text stringlengths 1.55k 332k | label int64 0 8 |
|---|---|
the ensuing description provides preferred exemplary embodiment ( s ) only , and is not intended to limit the scope , applicability or configuration of the disclosure . rather , the ensuing description of the preferred exemplary embodiment ( s ) will provide those skilled in the art with an enabling description for implementing a preferred exemplary embodiment . it being understood that various changes may be made in the function and arrangement of elements without departing from the spirit and scope as set forth in the appended claims . a detection material using a polymer sensor technology provides detection of a chemical , biological and / or explosive ( cbe ) substance , also referred to hereinafter as an “ item of interest .” this detection material can include different technologies , such as but not limited to , molecularly imprinted polymer ( mip ) technology that can register detection of an item of interest that has come in contact with the media using organic and / or inorganic polymers created to detect certain molecules and / or molecule groups . upon detection , the physical characteristics of the detection material , such as color ( including non - visible spectra , such as infrared ), transparency , magnetic and / or electrical conductivity , can change . thus , one or more images and / or electrical readings of the material can be taken and used to determine a change in a physical characteristic of the detection material , thereby indicating detection of an item of interest . because detection material can be configured to detect a specific item of interest substance , multiple detection materials can be applied to the media to detect multiple items of interest . in addition to being able to detect the item ( s ) of interest , some embodiments also provide an indication of the volume or strength of trace materials detected . detection materials include polymers that are currently available to detect a particular item of interest . they could include vapor or particulate sensing polymers , florescent quenching polymers , and / or molecularly imprinted polymers ( mip ). current classifications of sensing would include cbe substances . the molecular formula and the electrical properties for each classification of substances vary , as well as the formulations for each subclass . for example , the molecular formula for a mip polymer that detects tnt will vary from the molecular formula for the mip polymer that detects rdx . these differing formulas cause physical properties of a mip polymer to react differently upon exposure . the value of the exposure information can be a value indicative of the amount of exposure experienced . the characteristics of the mip can be such that a physical characteristic or electrical characteristic changes as a function of exposure . the use of detection materials , applied to and / or embedded in a media as described herein , can be utilized in any of a variety of security applications . for example , and not by way of limitation , fig1 a is a simplified block diagram of a detection system 100 - 1 that can be used in a public transit system . in this embodiment , a transit passenger 105 who has been issued a ticket / media 130 can insert the ticket / media 130 into the validator unit 145 . along with validating the ticket / media 130 , the validator unit 145 can utilize techniques described herein to apply a detection material to the ticket / media 130 and determine whether the ticket / media 130 has been exposed to any items of interest while in the custody of the transit passenger 145 . the validator unit 145 can then reissue the ticket / media 130 to the transit passenger 105 , or capture the media . the determination of whether to reissue or capture the ticket / media 130 can be based on whether the ticket / media 130 was exposed to an item of interest , a level of exposure , a type of exposure , which may be considered with additional information ( e . g ., a current security threat level , information regarding the transit passenger 145 , a time of day , a condition of the media ( e . g ., if damaged or purposefully altered to reduce readability ), etc .). furthermore , information may be written to the media / ticket 130 before reissuance or capture , which can include a flag or other information regarding detection / non - detection of an item of interest along with other information ( e . g ., validation information ) that can provide additional functionality in the transit system . in this embodiment , the validator unit 145 can be connected with various other components of the detection system 100 - 1 either directly or via a network 210 . for example , the validator unit 145 can communicate with a camera 155 to capture a picture and / or video of the transit passenger 105 . the captured picture and / or video can be associated with the ticket / media 130 provided by the transit passenger 105 to allow the detection system 100 - 1 to have a form of passenger identification associated with the picture and / or video . other components of the detection system 100 - 1 can provide added functionality in a transit system context . for example , information regarding detection / non - detection of an item of interest , along with images from the camera 155 and other information associated with the media / ticket 130 , may be sent to a security computer 185 for further analysis , processing , security measures , and / or archival . the validator unit 145 and / or security computer 185 can further communicate information to one or more transit gate / fareboxes 175 . this can , for example , enable the transit gate / fareboxes 175 to deny access to a media / ticket 130 that has been flagged by the detection system 100 - 1 . additionally or alternatively , a transit gate / farebox 175 can deny access if the transit gate / farebox 175 reads information from the ticket / media 130 that the ticket / media 130 has been flagged . the detection system 100 - 1 can also include an image / data distribution system 165 . the image / data distribution system 165 can be used to distribute information to help ensure the security of the transit system . for example , if a media / ticket 130 is flagged , the image / data distribution system 165 can send captured images or video of the transit passenger 105 , and / or other data associated with the flagged ticket / media 130 , to police , security , transit personnel , etc . such alerts can be sent from a computer or other processing device using short message service ( sms ), email , telephone , or the internet to computers , terminals , cellphones , mobile devices , etc . fig1 b is a simplified illustration of another embodiment of a detection system 100 - 2 . in particular , but not by way of limitation , fig1 b provides an overview of how detection materials can be used to help enhance security in an airport security line . in this embodiment , a passenger 110 is issued a ticket / media 130 by a ticket / media dispenser 140 when moving from an unsecured area 102 to a semi - secure area 104 . the ticket / media dispensing can be overseen and / or operated by a first security worker 120 - 1 . the ticket / media dispenser 140 can be , for example , integrated into a first security checkpoint , in which the first security worker 120 - 1 checks identification of the passenger 110 . the identification of the passenger 110 can be automatically or manually associated with the ticket / media 130 issued to the passenger 110 , and the ticket / media 130 can include a unique identifier for later identification of the ticket / media 130 . moreover , the ticket / media 130 can include a detection material to detect exposure to an item of interest . the passenger 110 then moves though the semi - secure area 104 , exposing the ticket / media 130 to trace amounts of substances ( in a process called “ sample harvesting ”) on the passenger &# 39 ; s hands , clothes , luggage , etc . when attempting to enter a secure area 106 from the semi - secure area 104 , the passenger 110 can enter the ticket / media 130 into a ticket / media analyzer 150 and optionally pass through other security measures , such as a metal detector 170 or similar device . the media / ticket analyzer 150 can analyze the detection material of the ticket / media 130 to determine whether the ticket / media 130 was exposed to any items of interest . the ticket analyzer 150 can also validate and / or mutually authenticate the ticket / media 130 and compare to the initial issuance record of the ticket / media dispenser 140 . the ticket / media 130 analyzer 150 can then indicate to a second security worker 120 - 2 a result of the analysis ( e . g ., whether an item of interest was detected , a level of exposure of the ticket / media 130 to an item of interest , etc .). additionally or alternatively embodiments can integrate cbe detection with a luggage screener 160 to determine whether luggage , trays , or other items travelling through the luggage screener 160 have been exposed to an item of interest . depending on the type of detection material used , such analysis may have to occur before the ticket / media 130 is exposed to x - rays or other security measures that could alter the detection material , thereby adversely impacting the accuracy of the analysis . the result of the analysis could be provided to a security worker 120 - 3 operating the luggage screener 160 . detection materials and analysis can be part of detection systems used in various types of applications . fig2 a illustrates a block diagram of the basic components of a detection system 200 - 1 , according to a first embodiment . media issuer ( s ) 240 can issue media to users at a first location , such as a checkpoint of a security line , a ticket booth or vending machine in a transit station , an outer entrance to a stadium , etc . an element of this embodiment is to provide some period of time from the issuance of media in which the media can be exposed to an item of interest . this exposure can occur when a user touches the media , or the media comes in contact with other items that may have come in contact with an item of interest . such items can include clothes , luggage , purses , wallets , etc . multiple media issuers 240 and / or analyzers 250 can be used in the detection system 200 to reduce congestion of users in the system . the media issuer ( s ) 240 can include ticket feeders and / or other media - issuing devices that help ensure the media is not exposed to an item of interest beforehand . the media itself can provide a sampling particle harvesting enhanced surface , which can enhance the likelihood that items of interest remain on the surface of the media until analysis . the media issuer ( s ) 240 additionally can collect identification information from a user to whom the media is issued . this can include reading identification information from a government - issued identification card ( e . g ., drivers license ) and / or gathering biometric information of the user . collecting biometric information of the user can include taking a picture , scanning certain identifying features ( e . g ., fingerprint , retina , etc . ), recording a voice , gathering a signature , etc . the information collected can be sent via a network 210 to a central processing system 220 , which can store the information in a data store 230 . the detection system 200 also includes analyzer ( s ) 250 that determine whether the issued media has been exposed to an item of interest . the analyzer ( s ) 250 can be located at a second location to help allow time for a media to become exposed to any items of interest in the media &# 39 ; s proximity . for example , in a transit station where media issuer ( s ) 240 are located in or at vending machines and / or ticket booths , the analyzer ( s ) can be located in or at a validator , on a platform , or in a transit vehicle . in another example , media issuer ( s ) 240 may be located at a checkpoint at the beginning of a security line ( e . g ., in an airport or a courthouse ) and analyzer ( s ) 250 could be located at a later point in the security line ( e . g ., at a metal detector , after luggage x - ray , etc .). alternatively , if a user and / or an item to which the media is attached is expected to return to a location at which media issuer ( s ) 240 are located , the analyzer ( s ) 250 can be located at the location of the media issuer ( s ) 240 and / or integrated with the media issuer ( s ) 240 . rental equipment , for example , such as luggage carts , may be returned by a user to a location at which the equipment was originally rented . as discussed in greater detail hereafter , the analyzer ( s ) 250 can determine whether the media has been exposed to an item of interest by apply detection material to media and determining whether the undergoes any changes in physical and / or electrical characteristics . the analyzer ( s ) 150 can automatically apply the detection material to the media using application methods involving adhesive frame , sticker , magazine , or roll feed application . to help facilitate application , the detection material can be disposed on a sticker , roll of tape , clear laminate , or other material enabling the detection material to adhere to the media and react with any items of interest that may be on the media . in addition , or as an alternative , to chemical adhesion , adhesion can be created with an electrical charge , such as through negative or positive electron current flow or static electrical charge ( e . g ., ion charge via chemical - based reaction ), and analyzer ( s ) 250 can be configured to create , activate , and / or expose an adhesion area on the media prior to applying the detection material . after the detection material is applied to the media , the analyzer ( s ) 250 can determine whether the detection material has reacted . for example , the analyzer ( s ) 250 can take an image of the media to determine whether physical characteristics of a detection material ( e . g ., color , transparency , etc .) have changed to indicate detection of an item of interest . this analysis may also reference an image of the media that was taken before detection material was applied to the media or even before the media was issued to the user . optionally , the media contains a background color that is encoded to be used as a quality and reference check during analysis . in one embodiment for example , after receiving the media and before applying detection material to the media , the analyzer ( s ) 250 can take a first image of the media for initial reference of color and graphics . afterwards , the analyzer ( s ) 250 can apply the detection material and take a second image of the media to determine a change in color with respect to the first image . in an alternative embodiment ( not shown ) the media issuer ( s ) 240 can communicate with the analyzer ( s ) 250 to validate serialization , original background color for matching and card anti - cloning verification as well as transaction counting and transaction timing . optionally , the media issuer ( s ) 240 and analyzer ( s ) 250 have check - and - balance networked communication protocol and work as a paired device ( s ). the media discussed herein can include any of a variety of media types , including media provided in current transit , transportation , security , and other systems . for example , the media may comprise a fob , ticket , boarding pass , security card , or other item used for admission , access , etc . additionally or alternatively , the media can be applied to or otherwise integrated with other items , such as a luggage cart in a hotel or airport , a tray or bin for personal items in an airport security line , a keycard for a hotel room , personal items ( e . g ., mobile devices , identification cards , etc ), and more . the media itself can be made of one or more of a variety of materials , including but not limited to paper , plastic , glass , paper / plastic composite , and metal foil . to help ensure the correct media is identified by the analyzer ( s ) 250 , media can include a unique identifier . the unique identifier can include any of a variety of unique features , including numbers and / or letters . the unique identifier may be issued and / or read by the media issuer ( s ) 240 when issuing the media . depending on the desired functionality of the media and / or the detection system 200 , the unique identifier can be embedded on the media such that it can be read by the analyzer ( s ) 250 utilizing radio frequency identification ( rfid ), bar code scanning , optical imaging ( e . g . optical pattern recognition ), and / or magnetic stripe reading . optionally , the unique identifier may contain identification information of a user , such as birth date , social security number or other government - issued identifier , name , address , phone number , email address , and / or information provided by a government - issued identification card . moreover , the unique identifier may be encrypted , and the unique identifier also can be embedded within other information provided by the media issuer ( s ) 240 to the central processing system 220 . fig2 b is a block diagram of the basic components of a detection system 200 - 2 , according to a second embodiment . here , media issuer ( s ) 240 and analyzer ( s ) 250 are connected directly with a communication link 245 . moreover , the media issuer ( s ) 240 and analyzer ( s ) 250 are only optionally connected via a network 210 to a central processing system 220 and data store 230 . configurations with out a network 210 and / or centralized systems 220 , 230 , analyzer ( s ) 250 and or media issuer ( s ), for example , can be configured to interact directly and / or provide the functionality of the central systems 220 , 230 . fig3 a shows a block diagram of an embodiment of a media issuer 240 - 1 . a processing unit 310 , which can include one or more processor and / or microcontroller , runs software 325 embedded in memory 320 . the memory 320 can include persistent storage such as flash , rom , or some other non - volatile machine readable medium . the memory 320 also can be used to store unique identifiers , user information , and / or other information relating to issued media . this embodiment of the media issuer 240 - 1 includes identification ( id ) reader ( s ) 330 , which can collect id information from a user . id reader ( s ) 330 can include magnetic stripe , rfid , bar code , and / or optical image readers configured to gather information from a user identifying media , such as a drivers license and / or credit card . additionally or alternatively , the media issuer 240 - 1 can be connected and / or integrated with other equipment ( not shown ) via a biometric data interface 370 to collect biometric information from the user to which the media is issued . the equipment can include devices such as scanners and / or cameras can be to gather biometric data such as a fingerprint , signature , facial image , retinal scan , etc . this information can be utilized by the media issuer 240 - 1 and / or detection system 200 to determine an identity of a user , and associate the identity with a unique identifier of the media issued to the user . this association can be used later to help determine if the user has the correct media at the time of analysis of the media . this embodiment of the media issuer 240 - 1 additionally includes a media dispenser 350 and a media reader / writer 340 . these two components can be integrated and / or synchronized to ensure that media writer writes to the media dispensed by the media dispenser 350 . the media writer 240 can write a unique identifier , which can include information specific to the media and / or to the person to whom the media is issued . depending on the functionality of the media , the media writer 240 can write this information to the media in various ways , such as utilizing contactless / proximity technology ( such as radio frequency identification rfid , iso / iec 14443 , near - field communication ( nfc ), and / or other wireless techniques ), electrical communication ( e . g ., contact smartcard technology ), magnetic stripe writing , stamping , and / or printing of optical bar codes and / or other optical images or patterns . finally , this embodiment of the media issuer 240 - 1 includes a network interface 360 . the network interface 360 can enable the media issuer 240 - 1 to communicate with other components in the detection system 200 , via the network 210 . the network interface 360 can utilize any of a variety of hardware and software layers to interface with the network 210 . the hardware involved , for example , can utilize wireless radio frequency ( rf ), optical , wired , satellite , and / or other communications technologies . as shown herein , alternative embodiments can provide an interface that communicates directly with analyzer ( s ) 250 . fig3 b shows a block diagram of another embodiment of a media issuer 240 - 2 . this embodiment illustrates how an embodiment of a media issuer 240 - 2 can include a media imager 380 , which can comprise a camera , scanner , and / or other sensor utilizing a charge coupled device ( ccd ), digital light processor ( dlp ), infrared ( ir ) sensor , and / or other optical technologies . as discussed herein , some embodiments of a detection system 200 include capturing an image of media before and after application of the detection material . this can include capturing an image of the media before issuance , which can be used as a reference in later analysis of the media . as shown in fig3 a and 3b , media issuer ( s ) 240 can include a number of components and can be configured various ways . the embodiments of the media issuers 240 - 1 , 240 - 2 illustrated are provided as examples and are not limiting . other embodiments can include more or less components , integrate multiple components into one combined component , and / or divide functionality differently among components , depending on desired functionality . for example , where biometric data is sufficient to identify users , a media issuer 240 may not include id reader ( s ) 330 . fig4 a shows a block diagram of an analyzer 250 - 1 , according to one embodiment . similar to the media issuers 240 described herein , the analyzer 250 - 1 in this embodiment includes a processing unit 310 , analyzer memory 323 with analyzer software 327 . also , the analyzer 250 - 1 includes a media imager 380 and a detection material applicator 345 . according to some embodiments , the media imager 380 can be used to take two images , a first image before and a second one after the detection material is applied to the media . because the media may have been exposed to an item of interest prior to analysis by the analyzer 250 - 1 , the detection material can indicate exposure shortly after contact with the media . thus , the first image can be taken prior to application of the detection material to serve as a reference . this reference image can facilitate the processing of the second image to determine whether detection material has reacted to an item of interest . for example , the images can be analyzed to determine a change or change rate in reflective light in the event a color change occurs after exposure to an item of interest . analysis can be conducted by the processing unit 310 , a remote system , and or the media imager 380 . therefore , in some embodiments , the media imager 380 can provide the additional functionality of a processing image comparator , differentiator and / or image integrator . the determination of whether an item of interest is detected can be made by the processing unit , which can run the analyzer software 327 to process image ( s ) taken by the media imager 380 to determine changes in coloration , opacity , etc . alternatively , the analyzer 250 - 1 can use the network interface 360 to provide information to the central processing system 220 or other processing system , via the network 210 , to make the analysis . once a result is determined , it is provided using an analysis indicator 430 and / or provided via the network interface 360 to the central processing system 220 or other remote system . the functionality of the analysis indicator can vary , depending on cost considerations and desired functionality of the detection system 200 . the indicator can be simple binary indicator such as a light - emitting diode ( led ), for example , indicating detection or not . additionally or alternatively , the indicator can indicate a more detailed result , such level ( s ) of detection and / or material ( s ) detected . this can be provided a variety of ways , including a text and / or graphical display , series of light indicators , etc . the analysis indicator 430 can be read by a human operator , who can execute appropriate security procedures based on the indicated result . the analyzer 250 - 1 in the embodiment of fig4 a additionally can validate a media . depending on the application of the detection system 200 , a validator 420 can be integrated into the analyzer 250 - 1 . this can provide validating functions in transit and other applications . for example , where a transit passenger is issued a ticket by a media issuer 240 at a ticket booth or vending machine , the transit passenger later can insert the ticket into the analyzer 250 - 1 for ticket validation . the analyzer 250 - 1 can then validate the ticket an addition to analyzing the ticket to determine whether it has been exposed to an item of interest . additionally , the analyzer can include one or more media reader ( s )/ writer ( s ) 410 and / or a biometric data interface 370 to verify an identifier of the media and identify of the user . the media reader ( s )/ writer ( s ) 410 can determine a unique identifier of the media using technologies such as bar code or other optical scanner , rfid and / or magnetic stripe reader , etc . once the unique identifier is determined , the analyzer can communicate with the central processing system 220 via the network interface 360 to determine an identity of a user associated with the unique identifier ( the association being previously created upon issuance of the media ). the analyzer 350 - 1 can also receive biometric data of the user from the biometric data interface 370 to verify that the user providing the media at the analyzer 350 - 1 is the same user to which the media was issued . alternatively , the analyzer can provide the biometric data to the central processing system 220 and / or other remote system to verify the user . if the user is different or cannot be verified , the analyzer 250 - 1 can indicate accordingly to another system via the network interface 360 and / or using the analysis indicator 430 . finally , the media reader ( s )/ writer ( s ) 410 can write additional information to the media , such as an indication of the result of the detection analysis , a timestamp , and / or other information that can provide additional functionality to the media . fig4 b shows a block diagram of an analyzer 350 - 2 , according to another embodiment . this embodiment includes less components and therefore provides different functionality . for example , rather than include a biometric data interface 370 , this embodiment simply includes a camera 440 , which can be utilized to determine and / or verify an identity of a user . in some embodiments , the camera may simply record a picture of a user associated with the media having a certain unique identifier . these latter embodiments , for example , may be included in embodiments of detection systems 300 in which an identity of a user is not determined at issuance , or verification of a user identity is not needed during analysis . although , as indicated herein , media of various forms can be utilized in the systems and methods described herein , fig5 a and 5b illustrate a wireless smartcard that can be used as media , according to one embodiment . fig5 b illustrates a inlay core 508 of the smartcard , which includes an induction antenna 530 and an integrated circuit 550 , which provide the wireless smartcard functionality . the overall configuration of the smart card can be changed dependent upon the requirements of the media and the ergonomics of the device , which can enhance detection from the expected handling of the smartcard . fig5 a , illustrates an external layer ( s ) 504 of the smartcard , which can include a front and / or back layer ( s ). in addition to graphics and / or other features that can provide additional functionality to the smartcard , the external layer ( s ) 504 can include detection areas 524 to which detection material is applied to determine exposure of the media to items of interest . detection areas 524 can include special materials and / or specially - treated surfaces that can facilitate sample harvesting of particles , including items of interest . for example , media can be manufactured in a unique manner that makes the surface of the media and / or detection areas 524 highly receptive to capturing particles as follows . the media surface structure can be manipulated to gather , capture and enhance the particle detection . in addition the media surface and / or detection areas 524 may also be smooth or glossy , dependent on the type of threat detection material . furthermore , changes in color of detection area ( s ) can be compared to a color matrix to be used for a quality and reference check . the external layer ( s ) 504 can be made of a plastic , plasticized , polyvinyl or paper material and the locations of the detection areas 524 can vary with ergonomic requirements . other card types can be utilized in certain embodiments of the systems and methods described herein . for example , fig5 c illustrates a non - wireless card 512 having a magnetic stripe 534 and detection areas . detection areas are preferably located in areas of the card where the card will be handled by a card user , which may vary by card type . moreover , although cards conforming to the id - 1 size of the iso / iec 7810 standard can be used , cards of virtually any type can be integrated into detection systems and methods described herein . embodiments of media shown in fig5 a - 5c are shown for illustration purposes and are not limiting , and various forms of media other than cards can be used . fig6 a is a flowchart of an embodiment of a process 600 - 1 for determining exposure of media to an item of interest . the depicted portion of the process 600 - 1 can begin at block 605 , where the media having a unique identifier is issued at a first location . as indicated herein , the unique identifier could be written to the media at issuance and may contain information indicative of a user . the media is then subject to exposure to items of interest during a period in which the media is in the custody of a user , while traveling from the first location to a second location . at block 610 , the unique identifier of the media is read at the second location , and at block 615 , a first image of the media is created . reading the identifier of the media can identify the previously - issued media , and creating a first image of the media can provide a reference image that can be used in later analysis . at block 620 , the detection material is applied to the media . as discussed earlier , a detection material can be sensitive to certain substances , such as certain molecules or families of molecules . thus different detection materials can be applied to different areas of the media to determine exposure to different items of interest . a predetermined amount of time may be provided after the detection material is applied and before an image of the media is taken , to provide any necessary time for detection material to react . at block 625 , a second image of the media is created , and at block 630 , the first and second images are analyzed to determine whether the detection material has reacted ( i . e . whether the detection material has been exposed to an item of interest ). this analysis can occur at the second location , or may occur remotely , depending on desired functionality . the result of the analysis is indicated at block 635 . this result can include a range of values . fig6 b is a flowchart of another embodiment of a process 600 - 2 for determining exposure of media to an item of interest , illustrating yet further contemplated features . for example , at block 603 , information regarding the identity of a user can be collected . this can include biometric and / or biographic information retrieved in a database , provided by a user , read from an identification card or other identifying media , and / or captured during the issuance process . with identification information , the unique identifier can be associated with an identity of the user . this association can be made , for example , by a media issuer 240 or another component of a detection system 200 . once the media is presented at a second location , a picture of a user is captured at block 613 , and at block 617 the identify of the user is verified . additionally or alternatively , other biometric and / or biographic information can be collected and used to verify the identity of a user . in any event , verification of a user &# 39 ; s identity can involve retrieving information regarding the association between the user and the unique identifier of the media . at block 617 , an image of the media is created , and at block 633 the image is analyzed to determine whether the detection material has reacted . unlike the process 600 - 1 of fig6 a , this process 600 - 2 analyzes a single image . such single - image analyses are contemplated where the detection material and media imaging are sufficiently accurate to provide a reliable analysis . at block 640 , the media is validated . as described herein , embodiments can incorporate other features , such as ticket validation , to provide additional functionality to the user . in so doing , not only is overall security increased , but individual users are provided an additional convenience . finally , at block 645 , the media is returned to the user or captured . as discussed hereinabove , whether the media is returned to the user or captured can depend on whether an item of interest was detected , a type of item of interest detected , and / or a value or level of detection . moreover , other factors ( e . g . information regarding the user , a security threat level , a time of day , etc .) can be considered in the determination of whether to return the media . captured media can be preserved for further analysis and / or processing . fig6 c is a flowchart of yet another embodiment of a process 600 - 3 for determining exposure of media to an item of interest , illustrating how processes contemplated herein can be further altered and adapted . the process 600 - 3 , for example , can be carried out by validator units 145 such as those discussed in the detection system 100 - 1 utilized in a public transit system , as shown in fig1 a . the process begins at block 607 , where the media is issued . however , this step may not be needed ( as indicated by the dotted line ) in certain cases , such as where media is provided by a third party , or is reusable ( e . g . identification or security cards ). at block 609 the media is read and validated before undergoing a process ( blocks 613 - 633 ) similar to those shown in fig6 a and 6b . here , however , no unique identifier is read from the card . nonetheless , the picture of the user , taken at block 613 , can be used to associate the user with a particular media . another feature shown in this process 600 - 3 is , at block 637 , data can be written to the media . the information can include detection / non - detection information , such as a timestamp , location , what item ( s ) of interest was detected , and / or levels of detection . other information ( e . g ., transit data ) can also be written to provide additional functionality to the media . depending on the type of media , data can be written using contactless / proximity or other radio frequency ( rf ) technology , electrical signals , magnetic stripe writing , stamping , and / or printing of optical bar codes and / or other optical images or patterns . a number of variations and modifications of the disclosed embodiments can also be used . for example , the processes depicted in fig6 a - 6c are not limiting and can include more or less blocks , may combine or separate features of a particular blocks , or rearrange order of blocks while keeping within the spirit of this disclosure . embodiments could be embedded into any human - transported item . furthermore , embodiments described herein regarding contactless smartcards can apply similarly to smartcards with contacts . also , as indicated earlier , media can be issued and analyzed at the same location . depending on the result of a detection analysis , an analyzer 250 can route the media to a capture bin or issue to an external feeder for human exchange . fig7 a and 7b illustrate additional embodiments of media that can be utilized in the systems and methods described herein . for example , fig7 a shows a media 710 having non - symmetric , geometrically - spaced holes in one or more layers of the media 710 that are used to capture particles , including items of interest . the holes can also enhance particle detection , and they may be rough or non - symmetrical , and / or smooth or symmetrical , as shown by media 720 in fig7 b . the holes can be under or over the polymer detection area ( s ) 524 . the disclosure has focused on detecting items of interest by using images of media to determine changes in physical characteristics of a detection material . other methods can be used , however , additionally or alternatively , to determine whether the detection material has been exposed to an item of interest . for example , where a detection system 100 utilizes detection materials that have electrical properties that change upon exposure to an item of interest , one or more electrical readings ( e . g ., conductivity , capacitance , inductance , etc .) can be taken by an analyzer 250 before and / or after application of the detection material to the media . electrical measurement reader ( s ) can thereby be used in addition or as an alternative to a media imager ( s ) 380 . additionally , components shown in various diagrams detailed herein can include additional functionality . for example , components described as “ readers ” or “ writers ” can include proximity coupling devices ( pcds ) that include both reading and writing capabilities . other components can be similarly combined to form multi - functional units . conversely , components having multiple functions may be separated into functionally distinct units . also , it is noted that individual embodiments may be described as a process which is depicted as a flowchart , a flow diagram , a data flow diagram , a structure diagram , or a block diagram . although a flowchart may describe the operations as a sequential process , many of the operations can be performed in parallel or concurrently . in addition , the order of the operations may be re - arranged . a process is terminated when its operations are completed , but could have additional steps not included in a figure . a process may correspond to a method , a function , a procedure , a subroutine , a subprogram , etc . when a process corresponds to a function , its termination can correspond to a return of the function to the calling function or the main function . furthermore , embodiments may be implemented by hardware , software , firmware , middleware , microcode , hardware description languages , or any combination thereof . when implemented in software , firmware , middleware or microcode , the program code or code segments to perform the necessary tasks may be stored in a machine readable medium . a processor ( s ) may perform the necessary tasks . the term “ machine - readable medium ” includes , but is not limited to portable or fixed storage devices , optical storage devices , wireless channels and various other mediums capable of storing , containing or carrying instruction ( s ) and / or data . a code segment or machine - executable instructions may represent a procedure , a function , a subprogram , a program , a routine , a subroutine , a module , a software package , a class , or any combination of instructions , data structures , or program statements . a code segment may be coupled to another code segment or a hardware circuit by passing and / or receiving information , data , arguments , parameters , or memory contents . information , arguments , parameters , data , etc . may be passed , forwarded , or transmitted via any suitable means including memory sharing , message passing , token passing , network transmission , etc . while the principles of the disclosure have been described above in connection with specific apparatuses and methods , it is to be clearly understood that this description is made only by way of example and not as limitation on the scope of the disclosure . | 6 |
the present invention is directed to improvements pertaining to the telephone and caller identification services . the present invention makes for a more efficient use of time , whether for personal use or for business use . it will lend convenience and will greatly help the blind . those that cannot move around easily will also be helped . the imagination can come into play , selecting a tune or sound to represent an individual is limitless . business will benefit by having well thought out responses to inquiries to their clients . these calls can be recorded and stored as a record . objects of the invention are to make for a more efficient use of time and lend convenience . personal caller identification is an improvement on conventional answering machines and answering services . in accordance with aspects of the invention , when someone calls , the number associated with the caller identification will activate a tape that will play a tune or sound identifying the caller . a person can be anywhere in hearing range and know who is calling . each expected caller will have a section of the tape with his or her tune or sound as identification . the tape may be numbered , as in a cassette tape . as seen in fig1 , there is preferably a menu on the telephone machine or device 10 identifying each caller and the block of numbers or range in memory set aside for that caller . for example , robert brown may be the second person listed on the menu , along with his telephone number and range in memory ( meter range 100 - 200 ). the telephone includes components to record and store the messages or delete them , as seen at the bottom of the telephone 10 . the user can use the handset 12 to record messages and play them back . the telephone 10 also includes the functionality to record the tune or sounds for each prospective caller &# 39 ; s numbered section on the tape . a button will be available to turn the tape to the desired number on the tape or point to the appropriate location in memory . by way of example , when the telephone 10 rings , it will ring twice . the number associated with the caller identification preferably starts a tape . this tape plays a tune or sound that identifies the caller to the called party . the caller will not hear these sounds . the called party can be anywhere within hearing range , and the person will know who is calling by the tune or sound . the called party does not have to stop what he or she is doing to find out who is calling . each expected caller would preferably be identified by a different tune or sound . the tune could be associated , e . g ., with the caller &# 39 ; s personality or his or her relationship to the person he or she is calling . a user can , instead of a tune or sound , just record the person &# 39 ; s name , saying it over and over with appropriate comments . this information can be put on a storage medium , preferably on tape , with each caller identification number having a section of the tape that is numbered . by way of example only , the numbers could be 1 to 1000 . the numbers will be visible on the machine as the tape plays , as seen by meter no . 1 on the bottom left of the telephone 10 . the telephone 10 desirably includes a in - built recording system to record the tune , sound or name on the numbered tape . adequate space on the tape will be given for the identifying sound and a possible message , and a section on the tape for a reply . each number on the caller identification will activate the tape to the section of the tape set aside for that number . at the end of the section set aside for a specific number or calling party , the tape will stop . preferably , there will be another tape that records a special message for a specific number or calling party . again , each specific message for a specific number will have a block of numbers reserved or set aside on the tape . there will be a menu of all the names and telephone numbers of prospective callers and the numbers on the tape set aside for each caller . bob has to leave and is expecting a call from alice . bob can record , on the numbers of the tape set aside for alice &# 39 ; s telephone number , a message for alice instead of waiting for her to call . when alice calls , her number on the caller identification will activate the tape that is assigned to that number and will give her bob &# 39 ; s message . a lawyer , businessman ( the “ professional ”), etc . can record a message on the section of the tape set aside for each number representing a client . he or she can state a question the client wants answered , give a reply and leave a section of the tape for a response . the client can call anytime for this information . the client can call late at night or all weekend . thus , the client may hear the professional restate the client &# 39 ; s question , along with the professional &# 39 ; s answer . then the client can leave a reply to the answer on the reserved section of the tape . it can be seen that this type of messaging creates a pleasant environment in which the client and the professional can communicate effectively . the lawyer , businessman , etc ., after hearing these calls , can store these calls as a record on a separate tape or memory set aside to record calls , as seen by the “ recording messages for storage ” portion of the telephone 10 in fig1 , or he or she can delete the call . the professional can use a record button and a button on his or her telephone 10 to bring the tape to the desired location on the tape , as seen by meter no . 2 in the recording messages for storage section . this allows the professional to record any client &# 39 ; s reply as a record . the telephone 10 may also include a small light associated with each expected caller to identify if they called while the person was out . thus , the light next to caller number 2 , robert brown , may light up after he calls . all other calls may be processed as they would by a conventional answering machine . in order to more fully understand the invention , a client - professional dialogue will now be described in relation to the flow diagram of fig4 . the professional and client had a prima face meeting or a first telephone call . the client asks the professional to look up some information or provide an answer to a question . the professional tells the client that a personal caller identification system will be used to get the information to the client . the client is given or sent a notebook with a pen and a small meter that can be put flat on a desk . ( see fig3 ). when the client calls , the regular caller identification in the telephone 10 registers the number and it is decoded , as seen by the “ detect incoming call ” and “ obtain caller identification number from incoming call ” steps in fig4 . by decoding , it is meant that the telephone 10 is programmed to play a section of tape or a memory location allotted for that caller &# 39 ; s telephone number . if the caller is on the menu , the client will hear the question he or she wants answered . it will last one minute . continuing , the client will hear the answer or response to the question . it will last one minute . as the tape continues , the third section will be set aside for a response or reply by the client , after the client hears , “ please record your response after the beep .” the three sections will each last one minute . if the caller is not listed on the menu , his or her call is directed to an answering machine . the meter is run by a small battery and has three digits and two buttons , e . g ., start and reverse ( see fig3 ). the client is told to work out the response in the notebook so it will be concise and easily understood . this material in the notebook will become a record of what the professional and the client are working towards . the client will press start on the meter that is flat on the desk in front of the client , at the beginning of the recording . the first section , the question , will use up 0 to 33 on the meter . section two , the answer , will use up 33 to 66 on the meter . section three , the response , will take up 66 to 100 on the meter . it is to be understood that these numbers are merely exemplary , and may differ depending on the storage medium , duration of messaging , etc . as mentioned above , the client was asked to work out his or her response in the notebook to have as a record . this will be a time saver for both parties . the efficient messaging will be one minute of a concise and compact response . if the client wants to hear the call again , he or she can call again . the client can press reverse on the meter to get to 0 again . the client may call anytime during the week and all weekend . the professional prepares the tape in the following manner . each client will be listed on the menu ( fig1 ). each client will , for example , have 100 numbers on meter no . 1 ( fig1 ). if the professional wants to record a message for client no . 3 , client no . 3 is assigned 200 to 300 on meter no . 1 , which can represent three minutes of playing time on the tape . the whole tape , if it has sixty minutes , can service 20 clients . after each hundred on meter no . 1 , 100 for each client , the tape automatically stops with the aid of a timer . the time limit can be adjusted depending on the needs of the professional . meter no . 1 may be adjusted , and the 100 numbers for each client will remain the same . meter no . 2 is preferably also adjusted to have 100 numbers for each call recorded and stored on the recording messages for storage tape . the switch , in function , is set at dubbing for recording a message and tape for rehearing a message when the professional has his or her work completed , he or she may start to record . the professional sets meter no . 1 for client no . 3 ( fig1 ). meter no . 1 is set at 200 . now , the professional is ready to record . of course , when the tape is recording , it is reflected on meter no . 1 . the professional presses the record button ( fig1 ) for recording messages and talks near the “ record voice or sound here ” button . the professional will record the question and use 200 to 233 on meter no . 1 . it will last one minute . continuing , the professional will answer the question using up 233 to 266 on meter no . 1 . it will last one minute . then , the professional will say , “ please record your response after the beep ,” and the professional will press the beeper button . this section will last one minute . the tape will stop at the end of the response with the aid of a timer . meter no . 1 will , of course , have the number 300 . the recording is then ready for the client . after the client calls and hears the recording and records his or her response , the button on the left side of the client &# 39 ; s name , using a timer , lights up . when the professional wants to hear the call , the professional presses the lighted button and , with the aid of a timer , reverses to 200 on meter no . 1 and plays to 300 on the meter . if the professional wants to save the call , he or she presses the reverse button on meter no . 1 to go from 300 to 200 . the professional then presses the play button on “ recording messages for storage ” section and simultaneously presses the “ high speed dubbing ” button as well . the call will be recorded and stored either in the same or a different memory . after the professional records the call , he or she will record in his or her notebook ( fig2 ), on the page set aside for that client , the date the client called , a note on the call and the numbers used on meter no . 2 . when the professional wants to hear the call again , he or she will adjust meter no . 2 connected to the tape used for recording messages for storage and hears the call again ( fig1 ). for example , if the professional wants to hear john doe &# 39 ; s call of jun . 10 , 1999 again ( fig2 ), meter no . 2 is set at 1500 and the professional presses play of the tape , recording messages for storage . with the aid of a timer , meter no . 2 stops at 1600 . the call has been heard . the switch , in function , is set at dubbing for recording a message and tape for rehearing a message ( fig1 ). if the professional does not want to save the call , he or she presses delete using the same method as on an answering machine . the call is automatically deleted . the system of the present invention will now be described in more detail . fig1 has a view of an illustrative personal caller identification device , the telephone 10 , in accordance with the present invention . no . 12 is the handset or receiver and a numeric keyboard 14 is also provided . device 10 is connected to a standard telephone line 16 via input jack 18 . an output jack 20 is provided to the standard telephone line 16 via input jack 18 for attachment of other telephone line equipment . display 22 displays the caller identification number transmitted with the telephone call through the telephone network that identifies the telephone number from which the calling party is calling . this can be done by means of fiber optics associated with the telephone line that can transmit or receive information . fiber optics may also be used with this invention to decode an incoming telephone number , activate a series of timers and play a section of the recording messages tape assigned to that number . the menu may have 20 or more names of clients . on the menu , each client is preferably assigned 100 numbers ( e . g ., a counter range from 201 to 300 ) on meter no . 1 . the telephone numbers of each client may be manually added or taken off the list . this can also be done digitally with information going through a telephone line 16 and then turned into numbers . this is an over - simplification of a telecommunication art that has manifested itself in remarkable works . meter no . 1 has four digits with a button for reverse and fast forward . the tape or memory for recording messages has pause , fast forward , reverse , play , record , stop / eject , delete and beeper . the short lines (-----) indicate where the tape for the “ recording messages ” is located . the “ recording messages ” section is used by the professional to record his or her messages . the professional records or speaks near the “ record voice or sound here ” section . meter no . 2 has a button for recording messages for storage . buttons for the “ recording messages for storage ” section are pause , fast forward , reverse , play , high speed dubbing and stop / eject . the recording messages for storage tape has a switch for controlling dubbing and tape playing . it is used as in a regular tape recorder . when copying a message , the switch will be on dubbing . when rehearing a message , the switch will be on tape . fig2 shows the page in the professional &# 39 ; s notebook for john doe . each client will have a page in the notebook to provide a record or log of discussions with that client . it will include the client &# 39 ; s name , telephone number and calls recorded . the date the client called and a notation about the call will also be recorded . when the tape is complete , another tape will be placed in its place and will be labeled as recording messages for storage tape no . 2 . fig3 shows the meter the professional gives or sends to the client . it shows the meter before the call and the dotted lines indicating where the battery is located . fig3 also shows how the meter increments as the user listens to and records messages . fig4 is a flow chart of the steps involved in the use of the present invention . the telephone rings and the caller identification number is displayed on the display 22 ( see fig1 ). the caller identification number is compared to the list on the menu of the telephone / device 10 . if it is not on the menu , the call is directed to an answering machine , e . g ., with the use of the output jack 20 to the standard telephone line 16 via the input jack 18 . if the caller identification number is on the menu , it is decoded ( and plays , e . g ., the 100 numbers on meter no . 1 assigned to that number . for example , if john doe calls , his number is displayed on the display 22 . it is decoded and the messaging is played from the portion of the memory or tape , e . g ., 200 to 300 , on meter no . 1 . it stops with the use of a timer , and the light on the left of his name goes on to signal that john doe called . the professional may add or delete telephone numbers manually from the menu with a mechanical switch . today , it is possible to program the different operations with a computer . it is known in the art that all of this information can be stored in a chip in the telephone to perform all of the operations necessary in the present invention . wherever the technical improvements in the art may lead , the nucleus of the present invention will remain constant . this nucleus is that the present invention can state a client &# 39 ; s question or request for information , answer the question or give the requested information , and a response to the question or information can be given all in one telephone call . all of this can be recorded and stored together , e . g ., on one tape . the power source for the system to perform the present invention may be a battery , a telephone line or an electrical outlet . a computer chip in the telephone and the power source constitute a complete circuitry . when the client calls , the regular caller identification registers the number , and it is decoded , i . e ., it is programmed to play a section of tape allotted for that number . this tape is associated with the “ recording messages ” portion of the device 10 ( fig1 ). the names are listed on the menu of the device , with the numbers allotted for each caller placed after the caller &# 39 ; s name . the client will hear the question he or she wants answered . it will last one minute . continuing , the client will hear the question answered or the information he or she requested . as the tape continues , the third section will be set aside for a response by the client after the client hears , “ please record your response after the beep .” the three sections will each last one minute . thus , it can be seen that the present invention solves the problems associated with past messaging systems and provides a cohesive personalized messaging system . although the invention herein has been described with reference to particular embodiments , it is to be understood that these embodiments are merely illustrative of the principles and applications of the present invention . it is therefore to be understood that numerous modifications may be made to the illustrative embodiments and that other arrangements may be devised without departing from the spirit and scope of the present invention as defined by the appended claims . | 7 |
fig1 a and 1b illustrate the connection between a conventional lvds driver 100 and receiver 102 . the driver has an input 114 , a non - inverting output 116 and an inverting output 118 . the driver is comprised of transistors , indicated as switches 104 - 110 , that are controlled by the input 114 . the receiver has a non - inverting input 120 , an inverting input 122 , and an output 124 . a first signal path connection 126 is formed between driver output 116 and receiver input 120 . a second signal path connection 128 is formed between driver output 118 and receiver input 122 . a termination resistor 112 is placed across the receiver inputs 120 and 122 . in fig1 a , a logic high is input to the driver . in response , transistors 104 and 106 are turned on and transistors 108 and 110 are turned off . in this arrangement current flows from the driver current source through transistor 104 , termination resistor 112 , and transistor 106 . the direction of the current flow develops a voltage across termination resistor 112 such that the voltage at the receiver input 120 is more positive than the voltage at receiver input 122 . in response to this input voltage , the receiver outputs a logic high on output 124 . in fig1 b , a logic low is input to the driver . in response , transistors 108 and 110 are turned on and transistors 104 and 106 are turned off . in this arrangement current flows from the driver current source through transistor 108 , termination resistor 112 , and transistor 110 . the direction of the current flow develops a voltage across termination resistor 112 such that the voltage at the receiver input 122 is more positive than the voltage at receiver input 120 . in response to this input voltage , the receiver outputs a logic low on output 124 . fig1 a and 1b are provided to illustrate the conventional operation of current mode lvds drivers and receivers . voltage mode lvds drivers and receivers may also be used , but current mode lvds drivers and receivers are the most common variety . the present disclosure may be used with either current or voltage mode lvds drivers and receivers . fig2 a and 2b illustrate an lvds connection formed between a first device 200 and a second device 204 . devices 200 and 204 may be sub - systems in a system , boards in a backplane , ics on a board or other substrate , or embedded core circuits in an ic . in fig2 a and 2b and all following figures , the devices could represent ; ( 1 ) a master device coupled to a slave device , ( 2 ) a master device coupled to another master device , or ( 3 ) a slave device coupled to another slave device . example master devices include but are not limited too ; a microprocessor , a digital signal processor , a serdes serializer , a computer , a production or field tester , an emulation controller , and a trace / debug controller . example slave devices include but are not limited too ; a circuit controlled by a microprocessor , a circuit controlled by a digital signal processor , a serdes deserializer , a circuit controlled by a computer , a circuit controlled by a tester , a circuit controlled by an emulation controller , and a circuit controlled by a trace / debug controller . device 200 comprises a signal source 202 and an ldvs driver 100 . device 204 comprises a signal destination 206 and an ldvs receiver 102 . the signal source 202 in device 200 may be any type of circuit that operates to output signals to the lvds driver 100 . the signal destination 204 may be any type of circuit in device 204 that operates to input signals from lvds receiver 102 . the source and destination circuits could be used to perform a myriad of operations including but not limited to ; ( 1 ) a functional operation of the device , ( 2 ) a test operation of the device , ( 3 ) a debug operation of the device , ( 4 ) a trace operation of the device , and ( 5 ) an emulation operation of the device . one example signal source circuit could be a serdes serializer that operates to input parallel data from another circuit within device 200 and to output the data serially to driver 100 . one example signal destination circuit could be a serdes deserializer that operates to input serial data from receiver 102 and to output the data in parallel to another circuit within device 204 . fig2 a illustrates a logic high being output from source 202 and received by destination 206 . as seen , the driver 100 outputs current from output terminal 116 to output terminal 118 , which develops a voltage across resistor 112 with the polarity being more positive on the receiver input 120 than receiver input 122 . the receiver 102 outputs a logic high to destination 206 in response to the polarity of the voltage across the resister 112 . fig2 b illustrates a logic low being output from source 202 and received by destination 206 . as seen , the driver 100 outputs current from output terminal 118 to output terminal 116 , which develops a voltage across resistor 112 with the polarity being more positive on the receiver input 122 than receiver input 120 . the receiver 102 outputs a logic low to destination 206 in response to the polarity of the voltage across the resister 112 . in either fig2 a or 2 b the termination resistor 112 may exist within device 204 or it may exist external of device 204 . this is true for all following figures . fig3 illustrates two devices 300 and 302 each having signal source 202 and destination 206 circuits and lvds driver 100 and receiver 102 circuits . in this example , source 1 202 of device 300 can communicate with destination 1 206 of device 302 and source 2 202 of device 302 can communicate with destination 2 206 of device 300 . the communications can occur simultaneously since separate lvds signal paths 304 and 306 exist between the devices . having to use separate lvds signal paths for simultaneous communication increases the interconnect between devices 300 and 302 . fig4 illustrates two devices 400 and 402 each having signal source 202 and destination 206 circuits and lvds driver 402 and receiver 102 circuits . lvds drivers 402 are similar to lvds drivers 100 with the exception that the lvds drivers 402 have an enable input 404 and 406 . the enable input is used to enable or disable the output drive of driver 402 . if enable input 404 is set to enable driver 402 of device 400 and enable input 406 is set to disable driver 402 of device 402 , source 1 202 of device 400 can communicate with destination 1 206 of device 402 . likewise , if enable input 404 is set to disable driver 402 of device 400 and enable input 406 is set to enable driver 402 of device 402 , source 2 202 of device 402 can communicate with destination 2 206 of device 400 . the communications cannot occur simultaneously but rather must occur at separate times since only one lvds signal path 410 exists between the devices . having to communicate at separate times decreases the communication bandwidth between the source and destination circuits of devices 400 and 402 . as seen in fig4 , the termination resistors 112 of each receiver 102 lie in parallel on the lvds signal path 410 . this results in a parallel resistance termination ( prt ) 412 on the signal path ( indicated in dotted line ). the value of prt 412 is equal to the parallel resistance of resistors 112 . for example , if resistors 112 are 100 ohms , a typical value for lvds termination resistors , prt will be 50 ohms . since current mode lvds drivers 402 output a constant current , a reduction in the signal path termination resistance ( i . e . the 50 ohm prt ) will lower differential signaling voltages on the signal path 410 to the receivers 102 . lowering differential signaling voltages can cause communication problems ( i . e . lowers the differential noise margin ) between an enabled driver and receiver in the lvds signaling arrangement of fig4 . therefore the differential signaling arrangement of fig4 should only be used in applications where noise is low and the signaling path 410 is short . the present disclosure provides a way to allow simultaneous source to destination communication between devices , like in fig3 , while requiring only a single lvds signal path interconnect between devices , like in fig4 . the present disclosure provides a way to maintain appropriate lvds signaling voltages ( and noise margins ) on an lvds signal path where the termination resistance of the signal path is decreased due to the parallel arrangement of lvds termination resistors , like in fig4 . fig5 illustrates the lvds signaling arrangement between devices 500 and 502 according to the present disclosure . device 500 comprises a signal source 1 202 , a signal destination 2 206 , an lvds driver 100 , an input circuit 504 , termination resistor 112 , and resistors 506 and 508 . the input circuit 504 receives inputs from lvds signal path 514 , lvds signal path 516 , and the output from source 1 202 . the input circuit 514 provides input to destination 2 206 . resistor r1 506 is placed in series between the driver output terminal 116 and signal path 514 . resistor r2 508 is placed in series between the driver output terminal 118 and signal path 516 . device 502 comprises a signal source 2 202 , a signal destination 1 206 , an lvds driver 100 , an input circuit 504 , termination resistor 112 , and resistors 510 and 512 . the input circuit 504 receives inputs from lvds signal path 514 , lvds signal path 516 , and the output from source 2 202 . the input circuit 514 provides input to destination 1 206 . resistor r3 510 is placed in series between the driver output terminal 116 and signal path 514 . resistor r4 512 is placed in series between the driver output terminal 118 and signal path 516 . if devices 500 and 502 are boards or other substrates in a system , resistors 506 - 512 could be discrete resistors placed , as shown , in series between the driver outputs 116 and 118 and board / substrate contacts connected to signal paths 514 and 516 . if devices 500 and 502 are ics on a board or other substrate , resistors 506 - 512 could be poly or transistor channel resistances placed , as shown , in series between the driver outputs 116 and 118 and ic pads connected to signal paths 514 and 516 . if devices 500 and 502 are embedded core circuits in an ic , resistors 506 - 512 could be poly or transistor channel resistances placed , as shown , in series between the driver outputs 116 and 118 and core circuit terminals connected to signal paths 514 and 516 . the lvds driver and series resistor arrangement could be as shown in fig5 , i . e . the driver and resistors are separate circuits connected together inside the device , or the driver and series resistors could be integrated to form a new driver circuit 518 applicable for use by the present disclosure . the circuitry and detail operation of the input circuits 504 will be described later in regard to fig1 , 12 , and 13 . during operation of the devices in fig5 , source 1 202 of device 500 outputs data to driver 100 which transmits differential signals over the signal paths 514 - 516 to input circuit 504 of device 502 to be input to destination 1 206 of device 502 . simultaneously , source 2 202 of device 502 outputs data to driver 100 which transmits differential signals over the signal paths 514 - 516 to input circuit 504 of device 500 to be input to destination 2 206 of device 500 . resistors 506 - 512 should be equal in value or as near equal in value as possible to each other . the value of each resistor 506 - 512 is preferably less than the value of the termination resistor 112 . in the following description of the examples shown in fig6 a - 6b , 7 a - 7 b , 8 a - 8 b , 9 a - 9 b , and 10 it will be assumed for simplification that the termination resistors 112 are 100 ohms , resistors 506 - 512 are each 25 ohms , and the drivers 100 are 5 milliamp lvds drivers . with 100 ohm termination resistors 112 , the parallel termination resistance ( prt ) 412 across the signal paths 514 - 516 , due to the termination resistors 112 , is equal to 50 ohms . while these resistor and current values are used in the description , the present disclosure is not limited to use of only these values . indeed , other resistance and current values can be used without departing from the spirit and scope of the present disclosure . in fig6 a , it is seen that if source 1 of device 500 and source 2 of device 502 both output a logic high to drivers 100 , input circuit 504 of device 500 will input a logic high to destination 2 of device 500 and input circuit 504 of device 502 will input a logic high to destination 1 of device 502 . in fig6 b , the electrical model of the fig6 a signal transfer operation is shown . as seen , driver 100 of device 500 sources current ( i 1 ) into signal path 514 from terminal 116 and returns current ( i 2 ) from signal path 516 at terminal 118 . also as seen , driver 100 of device 502 sources current ( i 3 ) into signal path 514 from terminal 116 and returns current ( i 4 ) from signal path 516 at terminal 118 . the sum of the source currents ( i 1 and i 3 ) pass through prt 412 ( the parallel resistance of terminal resistors 112 ) and develop a voltage across prt with the polarity shown . the voltage developed across prt is input to the voltage input ( vin ) of the input circuits 504 of fig6 a . in response to vin the input circuits 504 output logic highs to destinations 1 and 2 206 . in fig6 b , if the drivers 100 each provide a source current of 5 milliamps , the voltage across each resistor 506 - 512 will be 125 millivolts ( i . e . 25 ohms × 5 ma ) and the voltage across prt 412 will be 500 millivolts ( i . e . 50 ohms × 10 ma ). a vin of 500 millivolts with the polarity shown provides a differential lvds input signal to the input circuits 504 that the input circuits 504 can easily recognize as a logic high . the 500 millivolts differential input signal also provides excellent noise immunity in applications with high noise and long signal paths 514 - 516 . while a 500 millivolts differential signal was produced in this example using the assumed currents and resistances , other differential signal voltages could be produced using different assumptions on currents and resistances . in fig7 a , it is seen that if source 1 of device 500 and source 2 of device 502 both output a logic low to drivers 100 , input circuit 504 of device 500 will input a logic low to destination 2 of device 500 and input circuit 504 of device 502 will input a logic low to destination 1 of device 502 . in fig7 b , the electrical model of the fig7 a signal transfer operation is shown . as seen , driver 100 of device 500 sources current ( i 2 ) into signal path 516 from terminal 118 and returns current ( i 1 ) from signal path 514 at terminal 116 . also as seen , driver 100 of device 502 sources current ( i 4 ) into signal path 516 from terminal 118 and returns current ( i 3 ) from signal path 514 at terminal 116 . the sum of the source currents ( i 2 and i 4 ) pass through prt 412 and develop a voltage across prt with the polarity shown . the voltage developed across prt is input to the voltage input ( vin ) of the input circuits 504 of fig7 a . in response to vin the input circuits 504 output logic lows to destinations 1 and 2 206 . in fig7 b , if the drivers 100 each provide a source current of 5 milliamps , the voltage across each resistor 506 - 512 will be 125 millivolts ( i . e . 25 ohms × 5 ma ) and the voltage across prt 412 will be 500 millivolts ( i . e . 50 ohms × 10 ma ). a vin of 500 millivolts with the polarity shown provides a differential lvds input signal to the input circuits 504 that the input circuits 504 can easily recognize as a logic low . again , the 500 millivolts differential input signal provides excellent noise immunity in applications with high noise and long signal paths 514 - 516 . as in fig6 a - 6b , while a 500 millivolts differential signal was produced in the fig7 a - 7b example using the assumed currents and resistances , other differential signal voltages could be produced using different assumptions on currents and resistances . in fig8 a , it is seen that if source 1 of device 500 outputs a logic high to the driver 100 of device 500 and source 2 of device 502 outputs a logic low to driver 100 of device 502 , input circuit 504 of device 500 will input a logic low to destination 2 of device 500 and input circuit 504 of device 502 will input a logic high to destination 1 of device 502 . in fig8 b , the electrical model of the fig8 a signal transfer operation is shown . as seen , driver 100 of device 500 sources current ( i 1 ) into signal path 514 from terminal 116 and returns current ( i 2 ) from signal path 516 at terminal 118 . also as seen , driver 100 of device 502 sources current ( i 4 ) into signal path 516 from terminal 118 and returns current ( i 3 ) from signal path 514 at terminal 116 . in this electrical situation , the current ( i 1 ) sourced from driver 100 of device 500 is the current ( i 3 ) returned to driver 100 of device 502 , and the current ( i 4 ) sourced from driver 100 of device 502 is the current ( i 2 ) returned to driver 100 of device 500 . since resistors 506 - 512 are assumed to be 25 ohms each and the source currents i 1 and i 4 are assumed to be 5 milliamps each , the voltages present on signal path 514 and signal path 516 are the same or very close to being the same . with the same voltage present on the terminals of prt 412 , no current , or only a small leakage current , flows through prt 412 . thus the voltage drop across prt ( i . e . vin ) that is input to input circuits 504 is extremely small . in response to the small vin voltage , the input circuits 504 of devices 500 and 502 are designed to input the opposite logic level that each device 500 and 502 was outputting . for example , since source 1 202 of device 500 in fig8 a is outputting a logic high , the input circuit 504 of device 500 will respond to the small vin voltage by inputting a logic low to destination 2 206 of device 500 . likewise , since source 2 202 of device 502 in fig8 a is outputting a logic low , the input circuit 504 of device 502 will respond to the small vin voltage by inputting a logic high to destination 1 206 of device 502 . in fig9 a , it is seen that if source 1 of device 500 outputs a logic low to the driver 100 of device 500 and source 2 of device 502 outputs a logic high to driver 100 of device 502 , input circuit 504 of device 500 will input a logic high to destination 2 of device 500 and input circuit 504 of device 502 will input a logic low to destination 1 of device 502 . in fig9 b , the electrical model of the fig9 a signal transfer operation is shown . as seen , driver 100 of device 500 sources current ( i 2 ) into signal path 516 from terminal 118 and returns current ( i 1 ) from signal path 514 at terminal 116 . also as seen , driver 100 of device 502 sources current ( i 3 ) into signal path 514 from terminal 116 and returns current ( i 4 ) from signal path 516 at terminal 118 . in this electrical situation , the current ( i 2 ) sourced from driver 100 of device 500 is the current ( i 4 ) returned to driver 100 of device 502 , and the current ( i 3 ) sourced from driver 100 of device 502 is the current ( i 1 ) returned to driver 100 of device 500 . since resistors 506 - 512 are assumed to be 25 ohms each and the source currents i 2 and i 3 are assumed to be 5 milliamps each , the voltages present on signal path 514 and signal path 516 are the same or very close to being the same . with the same voltage present on the terminals of prt 412 , no current , or only a small leakage current , flows through prt 412 . thus the voltage drop across prt ( i . e . vin ) that is input to input circuits 504 is extremely small . in response to the small vin voltage , the input circuits 504 of devices 500 and 502 are designed to input the opposite logic level that each device 500 and 502 was outputting . for example , since source 1 202 of device 500 in fig9 a is outputting a logic low , the input circuit 504 of device 500 will respond to the small vin voltage by inputting a logic high to destination 2 206 of device 500 . likewise , since source 2 202 of device 502 in fig9 a is outputting a logic high , the input circuit 504 of device 502 will respond to the small vin voltage by inputting a logic low to destination 1 206 of device 502 . fig1 is provided to indicate that in applications where noise is low and the signal paths are short , a single termination resistor ( rt ) 1002 may be used between the signal paths instead of the two separate termination resistors 112 previously shown on the input of the input circuits 504 . it is clear that use of a single termination resistor 1002 , of say 100 ohms , will advantageously increase the vin voltage to the input circuits 504 using the assumed 5 milliamp lvds drivers 100 . the operation of the present disclosure in the single termination resistor arrangement of fig1 is identical to that previously described in fig6 a - 6b through 9 a - 9 b . as seen from the above descriptions of fig6 a - 6b , 7 a - 7 b , 8 a - 8 b , 9 a - 9 b , and 10 , the present disclosure uses a network of resistances ( r1 , r2 , r3 , r4 , and prt / rt ) in an lvds signal path 514 - 516 in combination with special input circuits 504 to advantageously enable simultaneous differential signal communication between two devices . fig1 a illustrates a first example circuit 1100 that could be used to perform the function of input circuit 504 . circuit 1100 comprises an inverter 1102 with its input coupled to the output 1120 from source circuit 202 , a differential receiver 102 with its non - inverting input 1108 coupled to signal path 514 and its inverting input 1110 coupled to signal path 516 , a window comparator 1104 with its a input 1112 coupled to signal path 514 and its b input 1114 coupled to signal path 516 , and a multiplexer 1106 with a first input coupled to the output of inverter 1102 , a second input coupled to the output of differential receiver 102 , a control input coupled to the output window comparator 1104 , and an output 1118 coupled to the input to destination circuit 206 . the function of the window comparator 1104 is to output a logic high on the c output 1116 whenever the voltage on its a input 1112 is greater than the voltage on its b input 1114 plus an offset voltage ( osv ) “ or ” whenever the voltage on its b input 1114 is greater than the voltage on its a input 1112 plus an offset voltage ( osv ). otherwise the window comparator outputs a logic low on the c output 1116 . the offset voltages ( osv ) are set such that if a small differential voltage , as described in fig8 a - 8b and 9 a - 9 b , is present between signal paths 514 and 516 , the voltage differential at the a and b inputs of the window comparator 1104 will not be sufficiently large enough to cause the c output of the window comparator to be set to a logic high . thus in response to small differential voltages , the window comparator 1104 will output a logic low to the control input of multiplexer 1106 , which causes the inverted out ( out *) signal from the source 202 of a device to be input to the destination 206 of the same device , via multiplexer output 1118 . on the other hand , if an adequately large differential voltage is present between the signal paths 514 and 516 , the differential voltage at the a and b inputs of the window comparator 1104 will be sufficiently large enough to exceed the offset voltages ( osv ) and cause the c output of the window comparator to be set to a logic high . for example , the 500 mv signal of polarity shown in fig6 a - 6b will cause output c of the window comparator to be set high . likewise , the 500 mv signal of polarity shown in fig7 a - 7b will cause output c of the window comparator to be set high . if output c of the window comparator is high , multiplexer 1106 will output the output of receiver 102 to the destination 206 via multiplexer output 1118 . for example , receiver 102 will output a logic high to destination 206 , via multiplexer 1106 , in response to receiving the 500 mv signal of polarity shown in fig6 a - 6b . further , receiver 102 will output a logic low to destination 206 , via multiplexer 1106 , in response to receiving the 500 mv signal of polarity shown in fig7 a - 7b . in summary , the input circuit 1100 of fig1 a outputs the inverted output of the source 202 of a device to the destination 206 of the same device if the differential voltage on signal paths 514 and 516 is small and within a voltage window established by offset voltage ( osv ) settings . the input circuit 1100 of fig1 a outputs the output of the receiver 102 to the destination 206 of the device if the differential voltage on signal paths 514 and 516 is large and outside the voltage window established by the offset voltage ( osv ) settings . fig1 b illustrates one example circuit 1124 that could be used as window comparator 1104 of fig1 b . the circuit 1124 comprises a first comparator 1126 with its non - inverting input 1132 coupled to input a 1112 and its inverting input 1134 coupled to input b 1114 , a second comparator 1128 with its non - inverting input 1136 coupled to input b 1114 and its inverting input 1138 coupled to input a 1112 , an or gate 1130 with a first input coupled to the output of comparator 1126 , a second input coupled to the output of comparator 1128 , and an output coupled to output c 1116 . comparator 1126 is designed such that the voltage on its non - inverting input 1132 must be greater than the voltage on its inverting input 1134 by an offset voltage ( osv ) value ( assumed to be 80 millivolts in this example ) before the comparator output will go high . comparator 1128 is designed such that the voltage on its non - inverting input 1136 must be greater than the voltage on its inverting input 1138 by an offset voltage ( osv ) value ( assumed to be 80 millivolts in this example ) before the comparator output will go high . if the voltage difference on the a and b inputs is less than 80 millivolts , output c goes low . if the voltage difference on the a and b inputs is greater than 80 millivolts , output c goes high . while 80 millivolts was used as an example osv , any desired value of osv may be used as well . fig1 a illustrates a second example circuit 1200 that could be used to perform the function of input circuit 504 . circuit 1200 comprises an inverter 1202 with its input coupled to the output 1216 from source circuit 202 , a window comparator 1204 with its a input 1208 coupled to signal path 514 and its b input 1210 coupled to signal path 516 , and a multiplexer 1206 with a first input coupled to a fixed logic high , a second input coupled to a fixed logic low , a third input coupled to the output of inverter 1202 , a first control input coupled to output c 1212 of window comparator 1204 , a second control input coupled to output d 1214 of window comparator 1204 , and an output 1218 coupled to the input to destination circuit 206 . ( 1 ) to output a logic high on output c and a logic low on output d whenever the voltage on its a input 1208 is greater than the voltage on its b input 1210 plus an offset voltage ( osv ) “ and ” the voltage on its b input 1210 is less than the voltage on its a input plus an offset voltage ( osv ), ( 2 ) to output a logic low on output c and a logic high on output d whenever the voltage on its a input 1208 is less than the voltage on its b input 1210 plus an offset voltage ( osv ) “ and ” the voltage on its b input 1210 is greater than the voltage on its a input plus an offset voltage ( osv ), ( 3 ) to output a logic low on output c and output d whenever the voltage on its a input 1208 is less than the voltage on its b input 1210 plus an offset voltage ( osv ) “ and ” the voltage on its b input 1210 is less than the voltage on its a input plus an offset voltage ( osv ). the offset voltages ( osv ) are set such that if a small differential voltage , as described in fig8 a - 8b and 9 a - 9 b , is present between signal paths 514 and 516 , the voltage differential at the a and b inputs of the window comparator 1204 will not be sufficiently large enough to cause both the c and d outputs of the window comparator to be set high . thus in response to small differential voltages , the window comparator 1204 will output logic lows to the control inputs of multiplexer 1206 , which causes the inverted out ( out *) signal from the source 202 of a device to be input to the destination 206 of the same device , via multiplexer output 1206 . on the other hand , if an adequately large differential voltage is present between the signal paths 514 and 516 , the differential voltage at the a and b inputs of the window comparator 1104 will be sufficiently large enough to exceed the offset voltages ( osv ) and cause either the c or d output of the window comparator to be set high . for example , the 500 mv signal of polarity shown in fig6 a - 6b will cause output c to be set high and output d to be set low . likewise , the 500 mv signal of polarity shown in fig7 a - 7b will cause output d to be set high and output c to be set low . if output c is high and output d is low , multiplexer 1206 will output the fixed logic high input to destination 206 via multiplexer output 1218 . if output c is low and output d is high , multiplexer 1206 will output the fixed logic low input to destination 206 . and as mentioned , if both output c and d are low , multiplexer 1206 will output the inverted output ( out *) of the source 202 of a device to the destination 206 of the same device . in summary , the input circuit 1200 of fig1 a outputs the inverted output of the source 202 of a device to the destination 206 of the same device if the differential voltage on signal paths 514 and 516 is small and within a voltage window established by offset voltage ( osv ) settings . the input circuit 1200 of fig1 a outputs the fixed logic high to the destination 206 of the device if the differential voltage on signal paths 514 and 516 is such that the voltage on input a is sufficiently larger that the voltage on input b plus the offset voltage ( osv ). the input circuit 1200 of fig1 a outputs the fixed logic low to the destination 206 of the device if the differential voltage on signal paths 514 and 516 is such that the voltage on input b is sufficiently larger that the voltage on input a plus the offset voltage ( osv ). fig1 b illustrates one example circuit 1220 that could be used as window comparator 1204 of fig1 b . the circuit 1220 comprises a first comparator 1222 with its non - inverting input 1226 coupled to input a 1208 , its inverting input 1228 coupled to input b 1210 , and its output coupled to output c 1212 , and a second comparator 1224 with its non - inverting input 1230 coupled to input b 1210 , its inverting input 1232 coupled to input a 1208 , and its output coupled to output d 1214 . comparator 1222 is designed such that the voltage on its non - inverting input 1226 must be greater than the voltage on its inverting input 1228 by an offset voltage ( osv ) value ( 80 millivolts in this example ) before the comparator output c will go high . comparator 1224 is designed such that the voltage on its non - inverting input 1230 must be greater than the voltage on its inverting input 1232 by an offset voltage ( osv ) value ( 80 millivolts in this example ) before the comparator output d will go high . if the voltage difference on the a and b inputs is less than 80 millivolts , comparator outputs c and d go low . while 80 millivolts was used as an example osv , any desired value of osv may be used as well . fig1 a - 13d show another circuit 1300 that could be used to realize window comparator 1104 of fig1 a . circuit 1300 comprises a first comparator 1302 with its non - inverting input coupled to the a input and its inverting input coupled to a reference voltage ( assumed to be 250 mv in the fig1 a - 13d examples ), a second comparator 1304 with its non - inverting input coupled to the b input and its inverting input coupled to the reference voltage , an or gate 1306 with a first input coupled to the output of comparator 1302 , a second input coupled to the output of comparator 1304 , and an output coupled to the c output . to simply the description , circuit 1300 will be shown used in the signaling arrangements previously described in fig6 b , 7 b , 8 b , and 9 b , and with the previously assumed resistance and current values stated for said figures . fig1 a illustrates that in the previously described signaling arrangement of fig6 b , the voltage ( 625 mv ) on the a input of circuit 1300 , coupled to signal path 514 , will be greater than the reference voltage ( 250 mv ) and the voltage ( 125 mv ) on the b input , coupled to signal path 516 , will be less than the reference voltage ( 250 mv ). thus comparator 1302 will output a logic high to or gate 1306 and comparator 1304 will output a logic low to or gate 1306 . in response , the or gate will output a logic high on the output c , causing multiplexer 1106 of fig1 a to output the output of receiver 102 to destination 206 as previously described . fig1 b illustrates that in the previously described signaling arrangement of fig7 b , the voltage ( 125 mv ) on the a input of circuit 1300 , coupled to signal path 514 , will be less than the reference voltage ( 250 mv ) and the voltage ( 625 mv ) on the b input , coupled to signal path 516 , will be greater than the reference voltage ( 250 mv ). thus comparator 1302 will output a logic low to or gate 1306 and comparator 1304 will output a logic high to or gate 1306 . in response , the or gate will output a logic high on the output c , causing multiplexer 1106 of fig1 a to output the output of receiver 102 to destination 206 as previously described . fig1 c illustrates that in the previously described signaling arrangement of fig8 b , the voltage ( 125 mv ) on the a input of circuit 1300 , coupled to signal path 514 , will be less than the reference voltage ( 250 mv ) and the voltage ( 125 mv ) on the b input , coupled to signal path 516 , will be less than the reference voltage ( 250 mv ). thus comparator 1302 will output a logic low to or gate 1306 and comparator 1304 will output a logic low to or gate 1306 . in response , the or gate will output a logic low on the output c , causing multiplexer 1106 of fig1 a to output the output ( out *) of inverter 1102 to destination 206 as previously described . fig1 d illustrates that in the previously described signaling arrangement of fig9 b , the voltage ( 125 mv ) on the a input of circuit 1300 , coupled to signal path 514 , will be less than the reference voltage ( 250 mv ) and voltage ( 125 mv ) on the b input , coupled to signal path 516 , will be less than the reference voltage ( 250 mv ). thus comparator 1302 will output a logic low to or gate 1306 and comparator 1304 will output a logic low to or gate 1306 . in response , the or gate will output a logic low on the output c , causing multiplexer 1106 of fig1 a to output the output ( out *) of inverter 1102 to destination 206 as previously described . fig1 e - 13h depicts another circuit 1308 that could be used to realize window comparator 1204 of fig1 a . circuit 1308 comprises a first comparator 1310 with its non - inverting input coupled to the a input , its inverting input coupled to a reference voltage ( assumed to be 250 mv in the fig1 e - 13h examples ), and an output coupled to the c output , a second comparator 1312 with its non - inverting input coupled to the b input , its inverting input coupled to the reference voltage , and an output coupled to the d output . to simply the description , circuit 1308 will be shown used in the signaling arrangements previously described in fig6 b , 7 b , 8 b , and 9 b , and with the previously assumed resistance and current values stated for said figures . fig1 e illustrates that in the previously described signaling arrangement of fig6 b , the voltage ( 625 mv ) on the a input of circuit 1308 , coupled to signal path 514 , will be greater than the reference voltage ( 250 mv ) and the voltage ( 125 mv ) the on b input , coupled to signal path 516 , will be less than the reference voltage ( 250 mv ). thus comparator 1310 will output a logic high on the c output and comparator 1312 will output a logic low on the d output . in response to c being high and d being low , multiplexer 1206 of fig1 a will output the fixed logic high input to destination 206 as previously described . fig1 f illustrates that in the previously described signaling arrangement of fig7 b , the voltage ( 125 mv ) on the a input of circuit 1308 , coupled to signal path 514 , will be less than the reference voltage ( 250 mv ) and the voltage ( 625 mv ) the on b input , coupled to signal path 516 , will be greater than the reference voltage ( 250 mv ). thus comparator 1310 will output a logic low on the c output and comparator 1312 will output a logic high on the d output . in response to c being low and d being high , multiplexer 1206 of fig1 a will output the fixed logic low input to destination 206 as previously described . fig1 g illustrates that in the previously described signaling arrangement of fig8 b , the voltage ( 125 mv ) on the a input of circuit 1308 , coupled to signal path 514 , will be less than the reference voltage ( 250 mv ) and the voltage ( 125 mv ) the on b input , coupled to signal path 516 , will be less than the reference voltage ( 250 mv ). thus comparator 1310 will output a logic low on the c output and comparator 1312 will output a logic low on the d output . in response to c being low and d being low , multiplexer 1206 of fig1 a will output the output ( out *) of inverter 1202 to destination 206 as previously described . fig1 h illustrates that in the previously described signaling arrangement of fig9 b , the voltage ( 125 mv ) on the a input of circuit 1308 , coupled to signal path 514 , will be less than the reference voltage ( 250 mv ) and the voltage ( 125 mv ) the on b input , coupled to signal path 516 , will be less than the reference voltage ( 250 mv ). thus comparator 1310 will output a logic low on the c output and comparator 1312 will output a logic low on the d output . in response to c being low and d being low , multiplexer 1206 of fig1 a will output the output ( out *) of inverter 1202 to destination 206 as previously described . while fig1 a - 11b , 12 a - 12 b , and 13 a - g have shown various examples of how to design input circuits 504 for use by the present disclosure , it is anticipated that other ways of designing input circuits 504 will be conceived by those skilled in the art . thus the present disclosure is not limited to only using the example input circuit designs shown and described herein . fig1 illustrates two devices 1400 and 1402 coupled together using an lvds signal path 514 - 516 for transferring data signals and an lvds signal path 1424 - 1426 for transferring clock signals . the devices communicate data simultaneously between each other using input circuit 504 , driver 100 , and signaling path resistor network as previously described . the data being communicated could be of any data type , including but not limited to ; functional data , test data , debug data , trace data , and emulation data device 1400 comprises a deserializer 1404 for inputting serial data from input circuit 504 , data receiving circuitry 1406 for inputting parallel data from the deserializer 1404 , a serializer 1408 for inputting serial data to driver 100 , and data providing circuitry 1410 for inputting parallel data to serializer 1408 . the combination of the data receiving circuitry 1406 and deserializer 1404 represent one example design for a destination circuit 206 . the combination of the data providing circuitry 1410 and serializer 1408 represent one example design for a source circuit 202 . device 1400 also comprises clock output circuitry 1412 and an lvds clock driver 1428 . the clock output circuitry 1412 provides a clock output to driver 1428 and outputs control ( ctl ) signals to operate the providing circuitry 1410 , serializer 1408 , deserializer 1404 , and receiving circuitry 1406 . the control ( ctl ) signals output to the serializer and deserializer from the clock output circuit will operate faster than the control signals to the receiving and providing circuits since they will be controlling the higher speed serial input and output operations occurring over signal paths 514 and 516 . the clock output circuit 1412 may employ use of clock and control signal modification circuits such as but not limited to ; a phase lock loop , a phase shifter , a frequency divider , or a frequency multiplier . driver 1428 is similar to driver 100 and drives lvds clock outputs from device 1400 on signal paths 1424 and 1426 . lvds clocking is shown being used to provide high speed clock signals from device 1400 to device 1402 . if desired , single ended clocking could be used instead of the differential clocking shown , but the clocking frequency would be reduced between device 1400 and 1402 . device 1400 is assumed to be a master device since it outputs the lvds clock on signal paths 1424 - 1426 . device 1402 comprises a deserializer 1418 for inputting serial data from input circuit 504 , data receiving circuitry 1420 for inputting parallel data from the deserializer 1418 , a serializer 1414 for inputting serial data to driver 100 , and data providing circuitry 1416 for inputting parallel data to serializer 1414 . as in device 1400 , the combination of the data receiving circuitry 1420 and deserializer 1418 represent one example design for a destination circuit 206 , and the combination of the data providing circuitry 1416 and serializer 1414 represent one example design for a source circuit 202 . device 1402 also comprises clock input circuitry 1422 and an lvds clock receiver 1430 . the clock input circuitry 1422 receives the clock output from receiver 1430 and outputs control ( ctl ) to operate the providing circuitry 1416 , serializer 1414 , deserializer 1418 , and receiving circuitry 1420 . the control ( ctl ) signals output to the serializer and deserializer from the clock input circuit will operate faster than the control signals to the receiving and providing circuits since they will be controlling the higher speed serial input and output operations occurring over signal paths 514 and 516 . the clock input circuit 1422 may employ use of clock and control signal modification circuits such as but not limited to ; a phase lock loop , a phase shifter , a frequency divider , or a frequency multiplier . receiver 1430 is similar to receiver 102 and inputs the lvds clock outputs from device 1400 on signal paths 1424 and 1426 . device 1402 is assumed to be a slave device since it inputs the lvds clock on signal paths 1424 - 1426 . during operation data is transmitted from the providing circuitry 1410 and serializer 1408 of device 1400 to the deserializer 1418 and receiving circuitry 1420 of device 1402 . simultaneous with data transmitted from device 1400 to device 1402 , data is transmitted from the providing circuitry 1416 and serializer 1414 of device 1402 to the deserializer 1404 and receiving circuitry 1406 of device 1400 . the simultaneous data transfers between devices 1400 and 1402 are controlled by clock output circuitry 1412 of device 1400 and the clock input circuitry 1422 of device 1402 . as mentioned , internal to device 1400 , clock output circuitry 1412 provides the control ( ctl ) inputs to operate the providing 1410 , serializer 1408 , deserializer 1404 , and receiving 1406 circuits . external to the device , clock output circuitry 1412 provides the lvds clock input to device 1402 . internal to device 1402 , and in response to the lvds clock input from device 1400 , the clock input circuitry 1422 provides the control ( ctl ) inputs to operate the providing 1416 , serializer 1414 , deserializer 1418 , and receiving 1420 circuits . fig1 is provided to indicate that a plurality of the providing ( 1410 , 1416 ), serializer ( 1408 , 1414 ), deserializer ( 1404 , 1418 ), and receiver ( 1406 , 1420 ) circuit arrangements 1504 - 1510 of fig1 could exist in devices 1500 and 1502 . each arrangement 1504 - 1506 in device 1500 operable , in response to the clock output circuitry 1412 to communicate data simultaneously with an associated arrangement 1508 - 1510 in device 1502 via an input circuit 504 , driver 100 , resistors , and lvds signal path 1512 / 1514 . fig1 illustrates a device 1600 coupled to a debug , trace , or emulation controller 1610 via an lvds signal path 1606 and lvds clock path 1608 according to the present disclosure . the debug , trace , or emulation controller 1610 is similar in design to the master device 1400 of fig1 with the exception that its specific function is to control a debug , trace , or emulation operation in device 1600 via the data and clock signal paths 1606 and 1608 . device 1600 is similar to the slave device 1402 of fig1 with the exception that the providing circuit 1416 of fig1 is indicated to be a memory or other circuit 1602 that needs to be controlled by device 1610 to output data during a debug , trace , or emulation operation , and the receiving circuit 1420 of fig1 is indicated as being a memory or other circuit 1604 that needs to be controlled by device 1610 to input data during a debug , trace , or emulation operation . using the lvds signaling approach of the present disclosure , much higher debug , trace , and / or emulation communication can occur between master device 1610 and slave device 1600 , as opposed to other approaches used in the industry today . for example , it is well known to use the ieee 1149 . 1 standard interface ( i . e . jtag ) for debug , trace , and / or emulation operations . however , standard jtag communication rates between a master and slave device is limited to around 50 - 100 mhz . since the present disclosure uses lvds signaling , the communication rates between a master 1610 and slave 1600 during debug , trace , and / or emulation operations can be greater than 400 mhz . indeed , using the lvds signaling approach of the present disclosure , communication for debug , trace , and / or emulation operations may well extend into the gigahertz range . device 1600 can be extended , as shown in device 1502 of fig1 , to include a plurality of lvds signal paths and associated driver 100 , input circuits 504 , serializer 1414 and deserializer 1418 such that high speed communication to greater number of debug , trace , and / or emulation circuits 1602 and 1604 is possible . fig1 is provided to indicate that a slave device 1700 may use a shift register 1702 during debug , trace , and / or emulation operations instead of a separate serializer 1414 ( i . e . a serial in / parallel out circuit ) and a separate deserializer 1418 ( i . e . a parallel in / serial out circuit ) if desired . in operation the shift register 1702 loads parallel debug , trace , and / or emulation data from circuit 1602 and shifts the data out to driver 100 as debug , trace , and / or emulation data is shifted in from input circuit 504 to be loaded in parallel to debug , trace , and / or emulation circuit 1604 . fig1 illustrates a device 1800 coupled to an ic or die tester 1810 via an lvds signal path 1806 and lvds clock path 1808 according to the present disclosure . the tester 1810 is similar in design to the master device 1400 of fig1 with the exception that its specific function is to control a test operation in device 1800 via the data and clock signal paths 1806 and 1808 . device 1800 is similar to the slave device 1402 of fig1 with the exception that a scan path 1802 is coupled between the output of the input circuit 504 and the input of driver 100 , and a circuit under test 1804 is shown coupled to the scan path 1802 to be the receiving 1420 and providing 1416 circuits during test operations . device 1800 can be a packaged ic , an unpackaged ic die , or a die on wafer . the circuit under test 1804 is typically , but not limited to being , combinational logic . the serial data input to scan path 1802 from input circuit 504 is stimulus test data to be applied in parallel 1812 to the inputs of circuit under test 1804 . the serial data output from scan path 1802 to driver 100 is response test data loaded in parallel 1814 to the scan register from the circuit under test outputs . scan testing is well known . what is new is performing scan testing using the lvds signaling approach of the present disclosure . using the lvds signaling approach of the present disclosure , much higher test input and output communication can occur between master device 1810 and slave device 1800 , as opposed to other approaches used in the industry today . for example , known scan interface used in the industry today ( ieee standards 1149 . 1 and 1500 ) are limited to scan test communication rates / frequencies of around 50 - 100 mhz . since the present disclosure uses lvds signaling , the communication rates between a master 1810 and slave 1800 during scan testing can be greater than 400 mhz . indeed , using the lvds signaling approach of the present disclosure , communication for scan test operations may well extend into the gigahertz range . fig1 illustrates a device 1900 coupled to an ic or die tester 1912 via a plurality of lvds signal paths 1906 - 1908 and an lvds clock path 1910 according to the present disclosure . each lvds signal path 1906 - 1908 is coupled to an arrangement 1902 - 1904 of drivers 100 , input circuits 504 , scan paths 1802 , and circuits under test 1804 . the tester 11912 is similar to tester 1810 with the exception that it can communicate to the device 1900 over the plurality of lvds signal paths 1906 - 1908 , instead of the single lvds signal path of fig1 . by increasing the number of lvds signal paths and arrangements 1902 - 1904 a larger number of circuits 1804 can be tested in parallel , which decreases test time of device 1900 . fig2 illustrates either a plurality or ics 2018 - 2030 in a fixture 2000 or a plurality of die 2018 - 2030 on a wafer 2000 interfaced to a plural ic or die tester 2002 via lvds data and clock signal paths 2004 - 2016 . if the ic or die 2018 - 2030 are the type shown in fig1 , there will be one lvds data signal path pair and one lvds clock signal path pair between the tester 2002 and each ic or die 2018 - 2030 . if the ic or die 2018 - 2030 are the type shown in fig1 , there will be one lvds clock signal path pair and a plurality of lvds data signal path pairs ( indicated by increased line width ) between the tester 2002 and each ic or die 2018 . fig2 illustrates how a plurality of ics 2018 - 2030 in a fixture 2000 or a plurality of die 2018 - 2030 on a wafer 2000 may be scan tested in parallel ( i . e . at the same time ) using the lvds signaling approach of the present disclosure . while fig1 - 20 have illustrated the lvds signaling approach of the present disclosure for testing ics or die using a scan test approach , other test approaches may be interfaced to the lvds signaling approach of the present disclosure as well . other test approaches that may be interfaced to the lvds signaling interface of the present disclosure may include but are not limited to , ( 1 ) a test approach based on ieee standard 1149 . 1 , ( 2 ) a test approach based on ieee standard 1149 . 4 , ( 3 ) a test approach based on ieee standard 1149 . 6 , ( 4 ) a test approach based on ieee standard 1500 , ( 5 ) a test approach based on built in self test , and ( 6 ) a test approach based on functional testing . although the present disclosure has been described in detail , it should be understood that various changes , substitutions and alterations may be made without departing from the spirit and scope of the disclosure as defined by the appended claims . | 7 |
referring to fig1 and 2 of the drawings that follow , there is shown a hollow circular cylindrical body 2 having an intended axis of rotation 3 . from the axis 3 outwards , the body 2 comprises an inner substrate layer 4 , two magnetic segments 6a , 6b , fibre reinforcing layers 8 , 10 and an outer protective coating 12 . in this context magnetic segments 6a , 6b may be regarded also as substrates . the body 2 has a length of 500 mm ( of which 350 mm is the active length ), an internal diameter of 100 mm and a radial thickness of about 6 mm . the substrate 4 defines a cylindrical tube and comprises a layer of resin impregnated fibres forming a rigid substrate base layer . the substrate 4 is a single hoop layer . that is one in which the winding angle relative to the axis 3 is approximately 90 °. it will be appreciated that the winding angle must not be exactly 90 ° otherwise the layer would be built up radially not longitudinally . it is preferred that the winding angle be chosen to lay fibre adjacent one another . the fibres may comprise carbon fibres or alternatively may be glass fibres , kevlar ( polyaramid ) plastics , boron , nylon , polyolefin or mixtures of those or any other suitable fibres . the resin can be an epoxy , in this case ly556 with hy917 hardener . in the embodiment of fig1 and 2 two substantially similar segments 6a , 6b are shown . each segment 6a , 6b extends for the substantial length of the cylinder defined by substrate 4 . each segment 6a , 6b is half of a cylindrical tube the internal diameter of which matches the external diameter of the substrate 4 . the segments 6a , 6b each comprise a mixture of an epoxy and a magnetic material . the magnetic material is isotropically and homogeneously distributed in a powder form , typically with a mean particle size of about 10 - 30 μm and may comprise iron , nickel , cobalt or an alloy containing one or more of these . it may comprise a ferrite , eg barium ferrite . alternatively and preferably the material comprises a known hard magnetic material ( ie hard to demagnetise ) comprising a rare - earth element , eg cobalt - samarium or neodymium - iron - boron . the amount of magnetic material to epoxy in the segments 6a , 6b is 40 - 50 % by volume , although up to 80 % loading by volume has been achieved . the reinforcing layer 8 comprises a fibre and epoxy hoop layer substantially similar to substrate 4 . the reinforcing layer 10 comprises a fibre and epoxy helix layer , similar to reinforcing layer 8 in materials , but wound with a winding angle relative to the rotor axis 3 of significantly less than 90 °. the hoop layer 8 provides thermal stability and radial strength . the helix layer 10 provides lateral structural stiffness . the combination of the hoop and helix layers 8 , 10 provides some thermal stability and lateral stiffness , as well as a rougher surface to which protective coating 12 can key . since , on cooling the helical layer 10 shrinks significantly more than the hoop layer 8 , the latter protects the magnetic body to some extent during the cooling process . a method of manufacturing the cylindrical body 2 of fig1 and 2 will now be described . the unmagnetised neodymium - iron - boron ( ndfeb ) magnetic material and uncured epoxy resin are mixed together in the ratio of up to 80 % of magnetic material by volume . referring to fig3 of the drawings that follow there is shown a two part mould 14a , 14b having male 14a and female 14b components . the male mould 14a is a hemicylindrical body of diameter r 1 . the female mould 14b is a cylindrical concave trough of diameter r 2 where r 2 is greater than r 1 by 3 mm . the ndfeb epoxy resin mixture ( identified at 16 ) is conveyed into the female mould 14b and the male mould 14a placed centrally thereover as shown . the epoxy resin is at least partially cured . the segment 6a is then self - supporting . the segments 6a , 6b produced are of constant 3 mm thickness . this has been found to be the best compromise between inertia , magnetisation and torque for most applications . the magnetic layers or segments 6a , 6b thereby produced are in the form of semi - cylindrical slabs comprising a generally homogeneous distribution of magnetic material and binder , without embedded fibre tows . the magnetic material is evenly distributed throughout the bulk of the segments 6a , 6b . next , the substrate layer 4 is formed by hoop winding carbon fibre tows impregnated with uncured epoxy resin onto a circular cylindrical mandrel ( not shown ) using a known fibre winding machine . only one layer is required to form the substrate 4 . glass , kevlar or other fibre tows could also be used . the preformed segments 6a , 6b are then disposed about the substrate 4 and secured temporarily thereto by an epoxy glue or other fixative . next the hoop layer 8 of controlled thickness is wound around the segments 6a , 6b . when the fibre tows cure , a hoop layer shrinks less than a helix layer . therefore , the hoop layer 8 protects the segments 6a , 6b which is a reason why it is desirable to have hoop layers on either side of the magnetic material . if a helically wound layer was adjacent the magnetic material , the pressure it would exert on curing could deform the segments 6a , 6b and even result in it not being possible to remove the cylindrical body from the mandrel . the combination of hoop layer 8 and helix layer 10 each formed from fibre tows impregnated with uncured epoxy resin is wound over the magnetic material to achieve the required mechanical properties for the cylindrical body . the resin in the substrate 4 , segments 6a , 6b , layers 8 and 10 is then cured by heating the body to a curing temperature appropriate to the resin ( s ). the body can then be removed from the mandrel ( not shown ) as it will be self - supporting when cured . a protective outer layer 12 is then disposed about the layer 10 . the nature of the final layer 12 is determined by the intended application of the body 2 . for instance , if the body 2 is to be used as a roller , the outer layer 10 could comprise a rubber , ceramic or stainless steel covering . either before or after the application of layer 12 , the ndfeb is magnetised to align the particles . in fact this can be carried out at any stage . magnetisation is achieved by passing the segments through a high strength magnetic field , typically 3 tesla . energies of only about 15 kj are required because the smaller segments can be magnetised separately or the magnetisation can be achieved in stages along the length of the segment . a preferred field pattern for the magnetised body 2 is shown in fig4 of the drawings that follow magnetised by a circumferentially continuously varying field . this pattern is based on an extension of that referred to in a paper &# 34 ; permanent magnets for production and use of high energy beams &# 34 ;, proc . 8th int . workshop on rare earth permanent magnets , pp 123 - 136 , 1985 ( k halbach ) the content of which is incorporated herein by reference . the fields of fig4 describe generally sinusoidal patterns . the magnetisation field distribution h to magnetise a halbach cylinder must satisfy the following criteria with the units being amps per metre : ## equ3 ## for an internal field , and according to the following for an external field : where p is the required number of pole - pairs h is the magnetising field strength , and θ h is the angle between the magnetizing field direction and the reference axis . the external field ( relative to the current carrier ) produced by a sinusoidally distributed current , of density jz = j sin ( pθ ), the units being amps per square metre for an internal field relative to the cylindrical body , is given by : ## equ4 ## in which r 1 is the internal radius to the current carrier and r 2 is the external radius to the current carrier . thus , the distribution of the external field satisfies the conditions for the magnetisation of a multi - pole halbach cylinder . externally of the cylinder , the magnetic field is kept at a minimum and normally about zero . thus , the halbach cylinder is substantially self - shielding . in the halbach paper there is reference only to the production of the field using discrete magnetic blocks orientated approximately to generate the field described above . cylindrical bodies according to the present invention can be magnetised to produce a continuous field that better satisfies the halbach equations ( 1 )-( 3 ). in fig4 the field pattern is produced from magnetising the segments 6a , 6b with a continuously varying field to produce 8 equally spaced poles ( or pseudo - poles ) labelled a through h for convenience . this field pattern produces a relatively high field inside the body 2 , with a minimal field outside , thereby reducing electromagnetic interference caused by operation of the body 2 . the magnetisation in the body is described by the following equation ( 4 ): ## equ5 ## where m is the magnetisation vector , p is the required number of pole pairs and θ m is the angle between the magnetic field direction and the radial axis of reference of the body . referring to fig5 of the drawings that follow , there is shown an arrangement for the internal magnetisation of the cylindrical body 2 . in fig5 the cylindrical body 2 has an inner radius r i and an outer radius r o , and disposed internally about the body 2 are a first group of six longitudinal conductors 20a - 20f and a second group of six longitudinal conductors 22a - 22f . each conductor subtends an angle of 2α . current is passed one way through conductors 20a - 20f and the other way through conductors 22a - 22f in order to magnetise the cylindrical body 2 . in order that the magnetisation can so far as possible approximate the sinusoidal halbach field desired , the angular spacing and radial distance of the conductors 20 , 22 is determined as follows . a multipole magnetised cylindrical body 2 with an internal field is characterised by a magnetisation distribution which satisfies : where θ m is the angle the magnetisation vector m makes with an arbitrary reference axis , as is shown in fig6 of the drawings that follow , and p is the number of pole - pairs . to achieve the magnetisation distribution , the magnetising field must satisfy the same condition . for an even number of conductors per pole , as in fig4 in which there are 8 , the n th harmonic of the current density for a distribution having k conductors per half pole is given by : ## equ6 ## the number of harmonics which can be eliminated equals k . this is achieved by solving the following set of equations : ## equ7 ## for example , for the case in which k = 3 , the determination of the angles θ 1 , θ 2 and θ 3 for with the 3rd , 5th and 7th harmonics are eliminated is achieved by solving the following set of equations : for example , another type of modulation which can be used independently or in conjunction with the previous , is one having two conductors per half pole , ie k = 2 . in this case , only the 3rd and 5th harmonics can be eliminated , and the angles θ 1 and θ 2 are determined similarly to the previous case . in this case equation ( 6 ) is reduced to : alternatively , an odd number of conductors per pole can be used , ie k conductors per half pole plus one conductor situated at the centre of a pole . for these category of distributions the nth harmonic of the current density j n is given by : ## equ8 ## again the number of harmonics which can be eliminated equals k and this is achieved by determining the angular positions of the conductors solving the following set of equations : in the above equations ( 6 ) to ( 11 ) j n is the current density contributing to the magnetisation for the nth harmonic . regarding the distance &# 34 ; d &# 34 ; between the conductors and the magnet , this is chosen to filter the effect of the lowest harmonic not eliminated by the angular distribution of the conductors . for example in the case of the distribution the 3rd , 5th and 7th harmonics have been eliminated hence , they do not have any contribution to the magnetising field . however , the harmonics 9th , which represents the lowest harmonic not eliminated by the distribution of the conductors , and above , ie 11th etc , are still existent , and to minimise their contribution to the magnetising field in the magnet region the distance &# 34 ; d &# 34 ; is required to minimise their effect on the magnetisation . in general , the distance d is given by : ## equ9 ## where r i is the inner radius of the magnet cylinder , p the number of pole pairs and n s the order of the lowest harmonic not eliminated by the current density distribution . in the first example given above n s = 9 . in the second example given above where only 3rd and 5th harmonics are eliminated n s = 7 . although up to now the invention has been described largely in relation to internally magnetised cylindrical bodies it can equally well be applied to externally magnetised cylindrical bodies . internal field cylindrical bodies can be used in external rotor permanent magnet motors , and external field cylindrical bodies can be used in internal rotor permanent magnet motors , as well as other applications . in the case of an externally magnetised body , the conductors 20a - 20f and 22a - 22f are disposed about the body 2 externally as shown in fig7 of the drawings that follow . for such a multiple external field cylinder the magnetisation distribution satisfies : and the distance &# 34 ; d &# 34 ; of a conductor from the surface of the body in order to reduce higher harmonic effects is given by : ## equ10 ## where r o is the external radius of the cylinder . of course , the distance d can be exceeded , but this requires further energy to be imparted to the conductors to achieve the desired magnetisation . thus , if the cylindrical body is magnetised only internally , only an internal field is produced , and if magnetised only externally only an external field is produced . the arrangement is self - shielding . in order to decrease the energy required to magnetise a given body , a slotless iron core 26 can be used as shown in fig8 of the drawings that follow for both an internal and an external field . the body facing surface of the iron core should be close as close as possible to the conductors for maximum effect . it is important for the core to be slotless to make the previous equations applicable . magnetising fixtures are designed to imprint a specific number of poles on a cylindrical magnet . the magnetising field required for full magnetisation depends on the magnetic material to be magnetised . three parameters are chosen to fully magnetise a multipole magnet cylinder , with a given size and using a given capacitor discharge magnetiser : the designer can still proceed in the same way , for example choosing a specific distribution or combining different distributions in different layers to change the number of conductors per pole . however , the angular positions of the magnetising conductors and minimum distance &# 34 ; d &# 34 ; for each layer must be satisfied in any case for the preferred magnetisation . before use , the body 2 is tested and corrected for any imbalance using high speed rotational trials . typically an imbalance will be corrected by removal or adding of material from or to a part of the body 2 . magnetised cylindrical bodies of this type have many applications , such as as rotors in motors , generators or rollers . these rotors are sometimes referred to as current sheet equivalent materials . the reader &# 39 ; s attention is directed to all papers and documents which are filed concurrently with or previous to this specification in connection with this application and which are open to public inspection with this specification , and the contents of all such papers and documents are incorporated herein by reference . all of the features disclosed in this specification ( including any accompanying claims , abstract and drawings ), and / or all of the steps of any method or process so disclosed , may be combined in any combination , except combinations where at least some of such features and / or steps are mutually exclusive . each feature disclosed in this specification ( including any accompanying claims , abstract and drawings ), may be replaced by alternative features serving the same , equivalent or similar purpose , unless expressly stated otherwise . thus , unless expressly stated otherwise , each feature disclosed is one example only of a generic series of equivalent or similar features . the invention is not restricted to the details of the foregoing embodiment ( s ). the invention extends to any novel one , or any novel combination , of the features disclosed in this specification ( including any accompanying claims , abstract and drawings ), or to any novel one , or any novel combination , of the steps of any method or process so disclosed . | 7 |
referring now to the drawings , fig1 shows a motor - generator 14 arranged about a central axis 18 and located within a space bounded by a front housing cover 20 secured by bolts 22 and to a housing 24 , whose position is fixed . the motor - generator 14 includes a stator 26 , secured by a series of bolts 28 to an extension of the housing 24 or another fixed member ; electrically conductive wire wound in a coil 30 about axis 18 ; a rotor 32 surrounded by the stator ; and a rotor shaft 34 supported for rotation about axis 18 on bearings 36 , 38 . each axial end of the rotor 32 is covered by an end cap 40 , 42 . a ring 48 contacts the end cap 40 . a nut 50 , engaged by a screw thread with rotor shaft 34 , contacts ring 48 . fig2 and 3 show a dog clutch 52 comprising nut 50 and a dog clutch member 58 . the coil of an electric conductor , preferably copper wire , is encased in a electromagnet assembly 54 secured by a first snap ring 56 on cover 20 and located adjacent the dog clutch member 58 . a belleville spring 60 , contacting dog clutch member 58 and a second snap ring 62 , continually urges the dog clutch member 58 leftward away from nut 50 . fig3 and 5 show that dog clutch member 58 is formed with projection 64 , spaced mutually and angularly about axis 18 and extending rightward axially away from the body of member 58 and toward the nut 50 . fig3 and 4 show that nut 40 is formed with projections 66 , spaced mutually and angularly about axis 18 and extending leftward axially away from the body of nut 50 and toward the teeth 64 of member 58 . fig4 shows that the axial inner face of nut 50 is formed with nine of the angularly spaced projections 66 , each projection 66 being formed with an inclined ramp 72 , an angular length portion 74 that may have a flat surface , and dog clutch tooth 76 , located at the opposite end of the length portion 74 from the location of the ramp 72 . similarly , fig5 shows that the axial inner face of dog clutch member 58 is formed with three of the angularly spaced projections 64 , each projection being formed with an inclined ramp 78 , an angular length portion 80 that may have a flat surface , and a dog clutch tooth 82 , located at the opposite of the length portion 80 from the location of the ramp 78 . the dog clutch member 58 is also formed with lugs 86 , spaced angularly about axis 18 and extending radially outward from the axis . the clutch member 58 is installed such that each of its projections 64 is located between first and second projections 66 of the nut 50 , with the clutch tooth 82 of the clutch member projection 64 aligned with and facing the clutch tooth 76 of the first one of the clutch member projections 64 , and with the ramp 86 of the clutch member projection 64 aligned with and facing the ramp 72 of the second one of the clutch member projections 64 . when installed in this manner and position ramps 72 and 78 are substantially parallel surfaces , as shown in fig6 and 7 . fig6 and 7 show a ramp 78 of dog clutch member 58 contacting a ramp 72 of nut 50 , and clutch teeth 82 of clutch member 58 spaced from clutch teeth 76 of the nut 50 . fig8 is an end view of the axial inner face of the dog clutch member 58 showing the clutch member installed in the end cover 20 . each lug 86 of member 58 is fitted in a recess 88 formed in the end cover 20 , thereby preventing rotational displacement of member 58 relative to the cover 20 and nut 50 , but permitting axial translation of member 58 relative to the cover and nut . in operation , when the coil of electromagnet 54 is energized , dog clutch member 58 translates rightward , when viewed as in fig2 and 3 , toward nut 50 due to the effect of the magnet field produced by the electromagnet . when rotor shaft 34 and nut 50 rotate counterclockwise about axis 18 when viewed as in fig8 , the clutch tooth 76 of at least one of the projections 66 of the nut contacts a corresponding clutch tooth of one of the projections 64 of the clutch member 58 , thereby preventing rotation of the rotor shaft and nut . when the coil of electromagnet 54 is deenergized , spring 60 urges dog clutch member 58 leftward , when viewed as in fig2 and 3 , away toward nut 50 . when rotor shaft 34 and nut 50 rotate clockwise about axis 18 when viewed as in fig8 , the ramp 72 of at least one of the projections 66 of the nut ascends the ramp 78 of one of the projections 64 of the clutch member 58 , thereby forcing the clutch member leftward , disengaging the nut from the clutch member , and allowing rotation of the rotor shaft and nut . leftward axial translation of the dog clutch member 58 is limited by its contact with the end cover 20 , as fig2 shows . rightward axial translation of the dog clutch member 58 is limited by its contact with nut 50 , whose axial position is fixed . in accordance with the provisions of the patent statutes , the preferred embodiment has been described . however , it should be noted that the alternate embodiments can be practiced otherwise than as specifically illustrated and described . | 5 |
in the fixed contact structure according to the present invention , an accommodation section is formed in the housing thereof to receive a slider therein , the housing being loaded with a printed circuit board such that fixed contact plates attached to the printed circuit board are brought into electrical conduction with the traveling contacts . hereinafter , embodiments of the fixed contact structure of the present invention being applied to the automotive room lamp will be explained with reference to the drawings . referring to fig1 which is a perspective view of the automotive room lamp system in general , the numeral 1 denotes a box - shaped base body formed by injection molding or the like , the body being divided into three chambers aligned generally in a longitudinal direction . in the respective left hand and right hand chambers , lamps and push switches are accommodated while lens plates 1 a are pivotally supported thereto on the central chamber sides thereof in cantilever fashion . when each lens plate 1 a is pressed at an end portion thereof opposite to the pivotal end thereof , the above mentioned push switches are turned on to light the lamp and when the lens plate 1 a is pressed again in a similar way , the push switch is operated to switch off the lamp . the thus structured automotive room lamp system is known as disclosed in u . s . pat . no . 6 , 273 , 593 ( the entire content of which is expressly incorporated hereinto by reference ). furthermore , bus bars ( not shown ) to connect the lamp and the push switch are mounted to the back side of the base body 1 . the numeral 2 denotes a switch box to be accommodated in the central chamber of the base body 1 , the structure of the box being shown in greater detail in fig2 and 3 . as is shown , the switch box 2 is composed of a front plate 21 , a printed circuit board 22 mounted to the interior of the front plate 21 by means of screws or the like . a back plate 23 is engaged with a hole 21 a in the front plate 21 by way of claw 23 a from the back thereof so as to be made integral with the front plate 21 . a slider or traveling contact member 24 has a knob 24 a protruding through a slot 21 c in the front plate 21 . the slot 21 c thus provides access to the slider 24 to allow lateral sliding manipulation of the same . the front plate 21 has a partition wall 21 d which defines an accommodation section 21 b . the partition wall 21 d has upright portions 21 d 1 which define six cutouts 21 i , each upright portion 21 d 1 being formed with steps at its upper portion . the front plate 21 is formed with a transparent window 21 e for letting out the light from a light emitting diode 22 d which will be explained later . on the back side of the front plate 21 , there is further formed a light shielding wall 21 f to surround the transparent window 21 e . ( see fig1 ) it is to be noted in this connection that the numeral 21 g denotes a sound collecting hole for picking up sound for a microphone to allow a hand free use of a cellular phone , for example . the slider 24 slidably accommodated in the accommodation section 21 b is oriented such that the knob 24 a thereof protrudes through the slot 21 c in the front plate 21 . as shown in fig6 , the slider 24 is provided with two traveling contacts 24 b and having contact faces and urged by springs 24 c toward the partition walls 21 d such that the contact faces are exposed outside thereof , each traveling contact 24 b being arranged for the contact faces to short any two of the fixed contact plates 22 c to be described later on . the printed circuit board 22 is soldered with a microphone 22 a , a connector terminals 22 b to be led out into the connector box 22 b for connecting the bus bars and the power source to the connectors , fixed contact plates 22 c to be engaged with the upright portions 21 d 1 of the partition wall 21 d in the front plate 21 and the light emitting diode 22 d to do spot illuminating . ( see fig9 and 10 ) as shown in fig4 and 5 , the respective fixed contact plates 22 c have fixation bases 22 c 1 to be connected to the conduction patterns of the printed circuit board 22 , contact portions 22 c 2 rising from the fixation bases 22 c 1 and engagement portions 22 c 4 having cutouts 22 c 3 therein such that the entire structure are channel shaped as viewed from the side . the procedure of bringing the fixed contact plates 22 c into engagement with the partition walls 21 d of the accommodation section 21 b will be explained hereinafter . in this regard , it is to be noted that the fixed contact plates 22 c are soldered to the printed circuit board 22 . therefore , when the printed circuit board 22 is assembled with the front plate 21 , the engagement portions 22 c 4 of the contact plates 22 c will be inserted into the generally u - shaped openings defined by the upright portions 21 d 1 . the relatively narrow width cutouts 22 c 3 in the fixed contact plates 22 c are thereby received within and slidably guided downwardly by the upright portions 21 d 1 . during assembly , the fixed contact plates 22 c will ultimately reach a lowermost extent of being guided downwardly along the upright portions 21 d 1 , at which time the upper engagement portions 22 c 4 of the contact plates 22 c are brought into abutment with the steps 21 d 2 formed in the upright portions 21 d 1 . as such , the contact plates 22 c will be seated in their final fixed position so as to be exposed through the openings of the upright portions 21 d 1 . in such a state , the printed circuit board 22 may then be further fastened to the front plate 21 by means of screws or the like to ensure that the fixed contact plates 22 c are secured immovably to the partition wall 21 d without play . the contact portions 22 c 2 of the contact plates 22 c are thus positioned so as to be substantially flush with the surfaces of the upright walls 21 d . such a flush mounting of the contact portions 22 c 2 thereby ensures that the traveling contacts 24 b of the slider 24 move relatively smoothly when the slider 24 within the accommodation section 21 b is manipulated so as to slide relative to the fixed contact plates 22 c . it is to be noted that the accommodation portion 21 b is also defined by an outer wall standing opposite to the partition wall 21 d . the outer wall preferably has a patterned indented surface 21 h formed in the inner side thereof so as to provide a clicking feel upon the sliding movement of the slider 24 . the switch box 2 is assembled into an integral body by securing the printed circuit board 22 to the front plate 21 , inserting the slider 24 into the accommodation portion 21 b , engaging the back plate 23 to the front plate 21 and then bringing a claw 23 b formed in the back plate 23 into engagement with a hole 1 b formed in the base body 1 . ( see fig1 ) in the preferred embodiment , the printed circuit board 22 is provided with two sets of fixed contact plates 22 c , the two sets being formed in separated positions , each set having three fixed contact plates 22 c . on the other hand , the slider 24 is provided with a pair of traveling contacts 24 c in separated positions , thus enabling the slider 24 to cause the fixed contacts 22 b to perform a two - step switching action while being slid . if the thus constructed slide switch is to be installed in a vehicle such as a minivan or the like having three rows of seats , the circuit as shown in fig1 will be required . more specifically , the push switches s 1 and s 2 incorporated with the slide switches to be used for a front seat illumination in a vehicle , the push switches s 3 and s 4 loaded with two lamps to be used for a middle seat illumination light and the switch s 5 loaded with two lamps for rear seat illumination are connected as shown in fig1 such that the operation of the middle seat and rear seat illumination lamps is controlled by sliding the front seat slide switch . it is to be noted in this connection that the numerals l 1 to l 5 denote lamps whereas the numeral s 6 denote a door switch to be turned on in response to the opening of a car door . hereinafter , the control operation thereof will be explained . in case the traveling contacts of the respective switches s 1 to s 5 have been switched to the fixed contact side as shown while the traveling contact 24 b is connected to the door contact of the fixed contact plate 22 c , the respective switches s 1 to s 5 are grounded by way of the door switch s 6 which is turned on when the door is opened . in this state , all the lamps l 1 to l 5 connected to the respective switches s 1 to s 5 are lit . on the other hand , all the lamps l 1 to l 5 are turned off if the door is closed to open the door stitch s 6 . when the traveling contacts 24 b of the slide switch are turned to the on side of the fixed contact plates 22 c while the switches s 1 to s 5 are as depicted , the traveling switch 24 b is grounded regardless of the on - off position of the door switch s 6 , thus enabling all the illumination lamps l 1 to l 5 arranged at the driver &# 39 ; s seat are brought into a lit state . furthermore , if the respective switches s 1 to s 5 are switched to the opposite direction from the connection state , the respective fixed contacts are grounded such that the lamps at the respective seats are freely operated for lightening . the light emitting diodes 22 d to be soldered to the printed circuit board 22 are inserted into a holder 25 secured to the printed circuit board 22 before the soldering is done . thereafter , the lead wire 22 d 1 of the light emitting diode 22 d is inserted into a through hole in the printed circuit board 22 for soldering . the holder 25 is formed of a resin in the shape of a rectangular sleeve having legs 25 a diagonally designed to fit into holes formed in the printed circuit board 22 . the inside of the holder 25 is provided with a platform 25 b to support the underside of the light emitting diode 22 d , the platform 25 b having a hole to allow the insertion of the lead wires 22 d 1 . further , the holder 25 has a wall above the platform 25 b , the wall having protruding members 25 c to restrain the play of the light emitting diode 22 d . the upper portions of the protruding members 25 c are formed with slants 25 c 1 to allow smoother insertion of the light emitting diodes 22 d into the holder 25 . the holder 25 is an open top type having an upper portion which flanks the light shielding wall 21 f formed in the inner wall surface of the front face plate 21 . therefore , when the light emitting diode 22 d is energized to be lit , the light ray radiating from the light emitting diode 22 d is emanated toward the transparent window 21 e formed in the front plate 21 to do the spot illumination for the cup holders or the like installed inside the vehicle by the light ray therefrom . in general , visible light rays from the light emitting diode tend to be diffused . however , the light emitting diode used in the present invention is accommodated within the holder 25 to prevent light rays from emanating outside the opening in the holder 25 . since the opening in the holder is positioned to extend in the light shielding wall 21 f , light rays spreading out from the opening in the holder 25 are shielded by the light shielding wall 21 f and are thereby prevented from being emitted from the room lamp per se . in the preferred embodiment of the present invention , although the explanation has been given only with respect to the automotive room lamp , it is needless to say that the invention can be applied to devices in which the operation of the circuit of the printed circuit board are controlled by electrically connecting the slide switches and the printed circuit board . | 7 |
referring now to the drawings , and to fig1 in particular , the fuel assembly illustrated therein and generally designated with reference numeral 10 is of the kind commonly employed in pressurized water reactors . basically , it comprises a lower end structure or bottom nozzle 12 adapted to support the fuel assembly on the lower core plate ( not shown ) of a nuclear reactor , guide tubes or thimbles 14 connected to the bottom nozzle 12 and extending longitudinally upwards therefrom , transverse support or spacer grids 16 spaced from each other along the guide thimbles 14 and fastened thereto , an instrumentation tube 20 extending longitudinally through the center of the fuel assembly , and an upper end structure or top nozzle 22 attached to upper end portions of the guide thimbles 14 . these parts all together form an integral unit known as the skeleton of the fuel assembly . the complete fuel assembly includes an array of fuel rods 18 loaded into the skeleton , in a manner to be described later herein , and supported by the grids 16 in parallel spaced relationship with respect to one another . each fuel rod 18 comprises a cladding tube 23 which is hermetically sealed at its opposite ends by means of end plugs 26 , 28 , and nuclear - fuel pellets 24 contained in the cladding tube and held firmly stacked therein by means of a pressure spring 30 interposed between the upper end plug 26 and the stack of fuel pellets 24 . during reactor operation , the fuel pellets , composed of fissile material , are the source of energy generated in the form of heat which is extracted from the reactor core by means of a liquid moderator / coolant , such as water or water containing boron , circulated therethrough . fissioning is controlled by means of control rods ( not shown ) which are connected to a control mechanism 34 mounted in the top nozzle 22 and operable to effect axial movement of the control rods into and out of preselected ones of the guide thimbles 14 , all as well known in the art . only some of the support grids 16 of the fuel assembly 10 are shown in fig1 . typically , there would be eight or ten , each comprising , as illustrated in fig2 and 4 , and cellular structure composed of a plurality of inner straps 40 interlaced and joined together in an egg - crate - like manner so as to form open cells , as indicated at 42 , and of outer or peripheral straps 44 interconnected at their ends and connected to the outer ends of the inner straps 40 so as to add strength to the whole grid structure . the inner and outer grid straps are made of a material having a low neutron - capture cross - section , such as for example a zirconium alloy known as zircaloy , and they are provided with detents , such as detents 46 and 48 ( see fig3 and 4 ), which project from the various cell - defining strap portions , or cell walls , into the respective cells 42 so as to resiliently engage and laterally support the fuel rods , such as fuel rod 18 , inserted therein . the spacing between the detents on each pair of strap portions forming oppositely disposed walls of a cell 42 is somewhat less than the outer diameter of the fuel rod to be received in the cell , the difference being accommodated , upon insertion of the fuel rod , due to resilience of the detent or detents on one of the respective pair of oppositely disposed cell walls or , if only relatively stiff detents are employed , by the resilience of the strap portions themselves . as noted earlier herein , the detents in the fuel - rod receiving cells of a support grid may take various forms . in the embodiment illustrated , they consist of elongate springs 46 and relatively rigid dimples 48 formed out of the grid straps , each cell - defining strap portion having thereon one elongate spring 46 which projects into the cell 42 located on one side of the strap portion , and a pair of dimples 48 which are located adjacent the opposite ends of the elongate spring 46 and project into the cell 42 located on the other side of the same strap portion . thus , each grid cell 42 has associated therewith two resilient springs 46 projecting from two cell walls located adjacent each other , and four relatively stiff dimples 48 arranged in two pairs projecting from the two remaining cell walls opposite the spring - bearing walls , so that there are altogether six detents 46 , 48 per grid cell 42 to engage and bear against the fuel rod 18 extending through the cell . the springs 46 and the dimples 48 are elongate and generally trapezoidal , with the springs 46 oriented to extend substantially parallel to the longitudinal axes of ( i . e . to the coolant - flow direction through ) the cells 42 , as seen best from fig4 and with the dimples 48 oriented to extend transversely of said longitudinal axes and said coolant - flow direction , as seen best from fig3 . there are other known grid designs ( not shown ) which have the dimples as well as the springs oriented in parallel to the longitudinal axes of the grid cells . as seen from fig3 and 4 , the support grid 16 partially illustrated therein includes mixing vanes 50 which extend from upper ( i . e . downstream , with regard to the coolant flow direction ) edge portions of the grid straps 40 , 44 , and have the function of promoting the mixing of coolant flow along the fuel rods in order to avoid local hot - spot conditions and to average the enthalpy rise in order to maximize power output , as well known in the art and as described , for example , in u . s . pat . no . 3 , 395 , 077 to long sun ton et al . usually , fuel rods are loaded into a fuel assembly from its top end , either by pulling them from the bottom end of the fuel assembly or by pushing them from its top end , depending primarily upon whether the fuel assembly is readily accessible from either end , as during manufacture of a new fuel assembly , or is readily accessible only from the top , as during reconstitution or reassembly of a fuel assembly standing upright in a submerged work station . it should be noted in this context that terms such as &# 34 ; top &# 34 ;, &# 34 ; bottom &# 34 ;, &# 34 ; upper &# 34 ;, &# 34 ; lower &# 34 ; and the like are generally used herein with reference to the operational or upright position of the fuel assembly rather than necessarily the disposition in which the fuel assembly might be held during a fuel - rod loading operation . referring now to fig5 it schematically illustrates equipment typically employed for pulling fuel rods into a fuel assembly skeleton while the latter is supported in a prone position and with its top and bottom nozzles not yet in place . basically , the equipment comprises a fuel rod magazine 52 for holding a complement of fuel rods ( only one being indicated at 18 ), and a fuel rod loader 54 including at least one axially extendable and retractable gripper 56 . as seen from fig6 the gripper 56 comprises a sleeve 57 and an expander rod 60 . the sleeve 57 is partially split longitudinally from the distal end thereof and , at the latter , has a gripping portion or gripper head 58 . the expander rod 60 extends into the sleeve 57 and is axially movable therein in one direction to expand the gripper head 58 , and in the opposite direction to permit elastic return of the gripper head 58 to its normal , i . e . non - expanded , condition . when in its non - expanded condition , the gripper head 58 is insertable into and withdrawable from a suitably shaped socket 62 formed in the lower end plug 28 of each fuel rod 18 , as described , for example , in copending u . s . patent application , ser . no . 797 , 331 of d . a . boatwright , filed nov . 12 , 1985 , and assigned to the present assignee . operation of the expander rod 60 effecting expansion or contraction of the gripper head 58 while the latter is inserted in the socket 62 causes the gripper head to be locked to or to be released for separation from , respectively , the end plug 28 of the fuel rod 18 . the initial step of a fuel - rod loading operation resides in placing the fuel assembly 10 , or rather the fuel assembly skeleton without its end structures ( top and bottom nozzles ), in position between the magazine 52 and the loader 54 such that its top and bottom are facing toward and are properly aligned with the magazine and the loader , respectively , as seen from fig5 . with the skeleton thus positioned , the gripper 56 of the loader is extended through the grid cells and into the end - plug socket 62 of the fuel rod 18 held aligned therewith in the magazine 52 . then , the expander rod 60 is operated to lock the gripper head 58 to the end plug 28 , whereupon the gripper 56 is retracted so as to pull the fuel rod out of the magazine 52 and into the aligned cells of all of the support grids 16 of the fuel assembly 10 . once the fuel rod is in its fully inserted position , the expander rod 60 is operated in release the gripper for disengagement thereof from the inserted fuel rod 18 . this operation is repeated until all of the fuel rods to be loaded into the fuel assembly 10 are in place . it is during this loading operation that a fuel rod , if unprotected , is at risk of having its cladding surface scratched by the detents 46 , 48 in the various grid cells , as explained hereinbefore . in accordance with the present invention , each fuel rod , during insertion thereof , is protected by means of a thin - walled metallic tubular member which has a uniform wall thickness of not more than about 0 . 008 inch and is positionable so as to have its wall interposed between the detents within the grid cells and the fuel rod being inserted therein . referring to fig7 and 8 , basically , the protective tubular member comprises a thin - walled tube 70 which has an as - formed inner diameter substantially equal to the outer diameter of the fuel rod to be received , and a longitudinal slit 72 formed in its wall 71 so as to render it resiliently deflectable in a diameter - reducing sense . the slit 72 , as shown in fig7 extends throughout the length of the tube 70 ; furthermore , it has a width sufficient to permit inward deflection of the tube wall to an extent enabling the tube alone to be inserted into the grid cells essentially without causing outward deflection of the detents therein , but insufficient to permit any of the detents within the grid cells 42 to enter the slit 72 . the tube 70 is of sufficient length to extend at least through a majority and preferably through all but one of the support grids of the fuel assembly to be loaded . the thin - walled tube may be formed from any suitable metallic stock lending itself to being shaped into a longitudinally split tube having the above - mentioned characteristics , the currently preferred material being stainless steel having a thickness substantially in a range of from 0 . 006 to 0 . 008 inch ( ca . 0 . 15 to 0 . 20 mm ). it is noted in this context that the wall thickness of the tubular member as shown in some of the various drawings is exaggerated for the purpose of greater clarity in illustration . if desired , the inner wall surface of the tube may be coated with a suitable anti - friction material chemically compatible with the environment in which the tube is to be utilized , such as polytetrafluoroethylene , for example . in order to facilitate insertion of the thin - walled tube 70 into the cells 42 of the various grids 16 , the tube 70 as shown in fig7 is provided with a tapered , frusto - conical end portion 74 formed integral therewith at the end thereof which during insertion is its leading end . the tubular member also includes tube withdrawal means comprising two openings 76 formed in diametrically opposed wall portions of the tube 70 proximate to its leading end and adapted to receive a suitable withdrawal tool or implement , such as , for example , a pin 78 ( see fig7 c ) adapted to be inserted into the openings 76 and used in pulling the tubular member from the inserted fuel rod . as mentioned hereinbefore , the longitudinal slit 72 , splitting the wall 71 of the tube 70 preferably from end to end and thereby rendering it radially deflectable through application of a moderate force , enables the tube 70 to be readily inserted into grid cells 42 alone , that is to say , prior to insertion of the fuel rod . hence , during insertion of the fuel rod , the tube 70 will serve the dual purpose of protecting mixing vanes , such as indicated at 50 in fig3 and 4 , from being bumped and damaged by the fuel rod , and of protecting the fuel rod from being scratched by the detents 46 , 48 within the grid cells 42 . referring now to fig7 a - c in which reference characters 16a and 16z designate the uppermost grid and the lowermost grid , respectively , of the fuel assembly 10 ( fig1 ), the protective tubular member or tube 70 is shown in fig7 a as inserted in the grids 16 and ready to receive a fuel rod 18 from the magazine 52 ( fig5 ). to load the fuel rod 18 into the grids 16 , the gripper 56 is extended axially through the protective tube 70 , as indicated in fig7 a by an arrow , is engaged with and locked to the lower end plug 28 of the fuel rod 18 , and then is retracted so as to pull the latter into the tube 70 , during which movement the wall 71 of the tube 70 will protect the fuel rod from being scratched by the detents 46 , 48 within the grid cells 42 . when the fuel rod 18 has reached its fully inserted position , as shown in fig7 b , it is suitably restrained from further movement while the protective tube 70 is advanced , such as by being pushed from the top , far enough to render the openings 76 near its leading end accessible , as seen from fig7 c , for engagement thereof with the above - mentioned tube withdrawal implement or pin 78 which then is used to pull the protective tube 70 off the fuel rod 18 . disengagement and full retraction of the gripper 56 may be effected either after utilizing the gripper for holding the fuel rod 18 in its inserted position during withdrawal of the protective tube 70 , or immediately after arrival of the fuel rod 18 in its inserted position in which event the fuel rod 18 is restrained in another suitable manner , such as , for example , by means of a holding implement ( not shown ) engaged with the upper end plug 26 or one held axially against the lower end plug of the inserted fuel rod 18 . referring now to fig9 which shows a modification of the protective tubular member , the latter as illustrated therein comprises a split tube 70 &# 39 ; similar in every respect to the one just described , except that the tube 70 &# 39 ; has no openings for receiving a tube withdrawal tool and instead has its tapered end portion 74 terminating in an in - turned lip 80 which , in cooperation with a shoulder 59 ( see fig6 ) formed on the gripper 56 at the juncture between the gripper head 58 and the sleeve 57 , serves as the means for withdrawing the protective tube 70 &# 39 ; from an inserted fuel rod . more specifically , the in - turned lip 80 is dimensioned such as , during initial extension of the gripper 56 into the protective tube 70 &# 39 ;, to be engaged and resiliently cammed aside by the entering gripper head 58 , and then to resiliently snap back to its natural position in which it is subsequently engaged by the shoulder 59 ( fig6 ) on the gripper head 58 when the gripper 56 is retracted and has pulled the fuel rod 18 to its fully inserted position , as shown in fig9 a . once the fuel rod 18 has reached this fully inserted position , the gripper 56 is operated to release its head 58 for withdrawal from the socket 62 in the lower end plug 28 of the inserted fuel rod 18 , whereupon retraction of the gripper 56 is continued , as shown in fig9 b , thereby causing the shoulder 59 on the gripper head , in cooperation with the in - turned lip 80 of the protective tube 70 &# 39 ;, to pull the latter from the inserted fuel rod 18 whilst the fuel rod is suitably retained in its inserted position , for instance by means of the previously mentioned implement ( not shown ) engaged with the upper end plug of the fuel rod 18 . a further modification of the protective tubular member embodying the invention is illustrated in fig1 wherein the tubular member again comprises a thin - walled tube 70 &# 34 ; which is similar in every respect to the thin - walled tube 70 of fig7 - 8 , except that the tube 70 &# 34 ; has no tapered end portion and has a substantially uniform diameter throughout its length . consequently , the protective tube 70 &# 34 ; is particularly suitable for use with fuel assemblies which are not readily accessible from the bottom and , therefore , require the protective tube to be withdrawn from the top . in order to minimize the chance of the tube &# 39 ; s getting caught on any of the detents within the grid cells during insertion therein , the tube 70 &# 34 ; preferably is provided with a chamfer 85 formed at the edge thereof which is its leading edge during insertion . the means for withdrawing the protective tube 70 &# 34 ; from an inserted fuel rod is shown in fig1 to comprise a generally l - shaped slot 84 which is formed in a wall portion of the tube 70 &# 34 ; adjacent the end thereof which is the leading end of the tube during its withdrawal , one leg of the l - shaped slot 84 extending into the tube wall in a direction generally parallel to the longitudinal slit 72 , and the other leg of the l - shaped slot 84 extending partly circumferentially of the tube 70 &# 34 ; and preferably terminating in an up - turned toe portion , as seen best from fig1 . the l - shaped slot 84 is adapted to receive a radial pin 88 on a lower end portion 86 of a long - handled tool 85 which is partially insertable into the slit tube 70 &# 34 ;. in order to facilitate entry of the radial pin 88 into the l - shaped slot 84 , the latter preferably is flared outward at the entrance thereof , as seen from fig1 . referring to fig1 a - c , the protective tubular member 70 &# 34 ; is shown in fig1 a as inserted into the grids of the fuel assembly and ready to receive a fuel rod 18 . if the fuel assembly were readily accessible from the bottom the fuel rod 18 could be pulled into the slit tube 70 &# 34 ; in the same manner as described hereinbefore . however , it is assumed that the fuel assembly is not readily accessible from the bottom and that , therefore , the fuel rod 18 must be pushed into the protective tube 70 &# 34 ; from the top . this can be done in any suitable manner known to the art , and may be done by utilizing the long - handled tool 85 as a push - rod . once the fuel rod 18 has been inserted into the protective tube 70 &# 34 ;, the lower end portion 86 of the long - handled tool 85 is engaged in the upper end portion of the protective tube 70 &# 34 ; while , at the same time , the radial pin 88 thereon is inserted into the vertical leg of the l - shaped slot 84 until it bottoms therein , whereupon the tool 85 is partially rotated to move the pin 88 into the horizontal leg of the l - shaped slot 84 and to the end thereof where it is aligned with the up - turned toe portion of the slot , as seen from fig1 b . with the tool 85 thus connected to the protective tube 70 &# 34 ;, it is retracted so as to pull the tube 70 &# 34 ; from the inserted fuel rod 18 , as depicted in fig1 c , while the fuel rod is being restrained in a suitable manner , for instance by means of an elongate restraining element ( not shown ) incorporated in the long - handled tool 85 and slideably supported therein such that it can be held restrainingly engaged with the upper end plug 26 of the inserted fuel rod 18 while the tool 85 is used simultaneously to pull the protective tube 70 &# 34 ; off the inserted fuel rod . it should be noted that each of the protective tubular members 70 , 70 &# 39 ; and 70 &# 34 ; described above lends itself to being inserted into the suppport grids 16 either alone , i . e . separate from and before the fuel rod , as shown herein , or simultaneously with a fuel rod while disposed thereon . if a fuel rod is to be loaded into grid cells which have mixing vanes associated therewith , it will likely be preferred to insert the protective tube before the fuel rod in order to protect the mixing vanes from being damaged through contact with the fuel rod , as explained hereinbefore . insertion of each protective tubular member 70 , 70 &# 39 ; or 70 &# 34 ; along may be effected by suitably guiding and pushing , or pulling , the tubular member into the selected cells 42 of the grids 16 ; if to be pulled , a similar technique may be employed as used in pulling the tubular member off an inserted fuel rod , as set forth above with particular reference to fig7 c , 9b or fig1 c , respectively . turning now to fig1 and 12a - c , they illustrate an embodiment wherein the protective tubular member is adapted for insertion thereof together and simultaneously with a fuel rod . as seen best from fig1 , the protective tubular member comprises a thin - walled tube 90 for receiving a fuel rod , and means 94 both for pulling the tubular member , together with the fuel rod disposed within the tube 90 , into the grids 16 ( fig1 ) of the fuel assembly 10 , and for withdrawing the protective tubular member from the fuel rod after insertion thereof . the thin - walled tube 90 corresponds essentially to the tube 70 &# 34 ; shown in fig1 in that it has a longitudinal slit 92 formed in its wall and is of uniform diameter throughout its length . the means 94 for inserting the protective tubular member together with the fuel rod , and for subsequently withdrawing the tubular member from the inserted fuel rod , comprises an end plug 94 secured to the tube 90 at the end thereof which is its leading end during insertion into the grids . the end plug 94 is similar to the fuel - rod end plug 28 shown in fig6 in that it is tapered and has formed therein a socket 96 adapted to be engaged with the gripper head 58 , and it may be secured to the thin - walled tube 92 in the same conventional manner as employed in securing the end plug 28 to the cladding tube of the fuel rod . the initial step in utilizing the protective tubular member of fig1 is to mount the latter telescopically upon the fuel rod 18 to be inserted , followed by a fuel - rod loading operation the same as initially described herein with respect to fig5 except that now the gripper head 58 of the extended gripper 56 is engaged with the end plug 94 of the protective tubular member 90 ( see fig1 a ) instead of with the lower end plug 28 of the fuel rod 18 . upon retraction of the gripper 56 , the protective tubular member , together with the fuel rod 18 disposed within the thin - walled tube 90 , is pulled into the cells 42 of the successive grids 16 until it reaches the fuel rod fully inserted position shown in fig1 b , whereupon the fuel rod 18 is restrained from further movement while the gripper 56 and the protective tubular member 90 still locked thereto continue to be retracted , thereby to pull the protective tubular member from the inserted fuel rod 18 , as depicted in fig1 c . in this case as in the preceding ones , restraint for the inserted fuel rod against further movement thereof while the protective tubular member is being withdrawn may be provided by any suitable means , such as the previously mentioned tool or implement ( not shown ) adapted to be restrainingly engaged with the upper end plug of the inserted fuel rod . such tool or implement may be of a kind to be manipulated manually or it may be one which , for instance , is supported from the fuel - rod magazine 52 ( fig5 ) and adapted to restrainingly engage the upper end plug of the fuel rod automatically as the latter leaves the magazine and reaches its fully inserted position within the fuel assembly 10 . additionally or alternatively , such restraint may also be provided by arranging for the protective tubular member 70 , 70 &# 39 ;, 70 &# 34 ; or 90 to extend , when in the fuel - rod inserted position , through all of the support grids 16 of the fuel assembly except the end grid 16a or 16z which is nearest the end of the protective tubular member representing its trailing end during withdrawal of the tubular member from the inserted fuel rod . with each of the arrangements as depicted in fig7 a - c , 9a - b and 12a - c , wherein the respective tubular members 70 , 70 &# 39 ; and 90 are withdrawn downwardly , the end grid nearest said trailing end of the tubular member is the uppermost grid 16a , whereas with the arrangement as depicted in fig1 a - c , wherein withdrawal of the tubular member 70 &# 34 ; occurs in the upward direction , the end grid nearest said trailing end of the tubular member 70 &# 34 ; is the lowermost grid 16z . this step of leaving an end portion of the fully inserted fuel rod exposed may be employed with any of the schemes disclosed herein but is illustrated , by way of example , only in connection with the embodiment shown in fig1 a to 12c . as seen best from fig1 b , the protective tube 90 has a length such as to leave the upper end portion of the fuel rod 18 exposed . thus , as the protective tube 90 together with the fuel rod therein approaches the fully inserted position during insertion , its upper end will ride off the detents 46 , 48 within the cell 42 of the uppermost grid 16a . this enables the detents 46 , 48 to frictionally engage the bare end portion of the fuel rod 18 and to apply thereto a restraining force which will cause the movement of the fuel rod to be arrested even as the gripper 56 and the protective tubular member 90 still connected thereto continue to be retracted . in this manner , the insertion of the fuel rod and the withdrawal of the protective tubular member from the inserted fuel rod can be effected in one continuous operation . it is believed that leaving an end portion of the fuel rod 18 thus exposed during insertion is not likely to result in any objectionable scratching of its cladding surface since the bare end portion will come into direct moving contact with the detents of only one grid cell , and movement of the fuel rod relative to the detents will cease almost immediately after such direct contact has been established . although each of the foregoing embodiments has been described with respect to only one protective tubular member 70 , 70 &# 39 ;, 70 &# 34 ; or 90 , and even though it is possible of course to use a single protective tubular member repeatedly for loading several fuel rods in succession , it will be appreciated that in practice it may well be found more expedient to employ a separate protective tubular member individually for each of a plurality of fuel rods . thus , protective tubes such as the one shown in fig7 - 8 , fig9 fig1 or fig1 may be placed one on each of a whole complement of fuel rods stored in the magazine 52 ( fig5 ) and to be loaded into the fuel assembly 10 . alternatively , a whole complement of protective tubular members such as the one shown in fig7 - 8 , fig9 or fig1 may be inserted into the grids 16 of the fuel assembly 10 for having fuel rods subsequently loaded therein . this latter approach offers a particular advantage if practiced with the kind of protective tube illustrated in fig1 , and in conjunction with a new fuel assembly skeleton being prepared for shipment to , and subsequent loading with fuel rods at , a nuclear power plant . where protective tubes can or must be inserted and withdrawn from the same end of a fuel assembly , such as the top , it may be desirable to cluster several of the tubes , for instance by supporting them from a common plate ( not shown ) having the ends of the protective tubes connected thereto and having apertures for enabling fuel rods to be inserted therethrough and into the respective tubes . preferably , such plate would include means engageable with suitable retraction apparatus ( not shown ) for withdrawing the plate , together with the protective tubes connected thereto , upon completed insertion of the fuel rods . finally , it will be appreciated that even though the invention has been described herein in conjunction with a fuel assembly designed for use in a pressurized water reactor , it is applicable just as well with respect to fuel bundles for boiling water reactors . | 8 |
referring first to fig1 a heart beat coincidence detection system 10 is shown . system 10 is implemented , for example , on a corometrics 120 series maternal / fetal monitor manufactured by ge marquette medical systems of milwaukee , wis . however , system 10 may be implemented on other fetal monitoring systems , or other medical devices . system 10 includes an input / output device 12 coupleable via wires or wirelessly to one or more transducers 14 . transducers 14 include a fetal heartbeat transducer 16 and a maternal heartbeat transducer 18 , and may further include additional transducers 20 . transducers 14 may each include an electrocardiogram electrode , ultrasound transducer , blood pressure transducer , pulse oximetry transducer , or other transducer configured to monitor cardiac activity from a heart beat source and to generate a cardiac signal based on that activity . input / output device 12 includes a port , circuit board , or other circuit configured to receive the cardiac signals from transducers 14 and provide one or more of the cardiac signals to a digital signal processor 22 . digital signal processor 22 is an integrated circuit or other circuit configured to receive analog signals from transducers 14 , digitize them , and detect heart beats on the cardiac signals . digital signal processor 22 includes a processor and program - storage memory to perform these tasks , but may include any necessary circuit elements , such as discrete components , analog components , programmable logic , etc . digital signal processor 22 provides a priority interrupt to a central processing unit 24 ( e . g ., an intel or motorola microprocessor , or other processing circuit ) each time a heart beat is detected . central processing unit 24 runs a heart beat coincidence detection algorithm stored in program memory 26 each time the priority interrupt is received from digital signal processor 22 . the algorithm will be described below with reference to fig2 a and 2b . according to an alternative structure , digital signal processor 22 and central processing unit 24 can be fabricated on one integrated circuit . alternative methods and systems of heart beat detection for both fetal heart beats and maternal heart beats may be utilized in system 10 . system 10 further includes an operator input device 28 including keypads , switches , dials , a touch - screen interface , and / or other devices configured to receive input data from a caregiver or other operator . system 10 further includes one or more output devices 30 , such as , a display 32 , a strip chart device 34 , and / or a communications link 36 coupled to the central processing unit 24 and including any necessary interface circuitry . central processing unit 24 generates output signals , such as display signals , based on the heart beat coincidence detection algorithm stored in program memory 26 and provides these output signals to one or more of output devices 30 . the heart beat coincidence algorithm of fig2 a and 2b is configured to compare the heart beats on two or more cardiac signals and determine whether the heart beats exhibit coincidence . the above matrix illustrates the transducers which may be compared by the exemplary system and method . for example , a fetal electrocardiograph signal ( f 1ecg ) is compared to a maternal electrocardiograph signal ( m ecg ) as indicated by the word “ yes ” in the chart . however , a fetal electrocardiograph signal ( f 1ecg ) is not compared to a maternal blood pressure signal ( m bp ) as indicated by the word “ no ” in the chart . the symbols f 1ecg , f 1us ( fetal ultrasound signal 1 ), f 2us ( fetal ultrasound signal 2 ), m ecg , m spo2 ( maternal pulse oximetry transducer ), and m bp correspond to ports of input / output device 12 configured to receive cardiac signals from corresponding transducers . thus , f 1ecg is not compared to f 1ecg as indicated by the “ x ” since only one port on system 10 is available for this transducer . further , it is noted that the maternal blood pressure sensor is not utilized in this exemplary embodiment for comparison to any other signal . other alternative configurations of this matrix are contemplated , depending on the capabilities of the system . referring now to fig2 a and 2b , an exemplary heart beat coincidence detection method 50 is shown . method 50 is operable in system 10 as software , but may alternatively be operable via discrete circuit elements or other programming elements . at step 52 , cardiac signals on two channels , channel 1 and channel 2 , are monitored . when a heart beat occurrence is detected on one of channels 1 or 2 , the heart beat occurrence is registered and timestamped . hbt 1 and hbt 2 in fig2 a indicate the heart beat timestamps for a heart beat occurrence detected on channel 1 and a heart beat occurrence detected on channel 2 , respectively . when a heart beat occurrence is detected on the other of the two channels , the method proceeds to step 54 . a heart beat occurrence on one of channels 1 and 2 followed by a heart beat occurrence on the other of channels 1 and 2 is referred to hereinafter as a cycle . at step 54 , the method identifies whether the heart beat occurrences on channels 1 and 2 bear a 1 : 1 correspondence . in other words , at step 54 , the method calculates whether the number of heart beat occurrences from one of channels 1 and 2 occurs twice between successive heart beat occurrences in the other channel . if a correspondence of greater or less than 1 : 1 is found , the method proceeds to step 55 . at step 55 , if channel 1 ( representing the fetal heart beat in this exemplary embodiment ) has greater than one heart beat for one heart beat of channel 2 ( representing the maternal heart beat in this exemplary embodiment ), the method proceeds to step 68 . if channel 1 has less than one heart beat for one heart beat of channel 2 , the method proceeds to step 72 ( fig2 b ). alternatively , when the heart beat occurrences indicate greater or less than 1 : 1 correspondence , the method may directly generate a divergence signal , as described below with respect to step 82 . once a cycle of heart beat occurrences is detected and time stamped , times associated with each heart beat occurrence are compared to detect coincidence . the following is one exemplary method for comparing heart beat occurrences to detect coincidence , though alternative methods are contemplated utilizing heart beat occurrences . at step 56 , a time offset ( e . g ., a phase shift ) between hbt 1 and hbt 2 is calculated . next , the running jitter between multiple cycles of occurrences is determined to indicate coincidence or divergence . in this exemplary embodiment , determining jitter between cycles includes keeping a record of the minimum and maximum phase shifts occurring among a plurality of cycles . therefore , the jitter determination assumes multiple cycles over a period of time ( e . g ., a time “ window ”). the time window is a fixed time ( e . g ., three seconds ) in this exemplary embodiment after which the minimum and maximum phase shift variables are reset but may alternatively depend on a cycle count or all cycles during a period of 1 : 1 correspondence . at step 58 , a minimum phase shift variable is updated with the new phase shift provided the new phase shift is smaller than the prior minimum phase shift . at step 60 , a maximum phase shift variable is updated with the new phase shift provided the new phase shift is greater than the prior maximum phase shift . at step 62 , a jitter is calculated by subtracting the minimum phase shift from the maximum phase shift . once the phase relationship has been characterized by phase shift and jitter , this data is used to determine if the heart beat occurrences are representative of coincidence or divergence . maximum jitter and maximum phase shift criteria are applied . thus , at step 64 , the jitter is compared to a maximum jitter threshold ( j ) and the maximum phase shift is compared to a maximum phase shift threshold ( s ). maximum jitter threshold ( j ) and maximum phase shift threshold ( s ) are variable and may be adjusted to tune the algorithm . for example , maximum jitter threshold ( j ) may be set at approximately 100 ms , or as low as approximately 1 ms . in one exemplary embodiment , maximum jitter threshold ( j ) is less than one - half the minimum expected beat - to - beat interval . for example , if the minimum expected beat - to - beat interval is 200 ms ( i . e ., corresponding to 300 beats per minute ), maximum jitter threshold ( j ) is set to one - half of 200 ms , or 100 ms . phase shift threshold ( s ) may be set at approximately 200 ms , or between 1 and 2 , 000 ms . alternatively , ( j ) and ( s ) may be tuned to any value , depending upon the application and such factors as transducer type / cardiac source . maximum phase shift and maximum phase jitter thresholds may be dynamically variable by the algorithm or static . the potential range of the phase shift between channels with signal peaks demonstrating a 1 : 1 correspondence is defined as 0 - 359 degrees , but would generally be expected to be within 180 degrees . in the time domain this could be from 0 to 1999 milliseconds depending upon the period between beats from channel 1 and channel 2 . coinciding heart beats at the low end could occur offset 1999 milliseconds from one another and be 359 degrees out of phase . maximum phase jitter may be defined as a constant or as a variable to the algorithm . one method is to make j a function of the maximum phase shift . for example , j = max shift / 3 . in this example , the maximum allowable jitter for beats to be characterized as coinciding would be 33 %. an embodiment that followed these principles would , first , characterize beats from two channels to be within 359 degrees phase of each other if the beat registry is 1 : 1 . then , within a window of comparison , the jitter , which is evaluated as the difference between the maximum and minimum phase shift , may be qualified characteristic of coincidence if less than 33 % of the maximum . maximum shift may be further qualified in the time domain if so desired , and would be a function which takes into account system latencies , this embodiment is more forgiving of the degree of phase shift , but enforces consistency in the phase relationship by allowing only a minimum in the phase jitter . with this approach the max jitter threshold should not be implemented to exceed 49 %. if the jitter is less than the maximum jitter threshold and the maximum phase shift is less than the maximum phase shift threshold , a coincidence counter is incremented and a divergence counter is decremented at step 66 . alternatively , the coincidence counter is decremented and the divergence counter is incremented at step 68 . as indicated by steps 64 , 66 , and 68 , both an increasing jitter and an exceedingly high phase shift indicate divergence . a steady jitter and a smaller phase shift indicate coincidence . at step 70 the heart beat registry is reset and prepared for registration of a new cycle of heart beat occurrences . at step 72 , a coincidence index is calculated . the coincidence index represents the degree of coincidence or divergence between heart beat occurrences on channels 1 and 2 over a time window which is either fixed or variable , as described hereinabove . in this example , the time window includes all heart beat occurrences in a three second window . the time window may include between 2 and 100 heart beat cycles . at step 72 , the coincidence index may be calculated , for example , as a ratio ( as in this exemplary embodiment ) or as a percentage of cycles which coincide . at step 74 , the coincidence index is compared to coincidence / divergence criteria ( e . g ., a coincidence trigger threshold ( c )) which indicates when a sufficient amount of coincidence or divergence is detected to alert the operator . the coincidence / divergence criteria are variable and may be adjusted to tune the algorithm . for example , coincidence trigger threshold ( c ) may be set at approximately 70 % of cycles being coincident , or approximately 3 coincident cycles to every 1 divergent cycle . alternatively , ( c ) may range between 50 % and 90 %, or may be any other value , depending upon the application and such factors as transducer type / cardiac source . if the coincidence index meets the coincidence / divergence criteria , a timer is started for the respective criterion . if the coincidence index continues to meet the coincidence / divergence criteria over multiple heart beat cycles for a predetermined time period , a signal will be generated to the user to notify the user of coincidence or divergence . in this exemplary embodiment , a coincidence trigger flag is used to implement the timer . at step 74 , if the coincidence index exceeds the coincidence trigger threshold ( c ), the coincidence trigger flag is checked at step 76 to see if it is false . if the coincidence trigger flag is false , at step 78 the coincidence trigger flag is set to true , a coincidence timer is started , and the algorithm returns to step 52 . the coincidence timer may be set to 60 seconds , between 40 and 80 seconds , or any other time , depending upon the application . if the coincidence trigger flag is not false at step 76 , at step 80 the coincidence timer is checked to see if it expired . if not , the algorithm returns to step 52 . if so , a coincidence signal is generated at step 82 and provided to one of output devices 30 . returning to step 74 , if the coincidence index does not exceed the coincidence index trigger threshold ( c ), the coincidence trigger flag is checked at step 84 . if the coincidence trigger flag is true , at step 86 , the coincidence trigger flag is set to false , a divergence timer is started , and the algorithm returns to step 52 . the divergence timer may be set to 5 seconds , between 1 and 10 seconds , or any other time , depending upon the application . if the coincidence trigger flag is not true , at step 88 the divergence timer is checked to see if it expired . if not , the algorithm returns to step 52 . if so , a divergence signal is generated at step 82 and provided to one of output devices 30 . in operation , when the coincidence index exceeds coincidence index trigger threshold ( c ) for a predetermined time ( i . e ., the duration of the coincidence timer ), a coincidence indicia is generated on one or more of output devices 30 . when the coincidence index is below coincidence index trigger threshold ( c ) for a predetermined time ( i . e ., the duration of the divergence timer ), a divergence indicia is generated on one or more of output devices 30 . according to one alternative , a divergence indicia is only provided to output devices 30 if a coincidence indicia was previously provided to output devices 30 . this alternative is particularly advantageous when the strip chart is utilized , since no indicia need be provided to the user when the heart beat occurrences are divergent unless a previous indicia indicated the heart beat occurrences were coincident . referring now to fig3 a chart 89 illustrates the operation of a portion of the heart beat coincidence detection algorithm of fig2 a . a heart beat occurrence on channel 1 is shown at occurrence 90 . a heart beat occurrence on channel 2 is shown at occurrence 92 . the phase shift or time offset between occurrences 90 and 92 is indicated by time period 94 . the x - axis of the chart represents real time in milliseconds ( ms ). in this example , the phase shift between occurrence 90 and 92 is 150 ms , as shown . in operation , the algorithm first updates the maximum and minimum phase shift values with the new phase shift value of 150 ms . a subsequent heart beat occurrence 96 is received on channel 1 , and a further subsequent heart beat occurrence 98 is received on channel 2 . note that 1 : 1 correspondence is maintained between heart beat occurrences on channels 1 and 2 from the first cycle to the second cycle . the phase shift between occurrences 96 and 98 is calculated as 155 ms , indicating a slight difference from the previous cycle . the maximum phase shift is updated to equal 155 ms and a jitter is calculated as 5 ms . further heart beat occurrences on chart 89 indicate phase shifts of 153 ms , 220 ms , 250 ms , and 190 ms and corresponding jitters of 5 milliseconds , 70 milliseconds , 100 milliseconds , and 100 milliseconds . the maximum phase shift and jitter are compared to maximum phase shift threshold ( s ) and maximum jitter threshold ( j ) to determine whether coincidence and divergence counters should be incremented or decremented . the coincidence index is then calculated and compared to the coincidence index trigger threshold ( c ). this occurs over a three second time window . processing continues in accordance with the relevant steps of fig2 b . the output of the algorithm is dependent on the values of thresholds ( j ), ( s ), and ( c ), which may be programmed when manufactured , may be updateable , and may also be adjusted by the operator via operator input device 28 to give the operator control over the sensitivity . referring now to fig4 a screen display 100 is shown . screen display 100 is generated by display 32 ( fig1 ) in response to display signals provided by central processing unit 24 . additional graphics cards or alternative circuitry may be implemented . screen display 100 includes an indicia 102 ( e . g ., the text “ hbc ”) indicating that the heart beat coincidence feature is currently operational . at step 82 of the heart beat coincidence algorithm ( fig2 b ), the algorithm generates a display signal which is one of a coincidence signal , a divergence signal , or no signal . display 100 indicates that a coincidence signal is received by displaying heart rates for channels 1 and 2 in inverse video at indicia 104 and 106 . other indicia may be used to indicate coincidence , such as , two side - by - side hearts , the text “ coincidence detected ”, an audible tone , other indicia , or some combination thereof . divergence is indicated in this example by ordinary ( i . e ., non - inverse ) video , but may be indicated by a different indicia or by no indicia . referring now to fig5 a portion 110 of a strip chart is shown . portion 110 is generated by strip chart device 34 ( fig1 ) in response to signals provided by central processing unit 24 . additional graphics cards or alternative circuitry may be implemented . portion 110 includes an indicia 112 ( e . g ., the text “ hbc ”) indicating that the heart beat coincidence feature is currently operational . indicia 112 is printed periodically ( e . g ., every 30 minutes ), but may alternatively be printed only once . at step 82 of the heart beat coincidence algorithm ( fig2 b ), the algorithm generates a display signal which is one of a coincidence signal and a divergence signal . strip chart device 34 indicates that a coincidence signal is received by printing a coincidence indicia 114 ( e . g ., two overlapping heart icons ). other indicia may be used , such as , the text “ coincidence detected ”, an audible tone , or some combination thereof . divergence may be indicated by a different indicia , such as indicia 116 ( e . g ., two non - overlapping heart icons ) or by no indicia . indicia 116 indicates that the coincidence was resolved . coincidence indicia 114 and divergence indicia 116 may be printed periodically to approve the current status , or may be printed only when the status changes . according to a further advantageous feature , the coincidence or divergence status may also be output via communications link 36 . while the embodiments and application of the invention illustrated in the figures and described above are presently preferred , it should be understood that these embodiments are offered by way of example only . for example , alternative algorithms may be employed to compare the heart beat occurrences . further , the method steps presented may be employed in a different order . accordingly , the present invention is not limited to a particular embodiment , but extends to various modifications that nevertheless fall within the scope of the appended claims . | 0 |
fig1 illustrates an athlete 2 moving toward an invisible barrier 1 : the athlete wears a belt with a sensor 16 the barrier , shown with dashed lines , is set up as a spatially fixed device and is formed by two markers . each of the two markers is constructed as a magnetic compound dipole ( mcd ) 3 and mounted on so - called cones 4 , i . e ., on pylons , such as are used , for example , in traffic control . in this manner , a type of gate is created , through which the athlete 2 is to run and which the athlete can easily recognized , because the cones 4 have contrasting color stripes 5 . with this set up , multiple barriers 1 may be set up at a venue that is not at a sports arenas , for example , for sporting events in which a number of athletes 2 are to be guided through the center of a city or through other courses . the barrier 1 is an imagined , invisible line between two posts of the virtual gate through which the athlete 2 is to run , whereby the construction of the post is clearly shown in fig2 : the cone 4 and the mcd 3 that is integrated into the cone 4 form the virtual gate . fig7 illustrates the mcd 3 as having two magnets 6 arranged at the ends of a metallic extension yoke 7 . fig8 illustrates that two or more magnets 6 are provided on each end of the mcd 3 . the mcd 3 is removably mounted in the cone 4 , whereby the cone 4 , for example , may have a sleeve that is open at the top , so that the mcd 3 is insertable through this opening , or the mcd 3 may have a circumferential flange on the extension yoke 7 , which limits the insertion depth into the cone 4 . in any case , multiple cones 4 are stackable , one on top of the other , after the mcds have been removed . the mcds 3 may also be bundled together to save space , so that overall , the organizational effort that is involved in setting up and later taking down a number of barriers 1 for a sporting event is reduced . the time detection barriers take up a relatively small space when being transported and may be set up in a very easy manner . this is because there is no need for cables , electronics for data evaluation , etc . to set up and operate the barriers 1 , such as is necessary when the barriers have to be permanently installed along a race course . fig3 shows a fitness device 8 , that has a bar 9 that is operated by the athlete 2 . the athlete 2 wears a belt with a sensor 16 . the bar 9 is connected with a plurality of weights 11 via a cable 10 guided over several pulleys . the cable 10 carries not only the weights 11 , but also a magnet 12 , that is movable along with the cable 10 and , particularly , is movable relative a spatially fixed mounted mcd 3 . the presence of the athlete 2 , as well as also the number of motions that the athlete carries out with the bar , are recorded by sensor based on the modulation of the magnetic field on the mcd 3 . this is done without requiring the use of a barrier 1 with the system that is shown here in fig3 . a second mcd 3 may be used to modulate the magnetic field of the first mcd 3 . fig4 to 6 illustrate a system for recording the position of an object in which a barrier 1 is not needed . the fitness device 8 shown here is a so - called ellipsis trainer , shown in side view in fig4 and 6 . fig5 illustrates components of the trainer 8 seen from the rear . similarly to the set up shown in fig3 , the athlete 2 wears a belt here , too , with the sensor 16 , and a movable magnet 12 is mounted on the fitness device 8 , where the spatially fixed mcd 3 is also mounted . the system according to the invention records the number of motion cycles that the athlete 2 executes with the fitness device 8 , based on the relative motion between the mcd 3 and the magnet 12 . fig4 and 5 show , in two different variants of the ellipsis trainer , that the movably mounted magnet 12 may be provided on one of the two step platforms 14 on which the athlete stands , or that a movable magnet 12 may be mounted on each of the step platforms 14 . or , it is also possible , as shown in fig6 , to affix the movable magnet 12 to a flywheel or cam wheel 15 that is set into rotation by means of the step platform 14 that serves as a crank to rotate the cam wheel . instead of a magnet 12 , a second , movable mcd 3 may be used . also , instead of the sensor 16 that is worn by the athlete 2 , the sensor may also be set up a distance from the fitness device 8 . fig9 illustrates an mcd 3 , that is encased in a sheath 17 . the sheath 17 does not have to be constructed as a magnetic shield , but merely serves to maintain a minimum distance of the mcd 3 to the surrounding objects , so as to reliably avoid magnetic disturbances that can be generated in close range to the mcd 3 because of the relatively strong magnetic field . furthermore , the sheath 17 may be constructed as protection against the elements of the weather , for example , so that the material used for the extension yoke 7 is protected against corrosion . finally , the sheath 17 may also be padded , to serve as a mechanical protection for the mcd 3 as well as for the athletes 2 , when they run through a magnetic barrier 1 . fig1 to 15 illustrate six different embodiments of magnetic barriers 1 , whereby these illustrations all show the magnetic barrier in a plan view . the arrow indicates the direction in which the athlete 2 passes through the barrier 1 . different set ups enable the recognition of the individual barriers , because the change in the magnetic field when passing the sensor differs in the set ups . additional combinations of set ups are possible with the use of diagonally oriented mcds . fig1 is a plan view of a magnetic barrier 1 , by which the two cones 3 are provided with contrasting stripes 5 and each has a vertically oriented mcd 3 . both mcds 3 are oriented in the same direction , i . e ., with either both north poles or both south poles of the magnets 6 pointing up . fig1 illustrates a magnetic barrier 1 , that has the same basic construction , whereby the two mcds 3 are oriented differently in the cones 4 . in other words , in one mcd , the north pole of the magnets 6 is pointing up and in the other mcd in the cone 4 the north pole of the magnet 6 used there is pointing down . fig1 and 13 illustrate two magnetic barriers 1 , in which the mcds 3 are oriented horizontally , also , lying down , and parallel to the direction the athlete is running through the gate . the “ n ” and “ s ” indicators make clear , that , in fig1 , the mcds 3 are oriented the same , whereas the two mcds 3 in the magnetic barrier in fig1 are oriented opposite each other . fig1 and 15 show two constructions of magnetic barriers 1 , in which the mcds 3 are also horizontally oriented , but not in the direction the athlete is running , but rather , transverse to the runner &# 39 ; s direction . fig1 relates to an embodiment , in which the two mcds 3 are oriented in the same direction , and fig1 to an embodiment of the magnetic barrier 1 in which the mcds are oriented opposite each other . in these two embodiments , the two north poles of the mcds 3 point inward , i . e ., toward the athlete 2 or toward the open passage through the magnetic barrier 1 . fig1 shows an athlete 2 riding a horse through the open passage way of a magnetic barrier 1 . the two mcds 3 are arranged in vertical orientation and , in this embodiment , the athlete 2 is not wearing a belt , but rather , the belt is part of the saddle belt that the horse is wearing . the sensor 16 is arranged in the lower area of the saddle belt . the dashed lines show how the lines of the sensor 16 run to the mcds 3 of the magnetic barrier 1 and indicate schematically the action between the sensor 16 and the mcds 3 . fig1 shows that the magnetic barrier 1 is not used to detect an athlete &# 39 ; s travel , but rather , travel a ball 18 . the two mcds 3 are mounted on the goal posts of a soccer goal . depending on the material that the goal posts are made of , the mcds 3 may be embedded into the posts . the ball 18 just crossing the goal line in the upper portion of fig1 and , thus , the magnetic barrier between the two mcds 3 . the effective lines between the sensor 16 that is incorporated into the ball 18 and the mcds 3 are shown in dashed lines . the ball 18 , which is shown in a larger scale in fig1 , below the soccer goal , carries the sensor 16 inside it . the sensor 16 is elastically suspended in the center of the ball 18 to protect it . the sensor 16 may be read wirelessly via a data cable after the end of the game . it is a particular advantage , however , if the sensor 16 is equipped with a radio module , so that during the game , practically in real time , the sensor signal may be evaluated . this provides irrefutable evidence , for example , of whether the ball 18 crossed the goal line between the soccer goal posts . fig1 shows the magnetic field lines of two mcds 3 , which are oriented opposite each other , as can be seen on the “ n ” and “ s ” designations on the magnetic north and south poles . fig1 shows , with the same distance of the two mcds 3 , that is , with a magnetic barrier 1 having the same width , the magnetic field lines of an arrangement in which the magnets 6 of the mcds 3 are oriented in the same direction . | 0 |
hereinafter , embodiments of the present invention will be described on the basis of the drawings . fig1 is a conceptual diagram of a die bonder 10 viewed from the upper side according to an embodiment of the present invention . the die bonder roughly includes a wafer supplying unit 1 , a work supplying / feeding unit 2 , a die bonding unit 3 , and a control device 4 that controls the respective units and a bonding flow in each embodiment to be described later . the work supplying / feeding unit 2 includes a stack loader 21 , a frame feeder 22 , and an unloader 23 . a work ( a substrate such as a lead frame or a die already laminated on a substrate ) supplied to the frame feeder 22 by the stack loader 21 is fed to the unloader 23 via two processing positions on the frame feeder 22 . the wafer supplying unit 1 includes a wafer cassette lifter 11 and a pickup device 12 . the wafer cassette lifter 11 includes wafer cassettes ( not shown ) filled with wafer rings , and sequentially supplies the wafer rings to the pickup device 12 . each wafer ring holds a wafer w having a die d , and the pickup device 12 holds the wafer rings . the die bonding unit 3 includes a preform unit 31 and a bonding head unit 32 . the preform unit 31 applies a die adhesive agent on the work fed by the frame feeder 22 . the bonding head unit 32 includes a bonding head 35 , an xzθ driving unit 36 that drives the bonding head in the x or z direction or rotates the same by θ , a y driving unit 37 that drives the xze driving unit in the y direction , a collet replacing unit 50 , and a collet descent distance correcting unit 60 . the bonding head 35 is lifted by the xzθ driving unit 36 while picking up the die d from the pickup device 12 , and translates the die d in the x direction to a bonding point on the frame feeder 22 . then , the bonding head 35 allows the die d to descend to be bonded onto the work with the die adhesive agent applied . hereinafter , as a feature of the embodiments , the collet attachment confirmation means 70 that confirms whether or not a collet is attached , the collet replacing unit 50 , and the collet descent distance correcting unit 60 that corrects a collet descent distance after collet replacement will be described . in the first place , structures of the bonding head 35 , a collet 40 and a collet holder 41 and a configuration of the collet attachment confirmation means 70 will be described using fig2 . the bonding head 35 has , in the middle , an absorption hole 35 v to which absorption air flows , and includes , on the tip end side , a collet shank 35 s connected to the collet holder 41 and a collet fixing unit 35 k that fixes the collet holder 41 to the collet shank 35 s . the collet holder 41 has , in the middle , an absorption hole 41 v in communication with the absorption hole 35 v , a magnet 41 j fixing the collet 40 , and the collet attachment confirmation means 70 provided in the absorption hole 41 v . as shown in fig4 , the four sides of the collet 40 are held by the collet holder 41 , and the collet 40 includes plural absorption holes 40 v in communication with the absorption hole 41 v to absorb the die d . the collet attachment confirmation means 70 includes an orifice 70 o , a confirmation bar 70 b with one end fixed to the orifice , and a compression spring 70 c that presses the orifice towards the collet holder 41 . in the case where the collet 40 is attached to the collet holder 41 as shown in fig2 , the confirmation bar 70 b is pushed up by the collet 40 against the compression spring 70 c in the collet attachment confirmation means 70 , and the orifice 70 o is lifted to secure the volume of air flow . on the other hand , in the case where no collet 40 is attached , the compression spring 70 c allows the orifice 70 o to descend to decrease the volume of air flow . the attachment of the collet 40 is confirmed by the volume of air flow or differential pressure . according to the above - described collet attachment confirmation means 70 , the attachment of the collet can be reliably confirmed without providing optical means . next , a first example of the collet replacing unit 50 as a second embodiment will be described using the drawings . in the first place , a configuration of the collet replacing unit 50 will be described using fig3 to fig6 . each of fig3 and fig4 is a birds - eye view of the collet replacing unit 50 shown in fig1 . fig3 shows a state in which an unused collet 40 is housed in a supplying unit 51 . fig4 shows a state in which the collet holder 41 is grasped to attach the collet 40 . fig5 is a plan view of the collet replacing unit 50 viewed from the upper side in the state of fig3 . fig6 is a diagram of the inside of the supplying unit 51 viewed from the direction of the arrow a in fig4 . as shown in each of fig3 and fig5 , the collet replacing unit 50 includes the supplying unit 51 that supplies an unused collet 40 , and a discarding unit 56 that discards a used collet 40 . the supplying unit 51 and the discarding unit 56 include opening portions 51 k and 56 k on the upper side , respectively . the opening portions 51 k and 56 k have the same structure , and include fixing claws 51 t and 56 t , respectively , of engagement portions at diagonal positions denoted by the circles . it should be noted that in consideration of a case in which the direction of mounting the die d is shifted by 90 ° as shown by the dotted line in the embodiment , two engagement portions are each provided at the positions where the fixing claws 51 t and 56 t are rotated by 90 °. as shown in fig6 , the supplying unit 51 includes a collet housing unit 51 s in which plural unused collets 40 are stacked , a compression spring 51 b as pressing and moving means that presses and moves the unused collets 40 in the collet housing unit towards the opening portion 51 k , and a spring housing unit 51 r in which the compression spring is housed . on the other hand , the discarding unit 56 includes a waste housing unit under the opening portion in which used collets 40 are housed . a cylinder or the like may be provided as the pressing and moving means . in the supplying unit 51 , the fixing claws 51 t serve as protrusion prevention means to prevent the collet from protruding by being engaged with the collet 40 . in addition , the fixing claws 51 t and 56 t are highly important when the collet 40 is attached to the collet holder 41 , or when the collet 40 is detached from the collet holder 41 . as shown in fig4 , the areas of the collet holder 41 corresponding to the fixing claws 51 t and 56 k are cut in a triangle shape so as not to interfere with the fixing claws 51 t and 56 k . a method of attaching the collet 40 to the collet holder in the collet replacing unit 50 with such a configuration will be described using fig3 to fig7 . each of fig3 and fig5 shows a state in which the collet 40 is simply housed in the supplying unit 51 . in this case , the fixing claws 51 t serve to prevent the collet 40 from protruding . next , as shown in fig4 , the bonding head 35 is controlled to move the collet holder 41 to the upper side of the unused collet 40 . after discarding , the bonding head 35 is only moved from the discarding unit 56 to the supplying unit 51 in the lateral direction . thereafter , the collet holder 41 is allowed to descend to grasp the unused collet 40 while covering the whole , and the unused collet 40 is held by the magnet 41 j . since the four corners of the collet holder 41 are cut in a triangle shape , the collet can be held without interfering with the fixing claws 51 t . next , as shown in fig7 , the collet 40 is rotated by the bonding head 35 in the counterclockwise direction by θ from the state of fig5 to be separated from the fixing claws 51 t . then , the bonding head 35 is lifted , and the attachment of the collet 40 is confirmed by the method shown in the first embodiment . thereafter , the process is moved to the following operation . next , a method of discarding a used collet 40 to the discarding unit 56 will be described using fig8 and fig9 . in the case of discarding , procedures opposite to the case of supplying an unused collet are performed . specifically , the bonding head 35 is first controlled to move the collet 40 to the upper side of the opening portion 56 k of the discarding unit 56 . thereafter , the collet 40 is rotated in the counterclockwise direction by θ so that the diagonal positions of the collet 40 do not interfere with the fixing claws 56 t , and the state shown in fig8 is realized . next , the collet 40 is allowed to descend using the bonding head 35 to be inserted into the opening portion 56 k , and the collet 40 is rotated in the counterclockwise direction by θ . then , the diagonal positions of the collet 40 are moved to the lower side of the fixing claws 56 k , and the state shown in fig9 is realized . thereafter , by pressing the diagonal positions of the collet 40 with the fixing claws 56 t , the bonding head 35 is lifts the collet to overcome the holding force of the magnet 41 j in order to detach the collet 40 from the collet holder 41 . the collet 40 falls into the waste housing unit under the opening portion . then , the bonding head 35 is moved to the side of the supplying unit 51 to hold an unused collet 40 , and the above - described procedures are performed . in the above - described embodiment , the fixing claws are provided at the diagonal positions . avoiding portions 41 c cut in a triangle shape are provided at the diagonal positions of the collet holder 41 corresponding to the fixing claws in order to avoid the fixing claws . the positions of the fixing claws are not limited to the diagonal positions , but may be other positions . for example , the fixing claws are provided at the middle positions of the opposite two sides , and the shape of the avoiding portions 41 c may be set in the middle portions of the collet holder 41 corresponding to the fixing claws so as not to interfere with the fixing claws by the rotation of the collet holder . to put it in an extreme way , a trapezoidal portion on the shorter side of the collet holder shown in fig4 may be cut . in this case , it is necessary to position in the longitudinal direction . for example , convex portions are provided in the longitudinal direction of the collet holder for positioning , and concave portions may be provided at the corresponding positions of the collet . even in the above - described embodiment , the avoiding portions 41 c may not be in a triangle shape . for example , the avoiding portions 41 c may be in a rectangular shape or ¼ circular shape . in the above - described embodiment , the collet replacing unit 50 is provided at one position . however , the collet replacing unit 50 may be installed at any position in a movable range of the bonding head as long as a mounting process is not affected , and plural collet replacing units 50 may be installed . in this case , the collet replacing units 50 may be provided for different die sizes . further , even if the die sizes are different , the outer shape of the collet may be standardized so as to be held by the common collet holder . according to the above - described second embodiment , plural unused collets 40 are orderly stacked and housed , so that a stock area can be narrowed . further , according to the above - described second embodiment , the collet replacing unit 50 can be downsized by accessing the supplying unit 51 and the discarding unit 56 from the upper side , and a replacement area including the stock area can be narrowed . further , according to the above - described second embodiment , the collet 40 can be attached or detached to / from the collet holder 41 ( bonding head 35 ) with a simple structure in which the fixing claws 51 t and 56 t are provided at the opening portions 51 k and 56 k of the supplying unit 51 and the discarding unit 56 , respectively , and the magnet 41 j is provided at the collet holder 41 . next , a second example of the collet replacing unit 50 as a third embodiment of the collet replacing unit 50 will be described using fig1 . the third embodiment is different from the second embodiment in the following two points , and the other points are the same . first , the collet 40 is detached from the collet holder 41 by the rotation of the fixing claws 51 t and 56 t and the collet 40 in the second embodiment . in the third embodiment , movable claws 52 t and 57 t are provided at the positions where the fixing claws 51 t and 56 t exist . by moving the movable claws 52 t and 57 t with shape - memory alloy springs 52 b and 57 b , respectively , the collet 40 is attached or detached to / from the collet holder 41 . the shape - memory alloy springs 52 b and 57 b release the holding of the collets 40 by shrinking the springs when current flows . thus , it is not necessary to rotate the collet when the collet 40 is attached or discarded in the third embodiment . second , as similar to the first embodiment , when the collet 40 is pushed up by the compression spring 51 b in the supplying unit 51 in the third embodiment , the movement of the movable claw 52 t causes a collet for replacement to protrude . in order to prevent this , when the collet 40 is replaced in the third embodiment , the stretch of the compression spring 51 b is fixed by a pulse motor ( not shown ), and the fixing by the pulse motor is released when the movable claw 52 t holds the collet . specifically , the pulse motor that fixes the stretch of the compression spring 51 b configures protrusion prevention means . in this case , using a pulse motor or a servo motor as moving means of the stacked unused collets , the collet is moved by the pulse motor or the servo motor by the height of the collet to serve as protrusion means , so that the movable claws 52 t can be eliminated . this point can be applied to the second embodiment , and the fixing claws 51 t can be eliminated . it should be noted that there are various driving methods of the movable claws 52 t and 57 t . for example , the movable claws 52 t and 57 t may be driven by a cylinder or a motor . next , an embodiment of the collet descent distance correcting unit 60 and a collet descent distance correcting method will be described using fig1 . the collet descent distance correcting unit 60 includes a collet height measuring unit 61 that measures changes of the height of the collet , and a control device 4 that corrects the descent distance of the collet , namely , the bonding head 35 on the basis of the measurement result by the collet height measuring unit . the collet height measuring unit 61 is a commercial sensor configured using a light emitting unit 61 h and a light receiving sensor 61 j . the collet height measuring unit 61 is fixed to the die bonder structure unit while being adjacent to the collet replacing unit 50 or the collet replacing unit 50 . the light emitting unit 61 h emits light 61 b with a certain bandwidth to the light receiving sensor 61 j , and the light receiving sensor 61 j can measure the length h of a light receiving unit or the length of a light - blocking unit in a unit of nm . a collet descent distance correcting method by such a collet descent distance correcting unit 60 will be described . the collet 40 is allowed to descend to a certain position of the collet descent distance correcting unit 60 . when the length of the light receiving unit of the collet 40 before collet replacement is hb and the length of the light receiving unit of the collet 40 after collet replacement is ha , the height change δh of the collet 40 is represented as the following formula ( 1 ). the descent distance bh of the bonding head 35 when the die d is picked up or is attached to the substrate is corrected only by the height change δh of the collet 40 . the correction may be done by using previous descent distance bhb or a standard descent distance bh . according to the above - described fourth embodiment , variations in the height of the collet at the time of manufacturing can be corrected in a unit of nm , and the die can be picked up and mounted to the substrate or the like without an adverse effect on the die such as destruction in the worst case . next , a bonding flow in the embodiment will be described using fig1 . in the first place , a collet 40 is attached to the bonding head on the basis of the collet attachment method shown in the second or third embodiment ( s 1 ). the attachment of the collet 40 is confirmed on the basis of the first embodiment ( s 2 ). if the attachment of the collet cannot be confirmed , s 1 is performed again . next , the descent distance of the collet is corrected on the basis of the fourth embodiment ( s 3 ). thereafter , the die d is mounted ( s 4 ). during the mounting , time of replacing the collet 40 is determined ( s 5 ). if replacement is necessary , the flow is moved to s 1 to replace the collet 40 , and the processes after s 2 are continued . finally , it is determined whether or not a predetermined mounting process is completed , and the process is completed ( s 6 ). as a method of confirming the attachment in the flow , optical means provided at the die bonder to confirm the posture of the die may be used without using the method of the first embodiment . according to the above - described fifth embodiment , a bonding method with a high operation ratio can be realized . according to the above - described first to fourth embodiments , a die bonder and a bonding method with a high operation ratio can be provided . the embodiments of the present invention have been described above , and various alternative , modified , or converted examples are available for those skilled in the art on the basis of the above description . the present invention includes various alternative , modified , or converted examples without departing from the gist of the present invention . | 8 |
a typical prior art cordless telephone system is shown in fig1 to include a portable unit 10 and a base unit 12 . when the hand set 13 of the portable unit 10 is removed from its cradle ( not shown ), switch 14 closes to apply power to the transmitter 16 and tone generator 18 . the transmitter 16 transmits a carrier , which may , for example , be 17 mhz and this signal is modulated by the tone from generator 18 applied through the interrupter contacts of a dial 20 . as an example , the tone signal may be 5000 hz . the frequency modulated signal from transmitter 16 is received by the receiver rc of base unit 12 . the dialing tone is detected by the tone decoder s 1 coupled to receiver rc and which in turn actuates a line relay rl through a controller or gate g whereby line relay contacts 30 are closed to connect the base station 12 to the telephone line 32 through line interfacing circuit t which may be , for example , a hybrid transformer . when the portable unit dial 20 is dialed , the dialing tone is interrupted in accordance with the dial contacts repeated opening and closing whereby the energizing circuit to the line relay rl is similarly interrupted . in this manner , the contacts 30 open and close to provide dialing pulses to the line l . voice transmission from the portable unit 10 is transmitted through handset transmitter 36 , amplifier modulator 38 , transmitter 16 , and to the receiver rc of base unit 12 for amplification by audio amplifier a which is connected to line 32 through circuit 34 . when ringing voltage appears in telephone line l , any suitable circuit device responsive to ringing voltage , such as an opto - isolator circuit 41 couples a ring detector circuit 42 to line l for detecting peak voltage levels . the ring detector circuit 42 enables a tone generator 44 which in turn modulates the signal from the base unit transmitter 46 . the base unit carrier wave will be transmitted at a different frequency than the portable unit , such as 27 mhz , for example , while the modulating signal may be 1700 hz , for example . this modulated signal is transmitted to the portable unit receiver 47 for being sensed by the tone detector 48 which energizes a bell 50 through electronic switch 52 . when the call is answered by lifting the portable unit handset 13 from its cradle , the line relay rl is energized as discussed above to close contact 30 thereby signaling the telephone line to remove the ringing voltage as in any normal telephone system . simultaneously , the portable cradle switch 14 removes the supply voltage from the tone detector 48 and energizes the portable unit receiver 48 to accommodate normal voice communication . voice communication received from telephone lines l is applied by line interfacing circuit 34 through audio amplifier 54 for modulating the signal from transmitter 46 and this transmitted signal is received by portable unit receiver 48 which is coupled to the handset receiver 56 through audio amplifier 58 . voice transmission from the handset transmitter 36 is summed with the tone from generator 18 in amplifier modulator 38 and this composite signal modulates the signal from transmitter 16 to produce wave propagation to the base unit receiver rc which is coupled to line l through audio amplifier a . fig2 shows a portion of the base station 12 which incorporates the present invention . in addition to the components of this portion of the circuit illustrated in fig1 the embodiment of fig2 includes a second tone detector circuit s 2 , a delay circuit d and a reset circuit rs . the tone detector s 2 is similar to tone detector s 1 although it is preferably adjusted to detect a different tone signal than the tone detector s 1 . it will be recalled that in the embodiment of fig1 the tone generator 18 is coupled through dial 20 to the amplifier modulator 38 so that the tone signal from generator 18 is employed to modulate the carrier wave transmitted by transmitter 16 . the portable unit employed with the embodiment of fig2 would be substantially the same as that illustrated in fig1 except a second tone generator ( not shown ) is connected directly to the amplifier modulator 38 while the first tone generator 18 is connected through the dial 20 . preferably , the two tone generators used in the portable unit to be employed in connection with the embodiment of fig2 would be of a type capable of generating tone signals within a very narrow band , such as , for example , tuning fork reeds . these signals provided by the two tone generators would preferably be different frequency signals which would each modulate the carrier frequency . the detector s 1 is tuned so that it detects the first tone signal , that is the one not subject to dialing pulsing interruptions while the detector s 2 detects the tone signal associated with the dial 20 . accordingly , each of these tone signals is employed to modulate the carrier wave and is transmitted automatically when the portable unit handset is taken off its cradle to open the hook switch . the gate g is preferably an and gate such that when tone signals are detected by s 1 and s 2 the and gate is operative to actuate relay rl which in turn closes contacts 30 so that the system is connected to the telephone line l . a feedback circuit f is provided for maintaining the gate g in an enabled condition so that the line relay rl will remain energized should the signal to s 1 be lost . for this purpose , the delay circuit d and the reset circuit rs are provided for resetting the and gate should the tone signal detected by both circuits s 1 and s 2 be interrupted . the interruptions of the signal detected by s 2 which is occasioned by dialing will cause opening and closing of the contacts 30 in the manner discussed with respect to fig1 . fig3 shows the circuitry of fig2 in greater detail . the gate g may comprise an and gate consisting of transistors tr 1 and tr 2 . when the first signal is detected by tone detector s 1 , an output is provided through converters ic 1 and ic 2 to the base of transistor tr 1 . if a second tone signal is detected by tone detector s 2 , a positive signal is applied to the base of transistor tr 2 . as a result , both transistors tr 1 and tr 2 become conductive to provide a signal to relay rl for closing contacts 30 . if at this time , the s 2 signal is interrupted , such as occurs during dialing on the portable unit , the relay contacts 30 are interrupted so that the dialing pulses will be transmitted to line l in the manner discussed with respect to fig1 . because of the cascade connection of the ic 1 and ic 2 converter circuits and the feedback circuit consisting of resistor r 2 and diode d 4 , once the output of ic 2 becomes positive , this output signal will remain even if the output of tone detector s 1 is interrupted . as a result , so long as an output signal exists from tone detector s 2 , the relay rl will remain energized and communication to the telephone line l may continue . the signal s 2 may be , for example , about 5 khz so as not to interfere with the lower voice frequency of telephone communication . the audio amplifier a , which is shown in fig1 and 2 but not in fig3 is provided with a narrow band pass filter or phase synchronous circuit to eliminate the tone signal generated by the portable unit into which the tone detector s 2 is responsive . as indicated above , the function of the reset circuit rs is to de - energize the relay rl when the tone signal to detector s 2 terminates . specifically , when the output signal from tone detector s 2 ceases , the base voltage of transistor tr 3 disappears after a predetermined time delay dictated by the resistor r 1 and the capacitor c 1 of delay circuit d . on this event , the voltage of the junction of transistor tr 4 emitter and resistor r 3 disappears so that the input voltage of ic 1 becomes zero and the output voltage of ic 2 similarly goes to zero . in this manner , the converter circuit ic 1 and ic 2 is reset and will remain in this condition so long as a positive signal does not return to its input . the delay circuit d consisting of capacitor c 1 and resistor r 1 are provided so that the converter circuit is not reset when the s 2 input is pulsed or interrupted in the case of dialing . in this manner , during dialing the converter circuit is not reset so that the delay circuit restores the converter circuit only when the s 2 output had disappeared for a fixed time which is greater than the time between dialing pulses . in the system illustrated in fig3 the s 2 signal of about 5 khz is applied constantly during a period of the telephonic communication , and therefore this signal sound may be disadvantageously leaked and heard in the telephonic communication in the event of poor performance of the eliminating filter of the receiving unit , component change or the other reasons . it will be appreciated that the s 2 tone signal and the carrier wave signal always exist simultaneously . since the modulated 5 khz wave signal never exists when the carrier wave does not exist , and because the 5 khz signal always corresponds to the carrier wave signal , the carrier wave may be used instead of the 5 khz signal without interference in the audio system . in addition , when the carrier wave is used instead of the 5 khz signal , there will be no interference as the result of jamming and disturbance waves . first , when there is no telephonic communication between the portable telephone and the receiver when an interfering wave is received having approximately the same frequency to which the receiver rc is tuned , an output is produced in the tone decoder s 2 . however , because the s 1 tone signal does not exist , so that the gate g is not operated , the interference is of no consequence . in the case where the interference signal is received during established telephonic communication , an output has been already produced in the tone detector s 2 in the manner indicated above so that the transistor tr 1 in fig3 is in a conductive condition . hereupon , even if the disturbing or interfering wave is further added , the operation of the tr 1 remains as it is , and again , no change is caused by the interference . the same results occur regardless of whether the disturbance wave is steady or intermitted . it will be appreciated , therefore , that it is possible to use the carrier wave for the s 2 detected signal , and further this proposed system produces excellent results as will be described hereafter , in comparison with a system using the specific signal , for example , the 5 khz wave modulating signal . specifically , in considering the case where an interfering or disturbance wave exists , when the disturbance wave signal is especially large in the system using the 5 khz wave modulation signal , the signal is suppressed , and the 5 khz multiple restored signal is decreased so the transistor tr 1 in fig3 may become nonconductive . in this case , undesirably the telephonic communication is not only interfered with but also the circuit may be cut off . however , as is apparent from the foregoing discussion , such an interference will have no effect in the system using the carrier wave . furthermore , in this system , the additional tone generator in the portable unit 10 for the s 2 signal as well as the s 2 signal filter of the receiving unit audio amplifier a are not required , thereby reducing costs . a disadvantage in using the carrier wave as the s 2 signal in the embodiment of fig3 results from the fact that if a disturbance wave of about the same frequency as the carrier signal is received during dialing , misdialing will result . specifically , when an output is produced in the selector s 1 by the first signal , the relay rl is operated to connect the system to the line . if , while the carrier wave , i . e . the s 2 output is intermitted during dialing , a disturbance wave is also received , an output is produced in the selector s 2 so that the s 2 output is not disconnected in response to the dialing , whereby a wrong number may be called or the dialing disabled . these defects are alleviated in the embodiment of the invention shown in fig4 . here a pair of tone detection circuits s 1 &# 39 ; and s 1 &# 34 ; are provided in addition to the tone detector s 2 . detector s 1 &# 34 ; is connected to the radio receiver rc through a gate ga while the second tone detector s 1 &# 39 ; is connected to the radio receiver rc and to gate ga which is operative for a fixed time after receiving an enabling signal from detector s 1 &# 39 ;. the signal received from the portable unit and which is initiated when the handset is elevated , consists of the carrier frequency modulated by a combined frequency signal with the detector s 2 tuned to the carrier frequency while the detectors s 1 &# 39 ; and s 1 &# 34 ; are each tuned to one of the frequencies of the combined modulating frequency signal . in addition , the frequency signal to which the detector s 1 is tuned is interrupted during dialing . gate ga is of a type that remains conductive so long as an input exists once turned on by a triggering signal so that the signal to detector s 1 &# 34 ; will continue even though the signal from s 1 &# 39 ; is interrupted by the dialing operation . when the portable unit handset is lifted from its cradle to provide the carrier frequency and the combined modulating frequency , the carrier wave is detected by s 2 which energizes transistor tr 2 while the first portion of the combined frequency is detected by s 1 &# 39 ; which enables gate ga so that tone detector s 1 &# 34 ; can detect the other portion of the modulating frequency to set transistor tr 1 whereby line coupling occurs in the manner discussed above . transistor tr 4 is biased such that when a signal appears on the output of detector s 1 &# 39 ;, transistor tr 4 becomes nonconductive . however , during dialing , the s 1 &# 39 ; portion of the modulating frequency is interrupted so that transistor tr 4 becomes conductive , thereby connecting diode d 1 to ground so that transistor tr 2 is turned off and the line contacts 30 are opened . accordingly , whenever the interruption of the tone detected by detector s 1 &# 39 ; is interrupted , transistor tr 2 is turned off regardless of whether s 2 detects an interference signal . when the combined frequency portion of the signal is detected by s 1 &# 39 ; between dialing pulses or when dialing is completed , transistor tr 4 will be turned off so that transistor tr 2 may be turned on to complete line coupling . accordingly , if the tone detector s 2 receives an interference signal during dialing , it will have no effect upon the dialing operation . further , because gate ga will continue to provide the tone signal to s 1 &# 34 ; after initially being enabled by the signal from s 1 &# 39 ;, the interruption of the s 1 &# 39 ; signal will have no effect on the operation of transistor tr 1 . those skilled in the art will appreciate that the portable unit illustrated in fig1 requires modification in a well - known manner when employed with the embodiment of fig4 to provide the output signal consisting of a carrier wave and a modulating wave consisting of two frequencies in combination , one of which is interrupted during dialing . while only a few embodiments in the invention have been illustrated and described , it is not intended to be limited thereby but only by the scope of the appended claims . | 7 |
