id int64 39 79M | url stringlengths 31 227 | text stringlengths 6 334k | source stringlengths 1 150 ⌀ | categories listlengths 1 6 | token_count int64 3 71.8k | subcategories listlengths 0 30 |
|---|---|---|---|---|---|---|
53,543,924 | https://en.wikipedia.org/wiki/Indian%20Machine%20Tool%20Manufacturers%27%20Association | Indian Machine Tool Manufacturers' Association (IMTMA) is the apex industry body for the machine tool sector in India. Comprising large-, medium- and small-scale units, the membership of IMTMA includes manufacturers in the entire range of metal working machine tools, accessories and other ancillary equipment for machine tools, cutting tools and tooling systems along with trading companies.
Objectives
IMTMA supports the machine tool industry of India in increasing its competitiveness, technology, productivity and quality for overall advancement and growth. The association has actively supported initiatives for advancement of metalworking manufacturing industry in India.
Association activities
Membership
The membership of IMTMA is open to any Indian company including large, medium and small scale units engaged in metalworking machine tools, machine tool consumables, accessories and other ancillary equipment for machine tool industry.
Policy advocacy
The association vouches member concerns to the government for formulating policies supporting the machine tool industry. IMTMA provides policy inputs to various government agencies on specific issues referred to it from time to time.
Publications
IMTMA consistently produces research publications. These publications, including the Comprehensive Metal Working Report, Market Research Reports, User Sector Updates, and more, are published at regular intervals and are accessible to both the public and member companies. Covering a wide range of topics, Additionally, IMTMA's newsletters and industry databases serve as resources.
Export development
IMTMA supports the export efforts of its members through various initiatives such as group participation in overseas fairs, trade missions, etc. In view of the periodic variation in machine tool markets it is imperative to develop a healthy market mix between domestic and export market.
Cluster development
IMTMA Cluster Development cell was conceptualized and implemented for the overall development of the cluster. This initiative acted as a focal point for all formal and informal linkages between various cluster actors.
Technology development
IMTMA has taken several initiatives to catalyze technology development among its members and open up new opportunities for research and development by initiating academia-industry cooperation in R&D projects. IMTMA helps members with their technology issues by identifying suitable academic / R&D institutions which have required expertise to develop solutions for them. After sustained advocacy with the Government of India, it was possible to create an Advanced Centre of Excellence for R&D and Technology Development in machine tools with IIT, Madras. This will help develop new technology and products by the machine tool units where the government funds 80% of the development cost as a grant.
C-MAT
As a result of IMTMA's interaction, the Government of India in the year 2009 constituted a C-MAT (Core Advisory Group for Research and Development in the Machine Tools Sector). The industry has implemented several R&D projects through industry-academia partnership by this scheme.
Regional councils
The regional councils of IMTMA promote the growth of the association activities and in particular serve as brand ambassadors for membership enhancement drive. IMTMA has 3 regional councils which play a role in addressing issues of regional importance and serve as liaison between IMTMA head office and regional members.
Centre of excellence
Bangalore International Exhibition Centre
Bangalore International Exhibition Centre (BIEC) was conceptualized by IMTMA with an objective of providing an international standard infrastructure for organizing trade exhibitions, industrial conferences and other business-to-business (B2B) events. Besides hosting IMTEX, BIEC acted as the facilitator for business cooperation in a wide segment of industries such as capital goods, oil and gas equipment, plastics processing, telecom equipment, textile machinery sector, food processing and dairy equipment, automobiles, auto components, aluminum extrusion, electrical and electronics industries and many more.
BIEC venue has also been used by leading industry associations such as Confederation of Indian Industry (CII), Federation of Indian Chambers of Commerce & Industry (FICCI) and many other trade associations for their B2B events. Some of these being:
EXCON 2015 (8th edition) organized by CII in November 2015 for propelling sustainable infrastructure growth.
Bengaluru Space Expo 2014 (Asia's only focused exhibition on space technologies, products and innovations) organized by CII in November 2014.
Indian Medical Expo to be jointly organized by the Department of Pharmaceuticals, Ministry of Chemicals & Fertilizers and FICCI in January 2016 is expected to give a huge boost to the medical electronics industry.
STONA 2016 organized by Federation of Indian Granite and Stone Industry – FIGSI (earlier known as All India Granites and Stone Association - AIGSA) in February 2016. The event is expected to give the natural stone industry in India a significant growth opportunity with higher visibility.
BIEC has hosted prominent events organized by the Government of India as well as the Government of Karnataka at its premises. These being:
Mobile-One E Governance by the Department of IT, BT & ST, Government of Karnataka in December 2014 which had the President of India, Shri Pranab Mukherjee visiting BIEC.
Global Investors Meet by the Government of Karnataka in June 2012 for bringing together business leaders, investors, corporations, thought leaders, policy and opinion makers.
PATA Travel Mart, a travel trade show to showcase travel products and services organized by the Department of Tourism, Government of Karnataka in September 2015.
Mining, Exploration Convention & Trade Show supported by the Ministry of Mines, Government of India in September 2015 to attract investments and technology in the sector.
CeBIT India supported by the Government of Karnataka in October 2015 to help the information technology fraternity in the state.
Expansion
BIEC has constructed a new hall of 17,500 m2, which is an add-on facility to its existing infrastructure. The newly built Hall 4 was inaugurated by Mr. Girish Shankar, Department of Heavy Industry, Ministry of Heavy Industries, Govt. of India on 26 January 2017. IMTEX 2017 inaugurated by Chief Minister of Karnataka Shri Siddaramaiah was the first exhibition held in this hall.
History
The history of the association is the history of the machine tool industry in India. The concept of binding machine tool manufacturers into an association was first mooted at an informal gathering of ‘like-minded’ manufacturers. The manufacturers met at a formal gathering in New Delhi on 20 September 1946 to concretise the thoughts of bringing together all machine tool manufacturers under one umbrella body. The meeting chaired by Sir Dhunjishaw B. Cooper came up with the name of "Indian Machine Tool Manufacturers’ Association" or IMTMA in short for this umbrella body representing the interest of the machine tool industry. The association was granted instant recognition by the government as a body representing machine tool manufacturers in the country. IMTMA was constituted with 19 members.
Executive committee
The seal of recognition of IMTMA was affirmed at the first meeting of the association's executive committee on 28 August 1947 at Indian Merchant's Chamber in Bombay. The chairman of the first executive committee was Sir Dhunjishaw B. Cooper.
Annual meeting
The first annual general meeting of IMTMA was held on 29 January 1948 at Indian Merchant's Chamber at Lalji Naranji Memorial Building in Bombay. A meeting of the first-elected members of IMTMA executive committee followed the first annual general meeting. The meeting unanimously elected M.B. Jambhekar as president of IMTMA and D.S. Mulla as the first vice president of the association. Subsequent annual general meetings of the association were held every year.
Registration
IMTMA was reconstituted as an association registered under the Indian Companies Act in Bombay on 26 March 1973.
Secretariat
In its early days the association operated from Bombay. In 1965 IMTMA moved into its own premises in Rampart Row. In 1991 the association shifted from Bombay to Delhi. IMTMA office in Bangalore came into existence two years later in 1993. With nearly 50% of the machine tool companies being based in Bangalore besides a large concentration of manufacturers in prominent industry sectors such as aerospace, defence, etc. also in the city, IMTMA felt the need of setting up a Centre of Excellence to cater requirements of the industries based in the region and also the need to have a world class exhibition infrastructure. With those thoughts BIEC was constituted. This eventually became the head office of IMTMA and the Gurgaon office becoming the regional office in north.
IMTEX
The first "All India Machine Tool Exhibition" was held in 1969 in the premises Godrej & Boyce Manufacturing Company Private Limited in Vikhroli, Mumbai, over 7,000 square metres. Initially christened as the "All India Machine Tool Exhibition", this later became "IMTEX". Bombay continued to host IMTEX for the next two decades until 1989. In 1992, IMTEX moved from Bombay to New Delhi and was held in Pragati Maidan with participation from over 600 companies. IMTEX and concurrent Tooltech exhibition was held in Bangalore for the first time in 2007, when IMTMA constructed a new venue called the Bangalore International Exhibition Centre (BIEC). IMTMA continues to host the IMTEX (metal cutting) every odd year and IMTEX FORMING (metal forming) every even year at BIEC.
See also
International Textile Machinery Association exhibition
References
IMTMA elects new President and VP; OEM Update; 12 January 2016
IMTMA’s AGM Ends on a High Note; MMI India; 15 December 2015
P.G. Jadeja elected as new IMTMA President; The Machinist; 16 December 2015
69th Annual General Meeting of Indian Machine Tool Manufacturers’ Association: P.G. Jadeja Elected as New President; Machine Tool World; December 2015
P G Jadeja Elected As New President of IMTMA; AutoParts Asia; 15 December 2015
IMTMA hosts Delhi Machine Tool Expo 2015, prime focus on regional manufacturing; ET Auto.com; 21 August 2015
Indian machine tool industry sees growing use of software in manufacturing; Auto Car Professional; 7 August 2015
IMTMA Inaugurates Technology Center in Pune; MMI India; 15 January 2015
Machine tool demand up; growth impulse back: IMTMA; Economic Times; 20 August 2014
IMTMA to make engineering graduates industry-ready; Business Standard; 25 January 2011
Trade associations based in India
Chambers of commerce in India
Non-profit organisations based in India
Organisations based in Bengaluru
Organizations established in 1946
1946 establishments in India
Machine tools
Manufacturing in India | Indian Machine Tool Manufacturers' Association | [
"Engineering"
] | 2,067 | [
"Machine tools",
"Industrial machinery"
] |
53,544,120 | https://en.wikipedia.org/wiki/NGC%202782 | NGC 2782 is a peculiar spiral galaxy that formed after a galaxy merger in the constellation Lynx. The galaxy lies 75 million light years away from Earth, which means, given its apparent dimensions, that NGC 2782 is approximately 100,000 light years across. NGC 2782 has an active galactic nucleus and it is a starburst and a type 1 Seyfert galaxy. NGC 2782 is mentioned in the Atlas of Peculiar Galaxies in the category galaxies with adjacent loops.
Structure
Active galactic nucleus
The nucleus and circumnuclear region of NGC 2782 display starburst activity, with bar of the galaxy providing gas to the nucleus. The active galactic nucleus is hidden by a compact high-column-density absorber and a H2O maser is associated with it. The vigorous star formation creates an unusual "superwind" of out-flowing gas, which has been detected in X-rays as a bubble like structure, approximately 7 arcsec south of the central region of the galaxy. A similar bubble can be seen in radiowaves at the north side. There is also diffuse X-rays emission. The nucleus of NGC 2782 is a low luminosity active galactic nucleus.
Tidal tails
NGC 2782 shows two tidal tails, extending in opposite directions. As depicted in HI imaging, a plume extends about 5 arcmin toward the northwest, with an estimated mass of of atomic hydrogen, accounting for about 40 percent of the total HI mass of the system. A shorter HI plume extending toward the east has been associated with the stellar tail which extends 2.7 arcmin toward the east in the optical images. The northwest tail is fainter in the optical spectrum. CO was detected in the eastern tail, underlying the presence of molecular gas and HII regions in the region, with total mass of or even more. There is star formation activity in the eastern tail. In the western tail, 7 UV sources have been detected. These stellar populations are 1 to 11 million years old. Three of them have high metallicity, similar to that of the nucleus of the galaxy.
Ultraluminous X-ray sources
Via observations by the Chandra X-ray Observatory, 27 X-ray point sources, of which 13 are ultraluminous X-ray sources (without counting the central one), were observed near the nucleus and are likely associated with the galaxy. This number is unusually high for a galaxy, although ultraluminous X-ray sources are common in starburst galaxies. Sixteen of these sources have a visual counterpart.
Supernovae
Two supernovae have been observed in NGC 2782. On 24 December, 1994, Reiki Kushida discovered SN 1994ak (Type IIn, mag. 16). On 20 August, 2020, Quanzhi Ye and Xing Gao discovered SN 2020scc (Type Ia, mag. 13.7).
Nearby galaxies
NGC 2782 is the largest galaxy in a small group of four galaxies. Nearby galaxies include UGC 4867 and UGC 4871 and further away lie NGC 2785 and UGC 4889.
References
External links
Spiral galaxies
Galaxy mergers
Starburst galaxies
Seyfert galaxies
Lynx (constellation)
2782
04852
215
26034
Peculiar galaxies | NGC 2782 | [
"Astronomy"
] | 659 | [
"Lynx (constellation)",
"Constellations"
] |
53,544,167 | https://en.wikipedia.org/wiki/Hungarian%20Astronautical%20Society | Hungarian Astronautical Society abbreviated as MANT (Magyar Asztronautikai Társaság), is a non-profit organization focusing on educational and informative activities on space science, founded in 1986.
The association considers itself a successor of the Astronautical Committee of the association called Scientific Lyceum (Hun. abbr.: TIT), founded in 1956; and the Central Astronautical Section of the Federation of Technological and Sciences Associations (Hun. abbr.: MTESZ).
Members of the society are space researchers, other professionals concerned in space-related fields and others interested in the interdisciplinary and state-of-the-art uses of outer space.
Aims
The main aims of the society are:
to recruit people for space research and engineering;
to use space research and applications to educate about STEM fields like physics, astronomy, biology, studies on (space and flight) medicine, flight technology, meteorology and about other fields related like (space) law, sociology, psychology;
to develop the independent and team-working skills and creativity of students by organizing youth competitions, group competitions and summer space camps;
to publicize space research and everyday applications of space not only in public events but also through media relations;
to keep contact with Hungarian space researchers and engineers working abroad;
to keep the memory of the great Hungarian pioneers of astronautics;
to act for Hungary in the International Astronautical Federation (IAF) (member since 1959) and in the International Academy of Astronautics (IAA); representing Hungary at the annual International Astronautical Congress as the only participating Hungarian organization;
to improve international connections which is even more important since Hungary has become a Member State of the European Space Agency (ESA).
Regular events
Main regular events of the society:
Hungarian Summer Space Camp (since 1994)
Student Competition (since 1992)
The Way to Space! Space contest for Hungarian-speaking high-school students
Hungarian Space Academy (since 2015)
Space Academy Club (since 2014, in February, April, September, November)
Space Research Day (every fall)
Hungarian Space Research Forum (biennial, odd years)
H-SPACE Conference (international conference in English since 2015, biennial, even years)
Publications
Hungarian Space Studies Annuary, since 1961 HU ISSN 1788-7771
English-Hungarian Space Dictionary, in cooperation with International Academy of Astronautics (IAA) as contribution to the IAA Multilingual Space Dictionary
"Science is Born" (Tudomány születik) – Book of Interviews with Creators of Hungarian Space Studies,
"Expanding Borders" (Táguló határok) – Book of Interviews with Hungarian Space Researchers of the '70s and '80s,
"Our Space Campers" (Űrtáborosaink) - Book of Interviews with 12 former participants of the Hungarian Space Camp
Hungarian Space Camp
History
The camp was founded by Aunt Magdi, the "Space Granny", in 1994. Her intent was to introduce space research and astronautics to the youth. That time the program of the camp consisted mostly of lectures presented by the best-known Hungarian scientists in the field. Later the camp had a younger leadership, leading to a shift to more active and creative programs. From 2010 the duration of the camp is one week, from Sunday to Saturday.
The participants are students between the age of 13 and 18, all interested in sciences and space topics. We are proud of the fact that the ratio of the girls among the participants is approaching 50%. About quarter of the students return next year and every fifth student becomes a regular camper. Some acknowledged space researchers started their "space career" in the Space Camp, like two of the secretaries general and several Members of Board.
Locations
1994 – Kecskemét, 1995 – Eger, 1996 – Veszprém, 1997 – Veszprém, 1998 – Győr, 1999 – Kecskemét, 2000 – Sopron, 2001 – Debrecen, 2002 – Székesfehérvár, 2003 – Budapest, 2004 – Kiskunhalas, 2005 – Gyulaháza, 2006 – Szentlélek, 2007 – Hollóstető, 2008 – Szentlélek, 2010 – Gyomaendrőd, 2011 – Sátoraljaújhely, 2012 – Kecskemét, 2013 – Alsómocsolád, 2014 – Felsőtárkány, 2015 – Sopron, 2016 – Debrecen, 2017 – Bakonybél, 2018 - Zalaegerszeg, 2019 - Sátoraljaújhely, 2020 - virtual (3-day online event), 2021 - virtual (3-day online event), 2022 - Székesfehérvár (planned)
Student competition
MANT organizes a competition for primary and secondary school students every year. The topics announced in around October are always different, but focus on a current aspect of space research and exploration.
Lectures and activities
In the camp space researchers and astronautical experts give lectures. Topics cover a wide range, from the basics of astronomy through problems of space debris to deciding the dilemma if Pluto is a planet or not. Other activities include several practical exercises make the camp exciting, e.g. water rocketry, underwater assembly, creating stereo pictures, astronomical observation, excursions, bathing, etc. There is a main topic every year which meets the topic of the Student Competition.
Mentor Program
Since 2015 private individuals and companies are invited to co-finance the Hungarian Space Camp as Mentors. MANT welcomes financial support of participation of needy students from Hungary and from the Hungarian diaspora in the surrounding countries. In the past years about one fifth of the participants was able to join the Camp by favor of a Mentor.
Student competition
MANT yearly announces a Student Competition for primary and secondary school students, since 1992. The topics announced around October are always different, but focus on a current aspect of space research and exploration. The topic of the Student Competition is going to be the main topic of the Space Camp of that year. E.g. title of the Competition was "Civilians in Space" in 2014, "Beyond Mars" in 2015 and "Cleaning in Space" in 2017.
Categories: writing essay; drawing; preparing project plan; creating video, website, Facebook page or blog.
Small teams of two or three students are also welcome. Applications are evaluated in two age classes: age between 11–14 and 15–18. The competition is open for visually impaired students as well. Their works are evaluated separately.
Prizes include participation in the Space Camp for free or for a reduced fee; science books and magazines; a visit to a selected space research institute or company; free one-year membership in the society.
Other activities
Space Academy
Hungarian Astronautical Society in collaboration with the international Space Generation Advisory Council initiated a yearly event called Space Academy in 2015 for university students and young professionals between ages 18 and 35. It is a four-day workshop in August where the participants outline a solution for a given task or problem together.
2015: Voice of Youth – Which Way Now in the European Space Agency?
2016: Design Experiment to the International Space Station!
Space Academy Club
Space Academy Club is a lecture series organized by the Hungarian Astronautical Society and the Hungarian organizers of Space Generation Advisory Council. It takes place usually in February, April, September and November, during university semesters. It targets primarily university students and young professionals of the age between 18 and 35. The series is connected with Space Academy in their name and their target groups.
Hungarian Space Studies Annuary (alias Space Brochure, Hun: Űrtan évkönyv)
MANT has been publishing its Astronautical Brochure since 1961, presenting the recent activities of MANT and summarizing the globally most significant affairs of space research. Hungarian researchers working in space research and its interdisciplinary fields present their latest results.
Space Research Day
Space Research Day is organized yearly. It joins the international World Space Week in October. It usually takes place at one of the universities of Budapest, or at the Hungarian Academy of Sciences. The program consists of lectures on actual space activities and space related results and exchange of views. There are blocks for professionals, interested amateurs and students.
Hungarian Space Research Forum (Ionosphere and Magnetosphere Physics Seminar)
Hungarian Space Research Forum is a traditional biennial conference of researchers of the field, to be held for the 30th time in 2017. Its former title and now subtitle Ionosphere and Magnetosphere Physical Seminar expresses its original specialty which gained a broader horizon in the past decades.
Hungarian physicists, geophysicists, astronomers, meteorologists etc. take part in this seminar by presenting their latest researches through lectures and posters.
School Day
MANT is willing to provide lectures for schools in various fields related to space activities titled School Day.
Radio Connection between Students and Charles Simonyi on board of ISS [2007]
Dr. Charles Simonyi, the first repeat space tourist launched on April 7, 2007 (GMT), on board Soyuz TMA-10 to the International Space Station and returned on April 21, 2007, on his first space flight. The Hungarian-born Simonyi is a licensed amateur radio operator (KE7KDP) and he contacted students of Puskás Tivadar Távközlési Technikum (Puskás Tivadar Telecommunications Polytechnic, Budapest) on April 13. This occasion of radio contact was organized in collaboration with MANT.
Structure
This structure is used since 2009 (as of April 2020):
All-time honorary president: Prof. Dr. Almár, Iván
President
Vice presidents
Secretary general
Deputies to secretary general
Administrative committee
Presidential Board
Audit Committee
Honorary members
Almár, Iván
Apáthy, István
Bán, András
Farkas, Bertalan
Horváth, András
Pap, László
Simonyi, Charles
Solymosi, János
Szabó, József
Szalai, Sándor
Abonyi, Ivánné (deceased)
Bencze Pál (deceased)
Detrekői Ákos (deceased)
Gál Gyula (deceased)
Ponori Thewrewk Aurél (deceased)
Somogyi Antal (deceased)
Some well-known members of MANT (present or past)
Almár, Iván astronomer
Detrekői, Ákos geodesist
Farkas, Bertalan flied astronaut
Fonó, Albert engineer, inventor
Gál, Gyula professor of space law
Kulin, György astronomer
Magyari, Béla trained astronaut
Ponori Thewrewk, Aurél astronomer
Simonyi, Charles "space tourist"
References
See also
Iván Almár, astronomer, lately working in SETI
Bertalan Farkas, the first Hungarian flied cosmonaut
Albert Fonó Inventor, working on turbojet and ramjet propulsion, first to patent a ramjet engine in 1928
György Kulin astronomer, discovered several minor planets
Béla Magyari, Colonel of the Hungarian Air Force, trained cosmonaut
Astronomy in Hungary
Science and technology studies associations
Scientific organisations based in Hungary
Aerospace engineering organizations | Hungarian Astronautical Society | [
"Technology",
"Engineering"
] | 2,240 | [
"Aerospace engineering organizations",
"Aeronautics organizations",
"Science and technology studies",
"Aerospace engineering",
"Science and technology studies associations"
] |
53,545,145 | https://en.wikipedia.org/wiki/Grimmia%20pulvinata | Grimmia pulvinata, otherwise known as grey-cushioned grimmia or pulvinate dry rock moss, is a bryophyte moss common in temperate climates worldwide.
Characteristics
Grimmia pulvinata grows in small cushion-like shaped, around 1–2 centimeters tall. Its color ranges from a grey-green to an orange-yellow. Its leaves are lanceolate, being broad and oval shaped at the base and very narrow toward the tip. They may show a silvery hue near the tip in some specimens. Its capsules are oval shaped, and bend back into the leaves when the plant is dry, and stand out when it is moist.
Habitat
Grimmia pulvinata colonizes a variety of surfaces including rocks, concrete, and tree trunks. It is tolerant of a wide range of pH levels on surfaces, allowing it to live on many types of rock.
However, it prefers surfaces such as old mortar and tree trunks.
Distribution
Grimmia pulvinata is the most common species in the genus Grimmia, with a nearly worldwide distribution. It is particularly common in Britain and the west coast of North America. It lives primarily in temperate regions, from sea level to elevations up to 9800 feet.
Ecological role
Grimmia pulvinata is a pioneer species, meaning it is among the first organisms to colonize habitat which has been disturbed by an event such as a forest fire. Its resistance to pollution allows it to colonize urban areas such as roofs, walls, and tarmac.
References
Grimmiales
Lithophytes
Epiphytes | Grimmia pulvinata | [
"Biology"
] | 321 | [
"Lithophytes",
"Plants"
] |
53,545,300 | https://en.wikipedia.org/wiki/Plain%20hunt | In method ringing, a branch of change ringing, the ringing pattern known as plain hunt is the simplest method of generating continuously changing sequences, and is a fundamental building-block of method ringing.
Explanation
Plain hunting consists of a linear undeviating course of a bell between the first and last places in the striking order, with two strikes in the first and last position to enable a turn-around.
On eight bells this is shown in the accompanying diagram below, where all the bells are plain hunting. The bells are written out in their striking order, and each sequence is a "change":
Thus each bell moves one position at each succeeding change, unless they reach the first or last position, when they remain there for two changes then proceed to the other end of the sequence.
This simple rule can be extended to any number of bells, so that on 12 bells for instance, 24 unique changes can be obtained.
Example – plain hunt on eight bells
1 2 3 4 5 6 7 8- start in rounds (rounds is the descending sequence of bells)
2 1 4 3 6 5 8 7
2 4 1 6 3 8 5 7
4 2 6 1 8 3 7 5
4 6 2 8 1 7 3 5
6 4 8 2 7 1 5 3
6 8 4 7 2 5 1 3
8 6 7 4 5 2 3 1
8 7 6 5 4 3 2 1 – reverse rounds
7 8 5 6 3 4 1 2
7 5 8 3 6 1 4 2
5 7 3 8 1 6 2 4
5 3 7 1 8 2 6 4
3 5 1 7 2 8 4 6
3 1 5 2 7 4 8 6
1 3 2 5 4 7 6 8
1 2 3 4 5 6 7 8 – finish in rounds
Limitations
Plain hunt is limited to a small number of possible different changes, which is numerically equal to twice the number of bells that are hunting. However, by introducing deviations from the plain hunt, by causing some of the bells to change their relationship to the others, change ringing "methods" were developed. These allow a large range of possible different changes to be rung; even to the extent of the full factorial sequence of changes.
Used as a method building block
The diagram on the right shows how plain hunt is used as a building-block in other ringing methods.
Bell number 1 is always plain hunting (shown in blue), and the other bells plain hunt but they change their pattern when bell number 1 is the first bell in the sequence. An example of one bell which is deviating from plain hunt is shown in red.
This variation on plain hunt means that up to 60 changes can be rung without repetition in this case.
There are thousands of ringing methods which incorporate blocks of plain hunt, and are only distinguished by different deviations at set points. These deviations define a particular ringing method in change ringing.
References
External links
Plain hunt diagram
Multiple plain hunt diagrams resource
Video of plain hunt ringing
Campanology
Permutations | Plain hunt | [
"Mathematics"
] | 596 | [
"Functions and mappings",
"Permutations",
"Mathematical objects",
"Combinatorics",
"Mathematical relations"
] |
53,545,555 | https://en.wikipedia.org/wiki/Outage%20probability | In Information theory, outage probability of a communication channel is the probability that a given information rate is not supported, because of variable channel capacity. Outage probability is defined as the probability that information rate is less than the required threshold information rate. It is the probability that an outage will occur within a specified time period.
Slow-fading channel
For example, the channel capacity for slow-fading channel is C = log2(1 + h2 SNR), where h is the fading coefficient and SNR is a signal to noise ratio without fading. As C is random, no constant rate is available. There may be a chance that information rate may go below to required threshold level. For slow fading channel, outage probability = P(C < r) = P(log2(1 + h2 SNR) < r), where r is the required threshold information rate.
See also
Shannon–Hartley theorem
Fading channel
References
Information theory | Outage probability | [
"Mathematics",
"Technology",
"Engineering"
] | 193 | [
"Telecommunications engineering",
"Applied mathematics",
"Computer science",
"Information theory"
] |
53,545,784 | https://en.wikipedia.org/wiki/Purple%20sweet%20potato%20color | Purple sweet potato color (PSPC) is a natural anthocyanin food coloring obtained from the sweet potato (Ipomoea batatas). Some cultivars, like the Ayamurasaki, released in Japan in 1995, are specially developed to have a higher anthocyanin content.
It is reported to have potential application as an antimutagenic, antioxidant, and anti-inflammatory. There is evidence it is protective against injury induced by D-galactose and has potential as a treatment for galactosemia.
The following chemical components of PSPC have been identified.
cyanidin 3-caffeoylsophoroside-5-glucoside
peonidin 3-caffeoylsophoroside-5-glucoside
cyanidin 3-caffeoyl-p-hydroxybenzoylsophoroside-5-glucoside
peonidin 3-caffeoyl-p-hydroxybenzoyl-sophoroside-5-glucoside
peonidin-caffeoyl-feruloylsophoroside-5-glucoside
cyanidin 3-caffeoylsophoroside-5-glucoside
cyanidin 3-(6′′,6′′′-dicaffeoylsophoroside)-5-glucoside
cyanidin 3-(6′′-caffeoyl-6′′′-feruloylsophoroside)-5-glucoside
peonidin 3-O-(6-O-(E)-caffeoyl-2-O-beta-D-glucopyranosyl-beta-D-glucopyranoside)-5-O-beta-D-glucoside
cyanidin 3-O-(6-O-p-coumaroyl)-beta-D-glucopyranoside
peonidin 3-O-(2-O-(6-O-(E)-caffeoyl-beta-D-glucopyranosyl)-6-O-(E)-caffeoyl-beta-D-glucopyranoside)-5-O-beta-D-glucopyranoside
peonidin 3-O-(2-O-(6-O-(E)-feruloyl-beta-D-glucopyranosyl)-6-O-(E)-caffeoyl-beta-D-glucopyranoside)-5-O-beta-D-glucopyranoside
References
Anthocyanins
Food colorings
Sweet potatoes | Purple sweet potato color | [
"Chemistry"
] | 596 | [
"PH indicators",
"Anthocyanins"
] |
53,545,809 | https://en.wikipedia.org/wiki/Motolimod | Motolimod (VTX-2337) is a drug which acts as a potent and selective agonist of toll-like receptor 8 (TLR8), a receptor involved in the regulation of the immune system. It is used to stimulate the immune system, and has potential application as an adjuvant therapy in cancer chemotherapy, although clinical trials have shown only modest benefits. It also worsens neuropathic pain in animal models and has been used to research the potential of targeting TLR8 in some kinds of chronic pain syndromes.
See also
Imiquimod
Vesatolimod
References
Nitrogen heterocycles
Amides
Amines | Motolimod | [
"Chemistry"
] | 135 | [
"Amines",
"Amides",
"Bases (chemistry)",
"Functional groups"
] |
53,545,863 | https://en.wikipedia.org/wiki/UGV%20Interoperability%20Profile | UGV Interoperability Profile (UGV IOP), Robotics and Autonomous Systems – Ground IOP (RAS-G IOP) or simply IOP was originally an initiative started by the United States Department of Defense (DoD) to organize and maintain open architecture interoperability standards for Unmanned Ground Vehicles (UGV). A primary goal of this initiative is to leverage existing and emerging standards within the Unmanned Vehicle (UxV) community such as the Society of Automotive Engineers (SAE) AS-4 Joint Architecture for Unmanned Systems (JAUS) standard and the Army Unmanned Aircraft Systems (UAS) Project Office IOPs.
The IOP was initially created by U.S. Army Robotic Systems Joint Project Office (RS JPO): and is currently maintained by the U.S. Army Project Manager Force Projection (PM FP).
The plural form Interoperability Profiles (IOPs) typically refers to the set of documents, which comprise the IOP and its intended usage. The IOPs are approved for public release. The National Advanced Mobility Consortium (NAMC) makes the IOPs available at the https://namcgroups.org website for registered users.
Basic Concepts
From a system perspective, the IOP is defined to address interoperability at multiple levels within varying systems configurations, e.g.:
OCU/UxV(s): Between Operator Control Units (OCU) and one or more Unmanned Vehicles (UxV(s))
Intra-OCU: Between and among OCU hardware and software elements.
Intra-UxV: Between and among UxV subsystems, payloads and platforms.
OCU/UxV/C2: Between OCUs, UxVs and external C2 systems to exchange command and control, battlespace and audio/video information.
A key solution to this is the utilization of JAUS to establish a common message passing layer between the software components of the system. The IOP specifies rules for the use of standard JAUS messages as well as custom extensions to the standard message set.
For the interoperability of hardware components, the IOP also includes the specification of hardware plugs and mounts.
Versions
The DoD intends to publish revisions to the IOP every other year. The current version is IOP version 2.0 (IOPv2). The release of version 3.0 is scheduled for the end of 2017.
Since version 3.0 the whole set of IOP documents is auto-generated from XML files.
Document Structure & Overview
The IOPs consist of the following documents
Overarching Profile Provides the base concepts, architecture, requirements, and overview for the IOP; and specifically addresses platform, payload, mobility, on-vehicle network, communication, and logical interoperability messaging requirements. Additionally, this document introduces and presents the conformance and validation approach to be employed within the IOP.
Capabilities Plan Defines capability requirements related to the employment and usage of UGVs to perform current and relevant near-term robotic missions, in turn scoping and bounding the content of the IOP.
SAE JAUS Profiling Rules Specifies the manner in which the SAE AS-4 JAUS standards have been profiled, to include clarification or additional content to define interoperability between controllers and UGVs as well as intra-UGV (platform/subsystem) interoperability.
Custom Services, Messages and Transports Specifies additional SAE AS-4 JAUS messages and transport protocols required to support the scope of the IOP. Although titled “custom”, these messages are published and standardized within the IOP community with the end goal of transitioning to the SAE AS-4 JAUS standard(s) or other standards bodies for official adoption.
Control Profile Specifies the Operator Control Unit (OCU) logical architecture, standards, Human-Machine Interface (HMI) requirements, and conformance approach to include host application user interface requirements, such as mission planning and command and control. Although OCU concepts and high level architecture are touched upon in the Overarching Profile, the Control Profile provides the more detailed requirements to specify how interoperability is to be achieved for conformant controllers.
Payloads Profile Specifies the payload classification, standards, requirements, and conformance approach. Although these concepts are touched upon in the Overarching Profile, the Payloads Profile provides the more detailed requirements to specify the interoperability requirements for payloads with respect to the UGV platform.
Communications Profile Specifies the communications standards, requirements, and conformance approach. Although these concepts are touched upon in the Overarching Profile, the Communications Profile provides the more detailed requirements to specify interoperability requirements for communications between and among controllers and UGVs.
Applique Profile Specifies the appliqué systems classification, standards, requirements, and conformance approach. Although these concepts are touched upon in the Overarching Profile, the Applique Profile provides the more detailed requirements to specify the interoperability requirements for appliqué systems with respect to the unmanned ground systems, controllers, and base manned vehicle systems.
Conformance Validation Tool
To validate the conformance of UGV components to IOP attributes (JAUS Profiling Rules), TARDEC has developed a software tool called Conformance Validation Tool (CVT). The CVT is a client tool that checks the interface (JAUS messages) and protocol (state) of the required JAUS services.
The CVT uses the original IOP XML-files to generate test messages. Thus, the CVT is considered to be the IOP reference implementation.
Significance and Distribution
NATO
The NATO Team of Experts on UGV has recommended the IOP to become a NATO STANAG. The proposal is being considered by NATO Land Capability Group Land Engagement (LCG LE). To prove the applicability of IOP to military robots, the NATO Team of Experts on UGV conducted several interoperability exercises and demonstrations.
Commercial use
Several robotics companies already support IOP-compliant interfaces for their software or hardware products.
Academia
Several academic robotics contests, like the IOP Challenge of the Intelligent Ground Vehicle Competition or the European Robotics Hackathon (EnRicH) recommend or require IOP as a common interface definition.
