text stringlengths 1.55k 332k | label int64 0 8 |
|---|---|
the present invention relates to the field of games , and in particular to games which simulate an activity , sport , or game in which recognizable characters participate . thus , in the illustrated embodiment , the toy figure 10 is representative of a pitcher in a baseball game , and may further represent a particular , identifiable pitcher by various indicia such as the style and coloration of the uniform worn by the figure , an identifying number and / or name on the uniform , and / or a name or other identifying indicia on the base 20 on which the figure is mounted , or even upon an associated card ( not shown ). a number of similarly constructed , though differently styled and / or posed figures may be provided to simulate the various members of a side or team that normally participate in the real life activity , sport or game . thus , in an example of a baseball game , an entire team of figures representing all nine of the defensive positions may be provided , along with corollary figures in the offensive batting position , as well as a tenth figure representing a designated hitter . it will be readily appreciated by those skilled in the art that similar sets of figures may be provided for other sports , and even fantasy war games . the basic rules of the game to be played may readily be based upon the rules of the actual game or sport , such as baseball . a game to be played using the toy figures of the present invention may also include a game board , a score sheet , and may also possibly include cards or tables providing for more advanced and complex play involving strategies and tactics pitting teams , and even individual players against each other . a game board or mat may reflect unique characteristics of a particular team &# 39 ; s home field or stadium , and may itself have provisions for a scorecard / scoreboard , and various statistics and probabilities . particularly where the toy figures are representative of a real life player , variations of the toy figure may be provided to reflect the player &# 39 ; s performance at different positions , such as , for example , a utility baseball player &# 39 ; s performance at different defensive positions or a football player &# 39 ; s performance in the player &# 39 ; s regular offensive or defensive position , as well as on a special team . each such character &# 39 ; s various skills , such as that of a baseball player &# 39 ; s probability of hitting singles , doubles , triples , homeruns , pop - ups , long fly balls , or striking out , may be used to determine play of the game . for example , a homerun slugger could have more homeruns and strikeouts sectors , and less singles and pop - ups sectors . variations of such a toy figure could also be provided to reflect the real life player &# 39 ; s change in skill levels at different times in the player &# 39 ; s career . referring now to the drawings in which like reference numerals are used for designating like parts throughout the several views , there is shown in fig1 a toy figure 10 having a base 20 according to the present invention . fig2 is an exploded view of the toy figure 10 according to the present invention . base 20 of toy figure 10 can comprise an upper shell 30 and a bottom wall or plate 40 , which is secured to the upper shell 30 by a friction fit , a suitable adhesive , or ultrasonic welding . a rotatable disk , dial , or spinner 60 is provided , in base 20 between upper shell 30 and bottom wall 40 . an upper pin 62 on the disk 60 is received in an upper socket ( not shown ) on the underside of upper shell 30 . in addition , a lower pin 63 on the disk 60 is received in a lower socket 42 in bottom wall 40 . pins 62 and 63 are substantially co - axial and serve as trunnions or stub axles . thus disk 60 is carried in base 20 for rotation or spinning about the axis of pins 62 and 63 . an upper decal 50 is affixed to the upper surface 64 of the disk 60 . fig3 shows an example of an upper decal 50 according to the present invention . upper decal 50 includes a center opening 52 so that upper pin 62 of disk 60 can connect to the upper socket of upper shell 30 . radial sectors 53 , of which there are nine in the example illustrated in fig3 , on upper decal 50 can be marked with various types of indices that may be determinative of the play of the game . in a game to be played with basic rules , there may only be a single ring of indices representing the possible outcomes that may result based on the particular character or player represented , the position of that character or player , and whether the character or player is represented to be on offense ( batting in a baseball game ) or on defense . alternatively , as illustrated in fig3 , there may be an inner ring of indices 54 , and an outer ring of indices 56 . each index of inner ring 54 of indices as shown in fig3 comprises a single number , while each index of outer ring 56 of indices as shown in fig3 comprises a combination of a single number and letter . however , an index of the outer ring 56 could comprise a single letter . fig4 shows an enlarged , partial , fragment of upper shell 30 of fig1 . the upper surface 33 of upper shell 30 is provided with a radially elongated viewing opening or window 34 through which the entirety of only one inner index from the inner ring of indices 54 and the entirety only one outer index from the outer ring of indices 56 appear . the outer peripheral wall 35 of upper shell 30 is provided with an access opening 36 through which the player &# 39 ; s finger or thumb ( not shown ) can spin disk 60 . a figure of a character 32 is mounted on upper surface 33 of upper shell 30 , as shown in fig1 - 2 . character 32 can be made in the image of the particular recognizable character or player that the toy figure 10 represents . the character may be pivotally mounted on base 20 , or it may be mounted in a fixed orientation , having a forward facing direction as illustrated . viewing opening or window 34 is oriented in the same forward facing direction of figure 32 , while access opening 36 is generally opposite . a tactile or textured surface 62 , such as a surface having a plurality of grooves , serrations , or knurling is provided on the outer peripheral wall or surface 61 of disk 60 . textured surface 62 facilitates a player &# 39 ; s finger or thumb more easily gripping the outer peripheral wall surface of disk 60 for spinning . on bottom plate 40 of base 20 , there is an upwardly biased pawl or detent 44 that cooperates with circumferential grooves 66 forming a face ratchet 68 on underside 65 of disk 60 , as shown in fig5 . as illustrated in fig2 , pawl 44 is formed as an integral part of base 20 , or more particularly bottom wall 40 , which is made of plastic . however , pawl 44 could be a separate component mounted on the upper , inside surface 43 of bottom wall 40 . as illustrated in fig2 , pawl 44 is formed in a cut - out portion 45 of bottom wall 40 , and has a thin , upwardly canted , inverted v - shaped leaf 46 . on the top of the free end of leaf 46 is a radial rib or projection 48 . pawl 44 provides a positive stop of disk 60 in one of a preselected number of radial positions in order to show the entirety of only one of sectors 53 containing an inner index from the inner ring of indices 54 and an outer index from the outer ring of indices 56 appearing in window opening 34 , to facilitate the elimination of “ liners ”. a series of circumferential grooves 66 are provided at predetermined locations on the underside 65 of disk 60 , and correspond in number to the number of sectors 53 . the bottom of one of each of grooves 66 aligns with the radial center of one of sectors 53 . as an alternative , ridges rather than grooves 66 may be used to comprise face ratchet 68 . rib or projection 48 of the pawl engages grooves 66 to bring disk 60 to a stop in a position such that the entirety of only one inner index from the inner ring of indices 54 and the entirety only one outer index from the outer ring of indices 56 appear in viewing opening or window 34 . a lower decal 70 can be affixed to the underside of bottom wall 40 . lower decal 70 can include additional information relating to a character or player such as a name , a position name , a position number , and a player cost . in a baseball game played using the present invention , each team could include a set of ten toy figures . each team could include a toy figure for each of the nine positions : pitcher ( 1 ), catcher ( 2 ), first baseman ( 3 ), second baseman ( 4 ), third baseman ( 5 ), shortstop ( 6 ), left fielder ( 7 ), center fielder ( 8 ), and right fielder ( 9 ). a toy figure for a designated hitter ( dh ) may also be included . each toy figure may have a player cost marked . the cost of the entire team may be required to equal , or be less than , some pre - selected amount . after the particular toy figures have been selected to fill a team , and the batting line - ups have been determined , the toy figures may be placed at their positions on a game board . the home team begins the game on defense , and therefore , the home team places the pitcher toy figure on the pitcher &# 39 ; s mound . in a very basic game the outcome of a pitch may simply be determined by the letters in outer index 56 , as for example : s for a single when the batter is moved to first base , and all of the runners that may be on base advance one base ; d for a double when the batter is moved to second base , and all of the runners that may be on base advance two bases ; t for a triple when the batter is moved to third base , and all of the runners that may be on base score ; h for a homerun when the batter and all of the runners that may be on base score ; k for a strike out when the batter spinner strikes out and none of the runners that may be on base advance ; w for a walk when the batter is moved to first base , and the runners that may be on base do not advance unless forced by the batter being moved to first ; f for a flyball out when the batter is out and the runners that may be on base do not advance ; p for a popup when the batter is out and the runners that may be on base do not advance ; and g for a ground out when the batter hits a ground ball ; the batter is out and the runners that may be on base do not advance if no runner is on first base . if a runner is on first base , then that runner on first base is out at second base and the batter is safe at first base on a fielder &# 39 ; s choice . normal baseball rules apply , and therefore , each team gets three outs per inning and the game lasts nine innings . in a more advanced game , the numbers forming part of the outer ring of indices may be taken into account to determine further variations of the outcome in combination with toy figures representing defensive players , or by some sort of chart or table . thus , for example , “ f9 ”, a fly out to the right fielder , may result in a runner on a base advancing , or even scoring from second base , depending on the skills of the right fielder . even more advanced games , with further variations , may be played employing the inner ring 54 of indices . thus , when a toy figure is used for the defensive player , such as a second baseman , and the batter hits a ground ball to the second baseman , a spin - off between the batter and the second baseman toy figures may be used to determine whether there is a double play or a runner on third scores . alternatively , such inner ring indices may be used with a chart or table to determine other results . even more possibilities and variations may result from color coding the indices . while particular embodiments of the invention have been shown and described , with some further suggested alternatives , further variations and modifications will occur to those skilled in the art . it is intended in the appended claims to cover all such variations and modifications that come within the true spirit and scope of the present invention . | 0 |
on fig1 is an architecture overview for the setup of a wireless telecommunications over bluetooth radio link . the fact that here bluetooth is shown is not restrictive . another protocol could have been used . in this example , the method to perform a wireless telecommunications according to the present invention is applied on a protocol between a mobile and a bluetooth audio gateway . it relies on spp defined in bluetooth standard 1 . 1 . the telecommunications is setup between one dual mode bluetooth / gsm mobile and one bluetooth audio gateway . more generally , a wireless telecommunications between two terminals ( on fig1 the mobile and the gateway ) is performed by using their respective serial port profile spp and a protocol for the transmission of said telecommunications based on at or hayes commands . said protocol will be also applied for the audio channel of said telecommunications . the terminal ( mobile phone on fig1 ) comprises at least a modem supporting a serial port profile , and a processor on which at or hayes commands can be performed to build a wireless telecommunications with another terminal ( gateway on fig1 ). latter can be connected to some enterprise network like a private branch exchange pbx or directly to some external network ( isdn , pstn , ip based one like a lan ). the gateway comprises at least a serial port profile , a modem and a processor on which at or hayes commands can be performed to build a wireless telecommunications with said terminal ( mobile ) while said gateway will take in charge at least some interface management of said terminal . typically , the gateway takes in charge inter - working with pbx or network as well as the mobile man machine interface at least when associated to a telecommunications . when mobile terminal is located inside bluetooth coverage area of an access point e . g . the gateway , access point makes setup of one bluetooth serial port profile with the mobile and takes control of mobile man machine interface . on fig2 is shown a diagram of the steps followed by the present method when an incoming call for the mobile is setup . when access point wants to page mobile , it sends a few at commands to notify the mobile of bluetooth incoming call with a ring and specific messages to display . during communication , dedicated action or notification are under control of access point . on fig2 is shown two situations for a telecommunications release . in case 1 , the release is initiated by the network on an event coming from the network . access point ( gateway ) asks to the mobile to release synchronous connection orientated sco channel . mobile translates this message on link manager layer . then , access point signals to mobile display , end of call . in case 2 , release is initiated by mobile using hang - up key . when mobile leaves bluetooth coverage , serial port profile is closed . on fig3 is shown a diagram of the steps followed by the present method when an outgoing call for the mobile is setup . when access point ( gateway ) wants to page mobile , it sends a few at commands to notify the mobile of bluetooth notification are under control of access point . on fig3 is shown two situations for telecommunications release . in case 1 , release is initiated by network on an event coming from network . access point asks to mobile to release sco channel . mobile translates this message on link manager layer . then , access point signals to mobile display , end of call . in case 2 , release is initiated by mobile using hang - up key . when mobile leaves bluetooth coverage , serial port profile is closed . some supplementary services can be advantageously offered using the present method . when mobile is located in the bluetooth coverage area of the gateway , the gateway or access point makes setup of one bluetooth serial port profile with the mobile and takes control of mobile man machine interface . gateway signals on mobile display that it can be managed by bluetooth infrastructure . when using man machine interface remote function over bluetooth , it is possible to manage supplementary services of pbx on mobile side . when no telecommunications is setup dial by name feature can be supported . when a telecommunications is active , conference or call transfer can be supported . since there is a lot of services that can be accessed or controlled by at or hayes commands , the present approach enables to benefit for them without to much modification . furthermore , it allows to control audio easily inside every at commands application or script . it gives a possibility to use gsm kind of mobile phone in a enterprise ( business ) environment managed by e . g . a pbx or a ipserver mapping a classical pbx . | 7 |
as required , detailed embodiments of the present invention are disclosed herein ; however , it is to be understood that the disclosed embodiments are merely exemplary of the invention , which may be embodied in various forms . therefore , specific structural and functional details disclosed herein are not to be interpreted as limiting , but merely as a basis for the claims and as a representative basis for teaching one skilled in the art to variously employ the present invention in virtually any appropriately detailed structure . the reference numeral 20 generally refers to a unitized electrode with three - dimensional capabilities for detection and control of brain state changes in accordance with the present invention , as shown in fig6 a through 6f . fig6 a and 6b show an enlarged top and side perspective view and an enlarged bottom and side perspective view , respectively , of an electrode 20 having a “ tack ”- like configuration with a disk portion 22 , a shaft portion 24 , and conductors 26 , such as electrically conducting wires or other suitable arrangement as appropriate for a particular application as hereinafter disclosed . the shaft portion 24 is secured to , or formed integrally with , the disk portion 22 and generally extends perpendicularly outwardly from the disk portion 22 , preferably from the center thereof . for some applications , however , it may be desirable that the shaft portion 24 be spaced off - center and / or at a selected angle relative to the disk portion 22 . the shaft portion 24 is generally inserted in a radial direction , i . e ., parallel to the orientation of apical dendrites or of the fibers ( axons ) entering or leaving the cortex at that site . in some applications , however , the shaft portion 24 may be inserted orthogonally or obliquely into the cortex . the direction of insertion is a function of the site selected for recording or control of brain state changes . this approach is favored over others , such as anchoring the device to the dura mater or to the skull , because it increases the area of recording surfaces and minimizes tearing of the cortex and dura that may result from differential displacement of these structures associated with head movements of certain force / acceleration and direction . the disk portion 22 has an upper surface 28 and a lower surface 30 . the shaft portion 24 has an outer surface 32 . as shown in fig6 a and 6b , the outer surface 32 of the shaft portion 24 has a single recording and / or stimulating contact surface 32 thereon connected in communication with conductor 26 . alternately , the shaft portion 24 may have a plurality of bands of recording and / or stimulating contact surfaces 36 separated by insulating material 38 , as indicated in fig6 d and 6f . in that event , each of the recording and / or stimulating surfaces 36 is independently connected to a different one of the conductors 26 . in addition , the lower surface 30 of the disk portion 22 may have a single recording and / or stimulating contact surface 40 connected in communication with a separate one of the conductors 26 . alternately , the disk portion 22 may have one or more concentric annularly - shaped bands of recording and / or stimulating contact surfaces 42 separated by insulating material 44 , as indicated in fig6 e . in that event , each of the recording and / or stimulating contact surfaces 42 is independently connected to a different one of the conductors 26 and independently of conductors 26 connected to the bands of recording and / or stimulating contact surfaces 36 on the outer surface 32 of shaft portion 24 . for some applications , it may be desirable to use one or more circularly - shaped recording and / or stimulating contact surfaces 46 separated by insulating material 48 in place of some or all of the previously described annularly - shaped bands of recording and / or stimulating contact surfaces 42 , as depicted in fig6 f . generally , the disk portion 22 has a diameter between approximately 1 – 25 mm and the shaft portion 24 has a diameter between approximately 0 . 1 – 1 . 0 mm ; it is to be understood , however , that the disk portion 22 and the shaft portion 24 may have other dimensions as necessary for a particular application . the length of the shaft portion 24 may have any desired length depending on the location as required for a particular application , as shown in fig6 c , wherein one of the electrodes 20 is inserted directly into brain tissue , designated by the numeral 50 , and another one of the electrodes 20 in inserted into a fold of the gyrus , designated by the numeral 52 . fig6 c illustrates how the electrode 20 can be inserted into the fold of the gyrus so that it can record from the unexposed surfaces , which project a negligible solid angle onto electrodes placed on the surface of the cortex . another advantage of electrode 20 is that the arrangement of the disk portion 22 and the shaft portion 24 relative to each other provide each other with the anchoring needed to maintain good contact and stable target acquisition , thereby improving signal - to - noise ratio , detection performance and efficacy of control measures . in other words , electrode 20 may be inserted into the exposed cortex or into the folds to record from both unexposed cortex and from the depths of the cortex . the insertion of the shaft portion 24 either directly into brain tissue or into a fold of the gyrus stabilizes the electrode 20 and prevents undesired lateral movement of the contact surfaces 40 on the lower surface 30 of the disk portion 22 relative to the exposed surface of the cortex which the contact surfaces 40 are bearing against . concurrently therewith , the abutting engagement between the lower surface 30 of the disk portion 22 stabilizes the electrode 20 and prevents undesired axial movement of the contact surfaces 36 of the shaft portion 24 relative to brain tissue . in other words and as one skilled in the art can determine from this disclosure , the presence of disk portion 22 provides supporting and anchoring capabilities to the shaft portion 24 and prevents undue movement of the shaft portion 24 to thereby avoid the consequent noise and contaminated signals as experienced with the use of prior art devices . similarly , the presence of the shaft portion 24 provides an anchor to the contact surfaces of the disk portion 22 to prevent movement artifacts . electrode 20 is sometimes referred to herein as a mesoelectrode because the diameter of the shaft is between the dimensions of the microelectrodes for single unit or intracellular recordings and the depth macro electrodes shown in fig2 . depending on the diameter of the shaft portion 24 , the present invention records activity ranging from minicolums which correspond approximately to 10 2 neurons which constitute a minicolumn ( for diameters of ˜ 0 . 1 mm ) to possibly up to 10 5 – 10 6 neurons which constitute a macrocolumn ; that is , the mesoelectrode of the present invention can simultaneously record activity from multiple spatial scales . those skilled in the art realize that the mesoelectrode electrode can have two or more shaft portions as required for a particular application . the mesoelectrode can be inserted , as shown in 6 a , into the exposed cortex or into the folds of the cortex to record from unexposed cortex and from its depths . this macroelectrode can be used for subcortical structures but not for cortical recordings . an electrode having a tip diameter of 10 − 3 cm and placed closed to the body of a neuron records activity contributed by approximately one hundred neurons . electrode 20 is constructed of biocompatible materials , such as polyurethane covered as appropriate with thin sheets or coatings of noble metals , such as platinum or other suitable material . the shaft portion 24 of the mesoelectrode 20 is configured to operatively accept a rigid mandrel to guide the electrode 20 into the brain tissue . the various contact surfaces are constructed of inert but conductive materials , such as platinum or platinum - iridium or other suitable material . if desired , contact surfaces of the disk portion 22 and shaft portion 24 may be “ printed ” or deposited onto the respective underlying surfaces using photolithographic techniques . in the case of the circularly - shaped contacts 46 shown in fig6 f , the diameter thereof generally ranges between approximately 1 – 5 mm and the contacts of the shaft portion 24 may be of any suitable length . insulating material between the various contact surfaces is constructed of biologically inert material , such as polyurethane or other suitable material , to prevent adjacent contacts from touching each other , which could otherwise create an undesirable “ shunt ”. conductors 26 , passing through the shaft and protruding from the upper surface 28 of the disk portion 22 , transfer signals from the various contact surfaces to amplifiers , usually for recording purposes , and are constructed of electrically conductive material , such as copper or other suitable material . electrical insulation is present about the conductors 26 throughout the shaft portion 24 and continues up to the juncture between the conductors 26 and the corresponding contact surface . conductors or wires 26 may also be used to convey control signals from control units ( or stimulation units ) to selected ones of the contact surfaces . each individual contact surface of the disk portion 22 and shaft portion 24 is connected to an electrically distinct conductor 26 allowing any contact surface to be independently available for stimulation either synchronously or asynchronously . for some applications , it may be desirable that communication to and from the electrode 20 be wireless , through micro - or nano - telemetric devices , housed in , or spaced in close proximity to , the electrode 20 . the presence of the contact surfaces of the disk portion 22 and the shaft portion 24 in three distinct axes provides three - dimensional information gathering capability for brain electrical activity ( bea ) and thus improves over the capabilities of the prior art devices for analysis of brain signals . the presence of multiple contacts on the shaft portion 24 and on the disk portion 22 improves the temporal and spatial resolution of cortical signals and also of the therapy delivered to the cortex , which translate into improved detection and control of brain state changes . the various contact surfaces that are connected to control units through conductors 26 not only allow usage of electrical stimulation strategy but also allow other therapeutic modalities such as cooling . those skilled in the pertinent art will appreciate that the mesoelectrode may be constructed using ceramic or silicon and thin - film techniques . a first modified embodiment of the unitized electrode with three - dimensional capabilities for detection and control of brain state changes , designated by the numeral 60 , is depicted in fig7 . the first modified embodiment 60 includes a hollow body mechanism 61 having one or more retractable electrode devices 62 with distal ends 63 that can be selectively pushed out into the cortex , wherein the body mechanism 61 is secured to a disk portion 64 similar to that hereinbefore described for electrode 20 . disk portion 64 provides supporting and stabilizing structure for the first modified embodiment 60 but can also have one or more recording and stimulating contact surfaces on a lower surface 65 thereof , as hereinbefore described . while the body mechanism 61 is being inserted into a fold of the gyrus , as indicated in fig7 , the distal ends 63 of the retractable electrode devices 62 are retained within the body mechanism 61 . once the body mechanism 61 is suitably placed inter - gyrally as desired , i . e ., in between two lateral walls of the brain , levers 66 can be operated by pairs of control leads or wires 67 to cause the distal ends 63 of the electrode devices 62 to the pushed into the brain tissue adjacent thereto . the levers 66 are mounted on an inner surface 68 of the body mechanism 61 . the control wires 67 can be operated manually , in which case pulling one of the pair of wires 67 extends the associated distal end 63 into the tissue and pulling the other one of the pair of wires 67 retracts the associated distal end 63 into the body mechanism 61 . it is to be understood that other precision control means , such as using stepper motors , dc motors or other suitable mechanisms may also be used for the purpose of extending and retracting the distal ends 63 into and from the adjacent brain tissue . if stepper motors are used , the control wires are attached to the stepper motor shaft so that rotating the motor in one direction ( for example , clockwise ) pushes the distal end into the brain tissue while rotating the motor in the opposite direction ( for example , counterclockwise ) retracts the distal end back into the shaft . it is to be understood that the stepper motors may be positioned outside the electrode structure . while any stepper motor can be used , use of one or more micro - stepper motors allows precise positioning of the distal ends 63 . for example , micro - stepper motors can be used to advance the distal ends 63 into the tissue in small steps for precise positioning thereof . either separate motors can be used to control each distal end 63 separately , or one motor can be used to simultaneously extend / retract some or all of the distal ends 63 as desired for a particular application . although only three electrode devices 62 are shown in fig7 , any number of the electrode devices 62 can be used to obtain as much spatial resolution as desired . the presence of several of the electrode devices 62 spaced around the body mechanism 61 provides three - dimensional information of the bea . the distal ends 63 of the electrode devices 62 are connected in communication with conductors 69 that can be used for recording the bea . it is to be understood that one or more contact surfaces 71 on an outer surface of the body mechanism 61 , as hereinbefore described , may be used in combination with the electrode devices 62 for a particular application as needed . a second modified embodiment 60 of the unitized electrode with three - dimensional capabilities for detection and control of brain state changes , designated by the numeral 75 , is shown in fig8 a and 8b , wherein channels 76 formed in a body mechanism 77 are utilized to slidably insert electrode wires 78 therethrough . the body mechanism 77 is constructed to insulate the electrode wires 78 from each other , such as by constructing the body mechanism 77 from insulating material , such as polyurethane or the like or lining the channels 76 with insulating material . an application of embodiment 75 can be described as follows : first the body mechanism 77 is inserted as desired into a fold of the gyrus . distal ends of the electrode wires 78 are slidably pushed through the channels 76 into the brain tissue as desired once the body mechanism 77 is in place . as hereinbefore described , it is to be understood that one or more contact surfaces 79 on an outer surface of the body mechanism 77 may be used in combination with the electrode wires 78 for a particular application as needed . a fragmentary and schematic illustration of a variation of the second modified embodiment 60 of the unitized electrode with three - dimensional capabilities for detection and control of brain state changes , designated by the numeral 85 , is shown in fig8 c , wherein a cannula 86 is slidably inserted through each channels 87 formed in body mechanism 88 and an electrode wire 89 is slidably inserted therethrough . an application of embodiment 85 can be described as follows : first the body mechanism 88 is inserted as desired into a fold of the gyrus . the cannula 86 is then pushed into the brain tissue as desired once the body mechanism 88 is in place . the cannula 86 is more rigid than the electrode wire 89 , thus enabling easier access and penetration into the brain tissue . after inserting the distal end of the cannula 86 a desired distance into the adjacent brain tissue , the more flexible ( less rigid ) electrode wire 89 is then guided and directed by the inserted cannula 86 as the electrode wire 89 is slidably extended through the cannula 86 , at least to the outer extremity of the distal end of the cannula 86 . without displacing the inserted electrode wire 89 , the cannula 86 is then retracted into the body mechanism 88 , thereby exposing the brain tissue to only the distal end of the electrode wire 89 . due to the elasticity of the brain tissue , the brain tissue closes around the distal end of the electrode wire 89 to form and maintain good communication contact therebetween after the cannula 86 is retracted . it is to be understood that the body mechanism 88 may contain several channels 87 , each having a cannula 86 and electrode wire 89 therein as described . also as hereinbefore described and illustrated , it is to be understood that one or more contact surfaces on an outer surface of the body mechanism 88 may be used in combination with the electrode wires 89 for a particular application as needed . fig8 c is an enlarged and schematic illustration of a first activating mechanism 90 , such as a stepper motor , being used to slidably displace the cannula 86 through the channel 87 and a second activating mechanism 91 being used , independently of the first activating mechanism 90 , to slidably displace the electrode wire 89 through the cannula 86 . a variation of the present invention is referred to herein as a “ hybrid ” as it consists of a macroelectrode having a diameter of approximately 1 . 1 – 2 mm with its own external recording surfaces , containing internally disposed mesoelectrodes having diameters of approximately 0 . 1 – 1 mm which can be deployed to increase dimensionality of recording from one - dimensional to up to three - dimensional . these hybrid electrodes are designed for detection and control of states of subcortical structures ( i . e , hippocampus ) offering great flexibility , wherein the mesoelectrodes will be deployed only if improved localization signal quality or control are needed . a third modified embodiment of the unitized electrode with three - dimensional capabilities for detection and control of brain state changes , designated by the numeral 92 is shown , in fig9 . the third modified embodiment 92 includes a plate portion 93 and a plurality of shaft portions 94 . as hereinbefore described , each shaft portion 94 may have a plurality of recording and / or stimulating electrode surfaces 95 separated by insulating material 96 , as indicated on only one of the shaft portions 94 for simplification of illustration . each of the recording and / or stimulating electrode surfaces 95 is independently connected to a different one of the conductors 97 . in addition , the lower surface 98 of the plate portion 93 may have a single recording and / or stimulating contact surface connected in communication with a separate one of the conductors 97 . application of the third modified embodiment is substantially similar to that indicated in fig6 c for electrode 50 . the multiple shaft portions 94 allow a further improved three - dimensional resolution of the bea . for some applications , it may be desirable that a plurality of the cannulae be slidably nested one within another to extend farther into the brain tissue . summarizing , those skilled in the art realize that : a ) the shape of the electrode component resting over the cortical surface 4 ( which in the preferred embodiment for a disk - type embodiment of the present invention ) may have any desired shape as appropriate for any particular application , such as rectangular , square , etc . moreover , the shape thereof may be tailored to conform to the top or exposed part of a gyrus over which it will be placed ; b ) the electrode may be constructed of materials with high thermal and electrical conductivity such as carbon nanotubes ; and c ) the shape , size and number of contact surfaces and number , diameter and lengths of the shafts may vary with the application for which it is being used . considerable improvements in temporo - spatial resolution , stability of target coverage and of signal acquisition , higher signal / noise ratio of brain signals , and multi - site recording and control capabilities at two or more spatial scales are provided by the present invention comprising a unitized electrode . through simple changes in design and variations in its length , the device of the present invention can be used for recording of : ( i ) intra - cortical activity only ; ( ii ) activity from exposed or non - exposed cortical surfaces only ; ( iii ) simultaneous recording of intracortical and epicortical ( surfaces ) activities from the same or different regions ; ( iv ) inter - gyral activity from non - exposed cortical walls only ; ( v ) inter - gyral and intracortical activities simultaneously ; ( vi ) trans - hemispheric activity from cortical surfaces , intra - cortical regions , white matter and sub - cortical hemispheric structures / nuclei , such as the thalamus , increasing its anatomo - functional range for detection and control of state changes . the multi - site and multi - modal ( electrical , thermal , chemical optical or other classes of signals ) recording and control capabilities / functions can be applied congruously wherein recording and control are performed through the same device or portion thereof , or incongruously wherein recording and control are carried out either through different portions of the same device or through different devices . furthermore , such unitized functions can be performed either synchronously in time , or asynchronously in time . also , detection of brain state changes may be accomplished using electrical or chemical signals and control may be exerted by , for example , cooling the region of interest . since the reciprocal projections between the cortex and deep nuclei , such as the thalamus , follow a radial pattern , the device of the present invention allows recording and control of signal / brain states along different levels of the same region / domain in a simultaneous or sequential fashion . application of additional devices allows similar degrees of flexibility and multiplicity of functions over different regions . the invention disclosed herein is more efficient and causes less trauma than prior art by requiring fewer electrodes and tissue penetrations and smaller holes , than the previously - required burr holes , for implantation . it is also more cost - effective in that it requires shorter surgical time compared to prior art approaches . the present invention may also be used for detection purposes as taught in u . s . pat . no . 5 , 995 , 868 issued nov . 30 , 1999 to ivan osorio et al . to summarize , by using the invention disclosed herein , recording / sensing or control of state changes can be performed integrally ( across all regions / domains sampled by one or more devices ) or differentially ( selected regions / domains sampled by one or more devices ). it is to be understood that while certain forms of the present invention have been illustrated and described herein , it is not to be limited to the specific forms or arrangement of parts described and shown . | 0 |
divided turbine housings in turbochargers are used to sustain , in the turbine , the pulse energy originating from low engine speed combustion in the cylinder head . the exhaust pulses are propagated along the exhaust manifold , and upon reaching the turbine the divided turbine housing further maintains the pulses to deliver pulsed flow , as against steady state flow , to the turbine wheel . this pulse energy is then converted to rotational energy by the turbine wheel . in an aerodynamic sense , the shape of the divider wall near the trailing edge ( 21 ) and the shape of the surface of the outer walls ( 22 , 23 ) of the volute form a nozzle to guide the exhaust flow into the turbine wheel ( 10 ). as a result of this aerodynamic need , the design of the divider wall , the function of which is to segregate the pulses in the separate volutes ( 111 ) and to support the trailing edge ( 21 ) surfaces , has historically been left in the hands of the aerodynamics designers . the inventors and set about to improve the durability of the divider wall by taking a different approach — by designing a divider wall from a thermodynamic vantage point . typically , as illustrated in fig4 , the divider wall is a generally parallel wall structure , terminating at one end in a curve defining the trailing edge ( 21 ) of the divider wall , and at the other end in a curve defined by a root radius ( 14 ) between the roof ( 13 ) of the volute and the potentially intersecting surface ( 19 ) of the divider wall ( 16 ). sometimes the outer surfaces ( 19 ) of the divider wall are designed parallel to each other ; and sometimes they are designed as straight lines of a “ v ” convergent in the direction of the trailing edge of the divider wall . generally , no matter the design of the divider wall , there will always exist both a mass difference and a thermodynamic mismatch between the divider wall and the outer walls of the volute . conventionally , the mass distribution in the divider wall is generally linear since both surfaces of the sides of the divider wall are linear . quantitatively , thermal energy is exponentially being passed to the exhaust gas , so the transient heat transfer from the divider wall is an exponential function , while the mass of the divider wall is a linear function . the inventors came to realize this mismatch , and set out to design a divider wall such that the mass of the divider wall and the transient heat transfer from the divider wall were more suitably matched . in a first embodiment of the invention , as depicted in fig5 , the surfaces ( 44 ) of the central part of the divider wall are designed as log 2 curves about the generally radial axis ( 26 ) of the divider wall ( 16 ). the log 2 curve is tangential to the root radius ( 14 ), which is at the intersection of the surface ( 44 ) of the inventive divider wall and the roof ( 13 ) of the volute . in the preferred case of the inventive divider wall , the log 2 curve also intersects the radial axis ( 26 ) of the divider wall at the intersection of the inside diameter bound ( 18 ) of the divider wall , and the axis ( 26 ) of the divider wall . in the preferred case , the shape of the trailing edge part ( 21 ) of the divider wall is defined within the definition of the shape of the surfaces of the sides ( 44 ) of the divider wall . in other cases , the trailing edge of the inventive divider wall may be designed as a parabola , a radius , or a spline plus a radius , in which case the inventive log 2 curve would be tangential to the definition of the trailing edge . the inner bound of the trailing edge would still be defined by the radius ( 18 ) from the central axis ( 1 ) of the turbocharger . the inventors studied several divider wall shapes based on different definitions of curves in the development of this invention . as depicted in fig6 , the prior art divider wall is defined by a parabolic trailing edge ( 49 ), which is tangential to a pair of surfaces ( 48 ) which are parallel to each other . the inventors studied divider walls with non - parallel side surfaces , i . e ., log 3 curves ( 46 ), log 4 curves ( 47 ) and the log 2 curves ( 45 ), all of which are depicted in fig6 , before discovering that a significant improvement in resistance to crack initiation and propagation in the divider wall could be ensured with divider walls having the shape of a log 2 curve . each of the alternatives depicted in fig6 have an inner bound , at the aforementioned radius ( 18 ), which radius is determined as a predetermined ratio of the turbine wheel diameter , and an outer bound , which is determined by the intersection of the particular definition of the curves ( 46 , 47 , or 48 ) of the divider wall ( 16 ) and the root radii ( 14 ) connecting said curves ( 46 , 47 , or 48 ) with the roof ( 13 ) of the volute . thus , the length / bounds of the outer surface ( 44 ) of the inventive divider wall are determined . because the exactness of the surfaces of the sides of the inventive divider wall ( 44 ) relative to a perfect shape is deteriorated by the manufacturing process , as a practical matter , a manufacturing bound of +/− 10 % in a generally axial displacement of the designed outer surface ( 44 ) of the divider wall is acceptable within the definition of the invention ( i . e ., plus 5 % of total wall thickness per side = 10 %; minus 5 % of total wall thickness per side also = 10 %). as depicted in fig7 , the widened displacement of the designed outer surface ( design thickness plus 5 % per side ) is depicted as the curve ( 54 ), and the narrowed displacement of the designed surface ( design thickness minus 5 % per side ) is depicted as the curve ( 55 ). the generally radial bound of the wider displaced surface ( 54 ) is defined as : the generally radial outer bound of the inventive surface is the intersection of the root radius ( 14 ) of the surface of the roof ( 13 ) of the volute , with the larger displacement of the designed outer surface ( 54 ). the generally radial inner bound of the inventive surface is the intersection of the larger displacement of the designed outer surface ( 54 ) and a line ( 56 ) representing 25 % of the generally axial length from the intersection of the root radius ( 14 ) with the larger displacement of the designed surface ( 54 ), and the intersection of the generally radial axis ( 26 ) of the divider wall with the defined above inner bound ( 18 ) of the trailing edge of the divider wall . the generally radial bound of the smaller displaced surface ( 55 ) is defined as such : the generally radial outer bound of the inventive surface is the intersection of the root radius ( 14 ) of the surface of the roof ( 13 ) of the volute with the smaller displacement of the designed outer surface ( 55 ). the generally radial inner bound of the inventive curve is the intersection of the smaller displacement of the designed outer surface ( 54 ) and a line ( 56 ) representing 25 % of the generally axial length from the intersection of the root radius ( 14 ) with the smaller displacement of the designed surface ( 55 ), and the intersection of the generally radial axis ( 26 ) of the divider wall with the defined above inner bound ( 18 ) of the trailing edge of the divider wall . a section of the annuli representing the aforementioned sectional bounds thus defined are depicted as the shaded areas in fig7 . | 5 |
although the disclosure hereof is detailed and exact to enable those skilled in the art to practice the invention , the physical embodiments herein disclosed merely exemplify the invention , which may be embodied in other specific structure . the scope of the invention is defined in the claims appended hereto . referring to fig1 and 2 , reference numeral 1 indicates a portion of a typical rotational molding machine . the rotational molding machine 1 has a top spider 3 and a bottom spider 5 . the spiders 3 and 5 support respective halves 6 and 6a of large molds . in fig1 two molds 6 , 6a are shown , but it will be understood that the invention is not limited to a particular size or type of rotational molding machine . in accordance with the present invention , and also looking at fig3 and 4 , a number of screws 11 with replaceable tips are used to releasably join the spiders 3 and 5 to each other . each screw with replaceable tip 11 is comprised of a master bolt 13 , a tip 15 , and a pin 17 . the master bolt 13 is made as a cylindrical shank 19 having a head 21 on one end thereof . the length of the master bolt shank 19 can vary to suit the spiders of different rotational molding machines 1 . preferably , the head 21 is a hex head . the other end 23 of the shank 19 has a bore 25 . a cross hole 27 is at an accurately located distance from the shank end 23 . the distance from the cross hole 27 to the shank end 23 is the same for all length shanks . the tip 15 has a first end with a pilot 29 of slightly smaller diameter than the diameter of the master bolt bore 25 . the pilot 29 terminates in a shoulder 31 . a cross hole 33 in the pilot has the same diameter as the cross hole 27 in the master bolt 13 . the tip cross hole 33 is located at the same distance from the shoulder 31 as the hole 27 is located from the master bolt end 23 . the tip is threaded at 34 between the shoulder and a guide 37 at the tip second end . the guide 37 is shown as being cylindrical in shape with a diameter less than the diameter of the threads 34 . however , it will be appreciated that the guide can have a tapered surface , if desired . the pin 17 is sized to fit snugly in the cross holes 27 and 23 . in the illustrated construction , the pin is shown as a cylindrical pin with a head 39 and a cotter pin 41 . however , a hair pin or ball - and - detent pin also are acceptable . as best shown in fig2 the screw 11 is used by choosing a master bolt 13 having the correct length shank 19 for the particular rotational molding machine 1 . the master bolt shank is passed through a clearance hole in the top spider 3 until the head 21 contacts the spider . the tip pilot 29 is inserted into the bore 25 of the master bolt 13 until the tip shoulder 31 abuts the master bolt end 23 . in that condition , the cross holes 27 and 33 are coplanar . rotation of the master bolt and tip relative to each other enables the cross holes to become axially aligned for inserting the pin 17 through them . the screw 11 is thus assembled , and it is captured in the top spider by the cooperation of the head 21 and pin 17 . with the screws 11 captured in the spider 3 , the screws are used on the rotational molding machine 1 in generally the same way as conventional screws . that is , the threads 34 are engagable with the threads of associated receivers 7 that are part of the bottom spider 5 . in the particular example of molding machine 1 shown , each receiver 7 is inside and is connected by a pin 43 to an associated short tube 45 . in turn , the tube 45 is welded to the bottom spider . at the beginning of a molding cycle , power wrenches , not illustrated , drive the screw heads 21 to fully engage the screws 11 with their respective receivers 7 in a manner that closes the molds 6 and 6a . at the end of the cycle , the power wrenches reverse the screws to completely disengage the threads 34 from the receivers . the spiders are separated , thereby separating the molds along the parting line 47 . the master bolt head 21 and the pin 17 cooperate to hold the screw from falling out of the top spider when the spiders are separated . after the workpieces have been removed from the molds , the spiders are brought together , and the screws are again driven into full engagement with their associated receivers . the guides 37 on the tips 15 facilitate initial entry of the tip threads back into the receivers . when the tip threads 34 of a screw with replaceable threads 11 become worn , the pin 17 is removed . the tip 15 is then immediately separable from the master bolt 13 and discarded . a new tip is then inserted into and pinned to the master bolt . it is thus not necessary to replace the entire screw 11 when the threads wear . similarly , when a tip thread 34 seizes to its receiver 7 , removing the pins 17 and 43 enables the tip 15 and receiver to be removed as a unit from the spiders 3 and 5 without requiring any flame cutting of the screw or other non - productive effort . a new tip and receiver can be installed quickly and with minimal interruption of production . in addition , the cost of the master bolt 13 is saved . in summary , the results and advantages of rotational molding equipment can now be more fully realized . the screw with replaceable threads 11 enables high production to be maintained from the equipment despite the severe service to which they are exposed . this desirable result comes from using the combined functions of the replaceable tip 15 and the pin 17 . the pin and master bolt head 21 cooperate to prevent the screw from falling out of a spider 3 during production . the tip is easily and quickly removable from the master bolt 13 when the tip is worn or seized to a spider receiver 7 merely by removing the pin from the cross holes 27 and 23 . a replacement tip is equally easily assembled to the master bolt by inserting the tip pilot 29 into the master bolt bore 25 until the tip shoulder 31 abuts the master bolt end 23 . aligning the cross holes enables reinsertion of the pin . it will also be recognized that in addition to the superior performance of the invention , its construction is such as to cost but little more than traditional screws . the great increase in productivity available to rotational molding equipment resulting from the screw with replaceable threads amply justifies its cost . thus , it is apparent that there has been provided , in accordance with the invention , a screw with replaceable threads that fully satisfies the aims and advantages set forth above . while the invention has been described in conjunction with specific embodiments thereof , it is evident that many alternatives , modifications , and variations will be apparent to those skilled in the art in light of the foregoing description . accordingly , it is intended to embrace all such alternatives , modifications , and variations of the invention as fall within the spirit and broad scope of the appended claims . | 8 |
referring to fig1 and 5 , an applied potential of approximately 3 volts at 4 milliamps is produced by a waveform generator a at 50 khz and applied through a voltage to current converter b and a multiplexer c in turn between every electrode combination and in each and every case the resultant potential between every adjacent pair of electrodes is fed through an amplifier d and a phase sensitive detector e and is recorded by a sample and hold unit f , from which the data is fed through a 12 - bit analogue to digital converter g to a computer h . the units a , e , f and g of the equipment are all controlled by a master clock j , which also controls the multiplexer through a unit k which stores the electrode combinations . the sixteen electrodes shown in fig1 give rise to 1456 potential measurements which can be recorded in 1 . 456 seconds or less . in order to demonstrate image reconstruction it is necessary to consider a specific configuration of electrodes on a specific object ( see fig1 ). the object chosen for illustration is a thin flat sheet of electrically resistive material enclosed by a circular boundary . connected to the boundary of this object are a number of equally spaced electrodes . for example , 16 electrodes may be attached to the boundary . let these electrodes be numbered from 1 to 16 . then current is passed between electodes 1 and 2 ( see fig1 ) and the voltages between electrodes 3 and 4 , 4 and 5 and so on up to 15 and 16 are measured by the apparatus . although ideally the voltages between the electrode pairs ( 16 , 1 ), ( 1 , 2 ) and ( 2 , 3 ) should also be measured their values are distorted by the presence of a voltage drop across these electrodes due to the electrode contact resistance . the other measurements e . g . between electrodes 3 and 4 can be made without taking any current through these electrodes and so this problem does not occur for these measurements , which is an important feature of this technique . once the measurements have been made for current passing between electrodes 1 and 2 , current is then directed to the apparatus to flow between electrodes 2 and 3 and a second set of measurements taken . this process is continued until finally current is passed between electrodes 16 and 1 . when this final set of measurements is complete a full set of 16 sets of measurements is available for reconstruction of an image of resistance distribution in the object . the distribution of voltage within an object through which electric current is flowing is determined by the equation ( eq 1 ). where ρ ( x , y , z ) is the distribution of log resistance in the object i . e . if the resistance at a point is ρ ( x , y , z ) then p = in ( ρ ) where ln is the natural logarithm function . this formula will give the value of voltage at the object boundary or surface of and the primary assumption behind resistance imaging is that if enough different independent current patterns are applied to the object and enough boundary measurements of voltage made the distribution of p can be determined . other methods of attempting to solve this problem require the accurate and repeated solution of the above equation for the object being probed . this , except for the most trivial examples , is a formidable task and effectively prevents the use of these techniques with currently available computing equipment . such a calculation would also need detailed information about the object boundary which would be difficult to obtain without extensive and elaborate additional instrumentation . in contrast the method presented here does not require explicit solution of the above equation either once or repeatedly in an iterative cycle and is able to produce ( and has produced ) in - vivo images of resistance distribution in times of no more than a few tens of seconds . the present method may in fact be formulated for a general three dimensional object . however because the reconstruction of the image does not require the solution of eq . 1 it has been shown experimentally that good images using data obtained from three dimensional objects may be obtained by applying an algorithm designed for a simple two dimensional configuration . the formulae given below refer to the idealized case of a two dimensional distribution of resistance enclosed by a circular boundary and with a pair of drive electrodes very close together , effectively forming a current dipole . fig1 represents such an idealized region with 16 electrodes placed at equal intervals around the boundary and with a current dipole at the origin 0 . in practice current would actually be passed between electrodes 1 and 2 in this example but the differences in the pattern of current flow between this latter configuration and the current dipole are negligible except close to the drive electrodes . in the example given above passing current between a pair of electrodes ( called hereafter the drive pair ) enables 16 measurements of voltage difference to be made around the boundary of the object . in practice only 13 measurements can be made because measurements involving one of the drive electrodes are unreliable because of contact resistance . the missing values can be interpolated from the available measurements . let this set of measurements be described by a vector v . if the current is being passed between electrodes i and i + 1 this vector will be called v i . let the natural logarithm of the resistance distribution within the region enclosed by the circular boundary be given by p ( x , y ) ( fig1 ). the algorithm being described here initially reconstructs an image of p ( x , y ) which may then be converted to an image of resistance ( x , y ) by the operation of exponentiation . consider current being passed by a current dipole at 0 . a vector of measurements v 1 is obtained . now suppose that the resistance in the region is set to some uniform value . again current is passed between electrodes 1 and 2 and this time a vector of measurements u 1 is obtained . a new vector p1 =( v 1 - u 1 )/ u 1 is formed and this is back - projected into the image space along the lines of constant potential . these lines are shown in fig1 and represent the lines of constant voltage in the medium when current is flowing through the medium . for the configuration shown in fig1 the lines of constant voltage are given by the points for which ## equ1 ## is constant where m is the strength of the current dipole . by back - projection the following is meant . consider an image point s at ( x , y ), initially with value zero . the equipotential passing through it when continued to the boundary intersects at a point q which is generally between two electrodes . the intersection point on the boundary ( see fig1 ) is given by ## equ2 ## the boundary value of p at this point is then assigned to the image point at x , y . this process is repeated for all image points inside the boundary . the resulting image is called a single back - projection of the vector p . a back projection image is produced for each of the data vectors p1 . x and y in the above equations are local coordinates relative to an origin at the current dipole . for 16 electrodes there would be 16 such back projection images . these are then added together in a weighted manner . consider the point x , y in fig1 . for each back projection the value of the back projection image at the point x , y is multiplied by the weighting term ## equ3 ## if uniform sensitivity to spaced objects is required or by ## equ4 ## if uniform sensitivity to a distributed change in resistance is required and the modified value restored to the image . when all 16 images have been modified in this way each image is converted to an absolute coordinate system by rotation about the centre of the image circle . for the ith image the angle of rotation is ( i - 1 ) 2π / 16 radians . they are then added together to produce an image representing the distribution of resistance in the object being imaged . the image produced in this way is still a blurred representation of the original object . if a very fine point - like object were being imaged the image would be a blurred representation of the object with a second central moment given by d . d must be measured experimentally . the amount of blurring is a function of the distance from the centre of the object . if the amount of blurring at the centre is given by d 0 then the amount of blurring at a distance r from the centre is ## equ5 ## in order to reduce this blurring as far as possible a filtering process is applied to the image . an image may be partially deblurred by subtracting the laplacean filtered image from the original image . if the image is f ( x , y ) then the deblurred image is given by from equation 5 it is seen that d is a function of the distance from the centre of the image . alternatively the image can be radially distorted to an image in which the value of the distorted image at a distance s from the centre of the image is given by the value at a distance r from the centre of the undistorted image where after this distortion the blurring is uniform across the image and the laplacian filter can be applied with d = d 0 . finally the distorted image is restored using the radial transform ## equ6 ## the formulae given above apply to the case of a two dimensional object enclosed within a circular boundary and with current applied by a current dipole . similar but more complex formulae exist for finitely spaced electrodes but for two dimensional objects of more general boundary shape no simple analytic forms exist , although values for the weights and equipotentials may be computed numerically . for three dimensional objects no simple closed analytic forms exist , even for most regular boundary shapes . however , useful images may be produced by assuming all problems are of the two dimensional form . provided that data is collectd using electrodes situated on the intersection of a plane through the object and the boundary of the object and that values of u i are known the vectors p may be back - projected using the formulae given above to produce images . it should also be appreciated that the u i may be obtained in practice by using a tank of conducting fluid with electrodes connected to the boundary of this tank and measuring the v i with the object immersed in the tank and the u i with the object removed and replaced by conducting fluid . finally if changes in resistance are all that is required measurements of v i measured before the changes occur may be substituted for the u i ; in this case the images represent changes in resistance , such as those associated with physiological changes in the body . in this case direct connection to the body can be made . fig1 also shows the isopotentials to be expected when current is applied between electrodes 8 and 16 adjacent the surface on a body l assumed to consist of one uniform medium . in fig5 the sixteen electrodes are to be considered as being equi - spaced around a human arm m at the cross - section shown in fig4 . the recorded potentials are compared by the computer h with the respective calculated potentials and the ratios are back projected along the appropriate isopotentially as described in detail above . thus twelve or thirteen back projections can be made for every pair of current drive electrodes ( a potential cannot be recorded from a current drive electrode ) and the modified isopotentials plotted . the plots of the modified impedance along isopotentials are superimposed on those obtained for each and every pair of drive electrodes , by means of the computer linked to a print - out n , to give a tomographic image i 1 as in fig2 and to a visual display unit ( vdu ) p , to give a visually displayed image i 2 as in fig3 . comparing fig2 and 4 it is possible to identify in the images i 1 and i 2 the radius and ulna bones r , s respectively , the radial and ulna arteries t , u respectively , and the median nerve v . with greater resolution of the images more constituent parts of the arm m could be identified . in addition to improving the resolution by iteration , the resolution can also be improved by increasing the number of electrodes to say 32 , but this will call for more elaborate computing equipment to handle the increased number of recordings and calculations . in fig6 a coil w electromagnetically induces a current in a body x and an inhomogeneity y causes surface potentials to be induced and which can be picked up by electrodes disposed as in fig1 and processed by modified equipment as in fig5 while in fig7 currents are induced by a plurality of coils z equi - spaced around the body x . in fig8 a linear array of electrodes is mounted in a block 0 1 , while in fig9 blocks 0 2 , 0 3 , 0 4 of contoured arrays of electrodes correspond to parts of the contour of a body . the method of the invention can also be applied to tomographic image construction from three - dimensional data , but this involves taking into account the spread of current out of the plane of the electrodes and either back projection has to be made over isopotential surfaces , or the three - dimensional data reduced to two - dimensional format , which -- again -- calls for more elaborate computing equipment . a slightly modified method for monitoring a change in the internal state of the body will now be described in detail . referring to fig1 and 11 , an array of sixteen ag / agcl electrodes equi - spaced round the abdomen of a human body is coupled to equipment substantially as described above and shown in fig5 . fig1 shows the assumed image of isopotentials to be expected when current is applied between electrodes 1 and 2 , with the body assumed to consist of one uniform medium and circular in cross - section . initial potentials between adjacent pairs of electrodes ( other than the pair between which the current is applied ) are measured in sequence over the array of electrodes , subsequent potentials between the same pairs of electrodes are measured in the same sequence after a change in the internal state of the body ( which in this case results from having a drink -- as indicated previously and as will be referred to again presently with reference to fig1 and 13 ), the subsequent potentials are compared by the computer h with the respective initial potentials , and the ratios are back projected along the appropriate isopotentials shown in fig1 , by increasing the impedance along an isopotential in proportion to a ratio greater than unity or decreasing the impedance in proportion to a ratio less than unity . thus thirteen back projections can be made for every pair of current drive electrodes ( a potential cannot be recorded from a current drive electrode ) and the modified impedances along the isopotentials plotted just as described above . the plots of the modified impedance along isopotentials are superimposed on those obtained for each and every pair of drive electrodes , by means of the computer linked to a print - out n , to give a back projected tomographic image of the type shown in fig1 , and to a visual display unit ( vdu ) p , to give a visually displayed back projected image ( not shown ). in fig1 the stomach is well outlined following the drink , which is taken before print - out ( b ). anterior is on the right and left is at the top of each image . as the changes disappear in the stomach they appear in the small intestine . by taking the maximum intensity of image in fig1 as 100 % it is possible to plot a graph x in fig1 showing gastric emptying , which compares with a corresponding graph y derived from gamma camera pictures of the same stomach during the emptying cycle ; but it must be borne in mind that in the latter case the subject or patient has to suffer the discomfort and risk of a radioactive meal in order for the gamma camera pictures to be taken . in fig1 the sixteen electrodes are disposed round the torso , and fig1 shows a resulting sequence of six print - outs at intervals of 1 second during inspiration after inhalation respectively of ( a ) 0 . 45 , ( b ) 1 . 0 , ( c ) 1 . 5 , ( d ) 2 . 0 , ( e ) 2 . 7 and ( f ) 4 . 2 liters of air . the lungs are clearly seen , with anterior at the bottom of each image . any defect in ventilation will show as a direction of the image of the lungs . | 0 |
the method according to the invention is based on the technical solutions of commonly used laser process devices and register control systems , which makes the invention easy to implement . the essence of the invention is that , on the basis of experience , even a laser which leaves hardly any or no marks on the base or carrier material of the web , plots a negative mark on a register mark made with printing ink . here , a negative mark means that the printing ink can be accurately and easily removed with the laser , even down to the surface of the base or carrier material of the web , whereby a mark is created which is easily detectable by computer vision . the register mark is preferably printed in such a way that there is a good contrast between the mark and the base or carrier material of the web , and when the negative mark made by the laser reveals a part of the base or carrier material of the web under the printed register mark , the negative mark will also have a good contrast . plotting a negative mark on a mark or surface made with printing ink is usually also a clearly visible and observable event , even if it is difficult or impossible to see and observe the impact of the laser beam on the surface of the base material . it has , in addition , been noted that the area covered by printing ink brings about a change in the reflection and / or penetration of the light from the laser beam compared to an area on which there is no printing ink . in the method according to the invention , at the printing process stage marks are printed with printing ink on the base or carrier material of the web , at the laser process stage a negative mark is made with the laser on this mark printed at the printing process stage , and during or after the laser process stage computer vision or other suitable sensor equipment is used to monitor the matching of the printed mark and the negative mark made on it with each other and the laser process stage is controlled on the basis of the information in such a way that the laser process stage is aligned with the printing process stage . the alignment can alternatively be monitored by measuring the change caused by the mark made with printing ink in the reflection or penetration of the laser beam , compared with areas with no printing ink on them . when the computer vision system or other suitable sensor equipment is located after the laser process stage , the size and shape of the negative mark can be selected quite freely . in the selection , it is advisable to aim at it being easy for the computer vision system or similar equipment to determine the mutual distances between marks , that is , the accuracy of alignment , precisely and rapidly . when the computer vision system or other suitable sensor equipment is located in the laser process stage , that is , the equipment is used to monitor the plotting of the negative mark with the laser , it is advisable to select the size and shape of the negative mark to be such that the web is able to move only a short distance while the laser plots the mark — a preferable negative mark is in this case often a spot which the laser makes with one or a few pulses , in which case the plotting of the mark can be positioned in one picture taken by the camera of the computer vision system or a similar sensor , even if short exposure is used . in this case , the determination of the alignment of the marks can be done rapidly , at best so rapidly that if the laser starts its working cycle by plotting a negative mark or marks , the alignment of the end of the working cycle can be corrected on the basis of this information . if no later process stage , quality assurance or other purpose requires clearly distinctive negative marks , a mark does not have to be plotted with the laser down to the base material , but it suffices that the impact of the laser beam on the mark or surface made with printing ink is detectable at the moment of occurrence . when the computer vision system or other suitable sensor equipment is included in the laser process stage , the equipment can also be used to scan a recently produced negative mark . in this case , it is advisable to select the size and shape of the negative mark to be such that it can be rapidly plotted by laser and read by the equipment . the plotting of the marks and determination of the alignment can be carried out rapidly , at best so rapidly that if the laser starts its working cycle by plotting a negative mark or marks , the alignment of the end of the same working cycle can be controlled on the basis of this information . in both of the solutions described above , a negative mark can easily be plotted also after correcting the alignment , whereby the success and accuracy of the correction of the alignment can be monitored . when the computer vision system or other suitable sensor equipment is included in the laser process stage , the monitoring and measurement of the alignment may also be based on the different way in which the laser light either reflects from the surfaces of the base material or the printed mark , or the different way in which the laser light penetrates the base material alone and the type of part of the base material on the surface of which is a printed mark . if the laser light penetrates the base material well , the alignment can be measured from the opposite side of the base material with respect to the laser , and in this case it is not a disadvantage if the base material reflects the laser light poorly . if the base material reflects the laser light poorly and it is desirable to measure the alignment on the laser &# 39 ; s side of the base material , the surface of the base material can be treated , for example by printing , to reflect the laser light better , and the printed marks reflecting in a different manner can be made in such a way that this treated surface of the base material surrounds the printed marks . it then suffices that the printed mark brings about a change in the reflection or penetration of the laser light compared to a plain or treated base material — the mark does not have to react to the laser light otherwise . thus , the essential difference of this alternative compared with those described above is that the laser does not leave on the web any marks relating to its register control , which may be a limitation from the point of view of further processing and / or quality assurance . one preferred embodiment is such that , at least at the moment of determining the alignment , the diameter of the laser beam is larger than printed mark , in which case the printed mark fits inside the laser light beam and the location of the printed mark with respect to the laser light beam can be determined easily and quickly . by adjusting the optics of the laser equipment , the diameter of the beam can often be increased , which is advantageous both in fitting the printed mark inside the beam and in decreasing the intensity of the laser to such low level that the printed mark will not be at least excessively damaged . the monitoring and measurement of the alignment is based on identifying with the laser &# 39 ; s light - sensitive computer vision system or other suitable sensor system the change caused by the printed mark in the laser beam in the reflection or penetration of the beam compared with an area which is not covered by printing ink . when applying this embodiment , the equipment must be included in the laser process stage and the measurement of the alignment may be very quick — it may be based , for example , on only one pulse shot by the laser . if the measurement of the pulse is carried out at the beginning of the working phase of the laser , at best the alignment at the end of the same work phase can be controlled on the basis of this information . the advantage of this embodiment is that the location of a stopped beam can also be measured from a single pulse , and much more accurate measurements can be made than the diameter at the moment of measurement . measuring merely the location of the printed mark by means of a laser beam larger than the mark requires that the laser beam is distinguishable from the base material . if this is not the case , a mark or an area larger than the laser beam can be used , in which is made a negative mark , for example an annular pattern , whereby the edge of the beam used for measurement hits the printed pattern and the negative mark made in the printed pattern , for example , a ring or an empty hole , acts as the reference . the negative mark may be either printed or it may have been plotted at an earlier laser process stage . it is obviously also possible , for example , to print a larger area outside the mark , which produces a suitable contrast for measurement . the monitoring and measurement of the alignment can also be carried out without an actual computer vision system by connecting a relatively simple light sensor to the laser equipment . this type of an arrangement can be carried out both in such a way that a negative mark is plotted on the printed mark , and in such a way that no negative mark is plotted on the printed mark . by means of the light sensor is identified either that the laser beam is plotting a negative mark on the printed mark , or that the laser beam hits the negative mark . both situations change the illumination compared to a situation where the laser beam meets the base material alone . the arrangement is , therefore , based on a moving laser beam crossing the border between the base material and the printed mark in so may places that the location of the mark can be identified . the laser equipment always knows the location of the beam with respect to its own coordinates , and on the basis of the information provided by the light sensor , the laser equipment is able to determine the location of the printed mark in its own coordinates and on the basis of that to monitor and measure the alignment of the laser process on the printed marks . the advantage of this arrangement is the simplicity and affordability of the light sensor compared to the computer vision system , and the fact that a direct view from the sensor to the laser beam is not necessarily required , its disadvantage being that measuring the alignment is based on the identification of the edges of the printed mark by means of a moving laser beam , due to which measurement is typically slower than with the arrangements described above . one preferred embodiment is such where the printed mark is , for example , circular or square and over it scanned with a laser beam a cross which is sufficiently larger than it , so large that each arm of the cross crosses the border between the base material and the printed mark . the size of the printed mark is selected to be such that the centre of the cross is always inside the mark . it may be advantageous for the accuracy of measurement of positioning that the laser plots each arm of the cross either outwards from the centre or to the centre from the outside , whereupon the beam crosses the border between the base material and printed mark always in the same direction , that is , either from the side of the mark to the side of the base material or vice versa . should it be desirable for the laser not to plot a negative mark , the power of the laser must be decreased considerably , because increasing the diameter of the beam is disadvantageous for measuring accuracy . if the laser is allowed to plot a negative mark on the printed mark , it is not necessary to change the power of the laser or the diameter of the beam and the negative mark produced can be utilised at later stages or , for example , in quality assurance . the position of a beam with a large diameter but sharp edges can also be measured in such a way that the beam is moved over a mark of approximately the size of the diameter of the beam , for example , over a line , whereby crossing the edges increases the amount of light penetrating the transparent web considerably . the beam can also be moved along the line at a small angle with respect to the centreline of the line , whereupon the beam moves slowly , perpendicularly to the line . in this way , the crossing of the edge by the beam can be measured on both sides of the line , the centreline of the line being between them . a special case of laser process register control is the internal register control of the laser equipment . for example , when the web is wide with respect to the working area of one laser scanner , the laser process stage can be carried out with laser equipment comprising several adjacent scanners , so that the width of the web can be covered . in such a case , it is often not possible or sensible to make printed marks in the base material to align each laser scanner independently , but to align the laser scanners with each other . thus , for example , only one scanner is aligned with register marks printed on the edge of the web , and by mutual alignment of the scanners is ensured that the alignment of the laser process is in order over the entire width of the web . two laser scanners can be aligned with each other by making a negative mark with both and determining their alignment with each other by means of a computer vision system or other suitable sensor equipment . when a wide web is covered with several laser scanners , their working areas typically intersect and then it is often advantageous to make the negative marks to be tracked in these intersecting areas . aligning two laser scanners with each other requires a surface on which the laser beam is able to plot a mark . this surface may be a printed , coated or otherwise treated surface on top of the base material , there being no great demands on the size , shape or accuracy of location of the area , as long as each scanner is able to plot its mark on it . when the product to be processed is a selectively laminated laminate , the layer of the laminate to be patterned , such as the conductive foil , can be used as the joint surface . the marks can then be made either in the part of the layer to be patterned remaining in the laminate or in the part to be removed from the laminate . when the marks are made in the part of the layer to be patterned remaining in the laminate , also the remaining part itself can be the mark — it may be a part remaining in the laminate in any case , a projection or other feature or a separate adhered area made for alignment . in connection with a selectively patterned laminate can also be used a printed , coated or otherwise treated area under the part of the patterned layer to be removed , because the laser can typically plot a mark also through the layer to be patterned . a preferred embodiment in connection with a selectively laminated laminate is one where mutually aligned scanners make their marks in an area in the part of the layer to be patterned removed from the laminate , where their working areas intersect . the limitation here is that the computer vision system or other suitable sensor equipment must be positioned before the removal of the part to be removed of the layer to be patterned . the advantages are that the marks can be positioned on top of one another , that no separate surface is required as a base for the marks , and that no marks of the alignment are typically left in the finished product . in general , it may be said that from the point of view of alignment monitoring and measurement , it is advantageous to select the marks to be tracked by a computer vision system or other suitable sensor equipment to be such that the location of their centre is easy and / or quick to determine even with an existing algorithm , and to position the marks with respect to one another in such a way that when the alignment is in place , their centres connect . the distance between the centres of the marks then equals the alignment error and the distance , therefore , does not have to be compared to any target value , which in the worst case changes in each case . therefore , a preferred embodiment for aligning laser processing is to print circular or square marks on the web and to aim at plotting a negative mark in the shape of a circle , spot or cross in the centre of each one with the laser , and a preferred embodiment for mutually aligning laser scanners is to plot circular marks with one scanner and to aim at plotting a mark in the shape of a different size circle , spot or cross in the centre of each one with another scanner . in the simplest case , register marks are printed on one edge of the base or carrier material of the web at the printing process stage , on which marks the laser then makes negative marks at the laser process stage . thus , by monitoring the mutual alignment of the marks and by controlling the laser process stage on the basis of it , the laser process stage can be aligned with the printing process stage in the longitudinal direction , or direction of travel , of the web and , if necessary , also transversely to the web even for the duration of a long production run . if marks are printed elsewhere on the web than only on one edge of the base or carrier material of the web , and on these marks are made negative marks with the laser at the laser process stage , the alignment of the laser process stage with the printing process stage can be monitored and controlled in a more versatile manner than by means of marks printed only on one edge . for example , if register marks are printed on both edges of the base or carrier material of the web at the printing process stage , and negative marks are made on these marks at the laser process stage , by monitoring the alignment of the marks with each other , the laser process can be controlled to match with the printing process stage , also taking into account the angle of printing and possible changes taking place in it with respect to the direction of travel of the web . similarly , by means of at least two or more marks , the scale of laser processing can be monitored and controlled , that is , care can be taken that the dimensions of laser processing remain correct with respect to the dimensions of printing even for the duration of a relatively long production run . in order to calibrate a dimensional change in the lateral direction of the web , at least two markings in the lateral direction are required , for example on both edges . the web is usually divided into several printed circuit boards in the lateral direction , which are finally cut off from each other . it usually suffices to align one coordinate point of each circuit to be detached in the lateral direction . a single circuit is usually so small that a scaling error will not grow too large within its area . in the process stages following the laser process stage , as register marks instead of a printed register mark can be used a negative mark made by the laser , or a combination of a printed mark and a negative mark made by the laser . there is often a need to align further processing specifically with laser processing exclusively or with emphasis on it , and thus negative marks or using a combination of a printed mark and a negative mark provide an advantageous opportunity for this . a printed mark may also be the adhesive pattern printed in the selective lamination described above , especially if a separate pattern is printed as a mark or the adhesive pattern extends beyond the conductive foil , in which case the mark remains visible and a negative mark can be made on it with the laser . a suitable area or surface for the laser can also be printed with other printing ink , whereby the negative mark made on it by the laser can be compared with a mark made at some other stage , for example , a mark printed with an adhesive . in this case , the other printing ink can be selected in such a way that a good contrast is acquired for both the adhesive and the laser mark . instead of printing can also be used other methods . for example , along the entire edge area of the base material can be made a strip for laser markings and the register marks can be printed in this area , but the laser marks can be made outside the printed register marks . this may be advantageous or necessary if the laser used does not plot properly on the printed marks . in that case , a pattern , for example a circle , can be plotted outside the printed mark , or on the printed mark can be left an empty area for plotting . the printed mark may be , for example , a line pattern , such as a circle , inside which is plotted another circle with the laser , the concentricity of which is measured with computer vision . the invention can also be applied to manufacturing processes in which the laser process stage is the first of the actual process stages . in that case , before the laser process stage , on the web are printed either register marks or other areas with printing ink , on which the laser can make a negative mark . the stages following the laser process stage can then be aligned with the negative marks made by the laser . with the laser can also be made several negative marks distinguishable from one another on the same surface , for example , circles or squares or their combinations with a cross . this can be utilised in aligning several laser process stages with one another and possibly with other process stages . it is also possible to make one mark before the correction based on register control and another after it , whereby the extent and success of the correction can be monitored . the invention can be applied irrespective of whether the process stages are on the same or different production lines . a preferred embodiment of the invention is described in the following , with reference to the accompanying drawings . fig1 shows a preferred embodiment of the method according to the invention with marks on only one edge of the web . fig2 shows a preferred embodiment of the method according to the invention with marks on both edges of the web . in fig1 , the web moves from left to right . when passing through the printing process stage 1 , on one edge of the base or carrier material 2 of the web are printed register marks 4 , and in the area to be processed typically also something is printed , such as the patterns 3 here . when the web passes through the laser process stage 5 , the laser makes a negative mark 7 on the printed register mark 4 at the same time as it changes the area to be processed in one way or another , which is shown as a change between patterns 3 and 6 . after the laser process stage follows the computer vision or other sensor system 8 by means of which the position of the negative mark 7 with respect to the printed register mark 4 is determined , and by means of this information the laser process stage 5 is controlled in such a way that the negative marks 7 remain with sufficient accuracy in the correct position , for example in the centre , with respect to the printed register marks 4 throughout the production run . in fig2 , the web moves from left to right . when passing through the printing process stage 1 , on the edges of the base or carrier material 2 of the web are printed register marks 4 and 9 , and in the area to be processed typically also something , such as the patterns 3 here . when the web passes through the laser process stage 5 , the laser makes negative marks 7 and 10 on the printed register marks 4 and 9 at the same time as it changes the area to be processed in one way or another , which is shown as a change between patterns 3 and 6 . the laser process stage is followed by the computer vision or other sensor systems 8 and 11 , by means of which is determined the position of the negative marks 7 and 10 with respect to the printed register marks 4 and 9 , and the laser process stage 5 is controlled with this information in such a way that the negative marks 7 and 10 remain with sufficient accuracy in the correct position with respect to the printed register marks 4 and 9 throughout the production run . by using two or more marks , it is possible to maintain the laser process stage both in the same position in the direction of travel of the web and at the same angle with respect to the direction of travel of the web as the print , and it is also possible to scale the laser processing in such a way that the distance between the negative marks remains the same as the distance between the printed marks . here , the register marks 4 and 9 are circles and the negative marks 7 and 10 are annular , but their shapes are unimportant as such . what is essential is that the marks function reliably with the computer vision or other sensor system . it is also possible to use , for example , successive parallel stripes , in which case for measuring their alignment can also be used a bar code scanner type of device , which measures the position of the bar plotted by the laser on the printed stripes in each stripe . the measurement of the position is also possible by means of pulse ratio measurement , in which case the width of the printed stripe is measured on both sides of the laser bar . by means of the bars can obviously only be measured one dimension at a time . between the printing process stage 1 and the laser process stage 5 may be other process stages such as lamination of the metal foil , in which case the patterns 3 are lamination adhesive , to which the metal foil covering the centre part of the web is attached at the lamination process stage , the foil being patterned at the laser process stage 5 at the same time as the laser is used to make the negative marks 7 and possibly also 10 on the register marks 4 and possibly also 9 . | 7 |
fig1 shows an exemplary process to automatically determine the summary sentences with distinguishing topics from document groups . the process uses comparative extractive document summarization ( cds ) to summarize the differences between comparable document groups . in one embodiment , given a collection of document groups , cds can generate a short summary showing the differences of these documents by extracting the most discriminative sentences in each document group . this is done by finding differences among document collections . in one implementation , the system finds solution to cds by sequentially selecting sentences from the documents by a greedy approach which minimizes the remaining uncertainty ( entropy ) of the documents after extracting sentences one by one based on the empirical distribution estimation . however , the empirical distribution faces data sparseness problem . in the preferred embodiment , the system performs discriminative sentence selection based on a multivariate normal generative model to extract sentences best describing the unique characteristics of each document group . as shown in fig1 , the process receives a plurality of input documents in 101 . using the input documents , the process produces comparative summaries of document groups by selecting predetermined sentences from original documents . in 102 , the process extracts sentences from the documents received in 101 . the documents are split into sentences . only those sentences suitable for summary are selected as the sentence candidates . next , in 103 , the process determines the similarity between the candidate sentences and the similarity between sentences and documents and generate a similarity matrix w . in 104 , the process selects the sentence following the procedure as detailed in fig2 . the selected sentences can efficiently render distinct the documents from different document groups . in 105 , the summaries are formed with sentences selected in 104 . thus , the process extracts sentences and determines distinguishing features for different document groups . the system directly analyzes sentence features by taking into account the sentence - document and sentence - sentence relationships and the most discriminative sentences are selected to minimize the average variance of the group prediction . the process then generates summaries as outputs in 106 . the comparative summaries are of high quality in term of the capability in comparing document groups . there are various applications of cds , for example , comparing different news groups , finding differences between communities in social network , among others . in brief , given a collection of document clusters , the process of fig1 decomposes the documents into sentences , and determines document - sentence and sentence - sentence similarities using cosine similarity , for example . since each document is labeled to indicate which cluster it belongs to , the process can select sentences one by one to minimize the average variance of all the cluster targets . one exemplary pseudo - code for the process of fig1 is as follows : turning now to fig2 , operation 104 of fig1 is shown in more detail . in 201 , the input of this process is a sentence - sentence similarity matrix w from 103 , and the document - sentence similarity matrix x from 103 , document - group indicator matrix y . in 202 , the process creates a matrix k as [ x , y ]′ [ x , y ]+ λ diag ( w , i ), where [ x , y ] is the matrix by concatenating x and y , [ x , y ]′ is its transposed matrix , diag ( w , i ) is the block diagonal matrix contains w and identity matrix i . parameter λ can be user specified . in 203 , the process selects a sentence i by maximize k ( i )′ k ( i )/ k ( i , i ), where k ( i ) is the i - th column of matrix k . k ( i , i ) is the element of k on i - th column and i - th row . in 204 , the process updates k as k - k ( i ) k ( i )′/ k ( i , i ). in 205 , the process repeats 203 and 204 until the required number of sentences is obtained . in 206 , the process returns the selected sentences as the output . fig3 shows an exemplary system for performing comparative document summarization . in 301 , the system includes a means for summarizing the content of documents by considering a discrimant criterion . in 302 , the system uses document - sentence similarity and sentence - sentence similarity to perform the summarization task . in 303 , one embodiment uses a discriminant criterion for sentence selection . the criterion measures the capability to predict the document group based on similarity between document and selected group summaries . in 304 , the system sequentially selects sentences to improve the criterion . in 305 , the system uses an efficient means to find the sentences to improve the criterion most . in one embodiment , in 306 , the criterion includes the similarity between sentences to avoid redundancy . the system produces comparative summaries of document groups by selecting sentences from original documents . the selected sentences can render efficiently distinct the documents from different document groups . the comparative summaries have higher quality in term of the capability in comparing document groups . the system can be used in a variety of application , for example , comparing different news groups , finding differences between communities in social network , among others . the system may be implemented in hardware , firmware or software , or a combination of the three . preferably the invention is implemented in a computer program executed on a programmable computer having a processor , a data storage system , volatile and non - volatile memory and / or storage elements , at least one input device and at least one output device . by way of example , fig4 shows a block diagram of a computer to support the system . the computer preferably includes a processor , random access memory ( ram ), a program memory ( preferably a writable read - only memory ( rom ) such as a flash rom ) and an input / output ( i / o ) controller coupled by a cpu bus . the computer may optionally include a hard drive controller which is coupled to a hard disk and cpu bus . hard disk may be used for storing application programs , such as the present invention , and data . alternatively , application programs may be stored in ram or rom . i / o controller is coupled by means of an i / o bus to an i / o interface . i / o interface receives and transmits data in analog or digital form over communication links such as a serial link , local area network , wireless link , and parallel link . optionally , a display , a keyboard and a pointing device ( mouse ) may also be connected to i / o bus . alternatively , separate connections ( separate buses ) may be used for i / o interface , display , keyboard and pointing device . programmable processing system may be preprogrammed or it may be programmed ( and reprogrammed ) by downloading a program from another source ( e . g ., a floppy disk , cd - rom , or another computer ). each computer program is tangibly stored in a machine - readable storage media or device ( e . g ., program memory or magnetic disk ) readable by a general or special purpose programmable computer , for configuring and controlling operation of a computer when the storage media or device is read by the computer to perform the procedures described herein . the inventive system may also be considered to be embodied in a computer - readable storage medium , configured with a computer program , where the storage medium so configured causes a computer to operate in a specific and predefined manner to perform the functions described herein . the invention has been described herein in considerable detail in order to comply with the patent statutes and to provide those skilled in the art with the information needed to apply the novel principles and to construct and use such specialized components as are required . however , it is to be understood that the invention can be carried out by specifically different equipment and devices , and that various modifications , both as to the equipment details and operating procedures , can be accomplished without departing from the scope of the invention itself . although specific embodiments of the present invention have been illustrated in the accompanying drawings and described in the foregoing detailed description , it will be understood that the invention is not limited to the particular embodiments described herein , but is capable of numerous rearrangements , modifications , and substitutions without departing from the scope of the invention . the following claims are intended to encompass all such modifications . | 6 |
embodiments of the presently disclosed dlu will now be described in detail with reference to the drawings , in which like reference numerals designate identical or corresponding elements in each of the several views . referring to fig1 , briefly , dlu 16 includes a tool assembly 17 , a proximal body portion 200 and a mounting assembly 202 . body portion 200 has a proximal end adapted to releasably engage the distal end of a surgical instrument 500 ( fig1 ) in the manner to be discussed in detail below . mounting assembly 202 is pivotally secured to a distal end of body portion 200 and is fixedly secured to a proximal end of tool assembly 17 . pivotal movement of mounting assembly 202 about an axis perpendicular to a longitudinal axis of body portion 200 effects articulation of tool assembly 17 between an orientation aligned with the longitudinal axis of body portion 200 and an orientation at an angle to the longitudinal axis of body portion 200 . referring also to fig2 - 4 , tool assembly 17 includes a cartridge assembly 18 and an anvil assembly 20 . anvil assembly 20 includes an anvil portion 28 having a plurality of staple deforming concavities 30 ( fig4 ) and a cover plate 32 secured to a top surface of anvil portion 28 . cover plate 32 and anvil portion 28 define a cavity 34 ( fig4 ) therebetween which is dimensioned to receive a distal end of a drive assembly 212 ( fig3 ). cover plate 32 encloses the distal end of drive assembly 212 to prevent pinching of tissue during actuation of dlu 16 . a longitudinal slot 38 extends through anvil portion 28 to facilitate passage of a retention flange 40 of drive assembly 212 . a camming surface 42 formed on anvil portion 28 is positioned to engage a pair of cam members 40 a supported on retention flange 40 of drive assembly 212 to effect approximation of the anvil and cartridge assemblies . a pair of pivot members 44 formed on anvil portion 28 are positioned within slots 46 formed in a cartridge assembly carrier 48 to guide anvil portion 28 between its spaced and approximated positions . a pair of stabilizing members 50 engage a respective shoulder 52 formed on carrier 48 to prevent anvil portion 28 from sliding axially in relation to staple cartridge 54 as camming surface 42 is pivoted about pivot members 44 . cartridge assembly 18 includes carrier 48 which defines an elongated support channel 56 which is dimensioned and configured to receive staple cartridge 54 . corresponding tabs 58 and slots 60 formed along staple cartridge 54 and elongated support channel 56 , respectively , function to retain staple cartridge 54 at a fixed location within support channel 56 . a pair of support struts 62 formed on staple cartridge 54 are positioned to rest on side walls of carrier 48 to further stabilize staple cartridge 54 within support channel 56 . staple cartridge 54 includes retention slots 64 ( fig2 ) for receiving a plurality of staples or fasteners 66 and pushers 68 . a plurality of laterally spaced apart longitudinal slots 70 extend through staple cartridge 54 to accommodate upstanding cam wedges 72 of an actuation sled 74 ( fig2 ). a central longitudinal slot 76 extends along substantially the length of staple cartridge 54 to facilitate passage of a knife blade 78 ( fig4 ). during operation of surgical stapler 10 , drive assembly 212 abuts actuation sled 74 and pushes actuation sled 74 through longitudinal slots 70 of staple cartridge 54 to advance cam wedges 72 into sequential contact with pushers 68 . pushers 68 translate vertically along cam wedges 72 within fastener retention slots 64 and urge fasteners 66 from retention slots 64 into staple deforming cavities 30 ( fig4 ) of anvil assembly 20 . referring to fig3 , mounting assembly 235 includes an upper mounting portion 236 and a lower mounting portion 238 . a centrally located pivot member 284 extends from each of upper and lower mounting portions 236 and 238 through respective openings 246 a formed in coupling members 246 . coupling members 246 each include an interlocking proximal portion 246 b configured to be received in grooves 290 formed in the proximal end of an inner housing which is formed from upper and lower housing halves 250 and 252 . coupling members 246 retain mounting assembly 235 and upper and lower housing halves 250 and 252 in a longitudinally fixed position in relation to each other . upper housing half 250 and lower housing half 252 are contained within an outer sleeve 251 of body portion 200 . body portion 251 includes a cutout 251 a dimensioned to receive a boss or projection 250 a formed on upper housing half 250 a . the positioning of projection 250 a within cutout 251 a prevents axial and rotational movement of upper and lower housing halves 250 and 252 within outer sleeve 251 of body portion 200 . in one embodiment , boss 250 a has a substantially rectangular configuration having a greater axial dimension than lateral dimension . the greater axial dimension provides increased surface area for preventing rotation of upper and lower housing halves 250 and 252 within sleeve 251 . a proximal portion 250 b of boss 250 a is ramped . ramped proximal portion 250 b allows sleeve 251 to be slid over boss 250 a as upper and lower housing halves 250 and 252 are positioned within sleeve 251 . it is envisioned that boss 250 a may assume other configurations , e . g ., circular , square , triangular , etc ., and still achieve its intended function . further , boss 250 a can be repositioned anywhere along upper housing half 250 or , in the alternative , be positioned on lower housing half 252 or partly on each housing half 250 and 252 . the proximal end or insertion tip 193 of upper housing half 250 includes engagement nubs 254 for releasably engaging the distal end of a surgical instrument in a bayonet type fashion . housing halves 250 and 252 define a channel 400 for slidably receiving axial drive assembly 212 therein . an articulation link 256 is dimensioned to be slidably positioned within a slot 402 formed between upper and lower housing halves 250 and 252 . a pair of h - block assemblies 255 are positioned adjacent the distal end of housing portion 200 and adjacent the distal end of axial drive assembly 212 to prevent outward buckling and bulging of drive assembly 212 during articulation and firing of surgical stapling apparatus 10 . each h - block assembly 255 includes a flexible body 255 a which includes a proximal end fixedly secured to body portion 200 and a distal end fixedly secured to mounting assembly 235 . a retention member 288 is supported on engagement section 270 of axial drive assembly 212 . retention member 288 includes a pair of fingers 288 a which are releasably positioned within slots or recesses 252 a formed in lower housing half 252 . in operation , when sulu 16 is attached to a surgical instrument and axial drive assembly 212 is actuated by applying a predetermined force to an actuation member 516 of the surgical instrument 500 ( fig1 ), axial drive assembly 212 is advanced distally to move drive assembly 212 and retention member 288 distally . as retention member 288 is advanced distally , fingers 288 a are forced from recesses 252 a to provide an audible and tactile indication that the surgical instrument has been actuated . retention member 288 is designed to prevent inadvertent partial actuation of dlu 16 , such as during shipping , by maintaining axial drive assembly 212 at a fixed position within dlu 16 until a predetermined axial force has been applied to axial drive assembly 212 . axial drive assembly 212 includes an elongated drive beam 266 including a distal working head 268 and a proximal engagement section 270 . in one embodiment , drive beam 266 is constructed from multiple stacked sheets of material . engagement section 270 includes a pair of resilient engagement fingers 270 a and 270 b which mountingly engage a pair of corresponding retention slots formed in drive member 272 . drive member 272 includes a proximal porthole 274 configured to receive distal end of a control rod 520 ( fig1 ) of a surgical instrument when the proximal end of dlu 16 is engaged with the body portion 412 of a surgical instrument 500 . referring also to fig5 - 10 , dlu 16 further includes a locking mechanism including a locking member 300 and a locking member actuator 302 . locking member 300 ( fig6 ) is rotatably supported within a longitudinal or axial slot 310 ( fig7 ) formed in a proximal portion of upper housing half 250 of body portion 200 of dlu 16 . locking member 300 is movable from a first position ( fig7 and 8 ), in which locking member 300 maintains drive assembly 212 in a prefired position , to a second position ( fig9 and 10 ), in which drive assembly 212 is free to move axially . as illustrated in fig6 , locking member 300 includes semi - cylindrical body 312 which is slidably positioned within transverse slot 310 formed in upper housing half 250 of body portion 200 . body 312 includes a radially inwardly extending cam member 314 and a radially inwardly extending finger 316 . finger 316 is dimensioned to be slidably received within a notch or slot 270 c ( fig3 ) formed in drive assembly 212 . engagement of finger 316 in notch 270 c of drive assembly 212 prevents drive assembly 212 from moving linearly within body portion 200 and , thus , prevents actuation of dlu 16 . referring to fig3 and 7 , a locking member actuator 302 is slidably positioned within a axial slot 320 ( fig7 ) formed in upper housing half 250 of body portion 200 of dlu 16 . actuator 302 includes a proximal abutment member 322 , a distal spring guide 324 , and a central cam slot 326 . axial slot 320 intersects transverse slot 310 such that cam member 314 of locking member 300 is slidably positioned within cam slot 326 of locking member actuator 302 . a biasing member or spring 328 ( fig7 ) is positioned about spring guide 324 between a distal surface 330 of actuator 302 and a wall 332 ( fig7 ) defining the distal end of axial slot 320 . spring 328 urges actuator 302 to its retracted position within axial slot 320 . in its retracted position , abutment member 322 is positioned on and extends radially outwardly of the proximal end of dlu 16 adjacent insertion tip 193 of proximal body portion 200 and cam slot 326 is positioned to locate cam member 314 such that finger 316 of lock member 300 is positioned within notch 270 c of drive assembly 212 . fig1 - 16 illustrate dlu 16 and surgical instrument 500 prior to and during attachment of dlu 16 to surgical instrument 500 . referring to fig1 - 13 , surgical instrument 500 includes a handle portion 510 and body portion 512 . handle portion 510 includes a stationary handle 514 and a movable handle 516 . movable handle 516 is movable in relation to stationary handle 514 to advance a control rod 520 which projects from a distal end of body portion 512 . surgical instrument 500 may be the stapling instrument disclosed in u . s . pat . no . 6 , 330 , 965 which is incorporated herein in its entirety by reference . prior to attachment of dlu 16 onto surgical instrument 500 , spring 328 urges actuator 302 to its retracted position to move lock member 300 to its locked position as discussed above . when insertion tip 193 dlu 16 is linearly inserted into the open end 522 ( fig1 ) of the body portion 512 ( fig1 ) of a surgical instrument 500 , nubs 254 move linearly through slots ( not shown ) formed in open end 522 of body portion 512 . as nubs 254 pass through the slots , the proximal end 322 a of abutment member 322 , which is angularly offset from nubs 254 , abuts a wall 276 c defining the slots for receiving nubs 254 . as dlu 16 is moved further into body portion 512 , locking member actuator 302 is moved from its retracted position to its advanced position in the direction indicated by arrow “ t ” in fig1 . as actuator 302 is moved to its advanced position , lock member 300 is cammed in the direction indicated by arrow “ u ” in fig1 from its locked position ( fig8 ) engaged with drive assembly 212 to its unlocked position ( fig1 ) to move finger 316 from notch 270 c . the locking mechanism including locking member 300 and locking member actuator 302 prevents accidental or inadvertent advancement or manipulation of the drive member of dlu 16 such as during loading of dlu 16 onto a surgical instrument 500 . when dlu 16 has been moved linearly in relation to instrument 500 to a position wherein a proximal surface 530 of body portion 200 abuts inner surface 276 c of body portion 512 ( fig1 ), dlu 16 can be rotated in relation to body portion 512 in a bayonet type action to position nubs 254 within openings 536 of body portion 512 to lock dlu 16 onto body portion 512 . it is envisioned that other coupling types besides bayonet couplings may be used to connect dlu 16 to instrument 500 , e . g ., spring detent or snap - fit couplings , friction fit couplings , interlocking members , threaded couplings etc . it will be understood that various modifications may be made to the embodiments disclosed herein . for example , the above - described lock assembly may be incorporated into a variety of surgical instruments which include dlu &# 39 ; s and is not limited to use on linear staplers . further , the dlu may be configured to receive an insertion tip of surgical instrument in contrast to that disclosed . therefore , the above description should not be construed as limiting , but merely as exemplifications of preferred embodiments . those skilled in the art will envision other modifications within the scope and spirit of the claims appended hereto . | 0 |
[ 0027 ] fig1 is a schematic illustration of the drivetrain of a motor vehicle , which has an internal combustion engine 1 , a starter 2 , a clutch 3 , a transmission 4 , and wheel axle 5 . the starter 2 is of a modern type , which can accelerate the internal combustion engine 1 from a standstill to the idling speed ( typically 800 rpm ) within several hundred milliseconds . alternatively , starter 2 is a starter / generator ( sg ). the starter can carry out a stop / start function . here , internal combustion engine 1 is switched off when the vehicle is at a standstill , for example in front of a traffic light . when the vehicle is restarted , the engine can then be started again virtually without delay using starter 2 . the switching off of internal combustion engine 1 , by the stop / start function , is generally controlled on the basis of the measured vehicle velocity , v , and an activation of the brake . if the vehicle velocity , v , is ( virtually ) zero and the brake is activated , internal combustion engine 1 is switched off after a brief idling time of typically 3 s . furthermore , other variables can also influence the stop / start function . for example a sufficiently high operating temperature of the internal combustion engine 1 can thus be used as a precondition for the internal combustion engine 1 being automatically switched off . a disadvantage with the known stop / start functions however is that they can switch off the internal combustion engine 1 in stop - and - go situations , for example in heavy , slow moving traffic or during a parking . in addition , fig1 illustrates two typical configurations 7 and 8 for the selection positions of the gear shift lever of an automatic transmission , the first configuration 7 having the positions p ( parking ), r ( reverse ), n ( neutral ), d ( drive ) and l ( relatively low gears ), and the second configuration 8 has the positions , d , r , n and m ( manual ). [ 0030 ] fig2 illustrates a first scheme for implementing a stop / start function , which is modified according to the invention and avoids the abovementioned disadvantages in stop - and - go situations . while the internal combustion engine is operating normally , the engine controller is in state a (“ run ”) in which the stop / start function is active (“ s / s on ”). under the stop / start function , a change from state a to state b occurs when a corresponding stop condition , stop_cond , is fulfilled . for example , vehicle velocity nearly zero and the brake activated constitutes a stop condition . in such an indication of a standstill of the vehicle , state b (“ stop ”) is assumed and the engine is switched off . monitoring of the pedals continues when the stop / start function (“ s / s on ”). control is passed back to a if a corresponding condition start_cond is fulfilled , for example if the brake is released or the accelerator pedal is activated . in the method described above , which corresponds to the prior art , the engine may be switched off for intervals , which are less than 20 seconds long , which is undesirable . to avoid this problem in the prior art , a stop - and - go state a ′ is introduced according to the present invention , in which the switching off of the engine is suppressed (“ s / s off ”). control is passed to stop - and - go state from the normal state a when a condition ss_disable is fulfilled . this occurs , for example , when the brake is activated , released and reactivated within intervals of less than 3 seconds and the vehicle velocity is less than 5 km / h . such driving behavior indicates a stop - and - go situation in which it would be inefficient to switch off the engine . control returns to normal state a from state a ′ when condition ss_enable1 is fulfilled . this condition is , for example , a vehicle velocity greater than 5 km / h and an activated accelerator pedal . alternatively , ss_enable1 occurs when a predefined relatively long time interval has passed since the state a ′ was entered . continuing to refer to fig2 stop - and - go state a ′ can jump to switch - off state b when ss_enable2 is fulfilled . this condition is , for example , when the aforesaid relatively long time interval has passed since the start of the state a ′ and the brake is activated at the end of this time interval . the conditions for the transitions in fig2 are summarized in table form below : [ t1 ] variable . . . . . . is true if stop_cond ν = 0 and brake activated start_cond brake released or accelerator pedal activated ss_disable brake is released and re - activated within 5 sec and ν & lt ;= 5 km / h ss_enable1 ( ν & gt ; 5 km / h and accelerator pedal activated ) or waiting time terminated ss_enable2 brake activated and waiting time terminated the parameters of the vehicle velocity v given in the table and the time periods are only to be understood by way of example and can be used or optimized in different ways depending on requirements . in addition , the stop - and - go state a ′ can also alternatively , or according to an additional criterion , be a function of the vehicle position . here , it is possible , for example , for a global positioning system ( gps ) to detect the position of the vehicle and initiate a transition into the state a ′ if the vehicle is in a region with stop - and - go traffic . the and and or herein , including the claims , refer to boolean and and or operations . [ 0037 ] fig3 shows a second alternative control scheme which is used in conjunction with an automatic transmission 7 according to fig1 . it is a characteristic of this scheme that the position of the gearshift lever is evaluated to detect a possible stop - and - go situation and the stop / start function is deactivated in response . the significance of the states a , b and a ′ is the same as in fig2 . however , in contrast to fig2 an additional state b ′ (“ stop ”) is present in which the motor has been switched off by the stop / start function , and at the same time the stop / start function is deactivated (“ s / s off ”). control is passed to state b ′ from state b when the condition ss - disable2 is fulfilled . state b ′ is exited when the ignition key is activated (“ key - on ”). after such activation of the ignition key , the engine controller ( 6 ) continues in state a ′. the conditions for the transitions in fig3 are summarized in table form below : [ t2 ] variable . . . . . . is true if stop_cond ν = 0 and brake activated start_cond brake released or accelerator pedal activated or gearshift lever in position r or l ss_disable1 gearshift lever in position r or l ss_disable2 gearshift lever in position p ss_enable gearshift lever in position d or n the conditions for stop_cond or start_cond which are given in the table and the parameters of the vehicle velocity , v , and the time periods are to be understood only by way of example and can be used and optimized in different ways depending on requirements . [ 0041 ] fig4 shows a third alternative regulating scheme which is used in conjunction with an automatic transmission 8 according to fig1 . in this scheme , the position of the gearshift lever is evaluated to detect a possible stop - and - go situation and deactivate the stop / start function in response , i . e ., state a ′, as also shown in fig2 and 3 and described in regards to fig2 and 3 . the significance of the states a , a ′ and key_on is the same as in fig2 and 3 . however , in contrast to the preceding figures , the state with the engine switched off by the stop / start function (“ stop ”) is divided up into two stages b 1 and b 2 , depending on whether the gear shift lever is in the position m ( b 1 ) or not ( b 2 ). from the last mentioned state b 2 , it is possible to jump to state a ′ ( engine on , stop / start function off ) when condition start - cond3 is fulfilled . the conditions for the transitions in fig4 are summarized below in table form : [ t3 ] variable . . . . . . is true if stop_cond1 ν = 0 and brake activated and gearshift lever in position m ( not r ) stop_cond2 ν = 0 and brake activated and gearshift lever not in position m or r start_cond1 brake released or accelerator pedal activated start_cond2 ( brake released or accelerator pedal activated ) and gearshift lever not in position m or r start_cond3 gearshift lever in position m or r ss_disable gearshift lever in position r ss_enable gearshift lever in position d or n or m and ν & gt ; threshold value , for example 5 km / h the conditions and parameters given in the table are again only to be understood by way of example and can be used and optimized in different ways depending on requirements . accordingly , it is characteristic for the method according to fig4 that the stop / start function is switched off ( state a ′) when reverse gear , r ; is engaged when the engine is running or switched off , or m gear is engaged when the engine is switched off . | 1 |
the full cycle of cardiac activity is represented by a wave known as the pqrst wave , defined by einthoven , arch . ges phys . 150 : 275 , 1913 , reprinted in am . heart j . 40 : 163 , 1950 , translation by h . e . huff and p . sekelj . this wave represents full contraction and relaxation of the heart . an example of a pqrst wave is shown in fig5 . one complete heart cycle averages { fraction ( 1 / 72 )} seconds . a flow chart illustrating the overall process of synthesizing and using the universal transformation matrix of the invention is depicted in fig1 . the first step , shown in block 101 , is to acquire a sequence of digitized voltage - time data for one complete cycle for leads i , ii , and v2 . multiple data sets can be acquired , and each set typically contains upward to 300 measurements . from the known geometry of leads i and ii , lead avf can be calculated in block 102 . the formula for generating lead avf from leads i and ii is shown at step 202 of fig2 . alternatively , a sequence of digitized voltage - time data for leads i , avf and v2 can be measured directly , as indicated in block 103 . leads i , avf and v2 are members of the set of leads that make up the standard 12 - lead ecg and are very well known to clinical staff . the sequence of digitized voltage - time measurements forms a matrix [ v ], which is a 3 × m matrix , where m is the number of measurements in time , as indicated in block 104 . typically , 300 sequential time measurements are taken . the placement of leads i , avf , and v2 on a human body is schematically illustrated in the three views depicted in fig9 . these views are , respectively , a sagittal view , a frontal view , and a transverse view . this lead set was chosen for the following reasons . as stated , these leads are well known to clinicians , nurses and ecg technicians . there is no need to place these leads on places that are unconventional , thus there is no need to research , develop and validate a new , unconventional lead configuration . in addition , these leads are approximately orthogonal . any of the other 22 leads discussed above can be derived from the lead set of i , avf , and v2 . fig1 depicts transverse planar view of the placement of the 13 v - leads ( v1 - v9 , v3r - v6r ) and the 3 frank ( x , y , z ) leads ( labeled as i , e , and m , respectively , in the drawing figure ) of the 22 - lead set that can be predicted from the measured lead set . a frontal view of the lead placements of fig1 is shown in fig1 , which also depicts placements for leads ra , la , rl , and ll . a total of 21 electrodes must be placed to capture the voltage - time data for 22 leads . the system of the present invention requires the placement of only 4 or 5 electrodes ( depending on the design of the grounding electrode ) to capture 3 leads from which the other 19 leads are derived . this has the advantages of cost savings , speed , minimizing errors from lead placement variability , and efficiency , particularly when sequential tracings are needed . abstract factor analysis (“ afa ”) is applied to the entire n - lead ecg measured data matrix in this invention to “ pre - treat ” the training set of ecgs , from which the transformation matrix is derived via simplex optimization , so as to minimize the inherent error in this training set . this is schematically illustrated in fig2 . the advantage of afa is that this technique minimizes predictable error , such as a wandering baseline , baseline noise , and lead placement errors , from a data set , yielded an improved , measured , data set . a comparison of ecg values for lead i as measured and as predicted through afa is shown in fig3 , showing close agreement . for the purpose of afa , the ecg can be represented in an n - dimensional system by a linear sum of product terms . the standard 12 - lead ecg is a system where n = 12 . at a particular time t , the 12 - lead ecg can be represented as v ( t )= v 1 ( t ) l 1 + v 2 ( t ) l 2 + . . . + v n ( t ) l n , where v is a 12 - dimensional vector , v m is the potential at the m th lead , l m is a unit vector in the 12 - dimensional space , and t is time . the potential v ( t ) can also be represented by a set of orthogonal basis vectors { x } that spans the space : v ( t )= σ n m = 1 k m ( t ) x m . abstract factor analysis identifies n , the number of factors influencing the data set , k , the transformation coefficient matrix , and x , the abstract lead - vector set . to perform afa , we consider an n × m data matrix [ v ] of voltage - time measurements , where n is the number of leads , as indicated in block 105 of fig1 , and m is the number of data points . in afa , a covariance matrix is diagonalized to yield a set of eigenvalues λ j that can be ordered by magnitude . the covariance matrix can be defined as [ z ]=[ v ] t [ v ], which is an m × m matrix with up to m eigenvalues , or it can be defined as [ z ]=[ v ][ v ] t , n × n matrix with up to n eigenvalues . each eigenvalue λ j corresponds to an orthogonal basis eigenvector x j . the diagonalization procedure involves finding a matrix [ q j ] that diagonalizes [ z ]: [ z ][ q j ]= λ j [ q j ]. in the context of ecgs , m is typically 300 measurements over one complete cycle . multiple training sets of the n × m matrix are subjected to the afa technique . from the application of afa to the data set we find that 3 leads can account for almost all of the information content in an n - lead ecg , where n = 12 to 22 leads . this can be demonstrated by means of the cumulative percentage variance . the variance can be defined as : where n = 12 . . . 22 and λ j is the magnitude of the j th eigenvalue . the cumulative percentage variance is defined as cum % var = σ c k = 1 λ k / σ n k = 1 λ k , where c = c th eigenvalue in the sequence of eigenvalues λ j ordered by magnitude . the cumulative percentage variance is thus a measure of the information content of the system . fig4 is a graph of the cumulative percentage variance as a function of λ j and illustrates that most of the information content of the system is contained in the first 3 eigenvalues . in fact , afa demonstrates that 3 leads can account for approximately 99 % of the information content of a 12 - lead ecg . thus , for a 12 - lead system , the resulting transformation matrix [ k ] is a 3 × 12 matrix , indicated in block 106 of fig1 . given a set of m voltage - time measurements for 3 leads , the full 12 lead set of measurements can be calculated by multiplying the transformation matrix [ k ] by the 3 × m voltage - time data matrix for the 3 measured leads . this result can easily be generalized to a system with an arbitrary number of leads , hence our n - lead ecg terminology . the reduction of dimensionality of the factor space of the ecg should not be surprising since the standard 12 - lead ecg already has built in redundancy . for example , the measurement of any 2 of the first 6 leads can be used to calculate the other 4 leads according to the following geometrically based formulae : the standard 12 lead ecg utilizes 12 pqrst configurations in a format from which the physician makes a diagnosis based on recognizing patterns in the plotted wave forms , as shown in fig6 . the ecg in fig6 is the usual and customary 12 - lead ecg and is a 12 - dimensional representation of 12 voltage - time signals . as stated above , the inventor has verified through the application of afa that ˜ 99 % of the information displayed thereon can be reproduced from the measurement of just 3 leads . since these leads are approximately orthogonal , they can be plotted against each other in 3 - dimensional space , resulting in a spatial ecg loop . virtually all of the information in a 12 - lead ecg is in the 3 - dimensional spatial ecg loop . in addition , the inventor has verified that the information content of lead configurations of up to 22 leads can be reproduced from just 3 measured leads . by increasing the lead space to 22 leads , clinicians can more accurately diagnose cardiac pathology , such as right heart infarction or posterior infarction . a typical 3 - dimensional spatial loop for a normal male heart is shown in fig7 . this type of display can easily be built into a standard heart monitor , shown in fig8 , that incorporates the single wave configuration as currently exists . this spatial loop can also be printed for then patient medical record . the next step in the derivation of the universal transformation matrix of the present invention was application of the simplex optimization technique (“ sop ”) to the training set that was subjected to afa or the measured ecg data , as illustrated in box 107 of fig1 . since 3 leads account for almost all of the information of an n - lead ecg , sop was applied to a 3 - lead set comprised of { i , avf , v2 } to calculate to other leads . simplex optimization , which is different from the simplex algorithm used for minimizing constrained linear systems , is a method for finding a maximum for a multiple variable function when the underlying function may be unknown . a simplex is a geometric figure defined by a number of points ( n + 1 ) that is one more than the number of variables . for a function of two variables z = f ( x , y ), one starts with 3 points {( x 1 , y 1 ), ( x 2 , y 2 ), ( x 3 , y 3 )}, and the value of the function is measured for those 3 points . these 3 points are then labeled as “ b ”, “ n ”, and “ w ”, for , respectively , the best , next best ( or next worst ), and worst values . since we are seeking a maximum point , the best value has the greatest magnitude . the next point r for measuring the function f is determined by r = p +( p − w ), where p is the centroid of the figure when the worst value point is eliminated . once the function has been measured for r , there are 3 possibilities for the next step . first , if the value for r is better than the value for b , an expansion is attempted with a new point defined by e = p + 2 ( p − w ). if the value for e is better than b , e is retained and the new simplex is defined by n , b , and e . if the value for e is not better than that for b , the expansion is said to have filed and the new simplex is defined by b , r , and n . second , if the value for r is between that for b and n , the new simplex is defined to be b , r , and n , and the process is restarted . finally , if the value for r is less desirable than that for n , a step was made in the wrong direction , and a new simplex should be generated . there are 2 possibilities . if the value for r is between that for n and w , the new point should be closer to r than w : c r = p + 0 . 5 ( p − w ), and the new simplex is defined by b , n , and c r . if the value at r is worst than the value at w , then the new point should be closer to w than r : c w = p − 0 . 5 ( p − w ). the new simplex is then defined by b , n , and c w . the process is iterated until a maximum is found . for the case of the 3 - lead ecg , the values of the other leads are calculated as functions of a 3 - lead set , preferably { i , avf , v2 }. thus , the simplex will be a 3 - dimensional figure defined by 4 points that represent the starting values of { i , avf , v2 }. the results of this optimization were used to define an n × 3 universal transformation matrix [ k ] such that when multiplied by a vector comprising the 3 leads { i , avf , v2 } for a particular time yield a full n - lead ecg , as illustrated in block 108 of fig1 . in particular , the [ k ] matrix was calculated for the full pp cycle of the heart beat as well for segments within the pp cycle , such as the pr interval , the qrs interval , the sp interval , and the qt interval . the accuracy of the optimization was validated by comparing the derived values for the ii , iii , avr , and avl leads with measured values for those leads . a comparison of a synthesized ecg based on values derived from simplex optimization with a measured ecg is depicted in fig1 . as described above , the current n comprises up to 22 leads placed around the body torso . although the inventor has increased n from 12 to 22 leads , it is possible to use the method of the invention to derive more than 22 leads . by plotting the voltage - time data of multiple leads in a contour graph , a body surface map (“ bsm ”) can be visualized . fig1 a and 12 b depict the chest lead placements from one electrode system soon to be commercial available . this system incorporates the placement of an 80 electrode vest around a patient &# 39 ; s chest for voltage - time acquisition . a bsm of a patient derived from such a configuration is displayed in fig1 . this figure uses a color - coded contour drawn unwrapped as if hinged on the left lateral side so that the posterior surface is displayed in continuity next to the anterior surface . fig1 displays a bsm measured from the end of the s - segment of the pqrst wave to the end of the t - segment (“ st - t ”), in a patient with acute myocardial infarction (“ mi ”) whose 12 - lead scalar ecg showed only a depression in the st portion of the pqrst wave . the bsm demonstrates a large posterior red area ( indicated by the arrow in the figure ) that indicates a posterior mi . the cost of the numerous leads required for a bsm and the time it takes to place the leads make bsms prohibitive for application in an acute care setting . sophisticated software and hardware is also required to analyze the bsm data , although recent technological advances make this process less cumbersome . however , bsms are now easily achievable using the method of the present invention , as any number of leads can be derived from just 3 measured leads using the universal transformation matrix of the present invention . a bsm derived from a 3 - lead system is displayed in fig1 . another clinical application of the method of the invention is that the cumulative percentage sum of the eigenvalues calculated from afa demonstrate statistically significant differences between normal and mi ecgs . thus , the eigenvalue contribution to the information space of the ecg is a marker for mi . in particular , by tracking the change in eigenvalue magnitudes over successive ecgs , a clinician can predict the onset of mi in a patient . in a study involving 20 patients , 10 men and 10 women , wherein half of each group displayed normal heart function and the other half of each group exhibited mi , and in which an 8 - lead ecg was used , it was found that the two largest eigenvalues decreased in magnitude in going from normal heart function to mi , while the 6 smallest gained in magnitude . although the decrease in magnitude of the two largest was not statistically significant , the increase in magnitude of the 6 smallest was statistically significant . fig1 a depicts a plot of the cumulative percentage sum of the normal and mi eigenvlaues for the two largest eigenvalues , here denoted by ev1 and ev2 . the plot displays a sharp break between the mi eigenvalues and the normal eigenvalues , wherein for normal function , this cumulative sum is greater than 97 % of the total sum , while for mi the cumulative sum is less than 97 % of the total value . more importantly , since these differences are statistically significant , the cumulative sum of the 6 smallest eigenvalues , here denoted by ev3 to ev6 , shows a break between mi eigenvalues and normal eigenvalues . this is depicted in fig1 b . as can be seen from the figure , the cumulative sum of the mi values range from about 3 % up to about 9 % of the total sum , while the cumulative sum of the normal values is less than 3 % of the total sum . this has great clinical implications . as of the current time , the only markers for mi are measured through blood testing . this takes time , and has an associated cost . these blood test measurements are also not performed in real time . they are ordered by the physician when needed , but it takes time for the technician to arrive and take the blood sample from the patient . it is just not feasible to perform such chemical testing every 1 - 15 minutes . the eigenvalues of the ecg can now be measured on a beat to beat basis using a 3 - lead bedside monitor , in real time , on demand , without the need of a technician . this invention would allow the immediate derivation of an n - lead ecg ( e . g ., 12 - lead ecg ) from a 3 - lead monitor from which the eigenvalues can be calculated instantaneously . the eigenvalue percentage contribution is itself a marker for mi . this can be displayed along with the heart rate on any customary bedside monitor . because this eigenvalue marker can be calculated on a beat - to - beat basis in less than a second with current conventional computer technology , the variability of the eigenvalues in time , and the rate of change of the eigenvalues , either by magnitude or percent contribution , are also markers for acute mi . this invention would allow the first known real - time electrophysiologic marker for acute mi . naturally , any function utilizing the eigenvalues would accomplish the same purpose . the method of the invention can be implemented on any computer system using any available programming language . one embodiment of the invention is implemented using microsoft visual basic executing on a personal computer running the windows operating system . the invention is not limited to this implementation , however , and implementations is other programming languages executing on other machines , such as the mackintosh , or workstations running under the unix operating system or variants thereof , such as linux , are within the scope of the invention . while the present invention has been described and illustrated in various preferred and alternate embodiments , such descriptions and illustrations are not to be construed to be limitations thereof . accordingly , the present invention encompasses any variations , modifications and / or alternate embodiments with the scope of the present invention being limited only by the claims which follow . | 0 |
referring more particularly to the drawings , the following discussion of the preferred embodiment and related process of the present invention focuses on shoes , and in particular the incorporation of the novel lighting system in an athletic shoe . it should be understood , however that the present invention is not limited to shoes , but all kinds of apparel that may be easily enclosed in hats , jackets , gloves and the like . the small nature of the module makes it adaptable for a wide range of apparel applications . shoes , as reflected in fig1 - 5 , are chosen for discussion purposes , only because of the challenge of using a small electronics package in the environment of a shoe . other apparel applications are much simpler . fig1 - 5 illustrate no more than an application of the present invention . referring to fig1 - 5 , an athletic shoe 1 typically includes an upper 5 and a sole portion 10 . an insole 6 typically resides in an upper 5 above the sole portion 10 . a transparent , window - like structure 20 is provided about a heel of the sole portion 10 . the transparent structure 20 may be molded integral with the sole portion 10 or may be bonded thereto with a suitable adhesive . when the shoe is moved , visible light 21 is emitted from the transparent structure . the sole portion 10 of the shoe 1 includes a mid - sole 22 and an outsole 23 which is fixably attached along the base of the shoe 1 . as disclosed in my prior u . s . patent , the outer sole is typically formed from a solid , wear - resistant material such as rubber and certain polyuretane materials , whereas the mid - sole is typically formed in an injection or thermoformive process from a foamed resilient material such as polyurethane or ethylene vinyl acetate . a light producing mechanism 30 is disposed in the midsole portion 10 of the shoe 1 , preferably below the heel of the wearers &# 39 ; foot . the light producing mechanism 30 includes a plurality of light emitting diodes 72 and 74 , ( each can be multiple diodes ) each is wired to a different part of the circuit . in the embodiment shown , the plurality of light emitting diodes are provided about the circumference of the housing 32 , although other arrangements could certainly be utilized . the housing 32 , which can be made from plastic or other suitable , resilient , yet solid material in an injection molding process , contains a lighting control circuit 33 . preferably , housing 32 is positioned within midsole 22 or immediately adjacent thereto so that leds 72 , 74 are positioned next to the transparent source 20 thereby enabling light emitted by the leds 72 , 74 to be visible externally of the shoe 1 . the lighting control circuit 33 is preferably disposed on a printed circuit board 39 to which the leds 31 are connected by conductors 38 . a switch 40 is disposed within the housing 32 and is a motion sensitive switch that closes in response to motion of the shoe . the motion activated switch 40 may be a mercury switch , such as disclosed in the rodgers &# 39 ; 009 patent , a piezoelectric transducer of the type disclosed in chiang u . s . pat . no . 5 , 188 , 447 , a vibration - type switch such as disclosed in wut u . s . pat . no . 5 , 408 , 764 , a magnetic reed switch disclosed in rodgers u . s . pat . no . 5 , 422 , 628 , or the vibration light switch disclosed in wong , u . s . pat . no . 5 , 400 , 232 . the switch arrangements disclosed therein are hereby incorporated herein by reference . a simple mechanical momentary contact switch may also be utilized . the operative characteristics of all of these switches is a switch closure of the mechanical or electrical type in response to motion . the lighting control circuit 33 is connected to a battery 41 which is located in the housing 32 . while it is shown in the diagrams as being beneath the printed circuit board 39 , the exact position is not important . the battery is electrically connected to the lighting control circuit shown in fig6 . the battery can be positioned at any convenient location within the housing . as noted , the illumination of the leds 72 , 74 is controlled by the lighting control circuit 33 shown in fig6 . the preferred embodiment is reflected therein . fig6 uses a conventional &# 34 ;+ 3v &# 34 ; to indicate that a particular element is tied to a 3 - volt power supply which would generally be provided by a dry cell , &# 34 ; button - type &# 34 ; lithium battery which provides extremely long life coupled with a light weight structure . obviously , other forms and voltages of batteries could be utilized for the present invention . the motion switch 40 is tied to the input of a monostable multivibrator 44 . this monostable multivibrator 44 is configured so as to trigger on a &# 34 ; negative &# 34 ; transition of the voltage at the switch 40 , which occurs when the switch is closed . this results in the inverted input to the or gate which forms a part of the multivibrator being tied to ground and the monostable multivibrator 44 producing a pulse at the output q1 which is defined by external resistor 48 and capacitor 46 . ( the multivibrator can also be configured to work on a positive transition , such as a switch opening and it can also be configurerd to require a series of switch closures within a set time interval to trigger . output q2 is used to enable the outputs of inverters 66 and 70 , which are of the buffered variety . as described in my previous patent , the duration of the pulse out of monostable multivibrator 44 is controlled by the resistor and capacitor by forming an rc time constant network . typical arrangements are a 47 μfd capacitor and a 2 mω resistor . the output of the one shot is used to control a signal generator which produces random width pulses . operation of the signal generator may be understood with reference to the timing diagrams in fig7 and the circuit in fig6 . the timing diagram in fig7 references a series of signal points a , b , c , s1 , m1 , l1 and l2 . signals a , b , and c are respectively the output of flip - flop 58 , flip - flop 56 , and exclusive - or gate 68 . s1 is the representation of the switch closure . m1 is the output of the one shot . l1 and l2 are the signals across the leds 72 and 74 . with reference to fig6 the signal generator includes flip - flop 58 , flip - flops 52 - 54 configured as a shift register , and 56 , nor gates 60 , 62 , and 64 , inverter 66 and exclusive or 68 . the purpose of flip - flop 58 is to divide the frequency of the oscillator . it is utilized to produce the appropriate control of the output of the shift registers through the exclusive or gate 68 . the three flip - flops , 52 , 54 , and 56 shift the clock signals from the output of the oscillator 50 . nor gate 60 has one input connected to the reset output of flip - flop 56 and the other input is connected to the set output of flip - flop 54 . a nor gate 64 has one input connected to the set output of the flip - flop 56 and another input connected to the reset output of the flip - flop 54 . the nor gates 60 and 62 have their outputs connected to one input of a nor gate 62 that also drives an inverter 66 , forming an or / nor combination . the outputs of nor gate 62 and inverter 66 are respectively connected to the set and reset inputs of flip - flop 52 . the output of the signal generator is provided at the output of flip - flop 56 , otherwise indicated as signal point b . the output at signal point b is the random width pulses indicated in fig7 . other random pulse variations can be achieved by changing the number of flip - flop circuits of the shift register and the input of the gate circuits connected in the feedback loop thereof . the output of the shift register at point b is then exclusive or &# 39 ; d with the output of flip - flop 58 so as to produce the signal at point c which is the random width pulse stream . an inverter 70 is used to invert this stream between leds 72 and 74 so that the lights can flash at opposite times . random width circuits are known in the art and are usually used for data synchronization applications . see , e . g ., u . s . pat . no . 3 , 890 , 265 to hara . no applications to apparel are known . as mentioned , once the switch closes , the output of the one shot is activated and removes the reset signal from the input of the oscillator 50 and the frequency divider 58 . thus , the shift register continues to shift whatever random series of pulses have been loaded by the feedback loop . as soon as the one shot ends its duration , the shift register stops shifting and is frozen until the next switch closure . the duration of the signals coming out of the shift register is controlled by oscillator 50 . as mentioned , this can be two back - to - back one shots , so that the frequency can be controlled with an exterior resistor / capacitor combination . the length of time which the random sequence occurs is set by the resistor / capacitor combination on the one shot 44 . as can be seen , the foregoing circuit provides an easily programmable random width series of pulses to light the leds 72 and 74 . of course , one skilled in the art would readily appreciate that numerous other modifications and / or additions can be made to the above - discussed features of the present invention without departing from the spirit and scope of the present invention . in particular , the circuit can be made in integrated form or as an application specific integrated circuit . it is intended that the present invention encompass all such modifications . | 8 |
description will now be given in detail of the present invention , with reference to the accompanying drawings . fig1 is a flowchart illustrating a radar signal clustering method using frequency modulation characteristics and combination characteristics of signals according to the present invention . first , in a cell creation step s 100 , two dimensional cells consisting of rf and aoa are created , and then pulses of radar signals stored after reception are assigned to the cells . here , the size of the cell should be determined with care because it affects to the clustering performance directly . if the cell size is too big , the pulses from several emitters may be assigned to the same cell . and , if the cell size is too small , the pulses from one emitter may be scattered to the several cells . the present invention defines the size of cell using aoa measurement accuracy σ aoa and rf measurement accuracy σ rf of a radar signal receiving unit . the measurement accuracies are set by root mean square ( rms ) unit , which means that the probability of the accuracy being within the range of ± 3σ is more than 99 %. in a noise cell removal step s 110 , for all cells with pulses , a cell density , namely , the number of pulses assigned to each cell is compared with a noise threshold th noise , thereby removing noise cells . the noise cell is determined based upon whether the cell density exceeds the noise threshold th noise . if a cell is determined to be a noise cell , the corresponding cell is initialized , so as to avoid such cell from affecting the later clustering process . in a cell difference function calculation step s 120 , first , in order to identify the distribution of pulses consisting of cells , a kernel density estimator ( kde ) f ( x ) is calculated using a kernel function k ( u ) for each cell . also , a difference function f d ( x ) of cumulative distribution function ( cdf ) for the kde f ( x ) is calculated . explaining such calculations in detail , kde is used to find out the signal distribution . for the kde , the contribution of each point to the overall density function is expressed by an influence or kernel function . the overall density function is simply the sum of the influence functions associated with each point . the kernel density estimator f ( x ) using the kernel function is defined as the following formula where n denotes the number of pulses in a cell , and h denotes a window size . afterwards , in order to determine the types of clusters , namely , whether a cluster is a frequency fixed cluster or a frequency agile cluster , the difference function f d ( x ) of cdf is calculated for the kde . the f d ( x ) of the cdf is defined as the following formula where x denotes the peak point in the kde , and σrf denotes the frequency measurement accuracy . therefore , the difference function f d ( x ), which denotes a domain value from a peak value to ± σ rf in the kde graph , represents the density distribution characteristics of pulses consisting of cells . next , in a frequency fixed cluster extraction step s 130 , clusters which have signals with the fixed frequency modulation , namely , the frequency fixed clusters are identified . explaining this step in detail , in order to identify the frequency fixed clusters , the kernel density estimator and its difference function f d ( x ) of the cdf are calculated for all of the cells . the distribution of the frequency fixed clusters has gaussian distribution in a frequency domain due to a receiver &# 39 ; s measurement error as illustrated in fig2 . fig2 illustrates the distribution of frequency fixed clusters in the frequency domain . in fig2 , f d ( x ) is about 0 . 683 , and the present invention considers this value to set a threshold th fixed for the frequency fixed cluster . therefore , if f d ( x ) of the cluster calculated is higher than th fixed ( i . e ., f d ( x )& gt ; th fixed ) for the frequency fixed cluster , the corresponding cluster is identified as a frequency fixed cluster . on the other hand , if f d ( x ) of the cluster is lower than th fixed ( i . e ., f d ( x )& lt ; th fixed ) for the frequency fixed cluster , the corresponding cluster is identified as a frequency agile cluster . afterwards , in a remaining cell merging step s 140 , adjacent cells are merged for remaining cells after the extraction of the frequency fixed clusters . the cell merging is now described in detail . if a current cell has coordinates ( x , y ), its neighboring ( adjacent ) cells with coordinates ( x − 1 , y ), ( x + 1 , y ), ( x , y − 1 ) and ( x , y + 1 ) are merged so as to make one large cell . contrary to the frequency fixed cluster , the pulses from the emitter which has an agile frequency modulation are distributed widely in a frequency domain , so merging the adjacent cells is necessary to identify the frequency agile cluster . afterwards , in a cell group difference function calculation step s 150 , first , a kde f ({ cell }) is calculated for each cell group formed by the merging , and then a difference function f d ({ cell }) of a cdf is calculated for the kde . here , the definitions of f ({ cell }) and f d ({ cell }) used are the same to those used in the cell difference function calculation step s 120 . as aforementioned , in general , the pulses from the emitter which has the agile frequency modulation are uniformly distributed in a wide frequency domain . thus , for the frequency agile cluster , the difference function f d ( x ) is about 0 . 333 due to its distribution and cell characteristics , which is illustrated in fig3 . fig3 illustrates the distribution of the frequency agile clusters in a frequency domain . the present invention uses this value , namely , 0 . 333 to set a frequency agile cluster threshold th agile for the frequency agile cluster . further , the present invention classifies signal combination types of frequency agile clusters into single type c single , overlap type c overlap and a split type c split − c single indicates that a cluster has only one frequency agile signal . if the clusters do not belong to the c single , the clusters may be classified into c overlap or c split according to whether signals are overlapped or not . c overlap indicates that a cluster has two or more frequency agile signals . c overlap may also indicate that such signals exist in an overlapped state . c split indicates that a cluster has two or more frequency agile signals without being overlapped with each other . next , in an identification step s 160 of a single type frequency agile cluster , the difference function value f d ({ cell }) calculated in the cell group difference function calculation step s 150 is compared with a threshold th single of a single type frequency agile cluster c single , thus to identify whether a frequency agile cluster is the single type frequency agile cluster c single . here , the threshold th single of the single type frequency agile cluster c single may be obtained as follows , th single =| th agile + 10 %|. if the difference function value f d ({ cell }) is smaller than or equal to th single ( i . e ., th agile − 10 %≦ f d ({ cell })≦ th agile + 10 %), it is identified as the single type frequency agile cluster c single . in an identification step s 170 of a split type frequency agile cluster , the difference function value f d ({ cell }) calculated in the cell group difference function calculation step s 150 is compared with a threshold th split of a split type frequency agile cluster c split , thus to identify whether a frequency agile cluster is the split type frequency agile cluster c split . here , th split = th agile − 10 %. if the difference function value f d ({ cell }) is smaller than th split ( i . e ., f d ({ cell })& lt ; th agile − 10 %), it is identified as the split type frequency agile cluster c overlap . afterwards , in an identification step s 180 of an overlap type frequency agile cluster , the difference function value f d ({ cell }) calculated in the cell group difference function calculation step s 150 is compared with a threshold th overlap of a split type frequency agile cluster c overlap , thus to identify whether a frequency agile cluster is the overlap type frequency agile cluster c overlap . here , th overlap = th agile + 10 %. if the difference function value f d ({ cell }) is greater than th overlap ( i . e ., f d ({ cell })& gt ; th agile + 10 %), it is identified as the overlap type frequency agile cluster c overlap . such classification for the frequency agile clusters may be represented as follows . that is , finally , in an extraction step s 190 of a frequency agile cluster , the frequency agile clusters are classified and extracted according to the combination type of each cluster ( i . e ., c single , c overlap , and c split ) identified through the comparison with the frequency agile cluster threshold . the extraction will be described in detail . if a combination type of a cluster is c single , it is identified as one frequency agile cluster , which is then extracted . on the other hand , if the combination type of the cluster is not c single , a distribution type of the kde is identified , and then cells which cause splitting or overlapping are estimated . afterwards , the difference function of the cdf is calculated for each expected cell to discriminate cells causing the split type or overlap type , and clusters are classified based upon the cells to be then extracted . fig4 illustrates the classification results for three types of frequency agile clusters . as illustrated in fig4 , it can be noticed that the frequency agile clusters are classified by the corresponding thresholds . hereinafter , description will be made of the performance of the clustering method according to the present invention in comparison with the existing clustering methods through a computer simulation in various signal environments . the input data consisted of 10 , 240 pulses for various emitters which individually have aoa , rf , pulse repetition interval ( pri ) and the like . the performance evaluation is performed with changes in the input signals , and the results are followed at table 1 . as can be seen in the results of table 1 , the existing sequential histogram and sequential scan methods do not make clusters properly for the input signals . for the sequential histogram method , it has the more clusters than expected as the number of input signal increases , and many pulses which do not exceed the threshold remain unused . the sequential scan method has the fewer clusters than expected , and also it cannot discriminate the modulation type of carrier frequency . on the other hand , it can be seen that the clustering method according to the present invention is performed properly and can identify the types of frequency agile clusters . type information is very important in the signal analysis process and it is useful for pulse train extraction . as described above , the present invention can provide an accurate clustering method based upon characteristics of frequency modulation of clusters and combination characteristics of signals through the series of processes . also , the present invention enables separate processing of signals with characteristics of fixed frequency modulation or characteristics of agile frequency modulation , which allows shortening of processing time of signal analysis and improving of accuracy of signal analysis , resulting in providing reliable information . the foregoing embodiments and advantages are merely exemplary and are not to be construed as limiting the present disclosure . the present teachings can be readily applied to other types of apparatuses . this description is intended to be illustrative , and not to limit the scope of the claims . many alternatives , modifications , and variations will be apparent to those skilled in the art . the features , structures , methods , and other characteristics of the exemplary embodiments described herein may be combined in various ways to obtain additional and / or alternative exemplary embodiments . as the present features may be embodied in several forms without departing from the characteristics thereof , it should also be understood that the above - described embodiments are not limited by any of the details of the foregoing description , unless otherwise specified , but rather should be construed broadly within its scope as defined in the appended claims , and therefore all changes and modifications that fall within the metes and bounds of the claims , or equivalents of such metes and bounds are therefore intended to be embraced by the appended claims . | 6 |
referring now in more detail to the application drawings wherein like parts are indicated by like reference numerals , the cap 1 shown in fig1 is shaped as a cylindrical body with a base 2 . while the cap for the purpose of its use as a screw cap is provided with a relatively high edge 3 , the edge in the generally employed crown cork closures is relatively low . to produce a sealing , base 2 of cap 1 is coated on its interior surface with an elastic sealing mass which is introduced into the cap in a liquid state and is uniformly distributed over the cap base 2 by a rotation of the cap under the effect of centrifugal force . the sealing area 4 wherein base 2 of cap 1 abuts against the upper bottle edge is shown in dot and dash lines in fig1 . depending on the shaping of the bottle neck , the sealing area is located more or less close to the edge of the cap and is more or less wide . since the bottles frequently contain carbonic acid gas - containing liquids , the sealing surface must be faultless and a fully satisfactory sealing , even against relatively high pressures , must be assured . fig1 shows a light point 5 imaged on cap base 2 , with the diameter of the point 5 being somewhat larger than the width of the sealing area 4 . in place of the light point 5 , a light line 6 may also be focused in , with the length of the line 6 likewise somewhat larger than the width of the sealing area . since the point or the line does not change its relative position with respect to the cap , the cap must be rotated , so that the ring - shaped sealing area is completely scanned by the light point or the light line . the sealing area is essentially illuminated only in the width or region of the circular ring 4 since defects outside the circular ring are immaterial and do not affect the sealing of the bottle . besides , with an increase in the size of the illuminated surface at a prespecified radiation intensity of the illuminating device the intensity of illumination decreases quadratically . in the basic diagram shown in fig2 the reflection factors of two different materials are recorded in relative units along the wave lengths of the entering light λ . the solid line is to diagrammatically illustrate the progress of the reflection conduct of the sealing mass , and the dash line is to illustrate diagrammatically the progress of the reflection conduct of the cap material . it can be recognized that at various points there are intersections and larger distances between the reflection curves . if a light source were chosen whose wave length would amount to λ 1 , a defect in the sealing would not be discovered since both work materials at this light wave length present the same reflection conduct . it is therefore suitable to select a light source whose light presents a wave length λ 2 since in this case the deviation in the reflection conduct is largest . in order to obtain reliable measuring value results , the detector should have a sensitivity as high as possible at the selected wave length λ 2 . fig3 shows a diagrammatical representation of an embodiment of the apparatus of the invention by means of which the locations of defects in the sealing area can be optically discovered . a light source 7 is imaged on sealing area 4 of cap 1 by way of a lens device 8 . by means of a second lens device 9 the beams reflected by cap 1 are bundled , and the image of light source 7 located on the cap is imaged in a detector 10 . the angle of incidence α of the entering light corresponds to the angle of reflection β of the reflected light and is smaller than 90 °. the angles are delimited by the height of edge 3 of cap 1 . in the selection of the angles the greatest care possible should be taken that the entire light entering the cap is reflected by the sealing area to be controlled and be collected in the detector . the embodiment of the apparatus of the invention diagrammatically represented in fig4 is provided with a first lens device 11 by means of which the beams emanating from light source 7 are directed upon a semitransparent mirror 12 . a portion of the beams emanating from light source 7 is reflected downward by the mirror 12 and imaged as a point by means of a second lens device 13 on the sealing area 4 of cap 1 . the beams reflected vertically upwardly penetrate the semitransparent mirror 12 and are bundled behind the mirror by means of a third lens device 14 in such a manner that the image of light source 7 located on cap 1 is imaged in detector 10 . as can be recognized in fig5 and 6 , it is possible to achieve by a suitable selection of lens 13a or 13b a vertical path of beams by means of which sealing areas at varying distances 15 from the edge 3 of cap 1 can be scanned . in place of the lens and mirror systems of the devices shown in fig3 and 4 , photoconductors 16 , 17 may also be employed according to the embodiment of fig7 in which case a photoconductor 16 is optically coupled with light source 7 and images the light source on the sealing mass in the sealing area 4 of rotating cap 1 . the other photoconductor 17 is optically coupled with detector 10 and conducts the image of light source 7 located on cap 1 , in the detector . this arrangement likewise permits a practically vertical direction of inspection without the occurrence of losses caused by an edge cover of the cap . fig8 shows in diagram the structure of the electronic measuring device . it can be recognized that detector 10 is connected to an ejecting device 22 by way of an amplifier 18 , an amplitude discriminator 19 , a gate stage 20 , and a terminal stage 21 . light source 7 is supplied with current by means of a service generator 23 which in turn is connected to the current supply source of an electronic measuring device 24 . the operation of the measuring device of the invention will be described . cap 1 rotates about the center of the circular - ring - shaped sealing area 4 . during this operation the reflection factor is measured along the width of sealing area 4 and the entire periphery thereof . the light source 7 used for illumination may emit either constant light of constant intensity or pulse light of constant intensity amplitude . in the latter case the pulse train must be adapted to the speed of rotation of the sealing area so that a continuous scanning of the sealing area is assured . detector 10 measures during this operation the intensity of the light reflected by the sealing area . when a deviation from the rated value prespecified for a fully satisfactory sealing area is discovered , ejection device 22 is actuated by means of an electronic measuring device , which ejecting device may comprise or include , for example , a magnetic valve . the objectionable cap is removed by the ejecting device from the assembly line . the signal transmitted by the detector is amplified by the amplifier 18 and in the amplitude discriminator 19 the amplified signal amplitude is compared with a previously adjustable rated amplitude . when a deviation from the rated value is found , an active switch element is actuated , whereby an auxiliary current circuit is switched on or off . this circuit , however , is also controlled by a gate stage for example , by means of a switch . the measuring process proper does not take place continuously but periodically during the time period at which the cap has reached its rated speed of rotation and carries out one or more rotations at this speed . this period of time is determined by means of a switch 25 , and the apparatus exerts the effect in the gate stage 20 that a possible ejecting signal is transmitted to the terminal stage 21 during this period of time only . the terminal stage 21 then switches the ejecting device 22 . the control of the measuring moment as well as of the duration of the measuring can be carried out in principle by means of the gate stage , in all groups of the circuit , so that , for example , the light source controlled by the gate stage operates only during the duration of the measurement . likewise , the detector , the amplifier , the amplitude discriminator , the terminal stage , and the ejecting device can be activated , by way of the gate stage , during the duration of the measurement only . | 1 |
according to the invention , polymers which may be modified are ones that are reactive with respect to free amino groups . these include the polyamides such as nylon 6 , and nylon 6 - 6 , among others , the polyurethanes , the polyesters such as the polymer produced by the reaction of dimethyl terephthalate or terephthalic acid and ethylene glycol , and others . it does not include polymers not having in their structures any reactive sites at which a material containing one or more free amino groups may react by amidation or transamidation to form a covalent bond , e . g ., polyethylene , polypropylene , sbr , isoprene , polyvinyl alcohol , polystyrene , etc . according to the invention , polymers capable of reacting with pendant primary amino groups are modified by being brought into intimate contact under reactive conditions with the modifying polymer , produced as hereinafter explained . in some instances , this may be done by blending 0 . 5 to 20 weight percent of the modifying polymer in a melt of the polymer to be treated , prior to the formation of a fiber or film or sheet or the like . in other instances , the modifying polymer , produced as explained below , is applied to a polymeric material after it has been produced in an extended form , i . e ., has become a fiber , film , sheet or the like . in either event , it is intended that the polymer to be modified and the modifying agent be brought into contact under conditions such as will permit their reaction , by amidation or transamidation or the like , to form a covalent bond between them , thereby affording a treated product having permanently altered properties . modifying polymers have two principal characteristics : a suitable oxyalkylene content arrived at by experimentation with each substrate and a reactive pendant amino group or a precursor of such reactive pendant amino group . the modifying polymer has a suitable oxyalkylene content . in order to bring about desired changes in the polymer to be modified , such as decreasing its ability to develop and retain a charge of static electricity or improving its compatibility with various dyes , it is desirable to use a modifying polymer of experimentally determined hydrophilic / hydrophobic balance . such polymers are obtained by incorporating substantial numbers of oxyalkylene units , usually amounting to between 20 and 95 weight percent of the modifying polymer . such polymers are made by reacting a compound containing at least one active hydrogen atom with the suitable number of moles of an oxirane compound or a mixture of such compounds . ethylene oxide is usually to be preferred ; it may be used alone or in combination with other lower alkylene oxides such as propylene oxide , butylene oxide , or other related alpha olefin epoxides . the preferred characteristic , i . e ., that of containing a pendant reactive amino group or a specified precursor thereof , is of critical importance because such a reactive group affords the means by which the modifying polymer may become chemically bonded to the substrate polymer , thereby making the modification durable , i . e ., capable of persisting through repeated washings and long - continued use . a modifying polymer according to the invention has at least one such reactive pendant amino group or precursor thereof , and may contain several such groups . as will be discussed below in greater detail , such reactive groups are obtained by starting with a diamino compound or a polyamino compound , blocking one of the free amino groups by reaction with an aldehyde or ketone to form a schiff base , and then oxyalkylating . if desired , the polymer produced as the result of such oxyalkylation may be hydrolyzed to convert the blocked amino group or groups to free amino groups before the polymer is used as a modifying agent ; alternatively , the modifying polymer while still in its blocked form may be applied to or mixed with the polymer to be modified and then , later , converted in situ to the free amino form by hydrolysis and so freed , to react with the polymer to be modified . in accordance with the invention , one starts with a material having a primary amino group and at least a second group that contains an active hydrogen atom and is capable of being oxyalkylated . preferably , the starting material is a diamine or polyamine , such as ethylenediamine , diethylenetriamine , triethylenetetramine , polyethyleneimine , 1 , 6 - hexamethylenediamine , 2 , 4 - diaminotoluene , 2 , 6 - diaminotoluene , or a mixture of 2 , 4 - and 2 , 6 - diaminotoluenes . also an amine - terminated prepolymer , such as one made by reacting an excess of a diamine , such as 1 , 6 - hexamethylene diamine , with a relatively small proportion of a diacid , such as adipic acid , or other prepolymers formed by an amine such as for example diethylene triamine and epichlorohydrin , among others , can be employed . in the first step of the making of a modified polymer in accordance with the invention , a starting amino compound as mentioned above is reacted with an aldehyde or ketone to block at least one of the amino groups present in the starting material . in performing this blocking reaction , care must be taken not to block all of the active hydrogen atoms of the starting material , one or more of which must remain in order that the subsequent oxyalkylation step may be performed . the aldehyde or ketone used to perform the blocking reaction is of the formula in which b 1 represents a hydrocarbon radical having from one to 12 carbon atoms and b 2 represents hydrogen or a hydrocarbon radical having one to 12 carbon atoms . suitable ketones for the reaction include acetone , methylethyl ketone , methylisobutyl ketone , ethylisobutyl ketone , diethyl ketone , diisobutyl ketone , and the like . effective aldehydes include isobutyraldehyde and 2 - ethylhexaldehyde . beta - substituted aldehydes are preferred , and aldehydes which condense in the presence of a strongly alkaline catalyst to aldol compounds are not suitable . in most instances , the reaction between the blocking agent and the starting amino compound takes place readily , particularly at a moderately elevated temperature such as 50 ° to 175 ° centigrade . if desired , an inert solvent may be added to facilitate the removal of water liberated by the reaction through formation of an azeotrope . if the starting material is one which will not be deprived of all of its active hydrogen atoms by the use of the blocking agent , an excess of the blocking agent may be employed as solvent . for example , diethylenetriamine is capable of retaining an active hydrogen atom in the presence of an excess of ketone , whereas ethylenediamine is not . the partly blocked amine made as described above is reacted with an alkylene oxide under oxyalkylation conditions to form an oxyalkylated blocked amine . the alkylene oxide adds onto the partly blocked amino compound at the location of an active hydrogen atom , which may be an amino or hydroxyl group . a wide range of such compositions may be prepared , ranging from materials of low molecular weight having 10 or 20 moles of alkylene oxide per mole of partly blocked amine to compositions of relatively high molecular weight in which 100 to 200 or more moles of alkylene oxide have been combined with one mole of partly blocked amino compound . other important variations may be obtained by employing more than one alkylene oxide reactant , either in mixtures or sequentially . the alkylene oxide compounds which may be employed according to the invention may be represented by the formula ## str1 ## in which r represents hydrogen or a hydrocarbon radical having from one to 20 carbon atoms . suitable alpha olefin oxides include ethylene oxide , propylene oxide , 1 , 2 - butylene oxide and 1 , 2 - octadecane oxide . oxyalkylation of the partly blocked amine is desirably conducted at a moderately elevated temperature . thus , the reaction may be conducted at a temperature in the range from about 40 ° to about 200 ° centigrade with the preferred operating temperature being from 55 ° centigrade to about 150 ° centigrade . moderately elevated pressures are preferably employed to improve the concentration and contact between the alkylene oxide and the partly blocked amino compound . such pressures may range from 1 to about 7 atmospheres . to promote the oxyalkylation reaction , alkaline catalysts can be used , such as sodium metal , sodium hydride , sodium hydroxide , sodium methoxide , sodium ethoxide , and the corresponding potassium compounds . the oxyalkylation reaction is conducted in the absence of water or alcohol or other substances which are themselves capable of reacting with the oxyalkylating agent used . in some instances , an oxyalkylated partly blocked amine made as indicated above may be subjected to certain additional reactions before being used . for example , in the case of producing modifying polymers for use with a polyester resin such as the reaction product of ethylene glycol and dimethyl terephthalate , it is desirable to have a modifying polymer which does not contain any free hydroxyl groups . accordingly , in such a case , it is desirable to block the reactive hydroxyl groups at the ends of any oxyalkylene chain by reaction with a suitable capping agent , such as a monocarboxylic acid . any suitable monocarboxylic acid may be used , such as acetic acid , propionic acid , butyric acid , benzoic acid , toluic acid , capric acid , caprylic acid , myristic acid , cyclohexanecarboxylic acid , etc . such a reaction with acid is conducted , of course , before the step of hydrolysis to regenerate amino groups , since otherwise the acid would react with such amino groups as well and thus destroy the usefulness of the modifying polymer . it will also be apparent to those skilled in the art that the oxyalkylated blocked amines made in the manner described above are , in effect , diols or polyols , depending upon the number of hydroxyl - terminated oxyalkylene chains in the molecular . such diols or polyols are capable of reacting with difunctional or higher functional compounds such as diacids , diesters of diacids , diisocyanates , and diepoxides to form linear or branched polymers . in appropriate circumstances the methyl esters may be used . dimethyl terephthalate is an example . diglycidyl ether having the formula : ## str2 ## and diglycidyl ethers of the formula : ## str3 ## wherein r &# 39 ; is the hydrocarbon residue of a diol ## str4 ## wherein r is a c 2 to c 4 alkylene and n is an integer from 1 to about 350 . preparation of diepoxides of the type just mentioned is described in the book entitled epoxy resins by lee and neville , published by mcgraw hill book company , new york ( 1957 ). phenols which may be used to prepare the diglycidyl ethers include : ## str5 ## where n and m are integers from 1 to 10 . diols which may be used to prepare the diglycidyl ethers include : ethylene diol , 2 , 3 - butanediol , 1 , 6 - hexanediol , etc . ( e . g . alkylene and alkane diols having two to 12 carbon atoms ). poly ( alkylene ethers ) which may be used to prepare the diglycidyl ethers include : polyethylene glycols , polypropylene glycols and copolymers thereof , wherein the poly ( alkylene ethers ) have a molecular weight between about 106 and 10 , 000 . the diglycidyl ether of bisphenol a is a preferred diepoxide for use in carrying out the invention , since it is inexpensive and commercially available . again , such reactions with diisocyanates , dicarboxylic acids , diesters , or diepoxides are to be conducted prior to the step of hydrolysis to regenerate amino groups . mixtures of the foregoing kinds of difunctional and higher functional materials may likewise be used in some instances . the oxyalkylated partly blocked amine , possibly further modified as described in the preceding section , is hydrolyzed to form the modifying polymers of this invention . this results in a splitting of the oxyalkylated partly blocked amine at the point or points where the carbonyl and the amino groups originally combined , without disturbing the alkylene oxide units added during oxyalkylation . the hydrolysis effects a regeneration of the carbonyl compound originally employed as a blocking agent . this step of hydrolysis to regenerate free amino groups may be conducted , as desired , either before the bringing together of the modifying polymer and the polymer to be modified , or after . the hydrolysis reaction takes place spontaneously upon contacting the modifying polymer with water , even under ambient conditions of temperature . however , heat may be employed . the modifying polymer , in either its amine - blocked or amine - regenerated form , must be brought into contact with the polymer substrate to be modified . in some instances this may be done by incorporating it into a melt of the polymer substrate and uniformly dispersing it prior to the formation of sheets or fibers . in other instances , this may be done by applying the modifying polymer to fibers , strands , sheets and the like . modifying polymers in their amine - regenerated form are quite reactive towards polyesters , polyurethanes , and polyamides , especially at advanced temperatures such as 100 °- 300 ° centigrade , depending on the substrate . in the case of modifying polymers in their amine - blocked form , the formation of the free amine takes place rather readily , as mentioned above , when water is permitted to react with the modifying polymer , which in some cases may take place at some subsequent step of the process after the modifier is blended with the substrate , such as a washing step . in either event , the free reactive primary amino group ( or groups ) of the modifying polymer finds in the substrate a portion of its structure with which it ( or they ) may react by , for example , amidation ( in the case of a polyester ) or transamidation ( in the case of a polyurethane or polyamide ). having thus become bonded covalently into the substrate , the modifying polymer alters the properties of the substrate in a manner that is permanent and not destroyed by washing or long continued use . it is possible in accordance with this invention to provide a modifying polymer having two or more free primary amine groups . as an example , diethylenetriamine may be end - blocked with two moles of acetone and then oxyalkylated . modifying polymers that have two or more amine groups may be used as diamines or polyamines are used in the art , namely , they may be reacted with dicarboxylic acids to produce polyamides or with diisocyanates to produce polyureas . thus , it is possible to use such a modifying polymer as a partial replacement for a diamine that is being so used to make such a polymeric material . moreover , in some cases it may be desirable to replace a diamine formerly used entirely with a diamine that comprises a modifying polymer according to this invention . still another use that may be made of a modifying polymer according to the present invention is the possibility of producing , for example , an external anti - stat material by curing the modifying polymer with a suitable curing agent , such as a diepoxide . the free hydrogen atoms of the amino groups of a modifying polymer according to this invention may in some circumstances by capable to being reacted with ( cured by ) a diepoxide to produce a polymer of high molecular weight which , because of the relatively hydrophilic nature of the modifying polymers of this invention , will be satisfactorily anti - static and at the same time compatible with and adherent to a polymer to which such materials are applied , whether sequentially or in admixture . this modification is illustrated below in example 3 . the invention described above may be illustrated by the following specific examples , which are to be taken as illustrative and not in a limiting sense . in the examples , parts are by weight unless indicated to the contrary . a three - liter round - bottom flask was charged with 1000 grams of diethylene triamine and 200 grams of methyl isobutyl ketone . the flask was equipped with a mechanical stirrer , thermometer and thermometer well , dean - stark trap with thermometer and condenser , one - liter pressure - equalizing dropping funnel , and nitrogen - sweep means . under a slow nitrogen sweep the reaction mixture was heated towards a reflux temperature , while 800 grams of methyl isobutyl ketone were charged to the dropping funnel . when the reactor temperature reached 80 ° centigrade , slow addition of the methyl isobutyl ketone was begun . after one hour , the reactor temperature had reached 137 ° centigrade , at which point reflux was achieved . the refluxing vapor had an average temperature throughout the rest of the condensation reaction of between 113 ° and 123 ° centigrade . the slow , continuous addition of methyl isobutyl ketone to the reactor was continued over a period of 4 hours , and the reaction mixture was thereafter maintained at reflux temperature for an additional hour , at which time further evolution of water ceased ( 190 grams of water collected , versus 181 grams theoretical ). the mixture was then vacuum - distilled at an absolute pressure of 10 millimeters of mercury maximum and a temperature of 90 ° centigrade for one - half hour to remove volatiles weighing 70 grams . the resultant reaction mixture was then employed in subsequent steps without further purification . an autoclave of about 3 . 8 liter capacity was charged with 556 grams of the above - mentioned ketimine ( 3 moles ), and 575 grams of propylene oxide ( a 10 percent excess ) was added to the autoclave over a period of 2 hours at 100 ° centigrade . the pressure in the autoclave was 5 . 7 atmospheres . thereafter , the autoclave was vented under nitrogen , and 11 . 2 grams of potassium hydroxide of 95 percent purity was added . the autoclave was sealed , and the contents were subjected to an absolute pressure of less than or equal to 10 millimeters of mercury for 1 hour at 125 ° centigrade . during this treatment , 55 grams of volatile material were removed , which corresponds to a 10 percent excess of propylene oxide ( 57 . 5 grams ). the above - mentioned vacuum was relieved with the addition of a second charge ( 1669 grams ) of propylene oxide , which charge was added over a period of 4 hours . an additional two hours were allowed for the reaction of this further addition of propylene oxide . this yields a material that may be called an oxypropylated ketimine . a 315 - gram portion of the oxypropylated ketimine mentioned above was treated with 1 . 5 grams of potassium hydroxide . the material was then subjected to reduced pressure , to remove volatiles . an autoclave of 3 . 8 liter capacity was charged with 315 grams of the material so treated , under a nitrogen blanket , and the autoclave was then sealed and evacuated to less than 10 millimeters of mercury absolute pressure , while being heated to a temperature of 115 ° centigrade . the vacuum in the autoclave was relieved by the addition of a further quantity of propylene oxide ( 1225 grams ), over a period of 3 hours . propylene oxide was allowed to react out for 2 hours ( maximum pressure 7 . 05 atmospheres ), and thereafter , the autoclave was vented and was pressurized with nitrogen to 3 . 3 atmospheres . ethylene oxide ( 1260 grams ) was then fed in , over 5 . 5 hours , and permitted to react until a constant pressure was achieved . the mixture was cooled to 80 ° centigrade and discharged under a nitrogen blanket . thereafter , a two - liter three - necked round - bottom flask was equipped with a mechanical stirrer , a thermometer , and a water - return trap and condenser , and into such equipment there were charged 716 grams of polyol material made as described above , along with 100 grams of distilled water . the mixture was heated to a reflux temperature for about two hours , during which time there was obtained as distillate an azeotrope of methylisobutyl ketone and water . an 81 percent yield of methyl isobutyl ketone ( 60 . 5 grams ) was isolated , dried over magnesium sulfate , and compared with a known sample of methylisobutyl ketone by infra - red spectral analysis . residual catalyst was neutralized by adding 0 . 24 milliliters of phosphoric acid , and then the reaction mixture was subjected to vacuum , to remove water . analysis by titration , before and after treatment with acetic anhydride , revealed 0 . 52 percent total amine nitrogen , versus 0 . 47 percent calculated , and 0 . 38 percent tertiary nitrogen , versus 0 . 31 percent calculated . this shows that the ketimine survives the oxyalkylation step . there was thus prepared a polymeric material that was stable up to 320 ° centigrade as determined by tga in a nitrogen atmosphere , exhibited a sink time for a 0 . 1 weight percent solution of 60 seconds , exhibited as a solution of 0 . 1 weight percent a surface tension of 32 . 8 dynes per centimeter , and a cloud point in a one weight percent aqueous solution of 83 ° centigrade . the ph of the one percent solution was 10 . a three - liter , four - necked flask was charged with 585 parts ( 4 moles ) of triethylene tetramine and 1000 parts ( 10 moles ) of methyl isobutyl ketone . the flask was equipped with a mechanical stirrer , a thermometer and thermometer well , a dean - stark trap , and means for providing a slow nitrogen sweep . the reaction mixture , a colorless and homogeneous solution , was heated to reflux temperature . azeotropic water removal started when the reactor reached 105 ° centigrade . after 10 . 5 hours , 141 parts of water had been collected ( versus 144 parts theoretical ). further water formation had become imperceptibly slow , the reactor being at 155 ° centigrade and the refluxing vapor at 125 ° centigrade . the reaction was stopped by lowering the reactor temperature to 120 ° centigrade . the reaction mixture was vacuum - distilled for one hour at 5 millimeters of mercury absolute pressure , thereby removing 212 parts of unreacted methyl isobutyl ketone . the product was a light - yellow mobile liquid , amounting by weight to a 96 . 4 percent yield of the diketimine resulting from the reaction of triethylene tetramine and methyl isobutyl ketone . to a stirred autoclave of approximately 3 . 8 liters capacity there were charged 617 parts ( approximately 2 moles ) of the diketimine mentioned above . at 60 ° centigrade under 3 . 3 atmospheres pressure , 211 parts ( approximately 4 . 8 moles ) of ethylene oxide were added continuously over 100 minutes . the temperature was raised to 80 ° centigrade for 2 hours . the reaction mixture was cooled to 60 ° centigrade and discharged under nitrogen , giving 799 parts of product . a small sample was vacuum - distilled at 60 ° centigrade for one hour at 1 millimeter of mercury absolute pressure to remove volatiles and then subjected to elemental analysis . calculated for c 22 h 44 n 4 o 2 : 66 . 62 % c , 11 . 18 % h , 14 . 13 % n further evidence of the structure was obtained by heating a small sample of the product with water for one hour to hydrolyze the product and regenerate methyl isobutyl ketone . in this test , 87 % of the calculated quantity of methyl isobutyl ketone was isolated . analysis by titration before and after treatment with acetic anhydride revealed a total amine content of 20 . 6 % and a tertiary - amine content of 10 . 9 %, which agrees with the theoretical values for c 22 h 44 n 4 o 2 when hydrolyzed to the extent indicated above . a higher ethoxylate was prepared . to a one - liter , three - necked flask equipped with a mechanical stirrer , a thermometer and thermometer well , and a vacuum distillation take - off assembly , there were charged 607 parts of the diketimine diethanolamine , which was then heated and vacuum - distilled to remove volatiles ( 100 ° centigrade , 15 minutes , 1 to 3 millimeters of mercury ). the vacuum was relieved with nitrogen , 14 . 5 parts of sodium methoxide powder were quickly added , and the vacuum was immediately reestablished . in 45 minutes of additional vacuum distillation under the same conditions , 12 parts of distillate were collected . the vacuum was again relieved with nitrogen , and 585 parts of the catalyzed intermediate were transferred to an autoclave of approximately 3 . 8 liters capacity . to the autoclave there were also charged 1131 parts by weight of ethylene oxide over a period of three hours with the autoclave contents at 125 ° centrigrade . a sample , 334 parts , was removed and treated with 70 milliliters of water at reflux for one hour , and 53 parts of methyl isobutyl ketone were isolated ( theory predicts 57 . 4 parts , based upon theoretical further addition of about 17 . 4 oxyethylene units ). titration , before and after treatment with acetic anhydride , indicated 5 . 26 % total titratable amine ( theory , 5 . 8 %) and 2 . 82 % tertiary amine ( theory , 2 . 9 %). this proves that the ketimine survives the oxyethylation step . to a two - liter round - bottom flask equipped with a mechanical stirrer , thermometer , dean - stark trap , and condenser , there were charged 387 grams of hexamethylene diamine , 193 . 5 grams of reagent - grade acetone , and 380 grams of reagent - grade toluene . the solution was heated to a reflux temperature , which slowly increased from 87 ° centigrade to 127 ° centrigrade over a period of 5 . 5 hours . during this interval , 62 grams of water - acetone azeotrope were collected ( theoretical , 60 grams ). the reaction mixture was subjected to vacuum distillation ( 40 ° centigrade , 1 . 5 millimeters of mercury absolute pressure ) to remove the toluene . the vacuum distillation was continued , with the collection of a first fraction weighing 316 grams at temperatures between 79 ° and 100 ° centigrade and absolute pressures of 1 . 5 to 2 . 0 millimeters of mercury , and with a second fraction weighing 150 grams being collected at temperatures between 100 ° centigrade and 115 ° centigrade . there remained a pot residue weighing 25 grams . for further processing , there was prepared a mixture of all of the first fraction mentioned above and 28 grams of the second fraction . a quantity ( 340 grams ) of this mixture was charged to an autoclave of 3 . 8 - liter capacity , which was then purged with nitrogen and pressurized with nitrogen to 3 . 3 atmospheres . an initial charge of 324 grams of ethylene oxide was then begun , and it was observed that an exothermic reaction was taking place . the temperature of the reaction mixture was maintained at 100 ° centigrade by continuing the addition of ethylene oxide . the reaction mixture was permitted to come to a constant pressure , and thereafter the reaction mixture was stripped of its volatile content at a maximum absolute pressure obtained of 10 millimeters of mercury , the quantity of volatiles being trapped in this way amounting to 9 . 9 grams . potassium hydroxide ( 1 . 0 gram ) was then added , and the reaction mixture was stripped by being subjected for one hour at a temperature of 130 ° centigrade to an absolute pressure of less than 10 millimeters of mercury . thereafter , the vacuum was released with nitrogen , and the autoclave was pressurized to 3 . 3 atmospheres with nitrogen , and a second charge of ethylene oxide , amounting to 470 grams , was added to the reaction mixture in the autoclave over a period of 2 hours at a temperature of 130 ° centigrade . the reaction mixture was permitted to come to a constant pressure , and thereafter , the autoclave was vented , and there was withdrawn from it a viscous , tan - colored liquid . a portion of the viscous , tan - colored liquid was then heated with an excess of water to reflux temperature , then subjected to vacuum distillation to recover the free amine . analysis by titration , before and after treatment with acetic anhydride , revealed 6 . 2 percent total titratable nitrogen ( 5 . 8 percent , calculated ) and 4 . 5 percent of tertiary nitrogen ( 2 . 9 percent , calculated ). as before , this indicates that the ketimine survives the oxyalkylation step . to a one - liter round - bottom flask equipped with a short - path distillation take - off , a mechanical stirrer , and a thermometer , there were charged 337 grams of the above - mentioned viscous tan - colored liquid , and 0 . 1 gram of sodium methoxide powder . this mixture was subjected to vacuum for one - half hour while the temperature thereof was raised to 120 ° centigrade . the vacuum was intermittently relieved with nitrogen , and small charges of dimethyl terephthalate ( 5 to 10 grams ) were added . vacuum was reestablished , and methanol was removed . when the mixture appeared to be very thick , the temperature of the reaction mixture was raised to 140 ° centigrade , and the addition of dimethyl terephthalate was continued . when a total of 103 . 5 grams of dimethyl terephthalate had been added , the reaction was stopped by the addition of 0 . 2 milliliters of phosphoric acid . there was thus obtained a polyester which was extremely viscous at room temperature but had a viscosity of 7400 centipoises at 100 ° centigrade . this material will be designated &# 34 ; agent x &# 34 ; hereinbelow . to a 100 - gram aqueous solution containing 10 weight percent of acetic acid , there were added 35 grams of agent x . this was divided into four parts . to one part , nothing further was added . to a second part , there were added 0 . 35 gram of accelerator en ( eponite 100 diepoxide ) and 0 . 17 grams of zinc fluoborate . to a third portion , there were added 1 . 75 grams of accelerator en and 0 . 87 gram of zinc fluoborate , and to the fourth portion there were added 3 . 5 grams of accelerator en and 1 . 75 grams of zinc fluoborate . the portions were formed into films and dried at 100 ° centigrade for one hour and then for 10 minutes at 150 ° centigrade . the films that were obtained with the untreated control and with the portion to which 0 . 35 gram of accelerator en was added were very tacky ; the portion to which 1 . 75 grams of accelerator en was added was slightly tacky , and the portion containing 3 . 5 grams of accelerator en was non - tacky and definitely cured . for testing upon nylon fiber , there was prepared a mixture corresponding in composition to the fourth portion mentioned above , i . e ., the above - mentioned polyester , dissolved in acetic acid , with appropriate quantities of accelerator en and zinc fluoborate added to it . this composition was applied to nylon fiber at a rate of 7 to 13 . 9 weight percent . for purposes of comparison , a similar portion of nylon fiber was treated at the same rate with a known commercial antistatic agent . resistivity tests were conducted , not only on the nylon as initially treated but also upon the nylon after repeated washing in a &# 34 ; terg - o - meter &# 34 ; machine ( 20 minutes , 100 revolutions per minute , 60 ° centigrade ). the results of this testing are presented below in table no . i . in the results presented below , the &# 34 ; log r &# 34 ; represents the logarithm to the base 10 of the resistance in ohms per square ; a high value of &# 34 ; log r &# 34 ; indicates that the fiber is relatively hydrophobic and is consequently likely to develop or hold a static - electricity charge . table i______________________________________material no . washings log r______________________________________untreated control 1 14 . 5 &# 34 ; 5 14 . 6 &# 34 ; 7 14 . 6 &# 34 ; 10 14 . 4nylon treated with 1 10 . 7known commercialantistatic agent 2 10 . 7 &# 34 ; 3 11 . 9 &# 34 ; 5 11 . 5 &# 34 ; 7 12 . 9 &# 34 ; 10 13 . 9nylon treated with 1 11 . 313 . 9 weight per - cent of agent x 2 11 . 5 &# 34 ; 3 11 . 3 &# 34 ; 5 11 . 7 &# 34 ; 7 11 . 3 &# 34 ; 10 12 . 1nylon treated with 1 11 . 710 . 4 weight per - cent of agent x 2 11 . 7 &# 34 ; 3 11 . 6 &# 34 ; 5 12 . 0 &# 34 ; 7 11 . 9 &# 34 ; 10 12 . 2nylon treated with 1 12 . 47 . 0 weight per - cent of agent x 2 12 . 5 &# 34 ; 3 12 . 3 &# 34 ; 5 12 . 5 &# 34 ; 7 12 . 5 &# 34 ; 10 12 . 6______________________________________ the foregoing data show that agent x is an effective antistatic agent , reducing the resistivity to about one percent or less of the value for an untreated control . moreover , in comparison with the known commercial antistatic agent , agent x was initially slightly less effective , but it was remarkably superior in regard to retaining its effect through repeated washings . to a two - liter three - necked round - bottom flask equipped with thermometer , mechanical stirrer , and dean - stark trap , there were charged 428 grams of diethylene triamine and 1200 grams of methyl isobutyl ketone . the mixture was heated to reflux under a slow nitrogen sweep . refluxing began at 110 ° centigrade and was continued for seven hours , finishing at the boiling point of methyl isobutyl ketone . azeotropic removal of water accounts for 94 percent of the water theoretically present . excess methyl isobutyl ketone was removed under reduced pressure . the intermediate product thus remaining was employed in the next step without further purification . an autoclave of 3 . 8 liters capacity was charged with 534 grams of the above - mentioned intermediate product . the charge was swept with nitrogen ; then the autoclave was sealed , pressurized with nitrogen to 3 . 3 atmospheres , and heated to 70 ° centigrade . then , over a period of 2 hours , ethylene oxide ( 150 grams ) was added . ( this was a 62 - gram excess of ethylene oxide , which was lost when the autoclave was later vented .) the autoclave was vented to atmospheric pressure , and 3 grams of 95 percent flake potassium hydroxide were added . the autoclave was resealed and evacuated to an absolute pressure of 10 millimeters of mercury or lower . the reaction mixture was stripped at 125 ° centigrade for one hour . nitrogen was admitted to the autoclave to relieve the vacuum and create a pressure of 3 . 3 atmospheres . then over four hours , 1451 grams of ethylene oxide were added . the contents of the autoclave were cooled to 80 ° centigrade and discharged . to a two - liter , three - necked round - bottom flask equipped with mechanical stirrer , thermometer and water - return trap there were charged 894 grams of the above - mentioned autoclave contents and 100 milliliters of water . after one hour of refluxing , removal of methyl isobutyl ketone ceased . there were isolated 150 grams of methyl isobutyl ketone , an 83 percent yield . the mixture remaining was vacuum - stripped ( 100 ° centigrade , 1 hour , absolute pressure 10 millimeters of mercury maximum ). to the mixture there was then added a six weight percent portion of finely divided activated silicate material to adsorb the basic catalyst present . filtration and vacuum stripping completed the preparation . a sample of the material so produced was titrated , before and after treatment with acetic anhydride , to determine total and tertiary amine nitrogen . the titrations showed 5 . 8 percent total nitrogen ( 5 . 3 percent , calculated ) and 2 . 4 percent tertiary nitrogen ( 3 . 6 percent , calculated ). these results show that the ketimine survived the oxyalkylation step . the material so produced is an example of a modifying polymer according to the invention . it may be used in various ways , such as by adding 3 weight percent of it to a melt of a polyester resulting from the reaction of ethylene glycol and dimethyl terephthalate . one mole of methyl isobutyl ketone is reacted with one mole of a mixture of 2 , 4 - and 2 , 6 - diaminotoluenes , and the resulting ketimine is reacted with 30 moles of ethylene oxide . the resulting material is added , to the extent of 5 weight percent , to a melt of nylon 6 -- 6 ( polyhexamethylene adipamide ). the melt is spun into fibers , which are then heated to 100 ° centigrade in a water - washing step , in which a hydrolysis occurs , regenerating the amine groups and thus causing the modifying polymer to react with the nylon 6 -- 6 . one mole of diethylene triamine is reacted first with 2 moles of 2 - ethylhexaldehyde , then with 10 moles of propylene oxide , then with 30 moles of ethylene oxide , then with 10 moles of propylene oxide . the resulting product is then hydrolyzed to restore its free amino groups , yielding a material which is used in making a modified nylon 6 -- 6 by being substituted for approximately 10 percent of the hexamethylene diamine ordinarily used . an amine - terminated polymer of relatively low molecular weight is made by reacting a quantity of hexamethylene diamine with a relatively small proportion of adipic acid . such polymer is reacted with diethylketone to block some of its amino groups , and then with ethylene oxide to obtain a material of desired viscosity . the material is then hydrolyzed to restore its free amino groups and added , at 7 weight percent , to a melt of nylon 6 ( polyepsiloncaprolactam ). one mole of ethylene diamine is reacted with one mole of diethyl ketone , and the resulting ketimine is reacted with 20 moles of ethylene oxide to form a diol , which is then reacted with dimethyl terephthalate to form a polyester of relatively low molecular weight . the polyester is dissolved in a suitable solvent such as toluene and sprayed upon freshly formed polyester fiber , which is then heated in an oven with a moist atmosphere to cause hydrolysis and amide formation . one mole of 2 , 4 - diaminotoluene is reacted with one mole of methyl isobutyl ketone , and then with 15 moles of ethylene oxide to form a diol . the diol is substituted for 5 weight percent of a hydroxyl - terminated prepolymer ordinarily used with toluene diisocyanate to make a polyurethane resin in accordance with a typical foaming formulation which , during foaming , produces water and heat . a modified , more hydrophilic polyurethane foam is obtained . one mole of tetraethylene pentamine is reacted with two moles of isobutyraldehyde to form a blocked amine . the blocked amine is reacted with 90 moles of ethylene oxide , and then hydrolyzed and dissolved in mixed xylenes and applied to fibers of nylon 6 -- 6 after they have been spun and woven . the treated cloth is then heated to about 150 ° centigrade to cause reaction of the nylon and the modifying polymer so applied . one mole of 2 , 4 - diaminotoluene is reacted with one mole of methyl isobutyl ketone , and then with 15 moles of ethylene oxide to form a diol . the diol is added to a melt of a polyurea resulting from the reaction of hexamethylene diisocyanate with a 90 : 10 mixture of hexamethylene diamine and isophorone diamine , the diol being added to the extent of 5 weight percent of the melt . subsequent hydrolysis yields a hydrophilized polyurea composition . | 3 |