in the fig1 two elevators of a elevator group are designated by c and d . wherein each elevator includes a car 2 guided in an elevator shaft 1 and driven by a hoist motor 3 by way of a hoisting cable 4 . in this example , fifteen floors e0 and e14 are served by the cars . the hoist motor 3 is controlled by a drive control , such as the control shown in the european patent no . ep - b 0 026 406 , wherein the target value generation the regulation functions and the stop initiation are realized by means of a microcomputer system 5 . the system 5 is connected to measuring and adjusting elements 6 of the drive control . the microcomputer system 5 computes a sum which is also called operating costs corresponding to the waiting time of all passengers and this sum is made the basis of the call allocation procedure , as is for example shown in the application ep - a 0 356 731 mentioned above . the car 2 includes a load measuring device 7 which is connected with the microcomputer system 5 . call registering and indicating devices 8 , which are for example shown in the previously identified application ep - a 0 320 583 and which have decade keyboards , are provided on the floors by which calls for travels to desired target floors can be entered . the call registering and indicating devices 8 are connected by way of an address bus ab and a data input conductor dl with the microcomputer system 5 . the call registering and indicating devices 8 of a floor are connected together and can be associated with more than one elevator of the group wherein , for example , those connected to the elevator c are connected by way of coupling members in the form of multiplexers 9 to the microcomputer system 5 of the elevator d . the microcomputer systems 5 of the individual elevators of the group are connected together by way of a comparison device 10 , which is shown in the european patent no . ep - b 0 50 304 , and a party line transmission system 11 , which is shown in the european patent no ep - b 0 050 305 , and together with the call registering and indicating devices 8 form a group control similar to the control shown in the aforementioned application ep - a 0 356 731 . the call registering and indicating devices 8 are furthermore connected by way of conductors l to the microcomputer systems 5 as described below . a signal by which the microcomputer systems 5 can identify an actuated call registering and indicating device 8 can be transmitted by way of the conductors l . the portion of the microcomputer system 5 , illustrated schematically in the fig2 and which is associated for example with the elevator a . includes a floor call memory ram1 and a first and a second call allocation memory ram2 and ram3 respectively . for each direction of travel , the memories possess storage places corresponding to the number of the floors ; however only the memories associated with the upwards calls are illustrated . the floor call memory ram1 consists of a first and a second memory portion , ram1 . 1 and ram1 . 2 respectively , wherein the calls identifying the entry floors are stored in the first memory portion ram1 . 1 and the calls identifying the target floors are stored in the second memory portion ram1 . 2 . the first allocation memory ram2 is associated with the first memory portion ram1 . 1 and the second allocation memory ram3 is associated with the second memory portion ram1 . 2 . an operating costs register for the storage of the operating costs is denoted by r1 and a car position register is denoted by r2 . a selector r3 in the form of a another register generates addresses which correspond to the floor numbers and by means of which the storage places of the memories ram1 . 1 , ram1 . 2 , ram2 and ram3 can be addressed . while the selector r3 indicates that floor at which the travelling car 2 could still stop , the car position register r2 indicates that floor in the region of which the car 2 is actually situated . the floor call memory ram1 , as well as the first and second call allocation memories ram2 and ram3 , are read - write memories which are connected with a bus sb of the microcomputer system 5 . memories 12 13 and 14 which are shown in the patent application ep - a 0 356 731 identified above are read - write memories in which data for the operating costs computation are stored load values in the form of a number of persons are stored for each floor in the load memory 12 . such persons are situated in the respective car during a future stop or the travel past a floor , and the number can be calculated on the basis of the entered calls . in this case , load values formed from faulty call entries can be corrected through comparison with the values ascertained by the load measuring device 7 . the door opening and closing times of the elevator concerned are stored for each floor in the door time memory 13 , while the traveling times of the elevator car between each floor and each other floor are stored in the traveling time memory 14 . denoted by 15 is an additional memory which is connected with the bus sb and in which are stored the times needed by a passenger at a floor for traversing the paths between the respectively actuated call registering and indicating device 8 and the shaft doors of the elevators . a comparator 16 , which is for example formed by the processor of the microcomputer system 5 , has inputs connected with the travelling time memory 14 and the additional memory 15 . the operating costs register r1 is connected through a switching device 17 in the form of a tri - state buffer with the comparison device 10 , wherein an activating lead of the tri - state buffer is connected to an output of the comparator 16 . the elevator shaft doors of the elevators a b , c and d of an elevator group shown by way of example in the fig3 are denoted by 18 for a particular floor . the shaft doors 18 can have the same spacings between adjacent pairs and the call registering and indicating devices can be located in the center between each two adjacent shaft doors . the empirically derived time which a passenger needs for the travel along a path between the call registering and indicating device 8 actuated by him and the adjacent one of the shaft doors 18 is denoted by &# 34 ; t &# 34 ;. in the arrangement shown in the example of fig3 a passenger would need a time of &# 34 ; 5t &# 34 ; to move to the indicated shaft door 18 upon allocation of the elevator d in response to the actuation of the call registering and indicating device 8 positioned between the elevators a and b . the additional memories 15 , associated with the elevators a , b . c and d as shown in the fig4 include a number of storage places corresponding to the number of call registering and indicating devices 8 provided on a floor . corresponding to the arrangement shown in the fig3 the additional memories 15 each have three storage places which are denoted in the sequence of the elevators by ab , bc and cd . the stored times entered in the fig4 result from the definition of the time &# 34 ; t &# 34 ; given in the description relating to fig3 wherein the time &# 34 ; 5t &# 34 ; mentioned by way of example is to be found in the storage place ab of the additional memory 15 associated with the elevator d . denoted by 20 in the fig5 are multiplexers which are associated with the elevators and the call registering and indicating devices 8 of a floor and which have a number of inputs corresponding to the number of call registering and indicating devices 8 located on a floor . the inputs of all of the multiplexers 20 associated with the same call registering and indicating device 8 are connected together . one input of each of the multiplexers 20 is connected with an output of an associated and gate 21 . inputs of the and gate 21 are connected to inverting outputs q of storage cells 22 of the associated call registering and indicating devices 8 . the multiplexers 20 are connected to the address buses ab of the associated microcomputer systems 5 and at an output are connected ( fig2 ) by way of the conductor l with the additional memory 15 of the associated microcomputer system 5 . the noninverting outputs q of the storage cells 22 are , as is known from the application ep - a 0 320 583 previously mentioned or european patent no . ep - b 0 246 395 , connected with inputs of multiplexers 23 associated with the respective call registering and indicating devices 8 for the interrogation of calls entered on a floor . the above described elevator group control operates as follows : after entry of a call , for example according to the data shown in the fig2 a call on the floor e10 for the floor e13 , a call identifying the entry floor is transferred into the first memory portion ram1 . 1 and a call identifying the target floor is transferred into the second memory portion ram1 . 2 of the floor call memories ram1 of all of the elevator cars . thereafter , the multiplexers 20 are interrogated for which it is assumed that the call from the floor e10 was entered by means of the call registering and indicating device 8 located between the elevators a and b . in this case , the output of the associated and gate 21 and thereby also the inputs of all of the multiplexers 20 associated with the actuated call registering and indicating device 8 become logic &# 34 ; 0 &# 34 ; ( fig5 ). upon the generation of the address associated with the respective input , the microprocessors of the microcomputer systems 5 interpret the signal &# 34 ; 0 &# 34 ; which is then carried on the conductors l as requiring that the content of the storage place ab of the additional memory 15 must be applied to the one input of the comparator 16 ( fig2 and 4 ). thereafter the associated travelling time is read from the travelling time memory 14 , in dependence on the car position contained in the car position register r2 and the address of the call entry floor e10 , and is applied to the other input of the comparator 16 . let it now be assumed that the travelling time of the car of the elevator d is less than the time &# 34 ; 5t &# 34 ; stored in the storage place ab of the additional memory 15 . in this case , the logic state at the output of the comparator 16 changes in such a manner that the switching device 17 is switched into a high resistance state and the operating costs register r1 is disconnected from the comparison device 10 . after the load values of the load memory 12 have been corrected in accordance with the newly entered call on the floor e10 , the operating costs for the entry and target floors of the new call are computed for all elevators , for which a formula is used for example which is disclosed in the previously identified application ep - a 0 356 731 . in this case , it is presumed that due to the possible new stops taking place at the entry and target floors not only the waiting times of the new passengers would be created , but also the waiting times of all traffic participants of already allocated calls of the elevator concerned would be increased . as already mentioned in the preceding , the computer takes door opening and closing times from the door time memory 13 , the number of the persons already situated in the car from the load memory 12 and the travelling times of the car from the instantaneous position to the entry or target floor from the travelling time memory 14 for the operating costs computation . immediately after the computation , the operating costs are transferred into the operating costs register r1 and are compared with the operating costs of the other elevators by means of the comparison device 10 , according to the method shown in the previously identified patent ep - b 0 050 304 , wherein the elevator d is excluded from the comparison as described in the preceding . let it now be assumed that the elevator a displays the lowest operating costs so that an allocation instruction is entered ( dashed arrows , fig2 ) for floor e10 in the first call allocation memory ram2 and for the floor e13 in the second call allocation memory ram3 . immediately after the allocation , the selected elevator a and its position are indicated in an indicating field of the call registering and indicating device 8 actuated by the passenger whereupon the passenger moves to the correspondingly identified shaft door 18 and arrives there before the car arrives . if the selector r3 , in continuation of an assumed upward travel of the car situated for example in the region of the floor e4 , switches over to the newly allocated floor e10 , then the stopping of the car is initiated on reaching the brake onset point according to the drive control described in the previously identified patent ep b 0 026 406 for example . in accordance with the provisions of the patent statutes the present invention has been described in what is considered to represent its preferred embodiment . however , it should be noted that the invention can be practiced otherwise than as specifically illustrated and described without departing from its spirit or scope . | 1 |
as shown in fig1 a , a system and method 100 according to our invention decomposes time series network traffic data arrival rate information 101 into multiple frequency bands . the frequency bands are used to identify low and high frequency components in the data arrival rate . an energy distribution in each frequency band is determined in order to analyze 1050 short and long term fluctuations in the network traffic . we use the output of the analysis to dynamically allocate 800 bandwidth for data streams transmitted by the network 102 . our unique energy distribution analysis enables better predictions of the bandwidth requirements than prior art techniques . our method is applicable to both aggregate and individual applications traffic . our method can be used to distribute an available bandwidth among multiple traffic data streams based on their frequency characteristics . more specifically , our invention can be deployed in weighted fair queuing ( wfq ) processes to adaptively update weight coefficients of each traffic class entering into the vfq process . our invention can be used in quality - of - service ( qos ) management blocks of network routers , switches , digital subscriber line access multiplexer ( dslam ), and the like . as shown in fig1 b , the system 100 according to our invention includes a clock 110 connected to a data counter 120 . the data counter receives the incoming network traffic ( data ) 101 . the network traffic is also presented to an output queue or buffer 105 . the output of the data counter 120 is connected to a shift register 130 of size m , for example eight . the shift register 130 is connected to a discrete wavelet transform unit ( dwt ) 200 , e . g ., a haar wavelet filter bank . specifically , we use a haar - 2 basis . an analyzer 140 processes the output of the dwt 200 . the output of the analyzer is connected to resource allocation mechanism ( ram ) 800 . the ram 800 can also receive optional feedback parameters , e . g ., buffer statistics 801 , from the buffer 105 and a minimum non - zero value x dc 132 from 130 . the output 809 from the ram 800 drives a dynamic bandwidth controller ( dbc ) 900 , which in turn , decides whether to start a renegotiation cycle with the network 102 based on the new prediction information and the comparison of previous and current variance and mean of the energy distribution in the sub - bands and sets a renegotiation flag . the dbc starts a renegotiation cycle with a network according to values of the renegotiation flag , e . g . renegotiate if the flag is one . if no renegotiation is decided , the dbc waits for the next prediction from the ram 800 . the dbc is also responsible for forwarding the buffered traffic onto the network 102 at the current negotiated data rates . ∑ n δ ( t - nt ) , during each time interval , the amount of data ( x n ) 121 that is received at qos management block is measured by in the data counter 120 . the measured data 121 can be bits , bytes , packets , cells , etc . as shown in fig7 for a thirty second mpeg - 4 video trace 401 where the x - axis 402 is the index of frames transmitted and the y - axis 400 is the frame sizes in bits . the amount of data received in a given fixed length time interval essentially gives the instantaneous data rate during the interval . the most recent m values of the measured data rate are buffered in the shift register 130 as an integer vector x k =[ x ( n − m + 1 )×( n − m + 2 ) . . . x ( n )] 131 and also the minimum non - zero sample 132 of the integer vector 131 is determined . [ 0041 ] fig3 graphs data arrival rates 301 for consecutive time intervals where each vector x has n elements . in the vector 131 , n is a time instance , k is a time scale , and m is an integer , e . g ., eight samples . each element x ( i ) indicates the amount of data , e . g ., bytes , received in a time slot i . for two consecutive time instances , the arrival rate information can be expressed by their sum and their difference . the difference reveals sharp changes in the arrival rate . an average arrival rate vector including m consecutive time slots is x k + 1 = ½ ./[ x ( n − m + 1 )+ x ( n − m + 2 ) x ( n − m + 3 )+ x ( n − m + 4 ), . . . x ( n − 1 )+ x ( n )] ( 1 ) difference of the arrivals of data between two consecutive time slots is denoted by a vector y k + 1 such that y k + 1 = ½ ./[ x ( n − m + 1 )− x ( n − m + 2 ) x ( n − m + 3 )− x ( n − m + 4 ), . . . x ( n − 1 )− x ( n )] ( 2 ) equations 1 and 2 can be rewritten in the general form x k + 1 ( i )= 0 . 5 ( x k ( 2 i − 1 )+ x k ( 2 i )), and ( 3 ) y k + 1 ( n )= 0 . 5 ( y k ( 2 i − 1 )− y k ( 2 i )). ( 4 ) we are interested in the dynamic behavior of the traffic as manifested by differences between consecutive samples . the data measuring steps can produce zero and positive integer values . wavelet domain modeling of positive processes requires that a positive output is ensured . to guarantee that a process is positive , a sufficient and necessary condition is | y k , n ( i )|≦ y k , n ( i ). the haar wavelet satisfies this constraint . therefore , we use the haar - 2 wavelet . however , any wavelet satisfying the above condition can be used in the dwt block 200 . therefore , as shown in fig2 we pass the buffered arrival rate vector x k , n 131 through a dyadic tree of scaling filters 210 and wavelet filters 220 , where each branch produces a low frequency component x k + 1 211 , and 212 , 213 respectively and a high frequency component x k + 1 221 of x k , n and further 222 and 223 . the output of each scaling filter 210 is down - sampled 230 by a factor of two . in other words , the output of each scaling vector 210 generates pair - wise average arrival rate vectors 211 , 212 and 213 , and the output of the each wavelet filter 220 generates pair - wise rate arrival differences 221 , 222 and 223 . the scaling and wavelet coefficient vectors of the haar wavelet are φ =[ 1 /{ square root }{ square root over ( 2 )} 1 /{ square root }{ square root over ( 2 )}] and φ =[ 1 /{ square root }{ square root over ( 2 )}− 1 /{ square root }{ square root over ( 2 )}], respectively . we know that for ∀ n , k , all x k ( n )≧ 0 . as stated above , wavelet domain modeling of positive processes requires the constraint that a positive output is ensured . to guarantee the constraint that the process is positive , the sufficient and necessary condition is | y k ( n )|≦ x k ( n ). the provision of this constraint for the haar wavelet is seen by modifying equations 3 and 4 such that x k ( 2 i − 1 )= 2 − ½ ( x k + 1 ( i )+ y k + 1 ( i )), and ( 5 ) x k ( 2 i )= 2 − ½ ( x k + 1 ( i )− y k + 1 ( i )). ( 6 ) the haar wavelet coefficients of a stationary signal are identically distributed with e [ y k ( n )]= 0 for ∀ k . therefore , applying the discrete haar wavelet transform 200 on the measured arrival rate data 131 reveals irregularities and sharp changes in traffic behavior . having r as a m × m wavelet transform matrix composed of parameters of vectors φ and φ , and x as the vector data with length m , the wavelet transform operation can be expressed as w = x . r , where w is the wavelet transform vector with size m . dwt block outputs vector w 600 energy of a stochastic process x at scale k can be determined from w 600 by e k = ∑ n = 2 k - 1 + 1 2 k w _ ( n ) 2 , k : scale index . ( 7 ) energy distribution in multi - resolution analysis provides information about the level of traffic burstiness and self - similarity . therefore , consideration of energy contents of a signal at different time scales in the dynamic bandwidth allocation method according to the invention has strong advantage over prior methods to prevent the impacts of traffic self - similarity . we define two moving windows : a “ data unit ” and a “ wavelet unit .” a moving data unit 650 illustrated in fig6 b , covers eight most recent measured data arrival rate samples 131 to be analyzed . each window of samples x 650 overlaps a previous window as shown in fig6 b between two consecutive measurements . in fig6 a , our wavelet transformed data vector w 600 uses a window of eight samples , the same size as of “ the data unit ” so that our multi - resolution process can respond to sudden changes in data rates . the area covered by this window is denoted as a “ wavelet unit ,” wu . we use the wavelet unit w = rx =[ w 1 w 2 w 3 w 4 w 5 w 6 w 7 w 8 ] the analyzer 140 takes the vector w 600 produced by the dwt 200 as input , and then computes and forwards the energy information 141 in each sub - band to the ram 800 . energy of the stochastic process x at scale k in the dyadic tree is determined by equation 7 , and yields energy vector e n [ e 1 , n , [ e 2 , n , . . . , [ e k , n ] 141 . as shown in fig5 energy 501 in each scale 510 - 513 is found by applying equation 7 to the wavelet transform unit vector w 600 . the x - axis 502 is in units of radians . scale 513 reveals the highest frequency detail within the original traffic data . the detail is expressed by four coefficients . the detail in scale index 512 is assigned to two coefficients . the first two element 511 and 510 in vector w 600 stands are assigned one element of coarser scales . the sum of the energies in each frequency band is bounded by the total energy of original data x . strong empirical evidence contends that the wavelet coefficients from 1 / f processes are weakly correlated both along and across the scales . abry et al ., in “ wavelet analysis of long range dependent traffic ,” ieee trans . inform . theory , v : 44 , pp . 2 - 15 , jan . 1998 , and sahinoglu et al ., in “ self - similarity and its effects on network performance ,” ieee comm . magazine , january 1999 , describe that for the haar wavelet , the variance progression of the wavelet transform of fractional gaussian noise satisfies var ( w k ( n ))∝ 2 − k ( 2h − 1 ) . the ratio of the energies in two subsequent scales can then be related to the hurst parameter h as γ = var ( w k ( n ) ) var ( w k + 1 ( n ) ) = 2 2 h - 1 , see r . riedi , m . s . crouse , v . j . ribeiro , r . g . baraniuk , “ a multifractal wavelet model with application to network traffic ,” ieee trans . on information theory , v : 45 , n : 3 , april 1999 . the stability of the arrival rate is proportionally related to the increase in this ratio . we define and use the following properties of frequency and energy distribution in the ram 800 . if for ∀ i , j , x ( i )= x ( j ) where 0 & lt ; i , j & lt ; n , i ≠ j and ijεz + , the energy content in each high frequency band becomes zero , and traffic is considered to be constant bit rate ( cbr ). in this case the entire energy of the input data is present within the lowest frequency band . the bandwidth to allocate to this type of traffic must be equal to x ( i ). if the elements of x show an increasing characteristic over time such that x ( n )& gt ; x ( n − 1 ) n = 2 , 3 . . . , n , then the energy distribution in each frequency band increases from finest to a coarser scale , being the lowest in the highest frequency region , e [ e j + 1 ]& gt ; e [ e j ]. the ram unit increases the bandwidth demand for the next time slot and sends this request to the dbc 900 . a decrease in the coarse scale energy while the fine scale energies are stable is an indicator of a linear decrease in traffic volume . less bandwidth than that in the previous time slot is needed . a request to lower the bandwidth allocation is sent to dbc from ram . assume that v i stands for the variance of the energies among k scales in time slot i , m i stands for the mean value of energy contents , and u i stands for the utilization . v i + 1 & gt ; v i and m i + l & lt ; m i u i + 1 & lt ; u i this is representative of possibly approaching “ off ” interval , or departing flows in case of aggregate traffic . the request to decrease the bandwidth allocation is sent to the dbc . this is representative of added flows to the aggregate traffic or an approaching “ on ” interval . the request to increase the bandwidth allocation is sent to the dbc . this is representative of traffic is getting smoother . in this case no bandwidth renegotiation is required . this is representative of traffic getting smoother with increased utilization therefore , the request for increase in bandwidth is sent to the dbc after receiving a request for bandwidth renegotiation and the amount of bandwidth to allocate in the next time slot , the dbc 900 uses a threshold table that comprises the previous energy statistics and decides whether to grant the request , or not . [ 0082 ] fig8 shows the ram 800 that receives the energy vector 141 from the analyzer . the ram also receives external feedback parameters ( buffer statistics ) 801 , e . g ., momentary buffer size , packet / cell loss rate , and the minimum non - zero value x dc 132 of the integer vector 131 produced by the shift register 130 . [ 0083 ] fig9 shows the dynamic bandwidth controller unit 900 which takes the variance and mean of the energy distribution in previous measure 902 and the current measure 903 , and the new bandwidth prediction 809 from ram 800 and decides if to start a resource renegotiation cycle with the network . the system first filters out the minimum non - zero dc component x dc 132 in traffic measurements x 131 . effectively , the x dc 132 is a lower bound for the bandwidth allocation in a next time slot and is one of the contributing components in each bandwidth prediction . the signal 131 at the output of the m shift register 130 includes low and high frequency components . the signal 131 is fed into a filter bank in which high pass filters 220 are composed of haar wavelet coefficients , and low pass filters 210 are composed of haar wavelet scaling coefficients . the signal 131 is decomposed into three high frequency sub - bands 511 - 513 , a coarse sub - band 510 , as described above . energies in each of the high frequency sub - band 511 - 513 are used as a representative of the traffic volume within that frequency band . the traffic volume that generates the maximum energy e max 804 is computed . because underestimation may cause the buffer congestion , while overestimation can only result in underutilization of the available bandwidth , we take the contribution of maximum energy content in each adaptation interval for the bandwidth allocation . the square root 802 of e max 804 returns a signal that would have the energy amount e max 804 . this equivalent signal , the square root of e max is added to 132 by 803 as the second component to the new bandwidth prediction . the new prediction is also compensated with the present queue size 801 to flush the queue contents to prevent building up delays . finally , the new prediction 809 takes the form in eq . 8 bw ( n + 1 )= x dc ( n )+ max ( e n ( i ))+ queue_size ( n ) ( 8 ) we can also modify the ram 600 so that the buffer size information 801 is not needed for bandwidth renegotiation . this can be done without degrading the queuing performance and without increasing the capacity underutilization . in a first modification , the ram 600 method compensates the new bandwidth allocation by including a component with energy equivalent to the superposition of all the energies bw ( n + 1 ) = x d c ( n ) + ∑ i - 1 k e _ n ( i ) . here , the value k is the number of high frequency sub - bands into which the data are decomposed . in a second modification , the bandwidth compensation is provided as the sum of k components , each of which is representing a bandwidth contribution such that the energy of each component is the same as the energy in one of the sub - bands . bw ( n + 1 ) = x d c ( n ) + ∑ i = 1 k e _ n ( i ) . bw ( n + 1 ) = w _ n ( 1 ) + ∑ i = 1 k e _ n ( i ) , w _ n ( 1 ) = 1 m ∑ i = 1 m x _ k , n ( i ) , that is the average of a data unit x k , n 131 , or in other words the first element in w 600 . bw ( n + 1 ) = w _ n ( 1 ) + ∑ i = 1 k e _ n ( i ) . the condition w n ( 1 )& gt ; x dc , n in time slot n is always true . therefore , it is clear that the third and fourth modifications allocate more bandwidth in each renegotiation than the first and second modifications . [ 0098 ] fig1 compares the queuing performances , of the wavelet - energy method according to the invention with four traditonal approaches . [ 0099 ] fig1 compares the queuing performances 1101 - 1104 , in a top to bottom order , of the four modified wavelet - energy methods described above where the x - axis 1105 is the index of a time slot , and the y - axis 1100 is the average queue size . [ 0100 ] fig1 compares the trade between average utilization 1201 and average queue size 1202 for the four modified wavelet - energy ram methods where the x - axis 1103 is the index of a time slot , and the y - axis to the left 1200 is average utilization and y - axis to the right is average queue size . predicting bandwidth requirements using the wavelet - energy method as described above yields better performs than prior art techniques . the invention also enables smaller queue sizes at a minimal expense of increased bandwidth utilization . this invention is described using specific terms and examples . it is to be understood that various other adaptations and modifications may be made within the spirit and scope of the invention . therefore , it is the object of the appended claims to cover all such variations and modifications as come within the true spirit and scope of the invention . | 7 |
referring to fig1 , a communications system 1 for delivering content to a mobile terminal 2 is shown . the communications system 1 includes sources 3 1 , 3 2 , 3 3 , 3 4 of content , for example in the form of video , audio and data files , and content servers 4 1 , 4 2 for retrieving content and , optionally , re - formatting , storing , aggregating and / or scheduling the content . the content servers 4 1 , 4 2 may be controlled by respective entities 5 1 , 5 2 referred to as “ content providers ”. however , the content servers 4 1 , 4 2 may be controlled by the same entity . the communications system 1 further includes a datacast service system 6 . the datacast service system 6 receives content from the content servers 4 1 , 4 2 via a network 7 , such as the internet , and performs a number of functions including receiving content , providing service sets and service bundles , arranging service sets data in carousels , generating service information ( si ) data , encapsulating and multiplexing data . in one embodiment of the invention a service set can be used for combining same kind of services of one service or content provider together . one service may belong to a number of service sets . in another embodiment of the invention a number of services are bundled into a service bundle , which may be a sellable entity . the datacast service system 6 may also re - format , store , aggregate and / or schedule content the communications system 1 also includes a broadcast network 8 , for example in the form of a terrestrial digital video broadcasting ( dvb - t ) network , for providing a transmission channel from the datacast service system 6 to the mobile terminal 2 . other broadcast networks may be used including other types of dvb networks , such as a cable dvb network or satellite dvb network , a digital audio broadcasting ( dab ) network or an advance television system committee atsc ) network or a terrestrial integrated services digital broadcasting - terrestrial ( isdb - t ) network . the datacast service system 6 and broadcast network 8 are controlled by an entity 9 referred to as a “ datacast operator ”. however , the broadcast network 8 may also be used for other purposes , such as transmission of digital television , and may be controlled by another , different operator ( not shown ). under those circumstances , the datacast operator 9 controls the datacast service system 6 but not the broadcast network 8 . a public land mobile network ( plmn ) 10 , for example in the form of a gsm system , may provide a return channel from the mobile terminal 2 to the internet 7 . other plmn networks may be used , such as other types of second - generation ( 2g ) network such as digital advanced mobile phone system ( d - amps ) network or personal digital communication system ( pdc ) network , a “ two - and - a - half ” generation network , such as general packet radio service ( gprs ) network and enhanced data rates for gsm evolution ( edge ), or a third - generation network ( 3g ), such as universal mobile telephone system ( umts ) network based on wideband code division multiple access ( w - cdma ), or a time division synchronous code division multiple access ( td - scdma ) network . a local area network ( lan ) 11 , for example using ieee 802 . 11x , may also be provided for obtaining data from local sources ( not shown ) or from the internet 7 . other lans or personal area networks ( pans ) may be used such as bluetooth ™. referring to fig2 , first and second geographical regions 12 , 13 are shown . one or both of the regions 12 , 13 may be a country , a part of a country , city or town or a district of a city or town . for example , the first region 12 may be a city , while the second region 13 may be a countryside surrounding the city . the first region 12 is served by the first datacast service system 6 via the broadcast network 8 . the broadcast network 8 comprises a core network 14 and one or more transmitters 15 1 , 15 2 , 15 3 which transmit in respective cells 16 1 , 16 2 , 16 3 . gap filler transmitters ( not shown ) may also be provided . it will be appreciated that alternative configurations of the broadcast network 8 may be used . for example , the core network need not be provided . the broadcast network 8 is in this example arranged to transmit as a single frequency network ( sfn ) using 16 quadrature amplitude modulation ( qam ) at frequency lying in the range 470 to 862 mhz . the first region 12 is also served by plmn 10 ( fig1 ) in a conventional manner . the second region 13 is served by second datacast service system 17 via another broadcast network 18 comprising a core network 19 and one or more transmitters 20 1 . alternative configurations may be used as with the first datacast service system . a user is initially located in the second region 13 and moves to the first region 12 , taking their mobile terminal 2 with them . in the first region 12 , the mobile terminal 2 receives a signal 21 transmitted from a transmitter 15 3 carrying a number of services . as explained earlier , it is desirable that the datacast service system 6 is easily identifiable and that information about services is readily available . therefore , the datacast service system 6 provides its own information service which supplements an electronic service guide ( esg ). the information service is specific to the area served by the datacast service system 6 . thus , when the mobile terminal 2 moves to the first region 12 , local information can be provided quickly . referring to fig3 , a schematic diagram of an embodiment of a datacast service system 6 according to the present invention is shown . in this embodiment of the invention , the datacast service system 6 comprises an interface 22 for receiving service data 23 and , optionally , relevant electronic service guide ( esg ) data 24 , both in the form of ip data , from content servers 4 1 , 4 2 ( fig1 ) and storage 25 for optionally storing at least part of the service data 23 and esg data 24 . the system 6 also comprises a controller 26 , memory 27 storing a computer program 28 for controlling the datacast system 6 shown in fig3 , a service information ( si ) table generator 29 , a carousel generator 30 , a multiprotocol encapsulation ( mpe ) encapsulator 31 and a multiplexer 32 . the controller 26 includes an esg data generator 33 for generating esg data 34 , which together with esg data 24 , is used for describing the scheduling and timing of content . the controller 26 also includes a main page generator 35 for producing a main page 36 for the datacast operator , herein referred to as the “ dco main page ”. the controller 26 also includes a hierarchy page generator 37 for generating a hierarchy page 38 which will be described in more detail later . the controller 26 may provide main pages 39 1 , 39 2 , 39 3 for a number of services . the service main pages 39 1 , 39 2 , 39 3 may be provided by the content servers 4 1 , 4 2 ( fig1 ). however , the controller 26 may modify the service main pages 39 1 , 39 2 , 39 3 or generate the service main pages 39 1 , 39 2 , 39 3 from the service data 22 . the dco main page 36 is selectively provided by the datacast operator 9 ( fig3 ) and may include data for identifying the datacast operator , data for advertising and / or data for informing the user , for example announcing new , upcoming or updated services , informing the user of popular services or providing recommendations . the carousel generator 30 receives data relating to the services such as service data . 22 and esg data 24 , 34 . it may generate a number of carousels 40 , 41 , 42 , 43 , 44 including an alert carousel 40 for notifying the mobile terminal 2 ( fig1 ) e . g . of changes in service , a security association carousel 41 for encryption keys for encrypted content , a session announcement carousel 42 for announcing sessions , a main page carousel 43 for providing main pages for the datacast operator and the services and a hierarchy carousel 44 for providing data relating to the hierarchy of available services . carousels 40 , 41 , 42 , 43 , 44 repeatedly transmit data usually in a cyclically manner . referring to fig4 , the main page carousel 43 may comprise the dco main page 36 in the form of one or more files 47 1 , 47 2 , 47 3 and service main pages 39 1 , 39 2 , 39 3 each in the form of one or more files 48 11 , 48 12 , 48 13 , 48 21 , 48 22 , 48 23 , 48 31 , 48 32 , 48 33 . the number of files 47 1 , 47 2 , 47 3 comprised in the dco main page 36 need not be the same as the number of files 48 11 , 48 12 , 48 13 , 48 21 , 48 22 , 48 23 , 48 31 , 48 32 , 48 33 comprised in any other service main page 39 1 , 39 2 , 39 3 . furthermore , the number of files 48 11 , 48 12 , 48 13 comprised in any service main page , for example the first service main page 39 1 , need not be the same as the number of files 48 21 , 48 22 , 48 23 comprised in another service main page , for instance the second service main page 39 2 . the files 47 1 , 47 2 , 47 3 , 48 11 , 48 12 , 48 13 , 48 21 , 48 22 , 48 23 , 48 31 , 48 32 , 48 33 are in one embodiment of the invention in the form of hypertext mark - up language ( html ) protocol files . however , other file formats may be used , such as extensible mark - up language ( xml ) or session description protocol ( sdp ). reference is made to “ session description protocol ” by m . handley & amp ; v . jacobson , rfc 2327 , ietf , april 1998 . referring to fig5 , a hierarchy file carousel 44 comprises a hierarchy file 38 in the form of one or more sub - files 49 1 , 49 2 , 49 3 . in one embodiment of the invention the hierarchy file 38 need not be configured or transmitted in the form of a carousel 38 . referring to fig6 , the esg data 24 , 34 includes service description data 50 in one embodiment of the invention . referring to fig7 , the hierarchy file 38 comprises sets 51 1 , 51 2 , 51 3 , 51 4 , 51 5 of carousel information . each carousel 40 , 41 , 42 , 43 , 44 ( fig3 ) has a respective set 51 1 , 51 2 , 51 3 , 51 4 , 51 5 of carousel information comprising an identifier 52 1 , 52 2 , 52 3 , 52 4 , 52 5 for identifying the carousel type , a list 53 1 , 53 2 , 53 3 , 53 4 , 53 5 of ip addresses and port numbers for sets of pages within a carousel , an optional list 54 1 , 54 2 , 54 3 , 54 4 , 54 5 of times for indicating when carousel information will expire and optional list 55 1 , 55 2 , 55 3 , 55 4 , 55 5 of times for indicating frequency of updates . the session , main page and hierarchy carousels 42 , 43 , 44 include respective lists 54 2 , 54 4 , 54 5 of expiry times . the main page and hierarchy carousels 43 , 44 may include respective lists 55 4 , 55 5 of update times . thus , the main page carousel 43 ( fig3 ) has a set 51 4 of carousel information including an identifier 52 4 for indicating that the carousel is the main page carousel , a list 53 4 of ip addresses and port numbers for the dco main page 36 ( fig4 ) and the service main pages 39 1 , 39 2 , 39 3 ( fig4 ), a list 54 4 of expiry times and a list 55 4 of update intervals . the ip addresses in lists 53 1 , 53 2 , 53 3 , 53 4 , 53 5 conform in one embodiment of the invention to ipv6 protocols and reference is made to “ internet protocol , version 6 ( ipv6 ) specification ”, by s . deering and r . hindern , rfc 2460 , ietf , december 1998 and other related ipv6 rfcs . however , other ip protocols may be used . the expiry times in lists 54 1 , 54 2 , 54 3 , 54 4 , 54 3 conform in one embodiment of the invention to network time protocol ( ntp ) and reference is made to “ network time protocol ( version 3 ) specification , implementation ” by d . mills , rfc 1305 , ietf , march 1992 . however , other times may be used . the expiry times in lists 54 1 , 54 2 , 54 3 , 54 4 , 54 5 may differ from one another . the update intervals 55 1 , 55 2 , 55 3 , 55 4 , 55 5 may be expressed in seconds . however , other units of time such as milliseconds may be used in various embodiments of the invention . referring to fig8 , an exemplary directory structure 56 of the main pages 36 , 39 1 , 39 2 , 39 3 is shown . in this example the dco main page 36 includes the service main pages 39 1 , 39 2 , 39 3 . as will be explained in more detail later , in one embodiment of the invention the ip address of the hierarchy file 38 is signalled through si , in particular through the nit 45 ( fig3 ) and the int 46 ( fig3 ). referring to fig9 , in one embodiment of the invention the datacast service system 6 transmits data in accordance with a number of transport protocols and a protocol stack 57 is shown . in one embodiment of the invention in the network layer ( layer 3 ), ipv6 protocols 58 are used and reference is made to “ internet protocol , version 6 ( ipv6 ) specification ” ibid . ip security ( ipsec ) is not necessarily used when transmitting main page files 47 1 , 47 2 , 47 3 , 48 11 , 48 12 , 48 13 , 48 21 , 48 22 , 48 23 , 48 31 , 48 32 , 48 33 . further in one embodiment of the invention in the transport layer ( layer 4 ), usergram data protocol ( udp ) 59 is used and reference is made to “ user datagram protocol ”, by j . postel , rfc 768 , ietf , august 1980 . in one embodiment of the invention real - time transport protocol ( rtp ) 60 1 may be used to transport files . however , asynchronous layered coding ( alc ) protocol 60 2 may be used in other embodiments of the invention . reference is made to “ a transport protocol for real - time applications ” by h . schulzrinne et al ., rfc 1889 , ietf , january 1996 and “ asynchronous layered coding protocol ” by m . luby et al ., rfc 3450 , ietf , december 2002 . on the rtp / alc layer 60 , a filecast payload format may be used which specifies , in detail , the use of rtp / alc protocols . a number of different file formats may be used . for example , xml 62 1 may be used for hierarchy files 49 1 , 49 2 , 49 3 ( fig5 ), security association files ( not shown ) and session announcement files ( not shown ). sdp 62 2 may be used for technical session information that is not directly shown to the user . in various embodiments of the invention html 62 3 may be used for main page files 47 1 , 47 2 , 47 3 , 48 11 , 48 12 , 48 13 , 48 21 , 48 22 , 48 23 , 48 31 , 48 32 , 48 33 . if more than one language is supported , then the main pages can be sent in files for different languages . the language used is indicated e . g . using language codes . reference is made to “ tags for the identification of languages ” by h . alvestrand , rfc 1766 , ietf , march 1995 . referring again to fig3 , an mpe encapsulator 31 encapsulates data , such as data from carousels 40 , 41 , 42 , 43 , 44 , into sections ( not shown ) compliant with dsm - cc section format for private data as specified section 7 “ multiprotocol encapsulation ” in “ digital video broadcasting ( dvb ); dvb specification for data broadcasting ”, etsi en 301 192 , v1 . 3 . 1 ( 2003 ). however , some data may not be so encapsulated . for example , the nit 45 may be segmented into network information sections , for example as specified in section 5 “ service information ( si ) tables ” in “ digital video broadcasting ( dvb ); specification for service information ( si ) in dvb systems ”, etsi en 300 468 , v1 . 5 . 1 ( 2003 ). referring also to fig1 , the multiplexer 32 places the sections ( not shown ) into mpeg - 2 transport stream ( ts ) packets 63 , according to international organisation for standards / international electrotechnical commission ( iso / iec ) standard 13818 - 1 “ information technology — generic coding of moving pictures and associated audio information : systems ” and outputs a transport stream 64 . the transport stream 64 is provided to the broadcast network 8 ( fig1 ) in which it may be multiplexed with other streams ( not shown ), then modulated and broadcast . as mentioned earlier , the ip address of the hierarchy file 38 may be signalled through si , in particular through the nit 45 ( fig3 ) and the int 46 ( fig3 ). referring to an example illustrated in fig1 , the nit 45 includes first and second descriptor loops 65 , 66 in which a plurality of descriptors ( not shown ) for , inter alia , specifying data values and identifying other parts of the transport stream , may be inserted . a linkage descriptor 67 can be used to point to other parts of the transport stream and thus obtain further data or access a service . to identify itself as such , the linkage descriptor 67 includes a descriptor tag 68 containing a predetermined value , e . g . 0 × 0b . the linkage descriptor 67 also includes a transport stream id 69 and an original network id 70 to identify uniquely a transport stream , in this case carrying the int 46 . the transport stream 54 ( fig1 ) may carry a plurality of sets of ip streams , a set of ip streams being known as an “ ip platform ”. each ip platform can be identified by a platform id 71 and a platform name 72 which describes the platform and can be used by the mobile terminal 2 to select a platform . reference is made to section 7 . 4 “ network ( si ) signalling ” in “ digital video broadcasting ( dvb ); dvb specification for data broadcasting ”, etsi en 301 192 ibid . and in section 6 . 2 . 17 “ linkage descriptor ” in “ digital video broadcasting ( dvb ); specification for service information ( si ) in dvb systems ” etsi en 300 468 ibid . to identify itself as such , the int 46 includes a table id 73 containing a predetermined value , such as 0 × 4c . the int 46 includes a platform id 74 and may include one or more target ip address descriptors 75 , each including a target ip address 76 . the ip address on which the hierarchy file 38 ( fig6 ) is transmitted is specified in target ip address 70 . referring to fig1 , a process performed by the datacast service system 6 in one embodiment of the invention is shown in the form of a flow diagram . referring also to fig3 , in one exemplary embodiment of the invention the dco main page generator 35 generates a dco main page 36 and the hierarchy page generator 37 generates a hierarchy page 38 ( step s 1 ). this may be done periodically , for example every 10 or 100 seconds . additionally or alternatively , the dco main page generator 35 may generate a dco main page 36 when any one of a number of predefined events occurs , such as a change in service , or any one of a number of predefined conditions , such as when a number of consumers exceeds a given number , are satisfied . additionally or alternatively , the dco main page generator 35 may generate a dco main page 36 as - and - when directed to do so by the dco operator 9 . the controller 26 also may provide service main pages 39 1 , 39 2 , 39 3 ( step s 2 ). the carousel generator 30 receives the dco main page 32 ( fig4 ), the service main pages 33 1 , 33 2 , 33 3 and the hierarchy page 38 and generates the main page carousel 43 and the hierarchy file carousel 44 ( step s 3 ). generation of the main page carousel 43 and the hierarchy file carousel 44 includes assigning respective ip addresses and port numbers to the dco main page 36 ( fig4 ) and the service main pages 39 1 , 39 2 , 39 3 ( fig4 ), and to the hierarchy file 38 ( fig6 ). the ip address and port numbers assigned to the dco main page 36 ( fig4 ) and the service main pages 39 1 , 39 2 , 39 3 ( fig4 ), as well as ip address and port numbers assigned to other carousels , are included in the hierarchy file 38 ( fig6 ). the ip address and port number assigned to the hierarchy file 38 ( fig6 ) are supplied to the table generator 29 for inclusion in the int 46 . the carousels 40 , 41 , 42 , 43 , 44 are local , i . e . specific to the network area . in other words , each network area has its own hierarchy , main page , security association , session announcement and alert carousels . thus , the hierarchy file 38 ( fig6 ) has a different ip address in each network area . the ip addresses may be assigned on an ad - hoc basis . alternatively , the ip addresses may be pre - assigned . the nit 45 and int 46 are prepared and cyclically transmitted ( step s 4 ). the main page and hierarchy file carousels 43 , 44 are transmitted ( step s 5 ). referring to fig1 , the mobile terminal 2 in one embodiment of the invention is in the form of a mobile telephone handset with a multimedia capability . the mobile terminal 2 includes first and second antennae 77 1 , 77 2 , a receiver 78 , and a transceiver 78 2 . in this example , the first antenna 77 , and receiver 78 , are used to receive signals from the broadcast network 8 ( fig1 ). the second antenna 77 2 and transceiver 78 2 are used to transmit and receive signals to and from the plmn 10 ( fig1 ). the receiver and transceiver 78 1 , 78 2 each include respective r . f . signal processing circuits ( not shown ) for amplifying and demodulating received signals and respective processors ( not shown ) for channel decoding and demultiplexing . the mobile terminal 2 also includes a controller 79 , a user interface 80 , memory 81 , storage 82 a smart card reader 83 , smart card 84 received in the smart card reader 83 , a coder / decoder ( codec ) 85 , a speaker 86 with corresponding amplifier 87 and a microphone 88 with a corresponding pre - amplifier 89 . the user interface 80 comprises a display 90 and a keypad 91 . the display 90 is adapted for displaying images and video by , for instance , being larger and / or having greater resolution than a display of conventional mobile telephone and being capable of colour images . the mobile terminal 2 also includes a battery 92 . a transceiver 93 may optionally be provided for transmitting and receiving signals to and from the lan 11 ( fig1 ). the transceiver 93 may be a wireless card compliant to ieee 802 . 11x or bluetooth ™ specifications . the controller 79 manages operation of the mobile terminal 2 under the direction of computer software 94 stored in memory 81 . for example , the controller 79 provides an output for the display 90 and receives inputs from the keypad 91 . the mobile terminal 2 may be modified by providing a single receiver adapted to receive signals from the broadcast network 8 ( fig1 ) and the plmn 10 ( fig1 ) and a transmitter adapted to transmit signals to the plmn 10 ( fig1 ). alternatively , a single transceiver for both communications networks 8 , 10 may be provided . when the mobile terminal 2 is switched on and / or if the mobile terminal 2 moves from one region 13 ( fig1 ) to another region 12 ( fig2 ) served by different datacast operators 6 , 17 ( fig2 ) or served by the same datacast operator and having at least partly different services available , then the mobile terminal 2 may not have up - to - date — or even any — electronic service guide ( esg ) information . the mobile terminal 2 acquires esg data 24 , 25 ( fig3 ), which includes nit 45 , int 46 , main pages 47 1 , 47 2 , 47 3 , 48 11 , 48 12 , 48 13 , 48 21 , 48 22 , 48 23 , 48 31 , 48 32 , 48 33 ( fig4 ) and service description data 50 ( fig6 ) using information included in the hierarchy file 38 ( fig5 ) and the dco main page 36 ( fig3 ). more detailed information may also be acquired , on request , using information included in the esg data 24 , 25 ( fig3 ). referring to fig1 and 14 illustrating one embodiment of the invention , a process performed by the mobile terminal 2 , for example when it is switched or moves from one region 13 ( fig1 ) to another region 12 ( fig2 ), is shown in the form of a flow diagram . the controller 79 instructs the receiver 78 1 to locate a network , in this case the broadcast network 8 ( fig1 ) ( step s 6 ). this may be achieved by scanning a part of the radio frequency spectrum until signal 21 ( fig2 ) is found . alternatively , the controller 79 may select one or one or more pre - defined or user inputted network frequencies . then again , the user may instruct the controller 79 to find a given network . in this exemplary embodiment of the invention the controller 79 locates , downloads , parses and stores the nit 45 , then locates , downloads , parses and stores the int 46 ( step s 7 ). the controller 79 obtains the ip address and port number of the hierarchy file 38 ( step s 8 ). this may comprise determining whether any ip address within the hierarchy file 38 falls within a predefined esg ip address range and returning any address which falls within that range . the controller 79 joins the address , downloads , parses and stores the hierarchy file 38 in storage 82 ( step s 9 ). from the hierarchy file 38 , the controller 79 can obtain respective ip addresses and port numbers for the carousels 40 , 41 , 42 , 43 , 44 . in particular , the controller 79 may obtain the ip address and port number for the main pages 36 , 39 1 , 39 2 , 39 3 ( step s 10 ), may join the addresses and download one or more of the main pages 36 , 39 1 , 39 2 , 39 3 ( step s 11 ). furthermore , the controller 79 can obtain the ip address and port number for session announcement carousel 42 ( step s 12 ), join the address and download the session description data 50 ( step s 13 ). the session description data 50 may include universal resource locators ( urls ) for obtaining further , more detailed information ( not shown ). at the request of the user , the controller 79 may retrieve more detailed information ( not shown ) via the plmn 10 ( fig1 ) or lan 11 ( fig1 ). referring to fig1 , 15 and 16 , a process performed by the mobile terminal 2 in one embodiment of the invention , for example once it obtained esg information , is shown in the form of a flow diagram . the controller 79 may only listen to announcements , such as hierarchy file 38 , when it is time for an update . based upon the expiry time 54 5 ( fig7 ), the controller 79 determines whether it is time to update the hierarchy file 38 ( step s 15 ). if it is time for an update , the controller 79 downloads a new hierarchy file 38 ′ ( step s 16 ). the currently stored hierarchy file 38 and the new hierarchy file 38 ′ each have values 95 , 95 ′ indicating when they were last modified . the controller 79 compares the modification time 95 ′ of the new hierarchy file 38 ′ with the modification time 95 of the currently - stored hierarchy file 38 ( step s 17 ). if the modification time 95 ′ of the new hierarchy file 38 ′ is later than the modification time 95 of the currently - stored hierarchy file 38 , in other words the new hierarchy file 38 ′ is indeed newer than the currently - stored hierarchy file 38 , then the new hierarchy file 38 ′ is stored in storage 82 ( step s 18 ). if not , the expiry time 54 5 ( fig7 ) is simply updated ( step s 19 ). the controller 79 may also check expiry times 54 4 for the main page carousel 43 . however , the update interval 55 4 ( fig7 ) for the main page carousel 43 may be shorter than the update interval 55 5 ( fig7 ) for the hierarchy file carousel 44 . therefore , the controller 79 may calculate expected expiry times for the main page carousel 43 using the update interval 55 4 , thereby avoiding the need to check the hierarchy file 38 . referring to fig1 , a first view of a dco main page display 96 as displayed by the mobile terminal 2 in display 90 is shown in one embodiment of the invention . the dco main page display 96 is the first page which is presented to the user when the datacast service system 6 ( fig1 ) is accessed and can be used to view the esg . the dco main page display 96 can be quickly presented because the dco main page 36 ( fig3 ) is used as a default starting point and presents the most relevant information to the user . the dco main page display 96 may include a number of fields including an operator identity field 97 , terminal status area 98 , an active area 99 , selection buttons 100 , time / date field 101 and further soft key selection buttons 102 . the operator identify field 97 may include the name of the datacast operator 9 ( fig1 ) and a logo . the terminal status area 98 may include information such as network connection status , battery level and incoming call alert . the information may be presented in the form of icons , animated icons or text . some of the fields may display data and information which has been received from the datacast service system 6 ( fig1 ). some of the fields may display data and information which has been stored in the storage 82 ( fig1 ) and which originates from the datacast service system 6 ( fig1 ), the user , the terminal 2 , another source , for example via plmn 10 ( fig1 ) or a combination of these . the selection buttons 100 may include a button 100 1 for presenting a viewing history , a button 100 2 for displaying programs which are currently running , a button 100 3 for displaying available channels and a button 100 4 for switching to a viewer 105 ( fig1 ) which fills substantially all or most of the display 90 . the dco main page display 96 is updated to reflect changes in esg , service popularity etc . it can also be used for informing users of upcoming events , changes in services or service availability . the dco main page display 96 may also be used for advertising purposes , such as displaying trailers . in fig1 , the active area 99 shows a list 103 of available channels . referring to fig1 , a second view of the dco main page display 96 is shown in which the active area 99 shows a list 104 of programs currently running . the selection buttons 100 may include a button 100 5 for entering an options menu , a button 100 6 for reverting back to the first view shown in fig1 and a button 100 7 for obtaining further details . referring to fig1 , a viewer 105 is shown . the viewer 105 includes an active area 106 and a button 107 for reverting to the dco main page display 96 . as mentioned earlier , the mobile terminal 2 can be used not only to obtain and render content obtained from the broadcast network 8 ( fig1 ), but also content and / or data obtained from the plmn 10 ( fig1 ). referring to fig2 , a process performed by the mobile terminal 2 in one embodiment of the invention is shown in the form of a flow diagram . referring also to fig1 and 13 , the controller 79 retrieves at least a part of the service data 23 from the datacast service system 6 via the broadcast network 8 ( step s 20 ). additionally , the controller 79 retrieves data ( not shown ) from a source ( not shown ) via the plmn 10 ( step s 21 ). the processor 79 displays service data 23 in the display 90 , for example in the dco main page display 96 ( step s 22 ) and also displays data obtained from the plmn 10 in the display 90 . it will be appreciated that many modifications may be made to the embodiments hereinbefore described . for example , the mobile terminal 2 may take the form of a personal digital assistant ( pda ). furthermore , a fixed or semi - fixed terminal may be used , for example in the form of a set - top box or personal computer . | 7 |
it will be appreciated that the invention may be implemented in a variety of ways for a range of different radios and batteries . the embodiments described here are given by way of example only . fig1 shows a battery charger for the first embodiment of a hand portable radio , having a cradle formed by a lower portion 10 and an upper portion 11 . these portions are typically made from moulded plastic and fastened together by screws , although a range of options might be considered . the upper portion includes a recess 12 with a rim 13 , which receives the base of the radio , or the battery alone , and a rear support 14 which contains all or part of a lock and release mechanism for a rear part of the radio or battery . the lower portion forms a shell around part of the upper portion . fig2 gives an exploded view of the cradle , showing a locking actuator 20 , a locking release actuator 21 , and locking latch 22 . in this example , the locking actuator and latch are in sliding contact with the release actuator which is in turn mounted in the upper portion of the cradle . a pair of spring loaded locking pins 23 are mounted in the rim 13 . these components form a lock and release mechanism which holds the radio or battery securely in the cradle . the components are typically made from plastic and may take a variety of shapes in other embodiments . fig3 a , b , c and corresponding fig4 a , b , c indicate how the lock and release mechanism operates in relation to a complete radio 50 including battery 51 . fig5 a , b indicate how the lock and release mechanism operates in relation to the battery alone . the locking actuator 20 has an approximate l shape with a single leg 30 , and sits in a vertical orientation within the cradle , biased upwards by a spring 31 . a foot 32 on the lower end of the leg lies in the bottom of the upper portion 11 and extends into the recess 12 . an aperture 33 towards the upper end of the leg is guided by an internal part on the upper portion 11 . a shoulder 34 on the upper end of the leg is shaped to engage the locking latch 22 . the release actuator 21 has an approximately square o shape with a central aperture 35 , and sits in a vertical orientation in the upper portion of the cradle , biased upwards by a spring 36 . a contact portion 37 protrudes above the cradle . a pair of slots 39 guide the locking latch through the central aperture , and include respective cam surfaces 40 . a foot 41 is guided by an aperture in the upper portion 11 and rests on spring 36 . the locking latch 22 is approximately u shaped with a pair of arms 42 and lies in a horizontal orientation through the release actuator 21 , biased transversely by a spring 43 . the arms are able to slide in slots 39 on the release actuator while a pair of cam surfaces 44 are aligned with corresponding surfaces 40 . the ends of arms 42 are shaped to engage corresponding recesses in a battery . fig3 a and 4 a show the empty cradle . locking actuator 20 is held upwards by spring 31 . shoulder 34 on the locking actuator restrains the locking latch 22 in an open position , against spring 43 . the locking release actuator 21 is held upwards in an open position by spring 36 . all of the springs are seated on internal surfaces of the cradle as shown . fig3 b and 4 b show a radio 50 including battery 51 locked into the cradle by a user . locking actuator 20 is displaced downwards in recess 12 against spring 31 , by contact of the battery on foot 32 . locking latch 22 has been released by shoulder 34 and is displaced transversely into engagement with the battery by spring 43 . the radio generally abuts internal walls of the recess 12 and is biased firmly against arms 42 of the latch by spring 31 . pins 23 have also engaged the battery but are not shown in this view . fig3 c and 4 c show how the radio 50 is released from the cradle . the user applies downwards pressure to contact portion 37 of the locking release 21 , against spring 36 . cam surfaces 40 on the release actuator engage cam surfaces 44 on the locking latch 22 which restores the latch to the open position out of engagement with the battery 51 . the locking actuator and the radio are returned upwards by spring 31 and shoulder 34 again restrains the latch against spring 43 . the user then removes pressure from the release actuator which returns to the open position , and the radio can be removed from the cradle . fig5 a and 5 b correspond to fig3 b and 4 b , and show how the battery 51 is held in the cradle without necessarily being attached to the radio . the locking actuator , locking latch and release actuator behave as before . pins 23 hold the battery in engagement arms 42 of the latch . charging of a battery separately from the radio might be considered an optional feature . fig6 is a sectional view indicating the location of electrical contacts 60 inside the cradle . these contacts meet corresponding contacts on the battery 51 . the associated electrical circuit and connection to an external power supply , typically a vehicle battery , will be known to a skilled reader and have not been shown . the cradle may be fixed within a vehicle in a variety of ways , depending on surfaces and fittings which are available inside vehicle . a range of brackets may be attached to the rear of the cradle for example . the cradle may also be held in an aperture having edges which are sandwiched between the upper and lower portions 10 and 11 . fig7 shows a second embodiment of the battery charger , having a cradle formed by a lower portion 15 and an upper portion 16 . the upper portion includes a recess 17 with a rim 18 , which receives the base of the radio , or the battery alone , and a rear support 19 which contains all or part of a lock and release mechanism for a rear part of the radio or battery . the charger in fig7 includes a locking actuator 70 , a locking release actuator 71 , and a locking latch formed by a pair of pins 72 mounted separately in the upper portion 16 . the locking actuator and latch are in sliding contact with the release actuator which is in turn mounted in the upper portion of the cradle . these components form a lock and release mechanism which holds the radio or battery securely in the cradle . fig8 a , b , c and corresponding fig9 a , b , c indicate how the lock and release mechanism operates in relation to a complete radio 50 including battery 53 . the lock and release mechanism may also operate in relation to the battery alone . the locking actuator 70 has an approximate l - shape with a single leg 80 , and sits in a vertical orientation within the cradle , biased upwards by a spring 81 . a foot 82 on the lower end of the leg lies in the bottom of the upper portion 16 and extends into the recess 17 . an aperture 83 towards the upper end of the leg is guided by an internal part on the upper portion 16 . a pair of arms 84 on the upper end of the leg are shaped to interact with the pins 72 of the locking latch . the release actuator 72 is an approximately square o - shape with a central aperture 85 , and sits in a vertical orientation in the upper portion of the cradle , biased upwards by a spring 86 . a contact portion 87 protrudes above the cradle . the arms of the locking latch are guided by internal sides of the central aperture 85 . cam surfaces 90 on external sides of the central aperture interact with the pins 72 . a foot 81 is guided by an aperture in the upper portion 16 and rests on spring 86 . the locking latch is formed by a pair of separate latches or pins 72 in this example . each pin has an approximate l - shape which includes a central block 91 , a cam surface 92 and a protrusion 93 . each pin lies in a horizontal orientation biased transversely inwards to the cradle by a respective spring 94 . the cam surfaces 92 are aligned with corresponding cam surfaces 90 on the release actuator 71 . the protrusions 93 engage corresponding recesses in the battery 53 . fig8 a and 9 a show the empty cradle . locking actuator 70 is held upwards by spring 81 . arms 84 restrain the pins of locking latch 72 in an open position , against springs 94 . the locking release actuator 71 is held upwards in an open position by spring 86 . all of the springs are seated on internal surfaces of the cradle as shown . fig8 b and 9 b show a radio 50 including battery 53 locked into the cradle by a user . locking actuator 70 is displaced downwards in recess 17 against spring 81 , by contact of the battery on foot 82 . locking latch 72 has been released by arms 84 and the pins are displaced transversely into engagement with the battery by springs 94 . the radio generally abuts internal walls of the recess 17 and is biased firmly against the latch by spring 81 . other pins provided in the cradle may also engage the battery but are not shown in this view . fig8 c and 9 c show how the radio 50 is released from the cradle . the user applies downwards pressure to contact portion 87 of the locking release 71 , against spring 86 . cam surfaces 90 on the release actuator engage cam surfaces 92 on the locking latch 72 which restores the respective pins to the open position out of engagement with the battery 53 . the locking actuator and the radio are returned upwards by spring 81 and arms 84 again restrain the pins of latch 72 against springs 94 . the user then removes pressure from the release actuator 71 which returns to the open position , and the radio can be removed from the cradle . | 7 |
as previously mentioned , this invention is designed for an existing ink duct of any arbitrary printing press . these elements are therefore represented in a purely schematic fashion . the actual design can be much more complex , however , this is irrelevant to this invention , since only one element need be matched to these existing conditions . every conventional printing press has an ink duct 2 which includes a housing 20 with a plurality of bores , mainly threaded bores 21 , through which duct - adjusting screws extend . the duct - adjusting screws act directly on an ink blade 22 , which rests against a ductor 23 . the ink present at the ductor 23 is intermittingly lifted off by a vibrator and transferred to an ink roller of an ink unit . a plurality of bores 21 are provided with regular spacing in the housing 20 of the ink duct 2 . the shape , diameter , length and extension of the bores 21 is extremely different between presses , depending on the particular press . instead of adapting the ink duct to a new duct - adjusting screw unit , or even to install a completely new ink duct , the duct - adjusting screw unit is divided basically into two areas , an area which remains the same and an adapted , type - specific area , such as an adapter element 10 . the adapter element 10 , as shown in fig1 comprises a two - piece cylindrical sleeve . the sleeve has a threaded element 11 and a plug element 12 . the nomenclature threaded element and plug element are merely used to differentiate the elements and corresponds to the exemplary embodiment shown in the drawings . the threaded element 11 is adapted in its design and dimensions to the conditions present in the existing housing 20 of the ink duct 2 to be equipped . the threaded element 11 of the adapter 10 is therefore customized . in contrast , the plug element 12 of the adapter 10 is standardized and fits the unchanged remaining part of the duct - adjusting screw unit 1 . the first element of the adapter element 10 , here designed as the threaded element 11 , has a lesser diameter than the plug element 12 , in most occurring cases . the plug element 12 is a cylindrically turned element , which can be pushed with pass fit into an adjusting block 13 . the adjusting block 13 preferably has a cuboid shape and has a cylindrical through - bore 14 . a contact pressure bolt 4 is seated in the through - bore 14 . the contact pressure bolt 4 extends almost completely through the adjusting block 13 and extends centered through the entire adapter element 10 , until it rests against the ink blade 22 . the adapter element 10 accordingly also has a bore 15 with a diameter of the same dimension , which extends completely through the adapter element 10 . the threaded element 11 of the adapter element 10 has an exterior thread 16 , which is matched to the existing interior thread in the bore 21 of the housing 20 of the ink duct 2 . thus the entire duct - adjusting screw unit 1 is releasably connected with the ink duct 2 and is also adjustable with respect to the ink duct 2 . as represented here , the connection between the adjusting block 13 and the adapter element 10 can be provided by means of a fixation screw 17 , which engages a circumferential recess 18 on the plug element 12 of the adapter element 10 . the fixation screw 17 laterally extends through the adjusting block 13 as far as a widened bore 19 . the length and diameter of the widened bore 19 are precisely matched to the plug element 12 of the adapter element 10 . as long as the fixation screw 17 is not tightened , the adapter element 10 is secured in the axial direction , but is still rotatable , which is useful for mounting and rough adjustment . the plug element 12 can also be fixed in place in the adjusting block 13 with appropriate recesses cut into both elements for an only limitedly releasable connection using a seger ring 17 &# 39 ;, by means of which an axial fixation is also achieved , while the rotatability of the two elements with respect to each other remains assured . this alternative is shown in a simplified form in fig1 . a seating bore 40 , which extends at least as far as into the through - bore 14 , is cut into the adjusting block 13 vertically with respect to a direction of extension of the cylindrical through - bore 14 . a pivot body 41 is rotatably seated and axially secured in the seating bore 40 , designed as a blind bore . axial securing can occur by conventional means , for example by means of a seger ring . on a front face located toward the cylindrical through - bore 14 , the pivot body 41 has an eccentric link track 42 , which is at least partially formed as a section of a circle . a catch 43 fastened on the contact pressure bolt 4 engages the link track 42 . thus , a rotating movement of the pivot body 41 leads to an axial displacement of the contact pressure bolt 4 . in order to improve guidance of the contact pressure bolt 4 and the pivot body 41 in the contact area , and also to prevent tilting of the catch 43 in the link track 42 , the contact area of the contact pressure bolt 4 is ground to form a flat sliding face 44 . the length of the flat sliding face 44 corresponds to at least a diameter of the pivot body 40 plus the maximum displacement of the contact pressure bolt 4 . the pivot body 40 also projects laterally out of the adjusting block 13 which accommodates an actuating lever 51 , which is arranged radially on the pivot body 40 . basically , the actuating lever 51 indicates by means of its angular position a position of the contact pressure bolt 4 with respect to the ink blade 22 . however , the indication can also be provided by a graduation 52 on the pivot body 41 , for reading off its angular position with respect to the adjusting block 13 . the setting is considerably more visible , however , if an element 53 having a graduation is screwed to the adjusting block 13 . in the embodiment in accordance with fig1 the element 53 is a cylinder calotte with an appropriate read - off graduation . the element 53 can also approximate a shape of a plate . the element 53 with the graduated scale for indication is fixed interchangeably by means of a screw 54 . the screw 54 directly engages the cylindrical through - bore 14 , which has an interior thread at the end . the element 53 with the graduation can also be designed in a press - specific manner . for example , the element 53 with the graduation can have exactly the width corresponding to the spacing between two neighboring duct - adjusting screw units . in this case , the element 53 is wider than the adjusting block 13 , or respectively wider than the entire width of the remaining duct - adjusting screw unit 1 without the element 53 . in the completely retrofitted state , the elements supporting the graduation lie closely next to each other . mounting the duct - adjusting screw units 1 in accordance with this invention is performed such that the adapter element 10 , which is produced in a press - specific manner , is screwed into an approximately correct position by means of its threaded section and the remainder of the unit is placed on the plug element 12 of the adapter element 10 . a tightening area 45 , provided in an advantageous manner , remains accessible on the adapter element 10 and is used to tighten the adapter element 10 by means of a tool , for example an open - end wrench . accordingly , the tightening area 45 can be hexagonal or octagonal . for a first adjustment , the pivot body 41 is set to a minimal position by means of the actuating lever 51 , and thereafter the adapter element 10 is screwed in with the aid of an open - end wrench until a pressure of the contact pressure bolt 4 against the ink blade 22 is so great that practically no ink can be passed . by pivoting the actuating lever 51 it is therefore possible to adjust ink delivery to the ductor 23 from a minimum to a maximum . this setting is easily recognizable , and can be easily set and read off , so that the same setting can be immediately repeated for a new printing process . an experienced printing press operator can determine by means of the material to be printed alone which setting is at least approximately appropriate for correct ink delivery . | 1 |
( the invention adding sb to hydrocarbon fcc feed so that it deposits on to the catalyst over time ) a commercial catalyst , foc90 , available from akzo chemicals , inc ., a division of akzo nobel , is employed in a conventional fluid catalytic cracking unit ( fcc ) of a design by uop , m . w . kellogg , or other designer . the catalyst circulates successively through a riser into a recovery section and then into a regenerator where carbon is burned off by treatment with air and / or co 2 . the decoked catalyst is then recycled back to the riser for contact with additional quantities of a heavy oil feedstock which contains approximately 10 ppm nickel plus 5 ppm iron . from this stream of catalyst , there is continuously or intermittently withdrawn a portion which is sent to a magnetic separator of the type described in u . s . pat . no . 5 , 147 , 527 . the magnetic separator operates conventionally and removes a high metal - contaminated portion of the catalyst before recycling the remaining lower metal catalyst back to the cracking cycle . when a 1 : 1 ppm ( weight ) ratio of feed iron to antimony ( as antimony acetate , 97 % wt .) is added to the feed to the fcc , the antimony gradually deposits on the circulating catalyst so that the catalyst which was earliest added becomes the most magnetic , and newly added make - up catalyst is the least magnetic . operating the same magnetic separator conventionally , causes a sharper recovery of new catalyst because the magnetic susceptibility of the nickel - iron - contaminated catalyst is sharply increased by the antimony depositing on the catalyst . the magnetic susceptibility of the newly added catalyst is virtually zero , whereas the magnetic susceptibility of the catalyst which has been in the unit for several months is approximately 1 to 200 × 10 − 6 emu \ g , giving a sharp difference on which the magnetic separator can operate to provide a separation between older and newer catalyst . ( the invention incorporating sb into a high value specialty catalyst additive particle during manufacture ) zsm - 5 and similar catalysts are covered by a number of patents , e . g . u . s . pat . nos . 3 , 702 , 886 ; 4 , 229 , 424 ; 4 , 080 , 397 ; ep 94693b1 ; and 4 , 562 , 055 , and is highly favored by the petroleum refining industry because it cracks hydrocarbon feedstocks in such a way as to produce higher octane gasoline . however , zsm - 5 costs approximately 2 - 4 times the cost of normal cracking catalyst conventionally used for fcc units . therefore , it is common practice to add some zsm - 5 particles along with a conventional product , e . g . foc - 90 or other conventional commercial catalyst . when withdrawing metal - contaminated catalyst , some of the zsm - 5 is removed and is conventionally landfilled or otherwise disposed of to waste . by incorporating 0 . 01 to 15 , more preferably 0 . 02 to 5 , and most preferably 0 . 03 to 2 % by wt . of antimony into the catalyst as it is made , a zsm - 5 catalyst can be “ tagged ” so that it separates preferentially from the conventional catalyst which does not contain substantial quantities of antimony . as the zsm - 5 / antimony tagged catalyst circulates , it is successively contacted with hydrocarbon fuel , separated from the hydrocarbon products , sent through a conventional regenerator to remove carbon , and is separated out ( a portion at a time ) to a magnetic separator . the magnetic separator preferentially separates the high magnetic susceptibility zsm - 5 catalyst which has had its magnetic susceptibility enhanced by the presence of antimony together with contaminating nickel and iron from the metal - containing hydrocarbon feed . alternatively , or supplementally , the highest magnetic fraction from the separator can be further processed through the same or an additional magnetic separator to still further concentrate ( beneficiate ) the zsm - 5 - containing catalyst . note that the common practice of adding antimony to fcc feedstocks can be conventionally combined with the invention , though it somewhat decreases the difference in magnetic susceptibility between the catalyst which was tagged with antimony during manufacture and that which was not because both will have some sb deposited on their surface from the feedstock being cracked . ( comparative ; the effect on magnetic susceptibility of the presence of iron versus the presence of nickel ) table 1 sets forth the magnetic susceptibility together with the parts per million of iron , nickel , and antimony for a series of different catalysts , all based on a commercially available petroleum cracking catalyst , foc - 90 manufactured by the filtrol division of akzo chemicals , inc ., a division of akzo nobel . as can be readily seen , the fe + foc - 90 ( 4 ) has a sharply increased magnetic susceptibility over sb + foc - 90 ( 2 ). this increase is enhanced as the nickel increases ( 3 and 4 ). when even a lower amount of nickel is added with 600 ppm of antimony ( 7 ), the magnetic susceptibility is dramatically increased by a factor of over four . this is only slightly affected by tripling the amount of nickel on the catalyst ( 6 ). thus , a major discovery of the invention is that antimony together with nickel plus iron is enormously higher in magnetic susceptibility than iron or nickel alone . thus , adding antimony , e . g . to a feed so that it deposits on a cracking catalyst gradually over time , can effectively sharpen the separation achieved by a magnetic separator operating on the catalyst . further evidence of such interaction between iron and antimony is evident in table ii . as can be seen , without antimony the magnetic susceptibility is at 2 . 89 × 10 − 6 emu / g . whereas with the addition of antimony , the magnetic susceptibility was increased by approximately 69 %, thus demonstrating the applicability of this invention . all magnetic susceptibilities supported in this application were measured by mathew - johnson magnetic susceptibility balance according to techniques recited in u . s . pat . no . 5 , 190 , 635 to hettinger , col . 6 , lines 8 - 16 . specific compositions , methods , or embodiments discussed are intended to be only illustrative of the invention disclosed by this specification . variation on these compositions , methods , or embodiments are readily apparent to a person of skill in the art based upon the teachings of this specification and are therefore intended to be included as part of the inventions disclosed herein . while foc - 90 is used in the examples , many other commercial catalysts can be used , e . g . davison / grace and / or engelhard . reference to documents made in the specification is intended to result in such patents or literature being expressly incorporated herein by reference . | 8 |
further aspects , features and advantages of this invention will become apparent from the detailed description which follows . polymers or polymer precursors of the present invention can be composed or synthesized according to a number of alternatives . for example , polymers can be formed by co - polymerizing one of the monomers from table 1 and one of the monomers from table 2 . also , polymers can be formed by co - polymerizing one of the monomers from table 1 , one of the monomers from table 2 , and one of the monomers from table 4 . polymer precursors can also be synthesized by co - polymerizing one of the monomers from table 3 , and one of the monomers from table 2 and / or one of the monomers from table 4 . alternatively , polymer precursors can be synthesized by self - polymerizing a monomer from table 1 , table 2 , table 3 or table 4 . the polymer precursors described above can be functionalized by attaching any suitable functional units such as bio - molecules to its reactive sites . the polymer is ether soluble in water in its precursor state or after functionalization . examples of suitable bio - molecules for functionalization may include , without limitation , carbohydrates , proteins , peptides , dna , rna , antibodies , antigens , enzymes , bacterias , redox molecules , host molecules , guest molecules , haptens , lipids , microbes , aptamers , sugars or the like . some specific examples of polymer precursors and functionalized polymers with suitable bio - molecules are shown in table 5 . the wavelength of energy absorbed by the polymers is about 700 - 1100 nm or above about 1100 nm , and the absorption can be adjusted by adjusting the degree of polymerization . the band gaps of the polymers are generally between about 0 . 8 ev and about 1 . 7 ev . in a number of cases , the band gaps are between about 1 . 1 ev and about 1 . 4 ev . the concepts of the present invention will now be further described by reference to the following non - limiting examples of specific polymers and exemplary techniques for their formation . it should be understood that additional polymers and additional techniques of formation are also comprehended by the present invention . scheme 1 below illustrates the synthesis of 4 , 7 - dibromo - 5 , 6 - diamine - benzo [ 1 , 2 , 5 ] thiadiazole 4 starting from benzo [ 1 , 2 , 5 ] thiadiazole . benzothiadiazole ( 10 . 0 g , 73 . 4 mmol ) and hbr ( 150 ml , 48 %) were added to a 500 ml three - necked round - bottomed flask . a solution containing br 2 ( 35 . 2 g , 220 . 3 mmol ) in hbr ( 100 ml ) was added dropwise very slowly . after the total addition of br 2 , the solution was heated at reflux for overnight . precipitation of a dark orange solid was noted . the mixture was cooled to room temperature , and a sufficient amount of a saturated solution of nahso 3 was added to completely consume any excess br 2 . the mixture was filtered under vacuum and washed exhaustively with water and dried under vacuum to yield the dibrominated product 2 , as confirmed by the following nuclear magnetic resonance ( nmr ) data obtained therefrom : 1 h nmr ( 500 mhz , cdcl3 ): δ 7 . 75 ( s , 2h ) ppm 4 , 7 - dibromobenzo [ 1 , 2 , 5 ] thiadiazole 2 ( 409 , 137 mmol ) was added to a mixture of fuming sulphuric acid ( 200 ml ) and fuming nitric acid ( 200 ml ) in small portions at 0 ° c . and then the reaction mixture was stirred at room temperature for 72 hrs . after 72 hrs , the mixture was poured into ice - water , the solid was filtered and washed with water several times , then recrystallized in ethanol to give compound 3 as a pale yellow solid . a mixture of 4 , 7 - dibromo - 5 , 6 - dinitro - benzo [ 1 , 2 , 5 ] thiadiazole 3 ( 10 g , 26 mmol ) and fine iron powder ( 10 g , 178 mmol ) in acetic acid was stirred at 80 ° c . until compound 3 completely disappeared monitored by thin layer chromatography ( tlc ). the reaction mixture was cooled down to room temperature and then precipitated in 5 % solution of naoh . the solid was filtered and washed with water several times . obtained filter cake was dissolved in hot ethyl acetate ( etoac ) and then filtered to remove unreacted iron , the filtrate was evaporated to remove solvent on a rotary evaporator to give 4 , 7 - dibromo - 5 , 6 - diamine - benzo [ 1 , 2 , 5 ] thiadiazole 4 as a yellow solid , as confirmed by the following nuclear magnetic resonance ( nmr ) data obtained therefrom : 1 h nmr ( 500 mhz , dmso ): δ 3 . 31 ( s , 4h ) ppm . scheme 2 below shows the synthesis of 1 , 2 - bis ( 4 -( 3 - bromopropoxy )- phenyl ) ethane - 1 , 2 - dione 6 starting from 1 , 2 - bis ( 4 - methoxyphenyl ) ethane - 1 , 2 - dione . 1 , 2 - bis ( 4 - methoxyphenyl ) ethane - 1 , 2 - dione ( 5 g , 18 . 52 mmol ) was dissolved in ch 2 cl 2 and cooled to − 78 ° c . ( solid occurred again ). bbr 3 ( 8 . 3 m , 87 . 82 mmol ) was added and mixture was allowed to warm to room temperature and stirred for 15 hrs . tlc check showed 1 , 2 - bis ( 4 - methoxyphenyl ) ethane - 1 , 2 - dione completely disappeared . the reaction mixture was poured into ice , extracted by etoac , washed with nacl solution , dried over mgso 4 . the solvent was removed by vacuum , and the residue was purified by column chromatography to give compound 5 , 1 , 2 - bis ( 4 - hydroxyphenyl ) ethane - 1 , 2 - dione , as confirmed by the following nuclear magnetic resonance ( nmr ) data obtained therefrom : 1 h nmr ( 500 mhz , dmso ): δ 10 . 8 ( s , 2h ), 7 . 71 ( d , j = 8 . 8 mhz , 4h ), 6 . 90 ( d , j = 8 . 8 mhz , 4h ) ppm . 1 , 2 - bis ( 4 - hydroxyphenyl ) ethane - 1 , 2 - dione ( 2 . 6 g , 10 . 74 mmol ) was dissolved in dmf and k 2 co 3 ( 5 . 9 g , 42 . 7 mmol ) was added , 100 mmol of 1 , 3 - dibromopropane and a catalytic amount of ki were then added . the mixture was heated to 80 ° c . and stirred for 3 days . tlc check showed 1 , 2 - bis ( 4 - hydroxyphenyl ) ethane - 1 , 2 - dione disappeared . dimethylformamide ( dmf ) was removed , and water was added , extracted by etoac , washed with brine , dried over mgso 4 . the solvent was removed and the residue was purified by column chromatography to give 1 , 2 - bis ( 4 -( 3 - bromopropoxy ) phenyl ) ethane - 1 , 2 - dione 6 as a pale yellow solid , as confirmed by the following nuclear magnetic resonance ( nmr ) data obtained therefrom : 1 h nmr ( 500 mhz , cdcl 3 ): δ 7 . 94 ( d , j = 8 . 8 mhz , 4h ), 6 . 99 ( d , j = 8 . 8 mhz , 4h ), 4 . 20 ( t , j = 6 . 2 mhz , 4h ), 3 . 61 ( t , j = 6 . 2 mhz , 4h ), 2 . 34 ( m , 4h ) ppm . 4 , 7 - dibromo - 5 , 6 - diamine - benzo [ 1 , 2 , 5 ] thiadiazole 4 ( 0 . 6 g , 1 . 23 mmol ) and 1 , 2 - bis ( 4 -( 3 - bromopropoxy ) phenyl ) ethane - 1 , 2 - dione 6 ( 0 . 4 g , 1 . 23 mmol ) were placed in a reaction flask , and acoh was added . the reaction mixture was heated to 125 ° c . and stirred for 3 . 5 hrs . tlc check showed both compound 4 and 6 disappeared . the mixture was cooled down to room temperature and poured into water , and then extracted by etoac , washed with brine , dried over mgso 4 . the residue was purified by column chromatography to give monomer 1 , 4 , 9 - dibromo - 6 , 7 - bis ( 4 -( 3 - bromopropoxy ) phenyl )-[ 1 , 2 , 5 ] thiadiazolo [ 3 , 4 - g ] quinoxaline as a orange solid , as confirmed by the following nuclear magnetic resonance ( nmr ) data obtained therefrom : 1 h nmr ( 500 mhz , cdcl 3 ): δ 7 . 77 ( d , j = 8 . 8 mhz , 4h ), 6 . 95 ( d , j = 8 . 8 mhz , 4h ), 4 . 19 ( t , j = 6 . 2 mhz , 4h ), 3 . 64 ( t , j = 6 . 3 mhz , 4h ), 2 . 37 ( m , 4h ) ppm . scheme 4 below shows the co - polymerization of monomer 1 and thiophene - 2 , 5 - diboronic acid to produce polymer 1 . 0 . 2 mmol of monomer 1 and 0 . 2 mmol of 2 , 5 - thiophene - diboronic acid , pd ( pph 3 ) 4 ( 8 mg ), k 2 co 3 ( 0 . 25 g ) were placed in three - neck flask and degassed , and then refilled with n 2 . 20 ml of tetrahydrofuran ( thf ) and 8 ml of water were added , and reaction mixture was heated to 85 ° c ., stirred for 24 hrs . the reaction was cooled down to room temperature and poured into ch 3 oh . collected polymer 1 was washed with ch 3 oh several times and dried by vacuum to give a dark solid . absorption of polymer 1 was measured and the spectrum is shown in fig1 . maximum wavelength absorption of energy by the polymer 1 can reach 1008 nm . 1 , 2 - bis ( 4 - hydroxyphenyl ) ethane - 1 , 2 - dione ( 2 . 6 g , 10 . 74 mmol ) was dissolved in acetone and k 2 co 3 ( 5 . 9 g , 42 . 7 mmol ) was added , then 80 mmol of 1 - bromo - 2 -( 2 -( 2 -( 2 - bromoethoxy ) ethoxy ) ethoxy ) ethane was added . the mixture was heated to 80 ° c . and stirred for 24 hrs . a tlc check showed 1 , 2 - bis ( 4 - hydroxyphenyl ) ethane - 1 , 2 - dione disappeared . acetone was removed , and water was added , extracted by etoac , washed with brine , dried over mgso 4 . the solvent was removed and residue was purified by column chromatography to give 1 , 2 - bis ( 4 -( 2 -( 2 -( 2 -( 2 - bromoethoxy ) ethoxy ) ethoxy ) ethoxy ) phenyl ) ethane - 1 , 2 - dione 7 as a pale yellow oil , as confirmed by the following nuclear magnetic resonance ( nmr ) data obtained therefrom : 1 h nmr ( 500 mhz , cdcl 3 ): δ 7 . 94 ( d , j = 8 . 8 mhz , 4h ), 6 . 99 ( d , j = 8 . 8 mhz , 4h ), 4 . 21 ( t , j = 4 . 8 mhz , 4h ), 3 . 88 ( t , j = 4 . 8 mhz , 4h ), 3 . 80 ( t , j = 6 . 3 mhz , 4h ), 3 . 78 - 3 . 66 ( m , 16h ), 3 . 46 ( t , j = 6 . 3 mhz , 4h ) ppm . 4 , 7 - dibromo - 5 , 6 - diamine - benzo [ 1 , 2 , 5 ] thiadiazole 4 ( 0 . 6 g , 1 . 23 mmol ) and 1 , 2 - bis ( 4 -( 2 -( 2 -( 2 -( 2 - bromoethoxy ) ethoxy ) ethoxy ) ethoxy ) phenyl ) ethane - 1 , 2 - dione 7 ( 0 . 89 g , 1 . 23 mmol ) were placed in a reaction flask , and acoh was added . the reaction mixture was heated to 125 ° c . and stirred for 3 . 5 hrs . a tlc check showed both compound 4 and 7 disappeared . the mixture was cooled down to room temperature and poured into water , and then extracted by etoac , washed with brine , dried over mgso 4 . the residue was purified by column chromatography to give monomer 2 , 4 , 9 - dibromo - 6 , 7 - bis ( 4 -( 2 -( 2 -( 2 -( 2 - bromoethoxy ) ethoxy ) ethoxy ) ethoxy )- phenyl )-[ 1 , 2 , 5 ] thiadiazolo [ 3 , 4 - g ] quinoxaline as an orange sticky oil , as confirmed by the following nuclear magnetic resonance ( nmr ) data obtained therefrom : 1 h nmr ( 500 mhz , cdcl 3 ): δ 7 . 75 ( d , j = 8 . 8 mhz , 4h ), 6 . 94 ( d , j = 8 . 8 mhz , 4h ), 4 . 20 ( t , j = 4 . 8 mhz , 4h ), 3 . 90 ( t , j = 4 . 8 mhz , 4h ), 3 . 82 ( t , j = 6 . 3 mhz , 4h ), 3 . 76 - 3 . 69 ( m , 16h ), 3 . 47 ( t , j = 6 . 3 mhz , 4h ) ppm . scheme 7 below shows the co - polymerization of monomer 2 and thiophene - 2 , 5 - diboronic acid to produce polymer 2 . 0 . 2 mmol of monomer 2 and 0 . 2 mmol of 2 , 5 - bis ( tributylstannyl ) thiophene , pd ( pph 3 ) 2 cl 2 ( or pd ( pph 3 ) 4 ) ( 8 mg ) were placed in a two - neck flask and degassed , and then refilled with n 2 . 20 ml of thf ( or toluene ) was added , and reaction mixture was heated to 85 ° c ., stirred for 24 hrs . the reaction mixture was cooled down to room temperature and then poured into ch 3 oh . collected precipitate was washed with ch 3 oh several times and recrystallized from ch 2 cl 2 / ch 3 oh and washed with ch 3 oh again and then dried by vacuum to give polymer 2 as a black solid . scheme 8 below shows an example of the conversion of polymer 2 to a bio - molecule derivatized water soluble polymer by attaching glucose to polymer 2 . 0 . 2 g of polymer 2 was dissolved in 8 ml of dmf in 25 ml single - neck round bottom flask . 0 . 2 g of 1 - thio - β - d - glucose was added , following by 0 . 5 g of anhydrous k 2 co 3 . the reaction mixture was stirred at room temperature for 30 hrs , and then transferred into a dialysis tube for dialysis against water for 2 days ( 8 water changes ). the solution obtained in dialysis tube was then transferred into a single - neck round bottom flask . after removal of water , glucose - functionalized polymer 2 was obtained as a black solid . glucose - functionalized polymer 2 has very good water solubility as shown in fig2 . shown on the left is monomer 2 in ch 2 cl 2 solution . shown in the middle is an upper layer of water and a lower layer of polymer 2 in ch 2 cl 2 solution . shown on the right is an upper layer of glucose - functionalized polymer 2 in water solution and a lower layer of ch 2 cl 2 . scheme 9 below shows the co - polymerization of monomer 3 and thiophene - 2 , 5 - diboronic acid to produce polymer 3 . 0 . 15 mmol of monomer 3 and 0 . 15 mmol of 2 , 5 - thiophene - diboronic acid , pd ( pph 3 ) 4 ( 8 mg ). k 2 co 3 ( 0 . 25 g ) were placed in two - neck flask and degassed , and then refilled with n 2 . 10 ml of thf and 5 ml of water were added , and reaction mixture was heated to 85 ° c ., stirred for 24 hrs . the reaction mixture was cooled down to room temperature and the water phase was extracted and transferred into a dialysis tube for dialysis against water for 2 days . then , the water solution in the dialysis tube was transferred into a single - neck round bottom flask , and the water was removed to give polymer 3 as a dark solid . polymer 3 has very good water solubility . scheme 10 below illustrates the synthesis of monomer 4 , 6 , 7 - bis ( 4 -( 2 -( 2 -( 2 -( 2 - bromoethoxy ) ethoxy ) ethoxy ) ethoxy ) phenyl )- 4 , 9 - bis ( 5 - bromothiophen - 2 - yl )-[ 1 , 2 , 5 ] thiadiazolo [ 3 , 4 - g ] quinoxaline , starting from monomer 2 . 2 . 0 g ( 1 . 98 mmol ) of monomer 2 and 40 mg of dichlorobis -( triphenylphosphine ) palladium were placed in a 50 ml two - neck round bottom flask , degassed and refilled with n 2 . anhydrous thf was added following by 2 -( tribytylstannyl ) thiophene ( 2 . 3 g , 4 . 96 mmol ). the mixture was heated to reflux . after stirring 4 hrs , the reaction mixture was cooled down to room temperature and poured into water , extracted with etoac . combined etoac layer was washed with water and dried over anhydrous mgso 4 . the solvent was removed and the residue was purified by chromatography to give monomer a , 6 , 7 - bis ( 4 -( 2 -( 2 -( 2 -( 2 - bromoethoxy ) ethoxy ) ethoxy ) ethoxy ) phenyl )- 4 , 9 - di ( thiophen - 2 - yl )-[ 1 , 2 , 5 ] thiadiazolo [ 3 , 4 - g ] quinoxaline as a dark blue sticky oil , as confirmed by the following nuclear magnetic resonance ( nmr ) data obtained therefrom : 1 h nmr ( 500 mhz , cdcl 3 ): δ 9 . 01 ( d , j = 4 . 0 mhz , 2h ), 7 . 81 ( d , j = 8 . 8 mhz , 4h ), 7 . 71 ( d , j = 5 . 0 mhz , 2h ), 7 . 34 ( m , 2h ), 6 . 98 ( d , j = 8 . 8 mhz , 4h ), 4 . 23 ( t , j = 4 . 8 mhz , 4h ), 3 . 94 ( t , j = 4 . 8 mhz , 4h ), 3 . 85 ( t , j = 6 . 3 mhz , 4h ), 3 . 80 - 3 . 72 ( m , 16h ), 3 . 49 ( t , j = 6 . 3 mhz , 4h ) ppm . monomer a ( 1 . 2 g , 1 . 19 mmol ) was dissolved in a 1 : 1 mixture of chloroform and acetic acid and n - bromosuccinimide ( 0 . 43 g , 2 . 42 mmol ) was added . the reaction mixture was stirred in darkness at room temperature for 3 hrs . a tlc check indicated complete reaction , and the mixture was poured into water and extracted with etoac . the combined organic layer was washed with brine solution and dried over anhydrous mgso 4 . after removal of solvent , the residue was purified by chromatography to afford monomer 4 , 6 , 7 - bis ( 4 -( 2 -( 2 -( 2 -( 2 - bromoethoxy ) ethoxy ) ethoxy ) ethoxy ) phenyl )- 4 , 9 - bis ( 5 - bromothiophen - 2 - yl )-[ 1 , 2 , 5 ] thiadiazolo [ 3 , 4 ] quinoxaline , as a dark sticky oil , as confirmed by the following nuclear magnetic resonance ( nmr ) data obtained therefrom : 1 h nmr ( 500 mhz , cdcl 3 ): δ 8 . 98 ( d , j = 4 . 0 mhz , 2h ), 7 . 74 ( d , j = 8 . 8 mhz , 4h ), 7 . 25 ( m , 2h ), 6 . 99 ( d , j = 8 . 8 mhz , 4h ), 4 . 24 ( t , j = 4 . 8 mhz , 4h ), 3 . 94 ( t , j = 4 . 8 mhz , 4h ), 3 . 82 ( t , j = 6 . 3 mhz , 4h ), 3 . 78 - 3 . 71 ( m , 16h ), 3 . 47 ( t , j = 6 . 3 mhz , 4h ) ppm . scheme 11 below shows the co - polymerization of monomer 4 and 1 , 4 - phenylenediboronic acid to produce polymer 4 . 0 . 2 mmol of monomer 4 and 0 . 2 mmol of 1 , 4 - phenylenediboronic acid , pd ( pph 3 ) 4 ( 8 mg ), kco 3 ( 0 . 25 g ) were placed in two - neck flask and degassed , and then refilled with n 2 . 20 ml of thf and 8 ml of water were added , and reaction mixture was heated to 85 ° c ., stirred for 24 hrs . the reaction mixture was cooled down to room temperature and then poured into ch 3 oh . collected precipitate was washed with ch 3 oh several times and recrystallized from ch 2 cl 2 / ch 3 oh and washed with ch 3 oh again and then dried by vacuum to give polymer 4 as a black solid . scheme 12 below shows an example of the conversion of polymer 4 to a bio - molecule derivatized water soluble polymer by attaching glucose to polymer 4 . 0 . 2 g of polymer 4 was dissolved in 8 ml of dmf in 25 ml single - neck round bottom flask . 0 . 2 g of 1 - thio - β - d - glucose was added , following by 0 . 5 g of anhydrous k 2 co 3 . the reaction mixture was stirred at room temperature for 30 hrs , and then transferred into a dialysis tube for dialysis against water for 2 days ( 10 water changes ). the solution obtained in dialysis tube was then transferred into a single - neck round bottom flask . after removal of water , glucose - functionalized polymer 4 was obtained as a black solid . glucose - functionalized polymer 4 has good water solubility as shown in fig3 . on the left is an upper layer of aqueous phase ( water ) and a lower layer of polymer 4 in ch 2 cl 2 solution . on the right is an upper layer of glucose - functionalized polymer 4 in water solution and a lower layer of ch 2 cl 2 . scheme 13 below shows an example of the conversion of polymer 2 to polymer 5 , with subsequent functionalization of polymer 5 with carboxylic acid groups , making cooh - functionalized polymer 5 water soluble . 0 . 3 g of polymer 2 was dissolved in 8 ml of thf in 25 ml single - neck round bottom flask . 0 . 4 g of k 2 co 3 was added , following by 0 . 5 ml of ethyl thioglycolate . after stirring at room temperature for 30 hrs , the whole mixture was poured into water and then filtered . the obtained solid was washed with water 2 times , then washed with ch 3 oh several times to yield polymer 5 . the obtained polymer 5 was directly used to do next step hydrolysis as described below without further purification . polymer 5 was dissolved in 10 ml of thf , and a solution of naoh ( 2 . 7 g ) in water ( 1 ml ) was added . a few seconds later after adding the naoh solution , a large amount of dark precipitates occurred in the reaction mixture . the mixture was stirred for about 5 minutes and then transferred into a dialysis tube for dialysis against water . the dark precipitates soon completely dissolved in water in the dialysis tube and the mixture was dialyzed against water for 2 days ( 8 water changes ). the solution in dialysis tube was then transferred into a single - neck round bottom flask and dried by lyophilization to give cooh - functionalized polymer 5 as a dark solid . cooh - functionalized polymer 5 has very good water solubility and its absorption in water was measured and the spectrum is shown in fig4 . maximum wavelength absorption of energy by the cooh - functionalized polymer 5 can reach about 950 nm . the cooh - functionalized polymer 5 shows a broad range of absorption beginning at about 700 nm in the visible region . the absorption continues past 1100 nm , which is well into the nir region . scheme 14 below shows an example of the conversion of cooh - functionalized polymer 5 to biotin - immobilized polymer 5 . 2 . 0 mg cooh - functionalized polymer 5 was dissolved in 0 . 2 ml of 0 . 1m mes buffer . 1 . 0 mg edc was dissolved in 0 . 1 ml di water . 1 . 0 mg sulf - nhs was dissolved in 0 . 1 ml di water . then , 27 μl of this edc solution and 50 μl of this sulf - nhs solution were added to the solution of step 1 ) and the whole mixture was incubated for 30 minutes . 1 . 0 mg biotin was dissolved in 0 . 1 ml dmso . 25 μl of this solution was added to the mixture of step 2 ). the whole mixture was incubated for overnight under gentle stirring then , the mixture was transferred into a dialysis tube for dialysis against water for 12 hrs ( 2 water changes ). after dialysis , the solution was transferred into a vial to dry by lyophilization to give biotin - immobilized polymer 5 . binding experiments of biotin - immobilized polymer 5 with streptavidin coated magnetic beads the above biotin - immobilized polymer 5 was used to incubate with streptavidin - coated magnetic beads following a reported procedure . the results , as observed by the naked eye , are shown in fig5 . on the left ( fig5 a ) is shown the binding experimental results for the streptavidin coated magnetic beads plus biotin - immobilized polymer 5 . in the middle ( fig5 b ) is shown the control experimental results for the streptavidin coated magnetic beads plus cooh - functionalized polymer 5 . on the right ( fig5 c ) is shown only the streptavidin coated magnetic beads . the binding and control experiments of the streptavidin coated magnetic beads and biotin - immobilized polymer 5 described above were carried out under the same conditions . after incubation , all the beads were washed with a coupling buffer 4 times . fig5 results are shown for the beads re - suspended in tris - buffer solution after the 4 washings . a color change can be visualized after the binding even without using fluorescence as signals to see the binding . for comparative purposes , a commercial available nir dye labeled biotin , atto 680 - biotin , was used to do the same binding experiment . the atto 680 - biotin used in the binding experiment is the same concentration and volume as biotin - immobilized polymer 5 used in the binding . fig6 shows the results of beads binding with atto 680 - biotin . on the left ( fig6 a ) is shown the atto 680 - biotin only . in the middle ( fig5 b ) is shown the binding of the streptavidin coated magnetic beads and atto 680 - biotin . on the right ( fig6 c ) is shown the streptavidin coated magnetic beads . fig7 shows comparative binding experimental results for magnetic beads binding with biotin - immobilized polymer 5 and atto 680 - biotin . on the left ( fig7 a ) is shown the binding for the streptavidin coated magnetic beads plus biotin - immobilized polymer 5 . in the middle ( fig7 b ) is shown the binding for the streptavidin coated magnetic beads plus the atto 680 - biotin . on the right ( fig7 c ) is shown the streptavidin coated magnetic beads . because of the water solubility of the polymers and their optical properties in the nir range , these polymers can be used as fluorescence signaling reagents in many bio - related applications in the life sciences , diagnostic testing markets , pharmaceutical market , and environmental testing and biological warfare agent detection markets . the water - soluble polymers above can also be used to form thin films by applying much lower potential in aqueous solution . these polymers can often be related to electro - conductive polymers with low band gaps . with both water soluble and electrically conductive properties , the polymers can be used in a biological related system for a number of applications , including as a conductor for electrical signals of biological origin and otherwise . any numbers expressing quantities of ingredients , constituents , reaction conditions , and so forth used in the specification are to be understood as being modified in all instances by the term “ about ”. notwithstanding that the numeric al ranges and parameters setting forth , the broad scope of the subject matter presented herein are approximations , the numerical values set forth are indicated as precisely as possible . any numerical value , however , may inherently contain certain errors or inaccuracies as evident from the standard deviation found in their respective measurement techniques . none of the features recited herein should be interpreted as invoking 35 u . s . c . § 112 , ¶ 6 , unless the term “ means ” is explicitly used . although the present invention has been described in connection with preferred embodiments thereof , it will be appreciated by those skilled in the art that additions , deletions , modifications , and substitutions not specifically described may be made without departing from the spirit and scope of the invention . | 7 |
the air cleansing module described herein may be used as part of a complete aircraft system to be used in an air filtration and sanitation capacity for cabins and / or fuel cells . the air cleansing module modifies existing aircraft air cleaning technology by containing oxidative species within a reaction chamber and / or dispersing the oxidative species into the atmosphere in question such as the aircraft cabin or pemfc air source . furthermore , prior art air purification generally uses uv lamps , but the present system uses a uv led array , which has the capacity to yield a finely tunable spectrum of uv wavelengths to target a wider range of contaminant species . it also provides a beneficial reacting coating on the surface of the module . the air cleansing module also cleanses air without the use of harmful chemicals and toxins making it a safe alternative to many air sanitation products . certain embodiments described herein are adaptations made to current monogram systems technology that is used to treat water . details of the water treatment system are provided in u . s . publication no . 2012 / 0051977 , the entire contents of which are incorporated herein by reference . the adaptations and modification provided herein allow the system to be used for air sanitation , cleansing , and treatment as well . fig1 shows one embodiment of an air treatment system 10 for aircraft cabins and / or proton exchange membrane fuel cells . in the embodiment shown , air enters through inlet 18 and exits from outlet 20 . this embodiment incorporates an ultraviolet ( uv ) source with a photo - catalytic oxidative ( pco ) coating on the inner reaction chamber surface . this pco coating interacts with the uv light to create radical oxidative species that are able to destroy pathogens adsorbed to the inner surface of the reaction chamber , pathogens resident in the volume of the reaction chamber , and pathogens moving in the air flow of the device . the uv light interacts with the photo - catalyst , so the uv source and the photo - catalyst are placed in close proximity to one another . the pco coating can be made from multiple different photo - catalytic surfaces . the most commonly used and effective pco material is titanium - dioxide ( tio 2 ). tio 2 has been shown to be non - toxic and a powerful source of hydroxyl and superoxide radicals . when these radicals are created , they react directly with pollutants in the air to destroy them . in the view of fig2 , the pco coating 13 is applied to the inner surface of the reaction chamber 12 . this coating can be applied either directly to this inner surface , or to protrusions 42 from the inner surface , as shown in fig3 . such protrusions 42 are used to induce turbulent flow of air and increase surface area , and may be referred to as fins 42 . turbulence inducing fins 42 , which are positioned in the interior of air flow space 22 , are intended to induce turbulence and agitate air in the system . the quartz tube or other sheath of the uv lamp may rest on these fins or teeth for support as well . in an alternate embodiment , the pco coating is not used directly . instead , a photo - catalyst coating of tio2 or equivalent with additional doping with silver , copper , and rhodium is used . in this embodiment , the system will eject radical species of hydroxyl , super - oxide , hydrogen peroxide , and ozone into the area of interest , which can render the system potentially more active when compared to the direct pco system , as the radical species attack pollutants at the point of interest , such as the aircraft cabin or pemfc air source , rather than in a reaction chamber . in one embodiment , the coating reacts with the airstream to release reactive species into the target atmosphere to perform the reactions therein . in another embodiment , the device may be located at the central circulation point or at an air distribution point . the structural features shown and described are all shown and described in co - pending application ser . no . 12 / 872 , 420 , publication no . 2012 / 0051977 , the entire contents of which are incorporated herein . the present inventors have modified the point - of - use water treatment system for use in disinfecting cabin air by including a reactive coating to interior of flow path , adapted interface points for aircraft environmental control system , optimized internal geometry to maximize contact time for airstream . the system 10 shown and described is generally constructed as a self - contained unit to be used as an air treatment system . referring now to the individual features of the system shown in fig1 , the reaction chamber 12 contains one or more germicidal uv light sources 14 , which are typically housed inside a sleeve 16 ( typically a quartz sleeve , but alternate sleeve options are within the scope of this invention and are described in more detail below ). air enters the treatment system 10 from a bottom inlet 18 , flows through the chamber 12 as described below , and exits through top outlet 20 , instantly ready for use . inlet 18 and outlet 20 are generally tubular or circumferential in nature . in one embodiment , inlet 18 is generally in fluid communication with an air source , such as an air tank or cabin duct air , and is configured to deliver air to the chamber 12 . outlet 20 extends out of the chamber 12 , and its free end is in fluid communication with an air - dispensing apparatus , such as a vent to deliver air to the end user or an inlet valve to deliver air to a proton exchange membrane fuel cell . for example , the system 10 may be placed in the air ducts of the cabin and the air can be purified either actively or passively . similarly , the device can be placed into the inlet tube for the cabin air into the pemfc with either the active or passive method as well . in the embodiment shown in fig2 , air entering the chamber 12 is directed through an air flow space 22 positioned generally in the center of the chamber 12 . air flow space 22 is typically an annular tube , although it should be understood that any appropriate channel or configuration may be provided . in this example , a uv light source 14 is generally positioned within the air flow space 22 in order to treat the air . the uv light source 14 positioned inside the air flow space 22 is generally protected by a sleeve 16 ( alternate options for which are described below ). the air to be treated enters the air flow space 22 , around the outside of the uv source 14 and sleeve 16 . the interior of the chamber wall 12 is covered with the pco coating 13 or the phfreme equivalent in order to produce radical oxidative species when contacted with the uv light . alternatively , in the embodiment shown in fig3 , air entering the chamber 12 is directed through an air flow space 22 positioned generally in the center of the chamber 12 , and one or two ( or more ) uv light sources 14 may be positioned alongside each side of the air flow space 22 within the chamber 12 , in order to treat the air . although two uv light sources 14 are shown and described , it should be understood that only a single uv source or more than two sources may be used . the interior of the chamber wall 42 should be covered ( at least partially , and in some instances , substantially fully coated ) with the pco coating or the phi / reme equivalent in order to produce radical oxidative species when contacted with the uv light . in either of these reaction chamber embodiments , one or more reflectors 24 may be positioned near or against the chamber wall 26 to help light reflection and enhance treatment . the reflector 24 may be a removable sleeve or liner inside the chamber 12 , and may be made of any appropriate reflective material , whether metal or non - metal . for example , exemplary reflectors may be made of ceramics or polymers , or may have coatings of ceramics or polymers , or specifically , may have polymeric coatings with a high gloss finish . alternate reflectors may be anodized aluminum - based , with or without the described coatings . in one embodiment , there may be provided an anodized coating that may have at least a portion stripped away in order to obtain conductivity and ground the unit for safety . in other words , the reflector can be etched to establish a conductivity point . even in the instance where a high gloss finish is used , there may be an etched portion to establish a contact point . the general intent for the reflectors is to provide as much reflection of the uv light back into the system as possible . uv light sources 14 are typically referred to as uv lamps . the uv lamps are typically enclosed by sleeves 16 to protect the lamps and help reflect light . the uv light source 14 may be any appropriate uv light source , such as low or high pressure uv lamps , standard uv bulbs , or light - emitting diode ( led ) sources , as described herein . the light is mounted so that as air passes through a flow chamber , uv rays are admitted and absorbed into the air stream . when uv energy is absorbed by the reproductive mechanisms of bacteria and viruses , the genetic material ( dna / rna ) is rearranged so that they can no longer reproduce , killing the bacteria and eliminating the risk of disease . uv treatment thus disinfects air without adding disinfection chemicals . in a preferred embodiment , the uv light source is provided as one or more light emitting diodes ( leds ) 30 that are positioned anywhere in the reaction chamber , as long as they are able to emit light having a disinfection wavelength to the air being treated . this may also be an array of leds with clusters emitting at different wavelengths so as to create a spectrum effect . the leds may either be positioned inside the air flow ( in a configuration similar to that shown in fig2 ) or positioned outside the air flow ( as shown in fig3 , 5 a , and 5 b ). the general goal is to expose the air in the flow passage to the uv led wavelength . any geometry that allows the leds to be arranged around or in the air is considered within the scope of this invention . for example , as shown in fig5 a , the uv light source may be provided as a set of one or more light emitting diode ( led ) units 28 . one example of an led unit 28 is shown in fig4 . the leds 30 themselves are manufactured to emit light in the ultraviolet range . they may be provided as individual leds 30 arranged in various positions directly on the chamber wall 26 , on or against air flow space 22 , or they may be arranged on units 28 as shown . if arranged on units 28 , one or more sides of the unit 28 may be provided with a reflective surface 32 in order to help reflect to the uv light emitted more effectively . the uv leds may be positioned in any desired configuration . one example is the box - shaped configuration shown in fig5 a , which is formed by two l - shaped units of fig4 . in the l - shaped embodiment shown , one or both panels 34 may be provided with a reflective surface 32 . in one specific use , the units 28 may be positioned around the air flow space 22 at angles to one another so that a box - shaped unit is formed . alternate configurations are possible and within the scope of this invention . for example , although an l - shaped led unit 28 and a box - shaped configuration are shown , it should be understood that any appropriately shaped unit may be used and is considered within the scope of this invention . for example , the unit 28 may be provided as a cylindrical or partially cylindrical unit ( e . g ., a tubular unit , a circular , round or oval unit , or a half circle unit , two partially separated halves ), a square or rectangular unit , single panels , a 3 - sided triangular unit , a straight or curved configuration , or any other appropriately shaped unit . moreover , although the leds 30 are shown as being provided in two rows in fig4 , it should be understood that fewer or more rows may be provided or that the leds may alternatively be scattered in random patterns along one or more panels 34 , along the inside wall of chamber , along the air flow space 22 , or in any other appropriate position in chamber 12 , as long as the leds are able to treat the air in the system . in the specific embodiment shown , the design of the unit has an l - shape array of uv leds and a corresponding l - shaped reflector that emits uv light and reflects on to the air to be treated . the uv led and reflector units may be used as structural components . this arrangement allows for the use of a larger quartz sleeve to maximize air flow rate . in other words , when a uv array is positioned on the outside of the air flow space , there is provided a larger passage for the air , which allows the air path to be larger , and as such , allows more air to be treated per pass . an alternative uv led arrangement with the array inset in the air flow / reaction chamber is diagrammed in fig5 b . in this embodiment , the leds are arranged on two flat panels , spaced to evenly illuminate a focal center . an alternative is to arrange leds on the concave side of a curved panel , and spaced to evenly illuminate a focal center , as shown in fig5 b . curvature can be of such a design that it facilitates the focus of light from illuminating leds into the target media , although other led configurations are possible and within the scope of this invention . the array of leds can be coated with a tio 2 layer , or an alternative photocatalyst to produce a pco reaction directly adjacent to the air flow . this provides a dual benefit of irradiating pathogens from a closer distance and providing a larger surface area for pco to occur . in one embodiment , inlet 18 is configured with at least one bend 36 , curve , or portion having a non - linear dimension along its length in order to prevent line of sight to the uv light source contained within the reaction chamber 12 . outlet 20 is also configured with at least one bend 38 , curve , or portion having a non - linear dimension along its length in order to prevent line of sight to the light source contained within the reaction chamber 12 . the bends 36 , 38 ( or curves or non - linear portions ) of this design are primarily intended to protect maintenance personnel or anyone else who may come into direct contact or otherwise have their eyes positioned at or near inlet 18 or the outlet 20 from being directly subjected to the uv light . the bends 36 , 38 prevent the uv light source from being immediately viewable , causing the light to refract and take differing paths along the inlet and outlet portions . the system 10 is typically provided with a minimal number of components and in certain embodiments , has a modular construction , as shown in fig6 . a modular construction provides increased ease of maintenance and replacement . in one embodiment , the modular construction is provided by three main components : a removable lower cap 44 comprising an inlet 18 , reaction chamber 12 , and removable upper cap 46 comprising an outlet 20 and a lamp housing 48 . however , it should be understood that the modular components may be provided alternatively as desired . the modularity provided by removable lower cap 44 and removable upper cap 46 allows easier cleaning , maintenance ( e . g ., disassembly and reassembly ), and access to the uv lamp . the caps may be secured to the chamber 12 by any appropriate mechanism , such as threaded , bolted , clamped , or any other securing means . as shown in fig7 , air inlet 18 may have one or more turbulence inducing fins 42 . in the specific embodiment shown , fins 42 are provided on the inside of lower cap portion 44 , and are intended to introduce turbulence into the air entering the air flow space 22 . causing agitation of the air and creating a vortex helps ensure circulation of the molecules in the air and distribution of the uv light through all air in the system . the turbulence also keeps the air in the air flow space 22 for a longer time , allowing for a lengthened contact time . the fins 42 may serve the additional ( or alternate ) function of supporting a uv lamp . in one embodiment , fins 42 are secured to the sides of cap portion 44 , as shown in fig8 and 9 . in this feature , the fins 42 create turbulence while also supporting a uv light source , providing dual functions . in one embodiment , one or more springs may be associated with the tripod , typically at the tripod base , which absorb shock and support the free end of the sleeve and uv light source . in effect , the tripod / spring combination helps vibrationally isolate the uv light source by absorbing potential shock rather than transferring shock to the uv lamp . the uv air disinfection system will be in communication with the environmental control system ( ecs ) to coordinate operation and conserve power . when the ecs is powered and operating at full capacity , such as during high - activity periods during flight or while on ground , the uv light source will be activated and air will be disinfected upon contact with the pco coating in the unit before distribution to consumers or passengers . if the ecs is operating below full capacity , the uv air disinfection system will incorporate signals from the ecs and fine - tune uv light intensity to give the appropriate dose for disinfection . the system will be deactivated when the ecs is no longer operating , for example during aircraft shutdown overnight . there may be features of certain hvac systems that may require different control mechanisms for a treatment module . for example , if the module is running all the time , it may be possible to provide “ once time ” air passes as desired . fig1 shows an embodiment of this invention positioned in an air duct . here , the device will emit radical oxidizers into the air stream which will then be carried by the inherent air flow in the duct to the target . changes and modifications , additions and deletions may be made to the structures and methods recited above and shown in the drawings without departing from the scope or spirit of the invention and the following claims . while the foregoing written description enables one of ordinary skill to make and use what is to be considered to be the best model thereof , those of ordinary skill will understand and appreciate the existence of variations , combinations , and equivalents of the specific embodiment , method , and examples herein . | 0 |
the present disclosure provides a method of producing stable genipin - rich extracts from the genipa americana plant . the process involves aqueous or polar solvent extraction and organic non - polar solvent extraction . the resulting powder form of genipin - rich extract is off - white in color and has genipin content up to about 97 %. the present disclosure further provides applications of the genipin - rich extracts in the production of natural heat - stable colorants and as a new cross - linking agent for use in a broad range of areas , such as foodstuffs , drugs , nutritional supplements , personal care products , cosmetics , animal feed , textiles , biodegradable polymers , and biomaterial production . the starting materials used in this process are fruits or leaves from a plant of genipa americana l . which is also known by numerous informal names : genipap , huito , jaguar , bilito , cafecillo denta , caruto , caruto rebalsero , confiture de singe , danipa , genipa , génipa , genipayer bitu , guaitil , guaricha , guayatil colorado , huitol , huitoc , huitu , irayol , jagua blanca , jagua amarilla , jagua colorado , jeipapeiro , juniper , maluco , mandipa , marmelade - box , nandipa , ñandipa genipapo , tapaculo , tapoeripa , taproepa totumillo , yagua , yanupa - i , yenipa - i , yenipapa bi , genipapo , huitoc , vito , chipara , guanapay , or other varieties such as jenipaporana , or jenipapo - bravo , etc . the fruit is optimal for harvest when mature in size , firm , and green to greenish brown in color . materials may be whole fruit , fruit pulp , fruit juice , fruit puree , fruit juice concentrate , dried powder from fruits or juice , water - insoluble part of fruit , and leaves from genipa americana l . in order to produce the genipin - rich extracts of the present invention , the mature fruits of genipa americana are processed with water or polar solvent in about 1 : 0 . 5 - 5 . 0 ( by weight ) ratios depending on extraction efficiency , preferably from about 1 : 1 - 1 . 5 ratios . after washing and / or blanching , the fruit is peeled and cut into pieces ; then milled or blended with water or polar solvents ; extracted with or without heating , the pulp , seeds and skin are separated by filtration ; and liquid is collected . extraction may take place for up to about 1 hour , preferably about 15 - 30 min , at a temperature of about 15 - 40 ° c . the water or polar solvent extraction from fruit pulp of genipa americana may be repeated 1 - 3 times . then , the ph of polar solvent extracts is measured and adjusted to about 3 . 8 - 4 . 0 using acids . concentration can be performed on a rotary evaporator with vacuum and temperature set at about 40 - 46 c . the solid content in the concentrate may be greater than 15 % w / w , preferably about 40 - 70 % w / w . next , the aqueous extract or the concentrated genipin - rich aqueous extract may be further extracted with non - polar organic solvents involving suitable mixing ( by shaking or agitation ) in a ratio of about 1 : 1 . those non - polar organic solvents have a polarity index from about 0 to 5 . 0 and water solubility less than about 30 %. the organic solvent phase is then separated from aqueous phase by settling and siphoning the top organic layer or by using a high speed centrifuge . non - polar solvent extraction may be repeated 2 - 3 times depending on the extraction efficiency . the genipin - rich extracts may subsequently be dried by evaporation and organic solvent can be recycled and reused for genipin extraction . the remaining yellow or off - white solid is a genipin - rich extract in which genipin content is at least about 70 % w / w of the solids . alternatively , the mature fruits of genipa americana are processed with organic solvents directly in a ratio of about 1 : 1 - 2 . after washing and / or blanching , the fruit is peeled and cut into pieces , then milled or blended , extracted with non - polar organic solvent directly , with or without heating , the pulp , seeds and skin are separated and the solvent extract is collected . extraction may take place for up to about 1 hour , preferably about 15 - 30 min at temperature of about 18 - 25 ° c . the organic solvent extraction may be repeated 2 - 3 times depending on the extraction efficiency . the genipin - rich extracts may subsequently be dried using an evaporator and condenser , and organic solvent can be recycled and reused . the resulting off - white or yellow solids is genipin - rich extract that contains genipin at greater than about 40 % w / w of solid . genipin - rich extracts may be aqueous or polar solvent extracts obtained from the starting material sources described . polar solvents include those with water solubility up to 100 % and polarity index greater than about 5 . 0 , such as water , acetic acid , methanol , ethanol , n - propanol , iso - propanol , dimethyl sulfoxide , dimethyl formamide , acetonitrile , acetone , dioxane tetrahydrofuran , etc ., or acetic , citric , phosphate acid buffer solutions , or mixtures thereof in different ratios . this list is not intended to limit the solvent used , however considering food safety , water , ethanol , n - propanol , iso - propanol , methanol and acetic , citric and phosphate acid buffer solutions , are preferred for food uses of the extract . genipin - rich extracts may alternatively be organic solvent extracts obtained from aqueous or polar solvent extracts described above . non - polar organic solvents include those with less than about 30 % of water solubility and a polarity index from 0 to about 5 . 0 , such as ethyl acetate , butyl acetate , n - butanol , diethyl ether , hexane , 2 - butanone , chloroform , 1 , 2 - dichloroethane , benzene , xylene , methyl - t - butyl ether , toluene , carbon tetrachloride , trichloroethylene , cyclohexane , pentane , and heptane , or mixtures thereof in different ratios . this list is not intended to limit solvent used , however considering food safety , ethyl acetate , butyl acetate , and n - butanol are preferred . genipin - rich extracts may alternatively be organic solvent extracts obtained from the starting material sources described . organic solvents include those with polarity index less than about 6 . 0 , and mixtures thereof in different ratios . the solvent or solvent mixture with low solubility in water is preferred in order to obtained colorless genipin - rich extracts . methods used for solid - liquid separation can be , for example , regular filtration , centrifugation , press filtration , and membrane cartridge filtration . the liquid - liquid separation can be done , for example , by using high speed centrifuge , or by settling and siphoning the required liquid layer . acids used for ph adjustment can be any organic or inorganic acids , selected to be suitable for the intended end use . concentration can be performed by any method known in the art , for example , by evaporation using a rotary vacuum evaporator , a flash evaporator , an osmosis filtration device , or an ultra - filtration device with a suitable membrane . genipin - rich extract is an off - white powder or crystals . some batches may have a slightly yellowish or greenish tint if purity is relatively low . the genipin content can be up to about 97 % ( w / w ) depending on the extraction method . no geniposide , geniposidic acid , or other iridoid compounds were found in genipin - rich extract when analyzed by hplc . the remainder of the composition of the genipin - rich extract is mainly moisture , fat , and also small amounts of acids and nitrogen - containing compounds , with the balance being carbohydrates , as noted in the following table . hplc methods can be used to determine genipin content and perform other iridoid analysis . genipin content of the off - white genipin - rich powder is stable when stored at refrigerated temperatures . genipin level decreased by less than about 5 % after 3 months of storage . however , when mixing genipin - rich extract with compounds having a primary amine group , genipin will quickly react and generate colorants and / or polymers . high genipin content extract readily dissolves in alcohol , alcohol - water mixtures , or hot water . its solubility in cold water is limited . the present invention also provides a method of manufacturing a blue colorant by using the genipin - rich extract reaction and mixing with water and amino acids , for example ( but not limited to ), lysine , histidine , arginine , glutamine , asparagine , methionine , glycine , glutamic acids , tyrosine , valine , alanine , serine , leucine , taurine , carnitine , ornithine and citrulline , in the presence of oxygen . heating can be used to accelerate the reaction speed . the molar ratios of genipin - rich extract to amino acids are from about 1 : 0 . 5 to about 1 : 10 . the blue shades generated are variable among deep blue , violet - blue , bright - blue , and greenish - blue depending on the amino acid used . the blue colorant generated from genipin - rich extract is a heat - and acid - stable pigment . similar blue colorants also can be generated by reaction of the genipin - rich extract with other extracts , fruit and vegetable juices , plant and animal materials , including dairy and egg products , which contain amino acids , polypeptides , proteins , and compounds with one or more primary amine groups . the blue color also can be generated by reaction of the genipin - rich extract with collagen , gelatin , chitosan , enzymes , and microbes . the colorant produced can be further concentrated or deposited on clay or other carriers and used in foods , cosmetic ( toothpaste , makeup , hair dye , etc ), and textile ( clothes ) applications . the present invention provides a method of manufacturing a red colorant by using the genipin - rich extract . the genipin - rich extract is hydrolyzed to remove a methyl group and convert the genipin to genipinic acid which further reacts with amine - containing compounds , with extra organic acid present and under anaerobic conditions , to generate red pigment . heating can be used to accelerate red pigment formation . the red solution can be further purified on an ion exchange column and the eluted material can be concentrated on a rotary vacuum evaporator . the genipa red is a heat - stable pigment , and is also stable at a high ph . genipin - rich extract can be dispersed or dissolved in about 5 - 50 % ethanol , preferably about 5 - 15 % ethanol , and about 0 . 5 - 1 . 5 n sodium hydroxide or potassium hydroxide solution , to a concentration of extract of about 5 - 10 % w / w . hydrolysis can be performed with or without heating for from about 30 min to 24 hours , preferably about 2 - 10 hours under room temperature (˜ 20 ° c .). hydrolyzed genipin - rich extract can be neutralized in ph by using acids , preferably organic acids , such as acetic acid , formic acid , lactic acid , citric acid , tartaric acid , adipic acid , oxalic acid , succinic acid , fumaric acid , and malic acid , preferably acetic acid and / or tartaric acid . the ph of hydrolyzed solution can be adjusted to the about 3 . 5 - 5 . 0 range . the acidified solution is then heated to about 65 - 85 ° c ., and preferably about 70 - 75 ° c ., for about 5 - 120 minutes , preferably about 10 - 20 minutes . the insoluble brown by - products are removed since they will not contribute to red color formation . precipitate separation can be accomplished by any of the filtration or centrifugation methods known in the art , for example , using regular filtration , centrifuge , press filtration , or tangential flow filtration or membrane cartridge filtration methods . formation of the insoluble brown by - products can be further enhanced by the addition of calcium carbonate to adjust the ph to about 5 - 7 . 5 and mixing for about 5 - 30 minutes . precipitation separation can be accomplished by the methods described above . the clear solution described above can be adjusted to ph about 4 . 0 - 4 . 6 with organic acid or salt , preferably acetic acid and / or sodium acetate . red color is generated after mixing with compounds having primary amine groups and heating to about 70 - 95 ° c ., preferably about 80 - 85 ° c ., for about 2 hours , or about 90 - 95 ° c ., for about 1 hour . the compounds with primary amine groups can be selected from amino acids , such as alanine , arginine , lysine , aspartic acid , glutamic acid , glycine , histidine , valine , leucine , and serine . this listing is not intended to limit useful compounds with primary amine groups . the present invention , in addition , provides a method of manufacturing green colorant by using the genipin - rich extract . genipin - rich extract can react with certain amino acids , such as isoleucine , threonine , cysteine , and tryptophan , to generate green color . it also can react with primary amine - containing compounds and mix with carotenoids , annatto , and turmeric pigments to generate green color . since genipa green can provide a heat resistant green shade , it is very useful in the food industry because of heat instability of the natural green pigment , chlorophyll . similar green colorants also can be generated by reaction of the genipin - rich extract with other extracts , fruit and vegetable juice , plant and animal materials , including dairy and egg products , which are rich in amino acids , for example , isoleucine , threonine , cysteine , and tryptophan . the green color also can be generated by reaction of the genipin - rich extract with collagen , gelatin , chitosan , enzymes and microbes and mixing with carotenoids , annatto , and turmeric pigments to generate green color . the colorant produced can be further concentrated or deposited on clay or other carriers and used in foods , cosmetic ( toothpaste , makeup , hair dye , etc ), and textile ( clothes ) applications . the present invention , in addition , provides a means to generate other colorants , like purple , red , yellow , orange , brown , and black by using the genipin - rich extract . purples and reds can be created by mixing genipin - rich extract with carmine , beet juice , and anthcyanin colorants and solution with amine - containing compounds . oranges and yellows can be created by reacting genipin - rich extract with pentoses , such as xylose , ribose , or vitamin c . black color shade can be generated when alkaline earth metals ( e . g . magnesium or calcium ), or metals with multi - valences are involved during genipin reaction with compounds containing a primary amine group . the present invention provides new materials which contain up to about 97 % of genipin content . genipin - rich extract can react with any compound that contains a primary amine group , such as collagen , gelatin , chitosan , glucosamine , and various enzymes and proteins , to form new texture materials used in , for example , the food , cosmetic , biomaterial , and polymer industries . the present invention also provides a cross - linking agent obtained from the natural plant , genipa americana , which can replace synthesized chemicals , such as glutaraldehyde , formaldehyde , glyoxal , malonaldehyde , succinaldehyde , epoxy compounds , etc . genipin - rich extract used as a cross - linking agent has a much lower toxicity than those commonly used synthetic cross - linking reagents . genipin - rich extract can work as a natural cross - linking agent for encapsulation production in the food and pharmaceutical industries . encapsulated materials can be nutritional ingredients , such as omega - 3 oil , vitamin a , conjugated linolenic oil , or medicines . gelatin , collagen , whey proteins , casein , chitosan , soy proteins , and other plant or animal proteins , are good starting materials in conjunction with the genipin - rich extract to use to make an encapsulation shell , film or micro - membrane . the products have good thermal and mechanical stability , as well as their biocompatible property . following examples are provided for purpose of further illustrating the present disclosure , but should in no sense be taken as limiting . a ) huito fruits were peeled to yield 866 . 0 g of peeled fruit . the peeled fruit was cut into pieces and blended with 1300 g of deionized ( di ) water and pureed with a blender to produce a puree ; b ) the puree was allowed to stand for 15 min at room temperature ; and the insoluble solid was separated from the aqueous extract by filtration . then , 1212 . 4 g of di water was added to the filtrate and mixed for 15 minutes followed by a second filtration step ; c ) the filtrate was adjusted to ph & lt ; 4 . 0 using citric acid , and concentrated to 25 - 55 % ( w / w ) of solid content on a rotovapor ; d ) then , the concentrated aqueous extract was extracted using ethyl acetate in a 1 : 1 ratio . the colorless or slightly yellow clear ethyl acetate layer was collected . this liquid - liquid extraction was repeated 2 times ; e ) next , the combined ethyl acetate extract layers were evaporated on a rotovapor at a temperature of 40 ° c . and vacuum of 35 mm hg to remove the solvent . condensed ethyl acetate can be reused for genipin extraction . after evaporating the ethyl acetate , an off - white or slightly yellow powder was obtained . the powder contained 74 . 4 % w / w of genipin . a ) huito fruits , 462 g , were peeled and blended with di water 537 g to produce puree ; b ) the puree was allowed to stand for 15 min at room temperature , and the insoluble solid was separated from aqueous extract by filtration . then , the same quantity of di water was added to the solid part , and the extraction step was repeated 2 times ; c ) the combined aqueous extract was adjusted to ph & lt ; 4 . 0 using citric acid and concentrated to 24 . 92 % ( w / w ) of solid content via a rotovapor ; d ) then , the concentrated aqueous extract was extracted using butyl acetate in 1 : 1 ratio . the colorless or slightly yellow clear butyl acetate layer was collected . this liquid - liquid extraction was repeated 2 times ; e ) next , the combined butyl acetate extract was evaporated on a rotovapor at a temperature of 55 ° c . and vacuum of 35 mm hg to remove the solvent . condensed butyl acetate can be reused for genipin extraction . after evaporating butyl acetate , an off - white or slightly yellow powder was obtained . the powder contains 90 . 9 % w / w of genipin . the genipin - rich extract made by the method in example 2 was tested for stability . genipin - rich powder , 0 . 20 g each , was sealed in vials and stored at 4 ° c . samples were pulled at 0 , 4 wks , 6 wks , and 12 wks , and genipin content was tested by using the hplc method . results are shown in table 1 . fifteen grams of genipin - rich extract made by the method in example 1 was dissolved in 118 . 10 g of 10 % ethanol solution . 16 . 89 g of 0 . 9 n solution of koh was added to the above mixture and the genipin was hydrolyzed with stirring at room temperature ( 22 ° c .) for 7 . 5 hours . the ph of the hydrolyzed solution was adjusted to less than 4 . 0 with tartaric acid . the solution was heated to 74 ° c . for 15 min and cooled . the precipitate was filtered out through # 2 filter paper . next , the ph of the filtrate was adjusted to ˜ 6 . 5 using calcium carbonate and the slurry was mixed for 10 minutes . the resulting precipitate was filtered off and the filtrate ph was adjusted to 4 . 0 - 4 . 5 by the addition of acetic acid . after alanine ( 4 . 50 g ) was added , genipin red color was developed by heating to 82 ° c . for 2 hrs . the color was analyzed by taking 0 . 30 g of genipin red color and diluting to 30 . 0 g with di water . l -, a -, and b - values were measured on a hunter lab spectrometer , and the absorption curve measured on a uv / vis spectrometer . results are shown in the following table . three grams of genipin - rich extract made by the method in example 2 was dissolved in 23 . 5 g of 10 % ethanol solution . 3 . 78 g of 1 . 0n solution of koh was added to the above mixture and the genipin was hydrolyzed with stirring at room temperature ( 22 ° c .) for 8 . 0 hours . the ph of the hydrolyzed solution was adjusted to less than 4 . 0 with tartaric acid . the solution was heated to 74 ° c . for 15 minutes and cooled . the precipate was removed by filtration on # 2 filter paper . next , the ph of the filtrate was adjusted to ˜ 7 . 0 using calcium carbonate and the slurry was mixed for 15 minutes . the resulting precipate was filtered off and the filtrate ph was adjusted to 4 . 0 - 4 . 5 by the addition of acetic acid . after alanine ( 1 . 20 g ) was added , genipin red color was developed by heating to 84 ° c . for 2 hours . the color was analyzed by taking 0 . 50 g of genipin red color and diluting to 30 . 0 g with di water . l -, a -, and b - values were measured on a hunter lab spectrometer , and the absorption curve measured on a uv / vis spectrometer . results are shown in the following table . one and a half grams of genipin - rich extract made by the method in example 2 was dissolved in 11 . 8 g of 10 % ethanol solution . 1 . 97 g of 1 . 0n solution of koh was added to the above mixture and the genipin was hydrolyzed with stirring at room temperature ( 22 ° c .) for 8 . 0 hours . the ph of the hydrolyzed solution was adjusted to less than 4 . 0 with tartaric acid . the solution was heated to 74 ° c . for 15 minutes and cooled . the precipitate was removed by filtration through # 2 filter paper . next , the ph of the filtrate was adjusted to ˜ 7 . 0 using calcium carbonate and the slurry was mixed for 15 minutes . the resulting precipitate was filtered off and the filtrate ph was adjusted to 4 . 0 - 4 . 5 by the addition of acetic acid . after alanine ( 0 . 60 g ), taurine ( 0 . 60 g ), and magnesium chloride ( 0 . 4486 g ) was added , a dark brown - black color was developed by heating to 84 ° c . for 2 hours . the color was analyzed by taking 1 . 0 g of genipin color and diluting to 30 . 0 g with di water . l -, a -, and b - values were measured on a hunter lab spectrometer , and the absorption curve measured on a uv / vis spectrometer . results are shown in the following table . 0 . 108 g of genipin - rich extract , made by the method in example 2 , was dispersed in 8 . 6 g of 8 % ethanol aqueous solution in a test tube . solids were completely dissolved after heating in a ˜ 50 ° c . water bath . then , 1 . 0 ml aliquots of the above genipin solution was put into test tubes separately and l - threonine 0 . 012 g , l - isoleucine 0 . 014 g , or l - histidine 0 . 016 g , respectively , were added . all test tubes were heated in an 80 ° c . water bath for 2 hours . the color was analyzed by taking 0 . 30 g of genipin color produced and diluting to 30 . 0 g with di water . l -, a -, and b - values were measured on a hunter lab spectrometer , and the absorption curve measured on a uv / vis spectrometer . results are shown in the following table . 0 . 37 g of genipin - rich extract , made by the method in example 2 , was dispersed in 34 . 63 g of 10 % ethanol aqueous solution in a beaker . alanine 0 . 7 g , and xylose , 1 . 4 g , were added and dissolved . sample heated at 92 ° c . for 1 hour . after cooling , the color was analyzed by taking 1 . 50 g of the color solution and diluting to 30 . 0 g with di water . the color was observed to be orange - red in contrast to the red color observed when alanine was mixed alone with the genipin - rich extract . l -, a -, and b - values were measured on a hunter lab spectrometer , and the results are shown in the following table . | 0 |
in an embodiment of the present invention , a backplane device using a 3 - tft approach is used ( 1 dual gate selection tft + 1 transfer tft ). compared to a 3 - tft lc backplane setup for a spatial light modulator as described in ep10156572 . 9 or in pct / ep / 2011 / 053912 , an oled is inserted instead of the pixel capacity . accordingly , the basic principle of the backplane device disclosed in ep10156572 . 9 or in pct / ep / 2011 / 053912 can be applied to the backplane device for the light source array or light source matrix according to the present invention . therefore , the entire content of the documents ep10156572 . 9 or pct / ep / 2011 / 053912 is incorporated herein by reference . for the backplane according to the present invention the voltage source connected to the analog line is replaced by a current source . the tfts are switching only digital , such there is no analog feedback into the pixel or into the circuitry of the pixel . the current flow is not regulated in the pixel circuit but thru outside drivers . this is especially applied for a cluster of the backplane device , wherein the backplane device comprises at least two , preferably many clusters . fig1 shows a 4 × 4 pixel cluster of an embodiment of a backplane design . fig2 a and 2 b show in an enlarged representation two examples of the circuitry being used as a pixel circuitry 20 to drive one oled , which might be used as one pixel of the 4 × 4 pixel cluster as shown in fig1 in the dotted circle . the schematic representation of the address decoder 24 for the x 0 to x 3 lines is shown by the rectangle above the 4 × 4 pixel cluster in fig1 . the schematic representation of the address decoder 24 for the y 0 to y 3 lines is shown by the rectangle on the left hand side of the 4 × 4 pixel cluster in fig1 . even though not shown in fig1 , it is also possible that the transistors of the x address decoder and / or the y address decoder is integrated into the 4 × 4 pixel cluster . in other words , the transistors of the x address decoder and / or the y address decoder can be placed in between the pixels , such that a seamless sequence or arrangement of the pixel clusters can be achieved without gaps , even if every single pixel cluster comprises its own x address decoder and / or the y address decoder . the placement of the transistors of the x address decoder and / or the y address decoder can be done in a manner such that the transistors of the x address decoder and / or the y address decoder are not accumulated at one location , but rather are spread over the area of the cluster . the backplane device 16 according to the present invention therefore might comprise pixel circuitries for providing the on / off control of single pixels 14 . furthermore , address decoder circuits might be provided for addressing single pixels 14 . at least one address decoder circuit for a pixel cluster 18 might be assigned and / or located on the backplane device 16 at or near the location of the pixel cluster 18 either at the margin or the periphery of the pixel cluster 18 , as shown schematically in fig8 . alternatively , at least one address decoder circuit for a pixel cluster 18 might be integrated into and therefore might be located in the pixel cluster 18 . the address decoder circuit for a pixel cluster 18 might be distributed within the pixel cluster 18 . oled driving : a driving scheme is assumed that supports individual activation and deactivation of the pixels 14 / oleds di , 500 . a 3 - tft solution described for oled driving is shown in fig2 a and 2 b and fig9 and 10 and is adapted in a way to use the transfer - tft ( t_ti , 300 ) like a switch to close or open the connection between the analog line 22 and a ground line via the oled di , 500 . the selection tfts t_yi , 100 and t_xi , 200 in fig2 a , 2 b , 9 and 10 are used to address only one single pixel per cluster . the logic level of the “ enable ”- line 30 as shown in fig2 a , 2 b , 9 , 10 selects the type of the operation , e . g . ‘ 1 ’= enable and ‘ 0 ’= disable . after the address operation the current voltage value at the gate g of the transfer tft t_ti , 300 is maintained by the additional gate storage capacity c_si , see fig2 a , 2 b . nearly the same principle is used to store values in dram memory cells . the backplane device can be adapted such that a pixel being enabled by an enable address operation remains enabled the hole frame until it is disabled by a disable address operation . at frame start all pixels 14 are disabled . first a number of pixels 14 are enabled . if a predetermined ( e . g . a medium ) number n of pixels are enabled , the analog line is used to apply a current i t = n * i p were i p is the predetermined or desired current thru each oled pixel of the n enabled pixels . the total current i t is regulated by an external programmable current source connected to the oled display . if the number n of enabled pixels is changed , the current provided by the current source must be also adjusted to the new values . because only one pixel is enabled or disabled per address cycle in one embodiment the approximate value of the total current is changing only slowly compared to the address operations , if the total number n is quite high . for oled displays with very low gray scale resolution and a broad uniformity of the brightness , it can be supposed that the threshold voltages of all oleds are approximately equal and the r on of all transfer tfts ( t_ti , 300 ) are also approximately equal . now the brightness of an oled pixel can be adjusted by the duration an oled pixel is enabled . so the brightest pixels are switched on early in the frame and are disabled at the end of the frame . in other words , the light source of the pixel is to be operated for a pre - determinable time period . black pixels are not activated and dark pixels are only activated for a short time . because of the non linear characteristic curve of an oled , very small variations of the threshold voltage will result in large variations of the oled current ( i = f ( u )). if oleds with different threshold voltages are connected in parallel , the currents are not equally divided up between all enabled pixels . to compensate for this , the time an oled pixel is enabled must be adjusted by a correction factor computed from the current - voltage response curve of this pixel and from the curves of all other enabled pixels . if a large number of pixels are enabled , it is possible to use an average voltage response curve instead of the superposition of all other enabled pixels . this will reduce computing effort , because only a correction value stored for each pixel must be multiplied with the desired pixel brightness to compute the on - time of a pixel . however , this shows that a classification of the pixels and in particular of the oleds of the pixels according to a pixel characteristic is helpful for determining the order of switching the single light sources on and / or off depending on the pixel characteristic . if the threshold voltages are too different , nearly all current flows thru the oleds with the lowest threshold voltages . to prevent this , only oled pixels with similar threshold voltages are enabled at one time . for instance , pixels with high threshold voltages at frame start and pixels with low at the end . in this case , the average voltage response curve used to compute the correction values must be adapted equally to the average values of the enabled pixels . a calibration for all pixels might be performed , in order to determine the pixels with similar threshold voltages . this can be done by applying the measurement schemes mentioned above . these characteristics might be stored . in an embodiment of the present invention , a switch on is only performed for pixels with the similar threshold voltage . therefore , the pixels are sorted by the oled threshold voltage vt as a pixel characteristic . a number n of pixels with similar vt are connected to the analog line 22 . a programmable current source ( i_analog ) is connected to the analog line 22 . the total current ( i_analog ) is divided by the number of the parallel connected oled pixels . the current thru one oled di is about i_pixel = i_analog / n . the measurement of pixel characteristics can be performed as follows : if only one oled pixel per cluster is selected ( t_t conductive ) the electrical characteristics of each single oled can be measured one by one thru the analog line 22 . this can be done once after power - up or in the background . if for instance 1 % of the frame time is used to measure 1 % of the pixels , the measurement - cycle of 100 frames is short enough to compensate for aging effects . aging effects of oleds and a - si tfts are normally in time periods greater than 120 s . it is possible to measure the threshold voltage but also the voltage to current response curve according to the measurement schemes mentioned above . in a preferred embodiment , there is provided an external current regulation and a maximum current driving . an oled pixel ( i . e . the oled light source of a pixel ) is connected to the analog line 22 being adapted to act as a current source and is enabled by the enable operation ( enable line 30 on , x and y address line 26 , 28 on ). if a new pixel is connected to the analog line 22 , the total current i_analog has to be increased by the external programmable current source in order to maintain the maximum current flowing thru each enabled pixel and therefore through each oled light source of the enabled pixels . depending on the pixel brightness , after a time period the pixel is disconnected from the analog line by a disable operation ( x and y address line 26 , 28 on , enable line 30 off ). the start of the time period of a pixel being enabled is defined by its threshold voltage . the duration of the time period is defined mainly by the brightness of the pixel . because a large number of pixels are enabled at the same time the threshold voltages of these pixels are similar but not equal . this might result in small variations from the ideal current i_pixel = i_analog / n . a compensation with small offset values for start and duration ( position and length ) of the time period is computed depending on the division of the currents between the enabled pixels . because a pixel with maximum brightness is enabled only for a portion of the frame time , the oleds are pulsed with adapted higher maximum pixel current . additionally or alternatively , driving the oleds with different currents is provided . an oled display offers a very large on / off contrast ratio . depending on the desired brightness - resolution the time period of a very dark pixel is too short to address , if the pixel is driven with the maximum current for this pixel . to solve this problem , all dark pixels with similar threshold voltage vt are enabled only on special dark periods , where the driving current is reduced to a small portion of the maximum current ( for instance 10 %). the bright pixels with similar threshold voltage vt can be enabled at the dark period too , to shorten their duty cycle . but if these pixels are disabled , the current division is improved because of the lower number of pixels enabled at the same time . therefore , depending on the pixel characteristics , at least two groups g 1 , g 2 of pixels can be determined . the pixels of each pixel group g 1 or g 2 can be controlled collectively . two groups g 1 , g 2 of pixels are indicated by the different dotted lines of the two groups of pixels g 1 and g 2 as shown in fig1 . this might be applied on the complete light source matrix or in a cluster . in an implementation for an oled backplane structure or a backplane device 16 clusters 18 of pixels are used and the oled backplane structure comprises preferably only digital switching tfts ( thin film transistors ). a cluster of pixels in the sense of the present application is especially a plurality of pixels forming a connected or a contiguous region of the light source matrix or of the display . such a region might have a rectangular shape , a square shape , a honeycomb shape or any other suitable shape . preferably , a cluster does not extend over a full width or a full length of the display . several clusters can be arranged next to each other in a seamless manner . a cluster can be regarded as a sub - display . if negated and non negated address lines are used , address decoders can be integrated using only nmos a - si tfts . this requires a doubled amount of global address lines compared to a cmos implementation . a display with 60 fps ( frames per second ) and 64 × 64 pixels per clusters need an a - si tft switching frequency of about 350 khz . a total of 0 . 22 tfts / pixel are needed to implement the address decoders . so this embodiment enables a driving of the oleds using a - si address decoders . fig3 shows an example cluster design comprising 4 × 4 pixels . fig3 shows furthermore the pixel circuit and the address decoder circuits not being embedded into the pixel matrix . the address decoder circuits as shown above and to the left hand side of the 4 × 4 pixel circuitry in fig3 correspond to the x and y address decoders 24 indicated by the rectangles as shown in fig1 . the static and dynamic pixel characteristics can be predicted with suitable models in order to compute the values for the external current source and the address operations . because the backplane circuit is only driven by digital values to compensate for the large tft variations , the analog pixel characteristics have to be measured / determined by external circuits . it might be necessary that a frame memory and a computing unit are needed to determine the driving parameters for each pixel . the characteristics of the backplane device according to a preferred embodiment can be outlined by the following features : a light source matrix with oled light sources used as a display with only 3 . 25 tfts / pixel are provided . a - si , p - si and amorphous oxide tfts are possible . digital switching tfts marginalize the ltps threshold voltages variations . power savings can be achieved because the oleds are directly driven through the very low r on of the transfer - tft . only one dac ( digital to analog converter ) per cluster is needed , not one per column line . the present invention supports very high on / off current ratios . new pixel circuits are achieved by multiplexing of an analog - line and one address - line , a combination of the enable - line and one address - line or both . more than 10 variations are possible , depending on the specific characteristic of the behaviour of the oleds . four examples are illustrated in fig2 a , 2 b , 9 and 10 . as address decoders normal existing variants like “ nand address decoder ” or “ nor address decoder ” can be applied . the address decoders can be embedded into the pixel matrix or can be arranged not being embedded into the pixel matrix . a global data distribution can be achieved by applying shift registers and / or global lines with amplification and / or global lines with a threshold circuit . examples for that are described e . g . in wo 2009 / 024523 a1 or wo 2009 / 092717 a1 . fig4 shows an example of a driving scheme for an example 4 × 4 pixel cluster which is shown in fig1 or 3 . the tables being shown in fig4 b are to be completed on the right hand side of the tables shown in fig4 a . in fig4 a the x and y addressing and the enable e operation is shown . in the left table of fig4 a , the y - addressing operations of two the global y - addressing lines g_y 0 and g_y 1 as well as the four y - addressing lines y 0 , y 1 , y 2 and y 3 are shown . in the middle table of fig4 a , the x - addressing operations of two the global x - addressing lines g_x 0 and g_x 1 as well as of the four x - addressing lines x 0 , x 1 , x 2 and x 3 are shown . in the very left table entry of fig4 a , the enable or disable operation on the enable line of the pixel cluster is indicated . this is also shown in the very right table of fig4 a . the order of addressing and enabling is done from the top row to the bottom row in a sequential order . in the upper left table of fig4 b , the logic levels on the gates g 00 to g 33 of the transfer transistors of the pixels p 00 to p 33 are shown as a consequence of the addressing and enabling operations as shown in fig4 a . the reference g 00 relates to the gate of the transfer transistor of the pixel p 00 , the reference g 01 relates to the gate of the transfer transistor of the pixel p 01 and so on . a transfer transistor can either be in a conductive state — then the logic level is 1 — or in a non - conductive state — then the logic level is 0 —. it is indicated with a grey background when the logic level on one of the gates g 00 to g 33 changes from 0 to 1 or from 1 to 0 . for example , pixel p 11 is not enabled at all during the frame cycle as shown in the tables of fig4 a and 4 b ; pixel p 21 is enabled first , pixel p 12 is enabled thereafter . pixels p 21 and p 12 are enabled for the same amount of time and therefore appear with the same brightness and , because they are enabled for the longest duration , they appear as the brightest pixels with a value of 30 , as indicated in the lowest row of fig4 b being labelled with “ sum of brightness ”. in the table on the right side , the current values being applied on the analog line i_analog are indicated . in this example , every light source is operated with the same current value , e . g . with 1 arbitrary unit ( 1 a . u .). if e . g . two pixels are enabled , two times of the current value (= 2 a . u .) is supplied on the analog line . therefore , when 12 pixels are enabled , the twelvefold of the current value (= 12 a . u .) is supplied on the analog line . fig5 shows in a schematic diagram an example of the current characteristic of an analog line of a backplane device according to the prior art . the current i is shown in arbitrary units ( a . u .) as the function of the pixel number n for the duration of two frames . because of the addressing scheme of the prior art , wherein the pixels of a spatial light modulator and for a light source array or matrix are addressed line by line and within a single line are addressed one after another , different uniformly distributed currents between the range of 0 a . u . and 6 a . u . are applied on the analog line of the prior art backplane , whenever the next pixel according to the fixed addressing scheme is addressed . this results in driving analog values from the outside of the display area in a very fast manner , leading to the physical limits of the electronics of a backplane device , for example the large line capacities prevent increasing switching frequencies on the continues analog lines . this approach also makes a high precision of the tfts being applied necessary , in order to ensure analog signal quality . however , the frame rate or refresh rate of the spatial light modulator or the light source array or matrix can be increased according to the particulars of the present invention . according to the present invention , a pixel value assigning scheme being different to the one known from the prior art is used . this can be seen by the schematic diagram shown in fig6 a . the diagram in fig6 a shows a current characteristic 10 being a current function which is applied to the analog line of the backplane device , to which the pixels are connected . this current characteristic 10 shown in the diagram comprises the current values which are applied to the analog line during two frames . the current characteristic 10 comprises the shape of essentially a ramp up function for the first frame and comprises essentially a ramp down function for the second frame . a high precision of the pixel value or the current to flow through the light source of the pixel can be achieved , because the alteration of the current characteristic 10 comprises a relative low frequency . according to this embodiment of the invention , the current characteristic 10 has been generated depending on the pixel values which have to be assigned to single pixels of the light source matrix by the backplane device . because the current characteristic 10 is almost a function comprising a linear increase for the first frame and almost a linear decrease for the second frame , the pixel values to be assigned to the pixels are rather highly distributed . in other words , no regions comprising the same pixel value appear in the two frames which will be assigned by the current characteristic 10 of fig6 a , because if , for example ⅓ of all pixels would have the same pixel value , this would result in a region of the current characteristic 10 being horizontal or parallel to the abscissa as shown in the diagram of fig6 a . the schematic diagram according to fig6 b shows the pixel address signals which are applied to the addressing lines of the backplane device for the first frame . as can be seen , in this embodiment , high frequency signals are applied to the addressing lines . however , because these addressing signals are digital signals having the logical value of either 0 or 1 , this can be realized electronically at a higher frequency than realizing the high frequency analog values as they are shown for example in fig5 . fig7 a shows a schematic representation of a part of a light source matrix 12 comprising pixels 14 and comprising a backplane device ( not shown ) according to the prior art . the pixels 14 of the light source matrix 12 as shown in fig7 a comprise four different pixel values 15 being indicated with different hatching . in the example of fig7 a four pixels have been assigned with the maximum pixel value 15 of 100 %. three pixels 14 comprise the pixel value 15 of 66 %. six pixels 14 comprise the pixel value 15 of 33 % and the remaining three pixels comprise the pixel value 15 of 0 %. indicated by the numbers in each pixel 14 of the light source matrix 12 of fig7 a the address numbering of the single pixels 14 is indicated starting at 1 and ending at 16 . below the light source matrix 12 from fig7 a is indicated in the diagram the current characteristic 10 being a current function which is applied to the analog line of the backplane device , to which the pixels 14 are connected . on the abscissa , the fixed clock cycles of the pixels 14 being addressed are shown . the pixels 14 are addressed in a fixed order as shown on the abscissa , i . e . starting with pixel 1 and ending with pixel 16 . as a result , high frequency “ arbitrary ” values have to be applied on the analogue line , comparable to the ones shown in fig5 . the current characteristic 10 ( being 0 % to 100 %) is shown in dependence from the pixel address ( being 1 to 16 ). as can be seen , depending from the pixel values to be displayed with the light source matrix 12 , the current characteristic 10 is very fluctuating or comprises alternating current values , thus limiting the maximum speed with which the light source matrix 12 can be addressed or encoded . fig7 b shows a schematic representation of a part of a light source matrix 12 comprising pixels 14 comprising a backplane device ( not shown ) according to the present invention . the pixels 14 of the light source matrix 12 as shown in fig7 b display the same pixel values 15 as the light source matrix 12 as shown in fig7 a . because the addressing of the pixels 14 of the light source matrix 12 as shown in fig7 b is carried out in a different manner compared to the prior art , the address numbering of the pixels 14 ( being indicated by the numbers written in each pixel 14 ) of the light source matrix 12 depends on the pixel value 15 to be assigned to each pixel 14 . fig7 b below shows in a schematic representation the current characteristic 10 to be applied on the analog line ( not shown in fig7 a , 7 b ) for the pixel value 15 distribution as indicated in fig7 b above . on the abscissa of fig7 b the addressed pixels 1 to 16 are shown and the numbers are indicated in the pixels 14 of the light source matrix 12 . however , the order in which those 16 pixels are addressed is an order being indicated in the row below the addressed pixels . it appears that the order of addressing the pixels 14 is arbitrary . however , the order of addressing the pixels 14 depends on the pixel value 15 to be displayed with the light source matrix 12 . accordingly , the analog values being assigned to the different pixels 14 might have a characteristic of a ramp - up function having a low frequency of changing currents . as it can be seen , the current corresponding to the pixel value 15 of 0 % is applied to the analog line for a total of 3 pixel addressing cycles , i . e . the pixels 1 , 2 and 3 having the addresses 1 , 4 and 11 ( which correspond to the address numbering indicated in the pixels 14 of fig7 a ). the current corresponding to the pixel value 15 of 33 % is applied to the analog line for six pixel writing cycles , i . e . for the pixels 4 - 9 . the current corresponding to a pixel value 15 of 66 % is applied for three addressing cycles , i . e . for the pixels 10 - 12 . the current corresponding to the pixel value 15 of 100 % is assigned for four pixel addressing cycles to complete the assigning of all 16 pixels 14 of the light source matrix 12 for one frame as shown in fig7 b . each pixel 14 is enabled for the duration of a pixel cycle only , wherein the duration of the pixel cycles is essentially identical . as can be seen from fig6 a and 7 b , the current characteristic 10 is variable in time and in these examples has predominantly the characteristic a mathematically monotonic function . starting with the pixel value distribution of the pixels 14 of the light source matrix 12 as shown in fig7 a or 7 b , the current characteristic 10 as shown in fig7 b below is generated . in this example , a ramp up function is applied . therefore , the current characteristic 10 starts with the lowest current and increases to the highest current . therefore , the current characteristic 10 depends on the pixel values 15 to be assigned to the pixels 14 . this is to be understood in particular under the term “ pixel value assigning scheme ”. the current characteristic 10 is generated by a generating means not shown in fig7 b . once the current characteristic 10 has been generated depending on the pixel values 15 to be assigned to the pixels 14 , the pixel addresses of the pixels 14 to be addressed when the current characteristic 10 is applied to the analog line are determined . as can be seen , the pixels 14 comprising a pixel value 15 having 0 % will be addressed first . it is not necessary that the addresses of the pixels 14 having the 0 % pixel value 15 are exactly in the order as indicated above . a different order of assigning these pixel values 15 to the pixels 14 could be used as well . therefore , it is possible that the generated current characteristic 10 being applied to the at least one analog line determines the order of addressing of the pixels 14 . in this example , the addressing of all pixels 14 to which the same pixel value 15 is assigned is performed in temporal proximity to each other . advantageously , the analogue current can be ramped - up slowly from a minimum value to a maximum value with very few external drivers . the addresses or positions of the pixels to which a certain analog value is to be assigned is digitally transferred to the address decoders . if the backplane device comprises plurality of single clusters , then the addresses of all pixels of a cluster are digitally transferred to the address decoders of the cluster . fig8 shows an example of a backplane device 16 comprising a plurality of clusters 18 . fig8 does not show the complete backplane device 16 , but only a single section of it . therefore , only four clusters 18 are shown in fig8 . every cluster 18 comprises pixel circuits 20 being indicated schematically with single squares . every pixel circuit 20 is assigned to a pixel of the light source matrix ( not shown in fig8 ). according to the embodiment as shown in fig8 , the clusters 18 are controlled independently from each other . the pixels and therefore the pixel circuits 20 form a connected and contiguous region of the backplane device 16 as well as of the light source matrix to form the cluster 18 . the connected regions of this embodiment have a rectangular shape and the clusters 18 do not extent over the full with or over the full length of the backplane device 16 or the light source matrix . every cluster 18 comprises an analog line 22 as well as pixel addressing means 24 for addressing the pixels or the pixel circuits 20 of the cluster 18 . it is schematically indicated in fig8 , that pixel data coming for example for a computer are transferred to the display electronics of the display device in which the light source matrix and the backplane device 16 is included . the display electronics transfers the pixel values and the addressing values to the panel electronics of the backplane device 16 . depending on the particular configuration of the display device , the current characteristic 10 and the pixel address can be generated either in the computer or in the display electronics of the display device or in the panel electronics of the backplane device 16 . in fig8 it is indicated , that each cluster 18 comprises a connecting line between the panel electronics and the pixel addressing means 24 for transferring address information to the pixel addressing means 24 . it is schematically shown in fig8 that the pixel addressing means 24 is connected and / or comprises x - addressing lines 26 . the addressing means 24 for addressing the y - address of a pixel comprises y - addressing lines 28 . for achieving redundancy , a build - in “ software ” approach and / or additional redundancy circuits can be applied . the concept of the present invention can especially be applied in an advantageous way for display designs comprising backplanes using clusters , for example as disclosed in wo 2009 / 024523 a1 , wo 2009 / 092717 a1 , wo 2008 / 138983 , wo 2008 / 138984 , wo 2008 / 138985 , wo 2008 / 138986 or ep10156572 . 9 or pct / ep2011 / 053912 , all of which are copied with their whole content herein by reference . furthermore , the concept of the present invention can be applied for displays displaying 2d and 3d content . 3d displays might especially be stereoscopic displays , stereoscopic displays generating multi - views , auto - stereoscopic displays with tracking of the user &# 39 ; s eyes and holographic displays . such a 2d or 3d display could be operated in transmissive , in reflective or in transflective mode . such a 2d or 3d display could be working on the principle of oled , lcd ( liquid crystal display ) or pdp ( plasma display panel ). with the backplane device according to the present invention it is possible to scale up to larger sizes and resolutions for a light source array / light source matrix , especially because of the cluster approach . the display size is nearly unlimited , because the digital lines can be extended with registers and the analog line has very low frequency . it is furthermore possible to achieve power savings while operating the light source array / light source matrix with the backplane device according to the present invention , due to driving the light sources — oleds — directly over the low r on of the transfer tfts of the pixel circuits . a very high grey scale resolution and contrast can be obtained , because the oled current and / or the oled on - time can be controlled very precisely . with the backplane device according to the present invention it is possible to control the pixel value of each pixel ( e . g . the brightness at which each light source of the light source array or light source matrix is operated ) either by the duty cycle ( or duration per time interval ) each pixel is activated or by the current value being applied to each pixel ( or each light source ) or by the combination of both alternatives . the digital switching of the tfts of the pixel circuitry tolerate the threshold voltage changes caused by gate bias stress . especially if the light source array / light source matrix comprises oleds as single light sources , the lifetime of the oleds can be expanded advantageously , because a single oled is loaded with a rather constant current distribution during its duty cycle when being switched on when being driven by a backplane device according to the present invention compared to the rather peaked current distribution while being switched on when being driven by a backplane device according to the prior art . the low duty cycle of the pixel tfts allows to maintain digital function over the life time without compensation . higher duty cycle of pixel tfts are advantageous in respect to lengthen the life - time for each of them , but individual compensation might be necessary . because a smaller number of tfts for each pixel circuitry is needed , a higher yield in production of the backplane device can be achieved . the well known problem of tft gate bias stress is caused by impurity traps and other reasons of the tfts of an a - si backplane leading to charge trapping in tft as a reason for threshold - voltage shift . impurity traps are statistically distributed . the gate bias stress also statistically differs between tfts . according to the addressing scheme of the present invention , it is possible to individually address each pixel e . g . by a direct electrical connection from outside to each pixel allowing direct measurement of the characteristics of the pixel , e . g . the pixel circuitry and / or the light source . by these means , measurement can be easily controlled from outside the panel . such a measurement process can be performed in real - time as a background measurement process , e . g . within 1 % of the frame time . there is no need to implement additional tfts in matrix / on the pixels to carry out such measurements . the selection tfts ( t_yi , 100 ; t_xi , 200 ) according to the present invention comprise a low duty cycle . this allows to maintain the digital function of the selection tfts over the lifetime of the backplane device without substantive further compensation . it is also possible to reverse potential effects with a negative gate voltage pulse . tfts with medium duty cycles ( such as address decoder tfts ) can be sufficiently compensated with a collective pulse . this collective compensation is also possible for the pixel tfts (“ transfer tft ”, 300 ) for low duty cycle oled pixels . the concept of the backplane device according to the present invention also allows to individually compensate each pixel tft for oled duty cycles up to 100 %. as a result , brightness and colour of the pixel values will not change until the end of the lifetime . for example , the average duty cycles of the address decoder tfts are within the range between 10 % and 20 %. a compensation for the address decoder tfts can be done collectively . the average duty cycles of the selection tfts ( t_xi , t_yi according to fig2 ) are within the range between 0 . 2 % and 1 %. the selection tfts ( t_xi , t_yi ) do not need a compensation . the average duty cycles of the pixel driving tfts ( transfer tfts , according to fig2 ) are up to 80 %. a compensation for the pixel driving tfts ( transfer tfts , tip can be done individually or collectively depending on length of duty cycle . measurements of single tfts of all three types of tfts can be carried out on an individual basis . fig9 shows an example of two pixel circuitries 20 , 32 for two neighbouring pixels , each pixel circuitry 20 or 32 comprising three tfts 100 , 200 , 300 according to the second embodiment mentioned above . the two pixels are addressed by the same y - addressing line 28 . the first tft 100 of the first pixel circuitry 20 is connected to the x - addressing line 26 ( x 1 ) of the second pixel circuitry 32 — as an enabling function and therefore indicated with reference numeral 30 —, to the y - addressing line 28 and to the second tft 200 of the first pixel circuitry 20 . the second tft 200 of the first pixel circuitry 20 is connected to the first tft 100 of the first pixel circuitry 20 , to an x - addressing line 26 ( x 0 ) of the first pixel circuitry 20 and to the third tft 300 of the first pixel circuitry 20 . the third tft 300 of the first pixel circuitry 20 is connected to the second tft 200 of the first pixel circuitry 20 . the third tft 300 of the first pixel circuitry 20 is adapted to switch an electrical connection between the analog line 22 through the light source 500 of the first pixel circuitry 20 to the ground gnd . the first tft 100 of the second pixel circuitry 32 is connected to the x - addressing line 26 ( x 0 ) of the first pixel circuitry 20 — as an enabling function and therefore indicated with reference numeral 30 —, to the y - addressing line 28 and to the second tft 200 of the second pixel circuitry 32 . the second tft 200 of the second pixel circuitry 32 is connected to the first tft 100 of the second pixel circuitry 32 , to an x - addressing line 26 ( x 1 ) of the second pixel circuitry 32 and to the third tft 300 of the second pixel circuitry 32 . the third tft 300 of the second pixel circuitry 32 is connected to the second tft 200 of the second pixel circuitry 32 . the third tft 300 of the second pixel circuitry 20 is adapted to switch an electrical connection between the analog line 22 through the light source 500 of the second pixel circuitry 32 to the ground gnd . this embodiment does not have to have a separate enable line on the backplane device for the enablement functionality of a pixel . this is achieved by using the x - addressing line 26 of the one pixel as the enable line 30 for the other pixel of the two neighbouring pixels 20 , 32 . this can be done , if the logic level of the enable line 30 corresponds to the logic level of the x - addressing lines 26 . depending on whether a n - channel or p - channel transfer tft 300 or n - channel or p - channel selection tfts 100 , 200 are used , the following control schemes need to be applied ( x 0 , x 1 = signal being applied to the respective x - addressing line 26 , y = signal being applied to the y - addressing line 28 ): fig1 shows an example of four pixel circuitries 20 , 32 , 34 , 36 for four neighbouring pixels , each pixel circuitry 20 , 32 , 34 or 36 comprise three tfts 100 , 200 , 300 according to the third embodiment mentioned above . the four pixels are located adjacent to each other and are addressed by the same y - addressing line 28 . the first tft 100 of the first pixel circuitry 20 is connected to the x - addressing line 26 ( x 2 ) of the third pixel circuitry 34 — as an enabling function and therefore indicated with reference numeral 30 —, to the y - addressing line 28 and to the second tft 200 of the first pixel circuitry 20 . the second tft 200 of the first pixel circuitry 20 is connected to the first tft 100 of the first pixel circuitry 20 , to an x - addressing line 26 ( x 0 ) of the first pixel circuitry 20 and to the third tft 300 of the first pixel circuitry 20 . the third tft 300 of the first pixel circuitry 20 is connected to the second tft 200 of the first pixel circuitry 20 . the third tft 300 of the first pixel circuitry 20 is adapted to switch an electrical connection between the analog line 22 through the light source 500 of the first pixel circuitry 32 to the ground gnd . the first tft 100 of the second pixel circuitry 32 is connected to the x - addressing line 26 ( x 0 ) of the first pixel circuitry 20 — as an enabling function and therefore indicated with reference numeral 30 —, to the y - addressing line 28 and to the second tft 200 of the second pixel circuitry 32 . the second tft 200 of the second pixel circuitry 32 is connected to the first tft 100 of the second pixel circuitry 32 , to an x - addressing line 26 ( x 1 ) of the second pixel circuitry 32 and to the third tft 300 of the second pixel circuitry 32 . the third tft 300 of the second pixel circuitry 32 is connected to the second tft 200 of the second pixel circuitry 32 . the third tft 300 of the second pixel circuitry 32 is adapted to switch an electrical connection between the analog line 22 through the light source 500 of the second pixel circuitry 32 to the ground gnd . the first tft 100 of the third pixel circuitry 34 is connected to the x - addressing line 26 ( x 3 ) of the fourth pixel circuitry 36 as an enabling function and therefore indicated with reference numeral 30 , to the y - addressing line 28 and to the second tft 200 of the third pixel circuitry 34 . the second tft 200 of the third pixel circuitry 34 is connected to the first tft 100 of the third pixel circuitry 34 , to an x - addressing line 26 ( x 2 ) of the third pixel circuitry 34 and to the third tft 300 of the third pixel circuitry 34 . the third tft 300 of the third pixel circuitry 34 is connected to the second tft 200 of the third pixel circuitry 34 . the third tft 300 of the third pixel circuitry 34 is adapted to switch an electrical connection between the analog line 22 through the light source 500 of the third pixel circuitry 34 to the ground gnd . the first tft 100 of the fourth pixel circuitry 36 is connected to the x - addressing line 26 ( x 1 ) of the second pixel circuitry 32 — as an enabling function and therefore indicated with reference numeral 30 —, to the y - addressing line 28 and to the second tft 200 of the fourth pixel circuitry 36 . the second tft 200 of the fourth pixel circuitry 36 is connected to the first tft 100 of the fourth pixel circuitry 36 , to an x - addressing line 26 ( x 3 ) of the fourth pixel circuitry 36 and to the third tft 300 of the fourth pixel circuitry 36 . the third tft 300 of the fourth pixel circuitry 36 is connected to the second tft 200 of the fourth pixel circuitry 36 . the third tft 300 of the fourth pixel circuitry 36 is adapted to switch an electrical connection between the analog line 22 through the light source 500 of the fourth pixel 36 to the ground gnd . likewise to the second embodiment , this embodiment does not have to have a separate enable line on the backplane device for the enablement functionality of a pixel . this can be achieved , if for one pixel , the x - addressing line 26 of one of the other pixels of the four neighbouring pixels is used as the enable line 30 for this pixel . this can be done , if the logic level of the enable line 30 corresponds to the logic level of the x - addressing lines 26 . depending on whether a n - channel or p - channel transfer tft 300 or n - channel or p - channel selection tfts 100 , 200 are used , the following control schemes need to be applied ( x 0 , x 1 , x 2 , x 3 = signal being applied to the respective x - addressing line 26 , y = signal being applied to the y - addressing line 28 ): while the present invention has been described in conjunction with a specific embodiment , it is understood that many alternatives , modifications and variations will be apparent to those skilled in the art in light of the foregoing description . in particular , a person skilled in the art derives from the backplane device disclosed in the drawings and the description of this application a method to operate the backplane device according to the present invention and / or to use the backplane device according to the present invention for a specific purpose , e . g . to use it for a display device . accordingly , this invention is intended to embrace all such alternatives , modifications and variations which fall within the scope of the appended claims . | 6 |
the same reference numbers are used in the individual figures for the same or equivalent components . fig1 shows in a schematic view a block diagram of a sensor arrangement 1 according to the invention to record the position h and / or position change of a measured object 2 relative to an electromagnetic sensor 3 . a magnet 4 in the form of a permanent magnet is assigned to the measured object 2 , which is enclosed on almost all sides in the depicted variant by the measured object 2 . sensor 3 has a coil system 5 , which consists of a sensor coil 6 and a compensation coil 7 . in the area of influence of the coil system 5 a foil 8 of soft magnetic material is arranged . the sensor coil 6 has two terminals k 1 and k 2 . terminal k 1 is connected to the synchronizable oscillator 10 , terminal k 2 is connected to the input of an evaluation circuit 11 and the electrical contact 9 of the foil . the oscillator 10 supplies the sensor coil 6 with an alternating voltage of fixed frequency and amplitude . in this way an electromagnetic alternating field is generated by the sensor coil 6 , which induces eddy currents in foil 8 . the electromagnetic properties , like electrical conductivity σ and magnetic permeability μ of the material of foil 8 , then influence the character and feedback of the eddy currents on the alternating field . through a distance change between measured object 2 with sensor 3 the magnetic permeability μ of foil 8 changes , which leads to a change in alternating field in the coil system 5 . as a result of this , the complex impedance z of the sensor coil 6 changes , which is measured by means of evaluation circuit 11 . the voltage drop between terminals k 1 and k 2 is amplified with a difference amplifier 12 , in which the voltage u 2 at the output of the amplifier 12 is proportional to the impedance z of the sensor coil 6 . two orthogonal components u 3 and u 4 are determined for voltage u 2 by an electronic arrangement 13 . the voltage u 3 is used to control a controllable voltage source 14 , which supplies the compensation coil 7 of the coil system 5 with a direct current i_ . because of this a constant magnetic field is produced by the compensation coil 7 , which together with the magnetic field of permanent magnet 4 and the alternative field of sensor coil 6 forms a resulting magnetic field . the size of the direct current i_ is measured via the voltage drop on a stable resistor 15 by means of an integrator 16 . the signal at the output “ out 1 ” of integrator 16 is used to determine the distance changes between the measured object 2 and sensor 3 . the controllable voltage source 14 can be formed in different ways . a d / a converter or digital potentiometer can be used , which are driven via the signal u 3 . one possible embodiment is shown in fig8 and described in detail further below . the second voltage component u 4 , which is generated by the electronic arrangement from voltage u 2 , is used to synchronize oscillator 10 . because of this the voltage u 1 and voltage u 4 produced by the oscillator are synchronous . the sensor arrangement 1 could be used in a closed control loop , in which the signal u 3 is a control quantity determined as the difference between a target value in the memory of electronic arrangement 13 and the voltage u 2 . in another variant of the control loop the signal u 3 is interrupted and the voltage source 14 controlled manually , for example , via the keyboard , in order to reach a certain value of direct current i_ . the output signal is generated from “ out 2 ” of the electronic arrangement 13 . the relation between magnetic field distribution along the foil 8 and position h of magnet 4 will be explained with reference to fig2 ( a ) , ( b ), ( c ). the foil 8 consists of a nanocrystalline material that is applied to a support 17 , which consists of ceramic , for example . in this fig2 the significance of the redundancy factor is apparent : during a change in position of the measured object from distance h 1 to h 4 the distribution of permeability in the foil only varies by the path from a - b to g - h . this path is shortened by the redundancy factor relative to the path h covered by the measured object , in which the redundancy factor has a value of 3 , for example . fig2 ( a ) shows an arrangement consisting of a foil 8 applied to a support 17 and with which the distribution of the magnetic field generated by a permanent magnet 4 can be determined indirectly along foil 8 . a measurement coil 18 with a width δ = 3 mm is arranged in one layer around the support 17 and foil 8 . the measurement coil 18 is then configured so that it is movable in the longitudinal direction of foil 8 . the diagram depicted in fig2 ( b ) shows the amount of complex impedance of measurement coil 18 during a shift in measurement coil 18 in the x direction along foil 8 ( length of the foil l = 25 mm , width 5 mm and thickness 0 . 02 mm ). several impedance trends are shown in the diagram , which are obtained at different positions h of the measured object 2 relative to foil 8 . for clarification the positions h 1 = 60 mm , h 2 = 50 mm , h 3 = 40 mm and h 4 = 30 mm are given as numerical values this also shows how large the measurement range of such an arrangement can be set . the diagram of fig2 ( c ) schematically shows the area of the foil in which a maximum steepness of the impedance characteristic and therefore maximum sensitivity of the sensor using the soft magnetic foil is set . the areas are then shown for positions h 1 = 60 mm , h 2 = 50 mm , h 3 = 40 mm and h 4 = 30 mm . it is readily apparent that the areas ( a - b ), ( c - d ), ( e - f ) and ( g - h ) move in proportion to position h of the permanent magnet 4 . the relative sensitivity s is plotted more precisely in fig3 as a function of position h of the measured object 2 . the following applies for sensitivity s of sensor 3 : in which δz / z is the relative impedance change of the sensor coil ( 7 ) and δh the step width between the individual positions h . it is readily apparent that the relative sensitivity s assumes maximum values at position h 0 . in an area ± δh around position h 0 the relative sensitivity s still remains at significant values and is then significantly reduced . fig4 shows a diagram of the direct current trends dependent on the position change ± δh of a measured object relative to base position h 0 . the diagram shows that a linear function can be set up between the direct current i_ and the position changes of the permanent magnet ± δh . fig5 shows a first practical example of sensor arrangement according to the invention which consists of a measured object 2 and a sensor 3 . a permanent magnet 4 is incorporated in a housing of the measured object 2 so that the magnetic field direction agrees with the movement axis of the measured object 2 . the sensor 3 is designed flat and contains a support 17 on which two planar coils 6 and 7 are arranged on both sides . a circuit board or ceramic substrate could be used to support 17 and the coils 6 and 7 could be favorably produced by known methods , for example , screen printing on support 17 or gluing onto it . the support 17 with coils 6 and 7 is covered with two circuit boards 19 , 20 made of electrically conducting material , preferably aluminum or copper . the width “ δ ” of coils 6 and 7 is only about 25 % of the length “ l ” of foil 8 , which is glued onto one side of circuit board 20 . the coil 6 is supplied at high frequency alternating voltage and serves as measurement coil . the compensation coil 7 consists of several layers and is supplied with direct current . fig6 shows a second practical example of a sensor according to the invention . the sensor 3 consists of a round support 17 which is produced from a plastic . a first multilayer coil which serves as compensation coil 7 and is supplied with direct current is wound in a groove around support 17 . the measurement coil 6 , which is supplied by an oscillator with alternating current of higher frequency , is wound in one layer along support 17 and encloses the compensation coil 7 . a foil 8 of nanocrystalline or amorphous material is glued in the interior of a tube 21 . the tube 21 consists of a material with high electrical conductivity and simultaneously serves as sensor housing . the tube 21 is covered on a side of the measured object 2 with a cover 23 of electrically conducting material , which , however , is permeable for the permanent magnetic field ( h =) of the measured object 2 . the evaluation electronics 24 is incorporated in a housing 25 which should be connected to tube 21 and foil 8 for emc reasons . it is advantageous in this variant that the sensor 3 is completely encapsulated and shielded and can be incorporated directly without an additional pressure tube in a pressure space , for example , a hydraulic or pneumatic cylinder . fig7 shows a third variant of a sensor 3 in which a permanent magnet 4 is arranged at a specific fixed distance d to the coil system 5 of sensor 3 and does not move with the measured object 2 . the measured object 2 consists of ferromagnetic steel and is arranged at a base distance h to the surface of sensor 3 and is movable . in a first variant ( a ) the permanent magnet 4 is arranged on the side of the coil system 5 facing away from measured object 2 . this arrangement is particularly advantageous if relatively large measurement ranges , for example , 15 mm are measured with good linearity with a sensor 3 of limited size , for example , a diameter of 10 mm . in a second variant ( b ) the permanent magnet 4 is arranged between the measured object 2 and the coil system 5 . this variant can be used advantageously when small position changes δh are to be measured at relatively large base distance h of , say , 25 - 30 mm and the diameter of the sensor is only 10 mm . in a third variant the coil system 5 of sensor 3 , which consists of two coils 6 and 7 , is wound concentrically on a support 17 . a foil 8 of soft magnetic material is arranged between coil 6 and 7 , which encloses coil 7 . coil 6 serves as a measurement coil whose impedance or the imaginary part im z of the impedance depends on distance h and is measured . the coil 7 is supplied with direct current and serves as compensation coil . a tube 26 made of an electrically conducting material , for example , aluminum or copper , is situated above it . the housing 25 could then be produced cost - effectively from a non - conducting material , for example , plastic . a direct current could be adjusted ( or set ) so that during position changes δh between sensor 3 and measured object 2 the impedance or im z remains constant . in this case the level of the direct current is proportional to the position changes δh . the measured object could also have a profiled surface , for example , a gear or a rotor so that rotational speed and / or angles can also be measured with the sensor . fig8 shows a circuit diagram of the controllable dc source for driving the compensation coil with the device according to fig1 . the dc source has an electronically adjustable digital potentiometer 27 which is driven via a control line 28 by a tracking control or keyboard . the digital potentiometer 27 is supplied symmetrically with a direct voltage by two operational amplifiers 29 , 30 , in which a reference voltage u ref lies between the non - inverting inputs of the operational amplifiers 29 , 30 . the potentiometer arm 31 of the digital potentiometer 27 is connected to the non - inverting input of an additional operational amplifier 32 . a coil 33 is arranged between the output of the operational amplifier 32 and its inverting input , over which a direct current i_ flows . the coil 33 is formed here by the compensation coil 7 of the circuit according to fig1 . the level of the direct current i_ is determined by a resistor 34 as a function of the voltage of the output of the operational amplifier 32 , which again depends on the position of the potentiometer arm 31 of the digital potentiometer . the circuit is then dimensioned so that in the middle position of potentiometer arm 31 the current i_ equals zero . depending on the position of the potentiometer arm , a positive or negative current can be produced . depending on the position of the working point of the sensor the polarity and level of the direct current i_ is set so that the constant sensitivity of the sensor is reached in the area ± δh . the voltage dropping over resistor 34 is measured via an integrator , which consists of an operational amplifier 35 , resistor 36 and capacitor 37 . finally , it is mentioned that the practical examples described above merely explain the claimed teachings , but do not restrict them to the practical examples . | 6 |
the present invention now will be described more fully hereinafter with reference to the accompanying drawings , in which preferred embodiments of the invention are shown . this invention may , however , be embodied in many different forms and should not be construed as limited to the embodiments set forth herein ; rather , these embodiments are provided so that this disclosure will be thorough and complete , and will fully convey the scope of the invention to those having skill in the art . referring to fig6 a , a sheet iron 50 of a 4 pole rotor 100 has at the center thereof a hole 41 into which a rotating shaft ( not shown ) is to be fixed , permanent magnets with a predetermined length and which are disposed oppositely and in parallel with the radius direction from the center of rotor 100 , and first permanent magnet receiving slots 51 to 54 and second permanent receiving slots 61 to 68 which are formed in such a manner that four pairs of permanent magnets are disposed in ladder - shape toward the outer surface of sheet iron 50 . planar - type permanent magnets are fixed into magnet receiving slots 51 to 54 and 61 to 68 . preferably , the angle between two opposing permanent magnets disposed in ladder - shape is 120 ° to 170 °, and more preferably , 150 °, considering the smooth flow of the magnetic flux through the rotor . preferably , thickness of the permanent magnet is 2 % to 8 % of the circumference of the rotor , and the permanent magnets are disposed in such a manner that the magnetic poles of same polarity are opposed to each other by 180 ° centering from the rotating shaft . for example , second permanent magnet receiving slots 67 and 68 are disposed to be more adjacent as they go away from the center toward the outer surface of the rotor . a magnetic flux leakage preventive groove 110 shaped as a recess is formed at the outer surface of the rotor . magnetic flux leakage preventive groove 110 is formed in such a manner that the center thereof is positioned at a point where the centerline between permanent magnetic receiving slots 67 and 68 crosses the circumference of the rotor . referring to fig6 b , magnetic flux leakage preventive groove 110 includes portion ( a ) between the end of permanent magnet receiving slot 68 and the outer surface of the rotor , portion ( b ) between the sidewall of permanent magnet receiving slot 63 and the sidewall of magnetic flux leakage preventive groove 110 , and portion ( c ) which is the bottom surface of magnetic flux leakage preventive groove 110 . here , preferably , length l1 of portion ( a ), length l2 of portion ( b ), and length l3 which is the depth of magnetic flux leakage preventive groove 110 excluding length l1 are 0 . 5 mm or shorter , respectively . if they are longer than 0 . 5 mm , the magnetic flux leakage prevention effect will be decreased . length l3 is longer than the air gap between the stator and the rotor , which prevents the useless magnetic flux caused by the circular outer surface of the rotor , i . e ., the magnetic flux leakage . in some cases , length l3 is within a range that does not exceed the thickness of the permanent magnets , and the width of magnetic flux leakage preventive groove does not exceed 1 . 2 times of the thickness of the permanent magnets . in such a manner , the magnetic flux generated at the end of the magnet may not pass magnetic flux leakage preventive groove 110 , and pass teeth 46 of stator 45 . referring to fig7 a and 7b , the magnetic flux passes through the air gap between the rotor and the stator , teeth 46 , and the main body of rotor 100 , and enters the adjacent permanent magnet of opposite polarity . the magnetic flux intends to flow via the medium having excellent magnetic permeability , and has less magnetic reluctance as the magnetic flux path is shorter . therefore , it is preferable to make the magnetic circuit as short as possible . in addition , if the magnetic flux is distributed densely at a certain position , the magnetic reluctance increases . therefore , it is preferable to uniformly distribute the magnetic flux . as shown in fig7 a and 7b , the magnetic flux is distributed uniformly , and specifically , in the rotor , the magnetic flux line in the magnet proceeds in one direction . the magnetic flux leakage where the magnetic flux generated from the end of the permanent magnet directly passes the permanent magnets can be reduced by magnetic flux leakage preventive groove 110 which is designed to have a magnetic reluctance smaller than those between the permanent magnet and teeth 46 and those between the end of the permanent magnet and the end of the adjacent permanent magnet . thereby , the magnetic flux leakage is reduced , and the magnetic flux generated from the end of the permanent magnet passes through teeth 46 , which substantially enhances a motor efficiency . according to the present invention , the amount of torque generated from the magnetomotive force of the stator is further increased than the conventional art assuming that the number of turns of coils and the current consumption are the same . in addition , the torque ripple is enhanced , too . in the present invention , arrangement of magnets of the rotor is enhanced , and the magnetic flux leakage preventive groove having an appropriate size is formed at the outer surface of the rotor , to thereby reduce the magnetic flux leakage and the core loss in the rotor . thus , an overheating during the operation of the motor is prevented , and the useful magnetic flux is increased . ultimately , further large amount of torque can be achieved , and the motor can be operated in a high efficiency . the same amount of torque can be obtained with the reduced size of the motor . in addition , the magnetic reluctance can be reduced by making the path along which the magnetic flux flows to be short as possible . as a result , maximum amount of torque can be obtained with the same current of the stator . in summary , grooves shaped as a recess are formed at the outer surface of the rotor to which the permanent magnets of different polarities are adjacently positioned , which minimize the magnetic flux leakage . a high torque can be obtained with the same power consumption , the torque ripple can be reduced , and the noise and the vibration can be minimized . this invention has been described above with reference to the aforementioned embodiments . it is evident , however , that many alternative modifications and variations will be apparent to those having skill in the art in light of the foregoing description . accordingly , the present invention embraces all such alternative modifications and variations as fall within the spirit and scope of the appended claims . | 7 |
we describe a novel nasogastric tube introducer device ( fig1 , 3 , 4 , 8a , 8b , 9a , 9b , 9c , 10a , 10b , 10c , 10d , 11a , 11b and 11c ) comprising guide means in order to guide the nasogastric tube into a subject , the guide means comprising a longitudinal hollow conduit having a peripheral wall defining a passageway therethrough extending from a first / proximal end to a second / distal end . when used , the second / distal end of the device is inserted into the nasal cavity of a patient and the first / proximal end remains outside the nose . the device is manoeuvred as it is inserted in order for the distal end to locate in the gastrointestinal tract . a nasogastric tube can then be relatively easily passed through the conduit to the stomach . preferably the conduit is curvilinear comprising a unique “ s ” shaped curvature ( see for example , fig1 , 3 , 4 # 6 ; 9 a ) that conforms to the anatomy of the nasopharynx area , the design being based on nasal passage profiles from patient ct scans . the curvature improves steering of the nasogastric tube towards the gastrointestinal tract . the shape of the device generates gentle torque that guides the insertion to land in the hypopharynx in optimal position for esophageal cannulation , giving the device a predictable landing zone in the esophagus . preferably the conduit has a posteriorly directed second / distal end ( fig1 # 7 , 9 a ). such a curvature further assists to guide the nasogastric tube away from the trachea towards the esophagus which is posterior to the larynx and reduces the chance of tracheal cannulation . a combination of the anatomically conforming curvilinear form and semi - rigid but flexible material reduces the likelihood of multiple nasogastric tube insertion attempts and results in a procedure that is less time - consuming than when x - rays are used for monitoring positioning . in a preferred embodiment , the nasogastric tube introducer device further comprises an alarm member mounted at the first / proximal end . the alarm member may be detachably mounted . in view of hygiene concerns , a disposable alarm would be favoured . in order to be more certain that the device is not misaligned in the trachea , the alarm member is attached to the first / proximal end of the device and works on the basis of air passing through the trachea to provide an indication whether the nasogastric tube is correctly positioned in the gastrointestinal tract or is misplaced in the lung of said subject . the auditory feedback mechanism produces a characteristic warning sound should cannulation of the trachea occur . this sound is not produced if the esophagus is successfully cannulated . an example of a suitable alarm is the disposable baam ® beck airway airflow monitor device ( great plains ballistics , lubbock , tex ., usa ). the conduit preferably has a posteriorly directed round bevelled tip at the second / distal end ( fig1 # 2 ; 9 a , 9 b , 9 c ; 11 a , 11 b ). bevelling the tip improves air flow through the conduit for more effective triggering of the alarm member . the skilled person will appreciate that there may be several ways in which a nasogastric tube introducer device can be manufactured . one suitable method is by the use of 3d printing ; another is by extrusion . in a preferred embodiment of the invention , the nasogastric tube introducer device is comprised of a semi - rigid material and may have an elliptical cross - sectional profile . an elliptical profile provides an advantage because it more closely matches the elliptical shape of the inlet to the esophagus . it may be made of any suitable medical grade material such as plastic , polymers , latex , silicon or the like . preferably the device is engineered in a moderately stiff yet flexible silicone which confers steerability and a predictable landing at the desired target zone without overt discomfort to the patient . an example of a suitable silicone is nusil med - 4080 hcr ( nusil technology llc , ca 93013 usa ). the last two digits refer to the silicone hardness ( durometer , type a 80 , astm d2240 ). the tip of the posteriorly curved second / distal end ( fig9 a ; 11 a and 11 b ) is preferably comprised of a softer more compliant material to prevent mucosal injury . the compliant material may be silicone and an example of a suitable silicone is nusil med - 4930 ( nusil technology llc , ca 93013 usa ). the last two digits refer to the silicone hardness ( durometer , type a 30 , astm d2240 ). in a preferred embodiment , the nasogastric tube introducer device is coated on the inner ( luminal ) surface with a coating that reduces friction and can tolerate sterilization . an example of a suitable coating is nusil med - 6670 ( nusil technology llc , ca 93013 usa ). the last two digits refer to the silicone hardness ( durometer , type a 70 , astm d2240 ). preferably , the outer surface of the nasogastric tube introducer device is coated with a substance that reduces friction and can tolerate sterilization . an example of a suitable coating is a combination of nusil med - 6670 ( nusil technology llc , ca 93013 usa ) and parylene ( parylene coatings services , inc , tex . 77494 usa ). the alarm member may be composed of various suitable compounds , such as plastic and / or polymers and could be complex or simple in operation and readout . a simple version of the alarm member is whistle - like ( fig1 ; # 1 ), such as the disposable baam ® beck airway airflow monitor device ( great plains ballistics , lubbock , tex ., usa ). a more complex alarm may be digital . the alarm may produce a distinct sound corresponding to the bidirectional airflow in the trachea of the subject ; wherein an audible signal indicates tracheal cannulation . the conduit preferably has a handle located at or near the first end ( fig1 # 4 ; 9 c ; 10 a , 10 b , 10 c and 10 d ). the ergonomic handle provides the user with more control over the device during insertion and positioning and prevents the proximal end from entering the nasal cavity . preferably , the conduit comprises a longitudinal slit ( see for example fig1 # 5 ), preferably in the form of a “ v - groove ” ( see for example , fig8 a , 8b and 10d ) defined in the peripheral wall of the conduit to enable the nasogastric tube to be moved out of the passageway defined by the conduit and separate the guide from the nasogastric tube . the purpose of this is to allow removal of the device from the subject without disturbing the nasogastric tube . the slit may be sealed in some way to prevent the nasogastric tube from inadvertently becoming dislodged from the device during the insertion and location procedure . preferably , the longitudinal slit comprises a tear - away mechanism to allow removal of the introducer once the ngt has passed through its hollow conduit into the esophagus ( fig8 a , 8b ; 10 d ). in a preferred embodiment the handle is configured to help the user insert and peel the guide with ease ( fig1 a , 10b , 10c and 10d ). it preferably has a curved design that allows placement of a thumb on either side to initiate the tearing of the guide to release it from the ngt . the skilled person would understand that other means for removing the device while leaving the nasogastric tube undisturbed in situ may be possible without deviating from the present invention . the conduit of the nasogastric tube introducer device may also comprise guide and / or depth markings ( fig1 # 9 ) and / or a reflective longitudinal line ( fig1 ; # 3 ). these markings assist the user to determine the position of the device within the nasal cavity , throat and esophagus during the insertion procedure . a reflective longitudinal line may help orientate the user as to which side should be facing upwards or downwards during the insertion . preferably the conduit is configured in shape and length so that its distal end is advanced to its position of intended use in the hypopharynx just above the cricopharyngeus muscle and enter the esophagus , to allow the ngt to be passed into the esophagus and reach the stomach . in a preferred embodiment , the device is manufactured using extrusion methods and the device is comprised of the following materials obtainable from nusil technology llc , ca 93013 usa and parylene coatings services , inc , texas 77494 usa : material for the guide : med - 4080 hcr ( durometer , type a 80 , astm d2240 ); material for the distal tip : med - 4930 ( durometer , type a 30 , astm d2240 ); material for the handle : med - 4950 lsr ( durometer , type a 50 , astm d2240 ); material for the over mold : med - 4950 lsr ( durometer , type a 50 , astm d2240 ); coating of inner surface : med 6670 ( durometer , type a 70 , astm d2240 ); coating of outer surface : med 6670 / parylene . an advantage of the present invention is that nurses would be incentivized to adopt this product because they could overcome the practical difficulties faced during insertion of nasogastric tubes , like coiling and poor maneuverability etc ., hence saving precious time . the present invention is suitable for stroke patients , elderly and the disabled with difficulty in swallowing . it should be best deployed in an inpatient setting , community hospitals or nursing homes . the nasogastric tube introducer device of the invention may be manufactured by 3d printing or by extrusion methods . in a preferred embodiment of the invention , the nasogastric tube introducer device is made from silicone by extrusion . the silicone extrusion process begins with blending a two - part silicone gumstock on a two - roll mill to produce a homogeneous medical - grade silicone . the silicone was then formed into strips and fed continuously into the extruder . once the required shape was acheived the medical grade tubing was passed through an oven to cure the product with radiant heat . for the device described herein a “ form fixture ” and “ over molds ” were developed to form and mold components . also , the soft tip was made as a separate mold and then fused together . suitable silicone material for the guide may be med - 4080 hcr ( high consistency rubber ) ( nusil technology llc , ca 93013 usa ) a two - part , high durometer ( type a 80 , astm d2240 ), tear resistant silicone elastomer . suitable material for the over mold and / or handle may be med - 4950 lsr ( liquid silicone rubber ) ( nusil technology llc , ca 93013 usa ), a two - part , translucent silicone system ( durometer , type a 50 , astm d2240 ) used with injection molding equipment . the inner surface of the silicone guide may be coated to decrease the coefficient of friction ( cof ) compared to the uncoated silicone and increase abrasion resistance . a suitable coating for the inner surface of the invention may be med 6670 ( nusil technology llc , ca 93013 usa ), a two - part silicone elastomer ( durometer , type a 70 , astm d2240 ) dispersed in xylene . the outer surface of the guide may also be coated with a protective polymeric substance . a suitable outer coating is known as parylene ( parylene coatings services , inc , texas 77494 usa ). a more preferred outer coating comprises a mixture of parylene and med 6670 . bedside clinical tests like the “ whoosh test ” and ph test have long been established to be inadequate for placement confirmation [ farrington m ., et al ., pediatr nurs 35 ( 1 ): 17 - 24 ( 2009 )]. the cxr is at present the most routinely used method to confirm placement inpatient , usually in combination with the previous tests . however , incidence of misplacement remains at 3 . 2 %, and reported deaths resulting from missed airway intubation are at 0 . 5 % [ de aguilar - nascimento , j . e . & amp ; kudsk , k . a . jpen j parenter enteral nutr 31 : 269 - 273 ( 2007 )]. colorimetry ( rightspot ) has not been formally trialled for safety and carries the risk of false negatives due to concurrent acid secretion or inability to aspirate gastric contents ( e . g . on an empty stomach , or a tube &# 39 ; s exit holes are against the stomach wall ) electromagnetic - guided placement ( cortrak ) is claimed to provide bedside direct visualization during ngt insertion , but it is costly and studies document success rates of only 80 %. in addition there have been 21 adverse events reported to the us fda manufacturer and user facility device experience ( maude ) database . ( conventional ) endoscopic placement of ngts allows direct visualization of the ngt in the esophagus but is costly , time - consuming and requires the expertise of a trained specialist . this method is reserved for patients with distorted anatomy , for example , by obstruction from a tumour . the iris system is essentially the same as endoscopic ngt placement without the steerability of an endoscope and shares the same problems of cost , time and requirement of specialist presence . capnography ( co2nfirm ) claims to provide immediate feedback but remains a somewhat costly option and also does not reliably rule out airway intubation [ melody ni et al ., emj gastroenterol 3 : 49 - 56 ( 2014 )]. the benefits or advantages of the present invention over other currently known methods were determined in a comparative study and are set out in table 2 . | 0 |
in cooperation with the attached drawings , the technical contents and detailed description of the present invention are described thereinafter according to preferable embodiment ( s ), being not used to limit its executing scope . any equivalent variation and modification made according to appended claims is all covered by the claims claimed by the present invention . fig2 shows the block diagram of the driving circuit for led ( hereinafter briefed as driving circuit ) according to the present disclosure . the driving circuit is used for led module 40 comprising a plurality of leds . the driving circuit mainly comprises a power source 10 , a voltage regulator 30 , a current control unit 50 and a switching control unit 70 . the power source 10 provides an input voltage vin . the voltage regulator 30 is electrically connected to the power source 10 and the led module 40 and comprises an energy - storing capacitor cd . depending on the input voltage vin , the voltage regulator 30 generates a charging current ic for charging energy - storing capacitor cd . alternatively , the energy - storing capacitor cd generates a discharging current id , depending on the input voltage vin . the current control unit 50 is electrically connected to the voltage regulator 30 and the led module 40 , and adapted to generate a driving current i led for the led module 40 when the discharging current id reaches a current threshold . the current control unit 50 is adapted to maintain constant current driving for the led module 40 . the switching control unit 70 is electrically connected to the power source 10 , the voltage regulator 30 and the current control unit 50 , and receives a feedback voltage vfb associated with the driving current i led for the led module 40 . the switching control unit 70 controls the voltage regulator 30 to stop generating the charging current ic when the feedback voltage vfb reaches a reference voltage . according to one example , the power source 10 receives an external ac power and employs a bridge rectifier and a filter to respectively rectify and filter the external ac power , thus providing the input voltage vin . namely , the input voltage vin is generated through voltage conversion , rectification and filtering . according to another example , the input voltage vin may be provided by a dc power source . the voltage regulator 30 is used to regulate the input voltage vin , namely the ac power source , to maintain constant current and constant voltage driving for the led module 40 , thus matching the input / output voltage for the led driving circuit . moreover , the driving circuit further comprises a feedback unit 60 electrically connected to the current control unit 50 and the switching control unit 70 , and used to convert the driving current i led to the feedback voltage vfb . more particularly , the feedback unit 60 senses the driving current i led flowing through the led module 40 and converts the sensed driving current i led to the feedback voltage vfb . the feedback unit 60 further provides the feedback voltage vfb to the switching control unit 70 and the switching control unit 70 correspondingly generates a control signal sc for controlling the voltage regulator 30 . in this manner , the voltage regulator 30 regulates the driving voltage for the led module 40 such that the requirement for constant current and constant voltage driving , and input / output matching can be met . the description of the driving circuit , especially the voltage regulator 30 , will be detailed later . fig3 shows the circuit diagram of the driving circuit according to the first embodiment the present disclosure . the voltage regulator 30 comprises a first transistor switch q 1 , a second transistor switch q 2 , an inductor ld , and an energy - storing capacitor cd . the voltage regulator 30 provides a voltage - increasing loop and a voltage - decreasing loop , where the voltage - increasing loop has a first voltage - increasing path and a second voltage - increasing path , and the voltage - decreasing loop has a first voltage - decreasing path and a second voltage - decreasing path . the more detailed description for the voltage - increasing loop and the voltage - decreasing loop will be made later with reference to fig4 to 7 . the first transistor switch q 1 is parallel connected to a first diode d 1 , and the second transistor switch q 2 is parallel connected to a second diode d 2 , where the first transistor switch q 1 and the second transistor switch q 2 are connected at a first common node p a and the first transistor switch q 1 and the second transistor switch q 2 are further connected , respectively through a first capacitor c 1 and a second capacitor c 2 to a second common node p b . the inductor ld has a first end connected to the first common node p a and a second end . the energy - storing capacitor cd has a first end connected to the second end of the inductor ld and the anode of the led module 40 and a second end connected to the second common node p b and the current control unit 50 . an intermediate voltage is defined between the first end and the second end of the energy - storing capacitor cd . the first transistor switch q 1 and the second transistor switch q 2 can be realized by mosfet or bjt . in the shown embodiment , the first transistor switch q 1 and the second transistor switch q 2 are mosfet switches and the gates of the first transistor switch q 1 and the second transistor switch q 2 are connected to each other to receive the control signal sc from the switching control unit 70 such that the first transistor switch q 1 and the second transistor switch q 2 can be controlled by the control signal sc . the switching control unit 70 mainly comprises a voltage comparator qpv and a voltage - division resistor network . the voltage - division resistor network comprises a first voltage - division resistor r 1 and a second voltage - division resistor r 2 in series with the first voltage - division resistor r 1 . the input voltage vin is applied to the series - connected first voltage - division resistor r 1 and second voltage - division resistor r 2 such that a reference voltage , which is a divided voltage of the input voltage vin , is present across the second voltage - division resistor r 2 . the invert input end of the voltage comparator qpv receives the feedback voltage vfb and the non - invert input end of the voltage comparator qpv receives the reference voltage vref such that the voltage comparator qpv compares the feedback voltage vfb with the reference voltage vref . the voltage comparator qpv outputs the control signal sc of high level when the reference voltage vref is larger than the feedback voltage vfb . the voltage comparator qpv outputs the control signal sc of low level when the reference voltage vref is equivalent to or smaller than the feedback voltage vfb . in this way , the switching control unit 70 controls the first transistor switch q 1 and the second transistor switch q 2 of the voltage regulator 30 to regulate the input voltage vin . therefore , the led module 40 can be adapted to input voltages of various magnitudes and maintain constant - voltage and constant - current operation . moreover , the first transistor switch q 1 can be an npn mosfet while the second transistor switch q 2 can be a pnp mosfet . alternatively , the first transistor switch q 1 can be a pnp mosfet while the second transistor switch q 2 can be an npn mosfet . in latter embodiment , the invert input end of the voltage comparator qpv receives the reference voltage vref and the non - invert input end of the voltage comparator qpv receives the feedback voltage vfb . in the embodiment shown in fig3 , the switching control unit 70 is realized by an led driver ic . the feedback unit 60 is realized by an optical coupler , which detects the driving current i led for the led module 40 and then generates corresponding feedback voltage vfb . the feedback voltage vfb is sent to the voltage comparator qpv to compare with the reference voltage vref . the current control unit 50 comprises a voltage - stabilization diode z d , and a voltage - stabilization resistor rv . the voltage - stabilization diode z d is , for example , a zener diode to stabilize the source of the switch qd . more particularly , the voltage - stabilization diode z d can provide a stabilization voltage of 2 . 5v . the current control unit 50 is electrically connected to the intermediate voltage through a resistor rd such that the driving current i led for the led module 40 is relevant to the intermediate voltage . more particularly , when the led module 40 is in normal lighting operation , the voltage - stabilization diode zd , and the voltage - stabilization resistor rv can be used to provide constant driving current i led for the led module 40 , which is the ratio between the stabilization voltage ( such as 2 . 5v ) and the voltage - stabilization resistor rv . fig4 to 7 show the circuit diagrams for the voltage regulator 30 in different operation modes . to simplify description , the first transistor switch q 1 is an npn mosfet while the second transistor switch q 2 is a pnp mosfet . moreover , in fig4 to 7 the symbol vin indicates an equivalent voltage of the ac input vac after rectifying and filtering , and the output control signal sc of the switching control unit 70 directly controls the gates of the first transistor switch q 1 and the second transistor switch q 2 . fig4 shows the voltage regulator 30 operated in the first mode , where the ac input vac starts to activate the driving circuit and no current flows through the led module 40 due to non - conduction of the led module 40 . at this time , the input voltage vin charges the inductor ld and the energy - storing capacitor cd as well as the resistor rd ( shown in fig3 ) such that a discharging current id through the resistor rd increases . at this time , the feedback voltage vfb sent to the voltage comparator qpv is smaller than the reference voltage vref ( voltage division of vin by the first voltage - division resistor r 1 and the second voltage - division resistor r 2 ) due to zero driving current i led through the led module 40 . therefore , the voltage comparator qpv output high - level control signal sc to turn on the first transistor switch q 1 and turn off the second transistor switch q 2 . as shown in fig4 , in this operation mode , the driving circuit provides a first voltage - increasing path lp 1 including , in sequence , the input voltage vin , the first transistor switch q 1 , the inductor ld , the energy - storing capacitor cd , the capacitor c 2 and then back to the input voltage vin . in this mode , the inductor ld and the energy - storing capacitor cd are in energy - storing operation and the voltage v led of the led module 40 increases gradually due to the continual charging of the inductor ld and the energy - storing capacitor cd . moreover , the voltage comparator qpv continues outputting high - level control signal sc to turn on the first transistor switch q 1 and turn off the second transistor switch q 2 when the feedback voltage vfb is still smaller than the reference voltage vref , thus still increasing the discharging current id . as shown in fig5 , the driving circuit is operated in the second operation mode . more particularly , the led module 40 starts to turn on and the driving current i led for the led module 40 starts to increase when the discharging current id such increases that the driving voltage ( the product of the discharging current id and the resistor rd ) is large enough to turn on the switch qd in serial connection with the led module 40 ( shown in fig3 ). at this time , the led module 40 is normally driven for lighting and the voltage comparator qpv outputs the control signal sc to turn off both the first transistor switch q 1 and the second transistor switch q 2 such that the inductor ld and the energy - storing capacitor cd are in energy - releasing operation . as shown in fig5 , in this operation mode , the driving circuit provides a second voltage - increasing path lp 2 including , in sequence , the inductor ld , the energy - storing capacitor cd , the capacitor c 2 , the second diode d 2 and then back to the inductor ld . as shown in fig6 , the driving circuit is operated in the third operation mode . more particularly , during the continual lighting of the led module 40 , the feedback unit 60 may sense an excessive driving current i led , which induces an excessive voltage v led . at this time , the feedback voltage vfb sent to the voltage comparator qpv is larger than the reference voltage vref and the voltage comparator qpv generates low - level control signal sc to turn off the first transistor switch q 1 and turn on the second transistor switch q 2 . the led module 40 in this mode is not conducted due to excessive voltage v led . as shown in fig6 , in this operation mode , the driving circuit provides a first voltage - decreasing path lp 3 including , in sequence , the input voltage vin , the capacitor c 1 , the energy - storing capacitor cd , the inductor ld , the second transistor switch q 2 and then back to the input voltage vin . in this mode , the voltage regulator 30 controls the voltage v led to decrease such that the led module 40 can be operated in constant driving voltage . as shown in fig7 , the driving circuit is operated in the fourth operation mode . more particularly , the voltage v led is such decreased that the led module 40 has normal lighting operation . the voltage comparator qpv generates the control signal sc to turn off both the first transistor switch q 1 and the second transistor switch q 2 . as shown in fig7 , in this operation mode , the driving circuit provides a second voltage - decreasing path lp 4 including , in sequence , the energy - storing capacitor cd , the inductor ld , the first diode d 1 , the capacitor c 1 , and then back to the energy - storing capacitor cd . the switching control unit 70 can use schemes other than those shown in fig4 to 7 to control the voltage regulator 30 . the other implementation ways can be exemplified as follows : ( 1 ) the first transistor switch q 1 is a pnp mosfet while the second transistor switch q 2 is an npn mosfet , and vice versa , while both switches are controlled by the control signal sc of the switching control unit 70 . ( 2 ) both of the first transistor switch q 1 and the second transistor switch q 2 can be the same type of mosfet , namely pnp mosfet or npn mosfet , while the switching control unit 70 generates control signals of opposite levels to respectively control the first transistor switch q 1 and the second transistor switch q 2 . ( 3 ) both of the first transistor switch q 1 and the second transistor switch q 2 can be the same type of mosfet , namely pnp mosfet or npn mosfet , while the switching control unit 70 generates a control signal used with a level inverter to control the first transistor switch q 1 and the second transistor switch q 2 with two signals of opposite levels . fig8 shows the circuit diagram of the driving circuit according to the second embodiment of the present disclosure . the second embodiment is similar to the first embodiment except that the second embodiment has a plurality of led modules 40 and each of the led modules 40 can keep constant - current and constant - voltage operation . in this embodiment , the transistor switch qd used by the current control unit 50 is realized by bipolar transistor . similarly , the voltage - stabilization diode z d also provide a stabilization voltage of 2 . 5v and cooperates with the voltage - stabilization resistor rv to provide a constant led driving current i led . the operation of the driving circuit shown in fig8 is similar to that of fig3 and the detailed description thereof is omitted here for brevity . to sum up , the driving circuit for led of the present disclosure has following advantages : 1 . the voltage regulator 30 can advantageously adjust the input voltage to maintain constant voltage and constant current driving for the led module , thus solving the matching issue between input and output of linear driving circuit . 2 . the voltage regulator 30 can adapt the driving circuit of the present disclosure to various input voltages such that the led lamp with the driving circuit can be used with worldwide voltage . 3 . the user can save the extra cost for led lamp and the led driver designer can save r & amp ; d labor and cost . as the skilled person will appreciate , various changes and modifications can be made to the described embodiment . it is intended to include all such variations , modifications and equivalents which fall within the scope of the present invention , as defined in the accompanying claims . | 8 |