Connection to other robotics middlewares
As IOP relies on the message passing architecture of JAUS, IOP-compliant software can be connected to other robotics middlewares through translating software bridges. Studies have shown, that IOP-compliant software can coexist with ROS-based robotics software.
See also
Joint Architecture for Unmanned Systems (JAUS)
References
External links
U.S. Army Project Manager Force Projection (PM FP): Maintainers of the IOP
National Advanced Mobility Consortium (NAMC): Publishers of the IOP
Interoperability
Unmanned ground combat vehicles
Unmanned ground vehicles | UGV Interoperability Profile | [
"Engineering"
] | 1,399 | [
"Telecommunications engineering",
"Interoperability"
] |
53,546,885 | https://en.wikipedia.org/wiki/Phosphates%20in%20detergent | Phosphates in detergent refers to the use of phosphates as an ingredient in a detergent product. The advantage of using phosphates in a consumer laundry detergent or dishwashing detergent is that they make detergents more efficient by chelating calcium and magnesium ions. The disadvantage of using phosphates is that they remain in wastewater and eventually make their way to a natural body of water. While phosphates are low toxicity, they instead cause nutrient pollution and feed the algae. This leads to eutrophication and harmful algal bloom.
Many countries have banned the use of phosphates in detergent, including the European Union and the United States.
Regulation
States including Maine, Florida, and Indiana in the United States began restricting or banning the use of phosphates in laundry detergent in the early 1970s, culminating in a nationwide voluntary ban in 1994. In July 2010, 17 states followed up with bans on its use in automatic dishwasher detergent.
In 2004, the European Union introduced regulations to require biodegradability in all detergents.
In 2011 the European Commission announced that the European Parliament had ordered a ban of phosphates in consumer laundry detergent by June 2013 and a ban in dishwasher detergent by January 2017.
Australia began phasing out the use of phosphates in its detergents in 2011, with an all-out ban expected to take effect in 2014.
Canada banned some phosphates in detergent in 2011.
Italy started phasing out phosphates in the 1980s.
Pursuant to findings published in 2006 by the Shenkar College of Engineering and Design indicating that liquid detergents are "much more environment-friendly" than powdered detergents, Israel's Ministry of the Environment began recommending that consumers prefer liquid detergent over powdered ones "for laundry which is not heavily stained."
Discussion of banning phosphates from detergents in the United States started because of pollution of the Great Lakes. Seventeen US states have partial or full bans on the use of phosphates in dish detergent, and two US states (Maryland and New York) ban phosphates in commercial dishwashing. In 1983 there was a corruption scandal in which industry sought to influence government regulators regarding the ban.
Some dishwashing detergents may contain phosphorus, an ingredient which at least two states in the United States have limited use in dishwashing detergent.
Environmental impact
Phosphates have low toxicity in the environment but cause nutrient pollution, a major water quality problem in many watersheds. Phosphates in water cause eutrophication of algae which creates conditions favorable to formation of harmful algal blooms. These blooms prevent light and oxygen from getting into the water, leading to the death of organisms in the ecosystem.
Studies have revisited the question of whether existing household phosphate bans are effective in reducing phosphorus concentration in waterways, and subsequent algal blooms. A 2014 case study of Vermont phosphate policies around Lake Champlain showed that while the bans reduced the phosphate contribution by treated wastewater from households to five percent of the total contribution, phosphate levels did not decline and in fact increased slightly, due primarily to increased contributions of similar magnitudes from stormwater runoff and agricultural sources. As a result, algal blooms have continued to worsen.
Most dishwasher detergent contains complex phosphates, as they have several properties that aid in effective cleaning. However, the same chemicals have been removed from laundry detergents in many countries as a result of concerns raised about the increase in algal blooms in waterways caused by increasing phosphate levels (see eutrophication).
Phosphorus that runs into freshwater lakes and rivers can cause algal blooms. Phosphate-free detergent reduces the amount of phosphate that wastewater treatment plants must clean up.
From the 1960s-2010s the standard way to determine the amount of phosphate in water has been using colorimetry. It is possible to use optical sensors for measurements, which could be easier and cheaper, but this is not a common practice.
Uses
Sodium tripolyphosphate was an excellent builder used in laundry detergent powders. However, due to issues of biodegradability many countries have banned the use of phosphates in detergents. Manufacturers are using substitutes such as EDTA and other biodegradable chemicals instead.
Phosphates bind calcium and magnesium ions to prevent 'hard-water' type limescale deposits. They can cause ecological damage, so their use is starting to be phased out. Phosphate-free detergents are sold as eco-friendly detergents.
In the 21st century phosphates began to be reduced in percentage terms as an ingredient, leading to a New York Times report that said "low- or phosphate-free dishwasher detergents it tested, including those from environmentally friendly product lines that have been on the market for years, none matched the performance of products with phosphates".
Society and culture
History of discussion
There was a conflict between industry which wanted to continue to use phosphates and advocates of banning who wanted to preserve water quality.
In the 1960s scientists recognized that phosphates in water caused eutrophication. There was disagreement at that time about whether water with high phosphate came to have the chemical because of somehow being polluted with it. By the 1970s it was established that high phosphate levels in water were a consequence of pollution. Discussion began about how to respond to the effects of phosphates as a pollutant in both fresh and marine water.
Marketing
Detergent companies claimed it is not cost effective to make separate batches of detergent for the states with phosphate bans (although detergents are typically formulated for local markets), and so most have voluntarily removed phosphates from all dishwasher detergents.
According to The Washington Post, phosphorus keeps "minerals from interfering with the cleaning process and prevent food particles from depositing again on dishes." According to Time magazine, "One reason detergent makers have been using large amounts of phosphorus is that it binds with dirt and keeps it suspended in water, allowing the other cleaning agents to do their best work. Phosphorus is especially important in regions with hard water because the presence of lots of minerals can interfere with cleaning agents."
Marketplace response
Product testing by Consumer Reports found that new detergent formulations without phosphates, but with chemicals such as sodium citrate, polyacrylates, polycarboxylates, and tetrasodium etidronate did not wash dishes as well but were satisfactory replacement products. Similarly, testing found that phosphate bans in laundry detergent led to newer products which did not clean clothes as well but still could compete with the older products containing phosphate.
A 1973 paper in psychology predicted a consumer response from the perspective of removing a behavioral freedom.
References
External links
Nutrient Pollution, a guide by the United States Environmental Protection Agency
Detergents
Phosphates
Pollutants | Phosphates in detergent | [
"Chemistry",
"Technology"
] | 1,385 | [
"Phosphates",
"Salts"
] |
53,546,903 | https://en.wikipedia.org/wiki/Pavel%20Jungwirth | Pavel Jungwirth (born 20 May 1966 in Prague, Czech Republic) is a Czech physical chemist. Since 2004, he has been the head of the Senior Research Group at the Institute of Organic Chemistry and Biochemistry of the Czech Academy of Sciences. He has also been a professor in the Faculty of Mathematics and Physics at Charles University since 2000. He has also been a senior editor of the Journal of Physical Chemistry since 2009. He is popularly known for studying the explosive reaction between alkali metals, such as sodium and potassium, and water; his research on this subject indicates that these reactions result from a Coulomb explosion. He and his colleagues have also discovered a way to slow down this reaction, which they used to determine the source of a blue flash that is briefly produced during the reaction.
Pavel Jungwirth is a coordinator of an international science competition Dream Chemistry Award.
References
Czech chemists
Living people
1966 births
Charles University alumni
Academic staff of Charles University
Scientists from Prague
Organic chemists
Institute of Organic Chemistry and Biochemistry of the CAS | Pavel Jungwirth | [
"Chemistry"
] | 207 | [
"Organic chemists"
] |
53,547,112 | https://en.wikipedia.org/wiki/Samuelson%E2%80%93Berkowitz%20algorithm | In mathematics, the Samuelson–Berkowitz algorithm efficiently computes the characteristic polynomial of an matrix whose entries may be elements of any unital commutative ring. Unlike the Faddeev–LeVerrier algorithm, it performs no divisions, so may be applied to a wider range of algebraic structures.
Description of the algorithm
The Samuelson–Berkowitz algorithm applied to a matrix produces a vector whose entries are the coefficient of the characteristic polynomial of . It computes this coefficients vector recursively as the product of a Toeplitz matrix and the coefficients vector an principal submatrix.
Let be an matrix partitioned so that
The first principal submatrix of is the matrix . Associate with the Toeplitz matrix
defined by
if is ,
if is ,
and in general
That is, all super diagonals of consist of zeros, the main diagonal consists of ones, the first subdiagonal consists of and the th subdiagonal
consists of .
The algorithm is then applied recursively to , producing the Toeplitz matrix times the characteristic polynomial of , etc. Finally, the characteristic polynomial of the matrix is simply . The Samuelson–Berkowitz algorithm then states that the vector defined by
contains the coefficients of the characteristic polynomial of .
Because each of the may be computed independently, the algorithm is highly parallelizable.
References
Linear algebra
Polynomials
Numerical linear algebra | Samuelson–Berkowitz algorithm | [
"Mathematics"
] | 281 | [
"Linear algebra",
"Polynomials",
"Algebra"
] |
76,370,114 | https://en.wikipedia.org/wiki/Hidden%20line | In mathematics, a hidden line is a geometric edge line that is not visible from an observer's view of a shape or object.
A common practice is to draw the visible edges as solid lines and the hidden lines as dotted lines, dashed lines, or thinner lines than the visible lines.
Hidden lines add geometric information about the unseen sides of an object. They are used to help a person visualize drawings of geometric objects in three-dimensional space.
A three-dimensional object drawn with solid visible and hidden lines is a wire-frame model of the object.
Geometry objects without hidden lines
When a student is first introduced to a geometric cube, a cube without hidden lines looks like a closed box which they are familiar. Drawing an object without hidden lines, matches an observer's view of the object. Less lines makes an object easier to draw.
To draw higher dimensional cubes, hypercubes, without hidden lines, make the faces opaque. Then, the hidden lines are no longer visible, they are removed from the observer's view.
This works with a cube in three-dimensional space, a Tesseract
in four-dimensional space, a hypercube
in five-dimensional space, and will work with higher dimensions as well.
Hidden lines in technical drawings
Hidden lines represent edges of a physical object that are not visible from a specific viewpoint. Visible lines are viewable edges from the specified viewpoint. Visible lines are drawn as solid lines and hidden lines are drawn as lines of short dashes evenly spaced. Hidden lines are particularly useful when viewing an object from an angle where the visible only lines do not have much information. In a computer drawing application the option may be referred to a wire frame with hidden edges. The hidden edges would be dashed lines.
Removing hidden lines is important in computer design and graphics applications. There are algorithmic solutions to remove hidden lines or partially hidden lines during an object's rendering.
See also
Hidden-surface determination
Technical drawing
References
External links
What are the advantages and disadvantages of using dashed or dotted hidden lines?
Elementary geometry
Multi-dimensional geometry
Graphical projections
Technical drawing | Hidden line | [
"Mathematics",
"Engineering"
] | 422 | [
"Functions and mappings",
"Graphical projections",
"Design engineering",
"Mathematical objects",
"Elementary mathematics",
"Elementary geometry",
"Civil engineering",
"Mathematical relations",
"Technical drawing"
] |
76,370,202 | https://en.wikipedia.org/wiki/Helvella%20compressa | Helvella compressa, also known as the compressed elfin saddle, is a species of ascomycete "sac fungus" related to the Peziza cups. Helvella compressa is endemic to North America west of the Rocky Mountains. According to David Arora, H. compressa "seems to be the most common" of the non-fluted Helvellas found in California. Helvella compressa is possibly also present in China and Tibet.
The distinctive fruiting body looks roughly like a fortune cookie on a stick and can only be confused with Helvella albella, which is rarer, and has a darker brown cap and a smooth underside (rather than H. compressa's "faintly" fuzzy underside) and H. elastica, which is smaller, with "rounder lobes". H. compressa can be distinguished from Helvella atra by its coloration.
Helvella compressa is genetically closely related to H. stevensii, H. corbierei, and H. levis (synonym of Helvella latispora). H. levis is more common in Europe and the Danish call it Bredsporet foldhat ("wide-brimmed hat"). Helvella stevensii is smaller and paler than H. compressa.
See also
Helvella ephippium
Paragyromitra infula
References
compressa
Fungi of Asia
Fungi of North America
Fungus species
Fungi described in 1936 | Helvella compressa | [
"Biology"
] | 325 | [
"Fungi",
"Fungus species"
] |
76,370,295 | https://en.wikipedia.org/wiki/NGC%202523 | NGC 2523 is a barred spiral galaxy located around 168 million light-years away in the constellation Camelopardalis. NGC 2523 was discovered on 7 September 1885 by the American astronomer Edward Swift, and is approximately 120,000 light-years across. NGC 2523 does not have much star formation, and it does not have an active galactic nucleus.
NGC 2523 is one of several galaxies chosen by Halton Arp as an example of a spiral galaxy that has a separation of one of its arms. It is listed in Arp's Atlas of Peculiar Galaxies as Arp 9.
NGC 2523 group
According to A.M. Garcia, NGC 2523 is the largest and brightest galaxy of the NGC 2523 Group (also known as LGG 154), which contains 5 galaxies, including NGC 2441, NGC 2550A, UGC 4041, and UGC 4199.
Supernova
One supernova has been observed in NGC 2523: SN2024aeee (typeII, mag. 16) was discovered by Shinichi Ono on 17 December 2024.
See also
List of NGC objects (2001–3000)
References
External links
18850907
2523
Barred spiral galaxies
Camelopardalis
Discoveries by Edward Swift
04271
009
08092+7343
023128
+12-08-031 | NGC 2523 | [
"Astronomy"
] | 276 | [
"Camelopardalis",
"Constellations"
] |
76,370,310 | https://en.wikipedia.org/wiki/Donna%20DeEtte%20Elbert | Donna DeEtte Elbert (27 January 192815 January 2019) was an American mathematician and scientist.
Early life and education
Born 27 January 1928 in Williams Bay, Wisconsin to William Lawrence Elbert and Sue Melicent Hatch, Donna DeEtte Elbert was the second of three siblings. She attended Williams Bay Elementary School and Williams Bay High School, graduating in 1945.
When Elbert accepted her position to work for astrophysicist Subrahmanyan Chandrasekhar in 1948, she did not have any official education in advanced mathematics. It was only after Elbert’s employer Chandrasekhar encouraged her to enroll in advanced mathematics courses at the University of Wisconsin–Madison did she formally obtain education in advanced mathematics such as calculus. Despite her now-formal start in college mathematics, she pursued and graduated with a Bachelors of Fine Arts degree from School of the Art Institute of Chicago in 1974. She also received six weeks of education from Parsons School of Design in New York City during the summer of 1956, during which Chandrasekhar worked at Los Alamos.
Science career
At 20 years of age and without college education, Elbert began working as a human "computer" for Subrahmanyan Chandrasekhar at the Yerkes Observatory in Wisconsin in the autumn of 1948. She later also worked both at Yerkes and the University of Chicago. Although she originally intended to work under Chandrasekhar only long enough so that she could afford attending design college, she continued to work for the astrophysicist for over the next thirty years.
Elbert’s first major set of contributions to Chandrasekhar’s research, which resulted in her explicit name recognition, was computing solutions to sophisticated differential equations to numerically and algebraically solve for variables in relation to Heisenberg’s theory of turbulence. Although she did not gain co-authorship for her mathematical work, Chandrasekhar did give her his thanks in the paper’s closing remarks: "In conclusion, I wish to record my indebtedness to Miss Donna Elbert for valuable assistance with the various numerical integrations involved in the preparation of this paper".
After continuing to provide Chandrasekhar with mathematical assistance, he encouraged Elbert, who had no prior official education in advanced mathematics, to study advanced mathematics courses at the University of Wisconsin, Madison.
Elbert achieved co-authorship of 18 papers with Chandrasekhar with her work in analyzing turbulence, magnetohydrodynamics, polarization of the sunlit sky, rotating flows, convection, and other topics as she progressed into a more central role in Chardrasekhar’s group’s research, promoting herself beyond her original role as a computer. Despite this step-up, Elbert still conducted much of Chandrasekhar’s numerical work, often producing solutions that were more further simplified compared to Chandrasekhar’s. Elbert also authored her own paper, “Bessel and Related Functions Which Occur in Hydromagnetics," published in The Astrophysical Journal in 1957.
Elbert continued to conduct research with Chandrasekhar until 1979.
Elbert range
During Elbert’s research with Chandrasekhar on the book later published under the title Hydrodynamic and Hydromagnetic Stability, Elbert noted a range of values in the hydrodynamic and hydromagnetic marginal stability curves which result in local minima surrounded by extreme changes. Despite Elbert’s key insight and extensive work on the book, she was not given co-authorship of the work by Chandrasekhar. Instead, Chandrasekhar thanked Elbert in only a single footnote.
Researcher and scholar Susanne Horn of the Coventry University (UK) and postdoctoral associate Jonathan Aurnou of UCLA (USA) now build on Elbert’s key insight about a range of body’s specific values on hydrodynamic and hydromagnetic marginal stability curves that lead to unusually strong magnetic fields in their publication The Elbert Range of magnetostrophic convection I. Linear Theory. This specific range of values is now known as the Elbert range.
Horn and Arnou reveal that studying the Elbert Range can yield crucial insight into research on objects such as stars and exoplanets. In the case of exoplanets, objects that fall within the Elbert Range, such as earth, have substantially strong magnetic fields that can deflect harmful radiation, increasing the probability that life similar to that we know exists on that exoplanet.
Very Briefly: The Elbert Range
Bodies that have fluid and conductive interiors, such as Earth with its molten liquid metallic core, can create their own magnetic fields due to the movement of charge within their conductive cores. The fluid’s motion depends largely on two factors: 1) the combination of the body’s rotational velocity and size, which affects the Coriolis Force on the fluids, and 2) convection of the fluid caused by differences in temperature in different sections of the fluid. For bodies that lie in the Elbert Range, the strength of the motion of the conductive fluid caused by the Coriolis Effect and convection are approximately equal, causing the fluid to flow more uniformly in an orderly manner. This uniformity of flow allows for the generation of strong magnetic fields around the body. On the other hand, most bodies do not lie in the Elbert Range, and their conductive cores (if they have one) do not flow in an orderly fashion. Disparate contributions of fluid flow caused by the Coriolis Effect and convection cause disruptive flow patterns, resulting in only weak magnetic fields. Horn and Arnou expanded on Elbert’s work regarding the Elbert Range with modern computational and analytical tools.
Personal life
Despite working long hours for Chandrasekhar, Elbert and her family still remained in close touch with her community in Williams Bay. She served as the treasurer of Walworth County Historical Society for 15 years, and her father owned a local barbershop from 1929 to 1970. She picked up many hobbies, including art, piano, and genealogy, because of which she joined the Mayflower Society and Daughters of the Revolution. At one point she took piano lessons with Chandrasekhar, though he quit after their teacher progressed through the basics too fast for Chandrasekhar’s liking. On vacations, Elbert would read books recommended to her by her boss and discuss them with him upon her return.
Elbert died on 15 January 2019 at the age of 90 at Aurora Lakeland Medical Center in Wisconsin due to a brief illness.
References
1928 births
2019 deaths
American mathematicians
American women mathematicians
People from Williams Bay, Wisconsin
Human computers
American astrophysicists
American women astrophysicists
School of the Art Institute of Chicago alumni | Donna DeEtte Elbert | [
"Technology"
] | 1,361 | [
"Human computers",
"History of computing"
] |
76,370,925 | https://en.wikipedia.org/wiki/Phyllosticta%20concava | Phyllosticta concava, also known as opuntia dry rot or prickly pear brown spot, is a species of fungus that infects opuntia cactus, leaving discolored circular depressions in the pads. The species was first formally described by the mycologist Fred Jay Seaver in 1922.
References
Botryosphaeriaceae
Fungal plant pathogens and diseases
Opuntia
Fungus species
Fungi described in 1922
Taxa named by Fred Jay Seaver | Phyllosticta concava | [
"Biology"
] | 98 | [
"Fungi",
"Fungus species"
] |
76,371,283 | https://en.wikipedia.org/wiki/Inonotus%20andersonii | Inonotus andersonii, also known as oak canker-rot and heart rot, is a species of resupinate polypore fungus that forms fruiting bodies underneath tree bark. I. andersonii induces canker rot in oak, hickory, cottonwood, and willow trees.
Wood that has been infected by this species appears bleached of color and crumbles easily. Where sapwood decay reaches the cambium, the cambium may be killed, giving rise to an externally visible canker. The cankers caused by I. andersonii are commonly elongate and may become callused at the edges. The bark near expanding or developing cankers may also ooze varying amounts of dark sap. Affected branches or trees may show general symptoms of decline including poor growth, thinning, dieback, epicormic shoots (short twiggy branches arising from dormant buds on large-diameter stems) and branch or trunk failures. Generally, trees with canker rots decline slowly, often appearing to die from the top down as they slowly fall apart over a period of many years. The fruiting bodies (basidiocarps) of this fungus may appear on living trees or on recently failed stems.
I. andersonii is "a true pathogen of living trees with a pronounced specificity for oak, [that] exhibits annual, widely effused fruitbodies, monomitic hyphal system, and broadly ellipsoid, yellowish, thick-walled basidiospores." Inonotus andersonii and similar canker rots are serious pathogens of California oaks and are associated with oak decline, failure, and mortality in many California oak woodlands.
See also
Inonotus dryophilus
References
andersonii
Natural history of the California chaparral and woodlands
Plant pathogens and diseases
Fungus species | Inonotus andersonii | [
"Biology"
] | 376 | [
"Fungi",
"Plant pathogens and diseases",
"Fungus species",
"Plants"
] |
76,371,466 | https://en.wikipedia.org/wiki/Heisook%20Lee | Heisook Lee (, born 1948) is a South Korean mathematician and activist for gender equality in mathematics. She is retired as a professor of mathematics and dean at Ewha Womans University. Her mathematical research has concerned abstract algebra and algebraic coding theory, including work on self-dual codes and bent functions.
Lee graduated from Ewha Womans University in 1971. After a master's degree in 1974 from the University of British Columbia in Canada, she completed a Ph.D. in 1978 from Queen's University at Kingston, also in Canada. Her dissertation, The Brauer Group of an Integral Scheme, was supervised by Morris Orzech.
After postdoctoral research in Germany at the University of Regensburg, she returned to Ewha Womans University in 1980, as a professor of mathematics. She became dean of natural sciences and dean of research affairs from 1997 to 2001, and dean of graduate studies from 2006 to 2008.
Lee became founding editor of Communications of the Korean Mathematical Society in 1986. From 1994 to 1996 she was editor in chief of the Journal of the Korean Mathematical Society. She was the second president of the Korea Federation of Women's Science & Technology Associations (KOFWST), serving from 2006 to 2007. She founded the Center for Women in Science, Engineering, and Technology (WISET), now the Korean Foundation for Women in Science, Engineering, and Technology, and became its first president, serving from 2013 to 2016.
She is a professor emeritus at Ewha Womans University, and president of the Korea Center for Gendered Innovations (GISTeR).
References
1948 births
Living people
South Korean mathematicians
South Korean women mathematicians
Algebraists
Coding theorists
Ewha Womans University alumni
University of British Columbia alumni
Queen's University at Kingston alumni
Academic staff of Ewha Womans University | Heisook Lee | [
"Mathematics"
] | 369 | [
"Algebra",
"Algebraists"
] |
76,371,909 | https://en.wikipedia.org/wiki/ASMPT | ASMPT (formerly ASM Pacific Technology) is a Singapore-headquartered company listed in Hong Kong that designs and manufactures machines and tools used in semiconductor and electronics assembly industries. It was originally the Asia division of ASM International (ASM).
History
In 1975, ASM founder Arthur del Prado went to Hong Kong for a business meeting with its customer Philips. During his time there, he took the opportunity to survey the prospects for the semiconductor industry in Hong Kong. Eventually he established ASM Pacific Technology (ASMPT) with Patrick Lam, an electrical engineer that del Prado recruited during his visit. At first, the company’s business was acting as an agent for the sales of semiconductor materials and shelf production in Asia.
Originally ASMPT was an Asian sales branch of ASM which derived its revenue from the sale of encapsulation equipment from the Netherlands and related materials from U.S. By 1977, ASMPT had established a sizeable customer base and moved into small-scale production of mold bases. Soon it was producing custom-designed trim and form tools.
In 1979, ASMPT made two landmark decisions. The first was to acquire a 10,000 square-foot industrial property to support its move into the production of lead frames. The second was the acquisition of a wire bonder manufacturing business in Hong Kong from an American company.
In 1980, ASMPT looked into designing its own automated equipment. To do this, the company went on an aggressive recruitment spree to attract young engineering university graduates. In 1981, it launched a conversion kit that enabled manual aluminum wire bonder to operate semi-automatically. By 1984, it launched its fully-automatic wire bonders. In 1985, ASMPT produced its first die bonder aimed at LED manufacturers. By the end of the 1980s, the sales of leadframes and equipment provided steady profit streams for ASMPT.
At the end of 1989, ASMPT opened a plant in Shenzhen. ASMPT shifted its attention from manufacturing to research and development (R&D). Singapore was selected as its new R&D location due to tax incentives from the Economic Development Board. Former ASMPT CEO, Lee Wai-kwong stated that Hong Kong engineers would find a solution in the shortest possible time and be done with it while Singapore engineers would take longer to understand the root cause and come up with a more effective solution.
ASMPT's growth was financed mainly through retained earnings and bank loans. To expand further, ASMPT chose to become a public company to acquire additional funding. In January 1989, ASMPT held its initial public offering by listing on the Hong Kong Stock Exchange with del Prado as chairman and Lam as managing director.
In 2011, ASMPT acquired the electronics assembly systems business of Siemens.
ASMPT acquired AMICRA Microtechnologies GmbH in April 2018.
In August 2018, ASMPT acquired acquired Critical Manufacturing.
ASM has reduced its stake in ASMPT over the years. In 1997, 51% of ASMPT was owned by ASM. In 2013, it sold 11.9% of ASMPT making it no longer a majority shareholder. By 2018, ASM's stake in ASMPT was at 25% and Elliott Investment Management was pushing for ASM to divest from ASMPT. At that time one of the potential buyers was TCL Technology.
In recent times, ASMPT has been exploring going private. It would later relist on the Shanghai Stock Exchange STAR Market where it would obtain higher valuations. ASM supported the proposal although it would not divest its stake. In February 2021, ASM and EV Group partnered to develop die-to-wafer bonding techniques for 3d-IC.
In August 2022, the company changed its name from ASM Pacific Technology to ASMPT to avoid confusion with ASM International.
In March 2023 it was reported that PAG was interested in acquiring ASMPT. In October 2024, it was reported that Kohlberg Kravis Roberts was considering acquiring ASMPT.
See also
ASM International
References
External links
1975 establishments in Hong Kong
Companies of Singapore
Companies listed on the Hong Kong Stock Exchange
Electronics companies established in 1975
Equipment semiconductor companies
Semiconductor companies of Singapore | ASMPT | [
"Engineering"
] | 845 | [
"Equipment semiconductor companies",
"Semiconductor fabrication equipment"
] |
76,372,796 | https://en.wikipedia.org/wiki/Maria-Elena%20Torres-Padilla | Maria-Elena Torres-Padilla is a Mexican biologist who is the Director of the Stem Cell Center, the Director of the Institute for Epigenetics and Stem Cells (IES), and a Group Leader at the Helmholtz Zentrum München, Germany.
Education
From 1994 until 1998, Torres-Padilla completed her undergraduate studies at the Faculty of Sciences of the National Autonomous University of Mexico in Mexico and earned her Ph.D. from the Institut Pasteur in Paris in 2002.
Career and research
Between 2002 and 2006, she was a postdoctoral fellow at The Gurdon Institute, University of Cambridge, UK, after which she worked as a permanent scientist under Laszlo Tora's supervision.
Since December 2008, she has led her research group at the Institute of Genetics, Molecular and Cellular Biology (IGBMC) in Strasbourg, France. In January 2016, the lab was relocated to the Institute of Epigenetics and Stem Cells at the Helmholtz Zentrum München, Germany.
The primary objective of Torres-Padilla's research activities is to comprehend the manner in which epigenetic information controls the shifts in cellular identity and cellular reprogramming. This is crucial in comprehending pluripotent stem cell biology, particularly their development and origin. The work also endeavors to gain insight into the early stages of embryonic development, human reproduction, fertility, and stem cell biology from a broader perspective.
Torres-Padilla is an editorial board member of Science, Development, Genes & Development, and Scientific Reports.
Awards and honours
2011 ERC Starting Grant - "NuclearPotency"
2015 EMBO Member
2018 Female Award of the German Stem Cell Network
2019 Profiled in Development
2023 Member of the Latin American Academy of Sciences
2023 Member of the German National Academy of Sciences Leopoldina
References
Living people
European Research Council grantees
National Autonomous University of Mexico alumni
Stem cell researchers
Year of birth missing (living people) | Maria-Elena Torres-Padilla | [
"Biology"
] | 389 | [
"Stem cell researchers",
"Stem cell research"
] |
76,372,922 | https://en.wikipedia.org/wiki/Enitociclib | Enitociclib is an experimental drug that is being investigated for the treatment of cancer. It is an inhibitor of the kinase CDK9.
References
2-Aminopyridines
Kinase inhibitors
Fluorobenzene derivatives
Methoxy compounds
Imines
Sulfones | Enitociclib | [
"Chemistry"
] | 55 | [
"Pharmacology",
"Functional groups",
"Medicinal chemistry stubs",
"Sulfones",
"Pharmacology stubs"
] |
76,373,233 | https://en.wikipedia.org/wiki/LHS%201678 | LHS 1678 (TOI-696) is an astrometric binary star system, located about 65 light-years from the Earth in the constellation Caelum. It is made up of a red dwarf and a companion star whose nature is still uncertain, but is likely to be a brown dwarf. The red dwarf star is known to host three small, close-in exoplanets. The apparent magnitude of LHS 1678 is 12.5, which is too dim to be seen with the naked eye or a small telescope.
Characteristics
LHS 1678 is a binary star, more precisely an astrometric binary. It is made up of a red dwarf star and a likely brown dwarf star. They are sometimes called LHS 1678 A and B, respectively. The projected separation of the system, i.e. the observed separation between both stars, is a maximum of . The orbit is expected to be highly inclined, and the orbital period is in the order of decades, with two possible values of 42 and 100 years, as well as semi-major axes of 36 and 210 AU.
The system is located in the southern celestial hemisphere, within the constellation Caelum. The apparent magnitude is 12.5, which is too faint to be seen to the naked eye or even a small telescope. Gaia DR3 provides a parallax of to LHS 1678, which translates into a distance of to the system. LHS 1678 is moving away from Earth at a velocity of 10.9 km/s. The system has a high proper motion, from 1983 to 2022, it has moved 0.5 arcminutes across the sky.
LHS 1678 A
The primary component of the system is a red dwarf star (spectral type M3V, sometimes called LHS 1678 A) which has 0.345 times the mass and 0.329 times the Sun's radius. It has a surface effective temperature of , which is significantly cooler than the Sun, and is emitting a luminosity equivalent to 1.45% of the solar luminosity. LHS 1678 A is metal-poor compared to the Sun, with an abundance of iron equivalent to 44% of the solar level. Its rotational period is between (the Sun's rotational period is 24.5 days for reference), and its age is estimated to be 4.22 billion years. It hosts three exoplanets orbiting it which are smaller than Earth.
LHS 1678 A occupes an unusual position in the HR diagram. It is located in a narrow position in the diagram, characterized by a gap in the lower main sequence. This gap, which can be more accurately described as a deficit of stars, is associated with a transition from partially convective interiors to fully convective interiors in red dwarfs.
The star has little variability in its brightness, no signs of starspots or stellar flares have been found during two months of observations. It also shows no signs of magnetic activity.
LHS 1678 B
The secondary companion is a probable brown dwarf, sometimes called LHS 1678 B, that has been detected trough long-baseline astrometry from RECONS. Observations from the Very Large Telescope's NaCo adaptive optics rule out any companion with a mass larger than at a projected separation larger than 5 astronomical units. The companion has been not observed directly. It may be instead a Jovian planet, but the astrometric monitoring data indicates that it is likely a brown dwarf. The possibility of the companion to be a white dwarf is ruled out by the astrometry and radial velocity of the system. It is more likely in or below the hydrogen burning limit, but is nature remains uncertain.
The nearest star to the system is Alpha Caeli, at a distance of 3.3 light-years. Alpha Caeli is also the brightest star in Caelum.
Planetary system
The red dwarf LHS 1678 hosts three exoplanets, which are smaller than Earth and were discovered by the transit method. The first exoplanets discovered were LHS 1678 b and c, discovered by , which also announced the existence of a third possible exoplanet. This planet was later confirmed in 2024, and received the designation LHS 1678 d.
All planets are close to their host star: LHS 1678 b, c and d have orbital periods of about 21 hours, 3.7 and 5 days respectively. LHS 1678 c and d are close to a 4:3 orbital resonance, meaning that for every four orbits completed by LHS 1678 c, LHS 1678 d completes three orbits. Orbital resonances in planetary systems are occasionally linked to transit-timing variations, but no transit-timing variations were detected during a 3-year span.
The masses of the planets have been not measured, but future high-quality radial velocity measurements might measure their masses. Estimates of , and for the planets b, c and d were placed using the forecaster procedure, with large margins of error.
Notes
References
Caelum
Astrometric binaries
Binary stars
Brown dwarfs
Planetary systems with three confirmed planets
2MASS objects
M-type main-sequence stars
WISE objects
TIC objects | LHS 1678 | [
"Astronomy"
] | 1,060 | [
"Caelum",
"Constellations"
] |
76,373,639 | https://en.wikipedia.org/wiki/Attic%20ochre | Attic ochre or attic yellow ocher () — the historically known variety of ochre, which had a bright lemon yellow color, was considered the best and most expensive type of ochre in Ancient Greece and Rome. Attic ochre was used mainly for high-quality finishing work or decoration of household items. In painting, it was used to depict light, say, in contrast to achian ochre, which was used to paint shadows. This variety was mined in the immediate vicinity of Athens, from the ore veins of the silver mines near Koliada (, Κωλιάδα άκρα), as well as in the Laurian silver mines.
Attic bright yellow clay was considered to be of particularly high quality; it was homogeneous, had no inclusions, and held the surface perfectly, even to the point of appearing a slight shine when smoothed, which made a favorable impression. Dioscorides in his treatise “On Medicinal Substances” recommended taking Attic ochre for medical use.
History
The peak of Attic ochre production occurred in old Hellenic times. Already by the first century BC, this pigment was considered very rare in Rome, since the veins had been worked out to a large extent in the previous period. Marcus Vitruvius Pollio, in the seventh chapter (″Natural Colors″) of the seventh book of his architectural works, laments that “...the best Attic ochre is no longer available, because when there were slaves in the silver mines in Athens, they dug shafts underground in search of silver. Encountering a vein of ochre there, they tried to mine ochre along with silver; therefore the ancients had at their disposal excellent supplies of ochre for finishing their works.”