the prosthetic devices which are preferred for use with the catheters and methods described herein include stents , and particularly the palmaz - schatz stent which is available from johnson & amp ; johnson . stents for use herein are disclosed in palmaz , u . s . pat . no . 4 , 733 , 665 , and cragg , u . s . pat . no . 5 , 405 , 377 , both of which are expressly incorporated herein by reference . briefly , these stents include a tubular - shaped member having first and second ends and a wall surface disposed between the first and second ends , the wall surface being formed by a plurality of intersecting elongate members , at least some of the elongate members intersecting with one another intermediate the first and second ends of the tubular - shaped member ; the tubular - shaped member having a first diameter which permits intraluminal delivery of the tubular - shaped member into a body passageway having a lumen ; and the tubular - shaped member having a second , expanded diameter , upon the application from the interior of the tubular - shaped member of a radially , outwardly extending force , which second diameter is variable and dependent upon the amount of force applied to the tubular - shaped member , whereby the tubular - shaped member may be expanded to expand the lumen of the body passageway . methods for deploying prosthetic devices , including stents , are disclosed in lau et al ., u . s . pat . no . 5 , 158 , 548 , and in cox , u . s . pat . no . 5 , 257 , 974 , both of which are expressly incorporated herein by reference . the prosthetic devices may be composed of a shape retaining or shape memory material such as nitinol so that the devices are self - expanding and thermally activatable within a vessel upon release from a retaining means which holds the prosthetic device in a compressed state at the first diameter . these devices will automatically expand to a second , expanded diameter upon being released . the construction and deployment of a self - expanding stent is disclosed in morgentaler , u . s . pat . no . 5 , 224 , 953 , which is expressly incorporated herein by reference . the plurality of elongate members may be a plurality of wires , and the wires may be fixedly secured to one another where the wires intersect with one another . the plurality of elongate members may be a plurality of thin bars which are fixedly secured to one another where the bars intersect with one another . the tubular - shaped member may have a biologically inert coating on its wall surface , and the coating may include a means for anchoring the tubular - shaped member to the body passageway . the catheters for use herein include those described in jang , u . s . pat . no . 5 , 364 , 347 , and willard et al ., u . s . pat . no . 5 , 219 , 335 , both of which are expressly incorporated herein by reference . the catheters may comprise an elongate catheter body having proximal and distal ends and at least two regions , a proximal region and a distal region . the proximal region of the catheter body may have at least two lumens extending at least partly therethrough . the distal region of the catheter body will have a single common lumen in communication with both of the lumens of the proximal region . additionally , an inflatable angioplasty balloon will be disposed about the common lumen of the distal region of the catheter , and a prosthetic device , vascular graft , or stent will be releasably disposed about the angioplasty balloon , or associated therewith . in use , a catheter will be advanced over a guidewire into a patient &# 39 ; s vascular system . first the guidewire will be advanced alone into the patient until the guidewire lies within a particular region of interest . this will typically be a region in which a blood vessel has been narrowed by a stenotic lesion . the distal end of the guidewire will be advanced into the region of stenosis with the proximal end of the guidewire remaining outside of the patient &# 39 ; s body . the proximal end of the guidewire may then be inserted into the distal end of the catheter body and fed through the common lumen of the distal region . when the proximal end of the guidewire reaches a transition region between the distal and proximal region of the catheter body , the guidewire will be directed into a particular guidewire lumen of the proximal region . once the guidewire has been directed into the guidewire lumen , the catheter will be advanced into the patient &# 39 ; s vascular system until the prosthetic device associated with the distal region lies within the region of interest . during advancement of the catheter into the blood vessel , the proximal end of the guidewire will exit the catheter body through a guidewire port located some distance proximal of the distal region ( in either an “ over - the - wire ” configuration , or a “ monorail ” configuration ). the proximal end of the guidwire may then be grasped and pulled back sufficiently to withdraw the distal end of the guidewire into the guidewire lumen and clear of the common lumen of the distal region . an ultrasonic imaging transducer or other work element may then be advanced through another lumen of the proximal region and into the common lumen for imaging the region of interest . prior to inflation of the balloon , the imaging transducer is activated to determine the position of the proximal edge of the prosthesis , the distal edge of the prosthesis , or both edges of the prosthesis . this step is performed for the purpose of determining whether the prosthetic device overlaps with a branching segment of the blood vessel so that the balloon and its associated prosthetic device can be repositioned away from the branching segment before inflation of the balloon and deployment of the prosthetic device . the exact positioning of the prosthetic device is also important because it is desirable to have the prosthetic device extend longitudinally at both its proximal and distal ends to healthy segments of the blood vessel . it is difficult to determine exactly where the diseased segment of the blood vessel begins and ends without ultrasound imaging from within the body passageway . thus , a catheter according to the present invention will allow for the convenient delivery of a balloon angioplasty device and an associated prosthetic device in combination with another interventional or imaging device to a region of interest within the patient . because the catheter uses a single common distal lumen , it may be made with a reduced profile at its distal end . this will allow delivery of the balloon angioplasty , associated stent , imaging , or other interventionl devices even within narrow , tortuous regions of the patient &# 39 ; s vascular system . furthermore , the various work elements are delivered through a common lumen lying within the balloon , thus minimizing the need to reposition the catheter body between treatment steps . [ 0048 ] fig1 depicts a preferred embodiment of a catheter according to the present invention . the catheter has a catheter body 12 , which comprises proximal region 15 , distal region 18 , and transition region 20 . fig2 a is a cross - sectional view of the proximal region of catheter body 12 through section line a - a . in this embodiment , proximal region 15 has three lumens , work element lumen 23 , guidewire lumen 25 , and proximal balloon inflation lumen 27 . other embodiments could have still more lumens to accommodate additional imaging or interventional devices , as described generally in co - pending u . s . application ser . no . 07 / 975 , 769 , filed nov . 13 , 1992 , the full disclosure of which is incorporated herein by reference . guidewire port 30 and balloon inflation port 32 ( fig1 ) place guidewire lumen 25 and proximal balloon inflation lumen 27 in communication with the exterior of the catheter near its proximal end . in the embodiment depicted in fig1 drive shaft 45 is reciprocatably disposed within work element lumen 23 . ( for clarity , only a distal portion of drive shaft 45 is illustrated .) at its proximal end , work element lumen 23 is in communication with expandable member 39 , which is connected in turn to proximal housing 35 . the proximal housing is adapted to connect a proximal end of drive shaft 45 to a drive motor ( not shown ) for rotating the drive shaft . expandable member 39 allows the drive shaft to be conveniently advanced and retracted within work element lumen 23 by moving proximal housing 35 with respect to the catheter body to lengthen or shorten expandable member 39 as desired . proximal housing 35 is provided further with flush port 50 , to allow for the flushing of trapped air bubbles from within work element lumen 23 . the construction and use of proximal housing 35 in conjunction with a multi - lumen catheter is more fully described in co - pending u . s . application ser . no . 07 / 976 , 228 , filed nov . 13 , 1992 , the full disclosure of which is incorporated herein by reference . a cross - section through distal region 18 of catheter body 12 through section line b - b is depicted in fig2 b . as can be seen therein , distal region 18 has two concentric lumens . in the distal region , common lumen 60 is disposed within distal balloon inflation lumen 62 . referring again to fig1 balloon 65 is disposed about common lumen 60 . the balloon is in communication with distal balloon inflation lumen 62 to provide for inflation of the balloon . radiopaque band 68 is wrapped around the common lumen at a position within the balloon to allow for fluoroscopic imaging to assist in placing the balloon within the desired region of the blood vessel . a prosthetic device 90 , such as a stent , is disposed about the balloon 65 , and is in close radial proximity thereto . where the prosthetic device is a wire mesh stent composed of metallic material , the distal region of the catheter may be equipped with the stent by crimping the stent onto the distal region of the catheter body , such as over the balloon . the length of common lumen 60 will generally be between 5 and 30 centimeters , with balloon 65 typically having a length in the range of 1 . 5 - 4 . 5 centimeters . the balloon crossing profile , the minimum width crossable by the balloon when deflated , will typically be in the range of 0 . 020 - 0 . 045 inches . the outside diameter of the balloon when inflated within a blood vessel will commonly be between 1 . 5 and 4 . 5 millimeters . the foregoing ranges are set forth solely for the purpose of illustrating typical device dimensions . the actual dimensions of a device constructed according to the principles of the present invention may obviously vary outside of the listed ranges without departing from those basic principles . [ 0054 ] fig3 depicts transition region 20 between the three parallel lumens of proximal region 15 and the two concentric lumens of distal region 18 . transition region 20 provides for communication between common lumen 60 of the distal region and both guidewire lumen 25 and work element lumen 23 of the proximal region . also , distal balloon inflation lumen 62 is placed in communication with proximal balloon inflation lumen 27 through balloon inflation lumen connection 70 , which is formed by cutting through the exterior of proximal region 15 to expose a portion of the proximal balloon inflation lumen to close it off from common lumen 60 . thus , a continuous inflation path exists from balloon inflation port 32 , through proximal and distal balloon inflation lumens 27 and 62 , and into balloon 65 . injection of fluid into balloon inflation port 32 will thereby result in inflation of balloon 65 . it is contemplated that the catheter depicted in fig1 will be used as follows . first , a conventional guidewire will be advanced into the patient &# 39 ; s vascular system until it lies within the region of stenosis . next , the guidewire will be inserted into distal tip 77 ( fig1 ) of the catheter and through common lumen 60 of distal region 18 . the catheter will then be advanced into the patient &# 39 ; s body over the guidewire until the guidewire reaches transition region 20 . at this point , the guidewire will be directed into guidewire lumen 25 and through the proximal region until it exists the catheter through guidewire port 30 as the catheter is advanced further into the patient &# 39 ; s body . eventually , the catheter will be advanced to a point where common lumen 60 , balloon 65 , and prosthetic device 90 lie within the region of interest . the operator of the system can then grasp the guidewire at the end protruding from the guidewire port . the operator will pull the guidewire back a short distance into guidewire lumen 25 of proximal region 15 in order to clear common lumen 60 of distal region 18 . a work element 75 , which will typically be an ultrasonic imaging transducer , fixed to the distal end of drive shaft 45 , may then be advanced through work element lumen 23 of the proximal region and into the common lumen of the distal region . imaging of the region of interest may then take place to ensure that the prosthesis is positioned away from any branching segments of the blood vessel and is anchored on both sides in contact with healthy tissue . following imaging , the prosthesis is expanded in the region of interest by inflating the balloon to a desired diameter . alternatively , where a self - expanding prosthesis is employed , no balloon inflation is needed to expand the prosthesis . after the prosthesis has been expanded , the region of interest may be imaged again to verify that optimal positioning of the prosthesis has occurred and to determine the diameter of expansion achieved by the prosthesis . the prosthesis may then be further expanded if desired , or a second prosthesis having a larger expanded diameter may be installed within the first prosthesis . when proper diameter and positioning of the prosthesis has been achieved , the balloon , if used , is deflated , and the catheter is removed from the region of interest . [ 0058 ] fig1 depicts a catheter in which the common lumen is narrowed at a restriction 80 just proximal to the balloon . distal of the restriction , the common lumen will be just large enough to allow passage of the guidewire . this allows the balloon crossing profile , the width of the catheter in the region of the balloon when not inflated , to be as small as possible . this is advantageous in that it allows the balloon to be advanced into narrow and tortuous regions of the blood vessel . placing the restriction proximal to the balloon is disadvantageous , however , in that it may prevent entry of the work element into the common lumen within the balloon . thus , some repositioning of the catheter body within the blood vessel , i . e ., advancement of the catheter body further into the blood vessel , may be necessary to allow for imaging of the treated region . [ 0059 ] fig4 depicts the distal region of an alternative preferred embodiment in which the common lumen is not restricted in the region proximal to the balloon and the prosthesis . in this embodiment , the work element may travel through the common lumen into , through , and beyond the balloon . this is advantageous in that it allows for imaging of the blood vessel throughout the region of the prosthesis without repositioning the catheter body . as discussed above , it is desirable at present to have the guidewire in place within the common lumen during balloon inflation in case rapid withdrawal of the catheter over the guidewire becomes necessary . however , future developments in interventional devices and techniques may make this unnecessary . if this becomes the case , imaging will be possible from within the balloon even while the balloon is being inflated . of course , an increased diameter common lumen within the balloon requires a slightly larger balloon crossing profile . some ability to enter narrow regions must thereby be sacrificed in order to achieve a more flexible imaging capability . the embodiment of fig4 depicts the common lumen having restriction 80 at some distance distal to balloon 65 . this restriction will prevent the accidental exit of the work element from the distal tip 77 of the catheter body while still allowing passage of the guidewire . this prevents injury to the blood vessel wall , which might result from accidental contact by the rotating work element . in order to further safeguard against trauma to the blood vessel , distal region 60 and distal tip 77 are preferably constructed of a material which is highly atraumatic ; a material which is extremely soft and flexible so that the catheter can be repositioned in the vessel without using a guidewire and without harm to the vessel . a catheter according to the present invention could also be made to carry an interventional work element such as a rotating cutter or a laser ablation device . in such a case , it would be necessary for the work element to advance beyond the distal tip 77 of the catheter body . in such a catheter system , restriction 80 would be omitted altogether to allow for unhindered passage of the work element . [ 0063 ] fig5 depicts the proximal and distal regions of an alternative preferred embodiment which does not require an angioplasty balloon for expansion of the prosthetic device . this embodiment shares certain components with the catheter depicted in fig1 and those common aspects share the same numerals with this earlier - described catheter . the prosthetic device 90 is a self - expanding stent which is disposed on the distal region of the catheter body 12 . the stent is held in close radial proximity to the catheter body by a sheath 91 which covers the stent at the distal region of the catheter . in this embodiment , the stent 90 is disposed between the catheter body 12 and the sheath 91 . the sheath 91 extends to the proximal region of the catheter body to provide a proximal region 92 of the sheath which allows the sheath to be withdrawn proximally to release the prosthetic device at the region of interest . [ 0064 ] fig6 depicts the distal region of another alternative embodiment which does include an angioplasty balloon . this embodiment shares certain components with the catheter depicted in fig4 and those common aspects share the same numerals with this earlier - described catheter . this catheter includes inflation port 101 , guidewire lumen wall 102 , and guidewire / ultrasound lumen 103 within catheter body 100 . the catheter is provided with a short atraumatic region 104 extending beyond the angioplasty balloon 65 . fig6 a is a cross - sectional view of the proximal region of catheter body 100 through section line a - a . the proximal region has two lumens : one for inflation and one for a guidewire or ultrasound imaging device . a prosthetic device ( not shown ) is disposed about the angioplasty balloon 65 as shown in fig1 and 4 ,. in use , the catheter requires that the positioning guidewire be completely withdrawn from the lumen before an imaging device can be inserted therein for the purpose of imaging the prosthesis within a body passageway to determine whether it is positioned longitudinally within an optimal region . [ 0065 ] fig7 depicts the distal region of another alternative embodiment which also includes an angioplasty balloon . fig7 a is a cross - sectional view of the proximal region of the catheter body 100 through section line a - a . the proximal region includes separate lumens 105 and 106 for receiving a guidewire and an ultrasound imaging core . the distal region includes a common lumen 107 , the proximal end of which includes a transition region which is in communication with both lumens 105 and 106 . the common lumen 107 can alternately receive a guidewire or an imaging core . a prosthetic device ( not shown ) is disposed about the angioplasty balloon as shown in fig1 and 4 . in use , the catheter is positioned over a guidewire extending through the guidewire lumen and the common lumen . the guidewire is then withdrawn proximal beyond the transition region , and is housed in the guidewire lumen , leaving the common lumen open to receive an imaging core . the imaging core is then advanced into the common lumen and used to position the prosthesis within the body passageway . [ 0066 ] fig8 depicts the distal region of another alternative embodiment which shares many components with fig7 and these common aspects share the same numerals . fig8 a is a cross - sectional view of the proximal region of the catheter body 100 through section line a - a . inflation lumen 101 is in communication with balloon 65 through pore 110 . wire lumen 105 and ultrasound lumen 106 merge into common lumen 107 at the distal region of the catheter . the catheter of fig8 has a short common lumen 107 . this catheter allows for exchange of the imaging core for the guidewire with only minimal withdrawal of the guidewire . a prosthetic device ( not shown ) is disposed about the angioplasty balloon as shown in fig1 and 4 . [ 0067 ] fig9 depicts the distal region of another alternative embodiment which shares many components with fig8 and these common aspects share the same numerals . fig9 a is a cross - sectional view of the proximal region of the catheter body 100 through section line a - a , while fig9 b is a cross - sectional view of the distal region of the catheter beyond the balloon 65 through section line b - b . in this embodiment , the guidewire lumen 105 and the ultrasound lumen 106 extend as separate lumens through the entire distal end of the catheter . there is no transition region and no common lumen . the guidewire lumen may extend proximally to the proximal end of the catheter . alternatively , the guidewire lumen may terminate in the distal region of the catheter or just proximal thereto so as to include a monorail design as disclosed by yock , u . s . pat . no . 5 , 350 , 395 , which is expressly incorporated herein by reference . in use , this catheter allows positioning over a guidewire , followed by imaging of a prosthesis ( not shown ) without repositioning or withdrawing the guidewire . accordingly , the guidewire can be left in place in the guidewire lumen while imaging takes place in the ultrasound lumen . image artifacts may be observed when such use is undertaken , but can be eliminated by withdrawing the guidewire a small distance during imaging . the ultrasonic transducer device for use with catheters herein include removable imaging cores as disclosed in crowley et al ., u . s . pat . no . 4 , 951 , 677 , griffith et al ., u . s . pat . no . 5 , 115 , 814 , and sieben , u . s . pat . no . 5 , 353 , 798 , all of which are expressly incorporated herein by reference . the imaging devices also may include non - removable imaging cores as disclosed by sieben et al ., u . s . pat . no . 5 , 243 , 988 , incorporated herein by reference , which include an intravascular imaging device having an ultrasonic sensor located at a distal end of an intravascular wire sized and adapted to be located within the guidewire lumen of conventional catheters used for intravascular procedures . as such , the imaging cores have several significant advantages . for example , the imaging core can utilize the path provided by the guidewire lumen of a conventional catheter to image at the arterial location to which the catheter is advanced . moreover , in several embodiments , the imaging core may be provided with conventional guidewire features , e . g ., a floppy spring tip , to enable the imaging guidewire to be used as both a conventional guidewire for positioning an intravascular catheter as well as imaging features , e . g ., a sensor , to enable imaging the intravascular regions accessible thereby . in order to be utilized in the above - described manner , an embodiment of the imaging core 120 is provided , as shown in fig1 . the imaging core 120 includes a tip section 122 , a sensor section 124 , a drive cable section 126 , and a proximal connector section 128 . as mentioned above , an essential requirement for the imaging core is that it possess an outer profile of a size that allows it to fit through a guidewire lumen in conventional interventional catheters . in catheters that use 0 . 018 inch guidewires , the guidewire lumen has a diameter typically in a range between 0 . 020 and 0 . 022 inches . the diameter of the proximal section 128 of the imaging core 120 may be as large as 0 . 020 inches , but the rest of the imaging core should be not more than approximately 0 . 018 inches . for use with catheters designed with guidewire lumens of other sizes , relative adjustments in dimension apply . the catheters and methods disclosed herein are particularly well adapted for treatment of vascular stenosis positioned in close proximity to a branching segment of a blood vessel as depicted in fig1 . in use , the catheter is positioned over a guidewire as shown in fig1 in the region of a body passageway having a stenosis . with the aid of ultrasound imaging through lumen 60 which extends through the prosthetic device , the prosthesis is positioned to cover the stenosis but to avoid the branching segment of the vessel . the prosthetic device is then expanded in the region of interest as shown in fig1 . the stent is left in place while the catheter is removed from the region of interest . the stent holds the lumen at an expanded diameter . although the foregoing invention has , for purposes of clarity of understanding , been described in some detail by way of illustration and example , it will be obvious that certain changes and modifications may be practiced which will still fall within the scope of the appended claims . | 8 |
the present invention provides a stacked capacitor with a very high area per unit volume . capacitors utilizing a number of stacked thin layers of conductors , or fins , have previously been formed . however , reports indicate that very long and thin fins tend to deform , and the fins can bend appreciably , so as to touch one another . thus , up till now , fin thickness needed to be significantly more than required for adequate conductivity ; fin thickness needed to be sufficient to also provide for mechanical support during the process step when fins were defined and before they were otherwise supported by later inserted layers . the present invention provides support for fins , enabling each fin to be extremely thin . support is provided exploiting rough silicon to provide subminimum dimension columns . while , as noted in the background , rough silicon has previously been used to increase the surface area of a capacitor fin , in the present invention it is exploited both to increase surface area and to provide needed support for very thin fins . in brief , subminimum dimension trenches are etched through layers of alternately doped p - and p + polysilicon , and these trenches are lined with a thin layer of p + polysilicon . when p - doped layers are removed , p + polysilicon hollow columns are left in many locations supporting and electrically interconnecting all the p + fins remaining in the structure . because they are supported in many locations , the p + fins can be deposited significantly thinner than was previously possible without the risk of bending . in addition to providing support for the fins , the subminimum dimension columns also themselves participate in the area of the capacitor , so the support columns do not significantly reduce capacitance per unit volume . a practical fin thickness is presented in an article &# 34 ; fabrication of 64m dram with i - line phase shift lithography ,&# 34 ; by k . nakagawa et al ., published in proceedings of the iedm , 1990 , p . 817 . the sem cross section in fig8 therein shows fins approximately 0 . 1 μm thick and protruding a length of about 0 . 5 μm from their central support post . if mechanical support could be found so as to avoid fin bending , a fin further thinned by a factor of 5 or 10 would provide equivalent capacitance , while significantly reducing stack height . or many more fins could be added with the same stack height significantly increasing capacitance . if the approximately 1 : 5 ratio of fin thickness to fin length illustrated in the nakagawa paper is about equal to the mechanical limit needed to avoid bending or breaking , then a fin 0 . 02 μm thick would require support every 0 . 1 μm . since , 0 . 1 μm is well below present practical lithographic resolution limits , a subminimum dimension support system is needed . the present applicant has found that the rough silicon used to enhance capacitor surface area in the &# 39 ; 503 patent can also be used to provide subminimum dimension supports for capacitor fins . the process for forming capacitors of the present invention is illustrated in fig1 - 9 . referring to fig1 there is shown a substrate 10 which may be of any desired material , but is preferably a semiconductor , which may be monocrystalline or polycrystalline . previous process steps may have been performed on substrate 10 to provide diffusions , transistors , interconnects , and insulators . for example , portions of dram cells including transistors , wordlines , and bitlines may be formed in substrate 10 as is well known in the art of stacked capacitors . substrate 10 can have insulating layer 11 deposited thereon , and a contact to node diffusion 34 of the dram cell can be provided through insulator 11 ( see fig8 ). a stack 12 of alternating thin layers 12a and 12b are deposited , such as alternately p + and p - doped polysilicon layers or alternately n + doped polysilicon and silicon nitride layers . preferably , the lowest layer is a heavily doped polysilicon layer to simplify contact with circuitry below . also preferably , heavily doped layers 12a have the same doping type as node diffusion 34 ( fig8 ). of course , an intermediate layer or contact stud can be used between node diffusion 34 and the lowest layer of stack 12 . for example , if a titanium nitride stud is used for contact through insulating layer 11 , then the node diffusion and fins can be of opposite doping type . a process such as described in the &# 39 ; 503 patent , incorporated herein by reference , is then followed to provide irregular surface grains 14 on topmost layer 12t . for example , as shown in fig1 an irregular surface is formed by depositing polysilicon hemispherical shaped grains having a diameter of about 800 angstrom units or having dimensions of about 20 to 1000 angstrom units . next , a rough silicon mask is formed around grains 14 by depositing masking layer 16 ( fig2 ) and then selectively etching back masking layer 16 to expose top portions of grains 14 ( fig3 ). remaining portions of masking layer 16 are left to provide mask 18 used during the next step . masking material 16 is formed of a material such as silicon dioxide that has different etch properties than grains 14 . then , as shown in fig4 exposed portions of grains 14 are selectively etched , leaving mask 18 substantially intact , to form subminimum dimension trenches 20 in grains 14 and in stack 12 , stopping on substrate 10 , insulating layer 11 , or within the lowest layer of stack 12 . in the next step , shown in fig5 mask 18 is stripped . then , heavily doped polysilicon layer 22 is deposited along all surfaces , partially filling trenches 20 . polysilicon layer 22 has the same doping as heavily doped layer 12a of stack 12 . the stacked capacitor defining mask is then printed , and stack 12 is rie etched leaving individual stacks 24 , as shown in fig6 . each stack 24 thereby formed has p + polysilicon layer 22 on top layer 12t and within trenches 20 , but edges of alternating thin layers 12a and 12b are exposed on sidewalls 26 of each stack 24 ( fig6 a ) since individual stacks are formed only after polysilicon layer 22 is deposited . as shown in fig7 and fig9 starting from exposed sidewalls 26 , fins are then formed in a selective etch that removes layers 12b leaving layers 12a to serve as fins of a storage node of the stacked capacitor . the etchant penetrates around trenches 20 ( indicated by the arrow in fig9 ) to remove all accessible portions of layers 12b . heavily doped layers 12a of stack 12 are now supported only by columns of commonly and heavily doped layer 22 lining trenches 20 . selective etchants that attack p - silicon but leave p + silicon are well known and include koh . selective etchants that attack silicon nitride but leave n + silicon include hot phosphoric acid . as shown in fig8 capacitors are completed by the conformal formation of capacitor dielectric layer 30 , such as silicon dioxide , silicon nitride , tantalum pentoxide , or combinations thereof for simplicity in fig8 capacitor dielectric layer 30 is shown as a single line and the distinction between p + layer 22 and the p + fins ( layers 12a ) is eliminated . capacitor dielectric layer 30 is formed by thermal or deposition means as is well known in the art . a layer of conductive material , such as doped polysilicon , is then deposited to form conductive plate 32 . plate 32 not only fills the spaces left by etched out layer 12b and remaining space within trenches 20 , it also connects between capacitor stacks 12 to form a common capacitor electrode for an array . conductive plate 34 is formed by deposition using well known techniques and is formed of a material such as doped polysilicon or a metal . while several embodiments of the invention , together with modifications thereof , have been described in detail herein and illustrated in the accompanying drawings , it will be evident that various further modifications are possible without departing from the scope of the invention . for example , while polysilicon grains are preferred , other materials are capable of providing subminimum dimension structures . nothing in the above specification is intended to limit the invention more narrowly than the appended claims . the examples given are intended only to be illustrative rather than exclusive . | 8 |
fig1 a - 1c are cross section of fibers having three different types of a core / sheath structure according to the invention . as shown , fibers of a core / sheath structure consist basically of a core 1 that is surrounded by a sheath 2 ; the core 1 and the sheath 2 may be concentric ( fig1 a ) or eccentric ( fig1 b ); alternatively , the sheath 2 forming the sea or matrix may be interspersed with cores 1 forming islands ( fig1 c ). in fibers having these core / sheath structures , the sheath is preferably formed of a material which is capable of generating radicals upon exposure to ionizing radiation , whereas the core is preferably formed of a material that is less prone to the generation of radicals and / or the degradation of high - polymer upon exposure to an ionizing radiation . additionally , the core material has preferably a higher melting point than the sheath material because fibers of a core / sheath structure can be processed into a nonwoven fabric by thermal fusion . since the individual fibers are fused at their sheaths , the generation of particles such as fiber fragments is the least prone to occur . this is a very important characteristic for the treatments of water and air that are to be employed in precision electronics industry , nuclear power generation and other industrial sectors in which the present invention is to be employed . specifically , the sheath is preferably made of polyolefinic materials because it must be formed of materials that are suitable for radiation - initiated graft polymerization . suitable examples include polyolefins typified by polyethylene and polypropylene , halogenated polyolefins typified by polyvinyl chloride and polytetra - fluoroethylene ( ptfe ), copolymers of olefins and halogenated polyolefins typified by an ethylene - tetrafluoroethylene copolymer , and copolymers of olefins and other monomers such as an ethylene - vinyl alcohol or ethylene - vinyl acetate copolymer ( evoh or eva ). polyethylene is particularly advantageous for use as the sheath component of ion - exchange fibers . the core material may be selected from among materials that differ from the selected sheath material , and it is preferably such that the fiber strength can be maintained even after radiation - initiated graft polymerization on the core . while polyolefin core materials can be used , particularly suitable core materials are polyesters typified by polyethylene terephthalate and polybutylene terephthalate . exemplary combinations of core and sheath materials include polyethylene ( sheath )/ polypropylene ( core ) and polyethylene ( sheath )/ polyethylene terephthalate ( core ), with the latter combination , although not limited thereto , being particularly preferred since it assures high radiation resistance . fibers having a core / sheath structure have preferably a sheath to core weight ratio in the range from 0 . 1 to 10 . if the sheath to core weight ratio is less than 0 . 1 , the graft ratio of the sheath must be increased to a very high level in order to ensure an adequate amount of functional groups , but then the fiber strength is so much reduced that it is no longer possible to maintain the core / sheath structure of the fiber . if the sheath to core weight ratio exceeds 10 , the fiber is practically of a single structure in that it is essentially composed of the sheath and there is no merit in adopting the core / sheath structure . when the sheath of a fiber having a core / sheath structure is subjected to graft polymerization , the dimension of the sheath increases causing it to separate from the core ( see fig7 ). before grafting , there is no gap between the core and the sheath but after graft polymerization , a gap forms between the core and the sheath , causing creases to develop in the sheath . after the introduction of functional groups , the gap widens further and the creases will expand . fig8 - 11 are electron micrographs showing in cross section a plurality of composite fibers each consisting of a polyethylene terephthalate ( pet ) core and a polyethylene ( pe ) sheath before grafting ( fig8 ), after grafting ca . 116 % of glycidyl methacrylate ( fig9 ), followed by sulfonation ( fig1 ) or amination ( fig1 ). after grafting , the sheath has many nodes present , which is in sharp contrast with the smooth surface that was observed before grafting . with the presence of many undulations on its surface , the sheath has an increased surface area , which is not only preferred for the purpose of improving the rate of adsorptive separation but also instrumental to the enhanced effectiveness in physical trapping of fine particles . it should be added that the separation between the core and the sheath helps enhance the ability of the fibers , taken as a whole , to retain water . this property is advantageously utilized to prevent performance deterioration due to drying when the separation functional fibers of the invention , in particular , ion - exchange fibers prepared therefrom are assembled into an air filter that is used to remove deleterious gases such as acidic and alkaline gases . grafting to the sheath will somewhat deteriorate its physical strength but the overall strength of the fiber is maintained by the core . the fibers having a core / sheath structure may be long or short fibers . the invention is also applicable to woven or nonwoven fabrics which are fiber assemblies , as well as to articles prepared by processing such woven or nonwoven fabrics . the substrate , or fibers having a core / sheath structure , may be subjected to radiation - initiated graft polymerization in the following manner . in the first plate , various sources of radiation may be employed , such as α - rays , β - rays , γ - rays , electron beams , x - rays and ultraviolet rays , with γ - rays and electron beams being particularly suitable for the purposes of the invention . the preferred radiation dose is from 20 to 300 kgy . below 20 kgy , radicals will not be generated in a sufficient amount to initiate the intended reaction . above 300 kgy , the intensity of radiation deterioration increases and the cost of irradiation will also increase . a method of graft polymerization in which the substrate that has been given pre - exposure of a radiation is brought into contact with a polymerizable monomer is commonly referred to as &# 34 ; pre - irradiation graft polymerization &# 34 ;. compared to &# 34 ; simultaneous irradiation &# 34 ; in which the substrate is exposed to a radiation in the presence of a monomer , pre - irradiation graft polymerization produces a smaller amount of copolymer and , hence , is suitable for use in the manufacture of separation functional fibers of the type contemplated by the invention . a process in which an irradiated substrate is subjected to graft polymerization as it is immersed in a monomer solution is commonly referred to as &# 34 ; liquid - phase graft polymerization &# 34 ; and may suitably be performed at a reaction temperature of 20 °- 60 ° c . for a reaction time of 2 - 10 h . impregnation graft polymerization is a process in which an irradiated substrate is impregnated with a pre - determined amount of monomer and allowed to react either in vacuum or in an inert gas ; this process is suitably performed at a reaction temperature of 20 °- 60 ° c . for a reaction time of 0 . 2 - 8 h . after graft polymerization by this process , the substrate is in a dry state and this offers several advantage such as ease in handling the substrate and reduced emission of liquid wastes . vapor - phase graft polymerization which involves contact between an irradiated substrate and a monomer vapor is only applicable to monomers having comparatively high vapor pressures and uneven grafting is prone to occur ; on the other hand , it offers several advantages such as reduced emission of liquid wastes and the availability of a dry substrate as obtained by graft polymerization . when vapor - phase graft polymerization is to be performed , a reaction temperature of 20 °- 80 ° c . and a reaction time of 2 - 10 h are required . any one of these radiation - initiated graft polymerization processes is applicable in the present invention . polymerizable monomers may be ones having various functions in themselves or those which can be provided with certain functions by a secondary reaction after grafting . take , for example , the case of ion - exchange fibers : exemplary monomer having ion - exchange groups include acrylic acid , methacrylic acid , sodium styrenesulfonate , sodium methallylsulfonate and sodium allylsulfonate and these need only to be subjected to graft polymerization to produce ion - exchange fibers . examples of the monomers into which ion - exchange groups can be introduced by carrying out a further reaction after graft polymerization include acrylonitrile , acrolein , vinylpyridine , styrene , chloromethylstyrene and glycidyl methacrylate . to take styrene graft polymers as an example , sulfonic groups can be introduced into these polymers by means of sulfonating chemicals such as chlorosulfonic acid and sulfuric acid . while the foregoing description assumes that the process of the present invention for producing separation functional fibers is mainly applicable to ion - exchange fibers , it should be noted that the invention is also applicable to other products including heavy metal adsorbents having chelate groups , catalysts and affinity chromatographic carriers . the following examples are provided for the purpose of further illustrating the present invention but are in no way to be taken as limiting . a nonwoven fabric ( areal density , 50 g / m 2 ) formed of composite fibers ( av . dia . 20 μm ) consisting of a polypropylene core and a polyethylene sheath ( core - to - sheath weight ratio = 1 ) was irradiated with 200 kgy of γ - rays in a nitrogen atmosphere and dipped in an aqueous solution of 50 % acrylic acid . by 6 - h reaction at 40 ° c ., grafting was accomplished to 53 %. the thus treated fibers had an ion - exchange capacity of 4 . 8 meq / g . the fibers were converted to an na form with sodium hydroxide and examined for their cross section with an x - ray microanalyzer ; sodium was found to be distributed only in the polyethylene sheath . the nonwoven fabric ( h form ) was punched to a disk with a diameter of 20 mm and 0 . 4 g of the fabric was packed in a glass column in the experimental gas adsorption setup shown in fig2 . a test for removing ammonia gas was conducted as it was circulated at a rate of 3 l / min . shown by 3 in fig2 was a fluorine resin bag ( 40 l ); 4 was the glass column ( 20 mmφ ) packed with the nonwoven fabric 5 ; 6 was a pump ; 7 , 8 and 9 were each a sampling analyzing portion ; and 10 was a flowmeter . the test results are shown in fig3 by a curve connecting open circles ( o ). as one can see from fig3 the nonwoven fabric formed of the fibers of the invention insured that the ammonia concentration in the bag 3 which was initially at 40 ppm was reduced to 10 ppm or less in about 50 min and to 5 ppm or less after the lapse of 2 h . a nonwoven fabric ( areal density , 40 g / m 2 ) solely consisting of polypropylene fibers ( 20 μm in av . dia .) was subjected to radiation - initiated graft polymerization with acrylic acid as in example 1 until the graft ratio was 58 %. the thus treated fibers had an ion - exchange capacity of 5 . 0 meq / g , with the ion - exchange groups being distributed fairly uniformly across the diameter of each fiber . the nonwoven fabric was punched to a disk as in example 1 and subjected to a test for the removal of ammonia gas on an experimental setup of the type shown in fig2 . the results are shown in fig3 by a curve connecting open triangles ( δ ). obviously , it took one hour and fifty minutes for the ammonia concentration in the fluorine resin bag to decrease to 10 ppm and below . a nonwoven fabric ( areal density , 40 g / m 2 ) formed of composite fibers ( av . dia . 20 μm ) consisting of a polypropylene core and a polyethylene sheath ( core - to - sheath weight ratio = 1 ) was irradiated with 200 kgy of γ - rays in a nitrogen atmosphere and dipped in a glycidyl methacrylate / methanol ( 1 / 1 ) solution . by 7 - h reaction at 45 ° c ., grafting was accomplished to 138 %. after the grafting , the fibers were dipped in an aqueous solution of sodium sulfite and sulfonation was conducted by 8 - h reaction at 80 ° c . thus , strong acidic cation - exchange fibers were obtained ; they had an ion - exchange capacity of 2 . 42 meq / g , with almost all sulfonic groups being distributed in the sheath . the nonwoven fabric ( h form ) was punched to a disk with a diameter of 20 mm and subjected to a test for the removal of ammonia gas under the same conditions as described in example 1 using an experimental setup of the same type as shown in fig2 . the results are shown in fig4 by a curve connecting open circles ( o ). as one can see from fig4 the ammonia concentration in the fluorine resin bag which was initially at 40 ppm dropped to 10 ppm or less within 20 min . a nonwoven fabric ( areal density , 40 g / m 2 ) solely consisting of polypropylene fibers ( 20 μm in av . dia .) was subjected to radiation - initiated graft polymerization with glycidyl methacrylate as in example 2 until the graft ratio was 135 %. by subsequent sulfonation as in example 2 , strong acidic cation - exchange fibers were obtained . they had an ion - exchange capacity of 2 . 45 meq / g , with the sulfonic groups being distributed fairly uniformly across the diameter of each fiber . the nonwoven fabric was punched to a disk as in example 2 and subjected to a test for the removal of ammonia gas on an experimental setup of the type shown in fig2 . the results are shown in fig4 by a curve connecting open triangles ( δ ). obviously , it took 35 min for the ammonia concentration in the fluorine resin bag to decrease to 10 ppm and below . in example 1 and comparative example 1 , the type of functional group was identical and the graft ratio and the ion - exchange capacity were substantially the same and this is also true in the case of example 2 and comparative example 2 . however , the fibers having a coresheath structure in accordance with the invention obviously exhibited better performance in the removal of ammonia gas . a nonwoven fabric ( areal density , 55 g / m 2 ) formed of composite fibers ( av . dia . 20 μm ) consisting of a polyethylene terephthalate core concentric with a polyethylene sheath ( core - to - sheath weight ratio = 0 . 7 ) was irradiated with 100 kgy of electron beams in a nitrogen atmosphere and subjected reaction with glycidyl methacrylate as in example 2 to achieve a graft ratio of 116 %. the thus treated nonwoven fabric was dipped in an ethylenediamine solution and subjected to reaction for 3 h at 50 ° c . ; the nonwoven fabric now having chelate groups was capable of acid adsorption in an amount of 5 . 3 meq / g , with almost all chelate groups being distributed in the sheath . the nonwoven fabric was then punched to a disk with a diameter of 20 mm and sampled in an amount of 0 . 5 g . the sampled portion was dipped in 300 ml of an aqueous solution of copper sulfate ( 110 mg / l as cu ) and the change in the cu concentration was investigated over time under stirring . the results are shown in fig5 by a curve connecting open circles ( o ). obviously , the cu concentration dropped to 20 mg / l as cu in one minute . fig8 is an electron micrograph showing a cross section of the composite fibers used in example 3 to form the substrate membrane . after grafting , the fibers became as shown in fig9 and , after amination with the solution of ethylenediamine , the fibers became as shown in fig1 with the sheath , at least partly separated from the core , assuming a wrinkled and non - circular cross - sectional shape . a nonwoven fabric ( areal density , 60 g / m 2 ) solely consisting of polyethylene fibers ( 20 μm in av . dia .) was subjected to electron beam exposure under the same conditions as in example 3 . the non - woven fabric was then reacted with glycidyl methacrylate to achieve a graft ratio of 131 %. by subsequent reaction with ethylenediamine under the same conditions , one obtained a nonwoven fabric having chelate groups that was capable of acid adsorption in an amount of 5 . 19 mg / g ; the chelate groups were distributed uniformly along the radius of each fiber toward the center . the nonwoven fabric was then punched to a disk with a diameter of 20 mm as in example 3 and dipped in a solution of copper sulfate . the change in cu concentration was investigated over time . the results are shown in fig5 by a curve connecting open triangles ( δ ). obviously , the cu concentration dropped to ca . 40 mg / l as cu in one minute . in example 3 and comparative example 3 , the graft ratio and the concentration of radical groups were almost the same and yet the fibers having a core - sheath structure in accordance with the invention obviously exhibited better performance in adsorbing heavy metals . ( a ) a nonwoven fabric ( areal density , 50 g / m 2 ) formed of fibers ( dia . ca . 17 μm ) consisting of a polyethylene ( pe ) sheath concentric with a polypropylene ( pp ) core was irradiated with γ - rays in a nitrogen atmosphere and subjected to graft polymerization with glycidyl methacrylate until the graft ratio was 153 %. the nonwoven fabric was then dipped in a sulfonating solution consisting of 8 % sodium sulfite , 12 % isopropyl alcohol and 80 % h 2 o , and subjected to a sulfonation reaction at 80 ° c . for 8 h . additionally , the fabric was dipped in 7 % hcl for conversion to a h form . the fibers thus produced were designated ( a ) pe / pp . ( b ) in a separate step , a nonwoven fabric ( areal density , 50 g / m 2 ) formed of fibers ( ca . 17 μm in dia .) consisting of a polyethylene sheath concentric with a polyethylene terephthalate ( pet ) core was subjected to graft polymerization , sulfonation and regeneration in the same manner as described in ( a ). the fibers thus produced were designated ( b ) pe / pet . fig1 is an electron micrograph showing a cross section of the fibers . the nonwoven fabrics using two fibers , ( a ) pe / pp and ( b ) pe / pet , had tensile strength vs radiation dose profiles as shown in fig6 . the data for the fiber ( b ) are indicated by a curve connecting open triangles ( δ ) whereas the data for the fiber ( a ) are indicated by a curve connecting open circles ( o ). obviously , the tensile strength of the nonwoven fabric made from fiber ( b ) pe / pet did not decreased with the increasing dose of irradiation . in the next stage , tests were conducted in order to verify the release of the products of decomposition due to the chemical deterioration of fibers . it is generally difficult , even with ion exchangers based on synthetic high polymers , to avoid the oxidative deterioration of the polymer backbone chain and the subsequent formation of low - molecular weight decomposition products and elimination of functional groups and , hence , it is more desirable to develop ion exchangers having satisfactorily high resistance to these instances of chemical deterioration . with a view to evaluating the releasability of the products of decomposition due to deterioration , the nonwoven fabric formed of fiber ( a ) pe / pp and that formed from fiber ( b ) pe / pet ( each fabric measuring 20 cm × 4 cm ) were placed in separate containers in respective amounts of ca . 200 g ; air was circulated through the containers at a rate of 1 l / min ; the decomposition products in the discharged air were trapped in ultrapure water and analyzed . for evaluation of the organic , low - molecular weight decomposition products , toc measurement was conducted . for evaluation of the releasability of ion - exchange groups , the concentration of sulfate ions was measured by ion chromatography . the results of the measurements are shown in table 1 below . table 1______________________________________gasreleased so . sub . 4 . sup .- 2 tocfiber 25 ° c . 65 ° c . 25 ° c . 65 ° c . ______________________________________ ( a ) pe / pp & lt ; 2 μg / h - kg 96 μg / h - kg & lt ; 5 μg / h - kg 1200 μg / h - kg ( b ) pe / pet & lt ; 2 μg / h - kg 5 μg / h - kg & lt ; 5 μg / h - kg 320 μg / h - kg______________________________________ ( the release is expressed as the amount of 1 - h release per kg of the nonwoven fabric .) a nonwoven fabric of the same kind as used in example 1 was irradiated with 200 kgy of γ - rays in a nitrogen atmosphere and dipped in a solution of glycidyl methacrylate until 150 % of the substrate was impregnated with the solution . the nonwoven fabric was then put into a glass ampule , which was evacuated with a vacuum pump . thereafter , the fabric was subjected to reaction at 45 ° c . for 3 h until a graft ratio of 141 % was achieved . the thus treated nonwoven fabric was dipped in an aqueous solution of 30 % iminodiethanol and subjected to reaction at 70 ° c . for 3 h , yielding a weak basic , anion - exchange nonwoven fabric having an ion - exchange capacity of 2 . 89 meq / g . the fabric was then punched to a disk with a diameter of 20 mm and subjected to a test for removing sulfur dioxide ( so 2 ) by means of an experimental setup of the type used in example 1 . the concentration of so 2 in the fluorine resin bag was initially 30 ppm but dropped to 1 ppm and less in 40 min . a nonwoven fabric of the same kind as used in example 1 was irradiated with 200 kgy of γ - rays in a nitrogen atmosphere . thereafter , the fabric was dipped in a solution of chloromethylstyrene ( cms ) and subjected to reaction at 40 ° c . for 7 h until the cms graft ratio was 112 %. the fabric was then dipped in an aqueous solution of 10 % trimethylamine and subjected to reaction for forming a quaternary ammonium salt at 50 ° c . for 3 h . the thus treated nonwoven fabric was dipped in an aqueous solution of 5 % sodium hydroxide so that it was regenerated to an oh form , thereby yielding a strong basic , anion - exchange nonwoven fabric capable of decomposing neutral salts in a capacity of 2 . 38 mg / g . the fabric was then punched to a disk with a diameter of 20 mm , dried in vacuum and in a nitrogen atmosphere to ensure against contact with air , packed in an experimental setup of the same type as used in example 1 and subjected to a test for removing carbon dioxide ( co 2 ). the carbon dioxide in the fluorine resin bag was diluted to 130 ppm with pure air . just after the start of the test , the concentration of co 2 at the exit from the filter was 0 ppm and the co 2 concentration in the fluorine resin bag dropped to 1 ppm and below in 50 min . a nonwoven fabric of the same kind as used in example 6 was treated as in example 6 , packed in an experimental setup of the same type as used in example 1 and subjected to a test for removing hydrogen sulfide ( h 2 s ). the concentration of h 2 s in the fluorine resin bag was adjusted to 3 ppm with pure air . right after the start of the test , the concentration of h 2 s at the exit from the filter was 0 . 0 ppm and the h 2 s concentration in the fluorine resin bag which was initially at 3 ppm dropped to 1 ppm or below in about 30 min . a test was conducted to remove no 3 gas using a weak basic , anion - exchange nonwoven fabric of the same kind as employed in example 6 and an experimental setup of the same type as employed in example 1 . the concentration of no 2 in the fluorine resin bag was adjusted to 2 ppm with pure air . the no 3 concentration in the fluorine resin bag dropped to 0 . 5 ppm and below in 30 min after the start of the test . a test was conducted to remove hydrogen fluoride ( hf ) gas using a weak basic , anion - exchange nonwoven fabric of the same kind as employed in example 5 and an experimental setup of the same type as employed in example 1 . the concentration of hf in the fluorine resin bag was initially at 5 ppm and dropped to 1 ppm and below in 30 min after the start of the test . the hf concentration was 0 . 5 ppm or less at the exit from the filter . according to the invention , one could produce separation functional fibers that had functional groups introduced at high density on the surface , that would experience less physical and chemical deteriorations , and that were capable of retaining satisfactory strength . the fibers had such a high capacity for separation that they were capable of gas separation or separating heavy metals from liquids within short times ; hence , the fibers are useful in such applications as filters for removing gases and adsorbents of heavy metals . additionally , the fibers can be regenerated when used in ion - exchange applications . hence , they can be fabricated into an ion - exchange , gas removing filter that is regenerable with regenerants if all the components including the filter frame and the separator are made of materials that will not be attacked by regenerants . the foregoing description of the specific embodiments will so fully reveal the general nature of the invention that others can , by applying current knowledge , readily modify and / or adapt for various applications such specific embodiments without undue experimentation and without departing from the generic concept , and , therefore , such adaptations and modifications should and are intended to be comprehended within the meaning and range of equivalents of the disclosed embodiments . the means and materials for carrying out various disclosed functions may take a variety of alternative forms without departing from the invention . it is to be understood that the phraseology or terminology employed herein is for the purpose of description and not of limitation . | 1 |
as required , a detailed illustrative embodiment of the present invention is disclosed herein . however , techniques , systems , compositions and operating structures in accordance with the present invention may be embodied in a wide variety of sizes , shapes , forms and modes , some of which may be quite different from those in the disclosed embodiment . consequently , the specific structural and functional details disclosed herein are merely representative , yet in that regard , they are deemed to afford the best embodiment for purposes of disclosure and to provide a basis for the claims herein which define the scope of the present invention . reference will now be made in detail to embodiments of the invention . wherever possible , same or similar reference numerals are used in the drawings and the description to refer to the same or like parts or steps . the drawings are in simplified form and are not to precise scale . the word ‘ couple ’ and similar terms do not necessarily denote direct and immediate connections , but also include connections through intermediate elements or devices . for purposes of convenience and clarity only , directional ( up / down , etc .) or motional ( forward / back , etc .) terms may be used with respect to the drawings . these and similar directional terms should not be construed to limit the scope in any manner . it will also be understood that other embodiments may be utilized without departing from the scope of the present invention , and that the detailed description is not to be taken in a limiting sense , and that elements may be differently positioned , or otherwise noted as in the appended claims without requirements of the written description being required thereto . various operations may be described as multiple discrete operations in turn , in a manner that may be helpful in understanding embodiments of the present invention ; however , the order of description should not be construed to imply that these operations are order dependent . referring now to fig1 , the proposed system 100 includes an operable process control system and operable data tables 102 that is in communication with a delivery and supply system 101 for management of system 100 as will be discussed . as will be understood from the exemplary illustration an optional data communication loop is provided by illustrated arrows , but this will be understood by those of skill in the art to be operable over any known telecommunication process for receipt , manipulation , and delivery of information , and for tracking physical delivery of later described items . within system 100 there is provided a user - unit operable for receipt of a concentrate or supplement container 1 and a supply of a dilutant ( e . g ., water , coffee , tea , milk , carbonated beverages , any hot or cold fluid , or any other suitable fluid ) 2 , with operable power input access 3 ( at rear of unit ) and a control system 4 containing suitable controls for achieving the goals of the proposed system ( including but not limited to on / off , volume control , temp , control , mixing proportions , optional weight - stage for dispensing tracking etc .). both container 1 and dilutant 2 may be in multi - use , continuous , or single - use sizes . additionally noted is a dispensing station unit 5 for supporting a volume to receive a mixture of dilutant 1 and concentrate 2 under mixing conditions controlled by control system 4 . an individual tracking identification or bar code 6 is provided on each concentrate / supplement container 1 and there is positioned an associated reader 7 for receiving identification / use information from code 6 during an installation and use of container 1 . internal ( not shown ) to the location unit is an internal process controller unit 8 ( including suitable memory and processing units ) linked with an optional external communication control system 9 . as will be understood by those of skill in the system operational arts , during any use , system 100 will be able to track individual uses , dispensments , particular mixing proportions , total supplement delivery and other operations . additionally , in an optional embodiment , the end unit and communication control system 9 will be able to communicate externally to process control system and data tables 102 and with delivery supply system 101 , thereby permitting comprehensive benefit , use , and adaptation tracking for a user &# 39 ; s health benefit . additionally , system 100 will be able to optionally re - order , and operate commercial transactions on behalf of a user based upon designated user preferences . regarding process control system and data tables 102 , it will be understood that these include a comprehensive process control units to receive , track , organize , and select from informational data bases involving comprehensive user identifications , complete medical and query information and user goals , a complete selection with all parameters of dilutants and also all supplements , minerals , pharmaceuticals etc . that may be selected based upon user - parameters . referring now to fig2 wherein an operative and optional method of the proposed system is illustrated . in a first step 201 an initial determination is provided of user preferences and needs and includes ( in each step noted hereafter ) links with process and data control unit and system 102 containing operative communication links 102 a . such determination step may include questionnaires ( multiple ) following family history , health concerns , health history , desired outcomes ( weight loss , muscle gain , medical treatment support ( e . g ., diabetes , wound healing , cancer treatment support , etc . without limitations thereto ). following initial questionnaire and detail information for each individualized users an initial recommended user - unique supplement determination is made in a step 202 linked with a unique identification step 203 and via process and data control system 102 , a supplement concentrate product is created , packaged , and shipped in a combined step 204 to a user for installation in a device 205 . device system 100 recognizes the unique identification and conducts local controls and monitoring as discussed elsewhere through continuous use steps 206 for a designated period of time ( user determined , medically determined etc .) until a desire to conduct a secondary determination step 207 is reached . in step 207 a link with the unique identification is made via path 210 to process control 102 and the historic data is stored in data tables therewith . additional steps in a rebalancing step 208 are conducted that would include modifying the initial supplement determination step 202 and crafting a replacement or secondary supplement via a path 209 shown also linked with process control 102 . in this matter , during a rebalancing step a new individually identifiable supplement is packaged , shipped , delivered , linked with the system and dispensed therefrom . it will be recognized that this process of initial determination and later rebalancing may be repeated without limit so as to provide a continual trainable process unique to each user &# 39 ; s needs . further , it will be understood that the entire contents of the incorporated - by - reference u . s . pat . no . 7 , 762 , 181 is available to access for enabling content upon question by one of skill in the art . additionally , it will be understood that this application will incorporate the currently known highest skill in the communication , data management , shipping , user - identification and product - identification technologies in the art . thus , for a non - limiting example where data is “ sent ” or “ recorded ” this will be understood to incorporate all known ways ( wired , wireless , encrypted , open , random - access memory , bubble - memory , cloud - based etc .). for example , the current process control system and data tables could be cloud - based , or located on a proprietary enterprise type system with server modules . finally , it will be understood that the full health , medical , vitamin , pharmaceutical , and nutrition data available and is used to guide supplement or concentrate and dilutant determination . it will be understood that the phrase dilutant supply or dilutant may be any fluid material that is not the nutraceutical concentration , thereby allowing a dilution of the concentration during a use dispensment . the dilutant may be any suitable fluid for human consumption , and by way of non - limiting example the dilutant may be water or another combination of components ( e . g ., coffee , tea , milk , pharmaceutical combinations etc ., without limitation ). it will be understood that the phrase nutraceutical , indicates a portmanteau of the words “ nutrition ” and “ pharmaceutical ”, and as used herein is a food or food product that reportedly provides health and medical benefits , including the prevention and treatment of disease , and that this food or food product may be of any kind , but is preferably in the form of a fluid concentrate intended for combination with water prior to ingestion by an end user . nothing herein will limit the interpretation to requiring a pharmaceutical product . it will also be understood that nutraceutical may additionally include those compounds , vitamins , flavorings , minerals , drugs , or pharmaceutical compositions ( without limit to any ) that are believed to have a physiological benefit or provide protection against chronic disease . with recent developments in cellular - level nutraceutical agents the proposed use will be understood as non - limiting and is to be broadly interpreted to include any complementary and alternative therapies now known or later developed . turning next to fig3 a - c and 4 a - 4 b , shown are the portable mixing system with safety controls according to the preferred embodiment of the present invention with the system in the raised or open position ( fig3 a - c ) and in the lowered or closed position ( fig4 a - b ). preferably , the system comprises a housing body 318 having a pod or container receiving portion 312 with a slip resistant bottom surface 310 . alternatively , bottom surface 310 may be a type of key - in surface to lock or otherwise secure the pod or container 316 in place during operation . the preferred pods or containers 316 for use with the invention will be discussed in greater detail below . optionally , the mixing system 300 may have safety controls 314 to alert the user to a particular speed or frequency of the mixing based upon the type of nutraceutical being used or the size or amount being used . mixing system 300 further comprises movable mixing head 320 comprising back head 302 movably connected to front mixing head 304 which includes stirrer or mixer 306 . during operation , after pod or container 316 is positioned securely on surface 310 , mixing head 320 is lowered ( see fig4 a - b ) such that mixer or stirrer 306 is inserted into the contents of the pod or container 316 . the user then selects the appropriate control 314 for the desired frequency or speed of the mixing . optionally , front mixing head , which is connected to back head 302 via movable arms 308 such that mixing arm 306 moves about within pod or container 316 . similarly , the mixing head 320 may also optionally partially rotate ( e . g ., approximately 45 % or 60 %) again to move mixing arm 306 around within container or pod 316 . preferably , internal ( not shown ) to the mixing system 300 is an internal process controller unit ( including suitable memory and processing units ) optionally linked with an external communication control system . as will be understood by those of skill in the system operational arts , during any use , system 300 may be able to track individual uses , dispensements , particular mixing proportions , total supplement delivery and other operations . additionally , in an optional embodiment , the communication control system may be able to communicate externally to process control system and data tables and with delivery supply system , thereby permitting comprehensive benefit , use , and adaptation tracking for a user &# 39 ; s health benefit . additionally , system 300 may be able to re - order , and operate commercial transactions on behalf of a user based upon designated user preferences . referring next to fig5 a - c , shown is the portable mixing system with safety controls according to an alternate embodiment of the present invention . preferably , the system comprises a housing body 418 having a pod or container receiving portion 412 with a slip resistant bottom surface 410 . alternatively , bottom surface 410 may be a type of key - in surface to lock or otherwise secure the pod or container in place during operation . the preferred pods or containers for use with the invention will be discussed in greater detail below . optionally , the mixing system 400 may have power control switch 422 and safety controls 414 ( e . g ., one for mom , one for dad , and one for child ) to identify for or alert the user to a particular speed or frequency of the mixing based upon the type of nutraceutical or other health product being used or the size or amount being used . optionally , a user access code , fingerprint scan , retina scan or other known type of safety control mechanisms that are difficult to bypass , including software safety control , may be employed with the system , especially for the consumption of quantity - sensitive materials ( i . e ., iron , etc .) to prevent accidental overdose . mixing system 400 further comprises movable mixing head 420 movably connected within housing 418 and is connected on its bottom surface to stirrer or mixing arm 406 . during operation , after a pod or container is positioned securely on surface 410 , mixing head 420 is lowered such that mixing arm or stirrer 406 is inserted into the contents of the pod or container . the user then selects the appropriate control 414 for the desired frequency or speed of the mixing . as will be discussed further below , the mixing arm 406 may optionally have fans or blades which extend radially from mixing arm 406 to aid in the mixing process . optionally , the mixing head 420 may also move up and down as well as partially rotate within housing 418 ( e . g ., approximately 45 % or 60 %) again to move mixing arm 406 around within the container or pod . as discussed above , internal ( not shown ) to the mixing system 400 is preferably an internal process controller unit ( including suitable memory and processing units ) optionally linked with an external communication control system . in addition , a barcode reader or scanner 404 may be included to read and transmit information from the product being used to the internal process controller unit . as will be understood by those of skill in the system operational arts , during any use , system 400 may be able to track individual uses , dispensements , particular mixing proportions , total supplement delivery and other operations . additionally , in an optional embodiment , the communication control system may be able to communicate externally to process control system and data tables and with the delivery supply system , thereby permitting comprehensive benefit , use , and adaptation tracking for a user &# 39 ; s health benefit . additionally , system 400 may be able to re - order , and operate commercial transactions on behalf of a user based upon designated user preferences . turning next to fig6 a - b , shown is the portable mixing system 500 with safety controls according to yet another alternate embodiment of the present invention . preferably , the system comprises a housing body 518 having a pod or container receiving portion 512 with a slip resistant bottom surface 510 . alternatively , bottom surface 510 may be a type of key - in surface to lock or otherwise secure the pod or container in place during operation . the preferred pods or containers for use with the invention will be discussed in greater detail below . optionally , the mixing system 500 may have a power control switch and safety controls 514 ( e . g ., one for mom , one for dad , and one for child ) to identify for or alert the user to a particular speed or frequency of the mixing based upon the type of nutraceutical or other health product being used or the size or amount being used . alternatively , an led or other touch based electronic screen 504 may be employed to provide all the control menus and options for the user of the system . mixing system 500 further comprises mixing head 520 connected to housing 518 directly above container receiving portion 512 and is connected to stirrer or mixing arm 506 . during operation , after a pod or container is positioned securely on surface 510 , mixing head 520 lowers mixing arm or stirrer 506 into the contents of the pod or container . the user then selects the appropriate control 514 ( or using other control pad 504 ) for the desired frequency or speed of the mixing . as will be discussed further below , the mixing arm 506 may optionally have fans or blades which extend radially from mixing arm 506 to aid in the mixing process . optionally , the mixing head 520 may also move up and down as well as partially rotate within housing 518 ( e . g ., approximately 45 % or 60 %) again to move mixing arm 506 around within the container or pod . as discussed above with the other embodiments , internal ( not shown ) to the mixing system 500 is preferably an internal process controller unit ( including suitable memory and processing units ) optionally linked with an external communication control system . in addition , a barcode reader or scanner 508 may be included to read and transmit information from the product being used to the internal process controller unit . as will be understood by those of skill in the system operational arts , during any use , system 500 may be able to track individual uses , dispensements , particular mixing proportions , total supplement delivery and other operations . additionally , in an optional embodiment , the communication control system may be able to communicate externally to process control system and data tables and with delivery supply system , thereby permitting comprehensive benefit , use , and adaptation tracking for a user &# 39 ; s health benefit . additionally , system 500 may be able to re - order , and operate commercial transactions on behalf of a user based upon designated user preferences . turning next to fig7 a - b , shown is the portable mixing system 600 with safety controls according to still yet another alternate embodiment of the present invention . preferably , the system comprises a housing body 618 having a pod or container receiving portion 612 with a slip resistant bottom surface 610 . alternatively , bottom surface 610 may be a type of key - in surface to lock or otherwise secure the pod or container in place during operation . the preferred pods or containers for use with the invention will be discussed in greater detail below . optionally , the mixing system 600 may have a power control switch 622 and safety controls 614 ( e . g ., one for mom , one for dad , and one for child ) to identify for or alert the user to a particular speed or frequency of the mixing based upon the type of nutraceutical or other health product being used or the size or amount being used . alternatively , an led or other touch based electronic screen 604 may be employed to provide all the control menus and options for the user of the system . mixing system 600 further comprises mixing head 620 , in this embodiment a ball - shaped head , connected to housing 618 directly above container receiving portion 612 and is connected to stirrer or mixing arm 606 . again , during operation , after a pod or container is positioned securely on surface 610 , mixing head 620 lowers mixing arm or stirrer 606 into the contents of the pod or container . the user then selects the appropriate control 614 ( or using other control pad 604 ) for the desired frequency or speed of the mixing . mixing system 600 may optionally employ a locking mechanism or child safety lock to prevent a child from accidentally selecting an adult size or speed . as will be discussed further below , the mixing arm 606 may optionally have fans or blades which extend radially from mixing arm 606 to aid in the mixing process . optionally , the mixing head 620 may also move up and down as well as partially rotate within housing 618 ( e . g ., approximately 45 % or 60 %) again to move mixing arm 606 around within the container or pod . as discussed above with the other embodiments , internal ( not shown ) to the mixing system 600 is preferably an internal process controller unit ( including suitable memory and processing units ) optionally linked with an external communication control system . in addition , a barcode reader or scanner 508 may be included to read and transmit information from the product being used to the internal process controller unit . as will be understood by those of skill in the system operational arts , during any use , system 600 may be able to track individual uses , dispensements , particular mixing proportions , total supplement delivery and other operations . additionally , in an optional embodiment , the communication control system may be able to communicate externally to process control system and data tables and with delivery supply system , thereby permitting comprehensive benefit , use , and adaptation tracking for a user &# 39 ; s health benefit . additionally , system 600 may be able to re - order , and operate commercial transactions on behalf of a user based upon designated user preferences . referring now to fig8 a - b , shown is the portable mixing system 700 with safety controls according to still another alternate embodiment of the present invention . preferably , the system comprises a housing body 718 having a pod or container receiving portion 712 with a slip resistant bottom surface 710 . alternatively , bottom surface 710 may be a type of key - in surface to lock or otherwise secure the pod or container in place during operation . the preferred pods or containers for use with the invention will be discussed in greater detail below . optionally , the mixing system 700 may have a power control switches 722 and safety controls 714 ( e . g ., one for mom , one for dad , and one for child ) to identify for or alert the user to a particular speed or frequency of the mixing based upon the type of nutraceutical or other health product being used or the size or amount being used . alternatively , an led or other touch based electronic screen 704 may be employed to provide all the control menus and options for the user of the system . mixing system 700 further comprises a mixing head ( not seen ) within the upper portion of housing 718 connected to directly above container receiving portion 712 and which is connected to or integral with stirrer or mixing arm 706 ( also not seen ). during operation , after a pod or container is positioned securely on surface 710 , mixing head lowers mixing arm or stirrer 706 into the contents of the pod or container . the user then selects the appropriate control 714 ( or using other control pad 704 ) for the desired frequency or speed of the mixing . mixing system 700 may optionally employ a locking mechanism or child safety lock to prevent a child from accidentally selecting an adult size or speed . as will be discussed further below , the mixing arm 706 may optionally have fans or blades which extend radially from mixing arm 706 to aid in the mixing process . optionally , the mixing head may also move up and down as well as partially rotate within housing 718 ( e . g ., approximately 45 %, 60 %, 75 %, etc .) again to move mixing arm 706 around within the container or pod . as discussed above with the other embodiments , internal ( not shown ) to the mixing system 700 is preferably an internal process controller unit ( including suitable memory and processing units ) optionally linked with an external communication control system . in addition , a barcode reader or scanner 708 may be included to read and transmit information from the product being used to the internal process controller unit . as will be understood by those of skill in the system operational arts , during any use , system 700 may be able to track individual uses , dispensements , particular mixing proportions , total supplement delivery and other operations . additionally , in an optional embodiment , the communication control system may be able to communicate externally to process control system and data tables and with delivery supply system , thereby permitting comprehensive benefit , use , and adaptation tracking for a user &# 39 ; s health benefit . additionally , system 700 may be able to re - order , and operate commercial transactions on behalf of a user based upon designated user preferences . turning our attention now to fig9 through 19 , shown are various embodiment for pods or containers and some of their components that may be employed with the various mixing systems discussed above with respect to fig3 through 8 . referring first to fig9 a - 9d , show is a first embodiment of a pod or container 800 for use with the mixing systems previously described , illustrating a two part pod 800 ( 802 , 804 ), a nutritional supplement part 810 and a housing part 804 for containing filtered water 814 , with a mixing paddle 806 having radially projecting blades or fans and a upwardly projecting stem 808 for interfacing with the disclosed mixing systems . the nutritional supplement or vitamin supplement contained within nutritional supplement part 810 for any of the embodiments disclosed herein may be in the form of powder , liquid , dissolvable capsules or tablets , microcapsules , or other known form . preferably , upper part 810 of pod 800 has a sealing cap 802 having a sealing membrane or protective label 816 there on . optionally , protective label 816 contains a 2d or 3d barcode thereon as seen in fig9 d for the mixing system to read , store and / or transmit information about the product being used . also optionally , lid or cap 802 is secured onto an upper portion of housing part 804 in a tamper resistant manner such that if the seal is broken the average user would notice . any of the known tamper resistant mechanisms for bottles or containers may be employed . during operation , once pod or container 800 is positioned securely into the mixing system , a mixing head lowers the mixing arm or stirrer down onto the upper portion or protective label 816 of pod or container 800 . the mixing system will continue to move mixing arm downward until the lower end of the mixing arm connects or otherwise engages with the upper end of stem 808 of paddle 806 such that when mixing arm spins , paddle 806 will rotate at the same speed and / or frequency . mixing arm continues to apply downward pressure on stem 808 until a lower tip 807 of paddle 806 punctures sealing membrane 812 which had been maintaining nutritional supplement or vitamin 810 away from water 814 . once sealing membrane 812 is punctured nutritional supplement or vitamin 810 spills into water 814 and mixing arm continue to apply downward pressure on stem 808 until paddle 806 is sufficiently submerged to a distance within water 814 to adequately and completely mix the water and nutritional supplement as described above with respect to any of the mixing systems disclosed herein . once sufficiently mixed , the mixing arm rises out from within container 800 so that container 800 may be removed from the mixing system . optionally , mixing arm ( see any of fig3 through 8 ) and / or stem 808 may comprise a mechanism or may be configured in such a way that they become securely engaged and that when the mixing arm is removed from container 800 , it removes paddle 806 as well . optionally , paddle may remain with container and be disposed of along with container once all the liquid mixture is gone . turning next to fig1 , shown is an exposed cross - sectional view of an alternative embodiment for a two part pod or container 820 for use with the mixing systems in accordance with the invention . in this embodiment , two part pod or container 820 comprises outer container 828 housing liquid ( e . g ., 3 or 4 ounces of water ) and inner container or baggie 826 housing the nutritional supplement blend or vitamins 836 . inner container 826 is preferably heat - sealed on its upper end to the upper end of outer container 828 . outer container 828 may preferably be a blow molded polyurethane ( pe ) bottle or any other suitable container material for foods . an injection molded pe cap 832 is preferably affixed on the outer side of upper end of outer container 828 and includes an injection molded lance 830 through its top surface such that lance 830 has a lower bladed end within baggie 826 and an upper end extending outwardly through cap 832 . adjacent the outer top side of cap 832 is preferably positioned a compression spring 822 which is surrounded by a film 824 heat sealed to cap and covering spring 822 . compression spring 822 is configured such that it maintains lance 830 in position until a downward force is applied during use . as previously discussed , during operation , once pod or container 820 is positioned securely into the mixing system , a mixing head will lower the mixing arm or stirrer down onto the upper portion directly above spring 22 pod or container 820 . the mixing system will continue to move its mixing arm downward until the lower end of the mixing arm connects or otherwise engages with the upper end of lance 830 . the mixing arm continues to apply downward pressure on upper end of lance 830 until a lower tip of lance 830 punctures the lower end of baggie 826 . once broken , nutritional supplement or vitamin 836 spills into water 834 and mixing arm continue to apply downward pressure on lance 830 until sufficiently submerged to a distance within water 834 to adequately and completely mix the water and nutritional supplement as described above with respect to any of the mixing systems disclosed herein . once sufficiently mixed , the mixing arm rises out from within container 820 so that container 820 may be removed from the mixing system . optionally , mixing arm ( see any of fig3 through 8 ) and / or lance 830 may comprise a mechanism or may be configured in such a way that they become securely engaged and that when the mixing arm is removed from container 820 , it removes lance 830 as well . optionally , lance 830 may remain with container and be disposed of along with container once all the liquid mixture is gone . referring next to fig1 a - b , shown are descriptive illustrations of phase one and phase two of a bi - pod filtration process used with the system according to one aspect of the invention . looking now at fig1 , shown is an exploded perspective view of another alternative embodiment for a two part spin pod for use with the mixing system in accordance with the invention . as shown , two part pod 840 comprises housing or container 848 for hold liquid , and stir pod 845 comprising upper shaft 842 ( preferably of a hex shape or some other shape such that secure interface may be made with the lower end of a mixing arm ), side portions 844 and mixing paddle 846 . during operation , once pod or container 840 is positioned securely into the mixing system , a mixing head will lower the mixing arm or stirrer down onto the upper portion directly above and engages upper shaft 842 without applying too much pressure . the mixing system will then begin rotation of the mixing arm thereby rotating stir pod 845 . depicted in fig1 through 15 are alternative embodiments for the stir pod used in conjunction with the spin pod 840 shown in fig1 . for example , fig1 a - b shows stir pod 850 in its closed ( fig1 a ) and its open ( fig1 b ) positions . during use , the centrifugal force from rotation of stir pod 850 from engaging the mixing arm of one of the above described mixing systems generates sufficient centrifugal force to open blades 852 thereby spilling the nutritional supplement blend therefrom and into the liquid in the container below . blades 852 are then used to mix the water and nutritional supplement . similarly , fig1 a - c shows stir pods 854 , 860 ( stir pod 860 only having two blades ) in closed ( fig1 a ) and open ( fig1 b - c ) positions . during use , pressure applied to tabs 856 during rotation of stir pods 854 , 860 open blades 858 , 862 thereby spilling the nutritional supplement blend therefrom and into the liquid in the container below . blades 858 , 862 are then used to mix the water and nutritional supplement . looking at fig1 a - b shown is another alternate embodiment for a stir pod for use with the invention . that is , stir pod 864 comprises veins or inwardly opening blades 866 such that with rotation thereof water flows into the stir pod 864 and out through an opening 868 on a bottom end of stir pod 864 . during use , the centrifugal force from rotation of stir pod 884 from engaging the mixing arm of one of the above described mixing systems generates sufficient force to open blades 866 inwardly or allow water to break through a seal of some kind to mix with the nutritional supplement within stir pod 864 and flow out through its bottom thereby spilling the combined water - nutritional supplement blend from the stir pod 864 . briefly , fig1 shows a perspective view of one embodiment of how any of the spinning pods may be packaged for proper sealing and safe handling . as an alternative embodiment to the portable electronic mixing systems disclosed above , shown in fig1 a - c , 18 a - c and 19 describe various embodiments for a portable and disposable two part pod mixing system in accordance with the invention . referring first to fig1 a - d , shown is a first embodiment of a pod or container 900 . as illustrated , mixing container 900 preferably comprises a blow molded ( p . p . or pet ) housing 904 , which is heat sealed on its lower end 906 with a pp or foil membrane to a blow molded pp lower compressible container 910 . preferably , housing 904 contains liquid ( i . e ., approximately 3 ounces of water ) while lower collapsible container 910 contains the desired nutritional supplement . on its upper end , housing 904 is removably closed with a cap , such as the cap for an ordinary water bottle or soda bottle . also optionally , lid or cap 902 is secured onto an upper portion of housing part 904 in a tamper resistant manner such that if the seal is broken the average user would notice . any of the known tamper resistant mechanisms for bottles or containers may be employed . of course , a larger lid configuration of container having a large lid such as container 901 may be used . also , within lower collapsible container 910 is positioned , preferably affixed to the bottom surface thereof , a foil or membrane piercing divider 914 . upon shaking or vigorous up and down motion of the container 900 , piercing divider 914 punctures ( 912 ) foil or membrane 908 thereby allowing the nutritional supplement in lower container 910 to mix with the water in housing 904 upon continued shaking accordingly , while it is preferred that piercing divider 914 be configured as shown , i . e ., in the shape of a pyramid , any shape divider which has a sharp enough apex would suffice . turning to fig1 a - b , shown is a second embodiment of a two compartment mixing pod or container 920 . as illustrated , mixing container 920 here preferably comprises a blow molded ( p . p . or pet ) housing 924 , which is heat sealed on its lower end with a pp or foil membrane to a blow molded pp lower compressible container 930 . preferably , housing 924 contains liquid ( i . e ., approximately 3 ounces of water ) while lower collapsible container 930 contains the desired nutritional supplement . on its upper end , housing 924 is removably closed with a tamper resistant heat sealed pull off lid 922 , such as the pull off lid for a container of yogurt . also , within lower collapsible container 930 is positioned , preferably affixed to the bottom surface thereof , a foil or membrane piercing divider 934 . upon shaking or vigorous up and down motion of the container 920 , piercing divider 934 punctures the foil or membrane thereby allowing the nutritional supplement in lower container 930 to mix with the water in housing 924 upon continued shaking accordingly , while it is preferred that piercing divider 934 be configured as shown , i . e ., in the shape of a pyramid , any shape divider which has a sharp enough apex would suffice . moreover , while two piercing dividers are shown , other numbers of dividers may be used with the invention . as seen in fig1 c , yet another alternate embodiment of the two part mixing pod is shown . here , pod 920 comprises on its lower end an expandable lower region 926 which on its lower end is heat sealed to lower collapsible compartment 928 . in this embodiment , upon shaking or vigorous up and down motion of the container 920 , a piercing divider , much like divider 934 seen in fig1 b punctures the foil or membrane thereby allowing the nutritional supplement in lower container 928 to mix with the water in housing 924 upon continued shaking preferably , upon puncture of the membrane , lower compartment 928 compresses or collapses while at the same time or close to the same time expanding region 926 of pod 920 expands to allow for extra space with housing 924 upon entry of the nutritional supplement . similar to the embodiment just described with respect to fig1 c , yet another alternate embodiment of the two part mixing pod is shown in fig1 , which is similar to the two compartment pods shown in fig1 a - b but with the added expandable region 946 . here , pod 940 comprises on its lower end an expandable lower region 946 which on its lower end is heat sealed 938 to lower collapsible compartment 948 . in this embodiment , upon shaking or vigorous up and down motion of the container 940 , a piercing divider , much like divider 934 seen in fig1 b , punctures the foil or membrane thereby allowing the nutritional supplement in lower container 948 to mix with the water in housing 944 upon continued shaking preferably , upon puncture of the membrane , lower compartment 948 compresses or collapses while at the same time or close to the same time expanding region 946 of pod 940 expands to allow for extra space within housing 944 for entry of the nutritional supplement . alternatively , pod 940 may be held by a machine at 950 . the machine would compress lower compartment 948 , then shaking pod 940 such that expanding region 946 expands . in the claims , means or step - plus - function clauses are intended to cover the structures described or suggested herein as performing the recited function and not only structural equivalents but also equivalent structures . thus , for example , although a nail , a screw , and a bolt may not be structural equivalents in that a nail relies on friction between a wooden part and a cylindrical surface , a screw &# 39 ; s helical surface positively engages the wooden part , and a bolt &# 39 ; s head and nut compress opposite sides of a wooden part , in the environment of fastening wooden parts , a nail , a screw , and a bolt may be readily understood by those skilled in the art as equivalent structures . having described at least one of the preferred embodiments of the present invention with reference to the accompanying drawings , it will be apparent to those skilled in the art that the invention is not limited to those precise embodiments , and that various modifications and variations can be made in the presently disclosed system without departing from the scope or spirit of the invention . thus , it is intended that the present disclosure cover modifications and variations of this disclosure provided they come within the scope of the appended claims and their equivalents . the scope of the invention , therefore , shall be defined solely by the following claims . it should be appreciated that the present invention is capable of being embodied in other forms without departing from its essential characteristics . | 0 |
referring first to fig1 and 2 , these show a fragment of a diesel engine 20 including a camshaft 22 , a pair of exhaust valves 24 and 26 , a cross head 28 extending across tops 30 and 32 of the two exhaust valves , a rocker arm 34 , rocker arm supports 36 and 37 and a rocker arm shaft 38 . the rocker arm includes a cam follower in the form of a roller 40 rotatably mounted on a shaft 42 . there is a valve set screw 44 threadedly received at end 46 of the rocker arm above cross head 28 . a lock nut 48 is threadedly received on the set screw adjacent the rocker arm . the set screw has a concave recess 50 at its lower end which contacts hemispherical fitting 52 on cross head 28 . referring to fig2 there is a pair of intake valves 56 and 58 on the same cylinder of engine 20 as the exhaust valves 24 and 26 . these are also provided with a cross head 60 , a rocker arm 62 , a valve set screw 64 and a lock nut 66 . there is also a fuel injector 68 actuated in this example by another rocker arm 70 . the supports are provided with bolts 72 , 74 , 76 and 78 . as described thus far , the engine 20 is generally conventional . camshaft 22 rotates in the direction of arrow 80 once for every two revolutions of the crankshaft ( not shown ) of the engine . a first lobe 23 is positioned in the conventional manner on camshaft 22 to open the exhaust valves 24 and 26 during the exhaust stroke of the particular cylinder of the engine where these valves are located . the lobe 23 contacts roller 40 and rotates rocker arm 34 in the direction indicated by arrow 86 , causing screw 44 to press downwardly on fitting 52 of the cross head and thus open the exhaust valves . it is known to provide clearance in the exhaust valve opening mechanism . generally this is accomplished by adjusting screw 44 to provide a specified gap between the bottom of the screw and the cross head . lock nut 48 maintains the proper gap . the gap however could be considered as being between the camshaft and roller depending upon the position of the rocker arm . likewise it is known to provide clearance or play in other ways between the camshaft and the exhaust valves such that there is no actual clearance between the roller and the camshaft or the screw 44 and fitting 52 . for example , hydraulic devices can replace the rocker arm and the clearance or play can simply be lost motion in the hydraulic mechanism . thus , the term “ clearance ” between the camshaft , the rocker arm and the exhaust valves is used herein in the operative sense to mean some type of operative clearance or play in the system . engine 20 is somewhat unconventional in that camshaft 22 has a second lobe 25 located on the same portion of the camshaft as lobe 23 . in other words , lobes 23 and 25 are axially aligned along axis of rotation 90 of the camshaft in this embodiment , but are angularly spaced - apart about the axis . it may be seen that lobe 23 extends further from axis 90 than lobe 25 . the second lobe 25 is positioned to crack open the exhaust valves 24 and 26 near top dead center of the compression stroke to provide a compression release brake for the engine . when lobe 25 reaches roller 40 , the rocker arm rotates in the direction of arrow 86 , cracking open the exhaust valves . it is neither appropriate , nor desirable to have an engine brake operate at all times . clearly the exhaust valves should not be cracked open at top dead center of the compression stroke when the engine is providing power . the exhaust brake should only be operational , as discussed above , when the fuel supply to the engine is cut off and the vehicle is coasting . thus there must be some mechanism for selectively engaging the roller 40 with lobe 25 during engine brake operation only . it is known in the prior art discussed above to provide variable effective clearance between the roller and camshaft for this purpose . during normal engine operation , the clearance is increased such that the roller 40 operatively contacts only lobe 23 during rotation of the camshaft , so the exhaust valves are opened only during the exhaust stroke . when the engine brake is operational , there is means for decreasing this clearance such that the lobe 25 operatively contacts the roller 40 , rotates the rocker arm in the direction of arrow 86 , and cracks open the exhaust valves near top dead center of each compression stroke . however , there is a problem associated with prior art devices of this nature . when the clearance is so reduced , the exhaust valves 24 and 26 are opened further than normal during the exhaust stroke as the lobe 23 contacts the roller 40 . this conceivably could cause the exhaust valves to contact the piston , causing serious damage to the engine . one way of countering this problem has been to provide pockets in the pistons to give additional clearance for the exhaust valves . however this can be detrimental to engine operation since the flows of gases to and from the cylinder can be adversely affected by the pockets . it is not only the degree of opening of the exhaust valves which poses problems . reducing the clearance also affects exhaust valve timing . in particular , the exhaust valves stay open longer than normal , increasing overlap with the intake valves ( when both valves are open simultaneously ). this may cause more exhaust energy to be dumped into the intake system instead of , for example , being available to help drive the engine turbocharger . another problem associated with these prior art apparatuses is that their typical rocker arm ratio is too high . the rocker arm ratio is the amount of opening of the exhaust valves divided by the amount of lift provided by lobe 23 . a typical range of ratios in prior art devices would be 1 . 6 - 1 . 9 : 1 . such ratios increase loading on the camshaft . the loading is typically reduced by timing the opening of the exhaust valves early , resulting in weak engine braking . engine 20 optimizes the rocker arm ratio by achieving a rocker arm ratio more nearly approaching 1 : 1 in this preferred embodiment as may be seen with reference to fig1 . the distance between adjusting screw 44 and rocker arm shaft 38 is almost the same as the distance between the rocker arm shaft and point of contact 41 between the camshaft and roller 40 . the lever arms are therefore more equal in length and the amount of lift at the camshaft nearly equals the amount of opening of the exhaust valves . the engine also includes a valve control apparatus 100 which selectively reduces the operative clearance between the camshaft 22 and the exhaust valves 24 and 26 in order to operate the engine brake by cracking open the valves , near top dead center of the compression stroke , with lobe 25 of the camshaft . there is a solenoid valve 102 operatively connected to controls 104 . the controls are conventional and include a switch operatively associated with the throttle of the engine such that the brake is only operational when the throttle is closed . there is also a manual switch in the cab of the vehicle , allowing the operator to operate the engine brake when the vehicle is coasting downhill . the solenoid valve allows engine oil to enter a passageway 110 when the operator closes the switch and the valve opens . rocker arm 34 is unconventional in that it comprises a first portion 112 and a second portion 114 . both portions are rotatably mounted on rocker arm shaft 38 as best shown in fig1 . portion 112 operatively contacts the camshaft 22 by means of roller 40 and portion 114 operatively contacts the exhaust valves via screw 44 , fitting 52 and cross head 28 . as discussed above , both portions have nearly the same effective length measured by the distance from the center of the rocker arm shaft to the point of contact with camshaft 22 and fitting 52 respectively , providing a rocker arm ratio of nearly 1 : 1 for this example of the invention . there is a mechanism 130 for selectively changing the operative clearance between the camshaft and the valves . normally the rocker arm 34 is in a first operational mode , illustrated in fig7 where on each revolution of the camshaft the first lobe 23 only operatively contacts roller 40 , causing the valves 24 and 26 to open in the normal manner during the exhaust stroke only . the mechanism 130 can selectively put the rocker arm 34 in a second operational mode , illustrated in fig1 and 5 , where , on each revolution of the camshaft , the roller 40 is lifted by the second lobe 25 to crack open the exhaust valves near top dead center of the compression stroke . this second mode is selected by opening solenoid valve 102 with controls 104 to provide engine oil to the passageway 110 extending through rocker arm support 36 from oil line 111 . the adjusting mechanism 130 includes a hydraulic cylinder 132 with a piston 134 reciprocatingly received therein . there is a pin 136 extending through the cylinder and a bore 138 in the piston . the bore 138 is substantially wider than the pin , allowing for reciprocation of the piston in the cylinder , but limiting its movement . as seen in fig7 there is a first coil spring 140 biased between end 142 of the cylinder and recess 144 in the piston . the spring biases the piston to the right from the point of view of fig1 , 3 , 5 and 7 . there is a smaller coil spring 148 coaxially within spring 140 and biased between the recess 144 in the piston and a ball 150 . the spring biases the ball towards a position to close passageway 152 . there is a second cylinder 160 , integral with cylinder 132 in this embodiment and located coaxially to the left thereof from the point of view of fig7 . there is a second piston 162 in the cylinder having a stem 164 extending to the right , from the point of view of fig1 , 5 and 7 , into the passageway 152 . there is a further hydraulic passageway 170 which , from the point of view of fig1 , 5 and 7 , extends downwardly through portion 112 of the rocker arm and then angles to the right to intersect with cylindrical bore 174 which receives the rocker arm shaft 38 . passageway 110 in rocker arm support 36 and passageway 170 in portion 112 are both aligned with a passageway 113 in the rocker arm shaft 38 for the positions of the rocker arm portions illustrated in fig1 and fig7 . this allows oil to pass through the passageways 110 , 113 , 170 and 152 when the solenoid is open . there is a chamber 180 formed in the cylinder 132 between the piston 134 and end 142 of the cylinder . oil can pass from passageway 152 and into the chamber 180 , unseating ball 150 , when the rocker arm portions are in this position . the ball 150 acts as a check valve , trapping the oil within the chamber 180 . at the same time , the spring 140 biases the piston 134 to the right and against upward extension 190 on portion 114 of the rocker arm , to rotate the two portions 112 and 114 to the positions shown in fig1 and 5 , with the piston 134 projecting outwardly from the cylinder 132 . the two portions of the rocker arm are thus moved away from each other and reduce operative clearance between the camshaft and the exhaust valves during brake operation . referring to fig5 this shows a point after the lobe 25 has rotated past roller 40 , and before lobe 23 has completed the lifting of the rocker arm 34 to open the exhaust valves 24 and 26 for the exhaust stroke . there is another hydraulic passageway 200 . 1 in portion 112 of the rocker arm which becomes aligned with passageway 115 in the shaft which is connected to drain . this allows pressurized oil to flow through passageway 200 . 1 from chamber 204 of cylinder 160 , allowing spring 206 to move piston 162 to the right , from the point of view of fig5 so stem 164 unseats ball 150 to the right , compressing spring 148 . the force of projection 190 on piston 134 , as the roller 40 rides up on lobe 23 , forces the piston 134 to the left , from the point of view of fig5 dumping oil through passageways 152 , 170 , 113 and 110 back through the solenoid valve . thus the two portions 112 and 114 of the rocker arm rotate closer together , increasing operative clearance between the exhaust valves and camshaft to the same amount as occurs when the engine brake is not operational . to summarize the operation of each cylinder of engine 20 , fig1 is first referenced . this shows the position of camshaft 22 as the roller 40 on the rocker arm 34 is on the dwell surface 21 of the camshaft , with its second lobe 25 approaching . solenoid valve 102 has been opened using the controls 104 . in this position passageways 110 and 170 in the rocker arm support and portion 112 of the rocker arm respectively are aligned with passageway 113 in shaft 38 such that engine oil is forced through passageway 152 , past ball 150 and into the chamber 180 when piston 134 is moved to the right under the action of spring 140 . the piston is prevented from moving to the left by the ball 150 which blocks the oil in the chamber 180 . thus the two portions 114 and 112 of the rocker arm are rotated away from each other , increasing the gap 200 between them and decreasing the operative clearance between the roller 40 and camshaft such that the lobe 25 on the camshaft rotates the rocker arm clockwise cracking open the exhaust valves 24 and 26 , as shown in fig3 as the roller rides up on lobe 25 . fig5 shows the position of the apparatus after lobe 25 has passed the roller 40 and the roller is riding up on lobe 23 . at this point passageway 200 . 1 in portion 112 of the rocker arm becomes aligned with passageway 115 in the shaft , which is connected to drain , allowing pressurized oil from chamber 204 of cylinder 160 to escape so spring 206 forces piston 162 to the right . this causes stem 164 to unseat ball 150 . as roller 40 begins to ride up on lobe 23 , portion 112 of the rocker arm is pushed upwardly by the camshaft , forcing projection 190 of portion 114 against piston 134 and forcing oil out from chamber 180 toward solenoid 102 through passageways 170 , 111 and 110 . when the camshaft 22 has rotated such that the roller 40 is past the lobe 23 and is approaching lobe 25 , as shown in fig1 passageway 200 . 1 is aligned with passageway 113 . 1 in shaft 38 . as seen , this receives oil from passageway 113 connected thereto . the hydraulic pressure pushes piston 162 to the left , along with stem 164 , from the point of view of fig1 . spring 148 , shown in fig7 biases ball 150 to the left so it reseats itself passageways 110 and 170 are both aligned with passageway 113 in shaft 38 in this position such that oil again fills chamber 180 in cylinder 132 as piston 134 is biased to the right by spring 140 . the oil is locked in chamber 180 by ball 150 so the portions 112 and 114 of the rocker arm are held in the relative position shown in fig5 with the gap 200 increased , and the operative clearance between the roller 40 and the camshaft 22 decreased , so lobe 25 again cracks open the exhaust valves as it reaches roller 40 . fig9 show an alternative embodiment which is generally similar to the previous embodiment and like parts have like numbers with the additional designation “ 0 . 1 ”. like engine 20 , engine 20 . 1 has a camshaft 22 . 1 with two lobes 23 . 1 and 25 . 1 . rocker arm 34 . 1 has two portions 112 . 1 and 114 . 1 . there is a piston 134 . 1 which contacts projection 190 . 1 of portion 114 . 1 . there is a ball 150 . 1 which normally seals passageway 170 . 1 against a back flow of oil from chamber 180 . 1 . there is a passageway 350 which connects chamber 180 . 1 to chamber 352 in a cylinder 354 . there is a piston 356 , 0 . 225 ″ in diameter in this example , which slidingly extends through aperture 357 at end 359 of cylinder 354 . a larger diameter , tubular piston 358 , 0 . 250 ″ in diameter in this example , extends slidingly and sealingly through aperture 361 at opposite end 360 of the cylinder . there is a screw 380 with a nylon insert 381 on the end which provides resistance against the movement of piston 358 . there is a larger diameter spring 371 pressing against the disk - shaped member 370 and which biases the piston assembly to the left , from the point of view of fig1 . when chamber 180 . 1 is supplied with pressurized oil , as the lobe 25 . 1 approaches roller 40 . 1 , pistons 356 and 358 are moved to the right due to the larger diameter of piston 358 . this compresses spring 371 . the pressure builds up as the roller 40 . 1 rides up on the lobe , causing piston 358 to project outwardly beyond the right end of cylinder 354 from the point of view of fig1 . however , once the lobe 25 . 1 has caused the exhaust valves to crack open , the pressure in the engine cylinder rapidly drops due to the escape of the compressed gases through the exhaust valves . this reduces the pressure in cylinder 354 , causing larger spring 371 to force member 370 to the left against the pressure of smaller spring 373 , moving piston 356 to the left . however tubular piston 358 lags behind due to the resistance of nylon insert 381 pressing against the piston under the action of screw 380 . member 370 therefore separates from the tubular piston 358 , allowing oil to escape from chamber 180 . 1 through the center of the tubular piston 358 and outwardly to the right from the point of view of fig1 . thus piston 134 . 1 is forced towards chamber 180 . 1 by projection 190 . 1 as the roller 40 . 1 starts to ride on lobe 23 . 1 , so the apparatus resumes its normal operational mode , equivalent to its position when the brake is not operational , prior to each exhaust stroke . fig1 - 14 show another alternative embodiment wherein like parts have like numbers as in the previous embodiments with the additional designation “ 0 . 2 ”. in this example rocker arm 34 . 2 has only a single portion instead of the two portions of the previous embodiments . however , rocker arm 34 . 2 is unconventional in that includes a mobile hydraulic finger 201 , reciprocatingly received in a hydraulic cylinder 202 . the finger has a convex outer end 205 which contacts crosshead 28 . 2 . rocker arm shaft 38 . 2 is provided with two passageways 210 and 212 , the former aligning with passageway 110 . 2 to provide pressurized oil via solenoid 102 . 2 . the latter is connected to drain . there is a passageway 220 in the rocker arm equipped with a check valve 222 including a ball 224 biased against a seat 226 via spring 228 . there is another passageway 230 which intersects passageway 221 between the check valve and cylinder 202 . as in the previous embodiments , lobe 25 . 2 serves to crack open the valves 24 . 2 and 26 . 2 near top dead center of the compression stroke . fig1 shows lobe 25 . 2 approaching roller 40 . 2 of the rocker arm . it may be seen that passageway 220 is connected to passageway 110 . 2 via passageway 210 in the rocker arm shaft and thereby receives pressurized boil oil which passes through check valve 222 to enter cylinder 202 and thereby extend finger 201 . the same time , passageway 230 is not aligned with the passageway 212 and thereby not connected to drain . thus any oil entering cylinder 202 is trapped by the check valve and the nonalignment of passageway 230 with drain . referring to fig1 , this shows the valves 24 . 2 and 26 . 2 fully cracked open near top dead center of the compression stroke . this is achieved with finger 201 fully extended . referring to fig1 , this shows the position of the camshaft 22 . 2 after lobe 25 . 2 has rotated past roller 40 . 2 and as the roller begins to ride up on lobe 23 . 2 for normal opening of the valves for the exhaust stroke . in this position , passageway 230 becomes aligned with passageway 212 and , thereby , to drain . this allows oil from cylinder 202 drain outwardly from the cylinder through passageway 230 , thereby allowing finger 201 to retract until it contacts set screw 44 . 2 . this is the position for normal valve opening where the lash and amount of valve opening are dictated by the position of screw 44 . 2 . it will be understood by someone skilled in the art that many of the details provided above are by way of example only and can be deleted or altered without departing from the scope of the invention as set out in the following claims . | 5 |
fig1 shows by way of example a schematic view of the functional principle of the inventive apparatus . sheet material 1 , e . g . a bank note , is moved by indicated conveyor rollers 14 within transport channel 10 in defined direction 2 between transmitter 20 and receiver 30 disposed below and above the transport channel , respectively . transmitter and receive are disposed relative to the transport channel such that the soundwaves emitted by the transmitter in the direction of arrow 3 impinge on sheet material 1 through opening 13 in the transport channel at nonzero angle 7 based on perpendicular 8 at the impingement point of the transmitter sound . transmitter 20 can be operated for example at an operating frequency in the range of 150 - 250 khz preferably at the resonance frequency . operation in the resonance region permits high sound power with a narrow frequency spectrum to be obtained , which is advantageous in transmission measurement . a fraction 4 of the transmitter sound reflected by the sheet material impinges on inner surface 11 of the transport channel in accordance with the reflection condition ( angle of incidence = angle of reflection ), where it is reflected and again impinges on the sheet material . this second sound fraction 4 is thus reflected several times in controlled fashion between inner surface 11 of the transport channel and the sheet material . at each reflection second sound fraction 4 is scattered so that the intensity of the second sound fraction 4 decreases greatly with an increasing number of reflections and thus becomes negligible . second sound fraction 4 thus does not disturb the transmission measurement . for testing the sheet material , for example with respect to thickness and / or weight per unit area , a first sound fraction 5 transmitted through the sheet material is detected by receiver 30 and evaluated by a device not shown . for illustration , receive 30 is inclined in fig1 relative to the direction of first sound fraction 5 such that a third sound fraction 6 reflected on the receiver has a different direction from second sound fraction 5 . third sound fraction 6 reflected by the receiver impinges on the sheet material and is reflected thereby in accordance with the reflection condition ( angle of incidence = angle of reflection ), so that third sound fraction 6 impinges on inner surface 12 of the transport channel and is reflected several times between said inner surface and the sheet material , as described above in connection with second sound fraction 4 . due to the transport channel second and third sound fractions 4 , 6 cannot reach the receiver . furthermore , the transport channel provides a shield so that interference from outside the testing apparatus can have no appreciable influence on the test . third sound fraction 6 can be neglected , however , unlike second sound fraction 4 , by reason of the low transmission factor with sheet material , being for example in the range of a few percent . by reason of the low transmission factor of the sheet material ( the sheet material reduces the sound level detected by the receiver and emitted by the transmitter by 40 db for example ), transmitter and receiver can also be disposed parallel to each other without falsifying the measuring result . fig2 shows an apparatus with a plurality of transmitters 20 and receivers 30 disposed along transport channel 10 perpendicular to the transport direction not shown here . transmitters 20 all have the same radiation characteristic and are otherwise the same as well . this also applies accordingly to receivers 30 . left transmitter 20 with opposite receiver 30 forms the first transducer pair of a first measuring track . two measuring tracks are shown here by way of example but three or four or even more measuring tracks can of course also be provided . this is dependent on the room available for the testing apparatus and the dimensions of the sheet material . the detecting areas of the testing apparatus defined by the measuring tracks are obviously to be selected with respect to the sheet material such that multiple pulls , adhesive tape on the sheet material , concertina folds or tears in the sheet material are recognized . on the faces of transducers 20 , 30 facing openings 13 of transport channel 10 , layers 21 and 31 are provided , respectively . layers 21 , 31 consist e . g . of a deadening material and are optional and serve to additionally attenuate any standing soundwaves that might form . the oscillating body can be e . g . a piezoceramic body which is electrically excited to oscillate ultrasonically by a circuit not shown here . sound 3 is emitted substantially only on the side of layer 21 . with a multitrack testing apparatus the dimensions of the transducers are to be selected as small as possible while ensuring a sufficient signal yield or sensitivity of measurement . the dimensions of the transducers are generally given by operating frequency and material of the transducers . the dimensions of the ultrasonic transducer also determine the size and shape of the sound - radiating surface of the transducer , whereby the latter as well as the effective geometric dimensions of the sound channel substantially define the aperture angle of the sound lobe produced . the aperture angle of sound 3 emitted by transmitter 20 should if possible be selected so small that only direct sound 3 emitted in a narrow lobe reaches receiver 30 . sound - carrying openings 13 of transport channel 10 can be made of the same material as the transport channel , for example by the openings being simply milled or drilled into the transport channel . additionally the walls of openings 13 can be provided with deadening material 15 . this causes reflections on the walls of the openings to be suppressed . provision of deadening material 15 is not obligatory , but dependent on the aperture angle of the sound lobe emitted by the transmitter and the thickness of limiting surfaces 11 and 12 and distance 16 between the limiting surfaces . since the sensitivity or signal yield of measurement decreases with increasing distance between transmitter and receiver in particular with transmission measurement , distance 16 between limiting surfaces 11 and 12 of transport channel 10 is to be selected as small as possible while still ensuring troublefree transport of the sheet material within the transport channel . of course , distance 16 between the limiting surfaces is dependent on the thickness of the sheet material to be tested . for testing bank notes this distance can be for example 1 mm to 5 mm . the narrow design of the transport channel causes the sound fraction reflected by the sheet material to be reflected very often between inner surface 11 of the transport channel and the material to be tested not shown here . at each reflection this sound fraction remaining in the transport channel is scattered , so that the intensity of the sound decreases with the number of reflections . the sound power of the sound fraction which can pass from one measuring track to the other measuring track is thus negligible with respect to the measuring result and can therefore not falsify the measuring result . to achieve an optimum result , distance 17 between the transducer pairs or measuring tracks should be great compared to height 16 of the transport channel , the distance between two adjacent tracks being for example at least five times as great as the height of the transport channel . fig3 a , b show an embodiment of an inventive ultrasonic transducer assembly as can be used in connection with the sheet material testing apparatus described in fig1 and 2 . fig3 a shows a plan view of an embodiment of a transducer assembly with housing 50 having insets 51 or cavities open toward a planar surface defined by an outer periphery of the housing for receiving transduces 20 . each transducer is fixed in position by corresponding knobs 52 . fig3 b shows the transducer assembly in a sectional view . cutting line a — a is shown in fig3 a . housing 50 is connected detachably with board 40 via a snap not shown here . the ultrasonic transducer assembly comprises a plurality of transducers 20 disposed side by side preferably equidistantly . in the embodiment shown here , e . g . four transmitters are disposed on common elastic element 41 . element 41 can be made for example of foam disposed on board 40 . of course , each transmitter 20 can also be disposed on single elastic element 41 , e . g . a spring . in both cases the transducers are disposed on the elastic element on the side of the transducer opposite the sound - emitting or sound - receiving side . the sound - emitting side of transducers 20 can additionally be provided with a deadening layer not shown here . said layer is optional and serves to avoid standing waves . transducers 20 are positioned between fastening knobs 52 and elastic element 41 such that the sound axes of the transmitters are aligned exactly with the receivers not shown here . cavity 51 is left on the side walls of the transducers . the cavity has the form of a hollow cylinder whose diameter is greater than the diameter of the transducer . this has the advantage that transducers 20 undergo no appreciable attenuation through the mounting during operation since the transducers are held so as to oscillate almost freely with a force corresponding for example to five times the weight of the transducer . the inventive mounting of the transducers permits the sound power emitted by the transducers in the resonance region to be reduced only negligibly . one can thus achieve a good signal yield even in transmission measurement with small transducers . | 6 |
referring now to the drawings in detail wherein like numbers represent like elements throughout , fig1 illustrates a schematic view of an assembly , generally identified 10 , as it would be configured in accordance with the present invention . the assembly 10 is comprised of at least one blind spot or “ proximity ” sensor 12 , at least one plc 14 and at least one light fixture 16 , the light fixture 16 having a visual indicator or a light emission component 18 coupled to it . the sensor 12 , plc 14 and fixture 16 are each provided with an electrical supply source ( not shown ), such as a battery . alternatively , the power to the assembly 10 could be provided via an electrical connection to the vehicle . the blind spot sensor 12 is positioned so as to detect the presence of a moving object ( not shown ) that enters a blind spot 11 . the sensor 12 is electrically connected 13 to , or wirelessly in communication with , the plc 14 . when an object enters the blind spot 11 , the plc 14 is activated and begins a timing function . this timing function is programmable to set the plc 14 in accordance with a desired period of time , such as 10 to 15 seconds . the plc 14 can also be configured to eliminate increased power consumption due to the plc 14 being required to “ listen ” for incoming signals from the sensor 12 . once activated , the plc 14 counts the time that the object continues to be in the blind spot 11 via a timer 24 . once the pre - programmed amount of time passes , the plc 14 actuates the fixture 16 that is electrically connected 15 to , or wirelessly in communication with , the plc 14 . the visual indicator portion 18 of the fixture 16 emits light 17 via a plurality of diodes or backlit screen with a message that is visualized by the driver of the object that is in the blind spot 11 . see fig3 a and 3b . although the schematic illustrated in fig1 shows the assembly 10 as having its elements “ hard - wired ” to one another , it is to be understood that the elements of the assembly 10 could also use wireless technology to accomplish the same functionality and wireless communication between the elements shown is within the scope of the present invention . it is also within the scope of the present invention to use a combination of hard - wired and wireless components or elements in the assembly 10 and such is not a limitation of the present invention . further , it is also possible with the assembly 10 of the present invention that each fixture 16 is electronically - driven by its own plc 14 . that is , the present invention is not limited to a single plc 14 as a processor for the complete assembly 10 . it is within the scope of the present invention that the use of more than one plc 14 is contemplated and such is not a limitation of the present invention . the present invention also implements means to adjust the intensity of the light emitted 17 from the visual indicator portion 18 depending on a secondary sensor 19 that senses ambient light conditions . this ambient light sensor 19 is electrically connected 21 to , or wirelessly in communication with , the plc 14 . in situations where the assembly 10 is used in full daylight , the intensity of the light emitted 17 is greater . at dusk , the emitted light intensity can be lessened . in full darkness , the intensity can be minimal . the key point here is that the light intensity is adjustable based on the ambient light that is sensed . in application , the proximity sensor 12 can be mounted , for example , at a number of locations 31 on the tractor 32 and / or a number of locations 33 on the trailer 34 of a representative tractor - trailer combination 30 . see fig2 and 4 . the proximity sensor 12 is adjustable for size and distance , which corresponds roughly to multiple blind spots 42 , 44 , 46 that are created at various points relative to the combination 30 . the plc 14 can be positioned virtually anywhere within the combination 30 , but would most likely be placed within the cab of the tractor 32 . although specific blind spots 42 , 44 , 46 are shown , it is to be understood that such blind spots are vehicle - specific and are illustrated here as representative only . further , the location of the proximity sensor 12 and the ambient light sensor 19 at points along the tractor 32 and trailer 34 can vary and such variance is within the scope of the present invention , as is the number of proximity sensors 12 used . referring now to fig3 a and 3b , shows a representative light fixture , generally identified 50 , which is the counterpart of the element 12 shown in the schematic diagram of fig1 , that is attachable to the tractor 32 or trailer 34 of the combination 30 . to reduce drag on the combination 30 , this inventor intends that the fixture 50 be a three - sided structure that is configured in a somewhat triangular shape when viewed from the top of the fixture 50 , as shown in fig3 a and 3b . the fixture 50 , or several of them , would be placed at a point or a number of points 31 , 33 along the tractor 32 or the trailer 34 , respectively , or possibly both . see fig4 . proper placement of the light fixture 50 and its light emissive element is important . as illustrated , the light fixture 50 is shown as a triangularly - shaped structure 52 having a rearwardly - directed face 54 . this face 54 is the one facing other vehicles that may be in the blind spot of the tractor - trailer combination 30 . the lighted or backlit lighting and lettering , words , symbols or other warning indicia 56 are positioned along the face 54 such that the driver of a vehicle 60 within the blind spots 42 , 44 , 46 can easily visualize them . again , see fig3 a and 3b . though not limiting , this inventor believes that the lettering in a preferred embodiment would be , for example , “ you are in my blind spot .” it is also within the scope of the present invention that more than one message could be displayed using the warning indicia 56 . for example , it is possible that the “ you are in my blind spot ” phrase could be followed by the message “ you need to move ,” which would then indicate to the driver of the vehicle 60 in that blind spot 42 needs to move out of that blind spot . these two phrases could be sequentially repeated until the proximity sensor 12 has detected that the vehicle 60 is now out of that blind spot 42 . after a second preprogrammed amount of time following departure of the vehicle 60 from the blind spot 42 , the plc 14 will cause the light emission 17 to stop . as alluded to earlier , it is also desirable that the warning indicia 56 not be lit each time a vehicle 60 , 62 enters a blind spot . referring back to fig2 , for example , it will be appreciated that a vehicle 60 passing the combination 30 on the tractor driver &# 39 ; s side would enter the blind spot 42 . this would actuate the plc 14 to start a counting functionality via the timer 24 . however , and because the vehicle 60 is moving quickly through the blind spot 42 , the proximity sensor 12 will signal the non - existence of the vehicle 60 within that blind spot 42 and the fixture 50 will not be actuated . if the vehicle 60 lingers within that blind spot 42 for the preprogrammed period of time , however , the timer 24 will signal the plc 14 to send a signal to the fixture 16 , thereby actuating the light emission portion 18 of the assembly 10 and warn the driver of the vehicle 60 within the blind spot 42 that he or she should move out of that blind spot 42 . further , no light 17 is emitted when a vehicle 62 is wholly outside the blind spot 42 or passes through it within the pre - set amount of time as described above . the same functionality is true of blind spots 44 and 46 . further , and as was also alluded to previously , the assembly 10 utilizes an ambient light sensor 19 which can send a constant feed to the plc 14 such that actuation of the light emission portion 18 can be controlled in a way that adjusts the intensity or brightness of the light 17 being emitted by the fixture 50 . during bright sunny days , the intensity would need to be greater than it would be in the dark . the plc 14 can control the amount light 17 being emitted depending on the ambient light being detected by the sensor 19 as may be desired or required in order to optimize the ability of the other driver to visualize the warning . it is also desirable for the foregoing functionality to be inoperative when the engine ( not shown ) of the tractor - trailer combination 30 not running in traffic , such as when the combination 30 is parked and even though the engine may be idling , which can be for extended periods of time . it is , however , desirable for the foregoing functionality to be fully operative when the engine is running and in traffic , such as when the tractor - trailer combination 30 is not moving in traffic or when the combination 30 is stopped at an intersection . the key notion here is that the functionality be discontinued whenever the combination is not moving , or not soon to be moving , in traffic . lastly , it is also desirable to adapt the foregoing functionality to an auditory mode or other visual mode , both of which are incorporated here by reference though not completely disclosed in a detailed embodiment . as referred to in the claims below , the tractor - trailer combination 30 can be referred to simply as “ a first vehicle and / or a trailer .” such “ first vehicle ” may be any large motor vehicle such as a straight truck , a bus , a motor home , among others that may have been mentioned in this detailed description or elsewhere in this disclosure . the vehicles 60 , 62 which may drive through or remain within a blind spot can be referred to in the claims below simply as “ a second vehicle .” such “ second vehicle ” may be any large or small motor vehicle , but would typically comprise an automobile or small truck , among others that may have been mentioned in this detailed description or elsewhere in this disclosure . | 1 |
for the purpose of promoting an understanding of the principles of the invention , reference will now be made to preferred embodiments and specific language will be used to describe the same . it will nevertheless be understood that no limitation of the scope of the invention is thereby intended , such alterations and further modifications in the illustrated device , and such further applications of the principles of the invention as illustrated therein being contemplated as would normally occur to one skilled in the art to which the invention relates . as previously indicated , the present invention uses an air - permeable and adhesive - permeable “ cloth ” material to hold loose fill insulation in position in a wall cavity until the inner wall material can be installed . the cloth is preferably installed by gluing it to the vertical studs with a flowable adhesive that is applied with a roller . referring to the figures , fig1 shows the support skeleton for the inner walls of a building structure . the structure includes a number of vertically extending studs 1 mounted between lower joists 2 and upper joists 3 . the studs 1 are typically spaced uniformly from one another except where windows or corners interrupt the even spacing . when this happens , small cavities 4 are created . in either case though , a number of wall spaces opening toward the interior are formed between each adjoining pair of vertical studs . after the outer wall material 6 has been installed , it is desirable to place insulation in the wall spaces before the inner wall material 7 is installed . with this method , there is no need to remove part of the inner wall to install the insulation . to support the insulation before the inner wall is installed however , a support material must be placed where the inner wall will be . the support material must keep the insulation material completely back in the wall cavity , so that the inner wall may be installed flush against the studs . even ½ inch of bowing of the insulation may mean that the drywall cannot be installed properly . further , the support material should allow air to escape from the cavity as the insulation material is being blown in . this also helps to keep the insulation material from extending outward from the wall cavity . to accomplish these goals , an air - permeable and adhesive - permeable “ cloth ” material 8 is used to hold the loose fill insulation in position until the inner wall material can be installed . the cloth is secured to the studs using a flowable adhesive that can be “ painted ” on with a roller . the adhesive is painted onto the areas of cloth that overlie the stud face . as it soaks through the cloth and dries , it secures the cloth to the stud face . more specifically describing the cloth material , a polypropylene cloth is preferably used as the air - permeable / adhesive - permeable material . the most preferred material is a polypropylene encapsulated material sold under the trade name insulweb ®. the air - permeable / adhesive - permeable material preferably weighs between about 1 . 0 and 1 . 5 ounces per square yard , with a weight of 1 . 25 ounces per square yard being most preferred . the material preferably has a thickness of between 6 and 10 mils , with a thickness of 8 mils being most preferred . the danier per filament is preferably 6 - 10 , and is most preferably 8 . the most preferred cloth material has a mullen burst of at least about 35 psi . the sheet grab tensile md , and the sheet grab tensile xd are both preferably at least about 35 lbs ., while the trapezoid tear md and the trapezoid tear xd are both preferably at least about 18 lbs . the probe is preferably at least about 12 lbs ., and the melting point is preferably at least about 300 f , and is most preferably between 325 and 335 f . the specific gravity is preferably about 0 . 90 . the cloth is secured - to the stud faces using a flowable adhesive that is applied with a roller . the adhesive is preferably a latex adhesive that can be applied like latex paint . most preferably , a latex fabric adhesive such as bridges - smith fabric adhesive d is used . that adhesive dries in 20 to 45 minutes , depending on humidity , etc ., and holds with a force of at least about 4 psi after 10 minutes of drying time , a force of at least about 8 psi after 25 minutes of drying time ( at 90 % humidity ), and a force of at least about 14 psi when fully dry . in cold weather it may be preferable to use a hydrocarbon adhesive such as capital adhesive product # 3004 . the cloth is preferably installed by initially securing its upper and lower edges to the upper and lower wall plates with staples , nails , tacks , tape , glue , or some other fastener that can be installed quickly . then , the cloth material is “ permanently ” secured to each of the vertical studs by “ painting ” the adhesive onto the cloth ( where it covers the stud face ) with a brush or roller , and allowing the adhesive to begin drying . the use of the cloth material and the brush or roller makes a more secure attachment since the adhesive covers the entire stud face when applied that way , and since the number of strands of material that are glued to the stud face is increased with this relatively dense - woven cloth . in the most preferred embodiment , the air - permeable and adhesive - permeable cloth 8 is first stapled in the upper right comer to the top plate ( joist ) 3 using standard construction staples 9 . it is preferred to allow several inches excess past the corner so that excess cloth is provided on each end to provide a handhold for stretching and to compensate for cutting errors . the cloth is stapled across the top plate 3 every two to six inches pulling the cloth tight on the go . the top of the cloth is kept in alignment with top plate 3 . when tape is used to secure the cloth ( such as with metal studs ), a piece of tape is used every foot or so . preferably the tape is double - stick ( also referred to as double - backed or double - sided tape ) adhesive tape , although single - sided tape may alternatively be used . once the cloth is stapled to top plate 3 , it is stretched taunt in the middle towards the bottom plate 2 and stapled there . then the cloth is stapled to the bottom plate 2 every 2 to 6 inches , stretching on the go and working from the middle out to the corners . after the upper and lower edges have been secured to the upper and lower plates , it is preferred to also secure the cloth to at least some of the vertical studs to initially hold the cloth in place . most preferably , the comer vertical studs are stapled every 4 to 12 inches stretching from the middle upward and downward . the foregoing method is preferably used on each wall to be insulated , covering the whole wall . once the cloth is in place it is easily cut to uncover any aperture areas required such as windows , doors , electrical boxes , plumbing , etc . after cloth 8 has been stapled to plates 2 and 3 , and to some of studs 1 , the cloth is glued to the face of the vertical studs 1 for the whole length of the stud . the adhesive should be applied to that it is substantially smooth and flat relative to the stud face . this can be accomplished by applying the adhesive with a common paint roller . the adhesive is allowed to begin drying , usually for about 10 - 30 minutes , depending on temperature , humidity , etc . one advantage of the present invention is that it provides feedback as to the quality of the bond between the cloth and the stud . specifically , where the adhesive is securely holding the cloth to the stud ( i . e ., the cloth is in intimate contact with the stud and the adhesive is dry ), the cloth and adhesive will be substantially transparent and the installer will see the wood - colored stud surface very clearly through the cloth . alternatively , when the bond is not good ( such as where adhesive was not applied , or where the adhesive is not dry ), the installer will not clearly see the wood - colored stud surface , but will instead see the milky - white color of the cloth and adhesive . thus , one can look at the color of the cloth along the studs , and can easily see if and where there is poor adhesion . touch - ups can then be made where necessary before the wall is installed . cellulose insulation 10 is blown into the cavities formed by the studs and cloth , preferably through a hose with a “ wand ” ( hereinafter referred to as an installation tube ) attached to the end . in the most preferred embodiments the installation tube is an aluminum tube approximately 2 inches in diameter ( inner diameter ), and about 48 inches long . the four - foot length is preferred since it is easy to maneuver , yet also allows the installer to stand on the floor and still insulate above windows , doors , etc ., although a shorter tube may be preferred for some areas . the tube is preferably beveled at the end , such as a 45 bevel . using the installation tube , an aperture 11 is punched into cloth 8 a little off - center of each cavity . in one preferred embodiment the punch hole ( aperture ) is positioned about 40 inches off the floor . although the height off the floor will depend in part on operator height and preference , it has been found that placing the aperture about 40 inches off the floor generally works best for an eight foot tall cavity . the cellulose is propelled to the cavity by any suitable blowing means , preferably an air blower 12 with a hose 13 for directing and placing the insulation , as noted above . hose 13 may be virtually any length and diameter consistent with the delivery rate of the cellulose blowing machine being used . more specifically describing the preferred mode of installation , the installation tube is inserted into the cavity through the punch hole and is pushed downward to within a few inches of the bottom plate . the angled end of the tube is turned away from the operator and the blowing means is started . as the cellulose material is delivered , the hose is withdrawn with a series of small upward and downward jerks as each layer beneath the end of the hose is filled . if during withdrawal , pockets form that are not fully packed ( sometimes vertical runs of wire 5 will cause this ), the tube can be pushed into those areas to complete the filling . when the punched hole is reached , the hose is turned upward and pushed about six inches above the hole and paused until enough cellulose has been delivered to effect a filter function . then the installation tube is pushed to the top of the cavity and withdrawn in a series of small downward and upward jerks . as described above , any pockets that form are filled by pushing the tube into them . for cavities that are too small for the installation tube to be used effectively ( typically one to two inches in width or height ), a one inch nozzle is placed on the end of the hose . the nozzle is inserted through the cloth in as many positions as needed to fill the cavity . for cavities that are too small for the one - inch diameter nozzle , a foam - in - place insulation material may be used . it is to be appreciated that the present invention provides a method of supporting the insulation that minimizes bulging and therefore keeps the insulation material from extending beyond the vertical stud face . additionally , the smoothed and flattened adhesive 20 totally excludes cellulose from the faces of the studding . thus , with this method a denser pack of insulation may be used , improving insulating efficiency while still allowing a flush fit of the interior drywall . it is also to be appreciated that the present invention provides for a faster installation , making the process more efficient and economical . the use of rollers to apply the adhesive saves substantial time from the caulking gun method of the prior art . lastly , the strength of the bond between the cloth and the stud is improved over the strength of the bond when netting and a “ caulking gun adhesive ” were used . the area being held by the adhesive is greater since the adhesive more completely covers the stud face , and the number of strands of material being secured ( per square inch ) is greater with the cloth than it was with the netting . while the invention has been illustrated and described in detail in the foregoing description , the same is to be considered as illustrative and not restrictive in character , it being understood that only the preferred embodiment has been shown and described and that all changes and modifications that come within the spirit of the invention are desired to be protected . | 4 |
referring now to the drawings in detail , and more particularly to fig1 the reference character 11 represents a rack 11 , which may be easily inserted and removed from tank 12 . rack 11 and tank 12 form a low volume photosensitive material processing vessel 13 . when rack 11 is inserted in tank 12 , a space 10 is formed . rack 11 and tank 12 are designed in a manner to minimize the volume of space 10 . the outlet 6 of vessel 13 is connected to recirculating pump 17 via conduit 16 . recirculating pump 17 is connected to manifold 20 via conduit 5 and manifold 20 is connected to filter 25 via conduit 24 . filter 25 is connected to heat exchanger 26 and heat exchanger 26 is connected to control logic 29 via wire 9 . control logic 29 is connected to heat exchanger 26 via wire 8 and sensor 27 is connected to control logic 29 via wire 28 . metering pumps 7 , 18 and 19 are respectively connected to manifold 20 via conduits 21 , 22 and 23 . the photographic processing chemicals that comprise the photographic solution are placed in metering pumps 7 , 18 and 19 . pumps 7 , 18 and 19 are used to place the correct amount of chemicals in manifold 20 . manifold 20 introduces the photographic processing solution into conduit 24 . the photographic processing solution flows into filter 25 via conduit 24 . filter 25 removes particulate matter and dirt that may be contained in the photographic processing solution . after the photographic processing solution has been filtered , the solution enters heat exchanger 26 . sensor 27 senses the temperature of the solution and transmits the temperature of the solution to control logic 29 via wire 28 . for example , control logic 29 is the series cn 310 solid state temperature controller manufactured by omega engineering , inc . of 1 omega drive , stamford , conn . 06907 . logic 29 compares the solution temperature sensed by sensor 27 and the temperature that exchanger 26 transmitted to logic 29 via wire 8 . logic 29 will inform exchanger 26 , via wire 9 to add or remove heat from the solution . thus , logic 29 and heat exchanger 26 modify the temperature of the solution and maintain the solution temperature at the desired level . at this point the solution enters vessel 13 via inlet 4 . when vessel 13 contains too much solution the excess solution will be removed by drain 14 and flow into reservoir 15 . the remaining solution will circulate through space 10 and reach outlet line 6 . thereupon , the solution will pass from outlet 6 to conduit line 16 to recirculation pump 17 . the photographic solution contained in the apparatus of this invention , when exposed to the photosensitive material , will reach a seasoned state more rapidly than prior art systems , because the volume of the photographic processing solution is less . fig2 is a schematic diagram showing rack 11 positioned within tank 12 . handle section 11a of rack 11 includes a panel 40 . panel 40 has a cutout section 41 which allows driven roller 43 of rack section 11a to rotate in the vicinity of panel 40 . panel 40 also has a cutout section 44 which allows driven roller 51 of rack section 11b to rotate in the vicinity of panel 40 . driving roller 45 engages roller 43 . driving roller 46 drives driven roller 47 . rollers 46 and 47 are attached to section 11a . bottom plate 48 is connected to panel 40 and side plates 49 . handle 50 is connected to side plates 49 so that an individual may be able to grasp handle 50 and move rack 11 in the direction indicated by arrow x , thereby inserting rack 11 into tank 12 . this is the position shown in fig2 . handle 50 may also be grasped and moved in the direction indicated by arrow y to remove rack 11 from tank 12 . top section 11b of rack 11 includes panel 52 and driving roller 51 and center section 11c of rack 11 includes panels 53 and 54 and driving roller 60 . bottom section 11d of rack 11 includes panels 61 and 62 , driving roller 34 and driven roller 33 . tank section 12a includes a housing section 65 . tank section 12b include sides 71 . tank section 12c includes driven rollers 73 and 74 and sides 325 . roller 73 is connected to plate 85 and driven roller 74 is connected to plate 76 . plates 85 and 76 are connected to side 325 . bottom section 12d of tank 12 includes bottom panel 77 and sides 78 . outlet conduit 6 passes through panel 77 and inlet conduit 4 passes through side 71 . photosensitive material 80 may be a continuous web or cut sheets of film or photographic paper . the emulsion side of material 80 may face either rack 11 or tank 12 . material 80 passes in space 10 between rollers 45 and 43 , roller 51 and side 71 , rollers 73 and 60 , rollers 34 and 33 , rollers 60 and 74 , roller 51 and side 71 and between rollers 46 and 47 . photographic processing solution 75 reaches a level 86 within tank 12 . photographic solution 75 will be contained between level 86 , space 10 and photosensitive material 80 . thus , a small volume of photographic solution 75 will be on both sides of photosensitive material 80 between rack 11 and tank 12 . rack 11 and tank 12 respectively comprise : handle sections 11a and 12a ; top sections 11b and 12b ; center sections 11c and 12c ; and bottom sections 11d and 12d . tank 12 and rack 11 respectively have textured surfaces 300 and 301 . the manner in which surfaces 300 and 301 function will be more fully set forth in the description of fig5 and fig6 . the length of rack 11 and tank 12 may be adjusted for different processing step in the photographic process . if a vessel shorter than vessel 13 of fig2 is required , center rack section 11c and center tank section 12c may be respectively deleted from rack 11 and tank 12 . if a longer vessel than vessel 13 of fig2 is required , one or more top sections 11b and 12b and one or more center sections 11c and 12c may be respectively connected between present sections 11c and 12c and present sections 11d and 12d . fig3 is a side view of roller 51 and textured surface 301 of rack 11 . rollers 60 and 34 are connected in a manner similar to the connection of roller 51 of fig3 . panels 40 and 52 of rack 11 respectively have curved portions 83 and 84 . portions 83 and 84 are shaped so that they will match the curvature of the outer surface of roller 51 and minimize the volume of solution 75 that will be contained between roller 51 and portions 83 and 84 . thus , the least amount of solution 75 is used to fill the voids around roller 51 . fig4 is a side view of roller 74 and roller 60 respectively of tank section 12c of fig2 . panel 53 and panel 54 with textured surface 301 are shaped so that they will match the curvature of roller 60 and minimize the volume of solution 75 that will be contained between the shaped portions of panels 53 and 54 . panel 52 with textured surface 301 butts against panel 53 and panel 61 with textured surface 301 butts against panel 54 . roller 73 of fig2 is connected in the same manner as roller 74 . retainer 88 has a notch 89 . one end of spring 90 is connected to notch 89 and the other end of spring 90 is connected to the hub of roller 74 . one end of plate 91 is connected to retainer 88 and the other end of plate 91 is connected to textured surface 300 . one end of plate 92 is connected to retainer 88 and the other end of plate 92 is connected to textured surface 300 . plates 91 and 92 are connected to retainer 88 and surface 300 in a manner to minimize the amount of surface contact roller 74 has with space 10 . retainer 88 is connected to back plate 76 by any known fastening means , i . e ., bolts , screws , etc . plate 76 is connected to side 325 of tank section 12c to minimize the volume of solution 75 that exists in the voids between the above surfaces , plates , rollers and tank . photosensitive material 80 passes between rollers 60 and 74 so that driving roller 60 may move photosensitive material 80 in space 10 between textured surfaces 300 and 301 . roller 74 is spring loaded towards back plate 87 so that roller 74 may be moved out of the way when rack 11 is seated in tank 12 . when rack 11 is properly seated in tank 12 roller 74 will move in the direction shown by arrow a until it engages driving roller 60 . fig5 is a perspective drawing of textured fluid - bearing surface 301 which is affixed to rack 11 of fig2 . textured surface 301 is textured by any known process , e . g ., knurling , molded , edm electro - discharged machined or applied . knurls 95 are shown on surface 301 . the texturing improves the flow of solution 75 between the photosensitive material 80 and rack 11 . this yields a bearing of fluid aiding photosensitive material transport through rack 11 . it also allows for improved circulation of solution 75 and makes it easier for particulate matter to escape direct and damaging contact with photosensitive material 80 . textured surface 301 provides space between rack 11 and space 10 to prevent particulate matter from scratching , abrading or pressure sensitizing photosensitive material 80 . fig6 is a perspective drawing of textured fluid bearing surface 300 of tank 12 . textured surface 300 is textured by any known process , e . g ., knurling , molded , edm electro - discharged machined or applied . knurls 96 are shown on surface 300 . texturing improves the flow of solution 75 between photosensitive material 80 and tank 12 . this yields a bearing of fluid aiding photosensitive material transport through tank 12 . it also allows for improved circulation of the solution 75 and makes it easier for particulate matter to escape direct and damaging contact with photosensitive material 80 . textured surface 300 provides space between tank 12 and space 10 to prevent particulate matter from scratching , abrading or pressure sensitizing photosensitive material 80 . fig7 is a perspective drawing of slot nozzle 97 . slot 98 runs from top surface 99 of slot nozzle 97 to bottom surface 100 of slot nozzle 97 . nozzle 97 may be affixed to tank 12 or rack 11 ( fig2 ) by inserting any known fastening means , i . e ., bolts , rivets , screws , etc . in orifices 101 and attaching the fastening means to tank 12 or rack 11 . surface 100 will be coincident with the inside wall of tank 12 . processing solution 75 will enter slot 98 near top surface 99 and exit slot 98 near bottom surface 100 . fig8 is a bottom view of slot nozzle 97 of fig7 . slot 98 will distribute fresh processing solution along width x . width x will be wider than the width of photosensitive material 80 . the depth or thickness y of slot 98 is such that y / x ( 100 ) is less than 1 . fig9 is a perspective drawing of a plurality of slot nozzles 97 in processing tank 12 . nozzle 97 is connected to tank 12 in such a manner that surface 100 will be coincident with the inner wall of textured surface 300 of tank 12 . fresh processing solution 75 will enter port 335 and conduit 330 of nozzle 97 in the direction indicated by arrow a and exit nozzle 97 in the direction indicated by arrow b . to achieve the desired photographic reaction between the processing solution and the surface of the photosensitive material the position and quantity of nozzles 97 may be varied by one skilled in the art . fig1 is a side view of a plurality of slot nozzles 97 positioned within tank 12 . surface 100 ( not shown ) of slot nozzles 97 are coincident with the inner wall of textured surface 300 of tank 12 . photosensitive material 80 may be a continuous web or cut sheets of film or photographic paper . the emulsion side of material 80 may face either rack 11 or tank 12 . material 80 passes in space 10 between roller 45 and 43 , roller 51 , rollers 73 and 60 , rollers 34 and 33 , rollers 60 and 74 , roller 51 and between rollers 46 and 47 . photographic processing solution 75 reaches a level 86 within tank 12 . photographic solution 75 will be contained between level 86 , space 10 and photosensitive material 80 . thus , a small volume of photographic solution 75 will be on both sides of photosensitive material 80 between rack 11 and tank 12 . slot nozzles 97 &# 39 ; are positioned in the wall of tank 12 below rollers 43 , 45 and 51 . nozzles 97 &# 39 ; are removable for servicing or replacement . as photosensitive material 80 is processed , a boundary layer of exhausted processing solution forms in space 10 between material 80 and the wall of tank 12 . the boundary layer of exhausted solution is broken up by fresh processing solution 75 that is delivered to material 80 by slot nozzles 97 &# 39 ;. slot nozzles 97 &# 34 ; are positioned in the wall of tank 12 below rollers 73 and 60 . nozzles 97 &# 39 ;&# 39 ; are removable for servicing or replacement . as photosensitive material 80 is processed , a boundary layer of exhausted processing solution forms in space 10 between material 80 and the wall of tank 12 . the boundary layer of exhausted solution is broken up by fresh processing solution 75 that is delivered to material 80 by slot nozzles 97 &# 34 ;. slot nozzles 97 &# 39 ;&# 39 ;&# 39 ; are positioned in the wall of tank 12 below rollers 74 and 60 and above rollers 33 and 34 . nozzles 97 &# 39 ;&# 39 ;&# 39 ; are removable for servicing or replacement . as photosensitive material 80 is processed , a boundary layer of exhausted processing solution forms in space 10 between material 80 and the wall of tank 12 . the boundary layer of exhausted solution is broken up by fresh processing solution 75 that is delivered to material 80 by slot nozzles 97 &# 39 ;&# 39 ;&# 39 ;. slot nozzles 97 iv are positioned in the wall of tank 12 below rollers 46 , 47 and 51 . as photosensitive material 80 is processed , a boundary layer of exhausted processing solution forms in space 10 between material 80 and the wall of tank 12 . nozzles 97 iv are removable for servicing or replacement . the boundary layer of exhausted solution is broken up by fresh solution 75 that is delivered to material 80 by slot nozzle 97 iv . fig1 is a side view of a plurality of slot nozzles 97 positioned within rack 11 . surface 100 ( not shown ) of slot nozzles 97 are coincident with the inner wall of textured surface 301 of rack 11 . photosensitive material 80 may be a continuous web or cut sheets of film or photographic paper . the emulsion side of material 80 may face either rack 11 or tank 12 . material 80 passes in space 10 between rollers 45 and 43 , roller 51 , rollers 73 and 60 , rollers 34 and 33 , rollers 60 and 74 , roller 51 and between rollers 46 and 47 . photographic processing solution 75 reaches a level 86 within tank 12 . photographic solution 75 will be contained between level 86 , space 10 and photosensitive material 80 . thus , a small volume of photographic solution 75 will be on both sides of photosensitive material 80 between rack 11 and tank 12 . slot nozzles 97 &# 39 ; are positioned in the wall of rack 11 below rollers 43 , 45 and 51 . as photosensitive material 80 is processed , a boundary layer of exhausted processing solution forms in space 10 between material 80 and the wall of rack 11 . the boundary layer of exhausted solution is broken up by fresh solution 75 that is delivered to material 80 by slot nozzles 97 &# 39 ;. slot nozzles 97 &# 34 ; are positioned in the wall of rack 11 below rollers 73 and 60 . as photosensitive material 80 is processed , a boundary layer of exhausted processing solution forms in space 10 between material 80 and the wall of rack 11 . the boundary layer of exhausted solution is broken up by fresh solution 75 that is delivered to material 80 by slot nozzles 97 &# 34 ;. slot nozzles 97 &# 39 ;&# 39 ;&# 39 ; are positioned in the wall of rack 11 below rollers 74 and 60 and above rollers 33 and 34 . as photosensitive material 80 is processed , a boundary layer of exhausted processing solution forms in space 10 between material 80 and the wall of rack 11 . the boundary layer of exhausted solution is broken up by fresh solution 75 that is delivered by material 80 by slot nozzle 97 &# 39 ;&# 39 ;&# 39 ;. slot nozzles 97 iv are positioned in the wall of rack 11 below rollers 46 , 47 and 51 . as photosensitive material 80 is processed , a boundary layer of exhausted processing solution forms in space 10 between material 80 and the wall of rack 11 . the boundary layer of exhausted solution is broken up by fresh solution 75 that is delivered to material 80 by slot nozzle 97 iv . the above specification describes a new and improved apparatus for processing photosensitive materials . it is realized that the above description may indicate to those skilled in the art additional ways in which the principles of this invention may be used without departing from the spirit . it is , therefore , intended that this invention be limited only by the scope of the appended claims . | 6 |
referring now to the drawings , wherein similar parts of the instant mobile marketing map ( immm ) program 10 are identified by like reference numerals , there is seen in fig1 a block diagram of the instant mobile marketing map ( immm ) program 10 with a key 12 indicating the meaning of the different symbols and lines found on the diagram and block 14 indicating the four marketing methods . the prior art internet based map block 16 is initially used to locate a specific store location and then the instant store map system ( ism ) 18 can be brought up where the user can be anywhere with internet access designated in block 20 and search to a map indicated in block 22 before going to the search product in block 24 or to the map block 26 . from map block 26 the user can search by category indicated in block 28 or enter the product shown in block 30 and then go to search results and marketing methods one and two indicated in block 32 where you can see if it is in stock 34 or receive a pop - up ( marketing method 1 ) and item from top of the list ( marketing method 2 ) as indicated by block 36 or go directly to choosing the product while receiving marketing method three depicted in block 38 . it is anticipated by this disclosure of the present invention , that deployment of the invention may be done using the internet , wifi , lan , wan , wwan , rfid and any other wireless type of localized system of communicating . after choosing the product user can get directions to the product indicated in block 40 where the user can get directions to product from store location or from any location indicated in block 42 or just get the product indicated in block 44 . additionally after map box 26 user can search by zooming marketing method four indicated in block 46 where the user can zoom to a particular product or can zoom by sub - categories ( layers ) indicated in block 48 or choose the general product indicated in block 50 . then user can get directions to all similar products indicated in block 54 . while in search by zooming marketing method four indicated in block 46 user can select the precise product indicated in block 56 and go to get directions to the product as indicated in block 49 or choose product search results and be routed as indicated in block 32 . fig2 shows an embodiment of the delivery of the computer implemented web - based system over the internet . the end use application ( service customer ) is a website that is external to the system and that communicates with the system via web services from the customer website or directly from the customer website &# 39 ; s end user &# 39 ; s client browser . as shown , the system ma be distributed across multiple computers on a network . this consists of one or more web servers ( or web farm ), which collect data and process content recommendation requests . the web servers pass data to one or more application databases via a message queuing system that allows the web servers to continue processing while the much slower database servers feed the data into permanent storage , such as non - volatile ram , direct - attached raid array , network attached storage ( nas ), or storage area network ( san ). additionally , one or more data centers are used to retrieve floor plan maps and other data from an application database and uses the data to generate the delivered floor plans and product information as well as advertising associated to the products and related products . the resulting web - based computer implemented instant mobile marketing map ( immm ) system and instant store map system ( ism ) works on any fixed or mobile computer able to access the internet . it is anticipated that the system will also work wirelessly through the use of an application ( also known as “ apps ”) located on a mobile phone or smartphone . the system may also use the smartphone &# 39 ; s gps system to locate the user and deliver the floor plan of the store / facility being visited . moreover , the system may collect customer use data for the purpose of targeting future customers , and may be connected to social media sites for product / item related communications therein . fig3 depicts a block diagram of the prior art internet base map system 16 where the person with the mobile internet device is shown in block 60 can search for the desired store using the internet based device shown in block 62 then find the desire store using the internet based map in block 64 . the person gets the directions to the desired store using the internet based map 16 and once the directions are given an icon with the option to click on the store will appear shown in block 66 . fig4 depicts a block diagram of the instant mobile marketing map ( immm ) program 10 illustrating where the instant store map ( ism ) in block 70 after receiving the information from the prior art internet store map system 16 the person can go directly to ism if they are at the store or heading to a known store or at home or anywhere with internet shown in block 72 . the person can be in route to the store or at the store and see a map of the store floor plan 74 . from the instant store map ( ism ) 70 the person can either search for product as indicated in block 24 ( same as block 26 ) or can choose a department with the ability to zoom in and out of departments entire area shown in block 76 . the person can then choose the general product sub - categories shown in block 78 then choose the product shown in block 80 and the related products are advertised in block 82 . the related products advertised can be related product # 1 in block 84 , and related product # 2 in block 86 along with any additional products . fig5 depicts a continuation of the block diagram of the instant mobile marketing map ( immm ) system 10 where a person using the instant store map ( ism ) 70 , for example after entering the store shown in block 88 searches for the desired product shown in block 90 then enters the product to search for in the mobile internet device shown in block 92 . the person then chooses general similar product shown in block 94 and then ism marketing method 1 and 2 provides general advertisements shown in block 96 and the person chooses specific product shown in block 98 . ism marketing method 3 provides specific advertisements , general information and available coupons shown in block 100 and the person gets directions to the location in the store of the desired product from the instant facility / store map ( ism ) shown in block 102 . fig6 depicts a block diagram of a typical store floor plan 110 that illustrates the different typical department locations , such as hardware shown in block 112 and electronics in block 114 with marketing blocks 11 in the corners illustrating advertisements , general information and available coupons . fig7 depicts a block diagram of an electronics department 114 with the televisions shown in block 119 among other items in that department . fig8 depicts a block diagram of a typical marketing advertisement 116 with the first advertisements displayed as bold outstanding advertisements shown in block 118 then to search by size shown in block 120 and search by price shown in block 122 then smaller advertisements such as televisions 1 , 2 , 3 , etc . along with information and coupons are displayed in successive blocks 124 . fig9 is a block diagram indicates the marketing process after the person has chosen the desired product depicted in block 130 such as a television shown in block 132 with related products shown in block 134 . the related products may consist of dvr &# 39 ; s in block 136 with advertisements in block 138 , antennas in block 140 , blue ray disc players in block 142 , dvd players in block 144 , connection cables in block 146 each having the connections to similar advertisements 138 . fig1 depicts a block diagram of marketing method four 150 , starting with acquisition of the map 26 ( see fig1 ). in this example , the user / customer is searching for a power drill , and the map 26 leads the user to the complete floor plan ( plan view ) of the store 152 , in which numerous departments are shown , such as department 154 , sporting goods 156 , bed and bath 158 , hardware 160 and electronics 162 . as is shown in the sporting goods department 156 , an advertiser can place an ad “ a ” 166 by paying a fee , and as such may be the only advertiser to have an ad 166 on the complete store layout 152 , at this point where the complete store layout 152 is shown on the map . since the user / customer is looking for a power drill , then he or she clicks on the hardware department 160 and the screen zooms in 168 to show more detail within the hardware department 170 . within the zoomed in view of the hardware department 170 there is shown the aisles of power tools 172 and hand tools 174 locations . within the power tools aisle an advertiser may place an ad “ a ” 166 by paying the required fee to do so . the customer / user then clicks to zoom in 168 closer to the power tools aisle 172 , and this reveals greater detail of what is on the shelves , such as power tool a 174 ( power saws ), power tool b 176 , power tool c 172 ( which has the desired product power drills , in this case ) and power tools d 178 . an advertiser ( or another company ) can also pay to have an ad in any of these given locations , such as ad “ a ” 166 as shown here in the power tool d 178 location . by clicking on power tool c 172 which has the desired power drills the customer is searching for , this takes the customer to search results and marketing methods one and two indicated in block 32 of fig1 ( see fig1 ). the instant mobile marketing map ( immm ) program 10 shown in the drawings and described in detail herein disclose arrangements of elements of particular construction and configuration for illustrating preferred embodiments of structure and method of operation of the present application . it is to be understood , however , that elements of different construction and configuration and other arrangements thereof , other than those illustrated and described may be employed for providing a mobile marketing map ( immm ) program 10 in accordance with the spirit of this disclosure , and such changes , alternations and modifications as would occur to those skilled in the art are considered to be within the scope of this design as broadly defined in the appended claims . further , the purpose of the foregoing abstract is to enable the u . s . patent and trademark office and the public generally , and especially the scientists , engineers and practitioners in the art who are not familiar with patent or legal terms or phraseology , to determine quickly from a cursory inspection the nature and essence of the technical disclosure of the application . the abstract is neither intended to define the invention of the application , which is measured by the claims , nor is it intended to be limiting as to the scope of the invention in any way . | 6 |
illustrated schematically in fig1 is one embodiment 10 of an optical fiber ribbon manufacturing apparatus which manufactures optical ribbons in accordance with this invention . the ribbon manufacturing apparatus 10 comprises an optical fiber payout arrangement 20 , a fiber organizer 30 , a vacuum - assisted fiber - aligning guide 40 , a ribbon packaging mechanism 50 , a ribbon advancing mechanism 60 , and ribbon take - up arrangement 90 . the advancing mechanism 60 , which will be described in further detail below , draws the manufactured ribbon 12 and the ribbon components through the manufacturing line 10 . the fig1 apparatus is illustrated in side view in fig1 a . in accordance with this invention , the apparatus components are all aligned to cause the optical fibers 11 and optical fiber ribbon 12 to travel in a predetermined plane of travel denoted p . this plane of travel p , which substantially coincides with the major plane of the manufactured ribbon 12 and includes the axis of travel for the ribbon as denoted by arrow 8 , is a horizontal plane which is seen in fig1 a as line p -- p . as illustrated in fig1 a , and 2 , the payout arrangement 20 directs a plurality of optical fibers 11 into the predetermined plane of travel p . at the same time , the payout arrangement 20 also directs the optical fibers 11 into substantially parallel paths which are substantially parallel and adjacent to the ribbon axis of travel 8 . the payout arrangement minimizes the abrading of fibers , not only at the payout but also at the fibers &# 39 ; entry into fiber guide 40 . as the fibers are preliminarily directed into parallel paths in the predetermined plane of travel , the amount of bending stress and abrasion of the fibers at the entrance of guide 40 are reduced to a minimum . in the optical fiber payout arrangement 20 , a plurality of optical fiber supply reels 22 are advantageously positioned to rotate about axes substantially parallel to the ribbon axis of travel 8 . a plurality of first idler sheaves 24 , one corresponding to each reel 22 , receive the fibers 11 from the reels 22 . preferably , the first idler sheaves 24 rotate on axes substantially parallel to the ribbon axis of travel 8 and are grooved along their circumferences to engage the fibers 11 from reels 22 . a plurality of second idler sheaves 26 , also grooved along their circumferences , are substantially adjacent to the corresponding first idler sheaves 24 , from which corresponding fibers 11 are fed . the second idler sheaves 26 rotate on axes substantially normal to the ribbon axis of travel 8 to direct the fibers 11 into the parallel paths in the predetermined plane of travel as illustrated in fig2 . advantageously , the fibers 11 do not cross or touch in their paths due to the v - shaped arrangement of the second idler sheaves 26 with respect to the ribbon axis of travel 8 . the second idler sheaves 26 furthest from the fiber guide 40 feed the centermost fibers 11 of the ribbon 12 to the guide 40 . each corresponding pair of first and second idler sheaves , 24 and 26 respectively , are coupled so that the path travelled by the corresponding fiber 11 between the two sheaves is substantially normal to the rotational axes of both sheaves to minimize abrasion of fiber 11 by the sheaves . the idler sheaves 24 and 26 have diameters substantially larger than the diameters of the fiber such that optical losses and breakage due to bending are minimized . in the fig . 2 fiber payout arrangement , the optical fibers 11 are helically wrapped about the reels 22 so that the fibers 11 pay out to the sheaves 24 from different points along the rotational axes of the reels 22 . the first idler sheaves 24 are hence mounted on bearings , such as known conventionally in the art , which permit the sheaves 24 to translate , as indicated by arrows 25 , in response to the fibers 11 feeding from the reels 22 so that the fibers 11 can follow their most natural paths into sheaves 24 . this advantageously ensures that fibers 11 are not substantially skewed as they make contact with idler sheaves 24 . as an alternative to the above payout arrangement 20 , or as an additional fiber directing device to control the fibers 11 entering fiber guide 40 is fiber organizer 30 shown in fig1 and 3 . organizer 30 comprises a plurality of flexible tubes 32 , made of a material such as low density polyethylene , and hence bendable at very low stresses . the tubes 32 have interior circumferences substantially larger than the fibers 11 to permit easy fiber insertion and to minimize surface abrasion between the tubes 32 and the corresponding fibers 11 . the tubes 32 have first ends 35 for receiving the fibers 11 from the payout arrangement 20 or reels 22 . the second ends 33 of the tubes 32 , the ends directing the fibers 11 to fiber guide 40 , are held tightly in place with a holder 34 , which in fig3 is illustrated by a platform 36 on which it is mounted an inverted u - shaped cover 38 . the tubes at ends 33 are held in the predetermined plane of travel in fixed parallel relation with one another . the first ends 35 of the tubes 32 are left free to flex and bend in response to the movement of the fibers 11 being fed from the payout which is shown exaggerated in fig3 . as the fibers 11 travel from the first ends 35 to the second ends 33 , they are gradually urged into a coplanar and parallel arrangement . advantageously , the tubes 32 are sufficiently long in their length so that entry of corresponding fibers 11 at any forseeable angle will not cause abrupt deformations of the tubes 32 and hence not cause any abrasion or shock loads to the fibers 11 . shown in fig4 is an illustrative embodiment of the vacuum - assisted fiber - aligning guide 40 which accurately locates and holds fibers 11 in a precisely spaced coplanar array during ribbon manufacture . fiber guide 40 comprises a vacuum housing base 41 formed from a plurality of housing walls 42 mounted air tightly to platform 36 , a surface plate 43 mounted air tightly onto the housing base 41 , an exhaust line 44 for withdrawing a controlled amount of air from a vacuum chamber 45 created by housing base 41 and surface plate 43 , and a spring - mounted cover 46 . the vacuum pump connecting to the exhaust line 44 is not shown . surface plate 43 , which is also illustrated in fig5 comprises a plurality of parallel optical fiber receiving grooves 47 having the predetermined center - to - center spacing desired for the fibers 11 . a plurality of vacuum slots 48 which are located in the bottom of the grooves 47 , lead to vacuum chamber 45 and supply air suction to draw and hold the fibers 11 to the grooves 47 when the vacuum pump is operating . in accordance with this invention , the vacuum - assisted fiber - aligning guide 40 facilitates easy and precise loading of the optical fibers 11 into guide 40 in preparation for ribbon manufacture as depicted in fig6 . the fibers 11 are manually located into respective grooves 47 sequentially and held in their grooves with air suction supplied through the vacuum slots 48 . in the loading operation , a vacuum - blocking device 49 , such as a piece of paper , is placed over all the grooves 47 except for one groove 47 where a fiber 11 is to be placed . as a fiber 11 is placed near the uncovered or exposed groove 47 , air suction through the vacuum slots 48 in the groove 47 attracts the fiber 11 to the uncovered groove 47 and holds the fiber in place . preferably , the groove 47 at one end of the array is chosen as the initial exposed groove ; otherwise , a second vacuum - blocking device will be needed to cover grooves on the other side of the exposed groove . the vacuum slots 48 insure that the located fiber does not dislodge while the other fibers 11 are being located . also , because the located fiber 11 covers the slot or slots 48 of the corresponding groove 47 , the groove no longer attracts the other fibers 11 . after the first fiber 11 has been located , the vacuum - blocking device 49 is moved to expose another groove 47 , preferably one adjacent to the previously exposed groove , and another fiber 11 is located on the surface plate . this is continued until all the fibers 11 have been so located in the grooves . this simple and convenient loading technique , which requires a minimum of apparatus , accurately aligns fibers 11 in a precise array with a predetermined fiber - to - fiber spacing . advantageously , fiber guide 40 and the inventive loading technique eliminate the need to thread fibers through fixed guide channels known in the art which sacrifice fiber alignment for ease of fiber insertion and travels through the channel . after the fibers 11 have been located in their respective grooves 11 with the above loading technique , the spring - mounted cover 46 , comprising a felt pad 39 for cushioning the fibers 11 , is placed over the arrayed fibers 11 to hold them in alignment during ribbon manufacture . in accordance with this invention , the fiber guide 40 advantageously accommodates for cross - sectional variations in the fibers 11 during ribbon manufacture . in the illustrative embodiment , the cover 46 is spring - mounted to apply a controlled downward force s , as illustrated in fig4 which urges the fibers 11 against their respective grooves 47 and yet permits transverse displacements of the fibers 11 passing through guide 40 due to variations in fiber shape and size . also , in the illustrative embodiment , the vacuum pump is left on during ribbon manufacture . air suction through the vacuum slots 48 supplements the spring - mounted cover 46 by continuously vacuum - attracting the fibers 11 to their respective grooves 47 . this flexible hold on the fibers 11 reduces chances of surface abrasion or breakage of the fibers by guide 40 as the fibers are drawn along by advancing means 60 . the loading technique described above and depicted in fig6 is not limited to ribbon manufacture but can be used to easily align fibers for gang splicing , especially where the desired spacing of the fibers to be spliced differs from that of the ribbon structure or where the fibers have not yet been arranged at all . in either case , it may be desirable to use fiber organizer 30 in conjunction with fiber guide 40 ; organizer 30 would then operate to preliminarily position the fibers prior to their placement in guide 40 . while it is desirable in most gang splicing techniques to space the fibers apart at some distance greater than their diameters so that the fibers are not touching , packaging optical fibers in contiguous coplanar arrays as shown in fig8 b conserves space , and hence , is sometimes a more desirable configuration in an optical cable design . also , this configuration provides additional mechanical protection of the fibers in that the fibers support one another . it is apparent that fibers manufactured in a conttiguous array can easily be rearranged using the locating technique and apparatus depicted in fig6 when respacing the fibers for splicing is desired . fig7 illustrates a second embodiment denoted 140 of the vacuum - assisted fiber - aligning guide ( for convenience , shown without the vacuum housing ) which is used advantageously to locate and align a contiguous coplanar array of optical fibers 11 . a block 144 , which mounts onto planar surface plate 145 , forms a reference planar surface 141 substantially parallel to the desired longitudinal axes of fibers 11 . two vacuum slots 147 , to which a controlled degree of vacuum is applied , extend substantially from reference surface 141 in a direction substantially normal to reference surface 141 and are as long as needed to vacuum - attract and draw all the fibers 11 into a coplanar array to surface plate 145 during fiber loading . it is readily apparent that one slot 147 may be sufficient . to load the fibers onto surface plate 145 , a vacuum - blocking device 149 is used to cover the vacuum slots 147 but for a portion of each of the slots being used to vacuum - attract and hold a fiber being placed on surface plate 145 . after placement , a first fiber 11 is then urged against reference surface 141 with an edge 143 of the vacuum - blocking device 149 . the edge 143 is preferably linear to assure parallel abutment of fiber 11 against reference surface 141 . vacuum - blocking device 149 is then moved to expose another portion of the slots 147 , preferably near the previously placed fiber 11 , to locate a second fiber 11 . edge 143 is again used , this time to urge the second fiber 11 ino parallel alignment and abutment with the previously located fiber . this operation continues until all the fibers are arranged into a contiguous coplanar array on surface plate 145 . after the fibers have been located , a cover 146 , with a cushioning layer 148 , is then placed over the fibers . cover 146 is advantageously spring - loaded to apply controlled downward force s &# 39 ; against the aligned fibers 11 . in addition , a spring 142 having a predetermmined force is placed against the furthermost fiber 11 from the reference surface 141 to gently urge the fibers 11 toward block 144 . the forces of the cover 146 and spring 142 maintain a flexible hold on the fibers 11 during ribbon manufacture . also , the vacuum pump may be left on during ribbon manufacture to advantageously supply suction force , which will continuously urge the fibers 11 back into parallel alignment against surface plate 145 . depicted in cross - section in fig8 a and 8b are two illustrative ribbon structures made with ribbon manufacturing apparatus 10 having guides 40 and 140 respectively . both ribbon structures 12 and 12 &# 39 ; comprise a plurality of optical fibers 11 which are packaged in a parallel coplanar array and embedded between two layers 13 of pressure - sensitive adhesive , such as silicone or acrylic adhesive , which are coated on tapes 14 made of polyethylene terphthalate . the viscosity of the adhesive layers advantageously provides sufficient loose packaging of the fibers to permit stress relief , and hence to minimize microbending loss . in addition , in the illustrated ribbon structures , the optical fibers 11 are advantaeously coated with a thick polymer layer , such as disclosed in u . s . pat . application , ser . no . 639 , 912 , filed dec . 11 , 1975 , and assigned to the assignee hereof . the coating , which reduces microbending loss and affords abrasion protection , is applied to the fibers before they are wound onto the optical fiber supply reels 22 in the illustrated apparatus 10 . these particular ribbon structures are easy to separate for splicing purposes . the adhesive backed tapes can easily be pulled apart after they are nicked . the ribbon packaging mechanism 50 illustrated in fig1 comprises two payout reels 51 for feeding the adhesive backed tapes 15 to two pressure rollers 52 with the adhesive layers 13 facing each other . the arrayed fibers 11 from fiber guide 40 feed into pressure rollers 52 between the tapes 15 . the pressure rollers 52 cause adhesion of the adhesive layers 13 to the fibers and cohesion between the two adhesive layers 13 which , in turn , simultaneously embeds the fibers 11 . guiding rollers 54 direct the tapes 15 from the reels 51 to pressure rollers 52 . it is apparent that other techniques of packaging the fibers can be used in conjunction with applicants &# 39 ; inventive apparatus 10 , and would depend on the resulting optical fiber ribbon structure desired and the supporting medium involved . however , whether the packaging mechanism involves only pressure rollers to produce a ribbon or thermal heat in conjunction with rollers such as used in several other known ribbon structures , the ribbon - like supporting medium , such as the tape 15 , in the illustrated embodiment , is wider than that desired for the ultimate or finished ribbon structure to permit removal of extraneous segments 16 of the ribbon - like supporting medium extending from the outermost fibers of the ribbon structure . shown in fig1 is a ribbon cutter 64 , which comprises two blade cutters 69 set apart at somme predetermined spacing ; the cutter 64 separates and severs the outer segments 16 of the supporting medium from ribbon 12 after ribbon 12 emerges from pressure rollers 52 . in accordance with this invention , the two outer segments 16 from the outer edges of ribbon 12 then feed to the advancing mechanism 60 , which comprises motor - driven rotating rollers , 65 and 66 . the rollers , which extend from one side of the ribbon axis of travel 8 to the other , rotate about axes substantially normal to the ribbon axis of travel . fig1 illustrates only part of the rollers . the rollers , 65 and 66 , are in substantial touching contact with each other at a line 67 along their outer edges where the corresponding segments 16 are to be gripped and pulled through by frictional action . by drawing the outer segments 16 through the manufacturing line 10 , the rotating rollers also supply the power to pull the manufactured optical ribbon 12 and ribbon components through the manufacturing line 10 and ribbon cutter 64 . it is apparent that the extraneous segments 16 are of sufficient tensile strength by themselves to advance the manufactured ribbon through the manufacturing line 10 . because the advancing mechanism pulls only the outer ribbon segments 16 , the amount of tensile load applied to the fibers 11 as they are being packaged into ribbons 12 is minimized , hence reducing introduction of residual stress into the fibers . an encoder 68 monitors the length of outer tape segments being pulled through the rotating rollers 65 and 66 . it is appreciated in the broadest sense of applicants &# 39 ; invention that other portions of the ribbon - like supporting medium can be dissociated from the ribbon structure to pull the ribbon and its components through the manufacturing line . for example , shown in fig9 is an alternative ribbon structure 112 being advanced through the packaging mechanism 50 with an alternative advancing mechanism 160 . ribbon 112 , which is shown in cross - section in fig1 in a view taken along line 10 -- 10 in fig9 comprises two elongate plastic tapes 115 and 116 between which are embedded a plurality of optical fibers 11 . two longitudinal strength members 117 , such as metallic wire , are dissociably embedded along one surface of the tape 116 . the longitudinal strength members 117 , which are extraneous to the ultimate ribbon structure 112 &# 39 ; and have sufficient tensil strength by themselves to advance the ribbon through the manufacturing apparatus , are used to advance the ribbon 112 as depicted in fig9 . fig9 shows the strength members 117 being dissociated from ribbon 112 and taken up by motor - driven roller 165 . the dissociating means in this advancing mechanism comprises a roller 164 and a ribbon support plate 162 with slots 163 . the slots 163 permit downward movement of the strength members 117 to the take - up roller 165 while the ribbon support plate 162 holds the ribbon structure 112 &# 39 ; in the predetermined plane of travel p . roller 164 aids to cause gradual dissociation of strength members 117 from ribbon 112 &# 39 ;. shown in fig1 the ribbon take - up arrangement 90 cooperates with ribbon advancing mechanism 60 to permit zero or substantially zero tension take - up of ribbon 12 . in the illustrated embodiment , a set of ribbon take - up capstans 92 draw the ribbon 12 away from cutter 64 after which the ribbons are randomly placed in a ribbon receptacle 94 . the speed of capstans 92 is controlled by encoder 68 to advance the ribbon 12 at a rate substantially equal to that of the outer segment take - up . this essentially zero tension take - up of the ribbon 12 permits loss measurements to be taken of the fibers as schematically depicted by laser 96 . the detectors at the other end of the fibers 11 in the reels 22 are not shown . alternatively , ribbon take - up reel 98 can be used to draw and take up the manufactured optical ribbon 12 under a predetermined controlled tension using a conventional clutch ( not shown ). preferably , the ribbon tension is considerably less than that applied on the outer segments 16 by the advancing mechanism 60 . also illustrated in fig1 is a station 80 for dusting the manufactured ribbon 12 . a material , such as calcium stearate , is applied to ribbon 12 to reduce the tackiness of the exposed adhesive layers 13 along the outer edges of ribbon 12 . further shown in fig1 are two microscopes 82 and 84 which are advantageously used to permit visual observation of the fibers being positioned in the fiber guide 40 and of the finished optical fiber ribbon 12 exiting from the cutter 64 , respectively . it is understood that the embodiments described herein are merely illustrative of the principles of the invention . various modifications may be made without departing from the spirit and scope of the invention . what is claimed is : | 8 |
[ 0019 ] fig1 shows an acoustical system 100 with two port sub - arrays according to an embodiment of the invention . a first port sub - array comprises ports 101 , 103 , 105 , 107 , 109 , and 111 , acoustical pathways 125 , 127 , 129 , 131 , 133 , and 135 , a plenum 151 , and a capsule 155 . acoustical pathways 125 - 135 meet at plenum 151 . a second port sub - array comprises ports 113 , 115 , 117 , 119 , 121 , and 123 , acoustical pathways 137 , 139 , 141 , 143 , 145 , and 147 , a plenum 149 , and a capsule 153 . acoustical pathways 137 - 147 meet at plenum 149 . in the embodiment , capsules 153 and 155 each comprise a transducer . ( other embodiments of the invention may utilize more than two port sub - arrays , as will be apparent to one skilled in the art .) in the embodiment , pathways 125 - 135 and 137 - 147 correspond to tubes having the same length ( within a tolerance of error ), although other embodiments may utilize other forms of acoustical pathways . for benefits of describing the embodiments of the invention , the following definitions are used . a “ port ” refers to an opening that functions as an acoustical ingress for a pipe , tube , capillary , mold passageway , waveguide or other such physical pathway that carries pressure variations from a point outside acoustical delay network 100 to capsule 153 or 155 . a “ capsule ” ( e . g . capsule 153 and 155 ) is a section or subsection of a physical microphone assembly that may include a diaphragm and any additional hardware such as spacers , washers , ports , capillary tubes , resonators that are associated with the transduction of acoustical energy to electrical energy . referring to fig1 acoustical signals arriving at each port ( 101 - 123 ) of the port sub - arrays arrives with approximately constant phase with respect to frequency when originating from a particular direction ( in this embodiment , perpendicular to the plane or line of the acoustical system 100 ), whereas acoustical signals arriving at different angles do not possess constant phase relationships . the signals arriving perpendicular to system 100 add coherently ( constructively ) creating a gain in the acoustical signal strength , referred to as “ array gain .” signals arriving from other angles add incoherently ( destructively ), resulting in attenuation , notches , and nulls in the beampattern as a function of frequency . this principal is typically referred to as “ stacking ” and the resulting array gain is a function of the number of ports in each harmonic sub - array . because of these principles , arrays achieve highly directive beams and pick - up patterns . the result is that the array acts as a spatial filter , and acoustical system 100 discriminates between acoustical signals , or sources of acoustical signals , based on direction and signal frequency while a single microphone typically receives acoustical signals from many different directions . the desired sound results in a main beam with a 0 ° azimuth called the maximum response axis ( mra ). there are several issues associated with port sub - arrays . one issue is spatial aliasing that results in grating lobes , comprising undesirable acoustical signals from undesirable angles , that may have a signal power approximating that of the main ( desired ) beam and whose behavior is unpredictable and difficult to control . ( grating lobes correspond to beams other than the mra beam , in which the phase shift between ports of a port sub - array arriving from a given angle cannot be distinguished from n radians or n + kπ radians , where k is an integer .) in such cases , the undesirable acoustical signals correspond to a half - wavelength that is shorter ( i . e . greater in frequency ) than the port spacing of the port sub - array . another issue is the beam pattern that results from a port sub - array . the main beam of a sub - array is formed from the stacked signal of all the ports in the port sub - array . however , each subset of those ports also creates a beam . the main beam in acoustical system 100 depends on the desired acoustical signal being received by capsules 153 and 155 at the same time . thus , identical length tubing ( within a tolerance of error ) is employed in the embodiment . ( however , other embodiments may utilize electronic phase compensation to adjust for different tube lengths .) in electronic ( non - acoustic ) systems , phase shifting may be accomplished by electrical signal processing that creates a delay between ports . the delays allow an array microphone pointed in a particular direction to have a main ( desired ) beam that is not perpendicular to the array in the azimuth . the mra , then , is shifted to the angle of the azimuth . correspondingly , in an acoustic system , a phase shift is achieved by utilizing a second network of tubing with the same or coincident ports and specified staggered lengths to create acoustic propagation delays . ( the formation of acoustical phase shifts will be discussed in another aspect of the invention as shown in fig1 .) it is possible to achieve an approximate constant beamwidth with respect to frequency for an acoustical system ( e . g . acoustical system 100 ) by using a plurality of port sub - arrays with increased port spacing such that the spatial aliasing frequency of a port sub - array with larger port spacing is some fraction of the spatial aliasing frequency of another port sub - array with the next - smallest port spacing . because the beamwidth of a port sub - array becomes smaller for frequencies increasing up to the spatial aliasing frequency , implementing sets of port sub - arrays with gradually decreasing port spacing enables a port sub - array to support a narrow bandwidth for frequencies at which the beamwidth of another sub - array is too wide to be considered desirable . this is typically done at frequencies at double multiples of the of a lower frequency port sub - array ( having a larger port spacing ), corresponding to port sub - arrays that operate in octaves ( e . g . 600 - 1200 hz , 1200 - 2400 hz , 2400 - 4800 hz , and so forth ) so that the overall beam pattern of the acoustical system remains essentially constant . referring to fig1 adjacent ports ( ports 101 and 103 , ports 103 and 105 , ports 107 and 109 , and ports 109 and 111 ) of the first port sub - array are separated by a first port spacing ( d 1 ) 161 and adjacent ports ( ports 113 and 115 , ports 115 and 117 , ports 119 and 121 , and ports 121 and 123 ) of the second port sub - array are separated by a second port spacing ( d 2 ) 163 . first port spacing 161 is approximately a half wavelength ( λ 1 ) of a first upper frequency of a corresponding frequency response of the first port sub - array and second port spacing 163 is approximately a half wavelength of a second upper frequency of a corresponding frequency response of the second port sub - array . as will be discussed in greater detail in relation to fig5 the first upper frequency is selected as approximately 2 , 000 hz and the second upper frequency is selected as approximately 4 , 000 hz , which are separated by one octave from each other . correspondingly , the first distance is approximately 8 . 6 cm and the second distance is approximately 4 . 3 cm . in fig1 a first electrical signal that is generated by capsule 153 and a second electrical signal that is generated by capsule 155 are provided to an adder 157 through filters 169 and 161 , respectively , in order to form an output 159 . ( operation of filters 169 and 161 are discussed in the context of fig6 .) output 159 may be further processed , as discussed later , and may be utilized by another processing unit such as a telematics processing unit or wireless communications telephone in order to provide hands - free operation . in other embodiments of the invention , more than two port sub - arrays may be supported . each port sub - array may be coupled to a capsule , in which an output of a capsule is coupled to electronic circuitry for bandpass filtering and possibly for further processing . [ 0030 ] fig2 shows a front view of an automotive mirror configuration 201 that supports acoustical delay network 100 that is shown in fig1 . a glass mirror ( not shown and corresponding to a glass mirror 903 as shown in fig9 ) spans an approximate area of automotive mirror configuration 201 . ports 101 - 123 are situated around a periphery of automotive mirror configuration 201 ( corresponding to a mirror casing 1001 as shown in fig1 ). capsules 153 and 155 are typically positioned in the interior of automotive mirror configuration 201 ( not typically visible to a user ) and behind the glass mirror . ports 101 , 113 , 115 , 103 , 117 , and 105 are separated from ports 107 , 119 , 121 , 109 , 123 , and 111 by a vertical distance ( d 3 ) 207 . [ 0031 ] fig3 shows a top view of automotive mirror configuration 201 that supports the acoustical delay network 100 that is shown in fig1 . ports 101 - 123 are positioned in a wall 301 of the mirror casing . ports 101 - 123 are connected to capsules 153 and 155 through acoustical pathways 125 - 147 . a connection 315 couples capsule 153 to electronic circuitry ( e . g . filter 509 , adder 513 , and post - processor 515 as shown in fig5 ) and a connection 317 couples capsule 155 to electronic circuitry ( e . g . filter 511 , adder 513 , and post - processor 515 as shown in fig5 ). although fig3 shows the electronic circuitry external to the mirror casing , the electronic circuitry may reside within mirror configuration 201 in other embodiments of the invention . the embodiment shown in fig2 , and 9 utilizes a rear - view mirror for housing acoustical system 100 . however , other embodiments of the invention may utilize other locations in an automobile , including a steering wheel and an instrument panel . while the embodiment that is shown in fig1 - 3 support a planar array , other embodiments of the invention may support a three - dimensional array , in which the first acoustical sub - array comprises additional ports that are separated from ports 101 - 111 by a depth distance ( perpendicular to the vertical distance and the horizontal distance ) and the second acoustical sub - array comprises additional ports that are separated from ports 113 - 123 by the depth distance . [ 0034 ] fig4 shows a capsule mounting 400 that supports acoustical delay network 100 that is shown in fig1 . capsule mounting 400 houses capsules 153 and 155 and acoustically couples acoustical pathways 125 - 147 . in the embodiment , acoustical pathways 125 - 135 are coupled to one side of capsule 153 and acoustical pathways 137 - 147 are coupled to a same side of capsule 155 . with other embodiments , acoustical pathways 125 - 147 may be located differently with respect to capsules 153 and 155 . in one embodiment , acoustical pathways 125 - 137 may be coupled on different sides for capsule 153 , and acoustical pathways 137 - 147 are coupled on different sides of capsule 155 , where an acoustical barrier between a proximity of capsule 153 and a proximity of capsule 155 provides acoustical isolation between capsules 153 and 155 . in other embodiments of the invention , capsule mounting 400 may vary to accommodate a different configuration such as a different type of capsule . for a received voice signal in an automotive environment , experimental results suggest that a relative degree of voice recognition is good if the received voice signal is processed with exemplary filter configurations having limiting frequency characteristics such as with a 1000 hz to 4000 hz bandpass filter , a 1000 hz to 5000 hz bandpass filter , an octave filter centered at 2000 hz , or a high pass filter with a corner frequency of 1000 hz . an experimental configuration utilized an ibm via voice recognition engine , in which different microphone types were positioned at different points within an automobile . [ 0036 ] fig5 shows an architectural configuration 500 of acoustical delay network 100 that is shown in fig1 . architectural configuration 500 comprises acoustical port sub - arrays 501 and 503 , capsules 505 and 507 , filters 509 and 511 ( corresponding to filters 169 and 161 , respectively , as shown in fig1 ), an adder 513 , and a postprocessor 515 that provides an output 517 . output 517 may be used for a number of applications , including hands - free wireless terminals and telematics . acoustical port sub - array 501 corresponds to ports 101 - 111 ( as shown in fig1 ) and acoustical port sub - array 503 corresponds to ports 113 - 123 . capsules 505 and 507 correspond to capsules 155 and 153 ( as shown in fig1 ). in the embodiment , filter 509 is a bandpass filter having an approximate pass - band of 1 khz to 2 khz and filter 511 is a bandpass filter having an approximate pass - band of 2 khz to 4 khz . filters 509 and 511 reduce spatial grating that may be associated with acoustical port sub - array 501 and 503 , respectively . adder 513 combines the signals from filter 509 and filter 511 so that the corresponding combined frequency response of architectural configuration 500 is approximately 1 khz to 4 khz . ( experimental results , as discussed above , suggests a good relative measure of speech recognition in which a received voice signal is processed with a bandpass filter having a pass - band of 1 khz to 4 khz .) a post - processor 515 may modify a signal from adder 513 in order to dampen irregularities in the signal response characteristics that result from a quarter wavelength ( λ / 4 ) response of acoustical port sub - array 501 and acoustical port sub - array 503 . ( in some embodiments , post - processing unit 515 may also be capable of supporting a post - equalization filter to provide for a flat response with respect to frequency over an operational region of acoustical system 100 . this type of optimized filter is often referred to as a frequency domain “ inverse ” filter or an optimally converged adaptive /“ wiener ” filter .) in other embodiments of the invention , quarter wavelength damping may utilize partial acoustical blockage ( e . g . a foam material ) in acoustical pathways 125 - 147 . in other embodiments of the invention , quarter wavelength damping may be provided by filters 509 and 511 such that filter 509 dampens ( attenuates ) the quarter wavelength response of acoustical port sub - array 501 ( corresponding to approximately 1000 hz for the embodiment as shown in fig2 ), and filter 511 dampens the quarter wavelength response of acoustical port sub - array 503 ( corresponding to approximately 2000 hz for the embodiment as shown in fig2 ). additional damping of quarter - wavelength resonances in the tubing network may be implemented using acoustical filters consisting of tubes , pipes , plenums , and resistances that augment or supplant notching as implemented using foam impedances or electronic means . in the embodiment , a higher order pickup pattern is defined as a pattern resulting from the combination of low order or “ common ” pickup patterns that may be adjusted by delay or amplitude weighting ( such as a foam impedance in the ports or tubes ). examples of low order patterns include omnidirectional microphones ( zero - th order ), cardioids ( first order ), super - cardioids ( first order with different path difference delay than cardioids ), and hyper - cardioids . higher order beam patterns result from combining these inputs in various combinations , such as a second order finite difference ( two cardioids separated by a half wavelength with the second delayed by the travel - time between the two ). in some embodiments , it may be advantageous to include some type of analog or digital sub - array processing between capsule 505 or 507 and adder 513 . in the case where digital signal processing is applied , bandpass filters 509 and 511 and sub - array processing may be accomplished on the same processor ( e . g . a microprocessor ). in some embodiments , bandpass filters 509 and 511 , subarray processing , adder 513 , and post processor 515 may be implemented on the same processor ( in which the entire system is behind capsules 153 and 155 . even though the embodiment that is shown in fig1 - 5 is directed toward automotive applications , other embodiments of the invention may be directed to other acoustical applications such as high fidelity acoustical applications , audio conferencing , speakerphones , podium microphones , in - car intercoms , multimedia computers , drive - through communications systems , security or surveillance systems , speech - controlled appliances , and sonar applications . while some acoustical applications of the present invention may be associated with an air medium , applications ( e . g . sonar applications ), as may be apparent to those skilled in the art , may be associated with a water medium . the embodiment that is shown in fig1 - 3 support a frequency spectrum from approximately 1 khz to 4 khz with two harmonic nests ( port sub - arrays ) in order to provide a good relative measure of speech recognition accuracy . however , other acoustical applications may require one skilled in the art to consider other design parameters . for example , in some embodiments that support high fidelity acoustical applications , a frequency spectrum from approximately 100 hz to 16 khz may be desired . in such a case , seven port sub - arrays may be incorporated , in which a first port sub - array corresponds to a frequency band of 125 hz to 250hz , a second port sub - array corresponds to a frequency band of 250 hz to 500 hz , a third port sub - array corresponds to a frequency band of 500 hz to 1 khz , a fourth port sub - array corresponds to a frequency band of 1 khz to 2 khz , a fifth port sub - array corresponds to a frequency band of 2 khz to 4 khz , a sixth port sub - array corresponds to a frequency band of 4 khz to 8 khz , and a seventh port sub - array corresponds to a frequency band of 8 khz to 16 khz . also , embodiments of the invention may consider different error criteria such as a measure of speech recognition accuracy and mean square error ( mse ). mean square error may be useful in gauging the processing fidelity of non - speech acoustical signals such as musical sounds . [ 0042 ] fig6 shows a polar plot 600 of the horizontal directivity of acoustical delay network 100 that is shown in fig1 . polar plot 600 shows frequency responses for 800 hz , 1000 hz , 1500 hz , 2000 hz , 2500 hz , and 3000 hz corresponding to curves 601 , 603 , 605 , 607 , 609 , and 611 , respectively . each curve shows the horizontal directional response for the associated frequency with respect to the zero - degree azimuth of acoustical delay network 100 . typically , within each harmonic sub - array , the higher the frequency , the greater the directivity ( i . e . the narrower the beamwidth ) of acoustical delay network 100 . the use of multiple nests maintains approximately constant directivity over the operational range of the device . [ 0043 ] fig7 shows a polar plot 700 of the vertical directivity of acoustical delay network 100 that is shown in fig1 . polar plot 700 shows frequency responses for 800 hz , 1000 hz , 1500 hz , 2000 hz , 2500 hz , and 3000 hz corresponding to curves 701 , 703 , 705 , 707 , 709 , and 711 , respectively . typically , the vertical directivity increases as the frequency increases . the embodiment possesses only one “ nest ” in the vertical direction , but other embodiments may utilize a plurality of nests in the vertical ( y ) dimension or depth ( z ) dimension as is applied in the horizontal ( x ) dimension . [ 0044 ] fig8 shows a polar plot 800 of the horizontal directivity of acoustical delay network 100 that is shown in fig1 with quarter wavelength damping applied . polar plot 800 shows frequency responses for 800 hz , 1000 hz , 1500 hz , 2000 hz , 2500 hz , and 3000 hz , corresponding to curves 801 , 803 , 805 , 807 , 809 , and 811 respectively . as with polar plot 600 , typically the horizontal directivity increases as the frequency increases . however , comparing plot 611 ( as shown in fig6 ) with plot 811 ( corresponding to 3000 hz ), the side lobes are reduced with quarter wavelength damping . [ 0045 ] fig9 shows a mirror - tilting configuration in conjunction with acoustical delay network 100 that is shown in fig1 . acoustical delay network 100 is mounted in mirror casting 901 ( corresponding to 201 in fig2 and 3 ). mirror casting 901 is tilted at an angle θ 905 with respect to glass mirror 903 . a talker 907 talks within a main beamwidth 911 of acoustical delay network 100 , over an acoustical path 909 ( corresponding to a perpendicular to a plane of acoustical delay network 100 ). because glass mirror 903 is tilted with respect to mirror casing 901 , talker can also view an object 917 through a rear window 913 corresponding to a view path 915 . view path 915 forms an angle such that a perpendicular to glass mirror 903 bisects the angle . [ 0046 ] fig1 shows an acoustical pathway configuration that steers the reception of a transmitted acoustical signal in accordance with an embodiment of the invention . ports 1001 , 1003 , and 1005 receive an acoustical signal corresponding to a wave front 1017 that is incident to acoustical delay network 100 at an angle θ 1021 with respect to a horizontal reference 1019 . ports 1001 , 1003 , and 1005 are openings in acoustical pathways 1007 , 1009 , and 1011 , respectively . acoustical pathways 1007 , 1009 , and 1011 differ in length in order that the maximum response axis ( main beam ) is tilted by angle θ 1021 . the tilting of the main beam corresponds to a differential length between adjacent acoustical pathways ( e . g . 1007 and 1009 ) that is approximately equal to d * sin ( θ ), where d is the port spacing between adjacent ports . tilting the main beam facilitates the mounting of acoustical delay network 100 for mounting entities that are not easily adjusted such as a steering wheel or an instrument panel . as can be appreciated by one skilled in the art , a computer system with an associated computer - readable medium containing instructions for controlling the computer system can be utilized to implement the exemplary embodiments that are disclosed herein . the computer system may include at least one computer such as a microprocessor , digital signal processor , and associated peripheral electronic circuitry . while the invention has been described with respect to specific examples including presently preferred modes of carrying out the invention , those skilled in the art will appreciate that there are numerous variations and permutations of the above described systems and techniques that fall within the spirit and scope of the invention as set forth in the appended claims . | 7 |
in the figures , like components are identified by the same reference numerals . fig1 shows a cylinder head 1 of an internal combustion engine with mounted cylinder head cover 2 , which is held to the cylinder head 1 in an outer connecting region 3 . separate therefrom and offset inwardly is a sealing region 4 between the cylinder head 1 and the cylinder head cover 2 , which comprises a circumferential sealing element 6 that is inserted into a peripheral groove formed in the top of the cylinder head . the cross - section of sealing element 6 is cup - shaped , and a support member 7 formed integrally with the cylinder head cover 2 projects into the interior of the sealing element 6 . the sealing element 6 is slipped onto the support member 7 to obtain a pre - assembled unit . the sealing element 6 extends all around adjacent the outer margin of the cylinder head cover , providing a circumferential seal between the cylinder head and the cylinder head cover . the connection between the cylinder head cover 2 and the cylinder head 1 includes a connecting element 5 configured as an attachment bolt , which is guided through an opening in the outlying segment of the cylinder head cover . a stabilizing sleeve 8 is inserted into this opening . in addition , a sealing ring 9 receiving an axial force when the connecting element is secured may be placed around the bolt shank of the connecting element 5 . the attachment force applied by the connecting element 5 acts in the axial direction as indicated by the double arrow 10 and securely holds the cylinder head cover 2 to the cylinder head 1 . to enable axial play and provide vibration decoupling between the cylinder head cover and the cylinder head , a gap 11 is formed in the connecting region 3 between the adjacent surfaces of the cylinder head 1 and the cylinder head cover 2 . this gap 11 is bridged by the sealing element 6 to create a secure and fluid - tight axial connection between the cylinder head 1 and the cylinder head cover 2 . the sealing element 6 applies an additional fixing or clamping force between the cylinder head and the cylinder head cover , which acts parallel to the connecting force of the connecting element 5 . the sealing force generated by the sealing element 6 extends radially as indicated by double arrow 12 and thus perpendicularly to the attachment force indicated by arrow 10 . this provides an effective decoupling between the sealing element 6 and the connecting element 5 . fig2 shows an enlarged detail of the sealing element 6 . the cross - section of the sealing element 6 is cup - shaped and has a central recess 13 , into which the support member formed on the cylinder head 7 ( fig1 ) protrudes in the secured state . on the outer lateral surface , the sealing element 6 has a plurality of circumferential locking rings 14 , which in cross section taper radially outwardly and improve the clamping within the groove in the cylinder head 1 , into which the sealing element 6 is inserted in the mounted state . locking projections or locking rings 15 may also be provided on the inside of the central recess 13 to firmly clamp the inserted support member . fig3 and 4 illustrate a modified embodiment . adjacent its end face opposite the outside bottom 17 , the sealing element 6 has an annular circumferential separating lip 16 protruding radially outwardly into the gap between the cylinder head 1 and the cylinder head cover 2 . this separating lip 16 is made of a sealing material and provides effective vibration decoupling between the cylinder head and the cylinder head cover . the embodiment shown in fig5 essentially corresponds to that depicted in fig3 and 4 but with the difference that , in the region of the cylinder head cover 2 , axially protruding segments 18 and 19 are formed , which axially overlap the sealing element 6 on opposite sides to some extent to bridge the gap between the cylinder head 1 and the cylinder head cover 2 . in the embodiment depicted in fig6 , the sealing element 6 protrudes into opposed groove - shaped recesses formed in the cylinder head cover 2 and in the cylinder head 1 . the sealing element 6 is mirror symmetrical relative to a center plane and has a fixed support core 20 , which is completely enclosed by the material of the sealing element and stabilizes the sealing element . in the center section , the sealing element 6 has the radially outwardly extending separating lip 16 , which in this embodiment is disk - shaped . the axial end segments of the sealing element 6 have a pronounced rib - like structure with locking rings 14 that impart a pine tree type cross - section to the sealing element . these locking rings 14 improve the axial clamping force applied by the sealing element 6 to both the cylinder head 1 and the cylinder head cover 2 . in the embodiment illustrated in fig7 , the sealing element 6 has a central recess on the cylinder head cover 2 in which a support member 7 is disposed which protrudes vertically downwardly . the outer lateral surface of the sealing element 6 also has the pine tree like ribbing with locking rings 14 , which are inserted into a recess in the cylinder head . in contrast to the preceding embodiment , however , the sealing element of fig7 is not mirror symmetrical relative to a transverse center plane . rather , the segment of the sealing element adjacent the cylinder head cover 2 is formed with straight lateral faces . according to fig8 , the sealing element 6 has protruding locking elements 14 only on one side . these elements taper radially outwardly and press against a vertical sidewall of the cylinder head 1 . the embodiment illustrated in fig9 essentially corresponds to that shown in fig6 , but with the difference that the sealing element 6 depicted in fig9 has no central disk - shaped separating lip , so that the gap 11 between the mutually facing sides of the cylinder head 1 and the cylinder head cover 2 is consequently not filled with the sealing material of the sealing element . the decoupling between the cylinder head and the cylinder head cover is obtained by keeping these two components spaced apart via the interposed sealing element 6 , such that the sealing element 6 lies in the groove - shaped recesses of both the cylinder head 1 and the cylinder head cover 2 . in the embodiments illustrated in fig1 and 11 , the connection between the cylinder head 1 and the cylinder head cover 2 is produced by a connecting element 5 configured as a clip member that is integrally formed with the cylinder head cover or injection molded thereto . on the cylinder head 1 , in the connecting region , a radially outwardly protruding shoulder 21 is formed , which forms an undercut relative to a locking projection 22 on the connecting element 5 , via which the cylinder head cover is held in captive relation to the cylinder head 1 in a form - fit connection . in the embodiment depicted in fig1 , the sealing element 6 extends up to the outer end face of the shoulder 21 . this has the advantage that this end face of the shoulder 21 cannot come into direct contact with the connecting element 5 on the cylinder head cover . this ensures effective vibration decoupling between the cylinder head and the cylinder head cover . the foregoing description and examples have been set forth merely to illustrate the invention and are not intended to be limiting . since modifications of the described embodiments incorporating the spirit and substance of the invention may occur to persons skilled in the art , the invention should be construed broadly to include all variations within the scope of the appended claims and equivalents thereof . | 5 |