fig1 . shows how a participant will understand the project , and begin to participate by uploading creative submissions to their chosen category . a total amount of money ( 10 ) ( subject or adjective ) is divided into three unequal categories or nouns ( 12 ) ( 14 ) ( 16 ) that together equal the sum of the total money ( 10 ); the money of each of the three nouns is then divided into five different possible verbs ( 18 ) that when read simultaneously together ( adjective , noun , verb ), create assignments for the users to submit art work to . there are five verbs to each of the three nouns for a total of fifteen verbs in a project . the three nouns equal the sum of the total project amount ( 10 ), and the five verbs equal the sum of the total nouns ( 12 )( 14 )( 16 ). the three nouns being unequal amounts of money create low to high amounts of money for all of the fifteen verbs ( if one noun is worth $ 25 . 00 and the other worth $ 50 . 00 , the verbs following the $ 25 . 00 noun will be worth less amount of money then the verbs following the $ 50 . 00 noun ). an even number of participants are accepted to participate in a daily project ( 20 )( 22 ), although rewarding only half of the participants ( 20 ) that signed up in a day , thus creating fair chances of being rewarded for each user , 50 / 50 or half and half . in operation the user will sign up free and play in any category long enough to be awarded up to the allowed amount of money available for free users . the user will upgrade his / her account for more access to the project . the user selects a category they want to participate in , thus reserving one of the ten available spots in that category . ten spots are available per category , so that each user has a fair chance at winning one of the five spots . after the user has reserved their spot in a category , they have up to one week to upload their artwork to be reviewed by an administrator in order to be rewarded . the five most creative submissions ( 18 ) per category win , ( one submission per verb ) a total of fifteen submissions are awarded per day . the user purchases a membership that allows more access to the other categories to earn more money available in the project , there are multiple memberships , a membership for each category ( 12 )( 14 )( 16 ), a membership for unlimited access to all three , a membership to be qualified for the end of the year scholarship drawing , and a membership to be qualified as an employee . the project provides people around the world with the chance to make more money off the website , while a portion of the profits are donated to charitable causes , and our very own scholarship foundation . there are many ways to build this website and have it operate according to fig1 . there are two scripting languages (. php and . net ) that can absolutely build this website to these functioning capabilities . there is no particular scripting language to use . it is a preference decided by a web developer . fig1 gets updated everyday with a new adjective , nouns and verbs . this maybe randomly selected or an administrator can select it . in order to keep the project fair for all users one user cannot win more than one of five spots ( 18 ) in a category ( 12 )( 14 )( 16 ). a user will enter a category and submit artwork to all five verbs , but the user may only win one of the five , leaving the four other spots available to four other users . depending on the users purchased membership they may be allowed access to more categories ( 12 )( 14 )( 16 ) per day . there are different levels of a membership based on the users desired amount of access . in operation the user signs up free , but is encouraged to purchase a membership . when their access to the project ( fig1 ) runs out the user may purchase a membership that allows more access to the richer categories ( 14 )( 16 ) all year in the project ( 10 ). a free user has numerous options to select from in order to keep playing . a returning user will log in and have instant access to the project ( 10 ). businesses will host a custom online store on their personal profile , and a portion of all the networks sales goes to charitable causes . any form of art may be entered , as long as it is uploaded within the due date of the project the most unique entries are awarded . in order for the user to begin to play he / she must have a way of receiving payment online , credit / debit , paypal account , or checking account . the website will be developed as a social network , in order for all the users to keep in contact with old friends or meet new and interesting people . the project ( 10 ) provides people around the world with the chances to make more money every day , while a portion of membership sales are donated to charitable causes . accordingly the reader will see that , according to one embodiment of the invention , i have provided the first type of economic stimulus in exchange for creative submissions to the project i developed . while the above description contains many specifics , these should not be construed as limitations on the scope of any embodiment , but as exemplifications of the presently preferred embodiments thereof . many other ramifications and variations are possible within the teachings of the various embodiments . for example , the adjective ( 10 ), nouns ( 12 ) ( 14 ) ( 16 ) and verbs ( 18 ) may be organized in whichever way to create criteria for the project . words may even be substituted by an activity , etc . the money being dispersed does not have to be of any particular amount , therefore creating room for expansion and more users to play per day . this project can be expanded thus to award more people each day when needed . thus the scope of the invention should be determined by the appended claims and their legal equivalents , and not by the examples given . | 6 |
to develop a new vaccinia vaccine strain , nyvac ( vp866 ), the copenhagen vaccine strain of vaccinia virus was modified by the deletion of six nonessential regions of the by the deletion of six nonessential regions of the genome encoding known or potential virulence factors . the sequential deletions are detailed below . all designations of vaccinia restriction fragments , open reading frames and nucleotide positions are based on the terminology reported in goebel et al ., 1990a , b . the deletion loci were also engineered as recipient loci for the insertion of foreign genes . the regions deleted in nyvac are listed below . also listed are the abbreviations and open reading frame designations for the deleted regions ( goebel et al ., 1990a , b ) and the designation of the vaccinia recombinant ( vp ) containing all deletions through the deletion specified : nyvac is a genetically engineered vaccinia virus strain that was generated by the specific deletion of eighteen open reading frames encoding gene products associated with virulence and host range . nyvac is highly attenuated by a number of criteria including i ) decreased virulence after intracerebral inoculation in newborn mice , ii ) inocuity in genetically ( nu + / nu + ) or chemically ( cyclophosphamide ) immunocompromised mice , iii ) failure to cause disseminated infection in immunocompromised mice , iv ) lack of significant induration and ulceration on rabbit skin , v ) rapid clearance from the site of inoculation , and vi ) greatly reduced replication competency on a number of tissue culture cell lines including those of human origin . nevertheless , nyvac based vectors induce excellent responses to extrinsic immunogens and provided protective immunity . trovac refers to an attenuated fowlpox that was a plaque - cloned isolate derived from the fp - 1 vaccine strain of fowlpoxvirus which is licensed for vaccination of 1 day old chicks . alvac is an attenuated canarypox virus - based vector that was a plaque - cloned derivative of the licensed canarypox vaccine , kanapox ( tartaglia et al ., 1992 ). alvac has some general properties which are the same as some general properties of kanapox . alvac - based recombinant viruses expressing extrinsic immunogens have also been demonstrated efficacious as vaccine vectors ( tartaglia et al ., 1993 a , b ). this avipox vector is restricted to avian species for productive replication . on human cell cultures , canarypox virus replication is aborted early in the viral replication cycle prior to viral dna synthesis . nevertheless , when engineered to express extrinsic immunogens , authentic expression and processing is observed in vitro in mammalian cells and inoculation into numerous mammalian species induces antibody and cellular immune responses to the extrinsic immunogen and provides protection against challenge with the cognate pathogen ( taylor et al ., 1992 ; taylor et al ., 1991 ). recent phase i clinical trials in both europe and the united states of a canarypox / rabies glycoprotein recombinant ( alvac - rg ) demonstrated that the experimental vaccine was well tolerated and induced protective levels of rabiesvirus neutralizing antibody titers ( cadoz et al ., 1992 ; fries et al ., 1992 ). additionally , peripheral blood mononuclear cells ( pbmcs ) derived from the alvac - rg vaccinates demonstrated significant levels of lymphocyte proliferation when stimulated with purified rabies virus ( fries et al ., 1992 ). nyvac , alvac and trovac have also been recognized as unique among all poxviruses in that the national institutes of health (“ nih ”)( u . s . public health service ), recombinant dna advisory committee , which issues guidelines for the physical containment of genetic material such as viruses and vectors , i . e ., guidelines for safety procedures for the use of such viruses and vectors which are based upon the pathogenicity of the particular virus or vector , granted a reduction in physical containment level : from bl2 to bl1 . no other poxvirus has a bl1 physical containment level . even the copenhagen strain of vaccinia virus — the common smallpox vaccine — has a higher physical containment level ; namely , bl2 . accordingly , the art has recognized that nyvac , alvac and trovac have a lower pathogenicity than any other poxvirus . both nyvac - and alvac - based recombinant viruses have been shown to stimulate in vitro specific cd8 + ctls from human pbmcs ( tartaglia et al ., 1993a ). mice immunized with nyvac or alvac recombinants expressing various forms of the hiv - 1 envelope glycoprotein generated both primary and memory hiv specific ctl responses which could be recalled by a second inoculation ( tartaglia et al ., 1993a ). alvac - env and nyvac - env recombinants ( expressing the hiv - 1 envelope glycoprotein ) stimulated strong hiv - specific ctl responses from peripheral blood mononuclear cells ( pbmc ) of hiv - 1 infected individuals ( tartaglia et al ., 1993a ). acutely infected autologous pbmc were used as stimulator cells for the remaining pbmc . after 10 days incubation in the absence of exogenous il - 2 , the cells were evaluated for ctl activities . nyvac - env and alvac - env stimulated high levels of anti - hiv activities . thus , these vectors lend themselves well to ex vivo stimulation of antigen reactive lymphocytes ; for example , adoptive immunotherapy such as the ex vivo expression of tumor reactive lymphocytes and reinfusion into the host ( patient ). immunization of the patient with nyvac -, alvac -, or trovac - based recombinant viruses expressing taas produced by the patient &# 39 ; s tumor cells can elicit anti - tumor immune responses more rapidly and to sufficient levels to impede or halt tumor spread and potentially eliminate the tumor burden . clearly based on the attenuation profiles of the nyvac , alvac , and trovac vectors and their demonstrated ability to elicit both humoral and cellular immunological responses to extrinsic immunogens ( tartaglia et al ., 1993a , b ; taylor et al ., 1992 ; konishi et al ., 1992 ) such recombinant viruses offer a distinct advantage over previously described vaccinia - based recombinant viruses . the immunization procedure for such recombinant viruses as immunotherapeutic vaccines or compositions may be via a parenteral route ( intradermal , intramuscular or subcutaneous ). such an administration enables a systemic immune response against the specific taa ( s ). alternatively , the vaccine or composition may be administered directly into the tumor mass ( intratumor ). such a route of administration can enhance the anti - tumor activities of lymphocytes specifically associated with tumors ( rosenberg , 1992 ). immunization of the patient with nyvac -, alvac - or trovac - based recombinant viruses expressing taas produced by the patient &# 39 ; s tumor cells can elicit anti - tumor immune responses more rapidly and to sufficient levels to impede or halt tumor spread and potentially eliminate the tumor burden . the heightened tumor - specific immune response resulting from vaccinations with these poxvirus - based recombinant vaccines can result in remission of the tumor , including permanent remission of the tumor . examples of known taas for which recombinant poxviruses can be generated and employed with immunotherapeutic value in accordance with this invention include , but are not limited to p53 ( hollstein et al ., 1991 ), p21 - ras ( almoguera et al ., 1988 ), her - 2 ( fendly et al ., 1990 ), and the melanoma - associated antigens ( mage - 1 ; mze - 2 ) ( van der bruggen et al ., 1991 ), and p97 ( hu et al ., 1988 ) and the carcinoembryonic antigen ( cea ) associated with colorecteal cancer ( kantor et al ., 1993 ; fishbein et al ., 1992 ; kaufman et al ., 1991 ). more generally , the inventive vaccines or compositions ( vaccines or compositions containing the poxvirus art . such vaccines or compositions can be administered to a patient in need of such administration in dosages and by techniques well known to those skilled in the medical arts taking into consideration such factors as the age , sex , weight , and condition of the particular patient , and the route of administration . the vaccines or compositions can be co - administered or sequentially administered with other antineoplastic , anti - tumor or anti - cancer agents and / or with agents which reduce or alleviate ill effects of antineoplastic , anti - tumor or anti - cancer agents ; again taking into consideration such factors as the age , sex , weight , and condition of the particular patient , and , the route of administration . examples of vaccines or compositions of the invention include liquid preparations for orifice , e . g ., oral , nasal , anal , vaginal , etc ., administration such as suspensions , syrups or elixirs ; and , preparations for parental , subcutaneous , intradermal , intramuscular or intravenous administration ( e . g ., injectable administration ) such as sterile suspensions or emulsions . in such compositions the recombinant poxvirus may be in admixture with a suitable carrier , diluent , or excipient such as sterile water , physiological saline , glucose or the like . the recombinant poxvirus of the invention can be provided in lyophilized form for reconstituting , for instance , in isotonic aqueous , saline buffer . further , the invention also comprehends a kit wherein the recombinant poxvirus is provided . the kit can include a separate container containing a suitable carrier , diluent or excipient . the kit can also include an additional anti - cancer , anti - tumor or antineoplastic agent and / or an agent which reduces or alleviates ill effects of antineoplastic , anti - tumor or anti - cancer agents for co - or sequential - administration . additionally , the kit can include instructions for mixing or combining ingredients and / or administration . the poxvirus vector technology provides an appealing approach towards manipulating lymphocytes and tumor cells for use in cell - based immunotherapeutic modalities for cancer . characteristics of the nyvac , alvac and trovac vectors providing the impetus for such applications include 1 ) their apparent independence for specific receptors for entry into cells , 2 ) their ability to express foreign genes in cell substrates despite their species - or tissue - specific origin , 3 ) their ability to express foreign genes independent of host cell regulation , 4 ) the demonstrated ability of using poxvirus recombinant viruses to amplify specific ctl reactivities from peripheral blood mononuclear cells ( pbmcs ), and 5 ) their highly attenuated properties compared to existing vaccinia virus vaccine strains ( reviewed by tartaglia et al ., 1993a ; tartaglia et al ., 1990 ). the expression of specific cytokines or the co - expression of specific cytokines with taas by nyvac -, alvac -, and trovac - based recombinant viruses can enhance the numbers and anti - tumor activities of ctls associated with tumor cell depletion or elimination . examples of cytokines which have a beneficial effect in this regard include tumor necrosis factor - α ( tnf - α ). interferon - gamma ( inf - gamma ), interleukin - 2 ( il - 2 ), interleukin - 4 ( il - 4 ), and interleukin - 7 ( il - 7 ) ( reviewed by pardoll , 1992 ). cytokine interleukin 2 ( il - 2 ) plays a major role in promoting cell mediated immunity . secreted by the t h 1 subset of lymphocytes , il - 2 is a t cell growth factor which stimulates division of both cd4 + and cd8 + t cells . in addition , il - 2 also has been shown to activate b cells , monocytes and natural killer cells . to a large degree the biological effects of il - 2 are due to its role in inducing production of ifnγ . recombinant vaccinia virus expressing il - 2 is attenuated in mice compared to wild - type vaccinia virus . this is due to the ability of the vaccinia - expressed il - 2 to stimulate mouse nk cells to produce ifnγ , which limits the growth of the recombinant vaccinia virus ( karupiah et al ., 1990 ). similarly , it has been shown that inoculation of immunodeficient athymic nude mice with recombinant vaccinia virus expressing both il - 2 and the ha gene of influenza can protect these mice from subsequent challenge with influenza virus ( karupiah et al ., 1992 ). cytokine interferon γ ( ifnγ ) is secreted by the t h 1 subset of lymphocytes . ifnγ promotes the t h 1 cell mediated immune response , while inhibiting the t h 2 ( antibody ) response . ifnγ induces the expression of major histocompatibility , complex ( mhc ) molecules on antigen presenting cells , and induces the expression of the b7 costimulatory molecule on macrophages . in addition to enhancing the phaqocytic activity of macrophages , ifnγ enhances the cytotoxic activity of nk cells . when expressed in replicating recombinant vaccinia virus , ifnγ limits the growth of the recombinant virus . this allows t cell immunodeficient mice to resolve the infection ( kohonen - corish et al ., 1990 ). cytokine interleukin 4 ( il - 4 ) is secreted by the t h 2 subset of lymphocytes . il - 4 promotes the t h 2 ( antibody ) response , while inhibiting the t h 1 cell mediated immune response . recombinant vaccinia virus expressing il - 4 shows increased pathogenicity in mice compared to wild - type vaccinia virus ( ramshaw et al ., 1992 ). cytokine granulocyte macrophage colony stimulating factor ( gmcsf ) is pleiotropic . in addition to stimulating the proliferation of cells of both the granulocyte and macrophage cell lineages , gmcsf , in cross - competition with interleukins 3 and 5 ( il - 3 and il - 5 ), influences many other aspects of hematopoiesis and may play a role in facilitation of tumor cell growth ( lopez et al ., 1992 ). gmcsf is used clinically for hematopoietic reconstitution following bone marrow transplantation . cytokine interleukin 12 ( il - 12 ), formerly known as natural killer ( nk ) cell stimulatory factor , is a heterodimer composed of 35 kda and 40 kda subunits . il - 12 is produced by monocytes , macrophages , b cells and other accessory cells . il - 12 has pleiotropic effects on both nk cells and t cells . partly through its role in inducing ifnγ production , il - 12 plays a major role in promoting the t h 1 cell mediated immune response , while inhibiting the t h 2 response ( reviewed in trinchieri , 1993 ). recently , recombinant murine il - 12 has been demonstrated to have potent antitumor and antimetastatic effects in mice ( brunda et al ., 1993 ). b7 ( bb - 1 ), a member of the immunoglobin superfamily , is present on the surface of antigen presenting cells . interaction of the b7 molecule on antigen presenting cells with its receptors on t cells provides costimulatory signals , including il - 2 , which are necessary for t cell activation ( schwartz , 1992 ). recently it was shown that experimental co - expression of b7 along with a tumor antigen on murine melanoma cells can lead to regression of tumors in mice . this was accomplished by the b7 - assisted activation of tumor - specific cytotoxic t cells ( chen et al , 1992 ). the c - erb - b - 2 gene , which is conserved among vertebrates , encodes a possible receptor protein . the 185 kda translation product contains a kinase domain which is highly homologous to the kinase domain of the epidermal growth factor ( egf ) receptor . the c - erb - b - 2 gene is conserved among vertebrates , and is the same as the rat neu gene , which has been detected in a number of rat neuro / glioblastomas . the human c - erb - b - 2 gene , also known as her2 , is amplified in certain neoplasias , most notably breast cancer . in the gastric cancer cell line , mkn - 7 , both the normal 4 . 6 kb transcript encoding c - erb - b - 2 and a 2 . 3 kb transcript which specifies only the extracellular domain of the putative receptor are synthesized at elevated levels ( yamamoto et al ., 1986 ). the extracellular domain has been suggested as a potential immunogen for active specific immunotherapy of breast cancer ( fendly et al ., 1990 ). utility of nyvac -, alvac -, and trovac - based recombinant viruses expressing taas plus or minus specific cytokines for adoptive immunotherapy can take several forms . for one , genetic modification of pbmcs can be accomplished by vector - mediated introduction of taas , cytokine genes , or other genes and then directly reintroduced into the patient . such administration relies on the drainage or movement of modified pbmcs to lymphoid tissue ( i . e . spleen ; lymph nodes ) via the reticuloendothelial system ( res ) for elicitation of the tumor - specific immune response . pbmcs modified by infection with the pertinent nyvac -, alvac -, and trovac - based recombinant can be employed , for instance , in vitro , to expand taa - specific ctls for reinfusion into the patient . tumor - infiltrating lymphocytes ( tils ) derived from the tumor mass can be isolated , expanded , and modified to express pertinent genes using nyvac -, alvac -, or trovac - based recombinants viruses prior to reinfusion into the patient . tils retain the capability of returning to tumors ( homing ) when re - introduced into the subject ( rosenberg , 1992 ). thus , they provide a convenient vehicle for delivery of cytotoxic or cytostatic cytokines to tumor masses . cell - based active immunotherapy can also take on several potential modalities using the nyvac -, alvac -, and trovac vectors . tumor cells can be modified to express taas , cytokines , or other novel antigens ( i . e . class i or class ii major histocompatibility genes ). such modified tumor cells can subsequently be utilized for active immunization . the therapeutic potential for such an administration is based on the ability of these modified tumor cells to secrete cytokines and to alter the presentation of taas to achieve systemic anti - tumor activity . the modified tumor cells can also be utilized to expand tumor - specific ctls in vitro for reinfusion into the patient . a better understanding of the present invention and of its many advantages will be had from the following examples , given by way of illustration . dna cloning and synthesis . plasmids were constructed , screened and grown by standard procedures ( maniatis et al ., 1982 ; perkus et al ., 1985 ; piccini et al ., 1987 ). restriction endonucleases were obtained from bethesda research laboratories , gaithersburg , md ., new england biolabs , beverly , mass . ; and boehringer mannheim biochemicals , indianapolis , ind . kienow fragment of e . coli polymerase was obtained from boehringer mannheim biochemicals . bal - 31 exonuclease and phage t4 dna ligase were obtained from new england biolabs . the reagents were used as specified by the various suppliers . synthetic oligodeoxyribonucleotides were prepared on a biosearch 8750 or applied biosystems 380b dna synthesizer as previously described ( perkus et al ., 1989 ). dna sequencing was performed by the dideoxy - chain termination method ( sanger et al ., 1977 ) using sequenase ( tabor et al ., 1987 ) as previously described ( guo et al ., 1989 ). dna amplification by polymerase chain reaction ( pcr ) for sequence verification ( engelke et al ., 1988 ) was performed using custom synthesized oligonucleotide primers and geneamp dna amplification reagent kit ( perkin elmer cetus , norwalk , conn .) in an automated perkin elmer cetus dna thermal cycler . excess dna sequences were deleted from plasmids by restriction endonuclease digestion followed by limited digestion by bal - 31 exonuclease and mutagenesis ( mandecki , 1986 ) using synthetic oligonucleotides . cells , virus , and transfection . the origins and conditions of cultivation of the copenhagen strain of vaccinia virus has been previously described ( guo et al ., 1989 ). generation of recombinant virus by recombination , in situ hybridization of nitrocellulose filters and screening for b - galactosidase activity are as previously described ( piccini et al ., 1987 ). the origins and conditions of cultivation of the copenhagen strain of vaccinia virus and nyvac has been previously described ( guo et al ., 1989 ; tartaglia et al ., 1992 ). generation of recombinant virus by recombination , in situ hybridization of nitrocellulose filters and screening for b - galactosidase activity are as previously described ( panicali et al ., 1982 ; perkus et al ., 1989 ). the parental canarypox virus ( rentschler strain ) is a vaccinal strain for canaries . the vaccine strain was obtained from a wild type isolate and attenuated through more than 200 serial passages on chick embryo fibroblasts . a master viral seed was subjected to four successive plaque purifications under agar and one plaque clone was amplified through five additional passages after which the stock virus was used as the parental virus in in vitro recombination tests . the plaque purified canarypox isolate is designated alvac . the strain of fowlpox virus ( fpv ) designated fp - 1 has been described previously ( taylor et al ., 1988a ). it is an attenuated vaccine strain useful in vaccination of day old chickens . the parental virus strain duvette was obtained in france as a fowlpox scale from a chicken . the virus was attenuated by approximately 50 serial passages in chicken embryonated eggs followed by 25 passages on chicken embryo fibroblast cells . the virus was subjected to four successive plaque purifications . one plaque isolate was further amplified in primary cef cells and a stock virus , designated as trovac , established . nyvac , alvac and trovac viral vectors and their derivatives were propagated as described previously ( piccini et al ., 1987 ; taylor et al ., 1988a , b ). vero cells and chick embryo fibroblasts ( cef ) were propagated as described previously ( taylor et al ., 1988a , b ). referring now to fig1 plasmid psd406 contains vaccinia hindiii j ( pos . 83359 - 88377 ) cloned into puc8 . psd406 was cut with hindiii and pvuii , and the 1 . 7 kb fragment from the left side of hindiii j cloned into puc8 cut with hindiii / smai , forming psd447 . psd447 contains the entire gene for j2r ( pos . 83855 - 84385 ). the initiation codon is contained within an nlaiii site and the termination codon is contained within an sspi site . direction of transcription is indicated by an arrow in fig1 . to obtain a left flanking arm , a 0 . 8 kb hindiii / ecori fragment was isolated from psd447 , then digested with nlaiii and a 0 . 5 kb hindiii / nlaiii fragment isolated . annealed synthetic oligonucleotides mpsyn43 / mpsyn44 ( seq id no : 1 / seq id no : 2 ) smai mpsyn43 5 taattaactagctacccggg 3 ′ mpsyn44 3 ′ gtacattaattgatcgatgggcccttaa 5 ′ nla iii eco ri were ligated with the 0 . 5 kb hindiii / nlaiii fragment into puc18 vector plasmid cut with hindiii / ecori , generating plasmid psd449 . to obtain a restriction fragment containing a vaccinia right flanking arm and puc vector sequences , psd447 was cut with sspi ( partial ) within vaccinia sequences and hindiii at the puc / vaccinia junction , and a 2 . 9 kb vector fragment isolated . this vector fragment was ligated with annealed synthetic oligonucleotides mpsyn45 / mpsyn46 ( seq id no : 3 / seq id no : 4 ) hindiii smai noti ssp i mpsyn45 5 ′ agcttcccgggtaagtaatacgtcaaggagaaaacgaaacgatctgtagttagcggccgcctaattaactaat 3 ′ mpsyn45 mpsyn46 3 ′ agggcccattcattatgcagttcctcttttgctttgctagacatcaatcgccggcggattaattgatta 5 ′ mpsyn46 to combine the left and right flanking arms into one plasmid , a 0 . 5 kb hindiii / smai fragment was isolated from psd449 and ligated with psd459 vector plasmid cut with hindiii / smai , generating plasmid psd460 . psd460 was used as donor plasmid for recombination with wild type parental vaccinia virus copenhagen strain vc - 2 . 32 p labelled probe was synthesized by primer extension using mpsyn45 ( seq id no : 3 ) as template and the complementary 20mer oligonucleotide mpsyn47 ( seq id no : 5 ) ( 5 ′ ttagttaattaggcggccgc 3 ′) as primer . recombinant virus vp410 was identified by plaque hybridization . referring now to fig2 plasmid psd419 contains vaccinia sali g ( pos . 160 , 744 - 173 , 351 ) cloned into puc8 . psd422 contains the contiguous vaccinia sali fragment to the right , sali j ( pos . 173 , 351 - 182 , 746 ) cloned into puc8 . to construct a plasmid deleted for the hemorrhagic region , u , b13r − b14r ( pos . 172 , 549 - 173 , 552 ), psd419 was used as the source for the left flanking arm and psd422 was used as the source of the right flanking arm . the direction of transcription for the u region is indicated by an arrow in fig2 . to remove unwanted sequences from psd419 , sequences to the left of the ncoi site ( pos . 172 , 253 ) were removed by digestion of psd419 with ncoi / smai followed by blunt ending with klenow fragment of e . coli polymerase and ligation generating plasmid psd476 . a vaccinia right flanking arm was obtained by digestion of psd422 with hpai at the termination codon of b14r and by digestion with nrui 0 . 3 kb to the right . this 0 . 3 kb fragment was isolated and ligated with a 3 . 4 kb hincii vector fragment isolated from psd476 , generating plasmid psd477 . the location of the partial deletion of the vaccinia u region in psd477 is indicated by a triangle . the remaining b13r coding sequences in psd477 were removed by digestion with clai / hpai , and the resulting vector fragment was ligated with annealed synthetic oligonucleotides sd22mer / sd20mer ( seq id no : 6 / seq id no : 7 ) cla i bam hi hpa i sd22 mer 5 ′ cgattact atg aaggatccgtt 3 ′ sd20 mer 3 ′ taatgatacttcctaggcaa 5 ′ generating psd479 . psd479 contains an initiation codon ( underlined ) followed by a bamhi site . to place e . coli beta - galactosidase in the b13 - b14 ( u ) deletion locus under the control of the u promoter , a 3 . 2 kb bamhi fragment containing the beta - galactosidase gene ( shapira et al ., 1983 ) was inserted into the bamhi site of psd479 , generating psd479bg . psd479bg was used as donor plasmid for recombination with vaccinia virus vp410 . recombinant vaccinia virus vp533 was isolated as a blue plaque in the presence of chromogenic substrate x - gal . in vp533 the b13r − b14r region is deleted and is replaced by beta - galactosidase . to remove beta - galactosidase sequences from vp533 , plasmid psd486 , a derivative of psd477 containing a polylinker region but no initiation codon at the u deletion junction , was utilized . first the clai / hpai vector fragment from psd477 referred to above was ligated with annealed synthetic oligonucleotides sd42mer / sd40mer ( seq id no : 8 / seq id no : 9 ) cla i sac i xho i hpa i sd42mer 5 ′ cgattactagatctgagctccccgggctcgagggatccgtt 3 ′ sd40mer 3 ′ taatgatctagactcgaggggcccgagctccctaggcaa 5 ′ bgl ii sma i bam hi generating plasmid psd478 . next the ecori site at the puc / vaccinia junction was destroyed by digestion of psd478 with ecori followed by blunt ending with klenow fragment of e . coli polymerase and ligation , generating plasmid psd478e − . psd478e − was digested with bamhi and hpai and ligated with annealed synthetic oligonucleotides hem5 / hem6 ( seq id no : 10 / seq id no : 11 ) bam hi eco ri hpa i hem5 5 ′ gatccgaattctagct 3 ′ hem6 3 ′ gcttaagatcga 5 ′ generating plasmid psd486 . psd486 was used as donor plasmid for recombination with recombinant vaccinia virus vp533 , generating vp553 , which was isolated as a clear plaque in the presence of x - gal . referring now to fig3 psd414 contains sali b cloned into puc8 . to remove unwanted dna sequences to the left of the a26l region , psd414 was cut with xbai within vaccinia sequences ( pos . 137 , 079 ) and with hindiii at the puc / vaccinia junction , then blunt ended with klenow fragment of e . coli polymerase and ligated , resulting in plasmid psd483 . to remove unwanted vaccinia dna sequences to the right of the a26l region , psd483 was cut with ecori ( pos . 140 , 665 and at the puc / vaccinia junction ) and ligated , forming plasmid psd484 . to remove the a26l coding region , psd484 was cut with ndei ( partial ) slightly upstream from the a26l orf ( pos . 139 , 004 ) and with hpai ( pos . 137 , 889 ) slightly downstream from the a26l orf . the 5 . 2 kb vector fragment was isolated and ligated with annealed synthetic oligonucleotides ati3 / ati4 ( seq id no : 12 / seq id no : 13 ) nde i bgl ii eco ri hpa i ati3 5 ′ tatgagtaacttaactcttttgttaattaaaagtatattcaaaaaataagttatataaatagatctgaattcgtt 3 ′ ati3 ati4 3 ′ actcattgaattgagaaaacaattaattttcatataagttttttattcaatatatttatctagacttaagcaa 3 ′ ati4 reconstructing the region upstream from a26l and replacing the a26l orf with a short polylinker region containing the restriction sites bglii , ecori and hpai , as indicated above . the resulting plasmid was designated psd485 . since the bglii and ecori sites in the polylinker region of psd485 are not unique , unwanted bglii and ecori sites were removed from plasmid psd483 ( described above ) by digestion with bglii ( pos . 140 , 136 ) and with ecori at the puc / vaccinia junction , followed by blunt ending with klenow fragment of e . coli polymerase and ligation . the resulting plasmid was designated psd489 . the 1 . 8 kb clai ( pos . 137 , 198 )/ ecorv ( pos . 139 , 048 ) fragment from psd489 containing the a26l orf was replaced with the corresponding 0 . 7 kb polylinker - containing clai / ecorv fragment from psd485 , generating psd492 . the balii and ecori sites in the polylinker region of psd492 are unique . a 3 . 3 kb bglii cassette containing the e . coli beta - galactosidase gene ( shapira et al ., 1983 ) under the control of the vaccinia 11 kda promoter ( bertholet et al ., 1985 ; perkus et al ., 1990 ) was inserted into the bglii site of psd492 , forming psd493kbg . plasmid psd493kbg was used in recombination with rescuing virus vp553 . recombinant vaccinia virus , vp581 , containing beta - galactosidase in the a26l deletion region , was isolated as a blue plaque in the presence of x - gal . to generate a plasmid for the removal of beta - galactosidase sequences from vaccinia recombinant virus vp581 , the polylinker region of plasmid psd492 was deleted by mutagenesis ( mandecki , 1986 ) using synthetic oligonucleotide mpsyn177 ( seq id no : 14 ) ( 5 ′ aaaatgggcgtggattgttaactttatataacttattttttgaatatac 3 ′). in the resulting plasmid , pmp494δ , vaccinia dna encompassing positions [ 137 , 889 - 138 , 937 ], including the entire a26l orf is deleted . recombination between the pmp494δ and the beta - galactosidase containing vaccinia recombinant , vp581 , resulted in vaccinia deletion mutant vp618 , which was isolated as a clear plaque in the presence of x - gal . referring now to fig4 vaccinia sali g restriction fragment ( pos . 160 , 744 - 173 , 351 ) crosses the hindiii a / b junction ( pos . 162 , 539 ). psd419 contains vaccinia sali g cloned into puc8 . the direction of transcription for the hemagglutinin ( ha ) gene is indicated by an arrow in fig4 . vaccinia sequences derived from hindiii b were removed by digestion of psd419 with hindiii within vaccinia sequences and at the puc / vaccinia junction followed by ligation . the resulting plasmid , psd456 , contains the ha gene , a56r , flanked by 0 . 4 kb of vaccinia sequences to the left and 0 . 4 kb of vaccinia sequences to the right . a56r coding sequences were removed by cutting psd456 with rsai ( partial ; pos . 161 , 090 ) upstream from a56r coding sequences , and with eagi ( pos . 162 , 054 ) near the end of the gene . the 3 . 6 kb rsai / eagi vector fragment from psd456 was isolated and ligated with annealed synthetic oligonucleotides mpsyn59 ( seq id no : 15 ), mpsyn62 ( seq id no : 16 ), mpsyn60 ( seq id no : 17 ), and mpsyn61 ( seq id no : 18 ) mpsyn59 rsa i 5 ′ acacgaatgattttctaaagtatttggaaagttttataggt - mpsyn62 3 ′ tgtgcttactaaaagatttcataaacctttcaaaatatcca - mpsyn59 agttgatagaacaaaatacataattt 3 ′ mpsyn62 tcaactatct 5 ′ mpsyn60 5 ′ tgtaaaaataaatcactttttata - mpsyn61 3 ′ tgttttatgtattaaaacatttttatttagtgaaaaatat - mpsyn60 bgl ii sma i pst i eaq i ctaagatctcccgggctgcagc 3 ′ mpsyn61 gattctagagggcccgacgtcgccgg5 ′ reconstructing the dna sequences upstream from the a56r orf and replacing the a56r orf with a polylinker region as indicated above . the resulting plasmid is psd466 . the vaccinia deletion in psd466 encompasses positions [ 161 , 185 - 162 , 053 ]. the site of the deletion in psd466 is indicated by a triangle in fig4 . a 3 . 2 kb bglii / bamhi ( partial ) cassette containing the e . coli beta - galactosidase gene ( shapira et al ., 1983 ) under the control of the vaccinia 11 kda promoter ( bertholet et al ., 1985 ; guo et al ., 1989 ) was inserted into the bglii site of psd466 , forming psd466kbg . plasmid psd466kbg was used in recombination with rescuing virus vp618 . recombinant vaccinia virus , vp708 , containing beta - galactosidase in the a56r deletion , was isolated as a blue plaque in the presence of x - gal . beta - galactosidase sequences were deleted from vp708 using donor plasmid psd467 . psd467 is identical to psd466 , except that ecori , smai and bamhi sites were removed from the puc / vaccinia junction by digestion of psd466 with ecori / bamhi followed by blunt ending with klenow fragment of e . coli polymerase and ligation . recombination between vp708 and psd467 resulted in recombinant vaccinia deletion mutant , vp723 , which was isolated as a clear plaque in the presence of x - gal . referring now to fig5 the following vaccinia clones were utilized in the construction of pmpcsk1δ . psd420 is sali h cloned into puc8 . psd435 is kpni f cloned into puc18 . psd435 was cut with sphi and religated , forming psd451 . in psd451 , dna sequences to the left of the sphi site ( pos . 27 , 416 ) in hindiii m are removed ( perkus et al ., 1990 ). psd409 is hindiii m cloned into puc8 . to provide a substrate for the deletion of the [ c7l − k1l ] gene cluster from vaccinia , e . coli beta - galactosidase was first inserted into the vaccinia m2l deletion locus ( guo et al ., 1990 ) as follows . to eliminate the bglii site in psd409 , the plasmid was cut with bglii in vaccinia sequences ( pos . 28 , 212 ) and with bamhi at the puc / vaccinia junction , then ligated to form plasmid pmp409b . pmp409b was cut at the unique sphi site ( pos . 27 , 416 ). m2l coding sequences were removed by mutagenesis ( guo et al ., 1990 ; mandecki , 1986 ) using synthetic oligonucleotide the resulting plasmid , pmp409d , contains a unique bglii site inserted into the m2l deletion locus as indicated above . a 3 . 2 kb bamhi ( partial )/ bglii cassette containing the e . coli beta - galactosidase gene ( shapira et al ., 1983 ) under the control of the 11 kda promoter ( bertholet et al ., 1985 ) was inserted into pmp409d cut with bglii . the resulting plasmid , pmp409dbg ( guo et al ., 1990 ), was used as donor plasmid for recombination with rescuing vaccinia virus vp723 . recombinant vaccinia virus , vp784 , containing beta - galactosidase inserted into the m2l deletion locus , was isolated as a blue plaque in the presence of x - gal . a plasmid deleted for vaccinia genes [ c7l − k1l ] was assembled in puc8 cut with smai , hindiii and blunt ended with klenow fragment of e . coli polymerase . the left flanking arm consisting of vaccinia hindiii c sequences was obtained by digestion of psd420 with xbai ( pos . 18 , 628 ) followed by blunt ending with klenow fragment of e . coli polymerase and digestion with bglii ( pos . 19 , 706 ). the right flanking arm consisting of vaccinia hindiii k sequences was obtained by digestion of psd451 with bglii ( pos . 29 , 062 ) and ecorv ( pos . 29 , 778 ). the resulting plasmid , pmp581ck is deleted for vaccinia sequences between the bglii site ( pos . 19 , 706 ) in hindiii c and the bglii site ( pos . 29 , 062 ) in hindiii k . the site of the deletion of vaccinia sequences in plasmid pmp581ck is indicated by a triangle in fig5 . to remove excess dna at the vaccinia deletion junction , plasmid pmp581ck , was cut at the ncoi sites within vaccinia sequences ( pos . 18 , 811 ; 19 , 655 ), treated with bal - 31 exonuclease and subjected to mutagenesis ( mandecki , 1986 ) using synthetic oligonucleotide mpsyn233 ( seq id no : 20 ) 5 ′- tgtcatttaacactatactcatattaataaaaataatatttatt - 3 ′. the resulting plasmid , pmpcsk1δ , is deleted for vaccinia sequences positions 18 , 805 - 29 , 108 , encompassing 12 vaccinia open reading frames [ c7l − k1l ]. recombination between pmpcsk1δ and the beta - galactosidase containing vaccinia recombinant , vp784 , resulted in vaccinia deletion mutant , vp804 , which was isolated as a clear plaque in the presence of x - gal . construction of plasmid psd548 for deletion of large subunit , ribonucleotide reductanse ( i4l ) referring now to fig6 plasmid psd405 contains vaccinia hindiii i ( pos . 63 , 875 - 70 , 367 ) cloned in puc8 . psd405 was digested with ecorv within vaccinia sequences ( pos . 67 , 933 ) and with smai at the puc / vaccinia junction , and ligated , forming plasmid psd518 . psd518 was used as the source of all the vaccinia restriction fragments used in the construction of psd548 . the vaccinia i4l gene extends from position 67 , 371 - 65 , 059 . direction of transcription for i4l is indicated by an arrow in fig6 . to obtain a vector plasmid fragment deleted for a portion of the i4l coding sequences , psd518 was digested with bamhi ( pos . 65 , 381 ) and hpai ( pos . 67 , 001 ) and blunt ended using klenow fragment of e . coli polymerase . this 4 . 8 kb vector fragment was ligated with a 3 . 2 kb smai cassette containing the e . coli beta - galactosidase gene ( shapira et al ., 1983 ) under the control of the vaccinia 11 kda promoter ( bertholet et al ., 1985 ; perkus et al ., 1990 ), resulting in plasmid psd524kbg . psd524kbg was used as donor plasmid for recombination with vaccinia virus vp804 . recombinant vaccinia virus , vp855 , containing beta - galactosidase in a partial deletion of the i4l gene , was isolated as a blue plaque in the presence of x - gal . to delete beta - galactosidase and the remainder of the i4l orf from vp855 , deletion plasmid psd548 was constructed . the left and right vaccinia flanking arms were assembled separately in puc8 as detailed below and presented schematically in fig6 . to construct a vector plasmid to accept the left vaccinia flanking arm , puc8 was cut with bamhi / ecori and ligated with annealed synthetic oligonucleotides 518a1 / 518a2 ( seq id no : 21 / seq id no : 22 ) bam hi rsa i bgl ii eco ri 518a1 5 ′ gatcctgagtactttgtaatataatgatatatattttcactttatctcatttgagaataaaaagatcttagg 3 ′ 518a1 518a2 3 ′ actcatgaaacattatattactatatataaaagtgaaatagagtaaactcttatttttctagaatccttaa 5 ′ 518a2 forming plasmid psd531 . psd531 was cut with rsai ( partial ) and bamhi and a 2 . 7 kb vector fragment isolated . psd518 was cut with bglii ( pos . 64 , 459 )/ rsai ( pos . 64 , 994 ) and a 0 . 5 kb fragment isolated . the two fragments were ligated together , forming psd537 , which contains the complete vaccinia flanking arm left of the i4l coding sequences . to construct a vector plasmid to accept the right vaccinia flanking arm , puc8 was cut with bamhi / ecori and ligated with annealed synthetic oligonucleotides 518b1 / 518b2 ( seq id no : 23 / seq id no : 24 ) bam hi bgl ii sma i rsa i eco ri 518b1 5 ′ gatccagatctcccgggaaaaaaattatttaacttttcattaatag - ggatttgacgtatgtagcgtactagg 3 ′ 518b1 518b2 3 ′ gtctagagggccctttttttaataaattgaaaagtaattatc - cctaaactgcatactacgcatgatccttaa 5 ′ 518b2 forming plasmid psd532 . psd532 was cut with rsai ( partial )/ ecori and a 2 . 7 kb vector fragment isolated . psd518 was cut with rsai within vaccinia sequences ( pos . 67 , 436 ) and ecori at the vaccinia / puc junction , and a 0 . 6 kb fragment isolated . the two fragments were ligated together , forming psd538 , which contains the complete vaccinia flanking arm to the right of i4l coding sequences . the right vaccinia flanking arm was isolated as a 0 . 6 kb ecori / bglii fragment from psd538 and ligated into psd537 vector plasmid cut with ecori / bglii . in the resulting plasmid , psd539 , the i4l orf ( pos . 65 , 047 - 67 , 386 ) is replaced by a polylinker region , which is flanked by 0 . 6 kb vaccinia dna to the left and 0 . 6 kb vaccinia dna to the right , all in a puc background . the site of deletion within vaccinia sequences is indicated by a triangle in fig6 . to avoid possible recombination of beta - galactosidase sequences in the puc - derived portion of psd539 with beta - galactosidase sequences in recombinant vaccinia virus vp855 , the vaccinia i4l deletion cassette was moved from psd539 into prc11 , a puc derivative from which all beta - galactosidase sequences have been removed and replaced with a polylinker region ( colinas et al ., 1990 ). psd539 was cut with ecori / psti and the 1 . 2 kb fragment isolated . this fragment was ligated into prc11 cut with ecori / psti ( 2 . 35 kb ), forming psd548 . recombination between psd548 and the beta - galactosidase containing vaccinia recombinant , vp855 , resulted in vaccinia deletion mutant vp866 , which was isolated as a clear plaque in the presence of x - gal . dna from recombinant vaccinia virus vp866 was analyzed by restriction digests followed by electrophoresis on an agarose gel . the restriction patterns were as expected . polymerase chain reactions ( pcr ) ( engelke et al ., 1988 ) using vp866 as template and primers flanking the six deletion loci detailed above produced dna fragments of the expected sizes . sequence analysis of the pcr generated fragments around the areas of the deletion junctions confirmed that the junctions were as expected . recombinant vaccinia virus vp866 , containing the six engineered deletions as described above , was designated vaccinia vaccine strain “ nyvac .” the gene encoding rabies glycoprotein g under the control of the vaccinia h6 promoter ( taylor et al ., 1988a , b ) was inserted into tk deletion plasmid psd513 . psd513 is identical to plasmid psd460 ( fig1 ) except for the presence of a polylinker region . referring now to fig7 the polylinker region was inserted by cutting psd460 with smai and ligating the plasmid vector with annealed synthetic oligonucleotides vq1a / vq1b ( seq id no : 25 / seq id no : 26 ) to form vector plasmid psd513 . psd513 was cut with smai and ligated with a smai ended 1 . 8 kb cassette containing the gene encoding the rabies glycoprotein g gene under the control of the vaccinia h6 promoter ( taylor et al ., 1988a , b ). the resulting plasmid was designated prw842 . prw842 was used as donor plasmid for recombination with nyvac rescuing virus ( vp866 ). recombinant vaccinia virus vp879 was identified by plaque hybridization using 32 p - labelled dna probe to rabies glycoprotein g coding sequences . the modified recombinant viruses of the present invention provide advantages as recombinant vaccine vectors . the attenuated virulence of the vector advantageously reduces the opportunity for the possibility of a runaway infection due to vaccination in the vaccinated individual and also diminishes transmission from vaccinated to unvaccinated individuals or contamination of the environment . the modified recombinant viruses are also advantageously used in a method for expressing a gene product in a cell cultured in vitro by introducing into the cell the modified recombinant virus having foreign dna which codes for and expresses gene products in the cell . construction of trovac - ndv expressing the fusion and hemagglutinin - neuraminidase glycoproteins of newcastle disease virus this example describes the development of trovac , a fowlpox virus vector and , of a fowlpox newcastle disease virus recombinant designated trovac - ndv and its safety and efficacy . a fowlpox virus ( fpv ) vector expressing both f and hn genes of the virulent ndv strain texas was constructed . the recombinant produced was designated trovac - ndv . trovac - ndv expresses authentically processed ndv glycoproteins in avian cells infected with the recombinant virus and inoculation of day old chicks protects against subsequent virulent ndv challenge . cells and viruses . the texas strain of ndv is a velogenic strain . preparation of cdna clones of the f and hn genes has been previously described ( taylor et al ., 1990 ; edbauer et al ., 1990 ). the strain of fpv designated fp - 1 has been described previously ( taylor et al ., 1988a ). it is a vaccine strain useful in vaccination of day old chickens . the parental virus strain duvette was obtained in france as a fowlpox scab from a chicken . the virus was attenuated by approximately 50 serial passages in chicken embryonated eggs followed by 25 passages on chicken embryo fibroblast cells . the virus was subjected to four successive plaque purifications . one plaque isolate was further amplified in primary cef cells and a stock virus , designated as trovac , established . the stock virus used in the in vitro recombination test to produce trovac - ndv had been subjected to twelve passages in primary cef cells from the plaque isolate . construction of a cassette for ndv - f . a 1 . 8 kbp bamhi fragment containing all but 22 nucleotides from the 5 ′ end of the f protein coding sequence was excised from pndv81 ( taylor et al ., 1990 ) and inserted at the bamhi site of puc18 to form pce13 . the vaccinia virus h6 promoter previously described ( taylor et al ., 1988a , b ; guo et al ., 1989 ; perkus et al ., 1989 ) was inserted into pce13 by digesting pce13 with sali , filling in the sticky ends with klenow fragment of e . coli dna polymerase and digesting with hindiii . a hindiii - ecorv fragment containing the h6 promoter sequence was then inserted into pce13 to form pce38 . a perfect 5 ′ end was generated by digesting pce38 with kpni and nrui and inserting the annealed and kinased oligonucleotides ce75 ( seq id no : 27 ) and ce76 ( seq id no : 28 ) to generate pce47 . in order to remove non - coding sequence from the 3 ′ end of the ndv - f a smai to psti fragment from pce13 was inserted into the smai and psti sites of puci8 to form pce23 . the non - coding sequences were removed by sequential digestion of pce23 with saci , bamhi , exonuclease iii , si nuclease and ecori . the annealed and kinased oligonucleotides ce42 ( seq id no : 29 ) and ce43 ( seq id no : 30 ) were then inserted to form pce29 . the 3 ′ end of the ndv - f sequence was then inserted into plasmid pce20 already containing the 5 ′ end of ndv - f by cloning a psti - saci fragment from pce29 into the psti and saci sites of pce20 to form pce32 . generation of pce20 has previously been described in taylor et al ., 1990 . in order to align the h6 promoter and ndv - f 5 ′ sequences contained in pce47 with the 3 ′ ndv - f sequences contained in pce32 , a hindiii - psti fragment of pce47 was inserted into the hindiii and psti sites of pce32 to form pce49 . the h6 promoted ndv - f sequences were then transferred to the de - orfed f8 locus ( described below ) by cloning a hindiii - nrui fragment from pce49 into the hindiii and smai sites of pjca002 ( described below ) to form pce54 . transcription stop signals were inserted into pce54 by digesting pce54 with saci , partially digesting with bamhi and inserting the annealed and kinased oligonucleotides ce166 ( seq id no : 31 ) and ce167 ( seq id no : 32 ) to generate pce58 . a perfect 3 ′ end for ndv - f was obtained by using the polymerase chain reaction ( pcr ) with pce54 as template and oligonucleotides ce182 ( seq id no : 33 ) and ce183 ( seq id no : 34 ) as primers . the pcr fragment was digested with pvuii and hpai and cloned into pce58 that had been digested with hai and partially digested with pvuii . the resulting plasmid was designated pce64 . translation stop signals were inserted by cloning a hindiii - hpai fragment which contains the complete h6 promoter and f coding sequence from pce64 into the hindiii and hpai sites of prw846 to generate pce71 , the final cassette for ndv - f . plasmid prw846 is essentially equivalent to plasmid pjca002 ( described below ) but containing the h6 promoter and transcription and translation stop signals . digestion of prw846 with hindiii and hvai eliminates the h6 promoter but leaves the stop signals intact . construction of cassette for ndv - hn . construction of plasmid prw802 was previously described in edbauer et al ., 1990 . this plasmid contains the ndv - hn sequences linked to the 3 ′ end of the vaccinia virus h6 promoter in a puc9 vector . a hindiii - ecorv fragment encompassing the 5 ′ end of the vaccinia virus h6 promoter was inserted into the hindiii and ecorv sites of prw802 to form prw830 . a perfect 3 ′ end for ndv - hn was obtained by inserting the annealed and kinased oligonucleotides ce162 ( seq id no : 35 ) and ce163 ( seq id no : 36 ) into the ecori site of prw830 to form pce59 , the final cassette for ndv - hn . construction of fpv insertion vector . plasmid prw731 - 15 contains a 10 kb pvuii - pvuii fragment cloned from genomic dna . the nucleotide sequence was determined on both strands for a 3660 bp pvuii - ecorv fragment . the limits of an open reading frame designated here as f8 were determined . plasmid prw761 is a sub - clone of prw731 - 15 containing a 2430 bp ecorv - ecorv fragment . the f8 orf was entirely contained between an xbai site and an sspi site in prw761 . in order to create an insertion plasmid which on recombination with trovac genomic dna would eliminate the f8 orf , the following steps were followed . plasmid prw761 was completely digested with xbai and partially digested with sspi . a 3700 bp xbai - sspi band was isolated from the gel and ligated with the annealed double - stranded oligonucleotides jca017 ( seq id no : 37 ) and jca018 ( seq id no : 38 ). construction of double insertion vector for ndv f and hn . the h6 promoted ndv - hn sequence was inserted into the h6 promoted ndv - f cassette by cloning a hindiii fragment from pce59 that had been filled in with klenow fragment of e . coli dna polymerase into the hpai site of pce71 to form pce80 . plasmid pce80 was completely digested with ndei and partially digested with bglii to generate an ndei - bglii 4760 bp fragment containing the ndv f and hn genes both driven by the h6 promoter and linked to f8 flanking arms . plasmid pjca021 was obtained by inserting a 4900 bp pvuii - hindii fragment from prw731 - 15 into the smai and hindii sites of pbssk +. plasmid pjca021 was then digested with ndei and bglii and ligated to the 4760 bp ndei - bglii fragment of pce80 to form pjca024 . plasmid pjca024 therefore contains the ndv - f and hn genes inserted in opposite orientation with 3 ′ ends adjacent between fpv flanking arms . both genes are linked to the vaccinia virus h6 promoter . the right flanking arm adjacent to the ndv - f sequence consists of 2350 bp of fpv sequence . the left flanking arm adjacent to the ndv - hn sequence consists of 1700 bp of fpv sequence . development of trovac - ndv . plasmid pjca024 was transfected into trovac infected primary cef cells by using the calcium phosphate precipitation method previously described ( panicali et al ., 1982 ; piccini et al ., 1987 ). positive plaques were selected on the basis of hybridization to specific ndv - f and hn radiolabelled probes and subjected to five sequential rounds of plaque purification until a pure indicate that expression of either hn or f alone is sufficient to elicit protective immunity against ndv challenge . work on other paramyxoviruses has indicated , however , that antibody to both proteins may be required for full protective immunity . it has been demonstrated that sv5 virus could spread in tissue culture in the presence of antibody to the hn glycoprotein but not to the f glycoprotein ( merz et al ., 1980 ). in addition , it has been suggested that vaccine failures with killed measles virus vaccines were due to inactivation of the fusion component ( norrby et al ., 1975 ). since both ndv glycoproteins have been shown to be responsible for eliciting virus neutralizing antibody ( avery et al ., 1979 ) and both glycoproteins , when expressed individually in a fowlpox vector are able to induce a protective immune response , it can be appreciated that the most efficacious ndv vaccine should express both glycoproteins . this example describes the development of alvac , a canarypox virus vector and , of a canarypox - rabies recombinant designated as alvac - rg ( vcp65 ) and its safety and efficacy . cells and viruses . the parental canarypox virus ( rentschler strain ) is a vaccinal strain for canaries . the vaccine strain was obtained from a wild type isolate and attenuated through more than 200 serial passages on chick embryo fibroblasts . a master viral seed was subjected to four successive plaque purifications under agar and one plaque clone was amplified through five additional passages after which the stock virus was used as the parental virus in in vitro recombination tests . the plaque purified canarypox isolate is designated alvac . construction of a canarypox insertion vector . an 880 bp canarypox pvuii fragment was cloned between the pvuii sites of puc9 to form prw764 . 5 . the sequence of this fragment is shown in fig8 between positions 1372 and 2251 . the limits of an population was achieved . one representative plaque was then amplified and the resulting trovac recombinant was designated trovac - ndv ( vfp96 ). immunofluorescence . indirect immunofluorescence was performed as described ( taylor et al ., 1990 ) using a polyclonal anti - ndv serum and , as mono - specific reagents , sera produced in rabbits against vaccinia virus recombinants expressing ndv - f or ndv - hn . immunoprecipitation . immunoprecipitation reactions were performed as described ( taylor et al ., 1990 ) using a polyclonal anti - ndv serum obtained from spafas inc ., storrs , conn . the stock virus was screened by in situ plaque hybridization to confirm that the f8 orf was deleted . the correct insertion of the ndv genes into the trovac genome and the deletion of the f8 orf was also confirmed by southern blot hybridization . in ndv - infected cells , the f glycoprotein is anchored in the membrane via a hydrophobic transmembrane region near the carboxyl terminus and requires post - translational cleavage of a precursor , f 0 , into two disulfide linked polypeptides f 1 and f 2 . cleavage of f 0 is important in determining the pathogenicity of a given ndv strain ( homma and ohuchi , 1973 ; nagai et al ., 1976 ; nagai et al ., 1980 ), and the sequence of amino acids at the cleavage site is therefore critical in determining viral virulence . it has been determined that amino acids at the cleavage site in the ndv - f sequence inserted into fpv to form recombinant vfp29 had the sequence arg - arg - gln - arg - arg ( seq id no : 39 ) ( taylor et al ., 1990 ) which conforms to the sequence found to be a requirement for virulent ndv strains ( chambers et al ., 1986 ; espion et al ., 1987 ; le et al ., 1988 ; mcginnes and morrison , 1986 ; toyoda et al ., 1987 ). the hn glycoprotein synthesized in cells infected with virulent strains of ndv is an uncleaved glycoprotein of 74 kda . extremely avirulent strains such as ulster and queensland encode an hn precursor ( hno ) which requires cleavage for activation ( garten et al ., 1980 ). the expression of f and hn genes in trovac - ndv was analyzed to confirm that the gene products were authentically processed and presented . indirect - immunofluorescence using a polyclonal anti - ndv chicken serum confirmed that immunoreactive proteins were presented on the infected cell surface . to determine that both proteins were presented on the plasma membrane , mono - specific rabbit sera were produced against vaccinia recombinants expressing either the f or hn glycoproteins . indirect immunofluorescence using these sera confirmed the surface presentation of both proteins . immunoprecipitation experiments were performed by using ( 35 s ) methionine labeled lysates of cef cells infected with parental and recombinant viruses . the expected values of apparent molecular weights of the glycolysated forms of f 1 and f 2 are 54 . 7 and 10 . 3 kda respectively ( chambers et al ., 1986 ). in the immunoprecipitation experiments using a polyclonal anti - ndv serum , fusion specific products of the appropriate size were detected from the ndv - f single recombinant vfp29 ( taylor et al ., 1990 ) and the trovac - ndv double recombinant vfp96 . the hn glycoprotein of appropriate size was also detected from the ndv - hn single recombinant vfp - 47 ( edbauer et al ., 1990 ) and trovac - ndv . no ndv specific products were detected from uninfected and parental trovac infected cef cells . in cef cells , the f and hn glycoproteins are appropriately presented on the infected cell surface where they are recognized by ndv immune serum . immunoprecipitation analysis indicated that the f 0 protein is authentically cleaved to the f 1 and f 2 components required in virulent strains . similarly , the hn glycoprotein was authentically processed in cef cells infected with recombinant trovac - ndv . previous reports ( taylor et al ., 1990 ; edbauer et al ., 1990 ; boursnell et al ., 1990a , b , c ; ogawa et al ., 1990 ) would open reading frame designated as c5 were defined . it was determined that the open reading frame was initiated at position 166 within the fragment and terminated at position 487 . the c5 deletion was made without interruption of open reading frames . bases from position 167 through position 455 were replaced with the sequence ( seq id no : 39 ) gcttcccgggaattctagctagctagttt . this replacement sequence contains hindiii , smai and ecori insertion sites followed by translation stops and a transcription termination signal recognized by vaccinia virus rna polymerase ( yuen et al ., 1987 ). deletion of the c5 orf was performed as described below . plasmid prw764 . 5 was partially cut with rsai and the linear product was isolated . the rsai linear fragment was recut with bglii and the prw764 . 5 fragment now with a rsai to bglii deletion from position 156 to position 462 was isolated and used as a vector for the following synthetic oligonucleotides : oligonucleotides rw145 and rw146 were annealed and inserted into the prw 764 . 5 rsai and bglii vector described above . the resulting plasmid is designated prws31 . construction of insertion vector containing the rabies g gene . construction of prw838 is illustrated below . oligonucleotides a through e , which overlap the translation initiation codon of the h6 promoter with the atg of rabies g , were cloned into puc9 as prw737 . oligonucleotides a through e contain the h6 promoter , starting at nrui , through the hindiii site of rabies g followed by bglii . sequences of oligonucleotides a through e (( seq id no : 42 )-( seq id no : 46 )) are : a : ctgaaattatttcattatcgcgatatccgttaagtttgtatcgtaatggttcctcaggctctcctgtttgt ( seq id no : 42 ) b : cattacgatacaaacttaacggatatcgcgataatgaaataatttcag ( seq id no : 43 ) c : accccttctggtttttccgttgtgttttgggaaattccctatttacacgatcccagacaagcttagatctcag ( seq id no : 44 ) d : ctgagatctaagcttgtctgggatcgtgtaaatagggaatttcccaaaaca ( seq id no : 45 ) e : caacggaaaaaccagaaggggtacaaacaggagagcctgaggaac ( seq id no : 46 ) the diagram of annealed oligonucleotides a through e is as follows : a c -------------------------¦--------------------------- -----------------¦-------------------¦--------------- b e d oligonucleotides a through e were kinased , annealed ( 95 ° c . for 5 minutes , then cooled to room temperature ), and inserted between the pvuii sites of puc9 . the resulting plasmid , prw737 , was cut with hindiii and bglii and used as a vector for the 1 . 6 kbp hindiii - bglii fragment of ptg155pro ( kieny et al ., 1984 ) generating prw739 . the ptg155pro hindiii site is 86 bp downstream of the rabies g translation initiation codon . bglii is downstream of the rabies g translation stop codon in ptg155pro . prw739 was partially cut with nrui , completely cut with bglii , and a 1 . 7 kbp nrui - bglii fragment , containing the 3 ′ end of the h6 promoter previously described ( taylor et al ., 1988a , b ; guo et al ., 1989 ; perkus et al ., 1989 ) through the entire rabies g gene , was inserted between the nrui and bamhi sites of prw824 . the resulting plasmid is designated prw832 . insertion into prw824 added the h6 promoter 5 ′ of nrui . the prw824 sequence of bamhi followed by smai is ( seq id no : 47 ): ggatccccggg . prw824 is a plasmid that contains a nonpertinent gene linked precisely to the vaccinia virus h6 promoter . digestion with nrui and bamhi completely excised this nonpertinent gene . the 1 . 8 kbp prw832 smai fragment , containing h6 promoted rabies g , was inserted into the smai of prw831 , to form plasmid prw838 . development of alvac - rg . plasmid prw838 was transfected into alvac infected primary cef cells by using the calcium phosphate precipitation method previously described ( panicali et al ., 1982 ; piccini et al ., 1987 ). positive plaques were selected on the basis of hybridization to a specific rabies g probe and subjected to 6 sequential rounds of plaque purification until a pure population was achieved . one representative plaque was then amplified and the resulting alvac recombinant was designated alvac - rg ( vcp65 ) ( see also fig9 ). the correct insertion of the rabies g gene into the alvac genome without subsequent mutation was confirmed by sequence analysis . immunofluorescence . during the final stages of assembly of mature rabies virus particles , the glycoprotein component is transported from the golgi apparatus to the plasma membrane where it accumulates with the carboxy terminus extending into the cytoplasm and the bulk of the protein on the external surface of the cell membrane . in order to confirm that the rabies glycoprotein expressed in alvac - rg was correctly presented , immunofluorescence was performed on primary cef cells infected with alvac or alvac - rg . immunofluorescence was performed as previously described ( taylor et al ., 1990 ) using a rabies g monoclonal antibody . strong surface fluorescence was detected on cef cells infected with alvac - rg but not with the parental alvac . immunoprecipitation . preformed monolayers of primary cef , vero ( a line of african green monkey kidney cells atcc # ccl81 ) and mrc - 5 cells ( a fibroblast - like cell line derived from normal human fetal lung tissue atcc # ccl171 ) were inoculated at 10 pfu per cell with parental virus alvac and recombinant virus alvac - rg in the presence of radiolabelled 35 s - methionine and treated as previously described ( taylor et al ., 1990 ). immunoprecipitation reactions were performed using a rabies g specific monoclonal antibody . efficient expression of a rabies specific glycoprotein with a molecular weight of approximately 67 kda was detected with the recombinant alvac - rg . no rabies specific products were detected in uninfected cells or cells infected with the parental alvac virus . sequential passaging experiment . in studies with alvac virus in a range of non - avian species no proliferative infection or overt disease was observed ( taylor et al ., 1991b ). however , in order to establish that neither the parental nor recombinant virus could be adapted to grow in non - avian cells , a sequential passaging experiment was performed . the two viruses , alvac and alvac - rg , were inoculated in 10 sequential blind passages in three cell lines : ( 1 ) primary chick embryo fibroblast ( cef ) cells produced from 11 day old white leghorn embryos ; ( 2 ) vero cells — a continuous line of african green monkey kidney cells ( atcc # ccl81 ); and ( 3 ) mrc - 5 cells — a diploid cell line derived from human fetal lung tissue ( atcc # ccl171 ). the initial inoculation was performed at an m . o . i . of 0 . 1 pfu per cell using three 60 mm dishes of each cell line containing 2 × 10 6 cells per dish . one dish was inoculated in the presence of 40 μg / ml of cytosine arabinoside ( ara c ), an inhibitor of dna replication . after an absorption period of 1 hour at 37 ° c ., the inoculum was removed and the monolayer washed to remove unabsorbed virus . at this time the medium was replaced with 5 ml of emem + 2 % nbcs on two dishes ( samples t0 and t7 ) and 5 ml of emem + 2 % nbcs containing 40 μg / ml ara c on the third ( sample t7a ). sample t0 was frozen at − 70 ° c . to provide an indication of the residual input virus . samples t7 and t7a were incubated at 37 ° c . for 7 days , after which time the contents were harvested and the cells disrupted by indirect sonication . one ml of sample t7 of each cell line was inoculated undiluted onto three dishes of the same cell line ( to provide samples t0 , t7 and t7a ) and onto one dish of primary cef cells . samples t0 , t7 and t7a were treated as for passage one . the additional inoculation on cef cells was included to provide an amplification step for more sensitive detection of virus which might be present in the non - avian cells , this procedure was repeated for 10 ( cef and mrc - 5 ) or 8 ( vero ) sequential blind passages . samples were then frozen and thawed three times and assayed by titration on primary cef monolayers . virus yield in each sample was then determined by plaque titration on cef monolayers under agarose . summarized results of the experiment are shown in tables 1 and 2 . the results indicate that both the parental alvac and the recombinant alvac - rg are capable of sustained replication on cef monolayers with no loss of titer . in vero cells , levels of virus fell below the level of detection after 2 passages for alvac and 1 passage for alvac - rg . in mrc - 5 cells , a similar result was evident , and no virus was detected after 1 passage . although the results for only four passages are shown in tables 1 and 2 the series was continued for 8 ( vero ) and 10 ( mrc - 5 ) passages with no detectable adaptation of either virus to growth in the non - avian cells . in passage 1 relatively high levels of virus were present in the t7 sample in mrc - 5 and vero cells . however this level of virus was equivalent to that seen in the t0 sample and the t7a sample incubated in the presence of cytosine arabinoside in which no viral replication can occur . this demonstrated that the levels of virus seen at 7 days in non - avian cells represented residual virus and not newly replicated virus . in order to make the assay more sensitive , a portion of the 7 day harvest from each cell line was inoculated onto a permissive cef monolayer and harvested at cytopathic effect ( cpe ) or at 7 days if no cpe was evident . the results of this experiment are shown in table 3 . even after amplification through a permissive cell line , virus was only detected in mrc - 5 and vero cells for two additional passages . these results indicated that under the conditions used , there was no adaptation of either virus to growth in vero or mrc - 5 cells . inoculation of macapues . four hiv seropositive macaques were initially inoculated with alvac - rg as described in table 4 . after 100 days these animals were re - inoculated to determine a booster effect , and an additional seven animals were inoculated with a range of doses . blood was drawn at appropriate intervals and sera analyzed , after heat inactivation at 56 ° c . for 30 minutes , for the presence of anti - rabies antibody using the rapid fluorescent focus inhibition assay ( smith et al ., 1973 ). inoculation of chimpanzees . two adult male chimpanzees ( 50 to 65 kg weight range ) were inoculated intramuscularly or subcutaneously with 1 × 10 7 pfu of vcp65 . animals were monitored for reactions and bled at regular intervals for analysis for the presence of anti - rabies antibody with the rffi test ( smith et al ., 1973 ). animals were re - inoculated with an equivalent dose 13 weeks after the initial inoculation . inoculation of mice . groups of mice were inoculated with 50 to 100 μl of a range of dilutions of different batches of vcp65 . mice were inoculated in the footpad . on day 14 , mice were challenged by intracranial inoculation of from 15 to 43 mouse ld 50 of the virulent cvs strain of rabies virus . survival of mice was monitored and a protective dose 50 % ( pd 50 ) calculated at 28 days post - inoculation . inoculation of dogs and cats . ten beagle dogs , 5 months old , and 10 cats , 4 months old , were inoculated subcutaneously with either 6 . 7 or 7 . 7 log 10 tcid 50 of alvac - rg . four dogs and four cats were not inoculated . animals were bled at 14 and 28 days post - inoculation and anti - rabies antibody assessed in an rffi test . the animals receiving 6 . 7 log 10 tcid 50 of alvac - rg were challenged at 29 days post - vaccination with 3 . 7 log 10 mouse ld 50 ( dogs ) or 4 . 3 log 10 mouse ld 50 ( cats ) of the nygs rabies virus challenge strain . inoculation of squirrel monkeys . three groups of four squirrel monkeys ( saimiri sciureus ) were inoculated with one of three viruses ( a ) alvac , the parental canarypox virus , ( b ) alvac - rg , the recombinant expressing the rabies g glycoprotein or ( c ) vcp37 , a canarypox recombinant expressing the envelope glycoprotein of feline leukemia virus . inoculations were performed under ketamine anaesthesia . each animal received at the same time : ( 1 ) 20 μl instilled on the surface of the right eye without scarification ; ( 2 ) 100 μl as several droplets in the mouth ; ( 3 ) 100 μl in each of two intradermal injection sites in the shaven skin of the external face of the right arm ; and ( 4 ) 100 μl in the anterior muscle of the right thigh . four monkeys were inoculated with each virus , two with a total of 5 . 0 log 10 pfu and two with a total of 7 . 0 log 10 pfu . animals were bled at regular intervals and sera analyzed for the presence of antirabies antibody using an rffi test ( smith et al ., 1973 ). animals were monitored daily for reactions to vaccination . six months after the initial inoculation the four monkeys receiving alvac - rg , two monkeys initially receiving vcp37 , and two monkeys initially receiving alvac , as well as one naive monkey were inoculated with 6 . 5 log 10 pfu of alvac - rg subcutaneously . sera were monitored for the presence of rabies neutralizing antibody in an rffi test ( smith et al ., 1973 ). inoculation of human cell lines with alvac - rg . in order to determine whether efficient expression of a foreign gene could be obtained in non - avian cells in which the virus does not productively replicate , five cell types , one avian and four non - avian , were analyzed for virus yield , expression of the foreign rabies g gene and viral specific dna accumulation . the cells inoculated were : chicken embryo fibroblast cells produced from 11 day old white leghorn embryos were included as a positive control . all inoculations were performed on preformed monolayers of 2 × 10 6 cells as discussed below . three dishes of each cell line were inoculated at 5 pfu / cell of the virus under test , allowing one extra dish of each cell line un - inoculated . one dish was incubated in the presence of 40 μg / ml of cytosine arabinoside ( ara c ). after an adsorption period of 60 minutes at 37 ° c ., the inoculum was removed and the monolayer washed twice to remove unadsorbed virus . medium ( with or without ara c ) was then replaced . cells from one dish ( without ara c ) were harvested as a time zero sample . the remaining dishes were incubated at 37 ° c . for 72 hours , at which time the cells were harvested and used to analyze dna accumulation . each sample of 2 × 10 6 cells was resuspended in 0 . 5 ml phosphate buffered saline ( pbs ) containing 40 mm edta and incubated for 5 minutes at 37 ° c . an equal volume of 1 . 5 % agarose prewarmed at 42 ° c . and containing 120 mm edta was added to the cell suspension and gently mixed . the suspension was transferred to an agarose plug mold and allowed to harden for at least 15 min . the agarose plugs were then removed and incubated for 12 - 16 hours at 50 ° c . in a volume of lysis buffer ( 1 % sarkosyl , 100 μg / ml proteinase k , 10 mm tris hcl ph 7 . 5 , 200 mm edta ) that completely covers the plug . the lysis buffer was then replaced with 5 . 0 ml sterile 0 . 5 × tbe ( 44 . 5 mm tris - borate , 44 . 5 mm boric acid , 0 . 5 mm edta ) and equilibrated at 4 ° c . for 6 hours with 3 changes of tbe buffer . the viral dna within the plug was fractionated from cellular rna and dna using a pulse field electrophoresis system . electrophoresis was performed for 20 hours at 180 v with a ramp of 50 - 90 sec at 15 ° c . in 0 . 5 × tbe . the dna was run with lambda dna molecular weight standards . after electrophoresis the viral dna band was visualized by staining with ethidium bromide . the dna was then transferred to a nitrocellulose membrane and probed with a radiolabelled probe prepared from purified alvac genomic dna . dishes were inoculated exactly as described above , with the exception that input multiplicity was 0 . 1 pfu / cell . at 72 hours post infection , cells were lysed by three successive cycles of freezing and thawing . virus yield was assessed by plaque titration on cef monolayers . dishes were inoculated with recombinant or parental virus at a multiplicity of 10 pfu / cell , allowing an additional dish as an uninfected virus control . after a one hour absorption period , the medium was removed and replaced with methionine free medium . after a 30 minute period , this medium was replaced with methionine - free medium containing 25 uci / ml of 35 s - methionine . infected cells were labelled overnight ( approximately 16 hours ), then lysed by the addition of buffer a lysis buffer . immunoprecipitation was performed as previously described ( taylor et al ., 1990 ) using a rabies g specific monoclonal antibody . results : estimation of viral yield . the results of titration for yield at 72 hours after inoculation at 0 . 1 pfu per cell are shown in table 5 . the results indicate that while a productive infection can be attained in the avian cells , no increase in virus yield can be detected by this method in the four non - avian cell systems . analysis of viral dna accumulation . in order to determine whether the block to productive viral replication in the non - avian cells occurred before or after dna replication , dna from the cell lysates was fractionated by electrophoresis , transferred to nitrocellulose and probed for the presence of viral specific dna . dna from uninfected cef cells , alvac - rg infected cef cells at time zero , alvac - rg infected cef cells at 72 hours post - infection and alvac - rg infected cef cells at 72 hours post - infection in the presence of 40 μg / ml of cytosine arabinoside all showed some background activity , probably due to contaminating cef cellular dna in the radiolabelled alvac dna probe preparation . however , alvac - rg infected cef cells at 72 hours post - infection exhibited a strong band in the region of approximately 350 kbp representing alvac - specific viral dna accumulation . no such band is detectable when the culture is incubated in the presence of the dna synthesis inhibitor , cytosine arabinoside . equivalent samples produced in vero cells showed a very faint band at approximately 350 kbp in the alvac - rg infected vero cells at time zero . this level represented residual virus . the intensity of the band was amplified at 72 hours post - infection indicating that some level of viral specific dna replication had occurred in vero cells which had not resulted in an increase in viral progeny . equivalent samples produced in mrc - 5 cells indicated that no viral specific dna accumulation was detected under these conditions in this cell line . this experiment was then extended to include additional human cell lines , specifically wish and detroit - 532 cells . alvac infected cef cells served as a positive control . no viral specific dna accumulation was detected in either wish or detroit cells inoculated with alvac - rg . it should be noted that the limits of detection of this method have not been fully ascertained and viral dna accumulation may be occurring , but at a level below the sensitivity of the method . other experiments in which viral dna replication was measured by 3 h - thymidine incorporation support the results obtained with vero and mrc - 5 cells . analysis of rabies gene expression . to determine if any viral gene expression , particularly that of the inserted foreign gene , was occurring in the human cell lines even in the absence of viral dna replication , immunoprecipitation experiments were performed on 35 s - methionine labelled lysates of avian and non - avian cells infected with alvac and alvac - rg . the results of immunoprecipitation using a rabies g specific monoclonal antibody illustrated specific immunoprecipitation of a 67 kda glycoprotein in cef , vero and mrc - 5 , wish and detroit cells infected with alvac - rg . no such specific rabies gene products were detected in any of the uninfected and parentally infected cell lysates . the results of this experiment indicated that in the human cell lines analyzed , although the alvac - rg recombinant was able to initiate an infection and express a foreign gene product under the transcriptional control of the h6 early / late vaccinia virus promoter , the replication did not proceed through dna replication , nor was there any detectable viral progeny produced . in the vero cells , although some level of alvac - rg specific dna accumulation was observed , no viral progeny was detected by these methods . these results would indicate that in the human cell lines analyzed the block to viral replication occurs prior to the onset of dna replication , while in vero cells , the block occurs following the onset of viral dna replication . in order to determine whether the rabies glycoprotein expressed in alvac - rg was immunogenic , a number of animal species were tested by inoculation of the recombinant . the efficacy of current rabies vaccines is evaluated in a mouse model system . a similar test was therefore performed using alvac - rg . nine different preparations of virus ( including one vaccine batch ( j ) produced after 10 serial tissue culture passages of the seed virus ) with infectious titers ranging from 6 . 7 to 8 . 4 log 10 tcid 50 per ml were serially diluted and 50 to 100 μl of dilutions inoculated into the footpad of four to six week old mice . mice were challenged 14 days later by the intracranial route with 300 μl of the cvs strain of rabies virus containing from 15 to 43 mouse ld 50 as determined by lethality titration in a control group of mice . potency , expressed as the pd 50 ( protective dose 50 %), was calculated at 14 days post - challenge . the results of the experiment are shown in table 6 . the results indicated that alvac - rg was consistently able to protect mice against rabies virus challenge with a pd 50 value ranging from 3 . 33 to 4 . 56 with a mean value of 3 . 73 ( std 0 . 48 ). as an extension of this study , male mice were inoculated intracranially with 50 μl of virus containing 6 . 0 log 10 tcid 50 of alvac - rg or with an equivalent volume of an uninfected cell suspension . mice were sacrificed on days 1 , 3 and 6 post - inoculation and their brains removed , fixed and sectioned . histopathological examination showed no evidence for neurovirulence of alvac - rg in mice . in order to evaluate the safety and efficacy of alvac - rg for dogs and cats , a group of 14 , 5 month old beagles and 14 , 4 month old cats were analyzed . four animals in each species were not vaccinated . five animals received 6 . 7 log 10 tcid 50 subcutaneously and five animals received 7 . 7 log 10 tcid 50 by the same route . animals were bled for analysis for anti - rabies antibody . animals receiving no inoculation or 6 . 7 log 10 tcid 50 of alvac - rg were challenged at 29 days post - vaccination with 3 . 7 log 10 mouse ld 50 ( dogs , in the temporal muscle ) or 4 . 3 log 10 mouse ld 50 ( cats , in the neck ) of the nygs rabies virus challenge strain . the results of the experiment are shown in table 7 . no adverse reactions to inoculation were seen in either cats or dogs with either dose of inoculum virus . four of 5 dogs immunized with 6 . 7 log 10 tcid 50 had antibody titers on day 14 post - vaccination and all dogs had titers at 29 days . all dogs were protected from a challenge which killed three out of four controls . in cats , three of five cats receiving 6 . 7 log 10 tcid 50 had specific antibody titers on day 14 and all cats were positive on day 29 although the mean antibody titer was low at 2 . 9 iu . three of five cats survived a challenge which killed all controls . all cats immunized with 7 . 7 log 10 tcid 50 had antibody titers on day 14 and at day 29 the geometric mean titer was calculated as 8 . 1 international units . the immune response of squirrel monkeys ( saimiri sciureus ) to inoculation with alvac , alvac - rg and an unrelated canarypox virus recombinant was examined . groups of monkeys were inoculated as described above and sera analyzed for the presence of rabies specific antibody . apart from minor typical skin reactions to inoculation by the intradermal route , no adverse reactivity was seen in any of the monkeys . small amounts of residual virus were isolated from skin lesions after intradermal inoculation on days two and four post - inoculation only . all specimens were negative on day seven and later . there was no local reaction to intra - muscular injection . all four monkeys inoculated with alvac - rg developed anti - rabies serum neutralizing antibodies as measured in an rffi test . approximately six months after the initial inoculation all monkeys and one additional naive monkey were re - inoculated by the subcutaneous route on the external face of the left thigh with 6 . 5 log 10 tcid 50 of alvac - rg . sera were analyzed for the presence of anti - rabies antibody . the results are shown in table 8 . four of the five monkeys naive to rabies developed a serological response by seven days post - inoculation with alvac - rg . all five monkeys had detectable antibody by 11 days post - inoculation . of the four monkeys with previous exposure to the rabies glycoprotein , all showed a significant increase in serum neutralization titer between days 3 and 7 post - vaccination . the results indicate that vaccination of squirrel monkeys with alvac - rg does not produce adverse side - effects and a primary neutralizing antibody response can be induced . an amnanestic response is also induced on re - vaccination . prior exposure to alvac or to a canarypox recombinant expressing an unrelated foreign gene does not interfere with induction of an anti - rabies immune response upon re - vaccination . the immunological response of hiv - 2 seropositive macaques to inoculation with alvac - rg was assessed . animals were inoculated as described above and the presence of anti - rabies serum neutralizing antibody assessed in an rffi test . the results , shown in table 9 , indicated that hiv - 2 positive animals inoculated by the subcutaneous route developed anti - rabies antibody by 11 days after one inoculation . an anamnestic response was detected after a booster inoculation given approximately three months after the first inoculation . no response was detected in animals receiving the recombinant by the oral route . in addition , a series of six animals were inoculated with decreasing doses of alvac - rg given by either the intra - muscular or subcutaneous routes . five of the six animals inoculated responded by 14 days post - vaccination with no significant difference in antibody titer . two chimpanzees with prior exposure to hiv were inoculated with 7 . 0 log 10 pfu of alvac - rg by the subcutaneous or intra - muscular route . at 3 months post - inoculations both animals were re - vaccinated in an identical fashion . the results are shown in table 10 . no adverse reactivity to inoculation was noted by either intramuscular or subcutaneous routes . both chimpanzees responded to primary inoculation by 14 days and a strongly rising response was detected following re - vaccination . [ 0238 ] table 2 sequential passage of alvac - rg in avian and non - avian cells cef vero mrc - 5 pass 1 sample t0 a 3 . 0 2 . 9 2 . 9 t7 b 7 . 1 1 . 0 1 . 4 t7a c 1 . 8 1 . 4 1 . 2 pass 2 sample t0 5 . 1 0 . 4 0 . 4 t7 7 . 1 n . d . d n . d . t7a 3 . 8 n . d . n . d . pass 3 sample t0 5 . 1 0 . 4 n . d . t7 7 . 2 n . d . n . d . t7a 3 . 6 n . d . n . d . pass 4 sample t0 5 . 1 n . d . n . d . t7 7 . 0 n . d . n . d . t7a 4 . 0 n . d . n . d [ 0239 ] table 3 amplification of residual virus by passage in cef cells cef vero mrc - 5 a ) alvac pass 2 a 7 . 0 b 6 . 0 5 . 2 3 7 . 5 4 . 1 4 . 9 4 7 . 5 n . d . c n . d . 5 7 . 1 n . d . n . d . b ) alvac - rg pass 2 a 7 . 2 5 . 5 5 . 5 3 7 . 2 5 . 0 5 . 1 4 7 . 2 n . d . n . d . 5 7 . 2 n . d . n . d . [ 0240 ] table 4 schedule of inoculation of rhesus macaques with alvac - rg ( vcp65 ) animal inoculation 176l primary : 1 × 10 8 pfu of vcp65 orally in tang secondary : 1 × 10 7 pfu of vcp65 plus 1 × 10 7 pfu of vcp82 a by sc route 185 l primary : 1 × 10 8 pfu of vcp65 orally in tang secondary : 1 × 10 7 pfu of vcp65 plus 1 × 10 7 pfu of vcp82 by sc route 177 l primary : 5 × 10 7 pfu sc of vcp65 by sc route secondary : 1 × 10 7 pfu of vcp65 plus 1 × 10 7 pfu of vcp82 by sc route 186l primary : 5 × 10 7 pfu of vcp65 by sc route secondary : 1 × 10 7 pfu of vcp65 plus 1 × 10 7 pfu of vcp82 by sc route 178l primary : 1 × 10 7 pfu of vcp65 by sc route 182l primary : 1 × 10 7 pfu of vcp65 by im route 179l primary : 1 × 10 6 pfu of vcp65 by sc route 183l primary : 1 × 10 6 pfu of vcp65 by im route 180l primary : 1 × 10 6 pfu of vcp65 by sc route 184l primary : 1 × 10 5 pfu of vcp65 by im route 187l primary 1 × 10 7 pfu of vcp65 orally [ 0241 ] table 5 analysis of yield in avian and non - avian cells inoculated with alvac - rg sample time cell type t0 t72 t72a b expt 1 cef 3 . 3 a 7 . 4 1 . 7 vero 3 . 0 1 . 4 1 . 7 mrc - 5 3 . 4 2 . 0 1 . 7 expt 2 cef 2 . 9 7 . 5 & lt ; 1 . 7 wish 3 . 3 2 . 2 2 . 0 detroit - 532 2 . 8 1 . 7 & lt ; 1 . 7 [ 0242 ] table 6 potency of alvac - rg as tested in mice test challenge dose a pd 50 b initial seed 43 4 . 56 primary seed 23 3 . 34 vaccine batch h 23 4 . 52 vaccine batch i 23 3 . 33 vaccine batch k 15 3 . 64 vaccine batch l 15 4 . 03 vaccine batch m 15 3 . 32 vaccine batch n 15 3 . 39 vaccine batch j 23 3 . 42 [ 0243 ] table 7 efficacy of alvac - rg in dogs and cats dogs cats dose antibody a survival b antibody survival 6 . 7 11 . 9 5 / 5 2 . 9 3 / 5 7 . 7 10 . 1 n . t . 8 . 1 n . t . [ 0244 ] table 8 anti - rabies serological response of squirrel monkeys inoculated with canarypox recombinants monkey previous rabies serum - neutralizing antibody a # exposure − 196 b 0 3 7 11 21 28 22 alvac c nt 9 & lt ; 1 . 2 & lt ; 1 . 2 & lt ; 1 . 2 2 . 1 2 . 3 2 . 2 51 alvac c nt & lt ; 1 . 2 & lt ; 1 . 2 1 . 7 2 . 2 2 . 2 2 . 2 39 vcp37 d nt & lt ; 1 . 2 & lt ; 1 . 2 1 . 7 2 . 1 2 . 2 n . t . g 55 vcp37 d nt & lt ; 1 . 2 & lt ; 1 . 2 1 . 7 2 . 2 2 . 1 n . t . 37 alvac - rg e 2 . 2 & lt ; 1 . 2 & lt ; 3 . 2 3 . 2 3 . 5 3 . 5 3 . 2 53 alvac - rg e 2 . 2 & lt ; 1 . 2 & lt ; 1 . 2 3 . 6 3 . 6 3 . 6 3 . 4 38 alvac - rg f 2 . 7 & lt ; 1 . 7 & lt ; 1 . 7 3 . 2 3 . 8 3 . 6 n . t . 54 alvac - rg f 3 . 2 & lt ; 1 . 7 & lt ; 1 . 5 3 . 6 4 . 2 4 . 0 3 . 6 57 none nt & lt ; 1 . 2 & lt ; 1 . 2 1 . 7 2 . 7 2 . 7 2 . 3 [ 0245 ] table 9 inoculation of rhesus macaques with alvac - rg a route of primary inoculation days post - or / tang sc sc sc im sc im sc im or inoculation 176l b 185l 177l 186l 178l 182l 179l 183l 180l 184l 187l b − 84 — — — − 9 — — — — — — 3 — — — — 6 — — ± ± 11 — — 16 d 128 19 — — 32 128 — — 35 — — 32 512 59 — — 64 256 75 — — 64 128 — — 99 c — — 64 256 — — — — — — 2 — — 32 256 — — — — — — — 6 — — 512 512 — — — — — — — 15 16 16 512 512 64 32 64 128 32 — — 29 16 32 256 256 64 64 32 128 32 — — 55 32 32 32 16 — 57 16 128 128 16 16 — [ 0246 ] table 10 inoculation of chimpanzees with alvac - rg weeks post - animal 431 animal 457 inoculation i . m . s . c . 0 & lt ; 8 a & lt ; 8 1 & lt ; 8 & lt ; 8 2 8 32 4 16 32 8 16 32 12 b / 0 16 8 13 / 1 128 128 15 / 3 256 512 20 / 8 64 128 26 / 12 32 128 alvac - rg ( vcp65 ) was generated as described in example 9 and fig9 a and 9b . for scaling - up and vaccine manufacturing alvac - rg ( vcp65 ) was grown in primary cef derived from specified pathogen free eggs . cells were infected at a multiplicity of 0 . 01 and incubated at 37 ° c . for three days . the vaccine virus suspension was obtained by ultrasonic disruption in serum free medium of the infected cells ; cell debris were then removed by centrifugation and filtration . the resulting clarified suspension was supplemented with lyophilization stabilizer ( mixture of amino - acids ), dispensed in single dose vials and freeze dried . three batches of decreasing titer were prepared by ten - fold serial dilutions of the virus suspension in a mixture of serum free medium and lyophilization stabilizer , prior to lyophilization . quality control tests were applied to the cell substrates , media and virus seeds and final product with emphasis on the search for adventitious agents and innocuity in laboratory rodents . no undesirable trait was found . preclinical data . studies in vitro indicated that vero or mrc - 5 cells do not support the growth of alvac - rg ( vcp65 ); a series of eight ( vero ) and 10 ( mrc ) blind serial passages caused no detectable adaptation of the virus to grow in these non avian lines . analyses of human cell lines ( mrc - 5 , wish , detroit 532 , hel , hnk or ebv - transformed lymphoblastoid cells ) infected or inoculated with alvac - rg ( vcp65 ) showed no accumulation of virus specific dna suggesting that in these cells the block in replication occurs prior to dna synthesis . significantly , however , the expression of the rabies virus glycoprotein gene in all cell lines tested indicating that the abortive step in the canarypox replication cycle occurs prior to viral dna replication . the safety and efficacy of alvac - rg ( vcp65 ) were documented in a series of experiments in animals . a number of species including canaries , chickens , ducks , geese , laboratory rodents ( suckling and adult mice ), hamsters , guinea - pigs , rabbits , cats and dogs , squirrel monkeys , rhesus macaques and chimpanzees , were inoculated with doses ranging from 10 5 to 10 8 pfu . a variety of routes were used , most commonly subcutaneous , intramuscular and intradermal but also oral ( monkeys and mice ) and intracerebral ( mice ). in canaries , alvac - rg ( vcp65 ) caused a “ take ” lesion at the site of scarification with no indication of disease or death . intradermal inoculation of rabbits resulted in a typical poxvirus inoculation reaction which did not spread and healed in seven to ten days . there was no adverse side effects due to canarypox in any of the animal tests . immunogenicity was documented by the development of anti - rabies antibodies following inoculation of alvac - rg ( vcp65 ) in rodents , dogs , cats , and primates , as measured by rapid fluorescent focus inhibition test ( rffit ). protection was also demonstrated by rabies virus challenge experiments in mice , dogs , and cats immunized with alvac - rg ( vcp65 ). volunteers . twenty - five healthy adults aged 20 - 45 with no previous history of rabies immunization were enrolled . their health status was assessed by complete medical histories , physical examinations , hematological and blood chemistry analyses . exclusion criteria included pregnancy , allergies , immune depression of any kind , chronic debilitating disease , cancer , injection of immune globins in the past three months , and seropositivity to human immunodeficiency virus ( hiv ) or to hepatitis b virus surface antigen . study design . participants were randomly allocated to receive either standard human diploid cell rabies vaccine ( hdc ) batch no e0751 ( pasteur merieux serums & amp ; vaccine , lyon , france ) or the study vaccine alvac - rg ( vcp65 ). the trial was designated as a dose escalation study . three batches of experimental alvac - rg ( vcp65 ) vaccine were used sequentially in three groups of volunteers ( groups a , b and c ) with two week intervals between each step . the concentration of the three batches was 10 3 . 5 , 10 4 . 5 , 10 5 . 5 tissue culture infectious dose ( tcid 50 ) per dose , respectively . each volunteer received two doses of the same vaccine subcutaneously in the deltoid region at an interval of four weeks . the nature of the injected vaccine was not known by the participants at the time of the first injection but was known by the investigator . in order to minimize the risk of immediate hypersensitivity at the time of the second injection , the volunteers of group b allocated to the medium dose of experimental vaccine were injected 1 h previously with the lower dose and those allocated to the higher dose ( group c ) received successively the lower and the medium dose at hourly intervals . six months later , the recipients of the highest dosage of alvac - rg ( vcp65 ) ( group c ) and hdc vaccine were offered a third dose of vaccine ; they were then randomized to receive either the same vaccine as previously or the alternate vaccine . as a result , four groups were formed corresponding to the following immunization scheme : 1 . hdc , hdc - hdc ; 2 . hdc , hdc - alvac - rg ( vcp65 ); 3 . alvac - rg ( vcp65 ), alvac - rg ( vcp65 )- hdc ; 4 . alvac - rg ( vcp65 ), alvac - rg ( vcp65 ), alvac - rg ( vcp65 ). monitoring of side effects . all subjects were monitored for 1 h after injection and re - examined every day for the next five days . they were asked to record local and systemic reactions for the next three weeks and were questioned by telephone two times a week . laboratory investigators . blood specimens were obtained before enrollment and two , four and six days after each injection . analysis included complete blood cell count , liver enzymes and creatine kinase assays . antibody assays . antibody assays were performed seven days prior to the first injection and at days 7 , 28 , 35 , 56 , 173 , 187 and 208 of the study . the levels of neutralizing antibodies to rabies were determined using the rapid fluorescent focus inhibition test ( rffit ) ( smith & amp ; yaeger , in laboratory techniques on rabies ). canarypox antibodies were measured by direct elisa . the antigen , a suspension of purified canarypox virus disrupted with 0 . 1 % triton x100 , was coated in microplates . fixed dilutions of the sera were reacted for two hours at room temperature and reacting antibodies were revealed with a peroxidase labelled anti - human igg goat serum . the results are expressed as the optical density read at 490 nm . analysis . twenty - five subjects were enrolled and completed the study . there were 10 males and 15 females and the mean age was 31 . 9 ( 21 to 48 ). all but three subjects had evidence of previous smallpox vaccination ; the three remaining subjects had no typical scar and vaccination history . three subjects received each of the lower doses of experimental vaccine ( 10 3 . 5 and 10 4 . 5 tcid 50 ), nine subjects received 10 5 . 5 tcid 50 and ten received the hdc vaccine . safety ( table 11 ). during the primary series of immunization , fever greater than 37 . 7 ° c . was noted within 24 hours after injection in one hdc recipient ( 37 . 8 ° c .) and in one vcp65 10 5 . 5 tcid 50 recipient ( 38 ° c .). no other systemic reaction attributable to vaccination was observed in any participant . local reactions were noted in 9 / 10 recipients of hdc vaccine injected subcutaneously and in 0 / 3 , 1 / 3 and 9 / 9 recipients of vcp65 10 3 . 5 , 10 4 . 5 , 10 5 . 5 tcid 50 , respectively . tenderness was the most common symptoms and was always mild . other local symptoms included redness and induration which were also mild and transient . all symptoms usually subsided within 24 hours and never lasted more than 72 hours . there was no significant change in blood cell counts , liver enzymes or creatine kinase values . immune responses : neutralizing antibodies to rabies ( table 12 ). twenty eight days after the first injection all the hdc recipients had protective titers (≧ 0 . 5 iu / ml ). by contrast none in groups a and b ( 10 3 . 5 and 10 4 . 5 tcid 50 ) and only 2 / 9 in group c ( 10 5 . 5 tcid 50 ) alvac - rg ( vcp65 ) recipients reached this protective titer . at day 56 ( i . e . 28 days after the second injection ) protective titers were achieved in 0 / 3 of group a , 2 / 3 of group b and 9 / 9 of group c recipients of alvac - rg ( vcp65 ) vaccine and persisted in all 10 hdc recipients . at day 56 the geometric mean titers were 0 . 05 , 0 . 47 , 4 . 4 and 11 . 5 iu / ml in groups a , b . c and hdc respectively . at day 180 , the rabies antibody titers had substantially decreased in all subjects but remained above the minimum protective titer of 0 . 5 iu / ml in 5 / 10 hcd recipients and in 5 / 9 alvac - rg ( vcp65 ) recipients ; the geometric mean titers were 0 . 51 and 0 . 45 iu / ml in groups hcd and c , respectively . antibodies to the canarydox virus ( table 13 ). the pre - immune titers observed varied widely with titers varying from 0 . 22 to 1 . 23 o . d . units despite the absence of any previous contact with canary birds in those subjects with the highest titers . when defined as a greater than two - fold increase between preimmunization and post second injection titers , a seroconversion was obtained in 1 / 3 subjects in group b and in 9 / 9 subjects in group c whereas no subject seroconverted in groups a or hdc . booster injection . the vaccine was similarly well tolerated six months later , at the time of the booster injection : fever was noted in 2 / 9 hdc booster recipients and in 1 / 10 alvac - rg ( vcp65 ) booster recipients . local reactions were present in 5 / 9 recipients of hdc booster and in 6 / 10 recipients of the alvac - rg ( vcp65 ) booster . observations . fig1 shows graphs of rabies neutralizing antibody titers ( rapid fluorescent focus inhibition test or rffit , iu / ml ): booster effect of hdc and vcp65 ( 10 5 . 5 tcid 50 ) in volunteers previously immunized with either the same or the alternate vaccine . vaccines were given at days 0 , 28 and 180 . antibody titers were measured at days 0 , 7 , 28 , 35 , 56 , 173 , and 187 and 208 . as shown in fig1 a to 13 d , the booster dose given resulted in a further increase in rabies antibody titers in every subject whatever the immunization scheme . however , the alvac - rg ( vcp65 ) booster globally elicited lower immune responses than the hdc booster and the alvac - rg ( vcp65 ), alvac - rg ( vcp65 )- alvac - rg ( vcp65 ) group had significantly lower titers than the three other groups . similarly , the alvac - rg ( vcp65 ) booster injection resulted in an increase in canarypox antibody titers in 3 / 5 subjects who had previously received the hdc vaccine and in all five subjects previously immunized with alvac - rg ( vcp65 ). in general , none of the local side effects from administration of vcp65 was indicative of a local replication of the virus . in particular , lesions of the skin such as those observed after injection of vaccine were absent . in spite of the apparent absence of replication of the virus , the injection resulted in the volunteers generating significant amounts of antibodies to both the canarypox vector and to the expressed rabies glycoprotein . rabies neutralizing antibodies were assayed with the rapid fluorescent focus inhibition test ( rffit ) which is known to correlate well with the sero neutralization test in mice . of 9 recipients of 10 5 . 5 tcid 50 , five had low level responses after the first dose . protective titers of rabies antibodies were obtained after the second injection in all recipients of the highest dose tested and even in 2 of the 3 recipients of the medium dose . in this study , both vaccines were given subcutaneously as usually recommended for live vaccines , but not for the inactivated hdc vaccine . this route of injection was selected as it best allowed a careful examination of the injection site , but this could explain the late appearance of antibodies in hdc recipients : indeed , none of the hdc recipients had an antibody increase at day 7 , whereas , in most studies where hdc vaccine is give intramuscularly a significant proportion of subjects do ( klietmann et al ., int &# 39 ; l green cross — geneva , 1981 ; kuwert et al ., int &# 39 ; l green cross — geneva , 1981 ). however , this invention is not necessarily limited to the subcutaneous route of administration . the gmt ( geometric mean titers ) of rabies neutralizing antibodies was lower with the investigational vaccine than with the hdc control vaccine , but still well above the minimum titer required for protection . the clear dose effect response obtained with the three dosages used in this study suggest that a higher dosage might induce a stronger response . certainly from this disclosure the skilled artisan can select an appropriate dosage for a given patient . the ability to boost the antibody response is another important result of this example ; indeed , an increase in rabies antibody titers was obtained in every subject after the 6 month dose whatever the immunization scheme , showing that preexisting immunity elicited by either the canarypox vector or the rabies glycoprotein had no blocking effect on the booster with the recombinant vaccine candidate or the conventional hdc rabies vaccine . this contrasts findings of others with vaccinia recombinants in humans that immune response may be blocked by pre - existing immunity ( cooney et al ., lancet 1991 , 337 : 567 - 72 ; etlinger et al ., vaccine 9 : 470 - 72 , 1991 ). thus , this example clearly demonstrates that a non - replicating poxvirus can serve as an immunizing vector in humans , with all of the advantages that replicating agents confer on the immune response , but without the safety problem created by a fully permissive virus . mice . male outbred swiss webster mice were purchased from taconic farms ( germantown , n . y .) and maintained on mouse chow and water ad libitum until use at 3 weeks of age (“ normal ” mice ). newborn outbred swiss webster mice were of both sexes and were obtained following timed pregnancies performed by taconic farms . all newborn mice used were delivered within a two day period . viruses . alvac was derived by plaque purification of a canarypox virus population and was prepared in primary chick embryo fibroblast cells ( cef ). following purification by centrifugation over sucrose density gradients , alvac was enumerated for plaque forming units in cef cells . the wr ( l ) variant of vaccinia virus was derived by selection of large plaque phenotypes of wr ( panicali et al ., 1981 ). the wyeth new york state board of health vaccine strain of vaccinia virus was obtained from pharmaceuticals calf lymph type vaccine dryvax , control number 302001b . copenhagen strain vaccinia virus vc - 2 was obtained from institut merieux , france . vaccinia virus strain nyvac was derived from copenhagen vc - 2 . all vaccinia virus strains except the wyeth strain were cultivated in vero african green monkey kidney cells , purified by sucrose gradient density centrifugation and enumerated for plaque forming units on vero cells . the wyeth strain was grown in cef cells and enumerated in cef cells . inoculations . groups of 10 normal mice were inoculated intracranially ( ic ) with 0 . 05 ml of one of several dilutions of virus - prepared by 10 - fold serially diluting the stock preparations in sterile phosphate - buffered saline . in some instances , undiluted stock virus preparation was used for inoculation . groups of 10 newborn mice , 1 to 2 days old , were inoculated ic similarly to the normal mice except that an injection volume of 0 . 03 ml was used . all mice were observed daily for mortality for a period of 14 days ( newborn mice ) or 21 days ( normal mice ) after inoculation . mice found dead the morning following inoculation were excluded due to potential death by trauma . the lethal dose required to produce mortality for 50 % of the experimental population ( ld 50 ) was determined by the proportional method of reed and muench . comparison of the ld 50 of alvac and nyvac with various vaccinia virus strains for normal . young outbred mice by the ic route . in young , normal mice , the virulence of nyvac and alvac were several orders of magnitude lower than the other vaccinia virus strains tested ( table 14 ). nyvac and alvac were found to be over 3 , 000 times less virulent in normal mice than the wyeth strain ; over 12 , 500 times less virulent than the parental vc - 2 strain ; and over 63 , 000 , 000 times less virulent than the wr ( l ) variant . these results would suggest that nyvac is highly attenuated compared to other vaccinia strains , and that alvac is generally nonvirulent for young mice when administered intracranially , although both may cause mortality in mice at extremely high doses ( 3 . 85 × 10 8 pfus , alvac and 3 × 10 8 pfus , nyvac ) by an undetermined mechanism by this route of inoculation . comparison of the ld 50 of alvac and nyvac with various vaccinia virus strains for newborn outbred mice by the ic route . the relative virulence of 5 poxvirus strains for normal , newborn mice was tested by titration in an intracranial ( ic ) challenge model system ( table 15 ). with mortality as the endpoint , ld 50 values indicated that alvac is over 100 , 000 times less virulent than the wyeth vaccine strain of vaccinia virus ; over 200 , 000 times less virulent than the copenhagen vc - 2 strain of vaccinia virus ; and over 25 , 000 , 000 times less virulent than the wr - l variant of vaccinia virus . nonetheless , at the highest dose tested , 6 . 3 × 10 7 pfus , 100 % mortality resulted . mortality rates of 33 . 3 % were observed at 6 . 3 × 10 6 pfus . the cause of death , while not actually determined , was not likely of toxicological or traumatic nature since the mean survival time ( mst ) of mice of the highest dosage group ( approximately 6 . 3 ld 50 ) was 6 . 7 ± 1 . 5 days . when compared to wr ( l ) at a challenge dose of 5 ld 50 , wherein mst is 4 . 8 ± 0 . 6 days , the mst of alvac challenged mice was significantly longer ( p = 0 . 001 ). relative to nyvac , wyeth was found to be over 15 , 000 times more virulent ; vc - 2 , greater than 35 , 000 times more virulent ; and wr ( l ), over 3 , 000 , 000 times more virulent . similar to alvac , the two highest doses of nyvac , 6 × 10 8 and 6 × 10 7 pfus , caused 100 % mortality . however , the mst of mice challenged with the highest dose , corresponding to 380 ld 50 , was only 2 days ( 9 deaths on day 2 and 1 on day 4 ). in contrast , all mice challenged with the highest dose of wr - l , equivalent to 500 ld 50 , survived to day 4 . immunoprecipitations . preformed monolayers of avian or non - avian cells were inoculated with 10 pfu per cell of parental nyvac ( vp866 ) or nyvac - rg ( vp879 ) virus . the inoculation was performed in emem free of methionine and supplemented with 2 % dialyzed fetal bovine serum . after a one hour incubation , the inoculum was removed and the medium replaced with emem ( methionine free ) containing 20 μci / ml of 35 s - methionine . after an overnight incubation of approximately 16 hours , cells were lysed by the addition of buffer a ( 1 % nonidet p - 40 , 10 mm tris ph7 . 4 , 150 mm nacl , 1 mm edta , 0 . 01 % sodium azide , 500 units per ml of aprotinin , and 0 . 02 % phenyl methyl sulfonyl fluoride ). immunoprecipitation was performed using a rabies glycoprotein specific monoclonal antibody designated 24 - 3f10 supplied by dr . c . trinarchi , griffith laboratories , new york state department of health , albany , n . y ., and a rat anti - mouse conjugate obtained from boehringer mannheim corporation ( cat . # 605 - 500 ). protein a sepharose cl - 48 obtained from pharmacia lkb biotechnology inc ., piscataway , n . j ., was used as a support matrix . immunoprecipitates were fractionated on 10 % polyacrylamide gels according to the method of dreyfuss et . al . ( 1984 ). gels were fixed , treated for fluorography with 1m na - salicylate for one hour , and exposed to kodak xar - 2 film to visualize the immunoprecipitated protein species . sources of animals . new zealand white rabbits were obtained from hare - marland ( hewitt , n . j .). three week old male swiss webster outbred mice , timed pregnant female swiss webster outbred mice , and four week old swiss webster nude ( nu + nu + ) mice were obtained from taconic farms , inc . ( germantown , n . y .). all animals were maintained according to nih guidelines . all animal protocols were approved by the institutional iacuc . when deemed necessary , mice which were obviously terminally ill were euthanized . evaluation of lesions in rabbits . each of two rabbits was inoculated intradermally at multiple sites with 0 . 1 ml of pbs containing 10 4 , 10 5 , 10 6 , 10 7 , or 10 8 pfu of each test virus lys gln asp thr ile gln val lys ser ala leu leu lys asp tyr met gly leu lys val thr gly pro cys asn glu asn phe ile met phe leu ala asn gly pro asp ser pro thr val lys pro pro arg asn leu gln asn ile cys glu thr gly lys asn phe lys leu val val tyr ile lys glu asn thr leu ile ile lys trp lys val tyr gly glu thr lys asp lys glu thr pro phe thr ser ile leu ile his ala tyr lys glu his asn gly thr asn leu ile glu ser lys asn tyr ala leu gly ser asp ile pro glu lys cys asp thr leu ala ser asn cys phe leu ser gly tyr his ser glu glu asn ile asn thr leu lys asn lys phe arg asn arg leu lys asp glu asn asn cys ile ser asn leu gln val glu asp gln gly asn cys asp thr ser trp ile phe ala ser lys tyr his leu glu thr ile arg cys met lys gly tyr glu pro thr lys ile ser ala leu tyr val ala asn cys tyr lys gly glu his lys asp arg cys asp glu gly ser ser pro met glu phe leu gln ile ile glu asp tyr gly phe leu pro ala glu ser asn tyr pro tyr asn tyr val lys val gly glu gln cys pro lys val glu asp his trp met asn leu trp asp asn gly tyr thr ala tyr glu ser glu arg phe his asp asn met asp ala ala tyr ile lys ala glu asn val met gly tyr glu phe ser gly lys lys val gln asn leu cys gly asp asp thr ala asp his ala val asn tyr trp ile val arg asn ser trp gly pro tyr trp gly asp glu gly tyr phe lys val asp met tyr gly pro thr his cys his phe asn phe ile his ser val val ile phe asn val asp leu pro met asn asn lys val asn lys lys his ser cys thr arg ser tyr ala phe asn pro glu | 2 |
what is disclosed is a system and method for estimating minute ventilation by analyzing distortions in reflections of structured illumination patterns captured in a video of a thoracic region of a subject of interest being monitored for respiratory function . a “ subject of interest ” refers to a subject being monitored for respiratory function such that a respiratory minute volume can be determined in accordance with the teachings hereof . fig1 shows an anterior ( frontal ) view 101 of an adult human as well as a posterior ( rear ) view 102 . target region 103 outlines the subject &# 39 ; s anterior thoracic region . target region 104 outlines the subject &# 39 ; s posterior thoracic region . a target region , as used herein , also refers to any view of a region of the subject &# 39 ; s body which performs a respiratory function from which respiratory minute volume can be derived . it should be appreciated that the use of the terms “ human ”, “ person ”, or “ patient ” herein is not to be viewed as limiting the scope of the appended claims solely to human subjects of interest . the teachings hereof apply equally to other subjects of interest which also have a respiratory function . such additional subjects include , for example , mammals , birds , fish , reptiles , and even certain insects . a “ respiratory function ” is a multi - stage process involving inhaling air into the lungs ( inspiration ), gas exchange , and exhaling air out of the lungs ( expiration ) followed by a post - expiratory pause . inhalation causes the lungs contained within the chest cavity to fill with air thereby expanding chest volume . inhalation is initiated by a diaphragm muscle and supported intercostal muscles . under normal conditions , the diaphragm is the primary driver of inhalation . when the diaphragm contracts , the rib cage expands and the contents of the abdomen are moved downward . this results in a larger thoracic volume and negative pressure ( with respect to atmospheric pressure ) inside the thorax . gas exchange is a primary function of the respiratory system . molecules of gases are exchanged between the external environment and a blood system . this exchange facilitates oxygenation of the blood and removal of carbon dioxide and other metabolic wastes from the body . gas exchange also helps maintain the acid - base balance of the body . the cellular mechanism of gas exchange is carried out by the simple phenomenon of pressure difference . when the atmospheric pressure is low outside , air from the lungs flow out into the environment . when the air pressure is low inside the lungs , the opposite occurs . exhalation is generally a passive process due to the natural elasticity of lung tissue which causes them to recoil from the stretch of inhalation thus forcing air out until the pressures in the chest and the pressure of the outside atmosphere reach equilibrium . during forced exhalation , as when blowing out a candle , expiratory muscles including abdominal muscles and internal intercostal muscles , generate abdominal and thoracic pressure which helps force air out of the lungs . during forced inhalation , as when taking a deep breath , external intercostal muscles and accessory muscles aid in expanding the thoracic cavity and bringing more air into the lungs . during vigorous inhalation ( at rates exceeding 35 breaths per minute ), or in an approaching respiratory failure , accessory muscles such as the sternocleidomastoid , platysma , the scalene muscles of the neck as well as the pectoral muscles and latissimus dorsi of respiration are recruited for support . a post - expiratory pause occurs when there is an equalization of pressure between the lungs and the atmosphere . the duration of the post - expiratory pause reduces with increased physical activity and may even fall to zero at high rates of exertion . when the subject is at rest , the duration of the post - expiratory pause is relatively long . the subject &# 39 ; s respiration cycle is the time interval between the beginning of inhalation and the end of the post - expiratory pause . immediately following the post - expiratory pause is the start of the next cycle . the subject &# 39 ; s respiration rate is the number of breaths a subject takes within a certain amount of time ( typically in breaths / minute ). respiration rate is often measured when a subject is at rest and simply involves counting the number of breaths taken in a minute . a resting adult human takes about 12 - 20 breaths per minute depending on the overall condition of the cardio - vascular and respiratory systems . restrictive pulmonary diseases such as pulmonary fibrosis , pneumothorax , infant respiratory distress syndrome , and the like , decrease lung volume , whereas obstructive pulmonary diseases such as asthma , bronchitis , and emphysema , obstruct airflow . fig2 shows the output from a spirometer of a normal person taking seven tidal breaths , followed by maximal inspiration and expiration . expiratory reserve volume ( erv ) is the maximal volume of air that can be exhaled from the end - expiratory position . residual volume ( rv ) is the volume of air remaining in the lungs after maximal exhalation ( residual air remains in the lungs no matter how hard one tries to expel all their air ). inspiratory reserve volume ( irv ) is the maximal volume of air that can be inhaled at the end - inspiratory level . vital capacity ( vc ) is the maximum amount of air a person can expel from the lungs after maximum inhalation . inspiratory capacity ( ic ) is the volume of air that can be inhaled after normal inspiration . functional residual capacity ( frc ) is the volume in the lungs at the end - expiratory position . total lung capacity ( tlc ) is the total volume of air in the lungs at maximal inflation . “ respiratory minute volume ” or “ minute ventilation ” is the amount of air exchanged by the lungs in one minute . it can also refer to the amount of air inhaled in one minute ( inhaled minute volume ) or the amount of air exhaled in one minute ( exhaled minute volume ). although the name implies a volume , minute ventilation is actually a flow because it represents a volume change over time . minute ventilation is an important parameter in respiratory medicine due to its relationship with blood carbon dioxide levels ( paco 2 ) which varies inversely with minute ventilation . for example , a person with increased minute volume due , for instance , to hyperventilation , should demonstrate a lower blood carbon dioxide level . the healthy human body alters respiratory minute volume in an attempt to maintain physiologic homeostasis . a normal minute volume while resting is about 5 - 8 liters per minute in adult humans . minute volume generally decreases at rest , and increases with exercise as waste gases will build up more quickly in the blood stream and must be more rapidly expelled through increased exhalation . a “ video ”, as is generally understood , is a time - varying sequence of image frames captured over time using a video camera . a fully populated 2d image captured using , for example , a 3 - channel color video camera is a 2d array of pixels with each pixel in the array having color values collected for pixels from each of those channels . a fully populated 2d image captured using , for example , a single channel video camera is a 2d array of pixels with each pixel in the array having an intensity value measured for that pixel location at a desired wavelength band of interest . the video may also contain other components such as , audio , time reference signals , and the like . the size of the video data may get large for longer video sequences . the video may also be processed or pre - processed to compensate for non - uniform illumination due to a curvature of a surface of the skin , for motion induced blur due to body or surface motion , imaging blur , and slow illuminant variation . motion in the video may be compensated for using , for example , a video - based 2d image or 3d surface stabilization techniques . “ receiving a video ” is intended to be widely construed and means to retrieve , receive , capture with a video camera , or otherwise obtain a video for processing for minute ventilation estimation in accordance with the present method . the video can be received from a memory or internal storage of the video camera system , or obtained from a remote device over a network . the video may also be retrieved from a media such as a cdrom or dvd . the video may be received by being downloaded from a website which makes such videos available for pre - processing or post - processing . one such web - based system is disclosed in the above - incorporated us patent application entitled : “ web - based system and method for video analysis ” by piratla et al . the video can also be retrieved using an application such as those which are widely available for handheld cellular devices and processed on the user &# 39 ; s cellphone or other handheld computing device such as an ipad . a “ video system ” refers to a video camera for capturing a video and a structured illumination source which projects light through a patterned grid or window . the pattern may be a pseudo - random pattern with known spatial characteristics . accurate 3d surface profiles of objects in a scene can be computed using structured - light principles and triangulation - based image reconstruction techniques . fig3 shows a single 2d image frame 300 being captured of a target region 303 of the subject of interest of fig1 . video camera 310 captures reflected energy off the target region emitted by structured illumination source 311 . video camera 310 is shown having a communication element 313 to effectuate a bi - directional communication with a remote device , such as a computer workstation , wherein the video is received for processing . a video imaging system may further comprise a video analysis module . controllers 314 and 315 are shown to effectuate a manipulation of structured illumination source 311 and 312 , respectively , to reduce artifacts . one method for reducing such artifacts is disclosed in the above - incorporated reference : “ enabling hybrid video capture of a scene illuminated with unstructured and structured illumination sources ”, by xu et al . a “ video analysis module ”, in one embodiment , comprises a hardware device such as an asic with at least one processor capable of executing machine readable program instructions for analyzing video images on a frame - by - frame basis for minute ventilation estimation . such a module may also comprise , in whole or in part , a software application working alone or in conjunction with one or more hardware resources . software applications may be executed by processors on different hardware platforms or emulated in a virtual environment . aspects of the video analysis module may leverage off - the - shelf software . a “ remote sensing environment ” refers to a non - contact , unobtrusive non - invasive means of acquiring data from a subject , i . e ., the sensing device does not physically contact the subject being sensed . the sensing device can be any distance away from the subject , for example , as close as less than an inch to as far as miles in the case of telemedicine . the teachings hereof find their intended uses in such a remote sensing environment such that the resting cardiac patient remains undisturbed . a “ depth map ” is a map containing depth values based upon an analysis of the amount of distortion of a structured light pattern reflected from surfaces in that region of the image . once the depth map has been generated , a volume can be calculated . in fig4 , structured illumination source 403 projects sinusoidal gratings 404 onto an object 405 and the reflection of the impinging sinusoidal gratings is captured by the camera system 402 as they bounce off the object . the sinusoidal gratings have known spatial characteristics of undistorted projected patterns . camera system 402 is shown having a communication element 406 for bi - directional communication with a remote device , such as a workstation ( not shown ) wherein the captured video is communicated for processing . if the scene is a planar surface without any 3d surface variation and oriented approximately parallel to the camera sensor , the pattern shown in the acquired image will be similar to that of the projected structured - light pattern . however , when the surface is non - planar and contains a 3d object 405 , the shape of the object distorts the projected structured light pattern . such light distortions can be detected by camera 402 . the geometric relationship between camera 402 , a structured illumination source 403 , and a point p on the surface of 3d object 405 can be expressed in terms of a triangulation as follows : accurate 3d image reconstruction can be based on a phase - shifting or phase modulation technique which measures phases at different locations on the object &# 39 ; s surface and computes depth information from these phases . fig5 shows the phase shift with three projection patterns , collectively at 501 , projected onto the object surface , and an example fringe image 502 . phase shift is a well - known method wherein intensities for each pixel ( x , y ) of the three projected fringe patterns are described by the following relationships : i 1 ( x , y )= i 0 ( x , y )+ i mod ( x , y ) cos ( φ ( x , y )− θ ), ( 2 ) i 2 ( x , y )= i 0 ( x , y )+ i mod ( x , y ) cos ( φ ( x , y )), ( 3 ) i 3 ( x , y )= i 0 ( x , y )+ i mod ( x , y ) cos ( φ ( x , y )+ θ ), ( 4 ) where i 1 ( x , y ), i 2 ( x , y ) and i 3 ( x , y ) are the intensities of three fringe patterns , i 0 ( x , y ) is the dc component ( background ), i mod ( x , y ) is the modulation signal amplitude , φ ( x , y ) is the phase , and θ is the constant phase - shift angle . phase unwrapping is the process that converts the wrapped phase to the absolute phase . the phase information φ ( x , y ) can be retrieved ( i . e ., unwrapped ) from the intensities in the three fringe patterns : the discontinuity of the arc tangent function at 2π can be removed by adding or subtracting multiples of 2π on the φ ′( x , y ) value ( of fig6 ): where k is an integer representing projection period . note that unwrapping methods only provide a relative unwrapping and do not solve for the absolute phase . the 3d ( x , y , z ) coordinates can be calculated based on the difference between measured phase φ ( x , y ) and the phase value from a reference plane . reference is now being made to the system of fig8 which utilizes a video camera 802 to sense reflected light emitted ( at 804 ) by patterned illumination source projector 805 being reflected off point p of object 806 , i . e ., a location in the subject &# 39 ; s thoracic region . detector 808 generates pixel intensity values for pixel locations in the image . pixel intensity values and wavelength data are provided to storage media 809 . in fig8 , depth z is calculated by geometries given by : the camera and the illuminator form a stereo pair with a baseline distance b = 7 . 5 cm . the projector sends out a fixed pattern of light and dark speckles . since the spatial characteristics of the pattern are known and the pattern warps as the depth of the target surface changes , distances to the target can be estimated by determining the shape of the warping locally . local correlation operations are performed between the captured and the stored pattern . the best match gives an offset from the known depth in pixels called disparity , d . the relationship between disparity and depth is given by : where z is the estimated depth in meters , f is the focal length of the camera in pixels , and b is the baseline distance . stripe indexing can also be used to achieve robust 3d surface reconstruction because the order in which the stripes are observed is not necessarily the same as the order in which the stripes are projected due to the inherent parallax existing in triangulation - based 3d surface imaging systems and the possibility to have stripes missing from the acquired image due to occlusion of 3d surface features . fig7 shows an example stripe projection system wherein structured source light 701 is projected through stripped projector 702 with stripe 703 being illustrated for explanatory purposes . the pattern is projected onto object 704 whereon light stripe 705 illuminates the object at pixel location 706 . pixel element 708 of camera matrix 707 detects the reflected source light at this pixel location . the collection of pixels forms the image . use of color for stripe indexing in the projection patterns helps alleviate the ambiguity problem faced by phase - shift or multiple - stripe techniques using monochromatic patterns . this type of system enables encoding of multiple patterns into a single color projection image with each pattern possessing a unique color value . in order to reduce the decoding error rate , one can select a color set in which each color has a maximum distance from any other color in the set . the maximum number of colors is limited to a distance between colors that generates a minimal crosstalk in the acquired images . it should be appreciated that if the target 3d object is static and the application does not impose stringent constraints on the acquisition time , multiple - shot ( sequential ) techniques can be used and may often result in more reliable and accurate results . on the other hand , if the target is moving , single - shot techniques are used to acquire a snapshot 3d surface image of the 3d object at a particular time instance . single - shot techniques can be classified into techniques using continuously varying structured - light patterns , those using 1d encoding schemes ( strip indexing ), and those using 2d encoding schemes ( grid indexing ). each technique has its own advantages and disadvantages , depending on the specific applications . some techniques can be combined . for further information on 3d imaging techniques , the reader is respectfully directed to the above - incorporated reference entitled : “ structured - light 3 d surface imaging : a tutorial ”, by jason geng . in order to convert the device - dependent depth readouts ( in bytes ) to device - independent quantities ( in inches or meters ), a calibration needs to be performed . the calibration of the spatial coordinates of the device ( from pixels to meters or inches ) can be performed in a manner which is substantially similar to the way a traditional rgb camera is calibrated . for example , the reference : “ a flexible new technique for camera calibration ”, z . zhang , ieee trans . on pattern analysis and machine intelligence , vol . 22 ( 11 ), 1330 - 1334 , ( 2000 ), teaches a method to estimate a spatial calibration model with 11 unknown parameters . calibration of the depth output requires knowledge of the geometric configuration of the stereo pair ( illumination and imaging modules ). as discussed , both the spatial coordinates and the depth readouts from the 3d imaging sensor can be translated into device independent units of length ( such as meters or inches ). this , however , does not guarantee that the estimated volumes correspond to the volume being measured , given the fact that the changes in chest cage volume may not be identical to the changes in lung volume due to differences in elasticity between the two . thus , additional calibration may be desirable . assuming a linear relation between estimated and actual volume , a proportionality constant can be estimated via laboratory tests conducted for different breathing levels over a range required for the measurements . the actual volume can be measured using a spirometer . the slope of the linear regression line between the measurements of the spirometer and those obtained with the 3d imaging system would provide the calibration constant . before minute ventilation is estimated , the region of the depth map corresponding to the subject &# 39 ; s body is preferably segmented in the images . this can be achieved in a plurality of ways . for example , since the distance from the camera to the bed &# 39 ; s surface is known , the location of the subject &# 39 ; s body can be extracted by detecting pixels surrounded by the bed &# 39 ; s surface and located closer to the camera than the bed itself . another method is to perform localization and then region - grow the target area to include pixels with similar depth information . this produces a resulting binary mask . chest cage localization can be performed by judicious application of morphological operations on the binary mask that results from the body segmentation stage . for example , morphological opening of the mask with an appropriate size structuring element will remove pixels corresponding to the extremities and head given their relative size with respect to the chest area . another way is to apply morphological skeletonization to the mask and determine the branch points of the resulting skeleton . these branch points will be approximately located at the neck and shoulders , thus providing indication of the location of the subject &# 39 ; s thoracic region . reference is now being made to the flow diagram of fig9 which illustrates one example embodiment of the present method for estimating respiratory minute volume from video captured of a subject of interest being monitored for respiratory function in a remote sensing environment . flow processing begins at step 900 and immediately proceeds to step 902 . at step 902 , receive a video of a target region of a chest area of a subject of interest being monitored for respiratory function . the video has been captured using a video camera and an illuminator configured to project a pattern of structured illumination . example target regions of a subject of interest are shown and discussed with respect to the subject of interest of fig1 . at step 904 , process the video to obtain a depth map at inspiration and expiration within the same breathing cycle over a plurality of contiguous breathing cycles over time . in one embodiment , the depth maps are determined by comparing the captured images of the video to known spatial characteristics of undistorted patterns such that an amount of distortion of the captured patterns can be characterized at both inspiration and expiration over a plurality of breathing cycles . at step 906 , estimate chest volume at inspiration and at expiration from the respective depth maps . a chest volume is estimated after both inspiration and expiration for each breathing cycle over a predetermined amount of time such as one minute . in one embodiment , chest volume is estimated by tessellating surface points at various locations of the surface of the depth map and computing a reference point location which , in various embodiments , comprises either a centroid , a weighted arithmetic mean , or a rank - ordered statistic of surface point locations . tessellation is a technique for covering ( or tiling ) a surface with flat patterns ( or surfaces ) so that there are no overlaps and no gaps . tetrahedrons are created by connecting triangles in the tessellation with the reference point . a tetrahedron is a polygon having four vertices with each face being formed by connecting three of the vertices to form a triangle . three points of each triangle define a plane . there are four faces of a tetrahedron . a volume is computed for each tetrahedron . the total volume is the aggregate of all the tetrahedral volumes . at step 908 , estimate a minute ventilation for the subject based upon the estimated chest volumes . in one embodiment , the minute ventilation ∂ v e is given by : where v i and v m are estimated chest volumes at maximum inspiration and maximum expiration , respectively , in each breathing cycle . in another embodiment , the minute ventilation ∂ v e is given by : ∂ v e = f rr ×( v i − v m ), where v i and v m are estimated chest volumes at maximum inspiration and maximum expiration , respectively , in each breathing cycle , and f rr is the subject &# 39 ; s respiration rate ( preferably in cycles per minute ). at step 910 , communicate the minute ventilation to a memory . in this embodiment , further processing stops . the flow diagrams depicted herein are illustrative . one or more of the operations illustrated in the flow diagrams may be performed in a differing order . other operations may be added , modified , enhanced , or consolidated . variations thereof are intended to fall within the scope of the appended claims . reference is now being made to fig1 which illustrates a block diagram of one example video processing system 1000 for implementing various aspects of the present method as described with respect to the flow diagram of fig9 . in fig1 , workstation 1004 is placed in communication with communication element 1002 for receiving detected grid patterns from , for instance , video camera 303 of fig3 , and for otherwise effectuating communication between various devices and computer workstation 1004 via network 1001 . computer 1004 comprises monitor device 1003 and user interface 1005 for enabling a display of information for a user and for effectuating a user input or selection . an operator of the present system may use the graphical user interface 1003 to identify or otherwise select images of the captured video for processing or re - processing , and provide user input as may be required for the implementation hereof . pixels and / or regions identified or otherwise detected in the received video may be retrieved from a remote device over network 1001 . various portions of the video may be stored to a memory or storage device 1011 in communication with workstation 1004 or may be communicated to a remote device over network 1001 via a communications interface ( not shown ) for remote storage or further processing . workstation 1004 and communications interface 1002 are in communication with image processing unit 1006 for processing the video in accordance with the teachings hereof . video processing unit 1006 is shown comprising a buffer 1007 . such a buffer may be used for queuing information about the received image such as , for instance , one or more target regions within the image frames , size of the video , time / date information , and the like . the buffer may be configured to also store data , mathematical formulas and other representations to facilitate processing of the image in accordance with the teachings hereof . video pre - processor 1008 performs any pre - processing of the video as may be desired or required to compensate for non - uniform illumination due to a curvature of a surface of the skin , for motion induced blur due to body or surface motion , imaging blur , and slow illuminant variation . processor 1008 may further be programmed to reduce the dimensionality of the data and performing independent component analysis ( ica ) on the video signal . light distortion determinator 1009 determines an amount of distortion in the received pattern . the distortion is the determined amount of 3d surface variation . converter 1010 converts the determined amount of distortion to a depth value , on a pixel - by - pixel basis , for each image frame of the video and generates a depth map for each of the inspiration and expiration cycles of the subject . depth map generator 1012 retrieves the depth map values from storage device 1011 and generates a depth map at inspiration and expiration for each breathing cycle . 3d volume processor 1013 receives the generated depth maps and generates a 3d volume for each respective depth map . minute ventilation calculator 1014 retrieves the 3d volumes generated for each inspiration and expiration cycle for a predetermined amount of respiratory cycles , and estimates the subject &# 39 ; s minute ventilation over those respiratory cycles . information as required to perform any of the functions of any of the modules may be retrieved from storage device 1011 or may be received via a user input using the user interface of workstation 1004 . processor 1014 is shown in communication with transmitter 1015 which is used to communicate the subject &# 39 ; s estimated minute ventilation to a third party such as , for example , the patient &# 39 ; s physician , nurse , or respiratory therapist . such a communication may take include some or all of the original video . transmitted images may , in turn , be displayed on a graphical display device , such as that of workstation 1004 , for visual review and further processing . the modules and processing units of fig1 are in communication with monitor 1003 to present thereon information for a user selection . any of the modules and / or processing units of fig1 are in communication with storage device 1011 via pathways shown and not shown and may store / retrieve data , parameter values , functions , pages , records , and machine readable / executable program instructions required to perform their various functions . each of the modules and processing units of the video processing system 1006 is also in communication with workstation 1004 via pathways not shown and may further be in communication with one or more remote devices over network 1001 . it should be appreciated that some or all of the functionality for any of the modules may be performed , in whole or in part , by components internal to the workstation . it should also be appreciated that the workstation has an operating system and other specialized software configured to display a variety of numeric values , text , scroll bars , pull - down menus with user selectable options , and the like , for entering , selecting , or modifying information displayed on display device 1003 . various modules of the embodiments hereof may designate one or more components which may , in turn , comprise software and / or hardware designed to perform the intended function . a plurality of modules may collectively perform a single function . each module may have a specialized processor capable of executing machine readable program instructions . a module may comprise a single piece of hardware such as an asic , electronic circuit , or special purpose processor . a plurality of modules may be executed by either a single special purpose computer system or a plurality of special purpose computer systems in parallel . connections between modules include both physical and logical connections . modules may further include one or more software / hardware modules which may further comprise an operating system , drivers , device controllers , and other apparatuses some or all of which may be connected via a network . it is also contemplated that one or more aspects of the present method may be implemented on a dedicated computer system and may also be practiced in distributed computing environments where tasks are performed by remote devices that are linked through a network . one or more aspects of the methods described herein are intended to be incorporated in an article of manufacture , including one or more computer program products , having computer usable or machine readable media . for purposes hereof , a computer usable or machine readable media is , for example , a floppy disk , a hard - drive , memory , cd - rom , dvd , tape , cassette , or other digital or analog media , or the like , which is capable of having embodied thereon a computer readable program , one or more logical instructions , or other machine executable codes or commands that implement and facilitate the function , capability , and methodologies described herein . furthermore , the article of manufacture may be included on at least one storage device readable by a machine architecture or image processing system embodying executable program instructions capable of performing the methodology described in the flow diagrams . various presently unforeseen or unanticipated alternatives , modifications , variations , or improvements therein may become apparent and / or subsequently made by those skilled in the art , which are also intended to be encompassed by the following claims . accordingly , the embodiments set forth above are considered to be illustrative and not limiting . various changes to the above - described embodiments may be made without departing from the spirit and scope of the invention . the teachings of any printed publications including patents and patent applications , are each separately hereby incorporated by reference in their entirety . | 0 |
referring mainly to fig6 , a device 1 according to the invention can be seen represented , with an inverter 2 and switching means 4 comprising three h - shaped bridges , 3 , 3 ′, 3 ″. each bridge 3 , 3 ′, 3 ″ comprises four switches ( consisting , in the present example , of power transistors ) distributed on arms referenced a to f . the device 1 also comprises energy energy energy storage means 5 , a motor 6 , represented partially , the windings 7 of which serve as inductance . the device 1 also comprises a connector system 8 making it possible to connect to the outlet of the electrical network 11 . the switching from the power supply mode to the charging mode is managed by a control circuit 9 ( in fig6 , the link between the control circuit 9 and the switches 12 has not been represented to make it easier to read the figure ). referring to fig6 , it can be seen that the device 1 also comprises a dc / dc converter 10 arranged between the h - shaped bridges and the energy energy energy storage means 5 , the latter makes it possible to adapt the voltages and consequently optimize the dimensioning of the inverter without degrading efficiency . fig1 targets an embodiment combining a three - phase motor and a single - phase charging electrical network , the compensation being performed by rectification of the network . fig1 represents an inverter 2 with a control circuit 9 and a single - phase electrical source or network 11 . the single phase of the network 11 is connected to the first phase of the motor 6 to make it possible to charge the energy energy energy storage means 5 . more specifically , the phase of the network 11 is connected so as to use the first coil 7 of the stator of the motor 6 as inductance during charging . during this charging step , a magnetic field is created in the motor that includes a homopolar component which attracts and repels in succession the poles of the rotor of the motor 6 . depending on the rotor types , it is thus possible for the rotor to vibrate or start rotating during the charging of the energy storage means 5 and , in particular , in the case of use of a permanent - magnet rotor . even in the case of a wound rotor , if the latter is not insulated from its power supply , spurious induced currents can appear in the rotor and set the latter in motion . the use of a diode bridge 14 as compensation means makes it possible to create a unipolar field that varies only in amplitude . these compensation means prevent the appearance of the attraction repulsion phenomena in a permanent - magnet rotor . fig2 a and 2b target an embodiment combining a three - phase motor and a single - phase charging electrical network , the compensation being performed by current injection . fig2 a represents an inverter 2 with a control circuit 9 and a single - phase electrical network 11 . in this example , the compensation consists in injecting into the remaining phase a current identical to that used for charging . the compensation consequently makes it possible to thus inhibit the effect of the charge current with respect to the rotor . the compensation of the magnetic fields during the charging step is in this case performed by a compensation operation during which the control circuit 9 drives the switches 12 so as to inject , into each of the two phases of the motor that have remained free ( that is to say , into the two coils of the stator of the motor 6 that are not linked to the network 11 ), a compensation current determined by the control circuit 9 so that the vector sum of the magnetic fields created by each of the three coils 7 is zero . this makes it possible to reduce or eliminate the movements of the rotor due , for example , to dissymmetries of the motor . as an example , compensation currents identical to the charging current can be injected , thus inhibiting the effect of the charging current with respect to the rotor . the control circuit 9 thus determines the compensation current by slaving it to the charge current . as a variant , or in addition , the compensation currents can also be determined by the control circuit 9 according to the position of the rotor of the motor 6 supplied , for example , by a sensor . the compensation current is then slaved to the physical position of the rotor , that is to say that it is modified until the rotor is immobilized or exhibits an acceptable movement . fig2 b shows a variant in the connection of the single - phase network to the h - shaped bridges ( 3 , 3 ′, 3 ″). the link from the control circuit 9 to the transistors of the h - shaped bridges has not been represented to keep the figure simple . these links are identical to those of fig1 and 2a . in all the figures , the points that can be seen in proximity to the motor windings 7 define the winding direction of the winding in the notches provided for this purpose . the winding is such that if balanced three - phase currents supply the coils 7 of the motor 6 via each of the terminals indicated by the point , the magnetomotive force system is a balanced three - phase system . in a misuse of language , it is said that the terminal of coil 7 marked by a point is the positive terminal . in fig2 b , the single - phase network is connected so that the neutral of the network is on a coil 7 terminal that is said to be positive and the phase is on a negative terminal . thus , from the viewpoint of the motor 6 , the currents passing through its first two coils are in phase . it is then sufficient to inject into the remaining coil 7 a current that is in phase . thus , the fields generated on the stator of the motor 6 are in fact on the rotor because the vector sum of the currents of the coils 7 of the motor taking into account their spatial offset is zero . during charging , one of the possible commands is to drive the arms b and c in phase opposition . for example , the arms b and c can be controlled according to a conventional pwm ( pulse width modulation ) control in order to produce the pfc ( power factor corrector ) function . there will be no more detailed discussion here concerning how to control the current to produce all the functionalities of a battery charger , which is known to those skilled in the art . to produce the compensation , the arms e and f are driven in the present example so as to generate a current equal in amplitude and in phase on the corresponding coil 7 , the role of which is to compensate for the stator field created by the first two coils 7 . the arms a and d are represented in dotted lines because they are not controlled during this charging phase . the compensation is thus produced by the arms e and f . a variant of the embodiment of fig1 consists in complementing the compensation by rectification of the network with a compensation by current injection into the remaining free phase of the motor , as in the embodiment of fig2 a and 2b . fig3 targets an embodiment combining a three - phase motor and a single - phase charging electrical network , the compensation being performed by current injection at the mid - points of the windings 7 of the motor 6 . fig3 represents an inverter 2 with a control circuit 9 and a single - phase electrical network 11 . in this example , the compensation means are produced by connecting the terminals 15 of the electrical network 11 via the mid - points 16 of two coils of the stator of the motor 6 . during the charging step , the current is input at the mid - points 16 . this introduction means that the charge currents are balanced between each half - coil and consequently do not create any magnetomotive force . the arms a and b as well as c and d are driven in the present example so as to generate currents that are equal in amplitude but in phase opposition from the viewpoint of the motor 6 . for example , the arms b and c can be controlled according to a conventional pwm control in order to produce the pfc function . since the currents of each half - coil flow in the same notches but in opposite directions , as indicated in the figure , the magnetomotive force is therefore zero . there is no field created on the stator by virtue of this compensation . nevertheless , these currents are in phase from the viewpoint of the battery charger . the battery charging is handled , as in a conventional charger , by the arms a , b , c and d and by the leakage inductances of each pair of half - coils . in practice , the coupling of the two half - coils is not perfect even though they pass through the same notches , this being due to the inevitable shape imperfections of the coils . these imperfections therefore form an inductive element for the charger function . the arms e and f are not controlled during this charging phase . as a variant , the coils can be arranged so that the currents of each half - coil do not flow in the same notches . fig4 targets an embodiment combining a three - phase motor and a three - phase charging electrical network , the compensation being performed by rectification of the network . fig4 represents an inverter 2 with a control circuit 9 and three - phase electrical network 11 . in this exemplary embodiment , the compensation means comprise diode bridges 14 . to improve the compensation and prevent any rotation of the rotor , the compensation may include an additional step consisting in reversing a phase of the rotor of the motor 6 . this reversal can be produced simply by reversing the connection of one of the inductive windings of the stator ( see fig4 in which , for the leftmost winding 7 in the figure , the point is to the right of this winding whereas , for the other two windings 7 , the point is to the left of the corresponding winding ). fig5 targets an embodiment combining a three - phase motor and a three - phase charging electrical network , the compensation being performed by current injection at the mid - points of the windings 7 of the motor 6 . fig5 represents an inverter 2 with a control circuit 9 and a three - phase electrical network 11 . in this exemplary embodiment , the compensation means are produced by connecting the electrical network 11 to the mid - points 16 of the coils of the stator of the motor 6 . all the arms a to f are in this case controlled according to a conventional pwm control in order to produce the pfc function . the input of the current , during the energy energy energy storage means charging mode , at the mid - points means , in the same way as was described in the example of fig3 for a single - phase electrical network , that the charge currents are balanced between each half - coil and consequently do not create any magnetomotive force . this solution for compensation by current injection into the mid - points of the coils has the advantage of advantageously reducing the apparent inductance of the charger ( this is also valid for the embodiment of fig3 ). in practice , in order to produce a device producing the pfc function , the inductance of the coils must not be too great so as not to distort the wave of the current . when the power factor is unitary , the current is in phase with the voltage . the slope of the current is maximum when the voltage is zero . if the inductance is high , the rise of the current will take longer and will reach its maximum slope with a delay . the consequence is a distortion of the current during the transition to zero . this distortion is a source of harmonics . as it happens , the leakage inductance is much less than the magnetizing inductance . generally , the ratio of the leakage inductance to the magnetizing inductance is from 1 to 10 %. in the case of a high - voltage machine , the value of the inductance increases with the square of the control voltage . for high - voltage systems , the inductances of the stator coils of the electric machines are too high to produce a charger with control of the power factor . the solution of fig3 and 5 makes it possible to divide this inductance by 10 or even 100 . for example , a 50 kw machine engineered for an inverter with a 900 v h - shaped bridge may exhibit an inductance of 4 mh . this value is not suitable for a 3 kw charger at 230 v . the use of the leakage inductance makes it possible to reduce this value between 400 and 40 μh . the drawback may be a ripple on the current that is greater than the chopping frequency . this ripple can be reduced by increasing the chopping frequency . bearing in mind that the 3 to 6 kw charger does not use the full capacity of the electronics engineered for a 50 kw inverter , there is no drawback in increasing the switching losses in battery charging mode . consequently , in the case of a current injection at the mid - points of one or more coils of the stator ( fig3 and 5 ), and when the same current is injected into the two half - coils ( formed by the existence of the mid - point ), the inductances of the two half - coils are canceled out . only the leakage inductance associated with the imperfections of the coils remains apparent , this inductance being much lower and better suited to use in a charger . other features of the invention could also have been envisaged without thereby departing from the scope of the invention defined by the claims below . thus , in the various examples taken up in the description the compensation means are detailed with a three - phase motor , but the teachings of this description can be transposed and extended generally to polyphase electric machines . as in the examples cited the inverter has an h - shaped bridge structure , the invention however is not limited to this structure and notably can be extended to a conventional structure with an inverter produced with three - phase bridges and switching means of power contactor type to switch from a battery charging mode to a motor power supply mode . moreover , the various embodiments described here can be combined , just as the compensation step can be performed by a combination of the various compensation means described . in the examples cited , the expression “ mid - point ”, when it relates to a coil , may designate not only the point of connection of two half - coils with the same number of turns , but also the point of connection of two half - coils with different numbers of turns . the expression “ mid - point ” is therefore used here in accordance with its usual meaning in electronics , equally covering a point taken at the exact middle of a coil , and a point dividing the coil into two unequal portions ( for example , one portion comprising two thirds of the total number of turns and another portion comprising one third of the total number of turns ). in the same spirit , the terms “ half ” or “ half - coil ” designate one of these portions , even if the latter comprises a number of turns that is different from half the total number of turns of the coil . the charge currents are then distributed in each half - coil in such a way as to reflect the ratio between the number of turns of the half - coil concerned and the total number of turns of the coil . | 8 |
fig1 illustrates a gas turbine engine 10 of a type preferably provided for use in subsonic flight , generally comprising in serial flow communication a fan 12 through which ambient air is propelled , a multistage compressor 14 for pressurizing the air , a combustor 16 in which the compressed air is mixed with fuel and ignited for generating an annular stream of hot combustion gases , and a turbine 18 for extracting energy from the combustion gases . referring to the fig . 2 , the vane assembly 20 is located downstream of the fan 12 . the vane assembly 20 includes an inner shroud 26 and a plurality of vanes 22 extending radially between the inner shroud 26 and an engine casing or an outer shroud 21 . the inner shroud 26 includes a shroud ring 34 and a shroud web 36 . each of the vanes 22 has an airfoil portion 23 extending between the vane tip 24 and the vane root 25 . the vane root 25 is attached to the outer shroud 21 and the vane tip 24 is retained in a grommet 28 inserted into an opening 54 ( see fig . 5 ) of the shroud ring 34 . throughout this description , the axial , radial and circumferential directions are defined respectively with respect to the central axis , radius and circumference of the shroud ring 34 . as seen in fig2 and 3 , the airfoil portion 23 of each vane 22 defines a leading edge 27 and a trailing edge 29 , such that an airflow passing through the vane assembly 20 will flow from the leading edge 27 to the trailing edge 29 . the vane tip 24 includes a slot 38 defined therein and located between the leading and trailing edges 27 , 29 . the slot 38 has a generally rectangular shape and extends radially from the vane tip 24 . at the opposite extremity of the vane 22 proximate the vane root 25 is disposed a button portion 31 , which corresponds generally to the shape of the airfoil portion 23 however is slightly enlarged relative thereto , but nevertheless remains smaller than the adjacent vane root 25 . the button portion 31 includes relatively blunt leading and trailing ends . as seen in fig2 , the button 31 is received within an outer grommet 33 disposed within the outer shroud 21 proximate the root end of the vane 22 . the blunt vane button 31 accordingly helps to prevent the relatively sharp leading and trailing edges 27 and 29 of the vane airfoil 23 from tearing the outer grommet 33 during the assembly and / or disassembly process of the vane assembly or in the event of a bird strike . referring to fig . 4 , each grommet 28 includes a base portion 50 connected to a lip 46 by a recessed portion 48 . the base portion 50 defines two opposite elongated lateral surfaces 49 extending generally along the axial direction . two spaced apart tongues 40 extend perpendicularly from the lip 46 along the circumferential direction and define a slit 42 therebetween . a cutout 44 corresponding in shape to the vane tip 24 is defined within the grommet 28 , extends through the base and recessed portions 50 , 48 , and is bordered by the lip 46 . the grommet 28 also has a leading edge 30 and a trailing edge 32 connecting the lateral surfaces 49 and corresponding to the leading and trailing edges 27 , 29 of the associated vane 22 , as can be seen in fig . 2 . the grommets 28 are preferably made of a flexible material , such as rubber or the like , in order to be able to dampen vibrations of the assembly . referring to fig2 and 5 , the shroud ring 34 has an inner surface 35 and an outer surface 37 defining a circumference of the shroud 26 . the shroud web 36 is circular and extends generally radially from the inner surface 35 of the shroud ring 34 around the entire circumference thereof . the openings 54 are distributed along the circumference of the shroud ring 34 . each opening 54 corresponds in shape to the recessed portion 48 of one of the grommets 28 and is oriented according to a desired orientation of the vane 22 within the airflow . thus , a grommet 28 is receivable within each opening 54 , with the base portion 50 thereof abutting the outer surface 37 and the lip 46 abutting the inner surface 35 . adjacent to each opening 54 , a mating slot 56 is defined within the shroud web 36 . referring to figs . 2 , 4 and 6 , each of the openings 54 of the shroud ring 34 receives the recessed portion 48 of a grommet 28 . the shroud web 36 , at the mating slot 56 , is received within the slit 42 of the grommet 28 , with one of the tongues 40 abutting each side of the web 36 . the vane tip 24 is inserted into the grommet cutout 44 , the tongues 40 and shroud web 36 being received within the vane slot 38 . alternately , it is also possible to provide a deeper grommet slit 42 and vane slot 38 such as to eliminate the need for the mating slot 56 . referring to fig4 and 7 , the base portion 50 of each grommet 28 is shaped so that upon installation of the grommets 28 , the lateral surfaces 49 of each grommet 28 will be in close contact with the lateral surfaces 49 of adjacent grommets 28 , such that the base portions 50 together form a continuous gas path surface 52 along the entire circumference and at least an axial portion of the shroud 26 . this configuration eliminates the need to use adhesives or similar measures to maintain the grommets in position , since the gas flows over the grommets , “ pushing ” them radially inward , instead of flowing between them and producing a lifting force thereon . the airflow is also smoother since it is not perturbed by an uneven surface which would be produced with conventional grommets having free spaces therebetween . alternatively , it is possible to provide an annulus portion or an entire annulus formed by the combined base portions 50 of the grommets 28 , which are integrally connected to each other through the lateral surfaces 49 to form a single unit . in the case of an entire annulus , the grommets 28 would have to be made of a material sufficiently elastic to be able to stretch the annulus for insertion of the grommet lips 46 in into the shroud openings 54 . the vane assembly 20 thus efficiently retains the vane tip in the axial direction , providing additional stability to the vane position which reduces the risk of rearward movement of the vane tip 24 upon impact of a foreign object . this , in turn , reduces the risk of damage to the grommet 28 and adjacent components upon the impact of the foreign object . the vane slot 38 and mating slot 56 are easy to machine , and the grommet 28 with tongues 40 and slit 42 can be manufactured using the same process as other types of grommets . the vane assembly 20 eliminates the need for adhesives or the like to maintain the grommets in place , which reduces costs and simplifies production and maintenance operations . the above description is meant to be exemplary only , and one skilled in the art will recognize that changes may be made to the embodiments described without department from the scope of the invention disclosed . for example , the vane assembly 20 can be used for other types of engine stators as well as in different fields , such as in ventilation systems . the grommets 28 can be used in outer shrouds as well as other types of vanes or rotor blades . still other modifications which fall within the scope of the present invention will be apparent to those skilled in the art , in light of a review of this disclosure , and such modifications are intended to fall within the appended claims . | 5 |
with reference to fig1 - 2 , the principles of operation of a bubble leak tester in accordance with the present invention are illustrated . generally , the bubble leak tester is used to test for leaks in a test part having a test volume 10 by comparing the pressure in the test volume 10 with the pressure in a reference volume 12 across a bubble chamber 14 having a quantity of liquid 16 , such as water , therein . when the test and reference volumes 10 , 12 are positively pressurized ( i . e . pressure greater than atmospheric pressure ), which is the case shown in fig1 the pressure in the test volume 10 ( i . e . test pressure ) will be greater than atmospheric pressure . any leak in the test part will permit test pressure to escape from the test volume 10 , as shown by the arrows , thereby causing the test pressure to become lower than the pressure in the reference volume ( i . e . reference pressure ). since the test volume 10 and the reference volume 12 are connected to each other through the bubble chamber 14 by flow passages 17 and 18 , respectively , the test pressure and reference pressure will tend to equalize . thus air will move toward the test volume to account for the loss in pressure . this movement of air is in the form of bubbles in the liquid 16 in the bubble chamber 14 , thus signifying a leak in the test part . in the case where the test volume and reference volume are negatively pressurized ( i . e . pressure less than atmospheric pressure ), such as shown in fig2 the test volume 10 and reference volume 12 are switched such that test volume 10 is connected to flow passage 18 and reference volume 12 is connected to flow passage 17 , with a flow of air occurring in the opposite direction . if the test part leaks , atmospheric pressure enters the test volume 10 , as shown by the arrows , causing the test pressure to rise . this again causes a difference in pressure between the test pressure and reference pressure , such that the pressures tend to equalize thereby causing bubbles in the liquid 16 of the bubble chamber 14 . prior to testing , the test and reference volumes should be allowed to stabilize for a period of time , to ensure that the starting pressures within the volumes are the same . however , during pressurization of the test and reference volumes 10 , 12 thermal effects can alter the pressures within each volume , thereby adversely affecting the leak test . to minimize thermal effects , the test volume 10 and the reference volume 12 are preferably about the same size . since the volumes are about equal , they will have substantially mirrored thermal effects , and due to their interconnection , the thermal effects are always counteracting , thereby minimizing the time needed to stabilize the volumes . however , the test and reference volumes could be of unequal size if desired , although a longer stabilizing time would be needed . turning now to fig3 a and 3b , the bubble leak tester 20 of the invention is illustrated . the tester 20 includes a housing 22 having a front wall 24 , a first side wall 26 , a second side wall 28 , and a rear wall 30 , as well as top and bottom walls to thereby give the housing 22 a box - like shape . a bubble chamber 32 is mounted to one of the walls of the housing 22 on the exterior thereof , such as on the second side wall 28 , to allow the bubble chamber 32 to be watched for the presence of bubbles during testing . if desired , the bubble chamber 32 could be disposed within the interior of the housing 22 , with one or more of the housing walls being suitably modified to permit viewing of the bubble chamber 32 through the wall . for instance , the second side wall 28 could be wholly or partially made of a transparent material , such that the bubble chamber 32 disposed within the housing can be viewed . alternatively , an electronic sensor could be incorporated into the housing 22 to electronically sense and count the bubbles such that the presence of a leak could be detected automatically without the need for a person to watch the bubble chamber 32 . the data gathered by the electronic sensor could be dumped to a central computer located externally of the tester 20 for analysis of the data . the tester 20 is provided with a variety of switches that control operation of the tester 20 , including a start switch 34 to start operation of the tester , a system reset switch 36 that is used with the start switch 34 to set the initial operating conditions of the tester , and a mass leak reset switch 38 which is actuated in the event of a mass leak in the tester and / or in the test volume and / or in the reference volume to reset the operating conditions of the tester . a variety of gauges are also disposed on the front wall 24 of the tester 20 so as to provide an indication of operating conditions of the tester . the gauges include a pressure gauge 40 to provide an indication of pressure in the tester , an auxiliary indicator light 42 which indicates whether an auxiliary valve v8 of the tester is in use , a system stabilizing indicator light 44 which indicates when the tester 20 is in a stabilizing mode , a system testing indicator light 46 which illuminates when the tester is actually performing a test , and a mass leakage indicator light 48 which illuminates during a mass leak . the tester 20 is further designed to allow connection with the test volume 10 , the reference volume 12 , and a source of pressure ( referenced by reference numeral 50 in staring in fig6 a ) that is used to pressurize the volumes 10 , 12 . in particular , the side wall 26 of the tester 20 is provided with a test port 52 to which the test part , and thus the test volume 10 , is to be connected to perform a test . in addition , a reference port 54 is provided to which the reference volume 12 is connected , and an input port 56 permits connection of the pressure source to the tester . fig4 illustrates a tester 20 &# 39 ; that is similar to the tester 20 of fig3 a , 3b . however , the tester 20 &# 39 ; includes a keypad 150 and liquid crystal display ( lcd display ) 152 on the front wall 24 . the keypad 150 allows a user to enter data into the main controller for the tester 20 &# 39 ;, thereby allowing the operation of the tester 20 &# 39 ; to be changed by the user . the lcd display 152 is able to display the data that is being entered by the user on the keypad , in addition to displaying data or messages concerning the operation of the tester 20 &# 39 ;. as will be described in detail later in the description , the bubble chamber 32 , the test port 52 , the reference port 54 and the input port 56 are interconnected by a series of flow passages disposed within the interior of the housing 22 . a valve arrangement is also provided for selectively controlling flow between the bubble chamber , the test port , the reference port and the input port . thus , by connecting the test volume 10 to the test port 52 , the reference volume 12 to the reference port 54 , and the pressure source 50 to the input port 56 , the valve arrangement can be suitably controlled to perform a bubble leak test to check for leaks in the test part . however , prior to describing the valve arrangement in detail , reference is made to fig5 which illustrates a preferred form of the bubble chamber 32 . the bubble chamber 32 includes a housing 60 made of glass , clear plastic or other transparent material . the housing 60 is partially filled with a liquid 62 , such as water , in which bubbles will form when there is a difference in pressure between the test and reference volumes . the housing 60 is generally tubular in shape , and is closed at one end and open at the opposite end . the end of the housing 60 that is open is threaded , and a cap 64 is removably screwed onto the open end of the housing by engaging with the housing threads , so as to close off the open end of the housing 60 . the cap 64 is preferably made of aluminum , however other metals as well as plastic materials could be used if desired . the bottom of the cap 64 includes a central bore 66 formed therein which communicates with the interior of the housing 60 above the level of the liquid 62 , and a port 68 extends through the side of the cap 64 and into the bore 66 whereby the port 68 is in communication with the interior of the housing . the cap 64 further includes a reservoir 70 formed therein above the bore 66 and separated therefrom by a wall 72 . a passageway 74 extends between the reservoir 70 and the bottom of the cap 64 , and one end of a tube 76 is fit within the passageway and the opposite end of the tube 76 extends into the housing below the surface of the liquid 62 . therefore , the reservoir 70 is placed into communication with the liquid below the surface thereof . a further port 78 is formed in the side of the cap 64 to place the reservoir 70 in communication with the exterior of the cap . the port 68 is connected , via the flow passages and valve arrangement mentioned previously , to either the test volume 10 or the reference volume 12 , while the port 78 is connected , via the flow passages and valve arrangement , to either the reference volume 12 or the test volume 10 , depending upon whether there is positive pressure or negative pressure . in the event of a change in pressure in the test volume , air will tend to flow into the reservoir 70 through the port 78 , and then through the tube 76 in order to equalize pressure with the reference volume 12 . since the tube 76 extends beneath the surface of the liquid 62 , air exiting therefrom is in the form of bubbles , thus providing a visual indication of the presence of a leak in the test part . during a test , a person could mistakingly disconnect the reference or test volume , thereby causing a sudden large shift in pressure between the two volumes that could cause the fluid 62 in the housing 60 to be forced backwards up the tube 76 . the reservoir 70 in the cap 64 collects such backflowing liquid and prevents it from exiting the port 78 , to prevent contamination of the valve ( to be later described ) between the bubble chamber 32 and the reference or test volume . while a specific bubble chamber 32 has been described herein , it is to be realized that other bubble chambers could be used as well , such as a bubble chamber that does not include a reservoir . with reference to fig1 , a manometer 200 is shown that can be used in combination with , or in place of , the bubble chamber 32 . since there is a shift in volume when the test volume 10 leaks , the volume change can be measured by the manometer 200 . for positive pressures , one end 202 of the manometer apparatus 200 would be in communication with the reference port 54 , while the other end 204 of the manometer apparatus 200 would be in communication with the test port 52 . the manometer 200 includes a scale 206 on the side thereof that is reflective of the change in volume when a leak occurs . a liquid 208 is disposed within the manometer 200 , and when a leak occurs in the test part , the pressure is higher at the end 202 than at the end 204 , thereby causing the liquid 208 to rise up the scale 206 . a reservoir 210 is formed in the manometer 200 prior to the end 204 to collect liquid 208 and prevent it from being forced out of the end 204 . further , like the bubble chamber 32 , the manometer 200 could be disposed either inside or outside the housing 22 , and a sensor could be used to electronically measure the change in liquid height at the scale 206 . turning now to fig6 a - 6i , a first embodiment of the flow passages and valve arrangement 80 that are used to control flow within the bubble leak tester 20 or 20 &# 39 ; is illustrated . the flow passages and valve arrangement 80 are disposed inside of the housing 22 of the leak tester . fig6 a illustrates the valve arrangement 80 in a relaxed state , i . e . prior to testing , for positive pressure situations , with the valves of the valve arrangement being in their normal operating state . however , for negative pressure situations , the connection of the bubble chamber 32 with the test volume 10 and reference volume 12 would be switched as shown in fig7 which illustrates the valve arrangement 80 in a relaxed state for negative pressure situations . thus , the systems shown in fig6 a and 7 are substantially similar , except for the connection of the test and reference volumes with the bubble chamber 32 and the direction of fluid flow that occurs within the flow passages . in order to facilitate the description of the invention , fig6 b - 6i will be described in relation to positive pressure . however , it is to be realized that a valve arrangement of the type shown in fig7 operates in a similar manner , except for the direction of flow within the flow passages . as fig6 a shows , the test and reference volumes 10 , 12 are schematically illustrated as being connected to the leak tester 20 , by connecting to the test port and the reference port , 52 and 54 , respectively . a flow line 82 interconnects the test port 52 and the port 68 on the bubble chamber 32 , and a flow line 84 interconnects the reference port 54 and the port 78 on the bubble chamber 32 , to thereby achieve a system similar to that shown in fig1 . for negative pressure , i . e . vacuum , the bubble chamber 32 is essentially flipped such that the test port 52 is connected to the port 78 on the bubble chamber 32 , while the reference port 54 is connected to the port 68 as shown in fig7 in order to achieve a system similar to that shown in fig2 . a vent line 86 connects to the flow line 82 and communicates with a vent , such as ambient air outside of the housing 22 , to allow venting of pressure . an input line 88 extends from the input port 56 and branches into two lines 88a , 88b , with the line 88a joining with the line 82 leading to the test port 52 , and with the line 88b joining with the line 84 leading to the reference port 54 . a further vent line 90 is connected to the input line 88 and communicates with a vent , such as ambient air outside of the housing 22 , to allow further venting of the pressure in the flow passages . the pressure gauge 40 that is mounted on the front wall 24 of the housing 22 is connected to the flow line 84 adjacent the reference port 54 so as to measure the pressure adjacent the reference port 54 and reference volume 12 . further , a pair of pressure switches 92 , 94 are disposed in the flow line 82 adjacent the test port 52 for sensing pressure at the test port 52 and test volume 10 . the pressure switch 92 watches ( i . e . senses ) for the pressure to reach a predetermined set pressure before allowing the tester 20 to start . the pressure switch 94 on the other hand , senses if the pressure has fallen significantly , such as would occur in the case of a mass leak or removal of the test volume 10 , and shuts the tester 20 down in the event of a rapid loss in pressure . thus , the pressure switches 92 , 94 are integrated into the control of the tester 20 to ensure that if the tester never pressurizes up , the tester will not start , and if the system does pressure up , but experiences a subsequent rapid loss in pressure , the tester will shut down . each pressure switch 92 , 94 is preferably adjustable , and they are preferably accessible by the user whereby they can be adjusted so as to allow control of the pressure set point at which each switch activates . alternatively , in the tester 20 &# 39 ; of fig4 the pressure switches 92 , 94 would be replaced by a single pressure transducer ( not shown ) disposed within the housing . the pressure transducer would perform the same functions as the pressure switches 92 , 94 , i . e . waiting for a predetermined set pressure to be reached and sensing a significant reduction in pressure , and the pressure transducer would be integrated into the main controller of the tester 20 &# 39 ; to allow the user to change the pressure set points of the pressure transducer by entering the new pressure set points via the keypad 150 . with reference to fig6 a , the valve arrangement 80 includes a plurality of valves v1 - v7 for controlling the flow within the flow passages of the tester 20 . the valves v1 - v7 are preferably solenoid operated , bubble tight valves , such as in - line poppet valves , although other types of bubble tight valves could be used if desired . one such alternative valve will be described in relation to fig1 a - f later in the description . an auxiliary valve v8 is also provided that operates a pneumatic connector that may be used to connect the test and reference volumes 10 , 12 to the ports 52 , 54 , respectively . typically , the reference volume 12 would be generally permanently connected to the tester 20 , such that only the test volume 10 need be connected to the port 52 by controlling the auxiliary valve v8 . however , the test and reference volumes could each be manually connected to their respective ports 52 , 54 if desired , in which case the auxiliary valve v8 could be eliminated . fig6 a illustrates the valves v1 - v7 in their initial states , where valve v1 is normally closed and forms a means for selectively controlling the flow of positively pressurized fluid into the input line 88 through the input port 56 . valve v2 is normally open and is disposed in the vent line 90 and thereby forms a means for selectively controlling flow through the vent line 90 to the vent . the valves v3 and v5 are normally open and are disposed in the lines 88a , 88b , thereby forming a means for selectively controlling flow to the test port 52 and reference port 54 , respectively , and for selectively controlling flow between the test port and reference port . the valves v4 and v6 are normally closed and are disposed in the flow lines 82 , 84 , thereby forming a means for selectively controlling flow between the test port 52 and the bubble chamber 32 and between the reference port 54 and the bubble chamber 32 , respectively . the valve v7 is normally closed and is disposed in the vent line 86 , thereby forming a means for selectively controlling flow to the vent . as fig6 a further shows , a valve 100 , such as a needle valve , is also disposed in the vent line 86 , downstream of the valve v7 , for selectively controlling flow through the vent line 86 . the valve 100 is manually preset by the manufacturer to allow a predetermined rate of fluid flow through the vent line 86 when the valve v7 is actuated open . the valve 100 is preferably preset by the manufacturer , and the end user would not alter the setting of the valve , so that the valve 100 acts as a fixed orifice in allowing a preset rate of fluid flow therethrough . the user would typically control the time that the valve v7 is open to control the amount of venting that is allowed to occur . it should be realized that the valve 100 could be replaced by a fixed orifice if desired . the tester 20 is preferably provided with suitable controls to control the operation of the valves v1 - v8 during the operation of the tester 20 . the tester 20 is capable of performing at least three separate procedures during its operation : a testing procedure ; a startup procedure ; and a mass leak restart / pressurizing procedure . an example of each procedure will now be described in detail below . the testing procedure is conducted by the tester 20 during the performance of an actual leak test . fig6 b - 6i illustrate the state of the valves v1 - v7 , as well as the pressure conditions in the flow passages , at certain stages during the testing procedure for positive pressure conditions . in fig6 a - 6i , a line ----- represents a flow passage at source pressure , a line ------ represents a flow passage at atmospheric pressure , a line ------ represents a flow passage at a pressure less than source pressure , and a line ------ represents a flow passage at a pressure between source pressure and the initial pressure across the bubble chamber 32 . fig8 illustrates a timeline related to the testing procedure . during the testing procedure , as well as during the other procedures , many timers are used to control the operation of the tester . the procedures have to be designed to ensure that there is always a pressure across the bubble chamber 32 . this will cause the bubble chamber 32 to be on the verge of showing bubbles when testing by always allowing an initial surge of air to go through the tube 76 of the bubble chamber 32 to clear the bubble chamber 32 of backflow . with reference to fig6 b and fig8 after turning the tester 20 on and pushing the start button 34 , the auxiliary valve v8 energizes thereby actuating a connector to connect to the test volume 10 . simultaneously , the auxiliary valve indicator light 42 illuminates , indicating that the valve v8 is in use . further , once the start button 34 is pushed , an auxiliary timer t 1 starts . the auxiliary timer t 1 causes a delay to prevent the procedure from continuing before the connector connects to the test volume 10 . after the delay caused by the timer t 1 the valve v2 energizes ( i . e . closes ) and after a predetermined delay , such as about 0 . 1 seconds , to ensure that the valve v2 properly energizes , the valve v1 energizes ( i . e . opens ). thus , as shown in fig6 b , the pressure source 50 is in communication with the test and reference volumes 10 , 12 to bring the two volumes up to the desired test pressure . provided that the test volume 10 is able to pressurize , the pressure switch 94 closes first and then the pressure switch 92 closes . alternatively , when a pressure transducer is used , the system waits for the pressure transducer to sense that the test volume 10 has achieved the proper pressure and remains pressurized . the valve v1 then closes as shown in fig6 c , thereby closing off the pressure source , and the system stabilizing indicator light 44 comes on . a system stabilizer timer t 2 then starts , which delays the procedure for a period of time to allow the two volumes 10 , 12 to come to an equilibrium state , thereby negating all thermal effects that are present in the two volumes due to the pressurization . as was mentioned previously , one way to minimize thermal effects is to make the test and reference volumes 10 , 12 equal in size . by making the volumes equal in size , or nearly so , the two volumes will have mirrored thermal effects , and any thermal effects in one volume will be counteracted by a counteracting thermal effect in the other volume , thereby minimizing the time needed to stabilize the two volumes . however , in the event that one volume is larger than the other , it may take several minutes or more for the two volumes to stabilize . in addition , for filling large volumes , it would be beneficial to incorporate a bypass into the leak tester , in which the same or different source of pressure is directly connected to the two volumes , thereby bypassing the remainder of the system until pressurizing was complete . the bypass would allow large volumes to be pressurized in a shorter period of time , thereby speeding up the testing procedure . returning now to the preferred testing procedure , after the end of the stabilizing time , the valves v3 and v5 energize ( i . e . close ), as shown in fig6 d , so that the test volume and the reference volume are isolated from each other . after delaying for another predetermined period of time , such as about 0 . 25 seconds , to ensure that the valves v3 and v5 are closed , the valve v2 is opened , as shown in fig6 e , so as to vent the input line 88 and the lines 88a , 88b . further , the valves v4 and v6 are energized ( i . e . opened ) as shown in fig6 e to communicate the test volume 10 and the reference volume 12 with the bubble chamber 32 . after the valves v4 and v6 are opened , the procedure again delays for a predetermined period of time , such as about 0 . 25 seconds , and then the valve v7 is energized ( i . e . opened ) to drop the pressure on one side of the bubble chamber 32 , as shown in fig6 f , to provide a surge of air to clear out the bubble chamber 32 of any backflow . when the test volume and reference volume are connected with the bubble chamber 32 , there could be a small amount of flow that could occur through the bubble chamber 32 . the stabilizing timer t 3 delays for a period of time to allow the system to drop pressure on the one side and send a surge of air through the bubble chamber 32 to clean out the tube 76 of any liquid therein due to liquid backflow . after this delay period , the valve v7 is again closed for testing as shown in fig6 g , and the system delays for a period of time , such as about 2 . 0 seconds . in certain circumstances , it would be beneficial to be able to pause the procedure at this point . for instance , it may be beneficial for the user to utilize two testers at the same time , in order to increase the amount of tests performed . thus , the user could be setting - up one tester while the other is already set - up and ready for testing . however , while the user is occupied setting - up one tester , the test on the other tester may be missed . therefore , it would be desirable to be able to pause the procedure at this point on one tester , just prior to testing , thus allowing the user to continue the set - up on the other tester without having to worry about missing the actual leak test . to allow for this , the tester 20 is provided with a switch 102 , such as a dip switch or the like , which must be thrown by the user prior to the start of the procedure if the user wants the procedure to automatically pause after the expiration of the 2 . 0 sec . delay so as to temporarily pause the procedure until the user again pushes the start button 34 to continue . alternatively , for the tester 20 &# 39 ;, the switch 102 would be eliminated , and the functions of the switch would be integrated into the system control of the tester 20 &# 39 ;, such that the system automatically pauses the procedure after the expiration of the 2 . 0 sec . delay , with the procedure continuing once the start button is pushed by the user . the user can preferably turn on and off the automatic stoppage of the procedure through inputs entered on the keypad 150 . thus , the switch in the tester 20 , as well as the switch - like functions in the tester 20 &# 39 ;, allows the user to set - up the second tester without having to worry about missing the test on the first tester . in the event that the switch 102 is not thrown on the tester 20 before beginning the procedure , or the switch - like functions in the tester 20 &# 39 ; are not turned on , then the procedure will automatically continue after the 2 . 0 sec . delay ends . provided that the procedure has been paused , the start button 34 is pressed to continue the procedure , the system stabilizing indicator light 44 turns off and the system testing light 46 comes on initiating the actual leak test . the leak test is performed for a period of time determined by a test timer t 4 . the test timer t4 can be manually set to however long the bubble chamber 32 is to be monitored for the presence of bubbles in the liquid . the presence of bubbles during the test time provides an indication that there may be a leak in the test volume . in this event , further testing can then be done on the test volume to determine the actual source and location of the leak . once the test time is completed , the test light 46 goes out , the valves v4 and v6 close , as shown in fig6 i , and after a predetermined period of delay , such as about 0 . 25 seconds , the valves v3 and v5 open to allow the two volumes to vent , as shown in fig6 . an auxiliary timer t 5 then starts , which delays actuation of the valve v8 and thus prevents disconnection of the connector from the test part until the system goes to atmospheric pressure . after completion of this delay time , valve v8 actuates and the system is back to its initial state shown in fig6 a . the testing procedure outlined above is thus used to test for a leak in the test volume . as is evident from fig6 a - i , the valves v4 and v6 not only allow a pressure to be maintained across the bubble chamber 32 , but the valves v4 and v6 also prevent the liquid 16 in the bubble chamber 32 from backflowing through the lines 82 , 84 and into the volumes 10 , 12 . it is to be realized that the testing procedure could vary from that specifically described above . for instance , if the test volume 10 was manually connected to the test port 52 , thereby eliminating the need for the valve v8 , then the steps relating to the valve v8 could be eliminated . as mentioned above with respect to the testing procedure , there should always be a pressure maintained across the bubble chamber 32 . by maintaining a pressure across the bubble chamber 32 , the pressure difference between the two volumes and the bubble chamber 32 when the valves v4 and v6 are opened will be minimized . thus , when the two volumes 10 , 12 are communicated with the bubble chamber 32 , faster stabilization is achieved . in order to achieve a pressure across the bubble chamber 32 , the leak tester of the invention performs a startup procedure each time the start button 34 and the system reset button 36 are pushed at the same time , and the power to the tester is turned &# 34 ; on &# 34 ;. the startup procedure need be performed only once at some point prior to performing the testing procedure , and will only be re - performed if the start button 34 and the system reset button 36 are pushed at the same time and the power to the tester is turned &# 34 ; on &# 34 ;. like the testing procedure , the startup procedure will be described for a positive pressure condition . fig9 illustrates a timeline related to the startup procedure , showing the state of each valves v1 - v8 during the procedure . the system is set up with a good test volume and a good reference volume . the incoming air line is set to a pressure of 5 % lower than the desired test pressure . ( or 5 % higher for vacuum ) the &# 34 ; start &# 34 ; and &# 34 ; system reset &# 34 ; buttons are pushed simultaneously and held in , and the power switch is turned on . the buttons are then released . ( the system will go into start - up mode . all led &# 39 ; s will be blinking .) the two led &# 39 ; s on the back of the tester should be on . if they are not , then the pressure gauges were not backed out far enough . ( when a pressure transducer is used instead of the two pressure switches , the two led &# 39 ; s will not be present ). the user then turns the pressure switch 94 in until its led goes out . the pressure switch 94 is rotated back and forth slowly to find the point at which the switch is activating . once this point is found , the switch is backed off just slightly until the led light comes on . this will set the pressure switch . for a pressure transducer , the pressures are set by the user through the user interface , i . e . keypad 150 , on the tester 20 &# 39 ;. the incoming air line pressure is then set to 5 % above the desired test pressure . the pressure switch 92 is adjusted the same way as switch 94 . once the pressure switches are set , the start button is pushed by the user . the system checks both pressure switches to make sure they are on . if they are not , the system waits for the start switch . the pressure switch 94 is monitored by the system , until the end of the procedure . with reference to fig9 the startup procedure begins by connecting a test volume and reference volume to the tester 20 . the incoming air pressure provided by the pressure source 50 is set to a pressure 5 % lower ( or 5 % higher for vacuum conditions ) than the desired testing pressure . once this is done , the start button 34 and system reset button 36 are simultaneously pressed and held in , the power is turned on and then the buttons 34 , 36 are released . the tester 20 will then automatically go into its startup mode . the tester 20 is preferably provided with a pair of led &# 39 ; s on the rear wall 30 thereof , with one led providing an indication of the operation of the pressure switch 92 and the second led providing an indication of the operation of the pressure switch 94 . the two led &# 39 ; s are preferably on after the buttons 34 , 36 are released . these two led &# 39 ; s are eliminated when a pressure transducer is used in place of the two pressure switches . the valve v8 then energizes , and the auxiliary timer t 1 delays for a period of time before the valves v1 , v2 and v7 energize . then , the user adjusts the pressure switch 94 back and forth to find the point at which the switch is activating . once this point is found , the pressure switch 94 is backed off slightly until its led comes on . this sets the pressure switch 94 . the pressure source is then set to a pressure 5 % higher than the desired test pressure and the pressure switch 92 is then set in the same manner that pressure switch 94 is set . after setting the pressure switches , the start button 34 must again be pressed . if the start button is not pressed , the procedure will not continue . once the procedure starts , it is important that the system monitor the pressure switch 94 until the end of the procedure to check for a mass leak in the system . the valves v4 and v6 are then energized for a period of time , such as for about 10 . 0 seconds , and then de - energized . after waiting for a period of time , such as about 1 . 0 - 2 . 0 seconds , valves v4 and v6 are again energized , this time for a shorter period of time , such as about 1 . 0 seconds , after which the valve v4 and v6 are de - energized . the system then waits for a period of time , such as about 0 . 25 seconds , and then the valves v1 , v2 and v7 are de - energized . the auxiliary timer t 5 then starts , delaying the time before the auxiliary valve v8 de - energizes . once valve v8 de - energizes , the tester 20 is ready to perform the testing procedure . the startup procedure set forth above , and illustrated in fig9 pressurizes the bubble chamber 32 to a pressure that is less than source pressure but greater than ambient so that the pressure difference between the two volumes 10 , 12 and the bubble chamber 32 during the testing procedure is minimized , thereby reducing the time needed to stabilize the system once the two volumes are communicated with the bubble chamber . it is to be realized that the startup procedure could vary from that specifically described above , particularly when a pressure transducer is used . the use of a pressure transducer will allow the system to automatically perform the majority of the startup procedure , thereby reducing the amount of user interaction required during the startup procedure . in the event the pressure switch 94 senses that the pressure has fallen below the pressure set point of the switch 94 , which is set in the startup procedure , thereby indicating that there is a mass leak in the system , the mass leak indicator light 48 will turn on , and the tester 20 will shut down . next time the tester is run , the bubble chamber 32 will be pressurized and then the tester 20 will go directly into testing . this procedure is again described in relation to positive pressure conditions . fig1 illustrates a timeline of the mass leak restart / pressurize procedure . the system is started as normal by pushing the start button . ( the system will automatically go into start - up mode . all led &# 39 ; s will be blinking .) the system monitors and waits for pressure switch 92 to activate once the pressure set by switch 92 has been reached , the system turns off the mass leak timer . the system monitors pressure switch 94 until the end of the procedure . the system then energizes v4 / v6 / v7 for about 5 . 0 sec ., and the system monitors the pressure and energizes v1 as needed to maintain the pressure . the system waits for switch 92 to go off . max about 1 . 0 min . the system checks if switch 92 is on . if not , the system goes to *. * go directly to the beginning of the system stabilize timer t 2 in the main program . the procedure is initiated by starting the tester as normal , whereby the tester will automatically go into its startup procedure and all led &# 39 ; s will be blinking . the valve v8 then energizes and the auxiliary timer t 1 delays for a period of time after which a mass leak timer starts . the valves v1 and v2 are then energized and the system monitors and waits for pressure switch 92 to activate . once pressure switch 92 activates , the valve v1 is de - energized and the mass leak timer is turned off . again , pressure switch 94 is monitored by the system until the end of the procedure . the valves v4 , v6 and v7 are then energized for a period of time , such as about 5 . 0 seconds . during this time , the system monitors the pressure switch 92 or the pressure transducer to check whether it has activated , thereby indicating that the pressure has dropped . in the event that pressure has dropped , v1 is again energized so as to bring the pressure back up . if the pressure does not drop , v1 need not be re - energized . in the event that v1 energizes to bring the pressure back up , the procedure de - energizes v1 after the 5 . 0 sec . delay so that the rest of the procedure can resume . valves v3 and v5 are then energized , at which point the system monitors the pressure switch 92 , waiting for it to go off . the maximum time for waiting for the switch 92 is about 1 . 0 minute . valves v4 and v6 are then de - energized , and after a predetermined delay time , such as about 0 . 25 seconds , valves v3 , v5 and v7 are de - energized . at this point , the system checks to see if switch 92 is on . if it is not on , the procedure goes directly to the beginning of the system stabilizer timer t 2 in the testing procedure . if the switch is on , valve v2 is de - energized and the system waits for the switch 92 to go off . once the switch 92 is off , valve v2 is energized and the procedure goes directly to the beginning of the system stabilizer timer t 2 in the testing procedure . the mass leak restart / pressurize procedure thus re - pressurizes the bubble chamber 32 in the event of a mass leak , and returns back to the testing procedure to resume testing . it is to be realized that the mass leak procedure could vary from that specifically described above . with reference now to fig1 a - f , an alternative valve arrangement 110 is illustrated that utilizes three - way valves v9 - v11 , a valve v12 , and a valve 100 , such as a needle valve . this arrangement 110 is similar to the arrangement 80 , except that the two - way valves v5 and v6 are replaced by the single three - way valve v9 , the valves v3 and v4 are replaced by the single three - way valve v10 , and the valves v1 and v2 are replaced by the single three - way valve v11 . the valve v12 and the valve 100 are the similar to the valves v7 and valve 100 , respectively , in fig6 a . this embodiment is simpler in design than the embodiment in fig6 a - i , and requires fewer valves than the first embodiment . the pressure designations in the flow passages is the same as is used for fig6 a - i . like the first embodiment , the valves v9 - v11 selectively control flow between a bubble chamber 112 , the test port 52 , the reference port 54 and the input port 56 . the bubble chamber 112 is preferably the same type of bubble chamber as used in the first embodiment , however , the bubble chamber 112 could be different if desired . in addition , fig1 a - f illustrate the valve arrangement 110 under positive pressure conditions . however , like the first embodiment , this embodiment can be used for negative pressure as well . referring now to fig1 a , flow lines 114a , 114b extend from the bubble chamber 112 to the valves v9 , v10 , respectively . a vent line 116 connects to the flow line 114b and communicates with a vent , such as ambient air outside of the housing 22 , to allow venting of pressure . the valve v12 is disposed in the vent line 116 and allows flow therethrough , with the valve 100 being adjustable so as to control the amount of flow through the vent line 116 . in addition , flow lines 118a , 118b extend between the valves v9 , v1 and the reference port 54 and test port 52 , respectively . a further flow line 120 extends from the valve v11 and branches into two lines 120a , 120b , with the line 120a connecting to the valve v9 and the line 120b connecting to the valve v10 . an input line 122 extends from the input port 56 to the valve v11 , and a further vent line 124 extends from the valve v11 and connects to a vent . in this embodiment , the pressure switches 92 , 94 and the pressure gauge 40 are all disposed in the flow line 118b leading to the test port 52 and test volume 10 for sensing the pressure in this line . further , as in the first embodiment , the flow lines 114a , 114b are initially under pressure to ensure that there is a pressure across the bubble chamber 112 . thus , in the initial , relaxed state of the valve arrangement 110 shown in fig1 a , the valves v9 , v10 , v11 are positioned so as to communicate the test volume 10 and reference volume 12 with the vent line 124 so as to vent the two volumes . the two volumes 10 , 12 are also in communication with each other at this point . additionally , the valve v12 is closed , so that the flow lines 114a , 114b remain under pressure . the valve v11 thus forms a means for selectively controlling the flow of positively pressurized fluid through the input port 56 and into the system , as well as forming a means for selectively controlling flow through the vent line 124 to the vent . the valves v9 and v10 form a means for selectively controlling flow to the test port 52 and reference port 54 , respectively , for selectively controlling flow between the test port and reference port , and for selectively controlling flow between the test port 52 and the bubble chamber 112 and between the reference port 54 and the bubble chamber 112 , respectively . the valve v12 is normally closed and is disposed in the vent line 116 , and with the valve 100 , forms a means for selectively controlling flow to the vent . turning to fig1 b , to pressurize the two volumes 10 , 12 , the valve v11 is actuated so as to communicate the input line 122 , and thus the source of pressure 50 , with the flow line 120 and thus with the two volumes 10 , 12 . pressurization continues until the pressure switch 92 activates at the desired test pressure , as in the first embodiment . once the desired test pressure is reached , the two volumes 10 , 12 are isolated from the pressure source by suitably positioning the valves v9 , v10 to close off communication with the source , and placing the two volumes in communication with the bubble chamber , as shown in fig1 c . as shown in fig1 d , the valve v11 is then activated to vent pressure in the lines 120 , 120a , 120b , and the valve v12 is activated momentarily prior to testing to allow a surge of air to clear the tube in the bubble chamber , as in the first embodiment . the valve v12 is then closed , and the system performs the leak test , as shown in fig1 e . once testing is completed , the valves v9 , v10 are positioned as shown in fig1 f so as to vent the two volumes 10 , 12 and the system is returned to its initial state , ready to conduct a new test . a testing procedure , a startup procedure and a mass leak restart / pressurizing procedure would also be used with the embodiment of fig1 a - f . these procedures would be similar to the corresponding procedures used for the embodiment of fig6 a - i , but the procedures would be slightly modified to account for the difference in the valving used for each embodiment . the details of the procedures and timelines for use with the embodiment of fig1 a - f would be readily apparent from the description of the procedures and timelines given for the embodiment of fig6 a - i , and thus the details of the procedures and timelines are not discussed herein . the above specification , examples and data provide a complete description of the manufacture and use of the composition of the invention . since many embodiments of the invention can be made without departing from the spirit and scope of the invention , the invention resides in the claims hereinafter appended . | 6 |
the embodiment of the invention will be described below , referring to the drawings . fig2 shows the schematic structure of the optical pick - up apparatus of the embodiment of the present invention . the optical pick - up apparatus shown in fig2 is structured in such a way that : concerning both cd ( second optical disk 32 ) having 1 . 2 mm protective substrate 32 b , and dvd ( first optical disk 31 ) having 0 . 6 mm protective substrate 31 b , recording and / or reproduction of information can be performed on information recording surfaces 31 a and 32 a of first optical disk 31 and second optical disk 32 , by the light fluxes of wavelengths of 655 nm and 785 nm from the first and the second light sources , respectively . as shown in fig2 , the optical pick - up apparatus is provided with the optical system , including : coupling lens 16 which refracts both light rays coming from first semiconductor ( a first light source ) laser 11 which emits light flux at a wavelength of 655 nm for dvd use , and light rays coming from second semiconductor ( a second light source ) laser 12 which emits light flux at a wavelength of 785 nm for cd use , to make nearly parallel fluxes of infinite - point rays , and objective lens 18 which brings the infinite - point rays from coupling lens 16 to a focal point on information recording surfaces 31 a and 32 a of optical disks 31 and 32 , respectively . further , between each of light sources 11 and 12 and coupling lens 16 , arranged are : beam splitter 13 , through which the light flux coming from first light source 11 passes , and by which the light flux coming from second light source 12 is reflected , beam splitter 14 , through which each of the light fluxes coming from both of light sources 11 and 12 passes , and further , the light flux is reflected by information recording surfaces 31 a and 32 a of each of optical disks 31 and 32 , then the optical paths of the light flux are changed by beam splitter 14 , and the light flux travels to optical detector 21 . objective lens 18 has flange section 18 a on its outermost side , by which it is possible to attach objective lens 18 on the optical pick - up apparatus . flange section 18 a has a surface projecting perpendicularly to the optical axis of objective lens 18 so that it is possible to be mounted precisely . objective lens 18 is driven toward the focusing direction and the tracking direction by double shaft actuator 22 . still further , the ring - shaped diffractive structure for the correction of the spherical aberration is formed to correct the spherical aberration caused by the difference of the thickness between protective substrates 31 a and 32 b of each of optical disks 31 and 32 , at the central area on the optical surface of objective lens 18 , which is used for recording and / or reproduction of information on both first optical disk 31 and second optical disk 32 . the ring - shaped diffractive structure is one which compensates for spherical aberration of the focal point on information recording surface 31 a to be in a range where effective recording and / or reproduction of first optical disk 31 can be performed , when the refractive indexes of coupling lens 16 and objective lens 18 and the emission wavelength of first light source 11 are changed due to change of temperature of the optical pick - up apparatus during use . the above - mentioned ring - shaped diffractive structure is formed on the peripheral area of objective lens 18 which is used mainly for reproduction or recording of information for first optical disk 31 . the central area of objective lens 18 includes the optical axis of the lens , and is a common area for dvd and cd use , whereas the peripheral area is positioned around the central area , and is used exclusively for dvd . in case of information reproduction from first optical disk ( dvd ) 31 , a light beam is emitted from first semiconductor laser 11 , which passes through beam splitters 13 and 14 , quarter wavelength plate 15 , and coupling lens 16 to become a parallel light beam . the parallel light beam passes through diaphragm 17 , and is converged on information recording surface 31 a by objective lens 18 , through protective substrate 31 b of first optical disk 31 . then , the light beam is modulated by information pits on information recording surface 31 a and is reflected , passes back through objective lens 18 , diaphragm 17 , coupling lens 16 , and quarter wavelength plate 15 , next , the light beam is reflected by beam splitter 14 , and is given astigmatism by cylindrical lens 19 , after that , the light beam passes through concave lens 20 , and enters optical detector 21 . then , information recorded on first optical disk 31 is read - out , and information read - out signals are produced . still further , focal detection and track detection are performed by detecting a change in the amount of light caused by the change of position and the change of shape of specific spot on optical detector 21 , yet further , based on the above - mentioned detection , double shaft actuator 22 moves objective lens 18 in the focusing direction so that the light beam from first semiconductor laser 11 is brought into focus on information recording surface 31 a of first optical disk 31 , and double shaft actuator 22 also moves objective lens 18 in the tracking direction so that the light beam from first semiconductor laser 11 is brought into focus on a predetermined track . the information recording on first optical disk 31 is performed in the same way as mentioned above . next , in case of information reproduction from second optical disk ( cd ) 32 , a light beam is emitted from first semiconductor laser 12 , which is reflected by beam splitter 13 , and passes through beam splitter 14 , quarter wavelength plate 15 , and coupling lens 16 , to become a parallel light beam . the parallel light beam passes through diaphragm 17 , and is converged on information recording surface 32 a by objective lens 18 , through protective substrate 32 b of second optical disk 32 . the light beam is modulated by information pits on information recording surface 32 a and is reflected , passes back through objective lens 18 , diaphragm 17 , coupling lens 16 , and quarter wavelength plate 15 , next , the light beam is reflected by beam splitter 14 , and is given astigmatism by cylindrical lens 19 , after that , passes through concave lens 20 , and enters optical detector 21 . further , information recorded on second optical disk 32 is read - out , and information read - out signals are produced . focal detection and track detection are performed by detecting a change in the amount of light caused by the change of position and the change of shape of the specific spot on optical detector 21 , then , based on the above - mentioned detection , double shaft actuator 22 moves objective lens 18 in the focusing direction so that the light beam from second semiconductor laser 12 is brought into focus on information recording surface 32 a of second optical disk 32 , and double shaft actuator 22 also moves objective lens 18 in the tracking direction so that the light beam from first semiconductor laser 12 is brought into focus on a predetermined track . the information recording on second optical disk 32 is performed in the same way as mentioned above . in case of the above - mentioned reproduction and / or recording on first optical disk 31 , when the refractive indexes of coupling lens 16 and objective lens 18 and the emission wavelength of first optical light source 11 change , due to temperature change of the optical pick - up apparatus , the focal point on information recording surface 31 a changes so that any spherical aberration occurs largely during use of dvds than cds . any spherical aberration is corrected by the diffractive structure arranged on the peripheral area of objective lens 18 so that spherical aberration remains in a range in which reproduction and / or recording on first optical disk 31 can be optimally performed . due to this , when relatively short wavelength laser rays and an objective lens with a high numerical aperture are used , as in the case of dvd usage , it is possible to reduce adverse influence of spherical aberrations , caused by temperature change , during the recording and / or reproduction , and thereby , an optical pick - up apparatus exhibiting high reliability can be realized . next , the present invention will be described in detail below , showing examples 1 and 2 of the optical systems in which the objective lens and the coupling lens are paired , however , the present invention is not limited to these examples . in the present example , the first optical information recording medium is a dvd ( design base wavelength : 655 nm ), and the second optical information recording medium is a cd ( design base wavelength : 785 nm ). the optical systems shown in examples 1 and 2 can be applied to the optical pick - up apparatus shown in fig2 . when the optical surfaces of the objective lens and the coupling lens in the present example are structured to be aspheric surfaces , each aspheric surface has the aspheric shape shown in expression 4 , in which “ z ” is parallel to the optical axis , “ h ” is perpendicular to the optical axis , “ r ” is a paraxial radius of curvature , “ k ” is a cone coefficient , and “ a ” is an aspheric coefficient . the diffractive structure formed on the objective lens is shown by the following expression 5 , using φ b as the optical path difference function , and radian units . example 1 features an optical system in which the light rays , parallel to the optical axis , enter the objective lens from the coupling lens , in both cases of dvd and cd . fig3 ( a ) shows the optical path for dvd usage , and fig3 ( b ) shows the optical path for cd usage . table 1 shows lens data of example 1 . example 2 is the optical system in which the light rays parallel to the optical axis enter the objective lens from the coupling lens , in the case both for dvd and cd . the optical path for dvd usage is the same as that shown in fig3 ( a ), and the optical path for cd usage is the same as that shown in fig3 ( b ). table 2 shows lens data of example 2 . in examples 1 and 2 , spherical aberration , caused by the thickness difference between the protective substrates , is corrected by the ring - shaped diffractive structure formed in the common area for dvd and cd of the objective lens , and the spherical aberration caused by the temperature change is corrected by the ring - shaped diffractive structure formed in the exclusive dvd area . further , temperature characteristics of the objective lens and the temperature characteristics of the whole optical system in example 1 are shown below in table 3 . further , temperature characteristics of the objective lens and temperature characteristics of the whole optical system in example 2 are shown below in table 4 . as shown in tables 3 and 4 , concerning each of the objective lenses in examples 1 and 2 , among the spherical aberration variation amounts of the converged light spot on the information recording surface due to the temperature change δt , the 3rd spherical - aberration variation amount δsa 3 [ λ rms ]/ δt [° c .] and the 5th spherical aberration variation amount δsa 5 [ λ rms ]/ δt [° c .] satisfy the conditions shown by the above - mentioned formulas ( 7 ) and ( 8 ), respectively . further , they satisfy the condition shown by the above - mentioned formulas ( 9 ) and ( 10 ), respectively . further , concerning each of the optical systems in examples 1 and 2 , among the spherical aberration variation amounts of the converging spot on the information recording surface due to the temperature change δt , the 3rd spherical aberration variation amount δsa 3 [ λ rms ]/ δt [° c .] and the 5th spherical aberration variation amount δsa 5 [ λ rms ]/ δt [° c .] satisfy the conditions shown by the above - mentioned formulas ( 1 ) and ( 2 ), respectively . further , they also satisfy the conditions shown by the above - mentioned formulas ( 4 ) and ( 6 ), respectively . setting the height of the rays to be h l ( mm ), when the rays pass through the surface of the diffractive structure of the exclusive dvd area which is adjacent to the common area on the objective lens , setting the height of the rays of the outermost section of the effective light beam to be h h ( mm ), when the rays pass through the surface on which the diffractive structure exists for the exclusive use of dvd , and setting the wavelength to be λ ( mm ), the values ( unit : 1 / mm 2 ) of the expression , shown in following expression 6 using the above - mentioned optical pass difference function φ ( h ) shown in expression 1 , satisfy the conditions of the above - mentioned expressions 2 and 3 for the objective lens and the optical system , respectively . the satisfaction of the condition shown in expression 2 satisfactorily correct the deterioration of the spherical aberration due to temperature change , by the wavelength dependence of the diffractive structure . in tables 1 and 2 , f 1 is the focal length ( mm ) of the objective lens on the information recording surface for a dvd , f 2 is the focal length ( mm ) of the objective lens on the information recording surface for a cd , na 1 is the numerical aperture of the image side of the objective lens for the dvd usage , and na 2 is the numerical aperture of the image side of the objective lens for the cd usage . further , in the above - mentioned tables or figs , “ e ” ( or “ e ”) shows powers of 10 , that is , e - 02 or e - 2 means 10 − 2 . according to the present invention , in the optical pick - up apparatus which performs at least either recording or reproduction for a plurality of information recording media which are of various types , it is possible to provide for a pick - up apparatus and an objective lens for the pick - up apparatus which can correct for the spherical aberration caused by a temperature change in the optical system , when recording or reproduction is performed by shorter wavelength light beams . | 6 |
the present invention relates to backward diodes , as well as to apparatus incorporating them therein . the following description is presented to enable one of ordinary skill in the art to make and use the invention and to incorporate it in the context of particular applications . various modifications to the preferred aspect , as well as a variety of uses in different applications will be readily apparent to those skilled in the art , and the general principles defined herein may be applied to other aspects . thus , the present invention is not intended to be limited to the aspects shown , but is to be accorded the widest scope consistent with the principles and novel features disclosed herein . a band diagram of a conventional implementation of a typical backward esaki diode is shown in fig1 and its current - voltage i ( v ) curve is shown in fig2 . the backward esaki diode includes a conventional heavily doped p - n junction of ge or other semiconductor . the heavy doping bends the valence bands 100 and 102 sufficiently to allow electrons in the n - doped side to tunnel through the relatively thin band - bending region into the p - doped side . if the doping is very heavy on both sides , a negative resistance peak 200 in the i / v curve is produced for positive bias as the electrons tunnel from the n - doped side to the holes in the p - doped side . the vertical arrows in fig1 indicate the direction of the shift of valence band edges 100 and 102 with positive bias . for sufficient positive bias the electron energies are too high for tunneling into the hole states , and negative differential resistance results , as demonstrated by the downward slope 202 with increasing voltage in fig2 . for negative bias , if the doping is high , the band - bending region is short , and electrons from the p - doped side at energies below the fermi level 104 can tunnel from left to right into the n - doped side . this current can be large and increases exponentially with reverse bias , as demonstrated by the i ( v ) curve to the left of the origin 204 in fig2 . if the p - type doping is not too large , the fermi level 104 , in fig1 will be close to the valence band edge on the p - type side 102 . in this situation , there are relatively few hole states for the electrons to tunnel into with forward bias . the peak current of the negative resistance i ( v ) will be small , while the tunneling current in the negative bias direction 204 is relatively unaffected and large , as shown in fig2 . the desirable characteristic is the highly non - linear i ( v ) near zero bias , represented by the origin in the i ( v ) curve shown in fig2 . this characteristic makes the backward diode an extremely useful device for mixing and detecting of rf signals . ge diodes have become established as the most useful semiconductor choice for backward diodes . this is mainly due to the band gap , about 0 . 67 ev , at room temperature , which is small enough so that the amount of tunneling is large for small negative bias . at the same time it is large enough to block normal p - n diode - type thermally activated tunneling over the built - in junction voltage for small positive bias . thus the desirable characteristic of large backward current and small forward current for small bias is achieved . ge is rarely grown with modem epitaxial growth technology such as molecular beam epitaxy ( mbe ) due to the rarity of other ge semiconductor device applications . ingaas in particular , by contrast , has increasing application for type iii - v semiconductor circuits and ingaas epitaxial growth facilities are easily accessible . ingaas grown with lattice match to inp is a natural substitute for ge , as it has a small room temperature band gap of 0 . 75 ev . attempts have been made to grow heavily doped p - n junctions of ingaas in order to duplicate the i ( v ) of a comparison ge diode . although backward diodes were easily achievable , initial results were not as good as the comparison ge diode . either high backward currents or low forward currents could be achieved depending on the particular sample , but not both in the same sample . this problem is attributable to two features . first , the slightly greater band gap of the ingaas reduces the backward current compared to ge . second , ingaas is a direct semiconductor , which causes it to have a significantly smaller density - of - states conduction band effective mass than ge ; 0 . 043 versus 0 . 22 in units of the free electron mass . this means that for a similar n - type doping , the fermi level in ingaas is significantly higher as compared with ge . this results in an extended positive voltage range in which the tunneling current increases , i . e ., a high peak voltage ( see fig2 ), with an undesirable linear i ( v ) near the origin . to overcome this limitation , the ability to tailor the ingaas semiconductor layers on a nanometer scale is required . control of the p - doped side is not as critical as that of the n - doped side due to the high density - of - states effective mass of holes as compared with conduction electrons , so it may be kept as highly doped and homogeneous . in the present invention , a thin , highly doped region in the n - side near the p - n junction is used to increase the local electric field , while a lower doped region further away keeps the fermi level adequately low . this significantly enhances the backward tunneling current , while only moderately increasing the undesirable forward current . the highly doped region must be thin enough so that the fermi level does not re - acquire the value associated with the bulk material with that corresponding doping . fig3 ( a ) and fig3 ( b ) show the results of a simulation of the band profile and carrier concentration profile , respectively , where the p - side is uniform with a doping level of 7 × 10 18 cm − 3 , a 100 å layer n - doped to 1 × 10 19 cm − 3 is present at the junction , and a wide contact layer n - doped with to a doping level of n = 3 × 10 18 cm − 3 produces a sufficiently low fermi level for the contact layers . the effect of the 100 å region can be seen in the band profile in that it steepens the voltage drop at the junction and thereby increases the electric field . the fermi level relative to the conduction band is slightly increased , but not significantly . the plot of the concentration versus distance shows a corresponding increase in the number of conduction electrons in the added thin layer . conventional diode manufacturing techniques afford insufficient control to produce a consistent thin layer . therefore , epitaxial - growth techniques such as mbe provide the means for consistent , controlled production of a thin layer . fig4 provides a diagram showing the layer structure of an aspect of the present invention utilizing a thin layer similar to that described relative to fig3 ( a ) and fig3 ( b ). as can be seen from the diagram , the fabrication begins with a substrate 400 of inp n + or other semi - insulating material having a thickness that may be chosen suitable to the particular application . next , a first ingaas layer 402 is deposited and n + doped to generally between 1 × 10 18 to 1 × 10 19 cm − 3 , typically 3 × 10 18 cm − . the thickness of the first ingaas layer is shown in the figure as typically about 5000 å . subsequently , a second , thin and highly n + doped ingaas layer 404 is deposited , with the n + doping level generally between 3 × 10 18 and 3 × 10 19 cm − 3 ; typically 1 × 10 19 . it is important that the doping level of the second ingaas layer is greater than that of the first ingaas layer . the thickness of the second ingaas layer is generally between 25 å and 200 å , typically 100 å . next , a third ingaas layer 406 is deposited with a p + doping generally between 5 × 10 18 and 2 × 10 19 cm − 3 , and typically 1 × 10 19 cm − 3 , and with a thickness generally ranging from from 200 å to over 1000 å , and typically 500 å . subsequently , a fourth ingaas layer 408 is deposited with a p + doping generally ranging from 2 × 10 19 to 5 × 10 9 cm − 3 , and typically 3 × 10 19 cm − 3 and a thickness generally ranging from 100 å to 1000 å , and typically 200 å . finally , the structure is etched to provide the desired electrical isolation and contact regions , and contacts 410 and 412 are deposited onto the structure . note that fig4 provides a cutaway view of what typically is formed as a circular mesa - type structure , and that contact 412 would generally be formed as a ring . utilizing epitaxial - growth techniques such as molecular beam epitaxy ( mbe ) and metal - organic molecular beam epitaxy ( mombe ) to produce the ingaas structure of fig4 allows for improved control over the manufacturing process , resulting in a more consistent diode . without the control afforded by these techniques , tailoring the second ingaas layer in particular would not be feasible . thus , it is important that the second ingaas layer be formed by an epitaxial - growth technique or a method which achieves a similar result . furthermore , although ingaas has been chosen for the material structure of this example , there are other material structures to which it could apply . fig5 and 6 provide measurements from samples including three ingaas fabricated diodes and a ge diode . fig5 provides current - voltage curves generated for each of the samples . fig6 provides pertinent numerical data regarding each of the samples in units contained in the same data as the current - voltage ( i ( v )) diagram of fig5 . in fig6 v v provides the voltage in volts , v , at the local minimum of the valley toward the right hand side of the figure for each samples , j p provides the current in amps / cm 2 at the local maximum of the current peak located near the middle of the chart for each of the samples , r j provides the resistance in ohms , ω , at zero bias , and γ is the curvature coefficient , where γ = ∂ 2 i ∂ v 2 ∂ i ∂ v the last column in fig6 labeled d provides the thickness , in angstroms , å , of a thin ingaas layer with a doping level of 1 × 10 19 cm − 3 corresponding to the ingaas layer 304 of fig3 . of the samples , a conventional diode , 2025 , was fabricated without the thin ingaas layer , providing a curvature coefficient γ of approximately 13 and a low current density of 60 , resulting in a relatively slow operational speed . the best diode with the thin ingaas layer was 2026 , which had a higher current density j p and a lower curvature γ than 2089 , demonstrating the ability to trade off desirable features . sample 2026 also provided a lower resistance r j of approximately 155 ω . it is important to note that these samples are provided merely for illustrative purpose and not to infer any limitations to the present invention . a figure of particular importance for the voltage sensitivity of square law power measurement applications is γ , the i ( v ) curvature divided by the slope . values comparable to the ge diode were obtained . without the extra thin layer , γ was limited to less than 20 . thus , the ingaas diode of the present invention which provides a controllable profile designed to maximize curvature near the origin of the i ( v ) curve is useful for many applications , especially those requiring highly specific characteristics such as detectors . | 7 |