Pliny the Elder fully confirms his opinion in Natural History (book thirty-three). “The best ochre is the one called Attic; its price is 2 denarii per pound. The next one is marbled, the price is half that of the Attic one.”
Use
First of all, Attic ochre was used for painting rooms and high-quality finishing works, as well as for decorating ceramics and household items. According to the same Pliny, Greek painters used six types of ochre. The best of them, the so-called Sil atticum, was used for those cases when it was necessary to depict light. It is believed that the introduction of Attic ochre into paintings began quite late, in the 1st century AD. It was first used in their works by the Greek painters Polygnotus and Micon, as well as Apelles, Echion, Melanthius and Nicomachus. They used only four colors (ochres) in their work, one of which was Attic ochre, which depicted light and the light parts of the picture.
The work of Polygnotus, which has been preserved more than others, allows us to judge the range of paints and pigments with which he worked. His palette, however, like other artists of that time, was quite limited. It included white (melinium), yellow (atticum, Attic ochre), red (sinopis pontica) and black (atramentum) paints. Of course, one cannot understand the evidence of antiquity to mean that only four colors are found in the works of Polygnotus. The four pigments mentioned above, when mixed with each other in different proportions, result in more than eight hundred different shades.
To this it should be added that in ancient times ochre remained the only or almost the only yellow pigment available. When composing yellow paint itself, ochre was often mixed with chalk or lime.
The high cost and lack of Attic ochre forced us to look for recipes for simulating its color using artificial means. Thus, in the last, fourteenth chapter of the same book (“Paints replacing crimson, ochre, mountain green and indigo”), Vitruvius describes one of the methods used by house painters to obtain the color of Attic ochre from boiled dried violets and chalk.
Properties
Attic ochre is homogeneous and well-tanned, it has a provocatively bright light yellow color, reminiscent of the solar spectrum or even lighter. It is stable, does not fade in sunlight and does not decompose from exposure to atmospheric factors. However, this type of ochre should not be confused with Attic ceramics proper, which also had a reputation for high quality. Unlike the bright yellow ocher, Attic clay is light orange to reddish brown in color and often contains small mica sparkles.
Of the modern paints that are closer in tone to Attic ochre, one can name, first of all, golden ochre.
References
See also
Ochre
Antimony ochre
Golden ochre
Ochre (disambiguation)
Iron ochre
Clay
List of inorganic pigments
List of colors
Yellow
Shades of yellow
Pigments
Paints
Ancient Greek art
Iron oxide pigments
Clay | Attic ochre | [
"Chemistry"
] | 1,005 | [
"Paints",
"Coatings"
] |
76,376,038 | https://en.wikipedia.org/wiki/Caveja | A (, ) is a wrought iron rod which was fixed at the helm of a plough or cart to prevent the dislodging of an ox's yoke in the event of a sudden stop. It is a symbol of the historical region of Romagna in northern Italy, where it was widely used. In the rest of Italy, the is more commonly known as a or .
Use and decorations
In the agricultural societies of Romagna, a was fixed at the helm of a plough or cart, which would be driven by two oxen side by side. The pinned the oxen's shared yoke to the helm, preventing the yoke from dislodging in the event of a sudden stop. The also alleviated the yoke's weight on the oxen.
Each is topped by a stylised motif known as a . Typical include depictions of a rooster, a crescent moon, the Sun, an eagle, a dragon, hearts, or small breasts (representing prosperity). Some adopted religious motifs, such as a cross, dove (representing the Holy Spirit), or peacock (representing the Resurrection). Coloured bows could be added for further decoration.
Between one and three pairs of rings hang on the . The rings resonate with lively sounds as the oxen are driven, leading to the 's alternative name of (). Originally, a single ring was used to assist manoeuvres; the jingle it emitted served a further practical purpose by alerting other road users of the oxen.
Along with church bells, the rings would be tied between Maundy Thursday and Holy Saturday to deafen them as part of the religious observance of Holy Week. In some areas of Romagna, the is called (), attributed to a legend of a town that temporarily replaced its broken church bell with a .
History
The earliest examples of are undecorated metal pins dating to the 14th and 15th centuries. The metal pins were superior to wooden alternatives, which were susceptible to wear and tear from rubbing against the oxen. Over time, additional rings were added to the for the pleasantness of their jingle. By the mid-18th century, the had become a status symbol: wealthier families were distinguished by more pairs of rings and more elaborate decorations. were especially exhibited at village fairs, with some families owning "parade" not intended for agricultural use. It was traditional for the to be part of a bride's dowry, with a bronze ring in their stem and hearts in their .
The features in Romagna's folklore. In one ritual, the , the oldest woman in the house, could tell the sex of an unborn child by making the sign of the cross with a , circling the seated pregnant woman three times, and placing the on a base by a lighted candle. If the left rings stopped chiming first, it suggested the birth of a boy, while the right rings suggested a girl, and an indeterminate result suggested a miscarriage. The was also used in rituals to avert storms, pray for the forgiveness of debts, bless the houses of newlyweds, and capture bees. The could also be used to ward off the , mischievous nocturnal elves, by planting it outside a tormented victim's house.
In popular culture
The is among Romagna's most recognisable symbols. It features in unofficial regional flags, the most popular of which depicts a rooster holding a on a red and yellow background. Some hotels and restaurants in Romagna are named after the . In 1963, a regional journalism prize was known as the (), a name shared with a regional cinematography prize launched in 1983.
A 1908 poem by Giovanni Pascoli describes farmers braking a wagon using a " with a ringing bell", which he compares to "a ship's mast". The first literary mention of the instead appears in (1912), a Romagnol poem by . The poem compares the to "a campanile that unties its bells", with "all the passion of a song that dies", "a sound that seems silver, like the laughter of a child who never stays still", and "the big voice of a father...that would like to be bad and instead is a friend". The poem concludes that the is "the good music of fatigue". Spallicci's poem is widely attributed with promoting the 's status as a symbol of Romagna.
Following the 2023 Emilia-Romagna floods, several fundraisers used the to inspire donations to the region, including a calendar distributed by Il Resto del Carlino in Cesena, and a series of personalised keys featuring the on one side to raise funds for the Manfrediana Library in Faenza.
References
Emilia-Romagna
Agriculture in Italy
Agriculture in popular culture
Animal equipment | Caveja | [
"Biology"
] | 979 | [
"Animal equipment",
"Animals"
] |
76,377,909 | https://en.wikipedia.org/wiki/Craterellus%20atrocinereus | Craterellus atrocinereus, commonly known as the black chanterelle or California black chanterelle, is a species of edible fungus native to western North America. This uncommon species is a mycorrhizal associate of live oak, tanoak, and Oregon white oak in Oregon and northern California, where it is found most often in the vicinity of Monterey Bay. This species has a "fruity-cheesy" odor, and fruits in winter and spring. This bluish-gray to black chanterelle was previously considered to be Craterellus cinereus but was recognized as a distinct species in 2015. The specific name is a nod to C. cinereus, with the Latin prefix atro meaning dark and cinereus (akin to cinders) referring to its smoky gray coloration.
See also
Cantharellus californicus
Craterellus calicornucopioides
References
Edible fungi of California
Mycorrhizal associates of oaks
atrocinereus
Edible fungi
Fungi of California
Fungi described in 2015
Fungus species
Fungi of Oregon | Craterellus atrocinereus | [
"Biology"
] | 220 | [
"Fungi",
"Fungus species"
] |
76,378,014 | https://en.wikipedia.org/wiki/List%20of%20BIM%20software | The following table provides an overview of notable building information modeling (BIM) software.
See also
Arcadia (engineering)
BIMx
BuildingSMART
Computer-aided architectural design
Comparison of computer-aided design software
List of 3D modeling software
List of 3D computer graphics software
List of CAx companies
List of computer-aided engineering software
List of computer-aided manufacturing software
List of free and open-source software packages
Navisworks
Open Design Alliance
Procore
References
Building information modeling
3d Modelling Software
3D graphics software
Software | List of BIM software | [
"Technology",
"Engineering"
] | 99 | [
"Computing-related lists",
"Lists of software",
"Building information modeling",
"Building engineering"
] |
76,378,703 | https://en.wikipedia.org/wiki/List%20of%20computer-aided%20manufacturing%20software | This is a list of computer-aided manufacturing (CAM) software.
See also
APT (programming language)
Numerical control (CNC machining)
Computer-aided manufacturing
Comparison of computer-aided design software
G-code
List of 3D modeling software
List of 3D computer graphics software
List of 3D printing software
List of BIM software
List of computer-aided engineering software
List of CAx companies
References
3d Modelling Software
Computer-aided manufacturing software
Computer-aided manufacturing software for Linux | List of computer-aided manufacturing software | [
"Technology"
] | 94 | [
"Computing-related lists",
"Lists of software"
] |
76,380,163 | https://en.wikipedia.org/wiki/Taylor%E2%80%93Maccoll%20flow | Taylor–Maccoll flow refers to the steady flow behind a conical shock wave that is attached to a solid cone. The flow is named after G. I. Taylor and J. W. Maccoll, whom described the flow in 1933, guided by an earlier work of Theodore von Kármán.
Mathematical description
Consider a steady supersonic flow past a solid cone that has a semi-vertical angle . A conical shock wave can form in this situation, with the vertex of the shock wave lying at the vertex of the solid cone. If it were a two-dimensional problem, i.e., for a supersonic flow past a wedge, then the incoming stream would have deflected through an angle upon crossing the shock wave so that streamlines behind the shock wave would be parallel to the wedge sides. Such a simple turnover of streamlines is not possible for three-dimensional case. After passing through the shock wave, the streamlines are curved and only asymptotically they approach the generators of the cone. The curving of streamlines is accompanied by a gradual increase in density and decrease in velocity, in addition to those increments/decrements effected at the shock wave.
The direction and magnitude of the velocity immediately behind the oblique shock wave is given by weak branch of the shock polar. This particularly suggests that for each value of incoming Mach number , there exists a maximum value of beyond which shock polar do not provide solution under in which case the conical shock wave will have detached from the solid surface (see Mach reflection). These detached cases are not considered here. The flow immediately behind the oblique conical shock wave is typically supersonic, although however when is close to , it can be subsonic. The supersonic flow behind the shock wave will become subsonic as it evolves downstream.
Since all incident streamlines intersect the conical shock wave at the same angle, the intensity of the shock wave is constant. This particularly means that entropy jump across the shock wave is also constant throughout. In this case, the flow behind the shock wave is a potential flow. Hence we can introduce the velocity potential such that . Since the problem do not have any length scale and is clearly axisymmetric, the velocity field and the pressure field will be turn out to functions of the polar angle only (the origin of the spherical coordinates is taken to be located at the vertex). This means that we have
The steady potential flow is governed by the equation
where the sound speed is expressed as a function of the velocity magnitude only. Substituting the above assumed form for the velocity field, into the governing equation, we obtain the general Taylor–Maccoll equation
The equation is simplified greatly for a polytropic gas for which , i.e.,
where is the specific heat ratio and is the stagnation enthalpy. Introducing this formula into the general Taylor–Maccoll equation and introducing a non-dimensional function , where (the speed of the potential flow when it flows out into a vacuum), we obtain, for the polytropic gas, the Taylor–Maccoll equation,
The equation must satisfy the condition that (no penetration on the solid surface) and also must correspond to conditions behind the shock wave at , where is the half-angle of shock cone, which must be determined as part of the solution for a given incoming flow Mach number and . The Taylor–Maccoll equation has no known explicit solution and it is integrated numerically.
Kármán–Moore solution
When the cone angle is very small, the flow is nearly parallel everywhere in which case, an exact solution can be found, as shown by Theodore von Kármán and Norton B. Moore in 1932. The solution is more apparent in the cylindrical coordinates (the here is the radial distance from the -axis, and not the density). If is the speed of the incoming flow, then we write , where is a small correction and satisfies
where is the Mach number of the incoming flow. We expect the velocity components to depend only on , i.e., in cylindrical coordinates, which means that we must have , where is a self-similar coordinate. The governing equation reduces to
On the surface of the cone , we must have and conesequently .
In the small-angle approximation, the weak shock cone is given by . The trivial solution for describes the uniform flow upstream of the shock cone, whereas the non-trivial solution satisfying the boundary condition on the solid surface behind the shock wave is given by
We therefore have
exhibiting a logarthmic singularity as The velocity components are given by
The pressure on the surface of the cone is found to be (in this formula, is the density of the incoming gas).
See also
Kármán–Moore theory
References
Fluid dynamics | Taylor–Maccoll flow | [
"Chemistry",
"Engineering"
] | 957 | [
"Piping",
"Chemical engineering",
"Fluid dynamics"
] |
63,306,707 | https://en.wikipedia.org/wiki/Ministry%20of%20Industry%2C%20Energy%20and%20Mining%20%28Uruguay%29 | The Ministry of Industry, Energy and Mining (, MIEM) of Uruguay is a ministry of the Government of Uruguay that is responsible for formulating and promoting the industrial, energy and mining policies of the country.
The Ministry is headquartered in the Paysandú Street in Ciudad Vieja, Montevideo. The Minister of Industry, Energy and Mining from November 2023 was Elisa Facio who succeeded Omar Paganini.
History
In 1907, from the Ministry of Development, the President of the Republic Claudio Williman decided to create the Ministry of Industries, Labor and Public Instruction, it was responsible for livestock, agriculture, police, animal health, Immigration and colonization. The prime minister was Gabriel Terra.
In 1911, the name was changed to the Ministry of Industries, Labor and Communications and in 1935, after a reorganization of the Ministry, he began to take responsibility for Industry and Labor, until in 1967 his name was changed to the Ministry of Industries and Commerce . In 1974, in another reorganization process it was renamed Ministry of Industries and Energy, until in 1991 it received its current structure and was renamed Ministry of Industries, Energy and Mining.
List of ministers of industry, energy and mining
¹ Ministers of the Military-Civic government (1973-1985).
See also
Mineral industry of Uruguay
Energy in Uruguay
References
Government ministries of Uruguay
Industry in Uruguay
Mining in Uruguay
Energy in Uruguay
1907 establishments in Uruguay | Ministry of Industry, Energy and Mining (Uruguay) | [
"Engineering"
] | 275 | [
"Energy organizations",
"Energy ministries"
] |
63,307,438 | https://en.wikipedia.org/wiki/Julia%20Kubanek | Julia Kubanek is a Professor in the Schools of Biological Sciences and of Chemistry & Biochemistry in the College of Sciences at the Georgia Institute of Technology.
She is also the Vice President for Interdisciplinary Research for Georgia Tech. She is also Co-Director of the Aquatic Chemical Ecology Center (Georgia Tech) and member of the American Association for the Advancement of Science, the American Chemical Society, the Association for the Sciences of Limnology and Oceanography, the International Society of Chemical Ecology, the International Society for the Study of Harmful Algae and the American Association of Underwater Science
Education and career
Kubanek studied at Queen's University and got her Chemistry degree in 1991. She completed her doctoral studies in 1998 at the University of British Columbia. In 1998, she moved as post-doctoral researcher to the Scripps Institution of Oceanography in California and after, in 2001, to the University of North Carolina Wilmington.
In 2001 she became Assistant Professor and in 2006 Associate Professor in the School of Biology and School of Chemistry & Biochemistry at the Georgia Institute of Technology. In 2009 she became Associate Chair of the School of Biology and Co-Director of the Center for Aquatic Chemical Ecology. From 2010 to 2013 she was Waernska Guest Professor in the University of Gothenburg, Sweden. Since 2011 she is Professor in the School of Biology and School of Chemistry & Biochemistry at Georgia Tech. Between 2014 and 2021, she was Associate Dean for Research of the College of Sciences of Georgia Tech. Since 2021, she is the Vice President for Interdisciplinary Research for Georgia Tech.
Research
Kubanek's research interests are focused on the chemical signalling used by marine organisms to communicate with each other and with the environment. This research is multi-disciplinary as it crosses organic chemistry, chemical ecology, and chemical biology. Kubanek's research has revealed how seaweed produce a chemical compound, lobophorolide, that enables the seaweed to resist predation by marine fungi. Further research has revealed the presence of organic compounds on the surfaces of seaweed that inhibit growth of marine fungi. Other notable research projects characterize organic compounds that act as allelopathic chemicals in corals and Caribbean sponges. Kubanek also leads research projects into the chemical signals from the red tide producing Karenia brevis. Through screening of compounds produced by sea squirts, Kubanek's lab found compounds that can act as antifungal agents, which may lead to the development of novel drugs to prevent the growth of fungus. Kubanek's research on the compounds found in the urine of blue crabs was described in a New York Times article that presented the research in a manner readily accessible to the general public.
Kubanek has three patents filed in the United States: ABC transporter ligand GATX1, Compounds and compositions useful in the treatment of malaria, and Methods for inhibiting CLC-2 channel with GATX2.
Awards
National Science Foundation Presidential Early Career Award for Scientists and Engineers (PECASE) Award (2002)
Georgia Tech Faculty Outstanding Faculty Member (2009)
Silverstein-Simenone Award, International Society of Chemical Ecology, for 'contributions to the field of chemical ecology' (2012)
AAAS Fellow (2012)
References
External links
Kubanek research group
Video: http://www.ace.biosci.gatech.edu/news/
Year of birth missing (living people)
Living people
Fellows of the American Association for the Advancement of Science
Georgia Tech faculty
Queen's University at Kingston alumni
University of British Columbia Faculty of Science alumni
Recipients of the Presidential Early Career Award for Scientists and Engineers | Julia Kubanek | [
"Chemistry"
] | 728 | [
"Chemical ecologists",
"Chemical ecology"
] |
63,308,038 | https://en.wikipedia.org/wiki/Azaribine | Azaribine (triacetyl-6-azauridine) is a drug which was developed for the treatment of psoriasis, and also has anti-cancer and antiviral actions. It is a prodrug which is metabolised to the nucleoside analogue 6-azauridine in the body. Azaribine was approved for clinical use in treatment of psoriasis, but subsequently withdrawn because of toxicity issues, however it continues to be researched as a potential agent for the treatment of emerging viral diseases.
References
Antiviral drugs
Triazines
Tetrahydrofurans
Esters
Ketones
Withdrawn drugs | Azaribine | [
"Chemistry",
"Biology"
] | 133 | [
"Antiviral drugs",
"Ketones",
"Esters",
"Functional groups",
"Drug safety",
"Organic compounds",
"Biocides",
"Withdrawn drugs"
] |
63,309,432 | https://en.wikipedia.org/wiki/International%20Journal%20of%20Geometry | The International Journal of Geometry is a peer-reviewed academic journal that covers Euclidean, Non-Euclidean and Discrete geometry.
It was established in 2012 with two volumes per year, and as of 2021 is published quarterly by the Department of Mathematics of the Vasile Alecsandri National College of Bacău.
It is abstracted and indexed among others by Zentralblatt MATH, MathSciNet, the Electronic Journals Library and Ebsco. Its founding editor-in-chief is Cătălin Barbu, a professor of mathematics at the Vasile Alecsandri National College of Bacău.
See also
Forum Geometricorum
References
External links
Geometry journals
Open access journals
Academic journals established in 2012
English-language journals | International Journal of Geometry | [
"Mathematics"
] | 149 | [
"Geometry",
"Geometry journals"
] |
63,309,675 | https://en.wikipedia.org/wiki/The%20Elephant%20in%20the%20Brain | The Elephant in the Brain: Hidden Motives in Everyday Life is a 2018 nonfiction book by Kevin Simler and Robin Hanson. Simler is a writer and software engineer, while Hanson is an associate professor of economics at George Mason University. The book explores self-deception and hidden motives in human behaviour. The publisher's website describes the aim of the book as 'to track down the darker, unexamined corners of our psyches and blast them with floodlights'.
Summary
The main thesis of the book is that we are very often not aware of our real reasons for most of our behaviours. Our behaviors are optimised for living in a social group and very often, from the point of view of natural selection, it is useful if we are not consciously aware of our real motivations.
The book is split into two sections. The first, entitled 'Why We Hide Our Motives', includes an introduction to the subjects of animal behaviour, signalling, social norms and self-deception. In the second section, entitled 'Hidden Motives in Everyday Life', each chapter covers an aspect of human behaviour and describes how it can be explained through the framework of signalling and self-deception outlined in the first section. The chapters in this section cover body language, laughter, conversation, consumption, art, charity, education, medicine, religion and politics.
Body language
In this chapter, the authors claim that body language is largely a way of communicating status. Most of us will not consciously describe our body language as doing this; nonetheless, various status-related body positions can be observed in humans, similar to other primates.
Laughter
The authors argue that laughter is not just a response to humour, but is better thought of as a 'play signal' - an indication that we do not have feelings of hostility towards the other party. A wide range of data is used to support this hypothesis including the fact that people laugh more in groups than on their own, the fact that babies laugh more with their mothers, and the fact that a person who is speaking in general laughs more than a person who is listening.
Conversation
Conversation is often thought of as a means of exchanging information. However, most conversations do not involve the exchange of useful information, and the structure of conversation is often not optimised for this exchange. The authors argue that this is because a major purpose of conversation is instead to show off our mental ability.
Consumption
The authors discuss Thorstein Veblen's theory of conspicuous consumption. This is the idea that, though we may claim that we buy goods for practical purposes, the main purpose of buying many goods is to signal to others that we can afford to buy them. The authors then point out that many other things, apart from wealth, can be signaled through consumption.
Art
The authors point out that how much we value art largely depends on extrinsic features of the art, such as whether or not it is original and whether it is hand-made or machine-manufactured. This does not make sense if one claims that one cares about art for its intrinsic content. Art is better thought of as a way for people to show off their erudition and discernment as well as to associate themselves with artists.
Charity
The authors point out that, while most people claim and feel that they give money to charity because they wish to help a cause, very few people bother to check the cost-effectiveness of the charities which they donate to. The authors argue that this behaviour cannot be explained by the desire to help the cause, but can be explained if donations to charity are viewed as a way of signalling wealth, generosity and compassion.
Education
This section makes broadly the same argument as Bryan Caplan's book The Case Against Education. Most of us claim that the point of education is to learn the taught material. However, employers often require employees to have a degree, even if the degree is unrelated to the job and most students forget a lot of what they have learnt after a few years out of education. The authors argue that the main purpose of education is to show off intelligence, conscientiousness and conformity, as well as achieving secondary purposes, such as allowing people to socialize and allowing the government to indoctrinate its citizens.
Medicine
The story we tell ourselves about medicine and healthcare is that we use it in order to get better when we are unwell. However, this story does not fit in with many facts about healthcare. For example, regions which spend more on medicine do not tend to be healthier, and when people are given access to cheaper healthcare, they do not become healthier (for example in the RAND Health Insurance Experiment). Simler and Hanson argue that this is because medicine and healthcare are largely about signalling compassion, rather than promoting health.
Religion
Most religious people will claim that they are religious because they hold certain beliefs. Simler and Hanson argue that for most of history, religion has been about enacting certain behaviours, rather than specific beliefs. They also point out that religious people (of many conflicting religions) tend to have better physical and mental health than non-religious people. They suggest that the main purpose of religion is to provide a sense of community, and that the rituals and sacrifices that people make for their religions are ways of signalling loyalty.
Politics
On the face of it, the reason that people participate in politics is to improve the world in some way. However, most of us engage in politics in a way which is emotional, poorly informed relative to the strength of claims that we make, and we are generally unwilling to compromise on political issues. These facts are better explained if politics is a way of signalling affiliation to a 'tribe' of like-minded people than as a way of actually trying to improve the world.
Reception
Writing in The Wall Street Journal, Matthew Hutson called the book 'refreshingly frank' and 'penetrating'.
In a mostly negative review for The New Yorker, journalist and novelist John Lanchester praised the section on education, but criticized the book for 'taking an argument that has worthwhile applications and extending it further than it usefully goes '. He also claimed that the emphasis on hidden motives undermined human achievements generated by those motives, such as 'writing symphonies, curing diseases, building cathedrals, searching into the deepest mysteries of time and space and so on'. Hanson responded to these criticisms on his blog.
A review for Publishers Weekly called the book a 'fascinating and accessible introduction to an important subject'
In the New York Intelligencer, Park MacDougald gave the book a mixed review calling it ' interesting, occasionally enlightening, and sometimes a little slapdash'. MacDougald particularly criticized the book's reliance on social psychology research in light of the replication crisis in that field.
Kelly Jane Torrance in the National Review recommended the book, saying that it makes the 'best argument yet that we’re not even aware of much of what motivates us'.
Computer scientist Scott Aaronson praised the work on his blog, calling it a 'masterpiece' and 'Robin [Hanson]'s finest work so far'.
See also
Effective altruism which is discussed in the book as an alternative set of norms surrounding charitable giving.
The Case Against Education, a book by Bryan Caplan which makes a similar case to The Elephant in the Brain that education is mostly about signalling intelligence, conformity and conscientiousness
RAND Health Insurance Experiment, an experiment discussed in the chapter on medicine
References
2018 non-fiction books
Psychology books
Human behavior
Works about everyday life
Oxford University Press books | The Elephant in the Brain | [
"Biology"
] | 1,532 | [
"Behavior",
"Human behavior"
] |
63,312,375 | https://en.wikipedia.org/wiki/Pamela%20Thomas | Pamela Anne Thomas is a British condensed matter physicist, and former Pro Vice Chancellor for Research at the University of Warwick, where she leads the Ferroelectrics & Crystallography group. Her work focuses on the structure and related properties of ferroelectric, piezoelectric and nonlinear optical crystals, ceramics and thin-films. From September 2020 to April 2024, she served as the Chief Executive Officer of the Faraday Institution, an organisation which advances energy storage science and technology.
Education
Thomas studied at Physics at the University of Oxford. She completed her DPhil, 'Optical activity in crystals' at the University of Oxford in 1987 under Professor Mike Glazer.
Career
In 1992, Thomas was awarded the Physical Crystallography Prize of the British Crystallographic Association.
From 2009–2012, Thomas was the Director of the Science City Research Alliance (SCRA) for the Universities of Birmingham and Warwick. SCRA was a collaboration between the University of Birmingham and the University of Warwick, intended to provide world-leading research and knowledge support across three major platforms: advanced materials, energy futures and translational medicine. Set up in Warwick & Birmingham, with support from the European Regional Development Fund and by Advantage West Midlands, it provided a £58 M investment in state-of-the-art equipment, housed in purpose-designed buildings with dedicated technical support and HEFCE funded (£10 M) research fellows.
In 2011, Thomas was appointed the Chair of the Faculty of Science at the University of Warwick. Thomas was the Pro Vice Chancellor for Research at the University of Warwick, and served as a Pro Vice Chancellor from 2014 to 2021. She served as a trustee of the Faraday Institution before being appointed its chief executive in September 2020, and was previously on the board of the Alan Turing Institute where she represented the University of Warwick. Thomas chaired the UK's Open Research Data Task Force, which was established by Jo Johnson in 2016.
References
Living people
21st-century British physicists
Year of birth missing (living people)
Place of birth missing (living people)
British women physicists
Condensed matter physicists
Academics of the University of Warwick
Alumni of the University of Oxford | Pamela Thomas | [
"Physics",
"Materials_science"
] | 438 | [
"Condensed matter physicists",
"Condensed matter physics"
] |
63,312,457 | https://en.wikipedia.org/wiki/Tricia%20Carmichael | Tricia L. Carmichael (née Breen) is a Professor in the Department of Chemistry and Biochemistry at the University of Windsor. She develops new materials for stretchable electronics with a current focus on wearable electronic devices.
Early life and education
Carmichael was an undergraduate student at the University of Windsor, where she earned a bachelor's degree in Chemistry. She remained there for her graduate studies, where she worked on zirconium complexes. After graduating Carmichael was a postdoctoral fellow at the Massachusetts Institute of Technology. In 1997 she joined the laboratory of George M. Whitesides at Harvard University, where she spent two years as a Natural Sciences and Engineering Research Council (NSERC) research fellow. She studied charge transport through self-assembled monolayers, and showed that the injection current density was greater in n-alkanethiolates with odd numbers of carbon atoms. She joined the Thomas J. Watson Research Center in 1999, where she worked in research and development. Here she specialised in synthesis and the development of low-cost patterning methods.
Research and career
In 2005 Carmichael was appointed to the faculty at the University of Windsor, and promoted to Professor of Chemistry and Biochemistry in 2016. Her research involves the development of novel materials and fabrication methods stretchable and wearable electronic devices. A challenge for the real-world implementation of these materials is how they will survive machine washing. She has investigated various means to generate conductive threads, including nick immersion gold plating and soft wax screening. Each thread is bathed in a series of chemical washes and coated with a layer of gold only 100 nm thick, making the process cheap and scalable. In 2020 Carmichael demonstrated a stretchable, conformable light emitting fabric that could be used to replace high-visibility clothing. The semi-transparent fabric contains nylon, spandex and gold, whilst the light-emission occurs from zinc sulfide.
In 2019 Carmichael and her colleague James Gauld coordinated the first LGBTQ+ in STEM conference in Canada.
Awards and honours
NSERC Doctoral Prize for her PhD work
Ontario Ministry of Innovation Early Researcher Award
NSERC University Faculty Award
University of Windsor Impact Award
Selected publications
Her awards and honours include:
Forming electrical networks in three dimensions by self-assembly (DOI:10.1126/science.289.5482.1170)
High-performance, solution-processed organic thin film transistors from a novel pentacene precursor (DOI:10.1021/ja0266621)
Design and self-assembly of open, regular, 3D mesostructures (DOI:10.1126/science.284.5416.948)
Carmichael serves on the Editorial Board of the Institute of Physics journal Flexible and Printed Electronics as Editor-in-Chief, and Cell Press' Chem. She holds more than two dozen patents for her innovations in materials synthesis and electronic device design. She is also currently scientific co-Director of the NSERC Green Electronic Network.
References
Living people
Year of birth missing (living people)
University of Windsor alumni
Academic staff of University of Windsor
Harvard University people
Women materials scientists and engineers
Canadian materials scientists
Canadian women chemists
21st-century Canadian women scientists
21st-century Canadian chemists | Tricia Carmichael | [
"Materials_science",
"Technology"
] | 650 | [
"Women materials scientists and engineers",
"Materials scientists and engineers",
"Women in science and technology"
] |
63,313,205 | https://en.wikipedia.org/wiki/Decolonization%20of%20knowledge | Decolonization of knowledge (also epistemic decolonization or epistemological decolonization) is a concept advanced in decolonial scholarship that critiques the perceived hegemony of Western knowledge systems. It seeks to construct and legitimize other knowledge systems by exploring alternative epistemologies, ontologies and methodologies. It is also an intellectual project that aims to "disinfect" academic activities that are believed to have little connection with the objective pursuit of knowledge and truth. The presumption is that if curricula, theories, and knowledge are colonized, it means they have been partly influenced by political, economic, social and cultural considerations. The decolonial knowledge perspective covers a wide variety of subjects including philosophy (epistemology in particular), science, history of science, and other fundamental categories in social science.
Background
Decolonization of knowledge inquires into the historical mechanisms of knowledge production and their perceived colonial and ethnocentric foundations. Budd L. Hall et al argue that knowledge and the standards that determine the validity of knowledge have been disproportionately informed by Western system of thought and ways of being in the world. According to Jaco S. Dreyer, the western knowledge system that emerged in Europe during renaissance and Enlightenment was deployed to legitimise Europe’s colonial endeavour, which eventually became a part of colonial rule and forms of civilization that the colonizers carried with them. This perspective maintains that the knowledge produced by the Western system was deemed superior to that produced by other systems since it had a universal quality. Decolonial scholars concur that the western system of knowledge still continues to determine as to what should be considered as scientific knowledge and continues to "exclude, marginalise and dehumanise" those with different systems of knowledge, expertise and worldviews. Anibal Quijano stated:
In effect, all of the experiences, histories, resources, and cultural products ended up in one global cultural order revolving around European or Western hegemony. Europe’s hegemony over the new model of global power concentrated all forms of the control of subjectivity, culture, and especially knowledge and the production of knowledge under its hegemony... They repressed as much as possible the colonized forms of knowledge production, the models of the production of meaning, their symbolic universe, the model of expression and of objectification and subjectivity.
In her book Decolonizing Methodologies: Research and Indigenous Peoples, Linda Tuhiwai Smith writes:
Imperialism and colonialism brought complete disorder to colonized peoples, disconnecting them from their histories, their landscapes, their languages, their social relations and their own ways of thinking, feeling and interacting with the world.
According to this viewpoint, colonialism has ended in the legal and political sense, but its legacy continues in many "colonial situations" where individuals and groups in historically colonized places are marginalized and exploited. Decolonial scholars refer to this continuing legacy of colonialism as "coloniality", which describes the oppression and exploitation left behind by colonialism in a variety of interrelated domains, including the domain of subjectivity and knowledge.
Origin and development
In community groups and social movements in the Americas, decolonization of knowledge traces its roots back to resistance against colonialism from its very beginning in 1492. Its emergence as an academic concern is rather a recent phenomenon. According to Enrique Dussel, the theme of epistemological decolonization has originated from a group of Latin American thinkers. Although the notion of decolonization of knowledge has been an academic topic since the 1970s, Walter Mignolo says it was the ingenious work of Peruvian sociologist Anibal Quijano that "explicitly linked coloniality of power in the political and economic spheres with the coloniality of knowledge." It has developed as "an elaboration of a problematic" that began as a result of several critical stances such as postcolonialism, subaltern studies and postmodernism. Enrique Dussel says epistemological decolonization is structured around the notions of coloniality of power and transmodernity, which traces its roots in the thoughts of José Carlos Mariátegui, Frantz Fanon and Immanuel Wallerstein. According to Sabelo J. Ndlovu-Gatsheni, although the political, economic, cultural and epistemological dimensions of decolonization were and are intricately connected to each other, attainment of political sovereignty was preferred as a "practical strategic logic of struggles against colonialism." As a result, political decolonization in the twentieth century failed to attain epistemological decolonization, as it did not widely inquire into the complex domain of knowledge.
Themes
According to Alex Broadbent, decolonization is sometimes understood as a rejection of the notion of objectivity, which is seen as a legacy of colonial thought. He argues that universal conception of ideas such as "truth" and "fact" are Western constructs that are imposed on other foreign cultures. This tradition considers notions of truth and fact as "local", arguing that what is "discovered" or "expressed" in one place or time may not be applicable in another. The concerns of decolonization of knowledge are that the western knowledge system has become a norm for global knowledge and that its methodologies are the only ones deemed appropriate for use in knowledge production. This perceived hegemonic approach towards other knowledge systems is said to have reduced epistemic diversity and established the center of knowledge, eventually suppressing all other knowledge forms. Boaventura de Sousa Santos says "throughout the world, not only are there very diverse forms of knowledge of matter, society, life and spirit, but also many and very diverse concepts of what counts as knowledge and criteria that may be used to validate it." However, it is claimed that this variety of knowledge systems has not gained much recognition. According to Lewis Gordon, the formulation of knowledge in its singular form itself was unknown to times before the emergence of European modernity. Modes of knowledge production and notions of knowledge were so diversified that knowledges, in his opinion, would be more appropriate description.