the present inventions provide for a removable sensor assembly for tracking a movable object , such as a catheter , within a patient &# 39 ; s body . as illustrated in fig2 a sensor assembly 170 constructed in accordance with the present inventions is used with the afore - described image acquisition device 105 to facilitate synchronization of the catheter icon with the 2d fluoroscopic images while the c - arm 125 rotates about the patient . the sensor assembly 170 is shown mounted on a lateral surface 175 of the c - arm 125 near the upper end thereof . the sensor assembly 170 , however , may be mounted at alternative positions along the lateral surface , or any surface , of the c - arm 125 , as long as it is provides a reference point that accurately represents the relative position and orientation of the c - arm 125 . as illustrated in fig2 the sensor assembly 170 comprises a sensor mount 180 , which is permanently attached to c - arm 125 , and a sensor 185 , which is removably attached to the sensor mount 180 . in the illustrated embodiment , the sensor 185 comprises a housing that contains three pairs of sensing elements ( not depicted ), which orthogonally sense electromagnetic energy in three axes . the sensor 185 also includes an outlet ( not depicted ) for the leads or wires that connect to the reception circuitry 155 and controller / processor 135 ( depicted in fig1 ). the sensor mount 180 is permanently attached to a mounting surface 175 of the c - arm 125 by known means , such as by being welded , bonded , or even screwed on . the sensor mount 180 is made of non - ferromagnetic material , i . e ., anything other than steel or a natural or synthetic material containing iron , and acts to separate and provide an appropriate , prescribed distance between the sensor 185 and the mounting surface 175 of the ferromagnetic c - arm 125 , thereby preventing an adverse magnetic effect on the sensor 185 . to this end , the sensor mount 180 includes a spacer 190 , the thickness of which defines the distance between the sensor 185 and the mounting surface of the c - arm 125 . the sensor mount 180 further comprises a sensor engaging element 195 with which the sensor 185 mates and is secured by an interference fit . the element of the sensor 185 that the sensor engaging element 195 of the sensor mount 80 engages is , for the purposes of this specification , a mount engaging element , which may be a sensor housing or other element . for the purposes of this specification , an interference fit refers to any fit or contact between mating parts having prescribed limits of size , material , and shape , so that a reversible mechanical hold between the mating parts is established . as will be understood by the following description and reference to the respective drawings , the present inventors have developed a variety of innovative sensor mount assemblies with removably attached sensors that are maintained at the required distance from the surface of the c - arm 125 . referring now to fig3 c , a preferred embodiment of a sensor assembly 200 is depicted . the sensor assembly 200 comprises a sensor mount 202 ( shown separately in fig3 b ) and a sensor 204 ( shown separately in fig3 a ), which is removably attached to the sensor mount 202 . the sensor 204 comprises a sensor housing 206 , which contains sensing elements ( not depicted ). the sensor housing 206 has a substantially tubular shaft 208 that includes an outlet 212 at one end from which sensor wires 214 extend , and an oppositely - disposed rounded end 210 . as can be seen , the diameter of the rounded end 210 is greater than the diameter of the shaft 208 . the sensor mount 202 comprises a planar spacer flange 216 , which spaces the mounted sensor 204 the required distance away from the c - arm 125 . to this end , the spacer flange 216 comprises a first planar mounting surface 218 , which is the surface used to permanently attach the sensor mount 202 to the c - arm 125 via suitable means , such as welding or bonding , and an oppositely - disposed second planar mounting surface 220 from which a pair of sensor holding arms 222 extend . the ends 224 of the arms 222 curve towards each other to define an aperture 226 that has a cross - section that substantially matches that of the shaft 208 of the sensor housing 206 , such that the sensor 204 is disposed within the aperture 226 in a snap - fit arrangement with the arms 222 . thus , as best illustrated in fig3 c , the shaft 208 of the sensor housing 206 fits snugly within the aperture 226 , with the round end 210 of the sensor housing 206 abutting the tops of the arms 222 . it should be noted that the sensor mount 202 can be considered a front mount in that the sensor 204 is inserted therein in a direction perpendicular to the first planar mounting surface 220 . the ends 224 of the arms 222 comprise beveled edges 228 , which guide and facilitate the insertion of the sensor housing shaft 208 between the ends 224 of the arms 222 and into aperture 226 . moreover , the beveled edges 228 allow the arms 222 to almost completely enclose the sensor housing shaft 208 , thereby providing a more secure fit between the sensor mount 202 and sensor 204 . preferably , the arms 222 are composed of a firm material having an elastic property , such as an elastomer , so that their shape may be distorted as the shaft 208 is being inserted therebetween , yet at least partially restored once inserted . fig3 d and 3e depict alternative embodiments of sensor mounts that are similar to the afore - described sensor mount 202 , with the exception that they include spacer flanges that are coextensive with the pair of sensor holding arms , i . e ., the pair of sensor holding arms has the same profile as the spacer flange when viewing the mount at an angle perpendicular to the mounting surface of the mount . in particular , fig3 d depicts a front sensor mount 230 that comprises a spacer flange 232 ( set off by dashed lines ) that includes a mounting surface 234 for mounting of the sensor mount 230 to the c - arm 125 , and a pair of arms 236 that extend from the flange 232 in a direction perpendicular to the mounting surface 234 . as can be seen , the arms 236 have the same profile as the spacer flange 232 when viewing it at an angle perpendicular to the mounting surface 234 . fig3 e depicts a side sensor mount 240 that comprises a spacer flange 242 ( set off by dashed lines ) that includes a mounting surface 244 for mounting of the sensor mount 240 to the c - arm 125 , and a pair of arms 246 that extend from the flange 242 in a direction parallel to the mounting surface 244 . as can be seen , the arms 246 have the same profile as the spacer flange 242 when viewing it at an angle perpendicular to the mounting surface 244 . referring to fig4 a - 4c , another preferred embodiment of a sensor assembly 250 is depicted . the sensor assembly 250 comprises a sensor mount 252 ( shown separately in fig4 b ) and a sensor 254 ( shown separately in fig4 a ), which is removably attached to the sensor mount 252 . the sensor 254 comprises a t - shaped sensor housing 256 , which contains sensing elements ( not depicted ). the sensor housing 256 has a substantially tubular shaft 258 that includes an outlet 260 at one end from which sensor wires 262 extend , and a pair of sensor arms 264 at the other end . as illustrated , the pair of sensor arms 264 extend perpendicularly from the shaft 258 in opposite directions and in a coplanar relationship with the shaft 258 . the sensor arms 264 also include ends 278 that curve towards the shaft 258 for reasons that will further be described below . the sensor mount 252 comprises a planar spacer flange 266 , which spaces the mounted sensor 254 the required distance away from the c - arm 125 . to this end , the spacer flange 266 comprises a first planar mounting surface 268 , which is the surface used to permanently attach the sensor mount 252 to the c - arm 125 via suitable means , such as welding or bonding , and an oppositely - disposed second planar mounting surface 270 from which a pair of sensor holding arms 272 perpendicularly extend . the sensor arms 264 can be removably attached to the sensor holding arms 272 in a snap - fit arrangement . to this end , the sensor arms 264 each includes a ridge 274 , and the sensor holding arms 272 each includes an indentation 276 . alternatively , the sensor arms 264 can each include an indentation , and the sensor holding arms 272 can each include a ridge . in any event , the sensor arms 264 and sensor holding arms 272 include features that facilitate the snap - fit arrangement . thus , when the sensor shaft 258 is disposed between the sensor holding arms 272 , and the sensor arms 264 are disposed on the sensor holding arms 272 as illustrated in fig4 c , the ridges 274 snap into the indentations 276 to provide a secure fit between the sensor 254 and the sensor mount 252 . additionally , the respective ends 278 of the sensor arms 264 engage the sensor holding arms 272 to more securely fit the sensor 254 and sensor mount 252 . referring to fig5 a - 5c , still another preferred embodiment of a sensor assembly 300 is depicted . the sensor assembly 300 comprises a sensor mount 302 ( shown separately in fig5 b ) and a sensor 304 ( shown separately in fig5 a ), which is removably attached to the sensor mount 302 . the sensor 304 comprises an oblong sensor housing 306 , which contains sensing elements ( not depicted ). the sensor housing 306 has an outlet 308 at one end from which sensor wires 310 extend . the sensor housing 306 further comprises a barb 312 that extends perpendicularly from its center . alternatively , the barb 312 may extend from any longitudinal point on the sensor housing 306 . the sensor mount 302 comprises a planar spacer flange 314 , which spaces the mounted sensor 304 the required distance away from the c - arm 125 . to this end , the spacer flange 314 comprises a first planar mounting surface 316 , which is the surface used to permanently attach the sensor mount 302 to the c - arm 125 via suitable means , such as welding or bonding , and an oppositely - disposed second planar mounting surface 318 , in which an open oblong cavity 320 is formed for receiving the sensor housing 306 . the open cavity 320 includes a hole 322 along its midpoint for receiving the barb 312 of the sensor housing 306 . in this regard , the sensor housing 306 can be removably mounted within the open cavity 320 in a direction perpendicular to the first planar mounting surface 316 by disposing the barb 312 within the hole 322 , as illustrated in fig5 c . to further facilitate the mounting of the sensor 304 on the sensor mount 302 , the shape and size of the sensor housing 306 and open cavity 320 are similar , such that the sensor housing 306 is securely fit within the open cavity 320 . alternatively , the spacer flange 314 may be composed of an elastic material , and the size of the cavity 320 may be slightly smaller than the size of the housing 306 , such that the cavity 320 expands in a gripping relationship with the inserted housing 306 . furthermore , a channel 324 is formed within the second planar mounting surface 318 of the spacer flange 314 to receive the sensor wires 310 . referring to fig6 a - 6c , still another preferred embodiment of a sensor assembly 350 is depicted . the sensor assembly 350 comprises a sensor mount 352 ( shown separately in fig6 b ) and a sensor 354 ( shown separately in fig6 a ), which is removably attached to the sensor mount 352 . the sensor 354 comprises a conical sensor housing 356 , which contains sensing elements ( not depicted ). the sensor housing 356 has an outlet 358 at one end from which sensor wires 360 extend . the sensor mount 352 comprises a spacer flange , which spaces the mounted sensor 354 the required distance away from the c - arm 125 . to this end , the spacer flange 362 comprises a mounting surface 364 , which is the surface used to permanently attach the sensor mount 352 to the c - arm 125 via suitable means , such as welding or bonding . the spacer flange 362 further comprises a conical cavity 366 for receiving the conical sensor housing 356 . in this regard , the conical sensor housing 356 can be removably mounted within the conical cavity 366 in a parallel direction to the mounting surface 364 , as illustrated in fig6 c . to ensure a tight fit between the sensor 354 and the sensor mount 352 , the spacer flange 362 is preferably composed of an elastic material , and the size of the conical cavity 366 is slightly smaller than the size of the conical housing 356 , such that the conical cavity 366 expands in a gripping relationship with the inserted conical housing 356 . the spacer flange 362 further includes a slit 368 for receiving the sensor wires 360 . as illustrated , the slit 368 extends from the conical cavity 364 to the exterior of the spacer flange 362 , and is oriented in a direction parallel to the axis of the open cavity 364 . referring now to fig7 a - 7c , still another preferred embodiment of a sensor assembly 400 is depicted . the sensor assembly 400 comprises a sensor mount 402 ( shown separately in fig7 b ) and a sensor 404 ( shown separately in fig7 a ), which is removably attached to the sensor mount 402 . the sensor 404 comprises a sensor housing 406 , which contains sensing elements ( not depicted ). the sensor housing 406 has a substantially tubular shaft 408 that includes an outlet 410 at one end from which sensor wires 412 extend , and a clip 414 at the opposite end . the clip 414 exhibits a non - circular cross - section , which in the illustrated embodiment , is generally d - shaped . the sensor mount 402 comprises a spacer flange 416 , which spaces the mounted sensor 404 the required distance away from the c - arm 125 . to this end , the spacer flange 416 comprises a planar mounting surface 418 , which is the surface used to permanently attach the sensor mount 402 to the c - arm 125 via suitable means , such as welding or bonding . the sensor mount 402 also comprises clip - receiving means 420 , and specifically a cavity that exhibits a non - circular cross section , which in the illustrated embodiment , is d - shaped . as illustrated in fig7 c , the cavity 420 snugly receives the clip 414 in a direction parallel to the planar mounting surface 418 . fig7 d - 7f depict alternative embodiments of sensor mounts that are similar to the afore - described sensor mount 402 , with the exception that the means for receiving the clip 414 comprises a handle that is formed on the spacer flange . specifically referring to fig7 d , a sensor mount 422 comprises a spacer flange 424 that includes a first planar mounting surface 426 for permanently mounting the sensor mount 422 to the c - arm 125 , and a second planar mounting surface 428 from which a handle 430 extends . the handle 430 forms an aperture 431 between it and the second planar surface 428 for receiving the clip 414 of the sensor housing 406 in a direction parallel to the first planar mounting surface 426 . in the illustrated embodiment , the aperture 431 exhibits a cross - section substantially matching that of clip 414 , and in this case a d - shaped cross - section , so that the handle 430 snugly holds the clip 414 . the length of the spacer flange 424 preferably approximately matches that of the clip 414 . specifically referring to fig7 e , a sensor mount 432 comprises a spacer flange 434 that includes a first planar mounting surface 436 for permanently mounting the sensor mount 432 to the c - arm 125 , and a second planar mounting surface 438 from which a handle 440 extends . the handle 440 forms an aperture 441 between it and the second planar surface 438 for receiving the clip 414 of the sensor housing 406 in a direction parallel to the first planar mounting surface 436 . in the illustrated embodiment , the aperture 441 exhibits a cross - section substantially dissimilar to that of the clip 414 , and in this case a semi - circular cross - section , so that the handle 440 snugly holds the clip 414 . the length of the spacer flange 434 is substantially shorter than that of the clip 414 . specifically referring to fig7 f , a sensor mount 442 comprises a spacer flange 444 that includes a first planar mounting surface 446 for permanently mounting the sensor mount 442 to the c - arm 125 , and a second planar mounting surface 448 from which a handle 450 extends . the handle 450 forms an aperture 452 between it and the second planar surface 448 for receiving the clip 414 of the sensor housing 406 in a direction parallel to the first planar mounting surface 446 . in the illustrated embodiment , the aperture 452 exhibits a cross - section substantially dissimilar to that of the clip 414 , and in this case a rectangular cross - section , so that the handle 450 snugly holds the clip 414 . the length of the spacer flange 444 is substantially the same as that of the clip 414 . to further ensure a tight fit between the sensor housing 406 and the sensor mount 442 , a pair of sensor receiving arms 454 extend from the second planar surface 448 of the spacer flange 442 . the pair of arms 454 includes ends 456 , which curve towards each other to define an aperture 458 having a cross - section that substantially matches that of the shaft 408 of the sensor housing 406 , thereby allowing the arms 454 to grip the shaft 408 of the mounted sensor housing 406 . fig7 g depicts an alternative embodiment of sensor mount 462 that is similar to the afore - described sensor mount 402 , with the exception that the means for receiving the clip 414 comprises a slit that is formed in the spacer flange . specifically , the sensor mount 462 comprises a spacer flange 464 that includes a planar mounting surface 466 for permanently mounting the sensor mount 462 to the c - arm 125 . the sensor mount 462 further includes an elastomer slit 468 formed within the spacer flange 464 to receive the clip 414 of the sensor housing 406 in a direction parallel to the planar mounting surface 466 . preferably , the size of the slit 468 is slightly smaller than the size of the clip 414 , such that the slit 414 expands in a gripping relationship with the inserted clip 414 to snugly engage the sensor 404 with the sensor mount 462 . fig7 h depicts an alternative embodiment of sensor mount 472 that is similar to the afore - described sensor mount 402 , with the exception that the means for receiving the clip 414 comprises an l - shaped flange that extends from the spacer flange . specifically , the sensor mount 472 comprises a spacer flange 474 that includes a first planar mounting surface 476 for permanently mounting the sensor mount 472 to the c - arm 125 , and a second planar mounting surface 478 from which an l - shaped flange 480 extends . the l - shaped flange 480 forms an open slot 481 between it and the second planar surface 478 for receiving the clip 414 of the sensor housing 406 in a direction parallel to the first planar mounting surface 476 . fig7 depicts an alternative embodiment of sensor mount 482 that is similar to the afore - described sensor mount 402 , with the exception that the means for receiving the clip 414 comprises a spring clip that extends from the spacer flange . specifically , the sensor mount 482 comprises a spacer flange 484 that includes a first planar mounting surface 486 for permanently mounting the sensor mount 482 to the c - arm 125 , and a second planar mounting surface 488 from which a spring clip 490 extends . the spring clip 490 forms an open slot 494 between it and the second planar surface 488 for receiving the shaft 408 of the sensor housing 406 in a direction parallel to the first planar mounting surface 486 . the spring action of the clip 490 compresses the mounted sensor 404 against the spacer flange 484 in a snug relationship . the spring clip 490 also includes a cutout 494 that receives and accommodates the shaft 408 of the sensor housing 406 when the sensor 404 is mounted . referring now to fig8 a - 8c , still another preferred embodiment of a sensor assembly 500 is depicted . the sensor assembly 500 comprises a sensor mount 502 ( shown separately in fig8 b ) and a sensor 554 ( shown separately in fig8 a ), which is removably attached to the sensor mount 502 . the sensor 504 comprises a sensor housing 506 , which contains sensing elements ( not depicted ) and an outlet 508 at one end from which sensor wires 510 extend . the sensor housing 506 may be of any shape , e . g ., hexagonal , that has at least two lateral edges 512 and 514 . in fact , any shape other than a circle is contemplated to prevent rotation of the sensor housing 506 when mounted in the sensor mount 502 . the sensor mount 502 comprises a planar spacer flange 516 , which spaces the mounted sensor 504 the required distance away from the c - arm 125 . to this end , the spacer flange 516 comprises a first planar mounting surface 518 , which is the surface used to permanently attach the sensor mount 502 to the c - arm 125 via suitable means , such as welding or bonding , and an oppositely - disposed second planar mounting surface 520 in which an open cavity 522 is formed for receiving the sensor housing 506 in a direction perpendicular to the first planar mounting surface 520 . the shape and size of the sensor housing 506 and open cavity 522 are substantially the same , such that the sensor housing 506 is snugly disposed within the open cavity 522 in a snap - fit arrangement . thus , the open cavity 522 is defined by at least two lateral edges 524 and 526 that engage the at least two lateral edges 512 and 514 of the sensor housing 506 when the sensor 504 is mounted in the open cavity 522 . to further enhance the secure fit between the sensor mount 502 and the sensor 504 , the lateral edges 512 and 514 of the sensor 504 preferably each include at least one ridge 528 , and the lateral edges 524 and 526 of the open cavity 522 each include at least one mating indentation 530 . alternatively , the lateral edges 512 and 514 of the sensor 504 include at least one indentation , and the lateral edges 524 and 526 of the open cavity 522 each include at least one mating ridge . referring now to fig9 a - 9d , still another preferred embodiment of a sensor assembly 550 is depicted . as illustrated in fig9 d , the sensor assembly 550 comprises a sensor mount 552 and a sensor 554 . referring specifically to fig9 a , the sensor 554 comprises a sensor housing 556 , which contains sensing elements ( not depicted ). the sensor housing 556 has a substantially tubular shaft 558 that includes an outlet 560 at one end from which sensor wires 562 extend . referring specifically to fig9 b , the sensor mount 552 comprises a planar spacer flange 564 , which spaces the mounted sensor 554 the required distance away from the c - arm 125 . the spacer flange 564 comprises a circular cavity 566 in which the sensor 554 is mounted , e . g ., by bonding , with the tubular shaft 558 being disposed along the diameter of the circular cavity 566 , and the opposite ends thereof being in contact with a wall 568 of the cavity 566 . the spacer flange 564 further comprises a planar mounting surface 570 , which as will be described below , is the surface used to removably attach the spacer flange 564 to a patch 572 of the sensor mount 552 . referring specifically to fig9 c , the patch 572 comprises a first planar mounting surface 574 , which is the surface used to permanently attach the sensor mount 552 to the c - arm 125 via suitable means , such as welding or bonding , and an oppositely - disposed second planar mounting surface 576 , which is configured , such that the spacer flange 564 can be removably mounted thereto , as illustrated in fig9 d . in the illustrated embodiment , a hook - in - loop material 578 , the hook portion of which is permanently disposed on the planar surface 570 of the spacer flange 564 , and the loop portion of which is permanently disposed on the second planar surface 576 of the patch 572 , is used to removably mount the spacer flange 564 to the patch 572 . referring now to fig1 a - 10c , still another preferred embodiment of a sensor assembly 600 is depicted . the sensor assembly 600 comprises a sensor mount 602 ( shown separately in fig1 b ) and a sensor 604 ( shown separately in fig1 a ), which is removably attached to the sensor mount 602 . the sensor 604 comprises a cylindrical sensor housing 606 , which contains sensing elements ( not depicted ) and an outlet 608 at one end , from which sensor wires 610 extend . the sensor 604 further includes a member 612 that extends the length of the sensor housing 606 . the sensor mount 602 comprises a planar spacer flange 614 , which spaces the mounted sensor 604 the required distance away from the c - arm 125 . to this end , the spacer flange 614 comprises a first planar mounting surface 616 , which is the surface used to permanently attach the sensor mount 602 to the c - arm 125 via suitable means , such as welding or bonding , and an oppositely - disposed second planar mounting surface 618 , from which a member 620 extends . a cavity 622 is formed in the member 620 , and extends the length of the spacer flange 614 . the member 612 of the sensor 604 and the cavity 622 of the sensor mount 602 have substantially uniform and complementary cross - sections , and in this case t - shaped cross - sections , such that they are configured to slidingly engage each other in a direction parallel to the first planar mounting surface 616 of the sensor mount 602 . to further ensure a secure fit between the sensor 604 and the sensor mount 602 , the t - shaped member 612 includes a protuberance 624 , and the t - shaped cavity 622 comprises an indentation 626 that engage each other in a snap - fit arrangement when the t - shaped member 612 is fully engaged with the t - shaped cavity 622 , as illustrated in fig1 c . referring now to fig1 a 1 - 11 c , still another preferred embodiment of a sensor assembly 650 is depicted . the sensor assembly 650 is similar to the previously described sensor assembly 600 , with the exception that a trapezoidal - shaped member and cavity arrangement is used . specifically , the sensor assembly 650 comprises a sensor mount 652 ( shown separately in fig1 b ) and a sensor 654 ( shown separately in fig1 a ), which is removably attached to the sensor mount 652 . the sensor 654 comprises a sensor housing 656 , which contains sensing elements ( not depicted ) and an outlet 658 at one end from which sensor wires 660 extend . the sensor 654 further includes a member 662 that extends the length of the sensor housing 656 . the sensor mount 652 comprises a planar spacer flange 664 , which spaces the mounted sensor 654 the required distance away from the c - arm 125 . to this end , the spacer flange 664 comprises a planar mounting surface 666 , which is the surface used to permanently attach the sensor mount 652 to the c - arm 125 via suitable means , such as welding or bonding . the spacer flange 664 further comprises a cavity 668 formed therein that extends the length of the sensor housing 656 . the member 662 of the sensor 654 and the cavity 668 of the sensor mount 652 have substantially uniform and complementary cross - sections , and in this case , trapezoidal - shaped cross - sections , such that they are configured to slidingly engage each other in a direction parallel to the planar mounting surface 666 of the sensor mount 652 . to further ensure a secure fit between the sensor 654 and the sensor mount 652 , the trapezoidal - shaped member 662 includes a protuberance 670 , and the trapezoidal - shaped cavity 668 comprises an indentation 672 that engage each other in a snap - fit arrangement when the trapezoidal - shaped member 662 is fully engaged with the trapezoidal - shaped cavity 672 , as illustrated in fig1 c . the sensor 654 conveniently includes a finger handle 674 , which can be grasped by the user to slide the member 662 of the sensor 654 into and out of the cavity 668 of the sensor mount 652 . referring now to fig1 a - 12c , still another preferred embodiment of a sensor assembly 700 is depicted . the sensor assembly 700 comprises a sensor mount 702 ( shown separately in fig1 b ) and a sensor 704 ( shown separately in fig1 a ), which is removably attached to the sensor mount 702 . the sensor 704 comprises a sensor housing 706 , which contains sensing elements ( not depicted ) and an outlet 708 at one end from which sensor wires 710 extend . the sensor 704 further includes a member 712 that forms a cavity 714 that extends the length of the sensor housing 706 . the sensor mount 702 comprises a planar spacer flange 716 , which spaces the mounted sensor 704 the required distance away from the c - arm 125 . to this end , the spacer flange 716 comprises a first planar mounting surface 718 , which is the surface used to permanently attach the sensor mount 702 to the c - arm 125 via suitable means , such as welding or bonding , and an oppositely - disposed second planar mounting surface 720 from which a member 722 extends along the length of the spacer flange 716 . the cavity 714 of the sensor 704 and the member 722 of the sensor mount 702 have substantially uniform and complementary cross - sections , and in this case , rectangular - shaped cross - sections , such that they are configured to slidingly engage each other in a direction parallel to the first planar mounting surface 718 of the sensor mount 702 . to further ensure a secure fit between the sensor 704 and the sensor mount 702 , the rectangular - shaped cavity 714 includes opposing sidewalls 724 , each with a ridge 726 that extends the length thereof , and the rectangular - shaped member 722 includes opposing sidewalls 728 , each with a slot 730 that extends the length thereof . the ridges 726 and slots 730 engage each other in a friction fit , as the rectangular member 722 is engaged with the rectangular cavity 714 , as illustrated in fig1 c . referring now to fig1 a - 13c , still another preferred embodiment of a sensor assembly 750 is depicted . the sensor assembly 750 comprises a sensor mount 752 ( shown separately in fig1 b ) and a sensor 754 ( shown separately in fig1 a ), which is removably attached to the sensor mount 752 . the sensor 754 comprises a cylindrical sensor housing 756 , which contains sensing elements ( not depicted ) and an outlet 758 at one end , from which sensor wires 760 extend . for purposes that will be described below , the sensor housing 756 further includes a key 762 that extends along the length thereof . the sensor mount 752 comprises a planar spacer flange 764 , which spaces the mounted sensor 754 the required distance away from the c - arm 125 . to this end , the spacer flange 764 comprises a first planar mounting surface 766 , which is the surface used to permanently attach the sensor mount 752 to the c - arm 125 via suitable means , such as welding or bonding , and an oppositely - disposed second planar mounting surface 768 , from which a member 770 extends . the member 770 comprises a cylindrical cavity 772 formed therein that extends along the length of the spacer flange 764 . the cylindrical cavity 772 comprises a key slot 774 that extends along the length thereof . the sensor housing 756 and the cavity 772 of the sensor mount 752 havesubstantially uniform and complementary cross - sections , and in this case , elliposidal - shaped cross - sections , and specifically circular - shaped cross - sections , such that they are configured to slidingly engage each other in a direction parallel to the first planar mounting surface 766 of the sensor mount 752 . additionally , the key 762 of the sensor housing 756 fits in and engages with the key slot 774 of the cylindrical cavity 772 , such that the cylindrical sensor housing 756 does not rotate along the axis of the cylindrical cavity 772 . to further ensure a secure fit between the sensor 754 and the sensor mount 752 , the cylindrical sensor housing 756 includes a detent 776 , and the cylindrical cavity 772 includes an aperture 778 that engage each other when the cylindrical sensor housing 756 is fully engaged with the cylindrical cavity 772 , as illustrated in fig1 c . referring now to fig1 a - 14c , still another preferred embodiment of a sensor assembly 800 is depicted . the sensor assembly 800 is similar to the previously described sensor assembly 750 , with the exception that opposing extensions , rather than a key , is used to prevent rotation of the sensor housing . specifically , the sensor assembly 800 comprises a sensor mount 802 ( shown separately in fig1 b ) and a sensor 804 ( shown separately in fig1 a ), which is removably attached to the sensor mount 802 . the sensor 804 comprises a generally cylindrical sensor housing 806 , which contains sensing elements ( not depicted ) and an outlet 808 at one end , from which sensor wires 810 extend . for purposes that will be described below , the sensor housing 806 further includes a pair of lateral opposing extensions 812 . the sensor mount 802 comprises a spacer flange 814 , which spaces the mounted sensor 804 the required distance away from the c - arm 125 . to this end , the spacer flange 814 comprises a planar mounting surface 816 , which is the surface used to permanently attach the sensor mount 802 to the c - arm 125 via suitable means , such as welding or bonding . the sensor mount 802 further comprises a cylindrical cavity 822 that is formed within the spacer flange 814 extends along the length of the spacer flange 814 . the cylindrical cavity 822 comprises a pair of lateral opposing extensions 824 that extends along the length thereof . the sensor housing 806 and the cavity 822 of the sensor mount 802 have substantially uniform and complementary cross - sections , and in this case , elliposidal - shaped cross - sections , and specifically circular - shaped cross - sections , such that they are configured to slidingly engage each other in a direction parallel to the planar mounting surface 816 of the sensor mount 802 . additionally , the pair of opposing lateral extensions 812 of the sensor housing 806 fits in and engages with the pair of opposing lateral extensions 824 of the cylindrical cavity 822 , such that the cylindrical sensor housing 806 does not rotate along the axis of the cylindrical cavity 822 . to further ensure a secure fit between the sensor 804 and the sensor mount 802 , the cylindrical sensor housing 806 includes a detent 826 , and the cylindrical cavity 822 includes an aperture 828 that engage each other when the cylindrical sensor housing 806 is fully engaged with the cylindrical cavity 822 , as illustrated in fig1 c . referring now to fig1 a - 15c , still another preferred embodiment of a sensor assembly 850 is depicted . the sensor assembly 850 comprises a sensor mount 852 ( shown separately in fig1 b ) and a sensor 854 ( shown separately in fig1 a ), which is removably attached to the sensor mount 852 . the sensor 854 comprises a cylindrical sensor housing 856 , which contains sensing elements ( not depicted ) and an outlet 858 at one end , from which sensor wires 860 extend . the sensor 854 further includes a rigid planar member 862 , which includes a first planar surface 864 and an oppositely - disposed second planar surface 866 , from which the sensor housing 856 extends . the sensor mount 852 comprises a planar spacer flange 868 , which spaces the mounted sensor 854 the required distance away from the c - arm 125 . to this end , the spacer flange 868 comprises a first planar mounting surface 870 , which is the surface used to permanently attach the sensor mount 852 to the c - arm 125 via suitable means , such as welding or bonding , and an oppositely - disposed second planar mounting surface 872 . the sensor mount 852 further includes a flexible planar member 874 that is configured to be removably attached to the second planar mounting surface 872 of the spacer flange 868 . the flexible planar member 874 comprises an aperture 876 , through which the sensor housing 856 can fit through , but through which the rigid planar member 862 cannot . thus , the spacer flange 868 , with the sensor housing 856 , can be inserted between the flexible planar member 874 and the spacer flange 868 when removably attaching the flexible planar member 874 to the spacer flange 868 , thereby removably mounting the sensor 854 to the sensor mount 852 , as illustrated in fig1 c . in the illustrated embodiment , a hook - in - loop material ( not illustrated ), the hook portion of which forms the flexible planar member 874 , and the loop portion of which is permanently disposed on the second planar surface 872 of the spacer flange 868 , is used to removably mount the rigid planar member 862 , and thus , the sensor 854 , to the sensor mount 852 . referring now to fig1 a - 16c , still another preferred embodiment of a sensor assembly 900 is depicted . the sensor assembly 900 comprises a sensor mount 902 ( shown separately in fig1 b ) and a sensor 904 ( shown separately in fig1 a ), which is removably attached to the sensor mount 902 . the sensor 904 comprises a cylindrical sensor housing 906 , which contains sensing elements ( not depicted ) and an outlet 908 at one end , from which sensor wires 910 extend . the sensor 904 further includes a pair of axially aligned snap holes 912 that is formed within the sensor housing 906 . the sensor mount 902 comprises a planar spacer flange 914 , which spaces the mounted sensor 904 the required distance away from the c - arm 125 . to this end , the spacer flange 914 comprises a first planar mounting surface 916 , which is the surface used to permanently attach the sensor mount 902 to the c - arm 125 via suitable means , such as welding or bonding , and an oppositely - disposed second planar mounting surface 918 , from which a pair of axially aligned snap protuberances 920 extend . the spacing between , and size of , the pair of snap holes 912 and the spacing between , and size of , the pair of snap protuberances 920 match , such that they are configured to snap together to mount the sensor 904 on the sensor mount 902 , as illustrated in fig1 c . referring now to fig1 a - 17c , still another preferred embodiment of a sensor assembly 950 is depicted . the sensor assembly 950 comprises a sensor mount 952 ( shown separately in fig1 b ) and a sensor 954 ( shown separately in fig1 a ), which is removably attached to the sensor mount 952 . the sensor 954 comprises a cylindrical sensor housing 956 , which contains sensing elements ( not depicted ) and an outlet 958 at one end , from which sensor wires 960 extend . the sensor housing 956 includes two oppositely - disposed cutouts 962 , which are preferably provided at or near the midpoint of the sensor housing 956 . the sensor mount 952 comprises a spacer flange 964 , which spaces the mounted sensor 954 the required distance away from the c - arm 125 . to this end , the spacer flange 964 comprises a planar mounting surface 966 , which is the surface used to permanently attach the sensor mount 952 to the c - arm 125 via suitable means , such as welding or bonding , and an oppositely - disposed concave surface 968 that is sized and shaped to receive the sensor housing 956 . a pair of sensor holding arms 970 extends from the concave surface 968 of the spacer flange 964 , and includes opposing concave surfaces 972 that define an aperture 974 between the arms 970 . the holding arms 970 are configured to grip the sensor housing 956 therebetween in a snap - fit arrangement when the concave surfaces 972 are coincident with the cutouts 962 of the sensor housing 956 , as illustrated in fig1 c . the concave surface 968 of the spacer flange 964 receives the sensor housing 956 , thereby further ensuring a secure fit between the sensor 954 and the sensor mount 952 . each of the pair of sensor arms 970 comprises a beveled edge 976 , which guides and facilitates the insertion of the sensor housing 956 between the arms 970 and into the aperture 974 . preferably , the sensor holding arms 970 are composed of a resilient material having an elastic property , such as an elastomer , so that their shape may be distorted as the sensor housing 956 is inserted therebetween , yet at least partially restored once inserted . referring to fig1 a - 18c , still another preferred embodiment of a sensor assembly 1000 is depicted . the sensor assembly 1000 comprises a sensor mount 1002 ( shown separately in fig1 b ) and a sensor 1004 ( shown separately in fig1 a ), which is removably attached to the sensor mount 1002 . the sensor 1004 comprises a generally cylindrical sensor housing 1006 , which contains sensing elements ( not depicted ). for purposes that will be described in further detail below , the cross - section of the cylindrical sensor housing 1006 forms a semi - circle that exhibits an arc of greater than 180 degrees . the sensor housing 1006 has an outlet 1008 at one end , from which sensor wires 1010 extend . the sensor housing 1006 further comprises extensions 1012 that extend perpendicularly from the sensor housing 1006 in opposite directions . the sensor 1004 further includes a planar flange 1014 that has a planar surface 1016 , from which the sensor housing 1006 extends . the sensor mount 1002 comprises a planar spacer flange 1016 , which spaces the mounted sensor 1004 the required distance away from the c - arm 125 . to this end , the spacer flange 1004 comprises a first planar mounting surface 1018 , which is the surface used to permanently attach the sensor mount 1002 to the c - arm 125 via suitable means , such as welding or bonding , and an oppositely - disposed second planar mounting surface 1020 , in which a generally cylindrical open cavity 1022 is formed for receiving the sensor housing 1006 . the cross - section of the generally cylindrical cavity 1022 forms a semi - circle that exhibits an arc of greater than 180 degrees , such that it receives the generally cylindrical housing 1006 in a snap - fit arrangement , as illustrated in fig1 c . the coincidence between the planar surface 1016 of the sensor 1004 and the second planar mounting surface 1020 of the spacer flange 1016 prevents the sensor housing 1006 from rotating relative to the axis of the cavity 1022 . additionally , the cavity 1022 further comprises extensions 1024 that extend perpendicularly therefrom , in opposite directions , to receive the lateral extensions 1012 of the sensor housing 1006 , thereby ensuring that the sensor housing 1006 does not rotate within the cavity 1022 . although particular embodiments of the present inventions have been shown and described , it will be understood that it is not intended to limit the present inventions to the preferred embodiments , and it will be obvious to those skilled in the art that various changes and modifications may be made without departing from the spirit and scope of the present inventions . thus , the present inventions are intended to cover alternatives , modifications , and equivalents , which may be included within the spirit and scope of the present inventions as defined by the claims . all publications , patents , and patent applications cited herein are hereby incorporated by reference in their entirety for all purposes . | 0 |
the present invention relates to a method for verifying an amount of on - chip decoupling capacitance given a distance between a driver and a decoupling capacitor and an amount of decoupling capacitance needed for charge distribution . the present invention further relates to a method for forming a linear problem , where the solution to the linear problem is used to verify an amount of on - chip decoupling capacitance . the present invention also relates to a software tool that verifies an amount of decoupling capacitance on all or part of a computer chip . fig2 shows an exemplary arrangement of drivers ( 30 , 32 ) and decoupling capacitors ( 34 , 36 , 38 ) on a computer chip ( 40 ) in accordance with an embodiment of the present invention . driver a ( 30 ) and driver b ( 32 ) are used to drive discrete elements ( not shown ) on the computer chip ( 40 ). decoupling capacitors 1 , 2 , and 3 ( referred to and shown as “ decap 1 ,” “ decap 2 ,” and “ decap 3 ,” respectively ) ( 34 , 36 , 38 ) are used to provide on - chip decoupling capacitance . a percentage of a decoupling capacitor used by a particular driver is indicated as d xy , where x represents the particular driver and y represents the particular decoupling capacitor . for example , d b2 indicates the percentage of decap 2 ( 36 ) used by driver b ( 32 ). in order to verify that the amount of decoupling capacitance on the computer chip ( 40 ) is adequate to sufficiently distribute charge that may be required by each of the drivers ( 32 , 34 ), the present invention provides a method by which to form a linear problem , where the solution to the linear problem indicates whether there is enough decoupling capacitance on the computer chip ( 40 ) for the drivers on the computer chip ( 40 ). fig3 shows an exemplary flow process for generating a linear problem from an arrangement of drivers and decoupling capacitors on a computer chip in accordance with the embodiment shown in fig2 . first , a driver on the computer chip is selected ( step 50 ). decoupling capacitors within a specified distance of the selected driver are then selected ( step 52 ). next , the decoupling capacitance need of the selected driver is equated to the summation of the products of the capacitances of each of the selected decoupling capacitors and the use percentages of the selected decoupling capacitors by the selected driver ( step 54 ). those skilled in the art will appreciate that this step may be repeated for remaining drivers on the computer chip . further , those skilled in the art will appreciate that the equations that are formed for the selected drivers form a linear problem that can be solved to verify decoupling capacitance on the computer chip . however , before the linear problem is solved , certain conditions must be met in order to ensure verification requirements . for example , a decoupling capacitor that is used by multiple drivers cannot be fully used by each of the multiple drivers . thus , conditions are applied requiring that the cumulative percentage use of the decoupling capacitor by one or more drivers does not exceed 1 . in other words , only 100 % of a decoupling capacitor can be used , and this condition must be accounted for in the equations which are formed for the linear problem . under the constraints of these conditions , the linear problem can be solved , whereafter the decoupling capacitances of the drivers on a computer chip can be determined . based on the decoupling capacitance needs of the drivers , a determination can be made as to whether enough decoupling capacitance is present to decrease driver delays relative to when there is not enough decoupling capacitance present . further , those skilled in the art will appreciate that the verification of on - chip decoupling capacitance by solving the linear problem may indicate whether chip area is being wasted in cases where there is too much decoupling capacitance . equations ( 1 )-( 5 ) ( an individual equation is referred to as “ linear equation ”) show the generation of a linear problem based on the arrangement of drivers and decoupling capacitors shown in fig2 . driver a decoupling capacitance = decap 1 * d a1 + decap 2 * d a2 + decap 3 * d a3 ( 1 ) driver b decoupling capacitance = decap 1 * d b1 + decap 2 * d b2 ( 2 ) equation ( 1 ) equates the decoupling capacitance need of driver a ( 30 ) to the sum of the products of those decoupling capacitors ( 34 , 36 , 38 ) that are within a specified distance of driver a ( 30 ) and the use percentages of those decoupling capacitors ( 34 , 36 , 38 ) by driver a ( 30 ). equation ( 2 ) equates the decoupling capacitance need of driver b ( 32 ) to the sum of the products of those decoupling capacitors ( 34 , 36 ) that are within a specified distance of driver b ( 32 ) and the use percentages of those decoupling capacitors ( 34 , 36 ) by driver b ( 32 ). for driver b ( 32 ) in equation ( 2 ), note that decap 3 ( 38 ) is not included because it resides outside a specified distance of driver b ( 32 ). equations ( 3 )-( 5 ) are the conditions that are placed on the percentage use parameters in equations ( 1 )-( 2 ). equations ( 3 )-( 5 ) indicate that no more than 100 % of each decoupling capacitor can be used by those drivers that fall within the specified distance . note that once a capacitor falls outside some distance from a driver , the capacitive effects of the capacitor on the driver are considered so minimal that its capacitance is considered as not being used by the driver . equations ( 1 )-( 5 ), which form the linear problem for the exemplary arrangement of drivers and decoupling capacitors shown in fig2 are solved to determine the amount of decoupling capacitance for each driver . if one or more drivers are not meeting specified decoupling capacitance needs , then there is not enough decoupling capacitance on the computer chip and changes such as the repositioning , addition , or resizing of elements may be made . in the case that one or more drivers are overcompensated with respect to the amount of decoupling capacitance they are receiving , then there is probably too much decoupling capacitance on the computer chip and changes such as the repositioning , removal , or resizing of elements may be made . in another embodiment of the present invention , because a linear problem can be formulated for verifying decoupling capacitance , a software tool may be used to solve the linear problem . the software tool may include linear programming tools to solve the linear problem . this is advantageous because actual on - chip measurements do not have to be made to verify decoupling capacitance . advantages of the following invention may include one or more of the following . in some embodiments , because on - chip decoupling capacitance is verified , driver delay is decreased relative to when there is not enough on - chip decoupling capacitance , which , in turn , in turn leads to faster switching times and increased frequency operation . in some embodiments , because on - chip decoupling capacitance is verified , unnecessary charge transfer from a power supply may be avoided . further , this results in the reduction of noise on the power supply . in some embodiments , because a method for verifying on - chip decoupling capacitance may consider all the drivers and decoupling capacitors on a computer chip , unnecessary and over compensatory measurements may be avoided . in some embodiments , because a linear problem is formed to verify on - chip decoupling capacitance , a software tool may be used for solving the linear problem . in some embodiments , because a linear problem is formed to verify on - chip decoupling capacitance , where the linear problem accounts for decoupling capacitance of a driver on a computer chip , chip elements can be tested for proper functionality . while the invention has been described with respect to a limited number of embodiments , those skilled in the art , having benefit of this disclosure , will appreciate that other embodiments can be devised which do not depart from the scope of the invention as disclosed herein . accordingly , the scope of the invention should be limited only by the attached claims . | 6 |
fig1 - 3 schematically illustrate a plot of irrigated land having several irrigation zones . fig1 shows an elevation of plot of land 10 in which the various components of irrigation apparatus are installed . as seen in fig1 - 3 , a central controller 11 is disposed adjacnt to a building 26 and has a plurality of cables 12 extending outwardly to a respective soil resistance detection control probe 14 , and into a plurality of conductors 18 respectively connected into flow control devices such as solenoid valves 20 . each of the valves 20 are further connected into one or more irrigating heads 22 which may be sprinkler heads as illustrated . each detection probe 14 is buried within the earth at approximately the lowest depth that the roots of plants are expected to reach in a particular type of soil . such plants may be grass such as in a lawn , municipal park , or golf course , for example . in other installations the plants might be grape vines or fruit trees , for example . the probe 14 has two resistance detection probes 16 and 17 which are embedded in the earth where the probe 14 is installed . each of the solenoid valves 20 control the flow of water through a conduit 24 , for example . the solenoids 20 may control the flow of water to individual heads 22 as shown or a multiplicity of heads 22 as shown in dashed lines in fig2 . also shown in fig2 is other detection probes 14 extending through power cables 12 from central controller 11 . fig3 shows a plot of land 100 surrounding a building 26 which represents a residence , business building , or the like . a number f irrigation zones 98 are defined in the land plot 100 , and a power cable 12 terminating in one or more detection probes 14 is installed in each of these plots . as also shown , a plurality of control cables 18 extend outwardly from each detection probe 14 and are respectively connected into solenoid valves 20 . one or more irrigating heads or stations 22 ( not shown ) extend from each of the solenoid valves 20 . the central controller 11 actuates all the power cables 12 and resistance probes 14 as shown . the central controller 11 may be actuated to turn the system off and on by means of a timer switch , a temperature or freeze switch , and possibly a light responsive switch ( not shown ). in this manner the controller 11 will control power to the system for certain periods of each day , each week , or the like . the controller will also be responsive to irrigate the plot 100 only during evening and night hours , if desired , by a light sensitive switch . the system can also be regulated to be operable only during above freezing temperatures . when the earth in the vicinity of the electrodes 16 and 17 of detection probe 14 is dry , then the resistance measured between the probes 16 and 17 is very high with a relatively large voltage occurring between the electrodes . as the ground is moisturized , the earth between the electrodes 16 and 17 becomes less resistive and the voltage occurring across the electrodes is gradually lessened as the moisture increases . at a pre - determined voltage level , the detection probe 14 is actuated to open an internal switch and turn off the solenoids 20 as shown in fig1 - 3 . to curtail water demand at a designated time , the controller 11 may be equipped with sequencing switches ( not shown ) to sequentially activate the control probes 14 in any combination . since all the switches for controller 11 are commercially available , there is no need to describe or show such switches specifically . fig8 shows a typical detection probe 14 installed within the earth at a depth 28 which , as illustrated , is approximately the lower depth that the grass roots will extend . the physical structure of the detection probe 14 is schematically illustrated in fig4 - 6 . fig4 shows an elevational section of the probe 14 . as seen in fig4 - 6 , the probe 14 is seen to have detection probes 16 and 17 extending in parallel out the side of the probe 14 at a designated distance apart , with one inch between the inner edges being an example . mounted within the probe 14 are the electronic components 30 of the detection and actuating circuit mounted on a circuit board 32 . the circuit board 32 may be plated for circuit printing on one side and with a solid conductive sheet 34 on the other side . as shown in fig6 the circuit components may be mounted on one side of the circuit board 32 . in fig4 the plating of the circuit board 32 may be a shield 34 for the purpose of shielding the circuit against unwanted radiation such as emanating from high tension power lines , etc . in the manufacture of the probe 14 , the components 16 , 17 , 30 , 32 , and 34 are disposed in a casting mold ( not shown ) in the position as shown in fig4 and fig6 . a heat - hardenable resin of relatively low viscosity is thereon poured in and around the circuit board and circuit components in a manner eliminating any trapped air such that the liquid plastic is in close and intimate contact with all the respective components of the probe 14 . the plastic is then allowed to harden into a solid monolithic structure which is hermetic and impervious to liquid or gas intrusion . the hardening time of the epoxy resin may vary from only a few minutes to several hours , depending on the respective formula of the epoxy employed . the resulting body and internals of the probe 14 is an integral and monolithic mass . an epoxy resin is presently being used as the preferred plastic for the probe 14 . however , other plastics such as &# 34 ; nylon &# 34 ;, acrylic , and polyvinyl chloride may be employed if tailored to this particular application . fig7 is a schematic illustration of the detection and actuating circuit of the probe 14 . as shown , the circuit is seen to include generally a detection circuit component which actuates a relay switch component . a common ground connection 48 is seen to electrically extend through the probe 14 from the power cable conductor 12 to the controller conductor 18 . detection electrode 17 is connected into this ground . this common ground may also be the shield plate 34 as shown in fig4 and previously described . the detection portion of this circuit may be adapted from several integrated detection circuits commercially available . examples of such suppliers are sgs - semiconductor corporation , phoenix , ariz . 85022 ; sprague electric company , lexington , mass . 02173 ; and national semiconductor corporation , santa clara , calif . 95051 . sgs - semiconductor corporation supplies an integrated detection circuit model no . 4620 , for example . sprague electric company manufactures an integrated detection circuit model no . uln - 2429a , for example . national semiconductor corporation manufactures detection circuits model nos . lm1042 , lm903 , and lm1830 , as examples . of the above integrated detection circuits , the national semiconductor corporation &# 39 ; s detector circuit model no . lm1830 is the circuit considered to be preferred when modified for use in the present invention . this lm1830 fluid detector circuit is advertised for use in the fluid detection systems utilized in automotive and industrial equipment . an automobile radiator liquid lel detector is an example . there is shown an oscillator circuit 38 for providing a varied frequency voltage to energize the probes 16 and 17 . the frequency of the oscillator circuit 38 is set by the value of a timing capacitor 56 . a detector circuit 36 is provided in connection between the electrodes 16 and 17 to detect the voltage appearing across electrodes 16 and 17 and creates an activating voltage to activate the relay driver 40 when a designated voltage across detector 36 is reached . the capacitor 58 , connected between the detector 36 and ground , is provided to filter the output to the relay driver 40 to prevent relay chatter . the oscillator 38 is coupled to the sensing electrode 16 through a capacitor 60 and a fixed resistance 61 . the total resistance seen by oscillator 38 is the resistance of the earth seen between probes 16 and 17 in series with the fixed resistor 61 . thus , the resistance is a function of the fixed resistor 61 , the earth &# 39 ; s resistivity , the length and diameter of the probes , and the spacing between the probes . the value of the resistor 61 is used to calibrate the sensitivity of the system . the output of the detector 36 is a function of the earth &# 39 ; s resistance between the electrodes 16 and 17 , and this output is sent to the relay driver 40 . at a pre - determined voltage level , the relay driver 40 sends an actuating voltage to the switch relay 42 which actuates the contacts of switch 54 . the switch relay 42 with the switch 54 may be of a mechanical solenoid type as illustrated , or a solid state device ( not shown ). a dc bias supply circuit 44 supplies a dc bias voltage to the oscillator 38 , the detector 36 , and the relay driver 40 . an ac / dc bridge circuit 46 connected between the ground 48 and a voltage supply circuit 50 is energized to supply a dc voltage to the switch relay 42 . when the relay 42 is driven by the output of the relay driver 40 , an internal resistor in relay 42 provides a voltage drop to reduce unnecessary heating of the relay . a diode and capacitor in relay 42 provide additional delay for the opening of the relay . because the voltage necessary to close the relay 42 is much higher than the release voltage , there exists a hysteresis that prevents the tendency of the relay 42 to chatter when activated or de - activated . the ac / dc bridge 46 supplies energizing voltage to relay switch 42 . when relay 42 is activated , the relay contacts of switch 52 close and apply 28 volts ac , for example , to the solenoid 20 as shown in fig1 and fig2 . actuation of the solenoids 20 opens the valve to permit water to flow to the irrigating heads 22 . in operation , the circuit of probe 14 is energized when voltage is received from the controller 11 . when probe 14 is energized , the probe supplies electrical voltage to the solenoids 20 when the earth &# 39 ; s resistance across detection electrodes 16 and 17 indicate insufficient water in the earth between the electrodes . when the resistance of the earth between the electrodes 16 and 17 decreases to a pre - determined level , then the switch relay opens the circuit between the conductors 19 and 13 and allows the solenoids 20 to become de - energized . an optional feature which may be employed in the probe 14 is an override control conductor 52 which will connect through the switch 54 and energize the solenoids 20 even though the switch is disconnected in the regular connection through the conductor 50 from the conductor 13 to conductor 19 . this override wire or conductor 52 may be part of the power cable coming out to the detection probe 14 from the controller 11 . this override feature is useful in that an operator can close the override switch at the central controller 11 and thereby energize all the solenoid valves in the system . thus , all the irrigating heads in the system will be seen to sprinkle , indicating that all the respective probes 14 are operational and receiving voltage from the central controller . it will become apparent to those skilled in the art that the preferred embodiment as herein disclosed may be modified substantially without departing from the spirit of the invention as defined by the appended claims . | 8 |
preferred embodiments of the present invention be explained with reference to the accompanying drawings as follows . fig1 is an enlarged view of a main portion in a luminaire ( or , a lighting unit ) for explaining a liquid crystal display device according to a first embodiment of the present invention , and shows a structure of an electrode portion of a fluorescent lamp as a linear light source ( or , a tubular light source ) constituting the luminaire . in this embodiment , a cold cathode fluorescent lamp is utilized for the fluorescent lamp 8 , and the electrode portions at both ends thereof are inserted elastically into lamp holders 9 respectively . these lamp holders 9 are flexible , has an almost rectangular exterior , and has an opening for inserting an end of the fluorescent lamp 8 into a cavity formed therein on one of surfaces thereof . this cavity has a dead end in the lamp holder 9 , but may have a tunnel - like shape which pierces through the lamp holder 9 to another surface thereof opposite to the surface having the opening . an electrode terminal 8 a is pulled out from the electrode portion of the fluorescent lamp 8 , and an electric power supplying lead being connected to a power source section of the liquid crystal display device ( not shown ) is soldered to the electrode terminal for example in a similar matter to fig1 , but is omitted in this drawing . according to this embodiment , heat in the electrode portion of the fluorescent lamp 8 is retained by setting the fluorescent lamp equipped with the lamp holder 9 in an intermediate mold frame as shown in fig1 so that a temperature drop of the electrode portion is suppressed . consequently , the liquid crystal display device of this embodiment enables to display an image thereby without luminescence decrease . fig2 is an enlarged view of a main portion in a luminaire for explaining a liquid crystal display device according to a second embodiment of the present invention , and shows a structure of an electrode portion of a fluorescent lamp as a linear light source constituting the luminaire . a difference in this embodiment from the aforementioned first embodiment is that the lamp holder has an almost cylindrical exterior , and has an opening for inserting an end of the fluorescent lamp 8 into a cavity formed therein on one of end surfaces thereof . this cavity has a dead end in the lamp holder 9 , but may have a tunnel - like shape which pierces through the lamp holder 9 to another side thereof opposite to the surface having the opening . according to this embodiment also , heat in the electrode portion of the fluorescent lamp 8 is retained by setting the fluorescent lamp equipped with the lamp holder 9 in an intermediate old frame as shown in fig1 so that a temperature drop of the electrode portion is suppressed . consequently , the liquid crystal display device of this embodiment enables to display an image thereby without luminance decrease . in fig3 is an enlarged views of a main portion in a luminaire for explaining a liquid crystal display device according to a third embodiment of the present invention , and shows a structure of an electrode portion of a fluorescent lamp as a linear light source constituting the luminaire . in this embodiment , the lamp holder 9 is shaped into an almost cylindrical exterior like that of the second embodiment , and has an opening for inserting an end ( an electrode portion ) of the fluorescent lamp 8 into a cavity formed therein on one of end surfaces thereof also . an external diameter of a circumference 9 a around this opening is varied along a longitudinal direction of the fluorescent lamp 8 so as to adhere to outer wall of the fluorescent lamp . this cavity in this embodiment has a dead end in the lamp holder 9 also , but may have a tunnel - like shape which pierces through the lamp holder 9 to another side thereof opposite to the surface having the opening . according to this embodiment also , heat in the electrode portion of the fluorescent lamp 8 is retained by setting the fluorescent lamp equipped with the lamp holder 9 in an intermediate mold frame as shown in fig1 so that a temperature drop of the electrode portion is suppressed . consequently , the liquid crystal display device of this embodiment enables to display an image thereby without luminance decrease . dotted patterns drawn in each cross - section of the lamp holders shown in fig1 through 3 . these dotted patterns show that resin or other material having thermal conductivity like that of the resin of which the lamp holder 9 is formed has a plurality of pores therein . as these pores are formed in the lamp holder 9 , heat conduction from the fluorescent lamp 8 to a housing ( frame , casing , or else ) is effectively reduced . by the way , thermal conductivity of gas or solid state material is exemplified as follows . each value of thermal conductivity is based on a unit being defined as w ( watt )/ m ( meter )· k ( kelvin : temperature ). air : 2 . 41 × 10 − 2 w · m − 1 · k − 1 ( at 0 ° c .) ( ditto ): 3 . 41 × 10 − 2 w · m − 1 · k − 1 ( at 100 ° c .) nitrogen ( n 2 ): 2 . 40 × 10 − 2 w · m − 1 · k − 1 ( at 0 ° c .) ( ditto ): 3 . 09 × 10 − 2 w · m − 1 · k − 1 ( at 100 ° c .) carbon dioxide ( co 2 ): 1 . 45 × 10 − 2 w · m − 1 · k − 1 ( at 0 ° c .) ( ditto ): 2 . 23 × 10 − 2 w · m − 1 · k − 1 ( at 100 ° c .) argon ( ar ): 1 . 63 × 10 − 2 w · m − 1 · k − 1 ( at 0 ° c .) ( ditto ): 2 . 12 × 10 − 2 w · m − 1 · k − 1 ( at 100 ° c .) glass ( soda ): 0 . 55 ˜ 0 . 75 w · m − 1 · k − 1 ( at 0 ˜ 20 ° c .) quartz glass : 1 . 4 w · m − 1 · k − 1 ( at 0 ° c .) ( ditto ): 1 . 9 w · m − 1 · k ( at 100 ° c .) rubber ( soft rubber ): 0 . 10 ˜ 0 . 20 w · m − 1 · k − 1 ( at 0 ˜ 20 ° c .) rubber ( sponge ): 0 . 04 w · m − 1 · k − 1 ( at 25 ° c .) silicone rubber : 1 . 0 w · m − 1 · k − 1 ( at 0 ˜ 20 ° c .) acrylic resin : 0 . 17 ˜ 0 . 25 w · m − 1 · k − 1 ( at 0 ˜ 20 ° c .) polyethylene : 0 . 25 ˜ 0 . 34 w · m − 1 · k − 1 ( at 0 ˜ 20 ° c .) polystyrene : 0 . 08 ˜ 0 . 12 w · m − 1 · k − 1 ( at 0 ˜ 20 ° c .) asbestos ( textile ): 0 . 1 w · m − 1 · k − 1 ( at 0 ˜ 20 ° c .) asbestos ( cotton ): 0 . 06 w · m − 1 · k − 1 ( at 0 ˜ 20 ° c .) aluminum : 236 w · m − 1 · k − 1 ( at 0 ° c .) ( ditto ): 241 w · m − 1 · k − 1 ( at 100 ° c .) as apparent from the thermal conductivity difference between the soft rubber and the sponge formed by introducing pores thereinto , or that between the textile - like asbestos and the cotton - like asbestos , although both members are formed of the same material , one of the members may have different thermal conductivity from that of another of the members in accordance with amounts of pores or gaseous layers existing in the respective members . on the other hand , the thermal conductivity of the soda glass being utilized for the fluorescent lamp 8 is as 22 through 31 times greater as that of the air under the temperature of 0 ° c . furthermore , the thermal conductivity of the aluminum being utilized for the lower frame 6 is as c . a . 10 , 000 times greater as that of the air . for example , temperature inside the fluorescent lamp rises up to 50 ° through 60 ° c ., and temperature around the lower frame ( environmental temperature for operating the liquid crystal display device ) is around 20 ° c ., during a practical use of the liquid crystal display device . under the above exemplified environment for the practical use of the liquid crystal display device , the above - mentioned relationship of the thermal conductivity between the air and the soda glass and that between the air and the aluminum are almost unaffected . the conventionally used lamp holder 9 as shown in fig1 is formed of silicone rubber and contacts with an outer surface of a fluorescent lamp 8 therein , and at least one part of an outer surface thereof contacts with a lower frame 6 , respectively . the construction of this sort is clearly understood with reference to fig1 showing that the lower frame 6 covers the lamp holder 9 . in contrast to such a conventionally employed construction , the lamp holder 9 being used for the liquid crystal display device according to the present invention is formed for example , of a material indicating thermal conductivity lower than either that of silicone rubber or 1 w · m − 1 · k − 1 in any temperature selected from a range lying from − 40 ° c . through 80 ° c . fig1 a shows an example of the intermediate mold frame 4 being equipped with the fluorescent lamp 8 by using the lamp holder 9 according to the present invention . fig1 a is drawn in the same view of fig1 , but differs from fig1 in that fig1 is a partial cross - sectional view which is taken along a plane including the electrode terminal 8 a of the fluorescent lamp 8 and spreading along a surface of the lower frame 6 ( or the liquid crystal display panel ) and shows the intermediate mold frame 4 , the fluorescent lamp 8 , and the lamp holder 9 being cut along the plane respectively . therefore , fig1 a does not show the lower frame 6 , but shows an electrode 8 b disposed in the fluorescent lamp 8 and a core wire 10 a of the electric power supply lead 10 having coaxial structure . in fig1 a , a hollowed portion 4 b is formed at a part of the side of the intermediate mold frame 4 which faces a part of a side of the light guide plate 5 and the protruded portion 5 a is formed at the part of the side thereof similarly to those of fig1 so that the light guide plate 5 is fixed at the intermediate mold frame 4 properly by fitting the protruded portion 5 a into the hollowed portion 4 b . if the lamp holder 9 is formed of a material having sufficiently low thermal conductivity , the lamp holder 9 need not to include a plurality of pores therein . therefore , a dotted pattern as a symbol of the pores are not drawn in a cross section of the lamp holder shown in fig1 a . the material replacement of this sort is applicable to a lamp holder 9 being explained in each of the embodiments 1 through 3 , also . the lamp holder 9 shown in fig1 a has a cavity 9 a being formed therein into which one of ends of the fluorescent lamp 8 is inserted . the cavity 9 a has an dead - ended structure which is substantially surrounded by the material utilized for the lamp holder 9 except for an opening for inserting the fluorescent lamp 8 thereinto . strictly speaking , there is another opening at a portion of the lamp holder 9 through which the electrode terminal 8 a of the fluorescent lamp 8 pierces . however , since an inner surface of the lamp holder 9 at the electrode terminal piercing portion contacts with a surface of the electrode terminal 8 a more tightly than a contact thereof with the fluorescent lamp at the fluorescent lamp inserting portion , the opening at the electrode terminal piercing portion is negligible . heat dispersion from the end portion of the fluorescent lamp 8 causes not only through a contact surface thereof with the lamp holder 9 , but also through the electrode terminal 8 a thereof toward the electric power supply lead 10 . for preventing the latter of the heat dispersions , the cavity 9 a in the lamp holder 9 is formed to have a larger volume than that of an end portion of the fluorescent lamp being inserted thereinto . even if a gap appears between the fluorescent lamp 8 and the lamp holder 9 at the fluorescent lamp inserting portion 9 b , gas remaining in a space of the cavity 9 a which is isolated from an outside of the lamp bolder by inserting the fluorescent lamp 8 into the cavity 9 a ( the space called a rest portion of the cavity 9 a , hereinafter ) can hardly leak out from the rest portion of the cavity , and is regarded to be almost confined in the rest portion , as long as a volume of the gap is smaller than that of the rest portion ( the volume difference between the whole cavity 9 a and the end portion of the fluorescent lamp being inserted into the cavity ). therefore , heat being conducted from the fluorescent lamp 8 to an outside thereof through the electrode terminal 8 a thereof warms up the gas remaining in the rest portion of the cavity 9 a so that the warmed gas prevents the temperature drop of the end portion of the fluorescent 8 . some of the heat from the fluorescent lamp 8 which does not contribute to warm up the gas in the rest portion of the cavity 9 a and is conducted toward the electric power supply lead ( rightward in fig1 a ) by the electrode terminal 8 warms up the lamp holder 9 at the electrode piercing portion thereon . consequently , the temperature of the lamp holder 9 is so increased that the temperature drop of the end portion of the fluorescent lamp 8 contacting therewith is suppressed effectively . fig1 b is a partial cross - sectional view of another example of the lamp holding structure according to the present invention , and differs from fig1 a in that the lamp holder 9 has a tunnel - like structure and spacers 91 being disposed therearound . the lamp holder 9 of fig1 b has an opening for inserting the fluorescent lamp 8 into the cavity 9 a thereof and another openings for inserting the electric power supply lead into the cavity 9 a thereof , as that of fig1 does . furthermore , the lamp holder 9 of fig1 b has a third openings additionally to the aforementioned two openings . the third opening is provided for work to connect the electrode terminal 8 a and the core wire 10 a by soldering , spot - welding , or else in the cavity 9 a . the third opening is filled up with a cap 90 after connecting the electrode terminal 8 a to the core wire 10 a so as to suppress a leakage of gas remaining in the rest portion of the cavity 9 a to an outside of the lamp holder 9 in similar manner to the lamp holding structure of fig1 a . however , if the lamp holder 9 has sufficient elasticity and the intermediate mold frame has thermal conductivity lower than that of silicone rubber and a surface thereof being large enough to cover the third opening , the third opening may be blocked with the intermediate mold frame by pressing the third opening side of the lamp holder 9 upon the surface thereof . in the example of fig1 b , at least one spacer is provided between an outer surface of the lamp holder 9 and any surface of the intermediate mold frame 4 , the lower frame ( not shown ), or the like which faces the outer surface of the lamp holder 9 . the spacer may be for an example , shaped into a sleeve - like form rolling up an circumference of the lamp holder 9 ( if having a tuber form ), or for another example , separated to a plurality of pieces . by disposing the spacer 91 between the lamp holder 9 and the intermediate mold frame 4 as fig1 b , a first interface between the fluorescent lamp 8 and the lamp holder 9 , a second interface between the lamp holder 9 and the spacer 91 , and a third interface between the spacer 91 and the intermediate mold frame 4 appear on a path of heat conduction from the fluorescent lamp 8 to the intermediate mold frame 4 . according to manufacturing precision for assembling the lamp holding structure , gas penetrates into each of the interfaces , so that each of the interface functions like a porous member ( a member having a plurality of pores therein ). therefore , even by adding the spacer 91 to the heat conduction path as fig1 b shows , the thermal conductivity of the whole of the heat conduction path is decreased enough to suppress the temperature drop at an end portion of the fluorescent lamp 8 . such an advantage of the spacer 91 is also available for disposing the spacer between the lamp holder 9 and the member being formed of metal like the lower frame . furthermore , by using the spacer 91 , the lamp holder 9 is able to be formed not only of a material disclosed in the preceding embodiments 1 through 3 , but also of silicone rubber for example . the spacer may be formed of any materials , and preferably is formed a material having thermal conductivity equal to or lower than that of the lamp holder 9 . one of the lamp holding structures of fig1 b is embodied by combining a lamp holder 9 utilizing a rubber bush formed of silicone rubber with a spacer 91 formed of acrylic resin or abs ( acrylonitrile butadiene styrene ) resin . for this example , a part of a metal member like a lower frame which faces the rubber bush is recommended to be cut away as mentioned in following embodiments 4 and 5 . especially , by removing a part of the metal member having a possibility to be contacted with the spacer 91 , the heat dispersion from the fluorescent lamp 8 to the metal member is prevent so that the temperature of the electrode portion of the fluorescent lamp is kept at proper value exactly . on the other hand , the lamp holder 9 is recommended to be spaced from any members other than the spacer ( s ) 91 . fig4 is an disassembled squint view of a liquid crystal display device for explaining the liquid crystal display devices according to a fourth embodiment and a fifth embodiment to be mentioned later of the present invention , and shows a similar structure to that in fig1 except for a lower frame thereof . fig5 is a plan view of a main portion of a liquid crystal display device ( around a fluorescent lamp installed therein ) seen from a lower frame side thereof for explaining the lower frame of the liquid crystal display device shown in fig4 according to a fourth embodiment of the present invention , and fig6 is an partial cross - sectional view being taken along a line a — a of fig5 , respectively . in the fourth embodiment of the present invention , a lamp holder 9 may be formed of a material being utilized for that of the conventional type , and heat dispersion from the lamp holder 9 to the lower frame 6 constituting the liquid crystal display device is prevented by an opening 6 a of the lower frame 6 which is facing the electrode portion of the fluorescent lamp . consequently , a temperature drop of the electrode portion of the fluorescent lamp 8 is so suppressed that illumination of high brightness is able to be obtained by the fluorescent lamp . the lower frame 6 in this embodiment is shaped into a skeleton - like form , and rectangular openings ( or , holes , windows ) 6 a formed by punching respective portions of the lower frame 6 corresponding to the respective electrode portion of the fluorescent lamp 8 as fig5 and 6 shows . these openings are shaped not only into rectangular forms but also into any forms properly . in the fifth embodiment of the present invention equipping the electrode portions of the fluorescent lamp 8 with such lamp holders as explained with reference to fig1 through 3 previously , heat dispersion from the lamp holder 9 to the lower frame 6 is suppressed furthermore , because the lamp holders 9 have heat retaining effect . therefore , a temperature drop at each of the electrode portions of the fluorescent lamp 8 is so suppressed that illumination of higher brightness is able to be obtained by the fluorescent lamp . as fig6 shows , the fluorescent lamp 8 is fixed to the intermediate mold frame 4 by forcing the fluorescent lamp into the light source retaining portion 4 a thereof using elastic deformation of the lamp holders 9 attached thereto . the fluorescent lamp 8 is also fixed at a position facing a side of the light guide plate 5 which is incorporated to the intermediate mold frame 4 . according to this embodiment , heat dispersion to the lower frame 6 is so suppressed that a temperature drop of the electrode portion of the fluorescent lamp 8 is suppressed by retaining the temperature thereof and consequently an image of high display quality is obtained by preventing luminance decrease . fig7 is a plan view of a main portion of a liquid crystal display device ( around a fluorescent lamp ) seen from a lower frame side thereof for explaining the lower frame of the liquid crystal display device according to a sixth embodiment of the present invention . in this embodiment , the lower frame 60 is formed of a simple plate which does not have such a skeleton - shaped structure as mentioned in the aforementioned embodiments . therefore , a notch 60 a is formed at portions of the lower frame 6 ( a pair of corners thereof , in this embodiment ) corresponding to the electrode portions of the fluorescent lamp 8 so as to prevent heat dispersion from the lamp holder 9 to the lower frame 6 , in this embodiment . moreover , regardless of such shapes and materials of the lamp holders 9 as explained by referring fig1 through 3 , any kinds of the lamp holders like that used conventionally may be utilized as the lamp holders 9 being attached to the fluorescent lamp 8 for suppressing the luminance decrease , in this embodiment . various embodiments of the present invention being mentioned above are also applied to the liquid crystal display device employing a fluorescent lamp having so - called double - piped structure being disclosed for example by the japanese patent application laid - open no . hei 08 - 334760 / jp - a - 334760 / 1996 . the fluorescent lamp 8 of this sort has a cross sectional structure shown as fig1 a . in the fluorescent lamp of the double - piped type , a glass chamber 81 constituting a main body of the fluorescent lamp is disposed within another glass chamber 82 . an a - zone within the glass chamber 81 is provided for generating illuminating light , and a b - zone being surrounded by an outer surface of the glass chamber 81 and an inner surface of the glass chamber 82 is provided for thermal insulation between the a - zone and a c - zone . the c - zone means an environment around the fluorescent lamp 8 . temperature of the a - zone should be kept at 50 ˜ 60 ° c . for generating illuminating light therein . however , an environmental temperature of the fluorescent lamp 8 remains lower than that of the a - zone . in a conventionally used fluorescent lamp mentioned previously , the a - zone is separated from the c - zone only by one glass tube so that the temperature of the a - zone can be hardly kept in a preferable range for emitting light . the fluorescent lamp of the double piped type provides the b - region containing air or the like between the a - zone and the c - zone and reduces thermal conductivity between the a - zone and the c - zone by keeping temperature of the b - zone between those of the a - zone and the c - zone . thus , the whole of the a - zone is kept at the preferable temperature for light emission . however , even in the double piped fluorescent lamp , a possibility of heat dispersion from a electrode portion ter of the fluorescent lamp 8 still remain . the b - zone along the electrode terminal 8 a is hardly enlarged so that heat is easily leaked out to the c - zone by the electrode terminal 8 a . on the other hand , the double piped structure is assembled by forming glass beads 83 a and 83 b formed around the electrode terminal 8 a , then by welding an inner glass tube to the glass bead 83 a for forming the glass chamber 81 , and finally by welding an outer glass tube to the glass bead 83 b for forming glass chamber 82 . however , according to the manufacturing precision , the glass beads 83 a and 83 b tend to be contacted with one another as fig1 b shows , or both of the glass beads 83 a and 83 b tend to be united to be a glass bead 83 as fig1 c shows . in these structure , heat can be leaked through an interface between the glass beads from the a - zone to the c - zone also , and consequently the temperature of the a - zone around the electrode portion ter can be hardly kept at the preferable value for generating the illuminating light . for solving the aforementioned problems being missed in the double piped fluorescent lamp 8 previously , the present invention is applied to the lamp holding structure for the double piped fluorescent lamp 8 in similar manners to those for the conventionally used fluorescent lamp 8 as mentioned above . fig1 is a partial cross - sectional view of one of the lamp holding structure for the double piped fluorescent lamp 8 to which the present invention is applied . the lamp holding structure of fig1 employs a similar to that of fig1 b , but differs from fig1 b in that the electrode terminal 8 a is extended straightforward to the core wire 10 a of the electric power supply lead 10 , the opening for inserting the electric power supply line 10 is formed at opposite side to the opening for inserting , the fluorescent lamp 8 , and a washer - like spacer 91 is added at the side for spacing the lamp holder 9 from the intermediate mold frame 4 . the sleeve - like lamp holder 9 contact with an outer surface of the electric power supply lead 10 so as to be movable along the core wire 10 a thereof . therefore , a process for connecting the electrode terminal 8 a to the core wire 10 a becomes easier . the washer - like spacer being added to this structure helps the lamp holder 9 confine gas in the cavity thereof . of course , the lamp holding structures according to the present invention other than that of fig1 may be applied to the double - piped fluorescent lamp , and the lamp holding structure of fig1 may be also applied to the fluorescent lamp other than that having the double - piped structure . fig8 is an outlined diagram of one of liquid crystal display devices for portable data terminals for explaining the one of liquid crystal display devices to which the present invention is applied , and shows a transparent type liquid crystal display panel 3 , a light guide plate 5 , a fluorescent lamp 8 , a touch panel 20 , and a protective film 21 , respectively . this liquid crystal display devices for portable data terminals is equipped with the fluorescent lamp and the lamp holders mentioned in any one of the aforementioned embodiments . furthermore , a touch panel onto which data or commands are inputted by a pen - like device is provided on or over the liquid crystal display panel 3 . moreover , the protective film 21 having an abrasion - proof property and preventing extraneous light from being reflected thereby is stacked on an upper surface of the touch panel 20 . fig9 is a cross - sectional view of another of liquid crystal display devices for portable data terminals for explaining the another of liquid crystal display devices to which the present invention is applied , and so - called reflective type liquid crystal display panel is utilize therefor . in fig9 a lower glass substrate 31 as a lower substrate , an aluminum film 32 as a reflective layer , a protective film 33 formed of anti - oxidation film of sio 2 or the like , lower transparent electrodes 34 as lower - side electrodes , an upper glass substrate 35 as an upper substrate , color filters 36 each of which has one of three kinds of color ( r : red , g : green , b : blue ), protective film 37 formed of a transparent organic material for protecting a liquid crystal layer from pollutants exuding from the color filters and for leveling a surface on which upper - side electrodes are formed , one of transparent electrodes 38 as upper - side electrodes , a liquid crystal layer 39 containing liquid crystal compounds , and a scaling material 40 of epoxy resin or the like for gluing the upper side substrate and the lower side substrate to form a liquid crystal panel so as to seal the liquid crystal layer therebetween are shown . the liquid crystal display panel in this embodiment is a so - called stn - type ( super twist nematic - type ) liquid crystal display panel , and optical films 41 including an optical retardation plate and a polarizer are stacked on a surface thereof at the upper glass substrate 35 side ( at an upper side thereof ). as the need arises , lattice - like light shielding film ( black matrix ) is provided among color filters 36 so as to separate respective colors r , g , and b thereof from each other , and then the protective film 37 is formed over the color filters and the black matrix . the aluminum film 32 as a reflective layer having specular reflection property ( mirror reflection property ) is formed by a deposition method using aluminum in this embodiment . multi - layered films for improving a reflectance of the aluminum film 32 may be formed on a surface thereof , and the protective film 33 for preventing the aluminum thereof from being corroded and for leveling upper surface of the protective film itself is formed on or over a surface thereof . the reflective layer of this sort may be formed of metal or nonmetallic material other than aluminum as long as a layer of the metal or the nonmetallic material has a sufficient specular reflection property for the reflective film . the protective film is usually formed of a transparent organic material , and a lower - side transparent electrode 4 for driving the liquid crystal display panel is formed an upper surface thereof . a degree of polarization and a polarization as of the polarizer constituting the optical films 41 disposed on an upper surface of the upper - side glass substrate , and a value of δnd of the optical retardation plate ( δnd : a product being calculated from birefringence : δn multiplied by its thickness : d ) constituting the optical films 41 also are designed to be optimum values respectively which are determined in accordance with a twist angle , a tilt angle , and a value of δnd of the liquid crystal compound ( δnd : a product being calculated from birefringence of the liquid crystal compound : δn multiplied by thickness of the liquid crystal layer containing the liquid crystal compound : d ), by a known method . a light guide plate 5 having a function for emitting light toward the liquid crystal display panel effectively is disposed above an upper side thereof where the optical films 41 are disposed , so that the light guide plate functions as an auxiliary light source for enabling use thereof in such a dark environment as a room with little extraneous light , the night , or the like . the , light guide plate 5 is shaped by processing a surface of a board formed of transparent acrylic resin or the like . the fluorescent lamp 8 like a cold cathode fluorescent lamp or else is disposed along one of edges of the light guide plate 5 , and supplies illuminating light therefrom into the light guide plate 5 . the luminaire of this sort is called a front light , generally . according to the liquid crystal display device , an image of high display quality is available with low electric power consumption . fig1 is an explanatory diagram exemplifying an exterior of a portable data terminal as an example of electronic devices to which a liquid crystal display device according to the present invention is installed . the portable data terminal comprises a main body 50 , and a cover 51 being mounted at one of ends of the main body 50 with a hinge so as to allow the cover to cover and to reveal a display screen of the aforementioned liquid crystal display device 52 according to the present invention freely , which is installed in the main body 50 . information is inputted to the portable data terminal by tracing a data input section on the display screen of the liquid crystal display device 52 with a pen 53 ( a pen - like tool ) which is housed in a housing portion 54 formed at the cover 51 . moreover , a shape , a structure , and a function of the portable data terminal of this sort are not limited to those shown herein , but are considered to be diversified . on the other hand , the present invention should not be limited to an application for the aforementioned liquid crystal display device having a touch panel , but may be applied to the other well - known liquid crystal display devices as well . as explained above , the liquid crystal display device according to the present invention suppresses the temperature drop of the electrode portion at the end of the fluorescent lamp ( especially for the cold cathode fluorescent lamp ) even if current being supplied therefor is low . therefore , temperature difference between the electrode portion and middle portion thereof is so reduced that the luminance decrease phenomenon of the fluorescent lamp by accumulation of mercuric droplets at the end thereof is prevented . consequently , the liquid crystal display device with high brightness and high reliability is available . while we have shown and described several embodiments in accordance with the present invention , it is understood that the same is not limited thereto but is susceptible of numerous changes and modifications as known to those skilled in the art , and we therefore do not wish to be limited to the details shown and described herein but intend to cover all such changes and modifications as are encompassed by the scope of the appended claims . | 6 |
[ 0061 ] fig1 . a - 1 . f show various ways of placing information carrying areas for holding electronically readable information on a cartridge . in fig1 . a - 1 . d the information carrying areas are concentrated to one axial end of the cartridge , preferably near the lid , whereas in fig1 . e - 1 . f the information carrying areas are concentrated to a limited radial sector of the cartridge , but extending along the full length of the cartridge . [ 0062 ] fig1 . a - 1 . d show a cartridge 10 with an axis of rotational symmetry 11 and information carrying areas located at one axial end of the cartridge . [ 0063 ] fig1 . a shows two information carrying areas 101 , 102 positioned side by side in a radial direction on the surface of the cartridge ( i . e . along the periphery perpendicular to the axis of symmetry ). each information carrying area covers only a limited radial sector of the surface . [ 0064 ] fig1 . b shows two information carrying areas 103 , 104 positioned side by side in the axial direction on the surface of the cartridge ( i . e . along the periphery parallel to the axis of symmetry ). each information carrying area covers only a limited radial sector of the surface . [ 0065 ] fig1 . c shows two information carrying areas 105 , 106 positioned side by side in the axial direction on the surface of the cartridge ( i . e . along the periphery parallel to the axis of symmetry ). each information carrying area encircles the entire radial periphery of the cartridge . in each of fig1 . a - 1 . c , two information carrying areas are shown side by side . there might as well , however , be several information carrying areas located side by side in axial or radial direction . [ 0067 ] fig1 . d shows information carrying areas 110 , 111 , 112 , 113 , 114 positioned side by side , evenly distributed in a radial direction on the surface of the cartridge ( i . e . along the periphery perpendicular to the axis of symmetry ). each information carrying area covers only a limited radial sector of the surface . information carrying areas 110 , 111 , 112 , 113 , 114 plus identical ones situated on the hidden part of the surface are evenly distributed on the surface of the cartridge in a radial direction , i . e . extending along the whole periphery encircling the axial direction of the cartridge . [ 0068 ] fig1 . e - 1 . f show a cartridge 10 with an axis of rotational symmetry 11 and information carrying areas concentrated to an area 120 corresponding to a limited radial sector 121 of the cartridge 10 . [ 0069 ] fig1 . e shows information carrying areas 115 and 116 side by side in axial direction and extending along the major part of the axial length of the cartridge . the information carrying areas are located within a surface area 120 corresponding to a radial sector 121 . [ 0070 ] fig1 . f shows information carrying areas 117 and 118 side by side in radial direction and extending along the major part of the axial length of the cartridge . the information carrying areas are located within a surface area 120 corresponding to a radial sector 121 . in fig1 . e and 1 . f , two information carrying areas are shown within the surface area 120 . there might as well , however , be several information carrying areas located side by side in axial or radial direction . [ 0072 ] fig2 . a - 2 . e shows various ways of laying out the electrically conducting and electrically insulating areas in predefined positions within an information carrying area , implementing a binary representation of an item of information in its true and inverted form . in each of fig2 . a - 2 . e two information carrying areas containing an item of information in a true and inverted binary form , respectively , are schematically shown . each information carrying area has a rectangular shape defining a longitudinal direction as the direction defined by its longest side . a direction is also defined by the direction perpendicular to the face between two neighboring predefined positions each containing a specific bit of information . [ 0074 ] fig2 . a shows an embodiment with two information carrying areas 20 , 21 located side by side in a direction perpendicular to the direction 205 defined by adjacent predefined positions . each individual bit of information is implemented as a patch of electrically conducting 211 ( no filling ) or electrically insulating 201 ( hatched ) material located at a specific predefined position of the information carrying area . neighboring patches abut each other . the structure of information carrying areas 20 , 21 may e . g . be used in fig1 . a , 1 . d , and 1 . f . [ 0075 ] fig2 . b shows an embodiment with two information carrying areas 22 , 23 located side by side in a direction perpendicular to the direction 225 defined by adjacent predefined positions . each individual bit of information is implemented as a patch of electrically conducting 231 ( no filling ) or electrically insulating 221 ( hatched ) material located at a specific predefined position of the information carrying area . neighboring patches are separated by a an ‘ empty ’ space 220 , 230 of width equal to the width of each of the information carrying patches 221 , 231 . the ‘ empty ’ space may consist of an electrically conducting or insulating layer ( as long as the pads on the pcb ( cf . 763 , 764 on fig7 ) are correspondingly laid out ). the structure of information carrying areas 22 , 23 may e . g . be used in fig1 . a , 1 . d , and 1 . f . [ 0076 ] fig2 . c shows an embodiment with two information carrying areas 24 , 25 located side by side in a direction 245 defined by adjacent predefined positions . each individual bit of information is implemented as a patch of electrically conducting 251 ( no filling ) or electrically insulating 241 ( hatched ) material located at a specific predefined position of the information carrying area . neighboring patches abut each other . the structure of information carrying areas 24 , 25 may e . g . be used in fig1 . a , 1 . d , and 1 . f . [ 0077 ] fig2 . d shows an embodiment with two information carrying areas 26 , 27 located side by side in a direction 265 defined by adjacent predefined positions . each individual bit of information is implemented as a patch of electrically conducting 262 , 271 ( no filling ) or electrically insulating 261 , 272 ( hatched ) material located at a specific predefined position of the information carrying area . neighboring patches abut each other . the structure of information carrying areas 26 , 27 may e . g . be used in fig1 . b , 1 . c , and 1 . e . [ 0078 ] fig2 . e shows an embodiment with two information carrying areas 28 , 29 located side by side in a direction perpendicular to the direction 285 defined by adjacent predefined positions . each individual bit of information is implemented as a patch of electrically conducting 291 ( no filling ) or electrically insulating 281 ( hatched ) material located at a specific predefined position of the information carrying area . neighboring patches abut each other . the structure of information carrying areas 28 , 29 may e . g . be used in fig1 . b , 1 . c , and 1 . e . [ 0079 ] fig3 . a and 3 . b show labels according to the invention with a multitude of information carrying areas containing electrically conducting and electrically insulating areas in predefined positions . [ 0080 ] fig3 . a shows a self - adhesive label 30 consisting of a carrier foil 31 provided with information carrying areas 310 , 320 , 330 , 340 , 350 , 360 , 370 , each containing an item of information in its binary true or inverted form . each information carrying area consists of a rectangular electrically conducting base , to which layers of electrically insulating rectangular patches ( hatched ) 312 , 332 , 352 , 372 are added in predefined positions . the true and inverted forms appear alternatingly along the radial direction of the carrier . the binary representation of the information in information carrying area 340 is , for example , the inverse of that in 350 as indicated by corresponding bits 342 and 352 , respectively , being each others inverse ( 342 is illustrated with no filling , indicating an electrically conducting patch , and 352 is hatched , indicating an electrically insulating patch ). one predefined position 311 , 321 , 331 , 341 , 351 , 361 , 371 in each information carrying area 310 , 320 , 330 , 340 , 350 , 360 , 370 , respectively is reserved for applying a power supply voltage . [ 0081 ] fig3 . b shows a preferred embodiment of a self - adhesive label 35 consisting of an electrically conducting carrier foil 36 provided with information carrying areas 315 , 325 , 335 , 345 , 355 , 365 , 375 , each containing an item of information in its binary true or inverted form . each information carrying area consists of patterns of rectangular patches of electrically conducting 357 , 366 ( no filling ) and electrically insulating patches 356 , 367 ( hatched ) added in predefined positions . all predefined positions are illustrated for areas 355 and 365 , where each electrically conducting patch ( being just a predefined ‘ empty ’ position on the electrically conducting foil ) is indicated by a dotted boundary line . for the other information carrying areas , only the electrically insulating patches are specifically indicated . the true and inverted forms appear alternatingly along the radial direction of the carrier . the binary representation of the information in information carrying area 355 is , for example , the inverse of that in 365 as indicated by corresponding bits ( 356 , 366 ) and ( 357 , 367 ), respectively , being each others inverse . a predefined area 37 of the foil is reserved for applying a power supply voltage . [ 0082 ] fig4 shows a cartridge with a label containing an electronically readable information and a support for supporting the cartridge and for transferring the information from the cartridge to an electronic circuit . [ 0083 ] fig4 shows a replaceable cartridge 40 for a pen - type injection device . the cartridge has a rotational symmetry 43 . a label 41 is shown before its positioning on the surface at one axial end of the cartridge . the label consists of a self - adhesive carrier 42 with information carrying areas 410 , 411 , 412 , 413 , 414 , 415 , each consisting of a stripe of electrically conducting foil 4151 ( light grey ) with electrically insulating patches 4152 ( dark grey ) in predefined positions , cf . fig2 . b and fig3 . a . [ 0084 ] fig4 also shows a cross sectional view of a support 46 for receiving the cartridge corresponding to a cross section of the cartridge perpendicular to the axis of symmetry and a top view of the receiving surface 45 of the support 46 corresponding to an axial direction of the cartridge . the support 46 consists of two electrically connecting supports 461 , 462 separated by an electrically insulating volume 463 . the electrically connecting supports 461 , 462 consist of alternating layers of electrically conducting and electrically insulating silicone rubber as shown in the ‘ top view ’ illustration by identical areas 451 and 452 . the areas that are designed to receive the predefined positions 4152 ( comprising an electrically insulating or conducting layer ) of the information carrying areas on the cartridge are indicated by a dark grey filling , e . g . 454 , 457 , whereas areas with no filling , e . g . 455 , 466 , correspond to ‘ empty space ’ between predefined positions containing an information bit ( cf . 230 in fig2 . b ). the geometry of the insulating area 453 , corresponding to a ‘ top view ’ cross section of insulating volume 463 , is designed to match the geometry of the information carrying areas on the cartridge in such a way that two adjacent information carrying areas may be received by the support independently of the radial orientation of the cartridge , when placed in the support , cf . the discussion in connection with fig6 below . [ 0085 ] fig5 . a - 5 . c show various geometries of an electrically connecting support according to the invention . common for fig5 . a - 5 . c is that the layer thicknesses are exaggerated compared to the dimensions of the patches 51 on the information carrying areas and the pads 52 on the pcb . [ 0087 ] fig5 . a shows an embodiment of an electrically connecting support 50 , where the thickness t il 530 of the insulating layer 53 is larger than the thickness t cl 540 of the conducting layer 54 . the patches 51 of the information carrying area are shown to be of equal width wpda 510 and to abut each other . the pads 52 on the pcb are shown to have equal width wcp 520 and to be evenly distributed with a distance diacp 521 between each pad . [ 0088 ] fig5 . b shows an embodiment of an electrically connecting support 50 , where the thickness t il of the insulating layer 53 is smaller than the thickness t cl of the conducting layer 54 . [ 0089 ] fig5 . c shows an embodiment of an electrically connecting support 50 , where the thickness t il of the insulating layer 53 equals the thickness t cl of the conducting layer 54 . the relation diacp & gt ; 2 * t cl makes sure that the electrical states of adjacent information carrying patches on the cartridge are not transferred to the same pad in the contact area under the assumption that the border between adjacent patches is located at a position ‘ corresponding to midway between two pads ’. the fulfillment of the relation wcp & gt ; t il + t cl ensures that at least one conducting layer contacts any given pad . correspondingly , the fulfillment of the relation wpda & gt ; t il + t cl ensures that each patch has contact to at least one of the conducting layers of an electrically connecting support , when the cartridge is properly placed in the support . in fig5 . a - 5 . c , the information carrying patches on the cartridge are shown as abutted . this need not be the case , however . they may have any width wpda as long as the relation wpda & gt ; t il + t cl is fulfilled to ensure that at least one conducting layer contacts any given information carrying patch . the relations reflect the minimum distances of pads and patches and between pads and thus for given layer thicknesses determine the information density ( minimum width per bit ). [ 0093 ] fig6 shows geometries involved in reading an item of information provided a multitude of times along the periphery of a cartridge with a rotational symmetry by means of two electrically connecting supports . in fig6 the electrically connecting supports 61 , 62 are shown in a position where they read information from information carrying areas 630 , 640 , respectively , and transfer the information to groups of pads 63 , 64 , respectively , on a pcb . the information carrying areas 610 , 620 , 630 , 640 , 650 , 660 on a label 60 carry an item of information alternatingly in a binary true and inverted form as indicated by the schematically shown individual patches of equal width wpda 69 . the patches are either electrically conducting 6102 ( no filling ) or electrically insulating 6101 ( hatched ). the following geometric relations between the information carrying areas positioned on a cartridge and the electrically connecting supports 61 , 62 of a support according to the invention for the cartridge are preferred : hica & lt ; dctm ensures that the cartridge cannot be positioned in such a way that a given information carrying area has contact to two electrically connecting supports at the same time . hctm & lt ; dica ensures that the cartridge cannot be positioned in such a way that a given electrically connecting support has contact to two information carrying areas at the same time . dica & lt ; 2 * hctm + dctm ensures that the cartridge cannot be positioned in such a way that the electrically connecting supports fall entirely between two information carrying areas , in which case they would not have contact to any of the information carrying areas of the cartridge . dctm & lt ; 2 * hica + dica ensures that the cartridge cannot be positioned in such a way that two adjacent information carrying areas fall entirely between the electrically connecting supports , in which case the latter might not have contact to any of the information carrying areas of the cartridge . in a preferred embodiment , the following relation is fulfilled ( in addition to the above mentioned relations between dctm , hctm , dica , hica ), dctm + hctm = dica + hica , which ensures that the electrically connecting supports 61 , 62 will have contact to two of the information carrying areas irrespective of the radial orientation of the cartridge in the support . [ 0107 ] fig7 shows a cartridge containing an electrically readable information according to the invention in the form of patterns of patches in the axial direction of the cartridge and a support comprising two electrically connecting supports for transferring the information to an electronic circuit . a support according to the invention has the combined function of receiving and mechanically supporting a part of the cartridge provided with information carrying areas and of transferring the information from these information carrying areas to an electronic circuit for further processing . in fig7 the cartridge 70 is only partially shown , as indicated by the ‘ broken ’ outline in the right - hand part of the cartridge . the cartridge possesses a rotational symmetry as indicated by the arrow 71 symbolizing the axis of symmetry . a label 72 containing information carrying areas laid out in the axial direction of the cartridge , is located on the outer surface at one axial end of the cartridge , where a lid 73 , optionally in the form of a piston ( e . g . when the cartridge is a replaceable medication cartridge for a medication delivery device ), provides a closure of the cartridge . the label 72 comprises an electrically conducting foil 720 having information carrying areas 721 - 727 extending in the axial direction of the cartridge . in fig7 a multitude of information carrying areas ( 721 - 727 plus the ones situated on the hidden part of the surface ) are evenly distributed on the surface of the cartridge in a radial direction ( i . e . along the whole periphery encircling the axial direction of the cartridge ). each information carrying area , comprising patterns of electrically conducting 7250 , 7260 , 7261 and electrically insulating 7251 patches , thus only covers a limited radial sector of the surface . in the embodiment of fig7 the electrically conducting ‘ end ’- patches 7250 , 7260 may be used for connecting a power supply voltage . each of the information carrying areas contain an item of information in the form of patterns of electrically conducting and electrically insulating areas . each pattern represents an item of information in binary form . each bit of information is represented by an electrically characteristic layer in a predefined position in the information carrying area . a binary one in a specific predefined position may be represented by an electrically conducting layer covering that predefined position , and a binary zero in a specific predefined position may be represented by an electrically insulating layer covering that predefined position . alternatively , binary one may be represented by an insulating layer and binary zero by a conducting layer . because the foil 720 containing the information carrying areas is electrically conducting , it is only necessary to apply an electrically insulating layer ( e . g . a paint ) to the predefined positions representing one of the a binary states ( in this embodiment ‘ zero ’). in fig7 the cartridge is shown in a position just above the support 75 , which , again for illustrative purposes , is shown just above a pcb with electronic components and connecting wires 76 containing pads 763 , 764 with electrical connections , symbolically indicated by an arrow 762 , to a processing unit 761 , e . g . a microprocessor . the support consists of one or more electrically connecting supports 751 , 752 embedded in an electrically insulating material 755 . the electrically connecting supports comprise alternating layers of electrically conducting 7511 and electrically insulating 7512 layers of an elastomeric material , e . g . silicone rubber with the electrically conducting layer having a concentration of carbon black sufficient for electrical conduction . each electrically conducting layer is electrically insulated from all other electrically conducting layers , so that each electrically conducting layer in effect represents an insulated conductor . by controlling the layer thicknesses , the maximum ‘ density of information ’ in the axial direction may be controlled . in the embodiments of fig7 the support , including the electrically connecting supports , are shown to be adapted to receive the curved shape of the part of the cartridge , where the information carrying areas are located , by shaping them equivalently . this makes possible the use of non - elastic materials for the support , if convenient . in an operating configuration , the support is placed ( and optionally fastened ) on the pcb 760 so that electrical contact between the electrically connecting supports 751 , 752 and the pads 763 , 764 is ensured . the cartridge is positioned on the support so that electrical contact between two of the information carrying areas in their full axial lengths ( i . e . involving all patches of a given information carrying area representing bits of information ) and the electrically connecting supports is ensured . the geometrical dimensions of the patches , layers and pads and mutual distance between adjacent information carrying areas on the cartridge and corresponding electrically connecting supports are discussed above with reference to fig5 and 6 . by applying a specific electric potential to the electrically conducting foil , this potential will be transferred from those predefined areas containing a conductive layer ( i . e . in the present embodiment those predefined areas not being covered by an insulating layer ) to the corresponding pads on the pcb . via the connecting circuitry , a direct measure of the pattern of binary states of the information carrying area connected to the pads by a given electrically connecting support is presented on the inputs of the processing unit , possibly by appropriately terminating the inputs with pull - up or pull - down circuitry depending on the potential applied to the electrically conducting foil and the definition of the binary states . a specific part of the foil may be preferably reserved to the application of the electric potential ( e . g . an area of the foil circumfering the cartridge and not occupied by information carrying areas , in fig7 e . g . the part of the foil 720 not covered by information bits in predefined positions 721 - 730 ). the support is only shown as having an axial length corresponding to the axial length of the corresponding information carrying areas ( e . g . 725 in fig7 ) but it may of course extend in both axial directions if appropriate for the application in question . likewise the support is shown to cover a certain radial sector ( less than 90 degrees ), but it may of course cover any radial sector , including 360 degrees , if appropriate . in a preferred embodiment , the sector covered by the support is less than 180 degrees allowing a direct ‘ vertical ’ placement of the cartridge in the support ( in opposition to the case of a 360 degrees support , where the cartridge has to be axially inserted ). in fig7 the label containing information carrying areas is placed in one axial end of the cartridge covering only the space occupied by the axial extent of the lid / piston to ensure that a full view of the contents of the cartridge is available for inspection . of course it might be located in any convenient position along the surface of the cartridge . similarly , in fig7 the information carrying areas extend in the axial direction of the cartridge . they might as well extend in a radial direction ( as discussed in connection with fig1 and 2 ) or in a direction therebetween ( e . g . forming one or more helixes on the surface of the cartridge ), if convenient , as long as the support , including the electrically connecting supports , is adapted thereto . the electrical connections , schematically indicated by an arrow 762 , connecting the pads 763 , 764 with the processing unit 761 may be a one to one parallel set of electrical connections between each pad and a corresponding input on the processor , but it may also comprise a multiplexing or coding unit to reduce the number of necessary inputs to the processing unit . in the embodiment in fig7 the support 75 comprise two electrically connecting supports 751 , 752 for simultaneously reading two items of information from two information carrying areas on the cartridge . in fig7 the evenly distributed information carrying areas 721 - 730 contain an item of information in a true binary form alternating with the information in its inverted form as indicated by the schematically illustrated patterns of electrically conducting and insulating patches in information carrying areas 725 and 726 , respectively , one pattern being the inverse of the other . the rotational symmetry of the cartridge has the benefit that it only requires the user to position the cartridge properly in a radial direction ( possibly involving a slight rotation of the cartridge around its axis of symmetry ) to ensure that an electrical contact between one of the information carrying areas and the electrically connecting support is present ( since the positioning in an axial direction may be mechanically ensured by the receiving means for the cartridge ). the control of the cartridge being correctly positioned may be in the hands of the processing unit , which , if necessary , may indicate to the user via a display or a voice interface that a corrective action is required , and which may block further use of the device , if the cartridge is not correctly positioned . the embodiment of fig7 has the further advantage of reading the information in a binary true and inverted form , which allows the safety in reading to be improved . instead of providing the information in its true and inverted forms , the same binary representation of the item of information may be provided in all information carrying areas and read twice , which also allows an improved safety in reading . [ 0123 ] fig8 . a - 8 . b show an example of a cartridge and a support according to the invention comprising three electrically connecting supports made of elastic materials . [ 0124 ] fig8 . a shows a cartridge 81 having an axis of rotational symmetry 82 being positioned just above a support 80 comprising three individual electrically connecting supports 801 , 802 , 803 ready for receiving the cartridge . the cartridge is provided with information carrying areas positioned on the cartridge along its radial periphery with a spacing corresponding to the geometry of the electrically connecting supports . the space between the electrically connecting supports may be filled with an insulating material ( e . g . silicone rubber ), not shown . in fig8 . b the cartridge 81 is positioned in the support 80 and fixed with a slight downwards pressure indicated by the arrow 83 . the support including the electrically connecting supports is made of elastic materials so that it conforms to the shape of the cartridge over the length of the support , when the cartridge is placed in the support . the three items of information that may be simultaneously read may be identical , in which case the redundancy may be used to improve the safety in reading ( by a simple majority test or by more advanced error correcting techniques ). some preferred embodiments have been shown in the foregoing , but it should be stressed that the invention is not limited to these , but may be embodied in other ways within the subject - matter defined in the following claims . | 0 |
a compact , low - power , asynchronous sense amplifier ( s / a ) circuit can be implemented according to the present principles . referring now to the drawings in which like numerals represent the same or similar elements and initially to fig2 , an exemplary design of such an s / a circuit 100 is shown in the context of a resistor - based memory circuit . this embodiment can be made very compact , as it may be based on a resistor ( or a diode ) and an inverter . compared to an analog comparator ( e . g ., fig1 ), the design of fig2 is much smaller and uses less power . furthermore , because the s / a is connected to the bitlines and because no s / a enable signal or clock signal is needed , fully asynchronous operation is possible . during a read operation , a pulse signal is applied to the gate of the memory access device , which makes the s / a circuit generate a pulse if the memory cell is in its low - resistance state . there is therefore no precharge phase and , hence , no clock signal is needed . additional s / a circuits and outputs are possible if the memory cell has more than two memory possible states . as will be appreciated by one skilled in the art , aspects of the present invention may be embodied as a system or method . accordingly , aspects of the present invention may take the form of an entirely hardware embodiment or an embodiment combining software and hardware aspects that may all generally be referred to herein as a “ circuit ,” “ module ” or “ system .” the flowchart and block diagrams in the figures illustrate the architecture , functionality , and operation of possible implementations of systems , methods and computer program products according to various embodiments of the present invention . in this regard , each block in the flowchart or block diagrams may represent a module , segment , or portion of code , which comprises one or more executable instructions for implementing the specified logical function ( s ). it should also be noted that , in some alternative implementations , the functions noted in the block may occur out of the order noted in the figures . for example , two blocks shown in succession may , in fact , be executed substantially concurrently , or the blocks may sometimes be executed in the reverse order , depending upon the functionality involved . it will also be noted that each block of the block diagrams and / or flowchart illustration , and combinations of blocks in the block diagrams and / or flowchart illustration , can be implemented by special purpose hardware - based systems that perform the specified functions or acts , or combinations of special purpose hardware and computer instructions . the circuits as described herein may be part of a design for an integrated circuit chip . the chip design may be created in a graphical computer programming language , and stored in a computer storage medium ( such as a disk , tape , physical hard drive , or virtual hard drive such as in a storage access network ). if the designer does not fabricate chips or the photolithographic masks used to fabricate chips , the designer may transmit the resulting design by physical means ( e . g ., by providing a copy of the storage medium storing the design ) or electronically ( e . g ., through the internet ) to such entities , directly or indirectly . the stored design is then converted into the appropriate format ( e . g ., gdsii ) for the fabrication of photolithographic masks , which typically include multiple copies of the chip design in question that are to be formed on a wafer . the photolithographic masks are utilized to define areas of the wafer ( and / or the layers thereon ) to be etched or otherwise processed . the methods as described herein may be used in the fabrication of integrated circuit chips . the resulting integrated circuit chips can be distributed by the fabricator in raw wafer form ( that is , as a single wafer that has multiple unpackaged chips ), as a bare die , or in a packaged form . in the latter case the chip is mounted in a single chip package ( such as a plastic carrier , with leads that are affixed to a motherboard or other higher level carrier ) or in a multichip package ( such as a ceramic carrier that has either or both surface interconnections or buried interconnections ). in any case the chip is then integrated with other chips , discrete circuit elements , and / or other signal processing devices as part of either ( a ) an intermediate product , such as a motherboard , or ( b ) an end product . the end product can be any product that includes integrated circuit chips , ranging from toys and other low - end applications to advanced computer products having a display , a keyboard or other input device , and a central processor . referring now to fig8 , a high - level diagram of a resistor - based memory circuit is shown . a wordline 802 is applied to a memory cell 804 . the memory cell 804 produces a bitline 806 , where the output voltage reflects the resistance state of the memory cell 804 . a switch 808 determines whether this bitline is applied to a read circuit 810 or a write circuit 812 . the read circuit 810 produces a logical output that reflects the stored state of the memory cell 804 . referring now to fig2 , a resistor - based memory circuit with an s / a circuit 100 according to the present principles is shown . a memory cell , r mem 108 stores a memory state and can be modeled as a variable resistor . an exemplary type of resistor - based memory is phase - change memory ( pcm ), wherein a temperature change causes the resistor to change between a high - resistance phase and a low - resistance phase . these phases are used to represent different logical outputs , and modern resistor - based memory cells can store multiple bits by implementing additional memory levels of resistance . in one exemplary embodiment , the memory cell has two states : a high - resistance state ( r mem = r hi ) and a low - resistance state ( r mem = r low ). an exemplary phase change involves heating chalcogenide glass until it loses its crystallinity . the glass then cools into an amorphous state , representing its high - resistance state . the glass may be heated again , to a temperature above its crystallization point but below its melting point . this returns the glass to its crystalline state , having a much lower resistance . although pcm is discussed herein for the purpose of illustration , any form of resistor - based memory may be employed . memory access is triggered by access device m 1 106 which may , for example , be implemented as a metal - oxide - semiconductor field effect transistor ( mosfet ). when a wordline signal wl 102 arrives at m 1 106 , source voltage v dd 104 is applied to memory cell 108 . current across the memory cell 108 is applied to the s / a circuit 110 . the current across the memory cell 108 will reflect the memory cell &# 39 ; s resistance and , hence , a logical state stored therein . the s / a circuit 100 includes a resistor r sa 116 which implements a resistor divider in series with r mem 108 and m 1 106 and goes to ground . an amplifier 118 is connected in parallel with the s / a resistor 116 . the amplifier 118 may be implemented as an inverter comprised of two mosfets . mosfets are used herein for the purpose of illustration for their small component size , but it is contemplated that other forms of amplifiers or inverters may be used . a p - channel mosfet ( pmos ) 120 and an n - channel mosfet ( nmos ) 122 are connected as shown to a voltage source and to ground . when a voltage is applied to the inverter 118 that exceeds the triggering threshold voltage of the inverter , the nmos 122 is activated and the pmos 120 is turned off . this brings the voltage at the output of the inverter 118 to ground , producing a logical output of 0 . when a voltage is applied to the inverter 118 that is below the inverter &# 39 ; s threshold , the pmos 120 is activated and the nmos 122 is deactivated , producing a logical output of 1 . in this fashion , the inverter 118 reverses logical value of the voltage applied to it . in idle operation mode , access device m 1 106 is off , so the voltage inside the s / a circuit is pulled to ground by r sa 116 . as a low input is applied to the inverter 118 , the inverter therefore produces a high output . during a read operation , a pulse is sent to access device m 1 106 . the voltage divider then generates a settled voltage : v sa = v dd r sa r sa + r mem + r m 1 , where r m1 represents the resistances of access device m 1 106 , r sa represents the resistance in the voltage divider 116 , and r mem represents the resistance of the memory cell 108 . the inverter threshold voltage v th is set such that v dd r sa r sa + r hi + r m 1 & lt ; v th & lt ; v dd r sa r sa + r low + r m 1 , where r low represents the resistance of the memory cell 108 in its low state and r hi represents the resistance of the memory cell 108 in its high state . when r mem = r hi , v sa is smaller than v th and the inverter output stays high as a result . when r mem = r low , v sa is larger than v th and the inverter output changes from high to low , producing a logical 0 . once wl 102 becomes low , access device m 1 106 turns off and the settled voltage v sa drops back to ground . therefore , the inverter output changes back to high , producing a logical 1 . referring now to fig3 , another embodiment is shown in accordance with the present principles . a memory cell circuit 200 provides the ability to change the state of the memory cell . the operation of the memory cell circuit 200 is controlled by switches s 1 110 and s 2 112 . as shown for switch s 2 112 , it is contemplated that the switches may be implemented as mosfets , in particular an nmos , to further reduce circuit area . when s 1 110 is closed , memory write macro 114 is engaged and the state of the memory cell 108 is changed accordingly . when switch s 2 112 is closed , the s / a circuit 100 is engaged and the state of the memory cell 108 is read out . the switches 110 and 112 are controlled by write signals . during write operation , switch s 2 112 is open , whereas during read and idle operations , switch s 1 110 is open . a bitline output from memory cell 108 is always connected to the s / a circuit 100 in non - write conditions , such that in read operation , no s / a enable signal or clock signal is needed . this allows the s / a circuit to be operated asynchronously when used in the same circuit as a write macro . the resistor r sa from fig2 is replaced by an nmos transistor wired as a diode m 2 202 to further save area . to emphasize the potentially very small area consumed by a circuit of the present embodiment , the read circuit shown as the s / a circuit of fig3 can be implemented in an area as small as , e . g ., about 3 . 8 μm by 4 . 8 μm using a 0 . 90 nm process . using a more precise process will permit even smaller circuit features . referring now to fig4 , an embodiment of the present principles is shown that includes a multi - level resistor - based memory cell 108 . in this embodiment the memory cell 108 has the ability to produce multiple ( more than two ) levels of resistance , allowing for the storage of additional bits of information . this is an advantage of resistor - based memory over conventional memories , such as sram , dram , and flash memory . conventional memories have only two levels : 0 and 1 . in resistor - based memories , the resistance of the memory cells can be programmed to be at different values , which means that multi - level memory is achievable with an appropriate read circuit , allowing more information to be stored in the same area . to measure n memory cell levels , n − 1 s / a circuits 301 are connected in parallel to the output of the memory cell 108 . one exemplary way to detect n memory cell resistance values is to vary the n − 1 inverter threshold voltages . in the n − 1 s / a circuits 302 , the diode transistors used in each are similar , but the s / a circuits have a different inverter threshold voltage . for example , v th , 1 & gt ; v th , 2 & gt ; . . . & gt ; v th , n − 1 . if the maximum and minimum resistances are r max and r min respectively , then the voltage divider generates a settled voltage v sa = v dd r sa r sa + r s 2 + r mem + r m 1 at each s / a &# 39 ; s input . the i th inverter &# 39 ; s threshold voltage v th , 1 should be set between the i th inverter differentiates the memory resistance value smaller than r min +( i − 1 )( r max − r min )/( n − 1 ) and larger than r min + i ( r max − r min )/( n − 1 ). the n − 1 s / a output signals have a thermometer coding , representing the digitized memory resistance values . thermometer coding represents an output value as a number of activated outputs . so , for example , having the first 5 s / a circuits output at 1 would represent a stored value of 5 . various inverter threshold voltages can be achieved by varying the width - to - length ratio of the pmos and nmos transistors in the s / a circuits 301 . in a circuit such as that shown in fig4 , where the memory cell 108 can be in one of eight different memory states , the cell 108 can effectively store three binary bits of information ( in other words , the states represent 000 , 001 , 010 , 011 , 100 , 101 , 110 , and 111 ). it should be noted that the number of s / a circuits needed to service a memory cell will be the 2 n , where n is the number of bits . as such , it is not practical to increase the number of levels of the memory cell 108 indefinitely — at some point the space saved by the use of only a single memory cell will be outweighed by the cost of having additional read circuits . for example , one memory cell that stores four bits will use sixteen ( 2 4 ) s / a circuits , whereas two memory cells that store two bits each will use a total of eight ( 2 2 + 2 2 ) s / a circuits . as such , a memory cell having an appropriate number of elements should be selected to optimize power and space savings . referring now to fig5 , a further embodiment is shown where an input terminal m 1 106 is configured as a diode . signals coming from wl 102 pass through the diode 106 . implementing the input terminal as a diode further simplifies the circuit and provides additional space and power savings . referring now to fig6 , a table showing the output of a read circuit having an eight - level memory cell is shown . in this case , the memory cell is in the state i = 4 . this produces a voltage v sa that is between the threshold voltages of s / a 3 and s / a 4 . as such , read circuits s / a 1 , s / a 2 , and s / a 3 will be activated , producing a 0 output . the other four read circuits have a threshold voltage higher than v sa , and they therefore continue to output 1 . referring now to fig7 , a timing diagram showing a simulation of multiple resistor - based memory read operations is illustratively depicted . there are four memory cells , shown as graphs sa_out1_bar through sa_out4_bar ( the _bar suffix denotes that the displayed graphs are the opposite of the actual outputs of the respective s / a circuits ). the graphs show voltage level on the vertical axis and time on the horizontal axis . cells 1 and 3 are set to a high - resistance state : r mem = r hi , e . g ., 2 mω . memories 2 and 4 are set to a low - resistance state : r mem = r low , e . g ., 200 kω . at 2 . 5 μs there is a pulse on input wl . this generates pulses in the s / a outputs of cells 2 and 4 , since they are set to the low - resistance state . the s / a outputs of cells 1 and 3 remain low , since cells 1 and 3 are in the high - resistance state . in this simulation , the read energy is 0 . 13 pj / read . as can be seen from fig7 , neither the input nor the outputs require a clock signal , allowing for fully asynchronous operation . inputs are processed as they arrive and outputs are provided without delay . referring now to fig8 , a block / flow diagram describing the operation of a resistor - based memory circuit according to the present principles is shown . at block 902 , a wordline signal is applied to a memory cell to generate a bitline output voltage . as described above , any resistor - based memory cell may be used . the memory cell produces a bitline output , which is compared at block 904 to one or more thresholds . this comparison is then used in block 906 to produce a read output that reflects the state of the memory cell . the state of the cell is then determined at block 908 by counting how many of the thresholds were exceeded by the output voltage in the comparison . having described preferred embodiments of a system for low - power asynchronous resistor - based read operations ( which are intended to be illustrative and not limiting ), it is noted that modifications and variations can be made by persons skilled in the art in light of the above teachings . it is therefore to be understood that changes may be made in the particular embodiments disclosed which are within the scope of the invention as outlined by the appended claims . having thus described aspects of the invention , with the details and particularity required by the patent laws , what is claimed and desired protected by letters patent is set forth in the appended claims . | 6 |
fig1 is a block diagram showing an arrangement of a photoelectron sampling apparatus according to the present invention . in fig1 reference numeral 1 designates a signal source generating a signal to be measured ; 2 , a light pulse source ; 3 , a light transmission path ; 4 , a photoelectron sampling tube ; 5 , a drive circuit ; 6 , an integrator ; 7 , an amplifier ; 8 , a display processing unit ; 9 , a timing signal source ; and 10 , a delay circuit . in fig1 the light pulse source 2 is , for example , a laser that is synchronized with the signal source 1 by means of a timing signal from the signal source 1 . timing of the generation of the light pulse and the signal to be measured is delayed optically or electrically by the delay circuit 10 , which may be varied at will . the light pulse from the light pulse source 2 is incident upon the photoelectron sampling tube 4 through the light transmission path 3 to generate a photoelectron pulse . the photoelectron pulse is intensity modulated by the signal to be measured . this modulated photoelectron pulse is then multiplied in the sampling tube , integrated by the integrator 6 , and amplified by the amplifier 7 . in the above embodiment , the time difference between the photoelectron pulse and the signal to be measured , or the phase in which the photoelectron pulse is intensity modulated by the signal to be measured ( sampling phase ), is varied to reproduce , at the display processing , unit 8 , the waveform of the signal to be measured as a function of this time difference . fig2 is a block diagram showing another embodiment of a photoelectron sampling apparatus according to the present invention . in fig2 reference numeral 11 is a drive circuit , 31 is a half mirror , and 32 and 33 are reflectors , with the remaining like reference numerals identifying like components in fig1 . in this embodiment , the light pulse source 2 generates a light pulse upon receiving a trigger signal from the display processing unit 8 , and the light pulse triggers the source 1 of the signal to be measured in order to synchronize the occurrence of the light pulse , the signal to be measured , and the display processing apparatus . also , the light pulse incident upon the photoelectron sampling tube 4 , is delayed by the optical delay elements formed of the half mirror 31 and the reflectors 32 and 33 . the amount of delay can be varied by varying the light transmission length , which is effected by displacing the reflector 32 using the drive circuit 11 . at the same time , the signal from the drive circuit 11 is applied to the display processing unit 8 to express , as a function , the timing of occurrence of the signal to be measured and the photoelectron pulse , thereby reproducing the waveform of the signal to be measured . details of this process will be explained with respect to the embodiment of the present invention shown for example in fig6 - 12 . fig3 is a diagram showing an arrangement of a photoelectron sampling tube used in the present invention , fig4 is a diagram showing an example of voltages applied thereto , and fig5 is a diagram showing an arrangement of a photoelectron sampling tube which needs no focus electrodes . in fig3 and 5 , reference numeral 41 refers to a photocathode ; 42 , a photoelectron beam ; 43 , a first acceleration electrode ; 44 , a signal electrode ; 45 , a bias electrode ; 46 , a focus electrode ; 47 , a second acceleration electrode ; 48 , a micro - channel plate ; 49 , an anode ; 50 , a high frequency connector ; 51 and 55 capacitors ; and 52 , 53 and 54 , power supplies . the electrodes 43 , 44 and 45 may be of a strip line configuration . in the photoelectron sampling tube shown in fig3 , and 5 , when a short light pulse ranging in duration from femtoseconds to picoseconds is incident upon the photocathode 41 from a laser source ( not shown ), and a voltage is applied between the photocathode 41 and the first acceleration electrode 43 , photoelectron pulses ranging in duration from femtoseconds to picoseconds are extracted from the photocathode 41 . in this case , reducing the surface area of the photocathode 41 can present degradation of the sn ratio due to thermal noise . also , since the pulse duration of the extracted photoelectrons is determined by the electric field strength across the photocathode and the first acceleration electrode , the electric field should be increased to obtain the short photoelectron pulses . for this purpose , the potential of the first acceleration electrode 43 may be set sufficiently high with respect to the potential of the photocathode 41 , and / or the distance between the photocathode 41 and the first acceleration electrode 43 may be shortened . if the potential of the first acceleration electrode 43 is to be set high , the power supply 52 may be connected such that the first acceleration electrode 43 is grounded and the photocathode 41 is negative as shown in fig4 thereby preventing return of photoelectrons to the photocathode 41 to assure effective operation . the photoelectron pulse 42 thus accelerated is modulated by the voltage across the signal electrode 44 and the bias electrode 45 . the signal electrode 44 is required to have adequate high frequency characteristics ; therefore it is necessary to form the signal electrode 44 of a strip line , while at the same time the distance between the source of the signal to be measured ( not shown ) and the signal electrode 44 should be as short as possible to prevent distortion of the signal to be measured . the photoelectron pulse 42 is thus modulated by the signal to be measured , and is then accelerated by the focus electrode 46 and the second acceleration electrode 47 , which can be adjusted by varying the voltages applied thereto , so as to control the trajectory of the photoelectron pulse 42 . the photoelectron pulse 42 is then multiplied by the micro - channel plate 48 to obtain an output from the anode 49 . in this case , a pentode is formed by the first acceleration electrode 43 , the signal electrode 44 , the bias electrode 45 , the micro - channel plate 48 , and the anode 49 ; and modulation by the voltage of the signal electrode 44 is directly obtained from the anode 49 . the signal thus obtained may then be displayed on a display unit such as a crt for further analysis . it should be apparent from the foregoing description that a dynode may be used for multiplication of the photoelectron pulse instead of the micro - channel plate 48 . further , while a short pulse yag laser , dye laser , or a semiconductor laser may be used as the laser light source , an infrared light is preferably used in order to minimize initial velocity energy distribution of photoelectron . furthermore , an optical fiber ( not shown ) may be provided between the laser light source 2 and the photocathode surface 41 to reduce optical loss in transmitting the light pulse . the detected photoelectron current can be fed back from the first acceleration electrode 43 to the laser light source 2 to promote generation of a constant photoelectron beam . additionally , a cpu may be used to control the photocathode , the voltage of the acceleration electrodes , the voltage of the electron - multiplying section , the anode voltage , the timing difference between the photoelectron pulse and the signal to be measured , the integration time of the modulated electrical signal from the anode electrode , and the amplification factor of the integrated signal , to provide an automated measurement . fig6 is a block diagram showing an arrangement of an embodiment of an apparatus for analyzing and displaying an electrical signal according to the present invention . in fig6 reference numeral 101 represents a signal source generating a signal to be measured ; 102 , a laser light source ; 131 and 132 , half mirrors , 133 , 134 , and 135 , reflectors ; 104 , an electrical signal displaying unit ; 105 , an electronic gate ; 106 , a drive unit ; 107 , a deflection circuit ; 108 , a two - dimensional image unit ; and 109 , an image information processing unit . in fig6 the laser light source 102 generates a light pulse , which triggers the signal source 101 through the half mirrors 131 and 132 to generate the signal to be measured in synchronism with the light pulse , while also triggering the electronic gate 105 through the half mirror 131 to turn on the electrical signal displaying unit 104 . the light pulse is optically delayed by passing it through reflectors 133 , 134 and 135 , and is then incident upon the electrical signal displaying unit 104 . the amount of delay can be varied by displacing the reflector 134 by means of the drive unit 106 , and the deflection voltage , in accordance with the amount of delay , is applied by means of the deflection circuit 107 to the electrical signal displaying unit 104 . although , as described above , the input light pulse to the electrical signal displaying unit 104 is delayed with respect to the signal to be measured , the signal to be measured may instead by delayed with respect to the light pulse to provide the same result . in this embodiment , the pulse light from the laser light source 102 is delayed optically and is then incident upon the electrical signal display unit 104 to generate a photoelectron pulse while also activating the signal source 101 to provide synchronous operation of the two . the photoelectron pulse is generated , upon incidence of the light pulse , in the electrical signal displaying unit 104 with a predetermined delay time between the signal to be measured and is intensity modulated by the signal to be measured . the modulated photoelectron pulse is then deflected by a deflection voltage ( described below ) in accordance with the time difference or delay time between the signal to be measured and the photoelectron pulse to provide a display output . in this manner , the photoelectron pulse is modulated by an electrical signal to convert the electrical signal into a two - dimensional image for display . the electrical signal thus converted into the two - dimensional image is output to the two - dimensional image unit 108 , and is further processed as two - dimensional image information in the image information processing unit 109 . additionally , the electronic gate 105 is provided to decrease the noise from the photocathode . fig7 is a diagram showing another embodiment of an apparatus for analyzing and for displaying an electrical signal according to the present invention . like reference numerals refer to like components shown in fig6 and reference numeral 110 designates a timing signal generating unit and 111 a delay circuit . in this embodiment , the timing signal from the timing signal generating unit 110 is applied through the delay circuit 111 to the laser light source 102 and the signal source 101 so as to trigger both of them . in addition , the electronic gate 105 and the deflection circuit 107 are directly activated by the timing signal . the rest of the arrangement and operation is similar to that in fig6 . fig8 is a diagram showing an arrangement of an embodiment of an electrical signal display unit 104 which is similar in some respects to the photoelectron sampling tubes shown in fig3 - 5 . in fig8 reference numeral 141 is a photocathode ; 142 , a first acceleration electrode ; 143 , a signal electrode ; 144 , a bias electrode ; 145 , a focus electrode ; 146 , a second acceleration electrode ; 147 and 148 , deflection electrodes ; 149 , a two - dimensional electron multiplier ; and 150 , a phospher screen . the photoelectron pulse is extracted from the photocathode 141 due to incidence of the light pulse thereon and is accelerated by the first acceleration electrode 142 before being modulated by the signal to be measured at the signal electrode 143 . the modulation may be effected , for example by performing a triode operation between the bias electrode 144 . the electronic gate shown in fig6 is implemented by varying the bias to control conduction of the triode . after the photoelectron pulse is modulated , it is accelerated toward the phospher screen 150 by the focus electrode 145 and the second acceleration electrode 146 . additionally , deflection electrodes 147 and / or 148 may be driven to deflect the photoelectron pulse as necessary . after being deflected , the photoelectron pulse is multiplied by the two - dimensional electron multiplier 149 for example a micro - channel plate , and is then converted into a light image at the phospher screen 150 . as with the embodiments shown in fig1 - 7 , use of a laser light pulse , ranging in duration from femtoseconds to picoseconds , permits analysis of the waveform of an electrical signal ranging from ghz ( gigaherte ) to the thz ( terahertz ). in this case , it may be necessary to narrow the spacing between the first acceleration electrode 142 and the photocathode 141 , since , as described above , a photoelectron pulse having a short period is generated by increasing the electric field between the photocathode 141 and the first acceleration electrode 142 . fig9 shows another embodiment of the electrical signal display unit 104 in which the image information multiplied by the two - dimensional electron multiplier 149 , is read out through a semiconductor image device 151 as a displayed image . fig1 shows an example of an output from an electrical signal display unit 104 as shown in fig8 and 9 for analyzing and displaying the electrical signal . specifically , fig1 shows an example of an output waveform when the output is deflected in only one direction by the voltage varying in proportion to the delay time . the ordinate shows the difference of the delay time between the signal to be measured and the photoelectron pulse ( the sampling phase ) and the abscissa shows the position in space . the intensity distribution at any location is shown by the dotted line and the profile of the dotted line corresponds directly to the waveform of the electrical signal . in addition , deflecting in two directions permits a display of a multi - sampling image at spatially different positions , respectively . fig1 shows an output when the delay time is given as a logarithmic function in which the portion decaying exponentially appears to be a straight line . it is during this straight line portion that the time constant and others are directly obtained . fig1 shows timing waveforms in an apparatus for analyzing and displaying an electrical signal according to the present invention , in which the photoelectron pulse shown at fig1 ( b ) is generated in synchronism with the input light pulse shown in fig1 ( a ). in this case , the width , δt of the photoelectron pulse given a minimum time period , however , the image display will be much better if the peak value of the photoelectron pulse is detected . the delay time τ between the photoelectron pulse and the pulse for triggering the signal to be measured , is scanned with respect to time by a variable delay circuit ( fig1 ( c )). this trigger pulse causes the signal to be measured to occur ( fig1 ( d )), and the photoelectron pulse is intensity modulated based on the signal to be measured . at this time , since the phase relation between the signal to be measured and the photoelectron pulse varies in accordance with the delay time τ , the sampling phase with respect to the signal to be measured can be varied . the waveform of the signal to be measured can be reproduced in any desired form by effecting deflection with any of the deflection voltages shown in fig1 ( e ) to ( g ) corresponding to the varied delay time . it will be recognized that deflection voltages can be of various other forms such as a sinusoidal voltage or an exponential voltage . the delay time τ should be permitted to vary within a range that allows the waveform of the pulse to be measured and sufficiently analyzed . this variation range may be , for example 1 / 100 or 1 % of the width of the signal to be measured . additionally , although the above embodiment is arranged in such a way that a sampling electron is obtained from the photoelectron pulse incident upon the photocathode , those of ordinary skill will recognize that a thermal electron source that is produced electrically can also be applied to convert the electrical signal into a two - dimensional image . thus , in accordance with the present invention , since the electrical signal to be measured is sampled by the two - dimensional photoelectron pulse , outputting the electrical signal as a two - dimensional image is made possible . further , generation of the photoelectron pulse using the laser light pulse enables analysis of electrical signal waveforms ranging in frequency from ghz ( gigaherte ) to the thz ( terahertz ), in which case , resolution of the analysis is dependent on the pulse width of the photoelectron pulse or the pulse width of the incident light . since the electrical signal waveform of such a high frequency in a range of picoseconds to femtoseconds can be output in the form of an image , the distortion can be greatly reduced as compared to the distortion according to conventional sampling methods . the waveform can be directly analyzed due to the fact that the deflection voltage can be applied in an arbitrary form , which reduces loads imposed on the subsequent processing systems while also providing a high electron multiplying gain ( 10 3 to 10 5 ) with a high sn ration , thereby reducing loads imposed on the reading circuits . | 6 |
in the figures the same technical elements are provided with the same reference numbers and only described once . reference is made to fig1 , which shows a schematic view of a vehicle 2 with a driving dynamic control known per se . details of this driving dynamic control can be found , for example , in de 10 2011 080 789 a1 , which is incorporated by reference . the vehicle 2 comprises a chassis 4 and four wheels 6 . each wheel 6 can be slowed with respect to the chassis 4 by means of a brake 8 fastened in a fixed position on the chassis 4 , in order to slow a movement of the vehicle 2 on a road not shown further . in this case , it can occur in a manner known to the person skilled in the art that the wheels 6 of the vehicle 2 lose their road holding and the vehicle 2 even moves away from a trajectory predefined , for example , by means of a steering wheel not shown further , as a result of understeer or oversteer . this is avoided by control circuits known per se such as abs ( antilock braking system ) and esp ( electronic stability program ). in the present embodiment , the vehicle 2 has speed sensors 10 on the wheels 6 for this purpose , which detect a speed 12 of the wheels 6 . furthermore , the vehicle 2 has an inertial sensor 14 , which detects driving dynamic data 16 of the vehicle 2 , from which , for example , a pitch rate , a roll rate , a yaw rate 15 indicated in fig3 , a transverse acceleration 17 indicated in fig3 , a longitudinal acceleration 19 indicated in fig3 , and / or a vertical acceleration can be output in a manner known per se to the person skilled in the art . for example , the detection of the yaw rate 15 and the transverse acceleration 17 are required to implement the driving dynamic control . on the basis of the detected speeds 12 and driving dynamic data 16 , a controller 18 can determine in a manner known to the person skilled in the art whether the vehicle 2 is skidding on the roadway or is even departing from the aforesaid predefined trajectory , and react accordingly to this with a controller output signal 20 known per se . the controller output signal 20 can then be used by an adjusting device 22 in order to actuate by means of corrective signals 24 actuators such as the brakes 8 , which respond in a manner known per se to the skidding and the departure from the predefined trajectory . reference is made to fig2 , which shows a schematic view of the speed sensor 10 in the vehicle 2 of fig1 . in the present embodiment , the speed sensor 10 is executed as an active speed sensor 10 , within the framework of which a magnetic field 30 is delivered by an encoder disc 26 connected in a torqueproof manner to one of the wheels 6 , which encoder disc is composed of a plurality of magnetic poles 28 . the magnetic field 30 passes through a sensing element 34 enclosed in a housing 32 , which is connected via a signal processing circuit 36 to a data cable 38 , via which the speed 12 can be transmitted to the controller 18 . in this case , the sensing element 34 , the signal processing circuit 36 , and the data cable 38 can be wired to one another by means of wirings 40 , for example , in the form of a leadframe . a shield plate 42 can be provided in order to increase the electromagnetic compatibility of the speed sensor 10 . further background information on active speed sensors can be obtained , for example , from de 101 46 949 a1 , which is incorporated by reference . reference is made to fig3 , which shows a schematic view of the inertial sensor 14 from fig1 . for the driving dynamic control explained in fig1 , as described , for example , in de 10 2006 053 308 a1 , which is incorporated by reference , at least the yaw rate 15 must be detected . the detection of the transverse acceleration 17 is also appropriate within the framework of the driving dynamic control . however , rates of rotation and accelerations in any spatial directions can be detected with the inertial sensor 14 depending on the application . in this case , for the sake of clarity , it will be assumed hereinafter that for each rate of rotation and for each acceleration , its own sensing element is required , where the individual sensing elements in the inertial sensor 14 of fig3 are combined to form a sensor cluster 41 . the inertial sensor 14 in fig3 should be configured , for example , as a six - axis inertial sensor , which is capable of detecting the rates of rotation and accelerations in all three spatial directions . for this purpose , the sensor cluster 41 subject to the aforesaid requirement must comprise six different sensing elements . for the sake of clarity , however , only three of the sensing elements in the sensor cluster 41 are shown in fig3 and specifically in detail , a yaw rate sensing element 43 , a transverse acceleration sensing element 45 , and a longitudinal acceleration sensing element 47 . each of the sensing elements 43 , 45 , 47 is connected via wirings 40 to its own signal processing circuit 36 , via which the respective sensing elements 43 , 45 , 47 output to the respective signal processing circuit 36 a measurement signal not further indicated , which is dependent on the respective measured quantity 15 , 17 , 19 to be detected . the individual signal processing circuits 36 in the inertial sensor 14 determine the respective measured quantity 15 , 17 , 19 from the measurement signal received in each case from the individual sensing elements 43 , 45 , 47 and output this as digital data via wirings to a data interface 49 . the data interface 49 then modulates the received digital data according to a determined pattern and transmits this as the driving dynamic data 16 to the controller 18 . the modulation pattern in this case depends on the interface used . in the automobile area , various interfaces are commonly used such as , for example , an interface to a controller area network bus , called can bus . sensor data such as the measured quantities 15 , 17 , 19 from the inertial sensor 14 can , however , be transmitted in a particularly efficient manner with a so - called peripheral sensor interface 5 , called psi 5 interface , via a two - wire line as data cable 38 to the controller , which is why the data interface 49 can be configured in a particularly favorable manner as psi 5 interface 49 . further information on this can be deduced from the relevant standard . the present invention will be illustrated in further detail by reference to the inertial sensor 14 shown in fig1 and 3 , even though the present invention can be implemented on any electronic devices and in particular on any sensors such as the speed sensors 10 , magnetic field sensors , structure - borne sound sensors , or temperature sensors . when used in the aforesaid vehicle 2 , it is particularly important for a high longevity of the inertial sensor 14 that this is sealed as tightly as possible against ingressing moisture . precisely because the inertial sensor 14 is installed on the wheel 6 , which can throw up a not inconsiderable quantity of dirt and moisture during travel of the vehicle 2 , sealing against ingressing moisture acquires a very high importance , which avoids that , for example , the wiring 40 corrodes and is interrupted . in order to achieve this , the electronic assembly 44 of the inertial sensor 14 comprising the sensor cluster 41 and the psi 5 interface 49 is encased in the following manner . the electronic assembly 44 is shown in fig4 . in this assembly the sensor cluster 41 and the psi 5 interface 49 can be arranged on a common integrated circuit . the electronic assembly 44 can further comprise another protective capacitor 46 , which protects the sensor cluster 41 and the psi 5 interface 49 , for example , from any overvoltage . in the present exemplary embodiment , a leadframe is selected in a nonrestrictive manner as wiring 40 , from which two contact pins 48 and a number of protruding regions in the form of retaining pins 50 project . whereas the retaining pins 50 will be described in detail at a later point , the contact pins 48 are connected electrically to connector pins 52 , to which in turn the data cable 38 can be connected , in order , as indicated in fig2 , to transmit the speed 12 to the controller 18 . supporting elements 54 project from the shield plate 42 , when viewed in the plane of the shield plate 42 . these are formed in one piece with the connector pins 42 and are connected electrically and mechanically to the contact pins 48 and to a side opposite the contact pins 48 by means of the wiring 40 executed as a leadframe . the retaining pins 50 can , in principle , be designed arbitrarily . as shown , for example , in fig5 , the retaining pins 50 can also adjoin common frames 56 , which accordingly can enclose the integrated circuit with the sensor cluster 41 and the psi 5 interface 49 , as well as the protective capacitor 46 . the surface of the retaining pin 50 can in this case be configured arbitrarily . in order to optimally execute the function explained hereinafter , the retaining pins 50 and / or the frame 56 should be structured with grooves , embossings , or the like . furthermore , these can also be provided with constrictions or holes . in principle however , the shape of the retaining pins 50 and / or the frame 56 is arbitrary . for encasing the electronic assembly 44 , this is held on the retaining pins 50 and on the connector pins 52 with a tool not shown in detail . this is then followed by a first encasing with a first casing material 58 , shown in fig6 , for example , by an original molding method such as injection molding . to this end , the electronic assembly 44 can be inserted into a casting mold not shown further . the first casing material 58 is injected into this casting mold , so that it can assume the shape shown in fig6 . due to the fact that the electronic assembly 44 must rest on at least one location in the casting mold , the intermediate product 60 , also called pre - injection molded part , which can be seen in fig6 , has locations exposed at the retaining pins 50 via which , in principle , moisture could penetrate to the electronic assembly 44 . in order to avoid this , within the framework of the present embodiment , the intermediate product 60 is encased by a second casing material 62 , which can be seen subsequently in fig7 . in order to perform this second encasing particularly effectively , within the framework of the present embodiment , four receiving elements 64 are formed in the first casing material 58 , which are each surrounded by a labyrinth element 66 . respectively one holding element 68 can be inserted into these receiving elements 64 , of which only one is shown for clarity in fig7 . the receiving elements 64 therefore serve as holding regions for the holding elements 68 . these holding elements 68 will be discussed in detail at a later point . in order to protect the data cable 38 connected to the connector pins 52 from ingressing moisture , the connector pins 52 , which cannot be seen in fig6 , are surrounded by a connector housing 70 , into which a connector not shown further in the figures , connected to a data cable 38 , can be inserted positively . a latching element 72 is further formed on the connector housing 70 , on which the connector with the connector housing 70 can be engaged with a corresponding latching element . before the encasing with the second casing material 62 , within the framework of the present embodiment , fastening elements 74 in the form of sockets are arranged next to the first casing material 58 . in this case , the intermediate product 60 can again be received in a corresponding casting mold , which cannot be seen in fig6 , and held therein on the holding elements 68 . the holding elements 68 can also be part of this casting mold . the holding elements 68 rest on the first casing material 58 and have no direct contact with the electronic assembly 44 . if the intermediate product 60 held in the further casting mold is therefore encased with the second casing material 62 , the first casing material 58 and the second casing material 62 then form a labyrinth gap 76 indicated in fig7 , which extends , starting from the receiving elements 64 , via the labyrinth elements 66 and the surface of the first casing material 58 as far as the retaining pins 50 . only there can any ingressing moisture come in contact with the electronic assembly 44 and corrode this . the labyrinth elements 66 further lengthen the labyrinth gap 76 , where naturally a plurality of labyrinth elements 66 arranged concentrically to one another , can further extend the labyrinth gap 76 . in order to partially close the labyrinth gap 76 , for example , the labyrinth elements 66 can be configured as melting ribs . that is to say that at this point , during encasing with the second casing material 62 , the first casing material 58 melts and becomes joined to the second casing material 62 . in this way , the labyrinth gap 76 is closed in a seamlessly bonded manner . alternatively , the labyrinth elements 66 could naturally also be formed as grooves . after the encasing with the second casing material 62 , the holding elements 68 could be removed from the receiving elements 64 again , if this is desired . a material which is resistant to weathering , for example in the form of a plastic , should be selected as first casing material 58 and as second casing material 62 . in this case , for example , for each of the two casing materials , an arbitrary combination can be selected from the materials thermoplastic , thermosetting plastic , and elastomers . | 1 |
in the following description , considered embodiments are merely exemplary , and one skilled in the art may find other ways to implement the invention . although the specification may refer to “ an ”, “ one ” or “ some ” embodiment ( s ) in several locations , this does not necessarily mean that each such reference is made to the same embodiment ( s ), or that the feature only applies to a single embodiment . single feature of different embodiments may also be combined to provide other embodiments . fig1 and 2 were discussed in conjunction with the description of the prior art . the fingerprinting algorithm of the present invention may be divided into three main phases : embedding , noise transformation and fingerprint detection . fig3 depicts the embedding phase , fig4 depicts the noise transform phase ( i . e . removing a detectable watermark and inserting a non - detectable user fingerprint ) and fig5 depicts how a rights owner can find out who is illegally distributing an audio file . the main steps of the method for embedding a detectable watermark in an audio file are depicted in an exemplary flow chart of fig3 . in the embedding phase , a removable watermark is inserted into the original audio in order to produce the distributable preview version . the embedding algorithm may combine several digital watermarking techniques , such as frequency hopping and direct sequence spread spectrum watermarking . inputs of the process are the uncompressed original audio file 301 and the pseudo - random key 304 for improving the security of the watermark . at first , the original file 301 is divided into blocks of 1024 samples , step 302 , and each block is processed separately from here on . one audio block sample comprising 1024 samples is depicted by reference 311 . a fast fourier transform 312 is accomplished for the audio block 311 in question . the fft 312 gives an array of complex fft coefficients 313 . by taking absolute values 314 of the complex fft coefficients absolute magnitudes 315 of the fft coefficients can advantageously be expressed also in decibels 316 . an embedding of a watermark 317 may advantageously be made by modifying advantageously two frequency coefficients of the audio file sample which may be defined by a pseudo - random frequency hopping sequence 306 . the pseudo - random hopping sequence is accomplished by a linear congruential generator ( lcg ) 305 which uses as inputs frequency band parameters 303 and pseudo - random key 304 . the pseudo - random frequency hopping frequency band may comprise for example 512 frequency coefficients . a modified frequency coefficient pair may be advantageously selected to be five coefficients higher than the coefficient selected by the frequency hopping sequence . the lower coefficient may be modified with a − k modifier and the higher coefficient may be modified with a +( k / 2 ) modifier . the value of k is advantageously the value of the random k value 333 . for modifying the magnitudes of the extracted fft coefficients 316 a random k value , reference 333 , is selected using a random generator 332 from a range [ min_k , max_k ], reference 331 , with steps of 0 . 1 . this parameter defines the amount of noise in db to be advantageously added into a current audio block . a different random k value 333 is used for each audio block . the used k values may be advantageously stored for later use in a specific array 351 . using the random value k 333 and the fft coefficients selected by the pseudo - random frequency hopping sequence 306 actual scaling values for the audio block in question may be defined in phase 318 . the actual values of the scaling values k 1 and k 2 depend on the random value k of the audio sample , reference 333 . in step 320 the defined scaling values k 1 and k 2 , reference 319 , are used to modify the two defined fft coefficients of the original complex fft array 313 . the two defined coefficients in the complex fft array are scaled according to the defined scaling values k 1 and k 2 in order to produce a complex fft array 321 with added detectable noise . the modified fft array 321 is similar to the depicted example in fig2 where two fft coefficients , numbers 36 and 41 from 512 fft coefficients , are transformed for adding a watermark in an audio sample . the noisy watermarked audio block is then transformed to time domain by using ifft ( inverse fast fourier transform ) in step 322 . the result is an audio block 323 in time domain which comprises an audio file with a detectable noise signal . steps 311 - 333 are repeated for all audio blocks which each comprise 1024 samples . the used random value k 333 and pseudo - random hopping sequence 306 may be changed after each processed audio block . this means that the places of the noisy fft coefficients are not the same in all audio blocks and that the scaling values k 1 and k 2 may also vary from an audio sample to an audio sample . in step 341 all modified audio blocks are put together and a final level scaling is made for the whole audio file to avoid clipping issues . the result is a distributable audio file 342 . the final step 343 is to add a spread spectrum synchronization signal 309 by a sync signal generator 308 . the sync signal generator 308 builds a synchronization signal 309 using defined synchronization parameters 307 . the synchronization signal 309 is advantageously embedded in the beginning of the block sequence to facilitate the synchronization process in the phase where the noise is removed from the audio file . the synchronization signal 309 may be added to the beginning of each audio sample or use only one synchronization signal in the beginning of the audio file 342 . for example a spread spectrum signal of 16 384 samples limited to a frequency band of 10 - 20 khz may be used as a synchronization signal . it may be embedded to the beginning of the audio signal with a strength of 0 . 03 . the watermarking process ends in a step where an audio file 361 with a watermark is ready for posting on the internet . for removing the noise later ( i . e . the watermark ), the pseudo - random key 304 and the defined changes of the fft coefficients in db ( an array of k values 351 ) must be stored . these parameters form the watermarking key for the audio file . in addition , the used spread spectrum synchronization signal 309 must be stored . fig4 depicts the noise transform phase of the present invention . the noise transformation phase comprises transforming a detectable watermark of the audio file to a non - detectable user fingerprint . the main steps of the method for transforming a detectable watermark to a non - detectable fingerprint in an audio file are depicted in an exemplary flow chart of fig4 . a transformation from a watermark to user fingerprint can be accomplished in an electrical apparatus of several kinds . the invention can be accomplished in any kind of apparatus which comprises a processor unit and enough memory for saving a computer program utilized in the transformation . the apparatus may be for example a computer , a cellular phone , a digital personal assistant ( pda ), a digital television receiver , a digital radio receiver , an mp3 player , etc . the required parameters for creating a license for a user and modifying the distributable watermarked audio file into a uniquely fingerprinted audio file are : unique pseudo - random key of the audio file 304 , frequency band 303 for the watermark noise ( for example frequency band 1 - 512 of fig2 ), an array of db changes made in the audio file 351 during watermarking , intended fingerprint strength in db , user id of the buyer and synchronization signal 309 and its scale . the pseudo - random key 333 and frequency band parameters 303 must have the same values that were used in adding the watermark in the audio file . the db changes array 351 is also brought from the data stored in the watermark adding operation . the fingerprint strength determines directly the quality of the resulting audio file . it is the amount of noise left in the song after removing the watermark noise of the distributable sample . this leftover noise forms the individual user fingerprint , which contains the user id of the buyer in the system . when the user contacts a music store server , it must first identify itself with a unique user id . this user id is then during the noise transform encoded to the db changes array ( an array of k values ) of the fingerprinted audio file . the fingerprint embedding may be done by increasing or decreasing scaling values k 1 and k 2 used in the watermarking of the audio file . the fingerprint strength parameter defines the amount how much the db values are changed . in one advantageous embodiment of the invention the db values are increased if the embedded bit is “ one ”, and decreased if the bit is “ zero ”. a forward error correction may be used before embedding the fingerprint for increased reliability . in addition to the db changes array , the pseudo - random key of audio file is added to the license data . these two elements form the unique user &# 39 ; s license . the transformation process can be divided into three main steps : synchronization , block processing and combining the result audio . the watermarked audio signal must be synchronized before the noise can be removed from it . the synchronization is done by taking a cross - correlation between the audio and the original synchronization signal . the maximum value of the correlation is the synchronization offset . after the synchronization offset has been found , the synchronization signal is not needed anymore , and it may be removed from the audio signal . it may be removed by subtracting the scaled original synchronization signal from the synchronization offset point in the distributable audio file 361 . synchronization determines also the starting point of the watermarking sequence . the synchronization method may utilize direct sequence spread spectrum watermarking techniques . synchronization may be needed because different lossy compression encoders , for example mp3 encoding , may add some additional samples to the beginning of the audio file in the encoding phase . the synchronization signal is advantageously removed from the audio file after the starting point has been located in order to achieve higher audio quality . in the synchronization , step 402 , a client application synchronizes a watermarked audio file using a synch signal 309 . the result is a synchronized audio file 403 . the synchronized audio file may be divided into audio blocks of 1024 samples . each audio block is advantageously processed separately . the frequency hopping sequence is generated from the pseudo - random initialization key 304 . the sequence is limited with the same parameters as used in the watermarking . the resulting sequence is equal to the sequence generated in watermark embedding process of fig3 . the synchronized audio is divided into 1024 sample blocks 410 starting from the synchronization offset point . each audio block 410 is advantageously processed separately from here on . an fft process 411 transforms the audio sample into a complex fft array 412 . absolute values of each fft coefficient are then taken in step 413 . this process results magnitudes 414 of the fft coefficients . the magnitudes of the fft coefficients are transformed to db in step 415 . then the k value for the current audio block is read from the db changes array 352 . the array 352 comprises modified versions of the array of k values 351 used in the watermarking . this array element 352 contains advantageously modified scaling values k 1 and k 2 . by utilizing these modified scaling values the watermarking noise is advantageously transformed to a user fingerprint . then the k value for the current audio block is read from the db changes array 351 . this array element contains the modifications made to the respective block of the original audio , which result the watermarking noise . in steps 416 - 419 the watermarking noise is removed by first modifying those fft coefficient magnitudes in decibel domain which were used in the watermarking of the audio sample . after that the same fft coefficients are modified with new scaling values which cause less noise than those used in the watermarking . the used scaling values do not leave audible noise in the audio file . the new scaling values of fingerprinting are also modified to contain the fingerprint of the user . fig6 depicts an example of an audio block where fft coefficients 36 and 41 are transferred from watermark to a fingerprint . the differences between the original fft coefficients of the audio sample and the fingerprinted audio sample , references 61 and 62 , are smaller than the differences of the original fft coefficients of the audio sample and the watermarked audio sample . in step 421 an ifft is accomplished to the fingerprinted fft array 420 . the transform results a fingerprinted audio block of 1024 samples . the audio block 422 is then concatenated to the other audio blocks of the same audio file . each audio block of the audio file is advantageously processed separately . when all audio blocks of the audio file are transformed , a fingerprinted audio file 432 is ready for listening . the actual noise transformation from noise into a fingerprint is done when the fft coefficients are modified with the k array values 352 . it is possible because the k array values are not exactly the same in the fingerprinting phase compared to the values which were stored in the server in the watermark embedding phase . they are modified slightly by the server in a way that the k array values contain a non - detectable digital fingerprint of the user . the id of the user in the music store can be used as the fingerprint data . this means that a unique k array must be generated by the server every time a new customer purchases a license for an audio file , because of different fingerprint data . one advantage of this kind of process is that the audio file is never in an unprotected state , because it transforms directly from the free watermarked preview version into the fingerprinted user version without any additional steps in between . it is also convenient for the user because he does not have to download the song again after purchasing . instead , he only needs to acquire the license and wait for the local noise transform process to be completed . the main steps of the method for reading a fingerprint from an audio file are depicted in an exemplary flow chart of fig5 . before reading a fingerprint of an audio file the audio file must be identified . after that a correct pseudo - random key k can be extracted from the array of k values 351 . synchronizing 501 of the fingerprinted audio file 432 can be done against an original audio file 301 . a cross - correlation is calculated between the fingerprinted audio signal and the original audio signal . the maximum value of the correlation is the synchronization offset . if the fingerprinted audio file has any extra samples in the beginning , they are cropped away so that the original and the fingerprinted audio are in synchronization when digital rights owner starts reading them both at the first sample . the pseudo - random hopping sequence used in modification of the fft coefficients is generated at first from the pseudo - random initialization key 333 and the frequency band parameters 303 . then both the synchronized fingerprinted audio file 502 and the original audio file 301 are divided into blocks comprising 1024 audio samples ( references 503 and 511 ). the blocks are transformed 512 with fft which results a complex fft array 513 . the fft coefficient magnitudes are calculated with taking the absolute values 514 of the complex fft coefficients . the fft magnitudes are then advantageously transformed to db domain , reference 515 . reading the fingerprint may be done by comparing the fft coefficient pairs of the original audio file 301 and the fingerprinted audio file 432 , step 516 . the lower fft coefficient of the pair is read from the frequency hopping sequence and the higher coefficient is advantageously five coefficients higher . integration over all bit values and intensities in step 517 may be accomplished in the following way . two comparison values may advantageously be calculated from these fft pairs . the first value is a lower fft coefficient magnitude of the fingerprinted audio file subtracted with a lower fft coefficient magnitude of the original audio file . the second value is a higher fft coefficient magnitude of the fingerprinted audio file subtracted with a higher fft coefficient magnitude of the original audio file . the extracted fingerprint bit from this block of 1024 samples is 1 if the first value is greater than the second value and 0 if the second value is greater than the first value . this process is repeated with all corresponding audio blocks of 1024 samples of the fingerprinted audio file and the original audio file . the resulting fingerprint bit array 518 is divided into blocks of the size of the utilized forward error correction block 519 . for example , if the simplest hamming code ( 7 , 4 ) is used , the block size is 7 . after decoding , the error - corrected bit array is advantageously divided into blocks of 32 bits . these blocks are the actual fingerprint bit arrays 520 which present the user id . if additional error correction is required , the large number of fingerprints allows us to select the most common fingerprint bit array either bit - by - bit or word - by - word . although the fingerprinting method in fig3 , 4 and 5 is depicted in context of an audio file , it is evident to a man skilled in the art that the invention may be used also in the context of a video file or a picture file . any of the process steps described or illustrated above may be implemented using executable instructions in a general - purpose or special - purpose processor and stored on a computer - readable storage medium ( e . g . disk , memory , or the like ) to be executed by such a processor . references to ‘ computer - readable storage medium ’ and ‘ computer ’ should be understood to encompass specialized circuits such as field - programmable gate arrays , application - specific integrated circuits ( asics ), usb flash drives , signal processing devices , and other devices . the invention being thus described , it will be obvious that the same may be varied in many ways . for example more frequency coefficients than the depicted example of two frequency coefficients can be utilized in the watermarking and fingerprinting . the invention may also be accomplished by utilizing direct sequence spread spectrum watermarking method instead of frequency hopping watermarking method . such variations are not to be regarded as a departure from the spirit and scope of the invention , and all such modifications as would be obvious to one skilled in the art are intended to be included within the scope of the following claims . | 7 |
the preferred embodiments may be practiced in any suitable hardware configuration that uses a touchscreen , such as computing system 100 illustrated in fig1 or , alternatively , in a laptop or notepad computing system . computing system 100 includes any suitable central processing unit 10 , such as a standard microprocessor , and any number of other objects interconnected via system bus 12 . for purposes of illustration , computing system 100 includes memory , such as read only memory ( rom ) 16 , random access memory ( ram ) 14 , and peripheral memory devices ( e . g ., disk or tape drives 20 ) connected to system bus 12 via i / o adapter 18 . computing system 100 further includes a touchscreen display adapter 36 for connecting system bus 12 to a conventional touchscreen display device 38 . also , user interface adapter 22 could connect system bus 12 to other user controls , such as keyboard 24 , speaker 28 , mouse 26 , and a touchpad 32 ( not shown ). one skilled in the art readily recognizes how conventional touchscreens operate , how conventional touchscreen device drivers communicate with an operating system , and how a user conventionally utilizes a touchscreen to initiate the manipulation of objects in a graphical user interface . for example , touchscreen technology includes electronic sensors positioned inside a flexible membrane covering a computer screen , a grid of infrared signals , or a method of detecting a touch by sensing a change in reflected sound waves through glass or plastic . using current touchscreen technology , a user can initiate the display of a pull down menu by touching the touchscreen , and then selecting an object within that menu by dragging a finger down the pull down menu . a graphical user interface ( gui ) and operating system ( os ) of the preferred embodiment reside within a computer - readable media and contain a touchscreen device driver that allows one or more users a user to initiate the manipulation of displayed object icons and text on a touchscreen display device . any suitable computer - readable media may retain the gui and operating system , such as rom 16 , ram 14 , disk and / or tape drive 20 ( e . g ., magnetic diskette , magnetic tape , cd - rom , optical disk , or other suitable storage media ). in the preferred embodiments , the cose ™ ( common operating system environment ) desktop gui interfaces the user to the aix ™ operating system . the gui may be viewed as being incorporated and embedded within the operating system . alternatively , any suitable operating system or desktop environment could be utilized . examples of other guis and / or operating systems include x11 ™ ( x windows ) graphical user interface , sun &# 39 ; s solaris ™ operating system , and microsoft &# 39 ; s windows 95 ™ operating system . while the gui and operating system merely instruct and direct cpu 10 , for ease in explanation , the gui and operating system will be described as performing the following features and functions . referring to fig2 touchscreen 200 includes any conventional , suitable touchscreen that is sensitive to , for example , heat , pressure , or the sound of palm and fingerprints . in this illustration , a user has placed his / her right hand ( not shown ) on touchscreen 200 . while any suitable touchscreen technology may be used , for ease in explanation , the preferred embodiment will be described as using a touchscreen that detects sound patterns . in response to the user placing his / her hand on touchscreen 200 , touchscreen 200 detects the sound pattern of the user &# 39 ; s hand , including the sound from palmprint area 210 , thumbprint area 215 , fingerprint areas 220 , 230 , 235 , and 240 , and areas 280 . alternatively , only a portion of the hand ( e . g ., only fingers ) and / or a unique object ( e . g ., stylus ) could be substituted for the detection of a hand print . moreover , more than one hand or object can be detected at a time . when touchscreen 200 detects one or more hand / finger patterns similar to the one shown in fig2 the os attempts to identify the user ( s ). to do so , the os measures the distance of each fingerprint area 215 , 220 , 230 and 240 from palmprint area 210 , along with the x , y coordinates of palmprint area 210 and the x , y extremities of the palmprint area 210 . the os defines the cross point of the leftmost and uppermost point of the palmprint area 210 as the first reference point 255 . the os measures the longest distance from thumbprint 215 to the first reference point 255 . similarly , the os measures the longest distance from fingerprint areas 220 and 230 , respectively , to first reference point 255 . in the same manner , the os defines the cross point of the rightmost and uppermost point of palmprint area 210 as the second reference point 260 , whereby the longest distance from fingerprint area 240 to the second reference point 260 is determined . finally , the os measures the x and y coordinates 265 and 270 of palmprint area 210 . to add even more accuracy , the size of each fingerprint could be measured . next , the os searches a user file database ( not shown ) stored in memory for a match of the newly determined measurements with any existing measurements to determine if a stored identity exists for the handprint . specifically , the os compares the four distance measurements and the x , y coordinates of palmprint 210 with any existing measurements stored in the user file database . however , one skilled in the art realizes that numerous means exists for identifying the handprint ( or object print ) of a particular user ( or user &# 39 ; s object ) without departing from the scope and spirit of this invention . illustratively , only the width of the palmprint area 210 could be used to determine if a match existed . if the os finds a match within a user - defined ( or default ) acceptable tolerance ( described herein ), the os reads the user file for pre - defined customization features , if any , and creates a virtual pointing device under the hand ( or a portion of the hand ) positioned on touchscreen 200 using the pre - defined customization features . therefore , the areas of touchscreen 200 under , for example , the user &# 39 ; s thumb ( i . e ., thumbprint area 215 ), fingers ( i . e ., fingerprint areas 220 , 230 , 235 , and 240 ), and palm ( i . e ., palmprint area 210 ) become &# 34 ; activated &# 34 ;, such that certain defined movements of the user &# 39 ; s fingers , thumb , and / or palm on those &# 34 ; activated &# 34 ; areas cause certain functions to be invoked . however , if the os does not recognize the handprint , the os can build a default virtual pointing device under the hand or a portion of the hand using a default set of functions or the user can create a customized virtual pointing device ( described herein ). fig5 illustrates how the user ( s ) move and operate the virtual pointing device ( s ). as the user slides his / her hand over touchscreen 200 such that the hand remains in substantial contact with touchscreen 200 , the os detects the position of the user &# 39 ; s moving hand on touchscreen 200 and , in response , continuously re - defines the &# 34 ; activated &# 34 ; areas of the virtual pointing device to be the areas under the hand ( or a portion of the hand ). therefore , the virtual pointing device moves with and according to the movement of the user &# 39 ; s hand . for example , if an &# 34 ; activated &# 34 ; area is initially defined as the area contained within the touchscreen pixel coordinates x1 , y1 , x2 , y2 , x3 , y3 , and x4 , y4 ! ( not shown ) and the user moves a finger from that area to the touchscreen pixel coordinates x5 , y5 , x6 , y6 , x7 , y7 , and x8 , y8 !, the &# 34 ; activated &# 34 ; area moves to those new coordinates . the os positions pointer 250 near an activated area of the virtual pointing device ( in this case , over fingerprint area 230 ) such that pointer 250 moves in lock step with the virtual pointing device . therefore , the user could , for example , move the virtual pointing device and , therefore , pointer 250 , such that pointer 250 is positioned over a desired object icon . alternatively , the user could merely lift his hand and place it at a desired location , whereby the os would re - create the virtual pointing device under the user &# 39 ; s hand at the new location ( described herein ). the user operates the virtual pointing device via movement of the user &# 39 ; s fingers , thumb and / or palm . illustratively , the user may invoke the &# 34 ; focus function &# 34 ; 245 , whereby an object icon positioned under pointer 250 gains focus , by lifting his / her thumb and then placing the thumb back on thumbprint area 215 within a certain amount of time ( e . g ., two seconds ) ( referred to as &# 34 ; single clicking &# 34 ;). similarly , the user may invoke the &# 34 ; paste &# 34 ; function by lifting and replacing his / her third finger on third fingerprint area 235 within a certain amount of time . each finger , palm , and thumb behavior and associated functionality / command can be specially defined , and later redefined , to invoke a specific function ( described in more detail herein ). the os displays a dialog above each fingerprint / thumbprint area to indicate the finger behavior ( a &# 34 ;( 1 )&# 34 ; representing a single click ; a &# 34 ;( 2 )&# 34 ; representing a double click , etc .) and corresponding functionality / command ( e . g ., focus 245 , open 257 , select until release 259 , paste 261 and default menu 262 ). the default functionality / command , finger behavior and pointer are defined in the preferred embodiment as follows . a single click of the thumb on thumbprint area 215 causes the os to invoke focus function 245 on any object icon or text positioned under pointer 250 . a single click of a finger on fingerprint area 220 or a double click of thumbprint area 215 causes the os to invoke an open function 230 on any object icon or text positioned under pointer 250 . a single click on fingerprint area 230 invokes a select until release function 259 on any object icon or text positioned under pointer 250 , while a single click of fingerprint area 235 invokes a paste function 261 on any object icon or text positioned under pointer 250 . finally , a single click of fingerprint area 240 invokes a default menu function 263 . the default pointer 250 is in the shape of an arrow and is positioned near fingerprint area 230 . however , one skilled in the art readily recognizes that any combination of default functions , pointer location , and / or finger behavior ( e . g ., multiple clicks ) could have been used to define the default virtual pointing device . moreover , a simultaneous single click ( or multiple clicks ) of two or more fingers could invoke a function / command . fig3 illustrates a flow chart containing detailed logic for implementing the preferred embodiments . at 302 , touchscreen 200 detects sound / heat / pressure , etc ., from a handprint ( or object ), or alternatively , a portion of a handprint . at 306 , the os reads the handprint and calculates the measurements previously described and illustrated in fig2 . at 310 , the os searches user files in a database for the handprint measurements . at 312 , if the os locates any existing handprint measurements within a default tolerance of 10 % ( which can later be changed by the user , described herein ), at 320 , the os reads all information in that user file and , at 322 , draws a virtual pointing device on the touchscreen under the user &# 39 ; s hand ( or portion of the hand ) based on pre - defined characteristics found in the user file . additionally , in the future , if any objects and / or text have been selected by the virtual pointing device , they will be drawn in a position relative to their previous location to the virtual pointing device ( described herein ). at 324 , the os determines if there is any consistent unusual behavior or undefined behavior for four or more seconds , such as , for example , failing to detect the fingerprint ( s ), the palmprint , or no handprint . if the os detects no unusual behavior , the os performs a work event loop at 326 ( see fig9 ) and control returns to 324 . referring to fig9 at 902 , the os determines if any movement of the hand across the touchscreen has occurred and , if so , at 904 the os moves the virtual pointing device in accordance with the movement of the hand . at 906 , the os determines if movement of a finger or thumb has occurred to invoke a function / command and , if so , at 908 the os invokes that function / command on any object / text positioned under the pointer . control returns to 324 . returning to 324 of fig3 if the os detects unusual behavior or undefined behavior for a certain amount of time ( e . g ., 4 seconds ), at 328 , the os determines if all fingers have been lifted off the touchscreen while the palm remains on the touchscreen . alternatively , one skilled in the art recognizes that many other indicators could replace the &# 34 ; all fingers lifted &# 34 ; indicator , such as determining if a combination of fingers have been lifted or determining if the palm has been lifted while the fingerprints remain in contact with the touchscreen . if the os determines that all fingers have been lifted off the touchscreen , at 330 , the os displays a main menu 600 ( see fig6 described herein ) prompting the user to provide any recustomization of the virtual pointing device . at 344 , the os displays the new virtual pointing device in accordance with any changes made at 330 . returning to 328 , if all fingers were not detected as being raised while the palm remained in contact with the touchscreen , at 342 , control is directed to fig8 . referring to fig8 at 810 , the os determines if the entire hand ( or object ) has been lifted off the touchscreen . if the entire hand has not been lifted off the touchscreen , but unusual or undefined behavior has occurred , such as lifting a combination of fingers , thumb and / or palm ( whose behavior does not have a corresponding defined functionality ), control is directed to 814 , where the os re - draws the virtual pointing device under the hand based on the user file . this indicates to the user that the immediate past hand / finger behavior has no defined function . if the entire hand has been lifted off the touchscreen , at 811 , the os continues to display the virtual pointing device on the touchscreen in its current location for a period of time ( e . g ., 5 seconds ), but in an obvious hibernated state , meaning the fingerprint and palmprint areas will be viewed as translucent areas on the touchscreen . at 812 , the os determines if the hand has been re - positioned on the touchscreen within five seconds of detecting its removal . if the hand has not been re - positioned on the touchscreen within the five seconds , control is directed to 826 ( described herein ). however , if the os detects the hand being re - positioned on the touchscreen within 5 seconds , at 816 , the os determines if more than one virtual pointing device is concurrently being used and , if so , if more than one user had lifted his / her hand off the touchscreen at the time the hand was re - positioned on the touchscreen . if not , at 814 , control is directed to 322 of fig3 whereby the os activates and moves the virtual pointing identified by the user file under the re - positioned hand . additionally , if any objects and / or text were selected by the virtual pointing device at the time the hand was lifted , they will be re - drawn in a position relative to their previous location to the virtual pointing device ( described herein ). if more than one user had concurrently lifted his / her hand off the touchscreen , at 820 , the os reads the handprint of the re - positioned hand and calculates the measurements previously described and illustrated in fig2 . at 822 , the os searches the user files of the virtual pointing devices having a detected lifted hand for a hand measurement match . if a match is not found , at 823 , the os searches the user file database for the user identification of one of the virtual pointing devices having a detected lifted hand . the os then displays a dialog ( not shown ) asking the user if he / she is the user identified by the user identification . if the user indicates that he / she is identified by the user identification at 825 , at 826 , control is directed to 322 of fig3 whereby the os moves the virtual pointing device identified by the user file under the repositioned hand , and if any objects and / or text were selected by the virtual pointing device , they will be redrawn in a position relative to their previous location to the virtual pointing device ( described herein ). however , if the user indicates that the identification does not identify the user at 825 , the os determines if that identification is the last user file of a virtual pointing device having a detected lifted hand . if not , control returns to 823 where the os searches the next user file of a virtual pointing device having a detected lifted hand . this process repeats until a match is found between the user and the user identification and , therefore , the corresponding virtual pointing device having a detected lifted hand . if the os has search the last user file and no match has been found , at 839 , control is directed to 310 of fig3 where the os search all the user files for the user &# 39 ; s hand . returning to 812 , if the hand has not been repositioned on the touchscreen within 5 seconds or the entire hand has not been lifted off the touchscreen , at 826 , the os displays the virtual pointing device in the obvious hibernated state and , at 828 , prompts the user in a dialog ( not shown ) if the user desires to quit . if the user desires to quit , control is directed to 830 where the os removes the virtual pointing device from the display . if the user does not desire to quit , at 832 , the os places the mouse in a &# 34 ; hidden hibernation &# 34 ; state , which means that the mouse image displayed on the touchscreen in the obvious hibernated state ( i . e ., translucent ) begins to fade with time , but can be instantly activated when the user next touches the touchscreen . therefore , the os transforms the virtual pointing device from obvious hibernation ( e . g ., displayed in an translucent form ) to hidden hibernation . after a user specified time ( e . g ., 30 minutes ), the os interprets the time delay as meaning that the virtual pointing device is no longer needed . at 836 , if the os detects a hand placed on the touchscreen within 30 minutes , at 840 , the os brings the virtual pointing device out of hidden hibernation , redraws it under the hand , and control returns to 324 of fig3 . otherwise , at 838 , the os removes the virtual pointing device currently in a hidden hibernation state from memory ( e . g ., ram ). returning to 312 of fig3 the os determines if a match has been found between a measured hand placed on the touchscreen and any existing user files . if the os detects several user files having handprint measurements closely matching the handprint in question , at 316 , the os displays in a drop down menu ( not shown ) on the touchscreen showing those users having the closest match . at 318 , the os waits for the user to select ( using his other hand ) from the drop down menu a match in user identity , or a selection indicating that no match has occurred . if a match has occurred , control is directed to 320 ( previously described ). if no match has occurred , control is directed to 314 , where the os displays on the touchscreen a menu ( see 510 in fig5 ) asking the user to indicate if he / she desires to create a customized virtual pointing device . if the user does not desire to create a customized virtual pointing device , the os prompts the user to place his / her hand on the touchscreen and , in response , the os builds a generic virtual pointing device under the user &# 39 ; s hand , as shown in fig5 having the default finger / palm behavior and fingerprint functionality as previously described . if the user does desire to create a customized virtual pointing device , at 332 , the os opens a user file . at 334 , the os stores the size of the fingerprints and palmprint in the user file . at 336 , the os calculates the distance between the first reference point ( previously described and shown in fig2 ) and the farthest point to each fingerprint of the first three fingers . additionally , the os could calculate the second reference point and distance therefrom to the fourth fingerprint . at 338 , the os prompts the user for a user identification and displays main menu 600 , which prompts the user to enter virtual pointing device characteristics , such as the virtual pointing device shape , pointer location , behavior and sensitivity , and fingerprint functionality ( described herein and shown in fig6 ). at 340 , the os stores all information in the user file . control is directed to 322 , where the os draws the virtual pointing device under the hand ( or portion of the hand ) based on the information stored in the user file . at 324 , the os determines if any unusual behavior has occurred . if so , at 328 , the os determines if all fingers of the hand have been lifted off the touchscreen . if so , at 330 , the os displays a main menu 600 as illustrated in fig6 prompting the user to provide any customization of the virtual pointing device . referring to fig6 after the os displays the main menu 600 , the user may remove his / her hand from the touchscreen . if the user selects shape button 620 , a &# 34 ; shape &# 34 ; menu appears ( see 700 in fig7 ) that allows the user to define / redefine the shape of the virtual pointing device . referring to shape menu 700 of fig7 the os displays several options to the user . for example , the user could select a &# 34 ; fingers only &# 34 ; virtual pointing device ( see fig4 described herein ) whereby only the fingers need to be in contact with the touchscreen to move the virtual pointing device , or a palm and thumb only virtual pointing device , whereby only the thumb and palm need to be in contact with the touchscreen to move the virtual pointing device . in the latter case , movement of the fingers would not be assigned functionality . additionally , &# 34 ; a thumb plus one finger &# 34 ; or &# 34 ; palm &# 34 ; virtual pointing device could be created . however , because the os invokes the main menu 600 ( see fig6 ) by lifting all fingers while keeping the palm in contact with the touchscreen , if the user defines a new virtual pointing device that does not include the palm , the user could not later re - program the functionality of that special virtual pointing device . rather , the user would have to start with a generic virtual pointing device to create a new device . alternatively , a different technique could be used to activate the main menu 600 without departing from the scope of the invention . the user may change the default accuracy tolerance amount from 10 % to one of a number of pre - programmed values . to do so , the user presses accuracy button 702 and , in response , a drop - down list ( not shown ) of values ( e . g ., 4 %, 8 %, 20 %) appears for the user &# 39 ; s selection . the user enters / saves all selections by pressing button 704 . in response , the main menu 600 shown in fig6 reappears . returning to fig6 if the user selects define function button 625 , a &# 34 ; define function &# 34 ; menu appears that allows the user to define / redefine the functionality of the fingerprints / palmprint areas . specifically , define functionality menu 730 in fig7 allows the user to change the functionality of each fingerprint and thumbprint area by pressing the associated button next to the appropriate finger . for example , the user has pressed button 732 , indicating that he / she desires to change the functionality of the second finger ( i . e ., fingerprint area 230 ). in response , the os displays drop - down list 740 of pre - defined functions stored in memory . the user has selected open function 742 where , in response , the os displays another drop - down list 746 . the user selected a double click 744 of the second finger to invoke the open function . the user then presses save button 748 to save the entries in the user file . in response , the main menu 600 shown in fig6 appears . however , one skilled in the art readily recognizes that other changes in finger behavior and fingerprint area functionality may be made without departing from the scope and spirit of this preferred embodiment . returning to fig6 if the user selects define pointer button 630 , a &# 34 ; define pointer &# 34 ; menu appears that allows the user to define / redefine the shape , sensitivity , and position of the pointer on the virtual pointing device . referring to define pointer menu 760 in fig7 the user has a number of choices regarding the pointer . for example , the user can select a small , medium or large arrow , and / or a blinking arrow . the user can also select small or large pointer sensitivity , and the position of the pointer with respect to the virtual pointing device . for example , the pointer may be positioned over the third finger ( default position ), over the first finger , or below the palm . however , one skilled in the art readily recognizes that numerous changes in pointer behavior may be made without departing from the scope and spirit of this preferred embodiment . the user presses save button 762 to save the entries and , in response , the main menu 600 appears . finally , in fig6 the user has the option of saving and exiting by pressing save / exit button 635 , or cancelling all changes and returning to the default virtual pointing device by pressing cancel button 615 . referring to fig4 in a second embodiment , the os displays pre - determined , standard size fingerprint areas 415 , 420 , 430 , 435 and 440 and pointer 450 as a nonactivated ( also referred to as &# 34 ; obviously hibernated &# 34 ;) virtual pointing device . the fingerprint areas of the virtual pointing device are translucent such that object icons can be seen through them . to activate the virtual pointing device , the user places one or more fingers over a fingerprint area 415 , 420 , 430 , 435 or 440 on touchscreen 400 . alternatively , when the os detects a sound pattern ( or heat , pressure , etc .) over one or more of the translucent fingerprints areas 420 , 430 , 435 and 440 , the os activates only that area of virtual pointing device . the os assigns a default function ( e . g ., default function displayed above each fingerprint area ) to each fingerprint area having a finger placed over it . however , the fingerprint areas not having a finger placed over them will not be activated and , as such , will not have the default function assigned to them until they are activated . each fingerprint area may be activated at any time . as the user slides his / her fingers over touchscreen 400 , the os detects the touchscreen pixel coordinates under the user &# 39 ; s moving fingers and , in response , continuously re - defines the &# 34 ; activated &# 34 ; areas of the virtual pointing device to be the touchscreen areas under the fingers . therefore , the virtual pointing device moves with and according to the movement of the user &# 39 ; s fingers . however , while not all of the fingerprint areas may be activated at once , all fingerprint areas move together as one object . the os positions pointer 450 near the fingerprint area 420 such that pointer 450 moves in accordance with movement of the virtual pointing device . therefore , the user could , for example , move the virtual pointing device such that pointer 450 is positioned over a desired object icon . alternatively , the user could merely lift his hand and place it at a desired location , whereby the os would re - create the virtual pointing device under the user &# 39 ; s fingers at the new location . additionally , any objects or text selected by the virtual pointing device at the time the hand was lifted would also be re - drawn at the new location . in this example , the user has placed his / her first finger over fingerprint area 420 to activate that area of the virtual pointing device . if the user desires to resize the distance between the fingerprint areas of the virtual pointing device , the user merely places a separate finger , one by one , over each displayed fingerprint area ( thereby activating them ) and then slides each finger outward or inward , as appropriate , to customize the shape / size of the virtual pointing device . in this manner , the user customizes the shape / size of the virtual pointing device to the shape / size of his / her fingers . however , the user must actively customize the shape / size of the virtual pointing device each time he / she uses it . once the user positions pointer 450 over a desired object icon 422 , the user could , for example , single click his first finger over fingerprint area 420 to transfer focus to object icon 422 . however , only generic functions ( or previously established functions ) can be used for this embodiment . while the invention has been shown and described with reference to a particular embodiment thereof , it will be understood by those skilled in the art that the foregoing and other changes in form and detail may be made therein without departing from the spirit and scope of the invention , only defined by the appended claims . | 6 |