fig1 - 10 are for the purposes of illustrating the preferred embodiments of the present invention and not for limiting the same . the preferred embodiments of the present invention , as will be discussed below and as discussed in the summary of the invention , is generally related to z - pins 10 having a unique configuration . for example , the z - pins 10 may have a cylindrical middle flange section 16 so as to evenly distribute shearing forces . the present invention is additionally generally related to the position of the z - pins 10 within attached layers 12 , 14 , the orientation of the z - pins 10 in relation to an applied force , and a strip 20 to allow the attachment of a wide selection of materials from which the first and second layers 12 , 14 may be manufactured . the following is a brief discussion of the z - pins 10 and its relationship to the two attached layers 12 , 14 . generally , fig1 illustrates a z - pin 10 which has three flange sections 16 . fig2 illustrates the z - pins 10 before it 10 is embedded into first and second layers 12 , 14 , and subsequently , fig3 illustrates the z - pins 10 once they are embedded into the first and second layers 12 , 14 . the flange sections 16 of the z - pin 10 may be radially extending and have arcuately contoured peripheral edges . at least one of the flange sections 16 a of the z - pin 10 may be embedded into the first layer 12 , and at least one of the flange sections 16 b of the z - pin 10 may be embedded into the second layer 14 . the first and second layers 12 , 14 may have a mating surface 18 which is a portion of a surface of the first or second layers 12 , 14 in contact with the radially extending flange sections 16 of the z - pins 10 . referring now to fig4 , a strip 20 is shown which is used to attach the first and second layers 12 , 14 . the attachment of the first and second layers 12 , 14 as shown in fig4 is different compared to the attachment of the first and second layers 12 , 14 shown in fig3 . in particular , fig3 illustrates a plurality of z - pins 10 embedded into the first layer 12 which are subsequently embedded into the second layer 14 . in fig4 , the plurality of z - pins 10 embedded into the first layer 12 are not subsequently embedded into the second layer 14 . rather , they are embedded into the strip 20 , and a plurality of z - pins 10 are embedded into the second layer 14 which are subsequently embedded into the strip 20 . in this way , the plurality of z - pins 10 which are embedded into the first layer 12 and the plurality of z - pins 10 which are embedded into the second layer 14 are subsequently embedded into the common strip 20 to thereby attach the first and second layers 12 , 14 . the advantage of the strip 20 is that a wide range of materials may be attached to each other . for example , the material of the first layer 12 may be of a chemically incompatible material compared to the material of the second layer 14 . in this way , the intermediate strip 20 may isolate the chemical reactivity between the first and second layers 12 , 14 . whereas , in the prior art , the two incompatible materials of the first and second layers 12 , 14 could not be attached to each other , now , the two incompatible materials may be attached to each other . as will be discussed below , the use of various materials in the manufacture of attaching the first and second layers 12 , 14 is advantageous . for example , the failure mode of the attached first and second layers 12 , 14 may controlled such that failure of the attachment between the first and second layers 12 , 14 may be at the z - pins 10 through failure of the z - pin 10 and not at the interface surface 22 of the attached layers 12 , 14 through delamination . the failure of the attached first and second layers 12 , 14 may be preferable at the z - pin 10 because the z - pin 10 may be more easily replacable compared to the layers 12 , 14 . by adding the strip 20 between the first and second layers 12 , 14 , the volume of the attached first and second layers 12 , 14 is increased by the thickness of the strip 20 because the strip 20 must encapsulate the portion of the z - pin 10 which protrudes from the first and second layers 12 , 14 . in this regard , the thickness of the strip 20 may be greater than the sum of the heights of the z - pins 10 externally protruding from respective interface surfaces 22 a , 22 b of the first and second layers 12 , 14 . alternatively , the thickness of the strip 20 may be less than the sum of the heights of the protruding z - pins 10 from respective interface surfaces 22 a , 22 b of the first and second layers 12 , 14 . this embodiment which is illustrated in fig4 shows the z - pins 10 embedded within the first layer 12 offset from the z - pins 10 embedded within the second layer 14 so as to form a more compact attached first and second layers 12 , 14 . in another aspect of the present invention , a longitudinal axis 24 of the z - pins 10 used to attach the first and second layers 12 , 14 may be aligned with an applied force “ f ” which acts upon the first and second layers 12 , 14 . as a preliminary matter , definitionally , the longitudinal axis 24 is located centrally along the length of the z - pin 10 , and the applied force is the sum of all forces acting upon the first and second layers 12 , 14 . the alignment between the applied force and the longitudinal axis 24 of the z - pin 10 aids in controlling the failure mode of the attachment between the first and second layers 12 , 14 by ensuring that the summation of forces acting on the z - pin 10 is only in tension which is preferable over other forces such as torsion and moment . fig5 illustrates z - pins 10 with its longitudinal axis 24 in alignment with the applied force “ f1 .” in particular , the applied force “ f1 ” acts upon the first and second layers 12 , 14 at an angle which is 70 ° from the interface surfaces 22 a , 22 b of the first and second layers 12 , 14 , and accordingly , the longitudinal axis 24 is also oriented within the first and second layers 12 , 14 to be at an angle which is 70 ° from the interface surfaces 22 a , 22 b of the first and second layers 12 , 14 . as such , the z - pin 10 may experience only a tensile force . if the plurality of z - pins 10 had its longitudinal axis 24 perpendicular to the interface surfaces 22 of respective first and second layers 12 , 14 , as shown in fig4 , and the first and second layers 12 , 14 are subjected to a force “ f2 ” at an angle of 70 ° with respect to the interface surfaces 22 of the first and second layers 12 , 14 , then the plurality of z - pins 10 would be subjected to a variety of forces in addition to the tension force such as a shearing force , and a torsion force . hence , the z - pins 10 embedded within the first and second layers 12 , 14 may fail in other modes such as in shear , torsion or moment , whereas , the z - pins 10 having its longitudinal axis 24 aligned with the direction of the applied force “ f ” may fail only in tension . as such , the z - pins 10 having a longitudinal axis 24 aligned with the direction of the applied force have a greater degree of predictability and controllability compared to z - pins 10 having a longitudinal axis 24 misaligned with the direction of the applied force “ f ” subjected upon the first and second layers 12 , 14 . in another aspect of the present invention , instead of a separate and distinct z - pin 10 which attaches the first and second layers 12 , 14 , unitary nubs 26 may be formed as part of the either the first or second layer 12 , 14 , as shown in fig6 and 7 . in fig6 , the nubs 26 are formed as part of the second layer 14 which is a matter of convenience in explaining the various aspects of the present invention . more particularly , the first layer 12 may have mating surfaces 18 to receive the nubs 26 , and the second layer 14 may be manufactured as a unitary structure with the nubs 26 . the second layer 14 may have a plurality of nubs 26 with each nub 26 having at least one radially extending flange section 16 . in this regard , the nubs 26 may be embedded into first layer 12 and received by the mating surfaces 18 of the first layer 12 through the various manufacturing processes described in this specification . additionally , the longitudinal axis 24 of the nubs may be aligned with the applied force . still yet in another aspect of the present invention , the density of the z - pin material may be selected to be lower than the density of the materials of the first and second layers 12 , 14 so as to lower the overall density and weight of the attached first and second layers 12 , 14 and / or strip 20 compared to first and second layers 12 , 14 attached through other means such as welding or adhesive bonding . the advantage of making a structure 28 ( i . e ., attached first and second layers 12 , 14 ) lighter is obvious for many reasons such as reduced fuel consumption if the structure 28 was used on an airplane or car with the added benefit of being strong . in another aspect of the present invention , the shape of the flange sections 16 of the z - pin 10 may be re - contoured so as to more evenly distribute a shearing force that may be loaded onto the z - pin 10 . in particular , the middle flange section 16 may have a cylindrically contoured peripheral edge as shown in fig8 instead of an arcuately contoured peripheral edge as shown in fig3 . in fig3 , the z - pin 10 is embedded within first and second layers 12 , 14 wherein the z - pin 10 has three radially extending flange sections 16 a , 16 b , 16 c . the middle flange section 16 c is shown as being disposed at the interface surfaces 22 a , 22 b of the first and second layers 12 , 14 . the middle flange section 16 c is arcuately contoured at its peripheral edge and defines a width 30 . in contrast , fig8 illustrates a z - pin 10 embedded within the first and second layers 12 , 14 where the middle flange section 16 c of the z - pin 10 is cylindrically configured at its peripheral edge and the middle flange section 16 c is disposed at the interface surfaces 22 a , 22 b of the first and second layers 12 , 14 . in this regard , this z - pin 10 may bear a greater shear force “ f4 ” compared to a z - pin 10 embedded within the first and second layers 12 , 14 wherein the middle flange section 16 c of the z - pin 10 is accurately contoured at its peripheral edge . the reason stems from the shape of the middle flange section 16 c . if middle flange section 16 c is arcuately contoured then the first and second layers 12 , 14 may slip over the arcuate configuration when a shear force is applied to the first and second layers 12 , 14 . in contrast , if the middle flange section 16 c is cylindrically configured then the first and second layers 12 , 14 will exert an evenly distributed force on the cylindrical surface which is capable of bearing a greater shear force compared to the former arcuately configured flange section 16 . in another aspect of the present invention , the depth to which the flange sections 16 are embedded within the first and second layers 12 , 14 may be controlled so as to control the failure mode of the attachment between the first and second layer 12 , 14 . preferably , the flange sections 16 of the z - pin 10 are embedded within the first and second layers 12 , 14 at least to the width 30 of the flange section 16 . this aspect of the present invention is illustrated in fig3 which illustrates a z - pin 10 a having two radially extending flange sections 16 a , 16 b with each flange section 16 a , 16 b being embedded within respective first and second layers 12 , 14 . preferably , each flange section 16 a , 16 b is embedded within respective first and second layers 12 , 14 to a depth equivalent to the width 30 of the flange section 16 . in this regard , the first and second layers 12 , 14 have a greater amount of material which retains the flange sections 16 a , 16 b within the first and second layers 12 , 14 . in another aspect of the present invention , the number of flange sections 16 embedded within the first and second layers 12 , 14 may be adjusted as a function of the strengths of the first and second layers 12 , 14 . as a preliminary matter , definitionally , the strengths of the first and second layers 12 , 14 in conjunction with the z - pin 10 may be associated with a pull out force . the pull out force is the force required to pull the z - pin 10 out from the first or second layers 12 , 14 through delamination of the first or second layers . additionally , the z - pin 10 has an ultimate and / or yield strength . if the ultimate or yield strength of the z - pin 10 is less than the pull out force of the first and second layers 12 , 14 , then the attached first and second layers 12 , 14 will tend to fail at the z - pin 10 itself . if the ultimate or yield strength of the z - pin 10 is greater than the pull out force of the first and second layers 12 , 14 , then the attached first and second layers 12 , 14 will tend to fail at the first or second layers 12 , 14 with the lower pull out force . if the preferred mode of failure is at the z - pin 10 , then additional flange sections 16 formed on distal ends of the z - pin 10 may be embedded within the first and second layers 12 , 14 to increase the pull out force of the first and second layers 12 , 14 to a level greater than a force required to break the z - pin 10 . alternatively , if the preferred failure mode is at the first layer 12 , then the number of flange sections 16 embedded within the first layer 12 may be reduced such that the pull out force of the z - pin 10 from the first layer 12 is lower than the pull out force of the z - pin 10 from the second layer 14 and is lower than the force required to break the z - pin 12 . in another aspect of the present invention , the z - pin material may be selected to have a unique physical characteristic in relation to the physical characteristics of the materials from which the first and second layers 12 , 14 are manufactured . for example , the first layer 12 , second layer 14 and z - pin 20 may be manufactured with materials that have different or equivalent coefficients of thermal expansion ( cte ), hardness , melting temperature , chemical reactivity and density . by way of example and not limitation , to achieve the various unique physical relationships , the first layer 12 , second layer 14 , strip 20 and z - pin 10 may be manufactured from materials selected from the group consisting of plastic , composite , metallic , ceramic , graphite epoxy , thermosetting material and thermoplastic material . in relation to the cte relationship , the cte of the z - pin 10 may be less than the cte of the first and second layers 12 , 14 . in this regard , when the structure 28 comprising the z - pin 10 , first layer 12 and second layers 14 is heated , the z - pin 10 will expand at a slower rate compared to the rate of expansion of the first and second layers 12 , 14 . as such , the z - pins 10 will not exert a force on the mating surface 18 of the first and second layers 12 , 14 . preferably , the cte of the z - pin 10 is equal to the cte of the first and second layers 12 , 14 . in this regard , when the structure 28 is heated , the z - pins 10 will expand or contract at the same rate compared to the first and second layers 12 , 14 . as such , the z - pins 10 maintain a constant pressure between the z - pins and mating surfaces of respective first and second layers . in relation to the hardness relationship , the hardness of the z - pin 10 may be less than the hardness of the first and second layers 12 , 14 . in this way , the z - pin 10 may be drilled out when there is a failure in the z - pin 10 and there are remains of the z - pin 10 within the mating surface 18 of the first and second layers 12 , 14 . in relation to the melting temperature relationship , the melting temperature of the z - pin 10 may be greater than the melting temperature of the first and second layers 12 , 14 . in this regard , the z - pin 10 may be embedded into the first and second layers 12 , 14 through various manufacturing processes which may use heat . for example , the z - pin 10 may be embedded into the first layer 12 through investment casting . in investment casting , the z - pin ( s ) 10 may be embedded in the investment with a portion of the z - pin 10 protruding into the cavity after the wax has been removed therefrom . in this way , the z - pin ( s ) 10 may be embedded within the layer 12 , 14 after the investment material is removed from the casting or layer 12 , 14 . alternatively , the z - pin 10 may be embedded into the first layer 12 through methods such as injection , resin transfer and resin infusion . in relation to the chemical reactivity relationship , the chemical reactivity of the z - pin 10 with various chemicals may be different compared to the chemical reactivity of the first and second layers 12 , 14 with those chemicals . in this regard , the z - pin 10 may be embedded into the first and second layers 12 , 14 through various manufacturing processes which may use a chemical reaction such as resin transfer molding . referring now to fig9 , the same illustrates a z - pin 10 c as described in the &# 39 ; 593 patent . the z - pin 10 c may be embedded into first and second layers 12 , 14 by injecting the z - pin material in a liquid form through a channel 32 formed in one of the layers 12 , 14 . in fig1 , the channel 32 is formed in the first layer 12 . the first and second layers 12 , 14 have mating surfaces 18 configured in the shape of the z - pin 10 c shown in fig9 . the first and second layers 12 , 14 are attached to each other and the mating surfaces 18 of the first and second layers 12 , 14 are aligned with each other . the z - pin material in liquid form in injected into the channel 32 and allowed to fill the mating surfaces 18 of the first and second layers 12 , 14 . thereafter , the liquid z - pin material may be solidified to form the z - pin 10 c within the first and second layers 12 , 14 . this same technique may be used to attached the first and second layers 12 , 14 with z - pins 10 of various shapes and sizes such as the shape of the z - pins 10 shown in fig3 . this description of the various embodiments of the present invention is presented to illustrate the preferred embodiments of the present invention , and other inventive concepts may be otherwise variously embodied and employed . the appended claims are intended to be construed to include such variations except insofar as limited by the prior art . | 1 |
as starting material , standard sponge zirconium with about 40 % recycling material is used , which is at least double melted in a conventional manner . during the ingot manufacture , the alloying elements are added to form zircaloy - 2 or zircaloy - 4 . the manufactured ingot is forged in the beta - phase region , at a temperature of around 1150 ° c ., to dissolve and distribute phases containing silicon . thereafter , a heat treatment at 450 to 500 ° c . may be made for the purpose of precipitating small suicides and secondary - phase particles comprising the alloying elements . this heat treatment may also be omitted . conventional forging to reduce the dimensions of the material is made in the alpha - phase region to prevent the silicides from growing . the forging is reduced additionally by hot rolling for example after preheating at 950 ° c . for 15 minutes or 750 ° c . for 45 minutes to a thickness of about 30 to 20 mm followed by a second hot - rolling operation to a plate thickness of about 6 mm at a maximum temperature of 650 ° c . a 1020 ° c . solution treatment for 5 to 10 minutes followed by rapid cooling may be added at 30 / 20 mm thickness in order to homogenize the alloying elements , such as tin , iron , chromium or nickel . the temperature during the hot - rolling steps is kept relatively low to avoid the growth of silicides and other impurities . thereafter , the substance is cold - rolled in a number of steps down to the finished dimension . between each cold - rolling step , a heat treatment is carried out at about 630 ° c . in a static furnace or 730 ° c . in a continuous furnace . during the finishing beta quenching , a structure which improves the corrosion properties and the ductility is to be achieved . the material is heat - treated by allowing a band of the material to pass through a heat source , for example an infrared lamp , and thus be heated to about 1050 ° c . for about 10 seconds . thereafter , the material is cooled when the band leaves the heating zone . the cooling occurs at a rate of about 25 ° c . per second . the plate material exhibits a microstructure which is characterized by a finely lamellar basketweave structure . the material is heat - treated after the beta quenching at a temperature above 600 ° c . in a static furnace or 700 ° c . in a continuous furnace , and in both cases not above 800 ° c . to manufacture boxes , the plates shall first be bent into u - shape . the bending may be made without preheating of the plate . crossplates for boxes with an internal water cross may be preheated at about 200 ° c . before being bent and embossed . to prevent the risk of cracking during the bending operation , the plates must have a good ductility . the occurrence of even very small cracks in the material leads to the material having to be rejected . microcracks may constitute a problem since they may be difficult to detect . the ductility of the material must thus be sufficiently good to prevent the occurrence of cracking . the bent box halves are joined together by means of tig welding along the respective sides . the box is shaped to obtain the desired straightness and square dimension . the shaping is performed in a conventional manner by fitting the box onto a mandrel of stainless steel , which is true to gauge , and thereafter heating the package to about 600 ° c . since the steel expands more than the zirconium alloy , the dimensions of the mandrel are imparted to the box . | 6 |
fig1 illustrates an example of a power supply according to the present invention . the power supply 10 comprises a primary cell 11 , which is a conventional battery of the type having an anode , a cathode current collector and an electrolyte . the primary cell 11 is further of the type which comprises a passivation layer on a surface of the anode , formed as a result of a chemical reaction between the anode and the electrolyte . in the example shown , the primary cell is a 3 . 6 v lithium thionyl chloride battery . such batteries are particularly suitable for reliably providing power , preferably continuous power ( particularly at low current levels ), to a device for a long duration . such batteries also have a long shelf life , due to the passivation layer , which layer largely prevents self discharge of the battery . although lithium batteries are often designated as long - life batteries , the inventors have found that when connected to a device such as e . g . a machine condition monitor , the battery ( or batteries ) does not always last as long as expected , even at low continuous currents . the reduced battery duration can be due to leakage currents , particularly self discharge which continues to occur during battery operation . as mentioned , the passivation layer largely prevents self - discharge and it is thought that the rate of self discharge increases when the passivation layer breaks down . it has been found that at discharge current densities of less than 10 μa / cm 2 , the passivation layer remains essentially unaffected . as the rate of discharge increases , so does the porosity of the passivation layer , until a level is reached at which the parts of the passivation layer are torn off . this is thought to occur at current densities of around 100 μa / cm 2 and greater . if the battery is then subjected to a much lower rate of discharge ( or if no current is drawn ), a chemical reaction will again take place between the anode and the electrolyte and the passivation layer will be rebuilt . this rebuilding of the passivation layer requires energy and consequently occurs at loss of battery capacity . the present inventors believe that even a spike of current drawn from the primary cell 11 which leads to a discharge current density significantly greater than 10 μa / cm 2 can cause a deterioration in the passivation layer that results in : i . an increase in the self discharge rate of the primary cell and / or ii . a loss of battery capacity after the passivation layer has been repaired . thus , in a power supply according to the invention , the power supply 10 further comprises a current limiter 12 , which prevents the current drawn from the primary cell 11 exceeding a predetermined primary current threshold value and thereby prevents the current density exceeding a value at which the passivation layer starts to break down . the current limiter 12 can be either active , i . e . capable of being regulated , or can be passive , e . g . a resistor . preferably , the primary current threshold value corresponds to a current density of 10 μa / cm 2 or less . more preferably , the threshold value corresponds to a current density of approximately 5 μa / cm 2 or less . the primary current threshold value depends on the battery design . some lithium primary cells have a spiral anode with a relatively high surface area in the region of 14 cm 2 . for this design of lithium battery , the primary current threshold value can be set at ˜ 70 μa , which limits the discharge current density to ˜ 5 μa / cm 2 . using the given example of a 3 . 6 v lithium thionyl chloride battery , the current limiter 12 can suitably be a 50 kω resistor . other commercially available lithium cells have an anode surface area of approximately 6 cm 2 . assuming the same battery voltage , the current limiter 12 can then , for example , be a 100 kn resistor , which sets the primary cell threshold current at 36 μa and limits the discharge current density to ˜ 6 μa / cm 2 . the above calculations are based on the maximum short - circuit current . the primary current threshold can also be set lower than the values calculated above , depending on the power requirement of the application in question . because the passivation layer remains unbroken , the primary cell 11 has an extremely low self - discharge rate , which extends the life of a power supply according to the invention in comparison with conventional power supplies . a power supply according to the invention is therefore suited to long - life applications where it is desirable to delay battery replacement as long as possible ; for example , in the case of a battery for a pacemaker or for an autonomous sensor that is mounted in an inaccessible location . it is envisaged that a power supply according to the invention can achieve a service life of 30 years . for example , commercially available aa - size lithium thionyl chloride batteries with a nominal capacity of ˜ 2 . 6 ah can be used in the invention . assuming 30 years of operation at an average self - discharge loss of 1 % per year , the expected capacity of a power supply according to the invention comprising this type of battery is then 70 % of the nominal capacity : 1 . 82 ah . there are approximately 263000 hours in 30 years , meaning that the battery can supply a continuous current of ˜ 6 . 9 μa for the duration of its 30 - year life . a primary cell current of 6 . 9 μa is sufficient to continuously power e . g . a microprocessor . a power supply according to the invention can therefore supply a continuous low current to a device for an extremely long duration . in some applications , the device powered by a power supply may require a continuous low - level current and have an intermittent need for a current that is higher than the primary cell current . one example of a device with this kind of power requirement is a machine condition monitor comprising a microprocessor , a sensor and a data store . a primary cell current of e . g . 10 μa is sufficient to continuously power the microprocessor and the data store , but a higher load current of e . g . 20 ma is intermittently required to perform measurements . fig2 illustrates an example of a further development of a power supply according to the invention that is suitable for a device as described above . in this example , the power supply 20 comprises a primary cell 21 of a type described with reference to fig1 , i . e . a 3 . 6 v lithium thionyl chloride battery with an anode surface area of 6 cm 2 and a nominal capacity of 2 . 6 ah . the current limiter 22 in the example shown is a 120 kω resistor , meaning that the primary current threshold value is 30 μa , corresponding to a maximum primary current density of 5 μa / cm 2 . according to the further development of the invention , the power supply 20 additionally comprises an energy storage device 23 , suitably a capacitor . the capacitor 23 is configured to be charged using current drawn from the primary cell 21 ( the primary cell current ) and to periodically provide a load current at a magnitude greater than the primary current threshold value . the arrangement is such that the primary cell current never exceeds the primary current threshold value , neither when the primary cell is first put in to operation nor during operation of the device , thereby ensuring a long and reliable service life of the power supply 20 . when the power supply 20 is used to power a machine condition monitor comprising a microprocessor , a data store and a sensor , a continuous current of approximately 10 μa is needed to power the processor and the data store . therefore , around 20 μah / h remains available for charging the capacitor . as the primary cell current charges the capacitor 23 , the voltage across the capacitor will rise with an rc type curve . the efficiency of the power supply circuit could be improved , for example , by using semiconductors in the current limiter . nevertheless , a circuit as described with respect to fig2 , and also with respect to fig1 , has the benefit of simplicity . when the capacitor 23 has charged , it can supply a load current greater than the primary threshold current in short bursts . for example , if the sensor in the machine condition monitor is a strain sensor , a measurement can be performed by drawing a load current of e . g . 20 ma for 10 milliseconds . in the given example , this allows several measurements per hour . furthermore , if the condition monitor is provided with means for wireless transmission of data , a packet of data can be transmitted by drawing a load current of e . g . 25 ma for 100 milliseconds . even at a substantially empty battery condition , the primary cell current is preferably sufficient to provide a small charge surplus to charge the capacitor 23 , for example if a processor drawing part of the primary cell current is in a sleep state . the time required to provide a desired amount of charge to the capacitor 23 will depend upon the energy level of the primary cell 21 . if this time exceeds a preset limit , the device may indicate impending depletion of the primary cell , for example by transmitting an end of battery life indication . a processor , for example a microcontroller , of the device may determine when it should become active for the first time , for example using a brown out circuit . the processor may use a sleeping mode to conserve power ; it may be configured to wake up to : carry out housekeeping tasks ; and / or carry out a sensing and / or transmission task when sufficient power is available from the energy storage device 23 . one benefit of the illustrated embodiment is that some battery power is always available , for example , at a current of at least about 10 μa . continuous availability of battery current may be used to ensure that the processor state and / or memory contents are secure at all times . this may avoid the need for non - volatile memory which generally requires a lot of energy for writing data into it . the processor may be configured to optimise use of the power available ; it may be configured to control the frequency or point in time at which a component requiring a load current is in operation . the periodic provision of the load current may be controlled or programmed , for example by a processor ; this may be used to control the time and / or conditions at which the load current is made available , as opposed to the load current being drawn simply upon demand from a power consuming device . a number of aspects / embodiments of the invention have been described . it is to be understood that each aspect / embodiment may be combined with any other aspect / embodiment unless indicated to the contrary . moreover , the invention is not restricted to the described embodiments , but may be varied within the scope of the accompanying patent claims . | 7 |
the detailed embodiments of the present invention are disclosed herein . it should be understood , however , that the disclosed embodiments are merely exemplary of the invention , which may be embodied in various forms . therefore , the details disclosed herein are not to be interpreted as limited , but merely as the basis for the claims and as a basis for teaching one skilled in the art how to make and / or use the invention . referring to the drawings , the golf training apparatus takes the general form of a golf ball hitting platform 10 . the platform 10 includes a main support frame 12 having an upper planar support surface 14 . the upper planar support surface 14 is preferably formed of a simulated grass mat 16 which is generally rectangular in shape , approximately 2 ′× 3 ′ in size and formed in one or two sections . the mat 16 is supported by overlapping flanges 18 of the main support frame 12 and is replaceable with another mat if it becomes worn . the underside ( not shown ) of the platform 10 is recessed inwardly for purposes described hereinbelow . one lateral edge of the main support frame 12 is formed with a lowered , or recessed , planar surface 20 and a slotted channel 22 formed by the main support frame 12 and upper flanges 21 in order to receive a selected one of a plurality of teeing area panels 24 . the teeing area panels 24 are interchangeably connected to the main support frame 12 by slidably fitting into the channel 22 such that the teeing panel 24 rests on the planar support surface 20 . preferably , the channel 22 is sized to provide a loose friction fit with the teeing area panel 24 . teeing area panel 24 is a planar simulated grass support surface , which is used as a teeing area for hitting golf balls . fig3 shows a plurality of interchangeable teeing area panels 26 , 28 and 30 which may be used in accordance with the present invention . teeing area panel 26 is a simulated grass , planar support surface having a slot 46 along an outer longitudinal edge 32 to accommodate another accessory as described hereinbelow . teeing area panel 28 is a simulated grass , planar support surface having a bunker board accessory 34 . teeing area panel 30 is a simulated grass , planar support surface having a bunker tray accessory 36 . a knee brace accessory 38 , described in detail hereinbelow , is removably mountable to the main support frame 12 . in addition , an upright wall accessory 40 is removably attachable to the main support frame 12 when used in combination with teeing area panel 26 , as described in detail hereinbelow . it will be appreciated that each of the teeing area panels 24 , 26 , 28 and 30 are identically sized so as to be interchangeable and frictionally fit into the channel 22 . as such , different panels may be used to present a golfer with a variety of simulated conditions such as would be found on a golf course , without departing from the spirit of the present invention . another feature of the practice platform 10 is portability . with this in mind , an edge of the main support frame 12 of the platform 10 is provided with wheel casters 42 . side edges of the platform 10 are provided with handles 44 to enable the platform 10 to be placed upon its side and rolled , for example , from a storage to a use position . referring to fig4 teeing area panel 26 is shown in detail . the teeing panel 26 is generally rectangular in shape and includes a slot 46 along an outer lateral edge 32 for positioning of an upright swing path wall accessory 40 described hereinbelow . preferably , the teeing area panel 26 is provided with a simulated grass , mat surface 48 and may also include an opening 50 to accommodate a conventional rubber driving range tee ( not shown ) which would project upwardly through the opening 50 to present a raised tee upon which a ball may be placed . it will be appreciated that the simulated grass may be short to simulate a fairway cut or it may be longer to simulate rough . fig5 illustrates in detail the second teeing area panel 28 , which is identical in peripheral size to the other panels and fits onto the recessed planar surface 20 on the platform 10 in the same way as described hereinabove . this teeing panel 28 includes an integrally formed bunker board 34 having a slightly concave upper surface 52 . the concave upper surface 52 is designed to accommodate natural sand so that it may be used to simulate a sand trap environment for the execution and practice of sand shots . fig6 shows still another interchangeable teeing area panel 30 in detail . the teeing area panel 30 includes a shallow sand tray 36 . this panel 30 is also interchangeable with the other panels and fits onto the recessed planar surface 20 of the platform 10 . the tray 36 is structured to receive sand so that a golfer may practice sand shots . the platform 10 may be used with several training attachments . fig7 illustrates a swing guide attachment in the form of an upright swing path wall 40 . the upright wall 40 is shaped and positioned to prevent shanking of golf shots caused by a golf ball being hit by the hosel of the club head . the upright wall 40 has one side covered in mat fabric 54 . the upright wall further includes a pair of support brackets 56 extending downwardly from a lower edge 58 thereof . each support bracket includes an aperture 57 shaped and dimensioned to receive a locking bolt 59 which may be passed through the aperture 57 and screwed into holes ( not shown ) formed along the edge of the main support frame 12 to lock the upright wall 40 in position adjacent the hitting area . while a specific attachment structure is disclosed in accordance with a preferred embodiment of the present invention , various attachment structures may be employed without departing from the spirit of the present invention . when properly positioned , the mat surface 54 of the wall 40 prevents outward movement of a club head as it is being swung . by properly locating a ball to be struck , the possibility of a golfer hitting a shanked shot is totally eliminated . fig8 and 9 illustrate a training attachment which serves as a knee brace attachment 38 to prevent a golfer &# 39 ; s knee from moving laterally forward during the execution of a golf shot . the knee brace attachment 38 is formed by three flat planar members 60 configured into a triangle and extending upwardly against a golfer &# 39 ; s leading leg . this prevents the golfer &# 39 ; s leg from moving laterally during the execution of a golf swing and promotes weight shift and a leg turn . the flat planar members 60 of the knee brace attachment 38 is preferably lightweight aluminum . the knee brace attachment 38 has a base 68 , an upright leg 70 formed at 90 ° thereto and an angular support member 72 . the members 60 are attached at 90 °, 60 ° and 30 °, respectively , although these angles may be increased or decreased , depending upon the overall height of the upright knee brace 38 . a soft flexible shock absorbing material 74 , such as a piece of carpet or synthetic turf , is attached to the outer side of the upright leg 70 to form a cushion for the golfer &# 39 ; s leg . the knee brace attachment 38 is mounted to a support bracket 76 by connectors 78 and , in turn , is supported to the main support frame 12 by the support bracket 76 . while a specific attachment structure is disclosed in accordance with the present invention , various attachment structures may be employed without departing from the spirit of the present invention . for example , it is contemplated in accordance with a preferred embodiment of the present invention that the base 68 be formed with multiple holes to permit ready adjustment of the knee brace &# 39 ; s position . fig1 illustrates another training attachment for use in accordance with the present invention . a swing plane attachment 80 is used to train a golfer the proper inside swing plane position a golf club should traverse through the impact area when striking a golf ball . the swing plane attachment 80 is formed of a solid , rectangular reference board 82 preferably having an upper padded surface . referred to fig1 a , the swing plane attachment 80 is pivotally mounted to a bracket 84 shaped and dimensioned for secure attachment to the main support frame 12 of the platform 10 . the bracket 84 is secure to the main support frame 12 by a pair of locking bolts 86 . the swing plane attachment 80 rotates to accommodate all sizes and swing shapes of golfers . using the swing plane attachment 80 , a golfer having an excessive inside - out or outside - in swing plane will be given immediate feedback as the club strikes the padded surface of the rectangular reference board 82 . with this in mind , the reference board 82 is pivotally supported for angular adjustment . specifically , a support bar 83 extends between the bracket 84 and the reference board 82 with a first end 83 a of the support bar 83 being pivotally attached to the bracket 84 and a second end 83 b of the support bar 83 being releaseably secured to the reference board 82 to allow for attachment of the second end 83 b at various points along the reference board 82 . in this way , the support bar 83 may be adjusted along the reference board 82 to facilitate angular adjustment of the reference board 82 . while a specific attachment structure and pivoting structure are disclosed in accordance with the present invention , various attachment and pivoting structures may be employed without departing from the spirit of the present invention . fig1 shows a swing limiter attachment 90 made of a padded cylindrical stop member 92 which is supported and positioned on an l - shaped , upright rod 94 so as to lie across the swing plane . the upright rod 94 is releaseably secured to the main support frame 12 in much the same manner as the upright wall accessory 40 , although a variety of mounting structures may be employed without departing from the spirit of the present invention . preferably , the upright rod 94 is telescoping to allow the height of the stop member 92 to be readily adjusted . the padded cylindrical stop member 92 of the swing limiter attachment 90 acts as a stop to engage the shaft of a golf club as the golfer executes the backswing portion of a golf swing . the padded cylindrical stop member 92 may be placed in various backswing positions to provide feedback to the golfer as to the length of a particular backswing . the teeing panels and attachments described above may be used alone or in combination . for example , a golfer using a simulated grass teeing panel 24 may also use the knee brace 38 , the swing slot guide 80 , the swing limiter 90 and the anti - shank wall 40 at the same time to perfect a golf swing . referring to fig1 to 15 , the platform 10 is designed to be positioned at a variety of support angles by using a pair of support blocks 99 which may be placed on adjacent , inner corners of the support platform to raise a particular edge depending upon the ground angle to be simulated . by selecting the location of the support blocks 99 , it will be appreciated that the platform 10 may be sloped upwardly , downwardly and to either side depending upon the location of the blocks 99 . this enables a golfer to hit golf shots simulating uphill lies , downhill lies , lies where the ball is below the golfer &# 39 ; s feet , and lies where the ball is above the golfer &# 39 ; s feet . the blocks 99 may be of a variety of sizes to simulate a smaller or greater slope of the simulated ground surface . fig1 illustrates a practice platform 10 wherein the elevating blocks 99 are positioned on a forward edge of the practice platform 10 , thereby simulating an uphill lie condition for the golfer . fig1 illustrates a practice platform 10 wherein the elevating blocks 99 are located along a rearward edge of the platform 10 , thereby simulating a downhill lie condition for the golfer . fig1 illustrates a golf practice platform 10 of the present invention using a pair of support blocks 99 which elevate a side of the platform 10 above ground surface to simulate a lie condition where a golf ball is above the feet of a player . fig1 illustrates a practice platform wherein the elevating blocks 99 are located on the opposite side of the platform 10 , thereby simulating a position where a golf ball is below the feet of the golfer . fig1 illustrates a corner 100 of the underside of the platform 10 . the edges 102 of the main support frame 12 cooperate with a corner bracket 104 to locate a supporting block ( not shown ) in position . each corner 100 has the same structure permitting any two corners to be used with supporting blocks to simulate the lie conditions described with reference to fig1 to 15 hereinabove . while various preferred embodiments have been shown and described , it will be understood that there is no intent to limit the invention by such disclosure , but rather , is intended to cover all modifications and alternate constructions falling within the spirit and scope of the invention as defined in the appended claims . | 0 |
fig1 shows an illustrative computing environment 100 in which the present extensible system action for sharing may be implemented that includes a number of users 105 1 , 2 . . . n interacting with respective computing platforms 110 1 , 2 . . . n . the computing platforms 110 may , in this illustrative example , include any of a variety of devices such as desktop and laptop pcs , game consoles , mobile phones , smart phones , personal e - mail devices , personal media players , personal digital assistants , gps ( global positioning system ) devices , tablet computers , digital cameras , and the like . as shown , the users 105 may communicate among each other and interact with various services on the world wide web using public network infrastructure such as the internet 115 . the services in this example include a news service 120 1 , a social networking service 120 2 , photo sharing service 120 3 , and various other services or websites as representatively indicated by reference numeral 120 n . fig2 shows various illustrative functional components 205 that commonly execute on one or more of the computing platforms 110 . it is noted that the components shown in fig2 are not intended to be exhaustive and other components may be supported or executed on a given platform as needed to meet the requirements of a particular implementation . in many cases , the components 205 are implemented using code expressed in software instructions that is stored on one or more machine - readable media , however , the components may also be implemented using firmware , hardware , or various combinations or sub - combinations of software , firmware , and hardware . as shown , the components 205 include applications 210 and an operating system 215 . the applications 210 illustratively include web applications 210 1 , local applications 210 2 , client - server applications 210 3 , and other applications 210 n . the operating system 215 is configured , in this illustrative example , to perform various actions 220 and expose various interfaces 225 . the actions 220 are described in more detail in the text accompanying fig3 . the interfaces 225 may include , for example , drivers to enable the applications 210 to communicate with local capture devices 230 such as a digital camera 230 1 , a web cam , 230 2 , and a scanner 230 n . it is noted that the operating system 215 will not typically be identically configured in each instance of a computing platform 110 . in other words , differences in features , functionalities , structures , and methods implemented by the operating system 215 , among other differences , can be expected according to the needs of a given platform . however , principles of the present system action for sharing may be adapted to various operating systems . that is , the share action may be readily adapted to a variety of operating systems , computing platforms , usage scenarios , and environments . fig3 shows a set of illustrative system actions 220 that may be implemented by the operating system 215 ( fig2 ). as shown , some of the system actions 220 are included in a group ( i . e ., a subset of the system actions 220 ), as indicated by reference numeral 305 , that provides consistent entry points to particular workflows which are exposed to the user 105 via an action space as described in more detail below . these system actions illustratively include share 305 1 , favorite 305 2 , search 305 3 , and other actions 305 n . these actions respectively facilitate a user to implement sharing ; connecting to different devices ; searching ; and performing other actions . this subset 305 of system actions exposed in the action space may typically be invoked by the user 105 from anywhere on the computer at any time . the operating system 215 will typically implement other actions 310 that are outside the scope of the present disclosure . fig4 shows an illustrative arrangement 400 in which discovered content 405 or locally produced / captured content 410 is provided as shared content 415 from the user 105 with sharing endpoints , as collectively identified by reference numeral 420 , as facilitated by the operating system 215 and share action 305 1 . for example , discovered content 405 could be identified by the user 105 when surfing the web , while locally produced / captured content 410 could be captured by a digital camera or produced on the computing platform 110 using applications such as a word processor or drawing application . accordingly , the shared content 415 could include links 415 1 such as html ( hypertext markup language ) links , photographs 415 2 , videos 415 3 , documents 415 4 , and other files of various types as indicated by reference numeral 415 n . as shown in fig5 , the applications 210 can include both source applications 505 and target applications 510 . depending on the desires of a given application developer , an application 210 can be a source application 505 as well as a target application 510 , be one or the other , or be neither a source application nor a target application . to be a source application 505 , an application can simply register that it can provide shareable content in response to the user &# 39 ; s choice to share . such registration may be implemented , for example , as a runtime declaration in which the source application can respectively register and unregister depending on its state at any given instant . for example , in one state , the source application may have content that can be shared , while in another state it lacks such shareable content . in some cases , a source application 505 does not even need to produce the shareable content itself because the operating system 215 can provide content capture using a system option or action such as a screen shot . target applications 510 will also register the content types they can accept so that a filtered list of target applications can be presented to the user 105 during the course of the share workflow as shown in fig6 and described in the accompanying text . typically , such registration may occur when the target application 510 is installed on the computing platform 110 . as shown in fig5 , the operating system 215 essentially acts as a broker ( as indicated by reference numeral 515 ) via invocation of the share action 305 1 to facilitate passing of a reference 520 to the shared content 415 from the source application 505 to the target application 510 . such brokerage advantageously eliminates the need for the source application 505 and the target application 510 to have knowledge of the other . content sharing can be implemented simply through registration of the shareable content types as described above . in addition , by implementing the sharing as a functionality supported by the operating system , the present share action is native to the computing platform in which the operating system installed and , other than installing sharing applications on the computing platform ( which may come preinstalled in some cases ), the user typically will not have to install any special programs or engage in complex configuration settings in order to utilize sharing . furthermore , instantiating the sharing feature in the operating system ensures extensibility to other communication mechanisms that may be developed or implemented in the future so long as they conform to the present sharing paradigm . in this illustrative example , the shared content 415 is referred to by a data bundle reference 520 so that properties and / or metadata ( indicated by reference numeral 525 ) associated with the shared content 415 may also be passed to the target application 510 . such property / metadata 525 may include , for example , the title of the linked webpage or other descriptive data . the reference 520 is received by the operating system 215 and passed to the target application 510 which then reads the data bundle . fig6 shows an illustrative share workflow 600 for enabling the user 105 ( fig1 ) to share content while remaining in context without the need to switch to another application . when working with a source application 505 , the user 105 can open the action space , as indicated by reference numeral 605 , in order to expose the consistent entry points to workflows 305 ( as shown in fig3 and described in the accompanying text ) to the user . in some cases , the action space may be opened using a dedicated hardware key , for example , while in other cases the action space may be opened using a software command , using a predefined gesture such as a finger swipe on a predefined portion of a touchscreen on a computing platform , or it may be automatically opened via an action of a sharing application when it detects that sharing might be desired by the user 105 . the action space will typically graphically display the available system actions , including the share action in this example . the source application 505 may be optionally configured in some cases to enable the user 105 to explicitly specify content to be shared . however , it is noted that such optional configuration may not often be needed because it may be expected that the shared content exposed by the source application can be readily identified without an explicit action from the user 105 . in some cases , for example , the user &# 39 ; s interaction with the source application 505 will provide sufficient context by itself to enable accurate shared content identification . in an alternative implementation , a share button can be hosted by a source application . in this case , sharing can be initiated by the user 105 from within that source application rather than through use of the action space of consistent entry points supported by the operating system . when the user selects the share action , as indicated by reference numeral 610 , a target picker 620 is exposed so that the user 105 can specify a sharing end point 420 ( fig4 ). typically , the user can specify a sharing endpoint by picking a selection from a displayed list of shortcuts ( as described in more detail below ) and target applications 510 ( fig5 ), as indicated by reference numeral 625 . the shortcuts and target applications 510 are filtered by the operating system 215 so that only shortcuts and target applications that are registered to receive the content type provided by the source application 505 are displayed on the target picker 620 . when the user 105 selects the sharing shortcut / target application , the target application 510 will launch its companion application that will present a share screen 630 ( i . e ., ui ) to the user . as shown in fig7 , the operating system 215 will provide a drawing window 705 in which the companion application ( indicated by reference numeral 710 ) can draw its ui . enabling the target application to draw its own ut through the companion application 710 can be expected to further enhance the extensibility of the present share action to future communication applications and mechanisms . in many typical implementations of the share action , the companion application 710 is configured as small , lightweight and focused application that operates quickly with little impact on system resources . returning to fig6 , the share screen 630 may provide a preview of the shared content to the user 105 and ui control objects ( collectively indicated by reference numeral 640 ) that may be utilized , for example , to enable the user to execute the sharing or , in some cases provide annotations , comments , or other input to accompany the shared content . optionally , as indicated by reference numeral 635 , the share screen 630 may also expose an interface to enable the user 105 to choose a particular person to receive the shared content . when the user executes the sharing of the content , as indicated by reference numeral 645 , the share screen 630 provided by the companion application is collapsed and the workflow control is returned to the source application 505 , as indicated by reference numeral 650 . thus , the present share action enables the user 105 to take a few simple steps to share content without having to leave the context provided by the source application 505 . fig8 shows an illustrative ui 800 supported on a display screen 805 of a tablet computer 1103 . while a tablet computer is illustratively shown , it is noted that the ui for other devices could be expected to appear and function in a substantially similar way . the ui 800 includes a set of icons 810 arranged in an action space 815 for launching a set of system actions , one of which is a share action that may be invoked by the user through manipulation of button 820 . in this example , as shown , the action space 815 is located along the right edge of the ui window . however other configurations for the action space may also be utilized according to the needs of a particular implementation . in this example , the user 105 is interacting with a source application 505 that implements an image viewer using a viewer window 825 . the viewer window 825 shows a photograph of a group of pyramids which thus represents the content that the user 105 wishes to share . when the share button 820 is actuated from the action space 815 , the target picker is displayed on the ui 800 as indicated by reference numeral 905 in fig9 . as with the action space 815 ( fig8 ), a graphical configuration of the target picker 905 can vary from what is illustrated . in this example , a thumbnail 910 is displayed to provide a visual confirmation to the user 105 of the selected content to be shared . additional information may also be displayed such as a content title 915 and descriptive information or metadata as indicated by reference numeral 920 . the target picker 905 also displays a list of shortcuts indicated by reference numeral 925 and a list of sharing applications indicated by reference numeral 930 . the presentation of the shortcuts in sharing applications can vary but may typically include an icon and some associated descriptive text . for example , shortcut 935 ( shown in an enlarged view in fig9 ) represents a share action that the user 105 has taken in the past by sharing content that is posted to the user &# 39 ; s wall on a social networking site such as facebook . similarly , a sharing application 940 ( shown in an enlarged view in fig9 ) represents a share action that the user 105 can take to send the selected content to a sharing endpoint using e - mail , which in this case is supported by the hotmail application . the facebook and hotmail target applications are displayed in the target picker 905 because they have registered as being capable of receiving photo content . by comparison , a target application that is not capable of receiving photo content ( for example , a text - based instant messaging application ) would not be displayed by the target picker 905 in this illustrative example . fig1 shows an illustrative workflow 1000 associated with one of the sharing shortcuts 925 ( fig9 ). here , the source application 505 passes shared content to the target application 510 , as indicated by reference numeral 1005 . the target application 510 will in turn report a detailed action about the user &# 39 ; s action to the operating system 215 , as indicated by reference numeral 1010 . the operating system will use the reporting from the target application 510 in order to generate a list of frequently used actions , as indicated by reference numeral 1015 , which may then be used for the sharing shortcuts 925 . fig1 shows a series of ui screens 1105 , 1110 , and 1115 supported by the companion application to the hotmail application shown in fig9 . the companion application is launched when the icon 940 is selected by the user 105 ( fig1 ) and first displays ui screen 1105 to expose a list of recipients 1120 that the user 105 has recently e - mailed . if the intended sharing endpoint is not shown in the list 1120 , then the user 105 can actuate button 1125 to pull up the user &# 39 ; s hotmail address book shown in the ui screen 1110 . in this example , the address book includes the typical icons 1130 to enable the user to locate e - mail addresses alphabetically . accordingly , a number of e - mail addresses 1135 are displayed which , in this case are associated with the letter “ a ” 1140 , as shown in an enlarged view . by working through the address book , the user 105 can pick recipients for the shared content which are confirmed in the ui screen 1115 , as indicated by reference numeral . the companion application may support additional interfaces to enable the user 105 to provide annotations , comments , or other input to accompany the shared content . in this case as indicated by reference numeral 1150 , the user 105 has input a short note into a text entry window that is provided by the companion application . when the user 105 is ready to share the content , the user can actuate the share button 1155 to complete the share action . as shown in the workflow 1200 depicted in fig1 , upon actuation of the share button 1155 , the ui supported by the companion application closes ( as indicated by reference numeral 1205 ) and the target application 510 will upload the data bundle associated with the shared content to the selected sharing endpoint 420 typically as a background process ( as indicated by reference numeral 1210 ). by implementing the uploading as a background process , the user 105 can quickly be returned back to the source application 505 ( fig5 ) so that context of the user experience associated with the source application is maintained . as shown in fig1 , in order to ensure that the background uploading is completed to thus meet the expectations of the user 105 with regard to the behavior of the share action , the identity of a target application 510 that is currently engaged in uploading to a sharing endpoint 420 is added to a list 1305 of processes that are exempt from shutdown via action of the operating system 215 . the associated source application 505 may also be added to the list 1305 . for example , if the target application 510 is reading a large data bundle , it is not interrupted by having the source application get shut down prematurely . the source application 505 and target application 510 are removed from the list 1305 when the uploading is complete . although the subject matter has been described in language specific to structural features and / or methodological acts , it is to be understood that the subject matter defined in the appended claims is not necessarily limited to the specific features or acts described above . rather , the specific features and acts described above are disclosed as example forms of implementing the claims . | 6 |
metal workpieces to be treated in accordance with the method of the invention may be in the widest variety of forms , e . g ., foreign bodies , pipes , rods , wires , sheet metal or strip metal . however , preferred shapes are those which permit uniform mechanical distribution of the film of solution , e . g ., by squeegee - rolling , brushing or centrifuging . the method is particularly easy to use on sheet and strip metal . metals most commonly treated are iron , zinc and aluminum , pure or in the form of alloys , the said metals constituting either the whole workpiece or merely a thin surface layer thereon , e . g ., coatings of al , al - zn or zn on iron . for the application of the treatment according to the invention , the surface of the metal must be clean , since films of oil , for instance , prevent uniform wetting of the surface . coatings of dust and dirt would lead to defective areas of lower quality in the coating after the treatment . the formation of the coating is also impaired by thick layers of oxide , although thin oxide layers , like temper colours or less , are generally acceptable . the essential components of the acid aqueous solutions used according to the invention are chromium iii ions , phosphate ions and finely divided silicic acid ( silica ). the chromium iii ions may be introduced into the solution in the form of chromium iii salts with non - detrimental anions , e . g ., acetate , maleate , or phosphate . introduction is also possible , for example , by reducing chromium vi ions with sugar , starch , methanol , oxalic acid and the like . the phosphate is preferably added in the form of phosphoric acid and / or chromium iii phosphate . satisfactory sources of finely divided silicic acid have been found to be , for example , silicic acid obtained pyrogenically from silicon tetrachloride , and silicic acid precipitated in an aqueous medium from alkali silicates . silicic acid of small grain size is essential since this ensures a uniform stable suspension in the aqueous acid reaction solution . wetting of the metal surfaces may be achieved in any conventional manner , for example , by immersion and subsequent draining , flooding and centrifuging , brushing , spraying with compressed air , &# 34 ; air - less &# 34 ; and also electrostatic , sprinkling , and rolling with structured and smooth rolls running in the same direction or in the opposite direction . the solutions used according to the invention contain the components in amounts such as to produce a residue from evaporation of between 5 and 150 g / l . the film of liquid used for wetting is preferably between 2 . 5 and 25 ml per square meter of workpiece surface . satisfactory technical results may be obtained , for example , with a dried layer weighing between 0 . 03 and 0 . 6 g / m 2 of workpiece surface . the film of solution is then dried on the surface of the metal . although this may be done at room temperature , better results are obtained with a higher temperature , preferably with the specimens at a temperature of between 70 and 300 ° c . the solutions used according to the invention may contain zinc and / or manganese ions as additional components . the quantities of the individual components of the solution are preferably such that the molar ratio cr - iii : po 4 :( acetate and / or maleate ): sio 2 is as 1 :( 0 . 3 to 30 ):( 0 to 5 ):( 0 . 5 to 10 ), and that the molar ratio cr - iii :( po 4 + acetate and / or maleate ) is of the order of 1 :( 0 . 7 to 30 ). zinc ions and / or manganese ions are preferably added in a molar ratio of cr - iii :( zn and / or mn )= 1 :( 0 to 3 ). the method according to the invetnion is now explained by means of the following examples : 2 . 1 g / l . cr - iii ( trivalent chromium ); 48 g / l . po 4 ( phosphate ); 2 . 1 g / l . ch 3 co 2 ( acetic acid ); 10 g / l . sio 2 3 . 6 g / l . cr - iii ; 29 g / l . po 4 ; 3 . 5 g / l . ch 3 co 2 ; 10 g / l . sio 2 5 g / l . cr - iii ; 9 . 7 g / l . po 4 ; 4 . 9 g / l . ch 3 co 2 ; 10 g / l . sio 2 5 g / l . cr - iii ; 9 . 7 g / l . po 4 ; 0 . 9 g / l . ch 3 co 2 ; 15 g / l . sio 2 5 g / l cr - iii ; 9 . 7 g / l . po 4 ; 4 . 9 g / l . ch 3 co 2 ; 20 g / l . sio 2 5 g / l . cr - iii ; 29 g / l . po 4 ; 4 . 9 g / l . ch 3 co 2 ; 10 g / l . sio 2 5 g / l . cr - iii ; 9 . 7 g / l . po 4 ; 4 . 9 g / l . ch 3 co 2 ; 5 . 5 g / l . (: ch - co 2 ) 2 ( maleate ); 10 g / l . sio 2 ( a ) cr - iii : po 4 : ( ch 3 co 2 +(: ch - co 2 ) 2 ): sio 2 = 1 : 1 . 04 : 1 . 4 : 1 . 7 ( b ) cr - iii :( po 4 + ch 3 co 2 +(: ch - co 2 ) 2 )= 1 : 2 . 44 3 . 6 g / l . cr - iii ; 29 g / l . po 4 ; 10 g / l . sio 2 5 g / l . cr - iii ; 9 . 7 g / l . po 4 ; 4 . 9 g / l . ch 3 co 2 ; 10 g / l . sio 2 ; 1 . 7 g / l . zn 5 g / l . cr - iii ; 9 . 7 g / l . po 4 ; 4 . 9 g / l . ch 3 co 2 ; 10 g / l . sio 2 ; 1 . 4 g / l . mn with the exception of example 8 , the cr - iii was introduced into the solutions in the form of basic chromium acetate , the po 4 in the form of thermal phosphoric acid , the sio 2 in the form of pyrogenic finely divided silicic acid , the mn in the form of mno and the zn in the form of zno . the maleic acid was introduced as such . solutions 1 to 10 were applied , by means of a roll - frame with counter - rotating rolls , to sheets of metal previously subjected to alkaline spray degreasing , rinsing in water and squeezing between rubber rolls . the sheets were raised to a temperature of 80 ° c . by placing them for 17 sec . in a 220 ° c . furnace ; they were then raised to a temperature of 200 ° c . by placing them for 90 sec . in a 240 ° c . furnace . the coatings produced weighed between 0 . 1 and 0 . 2 g / m 2 . the color of the coatings on steel was blue - gray and , on aluminum and galvanized steel , grey . the test pieces thus pretreated were coated with an acrylate lacquer and a polyester &# 34 ; coil - coating &# 34 ; lacquer and were tested for adhesion by means of a bend - test and , for resistance to corrosion by means of the astm b 117 salt - spray test . these tests produced technological values showing results , with the method according to the invention , at least equivalent to , and some even rather better than , those obtained with solutions based upon the known cr - vi / cr - iii / sio 2 . | 2 |
although specific embodiments of the invention will now be described with reference to the drawings , it should be understood that such embodiments are by way of example only and are merely illustrative of but a small number of the many possible specific embodiments to which the principles of the invention may be applied . various changes and modifications obvious to one skilled in the art to which the invention pertains are deemed to be within the spirit , scope and contemplation of the invention as further defined in the appended claims . a preferred embodiment of a shaker 1 in accordance with the present invention is respectively shown in diagrammatic perspective , side plan , and top plan views in fig1 - 3 . during operational use the shaker 1 is normally covered with a case ( shown in fig6 ) exposing only ( i ) the control panel ( shown and discussed hereinafter in conjunction with fig6 ) of the motor 15 , and ( ii ) the upwards extending tops , or knobs , or attachment features 181 a , 181 b and 181 b , 182 b of the reciprocating pistons , or oscillating shafts 18 a , 18 b ( as hereinafter discussed ). the shaker 1 , which is built of metal and most commonly aluminum , is based on a substantial and strong rectilinear frame , or stanchion , 11 affixed to a first , or upper , tie plate 12 . this first , upper , tie plate 12 is held in suspension roughly level and equidistant from a second , lower , base plate 13 by springs 14 a and 14 b held on threaded shafts 14 c by spring retainers 14 d . normally four lower springs 14 a , and four upper springs 14 b , are used . two upstanding , left and right , frame portions , or stanchions , 11 a , 11 b are defined . the overall size of the preferred embodiment of a shaker 1 in accordance with the present invention is nominally 10 . 75 ″ w by 17 . 6 ″ d by 12 ″ h — although a practitioner of the mechanical arts will understand that the shaker 1 may be otherwise scaled . a motor 15 is held fixed within the frame 11 , specifically on frame stanchions 11 a and 11 b , and upon the upper base plate 12 by a motor bracket 151 . the motor 15 is preferably alternating current ( a . c .) available as a modified 4910 series motor from gs electronics , carlisle , pa . the motor is controlled by a microprocessor controller ( behind a control panel shown in fig6 ). an accessible control panel ( exposed to the exterior of the case , shown in fig6 and discussed hereinafter ) may be set to operate the motor under any load up to full load from 300 - 6000 revolutions per minute ( rpm ) for nominal durations from 1 to 300 seconds . the motor 15 has oppositely - extending extensions 151 a , 151 b of its central shaft 151 , of which extension 151 a is most clearly visible in fig3 . although the motor 15 has internal bearings , the shaft extensions 151 a , 151 b preferably pass through bearings ( not shown ) in the stanchions 11 a , 11 b of the frame 11 . the preferred bearing is fafnir type sk5pp . the most preferred bearing has an od of 1 . 1250 inches , a bore of 0 . 5000 inches , and a 0 . 312 inch width . each shaft extension 151 a , 151 b ( shaft extension 151 a shown in fig3 shaft extension 151 b not shown ) fits to an associated flywheel 16 a , 16 b ( flywheel 16 a shown in fig1 and 2 , flywheel 16 b not shown ). the flywheels 16 a , 16 b are preferably round , and are concentrically mounted to the associated shaft extensions 151 a , 151 b — although each flywheel 16 a , 16 b has eccentric peripheral weighing . each flywheel 16 a , 16 b affixes a corresponding eccentric post , or crank pin , 161 a , 161 b ( crank pin 161 a shown in fig1 and 2 , crank pin 161 b not shown ). the displacement of the eccentric posts , or crank pins , 161 a , 161 b from the center line of the central shaft 151 determines the magnitude of the oscillation imparted to the sample containers and samples , and this displacement is preferably from ¼ ″ to ½ ″ as imparts an oscillation cycle length from ½ ″ to 1 ″, and is more preferably ⅜ ″ as imparts an oscillation cycle length of ¾ ″. the crank pins 161 a , 161 b are normally sturdy and of substantial , ⅜ ″ diameter , as best suits the substantial forces that they transmit . in accordance with the present invention , the flywheels 16 a , 16 b , although concentrically mounted to shaft extensions 151 a , 151 b , are not mounted so that their eccentric posts , or crank pins , 161 a , 161 b are at the same angular displacement . in fact , the crank pins 161 a , 161 b of the two flywheels 16 a , 16 b are diametrically angularly opposite , with one being bottom dead center , or 180 °, while the other is at top dead center , or 0 °, and vice versa . this angular relationship is shown in fig1 ( and again in fig6 ) where the top 182 a of piston 18 a is maximally elevated simultaneously that the top 182 b of piston 18 b is maximally depressed — as is a direct consequence of this “ out of phase ” positioning of the crank pins 161 a , 161 b on the two flywheels 16 a , 16 b . one of the flywheels 16 a , 16 b — illustrated to be flywheel 16 a — mounts at its periphery an encoder disk 16 c . this encoder disk 16 presents a pattern of alternating light and dark areas , normally 180 such sectors , which can be detected by optical sensor , or interrupter switch 80 that is mounted opposite the rotating encoder disk 16 c on the frame stanchion 11 a ( or 11 b ) of the frame 11 . the electrical signal output of the interrupter switch 80 , which will be further seen in fig7 is a pulse train in respect of the rotation of the encoder disk 16 c , the flywheels 16 a and 16 b , and the motor 15 ; and also of the reciprocating motion of the shaker 1 . a linkage 17 a , 17 b connects the respective crank pins 161 a , 161 b of flywheels 16 a , 16 b to respective pistons 18 a , 18 b . ( linkage 17 a is shown in fig1 and 2 ; linkage 17 b is not shown ). each linkage 17 a , 17 b connects to its respective crank pin 161 a , 161 b though a needle bearing 171 a , 171 b . ( needle bearing 171 a is shown in fig1 and 2 ; needle bearing 171 b is not shown ). the preferred linkage or connecting rod , to crank pin bearing is type av24k40 of the abec - 5t series available from torrington . the preferred bearing has an od of 0 . 5620 inches , a bore of 0 . 3750 inches , and a 0 . 3120 inch width . a wrist pin 172 a , 172 b at the other end of the linkages 17 a , 17 b rotationally connects to the base of the pistons 18 a , 18 b through bearings 181 a , 181 b . ( linkage and wrist pin 172 a are shown in fig1 and 2 ; linkage 17 b and wrist pin 172 b are not shown . neither bearing 181 a , 181 b is shown , but each fits about a respective wrist pin 172 a , 172 b .) the preferred bearings 181 a , 181 b are torrington type b34 having an o . d . of 0 . 343 and i . d . of 0 . 1875 ({ fraction ( 3 / 16 )}) inches each piston 18 a , 18 b is guided for strictly straight - line linear reciprocating motion by a respective linear motion bearing 19 a , 19 b . the preferred motion bearing is type mlf 500 - 875 - 1 available from rotalin of england . this bearing is , and in accordance with the stresses of the shaker of the present invention must be , high performance , and is most preferably a very high performance bearing . both linear motion bearings 19 a , 19 b are firmly mounted in bearing carriers 20 a , 20 b , and to the frame 11 . the tops , or butt ends , of the shafts , or pistons , 18 a , 18 b have and present features 181 a , 182 a and 181 b , 182 b to which the sample containers may strongly attach . the feature 181 a , 181 b is in the form of two oppositely opposed , relieved , areas of the tops , or butt ends , of the shafts , or pistons , 18 a , 18 b which relieved areas are complimentary with a bore in the bottom of each jig fixture 4 , next discussed . the relieved areas at the tops , or butt ends , of the shafts , or pistons , 18 a , 18 b align the fixtures 4 , and keep them from angularly turning . the feature 182 a , 182 b is in the form of a threaded bore into the tops , or butt ends , of the shafts , or pistons , 18 a , 18 b . these threaded bores 182 a , 182 b receive a bolt , or screw ( not shown ) extending from the bottom of each jig fixture 4 , which bolt , or screw , holds each jig fixture 4 , next discussed , removably affixed to a top , or butt end , of a respective shaft , or piston , 18 a , 18 b . two exemplary specimen - container - holding jig fixtures 4 suitable for use with the shaker of the present invention ( as has just been seen and explained ) are shown in perspective view in fig4 . exploded views of a number of externally identical jig fixtures 4 as hold various contents are shown in fig5 . each jig fixture 4 , of which a pair are shown in fig4 and one in each of fig5 a through 5 d , removably mounts to one top 182 a , 182 b of one piston 18 a , 18 b at one time . the jig fixtures preferably so mount by screwing to threaded shaft at the tops 182 a , 182 b of the piston 18 a , 18 b . each jig fixture 4 has a turning radius whereby it may be removed and replaced independently of the other . normally the jig fixtures 4 remain mounted indefinitely and removed only for cleaning , with their contents only being replaced as will be illustrated in fig5 . it will be recognized that the jig fixtures 4 , and the particular jig fixtures 4 that are illustrated , are not integral to the shaker of the present invention , but are illustrated only so as to shown the environment of the invention , and the holding within specimen containers of those samples on which the shaker of the present invention serves to operate . each of the exemplary pair of jig fixtures 4 shown in fig4 is in the substantial shape of rectilinear boxes , and closes shut such as by lid hinges 41 to contain diverse specimens , including specimens as are contained in small test tube and / or micro specimen containers ( not shown in fig4 shown in fig5 ). various embodiments of internal holders , or fixtures , 51 - 54 us usable with , and inside , the single jig fixture 4 , and also with the preferred embodiment of the shaker 1 in accordance with the present invention , are respectively shown in fig5 a through 5 d . the internal holder , or fixture , 51 shown in fig5 a is in the substantial shape of a tray which fits to a complementary recess in the jig fixture 4 . the tray fixture 51 holds , by way of example , small test tubes or containers 61 , as illustrated . the internal holder , or fixture , 52 shown in fig5 b is in the substantial shape of a rack with vertical apertures . the rack fixture 52 holds , by way of example , small test tubes or containers ( not shown ). the internal holders , or fixtures , 53 and 54 respectively shown in fig5 c and 5 d are in the substantial shape of racks with horizontal apertures . these rack fixtures 53 . 54 holds , by way of example , large test tubes or containers , as shown . in all applications the jig fixture 4 in the substantial shape of a rectilinear box is preferably universal , and made of plastic , with an inner holder , or frame , 51 - 54 it suffices to hold diverse containers and test tubes . the internal holders 51 - 54 need not be unique to the shaker 1 of the present invention . a standard laboratory well plate that holds ninety - six ( 96 ) two - milliliter ( 2 ml .) test cells , of a standard well plate that holds four fifteen - milliliter ( 15 ml ). test tubes , can both be used as grid array holders 55 with the shaker 1 of the present invention . yet another holder ( not shown ) holds one single fifty milliliter ( 50 ml .) test tube . it will be recognized that the two pistons , or shafts , 18 a , 18 b of the shaker 1 permit that two jig fixtures 4 , each with an internal holder 51 - 51 , to be used simultaneously . accordingly , the nominal capacity of the shaker is 2 × 96 = 194 two milliliter ( 2 ml .) test cells , or 2 × 4 = 8 fifteen milliliter ( 15 ml .) test tubes , or one fifty milliliter ( 50 ml .) test tube . most generally , the fixtures 4 , 51 - 54 should be considered to be comprised of 1 ) a grid array holder , tailored to hold one or more sample containers of a particular configuration , such as the grid array holder 51 - 54 shown in fig5 . it will be recognized by a practitioner of the mechanical arts that the grid array holder could look quite different depending upon the particular specimen , or sample , containers held . the jig fixtures 4 , 5 - 54 also are also suitable to contain boxes directly holding samples , in contour much like the interior fixture 52 shown in fig5 b . finally , the jig fixtures 4 , 51 - 54 preferably comprise 3 ) an external space frame holding and clamping shut the 2 ) box with the at least one 1 ) grid array holder holding one or more sample containers held within the box . this external space frame is most clearly visible as the hinge 41 in fig4 . in fig4 the external frame is partially combined with the box . the space frame of the jig fixture has and presents an engagement feature complimentary to the engagement feature of the top region of each piston . the jig fixture is thus mountable by its engagement feature to a piston for oscillatory shaking during operation of the shaker . the preferred embodiment of a shaker 1 in accordance with the present invention located within its case 21 is shown in fig6 . the case 1 has an opaque bottom portion 211 that is permanently attached by screws to the base plate 13 ( shown in fig1 ) in the manner of the case of a personal computer . the interior of the bottom portion 211 of the case 21 is lined with airborne and structureborne noise - suppressing tuftane sm polyurethane foam ( not shown ) available as item number tcom24block from architectural surfaces , inc . of chaska , minn . a transparent top portion 212 is removable or , preferably , hinged at hinge joint 213 , to enclose the two jigs 4 as are mounted to the tip ends of the pistons , or shafts , 18 a , 18 b ( not shown in fig6 shown in fig1 - 3 ). an on / off switch 214 , indicators 215 , and a push button control panel 216 permit control of the shaker 1 . the indicators 215 and control panel 216 are in particular connected to a microprocessor ( not shown ) within the case 21 which microprocessor controls , through appropriate power circuitry , actuation of the motor 15 ( now shown in fig6 shown in fig1 ). a block diagram of the preferred embodiment of the shaker 1 in accordance with the present invention , previously seen in fig1 - 6 , is shown in fig7 . external a . c . power 71 is provided through a fuse e stop 72 to phase angle motor drive & amp ; instrumentation power supply 74 . this phase angle motor drive & amp ; instrumentation power supply 74 supplies ( i ) 9 v dc power to the instrumentation and processor controller 75 , and , under control of a main control signal received from the instrumentation and processor controller 75 , ( ii ) power drive to the series wound motor 76 . ( the series wound motor 76 is the drive motor part of the motor 15 shown in fig1 which motor 15 also includes frame and mounting elements .) the instrumentation and processor controller 75 , which is the core of the shaker 1 control , receives inputs from ( i ) an interrupter switch 80 ( as was previously seen in fig1 and 32 , and described in association with these figures ) essentially acting as a tachometer speed sensor 80 . as will be recalled , the interrupter switch , or tachometer speed sensor 80 generates a pulse train , illustrated in fig7 that is respective of the rotation of the shaft ( not shown ) of the series wound motor 76 . the instrumentation and processor controller 75 also receives ( ii ) a binary door open signal responsive to the position of the cover , or transparent top portion 212 previously seen in fig6 and ( iii ) key press signals from a keyboard 77 ( also shown in fig6 ). the instrumentation and processor controller 75 produces outputs to ( i ) display 78 ( also shown in fig6 ), and , as the main control signal , a motor drive control signal to the ( ii ) phase angle motor drive & amp ; instrumentation power supply 74 . a schematic diagram of the instrumentation and processor controller section 75 of the preferred embodiment of a shaker 1 in accordance with the present invention is shown in fig8 a - 8 e . u 3 integrated circuit , 8 bit microprocessor , microprocessor part no . atml / at89c55 - 33jc ( requires programming ) it will be understood by a practitioner of the electrical arts that various additional resistors may attach to various signal lines to perform a “ pull - up ” function , and that various additional capacitors may be used for signal smoothing , all as is routine in consideration of circuit board layout , signal noise environment , etc . considering the schematic diagram of the instrumentation and processor controller section 75 shown in fig8 a - 8 e , although some major signals are traced between drawings sheets , many signals will seen to appear unconnected . a practitioner in the art will recognize that these apparently unconnected signals are all named , and that the names of the signals may readily be located at various places in the schematic . the signals are of course connected , and common , at all points of occurrence , it simply being unwieldy to . trace every signal through all points of its distribution . continuing in the schematic diagram of the instrumentation and processor controller section 75 shown in fig8 a - 8 e , besides power and ground inputs , signal inputs are received at jack j 3 pin 3 ( see fig8 b ) from the tachometer speed sensor 80 ( shown in fig7 ); at jack j 7 ( see fig8 d ) from the door open switch 79 ( shown in fig7 ), and at jack j 6 ( see fig8 e ) from the keyboard 77 ( shown in fig7 ). a further signal bus selectably of the rs - 232c , rs - 422 , or rs - 485 type is presented at jack j 4 ( see fig8 a ). the instrumentation and processor controller section 75 produces outputs ( i ) at jack j 1 pin 3 ( see fig8 a ) as the main control signal to the phase angle motor drive & amp ; instrumentation power supply 74 ( shown in fig7 ), and ( ii ) at jack j 6 ( see fig8 e ) from the keyboard 77 ( shown in fig7 ). the main control signal at jack j 1 pin 3 ( see fig8 a ) is a d . c . signal of 0 to 5 v . d . c . amplitude , which signal serves to control the speed of the drive by the series wound motor 76 ( shown in fig7 ). in operation , and starting at fig8 a , any communication signals from , by way of example , an external computer received at the jack j 1 upon an interface that is programmably controlled to be any of the rs - 232c , rs - 422 , or rs - 485 types is converted to ttl logic levels in level converter / translator u 6 and communicated through the watchdog timer u 7 to the microprocessor u 3 . the watchdog timer u 7 serves to ( i ) monitor power , including so as to ( ii ) guarantee a reset on power up . also shown in fig8 a is the amplification and shaping of the speed signal output from the microprocessor u 3 to produce the main signal output . this process uses an inverted amplifier u 15 f , diode isolation realized by photodiode d 1 , and amplification in power amplifier u 5 . the final signal output is gated by enablement signal ena as amplified by level converter u 15 e and transistor q 1 . the timing parameters for the particular motor in use are contained in eeprom u 9 , readable and writable by microprocessor u 3 , which stores these parameters plus any shaking sequences that are programmed into the shaker 1 ( by use of the keyboard interface , to be discussed ) by its user - operators . for those persons unfamiliar with digitally - based motor control , motor timing parameters essentially relate to how much control signal , translated into motor drive current , must be applied for how long to effect a desired change in the motor and in the shaking rate , for example to increase from 1000 cpm to 2000 cpm . the ability to store user - defined shaking sequences even when the shaker 1 is powered down is one of the features of the present invention . continuing in fig8 b , a quite conventional connection of a microprocessor to its memory is shown therein . namely , microprocessor u 3 communicates through address decoder u 2 to read information from , and write information to , sdram u 4 . of greater interest in fig8 b is the receipt at plug jack j 5 pin 3 of the speed sensor signal from the tachometer speed sensor 80 ( shown in fig7 ). after amplification in inverters u 15 a and u 15 c , the signal is supplied for further use . continuing in fig8 c , the left / upper display u 8 and the right / lower display u 10 , both part of d 78 shown in fig7 are shown therein . these eight - character displays are conventionally addressed by the microprocessor u 3 with and address held in address latch u 1 , and are loaded with data from the microprocessor data bus , all under program control . most typically the left / upper display u 8 presents a prompt for a user - operator input when the shaker 1 is not operating , and the right / lower display u 10 presents the user / operator data as and when entered . when the shaker 1 is operating , the left / upper display u 8 preferably presents the remaining shaking time while the right / lower display u 10 presents the instantaneous shaking rate . also in fig8 c is the jack j 7 where is received the door open signal from the door open sensor 79 shown in fig7 . as indicated by the naming of signal int 0 and int 1 , this signal is distributed , most particularly to the microprocessor u 3 , as an interrupt . the program running in the microprocessor u 3 will , quite naturally , interpret this interrupt to stop any shaking . any re - start after the cover is closed demands user - operator intervention at the keyboard . finally shown in fig8 c is the buzzer buz 1 . the buzzer is primarily used as an audible confirmation ( under program control ) of the press of each key ( as enters control or data ) at the keyboard , but may also , optionally , be used ( still under program control ) as an alarm when , for example , an applied main control signal fails to produce ( after reasonable interval ) motor rotation ( as evidenced by the speed sensor signal ) and shaking . such an error or failure condition might occur if the motor or drive mechanism had failed , or the shaker was jammed . remaining fig8 d and 8 e show the conventional multiplexed selection logic by which a single microprocessor u 3 communicates upon a data bus , in the present case , with three separate addressable components . namely , the microprocessor u 3 can selectively communicate , under program control as translated in the logic of fig8 d and 8 e , with each of two displays u 8 , u 10 seen in fig8 c , and one keyboard 77 ( seen in fig7 ). in particular , both the display 78 and the keyboard 77 ( both seen in fig7 ) are connected to , and through , the plugjack j 6 shown in fig8 e . a flow chart of the software program run in the control microprocessor u 3 , seen in fig8 a and 8 b , or the instrumentation and processor controller section , seen in fig7 of the shaker 1 in accordance with the present invention is shown in fig9 . the control microprocessor u 3 executes this software program upon start - up , and continuously thereafter . the program provides for operator input of parameters at the keyboard 77 ( shown in fig7 ) part of control panel 216 ( shown in fig6 ), storage of these parameters in the volatile memory u 4 ( shown in fig8 b ) and non - volatile memory u 9 ( shown in fig8 a ), and selective activation of the series wound motor 76 ( shown in fig7 ) part of motor 15 ( shown in fig1 ) and the display 78 ( shown in fig7 ) part of control panel 216 ( shown in fig6 ) including , generically , the indicators 215 of control panel 216 ( shown in fig6 ). the actions diagrammed in the flow chart are self - explanatory . accordingly , the best mode presently contemplated for the carrying out of the invention has been described . this description was made for the purpose of illustrating the general principles of the invention , and is not to be taken in a limiting sense . the scope of the invention is best determined by reference to the appended claims . in fact , and in accordance with the preceding explanation , variations and adaptations of the shaker in accordance with the present invention will suggest themselves to a practitioner of the mechanical design arts . for example , there could be more than two shaker trays or containers supported , each on a separate piston connected to a separate linkage to a separate , angularly staggered , point on a camshaft . in other words , the shaker of the present invention could be expanded from being analogous to a two - cylinder engine to a engine of three , four , or even more cylinders . in accordance with these and other possible variations and adaptations of the present invention , the scope of the invention should be determined in accordance with the following claims , only , and not solely in accordance with that embodiment within which the invention has been taught . | 1 |
electrospinning is a well - known method of fabricating thin threads or fibers from dissolved polymers . in one embodiment , the polymer solution ( the “ precursor ” of the nanofibers ) is expressed from a syringe driven by a syringe pump . the solution is forced through a hollow needle and exits as tiny droplets . each droplet immediately traverses a field of high voltage . the potential applied to the solution as it emerges from the needle - tip induces an accumulation of charges on the surface of the droplet , which changes the surface tension of the droplet , causing the surface to “ break ” such that the droplet becomes a jet - stream of charged fibers that can be collected as a charged active matrix , which can build up to form a mat ( bishop et al . 2007 ; bishop et al . 2005 ; sawicka et al . 2006 ; gouma “ sensor materials — us - japan workshop 2004 ; haynes et al . 2008 ; haynes phd dissertation , “ electrospun conducting polymer composites for chemo - resistive environmental and health monitoring applications ,” 2008 ; each of which is herein incorporated by reference in its entirety , together with u . s . pat . no . 7 , 592 , 277 to andrady et al . any surface that is “ at ground ” relative to the potential on a droplet whose surface has just been charged in an electric field can serve as a “ collector ” for the spun fibers . this provides an opportunity to fabricate oil - absorbing mats in situ . adjustments to the properties of the electric field , the concentration of polymer in the precursor solution , the solvent and the polymer used , the pressure and flow - rate of the precursor solution from the needle tip , the distance from needle - tip to collection surface , and ambient conditions ( temperature , pressure , ambient gases ) allow persons of skill in the art to generate fibers of pre - determined thickness at pre - determined rates to build up mats of predetermined density , porosity and thickness . u . s . pat . no . 7 , 901 , 611 to wincheski , incorporated herein in its entirety for all purposes , is exemplary . nanofiber diameters ranging from about 1 micrometer to about 1 nanometer may be useful in certain embodiments of the invention . generally , a range from about 1 micrometer to about 10 nanometers is preferred . a range from about 50 to 500 nanometers is more preferred , and a range from about 100 to 300 nanometers is most preferred . an environment of air comprising gases at about standard partial pressures and temperatures ( 0 - 30 ° c .) is suitable for generating the nanofibers used in embodiments of the invention , but higher temperatures , such as those used for thermoset processes , are not to be excluded . neither are non - standard mixtures of air gases , or gases not normally present in air , or non - standard pressures . as noted above , the hydrophilicity of cellulose acetate and other cellulosic fibers such as cotton promotes water uptake and a concomitant reduction in oleophilicity , together with loss of buoyancy . accordingly , cellulosics tend not to be used to remove oil from water unless they are first treated to substantially increase their hydrophobicity ( u . s . pat . no . 3 , 667 , 982 to marx ; u . s . pat . no . 6 , 852 , 234 to breitenbeck ; u . s . pat . no . 7 , 544 , 635 to liang et al .). surprisingly , the inventors have found that no such treatment is required of the forming nanofibers , the spun nanofibers , or the nanofiber mats to create a buoyant product that does not become waterlogged before it can take up hydrocarbonaceous liquids . this fact obviates all need to consider the expense of substance ( s ) used to treat , the complexity of the treatment , and the environmental or public health implications of the treatment . photocatalytic decomposition of organic pollutants in water is receiving increased attention in recent years because of its reliance on solar energy . specifically , n - type semiconductors , such as titania ( tio 2 ), when illuminated with light having a higher energy than the semiconductor &# 39 ; s band gap , are capable of decomposing organic compounds ( nair et al ., 1993 ). crude oil consists primarily of hydrocarbons , such as alkanes ( e . g . butane , pentane ), cycloalkanes , and aromatic hydrocarbons ( benzene , toluene ). photocatalytic oxidation of crude oil on salt water has been studied by heller &# 39 ; s group ( nair et al ., 1993 ) who used titania pigment for these studies . titania as a photocatalyst absorbs and is excited by light of wavelengths shorter than 387 nm for the anatase polymorph having a 3 . 2 å bandgap ( nair et al ., 1993 ). the underlying physical chemistry of oil decomposition , as explained in detail in reference ( nair et al ., 1993 ) and as presented below , involves the generation of an electron - hole pair for each absorbed photon ( i . e . an electron moving from the valence to the conduction band leaving a hole or “ electron vacancy ” in the former as presented in equation 1 : the diffusion of the hole to the titania particle &# 39 ; s surface , upon reaction with an adsorbed water molecule , produces an oh radical and a proton ( see equation 2 ): equation 3 explains how charge neutrality is maintained during this process ( resulting in the production of hydrogen peroxide ): the hydroxyl radicals then initiate the oxidation of hydrocarbon to carbon dioxide , water , and water - soluble organics ( aldehydes , ketones , phenolates , carboxylates ) products that may “ rapidly biodegrade by marine bacteria ” ( nair et al ., 1993 ), for example see equation 5 , through photocatalytic oxidation , which has been defined as “ a free - radical catalyzed thermodynamically spontaneous process . . . that proceeds at ambient temperature ” ( nair et al ., 1993 ). titania photoassisted oxidation eliminates polycyclic aromatic hydrocarbons ( some of which are known carcinogens ) and also phenols ( products of natural photo - oxidation ) that further decompose to polymeric tars that are difficult to biodegrade ( nair et al ., 1993 ). thus , oxide - based photoassisted oxidation is a most promising route to effective and eco - friendly oil decomposition . the efficiency of the photocatalytic oxidation of anatase particles ( uv collectors ) is reduced by electron - hole recombination and water formation , which slows the rate of solar assisted oxidation ( nair et al ., 1993 ). however , “ approximately 96 . 0 - 97 . 0 % of the sea - level solar irradiance consists of photons that are not sufficiently energetic to promote valence band electrons to the conduction band of tio 2 ( anatase )” air et al ., 1993 ). for this reason , embodiments of the current invention use oxide photocatalysts that absorb in the visible range of solar radiation to improve cleaning efficiency in terms of oil decomposition rate and fast response . wo 3 is a visible - light - responsive photocatalyst for oxygen generation , and has a valence band potential similar to that of titania , suggesting that the “ oxidative ability of a hole on the wo 3 valence band is almost the same as that on tio 2 ” ( chai et al , 2006 ). however , it is known that wo 3 exhibits poor activity as far as the decomposition of organic compounds is concerned ( chai et al , 2006 ). while pd and pt are effective as co - catalysts for the complete photo - degradation of organic compounds under visible light , they are too expensive to be practical for use in environmental remediation . cupric oxide ( cuo ) has been considered as an economical and easy to make alternative for the noble metal co - catalysts ( chai et al , 2006 ) but the art teaches ( arai et al , 2009 ) that , in order for cuo to enhance the photocatalytic activity of wo 3 , the particles of the different oxides need to be in contact with each other . this is impossible to achieve to any useful effect by mixing the powders alone . surprisingly , the inventors have found that such contact — a virtual “ bicrystal ” of cuo and wo3 — can be created by methods disclosed herein . embodiments of the invention combine two synthesis methods to form novel 3d nanogrids of a cuo / wo3 system that performs as a bicrystal . wo 3 sol - gel — polymer , ( preferably either cellulose acetate ( ca ) or polyvinylpyrolidone ( pvp ), is deposited on cu grids by means of electrospinning , followed by thermal treatment ; the latter step oxidizes cu to cuo while crystallizing the amorphous wo 3 so as to form crystalline wo 3 particles . the resulting structure consists of self - supported 3d mats of a 1 : 1 wo 3 and cuo particle configuration in a “ photocatalytic screen ” or “ net ” of high aspect ratio and an extremely high surface area for surface - driven reactions . the “ nanofibers ” comprising the network are lined up clusters of metal oxides but they create a structure that is easy to handle and is strong enough to sustain vibrations and shaking , and stable enough to prevent particle dissolution in ( salt ) water environments . these examples present representative protocols used in describing the invention disclosed herein . these protocols are not to be considered limiting as any analogous or comparable protocol measuring the same end - points within the skill of an ordinary artisan would also be sufficient . cellulose acetate ( mw =˜ 29 , 000 ) precursor solution ( 15 wt %) was prepared in 4 : 6 acetic acid : acetone mixture with 1 hour of ultrasonication . electrospinning was carried out using a 10 ml syringe with a 20 gauge stainless steel needle at applied voltage 19 kv over a distance of 15 cm . the syringe pump was set to deliver the solution at a flow rate of 9 . 6 ml / h and all the spinning was carried out at ambient condition . fig1 is a scanning electron microscopy ( sem ) image of the deposited nanofibers . fig2 is a photograph of an ordinary cotton ball ( on left ) and a cellulose acetate mat ( on right ) weighing about half as much as the cotton ball . benzene was dyed with unisol blue as to help visualize the absorption activity of the cellulose acetate mats . two ml of dyed benzene solution was mixed with 10 ml of water in two vials ( fig3 ). approximately 0 . 4 g of cotton was floated atop the benzene and water mixture at left . approximately 0 . 2 g of matting was floated atop the benzene and water mixture at right . the cotton rapidly sank through the benzene layer into the water below . the matting instantly soaked up the benzene , remained afloat , and held the benzene as shown in the right panel of fig3 . fig4 is a photograph of the recovered cotton ball ( in the dish in foreground on left ) and the recovered cellulose acetate mat . the container in the background at left has retained all of its benzene ; there is no dye in the cotton ball . at the right in fig4 . ( in the dish in foreground ) is the blue - dyed nano - fiber mat recovered from the container in the background . no dyed benzene is evident in the container . the sol gels for the solutions were made by adding water to 1 . 5 g of tungsten isopropoxide ( c 18 h 42 o 6 w ). the hydrolysis was done in a glove box in a controlled atmosphere and the resulting solution was mechanically agitated inside the glove box for 5 minutes . the solution was then ultrasonicated for 2 hours and then aged for 24 hours to ensure complete hydrolysis of the solution . 1 . 5 g of wo 3 sol - gel was mixed with 3 ml of acetic acid and 3 ml of ethanol in a nitrogen - filled glovebox . then the mixed solution was removed from the glovebox and added to 10 % wt / vol polyvinylpyrolidone pvp ( aldrich , mw ˜ 1 , 300 , 000 ) in ethanol , followed by ˜ 30 min of ultrasonic bath . the mixture was immediately loaded into a syringe fitted with 22 gauge needle . the needle was connected to a high voltage power supply and positioned vertically 7 cm above a piece of a copper mesh ( twp inc ., 200 mesh , wire dia . 51 μm ) which acts as a ground electrode . the syringe pump was programmed to dispense 5 ml of pvp solution at a flow rate of 30 μl / min . upon application of a high voltage ( 25 kv ), a solution jet was formed at the needle tip . the solvent evaporated during flight and a nonwoven mat of fibers was deposited on the cu mesh . thermal oxidation of the composite cu mesh - nanofibers was carried out at 500 ° c . for 5 h for complete calcination of pvp . the thermal oxidation process first drives cuo crystals into the pvp nanofibers , which already contain amorphous wo 3 . as the thermal process evolves , crystals of wo 3 form between and among the cuo crystals . at about 500 ° c ., the pvp calcinates as can be seen in the differential scanning calorimeter traces shown in fig8 , leaving a network of “ fibers ” ( fig5 ) made of crystals of wo 3 in contact with crystals of cuo ( fig6 ). this network of metal oxide fibers , or “ nanogrid ,” now has photocatalytic properties . photocatalytic degradation of benzene proceeded in a glass vial ( fig7 ). 2 . 6 ml of dyed benzene ( dyed with unisol blue as , sigma - aldrich ) was poured into each of three vials , synthesized wo 3 / cuo was added to vial ( b ) and tio 2 ( sigma - aldrich , degussa p - 25 ) to vial ( c ). the bottom of each vial was irradiated with light from a xenon lamp ( newport , 300 w ). an am 1 . 5 filter was used solar - light - simulating irradiation , respectively . after 50 h of exposure in full spectrum light , a “ smoky ” residue persists , but little or no benzene remains in vial ( b ), whereas a substantial amount of ( discolored ) benzene remains in vial ( c ). fig5 is an exemplary scanning electron microscopic image of a nanogrid . at the higher resolution provided by the transmission electron microscopic image of nanogrid elements in fig6 , crystals arranged within nanometers of one another can be seen . | 8 |
referring now to the drawings , fig1 and 2 illustrate the recirculating water bath toy and an associated water flow schematic according to one embodiment of the present invention . the water bath toy 10 includes an outer body 12 , a pump system 14 , and an outlet system 16 . the outer body 12 includes an interface portion 20 , a pump housing 22 , a pump inlet 24 ( fig3 ), a battery compartment 26 , and mounting means 28 . the interface portion 20 houses the outlet system 16 including the associated controls . the pump inlet 24 is below the surface of the water and faces the wall of a bath tub or pool when the water bath toy 10 is properly installed . thus the pump inlet 24 is not accessible to a child . the pump inlet 24 may include a screen or other means for preventing objects from being taken up into the pump inlet 24 . the battery compartment 26 is best shown in fig3 and 7 and is a water resistant compartment in the present embodiment . fig4 demonstrates that the shape of the outer body 12 is configured to fit over the wall of a bath tub or pool . the mounting means 28 , shown in fig1 , aid in securing the outer body 12 to the wall of the bath tub or pool . the mounting means 28 may be rubber pads , adhesive pads , suction cups , clamps , or any combination thereof . referring to fig2 , the pump system 14 includes a battery operated pump 30 , a pump inlet line 32 , and a pump outlet line 34 , the pump 30 is powered by batteries in the battery compartment 26 via electrical wires . alternatively , the pump 30 is a hand operated pump . the pump inlet line 32 facilitates fluid communication between the pump inlet 24 and the pump 30 . the pump outlet line 34 facilitates fluid communication between the pump 30 and the outlet system 16 . the pump system 14 further includes a power toggle switch 36 ( fig1 ) that penetrates the outer body 12 . in the present embodiment the power toggle switch 36 is remotely located in relation to the interface portion 20 and the water . referring to fig2 , 5 , and 6 , the outlet system 16 is shown to include a selector valve 38 , a selector valve actuator knob 40 , and a variety of output features 42 . the selector valve 38 includes a valve inlet 44 in fluid communication with the pump outlet line 34 and a plurality of valve outputs 46 configured such that only one of the valve outputs 46 is open at any particular time . each of the valve outputs 46 is in fluid communication with an output feature 42 . the selector valve actuator knob 40 is operable to select which of the valve outputs 46 is open . in the present embodiment , the output features 42 include a wide spray feature 48 having a wide spray nozzle 50 , a narrow spray feature 52 having a narrow spray nozzle 54 , and a waterfall feature 56 having a variety of configurable obstructions 58 . the output features 42 are disposed on the surface 64 a of the front arm 64 . the obstructions 58 engage support holes 60 and may be moved around to change the affect of the obstructions 58 on the water exiting the water bath toy 10 through the waterfall feature 56 . many further output features can be imagined that are within the scope of the invention , for example a directional hose - type outlet . in use , the outer body 12 is mounted on a sidewall of a pool or a bath tub such that the mounting means 28 engages the sidewall . the distal end of front arm 64 of the outer body 12 is partially submerged in water such that the pump inlet 24 is at least partially submerged below water line 62 while outlet system 16 is disposed above water line 62 . such a configuration permits the child to observe the water flowing from outlet system 16 . the back arm 66 is joined to the front arm 64 by connecting arm 68 that joints the arms at their respective ends . the water level 62 or the positioning of the outer body 12 may be adjusted to achieve this . a supervising parent activates the pump 30 by actuating the power toggle switch 36 . fig2 shows that the pump 30 draws water through the pump inlet line 32 and supplies pressurized water to the selector valve 38 via the pump outlet line 34 . a child or supervising parent selects the output feature 42 by turning the selector valve actuator knob 40 to a corresponding position having an appropriate label on the face of the interface portion 20 . the pressurized water travels through the selector valve 38 to the selected output feature 42 . the selected output feature 42 in fig1 is the waterfall feature 56 . the user may arrange the obstructions 58 and observe the affect that different shapes and configurations have on the water flow in the waterfall feature . to ensure the safe use of the bath toy the pump is configured to delivery water at a predetermined rate . this predetermined rate is selected to cause the water to gently trickle out of the outlet feature 42 without substantial pressure . in one embodiment , the rate of water delivery is less than about 200 ml per second . in another embodiment , the rate of water delivery is less than about 100 ml per second . in yet another embodiment , the rate of water delivery is less than about 50 ml per second . graphics that are pleasing to children , such as cartoon characters , comic book characters , and television personalities , may be included on the surface of the outer body 12 . further , pleasing shapes such as cartoon characters may be incorporated into the output features 42 such that the liquid appears to be emitted from the graphic . for example , the graphic may in the shape of an elephant and the water may appear to be emitted from the elephant &# 39 ; s trunk . the graphic may be fixably joined to the outer body using any conventional technique including adhesives or making the graphic monolithic with respect to the outer body . for example , in fig8 , a graphic of an elephant head is disposed over spray nozzle 54 ( see fig5 ) such that water appears to be coming from a hole in the end of the elephant &# 39 ; s trunk . in fig8 , the graphic is monolithic with the interface portion 20 . in the present embodiment , durable and corrosion resistant materials such as high impact plastics and elastomers are used whenever possible . while this invention has been described as having a preferred design , the present invention can be further modified within the spirit and scope of this disclosure . this application is therefore intended to cover any variations , uses , or adaptations of the present invention using the general principles disclosed herein . further , this application is intended to cover such departures from the present disclosure as come within the known or customary practice in the art to which this invention pertains and which fall within the limits of the appended claims . | 0 |
referring now to drawings , various preferred embodiments of the present invention will be described . fig1 shows a structural block diagram of an frs / atm converting function unit according to an embodiment of the present invention . in an upper - half drawing portion of this frs / atm converting function unit , a data conversion along a direction defined from an atm cell format to a frame relay format is carried out . in this figure , reference numeral 401 indicates an atm cell receiving unit , namely corresponding to an interface for receiving an atm cell sent from an atm network . reference numeral 402 shows a data expanding unit . in this data expanding unit 402 , data of an atm cell is expanded , and then , this expanded data is used to constitute frame relay data . reference numeral 403 represents an efci saving unit for extracting an efci ( explicit forward congestion indication ) from atm data to save this extracted efci . the value of this efci is compared with a value of an fecn ( forward explicit congestion notification ) produced from the expanded data derived from the data expanding unit 402 by an fecn producing unit ( in the case of forward direction ) by a comparing unit 406 . then the comparison result is converted into a congestion bit by a congestion bit converting unit 407 . the congestion bit is supplied via the congestion bit converting unit 407 to an hdlc producing unit 412 . it should be noted that the comparing unit 406 contains a mode setting unit 410 . an fecn of a q . 922 - dll frame is set to either “ congestion occurs ” or “ no congestion ” in accordance with a setting mode of this mode setting unit 410 . the function of this mode setting unit 410 will be later discussed more in detail . an abort producing unit 408 owns a function capable of producing an abort signal in the case that such a recognition is made of “ congestion occurs ” based on an efci extracted from an atm cell . in response to this abort signal , a transmission frame is deleted in the hdlc producing unit 412 . also , a becn producing unit 405 owns a function capable of producing a becn ( backward explicit congestion notification ) along a backward direction . a selector ( sel ) has a function capable of selectively sending expanded data derived from the data expanding unit 402 and a conversion result of the congestion bit converting unit 407 to the hdlc producing unit 412 . a buffer amount monitoring unit 414 monitors a buffer state of the data expanding unit 402 to notify the monitored buffer state to a read control unit 413 . in response to the notification issued from this buffer amount monitoring unit 414 and a read reinitiating unit 415 , the read control unit 413 controls the data reading operation from the data expanding unit 402 . on the other hand , in a lower - half drawing portion of this frs / atm converting function unit , a data conversion along a direction defined from a frame relay format to an atm cell format is carried out . a hdlc receiving unit 417 receives an hdlc of frame relay data , and transfers this received hdlc to a data saving unit 418 . the data saving unit 418 extracts congestion information from this frame relay data , and then sends the extracted congestion information to both a becn producing unit 420 and the fecn producing unit 421 . the becn produced from the becn producing unit 420 is supplied to a mode setting unit 426 . in accordance with a mode set by this mode setting unit 426 , an efci is produced from an efci information producing unit 425 , and this efci is inserted into an atm cell . also , a selector ( sel ) 422 selectively supplies the outputs derived from the data saving unit 418 and the becn producing unit 420 to an sar - pdu producing unit 423 . then , finally , such an atm cell to which the congestion information has been set in the above manner is transmitted from an atm cell transmitting unit 424 to an atm network . next , frame structures of the respective layers ( see fig3 ) from a frame relay up to an atm cell employed in this embodiment will now be explained in detail . as indicated in fig5 , with respect to a q . 922 - dll - pdu format , “ 0 ” bit is stuffed in fields other than a flag field ( bit stuffing ). accordingly , after a flag is detected , “ 0 ” located immediately after “ 1 ” continued by 5 octets is a extracted to format it as a frame relay . similar to a header format of an fr - sscs - pdu format ( which will be discussed later ), there are 3 types ( namely , 2 octets , 3 octets , and 4 octets ) of address fields . the format structure of q . 922 - dll - pdu shown in fig5 is such a format structure from which “ 0 ” bit has been deleted . also , the address field shown in this drawing is 2 octets . in this drawing , the congestion information along the forward direction is stored into the fecn ( forward explicit congestion indication ), and the congestion information along the backward direction is stored into the becn ( backward explicit congestion notification ). as illustrated in fig6 , an fr - sscs - pdu format is identical to the q . 922 - dll - pdu format except for the flag , the “ 0 ”- bit stuffing portion , and the fcs . fig7 represents a cpaal5 - pdu format . in the cpaal5 , a variable length frame ( namely , 1 to 65535 - octet lengths ) transmission is performed . as a consequence , in the cpaal5 - pdu format , there are provided a pad ( pad : packet assembly / disassembly ) used to multiply an atm cell by an integer , extracting of a frame portion , and a length field for detecting an error which is not detected by crc - 32 . fig8 represents contents of the respective fields contained in the cpaal5 - pdu . fig9 represents a format of an atm cell . in this drawing , congestion information which is transmitted as efci information is stored into a pti ( payload type identifier ). this pti is arranged by 3 octets . it should be noted that either “ 000 ” or “ 001 ” implies “ no congestion ”, and either “ 010 ” or “ 011 ” implies “ congestion occurs ”. referring now to fig1 to fig1 , congestion information along a forward direction and also a backward direction will be described . in this specification , the following definition is made : with respect to a transmission direction of congestion information , an indication of a congestion condition occurred in an up stream is defined as a “ forward direction ”, whereas an indication of a congestion condition occurred in a down stream is defined as a “ backward ” direction . in this case , it is practically difficult to specify an actually existing congestion point with employment of the feci information , the fecn information , and the becn information . however , it is possible to clarify a direction along which congestion is present . fig1 represents a format direction defined from a frame relay network to an atm network . a fact as to whether or not congestion is present in the upper stream , namely on the side of a frame relay network 205 is transmitted as an fecn of a q . 922 core frame . this fecn information of the q . 922 core frame is converted into an fecn of an fr - sscs ( see fig6 ) by an frs / atm converting function unit ( iwf ) 202 . then , the converted fecn information of the fr - sscs is stored into the efci which is stored into the pti of the atm cell ( see fig9 ), depending upon each of various modes . as a result , it is possible to recognize as to whether or not the congestion is present on the upper stream side ( namely on the frame relay network side ) in the atm network 201 . fig1 indicates a backward direction defined from the frame relay network to the atm network . a q . 922 becn indicative of congestion occurred from the upper stream side ( frame relay network side ) along the backward direction is acquired , and furthermore , an efci of an atm cell arrived from the down stream direction ( atm network side ) is read . as a result , these q . 922 becn and efci of the atm cell are reflected to becn of fr - sscs in accordance with the respective modes , and the congestion information on the down stream side ( atm network side ) can be transmitted . fig1 represents a forward direction defined from the atm network to a frame relay network . a fact as to whether or not congestion is present in the upper stream , namely on the side of the atm network 201 is transmitted as an efci stored in a pti of an atm cell . this efci information is converted into an fecn of an fr - sscs ( see fig6 ) by the frs / atm converting function unit ( iwf ) 202 in combination with the congestion information of the original fecn of the fr - sscs in accordance with the respective modes . furthermore , this converted fecn information is transmitted as an fecn of a q . 922 core frame to the frame relay network 205 side . as a result , it is possible to recognize as to whether or not the congestion is present on the upper stream side ( namely on the atm network side ) in the frame relay network 205 . fig1 indicates a backward direction defined from the atm network to the frame relay network . a becn of an fr - sscs arrived from the down stream direction ( i . e ., frame relay network side ) is read into the frs / atm converting function unit ( iwf ) 202 , and then this becn information is converted into a becn of the q . 922 core frame in accordance with the respective modes . as a result , the congestion information occurred on the down stream side ( frame relay network side ) can be transmitted . in this embodiment , the mode setting units 410 and 426 as explained with reference to fig1 may prepare several modes . in accordance with these modes , a decision is made how congestion information occurred in one network is transferred to another network , depending upon a combination of a group of the above - described frame relay network to atm network and the above - explained atm network to frame relay network , and another group of the above - described forward direction and backward direction . fig1 to fig1 illustratively show types of mode setting operations along the forward / backward directions . mode setting operation of forward direction : frame relay network to atm network fig1 is a flow chart for showing a control sequence in the forward direction defined from the frame relay network to the atm network . in this flow chart , when the frs / atm converting function unit ( iwf ) 202 receives the q . 922 core frame , if the value of fecn information is equal to “ 0 ” ( step 1401 ), namely no congestion occurs on the side of the upper stream ( i . e ., frame relay network side ), then “ 0 ” is set to the fecn value of fr - sscs , and furthermore , “ 0 ” is set to the efci value of the atm cell ( step 1402 ). on the other hand , in such a case that the fecn value of the q . 922 core frame is not equal to “ 0 ” at the above - described step 1401 , three modes are selectable . that is , a first mode ( step 1404 ) corresponds to such a mode similar to the conventional mode . in this first mode , the fecn field of the q . 922 core frame is directly duplicated to the fecn field of fr - sscs without any conditions . however , this value is not reflected to the atm cell . as a consequence , in this first mode , the fecn value of fr - sscs is set to “ 1 ”, and the efci value of the atm cell is set to “ 0 ”. a second mode ( step 1405 ) corresponds to a mode specific to this preferred embodiment . in this specific second mode , the fecn information of the q . 922 core frame is mapped to all of the efci information of the atm cells belonging to this core frame ( namely , converted from this frame ). by using this second mode , the congestion information of the q . 922 core frame will be directly reflected to all of the atm cells . a third mode ( step 1406 ) also corresponds to a mode specific to this preferred embodiment . in this specific third mode , the fecn information of the q . 922 core frame is mapped only to the efci information of the last atm cell belonging to this core frame ( namely , converted from this frame ). by using this third mode , the congestion information is merely processed only in the last atm cell . as a consequence , it is possible to avoid such a problem that the transfer process operation is delayed by executing the cumbersome congestion information processing operation . fig1 indicates the contents of these first to third modes , and fig1 represents the setting conditions of the fecn of fr - sscs and the efci of the atm cells in the respective modes . mode setting operation of forward direction : atm network to frame relay network fig1 is a flow chart for showing a control sequence in the forward direction defined from the atm network to the frame relay network . in this flow chart , when “ 0 ” is set to a value of efci of an atm cell received by the frs / atm converting function unit ( iwf ) 202 ( step 1501 ), a determination is made as to whether or not a value of fecn of fr - sscs is also equal to “ 0 ” ( step 1502 ). when both values are equal to “ 0 ”, “ 0 ” is set to a value of fecn of a q . 922 core frame ( step 1503 ). on the other hand , when only a value of fecn of fr - sscs is equal to “ 1 ”, “ 1 ” is set to a value of fecn of the q . 922 core frame ( step 1507 ). also , when the value of efci of the atm cell is equal to a value other than “ 0 ”, two modes are selectable ( step 1504 ). in a first mode ( step 1505 ), a determination is made as to whether or not a value of efci of the last atm cell corresponding to the q . 922 core frame is equal to “ 1 ” ( step 1505 ). when this value is equal to “ 1 ”, “ 1 ” is similarly set to a value of fecn of the q . 922 core frame ( step 1507 ). in such a case that a value of efci of the last atm cell is not equal to “ 1 ”, “ 0 ” is set to a value of fecn of the q . 922 core frame ( step 1503 ). a second mode ( step 1506 ) corresponds to a mode specific to this preferred embodiment . in the case that an efci field of any atm cell belonging to a segment frame to be received is set to “ 1 ”, “ 1 ” is set to the value of fecn of the q . 922 core frame . also , when the values of efci of any atm cells are equal to “ 0 ”, “ 0 ” is set to the value of fecn of the q . 922 core frame ( step 1503 ). in accordance with this second mode , such information for indicating that the congestion occurs in any atm cell will be reflected to the frame relay network side . fig2 indicates the contents of the mode operations . fig2 shows the set values of fecn of the q . 922 core frame in the respective modes . mode setting operation of backward direction : atm network to frame relay network fig1 is a flow chart for showing a control sequence in the backward direction defined from the atm network to the frame relay network . in this flow chart of fig1 , a determination is made as it to whether or not a value of becn of fr - sscs received by the frs / atm converting function unit ( iwf ) 202 is equal to “ 0 ” ( step 1601 ). when this value of becn of fr - sscs is equal to “ 0 ”, “ 0 ” is similarly set to the value of becn of the q . 922 core frame ( step 1602 ). to the contrary , when the value of becn of fr - sscs is not equal to “ 0 ”, two modes are selectable ( step 1603 ). a first mode ( step 1604 ) corresponds to such a mode that a value of a becn field of fr - sscs is directly duplicated to the q . 922 core frame without any conditions . a second mode ( step 1602 ) corresponds to such a mode that the value of becn of the q . 922 core frame is always set to “ 0 ”. in accordance with this second mode , the congestion information in the backward direction can be neglected . this becomes effective in such a case that the congestion information is not required , depending upon service conditions . fig2 indicates the contents of the mode operations . fig2 shows the set values of becn of the q . 922 core frame in the respective modes . fig1 is a flow chart for showing a control sequence in the backward direction defined from the frame relay network to the atm network . in this mode setting operation , the state transition of either “ congestion occurs ” or “ no congestion ” is judged with providing a protection time period in accordance with the vcc congestion state transition diagram shown in fig4 . a state monitoring operation of this vcc is carried out by a vcc state monitoring unit 416 shown in fig1 . in fig4 , “ no vcc congestion ” is set as an initial setting condition ( step 2601 ). then , when efci = 1 is received ( step 2606 ), the timer t starts its time counting operation ( step 2603 ). while the time counting operation is commenced by this timer t , the present state is moved to “ vcc congestion occurs ” ( step 2604 ). then , when efci = 0 is received by time out ( step 2605 ), or time out is taken place ( step 2606 ), the present state is again moved to “ no vcc congestion ” state . next , in the below - mentioned mode 1 , or mode 3 , the state transition occurs at timing when efci = 1 of a final atm cell . in the below - mentioned mode 2 , or mode 4 , the state transition occurs at timing when efci = 1 of any one of atm cells . in the case that “ vcc congestion occurs ” is found based upon the state transition as explained in fig4 ( step 1701 ), the value of becn of fr - sscs is set to “ 0 ” ( step 1702 ). on the other hand , when there is no congestion of vcc and furthermore such a q . 922 core frame is received , the becn value of which is set to “ 0 ”, the becn value of fr - sscs is set to “ 0 ” ( step 1702 ). in any cases that the becn value of the received q . 922 core frame is equal to any value other than “ 0 ”, modes 1 to 4 can be set . in the first mode , an efci value of an atm cell in a “ last ” segment frame is employed in a vcc congestion transition , and furthermore , the congestion state of vcc is set to “ congestion occurs ”. the final segment frame is received along an atm network to frame relay network direction used in a bi - directional connection . in this case , “ 1 ” is set to the becn value of fr - sscs . a second mode corresponds to such a mode in which a becn value of a q . 922 core frame transmitted along a frame relay network — atm network direction is set , or an efci value of an atm cell in any one of segment frames is employed in a vcc congestion transition , and furthermore , the congestion state of vcc is set to “ congestion occurs ”. this any segment frame is received along the atm network to frame relay network direction used in the bi - directional connection . in this case , “ 1 ” is set to the becn value of fr - sscs . in a third mode , a becn value of a received q . 922 core frame is negligible . then , in this third mode , an efci value of an atm cell in a “ final ” segment frame is employed in a vcc congestion transition , and furthermore , the congestion state of vcc is set to “ congestion occurs ”. the final segment frame is received along the atm network to frame relay network direction used in the bi - directional connection . in this case , “ 1 ” is set to the becn value of fr - sscs . similarly , in a fourth mode , a becn value of a received q . 922 core frame is negligible . then , this fourth mode corresponds to such a mode in which an efci value of an atm cell in any one of segment frames is employed in a vcc congestion transition , and furthermore , the congestion state of vcc is set to “ congestion occurs ”. this any segment frame is received along the atm network to frame relay network direction used in the bi - directional connection . in this case , “ 1 ” is set to the becn value of fr - sscs . as a consequence , in this case , the mode 3 and the mode 4 are additionally provided , by which there is no mutual compatibility between the congestion information in fr - sscs and the congestion information in the q . 922 core frame . as a result , it is possible to select such a flexible transmission system for the congestion information . fig2 indicates the contents of these first to fourth modes , and fig2 represents the setting values of the becn of fr - sscs in the respective modes . | 7 |
the following terms will be used throughout this description and shall have the meaning associated therewith : computer generated object ( cgo ): a computer data structure containing values which describe a geometry and a display attribute . application program ( ap ): a computer process , task , thread of control or job , such as for example a unix process or ums job . association : an identification process whereby a computer data structure , such as an application program identifier , identifies an application program of a cgo . application program identifier ( apid ): a unique computer data structure which correlates to a unique application program . list : a collection of data for at least one cgo and a application program identifier corresponding to the application program responsible for said cgo data . scene : a display of the geometric attributes of at least one cgo wherein the displayed cgo coincides with the cgo data contained in the list . geometric attributes : include , but are not limited to , color , transparency , shininess , line style or fill style . scene manipulation instruction ( smi ): a command to edit , alter or modify the scene , and furthermore , wherein said command edits , alters or modifies at least one cgo or a scene depicting at least one cgo . referring again to the drawings , and more particularly to fig6 there is shown graphics interaction method 600 in accordance with the present invention . as illustrated in fig6 the graphics interaction method 600 includes application program a ( apa ) 602 and application program b ( apb ) 604 . it will be understood by those skilled in the art that the present invention may suitably function with a single application program or a plurality of application programs . but for convenience , the present invention is illustrated and described herein with reference to two application programs . data objects a 606 and data objects b 608 are input to apa 602 and apb 604 respectively . data objects provide information , generally in a digitized format , for processing by an appropriate application program . for example , if data objects a consisted of seismic data and data objects b consisted of well log data , an appropriate application program ( apa ) for processing seismic data would include a seismic interpretation program . an appropriate application program ( apb ) for processing well log data would include a well log interpretation program . once the data objects a 606 and data objects b 608 are received by apa 602 and apb 604 respectively , the data objects are transformed to computer generated object data a and b ( cgoa and cgob ). the process of transforming the data objects a 606 by apa 602 is represented by box 610 . the process of transforming the data objects b 608 by apb 604 is represented by box 610 &# 39 ;. cgo data from 610 and 610 &# 39 ; are input to corresponding cgo output processes represented by boxes 612 and 612 &# 39 ; respectively . output from the cgo output processes 612 and 612 &# 39 ; respectively is transmitted , using transmission methods 622 and 622 &# 39 ;, by conduits 620 and 620 &# 39 ; to a list generating process 624 . such transmission methods 622 and 622 &# 39 ; may be inter - process communication methods such as posix message queue which is known by those skilled in the art to be standard inter - process communication methods . the list generating process 624 generates a list 626 . list 626 stores computer generated object data a and b ( cgoa and cgob ) and the corresponding application program identifier for application program a and b . the application program identifier for application program a and b are represented in list 626 by notations apa &# 39 ; and apb &# 39 ; respectively . as mentioned previously , the present invention may include a plurality of application programs in addition to apa and apb . the notations ( apn &# 39 ;) and ( cgon ) represent the application program identifier and computer generated object data from such additional application programs which could be stored in list 626 . conduit 628 then provides the computer generated object data a and b to a scene generation process 630 . the scene generation process 630 preferably creates a scene in response to the all computer generated object data stored in list 626 . conduit 636 provides output from the scene generation process 630 , i . e ., the scene , to a dimension rendering process 638 . for purposes of the present invention , the dimension rendering process is preferably a 3 - d dimension rendering process . the dimension rendering process 638 transforms the scene into instructions recognizable by a computer display system . such dimension rendering process instructions may further integrate all computer generated object data present in the scene such that the computer display system may display an integrated visual scene . the computer display system instructions are then input via conduit 640 to a computer display system 642 . those skilled in the art will appreciate the requirements for the computer display system 642 . however , generally , an appropriate computer display system may include an operating system ( not shown ) and appropriate operating system software , a display means , such as screen 644 for displaying the scene , and an input instruction means 646 , such as a mouse or light pen , for preferably imputing user instructions to modify , alter or edit the displayed scene . once displayed , the scene may now be modified , altered or edited , preferably by an input instruction selected by a user ( user input event ). as previously discussed the user input event is communicated to the computer display system 642 by the input instruction means 646 . the computer display system 642 communicates , via conduit 648 , the user input event to a user interface process 650 . utilizing user interface methods , the user interface process 650 transforms the user input event into a scene manipulation instruction ( smi ). the preferred user interface methods for use with the present are motif user interface methods , a product of the open software foundation . the smi from the user interface process 650 is communicated , via conduit 652 , to a smi transformation process 654 . as will be discussed in greater detail below , the smi transformation process 654 ultimately converts the smi into a message processable by the application programs . ultimately , in response to such message , one or more affected application programs create new computer generated object data responsive to the user input event . the smi transformation process 654 includes an object identification process 656 . using the smi input to the smi transformation process 654 , the object identification process 656 interrogates the list 626 and identifies the computer generated object data relative to or affected by the user input instruction . in other words , if the user input instruction was to merge b with a by moving only b , the object identification process 656 would interrogate the list 626 , via conduit 657 , at which time the computer generated object data relative to image b would be identified . the smi and identification data for the affected computer generated object are communicated , via conduit 658 , to an application program identification process 660 . using the identification data for the affected computer generated objects , the application program identification process 660 interrogates the list 626 , via conduit 657 , and identifies application program identifiers ( apa &# 39 ; and apb &# 39 ;). the application program identifiers identified by process 660 correspond the application programs of the affected computer generated objects . in this way , the application program identification process can be said to create an association between an affected computer generated object and the application program of the affected computer generated object . the smi , the identification data for the affected computer generated object and the application program identifiers associated with the affected computer generated objects are communicated , via conduit 662 to a message building process 664 . the message building process 664 transforms the input data from the application identification process 660 into discrete messages or sets of instructions . these messages are ultimately routed to and are recognizable by the application programs which correspond to the identified application program identifiers . once constructed , these discrete messages are communicated , via conduit 666 to a message sending process 668 . the message sending process 668 directs each such message to the appropriate application program . in the method illustrated in fig6 messages responsive to the application program 602 are communicated , via conduit 670 , to application program 602 . messages responsive to the application program 604 are communicated , via conduit 670 &# 39 ; to application program 604 . as previously discussed , messages are relayed between processes by conventional inter - process communication methods . for conduit 670 , an inter - process communication method 672 , such as posix message queues , is preferred for conduit 670 &# 39 ; an inter - process communication method 672 &# 39 ;, such as posix message queues , is preferred . however , it will be understood by one skilled in the art that communication between process may be accomplished by other conventional inter - process communication methods . messages via conduits 670 and 670 &# 39 ; are communicated to scene manipulation input processes 614 and 614 &# 39 ; of application programs 602 and 604 respectively . output from input processes 614 and 614 &# 39 ; is communicated to the scene manipulation response processes 618 and 618 &# 39 ;. responsive to and dependent upon the messages imputed by conduits 670 and 670 &# 39 ;, processes 618 and 618 &# 39 ; may cause the retransmission of a new computer generated object from processes 610 and 610 &# 39 ; to corresponding computer generated object output processes 612 and 612 &# 39 ;. the computer generated contents of the list are updated to reflect the new computer generated objects input thereto via conduits 620 and 620 &# 39 ;. conduit 628 provides the new computer generated data to the scene generation process 630 which , via processes previously described , updates the scene responsive to the user input event . it will be clear that the present invention is well adapted to carry out the objects and attain the ends and advantages mentioned as well as those inherent therein . while a presently preferred embodiment of the invention has been described for purposes of this disclosure , changes may be made which will readily suggest themselves to those skilled in the art and which are encompassed within the spirit of the invention disclosed and as defined in the appended claims . | 6 |
at the starting positions which are shown in fig1 and 3 there is obtained in the respective cases , both for the work rolls a 1 / 1 and a 1 / 2 having a third order grind which are used in the new state ( fig1 , 2 ), and for the work rolls a 2 / 1 and a 2 / 2 having a fifth order grind ( fig3 , 4 ), a linear roll - gap contour which ensures optimized flatness for the steel strip s which is being rolled at the time . if differences in the shape of the strip s leaving the roll gap which go beyond the range of tolerances occur or , as a precaution , before each occasion on which a new steel strip is going to be rolled , the work rolls a 1 / 1 , a 1 / 2 or a 2 / 1 , a 2 / 2 , as the case may be , are moved together , as a pair , in the same direction in the manner according to the invention along their axes of rotation l 1 , l 2 in a direction r − or r +. even though the center of the pair of work rolls a 1 / 1 , a 1 / 2 or a 2 / 1 , a 2 / 2 moves relative to the center axis m of the steel strip s when this is done , there is , surprisingly , no disruption ( curving ) of the movement of the steel strip s which would adversely affect its shape . instead , because the shift of the pairs of work rolls a 1 / 1 , a 1 / 2 and a 2 / 1 , a 2 / 2 takes place in parallel , the roll gap maintains its optimum shape which was set in the starting position ( fig1 , fig3 ). the shift of the pairs of work rolls in the same direction follows , in this case , the shift strategy which is shown by way of example in fig5 . what are shown , in the co - ordinate system represented in fig5 , are the shifted positions v 1 - v 53 which were set , in the hot rolling of steel strips s 1 - s 53 respectively which were cast by a strip casting machine of the twin - roller type , for the work rolls which were used in this case , which are not shown in this case and which may for example be shaped to correspond to the work rolls a 1 / 1 , a 1 / 2 and a 2 / 1 , a 2 / 2 which are shown in fig1 - 4 . all the steel strips s 1 - s 53 were of the same width . in fig5 , the position on the abscissa ( the x - axis ) indicates the starting position at which the work rolls were located in the position shown in fig1 and 3 ( the “ 0 ” position of the work rolls ). shown on the ordinate axis ( the y axis ) are the respective shifted positions v 1 - v 53 which the work rolls occupied after respective shifts in a positive direction r + ( pointing to the right in fig1 - 4 ) or a negative direction r − ( pointing to the left in fig1 - 4 ) relative to the starting position . in the case of the shift strategy described here , the work rolls were in each case shifted , in the manner according to the invention , in parallel in the same direction on completion of the hot rolling of one of the steel strips s 1 - s 53 , because after each passage through of a steel strip the state of wear which had been reached was one which made it necessary for there to be an appropriate shift . accordingly , the first steel strip s 1 was hot rolled with the work rolls in the starting position v 1 ( the “ 0 ” position ). on completion of the hot rolling of steel strip s 1 , the work rolls were shifted in the positive direction of shift r + until a first shifted position v 2 was reached . with the work rolls in this shifted position v 2 , steel strip s 2 was rolled in its entirety . basically , it would have been possible , starting from the shifted position v 2 , for a further shift to have been made in the direction of shift r + ( a shift towards the right ). in the present case however , the shifted position v 2 was considered to be a first maximum shifted position at which a first change was made in the direction of shift . accordingly , on completion of the hot rolling of steel strip s 2 , the work rolls were shifted in the direction of shift r −, which was in the negative range of shift relative to the starting position v 1 . the hot rolling of steel strip s 3 took place with the work rolls situated in this shifted position v 3 . because the shifted position v 3 which was in the negative range relative to the starting position ( which was a shift to the left ) was a shorter distance away from the starting position v 1 than the shifted position v 2 reached previously , i . e . was smaller in size than the shifted position v 2 , the work rolls were again shifted in the negative direction of shift r − on completion of the hot rolling of steel strip s 3 until the shifted position v 4 was reached . this latter position was situated at the same distance from the starting position v 1 as the maximum shifted position v 2 which was previously reached in the direction of shift r +. accordingly , after the hot rolling of steel strip s 4 , the work rolls , at the shifted position v 4 , which was now the maximum position for the direction of shift r −, were shifted together in the direction of shift r + until the shifted position v 5 was reached . because this shifted position v 5 was at a distance from the starting position v 1 which was smaller in size than the distance at which the shifted position v 4 reached previously was situated , the work rolls continued to be moved in the direction of shift r +, after the hot rolling of steel strip s 5 had taken place in the shifted position v 5 , until the shifted position v 6 was reached . the distance between this latter and the starting position v 1 was larger in size than the distance between shifted position v 4 and the starting position and a fresh change in the direction of shift was therefore made on completion of the hot rolling of steel strip s 6 , which took place at shifted position v 6 . the procedure elucidated above was continued for steel strips s 7 - s 26 ( shifted positions v 7 - v 26 ). a point which should be noted in this case is that shifted positions v 15 , v 19 , v 21 , v 23 and v 25 of the work rolls at which the steel strips s 15 , s 19 , s 21 , s 23 were hot rolled were the same as the starting position v 1 . when the adjusted position v 26 was reached , the travel of the work rolls in adjustment had reached a maximum value from which the sequence of shift of the work rolls reversed . accordingly , on completion of the hot rolling of steel strip s 26 which took place at shifted position v 26 , the work rolls were first shifted in the direction of shift r − until the shifted position v 27 was reached . this latter coincided with the starting position v 1 . even though it was true that the adjusted position v 27 was already smaller in size relative to the starting position than the adjusted position v 28 , the work rolls continued to be shifted , on completion of the hot rolling of steel strip s 27 at this adjusted position v 27 , in the direction of shift r − to a shifted position v 28 , because the adjusted position v 27 as such did not constitute a maximum value of shift due to its not being at any distance at all from the starting position v 1 . the distance between the shifted position v 28 and the starting position v 1 was the same as the distance between the shifted position v 26 indicating the maximum value of shift and the starting position v 1 . the direction of shift was therefore changed after the hot rolling of steel strip s 28 which took place at the shifted position v 28 . the work rolls were therefore once again shifted in the direction of shift r + until the shifted position v 29 was reached , which once was the same as the starting position v 1 . after the hot rolling of steel strip s 29 at the shifted position v 29 , the work rolls therefore continued to be shifted in the direction of shift r + until the shifted position v 30 was reached . this latter corresponded to the shifted position v 22 and was therefore at a distance from the starting position v 1 which was smaller in size than distance at which the shifted position v 28 was situated . it was therefore considered a maximum shifted position at which a further reversal of the direction of shift took place . the above procedure was continued until the shifted position v 53 was reached , which position coincided with the starting position v 1 and , at it , there no longer appeared to be any purpose in any further shortening of the travel in shift in view of the state of wear of the work rolls . the shifted position v 53 itself constituted a minimum value at which it had to be decided whether the same cycle of shifts as has been described had to be repeated , possibly with different , and in particular shorter , travels in shift but in principle with the same sequence of changes of direction , or whether at least one of the work rolls a 1 / 1 , a 1 / 2 or a 2 / 1 , a 2 / 2 had to be replaced due to its state of wear , which would have been reflected in unacceptably large differences in the shape of the rolled metal strip s . in the case of the shift strategy which has been described above , the adjusted positions v 1 - v 26 which are reached between the starting position v 1 and the shifted position v 26 which represents the maximum value of the shift are arranged , about the shifted position v 27 , with mirror - image symmetry to the shifted positions which are set between the shifted positions v 28 to v 54 , i . e . in the case of the shift strategy which has been explained here , the increase in the size of each of the maximum shifted positions v 2 , v 4 , v 6 , v 8 , v 10 , v 12 , v 14 , v 16 , v 18 , v 20 , v 22 , v 24 , v 26 , which increase starts from the starting position v 1 , takes place in the same way as the reduction in the size of the maximum shifted positions v 28 , v 30 , v 32 , v 34 , v 36 , v 38 , v 40 , v 42 , v 44 , v 48 , v 50 , v 52 , which reduction starts from the adjusted position v 28 and continues until the last shifted position v 53 is reached which indicates the minimum value of the shift . the cycle described above can be repeated until such time as there is a difference in the shape of the metal strip , particularly in the edge regions of the strip , which is outside the permitted tolerances or is undesirable . the travel in shift then has to be shortened in the appropriate way or the cyclic shift has to be stopped completely . the shift strategy which has been described here has proved particularly successful with roll stands which are part of a strip casting or thin slab system . different strategies , and in particular ones in which the increase and decrease in the respective shifted positions which initiate a change in the direction of the shift are not symmetrically arranged in the way described , may be necessary particularly if metal strip of different widths is being rolled in the roll stand . ideally , the complete rolling schedule covered by a rolling campaign is then taken into account in this connection , in the way described in ep 0 953 384 a2 . the wear x on the work rolls has an effect on the results of the rolling and so too does their crowning b which occurs as a result of heating - up and fig6 shows how these effects are compensated for by the shift strategy according to the invention . it should be pointed out in this case that , with the procedure according to the invention , not only is optimized flatness achieved for the steel strip s obtained in the given case but the formation of tight edges k is also avoided . the range of shift e of the work rolls which is traversed by means of the adjustment cycle which has been explained by reference to fig5 is also shown in fig6 . as a comparison , what is shown in fig7 is the strip profile which comes into being with increasing wear x on the work rolls and increasing crowning b of them if no adjustment is made to the work rolls . | 1 |
fig1 shows a known transmission housing 1 , which is connected by means of a flange 3 to a flywheel housing 2 . the transmission housing 1 is divided by further flanges 4 , 5 , 6 into individual housing components or sections 7 , 8 , 9 , 9 a . by means of the flange joints , on the one hand , the housing components are sealed and , on the other hand , the flange joints enable transverse forces and / or torques to be transmitted from one part of the housing to another . in this connection , with a view to more precise details reference is made to the previously mentioned , older application by the present applicant with official file number de 10 2011 003 324 . 6 , whose entire content is subsumed in the disclosure content of the present application . fig2 shows a first example embodiment of the invention for a flange joint 10 , which comprises a first housing component 11 having a first flange 11 a and a second housing component 12 having a second flange 12 a . the flanges 11 a , 12 a are flat and have depressions or recesses 11 b , 12 b distributed around the periphery of the flanges 11 a , 12 a . in this example embodiment the recesses 11 b , 12 b are in the form of blind bores , i . e . of circular - cylindrical shape . between the flanges 11 a , 12 a is arranged a separate insert 13 , which has projections 13 a , 13 b in the form of raised collars or perforations on both sides , i . e . on the side facing the first flange 11 a and on the side facing the second flange 12 a . in this case the insert 13 is a sheet - metal component , i . e . made from a metallic material ; the collars 13 a , 13 b are produced by punching and drawing through , and are therefore formed integrally with the insert 13 . the collars 13 a , 13 b positively engage , without play , in the recesses 11 b , 12 b and thus form an interlocked joint between the first housing component 11 and the second housing component 12 , so that transverse forces and / or torques can be transmitted . thus , the insert 13 acts as an interlocking transmission element between the housing components 11 , 12 . fig3 shows a second example embodiment of the invention for a flange joint 20 between a first housing component 21 having a first flange 21 a and a recess 21 b , and a second housing component 22 having a second flange 22 a and a recess 22 b . between the two flanges 21 a , 22 a is clamped a separate insert 23 which has on both sides projections in the form of protuberances 23 a , 23 b that engage , with interlock , in the recesses 21 b , 22 b . in contrast to the open perforations 13 a , 13 b in the first example embodiment , the protuberances 23 a , 23 b are closed , so that including its projections the insert 23 has an unbroken surface . by virtue of the protuberances 23 a , 23 b the insert transfers transverse forces and / or torques from the first housing component 21 to the second housing component 22 and thus — as in the first example embodiment — it acts as a transmission element . fig4 shows a third example embodiment of the invention for a flange joint 30 , which connects a first housing component 31 having a first flange 31 a and a second housing component 32 having a second flange 32 a . in the first flange 31 a are formed cylindrical recesses 31 b , 31 c in the form of blind bores , and in the second flange 32 a corresponding recesses 32 b , 32 c are formed , which are aligned coaxially with the bores 31 b , 32 c in the first flange 31 a . between the two flanges 31 a , 32 a is clamped a separate insert 33 , which has on both sides projections 33 a , 33 b and 33 c , 33 d respectively opposite one another . the insert 33 consists of a metallic material and the projections 33 a to 33 d are produced by solid deformation such that on both sides of the insert the material is thickened to form cylindrical studs . the solid projections 33 a to 33 d engage , with interlock and without play , in the recesses 31 b 31 c on one side and in the recesses 32 b , 32 c on the other side . as in the previous example embodiments , the insert 33 acts as a transmission element between the two housing components 31 , 32 . fig5 shows a variant of the example embodiment in fig4 , i . e . a fourth example embodiment of the invention for a flange joint 40 between a first housing component 41 and a second housing component 42 , in which recesses 41 b and 42 b are formed . an insert has , in alternation , projections or raised areas 43 a on one side and projections or raised areas 43 b on the other side , which engage respectively , with interlock and without play , in the recesses 41 b of the first housing component 41 and in the recesses 42 b of the second housing component 42 . like the insert 33 in fig4 , the insert 43 is produced by solid deformation so that solid cylindrical studs 43 a , 43 b are obtained . fig6 shows a fifth example embodiment of the invention for a flange joint 50 between a first housing component 51 and a second housing component 52 , between which a separate insert 53 is clamped . the first housing component 51 has a recess in the form of a bore 51 a leading into a threaded bore 51 b which is a threaded blind bore . the insert 53 has a projection 53 a in the form of a raised collar or perforation , which engages with interlock in the bore 51 a . the second housing component 52 has a through - going bore 52 a aligned coaxially with the threaded bore 51 b and the raised collar 53 a , through which a screw - bolt 54 passes . by virtue of the screw - bolt 54 , of which a plurality can be distributed around the circumference of the two housing components , the two housing components are clamped and held together by friction force . in this example embodiment the raised collar or perforation 53 a of the insert 53 has a dual function : on the one hand it acts as an interlock element between the two housing components 51 , 52 ( additional projections as in the previous example embodiments can in this case be omitted ), and on the other hand the perforation 53 a provides a through - passage for the screw - bolt 54 . fig7 shows a section along the plane 7 - 7 in fig6 . the insert 53 is coated on both sides with a sealant 55 , which can be vulcanized to form an elastomer layer on both sides of the insert 53 . to improve the sealing action the insert 53 has bumps or bead - like elevations 53 b , 53 c on both sides . thus , between the housing components 51 , 52 there in formed a joint which is both interlocked and sealed . | 8 |
referring now to fig1 therein is shown the patient , or the person under examination , p , recumbent on the bed 10 comprising a recording mattress 11 and thereupon , most properly a foamed plastic mattress 28 . the patient has normal bedclothes and clothing . the recording mattress 11 comprises two metal plates 12a and 12b of the same size and shape , or equivalent metal nets , rods or gratings , and which serve as antennas . between the metal plates 12a and 12b lies an insulating plate 13 , which serves as insulation between the antenna plates 12a and 12b as well as their mechanical support so that the antenna plates 12a and 12b can be made in the form of comparatively thin films affixed on the surface of the insulating board 13 . the metal plates 12a and 12b have been connected by a shielded lead 14 to a pre - amplifier 17 , which is for instance a conventional differential amplifier of the kind used in ecg techniques , characterized by a high input impedance . as shown in fig1 the differential amplifier 17 has been connected by a shielded cable to the monitoring and recording means 19 . even the smallest movement of the patient p lying on the bed 10 , for instance the adduction of one finger , will cause in the clothing of the patient p , or of the person under monitoring or examination , in the bedclothes and / or in the active layer 29 of the mattress , quantitative and local changes of static charges , which generate potential differences between the antenna plates 12a and 12b , which plates have been placed as close as possible to the patient or to the active layer 29 in view of accomplishing the closest possible coupling between the antenna means 12 and the sources which produce the said change of charges . in the embodiment presented , the active layer 29 consists of two juxtaposed , insulating materials 29a and 29b with different dielectric constants . suitable materials are for instance plastics having mutually different dielectric constants . it is also a characteristic feature of the construction of the active layer 29 : that its courses are able to move with reference to each other , however maintaining their contact . the movement takes place so that the points of contact between the materials change . to this purpose , in the embodiment presented , the layer 29a consists of blister plastic , its air - filled blisters constituting &# 34 ; anti - friction elements &# 34 ; by virtue of which the courses 29a and 29b can move lightly with reference to each other . under the active layer 29 are located the above - described antenna means 12 for measurement of the charge distribution in the active layer . furthermore , the active layer 29 and the antenna means 12 have been inserted in a shield 30 consisting of conductive , flexible material and which is connected to the ground of the measuring amplifier 17 . in practice , the shield 30 may be made of a bag of plastic film metallized on the outside . since the antenna equipment 12 as well may be made of plastic film 13 of which the opposite faces have been provided with metallic films 12a and 12b , the recording mattress can be made thin and foldable . the mode of operation of the recording mattress above described is as follows . the body movements of the patient p are transmitted through the foamed plastic mattress 28 to the active layer 29 , where the materials 29a and 29b of different dielectric , insulating substances are set in motion with reference to each other so that their points of contact vary by effect of the movement . it is well known that this results in the generation of electrical superficial charges of different signs on said material courses 29a and 29b . these superficial charges constitute electrical dipoles , of which the electric fields are transmitted to the antenna means 12 , the signal therefrom obtained being recorded with the aid of the amplifier 17 . the recorded signal conforms to the patient &# 39 ; s movements because the orientation and number of dipoles , and consequently also their fields , vary under effect of the movement . on the other hand , the metallic surfaces of the shield 30 and the antenna plates 12a and 12b form between themselves capacitors , and since the active layer 29 consists of a resilient material , the capacitance of the metal plates on either side thereof will vary , and this causes changes of voltage in the statically charged capacitors . based hereon , the recording mattress of the invention may also be constructed as follows ( fig1 b ). the antenna means 12a , 12b have been so disposed that upon them is an active layer 29 , and these have been placed in a continuous shield 30 which is internally electrically insulating but has been coated with a conductive substance . the active layer 29 is an insulating layer fitting the purpose . the structure will then operate as follows . the antenna means consist , as has been described above , of two mutually insulated , conductive material courses 12a and 12b , which together form a capacitance c . the conductive shield 30 then forms a capacitance c2 with the course 12b and the capacitance c1 with the course 12a . the capacitances c2 and c1 differ in magnitude and , moreover , due to the construction so that c2 is far greater than c1 . upon this structure the foamed plastic mattress 28 is placed , on which the experimental subject p lies down . the subject &# 39 ; s movements are transmitted through the foamed plastic 28 into the arrangement thereinunder so that , first of all , c1 changes because the layer 29 consists of a highly resilient material . with an active layer 29 as shown in fig1 a , the distance of the charged courses from the antenna means 12 and from the bag 30 serving as shield will also change . in addition , the movement gives rise to static charges in the active layer , and to local changes in them . in the case of fig1 b , the capacitance c1 may also be charged by means of an external voltage source , or one may for the insulator 29 use a substance on which the charges have been permanently imposed . by effect of the factors enumerated above , the voltage across the capacitor c1 changes in the first place , and these changes are transmitted to the antenna means and to the capacitor c constituted by them . by the aid of the construction described , the following advantages are gained , among others . the plates 12a and 12b acting as antenna means and which become coupled to the input terminals of the amplifier are symmetrical with reference to external interference fields but they are asymmetric regarding the changes of charge taking place in the active layer 29 . the bag 30 serving as shield transmits the changes of the charge field induced by the movements , to the antenna plates , acting at the same time as an efficient shielding against external interference fields . this protective bag 30 is connected to the ground terminal , or to a potential &# 34 ; guard &# 34 ; terminal , of the measuring amplifier 17 . in fig2 is shown a hospital monitoring and control system applying the means of the invention . this system comprises the patient room 20 , where beds 10a , 10b , 10c etc . provided with antennas of the kind described have been placed , their antennas being connected by cable to the pre - amplifiers 17a , 17b , 17c etc ., and these in turn by shielded cables 18a , 18b , 18c to the monitoring and recording equipment 19 . since it is frequently unavoidable that the patient room 20 is quite far away from the control room 27 , a special electric transmission system must be used between these rooms , wherein modulation is employed and , for instance , the time sharing principle . such systems are known in the art in themselves and their closer description shall therefore be omitted . fig2 displays , of components belonging to this system : a line driver 21 , multiplex 22 , and line receiver 23 . the signals derived from the receiver 23 are conducted to a signal processing means 24 with among other things , a 50 hertz tank circuit and adjustable band pass , which is selected suitably for each particular application ; for instance , in respiration monitoring the band is in the range from 0 . 2 to 3 hz , for the movement pick - up in the night - time it is 0 . 5 to 100 hz . the signal processing circuit may perform , for instance , a frequency analysis of the incoming signal . after the signal processing circuit 24 , the signals are carried to the monitor or recorder 25 , both of which are devices known in themselves in the art . one may use , for monitor 25 : an oscilloscope , conventional recorders , e . g . an ecg recorder . with the monitor 25 has been connected an alarm device 26 , which actuates an alarm for instance in case the patient &# 39 ; s respiration or heart movements stop completely , or if these movements display a remarkable deviation from normal . the alarm device 26 is preferably arranged to be triggered by the signal amplitude e . g . when the respiration amplitude falls below a given limit or the ballistographic undulation falls below a given limit or drops out . triggering of the alarm device is , for instance , on the basis of the pulse display triggered by the ballistographic undulation when this pulse falls below a predetermined limit . fig3 displays three different signals recorded by the method of the invention . the recording a is the unfiltered scsb signal according to the invention , and the figure b presents the same signal after its conduction through a low pass or band pass filter , for instance a filter having its band in the range from 0 . 2 to 3 hz . hereby the undulation caused by the respiratory movements will show up with emphasis in the record . the record reproduced in fig3 c illustrates the principle of ballistographic triggering . in connection with the recording function , a given voltage level l has been set , by default of which the triggering events t1 , t2 , t3 etc . are obtained . the number of such triggerings per unit time is a measure e . g . for the heart rate , and when this quantity falls below a pre - set limit , triggering of the alarm device 26 ensues . the record c in fig3 illustrates the above - described principle of ballistographic triggering in its application in the method of the invention . in fig4 has been illustrated a ballistograph ( record b ) of the invention together with a simultaneous recording ( record a ) obtained with the ecg lead i of prior art . in fig5 have been reproduced several records produced by various movements of the patient p . the record a represents the completely motionless state , whereby the periodic fluctuations visible in this record reflect the vibrations caused by the patient &# 39 ; s heartbeat and breathing . the record a1 duplicates the record a on a larger scale . the record b represents the record produced by the index finger , c that produced by movement of the wrist , d of the ankle , e of the head , f by the patient turning about , g by movement of all fingers , h by shoulder movement , i by movement of the knee , j by isometric contraction , and k by speech . in the following , the claims are stated , and various details of the invention may vary within the scope of the inventive idea thereby defined . | 0 |
referring to fig1 a , 1b and 2a , removable hinge 100 comprises hinge cup 102 pivotally connected to attachment mechanism 104 by hinge arm 106 . typically , hinge cup 102 is affixed to cabinet door 103 with screws through mounting holes 107 . attachment mechanism 104 is removably attached to cabinet carcass 105 as will be described below . removable hinge 100 is repositionable between a “ locked ” position to cabinet carcass 105 and an “ unlocked ” position . in the locked position , the attachment mechanism is securely affixed to the cabinet carcass . in the unlocked position , the attachment mechanism can be removed from attachment to the cabinet carcass . in a preferred embodiment , the components of removable hinge 100 are typically constructed of metal such as cast aluminum or steel alloy plate stock . attachment mechanism 104 comprises base 110 , dog 112 , pressure plate 114 , lever 116 , and opposing links 118 and 119 . base 110 is attached to cabinet carcass 105 at faces 111 and 113 . base 110 is slidably engaged with dog 112 . thumbscrew 120 is threaded into dog 112 at hole 166 . thumbscrew 120 includes shoulder 121 which abuts washer 101 . the thumbscrew also includes end rivet 131 . end rivet 131 fits into mounting hole 176 in pressure plate 114 and is secured by peening during manufacture . pressure plate 114 includes stanchions 174 and 175 which fit into guide holes 164 and 165 . the clearance level between the stanchions and the guide holes is about 1 / 16 ″ and should allow for axial movement of the stanchions without binding . lever 116 is pivotally attached to base 110 with pins 126 and 127 . lever 116 is pivotally attached to links 118 and 119 with pins 122 and 123 . links 118 and 119 are pivotally attached to dog 112 with pins 124 and 125 . referring to fig2 a , 2b , and 2c , the horizontal , vertical , and lateral adjustment mechanisms will be described . adjustment plate 200 includes positioning extensions 204 and 226 . positioning extension 204 abuts slot 146 in base 110 . positioning extension 226 abuts slot 145 in base 110 . adjustment plate 200 includes pivot hole 241 and follower hole 244 . adjustment plate 200 also includes alignment slot 202 which is positioned between positioning extensions 226 . alignment slot 202 is open on one end and includes retaining shoulder 227 . the top surface of adjustment plate 200 also includes guide slot 248 . hinge arm 106 is generally sized to fit over and retain adjustment plate 200 . hinge arm 106 includes sides 229 and 231 which extend over adjustment plate 200 . guide rail 246 is sized to fit within guide slot 248 of adjustment plate 200 . hinge arm 106 includes threaded hole 228 for receipt of the threads of lateral adjustment screw b . hinge arm 106 includes generally square access hole 240 and oblong follower hole 242 . hinge arm 106 also includes step down 245 which is designed to engage guide shelf 243 of adjustment plate 200 . hinge arm 106 includes extension arm 254 . extension arm 254 is manufactured to include pivot hole 260 . pivot hole 260 is designed to engage pin 250 of hinge cup 102 . extension arm 254 includes cam surfaces 256 and 258 . cam surfaces 256 and 258 are sized to engage spring arms 264 and 266 of bias spring 262 . lateral adjustment screw b is threaded through threaded hole 228 of the hinge arm . head 230 of the adjustment screw fits within alignment slot 202 and engages retaining shoulder 227 . engagement of head 230 and retaining shoulder 227 restrains relative vertical movement between hinge arm 106 and adjustment plate 200 , but allows horizontal movement between the two components . vertical adjustment cam a is sized to fit through follower hole 244 and engage pivot hole 142 in base 110 . cam shoulder 232 engages the interior surface of follower hole 244 . offset cam extension 234 is sized to fit within pivot hole 142 while allowing free rotation between the two . during manufacture , offset cam extension 234 is peened after insertion into pivot hole 142 to prevent extraction . offset cam extension 234 is intentionally located flush with an edge of cam shoulder 232 . horizontal adjustment cam c includes cam shoulder 236 . cam shoulder 236 is sized to fit within follower hole 242 . horizontal adjustment cam c includes offset cam extension 238 . offset cam extension 238 is sized to fit within pivot hole 241 to allow free rotation . during manufacture offset cam extension 238 is peened after insertion into pivot hole 241 to prevent extraction . offset cam extension 238 is intentionally located flush with an edge of cam shoulder 236 . in use , lateral adjustment screw b is rotated whereby retaining head 230 moves retaining shoulder 227 and results in lateral movement , in direction 206 , of hinge arm 106 relative to adjustment plate 200 . vertical adjustment cam a is rotated in access hole 240 , which results in cam shoulder 232 engaging follower hole 244 . follower hole 244 and adjustment plate 200 are moved vertically , sliding positioning extensions 226 and 204 vertically within slots 145 and 146 of base 110 . the positioning extensions prevent angular movement of adjustment plate 200 and hinge arm 106 with respect to base 110 . adjustment plate 200 abuts sides 229 and 231 thereby moving hinge arm 106 with adjustment plate 200 vertically with respect to base 110 , in direction 208 . horizontal adjustment cam c is rotated whereby offset cam extension 238 rotates in pivot hole 241 . cam shoulder 236 engages follower hole 242 , thereby moving hinge arm 106 horizontally with respect to adjustment plate 200 in direction 210 . alignment slot 202 allows retaining head 230 to also move horizontally with respect to adjustment plate 200 . sides 229 and 231 prevent rotational movement of hinge arm 106 with respect to adjustment plate 200 . referring to fig1 a , 2b , and 2c , the connection of hinge cup 102 to hinge arm 106 will be described . hinge cup 102 comprises cup body 263 including coil indentions 268 and 270 . hinge cup 102 includes mounting tabs 259 and 261 . mounting tabs 259 and 261 include mounting holes 107 for securing the hinge cup to a cabinet door . hinge cup 102 includes through hole 252 in which is positioned pin 250 . pin 250 also engages pivot hole 260 and retains extension arm 254 in the hinge cup . coil indentions 268 and 270 form a housing for bias spring 262 . bias spring 262 includes spring arms 264 and 266 . spring arms 264 and 266 engage cam surfaces 256 and 258 respectively . the spring arms provide a greater bias to the cam surfaces when the hinge is in a closed position than they do when the hinge is in open position . referring to fig3 a and 3b , base 110 includes flanges 132 and 133 which extend at right angles from bridge 130 . bridge 130 includes a centrally located pivot hole 142 sized to engage adjustment cam a . a set of extensions 129 and 134 extend from bridge 130 opposite flanges 132 and 133 . extension 129 includes pivot hole 128 . extension 134 includes pivot hole 135 . pivot hole 135 is sized to engage pin 127 . pivot hole 128 is sized to engage pin 126 . rails 136 and 149 extend from opposite edges of bridge 130 . rail 136 includes tab 138 and slot 140 . rail 149 includes tab 148 and slot 141 . slot 145 is positioned between flanges 132 and 133 along an edge of bridge 130 . slot 146 is a generally rectangular shaped cut - out in bridge 130 . as shown in fig2 a and 4 , dog 112 is comprised of transverse portion 150 and jaw portion 152 . jaw portion 152 includes guide holes 164 and threaded hole 166 . threaded hole 166 is sized to engage the thumbscrew . extending from transverse portion 150 are arms 154 and 155 . arm 154 includes slot 160 , tab 162 , and extension 156 . extension 156 includes pivot hole 158 . pivot hole 158 is sized to engage pin 124 . arm 154 is slidably engaged with rail 149 . slot 160 is sized to slidably engage tab 148 . tab 162 is sized to slidably engage slot 141 . arm 155 includes slot 161 , tab 163 and extension 159 . extension 159 includes pivot hole 157 . pivot hole 157 is sized to engage pin 125 . arm 155 and is slidably engaged with rail 136 . slot 161 is sized to slidably engage tab 138 . tab 163 is sized to slidably engage slot 140 . referring to fig2 a and 5 , pressure plate 114 is shown . pressure plate 114 is generally rectangular and comprises face 170 and includes stanchions 174 and 175 extending from opposite sides . stanchions 174 and 175 are sized to slidably engage guide holes 164 and 165 . pressure plate 114 further includes hole 176 . thumbscrew 120 engages hole 176 such that thumbscrew 120 is free to rotate with respect to pressure plate 114 while shoulder 121 abuts washer 101 adjacent pressure plate 114 . face 170 includes a recess space surrounding hole 168 to allow attachment of the thumbscrew to the pressure plate without the thumbscrew extending beyond the plane of face 170 . face 170 further includes opposing triangular cleats 172 . in a preferred embodiment , cleats 172 are integrally formed with face 170 . in an alternate embodiment , cleats 172 are comprised of flexible plastic or rubber materials and are affixed to face 170 with a suitable adhesive . in another embodiment , the face includes a knurled surface . as shown in fig2 a and 6 , lever 116 comprises arms 182 and 183 extending from bridge 180 . arm 182 includes pivot hole 184 and pivot hole 186 . arm 183 includes pivot hole 185 and pivot hole 187 . pivot holes 184 and 185 are aligned with and sized to engage pins 126 and 127 , respectively . pivot holes 186 and 187 are aligned with and sized to engage pins 122 and 123 , respectively . lever 116 is pivotally connected to base 110 by pin 126 through pivot holes 184 and 128 and by pin 127 through pivot holes 185 and 135 . referring to fig4 and 7a , link 118 is shown . link 118 comprises body 190 integrally formed with standoff 192 . standoff 192 is generally cylindrical and includes a centrally positioned pivot hole 194 . pivot hole 194 is sized to engage pin 122 . body 190 includes pivot hole 196 . pivot hole 196 is sized to engage pin 124 . body 190 forms stop surface 198 . lever 116 is pivotally connected to link 118 by pin 122 through pivot holes 194 and 186 . link 118 is pivotally connected to dog 112 by pin 124 through pivot holes 196 and 158 . referring to fig4 and 7b , link 119 is shown . link 119 comprises body 191 integrally formed with standoff 193 . standoff 193 is generally cylindrical and includes a centrally positioned pivot hole 195 . pivot hole 195 is sized to engage pin 123 . body 191 includes pivot hole 197 . pivot hole 197 is sized to engage pin 125 . body 191 forms stop surface 199 . lever 116 is pivotally connected to link 119 by pin 123 through pivot holes 195 and 187 . link 119 is pivotally connected to dog 112 by pin 125 through pivot holes 197 and 157 . referring to fig8 a , 8b , and 8c , the preferred method of installing the hinge to the cabinet carcass will be described . fig8 a and 8b show the hinge in an unlocked position . to install removable hinge 100 , base 110 is positioned adjacent face 111 of cabinet carcass 105 . flanges 132 are positioned adjacent face 113 of cabinet carcass 105 . thumbscrew 120 is rotated and advances in direction 201 through threaded hole 166 thereby urging pressure plate 114 towards cabinet carcass 105 and away from jaw portion 152 . stanchions 174 and 175 similarly advance through guide holes 164 and 165 . thumbscrew 120 is advanced until cleats 172 abut face 115 of cabinet carcass 105 . lever 116 is pivoted in direction 200 toward base 110 . as the lever pivots , links 118 and 119 pivot with respect to the lever and dog 112 thereby forcing dog 112 towards cabinet carcass 105 . arms 154 and 155 slide on rails 136 and 139 , while tabs 138 and 148 engage slots 161 and 160 and tabs 163 and 162 engage slots 140 and 141 . the engagement prevents torsional rotation of dog 112 relative to base 110 . the lever in conjunction with the dog and links form a classic mechanical toggle which amplifies the compressive force applied to the pressure plate . as a result , cleats 172 are driven into face 115 , clamping attachment mechanism 104 to cabinet carcass 105 in a locked position . once in the locked position , minor vertical , horizontal , and lateral adjustments are made by rotating vertical adjustment cam a , horizontal adjustment cam c , and lateral adjustment screw b . to release the hinge from the cabinet carcass , lever 116 is pivoted away from base 110 , thereby urging dog 112 away from cabinet carcass 105 . thumbscrew 120 is reversed in threaded hole 166 causing cleats 172 to disengage from face 115 . as a result , the hinge can be removed completely or quickly adjusted to an alternate location . as lever 116 is moved away from base 110 , the stop surfaces provide a stop which abuts dog 112 and restricts rotational movement of the lever to prevent damage . it will be appreciated by those skilled in the art that modifications can be made to the embodiments disclosed and remain within the inventive concept . therefore , this invention is not limited to the specific embodiments disclosed , but is intended to cover changes within the scope and spirit of the claims . | 5 |
fig1 shows a top perspective view of disc drive 12 , which includes voice coil motor ( vcm ) 13 , actuator arm 14 , suspension 16 , flexure 18 , slider 20 , head mounting block 22 , and disc or media 24 . slider 20 is connected to the distal end of suspension 16 by flexure 18 . suspension 16 is connected to actuator arm 14 at head mounting block 22 . actuator arm 14 is coupled to vcm 13 . as shown on the right side of fig1 , disc 24 has a multiplicity of tracks 26 and rotates about axis 28 . during operation of disc drive 12 , rotation of disc 24 generates air movement which is encountered by slider 20 . this air movement acts to keep slider 20 aloft a small distance above the surface of disc 24 , allowing slider 20 to fly above the surface of disc 24 . vcm 13 is selectively operated to move actuator arm 14 around axis 30 , thereby moving suspension 16 and positioning the transducing head ( not shown ) carried by slider 20 over tracks 26 of disc 24 . proper positioning of the transducing head is necessary for reading and writing data on concentric tracks 26 of disc 24 . fig2 is a cross - sectional view of an embodiment of a magnetic writer 36 of the present invention . medium 24 for recording comprises thin storage layer 32 having high coercivity and perpendicular anisotropy ( the magnetization is held in a direction substantially normal to the surface of medium 24 ) and soft magnetic underlayer or keeper 34 having high permeability and in - plane orientation of the easy axis . in an exemplary embodiment , writer 36 comprises main pole 38 and return pole 40 , connected to each other by back gap closure 42 at a distal end and separated from each other by write gap 46 at the abs . at least one write coil 44 positioned proximate main pole 38 conducts current around main pole 38 , thereby intermittently inducing a magnetic field in main pole 38 . transducer main pole 38 serves as a trailing pole for the given direction of motion 47 of medium 24 . magnetization transitions on medium 24 are recorded by trailing edge 49 of main pole 38 . main pole 38 includes laminated main pole tip 45 partially embedded in yoke 48 . main pole 38 includes a first end including main pole tip 45 and a second , opposite end . in one embodiment , the first end of main pole 38 defines a plane at the air bearing surface . yoke 48 has a first end , a second end , and four sides ( see fig3 ). in the illustrated embodiment , main pole tip 45 is attached to the first end of yoke 48 . however , main pole tip 45 could also be attached to any of the four sides of yoke 48 . in an exemplary embodiment , magnetic layer 50 , shown here as the top layer of main pole tip 45 , contains trailing edge 49 . generally , the abs surface of main pole tip 45 is also an external surface of the transducer . in an exemplary embodiment , main pole tip 45 has a submicron width at the abs , to provide recording of ultra - narrow tracks on medium 24 . in an exemplary embodiment , main pole 38 is at least partially embedded in yoke 48 . the portions of yoke 48 surrounding main pole tip 45 help to direct the magnetic flux from relatively wide yoke 48 to relatively narrow pole tip 45 . the proposed structure of main pole tip 45 increases the uniaxial anisotropy of magnetic layers 50 and 54 , thereby rendering main pole 38 more magnetically stable . lamination of only pole tip 45 of main pole 38 may lead to savings in production costs and materials as well as an efficient writer 36 . flux easily travels through the bulk magnetic material of yoke 48 without disruption from lamination interfaces in the length of yoke 48 . to write data to perpendicular magnetic medium 24 , a time - varying write current is caused to flow through coil 44 , which in turn produces a time - varying magnetic field through main pole tip 45 and return pole 40 . medium 24 is then passed by the abs of writer 36 at a predetermined distance such that medium 24 is exposed to the magnetic field . with perpendicular writer 36 , the soft magnetic keeper 34 of magnetic medium 24 in essence acts as a third pole of the writer . a closed path for magnetic flux from writer 36 to medium 24 travels from main pole 38 through storage layer 32 of medium 24 to soft magnetic keeper 34 and returns to writer 36 through return pole 40 , again passing through storage layer 32 . to ensure that the magnetic field does not write data on this return path , the surface area of return pole 40 at the abs is preferably substantially larger than the surface area of main pole tip 45 at the abs . thus , the strength of the magnetic field affecting storage layer 32 under return pole 40 will not be sufficient to overcome a nucleation field of storage layer 32 . in a preferred embodiment , the thickness of main pole tip 45 is between about 0 . 05 and about 1 micrometer . the total cross - sectional area at the abs of return pole 40 is preferably greater than 10 times and more preferably greater than 100 times the total cross - sectional area of all the magnetic layers of main pole tip 45 . in an exemplary embodiment , main pole tip 45 has a multilayer structure . further , in one embodiment , main pole tip 45 is partially embedded in yoke 48 . multilayer main pole tip 45 preferably comprises magnetic layer 50 ; non - magnetic spacer layer 52 ; and magnetic layer 54 ( shown here as an underlayer ). this multilayer pole structure induces anisotropy in both magnetic layers 50 and 54 parallel to the external surface or abs , thereby enhancing the magnetic stability of main pole tip 45 while suppressing on - track erasure and increasing switching speed and ultimately increasing the data recording rate and reliability . when top magnetic layer 50 is coupled with magnetic underlayer 54 across non - magnetic layer 52 according to the present invention , the properties of the coupled multilayer system improve the performance of main pole tip 45 compared with a main pole tip made of a single layer of high magnetic moment material . while the layers of main pole tip 45 are illustrated as planar layers , it is contemplated that they may follow other contours . additionally , the illustrations are not rendered to scale . any suitable ferromagnetic materials may be used for magnetic layer 50 and magnetic underlayer 54 . the materials for each layer may be the same or they may be different . the materials are preferably magnetically soft , with a preferred coercivity less than about 5 oersted and more preferably less than about 1 oersted . the chosen materials preferably have well defined magnetic anisotropy , meaning that they have a stable orientation of the easy axis of magnetization parallel to the abs . in a preferred embodiment , magnetic layers 50 and 54 are made of cofe , conife , fecon , conifen , fealn , fetan , fen , nife ( e . g . ni 80 fe 20 , ni 45 fe 55 , etc . ), nifecr , nifen , cozr , cozrnb , fealsi , a permalloy , cozrta or another suitable material . magnetic layers 50 and 54 can be of any suitable thickness for use in writer 36 ; they are preferably each between about 0 . 01 and about 1 micrometer thick , and more preferably between about 0 . 1 to about 0 . 5 micrometer thick . non - magnetic spacer 52 may be composed of any non - magnetic material which is mechanically and chemically compatible with the magnetic materials used for top magnetic layer 50 and magnetic underlayer 54 . in an exemplary embodiment , non - magnetic spacer 52 between top magnetic layer 50 and magnetic underlayer 54 results in formation of an antiferromagnetic ( afm ) exchange coupling between top magnetic layer 50 and magnetic underlayer 54 . this coupling reinforces the anisotropy of top magnetic layer 50 and magnetic underlayer 54 oriented parallel to the abs , resulting in a more stable main pole tip 45 due to a reduction in magnetic energy of the parallel state . according to the rkky ( ruderman - kittel - kasuya - yosida ) interaction , non - magnetic spacer 52 composed of some materials induces a periodic coupling between top magnetic layer 50 and magnetic underlayer 54 . the coupling alternates characteristics between antiferromagnetic and ferromagnetic as a function of the thickness of non - magnetic spacer 52 and depends upon the crystallographic orientation of the material of non - magnetic spacer 52 . suitable non - magnetic materials for non - magnetic spacer 52 include , for example , copper , ruthenium , gold , tantalum , aluminum , rhodium , chromium , copper - silver alloys , nitride , carbide and various oxides , including aluminum oxide and silicon dioxide . preferred non - magnetic materials are those which provide for antiferromagnetic exchange coupling between the adjacent magnetic layers , such as copper , ruthenium , gold , rhodium , chromium , and copper - silver alloys . in a preferred embodiment , the thickness of non - magnetic spacer 52 is chosen to induce an antiferromagnetic coupling between top magnetic layer 50 and magnetic underlayer 54 . if the thickness in the proximity corresponding to the first antiferromagnetic peak results in a non - magnetic spacer which is too thin to be practical , then the thickness of non - magnetic spacer 52 in the proximity corresponding to the next antiferromagnetic peak can be used , and so on . in one embodiment , cu or ru spacer 52 has a thickness of about 1 to about 200 angstroms ( å ), more preferably a thickness of about 3 to about 30 å , and most preferably a thickness of about 6 to about 25 å . any suitable material may be used for yoke 48 , which is used in one embodiment to increase efficiency of writer 36 , as well as enhance the anisotropy and structural and magnetic integrity of multilayer main pole tip 45 . a length of main pole tip 45 is preferably about 0 . 02 to about 4 . 0 micrometers . thus , yoke 48 is preferably recessed from the abs by a distance of about 0 . 02 to about 4 . 0 micrometers so that yoke 48 does not contribute to an increased track width of main pole tip 45 at the abs . a narrow track width of main pole tip 45 at the abs allows for high track density recording and a narrow thickness of main pole tip 45 reduces skew - related side writing effects . in one embodiment , a length of yoke 48 is preferably about 8 to about 50 times the length of main pole tip 45 . in one embodiment , yoke 48 is made of a magnetic material such as conife , fecon , conifen , fealn , fetan , fen , nife ( e . g . ni 80 fe 20 , ni 45 fe 55 , etc . ), nifecr , nifen , cozr , cozrnb , cozrta , fealsi , or other suitable materials . the chosen material preferably has well defined magnetic anisotropy , meaning that it has well defined easy and hard magnetic axes . the material is preferably magnetically soft , with a preferred coercivity less than about 5 oersted and more preferably less than about 1 oersted . yoke 48 preferably has a relatively large magnetic permeability more than about 500 , and more preferably more than about 1000 . in an exemplary embodiment , the portions of yoke 48 surrounding main pole tip 45 are shown as tapered wedges ; however , they can also embody other configurations , such as graduated layers , for example . additionally , while portions of yoke 48 are illustrated as being positioned above and below main pole tip 45 , they can also be disposed on either side of main pole tip 45 in a case where yoke 48 is wider than main pole tip 45 in a lateral dimension . any suitable magnetic material may be used for back gap closure 42 . in a preferred embodiment , back gap closure 42 is constructed of a soft magnetic material such as conife , nife , ni 80 fe 20 , ni 45 fe 55 , nifecr , cozr , fen , fealsi , or other suitable materials . fig3 is a partial perspective view of an embodiment of a main pole of the present invention , viewed from a bottom of the pole tip . main pole 38 includes main pole tip 45 partially embedded in yoke 48 . main pole tip 45 is preferably centered on yoke 48 to most efficiently conduct the flux flowing from yoke 48 and through pole tip 45 . main pole tip 45 of the present invention has first magnetic layer 50 with a first magnetic moment orientation and second magnetic layer 54 with a second magnetic moment orientation . while the terms “ first ” and “ second ” are used for discussion purposes , it is to be understood that the order of the layers may be reversed or otherwise altered . in an exemplary embodiment of main pole tip 45 , the magnetic moment orientations or anisotropies of magnetic layers of 50 and 54 are fixed in a direction parallel to the bottom or external surface of the pole tip when the write current is off , thereby reducing unwanted erasure by reducing the remanent magnetization . this directional bias can be accomplished by means including but not limited to the choices of materials for the magnetic and non - magnetic layers , the thicknesses of the magnetic and non - magnetic layers , the application of stress or magnetostriction , the directional deposition of the materials of the magnetic and non - magnetic layers with low glancing angles , and the use of antiferromagnets or permanent magnets . by orienting the moments of magnetic layers 50 and 54 in a direction parallel to the abs , for example , residual magnetization and the remanence charge left on the tip 45 of main pole 38 of perpendicular writer 36 are minimized when the writing current is off . in one exemplary embodiment , the material of magnetic layer 50 , which is proximate trailing edge 49 , is made of a material with a higher saturation magnetic moment than the material of magnetic underlayer 54 . because the strength of the write field in the media is proportional to the magnetic moment of the main pole material , it is desirable to use a material with a high magnetic moment ( or high flux density saturation ) for construction of main pole tip 45 for ultra high track density recording . when the magnetic moment of the main pole material is increased , a track width and thickness of the main pole tip can be reduced for increasing the storage capacity of the disc drive while reducing skew - related effects . in an exemplary embodiment , magnetic layers 50 and 54 are antiferromagnetically exchanged coupled through nonmagnetic layer 52 . the antiferromagnetic coupling of the high magnetic moment material of top magnetic layer 50 by lower magnetic moment material 54 leads to greater overall stability in main pole tip 45 while retaining the high writability and high data rate advantages of using the high magnetic moment material . fig4 is a partial perspective view of another embodiment of a main pole tip of the present invention . in the illustrated embodiment of main pole tip 45 having trailing edge 49 , anisotropy in magnetic layers 50 and 54 parallel to the plane of the abs is induced by antiferromagnetic pinning layer or anisotropy inducing magnetic layer 62 contacting magnetic layer 50 . magnetic layer 62 induces the magnetic moment orientations of magnetic layers 50 and 54 into orientations substantially parallel to the abs in the absence of a write current . anisotropy inducing layer 62 is composed of an antiferromagnet or permanent magnet , for example . examples of suitable antiferromagnets include cr , nio , mno , irmn , ptmn , nimn , irmnx , ptmnx , and nimnx ; where x represents a third element . examples of suitable permanent magnets include co ; cocr ; copt ; cocrpt ; mfe 2 o 4 , where m represents any one of several metallic elements ; fe 3 o 4 ; ab 12 o 19 , where a is a divalent metal such as ba , sr , or pb , and b is a trivalent metal such as al , ga , cr or fe ; and m 3 fe 5 o 12 , where m is a rare earth ion such as sm , eu , gd or y . fig5 is a partial perspective view of another embodiment of a main pole tip of the present invention . in the illustrated embodiment of main pole tip 45 , anisotropy inducing layers 62 are disposed adjacent to the magnetic layer 50 and magnetic layer 54 . this configuration is useful where stronger pinning coupling is desirable to induce the orientations of the magnetic moments of magnetic layers 50 and 54 into directions parallel to the abs . fig6 is a partial perspective view of another embodiment of a main pole tip of the present invention . in this embodiment , anisotropy inducing layers 62 are disposed on one or both sides of main pole 38 , spaced apart from main pole tip 45 , but in close proximity so that the magnetic fields of anisotropy inducing layers 62 act upon magnetic layers 50 and 54 in the absence of a write current . those skilled in the art will appreciate that anisotropy inducing layers 62 could be disposed above or below main pole 38 . in these embodiments , a distance between main pole tip 45 and each layer 62 is between about 10 nm and about 80 nm . these configurations are especially useful when it is desirable to keep the surface area of pole tip 45 as small as possible for increasing efficiency and reducing skew - related effects . in an exemplary embodiment , a cross sectional area of main pole tip 45 at the abs is less than about 10 , 000 nm 2 . the anisotropy inducing layers 62 switch the direction of the magnetic moments in main pole tip 45 into directions parallel to the abs after the writing current is switched off , thereby decreasing or eliminating on - track erasure . in one embodiment , the longitudial biasing field provided by the biasing layers 62 is between about 5 oe and about 2000 oe , which is generally larger than the coercivity of the materials of writer 36 and generally smaller than the perpendicular field generated by coils 44 , resulting in a decrease in on - track erasure while resulting in minimal interference with the recording process . fig7 is a partial perspective view of another embodiment of a main pole tip of the present invention . main pole tip 45 of fig7 is similar to main pole tip 45 of fig3 , except that the embodiment illustrated in fig7 includes additional magnetic layers 66 , 70 , 74 and 78 and additional non - magnetic layers 64 , 68 , 72 and 76 . in the illustrated embodiment , each magnetic layer 50 , 54 , 66 , 70 , 74 and 78 is antiferromagnetically coupled to an adjacent magnetic layer so that the moments of adjacent layers align anti - parallel to each other . in one exemplary embodiment , a magnetic moment gradient from trailing edge 49 is created by disposing magnetic layers of higher moment closer to trailing edge 49 and lower moment layers further away from trailing edge 49 . while the multilayer structure of fig7 leads to better performance uniformity than the structure of fig3 , due to the stronger overall levels of coupling between the magnetic layers 50 , 54 , 66 , 70 , 74 and 78 , a large magnetic field is needed to saturate main pole 38 during the writing process . in order to make it easier to saturate main pole 38 , different materials can be chosen for non - magnetic layers 52 , 64 , 68 , 72 and 76 to selectively determine the strength of coupling between the magnetic layers in one embodiment . for example , a conductive material such as a transition metal such as copper , ruthenium , gold , rhodium , or chromium , for example , can be used in non - magnetic layers 52 , 68 and 76 to promote a relatively strong anti - parallel exchange coupling between magnetic layers 52 and 54 , between magnetic layers 66 and 70 , and between magnetic layers 74 and 78 . other non - magnetic materials , including transition metals of certain thicknesses , will cause only a weak antiferromagnetic exchange coupling between the two magnetic layers on either side of the non - magnetic layer . for example , an electrically insulating material such as tantalum , aluminum oxide , nitride , carbide , or silicon dioxide , for example , can be used for non - magnetic layers 64 and 72 to separate the sets of strongly coupled magnetic layers . in another example , ru with a thickness of about 5 å to about 10 å is used in non - magnetic layers 52 , 68 and 76 to promote a relatively strong anti - parallel exchange coupling between magnetic layers 52 and 54 , between magnetic layers 66 and 70 , and between magnetic layers 74 and 78 . ru with a thickness of about 12 å to about 18 å , which causes only a weak antiferromagnetic exchange coupling between the two magnetic layers on either side of the non - magnetic layer , is used in non - magnetic layers 64 and 72 to separate the sets of strongly coupled magnetic layers . with such configurations , each magnetic layer is antiferromagnetically coupled to an adjacent magnetic layer , but main pole 38 is easier to saturate during the writing process because the overall coupling strength of main pole tip 45 is decreased . this leads to higher writer efficiency while reducing on - track erasure . fig8 is a partial perspective view of yet another embodiment of a main pole tip of the present invention . non - magnetic layer materials 64 and 72 couple but do not antiferromagnetically couple the magnetic layers on either side of the non - magnetic layers . therefore , the moments of magnetic layers 54 and 66 point in the same direction , and the moment of magnetic layers 70 and 74 point in the same direction in the illustrated example . however , the magnetic layers are still arranged so that each pair of magnetic layers is antiferromagnetically coupled . for example , magnetic layers 50 and 54 are antiferromagnetically coupled by non - magnetic layer 52 ; magnetic layer 66 and 70 are antiferromagnetically coupled by non - magnetic layer 68 ; and magnetic layer 74 and 78 are antiferromagnetically coupled by non - magnetic layer 76 . since each magnetic layer has only one of its surfaces relatively strongly antiferromagnetically exchange coupled , the overall effective coupling strength of main pole tip 45 is reduced , making it easier to saturate main pole 38 during the writing process by requiring a smaller magnetic field , thereby leading to greater efficiency . fig9 is a partial perspective view of another embodiment of a main pole tip of the present invention . main pole tip 45 of fig9 is similar to main pole tip 45 of fig7 except that the embodiment of fig9 includes a trapezoidal shape of main pole tip . in this embodiment a magnetic moment gradient from trailing edge 49 is created by disposing wider layers of magnetic materials closer to trailing edge 49 and narrower layers of magnetic materials further away from trailing edge 49 . thus , a gradient can be created even if each magnetic layer is made of materials with similar magnetic moment values . fig1 is a partial cross - sectional view of another embodiment of the writer of the present invention . writer 82 of fig1 is similar to writer 36 of fig2 , except that the embodiment illustrated in fig1 includes an additional return pole 40 connected to main pole 38 by an additional back closure 42 . this configuration reduces side erasure because the flux flowing through main pole 38 is directed to both return poles 40 , effectively reducing the side flux effects by half . writer 82 thereby increases writer efficiency while reducing both remanent erasure and side erasure effects . although the present invention has been described with reference to exemplary embodiments , workers skilled in the art will recognize that changes may be made in form and detail without departing from the spirit and scope of the invention . | 6 |
the invention will now be described with reference to the drawing figures , in which like reference numerals refer to like parts throughout . an embodiment in accordance with the present invention provides an apparatus is provided that in some embodiments provides a locking mechanism for hold open rods that functions over long periods of time , holds large loads and is durable . an embodiment of the present inventive apparatus is illustrated in fig1 . fig1 is a perspective view of a hold open rod system 10 . the hold open rod system 10 includes an inner 12 and outer 14 tube and a locking mechanism 16 . fasteners 15 , are connected to the inner 12 and outer 14 tubes . in this view , the system 10 is shown in a retracted , resting position . fig2 is a perspective view of the hold open rod system 10 of fig1 . in this view , an inner tube 12 is shown extending out from an outer tube 14 . fasteners 15 are connected to the inner tube 12 and the outer tube 14 . the fasteners 15 permit the hold open rod system 10 to attach doors or hatches of an aircraft which are to be held open . the fasteners 15 may be threaded , press fit or otherwise attached to the inner 12 and outer rods 14 . fasteners 15 are connected to the inner tube 12 and the outer tube 14 . a locking mechanism 16 is shown in an a locking state , as will be described herein . fig3 is a cross - sectional view of the locking mechanism 16 in a retracted , unlocked position . in this position , the inner tube 12 is disposed circumferentially within an outer tube 14 . the locking mechanism 16 includes a release collar 40 having an outer housing 17 , and locking dogs 18 disposed around the inner tube 12 . the dogs 18 may be disposed circumferentially around the inner tube 12 contacting an outside wall 20 of the inner tube 12 . as in the embodiment shown there may be two locking dogs 18 that are located opposite to each other . the locking dogs 18 can have a variety of geometries as will be discussed further . as shown in fig3 and 4 , dogs 18 have a sloped surface 19 in that corresponds with a sloped surface 21 on the outer housing 17 . the sloped surface 19 on the dogs 18 and the sloped surface 21 on the outer housing 17 interact to compress the locking dogs 18 which will be discussed further later below . a lock body 22 surrounds the inner and outer tubes 12 , 14 respectively . specifically , the lock body 22 is a tubular structure that has a first end 24 and a second end 26 . the first end 24 and second end 26 have varying diameters , such that the second end 26 has a larger diameter than the first end 24 . in some embodiments the second end 26 may have internal threads that permit the inner tube 12 to threadably attach to the release collar 40 . proceeding longitudinally from the first end 24 to the second end 26 , the locking body 22 has a tubular shape . there is at least one larger diameter opening 28 for placement of the locking dogs in the lock body 22 . in the cross - sectional illustration depicted in fig3 , there are least two such openings 28 . thereafter , the lock body 22 geometry flares outwardly towards the second end 26 . this flare is characterized by inner seat 30 formed on an inside surface 32 of the lock body 22 and an outer seat 34 formed on an outer surface 36 of the lock body 22 . proceeding further toward the second end 26 , the lock body has a depression 38 and a lip 39 defined by the depression 38 and the second end 26 for connecting with the outer tube 14 . in some embodiments the connection may be via threads . the geometry of the lock body 22 may have a smaller diameter adjacent the first end 24 to accommodate the diameter of just the inner tube that it retains at the first end 24 and a larger diameter adjacent the second end 26 to accommodate the diameters of both the inner tube 12 and the outer tube 14 that it retains at the second end 26 . the lock body 22 and the locking dogs 18 are themselves circumferentially contained within a release collar 40 . the release collar 40 generally tubular in shape , has a first end 42 and a second end 44 remote therefrom . adjacent the first end 42 of the release collar 40 is a release collar cavity 46 for providing a space for locking dogs 18 when the locking dogs 18 are not in a locking position . the release collar cavity 46 has a first portion 48 disposed toward the first end 42 and a second portion 50 . further , the cavity 46 includes the sloped surface 21 that allows the locking dogs 18 to be fed into the second portion 50 . the first portion 48 has a larger diameter and geometry than the second portion 50 , such that the first portion 48 of the cavity 46 can accommodate the size and shape of the locking dogs 18 when the locking system 10 is in a relaxed , unlocked and retracted state . the second portion 50 of the release collar cavity 46 has a smaller diameter so as to capture and retain the locking dogs 18 when the inner and outer tubes , 12 , 14 , respectively , are placed in an extended , locked position as shown in fig4 . the release collar 40 further includes a lip 54 for preventing the locking dogs 18 from sliding down the outer wall 20 of the inner tube 12 . a spring 56 is positioned inside the release collar 40 to surround the lock body 22 . in particular , the spring 56 is retained inside the release collar 40 by the outer seat 34 of the locking collar 22 . the spring 56 retracts and contracts as the locking mechanism 16 is locked and unlocked . fig4 is a depiction of the locking mechanism 16 in an extended , locked position . in fig3 , a first end 58 of the inner tube 12 was visible and positioned adjacent the locking mechanism 16 . however , in fig4 , illustrating the extended , locked position , a second end 60 of the inner tube 12 is visible . the second end 60 of the inner tube 12 includes at least one inner tube groove 62 having a geometry to accommodate the locking dogs 18 . the inner tube groove 62 is formed on an outer wall 20 of the inner tube 12 . the groove 62 is dimensioned such that the locking dogs 18 will fit between the groove 62 and the second portion 50 of the release collar 40 . the groove 62 is formed at a location near the second end 60 so that when the locking mechanism 16 is in the extended locked position , the inner and outer tubes 12 , 14 respectively , can have the longest length possible . the second end 60 also includes a circumferential protrusion or stop 64 . the stop 64 catches against the inner seat 30 of the locking body 22 and prevents the inner tube 12 from sliding all the way through the lock body 12 . the stop 64 may be formed integrally with the inner tube 12 or be formed separately and attached to the second end of the 60 of the inner tube 12 . in operation , during the relaxed , retracted and unlocked position , the locking dogs 18 are circumferentially spaced about the outer wall 20 of the inner tube 12 and are located adjacent the first portion 48 of the release collar 40 as shown in fig3 . an example of when the hold open rod system 10 is in this unlocked position is when a door held open by the hold open rod system 10 is in a closed position . to extend and lock the hold open rod system in place , the inner tube 12 is extended out from the outer tube 14 . as the inner tube 12 is extended out , the locking dogs 18 ride on the outer wall 20 of the inner tube 12 until they approach the groove 62 of the inner tube 12 . then , the locking dogs 18 are angled radially inward by the angled surface 21 such that the locking dogs 18 fall into the groove 62 and are held in place by the second portion 50 of the release collar 40 . the locking dogs 18 stay thusly situated until an operator releases the locking mechanism . to release the locking dogs 18 , an operator slides the release collar 40 and compresses the spring 56 such that the locking dogs 18 are angled upward and outward , radially by the wall 21 , allowing the locking dogs 18 to return to the first portion 48 of the release collar cavity 46 . the release collar 40 can be configured such that the locking dogs 18 are released with a pull or slide motion or a turn - and - pull ( or slide ) motion . then the locking dogs 18 slide on the outer wall 20 of the inner tube 12 as the inner tube 12 is retracted back into the outer tube 14 . fig5 - 7 provide depictions of alternate embodiments of locking dogs 18 . in particular , fig5 shows a perspective view of a locking dog 18 having a generally elongated block like structure with rounded ends . fig6 illustrates yet another embodiment of a locking dog 18 . this embodiment has a shape similar to a torridal section ( a section of a torus ) with champhered ends . fig7 illustrates a generally spherical structure . in the embodiments shown in fig5 , the locking dog 18 has sloped surface 19 for sliding along the sloped surface 17 on the outer housing 21 as discussed above . the embodiments shown in fig6 and 7 have general curved surfaces 66 . the general curved surfaces 66 perform the function of sliding along the sloped surface 21 of the outer housing 17 . the arched sections 68 as shown in fig5 and 6 allow the dogs 18 to engage the ached groove 62 . thus the locking dogs 18 can have a variety of geometries and are within the scope of the present invention . further , in a preferred embodiment of the present invention , the locking dogs 18 are formed of a reinforced plastic material , such as but not limited to , glass or carbon reinforced torlon ® polymer available from solvay plastics . this material is a strong material that can withstand the large loads that the locking mechanism 10 will be subjected to but will not cause wear on the outer wall 20 of the inner tube 12 . the many features and advantages of the invention are apparent from the detailed specification , and thus , it is intended by the appended claims to cover all such features and advantages of the invention which fall within the true spirit and scope of the invention . further , since numerous modifications and variations will readily occur to those skilled in the art , it is not desired to limit the invention to the exact construction and operation illustrated and described , and accordingly , all suitable modifications and equivalents may be resorted to , falling within the scope of the invention . | 8 |
aspects of the present invention relate to a communications network having an intermediary security gateway computer and one or more intermediary third part gateway computers , where the third party gateway computers do not need to inspect the data content they receive and send . using embodiments of the present invention , the connection between a client and a server is split into two ssl connections , and two or more non - ssl connections . one of the two ssl connections is used for communication between the client and a first security gateway computer , and the other of the two ssl connections is used for communication between the server and a second security gateway computer . the two or more non - ssl connections are used for communications between a security gateway computer and a third party gateway computer , and for communications between two third party gateway computers . the first and second security computers operative cooperatively to authenticate signed certificates that are provided by the server during an ssl handshake . the second security computer transmits to the first security computer the certificate attributes received from the server , and the first security computer acts as a certificate authority , and creates a certificate for the client based on the attributes of the server certificate . reference is now made to fig2 , which is a diagram of a client - server system with two security gateways and a third party caching gateway , using only two ssl connections , in accordance with an embodiment of the present invention . shown in fig2 is a client computer 100 that communicates with a server computer 200 within a network in which a first security gateway computer 300 a , a third party gateway computer 400 , and a second security gateway computer 300 b intermediate . third party gateway computer 400 does not need to inspect that data content that it receives and sends . in some instances the data content passing through third party gateway computer 400 may need to be encrypted . it will be appreciated by those skilled in the ensuing description that embodiments of the present invention apply as well to a topology wherein third party gateway computer 400 is a plurality of networked third party gateway computers . notable in fig2 is the use of two ssl connections and two non - ssl connections . as such , establishing a connection between client computer 100 and server computer 200 requires only two ssl handshakes . specifically , security gateway computer 300 a establishes an ssl connection with client computer 100 , and security gateway computer 300 b establishes an ssl connection with server computer 200 . the connections between security gateway computer 300 a and security gateway computer 300 b are non - ssl connections , which are higher performance and lower latency connections than ssl connection . using the network topology of fig2 , client computer 100 and server computer 200 are still connected over ssl , and a certificate is exchanged and validated . if the communication between security gateway computers 300 a and 300 b is required to be encrypted , an encrypted tunnel / pipe is established between the security gateway computers , such as an open - vpn tunnel in cases where there are many connections between security gateway computers 300 a and 300 b , a permanent encrypted tunnel / pipe is established between them . for the network topology of fig2 to support ssl certificate validation , security gateway computers 300 a and 300 b perform special processing , as described hereinbelow regarding the methods of fig3 and 4 . reference is now made to fig3 , which is a simplified flowchart of a method for establish an ssl connection between a client and server computer intermediate between the client and the server computers , in accordance with an embodiment of the present invention . the flowchart of fig3 is divided into five columns . starting from the left , the first column includes steps performed by client computer 100 (“ client ”), the second column includes steps performed by security gateway computer 300 a (“ security gateway a ”), the third column includes steps performed by third party gateway computer 400 (“ third party gateway ”), the fourth column includes steps performed by security gateway computer 300 b (“ security gateway b ”), and the fifth column includes steps performed by server computer 200 (“ server ”). at step 1105 , the client computer sends an ssl request to security gateway a , to establish a connection , using the connect request method . at step 1110 security gateway a establishes a connection to the third party gateway . if an encrypted connection is desired , then security gateway a establishes an encrypted connection to the third party gateway using , for example , open - vpn . if subsequent connection requests are anticipated , then the connection between security gateway a and the third party gateway remains as a tunnel / pipe , in order not to disconnect . at step 1115 the third party gateway accepts the connection with security gateway a . at step 1120 the third party gateway establishes a connection to security gateway b . as above , if an encrypted connection is desired , then the third party gateway establishes an encrypted connection to security gateway b using , for example , open - vpn . also as above , if subsequent connection requests are anticipated , then the connection between the third party gateway and security gateway b remains as a tunnel / pipe , in order not to disconnect . at step 1125 security gateway b sends an ssl request to the server , to establish a connection , using the connect request method . at step 1130 security gateway band the server perform an ssl handshake to authenticate a server certificate . upon success of the handshake , an ssl connection is established between security gateway b and the server . at step 1135 security gateway b appends the server certificate attributes to a header in the protocol , such as an http reply header . certificate attributes generally include inter alia a domain name and a validity date . at step 1140 security gateway b replies to the third party gateway with a connect reply message . the reply includes the server certificate attributes in its header . at step 1145 the third party gateway forwards the reply received from security gateway b to security gateway a . at step 1150 security gateway a creates an ssl certificate using the attributes of the server certificate . finally , at step 1155 security gateway a and the client perform an ssl handshake to authenticate the certificate created by security gateway a . upon success of the handshake , an ssl connection is established between security gateway a and the client . at this stage , subsequent requests from the client to the server may be communicated over the established connections . in accordance with an embodiment of the present invention , the method of fig3 may be enhanced by maintaining a local certificate cache at security gateway a . such a cache obviates the need to security gateway b to send the server certificate attributes to security gateway a . instead , a cached server certificate is used . however , certificates often expire and are renewed . in order that the certificate cache at security gateway a be up - to - date , security gateway b sends updated server certificates to security gateway a when the server certificates change . in this regard , deference is now made to fig4 a and 4b , which are a simplified flowchart of an enhancement for the method of fig3 , using a certificate cache , in accordance with an embodiment of the present invention . the flowchart of fig4 a and 48 is divided into five columns , as described above with reference to fig3 . at step 1205 the client sends an ssl request to security gateway a , to establish a connection , using the connect request method . at step 1210 security gateway a checks its local certificate cache to determine if a certificate for the requested server name is already available in cache . if so , then at step 1215 security gateway a generates a fingerprint or hash of the server certificate , and at step 1220 security gateway a appends the fingerprint / hash to a connection request . otherwise , if it is determined at step 1210 that a certificate for the requester server name if not available in cache , then processing advances directly to step 1225 , by - passing steps 1215 and 1220 . at step 1225 security gateway a establishes a connection to the third party gateway . the connection request will include the fingerprint / hash of the server certificate if steps 1215 and 1220 were performed . if encryption between security gateway a and the third party gateway is desired , then an encrypted connection is established , using , for example , open - vpn . if subsequent requests are anticipated , then the connection between security gateway a and the third party gateway remains as a tunnel / pipe , in order that it not disconnect . at step 1230 the third party gateway accepts the connection with security gateway a . at step 1235 the third party gateway establishes a connection to security gateway b . the connection request received by security gateway b from the third party gateway will include the server certificate attributes if steps 1215 and 1220 were performed . as above , if encryption between the third party gateway and security for example , open - vpn . also as above , if subsequent requests are anticipated , then the connection between the third party gateway and security gateway b remains as a tunnel / pipe , in order that it not disconnect . at step 1240 security gateway b sends a ssl request to the server , to establish a connection , using the connect request method . at step 1245 security gateway b and the server perform an ssl handshake to authenticate a server certificate . upon success of the handshake , an s sl connection is established between security gateway b and the server . at step 1250 security gateway b determines whether a fingerprint / hash of the server certificate was included in the request made at step 1235 . if so , then at step 1255 security gateway b generates a fingerprint or hash of the certificate it received from the server during the ssl handshake at step 1245 . at step 1260 security gateway b compares the fingerprint / hash received at step 1235 with the fingerprint / hash generated at step 1255 . if the two fingerprints / hashes do not match , then the server certificate was recently updated , and the server certificate cached at security gateway a is no longer valid . at step 1265 security gateway b appends the certificate attributes from the server certificate received at step 1245 , to a header in the protocol , such as an http reply header . otherwise , if the two fingerprints / hashes compared at step 1260 do match , then the server certificate cached at security gateway a is still valid . in this case , processing advances directly to step 1270 , by - passing step 1265 , and no certificate attributes are appended to the reply message . if security gateway b determines at step 1250 that a fingerprint / hash was not included in the request received at step 1235 , then processing advances directly to step 1265 , by - passing steps 1255 and 1260 . at step 1270 security gateway b replies to the third party gateway with a connection reply message . at step 1275 the third party gateway forwards the reply received from security gateway b to security gateway a . at step 1280 security gateway a determines whether server certificate attributes are included in the reply message received from the third party gateway computer at step 1275 . if so , then at step 1285 security gateway a creates an ssl certificate using the attributes included in the reply message , and stores the created certificate in its local cache for subsequent access . otherwise , at step 1290 security gateway a retrieves its cached certificate . finally , at step 1295 security gateway a and the client perform an ssl handshake to authenticate the certificate created at step 1285 or the cached certificate , as appropriate . upon success of the ssl handshake , an ssl connection between gateway server a and the client is established . at this stage , subsequent requests from the client to the server are communicated over the established connections . reference is now made to fig5 , which is a simplified block diagram of security gateway computers 300 a and 300 b that cooperate in ssl certificate validation , in accordance with an embodiment of the present invention . security gateway computers 300 a and 300 b are operative to perform the steps in fig3 a and 48 that apply to security gateways a and b , respectively . in addition to the components shown in fig5 , each of security gateway computers 300 a and 300 b includes standard computer hardware ( not shown ), including inter alia one or more processors , one or more hard disk drives , ram , a communication bus , one or more network interfaces , and i / o drivers display . as shown in fig5 , security gateway computer 300 a includes an ssl connector 310 a , for establishing an ssl connection between security gateway computer 300 a and a client computer . ssl connector 310 a is used in performing step 1155 of fig3 and step 1295 of fig4 . security gateway computer 300 a also includes a non - ssl connector 320 a , for establishing a non - ssl encrypted or non - encrypted connection between security gateway computer 300 a and a third party gateway computer . non - ssl connector 320 a is used in performing step 1110 of fig3 and step 1225 of fig4 a . security gateway computer 300 a also includes a certificate creator 330 a , for creating a signed certificate for attributes of a server certificate . certificate creator 330 a is used in performing step 1150 of fig3 and step 1285 of fig4 . security gateway computer 300 b includes an ssl connector 310 a , for establishing an ssl connection between security gateway computer 300 b and a server computer . ssl connector 310 b is used in performing step 1130 of fig3 and step 1245 of fig4 a . security gateway computer 300 b also includes a non - ssl connector 320 b , for establishing a non - ssl encrypted or non - encrypted connection between security gateway computer 300 b and a third party gateway computer . non - ssl connector 320 b is used in performing step 1120 of fig3 and step 1235 of fig4 . security gateway computer 300 b also includes a protocol appender 340 a , for appending certificate attributes within a protocol request . protocol appender 340 a is used in performing step 1135 of fig3 and step 1265 of fig4 . for use in the enhanced method of fig4 , security gateway computer 300 a also includes a local certificate cache 350 for storing and retrieving attributes of signed server certificates . in addition , security gateway computer 300 a includes a certificate encoder 360 a for deriving a hash value for cached certificate attributes , and a protocol appender 340 a for appending the hash value to a protocol message . certificate encoder 360 a is used in performing step 1215 of fig4 a , and protocol appender 340 a is used in performing step 1220 of fig4 a . further for use in the enhanced method of fig4 a and 8 , security gateway computer 300 b also includes a certificate encoder 360 b for deriving a hash value for attributes of a certificate provided by the server computer , and a certificate comparator 370 b for comparing hash values generated by certificate encoder 360 a with a hash value generated by certificate encoder 360 b . certificate encoder 360 a is used in performing step 1255 of fig4 , and certificate comparator 370 b is used in performing step 1260 of fig4 . in the foregoing specification , the invention has been described with reference to specific exemplary embodiments thereof . it will , however , be evident that various modifications and changes may be made to the specific exemplary embodiments without departing from the broader spirit and scope of the invention as set forth in the appended claims . accordingly , the specification and drawings are to be regarded in an illustrative rather than a restrictive sense . | 7 |