According to Walter Mignolo, the modern foundation of knowledge is thus territorial and imperial. This foundation is based on "the socio-historical organization and classification of the world founded on a macro narrative and on a specific concept and principles of knowledge" which finds its roots in European modernity. He articulates epistemic decolonization as an expansive movement that identifies "geo-political locations of theology, secular philosophy and scientific reason" while also affirming "the modes and principles of knowledge that have been denied by the rhetoric of Christianization, civilization, progress, development and market democracy." According to Achille Mbembe, decolonization of knowledge means contesting the hegemonic western epistemology that suppresses anything that is foreseen, conceived and formulated from outside of western epistemology. It has two aspects: a critique of Western knowledge paradigms and the development of new epistemic models. Savo Heleta states that decolonization of knowledge "implies the end of reliance on imposed knowledge, theories and interpretations, and theorizing based on one’s own past and present experiences and interpretation of the world."
Significance
According to Anibal Quijano, epistemological decolonization is necessary for opening up new avenues for intercultural communication and the sharing of experiences and meanings, laying the groundwork for an alternative rationality that could rightfully stake a claim to some degree of universality. Sabelo J. Ndlovu-Gatsheni says epistemological decolonization is essential for addressing the "asymmetrical global intellectual division of labor" in which Europe and North America not only act as teachers of the rest of the world but also serve as the centers for the production of theories and concepts that are ultimately "consumed" by the entire human race.
Approaches
According to Linda Tuhiwai Smith, decolonization "does not mean a total rejection of all theory or research or Western knowledge". In Lewis Gordon's view, decolonization of knowledge mandates a detachment from the "commitments to notions of an epistemic enemy." It rather emphasizes "the appropriation of any and all sources of knowledge" in order to achieve relative epistemic autonomy and epistemic justice for "previously unacknowledged and/or suppressed knowledge traditions."
Indigenous decolonization
Relational model of knowledge
Decolonial scholars inquire into various forms of indigenous knowledges in their efforts to decolonize knowledge and worldviews. Louis Botha et al make the case for a "relational model of knowledge," which they situate within indigenous knowledges. These indigenous knowledges are based on indigenous peoples' perceptions and modes of knowing. They consider indigenous knowledges to be essentially relational because these knowledge traditions place a high value on the relationships between the actors, objects, and settings involved in the development of knowledge. Such "networked" relational approach to knowledge production fosters and encourages connections between the individuals, groups, resources, and other components of knowledge-producing communities. For Louis Botha et al, since it is built on an ontology that acknowledges the spiritual realm as real and essential to knowledge formation, this relationality is also fundamentally spiritual, and feeds axiological concepts about why and how knowledge should be created, preserved, and utilized.
In academia
One of the most crucial aspects of decolonization of knowledge is to rethink the role of the academia, which, according to Louis Yako, an Iraqi-American anthropologist, has become the "biggest enemy of knowledge and the decolonial option." He says Western universities have always served colonial and imperial powers, and the situation has only become worse in the neoliberal age. According to Yako, the first step toward decolonizing academic knowledge production is to carefully examine "how knowledge is produced, by whom, whose works get canonized and taught in foundational theories and courses, and what types of bibliographies and references are mentioned in every book and published article." He criticizes Western universities for their alleged policies regarding research works that undermine foreign and independent sources while favoring citations to "elite" European or American scholars who are commonly considered "foundational" in their respective fields, and calls for an end to this practice.
Shose Kessi et al argue that the goal of academia is "not to reach new orders of homogeneity, but rather greater representation of pluralistic ideas and rigorous knowledge". They invite academics to carefully scrutinize the authors and voices that are presented as authorities on a subject or in the classroom, the methods and epistemologies that are taught or given preference, as well as the academic concerns that are seen as fundamental and the ones that are ignored. They must reconsider the pedagogical tools or approaches used in the learning process for students, as well as examine the indigenous or community knowledge systems that are followed, promoted, or allowed to redefine the learning agenda. The purpose and future of knowledge must also be reevaluated during this process. There have been suggestions for expanding the reading list and creating an inclusive curriculum that incorporates a range of voices and viewpoints in order to represent broader global and historical perspectives. Researchers are urged to investigate outside the Western canons of knowledge to determine whether there are any alternative canons that have been overlooked or disregarded as a result of colonialism.
Ngũgĩ wa Thiong'o, who emphasizes the significance of decolonizing history, memory, and language, has stated that language, not geopolitics, should serve as the initial point of decolonization. According to Mahmood Mamdani, the idea of a university based on a single language is a colonial heritage, as in the case of African universities, which began as a colonial project, with English or French being the project language, and it recognized only one intellectual tradition—the Western tradition. According to Mamdani, university education needs to be more diverse and multilingual, with a focus on not only providing Westernized education in a variety of languages but also on ways to advance non-Western intellectual traditions as living traditions that can support both scholarly and public discourse. Mamdani makes the case for allocating funds to the creation of academic units that may research and instruct in non-Western intellectual traditions. He believes that learning the language in which the tradition has been historically developed is necessary if one wants to access a different intellectual tradition.
Louis Yako opposes the labeling of new scholars as "Marxist", "Foucauldian", "Hegelian", "Kantian", and so on, which he sees as a "colonial method of validating oneself and research" through these scholars. According to Yako, despite the fact that scholars such as Marx, Hegel, Foucault, and many others were all inspired by numerous thinkers before them, they are not identified with the names of such intellectuals. He criticizes the academic peer-review process as a system of "gatekeepers" who regulate the production of knowledge in a given field or about a certain region of the world.
In various disciplines
In order to overcome the perceived constraints of the Western canons of knowledge, proponents of knowledge decolonization call for the decolonization of various academic disciplines, including history, science and the history of science, philosophy, (in particular, epistemology), psychology, sociology, religious studies, and legal studies.
History
According to the official web page of the University of Exeter, the "colonialist worldview," which allegedly prioritises some people's beliefs, rights, and dignity over those of others, has had an impact on the theoretical framework that underpins the modern academic field of history. This modern field of study has first developed in Europe during a period of rising nationalism and colonial exploitation, which determines the historical narratives of the world. This account suggests "that the very ways we are conditioned to look at and think about the past are often derived from imperialist and racialised schools of thought". Decolonial approach in history requires "an examination of the non-western world on its own terms, including before the arrival of European explorers and imperialists". In an effort to understand the world before the fifteenth century, it attempts to situate Western Europe in relation to other historical "great powers" like the Eastern Roman Empire or the Abbasid Caliphate. It "requires rigorous critical study of empire, power and political contestation, alongside close reflection on constructed categories of social difference". According to Walter Mignolo, discovering the variety of local historical traditions are crucial for "restoring the dignity that the Western idea of universal history took away from millions of people".
Modern science
The decolonial approach contests the notion of science as "purely objective, solely empirical, immaculately rational, and thus, singularly truth confirming”. According to this account, such an outlook towards science implies "that reality is discrete and stagnant; immune to its observer’s subjectivity, including their cultural suasions; and dismountable into its component parts whose functioning can then be ascertained through verificationist means". Laila N Boisselle situates modern science within Western philosophy and Western paradigms of knowledge, saying that "different ways of knowing how the world works are fashioned from the cosmology of the observer, and provides opportunities for the development of many sciences". Margaret Blackie and Hanelie Adendorff argue "that the practice of science by scientists has been profoundly influenced by Western modernity". According to this perspective, modern science thus "reflects foundational elements of empiricism according to Francis Bacon, positivism as conceptualized by Comte, and neo-positivism as suggested by the School of Vienna in the early 1900s." Boisselle also suggests that the mainstream scientific perspective that downplays the function or influence of Spirit or God in any manifestation in its processes, is not only Western and modern but also secular in orientation.
Boisselle sought to identify two issues with Western knowledge, including "Western Modern Science". For her, it starts off by seeking to explain the nature of the universe on the basis of reason alone. The second is that it considers itself to be the custodian of all knowledge and to have the power "to authenticate and reject other knowledge." The idea that modern science is the only legitimate method of knowing has been referred to as "scientific fundamentalism" or "scientism". It assumes the role of a gatekeeper by situating "science for all" initiatives on a global scale inside the framework of scientism. As a result, it acquires the power to decide what scientific knowledge is deemed to be "epistemologically rigorous". According to Boaventura de Sousa Santos, in order to decolonize modern science, it is necessary to consider "the partiality of scientific knowledge", i.e. to acknowledge that, like any other system of knowledge, "science is a system of both knowledge and ignorance". For Santos, "scientific knowledge is partial because it does not know everything deemed important and it cannot possibly know everything deemed important". In this regard, Boisselle argues for a "relational science" based on a "relational ontology" that respects “the interconnectedness of physical, mental, emotional, and spiritual aspects of individuals with all living things and with the star world, and the universe”.
Samuel Bendeck Sotillos, with reference to perennial philosophy, critiques modern science for its rejection of metaphysics and spiritual traditions from around the world. He states that "the belief that only the scientific method gives access to valid forms of knowledge is not only flawed but totalitarian, having its roots in the European Enlightenment or the so-called Age of Reason". For him, "This dogmatic outlook is not science, but an ideology known as scientism, which has nothing to do with the proper exercise of the scientific method". This viewpoint challenges the idea that science is Truth, with a capital "T", saying that "contemporary science is largely relegated to dealing with approximations; in doing so, it is always modifying its understanding and thus is in no position to declare what can be finally known with certainty", and it promotes an understanding of science within the confines of its underlying philosophical assumptions concerning physical reality. In this context, Sotillos seeks to revive traditional metaphysics, also known as sacred science or scientia sacra, which is guided by metaphysical principles and is based on the sapiential teachings of world religions.
History of science
Beginning in the middle of the 1980s, postcolonial histories of science is said to constitute a “decentered, diasporic, or ‘global’ rewriting of earlier nation-centred imperial grand narratives.” These histories seek to uncover "counter-histories of science, the legacies of precolonial knowledge, or residues and resurrections of the constitutive relations of colonial science." Instead of "centering scientific institutes in colonial metropoles," this history attempts to examine what Warwick Anderson refers to "as the unstable economy of science’s shifting spatialities as knowledge is transacted, translated, and transformed across the globe". It seeks to eradicate "imperial grand narratives", which is said to provincialize science into a single "indigenous knowledge tradition". Instead, it seeks to recognise "the culturally diverse and global origins of science", and build a cosmopolitan model of science history in place of the narrow view of science as the creation of "lone geniuses". This perspective acknowledges the contributions of other civilizations to science, and offers a "contrageography of science that is not Eurocentric and linear". The central tenet is that the history of science should be seen as a history of transmissions. In this, Prakash Kumar et al cite Joseph Needham as saying, "modern science...[is] like an ocean into which the rivers from all the world’s civilizations have poured their waters”.
Philosophy
Nelson Maldonado-Torres et al see the decolonial turn in philosophy "as a form of liberating and decolonising reason beyond the liberal and Enlightened emancipation of rationality, and beyond the more radical Euro-critiques that have failed to consistently challenge the legacies of Eurocentrism and white male heteronormativity (often Euro-centric critiques of Eurocentrism)". According to Sajjad H. Rizvi, the shift toward global philosophy may herald a radical departure from colonial epistemology and pave the way for the decolonization of knowledge, particularly in the study of the humanities. In opposition to what is said to have been the standard method in philosophy studies, he argues against focusing solely on Western philosophers. Rizvi makes the case for the inclusion of Islamic philosophy in the discussion because he thinks it will aid in the process of decolonization and may eventually replace the Eurocentric education of philosophy with an expansive "pedagogy of living and being". Philip Higgs argues for the inclusion of African philosophy in the context of decolonization. Similar suggestions have been made for Indian philosophy and Chinese philosophy. Maldonado-Torres et al discuss issues in the philosophy of race and gender as well as Asian philosophy and Latin American philosophy as instances of the decolonial turn and decolonizing philosophy, contending that "Asia and Latin America are not presented here as the continental others of Europe but as constructed categories and projects that themselves need to be decolonized".
Psychology
According to many influential colonial and postcolonial leaders and thinkers, decolonization was "essentially a psychological project" involving a "recovery of self" and "an attempt to reframe the damaging colonial discourses of selfhood". According to the decolonial perspective, Eurocentric psychology, which is based on a specific history and culture, places a strong emphasis on "experimental positivist methods, languages, symbols, and stories". A decolonizing approach in psychology thus seeks to show how colonialism, Orientalism, and Eurocentric presumptions are still deeply ingrained in modern psychological science as well as psychological theories of culture, identity, and human development. Decolonizing psychology entails comprehending and capturing the history of colonization as well as its perceived effects on families, nations, nationalism, institutions, and knowledge production. It seeks to extend the bounds of cultural horizons, which should serve as a gateway "to new confrontations and new knowledge". Decolonial turn in psychology entails upending the conventional research methodology by creating spaces for indigenous knowledge, oral histories, art, community knowledge, and lived experiences as legitimate forms of knowledge. Samuel Bendeck Sotillos seeks to break free from the alleged limits of modern psychology, which he claims is dominated by the precepts of modern science and which only addresses a very "restricted portion of human individuality". He instead wants to revive the traditional view of the human being as consisting of a spirit, a soul, and a body.
Sociology
Decolonial scholars argue that sociological study is now dominated by the viewpoints of academics in the Global North and empirical studies that are concentrated on these countries. This leads to sociological theories that portray the Global North as "normal" or "modern," while anything outside of it is assumed to be either "deviant" or "yet to be modernized." Such theories are said to undermine the concerns of the Global South despite the fact that they make up around 84% of the world population. They place a strong emphasis on taking into account the problems, perspectives, and way of life of those in the Global South who are typically left out of sociological research and theory-building; thus, decolonization in this sense refers to making non-Western social realities more relevant to academic debate.
Religious studies
According to the decolonial perspective, the study of religion is one of many humanities disciplines that has its roots in European colonialism. Because of this, the issues it covers, the concepts it reinforces, and even the settings in which it is taught at academic institutions all exhibit colonial characteristics. According to Malory Nye, in order to decolonize the study of religion, one must be methodologically cognizant of the historical and intellectual legacies of colonialism in the field, as well as fundamental presuppositions about the subject matter, including the conception of religion and world religions. For Adriaan van Klinken, a decolonial turn in the study of religions embraces reflexivity, is interactive, and challenges "the taken-for-granted Western frameworks of analysis and scholarly practice." It must accept "the pluriversality of ways of knowing and being" in the world. The interpretation of the Quran in the Euro-American academic community has been cited as one such example, where "the phenomenon of revelation (Wahy)" as it is understood in Islam is very often negated, disregarded, or regarded as unimportant to comprehending the scripture. According to Joseph Lumbard, Euro-American analytical modes have permeated Quranic studies and have a lasting impact on all facets of the discipline. He argues for more inclusive approaches that take into account different forms of analysis and make use of analytical tools from the classical Islamic tradition.
Legal studies
Aitor Jiménez González argues that the "generalized use of the term “law” or “Law” masks the fact that the concept we are using is not a universal category but a highly provincial one premised on the westernized legal cosmovision". According to him, it was not the "peaceful spread of a superior science" that ultimately led to the universal adoption of the western notion of law. Rather, it "was the result of centuries of colonialism, violent repression against other legal cosmovisions during the colonial periods and the persistence of the process referred to as coloniality". The decolonial stance on law facilitates dialogue between various understandings and epistemic perspectives on law in the first place, challenging the perceived hegemony of the westernized legal paradigm. It is a strategy for transforming a legal culture that historically was based on a hegemonic or Eurocentric understanding of the law into one that is more inclusive. It highlights the need for a fresh historical perspective that emphasizes diversity over homogeneity and casts doubt on the notion that the state is the "main organizer of legal and juridical life".
According to Asikia Karibi-Whyte, decolonization goes beyond inclusion in that it aims to dismantle the notions and viewpoints that undervalue the "other" in legal discourse. This point of view maintains that a society's values form the foundation of legal knowledge and argues for prioritizing those values when debating specific legal issues. This is because legal norms in former colonies bear the imprint of colonialism and values of colonial societies. For example, English Common Law predominates in former British colonies throughout Africa and Asia, whereas the Civil Law system is used in many former French colonies that mirrors the values of French society. In this context, decolonization of law calls "for the critical inclusion of epistemologies, ways of knowing, lived experiences, texts and scholarly works" that colonialism forced out of legal discourses.
Inclusive research
Shift in research methodology
According to Mpoe Johannah Keikelame and Leslie Swartz, "decolonising research methodology is an approach that is used to challenge the Eurocentric research methods that undermine the local knowledge and experiences of the marginalised population groups". Even though there is no set paradigm or practice for decolonizing research methodology, Thambinathan and Kinsella offer four methods that qualitative researchers might use. These four methods include engaging in transformative praxis, practicing critical reflexivity, employing reciprocity and respect for self-determination, as well as accepting "Other(ed)" ways of knowing. For Sabelo Ndlovu Gatsheni, decolonizing methodology involves "unmasking its role and purpose in research". It must transform the identity of research objects into questioners, critics, theorists, knowers, and communicators. In addition, research must be redirected to concentrate on what Europe has done to humanity and the environment rather than imitating Europe as a role model for the rest of the world.
Data decolonization
Criticism
According to Piet Naudé, decolonization's efforts to create new epistemic models with distinct laws of validation than those developed in Western knowledge system have not yet produced the desired outcome. The present "scholarly decolonial turn" has been criticised on the ground that it is divorced from the daily struggles of people living in historically colonized places. Robtel Neajai Pailey says that 21st-century epistemic decolonization will fail unless it is connected to and welcoming of the ongoing liberation movements against inequality, racism, austerity, imperialism, autocracy, sexism, xenophobia, environmental damage, militarization, impunity, corruption, media surveillance, and land theft because epistemic decolonization "cannot happen in a political vacuum".
"Decolonization", both as a theoretical and practical tendency, has recently faced increasing critique. For example, Olúfẹ́mi Táíwò argued that it is analytically unsound, conflating "coloniality" with "modernity", leading it to become an impossible political project. He further argued that it risks denying the formerly colonized countries agency, in not recognizing that people often consciously accept and adapt elements of different origins, including colonial ones. Jonatan Kurzwelly and Malin Wilckens used the example of decolonisation of academic collections of human remains - originally used to further racist science and legitimize colonial oppression - to show how both contemporary scholarly methods and political practice perpetuate reified and essentialist notions of identities.
See also
Decolonization of higher education in South Africa
Decolonization of museums
Decolonising the Mind
Decolonization of public space
Decolonizing outer space
Universal Declaration of Human Rights
Notes
References
Further reading
Decolonization
Social epistemology
Postcolonialism | Decolonization of knowledge | [
"Technology"
] | 6,238 | [
"Social epistemology",
"Science and technology studies"
] |
63,313,287 | https://en.wikipedia.org/wiki/Geofence%20warrant | A geofence warrant or a reverse location warrant is a search warrant issued by a court to allow law enforcement to search a database to find all active mobile devices within a particular geo-fence area. Courts have granted law enforcement geo-fence warrants to obtain information from databases such as Google's Sensorvault, which collects users' historical geolocation data. Geo-fence warrants are a part of a category of warrants known as reverse search warrants.
History
Geofence warrants were first used in 2016. Google reported that it had received 982 such warrants in 2018, 8,396 in 2019, and 11,554 in 2020. A 2021 transparency report showed that 25% of data requests from law enforcement to Google were geo-fence data requests. Google is the most common recipient of geo-fence warrants and the main provider of such data, although companies including Apple, Snapchat, Lyft, and Uber have also received such warrants.
Legality
United States
Some lawyers and privacy experts believe reverse search warrants are unconstitutional under the Fourth Amendment to the United States Constitution, which protects people from unreasonable searches and seizures, and requires any search warrants be specific to what and to whom they apply. The Fourth Amendment specifies that warrants may only be issued "upon probable cause, supported by Oath or affirmation, and particularly describing the place to be searched, and the persons or things to be seized." Some lawyers, legal scholars, and privacy experts have likened reverse search warrants to general warrants, which were made illegal by the Fourth Amendment.
Groups including the Electronic Frontier Foundation have opposed geo-fence warrants in amicus briefs filed in motions to quash such orders to disclose geo-fence data.
In 2024 the United States Fifth Circuit Court of Appeals found that geofence warrants are "categorically prohibited by the Fourth Amendment."
See also
Dragnet (policing)
References
Geographic position
Internet privacy
Google
Databases
Warrants
Law enforcement terminology
Searches and seizures | Geofence warrant | [
"Mathematics"
] | 410 | [
"Point (geometry)",
"Geographic position",
"Position"
] |
56,340,743 | https://en.wikipedia.org/wiki/Microbial%20desalination%20cell | A microbial desalination cell (MDC) is a biological electrochemical system that implements the use of electro-active bacteria to power desalination of water in situ, resourcing the natural anode and cathode gradient of the electro-active bacteria and thus creating an internal supercapacitor. Available water supply has become a worldwide endemic as only .3% of the Earth's water supply is usable for human consumption, while over 99% is sequestered by oceans, glaciers, brackish waters, and biomass. Current applications in electrocoagulation, such as microbial desalination cells, are able to desalinate and sterilize formerly unavailable water to render it suitable for safe water supply. Microbial desalination cells stem from microbial fuel cells, deviating by no longer requiring the use of a mediator and instead relying on the charged components of the internal sludge to power the desalination process. Microbial desalination cells therefore do not require additional bacteria to mediate the catabolism of the substrate during biofilm oxidation on the anodic side of the capacitor. MDCs and other bio-electrical systems are favored over reverse osmosis, nanofiltration and other desalination systems due to lower costs, energy and environmental impacts associated with bio-electrical systems.
MDC Structure
An MDC is constructed similarly to a microbial fuel cell by including two
chambers with two electrodes, an anode and a cathode, in addition to both a third chamber separated by an anion exchange membrane (AEM) and cation exchange membrane (CEM), and a peripheral, external circuit that is responsible for aerobic and anaerobic processes at each respective electrode. Organic matter from the sludge proliferates in the anode chamber and creates a biofilm that generates an electric current. The biofilm thus begins to oxidize the pollutants in the sludge by strictly adhering to the anode, freeing both electrons and protons from the bio-sludge, creating a current of atoms that are collected by the electrodes through circuit transportation. Electrical current is produced by the potential difference generated between the anode and cathode due to the aerobic nature of the cathode chamber.
Applications
Seawater desalination
MDCs are utilized in seawater desalination by primarily acting as a precursor treatment for electrodialysis (ED) due to the inefficiency in salinity removal due to biofouling and membrane scaling by the complex ion composition. Studies show that efficacy of MDC systems diminish over 5000 hours due to membrane scaling such as calcium and potassium accumulation, increasing ohmic resistance and reducing ion exchange through the membrane. However, by utilizing MDCs as a precursor treatment for electrodialysis, results show that system time is reduced by 25% and energy expenditure decreases by 45.3%. Reduction in external resistance increases desalination efficiency to as high as 74%, as demonstrated in upflow microbial desalination cells (UMDC), but increased membrane scaling on the ion exchange membranes by calcium and magnesium accumulation, resulting in a higher internal ohmic resistance and decrease in overall desalination of seawater. With the application of an osmotic MFC (OsMFC) in conjunction with the UMDC as an initial pretreatment of biosolid removal and desalination, 85% of oxygen demand and approximately 97% of salts was reduced after secondary treatment. Subsequent treatment by traditional BES systems such as electrodialysis can function as a more effective system for desalination, provisioning energy demands by the output energy obtained from the MDC pretreatment.
Brackish water desalination
As MDCs contain low electrical conductivity in the desalination chamber and additional energy is not applied to the system, electron conductive-resins are applied to improve conductivity, decrease internal resistance and increase the desalination process of brackish waters. Brackish waters are low in salinity with a high amount of total dissolved solids, which results in difficulties in maintaining strong electrical currents due to increased internal resistance in the cell. MDCs also experience problems with the saturation of ions in the anode chamber which can be combatted by utilizing a microbial capacitive desalination cell (MCDC). MCDCs are analogous to MDCs with the exception of modification to the cation membrane by the addition of activate carbon cloth, permitting the free exchange of protons across both chambers of the cell and increasing the efficiency of desalination.
Groundwater denitrification
Increasing agricultural development is associated with the trend of elevated nitrogen concentrations in surrounding soil and groundwater composition due to the runoff of fertilizers and agricultural byproducts. Development of a submerged microbial desalination-denitrification cell (SMDDC) to remove nitrogen and saline from subsurface water alleviates the demand for additional compounds acting as electron donors and instead produces both a net energy and clean, desalinated and denitrified water. In contrast to the typical MDC model, the SMDDC excludes a middle desalination chamber, but instead only contains an anode and cathode chamber separated by a polycarbonate plate and are parallel to the exterior AEM and CEM respectively. Nitrate is introduced through the AEM into the anode chamber through synthetic groundwater, then propagated as an effluent through the external loop to the cathode chamber, in which nitrate is reduced to nitrogen by the cathode and sodium influent. A wastewater feeding tank pumps water to the anodic chamber for subsequent oxidation of sludge by the anodic biofilm. Similar to the original configuration of the MDC, the SMDDC also includes an external circuit in which electrons are thus freed from the oxidation process of the sludge and drove through a closed, external circuit to the cathodic chamber. The toxic and pathogenic content of the wastewater are thus separated simultaneously with the denitrification of the groundwater, producing water that is thus filtered out as a usable effluent. Highest nitrate removal was exhibited when an external voltage (0.8 V) was applied to the circuit, transporting the ions to the anodic chamber and reducing nitrate via heterotrophic denitrification.
References
Water desalination
Electrochemistry | Microbial desalination cell | [
"Chemistry"
] | 1,316 | [
"Water treatment",
"Electrochemistry",
"Water technology",
"Water desalination"
] |
56,340,757 | https://en.wikipedia.org/wiki/Datroniella%20tropica | Datroniella tropica is a species of crust fungus in the family Polyporaceae. Found in southwestern China, it was described as a new species in 2014 by mycologists Bao-Kai Cui, Hai J. Lee, and Yu-Cheng Dai, who placed it in the new genus Datroniella. The type collection was made in Tongbiguan Nature Reserve (Longchuan County, Yunnan), where the fungus was found growing on a fallen angiosperm branch. The specific epithet tropica refers to its distribution in tropical China.
Description
The fruit body of D. tropica is effused-reflexed, meaning it is like a crust fungus with the margins extended and bent backwards to form rudimentary caps. These caps project up to , and are wide and thick at their base. The smooth cap surface is yellowish brown to reddish brown. The pore surface, initially white to cream, becomes brown when bruised and grey when dried. The small round pores number about 5–7 per millimetre.
Datroniella tropica has a dimitic hyphal system, containing both generative and skeletal hyphae. Its smooth, thin-walled spores measure 8–9.8 by 2.5–3.5 μm, and usually contain up to three oil droplets. Datroniella subtropica is similar in appearance, but has smaller spores that are 6.8–8 by 2–2.7 μm.
References
Fungi of China
Fungi described in 2014
Polyporaceae
Taxa named by Bao-Kai Cui
Taxa named by Yu-Cheng Dai
Fungus species | Datroniella tropica | [
"Biology"
] | 339 | [
"Fungi",
"Fungus species"
] |
56,340,765 | https://en.wikipedia.org/wiki/Cohesion%20number | The Cohesion number (Coh) is a useful dimensionless number in particle technology by which the cohesivity of different powders can be compared. This is especially useful in DEM simulations (Discrete Element Method) of granular materials where scaling of the size and stiffness of the particles are inevitable due to the computationally demanding nature of the DEM modelling.
Background
In simulation of granular materials, scaling the particle size with regards to the other particles physical and mechanical properties is a challenging job. Especially in simulation of cohesive powders, lack of a robust criterion for tuning the level of the surface energy of the particles can waste enormous amount of time during the process of calibration. The Bond number has been used traditionally in this regards, where the significance of the adhesive force (pull-off force) is compared with the particles gravitational force (weight); nevertheless, the influence of the materials properties, particularly the particles stiffness, is not comprehensively observed in this number. The particles stiffness, which is not present in the Bond number, has a considerable impact on how particles respond to an applied force. If the forces in the Bond number are substituted with potential and cohesion energies, a new dimensionless number will be formed whereby the effect of the particles stiffness is also considered. This was firstly proposed by Behjani et al. where they introduced a dimensionless number titled as the Cohesion number.
Definition and mathematical derivations
The Cohesion number is a dimensionless number which shows the ratio of the work required for detaching two arbitrary solid particles (work of cohesion) to their gravitational potential energy as expressed below,
For example, in the JKR contact model the work of cohesion is by which the Cohesion number is derived as follows:
Mass can be shown in the form of density and volume and the constant number can be eliminated,
The final version of the Cohesion number is as following:
is the particle density
is the gravity
is the interfacial energy
is the equivalent Young’s modulus:
is the material Poisson's ratio
shows the equivalent radius:
This number is dependent on the particles surface energy, particles size, particle density, gravity, and the Young’s modulus. It well justifies that the materials having lower stiffness become “stickier” if adhesive and it is a useful scaling method for the DEM simulations at which Young’s modulus is selected smaller than the real value in order to increase the computational speed. Recently, a rigorous analysis of the contact stiffness reduction for the adhesive contacts to speed up the DEM calculations shows the same fractional form.
See also
Contact mechanics
Surface tension
References
Dimensionless numbers of mechanics | Cohesion number | [
"Physics"
] | 545 | [
"Dimensionless numbers of mechanics",
"Mechanics"
] |
56,341,353 | https://en.wikipedia.org/wiki/Datroniella%20scutellata | Datroniella scutellata is a species of fungus in the family Polyporaceae, and the type species of genus Datroniella.
Taxonomy
The fungus was originally described in 1832 by German-American mycologist Lewis David de Schweinitz. He found the original collections in Bethlehem, New York, where it was growing on the branches and trunk of Syringa vulgaris. The fungus has been shuffled to many different polypore genera in its taxonomic history. Since the mid-1980s, it has largely been accepted in the genus Datronia, where it was transferred by Robert Lee Gilbertson and Leif Ryvarden. In 2014, Chinese mycologists made it the type species of the new genus Datroniella after molecular analysis showed that the species then classified in Datronia belonged to three distantly related clades.
Distribution
Datroniella scutellata is a widespread species with a cosmopolitan distribution, and is particularly prevalent in tropical areas. It is uncommon in Europe, where it is found only in the Alps of Austria and Switzerland.
References
Fungi described in 1832
Polyporaceae
Fungi of Asia
Fungi of Europe
Fungi of North America
Fungus species | Datroniella scutellata | [
"Biology"
] | 239 | [
"Fungi",
"Fungus species"
] |
56,343,400 | https://en.wikipedia.org/wiki/Polynomial%20functor%20%28type%20theory%29 | In type theory, a polynomial functor (or container functor) is a kind of endofunctor of a category of types that is intimately related to the concept of inductive and coinductive types. Specifically, all W-types (resp. M-types) are (isomorphic to) initial algebras (resp. final coalgebras) of such functors.
Polynomial functors have been studied in the more general setting of a pretopos with Σ-types; this article deals only with the applications of this concept inside the category of types of a Martin-Löf style type theory.
Definition
Let be a universe of types, let : , and let : → be a family of types indexed by . The pair (, ) is sometimes called a signature or a container. The polynomial functor associated to the container (, ) is defined as follows:
Any functor naturally isomorphic to is called a container functor. The action of on functions is defined by
Note that this assignment is only truly functorial in extensional type theories (see #Properties).
Properties
In intensional type theories, such functions are not truly functors, because the universe type is not strictly a category (the field of homotopy type theory is dedicated to exploring how the universe type behaves more like a higher category). However, it is functorial up to propositional equalities, that is, the following identity types are inhabited:
for any functions and and any type , where is the identity function on the type .
Inline citations
References
External links
An extensive collection of Notes on Polynomial Functors
Type theory | Polynomial functor (type theory) | [
"Mathematics"
] | 333 | [
"Type theory",
"Mathematical logic",
"Mathematical structures",
"Mathematical objects"
] |
56,343,495 | https://en.wikipedia.org/wiki/Gas%20chromatography%E2%80%93vacuum%20ultraviolet%20spectroscopy | Gas chromatography–vacuum ultraviolet spectroscopy (GC-VUV) is a universal detection technique for gas chromatography. VUV detection provides both qualitative and quantitative spectral information for most gas phase compounds.
GC-VUV spectral data is three-dimensional (time, absorbance, wavelength) and specific to chemical structure. Nearly all compounds absorb in the vacuum ultraviolet region of the electromagnetic spectrum with the exception of carrier gases hydrogen, helium, and argon. The high energy, short wavelength VUV photons probe electronic transitions in almost all chemical bonds including ground state to excited state. The result is spectral "fingerprints" that are specific to individual compound structure and can be readily identified by the VUV library.
Unique VUV spectra enable closely related compounds such as structural isomers to be clearly differentiated. VUV detectors complement mass spectrometry, which struggles with characterizing constitutional isomers and compounds with low mass quantitation ions. VUV spectra can also be used to deconvolve analyte co-elution, resulting in an accurate quantitative representation of individual analyte contribution to the original response. This characteristically lends itself to significantly reducing GC runtimes through flow rate-enhanced chromatographic compression.
VUV spectroscopy follows the simple linear relationship between absorbance and concentration described by the Beer-Lambert Law, resulting in more accurate retention time-based identification. VUV absorbance spectra also exhibit feature similarity within compound classes, meaning VUV detectors can rapidly compound class characterization in complex samples through compound spectral shape and retention index information. Advances in technology reduces the typical group analysis data processing time from 15 to 30 minutes to <1 minute per sample.
History
The first benchtop detector was introduced in 2014 with detection capabilities between 120 and 240 nm. This portion of the ultraviolet spectrum had historically been restricted to bright source synchrotron facilities due to significant background absorption challenges inherent to working within the wavelength range. Further detector platform development has extended the wavelength detection range out from 120 to 430 nm.
How it works
VUV detectors for gas chromatography detectors
VUV detectors are compatible with most gas chromatography (GC) manufacturers. The detectors can be connected through a heated transfer line inserted through a punch-out in the GC oven casing. A makeup flow of carrier gas is introduced at the end of the transfer line. Analytes arrive in the flow cell and are exposed to VUV light from a deuterium lamp. Specially coated reflective optics paired with a back-thinned charge-coupled device (CCD) enable the collection of high-quality VUV absorption data. Figure 1 shows a schematic of the analyte path from GC to VUV detector.
VUV spectral identification
Gas phase species absorb and display unique spectra between 120 – 240 nm where high energy σ→σ*, n→σ*, π→π*, n → π* electronic transitions can be excited and probed. VUV spectra reflect the absorbance cross section of compounds and are specific to their electronic structure and functional group arrangement. The ability of VUV detectors to produce spectra for most compounds results in universal and highly selective compound identification. VUV spectroscopy data is highly characteristic while also providing quantitative information. Many commonly used GC detectors such as the electron capture detector (ECD), flame ionization detector (FID), and thermal conductivity detector (TCD) produce quantitative but not qualitative detail. Gas chromatography–mass spectrometry (GC-MS) generates qualitative and quantitative data but has difficulty characterizing labile and low mass compounds, as well as differentiating between isomers. GC-VUV complements MS by overcoming its limitations and providing a secondary method of confirmation. It also offers a single-instrument alternative to the use of multiple detectors for qualitative and quantitative analysis.