in embodiments , the ink compositions of the present invention comprise a polyesterified - dye ( i ) or polyurethane - dye ( ii ) of the formulas illustrated , and optionally a noncolored vehicle . examples of chromophores selected for the inks of the present invention are known and include , for example , nitroso , nitro , azo , diarylmethane , triarylmethane , xanthane , acridine , quinoline , methine , thiazole , indamine , indophenol , lactone , aminoketone , hydroxyketone , stilbene , azine , oxazine , thiazine , anthroquinone , phthalocyanine , perylenes , and the like , and wherein the weight average molecular weights thereof vary , however , they generally are in the range of from about 1 , 200 to about 5 , 000 grams / mole . other optional ink additives include biocides , such as dowicil 150 , 200 , and 75 , benzoate salts , sorbate salts , and the like , present in effective amounts , such as for example an amount of from about 0 . 0001 to about 4 percent by weight , and preferably from about 0 . 01 to about 2 . 0 percent by weight , ph controlling agents , such as acids , or bases , phosphate salts , carboxylate salts , sulfite salts , amine salts , and the like , present in an amount of from 0 to about 1 percent by weight and preferably from about 0 . 01 to about 1 percent by weight , or the like . the inks of the present invention are particularly suitable for printing processes wherein the substrate , such as paper , transparency material , or the like , is heated during the printing process to facilitate formation of the liquid crystalline phase within the ink . preferably , the substrate is heated to the highest temperature possible to enable the most rapid possible ink drying without damaging the substrate . when transparency substrates are employed , temperatures typically are limited to a maximum of about 100 ° c . to 110 ° c . since the polyester typically employed as the base sheet in transparency sheets tends to deform at higher temperatures . specially formulated transparencies and paper substrates can , however , tolerate higher temperatures , frequently being suitable for exposure to temperatures of 150 ° c . or even 200 ° c . in some instances . typical heating temperatures are from about 40 ° to about 140 ° c ., and preferably from about 60 ° c . to about 95 ° c ., although the temperature can be outside these ranges . the inks of the present invention are particularly suitable for use in acoustic ink jet printing processes . in acoustic ink jet printing , reference the patents recited here , the disclosures of which have been totally incorporated herein by reference , an acoustic beam exerts a radiation pressure against objects upon which it impinges . thus , when an acoustic beam impinges on a free surface of the ink of a pool of liquid from beneath , the radiation pressure which it exerts against the surface of the pool may reach a sufficiently high level to release individual droplets of liquid from the pool , despite the restraining force of surface tension . focusing the beam on or near the surface of the pool intensifies the radiation pressure it exerts for a given amount of input power . these principles have been applied to prior ink jet and acoustic printing proposals . for example , k . a . krause , &# 34 ; focusing ink jet head ,&# 34 ; ibm technical disclosure bulletin , vol 16 , no . 4 , september 1973 , pages 1168 to 1170 , the disclosure of which is totally incorporated herein by reference , describes an ink jet in which an acoustic beam emanating from a concave surface and confined by a conical aperture was used to propel ink droplets out through a small ejection orifice . acoustic ink printers typically comprise one or more acoustic radiators for illuminating the free surface of a pool of liquid ink with respective acoustic beams . each of these beams usually is brought to focus at or near the surface of the reservoir ( the liquid / air interface ). furthermore , printing conventionally is performed by independently modulating the excitation of the acoustic radiators in accordance with the input data samples for the image that is to be printed . this modulation enables the radiation pressure which each of the beams exerts against the free ink surface to make brief , controlled excursions to a sufficiently high pressure level for overcoming the restraining force of surface tension . that , in turn , causes individual droplets of ink to be ejected from the free ink surface on demand at an adequate velocity to cause them to deposit in an image configuration on a nearby recording medium . the acoustic beam may be intensity modulated or focused / defocused to control the ejection timing , or an external source may be used to extract droplets from the acoustically excited liquid on the surface of the pool on demand . regardless of the timing mechanism employed , the size of the ejected droplets is determined by the waist diameter of the focused acoustic beam . acoustic ink printing is attractive because it does not require the nozzles or the small ejection orifices which have caused many of the reliability and pixel placement accuracy problems that conventional drop on demand and continuous stream ink jet printers have suffered . the size of the ejection orifice is a critical design parameter of an ink jet because it determines the size of the droplets of ink that the jet ejects . as a result , the size of the ejection orifice cannot be increased without sacrificing resolution . acoustic printing has increased intrinsic reliability because there are no nozzles to clog . as will be appreciated , the elimination of the clogged nozzle failure mode is especially relevant to the reliability of large arrays of ink ejectors , such as page width arrays comprising several thousand separate ejectors . furthermore , small ejection orifices are avoided , so acoustic printing can be performed with a greater variety of inks than conventional ink jet printing , including inks having higher viscosities and inks containing pigments and other particulate components . it has been found that acoustic ink printers embodying printheads comprising acoustically illuminated spherical focusing lenses can print precisely positioned pixels ( i . e ., picture elements ) at resolutions which are sufficient for high quality printing of relatively complex images . it has also been discovered that the size of the individual pixels printed by such a printer can be varied over a significant range during operation , thereby accommodating , for example , the printing of variably shaded images . furthermore , the known droplet ejector technology can be adapted to a variety of printhead configurations including ( 1 ) single ejector embodiments for raster scan printing , ( 2 ) matrix configured ejector arrays for matrix printing , and ( 3 ) several different types of pagewidth ejector arrays ranging from ( i ) single row , sparse arrays for hybrid forms of parallel / serial printing to ( ii ) multiple row staggered arrays with individual ejectors for each of the pixel positions or addresses within a pagewidth image field ( i . e ., single ejector / pixel / line ) for ordinary line printing . inks suitable for acoustic ink jet printing typically are liquid at ambient temperatures ( i . e ., about 25 ° c . ), but in other embodiments the ink is in a solid state at ambient temperatures and provision is made for liquefying the ink by heating or any other suitable method prior to introduction of the ink into the printhead . images of two or more colors can be generated by several methods , including by processes wherein a single printhead launches acoustic waves into pools of different colored inks . further information regarding acoustic ink jet printing apparatus and processes is disclosed in , for example , u . s . pat . no . 4 , 308 , 547 , u . s . pat . no . 4 , 697 , 195 , u . s . pat . no . 5 , 028 , 937 , u . s . pat . no . 5 , 041 , 849 , u . s . pat . no . 4 , 751 , 529 , u . s . pat . no . 4 , 751 , 530 , u . s . pat . no . 4 , 751 , 534 , u . s . pat . no . 4 , 801 , 953 , and u . s . pat . no . 4 , 797 , 693 , the disclosures of each of which are totally incorporated herein by reference . the use of focused acoustic beams to eject droplets of controlled diameter and velocity from a free - liquid surface is also described in j . appl . phys ., vol . 65 , no . 9 ( 1 may 1989 ) and references therein , the disclosure of which is totally incorporated herein by reference . one embodiment of the present invention is directed to a process which comprises ( a ) providing an acoustic ink printer having a pool of liquid ink with a free surface , and a printhead including at least one droplet ejector for radiating the free surface of the ink with focused acoustic radiation to eject individual droplets of ink therefrom on demand , said radiation being brought to focus with a finite waist diameter in a focal plane , said ink comprising water , an oil - soluble or alcohol - soluble dye , and a surfactant , the ink exhibiting a liquid microemulsion phase at a first temperature , and at a second temperature higher than the first temperature , separating into a mixture of an aqueous liquid phase and a liquid crystalline gel phase ; and ( b ) causing droplets of said ink to be ejected onto a recording sheet in an imagewise pattern . the polyesterified - dye ( i ) selected for the inks of the present invention can be prepared by reacting a functional or reactive dye such as a dye containing one or more functional groups such as , for example , a hydroxy , amine , carboxylic acid or thiol group with a diester such as dimethylterephthalate and a diol such as a poly ( alkylene oxide ). in embodiments , the polyesterified - dye ( i ) is prepared , for example , by charging a reactor , such as a 300 milliliter parr reactor equipped with a distillation apparatus , with from about 10 to about 50 weight percent of a reactive dye , such as reactint black 57ab , available from milliken chemicals , with a mixture of from about 50 to about 90 percent by weight of equivalent mole amounts of poly ( oxyalkylene ), such as polyethylene oxide of molecular weight of about 200 or 400 grams per mole , and a diester , such as dimethyl isophthalate or dimethylterephthalate , a condensation catalyst , such as tin oxide or butylstannoic acid , and a diol , such as ethylene glycol . the reaction temperature is then raised to about 185 ° c . with stirring for a duration of about 3 hours . during this time , water is collected as a byproduct in the distillation receiver . the pressure of the reaction mixture is then reduced from atmospheric pressure to about 1 millimeter hg , and the reaction mixture stirred for an additional 3 hours at a temperature of from about 185 ° c . to about 210 ° c ., during which time the ethylene glycol is removed and collected in the distillation receiver . the mixture is then pressurized to atmospheric pressure , poured into a pan , and allowed to cool to room temperature , about 25 ° c . similarly , the polyurethane - dye ( ii ) can be prepared by reacting a functional or reactive dye , such as a dye containing one or more functional groups such as , for example , a hydroxy , amine , a carboxylic acid or thiol group with a diisocyanate , such as tolyldiisocyanate , and a diol , such as a poly ( alkylene oxide ). in embodiments , the polyesterified - dye ( i ) is prepared , for example , by charging a reactor , such as a 300 milliliter parr reactor equipped with from about 10 to about 50 weight percent of a reactive dye such as reactint black 57ab , available from milliken chemicals , with a mixture of from about 50 to about 90 percent by weight of equivalent mole amounts of diol , such as ethylene glycol , diethylene glycol , triethylene glycol and poly ( oxyalkylene ), such as polyethylene glycol of molecular weight of about 200 or 400 grams per mole , and a diisocyanate , such as tolyidiisocyanate , and a condensation catalyst , such as dibutyltin laurate . the reaction temperature is then raised to about 120 ° c . with stirring for a duration of from about 3 hours , after which the mixture is poured into a pan and allowed to cool to room temperature . the functional or reactive dye selected for the preparation of the polyesterified - dye or polyurethane - dye includes reactint black 57ab , reactint black x40lv , reactint blue 17ab , reactint blue x3lv , reactint blue x19 , reactint red x26b - 50 , reactint red x520 , reactint violet x80lt , reactint orange x38 , reactint yellow x15 , and the like , all available from milliken chemicals , 1 , 5 -( p - hydroxyphenylthio ) anthraquinone , 1 , 8 -( p - hydroxyphenylthio )- anthraquinone , 1 , 5 - bis ( p - hydroxyphenylthio )- 4 , 8 -( phenylthio ) anthraquinone , 1 , 4 - bis ( p - hydroxyphenylamino )- anthraquinone , and which dye is present , for example , in an amount of from about 2 to about 20 weight percent of the ink . the condensation catalyst utilized in the preparation of the polyesterified - dye or polyurethane - dye includes tin oxide , butylstannoic acid available from elf altochem as fascat 4100 , titanium ( iv ) tetraisopropoxide , titanium ( iv ) tetrabutoxide , zinc acetate , magnesium acetate , antimony oxide , zirconium acetate , lead oxide , tetrabutyl ammonium phosphate , and unicure from uniroyal chemicals , mixtures thereof , and the like , and is present in an amount of from about 0 . 01 to 0 . 1 mole equivalent of the ink . the diester utilized in the preparation of the polyesterified dye includes dimethyl terephthalate , dimethylisophthalate , dimethyl 5 - sulfoisophthalate , dimethyl phthalate , dimethyl succinate , dimethyl adipate , dimethyl suberate , dimethyl fumarate , dimethyl maleate , dimethyl glutarate , mixtures thereof , and the like , and is present in an amount of from about 25 to about 50 mole percent of the product . the diisocyanate utilized in the preparation of the polyurethane - dye includes benzene diisocyanate , toluene diisocyanate , diphenylmethane diisocyanate , 1 , 6 - hexamethylene diisocyanate , 1 , 12 - dodecane diisocyanate , mixtures thereof , and the like , and is present in an amount of from about 25 to about 50 mole percent of the ink . the oxyalkylene or poly ( oxyalkylene ) utilized in the preparation of the polyesterified - dye or polyurethane - dye includes ethylene glycol , diethylene glycol , triethylene glycol , tetraethylene glycol , propylene glycol , dipropylene glycol , tripropylene glycol , tetrapropylene glycol , polyethylene oxide or polyethylene glycol of a molecular weight ranging from about 200 grams per mole to about 2 , 000 grams per mole , polypropylene oxide or polypropylene glycol of molecular weight ranging from 200 grams per mole to about 2 , 000 grams per mole , mixtures thereof , and the like , and which component is present in various effective amounts such as in an amount of from about 25 to about 50 mole percent of the product . specific embodiments of the invention will now be described in detail . these examples are intended to be illustrative , and the invention is not limited to the materials , conditions , or process parameters set forth in these embodiments . all parts and percentages are by weight unless otherwise indicated . in these examples , the colorant is bound to the vehicle . synthesis of a black polyesterified - dye from reactint black 57 ab , polyethylene glycol of a molecular weight of 400 grams per mole and dimethyl terephthalate in a 1 liter parr reactor equipped with a mechanical stirrer and distillation apparatus were charged 100 grams of reactint black 57ab , available from milliken chemicals , with 200 grams of polyethylene glycol with a molecular weight of 400 grams per mole , 115 grams of dimethyl terephthalate , 50 grams of ethylene glycol and 0 . 4 gram of butylstannoic acid . the resulting mixture was then heated to about 185 ° c . with stirring for a duration of about 3 hours . during this time , water was collected as a byproduct in the distillation receiver . the pressure of the reaction mixture was then reduced from atmospheric pressure to about 1 millimeter hg , and the reaction mixture was stirred for an additional 3 hours at a temperature of from about 185 ° c . to about 210 ° c ., during which time the ethylene glycol was removed and collected in the distillation receiver . the mixture was then pressurized to atmospheric pressure , poured into a pan , and allowed to cool to room temperature , about 25 ° c . throughout the examples . synthesis of a black polyesterified - dye from reactint black 57 ab , polyethylene glycol of a molecular weight of 600 grams per mole and dimethyl terephthalate in a 1 liter parr reactor equipped with a mechanical stirrer and distillation apparatus were charged 100 grams of reactint black 57ab , available from milliken chemicals , with 300 grams of polyethylene glycol with a molecular weight of 600 grams per mole , 115 grams of dimethyl terephthalate , 50 grams of ethylene glycol and 0 . 4 gram of butyistannoic acid . the resulting mixture was then heated to about 185 ° c . with stirring for a duration of about 3 hours . during this time , water was collected as a byproduct in the distillation receiver . the pressure of the reaction mixture was then reduced from atmospheric pressure to about 1 millimeter hg , and the reaction mixture stirred for an additional 3 hours at a temperature of from about 185 ° c . to about 210 ° c ., during which time the ethylene glycol was removed and collected in the distillation receiver . the mixture was then pressurized to atmospheric pressure and poured into a pan and allowed to cool to room temperature . synthesis of a yellow polyesterified - dye from reactint yellow x15 , polyethylene glycol of a molecular weight of 600 grams per mole and dimethyl terephthalate in a 1 liter parr reactor equipped with a mechanical stirrer and distillation apparatus were charged 100 grams of reactint yellow x15 , available from milliken chemicals , with 300 grams of polyethylene glycol with a molecular weight of 600 grams per mole , 115 grams of dimethyl terephthalate , 50 grams of ethylene glycol and 0 . 4 gram of butylstannoic acid . the mixture was then heated to about 185 ° c . with stirring for a duration of about 3 hours . during this time , water was collected as a byproduct in the distillation receiver . the pressure of the reaction mixture was then reduced from atmospheric pressure to about 1 millimeter hg , and the reaction mixture stirred for an additional 3 hours at a temperature of from about 185 ° c . to about 210 ° c ., during which time the ethylene glycol was removed and collected in the distillation receiver . the mixture were then pressurized to atmospheric pressure , poured into a pan , and allowed to cool to room temperature . synthesis of a blue polyesterified - dye from reactint blue x3lv , polyethylene glycol of a molecular weight of 600 grams per mole and toluene diisocyanate in a 1 liter parr reactor equipped with a mechanical stirrer and distillation apparatus were charged 100 grams of reactint blue x3lv , available from milliken chemicals , 300 grams of polyethylene glycol with a molecular weight of 600 grams per mole , and 90 grams of toluene diisocyanate . the mixture was then heated to about 120 ° c . with stirring for a duration of about 3 hours , after which the mixture was poured into a pan and allowed to cool to room temperature . the resulting ink possessed a viscosity of 8 centipoise at 160 ° c . synthesis of a blue polyesterified - dye from reactint blue 17ab , polyethylene glycol of a molecular weight of 600 grams per mole and toluene diisocyanate in a 1 liter parr reactor equipped with a mechanical stirrer and distillation apparatus were charged 100 grams of reactint blue 17lv , available from milliken chemicals , with 300 grams of polyethylene glycol with a molecular weight of 600 grams per mole , and 90 grams of toluene diisocyanate . the resulting mixture was then heated to about 120 ° c . with stirring for a duration of about 3 hours , after which the mixture was poured into a pan and allowed to cool to room temperature . synthesis of a red polyesterified - dye from reactint red x520 , polyethylene glycol of a molecular weight of 600 grams per mole and toluene diisocyanate in a 1 liter parr reactor equipped with a mechanical stirrer and distillation apparatus were charged 100 grams of reactint red x520 , available from milliken chemicals , 300 grams of polyethylene glycol with a molecular weight of 600 grams per mole , and 90 grams of toluene diisocyanate . the mixture was heated to about 120 ° c . with stirring for a duration of about 3 hours , after which the mixture is poured into a pan and allowed to cool to room temperature . synthesis of a polyurethane 1 , 4 - bis ( p - hydroxyphenylamino ) anthraquinone blue dye with a molecular weight of about 1 , 500 gram per mole from propylene oxide , toluene diisocyanate and 1 , 4 - bis ( p - hydroxyphenylamino )- anthraquinone in a 1 liter parr reactor equipped with a mechanical stirrer and distillation apparatus were charged 200 grams of 1 , 4 - bis ( p - hydroxyphenylamino )- anthraquinone , 150 grams of propylene oxide , and 0 . 1 gram of butylstannoic acid . the mixture was refluxed for 3 hours at 120 ° c ., after which 24 grams of toluene diisocyanate were added , and the mixture heated at 120 ° c . for an additional 3 hours . the mixture was then poured into a pan and allowed to cool to room temperature . the inks of the above examples can , it is believed , be selected for acoustic ink jet printing and there will result images with excellent waterfastness , acceptable optical density , and wherein the paper with the images thereon is free from curling . also , the inks of the above examples possess desirable viscosities , for example in the range of from about 5 to about 20 centipoise . the viscosity is measured as illustrated in the u . s . pat . nos . 5 , 688 , 312 ; 5 , 667 , 568 and 5 , 700 , 316 , the disclosures of which are each totally incorporated herein by reference . also , the present invention can include as the optional vehicle in amounts , for example , of from about 0 to about 90 weight percent the vehicles as illustrated in the aforementioned copending applications . other modifications of the present invention may occur to those skilled in the art subsequent to a review of the present application , and these modifications , including equivalents thereof , are intended to be included within the scope of the present invention . | 2 |
referring particularly to fig1 a hydraulic system 200 is depicted . the hydraulic system 200 is utilized as a drive system for the wide area lawn mower 130 with a cutting deck 133 and a frame 135 depicted in fig1 . the wide area mower 130 actually includes two sets of these hydraulic drive systems 200 . each drive wheel 132 , 134 of the mower 130 is powered by a separate hydraulic motor ( 201 ). each motor 201 is powered by a separate hydraulic pump assembly 2 . an internal combustion engine 131 provides power to the hydraulic pumps 2 . wide area mower 130 further comprises an operator control means 150 for controlling the overall direction and speed of mower 130 during operation . control means 150 enables the operator to separately control the speed and direction of each drive wheel 132 , 134 by separately controlling the flow rate and direction of oil from each associated pump 2 . this permits forward and reverse travel of the mower 130 . this also provides a means for steering the mower 130 right or left . in a preferred embodiment , operator control means 150 is positioned on a handle member 155 rearwardly and upwardly extending from the cutting deck 133 and frame 135 . control means 150 preferably includes a control bar 158 having a central portion 159 with ends 154 of bar 158 bent downwardly at an angle of 90 degrees to the central portion 159 . a centrally located tube member 153 is welded to bar 158 and extends perpendicularly downward in the same plane as the ends 154 . a pivot shaft 169 is pivotally attached to handle 155 and aligned transverse to the direction of travel through axis 166 . a central stem 157 is welded perpendicular to shaft 169 . tube member 153 fits down within stem 157 and is secured to stem 157 to permit limited rotational displacement between tube member 153 and stem 157 . as a result , control bar 158 may be rotated about axis 156 , while pivot shaft 169 allows control bar 158 to be rotated forward and backward about axis 166 . control means 150 preferably further includes right and left control rods 151 ( a , b ). control rods 151 are each pivotally connected to an end portion 154 of control bar 158 . those skilled in the art will appreciate that control rods 151 are preferably coupled at their inner ends to direct - proportional displacement control means ( not shown ) for each pump assembly 2 . operator movement in the position of control means 150 relative to handle member 155 produces a movement of a swash plate control shaft ( not shown ) and results in a proportional swashplate 4 movement which changes pump 2 flow and / or direction . thus , overall movement of the mower 130 across the turf is controlled by the position of control means 150 relative to handle member 155 . each hydraulic system 200 includes a variable displacement pump assembly 2 that includes a cylinder block assembly 3 which houses variable swashplate 4 and input shaft 5 . hydraulic fluid is stored in reservoir 6 and enters the system flowing in the direction of arrow 7 through conduit 8 . an inlet filter 9 is required to insure that only clean fluid enters the system 200 . the fluid travels in the direction of arrow 10 through conduit 11 , where the fluid enters charge pump 12 . the charge pump 12 supplies fluid to keep the closed loop charged , preventing cavitation and providing cool oil flow 13 for the system 200 . the oil passes through orifice 14 to prevent the charge pump 12 from supercharging the hydrostatic pump 2 . the hydraulic fluid enters the cylinder block 3 . a case drain line 15 is provided to return oil to the reservoir that leaks past the pump shaft seals . either of the main hydraulic passages 17 or 18 can theoretically be at high pressure , which can typically exceed 1000 psi at normal operating conditions . fig1 shows oil flowing through conduit 17 and returning through conduit 18 which , in this configuration , provides forward travel of mower 130 . two charge check valves 20 and 21 are used to direct make up fluid into the low pressure side of the closed loop . in practice , a vehicle which primarily moves only in one direction , such as forward in the case of a lawnmower , would have conduit 17 as the high pressure side and conduit 18 as the low pressure side . a bypass line 22 interconnects conduit 17 with conduit 18 . referring also to fig2 - 4 , 12 and 13 , the pressure relief / tow valve 23 can be seen to reside in the bypass line 22 . the valve 23 includes a valve body 24 which is preferably formed of a single piece of a hard , durable material such as steel , which can be zinc plated for ward or corrosion resistance . the overall length 33 of valve body 24 is approximately 2 . 76 inches . in a preferred embodiment , the valve body 24 is formed to include a first end 25 having a hexagonal head with a distance between opposing faces of approximately 0 . 625 inch . the second end 35 of the valve body 24 includes a bore 135 having a depth 36 of approximately 0 . 94 inch and a diameter 37 of 0 . 122 inch . the entrance to the bore 135 includes a 30 ° chamfer 38 with a width 39 of 0 . 030 . the entrance to the bore can be configured in a number of ways including the use of larger chamfers . that is , the chamfer at the entry to bore 135 can be configured so as to have a wider opening to facilitate ease of insertion of the valve tip 52 , which is discussed below . selection of the desired chamfer at the entry to bore 135 affects assembly of the valve assembly 23 but does not affect performance of the valve once it is assembled and operating . perpendicular to the longitudinal axis 26 of the valve body 24 and passing through hex head 25 is a 0 . 266 inch diameter orifice 28 into which a screwdriver shaft or similar implement may be inserted to assist with manual rotation of the head 25 . the nominal distance 46 between the surface 27 and the longitudinal axis 47 of orifice 28 is 0 . 20 inch . as best seen in fig3 the surface 27 of head 25 transitions to a threaded shank 29 through a 0 . 03 inch radius 30 . the shank diameter 34 at the shoulder 30 is nominally 0 . 530 inch . the threads 31 have flats inclined at an angle 32 of approximately 30 °. the distance 147 between base 27 and the hex head surface 43 is about 1 . 82 inch . typically , a portion 49 of the valve body 24 is unthreaded , beginning at shoulder 50 . the distance 51 between shoulder 50 and surface 35 is , in one embodiment , approximately 0 . 80 inch . referring also to fig2 and 12 , details of the o - ring 98 and spacer 99 retaining groove 56 can be seen . the width 57 of groove 56 is approximately 0 . 159 inch . the groove floor 58 joins groove wall 59 through a radius 60 of approximately 0 . 010 inch . the edge 61 of the groove wall 59 is beveled at an angle 62 of about 5 °. the diameter 202 of the valve body 24 at the bottom of groove 56 is approximately 0 . 38 inch . an additional component of valve 23 which is best seen in fig5 and 12 is spring 63 . the spring is typically constructed of a resilient material such as 0 . 067 inch diameter music wire . the total number of complete coils 64 and 65 , for example , is nominally seven . the free length 66 is approximately 0 . 70 inch . the inside diameter 67 is about 0 . 250 inch , while the outside diameter 68 is 0 . 385 inch . these parameters result in a spring rate of 181 . 9 pounds per inch and a compressive force of 36 . 37 pounds when spring 63 is compressed to a length of 0 . 50 inches . when fully compressed , the spring 63 has a length of approximately 0 . 469 inch . the spring 63 fits over the valve tip 52 , which is discussed below . the valve tip or orifice engaging element 52 is preferably formed of a single piece of a hard , durable material such as steel , and is preferably hardened for improved strength and wear resistance . as seen in fig7 and 9 , the valve tip 52 is formed so as to have a shank region 71 and an enlarged head 72 . the overall length 88 of valve tip 52 is typically 1 . 63 inch . the length 87 of shank 71 is nominally 1 . 44 inch . the head 72 is formed partially as a truncated cone 81 having a relatively flat tip surface 73 having a diameter 74 of approximately 0 . 15 inch . the angle 80 of the cone 81 is approximately 54 °. the base 89 of the cone 81 is displaced a distance 90 of about 1 . 56 inch from the shank end wall 77 . the end wall 77 is beveled at an angle 78 of approximately 45 °. valve tip 52 also includes a groove 53 for accepting an o - ring 101 ( see fig1 ). groove 53 has a width 153 of 0 . 07 inch and a depth of approximately 0 . 13 inch . when o - ring 101 is placed in groove 53 , valve tip 52 is better retained in bore 135 of valve body 24 and is less likely to fall out of valve body 24 when valve assembly 23 is not secured in the hydraulic system as shown in fig1 . also , valve tip 52 will better follow valve body 24 as it is turned out of the receiving hydraulic system component . the outside diameter 82 of the shank 71 is approximately 0 . 22 inch , while the outside diameter 83 of the head 72 is about 0 . 35 inch , leaving an endwall 84 with a nominal wall of 0 . 06 inch . when valve 23 is assembled , the first end surface 85 of spring 63 abuts endwall 84 , while the second end surface 86 of spring 63 abuts the second end 35 of valve body 24 . the longitudinal axis 91 of valve tip 52 is substantially coaxial with valve body axis 26 and spring axis 69 when properly assembled as shown in fig1 . the effect of the spring 63 is to bias the valve tip 52 in the direction of arrow 92 . in operation , several additional components are needed to permit the practical use of the valve 23 . as seen in fig1 , the valve 23 is introduced into a cavity 93 that serves as a portion of the hydraulic fluid bypass line 22 . in the preferred embodiment , the cavity 93 is typically formed in a block 94 that serves as part of the housing for some portion of the pump assembly 2 . wall or cap 96 of block 94 is bored and tapped to receive the threaded portion 29 of the valve body 24 . one boundary 95 of cavity 93 contains a smooth bore 97 which is adapted to receive the unthreaded portion 49 of the valve body 24 . in order to create a fluid tight seal , an o - ring 98 is placed in groove 56 , with the o - ring 98 being held in place by spacer 99 . the o - ring 98 is positioned in groove 56 farther from the threaded section 29 and spacer 99 is positioned in groove 56 nearer to the threaded section 29 . as stated earlier , the spring 63 biases the valve tip 52 in the direction of arrow 92 , thereby urging the truncated conical head 81 to form a seal with the portion 100 of bypass line 22 . one additional component that is useful in securing the valve 23 to block 94 is shoulder nut 102 , best seen in fig1 , 11 and 12 . the nut 102 is formed with a hexagonal head having a dimension 103 between opposing faces of 0 . 938 inch . the head has an overall depth 104 of 0 . 52 inch , which includes a circular collar 105 having a height 107 of about 0 . 15 inch . the collar 105 has an outside diameter 106 of approximately 0 . 75 inch . the inner surface 120 of the collar 105 is threaded to engage the threads 29 of the valve body 24 . as seen in fig1 , a counterbore 108 is formed in wall 96 that is adapted to receive the collar 105 . in operation , when the engine 131 is engaged , the pumps 2 will be driven at the same speed . control means 150 includes a neutral position , as depicted in fig1 , whereby a negligible pressure differential is developed across the pump lines 17 , 18 . to commence overall mower 130 movement , the user control means 150 is actuated away from the neutral position to develop a hydraulic pressure differential across pump lines 17 , 18 . it is sufficient to understand the invention to state that as control bar 158 of control means 150 is pivoted about pivot shaft 169 fluid pressure to the wheel motors will result in an overall translation of the mower 130 across the turf , while as the control bar 158 is rotated about stem member 157 the mower 130 will experience rotational , right or left , motion . a forward rotation of control bar 158 , toward the mower deck 133 as viewed in fig1 , results in forward rotation of the wheel motors , while a rearward rotation of control bar 158 results in a reverse rotation of the wheel motors . combinations of control bar 158 pivot about shaft 169 and rotation about stem member 157 result in combinational translation and rotation of the mower 130 across the turf , thus allowing the user to control the overall machine 130 travel through curves , around corners , etc . the operation of the valve 23 can be understood with reference to fig1 , 13 and 14 . hydraulic system 200 includes a bypass line 22 which includes a chamber 93 that permits introduction of the valve 23 . in a preferred embodiment , the valve 23 is inserted into bore 97 by rotating head 25 until the shank end wall 77 of the valve tip 52 contacts the bottom of the bore 135 . this is achieved with a torque of approximately 50 inch pounds . this position corresponds to compression of the spring 63 , with the conical face 81 of the valve tip 52 being firmly pressed against the orifice 100 of bypass line 22 . the valve 23 is then loosened by rotating the head 25 in an opposite direction for half a turn , or approximately 180 °. the valve 23 is secured in this position by tightening the shoulder nut 102 to a torque value of between 60 and 120 inch pounds . when the motor 2 begins operation in the direction corresponding to forward vehicle movement , leg 109 of bypass line 22 is the high pressure side , while leg 110 of line 22 is the low pressure side . thus , any increase in hydraulic pressure results in a surge in the direction of arrow 111 ( see fig1 ). as the pressure reaches and exceeds a certain value , the valve tip 52 also moves in the direction of arrow 111 , limiting system pressure as some oil slips by valve face 81 of valve tip 52 . with the hydraulic pressure thus relieved , the valve tip 52 moves in the direction of arrow 92 in response to the biasing force of spring 63 , thus closing the bypass line 22 . as seen in fig1 , the actual pressure value at which the valve tip 52 moves away from seat 100 is dependent on the degree of compression of spring 63 , which is a direct function of the extent to which the valve 23 has been inserted into the chamber 93 . fig1 is a recording of actual pressure measurement data for two pumps and motors , one for the left wheel and one for the right wheel of a single test lawn mower , conducted simultaneously . for example , with the valve 23 inserted fully into chamber 93 of both right and left pumps , the peak pressure value 112 in the right hydraulic circuit reaches a peak value of over 1400 psi while the peak pressure 113 in the left side exceeds 1000 psi . at this setting , the shank end wall 77 of the valve tip 52 contacts the bottom of the bore 135 , meaning that the valve tip 81 is unable to retract in the direction of arrow 111 , as would be the case if a prior art tow valve having no pressure relief function was present in the chamber 93 . this indicates that the approximate peak pressure that occurs upon sudden pump engagement is 1000 psi for the left pump ( as denoted by peak value 113 ), and 1400 psi for the right pump ( as denoted by peak value 112 ). by loosening ( rotating ) the valve assembly 23 for each side 60 ° ( 1 / 6 turn ), the peak high pressure leg value 114 changes to 1200 psi in the left circuit and the high pressure leg value 115 is just over 800 psi in the right side . an additional loosening rotation of 60 ° ( 120 ° total ) for each valve 23 results in a left side peak 116 of about 900 psi and a right side peak 117 of about 500 psi . an additional 60 ° turn to loosen valves 23 ( 180 ° total ), reduces the right side surge value 119 to under 500 psi . as is clearly seen in the graph of fig1 , valves 23 can be set to a position which will dramatically reduce the peak pressure values which occur in the hydraulic circuit 200 , thereby reducing the tendency of the vehicle to lurch or jerk in response to sudden operator input to user control means 150 . the pressure differential between the two pumps is attributable to slight variations in the rolling resistance of wheels 132 , 134 . for example , if wheel 132 has a higher rolling resistance than wheel 134 , it will require more torque in order to initiate rotation . since torque is proportionally related to hydraulic pressure , the wheel with the higher rolling resistance will also require increased hydraulic pressure . the data shown in fig1 demonstrates this typical non - symmetry in pressure between the left and right pumps . several factors may contribute to this differential including : variations in hydraulic wheel motor efficiency ; non - symmetric weight distribution ; and unequal tire pressure . because these factors can rarely , if ever , be equalized , a pressure differential similar to that demonstrated in fig1 will almost always exist . nonetheless , the preferred embodiment permits the operator to adjust pressure relief valve 23 of each pump 2 independently to prevent excessive torque in either wheel 132 , 134 . the nominal setting for the valves 23 is one - half turn less than full insertion . this setting ensures an adequate pressure relief function for a wide area mower of typical size and weight , thus reducing the frequency and severity of the mower jerking upon rapid acceleration . however , this setting does not relieve so much pressure as to render the mower operating characteristics as sluggish . a lighter mower would require the valves 23 to be turned out more , perhaps as much as one full turn . conversely , a heavier mower might require the valves 23 to be turned in to a point near , but not at , full insertion . this particular setting might be at 1 / 6 turn counterclockwise from closed . in extremely hilly conditions with a heavy mower , it might be desirable to have the valves 23 closed all the way so as to provide full hydraulic power to the mower . obviously , the valve 23 setting should be determined by the operator , the operator &# 39 ; s supervisor , or the maintenance specialist of the mower . the terrain upon which the mower is operated will , obviously , be a factor in selecting a valve 23 setting . as for the tow valve function , it is desirable to have the valves 23 turned counterclockwise 41 / 2 and 51 / 2 turns from their fully closed position . in this position , the valve tips 52 are fully retracted from seats 100 on bypass lines 22 . with the valve tips 52 pulled away from seats 100 , oil can flow freely between lines 109 and 110 of bypass circuits 22 . thus , when mower 130 is moved with its engine off and the valves 23 retracted , oil flow generated by the rotating motors is free to flow between lines 17 and 18 of the hydraulic circuits 200 through bypass circuits 22 . this allows the operator to push or pull the mower 130 with a minimal amount of resistance since the oil can bypass the variable displacement pumps 2 which have a high degree of resistance when they are in neutral . after the mower 130 has been moved , the operator can close the valves 23 back to the desired position for operation as pressure relief valves . a preferred embodiment of the invention is described above . those skilled in the art will recognize that many embodiments are possible within the scope of the invention . variations and modifications of the various parts and assemblies can certainly be made and still fall within the scope of the invention . thus , the invention is limited only to the apparatus recited in the following claims and equivalents thereof . | 8 |
in the following description , for purposes of explanation and not limitation , specific details are set forth ( such as particular signalling steps ) in order to provide a thorough understanding of the technique presented herein . it will be apparent to one skilled in the art that the present technique may be practised in other embodiments that depart from these specific details . for example , while the embodiments will primarily be described in the context of an mme / sgsn ; however , this does not rule out the use of less or more devices to implement the present invention . moreover , those skilled in the art will appreciate that the services , functions and steps explained herein below may be implemented using software functioning in conjunction with a programmed microprocessor , or using an application specific integrated circuit ( asic ), a digital signal processor ( dsp ) or general purpose computer . it will also be appreciated that while the following embodiments are described in the context of methods and devices , the technique presented herein may also be embodied in a computer program product as well as in a system comprising a computer processor and a memory coupled to the processor , wherein the memory is encoded with one or more programs that execute the services , functions and steps disclosed herein . fig6 a and 6b show a first embodiment of an apparatus 2023 ( as an example , an mme or sgsn ) for relocating an sgw 2025 associated to a ue ( not shown ). fig6 a illustrates the components comprised in the apparatus 2023 ( and optionally , an enb 2021 , a source sgw 2025 and a target sgw 2026 ), and fig6 b shows the interaction between the components shown in fig6 a . as shown in fig6 a , the apparatus 2023 , the enb 2021 , the source sgw 2025 and the target sgw 2026 each comprise an own core functionality ( e . g . a central processing unit ( cpu ), a dedicated circuitry or a software module ) 202 x 1 ( wherein x = 1 , 3 , 5 or 6 ), a memory ( and / or database ) 202 x 2 , a ( n optional ) transmitter 202 x 3 and a ( n optional ) receiver 202 x 4 . in turn , the apparatus 2023 comprises a trigger 20235 , an updater 20236 , an optional performer 20237 and an optional continuer 20238 . as indicated by the dashed extensions of the functional blocks of the cpus 202 x 1 ( wherein x = 1 , 3 , 5 or 6 ), the trigger 20235 , the updater 20236 , the performer 20237 and the continuer 20238 ( of the apparatus 2023 ), as well as the memory 202 x 2 , the transmitter 202 x 3 and the receiver 202 x 4 may at least partially be functionalities running on the cpus 202 x 1 , or may alternatively be separate functional entities or means controlled by the cpu 202 x 1 and supplying the same with information . the cpus 202 x 1 may be configured , for example by software residing in the memories 202 x 2 , to process various data inputs and to control the functions of the memory 202 x 2 , the transmitter 202 x 3 and the receiver 202 x 4 ( as well as the trigger 20235 , the updater 20236 , the performer 20237 and the continuer 20238 ( of the apparatus 2023 ). the memory 202 x 2 may serve for storing code means for carrying out the methods according to the aspects disclosed herein , when run on the cpu 202 x 1 . it is to be noted that the transmitter 202 x 3 and the receiver 202 x 4 may alternatively be provided as an integral transceiver , as is shown in fig6 a . it is further to be noted that the transmitters / receivers may be implemented as physical transmitters / receivers for transceiving via an air interface ( e . g ., between the network apparatus 2023 and the ue 201 ), as routing entities / interfaces between network elements ( e . g ., for transmitting / receiving data packets between apparatus 2023 and sgw 2025 , 2026 when disposed as separate network functionalities ), as functionalities for writing / reading information into / from a given memory area ( e . g . between enb 2021 and sgw 2025 , 2026 when disposed as an integral network entity 2001 ) or as any suitable combination of the above . at least one of the above - described trigger 20235 , updater 20236 , performer 20237 and continuer 20238 ( of the apparatus 2023 ), as well as the apparatus 2023 itself , or the respective functionalities carried out , may also be implemented as a chipset , module or subassembly . as shown in fig6 c , the following steps are performed for each session ( i . e ., for each pdn connection ): step 1 : the trigger 20235 of the mme 2023 triggers the relocation of the source sgw 2025 by sending a create session request message to the new ( target ) sgw 2026 . step 2 : the target sgw 2026 may update the pgw ( not shown ) by a modify bearer request message and the pgw responds with a modify bearer response message . this causes the pgw 2027 to start sending downlink packets via the target sgw 2026 . step 3 : the target sgw 2026 acknowledges the request by sending a create session response message to the receiver 20234 of the mme 2023 . the message includes the uplink s1 gtp endpoints of the target sgw 2026 . steps 4 and 5 : the updater 20236 of the mme 2023 updates the ip address of the target sgw 2026 and the teid information in the enb 2021 used for uplink by using ue context modification request to which the enb 201 may respond to . this causes new uplink data to follow the new path via the target sgw 2026 . in case the procedure is executed in idle mode , steps 4 and 5 may be skipped . step 6 : the transmitter 20233 of the mme 2023 deletes the session in the source sgw 2025 to free up unused resources by transmitting a delete session request . note that the proposed procedure in the first embodiment may use messages that are already standardized , except for message ( s ) in steps 4 and 5 which may require the definition of a new information element ( ie ) to an existing message ( or the definition of a new message ). as an alternative , it may be possible to bundle steps 4 and 5 together for all pdn connections to reduce signalling to the enb 2021 . in that case , step 6 would be executed after steps 4 and 5 for all pdn connections . in case the sgw relocation is triggered by the activation of a new pdn connection , it is possible to combine the two procedures in the following way as a further optimization : the receiver 20233 of the mme 2023 may first get ( or receive ) a request for the activation of a new pdn connection and determines to relocate the sgw as a result of that . the performer 20237 of the mme 2023 may perform the sgw relocation procedure for the existing connections . finally , the continuer 20238 of the mme 2023 may continue with the activation of the new pdn connection using the target sgw . the advantage of this optimization is that the new pdn connection will use the new target sgw 2026 from the beginning , avoiding the use of the old sgw 2025 for a short period of time . for 3 rd generation ( 3g ) direct tunneling , the procedure is the same with the following small differences : instead of the enb 2021 , a radio network controller ( rnc ) may be provided . instead of the mme 2023 , an sgsn 2023 may be provided . steps 4 and 5 may use the radio access bearer ( rab ) assignment request / response messages . in the case of 2 nd generation ( 2g ) or 3g without direct tunneling , the sgsn 2023 will be automatically aware of the address and teid of the new sgw 2026 where uplink user plane packets should be sent to , so in that case there is no need for steps 4 and 5 . note that it is possible to use another message between the ( e ) nb 2021 and the mme / sgsn 2023 or to define a new message type . messages in steps 4 and 5 may require new functionality . other messages in the procedure may already exist . fig7 a and 7b show a second embodiment of an apparatus 2023 ( as an example , an mme or sgsn ) for relocating an sgw 2025 associated to a ue ( not shown ). fig7 a illustrates the components comprised in the apparatus 2023 ( and optionally , the enb 2021 , the source sgw 2025 and the target sgw 2026 ), and fig7 b shows the interaction between the components shown in fig7 a . as shown in fig7 a , the apparatus 2023 , the enb 2021 , the source sgw 2025 and the target sgw 2026 each comprise an own core functionality 202 x 1 ( wherein x = 1 , 3 , 5 or 6 ), a memory ( and / or database ) 202 x 2 , a ( n optional ) transmitter 202 x 3 and a ( n optional ) receiver 202 x 4 . in turn , the apparatus 2023 comprises the trigger 20235 , a setter 20236 a , a timer 20236 b and a requester 20236 c . as indicated by the dashed extensions of the functional blocks of the cpus 202 x 1 ( wherein x = 1 , 3 , 5 or 6 ), the trigger 20235 , the setter 20236 a , the timer 20236 b and the requester 20236 c ( of the apparatus 2023 ), as well as the memory 202 x 2 , the transmitter 202 x 3 and the receiver 202 x 4 may at least partially be functionalities running on the cpus 202 x 1 , or may alternatively be separate functional entities or means controlled by the cpu 202 x 1 and supplying the same with information . the cpus 202 x 1 may be configured , for example by software residing in the memories 202 x 2 , to process various data inputs and to control the functions of the memory 202 x 2 , the transmitter 202 x 3 and the receiver 202 x 4 ( as well as the trigger 20235 , the setter 20236 a , the timer 20236 b and the requester 20236 c ( of the apparatus 2023 ). the memory 202 x 2 may serve for storing code means for carrying out the methods according to the aspects disclosed herein , when run on the cpu 202 x 1 . it is to be noted that the transmitter 202 x 3 and the receiver 202 x 4 may alternatively be provided as an integral transceiver , as is shown in fig7 a . it is further to be noted that the transmitters / receivers may be implemented in the forms described in the first embodiment . at least one of the above - described trigger 20235 , setter 20236 a , timer 20236 b and requester 20236 c ( of the apparatus 2023 ), as well as the apparatus 2023 itself , or the respective functionalities carried out , may also be implemented as a chipset , module or subassembly . another alternative to perform sgw relocation for the purpose of transport optimization ( or other reasons , such as operation and maintenance , o & amp ; m , actions , sgw failure or load balancing ) is that the setter 20236 a of the mme 2023 may set a flag for the given ue selected for sgw relocation , and the next time this ue undergoes a mobility procedure , this flag will , by the trigger 20235 of the mme 2023 , trigger the sgw reallocation in the mme 2023 as defined for the existing mobility procedures . yet another alternative is that the timer 20236 b causes the mme 2023 to wait until the selected ue becomes idle and then performs the sgw relocation in idle mode as described above . this may also be a part of the flow chart in fig8 g . however , this may incur an unpredictable delay and hence it may not be useable for enterprise local ip access . due to the delay , it also has higher complexity in the mme 2023 to manage the process . another alternative may reside in using a mechanism by the mme 2023 to enforce a path switch request from the enb based on which the process in fig7 c may be applied again for sgw relocation . this would comprise that the requester 20236 c of the mme 2023 sends a new message to the enb 2021 ( step 1 ), requesting the enb 2021 to initiate a path switch by sending a path switch request to the mme 2023 ( step 2 ). this would trigger steps ( or messages ) 1 to 5 , 7 a and 7 b in the flow chart of fig3 . the procedure could be proprietary or standardized . in the latter case , the new message from the mme 2023 to the enb 2021 would have to be standardized . this procedure is illustrated in fig7 c , wherein it is to be noted that steps 2 to 9 of fig7 c correspond to steps 1 to 5 , 7 a and 7 b in fig3 . however , this alternative is not more complex than the proposed main alternative in the first embodiment above , since it requires the definition of a new message on the s1 interface . compared to that , it seems simpler to pass the necessary information to the enb 2021 already in a new s1 parameter according to the first embodiment . another issue is that this approach is limited to lte and not applicable in 3g where there is no corresponding procedure to the x2 handover . fig8 a , 8 b , 8 c , 8 d , 8 e and 8 f show a third embodiment of the apparatus 2023 ( as an example , mme or sgsn ) for relocating an sgw 2025 associated to a ue 201 . fig8 a , 8 c and 8 e illustrate the components comprised in the apparatus 2023 ( and optionally , the ue 201 , the enb 2021 , the source sgw 2025 and the target sgw 2026 ), and fig8 b , 8 d and 8 f show the interaction between the components shown in fig8 a , 8 c and 8 e . as shown in fig8 a , 8 c and 8 e , the apparatus 2023 , the ue 201 , the enb 2021 , the source sgw 2025 and the target sgw 2026 each comprise an own core functionality 20 x 1 ( wherein x = 1 , 21 , 23 , 25 or 26 ), a memory ( and / or database ) 20 x 2 , a ( n optional ) transmitter 20 x 3 and a ( n optional ) receiver 20 x 4 . as shown in fig8 a , the apparatus 2023 comprises an obtainer 20235 , an evaluator 20236 , a performer 20237 , an optional detector 20238 , an optional notifier 20239 , an optional determiner 202310 and an optional timer 202311 . as shown in fig8 c , the apparatus 2023 comprises , in addition or alternatively , an optional reducer 202312 , an optional counter 202313 , an optional setter 202314 , an optional monitor 202315 , an optional estimator 202316 and an optional delayer 202317 . finally , as shown in fig8 e , the apparatus 2023 ( further ) comprises , in addition or alternatively , an optional selector 202318 ( as a part of the evaluator 20236 ), an optional trigger 202320 and an optional configurator 202322 ; and the ue 201 comprises an optional activator 20119 and an optional deactivator 20121 . as indicated by the dashed extensions of the functional blocks of the cpus 20 x 1 ( wherein x = 1 , 21 , 23 , 25 or 26 ), the obtainer 20235 , the evaluator 20236 , the performer 20237 , the detector 20238 , the notifier 20239 , the determiner 202310 , the timer 202311 , the reducer 202312 , the counter 202313 , the setter 202314 , the monitor 202315 , the estimator 202316 , the delayer 202317 , the selector 202318 , the trigger 202320 and the configurator 202322 ( of the apparatus 2023 ) and the activator 20119 and the deactivator 20121 ( of the ue 201 ), as well as the memory 20 x 2 , the transmitter 20 x 3 and the receiver 20 x 4 may at least partially be functionalities running on the cpus 20 x 1 , or may alternatively be separate functional entities or means controlled by the cpu 20 x 1 and supplying the same with information . the cpus 20 x 1 may be configured , for example by software residing in the memories 20 x 2 , to process various data inputs and to control the functions of the memory 20 x 2 , the transmitter 20 x 3 and the receiver 20 x 4 ( as well as the obtainer 20235 , the evaluator 20236 , the performer 20237 , the detector 20238 , the notifier 20239 , the determiner 202310 , the timer 202311 , the reducer 202312 , the counter 202313 , the setter 202314 , the monitor 202315 , the estimator 202316 , the delayer 202317 , the selector 202318 , the trigger 202320 and the configurator 202322 ( of the apparatus 2023 ) and the activator 20119 and the deactivator 20121 ( of the ue 201 )). the memory 20 x 2 may serve for storing code means for carrying out the methods according to the aspects disclosed herein , when run on the cpu 20 x 1 . it is to be noted that the transmitter 20 x 3 and the receiver 20 x 4 may alternatively be provided as an integral transceiver , as is shown in fig8 a , 8 c and 8 e . it is further to be noted that the transmitters / receivers may be implemented in the forms described in the first embodiment . at least one of the above - described obtainer 20235 , evaluator 20236 , performer 20237 , detector 20238 , notifier 20239 , determiner 202310 , timer 202311 , reducer 202312 , counter 202313 , setter 202314 , monitor 202315 , estimator 202316 , delayer 202317 , selector 202318 , trigger 202320 and configurator 202322 ( of the apparatus 2023 ) and activator 20119 and deactivator 20121 ( of the ue 201 ), as well as the apparatus 2023 or ue 201 itself , or the respective functionalities carried out , may also be implemented as a chipset , module or subassembly . the approach is depicted in the flowchart in fig8 g . it consists of 3 important phases : the obtainer 20235 of the mme 2023 gets the information that triggers the evaluation procedure for sgw relocation ( step 8 - 0 ). the evaluator 20236 of the mme 2023 evaluates whether sgw relocation is beneficial ( step 8 - 5 ). the performer 20237 of the mme 2023 performs the sgw relocation if the evaluation above is positive ( steps 8 - 7 and 8 - 11 ). the evaluation procedure may trigger a sgw relocation procedure if the result of the evaluation is a different sgw 2026 than the currently selected sgw 2025 ( optionally with a required margin in terms of how much better the different sgw is than the old one ). getting information for sgw evaluation ( step 8 - 0 ) several circumstances may trigger the mme 2023 ( or sgsn 2023 in case of geran or utran ) to initiate the sgw relocation procedure . there are seven examples to this effect . the detector 20238 of the mme 2023 detects that the traffic volume or traffic compositions generated by the ue has changed significantly ( either the destination or the composition of the traffic , e . g ., by opening / closing gbr bearers ). a typical example is if the ue 201 has several pdn connections to more than one pgw and the traffic change makes another pgw become more important than the one combined with the current sgw 2025 . then relocating the sgw so that it is combined with the most important pgw would be beneficial . the mme 2023 may be made aware of changed traffic volumes by collecting long - or short - term traffic statistics from the subscriber . the former would be useful e . g ., to infer whether a certain subscriber generates different traffic patterns to different pgws in different times of day ( or days of week ). the latter would be used to infer sudden or unexpected changes in subscriber behaviour . however , it is suggested , that in the simplest variant the detector 20238 of the mme 2023 would just detect the changes in the subscriber traffic by collecting information about the opened / closed bearers ( qos class indicator ( qci ) of the bearers may be a good indicator of the traffic type ). the receiver 20233 of the mme 2023 receives that the ue 201 opens a new pdn connection or closes an existing one ( the mme 2023 is involved in the signalling so it gets notified by any such event ). also in this situation a typical example is that after the change of pdn connectivity , the current sgw 2025 is no longer optimal , e . g . because it is no longer combined with the most important pgw or no longer combined with any pgw . then relocating the sgw so that it is combined with the most important pgw would be beneficial . when the ue 201 transitions from idle to connected mode , the detector 20238 of the mme 2023 detects that the ue 201 has moved to a new location ( e . g . indicated by a cell identity ( ecgi ) or tracking area identity ( tai ) conveyed from an enb 2021 e . g . in an s1ap message ), where the user plane transmission path could potentially be optimized by sgw relocation ( even if the ue 201 still remains in the same sgw sa ). due to the selected ip traffic offload ( sipto ) feature , the sgw relocation needs to take place to a special sgw ( thus , the determiner 202310 of the mme 2023 determines the target sgw 2026 ), and the relocation needs to be done at a different time ( such as in idle mode ) in order not to disturb on - going traffic flows . the determiner 202310 of the mme 2023 determines that a certain sgw 2025 is too heavily loaded ( it either sends overload indication or the notifier 20239 of the mme 2023 receives an indirect notification by e . g ., rejecting some requests ) and the determiner 202310 of the mme 2023 decides that it is preferable to relocate some ues 201 to other sgws 2026 . the determiner 202310 of the mme 2023 determines that a failure occurs in the sgw 2025 of the ue 201 , so that the sgw 2023 loses parts of its capacity , which makes it preferable to relocate ues to other sgws . the determiner 202310 of the mme 2023 determines ( or is notified of ) the changes by the o & amp ; m system ( or indirectly by overload indications or rejections from the sgw 2025 ). the determiner 202310 of the mme 2023 determines that due to scheduled o & amp ; m actions , the sgw 2025 of the ue 201 will soon wholly or partly be taken down for service / maintenance or upgrade and to avoid service interruptions , ues allocated to the sgw should be relocated to other sgws 2026 . the receiver 20233 of the mme 2023 should get sgw load information in order to be able to off - load sgws considered to be loaded above an allowed threshold . this generally implies getting two quantities : the capacity limit of each gw , and the current load of each gw . note that the ue 201 location may be learnt by the mme during handovers , taus or service requests hence the triggers that indicate ue 201 movements are rather frequent . therefore , as shown in fig8 c and 8d , the reducer 202312 of the mme 2023 reduces the number of triggers to the sgw evaluation procedure based on subscriber mobility or traffic changes . one possibility is to limit the time window when the ue 201 movements may trigger a sgw evaluation ( e . g ., a five - minute interval every hour during which the ues giving a trigger are evaluated ). however , this may cause that some of the ues will never be evaluated from the sgw relocation perspective . an alternative method would be to count the number of location events by the subscriber and perform an evaluation after every n th such event . alternatively , one may use an “ evaluation gap ” timer 202311 which prohibits evaluations during a certain time after an evaluation . the timer 202311 of the mme 2023 may be complemented by a flag which is set , by the setter 202314 of the mme 2023 , if one or more change has occurred during this “ gap ” in which case a new evaluation would be performed , by the performer 20237 of the mme 2023 , at the end of the gap after which the timer 202311 of the mme 2023 once again would “ close ” the evaluation possibility for a prescribed time . the duration of the timer could be set such that the total rate of evaluations becomes acceptable . if the number of triggers for the sgw evaluation is still high , the load caused by sgw evaluations may further be reduced by : maintaining , by the memory 20232 of the mme 2023 , a list of already evaluated locations or conditions ; monitoring , by the monitor 202315 , if they occur again within a certain time , the performer 20237 should not trig an evaluation . the time during which a condition is “ uninteresting ” could be set such that the total rate of evaluations becomes acceptable . restrict the sgw evaluations when the load ( mainly the processing load ) of the mme is high . with this example , the estimator 202316 of the mme 2023 estimates the current processing load of the sgw 2025 every time it receives a sgw evaluation trigger . if the load is too high , the performer 20237 of the mme 2023 either skips the sgw evaluation or delays it , by the delayer 202317 of the mme 2023 , until the load has decreased below a threshold . the decision on sgw evaluation could further be modulated by : the result of the previous sgw evaluation for the given ue . the ue subscription type . currently established services / bearers for the given ue . current tracking area ( ta ) or ta list . the above restrictions / limitations of the sgw evaluation frequency would of course exclude cases where sgw evaluations have to be performed , e . g . sgw evaluation in conjunction with o & amp ; m action involving the current sgw , or sgw evaluation in conjunction with attaching ues . as shown in fig8 e and 8f , the role of the sgw evaluation procedure is to select , by the selector 202318 , the most optimal sgw 2026 for a given bearer . this procedure is based on extensive information in the mme : gw capability and configuration information , including capability to act as a combined sgw / pgw node and traffic off - load capability . topology information , i . e ., the locations of sgw , pgw and asbr nodes relative to each other as well as relative to the enb the ue is presently attached to . gw load information . information about active apns and bearers including qos parameters and requirements . the first step is the identification of the candidate sgws 2026 that requires basically the same capability and configuration information that is needed at attach , so the information may be received by the standard dns procedure as described in 3gpp ts 29 . 303 v8 . 2 . 0 . in the next step , the evaluator 20236 evaluates the sgws based on the above information , and the selector 202318 selects the most optimal sgw 2026 considering all criteria . the user plane path evaluation and optimization procedure may be based on information about the location of the gws in the network topology . one possibility is to use a topology database 20232 in the mme 2023 specifying the position of all gws ( including their ip addresses ) relative to the different cells . a simpler solution is that the obtainer 20235 of the mme 2023 obtains the would - be optimal sgw for the given ue by initiating the same process as for a sgw reallocation , but without the performer 20237 effectively performing the reallocation , just performing the selection phase . note that performing the standard dns procedure as described in 3gpp ts 29 . 303 v8 . 2 . 0 would typically not yield enough information to select the most optimal sgw . moreover , assuming that the sgw selection process in the mme 2023 may combine a number of “ soft ” selection criteria when evaluating ( by evaluator 20236 ) the candidate gws 2026 ( i . e ., not only the placement in the topology , but also other information like load information , qos requirement , combined node etc . ), all information available in the mme may be reused in the evaluation procedure . a specific case that should be mentioned is the evaluation of sgws for traffic off - load purposes . methods for selected ip traffic off - load from the mobile network close to the attachment point ( i . e ., typically below configured pgws in the network ) are currently under standardization ). an appropriate node where the off - load function may be placed or connected with is the sgw , because it has : bearer information . support for mobility below the sgw . support for i - rat handovers . charging support . etc . it is , however , not likely that all sgws in a network would connect to such a traffic off - load function . one possible solution for sgw selection is to configure ( by configurator 202322 of the mme 2023 ) the traffic off - load capability of the sgws either directly in the mme or in the dns together with the traffic policy on which off - load applies . the sgw evaluation process would then take also this information into account in selecting a proper sgw for a given bearer or pdn connection . note that such optimization may be very efficient not only during attach , but e . g ., also during subscriber mobility . also , closing pdn connections or bearers may make off - load capability no longer necessary , thus allowing for the selection of a more optimal sgw on the transport path . regarding sgw relocation for node off - load purposes , it should be noted that the purpose is to relocate already allocated users to other sgws 2026 in order to obtain a more optimal distribution of users , taking the above criteria and potential desired benefits into account . such re - location decisions may be made proactively , relocating a batch of subscribers in order to free capacity for coming subscribers which may be more optimal to allocate to the concerned sgw . more likely , however , the relocation decisions would be made on a case - by - case basis , i . e . when a user is to be allocated to a gw , the mme 2023 may consider whether it would be beneficial to relocate another user in order to make the required capacity available for the new user . note that special care should be taken when relocating sgws with off - load capability ( sipto , selected ip traffic offload ) due to the fact that on - going flows cannot be relocated to a new sgw ( the traffic off - load function acts as a local anchor for the off - loaded flows e . g ., through network address translating ( nat - ting ) the flows to the external network ). therefore , in the cases when it is suspected that a part of the subscriber traffic is off - loaded through the given sgw 2025 , special care should be taken not to reallocate the sgw until all these flows are completed . this may be done in the simplest way , as suggested in fig8 g , by waiting ( by the timer 202311 ) until the given ue 201 becomes idle . at the beginning , it is to be noted that the fourth embodiment is closely related to the third embodiment . in other words , the fourth embodiment may be considered as the tenth and eleventh example of the third embodiment . fig9 a and 9b show a fourth embodiment of an apparatus 2023 ( as an example , mme or sgsn ) for relocating an sgw 2025 associated to the ue 201 . fig9 a illustrates the components comprised in the apparatus 2023 ( and optionally , the ue 201 , the enb 2021 , the source sgw 2025 and the target sgw 2026 ), and fig9 b shows the interaction between the components shown in fig9 a . as shown in fig9 a , the apparatus 2023 , the ue 201 , the enb 2021 , the source sgw 2025 and the target sgw 2026 each comprise an own core functionality 20 x 1 ( wherein x = 1 , 21 , 23 , 25 or 26 ), a memory ( and / or database ) 20 x 2 , a ( n optional ) transmitter 20 x 3 and a ( n optional ) receiver 20 x 4 . in turn , the apparatus 2023 comprises the obtainer 20235 , the evaluator 20236 , the performer 20237 and an optional notifier 202323 , and the source sgw 2025 comprises an optional forwarder 202524 . as indicated by the dashed extensions of the functional blocks of the cpus 20 x 1 ( wherein x = 1 , 21 , 23 , 25 or 26 ), the evaluator 20236 , the performer 20237 and the notifier 202323 ( of the apparatus 2023 ) and the forwarder 202524 ( of the source sgw 2025 ), as well as the memory 20 x 2 , the transmitter 20 x 3 and the receiver 20 x 4 may at least partially be functionalities running on the cpus 20 x 1 , or may alternatively be separate functional entities or means controlled by the cpu 20 x 1 and supplying the same with information . the cpus 20 x 1 may be configured , for example by software residing in the memories 20 x 2 , to process various data inputs and to control the functions of the memory 20 x 2 , the transmitter 20 x 3 and the receiver 20 x 4 ( as well as the evaluator 20236 , the performer 20237 and the notifier 202323 ( of the apparatus 2023 ) and the forwarder 202524 ( of the source sgw 2025 )). the memory 20 x 2 may serve for storing code means for carrying out the methods according to the aspects disclosed herein , when run on the cpu 20 x 1 . it is to be noted that the transmitter 20 x 3 and the receiver 20 x 4 may alternatively be provided as an integral transceiver , as is shown in fig9 a . it is further to be noted that the transmitters / receivers may be implemented in the forms described in the first embodiment . at least one of the above - described evaluator 20236 , performer 20237 and notifier 202323 ( of the apparatus 2023 ) and forwarder 202524 ( of the source sgw 2025 ) as well as the apparatus 2023 or source sgw 2025 itself , or the respective functionalities carried out , may also be implemented as a chipset , module or subassembly . for the purpose of the tenth example , note that the functionalities are shown in fig8 e and 8f . for the case of an enterprise network with local ip access feature , the following trigger conditions can be applied for the use of the new serving gw relocation procedure . when the activator 20119 of the ue 201 ( see fig8 e ) successfully activates a local connection and the sgw is not in the enterprise local gw ( the apparatus 2023 may detect this via detector 20238 ), the trigger 202320 of the mme / sgsn 2023 triggers the relocation of the sgw into the local gw in the enterprise network . when the deactivator 20121 of the ue 201 ( see fig8 e ) deactivates ( all of the ) local connections ( the apparatus 2023 may detect this via detector 20238 ), the sgw role can be relocated from the local gw to the operator &# 39 ; s gw . this condition is optional , and improves signalling load if mobility into / out of the enterprise network is more frequent than the setup / release of a local connection ; or this can be used to decrease the load on the local gw . additionally , when moving into the enterprise network , regular sgw relocation to the local gw needs to be performed ( by performer 20237 ) in case the ue 201 has a local connection ( i . e ., an originally remote connection to the local gw becomes local ). when moving out of the enterprise network and the sgw was local , regular sgw relocation is performed ( by performer 20237 ) to the operator sgw . the conditions above require that the mme / sgsn 2023 actually knows when the ue 201 enters or leaves the enterprise network . that is fulfilled in connected mode , and also in idle mode if the enterprise network uses a separate ra / ta that is unique to the enterprise . additionally in lte , it is necessary not to use the ta list feature between the enterprise ta and the surrounding ta . if these conditions are not met in idle mode due to operator network configuration with the aim of reducing the ta / ra signalling , the mme / sgsn 2023 may not become aware when the ue 201 enters or leaves the enterprise network . in that case , the following solution can be used : each time the ue 201 becomes idle and the sgw 2025 is in the local enterprise gw , the sgw 2025 is relocated to the operator sgw 2026 . each time the ue becomes connected within the enterprise network and has a local connection , the sgw 2025 is relocated into the local gw 2026 . note that this implies that for a short duration packets on the local connection may pass via the operator sgw ; but this is not expected to cause any significant performance degradation . with the above conditions it is possible to avoid the tau / rau signalling ( based on operator configuration ) when the ue 201 enters or leaves the enterprise network . while this reduces tau / rau signalling for the ue 201 , it increases the amount of sgw relocation signalling in the network . the following optimization is for the case described in the previous section when tau / rau in idle mode cannot be guaranteed at the enterprise network border . this optimization reduces the number of sgw relocations . in this embodiment , the sgw 2025 is not relocated to the operator network when the ue 201 becomes idle in the enterprise network . instead , the following conditions apply : each time the ue 201 becomes connected within the enterprise network and has a local connection but the sgw 2025 is in the operator network , the sgw 2025 is relocated into the local gw 2026 . again , this implies that for a short duration packets on the local connection may pass via the operator sgw ; but this is not expected to cause any significant performance degradation . each time the ue 201 becomes connected outside the enterprise network but the sgw 2025 is in the enterprise local gw , the sgw 2025 is relocated into the operator sgw 2026 . note that this implies that for a short duration packets on the operator connection may pass via the local enterprise sgw . this may be acceptable as long as the operator network and the enterprise network are joined by a sufficiently high bandwidth and low delay connection , so that the short routing detour via the enterprise sgw does not significantly affect the performance of the operator connection . this variant may require a further mechanism : the local sgw must be able to accept s1 - u uplink packets on both its local enterprise ip address , and its operator - assigned ip address associated with its ip secure ( ipsec ) tunnel . the mme / sgsn 2023 may have to be able to use the local enterprise ip address in case the ue 201 is in the enterprise network , or the operator assigned ip address in case the ue 201 is outside the enterprise network . the local enterprise ip address is known to the mme 2023 as explicitly announced by the sgw 2025 on s11 / s4 and the operator assigned ip address may be known to the mme / sgsn 2023 as either being identical to the pgw is user plane address in case it is collocated with a pgw ; or be identical to the control plane sgw address which is the endpoint of the s11 / s4 signalling . as an alternative , it is possible to extend s11 / s4 to let the sgw explicitly inform the mme / sgsn 2023 about the two ip addresses , and possibly also about the two separate teids . note also that this approach additionally requires that the operator routing and firewall rules are such that the enterprise sgw is reachable by ( e ) nodebs 2021 outside the enterprise network which might not always be the case . also , this requires that a macro ran is upgraded to support the s1 / iu message defined for this procedure . the above approach might be applicable in cases when the sgw 2025 ( and possibly also the pgw ) is managed by the operator and is actually located in the operator network . that is , the operator uses a sgw 2025 close to the enterprise network , but still within the operator network . the pgw may also be in the operator network , and vpn tunneling can be used to forward traffic to / from the enterprise network . in that case , there is no need to deal with two sgw addresses , as only the operator address is used and there is no separate local address . yet another extension is to allow the sgw relocation procedure to take place during service request , which would further improve the flexibility of sgw relocations ( see fig9 c ): service request message is sent from ue 201 to mme 2023 ( and is received by the receiver 20233 ), and optional authentication may take place . the mme 2023 decides to relocate sgw 2025 based on the ue 201 current location and other information . the new sgw 2026 establishes context . new sgw 2026 notifies pgw 2027 about its new ip address and teid . new sgw 2026 acknowledges to mme 2023 and informs it about the new teids . context is established in the enb 2021 using the s1 - u termination of the new sgw 2026 . the old sgw 2025 is notified about the address and teid of the current enb 2021 , so that it can forward ( by the forwarder 202524 of the source sgw 2025 ) any buffered downlink data towards the enb 2021 . this is important for network initiated service request ( i . e ., paging ). if the service request is not network initiated , i . e . the mme has not received any downlink data notification from the old sgw 2025 , this step can be skipped . the new sgw 2026 is notified about the address and teid of the current enb 2021 . this step can be performed in parallel to step 13 . a similar procedure can be applied for 3g . note that the sgw relocation during the service request procedure may make the relocation longer . this is especially true for the roaming case as the signalling would involve a round - trip towards the home plmn ( hplmn ). hence it may be possible to limit the usage of this type of sgw relocation to non - roaming users . with the possibility of sgw relocation during service request , it becomes easier to allow deployments without ta / ra at the enterprise coverage border . the following conditions can be applied . each time a service request is performed outside the enterprise network and the sgw is in the enterprise network , it is relocated to the operator &# 39 ; s sgw . each time a service request is performed inside the enterprise network and the ue has a local connection , the sgw is relocated to the local sgw in the operator network . note that the above conditions are of course to be applied with those in the third embodiment with respect to connected mode mobility and activation / release of the local pdn connection . the present invention may require updates to the mme / sgsn 2023 to support the new procedures and the associated trigger conditions . in addition , the standalone sgw relocation procedure requires upgrading the ran nodes to support the new message . for enterprise local ip access , initially it is sufficient if the h ( e ) nodebs forming an enterprise network ( as well as the mme / sgsn 2023 ) are upgraded to support the new procedure . this allows running the new procedure within the enterprise network which is sufficient , except for the optimization in the third embodiment above which is not essential . in later phases , ( e ) nodebs in the macro ran may also be upgraded which expands the applicability of the new procedure . for transport optimizations , in case the ran does not support the necessary message in connected mode , it is possible to wait with the optimization until the terminal becomes idle . the proposed solution enables relocation of sgw 2025 , triggered by any event considered by the serving mme for other reasons than that the ue 201 has left the service area of its current sgw . this yields the following advantages : the user plane path is optimized for moving subscribers or change in the traffic conditions or pdn connectivity . the benefits of a combined sgw / pgw node are exploited . a certain sgw ( e . g ., for maintenance or load rebalancing ) or the mobile network below the ip point of presence ( also referred to as selected ip traffic offload or sipto ) is alleviated of load . allocated ues are moved from a sgw planned / scheduled to be taken down for o & amp ; m , service , or upgrade . for enterprise local ip access , with the help of the new standalone sgw relocation procedure , it is possible to limit the number of sgw relocation events , and limit them to the cases when it is actually necessary . this decreases the signalling load , and also the load on a given ( local ) sgw . this may also reduce the configuration complexity on mme / sgsn because it avoids the need to configure a priori which users may need sgw relocation later on . as a result of the more efficient handling of sgw relocations , it becomes possible to avoid alternative complex solutions for the enterprise local ip access case with standalone gw . in this way the solution helps reducing system complexity and avoids divergent architecture development paths that risk market fragmentation and interoperability issues . in addition , the present invention in view of ta / ra optimization , including the possibility of sgw relocation during service request further reduce the signalling impact in scenarios including enterprise networks . the extension of service request procedure with sgw relocation would make the relationship of ta lists and sgw service areas less coupled . to date , a ta list must be fully included in the sgw &# 39 ; s current service area ; that restriction could be lifted as we could perform sgw relocation when the ue becomes connected ( although that causes some extra delay ). it is believed that the advantages of the technique presented herein will be fully understood from the foregoing description , and it will be apparent that various changes may be made in the form , constructions and arrangement of the exemplary aspects thereof without departing from the scope of the invention or without sacrificing all of its advantageous effects . because the technique presented herein can be varied in many ways , it will be recognized that the invention should be limited only by the scope of the claims that follow . | 7 |
referring to fig1 , 2 , 3 and 4 , shown therein is but one embodiment of the method of the present invention . as shown in fig1 and 2 , the first step in the present invention is the securing of the file histories for a predetermined fire area to be analyzed . by way of example , we shall assume that the predetermined fire area is the santa monica mountains of southern california . the fire history data can be easily secured from the california state database on fire history and from other databases such as the california fire resource assessment program ( frap ). such data can be easily used individually or combined or layered by loading them into a wildfire simulation program such as arcmap to create individual fire histories and / or accumulated fire histories for a preselected time period ( i . e . a decade ) for the predetermined fire area for the 20th century . the data can then be selected by attributes and divided into data layer groups by decade and interactive functionality can be added to the database by utilizing visual basic for applications script in arcmap . this interactive functionality allows the fire history to be selected by a mouse click using a visual or graphical interface on a display of a smartphone , desktop computer , laptop , tablet computer , netbook , notebook , etc . and once a wildfire is selected , a visual preconfigured attribute table can be displayed of the pertinent information relative to the selected wildfire . by displaying the pertinent information related to a selected wildfire , a user can easily identify the fire safety zones , locate and map water resources for air support and identify suitable locations to drop or place hand crews based upon the fire history data . in addition to the above , the wildfire history data can be analyzed to determine the significant parameters of wildfires , such as wind speed and direction , fuel type , fuel moisture , humidity levels , elevation , aspect , slope , fuel canopy , canopy height , crown base height , crown bulk density and fuel type . in addition and from this fire history data , preconfigured models can be developed and the behavior of such models can be stored in a memory and analyzed in advance . by way of example an analysis of the wildfire histories in the santa monica mountains resulted in that the wind contributes to fires over 1000 acres in one of four ways ( 1 ) santa anna winds over 30 mile per hour at 30 degrees on a 360 degree compass course , ( 2 ) santa anna winds over 30 miles an hour at 0 degrees , ( 3 ) santa anna winds over 30 mile per hour at 1 to 15 degrees or 345 degrees compass course , and winds that do not sustain a given wind direction due to low or mixed wind direction . in addition , it was determined that the relative humidity was most likely less than 10 % in almost all case and the terrain and fuel was substantially unchanged . utilizing this wind information and assumed relative humidity , terrain and fuel , a plurality of preconfigured models are created by doing the calculations in advanced . in this example , four separate models are generated for each of the wind speed and wind direction . these four models are created for the most significant modeling features , namely rate of spread , flame length and major fire paths . after the preconfigured models are created in the wildfire modeling programs such as flamemap , the data is then converted and exported to a program for processing geographical such as arcmap . the output of the program for processing geographical data is then outputted in a compatible file form , such as kml , and overlaid onto geographical map data which is secured from a mapping source such as google earth . it should be apparent that both 2d map and topographical map data can be utilized . for speed of operation and security , the geographical data which has been processed is stored in a memory associated with a processor or server and the geographical map data from a source such as google earth is further stored in the memory . the wildfire models and the wildfire histories are stored in the memory and through a visual or graphical interface a user can select a particular model and / or history to be displayed on the display . also , by means of the graphical or visual interface , weather data such as wind speed and direction can be manually or automatically entered form a source such as an internet website to further predict the movement of the wildfire and or select the appropriate historical data while the above embodiment has been described as being integrated into a single unit , it should be apparent that for ease of transport , efficiency and speed , the method of the present invention could be performed utilizing the internet or a server and memory of a cloud environment . in other words , the display and graphical interface for making the selection of the desired history and / or models can be provided in a single unit , such as a smartphone , to be used by the user and the remainder of the system and method could be provided at a processor and an associated memory a at remote location accessed via the internet and / or in a cloud environment . in any case , it should be apparent that the large data storage and high speed processors would be most efficiently provided or accessed via the internet or the cloud environment so as to maintain the speed and efficiency of the system and method . still further , the system could be accessed through the internet or in the cloud environment utilizing an application programming interface ( api ) which utilizes a username and password . accordingly , a user using a smartphone as the display and graphical interface could using a simple application ( app ) which allows the smartphone to operate as a terminal , access the api and view the fire histories and / or wildfire models . still further an additional advantage could be achieved utilizing a cloud environment in that the processing could be divided into several tasks such as rate of spread , flame length and major fire paths and the processing be done utilizing a plurality of servers and memories . an example of software which can be used as part of the present invention is set forth in source code as part of this application . it should be apparent to those skilled in the art that the above described embodiment represents but one of the many possible specific embodiments which could be created utilizing the principles and objects of the present invention . | 6 |
to enable a further understanding of the innovative and technological content of the invention herein , refer to the detailed description of the invention and the accompanying drawings below : in this embodiment , it provides a rehabilitation exercise device for the health care and physiotherapy of the human spine , comprising a soleplate 1 and an exercise mechanism disposed on the soleplate 1 . the soleplate further comprising a bottom and an antiskid cushion 11 attached to the bottom , which is capable of avoiding the displacement of the device when in use . the exercise mechanism , in this embodiment , does not need to be driven by a power supply ; instead , via a mechanical structure , it realizes movement by the collaboration between the movement of a person and the device . the rehabilitation exercise device may be regarded as an ordinary pillow or a gymnastic apparatus , with convenient operation and safer and more reliable use . in this embodiment , the exercise mechanism comprises a pillow 2 , a supporting base 3 with an arc - shape bottom surface and a sliding mechanism , wherein the sliding mechanism comprises a rectangular slider 4 , the slider 4 has a bottom and a limiting mechanism ( also known as limiter ) for limiting movement of the slider 4 , the bottom of the slider 4 is provided with a rolling assembly ( also known as roller ) which enables the sliding mechanism to slide in line on the soleplate ; the cross section of the supporting base 3 is semicircular , and the camber of the supporting base 3 faces the slider 4 . the supporting base 3 is capable of rocking on top of the slider 4 and moving horizontally and in line together with the slider 4 on the soleplate 1 ; a pillow 2 , with a curve top surface matching a natural physical curvature of human spine , mounted on the supporting base 3 ; and an elastic assembly ( also known as a bounder ) disposed between the pillow 2 and the supporting base 3 , which enables the pillow 2 to have a trend of bouncing upward all the time . in this embodiment , the pillow 2 has a curve top surface matching a natural physical curvature of human spine . the curvature of the curve top surface may be selected according to different exercise parts of the body and different stress . in this embodiment , the curve top surface of the pillow 2 is selected as a curve top surface special for cervical spine . in order to further make the users more comfortable , the pillow 2 further comprises an elastic cushion 21 . the supporting base 3 has two pin holes 31 , the slider 4 has two connecting holes 41 , each pin hole 31 matching a connecting hole 41 , and each pin 51 passing through one pin hole 31 and a corresponding connecting hole 41 for connecting the supporting base 3 to the slider 4 , each pin 51 has a head and is fitted with a first spring 52 with two ends , and the first spring 52 may enable the supporting base 3 to rock or to restore , one end of the first spring 52 presses against the head of the pin 51 and other end of the first spring 52 presses against inside of the pin hole 31 ; the first spring 52 enables the pin 51 to move upward and the pillow 2 to stay in a middle position without inclining when the rehabilitation exercise device is standing still . the elastic assembly disposed between the pillow 2 and the supporting base 3 comprises a spring seat 6 with a top and two second springs 61 , the top of the seat 6 is connected to the pillow 2 , wherein the bottom of the pillow 2 is provided with two bosses 22 and two elastic latches 23 , the top of the seat 6 is provided with two insert holes 62 capable of fastening the bosses 22 and two lock holes 63 capable of fastening the elastic latches 23 ; two stand columns 64 extending downwardly from the spring seat 6 , the supporting base 3 is further provided with at two cylindrical holes 32 for receiving the stand columns 64 , each cylindrical hole 32 further has a positioning column 321 . the second springs 61 ensure a proper stress onto the spine when a user is doing exercise , and each second spring 61 engages the stand column 64 and the positioning column 321 . two sides of the bottom of the slider 4 are provided with two grooves 42 , parallel to each other , for receiving the two ball seatings 7 , each ball seating 7 can move in line in the corresponding groove 42 , the ball seating 7 is provided with a plurality of linearly aligned pores 71 ( in this embodiment , the ball seating 7 is provided with five linearly aligned pores ), each pore enabling one ball to touch the soleplate 1 . in order to control the movement direction of the slider 4 on the soleplate 1 , baffles 43 extending downward are formed on two sides of the slider 4 . the distance between the two baffles 43 is rightly matched with the length of the soleplate 1 . when the slider 4 moves horizontally , the insides of the baffles 43 can be in rolling touch with the two side edges of the soleplate 1 in the length direction so as to achieve the guide effect . the limiting mechanism further comprises a stopping block 81 with a shaft hole and a sliding shaft 82 passing through the shaft hole 811 , the stopping block 81 is fixed on the soleplate 1 by screw ; and the middle part of the bottom of the slider 4 is provided with a limiting recess 44 , which is parallel to the groove 42 receiving the ball seating 7 , having two end walls for limiting the stopping block 81 when the slider slides on the soleplate , the stopping block 81 and a sliding shaft 82 are disposed within the limiting recess 44 ; in order to prolong the service life of the stopping block 81 , the limiting recess 44 further comprises two shockproof pads 83 for pressing against the stopping block 81 , the shockproof pads 83 may eliminate the shock generated during the horizontal movement of the slider 4 to the limit end , and also reduce collision noise , each shockproof pad disposed at one end wall of the limiting recess 44 , and each shockproof pad 83 has a positioning hole 831 for receiving the sliding shaft 82 ; the stopping block 81 further comprises a damping adjustment hole 812 is formed at a bottom of the stopping block 81 communicating with the shaft hole 811 , the soleplate 1 is provided with a through hole 12 , and a damper 84 is inserted through the through hole 12 and the damping adjustment hole 812 , the damper 84 can adjust the gap between the sliding shaft 82 and the shafting hole 811 , in order to control the speed and strength of the slider 4 during the horizontal movement , so as to adapt to users of different constitution . for convenient processing , the pillow 2 , the spring seat 6 , the supporting base 3 with semicircle bottom surface , the slider 4 and soleplate 1 in this embodiment are all formed by injection molding in one time , while the elastic cushion 21 disposed on the pillow 2 is formed by impact molding in one time . standard fasteners are preferably used as fasteners ( screws , etc .) between all components . in this embodiment , the curve top surface of the pillow 2 , matching a natural physical curvature of human spine , is mainly used for realizing the exercise of cervical spine . when in service , the rehabilitation exercise device is placed on a horizontal plane ; a person lies on his back with both lower limbs bent at 90 degrees and both feet spaced apart at an interval equal to the shoulders ; and the exercise device is placed below the neck , with the center of the cervical spine facing the center of the curved face of the pillow 2 . a new user is better to hold the two ends of the pillow 2 by both hands so as to assist the cervical spine to do horizontal movement back and forth on the camber . when the user lowers his head so that the shoulders go down , the pillow 2 moves upward ; and when the user raises his head so that the shoulders and the waist rise up , the pillow 2 moves downward . each back - and - forth movement of the pillow 2 is a period of exercise . for a new user , the number of the periods of exercise should be increased progressively from less to more , depending on individual difference , such as constitution . embodiment 2 , as shown in fig8 and fig9 , the difference between this embodiment and embodiment 1 is that , in this embodiment , the pillow has a curve top surface special for thoracolumbar spine , mainly for the exercise of thoracolumbar spine ; and the pillow 2 comprises an elastic cushion 21 , wherein the middle part of the curve top surface special for thoracolumbar spine is formed with an arc depression 24 matching spinel evagination . the arc depression 24 is soft and flexible , and the portion of the arc depression 24 is formed with an elastic bump 25 matching the depression in size , so that the outer surface of the elastic cushion 21 forms a block protruding outward . therefore , a user with thoracolumbar spine kyphosis may feel more conformable when doing exercise and the effect of rehabilitation by exercise may be ensured . when in service , the rehabilitation exercise device in this embodiment is placed on a horizontal plane , and a person lies on his back with both lower limbs bent at 90 degrees and both feet spaced apart at an interval equal to the shoulders . the specific massage method will be described as below : ( 1 ) exercise of lumbosacral spine : the rehabilitation exercise device is placed in the center of the waist corresponding to the navel , with the center of the spine facing the center of the pillow . when the jaw and the lower back rise up and the hip goes down , the pillow 2 moves upward ; and when the jaw and the lower back go down and the hip rises up , the pillow 2 moves downward . each back - and - forth movement of the pillow 2 is a period of exercise . for a new user , the number of periods of exercise should be increased progressively from less to more , depending on individual difference , such as constitution . ( 2 ) exercise of lower thoracic spine : the rehabilitation exercise device is placed under the back at three inches above the navel ( four transverse fingers ) corresponding to the stomach , with the center of the spine facing the center of the pillow 2 . when , the jaw and the shoulders rise up and the waist and the hip go down , the pillow 2 moves upward ; and when the jaw and the shoulders go down and the waist and the hip rise up , the pillow 2 moves downward . each back - and - forth movement of the pillow 2 is a period of exercise . for a new user , the number of periods of exercise should be increased progressively from less to more , depending on individual difference , such as constitution . ( 3 ) exercise of upper thoracic spine : the rehabilitation exercise device is placed under the chest - back taking the nipple as center , with the center of the thoracic spine facing the center of the pillow 2 . when the jaw and the shoulders rise up and the waist and the hip go down , the pillow 2 moves upward ; and when the jaw and the shoulders go down and the waist and the hip rise up , the pillow 2 moves downward . each back - and - forth movement of the pillow 2 is a period of exercise . for a new user , the number of periods of exercise should be increased progressively from less to more , depending on individual difference , such as constitution . | 0 |
the kit of this invention normally includes two types of flex adapters which allow various combinations of wrenches to be releasably fixed and pivoted with respect to one another continuously through angles from 0 ° to 90 ° in two directions for a total included angle of 180 °. one type of flex adapter has a pivoted retainer for fast removal of a tool . in the other flex adapter the retainer is non - pivoted so that a relatively permanent tool engagement is provided . both types of flex adapters include means for sliding adjustability of the tool held by the adapter . the kit also includes a simple and durable ratchet mechanism for use with a standard socket set . referring to fig1 there is shown a flex adapter coupled with a bar extender of the invention and a standard socket extender . a non - ratcheting bar extender 10 has a handle 12 with a convenional male socket engaging head 14 , having a spring - loaded detent ball 16 , secured to one end of the bar . a flat surface 18 may be provided at the socket end of the handle , if desired , so as to allow the handle to operate with a minimum of clearance . handle 12 is adapted to be disposed in channel 20 , three sides of which are defined by flex adapter base 22 . retainer 24 is secured to base 22 by means of two screws 26 which project through holes 28 in the retainer and engage threaded bores ( not shown ) in the base , thereby defining the fourth side of channel 20 . raised circular central portion 30 of retainer 24 fits within the similarly shaped countersunk confronting area 32 in flex adapter base 22 to form cooperating arcuate shoulders to insure correct alignment between base 22 and retainer 24 . set screw 34 is threadably engaged through centrally disposed threaded bore 36 in the retainer to adjustably and removably fix handle 12 into position . projecting from the end of base 22 opposite channel 20 is the clevis tongue 38 having a transverse threaded bore 40 therethrough . one end of flex adapter head 50 supports two arms 52 of a clevis yoke , each with a transverse non - threaded countersunk bore 56 therethrough . partially threaded pivot pin 54 is disposed through the respective clevis yoke and clevis tongue bores 56 and 40 to pivotally interconnect the flex adapter base 22 and head 50 and thereby form a clevis joint . alternatively , pin 54 may be threaded throughout its length and the clevis yoke bores 56 may be oversized to permit a clearance fit between the pin 54 and the yoke bores 56 . snap - ring 58 engages annular recess 60 disposed in the end of pivot pin 54 opposite the head 54 to hold the pin in position in adapter head 50 . a tool receiving depression or slot 62 is provided in the head of pin 54 so that it may readily be tightened or loosened . when partially threaded pin 54 is tightened and engages the threads of clevis tongue bore 40 , flex adapter base 22 is frictionally engaged and angularly secured to one arm 52 of the clevis yoke . that portion of pivot pin 54 between annular recess 60 and the threads thereon has a length equivalent to the thickness of yoke arm 52 through which it passes , while the threads on said pin do not extend beyond the threaded bore in clevis tongue 38 when in fully tightened position . the other end of flex adapter head 50 contains socket 64 . standard socket extender 70 , which is a double male adapter , having a socket engaging head 72 at each end each having a spring - loaded detent ball 74 , may be disposed in socket 64 . of course , socket 64 may receive any standard socket tool having similar engaging heads . thus , the flex adapter of the present invention permits open - end and box - end wrenches or bar extenders mounted in the base 22 to be disposed at any relative angle of alignment continuously through a total angle of approximately 180 ° with respect to socket wrenches mounted in head 50 , to provide a variety of specially adapted obstruction by - pass tools . note that slidable adjustments of bar extender 10 in slot 20 is permitted by loosening set screw 34 . referring now to fig2 there is shown a somewhat different flex adapter having a retainer 80 which is pivotally secured to flex adapter base 82 by means of screw 84 disposed through hole 86 in the retainer into threaded bore 88 in the base . pivoted retainer 80 has an offset slot 90 for receiving a knurled bolt 92 which threadably engages bore 94 in base 82 . raised flange 96 is centrally disposed on retainer 80 and has a centrally disposed threaded bore 98 into which set screw 100 is threaded to secure the handle of a bar extender , a box - end or an open - end wrench ( not shown ) into channel 102 in base 82 . the wrench may be easily removed by loosening knurled nut 92 , pivoting retainer 80 out of the way and removing the wrench handle from channel 102 in base 82 . the corner 104 of base 82 is configured to allow the retainer to be pivoted without fully removing set screw 100 , that is , permitting it to project slightly into channel 102 , thereby providing for fast removal of the wrench . note that slot 90 in retainer 80 has a round termination 91 which is not tangent to the flat side of the slot . this is an alternative embodiment , where the flat side of slot 90 adjacent termination 91 abuts bolt 92 when the retainer is pivoted to the closed position . a small amount of force permits the retainer to snap into place with termination 91 closely engaging the stem of bolt 92 , thereby providing a positive seat for the retainer . base 82 is pivotally coupled to adapter head 50 in the same manner as in the embodiment of fig1 and like parts have like reference numerals . the ends of screws 26 , set screw 34 and pin 54 of fig1 and screw 84 , set screw 100 and pin 54 of fig2 may be formed to receive an allen wrench , a blade or a phillips head screwdriver , as well as other types of tools as desired . referring now to fig3 there is shown ratchet 150 including handle 152 , body 154 and wheel 156 . handle 152 is configured to pivot about one end 160 by means of offset transverse pivot bore 162 . the handle may pivot only through a limited angle as determined by stop tang 164 , the operation of which will be described hereinbelow . ratchet handle 152 is also formed with a downwardly disposed , tapered ratchet engaging tooth 158 . ratchet body 154 has a generally cylindrical base 170 with an axial bore 172 therethrough . generally cylindrical cap 174 is integrally disposed on and axially aligned with base 170 . channel 180 through cap 174 along a cap diameter is adapted to receive handle 152 . pin 176 engages pivot bore 162 of handle 152 through transverse hole 178 in cap 174 . the cap outside diameter is somewhat less than the base outside diameter so as to form an annular shoulder 175 providing a surface upon which stop tang 164 bears . cap channel 180 communicates with axial bore 172 through an opening 181 in the base of cap 174 radially spaced from the axis of body 154 , terminating at the inner cylindrical surface of base 170 . tooth 158 normally projects into opening 181 and further into the axial bore 172 when handle 152 is in the lower or engaged position . the remainder of the channel 180 is separated from axial bore 172 by platform 182 . platform 182 has a countersunk bore 184 coaxial with the axial bore 172 . ratchet wheel 156 is formed with a plurality of radial notches 190 , while a socket engaging head 194 depends axially from the center of the ratchet wheel . spring - loaded detent ball 196 is disposed on socket head 194 to facilitate the engagement of a standard socket ( not shown ) or with socket 64 in the flex adapter of fig1 . axial bore 198 passes through ratchet wheel 156 and socket head 194 terminating at the lower end of the socket head in a tapered countersunk opening 200 . fastener pin 202 passes into contoured entrance 200 , through axial bore 198 and through countersunk bore 184 in the platform 182 . c - ring 185 engages annular groove 203 on pin 202 to retain ratchet wheel 156 in rotatable engagement with ratchet body 154 . the end of fastener 202 extends into countersunk bore 184 but not into channel 180 so the fastener does not interfere with the ratchet handle 152 disposed in channel 180 . when handle 152 is pivoted downwardly , tooth 158 depends through opening 181 into axial bore 172 so as to engage one of the notches 190 of ratchet wheel 156 . handle 152 is then rotated about the axis of ratchet body 154 so as to turn the entire assembly , thereby rotating a tool wrench ( not shown ) which may be engaged by head 194 . handle 152 may then be pivoted upward about pivot pin 176 so that tooth 158 disengages the first notch 190 on wheel 156 . handle 152 and base 154 may then be rotated with respect to ratchet wheel 156 back to a starting position where tooth 158 may be pivoted back into engagement with a second notch 190 . this procedure may be repeated until the engaged fastener is completely loosened or tightened . it will be readily appreciated that this ratchet is reversible without the need for any ratchet switching mechanism . referring now to fig4 there is shown an alternative embodiment of the ratchet of the present invention , including handle 352 , body 354 and wheel 356 . handle 352 is formed as a bar having a transverse pivot bore 362 near one end and a downwardly disposed tapered ratchet engaging tooth 358 spaced from pivot bore 362 . ratchet body 354 is formed with a generally cylindrical body 370 having an axial recess 372 in one end thereof . the inside cylindrical surface of the recess has a snap - ring retaining groove 374 . on the other end or top of the ratchet body there are disposed two pivot support posts 376 placed near the circumference of the ratchet body aligned in parallel and offset from a diameter of the cylindrical ratchet body . each post 376 has a transverse bore 378 therethrough . a pivot pin 382 extends through both bores 378 in posts 376 . a radially aligned slot 380 is disposed through the top of the ratchet body along a diameter which passes between the posts 376 and the slot communicates with axial recess 372 . slot 380 extends from a point near the axis of the top portion of body 354 to the periphery thereof but extends only to the wall of the body defining recess 372 at the interface between the slot and the recess . tooth 358 is disposed in slot 380 . ratchet wheel 356 has a generally flat cylindrical configuration with a diameter slightly less than the diameter of axial recess 372 and has a plurality of radially extending beveled channels 390 extending partway therethrough , each channel having a curved floor 392 . a socket engaging head 394 depends axially from the center of the ratchet wheel 356 on a side opposite from the channels 390 . spring - loaded detent ball 396 is disposed on socket head 394 for normal engagement of a socket wrench ( not shown ). snap - ring 398 , having an inside diameter less than the outside diameter of the ratchet wheel , cooperates with snap - ring support groove 374 on the inside of axial recess 372 to retain ratchet wheel 356 inside recess 372 and to permit said ratchet wheel to freely rotate inside the recess . in operation , handle 352 is pivotally mounted to ratchet body 354 by means of pin 382 between pivot posts 376 . this alternative embodiment of the ratchet works the same way as the embodiment shown in fig3 with tooth 358 selectably engaging one of the channels 390 in the ratchet wheel . it will be appreciated that this alternative embodiment does not contain the specific stop tang 164 of fig3 but merely employs that portion of the handle 352 which extends beyond bore 362 to abut the top surface of the ratchet body to thereby permit only a limited pivoting of handle 352 about pin 382 . referring now to fig5 the elements of the tool kit of the present invention are shown in combination with standard socket wrenches , extenders and a standard open - end or box - end wrench . the standard tool elements are combined with the elements of the kit of this invention to fashion a special tool for by - passing obstruction 210 to reach relatively inaccesible fastener 218 . more particularly , conventional torque wrench 212 is shown in engagement with flex adapter head 50 of the present invention axially aligned with flex adapter base 22 which engages bar extender 10 by means of non - pivoting retainer 24 of the present invenion . standard socket extension 214 engages head 14 of bar extender handle 12 on one end and another flex adapter head 50 on the other . pivoted retainer flex adapter base 82 is secured to head 50 in accordance with the clevis joint of the present invention as previously described . one end of standard box - end wrench is disposed in flex adapter base 82 and the other end is disposed about the head of fastener 218 mounted in work piece 220 . referring now to fig6 there is shown in fig6 a , a bar extender 10 disposed in the base of a flex adapter of the present invention , and a standard socket wrench element 214 disposed in the head at an angle with respect to extender 10 . fig6 b shows a standard socket extension 214 engaged with the head of a flex adapter of the present invention and a standard box - end wrench disposed in parallel offset relationship . fig6 c shows a standard socket extension 214 engaging the head of the flex adapter of the present invention and a bar extender engaging a standard socket wrench disposed in the base , again in parallel offset relationship . the special obstruction by - pass tools shown in fig5 a , 6b and 6c are intended to be only illustrations of some ways of using the elements of the kit of the present invention to fashion specific obstruction by - pass tools . it is , of course , understood that the elements of the kit of the present invention may be used in combination with the elements of standard socket , open - end and box - end wrench sets to fashion almost an unlimited combination of special tools . it will be appreciated that the present invention adds versatility to the tool kit of the user resulting in a substantial savings of expenditures for the purchase of specially designed single - purpose tools and requiring substantially less space as compared with a plurality of such special tools . in view of the above description , it is likely that modifications and improvements will occur to those skilled in this art which are within the scope of this invention . | 1 |
applicants specifically incorporate the entire content of all cited references in this disclosure . further , when an amount , concentration , or other value or parameter is given as either a range , preferred range , or a list of upper preferable values and lower preferable values , this is to be understood as specifically disclosing all ranges formed from any pair of any upper range limit or preferred value and any lower range limit or preferred value , regardless of whether ranges are separately disclosed . where a range of numerical values is recited herein , unless otherwise stated , the range is intended to include the endpoints thereof , and all integers and fractions within the range . it is not intended that the scope of the invention be limited to the specific values recited when defining a range . in the context of this disclosure , a number of terms shall be utilized . “ ghrelin ” as used herein is a polypeptide having the amino acid sequence as set forth in genbank ® accession no . np — 057446 or swiss - prot identifier ghrl_human . ghrelin preprotein has 117 amino acids . this preprotein undergoes the following post - translational processing . the signal peptide ( amino acids 1 - 23 ) is removed and the remaining 94 amino acids are cleaved by a protease to provide a mature 28 amino acid ghrelin ( amino acids 24 - 51 ) or a mature 27 amino acid ghrelin ( amino acids 24 - 50 ) and a mature 23 amino acid obestatin ( amino acids 76 - 98 ). the 27 or 28 amino acid mature ghrelin peptides can be further modified at the serine at position 26 in the preprotein by either an o - octanoyl group or an o - decanoyl group . the obestatin mature peptide can be further modified at the lysine at position 98 of the preprotein by an amide group . an additional ghrelin preprotein is known , which lacks the glutamine at position 37 of the preprotein . “ ghrelin splice variant ” is a polypeptide having the amino acid sequence as set forth in seq id no : 1 or any peptide of 15 amino acids or more from seq id no : 1 with or without post translational modification , or any seq id no : 1 homologs as set forth in seq id no : 5 or seq id no : 6 , and / or any peptide of 15 amino acids or more from seq id no : 5 or seq id no : 6 with or without post translational modification . in a preferred embodiment , the ghrelin splice variant is at least 29 amino acids in length . “ ghrelin splice variant - like compound ” as used herein refers to any compound which mimics the function of ghrelin splice variant , in particular human ghrelin splice variant , particularly in terms of the ghrelin splice variant functions leading to the desired therapeutic effects described herein , such as stimulation of appetite and / or treatment and / or prophylaxis of cachexia and is defined by the formula i : z1 -( x1 ) m -( x2 )-( x3 ) n - z2 , wherein z1 is an optionally present protecting group ; each x1 is independently selected from a naturally occurring amino acid and a synthetic amino acid ; x2 is selected from a naturally occurring amino acid and a synthetic amino acid , said amino acid being modified with a bulky hydrophobic group ; each x3 is independently selected from a naturally occurring amino acid and a synthetic amino acid , wherein one or more of x1 and x3 optionally may be modified with a bulky hydrophobic group ; z2 is an optionally present protecting group ; m is an integer in the range of from 1 - 10 ; n is an integer in the range of from 4 - 92 ; provided that the compound according to formula z1 -( x1 ) m -( x2 )-( x3 ) n - z2 is 15 - 94 amino acids in length and has at least 80 % ( or , in alternative embodiments , 85 %, 90 %, 93 %, 95 %, 97 %, 98 %, 99 %, 100 %) homology to seq id no : 1 ( see co - owned , co - pending u . s . patent application ser . no . 11 / 716 , 137 , entitled “ use of ghrelin splice variant for treating cachexia and / or anorexia and / or anorexia - cachexia and / or malnutrition and / or lipodystrophy and / or muscle wasting and / or appetite - stimulation ”, filed mar . 9 , 2007 , incorporated herein by reference ). in a preferred embodiment , the ghrelin splice variant - like compound is at least 29 amino acids in length . ghrelin splice variant - like compounds can be produced using techniques well known in the art . for example , a polypeptide region of a ghrelin splice variant - like compound can be chemically or biochemical synthesized and modified . techniques for chemical synthesis of polypeptides are well known in the art ( see , e . g ., lee v . h . l . in “ peptide and protein drug delivery ”, new york , n . y ., m . dekker , 1990 ). examples of techniques for biochemical synthesis involving the introduction of a nucleic acid into a cell and expression of nucleic acids are provided in ausubel f . m . et al ., “ current protocols in molecular biology ”, john wiley , 1987 - 1998 , and sambrook j . et al ., “ molecular cloning , a laboratory manual ”, 2d edition , cold spring harbor laboratory press , 1989 , each of which is incorporated herein by reference . another exemplary technique , described in u . s . pat . no . 5 , 304 , 489 , incorporated herein by reference , is the use of a transgenic mammals having mammary gland - targeted mutations which result in the production and secretion of synthesized ghrelin splice variant - like compound in the milk of the transgenic mammal . while it is possible for the compounds or salts of the present disclosure to be administered as the raw chemical , it is preferred to present them in the form of a pharmaceutical composition . another embodiment relates to a pharmaceutical composition comprising a mixture of at least two different ghrelin splice variant - like compounds , such as a mixture of a ghrelin splice variant - like compound acylated with a c 8 acyl and a ghrelin splice variant - like compound acylated with a c 10 acyl . without being bound by theory , it is believed that such a mixture will have a longer half - life in plasma . in yet another embodiment , the pharmaceutical composition comprises acylated ghrelin splice variant - like compounds , optionally compounds having different acyl chain lengths preferably selected from the group consisting of c 7 acyl group , c 9 acyl group , and c 11 acyl group , optionally in combination with a desacylated ghrelin splice variant - like compound . another aspect relates to a pharmaceutical composition comprising any ghrelin splice variant - like compound as defined above or a pharmaceutically acceptable salt thereof and pharmaceutical acceptable carriers , vehicles and / or excipients ; said composition further comprising transport molecules . the transport molecules are primarily added in order to increase the half - life of the acylated compound , preventing premature des - acylation , since the des - acylated ghrelin splice variant might not be active at the ghs - r 1a . transport molecules act by having incorporated into or anchored to it a compound disclosed herein . any suitable transport molecule known to the skilled person may be used such as , for example , liposomes , micelles , and / or microspheres . conventional liposomes are typically composed of phospholipids ( neutral or negatively charged ) and / or cholesterol . the liposomes are vesicular structures based on lipid bilayer surrounding aqueous compartments . they can vary in their physio - chemical properties such as size , lipid composition , surface charge and number , and fluidity of the phospholipids bilayer . the most frequently used lipids for liposome formation are : 1 , 2 - dilauroyl - sn - glycero - 3 - phosphocholine ( dlpc ), dimyristoyl - sn - glycero - 3 - phosphocholine ( dmpc ), 1 , 2 - dipalmitoyl - sn - glycero - 3 - phosphocholine ( dppc ), 1 , 2 - distearoyl - sn - glycero - 3 - phosphocholine ( dspc ), dioleoyl - sn - glycero - 3 - phosphocholine ( dopc ), 1 , 2 - dimyristoyl - sn - glycero - 3 - phosphoethanolamine ( dmpe ), 1 , 2 - dipaimitoyl - sn - glycero - 3 - phosphoethanolamine ( dppe ), 1 , 2 - dioleoyl - sn - glycero - 3 - phosphoethanolamine ( dope ), 1 , 2 - dimyristoyl - sn - glycero - 3 - phosphate ( monosodium salt ) ( dmpa ), 1 , 2 - dipalmitoyl - sn - glycero - 3 - phosphate ( monosodium salt ) ( dppa ), 1 , 2 - dioleoyl - sn - glycero - 3 - phosphate ( monosodium salt ) ( dopa ), 1 , 2 - dimyristoyl - sn - glycero - 3 -[ phospho - rac -( 1 - glycerol )] ( sodium salt ) ( dmpg ), 1 , 2 - dipalmitoyl - sn - glycero - 3 -[ phospho - rac -( 1 - glycerol )) ( sodium salt ) ( dppg ), 1 , 2 - dioleoyl - sn - glycero - 3 -[ phospho - rac -( 1 - glycerol )] ( sodium salt ) ( dopg ), 1 , 2 - dimyristoyl - sn - glycero - 3 -[ phospho - l - serine ] ( sodium salt ) ( dmps ), 1 , 2 - dipalmitoyl - sn - glycero - 3 -( phospho - l - serine ] ( sodium salt ) ( dpps ), 1 , 2 - dioleoyl - sn - glycero - 3 -[ phospho - l - serine ] ( sodium salt ) ( dops ), 1 , 2 - dioleoyl - sn - glycero - 3 - phosphoethanolamine - n -( glutaryl ) ( sodium salt ) and 1 , 1 ′, 2 , 2 ′- tetramyristoyl cardiolipin ( ammonium salt ). formulations composed of dppc in combination with other lipid or modifiers of liposomes are preferred , e . g ., in combination with cholesterol and / or phosphatidylcholine . long - circulating liposomes are characterized by their ability to extravasate at body sites where the permeability of the vascular wall is increased . a preferred way to produce long circulating liposomes is to attach hydrophilic polymer polyethylene glycol ( peg ) covalently to the outer surface of the liposome . some of the preferred lipids are : 1 , 2 - dipalmitoyl - sn - glycero - 3 - phosphoethanolamine - n -[ methoxy ( polyethylene glycol )- 2000 ] ( ammonium salt ), 1 , 2 - dipalmitoyl - sn - glycero - 3 - phosphoethanolamine - n -[ methoxy ( polyethylene glycol )- 5000 ] ( ammonium salt ), 1 , 2 - dioleoyl - 3 - trimethylammonium - propane ( chloride salt ) ( dotap ). possible lipids applicable for liposomes are supplied by avanti polar lipids , inc ., ( alabaster , ala .). additionally , the liposome suspension may include lipid - protective agents which protect lipids against free - radical and lipid - peroxidative damages on storage . lipophilic free - radical quenchers , such as alpha - tocopherol and water - soluble iron - specific chelators , such as ferrioxianine , are preferred . a variety of methods are available for preparing liposomes , as described in , e . g ., szoka f . & amp ; papahadjopolous d ., ann . rev . biophys . bioeng . 9 : 467 - 508 ( 1980 ); u . s . pat . nos . 4 , 235 , 871 , 4 , 501 , 728 and 4 , 837 , 028 ; all of which are incorporated herein by reference . another method produces multilamellar vesicles of heterogeneous sizes . in this method , the vesicle - forming lipids are dissolved in a suitable organic solvent or solvent system and dried under vacuum or an inert gas to form a thin lipid film . if desired , the film may be redissolved in a suitable solvent , such as tertiary butanol , and then lyophilized to form a more homogeneous lipid mixture which is in a more easily hydrated powder - like form . this film is covered with an aqueous solution of the targeted drug and the targeting component and allowed to hydrate , typically over a 15 - 60 minute period with agitation . the size distribution of the resulting multilamellar vesicles can be shifted toward smaller sizes by hydrating the lipids under more vigorous agitation conditions or by adding solubilizing detergents such as deoxycholate . micelles are formed by surfactants ( molecules that contain a hydrophobic portion and one or more ionic or otherwise strongly hydrophilic groups ) in aqueous solution . as the concentration of a solid surfactant increases , its monolayers adsorbed at the air / water or glass / water interface become so tightly packed that further occupancy requires excessive compression of the surfactant molecules already in the two monolayers . further increments in the amount of dissolved surfactant beyond that concentration cause amounts equivalent to the new molecules to aggregate into micelles . this process begins at a characteristic concentration called “ critical micelle concentration ”. the shape of micelles formed in dilute surfactant solutions is approximately spherical . the polar head groups of the surfactant molecules are arranged in an outer spherical shell whereas their hydrocarbon chains are oriented toward the center , forming a spherical core for the micelle . the hydrocarbon chains are randomly coiled and entangled and the micellar interior has a nonpolar , liquid - like character . in the micelles of polyoxyethylated nonionic detergents , the polyoxyethlene moieties are oriented outward and permeated by water . this arrangement is energetically favorable since the hydrophilic head groups are in contact with water and the hydrocarbon moieties are removed from the aqueous medium and partly shielded from contact with water by the polar head groups . the hydrocarbon tails of the surfactant molecules , located in the interior of the micelle , interact with one another by weak van der waals forces . the size of a micelle or its aggregation number is governed largely by geometric factors . the radius of the hydrocarbon core cannot exceed the length of the extended hydrocarbon chain of the surfactant molecule . therefore , increasing the chain length or ascending homologous series increases the aggregation number of spherical micelles . if the surfactant concentration is increased beyond a few percent and if electrolytes are added ( in the case of ionic surfactants ) or the temperature is raised ( in the case of nonionic surfactants ), the micelles increase in size . under these conditions , the micelles are too large to remain spherical and become ellipsoidal , cylindrical or finally lamellar in shape . common surfactants well known to one of skill in the art can be used in the micelles of the present disclosure . suitable surfactants include sodium laureate , sodium oleate , sodium lauryl sulfate , octaoxyethylene glycol monododecyl ether , octoxynol 9 and pluronic ® f - 127 ( basf corp ., florham park , n . j .). preferred surfactants are nonionic polyoxyethylene and polyoxypropylene detergents compatible with intravenous injection such as , tween ®- 80 , pluronic ® f - 68 , n - octyl - beta - d - glucopyranoside , and the like . in addition , phospholipids , such as those described for use in the production of liposomes , may also be used for micelle formation . in another preferred embodiment , the compounds disclosed herein are formulated as described in the literature for an administration route selected from : buccal delivery , sublingual delivery , transdermal delivery , inhalation and needle - free injection , such as using the methods developed by powderjet . for inhalation , the compounds disclosed herein can be formulated using methods known to those skilled in the art , for example an aerosol , dry powder or solubilized such as in microdroplets , preferably in a device intended for such delivery ( such as commercially available from aradigm corp . ( hayward , calif . ), alkermes , inc . ( cambridge , mass . ), or nektar therapeutics ( san carlos , calif .)). suitable dosing regimens for the various compounds and methods of the present disclosure are preferably determined taking into account factors well known in the art including , e . g ., type of subject being dosed ; age , weight , sex and medical condition of the subject ; the route of administration ; the renal and hepatic function of the subject ; the desired effect ; and the particular compound employed . preferably , the composition will comprise about 0 . 5 % to 75 % by weight of a secretagogue disclosed herein , with the remainder consisting of suitable pharmaceutical excipients . optimal precision in achieving concentrations of drug within the range that yields efficacy without toxicity requires a regimen based on the kinetics of the drug &# 39 ; s availability to target sites . this involves a consideration of the distribution , equilibrium , and elimination of a drug . as described above , in one aspect , the ghrelin splice variant or a ghrelin splice variant - like compound is administered subcutaneously . in another aspect , the ghrelin splice variant or a ghrelin splice variant - like compound is administered as a premeal bolus , wherein the administration form may be any suitable parenteral form . in a preferred embodiment , the ghrelin splice variant or a ghrelin splice variant - like compound is administered subcutaneously in a premeal bolus . the ghrelin splice variant or a ghrelin splice variant - like compound can also be administered during a meal as a bolus . the mode of administration during a meal includes subcutaneous administration , such as a subcutaneously administered bolus . pharmaceutical compositions for parenteral administration include sterile aqueous and non - aqueous injectable solutions , dispersions , suspensions or emulsions , as well as sterile powders to be reconstituted in sterile injectable solutions or dispersions prior to use . other suitable administration forms include suppositories , sprays , ointments , creams , gels , inhalants , dermal patches , implants , pills , tablets , lozenges and capsules . a typical dosage is in a concentration equivalent to from 10 ng to 10 mg ghrelin splice variant per kg bodyweight . the concentrations and amounts herein are given in equivalents of amount ghrelin splice variant , wherein the ghrelin splice variant is a 29 amino acid human ghrelin splice variant ( seq id no : 2 ) and / or a 22 amino acid human ghrelin splice variant ( seq id no : 3 ) and / or a 24 amino acid human ghrelin splice variant ( seq id no : 4 ). equivalents may be tested as described in the section entitled “ functionality ”, above . in a preferred embodiment , the medicament is administered in a concentration equivalent to from 0 . 1 μg to 1 mg ghrelin splice variant per kg bodyweight , such as from 0 . 5 μg to 0 . 5 mg ghrelin splice variant per kg bodyweight , such as from 1 . 0 μg to 0 . 1 mg ghrelin splice variant per kg bodyweight , such as from 1 . 0 μg to 50 μg ghrelin splice variant per kg bodyweight , such as from 1 . 0 μg to 10 μg ghrelin splice variant per kg bodyweight . as described above , the ghrelin splice variant or a ghrelin splice variant - like compound is preferably administered as a bolus . accordingly , in one embodiment the medicament is administered as a bolus prior to a meal , said bolus comprising an amount of the ghrelin splice variant or ghrelin splice variant - like compound or a salt thereof equivalent to from 0 . 3 μg to 600 mg ghrelin splice variant . more preferably , the medicament is administered as a bolus prior to a meal , said bolus comprising an amount of the ghrelin splice variant or ghrelin splice variant - like compound or a salt thereof equivalent to from 2 . 0 μg to 200 mg ghrelin splice variant , such as from 5 . 0 μg to 100 mg ghrelin splice variant , such as from 10 μg to 50 mg ghrelin splice variant , such as from 10 μg to 5 mg ghrelin splice variant , such as from 10 μg to 1 . 0 mg ghrelin splice variant . it should be noted that the normal ghrelin splice variant - like response which occurs before a meal is a short - lived surge in plasma concentrations of ghrelin splice variant and that , due to the relatively short half life of the peptide , an intravenous injection of ghrelin splice variant will ensure that a similar short - lived peak on ghrelin splice variant concentrations can be obtained . the administration route must ensure that the non - degraded , bioactive form of the peptide will be the dominating form in the circulation , which will reach and stimulate the ghrelin splice variant receptors . thus , in order to obtain the maximum effect of the medicament , it is preferably administered from one to three times daily , each administration being within 45 minutes of a meal , such as within 30 minutes of a meal , such as within 25 minutes of a meal , such as within 20 minutes of a meal , such as within 15 minutes of a meal , such as within 10 minutes of a meal , such as within 5 minutes of a meal . more preferably , the medicament is administered prior to each main meal , such as administered three times daily . compounds disclosed herein may also be formulated for nasal administration . the solutions or suspensions are applied directly to the nasal cavity by conventional means , for example with a dropper , pipette or spray . the compositions may be provided in a single or multidose form . in the latter case of a dropper or pipette , this may be achieved by the patient administering an appropriate , predetermined volume of the solution or suspension . in the case of a spray , this may be achieved for example by means of a metering atomizing spray pump . the compounds disclosed herein may be formulated for aerosol administration , particularly to the respiratory tract and including intranasal administration . the compound will generally have a small particle size , for example of the order of 5 microns or less . such a particle size may be obtained by means known in the art , for example by micronization . the active ingredient is provided in a pressurized pack with a suitable propellant such as a hydrofluoroalkane ( hfa ) for example hydrofluoroalkane - 134a and hydrofluoroalkane - 227 , carbon dioxide or other suitable gas . the aerosol may conveniently also contain a surfactant such as lecithin . the dose of drug may be controlled by a metered valve . alternatively , the active ingredients may be provided in a form of a dry powder , for example a powder mix of the compound in a suitable powder base such as lactose , starch , starch derivatives such as hydroxypropylmethyl cellulose and polyvinylpyrrolidine ( pvp ). the powder carrier will form a gel in the nasal cavity . the powder composition may be presented in unit dose form for example in capsules or cartridges of , e . g ., gelatin or blister packs from which the powder may be administered by means of an inhaler . compositions administered by aerosols may be prepared , for example , as solutions in saline , employing benzyl alcohol or other suitable preservatives , absorption promoters to enhance bioavailability , employing fluorocarbons , and / or employing other solubilizing or dispersing agents . compounds disclosed herein may also be formulated for administration by injection pen in a similar way as for cartridged growth hormone ( gh ) or insulin . the cartridge contains compounds disclosed herein in solvents . the pen , which is basically a needle , syringe and vial in one piece , is operated by a turning movement and allows different doses to be administrated . this device offers simplicity , convenience , and enhanced safety features for compounds delivery . it provides a simple device design , few administration steps and one - step dial - back dose knob . such injection pen can be obtained by means known in art . for example , several manufacturers offer drug developers injection pens to be used with the drug developers compounds ( bd — medical - pharmaceutical systems , inc . ; owen mumford inc . etc .). those compositions capable of remaining biologically active in an individual after oral administration ( such as , e . g ., small molecules and short peptides ) can be formulated in a wide range of oral administration dosage forms . the pharmaceutical compositions and dosage forms may comprise the compounds disclosed herein or their pharmaceutically acceptable salt or crystal forms thereof as the active component . the pharmaceutical acceptable carriers can be either solid or liquid . solid form preparations include powders , tablets , pills , capsules , cachets , suppositories , and dispersible granules . a solid carrier can be one or more substances which may also act as diluents , flavoring agents , solubilizers , lubricants , suspending agents , binders , preservatives , wetting agents , tablet disintegrating agents , or an encapsulating material . for oral administration , such excipients include , e . g ., pharmaceutical grades of mannitol , lactose , starch , magnesium stearate , sodium saccharine , talcum , cellulose , glucose , gelatin , sucrose , magnesium carbonate , and the like . in powders , the carrier is a finely divided solid which is a mixture with the finely divided active component . in tablets , the active component is mixed with the carrier having the necessary binding capacity in suitable proportions and compacted in the shape and size desired . the powders and tablets preferably containing from one to about seventy percent of the active compound . suitable carriers are magnesium carbonate , magnesium stearate , talc , sugar , lactose , pectin , dextrin , starch , gelatin , tragacanth , methylcellulose , sodium carboxymethylcellulose , a low melting wax , cocoa butter , and the like . the term “ preparation ” is intended to include a composition comprising an active compound disclosed herein with encapsulating material as carrier providing a capsule in which the active component , with or without carriers , is surrounded by a carrier , which is in association with it . similarly , cachets and lozenges are included . tablets , powders , capsules , pills , cachets , and lozenges can be as solid forms suitable for oral administration . drops may comprise sterile or nonsterile aqueous or oil solutions or suspensions , and may be prepared by dissolving the active ingredient in a suitable aqueous solution , optionally including a bactericidal and / or fungicidal agent and / or any other suitable preservative , and optionally including a surface active agent . the resulting solution may then be clarified by filtration , transferred to a suitable container which is then sealed and sterilized by autoclaving or maintaining at 98 - 100 ° c . for half an hour . alternatively , the solution may be sterilized by filtration and transferred to the container aseptically . examples of bactericidal and fungicidal agents suitable for inclusion in the drops are phenylmercuric nitrate or acetate ( 0 . 002 %), benzalkonium chloride ( 0 . 01 %) and chlorhexidine acetate ( 0 . 01 %). suitable solvents for the preparation of an oily solution include glycerol , diluted alcohol and propylene glycol . also included are solid form preparations which are intended to be converted , shortly before use , to liquid form preparations for oral administration . such liquid forms include solutions , suspensions , and emulsions . these preparations may contain , in addition to the active component , colorants , flavors , stabilizers , buffers , artificial and natural sweeteners , dispersants , thickeners , solubilizing agents , and the like . other forms suitable for oral administration include liquid form preparations including emulsions , syrups , elixirs , aqueous solutions , aqueous suspensions , toothpaste , gel dentifrice , chewing gum , or solid form preparations which are intended to be converted shortly before use to liquid form preparations . emulsions may be prepared in solutions in aqueous propylene glycol solutions or may contain emulsifying agents such as lecithin , sorbitan monooleate , or acacia . aqueous solutions can be prepared by dissolving the active component in water and adding suitable colorants , flavors , stabilizing and thickening agents . aqueous suspensions can be prepared by dispersing the finely divided active component in water with viscous material , such as natural or synthetic gums , resins , methylcellulose , sodium carboxymethylcellulose , and other well known suspending agents . solid form preparations include solutions , suspensions , and emulsions , and may contain , in addition to the active component , colorants , flavors , stabilizers , buffers , artificial and natural sweeteners , dispersants , thickeners , solubilizing agents , and the like . the compounds disclosed herein may be formulated for parenteral administration ( e . g ., by injection , for example bolus injection or continuous infusion ) and may be presented in unit dose form in ampules , pre - filled syringes , small volume infusion or in multi - dose containers with an added preservative . the compositions may take such forms as suspensions , solutions , or emulsions in oily or aqueous vehicles , for example solutions in aqueous polyethylene glycol . examples of oily or nonaqueous carriers , diluents , solvents or vehicles include propylene glycol , polyethylene glycol , vegetable oils ( e . g ., olive oil ), and injectable organic esters ( e . g ., ethyl oleate ), and may contain formulatory agents such as preserving , wetting , emulsifying or suspending , stabilizing and / or dispersing agents . alternatively , the active ingredient may be in powder form , obtained by aseptic isolation of sterile solid or by lyophilization from solution for constitution before use with a suitable vehicle , e . g ., sterile , pyrogen - free water . aqueous solutions should be suitably buffered if necessary , and the liquid diluent first rendered isotonic with sufficient saline or glucose . the aqueous solutions are particularly suitable for intravenous , intramuscular , subcutaneous and intraperitoneal administration . the sterile aqueous media employed are all readily available by standard techniques known to those skilled in the art . solutions of ghrelin splice variant or a ghrelin splice variant - like compound or pharmaceutical acceptable salt thereof ( and for example antigenic epitopes and protease inhibitors ) can be prepared in water or saline , and optionally mixed with a nontoxic surfactant . compositions for intravenous or intra - arterial administration may include sterile aqueous solutions that may also contain buffers , liposomes , diluents and other suitable additives . oils useful in parenteral compositions include petroleum , animal , vegetable , or synthetic oils . specific examples of oils useful in such compositions include peanut , soybean , sesame , cottonseed , corn , olive , petrolatum , and mineral . suitable fatty acids for use in parenteral compositions include oleic acid , stearic acid , and isostearic acid . ethyl oleate and isopropyl myristate are examples of suitable fatty acid esters . suitable soaps for use in parenteral compositions include fatty alkali metal , ammonium , and triethanolamine salts , and suitable detergents include ( a ) cationic detergents such as , for example , dimethyl dialkyl ammonium halides , and alkyl pyridinium halides ; ( b ) anionic detergents such as , for example , alkyl , aryl , and olefin sulfonates , alkyl , olefin , ether , and monoglyceride sulfates , and sulfosuccinates ; ( c ) nonionic detergents such as , for example , fatty amine oxides , fatty acid alkanolamides , and polyoxyethylenepolypropylene copolymers ; ( d ) amphoteric detergents such as , for example , alkyl - beta - aminopropionates , and 2 - alkyl - imidazoline quaternary ammonium salts ; and ( e ) mixtures thereof . the parenteral compositions typically will contain from about 0 . 5 to about 25 % by weight of the active ingredient in solution . preservatives and buffers may be used . in order to minimize or eliminate irritation at the site of injection , such compositions may contain one or more nonionic surfactants having a hydrophile - lipophile balance ( hlb ) of from about 12 to about 17 . the quantity of surfactant in such compositions will typically range from about 5 to about 15 % by weight . suitable surfactants include polyethylene sorbitan fatty acid esters , such as sorbitan moriooleate and the high molecular weight adducts of ethylene oxide with a hydrophobic base , formed by the condensation of propylene oxide with propylene glycol . the parenteral compositions can be presented in unit - dose or multi - dose sealed containers , such as ampules and vials , and can be stored in a freeze - dried ( lyophilized ) condition requiring only the addition of the sterile liquid excipient , for example , water , for injections , immediately prior to use . extemporaneous injection solutions and suspensions can be prepared from sterile powders , granules , and tablets of the kind previously described . the pharmaceutical dosage forms suitable for injection or infusion can include sterile aqueous solutions or dispersions comprising the active ingredient that are adapted for administration by encapsulation in liposomes . in all cases , the ultimate dosage form must be sterile , fluid and stable under the conditions of manufacture and storage . sterile injectable solutions are prepared by incorporating ghrelin splice variant or a ghrelin splice variant - like compound or pharmaceutical acceptable salt thereof in the required amount in the appropriate solvent with various of the other ingredients enumerated above , as required , followed by , e . g ., filter sterilization . the compounds disclosed herein can also be delivered topically . regions for topical administration include the skin surface and also mucous membrane tissues of the rectum , nose , mouth , and throat . compositions for topical administration via the skin and mucous membranes should not give rise to signs of irritation , such as swelling or redness . the topical composition may include a pharmaceutical acceptable carrier adapted fortopical administration . thus , the composition may take the form of , for example , a suspension , solution , ointment , lotion , cream , foam , aerosol , spray , suppository , implant , inhalant , tablet , capsule , dry powder , syrup , balm or lozenge . methods for preparing such compositions are well known in the pharmaceutical industry . the compounds disclosed herein may be formulated for topical administration to the epidermis as ointments , creams or lotions , or as a transdermal patch . ointments and creams may , for example , be formulated with an aqueous or oily base with the addition of suitable thickening and / or gelling agents . lotions may be formulated with an aqueous or oily base and will in general also containing one or more emulsifying agents , stabilizing agents , dispersing agents , suspending agents , thickening agents , or coloring agents . compositions suitable for topical administration in the mouth include lozenges comprising active agents in a flavored base , usually sucrose and acacia or tragacanth ; pastilles comprising the active ingredient in an inert base such as gelatin and glycerin or sucrose and acacia ; and mouthwashes comprising the active ingredient in a suitable liquid carrier . creams , ointments or pastes according to the present disclosure are semi - solid compositions for external application comprising the active ingredient . they may be made by mixing the active ingredient in finely - divided or powdered form , alone or in solution or suspension in an aqueous or non - aqueous fluid , with the aid of suitable machinery , with a greasy or non - greasy base . the base may comprise hydrocarbons such as hard , soft or liquid paraffin , glycerol , beeswax , a metallic soap ; a mucilage ; an oil of natural origin such as almond , corn , arachis , castor or olive oil ; wool fat or its derivatives ; or a fatty acid such as steric or oleic acid together with an alcohol such as propylene glycol or a macrogel . the composition may incorporate any suitable surface active agent such as an anionic , cationic or non - ionic surfactant such as a sorbitan ester or a polyoxyethylene derivative thereof . suspending agents such as natural gums , cellulose derivatives or inorganic materials such as silicaceous silicas , and other ingredients such as lanolin , may also be included . lotions according to the present disclosure include those suitable for application to the skin or eye . an eye lotion may comprise a sterile aqueous solution optionally containing a bactericide and may be prepared by methods similar to those for the preparation of drops . lotions or liniments for application to the skin may also include an agent to hasten drying and to cool the skin , such as an alcohol or acetone , and / or a moisturizer such as glycerol or an oil such as castor oil or arachis oil . the compounds described herein can be administered transdermally . transdermal administration typically involves the delivery of a pharmaceutical agent for percutaneous passage of the drug into the systemic circulation of the patient . the skin sites include anatomic regions for transdermally administering the drug and include the forearm , abdomen , chest , back , buttock , mastoidal area , and the like . transdermal delivery is accomplished by exposing a source of the active compound to a patient &# 39 ; s skin for an extended period of time . transdermal patches have the added advantage of providing controlled delivery of a compound complex to the body ( see transdermal drug delivery : developmental issues and research initiatives , hadgraft and guy ( eds . ), marcel dekker , inc ., ( 1989 ); controlled drug delivery : fundamentals and applications , robinson and lee ( eds . ), marcel dekker inc ., ( 1987 ); and transdermal delivery of drugs , vols . 1 - 3 , kydonieus and berner ( eds . ), crc press , ( 1987 )). such dosage forms can be made by dissolving , dispersing , or otherwise incorporating a compound disclosed herein in a proper medium , such as an elastomeric matrix material . absorption enhancers can also be used to increase the flux of the compound across the skin . the rate of such flux can be controlled by either providing a rate - controlling membrane or dispersing the compound in a polymer matrix or gel . a variety of types of transdermal patches will find use in the methods described herein . for example , a simple adhesive patch can be prepared from a backing material and an acrylate adhesive . the active compound and any enhancer are formulated into the adhesive casting solution and allowed to mix thoroughly . the solution is cast directly onto the backing material and the casting solvent is evaporated in an oven , leaving an adhesive film . the release liner can be attached to complete the system . alternatively , a polyurethane matrix patch can be employed to deliver a compound disclosed herein . the layers of this patch comprise a backing , a polyurethane drug / enhancer matrix , a membrane , an adhesive , and a release liner . the polyurethane matrix is prepared using a room temperature curing polyurethane prepolymer . addition of water , alcohol , and complex to the prepolymer results in the formation of a tacky firm elastomer that can be directly cast only the backing material . a further embodiment will utilize a hydrogel matrix patch . typically , the hydrogel matrix will comprise alcohol , water , drug , and several hydrophilic polymers . this hydrogel matrix can be incorporated into a transdermal patch between the backing and the adhesive layer . a liquid reservoir patch will also find use in the methods described herein . this patch comprises an impermeable or semipermeable , heat sealable backing material , a heat sealable membrane , an acrylate based pressure sensitive skin adhesive , and a siliconized release liner . the backing is heat sealed to the membrane to form a reservoir which can then be filled with a solution of the complex , enhancers , gelling agent , and other excipients . foam matrix patches are similar in design and components to the liquid reservoir system , except that the gelled pharmaceutical agent - chemical modifier solution is constrained in a thin foam layer , typically a polyurethane . this foam layer is situated between the backing and the membrane which have been heat sealed at the periphery of the patch . for passive delivery systems , the rate of release is typically controlled by a membrane placed between the reservoir and the skin , by diffusion from a monolithic device , or by the skin itself serving as a rate - controlling barrier in the delivery system ( see u . s . pat . nos . 4 , 816 , 258 ; 4 , 927 , 408 ; 4 , 904 , 475 ; 4 , 588 , 580 , 4 , 788 , 062 ; and the like , all of which are incorporated herein by reference ). the rate of drug delivery will be dependent , in part , upon the nature of the membrane . for example , the rate of drug delivery across membranes within the body is generally higher than across dermal barriers . the rate at which the active compound is delivered from the device to the membrane is most advantageously controlled by the use of rate - limiting membranes which are placed between the reservoir and the skin . assuming that the skin is sufficiently permeable to the active compound ( i . e ., absorption through the skin is greater than the rate of passage through the membrane ), the membrane will serve to control the dosage rate experienced by the patient . suitable permeable membrane materials may be selected based on the desired degree of permeability , the nature of the active compound , and the mechanical considerations related to constructing the device . exemplary permeable membrane materials include a wide variety of natural and synthetic polymers , such as polydimethylsiloxanes ( silicone rubbers ), ethylenevinylacetate copolymer ( eva ), polyurethanes , polyurethane - polyether copolymers , polyethylenes , polyamides , polyvinylchlorides ( pvc ), polypropylenes , polycarbonates , polytetrafluoroethylenes ( ptfe ), cellulosic materials , e . g ., cellulose triacetate and cellulose nitrate / acetate , and hydrogels , e . g ., 2 - hydroxyethylmethacrylate ( hema ). other items may be contained in the device , such as other conventional components of therapeutic products , depending upon the desired device characteristics . for example , the compositions disclosed herein may also include one or more preservatives or bacteriostatic agents , e . g ., methyl hydroxybenzoate , propyl hydroxybenzoate , chlorocresol , benzalkonium chlorides , and the like . these pharmaceutical compositions also can contain other active ingredients such as antimicrobial agents , particularly antibiotics , anesthetics , analgesics , and antipruritic agents . the compounds disclosed herein may be formulated for administration as suppositories . a typical suppository is produced by providing a low melting wax , such as a mixture of fatty acid glycerides or cocoa butter , that is first melted and the active component is dispersed homogeneously therein , for example , by stirring . the molten homogeneous mixture is then poured into convenient sized molds , allowed to cool , and to solidify . the active compound may be formulated into a suppository comprising , for example , about 0 . 5 % to about 50 % of a compound disclosed herein , disposed in a polyethylene glycol ( peg ) carrier ( e . g ., peg 1000 [ 96 %] and peg 4000 [ 4 %]). a preferred aspect contemplates pharmaceutical compositions useful for practicing the therapeutic methods described herein . pharmaceutical compositions can contain a physiologically tolerable carrier together with at least one species of a secretagogue , such as ghrelin splice variant or a ghrelin splice variant - like compound as described herein , dissolved or dispersed therein as an active ingredient . in a preferred embodiment , the pharmaceutical composition is not immunogenic when administered to a human individual for therapeutic purposes , unless that purpose is to induce an immune response . one aspect relates to a pharmaceutical composition comprising at least one ghrelin splice variant or a ghrelin splice variant - like compound as defined above in formula i . in a preferred embodiment , the pharmaceutical composition comprises at least two different ghrelin splice variant - like compounds as defined above in formula i in order to increase the effect of the treatment . the difference may for example be compounds having different acylations as discussed above . as used herein , the terms “ pharmaceutically acceptable ”, “ physiologically tolerable ” and grammatical variations thereof , as they refer to compositions , carriers , diluents and reagents , are used interchangeably and represent that the materials are capable of administration to or upon a human without the production of undesirable physiological effects such as nausea , dizziness , gastric upset and the like . the preparation of a pharmacological composition that contains active ingredients dissolved or dispersed therein is well understood in the art . typically , such compositions are prepared as sterile injectables either as liquid solutions or suspensions , aqueous or non - aqueous ; however , solid forms suitable for solution , or suspensions , in liquid prior to use can also be prepared . the preparation can also be emulsified . the active ingredient can be mixed with excipients which are pharmaceutically acceptable and compatible with the active ingredient and in amounts suitable for use in the therapeutic methods described herein . suitable excipients are , for example , water , saline , dextrose , glycerol , ethanol or the like and combinations thereof . in addition , if desired , the composition can contain minor amounts of auxiliary substances such as wetting or emulsifying agents , ph buffering agents and the like which enhance the effectiveness of the active ingredient . it is preferred that the formulation has a ph within the range of 3 . 5 - 8 , such as in the range 4 . 5 - 7 . 5 , such as in the range 5 . 5 - 7 , such as in the range 6 - 7 . 5 , most preferably around 7 . 3 . however , as is understood by one skilled in the art , the ph range may be adjusted according to the individual treated and the administration procedure . for example , ghrelin splice variant and ghrelin splice variant homologs may be easily stabilized at a lower ph ; so , in another preferred embodiment , the formulation has a ph within the range 3 . 5 - 7 , such as 4 - 6 , such as 5 - 6 , such as 5 . 3 - 5 . 7 , such as 5 . 5 . pharmaceutical compositions disclosed herein can include pharmaceutically acceptable salts of the compounds therein . these salts will be ones which are acceptable in their application to a pharmaceutical use , meaning that the salt will retain the biological activity of the parent compound and the salt will not have untoward or deleterious effects in its application and use in treating diseases . pharmaceutically acceptable salts are prepared in a standard manner . if the parent compound is a base , it is treated with an excess of an organic or inorganic acid in a suitable solvent . if the parent compound is an acid , it is treated with an inorganic or organic base in a suitable solvent . the compounds disclosed herein may be administered in the form of an alkali metal or earth alkali metal salt thereof , concurrently , simultaneously , or together with a pharmaceutically acceptable carrier or diluent , especially and preferably in the form of a pharmaceutical composition thereof , whether by , e . g ., oral , rectal , or parenteral ( including subcutaneous ) route , in an effective amount . examples of pharmaceutical acceptable acid addition salts for use in the present inventive pharmaceutical composition include those derived from mineral acids , such as , e . g ., hydrochloric , hydrobromic , phosphoric , metaphosphoric , nitric and sulfuric acids , and organic acids , such as , e . g ., tartaric , acetic , citric , malic , lactic , fumaric , benzoic , glycolic , gluconic , succinic , p - toluenesulphonic , and arylsulphonic acids . other suitable pharmaceutically acceptable salts include the acid addition salts ( formed with the free amino groups of the polypeptide ). other examples of salts include pharmaceutically acceptable acid addition salts , pharmaceutically acceptable metal salts , ammonium salts and alkylated ammonium salts . acid addition salts include salts of inorganic acids as well as organic acids . representative examples of suitable inorganic acids include hydrochloric , hydrobromic , hydriodic , phosphoric , sulfuric and nitric acids and the like . representative examples of suitable organic acids include formic , acetic , trichioroacetic , trifluoroacetic , propionic , benzoic , cinnamic , citric , fumaric , glycolic , lactic , maleic , malic , malonic , mandelic , oxalic , picric , pyruvic , salicylic , succinic , rnethanesulfonic , ethanesulfonic , tartaric , ascorbic , pamoic , bismethylene salicylic , ethanedisulfonic , gluconic , citraconic , aspartic , stearic , palmitic , ethylenediaminetetraacetic ( edta ), p - aminobenzoic , glutamic , benzenesulfonic , and p - toluenesulfonic acids and the like . further examples of pharmaceutically acceptable inorganic or organic acid addition salts include the pharmaceutical acceptable salts listed in berge s . m . et al ., j . pharm . sci . 66 : 1 - 19 ( 1977 ), which is incorporated herein by reference . examples of metal salts include lithium , sodium , potassium and magnesium salts and the like . examples of ammonium and alkylated ammonium salts include ammonium , methylammonium , dimethylammonium , trimethylammonium , ethylammonium , hydroxyethylammonium , diethylammonium , butylammonium and tetramethylammonium salts and the like . salts formed with the free carboxyl groups can also be derived from inorganic bases such as , for example , sodium , potassium , ammonium , calcium or ferric hydroxides , and such organic bases as isopropylamine , trimethylamine , 2 - ethylamino ethanol , histidine , procaine and the like . also included within the scope of compounds or pharmaceutical acceptable acid addition salts thereof in the context of the present disclosure are any hydrates ( hydrated forms ) thereof . for parenteral administration , solutions of the present compounds in sterile aqueous solution , aqueous propylene glycol or sesame or peanut oil may be employed . such aqueous solutions should be suitably buffered if necessary , and the liquid diluent first rendered isotonic with sufficient saline or glucose . the aqueous solutions are particularly suitable for intravenous , intramuscular , subcutaneous and intraperitoneal administration . the sterile aqueous media employed are all readily available by standard techniques known to those skilled in the art . liquid compositions can also contain liquid phases in addition to and to the exclusion of water . exemplary of such additional liquid phases are glycerin , vegetable oils such as cottonseed oil , organic esters such as ethyl oleate , and water - oil emulsions . suitable pharmaceutical carriers include inert solid diluents or fillers , sterile aqueous solution and various organic solvents . examples of solid carriers are lactose , terra alba , sucrose , cyclodextrin , talc , gelatine , agar , pectin , acacia , magnesium stearate , stearic acid or lower alkyl ethers of cellulose . examples of liquid carriers are syrup , peanut oil , olive oil , phospholipids , fatty acids , fatty acid amines , polyoxyethylene or water . nasal aerosol or inhalation formulations may be prepared , for example , as solutions in saline , employing benzyl alcohol or other suitable preservatives , absorption promoters to enhance bioavailability , employing fluorocarbons , and / or employing other solubilizing or dispersing agents . the pharmaceutical compositions formed by combining the compounds disclosed herein and the pharmaceutical acceptable carriers are then readily administered in a variety of dosage forms suitable for the disclosed routes of administration . the formulations may conveniently be presented in unit dosage form by methods known in the art of pharmacy . in a preferred embodiment , the formulation comprises the ghrelin splice variant or ghrelin splice variant - like compound or a salt thereof as a lyophilisate , and the formulation further comprises a solvent , said lyophilisate and said solvent being in separate compartments until administration . in another embodiment , the formulation is a solution of the ghrelin splice variant or ghrelin splice variant - like compound or a salt thereof . in either embodiment , the solvent may be any suitable solvent , such as those described herein , and preferably the solvent is saline . another aspect relates to a method for preparing a medicament or pharmaceutical composition comprising a compound disclosed herein , the method comprising admixing at least one ghrelin splice variant - like compound , as defined above in formula i , with a physiologically acceptable carrier . a further aspect relates to a pharmaceutical composition comprising , as an active ingredient , a compound as defined above in formula i or a pharmaceutically acceptable salt thereof together with a pharmaceutically - acceptable carrier . accordingly , the formulation may further include the transport molecules as described above . in a further aspect , the present compounds may be administered in combination with additional pharmacologically - active substances or other pharmacologically - active material and / or may be administered in combination with another therapeutic method . by the phrase “ in combination with another substance ( s ) and / or therapeutic method ( s )” is meant herein that said another substance ( s ) and / or therapeutic method ( s ) is administered to the individual thus treated before , during ( including concurrently with ) and / or after treatment of an individual with a secretagogue . in all cases of combination treatment described herein , the combination may be in the form of kit - in - part systems , wherein the combined active substances may be used for simultaneous , sequential or separate administration . in all cases , it is preferred that any of the herein - mentioned medicaments are administered in pharmaceutically effective amounts , i . e . an administration involving a total amount of each active component of the medicament or pharmaceutical composition or method that is sufficient to show a meaningful patient benefit . the present disclosure is further defined in the following examples . it should be understood that these examples , while indicating preferred embodiments , are given by way of illustration only . from the above discussion and these examples , one skilled in the art can ascertain the preferred features of this disclosure , and without departing from the spirit and scope thereof , can make various changes and modifications to adapt it to various uses and conditions . amino acid derivatives and synthesis reagents can be obtained from commercial sources . peptide chain extension can be performed using applied biosystem 433a synthesizer produced by perkin elmer , and a protected peptide derivative - resin can be constructed by the boc or fmoc method . the protected peptide resin obtained by the boc method is deprotected with anhydrous hydrogen fluoride ( hf ) in the presence of p - cresol thereby releasing the peptide , which is then purified . the protected peptide resin obtained by the fmoc method is deprotected with trifluoroacetic acid ( tfa ) or dilute tfa containing various scavengers , and the released peptide is purified . purification is performed in reversed phase hplc on a c4 or c18 column . the purity of the purified product can be confirmed by reverse phase hplc , and its structure can be confirmed by amino acid composition analysis and mass spectrometry . peptides disclosed herein can be produced by a conventional peptide synthesis method . specifically , synthesis of acylated or alkylated peptides is exemplified below . abbreviations : “ hmp resin ” means 4 - hydroxymethyl - phenoxymethyl resin ; “ fmoc amide resin ” means 4 -( 2 ′, 4 ′- dimethoxyphenyl - fmoc - aminomethyl ) phenoxyacetamido - ethyl resin ; “ pam resin ” means phenylacetoamidomethyl resin ; “ hbtu ” means 2 -( 1h - benzotriazole - 1 - yl )- 1 , 1 , 3 , 3 - tetramethyluronium hexafluorophosphate ; “ tbtu ” means 2 -( 1h - benzotriazole - 1 - yl )- 1 , 1 , 3 , 3 - tetramethyluronium tetrafluoroborate ; “ hobt ” means 1 - hydroxybenzotriazole ; “ dcc ” means dicyclohexylcarbodiimide ; “ dipci ” means diisopropylcarbodiimide ; “ tfa ” means trifluoroacetic acid ; “ dipea ” means diisopropylethylamine ; “ tips ” means triisopropylsilane ; “ fmoc ” means fluorenylmethoxycarbonyl ; “ boc ” means t - butyloxycarbonyl ; “ trt ” means trityl ; “ bu ” means t - butyl ; “ pmc ” means 2 , 2 , 5 , 7 , 8 - pentamethylchroman - 6 - sulfonyl ; “ prl ” means propionyl ; “ phprl ” means phenylpropionyl ; “ bzl ” means benzyl ; “ born ” means benzyloxymethyl ; “ tos ” means toluenesulfonyl ; “ cl - z ” means 2 - chloro - benzyloxycarbonyl ; “ pis ” means 2 - phenylisopropyl ; “ mtt ” means 4 - methyltrityl ; “ dmf ” means n , n - dimethylformamide ; “ nmp ” means n - methylpyrrolidone ; “ dmap ” means 4 - dimethylaminopyridine ; “ hosu ” means n - hydroxysucciniimide ; “ adod ” means 2 - aminododecanoic acid ; “ aib ” means 2 - aminoisobutylic acid ; “ ape ” means 5 - aminopentanoic acid ; “ cha ” means cyclohexylalanine ; “ dap ” means 2 , 3 - diaminopropionic acid ; “ nal ” means naphtylalanine ; “ nie ” means norleucine . protecting amino acids which can be used in synthesis fmoc method : boc - gly , fmoc - gly , fmoc - ser ( bu ), fmoc - ser ( trt ), fmoc - glu ( obu ), fmoc - his ( boc ), fmoc - gln ( trt ), fmoc - arg ( pmc ), fmoc - lys ( boc ), fmoc - pro , fmoc - leu , fmoc - ala , fmoc - val , fmoc - phe , fmoc - phe , fmoc - ser ( n - c 8 h 17 ), fmoc - ser ( n - c 8 h 17 ), fmoc - cys ( n - c 3 h 17 ), fmoc - asp ( opis ), fmoc - ser ( bzl ), fmoc - cys ( trt ), fmoc - dap ( octanoyl ), fmoc - 2 - nal , fmoc - 2 - nal , fmoc - nle , fmoc - lys ( mtt ), fmoc - aib - oh , fmoc - asp ( o - c 7 - h 15 ). boc method : boc - gly , boc - ser ( bzl ), boc - ser ( ac ), boc - ser ( pri ), boc - glu ( obzl ), boo - his ( bom ), boc - gin , boc - arg ( tos ), boc - lys ( cl - z ), boc - pro , boc - leu , boc - ala , boc - val , boc - phe , boc - cys ( n - c 8 h 17 ), boo - ape , boc - ser ( n - c 8 h 17 ) ( a ) analytical hplc system unit : shimadzu lc - 10a system ; column : ymc protein - rp ( 4 . 6 mm × 150 mm ); column temperature : 40 ° c . ; eluent : a linear gradient of from 0 to 50 % acetonitrile for 20 minutes in 0 . 1 % trifluoroacetic acid ; flow rate : 1 ml / min ; detection : uv ( 210 nm ); injection volume : 10 to 100 mu i . ( b ) preparative hplc system unit : waters 600 multisolvent delivery system ; columns : ymc - pack - ods - a ( 5 mu m , 20 mm × 250 mm ) ymc - pack - protein - rp ( 5 mu m , c4 , 10 mm × 250 mm ) ymc - pack protein - rp ( 5 mu m , c4 , 20 mm × 250 mm ) ymc protein - rp ( 4 . 6 mm × 150 mm ); eluent : a suitable linear gradient of acetonitrile concentration in 0 . 1 % trifluoroacetic acid ; flow rate : 10 ml / min . ( for columns of an inner diameter of 20 mm ), 3 ml / min . ( for the column of an inner diameter of 10 mm ), 1 ml / min . ( for the column of an inner diameter of 4 . 6 mm ); detection : 210 nm , 260 nm ; injection : 10 to 2000 mu i ( 2000 mu i or more was injected via a pump ) ( c ) mass spectrometer unit : finnigan mat tsq700 ; ion source : esi ; detection ion mode : positive spray ; voltage : 4 . 5 kv ; capillary temperature : 250 ° c . ; mobile phase : a mixture of 0 . 2 % acetic acid and methanol ( 1 : 1 ); flow rate : 0 . 2 ml / min ; scan range : m / z 300 to 1 , 500 ( d ) analysis of amino acid sequence unit : applied biosystem 477a , 492 model sequencer manufactured by perkin elmer ( e ) analysis of amino acid composition unit : l - 8500 model amino acid analyzer manufactured by hitachi , co ., ltd . ; sample : unless otherwise specified , the sample is hydrolyzed with 6 m hcl at 110 ° c . for 24 hours in a sealed tube . example of synthesis of a derivative having acyl serine ( fmoc method , carboxyl - terminal amide derivatives ) ghrelin splice variant gss ( co - c 7 h 15 ) flspehqrvqvrpphkaph fmoc - his ( pmc )- hmp - resin ( 403 mg , 0 . 25 mmol , abi co ., ltd .) is treated with 20 % piperazine for 20 minutes and subjected repeatedly to introduction of fmoc - amino acid by hbtu / hobt and elimination of fmoc by piperazine sequentially to construct fmoc - ser ( bu )- ser ( trt )- phe - leu - ser ( tbu )- pro - glu ( obu )- his ( boc )- gln ( trt )- arg ( pmc )- val - gln - val ( trt )- arg ( pmc )- pro - pro - his ( boc )- lys ( boc )- ala ( boc )- pro ( boc )- pro - his ( pmc )- resin . after boc - gly is finally introduced by dcc / hobt , the resulting protected peptide resin ( 1 . 3 g ) is treated with 1 % tfa - 5 % tips - methylene chloride solution ( 15 ml ) for 30 minutes . the peptide resin is filtrated , washed several times with methylene chloride ( 30 ml ), and washed with 5 % di ea ( 10 ml ) and then with methylene chloride ( 30 ml ). the resulting de - trt peptide resin ( about 1 . 3 g ) is swollen with nmp ( 10 ml ), and octanoic acid ( 144 . 2 mg , 1 . 0 mmol ) and dipci ( 126 . 2 mg , 1 . 0 mmol ) are added thereto in the presence of dmap ( 61 . 1 mg , 0 . 5 mmol ) and allowed to react for 8 hours . the resin is recovered by filtration and washed with nmp and then with methylene chloride , followed by drying under vacuum to give about 1 . 2 g protected peptide resin wherein the side chain of third serine is octanoylated . to this product is added a de - protecting reagent ( 10 ml ) consisting of 88 % tfa - 5 % phenol - 2 % tips - 5 % h 2 o , and the mixture is stirred at room temperature for 2 hours . the resin is removed by filtration , and the filtrate is concentrated followed by adding ether to the resulting residues to form precipitates . the precipitates are recovered by filtration and dried to give about 550 mg crude peptide . 200 mg of this product is dissolved in 10 ml water and applied to ymc - pack protein - rp ( c4 , 20 mm × 250 mm ) and eluted with a linear gradient ( flow rate : 10 ml / min .) for 60 minutes of from 0 to 54 % acetonitrile in 0 . 1 % trifluoroacetic acid . the desired fractions are collected and lyophilized to give about 120 mg of the desired product . example of synthesis of a derivative having acyl serine ( fmoc method , carboxyl - terminal amide compounds ) ghrelin splice variant ( 1 - 22 )- nh 2 gss ( co - c 7 h 15 ) flspehqrvqvrpphkaph - nh 2 fmoc - amide - resin ( 403 mg , 0 . 25 mmol , abi co ., ltd .) is treated with 20 % piperazine for 20 minutes and subjected repeatedly to introduction of fmoc - amino acid by hbtu / hobt and elimination of fmoc by piperazine sequentially to construct fmoc - ser ( bu )- ser ( trt )- phe - leu - ser ( bu )- pro - glu ( obu )- his ( boc )- gln ( trt )- arg ( pmc )- val - gln - val ( trt )- arg ( pmc )- pro - pro - his ( boc )- lys ( boc )- ala ( boc )- pro ( boc )- pro - his ( boc )- resin . after boc - gly is finally introduced by dcc / hobt , the resulting protected peptide resin ( about 550 mg ) is treated with 1 % tfa - 5 % tips - methylene chloride solution ( 10 ml ) for 30 minutes . the peptide resin is recovered by filtration , washed several times with methylene chloride ( 30 ml ), and washed with 5 % diea ( 10 ml ) and then with methylene chloride ( 30 ml ). the resulting de - trt peptide resin ( about 750 mg ) is swollen with nmp ( 10 ml ), and octanoic acid ( 1442 mg , 1 . 0 mmol ) and dipci ( 126 . 2 mg , 1 mmol ) are added thereto in the presence of dmap ( 61 . 1 mg , 0 . 5 mmol ) and allowed to react for 4 hours . the resin is recovered by filtration and washed with nmp and then with methylene chloride , followed by drying under vacuum to give about 800 mg protected peptide resin wherein the side chain of third serine is octanoylated . tfa ( 10 ml ) is added to this product and stirred at room temperature for 30 minutes . the resin is removed by filtration , and the filtrate is then concentrated followed by adding ether to the resulting residues to form precipitates . the precipitates are recovered by filtration and dried to give about 250 mg crude peptide . about 200 mg of this product is dissolved in 10 ml of 30 % aqueous acetic acid and applied to ymc - pack protein - rp ( c4 , 20 mm × 250 mm ) and eluted with a linear gradient ( flow rate : 10 ml / min .) for 60 minutes of from 0 to 54 % acetonitrile in 0 . 1 % trifluoroacetic acid . the desired fractions are collected and then lyophilized to give about 150 mg of the desired product . example of synthesis of a derivative having acyl serine ( boc method ) [ ser3 ( propionyl )]- ghrelin splice variant ( 1 - 22 ) gss ( co - ch 2 ch 3 ) flspehqrvqvrpphkaph protected ghrelin splice variant resin ( 4 - 22 ) is constructed from boc - his ( tos )- pam resin ( 0 . 75 g , 0 . 5 mmol ) by boc chemistry , and boc - ser ( co - ch 2 ch 3 )- oh , boc - ser ( bzl )- oh and boc - gly - oh are condensed with a half ( 1 . 4 g ) of the resin . the resulting resin , 1 . 5 g , is then treated with a mixture of hf and p - cresol ( 8 . 5 ml : 1 . 5 ml ) at 0 ° c . for 1 hour , and the hf is evaporated . ether is added to the residues , whereby 671 mg crude peptide is obtained . this sample is then dissolved in 50 % acetic acid ( acoh ) and applied to a preparative column ymc - pack - ods - a ( 5 mu m , 20 mm × 250 mm ) and eluted at a rate of 10 ml / min by a gradient of from 0 to 95 % acetonitrile concentration in 0 . 1 % tfa solution for 75 minutes . those fractions containing the desired product are lyophilized to give approximately 135 . 8 mg crude peptide . a part ( 0 . 5 mg ) of this product is applied to ymc - a - 302 column ( c18 , 4 . 6 mm × 150 mm ) and eluted at a flow rate of 1 ml / min . by a gradient of from 15 to 19 % concentration acetonitrile . this purification procedure is then repeated and the desired fractions are combined to give approximately 0 . 41 mg of the desired product . other compounds according to the present disclosure can be produced likewise . acylated and un - acylated seq id no : 2 , acylated and un - acylated seq id no : 3 and acylated seq id no : 4 were produced synthetically using the above described method . efficacy of subcutaneous administration of acylated and un - acylated ghrelin splice variant on weight gain , lowering plasma glucose level , lowering cholesterol and lipid level acylated ghrelin splice variant ( 20 μg ; 29 amino acids in length ( seq id no : 2 )) or the vehicle ( 1 . 6 % mannitol ) was administered once daily for 14 successive days , via the subcutaneous ( sc ) route , to groups comprising n = 10 129sv male mice . no mortality occurred in any of the animals throughout the entire study period . no clinical signs were observed in any of the animals throughout the entire study period . all animals were subjected to terminal bleeding , under co 2 anesthesia , immediately prior to euthanasia . terminal blood collection was performed serially as per animal number , and not as per group . hematology : blood samples ( at least 100 μl ) were collected into pre - labeled edta coated tubes . the tubes were pre - labeled and contain the following information : study number , group number , animal number and date . the samples were kept until delivery and analysis at 2 - 8 ° c . hematology parameters that were tested using sysmex kx21 are : wbc , rbc , hgb , hct , mcv , mch , mchc , platelets . differential count was preformed manually . biochemistry : blood for biochemistry analysis was collected into non - coated pre - labeled tubes . the tubes were pre - labeled and contained the following information : study number , group number , animal number and date . following clotting , the blood from each animal was centrifuged , and the serum was collected into two pre - labeled tubes and submitted for analysis as follows : serum , 250 μl , was kept at 2 - 8 ° c . until analysis . the samples were subjected to the following listed tests using hitachi 917 system : creatinine , total bilirubin , glucose , triglycerides , cholesterol , hdl , ldl , total protein , globulin , albumin , urea , potassium , phosphorus , calcium , sodium , chloride , sgot , sgpt , alp . urinalysis : urine was collected into pre - labeled tubes ( as above ) from all animals ( where possible ) prior to and / or after euthanasia . for all surviving animals , urine collection was performed serially as per animal number , and not as per group . an attempt was made to attain the maximal amount as possible to perform the tests listed below . urinalysis is performed using a commercial test stick ( bayer , multistix ® 10sg ) applied to urine sample and evaluating the following parameters : glucose , ketone , ph value , leukocytes , blood , density , nitrite , bilirubin , urobilinogen and protein . necropsy procedures and macroscopic examination : all animals were subjected to a fully detailed necropsy . for all surviving animals , necropsy was performed serially as per animal number , and not as per group , immediately following the scheduled terminal bleeding . at necropsy , a thorough examination is made and any abnormality or gross pathological changes in tissues and / or organs are observed and recorded . organ / tissue collection : the organs and tissues listed ( brain , liver , kidney , stomach , pancreas , lungs , spleen , heart , epididymal wat , retroperitoneal wat , interscapular bat ) were excised and weighed wet as soon as possible after excision and removal of the attached fat and other connective tissues . all organs from one animal were collected into one container , pre - labeled with the following information : study number , group number , animal number and date . results : reduced levels of cholesterol in the acylated ghrelin splice variant and un - acylated ghrelin splice variant treated groups were observed ( 5 % & amp ; 6 %, respectively ; see fig1 a ). reduced levels of hdl in the acylated ghrelin splice variant and un - acylated ghrelin splice variant treated groups ( 5 % & amp ; 6 %, respectively ; see fig1 b ). ldl levels remained unchanged in the acylated ghrelin splice variant and un - acylated ghrelin splice variant treated groups treated groups ( see fig1 c ). increased levels of triglycerides in the acylated ghrelin splice variant ( 9 %) were observed , while the level of triglycerides in the un - acylated ghrelin splice variant treated group remained unchanged ( see fig1 d ). human patients with advanced coronary heart disease suffering from the hypercholesterolemia syndrome are believed to benefit from the present disclosure in terms of reduced atherosclerotic blockage , reduced atherosclerotic plaques and a healthier lipid profile . patients will receive subcutaneous administration of 10 μg / kg dose of ghrelin splice variant and placebo . the protocol will start at 08 . 00 hours after an overnight fast . a 22 - gauge catheter will be inserted into an antecubital vein for blood sampling . after an equilibration period of 30 min , ghrelin splice variant ( 10 μg / kg ) or placebo ( 0 . 9 % saline ) will be administered subcutaneously . investigational treatment : ghrelin splice variant will be available in gmp - quality in prepared vials of 10 μg / kg from bachem ag , switzerland or neomps inc ., usa . placebo consists of normal saline ( or the vehicle used to dissolve study substance ), which will be provided by a hospital pharmacy . ghrelin splice variant is dissolved in saline , and a dose of 10 μg / kg ghrelin splice variant will be administered to the patient . ( 1 ) cardiovascular autonomic function : for the screening of autonomic disorders , a 20 minute holter ekg will be performed , and the sdnn value determined . ( 10 ) mediators of the proinflammatory reaction ( crp , il - 6 , tnf - α ), the activated metabolism ( free fatty acids , triglycerides , insulin , glucose , leptin ), the gut - brain axis ( ghrelin ), and the somatotrophic axis ( igf - 1 , free testosterone ) will be determined as baseline in the first week . a urine sample will be reserved for assessment of proteolysis - inducing factor ( pif ), a mediator of the paraneoplastic anorexia / cachexia syndrome . human patients with obesity are believed to benefit from the present disclosure in terms of reduced weight gain , reduced plasma glucose level and a healthier lipid profile . patients will receive a daily subcutaneous administration of 10 μg / kg dose of ghrelin splice variant and placebo . the protocol will start at 08 . 00 hours after an overnight fast . a 22 - gauge catheter will be inserted into an antecubital vein for blood sampling . after an equilibration period of 30 min , ghrelin splice variant ( 10 μg / kg ) or placebo ( 0 . 9 % saline ) will be administered subcutaneously . investigational treatment : ghrelin splice variant will be available in gmp - quality in prepared vials of 10 μg / kg from bachem ag , switzerland or neomps inc ., usa . placebo consists of normal saline ( or the vehicle used to dissolve study substance ), which will be provided by a hospital pharmacy . ghrelin splice variant is dissolved in saline , and a dose of 10 μg / kg ghrelin splice variant will be administered to the patient . ( 1 ) percent change and absolute change in body weight . ( 2 ) waist circumference , waist - hip ratio , change in bmi , sagittal diameter and dexa ; blood tests ( triglycerides , cholesterol - total , ldl - c , hdl - c , ldh , blood glucose fasting , hba1c , c - reactive protein , insulin and adiponectin ); data from questionnaires ( baecke questionnaire , satiety & amp ; appetite questionnaire , poms , and impact of weight on quality of life questionnaire - lite version ( iwqol - lite )). ( 3 ) changes in homa ( homeostasis model assessment ) index value ; changes in baseline glucose , and post - charge glucose plasma levels . changes in serum insulin , leptin and adiponectin , inflammatory markers and oxidative stress markers . ( 4 ) mediators of the proinflammatory reaction ( crp , il - 6 , tnf - α ), the activated metabolism ( free fatty acids , triglycerides , insulin , glucose , leptin ), the gut - brain axis ( ghrelin ), and the somatotrophic axis ( igf - 1 , free testosterone ) will be determined as baseline pretreatment and measured weekly to evaluate the progress of treatment . a urine sample will be reserved for assessment of metabolites . human patients with diabetes are believed to benefit from the present disclosure in terms of reduced plasma glucose level and a healthier lipid profile . patients will receive a daily subcutaneous administration of 10 μg / kg dose of ghrelin splice variant and placebo . the protocol will start at 08 . 00 hours after an overnight fast . a 22 - gauge catheter will be inserted into an antecubital vein for blood sampling . after an equilibration period of 30 min , ghrelin splice variant ( 10 μg / kg ) or placebo ( 0 . 9 % saline ) will be administered subcutaneously . investigational treatment : ghrelin splice variant will be available in gmp - quality in prepared vials of 10 pg / kg from bachem ag , switzerland or neomps inc ., usa . placebo consists of normal saline ( or the vehicle used to dissolve study substance ), which will be provided by a hospital pharmacy . ghrelin splice variant is dissolved in saline , and a dose of 10 μg / kg ghrelin splice variant will be administered to the patient . ( 1 ) percent change and absolute change in plasma glucose level . ( 2 ) glucose level control as measured by change from baseline in fasting plasma glucose ( 3 ) difference in hbalc levels after 12 weeks , 26 weeks treatment ( 4 ) self monitoring of blood glucose ( smbg ; lipids as measured by change from baseline in total triglycerides , total ; cholesterol , ldl cholesterol , and hdl cholesterol ; change from baseline in circulating free fatty acids ; change from baseline in serum uric acid ; change from baseline in serum adiponectin . | 2 |
the invention will best be understood by reference first to fig1 fig3 and fig5 . the ball valve assembly 10 comprises a substantially monolithic valve body 12 provided with a dual inlet passageway 14 , which communicates with a valve chamber 18 formed in the valve body 12 and an outlet passageway 37 . the valve body 12 , in one embodiment , has a main portion 13 of generally cubic configuration having a right facet 20 , a rear facet 22 , a left facet 24 , a top 26 , a bottom 28 and a front 30 . contiguous with front 30 is a threaded boss 32 comprising an inlet inner circumference 34 and threaded portion 35 . the bottom 28 of main portion 13 has formed therein outlet passageway 37 to which communicates with outlet pipe 36 . preferably , threaded boss 32 and outlet pipe 36 are either machined as an integral element of valve body 12 or are attached thereto by pressure fits , brazing , welding or other techniques to insure a fluid - tight seal between threaded boss 32 and body main portion 13 , as well as between outlet pipe 36 and body main portion 13 . the dual inlet passage 14 communicates with valve chamber 18 ; likewise , outlet pipe 36 includes an outlet passageway 37 which communicates with valve chamber 18 . the outlet passageway 37 of outlet pipe 36 likewise communicates with outlet 38 formed in the wall of outlet pipe 36 , thereby permitting fluid within outlet passageway 37 to flow through outlet 38 . the outlet element 56 comprises an outlet barrel 58 , and an outlet nipple 52 provided with outlet barbs 54 . the outlet barrel 58 has an inner circumference 60 which slides over and engages outlet pipe outer o - ring 40 , outlet pipe inner o - ring 42 and threaded portion 44 . the upper annular surface 50 of the outlet element 56 preferably contacts the bottom 28 of valve body main portion 13 . the outlet barrel inner circumference 60 engages the outer circumference of outlet pipe o - rings 40 and 42 , thereby creating a fluid - tight seal between the outlet barrel inner circumference 60 and the outer circumference of outlet pipe o - rings 40 and 42 . o - rings 40 and 42 also create a fluid - tight seal between their inner circumference and the outer circumference of outlet pipe 36 . the outlet element 56 further comprises an outlet passageway 19 which communicates with outlet passageway 37 . when outlet element 56 is engaged with outlet pipe 36 as above - described , it is secured against the bottom 28 of main body portion 13 by lock nut 62 which engages outlet pipe threaded portion 44 . in this embodiment , the outlet element 56 is free to rotate about the central axis 65 of outlet pipe 36 , thereby permitting the outlet nipple 52 to be oriented at any angle in relation to the axis 65 of main body portion 13 . with reference now to fig1 and fig2 the dual inlet passageway 14 has an inlet inner circumference 34 selected to accommodate a main inlet insert 88 . inlet insert 88 comprises a barb 92 , block portion 96 , bearing portion 98 and pipe 94 having main inlet 15 . the block portion 96 is essentially square in cross - section , and the diagonal dimension of said cross - section corresponds to the inner diameter dimension of main inlet passageway 14 , which is essentially circular in cross - section . coaxial placement of the main inlet insert 88 within the inlet inner circumference 34 creates reserve passageways 16 for fuel flow which will be described herein in further detail . the main inlet insert 88 is provided with main inlet 15 which will communicate with valve chamber 18 in a manner which will be described main inlet insert is a secure press fit into passageway 14 , and is secure from movement once assembled into passageway 14 . referring now to fig1 fig3 and fig6 it will be seen that a principal operative element of the invention is ball valve element 66 , which is positioned within valve chamber 18 via ball valve entry 46 . as can be appreciated from reference to both fig1 and fig6 the valve chamber 18 is substantially cylindrical , having an inner diameter which corresponds to the outer diameter of the ball portion 68 of ball valve element 66 . ball valve element 66 is provided with a ball valve inlet 70 and outlet 72 , interconnected by passageway 74 . preferably , ball valve element 66 is monolithic , and includes a stem 76 located at one portion of the circumference of the ball portion , and a plug 77 located at a diametrically opposite portion of the ball portion 68 . in this fashion , ball valve outlet 72 is formed within plug 77 and communicates with passageway 74 of ball portion 68 , which in turn , communicates with ball valve inlet 70 , thereby creating a flow path for fluid from the ball valve inlet 70 through the ball valve passageway 74 formed inside a ball portion 68 , which further communicates with outlet 72 . ball valve element 66 is captured within the valve body 12 . plug 77 engages outlet 39 formed in the bottom 28 of valve body 13 . seal 82 surrounds the outer circumference of stem 76 and engages the valve entry inner circumference 48 as well as the top 26 of main valve portion 13 . preferably , the seal 82 is a press fit into the valve entry inner circumference 48 to create a fluid - tight seal with valve body 12 . the assembled orientation of the various components will be appreciated by reference to fig2 and fig3 . when assembled , ball valve element 66 is pivotably disposed within valve chamber 18 by engagement of plug 77 with outlet 39 and the engagement of the outer circumference of stem 76 with the inner circumference of the opening in seal 82 . this configuration permits ball valve element 66 to be rotated about an axis 65 which is perpendicular to the longitudinal axis of the main inlet insert 88 as positioned within the dual inlet passageway 14 . pivotal movement of ball valve element 66 serves to orient the ball valve inlet 70 in relation to the main inlet insert 88 as will be described in further detail herein . rotation of the ball valve element 66 is facilitated by the inclusion of operating handle 80 affixed to stem 76 . the placement of main inlet insert 88 within main inlet passage 14 creates a plurality of reserve inlet passageways 16 positioned circumferentially around the central axis of the dual inlet passageway 14 as shown in fig2 . the square cross - section of the main inlet insert 88 juxtaposed with the circular cross - section of the dual inlet passageway 14 creates four reserve inlet passageways 16 having sufficient cross - section to permit necessary fuel flows as will be described . an understanding of the function of the ball valve assembly 10 in relation to a typical fuel tank is depicted in fig4 . preferably , the ball valve assembly 10 is threadably engaged to a threaded fitting 102 affixed to a fuel tank wall 100 . in this embodiment , the valve body 12 is mounted utilizing the threaded boss 32 within a threaded fitting 102 on the bottom of a fuel tank . as can be readily perceived from the drawing , it is equally feasible to mount the ball valve assembly in the top of the tank , assuming that suitable adjustments are made in the overall length of the various inlet components herein described . typically , a screen filter 120 is fitted to enclose the inlet elements of the assembly . the ball valve assembly 10 may be likewise mounted to the tank utilizing a mounting nut and sealing washer to establish a fluid - tight seal between the valve body and the tank wall 100 . when the level of fuel in the tank is at or above a reference level a , it can be seen that fuel can readily follow main flow path m within riser 104 . at the same time , fuel is permitted to flow through reserve flow path r and through the reserve inlet passages 16 . however , since the position of ball valve element 66 is such that ball valve inlet 70 is in axial alignment with dual inlet passageway 14 , fuel flow through reserve inlet passages 16 enters valve chamber 18 , but is prevented by the configuration of the ball portion 68 of ball valve element 66 , together with its associated o - rings , from passage out of valve chamber 18 , by virtue of the alignment of the valve inlet 70 with the axis of insert 88 . once the level of fuel has dropped below reference line a , it will readily be seen that with the level of fuel below the lip 106 of riser 104 , fuel can no longer follow main flow path m to enter main inlet passage 14 , and the supply of fuel within the passageway will soon be exhausted . such interruption in the supply of fuel may be anticipated by providing an appropriate gauge with a “ empty ” or “ reserve ” marking in association with the fuel tank levels , or may be annunciated by the stoppage of the engine being fed through the ball valve assembly 10 . in any event , when it is desired to be able to utilize that portion of the fuel in the tank below reference line a , ball valve element 66 may be rotated 900 , thereby positioning the ball valve inlet 70 perpendicular to the flow path of fuel through the main inlet passage 14 . such position is indicated in fig5 . in this position , portions of the outer surface of ball portion 68 engage bearing portion 98 of insert 88 , and sealing o - rings 114 , thereby closing off further possible flows through the main flow path m . this sealing is desirable to prevent the introduction of air into the fuel flow path through the main fuel flow path m . still , in this position , fuel entering the valve chamber 18 through the reserve inlet passages 16 is free to flow into ball valve inlet 70 through passageway 74 to outlet 72 . in this fashion , a “ reserve ” level of fuel within the fuel tank may be selected to permit continued engine operation . to interrupt all fuel flow through the valve assembly 10 , ball valve element 66 is rotated an additional 90 ° to the position depicted in fig6 . in this orientation of ball valve element 66 , it can be seen that the central axis of ball valve inlet 70 is oriented opposite to the central axis of main inlet 15 , thereby sealing the circumference of ball valve inlet 70 from valve chamber 18 . in this valve position , although fuel may enter the valve chamber 18 though reserve inlet passages 16 , fuel is not permitted to pass to the ball valve inlet 70 , as o - rings 114 seal the surface of ball portion 68 against the wall of valve chamber 18 , thereby shutting off all fuel flow from both the main inlet 15 and the reserve inlet passages 16 . in this fashion , fuel flow can be selectively stopped . it is desirable in this embodiment of my invention to provide the ball valve assembly 10 with a combined indicator / stop plate 130 surrounding stem 76 and affixed to top 26 and seal 82 . this plate 130 which is secured from rotational movement in relationship to stem 76 , but located coaxially therewith , is provided with legends “ on ”, “ off ”, and “ reserve ”. further , such element may be provided with stops 132 which limit the travel of operating handle 80 , and thereby limit the operating travel of ball valve element 66 , through an arc of 180 °. the legends on the plate 130 correspond with the positions of the operating handle 80 , and , accordingly , the position of the ball valve inlet 70 in relation to the valve chamber 18 , the reserve inlets 16 and main inlet 15 . one or more detents 134 may be formed in the plate 130 to engage handle 80 . utilizing legends on this plate 130 , the operator can correctly select the position of the ball valve element 66 to permit flow of fuel from either the main inlet passage 15 or the reserve inlet passages 16 , or to shut off the flow of fuel altogether . the threaded boss 32 and riser pipe 104 , are preferably provided with filter 120 as shown in fig4 to prevent contaminants within the fuel tank from passing to the motor . at the discharge or outlet side of the assembly the outlet nipple 52 is provided with barbs 54 designed to engage flexible hose ( not shown ) to further route the fuel flowing through the assembly to its desired destination . by positioning the main and reserve inlet passages as above - described , it can be seen that the assembly may provide both main and reserve fuel flow passages within a single essentially cylindrical element which is relatively inexpensive to manufacture and simpler to install in fuel tanks than those valve assemblies currently known . having thus described my invention , numerous modifications will be apparent to those of ordinary skill in the art without departing from the invention herein described , which | 8 |
the following description with reference to the accompanying drawings is provided to assist in a comprehensive understanding of exemplary embodiments of the present invention as defined by the claims and their equivalents . it includes various specific details to assist in that understanding but these are to be regarded as merely exemplary . accordingly , those of ordinary skill in the art will recognize that various changes and modifications of the embodiments described herein can be made without departing from the scope and spirit of the invention . also , descriptions of well - known functions and constructions are omitted for clarity and conciseness . a method and apparatus of exemplary embodiments of the present invention will be described hereinafter for mimo decoding with outputting soft decisions using the complex - valued integer lattices in a mimo wireless communication system . the technical results of exemplary embodiments of the present invention consist in increasing the operational speed and in increasing the accuracy of the method for mimo signal decoding . for a better understanding of the present invention , a detailed description of exemplary embodiments thereof is adduced hereinafter , accompanied with respective drawings . fig1 illustrates graphs of the ber of u . s . pat . no . 6 , 724 , 843 ( blast - lr ), mmse osic of the lee algorithm ( lee - blast ) and mimo signal decoding ( lr - soft and lr - soft4 ) made according to an exemplary embodiment of the present invention . the 2 × 2 mimo - ofdm system having the ldpc decoder with respect to a value of the signal - to - noise ratio is exemplary . referring to fig1 , the channel model corresponds to a sui - 3 model . the lr - soft4 variant differs from the lr - soft variant by a number of candidates for the second layer , which is , respectively , one and four . line 100 corresponds to the blast - lr , line 200 corresponds to the lee algorithm , and lines 300 and 400 correspond to an exemplary embodiment of present invention . the drawing illustrates a reduction of the ber ( decrease of the probability of the bit error at the system output ). fig2 is a block diagram of an mmse osic soft lr decoder made according to an exemplary embodiment of the present invention . in an exemplary implementation , the modulation map may be a 16 - qam . referring to fig2 , the mmse osic soft lr decoder includes a channel transformer 205 , a first qr decomposition unit 206 , a lr unit 207 , a secondary qr decomposition unit 208 , a linear filter 209 , a nulling unit 210 , a first candidate selector 212 and a secondary candidate selector 211 . the channel transformer 205 receives a signal transmitted by two transmitting antennas using two receiving antennas . then , a signal propagation channel is estimated . in this example , the signal propagation channel is the relay two - dimensional mimo fading channel that has two transmitters and two receivers , and is characterized by a channel matrix h of a size of 2 × 2 as shown in equation 2 below : where , y refers to a received vector signal , x refers to a transmitted vector signal , an h refers to a channel matrix . here , each element of the matrix h characterizes a propagation channel between each transmitting and each receiving antenna . the mean energy of the symbol transmitted via one transmitter may be equal to e s = e (| x | 2 )/ 2 , and the noise vector v may have the gaussian distribution having the zero mean and the dispersion σ 2 . the inverse value of the signal - to - noise ratio ( snr ) is defined as α = σ 2 / e s . the input data are h , α and y . the channel transformer 205 obtains a received signal y , a channel matrix h , and an inverse value of the snr α , and outputs an extended matrix ĥ to a first qr decomposition , after transforming of the channel matrix h into the extended channel matrix ĥ . the extended matrix is expressed as shown in equation 3 below : where h refers to a channel matrix , i refers to an identity matrix , α refers to an inverse value of the snr . the first qr decomposition unit 206 decomposes , using the sorted qr decomposition , the extended channel matrix ĥ into equation 4 : here , the index 1 illustrates that the ordered qr decomposition is used in the method for the first time . matrices p , q , d , and r refer to , respectively , a permutation matrix , an orthogonal matrix , a diagonal matrix and an upper triangular matrix . the matrices p , d , r have the size 2 × 2 , the matrix q has the size 4 × 2 . the lr unit 207 decreases for the second column of the r 1 , ( greater than one in absolute value ) off - diagonal elements of the matrix r 1 , and then the previous columns of the r 1 multiplied by corresponding integers are subtracted from the current column . for example , if the absolute value of one of components r jk ( real or imaginary ) is greater than 1 , the real and imaginary parts of the r jk are rounded off , thus obtaining a complex integer quantity μ , and the column j is μ times subtracted from the column k ( i . e ., each element of the column j is multiplied by the integer complex μ and subtracted from the corresponding element of the column k ). in so doing , the off - diagonal elements of columns of the matrix r 1 are processed sequentially upward from the diagonal . simultaneously with altering ( decreasing of the off - diagonal elements ) the matrix r 1 , the transforming matrix t such that r 1 t − 1 remains unchanged . the subtraction of the column having the index j from the column k results in the following transformation of the matrices r 1 and t : r 1new ( m , k )= r 1 ( m , k )− μ r 1 ( m , j ) t 1new ( m , k )= t 1 ( m , k )− μ t 1 ( m , j ) [ equation 5 ] where , m refers to an index of symbol . k , j refer to an index of column in matrix . here , initially ( in the beginning of lr algorithm ), the matrix t is an identity matrix of the size of 2 × 2 . it should be noted as well that the t at every step would be a complex integer top unitriangular matrix . the intent of this step is for the matrix r 1 t ={ tilde over ( r )} 1 to become closer to the normal one than the matrix r 1 , therefore the mutual influence of the layers in solving the system with the matrix { tilde over ( r )} 1 is less than in solving the system with the matrix r 1 . the linear filter 209 performs filtering of the received signal y and outputs the filtered y . the filtered y is expressed as shown in equation 7 below : where { circumflex over ( q )} 2 =[ i 0 ] q 2 refers to the first two rows of the matrix q 2 , the vector s = e +√{ square root over (− 1 )} e , the vector e has the both components equal to one , and the matrix π = 2 p 1 tp 2 . it is important that the matrix the nulling unit 210 solves r 2 z = f with building candidates and estimations of their probabilities at each layer as follows . for the order two , the permutation matrix p 2 can take only two possible values . the permutation corresponding to the matrix p 2 is either trivial or the reverse permutation . if the permutation is trivial , then the component z 2 minus the noise portion belongs to a complex - valued integer - valued plurality ω , having , in the example with the 16 - qam , ω = θ +√{ square root over (− 1 )} θ , where θ ={− 2 , − 1 , 0 , 1 }. four elements of the ω nearest to the z 2 in the euclidean metric ( referred to as candidates ) are selected , and conditional probabilities are assigned to them according to the equation where { circumflex over ( z )} 2 refers to a component z 2 minus the noise portion , and s refers to an element of the ω . these probabilities are normalized on the assumption that the selected four candidates form exhaustive events . each candidate is used in the reverse substitution in solving the above system with the matrix r 2 , and the value x1 being obtained is also approximated by four ( or one in another variant of the method ) elements of the ω nearest to the x1 in the euclidean metric . here are calculating formulae : calculating z 1 = f 1 − r 12 { circumflex over ( z )} 2 , where r 12 is an off - diagonal element of the matrix r 2 , and { circumflex over ( z )} 2 is the current candidate ; calculating x 1 = z 1 + t 12 { circumflex over ( z )} 2 ; and determining four ( or one ) of the best approximations of x 1 from the ω in the euclidean norm ; one of such approximations being designated as { circumflex over ( x )} 1 . the vector - candidate corresponding to { circumflex over ( z )} 2 is p 1 ({ circumflex over ( x )} 1 , { circumflex over ( z )} 2 t , and a probability in the form of a product of values ([ equation 8 ]), calculated for every component of the vector - candidate , is assigned to the vector - candidate . or else , the component z 2 minus the noise portion belongs to a more complex set , namely ω − t 12 ω , where t 12 is the element of the matrix t in the position ( 1 , 2 ). geometrically , this is an aggregate of sixteen copies of the ω shifted by constants . it is necessary to make all operations mentioned for the case of the trivial permutation p 2 beginning from the four elements nearest to the z 2 in the euclidean metric , taking into account that the approximating set is more complex . since the complete enumeration of 256 elements could be difficult , in the beginning , four copies of the ω nearest to the z 2 in the euclidean metric are selected , and four nearest elements are selected in each of copies , and sixteen elements being obtained are sorted with retention of the four nearest elements . if | t 12 |& lt ; 3 , then the copies of the ω converge forming no gaps at the complex integer - valued lattice , and a simple decision on selection of four candidates exists : it is necessary to check each of eight nearest neighbors . the simulation shows that said inequality is fulfilled in a great number of instances . further , for each candidate { circumflex over ( z )} 2 , the z 1 = f 1 − r 12 { circumflex over ( z )} 2 is created , four ( or one ) candidates { circumflex over ( x )} 2 ∈ ω are calculated for the z 1 and the component { circumflex over ( x )} 1 ={ circumflex over ( z )} 2 + t 12 { circumflex over ( x )} 2 is calculated . if { circumflex over ( x )} 1 ∉ ω , then the pair { circumflex over ( x )} 1 , { circumflex over ( x )} 2 is recognized as bad , otherwise , if { circumflex over ( x )} 1 ∈ ω the vector - candidate p 1 ({ circumflex over ( x )} 1 , { circumflex over ( z )} 2 ) is created , a probability in the form of a product of values [ equation 8 ] calculated for each component of the vector - candidate being assigned to the vector - candidate . the first candidate selector 212 and secondary candidate selector 211 calculate bit probabilities using gray codes with summarizing for every bit the probabilities of vector - candidates in which this bit is equal to one , and normalizing the obtained values to the sum of all bit probabilities . the basis for the method is associated with the fact that there is a priori information that an actually sent vector { tilde over ( x )} has components from the preset modulation map , for example a 16 - qam . let us introduce a vector in order that the { circumflex over ( x )} having components from the complex - valued integer - valued set ω with the minimal distance between neighbors corresponds the really sent vector . a hard decision results by substituting the two last steps with the following prescriptions . first , solving a linear system r 2 z = f with rounding the decision at each layer to the nearest complex - valued integer . designating the obtained decision vector as { circumflex over ( z )}. the key property of the lr technique is as follows : the vectors { circumflex over ( x )} and { circumflex over ( z )} run one into another by a linear operator with a complex - valued integer - valued matrix : just the formula ( equation 9 ) describes a transition from the original lattice to a modified one , and said property permits to reduce significantly a number of candidates for enumeration ( in comparison with the maximal possible number ). in the two - dimensional instant , the formula ( equation 9 ) looks like the following as shown in equation 10 below : z ip2 ( 1 ) ={ circumflex over ( x )} p1 ( 1 ) t 12 x p1 ( 2 ) [ equation 10 ] here , p 1 ( 1 ) refers to an index of the unity element in the first column of the p 1 , p 1 ( 2 ) refers to an index of the unity element in the second column of the p 1 , ip 2 ( 1 ) refers to an index of the unity element in the first row of the p 2 , ip 2 ( 2 ) refers to an index of the unity element in the second row of the p 2 . a number of candidates at every layer is an algorithm parameter , the simulation shows that the value four is sufficient for the first layer , and the value one is sufficient for the second layer . the use of an exemplary embodiment of the present invention permits to improve the accuracy in estimating errors conditioned by a wrong hard decision , which results in improving the mimo system characteristics . the latter is illustrated by the ber function in fig1 . in an exemplary implementation , the ordered qr decomposition ( sqrd ) for the matrix of complex values is performed using the modified gram - schmidt technique : where q refers to an unitary matrix , d refers to a diagonal matrix , r refers to a top unitriangular matrix . the description of this technique in the general case of m × n is as follows . columns of the h refer to h 1 , h 2 , . . . , h n , columns of the q refer to q 1 , q 2 , . . . , q n . the matrix q is altered step by step in the iteration process . the iteration steps k , k = 1 , . . . , n , are considered . then the gram - schmidt technique includes the following operations : 1 . a column having the least euclidean length is selected among columns h k , . . . , h n , taking into account only components of columns having an indices greater than k , and this column is exchanged with the h k . thus , the columns are obtained which are disposed in a new order . 2 . the euclidean length of the h k is calculated and the inverse value of this length is recorded into the k - th diagonal element d . the normalized h k is recorded into the q k . 3 . the columns h k − 1 , . . . , h n are re - counted according to the equation h j =( i − q i q * k ) h j , where j = k + 1 , . . . , n , the scalar product q * k h j being recorded into the kj position of the matrix r . further , the comparison of the computational complexity of an exemplary embodiment of the present method ( referred to as clr , complex lattice reduction ) with the method ( referred to as real lattice reduction ( rlr )) and known decoding mimo methods ( zf and mmse ) are adduced in connection with the system 2 × 2 : where a is the addition , d is the division , and r is the square root ( or the inverse square root ). the primed letters mean the operations with real numbers , the usual letters mean the complex operations . referring to table 1 , it can be seen that the difference in the computational complexity of the rlr method in comparison with the zf and mmse methods is sufficiently great , which is a serious obstacle in the way of implementing the rlr method . as could be seen from the same table 1 and fig2 , an exemplary embodiment of present method ( clr ) allows to decrease significantly the number of computational operations in comparison with the rlr method while maintaining the same decision accuracy . even at m being equivalent to 4m ′ ( which is a rather ineffective technique for realizing the complex multiplication ), the clr , at the stage of initialization , requires twice as little operations than the rlr . the difference between lr and clr consists also in a number of memory cells that should be moved : here , the letter p denotes “ clean ” operations for transferring the memory cells , which operations are used for copying the elements of the channel matrix prior to performing the ordered qr decomposition . in the case of the rlr they are added by the procedure of “ unfolding ” the complex channel matrix onto the four - block real matrix . the numbers without letters are the sum of previous table rows , since every operation assumes the data transfer . fig3 is a flowchart of a decoding operation in a mimo wireless communication system according to an exemplary embodiment of the present invention . referring to fig3 , the decoder receives a signal transmitted by two transmitting antennas using two receiving antennas . in step 302 , a signal propagation channel is estimated ( h ). in step 304 , the decoder transforms the channel matrix h into an extended channel matrix ĥ . in step 306 , the decoder decomposes the extended channel matrix ĥ into p 1 , q 1 , d 1 and r 1 using the first sorted qr decomposition . p 1 , q 1 , d 1 , and r 1 refer to , respectively , a permutation matrix , an orthogonal matrix , a diagonal matrix and an upper triangular matrix . in step 308 , the decoder performs a complex lattice reduction ( lr ) algorithm . namely , the decoder decreases for the second column of the r 1 , great ( greater than one in absolute value ) off - diagonal elements of the matrix r 1 , and then the previous columns of the r 1 multiplied by corresponding integers are subtracted from the current column . for example , if the absolute value of one of components r jk ( real or imaginary ) is greater than 1 , the real and imaginary parts of the r jk are rounded off , thus obtaining a complex integer quantity μ , and the column j is μ times subtracted from the column k ( i . e ., each element of the column j is multiplied by the integer complex μ and subtracted from the corresponding element of the column k ) ( referring to equation 5 ). into p 2 , q 2 , d 2 and r 2 using the secondary sorted qr decomposition . p 1 , q 1 , d 1 and r 1 refer to , respectively , a permutation matrix , an orthogonal matrix , a diagonal matrix and an upper triangular matrix . the t refers to a transforming matrix . in step 312 , the decoder performs filtering the received signal and outputs the filtered received signal ( referring to equation 7 ). in step 314 , the decoder selects the candidate vector , and in step 316 , the decoder transform the signal of lr space into the signal of original space using reverse lr algorithm . in step 318 , the decoder outputs information bits mapping constellation dot in original space . the present invention can be used in radio - technical devices . also , the present invention is simple enough from the viewpoint of complexity , and therefore can be used in the mimo - ofdm systems . while the invention has been shown and described with reference to certain exemplary embodiments thereof , it will be understood by those skilled in the art that various changes and modifications in form and details may be made therein without departing from the spirit and scope of the invention as defined by the appended claims and their equivalents . | 7 |