the embodiments of the present invention will now be explained by referring to the accompanying drawings . the first embodiment of the present invention is characterized by using a liquid crystalline material which comprises a compound represented by the structural formula ( 1 ), compounds represented by the structural formulas ( 1 ) and ( 2 ), compounds represented by the structural formulas ( 1 ) and ( 3 ), or compounds represented by the structural formulas ( 1 ), ( 2 ) and ( 3 ) in an amount of 90 % by weight or more of the total weight of liquid crystalline components contained therein , provided that the weight of the compound represented by the structural formula ( 1 ) is 60 % or more of the total weight of the liquid crystalline components . as defined previously , each one of the molecules represented by the structural formulas ( 1 ), ( 2 ) and ( 3 ) has three fluorine atoms bonded to benzene ring which is positioned at the terminal end thereof . in order to further lower the operating voltage , the inventors carried out experiments by changing the proportion of a predetermined liquid crystalline component in a given liquid crystalline material which comprises as its main components ( for example , 90 % by weight or more of all of the liquid crystalline components contained therein ) the compounds having the structural formulas ( 1 ), ( 2 ) and ( 3 ). by making the proportion of the component represented by the structural formula ( 1 ) to 60 % by weight or more of the total weight of the components , voltage required to operate a liquid crystal display panel was lowered to a low value that had never been attained until then . the following can be considered as the reason why the operating voltage was lowered : under the condition that only the molecules represented by the structural formulas ( 1 ), ( 2 ) and ( 3 ) are used as liquid crystalline components , a conventionally - known liquid crystalline material in which the proportion of the molecule having the structural formula ( 1 ) is less than 60 % by weight , and a liquid crystalline material of the present invention in which the proportion of the molecule having the structural formula ( 1 ) is 60 % by weight or more were compared . as a result , the conventional liquid crystalline material and the liquid crystalline material of the present invention were found to be almost the same in anisotropy of dielectric constant δε . it is therefore considered that voltage required to operate a liquid crystal display panel was lowered because of a decrease in elastic modulus of the liquid crystalline components . a tft driven liquid crystal display panel having 640 × 400 pixels was prepared . the partial cross - sectional view of this display panel is as shown in fig3 . as shown in fig3 a tft 2 , a drain bus line 3 , a transparent pixel electrode 4 , and a gate bus line ( not illustrated ) are provided on a first transparent substrate 1 . a first alignment film 5 is formed at least on the transparent pixel electrode 4 . the tft 2 has , for example , a structure of stagger type ; it has a source electrode 2s connected to the pixel electrode 4 , a drain electrode 2d connected to the drain bus line 3 , an operating semiconductor layer 2a connected to a part of the source electrode 2s and to a part of the drain electrode 2d , and a gate electrode 2g which is provided on a gate insulating layer 2b formed on the active semiconductor layer 2a . further , a first polarizer 6 is provided on the other surface of the first transparent substrate 1 . on a second transparent substrate 7 , a transparent common electrode 8 and a second alignment film 9 are provided in the mentioned order . the second transparent substrate 7 faces the first transparent substrate 1 with the second alignment film 9 and the first alignment film 5 faced each other . the first and second transparent substrates 1 , 7 are made of glass , quartz or the like . in the gap between the first and second alignment films 5 , 9 , a liquid crystalline material 11 having the composition shown in fig4 was charged . the n - i transition temperature of the liquid crystalline material used was 59 ° c . in this example , liquid crystalline molecules of a plurality of types were used in order to control the temperature characteristics . in fig4 and in fig6 which will be described later , the liquid crystalline molecules 1 and 2 correspond to the molecule represented by the structural formula ( 1 ), the liquid crystalline molecules 3 to 8 correspond to the molecule represented by the structural formula ( 2 ), and the liquid crystalline molecule 9 corresponds to the molecule presented by the structural formula ( 3 ). a chiral material was further incorporated into the liquid crystalline material . the amount of the chiral material was adjusted so that the angle of the liquid crystalline molecules would be changed in approximately 90 ° to be a spiral form with a pitch of approximately 90 micrometers . the amount of the chiral material added was approximately 0 . 15 % by weight of the liquid crystalline material . the liquid crystal display panel having the above - described structure is of a normally white type . the relationship between applied voltage and relative transmittance in this display panel was examined . as a result , a characteristic curve as shown in fig5 was obtained . the applied voltage means a voltage between the pixel electrode 4 and the common electrode 8 , and the relative transmittance is defined as a transmittance taken under the condition that the amount of transmitted light is set to be 100 % when the applied voltage is 0 v . when the voltage at which the relative transmittance is 1 % is referred to as a saturation voltage v sat , the saturation voltage v sat of the liquid crystal display panel made by using the liquid crystalline material of this example is 2 . 46 v , which is lower than 2 . 5 v although the degree of lowering is small . it is noted that the saturation voltage v sat is defined as a voltage by which a contrast of 200 can be attained . on the other hand , four types of liquid crystalline materials , each containing less than 60 % by weight of the molecule represented by the structural formula ( 1 ) were prepared as shown in fig6 . each of these materials was charged between the first and second substrates 1 , 7 shown in fig3 and the saturation voltage v sat was measured . it is noted that the chiral pitch of each of the materials ( 1 ) to ( 4 ) shown in fig6 is approximately 90 micrometers . the results of this experiment were as follows : the saturation voltage v sat of the material ( 1 ) was 2 . 73 v , that of the material ( 2 ) was 2 . 71 v , that of the material ( 3 ) was 2 . 63 v , and that of the material ( 4 ) was 2 . 61 v . for reference , the relationship between applied voltage and relative transmittance obtained by using the liquid crystalline material ( 1 ), and this relationship obtained by using the liquid crystalline material ( 4 ) are shown in fig7 and fig8 respectively . as is clear from the above experimental results , when the proportion of the molecule having the structural formula ( 1 ) is less than 60 % by weight , the saturation voltage v sat falls in the range of 2 . 6 to 2 . 8 v , and a desired low voltage of 2 . 5 v cannot be attained . in contrast , when the proportion of the molecule having the structural formula ( 1 ) is 60 % by weight or more , a saturation voltage v sat of 2 . 5 v or lower can be successfully attained . in this example , the liquid crystalline material shown in fig4 having an n - i transition temperature of 59 ° c . was used . for reference , liquid crystalline materials having an n - i transition temperature of 55 ° to 57 ° c ., prepared by changing the proportions of the molecules represented by the structural formulas ( 1 ), ( 2 ) and ( 3 ) were also subjected to the determination of saturation voltage . as a result , it was found that the saturation voltage v sat of any of these materials never exceeded 2 . 5 v . the reason of this fact may be such that these liquid crystalline materials were to have a lower elastic modulus as the n - i transition temperature thereof became lower , and , as a result , a lower saturation voltage was obtained . a liquid crystal display panel of tft - operated type , having the same structure as shown in fig3 was prepared also in this example , provided that the direction of rubbing the first alignment film 5 and that of rubbing the second alignment film 9 were made different from those in example 1 ; these alignment films were rubbed so that the twist angle would be 100 °. a liquid crystalline material 11 charged between the first and second alignment films 5 , 9 was also the same as the material used in example 1 , shown in fig4 . when the twist angle is made wider , a negatively - twisted area tends to be formed . in order to prevent negative twisting , a chiral pitch was adjusted to approximately 60 micrometers by controlling the amount of a chiral material added to the liquid crystalline material . in order to ensure sufficient contrast , polarizers 6 , 10 provided on the first and second substrates 1 , 7 , respectively , were so arranged that the directions of polarization thereof can make a right angle with each other . the direction of rubbing the first alignment film 5 and that of rubbing the second alignment film 9 relatively make an angle of 100 °, so that the direction of polarization of each of the polarizers is fixed as shown in fig9 . namely , the direction of rubbing the first alignment film 6 provided on the first substrate 1 was relatively shifted in 5 ° from the direction of polarization of the polarizer 6 ; the direction of rubbing the second alignment film 9 provided on the second substrate 7 was relatively shifted in 5 ° from the direction of polarization of the polarizer 10 . thereafter , the relationship between applied voltage and relative transmittance was examined . as a result , a characteristic curve as shown in fig1 was obtained , and the saturation voltage v sat was found to be 2 . 25 v , which is lower than the saturation voltage v sat obtained in example 1 . it is considered that the following principle can be applied to this result : one of the reasons why a high voltage is required to operate a liquid crystal display panel is such that liquid crystalline molecules existing at a position closest to the surface of the first and second alignment films 5 , 9 , by which the liquid crystalline material is sandwiched , do not immediately change the tilt angle thereof even when voltage is applied . the twist angle of the liquid crystalline molecules is adjusted to 95 ° to 110 °, and , at the same time , the relative angle of the polarizing axis of a pair of the polarizers 6 , 10 is fixed to a value different from the twist angle of the liquid crystalline molecules . by this , incident light is to enter the liquid crystal display panel from the direction which is shifted from the direction of alignment of the liquid crystalline molecules . as a result , the effect of the liquid crystalline molecules which are late in response can be decreased . by making the twist angle as wide as 95 ° to 110 °, the saturation voltage becomes lower than 2 . 5 v , and the margin of voltage upon operation with 2 . 5 v becomes wider . next , a liquid crystal display panel according to a second embodiment of the present invention is described . because there is not any constitutional difference between the conventional active element type liquid crystal display panel and the liquid crystal display panel according to the second embodiment , except for alignment films , alignment films according to the second embodiment and an alignment processing for the alignment films are mainly described . as shown in fig1 ( a ) and 11 ( b ), in a liquid crystal display panel according to the second embodiment , the plurality of scanning bus lines ( or scanning wiring lines ) 14 formed out of a metal such as cr are spaced at first regular intervals on the first plane of the first transparent substrate 11 , and the plurality of data bus lines ( or data wiring lines ) 19 are spaced at second regular intervals on the scanning bus lines 14 through an insulating film ( not shown ) to cross over the lines 14 . the data bus lines 19 extend in a direction perpendicular to another direction in which the scanning bus lines 14 extend . each of the pixel electrodes 13 is arranged on a portion of the first transparent substrate 11 surrounded by one of the scanning bus lines 14 and one of the data bus lines 19 . therefore , the pixel electrodes 13 are arranged in matrix shape . each of the pixel electrodes 13 is connected to one of the data bus lines 19 through the active element 20 , and each of the active elements 20 is operated by a voltage applied from one of the scanning bus lines 14 . a thin - film transistor ( tft ) or a metal - insulator - metal ( mim ) diode is used as the active element 20 . in cases where the tft is used , the scanning bus line 14 is sometimes called a gate bus line , and the data bus line 19 is sometimes called a drain bus line . the scanning bus lines 14 , the data bus lines 19 , the active elements 20 and the pixel electrodes 13 are covered by a first alignment film 25a . as shown in fig1 ( a ) to 12 ( d ), a surface of the first alignment film 25a is rubbed with a rubbing role 21 , so that an alignment processing is performed for the first alignment film 25a . in detail , the surface of the first alignment film 25a is rubbed with a piece of rubbing cloth 21a formed out of silk or rayon which is attached to a surface of the rubbing role 21 . the first alignment film 25a is rubbed to orient main axes of a plurality of liquid crystal molecules placed on the film 25a toward the same axial direction . also , on a first plane of the second transparent substrate 12 , the counter electrode ( or transparent electrode ) 16 and a second alignment film 25b are arranged in that order . in this case , it is applicable that a color filter be additionally arranged between the second alignment film 25b and the second transparent substrate 12 . a surface of the second alignment film 25b is rubbed with the rubbing cloth 21a of the rubbing role 21 , so that another alignment processing is performed for the second alignment film 25b . the first transparent substrate 11 and the second transparent substrate 12 are arranged on condition that the rubbed surface of the first alignment film 25a face the rubbed surface of the second alignment film 25b , and the liquid crystal 17 is packed in a region between the first alignment film 25a and the second alignment film 25b . therefore , the liquid crystal 17 are in contact with the rubbed surfaces of the first and second alignment films 25a and 25b . in addition , the polarizing plate 18a is arranged on a second plane of the first transparent substrate 11 , and the polarizing plate 18b is arranged on a second plane of the second transparent substrate 12 . a manufacturing method of the liquid crystal display panel according to the second embodiment is described in brief . the first alignment film 25a not rubbed is formed on the first transparent substrate 11 , and the second alignment film 25b not rubbed is formed on the second transparent substrate 11 . thereafter , the surfaces of the first and second alignment films 25a and 25b are rubbed , the first and second alignment films 25a and 25b are arranged on condition that the rubbed surfaces of the films 25a and 25b face each other , and the liquid crystal 17 are packed in a region between the first and second alignment films 25a and 25b . next , the alignment processing performed for the first alignment film 25a and the alignment processing performed for the second alignment film 25b are described with reference to fig1 ( a ) to 12 ( d ). because the films 25a and 25b are rubbed according to rubbing methods which differ from a conventional rubbing method , the inventors ascertain that the liquid crystal display panel according to the second embodiment can be operated by applying a lower voltage to the display panel . fig1 ( a ) and 12 ( b ) show a first rubbing method according to the second embodiment of the present invention , and fig1 ( a ) and 12 ( b ) show a second rubbing method according to the second embodiment of the present invention . as shown in fig1 ( a ) to 12 ( d ), in case of the rubbing of the first alignment film 25a , the first alignment film 25a formed on the first transparent substrate ( or a glass substrate ) 11 is placed on a stage 22 , and the rubbing role 21 to which the rubbing cloth 21a formed out of rayon is attached . the rubbing role 21 formed in a cylindrical shape has a diameter of almost 15 cm , and a moving speed of the stage 22 which is equivalent to a moving speed of the first transparent substrate 11 is about several tens mm / sec . also , in cases where the rubbing role 21 is moved in place of the stage 22 , the moving speed of the rubbing role 21 is about several tens mm / sec . when the first or second alignment film 25a or 25b is rubbed , the rubbing role 21 is rotated at a high speed of several hundreds rotations per minute by a driving mechanism ( not shown ), and a surface of the first or second alignment film 25a or 25b is rubbed with the rubbing cloth 21a . in this case , there are two types of rubbing methods . in case of a first rubbing method , as shown in fig1 ( a ) and 12 ( b ), the rubbing role 21 is not moved over the stage 22 , but the stage 22 placed under the rubbing role 21 is moved to rub a surface of the first or second alignment film 25a or 25b . in the first rubbing method , a moving direction of the transparent substrate 11 or 12 and the alignment film 25a or 25b is the same as that of the stage 22 . a rotational direction rd of the rubbing role 21 shown in fig1 ( a ) is set to make a rubbing direction sr of the rubbing role 21a on a surface of the alignment film 25a or 25b agree with a moving direction dd of the transparent substrate 11 or 12 . a rubbing condition ( or method ) that the rubbing direction sr of the rubbing role 21 on the surface of the alignment film 25a or 25b set by the rotational direction rd of the rubbing role 21 agrees with a moving direction dd of the stage 22 ( or the moving direction dd of the transparent substrate 11 or 12 ) is called a same - directional rubbing in this specification . in contrast , a rotational direction rd of the rubbing role 21 shown in fig1 ( b ) is set to make a rubbing direction sr of the rubbing role 21a on a surface of the alignment film 25a or 25b be opposite to a moving direction dd of the transparent substrate 11 or 12 . a rubbing condition ( or method ) that the rubbing direction sr of the rubbing role 21 on the surface of the alignment film 25a or 25b set by the rotational direction rd of the rubbing role 21 is opposite to a moving direction dd of the stage 22 ( or the moving direction dd of the transparent substrate 11 or 12 ) is called an opposite - directional rubbing in this specification . in case of a second rubbing method , as shown in fig1 ( c ) and 12 ( d ), the stage 22 is not moved , but the rubbing role 21 is moved in a moving direction hd over the stage 22 while rotating the rubbing role 21 on a surface of the alignment film 25a or 25b . a rotational direction rd of the rubbing role 21 shown in fig1 ( c ) is set to make a rubbing direction sr of the rubbing role 21a on a surface of the alignment film 25a or 25b be opposite to the moving direction hd of the rubbing role 21 . a rubbing condition shown in fig1 ( c ) is the same - directional rubbing because a relative moving relationship between the rubbing role 21 and the stage 22 is the same as that shown in fig1 ( a ). in contrast , a rotational direction rd of the rubbing role 21 shown in fig1 ( d ) is set to make a rubbing direction sr of the rubbing role 21a on a surface of the alignment film 25a or 25b agree with the moving direction hd of the rubbing role 21 . a rubbing condition shown in fig1 ( d ) is the opposite - directional rubbing because a relative moving relationship between the rubbing role 21 and the stage 22 is the same as that shown in fig1 ( b ). in fig1 ( a ) to 12 ( d ), a direction of a relative movement between the rubbing role 21 and the stage 22 is perpendicular to a rotational axis of the rubbing role 21 . however , the second embodiment is not limited to the rubbing methods shown in fig1 ( a ) to 12 ( d ). that is , as shown in fig1 ( a ) and 13 ( b ), even though a direction of a relative movement between the rubbing role 21 and the stage 22 is not perpendicular to the rotational axis of the rubbing role 21 , the rubbing condition is judged to be the same - directional rubbing or the opposite - directional rubbing . in detail , as shown in fig1 ( a ), in cases where a rubbing direction sr of the rubbing role 21a on a surface of the alignment film 25a or 25b set by the rotation of the rubbing roll 21 includes the same directional component as that of a moving direction of the stage 22 , the rubbing condition is judged to be the same - directional rubbing . also , as shown in fig1 ( b ), in cases where a rubbing direction sr of the rubbing role 21a on a surface of the alignment film 25a or 25b set by the rotation of the rubbing roll 21 includes a directional component opposite to that of a moving direction of the stage 22 , the rubbing condition is judged to be the opposite - directional rubbing . the inventors of the present invention examined a relationship between a potential difference between the counter electrode 16 and the pixel electrode 13 and a light transmittance for a first liquid crystal panel having the first alignment film 25a rubbed according to the same - directional rubbing and a second liquid crystal panel having the first alignment film 25a rubbed according to the opposite - directional rubbing . as a result , the inventors discovered that a saturation value ( hereinafter , called a saturation voltage ) of the voltage applied to the scanning bus lines 14 , denoting a voltage value at which the light transmittance is saturated , in the first liquid crystal panel having the alignment film rubbed according to the same - directional rubbing differs from that in the second liquid crystal panel having the alignment film rubbed according to the opposite - directional rubbing . experimental results indicating the difference in the saturation voltage between the first liquid crystal panel according to the same - directional rubbing and the second liquid crystal panel according to the opposite - directional rubbing are described . the saturation voltage v sat is defined as a voltage value at which the light transmittance is 1 % on condition that the light transmittance is set to 100 % when any voltage is not applied to the scanning bus lines 14 of the crystal panel ( a normal white display ). fig1 shows experimental results obtained by examining the relationship between the number of rubbing operations and the saturated voltage v sat for the first and second liquid crystal display panels . in this case , polyimide called a trade name &# 34 ; al1054 &# 34 ; and manufactured in nippon goseigomu ( synthetic rubber ) corp . is used as a material of the first and second alignment films 25a and 25b . also , the configurations of the first and second liquid crystal display panels are the same as the liquid crystal display panel shown in fig1 according to the second embodiment . also , the liquid crystal 17 includes fluorine ( f ) as a polar group , a dielectric constant ε 1 of the liquid crystal in a direction of its major axis is 12 . 5 , and a dielectric constant ε 2 of the liquid crystal in a direction of its minor axis is 3 . 8 . as shown in fig1 , the saturation voltage v sat in the first liquid crystal display panel having the first alignment film 25a rubbed according to the same - directional rubbing is about 3 . 1 v on average . in contrast , the saturation voltage v sat in the second liquid crystal display panel having the first alignment film 25a rubbed according to the opposite - directional rubbing is about 2 . 7 v on average and is about 0 . 4 v lower than that in the first liquid crystal display panel . therefore , it is ascertained that the saturation voltage v sat in the display panel according to the opposite - directional rubbing is lowered as compared with that in the display panel according to the same - directional rubbing . to examine the reason of the difference in the saturation voltage v sat , a difference in an inclined angle of a liquid crystal molecule placed just on the rubbed surface of the alignment film 25a or 25b when any voltage is not applied , in other words a difference in a so - called pre - tilt angle , is examined . however , the pre - tilt angle of the liquid crystal molecule in the second display panel according to the opposite - directional rubbing is almost the same as that in the first display panel according to the same - directional rubbing . therefore , a difference between an anchoring energy of liquid crystal molecules placed on the first display panel according to the same - directional rubbing and another anchoring energy of liquid crystal molecules placed on the second display panel according to the opposite - directional rubbing is examine . an anchoring energy for the second liquid crystal display panel ( the opposite - directional rubbing ) is on the order of 10 - 4 j / m 2 , and an anchoring energy for the first liquid crystal display panel ( the same - directional rubbing ) is on the order of 10 - 3 j / m 2 . therefore , it is ascertained that the difference of one figure in the anchoring energy exists between the second liquid crystal display panel ( the opposite - directional rubbing ) and the first liquid crystal display panel ( the same - directional rubbing ). in this case , the measurement of the anchoring energy is performed by referring a method disclosed in &# 34 ; h . yokoyama et al ., j . appl . phys . 61 ( 9 ), may 1 , 1987 , pp . 4501 - 4518 &# 34 ;. therefore , in cases where the alignment film 25a or 25b is rubbed according to the same - directional rubbing , the anchoring energy of the liquid crystal molecules placed on the alignment film 25a or 25b becomes high , and liquid crystal molecules placed in the neighborhood of the rubbed surface of the alignment film 25a or 25b slowly rise when an voltage is applied to the alignment film 25a or 25b . as a result , the saturated energy in the first display panel according to the same - directional rubbing becomes high . also , the same - directional rubbing and the opposite - directional rubbing are alternately performed for the alignment film 25a or 25b to repeatedly rub the alignment film 25a or 25b , and it is examined which rubbing condition influences on the alignment film 25a or 25b . a relationship between the number of rubbing operations and the saturation voltage v sat obtained as a result of the examination is shown in fig1 . as shown in fig1 , the opposite - directional rubbing is first performed , and the same - directional rubbing , the opposite - directional rubbing , the same - directional rubbing and the opposite - directional rubbing are repeatedly performed in that order . that is , the rubbing condition performed in an odd - numbered repeated rubbing is the opposite - directional rubbing , and the rubbing condition performed in an even - numbered repeated rubbing is the same - directional rubbing . the saturation voltage v sat changes each time the rubbing operation is performed . by comparing the fig1 and 15 with each other , the saturation voltage v sat in the odd - numbered repeated rubbing is almost the same as that in the opposite - directional rubbing shown in fig1 , and the saturation voltage v sat in the even - numbered repeated rubbing is almost the same as that in the same - directional rubbing shown in fig1 . therefore , it is ascertained that the saturation voltage v sat in the display panel is determined by the rubbing condition finally performed for the alignment film 25a or 25b . therefore , the judgement whether the rubbing condition performed for the alignment film 25a or 25b is the same - directional rubbing or the opposite - directional rubbing is performed by considering only the rubbing operation finally performed . as is described above , to operate the liquid crystal display panel by applying a low voltage to the display panel , it is effective that the anchoring energy for the alignment film 25a or 25b is made small by finally performing the opposite - directional rubbing , as well as the improvement of the liquid crystal material . however , in cases where the opposite - directional rubbing is performed over the entire surface of an alignment film , there is a case that the arrangement of liquid crystal molecules placed in the neighborhood of a peripheral portion of the pixel electrode 13 in the liquid crystal display panel is put out of order . for example , in case of an active device type liquid crystal display panel , because a high negative voltage is applied to the scanning bus lines 14 respectively arranged between a pair of pixel electrodes 13 , a potential difference occurs between each of the scanning bus lines 14 and each of the pixel electrodes 13 , and an electric field e having a component parallel to the surface of the alignment film 25a is generated for each of the scanning bus lines 14 ( refer to fig1 ( b )). therefore , a peculiar region of the first alignment film 25a on which a pre - tilt angle of each of liquid crystal molecules becomes too large or too small is locally generated just above a peripheral portion of each of the scanning bus lines 14 because of the generation of the electric field e . because a saturation voltage v sat in each of the peculiar regions differs from those in other regions , an image is displayed on the active device type liquid crystal display panel in disturbed condition , and the active device type liquid crystal display panel cannot be operated by applying a low voltage to the display panel . to solve the above problem , as shown in fig1 , portions of the first alignment film 25a arranged in pixel regions 13a are rubbed according to the opposite - directional rubbing , and the other portions of the first alignment film 25a arranged out of the pixel regions 13a are rubbed according to the same - directional rubbing . each of the pixel regions 13a is defined as a region placed just over one of the pixel electrodes 13 . each of shadowed portions surrounded by a dot - dash - line in fig1 denotes one of the pixel regions 13a . therefore , the anchoring energy in the portions of the first alignment film 25a placed just over the pixel electrodes 13 is made small , the anchoring energy in the other portions of the first alignment film 25a which are not placed on any pixel electrode 13 and are placed in the neighborhood of the bus lines 14 and 19 is made large , and the generation of the peculiar regions can be prevented . in the same manner , portions of the second alignment film 25b placed just above the pixel electrodes 13 are rubbed according to the opposite - directional rubbing , and the other portions of the second alignment film 25b not placed above any pixel electrode 13 are rubbed according to the same - directional rubbing . accordingly , because the anchoring energy in the portions of the alignment films 25a and 25b placed in the neighborhood of the bus lines 14 and 19 and not placed in any pixel region 13a is made large , liquid crystal molecules in the neighborhood of the bus lines 14 and 19 are not influenced by the electric field e , and the liquid crystal molecules can be reliably oriented toward the same direction and can reliably have the same pre - tilt angle . in this embodiment , the second alignment film 25b is rubbed according to the opposite - directional rubbing and the same - directional rubbing in the same manner as the first alignment film 25a . however , because the influence of the electric field e on the second alignment film 25 is small , it is applicable that all surface of the second alignment film 25b is rubbed according to the opposite - directional rubbing . a rubbing method in which the portions of the alignment films 25a and 25b are rubbed according to the opposite - directional rubbing and the other portions of the alignment films 25a and 25b are rubbed according to the same - directional rubbing is described with reference to fig1 ( a ) and 17 ( b ). as shown in fig1 ( a ), portions of the first alignment film 25a placed just over the pixel electrode 13 are covered with a plurality of first resist masks 23 , the other portions of the first alignment film 25a not covered with any first resist mask 23 are rubbed according to the same - directional rubbing , and the first resist masks 23 are removed . thereafter , as shown in fig1 ( b ), the other portions of the first alignment film 25a are covered with a second resist mask 24 having a plurality of windows 24a placed just over the pixel electrodes 13 , the other portions of the first alignment film 25a are rubbed through the windows 24a according to the opposite - directional rubbing , and the second resist mask 24 are removed . therefore , a plurality of first rubbing regions relating to the opposite - directional rubbing and a plurality of second rubbing regions relating to the same - directional rubbing are formed on the surface of the first alignment film 25a . next , a plurality of examples of the liquid crystal display panel manufactured according to the above - described technique are described in detail . as shown in fig1 ( a ) and 16 , the first transparent substrate 11 on which the plurality of pixel electrodes 13 are longitudinally and latitudinally arranged to form a plurality of pixels of 600 × 400 is used , and a normally white mode of liquid crystal display panel of which the cross sectional structure is shown in fig1 ( b ) is manufactured . in this case , a tft is used as each of the active elements 20 . each of the pixel electrodes 13 has a size of about 150 × 150 μm 2 , and a distance between the pixel electrode 13 and the scanning bus line 14 ( or the data bus line 19 ) is about 10 μm . as a material of the liquid crystal 17 , a liquid crystal having fluorine ( f ) on its end portion is used . polyimide called a trade name &# 34 ; al1054 &# 34 ; manufactured in nippon goseigomu ( synthetic rubber ) corp . is used as materials of the first and second alignment films 25a and 25b . the first and second alignment films 25a and 25b are formed by spin - coating the polyimide on the first and second transparent substrates 11 and 12 . the rubbing operation for the first alignment film 25a placed on the first transparent substrate 11 with the tft 20 is performed as follows . the rubbing operation is performed according to the method shown in fig1 ( a ) and 12 ( b ), and the rubbing role 21 of which a surface is covered with the rayon cloth 21a is used . as a condition of the rubbing operation , a pushing degree of the rayon cloth 21a in the first alignment film 25a is set to 0 . 3 mm , the number of repeated rubbing operations is set to five , a moving speed of the first transparent substrate 11 is set to 350 mm / sec , and a rotational speed of the rubbing role 21 is set to 300 rpm . thereafter , the portions of the first alignment film 25a placed in the pixel regions 13a are repeatedly rubbed five times according to the opposite - directional rubbing shown in fig1 ( b ), and the other portions of the first alignment film 25a not placed in any pixel region 13a are repeatedly rubbed five times according to the same - directional rubbing shown in fig1 ( a ). also , the rubbing operation is performed for the second alignment film 25b placed on the second transparent substrate 12 , on which any tft is not arranged , on the same condition . the portions of the second alignment film 25b placed just above the pixel electrodes 13 are repeatedly rubbed five times according to the opposite - directional rubbing shown in fig1 ( b ), and the other portions of the second alignment film 25b not placed above any pixel electrode 13 are repeatedly rubbed five times according to the same - directional rubbing shown in fig1 ( a ). thereafter , the saturation voltage v sat of the liquid crystal display panel manufactured as the first example is examined . also , a defective ratio r of pixels in the display panel is examined . in cases where one or more liquid crystal molecules placed just above a pixel ( or a pixel electrode 13 ) or placed in the neighborhood of the pixel abnormally rise on the alignment film 25a or 25b , it is judged that the pixel is defective . a result of the examination for the first example is shown in table 1 . in table 1 , the saturation voltage v sat in the normally white mode of liquid crystal display panel is defined as a voltage at which the light transmittance is 1 % on condition that the light transmittance is set to 100 % when a potential difference between the pixel electrode 13 and the counter electrode 16 is zero . also , the defective ration r is expressed by the number of pixels judged to be defective among 500 pixels . also , a first liquid crystal display panel ( not shown ) having the first alignment film 25a of which all surface is rubbed according to the same - directional rubbing is manufactured as a first comparing sample , and a second liquid crystal display panel ( not shown ) having the first alignment film 25a of which all surface is rubbed according to the opposite - directional rubbing is manufactured as a second comparing sample . thereafter , the saturation voltage v sat and the defective ration r of the pixels are examined for the first and second liquid crystal display panels . results of the examination for the first and second comparing samples are also shown in table 1 . the configurations of the first and second liquid crystal display panels are the same as that of the liquid crystal display panel manufactured as the first example , except for the rubbing direction of the first alignment film 25a . table 1______________________________________ first second first comparing comparing example sample sample______________________________________v . sub . sat 2 . 75 v 3 . 16 v 2 . 72 vr 0 0 120______________________________________ as is apparent in table 1 , in case of the first liquid crystal display panel ( the first comparing sample ), though the defective ratio r of the pixels is zero , the saturation voltage v sat is not lowered . also , in case of the second liquid crystal display panel ( the second comparing sample ), though the saturation voltage v sat is lowered , the defective ratio r of the pixels is high . in contrast , in case of the liquid crystal display panel manufactured as the first example , the defective ratio r of the pixels is zero , and the saturation voltage v sat is lowered . therefore , a merit that the saturation voltage v sat is lowered by the opposite - directional rubbing and another merit that the orientation of the liquid crystal molecules is stabilized by the same - directional rubbing can be obtained in the liquid crystal display panel according to the second embodiment . a distance between each of the pixel electrodes 13 ( or pixels ) and each of the bus lines 14 and 19 in the liquid crystal display panel manufactured as the first example is shortened to 5 μm in a second example . in this case , the defective ratio r of the pixels is undesirably increased to about 250 . therefore , as shown in fig1 ( a ), a peripheral portion of each pixel region 13a which is placed in a range from a boundary line of a pixel region 13a to an inside line placed inward from the boundary line of the pixel region 13a by 10 μm is defined as a frame - shaped region 13b of the first alignment film 25a , and a central portion of each pixel region 13a which is placed inside of the frame - shaped region 13b is defined as an inside region 13c of the first alignment film 25a . the inside regions 13c of the first alignment film 25a are denoted by shadowed portions shown in fig1 ( a ). the frame - shaped regions 13b of the first alignment film 25a are rubbed according to the same - directional rubbing as well as the other portions of the first alignment film 25a not placed over any pixel electrode 13 , and the inside regions 13c of the first alignment film 25a are selectively rubbed according to the opposite - directional rubbing . in the same manner , inside regions of the second alignment film 25b narrower than the portions of the second alignment film 25b arranged just above the pixel electrodes 13 are defined , frame - shaped regions of the second alignment film 25b surrounding the inside regions of the second alignment film 25 are defined , the frame - shaped regions of the second alignment film 25b are rubbed according to the same - directional rubbing as well as the other portions of the second alignment film 25b not placed above any pixel electrode 13 , and the inside regions of the second alignment film 25b are selectively rubbed according to the opposite - directional rubbing . as a result , a liquid crystal display panel is manufactured as a second example . the defective ratio r of the pixels in the second example is reduced to zero . in this case , the saturation voltage v sat is 2 . 8 v . the reason that the defective ratio r is reduced is as follows . when the anchoring energy in the frame - shaped regions 13b of the first alignment film 25a which are placed in the neighborhood of the bus lines 14 and 19 is large , it becomes difficult to change the pre - tilt angle of liquid crystal molecules placed on the frame - shaped regions 13b of the first alignment film 25a even though the electric field e caused by the bus lines 14 and 19 influences on the liquid crystal molecules . therefore , the orientation of the major axes of the liquid crystal molecules is not disturbed by the electric field e . a distance between each of the pixel electrodes 13 ( or pixels ) and each of the bus lines 14 and 19 in the liquid crystal display panel manufactured as the first example is shortened to 8 μm in a third example . in this case , the defective ratio r of the pixels is increased to about 60 . therefore , the first alignment film 25a placed on the first transparent substrate 11 on which the tft 20 is arranged is rubbed according to the same - directional rubbing and the opposite - directional rubbing , in the same manner as in the second example . in contrast , all surface of the second alignment film 25b placed on the second transparent substrate 12 on which any tft is not arranged is rubbed according to the opposite - directional rubbing . as a result , a liquid crystal display panel is manufactured as a third example . the defective ratio r of the pixels in the third example is reduced to zero . in this case , the saturation voltage v sat is 2 . 8 v . the reason that the defective ratio r is reduced is that a strength of the electric field e caused by a potential difference between the pixel electrode 13 and the bus lines 14 and 19 is low on the surface of the second alignment film 25b . a difference between the liquid crystal display panel manufactured as the first example and a liquid crystal display panel manufactured as a fourth example is that the number of rubbing operations is changed in the fourth example . that is , the rubbing operations are performed twice for the portions of the first and second alignment films 25a and 25b according to the opposite - directional rubbing , and the rubbing operations are repeatedly performed five times for the other portions of the first and second alignment films 25a and 25b according to the same - directional rubbing . in this case , the other rubbing conditions such as the pushing degree of the rayon cloth 21a in the alignment films 25a and 25b , the moving speed of the transparent substrates 11 and 12 and the rotational speed of the rubbing role 21 are the same as those in the first example . as a result , a liquid crystal display panel is manufactured as a fourth example . the defective ratio r of the pixels in the third example is reduced to zero . in this case , the saturation voltage v sat is reduced to 2 . 71 v which is lower than that in the first example . the same effect is obtained by changing the pushing degree of the rayon cloth 21a in the alignment films 25a and 25b , the moving speed of the transparent substrates 11 and 12 or the rotational speed of the rubbing role 21 . also , following conditions can be selected to lower the anchoring energy for the purpose of lowering the saturation energy , as well as the selection of the same - directional rubbing and the opposite - directional rubbing . that is , when at least one of selective conditions such as the decrease of the pushing degree of the rayon cloth 21a , the decrease of the moving speed of the transparent substrates 11 and 12 and the decrease of the rotational speed of the rubbing role 21 is adopted , the display panel can be operated by applying a low voltage to the display panel . also , in cases where at least one of the selective conditions is additionally adopted when the alignment film 25a or 25b is rubbed according to the opposite - directional rubbing , the anchoring energy for the alignment film 25a or 25b can be more over lowered , and the display panel can be operated by applying a lower voltage to the display panel . in the second and third examples , as shown in fig1 ( a ), the liquid crystal molecules being prevented from abnormally rising on the first alignment film 25a because of the electric field e by rubbing the frame - shaped regions 13b of the first alignment film 25a according to the same - directional rubbing . in this case , the electric field e influencing the liquid crystal molecules placed on the frame - shaped regions 13b of the first alignment film 25a is not generated so much by a potential difference between the data bus line 19 and the pixel electrode 13 but is mainly generated by a potential difference between the scanning ( or gate ) bus line 14 and the pixel electrode 13 . therefore , as shown in fig1 ( b ), two peripheral portions of each pixel region 13a placed in the neighborhood of the gate bus line 14 are defined as gate - side regions 13d , and the gate - side regions 13d of the first alignment film 25a are rubbed according to the same - directional rubbing . also , a plurality of central regions 13e of the first alignment film 25a respectively placed between the two gate - side regions 13d are rubbed according to the opposite - directional rubbing . as a result , a liquid crystal display panel is manufactured as a fifth example . in this case , the defective ratio r and the saturation voltage v sat are the same as those in the second and third examples , and the same effect can be obtained . in the second embodiment , an active element type twisted nematic ( tn ) liquid crystal display panel is used as the liquid crystal display panel . however , even though another type tn liquid crystal display panel is used , the same effect can be obtained . in the above first embodiment of the present invention , a direction for rubbing the surfaces of the alignment films 25a and 25b is the same as or opposite to a moving direction of the alignment film 25a or 25b , and the saturation voltage v sat in the display panel according to the second embodiment is lowered as compared with that in a conventional display panel . the reason that the saturation voltage v sat is lowered is that the energy in the alignment film 25a or 25b is lowered . therefore , the inventors tried to change the anchoring energy in the alignment film 25a or 25 by using orientation methods other than the change of the rubbing condition . as the orientation methods , three orientation methods are known . first , an orientation method for orienting liquid crystal molecules on an alignment film toward the same direction by forming a plurality of grooves in the alignment film is disclosed in a literature &# 34 ; sid digest 93 digest , 1993 , pp . 957 - 960 &# 34 ;. secondly , an orientation method for orienting liquid crystal molecules on an alignment film toward the same direction by radiating electro - magnetic wave to the alignment film is disclosed in a literature &# 34 ; martin schadt et al ., japan , j . apply . phys . vol . 31 , 1992 , pp . 2155 - 2164 &# 34 ;. thirdly , an orientation method for orienting liquid crystal molecules on an alignment film toward the same direction by using a langnuir - blodgett ( lb ) film as the alignment film is disclosed in a literature &# 34 ; makoto murata et al ., japan , j . apply . phys . vol . 31 , 1992 , pp . l189 - l192 &# 34 ;. the direction of the orientation is set to an extension direction of the lb film . the decrease of the anchoring energy in the alignment film according to each of the orientation methods is examined by the inventors . that is , the anchoring energy of the order of 10 - 5 to 10 - 4 j / m 2 is observed , as is described in the literature . therefore , it is apparent that the anchoring energy in the alignment film according to each of the orientation methods is lowered by one or more figures as compared with the change of the rubbing condition . in this case , the measuring method of the anchoring energy is the same as that adopted in the second embodiment . in cases where the alignment films 25a and 25b of the active element type liquid crystal display panel shown in fig1 ( a ) and 11 ( b ) are processed according to one of the three orientation methods , an orientation defective region is generated on the alignment films 25a and 25b . the reason of the generation of the orientation defective region is as follows . in cases where the anchoring energy of a portion of the alignment film 25a or 25b placed in the neighborhood of the scanning bus line 14 or the data bus line 19 is low , a plurality of liquid crystal molecules placed on the portion of the alignment film 25a or 25b rise up in various directions in disorder because of a component of the electric field e extending from the bus line 14 or 19 in a lateral direction , and a so - called reverse tilt region equivalent to the orientation defective region is generated on the portion of the alignment film 25a or 25b placed in the neighborhood of the bus line 14 or 19 . the electric field e is generated by a potential difference between the bus line 14 or 19 and each pixel electrode 13 as is described in the second embodiment . to prevent the generation of the reverse tilt region , it is effective that the anchoring energy in portions of the alignment films 25a and 25b placed just over the pixel electrodes 13 is lowered and the anchoring energy in other portions of the alignment films 25a and 25b placed just over the bus lines 14 and 19 or placed in the neighborhood of the bus lines 14 and 19 is heightened . therefore , after the alignment films 25a and 25b of the liquid crystal display panel shown in fig1 ( a ) and 11 ( b ) are processed according to one of the three orientation methods , the portions of the alignment films 25a and 25b placed just over the pixel electrodes 13 are covered with resist masks , and the other portions of the alignment films 25a and 25b not covered with any resist mask are rubbed , for example , according to the same - directional rubbing described in the second embodiment . therefore , the anchoring energy of other portions of the alignment films 25a and 25b is heightened . in the third embodiment , both the alignment films 25a and 25b are processed according to one of the three orientation methods . however , because the reverse tilt region caused by the electric field e is not generated so much on the second alignment film 25b placed on the second transparent substrate 12 on which any active element is not arranged but is mainly generated on the first alignment film 25a placed on the first transparent substrate 11 on which the active element 20 is arranged , it is applicable that only the second alignment film 25b be processed according to one of the three orientation methods . in this case , though the voltage applied to the scanning bus lines 14 of the liquid crystal panel for the purpose of operating the display panel is heightened a little , it is sufficient to prevent the generation of the reverse tilt region . also , it is preferred that the pre - tilt angle of liquid crystal molecules placed on portions of the alignment film 25a or 25b which are not arranged on any pixel electrode 13 be large . as a first reason , because the pre - tilt angle of liquid crystal molecules which are placed on the portions of the alignment films 25a and 25b processed according to one of the orientation methods is almost zero and small , when the pre - tilt angle of liquid crystal molecules which are placed on the other portions of the alignment films 25a and 25b not arranged on any pixel electrode 13 is enlarged , an average pre - tilt angle of the liquid crystal molecules placed on all surface of the alignment film 25a or 25b can be increased to a value more than zero . as a second reason , the larger the pre - tilt angle of the liquid crystal molecules on the alignment film 25a or 25b , the more effectively the generation of the reverse tilt region is prevented . accordingly , it is required to set the pre - tilt angle of the liquid crystal molecules placed on portions of the alignment film 25a or 25b which are not arranged on any pixel electrode 13 to 5 degrees or more , or preferably 10 degrees or more , by selecting the rubbing condition . in general , a pre - tilt angle of liquid crystal molecules ranges from 2 to 3 degrees . in this first example , a normally white mode type liquid crystal display panel is used . the configuration of the display panel is the same as that manufactured according to the first example of the second embodiment , except for the alignment films 25a and 25b . a liquid crystal having fluorine ( f ) on its end portion is used as the liquid crystal 17 . therefore , a fundamental configuration of the display panel is the same as that shown in fig1 ( a ) and 11 ( b ). as a material composing the alignment films 25a and 25b , a resin which is called rn1046 ( trade name ) manufactured by nissan kagaku ( or chemistry ) corp . is used in the first example . the resin is spin - coated , heated and formed in a film shape . a plan view of the first alignment film 25a arranged on the first transparent substrate 11 on which the active element 20 is arranged is shown in fig1 . after the first alignment film 25a is formed on the first transparent substrate 11 , as shown in fig2 ( a ), the pixel regions 13a of the first alignment film 25a placed just over the pixel electrodes 13 are covered with first resist films 26 . thereafter , remaining surfaces of the first alignment film 25a not covered with any first resist mask 26 are rubbed in a particular rubbing direction , and the first resist masks 26 are removed . therefore , the pre - tilt angle of liquid crystal molecules placed on the remaining surfaces of the first alignment film 25a rubbed is set to about 6 degrees . thereafter , as shown in fig2 ( b ), a photomask 27 arranged on a polarizing plate 28 is prepared . the photomask 27 has a plurality of windows 27a placed just above the pixel regions 13a of the first alignment film 25a , thereafter , the pixel regions 13 a of the first alignment film 25a are radiated by ultra - violet light representing electro - magnetic wave through the polarizing plate 28 and the windows 27a of the photomask 27 . in this case , the ultra - violet light passing through the polarizing plate 28 is linearly polarized in a polarization direction perpendicular to the particular rubbing direction . also , the strength of the ultra - violet light is set to about 15 j / cm 2 . therefore , major axes of liquid crystal molecules placed on the pixel regions 13 a of the first alignment film 25a which are radiated by the ultra - violet light linearly polarized in the polarization direction are oriented in the same polarization direction . the above rubbing processing and the radiation of the ultra - violet light are also performed for the second alignment film 25b arranged on the second transparent substrate 11 on which any active element is not arranged , in the same manner . that is , portions of the second alignment film 25b placed just above the pixel electrodes 13 are radiated by the ultra - violet light linearly polarized in the polarization direction to orient major axes of liquid crystal molecules placed on the portions of the second alignment film 25b in the same polarization direction , and remaining portions of the second alignment film 25b are rubbed in a rubbing direction perpendicular to the polarization direction according to a normal rubbing . thereafter , the liquid crystal 17 is packed between first and second alignment films 25a and 25b , and a liquid crystal display panel manufactured as the first example of the third embodiment is obtained . the saturation voltage v sat of the liquid crystal display panel and the defective ratio r of the pixels are examined and listed on table 2 as the first example . in this case , the saturation voltage v sat is defined as a voltage value at which the light transmittance is 1 % on condition that the light transmittance is set to 100 % when any voltage is not applied to the scanning bus lines 14 of the normally white mode type crystal panel . also , the defective ratio r is expressed by the number of pixels judged to be defective among 500 pixels . also , a first liquid crystal display panel ( not shown ) in which all surfaces of the first and second alignment films 25a and 25b are rubbed according to the same - directional rubbing is prepared , and the saturation voltage v sat of the first liquid crystal display panel and the defective ratio r of the pixels are listed in table 2 as a first comparing sample . also , a second liquid crystal display panel ( not shown ) in which all surfaces of the first and second alignment films 25a and 25b are radiated by the ultra - violet light linearly polarized is prepared , and the saturation voltage v sat of the second liquid crystal display panel and the defective ratio r of the pixels are listed in table 2 as a second comparing sample . the configurations and manufacturing conditions of the first and second liquid crystal display panels are the same as those of the liquid crystal display panel manufactured as the first example of the third embodiment . table 2______________________________________ first second first comparing comparing example sample sample______________________________________v . sub . sat 2 . 71 v 3 . 16 v 2 . 7 vr 0 0 180______________________________________ as is apparent in table 2 , in case of the first liquid crystal display panel ( the first comparing sample ), though the defective ratio r of the pixels is zero , the saturation voltage v sat is not lowered . also , in case of the second liquid crystal display panel ( the second comparing sample ), though the saturation voltage v sat is lowered , the defective ratio r of the pixels is high . in contrast , in case of the liquid crystal display panel manufactured as the first example of the third embodiment , the defective ratio r of the pixels is zero , and the saturation voltage v sat is lowered . therefore , a merit that the saturation voltage v sat is lowered by the decrease of the anchoring energy caused by the radiation of the ultra - violet light and another merit that the orientation of the liquid crystal molecules toward the same direction is stabilized by the rubbing processing can be obtained in the liquid crystal display panel according to the third embodiment . also , after all surfaces of the first and second alignment films 25a and 25b are rubbed in a rubbing direction according to the same - directional rubbing , the pixel regions 13a of the first alignment film 25a and the portion of the second alignment film 25b arranged just above the pixel electrodes 13 are radiated by the ultra - violet light linearly polarized in the polarization direction perpendicular to the rubbing direction through the windows 27a of the photomask 27 . in this case , the saturation voltage v sat is 2 . 75 v which is sufficiently low , and the defective ratio r of the pixels is zero . therefore , because the formation of the resist mask 26 is not required , the manufacturing method of the display panel according to the third embodiment can be simplified , and a throughput of the display panels can be improved . a distance between each of the pixel electrodes 13 ( or pixels ) and each of the bus lines 14 and 19 in the liquid crystal display panel manufactured as the first example is shortened to 5 μm in a second example . in this case , the defective ratio r of the pixels is undesirably increased to about 280 . therefore , the first alignment film 25a on the first transparent substrate 11 on which the active element 20 is arranged is not radiated by the ultra - violet light , but all surface of the first alignment film 25a is rubbed according to the same - directional rubbing . also , as for the second alignment film 25b on the second transparent substrate 12 on which any active element is not arranged , the portions of the second alignment film 25b placed just above the pixel electrodes 13 is radiated by the ultra - violet light linearly polarized in the same manner as in the first example , and remaining portions of the second alignment film 25b are rubbed according to a normal rubbing . in this case , the saturation voltage v sat of the liquid crystal display panel is 2 . 85 , and the defective ratio r of the pixels is zero . therefore , the display panel can be operated by applying a lower voltage to the display panel as compared with the applied voltage in the conventional display panel . a distance between each of the pixel electrodes 13 ( or pixels ) and each of the bus lines 14 and 19 in the liquid crystal display panel manufactured as the first example is also shortened to 5 μm in a third example . in this case , the defective ratio r of the pixels is undesirably increased to about 280 . therefore , the defective ratio r of the pixels is reduced by changing the pre - tilt angle of liquid crystal molecules arranged on the other portions of the first or second alignment film 25a or 25b which are not placed just over or above any pixel electrode 13 . in detail , as a material of the first and second alignment films 25a and 25b , jals - 214 ( trade name ) manufactured by a nippon gosei gomu ( japan synthetic rubber ) corp . is used . the pre - tilt angle can be easily adjusted by using the material . the adjustment of the pre - tilt angle is performed by changing one of the rubbing conditions . for example , the pre - tilt angle is lowered as the number of rubbing operations repeated is increased , and the pre - tilt angle is lowered as the pushing degree of the rubbing cloth 21a in the alignment film 25a or 25b is increased . when the pre - tilt angle θ of the liquid crystal molecules on the alignment film 25a or 25b is changed by changing the number of rubbing operations repeated , a relationship between the defective ratio r of the pixels and the pre - tilt angle θ is shown in fig2 . a numeral written in parentheses indicates the number of rubbing operations repeated . as shown in fig2 , when the pre - tilt angle θ is set to 10 degrees or more , the defective ratio r is reduced to zero . in this case , the saturation voltage v sat of the liquid crystal display panel is lowered to values ranging from 2 . 70 to 2 . 75 v regardless of the change of the pre - tilt angle θ . in the above first to third examples , electro - magnetic wave such as ultra - violet light is radiated to the portions of the first or second alignment film 25a or 25b placed just over or above the pixel electrodes 13 , and the anchoring energy of the portions of the first or second alignment film 25a or 25b is lowered . to lower the anchoring energy of the portions of the first or second alignment film 25a or 25b according to other methods , as shown in fig2 ( a ), a method for forming a plurality of grooves 25c direction on upper surfaces of the first or second alignment film 25a or 25b placed just over or above the pixel electrodes 13 is applicable . in this method , major axes of liquid crystal molecules placed on the upper surfaces of the first or second alignment film 25a or 25b are oriented toward a direction in which the grooves 25c extend . also , as shown in fig2 ( b ), another method for using the lb film as a material of the first or second alignment film 25a or 25b is applicable . in this method , major axes of liquid crystal molecules placed on the first or second alignment film 25a or 25b are oriented toward a direction in which the lb film is pulled . in the above methods , the other portions of the first or second alignment film 25a or 25b not arranged on or above any pixel electrode 13 are rubbed according to a normal rubbing . in the fourth embodiment , the anchoring energy of the portions of the first or second alignment film 25a or 25b placed just over or above the pixel electrodes 13 is lowered . however , in cases where the electric field e caused by a potential difference between the bus line 14 or 19 and the pixel electrode 13 greatly influences liquid crystal molecules placed on the first or second alignment film 25a or 25b , it is preferred that the frame - shaped regions 13b of the first alignment film 25a and the frame - shaped regions of the second alignment film 25b defined in the second example of the second embodiment ( refer to fig1 ( a )) be rubbed according to the same - directional rubbing as well as the other portions of the alignment films 25a and 25b . also , in cases where the electric field e caused by a potential difference between the scanning bus line 14 and the pixel electrode 13 greatly influences liquid crystal molecules placed on the first alignment film 25a , it is preferred that the gate - side regions 13d of the first alignment film 25a defined in the fifth example of the second embodiment ( refer to fig1 ( b )) be rubbed according to the same - directional rubbing . in the third embodiment , the active element type twisted nematic ( tn ) liquid crystal display panel is used . however , even though another type liquid crystal display panel such as a simple matrix type tn liquid crystal display panel is used , the same effect can be obtained . fig2 ( a ) is a plan view of a simple matrix type tn liquid crystal display panel according to a third embodiment of the present invention . fig2 ( b ) is a cross sectional view of the simple matrix type tn liquid crystal display panel shown in fig2 ( a ). as shown in fig2 ( a ) and 23 ( b ), a plurality of scanning wiring lines 34 spaced at regular intervals are arranged in parallel on a first surface of a first transparent substrate 31 , and the first surface of the first transparent substrate 31 and the plurality of scanning wiring lines 34 are covered with a first alignment film 35a . also , a plurality of data wiring lines 39 spaced at regular intervals are arranged in parallel on a first surface of a second transparent substrate 32 facing the first surface of the first transparent substrate 31 . the first surface of the second transparent substrate 32 and the data wiring lines 39 are covered with a second alignment film 35b . the first surfaces of the first and second alignment films 35a and 35b face each other through a liquid crystal 37 packed , and an extending direction of the scanning wiring lines 34 is perpendicular to that of the data wiring lines 39 . in addition , a polarizing plate 38a is arranged on a second surface of the first transparent substrate 31 , and a polarizing plate 38b is arranged on a second surface of the second transparent substrate 32 . in the above configuration of a simple matrix type tn liquid crystal display panel , each of the pixel regions 13a is placed in a region of the first alignment film 35a in which one scanning wiring line 34 and one data wiring line 39 cross over each other . also , each of the pixel regions is placed in a region of the second alignment film 35b in which one scanning wiring line 34 and one data wiring line 39 cross over each other . the anchoring energy of liquid crystal molecules placed on the pixel regions 13a of the first alignment film 35a is lowered by rubbing the pixel regions 13a according to the opposite - directional rubbing , by radiating the ultra - violet light linearly polarized to the pixel regions 13a , by arranging a plurality of grooves on the first surface of the first alignment film 35a or by using the lb film as a material of the first surface of the first alignment film 35a . also , the anchoring energy of liquid crystal molecules placed on other portions of the first alignment film 35a is heightened by rubbing the other portions of the first alignment film 35a according to the same - directional rubbing . therefore , the liquid crystal molecules placed on the pixel regions 13a can easily rise up when a voltage is applied to the scanning wiring lines 34 , so that an operation voltage required to operate the simple matrix type tn liquid crystal display panel according to the fourth embodiment can be lowered . also , because a rising motion of the liquid crystal molecules placed on the other portions of the first alignment film 35a is slowly performed , the generation of defective pixels can be prevented . it is applicable that the distribution of the anchoring energy in the second alignment film 35b be formed in the same manner as that in the first alignment film 35a . in this case , the liquid crystal molecules placed on the second alignment film 35b rise up in the same manner as those on the first alignment film 35a . | 2 |
in a diagrammatic , perspective view , fig1 shows a gas cooking appliance 1 of the first version , installed in a sill plate 3 . the gas cooking appliance has a glass - ceramic plate 2 as a cooking surface , which is attached to a cooking area frame 8 , generally by gluing with a silicone adhesive . in the embodiment according to fig1 the gas cooking appliance has three cooking zones 4 that are heated by means of gas - radiation burners ( not shown ) that are arranged under the glass - ceramic plate . as indicated overall by the above - cited de 43 26 945 c2 , an insulating part 9 , which can also be seen partially from the cutaway view of fig2 of this application , is provided below glass - ceramic plate 2 to provide a gap therebetween . this insulating part 9 has recesses ( not shown ) for the gas - radiation burners , but also exhaust gas ducts 6 for discharging exhaust gases from the individual gas - radiation burners . exhaust gas ducts 6 are joined below a cooking - surface zone 5 that is often used for boiling off and finally end in an exhaust gas opening 8a that is designed according to the invention . to form exhaust gas opening 8a , cooking surface 2 is beveled upward around a line 2a in the rear part in such a way that unitary beveled portion 2b projects upward like a panel . there is a back wall provided by the frame 8 which is in fig1 spaced from the rear edge of the bent area 2b . here , cooking surface 2 is glued in cooking surface - frame housing 8 in such a way that a slot - shaped , adhesive - free opening 8a is formed as an outlet opening for hot exhaust gases 7 at the rear of the cooking surface 2 and gas cooking appliance 1 . the control knobs c are shown at the right side of the cooking surface but may be at the front of the cooking surface as is shown in fig1 . according to the corresponding cutaway view , hot exhaust gases 7a of several hundred degrees flow into exhaust gas ducts 6 that are made from insulating elements 9 to outlet opening 8a and , shortly before this , are mixed with cold air 7b that a fan produces , so that overall a considerably colder exhaust gas stream 7 leaves the gas cooking appliance . to protect the bent cooking surface edge , optionally a metal contour 8b can be mounted mechanically . this contour must not be glued with silicone since in this case it would not seal . the overflow protection in this design is ensured by the portion of cooking surface 2b that is beveled upward . the advantage of the design of exhaust gas opening 8a lies in the fact that , on the one hand , no adhesive compounds are located in the hot exhaust gas stream and in that overflow protection is automatically ensured by the shape of the cooking surfaces . in addition , the ventilation lattices are omitted from the metal frame , which , on the one hand , have a negative impact on the overall design , and , on the other hand , impede cleaning . this type of design according to the invention can also be used for gas cooking appliances of the second version with atmospheric burners . in this case , opening 8a is used as a fresh air opening for primary air . fig3 shows a diagram of such a gas cooking appliance 1 with an atmospheric burner 10 , which is recessed in the conventional way in glass - ceramic plate 2 . generally , a cooking area has three to four such open burners 10 . glass - ceramic plate 2 is glued into cooking area frame housing 8 , whereby the gas cooking appliance itself is installed in sill plate 3 . unlike in fig1 only to indicate the possible variations , bending edge 2a with bent area 2b lies on the ( right ) side of cooking surface 2 . in this case , as in fig1 a slot - shaped opening 8a is made between the upper edge of bent area 2b and frame 8 , via which fresh air or primary air 11 flows into the cooking area . as in fig1 bending edge 2a can , of course , also be arranged on the rear side or on the left side of the cooking surface . which alternative is selected depends on the design and the appliances that are arranged in the vicinity of the gas cooking appliance in sill plate 3 . fig4 shows another embodiment of the invention with respect to the design of the opening for fresh air or exhaust air , whereby the case of exhaust air is depicted . parts that are identical to those according to fig1 - 3 are given the same reference numbers . in fig4 beveled area 2b has a partial recess 2c that forms exhaust gas opening 8a , through which cooled exhaust gases 7 flow out . in addition , the upper edge of bent area 2b is embedded in cooking area frame 8 . in the case of fig4 opening 8a is thus not formed by a space ( gap ) in other appliance parts , as in fig1 - 3 , but by a recess in bent area 2b itself . fig5 shows another embodiment according to this principle . accordingly , bent area 2b has recesses 2d that are arranged like a line , through which the exhaust air or fresh air flows . the circular recess is indicated only by way of example . if design considerations so dictate , other geometric configurations can also be used . the line - like arrangement is also given only by way of example . recesses 2d can also be arranged in an offset pattern , for example . recesses 2d are invariably to be arranged in such a way that they are sufficiently far from the cooking surface plane , thus ensuring overflow protection . otherwise , the upper edge of bent area 2b is completely embedded in cooking area frame 8 ; this stresses an overall closed impression . fig5 a shows an arrangement similar to that of fig5 . in this case , glass - ceramic plate 2 of the cooking surface is bent over two bending edges 2a , in such a way that the area 2b with recesses 2d is raised by a portion 2h that extends at an obtuse angle θ relative to the cooking surface to extend horizontal plane and is arranged plane parallel to the cooking surface . in this embodiment , the exhaust gas flows vertically upward , which has an advantageous effect for catching exhaust gases in the exhaust hoods that are usually present in the kitchen . also advantageously , the exhaust gases cannot gradually discolor any wall parts of the kitchen appliance . fig6 shows an arrangement analogous to that according to fig2 whereby , however , outlet opening 8a is not made , as in the case of fig2 between the upper edge of the bent area that is protected by a contour 8b and an elevation of cooking area frame 8 , but between this edge and a lowered side of frame 8 , so that exhaust air 7 flows toward the rear . fig7 shows a partial area 2b that is formed bent concentrically toward the rear as a ventilation duct ( fresh air or exhaust air ), in contrast to the preceding embodiments with a bent area 2b , which extends completely over one side of the cooking surface . in this case , partial area 2b also does not have to be located concentrically to the cooking surface side , as in fig7 ; it can also be molded on eccentrically , i . e ., on one side , as depicted in fig8 specifically , relative to the cooking surface , either behind or to the right or else to the left . fig9 and 10 also show widely differing possible variations for the design of bent area 2b in the example of an upright range 12 at front and rear edge areas 14 and 15 . in upright range 12 according to fig9 which is designed with an integrated switch part 13 as a gas cooking appliance with open gas burners 10 ( as in fig3 ), glass - ceramic plate 2 is bent downward toward the front , adjacent edge 14 whereby the opening for fresh air 11 is made in area 2b . upright range 12 according to fig1 can be designed as desired as a gas cooking appliance with gas - radiation burners or as an appliance with atmospheric burners . the glass - ceramic plate is therefore partially bent both forward adjacent from edge 15 and toward the rear at rear edge 5 , with the formation of an area 2b in each case . in this case , front area 2b forms the intake opening for the primary - fresh air in the case of open burners ; conversely , rear partial bend 2b forms the opening for the discharge of exhaust air 7 in the case where upright range 12 is equipped with gas - radiation burners . in the previous embodiments , the opening for exhaust air and fresh air was formed between the upper edge of the bend and a cooking area or range device part . in fig1 and 12 , embodiments are depicted in which the opening is made in a part of another type of cooking appliance . fig1 shows a recessed tray with glass - ceramic cooking surfaces , composed of an electric part a and a gas part b . glass - ceramic plate 2 of electric part a has cooking zones 14 and a lip 2e that is bent downward by 90 ° and has a lower edge . glass - ceramic plate 2 of gas part b , which is lower than electric part a , has open burners 10 and a rectangular lip 2b that is bent upward and has an upper edge , whereby a certain distance is left between bent areas 2b and 2e that acts as an intake opening for fresh air 11 in gas burner part b . in a corresponding way , fig1 shows a cooking table that is composed of an electric part a with a glass - ceramic plate 2 , which has a rectangular beveled area 2e and cooking zones 14 , as well as a gas part b , which is lower than electric part a , with a glass - ceramic plate 2 , which has a rectangular partial area 2b that is bent upward ( covered partially by beveled edge 2e in the drawing ), as well as atmospheric gas burners 10 . as in the case of fig1 , two bent areas 2e and 2b that are arranged some distance apart also form an opening here with a guideway for fresh air 11 to gas part b . the entire disclosure of all applications , patents and publications , cited above and below , and of corresponding german application no . 197 03 301 . 6 , filed jan . 30 , 1997 , is hereby incorporated by reference . from the foregoing examples , one skilled in the art can easily ascertain the essential characteristics of this invention and , without departing from the spirit and scope thereof , can make various changes and modifications of the invention to adapt it to various usages and conditions . | 5 |
in the following detailed description , reference is made to various specific embodiments in which the invention may be practiced . these embodiments are described with sufficient detail to enable those skilled in the art to practice the invention , and it is to be understood that other embodiments may be employed , and that structural and logical changes may be made without departing from the spirit or scope of the present invention . fig2 shows an embodiment of a page configuration for a page - based memory device , for example , nand flash memory , capable of accommodating varying ecc and redundancy byte requirements according to the present invention . a memory array 85 is partitioned into a main array 20 , a column redundancy array 50 , and an additional cells array 90 . memory cells 5 in the main array 20 are used for storing user data 22 and ecc bytes 24 . memory cells 5 in the column redundancy array 50 are used for replacing malfunctioning cells . memory cells 5 in the additional cells array 90 may be designated for use as either additional ecc bytes or additional column redundancy cells . the additional cells array 90 designation is controlled by the output of a multiplexer 100 . the main decoder 30 and the column redundancy decoder 60 send channel signals 45 and 75 , respectively , to the multiplexer 100 . a select signal 120 is used to select which channel will be presented to the output 110 of the multiplexer 100 . for example , as illustrated , the channel select signal 120 is set to ecc . accordingly , a decoded address signal 45 from the main array 30 is sent through the multiplexer as output 110 and the cells 5 in the additional cells array 90 are designated for use as additional ecc bytes . memory array 85 is not limited to fixed amounts of redundancy cells and ecc bytes . by controlling which decoded address signal is sent to the additional cells array 90 , ecc bytes or column redundancy cells may be augmented as needed . the select signal 120 may be controlled at various operating levels , such as at a user - level , an operating system level or a manufacturer level . since redundancy cell needs are typically determined at the manufacturing level , the additional cells array 90 designation may be set exclusively as part of a preset manufacturing setting . fig3 shows an example of a page configuration of nand flash memory according to the invention . the total number of bytes is equal to the data bytes ( n )+ redundancy bytes ( m )+ ecc bytes ( l )+ additional bytes ( k ). the total number of redundancy bytes ( m ) or ecc bytes ( l ) available depends on the designation of the additional bytes ( k ). fig3 a shows a configuration in which the additional cells array 90 is designated for use as additional ecc bytes . the total number of ecc bytes ( l ) available is equal to ecc bytes ( l )+ additional bytes ( k ). fig3 b shows a page configuration in which the variable array is designated for use as additional redundancy bytes . the total number of redundancy bytes ( l ) available is equal to redundancy bytes ( m )+ additional bytes ( k ). in this manner additional ecc bytes may be made available as needed for stronger ecc algorithms , or additional redundancy bytes may be made available when implementing a weaker ecc algorithm . fig4 is a block diagram of a processing system 400 utilizing a memory device , e . g ., a flash memory device 410 , constructed in accordance with an embodiment of the present invention . the system 400 may be a computer system , a process control system , camera system or any other system employing a processor and associated flash memory . the system 400 includes a central processing unit ( cpu ) 420 , e . g ., a microprocessor , that communicates with the flash memory device 410 and an i / o device 430 over a bus 440 . it must be noted that the bus 440 may be a series of buses and bridges commonly used in a processor system , but for convenience purposes only , the bus 440 has been illustrated as a single bus . a second i / o device 450 is illustrated , but is not necessary to practice the invention . the processor system 400 may also include random access memory ( ram ) device 460 and may include a read - only memory ( rom ) device ( not shown ), and peripheral devices such as a floppy disk drive 470 and a compact disk ( cd ) rom drive 480 that also communicate with the cpu 420 over the bus 440 as is well known in the art . while the invention has been described in conjunction with specific embodiments , it is evident that many alternatives , modifications , permutations and variations will become apparent to those of ordinary skill in the art in light of the foregoing description . accordingly , it is intended that the present invention embrace all such alternatives , modifications , permutations and variations as fall within the scope of the appended claims . | 6 |
the method for manufacturing a light - transmissive metal oxide sintered body according to the invention is described below . the method for manufacturing a light - transmissive metal oxide sintered body according to the invention by subjecting a sintered body composed mainly of metal oxide to hot isostatic pressing ( hip ) treatment at a hip heat treatment temperature t set in a range of 1 , 000 to 2 , 000 ° c . to form a light - transmissive sintered body , is characterized in that the hip treatment includes the step of heating at a ramp rate over a temperature range from room temperature to the hip heat treatment temperature t , the temperature range is divided into a plurality of stages , the ramp rate is controlled in each divided stage , and the ramp rate of at least a final stage inclusive of the hip heat treatment temperature t is 10 ° c ./ h to 180 ° c ./ h . the detail is described below . the method of the invention preferably involves furnishing a preselected metal oxide in particle form as raw material powder ( or starting material ), press molding the powder into a predetermined shape , burnout and sintering into a sintered body consolidated to a relative density of at least 95 % by weight . the sintered body is then subjected to hot isostatic pressing ( hip ) treatment . thereafter , post - treatment such as annealing may be optionally carried out . as the raw material powder , any particulate metal oxides which exhibit light transmission when sintered may be utilized . that is , particles of one or more type selected from metal oxides which exhibit light transmission when sintered may be utilized as the raw material powder . for example , particles of ysz ( yttria - stabilized zirconia ), spinel ( al 2 o 3 - 26 wt % mgo ), plzt ( lead lanthanum zirconate titanate ), alumina , yag ( y 3 al 5 o 12 ), luag ( lu 3 al 5 o 12 ), tgg ( tb 3 ga 5 o 12 ), sesquioxides , bgo ( bi 4 ge 3 o 12 ), and gso ( gd 2 sio 5 ) are preferred as well as particles of oxides of constituent elements of metal oxides which are generally confirmed or expected to have light transmission , for example , particles of oxides of one or more metal elements selected from the group consisting of mg , y , sc , lanthanides , ti , zr , al , ga , si , ge , pb , and bi . any of these particulate metal oxides are weighed so as to meet an appropriate ratio and used as the raw material powder . when it is desired to manufacture a m 2 o 3 type sesquioxide sintered body wherein m is one or more rare earth elements selected from the group consisting of y , sc , and lanthanide series elements , use may be made of particulate oxides of one or more rare earth elements selected from the group consisting of y , sc , and lanthanide series elements , specifically a powder consisting of particulate oxides of one or more rare earth elements selected from the group consisting of y , sc , lu , tb , yb , gd , nd , eu , ho , dy , tm , sm , pr , ce , and er and particulate zr oxide . the amount of zro 2 powder added is preferably up to 1 % by weight ( exclusive of 0 % by weight ), more preferably up to 0 . 5 % by weight . if zro 2 powder is not at all added , bubble coalescence is promoted in the sintering step so that bubble growth may take place to form coarse bubbles of micron size , detracting from light transmission . if more than 1 % by weight of zro 2 powder is added , undesirably part of zro 2 may segregate in the m 2 o 3 type sesquioxide sintered body as a second phase during the sintering step , detracting from light transmission . the aforementioned particulate metal oxides preferably have a purity of at least 99 . 9 % by weight . their particle shape is not particularly limited , and particles of angular , spherical or plate shape , for example , are advantageously used . even a powder having undergone secondary agglomeration may be advantageously used , and a granular powder granulated by atomization treatment such as spray drying may also be advantageously used . the process of preparing the raw material powder is not particularly limited , and a raw material powder prepared by co - precipitation , pulverization , spray pyrolysis , or any other synthesis techniques may be advantageously used . if desired , the raw material powder thus prepared may be treated in a wet ball mill , bead mill , jet mill , dry jet mill , hammer mill or the like . in the practice of the invention , the raw material powder of metal oxide particles preferably has such a particle size distribution ( or particle size distribution of secondary particles if particles agglomerate into secondary particles ) that a particle diameter ( d 2 . 5 ) corresponding to an accumulation of 2 . 5 % from the minimum side may fall in a range of 180 nm to 2 , 000 nm . if d 2 . 5 value is less than 180 nm , bubbles may coalesce and grow in the sintering step into coarse bubbles of micron size , detracting from light transmission . if d 2 . 5 value exceeds 2 , 000 nm , there is a possibility that voids formed between particles during molding become too large , which cooperates with the constituent particles of already sufficiently enlarged size , so that the free energy on the particle surface is reduced . this prevents effective progress of sintering and makes it difficult to produce a dense light - transmissive sintered body . although the measurement of particle size is not particularly limited , reference is preferably made to the value obtained by dispersing the raw material particles in a liquid medium and measuring a diameter by the light scattering or light diffraction method , because the particle size distribution can also be evaluated . to the raw material powder used herein , a sintering inhibitor may be added if desired . for a particularly high light transmission , it is preferred to add a sintering inhibitor compatible with each light - transmissive metal oxide . the inhibitor should preferably have a purity of at least 99 . 9 % by weight . where the sintering inhibitor is not added , it is recommended to choose the raw material powder whose primary particles are of nano size and have very high sintering activity . such a choice is optional . further , for the purpose of improving the quality stability and yield in the manufacture process , various organic additives are preferably added . in the practice of the invention , no particular limits are imposed on these additives , and various dispersants , binders , lubricants , plasticizers and the like may be advantageously utilized . to the raw material powder used herein , an optical function activator may be added , if desired , so as to comply with the desired optical application . for example , there may be added a laser material capable of creating a population inversion state for laser oscillation at the desired wavelength , a scintillator material capable of fluorescence upon receipt of ionization radiation at high sensitivity , or a supersaturation absorber capable of imparting supersaturation absorption function for pulse laser oscillation , such as neodymium , praseodymium , chromium or the like . in the practice of the invention , these activators may be added if desired . the activator , if added , should preferably have a purity of at least 99 . 9 % by weight . in the manufacture method of the invention , a conventional press molding step is advantageously used . that is , a quite common pressing step of filling a mold with powder and applying pressure in a certain direction , or a cold isostatic press ( cip ) step of closely packing a waterproof deformable container with powder and applying hydrostatic pressure may be utilized . notably , the applied pressure may be adjusted as appropriate while monitoring the relative density of the molded body . though not critical , it is recommended to manage the pressure in a range of 300 mpa or less that can be handled by a commercially available cip system , because the manufacture cost is reduced . alternatively , a hot press step capable of achieving molding and sintering straight through the molding step , discharge plasma sintering step , microwave heating step or the like may also be advantageously utilized . in the manufacture method of the invention , a conventional binder burnout step may be advantageously utilized . that is , the method may involve the step of burning out the binder by heating in a heating furnace . the type of the atmosphere gas is not particularly limited , and air , oxygen , hydrogen or the like may be used . although the burnout temperature is not particularly limited , where an organic component such as binder is added , heating up to the temperature at which the organic component is decomposed off is preferred . in the manufacture method of the invention , a general sintering step may be advantageously utilized . that is , a heating / sintering step of resistance heating or induction heating mode may be advantageously utilized . the type of the atmosphere gas is not particularly limited , and an inert gas , oxygen , hydrogen or the like may be used , or even vacuum is acceptable . in the sintering step , the sintering temperature is adjusted as appropriate depending on the preselected starting material . in general , a temperature which is lower by several tens of degrees of centigrade to 100 ° c . or 200 ° c . than the melting point of a sintered body to be prepared from the preselected starting material is preferably selected . it is preferred to select the temperature which is as high as possible within the range so that the material may be consolidated to a relative density of at least 95 % by weight . when it is intended to produce a metal oxide sintered body in which a temperature zone inducing a phase change to a phase other than the cubic crystal system is present in proximity to the selected temperature , sintering at the temperature which is strictly managed to be lower than that temperature gives the advantage that optical strain or cracking is unlikely to occur in the material because a phase shift from non - cubic to the cubic crystal system does not substantially take place . the sinter holding time is adjusted as appropriate depending on the preselected starting material . while several hours of holding is generally satisfactory in many cases , it is recommended to ensure a time until the metal oxide sintered body is consolidated to a relative density of at least 95 % by weight . in the manufacture method of the invention , the sintering step should be followed by the hot isostatic pressing ( hip ) treatment step . the hip apparatus used in this step may be of general construction . the hip treatment is carried out by placing the sintered body having completed treatments until the sintering step in a pressure vessel , applying a uniform pressure across the entire sintered body by means of a pressurizing gas medium , and concurrently heating the sintered body at the predetermined hip heat treatment temperature t by means of an electric resistance heating unit mounted within the pressure vessel . the hip apparatus includes a crucible ( carbon vessel ) with a perforated carbon lid in which the sintered body is received , and a hip furnace in which the carbon vessel is placed , the hip furnace having heating means in the form of a carbon heater , wherein the sintered body is heated by the carbon heater while it is entirely compressed by introducing a pressurizing gas medium into the hip furnace . the pressurizing gas medium used herein may be an inert gas such as argon or ar — o 2 . it is convenient and preferable that the applied pressure is equal to or less than 196 mpa which can be managed by a commercial hip apparatus . the hip heat treatment temperature t may be set as appropriate , depending on the type of metal oxide of the sintered body and / or the sintered state of the sintered body , for example , in the range of 1 , 000 to 2 , 000 ° c ., preferably 1 , 400 to 1 , 900 ° c . like the sintering step , it is essential that the hip temperature t be equal to or lower than the melting point and / or the phase transition point of metal oxide of the sintered body . if the hip temperature t exceeds 2 , 000 ° c . and hence , exceeds the melting point and / or the phase transition point of metal oxide of the sintered body , it becomes difficult to perform adequate hip treatment . if the hip temperature t is lower than 1 , 000 ° c ., an effect of improving the light transmission of the sintered body is not available . in the disclosure , the temperature associated with the hip treatment always refers to the temperature of the metal oxide sintered body . in the actual hip apparatus wherein the metal oxide sintered body is received in the carbon vessel disposed inside the carbon heater in the hip furnace , it is difficult to measure the temperature of the sintered body directly . since the difference in temperature between the carbon heater and the carbon vessel during the heating and cooling steps is equal to or less than 10 ° c ., and the temperature of the carbon vessel is substantially equal to the temperature of the metal oxide sintered body therein , it is acceptable to consider the measured temperature of the carbon heater in the hip furnace to be the temperature of the metal oxide sintered body . accordingly , once the temperature of the carbon heater in the hip furnace is measured by a thermocouple ( e . g ., platinum - rhodium ), the hip apparatus controls the steps of heating and cooling the metal oxide sintered body on the basis of the measured temperature . the manufacture method of the invention is characterized in that the hip treatment includes the step of heating at a ramp rate over a temperature range , the temperature range of the heating step is divided into a plurality of stages , the ramp rate is controlled in each divided stage , and the ramp rate of at least a final stage inclusive of the hip heat treatment temperature t is 10 ° c ./ h to 180 ° c ./ h , preferably 10 ° c ./ h to 150 ° c ./ h , more preferably 10 ° c ./ h to 60 ° c ./ h , and most preferably 20 ° c ./ h to 40 ° c ./ h . if the ramp rate exceeds 180 ° c ./ h , an effect of improving the light transmission of the sintered body is not available . a ramp rate of less than 10 ° c ./ h is unacceptable from the aspect of productivity because the hip treatment takes a too long time . the temperature control in the heating step is preferably conducted by a proportional - integral - derivative ( pid ) controller on the basis of the measurement results . in the hip treatment , the pressure applied by the pressurizing gas medium is preferably 50 to 300 mpa , more preferably 100 to 300 mpa . at a pressure of less than 50 mpa , a light transmission improving effect may not be available . if the pressure is increased beyond 300 mpa , no further improvement in light transmission is available , and an excessive load may be imposed on the apparatus , causing damage to the apparatus . figure illustrates an exemplary temperature profile of metal oxide sintered body during hip treatment step in the method for manufacturing a light - transmissive metal oxide sintered body according to the invention . the temperature profile illustrated herein includes heating , temperature holding , and cooling steps , provided that the hip heat treatment temperature t is 1 , 625 ° c . the temperature profiles p 11 , p 12 , p 21 , and p 22 belong to the invention whereas the temperature profile p 99 belongs to the prior art . referring to the temperature profiles p 11 as a typical example , it is described how to control the temperature during the hip treatment according to the invention . according to the invention , once the hip heat treatment temperature t is set at 1 , 625 ° c ., the temperature range s from room temperature to the hip heat treatment temperature t in the heating step of the hip treatment is divided into a plurality of stages . the mode of division may be determined from a balance of the efficiency of hip treatment with the light transmission improving effect of sintered body . for example , the temperature range s may be equally divided into 2 to 20 stages . in figure , the temperature range s from room temperature ( 25 ° c .) to 1 , 625 ° c . is equally divided into 14 stages . next , the ramp rate for each divided stage is set , and specifically , the ramp rate of at least a final stage inclusive of the hip heat treatment temperature t is set in a range from 10 ° c ./ h to 180 ° c ./ h . as long as this requirement is met , the ramp rates of the remaining stages are set arbitrary . for example , with the productivity of hip treatment taken into account , it is recommended that the ramp rate of the final stage of the heating step be set in a range from 10 ° c ./ h to 180 ° c ./ h and the ramp rates of the remaining stages be set in a range from 200 ° c ./ h to 800 ° c ./ h . the temperature profile p 11 in figure shows that the ramp rate of the final stage ( 14 ) of the heating step is 60 ° c ./ h and the ramp rates of the remaining stages ( 1 ) to ( 13 ) are 400 ° c ./ h , equal to the conventional temperature profile p 99 . next , the sintered body is held at the hip heat treatment temperature t for a certain time ( temperature holding step ). the holding time is not particularly limited and may be set as appropriate for the selected material ( type of metal oxide of the sintered body ). the temperature profile p 11 in figure includes a holding time of 3 hours . next , the sintered body is cooled down to room temperature ( cooling step ). the temperature drop rate of the cooling step is not particularly limited , and the step may be either air cooling or spontaneous cooling . it is unnecessary to select an intentionally slow rate like the heating step . notably , an excessive drop rate and / or an excessive pressure withdrawal is undesirable because an incidental impact is applied to the metal oxide sintered body being manufactured , becoming the cause of cracks . the temperature profile p 11 in figure includes a drop rate of 400 ° c ./ h , equal to the conventional temperature profile p 99 . by carrying out hip treatment according to the temperature profile p 11 set as above , the sintered body is improved in light transmission . with respect to the temperature profile of hip heat treatment , since it suffices that the ramp rate of at least the final stage inclusive of the hip heat treatment temperature t is in the range from 10 ° c ./ h to 180 ° c ./ h , for example , the ramp rates of all stages in the heating step of hip treatment may be 10 ° c . to 180 ° c ./ h . the temperature profile p 12 in figure shows that the ramp rates of all stages ( 1 ) to ( 14 ) in the heating step are equal to 60 ° c ./ h while other steps ( temperature holding and cooling steps ) are the same as in temperature profile p 11 . the temperature profile p 21 in figure shows that the ramp rates of stages ( 1 ) to ( 13 ) in the heating step are equal to 400 ° c ./ h and the ramp rate of the final stage ( 14 ) is 30 ° c ./ h while other steps ( temperature holding and cooling steps ) are the same as in temperature profile p 11 . the temperature profile p 22 in figure shows that the ramp rates of all stages ( 1 ) to ( 14 ) in the heating step are equal to 30 ° c ./ h while other steps ( temperature holding and cooling steps ) are the same as in temperature profile p 11 . in the conventional temperature profile p 99 , the ramp rates of all stages ( 1 ) to ( 14 ) in the heating step are equal to 400 ° c ./ h while other steps ( temperature holding and cooling steps ) are the same as in temperature profile p 11 . in the manufacture method of the invention , once the metal oxide sintered body has passed the series of steps until the hip treatment step , the sintered body is preferably subjected to optical polishing on its axially opposed end surfaces with respect to an optical axis of utilization . the optical surface is polished at an accuracy of up to λ / 8 , more preferably up to λ / 10 , provided that the measurement wavelength λ is 633 nm . notably , more precise optical measurement becomes possible when an antireflective coating is deposited on the optically polished surface . by the method for manufacturing a light - transmissive metal oxide sintered body according to the invention , a metal oxide sintered body having very high light transmission is provided . in the practice of the invention , if desired , the sintered body may be assembled into a device compliant with the intended optical application . examples and comparative examples are given below by way of illustration and not by way of limitation . the average particle size of powder is a weight average value determined by the laser light diffraction method . in the hip apparatus , the temperature of the carbon heater inside the hip furnace was measured by a platinum - rhodium thermocouple . the heating and cooling steps were controlled on the assumption that the measured temperature was the temperature of a metal oxide sintered body . an example using y 2 o 3 powder as the raw material powder is described . there was furnished y 2 o 3 powder with a purity of at least 99 . 9 wt %, available from shin - etsu chemical co ., ltd ., to which was added 0 . 5 wt % of zro 2 powder , available from daiichi kigenso kagaku kogyo co ., ltd . further an organic dispersant and organic binder were added to the powders , which were dispersed and mixed in ethanol in a zirconia ball mill . the milling time was 24 hours . subsequent spray drying yielded a granular raw material ( starting material ) having an average particle size of 20 μm . next , a mold having a diameter of 10 mm was filled with the starting material . using a uniaxial press molding machine , the material was preliminary molded into a rod of 20 mm long , which was hydrostatically pressed under a pressure of 198 mpa into a cip compact . the cip compact was placed in a muffle furnace where it was heat treated in air at 800 ° c . for 3 hours for binder burnout . next , the compact as burned - out was placed in a vacuum heating furnace where it was heated at a ramp rate of 100 ° c ./ h to a temperature of 1 , 500 - 1 , 700 ° c ., held at the temperature for 3 hours , and cooled at a drop rate of 600 ° c ./ h , yielding a sintered body . in the step , the sintering temperature and holding time were adjusted such that the sintered sample might have a relative density of 96 %. the sintered body was then subjected to hip heat treatment at a temperature t of 1 , 500 - 1 , 800 ° c . and a pressure of 190 mpa using ar gas as pressurizing medium , for a holding time of 3 hours . in this example , heat treatment was carried out while the temperature ramp rate was set at nine levels as shown in table 1 and the drop rate was fixed at 400 ° c ./ h . a comparative sample was prepared under conditions according to the temperature profile p 99 in figure . the hip treated samples were ground and polished to a length of 14 mm . the opposite optical end surfaces of each sample were subjected to final optical polishing to an optical surface accuracy of λ / 8 wherein measurement wavelength λ = 633 nm . the sample was further coated with an antireflective coating designed to a central wavelength of 1 , 064 nm before a transmittance at wavelength 1 , 064 nm was measured , from which a visible region transmission loss per sintered body unit length was computed . the bubble state inside each optical surface was observed under an electron microscope ( sem ). further , the samples of examples 1 - 1 , 1 - 5 , 1 - 7 and 1 - 9 and comparative example 1 on their optical surface were subjected to mirror etching treatment with hydrochloric acid at constant temperature until sintered grain boundary was definitely seen . the sample was observed under sem and sintered grain size was measured . an average of 400 grains is reported as average sintered grain size . a burnout cip compact was prepared as in example 1 aside from using lu 2 o 3 powder with a purity of at least 99 . 9 wt %, available from shin - etsu chemical co ., ltd . next , the burnout compact was placed in a vacuum heating furnace where it was heated at a ramp rate of 100 ° c ./ h to a temperature of 1 , 600 - 1 , 800 ° c ., held at the temperature for 3 hours , and cooled at a drop rate of 600 ° c ./ h , yielding a sintered body . in the step , the sintering temperature and holding time were adjusted such that the sintered sample might have a relative density of 96 %. the sintered body was then subjected to hip heat treatment at a temperature t of 1 , 600 - 1 , 850 ° c . and a pressure of 190 mpa using ar gas as pressurizing medium , for a holding time of 3 hours . in this example , heat treatment was carried out while the temperature ramp rate was set at nine levels as shown in table 2 and the drop rate was fixed at 400 ° c ./ h . a comparative sample was prepared under conditions according to the temperature profile p 99 in figure . the hip treated samples thus obtained were ground and polished to a length of 14 mm . the opposite optical end surfaces of each sample were subjected to final optical polishing to an optical surface accuracy of λ / 8 wherein measurement wavelength λ = 633 nm . the sample was further coated with an antireflective coating designed to a central wavelength of 1 , 064 nm before a transmittance at wavelength 1 , 064 nm was measured , from which a visible region transmission loss per sintered body unit length was computed . the bubble state inside each optical surface was observed under an electron microscope ( sem ). further , the samples of examples 2 - 1 , 2 - 5 , 2 - 7 and 2 - 9 and comparative example 2 on their optical surface were subjected to mirror etching treatment with hydrochloric acid at constant temperature until sintered grain boundary was definitely seen . the sample was observed under sem and sintered grain size was measured . an average of 400 grains is reported as average sintered grain size . a burnout cip compact was prepared as in example 1 aside from using sc 2 o 3 powder with a purity of at least 99 . 9 wt %, available from shin - etsu chemical co ., ltd . next , the burnout compact was placed in a vacuum heating furnace where it was heated at a ramp rate of 100 ° c ./ h to a temperature of 1 , 600 - 1 , 800 ° c ., held at the temperature for 3 hours , and cooled at a drop rate of 600 ° c ./ h , yielding a sintered body . in the step , the sintering temperature and holding time were adjusted such that the sintered sample might have a relative density of 96 %. the sintered body was then subjected to hip heat treatment at a temperature t of 1 , 600 - 1 , 850 ° c . and a pressure of 190 mpa using ar gas as pressurizing medium , for a holding time of 3 hours . in this example , heat treatment was carried out while the temperature ramp rate was set at nine levels as shown in table 3 and the drop rate was fixed at 400 ° c ./ h . a comparative sample was prepared under conditions according to the temperature profile p 99 in figure . the hip treated samples thus obtained were ground and polished to a length of 14 mm . the opposite optical end surfaces of each sample were subjected to final optical polishing to an optical surface accuracy of λ / 8 wherein measurement wavelength λ = 633 nm . the sample was further coated with an antireflective coating designed to a central wavelength of 1 , 064 nm before a transmittance at wavelength 1 , 064 nm was measured , from which a visible region transmission loss per sintered body unit length was computed . the bubble state inside each optical surface was observed under an electron microscope ( sem ). further , the samples of examples 3 - 1 , 3 - 5 , 3 - 7 and 3 - 9 and comparative example 3 on their optical surface were subjected to mirror etching treatment with hydrochloric acid at constant temperature until sintered grain boundary was definitely seen . the sample was observed under sem and sintered grain size was measured . an average of 400 grains is reported as average sintered grain size . as seen from the results of tables 1 to 3 , independent of the type of starting material , that is , for all of y 2 o 3 powder , lu 2 o 3 powder and sc 2 o 3 powder , when the ramp rate of the final stage ( 14 ) in the temperature range s is set at 60 ° c ./ h , as in examples 1 - 1 to 1 - 4 , 2 - 1 to 2 - 4 , and 3 - 1 to 3 - 4 , the transmission loss per unit length is reduced ( or improved ) to about 2 / 5 as compared with comparative examples 1 to 3 corresponding to the conventional ramp rate ( 400 ° c ./ h , i . e ., ramp rate is not slowed down ). also , when the ramp rate of the final stage ( 14 ) in the temperature range s is reduced to 30 ° c ./ h , as in examples 1 - 5 , 1 - 6 , 2 - 5 , 2 - 6 , 3 - 5 and 3 - 6 , the transmission loss per unit length is significantly reduced ( or improved ) to about ⅕ as compared with comparative examples 1 to 3 corresponding to the conventional ramp rate ( 400 ° c ./ h , i . e ., ramp rate is not slowed down ). it is further demonstrated that when the ramp rate of the final stage ( 14 ) in the temperature range s is reduced to 150 ° c ./ h , as in examples 1 - 7 , 1 - 8 , 2 - 7 , 2 - 8 , 3 - 7 and 3 - 8 , the transmission loss per unit length is reduced ( or improved ) to about ½ as compared with comparative examples 1 to 3 corresponding to the conventional ramp rate ( 400 ° c ./ h , i . e ., ramp rate is not slowed down ). for those metal oxide sintered bodies in which the transmission loss per unit length is improved as in examples 1 - 1 to 1 - 8 , 2 - 1 to 2 - 8 , and 3 - 1 to 3 - 8 , the amount of residual bubbles inside the optical surface is dramatically reduced . it is seen from the above results that when the ramp rate of the final stage in the temperature range s of hip treatment step is reduced to 150 ° c ./ h or lower , there are obtained light - transmissive oxide sintered bodies featuring a significantly reduced amount of residual bubbles in the metal oxide sintered body , an extremely low transmission loss , and true clarity , as compared with the hip treatment at the conventional ramp rate . the results of examples 1 - 9 , 2 - 9 and 3 - 9 demonstrate that the upper limit of ramp rate below which an effect of improving transmission loss per unit length begins to appear is 180 ° c ./ h . it is also seen that grain growth is promoted during the hip treatment step at the conventional ramp rate of 400 ° c ./ h , whereas grain growth is suppressed during the hip treatment step where the ramp rate of the final stage in the temperature range s is reduced to 150 ° c ./ h or lower . the results of examples 1 - 9 , 2 - 9 and 3 - 9 demonstrate that the upper limit of ramp rate below which an effect of suppressing grain growth begins to appear is 180 ° c ./ h . it is seen from the above results that when the ramp rate of the heating step during the hip treatment is selected to a sufficient condition to suppress the growth of sintered grains , there is obtained a truly clear light - transmissive oxide sintered body in which the amount of bubbles remaining in the metal oxide sintered body is significantly reduced by a certain cause - and - effect relationship and the transmission loss is minimized . it is evident that the sufficient condition to suppress the growth of sintered grains is attainable when the ramp rate of at least the final stage in the temperature range s is reduced to a rate of 180 ° c ./ h or lower , which is remarkably lower than the conventional ramp rate . next , a terbium base sesquioxide faraday cell obtained by sintering a mixture of tb 4 o 7 powder and y 2 o 3 powder is described as an exemplary metal oxide sintered body having an optical function . there were furnished tb 4 o 7 powder and y 2 o 3 powder , both with a purity of at least 99 . 9 wt % and available from shin - etsu chemical co ., ltd . these raw material powders were mixed in a volume ratio 1 : 1 , to which was added 0 . 5 wt % of zro 2 powder , available from daiichi kigenso kagaku kogyo co ., ltd . further an organic dispersant and organic binder were added to the powders , which were dispersed and mixed in ethanol in a zirconia ball mill . the milling time was 24 hours . subsequent spray drying yielded a granular raw material ( starting material ) having an average particle size of 20 μm . next , a mold having a diameter of 10 mm was filled with the starting material . using a uniaxial press molding machine , the material was preliminary molded into a rod of 20 mm long , which was hydrostatically pressed under a pressure of 198 mpa into a cip compact . the cip compact was placed in a muffle furnace where it was heat treated in air at 800 ° c . for 3 hours for binder burnout . next , the compact as burned - out was placed in a vacuum heating furnace where it was heated at a ramp rate of 100 ° c ./ h to a temperature of 1 , 500 - 1 , 700 ° c ., held at the temperature for 3 hours , and cooled at a drop rate of 600 ° c ./ h , yielding a sintered body . in the step , the sintering temperature and holding time were adjusted such that the sintered sample might have a relative density of 96 %. the sintered body was then subjected to hip heat treatment at a temperature t of 1 , 500 - 1 , 800 ° c . and a pressure of 190 mpa using ar gas as pressurizing medium , for a holding time of 3 hours . in this example , heat treatment was carried out while the temperature ramp rate was set at nine levels as shown in table 4 and the drop rate was fixed at 400 ° c ./ h . a comparative sample was prepared under conditions according to the temperature profile p 99 in figure . the hip treated samples were ground and polished to a length of 10 mm . the opposite optical end surfaces of each sample were subjected to final optical polishing to an optical surface accuracy of λ / 8 wherein measurement wavelength λ = 633 nm . the sample was further coated with an antireflective coating designed to a central wavelength of 1 , 064 nm before a transmittance at wavelength 1 , 064 nm was measured , from which a visible region transmission loss per sintered body unit length was computed . the bubble state inside each optical surface was observed under an electron microscope ( sem ). further , the samples of examples 4 - 1 , 4 - 5 , 4 - 7 and 4 - 9 and comparative example 4 on their optical surface were subjected to mirror etching treatment with hydrochloric acid at constant temperature until sintered grain boundary was definitely seen . the sample was observed under sem and sintered grain size was measured . an average of 400 grains is reported as average sintered grain size . as described above , like examples 1 to 3 , when the ramp rate of at least the final stage ( 14 ) in the temperature range s is set at 60 ° c ./ h as in examples 4 - 1 to 4 - 4 , the transmission loss per unit length is reduced ( or improved ) to about 10 / 22 as compared with comparative example 4 corresponding to the conventional ramp rate ( 400 ° c ./ h , i . e ., ramp rate is not slowed down ). also , when the ramp rate of the final stage ( 14 ) in the temperature range s is reduced to 30 ° c ./ h as in examples 4 - 5 and 4 - 6 , the transmission loss per unit length is significantly reduced ( or improved ) to about ⅙ as compared with comparative example 4 corresponding to the conventional ramp rate ( 400 ° c ./ h , i . e ., ramp rate is not slowed down ). it is further demonstrated that when the ramp rate of the final stage ( 14 ) in the temperature range s is reduced to 150 ° c ./ h as in examples 4 - 7 and 4 - 8 , the transmission loss per unit length is reduced ( or improved ) to about ½ as compared with comparative example 4 corresponding to the conventional ramp rate ( 400 ° c ./ h , i . e ., ramp rate is not slowed down ). for those metal oxide sintered bodies in which the transmission loss per unit length is improved as in examples 4 - 1 to 4 - 8 , the amount of residual bubbles inside the optical surface is dramatically reduced . the results of example 4 - 9 demonstrate that the upper limit of ramp rate below which an effect of improving transmission loss per unit length begins to appear is 180 ° c ./ h . it is also seen that like examples 1 to 3 , grain growth is promoted during the hip treatment step at the conventional ramp rate of 400 ° c ./ h , whereas grain growth is suppressed during the hip treatment step where the ramp rate of the final stage in the temperature range s is reduced to 150 ° c ./ h or lower . the results of example 4 - 9 demonstrate that the upper limit of ramp rate below which an effect of suppressing grain growth begins to appear is 180 ° c ./ h . it is seen from the above results that in the case of a terbium base sesquioxide faraday cell as well , when the ramp rate of the heating step during the hip treatment is selected to a sufficient condition to suppress the growth of sintered grains , there is obtained a truly clear terbium base sesquioxide faraday sintered body in which the amount of bubbles remaining in the metal oxide sintered body is significantly reduced by a certain cause - and - effect relationship and the transmission loss is minimized . it is evident that the sufficient condition to suppress the growth of sintered grains is attainable when the ramp rate of at least the final stage in the temperature range s is reduced to a rate of 180 ° c ./ h or lower , which is remarkably lower than the conventional ramp rate . finally , each of the sintered bodies of examples 4 - 1 to 4 - 9 thus obtained was constructed as a terbium base sesquioxide faraday cell , the periphery of which was covered with a smco magnet of a sufficient size to saturate magnetization . this optical function unit was set on an optical axis between a polarizer and an analyzer . next , light of wavelength 1 , 064 nm was directed from both forward and backward directions to confirm a faraday rotation effect . as a result , all the cells showed a transmission loss of less than 0 . 1 db in the forward direction and an extinction ratio of at least 40 db in the backward direction . it is demonstrated that when the manufacture method of the invention is applied to a metal oxide sintered body having optical function , a truly clear oxide sintered body having a minimized transmission loss is obtained . although the invention has been described with reference to the embodiments , the invention is not limited thereto , and other embodiments may occur to , or various additions , changes and deletions may be made by those skilled in the art . all such embodiments fall in the scope of the invention as long as the advantages and results of the invention are obtainable . | 2 |
examples 1 - 4 of the inventive imaging optical system are given below . fig1 , 5 and 7 are illustrative in lens arrangement section of examples 1 , 2 , 3 and 4 , respectively , upon focused on an object point at infinity . in these drawings , an aperture stop is indicated by s , a first lens by l 1 , a second lens by l 2 , a plane - parallel plate for an electronic image pickup device &# 39 ; s cover glass or the like by cg , and an image plane by i . it is noted that the plane - parallel plate cg could be provided on its surface with a wavelength band limiting multilayer film or , alternatively , it could be designed to have a low - pass filter function . as shown in fig1 , this example is directed to an imaging optical system comprising , in order from its object side , an aperture stop s , a negative first lens l 1 that is convex on its object side and has both its surfaces defined by aspheric surfaces and weak power , a second lens l 2 that is convex on its object side and has both its surfaces defined by aspheric surfaces and positive power , and a cover glass cg . the specifications for the wide angle - of - view optical system according to example 1 are : as shown in fig2 , this example is directed to an imaging optical system comprising , in order from its object side , an aperture stop s , a negative ,¥ first lens l 1 that is convex on its object side and has both its surfaces defined by aspheric surfaces and weak power , a second lens l 2 that is convex on its object side and has both its surfaces defined by aspheric surfaces and positive power , and a cover glass cg . the specifications for the wide angle - of - view optical system according to example 2 are : as shown in fig3 , this example is directed to an imaging optical system comprising , in order from its object side , an aperture stop s , a positive first lens l 1 that is convex on its object side and has both its surfaces defined by aspheric surfaces and weak power , a second lens l 2 that is convex on its object side and has both its surfaces defined by aspheric surfaces and positive power , and a cover glass cg . the specifications for the wide angle - of - view optical system according to example 3 are : as shown in fig4 , this example is directed to an imaging optical system comprising , in order from its object side , an aperture stop s , a negative first lens l 1 that is convex on its object side and has both its surfaces defined by aspheric surfaces and weak power , a second lens l 2 that is convex on its object side and has both its surfaces defined by aspheric surfaces and positive power , and a cover glass cg . the specifications for the wide angle - of - view optical system according to example 4 are : numerical data on each example will be enumerated later . it is noted that the symbols used hereinafter but not hereinbefore mean : r 1 , r 2 , . . . : radius of curvature of each lens , n d1 , n d2 , . . . : d - line refractive index of each lens , and [ heading - 0172 ] here let x represent an optical axis with the proviso that the direction of propagation of light is taken as positive , and y represent a direction orthogonal with respect to the optical axis . then , aspheric configuration is given by x =( y 2 / r )/[ 1 +{ 1 −( k + 1 ) ( y / r ) 2 } 1 / 2 ]+ a 4 y 4 + a 6 y 6 + a 8 y 8 + a 10 y 10 where r is an axial radius of curvature , k is a conical coefficient , and a 4 , a 6 , a 8 and a 10 are the 4 th , 6 th , 8 th and 10 th aspheric coefficients . fig2 , 6 and 8 are aberration diagrams for examples 1 , 2 , 3 and 4 , respectively , upon focused at infinity , wherein “ ω ” stands for a half angle of view . the values of conditions ( 1 ) to ( 7 ) in examples 1 - 4 are tabulated below . condition example 1 example 2 example 3 example 4 ( 1 ) − 0 . 001 − 0 . 001 0 . 034 − 0 . 058 ( 2 ) − 0 . 059 0 . 000 − 0 . 064 − 0 . 031 ( 3 ) 0 . 66 0 . 81 0 . 66 0 . 78 ( 4 ) 0 . 62 0 . 59 0 . 61 0 . 59 ( 5 ) 0 . 10 0 . 11 0 . 09 0 . 14 ( 6 ) − 0 . 96 − 0 . 93 − 0 . 91 − 1 . 00 ( 7 ) − 1 . 15 − 1 . 27 − 1 . 13 − 1 . 24 while the aspheric lenses in examples 1 - 4 are all formed of plastics , it is understood that the plastic lenses could be replaced by glass lenses . for instance , much higher performance could be achieved by use of glass having a refractive index higher than that of the plastic material used in any of the above examples . likewise , the use of special low - dispersion glass could be more effective at correction of chromatic aberrations . the use of a plastic material of low hygroscopicity is particularly preferable because degradation of performance due to environmental changes is substantially reduced ( for instance , zeonex made by nippon zeon co ., ltd .). with a view to cutting off unnecessary light such as ghosts and flares , it is acceptable to rely upon a flare stop in addition to the aperture stop s . in examples 1 - 4 , that flare stop could be located at any desired position between the aperture stop s and the first lens l 1 , the first lens l 1 and the second lens l 2 , and the second lens l 2 and the image plane i . alternatively , the lens frame could be used to cut off flare light rays or another member may be used as the flare stop . such flare stops could be obtained by direct printing , coating , seal bonding on the optical system , etc ., and configured in any desired form such as circular , oval , rectangular , polygonal forms or forms surrounded with functional curves . the flare stop used could be designed to cut off not only harmful light beams but also light beams such as coma flare around the screen . each lens could have been provided with an antireflection coating for the purpose of reducing ghosts and flares . multicoatings are preferred because of having the ability to reduce ghosts and flares effectively . alternatively , infrared cut coatings may have been applied on lens surfaces , cover glass surfaces or the like . focus adjustment could be carried out by focusing . focusing could be performed by moving the whole lenses or extending or retracting some lenses . a drop , if any , of brightness of the peripheral area of an image could be reduced by the shifting of the ccd microlenses . for instance , the design of ccd microlenses could be changed in association with the angle of incidence of light rays at each image height , or decreases in the quantity of light at the peripheral area of the image could be corrected by image processing . throughout examples 1 - 4 , the first lens l 1 is formed of any material capable of absorbing near infrared radiation , and the plane - parallel plate is thinned without use of an ir cut filter or coating . in the plane - parallel plate cg shown in fig1 , 5 , and 7 , a low - pass filter is integral with a ccd cover glass . for further compactness , it is not always necessary to use a focusing mechanism . to secure focusing precision in a frequently used object point distance range in this case , the receiving plane of the ccd could be located at an image - formation position having a finite object point distance ( of , e . g ., 2 m to 0 . 3 m ). the imaging system according to the invention constructed as described above may be applied to phototaking systems where object images formed through image - formation optical systems are received at image pickup devices such as ccds , in particular , digital cameras or video cameras as well as pcs and telephone sets that are typical information processors , in particular , easy - to - carry cellular phones . given below are some such embodiments . fig9 - 11 are conceptual illustrations of a phototaking optical system 41 for digital cameras , in which the imaging optical system according to the invention is incorporated . fig9 is a front perspective view of the external appearance of a digital camera 40 , and fig1 is a rear perspective view of the same . fig1 is a sectional view of the construction of the digital camera 40 . in this embodiment , the digital camera 40 comprises a phototaking optical system 41 including a phototaking optical path 42 , a finder optical system 43 including a finder optical path 44 , a shutter 45 , a flash 46 , a liquid crystal display monitor 47 and so on . as the shutter 45 mounted on the upper portion of the camera 40 is pressed down , phototaking takes place through the phototaking optical system 41 , for instance , the imaging optical system according to example 1 . an object image formed by the phototaking optical system 41 is formed . on the image pickup plane of a ccd 49 via a cover glass cg provided with a near - infrared cut coating and having a low - pass filter function . an object image received at ccd 49 is shown as an electronic image on the liquid crystal display monitor 47 via processing means 51 , which monitor is mounted on the back of the camera . this processing means 51 is connected with recording means 52 in which the phototaken electronic image may be recorded . it is here noted that the recording means 52 may be provided separately from the processing means 51 or , alternatively , it may be constructed in such a way that images are electronically recorded and written thereon by means of floppy discs , memory cards , mos or the like . this camera may also be constructed in the form of a silver - halide camera using a silver - halide film in place of ccd 49 . moreover , a finder objective optical system 53 is located on the finder optical path 44 . an object image formed by the finder objective optical system 53 is in turn formed on the field frame 57 of a porro prism 55 that is an image - erecting member . in the rear of the porro prism 55 there is located an eyepiece optical system 59 for guiding an erected image into the eyeball e of an observer . it is here noted that cover members 50 are provided on the entrance sides of the phototaking optical system 41 and finder objective optical system 53 as well as on the exit side of the eyepiece optical system 59 . with the thus constructed digital camera 40 , it is possible to achieve high performance and compactness , because the phototaking optical system 41 is of high performance and compactness . in the embodiment of fig1 , plane - parallel plates are used as the cover members 50 ; however , it is acceptable to use powered lenses . fig1 , 13 and 14 are illustrative of a personal computer that is one example of the information processor in which the imaging optical system according to the invention is built as an objective optical system . fig1 is a front perspective view of a personal computer 300 in use , fig1 is a sectional view of a phototaking optical system 303 in the personal computer 300 , and fig1 is a side view of the state of fig1 . as shown in fig1 , 13 and 14 , the personal computer 300 comprises a keyboard 301 via which an operator enters information therein from outside , information processing or recording means ( not shown ), a monitor 302 on which the information is shown for the operator , and a phototaking optical system 303 for taking an image of the operator and surrounding images . for the monitor 302 , use may be made of a transmission type liquid crystal display device illuminated by backlight ( not shown ) from the back surface , a reflection type liquid crystal display device in which light from the front is reflected to show images , or a crt display device . while the phototaking optical system 303 is shown as being built in the upper right portion of the monitor 302 , it may be located somewhere around the monitor 302 or keyboard 301 . this phototaking optical system 303 comprises , on a phototaking optical path 304 , an objective lens 112 comprising , for instance , the imaging optical system of example 1 of the invention ( roughly shown ) and an image pickup device chip 162 for receiving an image . these are built in the personal computer 300 . here a cover glass cg having a low - pass filter function is additionally applied onto the image pickup device chip 162 to form an integral imaging unit 160 , which can be fitted into the rear end of the lens barrel 113 of the objective lens 112 in one - touch operation . thus , the assembly of the objective lens 112 and image pickup device chip 162 is facilitated because of no need of alignment or control of surface - to - surface spacing . the lens barrel 113 is provided at its end with a cover glass 114 for protection of the objective lens 112 . an object image received at the image pickup device chip 162 is entered via a terminal 166 in the processing means of the personal computer 300 , and shown as an electronic image on the monitor 302 . as an example , an image 305 taken of the operator is shown in fig1 . this image 305 may be shown on a personal computer on the other end via suitable processing means and the internet or telephone line . fig1 ( a ), 15 ( b ) and 15 ( c ) are illustrative of a telephone set that is one example of the information processor in which the imaging optical system according to the invention is built , especially a convenient - to - carry cellular phone . fig1 ( a ) and fig1 ( b ) are a front and a side view of a cellular phone 400 , respectively , and fig1 ( c ) is a sectional view of a phototaking optical system 405 . as shown in fig1 ( a ), 15 ( b ) and 15 ( c ), the cellular phone 400 comprises a microphone 401 for entering the voice of an operator therein as information , a speaker 402 for producing the voice of the person on the other end , an input dial 403 via which the operator enters information therein , a monitor 404 for displaying an image taken of the operator or the person on the other end and indicating information such as telephone numbers , a phototaking optical system 405 , an antenna 406 for transmitting and receiving communication waves , and processing means ( not shown ) for processing image information , communication information , input signals , etc . here the monitor 404 is a liquid crystal display device . it is noted that the components are not necessarily arranged as shown . the phototaking optical system 405 comprises , on a phototaking optical path 407 , an objective lens 112 comprising , for instance , the imaging optical system of example 1 and an image pickup device chip 162 for receiving an object image . these are built in the cellular phone 400 . here a cover glass cg having a low - pass filter function is additionally applied onto the image pickup device chip 162 to form an integral imaging unit 160 , which can be fitted into the rear end of the lens barrel 113 of the objective lens 112 in one - touch operation . thus , the assembly of the objective lens 112 and image pickup device chip 162 is facilitated because of no need of alignment or control of surface - to - surface spacing . the lens barrel 113 is provided at its end with a cover glass 114 for protection of the objective lens 112 . an object image received at the image . pickup device chip 162 is entered via a terminal 166 in processing means ( not shown ), so that the object image can be displayed as an electronic image on the monitor 404 and / or a monitor on the other end . the processing means also include a signal processing function for converting information about the object image received at the image pickup device chip 162 into transmittable signals , thereby sending the image to the person on the other end . many modifications could be made to the examples and embodiments as described above according to what is recited in the claims . | 6 |
in most countries , the mobile network is completely diverse from the wireline network except for some shared transport links , which have very high availability . fig1 is a block diagram of a high availability broadband access link , illustrating various aspects of the invention . the primary configuration is shown in full lines ; optional blocks for additional functionality are shown in dotted lines . as seen in the embodiment of fig1 , a customer is connected to a wireline access network 20 over customer premises equipment ( cpe ) illustrated at 5 . the direction of the arrows in fig1 shows traffic flow ‘ upstream ’ from the user to the network , although traffic will actually flow in both directions . a ha ( high availability ) interface between the customer and the cpe 5 is denoted with 10 , and the broadband interface between the cpe 5 and the wireline network 20 is denoted with 15 . a wireline channel has generally superior performance characteristics such as high throughput , low cost per bit , and low packet loss , latency ( packet delay ), and jitter ( variability in packet delay ), as compared to a wireless channel , so that the wireline link is normally set as the ‘ default ’ link . fig1 also illustrates a wireless network 25 that covers the location of cpe 5 . the invention enables cpe 5 to automatically and transparently restore the broadband wireline service in the case of a failure of link 15 , by establishing a wireless connection 30 through wireless network 25 . at the other end of the connection , a diverse link into the destination server ( not shown ) ensures connectivity will not be lost in the event of almost any single point failure . because the data will normally traverse the wireline link 15 , except under problem conditions , it normally places no load on the wireless network 30 . under failure conditions the customer node 5 automatically diverts traffic to the wireless data link . since the wireless connection is already established through signaling , switching of traffic along the redundant wireless link is performed very fast ( e . g . 50 ms ). cpe 5 includes a link monitoring mechanism ( link monitor ) 51 and a data switching mechanism 52 . the link monitor 51 monitors the integrity of link 15 and generates a fault signal when the broadband access connection on the wireline link under - performs . note that the fault signal is a generic term used to define the signal that triggers operation of the data switching mechanism 52 to begin transmitting data received from the customer over the wireless link 30 . the term “ under - performance ” as used in this specification refers to link 15 being failed , performing poorly , or being overloaded . the wireline link is for example declared “ failed ” when no traffic is received at the far end . this may happen for example upon detection of a loss of signal , or the failure to respond out of a period in which traffic was expected , or failure of the far - end network device to respond to an active inquiry . the wireline link is declared as “ performing poorly ” when the bit error rate of the received traffic is higher than a configured limit , or the packet loss is too high , or the flow of packets has excessive latency , or jitter . still further , the wireline link is declared ‘ overloaded ’ on detection that all the available bandwidth is fully occupied , ( e . g . the measured throughput is at or near wireline link capacity ). in addition , link monitor 51 monitors link 15 for detecting recovery to normal conditions . that is , it detects the conditions that allow a return to “ normal ” wireline transmission after diversion to the wireless link has occurred . this monitoring may be for example performed using test signals transmitted from the user site to the network at specific time intervals and the success of carrying that traffic is used to determine if switching back to the wireline link is possible . the frequency with which the wireline link is tested may be increased progressively between tests to avoid the testing from impacting on a connection which is suffering from a long duration problem . still further , a small amount of the low priority user traffic may be used as a test signal . as indicated above , data switching mechanism 52 switches the data path from the wireline link 15 to wireless link 30 and back , after the fault signal clears . by adding the backup wireless data link 30 to a dsl or fibre access link 15 , the customer is provided with the ability to restore connectivity for low volume and speed , critical services without over - engineering either network . this results in high availability for these critical services at low cost . a wireline link processor 53 ( a modem ) performs data formatting and signalling according to the protocol used on wireline link 15 . as discussed above , this could be a broadband communication link such as dsl , cable modem , or optical ethernet transceiver , etc . similarly , a wireless link processor 55 performs data formatting and signalling according to the protocol used on wireless link 30 . some examples of the possible technologies which could be used for the wireless link include a cdma 1x network , a cellular ‘ 3g ’ network , a 802 . 11 network , or a 802 . 16 or ‘ wimax ’ network . fig1 shows processing of forward traffic that accesses networks 20 or 25 from cpe 5 . the traffic processing for the reverse direction ( from network 20 or 25 to cpe 5 ) is performed in a similar manner . namely , the switch receives the traffic from one of the two links 15 , or 30 , as established by adequate signalling , and routes it to the customer over ha interface 10 . as noted above , the invention allows the wireless channel to be activated not just on failure of the wireline channel , but also in the situations where the wireline channel is suffering from performance impairment , such as inadequate throughput , excessive bit error rate or packet loss , or excessive delay . the nature and number of link performance parameters that trigger the switch , as well as the level of acceptable values may be configured by the user in the link monitoring mechanism 51 . fig1 is drawn showing the key decision to switch to the alternate path as being determined by the link monitoring mechanism 51 and implemented in the data switching mechanism 52 . in this instance , the network link reconfiguring mechanism 61 plays no active role in switching to the alternate link . mechanism 61 simply passively learns ( eg . by ethernet mac bridging ) which link is active . alternatively , the network link reconfiguring mechanism 61 may determine that switching to the backup link is required , and the customer premise equipment ( cpe ) can be made passive . in general it is assumed that one end only will be responsible for making the switching decision to avoid the need for coordination between cpe 5 and network provider equipment ( npe ) 6 , although the decision making could be split between the cpe function 51 and the npe function 61 . for example , npe 6 could make switching decisions on factors such as bit error rate or capacity loading , while cpe 5 could make switching decision based on loss of signal or latency . in the event of failure or performance degradation , cpe 5 delivers the upstream traffic identified as high priority to the wireless link 30 in preference to other traffic types , for example in accordance with the diffserve qos model . traffic prioritization is useful because the backup link 30 through the wireless network typically has lower capacity than the wireline network link 15 and also has a relatively high cost per bit . it is also common for wireless based networks to have more variable performance than is typically the case for wireline networks . it is therefore useful in most instances to have a means of identifying which traffic is most important and treating it differently . an analogous prioritization of downstream traffic is performed by the network link downstream filtering mechanism 62 . the invention provides for additional functionality , shown in dotted lines , for better controlling which traffic on a wireline link should be backed up to a wireless link of lower capacity . the identification of important traffic may be set by the customer , and may also be a function of the cpe 5 and network provider equipment 6 . the identification of high priority traffic may be based on one or more of the following factors : the source or destination mac address , the 802 . 1q vlan id , the 802 . 1q ethernet priority marking , the source or destination ip address , or the ip class of service identifier ( eg . diffserve code point ). to select the high reliability traffic from the respective flow , additional data filtering mechanisms need to be employed at the customer premise and at a network provider premise , as shown in dotted line of fig1 by units 58 and 62 . the data filtering function is preferably provided for the forward direction in the cpe 5 between the ha interface 10 and data switching mechanism 52 , and is provided for the reverse traffic ( from the network to cpe 5 ) in the network link downstream filtering mechanism 62 within the network provider equipment npe 6 . a further variant of the invention allows the wireless channel to be activated not just on failure or degradation of the wireline channel , but also in the situation where the wireline channel has reached maximum capacity , that is wireless becomes the ‘ overflow ’ channel and both channels 15 and 30 operate simultaneously . link monitor 51 detects this condition based e . g . on flow rate measurement . in this “ overflow ” mode , the two connections operate simultaneously . this is in contrast to the “ backup ” mode where the wireline network does not carry traffic when traffic is switched to the wireless link and the wireless link does not carry traffic when traffic is switched to the wireline link . the “ overflow &# 39 ; mode ”, unlike existing link aggregation mechanisms such as 802 . 3ad and ml ppp , keeps all possible traffic on the primary wireline link , and the minimum possible traffic on the wireless link . to deliver this overflow function , a mechanism must be implemented at both sides of the link to distribute the traffic between the two links . in the forward traffic direction ( user to network ), a link splitting functionality is performed by the data switching mechanism 52 and the split traffic is merged back into a single stream by the link reconfiguring mechanism 61 , shown in dotted line at network provider equipment 6 . for the reverse traffic ( network to user ), the link reconfiguring mechanism 61 splits the traffic streams for distribution along the multiple links , and the traffic is merged into as single stream again at the data switching mechanism 52 in the cpe . if traffic filtering functions are to be performed on traffic upstream to the network which exceeds the link capacity , ( i . e . to drop low priority packets or buffer traffic to keep it within the available capacity ), these must be implemented within the mechanism 58 . if traffic filtering functions are to be performed on traffic downstream to the customer which exceeds the link capacity , these must be implemented within the mechanism 62 . three alternative approaches are proposed in this invention for the basic management of the parallel wireline and wireless links , i . e . for implementing the data switching mechanism 52 and network link reconfiguration mechanism 61 and link monitor 51 . only one of these approaches would be employed in any given physical implementation . the first alternative mechanism employs osi ‘ layer 1 ’ mechanisms . specifically , the link monitor 51 observes activity on the wireline link 15 . if a problem condition is detected , e . g . no traffic received within a defined time - out interval , or one or more traffic parameters are degrade to below an acceptable threshold , a ‘ layer 1 switch ’ ( e . g . electrical switch ) occurs , diverting the physical connection to the wireless link . this mechanism is extremely inexpensive to implement , but will typically cause any session in progress to fail during the switchover . as a result , re - authentication may be required after the switchover . the second mechanism for switching to the backup wireless link at the data switching mechanism 52 would use osi layer 2 switching . for example , this could be implemented using an adaptation of 802 . 3ad ethernet link bonding . if a problem condition is observed by the link monitor 51 on the wireline link 15 , traffic is diverted to the wireless link 30 , using the mechanisms defined within the 802 . 3ad specification . for example this could occur by rewriting the ‘ operational key ’ which then reassigns the mac address of the outgoing interface in accordance with the 802 . 3ad standard . the network link reconfiguring mechanism 61 implements the other end of the 802 . 3ad link aggregation mechanism . the second diversion mechanism allows switching to the wireless link without loss of ip session continuity . the adaptation consists of link monitor 51 sensing total failure , partial failure or overloading of the wireline link and modifying the 802 . 3ad attributes to switch traffic to or from the wireless link . the use of the 803 . 3ad switching mechanism requires that both wireless and wireline link channels have an ethernet interface . in the event that either link is not ethernet , a layer 3 mechanism , such as that described below will be usable instead . the third mechanism for diversion to the backup wireless link at the data switching mechanism 52 uses osi layer 3 and 4 protocols , for example via an adaptation of the ml - ppp ( multi - link point to point protocol ) as defined in ietf rfc1990 / 1717 . again , ml - ppp is normally designed to make multiple links appear to be a single virtual communication channel . ml - ppp operates at osi layers 3 and 4 and therefore can be implemented with across any layer 2 link type including atm and frame relay . however standard ml - ppp does not allow one link to be used as ‘ primary ’ and another link as ‘ backup only ’. this invention proposes an adaptation of this standard mechanism to force the traffic to take one path or the other based on defined criteria such as failure of a primary link as described above . this would typically be implemented as a variant of the ml - ppp software in both cpe 5 and a network based gateway 61 , and use the link control protocol ( lcp ) to signal the switch to move to one of the three states : ‘ wireline available / wireless unavailable ’ or ‘ wireline unavailable / wireless available ’, or ‘ both links available ’, as in fig1 . | 7 |
the following description is provided to enable any person skilled in the art to make and use the invention and sets forth the best modes contemplated by the inventors of carrying out their invention . various modifications , however , will remain readily apparent to those skilled in the art , since the generic principles of the present invention have been defined herein specifically to provide an improved calibration feature to a conductivity meter . the preferred embodiments of the present invention will now be described with reference to the drawings . referring to fig1 and 2 , showing the essential components of the electromagnetic induction - type conductivity meter of the present invention , reference numeral 1 designates a case made of plastic resins which have superior insulation and corrosion resistance characteristics , such as pfa ( per fluoro alkyl vinyl ether ), pvc ( poly vinyl chloride ), and pvdf ( poly vinyliden fluoride ). the case or housing 1 is provided with a liquid - flowing passageway 7 consisting of a longitudinal vertical passageway 3 having an opening 2 at its lower end portion and a horizontal passageway 6 having openings 4 and 5 on its respective right and left sides and communicated traversely with the vertical passageway 3 . a transformer chamber 10 houses an exciting or primary transformer 8 and a detecting or secondary transformer 9 therein under a condition that they are electrically insulated from each other and are formed at a pointed end of the housing 1 . the transformers 8 and 9 have the same size circular iron cores 11 and 12 . an exciting coil 13 and a detecting coil 14 are wound around the iron core 11 and the iron core 12 , respectively . the vertical passageway 3 is arranged so as to pass through the respective centers of the iron cores 11 and 12 of both transformers 8 and 9 . reference numerals 15 and 16 designate lead wires connected with the exciting transformer 8 and connected with an alternating power source 17 at end portions thereof . in addition , reference numerals 18 and 19 designate a lead wire extending from the detecting transformer 9 and provided with an output terminals 20 and 21 at an end portion thereof , respectively , and thus connected with an operation - controlling portion ( not shown ). the operation - controlling portion can sense the induced current as a signal representative of a condition of the sample liquid . the value of the signal can be used to both monitor the operability of the meter on a display 36 and also to calibrate the instrument based on the assumption of a linear relationship of a ratio of the measured signal to a predetermined output . reference numeral 22 designates a loop - like stationary resistance circuit extending through the respective iron cores 11 and 12 in a parallel manner to the passageway 3 . the stationary resistance circuit 22 includes a lead wire 23 , a resistance or resistor 24 having an appointed resistance value , and an on - off switch 25 so as to open or close the circuit 22 . as can be seen , the lead wire 23 need not be in the fluidic passageway 3 . in one embodiment , the operation - controlling portion can constitute an appropriate conversion of the voltage signal , e c , across the output terminals 20 and 21 by an a / d converter 30 , and a storing of that value through an i / o interface circuit ( not shown ) into an operating cpu 32 with appropriate memory 34 . the cpu can also control the alternating power source 17 . the voltage signal , e s ., across the switch 25 is also converted into a digital value and stored for subsequent processing . next , an operation of an electromagnetic induction - type conductivity meter having the above - described construction will be described with reference to fig3 . if the on - off switch 25 is open or closed under a condition that a sample liquid , to be measured , flows in the direction shown by an arrow in fig2 a voltage is output between the output terminals 20 and 21 of the detecting transformer 9 . when the on - off switch 25 is opened , the voltage e c generated by an electrical current i c , depending upon a conductivity of the liquid to be measured , is output between the output terminals 20 and 21 . this is quite similar to that in the conventional electromagnetic induction - type conductivity meter . however , when the on - off switch 25 is closed , a different voltage value is obtained by adding a voltage e s generated by an electrical current i s , depending upon the value of the resistance 24 to the voltage e c , is output between the output terminals 20 and 21 . these output voltages are expressed as follows : a differential voltage ( e on - e off = e s ) between the voltage e on and the voltage e off has a constant value as long as the exciting coil 13 and the detecting coil 14 remain in a normal operating condition . however , if the respective parts deteriorate in a manner so as to change the voltage e on and the voltage e off , the voltage e s is also changed . in the case where values of the above - described respective voltages are changed , a check of the detecting system sensitivity , a calibration of the measured value in sensitivity , and a judgment of the existence of an abnormal situation and the like can be achieved by suitably monitoring these values in an operating - controlling portion and comparing the measured value with a predetermined value in a comparator circuit ( not shown ). as mentioned above , a software program can alternatively perform these operations in an operating cpu 32 and display the results on display 36 . provided that the voltage e off between the output terminals 20 and 21 during the time when the on - off switch 25 is opened is e c , and the voltage e on between the output terminals 20 and 21 during the time when the on - off switch 25 is closed is e c &# 39 ;+ e s &# 39 ;, the difference between both voltages at that time becomes e s &# 39 ;. thus , voltage e s can be compared with the voltage e s &# 39 ; to obtain e s &# 39 ;/ e s . a value of this e s &# 39 ;/ e s is compared with an appointed value to be able to determine the sensitivity of the detecting system . if the ratio e s &# 39 ;/ e s is within a permissible range , then e c &# 39 ;× d s &# 39 ;/ e s can be used as an electrical conductivity coefficient for calibrating the sensitivity . in addition , when the voltage e s &# 39 ; is nearly equal to zero , it is judged that at least one of the exciting coil 13 and the detecting coil 14 is disconnected . moreover , when the voltage e s &# 39 ; is larger than the standard value , it can be judged that the exciting coil 13 is short - circuited . in addition , if the resistance value of the stationary resistance circuit 22 is constant , the resistance 24 is not always required . also , although the resistance 24 is provided within the case 1 in the above - described preferred embodiment , it may alternatively be provided in the operating - controlling portion . in the case of a sample having a relatively high conductivity ( 10 to 1 , 000 ms / cm ), the full scale of the conductivity meter is 1 , 000 ms / cm , and a fixed resistance of 5ω corresponds to 1 , 000 ms / cm . according to the present invention , a check of the detecting system sensitivity , a calibration of the measured value in sensitivity , and a judgment of the existence of any disconnection and short - circuit in the coils and the like can be achieved while the electrical conductivity of the sample liquid is measured . accordingly , the sensitivity of the instrument can be checked without using a calibration liquid and interrupting the measurement of electrical conductivity . as a result , the measuring efficiency of electrical conductivity can be improved and calibration liquid will not contaminate the sample liquid . in addition , a superior effect is obtained in that the calibration of the measured value in sensitivity and the judgment of the existence of any disconnection or short - circuit in the coils and the like can be conducted at the same time as a check of the detecting system sensitivity . those skilled in the art will appreciate that various adaptations and modifications of the just - described preferred embodiment can be configured without departing from the scope and spirit of the invention . therefore , it is to be understood that , within the scope of the appended claims , the invention may be practiced other than as specifically described herein . | 6 |
although the disclosure hereof is detailed and exact to enable those skilled in the art to practice the invention , the physical embodiments herein disclosed merely exemplify the invention which may be embodied in other specific structures . while the preferred embodiment has been described , the details may be changed without departing from the invention , which is defined by the claims . turning now to the figures , fig1 is the basic schematic of an embodiment 100 of an improved voltage regulator circuit 100 according to the present invention . generally , the circuit 100 includes a rectifier circuit 110 , a microprocessor 52 , a voltage reference u 1 , and one or more switching circuits , such as an scr control circuit 120 . the circuit also includes a positive battery connection 101 , a ground connection 102 , a first ac input 103 , a second ac input 104 , and a third ac input 105 . the voltage reference u 1 is preferably a stable voltage reference , such as a shunt regulator , that provides power 161 for the microprocessor u 2 . the microprocessor u 2 contains an analog - to - digital converter ( not shown ) which uses the applied power 161 from the voltage reference u 1 as its reference voltage . a voltage divider 130 formed by resistors r 1 , r 2 may be used to divide the battery voltage 162 down to within an acceptable range of the microprocessor u 2 for sensing purposes . the phase timing of three ac signals , provided on the ac inputs 103 , 104 , 105 from an ac generator ( acg ) 300 is monitored by the microprocessor u 2 through dropping resistors r 5 , r 6 , r 7 . the scr control circuit 120 may or comprised of a transistor q 2 operatively coupled to diodes d 1 , d 2 , d 3 , wherein drive resistors r 8 , r 9 provide the gate drive current necessary to control the scrs scr 1 , scr 2 , scr 3 . that is , q 2 may be a pnp bipolar junction transistor , or a common collector cascade arrangement of same , wherein the collector is in electric communication , through one or more drive resistors r 9 , with the anodes of the diodes d 1 , d 2 , d 3 . the cathode of each diode d 1 , d 2 , d 3 is then electrically coupled to a gates of a respective scr . the rectifier 110 is comprised of three scrs scr 1 , scr 2 , scr 3 in respective combination with three diodes d 4 , p 5 and d 6 , thereby forming a three - phase full - wave rectifier which converts the ac signals of the acg 300 into the at least substantially direct current voltage that may used to charge a battery 302 , which is electrically coupled as is known between the positive battery connection 101 and the ground connection 102 , and operate the electrical devices that may be selective coupled to the battery 302 . such devices may include , by way of nonlimiting examples , a light 304 , a radio 306 , and a heater 308 , which may be electrically coupled to the battery 302 through switches 310 . in this arrangement , the microprocessor u 2 may monitor the ac inputs 103 , 104 , 105 , monitor the battery voltage 162 , or divided representation thereof , and may control the provision of rectified electricity in a controlled manner when required or desired . a preferred microprocessor is a pic12f510 , 8 - bit flash microcontroller , available from microchip technology , inc ., of chandler , ariz . furthermore , although the regulator circuit 100 is shown to include functional components , is to be understood that further components may be included or substituted . for instance the switching circuit 120 will likely require proper transistor biasing , and the transistor q 2 may be provided , as mentioned , as a cascade arrangement . furthermore , transient voltage suppression and other circuit components may be desirable , but are generally circuit design techniques that are presently known in the art . additionally , the operation of the microprocessor u 2 may also be achieved by using a combination of discrete electronic components , but the microprocessor u 2 is preferred due to space and ease of minor functional alterations through programming . in prior three - phase voltage regulator designs , three scrs in a rectifier circuit were sized to handle slightly over one - third of the total current that is expected to be received from an acg . however , it has been discovered that due to large current pulses received from the acg , in combination with wiring and connector losses , there are many times when an r - c filter will trigger a single scr , and then delay for a time period equal to almost a full cycle of the ac signals provided . this can result in repeated triggering of the same scr , or same two scrs , thus ultimately leaving one or more scrs unused for some period of time . this situation can occur at any acg speed with the proper loading on the regulator and occurs much more often as the power output of a given acg increases . the result may be an over - heating of the repeatedly triggered scrs , which may result in a lock - up condition which may be reset by dropping the output of the acg or reducing the load to a point where the locked scr temperature drops below the critical lock - up temperature . comparisons between prior analog regulators and regulators according to the present invention which provide scr load sharing have shown a substantial difference in performance with similar scrs . in many tests , the differences were dramatic . a circuit provided and operated according to the present invention can ensure that the scrs of a 3 - phase regulator are triggered such that the load current will be shared at least substantially equally between the three scrs scr 1 , scr 2 , scr 3 that are coupled to the respective ac inputs 103 , 104 , 105 . the microprocessor u 2 examines the three ac inputs , preferably at a sampling rate of at least 20 to 1 , more preferably of at least 36 to 1 , and even more preferably at about 50 to 1 . at the falling edge of each signal 103 , 104 , 105 , the microprocessor u 2 determines whether an scr should be triggered , such as by sensing that the battery voltage 162 , or a representation thereof , has dropped below a demand threshold voltage level , the microprocessor u 2 examines a three - state counter to determine whether the scr connected to the currently examined ac input is the next scr that should be fired . once the determined scr is fired , the counter is advanced to the next state , in preparation to fire the next scr in sequence , when the next voltage demand arises . to determine the proper scr sequence , the microprocessor u 2 preferably analyzes the phase relationships of the ac signals provided on the ac inputs ac 1 , ac 2 , ac 3 . by sampling the ac inputs received at the microprocessor u 2 , a process for determining phase relationships can be used , as seen in fig3 . in determining phase relationships , ac 1 , which is coupled to scr 1 is always specified as phase - 1 , or the first phase . then , it is preferable to analyze ac 2 , to determine whether the phase relationship of the ac signals is ac 1 - ac 2 - ac 3 or ac 1 - ac 3 - ac 2 . if the former , then ac 2 will be defined as phase - 2 and ac 3 will be defined as phase - 3 . if the latter , then ac 3 will be defined as phase - 2 and ac 2 will be defined as phase - 3 . in a quality assurance step 814 , it is determined if a subsequent cycle has the same phase order . if not , the process is repeated until two consecutive cycles have been found to have the same phase relationship . this step is especially useful to trigger all three scrs in desired order during heavy loading . for instance , if the acg phase relationship is 1 - 3 - 2 and the counter triggers the scrs in a 1 - 2 - 3 order , when scr - 1 is triggered , there will be a 120 degree gap before scr - 2 is triggered . this will be followed by a 120 degree gap before scr - 3 is triggered . the result will be a loss in overall power handling because the acg will only be able to provide current for 50 percent of the time . an alternate method of controlling the scrs involves a complete cycling of all scrs after power demand has been determined and prior to analyzing power demand . in this method , when the microprocessor u 2 determines that power is required or desired , such as by sensing that the battery voltage 162 , or a representation thereof , has dropped below a demand threshold voltage level , the microprocessor u 2 generates a drive pulse which lasts for approximately the time period of one complete ac signal cycle . this ensures that all three scrs are triggered once . at the end of such pulse , the microprocessor u 2 may then determine whether continued power is required or desired . if so , then another cycle - long drive pulse can be initiated or maintained . however , this technique may result in excess output voltage ripple at low engine speeds or light loads , where power demand is sporadic . however , at high speeds such cycling may be desirable , as such ripple is likely to be minimized . turning now to fig2 , representative oscilloscope traces are shown . in the scope traces , the top trace ch3 represents the voltage change physically measured at the battery 302 as the acg 300 applies output current at various times . the middle tract ch2 represents the voltage physically measured at a physical distance from the battery 302 , such as at the positive battery connection 101 of the regulator circuit 100 . theoretically , assuming ideal conduction between the battery 302 and the regulator 100 , ch2 should directly correspond and overlap ch3 . however , as can be seen , the voltage ch3 at the battery 302 , measured at point 302 a , rises about 1 . 1 volts between time zero at the center of the tract arid 1 . 00 milliseconds or one time division . however , measured at the other end of the cabling , at point 101 a , and through connectors used in a system , the voltage ch2 measured at the output of the regulator rises 3 . 0 volts during that same time period . thus , if only the voltage ch2 at the regulator , 101 a , is considered in the regulation process , the average will be skewed high . without compensating for cabling and connector loss , the battery voltage ch3 could actually drop by 1 . 9 volts . note the vertical voltage scale setting on the oscilloscope trace for ch3 is half the scale for ch2 . a circuit according to the present invention may clip peak voltage levels in the feedback path between the regulator output terminals and the regulator software low - pass filter when the regulator has activated the scrs between the acg 300 and the battery 302 . these peaks occur due to the losses in the cable and connectors and are not representative of the actual battery voltage . as a result , the voltage on the low - pass filter will more closely represent the actual battery voltage , thereby ignoring connection losses . the microprocessor reads the output voltage of the regulator with an analog - to - digital converter on a periodic basis and averages the readings using the following formula : where old_avg equals the previously calculated new_avg and new_reading is a digital representation of a voltage level sensed by the a - d converter , preferably an 8 - bit digital value . this is a commonly used low - pass algorithm . however , it has been discovered that when the scrs in the voltage regulator are active , the new_reading values may adversely affect the filtering and manipulation of the new_reading value during active voltage regulation provides adaptive voltage droop compensation . during normal operation , the microprocessor u 2 waits until it is time to trigger an scr . it does this by monitoring the respective ac signal for a high - to - low transition . for instance , if scr 1 is to be fired , then the microprocessor u 2 analyzes the ac signal through r 5 from the first ac input 103 for a high - to - low transition . then , the microprocessor u 2 compares the present old_avg value to a predetermined variable , but preferably fixed , number which represents a desired battery voltage . if the old_avg is below the desired value , the scr is triggered and a “ conduction flag ” is set in the microprocessor &# 39 ; s onboard random access memory ( ram ). if the old_avg is above the desired value , no trigger pulse occurs and the “ conduction flag ” is preferably cleared . as the microprocessor u 2 waits for the next high - to - low phase transition of the acg phase , or ac input , which has been determined to be the next phase adjacent in time to the current phase , it continues to monitor the voltage provided by the voltage divider 130 . but , if the “ conduction flag ” is set and the new_reading value exceeds a predetermined clipping threshold amount , which is greater than or equal to the predetermined desired battery voltage , predetermined clipping threshold is substituted for the new_reading in the averaging algorithm . therefore , despite the voltage loss in the electric cabling and connectors , the averaging algorithm compensates by ignoring excessive voltage levels that may occur during regulation , thereby limiting the effects of such losses . this may be especially advantageous in systems in which the losses are expected or predicted to change over time , such as through corrosion or fracture . an example 917 of a method of performing this adaptive voltage droop compensation 917 can be seen in fig5 . this figure also depicts the general voltage averaging process . in a timer check step 902 , a timer is evaluated to determine if the programmable time constant of the software low pass filter has expired . such time constant may be selectively chosen for circuit performance , but is preferably on the order of 100 microseconds to 200 microseconds , and more preferably about 128 microseconds . furthermore , if an overvoltage condition arises , the over - voltage counter is set 916 with a counter value to delay a desired amount of time , preferably about five seconds . it has also been discovered that upon addition of a demanding load to the circuit of the battery 302 , thus rapidly increasing power demand and decreasing perceived battery voltage 162 , the extremely low voltage level sensed by the microprocessor may skew the averaging algorithm of the software low - pass filter , thereby causing an apparent power shortage that would otherwise demand significant voltage from the regulator . thus , if the demanding load is removed from the circuit , the battery voltage 162 may overshoot the desired level because the average provided by the low - pass filter has been skewed low . a circuit according to the present invention may clip voltage levels presented to the microprocessor u 2 software low - pass filter which are much lower than the predetermined desired battery voltage level . since any voltage on the low pass filter which is below a desired voltage level generally would activate the scrs located between the acg 300 and the battery 302 , a very low level voltage provided to the software low - pass filter is an indication that the system current demands have exceeded the output current of the acg 300 . by limiting the floor voltage presented to the low - pass filter to a predetermined , variable but preferably static level , a low clipping threshold , which is below the desired voltage level , the battery voltage 162 will not over - shoot above the predetermined desired voltage level when the excessive load is removed . before the microprocessor u 2 compares the old_avg to the predetermined desired value , the old_avg is compared to the predetermined low clipping threshold . if the old_avg value is below the low clipping threshold , the value of the old_avg is set to the low clipping threshold value . because the low clipping threshold is below the desired value , the scrs will be driven on until the new_avg increases to above the predetermined desired value . this clipping generally only occurs if the system load exceeds the maximum acg output capability . instead of a protracted recovery in the event of a fast removal of the load , the clipping will result in a very short duration between the time that the load is removed and the time when the new_avg value rises above the predetermined desired value and turns off the scrs . the result is a reduction in the maximum peak battery voltage . this reduces stresses in sensitive electrical equipment . an example 883 of a method of performing this voltage rebound compensation can be seen in fig4 . the foregoing is considered as illustrative only of the principles of the invention . furthermore , since numerous modifications and changes will readily occur to those skilled in the art , it is not desired to limit the invention to the exact construction and operation shown and described . while the preferred embodiment has been described , the details may be changed without departing from the invention , which is defined by the claims . | 7 |
a detailed description will be given below on an embodiment of the present invention with reference to the accompanying drawings . fig1 is a block diagram showing the system structure of an image pickup apparatus according to this embodiment . the image pickup apparatus of fig1 is capable of picking up and recording moving image data that is made up of 30 frames of image data per second as well as reproducing a recorded moving image . the apparatus can take still pictures in addition to moving images . a central processing unit ( cpu ) 100 controls the entire image pickup apparatus . denoted by 101 is an interface circuit ( i / f ) for the cpu 100 , 102 denotes a recording medium such as a memory card , and 103 denotes an interface circuit ( i / f ) for the recording medium 102 . reference numeral 106 denotes a dynamic random access memory ( dram ) where image data , program and the like are stored . reference numeral 104 denotes a system controller , which is engaged in sequential control , bus arbitration control , and the like . reference numeral 107 denotes an image pickup lens , and 108 denotes an image pickup element composed of a one - chip charge - coupled device ( ccd ). denoted by 109 is an a / d conversion circuit to convert an analog signal into a digital signal . reference numeral 110 denotes a signal processing circuit and 111 , a magnification circuit to reduce or enlarge image data in a horizontal or vertical direction through thinning - out processing , linear interpolation processing , or the like . reference numeral 112 denotes a raster - block conversion circuit , which converts raster scan image data magnified by the magnification circuit 111 into block scan image data . denoted by 113 is a buffer memory for raster - block conversion . the memory 113 is used to convert raster data into block scan data . reference numeral 114 denotes a compression circuit , which employs jpeg to encode image data outputted block by block from the raster - block conversion circuit 112 and to thereby compress the amount of the data . when a moving image is picked up , the raster - block conversion circuit 112 denotes frames of moving image data that are in raster scan order into an order of blocks having predetermined number of pixels in length and width , and outputs the converted data . the compression circuit 114 encodes , when a moving image is picked up , frames of image data outputted from the raster - block conversion circuit 112 by jpeg . jpeg is , as well known , an intraframe encoding method which encodes image data are using only image data in the same frame . the raster - block conversion circuit 112 at this point reads out frames of image data stored in the buffer memory 113 starting from a block 501 , which is located at the upper left corner of the screen as shown in fig5 . the raster - block conversion circuit 112 next reads out the block to the right of the block 501 on the screen , and then continues on in this way until the rightmost block on the screen is reached . after the rightmost block is read out , blocks immediately below the current row of blocks are read out in a similar manner starting from the leftmost block . a memory control circuit 105 transfers , during recording , by dma transfer , image data outputted from the compression circuit 114 to the dram 106 , and transfers image data stored in the dram 106 via the system controller 104 and the i / f 103 to the recording medium 102 , where the transferred image is recorded . when image data is to be reproduced , the memory control circuit 105 reads out compressed image data from the recording medium 102 , transfers , by dma transfer , the read data to the dram 106 via the interface circuit 103 and the system controller 104 , and transfers , by dma transfer , the image data in the dram 106 to a reproduction circuit 121 , which will be described later . the cpu 100 uses a predetermined program to create decoded image data through software processing in which jpeg - encoded image data is decoded . the cpu 100 performs thinning - out processing and linear interpolation processing to reduce and enlarge , respectively , a decoded image . the reproduction circuit 121 performs modulation , addition of synchronized signals , digital / analog conversion and the like on image data that is reproduced from the recording medium 102 and decoded , to thereby convert the reproduced and decoded data into a form suitable for display on a monitor 122 . the number of pixels of an image that can be outputted to and displayed on the liquid crystal monitor 122 , which serves as a display unit , is smaller than the number of pixels of the image pickup element . denoted by 123 is an operation unit , which is composed of a switch splay , a switch sfwd , a switch srev , a switch szup , a switch szdown , and a switch sstop . denoted by 124 is a four - way operational key composed of a switch sup , a switch sdown , a switch sright , and a switch sleft . the functions of the switches of the operation unit 123 will be described . the switch splay is a switch used to command that an image be played . when the switch splay is turned on , an image recorded on the recording medium 102 is displayed on the liquid crystal monitor . the switch sfwd is a switch for playing one still image ahead , and the switch srev is a switch for playing one still image back . the switch szup is a switch used to command the apparatus to enlarge an image being played , and the switch szdown is a switch used to command the apparatus to reduce in size an image being played . the switch sstop is a switch used to command the apparatus to pause a moving image that is being played . each time the switch sstop is operated , one of an instruction to resume playing a moving image and an instruction to pause playing is outputted in an alternating manner . the switch sup , the switch sdown , the switch sright and the switch sleft correspond to the upper , lower , right and left portions of the four - way operational key 124 , respectively . the four - way operational key 124 is , as will be described later , effective when a reproduced image is displayed enlarged . the switch sup is a switch used to command the apparatus to scroll up over an enlarged image , the switch sdown is a switch used to command the apparatus to scroll down , the switch sright is a switch used to command the apparatus to scroll to the right , and the switch sleft is a switch used to command the apparatus to scroll to the left . fig4 a to 4c are diagrams showing a reproduced image and how the image is displayed on the monitor . fig4 a shows frames of a moving image before the image is enlarged and displayed . fig4 b shows areas of the moving image data of fig4 a that are decoded and stored in the dram 106 to extract and enlarge a part of each frame of the moving image data . fig4 c shows the screen of the monitor 112 which is displayed when the monitor 112 displays the moving image of fig4 a . described next with reference to fig2 and 3 is processing for playing a moving image . in this embodiment , a frame of moving image data before encoded has an aspect ratio of 4 : 3 , and 1280 pixels ( h )× 960 ( v ). such moving image data is reproduced from the recording medium 102 and is displayed on the monitor 122 , which has a resolution of 640 pixels ( h )× 480 pixels ( v ). as has been described , each frame of moving image data is encoded by jpeg and , to reproduce the moving image data , data of a frame is decoded by jpeg separately from data of another frame . the cpu 100 goes into a play mode when it is detected that the switch splay has been turned on . in step s 201 , the cpu 100 controls the interface circuit 103 and the system controller 104 to start reading out a desired moving image file from of the recording medium 102 . the image data read out from the recording medium 102 is transferred to and stored in the dram 106 in order . in step s 202 , the display magnification is initialized and × 1 display magnification is set to display the whole image on the monitor 122 . in step s 203 , the cpu 100 sets a still image stored at the head of the moving image file , and starts a timer set in accordance with a desired frame rate . in step s 204 , a state of the switch splay is judged . when the switch splay is off , the cpu 100 ends the play mode whereas the play mode is maintained and the cpu 100 moves to the next step when the switch splay is on . in step s 205 , a state of the switch sstop is judged . when the switch sstop is on , the cpu 100 pauses playing a moving image and moves to step s 206 . when the switch sstop is off , the moving image is kept played and the cpu 100 moves to the next step . stop mode processing in step s 206 will be described later . in step s 207 , states of the zoom switches szup and szdown , which are used to specify a display magnification , are judged . as a user operates either one of the zoom switches , the cpu 100 moves to step s 208 . in the case where neither of the switches szup and szdown is operated , the cpu moves to step s 217 . in step s 217 , whether the display magnification is × 1 magnification or not is judged . when an image is displayed enlarged , the cpu 100 moves to step s 218 , and to step s 220 when the display magnification is × 1 magnification . in step s 220 , the display magnification is set to × 1 . in step s 221 , the original image size , namely , 1280 pixels ( h )× 960 pixels ( v ), is set as the size in which the image data is to be read out from the dram 106 in accordance with the display magnification set in step s 220 . in step s 222 , the cpu 100 sequentially reads out , via the memory control circuit 105 , from the dram 106 , image data in the head frame of the moving image file set in step s 203 , and decodes the read image data . the decoded image data is sequentially written in the dram 106 block by block via the memory control circuit 105 . in step s 223 , whether decoding processing has been completed for one frame of image data or not is checked . in the case where decoding processing for one frame of image data has been completed , the cpu 100 moves to step s 224 . in step s 224 , the cpu 100 changes the resolution of decoded image data from the original image size to the resolution of the monitor 122 . specifically , the cpu 100 reads out stored image data from the dram 106 via the memory control circuit 105 and converts the resolution of the image data . when the display magnification is × 1 , the original image size , 1280 pixels ( h )× 960 pixels ( v ), is reduced by ½ in width and by ½ in height . the converted image data is sequentially written in a display area in the dram 106 . thus 640 pixels ( h )× 480 pixels ( v ) image data for display is stored in the dram 106 . the stored image data is displayed as shown in screens 60 and 61 of fig4 c . in step s 214 , whether the frame that is currently displayed is the last frame of the moving image data or not is judged . in the case where it is the last frame , the moving image play mode is ended . in the case where it is not the last frame , the cpu 100 moves to step s 215 . in step s 215 , which frame is to receive reproduction processing next is set . in step s 216 , the timer set in step s 203 is checked to determine whether a predetermined period of time has passed or not . in the case where the predetermined time has passed , the cpu 100 proceeds to processing the next frame of the image data . described next is the operation of displaying a moving image that is being played enlarged . a user operates the switch szup for enlarged display while a moving image is being played at × 1 magnification . then the cpu 100 judges in step s 207 that the switch szup has been operated , and moves to step s 208 . in step s 208 , a larger magnification is set each time the user operates the switch szup ( to × 2 at one flick of the switch szup , × 4 at the next flick ) whereas a smaller magnification is set each time the user operates the switch szdown ( to × 2 at one flick of the switch szdown , × 1 at the next flick ). in this embodiment , the display magnification is changed to × 2 by operating the switch szup while a moving image is being displayed at × 1 magnification . in this embodiment , an area of the original image is extracted in accordance with the enlarging magnification , and the extracted portion of image data is subjected to enlarging processing in accordance with the number of pixels of the monitor 122 . in step s 209 , the size of the area to be extracted is obtained from the original image size and the magnification set in step s 208 , to set a range to be extracted for enlarged display on the original screen . for instance , when the display magnification set in step s 208 is × 2 , the size of the extracted area is set to 640 pixels ( h )× 960 pixels ( v ) by multiplying 1280 pixels × 960 pixels by ½ in width and length , respectively . similarly , the display magnification set in step s 208 is × 4 , the size of the extracted area is set to 320 pixels ( h )× 240 pixels ( v ) by multiplying the original image size by ¼ in width and length , respectively . here , the display magnification set in step s 208 is 2 . in step s 210 , the cpu 100 reads out one frame of stored image data from the dram 106 via the memory control circuit 105 , and decodes the read - out image data block by block . at this point , the cpu 100 sequentially reads out one frame of image data stored in the dram 106 starting from a block at the upper left corner of the screen as shown in fig5 , and decodes the read - out image data . the decoded image data is sequentially transferred to and stored in the dram 106 via the memory control circuit 105 . after decoding processing is started in order from the upper left corner block on the screen in this way , the cpu 100 compares in step s 211 the position on the screen of the decoded image data against the extraction range set in step s 209 . the cpu 100 continues the processing of reading out encoded image data from the dram 106 and the processing of decoding the read - out image data until the position of the decoded image data exceeds the extraction range . when it is judged that the extraction range is exceeded , the cpu 100 moves to step s 212 . in step s 212 , the processing of decoding encoded image data is stopped . as a result , the dram 106 now stores image data of the range shown in 52 of fig4 b in a decoded state whereas image data of an area below this range on the screen remains encoded . in fig4 b , 520 indicates the extraction range set in step s 209 . in step s 213 , the cpu 100 converts the resolution of the image data in the extracted area set in step s 209 into the resolution of the monitor 122 . in other words , the cpu 100 has the memory control circuit 105 read out image data of an extraction area , specifically , image data in the extraction range 520 of fig4 b , from the dram 106 , and converts the resolution of the read image data into the resolution of the monitor 122 in accordance with a set display magnification . for instance , when the display magnification is × 4 , image data of 320 pixels ( h )× 240 pixels ( v ) extraction area is doubled in the horizontal direction and the vertical direction each . when the display magnification is × 2 , there is no need to convert the resolution and the image data is displayed as it is since the size of the extraction range is 640 pixels ( h )× 480 pixels ( v ). the image data with the resolution thus converted is written in a display memory area of the dram 106 in order . in this way , enlarged image data having 640 pixels ( h )× 480 pixels ( v ) is stored in the display memory area of the dram 106 , and the stored image data is displayed as a × 2 magnification image on the monitor as shown in a screen 62 of fig4 c . subsequently , steps s 214 to s 207 are repeated to set the next frame . in the case where the switches szup and szdown are found to be off in step s 207 , the cpu 100 moves to step s 217 . in step s 217 , the display magnification is checked to judge whether it is × 1 magnification or not . when the display magnification is judged to be larger than × 1 magnification , the cpu 100 moves to step s 218 . when the display magnification is judged as × 1 magnification , the cpu 100 moves to step s 220 . in step s 218 , the cpu 100 judges states of the switches sup , sdown , sright and sleft of the four - way operational key 124 . when the user operates any one of the four switches to instruct the apparatus to change the display position , the cpu 100 moves to step s 219 . when none of the switches sup , sdown , sright and sleft is operated , the cpu 100 moves to step s 210 . in the case where the four - way operational key is not operated while the screen 62 of fig4 c is displayed , a screen 63 is displayed without changing the current display range . subsequently , steps s 210 to 218 are repeated to display the continuous frames 62 and 63 of a moving image enlarged . on the other hand , when the user operates the four - way operational key 124 to change the display position while a moving image is being played enlarged , the cpu 100 checks the states of the switches sup , sdown , sright and sleft and moves to step s 219 . in step s 219 , the cpu 100 sets a new area to be extracted for enlarged display in a direction that is designated via the switches . for example , in the case where the switch sleft is operated while a screen 53 of fig4 b is displayed , the extraction range is moved to the left of the range 530 to set a new extraction range 540 . as a result , the display screen of the monitor 122 is switched to a screen 64 of fig4 c . the user operates the switch sstop in step s 205 to pause a moving image that is being played enlarged . this causes the cpu 100 to move into a stop mode where playing of a moving image is paused . fig3 is a flow chart showing processing of the stop mode in step s 206 . in step s 301 , the cpu 100 initializes display settings and sets a parameter disp to 0 . in step s 302 , the cpu 100 reads out one frame of image data stored in the dram 106 via the memory control circuit 105 , and decodes the read - out image data in order . the decoded image data is sequentially transferred to and stored in the dram 106 via the memory control circuit 105 . in step s 303 , completion of decoding one frame of image data is waited . image data stored at this point in the dram 106 is as shown in a screen 55 of fig4 b . in other words , when instructed to pause playing , the cpu 100 decodes all of image data of one frame , including an area of image data below the extraction range 550 for enlarged display , and stores the decoded image data in the dram 106 . when decoding one frame of image data is completed , the cpu 100 judges in step s 304 states the zoom switches szup and szdown , which are used to specify a display magnification . in the case where the user operates either one of the zoom switches , the cpu 100 moves to step s 305 . in the case where the user operates neither the switch szup nor the switch szdown , the cpu 100 moves to step s 310 . in step s 310 , the state of the display magnification is judged . when the display magnification is judged to be larger than × 1 magnification , the cpu 100 moves to step s 311 . when the display magnification is judged as × 1 magnification , the cpu 100 moves to step s 314 . in step s 311 , the cpu 100 judges the states of the switches sup , sdown , sright and sleft of the four - way operational key 124 . when the user operates any one of the four switches to instruct the apparatus to shift the display range , the cpu 100 moves to step s 313 . when none of the switches sup , sdown , sright and sleft is operated , the cpu 100 moves to step s 312 . in step s 312 , the value of the variable disp is checked . when it is judged that a still image is being displayed at a pause command ( disp = 1 ), the cpu 100 moves to step s 309 . on the other hand , when it is judged that a moving image , not a still image , is being displayed ( disp = 0 ), the cpu 100 moves to step s 307 . in step s 307 , the cpu 100 converts the resolution of image data in the extraction range that is stored in the dram 106 , in accordance with the resolution of the monitor 122 . in other words , of image data stored in the dram 106 , the cpu 100 reads image data in the extraction range and converts the resolution of the read image data in accordance with a set display magnification . for instance , when the display magnification is × 4 , 320 pixels ( h )× 240 pixels ( v ) extraction range image data is doubled in the horizontal direction and the vertical direction each . when the display magnification is × 2 , the 640 pixels ( h )× 480 pixels ( v ) extraction range image data is outputted as it is . the converted data is written in a display memory area of the dram 106 in order . thus 640 pixels ( h )× 480 pixels ( v ) image data is stored in the display memory area of the dram 106 . while the pause playing command is effective , the one frame of moving image data stored in the display memory area is repeatedly read out and outputted to the monitor 122 , to thereby display an enlarged image as a still image as shown in a screen 65 of fig4 c . in step s 308 , the parameter disp indicating whether a moving image or a still image is being displayed is set to 1 . in the case where the user operates the switch sstop in step s 309 in order to cancel the pause command while playing is paused , the cpu 100 ends the stop mode to resume playing a moving image in response . when the sstop is off , the cpu 100 moves to step s 304 . when it is judged in step s 310 that the display magnification is × 1 magnification , the original image size , namely , 1280 pixels ( h )× 960 pixels ( v ), is set in step s 314 as a size in which image data is read out from the dram 106 . in step s 315 , the cpu 100 converts the resolution of the decoded image data from the original image size to the resolution of the monitor 122 . then the cpu 100 sets the parameter disp to 1 and moves to step s 309 . in the case where an instruction made by the user to change the display position is detected by detecting in step s 311 that any one of the switches sup , sdown , sright and sleft of the four - way operational key 124 has been operated , the cpu 100 moves to step s 313 . in step s 313 , the cpu 100 sets moves the extraction range in a direction designated through the four - way operational key 124 . specifically , in the case where the switch sright is operated while the screen 65 of fig4 c is displayed , the extraction range is changed from 550 of fig4 b to 560 , with the result that a screen 66 of fig4 c is displayed on the monitor 122 . during the change , the monitor 122 keeps displaying a still image . as has been described , according to this embodiment , one frame of encoded image data stored in the dram 106 is read out and decoded sequentially starting from an upper end of the screen in response to an enlargement command given while a moving image is played . as image data in an extraction range necessary in enlarged display is decoded , processing of reading out encoded image data from the dram 106 is ended , and decoding processing on this frame is stopped to proceed to processing of the next frame . in this way , there is no need to read out a portion of encoded image data that is unnecessary for enlarged display , from the dram 106 , and to process decoding on this portion . accordingly , the dram is accessed less frequently and the load of the cpu is thus lightened . in addition , an enlarged play function can be obtained without increasing the load of the cpu even when the number of pixels per frame is increased , and at the same time , the power consumption can be reduced . another technological advantage of this embodiment is improved ease of use in pausing an enlarged moving image since the display position can be moved as processing of expanding a still image is completed . the above embodiment describes a case of playing a moving image , but similar processing can be performed when a still image is to be played . the expansion processing and magnification processing of a still image , which are performed by the cpu in the above - described example , may be carried out by hardware . the object of the present invention can also be achieved by providing a storage medium storing program codes for performing the aforesaid processes to a reproduction apparatus , reading out the program codes , by a cpu or mpu of the reproduction apparatus , from the storage medium , then executing the program . in this case , the program codes read out from the storage medium realize the functions according to the embodiments , and the storage medium storing the program codes constitutes the invention . further , the storage medium , such as a floppy disk , a hard disk , an optical disk , a magneto - optical disk , cd - rom , cd - r , a magnetic tape , a non - volatile type memory card , and rom , and computer network , such as lan ( local area network ) and wan ( wide area network ), can be used for providing the program codes . furthermore , besides aforesaid functions according to the above embodiments are realized by executing the program codes which are read out by a cpu from the reproduction apparatus , the present invention includes a case where an os ( operating system ) or the like working on the computer performs a part or entire processes in accordance with designations of the program codes and realizes functions according to the above embodiments . furthermore , the present invention also includes a case where , after the program codes read from the storage medium are written in a function expansion card which is inserted into the reproduction apparatus or in a memory provided in a function expansion unit which is connected to the reproduction apparatus , cpu or the like contained in the function expansion card or unit performs a part or entire process in accordance with designations of the program codes and realizes functions of the above embodiments . in a case where the present invention is applied to the aforesaid storage medium , the storage medium stores program codes corresponding to the flowchart of fig2 and 3 described in the embodiments . the present invention is not limited to the above embodiments and various changes and modifications can be made within the spirit and scope of the present invention . therefore to apprise the public of the scope of the present invention , the following claims are made . this application claims priority from japanese patent application no . 2004 - 213788 filed jul . 22 , 2004 , which is hereby incorporated by reference herein . | 7 |
since diffusion from the endplate 105 is crucial for maintaining the intervertebral disc , effort is made to re - establish nutrient and waste exchange between the nucleus pulposus and circulation within the vertebral body . guided by anteroposterior and lateral views from fluoroscopes , a trocar 103 enters posteriolaterally , 45 ° from mid - line into the disc 100 , as shown in fig5 . this guiding technique is similar to the one used in diagnostic injection of radiopaque dye for discography or chymopapain injection for nucleus pulposus digestion . a dilator 230 is inserted over the trocar 103 , as shown in fig6 . the trocar 103 is then withdrawn . the dilator 230 remains as a passage leading into the disc 100 , as shown in fig7 . fig8 shows the distal end of the dilator 230 near the nucleus pulposus 128 of the degenerating disc 100 . an elastically curved needle 101 , as shown in fig9 , is resiliently straightened in a rigid sleeve 220 indicated in fig1 . the round cross section of the straightened needle 101 and sleeve 220 is shown in fig1 . the resiliently straightened needle 101 within the rigid sleeve 220 is inserted into the dilator 230 and the disc 100 , as shown in fig1 . a longitudinal view of the needle 101 insertion into the degenerating disc 100 is indicated in fig1 . the elastically curved needle 101 is deployed by holding the rigid sleeve 220 stationary while pushing the needle 101 inward . the needle 101 resumes the curved configuration as it exits the distal opening of the sleeve 220 , puncturing upward as shown in fig1 , through the cartilage 106 and calcified layers 108 into the vertebral body 159 , as indicated in fig1 . multiple endplate 105 punctures 224 can be accomplished to re - establish the exchange of nutrients and waste between the disc 100 and bodily circulation . after retrieving the elastically curved needle 101 into the sleeve 220 , the assembly of needle 101 and sleeve 220 can be further advanced into or slightly withdrawn from the disc 100 to puncture more holes 224 through the calcified cranial endplate 105 . by turning the assembly of needle 101 and sleeve 220 180 °, the caudal endplate 105 can also be punctured , as shown in fig1 , to re - establish the exchange of nutrients , oxygen and waste through the superior and inferior endplates 105 . fig1 indicates restoration of swelling pressure within the nucleus pulposus 128 enabling the disc 100 to sustain compressive loads . with the presence of oxygen within the disc 100 , production of lactic acid may also decrease and ease chemical irritation and pain . endplate 105 puncturing can also be accomplished by electronic devices 134 , such as a laser , cutting or abrading device . fig1 depicts an electronic device 134 powering a cutter 127 to puncture , drill , abrade or cauterize the endplate 105 to re - establish the exchange of nutrients and waste . the electronic device 134 can be a cautery , laser , or drill . re - establishing the exchange of nutrients and waste through the calcified endplate 105 can also be accomplished using a conduit 126 . a conduit 126 can be an elastic tube 125 with a lumen or channel 104 and tissue - holding flanges 113 at both ends , as shown in fig1 . the orientations of the flanges 113 located at both ends of the conduit 126 are counter gripping to anchor onto the endplate 105 . the tube 125 is inserted over the elastically curved needle 101 and abutting a sliding plunger 109 , as shown in fig2 . the needle 101 carrying the elastic tube 125 is resiliently straightened within the rigid sleeve 220 , as depicted in fig2 . the assembly of the straightened needle 101 , tube 125 , sleeve 220 and plunger 109 is inserted into the dilator 230 , as shown in fig2 , and into the disc 100 . as the resilient needle 101 carrying the tube 125 is deployed from the rigid sleeve 220 , the curvature of the needle 101 resumes and punctures through the calcified endplate 105 , as shown in fig2 . the needle 101 is withdrawn while the plunger 109 is held stationary to dislodge the tube 125 from the needle 101 into the endplate 105 , as shown in fig2 . the lumen 104 of the tube 125 acts as a passage for exchanging nutrients , gases and waste between the vertebral body 159 and the inner disc 100 . a portion of the tube 125 is in the nucleus pulposus 128 or inner disc 100 , while the remaining portion is within the vertebral body ( not shown ) in fig2 . the handle 130 of the curved needle 101 and the handle 132 of the rigid sleeve 229 are used to maintain the direction of needle 101 deployment . the square handle 130 of the curved needle 101 is stacked within the handle 132 of the rigid sleeve 220 , as shown in fig2 , to avoid rotation between the needle 101 and sleeve 220 . the handle 130 of the needle 101 can also contain guide rails 131 , as shown in fig2 . the guide rails 131 are sized and configured to fit within the sunken tracks 133 on the handle 132 of the rigid sleeve 220 , as indicated in fig2 . direction of the needle &# 39 ; s curvature is indicated by the orientation lines 153 on the handle 130 of the needle 101 , as shown in fig2 , and on the rigid sleeve 220 as shown in fig2 . to indicate depth of insertion into the body , penetration markers 116 are labeled on the sleeve 220 , as shown in fig2 . the guide rails 131 within the tracks 133 keep the handles 130 , 132 from rotating around each other , as shown in fig2 . as the resiliently straightened needle 101 advances and protrudes from the rigid sleeve 220 , the curvature of the needle 101 resumes , as shown in fig3 . since the handle 130 of the needle 101 and the handle 132 of the sleeve 220 are guided by the rails 131 in tracks 133 , the direction of needle 101 puncturing is established and predictable for the operator or surgeon . non - circular cross - sections of the needle 101 and rigid sleeve 220 can also prevent rotation . fig3 shows a needle 101 and a sleeve 220 with oval cross - section . fig3 indicates a square cross - section . fig3 depicts a rectangular cross - section . fig3 shows a triangular cross - section . conduits 126 can also be made small enough to fit within the lumen of the elastically curved needle 101 . a conduit 126 can be a small tube 125 with a longitudinal channel 104 , as shown in fig3 , for transporting nutrients , oxygen and waste dissolved in fluid . the tubular conduit 126 with a lumen 104 can be braided or weaved with filaments , as shown in fig3 . the fluid can be transported through the lumen 104 as well as permeated through the braided filaments of the tube 125 . the tubular conduit 126 can also be molded or extruded with porous or spongy material , as shown in fig3 , to transport nutrients , oxygen and waste dissolved in fluid through the lumen 104 as well as through the pores . nutrients , oxygen , lactate , metabolites , carbon dioxide and waste can also be transported in fluid through capillary action of multi - filaments or braided filaments 122 , as shown in fig3 . a conduit 126 may not require the longitudinal lumen 104 as mentioned . a strand of braided filaments 122 can be a suture with channels formed among weavings of the filaments , capable of transporting fluid with nutrients , gases and waste . the braided filaments 122 can be coated with a stiffening agent , such as starch , to aid deployment using the plunger 109 . similar to the channels formed by the braided filaments 122 , a conduit 126 made as a spongy thread 124 , as shown in fig3 , can also transport fluid with nutrients , gases and wastes through the pores and channels formed within the porous structure . a conduit 126 is inserted into a longitudinal opening 269 of an elastically curved needle 101 abutting a plunger 109 , as shown in fig4 . to minimize friction between the curved needle 101 and the rigid sleeve 220 , the distal end of the lumen 268 of the sleeve 220 is angled or tapered with a bevel 102 or an indentation , conforming to the concave curvature of the needle 101 , as shown in fig4 . a lubricant or coating to lower friction can also be applied on the surface of the elastically curved needle 101 and / or within the lumen 268 of the rigid sleeve 220 . the elastically curved needle 101 carrying the conduit 126 is resiliently straightened within a rigid sleeve 220 , as shown in fig4 . the assembly is then inserted into a dilator 230 , as indicated in fig4 , which leads into the disc 100 . as the resiliently straightened needle 101 is deployed from the sleeve 220 , the needle 101 carrying the conduit 126 resumes the curved configuration and punctures into the cartilaginous endplate 105 through the calcified layers 108 , as shown in fig4 . the elastically curved needle 101 is then retrieved into the sleeve 220 while the plunger 109 is held stationary to deploy the conduit 126 at the calcified endplate 105 , as shown in fig4 . fig4 depicts insertion of the needle 101 , conduit 126 , plunger 109 , sleeve 220 and dilator 230 into the disc 100 . the resiliently straightened needle 101 carrying the conduit 126 is deployed from the sleeve 220 , resumes the curvature and punctures through the endplate 105 and calcified layers 108 , as shown in fig4 . while the plunger 109 behind the conduit 126 is held stationary , the elastically curved needle 101 is withdrawn from the calcified endplate 105 and retrieved into the sleeve 220 to deploy , expel or dislodge the conduit 126 at the calcified endplate 105 , as shown in fig4 . the conduit 126 acts as a channel or a passage , bridging between the bone marrow of the vertebral body 159 and the disc 100 to re - establish the exchange of fluid , nutrients , gases and wastes . fig4 shows the general location of the conduit 126 between the disc 100 and the vertebral body through the calcified endplate ( both not shown ). multiple conduits 126 can be loaded in series into the curved needle 101 , as shown in fig5 . each conduit 126 is deployed sequentially at the calcified endplate 105 by retrieving the curved needle 101 and holding the plunger 109 stationary . in essence , the plunger 109 is advanced toward the distal end of the needle 101 one conduit - length at a time . after deploying the first conduit 126 at the cranial endplate 105 , the rigid sleeve 220 is rotated 180 ° to deploy the second conduit 126 into the caudal endplate 105 , as shown in fig5 . multiple conduits 126 within the elastically curved needle 101 allow surgeons to implant multiple conduits through calcified endplates 105 without having to withdraw the needle 101 assembly , reload additional conduits 126 and re - insert the assembly into the disc 100 . in the supine position , disc pressure is low . during sleep , fluid is drawn in by the water absorbing glycosaminoglycans within the nucleus pulposus 128 . by bridging the calcified endplate 105 , the glycosaminoglycans draw fluid with sulfate , oxygen and other nutrients through the conduits 126 into the nucleus pulposus 128 during sleep by ( 1 ) capillary action , and ( 2 ) imbibing pull of the water - absorbing glycosaminoglycans . the flow of sulfate , oxygen and nutrients is channeled within the conduit 126 unidirectionally toward the nucleus pulposus 128 , rather than via the dispersion mechanism in diffusion . it is generally accepted that disc 100 degeneration is largely related to nutritional and oxygen deficiency . by re - establishing the exchange , a renewed and sustained supply of sulfate may significantly increase the production of sulfated glycosaminoglycans and restore swelling pressure . restoration of swelling pressure within the nucleus pulposus 128 reinstates the tensile stresses within the collagen fibers of the annulus , thus reducing the inner bulging and shear stresses between the layers of annulus , as shown in fig5 . similar to a re - inflated tire , disc 100 bulging is reduced and nerve impingement is minimized . thus , the load on the facet joints 129 is also reduced to ease pain , the motion segment is stabilized , and disc 100 space narrowing may cease . the progression of spinal stenosis is halted and / or reversed , as shown in fig5 to ease pain . in daily activities , such as walking and lifting , pressure within the disc 100 greatly increases . direction of the convective flow then reverses within the conduit 126 , flowing from high pressure within the disc 100 to low pressure within vertebral bodies 159 . the lactic acid and carbon dioxide dissolved in the fluid within the nucleus pulposus 128 is slowly expelled through the conduit 126 into the vertebral bodies 159 , then to bodily circulation . as a result , the lactic acid concentration decreases , and ph within the disc 100 is normalized . furthermore , due to the abundance of oxygen in the disc 100 supplied through the conduit 126 , lactic acid normally produced under anaerobic conditions may drastically decrease . hence , the pain caused by acidic irritation at tissues , such as the posterior longitudinal ligament 195 , superior 142 and inferior 143 articular processes of the facet joint , shown in fig5 , is anticipated to quickly dissipate . buffering agents , such as bicarbonate , carbonate or others , can be loaded or coated on the conduits 126 to neutralize the lactic acid upon contact and spontaneously ease the pain . the elasticity of the curved needle 101 still can twist within the rigid sleeve 220 during endplate 105 puncturing , as shown in fig5 . the likelihood of twisting increases with the length of the elastic needle 101 . the twisting is depicted in a cross - sectional view of the sleeve 220 , needle 101 and conduit 126 in fig5 . the elastic twisting between the shafts of the needle 101 and sleeve 220 allows directional shift at the tip of the needle 101 during contact with the calcified endplate 105 . as a result , puncturing of the endplate 105 may fail . to avoid twisting , the cross - sections of the needle 101 and sleeve 220 can be made non - round , such as oval in fig5 with a cross - sectional view in fig5 . a square cross - section is shown in fig5 . a rectangular cross - section is shown in fig5 . a triangular cross - section is in fig6 . the elastic property of the curved needle 101 may bend and fail to penetrate through the calcified endplate 105 , as shown in fig6 . the direction of the bend or droop is at the convex side of the curvature of the needle 101 . to minimize the droop , the distal end of the rigid sleeve 220 is cut at an angle , providing an extension to support the convex side of the curved needle 101 during endplate 105 puncturing , as shown in fig6 . the angled cut of the rigid sleeve 220 functions as a rigid needle 220 with a sharp tip supporting the convex side of the curved needle 101 , as shown in fig6 . the supporting structure can be further extended by cutting an indentation near the distal end of the rigid needle 220 , as shown in fig6 , to increase support of the convex side of the curved needle 101 during endplate 105 puncturing . to further support the elastically curved needle 101 , a window 270 may be located near the distal end of the rigid sleeve 220 with an oval cross - section , as shown in fig6 . the distal side of the window 270 is open slanted at an angle . the slant can also be formed with multiple angles into a semi - circular - like pocket , sized and configured to fit the convex side of the elastically curved needle 101 . fig6 shows protrusion of the elastically curved needle 101 from the window 270 of the rigid sleeve 220 . the sharp tip of the curved needle 101 is located on the concave side of the curvature to avoid scraping or snagging on the distal portion of the window 270 during deployment . fig6 shows deployment of the elastically curved needle 101 from the window 270 of the rigid sleeve 220 . the semi - circular pocket of the distal window 270 supports and brackets around the base of the convex curvature to minimize bending , twisting and / or deflection of the curved needle 101 during endplate 105 puncturing . in essence , the slanted portion of the window 270 provides a protruded pocket to direct and support the curved needle 101 . the distal end of the rigid sleeve 220 can be sharpened to function as a rigid needle 220 with the window 270 , as shown in fig6 . when a substantial amount of bone is formed , puncturing through the bony endplate 105 with a small curved needle 101 can be challenging . increasing the size of the needle 101 and creating a large hole 224 at the endplate 105 may cause leakage of nucleus pulposus 128 into the vertebral bodies 159 . to support a small curved needle 101 , a shape memory extension 271 containing a curvature similar to the curved needle 101 is added to strengthen and support the elastically curved needle 101 , as shown in fig6 . the shape memory extension 271 can be indented , as shown in fig6 , or tubular at the distal end . the curved needle 101 and shape memory extension 271 are capable of sliding independently within the rigid sleeve or needle 220 . fig6 shows resiliently straightening of both the curved needle 101 and shape memory extension 271 within the rigid sleeve 220 . both the curved needle 101 and shape memory extension 271 apply stresses on the rigid sleeve 220 . to minimize potential bending of the rigid sleeve 220 , the stresses are distributed over a larger area by positioning the tip of the needle 101 proximal to the curvature of the shape memory extension 271 , as shown in fig6 - 69 . spreading of the stresses also helps to ease the deployment and retrieval of both the needle 101 and shape memory extension 271 . for tissue puncturing , the shape - memory extension 271 is deployed from the rigid sleeve 220 , as shown in fig6 , followed by the curved needle 101 gliding along the curvature of the shape - memory extension 271 and puncturing into the calcified endplate 105 , as shown in fig7 . the shape memory extension 271 provides support to the needle 101 to minimize bending and twisting during puncturing without increasing the size of the puncture . the shape memory extension 271 can also be non - indented and sharpened to facilitate tissue piercing , as shown in fig7 . to dislodge the conduit 126 at the endplate 105 , the plunger 109 behind the conduit 126 is held stationary , while the curved needle 101 is retrieved into the shape memory extension 271 . the shape memory extension 271 is then withdrawn into the rigid sleeve 220 . the outer diameter of the curved needle 101 can be made non - uniform , being small at the distal end for creating a small opening , as shown in fig7 . the adjoining curved portion of the needle 101 contains a thick wall and a larger outer diameter to support and strengthen the process of endplate 105 puncturing . the transition between the small and large outer diameters is gradual , as shown in fig7 , or in steps . the curved needle 101 with varying outer diameters can be made by grinding , machining or injection molding . the lumen 268 of the rigid needle 220 may have a bevel 102 and a double - sided ramp 272 , as shown in fig7 . the bevel 102 or tapering at the distal end of the lumen 268 minimizes friction against the concave side of the curved needle 101 during deployment and retrieval . the double - sided ramp 272 is protruded at the side opposite to the bevel 102 with the distal side in continuation with the sharp tip or extended end of the rigid needle 101 . the proximal side of the ramp 272 or protrusion can be shaped to conform to and support the convex side of the curved needle 101 during endplate 105 puncturing . the ramp 272 can be made with epoxy , solder or other hardened material , then shaped by machining . the ramp 272 can also be created during a molten process to seal the lumen 268 at the distal end . the sealed end is then cut , the ramp 272 and bevel 102 are shaped , and the lumen 268 is re - opened by machining . sections of the conduit 126 are made to optimize the exchange of nutrients and waste . fig7 shows a conduit 126 with braided filaments 122 connected to a porous tube 125 with a lumen 104 . the tubular 125 portion acts as a funnel , collecting nutrients from capillaries within the vertebral body 159 and funneling the nutrients into braided filaments 122 within the nucleus pulposus 128 . especially at the endplate 105 , mineralization within the pores or channels of the conduit 126 may occlude or block the exchange of nutrients and waste between the vertebral body 159 and disc 100 . fig7 shows a tube 125 covering or wrapped around the mid - section of the conduit 126 to prevent ingrowth of minerals or tissue into the pores or channels . the material for making the tube 125 can also have swelling , expanding or sealing characteristics to seal the puncture at the endplate 105 and prevent formation of schmorl &# 39 ; s node . the swelling , expanding or sealing material can be polyethylene glycol , polyurethane , silicon or others . an anti - ingrowth film or coating at the mid - section of the conduit 126 may also discourage mineralization or occlusion within the channels or pores to ensure long lasting exchange of nutrients and waste . especially within the vertebral body 159 or outer annulus , formation of fibrous tissue over the conduit 126 may occur , hindering the exchange of nutrient and waste . a portion of the conduit 126 can be coated , grafted , covalently bonded or ionic bonded with a drug to minimize fibrous formation . the drug can be actinomycin - d , paclitaxel , sirolimus , cell - growth inhibitor or fibrous tissue inhibitor . due to the soft or pliable characteristic , conduits 126 made with braided filaments 122 are difficult to deploy with the retrieving needle 101 and stationary plunger 109 . a conduit 126 made with braided filament can be stiffened with water soluble agents , such as starch , collagen , hyaluronate , chondroitin , keratan or other biocompatible agents . after deployment , the soluble stiffening agent dissolves within the body , exposing the filaments to transport nutrients , oxygen and waste . fig7 shows a monofilament 110 used as a stiff core within the braided conduit 126 to assist deployment . the monofilament 110 can be made with degradable material to maximize transport area after deployment of the conduit 126 . degradable tubes 125 , indicated in the shaded area of fig7 , can also be used to wrap and stiffen the braided filaments 122 . the degradable tube 125 or the degradable monofilament 110 can be made with poly - lactide , poly - glycolide , poly - lactide - co - glycolide or others . since nutrients are relatively abundant within the peripheral 1 cm of the disc 100 , the conduit 126 can also draw nutrients from the outer annulus through capillary action into the nucleus pulposus 128 . a needle 101 carrying the starch - stiffened conduit 126 ( not shown ) and a plunger 109 is punctured into a disc 100 with calcified endplates 105 , as shown in fig7 . the needle 101 guiding technique is similar to the one used in diagnostic injection of radiopaque dye for discography or chymopapain injection for nucleus pulposus 128 digestion to treat herniated discs 100 . guided by anteroposterior & amp ; lateral views from fluoroscopes , the needle 101 enters posteriolaterally , 45 ° from mid - line into the disc 100 . a longitudinal view of the needle 101 carrying the stiffened conduit 126 puncturing through the disc 100 with calcified endplates 108 is shown in fig7 . by holding the plunger 109 stationary while the needle 101 is being withdrawn , the conduit 126 is dislodged from the lumen of the needle 101 and deployed across the disc 100 , as shown in fig7 - 80 . at least one end of the conduit 126 is placed less than 1 cm from the periphery of the disc 100 to draw nutrients and drain lactic acid . to enhance imaging , the section of the needle 101 containing the conduit 126 can be coated with a radiopaque , echogenic or magnetic coating 163 , as shown in fig8 . multiple conduits 126 can be safely and accurately deployed into different areas of a degenerating disc 100 . fig8 shows two conduits 126 deployed across a degenerating disc 100 , exchanging nutrients and waste between the inner and outer disc 100 . in locations lacking any major blood vessel and organ , the tip of the needle 101 can be guided beyond the disc 100 , as shown in fig8 , to deploy the conduit 126 beyond the disc 100 , as shown in fig8 . the extended conduit 126 may draw significantly more nutrients into the disc 100 . in addition , the extended conduit 126 may be more effective in disposing the waste generated within the disc 100 and expediting the repair and / or regeneration of the disc 100 , as shown in fig8 . psoas major muscles 193 are located adjacent to the lumbar segment of the spine . the needle 101 carrying the conduit 126 can puncture beyond the disc 100 into the muscle 193 . as a result , the conduit 126 can draw nutrients from the muscle 193 into the disc 100 , as shown in fig8 . muscles 193 are well supplied with nutrients and oxygen , and muscles 193 dissipate lactic acid well . by extending into the muscles 193 , the conduits 126 can draw an abundant amount of nutrients and safely deposit the waste from the inner disc 100 to repair or regenerate the degenerating disc 100 , as shown in fig8 . the supple and tensionless conduits 126 are expected to be free from interfering with the functions of the disc 100 and muscles 193 . methods and devices for conduit 126 deployments can also be in various combinations . the conduits 126 can be delivered into the endplates 105 , as shown in fig5 , and transverse the annulus , as shown in fig8 or 87 . an accelerated disc degeneration model was developed using rat tails . a tail section involving three discs was twisted or rotated 45 ° and held for 2 weeks . the section was then compressed by coil springs and held for an additional period of time . all discs within the section degenerated . discs that had received additional nucleus pulposus from donor discs by injection experienced a delay in degeneration . furthermore , insertions of the additional nucleus pulposus prior to the destructive loads provided the longest delay against disc degeneration . after lumbar fusion procedures , the intervertebral discs 100 of adjacent free motion segments degenerate quickly . the degenerative process leads to more pain and possibly more surgery ; following each new fusion is a new vulnerable segment adjacent to it . accelerated degeneration of segments adjacent to a lumbar fusion may be the result of additional post - fusion stress and load . in the rat model , the added volume within the nucleus pulposus had a protective function against the destructive load . in conjunction with spinal fusion procedures , implanting conduits 126 within discs 100 adjacent to the fused segment may provide adequate swelling pressure contributed by an abundant supply of sulfate and oxygen to delay and hopefully prevent adjacent disc 100 degeneration . device migration with time is always a concern . the average age of patients undergoing back surgery is 40 - 45 years old . the conduit 126 is expected to remain in place within the patients for fifty or more years . migration of the tensionless conduits 126 may result in loss of effectiveness , but it is not likely to be detrimental to nerves , ligaments , muscles or organs . to minimize migration , knots 161 can be tied on the braided conduit 126 , as shown in fig8 , to anchor within the annulus , endplate 105 and / or muscle 193 . similar to knots 161 , rings 162 or protruded components 162 can be crimped on the conduit 126 , as shown in fig8 . both the knots 161 and the protrusions 162 are small enough to fit within the needle 101 . tissue ingrowth can also limit or prevent device migration . indentations 160 or tissue ingrowth holes 160 can be created on the conduit 126 , as shown in fig9 , to discourage migration with time . the conduit 126 can also be used as a delivery vehicle to introduce healing elements for maintaining or regenerating the disc 100 . the conduit 126 can be coated or seeded with growth factor , stem cells , donor cells , nutrients , buffering agent or minerals . cells sensitive to sterilization can be loaded aseptically . installations of conduits 126 can be in multiple stages , separated by days , weeks , months or even years . initial conduit 126 deployment prepares the biological conditions , including ph , electrolytic balance and nutrients , to favor cell proliferation . subsequent deployments may contain seeded cells within the conduit 126 . since cellularity within the inner disc 100 is low , cell migration from the outer annulus or vertebral bodies 159 can be helpful in regenerating the degenerating disc 100 . cells can be transported along the convective flow within the conduit 126 into the nucleus pulposus 128 . the channels or pores within the conduit 126 need to be sufficiently large , about 50 to 200 microns . for minerals , nutrients , lactic acid and gas exchange alone , the channels or pore size can be much smaller . hence , the useful range of the channel or pore size of the conduit 126 is about 200 microns to 10 nanometers . potentially useful coating for the conduit 126 include antibiotic , anti - occlusive coating , lubricant , growth factor , nutrient , sulfate , mineral , buffering agent , sodium carbonate , sodium bicarbonate , alkaline , collagen , hydroxyapatite , analgesic , sealant , humectant , hyaluronate , proteoglycan , chondroitin sulfate , keratan sulfate , glycosamino - glycans , heparin , starch , stiffening agent , radiopaque coating , echogenic coating , cells or stem cells . the tube 125 for preventing occlusion from mineralization or tissue ingrowth can be made with a biocompatible polymer , such as polytetrafluoroethylene , polypropylene , polyethylene , polyamide , polyester , polyurethane , silicon , poly - ether - ether - ketone , acetal resin , polysulfone , polycarbonate or polyethylene glycol . similar material can be used to coat or partially coat the conduit 126 to prevent blockage of nutrient and waste transport . the coating should be able to withstand sterilization by gamma , electron beam , autoclave , eto , plasma or uv light to prevent infection . especially for investigative purposes , a biodegradable conduit 126 may provide evidence within weeks or months . since the conduit 126 degrades within months , any unforeseen adverse outcome would be dissipated . if the investigative - degradable conduit 126 shows promise , a permanent conduit 126 can then be installed to provide continuous benefits . the biodegradable conduit 126 can be made with polylactate , polyglycolic , poly - lactide - co - glycolide , polycaprolactone , trimethylene carbonate , silk , catgut , collagen , poly - p - dioxanone or combinations of these materials . other degradable polymers , such as polydioxanone , polyanhydride , trimethylene carbonate , poly - beta - hydroxybutyrate , polyhydroxyvalerate , poly - gama - ethyl - glutamate , poly - dth - iminocarbonate , poly - bisphenol - a - iminocarbonate , poly - ortho - ester , polycyanoacrylate or polyphosphazene can also be used . similar biodegradable material can be used to make the biodegradable monofilament 110 in fig7 . a wide range of non - degradable materials can be used to fabricate the conduit 126 . biocompatible polymers , such as polytetrafluoroethylene , polypropylene , polyethylene , polyamide , polyester , polyurethane , silicon , poly - ether - ether - ketone , acetal resin , polysulfone , polycarbonate , silk , cotton , or linen are possible candidates . fiberglass can also be a part of the conduit 126 to provide capillarity for transporting nutrients and waste . conduits 126 can also be made with metal , such as nickel - titanium alloy or stainless steel . both non - degradable and degradable conduits 126 can be formed by molding , extruding , braiding , weaving , coiling , spiraling or machining . the conduits 126 can have a longitudinal lumen 104 , pores and / or channels for fluid exchange . the conduit 126 can be a suture with a proven safety record . the conduit 126 can also be called or classified as a shunt , wick , tube , braided suture , braided filaments , thread or sponge . the disc 100 with the conduits 126 installed can be called the shunted disc 100 . the rigid needle 101 , trocar 103 , dilator 230 and plunger 109 can be made with stainless steel or other metal or alloy . the elastically curved needle 101 , shape memory extension 271 and plunger 109 can be formed with nickel - titanium alloy . the needle 101 , rigid needle 220 , dilator 230 , shape memory extension 271 and plunger 109 can be coated with lubricant , tissue sealant , analgesic , antibiotic , radiopaque , magnetic and / or echogenic agents . since nutrients and oxygen are extremely low particularly in degenerating discs 100 , cell death is common , and healthy cells capable of producing glycosaminoglycans are few . healthy cells 277 can be drawn from another disc 100 within the patient to inject with a syringe 276 into the degenerated disc 100 , as shown in fig9 . exchange of nutrients and waste is re - established through the newly installed conduits 126 through the cranial and caudal endplates 105 to nourish both the donor cells 277 and the remaining cells within the degenerating disc 100 . similarly , donor cells 277 can also be injected into the disc 100 with transverse conduits 126 to revitalize the disc 100 , as shown in fig9 . since cellularity within the degenerative disc 100 is low , introduction of donor cells 277 may expedite the process of halting or reversing disc degeneration . the avascular disc 100 is well sealed . even small ions , such as sulfate , and small molecules , such as proline , are greatly limited from diffusing into the nucleus pulposus 128 . the well sealed disc 100 may be able to encapsulate donor cells 277 from a disc 100 of another person , cadaver or animal without triggering an immune response . for disc 100 regeneration , the donor cells 277 can also be stem cells 277 , notochord 277 or chondrocytes 277 . the semi - permeable conduits 126 are permeable to nutrients and waste but impermeable to cells , proteins , glycoproteins and / or cytokines responsible for triggering an immune reaction . the cells of the immune system include giant cells , macrophages , mononuclear phagocyts , t - cells , b - cells , lymphocytes , null cells , k cells , nk cells and / or mask cells . the proteins and glycoproteins of the immune system include immunoglobulins , igm , igd , igg , ige , other antibodies , interleukins , cytokines , lymphokines , monokines and / or interferons . the molecular weights of nutrients and waste are usually much smaller than the immuno - responsive cells , proteins and glycoproteins . the transport selectivity can be regulated or limited by the size of the pores or channels within the semi - permeable conduit 126 . the upper molecular weight cut - off of the conduit 126 can be 3000 or lower to allow the passage of nutrients and waste but exclude the immuno - responsive cells , proteins , immunoglobulins and glycoproteins . the semi - permeable conduit 126 may also contain ionic or affinity surfaces to attract nutrients and waste . the surfaces of the semi - permeable conduit 126 can be selected or modified to repel , exclude or reject immuno - responsive components . in recent years , cell transplants from cadavers or live donors have been successful in providing therapeutic benefits . for example , islet cells from a donor pancreas are injected into a type i diabetic patient &# 39 ; s portal vein , leading into the liver . the islets begin to function as they normally do in the pancreas by producing insulin to regulate blood sugar . however , to keep the donor cells alive , the diabetic patient requires a lifetime supply of anti - rejection medication , such as cyclosporin a . in addition to the cost of anti - rejection medication , the long - term side effects of these immuno - suppressive drugs are uncertain . the benefit of cell transplant may not out weigh the potential side effects . the intervertebral disc 100 with semi - permeable conduits 126 can be used as a semi - permeable capsule to encapsulate therapeutic donor cells 277 or agents , as shown in fig9 and 92 , and evade the immune response ; hence no life - long immuno - suppressive drug would be required . a variety of donor cells 277 or agent can be harvested and / or cultured from the pituitary gland ( anterior , intermediate lobe or posterior ), hypothalamus , adrenal gland , adrenal medulla , fat cells , thyroid , parathyroid , pancreas , testes , ovary , pineal gland , adrenal cortex , liver , renal cortex , kidney , thalamus , parathyroid gland , ovary , corpus luteum , placenta , small intestine , skin cells , stem cells , gene therapy , tissue engineering , cell culture , other gland or tissue . the donor cells 277 are immunoisolated within the discs 100 , the largest avascular organs in the body , maintained by nutrients and waste transport through the semi - permeable conduits 126 . the donor cells 277 can be from human , animal or cell culture . in the supine sleeping position , nutrients and oxygen are supplied through the conduits 126 to the donor cells 277 . during waking hours while the pressure within the disc 100 is high , products biosynthesized by these cells 277 are expelled through the conduit 126 into the vertebral bodies 159 , outer annulus or muscle 193 , then into the veins , bodily circulation and target sites . the product biosynthesized by the cells 277 within the shunted disc 100 can be adrenaline , adrenocorticotropic hormone , aldosterone , androgens , angiotensinogen ( angiotensin i and ii ), antidiuretic hormone , atrial - natriuretic peptide , calcitonin , calciferol , cholecalciferol , calcitriol , cholecystokinin , corticotropin - releasing hormone , cortisol , dehydroepiandrosterone , dopamine , endorphin , enkephalin , ergocalciferol , erythropoietin , follicle stimulating hormone , γ - aminobutyrate , gastrin , ghrelin , glucagon , glucocorticoids , gonadotropin - releasing hormone , growth hormone - releasing hormone , human chorionic gonadotrophin , human growth hormone , insulin , insulin - like growth factor , leptin , lipotropin , luteinizing hormone , melanocyte - stimulating hormone , melatonin , mineralocorticoids , neuropeptide y , neurotransmitter , noradrenaline , oestrogens , oxytocin , parathyroid hormone , peptide , pregnenolone , progesterone , prolactin , pro - opiomelanocortin , pyy - 336 , renin , secretin , somatostatin , testosterone , thrombopoietin , thyroid - stimulating hormone , thyrotropin - releasing hormone , thyroxine , triiodothyronine , trophic hormone , serotonin , vasopressin , or other therapeutic products . the products ( hormones , peptides , neurotransmitter , enzymes , catalysis or substrates ) generated within the shunted disc 100 may be able to regulate bodily functions including blood pressure , energy , neuro - activity , metabolism , activation and suppression of gland activities . some hormones and enzymes govern , influence or control eating habits and utilization of fat or carbohydrates . these hormones or enzymes may provide weight loss or gain benefits . producing neurotransmitters , such as dopamine , adrenaline , noradrenaline , serotonin or γ - aminobutyrate , from the donor cells 277 within the shunted disc 100 can treat depression , parkinson &# 39 ; s disease , learning disability , memory loss , attention deficit , behavior problems , metal or neuro - related disease . release of the products biosynthesized by the donor cells 277 within the shunted disc 100 is synchronized with body activity . during activities of daily living , the pressure within the shunted disc 100 is mostly high to expel the products biosynthesized by the donor cells 277 into circulation to meet the demands of the body . in the supine position , the flow within the shunts 126 is reversed , bringing nutrients and oxygen into the disc 100 to nourish the cells 277 . using islets of langerhans from the donor &# 39 ; s pancreas as an example , production of insulin is induced in the shunted disc 100 during sleeping hours when glucose enters into the disc 100 . during waking hours when disc pressure is high , insulin is expelled through the conduits 126 into circulation to draw sugars into cell membranes for energy production . at night , the insulin released from the shunted disc 100 is minimal to prevent the hypoglycemia . in essence , products biosynthesized by the donor cells 277 are released concurrent with physical activity to meet the demands of the body . some biosynthesized products from the donor cells 277 are appropriately deposited through the vertebral body 159 , as shown in fig9 , then into bodily circulation . other products may be more effectively transported through the outer annulus , as in fig8 , and diffused through the abdomen into bodily circulation . some other products may be far more effective by entering into the muscles 193 , as shown in fig9 . growth factors , buffering agents , hormones , gene therapeutic agents , nutrients , minerals , analgesics , antibiotics or other therapeutic agents can also be injected into the shunted discs 100 , similar to fig9 - 92 . it is to be understood that the present invention is by no means limited to the particular constructions disclosed herein and / or shown in the drawings , but also includes any other modification , changes or equivalents within the scope of the claims . many features have been listed with particular configurations , curvatures , options , and embodiments . any one or more of the features described may be added to or combined with any of the other embodiments or other standard devices to create alternate combinations and embodiments . the conduit 126 can also have a gate to regulate rate and / or flow direction of nutrient , gas and waste exchange . it is also possible to connect a pump to the conduit 126 to assist the exchange between the disc 100 and the bodily fluid . a ph electrode may be exposed near the tip of the rigid needle 220 to detect the acidity within the disc 100 . it should be clear to one skilled in the art that the current embodiments , materials , constructions , methods , tissues or incision sites are not the only uses for which the invention may be used . different materials , constructions , methods or designs for the conduit 126 can be substituted and used . nothing in the preceding description should be taken to limit the scope of the present invention . the full scope of the invention is to be determined by the appended claims . for clarification in claims , sheath is a rigid tubular member . the elastically curved needle 101 can be called the elastic needle . | 0 |