Naphthols, xylenes, and cis- and trans- fatty acids are compounds that are prohibitively difficult to distinguish according to their electron ionization mass spectral profiles. Xylenes present the additional challenge of natural co-elution that makes separating their isoforms problematic. Figure 2 shows the distinct VUV spectra of m-, p-, and o-xylene. These compounds can be differentiated despite their only difference being the position of two methyl groups around a benzene ring. The spectral differences of these isomers enable their co-elution to be resolved through spectral deconvolution.
Fatty acid screening and profiling is an application that commonly requires the use of multiple detectors to achieve quantitative and qualitative results. FID is a quantitative detector that is suitable for routine screening when guided by retention index information. GC-MS has traditionally been used for qualitative compound profiling, but falls short where isobaric analytes are prevalent. It especially struggles with differentiating cis and trans fatty acid isomers. Electron impact ionization can also cause double bond migration and lead to ambiguous fatty acid structural data.
Determining cis and trans fatty acid distribution in oils and fats is important in assessing their potential health impacts. VUV spectra of trans-containing fatty acid methyl ester (FAME) isomers typically found in butter and vegetable oils are shown in Figure 3. These trans-containing isomers separate chromatographically from cis-containing isomers and have the tendency to co-elute with each other and, in some cases, with select C20:1 isomers. GC-VUV is not only able to differentiate the C18:3 FAME variants, but is also capable of telling cis isomers apart from trans isomers. Degrees of unsaturation such as C20:1 vs. C18:3 can additionally be distinguished. Previous work has demonstrated how distinct VUV spectra enable straightforward deconvolution and accurate quantitation of cis and trans FAME isomers.
Chromatographic compression and spectral deconvolution
Unique VUV absorbance spectra not only enable unambiguous compound identification, and allows GC run times to be deliberately shortened. VUV detectors operate at ambient pressure and are thus not flow rate limited. GC run times can be reduced by increasing the GC column flow and oven temperature program rates.
Flow rate-enhanced chromatographic compression utilizes VUV spectral deconvolution to resolve any co-elution that may result from shortening GC runtimes. VUV absorption is additive, meaning that overlapping peaks give a spectrum that corresponds to the sum absorbance of each compound. The individual contribution of each analyte can be determined if the VUV spectra for co-eluting compounds are stored in the VUV library. The ability to differentiate coeluting analyte spectra and use them to deconvolve the overlapping signals is demonstrated in Figure 4. The individual spectra of terpenes limonene and p-Cymene are shown in Panel A along with the summed absorbance of the selected retention time window (blue region in Panel B) and the fit with VUV library spectra. The R2 >0.999 fit result confirms their identities, and enables the deconvolution of these and other terpenes analyzed by GC-VUV as featured in Panel B.
Testing for the presence of residual solvents in Active Pharmaceutical Ingredients (APIs) is critical for patient safety and commonly follows United States Pharmacopeia (USP) Method <467> guidelines, or more broadly, International Council for Harmonization (ICH) Guideline Q3C(R6). The gas chromatography (GC) runtime suggested by USP Method 467 is approximately 60 min. A generic method for residual solvent analysis by GC-MS describes conditions that include a runtime of approximately 30 minutes. A GC-VUV and static headspace method was developed using a chromatographic compression strategy that resulted in a GC runtime of 8 minutes. The GC-VUV method uses a flow rate of 4 mL/min and an oven ramp of 35 °C (held for 1 min), followed by an increase to 245 °C at a rate of 30 °C/min.
Figure 5 compares the results when the general conditions of the GC-MS method were followed against the GC-VUV method run with Class 2 residual solvents. Tetralin eluted at approximately 35 minutes using the GC-MS method conditions, whereas the analyte had a retention time of less than 7 minutes when the GC-VUV method was applied. The co-elution of m- and p-xylene occurred in both GC-MS and GC-VUV method runs. VUV software matched the analyte absorbance of both isomers with VUV library spectra (Figure 2) to deconvolve the overlapping signals as displayed in Figure 6. Goodness of fit information ensures that the correct compound assignment takes place during the post-run data analysis.
The flow rate-enhanced chromatographic compression strategy has been applied to a diverse set of applications since the development of the GC-VUV method for residual solvents analysis. The fast GC-VUV approach reduced GC runtimes for terpene analysis from 30 minutes to 9 minutes (the deconvolution of monoterpene isomers is shown in Figure 4). It has also been demonstrated that GC runtimes as short as 14 minutes can be used for PIONA compound analysis of gasoline samples. Typical GC separation times range between 1 – 2 hours using alternative methods.
Compound class characterization
GC-VUV can be used for bulk compositional analysis because compounds share spectral shape characteristics within a class. Proprietary software applies fitting procedures to quickly determine the relative contribution of each compound category present in a sample. Retention index information is used to limit the amount of VUV library searching and fitting performed for each analyte, enabling the automated data processing routine to be completed quickly. Compound class or specific compound concentrations can be reported as either mass or volume percent.
GC-VUV bulk compound characterization was first applied to the analysis of paraffin, isoparaffin, olefin, naphthene, and aromatic (PIONA) hydrocarbons in gasoline streams. It is suitable for use with finished gasoline, reformate, reformer feed, FCC, light naphtha, and heavy naphtha samples. A typical chromatographic analysis is displayed in Figure 7. The inset shows how the analyte spectral response is fit with VUV library spectra for the selected time slice. A report detailing the carbon number breakdown within each PIONA compound class, as well as the relative mass or volume percent of classes, is shown. A table with mass % and carbon number data from a gasoline sample can be seen in Figure 8. Compound class characterization utilizes a method known as time interval deconvolution (TID), which has recently been applied to the analysis of terpenes.
References
Gas chromatography
Spectroscopy | Gas chromatography–vacuum ultraviolet spectroscopy | [
"Physics",
"Chemistry"
] | 2,261 | [
"Chromatography",
"Molecular physics",
"Spectrum (physical sciences)",
"Instrumental analysis",
"Spectroscopy",
"Gas chromatography"
] |
56,343,589 | https://en.wikipedia.org/wiki/SAMV%20%28algorithm%29 | SAMV (iterative sparse asymptotic minimum variance) is a parameter-free superresolution algorithm for the linear inverse problem in spectral estimation, direction-of-arrival (DOA) estimation and tomographic reconstruction with applications in signal processing, medical imaging and remote sensing. The name was coined in 2013 to emphasize its basis on the asymptotically minimum variance (AMV) criterion. It is a powerful tool for the recovery of both the amplitude and frequency characteristics of multiple highly correlated sources in challenging environments (e.g., limited number of snapshots and low signal-to-noise ratio). Applications include synthetic-aperture radar, computed tomography scan, and magnetic resonance imaging (MRI).
Definition
The formulation of the SAMV algorithm is given as an inverse problem in the context of DOA estimation. Suppose an -element uniform linear array (ULA) receive narrow band signals emitted from sources located at locations , respectively. The sensors in the ULA accumulates snapshots over a specific time. The dimensional snapshot vectors are
where is the steering matrix, contains the source waveforms, and is the noise term. Assume that , where is the Dirac delta and it equals to 1 only if and 0 otherwise. Also assume that and are independent, and that , where . Let be a vector containing the unknown signal powers and noise variance, .
The covariance matrix of that contains all information about is
This covariance matrix can be traditionally estimated by the sample covariance matrix where . After applying the vectorization operator to the matrix , the obtained vector is linearly related to the unknown parameter as
,
where , , , , and let
where
is the Kronecker product.
SAMV algorithm
To estimate the parameter from the statistic , we develop a series of iterative SAMV approaches based on the asymptotically minimum variance criterion. From, the covariance matrix of an arbitrary consistent estimator of based on the second-order statistic is bounded by the real symmetric positive definite matrix
where . In addition, this lower bound is attained by the covariance matrix of the asymptotic distribution of obtained by minimizing,
where
Therefore, the estimate of can be obtained iteratively.
The and that minimize can be computed as follows. Assume and have been approximated to a certain degree in the th iteration, they can be refined at the th iteration by,
where the estimate of at the th iteration is given by with .
Beyond scanning grid accuracy
The resolution of most compressed sensing based source localization techniques is limited by the fineness of the direction grid that covers the location parameter space. In the sparse signal recovery model, the sparsity of the truth signal is dependent on the distance between the adjacent element in the overcomplete dictionary , therefore, the difficulty of choosing the optimum overcomplete dictionary arises. The computational complexity is directly proportional to the fineness of the direction grid, a highly dense grid is not computational practical. To overcome this resolution limitation imposed by the grid, the grid-free SAMV-SML (iterative Sparse Asymptotic Minimum Variance - Stochastic Maximum Likelihood) is proposed, which refine the location estimates by iteratively minimizing a stochastic maximum likelihood cost function with respect to a single scalar parameter .
Application to range-Doppler imaging
A typical application with the SAMV algorithm in SISO radar/sonar range-Doppler imaging problem. This imaging problem is a single-snapshot application, and algorithms compatible with single-snapshot estimation are included, i.e., matched filter (MF, similar to the periodogram or backprojection, which is often efficiently implemented as fast Fourier transform (FFT)), IAA, and a variant of the SAMV algorithm (SAMV-0). The simulation conditions are identical to: A -element polyphase pulse compression P3 code is employed as the transmitted pulse, and a total of nine moving targets are simulated. Of all the moving targets, three are of dB power and the rest six are of dB power. The received signals are assumed to be contaminated with uniform white Gaussian noise of dB power.
The matched filter detection result suffers from severe smearing and leakage effects both in the Doppler and range domain, hence it is impossible to distinguish the dB targets. On contrary, the IAA algorithm offers enhanced imaging results with observable target range estimates and Doppler frequencies. The SAMV-0 approach provides highly sparse result and eliminates the smearing effects completely, but it misses the weak dB targets.
Open source implementation
An open source MATLAB implementation of SAMV algorithm could be downloaded here.
See also
(Radon transform)
(MUSIC), a popular parametric superresolution method
References
Signal estimation
Fourier analysis
Frequency-domain analysis
Trigonometry
Wave mechanics
Medical imaging
Inverse problems
Multidimensional signal processing
Signal processing
Tomography | SAMV (algorithm) | [
"Physics",
"Mathematics",
"Technology",
"Engineering"
] | 1,015 | [
"Physical phenomena",
"Telecommunications engineering",
"Spectrum (physical sciences)",
"Computer engineering",
"Signal processing",
"Frequency-domain analysis",
"Applied mathematics",
"Classical mechanics",
"Waves",
"Wave mechanics",
"Inverse problems"
] |
56,343,748 | https://en.wikipedia.org/wiki/Laser%20welding%20of%20polymers | Laser welding of polymers is a set of methods used to join polymeric components through the use of a laser. It can be performed using CO2 lasers, Nd:YAG lasers, Diode lasers and Fiber lasers.
When a laser encounters the surface of plastics, it can be reflected, absorbed or penetrate through the thickness of a component. Laser welding of plastics is based on the energy absorption of laser radiation, which can be reinforced by additives and fillers.
Laser welding techniques include:
Direct laser welding
Laser surface heating,
Through transmission laser welding
Intermediate film welding.
Because of high joining speeds, low residual stresses and excellent weld appearances, laser welding processes have been widely used for automotive and medical applications.
Laser sources
The types of lasers used in the welding of polymers include CO2 lasers, Nd:YAG lasers, Diode lasers and fiber lasers. CO2 lasers are mostly applied to weld thin films and thin plastics due to the high energy absorption coefficients of most plastics. Nd:YAG lasers and Diode lasers produce short wavelength radiation, which transmit through several millimeters of unpigmented polymer. They are used in the transmission laser welding techniques.
Carbon dioxide lasers
Carbon dioxide lasers have a wavelength of 10.6 μm which is rapidly absorbed by most polymers. Because of the high-energy absorption coefficients, processing of plastics using CO2 can be done rapidly with low laser powers. This type of laser can be used in direct welding of polymers or cutting. However, the penetration of CO2 lasers is less than 0.5 mm and is mostly applicable for the welding of thin film and surface heating. Because the beam cannot be transmitted by silicon fiber, the beam is commonly delivered by mirrors.
Nd:YAG lasers
Nd:YAG lasers have a wavelength in the range of 0.9 - 1.1 μm, with 1064 nm being the most common. These lasers provide a high beam quality allowing for small spot sizes. This type of beam can be delivered via fiber optic cable.
Diode lasers
The wavelength of diode lasers is typically in the 780 - 980 nm wavelength range. Compared with Nd:YAG laser and CO2 laser, diode laser has supreme advantage in energy efficiency. The high-energy light wave can penetrate a thickness of a few millimeters in semicrystalline plastics and further in unpigmented amorphous plastics. Diode lasers can be either fiber delivered or local to the weld location. The relatively small size makes assembling arrays for larger foot prints possible.
Fiber laser
Fiber lasers typically exhibit wavelengths ranging from 1000 to 3500 nm. The expanded range of wavelengths has allowed for the development of through transmission welding without additional absorbing additives.
Equipment
The equipment settings may vary greatly in design and complexity. However, there are five components included in most of the machines:
generator/power supply
control interface
actuator
lower fixture
upper fixture.
Generator/Power supply
This component transforms the received voltage and frequency to the corresponding voltage, current and frequency to the laser source. Diode laser and fiber laser are the two most commonly used system for laser welding.
Control interface
The control interface is an interface between operator and machine to monitor operations of the system. It is constructed by logic circuits to send operators the information of machine status and welding parameters. Depending on different laser modes, the control interface will vary the parameters allowable to change.
Actuator
This component is a press activated by pneumatical and electrical power. It compresses the part in the upper fixture to touch the components in the lower fixture and apply pre-determined loads during welding processes. Displacement controls are added to actuators to monitor precisely the movements.
Lower fixture
Lower fixture is a jig structure that locates the lower part of a joint. It provides locations and alignments that ensure the welding of components with tight tolerances.
Upper fixture
The upper fixture is the most complicated and important component in the whole system. Laser beam is generated in this component to heat up the welding parts. The design of upper fixture often varies from laser sources and heating modes. For example, when a YAG laser or a diode laser is used as the heat source, optical fibers are often employed to provide mobility. However, the welding part cannot move.
Laser interaction with polymers
There are three types of interactions that can occur between laser radiation and plastics:
reflection,
absorption
transmission
The extent of individual interaction is dependent upon materials properties, laser wavelength, laser intensity and beam speed.
Reflection
Reflection of incident laser radiation is typically on the order of 5 to 10% in most polymers, which is low compared with absorption and transmission. The fraction of reflection (R) can be determined by the following equation,
where is the index of refraction of the plastics and is the index of refraction of air (~1).
Transmission
Transmission of laser energy through certain polymers allows for processes such as through transmission welding. When the laser beam travel through the interfaces between different medium, the laser beam is refracted unless the path is perpendicular to the surface. This effect needs to be considered when laser travels through multi-layer to reach the joint region.
Internal scattering occur when laser pass through the thickness in semicrystalline plastics, where crystalline and amorphous phase have different index of refraction. Scattering can also occur in crystalline and amorphous plastics with reinforcement like glass fiber and certain colorants and additives. In transmission laser welding, such effect can reduce the effective energy of laser radiation towards joint area and limit the thickness of components.
Absorption
Laser absorption can occur at the surface of plastics or during transmission through thickness. The amount of laser energy absorbed by a polymer is a function of the laser wavelength, polymer absorptivity, polymer crystallinity, and additives (i.e. composite reinforcements, pigments, etc.). The absorption at surface has two possible ways, photolytic and pyrolytic.
Photolytic process occurs at short wavelength radiation (less than 350 nm or ultraviolet (UV)), when the photon energy is sufficient to break chemical bonds.
Pyrolytic process occurs at long wavelength radiation (larger than 0.35 μm). Such process is involved with heat generations, which can be used for welding and cutting purposes.
The heat distribution within a laser welded polymer is dictated by the Bouger–Lambert law of absorption.
I(z) = I(z=0) eKz
where I(z) is the laser intensity at a certain depth z, I(z=0) is the laser intensity at the surface, K is the absorption constant.
Effect of additives
Polymers often have secondary elements added to them for various reasons (i.e. strength, color, absorption, etc.). These elements can have a profound effect on the laser interaction with the polymer component. Some common additives and their effect on laser welding are described below.
Reinforcements
Various fibers are added to polymeric materials to create higher strength composites. Some typical fiber materials include: glass, carbon fiber, wood, etc. When the laser beam interacts with these materials it can get scattered or absorbed, changing the optical properties from that of the base polymer. In laser transmission welding, a transparent material with reinforcement may absorb or dilute the energy beam more, effecting the quality of the weld. High contents of glass fiber content increase the scattering within the plastics and raise the laser energy input for welding a certain thickness.
Colorants
Colorants (pigments) are added to polymers for various reasons including aesthetics and functional requirements (such as optics). Certain color additives, such as titanium dioxide, can have a negative impact on the laser weldability of a polymer. The titanium dioxide provides a white coloring to polymers but also scatters laser energy making it difficult to weld. Another color additive, carbon black, is a very effective energy absorber and is often added to create welds. By controlling the concentration of carbon black with the absorbing polymer it is possible to control the effective area of the laser weld.
Laser application configurations
The laser beam energy can be delivered to the required areas through a variety of configurations. The four most common approaches include:
contour heating,
simultaneous heating,
quasi-simultaneous heating, and
masked heating.
Contour heating
In the contour heating (laser scanning or laser moving) technique, a laser beam of fixed dimension passes through the desired area to create a continuous weld seam. The laser source is manipulated by a galvanic mirror or a robotic system to scan at a fast rate. The benefit of contour heating is that the weld can be performed with a single laser source, which can be reprogramed for different applications; however, due to the localized heating area, uneven contact between welding components can occur and form weld voids. The important parameters for this technique include: laser wavelength, laser power, traverse speed, and polymer properties.
Simultaneous heating
In the simultaneous heating approach, a beam spot of appropriate size is used to irradiate the entire weld area without the need for relative movement between the work piece and the laser source. For creating a weld with a large area, multiple laser sources can be combined to melt the selected region simultaneously. This approach can be adopted to substitute ultrasonic welding in the case of welding components sensitive to vibration. Key processing parameters for this approach include: laser wavelength, laser power, heating time, clamp pressure, cooling time, and polymer properties.
Quasi-simultaneous heating (QSLW)
In the quasi-simultaneous heating, a work area is irradiated by the use of scanning mirrors. The mirrors raster the laser beam over the entire work area rapidly, creating a simultaneously melted region. Some of the important parameters for this technique include: laser wavelength, laser power, heating time, cooling time, polymer properties.
Masked heating
Masked heating is a process of laser line scanning through a region with a mask, which ensures that only the selected areas can be heated when the laser pass through. Masks can be made out of laser cut steel, or other materials that effectively block the laser radiation. This approach is capable of creating micro-scale welds on components with complex geometries. Key processing parameters for this approach include: laser wavelength, laser power, heating time, clamp pressure, cooling time, and polymer properties.
Laser welding techniques
Depending on different interactions between laser and thermoplastics, four different laser welding techniques have been developed for plastic joining. CO2 lasers have good surface absorption for most thermoplastics, hence they are applied for direct laser welding and laser surface heating. Through transmission laser welding and intermediate film welding require the deep penetration of laser beam, so YAG lasers and diode lasers are the most common sources for these techniques.
Direct laser welding
Similar to laser welding of metals, in direct laser welding the surface of the polymer is heated to create a melt zone that joins two components together. This approach can be used to create butt joints and lap joints with complete penetration. Laser wavelengths between 2 and 10.6 μm are used for this process due to their high absorptivity in polymers.
Laser surface heating
Laser surface heating is similar to non-contact hot plate welding in that mirrors are placed between components to create a molten surface layer. The exposure duration is usually between 2-10 s. Then the mirror is retracted and the components are pressed together to form a joint. Process parameters for laser surface heating include the laser output, wavelength, heating time, change-over time, and forging pressure and time.
Through transmission laser welding (TTLW)
Through transmission laser welding of polymers is a method to create a joint at the interface between two polymer components with different transparencies to laser wavelengths. The upper component is transparent to the laser wavelength between 0.8 μm to 1.05 μm, and the lower component is either opaque in nature, or modified by the addition of colorants which promote the absorption of laser radiation. A typical colorant is carbon black that absorb most of the electromagnetic wavelength. When the joint is irradiated by the laser, the transparent layer passes the light with minimal loss while the opaque layer absorbs the laser energy and heats up.
The two components are held by the lower fixture to control alignment and a small clamping force is added to the upper part to form intimate contact. A melt layer is then created at the interface between the two components, composed of a mixture of two plastic materials.
There are four different modes of transmission laser welding: scanning mode, simultaneous, quasi-simultaneous, and mask heating.
Many benefits can be obtained by transmission laser welding such as fast welding velocity, flexibility, good cosmetic properties and low residual stresses. From processing perspectives, laser welding can be performed in the pre-assembled conditions, reducing the necessity for complex fixtures; however, this method is not suitable for plastics with high crystallinity due to refraction and geometric limitations.
Intermediate film welding
Intermediate film welding is a method to join incompatible plastic components by using an intermediate film between them. Similar to transmission welding, laser radiation passes through the transparent components and melts the intermediate layers to create a joint. This film can be made of an opaque thermoplastic, solvent, viscous fluid, or other substances that heat up upon exposure to laser energy. The combination of intermediate films and adhesion promoters is able to join incompatible thermoplastics together. The thin layer then generates the heat required to fuse the system together.
Applications
Automotive applications
The black body of car keys is welded by the Through Transmission Laser Welding (TTLW) technique, in which laser radiation transmits through the upper component and forms a joint at the interface. Carbon black is added to the lower part of car keys to absorb laser radiation. The black color of the upper part is made by the addition of dye, which makes the component appear black but transparent to laser radiation.
Other applications of laser welding in automotive industry include brake fluid reservoirs and lighting components.
Medical applications
Laser welding of plastics is applied to weld medical devices like IV-bags. Joints of high geometrical complexity can be produced by laser welding without particulate formation. This is critical for the safety of patients, when welding techniques are applied to produce IV-bags containing blood. In addition, flashes generated during welding can cause blood turbulences and destroy blood platelets. A good control of the laser power avoids flash formation and thus protects the blood cells from damage.
References
Polymers
Laser applications
Welding | Laser welding of polymers | [
"Chemistry",
"Materials_science",
"Engineering"
] | 2,937 | [
"Polymers",
"Welding",
"Mechanical engineering",
"Polymer chemistry"
] |
56,345,152 | https://en.wikipedia.org/wiki/Zero%20ionic%20layer | Zero ionic layer is the main site of interaction in the core SNARE complex. Dipole-dipole interactions take place between 3 glutamine (Q) residues and 1 arginine (R) residue exposed in this layer. Despite that, the majority of the SNARE complex is hydrophobic because of the leucine zipper. Extensively studied layers within the SNARE alpha-helical bundle are designated from "-7" to "+8". Zero ionic layer is at the center of the bundle, and thus designated as "0" layer.
Structure
SNARE complex is a bundle formed by 4 alpha-helical proteins, including vesicle-associated synaptobrevin and cell-membrane-associated syntaxin and SNAP. When the bundle is viewed on the side, for every alpha-helical turn, the alpha-carbons from each helix form a plane, which is thus designated as a "layer". Along the helical bundle from N-terminus to C-terminus, layers are designated from "-7" to "+8" respectively. "0" layer (i.e. zero ionic layer) is at the center of the helical bundle.
The zero ionic layer is an ionic domain within the otherwise largely hydrophobic alpha-helical complex (SNARE complex) . It is stabilized by attractive forces(dipole-dipole interactions) between three partially negatively charged carbonyl groups of glutamine residues and a positively charged arginine. Specifically, these interacting groups include Q226 on Syntaxin, Q53 on SNAP-25 (Sn1), Q174 on SNAP-25 (Sn2) and R56 on Synaptobrevin (v-SNARE).
The 4 amino acids are asymmetrically arranged in the layer, as shown in the picture. However, their intensive interactions ensure the layer's stability: the arginine side chain end lies in the center of the asymmetry and amino groups form hydrogen bonds with the three glutamine residues. Thus, steric and electrostatic fit is well established.
Function and research interest
SNARE proteins are a family of a proteins that are located in cell membranes to mediate any secretory pathways. The complex is formed during exocytosis, a process where the vesicles inside the cell fuse with the cell membrane to secrete molecules into the extracellular space.
The zero ionic layer of the SNARE complex is at special interest to scientists studying SNARE because of its three characteristics. Firstly, it is the only hydrophilic region in the entire hydrophobic SNARE complex; secondly, unlike most of the other layers, it displays asymmetry; thirdly, the 3Q:1R arrangement is found in almost all of the SNARE superfamily among eukaryotic cells. These unique aspects imply its importance to eukaryotic organisms in general. However, the exact and functions of zero ionic layer is still under investigation.
Previous studies have focused on how mutations in this layer would affect the functionality of SNARE complex in secretory pathways. Even though the exact mechanism still awaits further investigation, these studies have revealed that the integrity of zero ionic layer is not essential to the proper alignment during complex formation, but it is essential to the disassociation of SNARE complex and the recycling of its 4 constituent alpha-helical proteins after exocytosis.
An ATPase (NSF) together with a cofactor (α-SNAP) facilitates the breakdown of the SNARE complex after the completion of exocytosis. Studies have suggested that, during the disassociation process, the NSF/α-SNAP complex acts specifically on the zero ionic layer, particularly, the glutamine residue (Q226) in Syntaxin. The glutamine residue transmits the conformational change of NSF/α-SNAP complex to the SNARE complex in order to disrupt and thus disassociate the SNARE complex at the zero ionic layer. More specifically, even though the ionic layer is buried within the hydrophobic complex for the most part, during disassociation, NSF/α-SNAP complex may disturb the hydrophobic shielding and thus let water molecules into the core. This exposure of other hydrophilic molecules disturb the original hydrogen bonding equilibrium and thus facilitate disassembly of the alpha-helical bundle.
Mutation and alternation
In studies that use exocytotic SNAREs of yeast as models, a mutation from glutamine to arginine in the zero ionic layer leads to yeast cells that have deficient growth and protein secretion ability. However, a mutation from arginine to glutamine in this layer leads to yeast cells that are functionally wild-type. In the mutation where all four amino acids in the zero ionic layer are glutamine residues, the cells still exhibit normal secretory ability, but defects may become pronounced when there are other mutations.
Complementary mutations, where a glutamine to arginine mutation is paired with an arginine to glutamine mutation in the zero ionic layer, have resulted in functionally wild-type yeast cells too, according to their secretory ability.
These mutation studies have been done to study the role of the four amino acids in zero ionic layer. Underlying mechanisms of why these mutations would lead to certain results are not well discussed. In general, the glutamine residues in this layer are of critical importance to the functionality of mutated strains. As long as the glutamine is intact or compensated in someway during mutation, functionality of SNARE complex will be retained.
References
Membrane biology | Zero ionic layer | [
"Chemistry"
] | 1,174 | [
"Membrane biology",
"Molecular biology"
] |
56,345,311 | https://en.wikipedia.org/wiki/K2-138b | K2-138b is a potentially rocky Super-Earth exoplanet orbiting every 2 days around a K1V star. The planet, along with the four others in the system, was found by citizen scientists of the Exoplanet Explorers project on Zooniverse. It was the final planet found in the system and was officially announced on January 8, 2018.
K2-138b is the smallest planet of K2-138 with a radius of 1.57 , meaning it could be rocky. It orbits its host star every 2.35 days at a distance of 0.0338 AU. At this proximity, the planet is likely very hot and receives 486 times the stellar flux as Earth. The planet has a Mass of and a bulk density of g/cm−3, which is an earth-like density. The planet has likely a rocky core and a substantial atmospheric layer, composed of volatiles.
The K2-138 system is unique for being the first exoplanet system discovered entirely by citizen scientists.
The K2-138 system, including K2-138b will be studied with CHEOPS to further constrain the mass of the planets with transit-timing variation (TTV).
See also
List of exoplanets discovered in 2017
References
Transiting exoplanets
Exoplanets discovered in 2017
Exoplanets discovered by K2
Aquarius (constellation) | K2-138b | [
"Astronomy"
] | 290 | [
"Constellations",
"Aquarius (constellation)"
] |
56,347,574 | https://en.wikipedia.org/wiki/1883%20Tehachapi%20train%20wreck | The Tehachapi train wreck occurred on January 20, 1883, near Tehachapi, California, when a runaway train rolled down a slope into a curve and derailed. The accident resulted in the deaths of 15 people, including former Wisconsin congressman Charles H. Larrabee and Maria Guirado, the wife of the former California Governor John G. Downey. Governor Downey was also injured in the wreck.
Incident
On January 20, 1883, a 4-8-0 steam locomotive had just climbed a steep peak in Tehachapi, California. However, when the train was left unattended, it became a runaway and derailed along the same track that it had previously climbed. Both sleeper cars, an express car, and the mail and baggage coaches derailed and ignited a fire. Fifteen were killed. Investigation into the incident revealed that two strangers had boarded the train. It is believed that these two men were robbers that had lost control of the train and would also die in the disaster.
References
Railway accidents in 1883
Accidents and incidents involving Southern Pacific Railroad
1883 in California
1883 disasters in the United States | 1883 Tehachapi train wreck | [
"Technology"
] | 228 | [
"Railway accidents and incidents",
"Rail accident stubs"
] |
56,347,905 | https://en.wikipedia.org/wiki/Ciner%20Wyoming | The Ciner Wyoming LCC is a mining and chemical industry company based in Wyoming, United States, producing natural soda ash from trona. The initial company was founded in 1962. Since 2015, it is under the control of the Turkish Ciner Holding.
Background
In 1962, Big Island Mine and Refinery was founded by the Stauffer Chemical Company to produces soda ash from the mined trona. In 1984, mining method was changed from conventional drilling and blasting mining to continuous mining. The company was acquired by Chesebrough Pond's in 1985. The next year, the company was sold to the British Imperial Chemical Industries (ICI) after Chesebrough Pond's was acquired by the Anglo-Dutch company Unilever. In 1987, already one year later, the French chemical and pharmaceutical company Rhône-Poulenc bought the ICI interests in the soda ash production section of Stauffer Chemical. The company was sold to OCI Chemical Corporation, a subsidiary of the South Korea-based OCI Company Ltd in 1996. The production capacity was increased about one million tons of soda ash when an automated unit was pot into service in 1998. Dual fuel calcination became available in 2007. Overall plant efficiency was increased by recovering soda ash from the mine dump ponds in a newly built Decahydrate plant in 2009. In 2013, the company shares were listed on the New York Stock Exchange under the ticker symbol OCIR.
In 2015, Ciner Enterprises Inc., a subsidiary of the Turkish Ciner Holding acquired OCI Chemical Corporation, which was later renamed to Ciner Resources Corporation. 49% interest in Ciner Wyoming LLC is held by Natural Resource Partners.
Plant and production
Ciner Wyoming is located at Green River in Sweetwater County of Wyoming, United States. The company extracts trona using room and pillar mining method. After trona ore is conveyed to the surface, it is processed into dense soda ash (sodium carbonate, Na2CO3). Mining operations are carried out on an area of approximately , and for the surface operations are available.
Green River Basin in Wyoming has the highest purity, largest and most accessible underground trona ore deposit in the world. Mining operations are carried out in two separate deposit beds at depths of . The extent of the proven and probable reserves are , which is equivalent to of soda ash. The reserve life is reported to be well more than 60 years based upon current production rates.
Soda ash is used as a raw material in a variety of industrial products and consumer goods, including glass (47%), chemicals (30%), soap (7%), and paper. Other products are sodium percarbonate (2 Na2CO3 · 3 H2O2), hydrogen peroxide (H2O2), and other chemicals to soap and detergent production.
Global competitors in the field of soda ash are Tronox (United States), Solvay S.A. (Belgium), Tata Chemicals (India) and Searles Valley Mineralss, United States. Ciner Holding also owns two companies in Turkey, Eti Soda and Kazan Soda Elektrik, which produce natural soda ash.
See also
Eti Soda
Kazan Soda Elektrik
References
Ciner Glass and Chemicals Group
Mining companies of the United States
Chemical companies of the United States
Chemical plants
Industrial buildings and structures in Wyoming
Industrial buildings completed in 1962
Chemical companies established in 1962
Non-renewable resource companies established in 1962
2015 establishments in Wyoming
Privately held companies based in Wyoming
Green River, Wyoming
American companies established in 1962 | Ciner Wyoming | [
"Chemistry"
] | 721 | [
"Chemical process engineering",
"Chemical plants"
] |
56,348,140 | https://en.wikipedia.org/wiki/Richard%20von%20Mises%20Prize | The Richard von Mises Prize is awarded annually by the International Association of Applied Mathematics and Mechanics (GAMM). Since its inception in 1989, the award is given to a young scientist (not older than 36) for outstanding scientific achievements in the field of Applied Mathematics and Mechanics. The prize is presented during the opening ceremony of the GAMM Annual Meeting where the winner will present his research in a plenary talk. The prize aims to reward and encourage young scientists whose research represents a major advancement in the field of Applied Mathematics and Mechanics.
Richard von Mises was an Austrian-American mathematician who worked among others on numerical mathematics, solid mechanics, fluid mechanics, statistics and probability theory.
Winners
The prize winners have included:
Alexander Mielke (1989)
Tobias von Petersdorff (1991)
Peter Fotin (1992)
Carsten Carstensen (1993)
Michael Fey (1993)
Christiane Tretter (1993)
Franz Marketz (1996)
Hermann Nirschel (1997)
Guido Schneider (1997)
Valery Levitas (1998)
Michael Ruzicka (1999)
Peter Eberhard (2000)
Udo Nackenhorst (2000)
Martin Rein (2000)
Herbert Steinrück (2001)
Britta Nestler (2002)
Xue-Nong Chen (2002)
Barbara Niethammer (2003)
Mark David Groves (2004)
Bernd Rainer Noack (2005)
José A. Carrillo (2006)
Michael Dumbser (2007)
Tatjana Stykel (2007)
Chiara Daraio (2008)
Daniel Balzani (2009)
Bernd Schmidt (2009)
Volker Gravemeier (2010)
Ulisse Stefanelli (2010)
Oliver Röhrle (2011)
Swantje Bargmann (2012)
Dennis M. Kochmann (2013)
Christian Linder (2013)
Irwin Yousept (2014)
Siddhartha Mishra (2015)
Dominik Schillinger (2015)
Josef Kiendl (2016)
Martin Stoll (2016)
Benjamin Klusemann (2017)
Christian Kuehn (2017)
Marc Avila (2018)
Dietmar Gallistl (2019)
Philipp Junker (2019)
Fadi Aldakheel (2020)
Elisa Davoli (2020)
Thomas Berger (2021)
Silvia Budday (2021)
Matti Schneider (2022)
Ruming Zhang (2023)
Patrik Knopf (2024)
Marco Salvalaglio (2024)
See also
List of mathematics awards
References
Academic awards
Mathematics awards
Awards established in 1989 | Richard von Mises Prize | [
"Technology"
] | 516 | [
"Science and technology awards",
"Science award stubs",
"Mathematics awards"
] |
56,348,283 | https://en.wikipedia.org/wiki/Liquid%20entry%20pressure | The liquid entry pressure (LEP) of a hydrophobic membrane is the pressure that must be applied to a dry membrane so that the liquid penetrates inside the membrane. LEP with the application in membrane distillation or pervaporation can be calculated as a first parameter to indicate how wettable a membrane is toward different liquid solutions.