with reference to the figures , in which like numerals refer to like elements , the following generally describes an apparatus 10 of fig1 for collecting paper currency donations . in a preferred embodiment , the apparatus is intended to collect paper currency donations but it may also be used in any situation where lightweight material of a similar size and shape needs to be moved from one location to another . airflow device 12 provides an air flow through the entire apparatus . in a preferred embodiment , airflow device 12 is a squirrel cage fan but any suitable device for generating air flow may be used . as shown in fig1 , the entire apparatus is mounted to a wall using brackets as shown at 36 but it is also possible to provide a free - standing support structure for the apparatus . for example , a free - standing support structure could comprise a number of posts or a grid of support poles in a two - or three - dimensional arrangement . the inventive apparatus could also be wholly or partially suspended from the ceiling . airflow device 12 should be securely mounted at an appropriate distance from the rest of the apparatus . in fig1 it is shown as being mounted above the rest of the apparatus but it may also be mounted on any side or below the apparatus , as well as behind the wall or under the floor . the exact location of airflow device depends on site - specific requirements . factors influencing the decision of where to place the fan are safety , secure mounting location , noise of the device , speed of air flow generated by the device and length of tubing . the location of the airflow device can be adjusted to maximize or minimize all of these factors as needed . air flow generated by airflow device 12 travels through tubing section 14 to donation box 16 . tubing section 14 may be made of flexible or rigid tubing or a combination of both , depending on cost , availability and site - specific constraints . tubing section 20 is connected to a side of donation box 16 directly opposite tubing section 14 . donation box 16 includes a slot 18 for a patron to insert paper currency . slot 18 is shown as a narrow rectangle but any preferred shape could be used . after inserting the paper currency into donation box 16 , the patron moves to diverter box 22 and uses handle 24 to set air diverter flap 26 in either a right or left position , then starts airflow device 12 using button 46 , which should be located in close proximity to diverter box 22 . when air diverter flap 26 is swung to the right , tube 32 is blocked causing the inserted paper currency to flow through tube 20 into the diverter box , through tube 28 and into collection box 30 . when air diverter flap 26 is swung to the left , tube 28 is blocked causing the inserted paper currency to flow through tube 20 into the diverter box , through tube 32 and into collection box 34 . it would also be possible to let airflow device 12 run continuously in which case the patron would select a position of air diverter flap 26 before inserting paper currency into slot 18 . in an embodiment , button 46 , in addition to activating airflow device 12 , lights up and , when activated , causes an audible indication that a donation has been made , for example a bell , whistle or siren . tubing sections 20 , 28 and 32 may be made from transparent , flexible plastic with an internal wire coil . a transparent material is most advantageous for the purposes of the invention so that patrons can see the movement of their donated currency through the apparatus but the tubing could also be opaque . the sections of tubing may be curved or straight . as shown in fig1 , tubing section 28 is in a spiral shape while sections 20 and 32 are more of a freeform shape . the specific arrangement of the tubes and boxes 16 , 22 , 30 and 34 is flexible and depends on site - specific constraints . it is important that paper currency moving through the tubes can move freely and not get caught anywhere . a certain amount of experimentation is required during installation to determine the minimum curvature of the tubes that will provide free flowing paper currency . tubing sections can be connected to each other and to all other components in a variety of ways that would be well known to one of ordinary skill in the art , including pvc connectors , brackets or collars and thumb screws . each tubing section may also be installed in multiple pieces , connected so as to provide a continuous air flow from one component to the next . the last 1 . 5 to 2 feet of tubing sections 28 and 32 is made with rigid material that is vented with holes as shown at 38 and 40 . this rigid material may be a pvc pipe but other materials with equivalent characteristics may be used . as the donated currency moves into tubing section 38 or 40 , the air flow generated by airflow device 12 is vented through holes in the tubing sections . this allows the donated currency to drop down into collection boxes 30 and 34 with the aid of gravity . in an embodiment , optical sensors may be provided in tubing sections 38 and 40 or at the input of collection boxes 30 and 34 as shown in fig3 so as to detect when a piece of paper currency passes and trigger a visual or audible indication that a donation has been made . donation box 16 and collections boxes 30 and 34 are suitably made of clear or transparent acrylic glass , available commercially under a wide variety of trade names , so that patrons may see the movement of the donated currency . boxes 30 and 34 are provided with a hinged cover so that donated currency may be removed , as explained in more detail in accordance with fig3 . diverter box 22 may have a clear or transparent front cover with a fabricated aluminum back and sides as explained in more detail with regard to fig2 . in an embodiment , apparatus 10 is mounted to a wall using brackets 36 and other suitable attachment devices for the various components . decorations may be applied to the wall and various components of apparatus 10 to support the theme of the installation as shown by the cloud representations at 42 and 44 . cloud shape 42 also provides a location for suitable signage . other themes may be used as desired . various components of apparatus 10 may also be colored so as to assist a patron to select which collection box would receive the donated currency . for example , tube 38 and the brackets attaching tube 28 to the wall may be one color , while tube 40 and the brackets attaching tube 32 to the wall may be another color . in an embodiment , apparatus 10 may also include additional diverter boxes and collection boxes . for example , the input of an additional diverter box could be connected to one of the outputs of diverter box 22 . the outputs of the additional diverter box could then be connected to two collection boxes via additional tubing sections , providing the patron with a selection of three collection boxes . the number of diverter and collection boxes is limited only by the speed of airflow device 12 and site - specific constraints such as available space . fig2 a , 2 b and 2 c show more detailed views of diverter box 22 . in a preferred embodiment , diverter box 22 is triangular but any suitable shape that provides good air flow and suitable mounting surfaces for the tubing sections could be used . in fig2 a , side panels 50 are made from fabricated aluminum but any sturdy material could be used , for example , wood or steel . a back triangular surface of diverter box 22 is also made of aluminum . front cover 52 is suitably made from clear or transparent acrylic glass . flanges 54 and 56 in side panels 50 are used to attach tubing to the box . there is an additional opening in the third side of the box , shown in more detail in fig2 b . air diverter flap 26 is made of rigid , machinable shatter - resistant plastic and is suspended from a rod that extends across the top of box 22 through the front cover and back surface of the box . air diverter flap 26 has a handle 72 which a patron uses to move the air diverter flap into a desired position . deflectors 58 in the bottom right and left corners of diverter box 22 are used to improve airflow in the diverter box and prevent paper currency from becoming trapped in one of the corners . they are preferably made of plastic but any suitable material may be used . fig2 b shows additional details of diverter box 22 . flanges 54 , 55 and 56 are suitably made of aluminum and welded to side panels 50 . in an embodiment , couplers 60 and 61 are used to attach tubing sections to diverter box 22 using thumbscrews . a similar coupler , not shown , is used to attach a tube to flange 56 . one of ordinary skill in the art would be able to devise a number of ways to attach tubing sections to the flanges for instance , by using clamps and pvc couplers . front cover 52 is attached to side panels 50 using screws and holes 62 disposed around the front edge of side panels 50 . this allows easy access and maintenance of diverter box 22 and air diverter flap 26 . gaskets 64 and 65 are made of a soft plastic , for example , neoprene , and are glued to the inside of side panels 50 . they provide a buffer and better air seal between air diverter flap 26 and side panels 50 . air diverter flap 26 is shown in more detail in fig2 c . flat portion 76 is attached to rod 78 and extends downward . rod 78 extends through the front and back covers of diverter box 22 . bearings 70 in the plane of the front and back covers provide for rotation of air diverter flap 26 so that openings 54 and 55 in diverter box 22 may be covered as desired by the patron . rod 78 extends outward through the front cover 52 . a curved handle 72 ending in a plastic ball 74 is attached to the extending portion of rod 78 . in a preferred embodiment , handle 72 and ball 74 allow patrons , especially young children , to successfully grasp and move the air diverter flap but any equivalent handle shape may be used . handle 72 is used by a patron to move air diverter flap 26 into a desired position . in a preferred embodiment , rod 78 is approximately 0 . 75 inches in diameter with 0 . 5 inch diameter projections extending through bearings 70 . collection box 30 is shown in more detail in fig3 . the following description also applies to collection box 34 . collection box 30 includes four side panels and a back panel , generally shown at 90 . collection box 30 also includes a front cover 92 which is connected to the rest of the box by hinges 96 . a lock 94 is provided to protect the contents of the box and allow controlled removal of donated currency . although collection box 30 has been shown with a hinged cover , other embodiments , for example a cover that slides open , would be well known to one of ordinary skill in the art . it would also be known to substitute other mechanisms for locking the box . in a preferred embodiment , collection boxes 30 and 34 are made with transparent acrylic glass but one of ordinary skill in the art would be able to make them our of any suitable material , including wood or metal . tubing section 38 extends upward from collection box 100 . tubing section 38 can be made of pvc or any rigid material that can be connected to tubing section 28 shown in fig1 . in a preferred embodiment , venting holes 100 are drilled in an equidistant pattern along the length of the pipe as shown in fig3 . venting holes 100 are approximately 0 . 5 inches in diameter and are also continue around the back portion of tubing section 38 not shown in the figure . venting holes 100 are used to cut down the air pressure flowing through apparatus 10 and allow the paper currency to drop down into collection box 30 . although the apparatus is shown with circular holes to vent the air flow , it would be understood by one of ordinary skill in the art that any shape or configuration could be used as long as the air flow was reduced adequately . in an embodiment , collection box 30 may also include sensors 102 which detect when a piece of paper currency passes and trigger a visual or audible indication that a donation has been made . fig4 a shows the air flow through apparatus 10 when in operation . when a patron has inserted some paper currency into donation box 16 , the air diverter flap is set in diverter box 22 and airflow device 12 is activated using button 46 . in a preferred embodiment , button 46 lights up and , upon activation of the button , there is an audible indication that the button has been pressed , for example a bell , whistle or siren . after activation , airflow device 12 operates for a suitable amount of time required to move the paper currency to a collection box , approximately 15 seconds , then shuts off . the diameter of tubing 14 is reduced as it enters donation box 16 as shown in fig4 b so as to provide an appropriate pattern of air movement in the box and keep currency from becoming lodged in corners of the box . air flow continues through tube 20 to diverter box 22 . diverter box 22 is triangular shaped with deflectors in the bottom two corners as explained in further detail with regard to fig2 a . this provides a circular air flow as shown in fig4 c which keeps the currency moving freely through the diverter box 22 and into either tube 28 or 32 , as chosen by the patron . finally , air flow is vented through holes in tubing 38 or 40 as explained above with regard to fig3 . fig5 shows an alternative embodiment including a second diverter box 104 . air flow may be directed using an air diverter flap in diverter box 104 into tubing 106 and collection box 108 , or into tubing 110 and collection box 112 . one of ordinary skill in the art would understand how any number of diverter boxes and collections boxes could be combined to arrive at a desired configuration . from the foregoing description it will be appreciated that the subject invention has the advantages of , among other things , providing : an entertaining way to encourage patrons of an establishment like a museum to donate paper currency ; a way to flexibly and conveniently move any type of lightweight material , for example , pieces of paper or envelopes , from one place to another . furthermore , it will be appreciated by those skilled in the art that , while specific embodiments of the invention have been described in detail , various modifications and alternatives to those details could be developed in light of the overall teachings of this disclosure . accordingly , the particular arrangements disclosed are meant to be illustrative only and not limiting as to the scope of the invention which is to be given the full breadth of the appended claims and any equivalents thereof . | 6 |
the machine tool as illustrated in fig1 - 3 comprises a vertical support 10 provided with a vertical guide 11 arranged to have a carriage 12 vertically moved thereon in a controlled manner . on carriage 12 , a workpiece carrier 13 is supported for controlled rotation about a horizontal rotational axis 14 . the workpiece 15 to be machined will be fastened to workpiece carrier 13 . the movement of the carriage 12 along the vertical x - axis is performed by a spindle drive provided internally of support 10 and comprising a spindle 16 , a spindle nut 17 connected to carriage 12 , and a motor 18 rotating the spindle 16 . motor 18 is a nc drive ( nc = numerically controlled ) allowing for a highly accurate height adjustment of workpiece carrier 13 . mounted to carriage 12 is a further nc drive ( not shown ) for rotating workpiece carrier 13 . a lower beam 19 and an upper beam 20 extend horizontally from support 10 . the beams are arranged at a mutual distance and together with the support 10 and a vertical post 21 form a rectangular frame 22 enclosing a rectangular window 23 . arranged in window 23 is a first headstock 24 comprising a rotatably driven spindle 25 with a tool 26 fastened thereto . headstock 24 is arranged to be moved on a carriage 34 in the direction of an axis of movement z 1 extending axially to spindle 25 . carriage 34 is movable in a horizontal guide 27 along a first axis of movement y 1 extending at a right angle to the axial direction of spindle 25 , while traveling in the lengthwise direction of guide 27 . the movements along the axes y 1 and z 1 are carried out by headstock 24 . the movement along the x - axis and the rotation about rotational axis 14 are carried out by workpiece 15 . the mounting surface of the workpiece carrier has a normal line which coincides with the rotational axis 14 and extends parallel to the first axis y 1 . the upper side of beam 19 is provided with a horizontal guide 28 for a carriage 29 having a second headstock 30 arranged thereon . headstock 30 comprises a spindle 31 with a tool 32 fastened thereto . headstock 30 is movable on guide 28 along the first axis of movement y 2 and further along a second axis of movement z 2 extending axially to spindle 31 . the movement along axis of movement z 2 is generated by a linear drive 33 . each of the two spindles 25 , 31 is rotatably driven by a motor 35 and 36 , respectively , of the respective headstock . on support 10 , a tool magazine 37 is mounted which is provided with a circulating continuous endless conveyer 38 equipped with tool carriers 39 projecting therefrom to the outside . each tool carrier 39 comprises two fingers configured for clamping the shaft of a tool 40 therebetween . the tool magazine 37 is arranged in a vertical plane extending parallel to the movement axes y 1 and y 2 . the vertical front strand 41 of the tool magazine projects out of support 10 and comprises two exchange positions , respectively one for each headstock 24 and 30 . a tool 40 arranged in an exchange position can be gripped and taken over by the spindle of the respective headstock 24 or 30 . on the other hand , each headstock 24 , 30 can hand over a tool 26 , 32 attached to its spindle 25 , 31 to that workpiece holder 39 of tool magazine 37 which is arranged in the exchange position . the drive of continuous conveyer 38 is controlled by a motor 42 . as evident from fig2 the vertical support 10 together with the horizontal beams 19 and 20 in plan view forms an l - shaped structure enclosing a machining chamber 43 . machining chamber 43 is further delimited by a side wall 44 and a front wall 45 or door , thus being completely enclosed on the sides . the window 23 surrounded by frame 22 is closed by a louver 46 which is not shown in fig1 . the louver is a lamellar louver comprising two longitudinal slots , one for each headstock 24 , 30 . the slots are closed by lamellae configured to adapt to the respective position of headstock 24 , 30 in the direction of the axis of movement y 1 or y 2 and allowing only the headstock 24 , 30 to pass while the rest of the window 23 will remain closed . the front wall of beam 19 is formed by a vertical skirt 47 . thus , the machining chamber 43 is delimited exclusively by vertical walls . arranged on the lower end of machining chamber 43 is a chip conveyer 48 which can be provided e . g . as a belt or chain conveyer but also as a screw conveyer . the conveyer is sized to occupy the whole width of machining chamber 43 and will remove the dropped chippings from the machine tool . the embodiment according to fig4 is different from the first embodiment only in that , apart from the tool magazine 37 on support 10 , a further similar tool magazine 37 a is arranged on the post 21 . both tool magazines are arranged at the same height and delimit the moving path of the headstocks 24 , 30 in the horizontal direction , wherein each headstock 24 , 30 can access each of the tool magazines 37 , 37 a arranged in a common vertical plane . in both tool magazines 37 , 37 a , the rear or outer strand 50 is arranged externally of support 10 and post 21 and thus will be accessible from the outside for manual exchange of tools . in the embodiment according to fig5 a further support 10 a is provided in addition to support 10 , replacing post 21 . support 10 a comprises a second workpiece carrier 13 a arranged for controlled movement along a vertical guide and for rotation about its horizontal longitudinal axis . the workpiece 15 can by each of its ends be clamped into a workpiece carrier 13 and 13 a , respectively . the workpiece carriers 13 and 13 a are moved in synchronism with each other in the vertical direction and are also rotated in synchronism . this two - sided clamping attachment of the workpiece provides for a highly precise positioning even of bulky or heavy workpieces . on the other hand , an option exists to fasten e . g . an auxiliary bar to one workpiece carrier 13 a ; the bar will be attached to the workpiece and support the same on the respective side . in the embodiment shown in fig6 which largely corresponds to that according to fig5 the two workpiece carriers 13 , 13 a hold a u - shaped holder 55 clamped between them which has its legs 56 attached to the workpiece carriers by axes 57 . the base 58 of holder 55 carries a rotary table 59 for attachment of the workpiece 60 thereon . by pivoting the holder 55 about the axes 57 , the workpiece 60 can be brought into an oblique position so that , using the tool fastened to the respective headstock 24 , 30 , an angular machining process can be carried out . the pivotable holder 55 allows for a quick repositioning of workpiece 60 for performing machining processes on different sites or in different directions . in each of the embodiments according to fig4 - 6 , a laterally closed machining chamber 43 is provided ; in these figures , the walls 44 and 45 have been omitted for easier survey . in any case , chippings will fall down along vertical walls onto a collecting means 48 for chips , e . g . a chip conveyer , without being hindered by fittings . in each of the embodiments , all functions of the machine tool are controlled numerically according to predetermined programs so that the machining of workpieces and the exchanging of tools can be performed fully automatically . also the control of the tool magazine 37 , 37 a is fully automated , wherein the respectively required tool 40 is brought into the exchange position . likewise , the exchange of workpieces 15 and their delivery and removal are performed in a controlled manner . | 8 |
fig3 illustrates an embodiment of a disclosed method 300 for collecting system information while in the process of generating location estimates for mobile devices as requested from a mobile positioning center or other independent requestor . the information collected can then be fashioned to serve the needs of wireless network operators for test and measurement data . in block 210 as discussed with relation to fig2 , the geo - location system receives a request to locate a target mobile appliance along with mobile information . in block 220 , the gcs , based on available information about the target mobile , tasks selected geo - location sensors to detect the mobile appliance &# 39 ; s signal using channel information included in the mobile information . the geo - location sensors selected are typically in the vicinity or proximate to the serving sector or base station . in block 230 the geo - location sensors measure geo - location parameters such as toa , aoa or other signal parameters which assist in estimating the location of the target mobile appliance . the geo - location sensors may also measure and collect signal quality parameters , such as received signal strength ( rssi ) and carrier to interference ratio ( c / i ) as represented in block 360 . one of the selected geo - location sensors ( wls ), which may be in the serving sector for the target mobile appliance , is further tasked to capture a signal sample from the mobile appliance in block 370 . the time duration for the signal sample is selected to be sufficient to capture instructional data which typically includes handoff assistance information measured by the mobile . this handoff assistance information is normally contained in maho ( mobile assisted hand off ) messages . the appropriate sample length may be determined from the frequency in which the instructional data is repeated in a transmission , which is specified for the air interface standard employed by the mobile appliance such as is - 136 , gsm , cdma , etc . the handoff assistance information typically includes received signal strength ( rssi ) on the forward link from the serving base station as well as from one or more neighboring base stations . in prior art systems , this information was only available to system operators through a test drive with a technician operating a specially designed mobile as discussed previously . the signal sample containing the instrumentation data can be demodulated and decoded by a designated primary geo - location sensor to extract the data as indicated by block 380 , transmitted back to the gcs for extracting the information , or stored as a file for later processing . the wlss relay the geo - location parameters , the measured signal quality parameter and other collected data to the gcs . the gcs , using the geo - location parameters , calculates an estimated location for the target mobile , at block 240 , and reports the mobile &# 39 ; s location to the requesting entity , as indicated in block 250 . information such as the mobile &# 39 ; s location , the signal quality parameters measured by the wls , the instrumentation data or signal sample and time stamp , are then stored in a database , as shown in block 390 . this stored information represents substantially simultaneous forward and reverse signal quality parameters . these linked parameters are not available though the prior art test drive method . in the embodiment illustrated in fig3 , the system acquires test and measurement data only for those base stations or sectors involved in the location of the mobile based on an external request . while tasking requests may ultimately be uniform across the network , short or long term eccentricities in the data , or lack - there - of , are sure to occur , resulting in some areas of the network being over - laden with data while other areas only have sparse data . as discussed earlier , the disclosed subject matter makes use of the “ downtime ” or idle periods to direct data collection across the network , thus providing test and measurement data to those data starved areas of the network by focusing on specific sectors or network regions . this self directed data collection may also be used as the sole source of test and measurement data for the network . the embodiment shown in fig4 represents self directed data collection process . with reference now to fig4 , upon the geo - location system entering into an idle state , i . e ., when the geo - location system is not attempting to geo - locate a mobile appliance in response to tasking from an external source , the geo - location system may begin a self - directed test and measurement data collection process . from the idle state 401 , the geo - location system determines , at block 402 , if there are any location requests for the system to process . if a location request is present , then the geo - location system comes out of the idle state and proceeds with either the geo - location process 200 as described with reference to fig2 or with the geo - location piggy - backed with data collection process 300 as described with reference to fig3 . if the system is not being tasked with a location request , ( i . e ., the geo - location system is in an idle state ) then the gcs selects a probe search site at block 403 . it is to be understood by those of skill in the art that if the geo - location system receives a location request task at any point during the process shown in fig4 , the geo - location system stops generating test and measurement data until the location request is satisfied . once the location request is satisfied , the geo - location system then resumes test and measurement data collection until another external task is received , as indicated by block 499 . the probe search site selection by the gcs comprises designating a wls ( and generally one sector of a base station site being serviced by the wls ) as the probe search site . the probe site may be selected as part of a systematic schedule in which data is collected in a routine manner , moving across the network sequentially from one probe site to the next probe site . as appreciated by those of skill in the art , any method of data collection scheduling may be used and is contemplated by the present disclosure . as non - limiting examples , the schedule of data collection may be based on first designating those sectors with sparse measurement data , or the schedule may be a random walk through the network regardless of the amount of data known about a particular sector , or the schedule may be based on sectors or wlss chosen at random , or any other scheduling method . the selection methodology can be pre - programmed , queued by an alarm or be established on the fly through a real time interface by an operator . generally the selection methodology can cover entire market or targeted areas . continuing with the description of this embodiment of the disclosure , at block 404 , the wls at the probe site begins to scan in frequency / time slot / code to detect an active mobile operating within its sector to serve as a source for test and measurement data . the frequency / time slot / code information may be based on known operating parameters for the network or specific information from the gcs . once a mobile ( the “ probe mobile ”) is detected , the wls determines the reception quality for the probe mobile &# 39 ; s signal by testing , for example , received signal strength ( rssi ), bit error rate ( fer ), frame error rate ( per ), etc ., at block 405 . if the wls determines that the probe mobile &# 39 ; s signal is being received with sufficient quality , then the wls informs the gcs that an acceptable mobile signal has been received . this determination may be based on a comparison of the signal quality parameters of the probe mobile to a threshold . as will be understood by those of skill in the art , the wls may detect a probe mobile located in a sector other than a sector of interest , and if the probe mobile &# 39 ; s signal quality exceeds the threshold , the likelihood of the probe mobile being located in the sector of interest is improved . if the probe mobile &# 39 ; s signal quality is not acceptable , the wls will continue to scan for another active mobile appliance . the gcs operates on the information that a probe mobile signal has been received in a manner similar to the situation where the gcs receives information during external location request tasking , i . e ., the gcs chooses a set of wls units in the area that surrounds the probe search site ( and / or the probe mobile ) and requests that rf measurements be made as shown in block 220 . however , since the gcs is in test data collection mode and not operating in response to a tasked request , the operator is free to experiment with different search and selection protocols , which adds additional flexibility to the test and measurement scheme . these may include increasing the number of tasked wls units to collect more comprehensive test data at distant neighbor sites to the serving sector site . the tasked wls units make rf measurements on the probe mobile including , but not limited to , geo - location parameters , block 230 , and signal quality parameters , block 360 . the signal quality measurements may include , but are not limited to , received carrier to interference ration ( c / i ) and received signal strength ( rssi ). these and other measurements are passed to the gcs is the same manner as if in a standard mobile location scenario . additionally , the primary site ( the serving sector wls ) receives and stores a segment of rf transmission from the probe mobile , at block 370 , and demodulates and decodes the segment to find any instrumentation data that may be present , at block 380 . the length of the stored segment , as discussed previously , is chosen so that the desired data will likely be present . the instrumentation data of interest typically includes handoff assistance information measured by the mobile and provided to the network to manage site to site handoffs . this data routinely comprises measurement data made by the mobile on neighbor cell sites ( typically rssi measurements on forward link transmissions from the neighbor cell sites ). this data is forwarded to the gcs by the primary wls . as referred to in the discussion of fig3 , an actual signal sample may also be relayed to the gcs where it is demodulated and decoded as needed or where processing functions are more readily available . the gcs completes the normal location estimation process using measurements from participating wls units in block 240 . the gcs adds this test and measurement record to a database in block 390 . the data in the record may include , but is not limited to , the location of the probe mobile , the time of the measurement , the c / i and rssi data at the serving and neighboring cells for the reverse link , and the rssi for neighboring cells for the forward link . while the step elements shown in fig4 , as well as in fig3 , are shown as proceeding in series or parallel in relation to each other , the steps relating to measuring the rf signals , namely 230 , 360 and 370 need not necessarily be carried out according to the relationship shown . the geo - location system constantly monitors for a location request and aborts the self directed data collection at any time a request is received and does not restart the self directed collection again until the location request has been satisfied as indicated by block 499 . using the above - described test and measurement method , large amounts of test and measurement data for the network can be collected thereby generating a comprehensive , near simultaneous view of operation of the network for wireless carrier purposes . the selection of the probe search site can also be accomplished by any of a number of methods , and the designation of the desired neighbor sets can also be chosen by any of a number of different methods , including designating experimental neighbor sets . the probe search sites can be general and cover the entire network , or focused on specific areas of interest . the probe search sites may be chosen in accordance with an a priori plan or on the fly with a real time command interface . the neighbor lists for measurements can be generated based on the handoff neighbor list , or by a distance algorithm from the serving sector , or any other predetermined or user - interface on the fly method . the collected test and measurement data can be stored in a database , or simple file for batch review , or output on a real time interface to a test and measurement analysis tool , or any other application or display method known in the art . the data can also be formatted to match existing industry drive test tool formats so that existing testing and measurement analysis tools can be used . while preferred embodiments of the present inventive system and method have been described , it is to be understood that the embodiments described are illustrative only and that the scope of the embodiments of the present inventive system and method is to be defined solely by the appended claims when accorded a full range of equivalence , many variations and modifications naturally occurring to those of skill in the art from a perusal hereof . | 6 |
as can be seen from the drawings , the present invention is relatively simple in nature and can be easily accomplished by those skilled in the art once its general nature is known . basically , the technique uses an initial series of interactions between the computer ( 14 ) and the i / o board to arrive at the appropriate configuration parameters . these interactions can be , but need not be , accomplished in two modes : an installation mode and an operation mode . the first mode is installation . this is when a peripheral is introduced to the computer system for the first time or when a user is reconfiguring the computer system . the second mode is normal operation of the i / o device , for example a tape drive . this can include either a repetition of the interactions accomplished in the installation mode , may include a more detailed interaction than the installation mode , or may be a more abbreviated interaction than that of the installation mode . thus , once all possible details are understood , each may be combined as desired to achieve the goals of the invention . this would be evident to one skilled in the art and is disclosed to some extent in the claims , although they do not set out all the possible combinations . naturally , to need the invention , an i / o board , or some type of interactive circuitry -- which may or may not be separately attached to the computer -- must be connected to the computer ( 14 ) system . in most computer systems , this is usually done by connecting the i / o board into a board slot within the computer case . this board slot is actually a connection to the i / o bus of the computer ( 14 ). it establishes a number of specific connections between the computer ( 14 ) and the i / o board . the i / o bus ( 15 ) serves , together with its numerous electrical connections ( 20 ), as a means for communicating between the i / o board and the computer ( 14 ). if the i / o bus ( 15 ) is a standard bus , it will not have the inherent capability to select each slot individually . thus , for the present invention , the i / o board may be randomly connected to any slot of the i / o bus ( 15 ), it is not dependent on location . once physically installed , the methods of the present invention can then be initiated automatically or by the user by activating the installation mode of the invention when desired prior to running that i / o board . thus the user need only plug the board in and put the cover back on the computer ( 14 ). the invention software will appoint the parameter and configure or reconfigure the i / o board . in contrast , many devices of the prior art required more action on the user &# 39 ; s part . for example , to reconfigure an i / o board , it often was necessary to power down the computer , remove the cover on the system , adjust the switches and / or change jumpers which sometimes required removal of the board , plug the board back into the system , replace the cover , restore power to the system , and reboot the computer . obviously , this was very time consuming and was prone to confusion and errors as users often found it difficult to match the hardware setups configured by the jumpers or the switches to the parameters set in the configuration file on the hard drive . to understand the various routines of the invention , a review of the technique in the context of the installation mode is representative . referring to fig1 a flow chart of one possible installation sequence , it can be seen that the present invention greatly simplifies this process from the user &# 39 ; s perspective by accomplishing the key steps through software routines . as fig1 shows , the installation mode begins with the step of initiating the routine . this can be done automatically , or by user action . when done automatically , it is of course accomplished after the initiating operation of the computer ( 14 ) in the traditional manner . once initiated , the invention acts automatically to selectively activate an i / o board and select an initial value for the i / o board ( the order of these is not important ). the way in which the present invention individually activates an i / o board offers many advantages . first , it does not require a separate line from the i / o bus ( 15 ). second , it can be accomplished with relatively inexpensive circuit additions to the i / o board . essentially , the activation operation is individualized to a single board by using a specific sequence of common operations . the i / o board is configured to recognize this unique sequence , and then to activate some aspects of the board in response . as an additional protection against inappropriate responses , only so much of the i / o board need be initially activated as is necessary to assess the uniqueness of the assigned parameter . as mentioned a specific sequence is used which the i / o board can recognize . this is recognized by use of circuitry commonly referred to as a state machine ( 10 ), as those skilled in the art might readily understand once they are exposed to this unique use , even though state machines are traditionally not used for such a routine . while any sequence could be used under the concepts of the invention , the preferred embodiment uses a read sequence referred to as the &# 34 ; first read sequence .&# 34 ; the first read sequence activates the board to enter a setup mode . this unique activation technique also has the advantage of allowing multiple boards to share addresses , dma channels and irq channels . it thus acts to greatly increase i / o board possibilities . in order to allow individual activation , the sequence needs to be unique . it should act as a type of combination to unlock the board that other software or functions will have a very , very low probability of performing . in the preferred embodiment , a series of sixteen properly chosen i / o reads is used because it has been found that such a sequence rarely occurs in normal operation . naturally , this number may vary based upon system configurations likely to be encountered . at present , it is believed that less than four i / o reads in the first read sequence would not present a sufficient number to properly serve as the combination lock desired . naturally the number of reads can be increased as desired . in addition to being a series composed of common commands , the use of a read sequence in general offers the additional advantage of being substantially non - destructive . this is discussed later in the context of the step of assessing if the chosen address is unique . also , the use of state machine ( 10 ) allows individual activation to occur without utilizing any address space on i / o board ( 2 ). this can afford significant advantages not only in cost , but also in functionality . while the prior art teaches not only utilizing address space for activation , but also conducting the potentially destructive operation of writing to an address space , the present invention significantly departs from this approach . as mentioned , state machine circuitry ( 10 ) as shown in figure 2 is configured to react to a sequence specific to that i / o board . referring to fig2 it can be seen that this circuitry is responsive to computer signals and actually includes one or more programmable array logic unit ( pal ) ( 11 ) and counter ( 12 ). this is relatively inexpensive . also , by placing such circuitry on the i / o board itself , the invention can meet its goal of being compatible with standard i / o busses . the actual sequence which state machine ( 10 ) recognizes may be set through interruptible wiring ( 13 ). state machine ( 10 ) has the inherent capability to automatically reset if the complete sequence is not received . this means that any read sequence not matched in the read sequence described above will reset state machine ( 10 ). if the sequence is followed , each successive read in the sequence will move state machine ( 10 ) on to the next state . if the state machine requires sequences to occur in a specific order , any sequence outside the order will reset the state machine . in addition , state machine ( 10 ) is configured with a global sequence referred to as the &# 34 ; second read sequence .&# 34 ; thus each board may be configured to respond to two specific sequences : one to activate a specific board , and one to activate all boards in order to tristate them . for efficiency , the global sequence is a sequence which starts with the address read from base address with an offset of three . thus , in operation , the second read sequence routine performs two reads from base address with base offset of three . for further efficiency , the global sequence and the unique activation sequence differ by only one value in the read sequence . the specific orders of the two are only one different . this simplifies circuitry required as one skilled in the art would readily recognize so that instead of having two separate state machines totally independent of each other , the board may have one state machine with just two different options at a particular state . in addition a board specific deactivation command can , of course , be provided if desired . it should be understood that the process of activating an individual i / o board does not involve either a response from the board or the creation or change of any information on the board . first , avoiding any need for a response allows the state machine to monitor for the proper sequence without the i / o board being activated . second , the aspect of avoiding any creation or change of information , that is , being substantially non - destructive , serves to avoid inappropriate responses within the system as discussed later in the context of the step of assessing if the chosen address is unique . either before activating aspects of one i / o board , or immediately afterward as shown in fig1 the technique selects an initial parameter value . again , as accomplished in the preferred embodiment , the base address parameter is selected . rather then merely randomly trying a base address as shown by the prior art , the invention utilizes a prioritized list . this list is actually generated and stored on the computer ( 14 ) prior to these steps . thus the memory means ( 17 ) of the computer ( 14 ) serves as part of the means for assigning the address ( 16 ) or other parameter which is on the computer ( 14 ), rather than added to the i / o board . the prioritized list is designed to start with the most likely address to be available initially . it is prioritized based on widely disseminated industry specifications which specify what addresses some peripheral devices use . naturally this order may change from time to time as additional information becomes available . in addition , user override is possible . this would best be accomplished without accessing the board itself , so keyboard input is accommodated in the preferred embodiment . at present , the list includes only seven possible base addresses . this minimizes the hardware required on the i / o board . naturally , additional base address possibilities can be included if desired . in order to accommodate operational needs ( well understood to those in the art ) in an efficient manner , each of these base addresses is chosen not only for its probability of being otherwise unused , but also so that most have at least sixteen contiguous bytes free . in operation , the computer ( 14 ) acts to select the most likely base address to be available as an initial address . this initial address is then assessed to see if it is unique to that i / o board . if it is not unique , the next on the list is tried and so on . once an initial parameter value ( such as a base address ) is chosen , the technique automatically acts to assess if that value is unique to the i / o board . by doing this through operation of the computer ( 14 ), the computer ( 14 ) serves as a means for assessing uniqueness in contrast to the prior art . again , by using the computer &# 39 ; s programmable processing capability ( 21 ) cost is saved . certainly the use of a priority list developed with the intent that the first value be unique is an advantage over the prior art which merely uses random generation of an initial value . in some instances this may be enough , however , in order to accommodate the broad variation in system configurations , this initial choice needs to be checked . as alluded to in the prior art this can be accomplished through a unique routine , however , the present invention accomplishes this through the use of common commands in several unique manners . first , it allows for a multileveled , escalating assessment routine . second , it accomplishes initial assessment in a fashion which is substantially non - destructive and which provides additional information . third , it uses a repetitive routine . referring to fig1 it can be seen how the step of assessing if the initial address is unique is accomplished in a multilevel , escalating manner . as shown in fig1 three levels of assessment are accomplished . while naturally , any number is possible , the important aspect is that at the end , it be well known that the selected address is in fact unique . the first level starts by using common commands which are substantially non - destructive to avoid destroying any information which could be contained on other i / o boards which might recognize the initial address by executing a write command or otherwise . as with the commands chosen to activate and deactivate the i / o board , this step may use another such sequence , referred to here as a &# 34 ; read sequence .&# 34 ; in choosing such terms to identify the various read sequences involved , it should be understood that no order is implied . the terms &# 34 ; first read sequence ,&# 34 ; &# 34 ; second read sequence ,&# 34 ; and &# 34 ; read sequence ,&# 34 ; are chosen for differentiation purposes only as the techniques of the invention can be arranged in any order and still fall within the scope of the invention . as mentioned , the commands are substantially non - destructive . this means that they are of such a character as to be very unlikely to change any information contained on the i / o board or within the computer ( 14 ). certainly a write command acts to replace information contained at the write location . as such it is a destructive operation . while a read sequence can change information , this is far less likely , thus it is a substantially non - destructive operation . in the context of activating the board as discussed earlier , this is significant as if a command which is destructive is used , any unsuccessful attempts at assigning an address would destroy potentially important information . unlike the first read sequence , the read sequence does not rely on order to the same extent . instead it is merely a true read sequence which ascertains the information contained in each address location . again , for efficiency , an i / o board according to the present invention may be configured ( but need not be so configured ) so as to have an identification code in such address location . thus the read sequence also discovers useful information in the event the address is found to be unique . the conflict check through this sequence is accomplished by reading each address location used by the particular i / o board . it can do this sequentially . it is thus repetitive not in the sense that it does the same thing over and over , but rather in the sense that it does a different operation to see if the board correctly responds to each operation . in the case of the read sequence , not only must an identical identification code be returned at each location , the identification code must be consistent with a list of acceptable codes contained in a table . if the value read back is not in the software table on the computer ( 14 ), in other words , if the contents received back from the address locations are not what should be expected from any of the known boards that could possibly reside in the system , the routine assumes no board exists or that a possible conflict at that address exists . if a conflict is indicated , the routine returns to select the next most likely address and tries it . importantly , such a technique is effective because in the event two boards respond at once ( i . e . both recognize the same address ) an unintelligible signal is produced . this signal will thus be different from the identification code and will thus indicate that the initial address is not unique . as an additional note , it should be understood that the board identification code not only tells the software which board is being installed , but it also tells it how may bytes to read since some boards use 8 bytes and others use 16 bytes , etc . the identification code can also indicate what hardware version is being installed . this allows updates or revision to the board to be recognized by the software where necessary or desired . earlier , it was mentioned that the routine used to assess if the chosen address is unique is an escalating routine . by this it is meant that the routine next executes commands which have an even higher probability of discovering a conflict . the next level of assessment is to write to the board to tell it to return a value other than the identification value . in the preferred embodiment , a common command is sent to the i / o board which resets the same values to return all bits as zeros . this creates a command - response sequence . also the state machine can be expanded to perform this function without any need for a write operation . again , for efficiency , by using a single operation to reset all such values , less steps are involved . as with the read sequence conflict check , all values are compared by the computer ( 14 ) to assure that two boards do not respond at the same time . if a conflict exists , again , the routine returns to select another address and try it . the prior process is repeated for the third level of conflict check with an operation which establishes all bits as one &# 39 ; s at the same locations . if it indicates that no conflict was discovered , a unique address has been chosen . in addition , the computer ( 14 ) has identified that a board is residing at that location and what type of board is residing at that address location . all this has occurred without ever communicating with the board in the formal sense and even without ever fully activating the board . in regard to the prior steps , it should be understood that any type of operation or command can be chosen , that any number of repetitions can be used , and that any level of checking can be instituted . while at present three levels have been found to be adequate , as the configurations of systems encountered changes , so , too , may the types or numbers of routines used change . in addition , the invention also offers an additional degree of protection against inappropriate responses . in the event that a conflict is discovered anywhere in the process , not only does the routine act to select another address , it also triggers the need to reboot the system after finally storing an appropriate address and other information . this reboot acts to reset the entire computer system ( or at least so much as might reasonably be affected ) and thus will act to avoid any inappropriately set values in the systems naturally , if the address initially selected turns out to be unique , no such reboot will be necessary . once a unique address has been chosen , the setup , or installation mode can be exited . again , this can be accomplished by executing a standard command , in this case a write at the base address with an offset of seven . notice that the board has not yet been operated . rather the unique parameter is saved for later use in the operation mode . the entire routine can then be repeated to change other addresses , other parameters , other boards , and the like . as mentioned earlier , there is the possibility of manually changing the activation sequence . referring to fig2 it can be seen that state machine ( 10 ) is in part configured by interruptable wiring ( 13 ). by merely interruptible one or more of the traces comprising wiring ( 13 ), the user can physically change the sequence recognized . this , in turn , changes the activation combination recognized . thus in the event a user desires to have two identical boards it can also be accomplished by the present invention . two traces are shown in fig2 ; by providing four traces sixteen combinations are possible . this would allow sixteen possible i / o read sequences in a computer system for the same type of board . once the software now knows which board the user wants to configure , it is likewise possible to select unique direct memory access ( or dma ) channels and interrupt ( or irq ) channels . in addition , and incidentally highlighting how features may or may not be combined and still fall within the present invention , the preferred embodiment does not use the full three level conflict check to assign these parameters . instead , such are merely chosen from a prioritized table without a full conflict check since it is far less likely that a conflict will exist at this stage . in addition manual selection is possible . once again , the manual selection does the same thing for dmas and irqs as it did for base address . as for the dma channel parameters it is conflict checked only in the event a particular i / o board type is involved . recall that the type of i / o board was determined by the computer ( 14 ) as part of the initial address conflict check . this information can then be used to trigger conflict checks only for particular board types , further highlighting the flexibility of the present invention . for the specific assignment of a compression dma channel when a compression card is involved , the routine merely checks for a conflict by using the channel . a small block of data is sent to the i / o board , is passed through one of the chips on the board , put back on the hard drive , and compared to what was sent . if it is identical , uniqueness is assumed . again , this is a specific routine which is presented only to highlight the flexibility offered by the present invention . naturally other such specific testing can be accomplished and still fall within the scope and spirit of the present invention . as mentioned earlier avoiding inappropriate responses during the attempts to arrive at a unique address is an advantage of the present invention . this is not only accomplished by using substantially non - destructive commands and rebooting the system when appropriate , but it is also accomplished by only activating certain aspects of the i / o board . initially the present invention is configured to start out in a default condition having all important connections , the specific connections established by the board slot , in the electrically disconnected or tristated condition . the necessary lines must be untristated so that they can be used . this includes any combination of data lines ( which are connected to the address space ), dma lines , irq lines , and the like . this is easily accomplished through use of a control register as those skilled in the art will readily recognize . other techniques are , of course possible . while such registers are used to tristate some of the specific connections of the board , their use is not normally associated with an automatic configuration routine as disclosed here . by tying the control register to the state machine , it can only be utilized after a unique address has been assigned . this fact , and the fact that the configuration of the board has a default tristate condition , further affords the advantage of avoiding any inappropriate responses by preventing electrical activation of the lines &# 34 ; before their time .&# 34 ; thus the i / o board itself can contain the means for tristating such lines . once a unique parameter is found , it may be stored , preferably on existing , nonvolatile memory of the computer ( 14 ) system , such as the hard disk ( 18 ). while a nonvolatile storage means can be added to the i / o board as in some prior art devices , the present invention uses existing nonvolatile memory on the computer for efficiency purposes . this also saves cost . the unique value can then be used in the second mode , the operational mode . the operational mode of the present invention can be nearly identical to the installation mode , can include less than the installation mode , or can include more than the installation mode depending on circumstances or desires . while at first glance it may appear unnecessary to re - do each of the steps , this cannot be known with adequate certainty since changes in system configuration can be frequent and since the invention is designed to be compatible with other , traditional i / o boards . thus prior to actually initiating operation of the i / o board , the step of confirming parameter uniqueness can be accomplished . naturally this can and should use the information obtained during the installation mode for efficiency . in the preferred embodiment , most of the steps are identical with only minor exceptions . importantly , the initial address or other parameter selected to be tried should be the value originally arrived at through the installation mode . this is relatively straightforward . as to the level one conflict check , namely accomplishing the read sequence , it is already known that a board exists and what type of board , so the routine will perform the read sequence for that one board . in the operational mode , the unique parameter is also assigned to the board . while , as mentioned before , this is in volatile memory , the two part procedure used in the preferred embodiment overcomes -- and even takes advantage of -- this limitation . in addition , the invention expands upon how the prior art stored such information by using not only the board register , but by using the application specific integrated circuit ( asic ) ( 19 ) on the board . by so doing the invention achieves such storage while potentially reducing costs . finally , after all operation of the board for the present session is done , such lines may be tristated . if done at this point , it allows sharing of the same base address , dma channels , and / or irq channels . this can be easily accomplished through the control register as mentioned earlier . as will be readily understood by those skilled in the art , the foregoing methods may be accomplished with only minor changes to traditional i / o boards . with reference to the claims , it should be understood that the various steps can be accomplished by means which may already exist on the computer ( 14 ) on traditional boards . this is in keeping with the goal of requiring the minimum amount of change to the hardware of the i / o board as possible . the foregoing discussion and the claims which follow describe the preferred embodiments of the present invention . particularly with respect to the claims , it should be understood that changes may be made without departing from the essence of the invention . in this regard such changes will naturally fall within the scope of the present invention . it is simply not practical to describe and claim all possible permutations and combinations of the new routines presented here or to describe and claim all possible revisions to the present invention which may be accomplished . to the extent such revisions utilize the essence of the present invention , each would naturally fall within the breadth of protection encompassed by this patent . this is particularly true for the present invention since its basic concepts and understandings are fundamental in nature and can be broadly applied not only to a variety of devices , but also in a variety of manners . | 6 |
as shown in fig1 the centrifugal extractor ( 100 ) of this invention is composed of a liquid suction and rotation unit ( 10 ), a height - adjustable separating weir unit ( 20 ), and a housing unit ( 30 ). the liquid suction and rotation unit ( 10 ) sucks and rotates the liquid mixtures and thereby separates an organic phase from an aqueous phase . the height - adjustable separating weir unit ( 20 ) locates the phase separating weir ( 21 ) at a boundary layer between the two separated phases and thereby separating the organic phase from the aqueous phase . the housing unit ( 30 ) supports the suction and rotation unit ( 10 ) and provides the discharging paths of two separated phases to the outside of the extractor . the suction and rotation unit ( 10 ) consists of an inlet tube ( 11 ), a divert disk ( 12 ) attached to the end of the inlet tube ( 11 ), an impeller ( 13 ) installed at a position under the divert disk ( 12 ), a rotor ( 14 ) integrated with the impeller ( 13 ), and a rotor motor ( 15 ). the inlet tube ( 11 ) is used for sucking the liquid mixture into the centrifugal extractor ( 100 ). the inlet tube ( 11 ) is firmly assembled with a tube clamping frame ( 112 ) by a tube clamping bolt ( 111 ). the divert disk ( 12 ), used for allowing the two phases to collide thereon to increase the liquid flow speed in a centrifugal direction , is mounted to the lower end of the inlet tube ( 11 ). by vertically moving the inlet tube ( 11 ), the divert disk ( 12 ) is moved into the same direction , and it is possible to control the time interval that the two phases reside within the extractor ( 100 ) as desired . that is , by adjusting the height of the divert disk ( 12 ), the liquid volume between the suction impeller ( 13 ) and the divert disk ( 12 ) can be changed , so that this time interval is preferably controlled . the height of the divert disk ( 12 ) can be adjusted by loosening the tube clamping bolt ( 111 ) mounted on the tube clamping frame ( 112 ). once the bolt is loosened the inlet tube ( 11 ) can be freely moved . after vertically moving the divert disk ( 12 ) to the desired position , the tube clamping bolt ( 111 ) is tightened so as to lock the adjusted height of the disk ( 12 ). the impeller ( 13 ), used for sucking the liquid mixture into the inlet tube ( 11 ), is installed at under the divert disk ( 12 ) and is operated along with the rotor ( 14 ) by driving force of the rotor motor ( 14 ). the rotor ( 14 ) is used for giving a centrifugal force to the liquid mixture , inhaled by the impeller ( 14 ), thus separating the organic phase from the aqueous phase prior to separately discharging the two phases . the rotor ( 14 ) has a hollow cylindrical shape and is provided with a splash plate ( 141 ) at its upper end for guiding a separated aqueous phase to a fixed exit ( 31 ). the rotor ( 14 ) is firmly supported within the housing unit ( 30 ) by a support bearing ( 142 ). as best seen in fig3 a guide cylinder ( 143 ) is concentrically positioned within the rotor ( 14 ) at an upper end portion . a rotational exit of aqueous phase ( 144 ) is formed at the annular gap between the rotor ( 14 ) and the guide cylinder ( 143 ). this exit ( 144 ) provides the discharging path of the separated aqueous phase from the interior of the rotor ( 14 ) to the fixed exit of aqueous phase ( 31 ) as can be seen in fig1 . on the other hand , several rotational exits of organic phase ( 1431 ) are made at the upper end portion of the sidewall of the guide cylinder ( 143 ) and extend outward in a radial direction while passing through the rotor ( 14 ). these exits ( 1431 ) provide the discharging path of the separated organic phase from the interior of the weir guide ( 143 ). the splash plate ( 141 ) is used for guiding the separated aqueous phase from the rotational exit of aqueous phase ( 144 ) into the housing unit ( 30 ) and has an inlet tube guide ( 1411 ) at its center where the inlet tube ( 11 ) vertically passes through . guide rod bushes ( 1412 ), used for guiding the guide rods ( 22 ), are made on the top surface of the splash plate ( 141 ). as shown in fig1 and 4 , the height - adjustable separating weir unit ( 20 ) is designed to control the height of the separating weir ( 21 ) as desired . the weir unit ( 20 ) comprises the phase separating weir ( 21 ) which divides the paths of aqueous and organic phases after being separated from each other with a boundary layer . the weir unit ( 20 ) also comprises three height adjusting guide rods ( 22 ), an internal bearing clamping cap ( 23 ), an internal bearing ( 24 ), an external bearing ( 25 ), an external bearing clamping cap ( 26 ) and a clamping bolt ( 27 ). the guide rods ( 22 ) extend upwardly from the top end of the separating weir ( 21 ), while the internal bearing clamping cap ( 23 ) is integrally seated on the top ends of the guide rods ( 22 ). in the weir unit ( 20 ), both the guide rods ( 22 ) and the inlet tube ( 11 ) are set within the extractor ( 100 ). and the guide rods ( 22 ) extend through guide rod bushes ( 1412 ) of the splash plate ( 141 ) and the inlet tube ( 11 ) extends through the inlet tube guide ( 1411 ) of the splash plate ( 141 ). also , the external bearing clamping cap ( 26 ) is fixed to the extractor housing by a locking bolt ( 27 ), and the inlet tube ( 11 ) is fixed to the extractor housing by a tube clamping bolt ( 111 ). therefore , by driving the rotor motor ( 15 ), the parts of the weir unit ( 20 ) except for the external bearing clamping cap ( 26 ) are rotated along with the parts of the liquid suction and rotation unit ( 10 ) except for both the inlet tube ( 11 ) and the divert disk ( 12 ). three guide rods ( 22 ), connected to the bottom of the internal bearing clamping cap ( 23 ), are vertically movable under being guided by three guide rod bushes ( 1412 ). and by moving the guide rods ( 22 ), the phase separating weir ( 21 ) can be vertically moved under the guide of the guide cylinder ( 143 ). it is thus possible to adjust the height of the phase separating weir ( 21 ) as desired by moving the guide rods ( 22 ) in the vertical direction as shown in fig3 . after adjusting the position of the separation weir ( 21 ), the external bearing clamping cap ( 26 ) is tightened by the clamping bolt ( 27 ). all the above - mentioned rotating parts are supported by the external bearing ( 25 ) and the support bearing ( 142 ) and are rotated by the rotor motor ( 15 ). the housing unit ( 30 ) supports the liquid suction and rotation unit ( 10 ), and provides the discharging paths of two separated phases to the outside of the extractor ( 100 ). the centrifugal extractor ( 100 ) of this invention is operated as follows . as shown in fig1 a liquid mixture or the liquid radioactive wastes is sucked into the rotor ( 14 ) by the impeller ( 13 ), which is rotated along with the rotor ( 14 ) by the rotor motor ( 15 ). the liquid mixture , sucked into the rotor ( 14 ), collides on the divert disk ( 12 ) mounted to the lower end of the inlet tube ( 11 ), thus being accelerated in a radial direction by a centrifugal force . the centrifugal forces acting on the each phases of the liquid mixture are different from each other due to a difference in the specific weight of the two phases . therefore , the aqueous phase , having a relatively higher specific weight , is concentrated to the inner surface of the rotor ( 14 ), while the organic phase , having a relatively lower specific weight , is concentrated to a position inside of the aqueous phase as shown in fig2 b and 2 c . as the rotational speed of the rotor ( 14 ) is increased , the centrifugal force is also increased . and thus , two phases move upward along the interior surface of the rotor ( 14 ). the thickness variation of the boundary layer between the two phases with various rotational rotor speeds is shown in fig2 b to 2 e . if the vertical position of the separating weir ( 21 ) is appropriately adjusted while observing the position of the boundary layer , so as to allow the inlet of the weir ( 21 ) to be always positioned at the boundary layer , the organic phase is effectively and almost completely separated from the aqueous phase by the phase separating weir ( 21 ). the separated organic phase moves upward along the inner surface of the weir ( 21 ), and passes through the six rotational exits of organic phase ( 1431 ). and then , it is discharged to the outside of the extractor ( 100 ) through the fixed exit of organic phase ( 32 ). on the other hand , the separated aqueous phase moves upward along the annular gap between the inner surface of the rotor ( 14 ) and the outer surface of the guide cylinder ( 143 ) and is discharged from the rotor ( 14 ) through the rotational exit of aqueous phase ( 144 ). thereafter , the aqueous phase flows under the guide of the splash plate ( 141 ) and is discharged to the outside of the extractor ( 100 ) through the fixed exit of aqueous phase ( 31 ). in order to investigate the performance of the centrifugal extractor of this invention , a centrifugal extractor shown in fig5 was manufactured and a series of experiments has been performed . in the experiment , a scale was attached to the tube clamping frame ( 112 ) to measure the adjusted positions of both the separating weir ( 21 ) and the divert disk ( 12 ). the experiments were performed at room temperature , with kerosene being used as the organic phase and distilled water laden with brown rusty iron powder as the aqueous phase solvent . the purpose of using the rusty iron powder is to easily distinguish the aqueous phase from the organic phase since the rusty iron powder is not dissolved in the organic phase , but is dissolved in the aqueous phase . experiment 1 . measurement of the residence time of two phases in the extractor with various heights of the divert plate ( 12 ) the variation of residence time of the two phases in the extractor was measured while changing the height of the divert disk ( 12 ), with the rotational speed of the rotor ( 14 ) being fixed at 3 , 000 rpm . the height of the divert disk ( 12 ) was determined by measuring the gap between the divert disk ( 12 ) and the suction impeller ( 13 ). the residence time might be measured by counting the time interval between a time the two phases were fed into the extractor and a time the separated phases were completely discharged from the extractor . however , it was almost impossible to precisely check this time interval using a stopwatch . so , this interval was determined by measuring the electric conductance of fluids and converting it into the residence time . this method is frequently used in the chemical process of measuring the precise residence time of the two separated phases . experimental result was obtained as shown in table 1 . this experimental result shows that it is possible to effectively control the residence time of the two phases in the centrifugal extractor as desired by adjusting the height of the divert disk ( 12 ) of this invention . example 2 . verification of the relationship between the height of the separation weir ( 21 ) and the rotational speed of the rotor ( 14 ) the rotational speed of the rotor ( 14 ) was measured at a time instant when the two phases were completely separated from each other while changing the height of the separation weir ( 21 ). the height of the separating weir ( 21 ) was determined by measuring the distance between the top surface of the splash plate ( 141 ) and the reference points marked at the guide rods ( 22 ). the time instant of complete separation of the two phases was precisely determined by using the same method of measuring the electronic conductance of the fluids as used in the experiment 1 . while performing the experiment , it was possible to observe the thickness of the boundary layer between the two phases is changed as the rotational speed of the rotor ( 14 ) is changed . experimental result was obtained as shown in table 2 . this experimental result shows that it is possible to effectively and completely separate the two phases from each other regardless of a rotational speed of the rotor ( 14 ) by appropriately controlling the height of the separating weir ( 21 ) by using the centrifugal extractor of this invention . as described above , the present invention provides a centrifugal extractor for separation of an organic phase from an aqueous phase of a liquid mixture , such as liquid radioactive wastes . the phases separating weir ( 21 ) and the divert disk ( 12 ) are designed to be adjustable in their positions and so it is possible to effectively and completely separate the organic phase from the aqueous phase even in the case of a low rotational speed of the liquid mixture . in addition , the volume of the internal spaces of the extractor is easily controlled by adjusting the height of the divert disk ( 12 ), and so it is possible to appropriately select the residence time , or the reaction time , of the two phases in the extractor . although the preferred embodiments of the present invention have been disclosed for illustrative purposes , those skilled in the art will appreciate that various modifications , additions and substitutions are possible , without departing from the scope and spirit of the invention as disclosed in the accompanying claims . | 1 |
herein after , a method for providing a pay - tv service based on a session key will be described in detail with reference to the accompanying drawings . fig2 a and 2b are flowcharts describing a method for providing a pay - tv service based on a session key in accordance with a preferred embodiment of the present invention . fig2 a is a flowchart for describing a method for providing a pay - tv service applied to a subscriber and fig2 b is a flowchart for describing a method for providing a pay - tv service applied to a broadcasting station . for authentication of subscribers , a public encryption - based key is used in the present invention . the symmetric encryption - based session key , which is effective during a pay - event broadcasting period , is distributed to the subscribers . the authentication based on the public encryption - based key can provides a non - repudiation of the subscribers about subscription of a pay - event . by using a different session key to each event , the events can be provided independently . because the events can be provided independently , a specific event of the pay channel can be provided effectively to the subscribers . in the present invention , several event subscription methods are described as follows . first method is to subscribe to the pay - tv service based on a return channel provided by the digital tv system . second method is to subscribe to the pay - tv service using internet . third method is to subscribe to the pay - tv service by calling a staff of the broadcasting station . because basic steps of the first method and the second method are identical , only for easy description , only the first method is described . firstly , the method for subscribing to the pay - tv service d based on the return channel provided by the digital tv system is described . a user subscribes to the pay - tv service by reading an electronic program guide ( epg ) on a tv screen using a remote controller . when the user subscribes to the pay - tv service using internet , i . e ., the second method operations of the second method are identical to the first method except using the remote controller . meanwhile , in the present invention , it is assumed that the broadcasting station and the subscriber generate pairs of a public key and a private key between the broadcasting station and the subscriber , i . e ., a broadcasting station - public key ( bro_pub ), a broadcasting station - private key ( bro_prv ), a subscriber - public key ( sub_pub ) and a subscriber - private key ( sub_prv ). also , it is assumed that a broadcasting station certificate ( bro_cert ) and a subscriber certificate ( sub_cert ) are generated based on a reliable certificate distribution method such as a public key infrastructure ( pki ). referred to fig2 a and 2b , a process for subscribing to the pay - tv service of the broadcasting station in accordance with the present invention is described as follows . the subscriber selects a desired event using the epg on a screen , e . g ., a tv screen or a computer monitor at step s 211 . the subscriber achieves the sub_prv after authentication of subscriber at step s 212 . the subscriber fills out an application using service information . the subscriber signs on the application based on a digital signature scheme and encrypts the application at step s 213 . the application form is up to a strategy of the broadcasting station but following items [ a ] have to be included therein . the digital signature and encryption are performed according to following equations [ b ]. wherein , the service information ( si ) is si of a digital cable broadcasting system based on opencable architecture , a digital satellite broadcasting system based on digital video broadcasting - satellite ( dvb - s ) architecture or program and system information protocol ( psip ) of advanced television system committee ( atsc ). [ a ]={ client id , date , service type , transport stream id , program number , source id , event id , ( series id )}, wherein the “ client id ” is an identification number of the subscriber , the “ date ” is a date of the application submission , the “ service type ” is one of the ppe service , the ppd service , the pps service , the nvod service and the vod service , the “ transport stream id ” is a transport stream identifier defined in the si , the “ source id ” is a source identifier defined in the si , the “ event id ” is an event identifier defined in the si and the “ series id ” is an identification number of a series . the “ series id ” is effective if the subscriber subscribed to the pps . [ b ] digital signature = encrypting the application based on the sub_prv . encryption = encrypting the digital signed application based on the bro_pub . after the step s 213 , the subscriber transmits the encrypted application to the broadcasting station and waits a response of the broadcasting station at step s 214 . referring to fig2 b again , the response of broadcasting station will be described . the broadcasting station receives the encrypted application at step s 221 . the broadcasting station decrypts the encrypted application based on the bro_prv and verifies the digital signature at step s 222 . the verification based on the digital signature includes following steps . the broadcasting station receives the sub_cert and achieves the sub_pub . the broadcasting station decrypts the digital signed application . if the broadcasting station successes decryption of the digital signed application , it is regarded that the digital signature verification is successful . the broadcasting station determines whether the digital signature verification is successful or not at step s 223 . if the digital signature verification is successful at the step s 223 , the broadcasting station generates a session key and a subscription authority message , signs on the session key and the subscription authority message based on a digital signature scheme and encrypts the digital signed session key and the subscription authority message at step s 224 . the broadcasting station prepares the session key , which is a symmetric - based key , through a key server , etc . before the event is started . a form of the subscription authority message is up to the broadcasting station but following items [ c ] have to be included therein . the digital signature and encryption method are following equation [ d ]. [ c ] subscription authority message ={ client id , validity , service type , transport stream id , program number , source id , event id , ( series id )}, wherein the “ client id ” is an identification number of the subscriber , the “ validity ” is a term of validity of the session key , the “ service type ” is one of the ppe service , the ppd service , the pps service , the nvod service and the vod service , the “ program number ” is a program number defined in the si , the “ source id ” is a source identification defined in the si , the “ event id ” is an event identifier defined in the si and the “ series id ” is an identifier number of a series . the “ series id ” is effective if the subscriber subscribed to the pps . the event according to the “ source id ” and the “ event id ” is the first event of the series selected by the subscriber . [ d ] digital signature = encrypting the session key and the subscription authority message based on the bro_prv . encryption = encrypting the digital signed session key and the digital signed subscription authority message based on the sub_pub . the broadcasting station transmits the encrypted session key and the encrypted subscription authority message to the subscriber at step s 225 . the broadcasting station records the application information on database for charging fee at step s 226 . the broadcasting station receives a confirmation message of receiving the session key from the subscriber . after the step s 226 , step s 215 referred to fig1 is succeeded . the subscriber receives the encrypted session key and the encrypted subscription authority message from the broadcasting station at step s 215 . the subscriber decrypts the encrypted session key and subscription authority message based on the sub_prv and verifies the digital signature thereof at step s 216 . for verifying the digital signature , the subscriber decrypts the digital signed session key and subscription authority message . if the subscriber achieves the session key and the subscription authority message after decryption , it is regarded that the digital signature verification is successful . the subscriber determines whether the digital signature verification is successful or not at step s 217 . if the verification is failed , the process is terminated . if the verification is successful , the subscriber decrypts a channel key ( ck ) encrypted based on the session key and achieves a control word ( cw ) with the ck . the subscriber descrambles the subscribed event audio / video stream and watches the event at step s 218 . the subscriber stops using the event and deletes the session key in a cam memory if the event is terminated according to the si or if the session key is not effective any more according to the “ validity ” field in the subscription authority message . when the subscriber subscribed to the pps service , the session key ( sk ) is stored safely till the end of the validity of the selected series . the term of validity of the series can be found according to the “ validity ” and the “ series id ” in the subscription authority message . that is , within the “ validity ”, if the subscriber subscribes to another event , i . e ., a pps service of which a series id is identical to the “ series id ” in the subscription authority message , the subscriber uses the sk of the “ series id ”. if the “ validity ” is over , the sk is deleted regardless the “ series id ”- exists . meanwhile , the second method , which is a method for subscribing to the pay - tv service by calling a staff of the broadcasting station , is as following . the subscriber selects a desired event using the epg and calls the staff of the broadcasting station . the subscription authentication and the service subscription are carried out by the staff of the broadcasting station through the call conversation . the process after the authentication and the subscription is identical to the first method . that is , the process after the step s 224 is applied to the first method and the second method equally . the process includes the steps of generating the session key and the subscription authority message , signing based on a digital signature scheme and encrypting the session key and the subscription authority message . fig3 a and 3b are diagrams showing a method for providing a pay - tv service based on a session key in accordance with another embodiment of the present invention and showing a method for servicing the pay - service per event in the pay channel serving the pay - service per channel . in the broadcasting station , i . e ., a transmitting part of a conditional access system ( cas ), the ck is encrypted based on a “ ak_pub ”, which is a public key of a package group and a “ sk ”, which is a session key corresponding to a desired event by an encryptor 313 , respectively . a transmitting part transmits the cks encrypted based on the “ ak_pub ” and the “ sk ” to a decryptor 315 in a receiving part . wherein , the receiving part can be a subscriber who does not subscribe to the package service but want to uses a specific event included in the pay channel or who subscribes to the package service . fig3 a is a block diagram for the subscriber who does not subscribe to the package service but wants to watch a specific event included in the pay channel . a transmitting part includes a scrambler 311 and encryptors 312 and 313 . a receiving part includes a descrambler 314 and decryptors 315 and 316 . the scrambler 311 scrambles sources based on the cw and transmits the scrambled sources to the descrambler 314 . the encryptor 312 encrypts the cw based on the ck and transmits the encrypted cw to the decryptor 315 . the encryptor 313 encrypts the ck based on the ak_pub and the sk and transmits the encrypted cks to the decryptor 316 . the receiving part using the package service and a premium channel service decrypts the encrypted ck based on the sk by the decryptor 316 and achieves the ck . wherein , the sk is distributed by the method according to fig2 a and 2b . the encrypted cw is decrypted based on the achieved ck and cw is achieved . the descrambler 314 descrambles the scrambled source based on the achieved cw and the subscriber watches the desired event . fig3 b is a diagram showing pay events according to time and validity of keys . as shown , events such as golf , fifa world cup , tennis are serviced . in order to watch the fifa world cup event , refer to fig3 a , the subscriber decrypts the ck encrypted based on the sk of the fifa world cup , achieves the ck , decrypts the cw based on the achieved ck , descrambles scrambled audio / video stream based on the cw and watches the fifa world cup . as shown , the sk is effective when the fifa world cup is serviced . therefore , the pay - service per event of the event serviced in the pay channel can be provided based on the session key . the present invention can effectively provide a pay - service per event . an event is serviced connected to a session . during the session , a session key is used for keeping confidentiality of a pay event . public - based encryption algorithm is used for safely transmitting the session key to the authenticated subscriber . the present invention carries out non - repudiation of the subscription to the pay - tv service by using a digital signature scheme based on the public - based encryption algorithm . the present invention can effectively service pay - service per event of a specific event included in the pay channel servicing the ppc by using a session key . the present application contains subject matter related to korean patent application no . 2003 - 97795 , filed in the korean intellectual property office on dec . 26 , 2003 , the entire contents of which being incorporated herein by reference . while the present invention has been described with respect to certain preferred embodiments , it will be apparent to those skilled in the art that various changes and modifications may be made without departing from the scope of the invention as defined in the following claims . | 7 |
while the present invention is mostly described in connection with webpages , web browsers , web sites , internet servers and the like , it should be understood that it is not limited to the world wide web or the internet . the present invention may generally refer to any set of information which is considered as a single unit ( i . e ., an information unit ), of which a webpage is a non - limiting example , and which is sent over any type of computer network . furthermore , while the below description centers on web browsers and web servers , it should be understood that embodiments of the present invention may be used in conjunction with any device or software for presenting an information unit to a user , or for sending the information unit to the user &# 39 ; s device over a network . fig1 is a diagram of the environment in which an exemplary embodiment of the invention operates . a user &# 39 ; s computer 101 is connected to the internet 100 . also connected to the internet are a system server 103 , and one or more protected web servers 102 , 104 . the protected web servers are servers at which websites which are protected by the authentication system described herein are hosted . the user &# 39 ; s computer executes a web browser 105 . the user &# 39 ; s computer also executes client authentication software ( not shown ), which may implement aspects of the present invention . the client authentication software may be part of the web browser , a web browser add - on or a distinct application which communicates with the web browser , for example . the system server is optional . it provides information to the user &# 39 ; s computer according to some embodiments of the invention . the system server provides convenience , as information and updates may be quickly sent to the client authentication software . however , the system server may also cause a security weakness , as communications that go over the network can be intercepted by a malicious person . therefore , some embodiments of the invention do not use a system server , but instead provide the client authentication software with updates and other information through the use of physical media , such as , for example , cds and dvds , which the user inserts into computer 101 . other embodiments utilize a system server with encryption of the communications between the client authentication software and the system server in order to minimize any risk of compromise of these communications . fig2 is a flowchart showing a method of operation of an embodiment of the invention . at step 200 , the user obtains and installs the client authentication software on computer 101 . the software may be obtained over a network ; for example , it may be downloaded from the system server 103 over the internet 100 . in other embodiments , the software may be delivered using traditional storage media such as cds , dvds , etc . the client authentication software may be included in a specifically designed web browser . in an alternative embodiment , the client authentication software may be a distinct application ( from the web browser ), which serves as a proxy . this embodiment is well suited for cases in which the browser is difficult to modify . in the proxy embodiment , the browser is configured to use the client authentication software as a proxy ( and the client authentication software need not necessarily run on the user &# 39 ; s computer 101 ). in one embodiment , the client authentication software is an addition to a standard browser utilized by the user . most modern browsers provide for the ability to add additional software to extend their functionality . for example , for the mozilla and firefox internet browsers provided by the mozilla foundation , these extensions are referred to as plugins . for the internet explorer browser offered by the microsoft corporation these extensions are referred to as helper objects . embodiments of the invention may utilize either or both of these types of extensions for the above mentioned browsers . at step 202 , the authentication list is updated . the authentication list is a list of websites and their respective addresses which are considered to be authentic . in other words , these websites are what they purport to be . referring to fig1 , the authentication list is the list of the protected websites hosted at protected servers 102 , 104 . in one embodiment , the operators of these websites have consented that their sites be used in combination with the present invention . however , as discussed above , the protected websites need not have their underlying software and structure modified in order to participate in the present system . thus , in some cases , consent or assistance from the operators of a website are not necessary to protect the website according to certain embodiments of the present invention . the authentication list may be updated periodically . therefore , step 202 may be executed at multiple subsequent times . in one embodiment , the updates to the authentication list are downloaded from the system server 103 . alternatively , the updates may be obtained on a storage medium . the authentication list may include universal resource locators ( urls ) and uniform resource identifiers ( uris ) of protected websites . the urls define the global address of each website . the uris define the location of the login page of each website within that website . the location of the login page is significant for certain embodiments , because in these embodiments certain features of the present system are only activated when a user is looking at a login page . alternative embodiments may only store the urls of the protected websites . in some embodiments only hostnames are stored and each website belonging to a hostname is subject to the security features of the present invention . in other embodiments , regular expressions may be stored , the regular expressions defining one or more hostname , url , and / or uri pattern . at step 204 , the user is requested to select one or more tokens . an example of a token is provided in fig3 . tokens may include graphics , text , sound or any combination of the above . a typical token is a combination of a graphic 300 and text 301 . in one embodiment , the user is presented with a plurality of graphics and asked to choose one for his / her token . the user is also requested to add text to the token . if multiple users complete step 204 at various computers , each user is likely have a unique token . while it is expected that the token will be relatively unique for each respective user , it is not strictly necessary that it be absolutely unique . in other words , in some embodiments there may exist multiple users that have the same token . however , because repetitions will be rare , a malicious party should not be able to easily guess a user &# 39 ; s token . the above type of token is advantageous because it is unlikely to present an undue burden on a user &# 39 ; s memory . simple graphics are easy to remember and the user may choose a text which in his / her mind is associated with the graphic . for example , in fig3 the hypothetical user chose a graphic of a crown , and the text ‘ ooo ’. the hypothetical user may be a chess player because the crown is a symbol used for the ‘ king ’ piece in chess , and the text ‘ ooo ’ denotes a move the king may perform ( castle ). another user may choose other text in combination with this graphic , such as for example “ king of barbeque .” thus , one of the security features of embodiments of the invention is that it would be difficult for an unauthorized party to guess which text a user has chosen to combine with the graphic . the user may choose a single anti - fraud token , which will be valid for all protected websites . however , some embodiments may allow user to choose multiple tokens and select specific tokens to use for specific websites . at step 206 , the client authentication software monitors requests performed by the browser . step 206 may be performed continuously after the client authentication software is installed . therefore , step 206 is placed in its present position in the flow chart to aid the reader &# 39 ; s understanding only ; it may be performed at any other point in time . the client authentication software examines each request to determine whether it includes a reference to any of the addresses ( uris and optionally uris ) present in the authentication list . a more detailed schematic of the operation of the client authentication software is shown in fig4 . fig4 shows the client authentication software 400 and the standard browser module 405 . as discussed above , in some embodiments the client authentication software is part of the browser . accordingly , the standard browser module is the portion of the browser which is not the client authentication software . therefore , in some embodiments , the browser 105 is the combination of the standard browser module 405 and the client authentication software 400 . in other embodiments , such as the proxy embodiment , the standard browser module 405 is the same as the browser 105 and the client authorization software 400 is a distinct application . it can be seen in fig4 that as a request 401 is issued by the standard browser module , the client authentication software 400 compares the address of the request , with the addresses stored in the authentication list 410 . the other elements of fig4 will be discussed in more detail below . turning back to fig2 , at step 208 , during normal browsing , the user requests a webpage of a protected website . in one embodiment , step 208 happens when the user actually requests an address which specifies an actual user login page of the protected website . in other embodiments , step 208 may be triggered when the user accesses any page of the protected website . when the user requests the webpage , the standard browser module 405 sends an http request to a protected web server 102 ( see fig4 ). at step 210 , the client authentication server detects that the request for the protected website includes an address which is part of the authentication list 410 . the client authentication software then saves identifying information for the request ( i . e . socket number , http connection number , etc ), so that it can identify the response to this request . at step 212 , the protected server sends a response 402 to the request issued by the browser in step 208 ( see fig4 ). the response includes a webpage 403 . the client authentication software 400 monitors the data sent to the standard browser module 405 and , at step 214 , identifies when a response to the request it previously identified is received . thus , the response is matched to the previously identified request by socket , number , http connection number , address , etc . at step 216 , the client authentication software modifies the webpage 403 ( see fig4 ) within the response in order to add the anti - fraud token . therefore , the client authentication software converts response 402 into response 412 , which is similar to response 402 but includes some additions 404 to the webpage 403 ( which together form modified webpage 413 ). the additions may be made using dynamic html ( dhtml ). dynamic html is a known format for providing dynamic content in webpages . the dhtml format allows for various layers within a webpage . an html document may comprise a single dhtml layer . therefore , if the webpage 403 is originally in html the preferred embodiment converts it into a dhtml document 413 by keeping the original content as a first dhtml layer and adding a second dhtml layer which defines the anti - fraud token . if the original webpage 403 is a dhtml page , the client authentication software 400 modifies it by adding an additional dhtml layer which defines the anti - fraud token . if multiple anti - fraud tokens are being used , the client authentication software checks which protected website the webpage originated from ( by examining the response 402 , or the request 401 for an address ), and selects the respective anti - fraud token to add to the webpage 403 . while , to improve clarity , the response 402 and modified response 412 are shown in fig4 as blocks , it should be understood that the response may be treated as a stream . in other words , the client authentication software may modify parts of the response ( or webpage 403 ) while other parts are still being received from the protected server , or while other parts are actually being received and rendered on the screen by the standard browser module 405 . in an alternative embodiment , the client authentication software does not check requests for addresses from the authentication list 410 and attempt to match them to their respective responses . it simply checks the responses for those addresses and adds an anti - fraud token to each response which includes an address indicating it came from a protected website . this embodiment is simpler and faster , but may not be as effective because responses with fraudulent addresses may be created by using a technique referred to as ‘ spoofing ’. turning back to fig2 , at step 218 , the standard browser module 405 receives the modified webpage and displays it with the added anti - fraud token . if the anti - fraud token is a sound , the browser plays it instead . at step 220 , the user sees the webpage and the anti - fraud token . having noticed the anti - fraud token , the user realizes that he / she may safely interact with the webpage ( by , for example , entering sensitive information in various fields ). if on the other hand , the user sees a website that asks for sensitive information but does not include an anti - fraud token , the user knows that this website has not been shown to be safe by the present system and utilizes additional caution . fig5 is an example of a webpage 500 ( as displayed by browser 105 ) with an anti - fraud token 300 embedded therein . having seen the anti - fraud token , the user may confidently enter his / her username and password . embodiments of the invention allow a user to move the anti - fraud token around the webpage . thus a user may move the anti - fraud token away from useful portions of the webpage ( such as , for example , username and password fields 501 , 502 ). the ability to move the anti - fraud token may be provided by using known dhtml commands that allow an object to be moveable by a user . thus , a user will be able to move the anti - fraud token 300 by clicking on it with a mouse and “ dragging ” it around the webpage 500 . in one embodiment of the invention , the system actually remembers the movements of the anti - fraud token . thus , if the user moves the antifraud token 300 to the upper right hand corner of the webpage 500 ( as shown ), the token will appear at that location the next time the user accesses this particular webpage . this feature provides two benefits . the first is convenience . if a user has to move the token out of the way , it would be much more convenient if the token moving step could be performed only once for each protected website . the second benefit is additional security . if the user knows that the system remembers where the token was placed the last time a particular site was visited , then if the token appears at another place next time the user visits the site , the user will know that something is amiss . thus , even if a potential fraud perpetrator somehow correctly guesses a user &# 39 ; s token , he / she may not be able to fool the user without also guessing where in the webpage the user left the token last . in order to perform the above described token location memory feature , the client authentication software must be informed as to where the user moves the token . therefore , if standard dhtml features are used to allow movement of the token , an applet ( preferably in javascript ) may be placed in the same dhtml layer as the token . that applet may track the current position of the token and send information as to its position to the client authentication software . the client authentication software would in turn save the last position for the token for each protected webpage and re - insert the token in that position when the protected webpage is viewed for a second time . in an alternative embodiment , the user is not allowed to move the token by simply clicking on it and dragging it . instead , the user is provided with a visual toolbox 505 located at the browser &# 39 ; s interface 105 . the toolbox is created by the client authentication software . the user may move the anti - fraud token by clicking on the various arrows of the toolbox . thus , the client authentication software receives the user &# 39 ; s movement commands directly and in turn causes the token 300 to move . the client authentication software may cause the token to move by creating newer versions of the webpage 500 and causing the browser to refresh to these newer versions . in an alternative embodiment the movement ( or alternatively , only the last position ) of the anti - fraud token is sent to the system server 103 and saved thereon . the system server 103 then sends the various positions of the anti - fraud tokens for the various protected websites to the client authentication server 400 periodically with the updates of the authentication list . this embodiment is may be implemented in portable versions of the present invention which are designed to allow the user to easily utilize the present invention from different computers . fig6 is a diagram of a webpage 600 including an anti - fraud token according to alternative embodiments of the invention . specifically , while in the previous embodiments the anti - fraud token was inserted in the body of the webpage , in this embodiment it is inserted in the browser &# 39 ; s interface 601 . thus , the client authentication software does not modify the webpage at all , but having determined that the webpage is from a protected website , it modifies the browser &# 39 ; s interface to place a client request token . in theory , the embodiment of fig6 may be more secure as it is much more difficult for a potential fraud perpetrator to modify the browser &# 39 ; s interface than to modify a webpage . however , in practice the embodiments which place the token in the webpage may be more desirable , because users often do not notice elements on the browser &# 39 ; s interface and only pay attention to the content of webpages . if the user does not notice the anti - fraud token , its usefulness is very limited . since the illicit modifying of a browser &# 39 ; s interface is considered to be difficult , embodiments which place the anti - fraud token on the browser &# 39 ; s interface may do away with the custom token selection procedure . an example of such an embodiment is shown in fig7 ( showing website 700 ). this embodiment may not request that a user select and remember a custom token but may instead use a generic token , such as site valid sign 701 . in this embodiment , sign 701 would be the same for all protected websites and users . while the invention has been described in terms of particular embodiments and illustrative figures , those of ordinary skill in the art will recognize that the invention is not limited to the embodiments or figures described . although embodiments of the present invention are described , in some instances , using http , html and dhtml terminology , those skilled in the art will recognize that such terms are also used in a generic sense herein , and that the present invention is not limited to such systems . those skilled in the art will recognize that the operations of the various embodiments may be implemented using hardware , software , firmware , or combinations thereof , as appropriate . for example , some processes can be carried out using processors or other digital circuitry under the control of software , firmware , or hard - wired logic . ( the term “ logic ” herein refers to fixed hardware , programmable logic and / or an appropriate combination thereof , as would be recognized by one skilled in the art to carry out the recited functions .) software and firmware can be stored on computer - readable media . some other processes can be implemented using analog circuitry , as is well known to one of ordinary skill in the art . additionally , memory or other storage , as well as communication components , may be employed in embodiments of the invention . fig8 illustrates a typical computing system 800 that may be employed to implement processing functionality in embodiments of the invention . computing systems of this type may be used in the system server , the user terminal , and the protected web servers , for example . those skilled in the relevant art will also recognize how to implement the invention using other computer systems or architectures . computing system 800 may represent , for example , a desktop , laptop or notebook computer , hand - held computing device ( pda , cell phone , palmtop , etc . ), mainframe , server , client , or any other type of special or general purpose computing device as may be desirable or appropriate for a given application or environment . computing system 800 can include one or more processors , such as a processor 804 . processor 804 can be implemented using a general or special purpose processing engine such as , for example , a microprocessor , microcontroller or other control logic . in this example , processor 804 is connected to a bus 802 or other communications medium . computing system 800 can also include a main memory 808 , such as random access memory ( ram ) or other dynamic memory , for storing information and instructions to be executed by processor 804 . main memory 808 also may be used for storing temporary variables or other intermediate information during execution of instructions to be executed by processor 804 . computing system 800 may likewise include a read only memory (“ rom ”) or other static storage device coupled to bus 802 for storing static information and instructions for processor 804 . the computing system 800 may also include information storage system 810 , which may include , for example , a media drive 812 and a removable storage interface 820 . the media drive 812 may include a drive or other mechanism to support fixed or removable storage media , such as a hard disk drive , a floppy disk drive , a magnetic tape drive , an optical disk drive , a cd or dvd drive ( r or rw ), or other removable or fixed media drive . storage media 818 , may include , for example , a hard disk , floppy disk , magnetic tape , optical disk , cd or dvd , or other fixed or removable medium that is read by and written to by media drive 814 . as these examples illustrate , the storage media 818 may include a computer - readable storage medium having stored therein particular computer software or data . in alternative embodiments , information storage system 810 may include other similar components for allowing computer programs or other instructions or data to be loaded into computing system 800 . such components may include , for example , a removable storage unit 822 and an interface 820 , such as a program cartridge and cartridge interface , a removable memory ( for example , a flash memory or other removable memory module ) and memory slot , and other removable storage units 822 and interfaces 820 that allow software and data to be transferred from the removable storage unit 818 to computing system 800 . computing system 800 can also include a communications interface 824 . communications interface 824 can be used to allow software and data to be transferred between computing system 800 and external devices . examples of communications interface 824 can include a modem , a network interface ( such as an ethernet or other nic card ), a communications port ( such as for example , a usb port ), a pcmcia slot and card , etc . software and data transferred via communications interface 824 are in the form of signals which can be electronic , electromagnetic , optical or other signals capable of being received by communications interface 824 . these signals are provided to communications interface 824 via a channel 828 . this channel 828 may carry signals and may be implemented using a wireless medium , wire or cable , fiber optics , or other communications medium . some examples of a channel include a phone line , a cellular phone link , an rf link , a network interface , a local or wide area network , and other communications channels . in this document , the terms “ computer program product ,” “ computer - readable medium ” and the like may be used generally to refer to media such as , for example , memory 808 , storage device 818 , or storage unit 822 . these and other forms of computer - readable media may store one or more instructions for use by processor 804 , to cause the processor to perform specified operations . such instructions , generally referred to as “ computer program code ” ( which may be grouped in the form of computer programs or other groupings ), when executed , enable the computing system 800 to perform functions of embodiments of the present invention . note that the code may directly cause the processor to perform specified operations , be compiled to do so , and / or be combined with other software , hardware , and / or firmware elements ( e . g ., libraries for performing standard functions ) to do so . in an embodiment where the elements are implemented using software , the software may be stored in a computer - readable medium and loaded into computing system 800 using , for example , removable storage drive 814 , drive 812 or communications interface 824 . the control logic ( in this example , software instructions or computer program code ), when executed by the processor 804 , causes the processor 804 to perform the functions of the invention as described herein . it will be appreciated that , for clarity purposes , the above description has described embodiments of the invention with reference to different functional units and processors . however , it will be apparent that any suitable distribution of functionality between different functional units , processors or domains may be used without detracting from the invention . for example , functionality illustrated to be performed by separate processors or controllers may be performed by the same processor or controller . hence , references to specific functional units are only to be seen as references to suitable means for providing the described functionality , rather than indicative of a strict logical or physical structure or organization . although the present invention has been described in connection with some embodiments , it is not intended to be limited to the specific form set forth herein . rather , the scope of the present invention is limited only by the claims . additionally , although a feature may appear to be described in connection with particular embodiments , one skilled in the art would recognize that various features of the described embodiments may be combined in accordance with the invention . furthermore , although individually listed , a plurality of means , elements or method steps may be implemented by , for example , a single unit or processor . additionally , although individual features may be included in different claims , these may possibly be advantageously combined , and the inclusion in different claims does not imply that a combination of features is not feasible and / or advantageous . also , the inclusion of a feature in one category of claims does not imply a limitation to this category , but rather the feature may be equally applicable to other claim categories , as appropriate . | 7 |
in the formulae ( i ) and ( ii ) of the sensitizing dyes as used in the present invention , the heterocyclic rings formed by z 1 and z 2 , which can be substituted with one or more of a halogen atom such as fluorine , chlorine and bromine , a trifluoromethyl group , an alkyl group containing preferably 1 to 4 carbon atoms such as a methyl group , an ethyl group , etc ., a monoaryl group such as a phenyl group , a p - sulfophenyl group , etc ., a carboxy group , a carboxyalkyl group having an alkyl moiety containing preferably 1 to 4 carbon atoms such as a carboxymethyl group , a carboxyethyl group , etc ., and the like , include a benzoxazole ring , a 5 - fluorobenzoxazole ring , a 5 - chlorobenzoxazole ring , a 5 - bromobenzoxazole ring , a 5 - trifluoromethylbenzoxazole ring , a 5 - methylbenxozazole ring , a 5 , 6 - dimethyl benzoxazole ring , a methoxybenzoxazole ring , a 5 , 6 - dimethylbenzoxazole ring , a 5 - phenylbenzoxazole ring , a 5 - carboxybenzoxazole ring , a 5 - carboxymethylbenzoxazole ring , a β - naphthoxazole ring , and the like . heterocyclic rings formed by z 3 include a pyridine ring , a quinoline ring , an oxazoline ring , an oxazole ring , a thiazoline ring , a thiazole ring , a selenazole ring , a benzoxazole ring , a benzothiazole ring , a benzoselenazole ring , a benzimidazole ring , a dialkylindolenine ring , a α - naphthoxazole ring , a β - naphthoxazole ring , a β , β - naphthoxazole ring , a α - naphthothiazole ring , a β - naphthothiazole ring , a β , β - naphthothiazole ring , a α - naphthoselenazole ring , a tetrazole ring , a pyrroline ring , and the like . these rings may be substituted with one or more of a halogen atom , alkyl group , alkoxy group , alkoxycarbonyl group , and aryl group as described for z 1 and z 2 . the pyrazoline - 5 - one ring formed by z 4 can be substituted with one or more of an alkyl group preferably containing 1 to 4 carbon atoms such as methyl , ethyl , propyl , and the like ; an alkoxy group preferably containing 1 to 4 carbon atoms such as a methoxy group and an ethoxy group ; an alkoxycarbonyl group in which the alkyl moiety preferably has 1 to 4 carbon atoms , such as a methoxycarbonyl group , an ethoxycarbonyl group , and the like ; an aryl group such as a phenyl group and a substituted aryl group , e . g ., a sulfophenyl group , a carboxyphenyl group , a trichlorophenyl group , and the like ; an alkoxyalkyl group in which the alkyl moiety preferably has 1 to 4 carbon atoms , such as a substituted alkoxyalkyl group , e . g ., a hydroxymethoxyethyl group , a 2 - hydroxyethoxymethyl group , a 2 -( 2 - hydroxyethoxy ) ethyl group , a 2 -( 2 - acetoxyethoxy ) ethyl group , an acetoxymethoxymethyl group , and the like ; an n -( n , n - dialkylaminoalkyl ) carbamoylalkyl group in which the alkyl moiety has preferably 1 to 4 carbon atoms , such as an n -[ 3 -( n , n - dimethylamino ) propyl ] carbamoylmethyl group , an n -[ 2 -( n , n - diethylamino ) ethyl ] carbamoylmethyl group , an n -[ 3 -( morpholino ) propyl ] carbamoylmethyl group , an n -[ 3 -( piperidino ) propyl ] carbamoylmethyl group , and the like ; an n -[ n , n , n - trialkylammoniumalkyl ) carbamoylalkyl group in which the alkyl moiety preferably has 1 to 4 carbon atoms , such as an n -[ 3 -( n , n , n - trimethylammonium ) propyl ] carbamoylmethyl group , an n -[ 3 -( n , n , n - triethylammonium ) propyl ] carbamoylmethyl group , an n -[ 3 -( n - methylmorpholinolium ) propyl ] carbamoylmethyl group , an n -[ 3 -( n - methylpiperidinonium ) propyl ] carbamoylmethyl group , and the like ; an n , n , n - trialkylammoniumalkyl group in which the alkyl moiety preferably has 1 to 4 carbon atoms , such as an n , n - diethyl - n - methylammoniumethyl group , an n , n , n - triethylammoniumethyl group , and the like ; an allyl group such as a vinylmethyl group ; a hydroxyalkyl group in which the alkyl moiety preferably has 1 to 4 carbon atoms , such as a hydroxymethyl group , a β - hydroxyethyl group , and the like ; a carboxyalkyl group such as carboxymethyl group , a carboxyethyl group , and the like ; a sulfoalkyl group such as a sulfoethyl group , a sulfopropyl group , and the like ; and an amino group , etc . the aliphatic groups represented by r 1 , r 2 , and r 4 include a unsubstituted alkyl group preferably containing 1 to 8 carbon atoms , such as a methyl group , an ethyl group , a propyl group , and the like ; and a substituted alkyl group in which the alkyl moiety preferably has 1 to 4 carbon atoms and having as substituents a hydroxy group , a carboxy group , a sulfo group , and the like , such as a 2 - hydroxyethyl group , a 3 - hydroxypropyl group , a 2 - carboxyethyl group , a 3 - carboxypropyl group , a 4 - carboxybutyl group , a 2 - sulfoethyl group , a 3 - sulfopropyl group , a 3 - sulfobutyl group , a 4 - sulfobutyl group , a 2 - hydroxy - 3 - sulfopropyl group , a 3 - sulfopropoxyethoxyethyl group , and the like ; etc . the alkyl groups represented by r 3 and r 5 are the same unsubstituted alkyl groups as in r 1 , r 2 , and r 4 . the aryl group represented by r 5 includes a phenyl group , a carboxyphenyl group , and the like . x - represents a mineral acid ion , such as an iodine ion , a bromine ion , a chlorine ion , a perchlorate ion , a thiocyanate ion , and the like ; and an organic acid ion , such as p - benzene - sulfonic acid ion , a benzenesulfonic acid ion , an ethyl sulfate ion , and the like . the oxacarbocyanine dyes represented by the formula ( i ) are well known as dyes having high green sensitivity . furthermore , it is well known that when this dye is used in combination with an imidacarbocyanine dye , supersensitization is achieved and the spectral sensitive wavelength region is extended to a longer wavelength side . on the other hand , many of the sensitizing dyes represented by th formula ( ii ) have a quite low spectral sensitivity . however , when they are used in combination with the oxacarbocyanine dye represented by the formula ( i ), they can increase the green sensistivity without substantially changing the spectral sensitivity distribution of the oxacarbocyanine dye . that is , supersensitization can be achieved without shifting the spectral sensitive wavelength region of the oxacarbocyanine dye . moreover , they have an advantage that residual coloring is small . since the object can be attained by the use of the sensitizing dye of the formula ( i ) in a small amount of about 1 / 4 to 1 / 8 of the sensitizing dye of the formula ( ii ), residual coloring is not increased . the supersensitization of the present invention is usable in producing an emulsion for a multi - layer color film of the incorporated - coupler type , particularly a reversal color film and a negative color film . representative examples of dyes of the formula ( i ) and ( ii ) used in the present invention are shown below although the present invention is not to be construed as being limited thereto . the silver halide photographic emulsions which can be used in the present invention can be produced by conventional methods and contain silver chloride , silver bromide , silver iodide or mixtures thereof which can be precipitated by the single jet process , double jet process , or a conbination of these processes . a preferred silver halide is silver iodobromide or silver chloroiodobromide . the average diameter of the grains preferably ranges from about 0 . 04 μ to 2 μ as measured with the projected area method or by the number average measurement . to the silver halide photographic emulsion , conventionally used chemical sensitizations such as gold sensitization as described in u . s . pat . nos . 2 , 540 , 085 , 2 , 597 , 856 , 2 , 597 , 915 , 2 , 399 , 083 , etc . ; sensitization using group viii metal ions ; sulfur sensitization as described in u . s . pat . nos . 1 , 574 , 944 , 2 , 278 , 947 , 2 , 440 , 206 , 2 , 410 , 689 , 3 , 189 , 458 , 3 , 415 , 649 , etc . ; reduction sensitization as described in u . s . pat . nos . 2 , 518 , 698 , 2 , 419 , 974 , 2 , 983 , 610 , etc . ; or a combination of the sensitization methods , can be applied . chemical sensitizers which can be used in the present invention include sulfur sensitizers such as allyl thiocarbamide , thiourea , sodium thiosulfate , cystine , and the like ; noble metal sensitizers such as potassium chloroaurate , aurous thiosulfate , potassium chloropalladate , and the like ; and reduction sensitizers such as stannous chloride , phenylhydrazine , reductone , and the like ; etc . polyoxyethylene derivatives , polyoxypropylene derivatives , quaternary ammonium group containing derivatives can be present in the emulsion . furthermore , antifogging agents such as nitrobenzoimidazole and ammoniumchloroplatinate , and stabilizers such as 4 - hydroxy - 6 - methyl - 1 , 3 , 3a , 7 - tetrazaindene can be present in the emulsion . hardening agents , e . g ., aldehydes , such as glyoxal as disclosed in u . s . pat . no . 1 , 870 , 354 , glutalaldehyde as disclosed in british pat . no . 825 , 544 , n - methylol substituted compounds , such as n , n &# 39 ;- dimethylolurea , dioxane derivatives , e . g ., dihydroxydioxane as disclosed in u . s . pat . no . 3 , 380 , 829 , compounds having epoxy groups , as disclosed in u . s . pat . nos . 3 , 047 , 394 and 3 , 091 , 537 , compounds having active halogens , such as 2 , 4 - dichloro - 6 - hydroxy - 1 , 3 , 5 - triazine as disclosed in u . s . pat . no . 3 , 325 , 287 , mucohalic acids such as mucochloric acid and mucobromic acid as disclosed in u . s . pat . no . 2 , 080 , 019 , bis -( methane sulfonic acid ester ) as disclosed in u . s . pat . no . 2 , 726 , 162 , sulfonyl compounds such as bis -( benzene sulfonyl chloride ) as disclosed in u . s . pat . no . 2 , 725 , 295 , aziridine compounds , divinylsulfones as disclosed in u . s . pat . no . 2 , 579 , 871 , compounds having active olefinic bonds such as divinyl ketone as disclosed in german pat . no . 872 , 153 , compounds having acryloyl groups as disclosed in u . s . pat . nos . 3 , 255 , 000 and 3 , 635 , 718 , british pat . no . 994 , 869 and german pat . no . 1 , 090 , 427 , alkylene bis - maleimide as disclosed in u . s . pat . no . 2 , 992 , 109 , isocyanates as disclosed in u . s . pat . no . 3 , 103 , 437 , carbodiimides as disclosed in u . s . pat . no . 3 , 100 , 704 , isooxazole derivatives as disclosed in u . s . pat . nos . 3 , 321 , 313 and 3 , 543 , 292 , polymeric hardeners such as dialdehyde starch as disclosed in u . s . pat . no . 3 , 057 , 723 , and inorganic hardeners , such as chrom alum , chrom acetate , zirconium sulfate , etc . ; can be present in the emulsion . surface active agents , e . g ., nonionic surface active agents , such as saponin , polyethyleneglycol , polyethylene glycol / polypropylene glycol adducts as disclosed in u . s . pat . no . 3 , 294 , 540 , polyalkyleneglycol ethers , esters , and amides as disclosed in u . s . pat . no . 2 , 831 , 766 , anionic surface active agents , such as alkyl carboxylic acid salts , alkyl sulfonic acid salts , alkylbenzene sulfonic acid salts , alkylnaphthalene sulfonic acid salts , alkyl sulfates , n - acyl - n - alkyltaurine as disclosed in u . s . pat . no . 2 , 739 , 891 , maleopimalates as disclosed in u . s . pat . nos . 2 , 359 , 980 , 2 , 409 , 930 and 2 , 447 , 750 , other anionic surface active agents as disclosed in u . s . pat . nos . 2 , 823 , 123 and 3 , 415 , 649 , amphoteric surface active agents , e . g ., as disclosed in u . s . pat . no . 3 , 726 , 683 and british pat . no . 1 , 159 , 825 , etc ., can also be employed , if desired . when the silver halide emulsion as used herein is used for a color photographic photosensitive material , a color coupler and dispersing agents therefor can be added to the silver halide emulsion . examples of color couplers which can be employed are disclosed in the following u . s . pats ; e . g ., yellow couplers as described in u . s . pat . nos . 3 , 277 , 155 ; 3 , 415 , 652 ; 3 , 447 , 928 ; 3 , 408 , 194 ; 2 , 875 , 057 ; 3 , 265 , 506 ; 3 , 409 , 439 ; 3 , 551 , 155 ; 3 , 551 , 156 ; 3 , 582 , 322 , etc . ; magenta couplers as described in u . s . pat . nos . 2 , 600 , 788 ; 2 , 983 , 608 ; 3 , 006 , 759 ; 3 , 062 , 653 ; 3 , 214 , 437 ; 3 , 253 , 924 ; 3 , 311 , 476 ; 3 , 419 , 391 ; 3 , 419 , 808 ; 3 , 476 , 560 ; 3 , 582 , 322 , etc . ; and cyan couplers as described in u . s . pat . nos . 2 , 474 , 293 ; 2 , 698 , 794 ; 3 , 034 , 892 ; 3 , 214 , 437 ; 3 , 253 , 924 ; 3 , 311 , 476 ; 3 , 458 , 315 ; 3 , 582 , 322 ; 3 , 591 , 383 ; etc . moreover , to the silver halide photographic emulsion , as a protective colloid , gelatin ; gelatin derivatives , such as phthalated gelatin and malonated gelatin ; cellulose derivatives such as hydroxyethyl cellulose and carboxymethyl cellulose ; soluble starches such as dextrin ; hydrophilic polymers , etc . are added . suitable gelatin derivatives include those formed by the reaction of gelatin with aromatic sulfonyl chlorides , aromatic acid chlorides , aromatic acid anhydrides , isocyanates , 1 , 4 - diketones , as disclosed in u . s . pat . no . 2 , 614 , 928 , trimellitic acid , as disclosed in u . s . pat . no . 3 , 118 , 766 , organic acids having an active halogen , as disclosed in japanese pat . application no . 5514 / 1964 , aromatic glycidyl ethers as disclosed in japanese pat . application no . 26845 / 1967 , maleimides , maleamic acid , unsaturated aliphatic diamides as disclosed in u . s . pat . no . 3 , 186 , 846 , sulfoalkylated gelatin as disclosed in british pat . no . 1 , 033 , 189 , polyoxyalkylene derivatives as disclosed in u . s . pat . no . 3 , 312 , 553 and polymer - grafted gelatins , e . g ., grafted with acrylic acid , methacrylic acid , acrylate esters , methacrylate esters , acrylamide , acrylonitrile , styrene , etc . specific examples of synthetic hydrophilic polymers include homopolymers or copolymers of vinylalcohol , n - vinylpyrrolidone , hydroxyalkylmethacrylate , methacrylamide , n - substituted methacrylamide , styrene sulfonic acid , etc ., copolymers of these monomers with methacrylic esters , vinyl acetate , styrene , etc ., and a monomer as described previously copolymerized with maleic anhydride , maleic acid , etc . plasticizers for dimensional stability ; latex polymers ; and matting agents can also be added . the thus finished emulsion is coated on a suitable support , such as a baryta paper , a resin coated paper , a synthetic paper , a cellulose triacetate film , a polyethylene terephthalate film , a glass plate , or other plastic base . a suitable coating amount is generally about 0 . 001 to 0 . 1 mol ( as silver ) 1 m 2 of the support . the sensitizing dyes as used herein can be added as a solution in water or organic solvents miscible with water such as methanol , ethanol , methyl cellosolve , pyridine , and the like . the sensitizing dye is used in an amount conventionally used to effect supersensitization , for example , in an amount of about 5 × 10 - 3 to 1 × 10 - 6 mole per mole of silver . the molar ratio of the dye of the formula ( ii ) to the dye of the formula ( i ) preferably ranges from about 2 : 1 to 20 : 1 . the combination of the dyes of the present invention can be used in sensitizing various silver halide photographic emulsions for color , and black and white photosensitive materials . emulsions which can be used in the present invention are an emulsion for color positive materials , an emulsion for color papers , an emulsion for color negative materials , an emulsion for color reversal ( in which a coupler is incorporated or not incorporated ), an emulsion for use in photographic photosensitive materials for plate making such as a lith film , an emulsion for use in a photosensitive material for recording a cathode ray tube display , an emulsion for use in a photosensitive material for x - ray recording , particularly direct and indirect photographic material using a screen , an emulsion for use in a colloid transfer process as described in u . s . pat . no . 2 , 716 , 059 , an emulsion for use in the silver salt diffusion transfer process as described in u . s . pat . nos . 2 , 352 , 014 , 2 , 543 , 181 , 3 , 020 , 155 , 2 , 861 , 885 , etc ., an emulsion for use in the color diffusion transfer process as described in u . s . pat . nos . 3 , 087 , 816 , 3 , 185 , 567 , 2 , 983 , 606 , 3 , 253 , 915 , 3 , 227 , 550 , 3 , 227 , 551 , 3 , 227 , 552 , 3 , 415 , 644 , 3 , 415 , 645 , 3 , 415 , 646 , etc ., an emulsion for use in the inhibition transfer process as described in u . s . pat . no . 2 , 882 , 156 , an emulsion for use in the silver dye bleaching process as described in friedman , history of color photography , american photographic publishers co ., ( 1944 ), particularly chapter 24 and british journal of photography , vol . 111 , pages 308 to 309 , apr . 7 ( 1964 ), an emulsion for use in a material for recording a print - out image as described in u . s . pat . no . 2 , 369 , 449 and belgian pat . no . 704 , 255 , an emulsion for use in a direct print image as described in u . s . pat . nos . 3 , 033 , 682 and 3 , 287 , 137 , an emulsion for use in a thermally developable photosensitive material as described in u . s . pat . nos . 3 , 152 , 904 , 3 , 312 , 550 , 3 , 148 , 122 and british pat . no . 1 , 110 , 046 , and an emulsion for use in a photosensitive material for physical development as described in british pat . nos . 920 , 277 and 1 , 131 , 238 , etc . the dyes as used herein are used for spectral sensitization in accordance to the methods as described in german pat . laid - open no . 2 , 104 , 283 and u . s . pat . no . 3 , 649 , 286 . the invention is further explained in greater detail by reference to the following examples . unless otherwise indicated , all parts , percents , ratios and the like are by weight . silver halide grains were precipitated by the double jet process and subjected to a conventional physical ripening , a desalting treatment , and a chemical ripening . thus , a silver iodide bromide emulsion ( iodine content : 7 mole %) was obtained . the average diameter of the silver halide grains contained in the emulsion was 0 . 42 μ . 0 . 52 mole of the silver halide was contained in 1 kg of the emulsion . 1 kg of the emulsion was charged in a pot and melted by immersing the pot into a thermostatic bath at 50 ° c . methanol solutions of sensitizing dyes of the present invention and sensitizing dyes for comparison were added to the emulsion in amounts as indicated in table 1 and mixed at 40 ° c . moreover , 10 ml of a 0 . 1 % by weight aqueous solution of 4 - hydroxy - 6 - methyl - 1 , 3 , 3a , 7 - tetrazaindene , 10 ml of a 1 % by weight aqueous solution of sodium 1 - hydroxy - 3 , 5 - dichlorotriazine , and 10 ml of a 1 % by weight aqueous solution of sodium dodecylbenzene sulfonate were added and mixed . the thus finished emulsion was coated on a cellulose triacetate film base in a dry thickness of 5 microns and dried . thus , a sample of a photosensitive material was obtained . the sample was slit into strips . one piece was wedgewise exposed to a light source having a color temperature of 5400 ° k equipped with a blue filter ( wratten 47b , produced by eastman kodak co .) and yellow filter ( sc - 50 , produced by the fuji photo film co ., ltd .). another piece was exposed to obtain a spectrogram thereof by the use of a diffraction grating type of spectrophotometer equipped with a tungsten light source of a color temperature 2666 ° k . these strips were developed with a developer having the following composition at 20 ° c for 20 minutes , stopped , fixed , and washed . thus , strips having a given image were obtained . density measurement using an s type densitometer produced by the fuji photo film co ., ltd ., was measured and the sensitivity of blue color filter ( sb ), the sensitivity of yellow color filter ( sy ), and fog were obtained . the base point of the optical density for measuring the sensitivity was at a point of ( fog + 0 . 20 ). ______________________________________composition of developer______________________________________water 500 mlmetol 2 gsodium sulfite ( anhydrous ) 90 ghydroquinone 8 gsodium carbonate ( monohydrate ) 52 . 5 gpotassium bromide 5 gwater to make up 1 liter______________________________________ the results obtained are shown in table 1 as a relative value . tests nos . 7 and 8 were carried out for comparison . table 1__________________________________________________________________________no . sensitizing dyes and amount thereof sy sb fog spectrogram ( relative ( relative value ) value ) __________________________________________________________________________1 -- -- -- 13 100 0 . 05 ( base point ) ( i - a ) 8 -- -- 61 80 0 . 05 16 -- -- 100 70 0 . 05 ( base point ) 32 -- -- 104 63 0 . 07 -- ( ii - c ) 1 -- 13 86 0 . 05 -- 2 -- 13 81 0 . 05 -- 4 -- 12 77 0 . 05 ( i - a ) 16 ( ii - c ) 2 -- 110 77 0 . 05 16 4 -- 114 77 0 . 052 ( i - c ) 8 -- -- 83 91 0 . 05 16 -- -- 100 83 0 . 05 fig3 - 1 32 -- -- 100 70 0 . 06 -- ( ii - g ) 2 -- 15 83 0 . 05 fig3 - 2 -- 4 -- 18 73 0 . 05 -- 8 -- 22 73 0 . 06 ( i - c ) 16 ( ii - g ) 2 -- 142 91 0 . 05 fig3 - 3 16 4 -- 130 91 0 . 053 -- ( ii - a ) 1 -- 13 96 0 . 05 -- 2 -- 13 91 0 . 05 fig4 - 4 -- 4 -- 13 67 0 . 05 ( i - c ) 16 ( ii - a ) 1 -- 142 83 0 . 05 16 2 -- 142 83 0 . 05 fig4 - 54 -- ( ii - b ) 2 -- 13 97 0 . 05 -- 4 -- 13 97 0 . 05 8 -- 13 97 0 . 05 ( i - a ) 16 ( ii - b ) 2 -- 133 97 0 . 05 16 4 -- 129 83 0 . 055 ( i - e ) 4 -- -- 71 100 0 . 06 8 -- -- 125 100 0 . 07 16 -- -- 100 64 0 . 12 ( i - e ) 4 ( ii - g ) 1 -- 88 97 0 . 06 4 2 -- 100 97 0 . 06 ( i - e ) 8 ( ii - g ) 1 -- 140 97 0 . 07 8 2 -- 145 97 0 . 076 ( i - f ) 8 -- -- 49 75 0 . 05 16 -- -- 59 65 0 . 05 32 -- -- 63 50 0 . 06 ( i - f ) 16 ( ii - c ) 2 -- 102 70 0 . 05 16 4 -- 102 70 0 . 057 -- -- ( a )* 2 13 90 0 . 05 fig5 - 6 -- -- 4 13 68 0 . 05 -- -- 8 13 68 0 . 05 ( i - c ) 16 -- ( a ) 2 100 90 0 . 05 fig5 - 7 16 -- 4 81 84 0 . 058 -- -- ( b )** 2 24 84 0 . 05 -- -- 4 24 71 0 . 05 -- -- 8 19 41 0 . 05 ( i - e ) 16 -- ( b ) 2 96 74 0 . 08 16 -- 4 52 62 0 . 08__________________________________________________________________________ ## spc3 ## it can be seen from the results obtained that the combination of the dyes of the present invention is effective to achieve supersensitization . even though they are used in combination with well known green sensitive sensitizing dyes such 2 , 2 &# 39 ;- thiocyanine , imidacarbocyanine , and the like , the effect of the present invention is not deteriorated . while the invention has been described in detail and with reference to specific embodiments thereof , it will be apparent to one skilled in the art that various changes and modifications can be made therein without departing from the spirit and scope thereof . | 6 |
fig5 is a block diagram to show a circuit arrangement of an example of the present invention . at the time of a normal recording , an analog switch 24 for recording . reproduction change over is placed in a recording mode , and as image signals are introduced a brightness element of the image signals is taken out by a low pass filter 20 ( hereinafter called as lpf ) which takes out brightness signals . the lpf output is frequency modulated by an fm modulator 21 , and then it is added in an adder 22 . a color signal element of the image signals is taken out by a band pass filter ( hereinafter called as bpf ) 25 , and is converted to a low zone or low band frequency by a frequency modulator 26 which modulates the color signal to a low zone which is added in the adder 22 . sound signals are frequency modulated by an fm modulator 27 and are added in the adder 22 . a frequency zone of sound signals is established between the color signal zone which is converted to a low zone , and the brightness signal zone which are frequency modulated . the output of the adder 22 is sent to a picuture recording amplifier 23 , goes through the analog switch 24 , and then is recorded on a magnetic tape 45 by a rotating magnetic head 43 . also , at the time of normal reproduction , the analog switch 24 is changed over to a reproduction mode , and an analog switch 30 for change over of a post recording delay signal and a normal reproduction signal is changed over to a normal reproduction position n . that is , image . sound signals reproduced by the rotating magnetic head 43 pass through the analog switch 24 and are transmitted to a reproduction amplifier 28 . an output of the reproduction amplifier goes through the analog switch 30 and is sent to a high pass filter ( hereinafter called as hpf ) 31 , and an lpf34 and a bpf36 . the hpf31 operates to take out the brightness element which is frequency modulated , and an output thereof passes through an fm demodulator 32 and is entered into an adder 33 . the lpf34 operates to take out the color signal element which is frequency modulated to a low zone and the color signal is returned to its original state through a frequency demodulator 35 and is added in the adder 33 . at the output of the adder 33 are image signals which are then reproduced . further , the output of the analog switch 30 passes through the bpf36 which passes frequency modulated sound signals , and is applied to an fm demodulator 37 so that sound signals are provided from the output of the fm demodulator 37 . in the above - mentioned method , a rotating magnetic head 44 which is used solely for post recording is provided for making a post recording of sound signals , and synthesized signals of image signals and new sound signals are re - recorded along a recording locus before post recording on the magnetic tape 45 . at the time of post recording of sound signals , the change over analog switch 30 for normal reproduction and post recording is changed over to a post recording position a . image . sound signals being reproduced by the rotating magnetic head 43 pass through the analog switch 24 and are transmitted to the reproduction amplifier 28 . the output of the reproduction amplifier 28 passes through a delay device 29 and the analog switch 30 , and is connected to the hpf31 , the lpf34 and the bpf36 . a brightness signal output from the hpf31 and a color signal output from the lpf34 are respectively added in an adder 41 . on the other hand , sound signals before post recording go through the bpf36 , are demodulated by the fm demodulator 37 , and then are added in an adder 38 . also , new sound signals are added in the adder 38 . an adjuster 39 for the level of addition is attached to the adder 38 . therefore , the ratio of mixing of the sound signals before post recording , and the new sound signals , can be freely changed . the output of the adder 38 is applied to a frequency modulator 40 and the output thereof is added in the adder 41 , and is synthesized with image signals . the synthesized output of the adder 41 is amplified by a picture recording amplifier 42 and is recorded on the magnetic tape 45 by the rotating magnetic head 44 which is used solely for post recording . reproduction of the post recorded signals is done by the rotating magnetic head 43 . also , a function of the delay device 29 is to compensate a time differential generated as the magnetic heads 43 , 44 deviate or differ from each other phase ( time ) wise . that is , the delay device 29 works so that horizontal synchronizing signals will be recorded at the same position both before post recording and after the same . by this , a reproduction can be made by the magnetic head 43 even a post recording . the delay device 29 is made of an ultrasonic delay means , a glass plate or a memory means such as ccd , bbd , etc . fig6 shows an arrangement of a recording reproduction part of a vtr in which the circuit of fig5 is used . a cassette 51 houses the magnetic tape 45 , and rotating magnetic heads 53 , 54 are for normal recording reproduction corresponding to the magnetic head 43 of fig5 while rotating magnetic heads 55 , 56 are used solely for post - recording corresponding to the magnetic head 44 of fig5 . the magnetic heads 53 , 55 have the same azimuthal angle while the magnetic heads 54 , 56 have the same azimuthal angle which is different from the azimuthal angle of the heads 53 , 55 . the rotating magnetic heads rotate with a constant speed in the direction of an arrow 62 . also shown are a capstan 60 and a pinch roller 59 , wherein the magnetic tape 45 is held by pressure contacting of the capstan and the pinch roller and is fed with a constant speed in the direction of an arrow 61 by the constant speed rotation of the capstan , a total width erasing head 57 , and 58 is a fixed head 58 to record and reproduce ctl ( control ) signals . fig7 shows the arrangement shown in fig6 as viewed from the bottom of fig6 including tape guide posts 68 , 69 , an upper drum 67 , and a lower drum 66 having a lead plane 72 . a center line of a track formed by the magnetic head 43 , and a center line of a track formed by the magnetic head 44 , have a step difference d in the track direction . this is because rotating phases of the normal recording reproduction head 43 , and of the head 44 used solely for post recording , are deviated or differ from each other , and because the magnetic tape 45 always runs at a constant speed . the location of the track at which post recording is to be started is detected by the normal recording reproduction head 43 . when the head 44 used solely for post recording comes to said location , a certain time has elapsed because of a deviation in the rotating phase , while the tape advances during said time , thus the track at which post recording is to be made is deviated to downwardly . therefore , the normal recording reproduction head 43 is shifted downward by d , corresponding to a phase deviation thereof from the magnetic head 44 used solely for post recording , so that the magnetic head 44 properly traces on a magnetic locus on which it should make a post recording . by this phase deviation and step difference , and also by combining the delay device 29 of fig5 a recording can be made at a time of post recording in the same pattern as that before the post recording . that is , the phase relationship between the heads 43 and 44 can be varied to any position by varying the two other elements , the step difference and the characteristics of the delay device . generally speaking , in a helical scan type vtr , a recording is made in an overlapped manner with the two rotating magnetic heads 53 , 54 ( fig6 ) at the time of a normal recording . this will be explained referring to fig8 . as shown in fig8 ( a ), a head 1 which has a certain azimuthal angle and forms a track with a width a makes a recording of 1 -- 1 . next , a head 2 which has an azimuthal angle different from that of the head 1 and forms a track with a width a , makes a recording with an overlap by a width b with the recording 1 -- 1 . at this time the portion b which has a recording thereon by head 1 , is recorded on by the head 2 , and said recording by head 2 remains as a tape pattern . thereafter recordings will be made consecutively from 2 - 1 to 1 - 2 , 2 - 2 , 1 - 3 , 2 - 3 , 1 - 4 . . . with an overlapping of a width b . a width of a magnetic locus remaining on the magnetic tape 45 on which recordings are made as mentioned above will have a width ( a - b ), being narrower by the width b than the width a of the track formed by the head as shown in fig8 ( b ). therefore , the width of a track formed by the magnetic head used solely for post recording needs to be wider than the width ( a - b ) of magnetic locus remaining on the magnetic tape 45 . if it is not wider , the recording before the post recording will remain , resulting in a confusion and a disturbance both in image and sound signals at the time of reproduction . further , when the width of a track formed by the head solely used for a post recording is too wide , the width of an adjacent magnetic locus is narrowed ( if it is extremely wide the adjacent magnetic locus will be totally erased ), and the reproduction output from said narrowed locus at the time of reproduction will be lowered . in view of the same , the width of a track formed by the head solely used for a post recording needs to be made wider than a width of the magnetic locus remaining on the magnetic tape 45 at the time of a normal recording , and at the same time it needs to be made narrower than the width of the track formed by the normal recording heads 53 , 54 . that is , a width of a track formal by the head solely used for a post recording needs to be within a range of and the step difference d in fig7 is so set that the above - mentioned width a stretches over the width ( a - b ) of magnetic locus of a normal recording , so that any recording before the post recording will not remain . in the above described example , rotating magnetic heads for normal recording reproduction and rotating magnetic heads solely used for post recording are made as separate bodies , but such an arrangement will require four heads , taking a lengthy time for assembly and adjustment . fig9 and fig1 show examples in which said two heads are made as combination heads . the relationship of the step difference and the width of track formed will not be different from that in the former example in which said two heads are made as separate bodies . fig9 shows an example in which normal recording reproduction heads and heads solely used for a post recording are made as combination heads , showing respectively a normal recording reproduction gap 75 and a gap 76 solely used for a post recording , and cores 79 , 80 , 81 , 82 made of , for example , ferrite material . the cores 80 , 81 are welded together by low permeability material , for example , glass 83 or the like . a coil 77 is wound around the core 79 for supplying recorded signals or obtaining reproduced signals , and a coil 78 is wound around the core 82 to supply post recording signals . further , in the former example , re - recording is done by the magnetic head 44 having the same azimuthal angle as that of the magnetic head 43 , on the track having a recording thereon with a certain azimuthal angle by the head 43 , in such manner as to follow said track . that is , an arrangement wherein post recording is made in the form of an overlapped writing is employed . however , it is also possible to provide an erasing head between the magnetic head 43 and the magnetic head 44 before the head 44 , so that a recorded locus is erased and sound . image synthesized signals having new sound signals added thereto are recorded by the magnetic head 44 . fig1 shows an example of combination heads in which erasing heads are provided for the arrangement shown in fig9 showing respectively gaps 85 , 86 , 87 for a normal recording reproduction , erasing and a post recording , and cores 91 , 92 , 93 , 94 , 95 , 96 made of , for example , ferrite material . the cores 92 and 93 as well as the cores 94 and 95 are welded together by low permeability material , for example , glass shown 97 , 98 or the like . also , a coil 88 is wound around the core 91 for supplying recorded signals or for obtaining reproduction signals , and a coil 89 is wound around the core 93 to supply erasing signals at the time of a post recording . further , a coil 90 is wound around the core 96 to supply post recording signals . thus , by using combination heads , assembling and adjusting time can be shortened . as has been explained above by examples , in the present invention , signals obtained by mixing or selecting reproduced information from a recording medium on which a recording has been made , and new information , can be recorded at a position at which said reproduced information was recorded in almost the same manner , thus allowing a post recording of information . therefore , even when information on a recording medium without a post recording , and information having been post recorded by the present invention , are reproduced in succession , there will be no confusion or disturbance of information and an editing of information can be done in a very satisfactory manner . also , when normal recording reproduction heads and heads solely used for post recording are made integrally as shown in the latter examples , an assembly and an adjustment of the apparatus can be made simply as in an apparatus having no heads solely used for a post recording . | 6 |
while fig1 a and 2 represent different emphasis of illustration , the circuitry is substantially identical for all practical purposes , and accordingly indicia represent common elements of the two figures , and fig3 in like manner utilizes the same indicia for any common elements recognizable in the other figures . in particular , the ice - making air - conditioner primary unit 4 includes a coolant - container vessel 5 and an air - cooling enclosure structure 6 with inlet and outlet ports , having a fan 7 in the inlet port for drawing air into the enclosure space 11 of the enclosure structure , and fan 8 in the outlet for exhausting cooled air therefrom after cooling the air passing over coils 10 within the air - cooling space , coolant being pumped through the coils 10 by pump 9 , coolant 12 being within the coolant - container vessel 5 , within space 13 thereof . freezer device 14 has freezer coils 15 within the coolant 12 , for the freezing thereof and / or at least maintaining it at a low cooling temperature for circulation by the pump 9 . batteries 16 and 17 are the power sources . ignition switch 18 connects the batteries into electrical parallel by closing the ignition switch to thereby close the switch 19 . the charger 21 charges both batteries 16 and 17 when the engine of the automobile is running -- with the ignition switch on . typical ground leads are represented as 22 , 23 , 24 , 34 , 34 &# 39 ;, 34 &# 34 ;, but could obviously be interconnected into a common ground . the ignition and auto - circuitry system 25 is fed by typical lead wire 25 &# 39 ;. the dual fans 7 and 8 have manual switches 26 and 26 &# 39 ;, and the freezer device has manual switch 27 . thermostat 28 opens and closes the electrical circuitry of the freezer unit 14 and coils 15 thereof , described above . the thermostat 29 located within the partial enclosure of the air - conditioner unit 4 shown in fig1 a , controls cut - in and cut - out of the pump 9 . and the thermostat 30 , located outside of the air - conditioner unit 4 as shown in fig1 a , controls the cutting - in and cutting - out of the double - throw switches 32 and 33 between lead wires 35 and 35a , for power of leads 33a and 35a and 39a , the closing of the switch 30 sending current through coils 36 to thereby place the fans in electrical parallel for greater cooling air circulation . lead wire 35 &# 39 ; lead from the pump to ground 34 &# 39 ;. double throw switches 32 and 33 are a part of solenoid switch 31 . lead wire 40 leads to ground 34 &# 34 ; from the freezer unit . lead 41 leads to the ignition switch 18 . accordingly , the outside thermostat controls solely the rate of circulation of air , both fans i and ii being in electrical series when the thermostat switch 30 is opened as shown in fig1 a , whereby as is conventional , the fans in electrical series results in a low circulation as compared to a greater circulation when the fans are in electrical parallel when 1 thermostat switch 30 is closed when outside temperature is elevated . in the alternate embodiment of fig1 b , the lead wire 39 leads to fan 7 &# 39 ; and thereafter to resistor ( r ) 37 , on to ground 38 when switch 33 &# 39 ; is open ; when power is provided through lead 39 &# 39 ; and is grounded by a thermostat 30 closing to direct current through lead 35 to coils 36 &# 39 ; to close switch 33 , thus grounding the fan 7 &# 39 ;, current flows to ground instead of through the resistance resistor 37 , resulting in the fan running at a higher rate of speed . ac fans 7 and 8 run by current in either direction . however , in the fig1 b embodiment , the fan may be either dc or ac in type accordingly , in the fig1 b embodiment when outside temperature is not very high the open switch 30 of fig1 a would result in electric current passing in series through fan 7 and resistance 37 , with a corresponding low air circulation , as compared to a closed switch 30 at a more elevated temperature causing switch 33 to close whereby fan 7 is devoid of resistor 37 , fan 7 being directly ground through ground 34 , resulting greater air circulation by the fan 7 . it should be noted that the coolant may be water , or may be freon , or any other conventional coolant as might be desired . in like manner , the nature of the freezer unit is not critical , being of conventional design as desired . the size of the fans is optional , but is typically a 3 ohms fan run by 12 volts d . c ., at typically 4 amps . when the two fans are switched from parallel to electrical series , the power demand is reduced by three - quarters . typically , the freezing unit is a 12 volt , 2 amp unit of known conventional type typically normally used in campers and boats . for batteries , for example , the battery for a volks wagon is 45 ampere hours , and for cadillacs is 95 ampere hours , and for medium - sized cars is 60 ampere hours . the above - noted ice - maker draws 2 amperes per hour . a 60 ampere battery will last more than 24 hours driving the freezer unit . a volks wagon generator produces 360 watts . the alternator of a toronado produces 750 watts . a medium - sized car generator produces 520 watts . a 360 watts generator will charge 60 ampere hour battery in a 2 hour period . accordingly , a car which runs at least 2 hours per day , will keep the second battery in full charge and maintain the power for the ice - maker 24 hours , making about 15 pounds of ice in 24 hours . in a typical system of the invention , thermostats are set as follows . when the ignition key is turned - on , if the temperature is over 80 ° fahrenheit , the pump and fan ( high ) will automatically turn onto high speed , delivering 12 , 000 btu per hour of cold air to the car interior , and the car will be cooled within 15 seconds -- as proven by actual tests . when cooled down to 80 ° or lower , the speed of the fans automatically jumps to low speed to deliver 3 , 000 btu per hour to keep the car cool . when car inside space temperature gets down to 74 ° fahrenheit , the speed of the fans remains the same , but the pump turns - off and thus the freon ( or ice - water ) stops circulating , and the temperature of the car does not go down any further . if car temperature goes up , the pump starts , and if car temperature exceeds 80 °, the fans turn - on high circulation again . it is within the scope of the invention to make such variations and substitution of equivalents as would be apparent to a person of ordinary skill . | 1 |
one or more embodiments or implementations are hereinafter described in conjunction with the drawings , where like reference numerals are used to refer to like elements throughout , and where the various features are not necessarily drawn to scale . with reference to fig1 , a block diagram of a lamp 100 according to aspects of the present disclosure is provided . the lamp 100 may , for example , be a traffic lamp , a lamp employed by the backlight of certain watches , and the like . the lamp 100 may include one or more of a light source 102 , a lens 104 , one or more sensors 106 , a power supply 108 , a memory 110 , a communications unit 112 , a controller 114 , and the like . the light source 102 suitably generates light for the lamp 100 . the light source 102 may include one or more types such as guided light ( e . g ., light guided from optical fibers or other types of light guides ); direct electric - powered light emitters ( single or cluster ), such as electroluminescent sources ( leds , organic leds , polymer leds , etc . ), gas discharge sources ( fluorescent , plasma , etc . ), high - intensity discharge sources , lasers , non - linear light sources ; and the like . the light source 102 may be selected to control correlated color temperature ( cct ), color rendering index ( cri ), and other like characteristics of light . the lens 104 suitably distributes light from the light source 102 uniformly across a light emitting face of the lamp 100 . as discussed in greater detail below , this may be achieved using a positive lens that works partially on refraction and partially on total internal reflection . in certain embodiments , the lens 100 may occupy at least half the light emitting face and / or the light source 102 may be positioned away from the lens 104 less than ¼ of the radius or focal length of the lens 102 . further , in certain embodiments , the lens may be treated to increase uniformity , improve lit appearance , and / or reduce glare . additionally or alternatively , another optical component , such as a diffusing film , may be used to achieve a similar affect . the sensors 106 suitably measure one or more operating conditions of the lamp 100 . operating conditions may include one or more of input voltage , operating temperature , output current and / or voltage to the light source 102 , light output of the light source 102 , and the like . in certain embodiments , the sensors 106 may include a photo - electric transducer , such as a solid - state photo - detector . in such embodiments , the photoelectric transducer can be connected to any surface of the lens 104 . however , a surface with less impact on the optical performance of the lens 104 , typically an outer surface , is preferable . in certain embodiments , the sensors 106 may additionally or alternatively include a thermistor . the power supply 108 suitably receives power from an external power source ( not shown ) and distributes the power to the constituent components of the lamp 100 . the input voltage of the received power may be an alternating current ( ac ) voltage or a direct current ( dc ) voltage . in certain embodiments , the power supply 108 may receive commands from the controller 114 and / or an external device ( not shown ), controlling the distribution of the power . for example , the power supply 108 may receive commands from the controller 114 instructing the power supply 108 as to the output current and / or voltage to provide to the light source 102 . in other embodiments , the power supply 108 may receive a signal from the sensors 106 , such as the photo - electric transducer , and adjust the output current and / or voltage to the light source 102 to maintain a constant light output . the power supply 108 suitably includes one or more hardware components for distribution of the power to the lamp 100 . for example , the power supply 108 may include one or more of a rectifier , surge protection circuit , an electromagnetic interference circuit , a switching power supply , a conflict monitor , a fuse , a fuse blowout ( fbo ) circuit , a power factor correcting power supply , and the like . however , other components , such as software components , are equally amenable . the memory 110 suitably stores log data associated with one or more operating conditions in a stateful manner . for example , the memory 110 may store the operating time of the traffic lamp 100 . the memory 110 may include one or more of a magnetic disk or other magnetic storage medium ; an optical disk or other optical storage medium ; a random access memory ( ram ), read - only memory ( rom ), or other electronic memory device or chip or set of operatively interconnected chips ; and the like . the communications unit 112 suitably provides the controller 114 with an interface from which to communicate with other lamps and / or components external to the lamp 100 . for example , the communications unit 112 may allow the lamp 100 to receive commands from an external controller ( not shown ). the communications unit 112 may communicate with these other lamps and / or components external to the lamp 100 via , for example , a communications network , such as a local area network , wide area network , the internet , and so on , and / or a data bus , such as i2c , universal serial bus , serial , and so on . the controller 114 suitably monitors operating conditions of the lamp 100 . monitoring may include receiving data pertaining to one or more operating conditions of the lamp 100 from one or more hardware and / or software components comprising the lamp 100 , such as the sensors 106 . the received data may include the present values of operating conditions and / or data necessary to calculate the present values of operating conditions . monitoring may further include calculating values for one or more operating conditions from the received data and / or determining whether the operating conditions are within acceptable limits based on this received data . as to the determination , values for operating conditions ( whether calculated or directly measured ) may be compared against thresholds and / or expected values for the operating conditions . if an operating condition falls outside acceptable limits a fault is detected . in certain embodiments , the controller 114 may instruct the power supply 108 as to the output current and / or voltage to provide to the light source 102 , so as to account for degradation factors , while monitoring operating conditions of the lamp 100 . degradation factors reduce the light output of the light source 102 and may include one or more of operating time of the light source 102 , operating temperature of the lamp 100 , and the like . the controller 114 may adjust the power supply output current and / or voltage on the basis of light output of the light source 102 as determined by one of the sensors 106 , such as the photo - electric transducer . alternatively , the controller 114 may adjust the power supply output current and / or voltage on the basis of a calculated output current and / or voltage . a calculated power supply output i out may be defined as : where i nom is the nominal output current to the light source 102 , f th is a correction factor adjusting for temperature inside the lamp 100 , and f de is a correction factor adjusting for the age of the light source 102 . the correction factors may be determined through the use of one or more lookup tables in which correction factors are indexed by present values of operating conditions . a calculated output voltage v out can similarly be calculated . in certain embodiments , the controller 114 may log operating conditions of the lamp 100 while monitoring operating conditions of the lamp 100 . the process of \ ogging operating conditions of the lamp 100 may include writing values ( calculated or otherwise ) of one or more of the operating conditions to the memory 110 . the values of operating conditions may overwrite previously written log data and / or be written as a log entry indexed by time . logging may be performed when one or more of the operating conditions are determined to fall outside acceptable limits ( i . e ., a fault is detected ). however , other triggers for logging are equally amenable . for example , logging may be performed at periodic intervals as determined by , for example , a timer of the lamp 100 . as another example , logging may be performed right before the lamp 100 goes into an off state . in certain embodiments , the controller 114 may generate an indication if a fault is detected while monitoring operating conditions of the lamp 100 . for example , if the operating temperature and / or operating time of the lamp 100 exceed certain thresholds the controller 114 may generate an indication . the indication may include generating an indication signal . the indication signal may be provided to a local component of the lamp 100 and / or an external component thereof . further , the indication signal may be used for one or more of generating an audio and / or visual warning , flashing one or more light sources , enabling a fault light source , and the like . the controller 114 may include a digital / electronic processor , such as a microprocessor , microcontroller , graphic processing unit ( gpu ), and the like . in such embodiments , the controller 114 suitably executes instructions stored on a memory . in certain embodiments , the memory may be the memory 110 of the lamp 100 . in other embodiments , the memory may be local to the controller 114 and one of rom , eprom , eeprom , flash memory , and the like . the controller 114 may communicate with the memory 110 of the lamp 100 via a digital communications protocol , such as i2c , usb , rs - 232 , rs - 485 , 1 wire , spi , wifi , and the like . however , analog communications protocols are equally amenable . the communications protocol may be carried over one or more of a data bus , a communications network , and the like . with reference to fig2 and 3 , a lamp 200 according to aspects of the present disclosure is provided . fig2 provides a top plane view of the lamp 200 and fig3 provides a cross sectional view of the lamp 200 along line 202 . the lamp 200 is a more specific embodiment of the lamp 100 of fig1 . therefore , the discussion heretofore is equally amenable to the discussion to follow and components described hereafter are to be understood as paralleling like components discussed heretofore , unless noted otherwise . the lamp 200 may include one or more of a housing 204 , a memory 206 , a light source 208 , a light emitting face 210 , a lens ( not shown ), one or more sensors 212 , a power supply 214 , a communications unit 216 , a controller 218 , a circuit board 220 , and the like . the housing 204 suitably defines the body of the lamp 200 . the housing 204 may provide a mounting structure and / or protection for components of the lamp 200 . further , the housing 204 may be formed from one or more of a polymeric material , a metallic material , and the like . in certain embodiments , the housing 204 may act as a heat sink to draw heat away from the components of the lamp 200 . the memory 206 suitably stores log data associated with one or more operating conditions in a stateful manner . for example , the memory 206 may store the operating time of the traffic lamp 200 . the memory 206 may include one or more of a magnetic disk or other magnetic storage medium ; an optical disk or other optical storage medium ; a random access memory ( ram ), read - only memory ( rom ), or other electronic memory device or chip or set of operatively interconnected chips ; and the like . the light source 208 suitably generates light for the lamp 200 . the light source 208 may include one or more of guided light , such as light guided from optical fibers or other types of light guides ; direct electric - powered light emitters ( single or cluster ), such as electroluminescent sources ( leds , organic leds , polymer leds , etc . ), gas discharge sources ( fluorescent , plasma , etc . ), high - intensity discharge sources , lasers , non - linear light sources , and the like . the light source 208 may be selected to control correlated color temperature ( cct ), color rendering index ( cri ), and other like characteristics of light . the light emitting face 210 suitably corresponds to the portion of the lamp 200 out of which light from the light source 208 is emitted . put another way , the light emitting face 210 may be viewed as the boundary through which light from the light source 208 passes to get to the external environment of the lamp 200 . in certain embodiments , the light emitting face 210 and the light emitting face of the lens may be one and the same . the lens suitably uniformly distributes light from the light source 208 across the light emitting face 210 of the lamp 200 . as discussed in detail below , this may be achieved using a positive lens that works partially on refraction and partially on total internal reflection . in certain embodiments , the lens may occupy at least half the light emitting face 210 and / or the light source 208 may be positioned away from the lens less than ¼ of the radius of the lens . further , in certain embodiments , the lens may be treated to at least one of increase uniformity , improve lit appearance , and reduce glare . additionally or alternatively , another optical component , such as a diffusing film , may be used to achieve a similar affect . the sensors 212 suitably measure one or more operating conditions of the lamp 200 . operating conditions may include one or more of input voltage , operating temperature , output current to the light source 208 , light output of the light source 208 , and the like . the sensors 212 may include , for example , one or more of a photo - electric transducer ( not shown ), such as a solid - state photo - detector , a thermal - electric transducer ( shown ), such as a thermistor , and the like . in certain embodiments , the photo - electric transducer is disposed on the light emitting face of the lens . the power supply 214 suitably receives power from an external power source ( not shown ) and distributes the power to the constituent components of the lamp 200 . in certain embodiments , the power supply 214 may receive commands from the controller 216 and / or an external device ( not shown ), controlling the distribution of the power . for example , the power supply 214 may receive commands from the controller 216 instructing the power supply 214 as to the output current to provide to the light source 208 . the communications unit 216 suitably provides the controller 218 with an interface from which to communicate with other lamps and / or components externals to the lamp 200 . the communications unit 216 may communicate with these other lamps and / or components external to the lamp 200 via , for example , a communications network , such as a local area network , wide area network , the internet , and so on , and / or a data bus , such as i2c , universal serial bus , serial , and so on . the controller 218 suitably monitors operating conditions of the lamp 200 . in certain embodiments , the controller 218 may instruct the power supply 214 as to the output current to provide to the light source 208 , so as to account for degradation factors , while monitoring operating conditions of the lamp 200 . degradation factors reduce the light output of the light source 208 and may include one or more of operating time of the light source 208 , operating temperature of the lamp 200 , and the like . in other embodiments , the controller 218 may additionally or alternatively log operating conditions , such as operating time , of the lamp 200 to the memory 206 while monitoring operating conditions of the lamp 200 . in other embodiments , the controller 218 may additionally or alternatively generate an indication if a fault is detected while monitoring operating conditions of the lamp 200 . the indication may include generating an indication signal , which may be used to generate an audio and / or visual notification . the circuit board 220 suitably provides a mounting point for one or more of the controller 218 , the communications unit 216 , the power supply 214 , the light source 208 , the memory 206 , one or more of the sensors 212 , and the like . further , the circuit board 220 suitably interconnects the components electrically . in certain embodiments , the circuit board 220 may act as a heat sink for components mounted thereon and / or include a metal core printed circuit board . the circuit board 220 may mount to the housing 204 of the lamp 200 by , for example , mechanical fasteners , glue , tape , epoxy , and the like . with reference to fig4 and 5 , a revolved lens 400 according to aspects of the present disclosure is provided . fig4 provides a top plane view of the lens 400 , and fig5 provides a cross sectional view of the lens 400 along line 402 . the lens 400 is suitably employed within a lamp , such as the lamp 100 of fig1 and / or the lamp 200 of fig2 and 3 . the lens 400 may include one or more of a first surface 404 , a second surface 406 , a waveguide channel 408 , a multi - faceted optical element 410 , an injection surface 412 , and the like . as the lens 400 is oriented in fig5 , the first surface 404 may be viewed as the top surface of the lens 400 , and the second surface 406 may be viewed as the bottom surface of the lens 400 . further , it is to be appreciated that the first surface 404 and the second surface 406 need not be continuous . for example , as shown , the first surface 404 includes the multi - faceted optical element 410 and the second surface includes the injection surface 412 . the first surface 404 and the second surface 406 suitably interact to define the waveguide channel 408 , which may distribute light to the periphery 414 of the lens 400 using total internal reflection . light suitably refracts through the first surface 404 as it travels to the periphery 414 of the lens 400 via the waveguide channel 408 . in certain embodiments , the light may travel along a line greater than a critical angle for total internal reflection with respect to the first surface 404 and / or the second surface 406 . further , in certain embodiments , the outer edges of the first surface and the second surface may be coincident . light directed towards the first surface 404 suitably partially reflects off the first surface 404 towards the second surface 406 . reflection suitably employs both total internal reflection and simple reflection . further , light directed towards the first surface 404 suitably partially refracts through the first surface 404 . in that regard , it is to be appreciated that the first surface 404 defines the light emitting face of the lens 400 . in certain embodiments , the first surface 404 may include a diffusing treatment to increase uniformity . light directed towards the second surface 406 suitably reflects off the second surface 406 towards the first surface 404 . reflection suitably employs both total internal reflection and simple reflection . so as to facilitate reflection , the second surface 406 suitably includes a plurality of converging facets , such as a first facet 416 . suitably , the converging facets , in conjunction with the multi - faceted optical element 410 , are configured to simulate a focal point 417 different than that of the position of the light source . the converging facets may include a plurality of optical surfaces , such as optical surfaces 418 , and a plurality of non - optical surfaces , such as non - optical surfaces 420 . the optical surfaces , in contrast with the non - optical surfaces , may redirect light directed thereto to the first surface 404 , typically via total internal reflection . the multi - faceted optical element 410 suitably reflects and refracts light directed thereto . reflection includes total internal reflection and / or simple reflection . for example , the multi - faceted optical element 410 may total internally reflect a portion of light directed thereto to the second surface 406 and / or the first surface 404 and refract the remainder of light directed thereto away from the lens 400 . to do so , the multi - faceted optical element 410 suitably includes a plurality of cusps formed from a plurality of optical surfaces , such as optical surfaces 424 , and a plurality of non - optical surfaces , such as non - optical surfaces 422 . light directed to the multi - faceted optical element 410 typically refracts through the non - optical surfaces , and reflects , typically using total internal reflection , off the optical surfaces towards the second surface 406 . the multi - faceted optical element 410 may converge towards the second surface 406 and / or be configured in a fresnel way . the multi - faceted optical element 410 may , but need not , be centrally located within the lens 400 and / or aligned with the center of a light source used in conjunction with the lens 400 . putting the latter another way , the point of convergence 426 of the multi - faceted optical element 410 may be aligned with the center of the light source . suitably , the facets are configured to simulate the focal point 417 different than that of the position of the light source . the injection surface 412 suitably acts as the receiving area of the lens 400 for light emitted by a light source used in conjunction with the lens 400 . the injection surface 412 may receive light emitted by a light source 428 placed within 25 % of the simulated focal distance of the lens 400 for the simulated focal point 417 . further , the injection surface 412 may include a spherical surface , where a light source is positioned in the center thereof . in certain embodiments , the injection surface 412 may include no optical power . with reference to fig6 , a perspective view of an extruded lens 600 according to aspects of the present disclosure is provided . the lens 600 is suitably employed within a lamp , such as the lamp 100 of fig1 . as with the lens 400 of fig4 and 5 , the lens 600 makes use of a combination of total internal reflection and refraction to uniformly distribute light from a light source across a light emitting face . further , the cross section of the extruded lens 600 is the same as the cross sectional view of the lens 400 of fig5 , whereby it is to be appreciated that the lens 600 operates as described in connection with the lens 400 of fig4 and 5 . therefore , in lieu of repeating the discussion of the lens 400 of fig4 and 5 , attention is directed to the discussion of the lens 400 of fig4 and 5 above . the disclosure has been made with reference to preferred embodiments . obviously , modifications and alterations will occur to others upon reading and understanding the preceding detailed description . it is intended that the preferred embodiments be construed as including all such modifications and alterations insofar as they come within the scope of the appended claims or the equivalents thereof . | 5 |
fig1 shows the underreamer of the present invention in the closed or relaxed position . fig2 shows the underreamer of the present application in the energized position with the cutter arm engaging a well bore wb . directing our attention to the underreamer shown in fig1 , the upper tubular body 10 provides a bore 14 allowing hydraulic communication through the upper body 10 from a drillstring ( not shown ) which is threaded to the upper male threads 12 of upper body 10 . upper body 10 also provides a counterbore section 16 into which is fitted upper tube assembly 26 providing a set of hydraulic seals 44 to provide a dynamic seal on the tube in the counter - bored section 16 of the upper body 10 . fig1 also shows a threaded connection means 12 on upper body 10 allowing connection in a drill string ( not shown ) and permitting the flow of drilling fluid through the upper tube assembly 26 through longitudinal passage 14 . upper body 10 is counter - bored 16 to provide a means for inner body , shown generally at 9 , to move longitudinally in the upper body 10 and lower body 20 in the following manner . the upper piston of the tube assembly 26 engages an interior wall of an annular sleeve 29 inserted in an upper threaded throat 27 of the lower body 20 . this sleeve 29 portion is held in a fixed position in the lower body 20 by set screw 29 a . counterbore 16 also provides chamber 18 with fluid passage 22 , enclosing a spring 23 which provides resistance to the extension movement of the inner body when pump pressure is increased and fills the space 28 through the port 24 to move the cutter arm 32 into engagement with the well bore for underreaming . tube assembly 26 provides a passage 24 to chamber 28 to provide hydraulic pressure from a longitudinal passage 14 to move the piston assembly connected to yoke 30 and cutter arm 32 . yoke 30 provides a rail permitting movement of stop block 34 . stop block 34 has a complementary slot for relative movement on yoke 30 . yoke 30 is threadedly connected to tube assembly 26 by threaded connection 38 and is prevented from loosening by set screw 40 . dynamic seals 42 , 44 , and 46 are provided between the hydraulically sealed tubes 26 , 36 to seal the tube assembly within the assembled underreamer body 10 , 20 . the cutter arm assembly 32 has a slot 48 into which is assembled a cam 50 retained in the body by pin or other means 52 to thereby permit relative lateral cutter arm 32 movement thereby engaging the cutter elements 54 on a distal end outward of the body 20 on a wellbore ( not shown in fig1 ). lower tube assembly 36 is seated on shoulder 35 onto which is placed upper tube 26 which are then affixed to the yoke assembly 30 by set screw 40 to prevent disengagement of the inner body assembly 9 . seal bushing assembly 46 is mounted in the distal end to support the dynamic sealing elements and is retained thereon by a snap ring 47 or other device , all in a manner well known in this art . as further shown in fig1 , inner body 9 comprised of an assembly providing a bore 17 communicating from the interior diameter 14 of an underreamer , comprised of an upper body 10 connected to lower body 20 , providing a jetting nozzle 100 in a manner well known in this art and providing hydraulic pressure on the drill bit or motor which are normally found on the distal end of the drill string . fig2 is another view of the improved underreamer of the present application showing the cutter arm in extension after pump pressure has moved the inner body up and caused each arm to move outwardly of the body . all of the structure shown in fig1 and 2 are described in u . s . pat . no . 4 , 614 , 242 , with the exception of the cooperating stop block 34 with the upper body 10 connected with lower body 20 to form the outer body of the underreamer . as shown in fig2 , an increase in pump pressure moves the piston arrangement , i . e . the top 26 of the inner body or tube assembly 9 providing a dynamic seal 45 a between the outer diameter of the inner body 9 and the inner diameter of the sleeve portion 29 , having lower seal 45 . as may be readily appreciated , increased pump pressure moves drilling mud from the inner longitudinal bore 17 through port 24 into the space 28 moving the piston upward and compressing resilient member 23 . this action moves yoke 30 drawing the stop block 34 across the unencumbered space 62 , as seen in fig1 , into engagement with the shoulder 60 of lower body 20 which together with upper body 10 forms the outer body of the underreamer . fig2 also shows the relative movement of the pin 66 from the relaxed or unextended position and pin 68 of the extended position of the cutter arm 32 yoke assembly 30 . fig3 is a cross - sectional view of the stop blocks 34 , shown on fig1 at line 3 - 3 , showing lower tube 36 providing passage 17 ′ and yoke 30 on which each stop block 34 is slideably engaged . fig3 also more clearly shows the relative distribution of the stop block assemblies 34 on each rail of the yoke assembly 30 . fig4 is a cross - sectional perspective through the view , shown in fig1 at line 4 - 4 , providing a view of the relative location of the cams 50 in grooves on each cutter arm 32 fitting around the central passage 36 to permit relative outward movement of the cutter arm assembly 32 . each side of the cam 50 is either provided with a pin 50 a for engaging the underrreamer body 20 or another method of fixing of said cam in said groove by means well known in the trade at 52 . fig5 is a cross - sectional view of the pivot pin 66 and stop block 34 connection through the line 5 - 5 shown in fig1 detailing the eccentric screws 70 which retain the pivot pins 66 in each cutter arm assembly 32 . each screw 70 is retained in the body with a snap ring 72 . tube 36 provides a fluid passageway 17 ′ through the yoke assembly 30 . fig6 is an end view of the stop block assembly 34 of the present embodiment showing the slot 600 running through the body 34 permitting slideable engagement with a rail on each portion of the yoke ( not shown ) and providing a shoulder 608 for engaging the yoke ( not shown ) and the stop block 34 in slideable engagement . the narrow portion of yoke 30 is affixed to the stop block 34 through the passageway 606 . stop block 34 also provides an upper surface 602 having a bevel 604 for conformity of the circular profile of the underreamer body 20 . fig7 is a side view of the stop block assembly 34 of the present embodiment showing the arcuate shaped lower end 614 . the figure shows a side view of the stop block 34 having a lower surface profile 614 which accommodates the end of cutter arm ( not shown ) and which , upon movement of the stop block 34 in the lower body ( not shown , but shown as 20 in fig1 and 2 ), engages the upper end 612 with the body ( not shown , but shown as 20 in fig1 and 2 ). lower profile 614 is designed to fully support the end of cutter arm ( not shown , but more fully shown as 32 in fig1 and 2 ) in its extended position upon movement of the stop block 34 into contact with the outer body ( not shown , but shown as 10 and 20 in fig1 and 2 ) at face 612 on the upper end of the stop block 34 . bevels 610 are provided on the upper end of stop block 34 to allow movement of the stop block 34 into full flush engagement with the upper body 20 shoulder at 60 , as shown in fig1 and 2 . the stop block is shaped to accommodate the pivot pin assembly ( not shown in this view , but shown as 66 and 68 in fig1 and 2 ) and the movement of the cutter arm ( not shown ) outward from the body 20 to hold the cutter arm in full engagement with the well bore ( not shown ). the flattened , shaved or beveled 604 exterior surface 602 allows the stop block 34 to conform with the circular profile of the underreamer body ( not shown ). the inner slot shown in the dashed area 600 , 606 engages a rail ( not shown ) on the yoke assembly to slideably move and retain the stop block during operation within the underreamer body as previously described . fig8 is a top view of the stop block assembly 34 of the present embodiment showing in the dashed areas , the inner rail slot location 600 a , 606 a cut through the stop block 34 and slideably engaging the rail on the yoke assembly as previously described . fig8 also shows the upper surface 602 , the bevels 610 on the upper surface 612 as previously described and the lower surface 614 for engagement of the end of the cutter arms , all as previously described . the particular embodiments disclosed above are illustrative only , as the invention may be modified and practiced in different but equivalent manners apparent to those skilled in the art having the benefit of the teachings herein . furthermore , no limitations are intended to the details of construction or design herein shown , other than as described in the claims below . it is therefore evident that the particular embodiments disclosed above may be altered or modified and all such variations are considered within the scope and spirit of the invention . accordingly , the protection sought herein is as set forth in the claims below . | 4 |
embodiments of the present invention will hereinafter be described with reference to the accompanying drawings . reference numerals in the sheets of drawings should identify the following elements and parts . reference numeral 1 denotes a recording unit , reference numeral 2 denotes identification information , reference numeral 3 denotes a groove portion , reference numeral 4 denotes a land portion , reference numeral 5 denotes a track switching portion , reference numeral 6 denotes a non - switching portion , reference numeral 7 denotes a beam spot , reference numeral 15 denotes a wobbling , reference numeral 16 denotes a one cycle of wobbling , reference numeral 21 denotes identification information disposed at a first position , reference numeral 22 denotes identification information disposed at a second position , reference numeral 23 denotes a prepit , reference numerals 11 and 12 denote recording units , reference numerals 91 , 92 , 93 denote grooves , and reference numerals 81 , 82 denote information recording portions , respectively . [ 0063 ] fig5 shows the manner in which tracks and sectors of the information recording medium according to the present invention are disposed . as shown in fig5 a plurality of groups 91 , 92 and 93 are disposed in the radius direction of a disk - like recording medium 8 . the track 3 is wobbled by a very small amount in the radius direction of the disk - like recording medium 8 . each track 3 is divided into a plurality of circular arc - like sectors ( recording units ) 1 arrayed in the radius direction of the disk - like recording medium 8 . the length of the circular arc - like sector 1 is selected in such a manner that the number of the divided sectors per circumference of the disk - like recording medium 8 increases in the groups located at the position of the larger radius so as to make the length of the circular arc - like sector 1 become almost constant independently of the groups . [ 0064 ] fig1 shows an example of the manner in which tracks are disposed within one group of the information recording medium according to the present invention . as shown in fig1 within one group , there are alternately located groove portion information tracks 3 having a width of 0 . 7 μm and a depth of 60 nm and a land portion information track 4 having a width of 0 . 7 μm . the groove portion information track 3 and the land portion information track 4 are connected to each other by a switching portion 5 . specifically , the groove portion information track 3 is arranged such that it is connected to the adjacent land portion information track 4 after one circumference of the track , and the land portion information track 4 is arranged such that it is connected to the adjacent groove portion information track 3 after one circumference of the track . each track is divided into a plurality of circular arc - like recording units such as sectors , and identification information 2 is disposed at the head of each of the information recording units 1 . in this example , the length of the sector is about 8 mm , which corresponds to a user capacity of 2048 bytes . the groove portion information track 3 and the land portion information track 4 are wobbled with an amplitude of about 20 nm in the radius direction of the disk - like recording medium 8 . a wobble cycle during which the groove portion information 3 and the land portion information track 4 are wobbled in the radius direction was set to 1 / 145 of the sector length , i . e . about 55 μm . the ratio of 1 : 145 was selected in such a manner that the wobbling cycle becomes an integral multiple of the length ( channel bit length ) of recorded data . according to this arrangement , it becomes easy to generate a recording clock from the wobbling . [ 0065 ] fig2 and 3 are respectively fragmentary plan views illustrating information identification information portions in an enlarged scale . [ 0066 ] fig2 schematically shows a portion 6 in which preceding and succeeding tracks of identification information are connected by the groove portion information tracks 3 and the land portion information tracks 4 . also , fig3 schematically shows a portion in which preceding and succeeding tracks are connected at the groove portion information tracks 3 and the land portion information tracks 4 , i . e . a portion in which identification information is disposed such that the positions of the directions extended along the information tracks are different in the adjacent tracks but agree with the track advanced or delayed by two tracks . as shown in fig2 identification information is disposed to be radial in the radius direction at the two places of the first position 21 and the second position 22 . the preceding and succeeding tracks are connected by the groove portion information tracks 3 and the land portion information tracks 4 . in this illustrated example of fig2 each identification information corresponds to the recording area of the right - hand side information track . further , identification information corresponding to the right - hand side groove portion information track 3 is disposed at the first position 21 , and identification information corresponding to the land portion information track 4 is disposed at the second position 22 . specifically , the positions of the identification information along the information tracks are different from each other in the adjacent tracks but agree with each other in the tracks advanced or delayed by the two tracks . in the switching portion 5 of fig3 the preceding and succeeding tracks of identification information are connected to each other in the groove portion information track 3 and the land portion information track 4 . also in this case , each identification information corresponds to the recording area of the right - hand side information track . as shown in fig3 identification information corresponding to the right - hand side groove portion information track 3 is disposed at the first position 21 , and identification information corresponding to the land portion information track 4 is disposed at the second position 22 . as a consequence , when the beam spot 7 scans the land portion information track 4 , only pits of the one side are constantly reproduced . there is then no risk that a crosstalk occurs from the adjacent track . therefore , it becomes possible to satisfactorily reproduce address information from the prepits without crosstalk . the address information at the prepit is recorded by an 8 / 16 ( eight - to - sixteen ) modulation code ( channel bit length is 0 . 2 μm ). [ 0069 ] fig4 is a perspective view illustrating the manner in which tracks and identification information are configured according to the embodiment of the present invention , highlighting the manner in which identification information is formed by small concave portions ( pits ) 23 . according to this embodiment , since the pits 23 are equally disposed on both sides of the track ( land portion or the groove portion ), a bad influence exerted by the pits 23 upon a tracking servo signal can be cancelled out . accordingly , it is possible to suppress a track offset to be sufficiently small . further , when the land portion information track 4 , for example , is reproduced , address information of the first prepit portion 21 and address information of the second prepit portion 22 are reproduced continuously . therefore , if information is disposed in such a fashion that both of the address information of the first prepit portion 21 and the address information of the second prepit portion 22 may be integrated as one address information , then address ( track no . ), i . e . identification information can be set independently of the land portion information track 4 and the groove portion information track 3 . specifically , it becomes possible to discriminate the land portion information track 4 and the groove portion information track 3 from each other by continuously reproducing the address information of the first prepit portion 21 and the address information of the second prepit portion 22 . [ 0071 ] fig6 shows concretely an example of the manner in which identification information is numbered . in fig6 there are illustrated the identification information of the recording area 11 and the identification information of the recording area 12 . in this example , identification information is recorded on and / or reproduced from the recording medium by relatively scanning detection spots from left to right of fig6 . a groove portion information track k of the left - hand side , for example , is connected to a land portion information track k + 1 of the right - hand side of the switching portion 5 . a land portion information track k + 1 of the left - hand side is connected to the land portion information track k + 1 after one circumference . in this example , identification information of an information recording area 81 of the groove portion information track k , for example , is n − 1 + s where s denotes a sum of optical recording information units per circumference of the track . when the identification information portion 6 of this track is reproduced by the beam spot or the like , n − 1 + 2s is reproduced as identification information located at the first position 21 , and n − 1 + s is reproduced as identification information located as the second position 22 . in this case , if a smaller number is constantly used as a recording area no . in advance , then n − 1 + s is used as identification information of the information recording area 81 of this groove portion information track k . when the land portion information track k − 1 is scanned by the beam spot or the like , n − 1 is similarly used as identification information located at the first position 21 . at the same time , it is possible to discriminate the groove portion information track and the land portion information track from each other by detecting whether the identification information located at the first position 21 or the identification information located at the second position 22 is used . when the information track located at the track switching portion 5 is reproduced , a correspondence of identification information and recorded information can be judged in exactly the same manner , and also the groove portion information track and the land portion information track can be discriminated from each other in exactly the same way . accordingly , it is possible to switch the track polarity between the groove portion information track and the land portion information track by making effective use of the above - mentioned relationship . while there are two sets of the first and second identification information portions as described above , the present invention is not limited thereto , and there may be provided a plurality of sets of identification information portions . if there are provided four sets of identification information portions , for example , then first and third prepit portions are located under the groove portions and second and fourth prepit portions are located above the groove portions . if the number of the prepit portions increases , then the information recording medium according to the present invention becomes resistant to defects or the like , and therefore becomes highly - reliable . here , a phase change type recording film ( gesbte ) was used as a recording film of this information recording medium . accordingly , a recording mark is produced in the form of amorphous area . an example of an information recording and / or reproducing method using the recording medium according to the embodiment 1 will be described with reference to fig7 . as shown in fig7 the information recording medium 8 according to the embodiment 1 is rotated by a motor 162 . a light intensity control circuit 171 controls a light generating circuit 131 so that the light generating circuit 131 generates light 122 having a light intensity instructed by a central control circuit 151 . a converging circuit 132 converges the light 122 generated from the light generating circuit 131 to form a beam spot 7 on the information recording medium 8 . reflected light 123 of the light 122 is detected by a photo detecting circuit 133 . the photo detecting circuit 133 comprises a plurality of split photo detectors . a wobble detecting circuit 191 reproduces information from the information recording medium 8 by using a reproduced signal 130 from the split photo detectors of the photo detecting circuit 133 . when a wobbling of the track on the information recording medium 8 is detected , there is used a differential output among the outputs from the split photo detectors of the photo detecting circuit 133 . the reason that the differential output is utilized is based on such a fact that an intensity distribution of diffracted light from the beam spot is changed depending on a positional relationship between the beam spot and the track . on the basis of the wobble signal detected by the wobble detecting circuit 191 , information indicative of the positional relationship between the beam spot and the track and further prepit identification information , a position control circuit 161 controls the position of the converging circuit 132 and a rotation frequency of the motor 162 . when the position control circuit 161 controls the rotation frequency of the motor 162 , the rotation frequency is controlled in such a manner that a reproduced wobble signal may have a previously - determined constant value . if the rotational frequency of the motor 162 is controlled by the position control circuit 161 as described above , then the rotational speed of the motor 162 can be automatically and properly controlled independently of the groups on the information recording medium 8 . also , since this rotation information of the motor 162 has one cycle of about 55 μm , the rotation information is very high in density , and it becomes possible to control the rotation of the motor 162 with a high accuracy . furthermore , since this rotation information is disposed all over one revolution of the disk , even when a part of the rotation information is dropped out by some causes such as smudges or defects , the rotation information can be reproduced from the information recording medium 8 with a high accuracy satisfactorily . a description will now be given on a method of recording and / or reproducing information on and / or from an information recording medium by generating a clock synchronized with a phase of a wobble signal when information is recorded and / or reproduced . in order to generate the above - mentioned clock synchronized with the phase of the wobble signal , there is used a pll ( phase - locked loop ) circuit . since this clock is accurately synchronized with the wobble information of the information recording medium , if information is recorded on and / or reproduced from the information recording medium by using this clock , then information can be recorded on and / or reproduced from the information recording medium at a timing perfectly synchronized with the position on the information recording medium . therefore , information can be recorded on and / or reproduced from the information recording medium without providing unnecessary buffer areas on the information recording medium , and it is possible to obtain an information recording medium which is high in format efficiency . as a consequence , there can be raised a recording capacity of the information recording medium . furthermore , since the wobble information ( rotation information ) is disposed all over one revolution of the disk , even when a part of the wobble information is dropped out , information can be reproduced from the information recording medium with a high reliability satisfactorily . [ 0081 ] fig5 shows the manner in which the tracks and the sectors of the recording medium according to the embodiment of the present invention are disposed . as shown in fig5 there are disposed a plurality of zones ( groups ) 91 , 92 , and 93 in the radius direction of the disk - like recording medium 8 having a diameter of 120 mm . in this example of fig5 there are divided 24 zones of which the radiuses are ranging from about 24 mm to 58 mm . accordingly , one zone has a band width of about 1 . 4 mm . the groove portion information track 3 is wobbled by a very small amount in the radius direction of the disklike recording medium 8 . each of the groove portion information track 3 is divided into a plurality of circular arc - like sectors ( recording units ) 1 arrayed in the radius direction of the disk - like recording medium 8 . the length of the circular arc - like sector 1 is made almost constant independently of the zones ( groups ) so that the number of the divided sectors per circumference increases in the zone located at the position of the larger radius . in this embodiment , each track 3 is divided in such a manner that there are provided 17 recording units 1 per circumference in the zone ( inner - most peripheral zone ) of the radius of about 25 mm . the number of the divided zones increases one by one in the outer peripheral zone . by using the information recording medium having the groups divided in such a manner that the number of the divided groups increases in the outer peripheral zone as described above , the lengths of the recording units 1 in the inner and outer peripheries of the information recording medium 8 can be made almost constant . in other words , the density of the rotation information can be made substantially constant , and the surface area ( i . e . whole surface ) of the information recording medium 8 can be used effectively . moreover , since information can be recorded on and / or reproduced from the information recording medium at the same rotational speed and with the same recording frequency within each group , an information recording and / or reproducing apparatus using the information recording medium can be simplified in configuration . it is needless to say that the lengths of the recording units are slightly different in the inside and the outside of each zone . [ 0082 ] fig1 shows an example of the manner in which tracks within one group are disposed in the information recording medium according to the present invention . as shown in fig1 there are alternately disposed the groove portion information tracks 3 having a width of 0 . 74 μm and a depth of 60 nm and the land portion information tracks 4 having a width of 0 . 74 μm . in each zone , there are disposed about 950 groove portion information tracks 3 and the land portion information tracks 4 of the same number as that of the groove portion information track 3 . the groove portion information track 3 and the land portion information track 4 are connected to each other by the track switching portion 5 which is located at one place on one circumference of the disk . specifically , the groove portion information track 3 is connected to the adjacent land portion information track 4 after one circumference of the track , and the land portion information track 4 is connected to the adjacent groove portion information track 3 after one circumference of the track . each track is divided into a plurality of circular arc - like information recording units 1 , and the identification information 2 is disposed at the starting portion of each information recording unit 1 . in this example , the length of the information recording unit 1 is about 8 . 5 mm , which corresponds to a user capacity of 2048 bytes . the groove portion and the land portion are wobbled in the radius direction of the information recording medium by a half width amplitude of about 20 nm . the wobble cycle was set to 1 / 232 of the sector length or about 37 μm . the ratio of 1 : 232 is set not only within one group ( zone ) but also in all the recording units 1 on the disk . the ratio of 1 : 232 was selected in such a fashion that the wobble cycle becomes an integral multiple ( in this example , 186 times ) of the unit length ( channel bit length ) of the recorded data . accordingly , the length of the recording unit is equivalent to 232 × 186 = 43152 channel bits when it is expressed by the channel bit number . since the wobble cycle is equal to the integral multiples of the recording channel bit as described above , it is possible to easily generate a recording clock by multiplying the wobble frequency with an integral number . moreover , since the relationship between the information recording unit 1 and the duration of the wobbling cycle becomes equal over the whole surface of the disk , it becomes possible to generate the recording clock by using the signal obtained from the wobbling without switching the signal at the zone . thus , a density within the disk can be made almost uniform by the apparatus of the simple configuration , and the whole surface of the disk can be used efficiently . furthermore , if the rotational speed of the disk is controlled in such a manner that the wobbling frequency becomes constant , then it becomes possible to make a relative linear velocity between the beam spot and the information recording medium almost constant independently of the position of the information recording medium . if the linear velocity is made substantially constant as described above , then information can be recorded on and / or reproduced from the recording medium under the same recording conditions independently of the position of the information recording medium . thus , the recording and reproducing characteristics of the information recording medium can be controlled with ease , and hence the recording apparatus and the information recording medium can be configured with ease . here , since the lengths of the recording areas 1 are slightly different in the inside and the outside of the zone , the duration of the wobble cycle of a reciprocal of an integral number of the recording unit also is different in the inner and outer peripheries of the zone . thus , it is needless to say that a linear velocity also is different slightly . however , because central angles formed by the recording units are constant within the zone , the revolution rate ( angular velocity ) within the zone become constants so that it becomes possible to access the information recording medium within the zone at a high speed . moreover , since the integral multiple ( 232 times ) of the wobbling cycle agrees with the length of the recording unit 1 , the phases of the wobbling signals can be perfectly connected to each other without fractions between the adjacent recording units 1 . thus , it is easy to generate a timing signal such as a clock over the consecutive recording units 1 by using the wobbling signal . the fact that the phases of the wobbling signals are perfectly connected to each other without fractions means that the phases of the wobbling signals are made continuous between the adjacent recording units 1 but the wobbling signals need not always be continuous from a physical standpoint . specifically , there might be used such an information recording medium in which a wobbling signal is dropped out at the boundary portion of the recording units 1 over several cycles . in that case , if such dropped - out portions are interpolated , then the phases of the wobbling signals may be connected between the adjacent recording units 1 . in actual practice , according to this embodiment , the identification information composed of prepits is provided at the starting portion of the recording unit and neither the groove portion information track 3 nor the land portion information track 4 exists with the result that the wobble signal is not formed at all . that is , the wobble signal is dropped out during about 11 . 2 cycles due to this identification information 2 . accordingly , while there exist about 220 . 8 wobble signals in actual practice , the length of the recording information unit becomes exactly 232 times the cycle of the wobble signal . here , the recording unit in this embodiment need not always agree with the length of the sector . for example , more than two sectors may be integrated as one recording unit , and identification information may be disposed within such integrated recording unit . moreover , a plurality of recording units may be integrated as a logical sector or a logical block necessary for correcting errors . at any rate , the recording unit in this embodiment is referred to as an area of substantially a constant length in which identification information is disposed at the starting portion thereof . [ 0086 ] fig2 and 3 are respectively plan views illustrating identification information portions of the information recording medium in an enlarged scale . [ 0087 ] fig2 shows a portion 6 in which preceding and succeeding tracks of identification information are connected at the groove portions and the land portions . fig3 shows a portion 5 in which preceding and succeeding tracks are connected at the groove portions and the land portions , i . e . a portion in which the positions at which identification information is arrayed along the information tracks are different between the adjacent tracks but agree with the track advanced or delayed by two tracks . as shown in fig2 identification information is disposed to be radial at a first position 21 and a second position 22 in the radius direction of the information recording medium . the preceding and succeeding tracks are connected to each other by the groove portion information tracks 3 and the land portion information tracks 4 . in this illustrated example , each identification information corresponds to the recording area of the groove portion information track 3 on the right - hand side of fig2 . further , identification information corresponding to the groove portion information track 3 on the right - hand side of fig2 is placed at the first position 21 , and identification information corresponding to the land portion information track 4 is placed at the second position 22 . specifically , the positions at which identification information is arrayed along the information tracks are different between the adjacent tracks but agree with the track which is advanced or delayed by two tracks . the wobble signal is of a sine wave shape which begins with the same phase relative to all information tracks . the wobble signal starts immediately after the identification information portion or starts via a few buffer areas . with this arrangement , if points at which phases of the sine - wave wobble signal become zero degree are connected to each other by the adjacent tracks , then these points are arrayed to be radial so that the track width is never changed by the wobble signal . there is then presented no risk that the wobble signal will exert a bad influence upon the recording and reproducing characteristics . if the phases of the wobble signals are not made uniform in each track , then there is produced a portion in which the track width is modulated by the wobble signal , thereby resulting in the recording and reproducing characteristics being affected considerably . therefore , as is evident from the above description of the present invention , in order to realize the present invention , it is very important to make the phases ( including polarities ) of the wobble signals uniform between the adjacent tracks . in the track switching portion 5 shown in fig3 the preceding and succeeding tracks of the identification information are connected to each other at the groove portion and the land portion . also in this case , each identification information corresponds to the recording area of the information track on the right - hand side of fig3 . identification information corresponding to the groove portion information track 3 on the right - hand side of fig3 is placed at the first position 21 , and identification information corresponding to the land portion information track 4 on the right - hand side of fig3 is placed at the second position 22 . therefore , when the beam spot 21 scans the land portion information track 4 , for example , only one pit is constantly reproduced . there is then no risk that a crosstalk from the adjacent track will occur . accordingly , it becomes possible to satisfactorily reproduce address information provided at the prepits without crosstalk . in this example , the address information provided at the prepits is recorded on the information recording medium by an 8 / 16 ( eight - to - sixteen ) modulation code ( channel bit length is 0 . 2 μm ). accordingly , a shortest pit length is about 0 . 6 μm . from a standpoint of simplifying the configuration of the information recording and / or reproducing apparatus , the modulation code of the prepit portion and the modulation code of the user information recording portion should preferably be made the same . in this embodiment , the modulation code and the recording linear density are both made the same with the result that most of the circuit portions of the information recording and / or reproducing apparatus can be made common . [ 0091 ] fig4 is a perspective view illustrating the manner in which tracks and identification information according to this embodiment are configured , highlighting the manner in which identification information is formed by small concave portions ( pits ) 23 . in this embodiment , since the pits 23 are equally disposed on both sides of the track ( the land portion or the groove portion ), an influence exerted upon a tracking servo signal by the pits 23 is cancelled out so that a track offset can be suppressed to be sufficiently small . further , when the land portion information track 4 is reproduced , the address information of the first prepit portion 21 and that of the second prepit portion 22 are reproduced continuously . therefore , if information is disposed in such a fashion that both of address information are integrated as one address information , then it is possible to separately set address ( track no . ), i . e . identification information independently of the land portion information track 4 and the groove portion information track 3 . specifically , if the address information of the first prepit portion 21 and the address information of the second prepit portion 22 are reproduced continuously , then it becomes possible to discriminate the land portion information track 3 and the groove portion information track 4 from each other . [ 0093 ] fig6 concretely illustrates the example of the manner in which identification information is numbered , showing identification information of the recording area 11 and identification information of the recording area 12 . in this example , information is recorded and / or reproduced while detection spots are relatively scanned from left to right of the information recording medium . as shown in fig6 a groove portion information track k on the left - hand side is connected to a right - hand side land portion information track k + 1 . the left - hand side land portion information track k + 1 is connected to this track after one circumference of the information recording medium . in this example , identification information of an information recording area 81 of the groove portion information track k is n − 1 + s where reference letter s denotes a sum of optical recording information units per circumference of the track . if the identification information portion 6 of this track is reproduced by the beam spot or the like , then n − 1 + 2s is reproduced as identification information existing at the first position 21 , and n − 1 + s is reproduced as identification information existing at the second position 22 . in this case , if a smaller number is constantly used as a recording area no . in advance , then n − 1 + s is adopted as identification information of the information recording area 81 of this groove portion information track k . when the land portion information information track k − 1 is scanned , n − 1 is adopted as the identification information existing at the first position 21 similarly . at the same time , by the identification information existing at the first position 21 or the identification information existing at the second position 22 , it is possible to discriminate the groove portion information track 3 and the land portion information track 4 from each other . when the information track placed at the track switching portion 5 is reproduced , the correspondence between the identification information and the recording area can be detected , and the groove portion information track 3 and the land portion information track 4 can be discriminated from each other in exactly the same manner as that described above . therefore , by using this relationship , it is possible to switch the track polarities of the groove portion information track and the land portion information track . while there are provided two sets of the first and second identification information portions as described above in this example , there may be provided a plurality of sets of identification information portions . if there are provided four sets of identification information portions , then the first and second prepit portions may be located on the lower side of the groove portion ( inside of the radius direction ), and the third and fourth prepit portions may be located on the upper side of the groove portion ( outside of the radius direction ). alternatively , the first and third prepit portions may be located on the lower side of the groove portion , and the second and fourth prepit portions may be located on the upper side of the groove portion . the information recording medium can be made more resistant to the defects or the like and become highly - reliable by increasing the number of the prepit portions . here , a phase change type recording film ( gesbte ) was used as a recording film . accordingly , a recording mark is produced in the form of an amorphous area . the manner in which information is recorded on and / or reproduced from the information recording medium of the embodiment 4 by the information recording and / or reproducing apparatus shown in fig7 will be described below . as shown in fig7 the information recording medium 8 according to the embodiment 4 is rotated by the motor 162 . the light intensity control means 171 controls the light generating circuit 131 to generate the light 122 in such a way as to obtain a light intensity instructed by the central control circuit 151 . the converging circuit 132 converges the light 122 to form the beam spot 7 on the information recording medium 8 . the light 12 is detected by using the reflected light 123 from the beam spot 7 with the photo detecting circuit 133 . the photo detecting circuit 133 comprises a plurality of split photo detectors . the wobble detecting circuit 191 reproduces information from the information recording medium 8 by using the reproduced signal 130 from the split photo detectors of the photo detecting circuit 133 . when the wobble signal of the track on the information recording medium 8 is detected , there is used a differential output between the outputs from the split photo detectors of the photo detecting circuit 133 . this utilizes the fact that an intensity distribution of diffracted light from the beam spot is changed depending upon a positional relationship between the beam spot and the track . on the basis of the wobble signal detected by the reproducing means 191 , information indicative of the positional relationship between the beam spot and the track and prepit identification information , the position control circuit 161 controls the position of the converging circuit 132 , and also controls the rotation frequency of the motor 162 . in this case , the position control circuit 161 controls the rotation frequency of the motor 162 in such a manner that the frequency of the reproduced wobble signal becomes a previously - determined constant value . if the rotation frequency of the motor 162 is controlled by the position control circuit 161 as described above , then it is possible to automatically control the motor 162 independently of the zones on the information recording medium 8 so that the motor 162 can be rotated at a proper rotational speed . also , since this rotation information has one cycle of about 37 μm , the rotation information is considerably high in density , and it becomes possible to control the rotation of the motor 162 with a high accuracy . furthermore , since this rotation information is disposed all over one revolution of the disk , even when one portion of the rotation information is dropped out due to some causes such as smudges or defects , information can be satisfactorily reproduced from the information recording medium 8 highly reliably . [ 0099 ] fig8 shows examples of a reproduced signal 41 of wobble information and a reproduced signal 42 of identification information portion . in this example , photo detectors which are split at least by a half in the radius direction are used as a detector , and there is obtained a differential signal between the outputs from the two split photo detectors . specifically , there was used a detection system that is similar to a detection system of a push - pull signal used in an ordinary tracking control or the like . however , since the frequency of the wobble signal and the frequency of the identification information signal are higher than the band necessary for the tracking servo , there were prepared an amplifying apparatus and a differential circuit , both of which should be in accordance with the high frequency specification . there were obtained reproduced signals 421 , 422 , 423 and 424 in correspondence with the first , second , third and fourth identification information signals 21 , 22 , 23 and 24 . when the beam spot 7 is not overlapping the prepit 23 of the identification information portion 2 , reflected light is equally introduced into the above - mentioned split photo detectors so that a reproduced signal ( differential signal ) output is almost zero . whereas , under the condition that the beam spot 7 partly overlaps the prepit 23 ( see fig2 ), a distribution of reflected light from the beam spot 7 is largely deviated due to a diffraction effect , and the outputs from the split photo detectors are unbalanced . as a consequence , there is obtained a large differential signal output . inasmuch as the direction in which the distribution of reflected light is deviated at that time is different depending on the positional relationship between the beam spot and the pit , the differential output corresponding to the identification information portions 21 , 22 and the differential output corresponding to the identification information portions 23 , 24 are inverted in polarity . accordingly , if this polarity of the differential outputs is used , then it is possible to determine any one of the groove portion information track and the land portion information track in which the beam spot is positioned . identification information can be obtained when the resulting signal is converted into a binary signal and then decoded by a follow - up slice circuit ( not shown ). at that time , since error detection information is added to the identification information , it is possible to judge whether or not identification information is detected correctly . hence , there can be used only correct identification information in a plurality of identification information . the wobble signal is detected in a similar manner . specifically , since the positional relationship between the beam spot and the groove is modulated by the wobbling signal , there is obtained a signal output 41 shown in fig8 . however , since an amplitude ( track displacement amount : 20 nm ) of a wobble signal is small relative to the displacement amount ( about 0 . 3 μm ) of identification information , the amplitude of the wobble signal becomes smaller in proportion thereto . an example of the manner in which a timing signal ( clock signal ) is obtained from the wobble signal thus detected will be described with reference to fig1 a through 10d . initially , the reproduced signal 41 shown in fig8 is supplied to a limiter circuit shown in fig1 a , in which an identification information is limited in amplitude . then , by using the bandpass filter shown in fig1 b , only a signal having a component synchronized with the wobble signal is extracted from the reproduced signal . then , the resulting signal is converted into a binary signal by a comparator shown in fig1 c , and eventually , there is obtained the clock signal by using a phase - locked loop ( pll ) comprising a phase comparator , a filter circuit , a vco ( voltage - controlled oscillator ) and a divide - by - 186 circuit as shown in fig1 d . at that time , a filter characteristic used in the pll is set to be sufficiently lower than the frequency corresponding to 11 . 2 wobble cycles in this example in such a manner that the clock signal may be prevented from being affected by a dropped - out portion ( identification information portion ) of the wobble signal . in this embodiment , since the frequency of the wobble signal becomes 160 khz , the frequency band of the pll is set to about 2 khz . this frequency should preferably be set to be larger than a frequency ( about 700 hz ) corresponding to the length of the recording unit from a standpoint of a high - speed accessing . in this way , there was obtained the clock signal that was synchronized with the wobble signal . a method of recording and / or reproducing information on and / or from the information recording medium by using this clock signal and identification information will be described below . [ 0104 ] fig9 is a timing chart used to explain the manner in which information is recorded on and / or reproduced from the information recording medium . in fig9 reference letters ( a ), ( b ), ( c ), and ( d ) denote an identification information detecting signal , a wobble signal , a clock signal , and a recording and reproducing timing signal , respectively . the identification information detecting signal is a signal indicating that identification information is detected normally . it is customary that the recording unit areas that should be recorded and / or reproduced are discriminated from each other based on this identification information detecting signal and that the recording and / or reproducing timing can be controlled . according to the present invention , when the identification information could not be normally detected as shown in fig9 ( crosses on ( a ) in fig9 show that identification information could not be detected normally ), it is possible to obtain the recording and reproducing timing signal instead of the identification information detecting signal by counting the clock signal obtained from the wobble signal based on the final identification information that was detected normally . according to this arrangement , even when identification information cannot be detected normally , there can be obtained the recording and reproducing timing signal . also , since this recording and reproducing timing signal is generated from the wobble signal synchronized with the information recording medium , even if there is an error such as a rotational speed of the information recording medium , the recording and reproducing timing signal can be obtained accurately . furthermore , even when a plurality of identification information cannot be detected continuously , there is no risk that errors will be accumulated . therefore , it becomes possible to configure an information recording and / or reproducing apparatus which can greatly allow errors of identification information itself . if the signal detected from the above - mentioned wobble signal and the identification information are combined as described above , then it becomes possible to identify the position of the beam spot at all positions on the disk . thus , information can be recorded on and / or reproduced from the information recording medium highly reliably . with the above - mentioned advantage , even if the information recording medium is not inspected at al when the information recording medium is shipped , it becomes possible to maintain the recording and / or reproduction highly reliable , thereby making it possible to reduce the cost of the information recording medium considerably . furthermore , since the information recording medium becomes very resistant to smudges , the information recording medium need not be protected from the smudges by some suitable means such as a case . therefore , it becomes possible to provide an inexpensive information recording medium . according to the aforementioned first to fifth embodiments of the present invention , since information can be recorded on and / or reproduced from the information recording medium highly reliably , even if the information recording medium is not inspected at all when the information recording media are shipped , a high reliability with which information is recorded on and / or reproduced from the information recording medium can be maintained , thereby making it possible to reduce the cost of the information recording medium considerably . moreover , since the information recording medium according to the present invention becomes very resistant to smudges , the information recording medium need not be protected from the smudges by some suitable means such as a case . therefore , it becomes possible to provide an inexpensive information recording medium . further , since the recording units are arrayed to be radial in the radius direction of the information recording medium , the tracks can be accessed with ease , and a crosstalk between position information of respective recording units can be suppressed to the minimum . moreover , since the recording units are disposed in such a manner that the lengths of the circular arc - shaped portions which are the recording units are made almost the same , a recording density becomes substantially uniform within the disk , and hence it becomes possible to use the whole surface of the disk efficiently . moreover , the starting point and the ending point of the recording unit can be reliably detected by using the wobble cycle , and it becomes possible to detect the accurate position in the recording unit . also , since the length of the recording unit and the wobble cycle are perfectly synchronized with each other , by making the wobble frequency become constant , it is possible to automatically control the rotational speed of the information recording medium in such a fashion that the relative velocity of the information recording medium becomes almost constant . further , since it becomes easy to make the length of each recording unit on the information recording medium become constant , the length of the extra gaps on the information recording medium can be minimized . furthermore , since it is possible to record and / or reproduce information on and / or from the information recording medium while monitoring the displacement amount of the track , a reliability with which the positioning servo is effected can be improved greatly . according to the present invention , since the identification information is provided at every recording unit and the position information can be reliably obtained from the recording portion owing to the wobbles of the groove portion and the land portion , the recorded information can be accessed reliably and the recording information can be positioned on the information recording medium with a high accuracy . having described preferred embodiments of the invention with reference to the accompanying drawings , it is to be understood that the invention is not limited to those precise embodiments and that various changes and modifications can be effected therein by one skilled in the art without departing from the spirit or scope of the invention as defined in the appended claims . | 6 |