the page lifting spring of fig3 is not a stand - alone device . it must be used in combination with the page lifters of prior art as described in fig2 . together the page lifting spring and the page lifter form a page lifting system . the page lifting system essentially eliminates the loose - leaf binder closing problems . the page lifting spring is made of a sheet of relatively stiff durable material such as , but not limited to , plastic or polymer . the typical durometer of this material is 69 b . the page lifting spring is a single sheet of material that spans both covers and the center section of a loose - leaf binder . the page lifting spring may cover part of each loose - leaf binder cover or it may cover each cover completely . the page lifting spring has slots created in it so that it can be installed over the loose - leaf binder rings . there are two slots for each binder ring . the page lifting spring slots are sized and located such that the center section of the page lifting spring is flat when the binder is open , and each cover and the center section , is lying on a flat surface such as a table . the page lifting spring is not attached to the binder center section of the binder or the binder covers , but is kept in place by its slots sliding on the binder rings . the page lifting spring is first installed on the loose - leaf binder rings . the page lifters of prior art are installed next on the binder rings . the loose - leaf pages are then installed on the rings and then the rings are closed . as the binder begins to close , several simultaneous actions begin to take place . region 1 of fig2 begins to slide toward the outside edges of region 3 of fig3 and simultaneously region 4 of fig2 begins to slide toward the edge of region 5 of fig3 . regions 1 and 4 of fig2 are in contact with region 2 of fig3 . also as the binder begins to close , region 6 of fig2 begins to slide on region 7 toward region 3 of fig3 . simultaneously region 8 of fig2 begins to slide on region 21 toward region 5 of fig3 . also as the binder begins to close , region 3 of fig3 begins to slide on region 9 toward region 10 of fig1 . simultaneously region 5 of fig3 begins to slide on region 11 toward region 12 of fig1 . also as the binder begins to close , the left stack of pages , see fig5 , begins to slide on region 13 of the page lifting spring and region 14 which is the left binder cover toward region 15 which is the left edge of the binder cover of fig4 . simultaneously the right stack of pages of fig5 begins to slide on region 16 of the page lifting spring and region 17 , which is the right binder cover toward region 18 , which is the right edge of the binder cover of fig4 . a significant feature of the page lifting system is that the page lifting spring will not allow the edges of the page lifters of prior art , regions 1 and 4 of fig2 to fall into the position shown in regions 19 and 20 of fig6 . when the page lifting spring is not used the page lifter of prior art can assume the position shown in fig6 . when the page lifter is not used with the page lifting spring , there is no lifting action on regions 1 and 4 of fig2 . all of the lifting action comes from the page lifters of prior art riding up the ring . when the page lifting system is used , the lifting action occurs at the regions 1 and 4 of fig2 as well as the lifting action provided by the rings in the slots of the page lifter of prior art . | 1 |
this invention is described in the context of a radiotelephone or mobile terminal that operates in accordance with an analog ( fm ) mode and a time division multiple access ( tdma ) digital mode of operation ( dual - mode ), as specified in the dual - mode interim standard is - 136 and its future revisions . however , it should be realized that the teaching of this invention may be employed in an all - digital radiotelephone , and may also be employed in a radiotelephone that operates with spread spectrum ( ss ) and code division multiple access ( cdma ) techniques , such as that described in the is - 95 standard . fig1 illustrates a block diagram of a dual - mode mobile terminal ( is - 136 compatible ) that is constructed in accordance with the invention . an antenna ( 1 ) receives a signal from a base station ( not shown ). the received signal has a center frequency of 885 mhz . the received signal is fed through a bandpass filter ( 2 ) to a mixer ( 3 ). the receiver &# 39 ; s first local oscillator signal is generated with an rx - synthesizer ( 7 ) which is tuned above the received frequency by an amount equal to , by example , 45 mhz . the receiver block ( 4 ) demodulates and processes the received signal and provides the processed received signal , for voice information , to an audio processing block ( 5 ). the required audio processing is accomplished digitally ( using a digital to analog converter ) or in an analog manner , depending on the operating mode . the output of the audio processor 5 drives a loudspeaker ( 6 ) whereby a user is enabled to hear the speech of another party during a conversation . for the case where the short message service broadcast channel ( s - bcch ) is being received , the s - bcch information is extracted from the received signal by the receiver block ( 4 ), and the extracted digital information is input to a controller ( 20 ) on a path ( 4a ). in this regard the controller ( 20 ) manages various counters to maintain synchronization with the hyperframe and superframe counters and indicators of the b - sms , as described previously . having described the receiving side , a description is now given of the transmitting side of the dual - mode mobile terminal . a voice signal is fed from a microphone ( 8 ) to an analog to digital ( a / d ) converter ( sa ) and thence to a vocoder ( 9 ), in the digital mode , or to an audio processing block ( 14 ) for audio shaping and companding in the analog mode . after audio processing , the analog signal is fed to a digital to analog converter ( d / a ) ( 15 ) for conversion back to an analog signal . the operation of the d / a converter ( 15 ) is controlled by the controller ( 20 ), preferably implemented as one or more microprocessors that operate under a control program . in a presently preferred embodiment of this invention there are two microprocessors . one is a high speed digital signal processor ( dsp ) that manages the layer 1 and layer 2 real - time interface to the radio channel . the second microprocessor ( mcu ) is a slower speed device that is responsible for managing the user interface , via a keypad ( 22 ) and a user display ( 19 ), and also the layer 3 and above real - time interface to the radio channel . the layers 1 , 2 and 3 are illustrated in , by example , fig2 - 1 and 2 - 2 of the is - 136 rev . 0 specification . for simplicity , the dsp and the mcu are collectively illustrated in fig1 as the controller ( 20 ). in the digital mode of operation the controller ( 20 ) causes the output signal from the d / a converter ( 15 ) to assume a predetermined level , or to be switched out and replaced by a predetermined potential . in the analog mode of operation the controller ( 20 ) causes the output of the d / a converter ( 15 ) to be coupled to the input of a programmable oscillator of a transmitter synthesizer ( tx synth ) ( 16 ). that is , the output frequency of the tx - synthesizer ( 16 ) is varied in accordance with the input audio signal , thereby achieving a frequency modulation of the tx - synthesizer ( 16 ) output frequency . the controller ( 20 ) also operates to frequency modulate the tx - synthesizer ( 16 ) output frequency in accordance with signalling information to be transmitted . the tx - synthesizer ( 16 ) output frequency is also controlled to achieve channel switching . the output frequency of the tx - synthesizer ( 16 ) is applied to a mixer ( 17 ) wherein it is mixed with the output of an offset oscillator ( 18 ) to generate a transmitter injection signal ( lo ) at the final transmitter frequency ( 840 mhz ). the offset oscillator ( 18 ) is typically set to 90 mhz . a further oscillator ( not shown ) may provide a synchronizing frequency to the rx synth ( 7 ), the tx synth ( 16 ), and the offset oscillator ( 18 ). it should be realized that the exact frequencies of the transmitter and receiver synthesizers ( 7 ) and ( 16 ) and the offset oscillator ( 18 ) are adjustable according to application specific requirements . the values given above are suitable for use in the dual - mode interim standard specified in is - 136 , and are not intended to be read in a limiting sense upon the practice of the invention . as was indicated previously , the mobile terminal also includes the user display ( 19 ) and the keypad ( 22 ), each of which is coupled to the controller ( 20 ). although the user display ( 19 ) and keypad ( 22 ) may be used in a conventional manner to place a call , their use is extended by the teaching of this invention to provide a novel interface for short message service ( sms ) functions of a type referred to in the background portion of the specification . a message memory ( 21 ) is also provided . the message memory ( 21 ) may be a part of the random access memory of the controller ( 20 ), and / or may be implemented with a non - volatile memory ( e . g ., eeprom ). referring to fig2 a user of the mobile terminal of fig1 employs the keypad ( 22 ) to enter information into the controller ( 20 ). this preferably occurs during a time that the controller ( 20 ) displays a b - sms menu on the display ( 19 ). at block a the user interface is initialized and the b - sms menu is displayed . at block b a first menu function can be invoked by the user for enabling / disabling b - sms reception . if this menu function is invoked control passes to block c where the controller ( 20 ) sets a flag to either enable or disable the reception of the b - sms information . it may be desirable to disable the reception of the b - sms information to maximize the battery life of the mobile terminal . control then passes to the block labeled done . alternately , an enable / disable b - sms display menu function can be enabled at block d . if this function is selected control passes to block e where the controller ( 20 ) sets a flag to selectively enable or disable the display of b - sms message data on the user display ( 19 ). alternately , at block f an enable / disable of a first b - sms audible tone is selected . if this function is enabled the controller ( 20 ) at block g sets a flag to enable or disable the generation of an audible tone on the occurrence of a new b - sms message . the audible tone can be generated by the controller ( 20 ) by programming a digital to analog converter that forms a portion of the audio processor block ( 5 ). the audible tone is generated when , after all b - sms channels have been scanned by the controller ( 20 ), a new message ( with a new message id ) is located . the new message is then displayed if the display has not been disabled at block e . in this regard the controller ( 20 ) may store the header portion of all received messages . the stored header contains the start strings from all messages currently being transmitted on the b - sms channels . the controller ( 20 ) may then monitor the b - sms continuously and update the stored header information as appropriate . deleted messages can be removed from the header list while new messages are added to the header list . alternately , at block h a scan for selected messages function can be enabled . if this function is enabled control passes to block i where the controller ( 20 ) sets a flag to enable or disable the scanning of the b - sms for selected message ids . during the operation of this function , all message headers belonging to a user - selected category list ( e . g ., news information , financial information , etc .) are indicated to the controller ( 20 ). after selection of a specific message id the controller ( 20 ) will receive and store the complete message and , optionally , also some predetermined number ( e . g ., 5 ) of subsequent messages . after the messages have been stored in the message memory 21 , the user is enabled to read the stored messages using a scroll key function found on the keypad ( 22 ). this scroll key function forms a portion of the conventional user interface . messages remain stored until the user chooses another message id to be displayed . alternately , at block j an enable / disable second b - sms audible tone can be enabled . if this function is enabled control passes to block k where the controller ( 20 ) sets a flag to enable or disable the generation of an audible tone to indicate when the controller ( 20 ) has received and stored a user selected message from the b - sms channel . if the second audible tone is disabled the controller ( 20 ) instead displays the beginning of the received message without audibly notifying the user . alternately , at block l the user is enabled to select b - sms scan categories for the controller ( 20 ). if enabled , the controller ( 20 ) displays a list of b - sms category types and the user employs the keypad ( 22 ) to select one or more category types . in response , the controller ( 20 ) sets flags to enable only the selected b - sms category types for reception . all messages that belong to a selected category will be either displayed or stored in the message memory ( 21 ). the second audible tone , if enabled at block k , is generated to alert the user that the controller ( 20 ) has received a message that matches one of the selected categories , after which the received message is displayed . in addition to the category selection menu a menu may also be displayed enabling keyword selection for messages that fall under the selected category . by example , if the financial message category is selected , the user may enter a keyword , such as the name of a particular company or stock . if the controller ( 20 ) receives a financial category message , and if the indicated keyword occurs within the message , then the message is displayed and the second audible tone generated , if enabled at block k . if the broadcast b - sms has been enabled on any combination of , or on all , sms categories and channels , the controller ( 20 ) will receive all messages for this combination . these messages are then either displayed , stored , or discarded . after all messages on user selected channels and categories have been received once , the controller ( 20 ) will thereafter only respond to updated messages . in this mode the controller ( 20 ) displays as much of the new message as it is able to display to enable the user time to read the message . in this reception mode the display ( 19 ) is scrolled to show all messages being received . if more messages are received than can be displayed with enough time for the user to read the message ( e . g ., 2 seconds ), the controller ( 20 ) may truncate the messages before display . in this regard all messages can be truncated by some predetermined amount . alternatively , selected message types can be prioritized by the user at block m , such as by the order of selection , and higher priority messages truncated less than lower priority messages . if the mobile terminal is connected via an adapter ( 24 ) ( fig1 ) to an external data processor or other device capable of message storage , all received messages can be output through the adapter ( 24 ) for storage and subsequent later display . in this regard it is noted that the above - described user interface functions illustrated in fig2 can also be accomplished through the adapter ( 24 ), wherein the display of an attached data processor is used in place of the display ( 19 ), and wherein the keyboard or pointing device of the attached data processor is used in place of the keypad ( 22 ). a command or a keystroke ( s ) sequence , if received by the controller ( 20 ) through the adapter ( 24 ), can be employed to cause the controller ( 20 ) to direct data to the adapter for external display , and to respond to information entered through the adapter ( 24 ). it is noted that the b - sms functions in a manner analogous to a videotext service , and periodically transmits all messages selected for broadcast . all broadcast messages are specified in a header type of message which gives the message id and category . all changes to the contents of a broadcast cycle on any of the four b - sms channels can thus be given in the header message information . in addition , all changes can be indicated by a change flag on a paging channel which the controller ( 20 ) constantly monitors . in order to conserve battery power it is preferred that the mobile terminal read only once the unchanged content of the b - sms , and thereafter only by request of the user . thus , if the b - sms has been enabled for certain categories of messages , the mobile terminal will only read the selected category messages once and thereafter only in the case where new or updated message is received in the user - selected category or categories . although not shown in fig2 a further menu function can be employed to control the scrolling of messages on the display 19 . while the invention has been particularly shown and described with respect to a preferred embodiment thereof , it will be understood by those skilled in the art that changes in form and details may be made therein without departing from the scope and spirit of the invention . | 7 |
the following examples are given to illustrate the present invention but are not to be construed as limiting . dehydrated paprika ( 5 . 5 % moisture ) is ground in a hammer mill and the resulting ground paprika ( 95 % passing us 40 mesh ) is admixed with about 10 % by weight of soy bean oil and processed in a countercurrent extraction system involving three ( 3 ) pressing stages , each using an egon keller model kek - 100 screw press , with the extracts from the second and third stages being returned to the preceding mixing stage before being removed from the process at the end of the first press stage . a high shear , high speed pin mixer or equivalent is used to mix the soy oil or extracts from the second and third press stages into the ground spice or residual solid from the preceding stage . this recycling is continuous . the raw material paprika solids are continuously fed at a rate of about 240 lbs . per hour with a total contact time in each mixing stage of about 15 - 60 seconds . the residence time in each press is 5 - 60 seconds . the pressing stages are operated at about 10 , 000 psi internal pressure and about 200 degrees fahrenheit , which is maintained by cooling with water through the bore of the press shafts . the starting color value of the ground paprika solids is 200 asta . the principal components extracted and standardized in both the extract and the residual solid are the carotenoid pigments . the resulting final soy - paprika extract has a color value of about 1 , 375 asta and the reground paprika residual solid from the final ( 3rd ) press stage has a color value of about 85 asta . by varying the percentage of edible solvent employed from about 5 % to 20 %, the pressure from about 6 , 000 to 30 , 000 psi , the number of countercurrent mixing and pressing stages from 2 to 5 , with return of the extract from each press stage to the preceding mix stage before final removal from the process in the first press stage , varying the temperature from about 130 ° f . to 280 ° f ., and removing the seed from the paprika solids prior to grinding , the resulting extract ranges in color value from about 2 , 700 asta to about 800 asta and the residual solids range in color value from 180 asta to 35 asta . by regrinding the residual solids ( from the final stage ) just as is done with fresh , dehydrated paprika , a product in every way comparable to commercially available ground paprika solids is produced . after filtering or centrifuging off the fine particulate solids , the extract can be directly substituted for commercially available paprika oleoresin in every respect . by varying the pressing temperature of the process from about 130 ° f . to 325 ° f ., the hue of the reground residual solid is varied from slightly browned to a dark chocolate brown , demonstrating that the degree of brownness can be controlled by the pressing temperature employed . the degree of &# 34 ; brownness &# 34 ; is measured using a hunter labscan spectrocolorimeter with 0 degree illumination , 45 degree circumferential viewing , illuminant d65 , 10 degree observer , ceilab coordinate system . the hue of the paprika powder is measured by placing the powder in a 2 . 5 - inch diameter cuvette , shaking gently to ensure even coverage , and measuring through the bottom of the cuvette . the results of the varied operating temperatures of the process are shown in table i . the designation l * is indicative of the &# 34 ; lightness &# 34 ; of the sample with the higher numbers being lighter or less browned , and the lower numbers being darker or more browned . table i______________________________________processing temperature visual appearance l * values______________________________________130 ° f . red 40 . 18150 ° f . tan - red 37 . 25200 ° f . light brown red 33 . 22280 ° f . dark brown red 29 . 16325 ° f . chocolate red 22 . 85______________________________________ the data clearly demonstrate that the degree of browning can be controlled by varying the press temperature at which the process is conducted . this broadens the applications or uses of the residual solid to include a base for toasted chili powder and as a replacement for browned , caramelized paprika . the residual solid can be substituted for ground paprika or chili powder in many common applications and a separate processing step for browning to a desired degree is not required . the starting ground paprika solids have an aerobic plate count ( analysis run according to bacterial analytical manual by aoac , 8th edition , 1995 , and iso - grid methods manual , 3rd edition , 1989 ) of about 14 , 000 , 000 . the residual solids exiting the extraction system have a count of about 2 , 000 to 200 , 000 , with the lower count being achieved at the higher temperatures . this is a significant reduction and makes the residual solids per se suitable for any application where treatment with ethylene oxide or irradiation would normally be required . the foregoing example is repeated with all materials and conditions being the same , except that the soybean oil edible solvent is supplemented with an antioxidant blend at a concentration of 3 % by weight of the original ground paprika solids . the blend consists of about 29 % lecithin , 20 % powdered ascorbic acid , 5 % citric acid , 15 % tocopherol , and 1 % rosemary extract ( in accordance with chang and wu u . s . pat . no . 5 , 077 , 069 ). the stability of ( 1 ) the resulting extract and ( 2 ) the residual solids is compared in each case with an untreated control . in such evaluation , the paprika extracts are plated on flour salt to an extent of 2 . 4 % by weight with a mortar and pestle . two - gram samples are weighed into 13 × 100 mm test tubes . the test tubes are stored in a thermostatically - controlled oven at 65 ° c . samples are withdrawn periodically , extracted with acetone , and the color at 460 nm of a standard (%) dilution in acetone is determined spectrophotometrically . in the evaluation of the residual solids , two - gram samples of the reground residual solid are substituted for the flour salt dispersions . the procedure for the &# 34 ; standard dilution &# 34 ; is as follows : the initial color of the dispersion is determined by pouring two grams of the original dispersion into a 100 - ml flask . acetone is added up to the 100 - ml level . the flask is inverted several times . the flour salt is allowed to settle for five minutes . then three ml of the dilution is pipetted into a 25 - ml flask and diluted up to the 25 - ml level . the absorbance is read at 460 nm . the 460 nm color is determined by the formula : ## equ1 ## where the percent dispersion is determined by the formuls : ## equ2 ## to translate to asta color , multiply the 460 nm color by 820 . the color is plotted against time and the time for 1 / 3 of the starting color to fade is reported as the 2 / 3 life . this is a highly - reproducible measurement , which is sufficiently accurate to evaluate the effectiveness of the antioxidants and will assist the practitioner to optimize formulations for specific uses . the final extract from the first press stage of the unprotected or unstabilized process has a color value of about 1375 asta and a 2 / 3 life of 6 . 5 hours as compared to a color value of about 1600 asta and a 2 / 3 life of 63 hours for the extract from the protected material . the color value of the unprotected or unstabilized residual solids is about 85 asta with a 2 / 3 life of 54 hours , compared to the protected solids which have a color value of about 95 asta and a 2 / 3 life of 155 hours . this clearly demonstrates that inclusion of antioxidants can improve not only the color yields from the extraction process but also at the same time improve the color stability of both the extract and the residual solids . other suitable antioxidants ( e . g ., lecithin , ethoxyquin , butylated hydroxy anisole ( bha ), butylated hydroxy toluene ( bht ), tertiary butyl hydroxy quinone ( tbhq ), sesame , tea catechins , and labiatae herb antioxidant activity , finely - divided ascorbic acid , tocopherol , citric acid ) can be substituted in whole or in part for the specific antioxidant mixture employed with similar desirable color - protective results , preferably a naturally - occurring antioxidant from an herb of labiatae family , e . g ., rosemary , sage , or thyme , or powdered ascorbic acid . dehydrated paprika solids ( 2 . 5 % moisture ) were ground in a hammer mill and the resulting ground paprika ( 95 % passing us 40 mesh ) was processed with about 15 % by weight of soy bean oil in a countercurrent extraction system as in example 1 involving two ( 2 ) pressing stages , with extracts from the second press stage being returned to the preceding ( first ) mix stage before being removed from the process at the first press stage . upon exiting the first press stage , distilled water was metered continuously into the crude extract at a rate of 75 % by weight of the gums and solids by means of an inline static mixer . the weight of the gums and fine particulate solids in the extract was determined by diluting one gram of the crude extract in nine grams of acetone . the mixture was spun down for three minutes at 2000 g &# 39 ; s in a laboratory centrifuge . the solids separated were air dried and the weight of the gums and solids was calculated as a percentage of the weight of the starting extract . the hydrated gums and solids removed from the extract were continuously returned to the final residual press solids via a high shear , continuous pin mixer installed immediately following a water - jacketed cooling screw which received the residual solids from the second press stage . prior to hydration and centrifugation , the extract contained approximately 10 % by weight of gums and fine particulate solids as determined by the above - described method . following hydration and centrifugation the gums and particulate solids amounted to no more than 1 % by weight of the extract and the extract was a crystal clear solution , free of any suspended insoluble materials . the color value of the starting ground paprika was about 150 asta . the pressing stages were operated at about 20 , 000 to 30 , 000 psi . the extraction process was started with the presses operating at about 80 ° f . as measured by the temperature of the cake exiting the presses . the temperature of the presses was controlled by the rate of flow of cooling water through the bore of the press shafts and the screen cages to keep the operating temperatures in the range of 80 ° to 180 ° f . over the time of the extraction run , the operating temperatures of the presses , as measured by the temperature of the cake exiting the presses , was gradually increased to about 255 ° f . by first slowing and then stopping the flow of cooling water to obtain operating temperatures of 180 - 200 ° f ., and then by substituting steam for the water in the shaft and cages at gradually increasing pressures to achieve temperatures of 200 - 255 ° f . samples of the extracted oil and press residual solids were pulled at various temperature intervals as the temperatures were increased . samples of the residual solids were pulled at two points , the first ( non - rehydrated ) immediately after exiting the cake - cooling screw following the final ( second ) pressing stage , and the second after the thus - cooled residual press solids were rehydrated to a moisture content of about 10 %. the samples were assayed for asta color , aerobic and anaerobic plate count , and color stability over time using methods employed in examples 1a and 1b . the advantages of operating the process at a temperature above 130 ° f ., as indicated by the temperature of the cake exiting the presses , can clearly be seen . the plate count of both the extract and the cake are progressively reduced as the temperatures are increased . ( tables 2 & amp ; 3 ) table 2______________________________________effect of increasing temperatureson the plate count of the extracttemperature degree f . aerobic plate count anaerobic plate count______________________________________ 80 1 , 900 , 000 790 , 000130 1 , 700 , 000 800 , 000150 1 , 700 , 000 660 , 000170 1 , 600 , 000 500 , 000175 1 , 500 , 000 425 , 000180 1 , 300 , 000 380 , 000190 360 , 000 150 , 000200 300 , 000 200 , 000215 240 , 000 150 , 000225 190 , 000 65 , 000235 170 , 000 32 , 000245 69 , 000 8 , 600255 3 , 800 830______________________________________ table 3______________________________________effect of increasing temperatures on the platecount of the press solidstemperature degree f . aerobic plate count anaerobic plate count______________________________________ 80 220 , 000 55 , 000130 160 , 000 35 , 000150 160 , 000 25 , 000170 100 , 000 20 , 000175 32 , 000 15 , 000180 80 , 000 7 , 400190 3 , 500 800200 9 , 800 3 , 400215 5 , 800 2 , 300225 4 , 100 500235 1 , 900 1 , 100245 5 , 400 100255 800 100______________________________________ the efficiency of extraction is dramatically improved as evidenced by the progressively decreasing asta values and the progressively decreasing residual extractable yields of the press residual solids . it is apparent that , to achieve residual extractable yields of less than about 20 % by weight of the cake , it is necessary to operate the presses at 130 ° f . or higher . ( table 4 ) moreover , for obvious reasons of efficiency , temperatures above 180 ° f ., and especially between about 180 ° f . and about 235 ° f ., are greately preferred . table 4______________________________________press cake asta and residual yields atprogressively increasing temperaturestemperature degree f . press solids asta press solids residual yield______________________________________ 80 87 28 . 28 % 130 76 16 . 40 % 150 65 15 . 72 % 170 61 15 . 72 % 175 53 12 . 36 % 180 43 13 . 88 % 190 42 10 . 84 % 200 44 10 . 72 % 215 41 9 . 96 % 225 39 9 . 50 % 235 33 9 . 28 % 245 32 9 . 00 % 255 35 9 . 80 % ______________________________________ most importantly , the stability of the extract is not adversely affected and is in fact increased . the results , from example 2 , of an accelerated study on the stability of the extract , generated at varying press operating temperatures , can be seen in table 5 . the accelerated study was done according to the procedures described in example 1b with the colors reported as a percent of the starting color for each respective sample to adjust for the varying color yields at the respective temperatures . these results demonstrate that the extract produced at higher operating temperatures exhibits increased resistance to oxidative color deterioration . this is surprising , as explained in the following . table 5______________________________________press oleoresin ( extract ) stability , accelerated , 65 ° c . temperature hour hour hour hour hourdegree f . 2 4 8 12 17______________________________________ 80 94 % 88 % 81 % 73 % 62 % 130 94 % 89 % 82 % 75 % 64 % 170 93 % 89 % 82 % 76 % 65 % 225 94 % 90 % 82 % 78 % 67 % 235 94 % 90 % 82 % 77 % 69 % 255 95 % 90 % 84 % 78 % 72 % ______________________________________ it is commonly believed that lipid - containing systems , exposed to heat , will exhibit an increased rate of lipid oxidation that , once initiated , will proceed at an ever - increasing rate . ( rancidity and its measurement in edible oils and snack foods , a review , robards , kerr , and patsalides , analyst , february 1988 , vol 113 ). in fact , prior art ( u . s . pat . no . 4 , 681 , 769 ) claims a process for counter - current , high pressure extraction of capsicums at less than 100 ° f . and less than 500 psi for the express reason of protecting the extracted oil from oxidation . to confirm the positive effect of high temperature treatment in more controlled conditions , a forty gram sample of hexane - extracted oleoresin paprika , with no diluents added , was heated in a beaker on a heated stir plate at 100 ° c . for eight and one - half hours . a control sample which was unheated , a sample pulled from the heated beaker after four hours , and a sample of the material heated for the full eight and one - half hours were dispersed on flour salt to make dispersions of 1 . 2 % oleoresin by weight of flour salt . two gram - portions of the dispersions were weighed into test tubes and placed in a 65 ° c . oven . an initial asta color was run on each dispersion and then asta colors were run periodically and the results were plotted versus time to determine the relative stability of the heated and unheated samples . the results are shown in table 6 . it can be readily observed that the heat - treated samples , although they lose some initial color during the heating process , have improved stability over time , thus confirming the improved resistance to oxidation observed in table 5 . table 6______________________________________asta values of heated & amp ; unheated oleoresinpaprika ( extract ) over timehours unheated heated 4 @ 100 ° c . heated 8 @ 100 ° c . ______________________________________ 0 32 . 5 31 . 5 26 . 0 2 29 . 0 29 . 0 25 . 8 4 26 . 0 28 . 0 25 . 7 6 24 . 0 27 . 0 25 . 5 8 22 . 5 25 . 8 25 . 310 21 . 0 24 . 5 25 . 012 20 . 0 23 . 0 24 . 814 19 . 0 22 . 3 24 . 516 18 . 0 21 . 8 24 . 018 17 . 0 21 . 0 23 . 520 16 . 0 20 . 0 23 . 022 15 . 1 19 . 0 22 . 524 14 . 2 18 . 5 22 . 126 13 . 4 18 . 0 21 . 828 12 . 9 17 . 5 21 . 430 12 . 5 17 . 0 21 . 0______________________________________ the non - rehydrated press residual solids produced in example 2 exhibit decreased resistance to oxidative color loss as the press operating temperatures are increased as predicted by prior art ( bennett et al , u . s . pat . no . 4 , 681 , 769 ) and as seen in table 7 . table 7______________________________________stability of non rehydrated press solids at variouspress operating temperatures , expressed as percentof starting color retainedtemperature degree f . week 2 week 4 week 6______________________________________ 80 86 . 7 % 82 . 2 % 85 . 5 % 130 89 . 6 % 85 . 5 % 84 . 6 % 170 73 . 3 % 65 . 3 % 58 . 1 % 225 61 . 7 % 35 . 8 % 32 . 5 % 245 68 . 2 % 31 . 0 % 19 . 3 % ______________________________________ but , very importantly , it can be seen that the press residual solids which are rehydrated immediately after exiting the second press stage of the process ( example 2 ) exhibit significantly increased stability ( table 8 ) relative to the non - rehydrated solids , thus overcoming the claimed disadvantages from operating at temperatures above 100 ° f . as set forth in u . s . pat . no . 4 , 681 , 769 . table 8______________________________________stability of rehydrated press solids at variouspress operating temperatures , expressed as percentof starting color retainedtemperature degree f . week 2 week 4 week 6______________________________________ 80 90 % 92 % 91 % 130 93 % 91 % 92 % 170 92 % 92 % 91 % 225 94 % 93 % 91 % 245 95 % 94 % 93 % ______________________________________ in fact , after discounting for the effect on pigment stability of increasing residual extractable yields in the press solids ( tables 4 & amp ; 11 ) obtained at the lower temperatures , the carotenoid pigments in the residual solids would show enhanced stability for a given residual extractable yield . these are surprising and unexpected results and clearly overcome the supposed obstacle of operating at elevated press temperatures and pressures . it is further surprising that the color stability of the residual press solids is significantly improved by controlling the water activity ( a w ) of the solids in ranges above those suggested for the stabilization of lipidcontaining systems by extensive studies and particularly by nelson and labuza , water activity and food polymer science : implications of state on arrhenius and wlf models in predicting shelf life , k . a . nelson & amp ; t . p . labuza , journal of food engineering 22 , 271 - 289 ( 1994 ). water activity is defined as the ratio of the vapor pressure of water in a food to the vapor pressure of pure water at the same temperature . prior art suggests that maximum stability of lipid systems should be attained at water activities of about 0 . 3 with decreasing stability developing as the water activity is increased above this level . in this example we find precisely the inverse effect on stability of the carotenoid pigments for a given water activity . in order to confirm the effect of high temperatures in the pressing operation , and to confirm the effect of added moisture , a controlled test was performed on a laboratory scale where the effect of levels of extractable yield in the cake could be controlled to eliminate the effect of variable press cake residual yields on the stability of the carotenoids . a 3 , 000 gram sample of ground paprika solids ( 175 asta , 9 . 8 % extractable yield ) was dried in a lab tray dryer at 100 ° f . for 16 hours to a moisture content of about 2 %. one half of this sample was then heated in an oven at 220 ° f . for twenty minutes to approximate the temperature in a pressing operation according to the invention . the other unheated sample served as a control . one hundred gram samples of each of the two materials were rehydrated at approximately 1 % intervals up to about 12 % moisture . the water activity a w of each was determined using a rotronics hygroskop dt , model dt2 / 1 - 00iv , water activity instrument . samples were weighed into sealed test tubes , stored at ambient temperatures of about 72 ° f . in the dark , and the asta colors were determined over a period of eighteen weeks to determine the relative rates of color degradation . the color retained ( as a percentage of the starting color for each sample to compensate for the effect of color dilution with the rehydration water ) was plotted against time . table 9______________________________________percent color retained of unheated ground paprikaat various water activity rangeswater activity a . sub . w week 1 week 5 week 18______________________________________0 . 15 74 % 57 % 42 % 0 . 30 50 % 45 % 12 % 0 . 40 68 % 50 % 43 % 0 . 60 83 % 68 % 55 % ______________________________________ table 10______________________________________percent color retained of heated ground paprikaat various water activity rangeswater activity a . sub . w week 1 week 5 week 18______________________________________0 . 15 66 % 56 % 41 % 0 . 30 60 % 50 % 45 % 0 . 40 80 % 62 % 57 % 0 . 60 98 % 82 % 78 % ______________________________________ it can be seen in tables 9 & amp ; 10 that the stability of the carotenoid pigments follows almost precisely the inverse of the curve predicted by nelson & amp ; labuza ( fig2 ). it can also be seen from these tables that controlled temperature ( with concurrent browning ) significantly enhances the stability of the carotenoids above a water activity of 0 . 3 and particularly in the water activity range of 0 . 4 to 0 . 6 . water activity ranges higher than 0 . 6 were not tested as levels marginally higher than this range will support microbial growth which is not acceptable in a dry spice product . it can be concluded that the stability of the carotenoid pigments found in capsicums unpredictably does not follow the commonly - accepted and predicted pattern for lipid oxidation with respect to temperature and water activity as suggested in u . s . pat . no . 4 , 681 , 769 , or in the cited literature ( nelson and labuza , water activity and food polymer science : implications of state on arrhenius and wlf models in predicting shelf life , k . a . nelson & amp ; t . p . labuza , journal of food engineering 22 , 271 - 289 ( 1994 ); rancidity and its measurement in edible oils and snack foods , a review , robards , kerr , and patsalides , analyst , february 1988 , vol 113 ); describing the stability of lipid systems . in fact , high temperature treatment , combined with rehydration of the press solids to a water activity above 0 . 3 , preferably of 0 . 4 to 0 . 6 , significantly improves stability rather than decreases it . this is a very surprising and unpredicted result . it is well known that the lipid profile of capsicum and its extracts , without the addition of any diluents , comprises a mixture of saturated and unsaturated fatty acids , 60 - 70 % being unsaturated linoleic and linolenic , lipid and antioxidant content of red pepper , daood , biacs , et al ., central food research institute , budapest , hungary ( 1989 ) and the nature of fatty acids and capsanthin esters in paprika , nawar et al ., journal of food science , vol . 36 ( 1971 ). in fact , daood et al suggest that &# 34 ; . . . the presence of triglycerides containing high amounts of unsaturated fatty acids may be an important factor contributing to the fading of paprika during processing and storage .&# 34 ; the present findings are just the opposite . without in any way being limited by theoretical considerations , it is hypothesized that the presently - discovered surprising and unpredicted inverse relationship shown ( in tables 9 & amp ; 10 ) between the stability of carotenoid pigments at given water activities is due to the fatty acids in the substrate being preferentially attacked by the oxidation reaction at the low ( from about 0 . 05 to 0 . 2 a w ,) and higher water activity ranges ( above 0 . 3 , preferably about 0 . 4 to 0 . 6 a w ,), thus protecting the carotenoids . at the intermediate water activity ranges ( 0 . 2 to 0 . 4 a w ,), where the lipids are best protected , the carotenoids are more readily and preferentially attacked and exhibit low resistance to oxidative degradation . another controlled test was conducted to demonstrate the effect of different extractable yields in the residual solid press cake . the effect of higher amounts of unsaturated fatty acids is evident from the results illustrated in table 11 where fresh , refined , bleached , and deodorized soybean oil with no antioxidants was added at various percentages based on the weight of the paprika . the color over time was compared to the untreated control in an accelerated study at 65 ° c . a typical refined , bleached , and deodorized soy oil has a fatty acid composition of 22 . 3 % oleic ( 18 : 1 ), 51 % linoleic ( 18 : 2 ), and 6 . 8 % linolenic ( 18 : 3 ). ( riecel &# 39 ; s handbook of industrial chemistry , 9th edition , pg 278 ). it can be concluded that higher levels of unsaturated fatty acids , such as oleic , linolenic , and linoleic , which are found in most vegetable oils , will improve the color stability of the press residual solids . levels of extractable yield in the residual solids above about 15 - 20 % by weight of the residual solids is undesirable as the residual capstcum solids become difficult to handle for most uses and the efficiency of extraction is reduced , i . e ., less color can be removed from the spice as the residual yield is allowed to increase by decreasing either the pressure or temperature employed . table 11______________________________________percent color retained with varying amountsof soy oil added to ground paprikapercent addition hour 2 hour 4 hour 6 hour 8______________________________________ 0 % 65 % 59 % 52 % 50 % 5 % 90 % 83 % 74 % 72 % 10 % 92 % 84 % 75 % 74 % 15 % 94 % 87 % 80 % 78 % 20 % 96 % 91 % 83 % 81 % ______________________________________ it is readily apparent , comparing the results of the controlled test ( tables 9 & amp ; 10 ) on stability of heated vs unheated material , where oil is controlled at a constant level that , at a given added soy oil content in the press residual solids , the color stability of the residual press solids is significantly improved when the capsicum has been exposed to higher temperatures . this conclusion is not readily apparent in the results shown in table 8 where the amount of residual vegetable oil left in the press residual solids is higher in the low temperature ranges due to the decreased efficiency of the extraction process at lower temperatures ( table 4 ). the presence of higher amounts of residual oils there offers some protection which overshadows the increased protective effect at higher temperatures so evident in tables 9 & amp ; 10 . it can therefore be concluded that much , if not all , of the protection offered by operating the presses at temperatures lower than 100 ° f . ( as claimed in u . s . pat . no . 4 , 681 , 769 ) as compared to temperatures above 100 ° f . is simply due to the higher residual oil levels ( reduced extraction efficiency ) and that , for any given residual oil content , and with rehydrated residual solids , the operating temperatures above 130 ° f . give superior results , not only in an increased extraction efficiency which allows for a continuous , high speed process with increased throughput rates and significantly reduced microbial activity , but most surprisingly in an increased color stability of both the extract and the residual press solids , particularly when the press solids are rehydrated . as can be seen in table 4 , the press solids residual yield is much higher at temperatures below 100 ° f . and much higher ( 28 . 3 % residual yield ) than disclosed in u . s . pat . no . 4 , 681 , 769 ( 10 - 15 % residual yield ). in example 2 , table 4 , the model kek 100 screw press used for the test was operated at about 100 % of its rated capacity of 240 pounds per hour for typical oil seeds . in an effort to more closely model the residual yields of 10 - 15 % ( oil ) in the cake as disclosed in u . s . pat . no . 4 , 681 , 769 , the feed rate for this test was set at about 95 pounds per hour , thus allowing more residence time in the press to expel more extract and to reduce the residual yield of the press residual solids to 10 - 15 %. the following example according to bennett is a two - step production run . one lot , comprising about 300 lbs of 160 asta chili , ground to pass 20 mesh ( usss ), was transferred to a ribbon blender and blended with 13 . 7 % by starting weight of the ground chili of fortified soybean oil having 500 asta oleoresin for about 15 minutes and then allowed to stand for about 16 hours at room temperature ( 75 ° f .) before transfer to the feed hopper of an egon keller model kek - 100 screw press . the feed hopper provides for a controlled flow of the mixture of chili and fortified oil to the press at a rate of about 95 lbs per hour of fresh ground chili , the equivalent of about 800 lbs per hour in a french oil mill machinery company f - 44 press . both these feed rates represent about 40 % of the rated capacity of the respective screw presses on whole oil seeds . the production run was started with a cone setting of about 0 . 030 inches and with the internal worms configured so as to provide a pressure gradient of essentially little or no pressure up to about 500 pounds per square inch of pressure . at these low pressures and feed rates , effluent oil temperatures were maintained at less than 100 ° f . with cooling water as in bennett , and the residual yield ( oil ) in the press residual solids averaged about 12 . 5 %, just as prescribed by bennett , who states that : &# 34 ; temperatures above 100 ° f . should be avoided inasmuch as higher temperatures cause oxidation with a resultant destruction of delicate flavor and / or color principle .&# 34 ; with the press operating as described , the oil extracted , after centrifugation to remove the residual spice fines , assayed at about 1000 asta and the press cake residual solids fraction had a corresponding reduction in asta to about 115 . the press cake of the once - extracted ground fresh spice from the first pressing is further processed following the same procedure above described for the first blending / pressure extraction sequence using , however , fresh soybean oil as an additive in place of the fortified oleoresin soybean oil . the fortified soybean oil extracted assayed at approximately 500 asta . this 500 asta fortified soybean oil extract is recycled as an extractant on fresh ground chili . the extracted chili powder cake from this extraction step had a corresponding reduction in asta value to an average of about 65 asta ( ranged from 41 to 95 asta ). the results of this low temperature , low pressure test are compared to results of high temperature , high pressure conditions in example 2 and are shown in table 12 . table 12______________________________________comparison of low temperature / low pressure and hightemperature / high pressure low temp / low high temp / high pressure , 16 hour pressure continuous batch mixing from example 2______________________________________temperature , deg f . 95 235pressure , psi & lt ; 500 20 , 000 - 30 , 000final residual solids asta 65 33final residual solids yield 12 . 5 % 9 . 3 % final residual solids asta as a 41 . 5 % 22 % percent of fresh chili astaasta loss in 1st mixing stage 7 % 0 % asta loss in 2nd mixing stage 10 . 5 % 0 % final oleoresin asta 1 , 000 1 , 000______________________________________ it can clearly be seen , as is also shown in example 2 ( effect of varying operating temperatures ), that the low temperature / low pressure batch process with extended contact times incurs significant color loss during the extended contact times necessary for low temperature / pressure extraction . in addition , the low temperature / pressure batch process does not remove the color as efficiently as with higher temperatures and pressures for any given size pressing operation . the foregoing example can scientifically be scaled up or extrapolated into a comparative two - stage production run using two model 44 - f french oil mill machinery company presses , as follows : one lot comprising about 3 , 840 lbs of 5 % moisture , 160 asta , 20 mesh , fresh ground chili solids ( capsicum annum ) is passed through a high speed , high shear , steam - jacketed paddle mixer on a continuous basis and fed directly into the press feed hopper at stage one , through the 1st stage press , into a 2nd stage paddle mixer , and then to the 2nd stage press . soybean oil is added continuously through a metering pump into the paddle mixer at stage 2 at the rate of 13 . 7 % by weight of the starting ground chili solids ( 525 lbs of oil for the 3840 lb run ). the raw material chili solids are continuously fed at a rate of about 2 , 500 lbs per hour to the system with a total contact time in each paddle mixer of about 15 seconds . the temperature of the chili / oil mix exiting the paddle mixer is maintained at about 180 ° f . at stage 2 and about 150 ° f . at stage 1 . the oil / extract expelled from the second pressing stage is returned on a continuous basis to the paddle mixer at stage one wherein the oil / extract and fresh ground paprika are mixed in preparation for the first pressing stage . the oil / extract and fresh ground paprika exit the first stage paddle mixer and enter the first stage press at about 150 ° f ., the temperature being controlled by the amount of steam on the paddle mixer jacket . the concentrated oil / extract expelled from the first pressing stage is hydrated with water to about 75 % by weight of the fines ( fine particulate solids ) and gums and is then centrifuged and the hydrated fines and gums are added to the residual press solids from the final ( second ) pressing stage in a high shear mixer , after the solids have passed through a water - jacketed cooling screw . the internal shaft and collar arrangements of the press are configured so as to provide internal pressures of about 20 , 000 to 30 , 000 psi and cooling water is maintained at a flow rate through the bore of the shaft and through the cage cooling jackets so as to maintain an exit oil temperature at the external cage surface of about 180 to 200 ° f . and an exiting residual solid cake temperature of about 235 ° f . the residual cake solid is cooled in a water - jacketed screw conveyor to about 85 ° f . and water , in addition to the hydration water used to remove the fines and gums from the extract , is injected into the high shear , continuous mixer to rehydrate the cake to a water activity of about 0 . 6 . the concentrated extract exiting press stage one has an asta value of about 1 , 000 and the residual press solid cake exiting stage two has an asta value of about 45 . the residual press solid cake has a reddish - brown appearance typical of lightly toasted chili powder . the aerobic plate count of the residual solid cake is about 70 , 000 . the same test is repeated ( according to the bennett example ). no heat is applied during the mixing stages and the press internals are reconfigured so as to provide for minimal friction and compression and the resultant minimal heat generation during the pressing operations . the working compression is supplied primarily by the cone at the cake discharge and is maintained at about 500 psi . oil is added at a rate of about 13 . 7 % by weight of the starting paprika solids ( 525 lbs for the 3840 lb batch ) and mixed in a ribbon blender for sixteen hours and then fed at ambient temperature ( about 75 ° f .) to the pressing system . the feed rate through the pressing stages is maintained at 800 pounds per hour . cooling water is supplied to the internal bore of the shafts and the cooling jackets to maintain exit oil temperatures of less than 100 ° f ., on both the expelled oil and the residual press cake . the extract exiting the first pressing stage of the press is centrifuged without hydration of the gums and fine particulate solids . the concentrated extract exiting press stage one has an asta value of about 1 , 000 and the residual cake solid has an asta value of about 65 . the appearance of the cake is lacking the brownness characteristic of commercially - available ground paprika and chili powder and would require a separate browning step to make it acceptable for common uses . the material is difficult to regrind due to the high level of residual extractable yield left in the cake , it is not flowable , and it must be combined with other solid materials to make an acceptable product for sale . the aerobic plate count is about 220 , 000 . a comparison of the results of the two tests is shown in table 13 . table 13______________________________________ high temperature low temperature pressing pressing______________________________________mixing time , soy oil continuous , 16 hours ( seconds ) fresh oil temp , ° f . 75 75oil / chili stage 1 at press feed , 150 75 ° f . oil / chili stage 2 at press feed , 180 75 ° f . cake after stage 1 pressing , ° f . 225 95cake after stage 2 pressing , ° f . 235 95asta value , extract 1000 9952 / 3 life , extract , 65 ° c ., hours 25 16asta value , press cake 45 652 / 3 life , cake , 72 ° f ., weeks 32 10color recovery , extract 75 % 51 % aerobic plate count , extract 70 , 000 2 , 000 , 000aerobic plate count , cake 2 , 000 220 , 000overall color recovery ( extract 98 % 91 % and cake ) visual appearance , cake red - brown red - tanthroughput rate , lbs per hour 2 , 500 800______________________________________ it is readily apparent that there are substantial advantages to higher temperatures and pressures . the color recovery is enhanced , there is a 50 % increase in yield to the extract , the rate for a given press size is increased by over 300 %, the color stability of the extract is improved by 65 %, the color stability of the residual solids cake is improved by 300 %, and the aerobic plate count is reduced by a factor of greater than 30 in both the extract and the residual cake ; all without the oxidative color losses that are alleged to be an obstacle in u . s . pat . no . 4 , 681 , 769 . it is thereby seen that an improved countercurrent process for the extraction of capsicum solids using an edible solvent , whereby improved yields of both extract and residual solids are obtained , whereby both the extract and the residual solids have improved color stability and freedom from bacterial contamination due to the higher temperatures employed , whereby due to optional advantageous rehydration of residual solids and level of water activity employed an improved color stability in the residual solids is attained , whereby an extract in the form of a clear solution can be obtained by removal of gums and particulate solids in the form of their insoluble hydrates , whereby even greater color stability can be effected by the employment of edible antioxidants in the solvent utilized , and whereby controlled browning of the residual solids may be conveniently effected , all without the expected disadvantages of employing higher temperatures as clearly indicated by the prior art , and whereby all of the stated objects of the invention have been accomplished , has been provided . it is to be understood that the invention is not to be limited to the exact details of operation , or to the exact compositions , methods , procedures , or embodiments shown and described , as obvious modifications and equivalents will be apparent to one skilled in the art , and the invention is therefore to be limited only by the full scope which can be legally accorded to the appended claims . | 0 |
referring now to the vacuum switch of fig1 there is shown an evacuated housing consisting of a metallic cylindrical part 5 and disk - like insulator parts 6 and 7 closing the cylindrical part on both ends thereof . within the evacuated housing there are two contact members consisting of contact disks 1 and 2 mounted on contact rods 3 and 4 , respectively . the contact rod 3 is stationary secured to the insulator part 7 , whereas the contact rod 4 with the contact disk 2 mounted thereon may be moved to and from the contact disk 1 , to which effect the contact rod 4 is connected to the insulator part 6 by means of a flexible bellows 8 . in fig1 the contact disks 1 and 2 meet each other in the tangent plane 9 . at a relatively small distance from this tangent plane 9 , and on either side thereof u - shaped yokes 10 and 11 have been mounted about the contact rods 3 and 4 . yokes 10 and 11 are made of a material having a good magnetic permeability . in the represented embodiment each of the yokes has been shaped as a broad ring of , for instance , soft iron . the yokes may be solid , though they may also be laminated as will be preferred of course in case of alternating current . each of yoke rings 10 and 11 has an inner diameter somewhat larger than the size of the pertaining contact rods 3 and 4 . in the present embodiment the outer diameter has been chosen equal to the outer diameter of the contact disks 1 and 2 . furthermore each of the yokes 10 and 11 has been provided with an air gap 12 and 13 respectively , between the legs , each air gap having a constant width from the outside of the inside equalling the inner diameter of the ring . each of the yokes has thus been slid over the pertaining contact rod until the yoke is in abutment with the contact rod . the yokes 10 and 11 lie in substantially parallel planes ( see also fig2 ) as closely as possible to the tangent plane 9 and rest against the contact disks 1 and 2 . preferably in the direction of the open end of the yoke the legs of the first yoke occupy a direction opposite to the direction of the legs of the second cooperating yoke . in other words upon axial projection of the first yoke on the second yoke the solid part of the first yoke will at least partially overlap the opening between the ends of the legs of the second yoke . fig1 - 3 , inclusive , also show the course of the magnetic flux lines in case of the passage of an electrical current through the switch . the magnetic field produced by this current passage through the switch is concentrated partially in the yokes 10 and 11 due to the good magnetic permeability of the yokes . in combination with the air gaps 12 and 13 situated between the open ends of the legs , the yokes 10 and 11 present on the respective sides of the tangent plane each constitute a magnetic circuit running partly round the contact rod . these air gaps 12 and 13 have -- at least as long the contact members are in touch -- a width larger than the distance between the yokes on both sides of the tangent plane 9 when viewed in the axial direction . consequently the magnetic flux lines will traverse to the yoke on the other side of the tangent plane rather than to the opposite leg of its own yoke . in fig1 this situation has clearly been shown . this traversion of the flux lines not only occurs at the site of the air gap but rather the main part of the flux lines will run between the parallel legs of the two yokes 10 and 11 having the opposite direction and facing each other due to the initially short distance between the yokes . in fig3 this situation has further been shown . the dots and crosses represent flux lines running perpendicularly to the plane of the drawing . as will be evident a traversion of only a small part of the flux lines occurs at the site of the air gap per se , indicated by the interrupted axis . in fig3 in the right hand part the flux lines disappear in the plane of the drawing whereas in the left hand part the flux lines emerge from the plane of the drawing . the directions of the flux lines have also been indicated in fig2 representing the case in which upon opening the contact members the contact disks are already at a certain distance from each other . fig4 graphically represents the course of the density of the magnetic field produced by the yokes at the side of the tangent plane on current passage in the directions indicated in fig3 by arrows i , ii and iii . in fig4 the distance measured from the center of the contact disks has been plotted in millimeter units along the abscissa whereas the induction expressed in tesla - units has been plotted along the ordinate . it is apparent that the density of the magnetic field is the highest in the region of the arrow i . this is in accordance with what is to be expected expectations because the influence of the parts having a low permeability will be the least noticeable in this region . the current used for these measurements amounted to 1800 amps a . c . the roman numeral in the curves without an accent pertains to the measurement on a contact disk having a thickness of 3 mm and the roman numeral with an accent corresponds to the measurement on a contact disk having a thickness of 1 mm . the thickness of the disks thus has a considerable influence on the strength of the magnetic field . likewise the location of the maximum induction is influenced by the thickness . the measurements for obtaining the curves in fig4 have been performed on yokes having an external circular shape . the invention however , is not restricted thereto . likewise the shape of the u - shaped yokes will influence the course of the curves . from fig4 it furthermore appears that a weak magnetic field is only present in the region of the arrow iii , i . e . the region of the tangent plane between the contact disks running parallel with the space between the legs of the yokes . in the main part of the tangent plane and the space between the contact disks flux lines , and consequently a more or less strong magnetic field , occur upon displacement of the contact disks with respect to each other . like in the switch according to the above mentioned dutch patent application no . 7601084 this results in a considerable improvement of the interruptor properties of the switch according to the invention . upon further displacement of the contact disks 1 and 2 , and thus the yokes 10 and 11 with respect to each other , the strength of the axial magnetic field between the yokes and consequently between the contact disks will decrease due to the increasing distance , whereas the strength of the field between the two legs of each of the yokes will increase . the contact disks and yokes may , however , easily be constructed and mounted in such a manner that a sufficiently strong axially directed field will remain during the operative part of the circuit breaking procedure . this applies to the switch having the dimensions according to fig2 which has been drawn on real scale . the contact rods have a diameter of 25 mm , the contact disks a diameter of 60 mm and a thickness of 2 mm . even if upon opening the distance between the yokes amounts to 16 mm , a sufficiently strong axial magnetic field between the yokes 10 and 11 will still be present . it has been found by experiments with switches according to the present invention that the arc voltage of the switches is improved considerably . fig5 shows a graphical representation of the maximum arc voltage expressed in volts , vs the interrupted current , expressed in kiloamps . the curve a relates to a switch without a longitudinal magnetic field , whereas the curve b concerns a switch according to the invention in which a longitudinal magnetic field is produced by the u - shaped yokes . from this diagram it is apparent that the switch according to the invention may interrupt currents of about 30 kiloamps , whereas the switch without this provision cannot interrupt currents of more than 15 kilo amps in a reliable manner . the air gaps 12 and 13 may also be filled with a solid piece of an electrically good conductor material such as copper . it has been demonstrated that in this case the magneetic resistance may yet further be increased . this may be explained by the eddy currents generated by the magnetic field in the piece of copper , the eddy currents on their turn also producing a magnetic field having a direction opposite to the initial field . this effect may be utilized in two ways , that is , either by maintaining the gap width , with the result that even upon increasing the distance between the yokes the magnetic flux will still traverse and thus create an axial field ; or by maintaining the magnetic resistance , the latter meaning that the gap width may be narrowed due to which the operative part of the yoke is broadened and the regions having a weak magnetic field are consequently reduced . in fig1 the inserts for filling the air gaps 12 and 13 have been indicated in dotted lines . it will be obvious that the invention is not restricted to the embodiment shown and described above and that various changes and modifications are possible within the true spirit and scope of the invention . | 7 |
in the following discussion , numerous specific details are set forth to provide a thorough understanding of the present invention . however , those skilled in the art will appreciate that the present invention may be practiced without such specific details . in other instances , well - known elements have been illustrated in schematic or block diagram form in order not to obscure the present invention in unnecessary detail . additionally , for the most part , details concerning well known features and elements have been omitted inasmuch as such details are not considered necessary to obtain a complete understanding of the present invention , and are considered to be within the understanding of persons of ordinary skill in the relevant art . turning now to the drawings , fig1 shows a top orthogonal view of an assembled electrical connector with attached wire conductors . in this drawing , reference numeral 1000 generally indicates an illustrative embodiment of an electrical connector 1000 at least partially configured according to the present invention . the electrical connector 1000 may comprise a female member 100 and a male member 500 . attached to the electrical connector 1000 are wire conductors 10 a , 10 b , 20 a , and 20 b . the wire conductors 10 a , 10 b , 20 a , and 20 b , may not considered as components of the electrical connector 1000 and are shown for the purposes of illustration . wire conductors 10 a and 10 b may carry a positive current flow and wire conductors 20 a and 20 b may carry a negative current flow . the various components of the electrical connector 1000 will be described in more detail in the following illustrative embodiment . referring to fig2 , the components of an embodiment of the electrical connector 1000 are shown in an exploded assembly view . the female member 100 may comprise a female housing 102 , a first and second female terminal 200 , and a first and second resilient member 300 . the male member 500 may comprise a male housing 502 , and a first and second male terminal 600 . turning now to fig3 a , 3 b , and 3 c , the female member 100 may comprise a female housing 102 , a first female terminal chamber 110 , a second female terminal chamber 120 , female terminals 200 , and resilient members 300 ( more clearly shown in fig2 ). a first female polarity indicator 111 and a second female polarity indicator 121 may indicate the respective polarities of the first female terminal chamber 110 and the second female terminal chamber 120 . a first orifice 116 and a second orifice 126 may be located at an end of the female member 100 opposite to the first and second female polarity indicators 111 and 121 . an example of a resilient member 300 is shown in fig3 b and 3c . a resilient member 300 may be located in each of the first and second female terminal chambers 110 and 120 ( however , only one is shown in the fig3 b and 3c for the purposes of illustration ). the various components of the female member 100 will be described in more detail in the following illustrative embodiment . referring to fig3 b , the female housing 102 may be substantially rectangular in shape and comprise a female conductor housing 104 , a female internal wall 105 , and a female terminal housing 106 , for each of the first and second female terminal chambers 110 and 120 . due to symmetry , only the first female terminal chamber 110 will be described from this point forward , reference numerals enclosed by parenthesis refer to the second female terminal chamber 120 . although a substantially rectangular shape is shown for the female housing 102 , embodiments of the present invention may not be limited to this one configuration . any configuration capable of accommodating one or more female terminals 200 may be used . the female housing 102 may be manufactured from a dielectric material able to withstand the operating conditions of an intended application and provide sufficient electrical insulation between the current carrying female terminals 200 ( i . e ., inhibiting the occurrence of electrical shorts between the female terminals 200 ). for example , the material of the female housing 102 may be a glass reinforced nylon such as zytel ® 70g33l , made by dupont ®. in some applications the reinforced nylon material may comprise approximately 33 % glass . the material may be used in a remotely controlled vehicle operating in a natural environment for example and may experience a temperature range from below − 20 ° f . (− 29 ° c .) to over 250 ° f . ( 121 ° c .) ( e . g ., when operated in desert conditions over solar heated roadways , or due to battery heat , current flow , and electrical resistance ). the female conductor housing 104 may be separated from the female terminal housing 106 by the female internal wall 105 . the female internal wall 105 may comprise an opening 114 ( 124 ) to accommodate a female terminal 200 . on the female conductor housing 104 side of the female internal wall 105 , the female internal wall 105 may comprise an indicator 113 identifying the connection side of the electrical connector 1000 ( fig1 ) for example ( e . g ., “ a ” for the female member and “ b ” for the male member ). in other embodiments , the indicator 113 may comprise a polarity sign to be used in place of , or in addition to , the first and second female polarity indicators 111 and 121 ( fig3 a ). the female conductor housing 104 may circumferentially surround an end of a female terminal 200 inserted into each of the first and second female terminal chambers 110 and 120 . an end of the female conductor housing 104 opposing the female internal wall 105 may be open to provide access for a conductor ( not shown ) to contact an exposed end of a female terminal 200 . in other embodiments , an end or side of the female conductor housing 104 adjacent to the female internal wall 105 may be open to provide conductor access . in the embodiment shown , the female conductor housing 104 substantially shrouds and insulates the ends of the female terminals 200 from each other . in certain other embodiments the female conductor housing 104 may only partially surround an end of a female terminal 200 in each of the first and second female terminal chambers 110 and 120 . the female terminal housing 106 portions of each of the first and second female terminal chambers 110 and 120 may comprise a female terminal support 107 and a resilient member support 109 ( fig3 c ). each of the female terminal supports 107 may help to retain a corresponding female terminal 200 in the respective first and second female terminal chambers 110 and 120 . the female terminal support 107 may comprise one or more retention members 112 ( for example as represented by 112 a ) configured to retain a female terminal 200 after assembly into a female member 100 . although a slanted ramp type of retention member 112 is shown in fig3 b to facilitate an insertion type of assembly ( e . g ., inserting a female terminal 200 from left to right in the female housing 102 with respect to fig3 b ), a person of ordinary skill in the art would not be limited to just this type of retention member 112 . pins , rivets , fasteners , other mechanical attachments , welding , and chemical adhesives , among other various methods may be used to secure a female terminal 200 in the female housing 102 . further , similar additional retention members 112 b may be used to provide additional force to oppose the friction force generated during the assembly and disassembly of the electrical connector 1000 ( fig1 ) that may otherwise move or dislocate one or both of the female terminals 200 . other embodiments of the female member 100 may not comprise retention members 112 . in some cases the female terminals 200 and resilient members 300 may be core molded into the female member 100 at the time of manufacture . the resilient member support 109 ( fig3 c ) may secure a resilient member 300 in each of the first and second female terminal chambers 110 and 120 . the resilient member support 109 is shown as proximate to the female internal wall 105 . however , an embodiment of the resilient member support 109 may be located proximate to an end of the female terminal housing 106 opposite to the female internal wall 105 ( i . e ., the insertion end of the female terminal housing 106 , for example , essentially configured 180 ° in a horizontal plane relative to the embodiment shown in fig3 b ) in addition to other locations . as with the female terminal support 107 , the resilient member support 109 may comprise one or more retention features 112 , for example , as represented by 112 c in fig3 c . the retention features 112 of the resilient member support 109 may comprise slanted ramp protrusions as with an embodiment of the female terminal support 107 , or the retention features 112 may comprise any of the mechanical , chemical , or welding methods of fastening previously recited . the previously recited methods of retaining and / or fastening female terminals 200 and resilient members 300 are not intended to form an exhaustive list , but are merely a sampling from amongst a broad variety of retaining and fastening methods known to those of ordinary skill in the art . as with the female terminals 200 , the resilient members 300 may be core molded into the female housing 102 during the production of the female housing 102 . the ends of the first and second female terminal chambers 110 and 120 located in the female terminal housing 106 , opposite to the female internal wall 105 , are referred to as the first and second orifices 116 and 126 . each of the first and second orifices 116 and 126 may be configured substantially in a rectangular shape as shown in fig3 a . however , in the illustrative embodiment shown in these figures , an aspect of the first orifice 116 , such as a width , may be configured differently than the same aspect of the second orifice 126 . the difference in widths may inhibit an incorrectly polarized assembly of a male member 500 ( fig1 ) with the female member 100 . although a difference in dimensional aspects such as widths may be used to inhibit reversing the polarities during connection of an electrical connector 1000 ( fig1 ) the present invention may not be limited to this method . different configurations , devices , and dimensions may be used to facilitate the proper polar connection orientation during assembly of a male member 500 with a female member 100 . turning now to fig4 a and 4b , fig4 a shows a top view of an embodiment of a female terminal 200 , and fig4 b shows a side view of the female terminal 200 of fig4 a . as an example of an illustrative embodiment of a female terminal 200 , the female terminal 200 may comprise a terminal connector portion 204 and a terminal contact portion 206 . the female terminal 200 may comprise an electrically conductive material , such as brass , copper , or bronze . the female terminal 200 may be plated with gold ( such as a gold - cobalt or gold - nickel alloy ) or silver , among other materials , preferably copper plated with nickel and then plated with gold ( for example ), in order to increase the electrical conductivity between contacting portions of the male and female terminals 600 and 200 . the female terminal 200 shown may be made from a standard plate of material and punched formed to the correct size and configuration , among other methods of forming . the terminal connector portion 204 may be located on one end of the female terminal 200 and configured to electrically couple with a copper wire conductor ( for example ) such as wire conductors 10 b and 20 b ( fig1 ). the terminal connector portion 204 may be electrically coupled to a wire conductor through the use of soldering , mechanical fastening ( e . g ., through the use of a screw clamp ), standard insulated and non - insulated connector fittings , crimping , and other methods of electrically coupling a wire conductor to a portion of a terminal . embodiments of the terminal connector portion 204 may comprise a variety of configurations in order to accommodate a particular electrical coupling method . the terminal contact portion 206 may be located at an opposite end of the female terminal 200 relative to the terminal connector portion 204 , and may comprise an angled end 210 , one or more terminal retention features 212 ( two are shown in fig4 b , 212 a and 212 b ), and a contact surface 214 . the angled end 210 may help facilitate the coupling or assembly of a corresponding male terminal 600 ( fig2 ) during the connection of an electrical connector 1000 ( fig1 ). the contact surface 214 may directly contact an opposing surface of a male terminal 600 in order to allow an electrical current to flow from one end of the electrical connector 1000 to the other . terminal step 208 may separate the terminal connector portion 204 from the terminal contact portion 206 . in some embodiments , during assembly of the female terminal 200 into female housing 102 ( fig3 b ), the terminal step 208 may oppose a portion of the female housing 102 and prevent further movement in the assembly direction . the terminal retention features 212 may contact corresponding retention features 112 of the female housing 102 and prevent movement in a direction opposite to the assembly direction . at this point , the female terminal 200 may be substantially securely coupled with the female housing 102 . referring now to fig5 a and 5b , these figures respectively show an orthogonal top view of a resilient member 300 and a side view of the resilient member 300 of fig5 a . the resilient member 300 may comprise a resilient base member 310 and a resilient contact member 320 . the resilient member 300 may be punch formed from a sheet of stainless steel ( e . g ., ss 301 with no plating ), spring steel ( e . g ., spring steel with nickel plating ) or other resilient material configured to work within the anticipated environmental conditions of the electrical connector 1000 ( fig1 ). in some embodiments , the resilient member 300 may be plated or otherwise coated to inhibit rust or to provide an appropriate level of resistance ( e . g ., friction force ) necessary to maintain the connection between an assembled male member 500 and female member 100 . the resilient base member 310 may be located at one end of the resilient member 300 and comprise one or more resilient retention members 312 a and 312 b ( fig5 b ). the resilient retention members 312 a and 312 b may engage corresponding retention members 112 within the resilient member support 109 ( as seen in fig3 c , but only one retention member 112 c can be seen in this view ), located in each of the first and second terminal chambers 110 and 120 . the resilient retention members 312 a and 312 b may securely retain the resilient members 300 within the female housing 102 during assembly and disassembly of the electrical connector 1000 ( fig1 ). the resilient base member 310 is shown as a substantially flat quadrilateral but embodiments of the present invention may not be limited to this illustrative form . the resilient base member 310 may be retained separate from the corresponding female terminal 200 and separate from a fully inserted male terminal 500 ( fig2 ). in other words , the resilient base member 310 may not overlay a corresponding male terminal 500 when an electrical connector 1000 ( fig1 ) is electrically coupled . as more easily seen in fig5 b , the resilient contact member 320 may comprise an arcuate portion defined by a radius r . the arcuate portion may be resiliently deformed toward the radial center point in response to pressure or interference from portions of an installed male member 500 ( fig1 ). the arcuate portion may also be configured to interface with a depression or other engaging feature , detailed later , in an opposing surface or portion of the male member 500 in order to provide a disassembly retention force after coupling the male member 500 with the female member 100 ( see fig1 ). in the illustrative embodiment shown , only a single arcuate portion is illustrated in fig5 a and 5b . however , embodiments of the present invention are not to be limited to this one exemplary configuration . for example , larger and smaller radii either alone or in combination with one or more relatively straight portions may be used , an arcuate portion curving back upon the resilient contact member 320 , a single angular bend joining two straight portions together , or a plurality of angular or arcuate portions such as in a zig - zag or wave type of configuration may be used in order to more evenly apply a force from the female member 100 to the male member 500 . the listing is intended to provide a small representative sample of the various potential configurations consistent with the present invention and is not intended to be exhaustive . one end of the resilient contact member 320 may comprise a housing interface 324 . an example of the housing interface 324 may be illustrated by a small radius curve rotating in an opposite direction relative to the arcuate portion defined by the radius r . the housing interface 324 may facilitate a sliding movement along a contacting portion of an inner wall of the female housing 102 ( fig3 b ) in response to assembly and disassembly of a male member 500 and a female member 100 ( see fig2 ). the sliding contact may prevent or inhibit the abrading or prematurely wearing down of the inner surface of the female housing 102 over a multiple number of connections and disconnections of the electrical connector 1000 ( fig1 ). in this example , the contacting portion of the housing interface 324 curves away from the inner surface of the female housing 102 in directions tangent to the small radius curve . further , the resilient contact member 320 may extend at an angle from the resilient base member 310 such that the housing interface 324 may be located above ( with respect to fig5 b ) a plane containing the resilient base member 310 . this configuration may apply a pre - load to an assembled resilient member 300 via the housing interface 324 . by adjusting the angle for the resilient contact member 320 relative to the resilient base member 310 , and / or adjusting the radius r , the force applied to the male member 500 through the resilient contact member 320 may be adjusted . adjusting the force of the resilient contact member 320 may adjust the amount of insertion and withdrawal force for the connecting and disconnecting of the electrical connector 1000 . consequently , a desired amount of insertion and withdrawal force may be established for the connecting and disconnecting of the electrical connector 1000 . turning now to fig6 a , and 6 b , the male member 500 may comprise a male housing 502 , a first male terminal extension 510 , a second male terminal extension 520 , and male terminals 600 ( more clearly shown in fig6 b ). a first male polarity indicator 511 and a second male polarity indicator 521 may indicate the respective polarities of the first male terminal extension 510 and the second male terminal extension 520 . an example of a male terminal 600 is shown in fig7 a and 7b and is detailed later . the various components of the male member 500 will be described in more detail in the following illustrative embodiment . referring to fig6 b , the male housing 502 may be substantially rectangular in shape and comprise a male conductor housing 504 , a male internal wall 505 , and a male terminal tip 506 for each of the first and second male terminal extensions 510 and 520 . due to their similarities , only the first male terminal extension 510 will be described from this point forward , reference numerals enclosed by parenthesis refer to second male terminal extension 520 . although a substantially rectangular shape is shown for the male housing 502 , embodiments of the present invention may not be limited to this one configuration . any configuration capable of accommodating one or more male terminals 600 may be used . the male housing 502 may be manufactured from a dielectric material able to withstand the operating conditions of an intended application and provide sufficient electrical insulation between the current carrying male terminals 600 ( i . e ., inhibiting the occurrence of an electrical short between the male terminals 600 ). for example , the material of the male housing 502 may be a glass reinforced nylon such as zytel ® 70g33l , made by dupont ®. in some applications the reinforced nylon material may comprise approximately 33 % glass . the material may be used in a remotely controlled vehicle operating in a natural environment for example and may experience a temperature range from below − 20 ° f . (− 29 ° c .) to over 250 ° f . ( 121 ° c .) ( e . g ., when operated in desert conditions over solar heated roadways , or due to battery heat , current flow , and electrical resistance ). the male conductor housing 504 may be separated from the male terminal housing 506 by the male internal wall 505 . the male internal wall 505 may comprise an opening 514 ( 524 ) to accommodate a male terminal 600 . on the male conductor housing 504 side of the male internal wall 505 , the male internal wall 505 may comprise an indicator 513 identifying the connection side of the electrical connector 1000 ( fig1 ), for example ( e . g ., “ a ” for the female member and “ b ” for the male member ). in other embodiments , the indicator 513 may comprise a polarity sign to be used in place of , or in addition to , the first and second male polarity indicators 511 and 521 ( fig6 a ). the male conductor housing 504 may circumferentially surround an end of a male terminal 600 inserted into each of the first and second male terminal extensions 510 and 520 . an end of the male conductor housing 504 opposing the internal wall 505 may be open to provide access for a conductor ( not shown ) to contact an exposed end of a male terminal 600 . in other embodiments , an end or side of the male conductor housing 504 adjacent to the male internal wall 505 may be open to provide conductor access . in the embodiment shown , the male conductor housing 504 substantially shrouds and insulates the ends of the male terminals 600 from each other . in certain other embodiments the male conductor housing 504 may only partially surround an end of a male terminal 600 in each of the first and second male terminal extensions 510 and 520 . the male internal wall 505 of each of the first and second male terminal extensions 510 and 520 may function as a male terminal support ( fig6 b ). each of the male terminal supports ( i . e ., male internal walls 505 ) may help to retain a corresponding male terminal 600 in the respective first and second male terminal extensions 510 and 520 . the male terminal support may comprise one or more retention members 512 ( for example as represented by 512 a ), configured to retain a male terminal 600 after assembly into a male member 500 . although a slanted ramp type of retention member 512 is shown in fig6 b to facilitate an insertion type of assembly ( e . g ., inserting a male terminal 600 from the left to the right in the male housing 502 with respect to fig6 b ), a person of ordinary skill in the art would not be limited to just this type of retention member 512 . pins , rivets , fasteners , other mechanical attachments , welding , and chemical adhesives , among other various methods may be used to secure a male terminal 600 within the male housing 502 . further , similar additional retention members 512 b may be used to provide additional force to oppose the friction force generated during the connection and disconnection of the electrical connector 1000 ( fig1 ) that may otherwise move or dislocate one or both of the male terminals 600 . other embodiments of the male member 500 may not comprise retention members 512 . in some cases the male terminals 600 may be core molded into the male housing 502 at the time of manufacture . the ends of the first and second male terminal extensions 510 and 520 in the male terminal tips 506 , opposite to the internal wall 505 , are referred to as the first and second male terminal covers 516 and 526 . each of the first and second male terminal covers 516 and 526 may be configured substantially in a rectangular shape as shown in fig6 a . however , in the illustrative embodiment shown in these figures , an aspect of the first male terminal cover 516 , for example width , may be configured differently than the same aspect of the second male terminal cover 526 . the difference in widths may inhibit an incorrectly polarized assembly of a male member 500 ( fig1 ) with the female member 100 . although a difference in dimensional aspects such as widths may be used to inhibit reversing the polarities during connection of an electrical connector 1000 ( fig1 ), the present invention may not be limited to this method . different configurations , devices , and dimensions may be used to facilitate the proper polar connection orientation during assembly of a male member 500 with a female member 100 . the first and second male terminal covers 516 and 526 may each comprise a connector retention feature 507 . in some embodiments , the connector retention feature 507 may be configured as an arcuate cavity or depression corresponding to an arcuate portion of the resilient contact member 320 of a resilient member 300 ( see fig5 b ). as the male member 500 is connected to the female member 100 ( see fig1 ), the resilient member 300 moves relative to a surface of the corresponding first and second male terminal covers 516 and 526 until a portion of the resilient contact member 320 engages a corresponding portion of the connector retention feature 507 . the engagement between the resilient contact member 320 and the connector retention feature 507 may provide a sensory indication that the male member 500 is fully connected to the female member 100 . in addition , the engagement between the resilient contact member 320 and the connector retention feature 507 may help to prevent inadvertent disconnection between the male member 500 and the female member 100 during the operation of the electrical connector 1000 in an applied device . the first and second male terminal covers 516 and 526 may further comprise an angled or slanted portion 570 , which may be located at an end opposite to the male internal wall 505 . the slanted portion 570 of each of the first and second male terminal covers 516 and 526 may facilitate the insertion and / or assembly of the male member 500 with the female member 100 ( see fig1 ). in some embodiments , rounded , arcuate , or other insertion facilitating features may be used in place of , or in addition to , the slanted portion 570 of each of the first and second male terminal covers 516 and 526 . at least part of the remaining portions of the first and second male terminal covers 516 and 526 may provide a contact surface for the resilient member 300 , as previously explained , and may provide a degree of insulation between the resilient members 300 and the male terminals 600 . the material of the first and second male terminal covers 516 and 526 may be the same as the material used for the rest of the male housing 502 . in some embodiments , the first and second male terminal covers 516 and 526 may comprise a coating applied to a surface of the male terminals 600 . alternatively , a coating or texture may be applied to a surface of the first and second male terminal covers 516 and 526 to vary the level of frictional resistance between the surface and the contacting portion of the resilient contact member 320 of each of the respective resilient members 300 . turning now to fig7 a and 7b , fig7 a shows a top view of an embodiment of a male terminal 600 , and fig7 b shows a side view of the male terminal 600 of fig7 a . as an example of an illustrative embodiment of a male terminal 600 , the male terminal 600 may comprise a terminal connector portion 604 and a terminal contact portion 606 . the male terminal 600 may comprise an electrically conductive material , such as brass , copper , or bronze . the male terminal 600 may be plated with gold ( such as gold - cobalt or gold - nickel alloy ) or silver , among other materials , preferably copper plated with nickel and then plated with gold ( for example ), in order to increase the electrical conductivity between contacting portions of the male and female terminals 600 and 200 . the male terminal 600 shown may be made from a standard plate of material and punched formed to the correct size and configuration , among other methods of forming . the terminal connector portion 604 may be located on one end of the male terminal 600 and configured to electrically couple with a copper wire conductor ( for example ) such as wire conductors 10 a and 20 a ( fig1 ). the terminal connector portion 604 may be electrically coupled to a wire conductor through the use of soldering , mechanical fastening ( e . g ., through the use of a screw clamp ), standard insulated and non - insulated connector fittings , crimping , and other methods of electrically coupling a wire conductor to a terminal . embodiments of the terminal connector portion 604 may comprise a variety of configurations in order to accommodate a particular electrical coupling method . the terminal contact portion 606 may be located at an opposite end of the male terminal 600 relative to the terminal connector portion 604 , and may comprise an angled end 610 , one or more terminal retention features 612 ( two are shown in fig7 b , 612 a and 612 b ), and a contact surface 614 . the angled end 610 may help facilitate the coupling or assembly of a corresponding female terminal 200 ( fig2 ) during the connection of an electrical connector 1000 ( fig1 ). the contact surface 614 may directly contact an opposing surface of a female terminal 200 in order to allow an electrical current to flow from one end of the electrical connector 1000 to the other . terminal step 608 may separate the terminal connector portion 604 from the terminal contact portion 606 . in some embodiments , during assembly of the male terminal 600 into male housing 502 ( fig6 b ), the terminal step 608 may oppose a portion of the male housing 502 and prevent further movement in the assembly direction . the terminal retention features 612 may contact corresponding retention features 512 of the male housing 502 and prevent movement in a direction opposite to the assembly direction . at this point , the male terminal 600 may be substantially securely coupled with the male housing 502 . turning now to fig8 a and 8b , fig8 a illustrates a correctly assembled electrical connector 1000 , while fig8 b illustrates an incorrectly assembled electrical connector 1000 . as seen in fig8 a , when the male member 500 is correctly coupled to a female member 100 , the first and second male polarity indicators 511 and 521 correspond to the first and second female polarity indicators 111 and 121 , indicating the maintenance of proper polarity across the electrical connector 1000 . the correspondence between the sets of polarity indicators 111 , 121 , 511 , and 521 , may provide a visual indication of the correct coupling of the male and female members 500 and 100 . as seen in fig8 b , the first and second male polarity indicators 511 and 521 may not be visible from a top oriented viewing plane when the male member 500 is incorrectly assembled to the female member 100 . in addition , as indicated by the arrows for the first and second male polarity indicators 511 and 521 ( the polarity indicators themselves are not visible in this view ), the polarities on each side of the incorrectly assembled electrical connector 1000 have been reversed . referring to fig9 a and 9b , fig9 a illustrates a cross - sectional view of the correctly assembled electrical connector 1000 of fig8 a as viewed along line 9 a - 9 a , while fig9 b illustrates a cross - sectional view of the incorrectly assembled electrical connector 1000 of fig8 b as viewed along line 9 b - 9 b . fig9 a shows an electrical connector 1000 in which a first male terminal cover 516 is inserted into a first orifice 116 and a contact surface 614 of the male terminal 600 is abutting a contact surface 214 of the female terminal 200 . the first male terminal cover 516 and the first orifice 116 may each have an approximate width of w 1 with the first male terminal cover 516 configured to fit within the first orifice 116 . the second male terminal cover 526 is inserted into a second orifice 126 such that a contact surface 614 of the corresponding male terminal 600 is abutting a contact surface 214 of the corresponding female terminal 200 . the second male terminal cover 526 and the second orifice 126 may each have an approximate width of w 2 with the second male terminal cover 526 configured to fit within the second orifice 126 . the width w 1 may be smaller than the width w 2 . this difference in widths may provide another method of inhibiting or preventing cross - polarization during connection of the male member 500 to the female member 100 ( fig8 a ), since the male member 500 may be connected to the female member 100 when the male member 500 is properly oriented with respect to the female member 100 . the proper orientation of the male and female members 500 and 100 may provide for the correct polarity of the connection . fig9 b shows an electrical connector 1000 in which a male member 500 is incorrectly connected to a female member 100 . this type of connection may be substantially prevented by the interference between the width of the second male terminal cover 526 ( w 2 ) and the width of the first orifice 116 ( w 1 )( e . g ., w 2 − w 1 ). however , if the male member 500 is somehow coupled to the female member 100 in spite of this interference , cross - polarization of the electrical connector 1000 may still be prevented by the first and second male terminal covers 516 and 526 separating the male and female terminals 600 and 200 . the first and second male terminal covers 516 and 526 may prevent contact between corresponding male and female terminals 600 and 200 when the male member 500 is in a second orientation with respect to the female member 100 . therefore , as seen in this illustrative embodiment , cross - polarization of the electrical connector 1000 may be prevented and / or inhibited by at least two separate and independent methods , in addition to the visual indication given by the first and second male and female polarity indicators , 111 , 121 , 511 , and 521 . referring now to fig1 , this figure illustrates an orthogonal cross - sectional view of a correctly assembled male member 500 and female member 100 . in this figure , the first and second male terminal extensions 510 and 520 ( fig6 a ) have been inserted into the first and second female terminal chambers 110 and 120 ( fig3 a ), or more specifically , the male terminal housing 506 portions of the first and second male terminal extensions 510 and 520 have been inserted into the first and second orifices 116 and 126 of the first and second female terminal chambers 110 and 120 . as the male member 500 is connected to the female member 100 , the resilient members 300 may initially contact the slanted portion 570 of the corresponding first and second male terminal covers 516 and 526 . the resilient contact portions 320 may respectively slidingly engage a top surface of each of the first and second male terminal covers 516 and 526 . the resilient contact portions 320 may be compressed , causing the housing interface 324 portion of the resilient member 300 to slidingly engage an interior surface of the respective first and second female terminal chambers 110 and 120 . the male member 500 may continue to be inserted into the female member 100 until the resilient contact portion 320 engages a corresponding connector retention feature 507 of the respective first and second male terminal covers 516 and 526 . at this point , the male member 500 may be securely coupled to the female member 100 . although only one side portion of the electrical connector 1000 is described in detail , the other side portion may be similar due to the symmetry of the connector . however , complete symmetry is not a limitation required of an embodiment of the present invention and differences beyond the widths of the first and second male terminal covers 516 and 526 and corresponding first and second orifices 116 and 126 may exist . referring now to fig1 , this figure shows an orthogonal top view with a cross - section taken through the side of an embodiment of an electrical connector . in this figure , reference number 2000 generally refers to another illustrative embodiment of an electrical connector 2000 constructed according to aspects of the present invention . one difference between the electrical connector 2000 and the previously described electrical connector 1000 ( fig1 ) may be the replacement of one or more resilient members 300 ( fig2 ) of the previous illustrative embodiment with one or more resilient members 2300 . otherwise , the function and materials for the two electrical connectors 1000 and 2000 may be considered to be the same . similar components may be identified with similar reference numerals used in the previous description , and a detailed explanation of these components may not be repeated . electrical connector 2000 may comprise a female member 2100 and a male member 500 , shown here in a connected state . the female member 2100 may comprise one or more female terminals 200 ( only one is visible in this view ) and the male member 500 may comprise a corresponding number of male terminals 600 . when the female member 2100 and the male member 500 are coupled together , electricity may be able to flow between wire conductors ( not shown ) through the electrical connector 2000 via the areas of contact between the female and male terminals 200 and 600 . the female member 2100 may comprise one or more resilient members 2300 . the resilient members 2300 may provide a pressing force to facilitate electrical conduction through the contact areas between the corresponding female and male terminals 200 and 600 . in addition , the resilient members 2300 may provide a securing force to inhibit or prevent the inadvertent disconnection of the male member 500 from the female member 2100 during the use of the electrical connector 2300 in a desired application ( e . g ., such as in a vibratory and dynamic environment of a remotely controlled vehicle ). in some exemplary embodiments , the number of resilient members 2300 corresponds to the number of electrical connections formed or broken during the connection and disconnection of the electrical connector 2000 ( e . g ., two are shown in fig1 ). however , the number of resilient members 2300 may not be required to equal the number of electrical connections formed or broken . each resilient member 2300 may comprise a resilient housing 2310 integrated with the housing of the female member 2100 . as shown in fig1 , the resilient housing 2310 may be substantially cylindrical for example , but embodiments of the present invention may not be limited to this geometric configuration . each resilient member 2300 may further comprise a retention device 2324 , a resilient device 2322 , and a contact device 2320 . the retention device 2324 may comprise an allen set screw as shown for example , or may comprise any of a number of devices able to retain the resilient device 2322 and the contact device 2320 within the resilient housing 2310 , while in some embodiments further providing a measure of adjustability . for example , a mechanical threaded fastener , angled key , or cam device , among others , may be used . in this example , the retention device 2324 may be threadably engaged with a top portion of the resilient housing 2310 . the resilient device 2322 may be located between the retention device 2324 and the contact device 2320 . the resilient device 2322 may be a spring , such as a coil spring , or resilient material , such as foam , among other devices . the resilient device 2322 may press against the contact device 2320 , facilitating movement of the contact device 2320 as the male member 500 and the female member 2100 are coupled together . the force applied to the contact device 2320 and consequently to the male and female terminals 200 and 600 , may be adjusted by tightening or loosening the retention device 2324 , in addition to altering the spring stiffness or material , among other methods . in some embodiments , the male member 500 may be securely coupled to the female member 2100 by tightening the retention device 2324 so as to eliminate or reduce the ability of the contact device 2320 to move within the resilient housing 2310 , thereby forcefully engaging the contact device 2320 with a connector retention feature 507 . the contact device 2320 may be spherical ball for example , such as in a ball and spring type of mechanism . however , in other embodiments the contact device 2320 may be any member capable of moving across the surface of the first and second male terminal covers 516 and 526 ( only the first male terminal cover 516 is visible in this view ), such as a rounded pin , angled member , cylinder , among others . the contact device 2320 may be retained within the resilient housing 2310 between a protruding edge 2312 at one end and the retention device 2324 at the other end . during connection of the male member 500 and the female member 2100 , the contact device 2320 may engage the connector retention feature 507 as the male member 500 is fully coupled with the female member 2100 . the contact device 2320 and the connector retention feature 507 may be configured to have corresponding or interfacing features , such that when the male member 500 is fully coupled with the female member 2100 , a sensory indication of the application device 2320 engaging the connector retention feature 507 may be provided . the sensory indication may be visual , audible , tactile , or a combination of one or more of these sensory indications , in addition to other methods . referring now to fig1 , this figure shows an orthogonal top view with a cross - section taken through the side of an embodiment of an electrical connector . in this figure , reference number 3000 generally refers to another illustrative embodiment of an electrical connector 3000 constructed according to aspects of the present invention . one difference between the electrical connector 3000 and the previously described electrical connectors may be the replacement of one or more resilient members 300 ( fig2 ) or 2300 ( fig1 ) of the previous illustrative embodiments , with one or more resilient members 3300 . otherwise , the function and materials for the electrical connectors 1000 , 2000 , and 3000 may be considered to be the same . similar components may be identified with similar reference numerals used in the previous description , and a detailed explanation of these components may not be repeated . electrical connector 3000 may comprise a female member 3100 and a male member 500 , shown here in a connected state . the female member 3100 may comprise one or more female terminals 200 ( only one is visible in this view ) and the male member 500 may comprise a corresponding number of male terminals 600 . when the female member 3100 and the male member 500 are coupled together , electricity may be able to flow between wire conductors ( not shown ) through the electrical connector 3000 via the contact areas between the female and male terminals 200 and 600 . the female member 3100 may comprise one or more resilient members 3300 . the resilient members 3300 may provide a pressing force to facilitate electrical conduction through the contact area between the female terminals 200 and the male terminals 600 . in addition , the resilient members 3300 may provide a securing force to inhibit or prevent the inadvertent disconnection of the male member 500 from the female member 3100 during the use of the electrical connector 3300 in a desired application ( e . g ., such as in a vibratory and dynamic remotely controlled vehicle ). in some exemplary embodiments , the number of resilient members 3300 corresponds to the number of electrical connections formed or broken during the connection and disconnection of the electrical connector 3000 , two electrical connections are shown in this embodiment . however , the number of resilient members 3300 may not be required to equal the number of electrical connections formed or broken . each resilient member 3300 may be configured to interfere with a opposing surface of a first and second male terminal cover 516 and 526 ( only 516 is visible in this view ) when a male member 500 is coupled to a female member 3100 . as shown in fig1 , the area indicated by cross - hatching may be the area of interference between the resilient member 3300 and the top surface of the first male terminal cover 516 , although only a portion of the abutting surfaces may be configured to be interfering . the resilient member 3300 may comprise a rib interfacing with a portion of the respective top surface of the first and second male terminal covers 516 and 526 , or the resilient member 3300 may comprise the wall of the female member housing 3102 , among numerous other configurations such as those previously described for the resilient contact portion 320 . essentially , in some embodiments the housing 3102 of the female member 3100 may function as a resilient member , allowing at least some degree of resilient deformation or movement designed to apply a force to at least a portion of an installed male member 500 ( e . g ., such as the first and second male terminal covers 516 and 526 , or in some embodiments , the male terminals themselves , among other configurations ). alternatively , the first and second male terminal covers 516 and 526 may function as a resilient member , allowing at least some degree of resilient deformation or movement designed to urge the male terminals 600 together with the corresponding female terminals 200 . further , in some embodiments , both the female housing 3102 and the first and second male terminal covers 516 and 526 may experience some degree of resilient deformation , combining together to provide a force urging the male terminals 600 together with the corresponding female terminals 200 . the resilient member 3300 may further comprise protrusions or features configured to engage with corresponding depressions or features located on the top surfaces of the first and second male terminal covers 516 and 526 , such that the male member 500 may be securely coupled to the female member 3000 upon fully connecting the male member 500 to the female member 3100 . an example of a protrusion for the resilient member 3300 may be an arcuate ridge corresponding to the connector retention feature 507 shown in fig6 b . the resilient member 3300 may at least partially resiliently deform with respect to the area of interference . alternatively , the resilient member 3300 may take advantage of at least some degree of resilient deformation in the configuration of the female member housing 3102 . turning now to fig1 a and 13b , the first figure shows a top view of an illustrative embodiment of a male member 1500 configured according to aspects of the present invention , while the second figure shows an orthogonal cross - sectional top view of the male member 1500 of fig1 a as viewed along line 13 b - 13 b . one difference between the male member 1500 and the previously described male member 500 ( fig1 ) may be the lack of first and second male terminal covers 516 and 526 ( see fig6 a and 6b ) in the male member 1500 . another difference may be the use of first and second male terminals 1600 and 1650 in male member 1500 in place of the male terminals 600 shown in male member 500 ( see fig2 ). otherwise , the function and materials for the male members 500 and 1500 may be considered to be substantially the same . similar components may be identified with similar reference numerals used in previous descriptions , and a detailed explanation of these components may not be repeated . male member 1500 may comprise a male housing 1502 and first and second male terminal extensions 1510 and 1520 . the first male terminal extension 1510 may comprise the first male terminal 1600 , while the second male terminal extension 1520 may comprise the second male terminal 1650 . first and second male terminals 1600 and 1650 may be configured to be insertably engaged with the first and second orifices 116 and 126 of the first and second female terminal chambers 110 and 120 of a female member 100 ( see fig3 a ). in some embodiments , some aspects of the first male terminal 1600 may be different than similar aspects of the second male terminal 1650 in order to inhibit the cross - polarizing connection of a male member 1500 and a female member 100 . in the embodiment shown , the width w 1 of the first male terminal 1600 may be smaller that the width w 2 of the second male terminal 1650 . interference between the larger width w 2 and the first orifice 116 may inhibit the connection between a female member 100 and an improperly oriented male member 1500 ( i . e ., the male member 1500 may be improperly oriented with respect to the female member 100 ). the male housing 1502 may be substantially rectangular in shape and comprise a male conductor housing 504 and a male internal wall 1505 for each of the first and second male terminal extensions 1510 and 1520 . although a substantially rectangular shape is shown for the male housing 1502 , embodiments of the present invention may not be limited to this one configuration . any configuration capable of accommodating one or more first and second male terminals 1600 and 1650 may be used . the male housing 1502 may be manufactured from a dielectric material able to withstand the operating conditions of an intended application and provide sufficient electrical insulation between the current carrying first male terminal 1600 and second male terminal 1650 ( i . e ., inhibiting the occurrence of an electrical short between the first male terminal 1600 and the second male terminal 1650 ). the male internal wall 1505 of each of the first and second male terminal extensions 1510 and 1520 may function as a male terminal support . each of the male terminal supports ( i . e ., male internal walls 1505 ) may respectively secure and support the first and second male terminals 1600 and 1650 in the corresponding first and second male terminal extensions 1510 and 1520 . the male terminal support may comprise one or more retention members 512 ( for example as represented by 512 a and 512 b ) configured to retain the respective first and second male terminals 1600 and 1650 after assembly into a male member 1500 . although a slanted ramp type of retention member 512 is shown in fig1 b to facilitate an insertion type of assembly ( e . g ., inserting a male terminal 1600 from the right to the left in the male housing 1502 with respect to fig1 b ), a person of ordinary skill in the art would not be limited to just this type of retention member 512 . pins , rivets , fasteners , other mechanical attachments , welding , and chemical adhesives , among other various methods may be used to secure the first and second male terminals 1600 and 1650 within the male housing 1502 . additionally , the first and second male terminals 1600 and 1650 may be core molded along with the male housing 1502 at the time of manufacture . the first and second male terminals 1600 and 1650 may comprise retention members 612 ( for example as represented by 612 a and 612 b , however , only the retention members 612 of the first male terminal 1600 may be seen in fig1 b , the second male terminal 1650 may be similarly configured ) corresponding to the retention members 512 . as with the retention member 512 , a slanted ramp type of retention member 612 is shown in fig1 b to facilitate an insertion type of assembly , however , a person of ordinary skill in the art would not be limited to just this type of retention member 612 . pins , rivets , fasteners , other mechanical attachments , welding , and chemical adhesives , among other various methods may be used to secure the first and second male terminals 1600 and 1650 within the male housing 1502 . having thus described embodiments of the present invention by reference to certain exemplary embodiments , it is noted that the embodiments disclosed are illustrative rather than limiting in nature . a wide range of variations , modifications , changes , and substitutions are contemplated in the foregoing disclosure . in some instances , some features of an embodiment of the present invention may be employed without a corresponding use of the other features . many such variations and modifications may be considered desirable by those skilled in the art based upon a review of the foregoing description of the illustrative embodiments . accordingly , it is appropriate that the appended claims be construed broadly and in a manner consistent with the scope of the invention . | 7 |
the controlling agent and antifouling coating of the present invention contain an n - phenylbenzoisothiazolone derivative of the formula ( i ), which is hereinafter referred to as the compound ( i ), as an active ingredient . compound ( i ) is disclosed in the u . s . pat . no . 3 , 012 , 039 and a process of producing this compound is disclosed in the japanese patent publication no . 51 - 113 / 1976 . as used herein , the term &# 34 ; halogen &# 34 ; refers to chlorine , fluorine , bromine or iodine . the term &# 34 ; alkyl &# 34 ; refers to c 1 - c 10 alkyl such as methyl , ethyl , n - propyl , iso - propyl , n - butyl , isobutyl , tert - butyl , sec - butyl , tert - amyl , n - pentyl , n - hexyl and n - decyl . preferred is c 1 - c 4 alkyl . the term &# 34 ; alkoxy &# 34 ; refers to c 1 - c 10 alkoxy such as methoxy , ethoxy , n - propoxy , isopropoxy , n - butoxy , isobutoxy , tert - butoxy , sec - butoxy , tert - amyl oxy , n - pentyloxy , n - hexyloxy and n - decyloxy . preferred is c 1 - c 4 alkoxy . the compound ( i ) has an effect on the prevention and inhibition of harmful aquatic organisms adhering to water - exposed articles , and such an effect can be retained for a long period of time . examples of the harmful aquatic organisms are aquatic animals such as barnacles ( balanomorpha ), serpula , polyzoans ( polyzoa ), ascidiacea , hydrozoa and mollusks ( mollusca ); aquatic plants such as ulva , enteromorpha , ectocarpus and diatoms ( diatomaceae ); and slime . in case where the compound ( i ) is used for the purpose of preventing and inhibiting the adhesion and propagation of harmful aquatic organisms adhering to water - exposed articles , it may be applied in the form of a solution or emulsion . preferably , it is applied in the form of a resin - containing composition . in particular , to water - exposed articles present in the sea , the antifouling composition of the present invention is applied . the compound ( i ) can be made into an antifouling composition by ordinary formulation which is usually employed in the field of coatings . it is noted that the compound ( i ) has no adverse effect on the storage stability , such as viscosity increase and quality change . the antifouling composition of the present invention contains the compound ( i ) in a mixture with a resin . examples of the resin are vinyl chloride resins , vinyl chloride - vinyl acetate copolymers , vinyl chloride - vinyl isobutyl ether copolymers , chlorinated rubber resins , chlorinated polyethylene resins , chlorinated polypropylene resins , acrylic resins , styrene - butadiene copolymers , polyester resins , epoxy resins , phenolic resins , synthetic rubbers , silicone rubbers , silicone resins , petroleum resins , oil resins , rosin ester resins , rosin soap and rosin . preferred are vinyl chloride resins , vinyl chloride - vinyl acetate copolymers , vinyl chloride - vinyl isobutyl ether copolymers , acrylic resins and styrene - butadiene copolymers . the resin is mixed in an amount of 0 . 1 % to 80 % by weight , preferably 0 . 1 % to 60 % by weight , based on the total weight of the controlling agent or antifouling composition of the present invention . the antifouling composition of the present invention may further contain various additives which are usually used in conventional compositions , for example , plasticizers such as chlorinated paraffin and trimetacresyl phosphate ; color pigments such as red iron oxide and titanium dioxide ; extender pigments such as zinc oxide and silica powder ; and organic solvents such as xylene and methyl isobutyl ketone . preferably , a copper compound or a metallic copper is added to the control ling agent and antifouling composition of the present invention to obtain better controlling effects . examples of the copper compound are cuprous oxide , copper rhodanide , oxine - copper , copper naphthenate , copper glycinate , cuprous chloride and cuprous carbonate . preferred are cuprous oxide and copper rhodanide . the controlling agent and antifouling composition of the present invention may further contain other conventional antifouling agents , if required . examples of the antifouling agent are those which have been cited in the 2091th research meeting of the japan shipbuilding research association , such as zinc dimethyldithiocarbamate , 2 - methylthio - 4 - t - butylamino - 6 - cyclopropylamino - s - triazine , 2 , 4 , 5 , 6 - tetrachloroisophthalonitrile , n , n - dimethyl - n &# 39 ;-( 3 , 4 - dichlorophenyl ) urea , 4 , 5 - dichloro - 2 - n - octyl - 4 - isothiazolin - 3 - one , n -( fluorodichloromethylthio ) phthalimide , n , n - dimethyl - n &# 39 ;- phenyl - n &# 39 ;-( fluorodichloromethylthio ) sulfamide , 2 - pyridinethiol - 1 - oxide zinc salt , tetramethylthiuram disulfide , cu - 10 % ni solid solution alloy , n -( 2 , 4 , 6 - trichlorophenyl )- maleimide , 2 , 3 , 5 , 6 - tetrachloro - 4 -( methylsulfonyl ) pyridine , 3 - iodo - 2 - propynylbutyl - carbamate , diiodomethyl - p - tolylsulfone , bisdimethyldithiocarbamoyl zinc ethylenebis - dithiocarbamate and tetraphenylborane pyridine salt . the compound ( i ) is mixed in an amount of 0 . 1 to 60 % by weight , preferably 0 . 1 to 40 % by weight , based on the total weight of the controlling agent or antifouling composition of the present invention . when the amount is less than 0 . 1 % by weight , no controlling effect will be expected . when the amount is greater than 60 % by weight , defects such as cracks and peeling will readily occur on the coating film formed from the antifouling composition . in case where a copper compound is to be added to the controlling agent or antifouling composition of the present invention , the proportion of the copper compound to the compound ( i ) may vary case by case , but it is preferably in the range of 0 . 1 to 100 parts by weight to one part by weight of the compound ( i ). the total amount of compound ( i ) and copper compound is preferably 0 . 1 % to 80 % by weight , based on the total weight of the controlling agent or antifouling composition of the present invention . when the total amount is less than 0 . 1 % by weight , no controlling effect will be expected . when the total amount is greater than 80 % by weight , defects such as cracks and peeling will readily occur on the coating film formed from the antifouling composition , which makes it difficult to attain the desired antifouling effect . the compound ( i ) can safely be applied as the antifouling composition of the present invention by means of a spray or the like because of its low irritant action . some typical examples of the compound ( i ) are shown in table 1 below , which are to be construed as mere illustrations and not limitations of the preceding disclosure in any way whatsoever . table 1______________________________________compoundno . compound name______________________________________ ( 1 ) n - phenylbenzoisothiazolone ( 2 ) n -( 2 - chlorophenyl ) benzoisothiazolone ( 3 ) n -( 3 - chlorophenyl ) benzoisothiazolone ( 4 ) n -( 4 - chlorophenyl ) benzoisothiazolone ( 5 ) n -( 4 - bromophenyl ) benzoisothiazolone ( 6 ) n -( 2 - fluorophenyl ) benzoisothiazolone ( 7 ) n -( 4 - fluorophenyl ) benzoisothiazolone ( 8 ) n -( 2 - methylphenyl ) benzoisothiazolone ( 9 ) n -( 3 - methylphenyl ) benzoisothiazolone ( 10 ) n -( 4 - methylphenyl ) benzoisothiazolone ( 11 ) n -( 2 - ethylphenyl ) benzoisothiazolone ( 12 ) n -( 3 - ethylphenyl ) benzoisothiazolone ( 13 ) n -( 4 - ethylphenyl ) benzoisothiazolone ( 14 ) n -( 2 - isopropylphenyl ) benzoisothiazolone ( 15 ) n -( 4 - isopropylphenyl ) benzoisothiazolone ( 16 ) n -( 2 - methoxyphenyl ) benzoisothiazolone ( 17 ) n -( 3 - methoxyphenyl ) benzoisothiazolone ( 18 ) n -( 4 - methoxyphenyl ) benzoisothiazolone ( 19 ) n -( 4 - ethoxyphenyl ) benzoisothiazolone ( 20 ) n -( 4 - n - butoxyphenyl ) benzoisothiazolone ( 21 ) n -( 2 , 4 - dichlorophenyl ) benzoisothiazolone ( 22 ) n -( 3 , 4 - dichlorophenyl ) benzoisothiazolone ( 23 ) n -( 3 , 5 - dichlorophenyl ) benzoisothiazolone ( 24 ) n -( 2 , 6 - dichlorophenyl ) benzoisothiazolone ( 25 ) n -( 2 , 4 , 6 - trichlorophenyl ) benzoisothiazolone ( 26 ) n -( 2 , 3 , 4 , 5 , 6 - pentachlorophenyl ) benzoisothiazolone ( 27 ) n -( 2 , 4 - difluorophenyl ) benzoisothiazolone ( 28 ) n -( 2 , 3 , 5 , 6 - tetrafluorophenyl ) benzoisothiazolone ( 29 ) n -( 2 , 3 , 4 , 5 , 6 - pentafluorophenyl ) benzoisothiazolone ( 30 ) n -( 2 , 4 - dimethylphenyl ) benzoisothiazolone ( 31 ) n -( 3 , 4 - dimethylphenyl ) benzoisothiazolone ( 32 ) n -( 3 , 5 - dimethylphenyl ) benzoisothiazolone ( 33 ) n -( 2 , 6 - dimethylphenyl ) benzoisothiazolone ( 34 ) n -( 2 , 4 , 6 - trimethylphenyl ) benzoisothiazolone ( 35 ) n -( 3 , 4 - dimethoxyphenyl ) benzoisothiazolone ( 36 ) n -( 3 , 5 - dimethoxyphenyl ) benzoisothiazolone ( 37 ) n -( 3 , 4 , 5 - trimethoxyphenyl ) benzoisothiazolone ( 38 ) n -( 2 - chloro - 4 - methylphenyl ) benzoisothiazolone ( 39 ) n -( 2 - fluoro - 4 - chlorophenyl ) benzoisothiazolone ( 40 ) n -( 2 , 6 - dichloro - 4 - methylphenyl ) benzoisothiazolone ( 41 ) n -( t - butylphenyl ) benzoisothiazolone ( 42 ) n -( 2 , 6 - difluorophenyl ) benzoisothiazolone ( 43 ) n -( 4 - iodophenyl ) benzoisothiazolone ( 44 ) n -( 4 - chloro - 2 - methoxy - 5 - methylphenyl ) benzoisothia - zolone ( 45 ) n -( 2 , 4 - dichloro - 3 - methylphenyl ) benzoisothiazolone ( 46 ) n -( 4 - ethoxy - 3 , 5 - dichlorophenyl ) benzoisothiazolone ( 47 ) n -( 2 - chloro - 4 - methoxy - 3 - methylphenyl ) benzoisothia - zolone ( 48 ) n -( 4 - methoxy - 3 - chlorophenyl ) benzoisothiazolone ( 49 ) n -( 3 - chloro - 2 , 4 - difluorophenyl ) benzoisothiazolone ( 50 ) n -( 3 , 4 - diethoxyphenyl ) benzoisothiazolone ( 51 ) 4 - fluoro - n - phenylbenzoisothiazolone ( 52 ) 5 - fluoro - n - phenylbenzoisothiazolone ( 53 ) 6 - fluoro - n - phenylbenzoisothiazolone ( 54 ) 7 - fluoro - n - phenylbenzoisothiazolone ( 55 ) 4 - chloro - n - phenylbenzoisothiazolone ( 56 ) 5 - chloro - n - phenylbenzoisothiazolone ( 57 ) 6 - chloro - n - phenylbenzoisothiazolone ( 58 ) 7 - chloro - n - phenylbenzoisothiazolone ( 59 ) 4 - bromo - n - phenylbenzoisothiazolone ( 60 ) 5 - bromo - n - phenylbenzoisothiazolone ( 61 ) 6 - bromo - n - phenylbenzoisothiazolone ( 62 ) 7 - bromo - n - phenylbenzoisothiazolone ( 63 ) 6 - iodo - n - phenylbenzoisothiazolone ( 64 ) 4 - methyl - n - phenylbenzoisothiazolone ( 65 ) 5 - methyl - n - phenylbenzoisothiazolone ( 66 ) 6 - methyl - n - phenylbenzoisothiazolone ( 67 ) 7 - methyl - n - phenylbenzoisothiazolone ( 68 ) 6 - ethyl - n - phenylbenzoisothiazolone ( 69 ) 7 - propyl - n - phenylbenzoisothiazolone ( 70 ) 4 - methoxy - n - phenylbenzoisothiazolone ( 71 ) 5 - methoxy - n - phenylbenzoisothiazolone ( 72 ) 6 - methoxy - n - phenylbenzoisothiazolone ( 73 ) 7 - methoxy - n - phenylbenzoisothiazolone ( 74 ) 5 - ethoxy - n - phenylbenzoisothiazolone ( 75 ) 7 - isopropoxy - n - phenylbenzoisothiazolone ( 76 ) 4 - nitro - n - phenylbenzoisothiazolone ( 77 ) 5 - nitro - n - phenylbenzoisothiazolone ( 78 ) 6 - nitro - n - phenylbenzoisothiazolone ( 79 ) 7 - nitro - n - phenylbenzoisothiazolone ( 80 ) 5 , 7 - dinitro - n - phenylbenzoisothiazolone ( 81 ) 4 , 5 , 6 , 7 - tetrafluoro - n - phenylbenzoisothiazolone ( 82 ) 5 - chloro - 7 - fluoro - n - phenylbenzoisothiazolone ( 83 ) 5 - methoxy - 7 - chloro - n - phenylbenzoisothiazolone ( 84 ) 6 - chloro - n -( 4 - chlorophenyl ) benzoisothiazolone ( 85 ) 6 - chloro - n -( 2 , 3 , 4 - trichlorophenyl ) benzoisothiazolone ( 86 ) 5 - methyl - n -( 3 - fluorophenyl ) benzoisothiazolone ( 87 ) 6 - methoxy - n -( 4 - chloro - 2 - methylphenyl ) benzoisotia - zolone ( 88 ) 6 - methoxy - n -( 2 , 3 , 4 , 5 , 6 - pentachlorophenyl ) benzoiso - thiazolone ( 89 ) 7 - methyl - n -( 2 - methyl - 4 - chloro - 5 - methoxyphenyl )- benzoisothiazolone ( 90 ) 5 , 7 - dimethyl - n -( 2 - methyl - 4 - chloro - 5 - methoxyphenyl )- benzoisothiazolone______________________________________ the present invention will be further illustrated by the following examples , test examples and comparative examples , which are not to be construed to limit the scope thereof . unless otherwise indicated , the term &# 34 ; part ( s )&# 34 ; refers to part ( s ) by weight . specific examples of the compound ( i ) are designated by the respective compound numbers shown in table 1 . to each of the compound ( 1 ), ( 4 ), ( 8 ), ( 16 ), ( 57 ), ( 67 ), ( 72 ) and ( 80 ) were added the ingredients as shown in table 2 . these mixtures were independently mixed and dispersed with a paint conditioner , which afforded compositions of examples 1 - 9 . in the same manner , a composition of comparative example 1 was obtained . the trade names of the ingredients used are as follows : laroflex mp - 45 : vinyl chloride - vinyl isobutyl ether copolymer made by basf a . g ., in germany pliolite s - 5b : styrene - butadiene copolymer made by the goodyear co ., in the u . s . a . table 2__________________________________________________________________________ examples comparative 1 2 3 4 5 6 7 8 9 example__________________________________________________________________________ 1compound ( 1 ) 30 30compound ( 16 ) 30compound ( 4 ) 30compound ( 8 ) 30compound ( 57 ) 30compound ( 67 ) 30compound ( 72 ) 30compound ( 80 ) 30laroflex mp - 45 10 10 10 10 10 10 10 10 10pliolite s - 5b 10copper rhodanide 30red iron oxide 5 5 5 5 5 5 5 5 5 5zinc oxide 5 5 5 5 5 5 5 5 5 5aerozil # 200 1 1 1 1 1 1 1 1 1 1chlorinated paraffin 2 2 2 2 2 2 2 2 2 2rosin 10 10 10 10 10 10 10 10 10 10xylene 32 32 32 32 32 32 32 32 32 32methyl isobutyl ketone 5 5 5 5 5 5 5 5 5 5total 100 100 100 100 100 100 100 100 100 100__________________________________________________________________________ each of the coatings obtained in examples 1 - 9 and comparative example 1 was applied by means of an air spray to a sandblasted steel panel of 300 × 100 × 3 . 2 mm in size , which had been coated with a shop primer and an anti - corrosive paint of the vinyl tar type , in such a manner that a dry film of 100 μm in thickness was obtained . these sample panels were dried for 7 days , and immersed and left at rest in the sea off the coast of miyajima in the bay of hiroshima at hiroshima prefecture , and examined for the adhesion of harmful aquatic animals and plants as well as the adhesion of slime . the results are shown in table 3 . the amount of adhering harmful aquatic animals and plants in the table was evaluated as the percentage (%) of area to which they adhered , and the amount of adhering slime in the table was evaluated by the following criteria : 0 : no adhesion ; 1 : slight adhesion ; 2 : small adhesion ; 3 : moderate adhesion ; 4 : moderate to great adhesion ; and 5 : great adhesion . table 3__________________________________________________________________________ 6 months 12 months 18 monthsimmersion harmful harmful harmfulperiod aquatic aquatic aquaticadhering animals animals animalsobjects slime and plants slime and plants slime and plants__________________________________________________________________________example 1 0 0 1 0 2 0example 2 1 0 2 5 2 5example 3 2 0 2 5 3 15example 4 0 0 1 5 1 10example 5 1 0 1 0 2 0example 6 2 0 2 10 3 30example 7 1 0 2 5 2 15example 8 0 0 1 0 1 5example 9 1 0 1 5 2 5comparative 5 10 5 60 5 100example 1__________________________________________________________________________ various compositions containing the ingredients as shown in table 4 were obtained in the same manner as employed in examples 1 - 9 . for comparison , various compositions containing the ingredients as shown in table 5 were obtained in the same manner . table 4__________________________________________________________________________ examples 10 11 12 13 14 15 16 17 18__________________________________________________________________________compound ( 1 ) 5compound ( 16 ) 5compound ( 4 ) 5compound ( 8 ) 5 5compound ( 57 ) 5compound ( 67 ) 5compound ( 72 ) 5compound ( 80 ) 5laroflex mp - 45 10 10 10 10 10 10 10pliolite s - 5b 10 10cuprous oxide 30 30 20 20 20 30 30 30 30zinc dimethyldithiocarbamate 52 , 4 , 5 , 6 - tetrachloroisophthalonitrile 5n , n - dimethyl - n &# 39 ;-( 3 , 4 - dichlorophenyl ) urea 5red iron oxide 5 5 5 5 5 5 5 5 5zinc oxide 5 5 5 5 5 5 5 5 5aerozil # 200 1 1 1 1 1 1 1 1 1chlorinated paraffin 2 2 2 2 2 2 2 2 2rosin 10 10 10 10 10 10 10 10 10xylene 27 27 32 32 32 27 27 27 27methyl isobutyl ketone 5 5 5 5 5 5 5 5 5total 100 100 100 100 100 100 100 100 100__________________________________________________________________________ table 5______________________________________ comparative examples 2 3 4______________________________________laroflex mp - 45 10pliolite s - 5b 10 10cuprous oxide 30 30copper rhodanide 20zinc dimethyldithiocarbamate 10red iron oxide 5 5 5zinc oxide 5 5 5aerozil # 200 1 1 1chlorinated paraffin 2 2 2rosin 10 10 10xylene 32 32 32methyl isobutyl ketone 5 5 5total 100 100 100______________________________________ the compositions obtained in examples 10 - 18 and comparative examples 1 - 4 were examined in the same method as used in test example 1 . the results are shown in table 6 . table 6__________________________________________________________________________ 6 months 12 months 18 monthsimmersion harmful harmful harmfulperiod aquatic aquatic aquaticadhering animals animals animalsobjects slime and plants slime and plants slime and plants__________________________________________________________________________example 10 1 0 1 0 2 0example 11 1 0 1 0 2 0example 12 2 0 3 0 3 5example 13 1 0 2 0 2 0example 14 0 0 1 0 2 0example 15 2 0 3 0 3 10example 16 1 0 2 0 2 0example 17 0 0 1 0 2 0example 18 1 0 1 0 2 0comp . ex . 1 5 10 5 60 5 100comp . ex . 2 5 0 5 10 5 30comp . ex . 3 5 0 5 10 5 30comp . ex . 4 3 0 5 30 5 60__________________________________________________________________________ the compositions obtained in examples 1 - 4 , 10 - 13 and comparative examples 2 - 4 were used for the test in which they were actually applied in a patch on to the bottoms of small fishing boats working in three sea areas of nagasaki prefecture , hiroshima prefecture and niigata prefecture . after the lapse of 6 months , the adhesion of harmful aquatic animals and plants as well as the adhesion of slime were evaluated in the same manner as described in test example 1 . the results are shown in table 7 . the symbol &# 34 ;-&# 34 ; in the table refers to no execution of the test . table 7__________________________________________________________________________ nagasaki hiroshima niigataimmersion harmful harmful harmfulplace aquatic aquatic aquaticadhering animals animals animalsobjects slime and plants slime and plants slime and plants__________________________________________________________________________example 1 -- -- 0 0 0 0example 2 -- -- 0 0 0 0example 3 -- -- 1 0 0 0example 4 -- -- 0 0 0 0example 10 0 0 0 0 -- -- example 11 0 0 1 0 -- -- example 12 1 0 2 0 -- -- example 13 0 0 0 0 -- -- comp . ex . 2 5 0 5 0 5 0comp . ex . 4 -- -- 5 10 4 5__________________________________________________________________________ as described above , the compound ( i ) has an excellent effect on the prevention and inhibition of harmful aquatic organisms adhering to water - exposed articles , and such an effect can be retained for a long period of time . accordingly , the compound ( i ) can find various applications in the form of a controlling agent or antifouling composition against harmful aquatic organisms . | 2 |
with reference to fig1 and 2 , the optical transceiver connection module 100 in the first embodiment has a receptacle 200 and a housing 300 for accommodating an optical transceiver ( now shown ). the receptacle 200 is of the lc type . its input terminal 210 is for the connection of the connector 410 of an optic cable 400 . the connector 410 is also an lc - type fiber connector compatible with the receptacle . the output terminal 220 has two parallel trapezoid grooves 221 , two stop parts 222 , and a through hole 223 . the two grooves 221 and the two stop parts 222 roughly form a rectangle . the through hole 223 allows multiple optic fibers 420 wrapped inside the optic cable 400 to pass through . it is connected to the photo sensor on the circuit board in the optical transceiver . the housing 300 consists of a first cover 310 and a second cover 320 to accommodate all elements ( not shown ) of the above - mentioned optical transceiver . the corresponding sides of the first cover 310 and the second cover 320 have a u - shape protruding tracks 330 , which also have trapezoid cross sections to match with the grooves 221 on the receptacle 220 . the two covers 310 , 320 have an opening 340 on the inner side for the optic fibers 420 to go through . the first cover 310 has two hook arms 311 on opposite sides and extending toward the second cover 320 . the end of each of the hook arms 311 has a hook 312 . the second cover 320 is formed with hook holes 321 corresponding to the hooks 312 . the first cover 320 is further formed with pins 313 extending toward the second cover 320 . correspondingly , the second cover 320 has a pinhole 322 . the back end of the second cover 320 also has a hook arm 323 extending toward the first cover 310 . the end of the hook arm 323 is also a hook . a hook hole 314 corresponding to the hook arm 323 is formed on the first cover 310 . the elements described in the above paragraph are combined in the following manner . the first cover 310 and the second cover 320 are combined with the receptacle 200 by aligning the u - shape protruding tracks 330 with the grooves 221 on the output terminal 220 . finally , the inner sides of the closing ends of the two u - shape protruding tracks 330 touch the stop parts 222 of the receptacle 200 . since the grooves 221 and the protruding tracks 330 have matching trapezoid cross sections , the first and second covers 310 , 320 and the receptacle 200 can be tightly combined and will not depart along the axial direction of the optic fibers 420 . at the same time , the pin 313 on the first cover 310 , the hooks 312 of the hook arms 311 , and the hook holes 314 combine with the hook holes 321 , the pinhole 322 , and the hook arm 323 on the second cover 320 . in practice , one needs to finish the connection between the optic fibers 420 and the photo sensor on the circuit board of the optical transceiver inside the housing 300 before assembly . moreover , there are many other choices for combining the first and second covers 310 , 320 in the prior art . a connection module 500 for optical transceivers provided in the second embodiment of the invention is shown in fig3 . the housing 530 is exactly the same as in the previous embodiment . the only difference is that the receptacle 510 is the sc type ( the connector 520 connected with the input terminal is the same ). the output terminal 511 of the receptacle 510 also has two parallel grooves 513 with trapezoid cross sections , two parallel stop parts 514 , and a through hole 515 . the two grooves 513 and the two stop parts 514 also roughly form a rectangle . therefore , it is assembled in exactly the same way as the first embodiment . likewise , the third embodiment of a connection module 600 for optical receptacles shown in fig4 is only different from the above - mentioned ones in that the receptacle 610 ( including the connector 620 ) is replaced with a mu type one . the output terminal 611 of the receptacle 610 also has two parallel grooves 612 with trapezoid cross sections , tow parallel stop parts 613 , and a through hole 614 . the two grooves 612 and the two stop parts 613 also roughly form a rectangle . therefore , the first cover 631 and the second cover 632 can be combined into the housing 630 in the same way as the first embodiment . as disclosed in the above three embodiments , the invention utilizes the design of two separate covers and a u - shape protruding tracks to make an optical transceiver compatible with the lc , sc , and mu connectors or other small - form - factor ( sff ) standards , such as mt - rj ( amp , inc .) and vf - 45 ( 3m , inc .). moreover , both single - mode and multiple - mode optic fibers can be used with the invention . furthermore , the positions of the protruding tracks and the grooves can be mutually interchanged . for example , the connection module 700 of the fourth embodiment shown in fig5 has the two parallel grooves on the housing 710 , while the parallel protruding tracks 721 are designed on the receptacle 720 . the cross sections of the grooves 711 and the protruding tracks 721 are matching trapezoids . based upon the techniques of the invention , the connection port of a normal optical transceiver housing is singled out as a receptacle . the housing is separated into independent first cover and second cover , which have matching connection parts . the connection port of the receptacle can be of any standard , and the receptacle of any standard has the same matching part so as to combine with the first and second covers . while the invention has been described by way of example and in terms of the preferred embodiment , it is to be understood that the invention is not limited to the disclosed embodiments . to the contrary , it is intended to cover various modifications and similar arrangements as would be apparent to those skilled in the art . therefore , the scope of the appended claims should be accorded the broadest interpretation so as to encompass all such modifications and similar arrangements . | 6 |
in the following detailed description of the present invention , a method for optimizing body bias connections in a cmos circuit using a deep n - well grid structure , numerous specific details are set forth in order to provide a thorough understanding of the present invention . however , it will be obvious to one skilled in the art that the present invention may be practiced without these specific details . in other instances well known methods involving photolithography , ion implantation , deposition and etch , etc ., and well known structures such as ohmic contacts and barrier metallization , etc ., have not been described in detail so as not to unnecessarily obscure aspects of the present invention . fig2 a shows a plan view of an exemplary deep n - well grid structure 200 . for purposes of this disclosure a grid structure ( or grid ), is a planar sheet of semiconductor material with a regularly spaced rectangular array of apertures . although the regular spacing of apertures in the grid structure reduces the flexibility of the grid layout , it greatly simplifies the task of producing the layout . in view of the challenge in obtaining body biasing for all pfets using a buried deep n - well , the overall task of circuit and deep n - well layout is optimized by using a grid that is computationally efficient , and focusing on making the best use of the pfets that can be body biased . in the example embodiment shown , the apertures 205 of the grid 200 are approximately square with a dimension w . the apertures are separated by a web with a dimension t . dimensions w and t represent the minimum dimensions for the aperture and web , respectively , and are a function of the depth at which the grid 200 is formed in a substrate . the percentage of the grid area that is taken up by the apertures is preferably between 40 % and 60 % in one implementation , but could vary . this area distribution between the grid web and apertures provides for a balanced body biased connection for the pfets and nfets . the aperture may also have a shape that is rectangular , round , or oblong . the preferred method for forming the grid is through ion implantation , with or without a subsequent thermal diffusion step . annealing may be obtained through the thermal budget for other processing steps . fig2 b shows a cross - section elevation view of a deep n - well grid structure 200 situated in a p - type substrate 210 at a depth d . as described above , the values for w and t are functions of the depth d . this is due to the thickness of the resist that is used on the surface of the substrate 210 to define the pattern for the grid 200 . the greater the depth d at which the grid 200 is implanted , the greater the resist thickness required for pattern masking during implant . since thin resist patterns provide finer resolution than thick resist structures , the minimum feature size w and t for the implanted grid structure increases with increasing depth d . within the constraints for the achievable feature size for a grid at a particular depth , the grid dimensions are preferably selected to balance the impact of the resistance of the web and the aperture . if too much of the grid area is dedicated to apertures , the reduced web of the grid will result in too much resistance in the pfet bias path . conversely , if too little area is provided for the apertures , the bias path resistance of the nfets will be too large . in addition to the effects of resist thickness , scattering of the ion beam by the substrate lattice also contributes to a spreading between the aperture 205 and the grid 200 . this spreading of the doping profile at the interface contributes to an increase in the critical dimensions for the web and aperture since the less abrupt p - n junction increases the depletion region width at the interface . fig3 a shows a plan view of a substrate 210 with a deep n - well grid structure 200 and a misregistered surface n - well 215 . since the achievable feature dimension for surface n - wells is smaller than that achievable for a deep n - well , the minimum spacing between surface n - wells will be smaller than the minimum spacing between web regions , to which contact is desired . for a dense array of surface n - wells with a small pitch , it is inevitable that misregistration will occur between a portion of the surface n - wells and the grid . misregistration is the condition in which a surface n - well 215 achieves a partial overlap with the grid 200 , but the overlap is insufficient to establish a reliable electrical connection . the overlap between the surface n - well 215 and the grid 200 should be sufficient to provide a low resistance contact under both unbiased and biased operation . under bias , the expansion of the p - n junction depletion region should not produce a significant effect on the contact resistance . in order to resolve the ambiguity of a misregistered n - well , the n - well may be isolated by excising a portion of the grid by masking , or by relocating the n - well . relocation of the n - well may be done to establish sufficient overlap with the grid , or it may be done to isolate the n - well . in an embodiment of the present invention it is not necessary to connect all n - wells to the dnw grid , provided three conditions are met : 1 ) the isolated n - wells remain connected to v dd as before ; 2 ) the transistors in these wells represent a negligible fraction of the total leakage width ; and 3 ) the circuits using these transistors are robust enough to function properly even though their thresholds are not adjustable . in a retrofit design , n - wells may be unreachable from a global dnw mesh structure , in which case their n - wells can be left connected to v dd . n - wells may be unreachable because access is blocked by n - wells at a different potential or the target n - well is small and misregistered to the dnw mesh . if only some n - wells can be connected but not others then the connections can be prioritized . robustness may be an issue because one purpose of connecting n - wells with dnw is to lower the transistor thresholds to achieve higher performance . lowering thresholds can compromise functionality unless the thresholds can be tuned or the circuits are sufficiently robust . alternatively , misregistered n - wells may be implanted in a separate process from body biased n - wells in order to achieve vertical isolation without relocation . shallow isolated surface n - wells will have the greatest disparity in critical feature size with respect to the deep n - well grid structure . fig3 b shows a cross - section elevation view of substrate 210 and the deep n - well grid structure 200 with the misregistered surface n - well 215 of fig3 a . fig4 a shows a plan view of a deep n - well grid 200 structure and an isolated surface n - well 220 . the n - well 220 may be isolated as a result of the initial circuit layout , or it may be isolated in order to resolve misregistration in the initial layout . isolated n - wells are n - wells that are sufficiently separated from the grid 200 , so that they are unaffected by the body bias potential applied to the grid 200 . fig4 b shows a cross - section elevation view of substrate 210 and the deep n - well grid structure 200 with the isolated surface n - well 220 of fig4 a . it should be noted that although a deep n - well may be provided with apertures of varying sizes and spacings in an attempt to reduce misregistration and isolation , misregistration and isolation of n - wells in a dense circuit cannot be entirely eliminated due to the disparity in the critical dimensions between surface features and the achievable features for a perforated deep n - well . in the present invention , the inevitable isolation of a portion of the surface n - wells that results when a deep n - well is used for body biasing can be dealt with by allocating the available area for grid connection to specific types of transistors . fig4 c shows a plan view of an aperture 205 in the deep n - well grid structure and a buffer region 207 separating a connection region 208 from an isolation region 206 . the buffer region 207 ensures that an n - well will provide sufficient connection or isolation as required . the buffer region is useful for the layout of surface n - wells that have a critical dimension that is significantly smaller than the critical dimension of the grid structure . fig4 d shows a cross - section elevation view of connected n - wells 230 and unconnected n - wells 240 . the connected n - wells 230 contain transistors 235 that have a higher priority than the transistors 245 contained in the isolated n - wells 240 . body bias may be provided to transistors 235 through the grid 200 . nfets 255 may be body biased through the bulk substrate 210 . fig5 shows a process flow diagram 500 for a computer implemented method of optimizing body bias connections in a cmos circuit using a deep n - well grid structure in accordance with an embodiment of the present claimed invention . in the method of fig5 , the grid layout is determined independently from the circuit layout , and is a fixed constraint in one embodiment . the aperture area as a percentage of the grid is preferably between 40 % and 60 %. in step 505 , the physical layout for a deep n - well grid structure is performed . the grid layout is typically done using the smallest feature size attainable in order to maximize the probability of connection with the n - wells . in step 510 , the allowable site area for body biased n - wells is determined . the substrate surface is essentially divided into regions that are classified as connected or isolated , and the connected and isolated regions are separated by a buffer region that n - wells are not permitted to infringe . the buffer region ensures the connection or isolation of the surface n - wells . this method is predicated on a single mask for implanting the n - wells in step 515 , the pfets in the cmos circuit are prioritized for placement in the connected region and the isolated region . therefore , not all transistors may be body biased by the grid , in accordance with the prioritization . the factors that may be used to assign priority may include participation in a critical path in the circuit , voltage scalability , and power dissipation . prioritization may also be done on the basis of the effects of leakage current anticipated by modeling of the transistors in the circuit . in general , the priority for body biasing is related to the performance required of the transistor and the relationship of the performance level to the threshold voltage of the transistor . for example , with all other factors being equal , a transistor located in a critical path in a circuit block would be given priority over another transistor in the block that was not in the critical path . the priority level would in turn translate into a higher likelihood of the transistor being connected to the body bias grid . in step 520 , the circuit layout is performed , with the highest priority pfets being placed in the available n - wells in the connected region . for example , the placement of the pfets may be done by performing the initial layout without regard to priority , and then swapping the highest priority pfets that are not in the connected region with their nearest neighbors with lower priority that are in the connected region . in some cases , the lowest priority transistors may not be coupled to the body bias grid . fig6 shows a process flow diagram 600 for an alternative computer - implemented method embodiment that does not require a layout buffer region , but relies on two implant masks for the surface n - wells . in this process , a higher device density is obtained at the expense of a second well implant step . in step 605 , the layout for a deep n - well grid structure is performed . the grid layout is typically done using the smallest feature size attainable in order to maximize the probability of connection with the n - wells . in step 610 , the allowable site area for body biased n - wells is determined . the substrate surface is essentially divided into regions that are classified as connected or isolated . the n - wells that are ultimately placed in the connected region are designated for a deep implant , and the n - wells that are placed in the isolated region are designated for a shallow implant , with two masks being used for the overall well implant . in step 615 , the pfets in the cmos circuit are prioritized for placement in the connected region and the isolated region . the factors that may be used to assign priority may include participation in a critical path in the circuit , voltage scalability , and power dissipation . prioritization may also be done on the basis of the effects of leakage current anticipated by modeling of the transistors in the circuit . in step 620 , the circuit layout is performed , with the highest priority pfets being placed in the available n - wells in the connected region . for example , the placement of the pfets may be done by performing the initial layout without regard to priority , and then swapping the highest priority pfets that are not in the connected region with their nearest neighbors with lower priority that are in the connected region . in some cases , the lowest priority transistors may not be coupled to the body bias grid . fig7 shows a process flow diagram 700 for a computer implemented method of optimizing body bias connections in a cmos circuit using an adaptive deep n - well grid structure . in the embodiments shown in fig5 and fig6 , the location of the transistors in the layout may be modified in order to provide optimum body biasing . in the method shown in fig7 , the circuit layout is fixed , and the grid layout is adjusted to provide the optimum body biasing . in step 710 , the circuit layout is performed , with the n - well locations being determined . in step 715 , the pfets in the cmos circuit are prioritized with respect their requirement for body biasing . the factors that may be used to assign priority may include participation in a critical path in the circuit , voltage scalability , and power dissipation . prioritization may also be done on the basis of the effects of leakage current anticipated by modeling of the transistors in the circuit . depending upon the circuit , one or more factors may be used . each pfet in the layout may be assigned a score or ranking that is a weighted sum of the factors being considered . a factor may be excluded by giving it a weight of zero . in step 720 , grid parameters are selected from a set of parameters that are bounded by the minimum web dimension t , the minimum aperture dimension w and the aperture area percentage range of 40 % to 60 %. in step 725 , the grid is aligned with respect to the circuit layout at a position selected from a set of positions within a fixed area . the fixed area is typically a rectangular area that is sufficiently large to encompass all possible unique positions for the grid with respect to the circuit layout . due to the periodic structure of the grid , the fixed area is typically less than 3 times the aperture area . in step 730 , the circuit layout / grid alignment is inspected to determine how many of the pfets are in wells that are positioned so as to permit body biasing by the grid . the scores of the pfets that are so positioned are summed to provide a grid layout score for the combination of grid parameters and position . in step 735 , a check is made to see if the set of possible grid positions has been exhausted . if the set has not been exhausted , then step 725 is repeated . if the set of possible grid positions has been exhausted , then step 740 is executed . in step 740 , a check is made to see if all combinations of grid parameters in the set has been exhausted . if all combinations have not been exhausted , then step 720 is repeated . if all combinations in the set have been exhausted , then step 745 is executed . in step 745 , the grid layout is performed using the grid dimensional parameters and alignment position that totaled the best score . fig8 shows a process flow diagram 800 for a computer implemented method of implementing a partial deep n - well grid in a circuit design in accordance with an embodiment of the present invention . at step 805 the process is started . at step 810 , a netlist for an integrated circuit design including transistors is accessed . an example of an integrated circuit design is a logic circuit using cmos transistors . at step 815 , a first set of transistors belonging to the circuit design is determined . the first set of transistors is a set of transistors that may be connected to a deep n - well grid . at step 820 , a second set of transistors is identified . the second set of transistors is a set of transistors that may not be connected to the deep n - well grid . different criteria may be used to determine which transistors are to be included in the second set . examples of criteria are design rule violations , inapplicability , electrical constraints , undesired performance reasons , etc . the layout of surface n - wells and deep n - wells may preclude a connection between an particular surface n - well and a particular deep n - well . an n - well containing a transistor may be too close to a deep n - well at another potential . a surface n - well surrounded by other surface n - wells at different potentials may be isolated from the deep n - well grid , or the connection path available may have an unacceptably high resistance . at step 825 , the first set of transistors in the design is connected to the deep n - well grid . at step 830 , the second set of transistors is not connected to the grid . at step 835 , the netlist for the integrated circuit design including connections between the first set of transistors and the grid is supplied for further processing , e . g ., circuit fabrication , testing , design work , etc . at step 840 the process is done . fig9 is a block diagram of an exemplary computer system 900 , which may be used as a platform to implement embodiments in accordance with the present invention . computer system 900 is a general purpose computer system , as is well known in the art . the foregoing descriptions of specific embodiments of the present invention have been presented for purposes of illustration and description . they are not intended to be exhaustive or to limit the invention to the precise forms disclosed , and obviously many modifications and variations are possible in light of the above teaching . for example , there are many combinations of the parameters for the implant and anneal process steps , and their sequencing , that may be used to produce the structures described herein . the embodiments were chosen and described in order to best explain the principles of the invention and its practical application , to thereby enable others skilled in the art to best utilize the invention and various embodiments with various modifications are suited to the particular use contemplated . it is intended that the scope of the invention be defined by the claims appended hereto and their equivalents . | 6 |
fig1 shows , in cross section , a commercially available extruded tube 10 which may be cut to a desired length , sealed at either end , as by crimping and / or welding , and injected with a suitable coolant or working fluid to form a heat pipe . a vapor flow channel 12 is enclosed by the wall of the tube 10 , while a plurality of capillary or fluid flow channels 14 are formed within the wall itself . each channel 14 is defined by an adjacent pair of parallel ribs 16 projecting inwardly toward the central vapor flow channel 12 . a plurality of re - entrant groove openings 18 in one - to - one correspondence with channels 14 provide communication between channels 14 and channel 12 . each rib 16 has a rounded head portion 20 which is relatively thicker than the rib &# 39 ; s base portion 22 , resulting in a re - entrant profile wherein openings 18 are narrower than capillary channels 14 . fig2 and 3 show partial cross sections of a heat pipe 24 formed from a tube 10 which has been modified according to the present invention . as modified , each rib 16 includes a pair of transverse fins 26 projecting from opposite sides of head portion 20 . each adjacent pair of ribs 16 thus includes a facing pair of transverse fins 26 which project toward each other . each transverse fin 26 provides a flat sloping surface 28 extending from inner surface 30 of associated rib 16 to a tip 32 of the fin . the resulting re - entrant groove profile includes modified , narrowed groove openings 34 with convergent entrances 36 . each facing pair of transverse fins 26 borders an associated opening 34 , while the sloping surfaces 28 of a facing pair of fins define the convergent entrance 36 to the associated channel 14 . according to the present invention , the convergent re - entrant groove profile is achieved by modifying the commercially available , extruded tube 10 of fig1 . fig4 and 5 illustrate a tool 38 which may be used to modify the groove profile of tube 10 . as seen in fig5 tool 38 comprises a mandrel 40 and a draw bar 42 . mandrel 40 includes a forward supporting section 44 and threaded hollow for engagement on threaded end 46 of draw bar 42 . the length of draw bar 42 should be at least greater than the length of tube 10 to be operated on . the periphery of mandrel 40 includes a plurality of axial , v - shaped spines 48 corresponding to grooves 18 on tube 10 . the apex angle α of spines 48 corresponds to a desired convergent entrance angle α &# 39 ; in the modified groove profile ( fig4 ). if a different profile of convergent entrance 36 is desired , the shape of spines 48 is chosen accordingly . fig4 a , for example , shows a slightly varied mandrel 40a in which the troughs 49 between spines 48a are curved , the radius of curvature increasing from the midpoint of each trough to flat portions 50 of each spine . a chamfer 51 ( fig5 ) is provided at the forward end of the spine section for proper engagement and alignment with grooves 18 . modification of the virgin extrusion is accomplished by inserting draw bar 42 into a desired length of tube 10 so that the draw bar extends beyond either end of the tube &# 39 ; s length . splines 48 on mandrel 40 and groove openings 18 on tube 10 are next aligned with each other by rotating tool 38 relative to the tube . it should be obvious that draw bar 42 may be inserted into tube 10 prior to attaching mandrel 40 , in which case the draw bar may be inserted either end first . when the mandrel and tube are properly aligned , mandrel 40 is drawn through tube 10 by forcing end 52 of draw bar 42 axially away from tube 10 . as mandrel 40 passes through tube 10 , material from the rounded head portion 20 of each rib 16 is forced inward toward capillary channels 14 to form transverse fins 26 . this material displacement results in re - entrant groove openings 34 with widths on the order of 0 . 001 to 0 . 004 inches . attempts in the past to produce such narrow re - entrant grooves by direct extrusion have generally been unsuccessful , because the extrusion die is necessarily thin and hence very fragile at the points corresponding to the re - entrant grooves . the heat and pressure exerted on the die during the extrusion process has inevitably resulted in the die &# 39 ; s fracturing before any useful length of pipe can be produced . by contrast , the present method may be used to produce relatively long ( greater than one or two feet ), single - piece tubes having relatively narrow ( less than 0 . 004 in .) groove openings which have heretofore been unavailable in the art . because the desired length of tube may be produced in a single piece , there is no need to splice smaller lengths together , a process involving considerable expense and loss of efficiency in the resulting heat pipe . the operation of heat pipe 24 is shown schematically in fig6 . structurally , heat pipe 24 is a sealed chamber formed from a modified length of re - entrant groove tube in the same manner as prior art heat pipes would be formed from virgin extrusions . the heat pipe 24 is positioned so that one end , the evaporator 54 , is located in a heat source region 56 and the other end , condenser 58 , is in heat sink region 60 . heat is absorbed as indicated by arrows 62 , conducted through transport region 64 , which may be insulated , and heat is given off as indicated by arrows 66 . absorption of thermal energy in the evaporator 54 causes evaporation of a working fluid 68 ( fig2 ) while condensation of vaporized working fluid 70 in the condensor section 58 effects a release of thermal energy ( fig3 ). vapor channel 12 serves to conduct vaporized fluid 70 from evaporator 54 to condenser 58 , and capillary channels 14 bring condensed fluid 68 from the condenser back to the evaporator . arrows 72 and 74 ( fig6 ) indicate the direction of vapor and fluid flow through the heat pipe 24 . while fig6 illustrates the case where heat is conducted from a higher heat source to a relatively lower heat sink , as indicated by adverse tilt h , heat pipes constructed according to the present invention could also be used to conduct heat from a relatively lower source to a higher sink . in this latter situation , gravity would tend to assist the flow of condensed working fluid . otherwise , the utility of the heat pipe is limited by its static wicking height , which is the maximum adverse tilt , or vertical difference separating a higher source from a lower sink , at which the heat pipe will operate . unmodified ( virgin extruded aluminum ) heat pipes have been shown to have static wicking heights of 0 . 6 in ., using ammonia as the working fluid , while heat pipes constructed according to the present invention , using the same working fluid , have displayed static wicking heights of 1 . 8 in . this increase in static wicking height afforded by the present invention is made possible in part by the narrowed groove openings , which allow a more complete enclosure of capillary channels 14 and a concurrent increase in the surface area over which capillary action may occur . referring to fig2 working fluid 68 is seen to form a concave meniscus 76 in each convergent entrance 36 in evaporator section 54 . it is at the tips 78 of each meniscus that working fluid layer is thinnest . as is known in the art , heat transfer is improved by providing a thin layer of working fluid , because heat must pass through the working fluid to cause evaporation at the surface , and working fluids generally exhibit a much lower thermal conductivity than the material from which the wall of a heat pipe is formed . thus it becomes obvious that the heat transfer properties of the present invention may be altered by adjusting the convergent entrance angle α &# 39 ;, which conforms to the apex angle of the splines 48 of mandrel 40 , to better approximate a tangent to the meniscus of working fluid in the evaporator . splines 48 could also be made in other than a v - shape , to allow greater conformance with meniscus 76 . similary , angle α affects the flow of condensed working fluid into groove openings 34 . as seen in fig3 vaporized fluid 70 condenses on surfaces 30 in the condenser section 58 , and is urged by capillary action along sloping surfaces 28 toward groove openings 34 . by conducting the condensed working fluid away from surfaces 30 more efficiently , the present invention affords improved heat transfer in the condenser section . even further advances in condenser efficiency may be obtained by precisely controlling the profile of inner surfaces 30 . as in the evaporator , condenser heat transfer will be improved by providing thin condensation films , since heat from the vapor must be conducted through the film to surfaces 30 . also , an increasing radius of curvature from the midpoint of each surface 30 results in a capillary pumping action of the condensed working fluid toward the re - entrant grooves . both of these effects may be achieved by using a mandrel such as that of fig4 a which contacts the the entire surface of each rib between the re - entrant grooves during modification . nevertheless , it has been found that , using a mandrel having simple v - shaped splines with an apex angle of about 110 ° to modify according to the present invention an extruded aluminum tube having 20 re - entrant grooves and an inside diameter of about 0 . 4 in ., heat pipes made from such modified tubes exhibit the following improved characteristics over heat pipes made from the same tubing without such modification ( both using ammonia as the working fluid ): ______________________________________ unmodified modified according ( prior art ) to present inventionstatic wicking height 0 . 6 in . 1 . 8 in . ______________________________________heat evaporator 2000 7900transfer ( w / m . sup . 2 ° c . ): condenser 5400 14 , 000______________________________________ while the foregoing example is a specific illustration of the improvements occasioned by use of the present invention , it is not intended to be limiting . thus , one skilled in the art will realize that the selection of a working fluid , the number of capillary channels , the diameter of the tube , and the angle and / or shape of the convergent entrance may be varied according to a particular application , without departing from the spirit of the present invention , the scope of which is defined by the claims which follow . | 5 |
referring initially to fig1 , the reference numeral 10 refers , in general , to a vibrating screen separator assembly that includes a frame , or bed 12 , that includes a bottom wall 14 having an opening ( not shown ), a pair of side walls 18 and 20 , and a cross support member 24 coupled between the walls 18 , 20 . actuator 34 and 36 , respectively for imparting motion to the bed 12 are also coupled to the support member 24 . a flow box 16 is located at a feed end 22 of the shaker bed 12 to direct solid - bearing drilling mud to the screens 26 , located therein . a slide 28 may be located at the discharge end 30 of the shaker bed 12 to direct separated solids to a collection area ( not shown ). the shaker 10 may be mounted to a skid 32 to facilitate transport of the shaker 10 to the drill site as well as to aid in the positioning and relocation of the shaker 10 within the drill site . referring to fig2 , the lift system 40 includes a lift control assembly 42 , a hydraulic tank 44 , a first bellow 46 , and a second bellow 48 . the first and second bellows 46 , 48 are located near opposing corners 50 , 52 of the discharge end 30 of the shaker bed 12 ( shown in fig1 ). a shroud 54 is mounted to each of the first and second bellows 46 , 48 to help protect them from damage . an adapter plate 56 mounted to each shroud 54 attaches to an adjacent side wall 18 , 20 near the discharge end 30 of the shaker separator 10 . in one embodiment , shown in fig2 , the lift control assembly 42 is located at the discharge end 30 of the shaker bed 12 and the hydraulic tank 44 is shown to be at the feed end 22 of the shaker bed 12 . however the location of the lift control assembly 42 and the hydraulic tank 44 may be varied such that the lift control assembly 42 is located anywhere along the perimeter of the shaker assembly 10 where it is reachable by an operator and the hydraulic tank 44 is located in such proximity to first and second bellows 46 and 48 that fluid communication may reasonably be maintained between the hydraulic tank 44 and the bellows 46 , 48 . the lift control assembly 42 is operable to control pressurized air to and from the hydraulic tank 44 as well as to control communication of fluid between the hydraulic tank 44 and each of the bellows 46 , 48 . as will be described , the lifting system 40 utilizes an air over fluid hydraulic system to raise and lower the discharge end 30 of the shaker bed 12 , thereby providing a range of incline to the bed 12 of the shaker separator 10 . the hydraulic tank 44 is provided with a predetermined amount of liquid . in one embodiment , the liquid is water , such as when the shaker separator 10 is to be operated in temperatures where the water will not freeze . in one embodiment , the liquid is a fluid having an hydraulic fluid having a freezing point low enough for use in cold climates . a pneumatic line 72 directs air into the hydraulic tank 44 from the lift control assembly 42 . a first hydraulic line 80 directs the liquid to the bellows 46 , 48 . the flow through the first hydraulic line 80 is controlled by the lift control assembly 42 . thus , there is not a continuously open flow line between the hydraulic tank 44 and the bellows 46 , 48 . referring to fig3 and 4 , the lift control assembly 42 includes an air inlet 62 into which pressurized air is fed . the pressurized air is provided to a first valve 64 via a first pneumatic line 66 and to a second valve 68 via a first pilot line 70 . the first valve 64 is connected to a second pneumatic line 72 leading to the hydraulic tank 44 . a third valve 74 has an actuator 76 that is connected via a second pilot line 78 to the second valve 68 . the third valve 74 opens and closes a pathway between a first hydraulic line 80 from the hydraulic tank 44 and a hydraulic junction 82 providing liquid to second and third hydraulic lines 84 , 86 leading to the first and second bellows 46 , 48 . the lift control assembly 42 is discussed in further detail below . fluid to the first bellow 46 is provided through second hydraulic line 84 while fluid to the second bellow 48 is provided through third hydraulic line 86 . the second and third hydraulic lines 84 , 86 are connected to the hydraulic junction 82 in parallel such that , when the third valve 74 is open , liquid is communicated to the first and second bellows 46 , 48 simultaneously . further , when the third valve 74 is closed , the liquid may be communicated between the first bellow 46 and the second bellow 48 via the second and third hydraulic lines 84 , 86 . continuing to refer to fig2 - 4 , air from a pressurized air supply 88 enters the lift control system 40 through the air inlet 62 . a pressure regulator 90 is preferably included at the inlet 62 to provide an air stream at a predetermined pressure to the system . the preferred pressure will depend upon the weight to be lifted and the physical properties of the liquid to be communicated between the hydraulic tank 44 and the first and second bellows 46 , 48 at within the anticipated ambient operating conditions . a pressure gauge 92 is preferably included along the second pneumatic line 72 between the first valve 64 and the hydraulic tank 44 to use in the adjustment of the pressure regulator 90 . air from the pressure regulator 90 is provided to the first valve 64 through the first pneumatic line 66 and to the second valve 68 through the first pilot line 70 . the first valve 64 can be toggled between two positions , corresponding to raising and lowering the discharge end 30 of the shaker bed 12 . further , the first valve 64 is a three - way valve , that is there are three ports into or out of which air may be directed . in a first position , corresponding to the operation of raising the discharge end 30 , the pressurized air from the regulator 90 enters one port of the first valve 64 and exits a second port of the first valve 64 , which port directs the air to the second pneumatic line 72 and the hydraulic tank 44 . in a second position of the first valve 64 , corresponding to the operation of lowering the discharge end 30 , air , displaced by fluid forced back into the hydraulic tank 44 , is forced from the hydraulic tank 44 through the second pneumatic line 72 to the first valve 64 is vented through a third port of the first valve 64 . in one embodiment , the first valve 64 is a three - way , two position ball valve . in one embodiment , the second valve 68 is biased to a closed position such that the pressurized air from the first pilot line 70 is not directed to the second pilot line 78 unless the second valve 68 is manually actuated . while in the normally closed position , the second valve 68 provides a vent for air in the second pilot line 78 . upon actuation of the second valve 68 , the pressurized air from the first pilot line 70 is directed to the second pilot line 78 . air directed through the second pilot line 78 provides communication to the actuator of the third valve 74 , thereby actuating the third valve 74 when the second valve 68 is actuated . in one embodiment , the second valve 68 is a signal valve . the third valve 74 is biased to a closed position thereby preventing communication of liquid through the first hydraulic line 80 to the hydraulic junction 82 . as previously explained , when the third valve 74 is actuated , fluid flow between the hydraulic tank 44 and the first and second bellows 46 , 48 is open . in one embodiment , the third valve 74 is a two - way ball valve . referring to fig2 , 3 , and 6 , to operate the lifting system 40 , an operator will position the first valve 64 in a desired position corresponding to whether the shaker discharge end 30 will be raised or lowered . to lift the discharge end 30 of the shaker separator 10 , the operator will place the first valve 64 in a corresponding position using a handle , knob , or other such operator interface . air from the air supply 88 as regulated by the pressure regulator 90 is directed through the first valve 64 to the hydraulic tank 44 . so long as the third valve 74 is closed , communication of fluid from the hydraulic tank 44 to the first and second bellows 46 , 48 is prevented and the shaker 10 will maintain its initial incline . to raise or lower the discharge end 30 , the operator actuates the second valve 68 thereby providing pressurized air to the actuator 76 of the third valve 74 . actuation of the third valve 74 opens the passage between the first hydraulic line 80 and the hydraulic junction 82 . the pressurized air fed into the hydraulic tank 44 as a result of positioning the first valve 64 in the desired position , forces the liquid in the tank 44 through the first hydraulic line 80 to the hydraulic junction 82 . from the hydraulic junction 82 , the fluid is directed through the second and third hydraulic lines 84 , 86 to the first and second bellows 46 , 48 respectively . as the fluid fills the first and second bellows 46 , 48 , each bellow 46 , 48 expands to raise the discharge end 30 of the shaker separator 10 . once the desired incline of the bed 12 is achieved , the operator releases the second valve 68 , thereby closing it and releasing the actuator 76 of the third valve 74 . when the actuator 76 is released , the third valve 74 returns to a closed position . thus , the fluid transferred to the first and second bellows 46 , 48 and the second and third hydraulic lines 84 , 86 is confined . if the first bellow 46 contains more fluid than the second bellow 48 or vice versa , the weight of the shaker separator 10 will force the fluid to equalize between the first bellow 46 and the second bellow 48 , thereby leveling the discharge end 30 from side to side . to lower the discharge end 30 of the shaker separator 10 , an operator places the first valve 64 to a second position corresponding to lowering the discharge end 30 , again using a handle , knob , or other such interface device . when the first valve 64 is placed into the second position , any air under pressure in the second pneumatic line 72 and the hydraulic tank 44 may be vented . so long as the third valve 74 remains closed , only a minimal amount of air will be vented and the discharge end 30 will remain in the raised position . the operator actuates the second valve 68 to open fluid communication from the air supply 88 to the actuator 76 of the third valve 74 . when the air through the second pilot line 78 actuates the third valve 74 , the third valve 74 opens to provide fluid communication of the liquid between the first and second bellows 46 , 48 and the hydraulic tank 44 . with pressure on the fluid released , the fluid moves back into the hydraulic tank 44 while the third valve 74 is open . the weight of the shaker separator 10 on the first and second bellows 46 , 48 forces the liquid back into the hydraulic tank 44 . air from the hydraulic tank 44 , displaced by the liquid , is forced back through the second pneumatic line 72 and vented through the first valve 64 . when the bed 12 of the shaker separator 10 has reached the desired declination angle , the operator releases the second valve 68 to stop the flow of liquid from the first and second bellows 46 , 48 to the hydraulic tank 44 . this again confines the fluid in the first and second bellows 46 , 48 and the second and third hydraulic lines 84 , 86 and freezes the discharge end 30 in the desired position . referring to fig1 , 2 , and 6 , to assist the operator in adjusting the discharge end 30 of the shaker separator 10 , a means for indicating a position of the discharge end 60 may be coupled between the shaker bed 12 and the floor or skid on which the shaker 10 is located . indicator plates 94 may be located adjacent to one or both of the bellows 46 , 48 . the indicator plates 94 may include graduation lines corresponding desired positions of the discharge end 30 . graduation lines may correspond to a height of the discharge end 30 above the skid or the floor . graduation lines may correspond to an angle of the shaker bed 12 with respect to the skid or the floor . a marker 96 , or pointer , such as piece of formed sheet metal coupled to the bed 12 of the shaker separator 10 may be used to mark the angle of incline of the discharge end 30 of the shaker separator 10 relative to the skid 32 or floor to which the shaker separator 10 is mounted . referring to fig2 , a track system 98 may be provided to guide the vertical movement of each of the first and second bellows 46 , 48 . the track system 98 includes upright plates 100 , 102 located on opposing sides of each bellow 46 , 48 . the inner upright plate 100 for the first bellow 46 is shown in fig2 , while the corresponding outer upright plate 102 may be seen in fig1 . each upright plate 100 , 102 has a vertical track 104 along its inner surface 106 . each shroud 54 is provided with rollers 108 , which roll along the track 104 . a wall 110 extending from each upright plate 100 , 102 helps keep the rollers 108 in a confined area near the track 104 . one of skill in the art will appreciate that some variation of the components described are possible . for example the first and second bellows 46 , 48 may be replaced with other types of hydraulic lifters . another variation includes replacing the first and second bellows 46 , 48 with a single lifter centrally located along the discharge end 30 of the shaker bed 12 . in one embodiment of the lifting system 40 ′, depicted in fig7 , the lift control assembly 42 ′ includes a tank control valve 64 ′, a pair of pilot control valves 68 ′, 68 ″, a shuttle valve 112 , and a skinner fluid valve 74 ′. the pilot control valves 68 ′, 68 ″ and the skinner fluid valve 74 ′ are biased to a closed position . air from an air supply ( not shown ) is split , with a first stream directed through a pressure regulator 90 to the tank control valve 64 ′ and a second stream split again into a first sub - stream and a second sub - stream . the first sub - stream is directed to the first pilot control valve 68 ′ and the second sub - stream is directed to the second pilot control valve 68 ″. a pneumatic line 72 connects the tank control valve 64 ′ to the hydraulic tank 44 . a first pilot line 70 ′ connects the first pilot valve 68 ′ to the shuttle valve 112 and a second pilot line 70 ″ connects the second pilot valve 68 ″ to the shuttle valve 112 . a third pilot line 78 ′ connects the shuttle valve 112 to an actuator 76 ′ on the skinner fluid valve 74 ′. a first hydraulic line 80 ′ connects the hydraulic tank 44 to the skinner fluid valve 74 ′. a second hydraulic line 114 splits into two sub - hydraulic lines 84 ′, 86 ′ going to each of the bellows 46 , 48 , which are coupled to the shaker separator 10 near the discharge end 30 . to raise the discharge end 30 of the shaker separator 10 , an operator actuates the first pilot valve 68 ′. air flows through the first pilot valve 68 ′ to the shuttle valve 112 and to a pilot port of the tank control valve 64 ′. the shuttle valve 112 directs the air to the third pilot line 78 ′ and actuates the skinner fluid valve 74 ′. actuation of the skinner fluid valve 74 ′ opens fluid communication between the hydraulic tank 44 and the bellows 46 , 48 through the first hydraulic line 80 ′ and the second hydraulic line 114 . the air flow to the pilot port of the tank control valve 64 ′ actuates the tank control valve 64 ′ to provide pressure regulated air to the hydraulic tank 44 . the pressure regulated air displaces fluid in the hydraulic tank 44 , causing the fluid to exit the tank 44 through the first hydraulic line 80 ′. the fluid is forced from the tank 44 through the skinner fluid valve 74 ′ into the bellows 46 , 48 , causing them to expand and raise the discharge end 30 of the shaker separator 10 . when the first pilot valve 68 ′ is released by the operator , air pressure through the first pilot line 70 ′ to the shuttle valve 112 and air pressure to the pilot port of the tank control valve 64 ′ drops . the drop in air pressure on the shuttle valve 112 releases the actuation of the skinner fluid valve 74 ′, returning it to its normally closed position and terminating fluid communication between the hydraulic tank 44 and the bellows 46 , 48 . the drop in air pressure to the tank control valve 64 ′ releases it to its normal position wherein air in the hydraulic tank 44 and the pneumatic line 72 is vented and air flow into the hydraulic tank 44 from the air supply is stopped . to lower the discharge end 30 of the shaker separator 10 , the operator actuates the second pilot valve 68 ″. when the second pilot valve 68 ″ is actuated , air is directed to the shuttle valve 112 . the pilot signal to the shuttle valve 112 causes it to open and provide air flow to the third pilot line 78 ′, thereby actuating the skinner fluid valve 74 ′. upon actuation of the skinner fluid valve 74 ′, the first and second hydraulic lines 80 ′, 114 are in fluid communication , providing fluid communication between the bellows 80 ′, 114 and the hydraulic tank 44 . the tank control valve 64 ′ remains in its biased position wherein air from the hydraulic tank 44 is vented therethrough . the bellows 46 , 48 are compressed by the weight of the shaker separator 10 causing the fluid therein to flow back to the hydraulic tank 44 . air displaced by the fluid is vented through the tank control valve 64 ′. when the bed 12 has reached the desired angle , the operator releases the second pilot valve 68 ″, forcing the cessation of the pilot signal to the shuttle valve 112 and the return of the skinner fluid valve 74 ′ to its biased , closed position . the closure of the skinner fluid valve 74 ′ stops flow from the bellows 46 , 48 to the hydraulic tank 44 and the bed 12 is maintained at the desired angle . in one embodiment , an electrical interlock solenoid valve 116 is included in parallel with the skinner fluid valve 74 ′ between the first and second hydraulic lines 80 ′, 114 . in one embodiment , a needle valve 118 and silencer 120 is included at the venting port of the tank control valve 64 ′. in one embodiment , a filter 122 is included at the inlet to the lift control assembly 42 ′. referring now to fig8 and 9 , an alternative mechanism for lifting and guiding vertical movement of a shaker separator ( e . g ., 10 of fig1 ) may be described . in particular , each bellows ( 46 , 48 of fig1 - 7 ) may be replaced with a lifting mechanism 200 that includes a lifting apparatus 202 and a vertical alignment apparatus 204 . lifting apparatus 202 includes two hydraulic bellows 206 , 208 sandwiched between a bottom plate 210 and a top plate 212 for transmitting hydraulic energy from a hydraulic line 214 ( similar to 84 and 86 of fig4 ) to lift either a free end or a discharge end of a separator shaker assembly . while lifting apparatus 202 is shown having two bellows 206 and 208 , it should be understood that fewer or more bellows may be used without departing from the scope of the present disclosure . further , dual bellows 206 and 208 may be replaced with a single , larger bellows if desired . vertical alignment apparatus 204 extends between top plate 212 of lifting apparatus 202 and an adapter plate 216 ( similar to 56 of fig2 ) of the shaker separator . in selected embodiments , vertical alignment apparatus 204 is designed to ensure the displacement and forces transmitted from bellows 206 and 208 are substantially linear and vertical as would be desired by those having ordinary skill in the art . alternatively , it should be understood that vertical alignment apparatus 204 may be angled such that displacement and forces are transmitted in a substantially linear , but not necessarily vertical orientation , if desired . as such , vertical alignment apparatus 204 includes an actuated cylinder assembly 218 configured to reciprocate within a sleeve 220 affixed to a frame 222 of the shaker separator . sleeve 220 may be affixed to frame 222 by any mechanism known to those having ordinary skill including , but not limited to , welding , bolting , press fitting , brazing , and the like . with sleeve 220 rigidly affixed to frame 222 , cylinder assembly 218 is able to linearly displace therethrough when actuated by top plate 212 . further , by selecting the length and relative position of sleeve 220 within frame 222 , the top and bottom ends of sleeve 220 may be used to limit a maximum and a minimum amount of stroke of cylinder assembly 218 , described below in more detail . furthermore , cylinder assembly 218 includes an inner cylinder 224 , an outer cylinder 226 , and a top plate 228 . as such , an outer diameter of inner cylinder 224 is sized to engage through an inner diameter of sleeve 220 so that top plate 228 may be raised and lowered as bellows 206 and 208 of lifting apparatus 202 are inflated and deflated . an alignment ring 230 having an outer profile approximate to an inner diameter of inner cylinder 224 is rigidly affixed to top plate 212 so that cylinder assembly 218 is maintained in proper alignment at all times during the stroke of lifting apparatus 204 . additionally , outer cylinder 226 of cylinder assembly 218 extends downward from top plate 228 and includes an inner diameter larger than an outer diameter of sleeve 220 . thus , outer cylinder 226 may act as a cap to prevent fluids and debris from entering the annular gap formed between sleeve 220 and inner cylinder 228 . advantageously , by preventing fluids and debris from entering the annular gap between sleeve 220 and inner cylinder 228 , the same fluids and debris may be prevented from entering a compartment 232 within frame where lifting apparatus 202 , bellows 206 and 208 , and various other components are housed . furthermore , because shaker separator will experience to a large amount of vibration , a spring 234 may be mounted between top plate 228 of cylinder assembly 218 and adapter plate 216 to isolate lifting apparatus 202 and alignment apparatus 204 from vibrations . as such , a spring mount 236 may retain a bottom portion of spring 234 to top plate 228 , and a corresponding upper spring mount 238 may be mounted under adapter plate 216 . furthermore , while only spring 234 is shown , it should be understood that a viscous coupling or other form of vibration dampener may be use in conjunction with or in place of spring 234 . furthermore , one of ordinary skill in the art will appreciate that bellows 206 and 208 will also have inherent spring and dampening characteristics also . advantageously , lifting mechanism 200 enables hydraulic bellows 206 and 208 to be positioned below ( e . g ., in compartment 232 of frame 222 ) a shaking separator deck to be raised and / or lowered . further , alignment apparatus 204 enables any lifting force from bellows 206 and 208 to be applied substantially linearly in a desired direction so that damage from long term vibratory side , or translational , loading is minimized . furthermore , by locating lifting bellows 206 and 208 beneath the shaker deck , torsional loads to the deck resulting from the lifting forces may be reduced . further , lifting mechanisms in accordance with embodiments disclosed herein may be positioned at either a free end of a shaking separator , a discharge end of the shaking separator , or at both ends ( i . e ., all four corners ) control the amount and direction of relative shaker screen tilt desired . while the claimed subject matter has been described with respect to a limited number of embodiments , those skilled in the art , having benefit of this disclosure , will appreciate that other embodiments can be devised which do not depart from the scope of the claimed subject matter as disclosed herein . accordingly , the scope of the claimed subject matter should be limited only by the attached claims . | 4 |
with reference to the above figures , the sunglasses structure , generally indicated by the reference numeral 1 , is constituted by a front portion 2 having arms 2a , 2b hinged thereto and an associated lens 20 having an arcuate configuration . advantageously , the front portion 2 is constituted by a cross member 30 and an upper element 40 . the cross member 30 has a substantially rectangular cross section 31 defining an inner face 32 against which the lens 20 abuts . an elongate groove 33 is formed in an enlarged end portion 34 of the cross member 30 and accommodates a portion of the lens 20 . the upper cover element 40 expediently has an irregular hexagonal cross section 41 defining a recess 42 having a first face 43 and a second face 44 . the first face 43 of the recess 42 abuts against an upper surface 35 of the cross member 30 , while the second face 44 of the recess 42 abuts against an upper peripheral portion of the lens 20 . thus , the upper edge of the lens 20 is held between the inner face 32 of the cross member 30 and the second face 44 of the recess 42 formed in the cover element 40 . the enlarged end portion 34 of the cross member 30 also has formed thereon a connection recess 36 located adjacent to the groove 33 and having an abutment face 37 engaging a lateral surface 45 of a tongue 46 rigidly associated with a terminal portion 47 of the cover element 40 . a first inclined surface 49 extends substantially perpendicularly to the lateral surface 45 of the tongue 46 and abuts against a second inclined surface 39 extending substantially perpendicularly to the abutment face 37 of the connection recess 36 . in this manner , once the lens 20 is engaged in the connection recess such that its upper peripheral edge is located between the inner face 32 and the second face 44 , and the tongue 46 is engaged in the connection recess 36 , the lens is frictionally retained in position . by virtue of the inclination of the first 49 and second 39 inclined surfaces , the cover element 40 is retained in place on the cross member 30 . engagement between the upper cover element 40 and the cross member 30 is allowed by different thickness between the tongue 46 of the upper cover element 40 and the abutment face 37 of the cross member 30 . in order to fix the structural arrangement assembled as described heretofore , adhesive or ultrasonic welding or similar techniques may be used , or mechanical fixing devices such as screws may be adopted , e . g ., screws may be used in a concealed manner by being screwed into the inner face 50 of the cover element 40 , passing through the material constituting the lens 20 , and engaging the cross member 30 . in this manner , the heads of such screws are not visible when the sunglasses are worn . the arms 2a , 2b are connected to the front portion 2 , by means of conventional hinges , not illustrated for clarification purposes . said lens 20 has , approximately at the median region 3 , a milling 4 which is essentially v - shaped and is therefore symmetrical to the transverse middle axis ii -- ii of said lens ; temporary coupling means are provided on said milling for a bridge 5 . said coupling elements are constituted by a first and a second pair of raised portions , respectively indicated by the numerals 6a , 6b , and 7a , 7b , which protrude from the perimetral edge 8 of the v - shaped milling 4 . complementarily shaped grip elements provided on the bridge 5 are temporarily associable with said first and second pair of raised portions , which are symmetrical with respect to the transverse middle axis ii -- ii of the lens 3 . said bridge 5 has a v - shaped configuration and is preferably made of plastic material in order to confer on said lug a certain degree of elasticity , whereby it can be elastically deformed for insertion into the v - shaped milling 4 . the bridge 5 furthermore has a perimetral groove 9 which constitutes a seat for accommodating a portion of the perimetral edge 8 of the lens 3 , as well as a first pair of seats 10a and 10b , shaped complementarily to the second pair of raised portions 7a and 7b , provided at said perimetral groove 9 . a second pair of seats 12a and 12b for accommodating the first pair of raised portions 6a and 6b is provided at the terminal ends of the wings 11a and 11b of the bridge 5 . said second pair of seats 12a , 12b is advantageously formed in a portion of the material constituting the bridge 5 having a greater thickness dimension , at the perimetral groove 9 . in order to assemble the bridge 5 and the lens 20 , it is sufficient to introduce the apex 60 of the bridge 5 into the v - shaped milling 4 , and simultaneously align the perimetral edge 8 with the groove 9 . as the bridge 5 is pushed into the milling 4 , the raised portions 6a , 6b , 7a , 7b , slide along the groove 9 . this causes the wings 11a , 11b of the bridge 5 to be pressed towards each other , i . e . towards the transverse middle axis ii -- ii of the lens 20 , by causing elastic deformation of the bridge 5 itself . this condition prevails until alignment of the first pair of seats 10a , 10b with the second pair of raised portions 7a , 7b and alignment of the second pair of seats 12a , 12b with the first pair of raised portions 6a , 6b . when such alignment is achieved , the temporary elastic deformation of the bridge 5 generates a spring biasing force which causes the second pair of raised portions 7a , 7b to snap into engagement with the first seats 10a , 10b and the first pair of raised portions 6a , 6b to snap into engagement with the second seats 12a , 12b . the perimetral edge 8 of the lens 20 is then positioned correctly in the groove 9 , and the bridge assumes its normal unstressed configuration and is thus engaged with the milling 4 . the lens 3 furthermore has , proximate to the lateral ends 13a and 13b , a pair of air vents or intakes indicated by the reference numerals 14a and 14b . said air intakes are obtained by providing a hole at the lens ; a stud is then associated with said hole , and the flow of air is expediently reduced therein by means of the presence of a mesh , indicated by the numerals 15a and 15b . in this way , misting of the lens is prevented without thereby creating undesiderable air - currents . the mesh also prevents the ingress of foreign bodies such as dust or snow . the use of the structure is therefore as follows : first of all the association of the lug at the lens occurs by gripping said lug at the ends of the wings 11a and 11b , imparting to said wings a slight pressure which causes them to approach one another . in this manner said lug is positioned so that the first and second pair of raised portions is arranged facing at the second and first pair of seats : by releasing the ends of the wings 11a and 11b , the automatic engagement of the former to these last is achieved . the use of at least three temporary coupling elements provided on the lens for complementarily shaped grip elements provided on the bridge allows the optimum coupling of the bridge to the lens . the presence of the air intakes 14a and 14b furthermore allows an optimum passage of the flow of air at the surface of the lens which faces the user &# 39 ; s face , ensuring perfect vision through all portions of the lens in any condition . it has thus been observed that the invention has achieved the intended aim and objects , a structure of sunglasses having been obtained which allows good aeration of the lens , preventing it from misting . the sunglasses structure furthermore has a removable bridge which is at the same time firmly associable with the lens without said bridge being subject to accidental removal . this allows , for example in case of a fall , to avoid that a possible uncoupling of the lug may lead to an abutment of the perimetral edge 8 of the lens 3 at the nasal septum of the user , causing injury . the invention is naturally susceptible to numerous modifications and variations , all of which are within the scope of the same inventive concept . thus , for example , any number of air vents of any convenient size may be used , and they may be arranged at any suitable position at the lateral region of the lens 20 . the partial closure of one or more air vents may naturally occur with any device such as , for example , a sliding shutter or a removable cover . the number of temporary coupling elements provided on the lens may furthermore by any , though preferably at least three . finally , the materials , as well as the dimensions which constitute the individual components of the structure , may also naturally be the most appropriate according to the specific requirements . advantageously the cross member 30 and the arms 2a , 2b are made of plastic material , while the cover element may be made of rubber . | 6 |
the confectionery machine to which fig1 to 11 relate is equipped with open - top , cup - shaped molds 2 rotatable about a vertical shaft 1 which in an axial bore contains an axially movable ejector 3 for ejecting the finished confections . first a preformed wrapper 4 is inserted from above into the empty mold 2 in fig1 . alternatively a feeder may be arranged to deposit a flat blank of wrapper material on the open top of the mold 2 followed by the descent of a suitable plunger which applies the blank to the inside wall of the mold so that the wrapper material forms a lining . the size of the wrapper or blank is appropriately calculated to ensure that a portion of the wrapper material will project from the open top of the mold . when the wrapper material 4 has been inserted into the mold 2 a flowable confectionery mass 5 is poured in . rapid rotation is then imparted to the mold , but preferably not until the surface of the confectionery mass is quite level . the molds 2 are rotated about their vertical shafts at least for a predetermined period of time , suitable drive and timing means being provided . the speed of rotation and the spinning time depend upon the composition and consistency of the confectionery mass that is to be molded . suitable precautions must be taken to ensure that the wrapper cannot detach itself from the mold . these may comprise suitably shaping the profile of the wrapper and / or internal mold surface or by locating the wrapper by compressed air from above or suction from below . the mold and the wrapper must jointly rotate to ensure that the centrifugal forces will cause the confectionery mass to rise up the inside wall of the mold and to form a hollow cup 6 which can be set . this can be done by a blast of cold air or by conveying the mold into a cooling zone . in another working station a nut , raisin , fruit or the like 7 may be introduced into the open mold 6 and finally the molded confectionery case can be filled with any desired filling material 8 of a liquid or cream - like consistency . the open top of the confection is then closed with a capping mass 9 for which purpose rotation of the mold may be resumed to ensure that the capping mass spreads evenly over the top of the confection and fuses with the upper edges of the initially formed case 6 . when the capping material 9 has also set the wrapper can be closed . fig8 to 11 illustrate different possible ways of closing the wrapper . in fig8 use is made of two cooperating hot sealing tools 10 which merely press together the edges of the wrapper material 4 and form a seam by hot sealing . in the closing device shown in fig9 a mechanical impressed seam is formed by pressing tools 11 , whereas in fig1 folding instruments 12 produce a folded closure for instance in the manner of a &# 34 ; punch packing &# 34 ;. finally fig1 illustrates the method of closing the wrapper by twisting its edges to a neck 13 . in the methods of closing the wrapper shown in fig8 and 11 the portions of the wrapper material projecting from the top of the mold also provide means whereby the finished and wrapped confections can be lifted out of the mold . fig1 is a diagrammatic representation of a machine which permits wrapped confections to be produced in an extremely economical way . the machine contains conveyor chains 14 which run in parallel over driving and return wheels 15 in the arrowed direction either in intermittent steps or continuously . the chains are cross connected by carrier beams 16 on which the shafts and centrifugal molds 2 , which are only schematically shown in the drawing , are rotatably mounted . in the working zones in which rotation is imparted to the molds drive means 17 and a motor 18 for a coupling head 19 controlled and operated by a time switch are provided . the drive means and coupling head can be raised and lowered as indicated by a to impart the required rotation to the centrifugal molds for the required period of time . instead of being fixed the entire drive may be arranged to travel to and fro in the direction indicated by arrow b if the chain conveyor travels continuously or the spinning time is to be prolonged . in order to permit the machine to work economically a large number of separate centrifugal molds 2 are mounted on the chain conveyor in longitudinal and transverse rows , one or several rows of molds being simultaneously driven and filled . above the level of the travelling molds there is firstly a feeder for the supply of blanks of wrapping material or a device 20 adapted to insert preformed wrappers into the molds . means , not shown in the drawing , are also provided for pressing the wrappers into the mold as well as instruments or devices for retaining the wrappers inside the molds . the molds that have been provided with wrappers are then conveyed to a metering feed means 21 for the flowable confectionery mass that is to form the case of the confection or sweet , such as a hard boiled sugar , chocolate or like mass . rotation of the molds can be begun during the process of pouring in the confectionery mass , but preferably rotation is delayed until the mass has formed a level surface in the mold , as indicated for instance in the diagrammatic drawing . a feeder 22 is then provided for the insertion of a solid , such as a nut , a raisin , a fruit or the like , into the open case . the molds then pass through a cooling zone 23 where the confectionery mass sets , behind which there follows a pouring device 24 which provides the cases with a filling of liqueur , fondant , jam , creme or the like which may be in the form of a soft paste or of a liquid . the molds are then conveyed through another cooling zone 25 and a cap casting device 26 which discharges a capping mass , i . e . a confectionery mass that will set , on the open top of the case . in order to ensure that this mass spreads evenly over the top spinning of the molds may be resumed for a short time . finally at the several stations the molds may pass over vibrators 27 . these may be necessary to ensure that the confectionery masses are dense and well distributed in the molds . preferably the entire machine is accommodated inside a housing 28 which is air - conditioned to ensure that the masses will set as quickly as possible . the returning portion of the chain conveyor carries the molds back to the starting point of the process . the confections first remain inside the molds . during their return journey the molds pass across folding instruments 29 which are only schematically indicated and which are designed in a suitable manner to fold the parts of the wrapper projecting from the open end of the molds . finally the fully wrapped confections are dislodged by an ejector 30 and drop on a cross conveyor belt 31 which carries them to a collecting point . a cooling fan 32 ensures that the air inside the housing 28 is conditioned and circulated as is desirable . the set of folding instruments 29 and the ejector 30 can be inactivated if the wrappers are to be closed by twisting . for such an eventuality a toolholder 33 is provided above the conveyor chain . at its bottom end the toolholder is fitted with two rows of gripper instruments 34 which open and close , and which can be vertically raised and lowered and moved horizontally to and fro as a unit . below this arrangement and underneath the chain conveyor is a drive means 35 controlled by a time switch and adapted to be coupled to the mold shafts for rotating the molds and thus forming the twisted necks . when the grippers 34 have gripped the projecting edges of the wrapper material projecting from the top of the molds the latter are given a few turns by activation of the drive means 35 so that the wrapper ends are twisted whilst the grippers 34 keep the wrapper ends fixed . the closed grippers 34 are then raised and traversed to one side , thus lifting the wrapped confections out of the molds and depositing them on a cross conveyor 36 . for the sake of simplicity means and instruments for retaining the wrapper inside the mold are not shown . finally the several assemblies at the different working stations can be started , stopped and employed in a variety of ways . means may also be provided for applying a parting agent to the wrapping material before the introduction of the confectionery mass to permit the confections to be easily taken out of their wrappers for consumption . all the working assemblies , such as the metering feeders , folding and closing instruments , drive means , transmissions , couplings as well as the time switches are of conventional type and call for no special description . | 1 |
the following is a detailed description of the new prune tree cultivar that was obtained from the observation of eight year - old asexually propagated trees during the 1999 growing season ( except where otherwise indicated ). the trees were propagated on prunus cerasifera ‘ myrobalan 29c ’ plum rootstock . the trees were grown at the kearney agricultural center of the university of california located at parlier , calif . tree spacing was 5 . 49 m between rows and 4 . 88 m spacing between trees down the row . the color chart used in the identification of colors is that of the royal horticultural society , london ( r . h . s . colour chart ). other color terminology is to be accorded its customary dictionary significance . size .— the height during october at the end of the growing season ranges from approximately 4 . 2 to 4 . 7 m including approximately 1 . 7 to 1 . 8 m of current season &# 39 ; s growth . the width across the crown ranges from approximately 3 . 7 to 4 . 3 m . hardiness .— hardy under typical san joaquin valley of california climatic conditions . size .— average in thickness for prunus domestica . the trunk circumference at 35 cm above the ground is approximately 12 cm . texture .— relatively smooth with only a slight amount of short scarfskin . lenticels .— numerous , prominent , oval in configuration , most pronounced on the trunk and large scaffold limbs where they are the most abundant , and commonly raised with a calloused surface . the height commonly ranges from approximately 1 . 5 to 2 . 0 mm and the width from approximately 2 . 0 to 6 . 0 mm . the coloration is brownish - tan , near grey - orange group 173c . diameter .— average thickness for prunus domestica . the diameters of primary scaffold branches average 7 . 4 cm and range from 6 . 1 to 8 . 4 cm , and the diameters at the base of the secondary scaffold branches average 4 . 5 cm and range from 3 . 3 to 5 . 7 cm . the basal diameters of fruiting hanger limbs average 1 . 1 cm and range from 0 . 7 to 1 . 7 cm . the diameters of fruiting spurs average 0 . 5 cm with a range from 0 . 3 to 0 . 7 cm . these dimensions were obtained from the observation of ten - year - old trees during april 2001 . surface .— substantially pubescent especially on current season &# 39 ; s growth . such pubescence is moderately dense and short . color .— branch color is somewhat variable . mature current season &# 39 ; s shoots are medium brown of near brown group 200d . immature shoots range from light green of yellow - green group 144b to darker green of yellow - green group 144a on more mature growth . young shoots exposed to the direct sunlight often are blushed with a rose - red hue of red group 48a . new expanding shoot tips commonly are bright yellow - green of yellow - green group 151a . two year - old or older branches commonly are near grey - brown group 199b to darker brown of grey - brown group 199a . lenticels .— substantial presence on mature current season &# 39 ; s shoots , and two year - old or older branches . internode length .— normal for prunus domestica . the distance between nodes commonly ranges from approximately 19 to 36 mm on moderately vigorous current season &# 39 ; s shoots . size .— medium to large . leaves produced near mid - shoot on vigorous current season &# 39 ; s shoots range in length from approximately 10 . 9 to 15 . 4 cm including the petiole and in width from approximately 5 . 5 to 6 . 8 cm . the leaves are moderately thick and are slightly above average in thickness . form .— variable , frequently obovate , and with the occasional presence of oval leaves . the leaf apices are acute and commonly are very slightly reflexed sideways . with advancing maturity some older leaves are folded downwards from the midrib . color .— the upper surface is dark green . yellow - green group 146a to yellow - green group 147a . the under surface is lighter green , yellow - green group 147c to yellow - green group 148c . the primary mid - vein on the under surface is pale green , yellow - green group 145c . both the under surface and the leaf mid - vein on the under surface are highly pubescent . margin .— crenate with large somewhat irregular crenations . the margins tend to be slightly undulate . petiole .— average in size , commonly approximately 17 to 32 mm in length , approximately 1 . 5 to 2 . 0 mm in thickness , and light green , yellow - green group 145b , in coloration . with advancing age the petiole coloration can darken and assume a reddish blush near red group 37a . such blush tends to be most evident along the ridges of the petiole groove . glands .— from 0 to 2 small glands commonly can be observed at the extreme base of the leaf blade margin . such glands are globose in configuration and occur on stalks which are distinct or indistinct . usually no glands are present on the petiole itself . the gland position is alternate . the coloration when young is bright green , yellow - green group 151c , with darkening and deterioration with age . stipules .— medium to large in size , linear lanceolate in configuration , located at the very base of the petiole and arise from the base of the petal groove area , partially deciduous with some stipules remaining on the leaf throughout the growing season , margins are serrate and substantially pubescent , commonly approximately 5 to 11 mm in length and 1 . 5 to 2 . 0 mm in width at full maturity , and the coloration of young stipules is green , yellow - green group 145a . picking .— first pick was july 30th and the last pick was aug . 9 , 1999 . the 1999 fruit growing season in the san joaquin valley area of california was one of the latest on record and ranged from 12 to 15 days later than average . a more typical first - pick date is july 15th and a more typical last pick date is july 25th . size .— very large for the species and of relatively good uniformity . fruit from a well - thinned tree ranges from approximately 40 to 53 mm in the suture diameter and approximately 54 to 68 mm in the axial diameter . form .— most frequently oval in lateral aspect , is well rounded basally and apically , and tends to be slightly more pointed apically . nearly globose to slightly oval in the apical aspect and at times is slightly irregular . the fruit varies from symmetrical to slightly asymmetrical . suture .— very thin , with a somewhat indistinct line extending from the base to apex . most frequently is similar in coloration to that of the surrounding skin surface . at times is slightly depressed especially over the ventral apical shoulder . a very slight amount of stitching occasionally is observed over the apical shoulder . ventral surface .— usually quite smooth ; however , at times a very low lipping is observed . stem cavity .— oval , quite regular in configuration , very small , tight and very shallow . the width commonly ranges from approximately 2 . 5 to 5 . 0 mm and the depth commonly ranges from 2 . 0 to 2 . 5 mm . at times a small oval fleshy ring is observed within the cavity basin which surrounds the stem at the point of attachment to the basal cavity . such ring is narrow and averages approximately 1 . 0 mm in thickness . when the stem is removed from the fruit , the ring can remain in the cavity or be attached to the distal end of the stem . base .— regular and rounded . the stem attachment and stem cavity frequently are not positioned at the highest point of the fruit base , but rather are positioned approximately 5 to 8 mm down the ventral edge from the basal apex . the basal angle tends to be decidedly oblique to the fruit axis . apex .— slightly raised and somewhat more pointed than the fruit base with no depression at the apex . the pistil point is variable and at times is apical and at times is moderately oblique . stem .— medium in length and pubescent with the abundant presence of short and stiff hairs . the length commonly ranges from approximately 11 to 18 mm . the thickness commonly ranges from 1 . 5 to 2 . 0 mm . the color is pale green at commercial maturity , near yellow - green group 146c . skin pubescence .— generally glabrous but with a small amount of scattered very fine pubescence covering the surface of the fruit . skin tendency to split .— no tendency to crack or split has been observed . skin color .— grey - blue , violet - blue group 97b , at commercial maturity when the waxy cuticle bloom is intact . once the bloom is removed the coloration is dark purple , greyed - purple group 187a . the fruit usually is fully colored with no visible ground color . occasionally a lighter reddish - purple , greyed - purple group 187c , is observed especially on an exposed fruit surface . at full maturity a small number of light colored dots sometimes are observed , primarily on the lateral surfaces and over the basal shoulder . flesh color .— commonly varies from yellow - orange group 20b to a darker yellow orange , yellow - orange group 20a . a small number of fibers also commonly are observed within the stone cavity and along the margins of the stone . flesh texture .— at commercial maturity the flesh is firm , relatively fine textured , and moderately juicy . at more advanced maturity the fruit becomes softer and very juicy . flavor .— mild and sweet with a relatively low acidity . during the 1999 growing season on july 30th , soluble solids reached 17 degrees brix at 5 . 0 pounds pressure for fresh shipment . on august 13th of the same year , soluble solids reached 20 degrees brix at a drying maturity of 2 . 6 pounds pressure . aroma .— very slight to lacking at commercial maturity . the aroma becomes slightly stronger as maturity progresses . attachment .— semi - freestone . the flesh fibers are attached primarly at the base of the stone and along the suture edges , but are generally free laterally . the stone tends to become more free with advancing maturity . size .— relatively large , commonly ranges from approximately 28 to 33 mm in length , approximately 14 to 17 mm in width , and approximately 7 . 5 to 9 . 5 mm in thickness . hilum .— very small and commonly averages approximately 2 to 3 mm in length . is oval , but the shoulder commonly is distinctly eroded along the ventral edge . the basal area under the hilum scar is somewhat necked . distinct ridges commonly are present on the basal neck which converge basally . surface .— slightly rough with the lateral surfaces being covered with very low netted ridges . ventral edge .— relatively narrow , smooth and regular . very low wings of often less than 1 mm sometimes are present on the basal one - third of the ventral edge and sometimes are completely absent . commonly a shallow but distinct groove is present laterally and runs roughly parallel to the ventral edge at approximately 2 to 3 mm below the edge . the ventral edge sometimes is slightly pitted and at times is discontinuous . dorsal edge .— a distinct groove commonly is present along the dorsal edge from the base to the apex . at times the dorsal groove is discontinuous at or near med - suture . the dorsal groove is usually wider and more distinct from the base of the stone up to mid - suture . the groove tends to be narrower beyond mid - suture towards the apex . color .— cinnamon , greyed - orange group 165c . the wet color is darker , greyed - orange group 165b . chilling season .— data for this description was obtained during march 1999 . there were approximately 1331 chilling hours below 45 ° f . for the 1998 - 1999 winter season . floral buds .— medium in size , commonly 4 to 5 mm in length and 2 to 3 mm in width , conic in form , plump , slightly appressed to the bearing stem , and hardy under typical san joaquin valley climatic conditions . the bud surface scales are dark brown , brown group 200b , in coloration , are lightly pubescent , and are most distinct along the margins . the number of buds per node can range from approximately 1 to 6 and most commonly is approximately 3 . such buds commonly are present in abundance on one year - old wood which is uncommon for the species . blooming time .— early in relation to other prunus domestica cultivars . initial sustained bud burst began on mar . 14th during 1999 . full bloom occurred on mar . 19th during 1999 . the duration of bloom was approximately 10 days with nearly complete shatter by mar . 24th in 1999 . in contrast the ‘ improved french ’ cultivar attained full bloom on march 28th under the same conditions . size .— medium to large for the species . the fully expanded flower diameter commonly is approximately 22 to 30 mm . petals .— medium to large in size and commonly range from approximately 11 to 14 mm in length and approximately 10 to 12 mm in width . the number is 5 per flower . the form varies from oval to very slightly obovate and at times is notched at the apex . the coloration is white , white group 155b . the petal claw is short and truncate , approximately 0 . 5 to 1 . 0 mm in length and approximately 1 . 0 mm in width . the margins are variable and range from relatively smooth to slightly undulate and are somewhat cupped inwards . the apices are also somewhat variable and range from smoothly rounded to distinctly notched . pedicel .— commonly approximately 7 to 12 mm in length and a thickness of approximately 0 . 8 to 1 . 0 mm . the coloration is light green , green group 143c , and the surface is pubescent with short erect hairs throughout . calyx .— lightly pubescent with short fine pubescence , and greenish - yellow in coloration , yellow - green group 146c . sepals .— five in number , approximately 5 mm in length , approximately 3 to 4 mm in width , pubescent on the surfaces with greater density along the margins , oval in form , and the external coloration is light green , green group 143c . anthers .— average in size , and yellow - gold , yellow group 13a , both ventrally and dorsally in coloration . stamens .— approximately 20 to 27 and most frequently approximately 25 , the length is variable and commonly approximately 5 to 9 mm , and commonly equal in height to slightly shorter than the pistil . the filament color is white , white group 155b . pistils .— the surface of the ovary is pubescent and surface of the style is substantially glabrous . the length including the ovary is approximately 10 to 13 mm . the style is yellow - green , yellow - green group 145c , and the ovary is darker shiny green , yellow - green group 144b , in coloration . under normal environmental conditions only one pistil is present per flower . in seasons following very hot summers it is possible to observe a low number of double pistils ( e . g ., 2 to 3 percent ). | 0 |
in the artificial spine according to the present invention , it is preferable that the inner side section and outer side section each have formed therein a thread insertion through - hole for inserting a thread for the fixation of the artificial spine to the divided spines . further , it is desired that the ends of a pair of contacting surfaces of the intermediate section each have formed therein a thread insertion groove for guiding a thread for the fixation of the artificial spine to the divided spines . further , it is desired that in addition to the thread insertion through - hole , the outer side section has formed therein , a hole for facilitating bonding of the artificial spine to a surrounding tissue . moreover , it is desired that the outer side section , in a horizontal cross - section thereof , has a configuration of a trapezoid in which its width is gradually reduced with an increase of a distance from the intermediate section , and , in a cross - section of the forehead portion , has a configuration of a trapezoid in which its upper surface accesses to its lower surface with an increase of distance from the intermediate section . furthermore , it is preferred that an end surface of the inner side section at one side of the vertebral canal constitutes a part of a cylindrical inner surface of the section which surface accesses and declines to one side of the intermediate side section in the direction of a head . in the practice of the present invention , it is preferred that the biocompatible ceramic material used in the formation of the artificial spine is a glass ceramics or a calcium phosphate compound having a ca / p ratio in the range of about 1 . 0 to 2 . 0 . the calcium phosphate compound having a ca / p ratio of about 1 . 0 to 2 . 0 usable in the present invention includes a wide variety of apatites such as hydroxyapatite , fluoroapatite and the like , monobasic calcium phosphate , dibasic calcium phosphate , tricalcium phosphate , tetracalcium phosphate , and others . these calcium phosphate compounds may be used alone or as a mixture of two or more compounds . the calcium phosphate compounds may be produced in accordance with any well - known production methods including a wet synthesis process , a dry synthesis process and others . for example , they may be produced by drying a slurry of the starting calcium phosphate compound , followed by calcinating the dried product at a temperature of about 500 to 800 ° c . and then sintering at a temperature of about 800 to 1 , 400 ° c . after sintering , the resulting blocked body is fabricated to obtain a desired shape and size . alternatively , they may be produced from powders of the above - described calcium phosphate compound by preparing a pressed powder body having a desired shape and size , followed by sintering the powder body as in the above sintering process . in the artificial spine of the present invention , if at least a surface portion of the spine is formed from a porous ceramic material having a good biocompatibility , since the ceramic material has a good affinity with a surrounding bone tissue , a bone union can be accelerated as a function of the permeation of the bone tissue into pores of the ceramic material . the porous ceramic material used herein is preferably those having open pores . in a porous ceramic material , its pore size or diameter and its porosity are not particularly restricted , however , generally , it is preferred that the pore size is in the range of about 2 to 2 , 000 μm , and the porosity is in the range of about 30 to 80 %, more preferably about 40 to 70 %. a core portion of the artificial spine may be formed from a dense or porous ceramic material . usable ceramic material includes a calcium phosphate compound having a ca / p ratio in the range of about 1 . 0 to 2 . 0 , alumina , titania , zirconia , and the like . among these materials , the calcium phosphate compound can be suitably used . when a layer of the porous biocompatible material is intended to be applied over a surface of the core portion consisting of a dense ceramic material , the method for applying the porous layer is not particularly restricted , and accordingly any conventional methods may be used in the formation of such porous layer . suitable methods include , for example , flame spraying , sputtering , impregnation , spray coating , and the like . the artificial spine of the present invention can satisfy its requirements , if at least a surface portion of the spine is made from a biocompatible and porous ceramic material as described above , however , it is preferred that the artificial spine is made , as a whole , from a porous ceramic material having biocompatibility . the artificial spine according to the present invention will be further described with reference to the accompanying drawings . in the drawings , fig1 to 4 illustrate one working example of the artificial spine 10 of the present invention , and fig5 and 6 illustrate an expansion operation of the vertebral canal in which the operation is carried out by dividing the cervical spine , and insertion of the artificial spine 10 of the present invention in a gap of the divided spines , respectively . for the spinal longitudinal separation using the artificial spine 10 of the present invention , as is illustrated in fig5 a spine 21 of the cervical spine ( the fourth cervical spine is illustrated ) 20 is longitudinally divided in its middle line along the cutting lines 22a , and at the same time , a tip portion of the same spine 21 is cut in and removed from the cutting lines 22b . the expansion operation of the vertebral canal is carried out by bending the resulting divided spines 21a into right and left directions ( right and left of fig5 and 6 ). the reference numerals 23 and 24 represent a centrum of vertebrae and a vertebral canal , respectively . as is illustrated in fig1 to 4 , the artificial spine 10 of the present invention is constituted from an intermediate section 11 , an inner side section 12 and an outer side section 13 . the intermediate section 11 has a pair of contacting surfaces 11a in both ends thereof . in use of the artificial spine 10 , the contacting surfaces 11a can be disposed along the outer end 21b of the divided spines 21a obtained upon the cutting of the spine 10 . the inner side section 12 has a configuration capable of extending from a central portion of the intermediate section 11 to a space formed between a pair of the divided spines 21a . in a horizontal cross - section thereof , the inner side section 12 has a width which is gradually reduced in the direction of the vertebral canal 24 . further , in this inner side section 12 , its end surface positioning at a side ( inner side ) of the vertebral canal 24 constitutes a part of a cylindrical inner surface 12a of the same section 12 , and , as is illustrated in fig2 and 4 , the cylindrical inner surface 12a is declining to the intermediate side section 11 in the direction of a head . a curved surface of the cylindrical inner surface 12a is provided so that it can satisfy the requirement concerning a height of a spinal cord - dural canal which will be received and positioned in the inner surface 12a , and an anlge θ ( see , fig4 ) is provided so that it can be conformed to an angle of the side edge of the divided spines 21a , thereby ensuring a parallel maintenance of the cylindrical inner surface 12a of the artificial spine 10 to the spinal cord - dural canal . the outer side section 13 has a configuration capable of extending from a central portion of the intermediate section 11 to a direction which is opposite to a pair of the divided spines 21a . as in the above - described inner side section 12 , in a horizontal cross - section thereof , the outer side section 13 has a width which is gradually reduced in the direction of its tip portion . further , the outer side section 13 has an upper surface which is gradually declining in the direction of its lower surface , and , in a cross - section of the forehead portion ( perpendicular cross - section ), has a configuration of a trapezoid . the configuration of this outer side section 13 is similar to that of a real spine , and thus it is expected that the artificial spine of the present invention can effectively act in the adhesion and reconstruction of muscles . in each of the inner side section 12 and the outer side section 13 , there is a thread insertion through - hole 12b and 13b for inserting a fixation thread such as nylon wire for fixing the artificial spine 10 to the divided spines 21a formed therein , respectively , and , in the intermediate section 11 , there is a thread insertion ( and fixation ) groove 11b formed in each of the ends of the pair of contacting surfaces 11a . in addition , in the outer side section 13 , there is a bonding - facilitating hole 13c for facilitating the bonding of the artificial spine 10 to a surrounding tissue ( paravertebral muscles ). the artificial spine 10 having the above - described structure is inserted into and fixed to between a pair of divided spines 21a in such a manner that the inner side section 12 is directed to a side of the vertebral canal 24 and the outer side section 13 , in its cross - section of the forehead portion , has a lower and flat surface directed to a side of the legs . in this insertion of the artificial spine 10 , it is preferred that removable portion 21c is shaped and removed from a base portion of the cervical spine 20 so that the pair of divided spines 21a can be easily deformed . then , the pair of contacting surfaces 11a of the intermediate section 11 are intimately contacted to each of the outer end portion 21b of the corresponding pair of divided spines 21a , thereby stabilizing the fixed artificial spine 10 , and the fixation threads are guided through the thread insertion through - hole 12b of the inner side section 12 , the thread insertion groove 11b of the intermediate section 11 and the thread insertion through - hole 13b of the outer side section 13 as well as a fixation hole bored in the divided spines 21a . as a result , the artificial spine 10 is fixed to the divided spines 21a . after the operation , an adhesion of the artificial spine 10 with the surrounding muscles and reconstruction of the supporting structure can be expected as a function of the outer side section 13 and its bonding - facilitating hole 13c . using the artificial spine 10 of the present invention , it becomes possible to construct a bonding between the spine and the proper dorsal muscles , and reconstruct a mechanical supporting structure of the cervical spine . the present invention will be further described with reference to the production of the artificial spine of the present invention which is illustrated in fig1 to 4 . note , however , that the present invention should not be restricted to these examples . calcinated apatite powders and methyl cellulose powders were blended in a rotary mixer . the resulting mixed powders were contained in a rubber - made mold , and a pressure of 2t / cm 2 was applied to the powders in a hydrostatic press to obtain a dried product . the dried product was then fabricated in an nc machine , in anticipation of shrinkage of the product during sintering , to obtain a shape illustrated in the figures . the fabricated product was fired at a temperature of 1 , 100 ° c . for 2 hours in an electric oven . calcinated apatite powders and methyl cellulose powders were dissolved in pure water , and thoroughly mixed . the resulting suspension was foamed in a foaming machine , and then dried for about one hour in a drying machine to obtain a dried porous product . the dried product was then fabricated in a nc machine , in anticipation of shrinkage of the product during sintering , to obtain a shape illustrated in the figures . the fabricated product was fired at a temperature of 1 , 200 ° c . for about 3 days in an electric oven . calcinated apatite powders were subjected to a primary compression process to obtain a molded product . a pressure of 2t / cm 2 was applied to the molded product in a hydrostatic press to obtain a dried product . the dried product was then fabricated in a nc machine , in anticipation of shrinkage of the product during sintering , to obtain a shape illustrated in the figures . the fabricated product was fired at a temperature of 1 , 100 ° c . for about 3 days in an electric oven . | 8 |