LEP depends on many parameters, including the membrane maximum pore size, the surface tension of the liquid, the contact angle of the liquid on the membrane surface, and the geometrical structure of the membrane.
In the simplest form based on the Young–Laplace equation, the LEP is specified as:
where is a pore geometry coefficient ( = 1 for cylindrical pores and 0 < < 1 for non-cylindrical pores), is the liquid surface tension, is the contact angle measured on the liquid side, where the liquid-vapor interface meets the membrane surface, and is the maximum pore size of the membrane.
Membranes with small pore size, narrow pore size distribution, ideal cylindrical pore geometry, low surface energy, high contact angle, and high roughness typically show higher LEP. Rezaei et al. have shown that the presence of a secondary phase such as air on the surface of membrane can markedly increase the LEP of the membrane, especially for less hydrophobic materials.
As wetting is generally undesirable and represents a failure of the membrane process, design and research focus around avoiding its occurrence (e.g. through operating conditions), or reversing wetting after it has occurred (e.g. through backwashing or drying out the membrane). Surface coatings are a key way to improve LEP: these ideally are uniform, cause very high contact angles, and avoid pore clogging.
References
Membrane technology | Liquid entry pressure | [
"Chemistry"
] | 370 | [
"Membrane technology",
"Separation processes"
] |
56,349,233 | https://en.wikipedia.org/wiki/ALTIUS | ALTIUS (Atmospheric Limb Tracker for Investigation of the Upcoming Stratosphere) is a satellite mission proposed by the Belgian Institute for Space Aeronomy and currently under development by the European Space Agency. Its main objective is to monitor the distribution and evolution of stratospheric ozone in the Earth's atmosphere. The industrial consortium is led by QinetiQ Space, acting as mission prime. The satellite design is based on the PROBA small satellite bus. The payload, developed by OIP Sensor Systems, is an innovative UV, visible and NIR instrument.
The mission is scheduled for launch in 2026 from the Guiana Space Centre.
See also
List of European Space Agency programs and missions
PROBA
External links
References
Earth observation satellites of the European Space Agency
Proposed satellites
2026 in spaceflight | ALTIUS | [
"Astronomy"
] | 160 | [
"Astronomy stubs",
"Spacecraft stubs"
] |
56,349,373 | https://en.wikipedia.org/wiki/Markov%20theorem | In mathematics the Markov theorem gives necessary and sufficient conditions for two braids to have closures that are equivalent knots or links. The conditions are stated in terms of the group structures on braids.
Braids are algebraic objects described by diagrams; the relation to topology is given by Alexander's theorem which states that every knot or link in three-dimensional Euclidean space is the closure of a braid. The Markov theorem, proved by Russian mathematician Andrei Andreevich Markov Jr. describes the elementary moves generating the equivalence relation on braids given by the equivalence of their closures.
More precisely Markov's theorem can be stated as follows: given two braids represented by elements in the braid groups , their closures are equivalent links if and only if can be obtained from applying to a sequence of the following operations:
conjugating in ;
replacing by (here are the standard generators of the braid groups; geometrically this amounts to adding a strand to the right of the braid diagram and twisting it once with the (previously) last strand);
the inverse of the previous operation (if with replace with ).
References
Theorems in algebraic topology
Theorems in graph theory
Braids | Markov theorem | [
"Mathematics"
] | 238 | [
"Theorems in graph theory",
"Theorems in discrete mathematics",
"Theorems in algebraic topology",
"Theorems in topology"
] |
56,349,541 | https://en.wikipedia.org/wiki/Refining%20%28glass%29 | Refining is the removal of bubbles from the molten glass. Alternatively the term "Fining" is used, in this case, "refining" refers to the chemical processes only.
Refining is supported by high temperature and stirring, as well as chemical reactions caused by refining agents. Refining agents increase the volume of bubbles and “seeds” (small bubbles), facilitating their ascension. For the most common types of glass production sulfate raw materials are used, in particular, NaSO, decomposing into SO and O.
Glass types that melt at comparatively high temperature, such as borosilicate glasses, use chlorides, such as NaCl, having a sufficiently high vapour pressure at refining temperatures. Alkali-free glasses with high melting temperature, such as LC display glasses, use tin oxide, SnO.
In the following cooling process gases from bubbles are reabsorbed in the melt. Redox agents such as SbO may release or absorb oxygen depending on temperature and composition. Apart from chemical refining, bubbling, i.e. direct blowing of gas into the melt is used. Less common are methods like ultrasonic refining or low-pressure refining.
References
Glass production | Refining (glass) | [
"Materials_science",
"Engineering"
] | 237 | [
"Glass engineering and science",
"Glass production"
] |
56,350,120 | https://en.wikipedia.org/wiki/Build-on-demand | Build-on-demand or manufacturing on demand (MOD) refers to a manufacturing process where goods are produced only when or as they are required. This allows scalability and adjustable assemblies depending on the current needs of the part requestor or client.
Manufacturing on demand has the potential to markedly affect the manufacturing industry by shortening lead times and reducing costs. Manufacturing previously relied on Request for quotes (RfQs) that were not digitally obtainable.
Examples
Audio and video discs Recordable discs with audio and/or video content can be published from companies to customers via manufacture on demand. This differs from traditional releases as the discs are only produced on demand, rather than being stored in a warehouse, eliminating inventory. Many companies have taken advantage of this new process, including Warner Bros. (Warner Archive Collection), Smithsonian Folkways (Custom CDs), and Sony.
See also
On-demand (disambiguation)
Just-in-time manufacturing
Print on demand
References
Production planning
Manufacturing | Build-on-demand | [
"Engineering"
] | 199 | [
"Manufacturing",
"Mechanical engineering"
] |
56,350,257 | https://en.wikipedia.org/wiki/Enzyme%20repressor | An enzyme repressor is a substance that negatively regulates the amount of an enzyme by decreasing the rate of its biosynthesis. It is the opposite of an enzyme inducer.
See also
Enzyme activator
Enzyme inhibitor
Regulation of gene expression
References
Medicinal chemistry
Enzymes
Metabolism | Enzyme repressor | [
"Chemistry",
"Biology"
] | 56 | [
"Medicinal chemistry stubs",
"Biochemistry stubs",
"Cellular processes",
"nan",
"Medicinal chemistry",
"Biochemistry",
"Metabolism"
] |
56,350,739 | https://en.wikipedia.org/wiki/HD%20168009 | HD 168009 is a star in the northern constellation of Lyra. It has an apparent visual magnitude of 6.3, placing it just above to below the normal limit of stars visible to the naked eye under good viewing conditions of 6-6.5. An annual parallax shift of provides a distance estimate of 76 light years. It is moving closer to the Sun with a heliocentric radial velocity of −65 km/s. In about 328,000 years from now, the star will make its closest approach at a distance of around .
This is a solar analog, which means its measured properties are similar to those of the Sun. However, it is much older than the Sun with an estimated age of around 8.1 billion years. The spectrum matches a stellar classification of G1 V, indicating this is an ordinary G-type main-sequence star that is generating energy through hydrogen fusion at its core. The level of chromospheric activity is low, making it a candidate for a Maunder minimum event.
HD 168009 has about the same mass as the Sun, but is 14% larger in radius. It has a similar metallicity to the Sun – what astronomers term the abundance of elements other than hydrogen and helium – and is spinning with a rotation period of six days. The star is radiating 1.43 times the Sun's luminosity from its photosphere at an effective temperature of 5,792 K. It has been examined for an infrared excess that may indicate the presence of a circumstellar disk of dust, but no statistically significant excess was detected.
Planetary system
In 2020, a candidate exoplanet was detected orbiting this star. With a minimum mass of 0.03 (9.5 ) and an orbital period of 15 days, this would most likely be a hot mini-Neptune. The planet existence was confirmed in 2021.
References
G-type main-sequence stars
Solar analogs
Maunder Minimum
Planetary systems with one confirmed planet
Lyra
BD+45 2684
9622
168009
089474
6847
J18153245+4512333 | HD 168009 | [
"Astronomy"
] | 435 | [
"Maunder Minimum",
"Magnetism in astronomy",
"Lyra",
"Constellations"
] |
56,351,395 | https://en.wikipedia.org/wiki/Regulation%20of%20pesticides%20in%20the%20European%20Union | A pesticide, also called Plant Protection Product (PPP), which is a term used in regulatory documents, consists of several different components. The active ingredient in a pesticide is called “active substance” and these active substances either consist of chemicals or micro-organisms. The aims of these active substances are to specifically take action against organisms that are harmful to plants (Art. 2(2), Regulation (EC) No 1107/2009). In other words, active substances are the active components against pests and plant diseases.
In the Regulation (EC) No 1107/2009, a pesticide is defined based on how it is used. Thus, pesticides have to fulfill certain criteria in order to be called pesticides. Among others, the criteria include that they either protect plants against harmful organisms - by killing or in other ways preventing the organism from performing harm, that they enhance the natural ability of plants to defend themselves against these harmful organisms, or that they kill off competing plants such as weeds.
Within the European Union a 2-tiered approach is used for the approval and authorisation of pesticides. Firstly, before an actual pesticide can be developed and put on the European market, the active substance of the pesticide needs to be approved for the European Union. Only after approval of an active substance, a procedure of approval of the Plant Protection Product (PPP) can begin in the individual Member States. In case of approval, there is a monitoring programme to make sure the pesticide residues in food are below the limits set by the European Food Safety Authority (EFSA).
The use of PPPs (i.e. pesticides) in the European Union (EU) is regulated by the Regulation No 1107/2009 on Plant Protection Products in cooperation with other EU Regulations and Directives (e.g. the regulation on maximum residue levels in food (MRL); Regulation (EC) No 396/2005, and the Directive on sustainable use of pesticides; Directive 2009/128/EC).
These regulatory documents are set to ensure safe use of pesticides in the EU regarding human health and environmental sustainability. The responsible authorities within the EU working with pesticide regulation are the European Commission, European Food Safety Authority (EFSA), European Chemical Agency (ECHA); working in cooperation with the EU Member States. Additionally, important stakeholders are the chemical producing companies, which develop PPPs and active substances that are to be evaluated by the regulatory authorities mentioned above.
Conservative Agriculture Spokesman Anthea McIntyre MEP and colleague Daniel Dalton MEP were appointed to the European Parliament's special committee on pesticides on 16 March 2018. Sitting for nine months, the committee will examine the scientific evaluation of glyphosate, the world's most commonly used weed killer which was relicensed for five years by the EU in December after months of uncertainty. They will also consider wider issues around the authorisation of pesticides.
Procedure of active substance approval
In the EU, there is a detailed procedure (Regulation (EC) No 1107/2009) to evaluate whether an active substance is regarded as safe for human health and the environment. The procedure of approving new substances follows the steps listed below.
Submission of the application and dossier
The first step requires that an applicant (a company or association of producers) should submit a dossier to a Member State (called the Rapporteur Member State) in order to ask for the permission before putting an active substance on the market. The application must contain supporting scientific data and studies (i.e. toxicological and ecotoxicological relevance of metabolites, acceptable operator exposure level (AOEL), acceptable daily intake (ADI), genotoxicity testing etc. (Art. 4 and Annex II of Regulation (EC) No 1107/2009.) and Regulation (EC) No 283/2013)
Evaluation by the rapporteur member state
The Rapporteur Member State evaluates the application and shall within 45 days communicate (Art. 9(1) Regulation (EC) No 1107/2009) to the applicant that submitted the dossier. Furthermore, they will check whether the dossier is complete. If elements are missing, the applicant has 3 months to complete the dossier, otherwise the application is not considered admissible.
If the dossier is considered admissible, the Rapporteur Member State will notify the applicant and the competent authorities (other Member States, EFSA and the European Commission) and start evaluating the active substance. The applicant will then send the dossier to the three mentioned authorities. Moreover, EFSA will create a summary of the dossier and make it available for the public.
Draft Assessment Report from Rapporteur Member State
Within 12 months after the notification of admissibility, the Rapporteur Member State produces a Draft Assessment Report. This report aims to check if the active substance satisfies the criteria for approval listed in the Regulation. This report is submitted to the European Commission and EFSA. If additional information is needed, the Rapporteur Member State will set a period of maximum 6 months for the submission of the revised application. In addition, the European Commission and EFSA shall be informed (Art. 11 Regulation (EC) No 1107/2009).
Peer review by European Food Safety Authority and conclusion
European Food Safety Authority’s Pesticides Unit is responsible for the peer reviewing of the risk assessments on active substances. The EFSA is required to provide a conclusion on whether the active substance satisfies the criteria for approval.
When the Draft Assessment Report from the Rapporteur Member State has been received by EFSA, the report will be shared among other Member States and the applicant within 30 days after it has been received, and it shall be made available for the public (Art. 12 Regulation (EC) No 1107/2009).
The applicant, the Member State and the public have 60 days to provide comments. After that, EFSA has 120 days to submit a conclusion and forward it to the applicant, the Member States, and the European Commission. The EFSA will also make the conclusion available to the public (Art. 12 Regulation (EC) No 1107/2009).
After the conclusion of EFSA, the European Commission presents a review report to the Standing Committee for Food Chain and Animal Health. This standing committee votes on approval or non-approval of the active substance.
Publication
Based on the review report, a Regulation will be adopted according to the final decision (i.e. whether the substance is approved, not approved, or the application should be modified).
All approved active substances are included in the Official Journal of the European Union, which contains the list of active substances that have been already approved (Annex I of Directive 98/8/EC). The European Commission has subsequently the task of managing and updating the list of approved active substances, which is available online for the public.
Renewing the approval of active substances
Active substances may be approved for a maximum of up to 15 years. This approval period is proportional to the risks posed by the use of these substances.
However, when an active substance is considered necessary by the European Commission, it could be approved for a maximum 5 years, even if not all approval criteria of the Regulation (EC) No 1107/2009 are met.
At the renewal time, new knowledge regarding the active substance will be taken into consideration.
Procedure of Plant Protection Product approval
The procedure of applying for an authorisation of a PPP begins with the applicant who wishes to produce a PPP. Authorisation for the product must be sought from every Member State that the applicant wants to sell the product to.
The procedure and requirements for authorising a PPP are explained below.
Requirements and content
The authorisation of a PPP, its use and placing on the market is done by the Member States. For that, a PPP has to meet specific requirements:
Scientific and technical knowledge of its active substances, synergists, safeners, co-formulants.
Scientific knowledge regarding toxicological, ecotoxicological and environmental aspects. For instance, the ecotoxicological data required consist of, among others, acute toxicity to fish, aquatic invertebrates or effects on aquatic algae and macrophytes. It also includes studies on earthworms and other terrestrial species (Art. 29(1) and (2) of Regulation (EC) No 1107/2009 and Regulation (EC) No 284/2013).
Technical knowledge, including production, use, storage and residue handling.
Moreover, in the authorisation it is necessary to define elements in which the PPP may be used. This includes, among others, non-agricultural areas, plant products or plants, and their purpose. Other information that can be included, cover the maximum dosage per hectare in each individual application, the period of time between the most recent application and harvest, and the maximum application numbers each year.
The authorisation of a PPP shall not exceed one year, counting from the expire date of the approval for the active substances, synergists and safeners contained in the PPP. Re-evaluation of similar PPP for comparative assessment containing candidates for substitution may be granted.
The authorisation procedure of a Plant Protection Product (Pesticides)
The application for authorisation itself contains many parts and it should first and foremost clearly state where and how the PPP should be applied. Secondly, the applicants themselves should specify which Member State they wish, would carry out the evaluation of the PPP. If the PPP previously has been evaluated in another Member State, a copy of the conclusions from that evaluation should be attached. Moreover, the application should be accompanied by several dossiers containing, among other things, ecotoxicological data (see section “Requirements and content” above). One dossier for the PPP itself, and one for each active ingredient in the PPP is required. The applicant should also provide a draft of the product label clearly showing the hazard labels necessary for the specific product. There are several other things an application should include. This is more thoroughly described in Art. 33-35 of Regulation (EC) No 1107/2009.
The Member State assessing the PPP needs to perform an objective evaluation and allow other Member States to express their opinions. The evaluation results in an authorisation or a rejection of the PPP. This assessment takes many things into consideration. Among others, the Member State specifically looks at all the ingredients in the PPP and assesses whether they are approved for this type of use or not. They further look at if the risks associated with the PPP are limited without compromising the function of the product. If a PPP is given authorisation, it often has certain restrictions regarding the distribution and use, like mentioned in the “Requirements and content” above, in order to protect human health and the environment. If the PPP is shown to pose an unacceptable risk to humans or nature, it is not authorised. No matter what the Member State decides on, they have to justify the outcome of the evaluation in a document and provide it to both the applicant seeking authorisation, and the European Commission (Art. 36-38 of Regulation (EC) No 1107/2009).
Mutual recognition
A company or organization in possession of a valid authorisation for a PPP can apply for mutual recognition and obtain the approval for such products with the same use(s) under similar agricultural conditions.
Requirements, contents and procedures for the recognition are stated in Articles 40-42 of Regulation (EU) 1107/2009.
Mutual Recognition can only be applied if there is an existing authorisation for the PPP in another Member State. Applications can be made through the Plant Protection Products Application Management System for products that have been authorised via the system.
Some parts of the application procedure are managed and handled outside of the Plant Protection Products Application Management System by manual or electronic processes in the Member States.
The Plant Protection Products Application Management System is an online tool, thought to enable industry users to create applications for PPPs and submit these to Member States for evaluation and authorisation. The objectives of the system are: help harmonising the formal requirements for application among Member States, facilitate mutual recognition of authorisations between Member States in order to speed up time to market, improve the management of the evaluation of the authorisation process as wells as providing correct information to stakeholders on time.
Renewal, withdrawal and amendment
After an active substance has been re-approved for use, all PPPs containing this active substance also have to be re-approved within three months. If the applicants do not hand in a re-application, their authorisation for the product will expire in accordance to Art. 32. If expired, the PPP is allowed to stay on the market for sale up to six months, and allowed to be stored and disposed up to a year. To re-apply for authorisation the applicant has to provide a Renewal Assessment Report which shall contain any newly submitted data supporting the re-approval, as well as the original data if still relevant. The Member States also conduct this evaluation, but in the future this will be done through the Plant Protection Products Application Management Systems. Any holder of authorisation can choose to withdraw or amend its application at any time, though the reason why should be stated. If there are acute concerns for human, animal and/or environmental health the PPPs should be immediately withdrawn from the market. A withdrawal can also be made on the base of false and misleading informations, and/or on improvements in scientific and technological knowledge. All information about renewal, amendment and withdrawal can be found in Art. 43 - 46 of Regulation 1107/2009.
Special cases
When all active substances in a product are considered as low-risk active substances, a PPP will be approved as a low-risk PPP, except risk mitigation measures are required. The applicant of a PPP must demonstrate that all criteria for a low-risk PPP are met (Art. 47 of Regulation (EC) No 1107/2009). Among others, the criteria for consideration of low-risk active substances include not being classified as mutagenic, carcinogenic, toxic to reproduction, very toxic or toxic. Furthermore, they must not be persistent, deemed as endocrine disruptor or have neurotoxic or immunotoxic properties (Art. 47 and Annex II of Regulation (EC) No 1107/2009).
Applicants are encouraged to make use of this special case through a prolonged approval duration of 15 years and the possibility of a fast-track authorisation in 120 days instead of one year to facilitate the placement on the market of such PPPs.
Plant Protection Products comprising a genetically modified organism will also be examined in accordance to Directive 2001/18/EC on the deliberate release of genetically modified organisms into the environment. An authorisation will only be granted, when a written consent referring to this Directive is approved (Art. 48 of Regulation (EC) No 1107/2009).
The use and placing on the market of PPP-treated seeds is regulated through Art. 49 of Regulation (EC) No 1107/2009 and will not be prohibited, when authorisation is granted by at least one other Member State. But, when there is substantial concern that PPPs from treated seeds pose a serious risk to animals, humans or the environment, and no adequate mitigation measures are available, measures will be taken immediately, that is restricting or prohibiting the use of the respective PPP.
For PPPs containing candidates for substitution, a comparative assessment will be conducted. An authorisation will not be granted where the assessment of risks and benefits concludes that – among others – a substitution of the PPP is significantly safer for the environment, humans and animals, and not economically or practically disadvantageous (Art. 50 of Regulation (EC) No 1107/2009).
An applicant may ask for an extension to minor uses of PPPs (Art. 51 of Regulation (EC) No 1107/2009). This procedure is a facilitated way for the authorisation of a PPP. Lists on what minor uses in a specific Member State are provided by the European Minor Uses Database (EUMUDA).
A PPP already approved in one Member State will be permitted for parallel trade, thus the introduction, placement on the market, and uses in another Member State. Following Art. 52 of Regulation (EC) No 1107/2009, the application will be authorised - provided the applicant demonstrates that the PPP meets the requirements to be identical to the already authorised one.
Derogation
By partial suppression of Article 28, which states that a PPP will not be marketed or used in a Member State without authorisation, derogation states that such a PPP can be used under limited and controlled conditions where it appears necessary. A Member State authorising such a product will inform other Member States with detailed information that led to such a decision. It may be for purposes of research and development (Art. 53, 54 Regulation (EC) No 1107/2009).
Use and information
To ensure that PPPs are handled properly, a considerable amount of information is to be provided by the holder of an authorisation for such a product (Art. 56 Regulation (EC) No 1107/2009). New information on potential harmful effects on human or animal health concerning the PPP itself, its active substances, any associated metabolites, safeners or co-formulants have to be reported immediately to the Member State(s) that granted its authorisation. In such a case, it is up to the first Member State in a zone that granted the product's authorisation to evaluate and assess this information and come to a decision whether the product should be withdrawn or its conditions for use should be amended. The same Member State is also responsible for communicating this information to other Member States that might be concerned.
Information on PPPs authorised for use or that have been withdrawn shall also be available to the public in electronic form and updated every three months. This information shall at the very least include the business name of the holder of the product's authorisation, the trade name of the product, its type of preparation, its composition, its authorised uses (including minor uses) and its safety classifications. As well as this, information on withdrawal of a product's authorisation should be provided to the public if it is related to safety concerns.
Monitoring of Plant Protection Products
Monitoring of pesticide residues in food products
In order to protect human health and the environment, monitoring of PPP residues in food is a crucial step. With this process the EU can check the prediction of the safe use of respective PPPs.
In September 2008, the European Union issued new and revised Maximum Residue Limits (MRLs) in plants for the roughly 1,100 pesticides ever used in the world. The revision was intended to simplify the previous system, under which certain pesticide residues were regulated by the Commission, others were regulated by Member States, and others were not regulated at all.
How Maximum Residue Levels are monitored
The monitoring of the determined Maximum Residue Levels (MRLs) of pesticides in food is the duty of the responsible authorities of the Member States. In addition to the national monitoring programmes, all reporting countries are requested to monitor and analyse food products and processed cereal-based baby food according to the Regulation ((EU) No 400/2014) for the European monitoring programme.
Annually, the EFSA is modelling and assessing the risk of residues of pesticides in food. In this process, short-term (acute) exposure and long-term (chronic) exposure scenarios are analysed.
A risk assessment based on a short-term exposure includes mainly the comparison of the estimated uptake and/or exposure of pesticide residues via food in a short time period (one meal or within 24-hours). The chronic risk assessment is the estimated uptake and/or exposure levels of pesticide residues via food for a long-term period (predicted lifetime of a human). The evaluated data from the calculation models are compared to the experimental data (ecotoxicological reference data) for acute and chronic toxicity, to establish a safe level for human health. There is not a high probability of health risk for consumers if the modelled values are equal or lower than the reference data. The modelling starts with a conservative approach (e.g. consumers do not wash and/or cook the products) which may result in an overestimation of the actual toxicity of the respective pesticide.
Results of recent (2015) Maximum Residue Level monitoring
Recent results of the European monitoring programme were presented by EFSA (The 2015 European Union report on pesticide residues in food). The data was collected from the responsible authorities of the Member States and subsequently assessed and analysed by EFSA.
When looking at the pesticide residue levels, EFSA compared the analysed samples with the maximum residue level values previously established by the European Commission. The samples were taken from 11 different food products (aubergines, bananas, broccoli, virgin olive oil, orange juice, peas without pods, sweet peppers, table grapes, wheat, butter, and eggs).
The samples were collected from food products, produced both within and outside the EU, and pesticides that were analysed included compounds that are banned in the EU (e.g. Dichlorvos).
In 97.2% of the samples, there were residue levels below the determined Maximum Residue Limit. No detectable residues were found in 53.3% of the samples, while 43.9% contained residues but did not exceed the MRL, and 2.8% contained residues that exceeded the MRL. The countries reporting data to EFSA analysed a total of 84,341 samples for 774 different pesticides, with variety between countries and test-sites.
EFSA concluded that there was a negligible risk for short term (acute) exposure of pesticide residues in food, and overall a low risk for human health consequences.
The long term (chronic) exposure assessment showed that the estimated exposure did not exceed the acceptable daily intake values (ADI) for any of the tested pesticides except for dichlorvos, which is not allowed to be used as a pesticide in the EU.
Monitoring of pesticides in the environment
The concentrations of pesticides alongside other chemical substances that pose a significant risk to the environment or to human health in surface waters in the European Union are limited to Environmental Quality Standards. These are defined in the Directive on Environmental Quality Standards in the Field of Water Policy. This Directive covers a total of 45 priority substances as defined by the Water Framework Directive and 8 additional pollutants. Environmental Quality Standards set limits to the average annual concentration as well as the maximum allowable concentrations for short-term exposure and differentiates inland surface waters (rivers and lakes) and other surface waters (transitional, coastal, and territorial waters). It is the responsibility of the Member States to establish monitoring programmes for Environmental Quality Standards and to incorporate these into river basin management plans.
The Directive on Environmental Quality Standards was amended by Directive 2013/39/EU to establish a watch list of substances for monitoring and future prioritisation containing up to 10 substances, which include three pharmaceutical substances (Diclofenac, 17-beta-Estradiol (E2) and 17-alpha-Ethinylestradiol (EE2)).
Pesticides included in Directive on Environmental Quality Standards are to a large extent banned and not used in Europe. Reported data are sparse due to the geographic extent and the large quantity of different chemical substances used as pesticides in agriculture. However, there is a variety of pesticide monitoring programmes within the European Union, independently of EU regulatory frameworks. A 2014 review of organic chemicals (including pesticides) in surface waters in Europe concluded that there was concern for acute lethal effects in 14% and for chronic long-term effects in 42% of the 4,000 monitoring sites.
References
Further reading
SAPEA. (2018) Improving Authorisation Processes for Plant Protection Products in Europe: A scientific perspective on the assessment of potential risks to human health. doi:10.26356/plantprotectionproducts
Big sales, no carrots: Assessment of pesticide policy in Spain. Pablo Alonso González, Eva Parga-Dans & Octavio Pérez Luzardo. Crop Protection, 105428. https://doi.org/10.1016/j.cropro.2020.105428
European Union and the environment
Pesticides by region
European Union regulations
Pesticide regulation | Regulation of pesticides in the European Union | [
"Chemistry"
] | 5,030 | [
"Regulation of chemicals",
"Pesticide regulation"
] |
52,041,171 | https://en.wikipedia.org/wiki/Balanced%20heave%20compensation | Balanced heave compensation (BHC) is a heave compensation technology engaging the principle of a balanced-arm lamp for offshore motion compensation.
Working principle
The technical working principle can be summarized as converting the non-linear force of a gas spring or hydro-pneumatic spring into an adjustable, substantially linear force, by several mechanical measures. The technology comprises a series of patented inventions by NHLO licensed to and marketed by Seaqualize.
An active balanced heave compensation (ABHC) system adds an active component to a BHC for even further stabilisation of the mass.
Research project
In cooperation with IHC and research partners MARIN and ECN, a scale model of a first device comprising the technology, an offshore access bridge has been tested. Seaqualize is currently working on a full-scale prototype of the access bridge. The project has been subsidized by the Dutch Ministry of Economic Affairs as a renewable energy project. The research project indicates balanced heave compensation enables a range of potential benefits compared to currently available solutions. This may lead to improvements and cost savings in (engaging) heave compensation systems.
Comparison to traditional heave compensation systems
Balanced heave compensation (BHC) differs from traditional (spring-based) passive heave compensation (PHC) and active heave compensation (AHC) in several ways.
In traditional spring based heave compensation systems, the movement of the mass is parallel to the movement of the spring cylinder. A passive heave compensation system is in effect a mass spring system: it stabilizes a certain mass in a single position of the spring, in that position only the spring and the mass are balanced. In other positions of the spring, the mass and the spring are not balanced and the mass will tend to start moving towards the stabilized position due to residual forces in the spring.
A mass spring system can be beneficial for heave compensation only in certain (preset) conditions: the spring, its excitation, the mass and the frequency of the excitation of the spring all need to be taken into account in order for a mass to be substantially stabilised in a moving environment. In other (unexpected) conditions, mass spring systems may experience unwanted effects such as load amplification: its mass may start to move viciously instead of being stabilised. An active heave compensation system adds an active component to a traditional passive heave compensation system in order to counteract these residual forces / in order to counteract load amplification, in effect minimising the movement of the load.
In BHC systems, the movement of the mass is not parallel to the movement of the spring, leading to significantly lower residual forces, and therefore lower requirements on the active components. In BHC systems, load amplification is unlikely to occur since the mass is substantially balanced in the whole range of movement of the spring. Residual forces are minimized and therefore unexpected conditions such as variations in the wave pattern have a negligible effect on the working principle. This leads to a better stabilisation of the mass compared to PHC systems.
References
Offshore engineering | Balanced heave compensation | [
"Engineering"
] | 629 | [
"Construction",
"Offshore engineering"
] |
52,041,413 | https://en.wikipedia.org/wiki/Federal%20Institute%20for%20Population%20Research | The Federal Institute for Population Research (German: Bundesinstitut für Bevölkerungsforschung), abbreviated BiB, is a research institute of the German federal government under the portfolio of the Federal Ministry of the Interior (German: Bundesministerium des Innern, BMI) and has the task of providing scientific advice to the federal government on issues relating to demography and demographic trends in fertility, nuptiality, mortality, ageing and migration as well as global issues.
Purpose and Tasks
The BiB was established on 12 February 1973 as a federal institution and belongs to the executive agencies of the Federal Ministry of the Interior. The establishment decree of the Federal Minister of the Interior of 12 February 1973 was supplemented by the decree of 28 July 1995, as well as by the new decree of 21 November 2007. It was called into being in the context of the immense fertility decline in Germany.
The three main areas of responsibility are:
Research: In addition to continuous observations of demographic trends, thematic priorities of the main research areas are family and fertility, migration and mobility as well as demographic change and ageing. As part of its basic research, the BiB also conducts its own data collections.
Policy advice: The research results of the BiB serve the basis for advice given to the Federal government and the Federal ministries. The institute provides information, interprets demographic trends and draws up expert scientific reports. In addition, it supports the Federal government in its international cooperation on population issues within the framework of the United Nations.
Information: Research findings are disseminated, among others, through a large number of own publications addressing different target groups.
Administration
The BiB has 70 employees on staff, including 56 researchers. The interdisciplinary team of researchers in the institute consists of sociologists, demographers, economists, geographers and other scientists.
The BiB is divided into three departments (research areas):
Family and Fertility
Migration and Mobility
Demographic Change and Longevity
The BiB is supported in its scientific research by a board of trustees composed of nine researchers and nine representatives of the government departments.
Since 1 October 2021, the institute is headed by Prof. Christa Katharina Spieß. Previously, Prof. Norbert F. Schneider was Director of the BiB (from 1 April 2009 to 30 September 2021).
Publications
In ten series of publications, the Federal Institute for Population Research (BiB) regularly publishes research results and current demographic facts for various target groups. The publications are aimed at science, politics and the general public. Most of the contents are openly accessible. The most important series are:
Comparative Population Studies (CPoS) is an international peer-reviewed journal on demography and population studies. It is available online and is open access.
Series on Population Studies (Beiträge zur Bevölkerungswissenschaft) are monographs or compilations that deal with demographic topics. The volumes appear one to three times per year.
BiB Working Paper includes preliminary or final reports of research projects, surveys and reviews, but also academic articles before submission to relevant journals.
BiB Data and Technical Reports contains data set descriptions and technical reports on population surveys carried out by the Federal Institute for Population Research.
Population Research Bulletin (Bevölkerungsforschung Aktuell) provides information about current population research issues and news from the BiB.
Furthermore, the BiB publishes brochures, policy briefs and other reports at irregular intervals.
Cooperation
The BiB has worked in several international research projects, including GGP, PPAS/DIALOG, FEMAGE, FFS and JobMob.
The BiB is cooperating with the European Association for Population Studies (EAPS) and has organised the European Population Conference (EPC), which is the largest European conference on population studies, in 2016. It is also a member of the Population Europe network.
External links
BiB Homepage
Comparative Population Studies (CPoS) – Peer-reviewed open access journal of the BiB
References
Demography
Federal Ministry of the Interior (Germany)
German federal agencies
Research institutes in Germany
Government agencies established in 1973
1973 establishments in West Germany
Research institutes established in 1973 | Federal Institute for Population Research | [
"Environmental_science"
] | 842 | [
"Demography",
"Environmental social science"
] |
52,041,427 | https://en.wikipedia.org/wiki/G%2APower | G*Power is a free-to use software used to calculate statistical power. The program offers the ability to calculate power for a wide variety of statistical tests including t-tests, F-tests, and chi-square-tests, among others. Additionally, the user must determine which of the many contexts this test is being used, such as a one-way ANOVA versus a multi-way ANOVA. In order to calculate power, the user must know four of five variables: either number of groups, number of observations, effect size, significance level (α), or power (1-β). G*Power has a built-in tool for determining effect size if it cannot be estimated from prior literature or is not easily calculable.