as shown in fig1 the shield 11 of the present invention is for use in conjunction with a high chair 13 . the high chair 13 , which is conventional and commercially available , includes a tray 15 and a seat cushion 55 . the tray and seat cushion are supported up off of the ground by a chair frame that includes legs 57 and horizontal beams 59 . the legs 57 typically extend upwardly beyond the seat cushion 55 to arm rests . the tray 15 is coupled to the arm rests . the tray has a notch 61 formed therein . the notch 61 allows the tray to extend around the sides of the seated child when the tray is pushed up against the child . the tray 15 has a flat surface 43 that forms an eating area . plates 63 and other containers of food are placed on the eating area 43 . an upwardly extending lip 51 surrounds the eating area 43 in order to contain liquids in the tray . the high chair has a seat back 41 . a restraining belt is also typically provided , to restrain the child in a seated position in the chair . the shield 11 has a wall 17 which blocks food spillage from the front 19 and sides 21 of the high chair tray 15 when the shield 11 is located on the high chair tray 15 . the shield 11 also has securing means 23 which removably couples the wall 17 to the high chair tray 15 to keep the shield 11 from being dislodged while in use . the wall 17 has inner and outer sides 25 , 27 , a top edge 29 , a bottom edge 31 , and side edges 33 . in the preferred embodiment , the wall 17 is a sheet made up of a front panel 35 and two side panels 37 . the front panel 35 and the side panels 37 have fold edges 39 , where each side panel 37 is coupled to the front panel 35 and extends transversely from the front panel 35 to a side edge 33 . the side panels 37 can be folded along the folds 39 so that the shield may be easily stored . the vertical and horizontal dimensions of the wall 17 are such that an occupant seated on the high chair seat 55 will have difficulty disposing food over and around the wall 17 when the wall is located on the high chair tray 15 . the height of the wall 17 from the bottom edge 31 to the top edge 29 makes it difficult for a high chair occupant to spill food over the top of the front panel 35 and side panels 37 of the wall 17 . the wall has front and side dimensions wherein the wall wraps around the eating area located in front of and to the sides of the seated child . the wall 17 has a side dimension which extends from the front panel 35 to the side edges 33 , and a front dimension which extends across the front panel 35 from one side panel 37 to the other side panel 37 . some exemplary dimensions are provided to illustrate the relative size of the shield for a typical high chair . the wall 17 has a height ( from top edge 29 to bottom edge 31 ) of 18 inches . the side dimension of the wall 17 , from the respective fold 39 of the front panel 35 to each side edge 33 of the wall 17 is 12 inches . the front dimension of the wall from one fold 39 to the other fold 39 is 16 inches . the wall 17 has a thickness of about 1 / 16 of an inch . the dimensions of the shield 11 may be varied to fit the sizes and shapes of high chair trays 15 the shield 11 is employed upon . the front and side dimensions of the wall 17 make it difficult for the high chair occupant to spill food over the front 19 and sides 21 of the high chair tray 15 since the wall 17 surrounds the high chair tray 15 along the front 19 and sides 21 . the wall 17 , however , takes up only a minimal amount of the eating surface 43 of the tray 15 . the wall 17 is made of a transparent material so that the high chair occupant can see , and be seen , through the wall 17 . in addition , the wall should be lightweight , rigid and non - breakable . in the preferred embodiment , the wall is made of a clear acrylic plastic such as plexiglas . a flat sheet of plastic is cut to size and then bent to make the fold edges 39 . decals 45 may be affixed to the inner or outer sides 25 , 27 of the wall 17 to amuse and entertain the occupant of the high chair 13 . the shield 11 also includes two securing means 23 which removably couple the shield 11 to the high chair tray 15 to keep the shield 11 from being dislodged while in use . in the preferred embodiment , the securing means 23 are comprised of hook and loop type fasteners 23 that have a hook portion 47 and a loop portion 47a . referring to fig2 and 3 , one portion 47a of each fastener 23 is attached to the outer side 27 of a respective side panel 37 near the bottom edge 31 and near the side edge 33 of the wall 17 . the other portion 47 of each fastener 23 is attached to outer rear corners 50 of the high chair tray 15 . these portions 47 of the fasteners 23 attached to the high chair tray 15 are located on an inner wall 49 of the upwardly extending lip 51 of the high chair tray 15 . in order to install the shield 11 onto a high chair 13 and tray 15 , the shield 11 must first be oriented with the wall 17 disposed vertically , where the fastener portions 47 are located near the bottom edge 31 of the wall 17 . the shield 11 is then lowered onto the eating surface 43 of the high chair tray 15 . the shield 11 is located on the tray 15 so that the wall 17 of the shield 11 is adjacent to the inner wall 49 of the lip 51 , and the fastener portions 47a attached to the side panels 37 of the wall 17 align with the fastener portions 47 attached to the inner wall 49 of the lip 51 of the high chair 15 . the fastener portions 47 , 47a are then coupled together so as to secure the shield 11 to the tray 15 . when installed , the bottom edge 31 of the wall bears on the eating surface 43 . also , the bottom portions of the fold edges 39 are snugged into the front corners 65 of the tray lip 51 , in order to enhance stability of the wall . the shield 11 is simple to install onto a high chair tray . because the shield provides an effective barrier , it is preferred to seat the child in the chair before installing the shield . alternatively , the shield can be installed onto the tray and the tray - shield arrangement can be installed together on the high chair . once the shield is installed , food will be contained within the eating area . if the child splatters food , then the splatter will hit the shield and not the floor or surrounding furniture . because the side edges 33 of the shield extend near the shoulder of the child , it is difficult for the child to throw food around the shield . also , the child can see and be seen through the shield and hear and be heard from around the shield so that the child does not feel isolated from the family . because the shield has side panels 37 that are oriented somewhat perpendicularly to the front panel 35 , the shield is inherently stable and not prone to tipping . furthermore , the shield is securely coupled to the tray by the fasteners 23 and by the abutting position of the bottom edge 31 against the inner wall 49 of the lip 51 . thus , the child can hit the shield with a hand and not dislodge or tip the shield . likewise , any family member who may accidently hit the tray or shield will not dislodge or tip the shield . when the child is finished eating , the high chair and shield can be cleaned . because the shield is elevated by virtue of its location on the tray , a parent need not stoop to the floor during cleanup . all of the food that would normally fall to the floor is on the shield . the shield 11 can be removed from the tray by disengaging the securing means 23 and lifting the shield 11 off the tray 15 . the shield 11 may then be cleaned of any foodstuffs which have been disposed thereon . soap and warm water may be used for cleaning . the shield 11 may then either be reinstalled on the high chair tray 15 or stored away . to store the shield , the side panels 37 are folded in towards the front panel to form a flat object . the above description of the invention is the preferred embodiment of the invention , however , the invention has other embodiments . in particular , the wall 17 of the shield 11 is not limited to having three panels 35 , 37 . for example , the wall 17 may be a single sheet of flexible material that conforms to the eating surface 43 of the high chair tray 15 . the wall 17 may have two panels , or may have more than three panels as well . in addition , the dimensions and orientation of the wall 17 are variable . although the shield has been described as having side edges 33 that terminate at the rear of the tray , the side edges , or at least those portions of the side edges that are located above the lip 51 , can be extended rearwardly beyond the lip . the invention is not limited to hook and loop type securing means . the invention envisions various methods of attaching the shield 11 to the tray 15 , whether the tray 15 has an upwardly extending lip 51 or not . for example , snaps could be used to secure the shield to the tray . the foregoing disclosure and the showings made in the drawings are merely illustrative of the principles of this invention and are not to be interpreted in a limiting sense . | 8 |
the circuit of fig1 has a first transformer ü1 , whose secondary winding is connected to a load having an ohmic resistance rz . this transformer ü1 may be a rotary transformer arranged between a steering wheel equipped with an air bag and a stationary steering column . the load connected on the secondary side is then the resistance rz of an air bag squib , and the primary side of transformer ü1 is connected to a control circuit sg connected to the vehicle chassis . this controller sg generates a triggering signal for the air bag squib if the vehicle is involved in an accident . the squib ( including the conductor from the transformer to the squib ) is to be checked for reliability of operation on an ongoing basis . for this purpose , the squib resistance rz is periodically measured and it is checked whether it remains at a predefined value . a deviation from this predefined resistance value indicates that the function of the air bag is impaired . such a situation must be signaled in the vehicle . in order to record changes in resistance rz of the squib with high reliability , a measuring resistance rm is provided , which can preferably be connected in parallel to squib resistance rz using a switch s 1 . this measuring resistance rm has a predefined constant value , which is preferably approximately four to five times that of squib resistance rz . this ensures that , if the switch is defective and can no longer be opened , only one - fourth or one - fifth of the ignition energy is lost on the secondary side of transformer ü1 in the measuring resistance rm connected thereto when the air bag is triggered , so that the energy induced in the squib is still sufficient for triggering the air bag . when measuring resistance rm is connected , the total resistance connected to the secondary side of transformer ü1 , consisting of squib resistance rz and measuring resistance rm , changes by a well - defined value if squib resistance rz has its known value , which ensures reliable operation of the air bag . if the change in resistance deviates from a predefined value when measuring resistance rm is connected , a malfunction is to be signaled . thus , the squib resistance rz is checked by periodically connecting measuring resistance rm and recording the resulting change in resistance . thus distorting influences of the temperature and mechanical tolerances , which make the absolute determination of the load resistance impossible , are eliminated . a circuit ss installed on the secondary side , for example , in the steering wheel , actuates switch s 1 for connecting and disconnecting measuring resistance rm . circuit ss receives a switch actuation request signal from control circuit sg connected on the primary side via a second rotary transformer ü2 . the secondary side total resistance is measured when measuring resistance rm is connected , as indicated by the dashed - line signal arrow , in the secondaryside circuit ss ( e . g ., using a measuring resistance bridge ). the measurement result can then be transmitted back to control circuit sg via the second rotary transformer ü2 , whereupon control circuit sg signals a malfunction in the case of an inadmissible change in resistance . the ignition circuit and the diagnostic circuit are isolated from one another by the use of the two transformers . the change in resistance caused by connecting measuring resistance rm can also be noticed by a corresponding change in the current in the primary circuit of the transformer . a circuit ps inserted in the primary circuit of transformer ü1 takes into account the changes in the primary current when the measuring resistance rm is connected , and forwards them to control circuit sg . for example , control circuit sg determines , using threshold value analysis , whether the change in the primary current deviates from a predefined value . if this is the case , which is equivalent to an unallowable change in squib resistance rz , a signal indicating malfunction is generated . in the embodiment illustrated in fig2 measuring resistance rm is not connected together with squib resistance rz , but it is connected alternatively to squib resistance rz via a switch s 2 . switch s 2 is controlled as described above via circuits ss and sg . preferably a value that is equal to resistance rz of the squib when the squib operates properly is chosen for measuring resistance rm . if the current is switched from squib resistance rz to measuring resistance rm , circuit ps will detect no change in the current in the transformer &# 39 ; s primary circuit . however , if the primary circuit current changes , this indicates a malfunction of the squib . control circuit sg then generates an error signal . instead of choosing a measuring resistance equal to squib resistance rz , a fixed difference or a fixed ratio may also exist between the two . then the current in the primary circuit of transformer ü1 will experience a well - defined change when it is switched from squib rz to measuring resistance rm . again , it can be determined , using threshold value analysis in controller sg , whether or not this change in the primary circuit deviates from an allowable value . other than in air bag applications , the above - described circuits can also be used for checking other load resistances connected to the secondary winding of a transformer , for example , a horn or the operating elements of a radio or telephone arranged on the steering wheel . | 6 |
fig1 a illustrates the major anatomical aspects of the human venous system . via this natural system , deoxygenated blood is returned to heart 100 via inferior vena cava 105 , and oxygenated blood via pulmonary veins 102 . below renal veins 110 , inferior vena cava 105 emerges from the convergence of the left and right common iliac veins 115 . femoral veins 120 emerge upstream ( distally ) from the common iliac veins 115 , and long saphenous veins 125 also arise in this region . as shown in fig1 b , each of the common iliac veins 151 arises from the confluence of the femoral veins 152 and the long saphenous veins 170 . interventional catheter 155 may be placed into this system through femoral vein 152 , for example through the lumen of guide catheter 160 which may contain electrically conductive wires 161 . through the lumen , catheter 155 may advance to , for example , the common iliac artery , and may deploy filter mechanism 180 . distal end of catheter 155 may be used to deploy and to retrieve filtration device 180 as will be described in the pages to follow . conductive wires 161 within interventional catheter 155 are in electrical communication with power unit 170 . fig2 a , 2 b and 2 c illustrate use of electrostatic charges imparted upon an electrically conductive filtration mesh in order to repel platelets and red blood cells , and to attract particles and other cells and materials bearing a net positive electrostatic charge . in fig2 a , battery 257 has a negative pole connected to wire 256 , which runs through the core of interventional catheter 210 , and through struts 206 , which create a conductive contact with perimeter ring 220 and mesh 207 . the positive pole of battery 257 has resister 258 and is attached to an internal or external surface 250 of the body of the patient via electrode 255 . endogenous insulating tissue 251 generally lies between the vein walls 222 and electrode 255 . as a result of this arrangement , a net negative charge may be imparted upon filter mesh 207 . this results in the trapping of electropositive particles , such as electropositively polymerized methacrylate 231 , but not in the entrapment of electronegative particles such as platelets and red blood cells . struts 206 , perimeter ring 220 and mesh 207 may be made of conductive materials including , for example ; stainless steel , titanium and chromium or nitinol . blood flow is shown in this embodiment in direction 213 , although the principles apply to either flow direction . in an alternative embodiment , the opposite polarity is used , in which the filtration bears a positive charge and serves to attract negatively - charged particles , for example , electronegative fat components or methacrylate that has been prepared with an anionic polymerization compound . methods are known in the art for imparting electrostatic charges on plastics , for example using techniques similar to those described by peng et al 2006 . positively charged methacrylate may be prepared by emulsion polymerization , in which cationic element such as monomer methacryloyloxyethyltrimethylammonium chloride ( metac ) is copolymerized with methacrylate . alternatively , negatively charged pmma may be produced using an anionic comonomer such as sodium 2 - acrylamido - 2 - methylpropanesulphonate ( naamps ). such ionic copolymerization agents are non - toxic , and may alternatively be used to impart ionic charges on many thermoplastics , rubbery polymers , or their copolymers , including pmma , polystyrene , polyacrylonitrile , and polybutadiene , and others . in fig2 b , a similar configuration is shown , in which the positive pole is placed on filtration mesh 274 , while the negative pole is placed upon the body of the guide catheter 265 , thereby trapping electronegative particles 275 . alternatively , negative electrode 265 may be placed in another intravascular location , such as upon interventional catheter 271 . fig2 c illustrates an embodiment in which filtration elements 287 , 288 , 289 and 290 are each imparted with either a negative or a positive charge . filtration element 287 and 289 are positive , while filtration elements 288 and 290 are negative . maintaining charge on each of these elements is accomplished by sending positive wire 282 and negative wire 283 , which pass through interventional catheter 286 , on the interior of guide catheter 285 , and originate from battery 280 , with positive wire 282 receiving current limited by resistor 281 . fig3 a illustrates an embodiment of the present invention in which the filtration mesh 310 is deployed via guide catheter 326 and interventional catheter 325 from upstream of the targeted filtration site . note direction of the blood flow 301 . red blood cells 302 are able to pass through mesh 319 , as seen with red blood cells 304 , while large materials such as methacrylate particles 303 are trapped within the mesh as methacrylate particles 327 . the same principle applies for fat cells , which , like methacrylate ; are larger than the red and white blood cells , and are trapped by a 20 micron or less vessel . lumen margin 300 ; most often the endothelium of the vein in which the device is deployed ; is shown with expansible lumen perimeter ring 305 fitting against lumen margin 300 . filtration mesh 310 is delivered by interventional catheter 325 , which passes out from guide catheter 326 , and is held in place by flexible ; expansible lumen perimeter ring 305 , which is held orthogonal to the flow of blood 301 by flexible cords 328 . perimeter ring 305 may be made of materials including ; as an example , polytetrafluoroethylene ( ptfe ). cords may be made of materials including for example ptfe , nylon ; and suture materials including vicryl . filtration mesh 310 may have perforations of approximately 10 to 30 microns in size , so as to allow passage of endogeneous blood cells and very small clumps , but not of fat cells , nor of methacrylate particles . mesh 310 may also be made of materials including nitinol . purse string 329 serves to collapse perimeter ring 305 , closing off mesh 310 to prevent escape of trapped particles as the device is received and removed from intravascular placement , typically at the end of a surgical procedure . fig3 b illustrates an embodiment of the present invention in which filtration mesh 370 is deployed via guide catheter 376 and interventional catheter 375 from downstream of the targeted filtration site ; by virtue of semi - rigid struts 377 ( instead of flexible cords as seen in fig2 a ). note direction of blood flow 351 . following deployment , filtration mesh 370 , fixed upon expansible lumen perimeter ring 355 , is held into an extended position by semi - rigid struts 377 . at the convergence of struts 377 , a latched or spring - actuated mechanism may be used to assist with the deployment and retrieval processes . the closure process may be facilitated via purse string 379 : fig3 c illustrates an embodiment of the present invention in which semi - rigid struts 387 are used when mesh 351 is deployed downstream of blood flow 371 , ( in a manner similar to that accomplished with flexible cords in fig3 a ). use of semi - rigid struts 387 can permit greater each of deployment and closure of perimeter ring 385 and mesh 351 , optionally without need for a purse string . fig4 a illustrates an embodiment of the present invention in which the collapsed filtration mesh 410 surrounds the tip of interventional catheter 425 , after being pushed forward from the interior of guide catheter 426 . this embodiment also includes semi - rigid struts 407 . fig4 b illustrates the closure and retrieval of filtration mesh 466 in one embodiment of the present invention . purse string 461 may be used to assist with the opening and collapse of struts 460 ; which differentially move at their vertex , which extends from interventional catheter 462 . once collapsed , the apparatus may be withdrawn through guide catheter 476 . alternatively , if the mesh 466 , ring 465 and struts 460 are too large ; or too full of filtered debris 457 , they may be retracted through the incision following the removal of guide catheter 476 . fig4 c illustrates mesh 481 and perimeter ring 480 along an end view ; with trapped methacrylate or fat debris 482 . fig4 illustrates the same embodiment after purse string 487 has been pulled , closing perimeter ring 486 , and trapping within mesh 485 debris 488 . the various embodiments described above are provided by way of illustration only and should not be construed to limit the invention . based on the above discussion and illustrations , those skilled in the art will readily recognize that various modifications and changes may be made to the present invention without strictly following the exemplary embodiments and applications illustrated and described herein . such modifications and changes do not depart from the true spirit and scope of the present invention ; which is set forth in the following claims . | 0 |
reference will now be made in detail to embodiments of the technology . each example is provided by way of explanation of the technology only , not as a limitation the technology . it will be apparent to those skilled in the art that various modifications variations can be made in the present technology without departing from the scope or spirit of the technology . for instance , features described as part of one embodiment can be used on another embodiment to a still further embodiment . thus , it is intended that the present technology cover such modifications and variations that come within the scope of the technology . as is shown in fig1 , an embodiment of the present technology comprises at least one cable assembly 100 . the at least one cable assembly can comprise an outer shell 110 and can a plurality of inner 120 or wires running coaxially therewithin . the outer shell 110 can of any shape known in the art . for example , outer shell 1 ] 0 can be cylindrical , triangular , rectangular , or any other similar shape . alternatively , the outer shell 110 can also be a hollow outer wire . each of the plurality inner cables 120 or can consist of two or more members . the members can be strands , cables , or wires that are braided , entwined , or wrapped . the outer shell 110 and / or the plurality inner cables ] 20 can be made of a flexible material with little stretch . for example , the outer shell 110 and / or inner cables 120 can be made of bungee cord , elastic cord , nylon cord , or any other similar flexible material . with flexible material having little stretch , it is well known that as the diameter of each inner cable 120 increases , the resistance required to tension each inner wire will increase . the length of the cable assembly 100 can vary depending on the required use , and this variance can also affect the resistance required to tension the inner cable 120 . as is shown in fig2 a and 2b , an exemplary embodiment of the present technology comprises an attachment assembly which can be used for the attachment of utility items to a larger platform . the attachment assembly can comprise a male portion 200 and a female portion 215 , both of which can be configured for mating engagement with each other . for example , the male portion 200 and the female portion 215 can be configured such that they can be locked , attached , inserted , buckled or fit together to form a single unit . the attachment assembly can be a side - release buckle , a side buckle , a snap buckle , an end release buckle , or any other similar attachment assembly as is known in the art . both the male portion 200 and female portion 215 can be made a number of materials including , but not limited to , metals and plastics depending on the required use . for example , the attachment assembly illustrated in fig2 a and 2b has a male portion having an inner guide post 240 between two outer guide posts 230 and a female portion 215 having apertures for matingly engaging the inner guide post 240 and outer guide posts 230 of the male portion 200 . when the female portion 215 and male portion 200 of the attachment assembly shown in fig2 a and 2b engage , the guide post 240 and outer guide posts 230 snap , secure , or fasten in place with the apertures of the female portion 215 . the male portion 200 can comprises an inner guide post 240 between at least two outer guide posts 230 . the outer shell 210 of the cable assembly ( see fig1 , 100 ) can coupled to the proximal end 250 of male portion 200 of a corresponding attachment assembly , while at least one of plurality of inner cables extends transversely through the inner guide post 240 of the corresponding attachment assembly towards the distal end 260 of the male portion 200 . alternatively , the outer shell 210 of the cable assembly can be anchored to the proximal end of the male portion 200 of a corresponding attachment assembly . each of the plurality of inner cables 220 can have at least two members , such as attachment portions , braided cords , two entwined cords , or any other types members . as illustrated in fig2 a , the two attachment portions of each of the plurality of inner cables 220 can be configured that one of the attachment portions couples to the outer guide post 230 located to the right side of the inner guide post 240 , and a second one of the attachment portions couples to the outer guide post 230 located to the left side of the inner guide post 240 . for example , one of the braided cords of one of the plurality of inner cables 220 can extend from the inner guide post 240 and attach to an inner wall of one of the outer guide posts 230 . in at least some embodiments , one of the plurality of inner cables 220 extends through the inner guide post 230 of at least one of the respective male portions 200 , and at least two of the braids of the one of the plurality of inner cables 220 exit the inner guide post 240 and are coupled to an outer guide post 230 located on opposite sides of the inner guide post 240 . when one of the plurality of inner cables 220 is tensioned , the outer guide posts 230 can move closer to or approach the inner guide post 240 based upon the above couplings of the inner cable 220 to the outer guide posts 230 . consequently , the male portion 200 can be disengaged or unlocked from the female portion 215 . in one exemplary embodiment , the outer guide posts 230 can be manually squeezed or moved closer to the inner guide post 240 , allowing a release of the male portion 200 from the female portion 215 . in another exemplary embodiment , the outer guide posts 230 can be moved closer to or approach the inner guide 240 by a trigger as win be described later on the disclosure . fig3 a and 3b show an example embodiment of the current technology comprising a remote release assembly . the remote release assembly can comprise a remote release assembly enclosure at least one assembly 310 , a trigger assembly 360 , and a plurality of attachment assemblies 440 , 450 . the remote release assembly enclosure can be , but is not limited to , a housing , a box , an enclosure , or a receptacle having any number sides defining an area . the remote release assembly enclosure 300 can be made of any material known in the including , but not limited metals or plastics . the remote release assembly enclosure 300 can be covered or wrapped in a material compatible with modular lightweight load - carrying equipment ( molle ) standard . the remote release assembly enclosure 300 can be attached to a person in any way in the art , including , but not limited to : velcro , dips , adhesive , straps , buttons , molle , and ties . the remote release assembly enclosure 300 can have a connection side 370 and a trigger side 330 . though the trigger side 330 and connection side 370 are shown on opposite ends of the remote release assembly enclosure 300 , it should be appreciated that the trigger side 330 and connection side 370 can be located on any side of the remote release assembly enclosure 300 , including on the same side . at least one cable assembly 311 can be coupled to the remote release assembly . as depicted in fig3 a and 3b , the at least one cable assembly 311 can traverse through the remote release enclosure 300 from the connection side 370 to the trigger side 330 . the at least one cable assembly 311 can be anchored to the connection side 370 of the remote release enclosure 300 using any method known in the art . it should be appreciated that two cable assemblies 311 are shown , but there can be any number of cable assemblies 311 attached to the remote release assembly enclosure 300 . the at least one cable assembly 311 can be a cable assembly as described in the previous examples . the remote release assembly is described with respect to a cable assembly as described above comprising an outer shell 3 and a plurality of inner cables 320 . referring to fig3 a and 3b , the outer shell 310 of the cable assembly 311 can be anchored to the connection side 370 of the remote release enclosure 3000 the of inner cables 320 can traverse through the remote release enclosure 300 from the connection side to the trigger side 3300 the plurality of inner cables 320 can enter the remote release enclosure 300 at the connection - side aperture show ) and can pass through the trigger - side aperture 340 to terminate at the trigger side 3300 the ends of each of the plurality of inner cables 320 that are proximal to the trigger side 330 the remote release enclosure 300 can terminate at the trigger assembly 360 . the trigger assembly 360 can include a trigger handle 350 . the trigger handle 350 can comprise a ring , wherein at least one of the plurality of inner cables 320 terminates at the curved surface of the ring . fig3 a and 3d illustrate a d - ring exemplary purposes , but persons of ordinary skill in the art will appreciate that the trigger handle can be coupled to the plurality of inner cables 320 by other attachments , such as ties , circular rings , clips , or any other types of attachments known in the art . the flat side of the trigger handle 350 can anchor trigger assembly 360 to the remote release enclosure 300 , also referred to herein as a securing component . the trigger assembly 360 can be made of any material in the art , including , but not limited to a molle - compatible material , nylon webbing , cloth , metal , or plastic . the trigger assembly 360 should be of a size able to be gripped by the user , but can be of any useful length . the trigger assembly 360 can be removably coupled to the at least one cable assembly , such that the trigger 350 can be removed and replaced with a different trigger handle 350 as required or dependent upon user preference . it should be noted that a stopper ( not shown ) can be attached to both the trigger handle 350 and the connection side 370 to prevent the over - extension of any of the plurality of inner cables 320 . the stopper ( not shown ) can be made of cloth , metal , plastic or any other appropriate material and can be of a length appropriate to prevent the at least one inner wire 320 from extending past a pre - determined point . the stopper can be coupled to the trigger assembly 360 and to the connection side 370 or to the trigger side 330 of the remote release enclosure 300 . the plurality of attachment assemblies ( not pictured in fig3 a and 3d ) can each be coupled to an opposite end of a respective cable assembly 310 . the coupling of the attachment assemblies and the respective cable assembly 310 can operatively couple the attachment assembly to the trigger assembly 360 . the attachment assemblies can . be a side buckle , a side release buckle , and end release buckle , a snap buckle , or any other similar attachment assembly . example , an attachment assembly having a male portion and a female portion , such as the attachment assembly described above , is coupled to the trigger assembly 360 , the trigger assembly 360 can be actuated to release or release the male portion from female portion . for example , when the trigger 350 is activated , the movement of the trigger assembly 360 can transferred to each of the plurality of attachment assemblies such that at least a portion of the outer guide posts of the male portions approaches inner guide posts each of the plurality of attachment assemblies . the coupling of the attachment assembly its respective cable assembly 310 is described in more detail below . fig4 shows an example embodiment wherein multiple cable assemblies 410 can be activated from a single , remote trigger assembly 400 . while four cable assemblies 410 are shown , it should be appreciated that any number of cable assemblies 410 can be activated from a single , remote trigger assembly 400 . the cable assemblies 410 can be attached to connection side 470 of the remote release enclosure 400 . the trigger 460 can be located on the trigger side 430 of the remote release enclosure 400 . the male portion 440 of the attachment assembly can be secured , fixed , or attached to the female portion 450 of the attachment assembly . each of the plurality of inner cables 420 of each cable assembly 410 can run from outer guide posts 442 of the male portion of the corresponding attachment assembly 440 , through the inner guide post 441 , transversely through the outer shell 411 of the cable assembly 410 , through a connection - side aperture ( not shown ) in the remote trigger assembly 400 , through a trigger side aperture ( not shown ) in the remote trigger assembly 400 , and can finally terminate at or affix to the trigger handle shown ), which is further connected to the trigger assembly 460 . such a coupling permits movement of the trigger assembly 460 to transfer to each of the plurality of attachment assemblies 440 , 450 , whereby at least a portion of each of the outer guide posts 442 of each of the plurality of attachment assemblies approaches each of the inner guide posts 441 of each of the plurality of attachment assemblies . for example , pulling , tensioning , twisting or activating the trigger 460 of the remote trigger assembly 400 can retract the plurality of inner cables 420 the cable assemblies 410 , which can retract the outer guide posts 441 on the male portions 440 of the attachment assemblies . consequently , the male portion 440 of the attachment assembly can be disengaged or released from the female portion 450 . it should be appreciated that male portion 440 can be disengaged manually from respective female portion 450 of an attachment assembly by squeezing or pressing the outer guide posts 442 towards inner guide post 441 . the remote release assembly described herein can be configured with a backpack , belt , or other utility harness worn by a user . the remote release assembly can attached to a backpack , belt , or other utility harness by attaching the remote release enclosure 400 via a clip , ties , adhesive , threads , or any other attachment . the user can attach equipment , such as a water bottle , compass , or other types equipment to a respective female portion 450 an attachment assembly . the equipment can then be attached or secured to the backpack , belt , or other utility harness by engaging , snapping , or securing the female portion 450 to the corresponding male portion 440 of the attachment assembly . when the user desires to remove or release the equipment from the backpack or belt , the outer guide 440 can be manually squeezed or pressed towards the inner guide post of the attachment assembly corresponding to the individual piece of equipment . alternatively , if the user desires to remove or release all pieces of equipment from the backpack or belt , the trigger assembly 460 can be actuated which transfers movement of the trigger assembly 460 to the plurality of attachment assemblies , whereby at least a portion of each of the outer guide posts 442 of each the plurality of attachment assemblies approaches each of the inner guide posts 441 of each of the plurality attachment assemblies . for example , pulling , tensioning , twisting or activating the trigger 460 of the remote trigger assembly 400 can retract the plurality of inner cables 420 of the cable assemblies 410 , which can retract the outer guide posts 441 on the male portions 440 the attachment assemblies . consequently , the male portion 440 of the attachment assembly can be disengaged or released from the female portion 450 , which releases each piece of equipment from the backpack or belt to which the remote release enclosure 400 is attached . exemplary embodiments have been described hereinabove regarding the implementation of the remote release assembly on a carrying device , such as a backpack . however , one of ordinary skill in the art will appreciate that this disclosure relates to a system and method for quick release . various modifications to and departures from the disclosed embodiments will occur to those having skill in the art . the subject matter that is intended to be within the spirit of this disclosure is set forth in the following claims . | 5 |
referring now to the figures of the drawing in detail and first , particularly , to fig1 thereof , there is shown a construction 1 in which a first structure 4 and a second structure 5 , as they are represented for example in fig2 to fig6 , are to be sensed . positional information , i . e . a relative position between the first structure 4 and the second structure 5 , can be sensed by a position sensing device 2 . the positional information is stored in a position storing device or memory 3 and the position sensing device 2 can compare the stored positional information with the actually occurring positional information of the construction 1 in a comparison device 7 and the position sensing device 2 emits a corresponding signal s . in fig2 , there is provided a first layer 10 , in which a metallic contact 4 is provided as the first structure 4 . adjacent to this is a second layer 20 , in which a second metallic contact 5 is provided as the second structure 5 . the two contacts 4 , 5 butt against each other at the boundary layer . the contacts 4 , 5 may be two metallization levels of an electronic component or else contact areas of two components resting one on top of the other with their surfaces against each other . the position sensing device 2 is then capable of establishing by a resistance measurement the degree of overlap and consequently an item of positional information of the configuration . as revealed by fig3 , in that the configuration according to fig2 , is represented in a plan view , this may contain a displacement in two directions , which is a first displacement v 1 and a second displacement v 2 . in the case of a configuration of this type , it is admittedly difficult to ascertain the positional information by a resistance measurement . for this , it would be necessary to perform what are known as four - point measurements . the acquisition of positional information is made easier with the configuration according to fig4 . here , a multiplicity of first contacts 4 are provided , making contact with the second contact 5 of a larger surface area . by determining which of the first contacts 4 are touching the second contact 5 , the positional information can be obtained . similar in principle is the acquisition of the positional information with the configuration according to fig5 . here , the first contacts 4 are made to be of a size similar to that of the second contacts 5 . however , a different spacing is provided between the first contacts 4 and the second contacts 5 . consequently , when there is a misalignment of the first layer 10 with respect to the second layer 20 , it follows that the misalignment can be established by determining the contacts that are touching , in a way similar to a vernier . in fig6 , a second exemplary embodiment is represented . in this case , two transistors lying one behind the other of an eeprom cell 6 are represented by way of example . in a way corresponding to the previous exemplary embodiments , here the second structure 5 is provided , and functions as a gate 5 of a first transistor . for the generally known function of a transistor in an eeprom cell , what is known as a “ buried channel ” 4 is provided . for the functioning mode of the transistor it is envisaged that the buried channel 4 is disposed at the position indicated by dashed lines , so that a gate length l is formed . minimal inaccuracies in production can give rise to an offset δl from its predetermined position to the left or right . this consequently gives an effective gate length e where e = l + δl or e = l − δl . the effective gate length e can be measured and can be monitored for individual transistors . the operating mode of the individual configurations explained above is explained below . when the configuration is put into operation for the first time , the position sensing device 2 establishes the relative position between the first structure 4 and the second structure 5 . in this case , it is immaterial whether a resistance measurement , the sensing of individual contacts or the determination of an effective gate length is involved . the positional information consequently sensed is stored a single time in the position storing devices 3 . during the operation of the individual configuration it is checked whether the stored information coincides with the actual configuration . this can take place by the position sensing device 2 ascertaining the relative position between the first structure 4 and the second structure 5 each time the individual configuration is once again put into operation , and comparing it with the positional information stored in the position storing device 3 . if the two coincide , it may be provided for example that the signal s indicating that no manipulations have been performed on the configuration is emitted . alternatively , it may be provided that , if they do not coincide , a signal indicating the manipulation on the configuration is emitted . furthermore , it is also conceivable to dispense with the position storing device 3 . in such a case , the individual positional information would have to be stored by an external device when the individual configuration is put into operation for the first time and this information would have to be called up as soon as the configuration is operated once again . it can be easily appreciated that many further configurations that are not represented here but correspond to the idea of the present invention are conceivable . it has been found that the structures described yield accuracies for sensing the position in the μm to sub - μm range , depending on the extent of the structures involved . it is also possible to combine a number of structures , so that for example a coarse vernier and a fine vernier are provided . when a structure is removed , it is not possible to recreate the exact position . | 1 |
the present invention provides for the fusion of ct or mr images and ultrasound images . thus , biopsies , ablations or other procedures may be performed using an ultra sound device and benefiting from previously acquired ct or mr images . moreover , according to one embodiment a physician uses a tablet device such as an apple ® ipad ® to manually register ultrasound images to ct or mr images and may use such a device during a medical procedure . the manual registration process may be performed in a simple and intuitive manner . fig1 illustrates one example of a system . as shown in fig1 , a system 10 includes image software 12 which may be executed on a computing device 14 . the image software 12 may be used with images which are stored on media 14 . the media 14 may be any type of non - transitory machine readable storage medium such as solid state memory , magnetic memory , optical memory or otherwise . the image software 12 may also be used with images which are accessed from an image server . the image software may be an image processing application such as osirix or other application which may read imagery from medical equipment . one common format for such imagery is the dicom format . in one embodiment , the image software 12 is executed on a computing device and then selected images may be communicated to a tablet 20 or other computing device . it is contemplated that the image software 12 could also execute directly on the tablet 20 . as will be explained in further detail later herein , imagery used for fusion purposes ( such as ct or mr images ) may be loaded onto the tablet 20 . the tablet 20 may also be operatively connected to an ultrasound system . this may be a wired or wireless connection such as through a usb or network connection . in addition , the tablet may be mounted to the ultrasound system for convenience . the tablet is configured to display in real - time ultrasound imagery from the ultrasound system 22 . the ultrasound system 22 includes a probe 24 . in one example , ct scan images may be loaded onto the tablet device . in addition , ultrasound images may be acquired using the ultrasound system for image registration with the ct scan images . fig2 illustrates selection of a ct scan image as a part of a manual image registration process . as shown in fig2 , a series of ct scans are shown in a bottom row . a physician may select one of these images . as shown in fig3 , once one of the ct scan images is selected , a physician may select a corresponding ultrasound image . the physician may scroll through various images to select the corresponding ultrasound image . this process may be repeated multiple times . fig4 illustrates an example of another step in a manual image registration process . as shown in fig4 , a physician may trace the contour or boundaries of an organ , in this instance , a kidney . where a touchscreen display is used , a physician may simply trace the contour on the screen with their finger , although it is contemplated that digitizing tablets , mice , trackballs , joysticks , or other types of input devices may be used instead . alternatively , instead of having an operator draw the complete contour , the operator may select points instead associated with the organ and these points may be used to identify the organ and / or to draw the contour . fig5 illustrates an example of another step in the manual image registration process . as shown in fig5 , a physician may trace the contour of a region of interest ( such as a tumor or lesion ) in a manner similar to tracing the organ . similarly , the operator may select points associated with the region of interested ( such as a targeted tumor or lesion ). fig6 illustrates a real - time display of ultrasound imagery and corresponding ct scan imagery . as shown in fig6 real - time renal ultrasound imagery is shown which is registered to renal ct scan images . in real - time as the ultrasound imagery is updated the corresponding ct image may be updated accordingly so that the operator is always viewing the most relevant ct scan . a number of different algorithms may be used for this process . these include merely identifying which of the ultrasound images used for registration is closest to the currently displayed ultrasound image and then displaying the ct scan which corresponds to the ultrasound images used for registration . feature extraction of the organ or the region of interest may be performed to assist in this process . however , due to the manual registration process , the process is simplified relative to some type of process that attempts to perform automatic image registration . due to the manual image registration process the angle of the ultrasound probe should remain consistent in order to obtain the best alignment . fig7 illustrates an alert which may be provided during operation to indicate that the probe angle should be adjusted for best alignment . the alert may be provided various ways including visually and our audibly . fig8 illustrates that the user interface may provide for allowing a physician to re - register images at any time . if the software application has difficulty recognizing the ultrasound image ( due to suboptimal image quality for example ) which corresponds to the ct image or if the ultrasound operator becomes disoriented either to the position of the ultrasound probe on the patient &# 39 ; s body or the angle of the probe , the operator may scroll through the ct scan images quickly to locate the desired ct image slice to reorient himself . this will then bring up the contour image of the initial ultrasound image used for registration and the region of interest ( roi )/ targeted lesion . the operator may then adjust angle and position of the ultrasound to probe to match the landmarks marked at the beginning of the session . so during the actual procedure the ultrasound will be live and the ct images can be scrolled to change the contour / target . fig9 illustrates another example of a real - time display in which the contour of the kidney is shown . it is contemplated that it in some instances it may be helpful to overlay the contour of the organ or region of interest over the ultrasound imagery . fig1 illustrates a flow diagram of one example of a methodology for ultrasound and mr or ct fusion . a process 50 is shown . in step 52 , ct or mr images are obtained . in step 54 , ultra sound images are obtained . in step 56 the images are loaded onto a tablet device . in step 58 a manual image registration process is used . then in step 60 a ct scan image or mr image corresponding with real - time ultrasound imagery is displayed . in addition to using images associated with ct or mr , it is also contemplated that three - dimensional ( 3d ) models may also be used . 3d models may be created from dicom images or other types of images or image data . where 3d models are used , a 3d model may be displayed to the user and the user may select a cross - section of the 3d model to be used for registration processes . during operation , if an alignment issue is determined either manually by the user or automatically by the software the user may be given an opportunity to either adjust their probe or else choose a different cross - section of the 3d model to align with the ultrasound imagery . fig1 illustrates another example of a method which may be used . in the method of fig1 , 3d models are used . in step 72 , a 3d model or 3d rendering is obtained . the 3d model may be based on ct images or mr images or other acquired imagery . a 3d modeling or rendering program such as is known in the art may be used to generate the 3d model or rendering . in step 74 a physician may outline the organ and the region of interest on the 3d rendering . for example , the organ may be a kidney and the region of interest may be a lesion to be biopsied or treated . note that the physician may be given control of the 3d rendering to rotate , resize , or provide other functionality . in step 76 , the 3d rendering is de - segmented or otherwise processed to provide a set of slices but maintaining the outline or tracing made by the physician . although the size of the set of slices may vary , 30 or 40 slices provides a reasonable number . this outline or tracing may form an overlay which overlays the various images . next in step 78 the ultrasound images are acquired . in step 80 , the ct / mri slices may be synchronized with the ultrasound . note that the angle of insonation may be matched as a part of the synchronization process . in step 82 , the physician may outline the organ and region of interest on the ultrasound images . in step 84 , the physician may adjust image sizes ( s ) and manually register the ultrasound images to the ct or mr images . once the images are registered , it is contemplated that where a tablet device is used , it may be placed in a sterile bag such as is already commercially available . at this point , the live ultrasound may be performed to locate the mass for biopsy or treatment . once the optimal view for needle placement had been obtained , the operator may swipe the screen of the tablet device to select the appropriate overlay which best matches the live image . the operator may then hit a “ toggle ” button ( either a soft button or physical button ) on the tablet and bring up the corresponding ct or mr image . scrolling up frame by frame through the ct or mr images may be performed by adjusting the ultrasound probe slightly to move it cepahald or caudad ( toward the head or feet ) on the patient &# 39 ; s skin and pushing a “ button ” ( which may be a soft button or physical button ) to advance step by step ( level by level ) through the previously acquired ultrasound overlays and hitting a button to confirm the correct overlay . the corresponding ct or mr image may then be brought up on the tablet screen . a virtual needle may then be brought up on the ct or mr image which is adjustable by the operator to obtain the appropriate angle and depth . the needle trajectory visual guide or “ raster ” ( such as a dotted line ) may be selected to be displayed on the ultrasound overlay . the operator may then toggle between the ct or mr image and the ultrasound image with the raster or a split screen . optimally , the raster may be exported to the ultrasound machine as well and displayed on the ultrasound machine viewing screen , that way the operator would have a larger image of the ct or mr image on the tablet and the large ultrasound machine viewing screen to visualize all structures clearly . although various examples are described herein , it is to be understood that the present invention contemplates numerous options , variations , and alternatives . for example , detailed examples have been provided where the organ is a kidney and the region of interest contains a lesion . it is to be understood that this is merely one application . the kidney has a relatively simple shape structure with soft tissue tumors which can be biopsied or ablated ( such as through thermal ablation ). however , the system may be used for other organs . for example , in general surgery application , the present invention may be used in the biopsy and ablation of liver tumors , the biopsy and ablation of retroperitoneal tumors , the drainage of abdominal and retro peritoneal abscess , the drainage of biliary obstruction , the biopsy , needle localization , and cryoablation of breast cancer . other examples where the present invention may be used include in gynecology such as in the drainage of pelvic abscess and ovarian cysts . in addition , it is to be understood that various types of imagery may be used including ct imagery and mr imagery . it is to be further understood that 3d models may be generated from the ct imagery or the mr imagery and the 3d models may be used such that the ultrasound imagery is registered with the 3d model data . it is further to be understood that variations in the placement and relative placement of images being registered is contemplated . for example ultrasound images may be positioned above the mr / ct images or below the mr / ct images and the orientation of the images may be rotated based on the particular type of surgery being performed in order to provide the most convenient and intuitive view to the physician . | 0 |
the present disclosure is directed towards various embodiments of a message box , as well as features and aspects thereof , which can be used , among other uses , to present advertising to customers at drive - thru commercial establishments . the present detailed description is of the best currently contemplated modes of carrying out exemplary embodiments of the message box . it should be appreciated that the present description of the various embodiments , features and aspects of the message box is not to be taken in a limiting sense , but rather , is made merely for the purpose of illustrating the general principles of the various embodiments . in general , various embodiments provide a flashing message box adapted for use in presenting an advertisement to customers at drive - thru commercial establishments . the following elements are presented in the attached drawings and are defined more fully within the detailed description : 10 : is the overall environment and deployment of an embodiment of the message box . fig1 is a perspective view of a suitable environment for various embodiments of the message box . as illustrated , the message box 10 can be incorporated into a drive - thru menu screen or display 32 . embodiments of the message box comprise an led light source 12 or similar light source ; a graphic lens 16 that holds a message ; and a box enclosure 20 that contains the light source and lens . in exemplary embodiments ( fig2 , 3 ) the message box further comprises a light diffuser lens 14 that enhances the display of the graphic lens 16 , and a means to mount the box enclosure 20 in the selected site , for example , the menu board and ordering station 32 in a drive - thru restaurant 30 . the message box device 10 may also comprise a photocell or photo - sensor flasher circuit , which would control the led light source . for instance , the photocell may be interfaced to a controller or circuit such that depending on the readings from the photocell , the light source can be controlled . non - limiting examples of such control may include dimming the lights when the ambient light is low , brightening the lights when the ambient light is high ( i . e ., changing the light source inversely proportionate to the ambient light intensity around the box ), flashing the lights at different rates based on fluctuations in the ambient light , etc . the led light engine 12 ( fig7 ) can have a single led or rows of leds . led &# 39 ; s could be red or white / clear in color . alternatively , the light engine could be an lcd backlight source . the light engine is connected to a power source and , where necessary , a transformer . a programmable photocell flasher circuit controls the operation of the led light engine or similar light source . when used in outdoor locations , the led light engine 12 is weather resistant and is equipped with a damp location power supply . the photocell flasher circuit can be designed for incorporation into the pcb ( printed circuit board ) of the light engine . alternatively , it is incorporated into its own module wherein the photocell is placed on its own pcb and mounted separately at an opening 38 in the box enclosure 20 ( fig6 ) provided for that purpose . the photocell flasher circuit provides a programmable flash rate to the led light engine 12 as well as providing dimming capability of the light source . the flash rate can be selected . in an exemplary embodiment , the flash rate is a tested rate of 1 second on and 1 second off . the flash rate preferably alternates 3 times and pauses for 2 . 5 to 3 seconds . after the pause , then the flashing can resume or repeat for another cycle . if used in an outdoors installation , the photocell portion of the circuit provides that the light source is bright enough for excellent viewing of the message on the message panel 16 during daylight hours and dims for excellent viewing during night time hours . the ability to dim and brighten is also useful in inside installations where the ambient lighting conditions are variable . the photocell flasher circuit could have many variations to the design , as it is an electronic circuit . the most important functions are the programmable flash rate and the ability to dim and brighten the light engine for various ambient lighting conditions . the graphic lens 16 is a piece of anti - glare plastic , which holds and displays the message . the message is applied by a vinyl sticker application , a direct printing process , or alternatively , the graphic lens can sandwich the message between two graphic lenses . the graphic lens 16 has notches on the bottom of the panel that allow any flat object , such as a key or screwdriver to remove the lens for replacement . the preferred thickness of the graphic lens is from about 3 / 16 to 1 / 16 inches ; however the preferred size would be ⅛ inch . the graphic lens could be thinner or thicker depending on the various applications . full color graphics could also be applied to this design . various embodiments of the message box may also comprise a light diffuser lens 14 to provide maximum light diffusion to maximize the full graphic lens area . the diffuser lens is placed strategically in front of the light source for the optimum viewing of the message on the graphic lens 16 . depending on 20 the characteristics of the light engine , it would be possible to eliminate the diffuser and reduce costs . the components of the flashing message display are housed in a box enclosure 20 that has a number of specialized features . it has a small compact overall design that allows it to fit in existing drive - thru applications 28 and menu board systems 32 . graphic panel dimple stops 40 are illustrated on the two top edges and two bottom edges of the box 20 to hold the graphic panel 16 in place . these stops are rounded for easy movement of the graphic panel over them , and the box is designed to open up or stretch so that the graphic lens panel 16 can move over the dimple stops more easily . for instance , in one embodiment the box is designed to open in a jaw - like manner such that the lower or bottom edge gives more when pressure is applied during the insertion or removal of the lens panel 16 . to create this feature , the box may include a mechanical element that allows the jaw to open or , it may be manufactured to have some ability to be deformed , either by choice in material , structure design ( i . e ., thin material , slotted , etc ) or a combination of both . for instance , if slots are cut or included in the surface of the box , then flanges that can be forced out are created . in any of the variety of such embodiments , when pressure is applied to the box , such as when the lens 16 is being inserted , then the box slightly deforms to facilitate insertion of the lens 16 . when the pressure is then subsequently removed , the box returns to its normal position and thus securely holds the lens 16 in place . the dimple stop shape can be of a variety of shapes but , by making the dimples such that from the front to the rear and rear to the front the dimple is rounded as in a bell shape , the front panel can more easily be inserted and removed . as a non - limiting example , the dimple shape may be tubular and run along the top and bottom , or simply a protrusion , etc . but , in any of the various shapes , rounding the shape of the stops from front to rear and rear to front ( such as a bell shape ) advantageously allows the graphic panel to be removed and replaced easily . it should be appreciated that the dimples can be included on one or more surfaces of the box but , the illustrated embodiment shows the dimples on the inside of the lower and upper edges of the box . it should also be appreciated that in addition , or alternatively , to the dimples , other mechanisms may also be used to secure the lens 16 to the box . for instance , the faceplate 24 may include an opening that is smaller than the lens 16 and is used to hold the lens 16 to the box . other mechanisms such as clamps , springs , screws , etc . may also be used . it should be appreciated that various configurations and assemblies of the message box can be used in different embodiments . however , in the illustrated embodiment , the main enclosure 20 is opened on the front and back sides . the lip or rim 44 extends around the inner surface of the enclosure 20 and is proximate to the front of the box opening . the dimples 40 are positioned in front of the rim 44 at a distance sufficient to hold the lens 14 either against the lip 44 , or the diffuser 14 if the diffuser is installed between the lip 44 and the lens 16 . the light source 12 is installed behind the lip 44 . it should be appreciated that the light source 12 may include the other electronics , such as the processor , circuits , interface to power source , interface to sensors / detectors , etc or , a separate module containing the same be inserted into the enclosure . the strategically placed key slots 42 in the bottom sides of the box allow for an alternate way to remove the graphic panel . multiple and strategically placed fasteners 36 allow the enclosure to open up or stretch for easy graphic panel exchange . a photocell hole 38 allows the photocell to receive ambient outside light levels for proper light intensity setting of the light engine . internal lens stops 44 allow correct spacing for the diffuser lens 14 and graphic lens 16 placements . a face plate 24 on the front of the box enclosure allows for flush mounting installation on an existing order station or other enclosure . the box enclosure 20 could be made of aluminum formed construction , injection molding of aluminum or plastic , or any other appropriate forming process , as well as a vacuum forming process . however , the unique features of the box listed above would still need to apply for proper installation . the current mounting bracket design 18 , 22 , 24 and mounting screw locations 26 in the box give the most practical mounting application ; however , additional holes could be placed in the box for other mounting methods . a flush mount adapter kit provides various ways to install the box 20 in existing drive - thru menu boards 32 and order stations as well as other enclosures . brackets 18 , 22 , 24 align with the design of the box for multiple installation applications . depending on a specific installation application , other universal mounting kits could be made to connect with the existing box mounting methods . various embodiments of the message box could be made by a manufacturer with various skill sets known to those in the manufacturing arts : mechanical methods for the box design , and lens designers and electronics technicians for the photocell flasher and light source design . graphic design skills are also necessary for applying the message on the graphics panel . other embodiments , in which the power to supply the functions of the flashing message box is supplied by a solar panel and rechargeable battery source are contemplated . this arrangement would eliminate the need for a transformer directly connected to the light engine . in yet other embodiments , having a metal or plastic disk that would spin at a rate to reproduce the flashing effect could replicate the flashing message box , as could a computer programmed to provide a flashing voltage output . both of these possibilities would still need a flashing light source of some type with a photocell and would cause different installation requirements . the flashing message box could be used in many other applications , for example , banks , gas stations , food store end caps and isles , anywhere people gather and a store owner wants to get a message out to sell products . businesses want to sell more products to customers while they are in the drive - thru lanes 34 at fast food restaurants 30 , banks and gas stations , for example . there are plenty of distractions at these locations and the customers have a limited attention span . various embodiments of the flashing message box may deliver aprecise single message which is more apt to generate a positive reaction or , be more effective . the flashing message box provides an easy single message approach combined with a tested timed flash rate which gets the viewer to respond to the product advertised or offer presented . it is anticipated therefore that when the business owner has the device installed in their drive - thru location 28 with a message graphic displayed on it , those who read it will respond to it at a higher rate than to other advertising products . it should be understood , of course , that the foregoing relates to exemplary embodiments and that modifications may be made without departing from the spirit and scope of the invention as set forth in the following claims . in the description and claims of the present application , each of the verbs , “ comprise ”, “ include ” and “ have ”, and conjugates thereof , are used to indicate that the object or objects of the verb are not necessarily a complete listing of members , components , elements , or parts of the subject or subjects of the verb . in this application the words “ unit ” and “ module ” are used interchangeably . anything designated as a unit or module may be a stand - alone unit or a specialized module . a unit or a module may be modular or have modular aspects allowing it to be easily removed and replaced with another similar unit or module . each unit or module may be any one of , or any combination of , software , hardware , and / or firmware . the present invention has been described using detailed descriptions of embodiments thereof that are provided by way of example and are not intended to limit the scope of the invention . the described embodiments comprise different features , not all of which are required in all embodiments of the invention . some embodiments of the present invention utilize only some of the features or possible combinations of the features . variations of embodiments of the present invention that are described and embodiments of the present invention comprising different combinations of features noted in the described embodiments will occur to persons of the art . it will be appreciated by persons skilled in the art that the present invention is not limited by what has been particularly shown and described herein above . rather the scope of the invention is defined by the claims that follow . | 6 |
the following detailed description and appended drawings describe and illustrate various exemplary embodiments of the invention . the description and drawings serve to enable one skilled in the art to make and use the invention , and are not intended to limit the scope of the invention in any manner . in respect of the methods disclosed , the steps presented are exemplary in nature , and thus , the order of the steps is not necessary or critical . certain design principles to achieve the desired results are discussed in the succeeding paragraphs . fig1 of the accompanying drawings illustrates the behavior of the air and water slugs in a flexible pipe arrangement . for ease of understanding , we have considered the waves to be regular curves , such as in the case of a “ u tube manometer ”, connected in series 101 . let us also assume that , initially , water 102 is filled uniformly in all trough segments 101 a of the pipe 101 , with air 103 being trapped in crest segments 101 b . it can be seen that , since all the segments 101 a , 101 b are connected in series , any force applied at any point on the pipe 101 will be transmitted throughout the length of the pipe . thus , if some pneumatic pressure 104 is applied at one end of the pipe 101 , it will “ push ” all the water segments / slugs up preceding crests 105 ( against gravity ). in other words , a pressure head will be created , which will be equal to the sum total of all the height displacements of the water segments . fig2 a depicts an artist &# 39 ; s impression of the ffwec which describes an arrangement 201 depicting waves moving towards ashore 202 , reflected waves near shore (“ turbulence area ”) 203 , and a plurality of “ flexible pipes ” 204 connected at one end to a plurality of “ inlets ” 205 , respectively , further connected at opposite ends to a “ manifold ” 206 and the manifold 206 , by means of a pipe 207 or plurality thereof , in fluid communication with the “ pressure chamber ” or “ pneumatic accumulator ” 208 or plurality thereof . the pressure chamber 208 is further connected by means of “ air and water piping ” 209 to generators 210 or turbines . moorings 211 are provided at the “ inlets ” 205 ; supports 212 may be provided for the pipe 207 . at least one drain pipe 213 is connected to the chamber 208 ; and a grid power supply 214 is connected to the generators 210 . even though some of the systems above have been shown to be on shore , but could even be located offshore . likewise , pneumatic pressure could also be developed by pneumatic compressors instead of the pressure chamber . it would also be possible to develop power directly from the fluid flow from the “ outlet ”. the various pipes for fluid communication could also be in plurality . the aforesaid means and methods are preferred options and not the only possibilities . fig2 b is an enlarged view of the preferred embodiment of the invention essentially comprising the “ flexible pipe ” 204 connected at one end to the “ inlet ” 205 . an “ outlet ” or coupling 215 is attached to an opposite end of the pipe 204 and is further connected to components shown in fig2 . a “ suspension rod ” 218 extends downwardly from the “ inlet ” 205 and optionally includes a “ ballast / damper ” 219 and a mooring ring 220 . a mooring line 221 is attached to the ring 220 . fig3 of the present invention depicts a “ flexible pipe ” 301 floating on waves , with water 302 and air 303 “ slugs ” in sustained flow . a water reservoir 309 connected to the outlet of the pipe 301 is located at an elevation towards the outlet side of the flow representing the extent of a pressure - head 304 on the flow , with the direction of wave motion being from left to right ( arrow 305 ). with no back pressure ( no water in the tank 309 ) the water “ slugs ” 302 remain in the troughs of the pipe 301 , and with water in the tank 309 , the slugs 302 are pushed up the preceding wave crests 306 to generate an increased pressure - head 308 on the flow . the basic embodiment in fig4 shows an “ inlet ” apparatus 420 comprising a single “ inflexible pipe ” 400 , at least one buoyancy tank 401 , which tank normally floats on the surface of a body of water represented by a wave 409 . through a mouth 402 of the pipe 400 both air and water can enter and an outlet 403 of the pipe is connected in fluid communication with a front end of a “ flexible pipe ” 404 . further , the apparatus 420 additionally and generally consists of a “ suspension rod ” 405 , either fixedly attached to the apparatus or hinged to it . in the former arrangement , the suspension rod 405 could have a “ ballast ” and / or “ damper 406 and a mooring ring 407 with an attached mooring line 408 , all suspended below the apparatus , for providing and enhancing stability to the assembly , particularly in a vertical axis 418 , that is to minimize the pitching motion of the assembly , while providing freedom to heave viz . along the vertical axis . these components if positioned below the buoyancy tank 401 minimizes the torque that would otherwise be created by the moment arm formed , due to the distance between a center of floatation “ f ” 415 and a center of gravity ( cg ) 416 . hence , both are kept aligned along the vertical axis 418 or nearest thereto . whereas , in the former case the “ inflexible pipe ”, i . e . the fore and aft axis of the inlet 400 , has a freedom to pitch around the lateral axis and as well to heave . the “ ballast ” 406 also acts as a “ damper ”, creating drag while moving up and down the waves . thus , if it is located away from the center of floatation “ f ” 415 , somewhere along the fore and aft axis of the inlet , it would cause torque , thereby making the mouth 402 of the “ inflexible pipe ” 400 pitch up and down while riding the waves ; which aspect is discussed subsequently herein below . it may be noted that , at the time of the “ zero start ” it would be necessary to push water into the mouth 402 of the “ inflexible pipe ” 400 , at the required velocity and volume . therefore , it would be necessary to have a relative motion between the horizontal component of the waves and the “ inflexible pipe ” 400 . this does not happen if the “ inlet ” 420 pitches along with the waves . the “ ballast ” 406 enhances stability of the “ inlet ” 420 in the vertical axis 415 , thereby minimizing the pitching motion , as required in some embodiments of the present invention . the “ flexible pipe ” 404 , which trails the apparatus 420 , provides the directional stability . as such , it remains nearly in an upright position and rightly aligned as it floats up and down the waves . the inlet 420 generally faces the oncoming waves 409 ( direction arrow 410 ) and is made to float at an appropriate distance from the ( swl ) by adjusting the buoyancy of the buoyancy tank 401 . under operating conditions , it typically enters near a trough 411 and exists at a crest 412 of the waves 409 as they pass ( for explaining the sequence , the wave 409 in the drawing is shown as stationary while the “ inlet ” 420 is shown in three positions , moving from right to the left ). when a wave 409 strikes the mouth 402 of the “ inflexible pipe ” 400 , the water which enters it is separated from the main water body , while continuing to move through it at the same wave velocity . the “ water phase ” 414 commences from the trough of an oncoming “ air phase ” 413 . thus , the alternating intake of water and air “ slugs ” is appropriately synchronized with the waves 409 . the entry ( crest 412 ) and exit ( trough 411 ) points vary depending upon factors , such as the back - pressure at the “ outlet ” 215 , wave conditions , the length of the “ flexible pipe ” 204 , etc . and is suitably controlled . the system could work without any controlling devices , under fair wave climatic conditions , with average efficiency and reliability . however , since the waves are not regular , provision for optimally controlling and regulating the air and water ingestion timing and volume have also been provided . the intake volume and timing of air and water “ slugs ” are controlled by altering the buoyancy and / or “ up - down ” tilting of the “ inlet ” along its lateral axis . buoyancy is increased or reduced by filling the buoyancy tanks with air or water , respectively . alternatively , the inlet 420 could also be pushed in and out of water by certain actuation means or with baffle arrangement . this enables ingestion of the “ slugs ” according to the wave condition . inlets having means for controlling and regulating the buoyancy , whereby the air and water ingestion timing and volume could be controlled to a certain degree , besides making it possible to ingest only water to sink the apparatus / system in bad weather or ceasing operations by ingesting only air and totally float it , are described in detail below . fig5 illustrates the above embodiment comprising an “ inlet ” apparatus 501 with at least one “ buoyancy tank ” 502 having a “ pneumatic duct ” 506 , a top end 506 a of which opens in a top portion of the “ buoyancy tank ” 502 . the duct 506 is connected through a hose 505 to the “ pressure chamber ” 208 ( fig2 ) with some control systems / devices 808 preferably located thereat , for varying the pneumatic pressure in the “ buoyancy tank ” 502 . by varying the pneumatic pressure in the “ buoyancy tank ” 502 , water is pushed in / out through a “ water breathing tube ” 507 , a top end of which is fixedly attached to the bottom of the “ buoyancy tank ” 502 and a lower end opening into the sea below , consequently varying the “ inlet ” 501 buoyancy , thereby controlling the air and water intake timing and volume . the rest of the arrangements of this embodiment remain similar to those described in fig4 above , including an “ inflexible pipe ” 503 , connected to a “ flexible pipe ” 504 , a “ ballast ” 508 optionally attached to the tube 507 , a mooring ring 509 attached at the bottom of the tube 507 , and a mooring line 510 attached to the ring 509 . in another embodiment , an “ inlet ” apparatus 601 , which is illustrated by fig6 , includes at least one “ inflatable buoyancy tank ” 602 which is directly connected with a pneumatic hose 605 as above , but without the “ pneumatic duct ” and “ water breathing tube ” ( the rest of the arrangements being similar to the previous embodiment described in the above paragraph ). the hose 605 terminates at a duct 606 inside the tank 602 . an “ inflexible pipe ” 603 is connected to a “ flexible pipe ” 604 , a bracket 607 attaches a suspension rod 608 to the pipe 603 , a “ ballast ” 609 is provisionally attached to the rod 608 , a mooring ring 610 is attached at a bottom end of the rod 608 , and a mooring line 611 is attached to the ring 610 . as can be appreciated , the buoyancy of the “ inlet ” apparatus 601 can be varied by inflating / deflating the “ inflatable buoyancy tank ” 602 . the inflatable variable buoyancy tank 602 could be , as shown in fig6 , a spherical shape or any other suitable shape and its principle operation also being similar in each case . in yet another embodiment illustrated by fig7 , an “ inlet ” apparatus 701 comprises at least two “ inflatable buoyancy tanks ” 702 , connected individually , in groups or jointly through respective hoses 705 and 706 with the “ pressure chamber ” 208 , or pneumatic compressors , which may be shore based and having the pneumatic pressure and controls and switching devices generally installed thereat . the “ inflatable buoyancy tanks ” 702 are suitably arranged on the “ inlet ” apparatus 701 , whereby the pitching , i . e . the angle of rotation around the lateral axis of the “ inlet ” apparatus and its buoyancy , can be controlled by varying the buoyancy of the “ inflatable buoyancy tanks ” 702 individually . also shown are an “ inflexible pipe ” 703 connected to a “ flexible pipe ” 704 , brackets 707 for attaching a “ suspension rod ” 708 and the pipe 704 to the pipe 703 , a “ ballast ” 709 attached to the rod 708 , a mooring ring 710 attached to an end of the rod 708 , and a “ center of flotation ” ( f ) 711 . the tanks 702 encircle the pipe 703 and also can be positioned on the rod 708 . if the “ damper ” 709 is located at a certain distance aft of the “ center of floatation ” ( f ) 711 ( instead of vertically below it as described at fig5 for instance , and the suspension rod 708 may be hinged to the apparatus so as to enable pitching , the drag caused by the “ ballast / damper ” 709 would create some torque , which would make the “ inlet ” 701 tilt / pitch “ up ”, with ( f ) as the fulcrum , while it rides up the waves , and vice versa . in this case , the water which would be in the “ inflexible pipe ” 703 during the “ water phase ” 414 ( fig4 ) would also be lifted up by the additional pitching motion of the “ inlet ” 701 , causing it to fill the empty “ flexible pipe ” 704 at “ zero start ”. the angle of rotation of the “ inflexible pipe ” 703 can be varied by changing the buoyancy of the respective buoyancy tanks 702 . in another embodiment , at least two “ rigid buoyancy tanks ”, similar in construction to the “ buoyancy tank ” 502 explained at fig5 above are used , instead of the inflatable buoyancy tank 602 of fig6 . the arrangement of the components and their functions is similar to that explained in fig7 above , including the “ inflexible pipe , the “ flexible pipe ”, the “ suspension rod , the “ ballast ” and the mooring ring . fig8 ( a ) through fig8 ( e ) are the schematic representations of hydro / pneumatically actuated inlet systems 800 having certain alternative components and controls . the systems enable more precise , quicker and positive control of the air / water phases 411 - 412 , as compared with the previous systems , whereat the “ inlet ” apparatus 420 typically entered near a trough 411 and existed at a crest 412 of the waves as they passed . the means and method of controlling those operations have already been described at fig5 to 7 . whereas , in embodiment depicted at fig8 ( a ) , an inlet 803 is sequentially lifted above 804 a and pushed below 804 b the water surface , with more precise timing . the higher pressure below water surface also helps in pushing water slugs into the inlet 803 and when it is lifted to a height , a “ head ” is also created , both factors help in forming distinct water slugs and also imparting velocity to them , particularly at the time of “ zero start ”. the device could additionally have a tilting mechanism . this system 800 includes a suspension means 801 , depicted as an inverted “ u ” frame , at least one buoyancy tank 502 attached to pylons 801 a on either side of the suspension means 801 . the buoyancy tanks 502 having control features similar to those described at fig5 through fig7 and the relevant paragraphs above ( not shown ). the inlet pipe 803 , which may have shapes and dimensions different from the other inlet pipes 401 , 501 , 601 , etc . disclosed herein , is attached to one end of a reciprocating mechanisms ; for instance levers , guides , scissor jack or lift , that is operated by linear actuator , for instance bellow or cylinder , typically cylinder 804 as shown in fig8 , further attached to the “ flexible pipe ” 204 , and its other end 804 to the horizontal beam 801 b of the suspension means . the inlet pipe 803 reciprocates along the vertical axis , by means of at least one linear actuator 804 , between fully retracted ( in air ) 804 a and fully extended ( in water ) 804 b positions . the linear actuator 804 could be pneumatic or hydraulic system , driven by air , oil or even sea water . pneumatic pressure is provided through hoses 505 in fluid communication with the linear actuator 804 and a compressed air source ( not shown ), such as the pressure chamber 208 . alternatively , the fluid could even be hydraulic oil or sea water driven by external pump . the reciprocating and rotary motions of the inlet pipe 803 are triggered by suitable sensing and control system 808 with inputs from the phase of the wave at the inlet pipe 803 , the back pressure at the “ outlet ” 215 , length of the “ flexible pipe ” 204 , wave conditions or wave climate , energy demand , etc . fig8 ( b ) depicts a rotary actuator 802 , mounted on inlet pipe 803 , attached to the lower end of the actuator 804 and , enables rotation of the inlet pipe 803 through certain degrees around the lateral axis ∠ ø . fig8 ( c ) depicts yet another version of the hydro / pneumatically actuated inlet 800 . the “ baffle type ” inlet 805 system has two inlet pipes ; instead of a single inlet 803 previously described in the present invention , one each for water 806 and air 809 ingestion , respectively . air 807 a and water 807 b are alternately ingested through the respective pipes . a baffle 810 alternately closes either the air port 810 a or water port 810 b , while the opposite one automatically opens , thereby feeding the respective slugs into the flexible pipe 204 . an actuation system 813 , similar in construction to the cylinder actuator device 804 , is employed to operate the baffle valve 810 , through suitable up / down 812 linkage mechanism . the rest of the components remain similar to those described at fig8 ( a ) and 8 ( b ) above . the main difference between the “ baffle type ” inlet 805 system and the rest described in the present invention is that , the water 806 and air 809 ingestion pipes always remains under water and above water , respectively ; as shown in the diagram with “ water ”. in this embodiment , instead of pushing the inlet 803 in and out of water , either air 807 a or water 807 b , slugs are ingested with the baffle opening and closing the respective ports . this arrangement requires comparatively lesser time and force to alternate the between the two phases , besides causing minimal disturbance to the water flow . however , it also entails more number of moving components . while certain type of actuators 802 , 804 have been mentioned , any other type of actuator could be used . the phase of a wave at the inlet pipe 803 could be sensed by any of the various suitable sensors available for measuring wave heights , time period , etc . ( not shown ). in most of the previous inlet devices disclosed above , the phase velocity of a wave was being directly converted into flow of water slug . however , since the “ water ingestion phase ” 414 mostly commences near a trough 411 , where the velocity in the direction of flow is not only low , but could even be out of phase by 180 °. hence , there was a possibility of water slugs not getting enough “ push ” or kinetic energy to suddenly accelerate to the phase velocity at the right moment , particularly at the time of the “ zero start ”. to overcome this mismatch , it would be possible to first convert the kinetic energy at the crest of a wave into potential energy ; by topping up water in a reservoir or tank located at a height , storing it there , and then reconverting it into kinetic energy — by accelerating a slug to the desired velocity , volume and wave phase , particularly at the time of “ zero start ”. some embodiments to enable the above sequence of operation are disclosed below . fig8 ( d ) discloses yet another embodiment of the automatic inlet ( 814 ) consisting a tank fed inlet 816 , with a tank 815 suitably attached on top of the tank fed inlet 816 and 815 being in fluid communication with the tank fed inlet 816 , through a telescopic pipe or flexible hose 817 of adjustable length . the tank fed inlet 816 is further in fluid communication with the flexible pipe 204 , via baffle 810 that opens / closes either the air port 810 a or water port 810 b ports , wherein the tank fed inlet 816 functions as in the case of the “ baffle type ” inlet 805 above . a channeled ramp is 818 attached to the tank 815 , such that its trailing edge is jointed in front and top of tank 815 and its front edge is near the swl . fig8 ( e ) is a version of the inlet system disclosed at fig8 ( d ) , consisting an inlet 819 , with a tank 815 suitably attached on top and in fluid communication with the inlet 819 , through a telescopic pipe or flexible hose 817 of adjustable length . the inlet 819 is further in fluid communication with the flexible pipe 204 , via a first baffle 810 that opens / closes either the air port 810 a or water port 810 b . the inlet 819 further having a second baffle 811 located in front of the first baffle 810 , wherein the second baffle 811 opens / closes either the ocean port 811 a or tank port 811 b , actuated by means of an actuating system 813 . in the ocean port “ open ” 811 a / tank “ closed ” position , water from the ocean can flow through the tank fed inlet 816 , via first baffle 810 , further into the flexible pipe 204 , as in the case of fig8 ( d ) , while the tank port 811 b would remain “ closed ”, and vice versa . when the ocean port 811 a is “ open ”/ tank port 811 b “ closed ”, the inlet 819 functions as inlet 805 , fig8 ( c ) . whereas , when tank port 811 b “ open ”/ ocean port 811 a “ closed ”, the inlet 819 functions as in the case of tank fed inlet 816 , fig8 ( d ) . further , a channeled ramp 818 is rotatably hinged 819 to the tank 815 and can be moved “ up ” 818 a /“ down ” 818 b by means of a similar actuating mechanism 813 . it 818 is lowered till its front edge is near the swl 818 b to enable overtopping of the tank 815 by moving waves , generally at the time of “ zero start ” and lifted “ up ” for continuous operation . since the velocity of the water slug entering the tank fed inlet 816 will be a function of the “ head ” ‘ h ’ of the water level in the tank 815 above the tank fed inlet 816 , the desired slug velocity can be achieved by adjusting the “ head ” ‘ h ’, which can either be set manually , based on the average celerity in the area of deployment , or automatically by a servo mechanism ( not shown ), according to the inputs from sensing 808 devices . however , the latter option would increase the sophistication , with consequent cost escalation , o & amp ; m problems , etc . hence , the manual option is preferable , more so because the requirement of feeding water at some pressure and velocity would mostly at the time of “ zero start ” or kick - start . the rest of the arrangements are generally similar to those described at fig8 ( a ) through ( d ) above . the various structural components being generic in nature have not shown , to avoid clutter . a “ rod ” and “ ballast / damper ” arrangement 406 , 708 , 709 and 710 described at fig5 and fig7 is optionally attached to tank fed inlet 816 in line with the centre of gravity “ cg ” 416 . the ballast / damper 709 maintains the inlet system 805 d aligned in vertical position , along the vertical axis , and as well dampens the heaving motion as it rides the waves . the rationale for this has already been covered at the description of fig5 and 7 above . since the inlet system 805 d resists following wave motion , waves roll up the ramp and fill the tank 815 , where water is stored till let into the 816 by opening inlet port 810 b . it would also be possible to combine features of one embodiment with another . for instance , a larger diameter pipe or tank 815 could be attached at the front the tank fed inlet 816 of the inlet . when and lifted up and tilted backwards water would flow into the inlet 803 at the required velocity and timing . baffles 810 would be precluded . another feature of the invention is a “ flat - conical intake ” 900 ( hereinafter termed as the “ intake ” to distinguish it from the “ inlet ” 205 / 420 . it is a well - known fact that the larger pipe diameter the lesser the frictional loss , with the other factors remaining constant . due to this reason , where on one hand small diameter pipes are not suitable due to their higher frictional loss at the wave velocities expected in the ocean , on the other the large diameter pipes are ineffective when the wave heights are comparatively smaller . this is mainly because , in this case , ( a ) the mouth of the “ inlet ” may not completely enter a trough 411 and exit at a crest 412 , but remain partially in both , air and water most of the time . thus , integrated water slugs may not form , precluding development of the liquid seals which are essential for building up pressure , and ( b ) the large diameter “ inlet ” would take a longer time transiting through the air - water . during this period , both air and water would simultaneously enter the “ inlet ” 420 , creating a situation similar to the one described at the previous paragraph . the “ intake ” is meant to resolve these problems . fig9 depicts an “ intake ” 900 consisting of a hollow conical body 901 , a narrower mouth with rounded rectangular cross section 902 and a cylindrical outlet 903 to suit the flexible pipe 204 . the cross sectional area of the “ intake ” is maintained nearly constant all along its length and it smoothly blends from rounded rectangle to circular shape thereby providing better fluid dynamic characteristics . the intake could either be attached directly to the “ flexible pipe ” 204 , or mouth of the “ inlet ” 205 / 420 . the intake 900 assists in ingestion of water particularly in shallower wave climate . an additional feature of the invention includes an “ air - water separator ” 1000 . it may be possible to pump water up beyond a certain height in an arrangement which works on the principle of “ u tube manometer ”, such as the present invention , notwithstanding the amount of pressure that may be applied or is being generated by the “ flexible pipe ”. reference is made to fig1 . now , if the pneumatic pressure 104 is increased , the “ water slugs ” 101 a , that are already at the “ minimum water level ” 105 cannot be pushed up any further , but the “ liquid seals ” that were formed by the “ water slugs ” 101 a , will be breached and the air 103 that was trapped in the “ air slugs ” 105 will bubble out through the “ water slug ” 105 at “ minimum water level ”. some water from the “ water slugs ” 105 may also spill over into the adjacent trough segment . as a result of this , the pressure 106 will drop to some extent , and air will continue to escape as long as it is being pumped in . reference is also made to fig3 , “ slugs under pressure ”. in this case too , if a “ water slug ” 302 happens to go below its “ minimum level ”, the “ liquid seal ” would similarly be breached , consequently enabling the air pressure to escape . as the “ air slugs ” 303 get depleted , the buoyancy that was being provided by them would also decrease , resulting in sagging of the “ flexible pipe ” 204 between two adjacent “ air slugs ” 303 , causing them to merge . consequently , the “ flexible pipe ” 301 could sink . this phenomenon is more prominent in case the “ head ” 308 is more than the height of the “ water slug ” 306 , and the pipe diameter is also large ; for instance even 10 cm id whereas , it would be around a meter in diameter in the field conditions . as solution to this problem , the “ air - water separator ” 1000 is described below . fig1 depicts the “ air - water separator ” 1000 , viz . an apparatus attached at the discharge side of the “ flexible pipe ” 204 or “ manifold ” 206 or “ outlet ” 215 . water and air from the “ outlet ” 215 are pumped under pressure into the air - water separation tank 1002 and get segregated in it , with air and water flowing upwards and downwards , respectively , due to gravity . the fluids are further conveyed to the pressure chamber 208 and / or turbines / generators 210 , via the air 1003 and water 1004 pipes 209 , respectively . the air pressure is pumped by means of the air hose 1003 and injected into the pressure chamber 208 , through the “ air discharge nozzle ” 1005 , the mouth of which is located below the swl , at a given depth and termed as the “ differential pressure depth ” 1007 . the water level in the air - water separation tank 1002 is maintained at the “ differential pressure level ” 1010 , i . e . somewhere below the “ outlet ” 215 , irrespective of the pressure head h . this is because ; the air discharge nozzle ” 1005 is located at the “ differential pressure depth ” 1007 , viz . below the swl . the pressure required to displace water from the air discharge nozzle ” 1005 also acts on the top surface of the air - water separation tank 1002 , pushing the water in it down by an equal depth , i . e . to “ differential pressure level ” 1010 . the “ pressure chamber 208 ” and air - water separation tank 1002 hold slugs and column of water , respectively , in equilibrium , making it a closed system . the flow of water and air under pressure from the “ flexible pipe ” 204 , via the air - water separation tank 1002 , will build - up a pressure head “ h ” in the “ pressure chamber 208 , and get discharged through the water piping 209 to run the turbine 210 . the air bubbles injected into the “ pressure chamber ” 208 will increase the volume of the fluids in it and as well assist in enhancing the upward flow of the fluids , consequently increasing the pressure head “ h ”. thus , the pressure energy in the compressed air is also utilized . the principle of the “ air lift water . pump ” or “ geyser pump ” is applied in the case of case , with the exception that , the water to be lifted and the pneumatic pressure , both , are supplied from the same source , i . e . the “ flexible pipe ”. the air pressure / pneumatic is pumped back into the system , increasing the total efficiency or minimizing energy loss as well . fig1 a shows a selectively inflatable and deflatable tube 1300 attached to the “ flexible pipe ” 204 along a length of the flexible pipe , wherein the tube is coiled around the flexible pipe . the inflatable tube 1300 is inflated at the time of “ zero start ” and deflated when the system is running in a stable condition . by this method sagging during startup could be precluded . the pressure in the inflatable tube 1300 could also be varied between inflated deflated to depending on the operating conditions . a source of pneumatic pressure supplies pressured air to the tube , wherein when the tube is inflated by the pressured air , a buoyancy of the flexible pipe is increased to prevent the flexible pipe from sagging or sinking in the body of water . fig1 b shows pair of inflatable tubes 1300 externally and laterally attached on either side of the “ flexible pipe ” 204 along its length . on the left hand side of the drawing is a front view 1301 of the same . the inflatable tubes 1300 are inflated at the time of “ zero start ” and deflated when the system is running in a stable condition . by this method sagging during startup could be precluded . the pressure in the inflatable tubes 1300 could also be varied between inflated deflated to depending on the operating conditions . pneumatic pressure can be supplied from the pressure chamber ( 208 ) or an external source and controlled by a controlling means . fig1 c shows another embodiment which restrains the “ flexible pipe ” 204 from sinking beyond a preset depth / limit 1303 . in this case an inflatable / deflatable tube 1302 is disposed vertically above the “ flexible pipe ” 204 . the inflatable / deflatable tube 1302 is attached with the flexible pipe 204 by means of tethers 1308 , ropes or strands of the required length , for restraining the flexible pipe 204 from going below the depth / limit 1303 below the wave surface . for instance , if the length of the tethers 1303 is 1 m , the water segments will be restrained from going below this depth . pressure in the inflatable / deflatable tube 1302 can be varied to extend the depth / limit 1303 to some extent . pneumatic pressure is supplied to the inflatable / deflatable tube 1300 , 1302 from the “ pressure chamber ” 208 or any other external source . the pressure in the inflatable / deflatable tubes is controlled with control devices externality located . in the above case too , the selected depths 1303 can be varied in steps as described above . in another option for this embodiment , instead of the inflatable tube , inflatable / deflatable balloons are used . besides compressibility , the other significant factor that will affect the functioning of the ffwec is the rise in temperature due to compression , per charel &# 39 ; s law / gas law . however , it will mostly get absorbed by the water . conversely , at the time of expansion in the “ pressure chamber ” 208 generators 210 , the temperature will fall which could cause freezing , particularly when operating at low temperatures , such as in the higher latitudes . besides loss of energy / heat , more energy would have to be spent in heating the fluids to prevent freezing . therefore , to conserve energy the “ flexible pipe ” 204 is suitably insulated by wrapping it with thermal insulating material or providing built - in insulation . for mooring it is preferable to use mooring buoys , since the weight of the mooring line would be taken up by the buoys and not act on the “ inlet ” or system as such . the orientation of the flexible pipes is of significance for energy extraction . energy is progressively extracted by a “ flexible pipe ”. hence , if it is disposed directly along the wave direction , the maximum energy that it can absorb will be limited to the energy of the wave front acting on its cross section , i , e . area of the mouth of the pipe . whereas , if it is laid at certain angle to the wave direction , energy would be progressively absorbed as a wave travels along the length of the pipe . various other permutations and combinations of the same principle of operation and arrangements are also possible , but not mentioned herein in accordance with the provisions of the patent statutes , the present invention has been described in what is considered to represent its preferred embodiment . however , it should be noted that the invention can be practiced otherwise than as specifically illustrated and described without departing from its spirit or scope . | 5 |
a preferred embodiment of the invention is generally illustrated in fig1 - 3 , with fig1 illustrating use of the invention in connection with automobile data , and fig2 and 3 illustrating use in connection with a spa / pool application . persons of ordinary skill in the art will understand that the various components and methods can be of any suitable brand and nature , so long as they provide the desired functionality described herein . in general terms , the preferred embodiment of the invention includes a combination of hardware and software to allow real - time transmission of data being generated by a system ( even one such as the human body ), using a device such as a cellular telephone . the preferred embodiment permits remote viewing and communication / control with the site / application from which the data originates . persons of ordinary skill in the art will understand that the preferred cellular telephone component or device useful in the invention can be provided by programmable cellular telephones ( such as those discussed herein ), but could also be provided by other devices and technologies . wireless pagers as well as other technologies , can provide the preferred cellular networks that cover the vast majority of the planet , thereby making the invention easy to use , without the end - user having to create any communication infrastructure to get to and from the internet . preferably , the cellular telephone or similar device provides an internet communication interface , while connected ( via hardwiring or wirelessly ) to a “ live ” sensor / controller device in the monitored / controlled system . depending on the application , the sensor / controller device can be any of a wide range of devices , capable of reporting data , controlling the system , or both . also preferably , the invention includes a suite of hardware and software products provided for use on programmable cellular telephones or similar devices , such as the family of nextel / motorola java ™- powered phones ( e . g ., model i85s ). among other things , the invention preferably enables the cellular telephone to interface directly with a wide variety of devices , so that it can function as a service / diagnostic / monitoring device . in the preferred embodiment , the invention turns the phone into a powerful , highly configurable test tool . to enable the desired communication with a sensor / control device , the attached “ device ” preferably is in communication with the cell phone &# 39 ; s built - in serial port ( using appropriate serial communication parameters — baud rate , stop bits , parity , etc ). if a particular attached “ device ( s )” does not support a standard serial interface , an adapter apparatus ( such as a cable , connector , box , etc .) can readily be provided and used to suitably create a suitable “ serial ” connection between the cell phone and the “ device ”. ( note that the serial port on the cellular phone is traditionally used for a wired connection to a pc or laptop computer — both for purposes of uploading software applications to the phone , as well as acting as a cellular modem connection to the internet , for the attached computer ). by way of example , in a specific embodiment such as the automotive application discussed herein , an adapter cable and suitable rs232 obd protocol conversion circuitry is required to establish communication between the phone and the vehicle &# 39 ; s industry “ standard ” j1962 obd connector . among other existing resources available to persons of ordinary skill in the art , the sae ( society of automotive engineers ) provides ample information to understand and construct such an adapter ( similar principles and resources can readily be used in fabricating and providing other adapters / hardware / software for applications other than automobiles obd data ). on a related point , persons of ordinary skill in the art will understand that , as other communication channels ( other than the serial ports now available on current cell phones ) become available , the invention can be readily practiced using those other “ non - serial ” interface channels from the device to the phone . the cellular telephone preferably also functions as an internet gateway , delivering all or selected available data , in real - time , to a website / server such as the vtti erm ( embedded resource manager ) server . the data can be permanently and securely stored in an on - line database there , accessed from any web browser by a user having sufficient permissions ( passwords , etc .). the erm viewer , fig3 provides a real - time graphical interface through a suite of java ™ applets , allowing someone at a remote site ( such as a remote computer 10 , fig1 and 2 ) to “ see ” everything that the on - site service technician is seeing ( at , for example , location 20 , fig1 or location 30 , fig2 ), and , in some cases more ( see discussion elsewhere regarding the “ more ” that can be seen by a remote viewer , for virtually any application of the invention ). if desired , a cellular telephone can even be left “ permanently ” connected to the monitored device ( such as at locations 20 or 30 ), saving travel , hookup , and other time and expenses . remote commands preferably are supported through the erm control server delivering the appropriate command information to the remotely connected device through the cellular telephone . plotting applets allow for web - based viewing of all logged data , over any specified time interval , providing great flexibility in analysis . in a preferred configuration for automotive on board diagnostics , fig1 the cellular telephone is programmed to communicate with any vehicle through the obd connector , a connector that is required on all vehicles sold in the us since 1996 ( typically , the vehicle &# 39 ; s connector is located under the dashboard , making it fairly simple to connect and use the cell phone in this application , and thereby to even be able to gather data while actually driving somewhere and under varying conditions , as discussed herein ). persons of ordinary skill in the art will understand that many aspects and benefits of the invention can be practiced and realized by custom data connectors / collectors interfacing with the cellular telephone , rather that a “ standard ” connector such as the obd . even though the telephone &# 39 ; s programming preferably is standard to interface with the obd , that programming can be customized as may be needed / desired in any particular application . as for the preferred hardware to connect to the obd connector on any particular vehicle , there currently are three configurations of obd adapter blocks needed to cover all types of vehicles ( one works on ford vehicles , one on gm , and one for all other vehicles ). as indicated elsewhere , if bluetooth or other short - range wireless communication technology is incorporated into the obd “ connection ” on board the vehicle , the cellular phone can be configured ( with proper hardware and software ) to receive that wireless signal , rather than use any “ adapter block ” at all . preferably , the obd viewer software suite uses the obd connector connection to communicate a host of information , including diagnostic trouble codes ( dtc &# 39 ; s ), real - time vehicle performance data , and sensor status . the obdconnect java ™ midlet preferably delivers all the incoming obd data to the cellular telephone user , again , through a series of display forms ( see fig3 ). further support preferably is provided for graphing of selected real - time data ( rpm , vehicle speed , intake temp , ignition time , etc ) through a series of icons on the forms or other suitable user interface . for the remote display , a browser - based java ™ applet preferably provides a custom graphical user interface , delivering the information to the “ remote ” observer in a familiar “ gauge cluster ” display , along with any current diagnostic trouble codes ( dtcs ), vehicle identification number , and all available contact information for that particular individual . support for remotely controlling parameters within the engine control module ( ecm ) is provided through the erm control suite ( including the ability for a service center to reset dtc &# 39 ; s ). in a preferred pool / spa service tool configuration ( fig2 ), the cellular telephone is programmed to communicate with the on - board microprocessor powering the pool / spa control ( preferably in the form of a serial port on the pool / spa control , for which relevant communication specifications are typically available from each individual manufacturer — as mentioned above for the obd data specifications )— supplying detailed operational and diagnostic information . preferably , the spaconnect ™ java ™ midlet delivers all the incoming data to the on - site service technician through a series of display forms shown on the cell phone . control is supported through a series of icons on those forms , representing the different functions found on a pool or spa control ( jets on / off , blower on / off , spa lite on / off , filter settings , etc ). for the remote viewer / display , a browser - based java ™ applet provides a customized graphical user interface , delivering the information to the “ remote ” observer in a clear and concise fashion — with support for many sophisticated command and diagnostic routines . persons of ordinary skill in the art will understand that , among other things , the invention can include real - time downloading of new or updated firmware for the system being controlled / monitored ( in addition to downloads of applications and new software to the phone itself ), via the web — using the cell phone . persons of ordinary skill in the art will understand that the preferred apparatus and methods of the invention can be used in many other applications , systems , and processes . in addition , if desired , a preferred single cellular telephone can simultaneously hold programming so that it is capable of functioning in a plurality of such applications , without further or multiple downloads of programming ( such as java applets ) to the cellular phone . the number of programs / devices with which the cellular phone is capable of interfacing / monitoring / controlling is limited by the memory storage within the cellular phone , but current phones could readily hold 10 - 15 such programs , and future ( increased memory ) phone devices will presumably be able to hold even more . consequently , and by way of example , one telephone preferably could be used ( at the user &# 39 ; s election , and subject to the user &# 39 ; s control ) for ( 1 ) communication with devices at the user &# 39 ; s home ( such as a spa / pool / kitchen equipment / heater / ac / lights ), ( 2 ) to send data to the user &# 39 ; s doctor ( regarding the user &# 39 ; s health and / or vital signs or other diagnostic information ), and ( 3 ) to communicate data about the user &# 39 ; s automobile ( such as to a car dealer or service shop ). thus , a single user could be a pool / spa service technician ( using the phone in connection with onsite service work ), who also is a cardiac rehab patient ( using the phone to provide alerts and data to his health care center ), who also likes keeping an eye on the diagnostic codes are on his or her car ( using the phone as described above to monitor the car &# 39 ; s obd data ). with current operating systems , and serial port limitations , only one such application can be run at any given time , although future operating systems and connectivity mechanisms ( including bluetooth ), may permit multiple systems to be monitored / controlled simultaneously by a single telephone . in addition , for those embodiments using a cellular telephone , there is no need for the user ( such as a field technician ) to buy yet another costly , separate piece of communication equipment ( and to pay monthly service / access fees for the cellular or other communication service ). instead , the user can leverage the investment they have already made in their cellular telephone . further leveraging the internet access provided by the invention , such as through cellular telephones using the nextel network , the invention can deliver a whole host of services ( data logging , remote access , automatic alerts , etc .) that are not possible using other devices or technologies , let alone across such a wide array of applications . thus , the present invention provides numerous advantages over any existing technology of which the inventor is aware . for example , regarding the gecko electronics palm os ™- based spa tool ( pocket - tek ) discussed above , the invention can not only provide all the functionality of the gecko tool , but provides a remote user or users with a real - time remote window into all of the data an onsite user can see , and more . by way of example , if the onsite user is using a currently available cellular telephone with its relatively small display screen ( approximately 100 × 85 pixel black / white display ), the “ remote engineer / tech support / observer ” person ( viewing the data / system on a relatively much larger display such as a pc ) can “ see ” more than can be displayed in the smaller cell phone display . the “ remote ” viewing device ( such as a pc ) is therefore capable of more as a user interface device than is the cell phone . for instance , the “ remote observer ” preferably can access any / all historical data and have it displayed on the “ remote viewing device ” in the form of a graphical history plot , and can even print it out . as cell phones and similar devices advance , the differences in capability ( between the somewhat “ limited ” interface of current cell phones versus the more capable interface of current pcs ) may diminish , but other benefits of the invention will continue . similarly , in the arena of automotive scan tools , the invention can provide a service technician ( whether a car dealer , a service center , a gas station , or otherwise ) or even a car owner himself with all the functionality of the existing tools mentioned above , but ( as with the spa tool ) with a suite of internet technology tools to provide a real - time remote window into all the data the on - site person is seeing , and more ( similar to the “ more ” discussed above ). perhaps more importantly , the invention permits the user , technician , or even the manufacturer to take a “ test drive ” at any time , with the vehicle continuously transmitting all on - board diagnostic data to any selected destination , such as a secure internet website . the data can be stored there or viewed in real time , and in any case can include a mechanism for “ tagging ” the data at relevant points in time — for those nasty “ only - happens - when - i &# 39 ; m - driving ” glitches , noises , and rumbles — so that the service technician can easily see what was going on at the time of the problem . additional applications of the invention in the automobile industry are virtually unlimited . lube shops can use the invention to provide vehicle diagnostic scans with almost no expense on software or hardware infrastructure — hypothetically charging an extra fee for a 27 - point diagnostic scan . likewise , independent service shops can have access to all current manufacturers &# 39 ; data , without the purchase of a separate scantool ( approximately $ 2500 each currently ) from every auto maker , with no need for make - model - specific software . the low cost of equipment ( a nextel - type phone plus an obd adapter ) allows the shop to purchase only one scan tool , or at most , one per auto bay , and to use the tool out in the parking lot , on - site ( if called out to a vehicle that has stopped running ), or the like . the speed , efficiency , and quality of service can be improved , because all manufacturer - specific data can be displayed in their “ current ” form , as well as permitting the immediate selection and display ( back to the service technician ) of any recalls , warnings , or similar information relevant to the vehicle being tested , all via the erm internet server . in some or many of these situations , the “ remote ” viewer might actually be right beside the vehicle in the auto bay where it is being serviced , in the form of a pc logged onto the internet server site that is receiving the real - time data from the vehicle . yet another application of the invention regarding automobiles is automobile racing . sports such as nascar can create a revenue stream where one currently does not exist , and provides an off - track “ fan ” experience , by monitoring and displaying relevant data from various race cars over the internet , to subscribing customers . race car fans can thereby have a much deeper insight and involvement in the race they are watching , or the broadcast of the race may be displayed in an adjacent window in the fan &# 39 ; s browser , etc . automobile dealer service centers can achieve a better quality and more efficient result , as well as a faster turnover rate for their auto bays and equipment . the invention permits the service center access to vehicle diagnostic information / trip data prior to the customer &# 39 ; s arrival , thereby allowing the dealer to get a better handle on the potential problem , check parts availability , etc . loyalty to the dealer can be increased as well , if ( for example ) at the time of new / used vehicle purchase , the buyer is shown a demo of the invention application running on the cellular phone — highlighting the active role the dealer service center can play in the care and maintenance of the buyer &# 39 ; s car . as indicated above , car owners can use the invention to perform diagnostic scans on their cars at any time , saving between $ 50 -$ 150 a pop ( depending on where / when the scan / servicing would otherwise be done ), and also creating accountability for any repairs that are eventually made to the car . car owner end - users of the invention normally will require very minimal integration / support to adopt and use the invention . by way of example , each user can register online ( through either a website such as the nascar site , snap - on , etc . or directly on the invention &# 39 ; s internet server website ), where they will setup an account , and ultimately create their own personal car web page — with live view , and history display . all support to the car owner can be handled through the respective web site — via faq &# 39 ; s , tutorials , and problem report forms . as also mentioned above , historical data can also be archived and retrieved ( such as in an on - line database maintained on the internet or otherwise ) for any of the applications ( automobile or otherwise ) discussed herein . the availability of this information can permit much more effective use of time and resources . in the field of medical / health monitoring / reporting / analysis , again there are many companies providing localized solutions , where the burden of monitoring is put on the enduser ( to monitor , store , and / or upload the relevant vital signs or other data ). among the benefits of the present invention are : ( 1 ) it can provide a real - time , continuous uplink of the monitored data via the patient &# 39 ; s cellular telephone , securely delivering all the encrypted medical monitoring data for viewing by a physician or other medical personnel from any available web browser ; ( 2 ) in that same web browser , the medical personnel may also instantly pull up not only the real - time data that is being generated by the patient , but also a graphical history of the patient &# 39 ; s data ; ( 3 ) support for “ alert ” or warning / dangerous conditions can also generate a real - time message / alert ( such as an email and / or page ) to the physician or appropriate medical personnel in the event of a serious condition ; and ( 4 ) these and other aspects of the monitoring can be configurable through the web - based interface . by way of example , the telephone can be configured to interface with a commercially available heart rate monitor and temperature sensor for remote monitoring of “ discharged ” hospital patients ( an example would be a cardiac rehab patient who has recently undergone bypass surgery , and has been discharged by his hmo , but put on a “ restricted activity ” regimen ). using the invention , the hospital can keep close tabs on the patient , including setting alerts that trigger if the patient &# 39 ; s heart - rate exceeds a predetermined threshold . all data can be permanently logged into an online database , so that the physician is able to retrieve it for immediate analysis from any location ( hospital , home , vacation , office , hotel room , etc . ), thus providing a truly new level of patient care . further regarding benefits of the invention in health / medical applications , in embodiments in which the data is delivered from the patient using a network such as nextel &# 39 ; s , the patient can simply wear their chest strap heart - rate sensor ( or other sensing device ) connected to their cellular telephone , and the data will be continuously transmitted in real time . so long as the telephone is turned on , you do not have to “ dial up ” or call a number ; the data can find its way to a desired website or location such as the erm / rackspace server ( see fig1 and 2 ). the patient is free to move about ( take a walk , go to the store , return to the clinic for an exam ) all with complete monitoring of their vitals . persons of ordinary skill in the art will understand that , in the preferred embodiment the cellular telephone component of the invention is used as a local / on - site service / diagnostic tool , including using the cellular telephone &# 39 ; s display screen . although other technologies use a cellular telephone as a “ modem ” or otherwise use wireless modems to transmit data , the inventor is not aware of a cellular telephone previously being used as a local / service / diagnostic tool , especially while also being used as an “ internet data pipe ”. in addition to the benefits of the cellular telephone device providing an “ internet data pipe ” and / or a cellular telephone connection to transmit the data / control commands , persons of ordinary skill in the art will understand that the preferred cellular phone of the invention preferably can provide many of the benefits herein even without any such connection from the phone to the internet or to a cellular network . by way of example , even in such a “ non - broadcasting ” mode , the cellular phone can be used as a programmable , portable local / service / diagnostic tool , providing a user - friendly interface by which a service technician can extract relevant data , issue commands to the controlled / monitored system , etc . under such conditions , the remote viewer would not be receiving data , but the local service technician can benefit from a powerful tool not presently available to him . also under those conditions , the cell phone preferably is capable of storing the data for subsequent transmission ( such as via the internet or the cellular connection ). [ 0065 ] fig5 illustrates a block diagram of a preferred remote monitoring and control system for a network of embedded sensors and control devices . the erm technology provides an end - to - end solution , encompassing everything required for remote monitoring and control — from the erm sensor node , the erm gateway , to the erm server , providing a central gateway for all end - user access . [ 0066 ] fig6 depicts the data - flow of the preferred software architecture for the present invention — from the erm sensor node , the embedded gateway , then central server , and the end - user &# 39 ; s web browser . ( note that all connections to the internet preferably are originated by the remote gateway — thereby thwarting any remote attacks ). persons of ordinary skill in the art will understand that the erm server can be suitably practiced on any number of computing platforms . a preferred embodiment is a 750 mhz pentium iii computer , preferably running redhat linux version 7 . 0 or above , with a high - speed internet connection . the preferred software infrastructure can be broken down into four ( 4 ) categories : 1 . ermmonitor — java program , which handles incoming data from erm installations ( tim &# 39 ; s ), alerts , data storage in the database , and all “ live ” web browser connections . 2 . ermcontrol — java program , which handles “ control ” connections from web browser applet ( s ), queuing up and serving commands to erm installations ( tini &# 39 ; s ). 3 . webscripts — linux cron jobs , which run periodically to generate dynamic web content including cell phone pages , web statistics , and alert / error logs . 4 . database — a mysql db running on the same linux box , maintaining a central repository for all incoming data . in the preferred embodiment of the invention , all site - specific configuration information is accessed through web pages on the erm server , using cgi / perl scripts , providing end - user access to things like name , address , phone , e - mail , pager , password , as well as access to user - specific / selectable options — cell phone page , alerts , etc . [ 0073 ] fig7 is a software flowchart for a preferred ermmonitor application , which runs on the evcm server — accepting udp datagrams from the remote embedded gateway devices . the udp datagram is processed based on the stored configuration information — individually extracting each remote data block . the ermmonitor application preferably then forwards the latest data to each of three ( 3 ) threads : 1 . log file / database storage ; 2 . alert generation / e - mail notification ; and 3 . browser applet server . [ 0074 ] fig8 is a software flowchart for a preferred ermcontrol application , which runs on the erm server — managing control to and from the remote embedded control devices . tcp socket connections from web browser java applets are accepted — providing a secure mechanism for authentication and authorization , prior to accepting any requested commands . tcp socket connections are also accepted from the remote embedded gateway ( s ), where individual commands are extracted from the controlqueue maintained on the erm server . the apparatus and methods of my invention have been described with some particularity , but the specific designs , constructions and steps disclosed are not to be taken as delimiting of the invention . obvious modifications will make themselves apparent to persons of ordinary skill in the art , all of which will not depart from the essence of the invention and all such changes and modifications are intended to be encompassed within the appended claims . | 7 |
referring now more particularly to fig1 to 3 of the drawings which show our presently preferred mode of carrying out the invention with a hook - shaft 1 shown in cross - section positioned within a bushing 11 which is provided with lubrication inlet 2 and lubrication outlet 3 , spaced from each other . positioned between lubrication inlets 2 and 3 is a hook shaft oil inlet 23 within bushing 11 . the arrows in inlet 2 and outlet 3 show the direction of flow . oil flows into inlet 2 in a direction transverse to hook shaft axis 5 , and out from outlet 3 through oil - flow paths or conduits 31 , 32 and 33 . conduits 31 and 33 are transverse to hook shaft axis 5 , and conduit 32 is substantially parallel to hook shaft axis 5 . hook - shaft 1 is provided with a hollow interior and has a reduced area portion 4 positioned between hook - shaft inlet 23 and hook - shaft outlet 22 . oil from lubrication inlet 2 passes through wick 13 in inlet 2 and flows between bushing 11 and hook shaft 1 to inlet 23 through shaft 19 to hook shaft outlet 22 to outlet 3 through conduits 31 , 32 and 33 . in fig1 to 3 , one end of the hollow channel is closed off by an adjustment screw 14 having its head closing off the left - hand side of the hook - shaft , as shown in the drawing , and its shank or shaft portion 19 extending through the interior of the hook - shaft and being sufficiently narrowed to extend past the reduced area portion 4 . the other side of hook - shaft 1 is provided with a closure wall and closure member 15 having an oil supply channel 6 . the oil supply channel 6 has a longitudinal axis which is eccentric to or displaced from the axis of hook shaft 1 . in this embodiment oil - supply - channel 6 is neither co - axial with nor aligned with longitudinal axis 5 as will be explained subsequently during the explanation of the operation . as a further feature of the invention , a plug of porous foam material 7 is placed within a bore 26 of the hook - shaft 1 , and is held in place against closure member 15 by means of pressure member 18 carried at the end of shaft 19 coupled with screw 14 . screw 14 cooperates with the interior of hook - shaft 1 at the left - end 20 thereto as viewed in the drawing to maintain porous material 7 juxtaposed to closure member 15 . depending on the pressure on the porous material , the oil supply to the oil supply channel can be regulated . outer portion of hook - shaft 1 is provided with a spiral undercut 12 which works in connection with bushing 11 as a pump . referring now more particularly to fig4 and 5 , which show another embodiment of the invention , like parts will be designated by adding the number 200 , and as shown , hook - shaft 201 is provided with closure member 215 having an eccentric oil supplying channel 206 . porous material 207 is shown somewhat differently from porous material 7 and an insert part 208 is provided . the porous material is held against the closure member 215 by means of pressure member 218 which is shown with a pointed end 229 . pressure member 218 is connected with shaft 219 . in order to maintain the porous material raised above the bottom portion 227 of interior bore 226 of the hollow shaft 201 , there is insert part 208 . insert part 208 can be made from metal , plastic or any other type of solid material . the purpose of insert part 208 is to prevent the porous material 207 from soaking up oil which collects in the bottom of the hollow hook - shaft , if the machine is stopped in the position shown in fig3 . referring now more particularly to fig6 and 7 of the drawings , there is shown a hook - shaft 401 which is closed at end 424 . closed end 424 is provided with an oil supply channel 406 co - axially positioned and aligned with the longitudinal axis 405 of hook - shaft 401 and provided with a spring 410 wound about the outer circumferential surface of porous material 407 . it is to be understood that there is an oil inlet and an outlet ( not shown ) similar to that shown in fig1 and 2 . shaft 419 contains pressure member 418 to hold porous material 407 under pressure and in place against the inner portion 425 of closed end 424 , and to press or depress porous material in order to control oil supply to oil supply channel 406 . fig1 to 3 show a cross - sectional view of the hook - shaft 1 with bushing 11 . spiral groove 12 cut into the outer surface of the hook - shaft 1 causes oil to be pumped from wick 13 which is inserted in inlet 2 of bushing 11 and connected with oil reservoir 9 and hook - shaft inlet 23 into hollow hook - shaft 1 through outlet 22 , while the machine is running . the centrifugal force distributes the oil as a thin film onto the inner surface 26 of hook - shaft 1 . the decreased diameter of hook - shaft 1 in the reduced area 4 works as a control for the quantity of oil available for hook oiling . the spiral undercut 12 , as best seen in fig1 and 2 is triangular . the spiral on the outer surface of the hook - shaft pumps oil from inlet 2 through hook - shaft inlet 23 into hollow hook shaft 1 . if the oil film becomes too thick , excessive oil crawls over the shoulder in reduced area 4 towards hook - shaft outlet 22 and flows back through outlet 3 to an oil reservoir ( not shown ); another part of this oil is immediately transported by spiral 12 to inlet 23 and then back into the hollow hook - shaft . therefore , the fig1 to 3 embodiment achieves a constant amount of oil available for hook oiling depending on the location of reduced area 4 and the decreased diameter thereof . furthermore , the inner surface 26 of the hook - shaft 1 can be roughened or provided with grooves in order to control crawling - speed of the oil . the oil crawls due to centrifugal force to the oil - supply - channel 6 and finally reaches the hook . the oil supply to the hook also depends on the diameter of the oil - supply - channel 6 and its location . as the hook - shaft 1 revolves , the spiral 12 on its outer surface 21 pumps oil through the inlet 23 into the hollow hook - shaft . the pump effect is stronger than the centrifugal force . as soon as the oil enters the hollow hook - shaft , an oil film develops under the centrifugal force on the inner surface 26 . the oil , therefore , is driven along the inner surface of the hook - shaft to the left and the right of inlet 23 ( see fig1 ). the barrier in area 4 stops the oil from crawling to the left . therefore , the oil film becomes thicker until the thickness of the oil film exceeds the barrier in area 4 and crawls to outlet 22 ( the reason for this crawling effect is the centrifugal force ). depending on the increased diameter of the hollow hook - shaft in area 4 ( design parameter ), the thickness of the oil film can be factory set . the speed with which the oil crawls on the inner surface of the hook - shaft , under the influence of the centrifugal force , depends on the inner surface 26 of the hook - shaft . therefore , a means to control the crawling speed of the oil is to roughen the inner surface 26 or provide it with spiral grooves . the above - described design therefore assures a constant thickness of the oil film in the hook - shaft . depending on the location of the oil supply channel 6 , a design parameter , and the set thickness of the oil film , the amount of oil with which the hook is supplied can be a factory set design parameter . however , this embodiment of the idea does not allow to adjust the oil supply . by inserting a piece of porous material 7 which can be pressed or depressed , the oil supply can be adjusted . in this embodiment , during machine standstill , the porous material 7 soaks up the oil which collects in the lower part of the inner hook - shaft . a solution is to stop the machine in a position where the oil supply channel is located in the upper part of the hook - shaft and an insert part 208 is arranged in the lower part of the hook - shaft to prevent the porous material from soaking up oil during machine standstill . the fig1 to 3 embodiment of the invention , as noted , also works quite well without the block of porous material 7 . however , it is preferred to use the block of porous material 7 . it is important , when the sewing machine is stopped , that the oil - supply - channel 6 be located in the upper part of the hook - shaft 1 as shown in fig1 . this maintains the oil which collects when the machine is stopped in the lower part of the hook - shaft 1 and prevents the oil from flowing through the oil - supply - channel 6 . the block of porous material 7 which can be pressed by adjustment screw 14 operates as an oil - supply adjustment device in the fig1 embodiment . when adjustment screw 14 and porous material 7 are pressed together , less oil is supplied to the hook and when released more oil is supplied . this adjustment device for certain purposes may not provide sufficient control and may cause porous material 7 to soak up oil when the machine stops , and therefore the hook may be supplied with excessive oil when the machine starts again . the rough surface 426 ( fig6 ) is the result of machining a very fine spiral groove along the inside surface of the hollow hook - shaft 401 . the spirals on the inside and the rough surface of the inside of shaft 1 , 201 or 401 allow a more precise control of the oil flow in the inside of the hollow hook - shaft . an improved embodiment for an adjustment device according to the invention is shown in fig4 and 5 . in this embodiment , insert part 208 maintains and prevents porous material 207 from touching the oil which collects in the lower part or portion of the hook - shaft 1 when the sewing machine stops . for this purpose , insert part 208 plays an essential part . the two design possibilities permit the supplying of the hook - shaft with oil during the entire sewing machine operation cycle . in fig6 and 7 , the block of porous material 7 which is designated 407 is surrounded by spring 410 according to the invention . certain parts are omitted from fig6 and 7 but , if they were shown , they would be designated with numbers in the 400 range . this arrangement assures that the porous material 407 regains its original shape after the screw 14 in fig1 which would be designated 414 in fig6 and 7 , is screwed outwards so that the soaking of oil is performed faster and referring to pollution of the oil the required function of the porous material 407 provided for increased time of usage . an additional spring 410 which surrounds the porous material 407 assures that the material depresses properly and increases the outer surface of the porous material . the embodiment shown in fig6 and 7 shows the oil channel 406 located concentrically with the hook - shaft axis 405 . with the oil supply channel 406 located as described , oil will only be supplied to the hook during the start phase . during the running phase , the centrifugal force presses the oil against the inner surface of the hook - shaft and , therefore , no oil will be supplied through oil channel 406 . this embodiment can therefore only be used in machines with a short sewing cycle . however , a positioning of the oil channel after machine stop is not necessary . the fig6 and 7 embodiment is primarily intended for an adjustment device according to the invention which supplies the hook with oil only during machine start so that it will be sufficient for a short operation cycle . oil - supply - channel 406 is arranged concentrically to the hook - shaft - axis 405 . during machine stoppage , the porous material 407 soaks up oil and supplies the hook with oil during the machine &# 39 ; s start - up time . during machine operation , the hook is not supplied with oil . therefore , this device should primarily and preferably only be installed in machines with a relative short operation cycle . while there has been shown what is considered to be the preferred embodiments of the invention , it will be obvious to those skilled in the art that various changes and modifications may be made therein without departing from the scope of the invention . | 3 |
generally speaking , the present inventive method for testing and assessing adhd is based upon earlier findings that indicated that the highest degree of differentiation between adhd patients and non - adhd controls was noted at the vertex [ 29 ]. therefore , the cz cranial site was selected for placement of the active electrode in performing the qeeg assessment . prior studies [ 24 , 30 ] had also indicated that differentiation between groups occurred when participants were involved in scholastic tasks ( e . g ., reading , listening , drawing ), as would have been expected . therefore , the difficulty sustaining attention during completion of these types of tasks ( as manifested on the qeeg testing ) provides a neurometric index for identifying the presence and degree of adhd . referring to fig1 the testing apparatus of this invention is illustrated . a vga monitor 14 is used to observe the testing being performed . the monitor 14 is connected to a personal computer 19 , having a minimum 486 operating system . the computer 19 is connected to a digital processing card 18 ( contained in an autogenics a - 620 instrument ) and an analog - to - digital converter 17 ( stoelting autogenics part no . 7000 - 08 ) that is connected to a single channel , dual frequency eeg 16 ( autogenics a - 620 eeg instrument ). the computer 19 is also connected to a computer storage site 20 containing the normative index data base . the basis of this invention involves obtaining qeeg recordings using the single channel eeg recording device 16 . the computer 19 is programmed to select and statistically analyze specific eeg frequency bands . the eeg 16 and the associated software for programming the computer 19 consist of an autogenics a - 620 electroencephalograph with associated assessment software provided by the stoelting - autogenics company located in wood dale , ill . the individual 15 is connected to the single channel eeg device 16 via a monopolar ( referential ) eeg cable with junction box ( autogenics part no . 800 - 032 m ), not shown . this system provides clinicians with a quantitative analysis of electrophysiological recordings in two frequency bands : theta ( 4 - 8 hz ) and beta ( 13 - 21 hz ). four short periods ( 90 seconds each ) of digitized eeg are obtained . a fast fourier transformation algorithm , commonly utilized in this field , is used to process the signals and transform them into the data required for evaluation of adhd . referring to fig2 a and 2b , a flow chart 100 depicts the sequential steps of the testing method for quantitatively diagnosing and evaluating adhd in individuals using the apparatus shown in fig1 . the individual being tested is prepared , step 101 , and the eeg electrode is attached to the scalp at cranial site cz , step 102 . thereafter , ear electrodes are attached to the individual &# 39 ; s ear lobes , step 103 . impedance and offset potentials are obtained , step 104 . particular eeg frequency bands are then selected for the adhd assessment , step 105 . the eeg signals are amplified and digitized , step 106 during a 90 second period , in which the individual maintains an eyes open fixed gaze . then a fourier analysis of the signals is obtained , step 107 . the signal is analyzed for muscular and ocular movement artifact , step 108 . the computer 19 ( fig1 ) then processes the data and calculates the electrophysiological power ( pw ) recorded at 4 - 8 hz and 13 - 21 hz , step 109 , as well as a ratio of power ( theta / beta ) at these frequencies , step 110 . the individual is then given a number of tasks requiring attention . from a first test , step 111 , an attention ratio ( theta / beta power ratio ) is obtained . additional attention tasks are given to the individual , step 111 , which require repetition of steps 105 through 110 , as shown by exit line 112 and flow chart connector b . thereafter , the overall neurometric index is computed , step 113 . the tested index obtained in step 113 is then compared to a normative database index that has been determined during investigations conducted by the inventors , step 114 . the following is a more detailed step - by - step description of a typical test procedure used in this invention . 1 . the vertex ( cz ) is located using the international 10 - 20 system of electrode placement . 2 . the area is cleaned using omni prep ( or equivalent ) and isopropyl alcohol . a small amount of conductive paste ( e . g ., ten 20 ) is applied to the scalp and a grass gold disc electrode with hole ( e5gh ) and the sensor are attached to the scalp . a similar cleaning procedure is used for preparing the ear lobes . one pair of gold disc electrodes in ear clip ( grass e34d ) is attached to each ear lobe . quality of preparation is assessed via an autogenics electrode tester . impedance reading is set below 10 kohms . offset potential is set below 10 mv before recordings are obtained . 3 . band frequencies are selected with 4 - 8 hz defined as theta and 13 - 21 hz defined as beta . once the sensors are tested and band frequencies defined , the individual &# 39 ; s electrophysiological activity at cz is recorded during the following 90 second tasks : a ) eyes fixed baseline : the patient is seated in front of the computer monitor display and instructed to focus his / her gaze on the monitor &# 39 ; s &# 34 ; on / off &# 34 ; indicator light . eeg recordings are obtained for 90 seconds . after the task is completed , the eeg record is reviewed in two second intervals (&# 34 ; epochs &# 34 ;) in order to manually filter out epochs containing excessive emg artifact ( e . g ., body movement , eye rolls or blinks ). a minimum of 15 low artifact epochs ( i . e ., no evidence of eye rolls / blinks and peak emg output below 15 mv ) is required for completion of this task . b ) silent reading : the next 90 second task is reading . material that is age or grade appropriate is selected from school reading texts , reading tasks from the kaufman test of educational achievement , the peabody individual achievement test , or other age - related reading tests , and the material is read silently by the patient . again , after completion of this task , the eeg is reviewed in two second intervals to eliminate epochs with excessive emg activity or eye movement / blink artifact . a minimum of 15 low artifact epochs is required for completion of this assessment task . c ) listening : a 90 second listening task occurs next . age appropriate material is selected and read by a clinician , as described for task ( b ), above . eeg review is conducted , as with tasks ( a ) and ( b ). d ) drawing : a stable drawing surface is placed in front of the individual . the person is instructed to copy geometric figures from one of the following tests : beery - bender gestalt , benton visual retention test , mccarthy scales of child development . electrophysiological activity is recorded for 90 seconds with review , as for the aforementioned tasks . after the data is collected , a statistical analysis is performed . the analysis is first conducted by task and a ratio of electrophysiological power produced and recorded at 4 - 8 hz is divided by the power recorded at 13 - 21 hz . a separate ratio is calculated for each task . finally , an average ratio for the four tasks is calculated and an attentional index is derived . it is this attentional index that is used for comparison with the normative database . the specifications of the equipment used in the development of the current invention were as follows : signal acquisition was obtained using the aforementioned a - 620 eeg device . input was single channel , dual frequency . gain was 50 , 000 . noise was less than 1 mv pp , referred to input . differential input impedance was 200 kohms . common mode rejection ratio was greater than 100 db . amplitude range was 1 - 100 mv , rms . eeg frequency bands that could be recorded with this equipment ranged from 1 . 0 hz to 32 hz . sampling rate was 128 . a / d resolution was 12 bits ( 0 . 05 mv ). emg was also recorded with the a - 620 eeg device ( band pass frequency was 100 - 300 hz , fixed ). computer requirements were a pc , the minimum requirement being a 486 machine . in order to assess the ability of this invention to meet the standards for a valid and reliable assessment process , a series of studies have been conducted by the inventors [ 30 ]. although in the initial study [ 24 ], the inventors established a database founded on a qeeg examination of 482 individuals , cross validation , construct validation and test - retest reliability studies were required . for these reasons , five additional studies were conducted [ 30 ]. in the first study , the inventors compared the qeeg derived attentional index of 96 individuals diagnosed with adhd and 33 &# 34 ; non - clinical &# 34 ; controls , none of whom had participated in the initial validation study . this study was intended as a cross - validation study with non - clinical controls . anova results indicated significant differences between the two groups ( adhd vs . control ), with cortical slowing noted in members of the adhd , inattentive and the adhd , combined groups . using the critical values for cortical slowing established in the normative study as the basis for classification as adhd or non - adhd , 93 % of the individual participants were accurately classified . next , the qeeg derived attentional index was examined in 155 participants . of these individuals , 129 were classified as adhd , using the selection criteria developed in the initial study [ 24 ]; 13 individuals were classified with depressive disorders and 13 were classified with an oppositional defiant disorder based on rating scales and dsm - iv criteria . none of these individuals had participated in the initial validation study . significant differences were again noted in the results of the qeeg data , with cortical slowing only noted in the adhd groups . classification as adhd or non - adhd was accurate for 94 % of the participants . it was considered significant that the results of this study demonstrated that common co - morbid conditions , such as depression and oppositional defiant disorders , are not characterized by cortical slowing on the eeg . it was also considered significant that the absence of cortical slowing in the qeeg &# 39 ; s of patients diagnosed with oppositional defiant disorders and depression is consistent with pet and spect findings . amen and carmichael [ 31 ], using spect , reported increased activity in the anterior medial aspects of the frontal lobes in patients diagnosed with oppositional defiant disorder . previously , hollander [ 32 ], machlin [ 33 ], mordahl [ 34 ] and swedo [ 35 ] reported a similar pattern of increased metabolic activity , bilaterally , in the anterior medial portions of the frontal lobes on pet and spect examinations of patients diagnosed with affective disorder . as in the inventors &# 39 ; qeeg studies , cortical slowing was not observed in pet or spect procedures examining patients diagnosed with an affective or oppositional disorder . in order to assess the &# 34 ; construct &# 34 ; validity of their qeeg process , the inventors next examined the degree of diagnostic agreement between classification based on the attentional index and that derived from a cpt ( the test of variables of attention ). in this study 155 individuals were examined ( the same participants as described above ). as reported previously , 129 of these participants were classifiable with adhd , the remainder as either depressed or with oppositional defiant disorder . agreement between classification determined by the cpt and the qeeg was noted in 88 % of the participants . the degree of agreement was significant ( p & lt ; 0 . 001 ). in the fourth study , 83 participants classifiable as adhd using the previously described selection criteria and 18 clinical controls ( 9 with depressive disorders , 9 with oppositional defiant disorder ) were evaluated with the qeeg screening procedure as well as the addes . consistency between the two measures was assessed . the rate of agreement was 83 % ( p & lt ; 0 . 001 ). overall , the results of the construct validation studies provided further support for the qeeg measure as a laboratory test for adhd . finally , the inventors reported a test - retest reliability study of 55 individuals who met research criteria for classification as either adhd , inattentive or combined types . these individuals were evaluated on two occasions . during each assessment session , the qeeg scanning procedure for adhd was conducted over four conditions ( eyes open baseline , reading , listening , drawing ). each condition was 90 seconds in duration . an attentional index was calculated as in previous studies and the consistency of this index over the two testing sessions ( conducted 30 days apart ) was calculated . the correlation coefficient ( r = 0 . 96 ) revealed a significant level of consistency ( p & lt ; 0 . 01 ) between the two qeeg - derived attentional indices . barkley , r . a . ( 1998 ). attention - deficit hyperactivity disorder : a handbook for diagnosis and treatment , ( 2nd edition ). new york : guilford press . american psychiatric association . ( 1994 ). diagnostic and statistical manual of mental disorders , ( 4th edition ). washington , d . c . : author . zametkin , a . j ., ernst , m ., & amp ; silver , r . ( 1998 ). laboratory and diagnostic testing in child and adolescent psychiatry : a review of the past 10 years . journal of the american academy of child and adolescent psychiatry , 37 , 464 - 472 . barkley , r . a ., mcmurray , m . b ., edelbrock , c . s ., & amp ; robbins , k . ( 1990 ). the side effects of ritalin : a systematic placebo controlled evaluation of two doses . pediatrics , 86 , 184 - 192 . swanson , j . m ., mcburnett , k ., christian , d . l ., & amp ; wigal , t . ( 1995 ). stimulant medications and the treatment of children with adhd . in t . h . ollendick & amp ; r . j . prinz ( eds . ), advances in clinical child psychology ( vol . 17 , pp . 265 - 322 ). new york : plenum . achenbach , t . m ., & amp ; edelbrock , c . s . ( 1983 ). manual for the child behavior profile and child behavioral checklist . burlington , vt . : author . conners , c . k . ( 1969 ). a teacher rating scale for use in drug studies with children . american journal of psychiatry , 126 , 884 - 888 . dupaul , g . j . ( 1990 ). the adhd rating scale : normative data , reliability and validity . worcester : university of massachusetts medical center . mccarney , s . b . ( 1989 ) attention deficit disorders evaluation scale . columbia , mo . : hawthorne . conners , c . k . ( 1994 ). conners &# 39 ; continuous performance test manual . toronto : multi - health systems , inc . greenberg , l . m . ( 1994 ). t . o . v . a . continuous performance test manual . los alamatos , calif . : universal attention disorders . blondis , t . a ., accardo , p . j ., & amp ; snow , j . h . ( 1989 ). measures of attention deficit : i . questionnaires . clinical pediatrics , 28 , 222 - 228 . corkum , p . v ., & amp ; siegel , l . s . ( 1993 ). is the continuous performance task a valuable research tool for use with children with attention - deficit - hyperactivity disorder ? journal of child psychology & amp ; psychiatry & amp ; allied disciplines , 34 , 1217 - 1239 . casey , b . j ., castellanos , f . x ., giedd , j . n ., marsh , w . l ., hamburger , s . d ., schubert , a . b ., vauss , y . c ., vaituzis , a . c ., dickstein , d . p ., sarfatti , s . e ., & amp ; rapoport , j . l . ( 1997 ). implication of right frontostriatal circuitry in response inhibition and attention - deficit / hyperactivity disorder . journal of the american academy of child and adolescent psychiatry , 36 , 374 - 383 . zametkin , a . j ., nordahl , t . e ., gross , m ., king , a . c ., semple , w . e ., rumsey , j ., hamburger , s ., & amp ; cohen , r . m . ( 1990 ), cerebral glucose metabolism in adults with hyperactivity of childhood onset . new england journal of medicine , 323 , 1361 - 1366 . amen , d . g ., paldi , j . h ., & amp ; thisted , r . a . ( 1993 ). evaluating adhd with brain spect imaging . journal of the american academy of child and adolescent psychiatry , 32 , 1081 - 1091 . hynd , g . w ., hern , k . l ., novey , e . s ., eliopulos , d ., marshall , r ., gonzalez , j . j ., & amp ; voeller , k . k . ( 1993 ). attention deficit hyperactivity disorder and asymmetry of the caudate nucleus . journal of child neurology , 8 , 339 - 347 . semrud - clikeman , m ., filipek , p . a ., biederman , j ., steingard , r ., kennedy , d ., renshaw , p ., & amp ; bekken , k . ( 1994 ). attention - deficit hyperactivity disorder : magnetic resonance imaging morphometric analysis of the corpus callosum . journal of the american academy of child and adolescent psychiatry , 33 , 875 - 881 . castellanos , f . x ., giedd , j . n ., eckburg , p ., marsh , w . l ., vaituzis , c ., kaysen , d ., hamburger , s . d ., & amp ; rapoport , j . l . ( 1994 ). quantitative morphology of the caudate nucleus in attention deficit hyperactivity disorder . american journal of psychiatry , 151 , 1791 - 1796 . castellanos , f . x ., giedd , j . n ., marsh , w . l ., hamberger , s . d ., vaituzis , a . c ., dickstein , d . p ., sarfatti , s . e ., vauss , y . c ., snell , j . w ., lange , n ., kaysen , d ., krain , a . l ., ritchie , g . f ., rajapakse , j . c ., & amp ; rapoport , j . l . ( 1996 ). quantitative brain magnetic resonance imaging in attention - deficit hyperactivity disorder . archives of general psychiatry , 53 , 607 - 616 . mann , c . a ., lubar , j . f ., zimmerman , a . w ., miller , b . a ., & amp ; nuenchen , r . a . ( 1992 ). quantitative analysis of eeg in boys with attention deficit / hyperactivity disorder ( adhd ). a controlled study with clinical implications . pediatric neurology , 8 , 30 - 36 . chabot , r . a ., & amp ; serfontein , g . ( 1996 ). quantitative electroencephalographic profiles of children with attention deficit disorder . biological psychiatry , 40 , 951 - 963 . monastra , v . j ., lubar , j . f ., linden , m ., vandeusen , p ., green , g ., wing , w ., phillips , a ., & amp ; fenger , t . n . ( 1998 ). assessing adhd via quantitative electroencephalography : an initial validation study . neuropsychology , in press . lubar , j . f . ( 1997 ) neocortical dynamics : implications for understanding the role of neurofeedback and related techniques for the enhancement of attention . applied psychophysiology and biofeedback , 22 , 111 - 126 . sterman , m . b . ( 1996 ). physiological origins and functional correlates of eeg rhythmic activities : implications for self - regulation . biofeedback and self - regulation , 21 , 3 - 33 . lubar , j . f ., bianchini , k . i ., calhoun , w . h ., lambert , e . w ., brody , z . h ., & amp ; shabsin , h . w . ( 1985 ). spectral analysis of eeg differences between children with and without learning disabilities . journal of learning disabilities , 18 , 403 - 408 . cooley , j . w ., & amp ; tukey , j . w . ( 1965 ). an algorithm for the machine calculation of complex fourier series . mathematics of computation , 19 , 267 - 301 . lubar , j . f ., swartwood , m . o ., swartwood , j . n ., & amp ; timmermann , d . l . ( 1996 ). quantitative eeg and auditory event - related potentials in the evaluation of attention - deficit / hyperactivity disorder : effects of methylphenidate and implications for neurofeedback training . journal of psychoeducational assessment ( monograph : assessment of attention - deficit / hyperactivity disorders , pp . 143 - 204 ). monastra , v . j ., lubar , j . f ., & amp ; linden , m . ( 1998 ). assessing adhd via quantitative electroencephalography : test validation and reliability studies . presented at ch . a . d . d .&# 39 ; s tenth annual conference , new york . paper in preparation . amen , d . g ., & amp ; carmichael , b . a . ( 1997 ). oppositional children similar to ocd on spect : implications for treatment . journal of neurotherapy , 2 , 1 - 7 . hollander , e . ( 1992 ). hyperfrontality and serotonin in ocd . presented at the annual meeting of the american psychiatric association . machlin , s . r ., harris , g . j ., peralson , g . d . ( 1991 ). elevated medial - frontal cerebral blood flow in obsessive - compulsive patients : a spect study . american journal of psychiatry , 148 , 1240 - 1242 . nordahl , t . e ., benkelfat , c ., & amp ; semple , w . e . ( 1989 ). cerebral glucose metabolic rates in obsessive compulsive disorder . neuropsychopharmacology , 2 , 23 - 38 . swedo , s . e ., schapiro , m . b ., & amp ; grady , c . l . ( 1989 ). cerebral glucose metabolism in childhood onset obsessive compulsive disorder . archives of general psychiatry , 46 , 518 - 523 . since other modifications and changes varied to fit particular operating requirements and environments will be apparent to those skilled in this scientific field , the invention is not considered limited to the example chosen for purposes of disclosure and covers all changes and modifications which do not constitute departures from the true spirit and scope of this invention . having thus described the invention , what is desired to be protected by letters patent is presented in the subsequently appended claims . | 0 |
fig1 is a block diagram of a preferred embodiment of the led controller according to the present invention . as shown in fig1 , the led controller 10 comprises a sensing unit 11 , a control unit 12 , and a driving unit 13 . the sensing unit 11 can detect the luminous intensity of a led ( within the driving unit 13 and not shown in fig1 ), and output a corresponding sensing signal . in one embodiment , the sensing unit 11 employs a photodiode ( not shown ) to detect the luminous intensity . the control unit 12 , coupled to the sensing unit 11 , can determine if the luminous intensity of the led reaches a predetermined value according to the sensing signal . then , the control unit 12 outputs a control signal to the driving unit 13 . when the intensity reaches the predetermined value , the control unit 12 remains to output the original control signal such that the driving unit 13 can keep the luminous intensity at the predetermined value . however , when the intensity deviates from the predetermined value , the control unit 12 would adjust the control signal such that the driving unit 13 can change the luminous intensity ( described later ). in one embodiment , the color of the led is one of red , green and blue , and the led is used to mix white light . in the colorimetry suggested by the commission international de l &# 39 ; eclairage ( cie ), white can be represented as a linear combination of red , green and blue . thus , the predetermined value can be generated according to the cie colorimetry . for example , if the color of the led is blue , the proportion of blue in the above linear combination can be used as the predetermined value . after adjusting the luminous intensity to the predetermined value , the control unit 12 can further determine if the led is aging by comparing the control signal and the subsequent sensing signal . that is , the control unit 12 can record the values of the control signal and the corresponding ideal values of the sensing signal in a table . when the “ actual ” value of the sensing signal is lower than the ideal value over a default degree , it means that the led intensity does not reach the expected value , and then the led can be judged as aging . if the led is aging , its intensity is subject to deviate from the predetermined value . thus , the control unit 12 would require the sensing unit 11 to perform detection again after a shorter time . on the other hand , if the led is not aging , its intensity is not subject to deviate from the predetermined value . thus , the control unit 12 would require the sensing unit 11 to perform detection again after a longer time . fig2 is a block diagram showing a preferred embodiment of the control unit 12 of fig1 . in fig2 , the control unit 12 comprises an analog - to - digital converter ( adc ) 121 , a microprocessor 122 and a memory 123 . the adc 121 can convert the above analog sensing signal into a digital response value of the luminous intensity . the memory 123 can record the correspondence between the value of the control signal and the ideal response value , and the correspondence can be used to judge if the led is aging . the microprocessor 122 , coupled to the adc 121 and the memory 123 , can execute related operations to determine whether the led intensity reaches the predetermined value according to the actual response value provided by the adc 122 . besides , the microprocessor 122 accesses the memory 123 and calculates the difference between the actual and ideal response values , thereby judging if the led is aging . the driving unit 13 is coupled to the control unit 12 , and drives the led according to the control signal provided by the control unit 12 . fig3 is a block diagram showing a preferred embodiment of the driving unit 13 of fig1 . in fig3 , the driving unit 13 comprises a led unit 131 , a first adjusting unit 132 and a second adjusting unit 133 . in this embodiment , the control signal includes a driving signal , a pwm signal and a switch signal . the led unit 1 131 includes the led and associated control circuit , and switches between a “ light - on ” state and a “ light - off ” state according to the switch signal . also , the led unit 131 can receive the driving signal and drive the led to emit a corresponding luminous intensity . the first adjusting unit 132 receives the pwm signal and generates a corresponding adjusting signal to the led unit 131 , thereby adjusting the luminous intensity of the led . by changing the pulse width of the pwm signal , various adjusting signals can be generated to adjust the intensity by different degrees . the second adjusting unit 133 generates a feedback signal to the control unit 12 , and then the control unit 12 generates the corresponding driving signal according to the feedback signal . thus , by adjusting the feedback signal , the driving signal can be changed , and the led intensity can further be adjusted . besides , the second adjusting unit 133 can accelerate discharge for the led when the led unit 131 switches from the light - on state to the light - off state , thereby enabling a more rapid and precise switch . fig4 is a detailed circuit diagram of the driving unit 13 of fig3 . in fig4 , the led unit 131 comprises : a led for receiving the driving signal , a n - channel metal oxide semiconductor ( nmos ) q 1 coupled to the led and used as a switch , and a resistor r 1 with one end coupled to ground and the other to the drain of q 1 . the first adjusting unit 132 comprises : an operational amplifier op 1 with a non - inverting input , an inverting input and an output , wherein the inverting input receives the pwm signal and the non - inverting input is coupled to ground ; a resistor rd coupled between the non - inverting input and the output ; and a resistor rs coupled between the output and the led unit 131 . the adjusting unit 133 comprises : a power source vcc , a resistor r 2 coupled to vcc , a pmos q 2 used as a switch , a variable resistor r 3 coupled to vcc and the source of q 2 , and a resistor r 4 coupled between the sources of q 1 and q 2 . as shown in fig4 , the switch signal is applied to the gates of q 1 and q 2 such that q 1 and q 2 are not connected simultaneously . when q 1 is connected , q 2 is disconnected . at this time , a current is generated by the driving voltage v i ( i . e . the driving signal ) to flow through the led , and the led is in the light - on state . the first adjusting unit 132 uses op 1 to convert the pwm signal provided by the control unit 12 into a corresponding current and sends it to the led unit 131 , thereby generating a fine - tuning effect on the current flowing through the led . in addition , the second adjusting unit 133 feedbacks a voltage value v f ( i . e . the feedback signal ) to the control unit 12 so as to generate the corresponding driving voltage v i . compared to the first adjusting unit 132 , the second adjusting unit 133 performs a rough tuning on the led current . on the other hand , when q 2 is connected , q 1 is disconnected . at this time , the connected q 2 provides a discharge path to accelerate the discharge of the led , thereby achieving the effect of rapid switch mentioned above . fig5 is a flow chart of a preferred embodiment of the led control method according to the present invention . as shown in fig5 , the flow comprises the steps of : 51 generating a control signal to drive a led ; 52 sensing a luminous intensity value of the led ; 53 determining whether the luminous intensity value reaches a predetermined value , if yes then jumping to step 55 , otherwise proceeding to step 53 ; 54 adjusting the control signal and jumping to step 52 ; 55 determining whether the led is aging , if no then jumping to step 57 , otherwise proceeding to step 56 ; 56 waiting a first time and jumping to step 52 ; and 57 waiting a second time and jumping to step 52 . if the step 53 determines that the luminous intensity value does not reach the predetermined value , the steps 52 to 54 are executed repeatedly until the intensity value reaches the predetermined value . in one embodiment , the color of the led is one of red , green and blue , and in the step 53 , the predetermined value is generated according to the cie colorimetry . besides , if the luminous intensity value reaches the predetermined value , then the step 55 is executed to determine whether the led is aging . this determination is performed by comparing the control signal and the subsequent luminous intensity value . if the led is aging , a shorter first time is waited ( step 56 ) and then the step 52 is executed again to perform detection . if the led is not aging , a longer second time is waited before the step 52 is executed again ( step 57 ). while the present invention has been shown and described with reference to the preferred embodiments thereof and in terms of the illustrative drawings , it should not be considered as limited thereby . various possible modifications and alterations could be conceived of by one skilled in the art to the form and the content of any particular embodiment , without departing from the scope and the spirit of the present invention . | 7 |
fig1 illustrates a rectangular microwave circuit board 10 which may be tested by means of the present invention . board 10 has a rectangular shape of dimensions l × w and consists of a sheet 12 of dielectric material that has been clad with thin layers 14 , 16 of copper or other conducting material . the copper cladding 14 , 16 completely covers the top and bottom of sheet 12 , leaving it exposed only along the edges of the board . sheet 12 has thickness t that typically is in the range of 0 . 01 - 0 . 3 inches . the thickness t has been exaggerated in fig1 and is typically smaller than dimensions l and w by an order of magnitude or more . the copper cladding layers 14 , 16 typically have thicknesses in the range 0 . 0007 - 0 . 0027 inches . for practical microwave applications , dielectric sheet 12 must consist of a low loss , environmentally stable substrate . a common material is fiberglass impregnated with a polytetrafluoroethylene resin , which has a dielectric constant of about 2 . 5 . the techniques of the present invention are , however , not limited to any particular substrate . fig2 illustrates the use of microwave circuit boards in the construction of a microwave antenna . the antenna , shown in partial cross section , consists of microwave circuit boards 20 and 30 and radome 40 stacked together in a generally parallel fashion . the direction of radiation from the antenna is indicated by the arrows . microwave energy is fed to the antenna through a coaxial cable 42 which includes a central conducting element 44 . microwave circuit board 20 consists of dielectric sheet 22 and copper cladding layers 24 , 26 . similarly , board 30 consists of dielectric sheet 32 and copper layers 34 , 36 . randome 40 is typically an inert plastic material whose function is insulation . copper layer 36 of board 30 is etched in a manner dictated by the desired radiation pattern . the copper elements remaining in layer 36 after the etching process are indicated by numeral 37 . microwave energy injected via conducting element 44 travels through microwave circuit boards 20 and 30 to elements 37 , and then is radiated into space . the manner in which power from element 44 is divided among elements 37 is controlled by the etching patterns on facing copper layers 26 and 34 . these layers are commonly eteched in matching and aligned patterns , as indicated in fig2 . an important factor in antenna design is the phase delay experienced by the microwave energy in traveling from conducting element 44 to radiating elements 37 . when the wavelength of the radiation is greater than the thickness of boards 20 and 30 ( tem propagation , with the electric field perpendicular to the plane of the board ), the phase velocity through the dielectric sheet is given by : where c is the velocity of light in a vacuum , and e is the dielectric constant of sheets 22 and 32 . it is therefore apparent that unknown variations in dielectric constant can have a significant impact on antenna circuit design . while knowledge of the average dielectric constant for a board is of some value , it does not help the engineer deal with the problem of local anomalies , which , for example , could cause one of the elements 37 to be out of phase , seriously detracting from antenna performance . the present invention provides an efficient method for detecting such anomalies , before the cost of etching the copper layers has been incurred . boards that do not meet design tolerances can then be rejected or used for less critical applications . fig3 depicts in schematic form the testing of microwave circuit board 50 according to the present invention . board 50 is similar to board 10 shown in fig1 and includes a dielectric sheet 51 indicated in the cutaway portion of fig3 . the method of the present invention comprises measuring values related to the mean dielectric constant along paths 60 - 67 and 68 - 72 through sheet 51 . the measurements are made by means of microwave energy injected along the paths by transmitting horn 52 , which energy is detected by receiving horn 53 . transmitting horn 52 is illustrated schematically as including a feed element 54 and exit aperture 56 . similarly , receiving horn 53 includes entrance aperture 57 and pickup element 55 . details of a preferred horn construction are described more fully below . in fig3 transmitting horn 52 is positioned such that it is capable of injecting a beam of microwave energy edgewise into dielectric layer 51 of board 50 along path 60 , with an effective aperture or beam width b . receiving horn 53 is positioned in alignment with transmitting horn 52 , such that it is capable of receiving microwave energy traveling along path 60 with an effective entrance aperture also equal to b . the distance at which the divergence of radiation from aperture 56 begins to become significant is given by : ## equ1 ## where b is the width of aperture 56 , λ is the wavelength of the radiation , and e is the dielectric constant of sheet 51 . negligible beam divergence can be achieved by proper selection of these parameters . thus , for a board 18 inches wide having a dielectric constant of about 2 . 5 , one might choose b = 3 inches , λ = 2 / 3 inches ( 18 ghz ), giving a value for d of about 21 inches . the wavelength of the radiation is also selected so that the principal mode of propagation is tem . under such circumstances , equation 1 holds , and there is a known relationship between dielectric constant and wave velocity . to assure that the tem mode predominates , the wavelength should be greater than the thickness of sheet 51 and preferably greater than twice such thickness . for purposes of the present invention , it is assumed that knowledge of the wave velocity through a material is equivalent to knowledge of the dielectric constant of that material . after the mean dielectric constant or other appropriate value has been measured for path 60 , horns 52 , 53 and / or board 50 are repositioned such that path 61 is aligned between the horns , and a similar measurement is made . this process is repeated for paths 62 - 67 . board 50 is then rotated 90 ° with respect to the horns , and the process is continued for paths 68 - 72 . the accumulated values for rows 60 - 67 and columns 68 - 72 are then compared with one another , and the amount of variability is determined . particular comparison methods are discussed below . it is to be understood that the use of eight rows and five columns in fig3 is for illustration only , and that in general the number of rows and columns will depend upon the precision required in a particular application . for paths immediately adjacent the edges of the board ( e . g ., paths 60 , 67 , 68 and 72 ), it will at times be preferable to cover such edges with energy absorbing means ( not shown ) to prevent unwanted reflections . although not a requirement of the present invention , the use of a series of side by side paths of equal width will usually be preferred . if there are gaps between paths , then there will be a chance of missing an area containing an anomaly . overlapping paths may be used , but they require more effort and are generally unnecessary . if the board dimensions are not integer multiples of the aperture width b , then some small overlap will be needed to fully scan the board . paths may vary in width , but constant width paths are more convenient since they permit scanning of an entire board with a single pair of horns . fig4 illustrates the testing of a nonrectangular microwave circuit board 75 according to the method of the present invention . microwave energy is injected from transmitting horn 78 to receiving horn 79 along path 74 via a pair of adapter prisms 76 and 77 , respectively . the prisms are generally constructed of microwave circuit board material having a thickness and dielectric constant as close as possible to board 75 , so that reflections at the interfaces between the adapters and the board are minimized . as illustrated in fig5 adapter prisms may also be used to probe boards along nonperpendicular paths . in fig5 board 80 is tested along diagonal path 82 using prisms 83 and 84 . diagonal path testing may be especially suitable in cases where it is suspected that anomalies may be in the form of diagonal ridges . a testing apparatus according to one embodiment of the present invention is shown in fig6 . in this embodiment , signal generator 85 produces a single frequency microwave signal 86 that is routed into transmitting horn 87 . the microwave energy passes from horn 87 through the dielectric sheet of microwave circuit board 88 along path 91 , into receiving horn 89 , and the resulting transmitted signal 92 is cabled to network analyzer 94 . network analyzer 94 also receives a reference signal 96 directly from signal generator 85 . by comparison of the reference signal 96 and transmitted signal 92 , the phase delay of the microwave energy through the board is determined . this phase delay may be displayed directly to an operator . alternatively , signal generator 85 may be swept in frequency , and a graph of phase delay as a function of frequency may be produced on x - y recorder 98 . recorder 98 receives its phase delay signal 97 from network analyzer 94 , and its frequency signal 99 from signal generator 85 . network analyzer 94 computes phase delay by determining the phase difference between signal 92 and reference signal 96 . to avoid error due to the transit time of signals 86 , 92 and 96 , the phase delay is determined with reference to the delay measured with board 88 removed and horns 87 and 89 brought together so that their apertures tightly abut . the additional delay measured with board 88 in place is thus due to the phase delay through the board . this delay is related to the dielectric constant of the substrate of board 88 as follows : ## equ2 ## where φ is the phase delay , λ is the wavelength of the radiation , l is the length of path 91 , and e av is the average dielectric constant along path 91 . thus the average dielectric constant can readily be calculated once the phase delay is known . in the embodiment shown in fig6 in which dielectric constant is determined from phase delay , it is desirable to minimize the amount of reflection taking place at the interface between the horns and the board . referring to fig7 a preferred construction of the transmitting and receiving horns for phase delay measurement is shown . horn 100 comprises a section of metal - clad microwave circuit board having a thickness and dielectric constant as close as possible to those of the board to be tested . the shape of the horn is defined by linear edges 102 , 103 and 104 and parabolic edge 105 . edges 103 , 104 and 105 , and a portion of edge 102 are covered with copper tape , as indicated by crosshatch in fig7 . the portion of edge 102 which is not covered with copper tape constitutes aperture 107 . microwave energy is cabled to or from the horn through tap point 110 . the shape of parabolic edge 105 is defined by a parabola having a focal length of f and a prime focus at the apex 108 formed by extending edges 102 and 104 . with this geometry , radiation introduced at tap point 110 will arrive at aperture 107 with a flat phase front . similarly , radiation entering aperture 107 will be focused at tap 110 without phase distortion . preferred dimensions for horn 100 are : a second preferred method of carrying out the present invention is illustrated in block diagram form in fig8 . in this embodiment , signal generator 120 produces a single frequency microwave signal 122 that is cabled into transmitting horn 124 . the microwave energy passes from horn 124 through the dielectric sheet of microwave circuit board 126 along path 120 , into receiving horn 128 , and the transmitted signal 132 is routed to amplitude detector 134 . the amplitude detector sends a signal 136 to x - y recorder 140 indicative of the amplitude of the microwave signal transmitted through board 126 . x - y recorder 140 also receives a frequency signal 142 from signal generator 120 . the frequency of the signal produced by signal generator 120 is varied continuously within a range of frequencies , and the resulting amplitude vs . frequency graph is recorded on the x - y recorder . the method shown in fig8 depends upon the creation of resonance or of standing waves of microwave energy within board 126 . to produce such resonance , it is preferable that there be wave reflection at the horn / board interfaces . as is well known , such reflection can easily be achieved by mismatching the dielectric constant of the horns and board , and / or by using horns whose thickness does not match that of the dielectric layer within the board being tested . for this reason , the method shown in fig8 is preferred for very thin boards , e . g ., less than 0 . 1 inches , because of the difficulty in matching horns to such boards . the output of x - y recorder 140 will consist of a series of amplitude peaks corresponding to different resonances . for thin boards in which the thickness t of the dielectric layer satisfies where l is the length of path 120 through the board , the resonance peaks are described by ## equ3 ## where f n is the resonance frequency , c is the velocity of light in a vacuum , l is the length of path 120 , e av is the average dielectric constant along path 120 , and n is a positive integer . since successive frequency peaks will correspond to successive values for n , the dielectric constant can be determined from ## equ4 ## where δf is the peak spacing . more precise calculations can be made by repeating the amplitude versus frequency measurements for ranges of frequencies , which are whole multiples or divisions of the initial range , and thereby determining the exact resonance order of each frequency peak . for example , if a given peak had been tentatively identified as corresponding to resonance number 27 , and if the frequency of such peak was 12 . 63 ghz , then one would expect to find the ninth resonance at f / 3 or 4 . 21 ghz . failure to do so would suggest that 12 . 63 ghz corresponds to n = 26 or n = 28 , and further checking at f / 4 could select between these two values . fig9 a - h illustrate different methods of utilizing the data obtained through the present invention . referring first to fig9 a , a microwave circuit board having a nominal dielectric constant of 3 . 0 has been scanned along six paths consisting of three rows and three columns . the boundaries between adjacent paths are indicated by the dashed lines . the resulting values obtained for the average dielectric constants are indicated by the numbers written outside the board adjacent to the respective rows and columns . the numbers written within the board indicate the actual ( unknown ) variations of dielectric constant giving rise to the measured average values . as indicated , the center of the board in fig9 a contains an isolated peak of anomalously high dielectric constant . the size of the anomaly is 10 % of the nominal value for the board , a size that would make the board unsuitable for many applications . however , conventional testing techniques using a board - wide average would yield a value of 3 . 03 , a variation within the tolerances provided for many commercial boards . a simple inspection of the row and column averages produced by the present invention , however , reveals the presence of a serious problem with the board . fig9 b shows , in a format similar to that of fig9 a , a microwave circuit board in which the anomaly consists of a vertical ridge of high dielectric constant , the anomaly again being 10 % of the nominal value for the board . as in the case of fig9 a , the techniques of the present invention provide considerably more information about the suitability of the board for a given application . three rows and three columns have been used in the above examples for purposes of simplicity of illustration . in most instances , measurements of mean dielectric constant will be made over a greater number of paths , and more systematic methods for numerical processing are therefore desirable . in one preferred method , the dielectric constant for a particular subsection of the board is calculated by taking the arithmetic average of the row and column measurements corresponding to the subsection . symbolically , if e ij is the estimated dielectric constant for the subsection consisting of the intersection of row i and column j , then ## equ5 ## where r i is the measured average dielectric constant for row i , and c j is the corresponding quantity for column j . application of this formula to the values shown in fig9 a and 9b yields , respectively , the dielectric constant estimates shown in fig9 c and 9d . in both cases , the shape of the anomaly has been accurately portrayed . if it is believed that an anomaly consists of a single peak , then an improved method of estimation is : ## equ6 ## where e 0 is a nominal or most common value , and where m and n are the number of rows and columns respectively . if e 0 is taken to be 3 . 0 in fig9 a and 9b , then the results of applying this method are shown in fig9 e and 9f , respectively . as may be observed , the magnitude of the anomaly in fig9 a has been fully preserved in fig9 e . a third method of data handling is based on a cross - product or geometric average technique , and is represented by the formula : ## equ7 ## where e a is the average measured dielectric constant for the entire board . the results of applying this method to the boards of fig9 a and 9b are shown respectively in fig9 g and 9h . this approach completely reproduces the ridge anomaly of fig9 b . referring now once again to the phase delay method of fig6 the length of path 91 through the board will usually be greater than the effective wavelength of the radiation traveling along the path . in this case , phase delay can be expressed as where φ a is the actual phase delay , φ m is the phase delay measured by network analyzer 94 , and n is a positive integer . in general n is unknown , and thus there is an ambiguity in the determination of φ a . this ambiguity may be removed by measuring phase delay at a number of different frequencies , or by measuring it over a continuous range of frequencies using x - y recorder 98 , and comparing the results . in many cases , this can be a time - consuming process , and a technique for simplifying the determination of phase delay is desirable . a preferred method and apparatus for making phase delay measurements in accordance with the present invention is illustrated in fig1 and 11 . in this method , two phase delay measurements are made simultaneously ; one through the board , and a second through a reference path chosen to produce a known phase delay close to that of the board path . by subtracting the two phase delay measurements , the ambiguity discussed above is eliminated or greatly reduced . referring now to fig1 , the apparatus comprises a base 150 upon which arm 156 is pivotally mounted by pin 157 . microwave horns 158 and 160 are mounted respectively within slots 164 and 168 by mounting pins 159 and 161 , such that the horns are free to move longitudinally along slots 164 and 168 , but are not free to rotate . mounting pins 159 and 161 also pass through slots 162 and 166 respectively in arm 156 . microwave horns 152 and 154 are rigidly mounted to base 150 such that their central axes are aligned with slots 164 and 168 , and their apertures are aligned one under the other along line 153 . as a result of the described construction , horns 158 and 160 are constrained to move along parallel paths , defined by slots 164 and 168 , and to lie on the line defined by arm 156 . as arm 156 is rotated about pivot 157 , the board path length 172 between horns 152 and 158 will always be in a fixed ratio to the air path length 174 between horns 154 and 160 . depending on construction details , it may be desirable to raise horns 154 and 160 , such that path 174 is never blocked by board 155 . in operation , a microwave circuit board 155 to be tested is inserted between horns 152 and 158 , arm 156 is swung leftward so that the horns bear tightly against board 155 . referring now to fig1 , a single frequency microwave signal 182 is generated by signal generator 180 and cabled to power splitter 184 . the power splitter divides signal 182 into two equal output signals 186 and 188 , which signals are cabled to transmitting horns 152 and 154 , respectively . the radiation from horn 152 passes through microwave circuit board 155 along path 172 into receiving horn 158 , and the radiation from transmitting horn 154 passes along air path 174 into receiving horn 160 . the resulting received signals 190 and 192 are then combined in mixer / network analyzer 194 . the output of mixer / network analyzer 194 is a signal 196 whose amplitude is proportional to the phase difference between signals 190 and 192 . phase difference signal 196 along with frequency signal 200 are passed to x - y recorder 198 , which records the phase difference as a function of frequency . apparatus 150 is constructed such that the fixed ratio of the length of air path 174 to the length of board path 172 is equal to the square root of the nominal or average dielectric constant of board 155 . referring to equation ( 3 ), the result will be that the phase delay along paths 172 and 174 will be nearly equal , and the phase difference δφ measured by signal 196 will be small . thus , the ambiguity indicated by equation ( a ) will be eliminated or greatly reduced . since the phase delay along path 174 is known , the average dielectric constant along path 172 can easily be determined from the measured phase difference δφ . in particular , if subscripts 1 and 2 refer to paths 172 and 174 respectively , and if l 1 and l 2 are the lengths of paths 172 and 174 measured between the respective horn apertures , then : ## equ8 ## since e 2 = 1 . for a nominal dielectric constant of 2 . 56 , one would set l 2 =√ 2 . 56 l 1 = 1 . 6l 1 , and obtain : ## equ9 ## it will be understood that the invention may be embodied in other specific forms without departing from the spirit or central characteristics thereof . the described embodiments , therefore , are to be considered in all respects as illustrative , and the invention is not to be limited to the details thereof , but may be modified within the scope of the following claims . | 6 |
various embodiments are provided and described in detail as follow . the embodiments are merely described for being an example , but do not limit the scope of the present invention . in addition , in order to clearly show the technical features of the present invention , parts of elements are omitted in the drawings of the embodiments . refer to fig1 . fig1 is a perspective view of a uav 100 according to an embodiment of the present invention . the uav 100 includes a fuselage 110 , a plurality of landing gears 121 , 122 , 123 and 124 , a plurality of whirl wing structures 130 , a 3d image recognition system 140 and a plurality of distance sensing units 150 . the 3d image recognition system 140 may be disposed on the bottom of the fuselage 110 for obtaining a depth image of a scene , and may be capable of capturing a 2d image of the scene . the landing gears 121 , 122 , 123 and 124 and the whirl wing structures 130 are assembled together and disposed on the fuselage 110 . each of the landing gears 121 , 122 , 123 and 124 may respectively correspond to one of the whirl wing structures 130 . the distance sensing units 150 , such as the infrared sensors , are used to obtain a height information of the landing position and respectively disposed on the landing gears 121 , 122 , 123 and 124 . the landing gears 121 , 122 , 123 and 124 with a telescopic function may be specifically designed as screw rods , sleeves and so on , which are controlled to lengthen or shorten by an element such as a stepping motor . the numbers of the landing gears , the whirl wing structures and the distance sensing units of the uav 100 as shown in fig1 are all four , but the present invention does not limit thereto . the numbers of the landing gears , the whirl wing structures and the distance sensing units may be three or more than four . refer to fig2 . fig2 is a block diagram of the uav 100 according to an embodiment of the present invention . the uav 100 further includes a processing unit 202 and a storage unit 206 . the storage unit 206 is used to store the height information of the landing position obtained from the distance sensing units 150 , such as a memory . the processing unit 202 is coupled to the 3d image recognition system 140 and the storage unit 206 for determining a landing position in accordance with the depth image obtained from the 3d image recognition system 140 . in addition , the processing unit 202 may further control and adjust the length of each of the landing gears 121 , 122 , 123 arid 124 respectively in accordance with the height information stored in the storage unit 206 . the processing unit 202 may be , for example , a microprocessor or a microcontroller . refer to fig3 . fig3 is a flow chart of a landing method of the uav according to an embodiment of the present invention . in the present embodiment , the uav 100 of fig1 - 2 is exemplarily used for describing these steps of flow process . in step s 1 , the 3d image recognition system 140 obtains a depth image of a scene . the 3d image recognition system 140 may capture 2d images of different scenes , and perform processing to the 2d images to obtain a depth information of the 2d image , so as to obtain the depth image of the scene . refer to fig4 and 5 . fig4 is a part of flow chart of the landing method of the uav according to another embodiment of the present invention . fig5 is a schematic diagram of a 2d image according to another embodiment of the present invention . for instance , in step s 11 , the image capturing unit in the 3d image recognition system 140 ( such as a camera or a video camera ) captures a 2d image i of the scene . the image capturing unit may capture the 2d image i of the scene in accordance with different shooting angles ( e . g ., swinging the lens of the image capturing unit ) and shooting ranges ( e . g ., controlling the lens of the image capturing unit to zoom in or zoom out ). next , in step 512 , the 3d image recognition system 140 divides the 2d image i into a plurality of regions , such as region a 1 , region a 2 , region a 3 and region a 4 . in one embodiment , the number of the regions being divided may correspond to the number of the landing gears of the uav . in step s 13 , the 3d image recognition system 140 obtains depth values of all pixels in each of the regions a 1 , a 2 , a 3 and a 4 . for example , in region a 1 , there are pixels a 11 , a 12 , . . . , a 1 n contained therein . the 3d image recognition system 140 may depend on the color depth in each of the pixels a 11 , a 12 , . . . , a 1 n to recognize and obtain corresponding depth values d 1 n of all the pixels a 11 , a 12 , . . . , a 1 n , wherein n is an integer equal to or larger than 1 . in step s 14 , the 3d image recognition system 140 calculates average depth values respectively corresponding to each of the regions a 1 , a 2 , a 3 and a 4 to obtain the depth image . in case of region a 1 the 3d image recognition system 140 calculates average values of all the depth values d 1 n to obtain an average depth value d 1 of region a 1 . on this basis , the 3d image recognition system 140 respectively calculates average depth values d 2 , d 3 and d 4 of the regions a 2 , a 3 and a 4 , so as to obtain the depth image of the captured scene . refer to fig3 . after the step s 1 of obtaining the depth image of the scene , the method proceeds to step s 2 . in step s 2 , the processing unit 202 determines a landing position in accordance with the depth image . refer to fig4 . in step s 21 , the processing unit 202 obtains a maximum average depth value d max and a minimum average depth value d min from the average depth values d 1 , d 2 , d 3 and d 4 of the regions a 1 , a 2 , a 3 and a 4 , respectively . for instance , among the four regions a 1 , a 2 , a 3 and a 4 , the average depth value d 3 of the region a 3 is the maximum , while the average depth value d 1 of the region a 1 is the minimum . as a result , d 3 is the maximum average depth value d max , and d 1 is the minimum average depth value d min . in step s 22 , the processing unit 202 subtracts the minimum average depth value d min from the maximum average depth value d max to obtain a difference value d diff = d 3 − d 1 . in step s 23 , the processing unit 202 determines whether the difference value d diff is smaller than a threshold value . when the processing unit 202 determines that the difference value d diff is smaller than the threshold value , the method proceeds to step s 24 , that is , the processing unit 202 determines to land the uav on the landing position . when the processing unit 202 determines that the difference value d diff is larger than the threshold value , the processing unit 202 determines the 3d image recognition system 140 to re - obtain a depth image of a scene , that is , the method proceeds back to step s 1 to search for a suitable landing position . in one embodiment , the threshold value of step s 23 may be a maximum telescopic length of each of the landing gears 121 , 122 , 123 and 124 . that is , before landing , the uav will first search for a suitable landing position where the uav can land steadily . if the first found landing position has a level drop that is larger than a maximum telescopic length of each of the landing gears 121 , 122 , 123 and 124 so that the uav cannot keep a balance or may even topple over , the uav will continue to find another landing positions . refer to fig2 . after the step s 2 of determining the landing position in accordance with the depth image , the method proceeds to step s 3 . in step s 3 , the distance sensing units 150 obtain a height information of the landing position , and store the height information in the storage unit 206 . in one embodiment , when determining to land the uav on the landing position , the processing unit 202 orders the uav to fly to the landing position , and aims each of the landing gears 121 , 122 , 123 and 124 to correspond to each of the regions a 1 , a 2 , a 3 and a 4 . in this embodiment , the distance sensing units 150 are , for example , infrared sensors for sensing distance . the distance sensing units 150 are respectively disposed in the landing gears 121 , 122 , 123 and 124 for obtaining a height information of the landing position corresponding to each of the regions a 1 , a 2 , a 3 and a 4 . the infrared sensor includes an emitting end for emitting an infrared light to the ground and a receiving end for receiving the infrared light reflected from the ground . during the traveling of the infrared light , an energy attenuation will be generated . the infrared sensors may respectively obtain current heights relative to the ground of each of the landing gears 121 , 122 , 123 and 124 according to the energy attenuation , so as to obtain the height information of the landing position , and store the height information in the storage unit 206 . next , after the step s 3 of obtaining the height information of the landing position , the method proceeds to step s 4 . in step s 4 , the processing unit 202 adjusts a plurality of relative distances of the landing gears 121 , 122 , 123 and 124 relative to the landing position in accordance with the height information to make the relative distances substantially the same . in one embodiment , the processing unit 202 may lengthen or shorten the length of each of the landing gears 121 , 122 , 123 and 124 respectively in accordance with the height information stored in the storage unit 206 to make the relative distances of the landing gears 121 , 122 , 123 and 124 substantially the same . next , after the step s 4 of adjusting the relative distances of the landing gears 121 , 122 , 123 and 124 relative to the landing position , the method proceeds to step s 5 . in step s 5 , the processing unit 202 orders the uav 100 to land on the landing position . because the relative distances of the landing gears 121 , 122 , 123 and 124 relative to the landing position have been adjusted substantially the same in the step s 4 , the processing unit 202 may order the uav 100 to land in such a straightly downward way that the landing gears 121 , 122 , 123 and 124 can touch the ground simultaneously to keep the balance during landing . fig6 a - 6c are schematic diagrams showing the landing of the uav according to an embodiment of the present invention . fig6 a - 6c are exemplarily used for describing the landing process of the steps s 3 to s 5 . in the present embodiment , the uav 100 of fig1 - 2 is exemplarily used for describing these steps of landing process . refer to fig6 a . when the uav 100 confirms a landing position 10 , the distance sensing units 150 respectively disposed on the landing gears 121 , 122 ( not shown ), 123 and 124 obtain a height information of the landing gears 121 , 122 , 123 and 124 on the landing position 10 . for example , heights relative to the ground h 1 , h 3 and h 4 of each of the landing gears 121 , 123 and 124 measured by the distance sensing units 150 on the landing gears 121 , 123 and 124 are 140 cm , 200 cm and 160 cm , respectively . the heights relative to the ground h 1 , h 3 and h 4 are used as the height information of the landing position 10 . refer to fig6 b . after the distance sensing units 150 obtain the height information of the landing position 10 , the processing unit 202 depends on the height information to shorten the length l 1 of the landing gear 121 by 10 cm , and respectively lengthen the lengths l 3 and l 4 of the landing gears 123 and 124 by 50 cm and 10 cm . therefore , the relative distances of the landing gears 121 , 123 and 124 relative to the landing position 10 are adjusted to be equal to each other ( i . e ., 150 cm ). refer to fig6 . after adjusting the relative distances of the landing gears 121 , 123 and 124 relative to the landing position 10 , the processing unit 202 controls the uav 100 to fly downwards by 150 cm on the landing position 10 . finally , the landing gears 121 , 123 and 124 may touch the ground simultaneously without losing balance when the uav 100 lands . in the landing method of the uav disclosed in above embodiment of the present invention , the uav will first search for a suitable landing position before landing , so as to prevent itself from toppling over resulted from the larger level drop while being landing . after finding the suitable landing position , the uav of the present invention will obtain a height information of the landing position , and then adjust the landing gears in accordance with the height information , and finally land on the landing position . therefore , the uav can prevent from toppling over resulted from late calculation of gravity . moreover , in the step of correspondingly adjusting the landing gears in accordance with the height information , the relative distances of the landing gears relative to the landing position are made all the same . thus , when the uav is controlled to land in a straightly downward way , the landing gears can not only touch the ground simultaneously to keep the balance , but also prevent itself from toppling over in the case that any landing gears have not touched the ground while being landing . while the invention has been described by way of example and in terms of the preferred embodiment ( s ), it is to be understood that the invention is not limited thereto . on the contrary , it is intended to cover various modifications and similar arrangements and procedures , and the scope of the appended claims therefore should be accorded the broadest interpretation so as to encompass all such modifications and similar arrangements and procedures . | 7 |