same elements have been designated with same reference numerals in the different drawings and the timing diagrams of fig5 , and 9 have been drawn out of scale . for clarity , only those elements which are useful to the understanding of the present invention have been shown in the drawings and will be described hereafter . in particular , the details constitutive of the control pulse train generation circuits of the cut - off switches of the shown converters have not been detailed and are no object of the present invention , the present invention being compatible with the use of any conventional pulse train generation circuit . the present invention will be described in relation with an example of application to step - up converters . however , it more generally applies to any converter , be it a voltage step - up or step - down converter , the assembly of the inductive element of the switch and of the diode , although different according to the converter type , having no influence upon the operation of the present invention . a feature of one embodiment of the present invention is to devote to each of the loads periodic supply time windows , different from one load to another . fig4 very schematically shows in the form of blocks an embodiment of a power converter for supplying two loads 11 and 12 according to the present invention . in this example , loads 11 and 12 are series associations of light - emitting diodes forming , for example , the backlighting elements of a screen . for example , load 11 ( q 1 ) comprises four light - emitting diodes led in series while load 12 ( q 2 ) only has two . the actual power conversion circuit uses many of the same components as the conventional circuit of fig1 or 2 . thus , a cut - off switch m is connected to junction point 4 of an inductive element l with a diode d between a terminal 3 of application of a d . c . input voltage vdc and a terminal 1 connected to ground 2 by a capacitor c for providing an output supply voltage vout . a circuit 5 for providing control pulses of cut - off switch m is similar to the conventional circuit described in relation with fig1 and 2 . circuit 5 comprises an input for receiving a reference signal or of the value of the desired output voltage , an input for receiving a regulation signal fb and an input for receiving a clock signal f m of relatively high frequency ( generally , several hundreds of kilohertz ). each load 11 or 12 is connected in series with a switch k 1 or k 2 , respectively , between terminal 1 and a first terminal 6 of a current - to - voltage conversion resistor r having its other terminal connected to ground 2 . feedback signal fb is sampled from terminal 6 . each switch is controlled by a signal ct 1 or ct 2 , respectively , provided by a circuit 7 ( μc ), for example , a microcontroller . circuit 7 receives , for example , one or several reference signals ct setting the control needs of loads 11 and 12 , and defines the time periods assigned to each load with a relatively low frequency as compared to the relatively high cut - off frequency of supply voltage vdc . fig5 a , 5b , 5 c , and 5 d illustrate , in the form of timing diagrams , the operation of a power converter such as shown in fig4 . fig5 a illustrates the on periods ( on ) of switch k 1 . fig5 b illustrates the on periods ( on ) of switch k 2 . fig5 c illustrates the periods during which circuit 5 is active ( act ), that is , provides a control pulse train to switch m to regulate output voltage vout . fig5 d illustrates an example of a turn - on pulse train ( on ) of switch m . the present invention takes advantage from the fact that the loads that the converter must supply ( especially light - emitting diodes ) have a proper operation , even if they do not permanently receive a voltage . in particular , for diodes , their lighting has a sufficient remanence to enable periods when their supply is stopped . to achieve this , account is taken of this remanence of the diodes ( or more generally of the periods during which the load , for example , a motor , can temporarily receive no supply ) to set the repetition frequency ( period t , fig5 c ) of periods t 1 , respectively , t 2 , of supply of each of the loads . for the system to properly operate , another condition is that the frequency ( 1 / t ) of the respective supply periods of the different loads is smaller than control frequency f m of the cut - off switch . this condition is illustrated by fig5 d which shows that period t m of the pulses provided by circuit 5 is very low as compared to repetition period t of the control sequences of loads 11 and 12 . repetition period t of periods t 1 and t 2 assigned to loads 11 and 12 is short as compared to the average on time of the loads ( at least a few seconds in the case of backlighting diodes ) and long as compared to the duration ( the longest in the case of an fwm frequency modulation ) of the strobe pulses . for example , period t is at least 100 times greater than the duration of the strobe pulses and at least 10 times smaller than the average on time of the loads . an advantage of the converter of fig4 is that it enables an independent regulation on each of the branches supplied by the converter . another advantage resulting therefrom is that the loads can thus be regulated in power variation independently from each other . it is enough to synchronize reference or with periods t 1 and t 2 . this power variation is , for example , directly conditioned by signal or provided to circuit 5 and made variable by microcontroller 7 according to a power reference value that it receives for the considered load . another advantage , more specifically as compared to the diagram of fig2 , is that it avoids a permanent consumption in the circuit and thus enables true shutdown of the converter and of the supplied loads . another advantage is that it preserves the use of a single power converter whatever the number of loads to be supplied . in particular , as illustrated in fig4 , microcontroller 7 may provide one or several additional control signals cti to other loads . the only condition is that all loads be likely to be periodically supplied with a frequency which is compatible with their “ remanence ” and which is smaller than the switched - mode power supply frequency . preferably , the respective load supply periods ( periods t 1 and t 2 ) do not overlap . accordingly , at most , the duty cycle of the two control signals ct 1 and ct 2 of switches k 1 and k 2 is inverted . a resulting advantage is that the converter of fig4 enables optimizing the size of cut - off switch m since the maximum output voltage corresponds to the voltage required by the greatest load . fig6 illustrates a simplified embodiment of a circuit 7 ′ for providing signals ct 1 and ct 2 in the case where the periods assigned to the two loads 11 and 12 are complementary ( for example , 60 % and 40 %, 20 % and 80 %, etc .). in this case , circuit 7 ′ comprises a simple inverter inv receiving a control signal ct as an input , and provides two outputs respectively with the reproduced input signal ct ( signal ct 1 ) and this signal ct inverted ( signal ct 2 ). fig7 a , 7b , and 7 c illustrate in timing diagrams the operation of control circuit 7 ′. they show an example of control signal ct ( fig7 a ), signal ct 1 ( fig7 b ), and signal ct 2 ( fig7 c ). fig8 shows an embodiment of a circuit 10 for synchronizing switches k 1 and k 2 according to an optional embodiment of the present invention . it shows all the elements described in relation with fig4 , except the number of light - emitting diodes led of the loads ( load 11 here comprises three light - emitting diodes led while load 12 comprises 4 ). in this example , switches k 1 and k 2 are formed of mos transistors . the function of circuit 10 is to operate transistors k 1 and k 2 in linear mode during the supply transition from one load to the other . to achieve this , a current - limiting element 13 receives a reference ref on a first terminal while its second terminal is connected to node 6 of connection of switches k 1 and k 2 to resistor r . the output of current - limiting element 13 is connected to the respective gates of switches k 1 and k 2 via switches 14 and 15 respectively controlled by signals ct 1 and ct 2 . according to this embodiment , signal fb is sampled upstream of switches k 1 and k 2 . accordingly , two switches 16 and 17 respectively connect the interconnection nodes of loads 11 and 12 with their switches k 1 and k 2 to the input terminal of signal fb of circuit 5 . their switches 16 and 17 are respectively controlled by signals ct 1 and ct 2 . finally , two switches 18 and 19 connect the respective gates of mos transistors k 1 and k 2 to ground 2 . switch 18 associated with transistor k 2 is controlled by signal ct 1 while switch 19 associated with transistor k 1 is controlled by signal ct 2 . fig9 a , 9b , 9 c , 9 d , and 9 e illustrate in timing diagrams the operation of the circuit of fig8 . fig9 a illustrates the on periods ( on ) of switches 14 , 16 , and 18 controlled by signal ct 1 . fig9 b illustrates the on periods ( on ) of switches 15 , 17 , and 19 controlled by signal ct 2 . fig9 c illustrates the shape of current il 1 in load 11 . fig9 d illustrates the shape of current il 2 in load 12 . fig9 e illustrates the shape of voltage vout . it is assumed that at a time t 0 , the power converter is activated and microcontroller 7 sets a first period t 1 of conduction of the first load 11 . switches 14 , 16 , and 18 are on while switches 15 , 17 , and 19 are off . starting from a discharge state , voltage vout increases from zero to reach a voltage level v 1 corresponding to the reference value provided by microcontroller 7 . current il 1 in the load increases at the same time , to reach a nominal current inom adapted to light - emitting diodes led . at the end of period t 1 , switches 14 , 16 , and 18 are turned off ( time t 1 ). it is assumed in the left - hand portion of the timing diagrams of fig9 that the duty cycles are not inverted . accordingly , time t 2 of beginning of the supply of load 12 and of turning - on of switches 15 , 17 , and 19 is delayed with respect to time t 1 . load 12 comprises more light - emitting diodes than the first one , voltage vout must , for a same current inom , be higher ( level v 2 ) than on supply of load 11 . in the case of a power variation conditioned by reference value or on circuit 5 , levels v 1 and v 2 are accordingly adapted . on the side of current il 2 , the presence of current - limiting element 13 avoids a peak linked to the turning - on of the different switches . it is assumed that at a time t 3 , period t 2 of supply of the second load stops . level vout remains at level v 2 until the next time to of starting of the first load . at this time , level vout falls to level v 1 while current il 1 increases in the first load . in the vicinity of level v 1 , a slight drop in level vout ( point p ) due to the regulation can be observed . in the right - hand portion of the timing diagrams of fig9 , a duty cycle of 50 % is assumed for each of loads 11 and 12 . times t 1 ′ ( end of periods t 1 ) and t 2 ′ ( start of periods t 2 ) are confounded , and times t 0 ′ ( start of periods t 1 ) and t 3 ′ ( end of periods t 2 ) are confounded due to the 50 % duty cycle . as in the previous case , current limiter 13 avoids current peaks at times t 2 ′. of course , the present invention is likely to have various , alterations , improvements , and modifications which will readily occur to those skilled in the art . in particular , although the present invention has been described in relation with a voltage step - up converter , it also applies with no modification of the controls to a voltage step - down converter . the only difference lies in the actual conversion stage , which remains conventional . further , the generation of the control signals adapted to the operation of the power converter and of the controlled loads is within the abilities of those skilled in the art based on the functional indications given hereabove and by using conventional tools . moreover , more than two loads can be controlled independently from one another . finally , within a same period t , a different number of periods from one load to another may be provided instead of one period , respectively , t 1 or t 2 for each load . for example , a unity duration of supply of all the loads is set as a quotient of period t and a unity number of durations is assigned to each load according to the power desired for this load . such alterations , modifications , and improvements are intended to be part of this disclosure , and are intended to be within the spirit and the scope of the present invention . accordingly , the foregoing description is by way of example only and is not intended to be limiting . the present invention is limited only as defined in the following claims and the equivalents thereto . | 7 |
the practice of the present invention employs , unless otherwise indicated , conventional molecular biology , cellular biology , and recombinant dna techniques within the skill of the art . such techniques are well known to the skilled worker , and are explained fully in the literature . see , e . g ., sambrook and russell “ molecular cloning : a laboratory manual ” ( 2001 ); cloning : a practical approach ,” volumes i and ii ( d . n . glover , ed ., 1985 ); “ oligonucleotide synthesis ” ( m . j . gait , ed ., 1984 ); “ nucleic acid hybridisation ” ( b . d . hames & amp ; s . j . higgins , eds ., 1985 ); “ antibodies : a laboratory manual ” ( harlow & amp ; lane , eds ., 1988 ); “ transcription and translation ” ( b . d . hames & amp ; s . j . higgins , eds ., 1984 ); “ animal cell culture ” ( r . i . freshney , ed ., 1986 ); “ immobilised cells and enzymes ” ( irl press , 1986 ); b . perbal , “ a practical guide to molecular cloning ” ( 1984 ), and sambrook , et al ., “ molecular cloning : a laboratory manual ” ( 1989 ). ausubel , f . et al ., 1989 - 1999 , “ current protocols in molecular biology ” ( green publishing , new york ). before the present methods are described , it is understood that this invention is not limited to the particular materials and methods described , as these may vary . it is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only , and is not intended to limit the scope of the present invention which will be limited only by the appended claims . it must be noted that as used herein and in the appended claims , the singular forms “ a ,” “ an ,” and “ the ” include plural reference unless the context clearly dictates otherwise . thus , for example , a reference to “ a transcription factor ” includes a plurality of such factors , and a reference to “ a primer ” is a reference to one or more primers and equivalents thereof known to those skilled in the art , and so forth . unless defined otherwise , all technical and scientific terms used herein have the same meanings as commonly understood by one of ordinary skill in the art to which this invention belongs . although any materials and methods similar or equivalent to those described herein can be used to practice or test the present invention , the preferred materials and methods are now described . all publications mentioned herein are cited for the purpose of describing and disclosing the cell lines , protocols , reagents and vectors which are reported in the publications and which might be used in connection with the invention . nothing herein is to be construed as an admission that the invention is not entitled to antedate such disclosure by virtue of prior invention . in describing the present invention , the following terminology is used in accordance with the definitions set out below . abbreviations used bsa bovine serum albumin dmso dimethyl sulfoxide dna deoxyribonucleic acid edta ethylenediaminetetraacetic acid fan amine - reactive succinimidyl ester of carboxyfluorescein flu fluorescein il interleukin lc - 640 lightcycler ® red 640 led light emitting diode pcr polymerase chain reaction rast radioallergosorbent test rna ribonucleic acid rt - pcr reverse - transcriptase polymerase chain reaction taq thermophilus aquaticus t m melting temperature “ transcription factor ” or “ transcription factor protein ” refers to a polypeptide or protein encoded by a transcription factor polynucleotide sequence ; a polypeptide that is the translated amino acid sequence of a polynucleotide sequence ; fragments thereof having greater than about 5 amino acid residues and comprising an immune epitope or other biologically active site of a transcription factor protein . the terms “ nucleic acid ” and “ polynucleic acid ” refer herein to deoxyribonucleic acid and ribonucleic acid in all their forms , i . e ., single and double - stranded dna , cdna , mrna , and the like . as used herein , the term “ encode ” in its various grammatical forms includes nucleotides and / or amino acids that correspond to other nucleotides or amino acids in the transcriptional and / or translational sense . as such , “ cytokine transcription factor nucleic acid ” is rna or dna that encodes a transcription factor . “ isolated ” cytokine transcription factor nucleic acid is cytokine transcription factor nucleic acid that is separated from ( or otherwise substantially free from ), contaminant nucleic acid encoding other polypeptides . the isolated cytokine transcription factor nucleic acid can be labelled for diagnostic and probe purposes , using a label as described further herein in the discussion of diagnostic assays and nucleic acid hybridization methods . for example , isolated cytokine transcription factor dna , or a fragment thereof comprising at least about 15 nucleotides , can be used as a hybridization probe to detect amplified cytokine transcription factor cdna resulting from increased mrna expression , such as may result from stimulation of pmbc with specific allergens . in one embodiment of the invention , total rna in a biological sample from a subject ( that is , a human or other mammal ) can be assayed for the presence of cytokine transcription factor mrna , wherein the increase in the amount of cytokine transcription factor mrna is a result of stimulus - induced activation / differentiation of transcription factors . one purpose of the present invention is to identify changes in the level of transcription factor nucleic acid expression after exposure to allergens . there are many techniques for detecting nucleic acid expression that can be employed . cytokine transcription factor expression may be measured in a biological sample directly , for example , by conventional southern blotting to quantitate dna , or northern blotting to quantitate mrna , using an appropriately labelled oligonucleotide hybridization probe , based on the known sequences of cytokine transcription factor . identification of cytokine transcription factor mrna within a mixture of various mrnas , is conveniently accomplished by the use of reverse transcriptase - polymerase chain reaction and an oligonucleotide hybridization probe that is labelled with a detectable moiety . various labels may be employed , most commonly radioisotopes , particularly 32 p . however , other techniques may also be employed , such as using biotin - modified nucleotides for introduction into a polynucleotide . the biotin then serves as the site for binding to avidin or antibodies , which may be labelled with a wide variety of labels , such as radioisotopes , fluorophores , chromophores , or the like . keller , et al ., dna probes , pp . 149 - 213 ( stockton press , 1989 ). alternatively , antibodies may be employed that can recognise specific duplexes , including dna duplexes , rna duplexes , and dna - rna hybrid duplexes or dna - protein duplexes . the antibodies in turn may be labelled and the assay may be carried out where the duplex is bound to a surface , so that upon the formation of duplex on the surface , the presence of antibody bound to the duplex can be detected . cytokine transcription gene expression may also be based on the functional or antigenic characteristics of the expressed protein , eg . immunoassays and the like . in one preferred embodiment , a biological sample is taken from a test subject who is suspected of , of who is susceptible to an abnormal immunological response . such an individual will likely to be atopic in that they are constitutionally or hereditarily likely to develop immediate hypersensitivity to allergens that provoke no immune reactions in normal subjects . biological samples may include a sample of tissue or fluid isolated from an individual , including but not limited to bone marrow , plasma , serum , spinal fluid , lymph fluid , the external sections of the skin , respiratory , intestinal , and genitourinary tracts , tears , saliva , milk , blood ; both whole blood and anticoagulated whole blood , blood cells , tumours , organs , and also includes samples of in vivo cell culture constituents . however , it is preferable that the biological sample is blood , lymph fluid , or a blood component . most preferably the biological sample is leukocytes isolated from peripheral blood . also included in the term are derivatives and fractions of such cells and fluids . the leukocytes in the biological sample may be substantially isolated ie separated from ( or otherwise substantially free from ), other contaminant cells . the biological sample is then exposed to an agent which is capable of inducing expression of a transcription factor which modulates expression of a cytokine , including but not limited to specific allergens , heterologous or self antigens , mitogens such as concanavalin a or phytohaemagglutinin , and hormones such as progesterone , oestrogen or oestradiol . this step constitutes the stimulation phase of the described method . following exposure to the agent expression levels of cytokine transcription factors are determined or measured . in one preferred method , mrna in a biological sample is reverse transcribed to generate a cdna strand . the cdna may be amplified by conventional techniques , such as polymerase chain reaction , to provide sufficient amounts for analysis . amplification may also be used to determine whether a specific sequence is present , by using a primer that will specifically bind to the desired sequence , where the presence of an amplification product is indicative that a specific binding complex was formed . alternatively , the mrna sample is fractionated by electrophoresis , eg . capillary or gel electrophoresis , transferred to a suitable support , eg . nitrocellulose and then probed with a fragment of the transcription factor sequence . other techniques may also find use , including oligonucleotide ligation assays , binding to solid - state arrays , etc . detection of mrna having the subject sequence is indicative gene expression of the transcription factor in the sample . “ polymerase chain reaction ,” or “ pcr ,” as used herein generally refers to a method for amplification of a desired nucleotide sequence in vitro , as described in u . s . pat . no . 4 , 683 , 195 . in general , the pcr method involves repeated cycles of primer extension synthesis , using two oligonucleotide primers capable of hybridizing preferentially to a template nucleic acid . typically , the primers used in the pcr method will be complementary to nucleotide sequences within the template at both ends of or flanking the nucleotide sequence to be amplified , although primers complementary to the nucleotide sequence to be amplified also may be used . see wang , et al ., in pcr protocols , pp . 70 - 75 ( academic press , 1990 ); ochman , et al ., in pcr protocols , pp . 219 - 227 ; triglia , et al ., nuc . acids res . 16 : 8186 ( 1988 ). “ oligonucleotides ” are short - length , single - or double - stranded polydeoxynucleotides that are chemically synthesized by known methods ( involving , for example , triester , phosphoramidite , or phosphonate chemistry ), such as described by engels , et al ., agnew . chem . int . ed . engl . 28 : 716 - 734 ( 1989 ). they are then purified , for example , by polyacrylamide gel electrophoresis . as used herein , the term “ pcr reagents ” refers to the chemicals , apart from the target nucleic acid sequence , needed to perform the pcr process . these chemicals generally consist of five classes of components : ( i ) an aqueous buffer , ( ii ) a water soluble magnesium salt , ( iii ) at least four deoxyribonucleotide triphosphates ( dntps ), ( iv ) oligonucleotide primers ( normally two primers for each target sequence , the sequences defining the 5 ′ ends of the two complementary strands of the double - stranded target sequence ), and ( v ) a polynucleotide polymerase , preferably a dna polymerase , more preferably a thermostable dna polymerase , ie a dna polymerase which can tolerate temperatures between 90 ° c . and 100 ° c . for a total time of at least 10 minutes without losing more than about half its activity . the four conventional dntps are thymidine triphosphate ( dttp ), deoxyadenosine triphosphate ( datp ), deoxycitidine triphosphate ( dctp ), and deoxyguanosine triphosphate ( dgtp ). these conventional triphosphates may be supplemented or replaced by dntps containing base analogues which watson - crick base pair like the conventional four bases , eg deoxyuridine triphosphate ( dutp ). a detectable label may be included in an amplification reaction . suitable labels include fluorochromes , eg . fluorescein isothiocyanate ( fitc ), rhodamine , texas red , phycoerythrin , allophycocyanin , 6 - carboxyfluorexcein ( 6 - fam ), 2 ′, 7 ′- dimethoxy - 4 ′, 5 ′- dichloro - 6 - carboxyfluorescein ( joe ), 6 - carboxy - x - rhodamine ( rox ), 6 - carboxy - 2 ′, 4 ′, 7 ′, 4 , 7 - hexachlorofluorescein ( hex ), 5 - carboxyfluorescein ( 5 - fam ) or n , n , n ′, n ′- tetramethyl - 6 - carboxyrhodamine ( tamra ), radioactive labels , eg . 32p , 35s , 3h ; as well as others . the label may be a two stage system , where the amplified dna is conjugated to biotin , haptens , or the like having a high affinity binding partner , eg . avidin , specific antibodies , etc ., where the binding partner is conjugated to a detectable label . the label may be conjugated to one or both of the primers . alternatively , the pool of nucleotides used in the amplification is labelled , so as to incorporate the label into the amplification product . accordingly , in one preferred embodiment , once the cytokine transcription factor mrna has been reverse transcribed and amplified by pcr , it is detected by various means including oligonucleotide probes . oligonucleotide probes of the invention are dna molecules that are sufficiently complementary to regions of contiguous nucleic acid residues within the cytokine transcription factor nucleic acid to hybridise thereto , preferably under high stringency conditions . exemplary probes include oligomers that are at least about 15 nucleic acid residues long and that are selected from any 15 or more contiguous residues of dna of the present invention . preferably , oligomeric probes used in the practice of the present invention are at least about 20 nucleic acid residues long . the present invention also contemplates oligomeric probes that are 150 nucleic acid residues long or longer . those of ordinary skill in the art realise that nucleic hybridisation conditions for achieving the hybridisation of a probe of a particular length to polynucleotides of the present invention can readily be determined . such manipulations to achieve optimal hybridisation conditions for probes of varying lengths are well known in the art . see , e . g ., sambrook et al ., molecular cloning : a laboratory manual , second edition , cold spring harbor ( 1989 ), incorporated herein by reference . preferably , oligomeric probes of the present invention are labelled to render them readily detectable . detectable labels may be any species or moiety that may be detected either visually or with the aid of an instrument . commonly used detectable labels are radioactive labels such as , for example , 32 p , 14 c , 125 i , 3 h , and 35 s . examples of fluorescer - quencher pairs may be selected from xanthene dyes , including fluoresceins , and rhodamine dyes . many suitable forms of these compounds are widely available commercially with substituents on their phenyl moieties which can be used as the site for bonding or as the bonding functionality for attachment to an oligonucleotide . another group of fluorescent compounds are the naphthylamines , having an amino group in the alpha or beta position . included among such naphthylamino compounds are 1 - dimethylaminonaphthyl - 5 - sulfonate , 1 - anilino - 8 - naphthalene sulfonate and 2 - p - touidinyl - 6 - naphthalene sulfonate . other dyes include 3 - phenyl - 7 - isocyanatocoumarin , acridines , such as 9 - isothiocyanatoacridine acridine orange ; n -( p -( 2 - benzoaxazolyl ) phenyl ) maleimide ; benzoxadiazoles , stilbenes , pyrenes , and the like . most preferably , the fluorescent compounds are selected from the group consisting of vic , carboxy fluorescein ( fam ), lightcycler ® 640 and cy5 . biotin - labelled nucleotides can be incorporated into dna or rna by such techniques as nick translation , chemical and enzymatic means , and the like . the biotinylated probes are detected after hybridisation , using indicating means such as avidin / streptavidin , fluorescent labelling agents , enzymes , colloidal gold conjugates , and the like . nucleic acids may also be labelled with other fluorescent compounds , with immunodetectable fluorescent derivatives , with biotin analogues , and the like . nucleic acids may also be labelled by means of attachment to a protein . nucleic acids cross - linked to radioactive or fluorescent histone single - stranded binding protein may also be used . those of ordinary skill in the art will recognise that there are other suitable methods for detecting oligomeric probes and other suitable detectable labels that are available for use in the practice of the present invention . moreover , fluorescent residues can be incorporated into oligonucleotides during chemical synthesis . two dna sequences are “ substantially similar when at least about 85 %, preferably at least about 90 %, and most preferably at least about 95 %, of the nucleotides match over the defined length of the dna sequences . sequences that are substantially similar can be identified for example in a southern hybridisation experiment performed under stringent conditions as defined for that particular system . defining appropriate hybridisation conditions is within the skill of the art . see e . g ., maniatis et al ., dna cloning , vols . i and ii . nucleic acid hybridisation . however , briefly , “ stringent conditions ” for hybridisation or annealing of nucleic acid molecules are those that ( 1 ) employ low ionic strength and high temperature for washing , for example , 0 . 015m nacl / 0 . 0015m sodium citrate / 0 . 1 % sodium dodecyl sulfate ( sds ) at 50 ° c ., or ( 2 ) employ during hybridisation a denaturing agent such as formamide , for example , 50 % ( vol / vol ) formamide with 0 . 1 % bovine serum albumin / 0 . 1 % ficoll / 0 . 1 % polyvinylpyrrolidone / 50 mm sodium phosphate buffer at ph 6 . 5 with 750 mm nacl , 75 mm sodium citrate at 42 ° c . another example is use of 50 % formamide , 5 × ssc ( 0 . 75m nacl , 0 . 075m sodium citrate ), 50 mm sodium phosphate ( ph 6 . 8 ), 0 . 1 % sodium pyrophosphate , 5 × denhardt &# 39 ; s solution , sonicated salmon sperm dna ( 50 μg / ml ), 0 . 1 % sds , and 10 % dextran sulfate at 42 ° c ., with washes at 42 ° c . in 0 . 2 × ssc and 0 . 1 % sds . in a particularly preferred embodiment the present invention utilises a combined pcr and hybridisation probing system so as to make the most of the closed tube or homogenous assay systems such as the use of fret probes as disclosed in us patents ( u . s . pat . nos . 6 , 140 , 054 ; 6 , 174 , 670 ), the entirety of which are also incorporated herein by reference . in one of its simplest configurations , the fret or “ fluorescent resonance energy transfer ” approach employs two oligonucleotides which bind to adjacent sites on the same strand of the nucleic acid being amplified . one oligonucleotide is labelled with a donor fluorophore which absorbs light at a first wavelength and emits light in response , and the second is labelled with an acceptor fluorophore which is capable of fluorescence in response to the emitted light of the first donor ( but not substantially by the light source exciting the first donor , and whose emission can be distinguished from that of the first fluorophore ). in this configuration , the second or acceptor fluorophore shows a substantial increase in fluorescence when it is in close proximity to the first or donor fluorophore , such as occurs when the two oligonucleotides come in close proximity when they hybridise to adjacent sites on the nucleic acid being amplified ( for example in the annealing phase of pcr ) forming a fluorogenic complex . as more of the nucleic acid being amplified accumulates , so more of the fluorogenic complex can be formed and there is an increase in the fluorescence from the acceptor probe , and this can be measured . hence the method allows detection of the amount of product as it is being formed . in another simple embodiment , and as applies to use of fret probes in pcr based assays , one of the labelled oligonucleotides may also be a pcr primer used for pcr . in this configuration , the labelled pcr primer is part of the dna strand to which the second labelled oligonucleotide hybridises , as described by neoh et al ( j clin path 1999 ; 52 : 766 - 769 . ), von ahsen et al ( clin chem 2000 ; 46 : 156 - 161 ), the entirety of which are encompassed by reference . it will be appreciated by those of skill in the art that amplification and detection of amplification with hybridisation probes can be conducted in two separate phases — for example by carrying out pcr amplification first , and then adding hybridisation probes under such conditions as to measure the amount of nucleic acid which has been amplified . however , a preferred embodiment of the present invention utilises a combined pcr and hybridisation probing system so as to make the most of the closed tube or homogenous assay systems and is carried out on a roche lightcycler ® or other similarly specified or appropriately configured instrument . such systems would also be adaptable to the detection methods described here . those skilled in the art will appreciate that such probes can be used for allele discrimination if appropriately designed for the detection of point - mutations , in addition to deletion and insertions . alternatively or in addition , the unlabelled pcr primers may be designed for allele discrimination by methods well known to those skilled in the art ( ausubel 1989 - 1999 ). it will also be appreciated by those skilled in the art that detection of amplification in homogenous and / or closed tubes can be carried out using numerous means in the art , for example using taqman ® hybridisation probes in the pcr reaction and measurement of fluorescence specific for the target nucleic acids once sufficient amplification has taken place . however , because of the nature and speed of the roche lightcycler ®, the preferred method is by using real - time pcr and melting curve analysis on the roche lightcycler ® using fluorescent labelled hybridisation oligonucleotides . although those skilled in the art will be aware that other similar quantitative “ real - time ” and homogenous nucleic acid amplification / detection systems exist such as those based on the taqman approach ( u . s . pat . nos 5 , 538 , 848 and 5 , 691 , 146 ), fluorescence polarisation assays ( eg gibson et al ., clin chem , 1997 ; 43 : 1336 - 1341 ), and the invader assay ( eg agarwal p et al ., diagn mol pathol 2000 sep ; 9 ( 3 ): 158 - 164 ; ryan d et al , mol diagn 1999 jun ; 4 ( 2 ): 135 - 144 ). such systems would also be adaptable to use the invention described , enabling real - time monitoring of nucleic acid amplification . in one embodiment of the present invention an initial procedure involves the manufacture of the oligonucleotide matrices or microchips . the microchips contain a selection of immobilized synthetic oligomers , said oligomers synthesized so as to contain complementary sequences for desired portions of transcription factor dna . the oligomers are then hybridized with cloned or polymerase chain reaction ( pcr ) amplified transcription factor nucleic acids , said hybridization occurring under stringent conditions , outlined infra . the high stringency conditions insure that only perfect or near perfect matches between the sequence embedded in the microchip and the target sequence will occur during hybridization . after each initial hybridization , the chip is washed to remove most mismatched fragments . the reaction mixture is then denatured to remove the bound dna fragments , which are subsequently labeled with a fluorescent marker . a second round of hybridization with the labeled dna fragments is then carried out on sequence microchips containing a different set of immobilized oligonucleotides . these fragments first may be cleaved into smaller lengths . the different set of immobilized nucleotides may contain oligonucleotides needed for whole sequencing , partial sequencing , sequencing comparison , or sequence identification . ultimately , the fluorescence from this second hybridization step can be detected by an epifluorescence microscope coupled to a ccd camera . ( see u . s . pat . no . 5 , 851 , 772 incorporated herein by reference ). gene expression , alternatively , may be measured by immunological methods , such as immunohistochemical staining of tissue sections and assay of cell culture or body fluids , to quantitate directly the expression of the gene product , cytokine transcription factor . with immunohistochemical staining techniques , a cell sample is prepared , typically by dehydration and fixation , followed by reaction with labelled antibodies specific for the gene product coupled , where the labels are usually visually detectable , such as enzymatic labels , fluorescent labels , luminescent labels , and the like . a particularly sensitive staining technique suitable for use in the present invention is described by hsu , et al ., am . j . clin . path ., 75 : 734 - 738 ( 1980 ). antibodies useful for immunohistochemical staining and / or assay of sample fluids may be either monoclonal or polyclonal . conveniently , the antibodies may be prepared against a synthetic peptide based on known dna sequences of cytokines such as gata - 3 , t - bet , nfat , nfkκb , rog , stat4 , stat6 , irf - 1 , and c - maf . for example , the cytokine transcription factor peptide may be used as an immunogen to generate anti - cytokine transcription factor antibodies . such antibodies , which specifically bind to cytokine transcription factor , are useful as standards in assays for cytokine transcription factor , such as by labelling purified cytokine transcription factor for use as a standard in a radioimmunoassay , enzyme - linked immunoassay , or competitive - type receptor binding assays radioreceptor assay , as well as in affinity purification techniques . ordinarily , the anti - cytokine transcription factor antibody will bind cytokine transcription factor with an affinity of at least about 10 6 l / mole , and preferably at least about 10 7 l / mole . polyclonal antibodies directed toward cytokine transcription factor generally are raised in animals by multiple subcutaneous or intraperitoneal injections of cytokine transcription factor and an adjuvant . it may be useful to conjugate cytokine transcription factor or a peptide fragment thereof to a carrier protein that is immunogenic in the species to be immunised , such as keyhole limpet haemocyanin , serum albumin , bovine thyroglobulin , or soybean trypsin inhibitor , using a bifunctional or derivatizing agent , for example , maleimidobenzoyl sulfosuccinimide ester ( conjugation through cysteine residues ), n - hydroxysuccinimide ( conjugation through lysine residues ), glutaraldehyde , succinic anhydride , socl 2 , or r 1 n ═ c ═ nr , where r and r 1 are different alkyl groups . animals are immunised with such cytokine transcription factor - carrier protein conjugates combining 1 mg or 1 μg of conjugate ( for rabbits or mice , respectively ) with 3 volumes of freund &# 39 ; s complete adjuvant and injecting the solution intradermally at multiple sites . one month later the animals are boosted with ⅕th to { fraction ( 1 / 10 )} th the original amount of conjugate in freund &# 39 ; s complete adjuvant by subcutaneous injection at multiple sites . 7 to 14 days later animals are bled and the serum is assayed for anti - cytokine transcription factor antibody titre . animals are boosted until the antibody titre plateaus . preferably , the animal is boosted by injection with a conjugate of the same cytokine transcription factor with a different carrier protein and / or through a different cross - linking agent . conjugates of cytokine transcription factor and a suitable carrier protein also can be made in recombinant cell culture as fusion proteins . also , aggregating agents such as alum are used to enhance the immune response . monoclonal antibodies directed toward cytokine transcription factor are produced using any method which provides for the production of antibody molecules by continuous cell lines in culture . the modifier “ monoclonal ” indicates the character of the antibody as being obtained from a substantially homogeneous population of antibodies , and is not to be construed as requiring production of the antibody by any particular method . examples of suitable methods for preparing monoclonal antibodies include the original hybridoma method of kohler , et al ., nature 256 : 495 - 497 ( 1975 ), and the human b - cell hybridoma method , kozbor , j . immunol . 133 : 3001 ( 1984 ); brodeur , et al ., monoclonal antibody production techniques and applications , pp . 51 - 63 ( marcel dekker , inc ., new york , 1987 ). for diagnostic applications , anti - cytokine transcription factor antibodies typically will be labelled with a detectable moiety . the detectable moiety can be any one which is capable of producing , either directly or indirectly , a detectable signal . for example , the detectable moiety may be a radioisotope , such as 3 h , 14 c , 32 p , 35 s , or 125 i , a fluorescent or chemiluminescent compound , such as fluorescein isothiocyanate , rhodamine , or luciferin ; radioactive isotopic labels , such as , eg ., 125 i , 32 p , 14 c , or 3h , or an enzyme , such as alkaline phosphatase , beta - galactosidase or horseradish peroxidase . any method known in the art for separately conjugating the antibody to the detectable moiety may be employed , including those methods described by david , et al ., biochemistry 13 : 1014 - 1021 ( 1974 ); pain , et al ., j . immunol . meth . 40 : 219 - 231 ( 1981 ); and bayer , et al ., meth . enz . 184 : 138 - 163 ( 1990 ). the anti - cytokine transcription factor antibodies may be employed in any known assay method , such as competitive binding assays , direct and indirect sandwich assays , and immunoprecipitation assays . zola , monoclonal antibodies : a manual of techniques , pp . 147 - 158 ( crc press , inc ., 1987 ). the anti - cytokine transcription factor antibodies may also be used in western blots performed on protein gels or protein spots on filters , using a detection system specific for the transcription factor as desired , conveniently using a labelling method using conventional techniques . competitive binding assays rely on the ability of a labelled standard ( eg ., cytokine transcription factor or an immunologically reactive portion thereof ) to compete with the test sample analyte ( cytokine transcription factor ) for binding with a limited amount of antibody . the amount of cytokine transcription factor in the test sample is inversely proportional to the amount of standard that becomes bound to the antibodies . to facilitate determining the amount of standard that becomes bound , the antibodies generally are solubilised before or after the competition , so that the standard and analyte that are bound to the antibodies may conveniently be separated from the standard and analyte which remain unbound . sandwich assays involve the use of two antibodies , each capable of binding to a different immunogenic portion , or epitope , of the protein to be detected . in a sandwich assay , the test sample analyte is bound by a first antibody which is immobilised on a solid support , and thereafter a second antibody binds to the analyte , thus forming an insoluble three part complex . david , et al ., u . s . pat . no . 4 , 376 , 110 . the second antibody may itself be labelled with a detectable moiety ( direct sandwich assays ) or may be measured using an anti - immunoglobulin antibody that is labelled with a detectable moiety ( indirect sandwich assay ). for example , one type of sandwich assay is an elisa assay , in which case the detectable moiety is an enzyme . the invention will now be further described by way of reference only to the following non - limiting examples . it should be understood , however , that the examples following are illustrative only , and should not be taken in any way as a restriction on the generality of the invention described above . in particular , while the invention is described in detail in relation to the detection of gata - 3 from hdm exposed pmbc , it will be clearly understood that the findings herein are not limited to these specific allergens or cytokines . blood samples were obtained from five atopic adult volunteers , who were selected on the basis of positive serum ige responses to house dust mite ( hdm ), together with samples from five non - atopic controls who were tested for the presence of hdm - specific ige in serum and were all negative . the presence of ige to hdm was defined by the rast ( cap ) system ( pharmacia , australia ), and the positive volunteers in this study displayed rast ( cap ) scores ≧ 2 . the allergy status of the test and control subjects is summarised in table 1 . freshly isolated peripheral blood mononuclear cells ( pbmc ) were resuspended at 1 × 10 6 cells / ml and 1 ml of the cell suspension was cultured for 24 hours at 37 ° c ., 5 % co 2 in round bottom tubes in serum - free medium aim - v 4 ( life technologies , mulgrave , australia ) supplemented with 4 × 10 − 5 2 - mercaptoethanol , with or without the addition of 10 μg / ml of whole extract of hdm ( dermatophagoides pteronyssinus , csl limited , parkville , australia ), or with the polyclonal mitogen soluble monoclonal anti - cd3 antibody ( 1 : 100 culture supernatant from okt3 cell line , atcc , usa ) in combinatin with 20 u / ml recombinant human il - 2 . after culture , the cells were centrifuged , the supernatants were collected and stored at − 20 ° c . for future analysis of cytokine content , and the cell pellet was used immediately for total rna extraction . messenger rna encoding the transcription factors gata - 3 and c - maf was assayed by reverse transcriptase pcr ( rt - pcr ). messenger rna encoding beta - actin was assayed as a control for non - specific protein synthesis . pcr products were generated and detected generally as previously described ( macaubas et al ., 1999 ; yabuhara et al ., 1997 ). the gata - 3 primer sequences employed , which generated a 454 bp product , were 5 ′ gac gag aaa gag tgc ctc aag 3 ′ and 5 ′ tcc aga gtg tgg ttg tgg tg 3 ′. 5 ′ acc ttc cac aat caa gcc 3 ′ and 5 ′ gta acc cat tct ggt atc ttt g 3 ′. the annealing temperature for both gata - 3 and c - maf primers was 57 ° c ., and the samples were amplified for 30 cycles . the pcr products were detected by slot - blot , employing biotinylated probes for β - actin , gata - 3 and c - maf which were synthetised by pcr , as described previously ( macaubas et al ., 1999 ; yabuhara et al ., 1997 ), using the same primers as above . the results , shown in fig1 are expressed as the ratio of transcription factor mrna to beta - actin mrna for each subject . it is evident that in each of the atopic subjects this ratio increased in response to hdm or to anti - cd3 antibody , whereas in the control subjects the ratio decreased in response to hdm ; the response of these subjects to anti - cd3 antibody was variable , with two of the five showing a decrease , one no change , and two showing an increase . fig2 contrasts hdm - induced production of gata - 3 and c - maf in hdm - stimulated pbmc from hdm - sensitive atopics and non atopics . it is evident that the reciprocal patterns of gata - 3 expression which distinguish atopics and non atopics are to a significant extent mirrored in respective patterns of c - maf expression . thus we have demonstrated that when human pbmc are stimulated in vitro with a specific allergen , house dust mite allergen ( hdm ), the expression of mrna encoding the transcription factor known as gata - 3 is increased in atopic subjects who are positive responders to hdm as measured by skin prick test reactivity and the presence of serum ige antibody specific for hdm , and a similar pattern is seen with c - maf . in contrast , the expression of this mrna is decreased in non - atopic subjects who are skin prick test negative / ige negative . a similar increase in gata - 3 mrna expression was observed in some atopic subjects when their pbmc were cultured with a polyclonal mitogen . ( i ) pbmc from patients complaining of allergy symptoms are cultured overnight in separate aliquots with individual allergens to determine response status by measuring allergen - induced changes in levels of mrna specific for different transcription factors , in cell lysates ; ( ii ) pbmc from cancer patients undergoing tumour - specific immunotherapy are cultured with tumour antigen , and the resulting pattern of transcription factor expression determined to monitor underlying changes in host anti - tumour immune responses ; ( iii ) pmbc from recipients of kidney transplant are cultured with kidney antigen , and the resulting pattern of transcription factor expression determined in order to identify the covert onset of graft rejection . after we have completed the analyses of the samples using the standard rt - pcr / slot blot procedure , pcr analysis by the real - time method ( taqman ) was used to confirm the results obtained from example 1 . the cdna generated from subjects samples and polarised cell lines as described in example 1 were used . 18s rrna , gata - 3 and il - 12rb2 dna standards were generated by pcr amplification of cdna obtained from pha stimulated ( 24 h ) pbmcs , using the same primers as for the real time reaction . pcr products were cloned into the vector pcr 2 . 1 using the original ta cloning kit ( invitrogen , carlsbad , calif . ), and e . coli competent cells ( invitrogen ) were transformed with such vectors . the sequence identity of each dna insert was confirmed by cycle sequencing . serial 10 - fold dilutions from each purified plasmid preparations were used as standards . β - actin standard was used as a serial 1 : 2 dilution of pha stimulated cdna . the linear range of the pcr for 18s rrna , gata - 3 and il - 12rb2 was from 1 copy to 10 copies of plasmid , and for the β - actin , from neat to 1 : 128 dilution . for β - actin reactions the correlation coefficients were 0 . 98 and 0 . 99 . for gata - 3 it was between 0 . 93 and 0 . 98 . for il - 12 rb2 was 0 . 81 and for 18s rrna , 0 . 98 pcr reaction and quantitation pcr premixes were prepared using platinum ™ quantitative pcr super mix - udg ( life technologies ), mgcl2 at 5 . 5 mm ( final concentration ), and optimised concentration of primers and probe ( table 1 ). 18s rrna was used as a commercially available premix at 1 : 20 final dilution ( applied biosystems ). standard taqman conditions were used , except 2 minutes instead of 10 min for taq polymerase activation . for each assay the baseline was determined manually , and the threshold cycle ( ct ) for each well was compared to the standard curve of the standards serial dilutions . the ratio between the relative amount of target genes and housekeeping ( 18s rrna for cell lines and β - actin for subject samples ) was calculated and the resulting figures expressed as “ taqman units ”. gata - 3 rt - pcr primers and dual - labelled fluorogenic probe were designed using the program primer express ( applied biosystems ). the primer pair was designed to span an exon / intron boundary , and amplification of rna samples not reversed transcribed was not observed . amplification of these samples for 18s rrna ( which amplifies genomic dna ) showed amplification , demonstrating the presence of contaminating genomic dna . primers and probes for 18s rrna were purchased directly from applied biosystems and used as per manufacture &# 39 ; s instructions . analyses of rna samples not transcribed showed that the ct values for these sample were approximately 10 cycles lower than levels detected in transcribed samples . β - actin was also designed across exon / intron boundaries . il - 12rb2 primers and probe seguences were kindly provided by dr m . jenmaln . analyses of rna samples not transcribed showed that ct values for these samples were around 8 cycles lower than transcribed samples . probes were synthetised by applied biosystems ( table 1 ). analyses of cdnas from 5 of the hdm - ige positive and 4 of the hdm - ige negative subjects from example 1 by real time pcr showed a similar pattern to the results obtained with slot blot , ie , increased expression of gata - 3 after hdm stimulation in the hdm - ige positive group and decrease in the hdm - ige negative group ( table 2 ). it is not feasible to make direct correlations between values obtained through the slot blot experiment and the ones using real time pcr , due to the more extensive linear range of the taqman method . nevertheless , the trend observed with the two methods are very similar . it is noteworthy that the “ outlier ” hdm - ige positive subject who showed down regulation to hdm in the slot blot ( positive subject 5 in table 2 ) gave qualitatively similar results using the taqman . replicate samples ( cultured one year apart ) from one subject ( 1 / 1a ) also gave very similar results . it will be apparent to the person skilled in the art that while the invention has been described in some detail for the purposes of clarity and understanding , various modifications and alterations to the embodiments and methods described herein may be made without departing from the scope of the inventive concept disclosed in this specification . references cited herein are listed on the following pages , and are incorporated herein by this reference . 1 . murphy , k . m ., w . ouyang , j . d . farrar , j . yang , s . ranganath , h . asnagli , m . afkarian , and t . l . murphy . 2000 . signalling and transcription in t helper development . annu rev immunol . 18 : 451 - 494 . 2 . zheng , w .- p ., and r . a . flavell . 1997 . the transcription factor gata - 3 is necessary and sufficient for th2 cytokine gene expression in cd4 t cells . cell . 89 : 587 - 96 . 3 . ho , i ., d . lo , and l . glimcher . 1998 . c - maf promotes t helper cell type 2 ( th2 ) and attenuates th1 differentiation by both interleukin 4 - dependent and - independent mechanisms . j exp med . 188 : 1859 - 66 . 4 . zhang , d ., l . cohn , p . ray , k . bottomly , and a . ray . 1997 . transcription factor gata - 3 is differentially expressed in murine th1 and th2 cells and controls th2 - specific expression of the interleukin - 5 gene . j biol chem . 272 : 21597 - 21603 . 5 . miaw , s . c ., a . choi , e . yu , h . kishikawa , and i . c . ho . 2000 . rog , repressor of gata , regulates the expression of cytokine genes . immunity . 12 : 323 - 33 . 6 . bird , j . j ., d . r . brown , a . c . mullen , n . h . moskowitz , m . a . mahowald , j . r . sider , t . f . gajewski , c .- r . wang , and s . l . reiner . 1998 . helper t cell differentiation is controlled by the cell cycle . immunity . 9 : 229 - 237 . 7 . romagnani , s . 1991 . human th1 and th2 subsets : doubt no more . immunol today . 12 : 256 - 7 . 8 . borish , l ., and l . rosenwasser . 1997 . th1 / th2 lymphocytes : doubt some more . j † allergy clin immunol . 99 : 161 - 164 . 9 . macaubas c , sly p d , burton p , tiller k , yabuhara a , holt b j , smallacombe t b , kendall g , jenmalm m , holt p g . regulation of th - cell responses to inhalant allergen during early childhood . clin exp allergy 1999 ; 29 : 1223 - 1231 . 10 . yabuhara a , macaubas c , prescott s l , venaille t , holt b j , habre w , sly p d , holt p g . th - 2 - polarised immunological memory to inhalant allergens in atopics is established during infancy and early childhood . clin exp allergy 1997 ; 27 : 1261 - 1269 . | 6 |
a biodegradable composition of the present invention comprises cellulose , pulp , and water . the biodegradable composition of the present invention may comprise one or more of other water - soluble fibroid materials or plant fibers such as pectin , alginic acid , guar gum , agar and the like . in the biodegradable composition of the present invention , the cellulose and the pulp may be used after bleaching or dyeing depending on the use of a final product . in the biodegradable composition of the present invention , a content ratio of the cellulose and the pulp which refers to a weight ratio of the cellulose ( or the sum of the cellulose and other fibers ) to the pulp is 1 : 99 to 99 : 1 , preferably 10 : 90 to 90 : 10 , more preferably 30 : 70 to 70 : 30 , and most preferably 50 : 50 . a content of the water is 50 to 99 weight % and preferably 60 to 90 weight % with respect to the total weight of the composition . the cellulose used in the present invention is a main component constituting bodies of living things such as plants or marine plants that undergo photosynthesis . in the present invention , a size of the cellulose to be used for manufacturing the composition can be adjusted depending on the use of a final product , and for example , the cellulose may have a diameter of , preferably , 300 μm to 1 nm , or 100 μm to 5 nm . in a preferable embodiment of the biodegradable composition of the present invention , among the cellulose having a diameter of 300 μm to 1 nm , two or more of the cellulose different in diameter may be mixed . a manufacturing method for the biodegradable composition of the present invention comprises the following steps : a fourth step of manufacturing a composition by mixing the cellulose , the pulp , and the water prepared in the first to third steps , respectively . hereinafter , the manufacturing method of the biodegradable composition according to the present invention will be explained in detail . in the manufacturing method of the biodegradable composition according to the present disclosure , during the first step , ground cellulose is prepared by comminuting ( isolating ) cellulose to have a diameter of , preferably , 300 μm to 1 nm . the cellulose may be used after bleaching or dyeing depending on the use of a final product . during the present step , one or more of other water - soluble fibroid materials and plant fibers such as pectin , alginic acid , guar gum , agar and the like may be mixed with the cellulose . among the cellulose having a diameter of 300 μm to 1 nm , two or more of the cellulose different in diameter may be mixed . during the present step , a method of grinding cellulose is not particularly limited , and may include , for example , a mechanical grinding method using a machine such as a grinder or a homogenizer , or a chemical method such as acid hydrolysis using acids such as sulfuric acid , hydrochloric acid , phosphoric acid and the like . a time for the cellulose to be dispersed in the water and a water - proof time and strength of a finished product manufactured using the composition can be regulated by appropriately regulating a size of the cellulose isolated to 300 μm to 1 nm to be used for the composition of the present invention or appropriately mixing the cellulose different in size . as a size of the cellulose to be used decreases , a water - proof time and strength of a finished product increase . therefore , it is possible to regulate a size of the cellulose to be used for manufacturing the composition depending on the use of a finished product . for example , in order to manufacture a waterproofing product or a semi - permanent product made of a light structure material , preferably , cellulose ground to a nano - size ( 100 nm to 1 nm ) may be used , and in order to manufacture a product that needs to be degraded in a relatively short time , preferably , cellulose having a size of 1 to 300 μm may be used , and among the cellulose having a diameter of 300 μm to 1 nm , one or more of the cellulose different in diameter are mixed , thereby the product can be manufactured by appropriately regulating a water - proof time and strength thereof . pulp is composed of cellulose obtained from wood or other fiber plants by a mechanical and / or chemical method , and refers to a main material used for manufacturing paper . pulp includes wood pulp prepared using wood such as needle leaf trees or broad leaf trees , and non - wood pulp . the pulp used in the present invention is not particularly limited in kind , and all kinds of pulp may be used . in order to manufacture a product in need of elasticity and tensile strength , preferably , pulp having a long length and high tensile strength may be used , and in order to manufacture a product which is difficult to mold , preferably , pulp having a short length may be used . further , the pulp may be used after bleaching or dyeing depending on the use of a final product . in the present invention , water is an essential element for forming hydrogen bonds between cellulose molecules . however , since drainage ( dewatering ) or drying should be carried out when a product is manufactured , preferably , the minimum amount of water may be used within the limit where hydrogen bonds can be formed or within the limit required for molding a final product in order to reduce a time for manufacturing a product . further , the cellulose may be present in water - suspension state during the comminuting ( isolation ) step depending on a grinding method . if the comminuted cellulose is in a water - suspension state , during the present third step , the water may not be additionally mixed or an amount of the water may be mixed in a regulated concentration suitable for the use of a final product to be manufactured and then mixed . in the present mixing step , a composition is manufactured by mixing the cellulose , the pulp , and the water prepared in the first step to the third step , respectively . the mixing does not require a particular method , and may be easily carried out using a conventional machine such as a mixer , a blender , or a kneader . herein , a mixing ratio of the cellulose to the pulp is not limited and can be freely regulated in consideration of the use of a product to be manufactured or a time for biodegradation . in consideration of a biodegradable property , a waterproofing property , and strength , preferably , a weight ratio is 1 : 99 to 99 : 1 , or 30 : 70 to 70 : 30 , and particularly 50 : 50 . a content of the water may be 50 to 99 weight % with respect to the total weight of the composition . if the biodegradable composition [ i . e . a composition as a mixture of the cellulose isolated to a nano size , the pulp , and the water ] of the present invention is applied or coated on a target object and then dried , a coating film having an excellent waterproofing effect can be formed . therefore , the biodegradable composition of the present invention can be usefully used as a waterproofing agent . further , the present invention provides a molded product to be manufactured using the biodegradable composition of the present invention . the molded product is manufactured using hydrogen bonds between cellulose molecules and is not limited in kind as long as it is manufactured using the biodegradable composition of the present invention and may include , for example , alternatives to paper , disposable products , and plastic , or the like . a manufacturing method of each product is not particularly limited , and a typical manufacturing method of each product can be applied . if various molding machines for different uses are manufactured by applying a typical manufacturing method , various products can be manufactured using them . as a specific example , if paper is manufactured using the composition of the present invention , the conventional method used for manufacturing paper may be used . the paper making method includes a handmade paper making method and mechanical paper making methods ( for example , the fourdrinier paper making method , the cylinder type paper making method and the like ), and all of these methods can be used . to be specific , the composition ( cellulose + pulp + water ) of the present invention is transferred to a water permeable wire mesh to drain the water , and the mixture of the cellulose and the pulp is entangled so as to form a layer . then , the layer of the mixture is compressed and dried to be uniform . through this process , biodegradable paper and waterproofing paper ( paper having a high oil resistance and a high water resistance as an alternative to vinyl ) can be manufactured . as another specific example , if a disposable product is manufactured using the composition of the present invention , a general method for manufacturing a disposable product using pulp may be used . to be specific , on a molding frame having a shape to be manufactured ( for example , a frame having a draining function with a small gynecomorphous drainage hole ), a water permeable wire mesh having the same shape is placed , and then , the composition of the present invention is transferred to the water permeable wire mesh to drain the water , and the mixture of the cellulose and the pulp is entangled so as to form a layer . then , the layer of the mixture is compressed and dried by an andromorph ( smaller than a gynecomorphous molding frame by a thickness of a layer of a product ) having the same shape as the molding frame so as to manufacture the product . herein , in the molding frame , the gynecomorphous drainage hole may be changed to an andromorphous drainage hole on the contrary to the above example , and in this case , a water permeable wire mesh having the same shape may be inserted into the andromorph . further , in the above - described method , drainage and compression may be carried out at the same time , or a compression process may be repeated one or more times to manufacture a product . it is desirable to dry the layer while being compressed since strain of a finished product can be minimized . as yet another example , if a molded product as an alternative to plastic is manufactured using the composition of the present invention , the molded product may be manufactured by manufacturing a molding machine ( molding frame ) in which the composition of the present invention is mixed to be in a paste state and put into the molding frame having a drainage hole and then compressed to drain water by force , and while the compression is carried out , the substance to be molded is dried in the molding frame until the compression is completed , thereby gradually reducing a volume of the product ( that is , draining water by adding heat and leaving fiber having a high density ) and thus manufacturing the molded product . herein , water generated during compression or vapor generated during drying may be drained through a water permeable wire mesh or a filter ( as a preferable example , a filter manufactured using fiber or pulp ), or may be drained using both of the water permeable wire mesh and the filter . further , in the case of using the filter , preferably , a non - woven fabric for drainage or other subsidiary materials are attached between the filter and a molded product in order to make it easy to separate the filter from the molded product . a density of the molded product manufactured using the composition of the present invention is an important factor that determines a time for biodegradation , a water - proof time , and strength of the molded product . a product can be manufactured by adjusting a density of the product by regulating a content of the cellulose or a pressure for compression during the manufacturing process of the product . a volume or a mass of a finished product is the same as that of a pre - molding mixture from which an amount of water is subtracted , and , thus , it can be adjusted by regulating an amount of a mixture before molding . hereinafter , the present invention will be explained in detail with reference to examples , but these examples are provided only for illustrating but not for limiting the present disclosure . as illustrated in table 1 to table 5 below , each sheet of paper ( average basis weight : 76 . 47 g / m 2 ) was prepared by a handmade paper making method using biodegradable compositions prepared with different content ratios between cellulose and pulp and different sizes of cellulose . a waterproofing property test and a strength test of each sheet of paper prepared were carried out . the results thereof were as illustrated in table 1 to table 5 . the waterproofing property test was carried out by pouring water to paper and measuring a time for water to ooze out on a rear surface . the test on strength was carried out according to ks m iso 1924 - 2 “ testing method of tensile strength of paper and paperboard ”, and the test on tensile strength was carried out according to the constant rate of loading method under average md of 5 . 29 kn / m and cd of 2 . 18 kn / m . for reference , plain paper ( wood - free paper ) typically has a water - proof time in a range of 10 to 30 seconds . it could be confirmed from the above results as illustrated in table 1 to table 5 that the biodegradable composition of the present invention has an excellent waterproofing property and also has a much higher strength than the conventional one . therefore , it can be seen that the biodegradable composition of the present invention is suitable to be used as a waterproofing agent or a material of products in need of a waterproofing property . further , the results as illustrated in table 1 to table 5 involve the case of preparing paper by the handmade paper making method . if a density of paper is increased by a mechanical paper making method , it is possible to further increase a water - proof time and strength . furthermore , a specimen was manufactured using the composition of example 3 - 3 and a conventional plastic ( high density polyethylene ( hdpe )) was used as a control . then , a tensile strength of each specimen was measured according to ks b 0802 ( testing method of tensile strength of metallic material ). the results thereof were illustrated in fig1 ( the specimen manufactured using the composition of example 3 - 3 of the present disclosure ) and fig2 ( the plastic specimen as a control ). as can be seen from fig1 and fig2 , it is confirmed that the specimen manufactured using the composition of the present invention has an excellent tensile strength and can be usefully used as an alternative to the conventional plastic . the us and european countries have been focusing on developing bio - plastics using starch . however , due to the price increase of the grain , they are now making efforts on developing the raw materials to replace it . a modeled product that is manufactured using the composition of the present invention is manufactured using cellulose , which is the most abundant organic substance on earth , and therefore has the advantage of low production costs , compared to using plastic or pla of corn starch . it is also excellent in strength as plastic and can endure at a high temperature of 150 - 200 ° c . ; it also can manufacture disposable products or semi - permanent products including light weight construction products ( floor products , interior / exterior materials , furniture materials , electric home appliances , toys for children , etc .). as it is getting difficult to use crude oil , starch , and trees as raw materials due to the exhaustion of natural resources and convention on climate change , the present invention would be useful in securing the raw materials by using a herbaceous plant as main materials in terms of securing and using the future resources . it also provides saving of the natural resources such as crude oil and starch , and has a great potential to develop into a new future industry . | 2 |
according to the present invention , the four steps of ( a ) timely fixation for the purposes of cell preservation , ( b ) producing a cross - linked matrix in the plasma layer ; ( c ) decreasing surface tension and retarding evaporation at the fresh blood spread by by immersion in a non - polar ( water immiscible ) solvent , and ( d ) performing a chemical reaction by diffusing reagents across an interface , are combined for the purpose of stabilizing both the cell shape and the smoothness and homogeneity of the plasma layer . distortion of the plasma layer during drying of cell monolayers is solved by producing the cross - linked matrix before drying . an agent for subsequent cross - linking in the plasma is dissolved in the plasma while the blood is still a liquid suspension . the activating or polymerizing agent is dissolved in the non - polar solvent . concentrations are adjusted so that cross - linking occurs within about the first minute of immersion of the wet blood spread on the slide in the non - polar solvent while excessive reactions are prevented . by proper adjustment of conditions of agent to be cross - linked , polymerizing agent , blood spreading process , non - polar solvent and time , one may separate two phenomena of distortion . first , by using a polymerizing agent which acts chiefly on the plasma component , migration of plasma during the subsequent drying is eliminated . in this case , the cells are left unaffected , except that surface tension forces as they would act on the cells are greatly reduced . the spreading or stretching of the cells after this treatment is intermediate between fixed cells and those without the treatment . by using a polymerizing agent that also fixes the cells before they are dry , one may preserve both a smooth , undistorted plasma layer and cells without distortion . these cells generally have the appearance , after drying , of cells usually seen only in wet preparations . loss of central palor in red blood cells as described in u . s . pat . no . 4 , 209 , 548 does not happen under these conditions . any suitable cross - linking agent may be used in the process of the present invention . typical cross - linking agents include formaldehyde , glutaraldehyde and trichloroacetic acid . cross - linking action may be by structural change in the agent to be cross - linked , as with trichloroacetic acid , or by formation of additional covalent bonds , as with an aldehyde . while any suitable agent with these properties may be used , the agent of choice is glutaraldehyde . properties of the agent to be cross - linked include large molecular weight , solubility in the plasma of human blood , non - reactivity with either the plasma or particulate components of human blood , but responding to the cross - linking agent , and not causing cell aggregation or attachment of blood components to the cell surface . optimum results were obtained by using human serum albumin as agent to be cross - linked and glutaraldehyde as a cross - linking agent . any suitable non - polar solvent may be used in the present invention . properties of such a solvent include low surface tension , non - miscible with water but capable of dissolving the cross - linking agent , and non reactive with water , blood or the reagents used in cross - linking . the optimum solvent used with glutaraldehyde and human serum albumin is cyclohexane . any suitable blood spreading process , such as the spinner process , the coverslip process and the wedge process , may be used in this invention , although it is preferred to employ the spinner process because a larger usable monolayer area is produced . the following examples further define the present invention . it should be noted , however , that these examples are intended to illustrate , and in no way are intended to limit the invention . the agent , used herein , for subsequent cross - linking is human serum albumin , the coloring agent is a dye fast green sf ( color index # 42053 ), the slide preparation is by a spinner process described in u . s . pat . no . 3 , 827 , 805 , the non - polar solvent is cyclohexane and the cross linking or activating agent dissolved in cyclohexane is glutaraldehyde . human serum albumin ( hsa ) is a 30 % aqueous solution . glutaraldehyde solution is 1 / 6 of the maximum or saturation concentration in cyclohexane . it is prepared by shaking together a 25 % aqueous glutaraldehyde solution and the pure cyclohexane at room temperature . subsequently , the saturated solution is diluted with pure cyclohexane in ratio of about 1 part in 6 . two parts of blood are mixed with one part of human serum albumin solution . a monolayer spread is made on the slide using a spinner and is immediately immersed in cyclohexane glutaraldehyde . after 30 seconds , the slide is transferred to pure ( clean ) cyclohexane where the unreacted glutaraldehyde is rinsed away . upon removal of the slide from the clean cyclohexane bath , the solvent is permitted to evaporate and the slide is dried . both plasma and cells are preserved , free of distortion from their original shape . example i is repeated using trichloracetic as the cross - linking agent for the human serum albumin . immersion of the wet blood film is kept down to about 15 seconds in cyclohexane containing about 1 / 100 % of trichloroacetic acid . the cross - linking agents , as in example i , above , acts by crossing the boundary between the non - polar solvent and the water wet monolayer of blood , and by performing its cross - linking chemical reaction after further diffusion on the water side of the boundary . among other reactions the trichloroacetic acid causes denaturation of the albumin which then precipitates in place to the extent that a smooth plasma layer is obtained . in this example , only plasma is preserved free of distortion . since trichloroacetic acid does not fix the cells , they are subjected to stretching forces during drying . as a result they resemble cells as they would appear in conventional monolayer blood spreads . while specific components of the present system are defined in the examples above , many other variables may be introduced which may in any way affect , enhance or otherwise improve the invention . these are intended to be included herein . while variations are given in the present application , many modifications and variations will occur to those skilled in the art upon reading the present disclosure . these , too , are intended to be included herein . | 6 |
while the specification concludes with claims defining the features of the invention that are regarded as novel , it is believed that the invention will be better understood from a consideration of the following description in conjunction with the drawing figures , in which like reference numerals are carried forward . before the present invention is disclosed and described , it is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting . it must be noted that , as used in the specification and the appended claims , the singular forms “ a ,” “ an ,” and “ the ” include plural references unless the context clearly dictates otherwise . referring now to the figures of the drawings in detail and first , particularly to fig2 thereof , there is shown a first embodiment of a pressure - limiting balloon catheter 100 that does not inflate past the tearing limit of a lumen in which the catheter 100 is placed , for example , in the urethra . to prevent occurrences of urethra tearing due to premature - improper inflation of the balloon and / or due to premature removal of an inflated balloon , the invention of the instant application provides the balloon 110 with a balloon safety valve 112 . as set forth above , in a balloon 3 of a conventional catheter ( see reference numerals 1 to 5 in fig1 ), the balloon 3 is fixed to the outer surface of the fluid drainage line 120 ( not shown in fig1 ) and is not intended to be removed therefrom or to burst thereon unless an extraordinary amount of inflation occurs . such a tearing event is not supposed to occur under any circumstances during use with a patient . if such an event happens , the material of the balloon 3 will open at a random location , based upon the microscopic fractures or weaknesses in the material itself , and risk of serious damage to the patient is associated with the bursting , as well as a risk of balloon fragmentation , which could leave pieces of the balloon 3 inside the patient after removal of the catheter . in contrast to such conventional devices , the balloon 110 of the present invention is created specifically to tear when a predefined pressure exists in or is exerted on the balloon 110 . the controlled tear will occur because the balloon safety valve 112 is present . conventional balloons have constant balloon wall thicknesses . in contrast thereto , the balloon safety valve 112 in the first embodiment is a defined reduction in balloon wall thickness . this reduction creates a breaking point or selected breaking points at which the balloon 110 is intended specifically to break when a predefined force exists in or is imparted on the balloon 110 . because the balloon 110 is made of a material having a known tearing constant — dependent upon the thickness thereof ( which is determined experimentally for different thicknesses of a given material prior to use in a patient ), the balloon safety valve 112 of the present invention for urethra applications is matched to break when the pressure inside or exerted on the balloon 110 approaches the maximum urethra pressure . in the embodiment shown in fig2 , a decreased thickness is formed as a first semi - circumferential groove 114 near a proximal end of the balloon 110 and / or as a second semi - circumferential groove 116 near a distal end of the balloon 110 . the grooves 114 , 116 can have any cross - sectional shape , including , trapezoidal , triangular , square , or rectangle , for example . because rubber , plastic , and silicone materials tear well with thinner cuts , a relatively triangular shape or one with a narrow bottom is preferred . to make sure that the entire balloon 110 of the illustrated embodiment does not completely tear away from the fluid drainage line 120 , both grooves 114 , 116 do not extend around the entire circumference of the balloon 110 . as shown to the left of the proximal groove 116 in fig2 , the groove 116 is not present on at least an arc portion 118 of the circumference of the balloon 110 . the arc portion is defined to be sufficiently large so that , when the catheter 100 is removed from the patient , the balloon 110 cannot tear away entirely from the catheter 100 ( and create the disadvantageous fragmentation situation as set forth above ). the illustrated balloon safety valve 112 is , therefore , fashioned to keep the balloon 110 in one piece after breaking and firmly connected to the catheter 100 to insure that no piece of the balloon 110 will be left inside the patient after actuation of the balloon safety valve 112 . it is noted that the balloon 110 is inflated through an inflation lumen 130 having a proximal opening , typically formed by a female end of a luer connector . the female end is connected to a non - illustrated inflation device , for example , a distal end of a syringe for inflation of the balloon 110 . in this first embodiment , the balloon can be of rubber , silicone , or plastic , for example . once the balloon breaks , the catheter is useless and must be discarded . because the balloon 110 in this embodiment will break inside the patient , it should be inflated with a bio - safe fluid to prevent an unwanted air or gas from entering the patient . in certain circumstances where balloon catheters are used , air or gas will not injure the patient if let out into the patient &# 39 ; s body cavity . in such circumstances , the inflating fluid can be air under pressure , for example . maximum urethra pressure can also be tailored to the individual patient . based upon a urethral pressure - measuring device , the patient &# 39 ; s maximum urethra pressure can be measured before the catheter 100 is placed therein . a set of catheters 100 having different safety valve breaking constants can be available to the physician and , after estimating or calculating or knowing the patient &# 39 ; s maximum urethra pressure , the physician can select the catheter 100 having a safety valve breaking constant slightly or substantially smaller than the patient &# 39 ; s maximum urethra pressure . accordingly , if the pressure in the balloon 110 approaches the patient &# 39 ; s maximum urethra pressure for any reason , whether it is due to over - inflation , improper placement , and / or premature removal , the balloon 110 is guaranteed to break prior to the patient &# 39 ; s lumen , in particular , the patient &# 39 ; s urethra , prior to causing iatrogenic injury . a second embodiment of the one - use breaking safety valve of a pressure - limiting balloon catheter 200 is shown in fig3 . the catheter 200 has a fluid drainage line 220 , a balloon inflation lumen 230 , and a secondary lumen 240 . the fluid drainage line 220 is connected fluidically to the body cavity ( i . e ., the bladder 30 ) for draining fluid from the body cavity . the secondary lumen 240 can be used for any purpose , for example , for housing the radiation line that will supply energy to the radiation coil 2 . it can also be used for injecting fluid into any distal part of the catheter 200 or even the body cavity itself . the balloon inflation lumen 230 begins at a proximal end with an inflating connector 260 that , in a preferred embodiment , is a female luer connector ( of course , it can be a male luer connector too ). the balloon inflation lumen 230 continues through the body of the catheter 200 all the way to the balloon and is fluidically connected to the interior of the balloon . the balloon safety valve is also fluidically connected to the balloon inflation lumen 230 . in the second embodiment of the safety valve 212 , the valve 212 is formed integrally with the balloon inflation lumen 230 and is set to open into the environment ( instead of into the patient ) if the maximum urethra pressure is exceeded in the balloon or the balloon inflation lumen . because this safety valve 212 is located near or at the balloon inflation port 220 in this configuration , fluid used to inflate the balloon will not enter the patient when the valve 212 opens . the safety valve 212 in the second embodiment can merely be a narrowing of the distance between the balloon inflation lumen 230 and the outer surface 250 of the catheter 220 . in fig3 , the valve 212 has a rectangular cross - section and extends away from the balloon inflation lumen 230 . as shown in fig4 , and 6 , respectively , the cross - section can be triangular ( peaked or pyramidical in three - dimensions ), curved ( circular or cylindrical in three - dimensions ), or trapezoidal ( frusto - conical or bar - shaped in three - dimensions ). the cross - sections are shown in fig3 to 7 with the narrowing emanating from the balloon inflation lumen 230 outward . as an alternative , the narrowing can begin on the outer surface of the catheter and extend inwards towards the balloon inflation lumen 230 . a further alternative can have the narrowing extend from both the lumen 230 and the outer surface of the catheter . the cross - sections illustrated are merely exemplary . what is important is that the thickness t between the bottom 213 of the valve 212 and the outer surface 250 of the catheter 220 in comparison to the thickness t of the catheter body over the remainder of the balloon inflation lumen 230 . an enlarged view of this thickness comparison is illustrated in fig7 . as long as the thickness t is smaller than the thickness t ( t & lt ; t ), and as long as the force fb required to break the balloon is greater than the force fsv required to break the portion 213 of the safety valve 212 ( fb & gt ; fsv ), then the portion 213 of the safety valve 212 is virtually guaranteed to break every time pressure exerting a force f in the balloon inflation lumen 230 is greater than the force fsv required to break the safety valve ( fsv & gt ; f ). based upon this analysis , the force fsv required to break the safety valve can be tuned to whatever a patient needs or a physician desires and different sized valves can be available for any procedure and provided in the form of a kit . whether a standard maximum urethra pressure is used or a patient - specific maximum urethra pressure is measured and used , experiments can be conducted prior to use on a patient on various catheter thicknesses t to determine the pressure needed to break the portion 213 of the safety valve 212 . for example , ten different maximum urethra pressures can be known as desirable setpoints and the thicknesses t can be varied such that pressure required to break the ten thicknesses correspond to the ten setpoint pressures . if , then , ten catheters are placed in such a kit , each having one of the ten thicknesses , then the physician has a range of 10 maximum urethra pressure values to use with the patient . the safety valve 212 of the second embodiment need not be confined to the body of the catheter 200 . instead , the inflating connector 260 can be equipped with the safety valve 212 . alternatively , a modular attachment 270 containing the safety valve 212 can be attached to the inflating connector 260 . such a modular valve attachment 270 is removable and replaceable ( such as through a convention luer or even a screw - threaded connection ). accordingly , as long as the catheter 200 can still be used after the valve 212 actuates ( breaks ), the used attachment 270 can be replaced with a new attachment 270 . the converse is also true for reuse of the attachment 270 if the catheter 200 breaks and the valve of the attachment 270 remains unbroken . one embodiment of the attachment is illustrated in fig9 . specifically , an upstream end of the connector 260 is attached removably to a downstream end 272 of the modular valve attachment 270 and the upstream end 274 of the attachment 270 is attached to the female connection of the balloon inflation device 280 illustrated only diagrammatically in fig9 . a common exemplary inflation device 280 is a syringe . in such a configuration , the safety valve 212 , 312 of the present invention can be entirely separate from the catheter 200 , 300 and , therefore , form a retrofitting device for attachment to the luer connector present on conventional catheters . as an alternative to the one - use breaking safety valve of the second embodiment , a multi - use pressure valve can be used . this third embodiment of the pressure - limiting balloon catheter 300 is illustrated in fig8 . the catheter 300 can be the same as the catheter 200 in fig3 except for the portion illustrated in fig8 . instead of having a narrowing thickness t of the lumen wall , the valve portion 313 extends entirely to the environment . however , a one - way valve 314 ( shown only diagrammatically in fig8 ) is attached to the open end of the valve portion 313 and is secured to the outer surface 250 of the catheter 300 to close off the open end of the valve portion 313 . the one - way valve 314 can be secured directly to the outer surface 250 ( e . g ., with an adhesive ) or a connector 315 ( e . g ., a threaded cap ) can secure the one - way valve 314 to the open end of the valve portion 313 . regardless of the configuration , the one - way valve 314 includes a device that does not permit fluid from exiting the lumen 230 until a given resistance r is overcome . this given resistance r can be selectable by the physician depending upon the one - way valve that is chosen for use if a set of one - way valves having different resistances r are available for use by the physician . just like the second embodiment , the resistance r can be set to correspond to desired maximum urethra pressure values . therefore , when used , the fluid exits the one - way valve 314 into the environment well before the patient &# 39 ; s maximum urethra pressure is exceeded by the balloon . the one - way valve 314 can be a mechanical one - way valve . additionally , the one - way valve 314 can be a material having a tear strength corresponding to the desired set of resistances r . the material can be a fluid - tight fabric , a rubber , a plastic , or silicone different from the material making up the catheter . the material can even be a rubber , plastic , or silicone the same as the material making up the catheter but having a reduced thickness t than the thickness t of the catheter . because the safety valve 212 , 312 is located at the proximal end of the catheter 200 , 300 , the distal end of the catheter 200 , 300 can take the form of a distal end of a conventional balloon catheter 2 , 3 , 4 , 5 . alternatively , the distal end shown in fig2 can also be used for redundant over - pressure protection . the catheter 200 , 300 according to the invention can be used in vascular applications . it is known that every vessel has a tearing pressure . balloons are used in coronary arteries , for example . if a coronary artery balloon were to burst , there would be less damage if the burst was controlled according to the invention . the same is true for a renal or iliac blood vessel . in such situations , the breakaway catheter improves upon existing catheters by making them safer . from the urinary standpoint , the breakaway balloon will not only prevent injury , but will also be a signal to the technician that he / she needs to obtain the assistance of a physician or urologist with respect to inserting the catheter . referring now to fig1 thereof , there is shown a first embodiment of an illuminating balloon catheter 100 having a distal balloon 110 , a catheter body 102 , and a drainage assembly 150 . the catheter body 102 defines a fluid drainage lumen 120 , a balloon inflating lumen 130 , and an illumination device lumen 140 . the distal end of the drainage assembly 150 is explained below with regard to fig1 and includes a shaft on which or around which the balloon 110 is connected . the drainage assembly 150 has at least one distal drainage port 152 at the proximal end of the catheter 100 for draining fluid from a body cavity ( i . e ., urine from a bladder ). the drainage assembly 150 can also be integral with or connected to the catheter tip 154 . the interior of the balloon 110 is fluidically connected to the balloon inflating lumen 130 . the balloon 110 is inflated through a connector 160 disposed at a proximal opening 132 of the inflation lumen 130 . see fig1 . typically , a female end of a luer connector forms the connector 160 and is shaped to connect to a non - illustrated inflation device , for example , a distal end of a syringe for inflation of the balloon 110 . fig1 illustrates an exemplary embodiment of the proximal end of the catheter 100 of the present invention . the proximal end includes the proximal portions of the fluid drainage lumen 120 , the balloon inflation lumen 130 , and the illumination device lumen 140 . the fluid drainage lumen 120 is fluidically connected at a proximal end thereof to a drainage device having a drainage funnel 122 defining a proximal , substantially circular opening 124 within which is received a fluid connection device 170 , indicated in fig1 diagrammatically with dashed lines . the balloon inflation lumen 130 begins at a proximal end with the inflating connector 160 , continues through the body 102 of the catheter 100 an the way distal to the balloon 110 and is fluidically connected to the interior 112 of the balloon 110 as set forth above . the illumination device lumen 140 is formed to house a directional illumination source 201 , shown ( in a first embodiment in fig1 ) as a fiber optic strand having a distal end 202 terminating flush with a transparent portion of the balloon 110 . this strand supplies light into the balloon 110 . thus , an of the light emanating from the distal end 202 of the strand is coupled into the cavity 112 of the balloon 110 . a conventional fiber optic light source can be coupled to the fiber optic strand and , therefore , is not described in further detail nor is it illustrated more than diagrammatically with box 204 in fig1 . without anything further , if the balloon 110 were entirely transparent , the light entering the balloon 110 would enter the cavity 112 and pass entirely through the balloon 110 out the distal side thereof . the present invention , however , provides a reflective surface 210 on the balloon 110 . the reflective surface 210 is shown on the interior of the balloon 110 , however , it can be on the exterior of the balloon 110 as well . the reflective surface 210 can be a coating thereon or it can be a natural property of the material making up the balloon 110 . in fig1 , the reflective surface 210 is shown covering approximately half of the interior surface of the balloon 110 , i . e ., it is substantially hemispherical . thus , the light will emanate from the balloon 110 over the proximal hemispherical half and only illuminate structure located on the proximal side of the balloon 110 ( below the balloon in fig1 ). this configuration , however , is merely exemplary because the reflective surface 210 can be fashioned to traverse any extent on the balloon 110 . also , it need not be symmetrical . in the hemispherical shape of fig1 , the reflective surface forms a concave mirror and , therefore , focuses light in the proximal direction . alternatively , the reflective surface can be formed asymmetrically to focus and / or direct light at any angle cc with respect to the longitudinal extent of the catheter body 102 . as shown , for example , in fig1 , the reflective surface 210 is disposed on substantially an of the right half of the balloon 110 and is disposed on the distal half of the left side of the balloon 110 and on a portion adjacent the exit of the balloon inflating lumen 130 . in this configuration , the light coupled into the balloon 110 from the distal end 202 is reflected and emanates from the balloon 110 opposite the illuminating source 200 over an arc - shaped area β . thus , if the physician is located on the left side of the catheter 100 with respect to fig1 , and is looking at the catheter 100 in a direction along arrow a , an of the light will be emerging on the side facing the physician and in a relatively proximal direction . such illumination is very beneficial when locating the urethrovesical junction in a laparoscopic prostatectomy . a second embodiment of the illuminating balloon catheter is shown in fig1 . therein , the illuminating device 200 ( e . g ., a fiber optic strand ) is shielded from emitting illumination up until a point at which it emerges into the cavity 112 of the balloon 110 . this unshielded portion 206 allows the light to enter the balloon 110 without be attenuated by the material of the balloon 110 , which occurs to a small extent in the first embodiment . one drawback to this second embodiment is that two holes need to be created in the balloon 100 because the illumination source 200 is in a lumen entirely separate from the balloon inflation lumen 130 . if , however , the balloon inflation lumen 130 is sufficiently large to fit therein the illumination source 200 ( in a fluid - tight fit at the proximal end of the lumen 130 ) and still allow inflation of the balloon 110 without substantial back pressure or closing off of the lumen 130 , then the balloon 110 can be formed with only one hole . such an alternative configuration is shown in fig1 . in this configuration , the secondary lumen 140 becomes available for another useful purpose . fig1 illustrates a fourth alternative embodiment of the illuminating balloon catheter 100 . specifically , the illuminating device 200 ( e . g ., fiber optic ) is led through the fluid drainage lumen 120 and is fastened to the inside surface thereof except for a distal - most portion near the point at which the drainage assembly 150 is secured . the drainage assembly 150 is formed with an intermediate opening 156 that can be fluid - tightly sealed by securing thereto the unshielded portion 206 of the fiber optic device 200 , for example . this embodiment is particularly suited for an led as the illumination source because the intermediate opening 156 can be formed with exact tolerances so that the led can be secured therein easily in a fluid - tight manner with conventional glues . fig1 illustrates a fifth alternative embodiment of the illuminating balloon catheter 100 . specifically , the illuminating device 200 is tubular and is led through the fluid drainage lumen 120 in a longitudinally movable manner . the illuminating device 200 has a distal - most portion at which is disposed an illuminator 206 a . the illuminator 206 a can be formed from an unshielded portion of a fiber optic or can be an led having an illumination direction disposed along a radial line orthogonal to the longitudinal extent of the illuminating device 200 . because the illuminating device 200 can be rotated 360 degrees inside the fluid drainage lumen 120 , a portion of the drainage assembly 150 inside the balloon is transparent . thus , as the illuminator 206 a is rotated within the fluid drainage lumen 120 , the light beam also rotated within the balloon . in this embodiment , therefore , the catheter need not be rotated inside the patient &# 39 ; s urethra . to make sure that a majority of the illumination is directed proximally , the balloon 110 is , in this fifth embodiment , provided with the hemispherical reflector 210 similar to that shown fig1 ( but not shown in fig1 ). it is noted that the hollow structure of the illuminating device 200 allows for virtually unhindered passage of the fluid that is to be drained through the fluid drainage lumen 120 . laparoscopic prostatectomy can be assisted with all of the configurations shown in fig1 to 17 . with the invention of the instant application , the balloon of the catheter is inflated in the bladder and the surgeon or assistant directs the light to help locate the urethrovesical junction . inflation of the balloon such that the proximal portion thereof presses against the proximal wall of the bladder near the urethrovesical junction to compress the tissue at the urethrovesical junction . such compression allows the urethrovesical junction to be very apparent when viewed through a laparoscope . the directed illumination from the illumination device 200 , in combination with the compression of the urethrovesical junction , allows the metes and bounds of the urethrovesical junction to be clearly identified . accordingly , a laparoscopic prostatectomy can have greater chances for success . a fiber optic is used herein as an illustrative example for the illumination source . it should not , however , be deemed as limiting the scope of potential illumination sources . for example , as set forth above , conventional light - emitting diodes ( leds ) can be used . also , printed organic light - emitting diodes ( oleds ) can be used both as the illumination source and as the reflective coating . specifically , if the feature shown as a reflective coating 210 in fig4 and 5 is substituted with a printed oled , then the oled can become an illumination source that does not need reflection to direct illumination from the balloon 110 of the present invention . other similar forms of illumination devices can be substituted or used . the breakaway catheter is not only a separate device from the illuminating catheter and vice - versa . therefore , it is envisioned that the two catheters described individually herein can be combined in any manner into a single catheter with any of the features of both . trans - illumination through a catheter can help prevent surgical injuries in addition to those described herein . certain structures are at risk when doing laparoscopic surgery of the pelvis , for example . the bladder is often at risk during operations including hysterectomies , cesarean sections , pelvic masses , and colo - rectal procedures . this because the bladder is in close proximity to the relevant organs and is often difficult to recognize during dissection . the bladder can easily be perforated inadvertently . this is especially true with hysterectomies because the relevant organs lie anterior to the bladder . certain conditions such as adhesions and endometriosis make dissection much more difficult and bladder perforation even more common . by using directional trans - illumination by reflecting light to the dome of the bladder , the demarcation between the bladder and the uterus is much more visible during surgery . this allows the surgeon to more easily identify the bladder wall and dissect in the proper plane . large pelvic masses such as ovarian tumors and sarcomas and certain gastrointestinal malignancies can also be in very close proximity to the bladder . during these operations , a directional light helps to prevent bladder injury . as such , the devices and methods described herein can be used to prevent such injuries . however , the direction of the light that is needed to identify the bladder wall is opposite in direction to the light described hereinabove . instead of directing substantially all of the light towards the shaft of the catheter , in the embodiments to identify the bladder wall , substantially all of the light is directed directly opposite the shaft , referred to herein as the distal direction . all of the other features of the shaft - directed light configurations described herein are equally applicable to the distally directed embodiment but direct light in the opposite direction . thus , the light can be the distal half of the balloon or any portion or portions thereof . | 0 |
disclosed is a system and method for facilitating check writing . generally speaking , the system and method can be used to access a network - based ( e . g ., web - based ) imaging service that enables the user to identify the imaging data to be used to generate checks . once the data has been identified , it can be stored by the service and , if desired , one or more hard copy documents ( i . e ., checks ) can be generated . to facilitate description of the inventive system and method , example systems are discussed with reference to the figures . although these systems are described in detail , it will be appreciated that they are provided for purposes of illustration only and that various modifications are feasible without departing from the inventive concept . after the description of the example systems , examples of operation of the systems are provided to explain the manners in which check generation can be facilitated . fig1 is a schematic representation of the general operation of the invention . as shown in this figure , an imaging client 100 communicates with one or more imaging sources 102 and one or more imaging destinations 104 , which can in some arrangements comprise the same device and / or service . the imaging source ( s ) 102 represent any of a wide variety of devices / services that can be accessed by the imaging client 100 and used to input data that will be used to create a document , such as a check . once the imaging data have been input , the imaging client 100 can identify data from the imaging source ( s ) 102 that are to be used by the imaging destination ( s ) 104 for printing , as well as the arrangement of the data within the printed document . the image destination ( s ) 104 can then print the document ( s ) according to the client &# 39 ; s selections . fig2 illustrates an example system 200 with which the invention can be implemented . as indicated in this figure , the example system 200 generally comprises a computing device 202 , a printing device 204 , and one or more network servers 206 , each of which can be connected to a network 208 . as indicated in fig2 the computing device 202 can be arranged as a personal computer ( pc ). more broadly , however , the computing device 202 can comprise substantially any device that can be used to communicate via the network 208 and , therefore , access and / or be accessed by check writing services made available over the network . by way of example , the computing device 202 can alternatively comprise a notebook computer , macintosh computer , handheld computer such as a personal digital assistant or mobile telephone , smart card , etc . the printing device 204 comprises any device that is capable of generating hardcopy documents in the form of a check . although the term “ printing device ” is used herein , it is to be understood that the disclosure is not limited to any particular type of device that provides this functionality . accordingly , the term is intended to include any appliance or printing device ( e . g ., printer , photocopier , facsimile machine , multifunction peripheral ( mfp ), etc .) that either inherently provides this functionality or which provides it when a suitable accessory is used in conjunction therewith . the one or more network servers 206 typically comprise computing devices similar in configuration to the computing device 202 , but which normally possess greater resources in terms of processing power , memory , and / or storage space . as will be apparent from the discussions provided below , the network servers 206 are typically used with the internet ( public or private ) and , therefore , typically comprise web servers . although the use of internet networking protocols ( e . g ., transmission control protocol ( tcp ) and / or internet protocol ( ip )) may mean that web protocols ( e . g ., hypertext transfer protocol ( http )) will be used , it will be recognized by those skilled in the art that http is just one of many protocols capable of being used on internet networks . the network 208 normally comprises one or more sub - networks that are communicatively coupled to each other . by way of example , these networks can include one or more local area networks ( lans ) and / or wide area networks ( wans ) that comprise a set of networks that forms part of the internet . in addition to the network connections shown in fig2 one or more of the computing device 202 and servers 206 can be directly connected to the printing device 204 ( not shown ). direct connection between the computing device 202 and the printing device 204 may be likely where the printing device is used in a home or small office environment in which the user does not have access to a network . direct connection between a network server 206 and the printing device 204 may be likely where the server functions as a print server controlled by a check writing service . as noted above , other system arrangements are possible for implementation of the invention . for instance , the system can be arranged as one or more of the example systems identified in u . s . patent application ser . no . 09 / 999 , 450 , filed on nov . 15 , 2001 , entitled “ system and method for charging for printing services rendered ,” by shell simpson , ward foster , and kris livingston and bearing attorney docket no . 10008256 - 1 , the disclosure of which is hereby incorporated by reference into the present disclosure . in such a case , the data to be printed ( i . e ., imaging data ) can be accessed by imaging destinations ( e . g ., printing services ) in an , at least partially , automated manner . fig3 is a schematic view illustrating an example architecture for the printing device 204 identified in fig2 . as indicated in fig3 the printing device 204 can generally comprise a processing device 300 , memory 302 , hard copy generation hardware 304 , one or more user interface devices 306 , one or more input / output ( i / o ) devices 308 , and one or more network interface devices 310 , each of which is connected to a local interface 312 that normally comprises one or more internal and / or external buses . the processing device 300 is adapted to execute commands stored in memory 302 and can comprise a general - purpose processor , a microprocessor , one or more application - specific integrated circuits ( asics ), a plurality of suitably configured digital logic gates , and other well known electrical configurations comprised of discrete elements both individually and in various combinations to coordinate the overall operation of the printing device 204 . the memory 204 can include any one of a combination of volatile memory elements ( e . g ., random access memory ( ram , such as dram , sram , etc .)) and nonvolatile memory elements ( e . g ., rom , hard drive , tape , cdrom , etc .). the hard copy generation hardware 304 comprises the components with which the printing device 204 can generate hard copy documents and , more particularly , with which the device can generate checks . for example , the hard copy generation hardware 304 can comprise a print engine that is possible of many different configurations . the one or more user interface devices 306 , where provided , comprise those components with which the user can interact with the printing device 204 . by way of example , the user interface devices 306 comprise one or more function keys and / or buttons with which the operation of the device 204 can be controlled , and a display , such as a liquid crystal display ( lcd ), with which information can be visually communicated to the user and , where the display comprises a touch - sensitive screen , commands can be entered . with further reference to fig3 the one or more i / o devices 308 are adapted to facilitate communications of the printing device 204 with another device and may therefore include one or more serial , parallel , small computer system interface ( scsi ), universal serial bus ( usb ), ieee 1394 ( e . g ., firewire ™), and / or personal area network ( pan ) components . the network interface devices 310 comprise the various components used to transmit and / or receive data over a network 208 . by way of example , the network interface devices 310 include a device that can communicate both inputs and outputs , for instance , a modulator / demodulator ( e . g ., modem ), wireless ( e . g ., radio frequency ( rf )) transceiver , a telephonic interface , a bridge , a router , network card , etc . the memory 302 typically comprises an operating system 314 . in addition , where the printing device 204 is adapted to support a service that facilitates check writing , the memory 204 typically includes an embedded network server 316 . the operating system 314 controls the execution of other software and / or firmware and provides scheduling , input - output control , file and data management , memory management , and communication control and related services . the embedded network server 316 comprises software and / or firmware that is used to serve information to the network 208 . where the network comprises the internet ( public or private ), the embedded network server 316 may function as an embedded web server . as indicated in fig3 the embedded network server 316 , where provided , comprises a check writing service 318 that , as is discussed in greater detail below , can be used to facilitate the check writing process . the operation of the network server 316 and the check writing service 318 when acting in this capacity is described below with reference to fig4 - 5b . although the check writing service 318 has been identified as being supported by the printing device 204 , persons having ordinary skill in the art will appreciate that this service could , alternatively , be provided by another device , for instance one or more of the network servers 206 . as will be apparent from the discussions that follow , however , the location of the check writing service 318 is not critical to the operation of the inventive system and method . various software and / or firmware has been described herein . it is to be understood that this software and / or firmware can be stored on any computer - readable medium for use by or in connection with any computer - related system or method . in the context of this document , a computer - readable medium denotes an electronic , magnetic , optical , or other physical device or means that can contain or store a computer program for use by or in connection with a computer - related system or method . these programs can be embodied in any computer - readable medium for use by or in connection with an instruction execution system , apparatus , or device , such as a computer - based system , processor - containing system , or other system that can fetch the instructions from the instruction execution system , apparatus , or device and execute the instructions . in the context of this document , a “ computer - readable medium ” can be any means that can store , communicate , propagate , or transport the program for use by or in connection with the instruction execution system , apparatus , or device . the computer - readable medium can be , for example but not limited to , an electronic , magnetic , optical , electromagnetic , infrared , or semiconductor system , apparatus , device , or propagation medium . more specific examples ( a nonexhaustive list ) of the computer - readable medium include an electrical connection having one or more wires , a portable computer diskette , a random access memory ( ram ), a read - only memory ( rom ), an erasable programmable read - only memory ( eprom , eeprom , or flash memory ), an optical fiber , and a portable compact disc read - only memory ( cdrom ). note that the computer - readable medium can even be paper or another suitable medium upon which a program is printed , as the program can be electronically captured , via for instance optical scanning of the paper or other medium , then compiled , interpreted or otherwise processed in a suitable manner if necessary , and then stored in a computer memory . an example system having been described above , operation of the system will now be discussed . in the discussions that follow , flow diagrams are provided . it is to be understood that any process steps or blocks in these flow diagrams represent modules , segments , or portions of code that include one or more executable instructions for implementing specific logical functions or steps in the process . it will be appreciated that , although particular example process steps are described , alternative implementations are feasible . moreover , steps may be executed out of order from that shown or discussed , including substantially concurrently or in reverse order , depending on the functionality involved . fig4 provides a general overview of the manner in which a user can use the example system 200 , or another appropriate system , to facilitate check writing . beginning with block 400 , the check writing service 318 is accessed . typically , this access is gained via the network 208 . for instance , where the check writing service 318 executes on the printing device 204 , the user can access the service by directing an appropriate browser to the address ( e . g ., uniform resource locator ( url )) of the service . after the check writing service 318 has been accessed , the user can identify the data that are to be printed on the check that will be generated , as indicated in block 402 . this information typically includes at least a payee name and a payment amount . once the data has been entered by the user , the check writing service 318 can store the data , as indicated in block 404 . at this point , the user can print the data , as indicated in block 406 , by issuing a print command to the check writing service 318 . as noted above , the data are typically printed on preprinted check media that are contained within the printing device 204 . referring now to fig5 a - 5b , a more detailed example of the operation of the system 200 will be provided . more particularly , an example of operation of the check writing service 318 is provided . beginning with block 500 of fig5 a , the user browses to the check writing service 318 using an appropriate network browser ( e . g ., web browser ) that executes on the user computing device 202 . typically , this service 318 comprises a web site that is accessed via the internet ( and / or intranet ). to provide for security , this communication , and those that follow , can be accessed through a secure sockets layer ( ssl ) or through use of another security scheme . as noted above , the check writing service 318 can , for example , be executed upon the printing device 204 . once the check writing service 318 is accessed , the service downloads content to the user browser , as indicated in block 502 . this content normally includes various text and / or graphics that are displayed to the user to facilitate interfacing between the user and the service 318 . this content can , optionally , include one or more applications ( e . g ., applets ) that perform certain functions to aid the check writing service 318 and , thereby , facilitate check generation . after the check writing service 318 has been accessed , the user can be prompted to verify his or her authorization to use the check writing service , as indicated in block 504 . by way of example , the user can be prompted to enter a user name and password . notably , if the user already logged on to the computing device 202 that is being used to access the check writing service 318 , the above - noted verification procedure may be unnecessary . assuming the user to be authorized and therefore capable of establishing his or her authorization , the check writing service 318 can confirm the user authorization , as indicated in block 506 . at this point , the check writing service 318 can prompt the user to identify the data to be printed , as indicated in block 508 . typically , this prompting is effected with an interface ( e . g ., graphical user interface ( gui )) in the form of one or more web pages that are presented to the user with the user browser . for example , the check writing service 318 can prompt the user to manually enter the data or identify the location of the data . the latter option may be particularly attractive where the user wishes to print several different checks using data from one or more databases . for instance , where the data for several different insurance claimants resides in one or more such databases , the user can identify the location ( s ) of the database ( s ) such that the data can be uploaded to the check writing service 318 . these databases can , for instance , reside on the user computing device 202 ( e . g ., on a hard disk ) and may comprise one or more files associated with a given user application ( e . g ., peachtree ™ quicken ™, etc .). if this option is selected , one or more applications ( e . g ., applets or possibly signed applets which are allowed extensive access to the capabilities of the client system ) that were downloaded to the user browser as content can form part of an upload mechanism that is used to perform the upload operation . for instance , the applications can generate a pop - up dialogue box or further web page with which the user can provide one or more file names from which the data is to be retrieved . where the user does not know of the correct filename ( s ), the applications can , for instance , be used to scan the user &# 39 ; s computing device hard disk so that the user may browse through the contents of the hard disk to locate the appropriate file ( s ). where the databases comprise remote databases , the user can provide an address ( e . g ., url ) of the databases to be accessed so that the check writing service 318 can retrieve the data . again , this information can be provided with a dialogue box or further web page that is presented to the user . by way of example , the database ( s ) can include one or more internet - accessible database management systems ( e . g ., oracle , sybase , etc .) that the user may presently use to store the data to be printed . in such a circumstance , the user may further be prompted to provide additional information that identifies the print data . for example , the user may be prompted to provide a structured query language ( sql ) query to identify which data ( e . g ., records ) are to be accessed by the check writing service 318 , and any other details that may be pertinent to identifying and accessing the data ( e . g ., the credentials needed to access the database , the network address of the database , the name of the database , etc .). irrespective of the manner in which the data to be printed is identified , the data identification can be received by the check writing service 318 , as indicated in block 510 . at this point , the various data to be printed can be stored by the service 318 , as indicated in block 512 . where the service 318 is supported by the printing device 204 , ( i . e ., embedded within the device ), the data can be stored within memory 302 ( e . g ., an internal hard disk ) of the device . where the service 318 is not supported by the printing device 204 , or where the device lacks the storage resources to store the data in memory 302 , the data can be stored in another appropriate storage location that is accessible by the service . with reference to fig5 b and decision element 514 , it can then be determined whether checks are to be printed . if the checks are not to be printed , flow for the session is terminated and the user may return to the service 318 at a later time to print the checks , if desired . if , however , the user does wish for checks to be printed , the check writing service 318 facilitates this printing , as indicated in block 516 , by , for example , sending a print job comprising the data and its arrangement to the hard copy generation hardware 304 . as noted above , there is nearly always potential for fraud when printing checks . to cite one example way in which fraud can be perpetrated , an unscrupulous user can simulate a jam of the printing device 204 in an attempt to access the preprinted blank checks that the device contains . to prevent such activity or , to at least more quickly identify the perpetrator , the check writing service 318 can be configured to detect when a jam condition is registered . this detection is possible in that the check writing service 318 is closely linked with the printing device 204 ( e . g ., stored in the printing device ). assuming the service 318 to be configured to provide such functionality , flow continues to decision element 518 at which it is determined whether a jam occurs . this determination can be made affirmatively by the check writing service 318 through various detection means , or can be made with reference to a notification that is delivered to the service from another device component . regardless , if no jam occurs during the printing of the check ( s ), flow continues to block 528 described below . if , on the other hand , a jam does occur , flow continues to block 520 at which the jam occurrence is recorded along with information about who sent the print job , when the jam occurred , etc . this information can be recorded within the printing device 204 ( e . g ., within an internal hard disk ) or in another location accessible via the network 208 . in addition , it can be determined , at decision element 522 , whether to alert a responsible party as to the jam condition . in that checks are being printed , such a jam condition is an inherently suspect condition . for this reason , it may be desirable to provide an immediate notification to the responsible party who may , for instance , hold a managerial position . if no alert is to be transmitted , flow continues to decision element 526 described below . if the alert is to be transmitted , however , it is transmitted to the responsible party , as indicated in block 524 . this alert can comprise , for instance , an email message , a text message that is sent to a portable device ( e . g ., pda , mobile telephone ) of the responsible party , a page that is sent to a pager of the responsible party , combinations thereof , etc . accordingly , the responsible party can immediately be made aware of the situation and , if on the premises , immediately investigate the situation personally . with reference to decision element 526 , if the jam is not fixed , flow for the printing session is terminated until such time when the device 204 is again operational . once the jam is fixed , however , the check writing service 318 logs information about the completed check printing session , as indicated in block 528 , such as when the print job was initiated , who initiated the print job , who the listed payee ( s ) is / are , the amount of the check ( s ), etc . by way of example , this information can be stored within memory ( e . g ., internal hard disk ) of the printing device 204 or another designated location that is accessible via the network 208 . at this point , the printing session can be memorialized as indicated in block 530 . this memorialization can take many different forms . by way of example , the check writing service 318 can generate a receipt that can , for instance , be printed along with the printed check so that the user ( i . e ., sender ) can obtain a record of the printing of the check . this record can include some or all of the information that was logged by the check writing service 318 as noted above with reference to block 528 . this printed receipt can then be provided to the payee of the check ( e . g ., insurance claimant ). alternatively , an electronic receipt can be generated for the user and stored in a designated location that is accessible over the network 208 for later retrieval and / or inspection . for instance , the electronic receipt can be stored in a personal imaging repository of the user in the manner described in u . s . patent application ser . no . 09 / 999 , 450 , filed on nov . 15 , 2001 , identified above ( attorney docket no . 10008256 - 1 ). operating in the manner described above , the system and method can be used to simplify check writing in that the check writing service can be managed from a single control point as opposed to being distributed over several different computing devices . moreover , as noted above , fraud can be prevented and / or quickly discovered with greater ease . although the jam scenario has been discussed in detail , it is to be understood that the same antifraud measures described above can be used for any other type of occurrence that may be deemed suspicious ( i . e ., susceptible to fraudulent activity ) that may arise . while particular embodiments of the invention have been disclosed in detail in the foregoing description and drawings for purposes of example , it will be understood by those skilled in the art that variations and modifications thereof can be made without departing from the scope of the invention as set forth in the following claims . | 6 |
the present invention will now be described in detail with reference to a few preferred embodiments thereof as illustrated in the accompanying drawings . in the following description , numerous specific details are set forth in order to provide a thorough understanding of the present invention . it will be apparent , however , to one skilled in the art , that the present invention may be practiced without some or all of these specific details . in other instances , well known process steps and / or structures have not been described in detail in order to not unnecessarily obscure the present invention . to facilitate understanding , fig2 is a high level flow chart of a process that may be used in an embodiment of the invention . a mask is formed over a silicon layer to be etched ( step 204 ). the silicon layer may be polysilicon , crystalline silicon , such as a silicon wafer , or amorphous silicon . the silicon layer is generally a pure silicon , which may have a dopant . the silicon layer is not silicon oxide or silicon nitride , although the silicon layer may have a thin silicon oxide layer that may naturally form over the top surface of the silicon layer . a polymer is deposited over the mask using a hydrogen free deposition gas ( step 208 ). in such a hydrogen free deposition gas , none of the molecules making up the hydrogen free deposition gas have any hydrogen . the deposition layer is opened ( step 212 ). the silicon layer is etched ( step 216 ). in an example of an implementation of the invention , fig3 illustrates a processing tool that may be used in an implementation of the invention . fig3 is a schematic view of a plasma processing system 300 , including a plasma processing tool 301 . the plasma processing tool 301 is an inductively coupled plasma etching tool and includes a plasma reactor 302 having a plasma processing chamber 304 therein . a transformer coupled power ( tcp ) controller 350 and a bias power controller 355 , respectively , control a tcp power supply 351 and a bias power supply 356 influencing the plasma 324 created within plasma chamber 304 . the tcp power controller 350 sets a set point for tcp power supply 351 configured to supply a radio frequency signal at 13 . 56 mhz , tuned by a tcp match network 352 , to a tcp coil 353 located near the plasma chamber 304 . an rf transparent window 354 is provided to separate tcp coil 353 from plasma chamber 304 while allowing energy to pass from tcp coil 353 to plasma chamber 304 . the bias power controller 355 sets a set point for bias power supply 356 configured to supply an rf signal , tuned by bias match network 357 , to a chuck electrode 308 located within the plasma chamber 304 creating a direct current ( dc ) bias above electrode 308 which is adapted to receive a substrate 306 , such as a semi - conductor wafer work piece , being processed . a gas supply mechanism or gas source 310 includes a source or sources of gas or gases 316 attached via a gas manifold 317 to supply the proper chemistry required for the process to the interior of the plasma chamber 304 . a gas exhaust mechanism 318 includes a pressure control valve 319 and exhaust pump 320 and removes particles from within the plasma chamber 304 and maintains a particular pressure within plasma chamber 304 . a temperature controller 380 controls the temperature of a cooling recirculation system provided within the chuck electrode 308 by controlling a cooling power supply 384 . the plasma processing system also includes electronic control circuitry 370 . the plasma processing system may also have an end point detector . fig4 a and 4b illustrate a computer system 400 , which is suitable for implementing a controller for control circuitry 370 used in embodiments of the present invention . fig4 a shows one possible physical form of the computer system . of course , the computer system may have many physical forms ranging from an integrated circuit , a printed circuit board , and a small handheld device up to a huge super computer . computer system 400 includes a monitor 402 , a display 404 , a housing 406 , a disk drive 408 , a keyboard 410 , and a mouse 412 . disk 414 is a computer - readable medium used to transfer data to and from computer system 400 . fig4 b is an example of a block diagram for computer system 400 . attached to system bus 420 is a wide variety of subsystems . processor ( s ) 422 ( also referred to as central processing units , or cpus ) are coupled to storage devices , including memory 424 . memory 424 includes random access memory ( ram ) and read - only memory ( rom ). as is well known in the art , rom acts to transfer data and instructions uni - directionally to the cpu and ram is used typically to transfer data and instructions in a bi - directional manner . both of these types of memories may include any suitable of the computer - readable media described below . a fixed disk 426 is also coupled bi - directionally to cpu 422 ; it provides additional data storage capacity and may also include any of the computer - readable media described below . fixed disk 426 may be used to store programs , data , and the like and is typically a secondary storage medium ( such as a hard disk ) that is slower than primary storage . it will be appreciated that the information retained within fixed disk 426 may , in appropriate cases , be incorporated in standard fashion as virtual memory in memory 424 . removable disk 414 may take the form of any of the computer - readable media described below . cpu 422 is also coupled to a variety of input / output devices , such as display 404 , keyboard 410 , mouse 412 , and speakers 430 . in general , an input / output device may be any of : video displays , track balls , mice , keyboards , microphones , touch - sensitive displays , transducer card readers , magnetic or paper tape readers , tablets , styluses , voice or handwriting recognizers , biometrics readers , or other computers . cpu 422 optionally may be coupled to another computer or telecommunications network using network interface 440 . with such a network interface , it is contemplated that the cpu might receive information from the network , or might output information to the network in the course of performing the above - described method steps . furthermore , method embodiments of the present invention may execute solely upon cpu 422 or may execute over a network such as the internet in conjunction with a remote cpu that shares a portion of the processing . in addition , embodiments of the present invention further relate to computer storage products with a computer - readable medium that have computer code thereon for performing various computer - implemented operations . the media and computer code may be those specially designed and constructed for the purposes of the present invention , or they may be of the kind well known and available to those having skill in the computer software arts . examples of computer - readable media include , but are not limited to : magnetic media such as hard disks , floppy disks , and magnetic tape ; optical media such as cd - roms and holographic devices ; magneto - optical media such as floptical disks ; and hardware devices that are specially configured to store and execute program code , such as application - specific integrated circuits ( asics ), programmable logic devices ( plds ) and rom and ram devices . examples of computer code include machine code , such as produced by a compiler , and files containing higher level code that are executed by a computer using an interpreter . computer readable media may also be computer code transmitted by a computer data signal embodied in a carrier wave and representing a sequence of instructions that are executable by a processor . a mask is formed over a silicon layer ( step 204 ). fig5 a is a schematic cross - sectional view of a silicon etch layer 504 . in this example , the silicon etch layer is a crystalline silicon wafer , which forms a substrate . in this example , the mask 512 is a photoresist mask , which is deposited and then patterned to form openings 522 in the mask 512 . in other examples , that mask may be of other materials , such as silicon oxide , which is used to form a hardmask . a photoresist mask may be used to form a hardmask . the wafer is placed in the plasma processing system 300 . a hydrogen free deposition layer is formed over the mask ( step 208 ). fig5 b is a view after the deposition layer 516 has been formed over the mask 512 . fig6 is a more detailed flow chart of the formation of the hydrogen free deposition layer . a hydrogen free deposition gas comprising c 4 f 8 is flowed from the gas source 316 into the plasma processing tool 301 ( step 604 ). in an example recipe , the deposition gas consists of pure c 4 f 8 . in this example , the deposition gas is 100 sccm c 4 f 8 . the deposition gas is transformed to a deposition plasma ( step 608 ). in this example 900 watts at 13 . 56 mhz of power is provided to the top electrode and − 65 volts at 400 khz is provided to the bottom electrode to transform the deposition gas to a plasma . the deposition is provided for about 30 seconds . then the depositing the polymer layer is stopped ( step 612 ). a pressure of 90 mtorr is maintained . preferably the deposition is provided for at least 20 seconds . more preferably , the deposition is provided for at least 25 seconds . most preferably , the deposition is provided for at least 30 seconds . preferably , the deposition layer is at least 200 nm thick on the sidewalls . more preferably , the deposition layer is at least 300 nm thick on the sidewalls . the deposition gas is a hydrogen free deposition to provide a deposition layer with improved properties over depositions that are not hydrogen free . in this example , the deposition gas is pure c 4 f 8 because the resulting deposition layer provides improved properties . the deposition layer is opened ( step 212 ). fig5 c is a view after the deposition layer is opened . in this example , the opening process removes the parts of the deposition layer on horizontal surfaces , leaving only sidewalls 520 formed by the deposition layer . fig7 is a more detailed flow chart of the opening of the deposition layer . an opening gas is flowed from the gas source 316 into the plasma processing tool 301 ( step 704 ). in this example , the opening gas is 30 sccm of sf 6 . the opening gas is transformed to a opening plasma ( step 708 ). in this example 600 watts at 13 . 56 mhz of power is provided to the top electrode and − 150 volts at 400 khz is provided to the bottom electrode to transform the opening gas to a plasma . the opening is provided for about 15 seconds . the opening process is then stopped ( step 712 ). the pressure is set for 30 mtorr . other opening gases may comprise cf 4 and ar , or o 2 and ar , or sf 6 and ar . the silicon layer is etched ( step 216 ). fig5 d is a view after the silicon etch has been performed . features 524 have been etched into the silicon layer 504 . in this example , the deposition layer has been completely etched away . in other examples , some of the deposition layer may remain . also in this example , some of the photoresist mask 512 remains . in other examples , the photoresist mask may be completely etched away . if not completely removed , the deposited layer and mask are subsequently removed . it has been unexpectedly found that this example reduces or more preferably eliminates undercutting , as shown . fig8 is a more detailed flow chart of an example of the etching process . an etch gas is flowed from the gas source 316 into the plasma processing tool 301 ( step 804 ). in this example , the etch gas is 200 sccm of cf 4 . the etch gas is transformed to an etching plasma ( step 808 ). in this example , 600 watts at 13 . 56 mhz of power is provided to the top electrode and − 200 volts at 400 khz is provided to the bottom electrode to transform the etch gas to a plasma . the etching is provided for about 20 seconds . the etching process is then stopped ( step 812 ). in other examples , a combination of short etching and deposition steps may be used . such short deposition steps would deposit for less than 10 seconds . it is believed that multiple etch and deposition processes , especially with depositions greater than 10 seconds cause a stepped profile , instead of a vertical profile . although the etch gas chemistry may be the same as the opening gas chemistry in some examples , the plasma from the etching gas is different from the plasma from the opening gas , due to one or more differences in parameters . more preferably , the etching gas chemistry is different than the opening gas chemistry , since the etching gas chemistry is used for etching silicon , whereas the opening gas chemistry is used for opening the polymer deposition layer . preferably , the silicon features have a depth of at least 500 nm . more preferably , the silicon features have a depth of at least 1000 nm . preferably , the silicon features have a depth to width aspect ratio of at least 5 : 1 . more preferably , the silicon features have an aspect ratio of at least 10 : 1 . it has been found that the presence of hydrogen during the deposition causes an undesirable type of polymer to deposit . in addition to eliminating undercutting , it has been unexpectedly found that this process provides improved control of the etch profile and allows quicker processing . the invention also allows the formation of the deposition layer , opening of the deposition layer , and etching the silicon do be done in situ in a single plasma processing chamber . while this invention has been described in terms of several preferred embodiments , there are alterations , permutations , and various substitute equivalents , which fall within the scope of this invention . it should also be noted that there are many alternative ways of implementing the methods and apparatuses of the present invention . it is therefore intended that the following appended claims be interpreted as including all such alterations , permutations , and various substitute equivalents as fall within the true spirit and scope of the present invention . | 7 |
fig1 shows a motorcycle 100 . a reciprocating piston internal combustion engine 102 is provided to drive the motorcycle 100 , transmitting the driving forces via a cardan shaft 106 , for example , a driving belt or a drive chain to the driven wheel 108 with a transmission 104 in between . the cooling of the internal combustion engine 102 is accomplished by means of a circulating coolant which absorbs heat in areas of the internal combustion engine that are to be cooled and releases this heat elsewhere via a heat exchanger 110 through which air can flow . a heat exchanger 200 for cooling the internal combustion engine of a motorcycle , having a collecting tank 204 on the radiator forward flow end and a collecting tank 206 on the radiator return flow end with a curved heat sink 202 arranged between them , as shown in an iso view in fig2 a ; fig2 b shows a side view of the collecting tank 204 on the radiator forward flow end and fig2 c shows the curved heat exchanger 200 as seen from above . in the installed position , the heat sink 202 has a laterally inclined oncoming flow surface at the bottom in the installed position . in the present case , the oncoming flow surface of the heat sink 202 is formed geometrically by an upper rectangular area 208 and a lower trapezoidal area 210 , but it may also be expedient if the heat sink 202 has a different surface , e . g ., a v - shaped surface adapted to the available space . it shall be emphasized that the heat sink 202 has a longer side 212 and a shorter side 214 between the collecting tanks 204 , 206 . the heat sink 202 has a plurality of cross tubes through which flow passes from the collecting tank 204 on the radiator forward flow end to the collecting tank 206 on the radiator return flow end , these cross tubes each being fixedly connected with lateral connecting planes 216 , 218 for connecting to the collecting tanks 204 , 206 . the cross tubes and the lateral connecting planes 216 , 218 are made of metal , in particular lightweight metal or a lightweight metal alloy such as aluminum , and are soldered , welded or glued together . for connecting the collecting tanks 204 , 206 to the lateral connecting planes 216 , 218 , the connecting planes 216 , 218 have straps that can be flanged on the peripheral edges and engage behind a peripheral edge of the collecting tanks 204 , 206 in the installed state . gaskets ( not visible here ) are provided for a tight connection of the collecting tanks 204 , 206 to the lateral connecting planes 216 , 218 . the collecting tanks 204 , 206 are made of a thermoplastic material such as fiberglass - reinforced nylon , e . g ., nylon 6 . 6 containing 30 % glass fibers . a housing 228 to hold a thermostatic valve that controls the flow through the heat exchanger as a function of temperature is integrally connected to the collecting tank 206 on the return flow end of the radiator . fabrication of the heat exchanger 200 begins with a flat , uncurved heat sink 202 having lateral connecting planes 216 , 218 . the collecting tanks 204 , 206 are mounted with a gasket and secured by flanging the straps . the heat sink 202 , 302 is subsequently bent , as illustrated on an exaggerated scale in fig3 , whereby the longer side 212 , 312 undergoes a greater bending than the shorter side 214 , 314 owing to the difference in bending resistance torques , with the result that the collecting tanks 204 , 206 , 304 , 306 together with the connecting planes 216 , 218 , 316 , 318 are twisted . the collecting tanks 204 , 206 , 304 , 306 , which are made of plastic , have lower strength values in comparison with the metallic material of the heat sink 202 , 302 and the connecting planes 216 , 218 , 316 , 318 and accordingly they absorb a significant portion of the stresses occurring in deformation , so that the area of the connection of the individual radiator cross tubes with the connecting planes 216 , 218 , 316 , 318 is relieved in particular . the plastic of the collecting tanks 204 , 206 , 304 , 306 in the present case has a strength value r m of 30 to 80 n / mm 2 , while the cooling bodies 202 , 302 and the connecting planes 216 , 218 , 316 , 318 made of an aluminum alloy have a strength value r m of 200 to 600 n / mm 2 , so the material of the heat sink 202 , 302 and the connecting planes 216 , 218 , 316 , 318 is 2 . 5 to 20 times stronger than the material of the collecting tanks 204 , 206 , 304 , 306 . the stresses occurring in deformation of the heat sink 202 , 302 , the connecting planes 216 , 218 , 316 , 318 and the collecting tanks 204 , 206 , 304 , 306 are dissipated , in particular in the collecting tanks due to the material by yielding of the material . the dissipation of stress in the collecting tanks is supported by heat and / or substances that reduce the strength of the material of the collecting tanks ; for example the coolant of the internal combustion engine has a strength - reducing effect as a function of operating temperature and / or due to the glycol contained therein . in the present case , the strength of the material of the collecting tanks 204 , 206 , 304 , 306 is reduced by 30 to 40 %. the dissipation of internal stresses is accomplished comparatively rapidly and has a very positive effect on the long - term functionality of the heat exchanger and rejects in production can be reduced . the collecting tanks 204 , 206 are equipped with fastening points for securing them on the motor vehicle 220 and / or for attaching additional elements 222 , 224 , 226 such as fans , paneling parts , air ducts and / or protective grids . in the production of the collecting tanks 204 , 206 , the torsion - induced displacement in the assembly state is performed so that all the fastenings and connection points assume their intended positions after the deformation . the foregoing disclosure has been set forth merely to illustrate the invention and is not intended to be limiting . since modifications of the disclosed embodiments incorporating the spirit and substance of the invention may occur to persons skilled in the art , the invention should be construed to include everything within the scope of the appended claims and equivalents thereof . | 5 |
1 - bromo - 2 -( 2 - methoxyethoxy ) ethane is purchased from shenyang ollychem technology co ., ltd ., and other reagents are purchased from sinopharm chemical reagent co ., ltd . in beijing . 4 - fluoroaniline ( 11 . 1 g , 0 . 1 mol ), 2 - cyanoacetate acid ( 8 . 5 g , 0 . 1 mol ), edci ( 19 . 2 g , 0 . 1 mol ), hobt ( 13 . 5 g , 0 . 1 mol ) and et 3 n ( 20 . 2 g , 0 . 2 mol ) were dissolved in ch 2 cl 2 ( 200 ml ), and stirred at room temperature overnight . distilled water ( 100 ml ) was added , the liquid layers obtained was separated , the aqueous layer was extracted with ch 2 cl 2 ( 50 ml × 2 ), the mixed organic layer was successively washed with distilled water ( 50 ml × 2 ) and saturated brine ( 50 ml × 1 ), dried with na 2 so 4 , concentrated . the residue was separated by a silica gel column ( pe / ea = 3 : 1 ) to give 15 . 0 g of a white solid with a yield of 84 . 0 %. 1 h nmr ( 400 mhz , dmso - d 6 ): 3 . 89 ( s , 2h ), 7 . 18 ( m , 2h ), 7 . 56 ( m , 2h ), 10 . 39 ( s , 1h ). 2 - cyano - n -( 4 - fluorophenyl ) acetamide ( 2 . 0 g , 11 . 2 mmol ), 5 -( hydroxymethyl ) furan - 2 - carbaldehyde ( 2 . 1 g , 16 . 8 mmol ) and 1 - methylpiperazine ( 1 . 1 g , 11 . 2 mmol ) were dissolved in ch 3 oh ( 50 ml ), and stirred at room temperature overnight . the solid was collected by filtration , washed with ch 3 oh ( 50 ml ) to give 1 . 1 g of a yellow solid with a yield of 36 . 0 %. 1 h nmr ( 400 mhz , dmso - d 6 ): 4 . 54 ( d , 2h ), 5 . 56 ( m , 1h ), 6 . 68 ( d , 1h ), 7 . 20 ( m , 2h ), 7 . 41 ( d , 1h ), 7 . 68 ( m , 2h ), 8 . 07 ( s , 1h ), 10 . 26 ( s , 1h ). 2 -( 1h - indol - 3 - yl ) ethylamine ( 16 . 0 g , 0 . 1 mol ), 2 - cyanoacetate acid ( 8 . 5 g , 0 . 1 mol ), edci ( 19 . 2 g , 0 . 1 mol ), hobt ( 13 . 5 g , 0 . 1 mol ) and et 3 n ( 20 . 2 g , 0 . 2 mol ) were dissolved in ch 2 cl 2 ( 200 ml ), and stirred at room temperature overnight . distilled water ( 100 ml ) was added , the liquid layers obtained was separated , the aqueous layer was extracted with ch 2 cl 2 ( 80 ml × 2 ), the mixed organic layer was successively washed with distilled water ( 80 ml × 2 ) and saturated brine ( 80 ml × 1 ), dried with na 2 so 4 , concentrated . the residue was separated by a silica gel column ( pe / ea = 1 : 1 ) to give 18 . 0 g of a white solid with a yield of 79 . 0 %. n -[ 2 -( 1h - indol - 3 - yl ) ethyl ]- 2 - cyanoacetamide ( 3 . 0 g , 13 . 2 mmol ), 5 -( hydroxymethyl ) furan - 2 - carbaldehyde ( 1 . 1 g , 8 . 8 mmol ) and 1 - methylpiperazine ( 1 . 3 g , 13 . 2 mmol ) were dissolved in ch 3 oh ( 50 ml ), and stirred at room temperature overnight . the solid was collected by filtration , washed with ch 3 oh ( 50 ml ) to give 1 . 7 g of a yellow solid with a yield of 58 . 0 %. 1 h nmr ( 400 mhz , dmso - d 6 ): 2 . 91 ( m , 2h ), 3 . 47 ( m , 2h ), 4 . 51 ( d , 2h ), 5 . 53 ( m , 1h ), 6 . 64 ( d , 1h ), 6 . 98 ( m , 1h ), 7 . 07 ( m , 1h ), 7 . 17 ( d , 1h ), 7 . 33 ( m , 2h ), 7 . 59 ( m , 1h ), 7 . 93 ( s , 1h ), 8 . 42 ( s , 1h ), 10 . 83 ( s , 1h ). n -[ 2 -( 1h - indol - 3 - yl ) ethyl ]- 2 - cyanoacetamide ( 5 . 0 g , 22 . 0 mmol ), 5 - bromo - furan - 2 - carbaldehyde ( 2 . 5 g , 14 . 6 mmol ) and 1 - methylpiperazine ( 2 . 2 g , 22 . 0 mmol ) were dissolved in ch 3 oh ( 100 ml ), and stirred at room temperature overnight . the solid was collected by filtration , washed with ch 3 oh ( 50 ml ) to give 4 . 5 g of a yellow solid with a yield of 81 . 0 %. 2 - cyano - n -[ 2 -( 1h - 3 - indolypethyl ]- 3 -( 5 - bromo - 2 - furyl )- 2 - acrylamide ( 4 . 5 g , 11 . 7 mmol ) and 2 -( aminoethoxy ) ethanol ( 2 . 54 g , 17 . 6 mmol ) were dissolved in pyridine ( 30 ml ), stirred at 40 ° c . overnight . the reaction mixture was concentrated under reduced pressure , and the residue was separated and purified by preparative liquid chromatography to give 1 . 2 g of a brown solid with a yield of 25 . 0 %. to a solution formed by furfuralcohol ( 2 . 0 g , 20 . 4 mmol ) dissolved in tetrahydrofuran ( 100 ml ) nah ( 1 . 5 g , 61 . 3 mmol ) was added , followed by the addition of 1 - bromo - 2 -( 2 - methoxyethoxy ) ethane ( 7 . 5 g , 40 . 8 mmol ), and the reaction liquid was stirred overnight . the reaction mixture was extracted with ethyl acetate , and the extract was washed with distilled water , dried with anhydrous sodium sulfate , concentrated to dryness under reduced pressure , the residue was purified by a silica gel column to give 3 . 5 g of a pale yellow oil with a yield of 85 . 7 %. a mixed solution of dmf ( 1 . 7 g , 22 . 5 mmol ) and 1 , 2 - dichloroethane ( 45 ml ) was stirred and cooled to 0 ° c ., and pocl 3 ( 3 . 0 g , 20 . 1 mmol ) was slowly added dropwise with a controlled dropping rate to make the temperature of the reaction solution lower than 25 ° c . to the reaction mixture , a solution formed by 2 -( 2 , 5 , 8 - trioxa - nonyl - 1 - yl ) furan ( 3 . 0 g , 15 . 0 mmol ) dissolved in 1 , 2 - dichloroethane ( 45 ml ) was slowly added dropwise with a controlled dropping rate to make the temperature of the reaction solution lower than 25 ° c . the mixture obtained was stirred at room temperature overnight after completion of addition dropwise . to the reaction mixture , a saturated solution of sodium bicarbonate ( 200 ml ) was slowly added dropwise , then extracted with diethyl ether ( 3 × 200 ml ), the mixed extract was washed successively with distilled water and saturated sodium chloride solution , dried with anhydrous sodium sulfate , and concentrated to dryness under reduced pressure , the residue was purified by a silica gel column to give 3 . 1 g of a pale yellow oil with a yield of 91 . 3 %. 2 - cyano - n -( 4 - fluorophenyl ) acetamide ( 4 . 0 g , 22 . 4 mmol ), 5 -( 2 , 5 , 8 - trioxa - nonyl - 1 - yl ) furan - 2 - carbaldehyde ( 3 . 4 g , 14 . 9 mmol ) and 1 - methylpiperazine ( 2 . 2 g , 22 . 4 mmol ) were dissolved in ch 3 oh ( 50 ml ), stirred at room temperature overnight . the solid was collected by filtration , washed with ch 3 oh ( 50 ml ) to give 1 . 6 g of a yellow solid with a yield of 27 . 6 %. triglycol ( 12 . 2 g , 81 . 3 mmol ) was dissolved in dichloromethane ( 150 ml ), stirred and cooled to 0 ° c ., and then carbon tetrabromide ( 12 . 0 g , 27 . 1 mmol ) and triphenylphosphine ( 7 . 8 g , 29 . 8 mmol ) were added . the reaction mixture was stirred at room temperature for 2 h , the solvent was distilled off under reduced pressure , the residue was purified by a silica gel column to give 4 . 8 g of a pale yellow oil with a yield of 27 . 7 %. 1 h nmr ( 400 mhz , cdcl 3 ): 3 . 35 ( t , 2h ), 3 . 44 ( t , 2h ), 3 . 53 ( m , 4h ), 3 . 58 ( t , 2h ), 3 . 68 ( t , 2h ). 2 -[ 2 -( 2 - bromoethoxy ) ethoxy ] ethanol ( 4 . 2 g , 19 . 8 mmol ) was dissolved in diethyl ether ( 150 ml ), slowly added dropwise by 3 , 4 - dihydro - 2h - pyran ( 2 . 5 g , 29 . 7 mmol ) under stirring , the reaction mixture was stirred at room temperature for 1 h . to the reaction liquid , nahco 3 was added for neutralization , then the reaction mixture was filtered , evaporated under reduced pressure to remove the solvent and excess 3 , 4 - dihydro - 2h - pyran , the residue was purified by a silica gel column to give 4 . 1 g of a pale yellow oil with a yield of 69 . 7 %. nmr detection : 1 h nmr ( 400 mhz , cdcl 3 ): 1 . 40 - 1 . 85 ( m , 6h ), 3 . 35 - 3 . 85 ( m , 14h ), 4 . 55 - 4 . 62 ( m , 1h ). to a solution formed by furfuralcohol ( 2 . 0 g , 20 . 4 mmol ) dissolved in tetrahydrofuran ( 100 ml ) nah ( 1 . 5 g , 61 . 3 mmol ) was added , followed by addition of 2 -( 8 - bromo - 3 , 6 - dioxa - octane - 1 - yl ) tetrahydropyran ( 12 . 1 g , 40 . 8 mmol ), and the reaction liquid was stirred overnight . the reaction mixture was extracted with ethyl acetate , and the extract was washed with distilled water , dried with anhydrous sodium sulfate , concentrated to dryness under reduced pressure , the residue was purified by a silica gel column to give 5 . 1 g of a pale yellow oil with a yield of 79 . 5 %. pyridine p - toluenesulfonate ( 3 . 1 g , 14 . 0 mmol ) was dissolved in absolute ethanol ( 150 ml ), 2 -[ 10 -( furan - 2 - yl )- 3 , 6 , 9 - trioxa - decane - 1 - yl ] tetrahydropyran ( 4 . 0 g , 12 . 7 mmol ) was then added . the reaction mixture was warmed to 55 ° c ., stirred for 12 h with heat preservation , concentrated to dryness under reduced pressure , the residue was purified by a silica gel column to give 2 . 4 g of a pale yellow oil with a yield of 82 . 1 %. a mixed solution of dmf ( 1 . 7 g , 22 . 5 mmol ) and 1 , 2 - dichloroethane ( 45 ml ) was stirred and cooled to 0 ° c ., then pocl 3 ( 3 . 0 g , 20 . 1 mmol ) was slowly added dropwise with a controlled dropping rate to make the temperature of the reaction solution lower than 25 ° c . to the reaction mixture , a solution formed by 2 -( 10 - hydroxy - 2 , 5 , 8 - trioxa - decane - 1 - yl ) furan ( 3 . 5 g , 15 . 0 mmol ) dissolved in 1 , 2 - dichloroethane ( 45 ml ) was slowly added dropwise with a controlled dropping rate to make the temperature of the reaction solution lower than 25 ° c . the mixture obtained was stirred at room temperature overnight after completion of addition dropwise . to the reaction mixture , a saturated solution of sodium bicarbonate ( 200 ml ) was slowly added dropwise , then extracted with diethyl ether ( 3 × 200 ml ), the mixed extract was washed successively with distilled water and saturated sodium chloride solution , dried with anhydrous sodium sulfate , and concentrated to dryness under reduced pressure , the residue was purified by a silica gel column to give 3 . 4 g of a pale yellow oil with a yield of 87 . 8 %. n -[ 2 -( 1h - indol - 3 - yl ) ethyl ]- 2 - cyanoacetamide ( 5 . 0 g , 22 . 0 mmol ), 5 -( 10 - hydroxy - 2 , 5 , 8 - trioxa decane - 1 - yl ) furan - 2 - carbaldehyde ( 3 . 8 g , 14 . 6 mmol ) and 1 - methylpiperazine ( 2 . 2 g , 22 . 0 mmol ) were dissolved in ch 3 oh ( 100 ml ), stirred at room temperature overnight . the solid was collected by filtration , washed with ch 3 oh ( 50 ml ) to give 5 . 3 g of a yellow solid with a yield of 77 . 6 %. example 6 : test for anti - senile dementia effect of compounds jk - 01a , jk - 03a , jk - 05a , jk - 06a and jk - 07a in all tests , w 1118 ( isocj1 ) was used as a control gene system , referred to as the “ 2u ”. progeny fruit flies with disease carrying p35 and h29 . 3 were obtained by integration of fruit flies carrying elav - gal4 c155 ( referred to as p35 ) and fruit flies carrying aβ42 ( uas - aβ42 ; referred to as h29 . 3 ). the first generation of fruit flies obtained by hybridization was used for behavioral testing . details as follows : f0 p35 ♀ × h29 . 3 ♂ ( elav / elav ; ( w / y ; uas - aβ42 / cyo ) +/+) ↓ f1 ad ♂ ( elav / y ; uas - aβ42 /+; +/+) all the fruit flies were reared in an environment with a temperature of 24 ° c ., relative humidity of 40 % rh . on the first day , newborn male 2u * h29 . 3 fruit flies and male ad fruit flies were picked out and put into glass bottles ( there were about 120 fruit flies in each bottle ). during administration period , these fruit flies were placed in an environment with a temperature of 28 ° c ., relative humidity of 42 % rh . from the second day to the eighth day , the fruit flies were transferred into new glass bottles 4 hours later after administration . all the fruit flies were placed in an environment with a temperature of 28 ° c ., relative humidity of 42 % rh until 1 hour before pavlovian olfactory learning test . on the first day of eclosion dispensation of drugs was conducted , the second day administration was carried out . the respective initial amount of compounds jk - 01a , jk - 03a , jk - 05a , jk - 06a and jk - 07a was 10 mg , and the final concentration was 100 μm . each group had two glass bottles of flies which were administered 50 μl within seven days ( from the second day to the eighth day ). during administration period , since some fruit flies died naturally or for other causes , about 100 flies were remained in each bottle when pavlovian olfactory test was conducted on the ninth day . the fruit flies were placed on the automatic training device for training . in training , a group of about 100 flies first contacted with one kind of odor ( octanol or methyl cyclohexanol ) accompanied by electric shocks ( an electric shock of 60 v for 3 . 5 s at 1 . 5 - s intervals ) for 60 s , rested at 45 - s intervals , and then contacted with another kind of odor ( methyl cyclohexanol or octanol ) without electric shocks for 60 s . to test the “ immediate memory ” ( also called “ learning ”), flies after the training were immediately sent to the t - maze choice point , and allowed to choose between two kinds of odor , the learning and memory index pi ( performance index ) in every test was calculated according to the number of flies choosing each kind of odor . pi = 0 represented 50 : 50 , meaning that fruit flies could not remember the odor accompanied by electric shocks , pi = 100 represented that 100 % of the flies remembered the odor accompanied by electric shocks . learning test was carried out in a darkroom with a temperature of 25 ° c ., relative humidity of 70 % rh . the fruit flies entered the darkroom to be familiar with the environment 1 hour before test . the test data was analyzed and plotted by employing graphpad prism . in the activity test , the olfactory short - term memory impairment tests of healthy flies with the same genetic background and without administration , ad flies without administration , ad flies administrated positive or negative control drugs and ad flies administrated test drugs were carried out at the same time , their learning and memory indexes were calculated , and the learning and memory index of ad flies administrated test drugs was compared with those of healthy flies with the same genetic background , ad flies , ad flies administrated positive or negative control drugs to evaluate the anti - senile dementia effect of test compounds . a relatively higher learning and memory index of ad flies administrated test drugs represented a stronger anti - senile dementia effect of test compounds . comparison between learning and memory indexes of ad flies administrated test drugs and ad flies without administration ( only administrated drug sample - free solvent ) was conducted by employing t test , a p value less than 0 . 05 represented a difference , a p value less than 0 . 01 represented a significant difference , a p value less than 0 . 001 represented a very significant difference . the test results are shown in table 1 , the data in table 1 is plotted as shown in fig1 : the test data in table 1 showed that , compared with drugs crocetin , erlotinib , dasatinib , jkf - 006 , jkf - 027 and jkf - 011 ( disclosed in wo2012 / 103282a2 ) reported to had an anti - senile dementia effect , compounds jkf - 006 , jk - 05a and crocetin ( p & gt ; 0 . 05 ) had equivalent anti - senile dementia effects , compounds jkf - 027 , jkf - 011 and erlotinib ( p & lt ; 0 . 05 ) had anti - senile dementia effects , compounds jk - 01a , jk - 03a , jk - 06a , jk - 07a and dasatinib ( p & lt ; 0 . 01 ) had significant anti - senile dementia effects . test data also showed that the compounds of the present invention jk - 01a , jk - 03a , jk - 06a and jk - 07a had more significant anti - senile dementia effects compared with compound jkf - 006 , jkf - 027 and jkf - 011 . thus , the compounds of the present invention jk - 01a , jk - 03a , jk - 05a , jk - 06a and jk - 07a may be used for treatment or prophylaxis of alzheimer &# 39 ; s disease , senile dementia , neurodegenerative disease , vascular dementia , vascular cognitive impairment , cholinergic neuron degenerative lesions , and helpful for the improvement of cognitive dysfunction or learning and memory impairment . example 7 : preliminary acute toxicity test for compounds jk - 01a , jk - 03a , jk - 05a , jk - 06a and jk - 07a method : in the acute toxicity test , icr mice were used and divided into six groups for administration , with 10 mice in each group and half male and half female . due to limitations of administration concentration and dosing volume , each test drug had the maximum dosage of 6 g / kg / day , and administered orally twice with an interval of 3 hours . the control group was administrated the same volume of vehicle . observation was conducted for 14 consecutive days after administration . results : during the observation period , in test drug groups , no animal died ; no significant difference between indexes such as action , mental state , haircolor and the like of animals in each test drug group and vehicle group was obtained by clinical observation . additionally , the gross anatomy results showed no visible lesions in organs of animals in each test drug group . therefore , these compounds were considered to be with a very low toxicity , and did not cause any death of the animal with a dosage of 4 - 6 g / kg / day , while no abnormal clinical manifestations were observed , the acute toxicity test results for each compound are shown in table 2 . | 2 |
referring now to the drawings , and in particular fig1 a storage system generally indicated at 10 extends from a floor or other contacting surface 14 to a ceiling or other contacting surface 16 . the storage system 10 holds two triangular framed bicycles 12 . referring now to fig2 and 3 , the storage system 10 has two longitudinal support members 18 which are composed of an upper section 20 and a lower section 22 . the upper section 20 and the lower section 22 of each longitudinal support member 18 have a plurality of drillings 24 therein . a plurality of cross support pieces 28 extend through the drillings 24 to connect the pair of longitudinal support members 18 . certain drillings 24 in the upper section 20 and the lower section 22 define overlap regions 26 on each longitudinal support member 18 . cross support pieces pass through the overlap regions 26 to connect the upper 20 and lower 22 sections together . the drillings 24 in the upper section 20 are spaced closer together than the drillings 24 in the lower section 22 . the overall length of the longitudinal support members 18 is adjusted by shifting the upper sections 20 of each support so that the respective overlap regions are redefined by a different correspondence between the drillings of the upper section and the lower section . depending upon the length to which each longitudinal support member is adjusted , two or three overlap regions may be defined . when adjusted to a shortened position , as in fig1 three cross - support members extend through overlap regions defined by corresponding drillings . similarly , in a lengthened position , as in fig2 and 3 , only two cross - support pieces extend through overlap regions . the number of drillings provided in each longitudinal support member , as well as the number of cross - support pieces and overlap regions , depend upon the overall maximum length desired for the storage system . as shown in fig2 and 3 , additional cross - support pieces may be added to the upper portion of the upper section 20 . these additional cross suppport pieces provided additional support and rigidity . a threaded foot member 32 engages a threaded nut 30 secured to the lower end of the lower section 22 of each longitudinal support member 18 . a rounded lap 34 is disposed at the end of the threaded foot member 32 opposite the threads . the rounded lap 34 of each foot member is in contact with a horizontal contact member 36 , the horizontal contact member 36 being in contact with a floor or other horizontal surface . a locator peg 38 is provided at the upper end of the upper section 20 of each of the longitudinal support members 18 . the locator pegs 38 of the longitudinal support members are secured to a horizontal contact member 40 , the horizontal contact member 40 being in contact with a ceiling . the horizontal contact member 40 yields transverse stability of the storage system 10 , thus preventing the storage system 10 from twisting or leaning . as described above , the overall length of each of the longitudinal supports 18 is adjusted by shifting the upper section 20 thereof so that the cross support pieces 28 are aligned with redefined overlap regions 26 . fine height adjustment of the storage system 10 is achieved with the threaded feet members 32 . the threaded feet 32 ensure that a tight fit between a floor and ceiling or any other two substantially horizontal surfaces is obtained by the horizontal contact members 36 and 40 . since the threaded feet members 32 may be adjusted independently of each other , a tight fit between a floor and ceiling may be obtained by the storage system 10 even where the two contacting surfaces between which the support system is disposed are not exactly parallel . the threaded feet members must have a range of adjustability corresponding to , at least , the distance between the drillings in the upper section 20 . in this manner , a continuous range of adjustability of the longitudinal support member is achieved . movement between the upper 20 and lower 22 sections achieves coarse length adjustment , wherein fine length adjustment is accomplished by independently adjusting the threaded feet members . a plurality of rod supports 42 are fixedly connected to the longitudinal support members 18 and extend in an acute angle therefrom . the rod supports are connected to the longitudinal support members 18 in an axial relation so that the corresponding rod supports 42 of each longitudinal support member are the same height from the bottom of the storage system 10 . the rod supports 42 advantageously support two triangular framed bicycles 12 as shown in fig1 . in an alternative storage system ( not shown in the figures ), a weighted box is permanently attached to the lower end of a pair of longitudinal support members . the weighted box engages a floor or other horizontal contact surface and maintains the storage system in an upright position . a horizontal contact member is not provided at the upper end of the longitudinal support members . this embodiment of the invention is particularly suited for use in areas where the vertical distance between a lower horizontal surface and an upper horizontal surface is relatively large , or in areas having suspended ceilings , wherein the storage system could not be practically adapted to come into contact with an upper horizontal surface . the weighted box may be provided with an operable lid to advantageously store miscellaneous athletic equipment such as riding helmets , tennis balls and other accessories . an additional equipment holder is illustrated in fig4 and 5 . the additional equipment holder comprises a rod support piece 44 with a plurality of rod supports 46 permanently attached thereto . blocks 48 having drillings therein are attached to the rod support piece 44 . the blocks 48 are attached to the rod support piece 44 in such a way that the additional equipment holder fits in between either the upper section 20 or the lower section 22 of the longitudinal support members 18 . a cross support piece 28 extends through the drilling in the blocks and attaches the equipment holder to the longitudinal support members 18 . the rod supports 46 are fixedly attached to the rod support piece 44 at an acute angle therefrom and in an axial relation . the additional equipment holder is particularly suitable for holding tennis rackets or the like . an additional support member is shown in fig6 . horizontal support pieces 50 are provided , each having a drilling in one end and a groove 52 in an opposite end thereof . the horizontal support pieces are adapted to fit between the upper sections 20 or the lower sections 22 of the longitudinal support members 18 . a cross support piece 28 passes through the drillings of the horizontal support pieces , thereby attaching the horizontal support pieces 50 to the longitudinal support members 18 . angular support pieces 54 are connected to the horizontal support pieces 50 between the drillings and the groove 52 by dowels or other suitable members . at the end of each angular support piece 54 opposite the attachment to the horizontal support piece 50 is cut a semicircular groove . the semicircular groove of each angular support piece 54 is adapted to releasably engage the cross support piece 28 which is immediately below the cross support piece to which the horizontal support pieces 50 are attached . the equipment holder of this embodiment is particularly suited for holding surf boards or the like . while preferred embodiments of the invention have been shown and described , it will be understood by persons skilled in this art that various changes and modifications may be made without departing from the spirit of the inventin which is defined by the following claims . | 1 |
the invention is illustrated and compared with prior art devices , which for purposes of illustration are examples with the same number of pins , i . e . 54 . a die and lead frame configuration of an early generation prior art leads - over - chip ( loc ) semiconductor device 10 is illustrated in drawing fig1 and 1a . as shown , the relatively large semiconductor die 12 is mounted on a substrate 14 with outlined edges 15 . a row 22 of electrically conductive bond pads 24 with spacing 54 is located on the active surface of the semiconductor die 12 and aligned generally along the longitudinal centerline 30 , parallel to the opposing long sides 26 of the die 12 , and extending generally between the opposing short sides 28 . two insulative layers 32 of kapton polymer or similar material are adhesively joined to the active surface 34 of die 12 , one on each side of the bond pad row 22 . a conductive lead frame 16 is shown with inner leads 18 adhesively joined to the insulative layers 32 . the lead frame 16 comprises inner leads 18 and outer leads 20 for connecting the bond pads 24 to an electrical apparatus , not shown . as shown , the outer leads 20 are directed outward from the device 10 on opposite sides 36 , i . e the long sides , of the lead frame 16 . thus , the single central row 22 of bond pads 24 is parallel to the two opposing sides 36 of outer lead ends 38 , 40 . as depicted in drawing fig1 the inner ends 50 of the inner leads 18 comprise wire bonding areas for attachment of conductive wires 48 leading to specific bond pads 24 on the semiconductor die 12 . following wire bonding , the semiconductor die 12 and attached lead frame 16 are typically encapsulated with a polymer or ceramic material to form a packaged device . the dam bars 52 between the outer leads 20 are cut away , and the outer leads are thus singulated , enabling electrical connection of the bond pads 24 to an electronic apparatus , not shown , with minimum lead inductance . the outer leads 20 may be left as straight projections , or bent to a j - shape , l - shape or other shape , depending upon the apparatus to which the device 10 is to be connected . a typical prior art lead frame 16 is shown in drawing fig1 a as having a recurring pattern 42 of inner leads 18 and outer leads or pins 20 for accommodating a plurality of single semiconductor dice having longitudinal centerline 30 . the leads 18 , 20 are temporarily interconnected to each other and to the supportive lead frame rails 46 by dam bars 52 . index holes 44 in the lead frame rails 46 permit sequential positioning of the lead frame 16 in a wire bonding machine for joining the semiconductor die to the leads 18 , 20 . the lead frame 16 has a width 58 typically ranging from less than about one inch ( 2 . 54 cm .) to several inches or more . in this early version of a loc device , the large semiconductor die 12 enabled the inner leads 18 to be of sufficient width 56 ( fig1 ) to avoid significant resistance and / or inductance effects , particularly at the design speeds typical of that period . the current need for much higher speeds with smaller dice has limited the usefulness of these early devices . an exemplary loc semiconductor device 10 of a later generation is shown in drawing fig2 following wire bonding . the semiconductor die 12 and lead frame 16 are configured the same as die 12 and lead frame 16 of drawing fig1 . for purposes of comparison , the overall lead frame width 58 may be assumed to be the same as the lead frame width of fig1 a . the semiconductor die 12 is similar to the die of fig1 with respect to its central bond pad location along the centerline 30 . however , the reduced size of the semiconductor die 12 provides about one third of the surface area of the earlier die 12 of drawing fig1 and the bond pad spacing or pitch 54 is considerably reduced , i . e . by nearly 50 percent . in drawing fig2 the semiconductor die 12 is shown adhesively attached to a substrate 14 and has two insulative layers 32 on its active surface 34 upon which inner leads 18 of the lead frame 16 are adhesively attached . the inner lead widths 56 are reduced by about 50 percent to accommodate the smaller semiconductor die 12 . in addition , many of the inner leads 18 have an increased length . thus , the smaller semiconductor die 12 as depicted in drawing fig2 has an increased susceptibility to resistance and inductance effects which severely limit usefulness of the device . in addition , manufacture of the device is made more difficult by the limited room for wire bonding the crowded bond pads to the narrow inner leads 18 . it should be noted that the devices 10 may be formed without a permanent substrate 14 . the semiconductor die 12 may be separately supported during attachment of the loc lead frame 16 , and the final encapsulated package outline may be represented by the edges 15 . turning now to drawing fig3 and 4 , a device 70 having a semiconductor die 72 / lead frame 76 configuration of the invention is depicted . the semiconductor die 72 is positioned transversely relative to the lead frame 76 , i . e . such that its long sides 86 are perpendicular to the opposing rows 96 of outer lead ends . the semiconductor die 72 is shown as having peripheral rows 82 a , 82 b of bond pads 84 along opposing long sides 86 , parallel to the longitudinal centerline 90 of the semiconductor die 72 . the rows 82 a , 82 b of bond pads 84 are shown as generally extending between the opposed short sides 88 of the semiconductor die 72 . the lead frame 76 is shown with three sets 100 , 102 , 104 of inner leads 78 and outer leads 80 . a first set 100 has inner leads 78 which are positioned off - die for wire - bonding with wires 98 to bond pads 84 of row 82 a . a second set 102 has inner leads 78 which are also positioned off - die for wire - bonding with wires 98 to bond pads 84 of row 82 b . a third set 104 has inner leads 78 which are adhesively joined to the active surface 94 of the die 72 with an intervening insulative layer 92 , i . e . as leads - over - chip ( loc ) leads . the third set 104 is positioned between the two rows 82 a , 82 b of bond pads 84 and includes leads wire - bonded to both rows . in the example shown , the minimum width 106 of the critical function non - loc inner leads 78 of lead set 100 in device 70 is about 30 - 60 percent greater than the minimum width 56 of the comparable leads in device 10 of drawing fig2 . the twelve loc leads 78 of lead set 104 are shown as having a width 110 nearly double that of width 56 of the bulk of the loc leads 18 of the prior art device of drawing fig2 . the sixteen non - loc leads 78 of lead set 102 are shown to have a width 108 which is about 30 to 100 percent greater than the width 56 of nearly all loc leads 18 of the device of drawing fig2 . the twenty eight non - loc leads 78 of lead set 100 are shown as having a width 106 roughly comparable to the width 56 of nearly all loc leads of the device of drawing fig2 . thus , in this example , critical leads subject to inductance have a greater width while non - critical leads are formed with a reduced width . the lead widths may be adjusted as needed for the particular use of the device . the invention presents , on average , inner leads having a shorter length of the minimum width portions than the prior art device of drawing fig2 . moreover , the range of lead lengths is much greater . thus , in the particular example of drawing fig3 twelve leads with very abbreviated lengths are positioned near the semiconductor die corners to carry critical signals subject to inductance . as shown in drawing fig4 the device 70 is formed by adhesively joining a semiconductor die 72 to a substrate 74 with an intervening insulative layer 112 . the hybrid lead frame 76 includes a set 102 of inner leads 78 which are attached by conductive wires 98 to a row 82 b of bond pads 84 ( fig3 ). another set 104 of inner leads 78 overlies the active surface 94 of semiconductor die 72 in a loc configuration and is adhesively joined to the die with an intervening insulative layer 92 . in this embodiment , the loc lead set 104 is thus at a different level than the non - loc lead sets 102 ( and 100 , not visible in fig4 ). the outer leads 80 terminate in lead ends 114 which may be straight or formed as j - leads or l - leads , etc ., as known in the art . the lead widths 108 and 110 are illustrated in the figure . following the wire bonding operation , the lead frame 76 and attached semiconductor die 72 are encapsulated and extraneous lead frame portions excised to form a device package . the device 70 may be formed without a permanent substrate 74 . the semiconductor die 72 may be separately supported during attachment of the loc lead frame 76 , and the final encapsulated package outline may be represented by the edges 75 . in this embodiment , the non - loc leads and loc leads may be in the same horizontal plane . as explained in the foregoing description , the invention provides wider and generally shorter inner leads 78 for small dice 72 . this obviates problems with inductance at high speed operation , making the design extremely useful for state - of - the - art applications . the loc leads overlying a large portion of the active surface also result in enhanced heat transfer , improving the overall operation of the device . in addition , the larger leads and greater pitch enable a much improved wire - bonding operation in terms of speed and integrity . while the invention has been described using a semiconductor die 72 with a pronounced difference in lengths of the long sides 86 and short sides 88 , the term “ long side ” includes sides having a length equal to or greater than that of the “ short side .” the semiconductor die 72 is shown as rectangular in surface shape , but may be of other shapes provided space is provided between two sets of bond pads for entry of a significant number of loc leads . it is apparent to those skilled in the art that there is provided herein according to the invention a transverse hybrid loc semiconductor package particularly useful with small dice and in enhancing the construction and operability of a semiconductor package . although the device has been described and illustrated with reference to a specific embodiment thereof , it is not intended that the invention be limited by the illustrated embodiment . those skilled in the art will recognize that various modifications can be made without departing from the spirit and intent of the invention . for example , the invention is not limited to devices having a specific number or type of leads , bond pads , or dice , nor to a device with a permanent substrate supporting the die . thus , it is intended that this invention encompass all such modifications and variations which fall within the scope of the appended claims . | 7 |
fig1 a , to which reference will now be made , shows an exploded view of an embodiment of a cap 1 in accordance with the invention . the cap 1 includes a main body 2 preferably made of a molded plastic material such as a polypropylene , a high density polyethylene , or polyethylene terephthalate . the body 2 has an internal wall 3 and an external wall 4 joined in the vicinity of one of their ends by an annular transverse wall 5 . the other end of the internal and external walls 3 , 4 is free , so that the internal and external walls 3 , 4 define between them an annular space 6 . in the embodiment illustrated , the internal wall 3 has a slightly lower axial height than the axial height of the external wall 4 . the internal wall 3 has three elastically deformable tabs 7 , orientated axially and radially interspaced at 120 °. each one of the tabs 7 has a free end 9 in the vicinity of the annular wall 5 and disposed on the inner surface of the free end is a catch 10 . the end 8 on the side opposite the free end 9 is joined to the internal wall 3 . the tab 7 is also delimited by two side edges 11 , 12 separated from the internal wall 3 by a thin slot extending substantially over the whole height of the tab 7 . opposite each one of the tabs 7 , the external wall 4 has a cutout 13 that substantially matches the surface of the tabs 7 , so as to allow the tabs 7 to be removed from a mold . the inner surface of the external wall 4 has an axial bead ( or rib ) 14 whose purpose will be described in greater detail below . the cap 1 illustrated in fig1 a also comprises a ring 15 with a thickness slightly smaller than the width of the annular space 6 so as to be capable of insertion in the annular space 6 . the maximum axial height of the ring 15 is substantially equal to the axial height of the internal wall 3 . the ring 15 is delimited by a substantially straight upper edge 16 along the top and a variable edge 17 along the bottom . the variable edge 17 is intended to be proximate the transverse annular wall 5 when the ring 15 is mounted in the annular space 6 . the variable edge 17 has three regularly interspaced portions that form ramps 18 . as becomes apparent in greater detail in fig2 a , the edge 17 is saw - tooth shaped . the external surface of the ring 15 has three axial grooves 19 , 20 , 21 , where one is intended , according to the angular position of the ring 15 in the annular space 6 , to come into engagement with the rib 14 of the external wall 4 of the body 2 , so as to immobilize the ring 15 angularly inside the annular space 6 when the adjustment of the elasticity of the tab has been effected . thus , during the mounting of the cap 1 , the ring 15 is inserted into the annular space 6 of the main body 2 , as shown in fig1 b and 2b . referring again to fig2 a , when the axial rib 14 of the body 2 is disposed in the groove 19 , the ring 15 faces virtually the whole of the surface of the tabs 7 ( position a ). the mean axial height of the free portion of the tabs 7 ( indicated by the distance between the black dot and the free end 9 of the tab 7 ) is substantially equal to zero . because of this , the elasticity of the tab 7 is low . with reference to fig4 which shows a packaging unit 30 with a catch engagement edge 34 adapted to accept the tabs 7 , the axial force to be exerted to cause the catches 10 to cross and enter the catch engagement edge 34 is high . when the axial rib 14 of the body 2 is disposed in the groove 20 , causing the ring 15 to rotate in the annular space 6 , the ring 15 is opposite approximately half the surface of the tab 7 ( position b ). the mean axial height of the free part of the tabs 7 corresponds substantially to half the height of the tab 7 . because of this , the elasticity of the tab 7 is medium . the axial force to be exerted for causing the catches 10 to cross the catch engagement edge 34 is medium . when the axial rib 14 of the body 2 is disposed in the groove 21 , the ring 15 is opposite approximately one third of the surface of the tab 7 ( position c ). the mean axial height of the free portion of the tabs 7 corresponds substantially to two thirds the height of the tab . because of this , the elasticity of the tab is high . the axial force to be exerted for the catch engagement edge 34 to be crossed by the catches 10 is low . means , not shown , may be provided for axially immobilizing the ring 15 in the annular space 6 . by way of example , there may be a groove and rib arrangement ( not shown ). alternatively , the ring 15 can be force - fitted in the annular space 6 . once the tightening has been adjusted , the cap 1 is covered with a metal or plastic outer shell 22 . the outer shell 22 may be mounted by tightening , bonding , catch engagement , welding , or other suitable means . in the embodiment shown in fig3 the bottom edge 17 of the ring 15 is parallel to the upper edge 16 , that is to say , substantially perpendicular to the axis x of the cap 1 . according to this variant , the mean axial height of the free tab portions , and hence the elasticity of the tabs 7 , is adjusted no longer by modifying the angular position of the ring 15 relative to the tabs 7 , but by modifying the axial position of the ring 15 , namely , by lowering the ring 15 to a greater or lesser extent into the annular space 6 . the axial hold of the ring 15 in a given position is ensured either by tightening or , as shown in fig3 by making , at two diametrically opposite points of the external wall 4 , slots 40 , 41 parallel to the axis x , wherein one of the edges of each slot 40 , 41 features a plurality of recesses 42 , 43 , 44 , 45 , 46 , 47 capable of receiving corresponding studs 48 , 49 , by catch engagement , also provided at two diametrically opposite points on the outer surface of the ring 15 . thus , during mounting , if the studs 48 , 49 are disposed in the lower recesses 42 , 45 , the ring 15 is opposite virtually the whole of the surface of the tabs 7 ( akin to position a in fig2 a ). the axial height of the free portion of the tabs 7 is substantially equal to zero . because of this , the elasticity of the tab is low . the axial force to be exerted to cause the catches 10 to cross the catch engagement edge 34 is high . in the same way , if the studs 48 , 49 are disposed in the intermediate recesses 43 , 46 , the ring 15 is opposite approximately half the surface of the tabs 7 ( akin to position b in fig2 a ). the mean axial height of the free portion of the tabs 7 corresponds substantially to half the height of the tab 7 . because of this , the elasticity of the tab 7 is medium . the axial force to be exerted to cause the catches 10 to cross the catch engagement edge 34 is medium . finally , if the studs 48 , 49 are disposed in the upper recesses 44 , 47 , the ring 15 is opposite approximately a third of the surface of the tabs 7 ( akin to position c in fig2 a ). the mean axial height of the free portion of the tabs 7 corresponds substantially to two thirds of the height of the tab 7 . because of this , the elasticity of the tab 7 is high . the axial force to be exerted to cause the catches 10 to cross the catch engagement edge 34 is low . fig4 illustrates a packaging unit 30 formed by a reservoir in the form of a can 31 . the reservoir is surmounted by a valve which is itself surmounted by a push button 32 . the valve is crimped by means of a crimping collar 33 . in the vicinity of the upper end of the straight portion of the can 31 , there is formed a catch engagement edge 34 intended to receive the catches 10 carried by the cap 1 , such as discussed with reference to the preceding figures . alternatively , the catch engagement edge may be constituted by a recess formed under the crimping collar 33 . in the preceding detailed description , reference has been made to preferred modes of embodiment of the invention . it is obvious that variants can be introduced into them without departing from the spirit of the invention , such as claimed below . | 1 |
referring now to fig1 , a slack adjuster 10 may have a body 12 fitting about a brake actuation shaft 14 ( s - cam shaft ) to rock the brake actuation shaft 14 as indicated arrows 16 . a lever portion 18 of the slack adjuster 10 may connect to a brake actuation arm ( not shown ) communicating with brake actuation hydraulics or air chambers . an internal mechanism of the slack adjuster 10 described in the above referenced patents may connect to a radially extending anchor tab 20 having an orifice 22 that receives a locator pin 24 , the latter typically attached to the vehicle body to maintain a stationary position . during operation of the slack adjuster 10 , the orifice 22 may become enlarged or damaged . the present invention permits the repair of the orifice 22 through the use of a first c - shaped plate 26 and second c - shaped plate 28 each having slots 30 extending upward part way through the plates 26 and 28 along a vertical ( as shown ) centerline through the plates 26 and 28 . the slots 30 allow the c - shaped plates 26 and 28 to be fit over the locator pin 24 on either side of the anchor tab 20 while the slack adjuster 10 is installed with the anchor tab 20 on the locator pin 24 . a set of machine screws 32 may then pass through bores 34 in a front most c - shaped plate 26 to have their threaded shanks 40 received by tapped holes 36 in the rearmost c - shaped plate 28 clamping the plates 26 and 28 with their broad faces against corresponding broad faces of the anchor tab 20 with the slots 30 engaging the locator pin 24 . the machine screws 32 , when tightened in tapped holes 36 , pull c - shaped plate 26 toward c - shaped plate 28 the former as captured under the heads of the machine screws 32 resting outside of the bores 34 . referring now to fig2 , the slot 30 has a width that corresponds ( i . e . is approximately the same width ) as the width of the anchor tab 20 and smaller than a width of the orifice 22 . in this way the c - shaped plates 26 and 28 absorb the circumferential force of the locator pin 24 against the slack adjuster 10 communicating that force over a broad area to the anchor tab 20 . referring now to fig2 and 3 , each c - shaped plate 26 and 28 may be substantially identical except for the bores 34 ( which are sized to pass thread threaded shanks 40 of the machine screws 32 ) and a tapped holes 36 ( which are sized to receive the threaded shanks 40 in engagement ). in this way , tooling costs may be reduced . each of the c - shaped plates 26 and 28 has an inner face 42 that may abut corresponding broad faces 44 of the anchor tab 20 when the c - shaped plates 26 and 28 are clamped by the machine screws 32 to engage the same . to assist in the retention and initial placement of the c - shaped plates 26 and 28 on the anchor tab 20 , the inner faces 42 may have locator elements extending inward from the inner faces 42 including lips 50 position about the slot 30 and sized to engage inner edges of the orifice 22 , and bosses 52 positioned between vertically opposed pairs of the bores 34 and tapped holes 36 , the bosses 52 abutting each other when the c - shaped plates 26 and 28 are clamped together about the anchor tab 20 . generally the bosses 52 extend inward from the inner faces 42 further than the lips 50 and thus hold the plates 26 and 28 in separation by an amount only slightly smaller than the thickness 56 of the anchor tab 20 . thus , for example , the thickness of the anchor tab 20 may be 0 . 125 inches and the separation established by the bosses 52 may be 0 . 116 inches . in this way , the bosses 52 limit warping of the plates 26 and 28 under pressure by the machine screws 32 . the bosses 52 also abut outer edges of anchor tab 20 , thus allowing tighter engagement and rigidity . the bosses 52 and lips 50 may be formed by a stamping metal plates 26 and 28 to deform them locally according to methods well known in the art . the c - shaped plates 26 and 28 not only reinforce the existing orifice 22 but increase the surface area or contact area with the locator pin 24 from approximately ⅛ ″ to ½ ″. it is specifically intended that the present invention not be limited to the embodiments and illustrations contained herein and the claims should be understood to include modified forms of those embodiments including portions of the embodiments and combinations of elements of different embodiments as come within the scope of the following claims . | 8 |
fig1 is a section through the vicinity of the working piston in a dashpot with , in the present case , a solid - walled cylinder . cylinder 1 is closed at the top and bottom and charged with shock absorption fluid . working piston 3 travels up and down inside cylinder 1 on one end of a piston rod 2 . the working piston 3 in the illustrated example is indirectly connected , and partitions cylinder 1 into two compression - decompression compartments 4 and 5 . piston rod 2 travels into and out of cylinder 1 through a sealed port at the bottom . the fluid can flow out of one compression - decompression compartment and into the other through sloping bores 6 . the ends of sloping bores 6 are capped top and bottom by resilient stacks 7 of cupsprings , each stack 7 accordingly decelerating the flow . cylinder 1 and piston rod 2 are attached by unillustrated means to the vehicle &# 39 ; s wheel at one end and to its chassis at the other . when vibrations of narrow amplitude occur between piston rod 2 and cylinder 1 , only weak shock - absorption forces are needed to unnecessarily prevent deterioration of riding comfort , whereas the performance curve of the particular cupspring - capped valves employed will not allow corresponding compensation without simultaneously decreasing the shock - absorption force in the range of higher starting amplitudes , which would have a deleterious effect on driving dynamics . a cylindrical pressure - compensation chamber 8 is accordingly accommodated inside floating piston 10 in an extension 9 of piston rod 2 hydraulically parallel with working piston 3 . pressure - compensation chamber 8 is partitioned into two half chambers 11 and 12 by a floating piston 10 . half chambers 11 and 12 communicate hydraulically through ports , preferably bores 13 and 14 , with compression - decompression compartments 4 and 5 . the body 15 of floating piston 10 rests radially by way of a low friction sleeve 16 against the cylindrical inner surface of pressure - compensation chamber 8 , allowing the piston to travel up and down axially inside the chamber . floating piston 10 is provided with an axial hollow 17 , in the form of a central bore in the present example . a bumper 18 in the form of a shaft with a head 19 , at each end in the illustrated embodiment , extends through hollow 17 , each head 19 is in the form of a shallow cone , its base covering the adjacent face of body 15 . the shaft and heads in the embodiment illustrated in fig1 are in one piece and are vulcanized or molded onto the faces of floating piston 10 . the bore 14 between the lower half chamber 12 of pressure compensation chamber 8 and the lower compression - decompression compartment 5 of cylinder 1 extends along the central axis of piston - rod extension 9 . as floating piston 10 comes into action accordingly , and strikes the base represented at the bottom of fig1 , bore 14 would ordinarily close too suddenly , inducing impacts in the overall system . this behavior is not desirable , and the bumper would be rapidly destroyed by the edge of the bore . the pressure - compensation end of the bore 14 is accordingly capped with an isolating disk 20 . the fluid can flow out of bore 14 and into the lower half chamber 12 of pressure - compensation chamber 8 by way of several ports 21 along the edge of isolating disk 20 . in the embodiment illustrated in fig1 as well , accordingly , floating piston 10 will be ensured of a soft start against the base , i . e . isolating disk 20 in the present case , of pressure compensation chamber 8 . this function is ensured at any event in relation to the upper base 22 by a radially outward bore 13 . isolating disk 20 will in one alternative not be necessary if the bore 14 through a bolt 23 that working piston 3 is mounted on is a blind bore and does not extend through the lower base . in this event , the bore will communicate with the lower half chamber 12 of floating piston 10 through several supplementary channels . since the openings into these channels are positioned radially outward in the lower base , bumper 18 will not be able to block them and will not be damaged by the edge of the openings . the piston - rod extension 9 that accommodates the pressure compensation chamber 8 in fig1 is welded . its lower end is provided with a bolt 23 whereon working piston 3 is mounted , secured by a nut 24 . fig2 illustrates an alternative version of floating piston 10 . the floating piston &# 39 ; s body 15 , low - friction sleeve 16 , and axial hollow 17 are similar to the ones illustrated in fig1 . bumper 18 on the other hand is provided with integral annular ridges 26 that rest against the faces of floating - piston body 15 . to prevent them from adhering to base 22 , each annular ridge 26 is provided with at least one radial intersection 27 . the shaft of bumper 18 does not completely occupy hollow 17 , simplifying installation in a housing with a central intake channel . each head of bumper 18 will be thoroughly embedded in a recess provided in each face of floating piston 10 . floating - piston body 15 will impact the base of the cylinder by way of annular ridges 26 , limiting the deformation of bumper 18 and accordingly prolonging its life . the floating piston 10 illustrated in fig3 is similar to the one illustrated in fig1 . in this embodiment , however , hollow 17 is very wide , and the head is provided with a spherical bulge 19 . this species of floating piston allows bumper 18 to be separate from floating - piston body 15 , and the two components can snap together , resulting in an interlocking attachment . floating piston 10 will accordingly be easier to adapt to various requirements . various embodiments of bumper 18 can be combined with various embodiments of floating - piston body 15 as desired . floating piston 10 can be cemented or vulcanized or fabricated by bicomponent plastic injection molding . the outer annular surface in this embodiment of floating piston 10 can also act as a terminating stop , limiting the extent of deformation of bumper 18 . in this event , however , the mass of the bumper will not , as in the embodiment illustrated in fig2 , be forced into the depressions in the faces of floating - piston body 15 but will mainly be deformed axially by the body as a whole . the piston - rod extension 9 depicted in fig4 differs from the one depicted in fig1 in that it is not welded but screwed together . the essential difference , however , is in the terminating shock absorption . instead of the mechanical shock absorption represented in fig1 through 3 , that is , at least one end features hydraulic shock absorption . one face of floating piston 10 is provided with a central arbor 28 that , as the piston approaches lower base 29 , enters the bore 14 through the center of the bolt 23 that working piston 3 is mounted on . the hydraulic flow through the bore will accordingly be impeded . arbor 28 can , as illustrated in fig4 , taper in toward its end . in this event , bore 14 will accordingly gradually close as floating piston 10 comes to rest against lower base 29 . the hollow for the pressure - compensation chamber 8 illustrated in fig5 is particularly economical to produce . the hollow itself is in the form of a blind bore in the end of piston rod 2 . the bore can be conventionally produced by machining . cold forging can also be employed . it is important for the wall 31 at the end 30 of piston rod 2 to be in one piece with the piston rod . hydraulic communication between the upper half chamber 11 of pressure - compensation chamber 8 and the upper compression decompression compartment 4 of cylinder 1 is provided , as in the aforesaid embodiments , by a transverse bore 13 . the bolt 23 that the working piston 3 is mounted on in a further development of this embodiment can be cold forged for example and , as illustrated in fig5 , provided with a connector flange 32 . in this event , the central bore 14 in bolt 23 is blind and does not extend through connector flange 32 . transverse bores 33 slope through the flange and open into the blind end of central bore 14 on the one hand and , on the other , into the edge of the lower base 29 of pressure - compensation chamber 8 . the floating piston 10 in the embodiment illustrated in fig5 is similar to the one illustrated in fig3 . how the piston rod and its extension illustrated in fig5 are assembled will now be specified . floating piston 10 is inserted into the blind bore that constitutes pressure - compensation chamber 8 . connector flange 32 , which is rimmed by a wider lip 34 , is inserted into the end of pressure - compensation chamber 8 . the wall 31 that demarcates pressure - compensation chamber 8 at the bottom of end 30 is at this stage already being forced powerfully against the circumference of connector flange 32 , and the resulting joint between the wall and the flange will be tight of itself . this joint , however , is further reinforced by a weld 35 , especially a laser or electron - beam weld . the tightness of the joint before welding will go far to prevent the inclusion of air during that procedure . as will be evident from fig5 , weld 35 is deeper than wall 31 is thick , enuring that the base of the joint will also melt . the overflow from weld 35 is subjected to lower welding power , preventing the pokeholes that would cause weakness , especially subject to bending stress . to improve the roundness tolerance between the two components , the joint is welded in at least two passes , with less power during the first . this approach minimizes heat default . generally the welding speed will be high to keep as much heat as possible out of the work and accordingly to prevent damage to the floating piston . the embodiment illustrated in fig6 is similar to the one illustrated in fig1 . the end 30 of piston rod 2 and the adjacent housing 36 for pressure - compensation chamber 8 are aligned by a centering pin 37 before being finally fastened in place by a weld 38 . this measure maintains the two components concentric . fig7 is a graph representing force over distance in a floating piston 10 like the one illustrated in fig3 . the piston &# 39 ; s gentler approach to upper base 22 or lower base 29 is obvious . before , however , the bumper can deform enough to generate a steep progressive increase 39 in force , one face 25 of floating piston 10 will have come to rest against its adjacent base 22 or 29 . the force - to - distance behavior of bumper 18 will accordingly be very sensitive to tolerances . fig8 is a larger - scale rendering illustrating how an isolating disk 20 can be secured in a piston - rod extension and to the bottom 40 adjacent to working - piston accommodating bolt 23 and capping lower half chamber 12 . the bottom 40 in this embodiment is provided with a recess with more or less the same diameter as isolating disk 20 . the recess also has a depth 41 that exceeds the thickness 42 of isolating disk 20 . isolating disk 20 is embedded in the recess and the projecting edge 43 crimped onto it with an overhead punch 44 , reliably securing the disk to the bottom 40 of piston - rod extension 9 . the disk does not need to be secured as effectively axially because the difference in pressure between lower half chamber 12 and central bore 14 is not very great . as will be evident from fig8 , punch 44 travels laterally along the inner surface of pressure - compensation chamber 8 . isolating disk 20 can be continuously or discontinuously crimped along its circumference . | 1 |
as discussed in the summary of the invention section , the present subject matter is particularly concerned with certain aspects of feedthrough filtering employable in association with implantable medical devices and related technology and methodology . more particularly , the present subject matter is concerned with an improved asymmetrical filter designed to provide differing forward and reverse energy flow characteristics , and is concerned with corresponding methodologies . selected combinations of aspects of the disclosed technology correspond to a plurality of different embodiments of the present subject matter . it should be noted that each of the exemplary embodiments presented and discussed herein should not insinuate limitations of the present subject matter . features or steps illustrated or described as part of one embodiment may be used in combination with aspects of another embodiment to yield yet further embodiments . in additional , certain features may be interchanged with similar devices or features not expressly mentioned which perform the same or similar functions . reference will now be made in detail to exemplary presently preferred embodiments involving the subject asymmetrical filter . referring now to the drawings , fig1 schematically illustrates a partial schematic diagram and equivalent circuit diagram of an exemplary asymmetrical filter generally 100 associated with a feedthrough filter 110 in accordance with the present technology . asymmetrical filter 100 may be formed , for example , by inserting a small ( that is , low ) value resistor 130 in series between heart lead 140 and a filter circuit 110 . filter circuit 110 is coupled between small value resistor 130 and an input terminal of a device schematically represented by equivalent circuit 150 . heart lead 140 may correspond to , or represent , one or more electrical leads coupled directly to a patient &# 39 ; s heart for application of , for example , a pacing signal from a pacemaker , as well as for detection of naturally occurring heart related electrical signals . in the present discussion , reference is made to the use of the asymmetrical filter in accordance with the present subject matter in association with a pacemaker . it should be well understood , however , by those of ordinary skill in the art , that the present subject matter is not so limited , as the disclosed subject matter may be applied in other environments as well . for example , asymmetrical filtering may provide certain advantages when used in association with other medical devices including , for example , heart monitors , defibrillators , and neurostimulators . asymmetrical filtering as disclosed herein may also be applied in other environments where both high and low level signals may be applied to a common signal transmission medium . non - exhaustive examples of such include data line transceivers and radio frequency ( rf ) transceivers . as illustrated in fig2 , it has been found that insertion of a small valued resistor 130 in series between heart lead 140 and filter circuit 110 provides differing filter responses with respect to whether a signal is being applied to the asymmetrical filter and passed to , for example , measuring circuitry or being sent out through the asymmetrical filter and applied to , for example , heart lead 140 . as illustrated in fig2 , a pair of response curves 210 , 220 illustrate , respectively , the overall input and output responses from an exemplary asymmetrical filter constructed in accordance with the present subject matter . from a review of such response curves 210 , 220 , it will be appreciated that the input response curve 210 experiences significantly higher insertion loss than the output response curve 220 , particularly at frequencies above about 2 mhz . such asymmetric response provides improved protection from emi applied to device 150 while at the same time limiting impact on any output signal from device 150 . in this exemplary embodiment of the present subject matter , the small value resistor 130 had a value of 15 ohms . also , in such exemplary embodiment , the resistance , capacitance , and inductance values within representative filter circuit 110 may be practiced as follows . variations may also be practiced , for specific embodiments in accordance with the present subject matter . the represented initial inductance value may be 0 . 1 nh , while the inductance represented on either side of node 112 may each be 0 . 083 nh , while the inductance going to ground ( beneath node 112 ) may be 0 . 028 nh . the exemplary resistance in such ground leg may be about 0 . 229 ohms , while the resistance on either side of node 112 may be 0 . 2 ohms . the exemplary capacitance in the ground leg below node 112 may be 3553 . 407 pf . with reference now to fig3 , representative response curves are illustrated for a further exemplary embodiment of an asymmetrical filter constructed in accordance with the present subject matter . in the embodiment represented by fig3 , the small value resistor 130 ( fig1 ) had a value of 20 ohms . in this exemplary embodiment , the forward measurement ( representative response curve 310 ) exhibits a significantly higher insertion loss than the reverse measurement ( representative response curve 320 ), particularly at frequencies above about 2 mhz , in a manner similar to that illustrated in fig2 . response curves such as shown in fig3 in conjunction with a small value resistor 130 value of 20 ohms are the results of measurements made in a gain phase mode , with a 1 m ohm input impedance , as will be well understood by those of ordinary skill in the art . with reference now to fig4 ( a ) and 4 ( b ), there are illustrated side elevation and top plan views of an exemplary embodiment of a present resistor mounting substrate generally 400 as may be used to support a plurality of small value resistors 440 , 442 , 444 for connection in series with input / output leads of an implantable medical device , for example , a pacemaker . in the illustrated exemplary embodiment , resistor mounting substrate 400 may correspond to a ceramic substrate 430 on which are mounted a number of thick film resistors 440 , 442 , 444 such that the resistors are coupled to respective connection pin pairs 410 / 420 ; 412 / 422 ; and 414 / 424 . such present exemplary resistor mounting substrate 400 may be coupled , in some instances , to known feedthrough capacitor structures , as will be more fully illustrated and discussed with reference to fig7 . with reference now to fig5 , 6 ( a ) and 6 ( b ), a further exemplary embodiment of a present resistor mounting substrate generally 600 in accordance with the present subject matter . first with reference to fig5 , there is illustrated a second exemplary embodiment of a resistor usable as the small value resistor 130 ( fig1 ) to produce an asymmetrical filtering response . in this exemplary embodiment , resistor 530 corresponds to a wound wire resistor and is configured such that respective end portions generally 532 and 534 of the wound wire are inserted into respective conductive termination tubes 542 and 544 . in an exemplary configuration , wire wound resistor 530 may correspond to about 42 turns of nichrome wire ( 3 mil coated resistor wire , non - magnetic ) wound around a 15 mil mandrel to produce a resistance value of about 15 ohms . with such exemplary values , the resulting coil would be expected to be about 120 mils long . conductive termination tubes 542 and 544 may correspond to platinum / rhodium ( pt / rh ) tubes , for example , with about 12 mil outside diameters and 4 mil inside diameters , while the end portion 534 of the wound wire may be gas tungsten arc ( tig ) welded onto end 546 so as to form a hermetic and positive joint . referring now to fig6 ( a ) and 6 ( b ), there are illustrated top plan and side cross section views of a second embodiment of a resistor mounting substrate generally 600 in accordance with the present subject matter . as may more readily be seen in fig6 ( a ), a plurality of wire wound resistors 610 , 612 , 614 , and 616 are mounted on support substrate 630 and coupled by way of lands 640 , 642 , away from fillets 650 , 652 . solderable wires 660 , 662 ( shown in fig6 ( b )) may be soldered to selected fillets as at solder locations 664 , 666 to provide connection to a feedthrough capacitor structure , such as will be described with reference to fig7 . support substrate 630 may correspond to a ceramic substrate , although it is to be strictly understood that any other suitable support structure material may be employed . with reference now to fig7 , an exemplary assembly generally 700 of an exemplary asymmetrical filter in accordance with the present subject matter will be described . as illustrated per this embodiment , a known feedthrough capacitor structure generally 710 is provided with leads 712 , 714 , 716 , and 718 that may , in fact , correspond in number to more or less than the number of leads presently illustrated . the specific structure of the representative feedthrough capacitor is not a limitation of the present subject matter , but as an example only , such structure may generally correspond to that illustrated in u . s . pat . nos . 5 , 999 , 398 and 6 , 459 , 935 b1 , referenced above . an exemplary asymmetry circuit board 720 constructed in accordance with the previously described exemplary configurations may be mounted to feedthrough capacitor 710 leads 716 , 718 such that the asymmetry circuit board 720 , by way of associated resistors ( like resistor arrangements or equivalent thereto per other present figures but not separately shown in fig7 ), may provide a mechanism for inserting a small value resistor in series with the feedthrough capacitor leads . low thermal conductivity leads 722 , 724 soldered to fillets on asymmetry circuit board 720 provide a connection pathway to a standard filter assembly 730 , for example , such as filter 110 schematically illustrated in fig1 . in the instance of the example of present fig7 , low thermal conductivity leads 722 and 724 may have a thermal conductivity rating of less than 8 british thermal unit it per hour foot degree fahrenheit ( i . e ., btu / hrftf ). such leads 722 and 724 may comprise , for example , inconel , titanium or zirconium alloys , to allow laser welding or other forms of heat treatment for welding without causing significant heat transfer to any circuitry , such as on exemplary circuit board 720 . by contrast , in such exemplary embodiment , the thermal conductivity of the leads 712 and 714 may be above 42 btu / hrftf , and such leads may comprise platinum or an equivalent material . further in conjunction with the present exemplary configurations of fig6 ( a ), 6 ( b ) and 7 , present exemplary circuit board 720 may have an outside diameter of about 130 mils while leads 722 and 724 are about 95 mils apart and leads 712 and 714 are about 66 leads apart , in the illustrated exemplary embodiments . also , it will be understood by those of ordinary skill in the art that the side elevation view of fig7 in fact only illustrates half of the leads that would be utilized in an actual embodiment . various dimensions , materials , and characteristics may be practiced in the foregoing exemplary embodiments , as understood by those of ordinary skill in the art , for use in particular embodiments , without departing from the spirit or scope of the present subject matter . in addition , all presently referenced dimensions , materials and characteristics are intended as exemplary values , within the broader aspects of the present subject matter , and not intended as limitations thereto . while the present subject matter has been described in detail with respect to specific embodiments thereof , it will be appreciated that those skilled in the art , upon attaining an understanding of the foregoing may readily adapt the present technology for alterations or additions to , variations of , and / or equivalents to such embodiments . accordingly , the scope of the present disclosure is by way of example rather than by way of limitation , and the subject disclosure does not preclude inclusion of such modifications , variations , and / or additions to the present subject matter as would be readily apparent to one of ordinary skill in the art . | 7 |
in a microwave oven shown in fig1 is a housing of the microwave oven , 2 a door pivotally mounted to the housing for enclosing an opening of a heating cavity as mentioned in more detail hereunder , 3 an operating panel mounted on an upper portion of the forward side of the housing 1 , 4 a sealing plate fitted into an inspection window formed at the center portion of the door 2 for inspection and punched with a number of perforations for facilitating inspection inside the heating cavity without opening the door , 5 a door handle , 6 a timer knob , 7 a starting switch for operation and 8 is one of the supports for the housing . now referring to fig2 which shows a sectional view of the microwave oven , the housing 1 having a bottom member 1 &# 39 ; and a top member 1 &# 34 ; defines the heating cavity 13 at the center portion thereof , and a forward wall 1 &# 34 ;&# 39 ; of the housing defines an opening of the heating cavity for providing an access thereto . the opening is closable by the door 2 which is pivotally mounted on a pin 15 , which in turn is supported by a pair of supporting levers 14 fixed to the housing 1 . the heating cavity is adapted to receive microwaves radiated from a microwave generator 11 located at the upper portion of the heating cavity . a rotatable stirrer 12 may be provided for agitating microwave energy radiated into the heating cavity from the microwave generator . in order to prevent the leakage of microwaves , the door 2 is formed with a sealing cavity 9 at a side wall 2c thereof opposing to the forward wall portion 1 &# 34 ;&# 39 ; adjacent to the edge of the opening of the heating cavity 13 which extends longitudinally around the opening . the sealing cavity 9 defined by spaced walls 2a and 2b is separated into two spaces 9a and 9b by a partition 10 which extends longitudinally in the cavity . as shown in fig3 the partition 10 is divided into a plurality of segments 17 each spaced about 1 - 2 mm from an adjacent one by a slit 18 formed transversely across the partition . the sealing cavity 9 is inherently different from a conventional choke cavity as mentioned in detail hereinafter . side walls enclosing the periphery of the door 2 partially oppose metal sashes 16 which may be extensions of the side walls of the housing 1 . as abovementioned , the present invention has features in that the wave seal in a microwave oven is accomplished by providing the door 2 or an opposite wall thereto with a sealing cavity 9 which is separated by a partition 10 consisting of a plurality of segments 17 spaced from one another by slits 18 . the sealing effect of the wave seal according to the present invention will now be described on the basis of data obtained from our experimental study . the data were all measured for microwave ovens a follows : ______________________________________microwave oven for domestic use______________________________________magnetron : radio frequency output 550w 2450mhzheating cavity : height 250 mm width 330 mm depth 250 mmdoor size : height 300 mm width 420 mm______________________________________ fig4 shows the amount of microwave leakage of a microwave oven having a conventional wave seal consisting of two cavities separated by a partition of a flat metal sheet and having dimensions as schematically indicated on the right - hand of fig4 in which , however , the cavities are formed into the wall defining the opening of the heating cavity . as the depth d of each cavity is changed , the amount of microwave leakage varies along the full line . if the wave seal consists of a single cavity , the amount of microwave leakage increases as shown by the dotted line . in the so - called choke seal , the sealing effect is attained by forming a cavity or cavities having dimensions corresponding to the point a or b in fig4 . by increasing the number of cavities , the sealing effect of the wave seal will be improved to some extent . however , the improvement is limited by the space available for the wave seal , because the sealing effect of each cavity greatly decreases if the width thereof is made too narrow by increasing the number of cavities . in practice , the allowable maximum width for the wave seal is about 5 cm in domestic microwave ovens . the present invention has succeeded in improvement of the sealing effect beyond the limitation of the conventional wave seal . fig5 shows the leakage of microwaves from a microwave oven having a sealing cavity according to the present invention . the sealing cavity , whose dimensions are shown on the right - hand side of fig5 in which , however , the heating cavity is formed into the wall defining the opening of the sealing cavity , is separated into two spaces by a metal partition which is divided into a plurality of segments each spaced about 1 - 2 mm by a slit from an adjacent one . the leakage of microwaves changes along the curve in fig5 with variation of the length l of each segment . the sealing cavity may be formed into the wall of the door substantially without any change of the sealing effect thereof . as will be clear from the curve , when the segment has a length less than about 20 mm , the leakage of microwaves reduces to less than one several tenth of that for the conventional sealing cavity having a plane partition . these values , however , will change somewhat if the wavelength of the microwaves changes . the reason for this effect is not yet solved theoretically and therefore , the optimum dimensions of the sealing cavity must be determined experimentally . however , as far as we have found from our experimental study , it is true that the leakage of microwaves is always reduced by means of the partition divided into a plurality of segments more efficiently than by a conventional plane partition . the partition according to the present invention may be formed integrally with the door , or made as a separate piece of a metal sheet and fixed by screws to the door . in any event , the wave seal having a structure as abovementioned will meet with the objects of the present invention . the wave seal according to the present invention is applicable to a microwave oven having a semi - spherical heating cavity as shown in fig6 and 7 which are a sectional view of the oven and a perspective view of a part of the wave seal , respectively . in the figures , 19 is the heating cavity , 20 a cover of the heating cavity , 21 a door arm fixed to the cover 20 , 22 a support fixed to a housing 23 . the door arm 21 is pivotally connected to the support 22 . the door 20 is provided with a handle for facilitating opening or closing thereof . 25 indicates a microwave generator , 26 a stirrer , 27 a base plate made of heatproof plastics , 28 a sealing cavity which has a partition 30 divided into a plurality of segments by slits 31 as shown in fig7 a metal bracket for connecting the sealing cavity 28 to the cover 20 , and 31 supports for the housing 23 . the cover is formed into a semi - spherical shape and , when closed , enclosing therein the semi - spherical heating cavity 19 . the cover is pivotally movable to serve as a door for providing an access to the heating cavity . hitherto , a wave seal of the metal to metal contact type or the choke seal type has been proposed for the wave seal of the semi - spherical microwave oven . the metal to metal contact wave seal , however , has problems in that the life of the sealing effect is shorter and in that not only forming of the spherical cover of a metal sheet , but also forming of the flat contact surface on the edge thereof is very difficult . for these problems , the metal to metal contact wave seal has not been practically utilized for the semi - spherical microwave oven . the choke seal has not such problems in manufacturing , but another problem in that the sealing effect thereof is not sufficient . the present invention has solved the problems in not only manufacturing but also in the sealing effect . fig8 shows another embodiment in which a wave seal according to the present invention is applied to a microwave oven combined with a conveyor system . in fig8 indicates a heating cavity , 33 a microwave generator , 34 a cover for sealing microwaves , 38 a conveyor belt for transporting objects into and from the heating cavity 32 , 35 and 35 &# 39 ; are entry and exit sealing cavities , and 36 , 36 &# 39 ; are entry and exit ports formed between the conveyor belt and the respective sealing cavities . each of the sealing cavities is separated into spaces by a plurality of partitions 37 . as shown in fig9 which is a sectional view along ix -- ix in fig8 each partition is divided into a plurality of segments 39 by slits 40 . hitherto , no wave seal except the choke seal has been applicable to the microwave oven equipped to a conveyor system . the choke seal , however , has a problem in that the sealing thereof is unsatisfactory . this problem also has been readily solved by the present invention . now various modifications of the sealing cavity will be explained with reference to fig1 to 29 . in fig1 which shows a part of the door for a heating cavity ( not shown ), 41 indicates a sealing plate having a number of perforations 46 for facilitating inspection of objects placed into the heating cavity while energizing the heating cavity , and 42 indicates a sealing cavity formed into the door . the sealing cavity 42 is separated into two spaces by a partition which is divided by slits 45 into a plurality of segments 43 . this embodiment has features in that the sealing plate 41 extends so as to partially cover an opening of the sealing cavity 42 . this structure is effective to reduce the depth of the door . fig1 shows the leakage of microwaves relative to the depth of the sealing cavity having two spaces whose openings are not at all covered as shown on the right - hand thereof . the two spaces of the sealing cavity may have different depths d 1 and d 2 . when the depth d 2 is fixed to 20 mm or 30 mm , the leakage of microwaves varies with variation of the depth d 1 along the dotted line or the full line , respectively . as seen from the curves , the sealing effect of the cavity is best when the depths d 1 and d 2 are both about 29 mm . however , if it is necessary to make the door thinner than 29 mm , these dimensions are not applicable . the structure as shown in fig1 provides the same sealing effect as that corresponding to the point b in fig1 where the depths d 1 and d 2 are 35 mm and 20 mm , respectively . in other words , the structure shown in fig1 has the same sealing effect as a sealing cavity having one space and a depth of 35 mm . by means of a sealing cavity having the above structure , it is possible to provide a door having a thinner depth with a sealing effect which is almost the same as that of a door having a thicker depth , although , strictly speaking , the difference between the points a and b in fig1 is avoidable . another embodiment is shown in fig1 , in which 46 indicates a door , 47 and 47 &# 39 ; a sealing cavity separated into two spaces by a partition which is divided by slits 48 into a plurality of segments 49 . the door 46 has a center portion 50 projected by a height f 1 from the remaining portion along the edge of the door 46 . the remaining portion , in which the sealing cavity is formed , has a surface h aligned with the upper ends of the sealing cavity and the partition . fig1 shows a microwave oven whose heating cavity is closed by a door having the structure as shown in fig1 . in fig1 , 51 is a sealing plate , 52 a heating cavity , 53 a microwave generator , 54 a stirrer , 55 a housing . this embodiment has features in that the surface h , having a width f 2 , when the door is closed faces the forward wall defining the opening of the heating cavity , the sum of f 1 and f 2 being relatively large . the gap created between the wall of the door and the wall of the housing provides a path for the leakage of microwaves and , therefore , the length of the gap affects the leakage of microwaves . it is desirable to make the length of the gap as long as possible . by forming the stepped portion , the length of the gap increases by f 2 , whereby the sealing effect is increased substantially without increasing the size of the door . fig1 shows the leakage of microwaves from a microwave oven having a sealing cavity as shown schematically on the right - hand thereof relative to the dimension f . the leakage of microwaves varies along the curve in fig1 when the dimension f is changed . as known from the curve , the sealing effect increases by increasing the dimension f . improvement of the sealing effect is readily attainable by this structure of the wave seal . fig1 shows the effect of the sash 16 as described with reference to fig2 . in fig2 the sealing cavity is formed into the wall of the door , while , the sealing cavity schematically shown on the right - hand of fig1 is formed into the wall defining the opening of the heating cavity . however , this difference has substantially no influence on the sealing effect of the sealing cavity . the metal sash 16 in fig2 provides an additional narrow gap along the side wall of the door , which has the same sealing effect as that attainable by the gap extending across the width h in fig1 . with increasing h , the leakage of microwaves varies along the full line a in fig1 when the sealing cavity has a metallic wall slit into a plurality of segments spaced from one another , while the leakage of microwaves varies along the dotted line b when the sealing cavity is separated by a plain partition . as seen from the dotted line b , in case of the sealing cavity having a conventional structure , the leakage of microwaves does not decrease continuously with increasing h , while , in case of the sealing cavity according to the present invention , the leakage of microwaves decreases continuously . if a door having a thickness of 20 - 30 mm is employed , and the metal sash 16 is formed to entirely cover the side wall , the narrow gap between the metal sash and the side wall of the door will provide the same sealing effect as that obtainable when the dimension h in fig1 is 20 - 30 mm . thus , the metal sash is very effective to improve the sealing effect of the sealing cavity . the sealing cavity of the present invention may be filled with a dielectric material or enclosed by a cover made of a dielectric material , as shown in fig1 and 17 , for increasing the effective size of the cavity or avoiding accumulation of dust in the cavity . in fig1 , 57 is a door , 62 a sealing cavity formed into the door and filled with filler 58 of a dielectric material , 59 a partition divided with segments by slits 60 , and 61 a sealing plate of the door . in fig1 , 63 is a door , 64 a sealing cavity formed into the door 63 and separated into two spaces by a partition 65 divided into segments by slits 66 , the spaces each being enclosed by a cover 68 of a dielectric material , and 67 a sealing plate of the door . as seen from fig1 and 17 , in any case , the dielectric material is not filled above the upper end of the partition . this structure is concerned with the relation between the depth of the cavity and the height of the partition , which will be explained with reference to fig1 . fig1 shows the leakage of microwaves of a microwave oven having a sealing cavity as shown on the right - hand thereof relative to the depth d of the sealing cavity as the height of the partition is changed . d &# 39 ; indicates the difference between the depth d and the height of the partition and a value of d &# 39 ; indicates that the depth d is smaller than the height of the partition . when the difference d &# 39 ; is changed from - 2 mm to 0 , 2 , and 4 mm successively , the leakage of microwaves varies along the curves marked &# 34 ; d &# 39 ;=- 2 &# 34 ;, &# 34 ; d &# 39 ;= 0 &# 34 ;, &# 34 ; d &# 39 ;= 2 &# 34 ; and &# 34 ; d &# 39 ;= 4 &# 34 ;, respectively . it will be clear that the smaller value of the difference d &# 39 ;, the better the sealing effect . it is well - known that the wavelength of microwaves propagated through a dielectric material having a dielectric constant of ε is reduced to ## equ1 ## times that propagated through air whose dielectric constant is 1 . therefore , if the dielectric material is filled above the upper end of the partition , the effective value of the dimension d &# 39 ; will increase which in turn decrease the sealing effect of the cavity . the above structure is useful for avoiding such disadvantage . however , it is usually unnecessary to utilize such measure for providing a desired sealing effect . fig1 shows another embodiment for further improvement of the sealing effect . in fig1 , 69 is a sealing plate of the door , 70 a sealing cavity , 71 segments forming a partition for separating the sealing cavity of the sealing plate 69 extended above the sealing cavity , 74 a wave absorber made of ferrite or ferrite rubber , 75 a sealing element made of a metallic material for partially screening the opening of the sealing cavity . this embodiment has features in that the metallic sealing element 75 is fixed to the wall defining the sealing cavity thereby increasing the sealing effect of the sealing cavity , and also providing means for mounting the wave absorber 74 . the sealing element 75 having a width h provides substantially the same effect as that attainable by the extended portion of the sealing plate 41 , as shown in fig1 , covering partially the opening of the sealing cavity , or by increasing the dimension h in fig1 . the wave absorber 74 may be filled into the sealing cavity for increasing the sealing effect . in any event , it is possible to reduce the depth of the door without decreasing the sealing effect . for example , it is possible to employ a door having a depth of 20 mm with substantially the same sealing effect as that of a door having a depth of 30 mm . in fig2 , which shows another embodiment of the sealing cavity , 76 is a door , 77 a sealing cavity , 78 a canted partition divided into segments 78 &# 39 ; by slits 79 , and 80 a sealing plate . this structure has features in that , the partition is canted referring to the wall defining the bottom of the sealing cavity thereby making the height of the partition thereacross larger than the depth of the sealing cavity . for example , assuming that the depth of the sealing cavity is 25 mm , the height of the partition is 30 mm and the partition is fixed to the wall defining the bottom of the sealing cavity with an angle of sin - 1 25 / 30 therebetween , it has been found that the leakage of microwaves is reduced to several tenth of that attainable by a sealing cavity separated by a partition having a height of 25 mm and fixed perpendicularly to the bottom wall . various modifications of the partition are shown in fig2 to 23 . in fig2 , 81 is a door , 82 a sealing cavity which is separated by a partition divided by slits 84 into a plurality of segments 83 each having an end portion bent at a right angle , and 85 a sealing plate . in fig2 , 86 is a door , 87 a sealing cavity separated by a partition divided by slits 89 into a plurality of v - shaped segments 88 and 90 a sealing plate . in fig2 , 91 is a door , 92 a sealing cavity separated by a partition divided by slits 94 into a plurality of v - shaped segments 93 and 95 a sealing plate . in any modification , the feature thereof resides in that each segment of the partition is bent along a line or lines at an intermediate portion between the upper and lower ends . one - fourth of the wavelength λ of the microwaves is a standard for the total height of each segment , i . e . h 1 + h 2 as shown in the figures . but practically , it is unnecessary to meet the height h 1 + h 2 strictly with the value λ / 4 ; however , it is preferable to determine the optimum value experimentally . the aforementioned sealing cavities are common in that the sealing cavity is separated by a partition divided by slits into a plurality of spaced segments . however , the present invention is not limited to the above structure , but based on the technical concept that microwaves are sealed by a sealing cavity separated by a partition having a plurality of metal segments aligned in a row , and each segment functions to electromagnetically seal microwaves in co - operation with an adjacent segment . embodiments based on the above concept are shown in fig2 to 29 . in fig2 and 25 , the sealing cavity 96 is provided with a partition integrally formed with a dielectric filler 100 and consisting of a plurality of metal segments 98 , 99 indicating a sealing plate . in fig2 and 27 , the sealing cavity 101 is provided with a partition 102 formed integrally with a dielectric filler 105 and consisting of a plurality of metal segments 103 . 104 indicates a sealing plate of the door . in fig2 and 29 , the sealing cavity 106 is provided with a partition 107 formed integrally with a dielectric filler 110 and consisting of a metal wire 108 having a shape like a rectangular wave form . 109 is a sealing plate . | 7 |