References
Further reading
Faul, F., Erdfelder, E., Lang, A., & Buchner, A. (2007). G*Power 3: A flexible statistical power analysis program for the social, behavioral, and biomedical sciences. Behavior Research Methods, 39(2), 175-191. doi:10.3758/bf03193146
Faul, F., Erdfelder, E., Buchner, A., & Lang, A. (2009). Statistical power analyses using G*Power 3.1: Tests for correlation and regression analyses. Behavior Research Methods, 41(4), 1149-1160. doi:10.3758/brm.41.4.1149
External links
G*Power homepage
Statistical software | G*Power | [
"Mathematics"
] | 321 | [
"Statistical software",
"Mathematical software"
] |
52,042,018 | https://en.wikipedia.org/wiki/Cellular%20Inhibitor%20of%20Apoptosis%20Protein%201 | cIAP1 (also named BIRC2) is the abbreviation for a human protein, cellular inhibitor of apoptosis protein-1. It belongs to the IAP family of proteins and therefore contains at least one BIR (baculoviral IAP repeat) domain.
cIAP1 is a multi-functional protein which can be found in the cytoplasm of cells and in the nucleus of tumor cells. Its function in this particular case is yet to be understood. However, it is well known that this protein has a big influence in the growth of diverse cancers. cIAP1 is involved in the development process of osteosarcoma and gastric cancer among others.
Location
The cellular localization of cIAP1 is diverse depending on the phase of the living cycle of the cell. In healthy cells the protein is usually found in the nucleus. This was experimentally determined by immunofluorescence microscopy and subcellular fractionations methods. However, when the cell is apoptotic nuclear export of cIAP1 is induced provoking an increase in the cytosolic concentration of the protein. When a cell is tumorous it does not cease to proliferate inhibiting the apoptosis, as a result, in cancerous cells cIAP1 is rarely located in the cytoplasm.
In case of dividing cells, cIAP1 is released into the cytosol early in mitosis, then reaccumulated in nucleus in late anaphase and in telophase. Nevertheless, there is a pool of cIAP1 associated to the midbody that acts as the exception to the regular rule.
Structure
The gene of cIAP1 resides on chromosome 11 and its protein has a quaternary structure. It has a unique protein chain, consequently, is an asymmetric monomer protein. Its tertiary structure is basically composed by alpha domain, formed almost exclusively from alpha helix. Its size is of 31,489 bases composed by 618 amino acids and has a molecular mass of 69900 Da. cIAP1 contains baculovirus IAP repeat domains that facilitate binding to caspases and other proteins. cIAP1 is recruited to TNF receptor complexes where they support cell survival through NF-κB activation while suppressing apoptosis by preventing caspase activation.
Function
cIAP1 is an inhibitor of apoptosis protein. It directly ubiquitinates RIP1 and induces constitutive RIP1 ubiquitination in cancer cells. Ubiquinated RIP1 associates with the prosurvival kinase TAK1. When this complex is deubiquinated apoptosis is induced.
The absence of cIAP1 means that RIP1 will remain nonubiquitinated. As a consequence RIP1 forms a cytosolic complex with the adaptor molecule FADD and caspase 8, which leads to cell death. When cIAP1 ubiquitinates RIP1 this molecule acts as a signal activating the canonical NF-κB signaling pathway. The activation of this pathway stops the noncanonical one and simultaneously the apoptosis.
cIAP1 is important for the activation of MAPK signaling. MAPKs are involved in directing cellular responses to a diverse array os stimuli, such as mitogens, osmotic stress, heat shock and proinflammatory cytokines regulating cell functions including proliferation, gene expression, differentiation, mitosis, cell survival or apoptosis.
cIAP1 is as well implicated in innate immunity. When NOD-like receptors are activated by bacterial peptidoglycans, they oligomerize and recruit cIAP1, cIAP2, TRAF2 and RIP2. This allows cIAP1 mediated ubiquitination of RIP2, which leads to an expression of proinflammatory genes.
Other activities of the cIAP1 have been reported by Yanfei Qi et al. It has got a critical role in controlling β-cell survival under endoplasmatic reticulum (ER) stress. Studies show that when the protein is exposed to palmitate the concentration of cIAP1 decreases and, as a result, the apoptosis is no longer inhibited resulting in the death of the cell. ER stress increases cIAP1 expression in cancer cells through the UPR pathway, that is why, the induction of cIAP1 is suggested to be important for cancerous cell survival under stress conditions.
Related diseases
Crohn's disease.
cIAP1 is responsible for NOD signalling. When this signalling is defective, Crohn's disease is triggered. The most general symptoms of the disease are diarrhea, rectal bleeding and abdominal cramps and pain among others.
Pancreatic, liver, lung and oseophageal cancer. cIAP1 overexpression is directly related to the proliferation of the previously mentioned types of cancer. Several courses of treatment are focused on the removal of the IAPs to induce cells cytotoxicity.
Hemorrhage and Vascular Regression. cIAP1 has an important role on the maintenance of endothelial cells and blood vessel homeostasis during the development of the vessels. Mutations on the gene that encodes cIAP1 are related to hemorrhage and vascular regression because of the defects it represents on the endothelial cell survival and the modification of apoptosis.
References
Cancer
Genes on human chromosome 11
Proteins | Cellular Inhibitor of Apoptosis Protein 1 | [
"Chemistry"
] | 1,115 | [
"Biomolecules by chemical classification",
"Proteins",
"Molecular biology"
] |
52,043,496 | https://en.wikipedia.org/wiki/Romanas%20Janu%C5%A1kevi%C4%8Dius | Romanas Januškevičius (sometimes transliterated from Russian as Romanas Yanushkevichius; born July 10, 1953) is a Lithuanian mathematician who worked in probability theory and characterization of probability distributions and its stability. He was a professor at the Lithuanian University of Educational Sciences, head of the Department of Mathematics, Informatics and Physics since 2001 until 2017.
Early life
Januškevičius was born in Vilnius on July 10, 1953. He graduated from one of Vilnius high schools in 1971 and entered Vilnius University, from which he graduated in 1976.
In 1976–1978 Januškevičius trained in Steklov Institute of Mathematics in Moscow, where under the guidance of Professor Vladimir Zolotarev wrote and in 1978 defended his thesis "Investigation of stability in some problems of characterization of distributions" and received the Candidate of Sciences degree. The main result of this thesis was the work of the author, which considered the stability for decompositions of probability distributions into components.
Work and research interests
Januškevičius received the Doctor of Science degree (habilitation) in 1993. His doctoral thesis "Stability for characterizations of distributions" was published as a monograph.
Characterization theorems in probability theory and mathematical statistics are such theorems that establish a connection between the type of the distribution of random variables or random vectors and certain general properties of functions in them. For example, the assumption that two linear (or non-linear) statistics are identically distributed (or independent, or have a constancy regression and so on) can be used to characterize various populations. Verification of conditions of this or that characterization theorem in practice is possible only with some error, i.e., only to a certain degree of accuracy. Such a situation is observed, for instance, in the cases where a sample of finite size is considered. That is why there arises the following natural question. Suppose that the conditions of the characterization theorem are fulfilled not exactly but only approximately. May we assert that the conclusion of the theorem is also fulfilled approximately? Questions of this kind give rise to a following problem: determine the degree of realizability of the conclusions of mathematical statements in the case of approximate validity of conditions.
In solving these problems, a special place is given to the convolution equation. Decisions of non-homogeneous convolution equations on the half and applications for building stability estimations in characterizations of probability distributions devoted one of the major works of the author. His investigation of stability of characterizations of probability distributions R. Januškevičius has completed in the book in 2014.
Januškevičius was a professor at the Vilnius Pedagogical University since 1997 until 2017. The main emphasis of his pedagogical activity is training of teachers of mathematics and informatics.
Januškevičius pays great attention to the field of spiritual enlightenment. What is man? What is the real purpose of short human life? What will happen after death? Is it all going to end after death? Or, on the contrary, everything just starts? Are there absolute laws of human existence? Where lies the boundary between right and wrong? Moreover, why is there so much injustice? For this problems is devoted the book of R. Januškevičius and O. Januškevičienė "Basics of ethics", which has stood 8 editions (1st edition – Vilnius, Open Society Fund-Lithuania, 8th edition – Pro-Press Publisher, Moscow, 2010). The book was translated into the Ukrainian language.
Awards
Patriarch Alexy II during his visit to Vilnius on 25–27 July 1997 personally awarded Januškevičius with the Order of Holy Prince Daniel of Moscow of III degree for the diligent work for the blessing of Orthodoxy in Lithuania in the affair of revival of spirituality.
References
External links
Between Mathematics and Theology. List of R. Januškevičius publications, available in eLABa (Lithuanian Academic e-library) and in Research Gate.
About Romanas Januškevičius in Lithuanian book "Kas yra kas 2015".
Personal blog of Romanas Januškevičius.
20th-century Lithuanian mathematicians
21st-century Lithuanian mathematicians
Number theorists
Scientists from Vilnius
Probability theorists
Living people
1953 births
Vilnius University alumni
Soviet mathematicians
Academic staff of the Lithuanian University of Educational Sciences | Romanas Januškevičius | [
"Mathematics"
] | 872 | [
"Number theorists",
"Number theory"
] |
52,043,957 | https://en.wikipedia.org/wiki/IK%20Tauri | IK Tauri or NML Tauri is a Mira variable star located about from the Sun in the zodiac constellation of Taurus.
Discovery
In 1965, Neugebauer, Martz, and Leighton, astronomers with the California Institute of Technology, reported the discovery of two extremely cool stars. At the time, the temperatures of these extremely red objects were estimated to be around 1,000 K.
In the absence of other designations, these were named after the initials of their discoverers as NML Cygni and NML Tauri. It was identified as a Mira variable in 1967. The name NML Tauri fell into disuse after the star received its variable star designation of IK Tauri.
Variability
IK Tauri varies approximately every 470 days between extreme visual magnitudes of 10.8 and 16.5. It was classified as a Mira variable soon after discovery on the basis of its spectrum showing strong hydrogen emission and its very large visual amplitude. During each cycle, the spectrum of the star also varies, consistently reaching M10 near minimum and only M6-M8 at maximum.
Properties
IK Tauri pulsates strongly every 470 days, being coolest and largest at minimum brightness. The bolometric luminosity varies less dramatically and is estimated to be . The temperature is calculated to be only 2,234 K, and the radius is calculated to be .
IK Tauri has strong maser emission from its extended atmosphere and circumstellar material. The circumstellar material is rich in dust, with alumina close to the star and silicates further out. The two types of dust form separate shells, one within twice the star's radius and one more than three times its radius. The densest region of dust is at 6-8 times IK Tauri's radius.
Although IK Tauri is far below naked eye visibility, even at maximum brightness, this is due to the low temperature and strong extinction at visual wavelengths. In the infrared, it is brighter than prominent stars such as Rigel (K-band magnitude +0.18) and comparable to Sirius (K-band magnitude −1.35).
Evolution
As a Mira variable, IK Tauri is an asymptotic giant branch (AGB) star, originally around . It has exhausted its core hydrogen and helium, is not massive enough to ignite its carbon-oxygen core, and is now alternately fusing in concentric hydrogen and helium shells. As the inert core grows and the hydrogen shell nears the surface, mass loss becomes very high, and the star becomes highly obscured visually, an infrared star. It will then quickly lose its entire atmosphere, creating a planetary nebula and leaving behind a white dwarf.
References
Mira variables
M-type giants
Taurus (constellation)
J03532886+1124216
IRAS catalogue objects
Emission-line stars
Tauri, IK | IK Tauri | [
"Astronomy"
] | 589 | [
"Taurus (constellation)",
"Constellations"
] |
52,044,083 | https://en.wikipedia.org/wiki/Cryoimmunotherapy | Cryoimmunotherapy, also referred to as cryoimmunology, is an oncological treatment for various cancers that combines cryoablation of tumor with immunotherapy treatment. In-vivo cryoablation of a tumor, alone, can induce an immunostimulatory, systemic anti-tumor response, resulting in a cancer vaccine—the abscopal effect. Thus, cryoablation of tumors is a way of achieving autologous, in-vivo tumor lysate vaccine and treat metastatic disease. However, cryoablation alone may produce an insufficient immune response, depending on various factors, such as high freeze rate. Combining cryotherapy with immunotherapy enhances the immunostimulating response and has synergistic effects for cancer treatment.
Although, cryoblation and immunotherapy has been used successfully in oncological clinical practice for over 100 years, and can treat metastatic disease with curative intent, it has been ignored in modern practice. Only recently has cryoimmunotherapy been resurrected to become the gold standard in cancer treatment of all stages of disease.
History
Immunological effects resulting from the cryoablation of tumors was first observed in the 1960s. Since the 1960s, Tanaka treated metastatic breast cancer patients with cryotherapy and reported cryoimmunological reaction resulting from cryotherapy. In the 1970s, systemic immunological response from local cryoablation of prostate cancer was also clinically observed. In the 1980s, Tanaka, of Japan, continued to advance the clinical practice of cryoimmunology with combination treatments including: cryochemotherapy and cryoimmunotherapy. In 1997, Russian scientists confirmed the efficacy of cryoimmunotherapy in inhibiting metastases in advanced cancer. In 2000s, China, following closely with the exciting developments, enthusiastically embraced cryoablation treatment for cancer and has been leading the practice ever since with cryoimmunotherapy treatments available for cancer patients in numerous hospitals and medical clinics throughout China. In the 2010s, American researchers and medical professionals, started to explore cryoimmunotherapy for systemic treatment of cancer.
Mechanisms of actions
Cryoablation of tumor induces necrosis of tumor cells. The immunotherapeutic effect of cryoablation of tumor is the result of the release of intracellular tumor antigens from within the necrotized tumor cells. The released tumor antigens help activate anti-tumor T cells, which destroy remaining malignant cells. Thus, cryoablation of tumor elicits a systemic anti-tumor immunologic response.
The resulting immunostimulation from cryoablation may not be sufficient to induce sustained, systemic regression of metastases, and can be synergised with the combination of immunotherapy treatment and vaccine adjuvants.
Various adjuvant immunotherapy and chemotherapy treatments can be combined with cryoablation to sustain systemic anti-tumor response with regression of metastases, including:
Injection of immunomodulating drugs (i.e.: therapeutic antibodies) and vaccine adjuvants (saponins) directly into the cryoablated, necrotized tumor lysate, immediately after cryoablation
Administration of autologous immune enhancement therapy, including: dendritic cell therapy, CIK cell therapy
See also
Combinatorial ablation and immunotherapy
Photoimmunotherapy
References
External links
The Great Prostate Hoax: How Big Medicine Hijacked...
Immunologic Response to Cryoablation of Breast Cancer
Modern Cryosurgery for Cancer
Percutaneous Cryotherapy of Renal Cell Carcinoma Under an Open MRI System
Modern Cryosurgery for Cancer
Tumor Ablation: Effects on Systemic and Local Anti-Tumor Immunity and on Other Tumor-Microenvironment Interactions
Basics of Cryosurgery
Cryosurgery: A Practical Manual
Dermatological Cryosurgery and Cryotherapy
The Abscopal Effect and the Prospect of Using Cancer Against Itself
Tumor Ablation: Principles and Practice
Cryoimmunologie: Cryoimmunology: colloque
Metastatic Bone Disease: An Integrated Approach to Patient Care
Musculoskeletal Cancer Surgery: Treatment of Sarcomas and Allied Diseases
Prospects for cryo-immunotherapy in cases of metastasizing carcinoma of the prostate .
Therapy
Cancer
Cryobiology | Cryoimmunotherapy | [
"Physics",
"Chemistry",
"Biology"
] | 929 | [
"Biochemistry",
"Physical phenomena",
"Phase transitions",
"Cryobiology"
] |
52,044,177 | https://en.wikipedia.org/wiki/KaTeX | KaTeX is a cross-browser JavaScript library that displays mathematical notation in web browsers. It puts special emphasis on being fast and easy to use.
It was initially developed by Khan Academy, and became one of the top five trending projects on GitHub in September 2014.
Features
KaTeX rendering of math claims to be:
Fast: It renders its math synchronously and doesn't need to reflow the page.
Print quality: Its layout is based on TeX.
Self contained: It has no dependencies, so it can be easily bundled.
Capable of server-side rendering: it has an option to generate HTML on the server (so, for example, one can pre-render expressions using Node.js and send them as plain HTML).
KaTeX implements a smaller subset of LaTeX's mathematical notation features than MathJax.
See also
MathML
References
External links
"KaTeX is a (partial) alternative to (some of) MathJax"
"KaTeX - a new way to display math on the Web"
KaTeX-MathJax comparison
Free mathematics software
JavaScript libraries | KaTeX | [
"Mathematics"
] | 230 | [
"Free mathematics software",
"Mathematical software"
] |
52,044,774 | https://en.wikipedia.org/wiki/Attitude-behavior%20consistency | Attitude-behaviour consistency is a central concept in social psychology that examines the relationship between individual’s attitudes and their behaviour. Although, people often act in ways inconsistent with their attitudes, and the relationship has been highly debated among researchers. Many argue that attitudes are not the only factors influencing behaviour; some people behave more in line with their attitudes than do others, and people’s behaviour aligns with their attitudes is some circumstances more than in others.
The consistency between attitudes and behaviours can be explained by moderating factors, which strengthen or weaken the relationship. Two of the main categories of moderators are attitude strength and situational factors.
Attitudes-Behaviour Models
An attitude is a psychological construct ranging from positive to negative that reflects an individual's evaluation of an object, person or issue. These evaluations are shaped by affects, behaviours, and cognition. Affects are emotional responses, behaviours are intentions or tendencies to act and cognition includes beliefs about the object that is being evaluated (attitude object). These components interact to create a coherent, though not always consistent, attitude toward an object. Even in this regard there is still variability as the impact of each component can vary from person to person. While some attitudes are more influenced by emotions others may be more impacted by behaviours and beliefs. A meta analysis conducted by Stephan Kraus in 1995 found that attitudes influence behaviours when attitudes are stable, more accessible, and there is direct experience with the attitude object. Attitudes are more likely to predict behaviours when the attitude is strong and accessible, the influence of social influences is minimal and the attitude aligns with the specific behavior. However when there are external pressures or conflicting priorities attitudes may fail to predict behaviours.
Theory of Planned Behaviour
The Theory of Planned Behaviour, developed by Martin Fishbein and Izek Ajzen, suggests that people act rationally and their behaviours are influenced by intentions. There are three key variables that jointly predict our intentions:
The attitude toward the behaviour
Subjective norms
Perceived behavioural control ( a person’s belief in their ability to perform a behavior)
The likelihood of the intention to perform the behaviour and the behaviour itself increases as the three factors become more favourable.
Consistency Theories
Balance Theory
Balance Theory was first developed by Heider with Gestalt influences. Gestalt psychology posits that there is a tendency towards perceptual simplicity, such as symmetry and continuation. Heider extends this principle to social relations, where there are balanced and imbalanced states. When applied to attitudes, it is defined in triadic relation between three elements: a Person (P), an Other person (O), and an Attitude Object (X). Attitude is the relation between two elements, defined as either positive or negative, resulting in 8 distinct triads. If the number of positive relations is odd, the triad is balanced; vice versa.
Congruity Theory
Proposed by Osgood and Tannebaum, the principle of congruity claims that attitude change always results in increased congruity for the individual. Compared to balance theory, congruity theory allows for gradations of relation between elements and introduces a formula to quantitatively predict attitude change. There are five variables in the formula: point of resolution for object (RO), point of resolution for source (RS), prior attitude toward object (AO), prior attitude toward source (AS), and direction of assertion (d; no gradation). The frame of reference is the individual; the source is the other communicator; and the assertion indicates the source's attitude.
Dissonance Theory
The Cognitive Dissonance Theory proposed by Leon Festinger, suggests that cognitive discomfort (dissonance) occurs when an individual’s behavior and beliefs do not align, as such they are motivated to resolve this inconsistency. When an attitude is not consistent with an individual’s behavior it can lead to an attitude or behaviour change to reduce dissonance. For example a person who smokes but believes smoking is harmful may experience dissonance and as result try to change their attitude to “smoking isn’t that harmful” or they can change their behaviour by quitting smoking
Factors Influencing Consistency
Recent research has shown that attitudes accurately predict behaviour only under certain conditions:
Contextual factors
When both the attitude and behaviour occur under similar social contexts/situations, contextual factors are likely involved. A person's attitude and behaviour both vary from situation to situation. A college freshman may disapprove of binge drinking, only to subsequently become socialized to practice and celebrate doing so in the course of tailgating.
Social desirability bias may also skew self-reported attitudes that affect prima-facie attitude-behaviour consistency. Studies making claims about behaviours based on reports when behaviours may be seen as desirable may be particularly sensitive to the attitudinal fallacy. Unfortunately, there is no consensus on which attitudes are socially desirable and attitudes may be situational hence vary from setting to setting.
Individual Factors
Low-self monitoring enhances attitude-consistent behaviour because individuals are less influenced by external social cues or expectations. Individuals who are low self-monitors, act in accordance with their own beliefs and attitudes without adapting to social pressures so their behaviors are more aligned with their attitudes.
High self monitoring may decrease attitude-consistent behaviour because more precedence is given to external pressures over internal beliefs. High self-monitors are more responsive to social contexts, and will often adjust their behaviour to conform to social expectations.
Attitude Accessibility
The Attitude Accessibility Theory, developed by Russell H. Fazio suggests that attitudes are more likely to guide behaviours when they are easily accessible in memory. This theory focuses on the strength of association between an attitude object and an individual’s evaluation of it. It is measured by an individual's reaction time to evaluate an attitude object where faster responses suggest higher accessibility. Determinants of accessibility include the frequency of activation and recency of activation.
The factor of attitude accessibility is important when the accessibility of underlying affective and cognitive components of attitudes are aligned. For instance, when an attitude is assessed in a context where people primarily focus on its cognitive aspects, but the behaviour occurs in a situation where the affective components of the attitude are more prominent, attitude-behaviour consistency will be weak.
Strong attitudes are more stable, accessible, and resistant to change, which is why they are more likely to predict consistent behaviour. Weak attitudes are more likely to be influenced by context, situational factors, and social pressures, thus leading to less consistent behavior. When attitudes are strong, they have a greater influence on behaviour; individuals are more motivated to behave in ways that align with their beliefs and feelings towards the attitude object, leading to a higher level of attitude-behavior consistency.
Applications in research
Attitude-behavior consistency is an important concept for social science research because claims are often made about behavior based on evidence which is really about attitudes. The attitudinal fallacy is committed when verbal data are used to support claims not about what people believe or say, but what they do. Data collection methods based on self-report like surveys, and interviews are vulnerable to the attitudinal fallacy if they attempt to measure behavior and if reported attitudes are inconsistent with the behavior.
Research methods that directly observe behaviors avoid the attitudinal fallacy as a matter of course. However many kinds of behavior are not easily observed, especially not in ways amenable to statistical reporting. Ethnography can make rich observations and descriptions of behavior and allow for comparison between behavior and attitude. Unfortunately, in general ethnographic data cannot be used to draw statistically generalizable conclusions about behavior in a population. Moreover, ethnographers can still commit the attitudinal fallacy if they rely on quotations as evidence for behaviors. Experiments in laboratories make it possible to observe behavior, although people's behavior in laboratory conditions may not reflect their behavior in real-world situations. Internet research makes it possible to study a wide array of behaviors that leave traces online. Data from the Internet of things and sensors that record behavior like from location tracking may make it possible to measure more kinds of behavior that avoids the attitudinal fallacy. Still, some kinds of behavior are difficult to study other than through interviews or surveys, and the knowledge produced in such cases may be still useful. The possibility of inconsistency between behavior and reported attitudes is always a concern.
Methods that are limited by their inability to measure behavior can still contribute to important understandings. These include how meaning is created, the significance of events to individuals, emotion, semiotics, representation and opinions.
Examples
In the 1930s Richard LaPiere asked 251 hotel proprietors if they would serve Chinese guests and only 1 said yes. However, when he followed around a young Chinese couple that visited the hotels they were only denied service once.
Americans on average report going to church twice as much as they actually do. But Europeans accurately self-report church attendance.
Although most employers in an audit study reported that they were willing to give job interviews to young male black ex-offenders, they were unlikely to provide interviews when presented with opportunities to interview men appearing to be so.
People in health studies where they are asked to report how much food they eat tend to report eating less than they actually do.
Observing bystander effect in a naturalistic setting results in behavior that is consistent as per the classic bystander effect. However, if the same effect were to be done with surveys, one will get a very different results.
References
Behavior
Psychological attitude
Psychological theories
Qualitative research
Social science methodology
Sociological theories
Survey methodology | Attitude-behavior consistency | [
"Biology"
] | 1,953 | [
"Behavior"
] |
52,044,791 | https://en.wikipedia.org/wiki/Edge%20tessellation | In geometry, an edge tessellation is a partition of the plane into non-overlapping polygons (a tessellation) with the property that the reflection of any of these polygons across any of its edges is another polygon in the tessellation.
All of the resulting polygons must be convex, and congruent to each other. There are eight possible edge tessellations in Euclidean geometry, but others exist in non-Euclidean geometry.
The eight Euclidean edge tessellations are:
In the first four of these, the tiles have no obtuse angles, and the degrees of the vertices are all even.
Because the degrees are even, the sides of the tiles form lines through the tiling, so each of these four tessellations can alternatively be viewed as an arrangement of lines. In the second four, each tile has at least one obtuse angle at which the degree is three, and the sides of tiles that meet at that angle do not extend to lines in the same way.
These tessellations were considered by 19th-century inventor David Brewster in the design of kaleidoscopes. A kaleidoscope whose mirrors are arranged in the shape of one of these tiles will produce the appearance of an edge tessellation. However, in the tessellations generated by kaleidoscopes, it does not work to have vertices of odd degree, because when the image within a single tile is asymmetric there would be no way to reflect that image consistently to all the copies of the tile around an odd-degree vertex. Therefore, Brewster considered only the edge tessellations with no obtuse angles, omitting the four that have obtuse angles and degree-three vertices.
See also
Reflection group
Citations
Tessellation | Edge tessellation | [
"Physics",
"Mathematics"
] | 365 | [
"Tessellation",
"Planes (geometry)",
"Euclidean plane geometry",
"Symmetry"
] |
52,045,745 | https://en.wikipedia.org/wiki/BASHLITE | BASHLITE (also known as Gafgyt, Lizkebab, PinkSlip, Qbot, Torlus and LizardStresser) is malware which infects Linux systems in order to launch distributed denial-of-service attacks (DDoS). Originally it was also known under the name Bashdoor, but this term now refers to the exploit method used by the malware. It has been used to launch attacks of up to 400 Gbps.
The original version in 2014 exploited a flaw in the bash shell - the Shellshock software bug - to exploit devices running BusyBox. A few months later a variant was detected that could also infect other vulnerable devices in the local network. In 2015 its source code was leaked, causing a proliferation of different variants, and by 2016 it was reported that one million devices have been infected.
Of the identifiable devices participating in these botnets in August 2016 almost 96 percent were IoT devices (of which 95 percent were cameras and DVRs), roughly 4 percent were home routers - and less than 1 percent were compromised Linux servers.
Design
BASHLITE is written in C, and designed to easily cross-compile to various computer architectures.
Exact capabilities differ between variants, but the most common features generate several different types of DDoS attacks: it can hold open TCP connections, send a random string of junk characters to a TCP or a UDP port, or repeatedly send TCP packets with specified flags. They may also have a mechanism to run arbitrary shell commands on the infected machine. There are no facilities for reflected or amplification attacks.
BASHLITE uses a client–server model for command and control. The protocol used for communication is essentially a lightweight version of Internet Relay Chat (IRC). Even though it supports multiple command and control servers, most variants only have a single command and control IP-address hardcoded.
It propagates via brute forcing, using a built-in dictionary of common usernames and passwords. The malware connects to random IP addresses and attempts to login, with successful logins reported back to the command and control server.
See also
Denial-of-service attack (DoS)
Fork bomb
Hajime (malware)
LOIC
High Orbit Ion Cannon – the replacement for LOIC used in DDoS attacks
Low Orbit Ion Cannon – a stress test tool that has been used for DDoS attacks
Mirai (malware)
ReDoS
Slowloris (computer security)
References
Denial-of-service attacks
Botnets
IoT malware
Linux malware | BASHLITE | [
"Technology"
] | 521 | [
"Denial-of-service attacks",
"Computer security exploits"
] |
52,046,282 | https://en.wikipedia.org/wiki/Stable%20salt%20reactor | The stable salt reactor (SSR) is a nuclear reactor design under development by Moltex Energy Canada Inc. and its subsidiary Moltex Energy USA LLC, based in Canada, the United States, and the United Kingdom, as well as MoltexFLEX Ltd., based in the United Kingdom.
The SSR design being developed by Moltex Energy Canada Inc. is the Stable Salt Reactor - Wasteburner (SSR-W), which incorporates elements of the molten salt reactor, and aims to have improved safety characteristics (intrinsically safe) and economics (LCOE of $45/MWh USD or less) over traditional light water reactors.
SSRs, which are protected by robust patents, are being designed so that they will not need expensive containment structures and components to mitigate radioactive releases in accident scenarios. The design would preclude the type of widespread radiological contamination that occurred in the Chernobyl or Fukushima accidents, because any hazardous isotopes that might otherwise become airborne would be chemically bound to the coolant. Additionally, the modular design would allow factory production of components and delivery to site by standard road transportation, reducing costs and construction timescales.
The fuel design is a hybrid between light water reactor fuel assemblies and traditional molten salt reactor approaches, in which the fuel is mixed with the coolant. The liquid salt fuel mixture is contained within fuel assemblies that are very similar to current light water reactor technology. The fuel assemblies are then submerged in a pool of liquid salt coolant.
Moltex Energy Canada Inc. plans to deploy the SSR-W and associated waste recycling facility in New Brunswick, Canada in partnership with NB Power. The company has support and funding from the Canadian federal government, the government of New Brunswick, NB Power, Ontario Power Generation, ARPA-E, IDOM, SNC Lavalin.
Technology
The basic unit of the reactor core is the fuel assembly. In the SSR-W, each assembly contains nearly 300 fuel tubes of 10 mm diameter, filled to a height of 1.8 m with fuel salt. The tubes have “diving bell” gas vents at the top to allow fission gases to escape. The assemblies are loaded vertically into the core, with fresh assemblies entering through an airlock and inserted into the core through a fuelling machine.
Fuel and materials
The fuel in the SSR is two-thirds sodium chloride (table salt) and one-third mixed lanthanide/actinide trichlorides. Fuel for the initial reactors is planned to come from converted spent nuclear fuel from existing conventional reactors. In the UK, the fuel could come from the stocks of civil plutonium dioxide from PUREX downblended and converted to chloride impurities added to reduce any proliferation concerns.
Trichlorides are more thermodynamically stable than the corresponding fluoride salts, and can therefore be maintained in a strongly reducing state by contact with sacrificial nuclear-grade zirconium metal added as a coating on, or an insert within, the fuel tube of the SSR-W. As a result, using this patented approach, the fuel tube can be made from standard nuclear certified steel without risk of corrosion. Since the reactor operates in the fast spectrum, the tubes will be exposed to very high neutron flux and so will suffer high levels of radiation damage estimated at 100–200 dpa over the tube life. The highly neutron damage tolerant steel, PE16 will therefore be used for the tubes. Other steels with fast-neutron tolerance (such as T9, NF616 and 15-15Ti) could also be used depending on the local supply chain capabilities.
The average power density in the SSR-W fuel salt is 150 kW/L, which allows a large temperature margin below the boiling point of the salt.
Coolants
The coolant salt in the SSR-W reactor tank is a chloride-based coolant salt. The coolant also contains an agent to reduce its redox potential, making it virtually non-corrosive to standard types of steel. The reactor tank, support structures and heat exchangers can therefore be built with standard 316L stainless steel.
The coolant salt is circulated through the reactor core by three pumps attached to the heat exchangers in each module. Flow rates are modest (approximately 1 m/s) with a resulting low requirement for pump power. Redundant engineering would allow operation to continue in the event of a pump failure.
Safety
SSRs are designed with intrinsic safety characteristics being the first line of defence. No operator or active system is required to maintain the reactor in a safe and stable state. The following are primary intrinsic safety features of the SSR.
Reactivity control
As the SSR is self-controlling, no mechanical control is required. This is made possible by the combination of a high negative temperature coefficient of reactivity and the ability to continually extract heat from the fuel tubes. As heat is taken out of the system the temperature drops, causing the reactivity to go up. Conversely, when the reactor heats up, reactivity decreases. This provides security against all overpower scenarios, such as a reactivity insertion accident. For the SSR-W, diverse and redundant safety is also provided by an array of gravitationally driven boron carbide control rods.
Non-volatile radioactive material
Use of molten salt fuel with the appropriate chemistry eliminates the hazardous volatile iodine and caesium, making multi-layered containment unnecessary to prevent airborne radioactive plumes in severe accident scenarios. For the SSR-W, the noble gases xenon and krypton would leave the reactor core in normal operation, but would be trapped until their radioactive isotopes decay, so there would be very little that could be released in an accident.
No high pressures
In a water-cooled reactor, high internal pressures provide a driving force for dispersion of radioactive materials in the event of an accident. In contrast, molten salt fuels and coolants have boiling points far above the SSR's operating temperature. So, its core runs at atmospheric pressure. Physical separation of the steam-generating system from the radioactive core, by means of a secondary coolant loop, eliminates high pressure within the reactor. High pressures within fuel tubes are also avoided by venting off fission gases into the surrounding coolant salt.
Low chemical reactivity
Zirconium in pressurized water reactors and sodium in fast reactors both create the potential for severe explosion and fire risks. No chemically reactive materials are used in the SSR.
Decay heat removal
Immediately after a nuclear reactor shuts down, almost 7% of its previous operating power continues to be generated, from the decay of short half-life fission products. In conventional reactors, removing this decay heat passively is challenging because of the reactors’ low temperatures. An SSR operates at much higher temperatures; so, this heat can be rapidly transferred away from the core. In the event of a reactor shutdown and failure of all active heat-removal systems in the SSR, decay heat from the core would dissipate into air-cooling ducts around the perimeter of the tank that operate continually. This is known as the Emergency Heat Removal System. The main heat-transfer mechanism is radiative. Heat transfer goes up substantially with temperature; so, it is negligible at operating temperatures but sufficient at higher-temperature accident conditions. The reactor components are not damaged during this process and the plant can be restarted afterwards.
Consumption of nuclear waste
Most countries that use nuclear power plan to store spent nuclear fuel deep underground until its radioactivity has reduced to levels similar to that of natural uranium. As the SSR-W consumes nuclear waste, the countries could use them to reduce the volume of waste that ends up in long-term storage.
Operating in the fast spectrum, the SSR-W is effective at transmuting long-lived actinides into more stable isotopes. Today’s reactors that are fuelled by reprocessed spent fuel need very high-purity plutonium to form a stable pellet. The SSR-W can have any level of lanthanide and actinide contamination in its fuel, so long as it can still go critical. This low level of purity greatly simplifies the recycling method for existing waste.
The well established recycling method is based on pyroprocessing. A 2016 report by the Canadian Nuclear Laboratories on recycling of CANDU fuel estimates that pyroprocessing would cost about half as much as more conventional reprocessing. Pyroprocessing for the SSR-W uses only one third of the steps of conventional pyroprocessing, which will make it even cheaper. It is potentially competitive with the cost of manufacturing fresh fuel from mined uranium.