referring now to the drawings and , in particular , fig1 through 3 the heart of the present invention is the ata 10 , which is a rigid device with a tall end 11 and a short end 20 . the tall end 11 houses several of the ports that are needed to enable the numerous functions of the invention . an led light 12 provides a visual display of the current power and operational state of the ata 10 . the reset button 17 , when depressed by a user , shuts down and then immediately restarts the ata 10 . two usb ports 13 , 14 perform the function of providing data input / output as well as power input to the device . an ethernet port 15 allows an ethernet cord to be directly connected to the ata 10 so that the invention can be used without a computer with internet access . the telephone jack 16 is where the ata 10 can receive a connection from an analog telephone handset . the short end 20 of the invention contains a wi - fi adapter port 23 . in order to enable the ata 10 to employ a wi - fi internet connection to utilize voip service , a wi - fi adapter 24 must be inserted into the wi - fi adapter port 23 . when the wi - fi adapter 24 is fully engaged with the wi - fi adapter port 23 , the ata will search for available wi - fi networks and connect to an available wi - fi network . referring now to fig4 , the control circuitry 25 in the ata 10 contain several key components , all of which is mounted on to a platform . the heart of the circuitry components is the central processor 25 . the ata 10 also requires a random access memory component , an nic component , and a storage medium component . in addition , the storage medium will contain the necessary software to perform the basic voip operations , including codec , slic , and sip . each of these components connect work through the processor and the various ports depending upon a particular input from the internet and output to the internet that will be achieved from the physical connection to an analog telephone handset . referring now to fig5 , the basic telephone voip system is shown that includes an analog telephone handset 30 as one would find in the conventional residence or even commercially . the analog telephone handset 30 is connected to the ata 31 through the ata &# 39 ; s 31 telephone port ( rj 11 or compatible ). the ata 31 is shown connected to a computer 32 through a usb cord that is connected to the computer 32 and to the usb port on the ata 31 . the computer 32 is shown wired to a modem 33 ( or router , modem / router combination device and / or a switch ), which the computer is using to obtain access to the internet . the ata 31 receives power and accesses the internet through the computer &# 39 ; s 32 existing power supply and internet access and is able to provide voip service through the computer &# 39 ; s 32 internet connection . when the voip system is configured in this way , a user is able to place and receive telephone calls nationwide without the analog telephone headset 30 being wired through a pstn . referring now to fig6 , the voip system that does not require a computer is shown that includes a basic analog telephone handset 40 . the analog telephone handset 40 is connected to the ata 41 through the ata &# 39 ; s 41 telephone port ( rj 11 or compatible ). the ata 41 is shown connected to a usb electric plug adapter 42 through a usb cord that is plugged into one of the ata &# 39 ; s 41 usb ports . the usb electric plug adapter 42 allows the ata 41 to receive electrical power without a computer connection . the ata 41 is also shown connected directly to a modem 43 ( or router , modem / router combination device and / or a switch ) with a ethernet cord ( rj 45 or compatible ) plugged into its ethernet port . this allows the ata 41 to access the internet through the modem 43 without a computer connection . the ata 41 is able to utilize a direct connection to the internet through the ata &# 39 ; s 41 nic component , which is similar to the nic component found in computers . when the voip system is configured in this way , a user is able to place and receive telephone calls nationwide without the analog telephone handset 40 being wired through a pstn and even without a wired connection to a computer . referring now to fig7 , the voip system that does not require a computer is shown that includes a basic analog telephone handset 50 . the analog telephone handset 50 is connected to the ata 51 through the ata &# 39 ; s 51 telephone port ( rj 11 or compatible ). the ata 51 is shown connected to a usb electric plug adapter 52 through a usb cord that is plugged into one of the ata &# 39 ; s 51 usb ports . the usb electric plug adapter 52 allows the ata 51 to receive electrical power without a computer connection . the ata 51 is also shown exchanging wireless signals with a wireless router 53 . this facilitates the ata 51 to access the internet wirelessly through the wireless router 53 without a computer connection or even a wired connection to a modem , router , modem / router combination device and / or a switch . the ata 51 is able to connect to the wireless signal through the ata &# 39 ; s 51 wi - fi adapter and the ata 51 utilizes the connection to the internet through the ata &# 39 ; s 51 nic component , which is similar to the nic component found in computers . when the voip system is configured in this way , a user is able to place and receive telephone calls nationwide without the analog telephone handset 50 being wired through a pstn and even without the a wired connection to a computer or a modem . referring now to fig8 , the voip system that does not require a computer is shown that includes a basic analog telephone handset 60 . the analog telephone handset 60 is connected to the ata 61 through the ata &# 39 ; s 61 telephone port ( rj 11 or compatible ). the ata 61 is shown connected to a usb electric plug adapter 62 through a usb cord that is plugged into one of the ata &# 39 ; s 61 usb ports . the usb electric plug adapter 62 allows the ata 61 to receive electrical power without a computer connection . the ata 61 is also shown connected to a cell phone 63 through a usb cord that is plugged into one of the ata &# 39 ; s 61 usb ports . when configured in this manner , the ata 61 can access the internet through the cell phone &# 39 ; s 63 internet connection . generally , it is through a cell phone &# 39 ; s 63 connection to the cell phone tower 64 , whether the connection is of a gsm , cdma , or evdo standard , that the cell phone is able to obtain access to the internet . however , the ata 61 can also access the internet through the cell phone 63 if the cell phone is connecting to the internet through an available wi - fi or wimax signal . either way , this configuration provides the most flexibility in terms of location and facilitates the ata 61 to access the internet wirelessly cell phone 63 without a computer connection , a wired connection to a modern , router , modem / router combination device and / or a switch , or even a nearby wi - fi signal . when the voip system is configured in this way , a user is able to place and receive telephone calls nationwide without the analog telephone handset 60 being wired through a pstn and even without the a wired connection to a computer or a modem , or even a wlan nearby . referring now to fig9 the system is shown set up to have the analog phone 70 connected to ata 71 to include the wi - fi device 72 and a series of power adapters 73 , 74 , and 75 which are power connector adapters . the instant invention has been shown and described herein in what is considered to be the most practical and preferred embodiment . it is recognized , however , that departures may be made therefrom within the scope of the invention and that obvious modifications will occur to a person skilled in the art . | 7 |
as already indicated in the general summary , and by fig2 and 3 of the drawings , the construction member 20 of the invention is basically a shallow , channel - shaped member which may be assembled vertically with others to form a wall , as in fig2 or assembled horizontally with others to form a ceiling , as in fig3 . the preferred fabrication of the construction member is indicated diagramtically by fig1 with modification and further detail shown in fig4 to 6 inclusive . fig7 to 12 show erection details which will orient those skilled in the art and serve also to illustrate to them the time and cost savings to be had from use of the invention . referring to fig1 in particular , the upper part of the drawing shows a flat board member 20 which could be a 4 - foot wide or a 2 - foot wide gypsum board sheet , having two v - shaped grooves 22 , the sides of which are perpendicular to each other and the vertex of which is parallel to the long edge of the sheet . the grooves are spaced inwardly from the edges of the board a distance approximately equal to the desired depth of the flanges 24 to be formed by bending up the narrow side portions of the sheet along the vertices of the v - grooves , and define between them the panel portion 26 of the board . the v - shaped grooves may either be milled in a panel of otherwise conventional fabrication , or otherwise formed by cutting tools if not milled , or , in the case of gypsum board , may be formed as part of the board in its initial fabrication . in either case , the v - grooves thus milled , cut or otherwise formed leave intact a sufficient thickness of the paper skin or other laminate on the side of the board 20 opposite the groove to serve as a hinge about which to form the construction member 28 by bending up the flanges 24 as indicated by the transition between the upper and lower portions of fig1 of the drawings . an adhesive applied to the v - groove at or before the time of the bending up of the flanges , secures the flanges to the panel portion 26 of the construction member 28 in the perpendicular arrangement indicated in the lower portion of fig1 and in subsequent drawings , the bond being sufficient to enable the flanges to materially stiffen , i . e ., to enhance the longitudinal bending strength of , the member . while the two - step fabrication of fig1 is preferred in order to permit shipment of the member as a flat &# 34 ; blank &# 34 ; to be subsequently formed up at the erection site or at some intermediate station close to the job , i have contemplated , and have so indicated by fig4 the possibility of casting integrally flanged gypsum board , instead of forming by the v - notch , fold - up procedure . i have not , however , actually fabricated any construction members by that procedure , and believe , as far as gypsum board is concerned , that shipment of the gypsum board sheet as a pre - grooved but unfolded or flat blank is preferable to facilitate the handling and to minimize the damage to be expected from shipment and trans - shipment in the channel - shaped form . in fig5 i show the gypsum board blank 20 grooved to the depth of the gypsum filler 30 between the customary paper lamina 32 and 34 on opposite sides thereof . in addition , and by way of example only , i have shown on the notched side of the sheet which becomes the interior in contemplated wall construction assembly an optional additional lamina 36 , which may , for example , be a metal foil where a vapor barrier is desired , as in the exterior wall construction shown in cross section in fig7 . the paper skin 34 on the lower side of the sheet , which becomes the outside , or the &# 34 ; dress &# 34 ; side , when the flanges 24 are folded up , is left intact by the grooving , and may also have an optional layer 38 of a prefinishing material such as vinyl . to fabricate the construction member 28 from the grooved blank of fig5 a viscous liquid adhesive , such as sta - stuck ss - 2000a , manufactured by specialty chemicals company of elk grove village , ill , is deposited in the v - grooves in sufficient quantity to provide a slight exuded fillet 40 when the flanges 24 are folded up , as indicated in the lower portion of fig . 5 , and a sufficient waiting period allowed , of the order of 15 minutes , for the adhesive to set up before further handling . if desired for greater strength when using sheet of lighter gauge , e . g ., one - half inch , the mitered joint may be reinforced at intervals with glue blocks on the inside of the corner . fig6 illustrates a form of treatment of a gypsum board blank 20 &# 39 ; to provide v - grooves during the process of manufacture of the board . in this instance , the upper paper layer 32 of the board is formed into a v - shaped groove 22 &# 39 ; penetrating the gypsum filler 30 &# 39 ; while the gypsum is still in a fluid state , with suitable provision for the retention of the penetration until the gypsum filler has set up . the fig6 arrangement contemplates the application of a contact adhesive 42 to both walls of the v - grooves 22 &# 39 ; and to the upper surface of the board 20 &# 39 ; along a narrow margin flanking the grooves , all covered by a releasable protective &# 34 ; peel &# 34 ; tape 44 . the arrangement of fig6 would greatly increase the handleability of the construction member and greatly facilitate the erection of the flanges 24 &# 39 ; into stable bracing arrangement with the panel portion 26 of the construction member on the job site . the illustrative sample of fig . 6 also shows an optional interior laminate 36 &# 39 ; of a vapor barrier such as foil , and the optional exterior laminate 38 &# 39 ; such as a decorative vinyl . comparing the two corner treatments of fig5 and 6 , it will be noted that the paper - lined groove of the fig6 modification produces a slightly larger outside radius at the corner of the construction member when the flange is bent into place . to compensate for the additional paper material packed into the joint particularly at or near the folding axis , the v - groove is preferably made slightly larger than 90 ° so that when the flange 24 &# 39 ; is folded up , and the two walls of the groove brought into contact , the flange 24 &# 39 ; will be perpendicular to the panel portion 26 &# 39 ; of the construction member . the basic plan for the application of the construction member of the invention to wall construction , as already indicated , is shown in fig2 i . e ., with the construction members 28 standing vertically in butted , side - by - side relation on both sides of the wall , and with the studs formed by their flanges 24 interspersed so that the studs integral with one side of the wall are in touching bracing contact with the panel portions 26 of the construction members of the opposite side . the adaptation of this basic assembly plan to exterior wall construction is illustrated in fig7 . for exterior wall construction the sheet material of the outside members is preferably one of greater structural strength , such as wood . in fig7 the construction members 46 which constitute the outside of the wall are shown as formed from plywood sheet 48 , but for this application particle board is also suitable . in this instance , i show the exterior construction members as sheathed with an outer lamina 50 of metal which may be either steel or aluminum , and preferably prefinished . adjacent exterior members 46 are abutted in line preferably with an application of caulking material at the joints , and then fastened together , as indicated , by hardened wood screws driven through the abutting flanges 52 . the construction members 28 for the inside of the exterior wall are of gypsum board and placed in abutting aligned relation with the studs formed by their adjacent flanges 24 interspersed between those of the outer panels . they are screwed top and bottom to plate members , not shown , in the manner later to be described in connection with interior wall construction . gypsum board used in this manner , i . e ., as the inner face of an exterior wall , will preferably have an inner layer 36 of a vapor barrier material , and the void between the interior and exterior construction members filled with insulation 54 . for its utility as a bonding material as well as in providing highly efficient thermal insulation , i contemplate the ultimate use of a freon - blow low - density , foamed , rigid polyurethane , with suitable provision in the top plates of the wall for the pouring of the material from portable equipment in the field , and with fixtures as necessary to prevent the &# 34 ; oil canning &# 34 ; of the panels as the polyurethane expands and sets up . the detailing of the utilization of the construction members of the invention for interior wall construction , and as ceilings , is illustrated in fig8 to 12 inclusive . as in typical dry - wall construction in commercial buildings , an interior wall ( fig8 ) is positioned by locating a channel - shaped floor track 60 along the intended axis of the wall . such channels are usually roll - formed sheet steel in light gauge , easily penetrated by self - drilling , self - tapping screws , and are secured in place , openside up , by powder - driven nails 62 , such as ramset , or by tempered concrete nails , driven through the web of the channel or &# 34 ; floor track &# 34 ; into the floor 64 . a hemmed ceiling track 66 of similar but wider channel shape and having smooth , hemmed , rounded edges on its flanges , is plumbed with the floor track 60 and secured by screws to the ceiling 68 , with the track open downwardly . the flanges 24 of the gypsum - board construction members 28 are cut off at their lower ends 70 sufficiently to clear the floor track and to permit use of the track as raceway for electricl conduit . one side of the wall is then assembled by inserting the construction members 28 into the ceiling track , and abuttng them to the floor track , to which they are secured with screws 72 driven through the panel portion 26 of the construction member along its bottom edge , as indicated in fig8 . with one side of the wall , or a substantial portion thereof , assembled , the opposite side is then applied , and secured in place in the same manner . the flanges of the ceiling track 66 provide the upper trim of the wall , and the power - driven screws 72 by means of which the construction members are secured to the floor track are concealed by the application of a base molding 74 , usually molded vinyl , after the erection of the wall . the starting of a wall , where it adjoins another wall with an inside corner on both sides , is illustrated in fig9 . in such case , and in addition to the laying of floor and ceiling track as described in connection with fig8 a hemmed track 76 is secured vertically to the existing wall 78 on the desired axis of the new partition wall and lightly secured in place in any convenient manner , as for example by a pair of spaced self - tapping screws . a flanged gypsum board construction member 28 is then set into place within the hemmed wall track 76 and a sheet metal stud 80 is placed against the inside surface of the flange 24 of the gypsum board construction member 28 , and screwed to the existing wall 78 at several levels by pairs of power driven screws 82 as indicated in fig . 9 , leaving sufficient space , however , for the subsequent insertion of the cut edge 84 of the panel portion 26 of the construction member 28 on the opposite side of the wall . fig1 , as earlier indicated , is a fragmentary horizontal section which illustrates doorway framing occurring randomly with respect to the joints between adjacent construction members . the doorway is cut at the desired location which will have been predetermined by a gap in the floor track 60 of width to accommodate the door jamb 90 . a sheet metal stud 92 is then inserted between the panel portions 26 of the gypsum board on opposite sides of the wall , and the cut ends 94 thereof are secured to the stud by screws 96 . the sheet - metal door jamb 90 may be of wall - gripping press - on type , with integral doorstop 98 , outer trim 100 , and return anchor portions 102 . the detailing of an exposed corner of an interior partitioning is illustrated in fig1 , which is also a fragmentary horizontal section . in this instance , it is assumed that the section of wall 106 extending vertically in fig1 was completed first . the construction member 108 on the inside of the corner is secured to a sheet - metal stud 110 having a corner molding 112 riveted to one of its flanges , by means of screws driven 114 through the panel of the interior construction member 108 and into the stud . the end panel 116 of the outside of the existing wall has its cut edge seated in the channel of the corner molding 112 , which is secured to the stud . the cornering wall 118 is then started by abutting the flange 24 of the construction member 122 on the inside of the new wall against the construction member 108 on the inside of the existing wall , with their edges flush , and securing the beginning construction panel 122 of the new wall to the end stud of the existing wall by means of self - tapping screws 124 , driven through the double thickness of the gypsum board and into the flange of the stud 110 . the outside side of the cornering wall is then started by the insertion of the cut edge of the cornering outer construction member 126 into the space between the corner molding 112 and the end of the existing wall 106 . ceiling installation is indicated by fig1 , a particularly suitable application being relatively long and narrow ceilings such as in corridors and the like . in such applications , the long dimension of the construction member 28 is placed transversly of the passageway , with the construction member unsupported between its ends , which rest upon sheet metal angles 130 secured to the adjacent wall 132 by means of screws . hallway ceilings are quite typically lower than those of the adjacent spaces for the accommodation of duct work for utilities supplied to the privately occupied adjacent spaces , and the construction member 28 of the invention is especially suited to use in so - called &# 34 ; dropped &# 34 ; ceilings , of which corridors and passageways are a typical occurrence . in such cases , as indicated in fig1 , the ends 134 of the upstanding flanges 24 of the individual construction members are relieved at an angle to permit the insertion of the member diagonally into the space above its intended level , the resting of one of its ends upon the supporting angle or other support while still positioned diagonally , and then the rotation of the opposite end of the panel down onto its support . in ceiling application , the construction members are preferably connected together for mutual support , this being accomplished by the driving of screws 136 through abutted upstanding flanges of adjacent members , with the omission of such screws at intervals where desired for access to the overlying space . for spaces larger than corridors , the same arrangement is equally feasible but in such case the intermediate support consists of suspended track which is typically rail - shaped , i . e ., with horizontal flanges on opposite sides of the track and with aperatures at intervals in the web of the track for the suspension of the same by means of stiff wire from a preexisting ceiling , or other overhead structure . the saving of erection time , labor and cost which i have experienced utilizing the construction member of the invention as described in detail in the foregoing specification has been substantial resulting not only from the substantial elimination of studding and framing time , but also the elimination of the need to secure the gypsum board to studs . moreover the decorating of walls and ceilings made in the manner described is much simplified from existing conventional dry - wall practice , particularly by the elimination of the necessity for taping and spackling seams between adjacent wall board panels . these savings may further be enhanced by precladding the dress side of the construction member with an eye - pleasing finishing surface such as vinyl , but even in the simplest , paper - surface form , the walls after erection are ready for painting without requiring the time - consuming and costly patching which has been a necessary incident of existing dry - wall construction practice . the features of the invention believed new and patentable are set forth in the appended claims . | 4 |
for convenience , in the following description like numerals refer to like structures in the drawings . [ 0016 ] fig2 illustrates a circular buffer architecture , represented generally by the numeral 20 . the circular buffer 20 is partitioned into three distinct sections . the first section 22 is for pre - processed symbols , the second section 24 is for present symbol processing , and the third section 26 is for post - processed symbol extraction . a symbol manager 28 is used for managing the locations of these symbols . the buffer 20 may include an elastic region that is able to absorb data growth or depletion due to differences in rates of the three devices ( output device , input device , and processor ) that use the buffer 20 . this region may hold up to one symbol , and may be located within the first section 22 . [ 0018 ] fig3 illustrates a simd architecture , represented by the numeral 36 . the architecture 36 includes a pcu 12 , multiple data paths 13 , multiple data memories 14 and multiple processors 15 . the architecture also includes enable signals 32 , coupled to the processors 15 . referring to fig2 data is typically input serially into the pre - processed section 22 . once the data has been received , it is rotated to the present symbol processing section 24 , where it is parallel - processed . once the processing is complete , the symbol is rotated to the post - processed section 26 of the buffer 20 , where it is output serially . although the symbol is rotated through several sections of the buffer 20 , its physical location does not necessarily chance . changing the location of the symbol can be done ; however , it would require more time and more memory . maintaining the same location for a particular symbol is accomplished since the buffer 20 is circular . rather than have the address of the symbol physically rotate , the sections 22 , 24 , and 26 of the buffer 20 rotate about predetermined addresses . therefore , an address that points to an incoming symbol is in the pre - processed section 22 . once the symbol has completely arrived and is being processed , the address that points to that symbol is in the processing section 24 . once the symbol has been processed , that address is considered to be in the post - processed section 26 . the symbol manager 28 locates the base address for each of the symbols , allowing the circular nature of the buffer 20 to be transparent to each device accessing the data . the input data enters the buffer 20 at an arbitrary data rate . the data is loaded sequentially into the pre - processed section 22 until a complete symbol is collected . at that point , the symbol manager 28 advances to the next base pointer location . ( as an added feature , the address generation unit can access the buffer 20 directly with the address offset from the processor without the addition of the base address from the symbol manager 28 , by way of a switch . this allows the processor 15 to bypass the symbol manager 28 and access the buffer 28 absolutely .) the pcu 12 indicates the start of a processing cycle with a start of processing ( sop ) pulse . at each sop pulse , the base pointer for the processing section 24 is compared to the base pointer for the incoming symbol ( in the pre - processed section 22 ). the difference between these base pointers indicates whether or not a full symbol is ready for processing . if a full symbol is present , the enable signal 32 ( shown in fig3 ) for that symbol is activated . otherwise , the enable signal 32 remains inactive and the comparison is done again at the next sop . therefore , only the processors 15 that have received a complete symbol are enabled . as each of the devices completes processing its respective symbol , the symbol manager 28 advances the base pointer of the processing section 24 to the next symbol . once the base pointer of the processing section 24 advances , the processed symbol is in the post - processed section 26 . the extraction of the post - processed data is slaved to the processor 15 , and is only performed after the symbol has been processed . an advantage of this type of buffering scheme is that the processor is de - coupled from the incoming data rate of each channel . this is true with the restriction that the sop of the processor is greater than or equal to the maximum baud rate of the channels . if this were not true , it is possible that incoming data could overwrite previously received data before it is processed . therefore , the net processing rate of each channel is approximately equal to the baud rate for that channel since its processor 15 may be periodically disabled . the rate at which any given channel is disabled ( assuming zero jitter between each of the baud rates ) is given by : % proc off = fbaud sop - fbaud chan fbaud sop this equation also indicates the “ bursty ” nature of the data output rate . that is , the output is provided in bursts — when the processor is enabled — rather than a constant steady stream . also , the varying instantaneous latency due to the gapped processing can be determined . since the data is assumed to be arriving at a constant input rate , any gaps in the processing increase buffering requirements . however , since the worst case , or fastest , baud rate of the channel is equal to the baud rate of the processor , the buffering requirement is limited to the symbol size for each of the three sections 22 , 24 , and 26 . implementing an simd in this manner provides several advantages . the architecture ultimately results in a net decrease in gate count and expended power , since the processors are only used for completely received symbols . buffering requirements can be combined with those necessary for other considerations in the signal processing . therefore , little or no extra memory is required . the structure can be applied to any symbol size . this includes processing on a sample by sample basis . the structure can be expanded to accommodate any number of channels . lastly , this structure has direct applications to implementations of itu g . 992 . 2 ( and other standards ) for dsl systems , since the baud rate changes throughout operation . in an alternate embodiment , it is possible that the data is received in parallel and the output transmitted in parallel . in yet another embodiment , it is possible that the data is received serially and the output transmitted in parallel . in yet another embodiment , it is possible that the data is received in parallel and the output transmitted serially . it is possible to implement the system as described above using other simd implementations and will be apparent to a person skilled in the art . although the invention has been described with reference to certain specific embodiments , various modifications thereof will be apparent to those skilled in the art without departing from the spirit and scope of the invention as outlined in the claims appended hereto . | 7 |
fig1 and 2 show anti - skid assembly 20 mounted on a tire 22 with fig1 showing the assembly 20 in normal position when the tire is properly rotating with respect to a road surface and fig2 depicts the position of the assembly when it has been automatically shifted to an operative position at which it gives maximum traction to the road surface to stop slippage when the tire is in a skid relative to the road surface . the tire is of a conventional type having a treaded circumferential road engaging surface 24 and a pair of opposing side walls 26 and 28 . assembly 20 includes a plurality of spaced straps 30 mounted transversely on the road engaging tire surface 24 . the straps are substantially parallel to one another and are mounted at their ends to a pair of opposing anchor cables 32 and 34 . the anchor cables are of sufficient length so as to permit the cable to extend circumferentially around the side wall of tire 22 . at least one of the cables , preferably the cable exposed to the exterior side of the tire when it is mounted on a vehicle includes a detachable means 36 which permits quick release attachment and detachment of the ends of a cable 32 or 34 when it is desired to remove the assembly from the tire or to mount the assembly on the tire . the general configuration of the assembly 20 including the cables 32 and 34 and the straps 30 is substantially the same as the embodiment shown in fig1 - 18 of u . s . pat . no . 3 , 817 , 307 . there are differences in structural details which will be specifically discussed below . anchor cables 32 and 34 are constructed of a braided fabric which is formed into a rope - like structure . the braided fabric provides a similar strength to that of the webbing used in u . s . pat . no . 3 , 817 , 307 and has additional advantages in that it is possible to separte the braids at the location of points of connection . for example , in fig5 it is shown how the braids of anchor cable 32 are parted to permit passage of a rivet 38 used to make the connection to a strap end or any other connection . by being able to separate the braids there is no reduction in strength of anchor member 32 which could occur if holes were punched in the anchor member 32 . naturally hole punching could require reinforcement around the location of the hole . this is unnecessary where the fabric can be braided and separated to permit passage of the rivet . it has been found that a conventional braided fabric can be utilized of a material such as polyester and the materical can be one that does not vary in length so that the anchor member can be properly sized for the tire on which it is to be utilized . alternatively as shown in fig3 and 4 , a single strap 30 which is the same as the straps of the fig1 and fig2 embodiment can be connected to a single anchor member 40 of the same material as anchor member 32 . anchor member 40 is much shorter in length than anchor member 32 and is used to connect a single strap 30 to a tire 22 by having a similar detachable means such as detachable means 36 in the embodiment of fig1 and 2 and being of sufficient length to pass through an appropriate aperture 42 in the tire . the actual separation point for anchor strap 40 can be intermediate its ends or at the location of connection to one end of strap 30 such as by means of connection assembly 44 . in the embodiment of fig3 - 8 , the detachable means 44 is located at the point of interconnection with one end of strap 30 . the other end of anchor member 40 is permanently attached to the other end of strap 30 . details of these points of attachment are depicted in fig5 - 8 and the manner of attachment is the same as for the embodiment of fig1 and 2 . the single strap attachment of fig3 - 8 is alternative to the multi - strap assembly of fig1 and 2 or is supplemental to that arrangement . the interconnection at the non - detachable end as shown in fig6 and 7 is accomplished by aligning the end portion of strap 30 which is of slightly greater thickness than the intermediate portion of the strap with the end of the braided anchor cable 40 . an appropriate aperture 46 is present in end 30 and is aligned with aperture 48 of cap 50 and aperture 52 of cap 54 . the caps are positioned on opposing sides of strap 30 and capture strap 30 and cable 40 therebetween with the holes therethrough in alignment with the hole in strap 30 . the exposed surfaces of caps 50 and 54 include counter sunk entrance ways 56 and 58 respectively to provide the necessary recesses for passage and mounting of rivet 38 therein . the rivet has a tubular body portion 60 and an enlarged head 62 on one end . insertion of rivet 38 through the aligned apertures will seat head 62 within the recess 56 in one cap and the opposite end portion of the rivet 38 in recess 58 . rolling over of the ends of the rivet in conventional fashion locks the rivet to the surrounding cap surface and in turn locks the anchor cable 40 to strap 30 . the rivets may be of a conventional metal material and the caps can be formed of a conventional low cost metal or plastic material which is of sufficient strength and hardness to maintain the integrity of the riveted connection . braided anchor cable 40 is detachably interconnected to form a continuous loop and detachable connector means 64 is utilized for this purpose . connector assembly 64 is shown in detail in fig8 of the drawings . it includes a rigid nylon or plastic receptacle hook 66 which has rectangularly shaped mating surfaces for engaging with one side of the end portion and edge of strap 30 so as to form a longer leg portion 68 with an aperture 70 therein to receive a rivet therethrough and a shorter leg portion 72 having an upright side wall 74 integrally formed with an arcuately shaped hook portion 76 . the undersurface of the hook portion forms a circular recess 78 with the inner surface of side wall 74 and the hook 76 terminates in a vertical edge 80 which is parallel to and spaced from inside edge 82 of wall 74 . the space between parallel edges 80 and 82 is less than the diameter of the arcuately shaped receiving recess 78 . the free end of cable 40 has a metal or rigid plastic rectangularly shaped loop 84 mounted thereon by means of a locking bar 86 affixed to the loop 84 intermediate the ends thereof and substantially bisecting an aperture 88 through the center of loop 84 . the end of cable 40 is passed through one portion of aperture 80 and over bar 86 and back through the other portion of aperture 88 doubling the cable upon itself and adjustably fixing the length of cable 40 . the end of loop 84 which extends beyond attached cable end 40 is of greater width than diameter so that it forms a locking tongue 90 . by positioning tongue 90 with its narrower dimension in alignment with the aperture formed between walls 80 and 82 , the tongue 90 can be passed therebetween and into larger arcuate recess 78 . thereafter , the locking tongue 90 can be rotated 90 ° permitting its larger dimension to be exposed to the opening between walls 80 and 82 and retaining the tongue in position and the ends of cable 40 in attached condition . the wider dimension of tongue 90 is slightly less but approximately equal to the diameter of arcuate recess 78 thereby facilitating the rotation and positioning of the tongue within the recess in the latched position . to uncouple the cable ends , it is only necessary to rotate the tongue 90 the same 90 ° to bring the smaller dimension of the tongue 90 into alignment with the opening between walls 80 and 82 at which time the loop 84 can be removed from receptacle 68 . in this manner , the coupling and uncoupling of the strap ends can be quickly and efficiently carried out . to assemble the strap to a tire it is merely necessary to pass one free end of the strap and cable assembly through an appropriate opening 42 in the tire with strap 30 positioned on the tire surface as shown in fig3 and 4 for use and the tongue 90 appropriately positioned as described above in recess 78 . if tightening of the strap and cable assembly is necessary , it is merely required to draw back on the free end of the loop of cable 40 formed on bar 86 . bar 86 is mounted in position by deforming the ends thereof into arcuate loops around the sides of loop 84 until they substantially encircle the sides of loop 84 and are crimped in that position so as to affix bar 86 to loop 84 . the same type of detachable means can be employed as detachable means 36 in the embodiment of fig1 and 2 . the longer leg of receptacle 66 is provided with an aperture 70 through which rivet 92 is passed with enlarged head 94 of the rivet bearing against the surface of the receptacle surrounding aperture 70 . an appropriate cap 95 is positioned with an aligned aperture 96 on the opposite side of the end of strap 30 to receive rivet 92 therethrough . the rivet ends are then turned over in conventional fashion to engage with the surface of cap 95 holding the cap and receptacle to the strap 30 . the portion of cap 95 surrounding aperture 96 is counter sunk to form recess 98 so that the end portion of rivet 92 is below the exposed surface of cap 95 . there are many different types of stud structures that can be employed to make the stops of the depicted embodiment with road engaging stud 41 . the studded straps can be used with a braided cable as shown and described above in connection with the embodiment of fig1 - 10 . alternatively it can be used with cables of other material such as chain , other metal , woven fabric , plastic or a combination of materials . some of these structures are depicted in fig1 - 22 of the drawings . stud 100 of fig1 is designed for assembly to strap 30 as shown in fig1 . the stud 100 includes a tubular body 102 having a central aperture 104 in one end to receive a rivet locking tool and having an enlarged head 104 on the other end . in the center of the top surface of head 106 is a tapered aperture 108 which is adapted to receive a tapered insert therein in tight frictional engagement . the insert 110 is shown in position in fig1 and partially extends above the upper surface of head 106 . insert 110 is of an extremely hard material such as high carbide steel to increase the longevity and biting characteristics of the stud in use . stud 100 as is the case with all of the stud discussed is of a hard material such as steel but need not be necessarily as hard as the high carbide steel of insert 111 . in fact , for ease of assembly and rolling over the ends of the rivets to lock it in position it is desirable to have a rivet of less hardness than insert 110 to facilitate assembly . as shown in fig1 , the stud 100 in the form of a rivet is inserted through an appropriate aperture 112 in strap 30 and through an aligned aperture in washer 114 on the underside of strap 30 . the riveting tool then is inserted through central aperture 104 in the bottom end of stud 100 and the ends are turned over locking the stud in position in strap 30 . the head 106 of the stud is positioned in a recess 116 in the upper surface of strap 30 formed by counter sinking the portion of the strap surrounding aperture 112 . in this manner , substantially only the hardened insert 110 is exposed to direct road surface contact and the head 106 is protected within recess 116 . it has been found that a tungsten carbide material is extremely effective for use as insert 110 . washer 114 can be of a hard metal or plastic material . it should have sufficient hardness to accept the rivet roll - over . other designs for the stud which can be assembled to strap 30 in the same manner are depicted in fig1 and 14 . stud 118 of fig1 is also in the form of a rivet and has an annular shaped head 120 and a wider upper body portion 122 terminating in an integrally formed lower body portion 124 . an appropriate tapered aperture 126 is present in the head end for receipt of the insert in an appropriate central bore 128 in the opposite end is provided for receipt of the riveting tool . stud 130 of fig1 also is in the form of a rivet and includes a tubular body 132 and an enlarged head 134 . the difference in structure from stud 100 resides in the nature of the bore arrangement with a continuous axial bore 136 being provided through the length of the stud . in this manner , one end of the bore is adapted to receive the riveting tool and the other end of the bore is adapted to receive insert 110 . another type of stud 138 is shown in fig1 where the stud takes the form of a screw machine shell having a smaller diameter tubular body portion 140 adapted to pass through the aperture 112 in the central portion of strap 30 and through an aperture in washer 142 to be rolled over and riveted in position as shown in dotted lines in fig1 . an appropriate central aperture 144 is formed in the end which passes through the washer to receive the riveting tool . the opposed end has an enlarged head portion 146 with a central aperture 148 to receive insert 110 of the hardened material . stud 150 of fig1 has the identical configuration of the embodiment of fig1 and is also of a screw machine shell type design . however , the end 152 which extends through aperture 112 is threaded to receive an appropriate nut 142 in threaded interengagement to lock the stud 150 in position . the positioning of the insert 110 is accomplished in a similar manner as in the previous embodiment . fig1 shows a further form as stud 154 which is once again in the form of rivet , this time with the head portion 156 on the underside of strap 30 and the body portion 158 of lesser diameter passing through aperture 112 in the strap and through an appropriate aperture in washer 160 on the upper surface of strap 30 . a single opening is present in the end of body portion 158 distal from head portion 156 to operate as a dual function opening first to receive the riveting tool to provide roll - over for the end of the body portion 58 onto the surface of washer 160 and then to receive insert 110 therein thereby forming the stud . stud 162 of fig1 is in the form of a tubular body 164 having an enlarged head 166 engaging with the undersurface of strap 30 . tubular body 164 passes through aperture 112 and has an annular groove 166 adjacent the end distal from the head . the groove extends beyond the upper surface of strap 30 and is adapted to receive a snap ring 170 to lock the stud 162 in position . an appropriately tapered aperture in the upper end of the stud body 164 is adapted to receive insert 110 to form the exposed stud for road engagement . fig1 shows a stud 172 which has an enlarged head 174 engaging with the undersurface of strap 30 and a tubular body 176 of lesser diameter passing through aperture 112 with at least the end portion of the tubular body having a threaded outer surface 178 to receive an appropriate nut 180 to lock the stud in position . an appropriate central aperture is provided to receive tapered insert 182 . a final form of stud 184 is depicted in fig2 . instead of a through hole in strap 30 &# 39 ;, a recess 186 is provided in the upper surface in which is inserted a portion of a tubular stud 188 . the stud material is the same as the stud material for the previous embodiments and includes a central aperture in the upper surface thereof to receive the hardened carbide insert 110 . in this embodiment , the stud may be positioned by pressing or molding it into the strap 30 &# 39 ; and includes a plurality of ribs 190 spaced along the portion inserted in recess 186 to serve in securing the stud 184 in the elastomeric material . fig2 and 22 show the use of bolts or rivets to provide the interconnection between anchor cable 40 and strap 30 . in fig2 it is shown how the apertures in the strap 30 and cable 40 are aligned with the appropriate apertures in caps 54 and 50 as described in connection with fig6 and 7 and then the rivet is inserted through the aligned apertures with the end portions being housed in the counter sunked recesses in the caps . a riveting tool 192 is then moved downward into the receiving riveting recess to provide roll - over of the ends of the rivet and lock it in position locking the caps and strap and anchor member together . an alternative form of attachment of the same members may be accomplished as depicted in fig2 by means of a threaded bolt 194 and a threaded nut 196 with the head of the bolt being received in the counter sunk recess in cap 50 and the nut being received in the counter sunk recess in cap 54 . naturally other conventional fastening means well known in the art can be substituted for the riveting and bolting arrangements depicted in fig2 and 22 . strap 30 as shown in fig2 has a central portion 198 of narrow diameter . in the normal relaxed position when mounted on the tire it has a small dimensioned thickness with projecting ribs 200 extending laterally on the tire surface . the upper exposed surface of the central portion 198 includes a lattice of ribs 202 to provide additional traction for the tire under normal operating conditions and two studs 204 spaced on the surface of the central portion 198 and extending upwardly therefrom . the studs once again facilitate normal traction with the road . the undersurface of central portion has a plurality of pointed prongs 206 extending downwardly therefrom which bite into the tire surface and tend to hold each strap in relatively fixed position on the tire when it is in normal position and the tire is rotating and not skidding with respect to the road surface . when a skid is initiated , the lateral projections 200 facilitate gripping of the strap with the road surface and twisting of the strap into the right angle position as shown in fig2 to expose the undersurface of central portion 198 to the road surface and enhance the gripping characteristics . in that position , the pointed projections 206 also assist in addition to the enlarged surface area exposed to the road due to the width of strap 30 in stopping the skid . once past the road contacting area , the strap will return to its initial configuration as shown in fig1 and in fig2 . in this manner , operation of the device depicted and described herein is the same as the device of u . s . pat . no . 3 , 817 , 307 . fig2 also shows two alternative methods of fastening the ends of strap 30 to the anchors 40 . in one form the anchor is merely connected to the ends of the strap 30 in the manner depicted in fig6 and 21 . however , alternatively as shown in respect to strap 30a as shown in fig2 partially in phantom , the strap ends include a pair of wings 208 with apertures 210 therein to receive the cable anchor 40 therethrough . this type of arrangement strengthens the cable attachment . the cable is first threaded through one aperture 210 and then is mounted in a similar fashion as described above by riveting or bolting to the strap and then passes through the other aperture 210 thereby permitting the loops 208 to bear some of the stress when the strap is twisted with respect to the cable as the strap shifts automatically between the operative and inoperative positions . to facilitate the shifting action , the central portion of strap 198 extends outwardly into a narrower neck portion 212 which does not contain projections 200 . neck portion 212 then is integral with an outwardly tapering extension 214 which communicates with a wider strap end 216 . the connection to cable 40 is made by means of an aperture through the end of portion 216 in the manner described above . the narrower central portion tapering outwardly into a wider end portion facilitates the twisting of the strap between the flat position with respect to the tire and the perpendicular position with respect to the tire in both directions . in this manner the strap operates identical to the straps of u . s . pat . no . 3 , 817 , 307 . the present assembly 20 is designed for use with or without the studs in the central portion of the strap . the nature of the braided anchor member 40 and the quick release nature of the detachable means for interconnecting the ends of the anchor are individually improvements in design . when studs are used , the number of studs is a matter of choice with two being the preferred number and as stated above the stud inserts can be of tungsten carbide or other similar hardened material such as stainless steel . it should also be noted that in a number of the embodiments of studs which are depicted and described above , there is a portion of the stud which extends above the exposed surface of the strap in addition to the insert 110 . this exposed portion provides an additional stop surface when the hardened insert wears off . the rivets and studs can be formed of a conventional steel material and the tapered hole for the insert can be formed in any conventional fashion such as by drilling . the material for straps 30 and 30 &# 39 ; and 30a is of a similar nature as the material described in u . s . pat . no . 3 , 817 , 307 such as a flexible high strength material like polyurethane plastic or a high strength rubber . thus the several aforenoted objects and advantages are most effectively attained . although several somewhat preferred embodiments have been disclosed and described in detail herein , it should be understood that this invwention is in no sense limited and its scope is to be determined by that of the appended claims . | 1 |
referring now to the figures , where like numbers indicate like features , the illustration of fig1 depicts a block diagram illustrating an exemplary layout and interconnectivity of electronic devices comprising a guest check presentation device with rfid payment receiving capabilities 100 ( hereinafter , rfid device ). the rfid device 100 may include a wireless ( e . g . rfid ) antenna / receiver 101 , and a dedicated rfid processor 102 . in exemplary embodiments of the rfid device , the rfid antenna may be used to read information from an rfid payment token , such as , but not limited to , an rfid keychain fob , an rfid enabled credit card or rfid enabled hotel key . in particularly useful embodiments , the rfid antenna 101 may be integrated into the rfid processor . the rfid processor 102 is also connected to a processor 105 in a manner that allows communication with the rfid processor 102 . in one exemplary embodiment , the rfid processor may be connected to the processor 105 via a pin - to - pin multi - line data bus , a bi - directional bus , such as the inter - integrated bus ( 12 c ), or via a serial connection . in another particularly useful embodiment , the rfid processor 102 may be integrated into the processor 105 . the processor 105 may also be connected to a communication device 103 . in some exemplary embodiments , this communications device 103 may be a device capable of communicating with a base station wirelessly using rf transmissions . in one particularly useful embodiment , the communication device 103 may be an 802 . 11x receiver / transmitter , communicating using any supported rf transmission protocol . in another useful embodiment , the communication device 103 may be an infra - red transmitter / receiver capable of communicating with a base station in a wireless fashion using transmissions in the infrared ( ir ) range . another exemplary embodiment of the communication device 103 may be where the communication device 103 is a contact socket connector which may be physically plugged into a docking station , where communication with a server and transmission of data may occur via the communications device 103 . in one useful embodiment , the communications device 103 may be , but is not limited to , a serial socket such a usb plug , rs232 socket , or db9 socket . in yet another particularly useful embodiment , the communications device 103 may be a multi - line bus socket similar to , but not limited to , a pcmcia socket , 22 - pin sync socket , ide plug , or the like . according to one implementation , the communication device 103 may be used to load information regarding a guest check onto the rfid device 100 . in another exemplary embodiment , the communications device 103 may be used to transmit information regarding payment , such as verifying the account represented by an rfid payment device used to pay a guest check . the rfid payment device and be any known device , such as , for example , a credit card with rfid capability , a keychain or other compact rfid payment device , a cell phone having an rfid payment capability , a personal digital assistant ( pda ) having rfid payment capability , etc . for example , after a customer pays a guest check using the rfid payment device of their choice , the processor 105 may transmit the guest account information via a wireless communication device 103 to a base station or account server , where the account information is verified , and the account properly debited , after which the account server may transmit an acknowledgement back the communication device 103 residing within the rfid device 100 . alternatively , the guest account information may be stored within system memory 106 until the rfid device 100 is returned to a dock or base station , where , upon the rfid device 100 being plugged into the dock , the communication device 103 then transmits the guest account information to a server where the appropriate guest account is debited . in another useful implementation , the communication device 103 may take the form of a physical socket which including one or more physical electrical connections used to charge batteries powering the rfid device 100 . the processor 105 may also be connected in a bidirectional manner to some form of system memory 106 . the system memory 106 may be any known or unforeseen class of digital memory such as eeprom , eprom , ram , rom , flash memory , removable digital storage such as a memory card or any combination thereof . the processor 105 may store and retrieve from the system memory 106 data such as , but not limited to , information regarding the guest check . additionally , the system memory 106 may be used to store an operating system or computer code for execution by the processor 105 controlling the operation of the rfid device 100 and for controlling any specific applications that may be appropriate for the device and the establishment within which it is used ( e . g ., customer reward programs , customer reward redemption , etc .). in some exemplary embodiments , the system memory 106 may be removably disposed within a socket to facilitate upgrades of memory . in another exemplary embodiment , the system memory 106 may be integrated into the processor 105 , e . g . as with a microcontroller such as exhibited by the 80cx51 microcontroller architecture . one or more keypad inputs 104 may also be connected to the processor 105 to collect user input to be communicated to the processor 105 . the keypad inputs 104 may include a numeric keypad for manually entering numeric data , buttons allowing a user to respond to prompts given on the graphic display 107 , other buttons used to interact with the rfid device 100 , or a combination thereof . in one exemplary embodiment , the keypad inputs 104 may be comprised of buttons representing individual digits for entering data , e . g . manually entering a numerical value representing a gratuity when a bill or guest check is presented to a guest in a hospitality setting such as a restaurant , hotel , or tavern . in another useful embodiment , the keypad inputs 104 may include one or more buttons to automatically add a fixed percentage of the presented bill as a gratuity before payment is tendered via an rfid payment token or device . in yet another exemplary embodiment , the keypad inputs 104 may also be comprised of one or more buttons for interacting with the rfid device 100 . for example , a guest presented with a bill or check in a hospitality environment may be given the opportunity to press a keypad input 104 button indicating a standard gratuity percentage prior to payment via an rfid payment token . additionally , a guest presented with a bill may be prompted to approve the amount to be charged by pressing a keypad input 104 button indicating acceptance of the charge before using an rfid payment token to provide payment information . those of skill in the art will recognize that keypad 104 can be in the form of buttons ( as shown ), or could be integrated into the graphic display 107 as a touch sensitive display screen . the processor 105 may also be connected to a graphic display 107 , via which the processor 105 may display information regarding the current transaction to a guest or customer . the graphic display 107 may be any known or unforeseen device allowing the electronic display of text or pictorial information such as an lcd , active or passive matrix tft screen , led or oled screen , etc . in an exemplary implementation , after the rfid device 100 is loaded with information regarding the guest check and presented to the guest , the graphic display 107 may show the total of the guest check , and prompt the user to enter a gratuity using the keypad input 104 , or prompt the guest to make payment bringing the rfid payment device within range of the rfid antenna 101 disposed within the rfid device 100 . the rfid device 108 may also include one or more indicator lights 108 connected to the processor 105 , and which may be used to signal the status of the rfid device 100 . in one exemplary embodiment , the rfid device may include three indicator lights which may be of different color , wherein one indicator light 108 may be used to indicate that rfid device is ready for payment , one indicator light may indicated that the rfid device has received payment or that the rfid payment device was properly read and recognized by the rfid antenna 101 and rfid processor 102 , and one indicator light 108 used to indicate that the payment approved and that the transaction is complete . in another exemplary embodiment , one of the indicator lights 108 may be used to indicate the charge status of batteries powering the rfid device 100 . the illustration of fig2 depicts an isometric view of a guest check presentation device with rfid payment capabilities ( hereinafter , the rfid device ). the rfid device 200 includes an enclosure , or housing 201 , with a display screen 203 for displaying data to a user . the housing 201 may be made of any suitably rigid material ( e . g . plastic , metal , etc .). in one exemplary implementation , the housing 201 may be used to house electronic components , such as those shown if fig1 , which may be needed to handle display , reading the rfid payment tokens , and communication . in another implementation , the housing 201 of the rfid device may include a recessed area 206 for disposition of a paper receipt for presentation to a guest . the display screen 203 may be of any type suitable for displaying text , graphics , or a combination thereof , to a guest , as exemplified in fig1 . the display screen 203 may be used to show the total amount for a guest check , or provide instructions for use of the rfid device to the user . in another useful embodiment , the display screen 203 may be used to display responses to prompts on the display screen , which responses may be selected using keypad inputs of the keypad 204 . response buttons 202 may be disposed adjacent to the display screen . in one preferred implementation , one or more response buttons 202 may each be labeled with a percentage for adding a tip or gratuity to the total check amount . in another useful implementation , the display screen 203 may show responses to a question or prompt shown on the display screen 203 , with the response buttons 202 allowing a user to select a response button corresponding to one of the provided responses . for example , a guest may be presented with an rfid device 200 where the information regarding the guest &# 39 ; s bill has been loaded . in this example , the device 200 may display possible responses on the display screen 203 directly above each response button 202 , with a different possible response being associated with each response button 202 . the rfid device 200 may display the total of the check , and the prompt the user to input a gratuity using the response buttons 202 , if desired . in such a situation , prompts allowing a user to automatically add their choice of a predetermined or recommended gratuity amount may be provided , or alternatively , various options such as 10 %, 15 % or 20 % gratuity may be displayed over the response buttons 202 . after a gratuity , if any , is entered , the rfid may recalculate the guest check , including the gratuity , and prompt the guest to press a response button 202 to accept the totality of the charges . keypad input buttons 205 may also be disposed on the face of the rfid device 200 . the keypad input buttons 205 may be used to manually enter numbers when more customized entry is required than provided by the response buttons 202 . in an exemplary embodiment , the keypad input buttons 205 may be used to enter a gratuity or tip amount that does not correspond to the standard and automatically calculated amounts allowed entry by the response buttons 202 . for example , a guest that feels he received excellent service may wish to give an extraordinary gratuity of 30 %, and would be able to key that amount in via the keypad input buttons 205 . in another embodiment , the keypad input buttons 205 may be used to enter a total charge amount including gratuity for a guest that prefers to charge a rounded amount when gratuity is added to the check . for example , a guest presented with an rfid device with a bill of $ 42 . 37 may wish to add gratuity such that the total charge is $ 50 . 00 instead of automatically adding a percentage that result in a charge that does not total an easily accountable amount . as mentioned above , keypad input buttons 205 could alternatively be integrated into the display 203 as a touch sensitive display . indicator lights 204 may be disposed on the housing 201 of the rfid device 200 . one or more of the indicator lights 204 may be used to display the status of the rfid 200 device to the guest , the server handling the transaction , or others . in an exemplary implementation , one indicator light 204 may be used to show that the rfid device is functioning properly , and is ready to receive payment . in this embodiment , a server may load information regarding the guest check into the rfid device , after which the indicator light 204 may illuminated indicating the rfid device is ready to be presented to the guest . in another exemplary embodiment , one indicator light 204 may be used to show that payment has been made by the guest , and that the rfid device may be retrieved by the server . in yet another embodiment , one indicator light may be used to show that the rfid device 200 was unable to read the guest &# 39 ; s rfid payment device , or that the guest payment was not accepted due to the guest account being invalid or having insufficient funds . additionally , in one useful embodiment , the indicator lights 204 may be disposed on the face of the rfid device 200 as exemplified in fig2 , or the indicator lights 204 may located elsewhere , such as the upper end face of the rfid device 200 . referring now to fig3 , the upper face 300 of the rfid device as shown in fig2 is displayed in isometric detail . in this figure , the rfid device includes an opening 301 allowing access to a communications socket or device 103 disposed within the opening 301 . in the embodiment exemplified in fig3 , socket and opening 301 may be disposed within the upper end surface or face of the rfid device 200 . in other useful implementations , the socket and opening 301 may be disposed within the lower end or face , or any other portion of the rfid device 200 housing 201 . the disposition of the socket and opening 301 may allow multiple rfid devices 200 to be plugged into a single base station parallel to one another , allowing for a compact storage arrangement . the illustration of fig4 depicts an isometric view of an alternative exemplary embodiment 400 of the rfid device 200 as shown in fig2 . in this embodiment , a cover 401 is hingedly attached to the housing 201 of the rfid device via a spine 402 . the cover 401 may be opened and closed in order to insert a guest check , or to access the interactive features of the rfid device . the illustration of fig5 depicts an isometric view of another alternative implementation 500 of guest check presentation device with rfid payment capabilities . in this implementation , response buttons 202 , a display screen 203 , indicator lights 204 , and keypad input buttons 205 may be disposed within a housing or case 501 . according to one particularly useful implementation , the display screen 203 may be of a size suitable for displaying multiple lines of a guest check . additionally , navigation buttons 503 may be disposed within the case 501 . in some embodiments , the navigation buttons may be used to scroll the text shown on the display screen 501 . fig6 is a flow diagram illustrating the process of presenting and electronically handling payment of a guest check using rfid payment device in a hospitality environment . in this process 600 , after hospitality service 601 such as a meal is completed , the guest check is totaled or finalized 602 . the totaled guest check is then printed , if necessary , and loaded 603 into the rfid device system memory 106 . the rfid device 100 with the guest check loaded into system memory 106 is then presented to the customer 604 . the customer then has the opportunity to review the check 605 , ensuring that the check conforms to their expectations . the customer may then be prompted by the rfid device 100 to enter a tip or gratuity 606 if the customer desires . after the customer enters a tip or gratuity 606 , the customer then swipes an rfid payment device 607 by bringing the rfid payment device into such proximity to the rfid antenna 101 that the rfid antenna 101 and rfid processor 102 disposed within the rfid device 100 may read the rfid payment device . the rfid device 100 then determines whether the rfid payment device was read properly 608 . where the rfid payment device was properly read , the rfid device 100 indicates rfid payment device acceptance 610 , and stores payment information 611 in the rfid device 100 system memory 106 . the payment information may next be verified 612 , after which the customer account is debited 613 . where the rfid device determines that the payment device was not properly read , the rfid device then indicates the rfid device failed to read the payment device 609 . fig7 is a flow diagram illustrating an alternative embodiment of a process for presenting and electronically handling payment of a guest check using rfid payment device in a hospitality environment . in this exemplary embodiment 700 , after hospitality service 701 is completed , the guest check is totaled or finalized 702 . the guest check is then printed , if necessary , and loaded 703 into the rfid device 100 system memory 106 . the rfid device loaded with the guest check is then presented to the customer 704 . the customer then reviews the check 705 , and enters a tip , if desired 706 . the customer then swipes an rfid payment device 707 to make payment . the rfid payment device information is then wirelessly transmitted to a base station 708 via a communication device 103 , where a payment is verified 709 . the base station then determines whether payment was accepted 710 . the customer rfid device that is used for swiping may be any type of rfid payment device . examples of such devices include , but are not limited to , rfid enabled credit cards ; rfid enabled wireless telephones ; rfid enabled personal digital assistants ( pdas ), rfid keychain type devices ; rfid usb keys , and any other known , or not yet known device that contains and rfid type device or radio tag that contains and / or stores customer payment information that can be interrogated and obtained during an rfid payment transaction . when the payment via rfid payment device is accepted , acceptance of the payment is transmitted 713 wirelessly to the rfid device 100 . the rfid device 100 then indicates payment acceptance 714 , and the customer account is debited 715 accordingly . where the base station determines that the payment was not accepted , declination of the payment is transmitted 711 to the rfid device 100 , which then indicated that the payment was declined 712 . those of ordinary skill in the art will recognize that the examples given herein are for exemplary purposes and may be changed without departing from the spirit of the invention . although illustrative embodiments of the present principles have been described herein with reference to the accompanying drawings , it is to be understood that the present principles are not limited to those precise embodiments , and that various other alterations , modifications and improvements may be affected therein by one skilled in the art . such alterations , modifications and improvements are intended to be within the scope and spirit of the present principles . accordingly , the foregoing description is by way of example only and is not intended to be limiting . this present principles should be limited only by the claims and equivalents thereof . | 6 |
the isocyanate trimers of formula a , which are used for the production of the urethane acrylates according to the invention are known from ep - a 798 , 299 ( u . s . pat . no . 5 , 914 , 383 , herein incorporated by reference ) or german patent application de - a 19 734 048 . 2 ( copending application u . s . ser . no . 09 / 126 , 303 , herein incorporated by reference ). the isocyanate trimers which are preferably used are those produced by the partial oligomerization of hexamethylene diisocyanate ( hdi ), 1 , 3 - bis ( isocyanatomethyl )- cyclohexane ( h 6 xdi ) or isophorone diisocyanate ( ipdi ). it is immaterial whether or not the diisocyanate starting material to be oligomerized is completely separated from the reaction products after partial oligomerization . the isocyanate trimers of formula , which are preferably used for the production of the urethane acrylates according to the invention , are those having a viscosity at 23 ° c . of 300 to 3000 mpa · s , preferably 500 to 2000 mpa · s , more preferably 500 to 1500 mpa · s and most preferably 1000 to 1500 mpa · s ; an nco content of preferably 15 to 30 % by weight , more preferably 20 to 25 % by weight ; and a content of unreacted starting diisocyanates , of less than 5 . 0 % by weight , preferably less than 1 . 0 % by weight and more preferably less than 0 . 5 % by weight . alcohol component b ) is selected from one or more monobasic hydroxy - functional esters of ( meth ) acrylic acid . the latter is to be understood to include both esters of acrylic acid and esters of methacrylic acid . examples include the hydroxy - group containing esters obtained by reacting acrylic acid or methacrylic acid with dihydric alcohols , such as 2 - hydroxyethyl , 2 - or 3 - hydroxy - propyl or 2 -, 3 - or 4 - hydroxybutyl ( meth ) acrylates . also suitable are monohydric alcohols containing ( meth ) acryloyl groups and reaction products substantially containing monohydric alcohols which are obtained by the esterification of n - hydric alcohols with ( meth ) acrylic acid , wherein “ n ” preferably represents a whole number , or a fractional number ranging from greater than 2 to 4 , preferably 3 , and wherein ( n − 0 . 8 ) to ( n − 1 . 2 ), preferably ( n − 1 ) moles of ( meth ) acrylic acid are used per mole of alcohols . mixtures of different alcohols can also be used as the alcohols . examples of these compounds include the reaction products of i ) glycerol , trimethylolpropane and / or pentaerythritol , or low molecular weight alkoxylation products of these alcohols ( such as ethoxylated or propoxylated trimethylolpropane , e . g . the addition product of ethylene oxide and trimethylolpropane , oh number 550 ). also suitable are mixtures of at least trihydric alcohols of this type with dihydric alcohols such as ethylene glycol or propylene glycol for example , with ( ii ) ( meth ) acrylic acid in the preceding molar ratio . these compounds have a number average molecular weight of 116 to 1000 , preferably 116 to 750 and more preferably 116 to 158 . mono - or dihydric alcohols which have a molecular weight of 100 to 300 , preferably 130 to 200 , contain ether and / or ester groups and have a branched structure can optionally be used as a further constituent of the alcohol component . examples include 2 , 2 - diethyl - 1 , 3 - propanediol , 2 , 2 - dimethyl - 1 , 3 - propanediol , 2 - ethyl - 1 , 3 - hexanediol , 2 , 5 - dimethyl - 1 , 6 - hexanediol , 2 , 2 , 4 - trimethyl - 1 , 3 - pentanediol , ( 3 - hydroxy - 2 , 2 - dimethyl - propyl )- 3 - hydroxy - 2 , 2 - dimethyl propionate and trimethylolpropane formal . the reaction of starting components a ) and b ) can be carried out in the absence of solvents or in solvents which are inert to isocyanates and hydroxyacrylates . example include acetone , 2 - butanone , ethyl acetate , n - butyl acetate and low molecular weight esters of ( meth ) acrylic acid , which are known by the generic term “ reactive thinners ” for curing under the effect of high - energy radiation ( e . g ., those described in p . k . t . oldring ( ed . ), chemistry & amp ; technology of uv & amp ; eb formulations for coatings , inks & amp ; paints , vol . 2 , 1991 , sita technology , london , pages 237 - 285 ). the reaction is carried out at temperatures of preferably 20 to 100 ° c ., more preferably 40 to 80 ° c . starting components a ) and b ), and the individual constituents of components a ) and b ), can be reacted in any sequence when carrying out the method according to the invention . the nco / oh equivalent ratio of components a ) and b ) is 0 . 7 : 1 to 1 : 1 , preferably 0 . 9 : 1 to 0 . 95 : 1 . in one preferred embodiment of the method , component a ) is placed in a suitable reaction vessel and that portion of component b ) that contains hydroxy - functional esters of ( meth ) acrylic acid is first added then reacted at the preceding temperatures until an nco content is reached which corresponds to the complete conversion of the hydroxy - functional esters of ( meth ) acrylic acid . the remainder of component b ), which may optionally be present and does not contain esters of ( meth ) acrylic acid is subsequently added , and again reacted at the aforementioned temperatures until an nco content is reached which corresponds to as complete reaction of the hydroxy - functional component which is possible . if component b ) contains a constituent which is not an ester of ( meth ) acrylic acid , the preferred molar ratio , based on hydroxy groups , of the constituent which contains ( meth ) acrylic acid esters to the constituent which is free from ( meth ) acrylic acid is 99 : 1 to 7 : 1 , more preferably 50 : 1 to 10 : 1 . the reaction of components a ) and b ) can be conducted with or without catalysts . suitable catalysts are known from urethane chemistry and include tin ( ii ) octoate , dibutyltin dilaurate and tertiary amines such as diazabicyclooctane . the resulting products preferably have an nco content of less than 0 . 5 % by weight , more preferably less than 0 . 1 % by weight . in order to prevent unwanted , premature polymerization , both during the reaction and during subsequent storage , it is recommended that 0 . 01 to 0 . 3 % by weight , based on the total weight of the reactants , of known polymerization inhibitors or antioxidants may be added to the reaction mixture . examples of these additives are described in “ methoden der organischen chemie ” ( houben - weyl ), 4th edition , volume xiv / 1 , page 433 et seq ., georg thieme verlag , stuttgart 1961 , and include phenols , cresols and / or hydroquinones . in a preferred embodiment of the preparation method , an oxygen - containing gas , preferably air , is passed through the reaction mixture in order to prevent unwanted polymerization of the ( meth ) acrylates . the urethane acrylates according to the invention can be employed as the sole binder component or can be used in admixture with other binder components that may be cured by radiation . these binder components are described , for example , in p . k . t . oldring ( ed . ), chemistry & amp ; technology of uv & amp ; eb formulations for coatings , inks & amp ; paints , vol . 2 , 1991 , sita technology , london , pages 31 - 235 . examples include urethane acrylates , epoxy acrylates , polyester acrylates , polyether acrylates and unsaturated polyesters . in addition , the binder vehicles according to the invention can be used in a form in which they are thinned by solvents . examples of suitable solvents include acetone , 2 - butanone , ethyl acetate , n - butyl acetate , methoxypropyl acetate and low molecular weight esters of ( meth ) acrylic acid . the mono -, di - or oligo esters of ( meth ) acrylic acid are known as reactive thinners . their function is to reduce the viscosity of the uncured coating composition and to be incorporated into the polymer by polymerization during curing . these compounds are described in p . k . t . oldring ( ed . ), chemistry & amp ; technology of uv & amp ; eb formulations for coatings , inks & amp ; paints , vol . 2 , 1991 , sita technology , london , pages 237 - 285 . examples include esters formed from acrylic acid or methacrylic acid , preferably acrylic acid , with the following alcohols : monohydric alcohols , such as the isomeric butanols , pentanols , hexanols , heptanols , octanols , nonanols and decanols ; cycloaliphatic alcohols such as isoborneol , cyclohexanol , alkylated cyclohexanols and dicyclopentanol ; arylaliphatic alcohols such as phenoxyethanol and nonyl phenyl ethanol ; and tetrahydrofurfuryl alcohols . also suitable are alkoxylated derivatives of these alcohols . examples of dihydric alcohols include alcohols such as ethylene glycol , 1 , 2 - propanediol , 1 , 3 - propanediol , diethylene glycol , dipropylene glycol , the isomeric butanediols , neopentyl glycol , 1 , 6 - hexanediol , 2 - ethylhexanediol , tripropylene glycol and alkoxylated derivatives of these alcohols . the preferred dihydric alcohols are 1 , 6 - hexanediol , dipropylene glycol and tripropylene glycol . examples of trihydric alcohols include glycerol , trimethyolpropane and alkoxylated derivatives thereof . propoxylated glycerol is preferred . the polyhydric alcohols which can be used include pentaerythritol or ditrimethylol propane and alkoxylated derivatives thereof . a photoinitiator component can also be added for the curing process by high - energy radiation . these components comprise initiators which are known in the art and which are capable of initiating polymerization by a free radical mechanism after irradiation by high - energy radiation . suitable photoinitiators are described in p . k . t . oldring ( ed . ), chemistry & amp ; technology of uv & amp ; eb formulations for coatings , inks & amp ; paints , vol . 3 , 1991 , sita technology , london , pages 61 - 325 , for example . they are used in amounts of 0 . 1 to 10 parts by weight , preferably 2 to 7 parts by weight and more preferably 3 to 4 parts by weight , based on the weight of components a ) and b ). the urethane acrylates according to the invention can be mixed with the known additives for polyurethane coating compositions , such as extenders , pigments , colorants , thixotropic agents , glossing agents , matting agents and flow enhancers , which are employed in customary amounts . the invention is further illustrated but is not intended to be limited by the following examples in which all parts and percentages are by weight unless otherwise specified . 1000 g ( 5 . 95 mole ) of hdi were placed in a stirred apparatus fitted with an internal thermometer , a reflux condenser , a gas inlet tube and a metering device for catalyst solution and were initially freed from dissolved gases at 60 ° c . and a pressure of about 0 . 1 mbar for one hour . dry nitrogen was then passed through the batch , and a solution of tetrabutylphosphonium hydrogen difluoride ( bu 4 p + f − · xhf ) in methanol / isopropanol was added in portions over about 20 to 50 minutes . during the addition a gentle stream of nitrogen was passed through the batch at an internal temperature of 60 ° c ., in such a way that the internal temperature did not exceed 70 ° c . the catalyst solution contained 4 . 75 % f − , which did not represent the total fluorine content , and was prepared as described in german patent application de - a 19 824 485 . 2 ( co - pending application u . s . ser . no . 09 / 320 , 366 , herein incorporated by reference ), example 1a — stock solution 1 ). after the refractive index n d 20 had reached the value given below , further reaction was suppressed ( see below ) by adding an amount of di - n - butyl phosphate , which corresponded to the molar consumption of fluoride . the batch was stirred for a further hour at 60 ° c . and unreacted hdi was subsequently separated by thin - layer distillation in a short - tube evaporator at 0 . 15 mbar , using a heating medium at a temperature of 180 ° c . the properties of polyisocyanate component a ), which contained hdi iminooxadiazine dione groups , are set forth below : further reaction was suppressed at : n d 20 = 1 . 4620 , which corresponded to the consumption of 421 mg of the catalyst solution and to the use of 221 mg di - n - butyl phosphate as the terminating reagent . 45 mole % of the isocyanate groups of hdi , which were converted in the oligomerization reaction , were present as iminooxadiazine dione groups and 52 mole % were present as isocyanurate groups . the difference from 100 mole % was essentially due to uretdione groups ( determined by 13 c nmr spectroscopy , as described in copending application u . s . ser . no . 09 / 318 , 537 , herein incorporated by reference , and in “ die angewandte makromolekulare chemie 1986 , 141 , 173 - 183 ”). further reaction suppressed at : n d 20 = 1 . 4670 , which corresponded to the consumption of 410 mg of the catalyst solution and to the use of 215 mg of di - n - butyl phosphate as the terminating reagent . 305 . 3 g of the polyisocyanate from example 1a ) were dissolved in 122 . 7 g of butyl acetate , and 0 . 1 g of dibutyltin dilaurate and 0 . 49 g of 2 , 6 - di - tert .- butyl - 4 - methyl - phenol were added to the resulting mixture . the solution was heated to 60 ° c . while passing air through it and while stirring . the source of heat was removed , and initially 64 . 4 g of 2 - hydroxypropyl acrylate and secondly 134 . 0 g of hydroxyethyl acrylate were added drop - wise in such a way that the temperature did not exceed 60 ° c . the reaction was complete when the nco content of the solution was less than 0 . 10 % by weight . 615 . 4 g of the polyisocyanate from example 1b ) were treated with 0 . 5 g of dibutyltin dilaurate and 1 . 0 g of 2 , 6 - di - tert .- butyl - 4 - methyl - phenol . the solution was heated to 60 ° c . while passing air through it and while stirring . the source of heat was removed , and 394 . 4 g of 2 - hydroxyethyl acrylate were added dropwise such that the temperature did not exceed 60 ° c . the reaction was complete when the nco content of the solution was less than 0 . 10 % by weight . a further 0 . 5 g of di - tert .- butyl - 4 - methyl - phenol were subsequently stirred in over 10 minutes at 60 ° c . as a stabilizer . example 3 was repeated with the exception that 202 . 0 g of butyl acetate were initially placed in the reaction vessel . 435 . 0 g of the polyisocyanate from example 1b ) were dissolved in 176 . 0 g of 1 , 6 - hexanediol diacrylate , and 0 . 35 g of dibutyltin dilaurate and 0 . 35 g of 2 , 6 - di - tert .- butyl - 4 - methyl - phenol were added thereto . the solution was heated to 60 ° c . while passing air through it and while stirring . the source of heat was removed , and initially 78 . 0 g of 2 - hydroxypropyl acrylate , secondly 162 g of hydroxyethyl acetate , and finally 29 . 0 g of 2 - ethyl - 1 , 3 - hexanediol were added dropwise such that the temperature did not exceed 60 ° c . the reaction was complete when the nco content of the solution was less than 0 . 10 % by weight . a further 0 . 35 g of di - tert .- butyl - 4 - methyl - phenol were subsequently stirred in over 10 minutes at 60 ° c . as a stabilizer . 239 . 2 g of desmodur n 3600 ( an product of bayer ag , leverkusen , essentially containing hdi isocyanurate , nco content : 23 . 4 % by weight , viscosity 1200 mpa · s at 23 ° c .) were dissolved in 98 . 9 g of butyl acetate , and 0 . 2 g of dibutyltin dilaurate and 0 . 4 g of 2 , 6 - di - tert .- butyl - 4 - methyl - phenol were added thereto . the solution was heated to 60 ° c . while passing air through it and while stirring . the source of heat was removed , and initially 50 . 7 g of 2 - hydroxypropyl acrylate and secondly 105 . 6 g of hydroxyethyl acrylate were added dropwise such that the temperature did not exceed 60 ° c . the reaction was complete when the nco content of the solution was less than 0 . 10 % by weight . 248 . 4 g of the polyisocyanate starting materials form example 6 were dissolved in 102 . 3 g of butyl acetate and were treated with 0 . 2 g of dibutyltin dilaurate and 0 . 4 g of 2 , 6 - di - tert .- butyl - 4 - methyl - phenol . the solution was heated to 60 ° c . while passing air through it and while stirring . the source of heat was removed , and 156 . 6 g of hydroxyethyl acrylate were added dropwise such that the temperature did not exceed 60 ° c . the reaction was complete when the nco content of the solution was less than 0 . 10 % by weight . a further 0 . 1 g of di - tert .- butyl - 4 - methyl - phenol were subsequently stirred in over 10 minutes at 60 ° c . as a stabilizer . the viscosities of the products produced were determined by means of a rotating viscometer at 23 ° c . to test the tendency of the products to crystallize , one part of each product was stored at 23 ° c . and another part of each product at 8 ° c . all samples were checked daily for possible thickening / cry - tallization . products that exhibited thinnckening / crystallization were subsequently heated for 60 minutes at 60 ° c . and were the stirred briefly . the initial viscosity , which was measured shortly after the production thereof , was obtained again . a comparison of examples 2 and 6 and of examples 4 and 7 shows that the products according to the invention had a lower viscosity and exhibited significantly improved storage stability . the products according to the invention obtained in examples 2 to 5 and the comparison products obtained in examples 6 and 7 were each treated with 2 . 5 % by weight of darocur 1173 ( a photoinitiator available from ciba spezialtätenchemie gmbh ). after applying the coating compositions to cardboard ( thickness of application : 250 g / m 2 ), the coated samples were passed under a high - pressure mercury vapor lamp ( hanovia , 80 w / cm , at a distance of 10 cm ). at a belt speed of at least 10 m / minute , solvent - and scratch - resistant coatings were formed . the term “ solvent - resistant ” in this instance means that the coating still appeared perfect after least 30 double strokes with a cloth saturated with n - butyl acetate under a load of 1 kg . although the invention has been described in detail in the foregoing for the purpose of illustration , it is to be understood that such detail is solely for that purpose and that variations can be made therein by those skilled in the art without departing from the spirit and scope of the invention except as it may be limited by the claims . | 2 |
fig1 , in part , comprises the flat panels from which opposed interior sidewalls 203 j and 203 k , and middle floor panel 203 c , are formed . fig2 comprises the flat die cut sheet of fig1 after said panels 203 j , 203 k and 203 c have been detached along cut line 801 ( fig1 ). fig2 shows the flat panels of corrugated sheet 204 a and 204 b that can be folded along crease lines 291 f and 291 e to form the aforementioned front door , said panels referred to herein as the “ inside panel ” and “ outside panel ”, respectively . outside panel 204 b extends outwardly from exterior floor panel 101 . inside panel 204 a extends from outside panel 204 b . fig3 shows inside panel 204 a after it has been turned upward about 90 degrees . fig4 shows inside panel 204 a after it has been turned upward a full 180 degrees , thereby overlapping outside panel 204 b and glued to it to form the center section of the front door of said box . opposed rounded wings 204 c and 204 d extend from the left and right sides of outside panel 204 b . said center section and opposed rounded wings comprise the “ front door ” of said box . crease line 262 c acts as a hinge between said front door and said exterior floor panel of said box . said front door rotates between open and closed positions upon said hinge 262 c . in alternative embodiments , said front door could extend from ( and be hingedly attached to ) to other locations including , without limitation , the top lid or the interior or exterior sidewalls of said box . hole 617 provides a finger notch to facilitate opening said front door . fig5 a shows panels 203 j and 203 k after they have been turned ninety degrees upward with respect to middle floor panel 203 c . fig5 b shows a preferred embodiment in which panels 203 j and 203 k are positioned to form the interior sidewalls of the box . the upper side of middle floor panel 203 c has been glued to the lower side of interior floor panel 101 . in alternative embodiments , said opposed interior sidewalls and middle floor panel could extend from locations other than those shown in the preferred embodiment . said interior sidewalls 203 j and 203 k comprise holes 203 e and 203 f , respectively . fig5 b shows opposed panels 103 j and 103 k and opposed panels 102 a and 102 b as flat sheet before being turned . fig5 c shows said panels 103 j , 103 k , 102 a and 102 b after having been turned ninety degrees inward along crease lines 905 and 906 ( fig1 ). panels 103 j and 103 k form the opposed exterior sidewalls of the box . said exterior sidewalls comprise holes 103 e and 103 f , respectively . holes 103 e and 103 f are aligned with the aforementioned holes 203 e and 203 f , respectively , thereby forming a set of gripping areas through which hands can be inserted for carrying the box . fig5 c further shows panel 105 a after it has be turned along crease line 907 to form the exterior back wall of the box of the present invention . in fig5 b and 5c , wings 204 c and 204 d have been partially turned inward along crease lines 924 . fig5 d shows the box of the present invention after the aforementioned panels 102 a and 102 b ( not visible in fig5 d ) have been turned ninety degrees upward and glued to the underside of middle floor panel 203 c , said panels 102 a and 102 b thereby comprising the exterior floor panels of said box . panel 102 a has been turned along crease lines 901 a and 903 a ; panel 102 b has been turned along crease lines 901 b and 903 b . with respect to each of said panels , a double set of crease lines is used to facilitate turning . in fig5 d , exterior floor panels 102 a and 102 b , interior floor panel 101 and middle floor panel 203 c overlap each other and are glued together to form the triple thickness floor of box of the present invention . alternative embodiments may comprise single , double or other floor thicknesses . fig6 shows : ( i ) panels 104 a and 104 b in the process of being folded towards each other along crease lines 911 and 912 and ( ii ) panel 105 b after it has been turned with respect to panel 104 b along crease line 908 . fig7 shows : ( i ) panel 104 b after it has been fully folded and glued to panel 104 a , thereby forming a double - thickness top lid of the box of the present invention . fig7 further shows panel 105 b after it has been turned with respect to panel 104 b along crease line 908 . alternative embodiments may comprise single , triple or other top lid thicknesses . fig8 shows panel 105 b after it has been turned downward along crease line 908 to form the interior back wall of the box of the present invention . fig9 a shows the box of fig8 after the front door has been swung into closed position . the aforementioned center section of said front door covers the front opening of the box . left wing 204 c ( fig1 ) is tucked between exterior sidewall 103 j ( fig1 ) and interior sidewall 203 j ( fig1 ); right wing 204 d ( fig1 ) is tucked between exterior sidewall 103 k ( fig1 ) and interior sidewall 203 k ( fig1 ). stretchable tab 205 ( fig9 a ) is wrapped around button 208 ( fig9 b ), thereby securing said front door to said exterior sidewall . in a preferred embodiment , said tab 205 is permanently riveted , or otherwise affixed , to said front door . fig9 b shows the top lid of said box after said top lid has been turned downward along crease line 937 and 938 ( fig6 ) into closed position . loop 206 and tab 205 are both wrapped around button 208 . tab 205 secures said front door to said exterior sidewall . loop 206 secures said top lid to said exterior sidewall . in a preferred embodiment , said loop 206 is permanently affixed to said box by passing it through pair of holes 621 in said top lid . in a preferred embodiment , said button 208 is permanently riveted , or otherwise affixed , to said exterior sidewalls . in a preferred embodiment , loop 206 is similar in shape to a common rubber band and tab 205 has an oblong shape , although other shapes and structures of said loop and tab are possible in alternative embodiments . fig1 shows the results of a first set of steps in the process of collapsing the box of the present invention . in fig1 , the top lid of said box has been opened , exposing panel 104 b as the underside of said top lid . also in fig1 , the front door of said box has been opened , exposing panel 204 a as the back side of said front door . in fig1 , interior back wall 105 b has been turned upward about 130 degrees . in fig1 , interior sidewalls 203 j and 203 k are in the process of being folded downward . in fig1 : ( i ) said interior sidewalls 203 j and 203 k have been folded fully downward and rest atop exterior floor panel 101 ( as shown in fig1 ) and ( ii ) exterior sidewalls 103 j and 103 k are in the process of being collapsed inward along crease lines 909 a and 909 b , respectively . fig1 a shows the box of the present invention with exterior sidewalls 103 j and 103 k fully collapsed . fig1 b shows wings 204 c and 204 d fully folded inward and resting atop inside panel 204 a of said front door . fig1 c is a side view showing said front door in the process of being turned underneath the floor of said box upon crease line , or hinge , 262 c . fig1 d is a front view showing the box of the present invention fully collapsed with said front door fully turned , and resting beneath , said floor . in the above described preferred embodiment of the box of the present invention , the interior sidewalls ( 203 j and 203 k ) extend from the floor of said box . in a first alternative embodiment , the comparable interior sidewalls ( 6203 j and 6203 k ) extend from the back wall of said box . fig1 a shows the flat , die cut main sheet of corrugated from which such first alternative embodiment is primarily formed . fig1 b shows said flat die cut sheet after certain panels have been detached from it . fig1 c through 16f are perspective views showing the successive steps in which the main body of the box of said first alternative embodiment is formed from flat sheet stock . fig1 f shows panel 6105 b after it has been turned downward along score line 6937 ( fig1 b ) to form the interior back wall of the box of said first alternative embodiment . panels 6203 j and 6203 k , have been rotated downward along with panel 6105 b , said panels 6203 j and 6203 k , thereby in position to comprise the opposed interior sidewalls of said box . in additional alternative embodiments , opposed interior sidewalls could be attached to the main body of said box in locations other than the interior back wall . for example , without limitation , said interior sidewalls could be attached along : ( i ) the bottom of the exterior sidewalls , ( ii ) the top of said exterior sidewalls or ( iii ) the front of said exterior sidewalls or ( iv ) the back of said exterior sidewalls or ( v ) along the left and right sides of the main floor of said box or ( vi ) along the left and right sides of the interior floor panel of said box . in the above described preferred embodiment of the box of the present invention , the front door extends from the floor of said box . in , yet , another feature of the above stated first alternative embodiment , said front door is stored inside a hollow storage compartment that lies underneath the main body of said box . fig1 a , in part , comprises flat panels 6621 a and 6621 b from which said hollow front door storage compartment ( shown in fig1 d thru 17 f ) is formed . fig1 b comprises the flat die cut sheet of fig1 a after panels 6621 a and 6621 b have been detached along cut lines 6801 a and 6801 b ( fig1 a ), respectively . fig1 a thru 17 c are perspective views showing the components of the structure that comprises said hollow storage compartment . fig1 d thru 17 f show said components after they have been formed into a hollow compartment . front door panel 6204 would typically be die cut from a separate sheet that is not embodied within the main sheet shown in fig1 a , although , in other embodiments , said flat panel could be cut from said main sheet . fig1 d shows a front view in which said front door is fully housed inside said storage compartment . fig1 e and 17f respectively show a side view and a front view of said front door storage compartment with said front door partially protruding from said compartment . fig1 a , 18 b and 18 c show front perspective views after said front door storage compartment has been glued to the bottom of said box . said figs ., respectively show : ( i ) the front door panel fully housed inside said storage compartment , ( ii ) the front door panel protruding from said front door storage compartment and ( iii ) the panel after it has been pulled out of said compartment and rotated upward to form the front door of said box . in other alternative embodiments , the front door storage compartment could be attached either above or below the top lid , in front of or behind the back lid , or in other locations on said box . fig1 d thru 18 i show the box of said first alternative embodiment in successive stages of being collapsed . in fig1 d , top lid 6104 b has been turned upward into open position . in fig1 e , interior sidewalls 6203 j and 6203 k and interior floor 6105 b have been turned upward . in fig1 f , interior sidewall 6203 j and 6203 k have been turned 90 degrees inward . in fig1 g , exterior sidewalls 6103 j and 6103 k are in the process of being folded inward . in fig1 h , exterior sidewalls 6103 j and 6103 k have been folded fully downward . in fig1 i , front door panel 6204 has been pushed fully into the front door storage compartment , thereby completing the collapsing of said first alternative embodiment the box of the present invention . wherever the word “ hinge ” is used herein , such hinge comprises a means by which one or more of the surfaces to which said hinge is attached can pivot about an axis . such hinge can be made of a variety of materials including , without limitation , metal , plastic or paper and can comprise a variety of different structures . in particular , such hinge may comprise a length of flat , flexible tape that is affixed to a surface by glue or other means . in the alternative , such hinge may created within a wall by simple scoring , creasing , or cutting partially through , said wall ; such embodiment sometimes referred to as a “ living hinge .” the above applies to any variation of the word “ hinge ”, such as “ hinged ” or “ hingedly ”. wherever the word “ glue ” is used herein , other means of attachment may be used including , without limitation , staples , clips , rubber bands , string , cord , rope , pins , adhesive , adhesive backed tape and clamps . similarly , in some instances the box may be formed without using any external means of attachment by simply relying on the various folds or other structures of the box to hold its elements in place . while the above description contains many specificities , these should not be construed as limitations on the scope of the invention , but rather as exemplifications of one or more embodiments thereof . other variations and embodiments are possible . without limitation , such other embodiments may include variations in the flat sheet from which the box of the present invention may be formed . those who are skilled in the art will readily perceive how to modify the invention . therefore , the appended claims are to be construed to cover all equivalent structures which fall within the true scope and spirit of the invention and should not be limited to the embodiments illustrated . | 1 |
exemplary embodiments of the present invention are now described with reference to the figures . although the following detailed description contains many specifics for purposes of illustration , a person of ordinary skill in the art will appreciate that many variations and alterations to the following details are within the scope of the invention . accordingly , the following embodiments of the invention are set forth without any loss of generality to , and without imposing limitations upon , the claimed invention . potential applications for the flexible cladding system of the present invention cover a range of industrial sectors including oil , automotive , power generation , and consumer products . of particular importance is the application of corrosion resistant alloy ( cra ) materials to linepipes . the technology of the invention is also useful for larger scale structures ( vessels ) fabricated from clad flat plates . another application involves abrasion resistant coatings . these clads may be from material compositions ranging from tool steels to refractory metals , bonded in both tubular and flat configurations . examples include erosion critical linepipe applications , surfaces for cutting tools / implements , and automotive engine cylinder liners . another class of applications is that requiring oxidation resistance such as combustion systems and boilers ( heat exchangers ). products , i . e ., clad structures manufactured using the system of the present invention may be flats or rounds , with respect to their geometry . in most embodiments , a single cladding layer may be deposited on the inside or outside surface of the clad structure and / or the top and bottom surfaces using the device disclosed in u . s . patent application ser . no . 12 / 412 , 685 or a suitable commercially available device such as , for example , a 400 - kva alternating current ( ac ) resistance seam welder with a medweld 3005 controller . the clad structures manufactured with this system include a substrate component , a cladding layer , and a surface activation layer . the substrate component is typically metal , such as steel . a specific example of the substrate material is 1018 hot - rolled steel , nominally 12 . 5 - mm thick , which is representative of pipeline steel . the cladding layer is typically a refractory metal , stainless steel , tool steel , or iconel alloy . inconel alloys are oxidation and corrosion resistant materials well suited for service in extreme environments subjected to pressure and heat . specific examples of the cladding layer include 1 . 8 - mm - thick inconel 625 , 3 . 1 - mm - thick inconel 825 , and 2 - mm - thick 316 stainless steel . surface activation may be accomplished by using specific coatings ( e . g ., ni — p or ni — b ) or by using braze materials . a specific example of a braze material or alloy is 0 . 08 - mm - thick aws bni - 9 foil . the surface activation layer may be chemically deposited , cold sprayed , and / or plated onto either the substrate or the cladding layer . specific advantages of this invention include : ( i ) texturing of surfaces is not required ; ( ii ) the thickness of the cladding layer may be much greater than with prior art structures ; ( iii ) system power requirements are reduced ; ( iv ) the combinations of materials that may be used with one another is greatly expanded over prior art systems ; ( v ) processing speed is increased over prior art systems ; and ( vi ) the resultant surface profile is of high quality , i . e ., there is low distortion . the final product has the appearance of having a solid state weld . fig1 provides a generalized illustration of an exemplary embodiment of a tubular clad structure 10 , in accordance with this invention , that includes cladding layer 20 ( having a cut line 22 ), surface activation layer 25 , and substrate 30 . a specific example of a product made using the system of this invention includes a demonstrator pipe nominally 350 - mm in diameter , 300 - mm long , and clad with 2 - mm of in625 . the clad product was manufactured using overlapping seams nominally 6 - mm to 7 - mm wide . joining was conducted circumferentially , using overlapping seams to create a nominally full bonded product . the product was sectioned and the bond line integrity examined . the results show a highly localized bond with virtually no dilution between clad and substrate . these initial results also indicate the interdependence of weld forces , currents , and travel speeds . the present invention is based , at least in part , on the technology disclosed in u . s . patent application ser . no . 12 / 412 , 685 to workman et al . entitled method of creating a clad structure utilizing a moving resistance energy source ( filed mar . 27 , 2009 ), which is incorporated by reference herein , in its entirety , for all purposes . previous research largely addressed fusion - based attachment of stainless steel and nickel - based cladding to flat carbon steel plates . processing was based on previously applied approaches to dissimilar metal thickness resistance seam welding ( see , gould , j . e ., johnson , w ., and workman , d ., development of a new resistance seam cladding process , deep offshore technology monaco 2009 , pennwell publications , tulsa , okla ., paper 127 ( 2009 ); and gould , j . e ., a thermal analysis of resistance seam cladding corrosion - resistant alloys to steel substrates , materials science and technology 2009 - joining of advanced and specialty materials 2009 ( jasm xi ), asm , metals park , ohio ( 2009 ), both of which are incorporated by reference herein , in their entirety , for all purposes ). additional research attempted to exploit the claims made in wo 2009 / 126459 a2 ( the pct equivalent to u . s . patent application ser . no . 12 / 412 , 685 ), cladding a nominally 3 - mm corrosion resistant alloy ( cra ) to the interior of steel pipe . this research determined that the technology as described previously as applied to nickel - base alloy cladding of steel pipes was challenged by : ( i ) excessively slow welding speeds limiting commercial viability ; ( ii ) distortion issues that prevented adequate bonding between the clad and substrate ; and ( iii ) difficulty welding clad liners in the thickness range demanded by the application ( 3 - mm ). the present invention utilizes a technology referred to as resistance seam weld cladding that uses resistance heating to create a localized bond . this bond is then driven over an extended area to create a product . product forms include both tubular ( pipe ) and flat ( plate ) configurations . the approach offers significant cost advantages over other cladding methods in high volume production . resistance seam weld cladding ( rsewc ) is a variant of resistance seam welding ( rsew ), which is a well - established technology for the joining of sheet materials ( see , welding handbook , 9 th ed ., vol . 3 , welding processes , part 2 , american welding society , miami , fla ., pp . 1 - 48 ( 2007 ); recommended practices for resistance welding , aws c1 . 1m / c1 . 1 : 200 ( r2006 ); and american welding society , miami , fla . ( 2006 ); resistance welding manual , fourth ed ., resistance welder manufacturers association , miami , fla . ( 2003 ), all of which are incorporated by reference herein , in their entirety , for all purposes ). the process is typically conducted with at least one electrode wheel , which is used to allow current flow into the workpieces , as well as to apply a welding force . the resultant resistance heating of the workpieces , combined with the applied normal forces , results in the formation of a localized bond . this bond is then propagated as the wheel ( s ) traverse the workpieces to make continuous seams . bonding can be the result of either melting and re - solidification of individual weld nuggets or by local deformation ( see , buer , f . y . and begeman , m ., l ., evaluation of resistance seam welds by a shear peel test , welding journal research supplement , 41 ( 3 ): 120s - 122s ( 1962 ); and gould , j . e ., theoretical analysis of bonding characteristics during resistance mash seam welding sheet steels , welding journal research supplement , 82 ( 10 ): 263s - 267s ( 2003 ), both of which are incorporated by reference herein , in their entirety , for all purposes ). processes are available not only for joining steel sheet , but also a range of stainless steel and ni - based alloys . with regard to the rsewc approach , clad material is prepared as an insert ( similar to the approach used for mechanically clad material ), and locally bonded to the substrate using a rsew wheel . to a large degree , the process is analogous to resistance welding dissimilar materials with dissimilar thicknesses . a specific application of this process is for welding a relatively thin layer of clad material onto a much thicker substrate . additionally , the clad layer is typically of substantially higher resistivity . previous work has shown that proper heat balance can be accomplished by a combination of electrode design , electrode material selection , and appropriate selection of welding times or processing speeds ( see , fong , m ., tsang , a ., and ananthanarayanan , a ., development of the law of thermal similarity ( lots ) for low - indentation cosmetic resistance welds , sheet metal welding conference ix , detroit aws section , detroit , mich ., paper 5 - 6 ( 2000 ); and agashe , s . and zhang , h ., selection of schedules based on heat balance in resistance spot welding , sheet metal welding conference x , detroit aws section , detroit , mich ., paper 1 - 2 ( 2002 ), both of which are incorporated by reference herein , in their entirety , for all purposes ). these approaches have recently been used to develop resistance spot welding practices for stack - ups with 4 : 1 thickness variations ( see , gould , j . e ., peterson , w ., and cruz , j ., an examination of electric servo - guns for the resistance spot welding of complex stack - ups , welding in the world , doi 10 . 1007 / s40194 - 012 - 0019 - x . to address the technical challenges previously identified , further research focused on the manufacture of actual clad pipe demonstrators . the following aspects of this invention resulted from this research : ( 1 ) one side strip coating of the clad layer with micron scale active metal alloys ( i . e ., surface activation layer 25 ); ( 2 ) use of the strip as the clad material ; ( 3 ) improvements in tooling to allow accurate positioning of the welding wheels facilitating accurate overlap of progressive seams ; ( 4 ) proper design of welding wheels both accommodating inherent flexure in the welding machine itself , as well as providing bonded seam on the order of several millimeters ; ( 5 ) the ability to clad using specifically sized preforms ; ( 6 ) low cost cleaning procedures to facilitate adequate bonding between the clad and the substrate ; ( 7 ) resistance heating procedures to allow reflow of the active metal layer , including ( a ) deliverable forces of the welding machine and ( b ) the desired clad metal layer thickness ; and ( 8 ) flood cooling procedures to prevent surface damage to both the clad metal and the substrate . with regard to cladding cra liners into steel pipe , five of these aspects are of particular importance . with regard to one side strip coating with ni — p eutectic alloy , an important aspect of this invention is the inclusion of a thin , low cost melting point active layer affecting both the cra and substrate . this is typically done by utilizing one side electroless nickel plating . electroless nickel has a composition of nominally ni - 11 % to 13 % p . the coating may be applied by a commercial vendor or by other means . this volume of phosphorus provides a nominal 500 ° c . melting point suppression of the deposited nickel . the deposition process itself results in only about a 10 - μm coating of the completed assembly . single side coating allows the addition of the melting point suppressant to only the area where bonding is to occur , thereby minimizing any potential damage to the welding electrodes . alternate coating approaches many include electroless or electrolytic methods . with regard to use of a strip insert as the cra layer , the cra layer may be manufactured from strip stock nickel base cra with the nominally 10 - μm eutectic material on one side . while current methods for mechanical cladding employ pre - formed tube sections of cra ( which could also be done ) there is advantage to using the clad strip stock directly . in this approach , strip material is mechanically coiled parallel to the axis of the pipe and inserted . the strip is cut to a width matching that to the substrate pipe inner diameter ( id ). once the strip is inserted , it is allowed to expand . springback of the strip then creates fit - up between the cra and the substrate pipe . the clad then can be welded into place using the rsewc process . as assembled , the cra will typically show a gap at the locations where the coiled ends meet . once rsewc has been completed , the remaining gap may be closed with a range of secondary joining technologies such as , for example , gas metal arc welding ( gmaw ), thereby completing the process of cladding . with regard to improvements to tooling for facilitating reproducible overlapping seams during rsewc , rsewc is typically done with normal loads ranging from several kilo - newtons to several 10 &# 39 ; s of kilo - newtons . additionally , the process is known to cause small surface deformations ( on the order of 100 - μm ), so complex forces act on the tool during processing . this combination of high normal forces and local surface deformations can cause tracking inaccuracies during processing . initial research on flat plates used rigid tooling , and demonstrated tracking appropriate for the process . this invention provides an improvement in this technology wherein the tooling used to both retain the pipe during welding , as well as to provide indexing as part of the welding process . one embodiment of this tooling uses a spring loaded baseplate to support the pipe , rollers to provide for pipe rotation under the welding wheels , and a threaded mechanism to index the pipe as rsewc progresses . the generalized system illustrated in fig3 includes baseplate 70 , support 72 , rollers 74 , and axle 76 . with regard to proper design of the welding wheels to accommodate flexure of the welding machine and providing adequate single pass bond width , the wheels are designed both to create a defined contact area for joining and to be sufficiently robust to any flexure of the welding machine . wheel diameter is largely defined by the inner diameter of the clad surface for bonding . typically , wheels are designed with a maximum diameter providing a contact length under force on the order of 4 - 6 times the contact width or , alternately , 6 - 8 times the contact width ( see fig2 ). this design also prevents or minimizes surface marking . wheels also include a width and face radius that enable both some flexure of the welding machine , and provides adequate bond width . one embodiment of this invention includes a wheel design has a width of roughly 20 - mm , with a face radius of 150 - mm . the use of this wheel design , combined with the processing discussed below , results in per - pass bond widths on the order of 8 - mm for a 2 - mm thick clad . with regard to low cost cleaning procedures that facilitate adequate bonding between the cra coated surface and the pipe wall itself , another important feature for creating high quality bonds between the electroless nickel plated cra and the steel pipe is proper surface preparation . bonding largely depends on reflow of the electroless nickel , and potential reaction with these substrates . shot blasting with either a sic or steel media is a suitable process and typically results in excellent bonding . with regard to resistance heating procedures that allow reflow of the electroless nickel without significant changes to the properties of the clad and pipe materials , certain processes permit continuous bonding of the clad and substrate with minimal metallurgical changes to either component . sample cross sections of a joint showed intimate bonding of the cladding layer and substrate with little or no evidence of retained electroless nickel . this is related to both the forces and temperatures used in the process ( creating intimate fit - up ), and the rapid diffusivity of the phosphorus into the parent materials . additionally , this consolidation is done without any shielding gasses . this is a result of the high contact forces implicit in resistance processing , preventing oxygen exposure of the joint area and effectively creating a vacuum type bonding environment . uniformity of the bond across the joint area is achieved with this process . with regard to flood cooling procedures that prevent or minimize surface damage to both the cra and the pipe itself , this aspect of the present invention is enabled by proper thermal management , thereby allowing appropriate temperatures at the joint interface without excessively heating either the substrate steel pipe or the electrode / clad contact surface . either will lead to degradation of product performance . while heating is done resistively , cooling is done by flooding with water . flooding is done at both the inner diameter and outer diameter surfaces of the product . flooding is typically done with an excessive amount of water . more specifically , flooding is not done to actively control temperature profiles in the workpiece and electrodes , but rather provide a maximum cooling capability associated with the fluid medium . without proper flood cooling , damage would likely occur to the welding wheels and clad exposed surface , as well as the metallurgy of the substrate steel pipe . cooling of the wheels to achieve the same purpose may also be employed ( see fig4 ). the generalized system illustrated in fig4 includes clad structure 10 , inner welding wheel 50 , outer welding wheel 60 , internal cooling fluid conduits 80 , and external cooling fluid conduits 90 . achieving proper heat balance ( as described above ) creates conditions for bonding to occur . in embodiments where the surface activation layer is a braze alloy , a specific interlayer may be used ( bni - 9 ) that melts at lower temperatures than either the clad or the substrate . bni - 9 is a ni — cr — fe — b eutectic alloy with a distinct melting point of 1055 ° c . this melting point can be compared to the solidus points of the 1018 substrate ( 1495 ° c .) and the various cladding materials ( 1270 - 1370 ° c .). brazing with bni - 9 is typically done in vacuum and is effective as the rsew process results in high contact pressures ( supplied by a properly designed welding wheel ) over a specified area . this pressure has the effect of excluding the environment from joint area , allowing the braze alloy to flow . this is termed a “ micro - environment ”, and combined with the temperatures provided by the resistance heating facilitates localized brazing . joining is also enabled by the active character of the braze alloy itself . effectively , on melting , the braze locally alloys with the substrate ( s ), dissociating any residual surface . this effect facilitates wetting of the braze alloy , and formation of a joint . the combination of proper thermal balance , wide temperature operating window , appropriate micro - environment , and active alloy characteristics results in effective resistance brazing . while the present invention has been illustrated by the description of exemplary embodiments thereof , and while the embodiments have been described in certain detail , it is not the intention of the applicant to restrict or in any way limit the scope of the appended claims to such detail . additional advantages and modifications will readily appear to those skilled in the art . therefore , the invention in its broader aspects is not limited to any of the specific details , representative devices and methods , and / or illustrative examples shown and described . accordingly , departures may be made from such details without departing from the spirit or scope of the applicant &# 39 ; s general inventive concept . | 1 |
in the following description of the preferred embodiment , reference is made to the accompanying drawings which form a part hereof , and in which is shown by way of illustration a specific embodiment in which the invention may be practiced . it is to be understood that other embodiments may be utilized and structural changes may be made without departing from the scope of the present invention . fig1 illustrates an exemplary computer hardware environment that could be used with the present invention . in the exemplary environment , a computer system 100 comprises a computer 106 coupled to i / o devices comprising a monitor 102 , a keyboard 108 , a mouse device 110 , and a printer 118 . the computer 106 could also be coupled to other i / o devices , including a local area network ( lan ) or wide area network ( wan ) via interface cable 120 . the monitor 102 presents a display 104 visually depicting information from the computer system 100 to the user . the computer 106 comprises a processor and a memory including random access memory ( ram ), read only memory ( rom ), and / or other components . the computer 106 operates under control of an operating system 122 stored in the memory to present data to the user on the display 104 and to accept and process commands from the user via keyboard 108 and mouse device 110 . the present invention is preferably implemented using one or more computer programs or applications through a graphical user interface . these computer programs are depicted as windows 124 presented on the display 104 , operating under control of the operating system 122 . generally , the operating system and the computer programs implementing the present invention are tangibly embodied in a computer - readable medium , e . g . one or more of removable data storage devices 112 , 114 , such as a zip or floppy disc drive , or fixed data storage devices 130 , including for example , a hard drive , cd - rom drive , or tape drive . also , the relational databases used with the present invention can be stored in data storage devices 130 , 112 , 114 , or may be stored off - line and accessed via interface cable 120 . those skilled in the art will recognize that the exemplary environment illustrated in fig1 is not intended to limit the present invention . indeed , those skilled in the art will recognize that other alternative hardware environments may be used without departing from the scope of the present invention . the operation of the present invention is described with reference to fig2 through fig1 , which illustrate exemplary embodiments of the user interface aspects of the present invention . the present invention provides a method for extending rolling ball fillets to the outside boundary curves of two base surfaces , as shown in fig2 , 4 and 5 . as described in fig2 , a rolling ball fillet 136 is typically created between a first base surface 132 and a second base surface 134 . the present invention provides for an extension of the rolling ball fillet 136 via an extended rolling ball fillet 138 . as shown in fig3 the present invention also provides for the extension of a variable fillet 140 with an extended variable fillet 142 . fig4 illustrates how a rolling ball fillet 148 between a cylindrical surface 144 and planar surface 146 may be extended by an extended fillet 150 according to the present invention . fig5 shows how the present invention may be used to extend a rolling ball fillet 156 by an extended fillet 158 between a first surface 152 and a second surface 154 . fig6 a and 6b are a flow diagram illustrating the logical operation of the present invention . the process begins with the computer 106 receiving into its memory a ( u , v ) and b ( s , t ) as the definition of the two base surfaces , where parameters u , v and s , t are for the surfaces a ( u , v ) and b ( s , t ) respectively varying over the finite intervals . it is assumed that a rolling ball fillet surface exists between the two surfaces having a radius r . the present invention then provides for the creation of an extended fillet surface f ( p , q ) of radius r between a ( u , v ) and b ( s , t ) such that the rolling fillet is extended to the boundary of both the surfaces , as shown in fig1 . after the two base surfaces have been received into the computer 106 , at block 160 in fig6 a an offset surface a o ( u , v ) is created at the distance r for the base surface a ( u , v ), as illustrated by fig7 . the offset surface a o ( u , v ) of surface a ( u , v ) along its normal by a distance r is given by the relation : where a n ( u , v ) is the unit normal to the surface a ( u , v ) at any point u , v . the unit normal is given by the relation : ## equ1 ## where a u and a v are partial derivatives of surface a ( u , v ). at block 162 in fig6 a , an envelope surface e ( x , y ) is created for a boundary curve c ( w ) of the base surface b ( s , t ), where w denotes the parameter of the curve as shown by fig7 . the envelope surface e ( x , y ) is preferably created by instances of a ball of radius r with its center moving along the curve c ( w ). for each value of w there corresponds an instance of the ball . each instance of the ball intersects the normal plane of the curve c ( w ) in a circle whose radius equals r , which is equal to the radius of the sphere . this circle is called the &# 34 ; normal section &# 34 ;. all instances of the ball lead to a set or sequence of normal sections . the envelope surface e ( x , y ) may be understood as a spherical duct surface obtained by dragging a circle of radius r along the curve c ( w ). at block 164 in fig6 a , a spine curve 188 of the intersection of surfaces e ( x , y ) and a o ( u , v ) is computed as in shown in fig7 . the spine curve 188 contains a trace of points that simultaneously lie on the a o ( u , v ) and e ( x , y ) surfaces . the vector equation of the spine curve is given by the relation : at block 166 in fig6 a , the spine curve 188 is divided into a discrete sequence of k points represented by a set s which satisfies a predetermined chordial deviation tolerance . at block 168 in fig6 a , corresponding to each point in s , a set of contact points c1 on the surface a ( u , v ) is determined according to the following relation : it will be recognized that the set of points c1 also lies on the contact curve c1 ( w1 ) as shown in fig8 . at block 170 in fig6 a , corresponding to each point in s , a set of contact points c2 on the surface b ( s , t ) is determined according to the following relation : it will be recognized that the set of contact points c2 lies on the contact curve c2 ( w2 ), and that the curve c2 ( w2 ) is also a subset of the curve c ( w ), as shown in fig8 . at block 172 in fig6 a , a set of k arcs is preferably created from each collection of points on contact curves c1 ( w1 ) and c2 ( w2 ) with their center at the corresponding point in s . each of the arcs is tangent to the surface a ( u , v ) at one endpoint . it is possible to represent each arc in the set of arcs in the form of a spline segment , as shown in fig1 . the set c k ( p ) of k spline segments , each of degree d , polynomial n i , d ( p ) and control points x i , k can be represented by the following relation : ## equ2 ## at block 174 in fig6 a , an extended fillet surface f ( p , q ) is constructed from the spline segments c k ( p ) in three steps . in the first step , a q parameter value for the spline segments in set c k ( p ) is computed such that f ( p , q k )= c k ( p ) . this step assumes that the spline segments are iso - parametric in the p - direction . a centripetal method , as shown in fig9 may be used according to the following relation : ## equ3 ## in the second step , as shown in fig1 , the control points x i , k are interpolated from k = 0 , . . . k for each i , i = 0 , . . . n to determine curves c i ( q ) according to the following relation : ## equ4 ## in the third step , points y i , j are defined as the control points of the extended fillet surface according to the following relation : ## equ5 ## defined over the knot vectors p and q and degree d in the p and q direction , as shown in fig1 . the proof that the surface f ( p , q ) interpolates the set of splines c k ( p ) can be shown as follows : ## equ6 ## if in fig6 b at decision point 176 it is determined that one of the boundary curves of the surface f ( p , q ) is identical to one of the boundary curves of the rolling ball fillet , then the surface f ( p , q ) is an extended fillet and it is stored in the geometric model at block 178 . if at decision point 180 in fig6 b there are further boundary curves of b ( s , t ), the system obtains the next boundary curve at block 184 and flow control then returns to block 162 . if at decision point 176 there are no further boundary curves of b ( s , t ), and if at decision point 182 it is determined that the role of a ( u , v ) and b ( s , t ) has not been reversed , the role of a ( u , v ) and b ( s , t ) is reversed at block 186 and flow control returns to block 160 . otherwise , the procedure terminates . it will be recognized that the present invention is not limited to the embodiments described above . variations and modifications may be made without departing from the scope of the present invention . for example , an extended fillet can also be created for variable fillets as shown in fig3 a and 3b . further , the three step process for creating an extended fillet surface from spline segments can be replaced by other methods depending upon the type of surface being created . it will also be recognized that the present invention works for untrimmed as well as trimmed surfaces . the continuity between the rolling ball fillet and extended fillet can further be improved by blending the two surfaces along the common natural boundary . the envelope surface can also be a portion of the spherical duct surface obtained by dragging an arc , instead of a circle as described above . in conclusion , the foregoing description of the preferred embodiment of the invention has been presented for the purposes of illustration and description . it is not intended to be exhaustive or to limit the invention to the precise form disclosed . many modifications and variations are possible in light of the above teaching . it is intended that the scope of the invention be limited not by this detailed description , but rather by the claims appended hereto . | 6 |
embodiments of the present invention will be described in detail below with reference to the accompanying drawings . first , descriptions will be made as to the structure and operations of a multimedia processing section in accordance with an embodiment of the present invention provided on a receiving side that receives bitstreams with time stamps dedicated to ipmp processing ( hereafter called “ its ”) appended thereto . fig6 shows a structure of a multimedia processing section at a receiving side in accordance with an embodiment of the present invention . referring to fig6 , a bitstream receiving section 601 receives bitstreams that are multiplexed from a server . a demultiplexer 602 demultiplexes the multiplexed bitstreams , and extracts each of the bitstreams . here , each of the extracted bitstreams is independently stored in a buffer for bifs decoding 603 , a buffer for media decoding 604 ( wherein video and audio are generally called “ media ” in the present embodiment ), and a buffer for ipmp decoding 605 , respectively . the stored bitstreams are decoded by a bifs decoder 608 , a media decoder 609 and an ipmp decoder 610 , respectively . in some cases , as described below , decoding processings for bifs and each of the media may be prohibited by the ipmp processing . also , the demultiplexer 602 outputs time stamps for media streams and ipmp streams , respectively . the multimedia processing section also includes a media dts detector 607 , a media cts detector 616 , an ipmp dts detector 611 and an ipmp cst detector 612 . in the present embodiment , an its detector 606 extracts time stamps dedicated to ipmp processing which are referred to as its , and control decoding timings of the ipmp decoder 610 . decode time stamps ( dtss ) and composition time stamps ( ctss ) for the media and the ipmp are compared by a dts comparator 613 and a cts comparator 617 , respectively , to check whether or not the dtss and the ctss of the media and the ipmp are in consistent with each other , respectively . an and gate 619 provides logical products ( ands ) under conditions when the dtss and ctss of the media and the ipmp are in consistent with each other , respectively . accordingly , the and gate 619 outputs a true value “ 1 ” only when the dtss and ctss for the media are in consistent with the dtss and ctss for the ipmp , respectively . in other words , with the structure described above , a determination can be made as to whether or not the dtss and ctss for the media are completely in consistent with the dtss and ctss for the ipmp , respectively . a sync - controller 620 governs decoding timing control for the decoders , synchronization control among the media and reproduction timing control . when the dtss and ctss for the media are completely in consistent with the dtss and ctss for the ipmp , respectively , and assumes that updates of the ipmp data correspond to the corresponding access units of the media . as a more specific example , let us consider a situation where the media data has been scrambled , and its descrambling key changes periodically . in this case , a normal reproduction becomes impossible unless each of the access units of the media and the update timing of the descrambling key are accurately defined . the sync - controller 620 monitors outputs of the dts comparator 613 and the cts comparator 617 and controls the timings . more specifically , sync - controller 620 controls timings for descrambling the media data that are supplied to the respective decoders and update timings of the descrambling key . a bifs composition buffer 614 composes scene information that have been decoded by the bifs decoder . a media composition buffer 615 temporarily stores a specified amount of decoded image frames and audio data . when the ipmp method uses only a data scrambling , each of the media is composed ( re - constructed ) by a compositor 618 without a further change , and displayed or reproduced by a renderer 621 . a monitor apparatus 623 provides a final rendering on the image ( or video ) media ( for display ), and a speaker apparatus 624 provides a rendering on the audio media ( for audio reproduction ). when the ipmp method uses not only a data scrambling but also a control for reproduction or non - reproduction of the media , display and reproduction of each of the media must be accurately started ( or stopped ) at intended timings . in this case also , like the above case in which only the data scrambling is used , display and reproduction of each of the media can be accurately started ( or stopped ) in units of access units through controlling the compositor 618 and the renderer 621 by the sync - controller 620 based on the comparison results of the dts comparator 613 and the cts comparator 617 . fig1 shows a flow chart for describing a descrambling processing . when decoding is started ( step s 101 ), the its detector 606 detects itss ( step s 102 ). then , the ipmp decoder 610 decodes the ipmp data with the timings of the itss detected ( step s 103 ). the decoding processing of the ipmp data may correspond , when a scramble key itself is multi - scrambled ( encrypted ), to a processing to extract the scramble key to decode the media data . then , dtss and ctss of the ipmp data are detected by the ipmp dts detector 611 and the ipmp cts detector 612 , respectively ( step s 104 ). dtss and ctss of each of the media data are also detected by the media dts detector 607 and the media cts detector 617 , respectively ( step s 105 ). then , the dtss and ctss of the ipmp data and the dtss and ctss of each of the media are compared by the dts comparator 613 and the cts comparator 617 , respectively . when they are not in consistent with each other , a determination is made that the scramble key has not been updated , and the media data is descrambled with the current scramble key , and decoded ( step s 107 ). on the other hand , when they match with each other , a determination is made that the scramble key has been updated , the scramble key is updated ( step s 108 ), and then the media data is descrambled and decoded ( step s 109 ). then , the compositor 618 performs a composition processing and the renderer 621 performs a rendering processing ( step s 110 ), and these processings are repeated until the end of the data ( step s 111 ). it is noted that , when the ipmp method uses not only a data scrambling but also a control for reproduction or non - reproduction of the media , additional display and reproduction controls are performed in step s 110 . next , descriptions will be made as to the structure and operations of a multimedia processing section in accordance with an embodiment of the present invention provided on a transmission side that transmits bitstreams with itss appended thereto . fig7 shows the structure of a multimedia processing section on a transmission side in accordance with the present embodiment . referring to fig7 , a media encoder 701 performs an encoding for each of the media data , which is suitable for each of the media . for example , when the media data is image data , the media encoder 701 performs an encoding on the media data according to mpeg - 4 visual ( iso / iec 14496 - 2 ), and performs a scrambling processing with a scramble key . a dts / cts generator 702 generates time stamps ( dtss and ctss ) according to reproduction conditions of each of the media . an ipmp encoder 703 performs an encoding processing on the ipmp information . the encoding processing on the ipmp data may corresponds to a processing to scramble ( encrypt ) the scramble key itself . a dts / cts buffer 704 temporarily stores time stamps ( dtss and ctss ) that are generated by the dts / cts generator 702 . a sync - controller 705 receives inputs of the dtss and ctss generated by the dts / cts generator 702 and the ipmp information that is encoded ( scrambled or encrypted ) by the ipmp encoder 703 , and performs a synchronizing control for reproducing each of the media , and also controls generation of its information to be described below . an its generator 706 generates its information for each of access units according to an instruction from the sync - controller 705 based on the dtss and ctss stored in the dts / cts buffer 704 . a packetizer 707 performs an appropriate packetizing processing using the encoded media information and ipmp information , the dtss , the ctss , and the its information . since the values of the dtss and ctss of the ipmp are the same as those of the media information , the dts / cts generator 702 generates dtss and ctss for the ipmp . at the time of the packetizing processing , a header generation section 709 adds headers , and a multiplexer 708 performs a final multiplexing . then a bitstream transmission section 710 transmits the data multiplexed by the multiplexer 709 . fig8 shows a timing chart of time stamps in accordance with an embodiment of the present invention . fig8 shows video streams as one example of media streams , but the media streams can be of any type . what is to be focused on is the relations between the dtss and ctss of the video and dtss and ctss of the ipmp . for example , when a video access unit 1 ( video au 1 ) has a decode start timing dts 1 and a composition start timing cts 1 , a dts and a cts of the ipmp stream for this access unit have the same values as the dts 1 and the cts 1 , respectively . in other words , by making the values of dtss and ctss for each video access unit and each ipmp access unit equal to one another , the video access unit and the ipmp access unit can be correlated to each other . accordingly , dtss and ctss for the ipmp streams do not indicate decoding and composition timings of themselves , but are used for correlating each of the media streams and each of the access units . in the meantime , decoding ( for example , descrambling a scrambled encryption master key that is used to descramble the video bitstreams ) timings of the ipmp streams can be controlled in units of access units of the ipmp streams themselves by itss that are additionally defined . another embodiment of the present invention in which an electronic watermark technique is applied will be described below with reference to the accompanying drawings . in the present embodiment example , an electronic watermark technique is used to embed scramble keys for media data in ipmp data , and itss indicate processing timings for extracting ( decoding ) the scramble keys embedded by the electronic watermark technique . fig9 shows a timing chart of time stamps in accordance with the other embodiment . dtss and ctss shown in fig9 are used for the purpose of indicating mutual relations among the access units of the media streams and the ipmp streams . in the embodiment described with reference to fig8 , the present invention is applied to a system that uses an encryption scheme , for example . however , when media bitstreams have been scrambled , the media bitstreams need a descrambling processing , and then a decoding processing and a composing processing to be performed . accordingly , a relation its ≦ dts ≦ cts is established ( see fig8 ). when the time stamps its , dts and cts are equal to one another , such relation indicates an ideal state where all of the processings can be executed in no ( zero ) time . accordingly , the ipmp processing controls operations of the decoder ( i . e ., the ipmp processing has the decoder perform a decoding processing or not perform a decoding processing ). on the other hand , in the system using an electronic watermark technique , electronically watermarked data are extracted from decoded bitstreams , and therefore the decoding processing must be performed first , and then the ipmp processing controls operations of the compositor ( i . e ., the ipmp processing has the compositor perform a composition processing or not perform a composition processing ). in view of the above , the time stamps have a relation dts ≦ its ≦ cts . fig9 shows a timing chart in this case . in this manner , in accordance with the present invention , time stamps exclusively used for ipmp processings ( i . e ., itss ) are additionally provided , such that timings of itss can be flexibly controlled based on dtss and ctss for the media streams . the embodiments described above ( e . g ., the circuits indicated by block diagrams in fig6 and 7 ) may be realized by hardware . however , the entire system in accordance with the embodiments of the present invention can be realized by software . also , in the embodiments described above , video and audio data are handled as examples of multimedia data . however , the present invention is also applicable to texts and graphics data . as described above , in accordance with the embodiments of the present invention , a variety of ipmp processings are reliably synchronized , and can be flexibly composed . the present invention may be applicable to a system that is composed of a plurality of apparatuses ( for example , a host computer , interface devices , readers , printers and the like ), or to a unit that is composed of a single apparatus ( for example , a copy machine , a facsimile machine or the like ). the present invention can be achieved by having a storage medium that stores program codes of software that realize the functions of the embodiments described above supplied to a system or an apparatus , and by having a computer ( or a cpu or an mpu ) of the system or the apparatus read and execute the program codes stored in the storage medium . in this case , the program codes themselves that are read from the storage medium realize the functions of the embodiment of the present invention , and the storage medium that stores the program codes constitute the present invention . the storage medium to supply the program codes may be , for example , a flexible disk , a hard disk , an optical disk , an optical magnetic disk , a dvd , a cd - rom , a cd - r , a magnetic tape , a nonvolatile memory card , or a rom . furthermore , the present invention is applicable not only when the program codes read by a computer are executed to realize the functions of the embodiments , but also when an operating system that operates on the computer performs a part or all of the actual processing based on the instructions contained in the program codes and thereby realizes the functions of the embodiments . moreover , the present invention is also applicable when the program codes that are read from the storage medium are written on a memory of an expansion board inserted into a computer or of an expansion unit connected to a computer , and a cpu provided on the expansion board or on the expansion unit performs a part or all of the actual processing based on the instructions contained in the program codes and thereby realizes the functions of the embodiments . as described above , in accordance with the embodiments of the present invention , synchronization control information appended to media data and synchronization control information appended to ipmp information are synchronized , and information that indicates timings to start processings that are defined by the ipmp information are generated in association with the respective synchronization control information . as a result , processings for intellectual property management can be flexibly performed . while the description above refers to particular embodiments of the present invention , it will be understood that many modifications may be made without departing from the spirit thereof . the accompanying claims are intended to cover such modifications as would fall within the true scope and spirit of the present invention . the presently disclosed embodiments are therefore to be considered in all respects as illustrative and not restrictive , the scope of the invention being indicated by the appended claims , rather than the foregoing description , and all changes which come within the meaning and range of equivalency of the claims are therefore intended to be embraced therein . | 7 |
in the various views , similar parts , or parts performing similar functions , are referred to by the same numbers followed by an identifying letter suffix . the general disposition of the chambers and pistons and the operation of the basic system are diagrammatically illustrated by fig1 . in a typical supercharger or compressor application , a drive shaft 2 is connected by a pulley wheel and belt to an internal combustion engine or other power source ( not shown ). the shaft 2 drives an eccentric drive member 4 which has an oblong opening 6 that surrounds the drive shaft 2 . the eccentric drive member 4 is secured to the drive shaft by a pin 8 that is notched to receive an acuator ramp 12 that controls the position of the drive shaft 2 within the oblong opening 6 and thereby determines the stroke of the pistons . by varying the adjustment of the actuator ramp 12 , the eccentricity of the drive member 4 can be controlled . this variable displacement feature does not form part of the present invention and is described more fully in the above referenced patent application and also in u . s . pat . no . 4 , 907 , 950 . the eccentric drive member 4 is mounted in a bearing 14 that is rotatably positioned within a rigid drive sleeve 15 of an orbital - motion piston drive structure , generally indicated at 16 . the piston drive structure 16 is rigidly connected by four piston support brackets 17u , 17b , 17l and 17r respectively to four radially positioned pistons 18u , 18b , 18l and 18r . each of the pistons follows a circular orbit whose diameter is a function of the adjustment of the actuator ramp 12 . the pistons 18u , 18b , 18l and 18r are positioned respectively in one of the sliding chambers 22u , 22b , 22l and 22r . the pistons and the chambers are rectangular in cross section . each piston carries conventional piston seals , respectively , 24u , 24b , 24l and 24r . the circular orbit of each piston lies in a plane perpendicular to the longitudinal axis of the drive shaft 2 . each of the chambers is mounted for sliding reciprocating movement laterally with respect to the axis of the drive shaft . the apparatus is enclosed in a suitable housing , generally indicated at 25 . the lateral movement of the chambers that accompanies the orbital motion of the pistons also operates appropriate intake and exhaust valves ( not shown ). the structure and function of these valves is described in the above - referenced co - pending application and in u . s . pat . no . 4 , 907 , 950 . in some previous structures , the chambers are driven by the force of the piston seals 24 against the inner surfaces of the chambers . in the present structure , the chambers are driven laterally by a positive drive means independent of the seals 24 . the positive drive mechanisms for the chambers are illustrated diagrammatically by the exploded view of fig2 . rotation of the drive shaft 2 causes rotation of , two spaced eccentric drive members 4l and 4r ( only member 4r is shown in this view ) inside the circular bearings 14l and 14r . the outer races of the bearings 14l and 14r are formed respectively by the drive sleeve 15 , partially cut away in this view , that encompasses both of the bearings and may contain suitable hardened bearing inserts 26l and 26r ( see also fig3 and 4 ). the drive sleeve 15 and the piston driver structures , generally indicated at 16l and 16r , because they are secured to the pistons 22 , are restrained from rotation and thus follow a non - rotational orbital translation motion that is transferred to the pistons . the orbit of each piston is identical to the others except for a fixed radial displacement . the arrangement in which the eccentric drive members 4 , in spaced positions along the drive shaft 2 , simultaneously actuate the orbital movement of the sleeve 15 adds significantly to the stability of the compressor device . the drive mechanism for the chambers 22 creates the orbital motion of the drive sleeve 15 that drives the pistons . in this case , however , the orbital motion of the drive sleeve 15 is converted to reciprocating horizontal motion to drive the upper and lower chambers 22u and 22b and to reciprocating vertical motion to drive the two side chambers 22r and 22l . the bearings 14l and 14r are positioned within and drive the sleeve 15 in a non - rotational orbit , meaning that the sleeve 15 ( and also the piston drive structures 16 and 16r ) follows an orbital path but does not rotate about its own axis . the piston drive structure 16r has four radially extending brackets 17u , 17b 17l and 17r . the other drive structure 16l carries identical brackets 17 , partially visible in fig2 . the upper brackets 17u are secured to the upper piston 18u ; the two pairs of side brackets 17l and 17r are secured respectively to the side pistons 18l and 18r , and the bottom brackets 17b are secured to the bottom piston 18b . by this means when the drive shaft 2 is rotated , each of the pistons is driven in a circular orbit in a plane perpendicular to the longitudinal axis of the shaft 2 . to avoid an excessive load on the piston seals , the chambers 22u , 22b , 22l and 22r are driven by separate drive means along linear reciprocating paths , parallel with and displaced from the longitudinal axis of the drive shaft 2 , that correspond to the displacements of the pistons in the respective directions . this driving force is applied to the chambers by separate mechanisms secured to the ends of the chambers . the drive mechanism for the left hand ends of the chambers will now be described , it being understood that a similar drive arrangement is connected to the opposite ends of the chambers . the drive sleeve 15 extends beyond the piston drive structure 16l and carries a pair of ears 32a and 32b that extend laterally into corresponding notches 34a and 34b on the inner surface of an orbital chamber drive structure , generally indicated at 36l . the orbital chamber drive structure 36l has a pair of oppositely disposed inner drive rails 38 extending vertically along the sides . only one drive rail 38 is visible in the view of fig2 but the other rail is positioned symmetrically along the opposite side surface of the structure . this orbital chamber drive structure 36l is positioned within a first linear chamber drive structure , generally indicated at 42l , in which the inner drive rails 38 respectively engage outer drive rails 44 , only one of which is visible in fig2 . these mating drive rails permit vertical movement of the orbital chamber drive structure 36l within the linear chamber drive structure 42l , but do not permit horizontal movement of the orbital drive structure within the linear chamber drive structure . vertical or rotational movement of the linear chamber drive structure 42l is prevented by a pair of guide rails 46a and 46b that are fixed to the linear chamber drive structure 42l and are supported by two sets of guide pads 48a and 48b mounted for horizontal sliding movement in a fixed support plate 52l that may form part of the compressor housing 25 of fig1 . one of the end plates 54ul of the chamber 22u and one of the end plates 54bl of the chamber 22b form an integral part of the linear chamber drive structure 42l . the plate 54ul forms the left end plate of the upper chamber 22u and the plate 54bl forms the left end plate of the bottom chamber 22b . when the drive shaft 2 rotates , the sleeve 15 follows a non - rotational orbital path . this movement causes the orbital drive structure 36l to ride up and down in the linear chamber drive structure 42l while moving that structure horizontally in a reciprocating motion . an equivalent mechanism ( not shown ) operated by the eccentric drive member 4r through the bearing 14r produces an identical motion of the end plates at the opposite ends of the chambers 22u and 22b . the chambers 22u and 22b are thus caused to move laterally in synchronism with the horizontal component of motion of the pistons 18u and 18b . to drive the chambers 22r and 22l , the orbital chamber drive structure 36l is provided with a second pair of drive rails 56 that extend respectively horizontally along the upper and lower surfaces of the orbital chamber drive structure 36l and are offset along the axis of the shaft 2 from the drive rails 38 . it is not necessary that the drive rails 38 and 56 be axially displaced along the drive shaft 2 but , if desired , may be positioned in a common plane . these drive rails 56 respectively engage upper and lower cooperating outer drive rails 58 in a second linear chamber drive structure , generally indicated at 62l , that permit horizontal movement within the second linear chamber drive structure . only the upper drive rail 56 on the orbital chamber drive structure 36l and the lower drive rail 58 on the second linear chamber drive structure 62l are shown in this view , but opposing symmetrical rail drives are provided . the meshing drive rails on both the vertical and horizontal surfaces are provided with ball or roller bearing elements or other means to minimize the friction and wear of the reciprocating surfaces . horizontal or rotational movement of the second linear chamber drive structure 62l is prevented by a pair of guide rails 63a and 63b attached to the drive structure and mounted for vertical sliding movement in the fixed support 52l by means of two sets of guide pads 64a and 64b . an end plate 66l that forms the left end of the left side chamber 22l and an end plate 66r that forms the left end of the right side chamber 22r form integral parts of the second linear chamber drive structure 62l . as with the chambers 22u and 22b , the side chambers are driven to correspond to the vertical component ( as shown ) of the orbital movement of the pistons 18l and 18r . when the orbital chamber drive structure 36l moves in a circular orbit , the second linear chamber drive structure 62l reciprocates vertically driving the chambers 22l and 22r in a vertical reciprocating path . as stated above , a duplicate chamber driving mechanism ( not shown ) is provided and is driven by the orbital motion of the drive sleeve 15 to impart the appropriate motion to the right hand end of each of the chambers . analysis of the forces acting upon this assembly shows that the forces generated by acceleration and deceleration of the chambers as they reciprocate far exceeds the forces generated by the gases being compressed . earlier versions , in which the chambers are moved by pressure exerted on the piston seals or through a separate set of low friction or rolling element drive components , generally have high frictional losses reducing the efficiency of the system . in both such arrangements the pistons are generally located some distance from the drive shaft and any differential pressure between them and the driving mechanism , caused partially by unavoidable tolerances in the construction , thermal expansion or wear , can result in the creation of significant twisting or rotational torque on the chamber system as a product of the acceleration force and the eccentricity . in theory , the acceleration forces imparted by each of the opposing pistons on its associated chamber is identical , but in actual practice , one piston or the other usually exerts a large proportion of the total chamber - driving force . this results in much higher loads than would be predicted on the sliding or bearing surfaces that allow the chambers to reciprocate , increasing the friction losses and decreasing the useful life . this invention embodies a sliding or rolling interface between the eccentric drive element and the end plates of the chambers that allows the chamber drive structure to move horizontally for one pair of chambers and vertically for the other pair of chambers . friction losses are preferably minimized by using one of several rolling element configurations , while the twisting moments are dramatically reduced by having the drive forces resolved as near the centerline of the mass of the end plate and chamber assembly as possible . the twisting or rotational moments with respect to the upper and lower chambers 22u and 22b are resisted by the two guide rails 46a and 46b that are located respectively on the mass centerlines of the chamber end plates 54u and 54b . these guide rails ride , respectively , on the guide pads 48a and 48b that are slidably attached for horizontal sliding movement to the fixed support plate that may form part of the housing of the displacement apparatus . the guide rails 46a and 46b are positioned as far as possible from the centerline of the drive shaft 2 . by increasing the effective lever arm in this way , any twisting or overturning moment is resolved with minimum force , thus permitting the guide pads 48a and 48b to utilize a self - lubricated bearing material . the same considerations apply to the design of the end - plate chamber assemblies for the right and left chambers 22r and 22l and for the symmetrical constructions associated with the end plates that form the opposite ends of the chambers . with this arrangement , rolling bearing elements react with the largest forces to minimize friction losses , while maintaining minimum eccentricity between the centerline of the drive shaft 2 and centerline of the force that counteracts the overturning or twisting moments . as stated above this allows the use of simple sliding pads to resolve the much smaller gas pressure forces . various arrangements for counteracting the overturning forces are shown diagrammatically in fig5 to 11 . in the embodiment shown in fig5 a recirculating ball bearing system is positioned between the orbital chamber drive structure 36l and the end plates of the chambers . a somewhat more detailed illustration of this construction is shown in fig6 and 7 . in this example , ( fig5 ) the upper and lower chambers 22u and 22b are mounted for horizontal movement . the pistons , represented symbolically at 18u and 18b in this view , follow an orbital path as the chambers reciprocate . as before , this orbital drive movement is provided by the orbital chamber drive structure 36l . this orbital drive structure is confined by the chamber drive structure , or any structure secured thereto , indicated in this view diagrammatically at 42l , and the pistons 18u and 18b . the outer drive rails 44 are part of the chamber drive structure 42l , or a structure secured thereto , and the inner drive rail 38 is part of the orbital chamber drive structure 36l . free floating ball bearings 67a are positioned between the inner drive rails 38 and the outer drive rails 44 . to permit recirculation of the ball bearings , a recirculation track is provided through the pistons 18u and 18l . this ball bearing track may be through the pistons proper or it may be through appropriate structures forming part of the piston assemblies . with this arrangement , the ball bearings do not reciprocate , but follow a 360 - degree recirculation path . as before , the reciprocating motion is guided by the guide rails 46a and 46b and the guide pads 48a and 48b . as shown by fig6 and 7 , a separate set of recirculation ball bearings 67b is provided in connection with the vertical reciprocation of the side chamber drive structure 62l . fig8 illustrates an arrangement in which the recirculating ball bearings are replaced with low - friction sliding surfaces 68a and 68b . this arrangement provides a low cost simple displacement apparatus for less demanding applications . fig9 illustrates diagrammatically an arrangement where the recirculating ball bearings have been replaced by four small rolling elements 72 that resolve the twisting moments of the chambers . these rolling elements are mounted on the orbital chamber drive structure 36e and ride on the guide rails that form part of the end plate drive structure represented diagrammatically at 42e and 54f . as in the previous examples , rotary or twisting moments are resisted by the guide rails 46e and 46f operating respectively with the guide pads 48e and 48f . fig1 shows an arrangement similar to the one represented by fig9 in which the rolling elements 72 are mounted on the end plate structure 42g and ride on suitable guide rails 74 that form part of the orbital chamber drive structure 36g . fig1 illustrates diagrammatically another embodiment in which an inner drive rail 76 is circular in form and is mounted on the outer race of a drive bearing 78 slightly less than the distance between the outer guide rails 44j and 44k so that it can only make contact with one rail at any given time . this arrangement provides high efficiency , a simple construction and eliminates any possibility of jamming between the orbital drive structure 36j and the end plate drive structures 42j . the operation is based on a single - point rolling contact that minimizes the negative effects of tolerance reinforcements caused by changes in temperature , manufacturing tolerances and wear . | 5 |
referring to the drawing , fig1 shows a perspective view of parts of a data printing machine . a printing head 200 is moved laterally along a platen 202 , for example by a threaded lead screw 204 which rotates and is rotationally coupled to a rotary encoder 206 by a drive belt 208 . printing head 200 may be of the impact type having printing needles ( indicated pictorially in fig5 by numeral 556 ), arranged , for example , in a single column , which can be axially impelled or &# 34 ; fired &# 34 ; to impinge an inked ribbon against a printing surface ( 557 ), thereby forming a printed &# 34 ; dot &# 34 ; of a desired size and shape on the printing surface 557 . as the printing head 200 moves along the printing surface 557 additional dots are printed at specific locations , with coherent groupings of a plurality of dots forming characters such as letters or numbers . fig2 is a perspective view of internal components of rotary encoder 206 , including an elongated drive shaft 10 affixed to the central axis of a wheel 20 and rotationally coupled to drive belt 208 . rotation of lead screw 204 results in lateral movement of printing head 200 and transmission of a proportional rotation to wheel 20 through belt 208 and shaft 10 . wheel 20 has peripheral coding means , for example , a plurality of windows 100 , which rotate and are used to generate a signal which indicates lateral displacement of printing head 200 . in a particular embodiment , printing head 200 may print at a rate of 120 characters per second , as one example , in which case encoder 206 may be geared at a five - to - one gear ratio from the main drive shaft , and encoder wheel 20 may include twenty equally spaced windows 100 , resulting in a dot density on the surface 557 to be printed of 100 dots per inch , if each window 100 is made to correspond to a single dot position of the printing head 200 along the platen 202 , which is a very desirable relationship . if it is desired to change the dot density , the drive ratio of encoder wheel 20 can be changed , and / or encoder wheel 20 can have a different number of windows 100 in it . accordingly , the dot density on the surface 557 to be printed can be changed easily by changing the encoder module , while leaving most other parts of the printer the same . as shown in fig3 a plurality of window openings 100 , 100a , 100b , 100c , et seq . are spaced circumferentially in a circle around the periphery of wheel 20 . a u - shaped transducer housing 30 , with legs extending over both side edges of wheel 20 , has a pair of spaced cylindrical openings 32 and 34 ( fig2 and 3 ) extending through the legs of housing 30 parallel to the axis of shaft 10 and displaced from shaft 10 the same radial distance as window openings 100 . as wheel 20 rotates , the various window openings 100 move into and out of alignment with openings 32 and 34 to form a periodically interrupted light path . additionally , housing 30 has rectangular mounting openings 36 and 38 intersecting opening 34 at a right angle and rectangular mounting openings 40 and 42 intersecting opening 32 at a right angle . openings 36 and 42 extend into housing 30 parallel to the surface on a first side of wheel 20 and are adapted to receive light - emitting diodes 37 and 43 , respectively , by which openings 32 and 34 may be illuminated . openings 40 and 38 extend into housing 30 parallel to the surface on the other side of wheel 20 from openings 36 and 42 , and are adapted to receive photo - transistors 41 and 39 , respectively , for detecting light from light - emitting diodes 43 and 37 through openings 32 and 34 only when a window 100 is aligned with either opening 32 or 34 . advantageously , wheel 20 , housing 30 and a supporting framework for encoder 206 ( partially shown in fig1 ) are fabricated of plastic by molding . fig3 is taken along section line 3 -- 3 of fig2 and shows a part of the surface of wheel 20 and a partial cross - sectional view of housing 30 . the lateral spacing of openings 32 , 34 and of windows 100 is such that when opening 32 is fully aligned with window 100a , opening 34 is half covered by the wheel portion between windows 100b and 100c , and half exposed through window 100c . accordingly , a light source within opening 42 and communicating with opening 32 can transmit through window 100a and into opening 40 , where photo - transistor 41 receives the light and produces an electrical output . since window 100c is only partially aligned with opening 34 , photo - transistor 39 , associated with opening 38 , has a reduced electrical signal output amplitude compared to the output amplitude of photo - transistor 41 associated with opening 32 . from the relative position of openings 32 and 34 and the windows 100 , it can be appreciated that as wheel 20 rotates the magnitude of the light transmitted through openings 32 and 34 will vary approximately sinusoidally and that the sinusoid of the light output associated with opening 32 is displaced 90 electrical degrees from the sinusoid of the light output associated with opening 34 . further , in the situation illustrated in fig3 ( i . e ., with opening 32 fully exposed by window 100a ) the change in the magnitude of the output of photo - transistor 39 associated with opening 34 can indicate the direction of rotation of wheel 20 , since if this output is increasing at such time , wheel 20 , as shown in fig3 is rotating counterclockwise and , if the output is decreasing at such time , wheel 20 is rotating clockwise . fig4 shows a series of waveforms , with time along the horizontal axis and amplitude along the vertical axis , generated by decoding circuitry , shown in block form in fig5 from the output of encoder 206 . the approximately sinusoidal output produced by photo - transistors 39 and 41 , denoted output a and b , monitoring the light variations within openings 32 and 34 is applied to a differential amplifier 501 ( shown in fig5 ) to increase the magnitude of the signal . the amplified sinusoidal outputs a and b are coupled from amplifier 501 to a schmidt trigger 502 which changes the sinusoidal form of outputs a and b into square waves , corresponding to phase a ( φa ) and phase b ( φb ) shown as lines 1 and 2 , respectively , in fig4 . transformation of the sine waves to square waves facilitates an analysis and comparison of the wave forms . to this end , phases a and b are applied to logic circuitry which performs comparison of the two phases to determine the amount and direction of rotation of wheel 20 and , in turn , the amount and direction of movement of printing head 200 . more specifically , the position of the printing head 200 along the platen 202 , i . e ., along the printing surface 557 , may be monitored by monitoring , and algebraically summing , the pulses produced by rotating wheel 20 . the time of firing of the printing needles or stylii 556 to produce dot matrix printed characters can be controlled as a function of the pulses produced by the rotating wheel 20 of the encoder 206 . if , as a general rule , each such pulse is synchronized to , or used to trigger , the printing of one dot by a given needle 556 in the printing head 200 and the repetition rate of the square wave of phases a and b is directly related to the circumferential spacing of windows 100 , the spacing of windows 100 , in a sense , determines the spacing of dots imprinted by the printing head 200 on the surface 557 to be printed . the direction of rotation of wheel 20 , and thus the direction of travel of printing head 200 , may be determined by noting the level of one phase at the time of transition from a zero level to a one level of the other phase . for example , if phase b has a level transition from zero to one and phase a is at a one level at that time , wheel 20 can be defined as rotating in a first direction ( as shown in fig3 toward the left ). analogously , if phase b has a transition from zero to one and phase a is zero , wheel 20 can be defined as rotating in the other direction , e . g ., towards the right . a reversal in direction of rotation is indicated by an arrow 300 shown in fig4 . to the right of arrow 300 , at the point designated by arrow 302 , phase b has a zero to one transition , phase a is at a zero level , indicating leftward rotation . to the left of arrow 300 , when phase b has a zero to one transition , phase a is at a one level , indicating a rightward rotation . since the information from these phases is used to control ( i . e ., command ) printing operation by the printing head 200 at a particular horizontal location along the platen 202 and over the printing surface 557 , it is desirable to know as soon as possible when a reversal in direction of printing head movement ( i . e ., encoder rotation ) has occurred . if a zero to one transition of phase b is used to initiate interrogation of the direction of rotation , the first electrical indication that a physical change in direction of rotation has occurred at arrow 300 takes place at a time denoted by arrow 302 . an earlier electrical indication of the physical transition in direction can be obtained by using a one to zero , instead of a zero to one , transition of phase b , indicated by an arrow 304 . of course , when phase b switches from level one to level zero , a one level , rather than a zero level , of phase a indicates a change in direction of rotation . it can be appreciated that the interval of time between a physical change in direction of wheel 20 and an electrical indication that a change in direction has occurred depends upon the relative levels of phase a and phase b when a physical change in direction takes place and when the level transition which initiates interrogation of direction of rotation . typically , the level transition initiating interrogation is fixed in advance and the time interval between physical change in direction and electrical indication of change in direction depends upon the relative amplitude of phase a to phase b when physical reversal takes place . that is , phases a and b can both be zero or one , or phases a and b can have different levels . lines three through seven of fig4 indicate a preferred processing of the square waves of phase a and phase b at corresponding points in time . line three shows production of a pulse when phase a has a transition from zero to one , and line four shows production of a pulse when phase a has a transition from level one to level zero . line five is used to show a change in direction of wheel 20 when the reference used to initiate interrogation of the direction of rotation is the transition from level one to level zero of phase a . more specifically , starting at the left ( lines one and two ), phase b is at a level of one each time phase a makes a transition from level one to level zero until the time indicated at an arrow 306 . the transition of phase a and the level of phase b at arrow 306 is used to indicate a change in direction , and it may be seen that at point 306 direction line five undergoes a transition from level one , indicating one direction of rotation , to level zero , indicating another direction of rotation . line six is used to keep track of the printing head 200 so each printing position , or dot , is not lost when a change in direction occurs . line six is obtained by comparing line five with both lines three and four , i . e ., if line five is at level one then line six is the complement of line four ; if line five is at level zero then line six is the complement of line three . if a pulse occurs on line three or four during a transition of line five , then there is only a spike on line six , as opposed to a full pulse . line seven is a mirror image of line six , but with the spikes removed . each pulse on line seven indicates that the printing head 200 is present at a new dot location on the printing surface 557 , taking into consideration printing head direction reversals at the points already mentioned . the generation of the waveforms described above is accomplished in the circuit section 500 shown enclosed within a dotted box labeled direction and strobe decoder in fig5 . as already noted , square waves a and b are generated by schmidt trigger 502 , which is coupled to a quad - d flip - flop circuit 503 . the inputs of flip - flop circuit 503 also include a clock input , a power supply input and two feedback inputs . the outputs of flip - flop circuit 503 are coupled to a logic network comprising and circuits 504 , 505 and 506 , nand circuits 507 through 514 , and inverter circuits 515 , 516 and 517 . the signal represented by line 5 of fig4 appears at the output of inverter circuit 517 and the signal represented by line 7 of fig4 appears at the input of inverter 515 . describing circuit section 500 more specifically , the phase a output of schmidt trigger 502 is coupled to the 1d input of flip - flop circuit 503 and the phase b output of schmidt trigger 502 is coupled to the 2d input of flip - flop circuit 503 . the two inputs of and circuit 504 are coupled to the 1q and 4q outputs of flip - flop circuit 503 . the two inputs of and circuit 505 are coupled to the 1q and 4q outputs of flip - flop circuit 503 . one input of nand circuit 507 is coupled to the output of and circuit 504 and the other input of nand circuit 507 is coupled to the 2q output of flip - flop circuit 503 . one input of nand circuit 508 is coupled to the output of and circuit 505 and the other input of nand circuit 508 is coupled to the 2q output of flip - flop circuit 503 . the inputs of nand circuit 509 are coupled to output 2q of flip - flop circuit 503 and the output of and circuit 504 ; the inputs of nand circuit 510 are coupled to ouput 2q of flip - flop circuit 503 and the output of and circuit 505 ; the inputs of nand circuit 511 are coupled to the output of and circuit 504 and the output of inverter circuit 516 ; the inputs of nand circuit 512 are coupled to the output of nand circuit 514 and the output of and circuit 505 ; the inputs of and circuit 506 are coupled to the outputs of nand circuits 511 and 512 ; the inputs of nand circuit 513 are coupled to the outputs of nand circuits 507 , 508 and 514 ; the inputs of nand circuit 514 are coupled to the outputs of nand circuits 513 , 509 and 510 ; the input of inverter circuit 517 is coupled to the output of nand circuit 513 ; the input of inverter circuit 516 is coupled to the output of nand circuit 514 ; and the input of inverter circuit 515 is coupled to output 3q of flip - flop circuit 503 . the 3d input of flip - flop circuit 503 is coupled to the output of and circuit 506 and the 4d input of flip - flop circuit of 503 is coupled to the 1q output of flip - flop circuit 503 . the outputs of inverters 515 and 517 are coupled to an up - down counter 518 which forms the first element of a controller group receiving the outputs of circuit section 500 . a description of the controller group is found in u . s . patent application ser . no . 766 , 242 , entitled method and apparatus for setting and varying margins and line spacing on data printers , invented by william wegryn and juan f . velazquez , filed concurrently herewith , the disclosure of which is hereby incorporated by reference . a comparator 519 is coupled to counter 518 and a control logic and memory circuit 520 which is , in turn , coupled to an input / output interface 521 and a control character decoder 522 . control logic and memory circuit 520 also has an input from an operator - controlled keypad 550 and an input from a needle controller 525 . typical voltage signals from key pad 550 represent the binary number addresses of the left and right - hand margins desired by the operators . if desired , limit switches located at the left and right extremes of print head movement can be electrically coupled to logic and memory circuit 520 to provide voltage signals indicating the presence of the printing head 200 at the maximum permissible extreme of travel to either the left or the right . alternatively , maximum lateral travel can be indicated by an absence of pulses from encoder 206 during a period of time such as , for example , 50 milliseconds . the absence of pulses indicates printing head 200 has reached left or right limit or has jammed with respect to lateral movement . interface 521 is coupled to a data input source 523 , to the control character decoder 522 , and to a character storage buffer 524 . a needle power amplifier 527 is coupled to buffer 524 , sequentially , through a character generator read - only memory 526 and a needle controller 525 . the needle power amplifier 527 is also coupled to receive an input from a variable one - shot multivibrator 528 . a paper feed controller 529 is coupled to control character decoder 522 . up - down counter 518 stores the current printing head address , i . e ., the particular lateral location of the printing head 200 along the platen 202 , expressed in binary notation representing the number of dot positions from a reference point . the output of inverter 517 ( line 5 , fig4 ) indicates direction thus causing counter 518 to increment or decrement the stored binary number address when the output from inverter 515 ( inverse of line 7 ) indicates the presence of a pulse . more specifically , the voltage level of the signal output of inverter 517 establishes the sign of the binary number represented by the voltage output of inverter 515 . voltage signals sent from counter 518 to comparator 519 represent binary numbers indicating the actual location of the printing head 200 along the platen 202 . comparator 519 also receives voltage signals from control logic circuit 520 representing the binary number address of the location where the printing head 200 is desired to be located by the operator . comparator 519 compares the voltage signals representing the actual location of the printing head 200 with the voltage signals representing the desired location of the printing head 200 and generates voltage signals representing the difference between the two locations . that is , the output of comparator 519 is a voltage signal representing the distance from the actual location to the desired location of the printing head 200 and is applied to control logic circuit 520 . a carriage servo , power amplifier and motor circuit 552 is coupled to receive an input from control logic circuit 520 and determines the right and left movement of the printing head 200 along the platen 202 . carriage servo , power amplifier and motor circuit 552 also is coupled to receive an output of voltage pulses from circuit section 500 indicating movement of printing head 200 . the servo of circuit 552 is set for a given pulse repetition rate and changes the motor speed to attain that repetition rate . that is , if the received pulse repetition rate is too slow the motor is speeded up , and if the received pulse repetition rate is too fast the motor is slowed down . the data which is eventually printed on the printing surface 557 by the printing head 200 is supplied at data source 523 . a typical source can be , for example , a magnetic memory having information describing a particular paragraph to be printed . interface 521 is adapted to adjust the level of the voltage signals from data source 523 to the level required by control logic circuit 520 . for example , if control logic circuit 520 uses transistor logic , voltage applied to circuit 520 should be in the range of about 0 to 5 volts . in addition to translating voltage levels , interface 521 can also match impedance levels and filter out noise from data source 523 . further , interface 521 is coupled to data source 523 to send voltage signals indicating whether interface 521 can receive additional data . paper feed controller 529 applies a voltage signal to power amplifier and step motor 553 causing the paper to move one vertical increment . in one embodiment of this invention , twelve incremental steps are required to move the paper one line . paper feed controller 529 includes logic and memory circuits for determining the last instructions sent to motor power amplifier 553 and for determining how many more increments are acquired to complete one line . control character decoder 522 decodes characters from data source 523 which are not to be printed but , instead , are used to indicate such actions as line feed , carriage return , horizontal tab and various other control functions . for example , a single character representing the spacing of a certain number of lines is converted into an order for a discrete number of line spacings equal to the desired vertical distance . the completion of a control function is transmitted by a connection from paper feed controller 529 to decoder 522 . needle controller 525 operates in a manner analogous to paper feed controller 529 . more specifically , a character can have for example , 10 vertical segments much the same as each line can have a plurality of horizontal segments . needle controller 525 has an output of voltage signals representing the next character to be printed and the vertical column in which the character is to start . information about where the printing head 200 should be located is introduced into control logic 520 and compared in comparator 519 to the current print head address . information for the actuation or firing of the printing needles 556 is sent from control logic 520 to needle controller 525 and information indicating completion of printing at a given lateral location is sent from needle controller 525 to control logic 520 . in accordance with an embodiment of this invention , print needle actuation current for displacing a printing needle 556 is supplied to an actuating solenoid 555 from an unregulated power supply 554 for a regulated period of time determined by a variable one - shot multivibrator 528 which is coupled to needle power amplifier 527 . needle 556 is mechanically coupled to actuating solenoid 555 which , in turn , is electrically coupled to power supply 554 through the serial combination of multivibrator 528 and needle power amplifier 527 . needle power amplifier 527 is also electrically coupled to character generator memory 526 and receives a voltage level from character generator memory 526 which determines whether a pulse from multivibrator 528 supplying power is accepted or rejected . although unregulated power supplies are desirable because there is no heat generated by regulation and cooling requirements are therefore reduced , they may adversely affect the consistency and quality of the printed dots , which depend on the amount of power supplied to the solenoids 555 of the printing needles 556 . multivibrator 528 has an input representative of the voltage level of power supply 554 , and serves to regulate the duration of the time power supply 554 supplies current to the actuating solenoids 555 which drive the printing needles 556 . thus , regulation is accomplished by changing the width , i . e ., duration , of an actuating pulse from power supply 554 to needle power amplifier 527 . the power supply actuating pulse can be initiated , for example , by the pulses shown in fig4 line 7 , indicating a printing position has been reached . the action of variable one - shot multivibrator 528 is much like that of a switch which is closed during the duration of the pulse thereby connecting power supply 554 to power amplifier 527 . since a relatively constant amount of power is desired to be applied to the solenoids 555 activating the needles 556 , a high voltage at the output of power supply 554 causes variable one - shot multivibrator 528 to remain closed a shorter period of time than when a lower voltage is present at the output of power supply 554 . as a result , although power supply 554 is not regulated the power applied to needle power amplifier 527 is substantially regulated . referring to fig6 there is shown a wheel 20a in accordance with another embodiment of this invention . wheel 20a has a higher effective density of light - passing windows and permits a higher density of characters on the printed surface 557 . wheel 20a includes an outer ring of equally - spaced windows 101a , 101b , et seq . as in the embodiment shown in fig2 ( which for purposes of illustration here may be considered as including twenty such windows ). additionally , an innermost ring has a single window 103 to provide synchronization pulses , and an intermediate ring has another series of equally spaced windows 105 , i . e ., 105a , 105b , et seq . which for illustration may include thirty - three windows , as opposed to twenty , to provide a higher dot density on the printing surface 557 . a housing 30a , similar to housing 30 of fig1 has five openings to pass light between five pairs of light - emitting diodes and photo - transistors . as in the embodiment in fig2 the outer row of windows has two openings in housing 30a associated with it , here designated 33 and 35 . similarly , the intermediate row of windows has two housing openings 137 and 139 associated with it . in each case , the two openings and their associated two pairs of light - emitting diodes and photo - transistors are used to determine the direction of rotation of wheel 20a . a selective switching means chooses the electrical outputs associated with either the outer or intermediate ring depending upon the dot density desired . for example , the switching means can be included in amplifier 501 . the innermost ring with single window 103 has a single light - emitting diode and photo - transistor pair associated with it in housing 30a , at an opening 141 aligned to intersect the innermost ring . the output pulse produced by window 103 in the third ring is used to indicate the passing of window 103 by housing 30a which occurs once during each rotation of wheel 20a . this output pulse is used as a synchronization check to make sure that the number of windows counted during each complete rotation of wheel 20a is equal to the actual known number in the outer row or in the intermediate ring , whichever is selected . it is possible , in actual practice , for the printing head 200 to go out of synchronization for any number of reasons , including an electrical noise spike giving an erroneous indication of movement , or slippage or variation in the mechanical coupling between the printing head 200 and the encoder 206 . synchronization is accomplished by counting the pulses from the selected ring of multiple equally - spaced windows after a pulse is received from the innermost synchronization ring containing only a single window . after the number of pulses corresponding to the known number of windows in the outer ring are received , another synchronization pulse should be received . a synchronization pulse occurring when fewer than or more than the normal number of pulses have been counted indicates that the physical location of the printing head 200 is not synchronized with the location of the printing head 200 as indicated by the electronic logic circuitry . when such an out - of - synchronization signal is received , printing can be stopped by appropriate means , or an alarm signal sounded . if printing were to continue , provision can be made in the controller for electronically modifying the address counter so that it reflects the correct head position . any misalignment of left and right margins of a printed line may also be taken as an indication of a loss of synchronization of the printing head 200 . if , for example , an outer ring having twenty windows 101 is used to activate a printing head 200 to form a dot matrix character on the printing surface , and each window 101 is correlated to a single dot position of the printing head 200 across the platen 202 , there may advantageously be ten character spaces per inch and each character space may have twelve vertical columns , with the last three vertical columns being used for spacing between adjacent printed characters . thus the characters themselves may each consist of nine vertical columns . if , for comparison , the intermediate ring having thirty - three windows 105 is used , with other factors remaining the same , the character density will increase to sixteen and one - half characters per inch . in effect , each character is made narrower when the intermediate ring is used than when the outer ring is used . the number of characters printed per second remains the same , and is not affected by the particular ring used , but the speed of movement of the printing head 200 is less when the intermediate row of windows 105 is used than when the outer row of windows 101 is used . of course , the encoding techniques described , including the particular examples given for illustration , may be used with many different specific printer speeds . various modifications and variations will no doubt occur to those skilled in the art to which this invention pertains . for example , the coupling of the encoder 206 to the printing head 200 may be varied from that disclosed herein . similarly , the shape and spacing of the windows 100 , 101 , 105 may be varied from that disclosed here . these and all other variations which basically rely on the teachings through which this disclosure has advanced the art are properly considered within the scope of this invention . | 6 |
fig1 shows a plate - link chain portion 1 in double configuration in simplified form . the plate - link portion 1 includes four rocker pressure member pairs 4 , 5 , 6 , and 7 . each rocker pressure member pair 4 through 7 includes two rocker pressure members 8 , 9 . two of the rocker pressure member pairs 4 through 7 serve to constitute a chain link 11 , 12 , 13 . in the double configuration shown in fig1 , the chain links 11 and 13 are designed as shorter or short chain links . chain link 12 is designed as a longer or long chain link . the longer chain link 12 includes four plate - links 21 through 24 , which are coupled with one another by the rocker pressure member pairs 5 and 6 . the plate - links 21 through 24 of the long chain link 12 are of identical design . the short chain link 11 includes four plate - links 31 through 34 , which are coupled with one another by the rocker pressure member pairs 4 and 5 . the short chain link 13 includes four plate - links 35 through 38 , which are coupled with one another by the rocker pressure member pairs 6 and 7 . the plate - links 31 through 38 of the short chain links 11 and 13 are of identical design . a chain running direction extends in the vertical direction in fig1 . in the plate - link chain portion 1 , the two plate - links 22 , 23 of the long chain link 12 are disposed medially . the plate - links 31 , 32 , 33 , 34 , 35 , 36 , 37 , 38 of the short chain links 11 and 13 are combined in pairs . the plate - link pairs 31 , 32 and 35 , 36 of the short chain links 11 and 13 contact one another at their longitudinal ends that face one another . the plate - link pairs 31 , 32 and 35 , 36 are disposed laterally relative to the chain running direction between the plate - links 21 and 22 of the long chain link 12 . the plate - link pairs 33 , 34 and 37 , 38 of the short chain links 11 and 13 are similarly disposed laterally relative to the chain running direction between the plate - links 23 and 24 of the long chain link 12 . the longitudinal ends of the plate - link pairs 33 , 34 and 37 , 38 that face one another contact one another . intermediate spaces 29 , 30 are produced between the outer plate - links 21 , 24 of the long chain link 12 and the plate - links 31 , 35 , 34 , 38 of the shorter chain links 11 and 13 in the arrangement shown in fig1 . furthermore , the double configuration in fig1 includes intermediate spaces 39 , 40 between the longer plate - links 22 , 23 of the long chain link 12 and the shorter plate - links 32 , 36 , 33 , 37 of the shorter chain links 11 and 13 . the intermediate spaces 29 , 30 and / or 39 , 40 are advantageously provided with spacing and / or biasing elements ( not shown in fig1 ). filling the intermediate spaces 29 , 30 , 39 , 40 fulfills at least one of the following functional options . 1 . weight balancing for a uniform distribution of weight in the plate - link chain ; 2 . joint damping by means of elastic elements which lie pre - stressed around the rocker joints ; 3 . damping through axial bracing of the plate - links against one another ; 4 . springing / damping of the plate - links against the respective neighbor rocker pressure piece in the chain running direction ; 5 . springing / damping of the plate - links against following plate - links in the chain running direction . fig2 a shows a side view of a portion of a plate - link chain 41 having a long chain link 42 . within a longer plate - link 43 of the long chain - link 42 there are visible two longitudinal ends or bows 44 , 45 of plate - links of a longer and a shorter chain link . to the left thereof the same is shown , but in the foreground . the mutually facing longitudinal ends or bows 44 , 45 of the plate - links of the two chain links contact one another . the ends 44 , 45 are shaped on top so that the plate - links to which they belong are in contact when the chain is in a straight strand , as shown in fig2 a . by straight contacting surfaces at the ends 44 , 45 or bows in a contact region 48 , unwanted swing - back of the plate - link chain 41 is prevented when it is in the straight strand orientation . in the intermediate spaces 29 , 30 shown in fig1 , and laterally relative to the chain running direction , between individual plate - links of the longer and shorter chain links spacing and / or biasing elements 51 through 54 are positioned as shown in fig2 b . the spacing and / or biasing elements 51 through 54 on the one hand prevent unwanted telescoping of the longer chain links . in addition , so - called guide tips , which are also referred to as overlap tips and will be explained below in reference to fig5 , can be eliminated . fig3 a through 3d show different forms of spacing and / or biasing elements 61 through 64 in side views . the spacing and / or biasing elements 61 , 62 , and 64 are essentially h - shaped . the spacing and / or biasing element 63 is essentially x - shaped . the spacing and / or biasing element 62 has a notch 65 on top . the spacing and / or biasing element 63 has notches 66 , 67 on top and bottom . the spacing and / or biasing element 64 has a central opening 68 . fig4 shows a spacing and / or biasing element 61 of fig3 a in a perspective view . in that view it can be seen that the spacing and / or biasing element 61 is made of a corrugated material having corrugations 69 that extend between opposed longitudinal outer edges of the biasing element 61 . the material from which biasing element 61 is made can be a spring material . fig5 shows a plate - link chain portion 71 in triple configuration , also referred to as a triple grouping . the illustrated plate - link chain portion 71 includes four rocker pressure member pairs 74 through 77 , which serve to connect three chain links 81 through 83 . the chain links 81 and 83 are designed as shorter chain links . chain link 82 is designed as a longer chain link . the shorter chain link 81 includes four plate - links 31 through 34 , which are designed and identified exactly like the plate - links of the shorter chain link 11 in fig1 . the longer chain link 82 includes four plate - links 21 through 24 , which are configured and arranged exactly like the plate - links of the longer chain link 12 in fig1 . the shorter chain link 83 includes four plate - links 85 , 86 , 87 , and 88 , which are distributed differently than the other plate - links in the plate - link chain portion 71 . at the longitudinal ends of the plate - links 85 through 88 as shown in fig5 , in an overlap region 90 , there result overlap ends , which are also referred to as guide ends . in a manner similar to the previously described spacing and / or biasing elements , the overlap ends prevent unwanted sliding between one another of laterally spaced plate - links of the chain links 81 through 83 . however , the overlap ends or guide ends do not perform a biasing function , as do the spacing and / or biasing elements 61 . | 5 |
plasmid pspr6 ( see fig1 ), ( in escherichia coli nm554 host ncimb 40786 deposited with the national collections of industrial and marine bacteria limited , 23 st machar drive , aberdeen ab2 1ry scotland uk on feb . 8 , 1996 under the budapest treaty ) contains unique noti and spei restriction sites which are positioned on either side of the plasmid origin of replication ( ori ) and on either side of a tetracycline resistance marker teta / r . this plasmid allows the insertion of two independent copies of an expression cassette to improve the genetic stability of the plasmid during fermentations . in this example the expression cassette was dna encoding the expression of a fungal xylanase comprising of a constitutive promoter ( gene a3 promoter from bacteriophage t7 ), a ribosome binding site ( from lac z of e . coli ), the coding sequence for the enzyme ( truncated xylanase gene from plasmid pnx10 described in wo 93 / 25693 ) and a transcriptional terminator from bacteriophage t4 . the expression cassette was flanked by either noti or spei restriction sites . the expression cassette can be obtained by complete digestion of the plasmid pspr8 in e . coli nm554 , ( ncimb 40787 deposited with the national collections of industrial and marine bacteria limited , 23 st machar drive , aberdeen ab2 1ry scotland uk on feb . 8 , 1996 under the budapest treaty ) using restriction endonucleases noti or spei in a high salt restriction buffer . strain e . coli nm554 ( pspr8 ) was constructed as follows : plasmid dna was prepared from e . coli strain nm554 ( pspr6 ) grown overnight at 37 ° c . in l broth ( 1 % tryptone , 0 . 5 % yeast extract , 0 . 5 % nacl ) using &# 34 ; rapid pure miniprep &# 34 ; ( rpm ) ( stratech scientific ltd , luton , uk ) following the manufacturers protocol . plasmid dna may also be isolated using standard methods such as described by sambrook et al 1 . 50 μl of plasmid pspr6 dna was digested with restriction endonuclease noti ( boehringer mannheim , lewes , uk ) with the addition of 6 μl of the manufacturers h buffer ( high salt restriction buffer ) and 20 units of restriction enzyme . digestion was carried out at 37 ° c . for 16 h . the xylanase expression cassette was digested with noti and ligated to plasmid pspr6 similarly digested with noti , as follows . the two species of dna were mixed and the restriction enzyme and other contaminants were removed using an rpm miniprep ( following the manufacturer &# 39 ; s protocol but with the following modifications : dna mixture used in place of cleared lysate and dna eluted into 40 μl ). 0 . 5 μl of 100 mm adenosine triphosphate ( atp ) was added with 4 μl of m buffer ( medium salt restriction buffer ). 1 unit of t4 dna ligase ( boehringer mannheim ) was added and the reaction incubated at 18 ° c . for 16 h . 5 μl of the ligation reaction was mixed with 100 μl of e . coli strain jm109 ( atcc 53323 ) competent cell suspension , produced by calcium chloride treatment essentially as described by hanahan 2 , and incubated on ice for 45 m . cells were then heat shocked at 42 ° c . for 90 s and returned to ice for 2 m . 1 ml of l broth was added and cells incubated at 37 ° c ., with shaking , for 1 h before plating out dilutions onto l agar plates ( l broth + 1 % bacteriological agar ) containing 10 μg / ml tetracycline and 1 % remazol brilliant blue -- xylan ( rbb - xylan , sigma , poole , uk ). plates were incubated for 24 h at 37 ° c . one colony which gave a zone of clearing and contained the expected plasmid when miniprep dna was digested with noti was designated jm109 ( pspr7 ). plasmid dna from pspr7 which is shown diagramatically in fig2 was prepared as above from an overnight culture of jm109 ( pspr7 ) in l broth supplemented with 10 μg / ml tetracycline . 50 μl of plasmid dna was linearised by digestion with restriction endonuclease spei ( boehringer mannheim ) by adding 5 μl of manufacturers h buffer and 20 units of spei enzyme . reaction was incubated for 16 h at 37 ° c . the position of the noti flanked xylanase expression cassette ( xyl ) relative to the plasmid origin of replication ( ori ) and the selectable marker ( teta / r ) is shown . a second xylanase expression cassette , identical to the first except flanked by spei restriction sites rather than noti , was digested with spei as described above . this expression cassette may be obtained by the complete digestion of plasmid pspr8 with the restriction enzyme spei . this dna was ligated to spei digested plasmid pspr7 exactly as described above but with selection of transformants on l agar containing 10 μg / ml tetracycline . tetracycline resistant colonies were screened using a rapid lysis method ( twigg and sherrett 3 ) to estimate the size of the plasmid carried . 1 colony which contained a plasmid larger than plasmid pspr7 and which subsequent digests of isolated plasmid dna with noti and spei restriction endonucleases showed to contain 2 copies of the xylanase expression cassette was designated jm109 ( pspr8 ), see fig3 which shows plasmid pspr8 showing the positions of both inserted xylanase expression cassettes ( xyl ) relative to the plasmid origin of replication ( ori ) and selectable marker ( teta / r ). plasmid dna was prepared from jm109 ( pspr8 ) and jm109 ( pspr7 ) and 1 μl used to transform e . coli strain nm554 ( stratagene , cambridge , uk ). preparation of dna and competent cells and transformation of dna were done as described above . transformants were selected on l agar containing 10 μg / ml tetracycline . stocks of nm554 ( pspr7 ) and nm554 ( pspr8 ) were stored at - 70 ° c . in l broth containing 10 μg / ml tetracycline and 25 % ( v / v ) glycerol . to prepare a fermentation inoculum , 50 ml of l broth containing 10 μg / ml tetracycline was inoculated with 500 μl from freezer stock and grown for approximately 4 h at 37 ° c . with rapid aeration before transfer to the fermenter . fermentations were done using braun ed / er5 fermenters ( b . braun biotech , reading , uk ) . vessels were in situ sterilised and bottom agitated using 2 × 70 mm diameter rushton impellers . the fermenter working volume was approximately 2 l . the medium used throughout the experiments was jv1 ( see appendix ). temperature was maintained at 37 ° c .± 0 . 2 ° c . the ph was measured using an ingold ph probe and maintained at 6 . 7 ± 0 . 1 by the controlled addition of filter sterilised 10m nh 4 oh and 2m h 3 po 4 . an agitation speed of 600 rpm was used with air or 35 % o 2 aeration to maintain a % po 2 ( dissolved oxygen tension ) between 20 % and 80 %, of saturation measured by an ingold oxygen probe . foaming was controlled by the addition of sterile diamond shamrock ppg foamaster eea 142 at a rate of 0 . 1 ml / h . 50 ml inoculum was transferred to the fermenter which contained 2 l of jv1 medium plus 30 g / l glycerol and 10 ppm fe 2 + ( as feso 4 . 7h 2 o ). cultures were allowed to grow in batch to a point at which the co 2 evolution rate was between 10 and 40 mm / l / h ( typically 20 mm co 2 / l / h ), when the fermenter was switched to continuous operation at a dilution rate of 0 . 1 h - 1 . jv1 medium was fed with separate feeds of sterile glycerol ( feed rate 30 g / 1 ) and feso 4 . 7h 2 o ( feed rate 10 mg fe 2 + / l ). 1 ml samples were regularly withdrawn and stored at - 20 ° c . in 25 % glycerol for later analysis of plasmid content . enzyme activity and dry cell weight was also periodically measured in 10 ml samples . xylanase enzyme activity was determined by measuring the amount of reducing sugar released from soluble oat spelt xylan substrate ( 1 %), essentially as described by kellett et al 4 . the production of xylanase and molecular weight was confirmed by sodium dodecyl sulphate polyacrylamide gel electrophoresis ( sds - page ) on an 8 - 25 % gradient gel with commasie blue protein staining using phast electrophoresis system ( pharmacia biotech , st albans , uk ). dry cell weights were determined by pelleting the cells in the withdrawn sample by centrifugation at 5700 rpm in a beckman tj - 6 centrifuge for 20 m and resuspending cells in 2 - 3 mls tris buffer ( 100 mm , ph7 . 2 ). cells were then re - pelleted and dried in a pre - weighed tube in an oven at 105 ° c . for 16 h and mass of dried cells determined . changes to plasmid size during the fermentations were detected by plating of stored fermentation samples onto l agar containing 10 μg / ml tetracycline and 1 % rbb - xylan . colonies were then picked and lysed using the procedure described by twigg and sherrett 3 . changes in plasmid size were seen as a shift in mobility of the plasmid band on a 1 % agarose gel compared to the control plasmid ( agarose gel electrophoresis was done as described by sambrook et al 1 ). fig4 shows xylanase activities ( ku / ml ) for fermentations of e . coli strains nm554 ( pspr7 ) ⋄, and nm554 ( pspr8 ), ♦, growing in jv1 medium . cultures switched from batch to continuous culture , with dilution rate of 0 . 1 h - 1 , at approx . 10 hrs . these results show that strain nm554 ( pspr7 ), with a single copy of the xylanase expression cassette , very rapidly lost enzyme activity during continuous culture . sds page analysis of samples confirmed that the loss of enzyme activity corresponded to the loss of production of a heterologous protein band . examination of plasmids using the rapid lysis technique showed no difference in plasmid size compared to pspr7 control in samples taken up to 19 hrs , but showed several differently sized plasmids at the 50 hr and 72 hr sample points , indicating rearrangements and deletions had occurred in this plasmid causing the loss of enzyme activity . strain nm554 ( pspr8 ), containing 2 copies of the xylanase expression cassette , produced a high level of xylanase activity for 480 hrs in continuous culture . sds page confirmed production of heterologous protein over this time period . analysis of plasmids from fermentation samples showed no detectable change in plasmid size during the course of this experiment , indicated that no rearrangements or deletions had occurred . it was noted that the peak xylanase activity for nm554 ( pspr7 ) was higher than for nm554 ( pspr8 ) when the continuous fermentation was operated at a dilution rate of 0 . 1 h - 1 . in order to investigate whether the observed increase in strain stability was due to this initial reduction in enzyme expression strain nm554 ( pspr7 ) was fermented as previously but with a dilution rate of 0 . 2 h - 1 . this had the effect of reducing the peak xylanase activity to a comparable level to that seen with strain nm554 ( psprs ) operated at a dilution rate of 0 . 1 h - 1 . results showed the same instability despite the reduced expression level . analysis of plasmid content showed changes in plasmid size similar to those seen previously . the invention was further exemplified through production of a second protein , a haloalkanoic acid dehalogenase . in this example the host strain , promoter , ribosomal binding site , structural gene and fermentation medium were all different from those used in the xylanase example indicating the wide applicability of the invention . plasmid pspr6 was modified to remove the unique noti restriction site and introduce a unique psti restriction site at the same position . plasmid pspr6 dna was isolated and digested with noti restriction enzyme , as above . approx 2 μg of a synthetic oligonucleotide with the sequence ggccctgcag ( seq id no : 1 ) was self annealed by heating to 94 ° c . in high salt restriction buffer and cooling slowly to room temperature . the annealed oligonucleotide and digest ed pspr6 dna were mixed , atp added to final concentration of 1 mm and 1 unit of t4 dna ligase added . reaction was incubated at 18 ° c . overnight . ligation mix was transformed into jm109 competent cells as described above and plated onto l agar plates containing 10 μg / ml tetracycline . randomly picked colonies were screened by isolating plasmid dna and digesting with not i and psti restriction enzymes in separate reactions . one clone which failed to digest with noti but digested with psti was isolated and designated jm109 ( pspr6pst ). plasmid pspr6pst dna was isolated and digested with psti restriction enzyme in high salt restriction buffer . after 3 h incubation at 37 ° c . 1 unit of calf intestinal alkaline phosphatase ( boehringer mannheim ) was added to prevent relegation . the reaction was incubated at 37 ° c . for a further 30 mins then stopped by adding edta to a final concentration of 5 mm and heating the reaction to 75 ° c . for 10 mins . the dehalogenase expression cassette , comprising the e . coli trp promoter , a two cistron type ribosomal binding site ( gold and stormo 5 ), the hadd dehalogenase structural gene ( barth et al 6 .,) and t4 phage transcriptional terminator , may be obtained by digesting the plasmid pspr11 . 1 ( deposited in e . coli host strain xl1 blue mr at ncimb as deposit no 40859 on feb . 12 , 1997 ) with the restriction enzyme psti as described above . plasmid pspr10 , which contains a single copy of the dehalogenase expression cassette , may then be obtained by ligation of this dna with the pspr6pst dna prepared as above , selecting for transformants on lagar containing 10 μg / ml of tetracycline . plasmid pspr11 . 1 ( available from ncimb in host strain xl1 blue mr , deposit no 40859 ), contains 2 copies of the same dehalogenase expression cassette . this plasmid was constructed by the addition of a second copy of the expression cassette into a unique swai restriction site on plasmid pspr10 . plasmid pspr10 dna was isolated as previously and digested with restriction enzyme swai in high salt restriction buffer before treatment with calf intestinal alkaline phosphatase as described above . the dehalogenase expression cassette may be obtained by digestion of pspr11 . 1 with restriction enzyme psti . to produce blunt ended dna compatible with the swai digested plasmid pspr10 , 1 unit of t4 dna polymerase ( boehringer mannheim ) and a final concentration of 200 μm each deoxyadenosine 5 &# 39 ; triphosphate , deoxy - cytidine 5 &# 39 ; triphosphate deoxyguanosine 5 &# 39 ; triphosphate and thymidine 5 &# 39 ; triphosphate ( all from boehringer mannheim ) was added to the reaction after 3 h incubation and incubated a further 30 mins at 12 ° c . the reaction was stopped by heating to 75 ° c . for 10 mins . the blunt ended dehalogenase expression cassette and swai digested pspr10 were ligated and transformed into xl1 blue mr competent cells ( stratagene ) as described above and plated onto l agar plates containing 10 μg / ml tetracycline . plasmid pspr11 . 1 was identified by restriction digests of isolated plasmid dna , as containing 2 copies of the expression cassette in opposite orientations to one another . fermentation experiments were conducted in a derivative of e . coli strain w3110 ( atcc 27325 )( american type culture collection ( atcc ), 10801 university blvd , manassas , va ., 20110 - 2209 , usa ) engineered to be recombinationally deficient due to a deletion of the recj gene . the construction of this strain is given , but other recombinationally deficient hosts may also be used . 2 pcr products were produced of regions of the e . coli chromosome flanking the recj gene , primers used were : ctggatcccggcgttttcaggctttgctc ( seq id no : 2 ) with acagatcttcaccgaccacaataatccgc ( seq id no : 3 ) to give product 1 and acagatcttgaccctgtgcgagaaactgg ( seq id no : 4 ) with tgggatccgctcggcgtttacttcttcca ( seq id no : 5 ) to give product 2 . pcr reactions were carried out using 35 cycles of denaturation at 94 ° c . for 1 min ; prime annealing at 60 ° c . per 1 min and product extension at 72 ° c . per 1 min . reactions were performed in a volume of 100 μl , containing 200 μm of each nucleoside triphosphate . taq dna polymerase buffer ( promega , southampton ;) and 5 units of taq dna polymerase . e . coli w3110 cells were used as template dna . the 2 pcr products produced were purified using an rpm column , as above , and cloned using the pmos blue t vector kit ( amersham , amersham , uk ) following the manufacturers protocol . plasmid containing pcr product 1 was isolated and digested with restriction enzyme bglii ( boehringer mannheim ) in medium salt restriction buffer . a dna fragment encoding streptomycin and spectinomycin resistance was produced by bam hi restriction digestion of plasmid put :: minitn5sm / sp ( de lorenzo 7 ) in medium salt restriction buffer . this fragment was ligated to the digested plasmid and transformed into xl1 blue mr competent cells with selection for transformants on l agar containing 50 μg / ml ampicillin and 25 μg / ml streptomycin . the insert from this plasmid was released by restriction digestion with the enzyme bamhi in medium salt restriction buffer . this fragment was ligated to the plasmid containing pcr product 2 which was digested with the restriction enzyme bglii . ligation and transformation was as above . a clone was identified by restriction digestion of isolated plasmid dna in which the streptomycin / spectinomycin resistance gene was flanked by dna which normally flanks the recj gene on the e . coli chromosome . the deletion of the recj gene on the e . coli chromosome was achieved by transformation of e . coli strain jc7623 ( atcc 47002 ). the above plasmid was digested using the restriction enzyme bamhi and the dna concentrated by ethanol precipitation ( sambrook et al 1 ) to give a final concentration approx 500 ng / ul . fresh electrocompetent jc7623 cells were produced ( sambrook et al 1 ) and 2 μl of digested plasmid dna was transformed by electroporation in gene pulser electroporation apparatus ( bio - rad , hemel hempstead , uk ) ( 15 kv / cm , 25 μf capacitance , 2000 parallel resistance ). after a 2 hr recovery period shaking in l broth at 37 ° c ., transformants were recovered on l agar containing 25 μg / ml streptomycin and 25 μg / ml spectinomycin . transformants were screened for sensitivity to ampicillin by plating onto l agar containing 100 μg / ml ampicillin . a transformant was identified as resistant to streptomycin and spectinomycin but sensitive to ampicillin and with an increased sensitivity to uv light compared to strain jc7623 . this strain was designated jc7623 δrecj . the δrecj mutation was introduced to strain w3110 by p1 phage transduction . a phage lysate was raised on jc7623 and used to infect w3110 using the method described by miller 8 . transductants were selected on l agar containing streptomycin and spectinomycin as above . for fermentations the strain w3110 δrecj was transformed with the plasmids pspr10 and pspr11 . 1 using electroporation as described above . fermentation inocula and fermentations of dehalogenase producing strains were carried out essentially as described for xylanase production except that no yeast autolysate was present in the medium and glucose was used rather than glycerol . dehalogenase enzyme activity was measured as the rate of dechlorination of 2 - chloropropionic acid , ( fluka chemical , gillingham , dorset , uk ) neutralised with naoh . results of continuous fermentations of w3110 δrecj ( pspr10 ) and w3110 δrecj ( pspr11 . 1 ) are shown in fig5 . they show dehalogenase activities ( units / ml ) for fermentations of e . coli strains w3110 δrecj ( pspr10 ) ▴ and w3110 δrecj ( pspr11 . 1 ) growing in jv1 medium , modified as described . the cultures were switched from batch to continuous operation , with dilution rate of 0 . 1 h - 1 , at approx 40 hrs . it can clearly be seen that the strain with pspr11 . 1 , containing 2 copies of the dehalogenase expression cassette , has much greater stability than the strain with plasmid pspr10 , which has only a single copy of the expression cassette . it is clear that although the peak enzyme activity is reduced the overall productivity of the fermentation is greatly enhanced . appendix______________________________________fermentation medium ( jv1 ) ______________________________________k . sub . 2 so . sub . 4 2 g / l mgso . sub . 4 . 7h . sub . 2 o 1 . 5 g / l h . sub . 3 po . sub . 4 ( 85 %) 0 . 14 ml / l cacl . sub . 2 . 2h . sub . 2 o 0 . 11 g / l trace elements solution 1 ml / l yeast autolysate ( biospringer , low salt , 20 g / l grade d ,) thiamine hcl ( sigma chemicals , uk 0 . 5 ml / l 32 g / l sterile stock ) tetracycline hydrochloride ( sigma chemicals , uk 0 . 15 ml / l 67 mg / ml sterile stock ) ______________________________________ trace element solution contained 0 . 2 g / l alcl 3 . 6h 2 o , 0 . 08 g / l cocl 2 . 6h 2 o , 0 . 02 g / l cucl 2 . 2h 2 o , 0 . 01 g / l h 3 bo 4 , 0 . 2 g / l ki , 0 . 5 g / l mnso 4 . h 2 o , 0 . 01 g / l niso 4 . 6h 2 o , 0 . 5 g / l na 2 mo 4 . 2h 2 o , 0 . 5 g / l znso 4 . 7h 4 o . all chemicals were of &# 34 ; ar &# 34 ; grade and obtained from fisons ( loughbrough , uk ) unless otherwise stated . sterilisation was carried out at 121 ° c . for 30 m . thiamine , trace elements and tetracycline solutions were filter sterilised through a 0 . 2 μm filter and added aseptically . 1 . sambrook , j ., e . f . fritsch and t . maniatis . 1989 . molecular cloning , a laboratory manual . cold spring harbor laboratory press , new york . 2 . hanahan , d . 1985 . techniques for transformation of escherichia coli . in : dna cloning vol , a practical approach ( ed : d . m . g . glover ) pp 109 - 135 . irl press , oxford . 3 . twigg , a . t . and d . sherratt . 1980 . trans - complementable copy number mutants of plasmid cole1 . nature 283 pp 216 - 218 . 4 . kellet , l . e ., d . m . poole , l . m . a . ferreira , a . j . durrant , g . p . hazelwood and h . j . gilbert . 1990 . xylanase b and an arabinofuranosidase from pseudomonas fluorescens subsp . cellulosa contain identical cellulose - binding domains and are encoded by adjacent genes . biochem j 272 pp 369 - 376 . 5 . gold , l . and stormo , g . d ., 1990 . high level translation initiation . methods in enzymology 185 p 89 - 103 . 6 . barth , p . t ., bolton , l ., and thomson j . c ., 1992 . cloning and partial sequencing of an operon encoding two pseudomonas putida haloalkanoate dehalogenases of opposite stereospecificity . journal of bacteriology 174 , p 2612 - 2619 . 7 . de lorenzo , v ., herrero , m ., jakubzik , u . and timmis , k . n . 1990 . mini - t - 5 transposon derivatives for insertion mutagensis , promoter probing and chromosomal insertion of cloned dna in gram negative eubacteria . journal of bacteriology . 172 p 6568 - 6571 . 8 . miller , j . h . 1972 . in : experiments in molecular genetics , pp 201 - 205 . cold spring harbor laboratory , new york . __________________________________________________________________________ # sequence listing - - - - & lt ; 160 & gt ; number of seq id nos : 5 - - & lt ; 210 & gt ; seq id no 1 & lt ; 211 & gt ; length : 10 & lt ; 212 & gt ; type : dna & lt ; 213 & gt ; organism : artificial sequence & lt ; 220 & gt ; feature : & lt ; 223 & gt ; other information : description of artificial - # sequence : oligonucleotide - - & lt ; 400 & gt ; sequence : 1 - - ggccctgcag - # - #- # 10 - - - - & lt ; 210 & gt ; seq id no 2 & lt ; 211 & gt ; length : 29 & lt ; 212 & gt ; type : dna & lt ; 213 & gt ; organism : artificial sequence & lt ; 220 & gt ; feature : & lt ; 223 & gt ; other information : description of artificial - # sequence : primer - - & lt ; 400 & gt ; sequence : 2 - - ctggatcccg gcgttttcag gctttgctc - # - # 29 - - - - & lt ; 210 & gt ; seq id no 3 & lt ; 211 & gt ; length : 29 & lt ; 212 & gt ; type : dna & lt ; 213 & gt ; organism : artificial sequence & lt ; 220 & gt ; feature : & lt ; 223 & gt ; other information : description of artificial - # sequence : primer - - & lt ; 400 & gt ; sequence : 3 - - acagatcttc accgaccaca ataatccgc - # - # 29 - - - - & lt ; 210 & gt ; seq id no 4 & lt ; 211 & gt ; length : 28 & lt ; 212 & gt ; type : dna & lt ; 213 & gt ; organism : artificial sequence & lt ; 220 & gt ; feature : & lt ; 223 & gt ; other information : description of artificial - # sequence : primer - - & lt ; 400 & gt ; sequence : 4 - - acagatcttg accctgtgcg agaaactg - # - # 28 - - - - & lt ; 210 & gt ; seq id no 5 & lt ; 211 & gt ; length : 29 & lt ; 212 & gt ; type : dna & lt ; 213 & gt ; organism : artificial sequence & lt ; 220 & gt ; feature : & lt ; 223 & gt ; other information : description of artificial - # sequence : primer - - & lt ; 400 & gt ; sequence : 5 - - tgggatccgc tcggcgttta cttcttcca - # - # 29__________________________________________________________________________ | 2 |