the invention will be specifically described hereinafter in the context of its application to video cable networks where carrier frequency allocation is subject to two kinds of standards . under a first kind of standard ( in force in europe ) the frequency band including the allocatable carrier frequencies is divided into a lower band in the vhf band and an upper band in the uhf band . the frequencies that can be allocated in the uhf band run from 471 . 25 mhz through 839 . 25 mhz in steps of 8 mhz . the frequencies that can be allocated in the vhf band run in france from 120 mhz through 288 mhz in steps of 8 mhz and in countries other than france from 303 . 25 mhz through 455 . 25 mhz in steps of 8 mhz . under a second kind of standard ( in force in north america and japan ) the frequency band including the allocatable carrier frequencies is in the vhf band and the allocatable frequencies run from 55 . 25 mhz through 643 . 25 mhz in steps of 6 mhz . the first kind of standard covers b , g , h and i standard systems in european countries other than france and the l standard system in france . fig1 is a diagrammatic representation of a video cable network to which the present invention may be applied . a network head end 11 which can receive television programs from a satellite ( a ), over a microwave link ( b ) or via a digital highway ( c ) and which demodulates the signals received in the base band , modulation equipment 12 providing modulated signals by modulating various carriers using the various base band signals obtained , and electrical - to - optical conversion equipment 13 for converting electrical signals obtained at the output of the modulation equipment 12 into optical signals and amplifying the resulting optical signals by means of one or more doped fiber optical amplifiers . the optical signals obtained at the output of the operating center 1 are routed over transport optical links 2 ( only one of which is shown in fig1 ) to distribution centers 3 ( only one of which is shown in fig1 ). the distribution center 3 distributes the optical signals received from the operating center to n user equipments 4 over n distribution optical links 4 &# 39 ; forming a distribution network . the distribution center also amplifies the optical signals received and sent . the modulation equipment 12 shown in fig2 essentially comprises a battery of modulators ( the number of modulators is equal to the maximum number of television channels that can be transmitted over the network ) the outputs of which are connected to a common coaxial line via coupling means . this equipment comprises : a first battery of up to 40 modulators dedicated to tv programs and organized into five sets 121 each of eight modulators 122 the outputs of which are coupled to a common coaxial line through a coupler 123 , the outputs of four sets 121 being coupled to a common coaxial line by a coupler 124 , and a second battery of up to 30 modulators dedicated to high fidelity programs and comprising a set of 30 modulators 125 whose outputs are coupled to a common coaxial line by a coupler 126 . the output of the coupler 126 and the output of that of the five sets 121 which is not connected to the coupler 124 are coupled to a common coaxial line by a coupler 127 via respective attenuators 128 and 129 . the outputs of the couplers 124 and 127 are coupled to a common coaxial line by a coupler 130 whose output constitutes the output of the modulation equipment . the basic idea for a process of allocating carrier frequencies without regard to second order composite beat frequencies for television channels with a nominal bandwidth of n mhz is to allocate to those channels carrier frequencies which are odd multiples of n mhz . any two carrier frequencies defined in this way produce second order composite distortion at a frequency 2q × n mhz ( where q is an integer , i . e . at an even multiple of n mhz ) offset by + n mhz relative to the carrier frequency ( 2q - 1 )× n mhz and by - n mhz relative to the carrier frequency ( 2q + 1 )× n mhz . the second order composite distortion therefore has no effect on these two n mhz channels . under the m standard the width &# 34 ; n &# 34 ; is 6 mhz and so in theory the carrier frequencies must be odd multiples of 6 mhz . under the b , g , h , i and l standards the nominal width &# 34 ; n &# 34 ; is 8 mhz in the uhf band and 8 or 12 mhz in the vhf band , depending on the type of television signal concerned . thus in theory the carrier frequencies must be odd multiples of 8 mhz or 12 mhz . carrier frequencies which are odd multiples of 8 mhz are advantageously chosen to eliminate the effect of second order composite distortion in the uhf band and to obtain the largest possible number of stable channels in the vhf band ( it is possible to choose carrier frequencies that are odd multiples of 12 mhz but this yields a smaller number of usable channels and does not conform to the channel spacing of 8 mhz in the uhf band in force in europe ). thus the 12 mhz uhf channels ( for d2mac type signals in the 16 format ) affected by second order composite distortion are offset + 8 mhz from the carrier frequency . however , this is compensated by the fact that in practise the protection required at the subscriber outlet of a video network under applicable standards for d2mac 16 / 9 type signals is reduced as compared with the worst case scenario in which the second order composite distortion is offset 0 mhz from the carrier frequency ( in practise 23 db in the former case as compared with 56 db in the latter case , a reduction of 33 db ). in reality , to conform to the standards governing the allocation of carrier frequencies , as summarized above , frequencies must be allocated that are defined by the following equations : the effect of this is merely to shift by - 0 . 75 mhz ( respectively + 1 . 25 mhz ) relative to 8 mhz ( respectively 6 mhz ) the offset between the second order composite beat frequencies of type f1 + f2 and the channel picture carriers and by + 0 . 75 mhz ( respectively - 1 . 25 mhz ) relative to 8 mhz ( respectively 6 mhz ) the offset between second order composite beat frequencies of type f1 - f2 and the channel picture carriers . in m standard systems a channel for an ntsc type television signal occupies a band only from - 0 . 75 mhz to + 4 . 2 mhz relative to the picture carrier and the sound carrier is 4 . 5 mhz away from the picture carrier and is frequency modulated with a frequency excursion of ± 0 . 025 mhz . accordingly , second order composite distortion + 6 - 1 . 25 =+ 4 . 75 mhz from the picture carrier of channel ( 2q - 1 ) or - 6 -- 1 . 25 =- 7 . 25 mhz from the picture carrier of channel ( 2q + 1 ) has no effect on either channel . second order composite distortion + 6 + 1 . 25 =+ 7 . 25 mhz from the picture carrier of channel ( 2q - 1 ) or - 6 + 1 . 25 =- 4 . 75 mhz from the picture carrier of channel ( 2q + 1 ) has no effect on either channel . equation ( 2 ) above thus defines a frequency plan suitable for m standard systems . a d2mac 4 / 3 type television signal occupies a band from only - 1 . 25 mhz to + 6 . 5 mhz relative to the picture carrier and a b , g , h or i standard channel ( worst case scenario for the i standard ) occupies a band of only - 1 . 25 mhz to + 5 . 5 mhz relative to the picture carrier and the sound carrier is + 6 mhz away from the picture carrier ( worst case scenario for the i standard ) and is frequency modulated with a frequency excursion of ± 0 . 050 mhz . accordingly , second order composite distortion + 8 - 0 . 75 =+ 7 . 25 mhz from the picture carrier of channel ( 2q - 1 ) or - 8 - 0 . 75 =- 8 . 75 mhz from the picture carrier of channel ( 2q + 1 ) has no effect on either channel . second order composite distortion + 8 + 0 . 75 =+ 8 . 75 mhz from the picture carrier of channel ( 2q - 1 ) or - 8 + 0 . 75 =- 7 . 25 mhz from the picture carrier of channel ( 2q + 1 ) has no effect on either channel . only second order composite distortion + 7 . 25 mhz or + 8 . 75 mhz from the carrier frequency on 12 mhz vhf channels for d2mac 16 / 9 type signals requires consideration . however , the protection required at the subscriber outlet under applicable standards for d2mac 16 / 9 channels + 7 . 25 mhz from the carrier ( respectively + 8 . 75 mhz from the carrier ) is 27 db ( respectively 13 db ), a reduction of 29 db ( respectively 43 db ) relative to the worst case scenario ( 56 db ) in which the composite distortion occurs at an offset of 0 mhz from the carrier frequency . equation ( 1 ) above thus defines a frequency plan suitable for b , g , h and i standard systems . in l standard systems the protection required at the subscriber outlet under applicable standards 7 . 25 mhz from the carrier frequency is 34 db . there is therefore in this case an additional constraint as to second order composite beat frequencies for 8 mhz channels . consideration of the origin of second order composite distortion occurring in the uhf channels + 7 . 25 mhz from the carrier frequency shows that it is due entirely to combinations of the type f1 vhf + f2 uhf or f1 vhf + f2 vhf . to circumvent this additional constraint the principle described above for b , g , h and i standard systems is adopted for frequency allocation in the uhf band , namely : and the frequencies allocated in the vhf band are offset by + 0 . 75 mhz to obtain the generic formula : the f1 vhf + f2 uhf type beat frequencies are equal to : with q = m + p + 1 . they are offset by + 8 mhz relative to the uhf carrier frequency ( 2q - 1 )× 8 - 0 . 75 mhz and by - 8 mhz relative to the uhf carrier frequency ( 2q + 1 )× 8 - 0 . 75 mhz . they have no effect on these two 8 mhz channels even if they are secam or d2mac 4 / 3 type uhf channels . where q = m + p + 1 . they are offset by + 8 . 75 mhz relative to the uhf carrier frequency ( 2q + 1 )× n - 0 . 75 mhz and they have no effect on these two 8 mhz channels even if they are secam or d2mac 4 / 3 type channels . the f1 uhf - f2 vhf type beat frequencies are equal to : with q = m + p . they are offset by + 8 mhz relative to the uhf carrier frequency ( 2q - 1 )× 8 - 0 . 75 mhz and by - 8 mhz relative to the uhf carrier frequency ( 2q + 1 )× 8 - 0 . 75 mhz and have no effect on these two 8 mhz channels even if they are secam or d2mac 4 / 3 type channels . the f1 uhf ± f2 uhf combinations do not cause second order composite distortion in the uhf band used . by using for allocation of carrier frequencies in the vhf band the equation f ( mhz )=( 2p + 1 )× 8 mhz the constraint on second order composite distortion for 8 mhz uhf channels to the l standard is totally eliminated . consideration of second order distortion occurring in the vhf band shows that only f1 vhf ± f2 vhf , f1 uhf - f2 uhf and f1 uhf - f2 vhf distortion require consideration . the f1 vhf ± f2 vhf type beat frequencies are equal to : where q = m + p + 1 or m - p . they are offset by + 8 mhz relative to the vhf carrier frequency ( 2q - 1 )× 8 mhz and by - 8 mhz relative to the vhf carrier frequency ( 2q + 1 )× 8 mhz and they have no effect on these two channels in the case of secam or d2mac 4 / 3 type channels . consideration is required only as to the effect of second order composite distortion + 8 mhz from the carrier frequency on 12 mhz vhf channels for d2mac 16 / 9 signals . however , the protection required at the subscriber outlet for d2mac 16 / 9 channels + 8 mhz from the carrier is 23 db which represents a reduction of 33 db relative to the worst case scenario ( 56 db ) in which the second order composite distortion occurs at an offset of 0 mhz relative to the carrier frequency . the f1 uhf - f2 uhf type beat frequencies are equal to : where q = m - p . they are offset by + 8 mhz relative to the vhf carrier frequency ( 2q - 1 )× 8 mhz and by - 8 mhz relative to the vhf carrier frequency ( 2q + 1 )× 8 mhz and they have no effect on these two channels in the case of secam or d2mac 4 / 3 type channels . consideration is required only as to the effect of second order composite distortion + 8 mhz from the carrier frequency on 12 mhz d2mac 16 / 9 vhf channels . however , the protection required at the subscriber outlet for d2mac 16 / 9 channels + 8 mhz from the carrier is 23 db which represents a reduction of 33 db relative to the worst case scenario ( 56 db ) in which the second order composite distortion occurs at an offset of 0 mhz relative to the carrier frequency . the f1 uhf - f2 vhf type beat frequencies are equal to : where q = m - p . they are offset by + 7 . 25 mhz relative to the vhf carrier frequency ( 2q - 1 )× 8 mhz and by - 8 . 75 mhz relative to the vhf carrier frequency ( 2q + 1 )× 8 mhz and they have no effect on these two channels in the case of d2mac 4 / 3 type channels . consideration is required only as to the effect of second order composite distortion + 7 . 25 mhz from the carrier frequency on 8 mhz or 12 mhz vhf channels for secam or d2mac 16 / 9 type signals . however , the protection required at the subscriber outlet under applicable standards for secam ( respectively d2mac 16 / 9 ) channels + 7 . 25 mhz from the carrier is 34 db ( respectively 27 db ) which represents a reduction of 22 db ( respectively 29 db ) relative to the worst case scenario ( 56 db ) in which the second order composite distortion occurs at an offset of 0 . 5 to 1 mhz ( respectively 0 mhz ) relative to the carrier frequency . equations ( 3 ) and ( 4 ) above therefore define a frequency plan suitable for l standard systems . as shown in fig3 by way of example the following could be selected for l standard systems : 24 uhf carrier frequencies from 471 . 25 mhz to 839 . 25 mhz in 16 mhz steps , 24 vhf carrier frequencies in the 47 - 470 mhz band , avoiding the fm band , for example the following frequencies : as shown in fig4 by way of example the following could be selected for b , g , h , i standard systems : 24 uhf carrier frequencies from 471 . 25 mhz to 839 . 25 mhz in 16 mhz steps , 24 vhf carrier frequencies chosen in the 47 - 470 mhz band , avoiding the fm band , for example the following frequencies : as shown in fig5 by way of example 48 carrier frequencies could be chosen for m standard systems , as follows : 55 . 25 mhz , 67 . 25 mhz , 79 . 25 mhz , 115 . 25 mhz to 643 . 25 mhz in 12 mhz steps . the resulting frequency plan for an m standard system avoids all constraints associated with second order composite distortion . there remain in the resulting frequency plans for b , g , h , i and l standard systems only constraints in respect of the vhf channels . it can be shown that for a dispersive transmission distance of up to 30 km these constraints relating to second order composite distortion for vhf channels in these frequency plans are always satisfied for lasers where the &# 34 ; chirp &# 34 ; ( wavelength fluctuation as a function of applied modulation ) is less than 1200 mhz / mw coupled into the fiber . the contribution of this laser &# 34 ; chirp &# 34 ; ( or fluctuation ) and the fiber dispersion in terms of second order composite distortion may be calculated from the following formula : n is the number of f1 ± f2 type beat frequencies causing the second order composite distortion at the frequency f , m is the modulation index of the laser for each tv channel , po is the laser power in mw coupled into the fiber , c is the fluctuation in mhz / mw in the laser wavelength as a function of the modulation applied at the modulating frequency f coupled into the fiber , f is the frequency in mhz of the second order composite distortion , d is the chromatic dispersion in ps /( nm . km ) of the fiber at the wavelength in question , l is the transmission distance in km , λ is the wavelength in nm and c is the speed of light in nm . it can be shown that the worst case scenarios for these constraints associated with second order composite distortion for vhf channels are : for the frequency plan defined above for the b , g , h , i systems f = 464 mhz where the n . f 2 product is maximum with n = 19 for f1 - f2 beat frequencies and where the protection required is 13 db ; f = 462 . 5 mhz where the product n . f 2 is maximum with n = 10 . 25 for the f1 + f2 beat frequencies and where the protection required is 27 db ; for the frequency plan defined above for the l system , f = 463 . 25 mhz where the product n . f 2 is maximum with n = 10 and where the protection required is 34 db . for a maximum modulation index m of 6 . 5 % for 40 to 45 channels directly modulating a distributed feedback ( dfb ) laser , with n = 19 , po = p o maximum = 3 mw , λ = 1 550 nm , d = 19 ps / nm . km , c = 3 . 10 17 nm / s , c . l = 36 500 km . mhz / mw , the worst case scenario gives a - 38 db laser &# 34 ; chirp &# 34 ; ( wavelength fluctuation )+ fiber dispersion contribution to second order composite distortion . the protection required at the subscriber outlet being 34 db for this worst case scenario , it is seen that if all other second order non - linearities of the system ( optical sender , amplifiers , optical receiver ) do not contribute more than 45 db ( for example ) of second order composite distortion there will remain at least 37 db of protection at the user outlet . a second order composite distortion contribution of 45 db is well below what can be achieved in the present state of the art . the only applicable condition therefore concerns the product of laser &# 34 ; chirp &# 34 ; ( wavelength fluctuation ) and transmission distance . for example , for lasers having a fluctuation of less than 1 200 mhz / mw coupled into the fiber transmission distances up to 30 km can be achieved . although the foregoing description has been given by way of specific example with reference to video cable networks in which said modulated signals are television signals transmitted by vestigial sideband amplitude modulation , in respect of which carrier frequency allocation is subject to standards , it will be understood that the invention is not limited to an application of this kind . | 7 |
a shatter proof enclosure and mount for motion a capture element will now be described . in the following exemplary description numerous specific details are set forth in order to provide a more thorough understanding of the ideas described throughout this specification . it will be apparent , however , to an artisan of ordinary skill that embodiments of ideas described herein may be practiced without incorporating all aspects of the specific details described herein . in other instances , specific aspects well known to those of ordinary skill in the art have not been described in detail so as not to obscure the disclosure . readers should note that although examples of the innovative concepts are set forth throughout this disclosure , the claims , and the full scope of any equivalents , are what define the invention . one skilled in the art will recognize that embodiments of the invention may be utilized in any equipment capable of coupling with the apparatus . this includes any piece of sporting , exercise or medical rehabilitation equipment , for example a baseball bat , hockey stick , lacrosse stick , helmet , skateboard , ski , snowboard , surfboard , golf club , tennis racquet , weight training bar , or any other equipment capable of movement . the apparatus may be located internal or external to the piece of sporting equipment and may show a visual marker for use in visually obtaining motion in combination with electronically detected motion obtained with the motion capture sensor . for example , the outer portion of the enclosure may display a visual marker on the outer portion while the inner portion of the enclosure may be located on or within a shaft or grip in the handle portion of the equipment for example . fig1 illustrates an embodiment of the invention 100 alone in perspective view and as mounted in a shaft of a piece of movement equipment , for example a baseball bat , hockey stick , lacrosse stick , golf club , tennis racquet or any piece of equipment having a handle near shaft 110 as shown in cutaway view . embodiments enable a mount for a new piece of equipment or that can be retrofitted in an existing piece of equipment . the mount may be located in the handle portion of the shaft , or for example within a grip that is to be attached to the shaft , and is configured to hold electronics and / or a visual marker . fig2 illustrates an embodiment of the invention broken into an exploded view of the main components along with the shaft handle and blow up views of the major components in transparent shading . one or more embodiments of the mount include enclosure or shaft enclosure 220 and expander 210 that may be coupled with an attachment mechanism , for example a screw aligned along an axis parallel to the axis of the shaft . the shaft enclosure and expander are situated within the handle , i . e ., shaft 110 . in one or more embodiments , the screw is then rotated to move the shaft enclosure towards the expander , which thus forces legs of the shaft enclosure in a direction orthogonal to the axis of the shaft . the force of the shaft enclosure against the inner wall of the shaft thus couples the shaft enclosure to the shaft based on the coefficient of static friction therebetween . any other mechanism of coupling the shaft enclosure to a shaft in a non - permanent manner is in keeping with the spirit of the invention . after the shaft enclosure and expander are brought close enough together via the screw to securely couple the mount to the shaft , then either the electronics package or a weight element that may for example weigh the same as the electronics , is coupled with the shaft enclosure . cap 230 is coupled with the shaft enclosure in either case , which provides a cover for the weight element or electronics package and which may include a visual marker and / or logo on the cap . one or more embodiments of the electronics package are removable to comply with any sporting rules that do not allow instrumented sporting equipment for example . any other method or structure that enables a non - permanent mount of the apparatus that requires no modification of the shaft is in keeping with the spirit of the invention . optionally , an identification element or id sticker , for example an rfid tag may be mounted within the enclosure , cap , or any other portion of the apparatus , for equipment identification , or shot count functionality . the identification element may also be implemented integral to , or coupled with the pcb in any manner as desired . if the electronics package is installed , then generally a positive battery contact , printed circuit board or pcb , an insulator or insulative spacer , with negative electrical contact and battery may be installed between the shaft enclosure and cap . optionally , a wireless antenna and / or gps antenna may be coupled with the cap or alternatively may be implemented integral to the pcb as desired . also see fig3 a - c , 4 , 4 a - d and 9 for more detailed views . fig3 a illustrates a detailed cutaway view of the main components of an embodiment of the invention , specifically expander 210 , shaft enclosure 220 and cap 230 . fig3 b illustrates a detailed cutaway view showing negative battery contact 450 , also shown in full in exploded view in fig4 . fig3 c illustrates a detailed cutaway view showing positive battery contact 420 , also shown in full in exploded view in fig4 . optional o - ring indentation 310 on shaft enclosure 220 provides a potential well for o - ring 320 to be located . different size o - rings may be utilized to provide a secure fit on the end of shaft enclosure 220 on the end near cap 230 . fig4 illustrates an exploded view “ a ” of the main mount components , namely expander 210 , shaft enclosure 220 along with screw 410 , positive battery contact 420 and battery 430 , while view “ b 1 ” shows a top oriented view of the insulator 440 , negative battery contact 450 , electronics package 460 , here a printed circuit board or pcb and cap 230 , while view “ b 2 ” shows a bottom oriented view of the same components shown in view “ b 1 ”. the left portion of shaft enclosure 220 shows extensions or “ legs ” that allow for the shaft enclosure to radially expand when expander 210 is pulled along the axis shown by screw 410 , when screw 410 is rotated . to keep expander 210 from simply rotating when screw 410 is rotated , expander 210 may include a protrusion ( shown on the left side of the expander ) that aligns in a slot formed by two of the shaft enclosure &# 39 ; s legs . in this manner , expander 210 is pulled along the axis of the screw without rotating along that axis . electronics package 460 for example may include active motion capture electronics that are battery powered , passive or active shot count components , for example a passive or active rfid tag , which for example may be coupled with electronics package 460 or for example coupled with insulator 440 . in addition , a gps antenna may also be coupled with electronics package 460 or cap 230 ( see fig9 a ). embodiments of the electronics may include motion capture accelerometers and / or gyroscopes and / or an inertial measurement unit along with wireless transmitter / receiver or transceiver components . the rfid tag enables golf shots for each club associated with a golfer to be counted . the rfid tag may be coupled with any component shown as rfid tags are tiny , for example cap 230 or shaft enclosure 220 or electronics package 460 , or any other element . golf shots may optionally be counted via an identifier associated with motion capture electronics on the golf club in conjunction with a mobile computer , for example an iphone ® equipped with an rfid reader that concentrates the processing for golf shot counting on the mobile computer instead of on each golf club . the visual marker may be mounted on cap 230 , shown as a circle with dots in view b 1 may be utilized with visual motion capture cameras . an equipment number , for example a golf club number may also be displayed on in a display area of the cap to indicate which club number is associated with the golf club , which is shown as a small circle with a number in it in view b 1 . embodiments of the visual marker may be passive or active , meaning that they may either have a visual portion that is visually trackable or may include a light emitting element such as a light emitting diode ( led ) that allows for image tracking in low light conditions respectively . this for example may be implemented with a graphical symbol or colored marker at the cap of the mount on the shaft at the end of the handle for example . motion analysis may be performed externally , for example using a camera and computer system based on the visual marker in any captured images . the visual data may also be utilized in motion analysis in combination with any wireless data from electronics package 460 . fig4 a illustrates an exploded view “ a ” of the main mount components of a second embodiment of the invention , namely expander 210 a , with ribs slightly offset with respect to expander 210 of fig4 . in addition , fig4 a also shows a second embodiment of shaft enclosure 220 a having coupling elements that enable second embodiment of insulator 440 a to securely couple to shaft enclosure 220 a without falling out if the mount is turned upside down for example . in this embodiment , insulator 440 a holds battery 430 inside while providing access to the battery so that positive battery contact 420 a and negative battery contact 450 a can make electrical contact with battery 430 . view “ b ” shows a bottom - oriented view of the insulator , positive and negative battery contact , electronics package , here a printed circuit board or pcb and cap . weight element 490 can be any shape so long as weight element 490 fits within , or couples in any direct or indirect manner with shaft enclosure 220 or 220 a and cap 230 for example . weight element 490 can be made to weigh as near as desired to the weight of the components that it replaces , for example to comply with any sporting rules that do not allow instrumented sporting equipment , e . g ., during competition . weight element 490 can also be utilized with the embodiment shown in fig4 as one skilled in the art will appreciate . fig4 b illustrates a perspective view of shaft enclosure 220 a and insulator 440 a of the second embodiment of the invention of fig4 a along with the positive and negative battery contact 420 a and 450 a respectively ( situated above holes in insulator 440 a ) along with battery 430 that is internally held within insulator 440 a . insulator 440 a includes for example snap components , e . g ., coupling elements 441 that couple with coupling elements 221 of shaft enclosure 220 a so that insulator 440 a and hence battery 430 do not fall out when the cap is removed . to remove insulator 440 a and hence battery 430 , tab 442 may be engaged with for example a finger , screw driver or other implement to disengage coupling elements 441 from coupling elements 221 . alignment component 443 enables rotational alignment of the insulator with the shaft enclosure . fig4 c illustrates a perspective view of the insulator along with the positive and negative battery contact 420 a and 450 a respectively , and battery 430 . coupling elements 441 are shown on the top and bottom in the written page , however any type of coupling element may be utilized in keeping with the spirit of the invention as desired . fig4 d illustrates a perspective close - up view of positive battery contact 420 a . in one or more embodiments of the invention , the positive and negative battery contacts may utilize the same structure . any type of positive and negative battery contacts may be utilized so long as they maintain electric connection between the battery and electronics package . fig4 e illustrates a top view of an embodiment of insulator 440 a that is configured to house a battery along with specific exemplary dimensions . to remove insulator 440 a and hence the battery within insulator 440 a , tab 442 may be engaged with for example a finger , screw driver or other implement to disengage coupling elements 441 from the coupling elements shown for example in fig4 b . in this figure , the numbers represent millimeters , and angle tolerances are within 2 degrees . as shown , this embodiment of insulator 440 a is configured to house a 6 . 4 mm battery . although not required for distribution in some countries , one or more embodiments of insulator 440 a may be constructed to be compliant with eu directive 2002 / 95 / ec ( rohs ) and eu directive 2002 / 96 / ec ( weee ). embodiments may alternatively be constructed to be compliant with any other electrical or manufacturing standards as desired . fig4 f illustrates a first side of the embodiment of the insulator of fig4 e . see also fig4 h for the cross section view . fig4 g illustrates a second side of the embodiment of the insulator of fig4 e . fig4 h illustrates a cross section view “ a ” of fig4 f . fig4 i illustrates a bottom view of the embodiment of the insulator of fig4 e . fig5 illustrates a close up perspective view of the electronics package 460 or pcb and associated positive contact 510 and negative contact 520 that are configured to make an electrical connection with the positive battery contact 420 and the negative battery contact 450 respectively . see also fig4 for an exploded view of the relative positioning of the components shown in this figure . fig5 a illustrates a second embodiment of positive battery contact 420 b located in the shaft enclosure . this embodiment is symmetrical in that there are two opposing sets of upward projections from the base plane that contacts shaft enclosure 220 . one of the opposing sets of upward projections of positive battery contact 420 b are slightly wider and are positioned within areas on shaft enclosure 220 to allow for radially aligning positive battery contact 420 b with respect to shaft enclosure 220 . fig6 illustrates a close up perspective view of cap 230 with electronics package 460 or pcb and negative battery contact 450 coupled with insulator 440 showing along with a coupling element , here four coupling points 610 ( with only the top two shown with reference number 610 with the inside portions visible , while the opposing two have only the initial slot openings in the cap visible ), and alignment element 620 . fig6 a illustrates a second embodiment of the negative battery contact 450 b having faceted surfaces as shown from the bottom side of insulator 440 . fig6 b illustrates the embodiment of fig6 a as shown from the top side of the insulator . the right portion of negative battery contact 450 b as shown may be folded over to engage insulator 440 while the opposing end of negative battery contact 450 b may freely travel in a slot provided in insulator 440 . the slot allows for the negative battery contact 450 b to flatten , and hence travel in the slot , based on the force generated by placing the battery against negative battery contact 450 b . fig7 illustrates a close up perspective view of the cap and alignment element . alignment element 620 allows for the angular alignment of insulator 440 , and electronics package 460 that have indents on their sides to engage the alignment element 620 . ( see fig4 ). by aligning insulator 440 and electronics package 460 with cap 230 , positive battery contact 420 and negative electrical contact 450 are also aligned rotationally since they couple to respective components non - rotationally , for example . fig8 illustrates a cutaway view of a second embodiment of electronics package 460 a in longitudinal form along with a second embodiment of a coupling element . any other orientation of electronics is in keeping with the spirit of the invention so long as the mount is configured to hold the desired electronics package . embodiments of the invention do not require modifying the piece of equipment , for example to include threads within the shaft . embodiments of the invention also can be flush mounted with the normal end of a shaft or have any desired low profile extension from a non - instrumented club . embodiments of the invention generally utilize a mount that is separate from the electronics so that the electronics package can be easily removed and replaced , or so that the battery can be easily removed and replaced , for example without any tools . as shown in this embodiment , a different coupling mechanism is used versus coupling points 610 , namely threads 810 that engage shaft enclosure 220 , which in this embodiment has corresponding threads . fig9 illustrates an embodiment of wireless antenna 910 , configured to mount within cap 230 as shown in the right portion of the figure . alternatively , the wireless antenna may be coupled with the electronics package 460 or may include any conductive element in any shape that can radiate electromagnetic energy . fig9 a illustrates an embodiment of the cap having two antennas , a wireless antenna , for example a bluetooth ® antenna and a gps antenna 920 . the gps antenna is optional and may be mounted in cap 230 as wireless antenna 910 is , or may be implemented in a different form factor or coupled with the pcb in any direct or indirect manner as one skilled in the art will appreciate . see also fig1 for another embodiment of the antenna configuration . fig1 shows an embodiment of shaft enclosure 220 b with angled area 1001 . shaft enclosure 220 b couples with cap 230 as is shown in the right portion of the figure . any other embodiment of the shaft enclosure detailed herein may be utilized on a shaft having a grip that either includes a hole or that does not include a hole and that wraps partially or fully around the motion capture element . fig1 shows grip 1101 , having a hole in the top of the grip that allows for the grip to be rolled down the shaft as is shown at area 1101 a . this enables cap 230 to be exposed , removed or otherwise accessed without removing the grip from the piece of equipment for example . fig1 shows grip at area 1101 b rolled back over angled area 1001 and onto the side portions of cap 230 . this enables the end of the cap 230 to be seen through the hole in the end of the grip , and enables the grip to provide extra support for the motion capture element . fig1 illustrates a spear collet cutaway view of an embodiment of the invention . spear 1301 couples enclosure 220 with the hole 1302 in the handle - based piece of equipment . the spear has a narrower portion shown at the hole , but this is not required so long as the spear is capable of holding enclosure 220 to the handle . fig1 illustrates a rear perspective view of the embodiment shown in fig1 . as shown , visual marker 1401 for motion capture detection via visual methods is shown on cap 230 of enclosure 220 . fig1 illustrates a handle - based embodiment of the invention . as shown , visual marker 1401 is visible and in one or more embodiment may contain high contrast or active elements to enable easier visual detection of the orientation and / or motion of the motion capture sensor for example with a camera . the embodiment shown may be coupled with a baseball bat or other handle based piece of equipment for example . fig1 illustrates a structural view of another handle - based embodiment of the invention . as shown , cap 230 , which covers the enclosure , is isolated from the piece of equipment via shock puck 1601 . shock puck 1601 may include any material that dampens or otherwise limits g - forces from the piece of equipment to assert force on the motion capture sensor . fig1 illustrates another handle - based embodiment of the invention . as shown , uncovered portion 1701 may be utilized to house an antenna external to the inside portion of the enclosure . in one or more embodiments , areas 1702 may be made from any material that enables radio frequency waves to emanate from the internal volume of the enclosure . alternatively , or in combination , the uncovered portion may provide an area for a small antenna that is then covered for protection as is shown in the next figure . fig1 illustrates the handle - based embodiment of the invention of fig1 showing the location of the antenna on the outer portion of the enclosure . as shown , antenna 1801 may be placed in the uncovered portion 1701 as shown in fig1 , which is shown in this figure partially filled with epoxy . two holes may be drilled through the cap to provide feed lines for antenna 1801 and also for ground point 1802 . the antenna and ground point may be covered as is shown in the next figure . embodiments of the enclosure that are metallic and for example behave as an electromagnetic shield may utilize this type of antenna and provide for an extremely durable enclosure and exceptional antenna coverage for example . fig1 illustrates the embodiment of fig1 with the antenna shown in fig1 covered with non - conductive material . as shown , the uncovered portion shown in fig1 is covered at 1901 for example , and flush with the other portions of the cap to provide a finished cap for the enclosure that provides maximal antenna covered , while still providing a visual marker for bot electronic and visual motion capture sensing capabilities . fig2 illustrates a cutaway view of an embodiment of the invention coupled with a piece of equipment having a handle . as shown , shock puck 1601 surrounds enclosure 220 to provide high g - force shock protection to the internal components of the motion capture sensor . one or more embodiments of the invention may be covered with an outer protective area 2001 , which may be transparent in one or more embodiments . fig2 illustrates an embodiment of the invention configured to couple with a helmet . as shown , enclosure 220 couples with mount 2101 that includes a half circle opening for example that may be fit around a helmet facemask tube or grill . screw 2102 may be tightened to close the gap between the mount and the screw backing to couple enclosure 220 to a helmet . fig2 illustrates the embodiment shown in fig2 coupled with the helmet . as shown , enclosure 220 is coupled with helmet via facemask tube or grill 2201 as per the elements shown in fig2 . any other method of coupling the enclosure with a helmet is in keeping with the spirit of the invention . fig2 illustrates a close - up of the embodiment shown in fig2 . visual marker 1401 is shown on the outside portion of the helmet for use in capturing motion with an external camera for example . fig2 illustrates a perspective view of an embodiment of the invention coupled with a skateboard truck . as shown , enclosure 220 couples with or otherwise includes mount 2401 that is configured to couple with the existing screws of a skateboard truck mount 2402 . thus no extra holes are required for mounting an embodiment of the invention to a skateboard . the same configuration may be reshaped to fit holes associated with a snowboard binding or other planar oriented piece of equipment including skis as is shown in the next figure . fig2 illustrates an embodiment coupled with planar equipment . as shown , enclosure 220 may be mounted along with the snowboard binding 2501 of a snowboard . in one or more embodiments , the enclosure may be coupled with the snowboard mount itself , or utilize a flat version of mount 2401 to couple with an existing screw used to mount the binding . as shown in the lower portion of the figure , enclosure 220 may mount on or near the top of the surfboard or on the underside of the surfboard near the skeg 2502 since surfboards may be made from materials that enable the transmission of electromagnetic waves . in one or more embodiments enclosure 220 may be housed in streamlined mount 2503 and adhesively mounted to any planar equipment , for example the snowboard , surfboard or skis . streamlined mounts provide low wind or water drag and minimize interference with external objects for example . fig2 illustrates an embodiment coupled with a baseball bat . sensor mount and enclosure 2605 is installed on baseball bat 2601 . the sensor and mount 2605 has an external portion or enclosure 2610 that protrudes from the knob of the bat , and an internal portion or mount 2611 that is coupled with the bat , for example inside the bat . the external portion or enclosure 2610 of the mount encloses electronics 2620 , which may for example include circuit boards , a battery , integrated circuits , and an antenna . fig2 illustrates a risk with the prior art when an enclosure experiences an impact event . in fig2 , enclosure 2710 is attached to bat 2601 , as illustrated in fig2 . however , the mount 2710 is not designed to be shatter proof . baseball 2701 a approaches the bat and impacts the enclosure 2710 at location 2701 b . the impact force shatters the enclosure 2710 , and potentially the mount internal to the bat , and fragments such as 2702 a , 2702 b , and 2702 c generally move away from the impact area rapidly . these fragments may pose a safety risk ; for example , fragment 2702 c may hit the eye of the batter . fig2 illustrates an embodiment with a shatter proof enclosure and mount . as in fig2 , the mount is shown attached to baseball bat 2601 . this example is for illustration ; one or more embodiments may be attached to any type of equipment . the exposed enclosure 2610 is covered with a protective layer 2801 . this layer may for example include materials that are designed to flex rather than break , or materials that are sufficiently strong that they will not shatter under impact . materials in protective layer 2801 may include for example , without limitation , rubber , silicone rubber , plastics , thermoplastics , polycarbonates , acrylics , reinforced glass , metals , and carbon fiber reinforced polymers . one or more embodiments may use multiple protective layers . one or more embodiments may use protective layers of any size , thickness , and shape . fig2 illustrates an impact event with the mount of fig2 . baseball 2701 b impacts the enclosure , and protective layer 2801 deforms at location 2901 a ; however , the protective layer does not break . after impact , the impacted location 2901 b maintains integrity and prevents internal components such as 2902 from exiting the enclosure . although the internal components may be damaged , the protective layer 2801 prevents components or fragments from exiting the enclosure , mitigating the potential safety risk . one or more embodiments may use a mesh structure or composite structure instead of or in addition to materials that flex or resist shattering . the mesh may be for example embedded into the protective layer or the enclosure . fig3 illustrates an example with mesh 3001 integrated into protective layer 2801 . the mesh may for example prevent components from exiting the enclosure even if the layer 2801 experiences tears or breaking . fig3 illustrates a mesh installed on the outside of an enclosure . mount 230 has a mesh 3101 added to the external surface , which prevents fragments of the enclosure or internal components from exiting the mesh . the mount 230 has a visual marker 3102 which remains visible through the mesh . embodiments of the invention may be mounted on any type of equipment to prevent shattering for example . thus any mount described herein for any type of equipment may couple with an enclosure that utilizes or includes materials or layers as described in fig2 - 31 . while the ideas herein disclosed has been described by means of specific embodiments and applications thereof , numerous modifications and variations could be made thereto by those skilled in the art without departing from the scope of the invention set forth in the claims . | 6 |
referring to the drawings and in particular fig1 , 17 18 , 25 , 28 and 32 , the rigid intersection connection 1 , 1 &# 39 ;, 1 &# 34 ;, 1 &# 34 ;&# 39 ;, 1 &# 34 ;&# 34 ;, 1 &# 34 ;&# 39 ;&# 34 ;, and 1 &# 34 ;&# 34 ;&# 34 ; of the present invention as shown in the structures of fig3 , 24 and 36 include a first elongated wood x structural member 2 having first , second , third , and fourth sides 3 , 4 , 5 , and 6 ; a first elongated wood y structural member 7 intersecting the elongated wood x structural member 2 and having first , seat and second sides 8 , 9 and 10 ; a first elongated wood z structural member 11 intersecting the elongated wood x and y structural members 2 and 7 and having first , seat and second sides 12 , 13 , and 14 ; and a first rigid connector 15 constructed from a single sheet of sheet metal 16 configured for holding the intersecting elongated wood x , y , and z structural members 2 , 7 and 11 in a rigid embrace . the first rigid connector 15 includes : an xy support side member 17 dimensioned for registration with a portion of the elongated wood x structural member 2 ; an xz support side member 18 integrally connected to the xy support side member 17 along a substantial portion thereof and dimensioned for registration with a portion of the elongated wood x structural member ; a yx side member 19 integrally connected to the xy support side member 17 and dimensioned for registration with a portion of the first side 8 of the elongated wood y structural member 7 ; a zx side member 20 integrally connected to the xz support side member 18 and dimensioned for registration with a portion of the first side 12 of the elongated wood z structural member 11 ; a y seat member 21 integrally connected to the yx side member 19 and dimensioned for registration with a portion of the seat side 9 of the elongated wood y structural member 7 ; a y side member 22 integrally connected to the y seat member 21 and dimensioned for registration with a portion of the second side 10 of the elongated wood y structural member 7 ; a z seat member 23 integrally connected to the zx side member 20 and dimensioned for registration with a portion of the seat side 13 of the elongated wood z structural member 11 ; and a z side member 24 integrally connected to the z seat member 23 and dimensioned for registration with a portion of the second side 14 of the elongated wood z structural member 11 . the rigid connectors are connected to the elongated wood structural members as shown in the drawings by first fastener means 25 attaching the xy support side member 17 to the first side of the elongated wood x structural member ; second fastener means 26 attaching the yx side member 19 to the first side 8 of the elongated wood y structural member 7 ; third fastener means 27 attaching the y side member 22 to the second side 10 of the elongated wood y structural member 7 ; fourth fastener means 28 attaching the zx side member 20 to the first side 12 of the elongated wood z structural member 11 ; and fifth fastener means 29 attaching the z side member 24 to the second side 14 of the elongated wood z structural member 11 . this application describes three basic rigid connectors which may be constructed from the same sheet metal blank 16 . these rigid connectors are divided into three series 15 &# 39 ;, 15 , and 15 &# 34 ; which in turn have several modifications . the first series of rigid connectors 15 &# 39 ; are illustrated in fig1 - 21 and are constructed from the blank 16 illustrated in fig2 . the first series rigid connectors 15 &# 39 ; are used in the greenhouse structure 69 illustrated in fig3 - 14 , the bench structure 61 illustrated in fig2 , and the bunk bed furniture structure 68 illustrated in fig3 - 38 . the first series rigid connection 1 &# 39 ; is characterized by a structure in which the first elongated wood y and z structural members 7 and 11 are in general linear alignment and the xy and xz support side members 17 &# 39 ; and 18 &# 39 ; of the first rigid connector 15 &# 39 ; are in substantially the same plane . the parts of the first series rigid connector 15 &# 39 ; which are identical to the second series rigid connector 15 are designated by a single prime mark (&# 39 ;) and the description is not repeated . the third series of rigid connectors 15 &# 34 ; are illustrated in fig1 and are constructed from the blank 16 illustrated in fig2 . the third series rigid connectors 15 &# 34 ; are used in the greenhouse structure 69 illustrated in fig3 - 14 . the third series rigid connection 1 &# 34 ; is characterized by a structure in which the xy , and xz support side members 17 &# 34 ; and 18 &# 34 ; of the first rigid connector 15 &# 34 ; are disposed at an angle 70 and the yx side member 19 &# 34 ; and the xy support side member 17 &# 34 ; of the first rigid connector 15 &# 34 ; are disposed at an angle 71 . the parts of the third series rigid connector 15 &# 34 ; which are identical to the second series rigid connector 15 are designated by a double prime mark (&# 34 ;) and the description is not repeated . the second series of rigid connectors 15 are illustrated in fig1 , 15 and 16 and are constructed from the blank 16 illustrated in fig2 . the second series of rigid connectors have several modifications as follows : a first modified second series rigid connector 15 &# 34 ;&# 39 ; is illustrated in fig2 - 30 ( like parts are designated by the symbol (&# 34 ;&# 39 ;); a second modified second series rigid connector 15 &# 34 ;&# 34 ; is illustrated in fig2 - 27 ( like parts are designated by the symbol (&# 34 ;&# 34 ;); a third modified second series rigid connector 15 &# 34 ;&# 34 ;&# 39 ; is illustrated in fig3 - 34 ( like parts are designated by the symbol (&# 34 ;&# 34 ;&# 39 ;); and a fourth modified second series rigid connector 15 &# 34 ;&# 34 ;&# 34 ; is illustrated in fig3 - 41 ( like parts are designated by the symbol (&# 34 ;&# 34 ;&# 34 ;). the second series rigid connectors 15 are used in the greenhouse structure 69 illustrated in fig3 - 14 , the bench structure 61 illustrated in fig2 , the log holder structure 54 illustrated in fig2 , and the bunk bed furniture structure 68 illustrated in fig3 - 38 . the rigid intersection connections 1 , 1 &# 34 ;, 1 &# 34 ;&# 34 ;, 1 &# 34 ;&# 39 ;, 1 &# 34 ;&# 34 ;&# 39 ;, and 1 &# 34 ;&# 34 ;&# 34 ; illustrated in fig1 , 17 , 25 , 28 or 32 which includes third as well as second series rigid connectors include : a first elongated wood x structural member 2 having first , second , third , and fourth sides 3 , 4 , 5 , and 6 ; a first : elongated wood y structural member 7 intersecting the elongated wood x structural member 2 and having first , seat and second sides 8 , 9 , and 10 ; and a first elongated wood z structural member 11 intersecting the elongated wood x and y structural members 2 and 7 and having first , seat and second sides 12 , 13 , and 14 . first rigid connector 15 1 is constructed from a single sheet of sheet metal 16 configured for holding the intersecting elongated wood x , y , and z structural members 2 , 7 , and 11 in a rigid embrace and includes : an xy support side member 17 dimensioned for registration with a portion of the first side 3 of the elongated wood x structural member 2 ; an xz support side member 18 disposed at an angle 72 to the xy support side member 17 and integrally connected thereto along a substantial portion thereof and dimensioned for registration with the second side 4 of the elongated wood x structural member 2 ; a yx side member 19 integrally connected to the xy support side member 17 and dimensioned for registration with a portion of the first side 8 of the elongated wood y structural member 7 ; the xy support side member 17 and the yx side member 19 forming a first angle 30 ; a zx side member 20 integrally connected to the xz support side member 18 and dimensioned for registration with a portion of the first side 12 of the elongated wood z structural member 11 ; the xz support side member 18 and the zx side member 20 forming a second angle 31 ; a y seat member 21 integrally connected to the yx side member 19 and dimensioned for registration with a portion of the seat side 9 of the elongated wood y structural member 7 ; a y side member 22 integrally connected to the y seat member 21 and dimensioned for registration with a portion of the second side 10 of the elongated wood y structural member 7 ; a z seat member 23 integrally connected to the zx side member 20 and dimensioned for registration with a portion of the seat side 13 of the elongated wood z structural member 11 ; and a z side member 24 integrally connected to the z seat member 23 and dimensioned for registration with a portion of the second side 14 of the elongated wood z structural member 11 . the first rigid connector 15 1 is connected to the elongated wood structural members by first fastener means 25 attaching the xy support side member 17 to the first side 3 of the elongated wood x structural member 2 ; second fastener means 26 attaching the yx side member 19 to the first side 8 of the elongated wood y structural member 7 ; third fastener means 27 attaching the y side member 22 to the second side 10 of the elongated wood y structural member 7 ; fourth fastener means 28 attaching the zx side member 20 to the first side 12 of the elongated wood z structural member 11 ; fifth fastener means 29 attaching the z side member 24 to the second side 14 of the elongated wood z structural member 11 ; and sixth fastener means 32 attaching the xz support side member 18 to the second side 4 of the elongated wood x structural member 2 . the rigid intersection connections 1 , 1 &# 34 ;, and 1 &# 39 ; illustrated in fig1 . 2 , 17 , and 18 may be made even more rigid and hold greater loads by providing a y side opening means 33 formed in the y side member 22 permitting double shear fastening of the y side member 22 to the elongated wood x structural member 2 and z side opening means 34 formed in the z side member 24 permitting double shear fastening of the z side member to the elongated wood x structural member 2 . double shear attachment is by seventh fastener means 35 dimensioned for insertion through the y side opening means 33 , the elongated wood y structural member 7 and into the elongated wood x structural member 2 ; and eighth fastener means 36 dimensioned for insertion through the z side opening means 34 , the elongated wood z structural member 11 and into the elongated wood x structural member 2 . double shear fastening is fully explained in my u . s . pat . no . 4 , 480 , 941 granted nov . 6 , 1984 entitled double shear angled fastener connector . a first modified second series rigid connector 15 &# 34 ;&# 39 ; is illustrated in fig2 - 30 . this form of the invention has been found to be suitable for connecting smaller dimension lumber to larger dimension posts . the rigid intersection connection 1 &# 34 ;&# 39 ; includes : a y side extension 37 integrally connected to the y side member 22 &# 34 ;&# 39 ; at an angle 41 and disposed in registration with a portion of the elongated wood x structural member 2 ; and a z side extension 38 integrally connected to the z side member 24 at an angle 42 and disposed in registration with a portion of the elongated wood x structural member 2 . connection is by ninth fastener means 39 piercing the y side extension 37 and inserted into the elongated wood x structural member 2 ; and tenth fastener means 40 piercing the z side extension 38 and inserted into the elongated wood x structural member 2 . a second modified , second series rigid connector 15 &# 34 ;&# 34 ; is illustrated in fig2 - 27 . this form of the invention is particularly suitable for lumber of the same thickness . the rigid intersection connection 1 &# 34 ;&# 34 ; includes : a y side extension interlock 43 integrally connected to the y side member 22 &# 34 ;&# 34 ; at an angle 47 and disposed in registration with a portion of the z side member 24 &# 34 ;&# 34 ;; and a z side extension interlock 44 integrally connected to the z side member 24 &# 34 ;&# 34 ; at an angle 48 and disposed in registration with a portion of the y side member 22 &# 34 ;&# 34 ;. connection is by eleventh fastener means 45 piercing the y side extension interlock 43 and the z side member 24 &# 34 ;&# 34 ; and inserted into the elongated wood z structural member 11 ; and twelfth fastener means 46 piercing the z side extension interlock 44 and the y side member 22 &# 34 ;&# 34 ; and inserted into the elongated wood y structural member 7 . a third modified second series rigid connector 15 &# 34 ;&# 39 ;&# 34 ; is illustrated in fig3 - 34 . this form of the invention is particularly suitable for large dimension lumber . the rigid intersection connection 1 &# 34 ;&# 39 ;&# 34 ; includes : a y side member extension x structural member interlock 49 integrally connected to the y side member 22 &# 34 ;&# 39 ;&# 34 ; at an angle 53 and disposed for registration with the z side member 24 &# 34 ;&# 39 ;&# 34 ;; a restricted opening 50 formed in the y side member extension x structural member interlock 49 ; a restricted slot opening 51 formed in the z side member 24 &# 34 ;&# 39 ;&# 34 ; in registration with the restricted opening 50 formed in the y side member extension x structural member interlock 49 : and thirteenth fastener means 52 dimensioned for insertion through the restricted opening 50 formed in the y side member extension x structural member interlock and the restricted slot opening 51 formed in the z side member 24 &# 34 ;&# 34 ;&# 39 ;, and inserted into the elongated wood x structural member 2 . tab 89 connected to y seat member 21 &# 34 ;&# 39 ;&# 34 ; and formed with a fastener opening for receipt of fastener 124 for insertion therethrough into elongated x structural member 2 , and tab 90 connected to z seat member 23 &# 34 ;&# 39 ;&# 34 ; and formed with a fastener opening for receipt of fastener 124 for insertion therethrough into elongated x structural member 2 assist in increasing the rigidity of the rigid intersection connection 1 &# 34 ;&# 39 ;&# 34 ;. a fourth modified second series rigid connector 15 &# 34 ;&# 34 ;&# 34 ; is illustrated in fig3 - 41 . this form of the invention is particularly suitable for lumber of the same dimensional width and for structural rigidity . the rigid intersection connection 1 &# 34 ;&# 34 ;&# 34 ; includes : a y side extension overlap 57 integrally connected to the y side member 22 &# 34 ;&# 34 ;&# 34 ; at an angle 59 ; a z side extension overlap 58 integrally connected to the z side member 24 &# 34 ;&# 34 ;&# 34 ; at an angle 60 and disposed in overlapping registration with the y side extension overlap 57 ; and fifteenth fastener means 56 piercing the y and z side extension overlaps 57 , and 58 and inserted into the first elongated wood x structural member 2 . one of the simplest structures using a plurality of rigid intersection connections as described in the present invention is a log holder 54 which is illustrated in fig2 . this is only one example of a furniture structure , but it typifies one of the structures which takes advantage of the unique characteristics of the rigid connector of the present invention . any one of the second series rigid connectors could be used , but as an example , the second modified second series rigid connector 15 &# 34 ;&# 34 ; as previously described in fig2 -- 27 is illustrated . the structure 54 as illustrated in fig2 includes : a plurality of rigid intersection connections 1 &# 34 ;&# 34 ; including : a first elongated wood x structural member 2 1 having first , second , third , and fourth sides 3 , 4 , 5 , and 6 ; a second elongated wood x structural member 2 2 having first , second , third and fourth sides 3 , 4 , 5 , and 6 spaced from and disposed generally parallel to the first elongated wood x structural member 2 1 ; a third elongated wood x structural member 2 3 having first , second , third and fourth sides 3 , 4 , 5 , and 6 spaced from and disposed generally parallel to the second elongated wood x structural member 2 2 ; a fourth elongated wood x structural member 2 4 having first , second , third and fourth sides 3 , 4 , 5 , and 6 spaced from and disposed generally parallel to the first and third elongated wood x structural members 2 1 and 2 3 ; a second elongated wood y structural member 7 2 disposed parallel and spaced from the first elongated wood y structural member 7 1 ; a second elongated wood z structural member 11 2 disposed parallel and spaced from the first elongated wood z structural member 11 1 ; a first rigid connector 15 1 &# 34 ;&# 34 ; connected to the first elongated wood x structural member 2 1 , a second rigid connector 15 2 &# 34 ;&# 34 ; connected to the second elongated wood x structural member 2 2 , the first elongated wood z structural member 11 1 and the second elongated wood y structural member 7 2 ; a third rigid connector 15 3 &# 34 ;&# 34 ; connected to the third elongated wood x structural member 2 3 , the second elongated wood y structural member 7 2 and the second elongated wood z structural member 11 2 ; a fourth rigid connector 15 4 &# 34 ;&# 34 ; connected to the fourth elongated wood x structural member 2 4 , the second elongated wood z structural member 11 2 and the first elongated wood y structural member 7 1 ; and fastener means 55 attaching the first , second , third , and fourth rigid connectors 15 2 &# 34 ;&# 34 ;, 15 3 &# 34 ;&# 34 ;, 15 4 &# 34 ;&# 34 ; to the elongated wood structural members 2 1 2 2 , 2 3 , 2 4 , 7 1 , 7 2 , 11 1 , and 11 2 . the log holder 54 may be made of any dimension lumber , but a typical lumber size would be 2 &# 34 ;× 4 &# 34 ; or nominal 2 × 4 &# 39 ; s . referring again to the log holder structure illustrated in fig2 and the second modified , second series rigid connector 15 &# 34 ;&# 34 ; illustrated in fig2 - 27 each of the first , second , third and fourth rigid connectors 15 1 &# 34 ;&# 34 ;, 15 2 &# 34 ;&# 34 ; 15 3 &# 34 ;&# 34 ;, and 15 4 &# 34 ;&# 34 ; include : a y side extension interlock 43 integrally connected to the y side member 22 &# 34 ;&# 34 ; at an angle 47 and disposed in registration with a portion of the z side member 24 &# 34 ;&# 34 ;; a z side extension interlock 44 integrally connected to the z side member 24 &# 34 ;&# 34 ; at an angle 48 and disposed in registration with a portion of the y side member 22 &# 34 ;&# 34 ;; eleventh fastener means 45 piercing each of the y side extension interlocks 43 and the z side members 24 &# 34 ;&# 34 ; and inserted into the elongated wood z structural members 11 ; and twelfth fastener means 46 piercing each of the z side extension interlocks 44 and the y side members 22 &# 34 ;&# 34 ; and inserted into the elongated wood y structural members 7 . another furniture structure which is uniquely adapted for construction with the rigid intersection connections of the present invention is a work bench . the work bench may have four or more legs such as the five leg work bench in fig2 . to minimize the number of drawings , a four leg work bench has not been specifically drawn ; rather it may be readily envisioned that simply placing a table top means on the top of the log holder of fig2 would readily result in the formation of a work bench or table . to construct an even sturdier work bench , horizontal wood structural members may be used as in the 5 post work bench of fig2 . the description which follows refers to a four leg work bench as illustrated in fig2 , but with the additional horizontal support members as illustrated in fig2 . a furniture structure such as a work bench previously described may include : a third elongated wood y structural member 7 3 disposed from the first elongated wood y structural member 7 1 and in parallel relation thereto ; a fourth elongated wood y structural member 7 4 disposed from the second elongated wood y structural member 7 2 and in parallel relation thereto ; a third elongated wood z structural member 11 3 disposed from the first elongated wood z structural member 11 1 and in parallel relation thereto ; a fourth elongated wood z structural member 11 4 disposed from the second elongated wood z structural member 11 2 and in parallel relation thereto ; a fifth rigid connector 15 5 &# 34 ;&# 34 ; disposed from the first rigid connector 15 1 &# 34 ;&# 34 ; and connected to the first elongated wood x structural member 2 1 , the third elongated wood y structural member 7 3 , and the third elongated wood z structural member 11 3 ; a sixth rigid connector 15 6 &# 34 ;&# 34 ; connected to the second elongated wood x structural member 2 2 , the third elongated wood z structural member 11 3 , and the fourth elongated wood y structural member 7 4 ; a seventh rigid connector 15 7 &# 34 ;&# 34 ; disposed from the third rigid connector 15 3 &# 34 ;&# 34 ; and connected to the third elongated wood x structural member 15 3 &# 34 ;&# 34 ;, the fourth elongated wood z structural member 11 4 and the fourth elongated wood y structural member 7 4 ; an eighth rigid connector 15 8 &# 34 ;&# 34 ; disposed from the fourth rigid connector 15 4 &# 34 ;&# 34 ; and connected to the fourth elongated wood x structural member 2 3 , the third elongated wood y structural member 7 3 and the fourth elongated wood z structural member 11 4 ; and the fastener means 55 also attach the fifth , sixth , seventh and eight rigid connectors 15 5 &# 34 ;&# 34 ; , 15 6 &# 34 ;&# 34 ;, 15 7 &# 34 ;&# 34 ;, and 15 8 &# 34 ;&# 34 ; to the elongated wood structural member 7 3 , 11 3 , 7 4 , 11 4 , 2 1 , 2 2 , 2 3 , and 2 4 . fig2 is an illustration of a 5 post work bench . the description which follows includes the description of the four post work bench set forth above . while the work bench may be constructed from any of the rigid connectors previously described , the description which follows is based on the second series rigid connectors illustrated in fig1 and 2 and the first series rigid connector illustrated in fig1 . the furniture structure 61 illustrated in fig2 includes : a fifth elongated wood x structural member 2 5 disposed between the first and fourth elongated wood x structural members 2 1 and 2 4 ; a first , first series rigid connector 15 2 , which includes : an xy support side member 17 &# 39 ; dimensioned for registration with a portion of the fifth elongated wood x structural member 2 5 ; an xz support side member 18 &# 39 ; integrally connected to the xy support side member 17 &# 39 ; along a substantial portion thereof and dimensioned for registration with a portion of the fifth elongated wood x structural member 2 5 ; a yx side member 19 &# 39 ; integrally connected to the xy support side member 17 &# 39 ; and dimensioned for registration with a portion of the first side 8 of the first elongated wood y structural member 7 1 ; a zx side member 20 &# 39 ; integrally connected to the xz support side member 18 &# 39 ; and dimensioned for registration with a portion of the first side 8 of the first elongated wood y structural member 7 1 ; a y seat member 21 &# 39 ; integrally connected to the yx side member 19 &# 39 ; and dimensioned for registration with a portion of the seat side 9 of the first elongated wood y structural member 7 1 ; a y side member 22 &# 39 ; integrally connected to the y seat member 21 &# 39 ; and dimensioned for registration with a portion of the second side 10 of the first elongated wood y structural member 7 1 ; a z seat member 23 &# 39 ; integrally connected to the zx side member 20 &# 39 ; and dimensioned for registration with a portion of the seat side 9 of the first elongated wood y structural member 7 1 ; a z side member 24 &# 39 ; integrally connected to the z seat member 23 &# 39 ; and dimensioned for registration with a portion of the second side 14 of the first elongated wood y structural member 7 1 ; and the xy and xz support side members 17 &# 39 ; and 18 &# 39 ; are in substantially the same plane ; a second , first series rigid connector 15 2 , spaced from the first , first series rigid connector 15 1 &# 39 ; including : an xy support side member 17 &# 39 ; dimensioned for registration with a portion of the fifth elongated wood x structural member 2 5 , an xz support side member 19 &# 39 ; integrally connected to the xy support side member 17 &# 39 ; along a substantial portion thereof and dimensioned for registration with a portion of the fifth elongated wood x structural member 2 5 ; a yx side member 19 &# 39 ; integrally connected to the xy support side member 17 &# 39 ; and dimensioned for registration with a portion of the first side 8 of the third elongated wood y structural member 7 3 ; a zx side member 20 &# 39 ; integrally connected to the xz support side member 18 &# 39 ; and dimensioned for registration with a portion of the first side 8 of the third elongated wood y structural member 7 3 ; a y seat member 21 &# 39 ; integrally connected to the yx side member 19 and dimensioned for registration with a portion of the seat side 9 of the third elongated wood y structural member 7 3 ; a y side member 22 &# 39 ; integrally connected to the y seat member 21 &# 39 ; and dimensioned for registration with a portion of the second side 10 of the third elongated wood y structural member 7 3 ; a z seat member 23 &# 39 ; integrally connected to the zx side member 20 &# 39 ; and dimensioned for registration with a portion of the seat side 9 of the third elongated wood y structural member 7 1 ; a z side member 24 &# 39 ; integrally connected to the z seat member 23 &# 39 ; and dimensioned for registration with a portion of the second side 14 of the third elongated wood y structural member 73 ; and the xy and xz support side members 17 &# 39 ; and 18 &# 39 ; are in substantially the same planes ; and the fastener means 55 also attach the first and second first series rigid connectors 15 1 , and 15 2 &# 39 ; to the elongated wood structural members 2 5 , 7 1 , and 7 3 . table surface 125 may be attached to third and fourth elongated wood y structural members 7 3 and 7 4 and third and fourth elongated wood z structural members 11 3 and 11 4 . use of eight rigid connectors in any furniture structure such as the table structure illustrated in fig2 or the bunk bed illustrated in fig3 - 38 which follow eliminates the need for any diagonal bracing . the use of a plurality of rigid intersection connections of the present invention forming structures based on rectangles instead of triangles , makes it possible to form many useful structures with very little change in the basic structure . for example , the construction of a 4 post table using the basic structure of the log holder 54 in fig2 also may result in the formation of a basic 4 poster bunk bed ( not shown but similar to the structure of fig3 ). the description that follows is therefore a continuation of the description of the four post bench but instead of using the second series rigid connectors previously described and illustrated in fig1 and 2 , the fourth modified , second series rigid connectors illustrated in fig3 and 41 is used . the furniture structure such as a four post bunk bed may include the structure previously described for a four post table and also include : the first through eighth rigid connectors 15 1 &# 34 ;&# 34 ;&# 34 ; through 15 8 &# 34 ;&# 34 ;&# 34 ; each of which include : a y side extension overlap 57 integrally connected to the y side member 2 2 &# 34 ;&# 34 ;&# 34 ; at an angle 59 ; a z side extension overlap 58 integrally connected to the z side member 2 4 &# 34 ;&# 34 ;&# 34 ; at an angle 60 ; fifteenth fastener means 56 piercing each of the y and z side extension overlaps 57 and 58 and inserted into each of the first , second , third , and fourth elongated wood x structural members 2 1 , 2 2 , 2 3 , and 2 4 . amazingly , the rigid intersection connection of the present invention is capable of constructing a log holder , a work bench and a bunk bed , but it is uniquely capable of constructing an entire building based on one rigid connector . the structure illustrated in fig2 - 14 may be a storage shed , tool house or greenhouse or other garden utilitarian structure . note that the structure is based on a series of rectangles rather than a series of triangles as in all other building structures . the use of rectangles rather than triangles permits windows , doors , vents or other openings to be placed anywhere in the structure ; even at corners because there is no interfering diagonal members . use of the intersecting connections of the present invention eliminates the need for plywood or other sheathing to create shear walls in building structures . thus glass or plastic panels may be fitted in each of the rectangles in the greenhouse illustrated in fig2 - 14 . the greenhouse described in this application may have a flat roof , a shed roof or a peaked roof . the description which follows relates to a flat roofed greenhouse which is not shown in order to reduce the number of drawings in this application . the rigid connectors used in the construction of the greenhouse structure may be any of those described . a full description of each rigid connector is not repeated as the description has been set forth above for each of the different series connectors . in determining the particular rigid connector , one may refer to the previous description , the claims and the drawings . referring specifically to fig3 the building structure includes : a first elongated wood x structural member 2 1 having first , second , third , and fourth sides 3 , 4 , 5 , and 6 and upper and lower ends 62 and 63 , a second elongated wood x structural member 2 2 disposed generally parallel to and spaced from the first elongated wood x structural member 2 1 and having first , second , third and fourth sides 3 , 4 , 5 , and 6 and upper and lower ends 62 and 63 ; a third elongated wood x structural member 2 3 spaced from and disposed generally parallel to the second elongated wood x structural member 2 2 and having first , second , third and fourth sides 3 , 4 , 5 , and 6 and upper and lower ends 62 and 63 ; a fourth elongated wood x structural member 2 4 spaced from and disposed generally parallel to the first and third elongated wood x structural members 2 1 and 2 3 and having first , second , third and fourth sides 3 , 4 , 5 , and 6 and upper and lower ends 62 and 63 ; the first , second , third , and fourth elongated wood x structural members 2 1 , 2 2 , 2 3 , 2 4 provide corner studs in the building structure ; a first elongated wood y structural member 7 1 disposed between and intersecting the first and fourth elongated wood x structural members 2 1 and 2 4 and having first , second , third , and fourth sides 3 , 4 , 5 , and 6 ; a first elongated z structural member 11 1 disposed between and intersecting the first and second elongated wood x structural members 2 1 and 2 2 and having first , second , third , and fourth sides 3 , 4 , 5 , and 6 ; a second elongated wood y structural member 7 2 disposed parallel and spaced from the first elongated wood y structural member 7 1 and intersecting the second and third elongated x structural members 2 2 and 2 3 and having first , second , third , and fourth sides 3 , 4 , 5 , and 6 ; a second elongated wood z structural member 11 2 disposed parallel and spaced from the first elongated wood z structural member 11 2 , and intersecting the second and third elongated wood x structural members 2 2 and 2 3 and having first , second , third and fourth sides 3 , 4 , 5 , and 6 ; the first and second elongated wood y structural members 7 1 and 7 2 and the first and second elongated wood z structural members 11 1 and 11 2 form a perimeter sill in the building ; a first , second series rigid connector 15 1 connected to and forming a rigid interconnection with the first elongated wood x structural member 2 1 , the first elongated wood y structural member 7 1 and the first elongated wood z structural member 11 1 ; a second , second series rigid connector means 15 2 connected to and forming a rigid interconnection with the second elongated wood x structural member 2 2 , the first elongated wood z structural member 11 1 and the second elongated wood y structural member 7 2 ; a third , second series rigid connector means 15 3 connected to and forming a rigid interconnection with the third elongated wood x structural member 2 3 , the second elongated wood y structural member 7 2 and the second elongated wood z structural member 11 2 ; a fourth , second series rigid connector means 15 4 connected to and forming a rigid interconnection with the fourth elongated wood x structural member 2 4 , the second elongated wood z structural member 11 2 and the first elongated wood y structural member 7 1 ; roof means such as a flat structure connected to the upper portions 62 of the elongated wood x structural members 2 1 , 2 2 , 2 3 , and 2 4 ; fastener means 25 - 29 , 32 , and 56 attaching the first , second , third , and fourth , second series rigid connectors 15 1 , 15 2 , 15 3 , and 15 4 , to the elongated wood structural members 2 1 , 2 2 , 2 3 2 4 , 11 1 , 7 2 , 11 2 and 7 1 ; and the first elongated wood x structural member 2 1 , the first elongated wood y structural member 7 1 , the fourth elongated wood x structural member 2 4 and the roof means form a rectangular opening . the previously described building structure with a flat roof may also be formed with a shed or slanting roof by simply adding third series rigid connectors illustrated in fig1 and previously described . the additional structure for a shed roof building structures includes : the first , second , third , and fourth elongated wood x structural members have upper ends 62 ; a sixth elongated wood x structural member 2 6 disposed adjacent the upper ends 62 of the first and fourth elongated wood x structural members 2 1 and 2 4 ; a fifth elongated wood z structural member 11 5 having an upper end 64 and a lower end 65 intersecting the sixth elongated wood x structural member 2 6 and disposed in close association with the upper end 62 of the first elongated wood x structural member 2 2 ; a fifth elongated wood y structural member 7 5 having an upper end 66 and having a lower end 67 intersecting the sixth elongated wood x structural member 2 6 and disposed in close association with the upper end 62 of the fourth elongated wood x structural member 2 4 ; a first , third series rigid connector means 15 1 &# 34 ; connected to and forming a rigid interconnection with the sixth elongated wood x structural member 2 6 , the first elongated wood x structural member 2 1 and the fifth elongated wood z structural member 11 5 ; a second , third series rigid connector means 15 2 &# 34 ; connected to and forming a rigid interconnection with the sixth elongated wood x structural member 2 6 , the fourth elongated wood x structural member 2 4 , and the fifth elongated wood y structural member 7 5 ; and panel means connecting the upper ends 64 and 66 of the fifth elongated wood z structural member 11 5 and the fifth elongated wood y structural member 7 5 and the upper ends 62 of the second and third elongated wood x structural members 2 2 and 2 3 . the building structure with a peaked roof is illustrated in fig3 - 14 . this structure differs only with the previously shed roofed structure in that two additional third series rigid connectors illustrated in fig1 are required and two additional second series rigid connectors are added . any of the second series rigid connectors previously described may be used . the peaked roof building structure 69 illustrated in fig3 in addition to the description for the shed roof structure includes : a seventh elongated wood x structural member 2 7 disposed adjacent the upper ends 62 of the second and third elongated wood x structural members 2 2 and 2 3 ; an eighth elongated wood x structural member 2 8 disposed from and parallel to the sixth and seventh elongated wood structural x members 2 6 and 2 7 ; a sixth elongated wood y structural member 7 6 having upper and lower ends 66 and 67 and intersecting the seventh and eighth elongated wood x structural members 2 7 and 2 8 and the fifth elongated wood z structural member 11 5 , and the lower end 67 being disposed in close association with the upper enlongated 62 of the second elongated wood x structural member 2 2 ; a sixth elongated wood z structural member 11 6 having upper and lower ends 64 and 65 and intersecting the seventh elongated wood x structural member 2 7 and the fifth elongated wood y structural member 7 5 , and disposed in close association with the upper end 62 of the third elongated wood x structural member 2 3 ; a third , third series rigid connector means 15 3 &# 34 ; connected to and forming a rigid interconnection with the seventh elongated wood x structural member 2 7 , the second elongated wood x structural member 2 2 and the sixth elongated wood y structural member 7 6 ; a fourth , third series rigid connector means 15 4 &# 34 ; connected to and forming a rigid interconnection with the seventh elongated wood x structural member 2 7 , the third elongated wood x structural member 2 3 , and the sixth elongated wood z structural member 11 6 ; a ninth , second series rigid connector means 15 9 connected to and forming a rigid interconnection with the eighth elongated wood x structural member 2 8 , the sixth elongated wood y structural member 7 6 and the fifth elongated wood z structural member 11 5 ; a tenth , second series rigid connector means 15 10 connected to and forming a rigid interconnection with the eighth elongated wood x structural member 2 8 , the fifth elongated wood y structural member 7 5 and the sixth elongated wood z structural member 11 6 ; and fastener means 55 attaching the third and fourth , third series rigid connectors 15 3 &# 34 ; and 15 4 &# 34 ; and the ninth and tenth second series rigid connectors 15 9 and 15 10 to the elongated wood structural members 2 7 , 2 8 , 7 6 , 11 6 , 11 5 , and 7 5 . surprisingly , the first , second , and third series connectors 15 &# 39 ;, 15 , and 15 &# 34 ; are all constructed from the same sheet metal blank 16 illustrated in fig2 . the second series rigid connector 15 illustrated in fig1 , 15 and 16 is constructed from sheet metal blank 16 illustrated in fig2 as follows : xy support side member 17 is bent up 90 ° along bend line 73 , y seat member 21 is bent up 90 ° along bend line 74 , y side member 22 is bent up 90 ° along bend line 75 , z seat member 23 is bent up 90 ° along bend line 76 and z side member 24 is bent up 90 ° along bend line 77 . first series rigid connector 15 &# 39 ; illustrated in fig1 - 21 is constructed from sheet metal blank 16 illustrated in fig2 in the exact same manner as second series rigid connector 15 explained above except that no bend is made along bend line 73 . third series rigid connector 15 &# 34 ; illustrated in fig1 is constructed from sheet metal blank 16 illustrated in fig2 in the exact same manner as second series rigid connector 15 except that variable bends may be made in either bend line 78 or 79 depending on the slope required as in the sloping roof for the greenhouse 69 illustrated in fig3 . first modified , second series rigid connector 15 &# 34 ;&# 39 ; illustrated in fig8 - 30 is constructed from sheet metal blank 80 illustrated in fig3 as follows : xy support side member 17 &# 34 ;&# 39 ; is bent up 90 ° along bend line 73 &# 34 ;&# 39 ;, y seat member 21 &# 34 ;&# 39 ; is bent up 90 ° along bend line 74 &# 34 ;&# 39 ;, y side member 22 &# 34 ;&# 39 ; is bent up 90 ° along bend line 75 &# 34 ;&# 39 ;, z seat member 23 &# 34 ;&# 39 ; is bent up 90 ° along bend line 76 &# 34 ;&# 39 ; and z side member 24 &# 34 ;&# 39 ; is bent up 90 ° along bend line 77 &# 34 ;&# 39 ;. y side extension 37 is then bent down 90 ° along bend line 81 , z side extension 38 is then bent down 90 ° along bend line 82 , and blank 80 is cut along cut line 83 and cut line 84 . second modified , second series rigid connector 15 &# 34 ;&# 34 ; illustrated in fig2 - 27 is constructed from the same sheet metal blank 80 illustrated in fig3 as first modified , second series rigid connector 15 &# 34 ;&# 39 ;, except that no cuts are made along line cut lines 83 and 84 , nor is any bend made along bend lines 81 and 82 . instead , y side extension interlock 43 is bent down 90 ° along bend line 85 and z side extension interlock 44 is bent down 90 ° along bend line 86 . third modified , second series rigid connector 15 &# 34 ;&# 39 ;&# 34 ; illustrated in fig3 - 34 is constructed from sheet metal blank 87 illustrated in fig3 as follows : xy support side member 17 &# 34 ;&# 39 ;&# 34 ; is bent up 90 ° along bend line 73 &# 34 ;&# 39 ;&# 34 ;, y seat member 21 &# 34 ;&# 39 ;&# 34 ; is bent up 90 ° along bend line 74 &# 34 ;&# 39 ;&# 34 ;, y side member 22 &# 34 ;&# 39 ;&# 34 ; is bent up 90 ° along bend line 75 &# 34 ;&# 39 ;&# 34 ;, z seat member 23 &# 34 ;&# 39 ;&# 34 ; is bent up 90 ° along bend line 76 &# 34 ;&# 39 ;&# 34 ; and z side member 24 &# 34 ;&# 39 ;&# 34 ; is bent up 90 ° along bend line 77 &# 34 ;&# 39 ;&# 34 ;. in addition , y side member extension x structural member interlock 49 is bent down 90 ° along bend line 88 , and tabs 89 and 90 are bent down 90 ° along bend lines 91 and 92 . fasteners 124 attach tabs 89 and 90 to elongated wood structural member 2 . fourth modified , second series rigid connector 15 &# 34 ;&# 39 ;&# 34 ; illustrated in fig3 - 41 is constructed from sheet metal blank 93 illustrated in fig4 as follows : xy support side member 17 &# 34 ;&# 34 ;&# 34 ; is bent down 90 ° along bend line 73 &# 34 ;&# 34 ;&# 34 ;, y seat member 21 is bent down 90 ° along bend line 74 &# 34 ;&# 34 ;&# 34 ;, y side member 22 &# 34 ;&# 34 ;&# 34 ; is bent down 90 ° along bend line 75 &# 34 ;&# 34 ;&# 34 ;, z seat member 23 &# 34 ;&# 34 ;&# 34 ; is bent down 90 ° along bend line 76 &# 34 ;&# 34 ;&# 34 ; and z side member 24 &# 34 ;&# 34 ;&# 34 ; is bent down 90 ° along bend line 77 &# 34 ;&# 34 ;&# 34 ; in addition , y side extension overlap 57 is bend up 45 ° along bend line 94 and z side extension overlap 58 is bent up 45 ° along bend line 95 . fourth modified , first series rigid connector 15 &# 39 ;&# 34 ;&# 34 ;&# 34 ; as illustrated in fig4 - 45 is constructed from sheet metal blank 93 illustrated in fig4 in the exact same manner as fourth modified , second series rigid connector 15 &# 34 ;&# 34 ;&# 34 ; explained above except that no bend is made along bend line 73 &# 34 ;&# 34 ;&# 34 ; nor is any bend made along bend lines 94 and 95 . the description of fourth modified , first series rigid connector 15 &# 39 ;&# 34 ;&# 34 ;&# 34 ; as illustrated in fig4 - 45 is identical to the description of fourth modified , second series rigid connector 15 &# 34 ;&# 34 ;&# 34 ; illustrated in fig3 - 41 except for the absence of bending along bend line 73 &# 34 ;&# 34 ;&# 34 ;, and bend lines 57 and 58 . numbering of rigid intersection connection 1 &# 39 ;&# 34 ;&# 34 ;&# 34 ; in fig4 - 45 is identical to the numbering of rigid intersection connection 1 &# 34 ;&# 34 ;&# 34 ; in fig3 - 41 except that the designation (&# 39 ;&# 34 ;&# 34 ;&# 34 ;) is set forth after the numbers in fig4 - 45 instead of the designation (&# 34 ;&# 34 ;&# 34 ;) set forth after the numbers in fig3 - 41 . rigid intersection connections 1 &# 34 ;&# 34 ;&# 34 ; and 1 &# 39 ;&# 34 ;&# 34 ;&# 34 ; are used in the construction of the furniture structure 68 sometimes referred to as the &# 34 ; bunk bed &# 34 ; in fig3 - 38 . referring to fig4 - 51 , a rigid angle 96 is illustrated which is ancillary to the structures of the present invention based on rectangles rather than triangles . the rigid angle 96 consists of a first side 97 , connected at right angles to a second side 98 and formed with a first member 99 integrally connected to first side 97 along bend line 101 and a second member 100 integrally connected to second side 98 along bend line 102 and constructed from a sheet metal blank 103 illustrated in fig4 . attachment in furniture products is preferably by screws or lag bolts 104 . construction of the building structure 69 such as a greenhouse illustrated in fig3 - 14 is generally as set forth above , but with the following additional description . a plurality of intermediate elongated wood x structural members 2 9 are attached at their bottom ends to elongated wood y structural members 7 1 and 7 2 at spaced intervals by a plurality of first series rigid connectors 15 &# 39 ; and at their top ends to sixth and seventh elongated x structural members 2 6 and 2 7 by third series rigid connectors 15 &# 34 ;. a door 105 may be hung in door frame members 106 and 107 in which their bottom ends are attached to first elongated wood z structural member 11 1 by first series rigid connectors 15 &# 39 ; and their top ends by rigid angles 96 . in addition to the roof structure previously described , a plurality of intermediate rafters or intermediate elongated wood z structural members 11 7 and intermediate elongated wood y structural members 7 7 may be spaced at intervals with their lower ends connected to sixth and seventh elongated wood x structural members 2 6 and 2 7 by third series rigid connectors 15 &# 34 ; and their top ends connected to eighth elongated wood x structural member 2 8 by second series rigid connectors 15 . a movable roof vent 109 may be located in the roof structure . preferably the movable roof vent is controlled for opening and closing by a temperature sensitive means so that a more even temperature may be maintained in the greenhouse . movable roof vent 109 may be framed by framing member 112 . preferably movable lower side vent 108 is also installed in the side or rear of the greenhouse 69 to admit cool fresh air when needed . an alternate form of construction is illustrated in fig8 , 13 and 14 . the rear elevation of the building structure illustrated in fig8 may be constructed with a window 114 set in window frames 113 and a movable vent 115 installed below window 114 . to strengthen the building structure , fire stops 116 may be installed as required and connected to the wood members by either first series rigid connectors 15 &# 39 ; or second series rigid connectors 15 as required . door 105 may be one piece or it may be a two piece &# 34 ; dutch door &# 34 ; divided into upper and lower portions 110 and 111 . a basic version of furniture structure 68 , also known as a bunk bed was previously described . fig3 illustrates a more commercial form having ladder means 119 including an intermediate elongated wood structural member 2 10 connected at its upper end to third elongated wood y structural member 7 3 by first series rigid connector 15 &# 39 ; and including a plurality of ladder steps 120 . railings 121 may be connected to the upper ends of elongated wood x structural members 2 1 , 2 2 , 2 3 , 2 4 , and 2 10 by rigid angles 96 , first series rigid connectors 15 &# 39 ;, and second series rigid connectors 15 as required . load ledgers 122 may be added to support the edges of the bed frame , book shelves , desks and other loads to be held by the furniture structure . first elongated wood y structural member 7 1 may be removably attached to fifth rigid connector 15 4 &# 34 ;&# 34 ;&# 34 ; and rigid angle 96 for ease in entering and exiting the furniture structure . research has indicated that college students assigned to small dormitory rooms or renting private rooms have very limited floor area in which to place their bed , desk and book storage unit . a combination bed and study unit illustrated 123 in fig3 and 38 using the rigid connectors previously described in this application was the structure which resulted from this study . the combination bed and study unit includes : a desk unit 117 connected to the first and second elongated wood x structural members 2 1 and 2 2 ; a storage unit 118 connected to the third and fourth elongated wood x structural members 2 3 and 2 4 ; ladder means 119 connected to the third and fourth elongated wood and structural members 2 10 ; and the fastener means 55 are threaded for installation and disassembly of the rigid connectors 15 , and 15 &# 39 ;, rigid angles 96 , and elongated wood structural members as set forth in fig3 - 38 of the drawings . for purposes of clarity and convenience , no connectors were drawn on fig3 and 38 . it is to be understood that the same connectors illustrated on fig3 are used in the construction of the bed and study units illustrated in fig3 and 38 . | 8 |
fig1 is a block diagram of a system environment 100 for radiation treatment planning and delivery , in accordance with an embodiment of the invention . as shown , the system environment 100 includes an imaging engine 102 , a treatment planning engine 104 , and a treatment delivery engine 106 . the imaging engine 102 provides imaging data associated with patients needing radiation treatment . the imaging data may include visual representations of the interior of a patient &# 39 ; s body for medical purposes . in one embodiment , the imaging engine 102 generates the visual representation through one or more scanning techniques , such as computed tomography ( ct ), nuclear medicine including positron emission tomography ( pet ), and magnetic resonance imaging ( mri ). in alternative embodiments , the imaging engine 102 receives the imaging data from external sources and stores the imaging data in an internal data base . the imaging engine 102 transmits the imaging data associated with the patient to the treatment planning engine 104 for the purposes of generating a radiation treatment outcome for the patient . the treatment planning engine 104 processes imaging data associated with a patient and recommends different treatment outcomes to the patient &# 39 ; s physician , thus enabling the physician to efficiently identify the optimal treatment outcome for the patient . the treatment planning engine 104 includes a patient data module 108 , a notification module 110 , a contour definition module 112 , an outcome recommendation module 114 , a user interface ( ui ) module 116 , a patient data store 118 , and an outcome store 120 . the patient data store 118 and the outcome store 120 may each be , or include , one or more tables , one or more relational databases , and / or one or more multi - dimensional data cubes . further , though illustrated as a single component , the patient data store 118 and the outcome store 120 may each be a plurality of databases , such as a database cluster , which may be implemented on a single computing device or distributed between a number of computing devices or memory components . further , the various modules and data stores included in the treatment planning engine 104 may be physically co - located within one computing system or , alternatively , may be disparately located across multiple computing systems . the patient data module 108 manages patient data and stores such data in the patient data store 118 . in one embodiment , each patient has a unique identifier such that the patient data belonging to a given patient is stored in conjunction with the unique identifier . patient data includes , but is not limited to , imaging data received from the imaging engine 102 , electronic medical records ( emrs ) associated with the patient , information related to the patient &# 39 ; s treatment team ( e . g ., physician ), and the treatment machines ( e . g ., radiation therapy machine ) that is likely to be used for the patient . with regards to imaging data , the patient data module 108 may automatically receive new imaging data from the imaging engine 102 or , alternatively , may periodically request new imaging data from the imaging engine 102 . when new imaging data associated with a patient is stored in the patient data store 118 , the notification module 110 transmits a notification to the patient &# 39 ; s physician informing the physician that the data is available for further evaluation . in one embodiment , the notification module 110 regularly polls the patient data store 118 for new patient data . in another embodiment , the notification module 110 polls the patient data store 118 for new patient data when a physician accesses the treatment planning engine 104 to determine whether new imaging data has been received for any of the physician &# 39 ; s patients . the notification transmitted to the physician may be an email , a message transmitted over a short messaging service , or a push notification transmitted to the physician via a mobile application . the notification may include a link to automatically launch the contour definition module 112 . the contour definition module 112 detects the contours identifying the three - dimensional tumor volumes captured in the imaging data and the anatomical structures located in the same region as the tumor volumes . the contour definition module 112 may automatically generate contours of the tumor volume and anatomical structures using contouring techniques known in the field . in addition , the contour definition module 112 may automatically generate contours of the tumor volume and anatomical structures using historical contours created for the current patient or a different patient having similar imaging data stored in the patient data store 118 . the contour definition module 112 may provide suggested contours to the physician based on previously created contours stored in the patient data store 118 . the contour definition module 112 determines the suggested contours by comparing the image data associated with the current patient with image data for which contours were previously determined and stored in the patient data store 118 . when the image data associated with the current patient is statistically similar to image data stored in the patient data store 118 , the contour definition module 112 suggests the previously determined contours for the statistically similar image data to the physician . in operation , the contour definition module 112 leverages the outcome recommendation module 114 , i . e ., the mapping between contours and treatment outcomes , to provide the statistical basis for providing alternate contours for the tumor volume and the neighboring anatomical structures ( also referred to herein as the “ planning tumor volume ( ptv )”). in this embodiment , the contour definition module 112 utilizes definitions of the gross tumor volume ( gtv ) and / or clinical tumor volume ( ctv ), where the physician ( or alternatively an automated algorithm ) contours what is determined with high - confidence to be tumor . this gtv or ctv contour is the minimum suggested ptv size . a treatment outcome is created from this minimum accepted ptv size based on the mappings between contours and treatment outcomes 114 . the contour definition module 112 then creates series of uniform or non - uniform expansions of the ptv and maps these expansions of the ptv to outcomes based on the outcome results provided by the outcome recommendation module 114 . to reduce the potential number of contour suggestions , the contour definition module 112 may be configured with a threshold such that only contours that result in changes to treatment outcomes exceeding the threshold are presented to the physician . similarly , if a suggested contour results in a treatment outcome that is statistically similar to a contour of a previously treated patient , this contour may be presented with an additional indication that it matches a previous patient . in one embodiment , a metric of similarity may be euclidean distance between predicted treatment outcomes ( as output by the outcome recommendation module 114 ) and the previously - treated patient outcomes , or other distance - based metrics known in the art . a preferred method to calculate this distance - based similarity metric , s , is through the method of least squares between the predicted dose to the new patient based on each contour expansion , dnew , and the dose given to a previous patient , dprev : s =√{ square root over (( d new − d prev ) 2 )}. in this preferred method , if s is less than the threshold , the contour is recommended . here , the threshold may be chosen manually ( based on physician - preferred fidelity ), or may be learned from the variation in predicted outcomes across the cross - validated kth model constructed from the kth fold of the training data set . if the physician chooses to accept a suggested contour , then the predicted treatment outcome is presented to the physician . the contour definition module 112 also enables the physician to manually create and / or edit the contours of the tumor volume and anatomical structures . in operation , the contour definition module 112 provides a graphical user interface that includes a visual representation of the imaging data associated with the patient and one or more contouring tools that allow the physician to create or edit contours . fig2 is an exemplary user interface for defining contours on patient image data , in accordance with an embodiment of the invention . as shown , the user interface includes a visual representation 202 of imaging data associated with a given patient . the user interface also includes contouring controls 204 that enable a physician to draw the contours around tumor volumes and neighboring anatomical structures . in the illustrated example , the region 206 is enclosed by a contour manually created by the physician using the contouring controls 204 . returning to fig1 , as the contour definition module 112 detects contours ( automatically or manually defined ), the contour definition module 112 transmits requests to the outcome recommendation module 114 to generate recommended treatment outcomes for the current patient based on the detected contours . the outcome recommendation module 114 performs a multi - feature comparative analysis between the current patient and previous patients to identify previously - administered treatment outcomes stored in the outcome store 120 that are applicable to the current patient . the outcome store 120 stores information associated with previous treatment outcomes such as , for example , previously planned radiation treatments that were approved for use on patients by medical personnel , or previously planned radiation treatments that were used on patients by medical personnel . in one embodiment , each treatment outcome specifies the dose of radiation that was administered to tumor volumes and any neighboring anatomical structure during the radiation treatment . in another embodiment , each treatment outcome specifies a probability of control for tumor volumes and / or probability of toxicity for any neighboring anatomical structure resulting from the radiation treatment . the outcome store 120 may also include a medical data database that includes medical data associated with the previously planned radiation treatments . in some embodiments , the outcome store 120 includes a processed database configured to store selected data that have been extracted and transformed from a medical data database and stored in the processed database . the outcome recommendation module 114 compares features extracted from patient data associated the current patient with features and / or outcomes extracted from data associated with other patients , as stored in the patient data store 118 , to identify recommended treatment outcomes for the current patient . the features associated with patient data may include a physics parameter , a treatment type parameter , a patient image parameter , and / or a disease parameter . in one embodiment , physics parameters may be , or include , penumbra , aperture , incident angle , beam energy , radiation type , depth of structure , and / or existence of bolus . treatment type parameters may be , or include , fractionation schedule , treatment margin , number of beams / arcs , interpretation of contours , and / or the clinicians who are part of the team creating the radiation treatment outcome . patient image parameters may be , or include , distance , volume , geometric relationship , and / or the importance of structures and surrounding structures . disease parameters may be , or include , disease stage , prior or post treatment therapy , prior radiation therapy , prior radiation damage to nearby tissue , disease type , disease histology , extent of the disease , and / or prior disease . any number of different types of techniques and / or algorithms may be utilized to identify the recommended treatment outcomes by comparing features of the current patient with previous patients , and may include statistical techniques , pattern - matching techniques , artificial intelligence techniques , and / or the like . in some embodiments , the outcome recommendation module 114 may include a search engine , a query module , and / or a database management component . identifying previously administered treatment outcomes based on a multi - feature comparative analysis , as performed by the outcome recommendation module 114 may be performed with the techniques described above , and is further described in u . s . patent application ser . no . 14 / 310 , 925 , filed on jun . 20 , 2014 , which is hereby incorporated by reference in its entirety . the outcome recommendation module 114 presents the recommended treatment outcomes for the current patient to the physician via the user interface ( ui ) module 116 . the ui module 116 generates a visual representation of each recommended treatment outcome . in one embodiment , the ui module 116 associates different visual indicators with the radiation doses delivered during the execution of the treatment outcome . as discussed above , each treatment outcome specifies the dose of radiation treatment delivered to one or more tumor volumes and nearby anatomical structures . for each tumor volume or anatomical structure , the ui module 116 determines a visual indicator for the corresponding dose based on the risk level associated with the dose . when the treatment outcome specifies a dose that delivers a larger than recommended amount of radiation to an organ at risk , the visual representation of the dose to that organ may be highlighted or color coded to represent the high risk . conversely , when the treatment outcome specifies a dose that delivers an acceptable amount of radiation to an organ at risk , the visual representation of the dose to that organ may be highlighted or color coded to represent the relatively lower risk . such visual indicators enable the physician viewing and evaluating the recommended treatment outcomes to quickly determine whether a given treatment outcome is optimal for the current patient . fig3 is an exemplary user interface generated by the ui module 116 for providing visual representations of recommended treatment outcomes , in accordance with an embodiment of the invention . as shown , the user interface includes a structure column 302 that lists each of the structures and tumors identified by the contour . the user interface also includes one or more outcome columns , such as outcome column 304 and outcome column 306 . each outcome column is associated with a different recommended treatment outcome and lists , for each structure and tumor in the structure column 302 , the dose of radiation , if any , to be delivered per the treatment outcome . further , as illustrated , the doses of radiation in the outcome columns are color based on the risk level associated with the dose . returning to fig2 , upon evaluating the recommended treatment outcomes , the physician may select one of the recommended treatment outcomes via a control provided by the user interface module 116 . alternatively , when none of the recommended outcomes is deemed optimal by the physician , the physician may edit the contours of the tumor volume and neighboring anatomical structures via the contour definition module 112 . in response to the contours being edited , the contour definition module 112 transmits another request to the outcome recommendation module 114 to generate new recommended treatment outcomes that are subsequently presented to the physician . in such a paradigm , the physician is able to adjust contours and in real - time evaluate the impact on the tumor volume and the toxicity risk to the nearby anatomical structures . when the physician is satisfied with a given recommended outcome , the physician selects the treatment outcome for the current patient . in response , the outcome recommendation module 114 stores the contour in conjunction with the selected treatment outcome in the patient data store 118 . in addition , the outcome recommendation module 114 transmits a notification to the treatment delivery engine 106 indicating that the physician has selected a treatment outcome for the patient . the treatment delivery engine 106 enables a dosimetrist or physicist to create a patient - specific treatment delivery plan based on the treatment outcome selected by the physician (“ the selected treatment outcome ”). in operation , the treatment delivery engine 106 transmits a notification , such as an email or a push notification on a mobile application , to the dosimetrist or physicist indicating that the physician selected a treatment outcome for the patient . the notification may optionally include a representation of the selected treatment outcome and / or a link to access the selected treatment outcome . the dosimetrist or physicist evaluates the selected treatment outcome and creates a treatment delivery plan that is specific to the patient . specifically , the selected treatment outcome informs the dosimetrist or physicist of the clinically appropriate profile of radiation to be delivered including but not limited to radiation intensity , angle of delivery , multi - leaf collimator status , temporal fractionation , anatomy , presentation of the tumor , anticipated treatment outcomes , prior clinical staff , and anticipated treatment course . based on the treatment delivery plan , the treatment delivery engine 106 generates a patient - specific delivery template that configures a radiation therapy machine for delivering the radiation treatment to the patient . in one embodiment , the treatment delivery engine 106 interacts with a therapy machine control interface that is configured with standard communication protocols . the patient - specific delivery template identifies the tumor volumes as well as the anatomical structures that are to receive radiation treatment . for each volume or structure , the delivery template may also specify the percentage volume that is to receive radiation treatment and the dose of treatment to be delivered . in addition , this template may specify the optimization objectives , treatment protocols , beam orientations , collimator / multi - leaf collimator positions , couch positions , and other parameters known in the art . table 1 illustrates an exemplary patient - specific delivery template . the treatment planning engine 104 enables physician directed treatment planning where the physician is able to adjust contours around the tumor volume and in real - time or near real - time evaluate the impact on the tumor volume and the toxicity risk to the nearby anatomical structures . fig4 is a state diagram 400 illustrating the various stages of physician directed radiation treatment planning using the treatment planning engine 104 , in accordance with an embodiment of the invention . in state 402 , patient data associated with a patient who is to receive radiation treatment is collected . such patient data may include imaging data , electronic medical records and information related to the anticipated therapy system . in state 404 , the patient &# 39 ; s physician , using the contour definition module 112 , defines the contours of the tumor volumes and / or the anatomical structures included in the imaging data that are to receive radiation treatment . in state 406 , the physician evaluates recommended treatment outcomes recommended by the outcome recommendation engine 114 to determine whether any of the treatment outcomes are suitable for the patient . the physician iterates through states 404 and 406 until the outcome recommendation engine 114 presents a suitable treatment outcome . in state 408 , the physician selects the treatment outcome for the patient via the outcome recommendation engine 114 , which transmits a notification to the dosimetrist . in state 410 , the dosimetrist evaluates the selected treatment outcome and creates a treatment delivery plan that is specific to the patient . in state 412 , a radiation therapy machine delivers radiation treatment to the patient based on the delivery plan created by the dosimetrist . fig5 is a flow diagram 500 illustrating the steps for physician directed radiation treatment planning , in accordance with an embodiment of the invention . other embodiments may perform the steps of the process illustrated in fig5 in different orders and can include different , additional and / or fewer steps . the process may be performed by any suitable entity , such as the treatment planning engine 104 . the treatment planning engine 104 receives 502 patient data , including , but not limited to , imaging data , data accumulated from the medical record , associated with a patient , and information related to the anticipated therapy system . the treatment planning engine 104 may automatically receive imaging data from the imaging engine 102 or , alternatively , may periodically request imaging data from the imaging engine 102 . imaging data associated with a patient includes visual representations of the interior of a patient &# 39 ; s body or a portion thereof . the treatment planning engine 104 detects 504 , based on the imaging data , contours identifying the three - dimensional tumor volumes and the anatomical structures near the tumor volumes . in one embodiment , the treatment planning engine 104 enables the patient &# 39 ; s physician to create and / or edit the contours of the tumor volume and anatomical structures via a graphical user interface . in alternate embodiments , the treatment planning engine 104 automatically creates the contours using pre - existing contouring techniques . the treatment planning engine 104 recommends 506 treatment outcomes for the patient based on the detected contours . in one embodiment , the treatment planning engine 104 performs a multi - feature comparative analysis between the current patient and previous patients to identify treatment outcomes stored in the outcome store 120 that are applicable to the current patient . the treatment planning engine 104 presents 508 the recommended treatment outcomes to the physician via a user interface that generates a visual representation of each recommended treatment outcome . the treatment planning engine 104 determines 510 whether the contour identifying the three - dimensional tumor volumes and the anatomical structures has changed . specifically , the physician may edit the contour using one or more contouring tools . if the contour changes , then the treatment planning engine 104 re - computes 506 new treatment outcome recommendations based on the updated contours . if the contour does not change , then the treatment planning engine 104 determines 512 whether the physician selected a given recommended treatment outcome . the treatment planning engine 104 continues to loop through 510 - 512 until the physician selects a plan . when the patient selects a treatment outcome , the treatment planning engine 104 provides 514 the selected treatment outcome to the treatment delivery engine 106 for the purposes of delivering radiation treatment to the patient according to the selected outcome . the treatment delivery engine 106 enables a dosimetrist or physicist to create a patient - specific treatment delivery plan based on the treatment outcome selected by the physician . fig6 is a block diagram illustrating components of an example machine able to read instructions from a machine - readable medium and execute them in a processor ( or controller ). the computer system 600 can be used to execute instructions 624 ( e . g ., program code or software ) for causing the machine to perform any one or more of the methodologies ( or processes ) described herein . in alternative embodiments , the machine operates as a standalone device or a connected ( e . g ., networked ) device that connects to other machines . in a networked deployment , the machine may operate in the capacity of a server machine or a client machine in a server - client network environment , or as a peer machine in a peer - to - peer ( or distributed ) network environment . each of the various engines and modules described herein may be implemented using all or some of the components of the computer system 600 . the machine may be a server computer , a client computer , a personal computer ( pc ), a tablet pc , a set - top box ( stb ), a smartphone , an internet of things ( iot ) appliance , a network router , switch or bridge , or any machine capable of executing instructions 624 ( sequential or otherwise ) that specify actions to be taken by that machine . further , while only a single machine is illustrated , the term “ machine ” shall also be taken to include any collection of machines that individually or jointly execute instructions 624 to perform any one or more of the methodologies discussed herein . the example computer system 600 includes one or more processing units ( generally processor 602 ). the processor 602 is , for example , a central processing unit ( cpu ), a graphics processing unit ( gpu ), a digital signal processor ( dsp ), a controller , a state machine , one or more application specific integrated circuits ( asics ), one or more radio - frequency integrated circuits ( rfics ), or any combination of these . the computer system 600 also includes a main memory 604 . the computer system may include a storage unit 616 . the processor 602 , memory 604 and the storage unit 616 communicate via a bus 608 . in addition , the computer system 600 can include a static memory 606 , a display driver 660 ( e . g ., to drive a plasma display panel ( pdp ), a liquid crystal display ( lcd ), or a projector ). the computer system 600 may also include an alphanumeric input device 662 ( e . g ., a keyboard ), a cursor control device 614 ( e . g ., a mouse , a trackball , a joystick , a motion sensor , or other pointing instrument ), a signal generation device 618 ( e . g ., a speaker ), and a network interface device 620 , which also are configured to communicate via the bus 608 . the storage unit 616 includes a machine - readable medium 622 on which is stored instructions 624 ( e . g ., software ) embodying any one or more of the methodologies or functions described herein . the instructions 624 may also reside , completely or at least partially , within the main memory 604 or within the processor 602 ( e . g ., within a processor &# 39 ; s cache memory ) during execution thereof by the computer system 600 , the main memory 604 and the processor 602 also constituting machine - readable media . the instructions 624 may be transmitted or received over a network 626 via the network interface device 620 . while machine - readable medium 622 is shown in an example embodiment to be a single medium , the term “ machine - readable medium ” should be taken to include a single medium or multiple media ( e . g ., a centralized or distributed database , or associated caches and servers ) able to store the instructions 624 . the term “ machine - readable medium ” shall also be taken to include any medium that is capable of storing instructions 624 for execution by the machine and that cause the machine to perform any one or more of the methodologies disclosed herein . the term “ machine - readable medium ” includes , but not be limited to , data repositories in the form of solid - state memories , optical media , and magnetic media . the foregoing description of the embodiments of the invention has been presented for the purpose of illustration ; it is not intended to be exhaustive or to limit the invention to the precise forms disclosed . persons skilled in the relevant art can appreciate that many modifications and variations are possible in light of the above disclosure . some portions of this description describe the embodiments of the invention in terms of algorithms and symbolic representations of operations on information . these algorithmic descriptions and representations are commonly used by those skilled in the data processing arts to convey the substance of their work effectively to others skilled in the art . these operations , while described functionally , computationally , or logically , are understood to be implemented by computer programs or equivalent electrical circuits , microcode , or the like . furthermore , it has also proven convenient at times , to refer to these arrangements of operations as modules , without loss of generality . the described operations and their associated modules may be embodied in software , firmware , hardware , or any combinations thereof . any of the steps , operations , or processes described herein may be performed or implemented with one or more hardware or software modules , alone or in combination with other devices . in one embodiment , a software module is implemented with a computer program product comprising a computer - readable medium containing computer program code , which can be executed by a computer processor for performing any or all of the steps , operations , or processes described . embodiments of the invention may also relate to an apparatus for performing the operations herein . this apparatus may be specially constructed for the required purposes , and / or it may comprise a general - purpose computing device selectively activated or reconfigured by a computer program stored in the computer . such a computer program may be stored in a non - transitory , tangible computer readable storage medium , or any type of media suitable for storing electronic instructions , which may be coupled to a computer system bus . furthermore , any computing systems referred to in the specification may include a single processor or may be architectures employing multiple processor designs for increased computing capability . embodiments of the invention may also relate to a product that is produced by a computing process described herein . such a product may comprise information resulting from a computing process , where the information is stored on a non - transitory , tangible computer readable storage medium and may include any embodiment of a computer program product or other data combination described herein . finally , the language used in the specification has been principally selected for readability and instructional purposes , and it may not have been selected to delineate or circumscribe the inventive subject matter . it is therefore intended that the scope of the invention be limited not by this detailed description , but rather by any claims that issue on an application based hereon . accordingly , the disclosure of the embodiments of the invention is intended to be illustrative , but not limiting , of the scope of the invention , which is set forth in the following claims . | 0 |
[ 0017 ] fig1 shows a sectional view of an ic socket 1 according to an exemplary embodiment of the present invention . the ic socket 1 comprises an insulative housing 2 , a metal plate 20 , and a loading plate 19 . the metal plate 20 supports the housing 2 from the side of a circuit board mounting surface 10 on the housing 2 . the loading plate presses an ic package 30 onto the housing 2 . the metal plate 20 and the loading plate 19 may be formed , for example , by stamping and forming . the housing 2 of the ic socket 1 is rectangular . an ic package mounting surface 6 is provided on a first side of the housing 2 , and the circuit board mounting surface 10 is provided on the other side of the housing 2 . the ic package mounting surface 6 is surrounded by walls 4 . the circuit board mounting surface 10 is configured to be mounted on a circuit board 8 . contact housing apertures 12 , which will be described later ( refer to fig2 ), are formed through the housing 2 from the first side , which is the ic package mounting surface 6 ( or upper surface as shown in fig2 ), to the other side or board mounting surface 10 , on which a circuit board 8 is mounted . the contact housing apertures 12 are arranged in a matrix . contacts 14 are press fit and fixed within each of the contact housing apertures 12 . a step 16 is formed along the entire periphery of the lower surface of the housing 2 . an opening 18 is formed in the metal plate 20 for receiving the lower portion of the housing 2 , formed by the step 16 . when the metal plate 20 and the housing 2 are assembled together , the edge of the plate 20 adjacent to the opening 18 abuts the step 16 in the housing 2 . a support portion 28 is formed at one end of the metal plate 20 , for example by bending . the support portion holds a rotating axis 26 of a lever 22 that operates the loading plate 19 . a crank shaped operating portion 24 is formed on the rotating axis 26 to urge the loading plate 19 downward when it is rotated . a bearing 32 is formed at the end of the loading plate 19 opposite from the end of the lever 22 . the metal plate 20 is provided with claws 34 for rotatably engaging an aperture 32 a formed through the bearing 32 . this structure enables the loading plate 19 to rotate in the direction indicated by arrow 36 of fig1 . a tongue piece 38 , which is to be pressed by the operating portion 24 , is formed at the end of the loading plate 19 opposite the end of the bearing 32 . in addition , a curved portion 40 , which curves downward in fig1 is formed at the central portion of the loading plate 19 . when the loading plate 19 is closed by rotating the lever 22 and is in the position shown in fig1 the curved portion 40 presses the ic package 30 ( shown by broken lines in fig1 ) toward the housing 2 . thus , electrodes 31 ( contacts ) of the ic package 30 , that is , the lga or the bga , electrically connect with contact arms 46 of the contacts 14 . next , the shape and the mounting structure of the contacts 14 will be described with reference to fig2 through fig4 b . fig2 is a detailed view of the area 42 indicated in fig1 showing only the housing 2 and the contacts 14 . fig3 a , 3b , and 3 c show the contact 14 , which is utilized in the ic socket of the present invention . fig3 a is a left side view , fig3 b is a front view , and fig3 c is a right side view of the contact 14 of fig2 . fig4 a is a plan view , and fig4 b is a bottom view of the contact 14 . first , with reference to fig2 it is clearly illustrated that the contacts 14 are engaged within the contact housing apertures 12 from the ic package mounting surface 6 to the circuit board mounting surface 10 of the housing 2 . each of the contacts 14 in the illustrated exemplary embodiment , as more clearly shown in fig3 a , 3b , 3 c , 4 a , and 4 b , is constructed by punching and bending a single metal plate . each of the contacts 14 comprises a base portion 44 ( also referred to as a fixing portion ) that extends in the vertical direction of fig3 a , 3b , and 3 c ; a contact arm 46 that extends from the base portion 44 upwardly ; and a terminal portion 48 that extends form the lower end of the base portion 44 downwardly toward the circuit board 8 . the contact arm 46 , as best shown in fig3 a and 3b extends from the side of the base portion 44 , and is bent along a vertical line to overlap the base portion 44 , and extending upwardly beyond the base portion 44 . note that the expressions up , down , left , and right will be employed to indicate those directions in each figure , to facilitate the description . the shapes of each portion of the contact 14 will be described in further detail . as most clearly shown in fig3 c , engagement protrusions 56 ( 56 a , 56 b , 56 c , and 56 d ), for frictionally engaging inner walls 54 of the contact housing apertures 12 . the engagement protrusions 56 are formed at the top and bottom of the base portion 44 on both side edges 50 and 52 thereof . the contact arm 46 is bent from the side edge 52 of the base portion 44 at a bend 58 . the contact arm 46 extends further upward from the bend 58 , and is bent toward the left in fig3 b . a contact point 60 , which has an arcuate upper surface for connecting with the contacts of the ic package 30 , are provided at the distal ends of the contact arms 46 . the terminal portion 48 comprises : a solder ball pad 62 , to which a solder ball 64 is soldered ; and a transition portion 66 , for linking the base portion 44 with the solder ball pad 62 . the solder ball pad 62 is of a discoid shape having a diameter slightly smaller than that of the solder ball 64 , and extends substantially parallel to the circuit board mounting surface 10 . the transition portion 66 offsets the solder ball pad in substantially the same direction as that in which the contact point 60 is offset . the transition portion 66 will be described with reference to fig5 . [ 0025 ] fig5 is a partial detailed view that shows the terminal portion 48 of the contact 14 of fig3 a - 4b . the transition portion 66 comprises a horizontal portion 66 a that extends substantially parallel to the circuit board mounting surface 10 and a vertical portion 66 b that is continuous with the horizontal portion 66 a and substantially perpendicular to the solder ball pad 62 . next , the operation of the transition portion 66 will be described in further detail . during soldering of the solder ball 64 onto the solder ball pad 62 a solder fillet 64 a is formed , by partially molten solder , between the solder ball pad 62 and the solder ball 64 around the entire periphery thereof . because the vertical portion 66 b , which is continuous with the solder ball pad 62 , is formed perpendicular thereto , the solder fillet 64 a does not flow toward the vertical portion 66 b . accordingly , the vertical portion 66 b functions to prevent solder fillet formation thereon . if the transition portion 66 extends rightward from the solder ball pad 62 then upward , as shown by the broken lines of fig5 then the solder fillet 64 a would flow toward the right from the solder ball pad 62 . then , the surface tension of the molten solder would cause the solder ball 64 to move to the right , and cause it to be fixed in a positionally misaligned state . as a result , the solder balls 64 and conductive pads of the circuit board ( not shown ) become misaligned , reducing the reliability of electrical connections therebetween . in sharp contrast , the ic socket of the present invention allows the solder balls 64 to be consistently formed at their predetermined positions . therefore , there is a reduced risk that positional misalignment will occur . in addition to the transition portion 66 , the size of the solder ball pad 62 ( slightly smaller than the solder ball 64 ) also works to achieve this characteristic . that is , the size of the solder ball pad 62 reduces the risk of horizontal movement of the solder ball 64 , thereby contributing to accurate positioning thereof . the transition portion 66 is not limited to being of the shape shown in fig5 . various shapes may be considered , as long as they prevent the flow of the solder fillet 64 a . for example , a modified contact 14 , having a differently shaped transition portion , is shown in fig6 . [ 0030 ] fig6 is a partial detailed view of a modified contact 14 a having a transition portion 68 with a single inclined portion 68 a . note that of the parts illustrated in fig6 those in common with the parts illustrated in fig3 a through 5 will be denoted with the same reference numerals in the following description . the transition portion 68 is inclined . therefore , it is difficult for the solder fillet 64 a to flow upward along the inclined portion 68 a . that is , it is difficult for the solder ball 64 to be pulled upward toward the transition portion 68 . in addition , the incline portion 68 a links the base portion 44 and the solder ball pad 62 with a shorter distance , thereby shortening the electrical path . the transition portion may be of a variety of shapes that discourage movement of the solder fillet 64 a toward the transition portion . for example , the shape of the transition portion may be a combination of the aforementioned vertical portion 66 b and the inclined portion 68 a . alternatively , the transition portion may be formed as an arcuate shape that curves diagonally upward . next , an alternative exemplary embodiment of the present invention will be described with reference to fig7 . fig7 is a partial detailed view showing the terminal portion 48 of the contact 14 of fig3 a - 4b , with an alternate housing 2 a . in this embodiment , a protrusion 70 having a triangular cross section is provided on the circuit board mounting surface 10 of the housing 2 a . the protrusion 70 is provided to discourage movement of the solder fillet 64 a toward the transition portion 66 of the contact 14 . the protrusion 70 extends from the fixing portion of the circuit board mounting surface 10 , that is , the base portion 44 of the contact 14 , to the solder ball pad 62 . therefore , the distal end 70 a of the protrusion 70 prevents upward movement of the solder fillet 64 a when it attempts to flow along the transition portion 66 . accordingly , movement and deformation of the solder ball 64 is further prevented . next , a modification of the protrusion will be described with reference to fig8 . fig8 is a partial detailed view showing the terminal portion 48 of the contact 14 with an alternative modified housing 2 b . fig8 shows a state in which the shape of a protrusion 72 ( protrusive portion ) copies that of the transition portion 66 . that is , the protrusion 72 has a shape that is complementary to the right side of the transition portion 6 - 6 of : the contact 14 . in this case as well , the distal end 72 a of the protrusion 72 prevents movement of the solder fillet 64 a toward the transition portion 66 . in addition , a protrusion may be formed in the housing 2 , in combination with the contact 14 a having the inclined transition portion 68 ( shown in fig6 ). again , upward movement of the solder fillet 64 a along the transition portion 68 can be prevented by such a protrusion . in this manner , the transition portions 66 and 68 of the contacts 14 and 14 a may act as solder fillet stops by themselves , without depending on the shape of the housing 2 . however , by additionally providing the aforementioned protrusions 70 and 72 to the housings 2 a and 2 b , the solder balls 64 are enabled to be offset while more effectively preventing positional misalignment . in this manner , the protrusions 70 and 72 of the housings 2 a and 2 b also function as solder fillet stops . while the invention is illustrated and described with reference to particular exemplary embodiments , it should be understood that alternative equivalent structures are contemplated within the scope of the invention . for example , metal plate 20 does not have to be formed from metal , but could be formed from a non - metallic material . | 7 |
the invention is described with reference to the attached figures . the figures are not drawn to scale and they are provided merely to illustrate the instant invention . several aspects of the invention are described below with reference to example applications for illustration . it should be understood that numerous specific details , relationships , and methods are set forth to provide a full understanding of the invention . one having ordinary skill in the relevant art , however , will readily recognize that the invention can be practiced without one or more of the specific details or with other methods . in other instances , well - known structures or operation are not shown in detail to avoid obscuring the invention . the invention is not limited by the illustrated ordering of acts or events , as some acts may occur in different orders and / or concurrently with other acts or events . furthermore , not all illustrated acts or events are required to implement a methodology in accordance with the invention . the implementation of the inventive system disclosed herein advantageously does not add new hardware or additional cost to the existing eas systems . since the solution can be software - implemented , it can also be readily ported to older systems to enhance their performance accordingly . the invention is described herein in terms of an am eas system , however the method of the invention can also be used in other types of eas systems , including systems that use rf type tags and radio frequency identification ( rfid ) eas systems . the inventive system and method can identify the approximate location of a marker with sufficient granularity to determine if the marker is located between a pair of eas pedestals , as opposed to a location which is behind one of the pedestals in the “ backfield .” by strategically varying the amplitude and phase of individual exciter coils ( antennas ) and monitoring the associated signal response produced by a marker , the approximate location of the marker can be determined . as such , the system and method described herein can reduce undesired alarms an eas system having at least two transceiver pedestals , where a detection zone is defined between the pedestals . referring now to the drawings figures in which like reference designators refer to like elements , there is shown in fig1 and 2 an exemplary eas detection system 100 . the eas detection system will be positioned at a location adjacent to an entry / exit 104 of a secured facility . the eas system 100 uses specially designed eas marker tags (“ tags ”) which are applied to store merchandise or other items which are stored within a secured facility . the tags can be deactivated or removed by authorized personnel at the secure facility . for example , in a retail environment , the tags could be removed by store employees . when an active tag 112 is detected by the eas detection system 100 in an idealized representation of an eas detection zone 108 near the entry / exit , the eas detection system will detect the presence of such tag and will sound an alarm or generate some other suitable eas response . accordingly , the eas detection system 100 is arranged for detecting and preventing the unauthorized removal of articles or products from controlled areas . a number of different types of eas detection schemes are well known in the art . for example known types of eas detection schemes can include magnetic systems , acousto - magnetic systems , radio - frequency type systems and microwave systems . for purposes of describing the inventive arrangements in fig1 and 2 , it shall be assumed that the eas detection system 100 is an acousto - magnetic ( am ) type system . still , it should be understood that the invention is not limited in this regard and other types of eas detection methods can also be used with the present invention . the eas detection system 100 includes a pair of pedestals 102 a , 102 b , which are located a known distance apart ( e . g . at opposing sides of entry / exit 104 ). the pedestals 102 a , 102 b are typically stabilized and supported by a base 106 a , 106 b . pedestals 102 a , 102 b will each generally include one or more antennas that are suitable for aiding in the detection of the special eas tags as described herein . for example , pedestal 102 a can include at least one antenna 302 a suitable for transmitting or producing an electromagnetic exciter signal field and receiving response signals generated by marker tags in the detection zone 108 . in some embodiments , the same antenna can be used for both receive and transmit functions . similarly , pedestal 102 b can include at least one antenna 302 b suitable for transmitting or producing an electromagnetic exciter signal field and receiving response signals generated by marker tags in the detection zone 108 . the antennas provided in pedestals 102 a , 102 b can be conventional conductive wire coil or loop designs as are commonly used in am type eas pedestals . these antennas will sometimes be referred to herein as exciter coils . in some embodiments , a single antenna can be used in each pedestal and the single antenna is selectively coupled to the eas receiver and the eas transmitter in a time multiplexed manner . however , it can be advantageous to include two antennas ( or exciter coils ) in each pedestal as shown in fig1 , with an upper antenna positioned above a lower antenna as shown . the antennas located in the pedestals 102 a , 102 b are electrically coupled to a system controller 110 , which controls the operation of the eas detection system to perform eas functions as described herein . the system controller can be located within a base of one of the pedestals or can be located within a separate chassis at a location nearby to the pedestals . for example , the system controller 110 can be located in a ceiling just above or adjacent to the pedestals . eas detection systems are well known in the art and therefore will not be described here in detail . however , those skilled in the art will appreciate that an antenna of an acousto - magnetic ( am ) type eas detection system is used to generate an electro - magnetic field which serves as a marker tag exciter signal . the marker tag exciter signal causes a mechanical oscillation of a strip ( e . g . a strip formed of a magnetostrictive , or ferromagnetic amorphous metal ) contained in a marker tag within a detection zone 108 . as a result of the stimulus signal , the tag will resonate and mechanically vibrate due to the effects of magnetostriction . this vibration will continue for a brief time after the stimulus signal is terminated . the vibration of the strip causes variations in its magnetic field , which can induce an ac signal in the receiver antenna . this induced signal is used to indicate a presence of the strip within the detection zone 304 . as noted above , the same antenna contained in a pedestal 102 a , 102 b can serve as both the transmit antenna and the receive antenna . accordingly , the antennas in each of pedestals 102 a , 102 b can be used in several different modes to detect a marker tag exciter signal . these modes will be described below in further detail . referring now to fig3 a and 3b , there are shown exemplary antenna field patterns 403 a , 403 b for antennas 302 a , 302 b contained in pedestal 102 a , 102 b . as is known in the art , an antenna radiation pattern is a graphical representation of the radiating ( or receiving ) properties for a given antenna as a function of space . the properties of an antenna are the same in transmit and receive mode of operation and so the antenna radiation pattern shown is applicable for both transmit and receive operations as described herein . the exemplary antenna field patterns 403 a , 403 b shown in fig3 a , 3 b are azimuth plane pattern representing the antenna pattern in the x , y coordinate plane . the azimuth pattern is represented in polar coordinate form and is sufficient for understanding the inventive arrangements . the azimuth antenna field patterns shown in fig3 a and 3b are a useful way of visualizing the direction in which the antennas 302 a , 302 b will transmit and receive signals at a particular power level . the antenna field pattern 403 a , 403 b shown in fig3 a includes a main lobe 404 a with a peak at ø = 0 ° and a backfield lobe 406 a with a peak at angle ø = 180 °. conversely , the antenna field pattern 403 b shown in fig3 b includes a main lobe 404 b with its peak at ø = 180 ° and a backfield lobe 406 b with a peak at angle ø = 0 °. in an eas system , each pedestal is positioned so that the main lobe of an antenna contained therein is directed into a detection zone ( e . g . detection zone 108 ). accordingly , a pair of pedestals 102 a , 102 b in an eas system 400 shown in fig4 a will produce overlap in the antenna field patterns 403 a , 403 b as shown . notably , the antenna field patterns 403 a , 403 b shown in fig4 a are scaled for purposes of understanding the invention . in particular , the patterns show the outer boundary or limits of an area in which an exciter signal of particular amplitude applied to antennas 302 a , 302 b will produce a detectable response in an eas marker tag . the significance of this scaling will become apparent as the discussion progresses . however , it should be understood that a marker tag within the bounds of at least one antenna field pattern 403 a , 403 b will generate a detectable response when stimulated by an exciter signal . the overlapping antenna field patterns 403 a , 403 b in fig4 a will include an area a where there is overlap of main lobes 404 a , 404 b . however , it can be observed in fig4 a that there can also be some overlap of a main lobe of each pedestal with a backfield lobe associated with the other pedestal . for example , it can be observed that the main lobe 404 b overlaps with the backfield lobe 406 a within an area b . similarly , the main lobe 404 a overlaps with the backfield lobe 406 b in an area c . area a between pedestals 102 a , 102 b defines a detection zone in which active marker tags should cause an eas system 400 to generate an alarm response . marker tags in area a are stimulated by energy associated with an exciter signal within the main lobes 404 a , 404 b and will produce a response which can be detected at each antenna . the response produced by a marker tag in area a is detected within the main lobes of each antenna and processed in a system controller 110 . but note that a marker tag in areas b or c will also be excited by the antennas 302 a , 302 b , and the response signal produced by a marker tag in these areas b and c will also be received at one or both antennas . this condition is not desirable because it can produce eas alarms at system controller 110 when there is in fact no marker present within the detection zone between the pedestals . accordingly , a method will now be described which is useful for determining when a detected marker tag is within a backfield zone ( area b or area c ) as opposed to a detection zone ( area a ). the process described herein is advantageous as it can be implemented in a detection system 400 by simply updating the software in system controller 110 without modifying any of the other hardware elements associated with the system . referring now to fig5 there is provided a flowchart that is useful for understanding the inventive arrangements . the flowchart describes an inventive algorithm that compares the amplitude of the tag response captured in antennas 302 a , 302 b , and then uses that information to prevent undesired alarms caused by marker tags present in the backfield lobes 406 a , 406 b of an antenna . the process begins at 502 and continues to 504 where the detection zone ( e . g . area a ) is monitored to determine if an active marker tag is present . for purposes of the present invention , the monitoring at 504 can be performed in accordance with one or more different operating modes . for example , in a first operating mode the antennas 302 a , 302 b are excited simultaneously using an appropriate exciter signal and the responsive signal produced by the marker tag is then detected by receiving circuitry respectively associated with each of the antennas . in a second mode , an antenna at a first one of the pedestals ( e . g . antenna 302 a ) transmits an exciter signal and the responsive signal produced by the marker tag is detected by receiver circuitry associated with the antenna ( e . g . antenna 302 b ) in the second one of the pedestals . in a third operating mode an antenna ( e . g . antenna 302 b ) at the second of the pedestals transmits an exciter signal and the responsive signal produced by the marker tag is detected by receiver circuitry associated with the antenna in the first one of the pedestals ( e . g . antenna 302 a ). in one embodiment of the invention , only one of the operating modes described herein is used for the monitoring purposes at step 506 . however , in other embodiments , the monitoring step can include cycling through two or more of the different operating modes before the process continues at step 506 . due to the fact that an eas marker tag 112 may not be located in the exact center between the two pedestals 102 a , 102 b the , amplitude of the response signal may be different at the antennas respectively associated with pedestals 102 a , 102 b , and can vary in amplitude depending on which pedestal has transmitted the exciter signal . the various operating modes as described herein can be useful for confirming the presence of an active marker tag . at 506 a determination is made as to whether an active tag has been detected . this determination can be made based on detection of an eas marker signal response at antenna 302 a , antenna 302 b , or both antennas . the determination is made by system controller 110 using techniques which are well known and therefore will not be described here in detail . if no response has been detected ( 506 : no ), the process returns to 504 and monitoring for active tags in the detection zone 108 continues . if it is determined at 506 that an active tag has been detected ( 506 : yes ) by at least one of the antennas 302 a , 302 b then the process continues to 508 . at this point , an alarm flag can also be set by the system to indicate that an eas alarm condition may exist . a determination is made at 508 as to the amplitude of contemporaneous tag responses detected at antennas 302 a , 302 b . these contemporaneous responses are preferably obtained by generating an exciter signal field using antennas in both pedestals and then monitoring the tag response at both pedestals . still , the invention is not limited in this regard and it possible for the contemporaneous responses to be generated by an exciter signal field which is generated by only one pedestal , and then detecting the tag response at both pedestals . when an active marker tag is present in the detection zone , the contemporaneous tag response detected by one pedestal will generally be greater than or less than the response detected in the other pedestal . step 509 is an optional step which involves determining orientation of a detected eas marker tag . step 509 will be discussed below in further detail in relation to fig7 . following step 509 , the process continues to 510 where an exciter drive signal setting is selected or adjusted . more particularly , the exciter drive signal is selectively reduced for the antenna in the pedestal having the lesser of the detected tag response amplitudes . the exciter drive signal for that antenna is reduced so that when the drive signal is applied to the particular antenna 302 a , 302 b it is capable of producing a detectable marker tag response in tags located at a maximum distance which does not extend beyond the plane of the opposing antenna . this concept will be described in further detail below , but is illustrated in fig4 b which shows a scenario in which the exciter drive signal applied to antenna 302 a has been reduced . once the lower drive signal setting is established for the pedestal in which a lesser tag response is detected , the process continues in step 512 . at 512 , an exciter drive signal is applied exclusively to the antenna where the lesser tag response was detected , and using the reduced exciter drive signal . for example , if the lesser tag response was detected in pedestal 102 a , then the reduced amplitude exciter drive signal would be applied to antenna 302 a . the reduced amplitude exciter drive signal will produce a field that is capable of exciting marker tags in the main lobe of the antenna up to the distance of the opposing antenna , and no further . this concept is illustrated in fig4 b . note that as a result of the reduction in exciter drive signal , the antenna pattern 403 a is reduced in scale to show that it does not extend beyond the plane of the antenna 302 b . this is intended to illustrate that the field is not capable of producing a detectable marker tag response at a distance beyond the plane of antenna 302 b . a reduced amplitude drive signal applied at a first one of the antennas ( e . g . at antenna 302 a ) should result in no detectable marker tag response if the marker is in the backfield of the opposing antenna ( e . g . 302 b ). therefore the absence of a detectable marker tag response at 514 can be used as a basis to conclude that the marker tag is not present in the detection zone ( area a ). for example , in the scenario shown in fig4 b , the absence of a detectable marker tag response can be used as a basis to conclude that the marker tag must be present in the backfield of antenna 302 b ( i . e . in area b ) rather than in the detection zone ( area a ). if no response is detected at 514 ( 514 : no ), the process continues to 516 where the previously set alarm flag is disabled or cancelled . the alarm is disabled because the absence of response under the conditions described is understood to mean that the marker tag is in a backfield of the opposing antenna ( in the backfield of antenna 302 b in this example ). accordingly , an eas alarm is advantageously cancelled or inhibited . conversely , if a response is detected at 514 ( 514 : yes ) then it can be concluded that an eas tag is present in the detection zone between the pedestals . at this point , a previously set alarm tag is validated and the process could simply cause an eas alarm to be generated at 522 . however , as a precautionary measure to prevent undesired alarms , it can be advantageous to subsequently confirm the presence of the eas tag in the detection zone . for example , this can be accomplished at optional step 518 by applying an exciter drive signal to the antenna contained in the pedestal which had the greater amplitude tag response . this pedestal having a higher amplitude response can be determined using the response amplitude information as previously obtained at 508 . alternatively , a drive signal could be applied simultaneously to the antennas at both of pedestals 102 a , 102 b . thereafter , at 520 , a determination is made as to whether an eas marker tag response has been detected at one or both of the antennas 302 a , 302 b . for example , if the eas exciter drive signal is applied only to pedestal 302 b , then the eas marker tag response signal could be detected at pedestal 302 a . still , the invention is not limited in this regard and other confirmation methods can be used . if an active eas marker tag response is detected at 520 ( 520 : yes ) then the process will continue to step 522 where an eas alarm is triggered . the presence of the marker tag in the detection zone between the pedestals is assured based on the foregoing processing steps . at 524 a determination can be made as to whether the eas monitoring process should continue , and if so ( 524 : yes ) then the process will return to 504 . if processing is complete or the system is to be shut down , the process will end at 526 . it will be appreciated that the inventive arrangements described herein will require precise calibration of exciter drive signal power levels to ensure that the scenario shown in fig4 b is achieved . in particular , the reduced amplitude exciter drive signal referenced in relation to step 510 must be calibrated to produce a field that is capable of exciting marker tags in the main lobe of the antenna up to the distance of the opposing antenna , and no further . if the exciter drive signal is reduced too much , an electromagnetic field of required intensity may not extend fully to the opposing pedestal . in that case the exciter drive signal may fail to excite an active eas marker tag in the detection zone ( area a ), particularly if the eas tag is very close to the opposing pedestal . conversely , if the exciter signal is not reduced enough , the electromagnetic exciter signal field produced by the exciter drive signal may extend into the backfield area of the opposing antenna . in that case , the exciter signal may inadvertently produce a response from an eas marker tag which is not contained in the detection zone . accordingly , the correct power setting for the reduced amplitude exciter drive signal is an important factor for purposes of ensuring proper system operation . one problem with determining the correct reduced amplitude drive signal setting to be applied in step 510 is related to eas marker tag orientation . notably , the intensity of the rf field required to produce a detectable response from an eas marker tag can vary in accordance with the orientation of the tag relative to the antennas 302 a , 302 b . this means that the correct reduced amplitude drive signal setting applied in step 510 will vary depending on the physical orientation of the marker tag which is present . accordingly , it can be useful to have information concerning tag orientation for purposes of selecting the reduced amplitude drive signal setting . this information is optionally obtained at step 509 . marker tag orientation can be discerned by strategically varying the phase of individual exciter coils ( antennas ) in a pedestal and monitoring the associated signal response produced by a marker tag . a marker tag having an elongated length aligned substantially in a horizontal orientation ( i . e ., aligned along the x axis in fig1 , transverse to the vertical orientation of the antennas and pedestals ) is optimally excited by a “ phase aiding ” configuration in which the upper and lower antennas or exciter coils are excited in phase . this concept is illustrated in fig6 a which shows a partial cutaway view of a pedestal 600 comprising an upper exciter coil 604 and a lower exciter coil 606 which are excited in phase . conversely , a marker tag having an elongated length aligned substantially with a vertical orientation ( i . e . aligned with the z axis in fig1 , parallel to the vertical orientation of the antennas ) is optimally excited by a “ phase opposed ” configuration wherein the upper and lower exciter coils are excited out of phase . for example , the signals applied to the upper and lower exciter coils can be approximately 180 ° out of phase ( ø = 180 °). still , the invention is not limited in this regard and other phase relationships are also possible . the phase opposed configuration is illustrated in fig6 b . the different response characteristics can be used to determine a marker tag orientation as described below in fig7 . the flowchart shown in fig7 provides an exemplary set of steps which are useful for understanding how an orientation of a marker tag can be discerned in step 509 . once determined , this information can be used to select an optimal or correct reduced amplitude exciter drive signal for use at steps 510 and 512 . the process of determining orientation can begin at 702 by transmitting a tag exciter signal from the pedestal where the lesser tag response was detected in accordance with the comparison of step 508 . for example , if the lesser tag response was detected in pedestal 102 a , then the tag exciter signal is applied to antenna 302 a . the tag exciter signal is applied to an upper and lower antenna ( exciter coils ) in a phase aiding configuration similar to that shown in fig6 a . the resulting response from the marker tag is then sensed at the antenna in the opposing pedestal ( e . g . pedestal 302 b in this example ) and the received signal amplitude is stored by the controller 110 . the process then continues on to step 704 by again transmitting a tag exciter signal from the pedestal where the lesser tag response was originally detected at 508 . the tag exciter signal drive level is advantageously chosen to be the same as the level used at step 704 , but the signal is applied to the upper and lower antennas in a phase opposed configuration similar to that shown in fig6 b . the signal response produced by the marker tag is sensed by the antenna in the opposing pedestal and the amplitude value is again stored . at 706 , a determination is made as to whether the measured amplitude response received from the marker tag at steps 702 , 704 was greater in the phase aiding configuration or phase opposed configuration . if the detected response was greater in the phase aiding configuration then it can be concluded that the marker tag is substantially in the horizontal orientation . accordingly , the reduced exciter drive signal setting is selected to correspond to a horizontally oriented tag at 708 . conversely , if the detected response was greater in the phase opposed configuration , then it can be concluded that the marker tag is substantially in the vertical orientation . in that case , the reduced exciter drive signal setting is selected to correspond to a vertically oriented tag at 710 . in either scenario , the actual orientation of the marker tag may not be precisely vertical or horizontal . however , the orientation sensing process will provide a useful indication of a setting for a reduced amplitude exciter drive signal for use at steps 510 and 512 . referring now to fig8 , there is provided a block diagram that is useful for understanding the arrangement of the system controller 110 . the system controller comprises a processor 816 ( such as a micro - controller or central processing unit ( cpu )). the system controller also includes a computer readable storage medium , such as memory 818 on which is stored one or more sets of instructions ( e . g ., software code ) configured to implement one or more of the methodologies , procedures or functions described herein . the instructions ( i . e ., computer software ) can include an eas detection module 820 to facilitate eas detection and perform backfield reduction for reducing undesired alarms as described herein . these instructions can also reside , completely or at least partially , within the processor 816 during execution thereof . the system also includes at least one eas transceiver 808 , including transmitter circuitry 810 and receiver circuitry 812 . the transmitter and receiver circuitry are electrically coupled to antenna 302 a and the antenna 302 b . a suitable multiplexing arrangement can be provided to facilitate both receive and transmit operation using a single antenna ( e . g . antenna 302 a or 302 b ). transmit operations can occur concurrently at antennas 302 a , 302 b after which receive operations can occur concurrently at each antenna to listen for marker tags which have been excited . alternatively , transmit operations can be selectively controlled as described herein so that only one antenna is active at a time for transmitting marker tag exciter signals for purposes of executing the various algorithms described herein . the antennas 302 a , 302 b can include an upper and lower antenna similar to those shown and described with respect to fig6 a and 6b . input exciter signals applied to the upper and lower antennas can be controlled by transmitter circuitry 810 or processor 816 so that the upper and lower antennas operate in a phase aiding or a phase opposed configuration as required . additional components of the system controller 110 can include a communication interface 824 configured to facilitate wired and / or wireless communications from the system controller 110 to a remotely located eas system server . the system controller can also include a real - time clock , which is used for timing purposes , an alarm 826 ( e . g . an audible alarm , a visual alarm , or both ) which can be activated when an active marker tag is detected within the eas detection zone 108 . a power supply 828 provides necessary electrical power to the various components of the system controller 110 . the electrical connections from the power supply to the various system components are omitted in fig8 so as to avoid obscuring the invention . those skilled in the art will appreciate that the system controller architecture illustrated in fig8 represents one possible example of a system architecture that can be used with the present invention . however , the invention is not limited in this regard and any other suitable architecture can be used in each case without limitation . dedicated hardware implementations including , but not limited to , application - specific integrated circuits , programmable logic arrays , and other hardware devices can likewise be constructed to implement the methods described herein . it will be appreciated that the apparatus and systems of various inventive embodiments broadly include a variety of electronic and computer systems . some embodiments may implement functions in two or more specific interconnected hardware modules or devices with related control and data signals communicated between and through the modules , or as portions of an application - specific integrated circuit . thus , the exemplary system is applicable to software , firmware , and hardware implementations . although the invention has been illustrated and described with respect to one or more implementations , equivalent alterations and modifications will occur to others skilled in the art upon the reading and understanding of this specification and the annexed drawings . in addition , while a particular feature of the invention may have been disclosed with respect to only one of several implementations , such feature may be combined with one or more other features of the other implementations as may be desired and advantageous for any given or particular application . thus , the breadth and scope of the present invention should not be limited by any of the above described embodiments . rather , the scope of the invention should be defined in accordance with the following claims and their equivalents . | 6 |
the invention &# 39 ; s various components assume that a number of “ best practices ” are applied to the implementation . for example , it is assumed that the relational database is accessible to all other components and applies strict rules and constraints that guarantee data integrity . presuming a best practices implementation , the processes that evaluate , transform and deploy digital assets are specialized enough to operate over a variety of digital formats and still cooperate and interact seamlessly with the system . for example , each form of digitized intellectual property has a dedicated software program built to expose a common system interface through which it can be controlled . in the case of a digital audio file , an mpeg 3 encoder / decoder obtains information about assets to be encoded for a particular distribution medium through this interface and performs its encoding task unattended for many thousands of digitized intellectual properties . the invention &# 39 ; s ability to identify exceptional digitized intellectual properties and / or tolerate chaos and errors without manual intervention is assisted by several quality metrics established by analysis of the following exemplary issues : a ) the quality of the original digitized intellectual property form , such as a master recording . for audio material , this evaluation can be assisted by an analysis of the frequency spectrum and amplitude envelope , as well as statistical clues evident in the accompanying metadata . b ) the quality of the digital transformations , if any , to prepare the asset for distribution . this evaluation can be assisted by the detection of waveform transients and other unusually randomized data within an audio or video stream . c ) the quality of accumulated and finalized metadata obtained by the fulfillment of internal business processes and / or correlation with external sources . for music , artist and repertoire , considerations are applied during the review process and the quality of such descriptions and judgments can be weighed by measuring the completeness , consistency and authorship of the data . in addition , audience awareness of musical compositions and artists can be gauged by querying web sites and publicly accessible databases . the quality of such information may be ascertained by similar methods . d ) the quality and accuracy of legal rights and privileges held by all parties with an interest in a particular digital asset . for audio material , this would include an automated analysis of contracts , explicit or implied , pertaining to composers , writers , performance rights organizations , publishers and the like . e ) the quality of the intended retail outlet with respect to consumer experience and asset delivery timing . as shown in fig1 , the process is initiated by the digitized intellectual property owner and transpires in the following manner : step 1 . ip owner or controller seeks to monetize digitized intellectual property (“ dip ”). the ip owner may be viewed as a client computer 102 in a networked environment ( e . g ., the internet ). step 2 . access web - based software platform through user interface . the web - based software platform may be a server 104 forming a portion of an intranet with a control computer 106 and a read / write memory facility 108 . step 3 . enter in relevant detailed description / characteristics and rules governing dip . in particular , a user of a client computer 102 inputs this information . this information may be entered using downloaded software from the software platform 104 . step 4 . customize format of dip — the way it will be exhibited before digital purchasers . this may be facilitated using downloaded software from the software platform 104 . step 5 . save information and send to the remote software platform . again , using the downloaded software from the software platform 104 , the information is routed over a network to the software platform 104 . step 6 . upload digital copy of ip to software platform . the digital copy of the ip is typically resident on a client computer 102 , but my come from any source . step 7 . where applicable , send physical copy to designated operator . thus , fig1 illustrates the acquisition of digitized intellectual property in accordance with an embodiment of the invention . as indicated above , the software platform 104 may be configured to deliver application interfaces to the clients 102 . the software platform 104 is also preferably configured to update an asset database , assign quality metrics , and assign a projected desirability value . the software platform 104 fully prepares all digitized intellectual properties for sale by applying a wide variety of transformations according to a prescribed schedule , as illustrated in connection with fig2 . for example : audio file is reviewed , catalogued and analyzed for initial quality and desirability metrics a digital sample file is prepared automatically based on an algorithm to determine the most representative contiguous segment of the asset relevant metadata is collected ( e . g . artist information , associated artwork , licensing terms ) consumer destinations are assigned a configuration matrix is established based on the above factors the matrix is then applied to produce the required formatting for all the digitized intellectual properties &# 39 ; components ( e . g ., artist images , metadata , audio file type ) audio components are automatically transcoded encryption and / or digital rights management are applied , as required components are sent to a designated staging area for syndication as business processes are applied to move digitized intellectual properties from acquisition to distribution , the quality metrics are combined with formulas to obtain an overall characterization of each asset . a minimal set of master thresholds are then set in order to determine which digitized intellectual properties are allowed to be released as finished goods . in this way , a quality standard is maintained and enforced with minimal effort , thereby contributing to the desired scalability for an automated business . those assets that are below the established quality threshold are archived and reviewed for potential exclusion from future exploitation . fig2 illustrates the software platform 104 operative with the control computer 106 . the software platform may interact with content servers 200 to perform functions , such as assign terms , such as royalty splits , assign syndication destinations , transcode and tag audio files , prepare audio samples , update remote content , assign quality metrics , and assign projected desirability based upon information processed during the review and transformation process . the next step in the process is to syndicate , or directly distribute , the digitized intellectual properties . the invention utilizes software to aggregate individual digitized intellectual properties from the staging area based on their desirability , quality and consumer destinations . all related dip components are prepared for syndication in the following manner as shown in connection with fig3 : step 1 . review information and copy of dip . step 2 . assign and / or confirm additional characteristics and syndication / distribution rules where necessary . step 3 . perform any additional tasks necessary to prepare dip for digital sale to consumers , such as preparation of sample clips of audio files . step 4 . encode dip in multiple formats through automated process . step 5 . validate that dip is ready for syndication to online distribution services / storefronts . step 6 . organize dips into categories , or other units , as requested by the various digital distribution outlets that will be selling dips to consumers . once a quorum of digitized intellectual properties within the staging area is available , as predetermined by management and / or previously analyzed metrics , the assets are copied to the relevant distribution export devices , including , but not limited to : the dips are then delivered to digital distribution outlets / storefronts in the following manner as shown in connection with fig3 : step 1 . store copies of dips and accompanying metadata onto physical media , such as dvd or hard drive , to send to the outlets or upload dips over an internet connection to a designated ftp or similar site . fig3 illustrates the delivery of a disk 300 and the uploading of dips via computer 302 . step 2 . ensure that digital distribution outlets receive dips and validate the information and quality of the dips . step 3 . emit xml , microsoft office , text , adobe and metadata documents . in sum , fig3 illustrates that the software platform 104 performs one or more of the following functions : organizes dips into specific destination buckets , generates xml and metadata documents , and copies transformed dip components . once the digitized intellectual properties are determined to be available to consumers through digital ( online and mobile ) distribution outlets , their activity and performance are monitored to produce final quality and desirability metrics plus revenue and sales analyses . the invention produces these results through several methods , including : importing sales and activity reports provided by the digital distribution outlets and collecting statistics on the performance of specific dips impersonating consumers of goods and services provided by the digital distribution outlets and analyzing their experience scraping publicly available web pages and / or public documents that describe the general awareness and popularity of the digitized intellectual properties in order to optimize the profitability of the business without manual intervention , a feedback loop is established between a revenue analysis and characterization of each digitized intellectual property . the desirability metric is established for each asset based on some attribute or trend that is determined to predict its ability to contribute revenue to the system . such assets are favored , rising to the forefront for priority processing , promotion , reporting and trend analysis . sales , royalty and performance ingestion from digital distribution outlets produce disbursement of funds . this can be more fully appreciated in connection with fig4 and the following exemplary operations : step 1 . track which digital distribution outlets received dips . step 2 . alert dip owner or controller — either though the web - based interface or other communication method — that their dip is available for sale through designated digital distribution outlets . step 3 . online outlets send electronic or physical copies of sales performance . step 4 . operator ingests dip performance reports into software platform 104 . step 5 . software platform 104 aggregates performance metrics and payment totals where appropriate . step 5 . dip owner or controller views totals through their human online interface . step 6 . operator processes payment to dip owner or controller as needed . the interaction between desirability and quality can be exploited to give the system an adaptive nature , using any of a number of widely available methods in the public domain to discover and introduce optimizations to formulas and processes automatically over time . for example , a formulaic or genetic analysis can utilize the metrics most recently received to adjust the algorithms that assign the initial metrics to incoming digitized intellectual properties . once the sales and activity reports from digital distribution outlets are converted from their respective formats to a uniform performance report , the aggregation of the sales activity is combined with royalty splits and other individualized terms to determine the payout to each digitized intellectual property owner . the invention is able to calculate the appropriate amounts in a fully automated manner and issue payable reports summarizing the overall disbursement of revenue . embodiments of the invention include various additional and alternative techniques . for example , an initial ranking of dip may be based upon the historical performance of the owner , as derived from previous rankings . the initial ranking may set an expected desirability metric and guide the initial distribution process to consumers and prioritization of processing resources . ideally , a large amount of data is gathered from the outset of the dip management process . this data can be reduced , modified or stored for later use as the ongoing dip management process unfolds . any characteristic of dip determined to have influence over desirability , quality and / or uniqueness is considered for archival purposes . in some embodiments of the invention , each quality characteristic is evaluated when dip is received and a combined total and probabilistic calculation is derived . for example , the ability to pay accurately on dip sales ( and thus use sales to determine quality and desirability ) is driven by the platform &# 39 ; s ability to receive accurate sales data from a distribution outlet . in one instance , the platform uses a fuzzy logic based technique call “ fuzzy matching ” that uses an automated function to match the true dip characteristics to the ones provided by the owner . fuzzy matching allows for some human error , but ranks the likelihood of an accurate match , and factors that into the overall assessment of the quality of the dip and the associated performance data . preferably , during each step along dip processing and evaluation , metrics are gathered and the dip &# 39 ; s summary characteristics and desirability matrix are continually updated . summarized dip characteristics can be adjusted and moved into different buckets or classifications in order to improve desirability and performance . the quality of specific dip data can be monitored to help set initial and ongoing prioritization . for example , how many metadata errors were found when dip was initially brought in ? missing information and excessive time taken to catalogue the digital asset results in relative de - prioritization because it can be anticipated that the expected value of the dip is low . overall robustness of metadata helps enhance the value of a dip , as it helps target its desirability segment . metrics are updated and an owner is assigned a generally higher ranking based on the positive combined assessment of all metrics gathered during processing plus continued good performance of the owner &# 39 ; s dip . most recent performance is weighted more heavily than decaying older performance metrics . as performance is calculated , investment in a specific dip , in terms of processing , human and capital resources can fluctuate based on return on investment . the invention can utilize scaling , such that at every step in the process where the system is required to utilize resources , all the resources submitted to that process are prioritized , and depending on the arbitrary conditions that are set , only the top performing assets are pushed through the process . the remaining assets can be delayed , thus maximizing use of resources and return on investment . process input and output may be governed by any number of graphical user interfaces . for example , an executive dashboard may be used that displays current conditions and enables executive responses that can influence the strategy of a business . this is accomplished by several controls that are available via a simple interface that clearly sets overall quality and desirability goals , thereby adjusting the balance between the number of assets permitted to be finished and the amount of resources to be expended . an embodiment of the present invention relates to a computer storage product with a computer - readable medium having computer code thereon for performing various computer - implemented operations . the media and computer code may be those specially designed and constructed for the purposes of the present invention , or they may be of the kind well known and available to those having skill in the computer software arts . examples of computer - readable media include , but are not limited to : magnetic media such as hard disks , floppy disks , and magnetic tape ; optical media such as cd - roms and holographic devices ; magneto - optical media such as floptical disks ; and hardware devices that are specially configured to store and execute program code , such as application - specific integrated circuits (“ asics ”), programmable logic devices (“ plds ”) and rom and ram devices . examples of computer code include machine code , such as produced by a compiler , and files containing higher - level code that are executed by a computer using an interpreter . for example , an embodiment of the invention may be implemented using java , c ++, or other object - oriented programming language and development tools . another embodiment of the invention may be implemented in hardwired circuitry in place of , or in combination with , machine - executable software instructions . the foregoing description , for purposes of explanation , used specific nomenclature to provide a thorough understanding of the invention . however , it will be apparent to one skilled in the art that specific details are not required in order to practice the invention . thus , the foregoing descriptions of specific embodiments of the invention are presented for purposes of illustration and description . they are not intended to be exhaustive or to limit the invention to the precise forms disclosed ; obviously , many modifications and variations are possible in view of the above teachings . the embodiments were chosen and described in order to best explain the principles of the invention and its practical applications , they thereby enable others skilled in the art to best utilize the invention and various embodiments with various modifications as are suited to the particular use contemplated . it is intended that the following claims and their equivalents define the scope of the invention . | 6 |
the present invention provides a membrane composed of at least three elements , the first being a synthetic , hydrophobic polymer having a positive surface charge , which is non - biodegradable under physiologic conditions , at least one hydrophilic polymer which is biodegradable under physiological conditions and at least one plasticizer . without wishing to be bound by theory , the combination of these elements generates a membrane which is flexible enough to be able to generate three dimensional structures suitable for various therapeutic applications , for example , a hollow tube . moreover , upon exposure to fluid ( in vivo or ex vivo ), the hydrophilic polymer at least partially disintegrates and the membrane becomes porous , thus enabling the adhesion of cells . cells may be seeded on a membrane of the invention as will be further described below in detail . in further embodiments , a membrane of the invention may further include an active agent , as further detailed below . a membrane of the invention can serve as an infrastructure to allow guided tissue repair as well as a cell delivery system . a membrane of the invention may also serve as a barrier membrane for eliminating infiltration of unwanted cells , blood vessels and soft / scar tissue into the treated area , and for isolating the cells delivered in said membrane from the surrounding tissue , and preventing the leakage of cells and factors from the space inside the membrane to the surrounding tissue . a membrane of the invention may be used as such , for example , by covering a region into which the cells are delivered , however , in certain embodiments it may be used to form a three dimensional device ( for example a hollow tubular device ) which holds the cells to be deliver , or may coat a tissue engineering scaffold containing the cells to be delivered . in some embodiments , a membrane of the invention is folded into a desired three dimensional structure , e . g . a tubular device . the tubular device can be used as an infrastructure to allow guided tissue repair as well as to deliver cells into a tubular region of defect , such as a bone defect , and the membrane can be used to hold the delivered cells and components in the device and prevent infiltration of cells , extracellular matrix and blood vessels from the surrounding tissue into the space surrounded by the device . in other embodiments , a membrane of the invention is used for coating a tissue engineering scaffold . such a membrane - coated scaffold can hold cells to be delivered into a site in the body . the membrane coating isolates the cells delivered in the scaffold from the surrounding tissue and prevents the leakage of cells , and soluble factors from the space inside the scaffold into the surrounding tissue . coating of the scaffold with a membrane of the invention may allow better cell adhesion and higher doses of cells to be delivered to the target site . in yet other embodiments , a bone defected area can be wrapped after implantation of a scaffold with a membrane of the invention in order to prevent leakage of cells and soluble factors and to prevent growth of soft tissue into the scaffold . the term “ cell delivery ” refers to introduction of cells into a desired site in the body of an individual for therapeutic purposes . a membrane of the invention is suitable for seeding of any type of cells for example stem cells ( both adult and embryonic stem cells ). in other embodiments cell type may be selected from the following non - limiting list : mesenchymal ( stromal ) stem cells , umbilical cord blood cells , osteoblasts , chondroblasts , or cd105 + cells . the invention also encompasses seeding of pluripotent stem cells of embryonic origin as well as adult cells that have been reprogrammed to become pluripotent . the cells may be autologous , allogenic or xenogenic . in some embodiments , the cells are autologous adult stem cells , obtained , for example , from bone marrow or adipose tissue . cell seeding is performed in some embodiments ex vivo . the cells may be placed on the membranes ( for example formed as a hollow tubular device ) or placed in a tissue engineering matrix ( also termed herein “ scaffold ”) coated by the membrane of the invention . examples of tissue engineering matrix are those fabricated from either biological materials or synthetic polymers . in certain embodiments , a membrane of the invention , a tubular implant of the invention or a coated scaffold of the invention , with or without ex vivo seeded cells are placed at a desired location in the body . this location is typically a location where it is desired to generate new tissue which has been damaged by trauma , surgical interventions , genetic or disease processes . in some embodiments a desired site is a site where tissue should be generated from adult stem cells ; is some embodiments such a site is ligament , tendon , cartilage , intervertebral disc , dental tissue or bone tissue , most preferably bone tissue . generation of bone tissue is required in conditions such as non - union fractures , osteoporosis , periodontal disease or teeth implantation , osteolytic bone disease , post - plastic surgery , post - orthopedic implantation , post neurosurgical surgery that involves calvaria bone removal , in alveolar bone augmentation procedures , for spine fusion and in vertebral fractures . generation of tendon / ligament tissue is required for example following tissue tear due to trauma or inflammatory conditions . generation of cartilage tissue is required in conditions such as rheumatoid arthritis , osteoarthritis , trauma , cancer surgery or cosmetic surgery . generation of intervertebral disc tissues including nucleous pulposus and annulus fibrosus , is required in conditions such as nucleous pulposus degeneration , annulus fibrosus tears , or following nucleotomy or discectomy . typically the membrane , for example in the form of a hollow tube is placed at the desired site by implantation . in certain embodiments , the membrane of the invention comprises a synthetic , hydrophobic positively charged polymer , a hydrophilic polymer , a plasticizer and an active agent and is further seeded with cells . in a specific embodiment the membrane of the invention comprises a synthetic , hydrophobic positively charged polymer and peg and is further seeded with stem cells . as used herein the term “ cell - growing surface ” refers to any artificial surface suitable for cell growth for example a slide , vessel or cell / tissue culture dish . the membrane coated cell growing surface in accordance with the invention thereby gains properties suitable for cell adhesion , proliferation and / or differentiation . the present invention provides a flexible membrane capable of supporting msc adherence , proliferation and differentiation . such a membrane can be used as treatment for bone regeneration applications . the healing of displaced fractures and regeneration of bone defects does not result only from proliferation of the locally present osteoblasts , but involves recruitment , proliferation , and differentiation of preosteoblastic cells . the differentiation of multipotent osteoblastic precursors is the main initial event in bone healing and callus formation , although preexisting osteoblasts might also be involved . any failure in the recruitment , establishment , proliferation , and differentiation of these progenitor cells can lead to delayed union or nonunion . there are many difficulties related to the healing of critical - size bone defects . in general , these difficulties result from the fact that there is an insufficient number and / or activity of osteogenic cells of the host to allow for healing . a membrane of the invention can guide bone regeneration as well as prevent unwanted vascularization in the newly formed bone . the membrane can also protect the area of bone defect from infiltration by connective and scar tissues , guide the osteogenic cells and allow storage of osteogenic components in the space enclosed by the membrane , which may potentially be released from the bone ends and bone marrow [ 10 , 12 ]. furthermore , placing msc attached to a membrane at the site of critical size defect model will provide starting material for a new bone tissue . therefore , implanting gbr membrane with expanded ex vivo msc may greatly improve the bone repair outcome . as demonstrated in the examples provided below , several polymers were tested in conjugation with various plasticizers . in one embodiment , a membrane constituted from amca and 15 % peg 400 could support good msc adhesion , proliferation and differentiation : ( i ) msc adhered to amca membrane with 15 % peg 400 as determined by light microscopy , fluorescent microscopy and sem . ( ii ) msc maintain their proliferative activity as determined by cfse labeling and flow cytometric analysis ( iii ) msc maintained their differentiation ability as determined by alizarin red staining . amca membrane containing 15 % peg 400 supported msc differentiation to osteoblasts . polymers : ammonio methacrylate copolymer type a nf ( amca , eudragit ® rl , degussa , germany ) and ethyl cellulose ( ec , ethocel ® n 100 , hercules inc , wilmington , del .). plasticizers : polyethylenglycol 400 ( peg 400 , merck , germany ), glyceryl triacetate ( triacetin , fluka , rehovot , israel ), glycerin ( frutarom , israel ), triethyl citrate ( fluka , rehovot , israel ), dibutyl sebacate ( fluka , rehovot , israel ), dibutyl phtalate ( fluka , rehovot , israel ). polymeric membranes preparation and sterilization — membranes were prepared using solvent casting technique as disclosed in friedman m . and golomb g . j . [ 13 ]. polymeric membranes were cast from solution consisting of polymer , plasticizer and ethanol ( frutarom , israel ) into the teflon moulds ( round plates , inner diameter 9 . 6 cm ) and the solvent was allowed to evaporate over night . membranes width was : 100 ± 5 μm . prior to use in tissue culture , membranes were immersed in pbs ( biological industries , beit haemek , israel ) for 24 hours to wash out possible remains of ethanol and then sterilized by uv irradiation for 2 hr . characterization of membranes — scanning electron microscopy ( sem ) photomicrographs — amca membranes containing 15 % peg 400 were fixed with 2 % glutaraldehyde in cocodylate buffer ( 0 . 1 m ; ph = 7 . 2 ) for 2 hours . the specimens were then processed according to the air drying method skipping the ethanol dehydration series ( ethanol dissolves amca ; therefore it should be excluded from the specimen preparation ). the process was accomplished through 100 % freon 113 . the specimens were vigorously shaken , which allowed rapid evaporation of the freon phase . the membranes were mounted in copper stubs , coated with gold and then examined in fei quanta 200 at an accelerating voltage of 30 kv . cell harvesting and culture — hmscs were obtained from discarded bone tissues from patients undergoing total hip replacement surgeries , under approval of hadassah medical center helsinki ethics committee following an informed consent . the hmscs were separated from other bone marrow - residing cells by plastic adherence and were then grown under tissue culture conditions , as described in krampera m . et al . [ 14 ], and djouad f et al [ 15 ]. the cells were maintained in a low - glucose dulbecco &# 39 ; s modified eagle medium ( dmem ) supplemented with 10 % heat - inactivated fetal calf serum , 2 mm glutamine , and penicillin / streptomycin ( biological industries , beit - haemek , israel ). primary cultures were usually maintained for 12 - 16 days , and were then detached by trypsinization and subcultured ( barry f p . et al . [ 16 ]). the medium was changed every 3 - 4 days . msc adhesion to membrane — for msc labeling , msc were re - suspended in pbs ( 10 7 cells / ml ) containing 5 - carboxyfluorescein diacetoxymethyl ester ( bcecf / am or cfse ; 5 μg / ml ; calbiochem ), incubated at 37 ° c . for 10 mm , and the cells were then washed three times . cells were cultured on a sterilized membrane wetted with pbs , 15 × 10 4 cells in 150 μl medium , and incubated for six hours at 37 ° c . afterwards 3 ml of medium were added . cells were examined 24 hours after seeding by fluorescent microscope . tissue culture polystyrene dishes were used as a positive control for membrane in cell adhesion test . cfse - based proliferation assay — for cell division studies , msc were resuspended in pbs ( 10 7 cells / ml ) containing 3 ′- o - acetyl - 2 ′, 7 ′- bis ( carboxyethyl )- 4 or 5 - carboxyfluorescein diacetoxymethyl ester ( bcecf / am or cfse ; 5 μg / ml ; calbiochem ), incubated at 37 ° c . for 10 min , and washed three times . cfse - labeled cells were then seeded on the membrane or on the tissue culture dishes as described above . at the indicated time points cells were harvested and proliferation of cells was visualized by incremental loss of cfse fluorescence as analyzed on a facscalibure flow cytometer ( becton dickinson ) using cell quest software . msc differentiation on membrane — msc were seeded on the membranes or on the center well organ culture dishes ( falcon ) for control , as described above . as soon as msc were confluent , the culture medium was supplemented with ascorbic acid ( 50 μg / ml ), dexamethasone ( 10 − 8 m ) and β - glycerophosphate ( 10 mm ). medium was changed twice a week for 17 days , afterwards membranes and dishes were dyed with alizarin red , as described below . alizarin red staining — a stock solution of 2 % alizarin red in distilled water was adjusted to ph 4 . 2 with naoh and passed through a 0 . 22 μm filter . cultures in the center well organ culture dishes were rinsed with 150 mm nacl three times , fixed in ice cold 70 % ethanol , rinsed with distilled water and stained at room temperature for 10 min with 500 μl of alizarin red stock per well . individual wells were rinsed five times with distilled water ; a sixth and final wash with distilled water was performed for 15 min ( halvorsen y d . et al . [ 17 ]). membranes due to their positive charge had a higher affinity towards alizarin red stain than a negatively charged center well organ culture dishes , therefore rinsing with distilled water didn &# 39 ; t remove the stain from the membranes well enough . to reduce background we applied a single rinse with 0 . 02 m hcl on the membranes . photomicrographs were then obtained . various membranes were tested for their ability to support cell attachment and growth . the tested membranes varied in their polymer and plasticizer types . several plasticizers were tested , i . e . glycerin , polyethylene glycol , triethyl citrate , dibutyl sebacate , dibutyl phtalate , triacetin . the plasticizers tested were hydrophobic or hydrophilic and were added in order to contribute flexibility to membrane . msc were seeded on sterilized membranes as described hereinabove . ec membranes : msc cells showed little adherence to all formulations of ec membranes and cell aggregation was slight . the various plasticizers had no influence on either cell adhesion or cell shape . as control , poly - 1 - lysine coated membranes were used . poly - 1 - lysine , a highly positively charged amino acid chain , is commonly used as a coating agent to promote cell adhesion in culture . cells adhered in monolayer spindle shape to ec membranes coated with poly - 1 - lysine , hence it was concluded that ec does not support cell adhesion , as such . however ec was found to be non toxic in the presence of poly - 1 - lysin . amca membranes : cell adhesion test was performed with ammonio methacrylate copolymer type a ( amca , eudragit rl ™, degussa , germany ) [ 85 %], mixed with various plasticizers disclosed herein above [ 15 %]. msc adhered well to amca membranes prepared with the various plasticizers ( fig1 d - f ) in spindle monolayer shape . cell spreading on the amca membranes was similar to spreading on the polystyrene dishes which were used as a positive control for cell adhesion ( fig1 a - c ). the mode of spreading is indicative of the cells &# 39 ; well being . cell adhesion was further analyzed using sem . as shown in fig2 cells on the amca membrane , were flat and monolayer spindle shaped . furthermore , at higher magnification , cell - membrane interaction was seen , with a cellular podia attached to the membrane , ( fig2 , d - f ). moreover , the release of numerous vacuoles from the cell surface was observed , demonstrating cell functionality . similar results were obtained using both human as well as rabbit msc . proliferative capacity of msc was tested using the fluorescent marker of cell division , cfse and flow cytometric analysis . this method is based on the fluorescein related dye cfse , which is partitioned with remarkable fidelity between daughter cells allowing eight to 10 discrete generations to be identified both in vitro and in vivo . the technique allows complex information on proliferation kinetics and differentiation to be collected according to this technology ; individual cells are tagged with the fluorescent cfse dye that binds irreversibly to cell cytoplasm . as cells divide , their fluorescence halves sequentially with each generation , allowing the proliferative history of any single cell present to be monitored over time ( see lyons ab . et al [ 18 ]). msc proliferated on amca and peg 400 membrane ( fig3 b ) ( but no proliferation was detected with other plasticizers ; data not shown ) although at somewhat reduced rates as compared to their proliferative capacity on tissue culture dishes used as control ( fig3 a ). subsequently , msc proliferation rate was tested over time on membranes containing different concentrations of peg 400 ( 10 %, 15 %, 20 % and 25 % w / w ). the rate of msc proliferation inversely correlated to the mean fluorescent intensity value ( mfi ) ( fig4 ). this analysis revealed that , membranes containing 15 % peg 400 and 20 % peg 400 were fairly close to the polystyrene control , while other concentrations of peg resulted in either higher or lower proliferation rates . in addition , amca membrane with 15 % and with 5 % peg 400 was characterized using scanning electron microscopy ( sem ). membranes were observed before and after immersion in pbs ( fig5 ). it is noted that membranes were immersed in pbs for 24 hours before each msc seeding , in order to wash out residual ethanol . since peg 400 is soluble in water and thus porogenic , only after immersion in pbs , pores were observed on the membrane surface ( fig5 b - c ). in both concentrations of peg 400 , sem pictures demonstrated a porous surface , with average pore size of 0 . 18 μm . pore distribution correlated directly to different peg 400 concentrations . differentiation medium was added as described hereinabove . membranes and dishes were then dyed with alizarin red . ( fig6 a and 6b ). alizarin red binds irreversibly to bivalent positive ions and has especially high affinity towards calcium . calcium is secreted from osteoblasts and deposits on the membrane as part of the creation of an extracellular matrix . therefore presence of calcium marks the differentiation from msc that do not secrete calcium into osteoblast . fig6 demonstrates that msc cultured on both amca membrane and polystyrene controls have differentiated to osteoblast and produced extracellular matrix . this finding confirms that amca membrane with 15 % peg 400 supports msc differentiation and that msc after adhesion to membrane maintain their stem cells traits . in vivo bone regeneration study using a membrane of the invention study group : five male new zealand rabbits weighing 3 . 8 - 4 . 4 kg underwent bilateral midshaft resection of radial bone segment ( 1 cm in length ) in forelimbs . tubular amca membranes were implanted in the left forelimb ( treated osteotomy ) and the right limb served as a control ( untreated osteotomy ). evaluation of healing process : radiographic evaluation — lateral radiographs of forelimbs were obtained 2 , 4 , 6 and 8 weeks postoperatively . to obtain standardized measurements of the bone defects during the regenerative healing process , true lateral radiographs of both forelimbs were performed in standard conditions ( 42 kv , 2 mas ). radiographs were examined using osirix medical imaging software to evaluate the area and density of the new bone . total area of regenerated bone tissue ( appearing around and within the bone gap defect ). to eliminate possible bias by variability of bone dimensions , data calibration was made using the diameter of olecranon process at its narrowest zone as a standard reference . this diameter was defined as 10 mm in each specimen . relative density of the newly regenerated bone in the gap defect . the segmented area was outlined , and the density was measured . the bone density in the center of the olecranon process was measured in each forelimb for a calibration , as a reference value . the density of olecranon process was defined as a 100 % for each specimen ( see mosheiff r . et al . [ 10 ]). results : fig7 shows bone regeneration expressed by mean callus area ( mm 2 ) throughout the study ( weeks 2 to 8 ). at week 2 of the study the mean callus area produced in control arm was larger then that of arm treated with amca membrane , possibly due to formation of hematome or blood clot at the surgery site . when the site was surrounded by membrane it isolated the area and thus slowed the degradation of the hematome . however from week four of the study , mean area of callus generated in the limb treated with amca membrane was slightly bigger than that of the control ( 144 . 8 mm 2 vs . 114 . 5 mm 2 ). this trend continued at weeks 6 and 8 , hand in hand with widening the difference between mean callus areas of amca membrane treated limb and control limb . at week 8 , the difference between mean callus areas produced in two limbs ( treated with amca membrane and control ) reached its peak and was 143 . 91 mm 2 ( see table 1 below ). however , this difference is not statistically significant , due to small sample size ( n = 5 ) of this preliminary study and high variability of results , as it often happens in in vivo studies . in 6 male new zealand rabbits critical size defect ( 10 mm ) was created in both forelimbs . in one forelimb ec membrane which contained simvastatin was inserted , in the contralateral limb ec membrane with no active agent was inserted . callus density and callus area were measured and calibrated using osirix software . fig8 a and 8b show the quantitative analysis of the radiographs . fig9 shows the microct of bone regeneration with ec membrane . in this experiment bone defect was left untreated . the bone defect is in non union state . arrows mark the bone defect area . fig1 shows microct of bone regeneration with ec membrane containing simvastatin . arrows mark the bone defect area . in this experiment bone defect was treated and successful bridging of the defect is evident . in vivo bone regeneration study using an amca membrane of the invention further comprising simvastatin rabbit model : critical size bone defect of 1 cm in radius bone were created . 5 rabbits were treated with simvastatin controlled release amca membrane and 5 others with amca membrane without any active ingredient . simvastatin 20 % w / w — 0 . 36 g amca ( eudragit rl ) 70 % w / w — 1 . 26 g peg 400 10 % w /— 0 . 18 g membrane width was 180 micrometer . amca ( eudragit rl ) 90 % w / w — 1 . 62 g peg 400 10 % w / w — 0 . 18 g membrane width was 180 micrometer . fig1 shows significantly larger callus area formed at the defect site treated with simvastatin controlled release amca membrane ( wilcoxon summed ranks test ), as well as increase in callus growth rate at 2 first post operation weeks — may be important from clinical point of view . in vitro release rate of simvastatin from different membranes of the invention the effects of various parameters on simvastatine release from membranes of the invention were measured in vitro as follows : the effect of simvastatin concentration on simvastatin release rate is shown in fig1 a ; the composition of the tested membranes was as follows : the effect of membrane width on simvastatin release rate is shown in fig1 b ; the composition of the tested membranes was as follows : the effect of plasticizer on simvastatin release rate is shown in fig1 c ; the composition of the tested membranes was as follows : the effect of plasticizer type on simvastatin release rate is shown in fig1 d . rabbit model : critical size bone defect of 1 cm in radius bone was created . two rabbits were treated with amca membrane carrying hmsc in one forearm and on another forearm amca membrane without hmsc . fig1 a demonstrates the development of the callus area in the effected bone . as shown in fig1 b the histological score of various parts of the defected bone area at 8 weeks post operation is higher in bones implanted with an amca membrane carrying hmsc . 1 . gerstenfeld l c , cullinane d m , barnes g l , graves d t , einhorn t a . fracture healing as a post - natal developmental process : molecular , spatial , and temporal aspects of its regulation . j cell biochem 2003 ; 88 ( 5 ): 873 - 84 . 2 . megas p . classification of non - union . injury 2005 ; 36 suppl 4 : s30 - 7 . 3 . crenshaw h . delayed union and non - union of fractures . st . louis : c v mosby ; 1987 . 2053 - 118 p . 4 . hernigou p , poignard a , beaujean f , rouard h . percutaneous autologous bone - marrow grafting for nonunions . influence of the number and concentration of progenitor cells . j bone joint surg am 2005 ; 87 ( 7 ): 1430 - 7 . 5 . kraus k h , kirker - head c . mesenchymal stem cells and bone regeneration . vet surg 2006 ; 35 ( 3 ): 232 - 42 . 6 . cancedda r , mastrogiacomo m , bianchi g , derubeis a , muraglia a , quarto r . bone marrow stromal cells and their use in regenerating bone . novartis found symp 2003 ; 249 : 133 - 43 ; discussion 143 - 7 , 170 - 4 , 239 - 41 . 7 . cancedda r , dozin b , giannoni p , quarto r . tissue engineering and cell therapy of cartilage and bone . matrix biol 2003 ; 22 ( 1 ): 81 - 91 . 8 . tsuchiya k , mori t , chen g , ushida t , tateishi t , matsuno t , sakamoto m , umezawa a . custom - shaping system for bone regeneration by seeding marrow stromal cells onto a web - like biodegradable hybrid sheet . cell tissue res 2004 ; 316 ( 2 ): 141 - 53 . 9 . meinig r p , rahn b , perren s m , gogolewski s . bone regeneration with resorbable polymeric membranes : treatment of diaphyseal bone defects in the rabbit radius with poly ( l - lactide ) membrane . a pilot study . j orthop trauma 1996 ; 10 ( 3 ): 178 - 90 . 10 . mosheiff r , friedman a , friedman m , liebergall m . quantification of guided regeneration of weight - bearing bones . orthopedics 2003 ; 26 ( 8 ): 789 - 94 . 11 . ito k , nanba k , murai s . effects of bioabsorbable and non - resorbable barrier membranes on bone augmentation in rabbit calvaria . j periodontol 1998 ; 69 ( 11 ): 1229 - 37 . 12 . nasser n j , friedman a , friedman m , moor e , mosheiff r . guided bone regeneration in the treatment of segmental diaphyseal defects : a comparison between resorbable and non - resorbable membranes . injury 2005 ; 36 ( 12 ): 1460 - 6 . 13 . friedman m , golomb g . new sustained release dosage form of chlorhexidine for dental use . i . development and kinetics of release . j periodontal res 1982 ; 17 ( 3 ): 323 - 8 . 14 . krampera m , glennie s , dyson j , scott d , laylor r , simpson e , dazzi f . bone marrow mesenchymal stem cells inhibit the response of naive and memory antigen - specific t cells to their cognate peptide . blood 2003 ; 101 ( 9 ): 3722 - 9 . 15 . djouad f , plence p , bony c , tropel p , apparailly f , sany j , noel d , jorgensen c . immunosuppressive effect of mesenchymal stem cells favors tumor growth in allogeneic animals . blood 2003 ; 102 ( 10 ): 3837 - 44 . 16 . barry f p , murphy j m . mesenchymal stem cells : clinical applications and biological characterization . int j biochem cell biol 2004 ; 36 ( 4 ): 568 - 84 . 17 . halvorsen y d , franklin d , bond a l , hitt d c , auchter c , boskey a l , paschalis e p , wilkison w o , gimble j m . extracellular matrix mineralization and osteoblast gene expression by human adipose tissue - derived stromal cells . tissue eng 2001 ; 7 ( 6 ): 729 - 41 . 18 . lyons ab . analysing cell division in vivo and in vitro using flow cytometric measurement of cfse dye dilution . j immunol methods 2000 ; 243 ( 1 - 2 ): 147 - 54 . 19 . gugala z , gogolewski s . differentiation , growth and activity of rat bone marrow stromal cells on resorbable poly ( l / dl - lactide ) membranes . biomaterials 2004 ; 25 ( 12 ): 2299 - 307 . | 0 |
before the present invention is described terms or words used in the specification and claims of the present invention should not be restrictively construed as having the same meanings as those commonly used or those defined in dictionaries but should be interpreted as having meanings and concepts that are consistent with their meanings and concepts in the context of the spirit or scope of the present invention . therefore , the constitution shown in the embodiments and drawings of the present invention are provided only for illustration of the best exemplary embodiment of the present invention but are not provided to completely encompass the spirit or scope of the present invention . accordingly , it is to be understood that various equivalents and modifications that can be substituted at the time of the filing date of the present application may be made to the invention . as shown in fig1 , the floating structure controlling device according to an embodiment of the present invention includes a floating structure 110 , a post 120 , a floating structure rotating unit 130 , a wire winding measurement unit 140 and a control unit 150 . the floating structure 110 is formed using a material having buoyancy so as to be floatable on the water ( w ) and a through - hole 110 b may be formed at a predetermined position , preferably at the center of the floating structure 110 . the floating structure 110 may take any shape so long as it has buoyancy without being limited to a particular shape . in the following description , the floating structure 110 will be described by way of example with regard to a case where the floating structure 110 is shaped of a rectangular plate . a solar energy generating device 115 may be mounted on a top surface of the floating structure 110 . the solar energy generating device 115 may include a solar cell module , a power conversion device ( not shown ), and a storage battery ( not shown ). the solar cell module is constituted of a plurality of solar cells connected to each other as a module and may be controlled by a support stand ( 117 of fig5 ) capable of varying angles of the solar cell module to allow sunlight to be incident in a vertical direction . the power conversion device is connected to the solar cell module and converts dc power into ac power , the dc power having the voltage and current generated by the solar cell module not constant . the storage battery is connected to the power conversion device and is capable of accumulating electricity . in addition , the floating structure 110 includes a slot hole 110 a having a predetermined section pierced such that a water surface and a bottom portion of the solar cell module make contact with each other . low - temperature gas on the water surface is brought into contact with the heated bottom portion of the solar cell module by convection , thereby cooling the solar cell module . the post 120 is disposed to stand and guides ascending and descending of the floating structure 110 according to the water level . in particular , the post 120 penetrates the through - hole 110 b of the floating structure 110 and has one end fixed to the bottom of the reservoir or lake and the other end upwardly protruding from the floating structure 110 . thus , a portion of the post 120 is positioned in water , that is , below the water surface , and the other portion of the post 120 is positioned outside the water . meanwhile , the floating structure rotating unit 130 includes a pair of first and second power devices 131 and 132 installed on the ground , and a pair of first and second wires 133 and 134 having opposite ends installed at the first and second power devices 131 and 132 and a fixing bar 116 of the floating structure 110 to be cross - linked with each other . the pair of first and second power devices 131 and 132 may include a motor ( not shown ) generating power , a decelerator ( not shown ), a clutch ( not shown ) for transmitting or interrupting power of the motor , and a brake ( not shown ) stopping the motor . the first power device 131 and the second power device 132 are actuated forward and backward , respectively , thereby rotating the floating structure 110 . meanwhile , as shown in fig2 and 3 , the wire winding measurement unit 140 is installed on the ground so as to correspond to the first wire 133 , and measures a wound amount on a real time basis . the wire winding measurement unit 140 includes a fixing member 141 fixedly installed on a block structure b on the ground , an extending member 143 supported to one side of the fixing member 141 and extending in a lengthwise direction of the first wire 133 , a plurality of rollers 145 installed at one side of the extending member 143 to allow the first wire 133 to be wound in a constant interval and rotatably installed according to winding of the first wire 133 , and a sensor member 147 fixed at the other side of the extending member 143 and sensing the number of revolutions of one of the plurality of rollers 145 . the fixing member 141 includes an ‘ l ’ shaped support unit 141 a and a standing unit 141 b upwardly installed on the support unit 141 a . the extending member 143 is shaped of a rectangle having a predetermined length and fixedly installed at the standing unit 141 b . the shape of the extending member 143 is not limited to the rectangle and various changes may be made to the shape of the extending member 143 so long as it can support the plurality of rollers 145 . the plurality of rollers 145 are rotatably supported to a fixed shaft 143 a installed on a top surface of the extending member 143 to be spaced apart from each other in a lengthwise direction , and are arranged at different heights in a zigzag configuration , thereby establishing a winding state of the first wire 133 more firmly . here , the wound amount of the first wire 133 can be estimated per one revolution of the roller 145 . the sensor member 147 includes a bar 147 a integrally extending to the outside of the one of the plurality of rollers 145 and rotating in an interlocked manner , and a sensor 147 b supported to a bracket 143 b installed at the other side of the extending member 143 and corresponding to the bar 147 a . here , the sensor 147 b may include one of known sensors , such as a proximity sensor or an optical sensor , and is electrically connected to the control unit 150 by a cable ( c ). for example , when a proximity sensor is used as the sensor 147 b , the bar 147 a is preferably made of a metal . the control unit 150 is connected to the wire winding measurement unit 140 and the first and second power devices 131 and 132 and estimates a rotation angle of the floating structure 110 based on the number of revolutions of one of the plurality of rollers 145 having the bar 147 a installed therein . in addition , the control unit 150 controls forward and backward actuation of the pair of first and second power devices 131 and 132 in units of several seconds or several minutes according to reference angles pre - programmed by seasonal and temporal solar orbits . further , when the first and second power devices 131 and 132 are actuated forward and backward , the control unit 150 checks whether one of the plurality of rollers 145 having the bar 147 a installed therein rotates normally or not , thereby safely controlling the floating structure rotating unit 130 . that is to say , a reference time , which can be compared with the rotation time of the one of the plurality of rollers 145 having the bar 147 a installed therein , is input to the control unit 150 . if the rotation time exceeds the reference time , it is determined that the one of the plurality of rollers 145 having the bar 147 a installed therein does not rotate normally , and the actuation of the first and second power devices 131 and 132 is forcibly stopped , thereby preventing over - rotation of the floating structure 110 . here , the control unit 150 may control a greater torque to be applied to the first power device 131 than to the second power device 132 to allow the second wire 134 to be unwound by the wound first wire 133 with a tension . in addition , the floating structure 110 according to the present invention may further include a bearing 125 for rotatably supporting the floating structure 110 between the through - hole 110 b of the floating structure 110 and the circumferential surface of the post 120 . in the embodiment of the present invention , an element for rotatably supporting the floating structure 110 is limited to the bearing 125 , but any element can be adopted so long as it can smoothly rotate the floating structure 110 with respect to the post 120 . that is to say , the floating structure 110 includes gear teeth ( not shown ) formed on its outer peripheral surface , an interlocking gear ( not shown ) engaged with the gear teeth and a driving gear ( not shown ) engaged with the interlocking gear to increase a rotation torque by adjusting a gear ratio , thereby easily rotating the floating structure 110 . hereinafter , a method for controlling the floating structure according to an embodiment of the present invention will be described with reference to the accompanying drawings . as shown in fig4 , the floating structure controlling method according to an embodiment of the present invention includes a first step ( s 10 ) of actuating first and second power devices 131 and 132 forward and backward in a predetermined time unit , a second step ( s 20 ) of measuring a rotation time of a roller 145 having a bar 147 a installed therein when the first and second power devices 131 and 132 are actuated forward and backward , a third step ( s 30 ) of measuring an rotation angle of the floating structure 110 based on an wound amount of the first wire 133 , a fourth step ( s 40 ) of comparing the measured rotation angle of the floating structure 110 with a reference angle input according to the seasonal solar orbit , and a fifth step ( s 50 ) of fixing the floating structure 110 by stopping the actuating of the first and second power devices 131 and 132 . in the first step ( s 10 ), motors of the first and second power devices 131 and 132 are actuated forward and backward for a predetermined time , that is , in units of several seconds or several minutes , to allow the solar energy generating device 115 to move along the solar orbit , thereby rotating the floating structure 110 . that is to say , in order to rotate the floating structure 110 in a clockwise direction ( the solar orbit ) of fig1 , the first wire 133 is wound by driving the motor of the first power device 131 while the second wire 134 is unwound by driving the motor of the second power device 132 . in the second step ( s 20 ), when the first and second power devices 131 and 132 are actuated forward and backward , a rotation time of one of the plurality of rollers 145 having a bar 147 a installed therein is measured using a sensor 147 b and is compared with a reference time input to the control unit 150 , thereby determining whether the one of the plurality of rollers 145 having the bar 147 a installed therein rotates normally or not . if the rotation time of the one of the plurality of rollers 145 having the bar 147 a installed therein exceeds the reference time of the control unit 150 , it is determined that the one of the plurality of rollers 145 having the bar 147 a installed therein does not rotate normally . therefore , the actuating of the first and second power devices 131 and 132 is forcibly stopped , the wire winding measurement unit 140 is checked and repaired , and the process goes back to the first step ( s 10 ). next , in the third step ( s 30 ), the wire winding measurement unit 140 estimates the wound amount of the first wire 133 based on the number of revolutions of the one of the plurality of rollers 145 having the bar 147 a installed therein , thereby measuring the rotation angle of the floating structure 110 on a real time basis . in addition , in the fourth step ( s 40 ), the control unit 150 receives the number of revolutions of the one of the plurality of rollers 145 and compares reference angles set according to seasonal and temporal solar orbits to control the motors of the first and second power devices 131 and 132 to be continuously actuated until the rotation angle of the floating structure 110 reaches a predetermined level . that is to say , if the reference angle is 4 °, the rotation angle of the floating structure 110 can be controlled based on the number of revolutions of the one of the plurality of rollers 145 having the bar 147 a installed therein . if the rotation angle of the floating structure 110 is 2 ° per one revolution of the one of the plurality of rollers 145 , the motors of the first and second power devices 131 and 132 are continuously actuated until the one of the plurality of rollers 145 having the bar 147 a installed therein rotates twice . thereafter , if the number of revolutions of the one of the plurality of rollers 145 is 2 , the actuating of the motors of the first and second power devices 131 and 132 is immediately stopped by a brake , thereby fixing the floating structure 110 the above - described process ( the fourth and fifth steps ) are repeatedly performed in units of several seconds or several minutes before the sunset , thereby accurately controlling the rotation of the floating structure 110 according to the solar orbit . after the sunset , the motors of the first and second power devices 131 and 132 are actuated forward or backward which is opposite to that in the above actuation , thereby restoring the floating structure 110 to a morning start position . meanwhile , as shown in fig5 , a floating structure controlling device according to another embodiment of the present invention further includes a water level measurement unit 160 . here , the post 120 has an internal space 122 and is shaped of a pillar having a laterally cross section corresponding to the through - hole 110 b to penetrate the through - hole 110 b of the floating structure 110 . the post 120 may further include an air inlet hole 124 and a water inlet hole 126 . the air inlet hole 124 is formed at an upper portion of the post 120 . that is to say , the air inlet hole 124 is positioned outside the reservoir or lake , to allow the air present outside the water to be induced into the internal space 122 . the water inlet hole 126 is formed at a lower portion of the post 120 . that is to say , the water inlet hole 126 is positioned in water to allow water to be induced into the internal space 122 . therefore , the water level of the internal space 122 of the post 120 may be equal to the height of the reservoir or lake . referring to fig6 , the water level measurement unit 160 is positioned in the internal space 122 of the post 120 and measures the water level of the reservoir or lake . in more detail , the water level measurement unit 160 may include a buoyancy member 162 and a distance measurement sensor 164 . the buoyancy member 162 is formed using a material having buoyancy and is positioned on a surface of the water induced into the internal space 122 of the post 120 . the buoyancy member 162 may take any shape so long as it is sized to be positioned within the internal space 122 . the distance measurement sensor 164 is mounted in the internal space 122 of the post 120 , detects the buoyancy member 162 and measures a distance from the buoyancy member 162 to the distance measurement sensor . in more detail , the distance measurement sensor 164 is mounted in the internal space 122 of the post 120 , specifically , above the buoyancy member 162 . that is to say , the distance measurement sensor 164 is mounted at a point spaced from the bottom surface of the reservoir or lake at a predetermined height , measures a distance between the distance measurement sensor and the buoyancy member 162 , and calculates a difference of the above distance , thereby measuring the water level of the reservoir or lake . in addition , the distance measurement sensor 164 has a waterproofing function and is mounted under the buoyancy member 162 ( that is , in water ) if it can be operated in water , thereby measuring the water level by measuring the distance between the distance measurement sensor and the buoyancy member . as described above , since the buoyancy member 162 and the distance measurement sensor 164 are positioned in the internal space 122 of the post 120 , the surface of the water induced into the internal space 122 is not affected by waves occurring on the water surface of the reservoir or lake . that is to say , since the buoyancy member 162 is not subjected to up - down movement by the wave , the distance measurement sensor 164 can more accurately measure the distance from the buoyancy member 162 , thereby accurately measuring the water level of the reservoir or lake . hereinafter , a method for controlling a floating structure further including a water level measurement unit 160 according to the present invention will be described with reference to the accompanying drawings . as shown in fig7 , a control unit 150 determines a value measured by the water level measurement unit 160 and actuates first and second power devices 131 and 132 to adjust lengths of the first and second wires 133 and 134 . that is to say , the control unit 150 is mounted at the reservoir or lake side to then be connected to a distance measurement sensor 164 to determine the measured value received from the distance measurement sensor 164 and controls the actuations of the first and second power devices 131 and 132 based on the determination result . the control unit 150 and the distance measurement sensor 164 may be connected to each other on line . in detail , the floating structure 110 moves up and down according to a change in the water level of the reservoir or lake . here , the first and second wires 133 and 134 connected to the floating structure 110 extend to generate tension ( t ), and if the generated tension exceeds a tensile strength of the first and second wires 133 and 134 , the first and second wires 133 and 134 may be broken . therefore , the control unit 150 receives data measured by the water level measurement unit 160 on line and compares the data with a value input to the control unit 150 for determination . in addition , the control unit 150 actuates the first and second power devices 131 and 132 to unwind the first and second wires 133 and 134 wound around a motor device 174 to maintain the tension to be lower than the tensile strength of the first and second wires 133 and 134 , thereby preventing the first and second wires 133 and 134 from being broken . in addition , the control unit 150 may be connected to the first and second power devices 131 and 132 by wires ( not shown ) for transmitting electrical signals . therefore , since the floating structure 110 is not affected by the wave formed in the reservoir or lake , the water level can be accurately measured , and based on the measured water level , lengths of the first and second wires 133 and 134 can be controlled according to the change in the water level of the reservoir or lake , thereby maintaining stability of the floating structure . meanwhile , as shown in fig8 , the floating structure controlling device may further include a rotation preventing wire 170 . the rotation preventing wire 170 is wound around one of top and bottom end of the post 120 ( the bottom end in this embodiment ) and the both ends are engaged with a connecting member 175 of the floating structure 110 . preferably , the both ends of the rotation preventing wire 170 are loosely installed such that rotation of the floating structure 110 is not interfered . here , as shown in fig9 , in order to fix a winding position of the center of the rotation preventing wire 170 , at least one wire fixing member 176 may further be fixedly installed at the post 120 . as shown in fig1 , the wire fixing member 176 has a ‘ u ’ shaped cross section . in a case where both ends of the wire fixing member 176 are fixed , a space is formed in the wire fixing member 176 . therefore , the rotation preventing wire 170 passes the space of the wire fixing member 176 and placed to enable a central winding portion of the rotation preventing wire fixed on a point of the floating structure 110 to be to be safely maintained . here , the same rotation preventing effect can be achieved such that a pair of wire fixing members 176 are fixedly installed on the post 120 in a connecting loop ( not shown ), one end of the rotation preventing wires 170 is connected to the connecting loop and the other end of the rotation preventing wire 170 is cross - linked to the connecting member 175 of the floating structure 110 . in addition , as shown in fig1 , the same rotation preventing effect can also be achieved such that a pair of ground fixing members 177 , instead of the wire fixing member 176 or the connecting loop , are separately installed provided on the bottom of a water depth , one ends of the pair of rotation preventing wires 170 are connected to each other and the other ends of the rotation preventing wires 170 are cross - linked to the connecting member 175 of the floating structure 110 . in this case , both ends of the rotation preventing wire 170 may be loosely installed such that rotation of the floating structure 110 is not interfered . in particular , the post 120 and the pair of ground fixing members 177 are preferably arranged on a line . here , the same effect can be expected even when both ends of the ground fixing member 177 are loosely installed on the ground to be positioned in the same line with the post 120 , rather than on the bottom of the water depth , such that the rotation of the floating structure 110 is not interfered . hereinafter , a method for controlling a floating structure further including a rotation preventing wire 170 according to the present invention will be described with reference to the accompanying drawings . in a case where there is a big wave or wind due to an aggravating water environment , first and second wires 133 and 134 of a floating structure rotating unit 130 may be broken . in such a case , a rotation restraining state in which a floating structure 110 is restrained by the first and second wires 133 and 134 may be released . as the result , an incidence angle with respect to a solar cell module may not be controlled , solar power generation may not be stably operated , and concerns of major facilities being damaged may be raised . in this case , the floating structure 110 rotates in an uncontrollable manner in one direction by the wind and wave . here , the rotation preventing wire 170 having both ends thereof loosely installed at both sides of the floating structure 110 is tightened to restrain rotation of the floating structure 110 , thereby temporarily supporting the floating structure 110 in an emergent situation in which the first and second wires 133 and 134 of the floating structure rotating unit 130 are broken . therefore , even when the floating structure 110 is uncontrollable by the broken first and second wires 133 and 134 due to bad weather , the floating structure 110 can be temporarily supported in a safe manner , thereby preventing a solar power generating device and operating solar power generation in a stable manner after repairing an actuating member . although exemplary embodiments of the present invention have been described in detail hereinabove , it should be understood that many variations and modifications of the basic inventive concept herein described , which may appear to those skilled in the art , will still fall within the spirit and scope of the exemplary embodiments of the present invention as defined by the appended claims . | 7 |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.