referring to the drawings and , in particular , to fig1 there is shown a checkered game board 10 consisting of alternating squares which are bilaterally colored , as indicated . the board has fourteen rows of squares and fourteen columns of squares , as indicated . in the drawing , the rows are numbered by arabic numerals and the columns by roman numerals . these numbers are used in the drawing strictly as coordinates for describing the movement of the playing pieces and would not ordinarily be on the playing board itself . the peripheral area of the board has the squares 11 colored black as indicated and alternating squares 12 colored white . at the center of the board is a discrete playing area marked by border 13 of a suitable distinguishing color . within the border 13 , the playing squares are of a different color . the colored squares are blue as indicated at 14 while the alternating squares 15 are white . on one side of the board a target area is provided which is marked by a boundary line 16 of distinctive color which surrounds playing squares 17 and 18 , located at coordinates 1 - vii and 1 - viii respectively . likewise , on the other side of the board is a target area marked by boundary line 19 surrounding squares 20 and 21 , located at coordinates 14 - vii and 14 - viii , respectively . a complete set of the playing pieces and their initial position on the playing board is shown in fig1 . the playing pieces consist of 20 of the basic pieces 22 , which may be called checkers , soldiers , pawns , or the like . for convenience , this description we will use chess terminology and refer to the pieces 22 as pawns . there are provided two bishops 23 and two knights 24 . an identical set of pieces arranged as shown is positioned on the opposite side of the board and differs only in color from the other set . the playing pieces will ordinarily be black and white as in a conventional chess set , although any other suitable contrasting colors could be used for the playing pieces of the opposing sides . in the playing area surrounded by borderline 13 , which is called the sea , there are provided a plurality of hollow pieces 25 which are small boats , located in row 5 and a single large boat 26 , located in row 4 . these boats are for transport of one or more of the playing pieces initially located in rows 1 , 2 and 3 , across the sea . boats 25 will accepted only one of the playing pieces while boat 26 will accept up to three of the playing pieces of the same or different kind . a similar set of small boats of opposite color are initally positioned in row 10 and a single large boat of opposite color is initially positioned in row 11 . the boats are not capable of independent movement but may be moved only when occupied by a playing piece of the same color . the large boat 26 likewise is not capable of independent movement but may be moved in accordance with the movement characteristics of any or all of the pieces of the small color occupying said boat . initially , large boat 26 occupies the squares at coordinates 4 - vii and 4 - viii . on the first move of large boat 26 it may move from either of the squares on which it sits , but subsequent moves are from a single square . in fig2 to 6 of the drawing , there are shown detail views of the playing pieces of the boats . one of the pawns 22 is shown in fig2 . one of the bishops 23 is shown in fig3 . one of the knights 24 is shown in fig4 . a small boat 25 is shown in fig5 . one of the large boats 26 is shown in fig6 . in these drawings , it is seen that the playing pieces are of square cross - section and fit into a square recess in small boat 25 for movement across the water area . the interior of large boat 26 is a rectangular recess which will accommodate up to three of the playing pieces . movement of the various pieces , including the boats , is illustrated in fig7 to 10 . in fig7 movement of the pawns 22 is illustrated . the pawns 22 may move forwardly or laterally in a straight line or forwardly on a diagonal line one square at a time . thus , in fig7 the pawn shown at square 1 - viii may move to any of squares 1 - vii , 2 - vii , 2 - viii , 2 - ix and 1 - ix . the pawn located at square 4 - iv may cross the boundary line 13 and move into small boat 25 , if desired , provided that boat 25 is unoccupied . in addition , pawns 22 may move forwardly or laterally in a straight line or diagonally in a straight line jumping over one of an adjacent piece ( pawn , knight or bishop ) of the same color to an unoccupied square beyond said piece . this movement may be continued as long as there are pieces to jump an unoccupied squares beyond the piece being jumped . these jumping moves may be made in a straight line direction along a row or column of squares or on the diagonal along squares of the same color . these jumping moves are also illustrated in fig7 . the pawn located at square 2 - vi may jump over square 3 - vii to enter the large boat at square 4 - viii . it should be noted that pieces may enter large boat 26 by entry of either of the squares 4 - vii or 4 - viii . pawn 22 on square 1 - vi could jump to square 3 - vi as indicated and could continue by jumping laterally to square 3 - viii . pawn 22 at square 1 - vi could likewise jump to square 3 - iv and thence jump over square 4 - iv to enter boat 25 on square 5 - iv , provided that boat 25 is unoccupied . when one of the pawns 22 is occupying one of the boats 25 , the boat containing the pawn may then move according to the rules for movement of the pawn on land , i . e . the black and white squares of the board , with the additional proviso that a boat 25 occupied by a pawn 22 may also move backward in a straight line or diagonally . this backward movement is forbidden to the pawns when moving on land , i . e . the black and white squares . the movement of the knights 26 is in accordance with the movement of the knight of the game of chess . thus , the knight 26 which is initially located on square 1 - viii may be moved initially to squares 2 - vi , 3 - vii , 2 - x , or 3 - ix . the movement of the knight 26 initially positioned on sqaure 1 - vii could be to any of the squares 2 - v , 3 - vi , 3 - viii or 2 - ix . the circles shown on squares 3 - vi and 3 - vii illustrate a first round move of the knights 26 to those positions . a second move of those knights would allow them to enter one or more of the boats . thus , one of the knights 26 moved to square 3 - vii could , on its second move , enter boat 25 on square 5 - vi , as indicated . likewise , a knight 26 moved on the first round to square 3 - vi could , on the second move , enter the large boat 26 at square 4 - viii . the movement of the bishops 23 is in accordance with the move of the bishop at the game of chess , i . e ., on the diagonal to an unobstructed destination . the bishop may not jump over any intervening piece in its move , whether such piece be of its own color or of the opposing color . the move of the bishop is illustrated in fig9 . a bishop located at the square 1 - vi may move diagonally to square 3 - iv or to square 4 - ix . likewise , the bishop located at 1 - ix may move to square 4 - vi . at this point the move of the bishop differs slightly from the game of chess . the bishop may move diagonally but must stop on the square adjacent the boundary line 13 surrounding the sea area ( blue and white squares ) of the board before entering an empty boat 25 . in the move illustrated , the bishop 23 would move to square 4 - vi on the initial move and on a subsequent move could enter an empty boat 25 located on square 5 - v . in fig1 , the movement of the small boats 25 and the large boat 26 is illustrated . in the position shown , small boat 25 , containing pawn 22 , is located on square 5 - iv and may make a first round move to square 6 - iv or 6 - v , or may jump over the boat containing bishop 23 on square 5 - v to empty square 5 - vi . this latter move would not be permissible if boat 25 on square 5 - v were unoccupied . on square 9 - vi there is shown a boat 25 containing a pawn 26 , for purposes of illustrating movement toward the central portion of the sea ( blue and white ) area . the boat , containing a pawn , may move one square in any straight line or diagonal direction , forward or backward , as shown by the arrows . the boat and pawn could therefore move to any of squares 10 - v , 10 - vi , 10 - vii , 9 - v , 9 - vii , 8 - v , 8 - vi or 8 - vii , provided that those squares are unoccupied . the boat 25 containing pawn 22 may also move by jumping over a boat which is occupied by a playing piece to a square which is unoccupied on the other side of such boat . this move may be on a straight line or on a diagonal line and the piece and boat may continue to move by jumping movement as long as there are alternant squares which are occupied and unoccupied to allow for such movement . movement of a boat 25 containing a bishop 23 is on the diagonal as indicated by the dotted line and arrow . the boat 25 containing bishop 23 on square 5 - v could move to square 10 - x , provided that the intervening path is unoccupied . a boat 25 containing one of the knights 26 would move similarly in accordance with the moves permitted to the knight . the movement of large boat 26 is in accordance with the rules for movement of any or all of the pieces contained in that boat . the initial move of the boat may be made from either of the two squares which it occupies , i . e ., 4 - vii and 4 - viii . the move can be from either of these squares in accordance with the moves of the occupying pieces . the maximum utilization of large boat 26 in the game requires that is be occupied by one of each kind of playing piece , i . e ., pawn , bishop , and knight . when occupied by all three types of playing pieces , boat 26 may move forward , backward or laterally according to the simple unobstructed moves of the knight or bishop or may move by jumping over the adjacent pieces to unoccupied squares on the other side of such piece in accordance with the moves of the pawn . up to this point , the moves of the pieces have been described in situations where opposing pieces are not encountered . it is therefore necessary to consider the rules of the game as applied to the capture of opposing pieces . when moving in the land area ( black and white squares ) the bishop 23 and the knight 24 capture pieces of opposite color by movement onto the square occupied by such piece . moves which involve capture of an opposing piece are not compulsory as at checkers . capture of an opposing piece by one of the pawns 22 is by a jumping move , as at the game of checkers , although the pieces may make the jumping moves in either a straight line forward or laterally or diagonally . when a piece is captured by a pawn jumping over it or by movement of a knight or bishop onto the square where such piece is located , such opposing piece is removed from the board . in the sea area ( blue and white squares ) enlcosed by boundary 13 , offensive action occurs only between boats 25 and 26 of opposing color when moving according to the moves of the pieces located in such boat . a boat moving according to moves of a bishop or a knight may capture a boat of opposite color by occupying the square on which such boat is located . a boat containing a pawn and moving according to the moves of a pawn may capture a boat of opposing color ( containing a piece of the opposing color ) by jumping over that boat to an unoccupied square on the other side . pieces located in boats in the sea area ( blue and white squares ) may not be attacked by pieces moving from the land area ( black and white squares ) with one exception . if a pawn enters an empty boat 25 or 26 from the land area by jumping over a boat containing a piece of the opposite color , the piece so jumped and the boat containing it are considered captured and removed from the board . pieces in the various boats moving in the sea area ( blue and white area ) may move to land in accordance with the movement of those pieces . pieces being carried in the boats may therfore make attacking moves against opposing pieces on the adjacent land but may not be attacked from land with the exception noted above for a pawn entering an empty boat . the objective of the game is to enter the opposing side of the board and occupy the target area enclosed by boundary line 19 or boundary line 16 , respectively . attempts to reach the target area may be by way of the land areas ( black and white areas ) on either side of the sea area ( blue and white areas ) or may be across the sea carried on the boats 25 and 26 . it should be noted that in attacking the opponent &# 39 ; s target area , the attacking pieces may capture pieces located inside the target area by the normal moves made by the attacking pieces . once an attacking piece is positioned inside the target area , it is immune from capture by the opponent &# 39 ; s pieces . such a piece may take offensive action and capture opponent &# 39 ; s pieces outside the target area , but in such case , the piece moving out of the target area would lose its immunity from capture . the game ends when one side has two of its pieces of any category , occupying the target area on the other side of the b chinese checkers , and chess with additional strategic concepts introduced by the boats which carry pieces across the sea area ( blue and white squares ). the game , as described , uses black and white squares for the land areas around the periphery of the board and blue and white squares for the sea area in the central portion of the board . other colors could obviously be used for distinguishing these separate areas so long as the sea area is distinguished in color from the surrounding land area . the individual pieces may be black for one side and white for the other or any other suitable colors pairs , i . e ., black and red , red and white , etc . the boats generally are of a shape fitting closely the shape of the pieces which they carry . the pieces are shown as having square bases , but could have round bases or bases of other shapes if desired , provided if the boats were made to accomodate . the pieces may be manufactured of wood , metal , plastic , paper mache , plaster , or any other suitable material of construction . the board is shown as one having fourteen rows and fourteen columns of squares of alternating color . the sea area is six squares in one direction by eight squares in the other direction with projecting areas for the initial positioning of the large boats . these areas could obviously be changed and the board made larger or smaller without varying the basic concept of the game . it should be obvious therefore to those skilled in the art that this invention does not have to be constructed precisely as described above and it should be understood that , within the scope of the appended claims , the invention may be practiced otherwise than as specifically described . | 0 |
referring to fig3 , which shows schematically an overview of an example of a method according to the present invention , an original input image 11 is filtered by a low pass filter 12 which effectively removes the sharp or high frequency component of the input image 11 to leave an unsharp or low frequency image . this unsharp image is subtracted from the original image 11 in a summer 13 , which therefore outputs the high frequency component . the high frequency component is multiplied with a gain factor obtained from a gain calculator 14 in an amplifier 15 . the amplified high frequency component of the image is then added back to the original input image 11 in a second summer 16 , which outputs the enhanced image 17 . the gain that is provided by the gain calculator 14 is varied in the preferred embodiment , as will be discussed further below . in adaptive contrast enhancement , mathematically the enhanced or output image y ( m , n ) is obtained from the input image x ( m , n ) as : where m is the row number and n is the column number of the pixels , μ ( m , n ) is the local mean of brightness levels , and g ( m , n ) is the enhancement gain ( calculated by the gain calculator 14 ). the preferred embodiments use a locally adaptive non - linear filter to find the local mean μ ( m , n ) at each pixel . the filter can be regarded as a geometric averager of the brightness levels of the pixels . the use of such a filter introduces a phase - shift in the filtered output . accordingly , in the preferred embodiment , two filters are used . the first filter runs horizontally along a single row of pixels in a first direction , from left to right , and is referred to herein as the forward filter which outputs μf ( m , n ). the second filter runs in the opposite direction , from right to left horizontally along a single row of pixels , and is referred to herein as the backward filter which outputs μb ( m , n ). the local mean μ ( m , n ) that is used in the enhancement algorithm is given by the average of the outputs of the two filters , i . e . the forward and backward filters that are used are each recursive infinite impulse response ( iir ) filters . a “ recursive ” filter is one that uses recursion , i . e . the present value of the output signal is dependent on at least one previously calculated value of the output signal . an iir filter has an impulse response that is non - zero over an infinite length of time , which is in contrast to finite impulse response ( fir ) filters which have impulse responses of finite duration . in the preferred embodiment , the input - output relationship for the forward filtered μf ( m , n ) is : and the input - output relationship for the backward filtered μ b ( m , n ) is : as can be seen , for each filter the local mean μf ( m , n ) or μb ( m , n ) at a pixel is dependent on the local mean at a previous pixel ( i . e . μf ( m , n − 1 ) and μb ( m , n + 1 ) respectively ) as well as the brightness level x ( m , n ) at the current pixel . ( clearly , if attempting to filter the first pixels at the leftmost and rightmost ends of the row of pixels , there is no local mean at a previous pixel to be used in the recursive filters . this can be handled in a number of ways . in one example , the filtering begins at the second pixel from the left of a row for the forward filter and second pixel from the right of the row for the backward filter . in each case , the value that is used for the local mean at the previous pixel in the recursion equations ( 3 ) and ( 4 ) for these second pixels at the left and right of the row is the original brightness level of the first pixels respectively at the left and right of the row .) in these filter relationships , λ ( m , n ) is the delay coefficient . as can be seen , each filter has a single pole , namely the delay coefficient λ ( m , n ). as will be discussed further below , this makes the filtering process computationally efficient . in order to achieve adaptive contrast enhancement , the delay coefficient λ ( m , n ) is adapted at each pixel to edge information , or information about other areas of high contrast , in the input image 11 . given that λ ( m , n ) is effectively the weight of the previous output , a higher value of λ ( m , n ) increases the low - pass characteristic of the filter . accordingly , when an edge is encountered , λ ( m , n ) should be decreased so that the edge will be preserved in the output . for the backward filter . as will be appreciated , these edge signals are the differences between the original pixel value and the previous filter output . using these edge signals , λ ( m , n ) for the forward filter is obtained in one example using : λ ( m , n ) = [ 1 - μ f ( m , n - 1 ) - x ( m , n ) l ] α ( 7 ) here , l can be any constant integer up to the maximum possible pixel value less 1 , i . e . up to the number of brightness levels available in the input image less 1 . in an example , the number of brightness levels available in the input image is 256 , so in principle l may be set as any integer up to 255 , with a high value ( such as 255 ) being preferred . preferred values for α are in the range of 5 to 9 , with 7 being found to provide particularly good results . as will be seen from an inspection of equations ( 7 ) and ( 8 ), strong edges reduce λ ( m , n ) such that the low - pass characteristic of the filter at that location is reduced . the operation of the two filters is shown schematically in fig4 . in particular , there is shown a row of pixels 20 . the forward filter 21 passes along the row 20 in a first direction , from left to right . the backward filter 22 passes in the opposite direction along the row 20 from right to left . a λ look - up table 23 provides the required values of λ at each pixel location . an averager 24 outputs the mean of the outputs of the forward and backward filters 21 , 22 . thus , the output image can be seen as the sum of the input image ( the first term in equation ( 9 )) and the amplified high - pass filtered original image ( the second term in equation ( 9 )). the fact that the second term in equation ( 9 ) is the high - pass filtered original image can be seen from the fact that it is the difference between the original image and the low - pass filtered image . the frequency response of the high - pass filter generating the second term in equation ( 9 ) is : a plot of equation ( 10 ) is shown in fig5 . as can be seen , the gain of the high - pass filter is approximately constant after some frequency threshold . accordingly , not only are high frequencies being enhanced , but mid - range frequencies are also enhanced and with substantially the same magnitude . this increases the visual quality of the enhanced image because details that have their energy in the mid - range of the frequency spectrum are enhanced as well as the high frequency details . it can also be seen that the magnitude of the frequency response decreases with decreasing λ . since λ is a function of the edge signal , this demonstrates that the high - pass filter adapts itself to edges by reducing its magnitude . from equation ( 9 ), it can be seen that enhancement in the locality of edges decreases because the magnitude of the enhancement signal decreases accordingly . this adaptive behaviour allows the preferred contrast enhancement method to successfully avoid so - called over / under shooting artefacts . by way of comparison , fig5 also shows the corresponding plot in dashed lines for a laplacian filter , which has three taps {− 1 , 2 , − 1 }. as can be seen in fig5 , the laplacian filter emphasises the high frequency components . broadly speaking , the gain at high frequencies is about twice that at the mid - range frequencies . this causes two problems , namely noise sensitivity in the mid - range and over / under shooting around edges . a laplacian filter also requires complex computation , as mentioned above . in the above discussion , reference has been made principally to filtering in a forward and a backward direction along rows of pixels in the input image 11 . the filtering may however be carried out by filtering in a forward and backward direction ( i . e . up and down ) columns of pixels in the input image 11 . in the most preferred embodiment , filtering is carried out by two filters operating in opposite directions along the rows of pixels and by two filters operating in opposite directions along the columns of pixels . in the preferred embodiment , the gain that is used to amplify the high frequency component is calculated by the gain calculator 14 in dependence on the original brightness level at the pixel and the magnitude of the difference between the local mean and the original pixel brightness level . the original pixel brightness level determines the maximum gain that can be applied to the current pixel . the end user or system designer can select a gain within this range of possible gains . the maximum gain that can be used in enhancing is chosen by comparing the pixel value to two thresholds . the larger threshold , maxsatlev , is chosen such that enhanced version of the pixel brightness level is less likely to saturate to the maximum available brightness level . the smaller threshold , minsatlev , is chosen such that the enhanced version of the pixel brightness level is less likely to saturate to zero . given the maximum gain that can be used to enhance the high - frequency component , a user - selected maximum gain from the range of possible gains is used . this user - selected maximum gain is used to modulate a gain function . this gain function is a function of the magnitude of the difference between the local mean and the original pixel brightness level . if ( mdiff & lt ; a ) gain = 0 ; elseif ( mdiff & lt ; b ) gain = k ( cos ( π + π / 2 . ( mdiff − a )/( b − a ))+ 1 ); elseif ( mdiff & lt ; c ) gain = kcos ( π / 2 . ( mdiff − b )/( c − b )); else gain = 0 ; end , where k is the user - selected maximum gain , a , b , c are constants to be chosen by the designer , and mdiff is the magnitude of the difference . in one particular example , a = 1 , b = 7 , c = 21 and k = 1 . this particular example is shown schematically in fig6 . when mdiff is in the range [ a , b ], the gain function in the preferred embodiment is derived from a cosine that is evaluated in the 3rd quadrant . this produces a convex function , which better avoids noise enhancement by first slowly increasing and then rapidly increasing to the maximum user selected gain ( i . e . k ). when mdiff is in the range [ b , c ], the function is derived from a cosine that is evaluated in the 1st quadrant . this produces a concave function , which better enhances the medium level frequency components in the image by first slowly decreasing and then rapidly decreasing to zero to avoid saturation . it should be noted that the gain function can be any function with similar characteristics , namely : zero when the magnitude of the difference is less than some threshold , and again zero when the magnitude of the difference is greater than some threshold . the first condition ensures the preservation of smooth regions in the image . the second condition avoids saturation . the computational complexity of the preferred method is extremely low because at each given pixel , two single pole iir filters are used . the delay coefficient λ of the filter does not have to be computed as such since λ is determined by equations ( 7 ) and ( 8 ) and the edge signal that is input to this function is always an integer ( in this example between zero and 255 ). accordingly , for both λ and the enhancement gain , respective look - up tables can be used . in a particular example , the total number of computations required per pixel , including the computation of the indices of the look - up tables , is two multiplications , six additions and one bit shift . this provides low computational complexity , which means that the method can be carried out quickly and / or in relatively low cost equipment . this makes the method particularly attractive for use in consumer equipment , such as television sets , computer displays , etc . the memory requirements are also low , being 256 bytes for the λ look - up table , c bytes ( 21 in the example mentioned above ) for the enhancement gain look - up table , one line store for the output of the forward filter and an additional single register for the output of the backward filter . the present contrast enhancement method may be used prior to resizing of an image , particularly prior to zooming in on the image , so that edges will look sharper than otherwise . this is because the edges are enhanced prior to the resizing of the image . the method may be used to blur an image , for example so as to give depth perception to the image or before shrinking the image . embodiments of the present invention have been described with particular reference to the examples illustrated . however , it will be appreciated that variations and modifications may be made to the examples described within the scope of the present invention . | 7 |
according to the present invention , certain styryl sulfone derivatives affect the mapk signal transduction pathway , thereby affecting tumor cell growth and viability . the compounds inhibit the growth and proliferation of breast and prostate tumor cells in a dose - dependent manner , without affecting normal cell growth . this cell growth inhibition is associated with regulation of the erk and jnk types of mapk . the ability of the styryl sulfones to regulate these mapks and induce cell growth arrest is dictated by the nature and position of the functional groups present in the compound . treatment of breast and prostate tumor cells with the styryl sulfone compounds of the invention leads to inhibition of cell proliferation and induction of apoptotic cell death . the effect is observed for estrogen receptor ( er ) positive as well as estrogen receptor negative cells , although once breast cancer cell line tested , cell line 361 , showed considerable resistance to styryl sulfones . inhibition of cell proliferation and induction of apoptotic cell death is also observed for androgen - dependent as well as androgen - independent prostate tumor cells , although the former are considerably more sensitive to the styryl sulfones . tumor cells treated with the compounds of the invention accumulate in the g2 / m phase of the cell cycle . as the cells exit the g2 / m phase , they appear to undergo apoptosis . treatment of normal cells with the styryl sulfones fails to produce a similar effect on cell cycle progression . normal cells exhibit normal cell cycle progression in the presence and absence of styryl sulfone drug . both cells treated with the styryl sulfone compounds of the invention and untreated cells exhibit similar levels of intracellular erk - 2 , but the biochemical activity of erk - 2 as judged by its ability to phosphorylate the substrate myelin basic protein ( mbp ), is considerably diminished in drug - treated cell compared to untreated cells , in prostate tumor cells . fr - 20 , a preferred compound of the invention , reduced the phosphorylation status of mbp by more than 80 % compared to mock - treated cells . western blot analysis of the drug and mock - treated cell lysates with erk - 2 antibody shows the same amount of protein in both lysates , indicating that higher levels of phosphorylated mbp in mock treated cells was not due to an unequal quantity of erk - 2 protein in the lysates . these results suggest that the styryl sulfones of the present invention block the phosphorylating capacity of erk - 2 . the styryl sulfones of the present invention enhance the ability of jnk to phosphorylate c - jun protein compared to mock - treated cells . without wishing to be bound by any theory , this result suggests that the styryl sulfones may be acting like pro - inflammatory cytokines or uv light , activating the jnk pathway , which in turn may switch on genes responsible for cell growth inhibition and apoptosis . the compounds of the invention are characterized by cis - trans isomerism resulting from the presence of one or more double bonds . the compounds are named according to the cahn - ingold - prelog system , the iupac 1974 recommendations , section e : stereochemistry , in nomenclature of organic chemistry , pergamon , elmsford . n . y . 1979 ( the “ blue book ”). see also , march , advanced organic chemistry , john wiley & amp ; sons . inc ., new york , n . y ., 4th ed ., 1992 . p . 127 - 138 . stearic relations around a double bond are designated as “ z ” or “ e ”. ( e )- styryl and benzyl sulfones are prepared by knoevenagel condensation of aromatic aldehyde with active methylene molecules such as aryl , benzyl , styryl sulfonyl acetic acids , phenacyl aryl sulfones and sulfonyl diacetic acid . the procedure is described by reddy et al ., acta . chim . hung . 115 : 269 ( 1984 ); reddy et al ., sulfur letters 13 : 83 ( 1999 ); reddy et al ., synthesis 322 ( 1984 ); and reddy et al ., sulfur letters 7 : 43 ( 1987 ), the entire disclosures of which are incorporated herein by reference . ( z )- benzyl and ( z )- styryl sulfones are synthesized by the nucleophilic addition of aromatic and aliphatic thiols to phenyl acetylene , and subsequent oxidation of the product with 30 % hydrogen peroxide . aryl and benzylsulfonyl acetic acids are the starting compounds for the synthesis of ( e )- styryl aryl and ( e )- styryl benzyl sulfones . arylsulfonyl acetic acids may be prepared by the condensation of sodium aryl sulfinate with chloroacetic acid at alkaline ph . an alternate method for the synthesis of same compounds involves oxidizing the products obtained by the condensation of sodium arylthiolate with chloroacetic acid . benzylsulfonyl acetic acids may be synthesized by 30 % hydrogen peroxide oxidation of the condensation products of the condensation of benzyl chlorides with sodium thioglycollate . alternatively , benzylsulfonyl acetic acids may be synthesized by 30 % hydrogen peroxide oxidation of the products of the condensation of sodium salts of benzyl thiols with chloroacetic acids . to prepare the ( e )- styryl benzyl and ( e )- styryl benzyl sulfones , a mixture of the appropriate sulfonylacetic acid ( e . g ., 10 mmol ), an aromatic aldehyde ( e . g ., 10 mmol ) and a catalytic amount of benzylamine in acetic acid ( e . g ., 15 ml ) is refluxed for 2 - 3 hours . after cooling , dry ether is added and the reaction mixture is refrigerated overnight . the ethereal solution is washed successively with a saturated solution of sodium hydrogen carbonate , sodium bisulfite , dilute hydrochloric acid and finally with water . evaporation of the sodium sulfate dried ethereal solution gives solid products of ( e )- styryl aryl or benzyl sulfones which may be recrystallized with 2 - propanol or 95 % ethanol . ( z )- styryl aryl and ( z )- styryl benzyl sulfones may be prepared by the addition of sodium arylthiolate or benzylthiolate prepared from appropriate thiol ( e . g ., 10 mmol ) and sodium hydroxide ( e . g ., 20 mmol ) to freshly distilled phenylacetylene in methanol . the mixture is refluxed for 24 hours and poured onto crushed ice . the ( z )- styryl aryl and ( z )- styryl benzyl sulfides are oxidized with 30 % hydrogen peroxide to provide ( z )- styryl aryl and ( z )- styryl benzyl sulfones , respectively . ( e ),( e )- bis ( styryl ) sulfones may be prepared by the condensation of sulfonyl diacetic acid with aromatic aldehydes in the presence of benzylamine as catalyst . the reaction mixture is refluxed for 2 hours in glacial acetic acid . after cooling , absolute ether is added to the reaction mixture , which is washed successively with saturated solution of sodium bicarbonate sodium bisulfite , dilute hydrochloric acid and water . evaporation of the dried etherial layer yields ( e ),( e )- bis ( styryl ) sulfones . ( z ),( e )- bis ( styryl ) sulfones may be prepared by mixing a solution of ( z )- styrylsulfonyl acetic acid in glacial acetic acid with araldehyde and benzylamine . the solution is boiled for 3 hours . the reaction mixture is cooled and dry ether is added . any product separated is filtered . the filtrate is diluted with more ether and washed with saturated solution of sodium hydrogen carbonate , sodium bisulfite , dilute hydrochloric acid and water . the ether layer is separated , dried and evaporated to give ( z ),( e )- bis ( styryl ) sulfones . the styryl sulfones of the invention may be administered in the form of a pharmaceutical composition , in combination with a pharmaceutically acceptable carrier . the active ingredient in such formulations may comprise from 0 . 1 to 99 . 99 weight percent . by “ pharmaceutically acceptable carrier ” is meant any carrier , diluent or excipient which is compatible with the other ingredients of the formulation and to deleterious to the recipient . the compounds of the invention may be administered to individuals ( mammals , including animals and humans ) afflicted with breast or prostate cancer . the compounds may be administered by any route , including oral and parenteral administration . parenteral administration includes , for example , intravenous , intramuscular , intraarterial , intraperitoneal , intranasal , rectal , or subcutaneous administration . the active agent is preferably administered with a pharmaceutically acceptable carrier selected on the basis of the selected route of administration and standard pharmaceutical practice . the active agent may be formulated into dosage forms according to standard practices in the field of pharmaceutical preparations . see gennaro alphonso , ed ., remington &# 39 ; s pharmaceutical sciences , 18th ed ., ( 1990 ) mack publishing co ., easton , pa . suitable dosage forms may comprise , for example , tablets , capsules , solutions , parenteral solutions , troches , suppositories , or suspensions . for parenteral administration , the active agent may be mixed with a suitable carrier or diluent such as water , an oil , saline solution , aqueous dextrose ( glucose ) and related sugar solutions , or a glycol such as propylene glycol or polyethylene glycol . solutions for parenteral administration preferably contain a water soluble salt of the active agent . stabilizing agents , antioxidizing agents and preservatives may also be added . suitable antioxidizing agents include sulfite , ascorbic acid , citric acid and its salts , and sodium edta . suitable preservatives include benzalkonium chloride , methyl - or propyl - paraben , and chlorbutanol . for oral administration , the active agent may be combined with one or more solid inactive ingredients for the preparation of tablets , capsules , or other suitable oral dosage forms . for example , the active agent may be combined with carboxymethylcellulose calcium , magnesium stearate , mannitol and starch , and then formed into tablets by conventional tableting methods . the specific dose of compound according to the invention to obtain therapeutic benefit will , of course , be determined by the particular circumstances of the individual patient including , the size , weight , age and sex of the patient , the nature and stage of the disease , the aggressiveness of the disease , and the route of administration . for example , a daily dosage of from about 0 . 05 to about 50 mg / kg / day may be utilized . higher or lower doses are also contemplated . the practice of the invention is illustrated by the following non - limiting examples . to a solution of ( 8 g , 0 . 2 mol ) sodium hydroxide in methanol ( 200 ml ), appropriate thiophenol or benzyl mercaptan ( 0 . 1 mol ) is added slowly . then chloroacetic acid ( 0 . 1 mol ) is added in portions and the reaction mixture is refluxed for 2 - 3 hours . the cooled contents are poured onto crushed ice and neutralized with dilute hydrochloric acid ( 200 ml ). the resulting aryl and benzylthioacetic acids ( 0 . 1 mol ) are subjected to oxidation with 30 % hydrogen peroxide ( 0 . 12 mol ) in glacial acetic acid ( 25 ml ) by refluxing for 1 - 2 hours . the contents are cooled and poured onto crushed ice . the separated solid is recrystallized from hot water to give pure aryl and benzylsulfonyl acetic acids . a mixture of the appropriate aryl or benzylsulfonyl acetic acid ( 0 . 001 mol ), an aromatic aldehyde ( 0 . 001 mol ) and benzylamine ( 1 ml ) in glacial acetic acid ( 15 ml ) is reflexed for 2 - 3 hours . the contents are cooled and treated with dry ether ( 50 ml ). any product separated is collected by filtration . the filtrate is diluted with more ether and washed successively with a saturated solution of sodium bicarbonate ( 20 ml ), sodium bisulfite ( 20 ml ), dilute hydrochloric acid ( 20 ml ) and finally with water ( 35 ml ). evaporation of the dried ethereal layer yields a solid in many cases . however , in some cases a syrupy material separates and is solidified on treatment with 2 - propanol . the purity of the compounds is checked by tlc ( silica gel bdh , hexane / ethyl acetate 3 : 1 ). to freshly distilled phenyl acetylene ( 51 . 07 g , 0 . 5 mol ) is added sodium thioglycollate prepared from thioglycolic acid ( 46 g , 0 . 5 mol ) and sodium hydroxide ( 40 g , 1 mol ) in methanol ( 250 ml ). the mixture is refluxed for 24 hours and poured onto crushed ice ( 500 ml ) after cooling . the styrylthioacetic acid , formed after neutralization with dilute hydrochloric acid ( 250 ml ), is filtered and dried ; yield 88 g ( 90 %); m . p . 84 - 86 ° c . the styrylthioacetic acid is then oxidized to styrylsulfonylacetic acid as follows . a mixture of styrylthioacetic acid ( 5 g , 25 mmol ) in glacial acetic acid ( 35 ml ) and 30 % hydrogen peroxide ( 15 ml ) is heated under reflux for 60 minutes and the mixture is poured onto crushed ice ( 200 ml ) after cooling . the compound separated is filtered and recrystallized from hot water to give white crystalline flakes of ( z )- styrylsulfonylacetic acid ; yield 2 . 4 g ( 41 %); m . p . 150 - 51 ° c . a solution of ( z )- styrylsulfonylacetic acid ( 2 . 263 g , 10 mmol ) in glacial acetic acid ( 6 ml ) is mixed with an aromatic aldehyde ( 10 mmol ) and benzylamine ( 0 . 2 ml ) and refluxed for 3 hours . the reaction mixture is cooled , treated with dry ether ( 50 ml ), and any product separated is collected by filtration . the filtrate is diluted with more ether and washed successively with a saturated solution of sodium hydrogen carbonate ( 15 ml ), sodium bisulfite ( 15 ml ), dilute hydrochloric acid ( 20 ml ) and finally with water ( 30 ml ). evaporation of the dried ethereal layer yields ( e )( z )- bis ( styryl ) sulfones . ( e ),( e )- bis ( styryl ) sulfones are prepared following the same procedure as described above with exception that sulfonyldiacetic acid is used in place of ( z )- styrylsulfonylacetic acid , and twice the amount of aromatic aldehyde ( 20 mmol ) is used . these compounds are synthesized by two methods which employ different reaction conditions , solvents and catalysts . method 1 : phenacyl aryl sulfones are made by refluxing α - bromoacetophenones ( 0 . 05 mol ) and sodium arylsulfinates ( 0 . 05 mol ) in absolute ethanol ( 200 ml ) for 6 - 8 hours . the product which separates on cooling is filtered and washed several times with water to remove sodium bromide . the product is then recrystallized from ethanol : phenacyl - phenyl sulfone , m . p . 90 - 91 ° c . ; phenacyl - p - fluorophenyl sulfone . m . p . 148 - 149 ° c . ; phenacyl - p - bromophenyl sulfone , m . p . 121 - 122 ° c . ; phenacyl - p - methoxyphenyl sulfone . m . p . 104 - 105 ° c . ; p - nitrophenacyl - phenyl sulfone . m . p . 136 - 137 ° c . a solution of phenacyl aryl sulfone ( 0 . 01 mol ) in acetic acid ( 10 ml ) is mixed with an araldehyde ( 0 . 01 mol ) and benzylamine ( 0 . 02 ml ) and refluxed for 3 hours . the solution is cooled and dry ether ( 50 ml ) is added . the ethereal solution is washed successively with dilute hydrochloric acid , aqueous 10 % naoh , saturated nahso 3 solution and water . evaporation of the dried ethereal layer gives a solid product which is purified by recrystallization . method 2 : dry tetrahydrofuran ( 200 ml ) is taken in a 500 ml conical flask flushed with nitrogen . to this , a solution of titanium ( iv ) chloride ( 11 ml , 0 . 01 mol ) in absolute carbon tetrachloride is added dropwise with continuous stirring . the contents of the flask are maintained at − 20 ° c . throughout the course of the addition . a mixture of phenacyl aryl sulfone ( 0 . 01 mol ) and aromatic aldehyde ( 0 . 01 mol ) is added to the reaction mixture and pyridine ( 4 ml , 0 . 04 mol ) in tetrahydrofuran ( 8 ml ) is added slowly over a period of 1 hour . the contents are stirred for 10 - 12 hours , treated with water ( 50 ml ) and then ether ( 50 ml ) is added . the ethereal layer is separated and washed with 15 ml of saturated solutions of 10 % sodium hydroxide , sodium bisulfite and brine . the evaporation of the dried ethereal layer yields 2 -( arylsuifonyl )- 1 - phenyl - 3 - aryl - 2 propen - 1 - ones . a solution of phenyl sulfonylacetic acid ( 0 . 01 mol ) and benzaidehyde ( 0 . 01 mol ) was subjected to the procedure 1 . the title compound was obtained in 68 - 72 % yield . a solution of phenyl sulfonylacetic acid ( 0 . 01 mol ) and 4 - chlorobenzaldehyde ( 0 . 01 mol ) was subjected to procedure 1 . the title compound was obtained in 78 - 80 % yield . a solution of phenyl sulfonylacetic acid ( 0 . 01 mol ) and 2 , 4 - dichlorobenzaldehyde ( 0 . 01 mol ) was subjected to procedure 1 . the title compound was obtained in 60 - 65 % yield . a solution of phenyl sulfonylacetic acid ( 0 . 01 mol ) and 4 - bromobenzaldehyde ( 0 . 01 mol ) was subjected to procedure 1 . the title compound was obtained in 78 - 80 % yield . a solution of 4 - chlorophenyl sulfonylacetic acid ( 0 . 01 mol ) and 4 - chlorobenzaldehyde ( 0 . 01 mol ) was subjected to procedure 1 . the title compound was obtained in 70 - 72 % yield . a solution of 4 - chlorophenyl sulfonylacetic acid ( 0 . 01 mol ) and 4 - methylbenzaldehyde ( 0 . 01 mol ) was subjected to procedure 1 . the title compound was obtained in 60 - 64 % yield . a solution of 4 - chlorophenyl sulfonylacetic acid ( 0 . 01 mol ) and 4 - methoxybenzaldehyde ( 0 . 01 mol ) was subjected to procedure 1 . the title compound was obtained in 68 - 70 % yield . a solution of 4 - chlorophenyl sulfonylacetic acid ( 0 . 01 mol ) and 4 - bromobenzaldehyde ( 0 . 01 mol ) was subjected to procedure 1 . the title compound was obtained in 80 % yield . a solution of benzyl sulfonylacetic acid ( 0 . 01 mol ) and 2 - chlorobenzaldehyde ( 0 . 01 mol ) was subjected to procedure 1 . the title compound was obtained in 72 % yield . a solution of benzyl sulfonylacetic acid ( 0 . 01 mol ) and 4 - chlorobenzaldehyde ( 0 . 01 mol ) was subjected to procedure 1 . the title compound was obtained in 78 % yield . a solution of 4 - chlorobenzyl sulfonylacetic acid ( 0 . 01 mol ) and 4 - fluorobenzaldehyde ( 0 . 01 mol ) was subjected to procedure 1 . the title compound was obtained in 72 % yield . a solution of 4 - chlorobenzyl sulfonylacetic acid ( 0 . 01 mol ) and 4 - chlorobenzaldehyde ( 0 . 01 mol ) was subjected to procedure 1 . the title compound was obtained in 80 % yield . a solution of 4 - fluorobenzyl sulfonylacetic acid ( 0 . 01 mol ) and 4 - fluorobenzaldehyde ( 0 . 01 mol ) was subjected to procedure 1 . the title compound was obtained in 73 % yield . a solution of 4 - fluorobenzyl sulfonylacetic acid ( 0 . 01 mol ) and 2 . 4 - difluorobenzaldehyde ( 0 . 01 mol ) was subjected to procedure 1 . the title compound was obtained in 68 % yield . a solution of 4 - bromobenzyl sulfonylacetic acid ( 0 . 01 mol ) and 4 - fluorobenzaldehyde ( 0 . 01 mol ) was subjected to procedure 1 . the title compound was obtained in 82 % yield . a solution of 4 - bromobenzyl sulfonylacetic acid ( 0 . 01 mol ) and 4 - bromobenzaldehyde ( 0 . 01 mol ) was subjected to procedure 1 . the title compound was obtained in 88 % yield . a solution of 4 - fluorobenzyl sulfonylacetic acid ( 0 . 01 mol ) and 4 - bromobenzaldehyde ( 0 . 01 mol ) was subjected to procedure 1 . the title compound was obtained in 82 % yield . a solution of 4 - bromobenzylsulfonyl acetic acid ( 0 . 01 mol ) and 4 - chlorobenzaldehyde ( 0 . 01 mol ) was subjected to procedure 1 . the title compound was obtained in 88 % yield . a solution of 4 - chlorobenzylsulfonyl acetic acid ( 0 . 01 mol ) and 4 - bromobenzaldehyde ( 0 . 01 mol ) was subjected to procedure 1 . the title compound was obtained in 92 % yield . a solution of ( z )- styryl sulfonylacetic acid ( 0 . 01 mol ) and 4 - 4 - fluorobenzaldehyde ( 0 . 01 mol was subjected to procedure 2 . the title compound was obtained in 68 % yield . a solution of ( z )- styryl sulfonylacetic acid ( 0 . 01 mol ) and 4 - bromobenzaldehyde ( 0 . 01 mol ) was subjected to procedure 2 . the title compound was obtained in 70 % yield . a solution of ( z )- styryl sulfonylacetic acid ( 0 . 01 mol ) and 4 - chlorobenzaldehyde ( 0 . 01 mol ) was subjected to procedure 2 . the title compound was obtained in 64 % yield . a solution of phenacyl - 4 - fluorophenyl sulfone ( 0 . 01 mol ) and 4 - fluorobenzaldehyde ( 0 . 01 mol ) was subjected to method 1 of procedure 3 . the title compound was obtained in 63 % yield . a solution of phenacyl - 2 - chlorophenyl sulfone ( 0 . 01 mol ) and 2 - fluoro benzaldehyde ( 0 . 01 mol ) was subjected to method 1 of procedure 3 . the title compound was obtained in 58 % yield . a solution of phenacyl - 2 - chlorophenyl sulfone ( 0 . 01 mol ) and 4 - bromo benzaldehyde ( 0 . 01 mol ) was subjected to method 1 of procedure 3 . the title compound was obtained in 66 % yield . a solution of phenacyl - 4 - chlorophenyl sulfone ( 0 . 01 mol ) and 4 - bromo benzaldehyde ( 0 . 01 mol ) was subjected to method 1 of procedure 3 . the title compound was obtained in 60 % yield . a solution of phenacyl - 2 - nitrophenyl sulfone ( 0 . 01 mol ) and 4 - bromo benzaldehyde ( 0 . 01 mol ) was subjected to method 1 of procedure 3 . the title compound was obtained in 56 % yield . the effect of the styryl sulfones on the growth of normal and tumor cells of breast and prostate was examine utilizing four cell lines , nih3t3 , mcf - 7 . bt - 20 and lncap . nih / 3t3 cells represent normal fibroblasts while lncap is an androgen - dependent prostate tumor cell line . mcf - 7 , is an estrogen - responsive breast tumor cell line , while bt - 20 is an estrogen - unresponsive breast tumor cell line . mcf - 7 and bt - 20 were grown in dulbecco &# 39 ; s modified eagle &# 39 ; s medium ( dmem ) containing 10 % fetal bovine serum supplemented with penicillin and streptomycin . lncap were cultured in rpmi with 10 % fetal bovine serum containing penicillin and streptomycin . nih3t3 cells were grown in dmem containing 10 % calf serum supplemented with penicillin and streptomycin . all cell cultures were maintained at 37 ° c . in a humidified atmosphere of 5 % co 2 . cells were treated with test compound at 2 . 5 μm or 5 . 0 μm concentration and cell viability was determined after 48 hours by the trypan blue exclusion method . the compounds identified in table 1 , 2 and 3 inhibited cell growth and induced cell death , to varying degrees . the tables list the percent viable lncap and mcf - 7 cells treated with 5 . 0 μm compound . five of the more active compounds which exhibited the highest activity were designated as fri - 2 ( e - 2 , 4 - difluorostyryl - 4 - fluorobenzyl sulfone ). fri - 6 ( e - 4 - fluorostyryl 4 - bromobenzyl sulfone ), fri - 7 ( e - 4 - bromostyryl 4 - fluorobenzyl sulfone ). fri - 20 ( e - 4 - fluorostyryl 4 - chlorobenzyl sulfone ) and fri - 22 ( e - 4 - chlorostyryl 4 - chlorobenzyl sulfone ). these compounds were found to substantially inhibit the growth and induce the death of lncap , bt - 20 and mcf - 7 cells at 2 . 5 mm ( fig1 a ) and 5 . 0 mm ( fig1 b ) after 48 hours of treatment with the compounds . under identical conditions , more than 80 % of nih3t3 cells were viable after 48 hours incubation ( fig1 a and 1 b ), e - 4 - chlorostyryl 4 - bromobenzyl sulfone and e - 4 - bromostyryl 4 - chlorobenzyl sulfone were also highly active . the dose dependency of the styryl sulfone was established by treating the cells with fri - 20 , one of the five most active compounds . nih3t3 , mcf - 7 , bt - 20 and lncap cells were treated with fri - 20 dissolved in dmso to concentrations of 250 nm , 500 nm , 1 μm , 2 . 5 μm and 5 μm and examined for their proliferation and viability after 48 hours ( fig2 a ). the percentage of living cells was determined by trypan blue exclusion . the control cells were treated with dmso to determine the effect of solvent on cells . at a concentration of 250 nm , there was about 10 % cell death in mcf - 7 , bt - 20 and lncap cells and about 15 - 20 % inhibition in cell division compared to untreated cells after 48 hours . there was about 30 - 50 % inhibition in cell proliferation and 25 - 30 % cell death in lncap . bt - 20 and mcf - 7 at 500 nm concentration . under these conditions , only 2 - 3 % of nih3t3 cells were non - viable at both the concentrations . the lncap , bt - 20 and mcf - 7 cell growth was greatly inhibited by 1 μm concentration of fri - 20 with concomitant loss of cell viability . after 48 hours incubation , 60 - 75 % of the lncap bt - 20 and mcf - 7 cells were dead at 2 . 5 mm fri - 20 concentration , whereas more than 90 % of nih3t3 cells were viable ( fig2 a ). the lncap , bt - 20 and mcf - 7 cells treated with 5 μm fri - 20 ( fig2 a ) showed nearly 90 % cell death . nih3t3 showed little or no alteration in their ability to grow and maintain & gt ; 80 % viability in the presence of fri - 2 , - 6 , - 7 , - 20 or - 22 , at 5 μm concentration . the time course of the activity of fri - 20 was demonstrated as follows . nih / 3t3 , mcf - 7 , bt - 20 and lncap were treated with fri - 20 at 2 . 5 μm and the number of viable cells was determined at 12 , 24 , 48 and 72 hours by trypan blue exclusion . the mean of three independent experiments is shown in fig2 b . the time course study revealed that more than 95 % of mcf - 7 , lncap and bt - 20 cells were dead after 72 hours of treatment with fri - 20 at 2 . 5 μm ( fig2 b ). the effect of fr - 20 on the growth of normal and tumor cells of breast and prostate was examine utilizing nine cell lines : nihl3t3 and hfl ( normal fibroblast cell lines ); mcf - 7 and 361 ( estrogen - receptor negative breast tumor cell lines ); btf - 20 , 435 and skbr - 3 ( estrogen - receptor positive breast tumor cell lines ); lncap ( androgen sensitive prostate tumor cell line ); pc - 3 and du - 145 ( androgen insensitive prostate tumor cell line ). the cells were grown as in example 22 , a . fr - 20 was dissolved in dmso and added to the cells at 2 . 5 μm and 5 . 0 μm concentration . to control cells , dmso was added equivalent to the volume of solvent ( dmso ) present at the highest concentration of the compound . the activity of the compound as evaluated after 48 hours by trypan blue exclusion . nih3t3 and hfl cells were found to maintain a percent viability of 85 - 90 % at 2 . 5 and 5 . 0 μm concentration . of the seven breast tumor cell lines treated with fri - 20 compound , mcf - 7 , htb126 , t470 and 435 cells showed very high mortality with less than 25 % and 10 % viability at 2 . 5 and 5 . 0 μm concentrations of the drug ( fig3 a ). nearly 50 % of skbr - 3 and bt - 20 cells were dead at 2 . 5 μm and 75 % at 5 . 0 μm concentration of the compound . the 361 breast tumor cell line , on the other hand showed considerable resistance to fri - 20 with 50 - 75 % of cells being viable at 2 . 5 and 5 . 0 μm concentration . fri - 20 had profound effect on the viability of androgen - dependent lncap prostate tumor cell line when compared to androgen - independent du - 145 and pc - 3 prostate cell lines . at 2 . 5 mm fri - 20 , 80 % of lncap , 40 % of pc - 3 and 20 % of du - 145 cells were killed . at 5 . 0 mm fri - 20 , 72 % of lncap , 47 % of pc - 3 and 40 % of du - 145 were killed ( fig3 b ). the androgen - dependent prostate tumor cell line lncap was grown as in ex . 22 . a , and treated with 2 . 0 μm fri - 20 dissolved in dmso or with equivalent amounts ( 10 ml ) of dmso alone . cells were harvested 6 , 12 , 24 , and 48 hours following treatment and stained with propidium iodide and subjected to flow cytometry ( facs ) for analysis of dna content . as shown in fig4 the addition of fr - 20 to the culture medium results in the accumulation of cells in the g2 / m phase of the cell cycle and as the cells exit this phase of the cell cycle they appeared to undero apoptosis . cells treated with dmso alone failed to exhibit such an arrest in the g2 / m phase of the cell cycle suggesting that the effects seen are associated with fri - 20 addition . treatment of the normal cell lines nih3 or hfl with fri - 20 failed to produce a similar effect on cell cycle progression . nih3t3 and hfl exhibited normal cell cycle progression in the presence and absence of drug . to examine the effects of fri - 20 on the mapk pathway , nih3t3 , lncap and mcf - 7 cells were incubated with fri - 20 at a concentration 2 . 5 mm for48 hours . following incubation of cells in the presence and absence of fri - 20 , the cells were lysed using erk lysis buffer containing 20 mm hepes ( ph 7 . 4 ), 50 mm β - glycerophosphate , 0 . 5 % triton x - 100 , 2 mm mgcl 2 , 1 mm egta . 1 mm dithiothreitol , 2 μg / ml leupeptin , 2 μg / ml aprotinin , 100 μm phenylmethylsulfonyl fluoride , and 1 mm benzamidine . erk - 2 in 100 mg of cell lysate was immunoprecipitated by incubating lysate protein with 1 mg of erk - 2 polyclonal antibody ( antibody sc - 154 to erk2 is from santa cruz biotechnology , inc .) for one hour followed by an additional incubation of 20 μl of protein a - sepharose ( pharmacia ) for one hour . the immune complex - bound protein a - sepharose beads were washed twice with lysis buffer and twice with erk / mapk buffer containing 20 mm hepes ( ph 7 . 4 ), 50 mm β - glycerophosphate , 10 mm mgcl 2 , 1 mm egta , 1 mm dithiothreitol , and 100 mm na 3 vo 4 . the immunoprecipitated were then tested for map kinase activity by an in vitro assay which utilizes myelin basic proteins ( mbp ) as a substrate for erk - 2 in the presence of [ γ - 32 p ] atp . accordingly , the beads were resuspended in 40 μl of mapk buffer containing 100 μm [ γ - 32 p ] atp ( 5000 cpm / pmol ), and the kinase assay was carried out for 20 minutes at 30 ° c . using 5 μg of mbp as substrate . the reaction was stopped by the addition of laemmli &# 39 ; s buffer followed by the boiling of the samples for 3 minutes . the proteins were resolved on 12 % sds - page ; the gel was dried , and an autoradiogram was developed . the results show that both drug - treated and untreated cells exhibit similar levels of intracellular erk - 2 , but the biochemical activity of erk - 2 , as judged by its ability to phosphorylate mbp , was considerably diminished in drug - treated cells compared to cells treated with dmso alone . in prostate tumor cells , fri - 20 reduced the phosphorylation status of mbp by more than 80 % compared to mock - treated cells ( fig5 ). cell lysates of fri - 20 - treated cells were prepared for western blot analysis as follows . nih3t3 , lncap or mcf - 7 cells were seeded at a density of 2 × 10 5 cells / per well in a six - well plate and allowed to grow for 24 hours . fresh medium was added to each well 2 hours before treatment with fri - 20 . the compound was dissolved in dmso to make a 2 mm stock solution and added to the medium ( 2 ml ) to obtain a final concentration of 2 . 5 and 5 . 0 μm . after 48 hours at 37 ° c . the cells were washed twice with 10 ml of ice cold phosphate - buffered saline and harvested in 400 μl of lysis buffer containing 25mm hepes ( ph 7 . 6 ), 0 . 1 % triton x - 100 . 300 mm nacl , 1 . 5 mm mgcl 2 , 20 mm β - glycerophosphate , 100 μm na 3 vo 4 , 0 . 2 mm edta , 0 . 5 mm dithiothreitol , 2 μg / ml aprotinin , 2 μg / ml leupeptin . 100 μm phenylmethylsulfonyl chloride and 1 mm benzamidine . the cell lysates were kept on ice for 30 minutes and centrifuged for 10 minutes in a microcentrifuge ( 16000 × g ). the cell lysates were separated from the debris and normalized for protein content . western blot analysis was carried out on the drug - and mock - treated cell lysates with erk - 2 antibody . equal amounts of total protein ( 100 μg ) were loaded in each lane of a sds - page gel ( 10 - 12 %) and transferred to immobilon - p ( millipore , usa ). following transfer , membranes were blocked in 3 % milk , then probed with erk - 2 and jnk - 1 rabbit polyclonal antibodies ( santa cruz biotechnoloy inc . santa cruz , calif .) and then probed with horseradish peroxidase linked donkey anti - rabbit 1 g secondary antibody ( amersham ) ( 1 : 10000 dilution ). the antibody was detected using the ecl western blotting analysis kit ( amersham ) following the manufacturer &# 39 ; s instructions . the western blot analysis of the drug - and mock - treated cell lysates with erk - 2 antibody showed the same amount of protein in both lysates ( fig6 ), indicating that higher levels of mbp phosphorylation in mock - treated cells was not due to an unequal quantity of erk - 2 protein in lysates . these results suggest that fri - 20 blocks the phosphorylating capability of erk - 2 . to further establish if the activity of stress activated protein kinases ( sapks ), of which jnk is a member , is compromised in the presence of fri - 20 , cells ( nih3t3 , mcf - 7 or lncap ) were treated with fri - 20 dissolved in dmso or with dmso alone . forty - eight hours later , the cells were lysed with kinase buffer and the lysates used for estimation of the amount of jnk present in each lysate by western blot analysis using jnk polyclonal antibody . the biochemical activity of the jnk present in the fri - 20 - treated and mock - treated cell lysates was also determined by immunoprecipitation of jnk followed by incubation with gst - c - jun protein as a substrate for jnk in the presence of [ γ - 32 p ] atp . accordingly , jnk - 1 in 100 mg of cell extracts was immunoprecipitated by incubating the lysate with 1 mg of jnk - 1 polyclonal antibody ( sc from santa cruz biotechnology ) for one hour followed by an additional incubation with 20 μl of protein a - sepharose ( pharmacia ) for one hour . the beads were washed twice with jnk lysis buffer ( as described above ) followed by two washes with jnk reaction buffer . the beads were resuspended in 40 μl of jnk buffer containing 20 mm [ γ - 32 p ] atp ( 5000 cpm / pmol ), and the kinase reaction was carried out for 20 minutes at 30 ° c . using 3 μg of purified gst - c - jun ( 1 - 79 ) as substrate . the reaction was stopped , and the radioactivity in the phosphorylated gst - c - jun protein was quantitated . the results show that the fri - 20 treatment enhanced the ability of jnk to phosphorylate recombinant gst - c - jun protein by 60 - 80 % compared to mock - treated cells ( fig7 ). jnk has been shown to be activated by treatment of cells with uv radiation , pro - inflammatory cytokines and environmental stress ( derijard et al ., cell 1025 ( 1994 )). the activated jnk binds to the amino terminus of c - jun and increases its transcriptional activity by phosphorylating at ser63 and ser73 ( adler et al ., proc . natl . acad sci . usa 89 : 5341 ( 1992 ); kwok et al ., nature 370 : 223 ( 1994 )). without wishing to be bound by any theory , the results demonstrated herein suggest that fri - 20 may act like a pro - inflammatory ctokine or uv light in activating the jnk pathway , which in turn may switch on genes responsible for cell growth inhibition and apoptosis . the killing effect of fr - 20 or androgen - sensitive ( lncap ) and androgen insensitive ( du145 ) prostate tumor cells was compared to the effect of cisplatin ( cis - diamminedichloroplatinum ii ), a widely used anti - prostate cancer agent . the cells were grown as in example 26 . fri - 10 or cisplatin was dissolved in dmso and added to the cells at various concentrations . viability was determined after 72 hours by the trypan blue exclusion method . the concentration of fri - 20 required to completely kill lncap and du145 cells was 2 . 5 μm and 5 . 0 μm , respectively . under identical conditions , complete killing of lncap and du145 cells by cisplatin required 25 μm and 15 μm concentrations , respectively . thus , fri - 20 is at least tenfold more active than cisplatin in killing both hormone - dependent and hormone - independent prostate tumor cells . all references cited with respect to synthetic , preparative and analytical procedures are incorporated herein by reference . the present invention may be embodied in other specific forms without departing from the spirit or essential attributes thereof and , accordingly , reference should be made to the appended claims , rather than to the foregoing specification , as indication the scope of the invention . | 2 |
referring now to the drawings , and particularly fig1 thereof , there is shown a seat cover 10 of the invention . the seat cover 10 comprises a cover section 12 which has a peripheral edge 14 which may be elasticized so that it can easily fasten or engage in a releasable manner to the infant / child seat . the cover section 12 has generally two areas , namely a seat area 16 and a back area 18 which , respectively , cover the seat and the back of the infant / child seat . two approximately parallel lateral slots 20 and 22 are formed within the back area 18 and a single slot 24 is formed in the seat area 16 . each lateral slot 20 and 22 has a pair of edges 26 and 28 and each edge 26 and 28 has an upper section 30 , a middle section 32 , and a lower section 34 . along the middle section 32 of each edge 26 and 28 , there is formed a fastening mechanism 36 . the fastening mechanism 36 comprises a first velcro ™ strip 38 on the edge 26 and a corresponding second velcro ™ strip 40 along the edge 28 . the first and second velcro ™ strips 38 and 40 can easily be releasably fastened to and unfastened from each other . fastening has the effect of closing off at least a portion of the lateral slots 20 and 22 , while conversely , unfastening the first and second velcro ™ strips 38 and 40 opens these lateral slots 20 and 22 . reference is made to fig3 of the drawings which illustrates the seat cover 10 as shown in fig1 , but with the first and second velcro ™ strips 38 and 40 of both of the lateral slots 20 and 22 closed off . in this configuration , only smaller apertures 42 and 44 will allow the slots 20 and 22 to part at their edges 26 and 28 to accommodate the seat belts as will be described in more detail below . note that the central slot 24 does not typically require any fastening since it need only be small to allow a central seat strap to be pulled therethrough . in fig2 , the rear of a car seat 50 is shown . the car seat 50 has a frame 52 molded to provide a seat 54 , a back 56 and side walls 58 on each side of the seat 54 . the car seat 50 can be secured in a vehicle in conventional fashion . the back 56 has a left upper orifice 60 , a left lower orifice 62 , a right upper orifice 64 and a right lower orifice 66 . each of the upper sections 30 of the slots 20 and 22 are formed to be at the approximate location of the upper orifices 60 and 64 . each of the lower sections 34 of the slots 20 ands 22 are formed to be at the approximate location of the lower orifices 62 and 66 . the orifices 60 and 62 are adapted to fit one shoulder seat belt 70 while the orifices 64 and 66 are adapted to fit the other shoulder seat belt 72 . the seat belt 70 passes through the upper section 30 of slot 20 to the front of the seat back 56 and then back behind the seat back 56 by passing through the lower section 34 of the slot 20 . similarly , the seat belt 72 passes through the upper section 30 of slot 22 to the front of the seat back 56 and then back behind he seat back 56 by passing through the lower section 34 of the slot 22 . the elongate shape of the slots 20 and 22 allow the entire front section of seat belts 70 and 72 to be pulled therethrough as can be seen in fig4 of the drawings . once pulled through , as seen in fig4 , the fastening means 36 is sealed to leave only small apertures 42 and 44 at the upper section 30 and the lower section 34 respectively , as illustrated in fig5 of the drawings . note that the dimensions of the small apertures 42 and 44 can be varied so as to be larger or smaller , by regulating the size of the fastening means 36 . therefore , the size of the small apertures 42 and 44 need not be on the scale shown in the drawings but can be made longer or shorter so that different requirements and preferences can be accommodated . with the seat belts 70 and 72 pulled through the slots 20 and 22 , and the slots 20 and 22 sealed and closed as shown in fig5 of the drawings , a safe , easy and effective method is provided to instal a seat cover of the invention . no complex time consuming procedures are required to remove and reinstall the seat belts and , further , the unsightly gaping spaces which are present without the fastening mechanism are eliminated or significantly reduced . thus , seat covers can be changed often and simply with worrying about safety and cleanliness issues . in other embodiments of the invention , a fastening mechanism other than velcro ™ may be used . thus , a hook and eye arrangement , zippers , buttons or tying cords are just examples of the various types of fastening mechanisms that can be used within the scope of the invention . the invention also provides for a hood structure which can be easily removed and replaced . in accordance with another aspect of the invention , there is thus provided a hood for use with an infant / child seat , the hood typically comprising a support bar having ends connectable to the infant / child seat , and a fabric hood piece attached to the support bar , the fabric piece having a hem formed by a releasable fastening means , such as velcro ™, so that the hood piece can be easily removed and installed on the support bar for mounting on the infant / child seat . one such hood arrangement can be seen in fig6 of the drawings . a hood structure 80 comprises a hood 82 designed to shield or protect the infant &# 39 ; s face from the sun , rain , or other condition . the hood 82 has an edge 84 which is seamed to form a channel 86 . the channel 86 receives an elongate and flexible rod whose ends ( not shown ) extend outwardly through openings 88 and 90 and fasten to the seat or frame . the rod can be easily installed and removed making the hood structure 80 a convenient , safe and simple accessory to use . the invention is not limited to the precise details described herein and variations and modifications can be made within the scope of the invention . different types of fabric can be used to construct the seat cover , the slots may vary in length according to the specific infant / child seat for which it is designed and the location of the seat belts , and the size and length of the fastening mechanism on the slot can be varied according to preselected criteria . | 0 |
in accordance with embodiments of the present invention , an apparatus and method are provided to enable effective control and monitoring of a motorized locomotion assisting exoskeleton device by means of ground force measurement . by “ ground force measurement ” is meant a local measurement of the force that is exerted by an area of a supporting surface that counters the force exerted on that area of the surface by the user . the supporting surface may be a floor , or ground , below the user , or any other horizontal or non - horizontal surface that supports the weight of , or otherwise supports or stabilizes the user , or counters a force exerted by the user or the locomotion assisting exoskeleton device . the ground force may be a force applied directly by the supporting surface on a component of the locomotion assisting exoskeleton device , or may be transmitted via a body or object that is between the supporting surface and the component . the locomotion assisting exoskeleton device includes braces and supports that may be strapped on , or otherwise attached or affixed to , the trunk and sections of limbs and body parts in the lower portion of the body of a user . the various braces and supports are connected to one another by means of joints that enable relative movement between the braces and supports . the locomotion assisting exoskeleton device may include motorized actuation assemblies or joints for moving parts of the user &# 39 ; s body , such as for bending joints in order to propel various limbs of the user &# 39 ; s body . the locomotion assisting exoskeleton device may also include sensors for measuring relative situation of various components of the device , and thus of the body parts to which they are attached . such sensors may measure , for example , the angle between the brace sections on either side of a joint . in addition , the locomotion assisting exoskeleton device may include one or more sensors that sense or measure tilt . for example , such a sensor affixed to the upper portion of the user &# 39 ; s body may measure the tilt of that portion of the body . the user of the locomotion assisting exoskeleton device is provided with a set of controls that communicate with the locomotion assisting exoskeleton device . by means of the controls , the user may select a locomotion mode for the device . available modes may include walking , climbing a stair , descending a stair , sitting , and standing from a sitting position . in accordance with embodiments of the present invention , the locomotion assisting exoskeleton device includes a foot brace that is positioned under a foot of the user . the foot brace supports the foot of the user , and applies force to the user &# 39 ; s foot that counters the force of the weight of the user on the foot brace . the foot brace is provided with one or more ground force sensors . ground force sensors are known in the art . for example , a ground force sensor may be based on a force sensitive resistor , such as a piezoresistive force sensor . a ground force sensor generates a signal that indicates the force that is applied to it . the amount of force applied to the ground force sensor depends on the posture or stance of the user , or on the activity of the user . when a locomotion mode is selected , the locomotion assisting exoskeleton device awaits an instruction before initiating the appropriate motion sequence . in accordance with embodiments of the present invention , instructions are provided in accordance with signals generated by the ground force sensors of a foot brace . by shifting the weight of the user &# 39 ; s body , perhaps with the aid of crutches , the user may increase or decrease the force applied to one or more of the ground force sensors . for example , if a walking gait mode was selected and the user wishes to begin walking with the right foot , the user slightly leans on the left foot ( perhaps with concurrent use of crutches ). a ground force sensor on the right foot brace may then generate a signal indicating decreased force and a force sensor of the left foot brace may indicate increased force . the locomotion assisting exoskeleton device then initiates the walking gait by lifting and extending the right foot brace . the locomotion assisting exoskeleton device continues to monitor the signals generated by the ground force sensors . thus , the user retains control over the gait . by leaning or otherwise controlling the force on the ground force sensors in an expected manner , the user continues to enable the gait . if , however , the weight of the user shifts in a manner inconsistent with the current phase of the gait , the locomotion assisting exoskeleton device may alert the user or halt the gait or converge to a stance until further instructions are received . fig1 a shows a motorized locomotion assisting exoskeleton device that is controlled in accordance with embodiments of the present invention . locomotion assisting exoskeleton device 20 is powered and controlled by controller pack 22 . controller pack 22 incorporates a controller in the form of a programmable processor , and a battery or other power supply ( shown schematically in fig1 c ). controller pack 22 is generally worn on the back of a person using locomotion assisting exoskeleton device 20 . alternatively , the various components of controller pack 22 may be attached to or incorporated in various components of exoskeleton device 20 . for example , components of controller pack 22 may be incorporated into braces 24 . controller pack 22 may communicate with a tilt sensor 23 that is fixed to a location on the upper portion of the user &# 39 ; s body . for example , tilt sensor 23 may be worn on a shoulder strap that holds controller pack 22 to the user &# 39 ; s torso , and thus senses the degree of tilt of the torso . the tilt sensors may include accelerometers , gyroscopes , or any other sensors capable of being incorporated in a locomotion assisting exoskeleton device and designed to sense tilt . the tilt sensor generates a signal that indicates whether the user &# 39 ; s upper portion of the body is leaning or is upright with respect to the vertical braces 23 a are affixed by means of straps 25 to segments of the user &# 39 ; s lower limbs and to the pelvis , torso , or other parts of the user &# 39 ; s body . braces 23 a incorporate motorized actuation assemblies 24 . each actuation assembly 24 includes a motorized actuator ( not shown ) that , in response to commands transmitted by controller pack 22 , causes a joint that connects between individual braces 23 a to bend or extend . bending or extending a joint may propel or move a limb to which an adjoining brace is attached . when the lower limbs of the user are affixed to braces 23 a , each of the user &# 39 ; s feet is placed on a foot brace 26 . foot brace 26 may be movable by means of a separate motorized actuation assembly ( not shown ) to lift , guide , and lower a foot of the user . alternatively , foot brace 26 may include a coil , spring , or other elastic anti - drop mechanism associated with ankle joint 27 . the anti - drop mechanism associated with ankle joint 27 holds foot brace 26 substantially horizontal when foot brace 26 is raised above , and is not supported by , a supporting surface . fig1 b shows a control panel unit associated with the motorized locomotion assisting exoskeleton device shown in fig1 a . control panel unit 30 communicates with controller pack 22 via a wireless or other communications channel . typically , control panel unit 30 is strapped to the user &# 39 ; s wrist by means of straps 34 . control panel unit 30 includes one or more touch - sensitive buttons or keys 32 . the touch - sensitive buttons 32 may serve as a mode selector to select a mode of locomotion , to verify a command , or to communicate other instructions to controller pack 22 . one or more ground force sensors 28 are mounted on each foot brace 26 . each of ground force sensors 28 is capable of generating a signal that indicates the force applied to that sensor . signals generated by ground force sensors 28 are transmitted to controller pack 22 . controller pack 22 receives signals transmitted by control panel unit 30 and by ground force sensors 28 . on the basis of the received signals and in accordance with programmed instructions , controller pack 22 transmits instructions to actuation assemblies 24 . the instructions transmitted to actuation assemblies 24 may cause one or more of braces 23 a to move , propelling any limbs attached to the units . by activating buttons 32 and by adjusting the force on ground force sensors 28 , a person may control locomotion assisting exoskeleton device 20 to assist in performing a desired task . examples of controlling a locomotion assisting exoskeleton device in accordance with embodiments of the present invention are described below . fig1 c is a block diagram of the locomotion assisting exoskeleton device shown in fig1 a and fig1 b . power supply 15 is located in controller pack 22 . main supply 16 provides power to main processor 12 , actuation assemblies 24 , and motors 38 . main supply 16 may include a rechargeable battery that may be charged by means of charger unit 18 that may be connected to main supply 16 through protection circuit 19 . when necessary , an appropriate alternative external power source , such as an auxiliary battery , may be connected to auxiliary connection 17 . main processor 12 may receive signals from tilt sensor 23 and ground force sensors 28 . main processor 12 may communicate with control unit 30 over a wireless connection through wireless communications board 14 . main processor 12 communicates with actuation assemblies 24 via communications channels , such as controller - area network ( can ) bus 37 . each actuation assembly 24 includes a control board 36 . each control board 36 controls a motor 38 that determines the motion of actuation assembly 24 , and thus of a brace or joint to which actuation assembly 24 may be attached . in general , a user of locomotion assisting exoskeleton device 20 selects a mode of operation . modes of operation may include selection of a task to be carried out . examples of such tasks may include walking with a particular gait , sitting , standing from a sitting position , climbing stairs , and descending stairs . the locomotion assisting exoskeleton device may include one or more alerting devices for alerting the user of situations demanding the user &# 39 ; s attention . such alerting devices may generate audible , visible , or tactile alert signals . the alerting devices may be incorporated into one or more components of the locomotion assisting exoskeleton device . situations requiring user attention may include contradictory or unexpected movements or foot loading , falling , and points during the execution of a procedure where user verification is required for safety purposes . depending on the details of the control algorithm for the motorized locomotion assisting exoskeleton device , the ground force sensor values used in controlling the locomotion assisting exoskeleton device may represent a signal generated by a single sensor , or may be a representative value of the signals based on processing the outputs generated by part or all of an array of sensors associated with a single foot brace . alternatively , the value used may represent a pattern or map of forces applied to the sensors of one or both foot braces . for the sake of simplicity in the discussion below , the values of forces measured by the ground force sensors , or foot loadings , may be classified into one of four loading categories . the ranges of sensor signals to be included within each loading category may vary from user to user , or from one mode of operation to another . the loading categories may also be defined relative to one another . the category representing the range of the smallest forces may be labeled “ foot off ” ( fo ), and is associated with a foot brace that is not touching the ground . the category representing the next larger range of forces may be labeled “ foot touching ” ( ft ), associated with a foot brace that is touching the ground , but with minimal loading . the category representing the next larger range of forces labeled “ foot lightly loaded ” ( fll ), may represent light loading on a foot brace , associated with a situation where the user is standing on both feet , and load of the weight of the body is shared with the other foot brace . finally , a category representing the range of greatest forces may be labeled “ foot heavily loaded ” ( fhl ). fhl is associated with a user leaning on one foot brace , with that foot brace supporting most of the weight of the user &# 39 ; s body . in addition to the signal output of ground force sensors , control of the locomotion assisting exoskeleton device may utilize a measurement of the tilt of the upper part of the user &# 39 ; s body . the tilt measurement may be used to check whether the tilt of the user &# 39 ; s body is consistent with the current phase of an activity . in addition , depending on the control algorithm of the locomotion assisting exoskeleton device , the user may use body tilt , in addition to applying force to the ground force sensors , to control the locomotion assisting exoskeleton device . loading on a particular foot , the right or the left foot is indicated in the discussion below by preceding the abbreviation for a loading category with the letter r or l , respectively . for example , the right foot lightly loaded may be designated rfll . the left foot touching may be designated lft . various combinations of loading on the right and left legs may indicate various stances . a stance is to be understood as including any posture of the body , such as , for example , standing , sitting , or a phase of a walking gait , including an unstable or falling posture , and not only a stable standing posture . for example , a loading combination rfll and lfll may indicate that the user is standing straight or otherwise placing approximately equal loading on both legs . a combination of rfhl with lighter loading on the left leg , lfll , lft , or lfo , may be indicate that the user is leaning on the right leg . conversely , a combination of lfhl with rfll , rft , or rfo may indicate leaning on the left leg . leaning on a leg is understood to include standing on one leg with the other leg being held above the ground . any combination of fll , ft , or fo loading on one leg , combined with ft or fo loading on the other leg , may indicate falling . falling may also be indicated by a tilt sensor . during falling , the tilt sensor may indicate that the upper body is tilted at an angle indicative of falling , or may indicate acceleration indicative of falling . in the diagrams discussed below , the left leg is designated lg , the right leg is designated rg , and ground force sensors are designated gf . in the examples of the control methods described below , the user may coordinate the action of the locomotion assisting exoskeleton device with the use of crutches . however , the role of the crutches is not indicated in the figures . fig2 a is a diagram of the control process for initiating a step from a standing position , in accordance with embodiments of the present invention . fig2 b is a flow chart of a control method for the process illustrated in fig2 a . by means of the controls on the control panel unit of the exoskeleton skeleton device , the user indicates the intention to initiate a walking gait ( step 140 ). the control system of the locomotion assisting exoskeleton device then checks whether tilt sensors indicate that the user is leaning forward ( step 142 ). if not ( step 57 ), the system checks whether a predetermined time has elapsed since step 140 ( step 144 ). if the time has elapsed , the process of initiating a walking gait times out and is halted ( step 58 ). if not , the system continues to wait for an appropriate signal from the tilt sensors ( return to step 142 ). the user initiates the walking gait by leaning forward ( step 41 ). the user may be initially standing with weight distributed approximately equally between both legs ( as in step 40 , rfll and lfll , loading ). if no change in loading is detected by the ground force sensors within a predetermined period of time ( step 150 ), the process of initiating a walking gait times out and is halted ( step 58 ). the user may lean on the right leg ( rfhl loading , step 42 ) to instruct the locomotion assisting exoskeleton device to begin a walking gait , stepping with the left leg first . leaning on the right leg is a relatively intuitive way of indicating that the user wishes to start walking by stepping with the left leg . when the control system detects leaning on the right leg , the system executes an algorithm ( step 44 ) causing the locomotion assisting exoskeleton device to extend the left leg . the user is then standing with left leg extended ( step 46 ). the system records that a walking step was made with the left leg ( step 146 ) and the gait maintenance process ( described below ) begins ( step 48 ). if the user prefers to start the gait with the right leg , the user leans on the left leg ( lfhl loading , step 50 ). this initiates a walking step with the right leg ( step 52 and step 54 ) that is recorded by the system ( step 148 ). during the process of initiating a gait , the locomotion assisting exoskeleton device continues to monitor the ground force sensors . should the ground force sensors indicate falling ( step 56 , fll , ft , or fo loading on one leg combined with a ft or fo loading on the other ), or a tilt sensor indicate falling , the walking gait initiation procedure is halted ( step 58 ). alternatively , initiating a gait by the locomotion assisting exoskeleton device may be controlled by means of activating the ground force sensors alone , without waiting for a signal from a tilt sensor . fig3 is a diagram of control for initiating a step from a standing position using only ground force sensors , in accordance with embodiments of the present invention . leaning on either leg initiates the gait initiation process . if the ground force sensors do not indicate that the user has leaned on either leg within a predetermined period of time , the gait initiation process times out and is halted . fig4 a is a diagram of the control process for maintaining a gait , in accordance with embodiments of the present invention . fig4 b is a flow chart of a control method for the process illustrated in fig4 a . before initiating another walking step of the gait , the system checks if the tilt sensors indicate that the user is leaning forward . if not ( step 57 ), and a predetermined time period has elapsed ( step 144 ), the gait maintenance process times out . when the process times out , an algorithm is executed ( step 70 ) to bring both legs to a standing position ( step 40 ) and the process is halted ( step 58 ). the user indicates the intention to continue the walking gate by continuing to lean forward ( step 47 ). if the previous step of the gait was executed with the left leg , the user may be standing in the position of step 46 , with left leg extended forward . the user leans on the extended left leg ( step 60 ) to instruct the locomotion assisting exoskeleton device to continue the walking gait by extending the right leg ( step 62 ). the system records that the last step of the gait was executed with the right leg . the user is now in the position of step 54 , with right leg extended . on the other hand , while standing in the position of step 46 , the user may lean on the trailing right leg ( step 68 ) or on both legs with about equal force . continuing to lean on the trailing right leg or on both legs for a predetermined time interval ( step 150 ) instructs the locomotion assisting exoskeleton device to halt the walking gait . the system executes an algorithm ( step 70 ) to bring the user &# 39 ; s legs together to a standing stance , to the position of step 40 . the walking process is then halted ( step 58 ). if the previous step of the gait was executed with the right leg so that the user stands with right leg extended ( step 54 ), the user may lean on the extended right leg to instruct the locomotion assisting exoskeleton device to continue a forward gait by extending the left leg ( step 64 ). the locomotion assisting exoskeleton device then executes a step of the gait with the left leg forward ( step 66 ) so that the user is standing with the left leg extended ( step 46 ). the system records that a step was executed with the left leg ( step 146 ). on the other hand , while still standing in the position of step 54 , leaning on the trailing left leg ( step 74 ) or about equally on both legs ( step 40 ) for a predetermined time interval ( step 150 ) instructs the locomotion assisting exoskeleton device to bring the user to a standing position ( step 70 and step 40 ) and to stop the gait maintenance process ( step 58 ). after taking a step of the gait , with the having one leg extended ( step 46 or step 54 ), the system again checks for tilt ( step 142 ) and repeats the step process . if during execution of a step of the gait , the ground force sensors or a tilt sensor indicate that the user is falling ( step 56 ), the gait maintenance process is halted ( step 58 ). alternatively , the process of maintaining a walking gait of the locomotion assisting exoskeleton device may be controlled by means of activating ground force sensors alone , without waiting for a signal from a tilt sensor . fig5 is a diagram of the control process for maintaining a gait using only ground force sensors , in accordance with embodiments of the present invention . leaning on the extended leg signals continuation of the gait maintenance process . if the ground force sensors do not indicate that the user has leaned on the extended leg within a predetermined period of time , the gait maintenance process times out , the legs are brought together to a standing - straight position , and the process is halted . fig6 is a diagram of the control process for standing from a sitting position , in accordance with embodiments of the present invention . the user , in a sitting position , uses the control panel unit of the locomotion assisting exoskeleton device to signal the locomotion assisting exoskeleton device that the user wishes to stand . in order to instruct the locomotion assisting exoskeleton device to initiate the standing procedure , the user places both feet on the ground ( step 80 , ft loading on both legs ). the locomotion assisting exoskeleton device initiates a standing procedure algorithm ( step 82 ). the locomotion assisting exoskeleton device begins straightening the user &# 39 ; s legs ( step 84 and step 86 ), bringing the user to a standing position ( step 88 ). while executing the standing procedure , the locomotion assisting exoskeleton device monitors the output signals of the ground force sensors . if the standing procedure proceeds as expected , the ground force sensors measure increasing force during steps 84 and 86 until the full standing position of step 88 is attained ( rfll and lfll loading ). alternatively or additionally , progress of the standing procedure may be monitored by means of sensors that sense the angles of the various joints , and that are incorporated in the actuation assemblies of the locomotion assisting exoskeleton device . deviation from the expected increase in force , or change in joint angle , for a predetermined interval of time may be interpreted as indicating a problem with the standing procedure . in such a case , the locomotion assisting exoskeleton device may alert the user , and may halt or suspend the standing procedure until further instructions are received or may return the user to a sitting position 80 . another safety means may involve a tilt sensor that senses the tilt angle of a part of the upper body of the user . if the tilt sensor indicates that the user is falling , the locomotion assisting exoskeleton device may act to attempt to prevent or mitigate the effects of the fall . for example , the locomotion assisting exoskeleton device may cause the user to sit back . fig7 is a diagram of the control process for sitting from a standing position , in accordance with embodiments of the present invention . while standing in front of a surface on which the user wishes to sit , the user uses the control panel unit to instruct the locomotion assisting exoskeleton device to execute a sitting procedure . the user stands straight , with approximately equal force ( fll loading ) on both legs ( step 90 ). this signals the locomotion assisting exoskeleton device to initiate a sitting procedure algorithm ( step 92 ). the locomotion assisting exoskeleton device bends the user &# 39 ; s legs ( step 94 and step 96 ), bringing the user to a sitting position ( step 98 ). while executing the sitting procedure , the locomotion assisting exoskeleton device continues to monitor the ground force sensors . it is expected that the ground force sensors will indicate decreasing ground force until a full sitting position is attained ( rft and lft loading ). alternatively or additionally , progress of the sitting procedure may be monitored by means of sensors that sense the angles of the various joints , and that are incorporated in the actuation assemblies of the locomotion assisting exoskeleton device . a deviation from the expected decrease in force , or change in joint angle , for a predetermined interval of time may be interpreted as indicating a problem with the sitting procedure . the procedure may then be stopped or paused until further instructions are received . if a tilt sensor indicates that the user may be falling during the sitting procedure , the sitting procedure may be stopped , and action may be taken to prevent , or mitigate the effects of , the fall . fig8 a is a diagram of the control process for ascending a stair , in accordance with embodiments of the present invention . fig8 b is a flow chart of a control method for the process illustrated in fig8 a . to ascend a stairway of several stairs , the control process is repeated for each consecutive stair . to initiate the process of ascending a stair , a user standing below a stair to be ascended uses the control panel unit to instruct the locomotion assisting exoskeleton device to execute a stair ascending procedure ( step 160 ). the system then checks if the ground force sensors indicate that the user is leaning on a single leg ( step 162 ). the user leans on one leg to instruct the locomotion assisting exoskeleton device to initiate the procedure by placing the opposite leg on top of the stair . if the user does not lean on a single leg but continues to stand on both legs , the locomotion assisting exoskeleton device alerts the user ( step 163 ). in this example , the user leans on the left leg ( step 100 ). for simplicity , we limit the discussion here to an example in which the user leans on the left leg in order to begin the ascent with the right leg . however , the description of the procedure remains valid if right and left legs are interchanged throughout . in response to leaning on the left leg , the locomotion assisting exoskeleton device executes an algorithm for lifting the right leg and extending it forward above the stair ( step 102 ). with the right leg positioned above the stair , the ground force sensors are expected to indicate that the user is standing on the left leg ( step 104 ). the locomotion assisting exoskeleton device then executes an algorithm to lower the right leg ( step 106 ), checking the ground force sensors on the right foot brace ( step 170 ) until the sensors indicate that the right foot has touched the top of the stair ( rft loading ) while leaning on the left leg ( step 108 ). at this point the output signals from the ground force sensors are monitored to check whether the right foot is fully resting on the stair ( step 172 ). for example , input signals from sensors in both the toe and heel of the right foot brace may be checked to verify that all sensors indicate at least minimal contact ( ft loading ). if the sensor signals indicate that all or part of the right foot is not resting on top of the stair within a predetermined time interval , the algorithm assumes that the procedure has failed . in the event of such failure , the locomotion assisting exoskeleton device may return the right foot to its original position as at the beginning of the procedure ( step 173 ), i . e . the position of step 100 . the procedure is then halted until further instructions are received ( step 58 ). if the sensors indicate that the procedure has continued as expected , and that the right foot is fully resting on top of the stair , the locomotion assisting exoskeleton device may alert the user to this by generating an audible or other signal . for safety reasons , the locomotion assisting exoskeleton device may then await acknowledgment or verification from the user before proceeding to the next step in ascending the stair ( step 174 ). the user may indicate verification by means of a control button , or by any other appropriate control or signaling means known in the art . once verification is received from the user , system checks whether the user is leaning on the right leg ( step 176 ). in addition , the system may verify that a tilt sensor indicates that the user &# 39 ; s torso is leaning forward . if the user leans on the right leg ( step 110 ), the system executes an algorithm to lift the left leg and the user &# 39 ; s body to the top of the stair ( step 112 ). failure to lean on the right leg , or to lean forward , within a predetermined time interval may indicate the user &# 39 ; s stance is inconsistent with safely proceeding with the ascend stair procedure . therefore , failure to lean on the right leg , or to lean forward , may cause the locomotion assisting exoskeleton device to alert the user and to stop the procedure until further instructions are received ( step 178 ). when step 112 is complete , the left leg is brought into line with the right leg on top of the stair . the user is then standing on top of the ascended stair ( step 114 ). at this point , the user may use the control panel unit to instruct the locomotion assisting exoskeleton device to execute a procedure to begin a walking gait , to ascend another stair , or any other appropriate action . throughout the stair ascending procedure , the stability and safety of the user may be achieved by concurrent use of crutches or a hand railing . during execution of the stair ascending procedure , the ground force sensors or a tilt sensor may indicate that the user is falling . the locomotion assisting exoskeleton device may then take action to prevent , or mitigate the effects of , a fall . for example , the locomotion assisting exoskeleton device may attempt to restore balance to prevent a fall , may cause the user to collapse in such a manner as to reduce the impact of a fall . fig9 a is a diagram of the control process for descending a stair , in accordance with embodiments of the present invention . fig9 b is a flow chart of a control method for the process illustrated in fig9 a . to descend a stairway of several stairs , the control process is repeated for each consecutive stair . to initiate the process of descending a stair , a user standing on an upper level above a stair to be descended uses the control panel unit to instruct the control system of the locomotion assisting exoskeleton device to execute a stair descending procedure ( step 182 ). the user leans on one leg to instruct the locomotion assisting exoskeleton device to initiate stair descent procedure with the opposite leg . if the user does not lean on a single leg ( step 184 ) but continues to stand on both legs , the locomotion assisting exoskeleton device alerts the user ( step 186 ). in this example , the user leans on the left leg ( step 120 ). for simplicity , we limit the discussion here to an example in which the user leans on the left leg in order to begin the descent with the right leg . however , the description remains valid if right and left legs are interchanged throughout . in response to leaning on the left leg , the system executes an algorithm for extending the right leg forward above the stair ( step 122 ). while extending the right leg , the system continues to check if the right foot is no longer touching the upper level ( rfo loading , step 190 ). when the right leg is extended above the stair , the ground force sensors are expected to indicate rfo loading on the right foot , and that the user is standing on the left leg ( step 124 ). at this point , for reasons of safety , the system may wait for an acknowledgement signal indicating verification by the user ( step 192 ). verification from the user may be understood to indicate that crutches are properly positioned , or other precautions have been taken , to assure proper support of the user &# 39 ; s body during the next steps of the procedure . if verification is received , the locomotion assisting exoskeleton device then executes an algorithm for bending the left knee ( step 127 ), lowering the right leg . during execution of the algorithm of step 127 , the ground force sensors may indicate a state equivalent to falling , with a combination of rfo and lfll or lft loading ( step 126 ). however , in reality , the weight of the user is being supported by crutches or other means . during this phase of descending a stair , a true state of falling may be indicated only by a tilt sensor or similar sensor , and not by the ground sensors . while bending the left knee , the system checks the ground force sensors for rft loading ( step 194 ) that may indicate that the right foot has made contact with the top of the stair . when rft loading is indicated , the right foot is expected to rest on the top of the stair the algorithm of step 127 ceases to execute . the ground force sensors are checked to verify that the user is leaning on the right leg ( step 196 ). if not the user is alerted ( step 198 ). when the user leans on the right leg ( step 128 ), the system begins execution of an algorithm to remove the left leg from the upper level ( step 130 ). the locomotion assisting exoskeleton device lifts the left leg at the hip and bends the left knee to remove the left foot from the upper level . this action continues as long as the ground force sensors indicate lft loading ( step 131 ). when the ground force sensors indicate lfo , the left foot is expected to be positioned above the stair , with the user leaning on the right leg ( step 132 ). the system then executes an algorithm that causes the locomotion assisting exoskeleton device to lower the left foot until the left foot touches the top of the stair ( step 134 ). when step 134 is complete , the user is standing with both legs on top of the stair ( step 136 ). at this point , the user may use the control panel unit to instruct the locomotion assisting exoskeleton device to execute a procedure to begin a walking gait , to descend another stair , or any other appropriate action . throughout the stair descending procedure , the stability and safety of the user may be achieved by concurrent use of crutches or a hand railing . it should be understood that in the above descriptions of examples of control processes , steps of the processes may have been omitted for the sake of clarity and simplicity . also , variations of the processes and procedures described above may be apparent to one skilled in the art , and are to be considered as falling within the scope of the present invention . examples of such variations are : additional or different points during a procedure where user verification may be required , different means of indicating user verification or monitoring a procedure , additional timeout intervals that were not indicated in the above discussion , use of tilt sensor output in procedures where such use was not described in the above discussion , use of angle sensor output , changing the order of individual steps of the procedure , and other variations . thus , as described above , a system for the convenient , safe , and intuitive control of a locomotion assisting exoskeleton device is provided . it should be clear that the description of the embodiments and attached figures set forth in this specification serves only for a better understanding of the invention , without limiting its scope . it should also be clear that a person skilled in the art , after reading the present specification could make adjustments or amendments to the attached figures and above described embodiments that would still be covered by the present invention . | 1 |
fig1 shows a photovoltaic assembly 100 according to an exemplary embodiment of the present disclosure . the exemplary photovoltaic assembly 100 includes an optical assembly 106 that is affixed to a front surface of a photovoltaic cell 102 for concentrating solar rays . in an exemplary embodiment , the optical assembly 106 provides a concentration of about 1600 times or greater than the incident solar concentration . in an exemplary embodiment , this level of solar concentration produces a large amount of heating at the photovoltaic cell 102 . the photovoltaic cell 102 is coupled to a cell package 104 for dissipating heat from the photovoltaic cell 102 . in an exemplary embodiment , a back surface of the photovoltaic cell 102 is directly soldered to the cell package 104 using a solder . the solder may include an 80 / 20 lead / tin solder or a low melt solder . alternate solders usable for soldering the photovoltaic cell 102 and cell package 104 may include alloys containing at least one of lead , tin , copper , gallium , silver , manganese , magnesium , bismuth , indium , zinc and antimony , such as for example sn — ag — cu , sn — ag — cu — zn and sn — ag — cu — mn . alternately , the photovoltaic cell 102 may be coupled to the cell assembly 104 using a conductive particle infused polymer adhesive , such as silver paste . wires 108 are bonded between the photovoltaic cell 102 and the cell package 104 to provide an electrical path for current produced at the photovoltaic cell 102 . in an exemplary embodiment , the wires 108 may be bonded using a solder such as the exemplary solders listed above . in an alternate embodiment the cell is connected to the top surface conductors on the cell package using on of wire bonding and ribbon bonding methods where the wire and ribbon may comprise one of gold , silver , platinum , palladium , aluminum , silicon and copper . fig2 shows an exploded view of an exemplary cell package 104 of fig1 in one embodiment of the present disclosure . the exemplary cell package 104 includes a coating 202 , a solder mask 204 , a copper layer 206 , a dielectric layer 208 and a substrate layer 210 . in an exemplary embodiment , copper layer 206 and substrate layer 210 form electrodes coupled to the photovoltaic cell 102 . in an exemplary embodiment , copper layer 206 forms an electrical circuit with the photovoltaic cell 102 . coating 202 provides a top surface of the cell package and is in contact with the photovoltaic cell 102 . coating 202 provides a substantially corrosion resistant surface for wire bonding and may include at least one of gold , silver , nickel , zinc and tin . solder mask 204 provides a second layer of the cell package 104 and includes an insulating material . the solder mask may include standard solder mask material such as , for example , an epoxy paint . the solder mask 204 may be applied via screen printing in an exemplary embodiment . the solder mask may have windows for wire bonding , strap bonding or strap welding of connections between the photovoltaic cell 102 and package electrodes ( not shown ) of the cell package 104 . the solder mask 204 further includes windows allowing interconnecting wires ( see fig5 ) to be soldered to the package electrodes , thereby interconnecting a plurality of photovoltaic assemblies 100 to each other and / or to an external device . in exemplary embodiments , the interconnecting wires may be bonded between the photovoltaic cell 102 and the electrodes of the cell package 104 using gold wire bonding , ribbon bonding or strap welding , for example . connective bonding material may include at least one of gold , silver , invar , iron , copper and tin . copper layer 206 provides a third layer of the cell package 104 and is an electrically conductive layer that forms a second electrode of the photovoltaic cell 104 . in alternate embodiments , the copper layer 206 may be made of any material that is electrically conductive . copper layer 206 may be patterned using exemplary lithographic methods such as photolithography , screen printing , and ink jet printing , for example . after patterning , an etch process may be used to remove unwanted copper from the copper layer 206 to form a selected shape . in addition , the copper layer is selected to provide an electrically conductive channel for conducting current generated from the photovoltaic cell , for example , to the interconnecting wires . in various embodiments , the current densities are in a range from about 6 . 3 amps per square centimeter ( amps / cm 2 ) to about 25 . 2 amp / cm 2 . the copper layer 206 may be electrically coupled to an electrode of the photovoltaic cell 102 using a ribbon bond , a wire bond , etc . dielectric layer 208 provides a fourth layer of the cell package 104 that provides electrical isolation of the copper layer 206 from the underlying substrate layer 210 . the dielectric layer 208 further allows heat transfer from the copper layer 206 to the substrate layer 210 . in an exemplary embodiment , the dielectric layer 208 may include an fr4 matrix of glass fiber and epoxy that may be cured by thermal , chemical or ultraviolet methods . substrate layer 210 provides a fifth and bottom layer of the cell package 104 and may be a thick layer in comparison to layers 202 - 208 . the substrate layer 210 may serve as both an electrode and a thermal conductor . increasing the thickness d of the substrate layer 210 relative to the thicknesses of layers 202 - 208 increases an ability of the substrate layer 210 to spread the heat conducted to the substrate layer from the photovoltaic cell 104 via the layers 202 - 208 . the substrate layer may have lateral dimensions of length and width . increasing the size of the lateral dimensions may improve a thermal coupling of the substrate layer 210 to a backplane ( see fig4 ). the lateral dimension and thickness of the substrate layer may be selected to achieve a selected thermal performance ( i . e ., solar heat dissipation ) of the cell package 104 and a selected operating temperature of the related photovoltaic assembly 100 . in an exemplary embodiment , the substrate layer 210 is made of copper or other material selected to achieve high thermal conductivity . in alternate embodiments , layer 210 may include aluminum or at least one of copper , aluminum , iron , chrome , nickel , molybdenum , zinc and tin . in an embodiment in which a photovoltaic cell has a length and width of about 3 . 75 millimeters ( mm ), a length and width of the substrate layer 210 may be about 15 mm and the thickness may be about 1 . 5 mm . layers 206 , 208 and 210 may be coupled to each other by pressure and heat to cure layer 208 to form a bond . in an exemplary embodiment , layers 206 , 208 and 210 may be bonded to form a sheet that is then separated into individual substrates suitable for use in a selected cell package 104 . the separated substrates may be patterned into individual substrate layers using printed circuit methods . fig3 shows a cell package 104 in an alternate embodiment . the alternate cell package 104 includes a coating 302 , a solder mask 304 , a copper layer 306 , a dielectric layer 308 and a substrate layer 310 . in the alternate embodiment , layer 306 includes both cell electrodes 306 a and 306 b coupled to the photovoltaic cell 102 and is made of thick copper that has a thickness that is substantially between about 20 microns and about 400 microns . the dimensions of the layer 306 are selected so as to be conducive to spreading heat laterally . layer 308 is made thin in comparison to layer 208 of fig2 to increase heat transfer between layer 306 and the substrate 310 . fig4 shows a cross - sectional view 400 of an exemplary photovoltaic assembly coupled to a backplane 410 . the photovoltaic assembly includes photovoltaic cell 402 mounted on an exemplary cell package 404 . the cell package 404 is coupled to an insulation layer or layers 408 via a thermal adhesive 406 that allows heat transfer between the cell package 404 and the insulation layer or layers 408 . the insulation layer or layers 408 may be a printable layer . in one embodiment , the insulation layer or layers 408 may be multi - layer insulators . the insulation layer or layer 408 may also include aluminum oxide , polymers , or other electrically resistive particles , etc . in an exemplary embodiment , the thermal adhesive 406 may include a material having at least one of a high thermal conductivity , a high mechanical flexibility , an ability to cure at low temperatures , an ability to withstand operating temperatures in a range from about − 40 ° c . to about 120 ° c ., and an ability to adhere to the contacting faces of the cell package 404 and of the insulation layer or layers 408 providing electrical insulation . the thermal adhesive 406 may include , but is not limited to , silcool ® tia - 0220 of momentive performance materials , inc . in an exemplary embodiment , the thermal adhesive 406 includes an insulating silicone adhesive . in alternate embodiments , the thermal adhesive 406 may include epoxy and acrylic adhesives . in another embodiment , the thermal adhesive 406 includes a polymer with thermally conductive particles embedded therein . exemplary polymers may include at least one of silicone , acrylic and epoxy . exemplary particles may include at least one of aluminum oxide , aluminum nitride and silicon dioxide . in an exemplary embodiment , the thermal adhesive 406 is compressed to a thin bond line of approximately 50 microns or less and is allowed to slightly extrude beyond the edges of the cell package 404 . the insulation layer 408 or layers reduces electrical conduction between the cell package 404 and the backplane 410 , while allowing heat transfer therebetween . the insulation layer or layers 408 may be bonded to an aluminum backplane 410 prior to bonding the insulation layer or layers 408 to the cell package 404 . the insulation layer or layers 408 may include an epoxy - based screen - printable material . in various embodiments , the insulation layer or layers 408 may include any electrically - insulating material with high dielectric strength , strong adhesion to the anodized aluminum of the backplane 410 and an ability to resist heat damage at temperatures in an operating range from about 85 ° c . to about 120 ° c . in an exemplary embodiment , the insulation layer or layers 408 may include techniflex by technic corp . and may be applied using screen printing methods on the backplane 410 to a thickness of about 15 microns . in alternative embodiments , the insulation layer or layers 408 may include , but is not limited to , paints , lacquers , powder coats , etc . such materials in the alternative embodiment of the insulation layer or layers 408 may include at least one of polyester , polyurethane , polyester - epoxy , epoxy , acrylic and silicone . the aluminum backplane 410 may include a sheet of anodized aluminum . in an exemplary embodiment , the backplane 410 includes a sheet of about 1 . 5 mm in thickness and an anodized layer thickness of about 10 microns . in various embodiments , the anodized layer may have a thickness that provides a protective layer to the aluminum surface as well as an electrical breakdown resistance . electrical breakdown resistance is provided by the thermal adhesive 406 , the insulation layer or layers 408 and the anodization of the backplane 410 . in an exemplary operation of the photovoltaic assembly , heat concentrated at the photovoltaic cell is transferred to the cell package 404 . at the cell package 404 , the heat is distributed in along lateral dimensions of the cell package at the copper substrate , such as substrate 210 in fig2 or alternately substrate 310 in fig3 in order to reduce an areal density of the heat by spreading the heat , in general along a lateral dimension of the substrate . heat from the substrate 210 is transferred to the aluminum backplane 410 through the insulation layer 408 . in various embodiments , the insulation layer 408 prevents current transfer between substrate 310 and the aluminum backplane 410 by providing a breakdown resistance to about 1700 volts or more . fig5 shows an exemplary assembly 500 for mounting a plurality of photovoltaic assemblies . cell package 502 a is shown having an associated photovoltaic cell 504 a and an associated secondary optic 506 a . cell package 502 b is shown having an associated photovoltaic cell 504 b and an associated secondary optic 506 b . cell packages 502 a and 502 b are coupled to the aluminum backplane 510 via exemplary screen - printed dielectric 520 . cell packages 502 a and 502 b are disposed on the backplane 510 at a location that corresponds to a focal point of their respective secondary optics 506 a and 506 b when the backplane 501 is perpendicular to solar radiation . in one embodiment , a protection diode 512 is packaged to the backplane in a manner similar to the packaging of cell packages 502 a and 502 b . the protection diode 512 includes a heat shield 514 that protects the protection diode 512 from heat or dissipates heat from the protection diode 512 . in an exemplary embodiment , the heat shield 514 includes a copper strip that covers the protection diode 512 and is soldered to contact pads of the diode package . interconnecting wiring 516 provides an electrical connection between cell packages 502 a and 502 b . in one embodiment , the interconnecting wiring 516 connects printed circuit layers of the cell packages 502 a and 502 b . the interconnecting wiring 516 includes copper wire that is soldered to electrodes of the cell packages 502 a and 502 b . the diameter of the wire is selected to handle a current provided by the exemplary cell packages and to reduce internal resistance losses kinks 518 are introduced into the interconnecting wiring 516 to avoid mechanical stress due to thermal expansion of the interconnecting wiring 516 . the interconnecting wiring 516 may be sufficiently rigid to be self - supporting . the interconnecting wiring 516 may be affixed to the backplane 510 separated by a separation distance in a range of about 1 millimeter to about 2 millimeters above the surface of the backplane 510 . such a configuration avoids physical contact with the insulating dielectric or with the aluminum anodized surface . fig6 shows a top view of a solar panel assembly 600 in an exemplary embodiment . the exemplary solar panel assembly 600 includes five tiers 602 a - 602 e of cell packages . in each tier , four cell packages , such as exemplary cell packages 604 a - 604 d , and a protection diode 606 are connected in parallel using the interconnecting wiring 608 . the cell packages are coupled to an aluminum backplane 610 via dielectric layer 612 . the tiers 602 a - 602 e are connected in series to form a solar panel assembly 600 having 20 cell packages . in various embodiments , the number of cells in parallel vs . the number of cells in series may be selected to achieve a selected current - voltage ratio of the solar panel assembly 600 . having cells wired in parallel ( in the tiers ) allows one or more cells to fail while maintaining the function of the panel at a reduced power , thereby improving an overall reliability of the solar panel assembly 600 . terminal connections 614 provide electrical coupling from the interconnecting wiring 608 to external circuitry . the interconnect wiring 608 may be soldered to an insulated multi - strand copper external connection wire ( not shown ) that penetrates the aluminum backplane 610 to an exterior of the solar panel assembly 600 via a strain relief cord grip . fig7 shows an exemplary solar panel package 700 of the present disclosure . the exemplary solar panel package 700 includes an enclosure 702 that encloses a solar panel assembly ( not shown ) having one or more cell packages according to the present disclosure . a lens 704 such as a fresnel lens is coupled to a top of the enclosure 702 using an adhesive , to enclose the solar panel assembly . in various embodiments , the adhesive includes a silicone adhesive . filtered vents are provided in the enclosure 702 to equalize pressures between an interior and an exterior of the enclosure 702 and to allow moisture within the enclosure to escape to an exterior of the enclosure 702 . fig8 shows an exploded view 800 of the solar panel package 700 of fig7 . the exploded view 800 shows the enclosure 702 and the fresnel lens 804 . additionally , the exploded view 800 shows the solar panel assembly 802 that includes a number of cell packages and resides in a chamber formed by the enclosure 702 and the fresnel lens 704 . the enclosure 702 may further include one or more cooling fins 804 to aid in the dispersion of heat from the enclosure 802 and thus from the solar panel 802 . the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the disclosure . as used herein , the singular forms “ a ”, “ an ” and “ the ” are intended to include the plural forms as well , unless the context clearly indicates otherwise . it will be further understood that the terms “ comprises ” and / or “ comprising ,” when used in this specification , specify the presence of stated features , integers , steps , operations , elements , and / or components , but do not preclude the presence or addition of one more other features , integers , steps , operations , element components , and / or groups thereof . the corresponding structures , materials , acts , and equivalents of all means or step plus function elements in the claims below are intended to include any structure , material , or act for performing the function in combination with other claimed elements as specifically claimed . the description of the present disclosure has been presented for purposes of illustration and description , but is not intended to be exhaustive or limited to the disclosure in the form disclosed . many modifications and variations will be apparent to those of ordinary skill in the art without departing from the scope and spirit of the disclosure . the embodiment was chosen and described in order to best explain the principles of the disclosure and the practical application , and to enable others of ordinary skill in the art to understand the disclosure for various embodiments with various modifications as are suited to the particular use contemplated the flow diagrams depicted herein are just one example . there may be many variations to this diagram or the steps ( or operations ) described therein without departing from the spirit of the disclosure . for instance , the steps may be performed in a differing order or steps may be added , deleted or modified . all of these variations are considered a part of the claimed disclosure . while the exemplary embodiment to the disclosure had been described , it will be understood that those skilled in the art , both now and in the future , may make various improvements and enhancements which fall within the scope of the claims which follow . these claims should be construed to maintain the proper protection for the disclosure first described . | 8 |
embodiments of the invention are described in detail hereinafter with reference to the accompanying drawings to further clarify the objectives , technical solutions and advantages of the embodiments of the invention . a wideband code division multiple access ( wcdma ) network system is one of the mainstream networks of the 3g mobile communication systems , adopting the general packet radio service ( gprs ) techniques . the schematic diagram illustrating the wcdma system architecture is shown in fig1 , which includes a terminal 101 , an access network 102 and a cn 103 , wherein the cn 103 connects with the internet to implement the interaction between the mobile communication network and the internet . the access network 102 further includes a base station ( node b ) 104 and a rnc 105 , the cn 103 further includes an sgsn and a ggsn . to play a stream media , there is also a content server 106 in the network , which is called a stream media server , and the stream media or the stream media link is directly placed on the webpage of the content server . the user visits the webpage of the content server 106 in the internet by the terminal 101 via the access network 103 and the cn 103 , to select , click and play the stream media which the user wants to watch . as the visit to the webpage of the content server by the user is an interactive traffic without requirements on rate and time delay , it uses the be traffic as the bearer . when the user clicks the stream media on the webpage , it is necessary to switch the be traffic to the streaming traffic to bear the stream media . in embodiments of the invention , the stream media refers to stream , namely real time stream , and the stream media transmission refers to the stream transmission . according to different initiators of traffic switching , the solution can be implemented in two embodiments , which are the traffic switching performed by the content server and the traffic switching performed by the network element such as the sgsn or the ggsn in the cn . the content server initiates the be traffic / streaming traffic switching . the flow chart of the embodiment is shown in fig2 , which includes the following steps . step 201 : a terminal sends a request for activating data traffic to a cn via an access network . step 202 : upon receiving the request , the cn sends a request to the access network for setting up a be traffic bearer channel . step 203 : upon receiving the request from the cn , the access network interacts with the terminal to set up the be traffic bearer channel . step 204 : the access network sends to the cn a message indicating the be traffic bearer channel has been set up successfully . steps 205 to 206 : the terminal visits the content server in the manner of be traffic bearer to obtain the stream media network link address through the access network and the cn . step 207 : the terminal visits the stream media network link , and requests the stream media transmission . step 208 : the content server analyzes the sdp file corresponding to the stream media to be transmitted , and obtains the qos requirement of the stream media transmission . the sdp file includes : basic information of the session , such as the title and author as well as the type of the stream media , the bandwidth requirement , and etc . step 209 : the content server sends a request for setting up a streaming traffic bearer to the sgsn of the cn , wherein the request includes the qos requirement of setting up the streaming traffic . the sgsn activates the pdp context by interacting with the ggsn , and authenticates the terminal user . step 210 : if the authentication is successful , the cn sends to the rnc of the access network a request for switching the bearer channel from the be traffic to the streaming traffic . step 211 : upon receiving the request , the access network interacts with the terminal to switch the bearer channel from the be traffic to the streaming traffic . step 212 : the access network notifies the sgsn in the cn that the bearer channel has been switched to the streaming traffic successfully . step 213 : the terminal sends a play signaling of the real - time streaming protocol ( rtsp ) to the content server , upon receiving the play signaling , the content server transmits the stream media to the terminal via the streaming traffic bearer channel . step 214 : when the stream media transmission is finished , the terminal sends to the content server a teardown signaling of rtsp for terminating the stream media transmission ; upon receiving the teardown signaling , the content server sends a request for setting up a be traffic bearer to the sgsn in the cn . step 215 : the sgsn in the cn sends to the rnc of the access network a request for switching the bearer channel from the streaming traffic to the be traffic . step 216 : upon receiving the request , the access network interacts with the terminal to switch the bearer channel to the be traffic . step 217 : the access network notifies the sgsn in the cn that the bearer channel has been switched to the be traffic successfully , and terminates the current traffic flow . in this embodiment , network element of the cn , for example , an sgsn or a ggsn analyzes network packet sent to a content server by a terminal . when determining that stream media transmission is about to start according to the contents of the network packet , the network element of the cn switches the bearer channel from the be traffic to the streaming traffic . when determining the stream media transmission is about to end from the contents of the network packet , the network element of the cn switches the bearer channel from the streaming traffic to the be traffic . therefore the embodiment requires the sgsn or the ggsn to analyze and identify the network packet , and the analyzing step can be divided into two steps : step 1 , analyzing a destination address of a forwarded network packet , and determining whether the destination address is the address of the content server . if the destination address is the address of the content server , proceed to step 2 ; otherwise , forward the network packet ; step 2 , further analyzing the content of the network packet , determining whether the content is a play signaling or a teardown signaling which both belongs to the rtsp ; if the content is a play signaling , the sgsn or the ggsn initiates the switching from the be traffic to the streaming traffic ; if the content is a teardown signaling , the sgsn or the ggsn initiates the switching from the streaming traffic to the be traffic . if the content of the network packet is neither of the two kinds of signaling , forward the network packet . the start or end of the stream media transmission is determined by identifying a play signaling or a teardown signaling in the step 2 mentioned above , which can also be determined by identifying other kinds of signaling indicating the start or end of the stream media or other characteristic information . the flow chart of this embodiment is shown in fig3 , which includes the following steps . step 301 : a terminal sends a request for activating data traffic to a cn via an access network . step 302 : upon receiving the request , the cn sends a request to the access network for setting up a be traffic bearer channel . step 303 : upon receiving the request from the cn , the access network interacts with the terminal to set up the be traffic bearer channel . step 304 : the access network sends to the cn a message indicating the be traffic bearer channel has been set up successfully . steps 305 to 306 : the terminal visits the content server in the manner of the be traffic bearer to obtain a stream media network link address via the access network and the cn . step 307 : the terminal visits the stream media network link , and sends a rtsp play signaling to the content server . step 308 : the sgsn or the ggsn determines that the signaling sent to the content server from the terminal is the play signaling by analyzing and identifying the network packet , obtains and analyzes the sdp file corresponding to the stream media from the content server , and obtains the qos requirement of the stream media transmission . the content of the sdp file includes basic information of the session such as the title and author , the type of the stream media , the bandwidth requirement , and etc . the sgsn activates the pdp context through interacting with the ggsn , and authenticates the terminal user . step 309 : if the authentication is successful , the sgsn of the cn sends to the rnc of the access network a request for switching the bearer channel from the be traffic to the streaming traffic . step 310 : upon receiving the request , the access network interacts with the terminal to switch the bearer channel from the be traffic to the streaming traffic . step 311 : the access network notifies the sgsn of the cn that the bearer channel has been switched to the streaming traffic successfully . step 312 : the content server transmits the stream media to the terminal via the established streaming traffic bearer channel . step 313 : when the stream media transmission is finished , the terminal sends a rtsp teardown signaling to terminate the stream media transmission to the content server , the sgsn of the cn or the ggsn of the cn determines the signaling sent to the content server by the terminal is a teardown signaling by analyzing and identifying the network packet . step 314 : the sgsn of the cn sends to the rnc of the access network a request for switching the bearer channel from the streaming traffic to the be traffic . step 315 : upon receiving the request , the access network interacts with the terminal to switch the bearer channel to the be traffic . step 316 : the access network notifies the sgsn of the cn that the bearer channel has been switched to the be traffic successfully . the foregoing describes only preferred embodiments of the invention and is not to limit the invention . any modification , equivalent substitution , and improvement without departing from the spirit and principle of the invention should be covered in the protection scope of the invention . | 7 |
the present invention is shown in an elevational view , partially in cross - section , in fig1 . there is shown rescue tool 1 having a frame 3 which is constructed so as to be integrally formed with handles 5 . a pair of arms 7 and 9 are attached to each other by bolt 11 mounted through yoke 13 . the arms are constructed of a graphite laminate composite material with a directional fiber orientation to maximize strength and stiffness . the frame may be constructed of metal , or of a hybrid of metal and graphite . thus , the arms are essentially graphite - reinforced plastic , while the frame is metal or graphite - reinforced . the arms made of the graphite laminate composite are extremely strong , but are of lighter weight than the metal arms known in the prior art . the arms in the present invention may weigh about two pounds , while the steel arms used previously might be 91 / 2 pounds . unlike those of the prior art , the arms of the present invention are flat plates , and need not be made of i - beam or box cross - section . despite being flat plates , the arms maintain their rigidity . the overall weight of the complete tool is approximately 50 pounds , a substantial reduction compared to the prior art tools which have weighed as much as 70 pounds , or more . arms 7 and 9 are also connected to frame 3 by pivot links 15 and 17 . the pivot links are connected to the arms 7 and 9 by arm pins 19 and 21 , and are connected to the frame 3 by pivot pins 23 and 25 . disposed within hollow cylindrical region 27 is piston 29 . piston 29 is adapted to push on yoke 13 , through hollow cylinder 31 which is connected directly to the base 33 of yoke 13 . region 27 is adapted to receive high - pressure fluid , as will be described below . region 27 is further defined by end cap 35 which is attached to frame 3 by bolt 37 . valve block 39 is mounted on frame 3 , and holds the valves that are used for directing fluid into the regions around the piston , as will be described more fully below . attached to arms 7 and 9 are a pair of cutting blades 41 and 42 ( blade 42 being shown in phantom , as the blades overlap each other when the arms 7 and 9 are together ). due to the composition of the arms , the arms maintain their rigidity such that when the arms come together , the blades cut like a scissors . that is , the blades will not separate while cutting but will make a clean , sharp cut . attached to the tips of arms 7 and 9 are work jaws 43 and 45 . the work jaws , which can be made of steel , have holes 46 which are suitable for insertion of chains or nylon belts to perform lifting operations . work jaws 43 and 45 are used as the working tool surfaces for pushing , prying and lifting . the work jaws will become worn with use , and may be replaced . they are attached to arms 7 and 9 by a pin with an internal ball detent ( not shown ) to prevent accidental withdrawal , but which is removable by hand , thus making it possible to replace the work jaws in the field , without tools . the holes 46 can be used to attach chains or nylon belts , or other material of high tensile strength , in order to use the tool for lifting . the cutting blades 41 and 42 are attached to their respective arms by a plurality of bolts 47 . as is apparent from fig1 when piston 29 is forced upward , as indicated by the direction of arrow a , the arms 7 and 9 separate . as the arms separate , they are free to pivot on links 15 and 17 , as well as around yoke 13 . conversely , when the piston is moved downward , the arms 7 and 9 are forced together . when the hydraulic pressure on the piston 29 is sufficiently great , the arms 7 and 9 can be forced together or apart with extraordinary power , and can be used to push or pull with tremendous strength . also , when the arms 7 and 9 are forced together , blades 41 and 42 can be utilized as a high - powered scissors for cutting through metal . it is to be appreciated that the fixed point of rotation of the arms is at the center of the apparatus , i . e . at the yoke 13 , and not at the outer edges of the apparatus . as the piston 29 is moved , the arms are allowed to rotate around arm pins 19 and 21 , and the arm pins also move , by virtue of rotation of the links 15 and 17 around pivot pins 23 and 25 . because the force is applied at one point in the center ( and not at two points , on the ends , as was done in the prior art ), it is possible to make the distance from the yoke 13 to the arm pins 19 and 21 greater , thus increasing the lever arm length , and improving performance . in fact , the ability to use a longer lever arm results in the ability to achieve the same force with a smaller piston , thus reducing the weight of the tool . the detailed structure of the links and the yoke are further illustrated in fig2 and 3 . fig2 which is a cross - sectional view taken along the lines 2 -- 2 of fig1 shows frame 3 and arms 7 and 9 . arms 7 and 9 are shown attached to links 15 and 17 by arm pins 19 and 21 . also shown are pivot pins 23 and 25 , which attach the links 15 and 17 to frame 3 . also visible in fig2 are cutting blades 41 and 42 . the arms 7 and 9 are sandwiched between members 49 and 51 of yoke 13 ( see fig1 ). clamped around members 49 and 51 are bolt 52 and nut 50 . fig3 which is a cross - sectional view taken along the line 3 -- 3 of fig1 provides more detailed illustration of link 15 . arm pin 19 is shown holding arm 7 to link 15 . the frame pivot bolt 23 and pivot pin nut 55 are shown . also visible , mounted on handle 5 is valve block 39 to which are attached valve triggers 61 . the valve triggers 61 are used to control the tool manually . when the appropriate trigger is squeezed , the arms are made to open or close , according to the direction of high - pressure fluid flow in the hydraulic system , which will be explained below . fig6 is a schematic diagram of the hydraulic system , together with an abbreviated cross - sectional elevation of the rescue tool . although the rescue tool , as shown in fig6 is not identical to that shown in fig1 it is understood that fig6 represents the same rescue tool as that in fig1 and thus some of the same reference numerals are used in the schematic drawing of fig6 for purposes of clarity . fig6 shows hydraulic pump 71 which draws fluid along line 73 from reservoir 75 . fig6 also depicts schematically valve 77 which has four ports and three positions . valve 77 is centered by spring means 79 , and is manually operated by pressing triggers 80 . the triggers 80 are either identical to , or are operatively connected to , the valve triggers 61 of fig3 . the ports of valve 77 are indicated by the letters a , b , c , and d . in the quiescent position , which is the position shown in fig6 ports a and b are connected within valve 77 , so that fluid from reservoir 75 is pumped along line 73 and back to reservoir 75 through line 81 . when valve 77 is moved to the right in fig6 fluid pumped by pump 71 through line 73 enters the valve 77 at port b and exits valve 77 at port d along line 83 . the fluid then enters lower region 85 of the cylinder 91 . at the same time , any fluid that is in upper region 87 of cylinder 91 is drawn out through line 89 , entering valve 77 at port c , exiting valve 77 at port a , and returning to reservoir 75 through line 81 . the net effect is to cause an increase in pressure in region 85 and a decrease in pressure in region 87 , thereby causing piston 29 to move up , and to force arms 7 and 9 apart . conversely , when valve 77 is moved to the left in fig6 fluid pumped by pump 71 through line 73 enters valve 77 at port b and exits valve 77 at port c , and travels through line 89 into upper region 87 of cylinder 91 . at the same time , fluid in lower region 85 of cylinder 91 exits the cylinder through line 83 , and enters valve 77 at port d , leaves valve 77 at port a , and returns to reservoir 75 through line 81 . the net effect is an increase in pressure in upper region 87 , and a decrease in pressure in lower region 85 , causing piston 29 to move downward , thereby causing the arms 7 and 9 to come together . the hydraulic system is portable , and the pressure lines shown schematically in fig6 are preferably flexible hoses with quick - connect couplings having appropriate check valves . the operating pressure of the system should be at least 5 , 000 p . s . i . for a pulling distance of 32 inches , a minimum opening force of 12 , 000 pounds is required . a cutting force of 40 , 000 pounds is also needed . fig4 and 5 together illustrate the attachment of the arms to the yoke in the embodiment described above , and in an alternative embodiment . both figures are taken in a direction indicated by line 4 -- 4 of fig1 . fig4 shows the embodiment used in the tool described so far . arms 7 and 9 are shown held within yoke 13 by bolt 101 , the bolt being mounted within bushing 103 . it is seen that head 105 of bolt 101 , and nut 107 press upon the external surfaces 109 and 111 of yoke 13 . although this embodiment has been found to produce a workable tool , it has the disadvantage that , because of the tightness of the nut and bolt , the yoke may be deformed when this embodiment is used . the embodiment shown in fig4 produces a mechanical couple on the yoke , which tends to twist the yoke . the alternative embodiment , illustrated in fig5 avoids the problem of deformation of the yoke . in this embodiment , there is effectively only one member , namely nut 113 , pressing upon an external surface 111 of yoke 13 . bolt 115 is disposed within yoke 13 , and rests upon a portion of washer 117 . glide washer 119 separates yoke 13 from arms 7 . it is found that this arrangement avoids the deformation problem described above . it is apparent that the objects of the present invention are fulfilled by the above disclosure . many modifications to the basic design are possible . all such modifications which would be apparent to those skilled in the art are deemed within the spirit and scope of the following claims . | 8 |
the following description of an embodiment of the present invention is made with reference to the above - described drawings wherein like numerals refer to like parts or components through the several figures . the present invention is directed to a method and system for locating and retrieving stored computer files that are related to an incoming telephone call directed to a computer user . fig1 is a block diagram illustrating an exemplary operating environment for an embodiment of the present invention and includes a general description of a modern public switched telephone network through which the present invention preferably operates . the modern public switched telephone network ( pstn ) has separate signaling paths for voice signals ( or other customer - utilized communication circuits ) and for control signals , which include information transmitted throughout the network to control the connection and disconnection of the voice circuits . the public switched telephone network that evolved in the 1980s also incorporated the advanced intelligent network ( ain ). some of the components of the advanced intelligent network are illustrated in fig1 . the advanced intelligent network ( ain ) uses the signaling system 7 ( ss7 ) network for signal or system control message transport . the components thereof are well known to those skilled in the art . the operation of many of the components of the advanced intelligent network is also described in u . s . pat . no . 5 , 245 , 719 to weisser entitled “ mediation of open advanced intelligent network interface by shared execution environment ” which is incorporated herein by reference . the ss7 communications protocol is provided in the document entitled “ bell communications research specification of signaling system 7 ,” document tr - nwt - 000246 , issue 2 ( june 1991 ), plus revision 1 ( december 1991 ), which is also incorporated herein by reference . referring still to fig1 , a plurality of central offices is provided in a typical public switched telephone network . each central office may include an electronic switch known to those skilled in the art as a service switching point ( ssp ). these are indicated in fig1 as ssp switches 12 , 14 , and 16 . the number of ssp switches depends on the number of subscribers to be served by the public switched telephone network . an ssp is the ain component of a typical electronic central office switch used by a local exchange carrier . the terms “ ssp ” and “ switch ” are used interchangeably hereinafter and are understood to refer to a telecommunications switch having ain capability and which may be utilized for connecting voice channel circuits , including voice channel lines , such as trunk circuits 30 and 32 . central offices switches ( ssp ) 12 , 14 , and 16 have a plurality of subscriber lines 18 , 20 , and 22 connected thereto . each of the subscriber lines 18 , 20 , and 22 is connected to a terminating piece or pieces of customer premises equipment that are represented by telephone sets 21 , 24 and 28 . ssp switches 12 , 14 , and 16 are connected by a plurality of trunk circuits indicated as 30 and 32 in fig1 . these are the voice path trunks that interconnect the central offices 12 , 14 , and 16 and over which calls are connected when completed . each piece of terminating equipment in the pstn is preferably assigned a directory number . the term “ directory number ” is used herein in a manner consistent with its generally understood meaning of a number that is dialed or input by an originating party at an originating station to reach a terminating station associated with the directory number . a directory number , typically a ten digit number , is commonly referred to as a “ telephone number ” and may be assigned to a specific telephone line , such as the telephone line 18 shown in fig1 . much of the intelligence , and the basis for many of the enhanced features of the network , resides in the local service control point ( scp ) 42 that is connected to signal transfer point 34 via ss7 data link 44 . as is known to those skilled in the art , service control points , such as scp 42 , are physically implemented by relatively powerful fault tolerant computers . among the functions performed by the service control points is maintenance of network databases used in providing enhanced services . the scp 42 is also connected to a caller id with name ( cnam ) database 48 . the cnam database comprises a plurality of directory numbers along with associated names for the directory numbers . the cnam database may be used to provide a look - up database to provide caller identification ( id ) service . in operation , the intelligent network elements of the telecommunications network 100 , as described above , communicate with each other via digital data messages transmitted over the network of digital data links . an ssp may be configured to interface with these network elements through the use of a trigger . a trigger in the network is an event associated with a particular subscriber line or call that causes the ssp to generate a data packet message to be sent to a service control point . in order to keep the processing of data and calls as simple and generic as possible at central office switches , such as ssp central office switches 12 , 14 , and 16 , a relatively small set of triggers are defined at the ssp central office switches for each call . the message created by an ssp 12 in response to a trigger is known as a “ query ” message . a query message opens a “ transaction ” and the ssp generally holds the communication until it receives a reply from an appropriate network element via the network of digital data links instructing the ssp 12 to take a certain action . if the ssp 12 receives no instructions within a certain amount of time , the ssp “ times - out ” and executes a default task for the communication . the reply to the query message may be a “ conversation ” message or a “ response ” message . conversation messages allow for bi - directional exchanges between network elements while the transaction remains open . a “ response ” message closes the transaction opened by the query message , and usually instructs the ssp 12 to route the held communication for connection with a terminating station . query messages , conversation messages , and response messages are standard types of messages defined by the ain protocol . the details of the ain protocol are known to those skilled in the art and will not be further described herein . for more information regarding the ain protocol , see bellcore specification gr - 1298 - core switching systems generic requirements for ain 0 . 1 , which is incorporated herein by reference . the modern advanced intelligent network also includes service nodes ( sn ) such as service node 55 shown in fig1 . those skilled in the art are familiar with service nodes , which are physically implemented by the same types of computers that embody the scp 42 . in addition to the computing capability and data base maintenance features , service nodes 55 use isdn lines and may include dtmf signal recognition devices , tone generation devices , text to speech ( tts ) voice synthesis devices and other voice or data resources . as shown in fig1 , the connection is through the ssp . for example sn 55 is connected to scp 42 via isdn links 54 to ssp 12 , isdn / ss7 protocol conversion in ssp 12 , and ss7 links 36 and 44 . it is understood that the service node 55 may also be connected to a service management system 46 , but such connection is not shown in fig1 . service nodes 55 are used principally when some custom feature or service is needed that requires an audio connection to the call or transfer of a significant amount of data to a subscriber over a switched connection during or following a call . the computer 23 illustrated in fig1 represents any well known computing device capable of processing information that may be stored and subsequently retrieved by the computer user . the computer 23 may be operated on the same subscriber line 18 as the telephone 21 of the computer user such as often the case in a home computing or small business computing environment . the subscriber line 18 connected to the computer 23 may be a standard analog subscriber line or may include other lines for transmitting data to and from the computer 23 such as a digital subscriber line or t1 line . alternatively , the computer 23 may be part of a distributed computing environment in a large business or educational institution where data is transmitted to and from the computer 23 in accordance with the present invention from a telecommunications network 100 that is connected to the distributed computing environment or network in which the computer 23 resides . likewise , data and files saved on the computer 23 may be saved on and retrieved from a remote memory server connected to the computer 23 via a distributed computing environment . referring now to fig2 , in accordance with the present invention , incoming calls directed to the operator of a telephone 21 and computer 23 are received at the telephone 21 along with caller identification information obtained on the calling party . as should be understood by those skilled in the art , when the calling party initiates a telephone call to the called party from the calling party &# 39 ; s telephone 24 , an intelligent network component such as the service control point 42 obtains caller identification information such as the caller &# 39 ; s name , telephone , and address from the cnam database 48 for presentation to the called party at the called party &# 39 ; s telephone 21 . operation of caller identification systems is well known to those skilled in the art . a computer telephony interface 210 serves as an interface between the called party &# 39 ; s telephone 21 and the called party &# 39 ; s computer 23 . computer telephone integration , as facilitated by the computer telephony interface ( cti ) 210 , is a process for integration of a telephone system with a computing system . for example , the cti 210 may be used for allowing computer applications to answer incoming calls , provide database information on a computer screen at the same time the call comes in , automatically route and reroute calls , automatically dial and speed dial outgoing calls from a computer resident database and identify incoming customer calls and transfer them to predetermined destinations based on caller identification received on the incoming telephone call . according to the present invention , the cti 210 serves as an interface between the called party &# 39 ; s telephone 21 and the called party &# 39 ; s computer 23 for linking computer files saved on the called party &# 39 ; s computer 23 to the incoming telephone call based on caller identification information received on the incoming telephone call . the computer telephony interface 210 may be a software application program resident on the called party telephone 21 for passing information such as the caller identification information on a calling party to the called party computer 23 . alternatively , the computer telephony interface 210 may also include a software application program resident on the called party computer 23 for receiving and acting upon information received from the called party telephone 21 such as the caller identification information on a calling party . the software synchronization program 220 is a computer software application according to the present invention resident on the called party computer 23 for linking stored computer files to caller identification information received through the cti 210 on an incoming telephone call . the software synchronization program 220 may include an application programming interface ( api ) which as is known to those skilled in the art is a set of routines used by an application program to direct the performance of procedures by the computer &# 39 ; s operating system . in accordance with the present invention , the procedures performed by the program 220 include searching for the file paths to stored computer files that are associated with an incoming telephone call based on caller identification information for the incoming telephone call . additionally , the software synchronization program 220 launches a dialog box , discussed with reference to fig3 , for providing the called party access to all stored computer files related to the incoming call . accordingly , the software synchronization program 220 serves as an intermediary application between the cti 210 and stored computer files related to an incoming telephone call . the application program 230 is illustrative of any software application program for creating and storing files in accordance with the present invention . for example , the application program 230 may be a word processing program , a spreadsheet program , a database program , a desktop publishing program , and the like . the application program 230 is limited only by the numbers and types of software application programs loaded and operated on the called party &# 39 ; s computer 23 for creating , storing , and operating on computer files . the memory 240 is illustrative of memory containing stored computer documents that may be accessed , retrieved , and displayed in accordance with the present invention . for example , the documents 340 , 350 , 370 may include word processing documents , spreadsheet documents , database documents , and the like . the memory 240 may be resident on the computer 23 or may be resident on a remote storage device such as a remote memory server that may be accessed by the computer 23 via a distributed computing environment . in order for the software synchronization program 220 to locate stored computer files 340 , 350 , 375 for presentation to the called party in accordance with the present invention , the stored files must include information that allows the software synchronization program 220 to locate those files in relation to caller identification information received on an incoming telephone call . the document management system 245 is illustrative of a software program or application programming interface for collecting information related to a given computer file and linking that information to the computer file for subsequent searching and retrieval of the file based on that collected information . for example , in accordance with a variety of well known document management systems , when a user of the computer 23 saves any computer file 340 , 350 , 375 , the computer user is presented with a dialog box that requires the input of certain identification information for the file before the file is saved . for example , upon selection of the save functionality of the application program 230 , such as a word processing program , the user of the computer 23 may be presented with a dialog box that requests such information as a name for the file to be saved , a name or title associated with the file , or other information that may be used to locate the file during a subsequent search . in accordance with the present invention , the document management system 245 in conjunction with the application program 230 allows the user to save information including the name of a party related to the stored file , the telephone number of a party associated with the stored file , the address of a party associated with the stored file , or any other pertinent personal or related information . for example , if the user has prepared a spreadsheet of accounting data for a project on which she is working with a fellow employee , when the user saves the spreadsheet file with the software application program 230 , the document management 245 allows the computer user to store the name of the fellow employee , the fellow employee &# 39 ; s telephone number , the fellow employee &# 39 ; s address , and any other information , such as the employee &# 39 ; s job title , wireless telephone number , and the like . according to the present invention , when an incoming telephone call is received by the called party on the called party &# 39 ; s telephone 21 , caller identification information received on the calling party , as described above , is used by the software synchronization program to search for computer files based on the caller identification information so received . that is , the software synchronization program searches on caller identification information such as the caller &# 39 ; s name , telephone number , and address . based on the search of the memory 240 by the software synchronization program 220 , all computer files 340 , 350 , and 375 , with stored identification information matching caller identification information received on the calling party allows the software synchronization program to flag those files for presentation to the called party in response to the incoming telephone call . referring now to fig3 , a graphical user interface 310 for presentation of caller identification information on an incoming call and for providing the called party access to computer files related to the incoming call is illustrated . when an incoming telephone call is received and information on that call such as caller identification information is passed to the called party &# 39 ; s computer 23 via the cti 210 , the software synchronization program 220 launches the graphical user interface 310 on the display screen 300 of the computer 23 . the caller identification information 325 including any information included in the caller identification data such as the telephone number , address , e - mail address , work address , etc . for the incoming telephone call is displayed . prior to launching the user interface dialog box 310 , the software synchronization program searches for all files 340 , 350 , 360 , 370 , 375 , associated with the incoming call , as described above with reference to fig2 . once the software synchronization program establishes a file path to each of the stored files related to the incoming call , the dialog box 310 is displayed to the called party so that the called party may access the related files . an icon 330 is illustrated in fig3 for presentation of all files related to the incoming telephone call located by the software synchronization program , as described above . selection of the icon 330 launches a display box 335 that displays each of the related files . as shown in fig3 , a letter document 340 , a spreadsheet document 350 , a presentation document 360 , and a database document 370 are illustrated as documents located and presented to the called party as related to the incoming telephone call . alternatively , the display box 335 may be presented to the called party automatically without selection of the icon 330 . as should be understood by those skilled in the art , the presentation of the files 340 - 375 may be done according to a number of display protocols such as alphabetical ordering or ordering based on the date of document modification . referring now to fig4 , the following is a description of an exemplary operation of an embodiment of the present invention with reference to fig1 - 4 . fig4 illustrates a logical call flow of steps performed by a method and system of the present invention for linking and retrieving stored computer files related to an incoming telephone call . the method 400 begins at start step 405 and proceeds to step 410 where a calling party places a telephone call from the calling party &# 39 ; s telephone 24 to the called party at the called party &# 39 ; s telephone 21 . at step 415 , a query is generated from the central office ssp 14 of the calling party to the service control point 42 for obtaining caller identification information on the calling party from the cnam database 48 . at step 420 , the telephone call from the calling party along with the caller identification information retrieved from the cnam database 48 is routed to the called party at the called party &# 39 ; s telephone 21 through the called party &# 39 ; s central office ssp 12 in accordance with standard call routing procedures . according to the present invention , the computer telephony interface 210 recognizes the caller identification information and routes the caller identification information to the software synchronization program resident on the called party &# 39 ; s computer 23 . at step 425 , in response to receipt of the caller identification information on the incoming call , the cti 210 launches the software synchronization program 220 for searching and retrieving stored computer files related to the incoming telephone call . at step 430 , the software synchronization program searches the memory 240 of the computer 23 for computer files related to the incoming telephone call based on the caller identification information associated with the incoming telephone call . as described above with reference to fig2 , the software synchronization program locates related computer files based on previously input information related to the incoming telephone call such as the caller &# 39 ; s name , telephone number or address . once the software synchronization program 220 locates all computer files related to the incoming telephone call , the dialog box 310 is launched on the display screen 300 of the computer 23 at step 435 . as shown in fig3 , according to a preferred embodiment , caller identification information for the incoming telephone call is presented in the dialog box to the user of the computer 23 . at step 440 , based on the files located by the software synchronization program 220 , the icon 330 is enabled and is displayed to the user of the computer 23 in the dialog box 310 . as described above , selection of the icon 330 causes the display box 335 to be presented to the user of the computer 23 for presentation of a list of all files located by the software synchronization program 220 that are related to the incoming telephone call based on the caller identification information for the incoming telephone call . alternatively , as described above , the display box 335 may be presented to the user of the computer 23 automatically without selection of the icon 330 . at step 450 , the called party may view the list of documents found by the software synchronization program and select a document that the called party determines is most likely the document the calling party is calling to discuss . or , the calling party may wait until the calling party tells the called party the precise document the calling party would like to discuss . for example , if the calling party recognizes from the caller identification information 325 that the calling party is a co - worker with whom the called party has very recently constructed the spreadsheet document 350 displayed in the display box 335 , the called party may select the spreadsheet document 350 at step 450 . at step 455 , selection of the stored computer file , such as the spreadsheet document 350 , launches an instance of the application program 230 responsible for creation and storage of the selected file , and the selected file , such as the spreadsheet document 350 is displayed to the called party on the computer screen 300 of the called party &# 39 ; s computer 23 . advantageously , the called party quickly and efficiently locates and launches the selected computer file related to the incoming call without having to place the caller on hold or cause the caller to wait while the called party searches for a selected file through a large list of stored files on the called party &# 39 ; s computer 23 . it will be apparent to those skilled in the art that various modifications or variations may be made in the present invention without departing from the scope or spirit of the invention . other embodiments of the invention will be apparent to those skilled in the art from consideration of the specification and practice of the invention disclosed herein . | 7 |
as used herein , “ a ” or “ an ” means one or more . unless otherwise indicated , the singular contains the plural and the plural contains the singular . as used herein , “ surface ” refers to locations at or above the surface . attention is first directed to fig1 wherein the preferred embodiment is shown . in the preferred embodiment of this invention , there is a well construction method where a first conduit 4 commonly known to those familiar with the art of well construction as casing is deployed into the earth 18 through the well bore 3 . casing 4 is grouted into a well bore 3 in the earth 18 generally referred to as a well bore 3 . a second conduit , shown in fig1 as conduit 5 , may be deployed into the well bore 3 through the casing 4 . conduit 5 may be a continuous length of tubing , referred to as coiled tubing , and is lowered and extracted from the well through an elastomeric sealing device 6 separating the well pressure environment from the surface environment . it should be understood that although coiled tubing and injector heads is preferred and discussed in this example , any other conduit material , deployment method , and extraction method , familiar to those of ordinary skill in the art , may be used . for example , powered spooling drums , drilling rigs and work over rigs with jointed pipe may be used instead of , or in addition to coiled tubing . the coiled tubing 5 is lowered and extracted from the well with a coiled tubing injector device 7 that mechanically engages the coiled tubing 5 to push or pull it into the well . it is clearly understood to those familiar with the art of well construction that the coiled tubing can be replaced with other types of tubing , such as with jointed tubing that is threaded and lowered into the well with a rig and that the coiled tubing or jointed tubing can be lowered into well tubing or casing but without changing the herein disclosed inventive method . the embodiment shown in fig1 includes a fracture head or well head manifold 8 connected to the casing 4 for the injection of fluids from the surface into the casing 4 . manifold 8 , together with the region that is within casing 4 yet outside of conduit 5 to which manifold 8 is fluidly coupled , comprises the first conduit ( as distinguished from the second conduit 5 ). the stimulation fluid 51 to be injected is pumped from at least one tank or blender 10 through at least one pump 9 into the casing 4 through manifold 8 . the fluid 51 for the purpose of this embodiment is a water based fluid with a polyacrylamide , a friction reducer fluid , mixed into it and is transmitted through the casing 4 and injected through the perforation tunnels 2 into at least one subterranean reservoir 1 . during the injection process of the preferred embodiment , another fluid 17 is injected down the coiled tubing 5 to mixing point 11 . for the purpose of this embodiment fluid 17 is a fluid like hydrogen peroxide that breaks the long chain polymer bonds of polyacrylamide fluid 51 as they are mixed at injection point 11 and continue into the subterranean reservoirs . the position of the mixing point 11 in the well may be modified during the injection process by lowering or raising the coiled tubing 5 with the tubing injector device 7 . in preferred embodiments , mixing point 11 comprises an injection valve on coiled tubing conduit 5 , although mixing point 11 can take any form whereby the fluid paths defined by coiled tubing conduit 5 and that of manifold 8 and the interior of casing 4 come into fluid communication with one another . injection valve 11 preferably contains a back pressure valve or be in combination with a back pressure valve on the coiled tubing 5 in order to keep fluids 51 from the casing 4 from entering the coiled tubing 5 . the second fluid 17 being injected into the well through coiled tubing 5 is pumped from at least one tank 12 at surface through a surface pump 13 into the coiled tubing 5 , which may be partially wound on a coiled tubing reel 21 . although the described preferred embodiment deals with wells and formation having perforated intervals , it should be noted that the method is also applicable to wells and formations which do not have perforated intervals . such perforated intervals can be those that are naturally - occurring and those that are formed by use of explosive charges when drilling the well . in the preferred embodiment there is also a data communication line 14 inside the coiled tubing 5 connected at surface to a data collection device 15 . this data communication line can be connected to a pressure and temperature measurement and / or recorder 16 connected and disposed in the casing 4 on the coiled tubing 5 . the data communication line 14 can be an optical fiber transferring data from the subterranean environment to the surface . the data is collected using analytical and / or recording device 15 . although device 15 is shown at the surface in the fig1 , it should be understood that the analytical data may be collected and recorded in a subterranean environment also . one non - limiting example of device 15 is an optical time domain reflectometer ( otdr ) that launches light down the optical fiber 14 disposed in the coiled tubing 5 and measures the backscattered light up the optical fiber 14 to surface where it is interpreted in the otdr device at surface to yield a distributed temperature profile versus depth along the length of the fiber . other optical , electrical , hydraulic , nuclear , acoustic , and spectroscopic measurements may be used to remotely gather information regarding well conditions , with the resulting data then transmitted via the communication line 14 . preferably this communication transmits real - time data , which can be used to optimize the injection profile of fluids into intervals 1 and 2 in real - time . various fluids and injection methods including , colloidal suspensions , solids and gases can be injected down coiled tubing 5 to affect the injection fluid process where said fluids may include additives that affect , among other things , viscosity , composition , ph , temperature , pressure , and flow rate . other recording and / or analytical devices , known to those of skill in the art , which measure and / or record temperature , pressure , radio - activity , composition , and / or any other relevant parameters may be used , either alternatively or additionally . the communication line 14 may also be an electronic communication line that sends and receives electronic data communications relating to well conditions . as for the case for an electronic communication line , wherein an electronic communication line is used , it is preferable that any data transmitted is transmitted in real - time to permit real - time optimization of fluid injection . additionally , the point or points of data gathering with the data temperature measurement and / or recorder 16 and the distributive sensor optical fiber 14 can be affected similarly by raising or lowering the coiled tubing 5 with the tubing injector device 7 . fig2 illustrates another embodiment in which a fluid 17 is injected into second conduit 5 while fluids comprising injected fluid and reservoir fluids 53 are produced up the first conduit which comprises the volume of casing 4 outside of second conduit 5 and manifolds 8 . in a preferred embodiment , fluids from reservoir 1 and 2 are produced back through the perforations 2 into the casing 4 and back to the surface through manifold 8 or a wellhead while simultaneously injecting a fluid 17 like hydrogen peroxide from the surface tank 12 through the coiled tubing 5 into the casing 4 . this simultaneous injection of hydrogen peroxide into the well casing 4 while the well is flowing back fluid 53 further treats the fluids 53 in the well thereby reducing and killing bacteria and polymers in the flowed back fluids 53 . it is understood that , in addition to , or in lieu of the fluid hydrogen peroxide , many combinations of other compositions can be added to the coiled tubing of 5 , including but not limited to , bactericides , oxidizers , surfactants , acids , salts , ph modifiers , scale inhibitors and their various concentrations and combinations can be used in this process without deviating from the scope of the invention . this embodiment also teaches that the injection point 11 can be changed to be above or below the perforated interval 1 and or 2 before during and after the fluid is being injected down coiled tubing 5 while fluids 53 are flowing or when the fluids of 53 are not flowing . for example , the coiled tubing 5 with the optical fiber 14 can be lowered with injector head 7 to below both perforated intervals 1 and 2 and an optical survey of the distributive temperatures of the well bore maybe taken by launching light from the otdr device 15 while the well fluids 53 are flowing . conversely , the otdr well temperature profile survey can be obtained when fluids 53 are not flowing . attention is directed to fig3 , which is a specific sub - embodiment of the embodiment of fig1 wherein the coiled tubing 5 with data communication line 14 disposed in the coiled tubing 5 is lowered to point below at least one perforated interval 22 at some time during the injection process . as a result , mixing point 11 is below at least one perforated interval 22 . this lowering or raising of the coiled tubing 5 in the well can take place at any time during the injection process or after the injection process and the depth of mixing point 11 can be selected by monitoring the distributive temperature profiles of the well on the otdr ( and / or other analytical device ). the injection of crosslinker material can be increased down the coiled tubing 5 such that it causes the fluid 51 being injected from surface through the casing 4 to have a higher viscosity below the perforated interval 22 thus diverting more of the stimulation fluid being injected down the casing 4 into the upper perforated intervals at 22 . many perforated intervals can be treated in a well in this manner by diverting the fluids from the bottom - most perforations sequentially up the well by injecting a viscosity modifier through the coiled tubing , and then adjusting ( raising or lowering ) the coiled tubing injection depth in the well . by thus varying the location of the down - hole mixing , the viscosity profile and hence the fluid injection profile into multiple well intervals can be manipulated . referring now to fig1 in the preferred embodiment , a fluid composition 51 is injected , from a surface tank 10 through a pump 9 wherein the composition comprises a friction reducer chemical such as polyacrylamide . the composition may comprise solids added at the surface . the friction reducer can be blended into the composition ( which may be water ) in the tank 10 or added at the pump 9 at surface ; in either case the friction reducer is added to the composition being injected into the well casing 4 . the composition comprising the friction reducer is then pumped through the manifold 8 into the casing 4 and into the perforations . simultaneously , while the composition is being pumped down the casing 4 , an oxidizer fluid ( such as a fluid comprising hydrogen peroxide ) is injected down the coiled tubing 5 from a surface tank 12 through a pump 13 and into the coiled tubing 5 the well casing through the mixing point 11 where the hydrogen peroxide mixes with the composition in the casing 4 at a depth in the well denoted by 11 . in the preferred embodiment the distal end of the coiled tubing and the mixing point 11 ( preferably an injection valve ) are located at a well depth which is approximately 100 feet above the depth of perforated intervals 1 and 2 . in the preferred embodiment the perforated depth and the casing are located several thousands of feet below the surface of the earth 18 . this allows the friction reducer to form a friction reducing film on the internal diameter of the casing 4 and the outer diameter of the coiled tubing 5 from the surface depth 18 to the depth 11 thereby maximizing the effect of the friction reducer to reduce fluid friction between the injection fluid and the well conduits during the injection . just above the perforated interval at depth 11 , the mixing of the hydrogen peroxide 17 begins a process of breaking down the long polymer chains of the polyacrylamide thereby reducing its molecular length and reducing its adhesion and plugging to reservoir porosity and permeability upon prior to fluid 51 entering the reservoirs 56 . in the preferred embodiment of fig1 , the down - hole pressure is recorded at the recorder 16 and is read at the surface from the data recording device 15 , preferably in real time with the simultaneous injection of the hydrogen peroxide down the coiled tubing 5 and the composition comprising friction reducer 51 down the casing 4 . attention is directed to fig2 which further teaches that once the injection process is completed , the fluid injected into subterranean reservoirs 1 and 2 is produced back into the casing 4 and back to the surface of the earth 18 through manifold 8 or a wellhead while simultaneously injecting a fluid 17 hydrogen peroxide from the surface tank 12 through the coiled tubing 5 into the casing 4 . this simultaneous injection of hydrogen peroxide into the well casing 4 while the well is flowing back the stimulation fluid 53 further treats the injection fluids in the well thereby reducing and killing bacteria and polymers in the flowed back fluids . it is understood that many combinations of chemicals can be added to the coiled tubing of 5 including bactericides , oxidizers , surfactants , acid , and their various concentrations and combinations can be used in this process without deviating from the scope of the invention . in another embodiment , the injection process shown in fig3 comprises the injection of a water based fluid 51 with a gelling agent ( for example , hydroxypropyl guar ( hpg )) blended into water and pumped at the surface down into the well having perforated intervals 22 , 1 , 2 . the fluid is injected through manifold 8 through the casing 4 while a crosslinker fluid ( or other viscosity enhancer for fluid 51 ) is injected down the coiled tubing 5 and mixed into the gelled fluid at mixing point 11 , whereby the blended fluids 51 continue down the casing 4 being transported into the perforated interval 22 and into a subterranean reservoir 56 . by injecting the crosslinker fluid down coiled tubing 5 and mixing with fluid 51 at mixing point 11 the viscosity of fluid 51 in the casing 4 below the perforated interval 22 is higher thereby affecting the injection profile such that fluid 51 is diverted to the upper interval 22 and less to the lower intervals 1 and 2 . in a still further embodiment , a fluid 51 with a catalyst is injected down the casing 4 of fig1 while hydrogen peroxide is injected down the coiled tubing 5 and injected through the injection valve 11 into the casing 4 where the catalyst and the hydrogen peroxide mix in the well and are injected into the reservoir 1 through the perforations 2 and 1 . in some embodiments , the fluid 51 injected down the casing 4 contains a fuel and a magnesium oxide that decomposes or otherwise neutralizes the hydrogen peroxide in the subterranean environment . it should be understood that an almost unlimited combination of gelled fluids , catalyst , fuels , surfactants , and oxidizers can be added to the fluid 51 being pumped down the well casing 4 to be mixed with almost unlimited combination of fluids 17 , catalyst , fuels , surfactants , acids , and oxidizers being injected simultaneously down the coiled tubing 5 . in a preferred embodiment , the use of an analytical instrument to collect , transmit , and possibly record down - hole well information , preferably in real - time at surface , allows for the optimization of the injection of fluids rate and positioning of the injection point . for instance , if data collected indicates an increase in pressure in one or more conduits supplying fluids to the subterranean environment , one may increase the concentration of friction reducer or otherwise change the composition of friction reducer ( for example , going from one friction reducer to another friction reducer ) to optimize performance . likewise , the optical fiber that is a distributive sensor may indicate that a particular injection profile is developed during the fluid injection profile and the location of the injection point of the coiled tubing , or changes in the fluids being injected can be made at surface to modify the injection profile . other examples of optimization should be immediately clear to those of skill in the art . it should also be understood that in any of the embodiments discussed , the compositions injected may be those that increase or decrease viscosity of a resulting fluid when the injected fluid mixes with another fluid . alternatively , other characteristics of the resulting fluid can be modified by injecting various compositions , including , but not limited to , ph modifiers , scale inhibitors , corrosion inhibitors , bacterial contamination inhibitors ( such as bactericides ), surfactants ( to modify surface tension ), etc . variables such as injection and production pressure and flow can be manipulated as well to fine - tune the injection to optimize specific properties . these variables can be changed in real time in response to data collected and monitored using the analytical instrumentation and recording devices described herein . although the present invention and its advantages have been described in detail , it should be understood that various changes , substitutions and alterations can be made herein without departing from the spirit and scope of the invention as defined by the appended claims . the examples given are merely illustrative and not exhaustive . moreover , the scope of the present application is not intended to be limited to the particular embodiments of the process , machine , manufacture , composition of matter , means , methods and steps described in the specification . as one of ordinary skill in the art will readily appreciate from the disclosure of the present invention , processes , machines , manufacture , compositions of matter , means , methods , or steps , presently existing or later to be developed that perform substantially the same function or achieve substantially the same result as the corresponding embodiments described herein may be utilized according to the present invention . accordingly , the invention is intended to encompass within its scope such processes , machines , manufacture , compositions of matter , means , methods , or steps . | 2 |
the term “ bio - applications ” as used herein refers to all applications for which the most important property is biocompatibility . the term “ biocompatibility ” as used herein refers to biochemical characteristics which a material possess that make it acceptable to living organisms ( human , animals and plants ), as an integral part of them , without have spontaneous or in time the manifestation of some repulsive or toxic phenomena under the form of inflammation , infections and others ( black j ., “ biological performance of materials : fundamentals of biocompatibility ”, 2 d ed . m . dekker , n . y ., 1992 ). this interpretation is given both to pure materials ( 100 % purity , other substances not detected ) and those that have a purity less than 100 % ( because they contain contaminants ). the standards that have guided biocompatibility testing are the 1 ) tripartite guidance ; 2 ) the international organization for standardization ( iso ) 10993 standards ( which are known as the biological evaluation of medical devices and remain under development internationally ); and 3 ) the fda blue book memoranda . in one embodiment , the present invention relates to a process of obtaining styrene - maleic - anhydride copolymers using bulk - polymerization methods and free - radical initiators , with monomer feeds of styrene ( sty ): maleic anhydride ( manh ) of 1 : 6 , 1 : 14 , 1 : 8 , or 1 : 12 and a quantity of initiator not less than 0 . 01 % and not more than 0 . 05 % versus the reaction mass . in another embodiment , the quantity of initiator is not less than 0 . 025 % and not more than 0 . 035 %. examples of suitable initiators for initiating polymerization are the customary agents which form free radicals by thermal decomposition . non - limiting examples include : diacyl peroxides , such as dibenzoyl peroxide , di - tertbutyl peroxide , tert - butyl perbenzoate or tert - butyl perethylhexanoate peresters , such as tert - butyl perpivalate , aliphatic azo compounds , such as azoisobutyronitrile , azo - 4 - cyanopentanoic acid or other water - soluble aliphatic azo compounds , salts of peroxodisulphuric acid or hydrogen peroxide . in one embodiment , the initiator is dibenzoyl peroxide and azoisobutyronitrile . polymeric reactions are carried out in a kneader - extruder connected to a vacuum that includes a trap for condensed water cooled at temperature of 5 - 7 ° c ., a heating - cooling mantle , thermometer , and dosing funnel for liquids , in which is loaded at ambient temperature a predetermined quantity of technical grade maleic anhydride . the maleic anhydride is mixed at temperatures of about 75 ° c . for about 30 minutes to yield a transparent fluid mass of melted maleic anhydride . a persistent semi - opaque melt indicates the presence of maleic acid . transforming maleic acid to maleic anhydride can be achieved by connecting the kneader to a vacuum distillation apparatus and adjusting the pressure to 400 mbar at the above temperature for about 30 minutes . the maleic anhydride melt at atmospheric pressure is brought to a temperature not less than 55 ° c . and not greater than 100 ° c . in another embodiment , the temperature is between 65 ° c . and 90 ° c . technical grade styrene and dissolved initiator are added to the maleic anhydride melt over a period of time not less than 10 minutes and not greater than 60 minutes . in another embodiment , period of time is between 20 and 40 minutes . mixing is continued at atmospheric pressure and a temperature not less than 60 ° c . and not greater than 150 ° c . for a period of time not less than 45 minutes and not greater than 300 minutes . in another embodiment the mixing temperature is maintained between 85 ° c . and 115 ° c . in another embodiment , the mixing time is between 60 and 180 minutes . the yellow - brown , viscous and transparent reaction mass is processed to transform unreacted excess maleic anhydride to maleic acid by hydrolysis . the content of the kneader is cooled to not less than 55 ° c . and not greater than 85 ° c . by adding deionized water ( with a conductivity less than 10 μs ). in another embodiment , the content of the kneader is cooled to temperatures between 60 ° c . and 80 ° c . the amount of deionized water added is not less than 5 % and not greater than 40 % by weight versus the reaction mass . in another embodiment , the amount of deionized water added is between 10 % and 35 % by weight during a period of time not less than 30 minutes and not greater than 180 minutes . in another embodiment , the deionized water is added between 60 minutes and 120 minutes . after finishing dosing with the deionized water , the reaction mass is mixed for a period of time not less than 20 minutes and not greater than 90 minutes . in another embodiment , the reaction mass is mixed for a period of time between 30 minutes and 60 minutes . alternatively , the reaction mass is cooled to ambient temperatures by circulating through the mantle liquid with temperatures of 5 - 7 ° c . the maleic acid is then extracted from the content of the kneader according to the following process . a stainless steel mixing vessel equipped with a nuce filter and having a useful volume three times larger than that of the kneader is used . the mixing vessel is further equipped with an impeller stirrer with two blades , a mantle for heating or cooling , a thermometer , a dosing nipple for liquids , an inlet - pipe connection for compressed air , an outlet nipple , and , in the interior , a filter based on two pierced stainless steel plates with a polyamide cloth ( 100 micron mesh ) between them . the vessel is filled with deionized water ( with a conductivity less than 10 μs ) in an amount that is approximately six times the volume of the reaction mass at a temperature not less than 5 ° c . and not greater than 40 ° c . in another embodiment , the temperature is between 15 ° c . and 35 ° c . while stirring the deionized water moderately ( stirrer speed = 40 - 60 rpm ) the reaction mass is added via the helical conveyer . the coarse , aqueous suspension formed is mixed for not less than 1 hour and not greater than 6 hours . in another embodiment , the suspension is mixed between 2 and 4 hours . the stirring is then stopped and the aqueous phase is eliminated by filtration under pressure . the process is repeated for as many times as it takes to obtained a maleic acid content in the supernatant of less than 0 . 001 % by weight as determined by volumetric titration with a solution of naoh 0 . 01 n . the wet solid , substantially free of the maleic acid , and with a humidity content of 70 %, is transferred to a circular dryer equipped with a heating and cooling mantle , thermometer , helicoidally stirrer , breaking device with rotary knife , and is connected to a vacuum distillation apparatus comprising a filter with sackcloth , condenser , and collecting vessel for the condensation water . the granular mass is dried at a temperature of not less than 50 ° c . and not greater than 90 ° c . in another embodiment , the drying temperature is between 60 ° c . and 80 ° c ., and the vacuum is at 50 mbar for a period of time not less than 4 hours and not more than 10 hours . in another embodiment , the drying period of time is between 6 and 8 hours . lastly , the material is cooled to ambient temperature , removed from dryer , and packed in welded polyethylene bags . the aqueous solution of maleic acid resulting from the extraction is processed by thermal dehydration to obtain maleic anhydride using one of the proceeding known methods in art and adapted to the present invention ( see for example u . s . pat . no . 3 , 993 , 671 ; u . s . pat . no . 4 , 118 , 403 ; u . s . pat . no . 4 , 414 , 898 or u . s . pat . no . 4 , 659 , 433 ). sma copolymers prepared in conformity with the methods described above have the following characteristics : a ) the amount of residual styrene was measured by extraction with benzene ( spectroscopic grade ) of 1 g of polymer for 12 hours by sohxlet extraction . the benzene extractions were then analyzed by gas spectroscopy ( perkin - elmer equipment ). b ) the amount of residual maleic acid was measured by dialysis with distilled water of a 2 g sample of polymer at 40 ° c . using a spectr / por ce dialyze membrane in 14 cycles of 24 hours each ( 500 ml water per cycle ), the water was changed after each cycle . the accumulated water was analyzed for maleic acid by hplc method ( waters equipment ). c ) monomeric concentration expressed as sty : mal ( styrene : maleic comonomer [ maleic anhydride + maleic acid ]) was estimated by conductometric titration of a solution prepared by dissolving 0 . 1 g of dry polymer in a solution of naoh 0 . 5 n and hcl 0 . 5n . d ) functionality ratio , expressed as manh : mal ( maleic anhydride [ maleic anhydride + maleic acid ]), [( mol / g ): ( mol / g )], was estimated using ftir quantitative analysis ( shimazu equipment ): maleic anhydride p . a . ( across ) and maleic acid p . a . ( across ) versus the characteristic absorption bands : 1770 - 1790 cm 1 for anhydride and 1700 - 1720 cm 1 for cooh . e ) viscosimetric average molecular weight , m v , was estimated using the evaluation of intrinsic viscosity [ η rel ] based on relative viscosity [ η ] of one solution of polymer with concentration c = 0 . 5 g / 100 ml in tetrahydrofuran at 25 ° c ., using the calculus formulae ( raju k . v . s . n ., yaseen m . j . appl . polym . sci ., 45 , 677 - 681 , 1992 ; chee k . k . j . appl polym . sci ., 34 , 891 - 899 , 1987 and spiridon d . et al . polymer international , 43 , 175 - 181 , 1997 ). [ η ] = 2 ( η rel - ln ( η rel ) - 1 ) c [ η ] = 0 . 77 ⋆ 10 - 4 ⋆ m v 0 . 725 in a kneader - extruder apparatus ( 60 liters ) connected to a vacuum that includes : a trap for condensed water cooled at temperatures of 5 - 7 ° c ., a heating - cooling mantle , thermometer , and dosing funnel for liquids , 25 kg of technical grade maleic anhydride was added at ambient temperatures . the maleic anhydride was mixed and heated at 75 ° c . for about 30 minutes to obtain a transparent fluid mass of melted maleic anhydride . technical grade styrene with 8 g of dissolved dibenzoyl peroxide was added under ambient pressure over 20 minutes bringing the temperature of the mixture to 65 ° c . after adding the styrene , the temperature of the reaction increased rapidly during a period of 15 minute from 78 ° c . to 116 ° c . due to polymerization . when the exothermic phase of polymerization is completed , mixing continued at atmospheric pressure at 100 ° c . for another 60 minutes . the reaction mass was a viscous , transparent , yellow brown solution which was cooled to 65 ° c . by adding 8 liters of deionized water ( with a conductivity less than 10 μs ) while mixing over 60 minutes . after finishing water dosing , the reaction mass was mixed for another 45 minutes at 65 ° c . alternatively , the reaction mass can be cooled to ambient temperatures by circulating cooled water ( 5 - 7 ° c .) through the mantle of the kneader . the reaction mass is transferred through the helical conveyer located in the interior central zone of the apparatus to a stainless steel vessel ( nutsche filter ) containing 160 liters of deionized water at 18 ° c . under moderate stirring ( stirrer speed adjusted to 40 - 60 ppm ). the nutsche filter has a useful volume three times larger than that of the kneader . the nutsche filter has a mantle for heating and cooling , a stirrer , a thermometer , a dosing nipple for liquids , an inlet - pipe connection for compressed air , an outlet nipple , and , in the interior , a filter media based on two pierced plates of stainless steel with a polyamide cloth between them ( 100 microns mesh ). the coarse aqueous suspension was mixed for 2 hours . the aqueous phase was then removed by filtration under pressure . the process was repeated 3 times . the last supernatant had a maleic acid concentration of only 0 . 00073 % by weight . the wet solid had a humidity content of 68 . 3 % and was transferred to a circular dryer equipped with a heating and cooling mantle , thermometer , helicoidally stirrer , breaking device with a rotary knife and was connected to a vacuum . the wet mass was dried at 65 ° c . at 50 mbar for 5 hours . lastly , the material was cooled to ambient temperature , removed from the dryer , and packaged in welded polyethylene bags . the aqueous solution of maleic acid resulting from the extraction was collected for maleic anhydride recovery . from this process , 5 . 17 kg sma copolymer was obtained as a white powder : 94 . 598 % sma copolymer ; 5 . 31 % water ; 0 . 029 % styrene and 0 . 063 % ( maleic anhydride + maleic acid ), all as weight percent . the purified sma copolymer had the following structural characteristics : m y = 1 , 251 , 000 ; sty : mal = 46 : 54 same equipment and procedure as described in example 1 except 3 . 4 liters of styrene having 6 . 8 grams of dibenzoyl peroxide dissolved therein was added at 80 ° c . maximum temperature during the exothermic phase was 121 ° c . the last supernatant from the extraction had a maleic acid content of 0 . 00095 % by weight and drying was at 80 ° c . for 6 hours . the process yielded 6 . 28 kg of sma copolymer as a white powder : 95 . 267 % sma ; 4 . 63 % water ; 0 . 031 styrene and 0 . 072 % ( maleic anhydride + maleic acid ), all as weight percent . the purified sma copolymer had the following structural characteristics : m v = 546 , 000 ; sty : mal = 48 : 52 and manh : mal = 0 . 68 . same equipment and procedure as in example 1 except that 2 . 5 liters of styrene having 8 . 5 grams of initiator dissolved therein was added over 40 minutes . maximum temperature during the exothermic phase was 128 ° c . polymerization was complete after 180 minutes with a final temperature of 85 ° c . hydrolysis utilized 6 liters of water added over 120 minutes and the extractions were made at 35 ° c . the process yielded 4 . 72 kg of sma copolymer as a white powder : 93 . 08 % sma ; 6 . 82 % water ; 0 . 018 % styrene and 0 . 082 % ( maleic anhydride + maleic acid ), all as weight percent . the purified sma copolymer had the following structural characteristics : m v = 726 , 000 ; sty : mal = 51 : 49 and manh : mal = 0 . 27 . in the same type of kneader - extruder apparatus that used in example 1 , 25 kg of technical grade maleic anhydride was loaded at ambient temperatures . the maleic anhydride was heated and mixed at 75 ° c . for 30 minutes to yield a fluid transparent mass of melted maleic anhydride . 3 liters of technical grade styrene having 9 . 8 grams of dibenzoyl peroxide dissolved therein was added at atmospheric pressure over a period of 40 minutes . after adding the styrene , the temperature of reaction increased rapidly from 83 ° c . to 132 ° c . over 12 minutes . after the exothermic phase of reaction was completed , mixing at atmospheric pressure at 115 ° c . continued for 120 minutes . at this time 9 . 8 liters of deionized water ( with conductivity less than 10 μs ) was added over 120 minutes cooling the reaction mass to 60 ° c . the reaction mass was mixed at 60 ° c . for 60 minutes at 60 ° c . alternatively , the reaction mass can be cooled to ambient temperatures by circulating cooled water ( 5 - 7 ° c .) through the mantle . the granular mass from the kneader was transferred through the helical conveyer to a vessel containing 160 liters of water at 15 ° c . under moderate stirring . the coarse aqueous suspension was mixed for 4 hours before removing the aqueous phase by filtration under pressure . this process was repeated 3 times . the last supernatant removed had a maleic acid content of 0 . 00091 % by weight . the purified wet solid had a humidity content of 72 . 8 % and was transferred to a circular dryer connected to a vacuum and dried at 80 ° c . at 50 mbar for 4 hours . lastly , the material was cooled to ambient temperature , removed from dryer , and packed in welded polyethylene bags . the aqueous solutions of maleic acid from the extractions were collected for maleic anhydride recovery . the process yielded 6 . 93 kg of sma copolymer as a white powder : 92 . 114 % sma ; 7 . 82 % water ; 0 . 021 % styrene and 0 . 045 % ( maleic anhydride + maleic acid ), all as weight percents . the purified sma copolymer had the following structural characteristics : m v = 251 , 000 ; sty : mal = 42 : 58 and manh : mal = 0 . 17 . the same type of equipment and procedure as in example 4 was used except 2 . 4 liters of styrene having 6 . 8 grams of dibenzoyl peroxide dissolved therein was added , the reaction mass was added to 2 . 1 liters of deionized water , and drying was carried out at 80 ° c . for 8 hours . the process yielded 4 . 72 kg of sma copolymer as a white powder : 96 . 121 % sma ; 3 . 78 % water ; 0 . 041 % styrene and 0 . 058 % ( maleic anhydride + maleic acid ), all as weight percents . the purified sma copolymer had the following structural characteristics : m v = 1 , 780 , 000 ; sty : mal = 49 : 51 and manh : mal = 0 . 79 . | 0 |
before explaining an optical transmitting device in the preferred embodiments , the aforementioned conventional optical transmitting device will be explained in fig1 . as shown , a coded data signal to be repeated is input to an electrical - optical converter 1 and is converted into an optical signal . then , the optical signal is amplified by an optical amplifier 2 and is again transmitted to an optical transmission line ( not shown ). the optical amplifier 2 is composed of an optical fiber for amplification , a semiconductor laser for excitation , an optical coupler which couples light emitted from the semiconductor laser for excitation with optical signal light , an optical isolator etc . the optical signal entering the optical fiber for amplification is optically amplified by the semiconductor laser for excitation and is then output . next , an optical transmitting device in the first preferred embodiment will be explained in fig2 wherein like parts are indicated by like reference numerals as used in fig1 . referring to fig2 a coded data signal to be repeated is converted into an optical signal by an electrical - optical converter 1 . the optical signal is optically direct - amplified by a first optical direct amplifier 2 and is then supplied to an optical switch 3 . applicable to the optical switch 3 are , for example , an optical device such as a semiconductor switch , a temperature sensitive type optical switch ( also called a therm - optic switch ( tosw )) and an optical material with electro - optic effect such as lithium niobate ( linbo3 ) and lithium tantalate ( litao3 ), which are composed of an optical waveguide with one input port and n ( n is an integer of two or more ) output ports . each of the output ports of the optical switch 3 can be selected by an optical path switching controller 7 . to the n output ports , n kinds of dispersion compensating fibers 4 - 1 to 4 - n which have dispersion compensating quantities different from each other are connected , thereby being adaptable for various transmission lines . next , outputs from the n kinds of dispersion compensating fibers are combined into one signal light by an optical coupler 5 , then input to a second optical direct amplifier 6 . signal light output from the optical coupler 5 has a reduced optical level since it has passed through various optical parts . because of the reduced optical level , the optical direct amplifier 6 is needed to amplify the signal light up to a normal level . meanwhile , it is obvious that the first and second optical direct amplifiers 2 , 6 may have the same composition as the optical direct amplifier 2 in fig1 . if , in an optical transmission system that employs a 1 . 55 μm band optical amplifier , an existing 1 . 3 μm band zero - dispersion single mode fiber is used as the transmission line , deterioration in transmission characteristics may be caused by wavelength dispersion . the 1 . 3 μm band zero - dispersion single mode fiber has a positive wavelength dispersion . therefore , an optical fiber which has a negative wavelength dispersion to cancel the positive wavelength dispersion can be used as a dispersion compensating fiber ( dcf ). this dcf is 1 . 55 μm band optical fiber , which is made by , for example , increasing the refractive index distribution of a core and decreasing the diameter of the core to provide the dcf with a negative wavelength dispersion . then , by providing the obtained dcf with various lengths , it can be used as the dispersion compensating fibers 4 - 1 to 4 - n in fig2 . examples of such kind of dcf are detailed in technical report of the institute of electronics information and communication engineers , emd93 - 42 , cpm93 - 55 ooe93 - 76 ( 1993 - 08 ), pp . 51 - 56 . an optical transmitting device in the second preferred embodiment will be explained in fig3 wherein like parts are indicated by like reference numerals as used in fig2 . as shown in fig3 in the second embodiment , n pairs of dispersion compensating means which are composed of optical circulators 8 - 1 to 8 - n and fiber gratings 9 - 1 to 9 - n are used instead of the dispersion compensating fibers 4 - 1 to 4 - n in the first embodiment . namely , each of the signal lights output from the output ports of the optical switch 3 is input to one port of any one of the optical circulators 8 - 1 to 8 - n , to the other ports of which the fiber gratings 9 - 1 to 9 - n are connected . then , signal lights output from further ports of the respective optical circulators 8 - 1 to 8 - n are introduced to the optical coupler 5 to combine them into one signal light . this signal light is , similarly to the first embodiment , optically direct - amplified by the second optical direct amplifier 6 , then sent out to an optical transmission line ( not shown ). the fiber gratings 9 - 1 to 9 - n are of optical fibers with gratings written on by interference exposure using , e . g ., ultraviolet laser light . by providing the gratings with n kinds of pitches ( by writing a wavelength difference less than 1 nm on an optical fiber of several tens nm ), which are different from each other , dispersion compensating means with various negative dispersion compensating quantities can be obtained . the signal light supplied to the input port of any one of the optical circulators 8 - 1 to 8 - n enters and passes through corresponding one of the fiber gratings 9 - 1 to 9 - n connected to the other port of the optical circulator , then returning to the same port by reflection . when going and returning through the fiber grating , a phase difference is introduced depending on the grating , thereby enabling the dispersion compensating of signal light . in the second embodiment , there is an advantage that the dispersion compensating means can be miniaturized as compared to that in the first embodiment using dcf since the lengths of the fiber gratings 9 - 1 to 9 - n can be within several tens nm . although the invention has been described with respect to specific embodiment for complete and clear disclosure , the appended claims are not to be thus limited but are to be construed as embodying all modification and alternative constructions that may be occurred to one skilled in the art which fairly fall within the basic teaching here is set forth . | 7 |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.