Waste from the SSR-W will take the form of solid salt in tubes. This can be vitrified and stored underground for over 100,000 years, as is planned today, or it can be recycled. In that case, fission products would be separated out and safely stored at ground level for the several hundred years needed for them to decay to radioactivity levels similar to that of uranium ore. The troublesome long-lived actinides and the remaining fuel would go back into the reactor, where they could be burned and transmuted into more-stable isotopes.
Other stable salt reactor designs
Stable salt reactor technology is highly flexible and can be adapted to several different reactor designs. The use of molten salt fuel in standard fuel assemblies allows stable salt versions of many of the large variety of nuclear reactors considered for development worldwide. The industry’s focus today however is to allow rapid development and roll out of low-cost reactors.
Another design now in development, by MoltexFLEX Ltd., is the FLEX reactor, a thermal spectrum SSR fuelled by low-enriched uranium (around 6%). The FLEX reactor may be more suited to nations without an existing nuclear fleet and concerns about waste. It is moderated with graphite as part of the fuel assembly and has significant peaking plant capabilities.
Moltex Energy Canada Inc., Moltex Energy USA LLC and MoltexFLEX Ltd. have also conceptualized a thorium breeding version of the SSR (SSR-Th). This reactor would contain thorium in the coolant salt, which could breed new fuel. Thorium is an abundant fuel source that can provide energy security to nations that do not have their own uranium reserves.
With this range of reactor options and the large global reserves of uranium and thorium available, SSRs could fuel the planet for several thousands of years.
Economics
The capital cost of the SSR-W was estimated at $1,950/kW USD by an independent UK nuclear engineering firm. For comparison, the capital cost of a modern pulverized coal power station in the United States is $3,250/kW and the cost of large-scale nuclear is $5,500/kW. Further reductions to this cost are expected for modular factory-based construction.
This low capital cost results in a levelised cost of electricity (LCOE) of $44.64/MWh USD with substantial potential for further reductions, because of the greater simplicity and intrinsic safety of the SSR.
Given the pre-commercial nature of the technology, the figures for capital cost and LCOE are estimates, and may increase or decrease during completion of the development and licensing processes.
The International Energy Agency predicts that nuclear power will maintain a constant small role in the global energy supply, with a market opportunity of 219 GWe up to 2040. With the improved economics of the SSR, Moltex Energy predicts that it has the potential to access a market of over 1,300 GWe by 2040.
Development
The fundamental patent on the use of unpumped molten salt fuel was granted to Moltex Energy Ltd in 2014, and further implementation-related patents have been applied for and granted since.
The SSR-W has completed Vendor Design Review Phase 1 review with the Canadian Nuclear Safety Commission. Both the US and Canadian governments are supporting development of elements of the SSR technology.
Moltex Energy Canada Inc. plans to build, by the early 2030s, a demonstration SSR-W at the Point Lepreau nuclear power plant site in Canada under an agreement signed with NB Power.
Recognition
As well as the selection for development support by the US and Canadian governments noted above, the SSR has been identified as a leading SMR technology by a 2020 Tractebel analysis, and the SSR-W was selected as one of two SMR candidates for further progression by NB Power, out of a field of 90 candidates. It was also selected as part of the UK government's Phase 1 Advanced Modular Reactor competition but was not selected for the Phase 2 part of the funding.
References
External links
Stable Salt Reactor Technology Introduction, YouTube video
Modular Stable Salt Reactors – a simpler way to use molten salt fuel – Ian Scott Moltex Energy
Nuclear power reactor types
Nuclear power
Molten salt reactors | Stable salt reactor | [
"Physics"
] | 2,628 | [
"Power (physics)",
"Physical quantities",
"Nuclear power"
] |
52,046,315 | https://en.wikipedia.org/wiki/Mirai%20%28malware%29 | Mirai (from the Japanese word for "future", 未来) is malware that turns networked devices running Linux into remotely controlled bots that can be used as part of a botnet in large-scale network attacks. It primarily targets online consumer devices such as IP cameras and home routers. The Mirai botnet was first found in August 2016 by MalwareMustDie, a white hat malware research group, and has been used in some of the largest and most disruptive distributed denial of service (DDoS) attacks, including an attack on 20 September 2016 on computer security journalist Brian Krebs' website, an attack on French web host OVH, and the October 2016 DDoS attacks on Dyn. According to a chat log between Anna-senpai (the malware's original author) and Robert Coelho, Mirai was named after the 2011 TV anime series Mirai Nikki.
The software was initially used by the creators to DDoS Minecraft servers and companies offering DDoS protection to Minecraft servers, with the authors using Mirai to operate a protection racket. The source code for Mirai was subsequently published on Hack Forums as open-source. Since the source code was published, the techniques have been adapted in other malware projects.
Malware
Devices infected by Mirai continuously scan the internet for the IP address of Internet of things (IoT) devices. Mirai includes a table of IP address ranges that it will not infect, including private networks and addresses allocated to the United States Postal Service and Department of Defense.
Mirai then identifies vulnerable IoT devices using a table of more than 60 common factory default usernames and passwords, and logs into them to infect them. Infected devices will continue to function normally, except for occasional sluggishness, and an increased use of bandwidth. A device remains infected until it is rebooted, which may involve simply turning the device off and after a short wait turning it back on. After a reboot, unless the login password is changed immediately, the device will be reinfected within minutes. Upon infection Mirai will identify any "competing" malware, remove it from memory, and block remote administration ports.
Victim IoT devices are identified by “first entering a rapid scanning phase where it asynchronously and “statelessly” sent TCP SYN probes to pseudo-random IPv4 addresses, excluding those in a hard-coded IP blacklist, on telnet TCP ports 23 and 2323”. If an IoT device responds to the probe, the attack then enters into a brute-force login phase. During this phase, the attacker tries to establish a telnet connection using predetermined username and password pairs from a list of credentials. Most of these logins are default usernames and passwords from the IoT vendor. If the IoT device allows the Telnet access, the victim's IP, along with the successfully used credential is sent to a collection server.
There are a large number of IoT devices which use default settings, making them vulnerable to infection. Once infected, the device will monitor a command and control server which indicates the target of an attack. The reason for the use of the large number of IoT devices is to bypass some anti-DoS software which monitors the IP address of incoming requests and filters or sets up a block if it identifies an abnormal traffic pattern, for example, if too many requests come from a particular IP address. Other reasons include to be able to marshall more bandwidth than the perpetrator can assemble alone, and to avoid being traced.
Mirai as an Internet of things (IoT) devices threat has not been stopped after the arrest of the actors. Some believe that other actors are utilizing the source code on GitHub to evolve Mirai into new variants. They speculate that the goal is to expand its botnet node to many more IoT devices. The detail of the recent progress of these variants is listed in the following paragraphs.
Variants
On 12 December 2017, researchers identified a variant of Mirai exploiting a zero-day flaw in Huawei HG532 routers to accelerate Mirai botnets infection, implementing two known SOAP related exploits on routers web interface, CVE-2014–8361 and CVE-2017–17215. This Mirai version is called "Satori".
On 14 January 2018, a new variant of Mirai dubbed “Okiru”, the Japanese word for "get up," already targeting popular embedded processor like ARM, MIPS, x86, PowerPC and others was found targeting ARC processors based Linux devices for the first time. Argonaut RISC Core processor (shorted: ARC processors) is the second-most-popular embedded 32 bit processor, shipped in more than 1.5 billion products per year, including desktop computers, servers, radio, cameras, mobile, utility meters, televisions, flash drives, automotive, networking devices (smart hubs, TV modems, routers, wifi) and Internet of Things. Only a relatively small number of ARC-based devices run Linux and are therefore exposed to Mirai.
On 18 January 2018, a successor of Mirai is reported to be designed to hijack cryptocurrency mining operations.
On 26 January 2018, two similar Mirai variant botnets were reported, the more modified version of which weaponizes EDB 38722 D-Link router's exploit to enlist further vulnerable IoT devices. The vulnerability in the router's Home Network Administration Protocol (HNAP) is utilized to craft a malicious query to exploited routers that can bypass authentication, to then cause an arbitrary remote code execution. The less modified version of Mirai is called "Masuta" (after the Japanese transliteration of "Master"), while the more modified version is called "PureMasuta".
In March 2018, a new variant of Mirai, dubbed as "OMG", has emerged to surface with added configurations to target vulnerable IoT devices and turning them into proxy servers. New firewall rules that allow traffic to travel through the generated HTTP and SOCKS ports were added configurations to the Mirai code. Once these ports are open to traffic, OMG sets up 3proxy – open-source software available on a Russian website.
Between May and June 2018, another variant of Mirai, dubbed as "Wicked", has emerged with added configurations to target at least three additional exploits including those affecting Netgear routers and CCTV-DVRs. Wicked scans ports 8080, 8443, 80, and 81 and attempts to locate vulnerable, unpatched IoT devices running on those ports. Researchers suspect the same author created the Wicked, Sora, Owari, and Omni botnets.
In early July 2018 it was reported at least thirteen versions of Mirai malware has been detected actively infecting Linux Internet of things (IoT) in the internet, and three of them were designed to target specific vulnerabilities by using exploit proof of concept, without launching brute-forcing attack to the default credential authentication. In the same month it was published a report of infection campaign of Mirai malware to Android devices through the Android Debug Bridge on TCP/5555, an optional feature in the Android operating system, though it was discovered that this feature appears to be enabled on some Android phones.
At the end of 2018, a Mirai variant dubbed "Miori" started being spread through a remote code execution vulnerability in the ThinkPHP framework, affecting versions 5.0.23 to 5.1.31. This vulnerability is continuously being abused by the further evolved Mirai variants dubbed as "Hakai" and "Yowai" in January 2019, and variant "SpeakUp" in February, 2019.
Use in DDoS attacks
Mirai was used, alongside BASHLITE, in the DDoS attack on 20 September 2016 on the Krebs on Security site which reached 620 Gbit/s. Ars Technica also reported a 1 Tbit/s attack on French web host OVH.
On 21 October 2016, multiple major DDoS attacks in DNS services of DNS service provider Dyn occurred using Mirai malware installed on a large number of IoT devices, many of which were still using their default usernames and passwords. These attacks resulted in the inaccessibility of several high-profile websites, including GitHub, Twitter, Reddit, Netflix, Airbnb and many others. The attribution of the Dyn attack to the Mirai botnet was originally reported by Level 3 Communications.
Mirai was later revealed to have been used during the DDoS attacks against Rutgers University from 2014 to 2016, which left faculty and students on campus unable to access the outside Internet for several days at a time. Additionally, a failure of the university's Central Authentication Service caused course registration and other services to become unavailable during critical times in the academic semester. The university reportedly spent $300,000 in consultation and increased the cyber-security budget of the university by $1 million in response to these attacks. The university cited the attacks among its reasons for the increase in tuition and fees for the 2015–2016 school year. A person under the alias "exfocus" claimed responsibility for the attacks, stating in a Reddit AMA on the /r/Rutgers subreddit that the user was a student at the school and the DDoS attacks were motivated by frustrations with the university's bus system. The same user later claimed in an interview with a New Jersey–based blogger that they had lied about being affiliated with the university and that the attacks were being funded by an anonymous client. Security researcher Brian Krebs later alleged the user was indeed a student at Rutgers University and that the latter interview was given in an attempt to distract investigators.
Staff at Deep Learning Security observed the steady growth of Mirai botnets before and after the 21 October attack.
Mirai has also been used in an attack on Liberia's Internet infrastructure in November 2016. According to computer security expert Kevin Beaumont, the attack appears to have originated from the actor which also attacked Dyn.
Its DDoS attacks were also notable in Brazil, Taiwan, Costa Rica and India.
Other notable incidents
At the end of November 2016, approximately 900,000 routers, from Deutsche Telekom and produced by Arcadyan, were crashed due to failed TR-064 exploitation attempts by a variant of Mirai, which resulted in Internet connectivity problems for the users of these devices. While TalkTalk later patched their routers, a new variant of Mirai was discovered in TalkTalk routers.
A British man suspected of being behind the attack was arrested at Luton Airport, according to the BBC.
Identity of the author
On January 17, 2017, computer security journalist Brian Krebs posted an article on his blog, Krebs on Security, where he disclosed the name of the person who he believed to have written the malware. Krebs stated that the likely real-life identity of Anna-senpai (named after Anna Nishikinomiya, a character from Shimoneta), the author of Mirai, was actually an Indian-American Paras Jha, the owner of a DDoS mitigation service company ProTraf Solutions and a student of Rutgers University. In an update to the original article, Paras Jha responded to Krebs and denied having written Mirai. The FBI was reported to have questioned Jha on his involvement in the October 2016 Dyn cyberattack. On December 13, 2017, Paras Jha, Josiah White, and Dalton Norman entered a guilty plea to crimes related to the Mirai botnet. The trio assisted the government with other cybersecurity investigations, and were sentenced to probation and community service without imprisonment.
Daniel Kaye, 29, also known as alias "BestBuy", "Popopret" or "Spiderman", has been accused of "using an infected network of computers known as the Mirai botnet to attack and blackmail Lloyds Banking Group and Barclays banks," according to the NCA. He has been extradited from Germany to the UK according to the same report. Kaye has also pleaded guilty in court on hijacking more than 900,000 routers from the network of Deutsche Telekom.
Researchers later pointed to the handle name "Nexus Zeta" as responsible for the author of new variants of Mirai (dubbed as Okiru, Satori, Masuta and PureMasuta), and on August 21, 2018, an American grand jury indicted Kenneth Currin Schuchman, 20, aka Nexus Zeta, of knowingly causing the transmission of a program, information, code, and commands, and as result of such conduct intentionally causing damage without authorization to protected computers, according to the indictment filed in U.S. District Court in Anchorage, followed by the arrest and trial of the suspect.
In popular culture
American electronic musician and composer James Ferraro's 2018 album Four Pieces for Mirai references Mirai in its ongoing narrative.
See also
Linux malware
Denial-of-service attack
BASHLITE – another notable IoT malware
Linux.Darlloz – another notable IoT malware
Remaiten – another IoT DDoS bot
Linux.Wifatch
Hajime
BrickerBot
References
Further reading
Denial-of-service attacks
Botnets
Software using the GNU General Public License
Free software programmed in C
Free software programmed in Go
IoT malware
Linux malware
Cybercrime in India | Mirai (malware) | [
"Technology"
] | 2,796 | [
"Denial-of-service attacks",
"Computer security exploits"
] |
52,048,187 | https://en.wikipedia.org/wiki/Twister%20sister%20ribozyme | The twister sister ribozyme (TS) is an RNA structure that catalyzes its own cleavage at a specific site. In other words, it is a self-cleaving ribozyme. The twister sister ribozyme was discovered by a bioinformatics strategy as an RNA Associated with Genes Associated with Twister and Hammerhead ribozymes, or RAGATH.
The twister sister ribozyme has a possible structural similarity to twister ribozymes. Some striking similarities were noted, but also surprising differences, such as the absence of the two pseudoknot interactions in the twister ribozyme. The exact nature of the structural relationship between twister and twister sister ribozymes, if any, has not be determined.
Discovery
The twister sister ribozyme was discovered through a bioinformatic search. This study conducted a search for conserved RNA structures near known twister and hammerhead ribozymes as well as certain protein-coding genes based on the fact that many ribozymes are located near to each other and near those genetic fragments. Later they tested the self-cleaving activity of 15 conserved RNA motifs that were found in these regions. 3 out of the 15 RNA motifs showed self-cleaving activity, which were the twister sister ribozyme, the pistol ribozyme and the hatchet ribozyme.
Structure
The crystal structures of the pre-catalytic state of the twister sister ribozymes were solved by two research groups independently.
The structure of a three-way junctional twister sister ribozyme is composed of two co-axial stacked helical sections connected with a three-way junction and two tertiary contacts. The active site, a scissile phosphate, is located in a loop with quasihelical character in one coaxial base-stacked helix. Five divalent metal ions are coordinate to RNA ligands, one of which is directly bound to C54 O2’ near the scissile phosphate and exchange inner sphere water molecules with the RNA ligands.
The crystal structure of a four-way junctional twister sister ribozyme is different from the three-way junctional one in terms of long-range interaction and active site structure. The active site of a four-way junctional twister sister is splayed-apart with an interaction between guanine and scissile phosphate. Besides, there are seven divalent metal ions in this ribozyme.
So far, we only know the pre-catalytic conformation of twister sister ribozymes. Understanding the transition state is needed to explain the relationship between twister ribozyme and twister sister ribozyme as well as the structure differences of the active site between the three-way and four-way junctional twister sister ribozymes.
Catalytic mechanism
Generally, nucleolytic ribozymes cleave a specific phosphodiester linkage by SN2 mechanism. The O2' acts as a nucleophile to attack the adjacent P, with O5’ as a leaving group. The catalytic products are a cyclic 2’,3’ phosphate and a 5’-hydroxyl.
The catalytic activity of twister sister increases with pH and depends on divalent metal ion. The cleavage speed increases 10 fold with each increase in pH unit and reach a plateau near pH 7, which indicates that the 2-hydroxyl group of cytidine near the active site is fully deprotonated at pH 7 in the ribozyme. However, the structural basis for the catalytic activity is still under investigation.
The three-way junctional twister sister is a metalloenzyme. The inner sphere water of a divalent metal ion bound to C54 O2’ acts as a general base to deprotonate the 2-hydroxyl group, making it a stronger nucleophile, but the general acid which can stabilize the oxyanion leaving group remains unknown. This mechanism is supported by the exponential correlation between catalytic activity and the pKa of hydrated metal ion.
For the four-way junctional twister sister, Ren and coworkers find that guanine with an amino group is likely to play a role in the catalysis because G5 mutations result in very low catalytic activity. However, it remains unclear whether guanine directly participates in the catalysis as it is not absolutely conserved. The formation of a pseudoknot for four-way junctional TS was found to be highly Mg2+ dependent by conducting SHAPE (Selective-2′ -Hydroxyl Acylation analyzed by Primer Extension) experiments.
References
RNA
Ribozymes | Twister sister ribozyme | [
"Chemistry"
] | 966 | [
"Catalysis",
"Ribozymes"
] |
52,048,251 | https://en.wikipedia.org/wiki/Pistol%20ribozyme | The pistol ribozyme is an RNA structure that catalyzes its own cleavage at a specific site. In other words, it is a self-cleaving ribozyme. The pistol ribozyme was discovered through comparative genomic analysis.
Subsequent biochemical analysis determined further biochemical characteristics of the ribozyme. This understanding was further advanced by an atomic-resolution crystal structure of a pistol ribozyme
Discovery
Pistol ribozyme was discovered by a bioinformatics strategy as an RNA Associated with Genes Associated with Twister and Hammerhead ribozymes, or RAGATH.
Physical Properties
Comparative analysis of 501 unique samples of pistol ribozyme from ribozyme-associated gene classes and bacterial DNA sequences was done to reach a consensus of the physical properties of the pistol ribozyme
Sequences
10 nucleotides were discovered to be highly conserved amongst many pistol ribozymes: G5, A19, A20, A 21, A31, A32, A33, G40, C41, and G42. Mutation to any of these nucleotides disrupt its secondary structure, which also disrupt its catalytic ability. The scissile bond was also determine to be between G53-U54 located in the junction connecting P2 and P3. Although the identity of these two nucleotides might vary, the length of the junction remains highly conserved.
Secondary Structure
Secondary structure in pistol ribozyme was observed to be highly conserved. There are 3 Watson-Crick base-paired stems: P1, P2, and P3, which are all connected by loops. A pseudoknot interaction exists between the loop of P1 and the junction connecting P2 and P3.
Catalytic Activity
Mechanism
The mechanism for pistol ribozyme was deduced through the identification of the products of the self-cleaving reaction. Through mass spectrometry, it was found that the products contain 5'-hydroxyl and 2',3'-cyclic phosphate functional groups. Reaction mechanism was concluded to involve 2'-OH nucleophilic attack by G53 on the phosphate bond connecting G53-U54. The process involves a trigonal bipyramidal penta-coordinated phosphorus center. N1 on G40 acts a general base in which it activates the nucleophile 2'-OH on G53. G32 acts as a general acid in which it neutralizes the developing negative charge on the intermediate.
Kinetics
Under physiological pH and magnesium ion concentration, the rate constant of pistol ribozyme self-cleaving reaction was observed to be > 10 min−1. Under optimum condition (pH = 7.0 - 9.0, and magnesium concentration above 50 mM), the rate constant detected to be > 100 min−1. As magnesium concentration increases, the rate of reaction increases but starts to plateau around 50 mM.
Metal Ions Specificity
Self-cleaving reactions were observed in the presence of 0.1 mM of various monovalent and divalent metal ions such as magnesium, manganese, calcium, cobalt, nickel, cadmium, barium, sodium, and lithium. This implies that pistol ribozyme possess no specificity in the metal ion required in catalysis.
References
RNA
Ribozymes | Pistol ribozyme | [
"Chemistry"
] | 670 | [
"Catalysis",
"Ribozymes"
] |
52,048,266 | https://en.wikipedia.org/wiki/Hatchet%20ribozyme | Background: The hatchet ribozyme is an RNA structure that catalyzes its own cleavage at a specific site. In other words, it is a self-cleaving ribozyme. Hatchet ribozymes were discovered by a bioinformatics strategy as RNAs Associated with Genes Associated with Twister and Hammerhead ribozymes, or RAGATH.
Subsequent biochemical analysis supports the conclusion of a ribozyme function, and determined further characteristics of the chemical reaction catalyzed by the ribozyme.
Nucleolytic ribozymes are small RNAs that adopt compact folds capable of site-specific cleavage/ligation reactions. 14 unique nucleolytic ribozymes have been identified to date, including recently discovered twister, pistol, twister-sister, and hatchet ribozymes that were identified based on application of comparative sequence and structural algorithms.
The consensus sequence and secondary structure of this class includes 13 highly conserved and numerous other modestly conserved nucleotides inter-dispersed among bulges linking four base-paired substructures. A representative hatchet ribozyme requires divalent cations such as Mg2+ to promote RNA strand scission with a maximum rate constant of ~4/min. As with all other small self-cleaving ribozymes discovered to date, hatchet ribozymes employ a general mechanism for catalysis consisting of a nucleophilic attack of a ribose 2-oxygen atom on the adjacent phosphorus center. Kinetic characteristics of the reaction demonstrate that members of this ribozyme class have an essential requirement for divalent metal cations and that they have a complex active site which employs multiple catalytic strategies to accelerate RNA cleavage by internal phosphoester transfer.
Mechanism
Nucleolytic ribozymes like the Hatchet Ribozyme adopt an SN2-like mechanism that results in site-specific phosphodiester bond cleavage. An activated 2-OH of the ribose 5 to the scissile phosphate adopts an in-line alignment to target the adjacent to-be-cleaved P-O5 phosphodiester bond, resulting in formation of 2,3-cyclic phosphate and 5-OH groups. X-ray crystallographic structural studies on the hammerhead, hairpin, GlmS, hepatitis delta virus (HDV), Varkud satellite, and pistol ribozymes have defined the overall RNA fold, the catalytic pocket arrangement, the in-line alignment, and the key residues that contribute to the cleavage reaction. The cleavage site is located at the 5' end of its consensus secondary motif.
In addition, the removal of the nucleophilic hydroxyl renders the ribozyme inactive as it is not able to create the cleavage site. More specifically, if the 2'-ribose or 2'-OH is replaced with a 2'-deoxyribose or 2'-H, there are no electrons available to perform the nucleophilic attack on the adjacent phosphate group. This results in no phosphoester bond being formed, which again inactivates the ribozyme's enzymatic cleavage ability.
Secondary Structure
In 2019, researchers crystallized a 2.1 Å product of the Hatchet Ribozyme. The consensus sequence is depicted in the image to the right. Most hatchet ribozymes and ribozymes in general adopt a P0 configuration. P0 is an additional hairpin loop located at the 5' end of the cleavage site, though it does not contribute to catalytic activity or functionality unlike Hammerhead ribozymes which have a short consensus sequence near P1, or the 5' end, that promotes high speed catalytic activity. About 90% of the sequence is conserved and similar to other ribozymes in this class.
Based on the RNA sequence, the resulting DNA sequence which ends up coding for the Hatchet Ribozyme is as follows from 5'-3' because in DNA uracil is replaced by thymine.
TTAGCAAGAATGACTATAGTCACTG TTTGTACACCCCGAATAGATTAGAA GCCTAATCATAATCACGTCTGCAAT TTTGGTACA
Due to this sequence construct, after self catalyzed cleavage, it leaves an 8 nucleotide residue upstream on the 3'-end of the RNA.
Tertiary Structure
Each ribozyme may have different motifs and thus different tertiary structures:
The Tertiary structure of the Hatchet Ribozyme with the motif of HT-UUCG is through dimerization. The dimer is formed through the swapping of the 3' ends of the pairing strands which is also in equilibrium with the dimer formed product of HT-GAAA. Therefore, the RNA sequence shifts between monomer and dimer configurations. To view the 3-D shape of the ribozyme see Figure S1A and B. Two molecules of the HT-GAAA ribozyme can actually form a pseudosymmetric dimer with both monomers of the ribozyme exhibiting relatively well-defined electron density. The tertiary fold consists of four stem substructures which covalently stack upon each other forming the helical and loop structures, called P1, P2, P3, and P4, L1, L2 and L3 respectively (though not shown in the figure above). The actual cleavage site is positioned between the junction of P1 and P2 adjacent to P3 and L2. P1 is composed of three or six base pairs roughly 40% and 60% of the time respectively in its natural state, suggesting that length corresponds to catalytic function.
There is also a conserved palindromic sequencing between base U70' and A67', which likely triggers the formation of the dimer due to Watson-Crick base pair interactions.
The tertiary structure also has long range implications within itself based on interactions between its loops.
Effect of pH and Mg2+
Ribozyme catalysis experiments were done by the addition of MgCl2 and stopped for measurement at each time point by the addition of a stop solution containing urea and EDTA.
A plot of the kobs values measured at pH 7.5 with increasing concentrations of Mg2+. There is a sharp increase in ribozyme function that plateaus as the concentration approaches 10 mM. The steep slope observed at lower Mg2+ concentrations suggests that more than one metal ion is necessary for each RNA to achieve maximal ribozyme activity. Moreover, this suggests that the construct requires higher than normal physiological concentrations of Mg2+ to become completely saturated with Mg2+ as the cofactor. It is possible that native unimolecular constructs, also carrying P0, might achieve saturation at concentrations of Mg2+ that are closer to normal physiological levels.
The effect of pH on ribozyme rate constant in reactions containing 10 mM Mg2+ was also experimentally measured. pH-dependent ribozyme activity increases linearly with a slope of 1 until reaching a kobs, of a Michaelis-Menten plot, plateau of ~4/min near a pH value of 7.5. Any higher pH has the same catalytic effect and more acidic pH's begin denaturing the ribozyme and thus reducing catalytic function. Both the pH dependency and the maximum rate constant have interesting implications for the possible catalytic strategies used by this ribozyme class.
The effects of various mono- and divalent metal ions on hatchet ribozyme activity
The Hatchet ribozyme construct remains completely inactive when incubated in the absence of Mg2+ in reactions containing only other monovalent cations at 1 M (Na+, K+, Rb+, Li+, Cs+), 2.5 M (Na+, K+), or 3 M (Li+). In contrast, other divalent metal ions such as Mn2+, Co2+, Zn2+, and Cd2+ support ribozyme function with varying levels of efficiency. Furthermore, two metal ions (Zn2+, Cd2+) function only at low concentrations, and three metal ions (Ba2+, Ni2+, and Cu2+) inhibit activity at 0.5 mM, even when Mg2+ is present. These results indicate that hatchet ribozymes are relatively restrictive in their use of cations to promote catalysis, perhaps indicating that one or more specialized binding sites that accommodate a limited number of divalent cations are present in the RNA structure or perhaps even at the active site. Inhibition by certain divalent metal ions could be due to the displacement of critical Mg2+ ions or by general disruption of RNA folding.
Significance/Applications
One standard application is to use flanking self-cleaving ribozymes to generate precisely cut out sequences of functional RNA molecules (i.e. shRNA, saiRNA, sgRNA). This is especially useful for in vivo expression of gene editing systems (i.e. CRISPR/Cas sgRNA) and inhibitory systems.
Another method is for in vivo transcription of siRNA. This design uses multiple self-cleaving ribozymes, which are all transcribed from the same gene. After cleavage, both parts of the precursor siRNA (siRNA 1 and 2) can form a double strand and act as intended. To see the setup, see saiRNA graphic
Lastly, if you want to combine self-cleaving ribozymes with protein sequences, it is important to know that the self-cleaving mechanism of the ribozymes will modify the mRNA. A 5' ribozyme will modify the downstream 5' end of the pre-mRNA, disabling the cell from creating a 5' cap. This decreases the stability of the pre-mRNA and prevents it from being fully functional mature mRNA. On the other side, a 3' ribozyme would prevent polyadenylation of the upstream pre-mRNA, again decreasing stability and preventing maturation. Both interfere with translation as well.
References
RNA
Ribozymes | Hatchet ribozyme | [
"Chemistry"
] | 2,089 | [
"Catalysis",
"Ribozymes"
] |
52,048,474 | https://en.wikipedia.org/wiki/NGC%20306 | NGC 306 is an open cluster in the Small Magellanic Cloud. It is located in the constellation Tucana. It was discovered on October 4, 1836, by John Herschel.
References
0306
18361004
Tucana
Small Magellanic Cloud
Open clusters | NGC 306 | [
"Astronomy"
] | 55 | [
"Tucana",
"Constellations"
] |
52,048,482 | https://en.wikipedia.org/wiki/NGC%20307 | NGC 307 is a lenticular galaxy in the constellation Cetus. It was discovered on September 6, 1831 by John Herschel.
References
External links
0307
18310906
Cetus
Lenticular galaxies
003367 | NGC 307 | [
"Astronomy"
] | 47 | [
"Cetus",
"Constellations"
] |
52,048,498 | https://en.wikipedia.org/wiki/NGC%20308 | NGC 308 is a star located in the constellation Cetus. It is only 55" away from NGC 307. It was recorded on December 31, 1866, by Robert Ball.
References
0308
18661231
Cetus
Stars
Discoveries by Robert Stawell Ball
3354 | NGC 308 | [
"Astronomy"
] | 56 | [
"Astronomical objects",
"Cetus",
"Stars",
"Constellations"
] |
52,048,522 | https://en.wikipedia.org/wiki/NGC%20309 | NGC 309 is a spiral galaxy in the constellation Cetus. Its velocity with respect to the cosmic microwave background is 5343 ± 22km/s, which corresponds to a Hubble distance of . However, nine non-redshift measurements give a much closer distance of . It was discovered in 1876 by Wilhelm Tempel.
NGC 309 and NGC 309A are listed together as Holm 27 in Erik Holmberg's A Study of Double and Multiple Galaxies Together with Inquiries into some General Metagalactic Problems, published in 1937.
Supernovae
Five supernovae have been observed in NGC 309.
See also
List of NGC objects (1–1000)
References
External links
0309
-02-03-050
003377
?
Cetus
spiral galaxies
Discoveries by Wilhelm Tempel
00542-1010 | NGC 309 | [
"Astronomy"
] | 166 | [
"Cetus",
"Constellations"
] |
52,048,549 | https://en.wikipedia.org/wiki/NGC%20310 | NGC 310 is a star located in the constellation Cetus. It was recorded on December 31, 1866, by Robert Ball.
References
0310
18661231
Cetus
Discoveries by Robert Stawell Ball
3396 | NGC 310 | [
"Astronomy"
] | 44 | [
"Cetus",
"Constellations"
] |
52,048,594 | https://en.wikipedia.org/wiki/RAGATH%20RNA%20motifs | RNAs Associated with Genes Associated with Twister and Hammerhead ribozymes (RAGATH) refers to a bioinformatics strategy that was devised to find self-cleaving ribozymes in bacteria. It also refers to candidate RNAs, or RAGATH RNA motifs, discovered using this strategy.
With the discovery of the twister ribozyme, it was recognized that many genetic elements in bacteria are often located nearby to twister ribozymes and also to the previously discovered hammerhead ribozymes. These genetic elements include several gene classes, many of which are characteristic of Mu-like phages. The nearby elements also include twister and hammerhead ribozymes. In other words, twister and hammerhead ribozymes are often located in bacteria nearby to other twister or hammerhead ribozymes.
Given these observations, researchers hypothesized that other classes of self-cleaving ribozymes would also associate with these genetic elements. Therefore, searches were conducted on the non-coding regions nearby to the associated genetic elements to find conserved RNA structures using a previously established method. Such RNA structures would then be candidates as self-cleaving ribozymes.
Using this method, previously unknown self-cleaving ribozyme classes were found: the twister sister, pistol and hatchet ribozymes. Unusual examples of hammerhead and HDV ribozymes were also found. Twelve additional conserved RNA structures did not appear to function as ribozymes, and the biological and biochemical functions of these RNAs remain unknown. All conserved RNAs were named "RAGATH RNA motifs", and the unsolved RNAs are numbered RAGATH-4 through RAGATH-15. Additional RAGATH motifs that did not self-cleave 'in vitro' were also later published.
RAGATH-18 RNAs contain a predicted kink turn. This particular example of a kink turn was studied to better understand how kink turn structures relate to their sequences.
References
RNA | RAGATH RNA motifs | [
"Chemistry"
] | 422 | [
"Catalysis",
"Ribozymes"
] |
52,048,719 | https://en.wikipedia.org/wiki/International%20Prize%20in%20Statistics | The International Prize in Statistics is awarded every two years to an individual or team "for major achievements using statistics to advance science, technology and human welfare". The International Prize in Statistics, along with the COPSS Presidents' Award, are the two highest honours in the field of Statistics.
The prize is modelled after the Nobel Prizes, Abel Prize, Fields Medal and Turing Award and comes with a monetary award of $80,000. The award ceremony takes place during the World Statistics Congress.
Laureates
Rules
The prize recognizes a single work or body of work, representing a powerful and original idea that had an impact in other disciplines or a practical effect on the world. The recipient must be alive when the prize is awarded.
Organization
The prize is awarded by the International Prize in Statistics Foundation, which comprises representatives of the following major learned societies:
American Statistical Association
International Biometric Society
Institute of Mathematical Statistics
International Statistical Institute
Royal Statistical Society
In addition to recognizing the contributions of a statistician, the Foundation also aims at educating the public about statistical innovations and their impact on the world and gaining wider recognition for the field.
The recipient of the prize is chosen by a selection committee comprising international experts in the field. , the committee members were Xiao-Li Meng (Harvard University), Sally Morton (Virginia Tech), Stephen Senn (Luxembourg Institute of Health), Bernard Silverman (University of Oxford), Stephen Stigler (University of Chicago), Susan Wilson (Australian National University) and Bin Yu (University of California, Berkeley). As of May 2022, the members of the selection committee are Yoav Benjamini, Francisco Cribari-Neto, Vijay Nair, Sonia Petrone, Nancy Reid, Sylvia Richardson, and Jane-Ling Wang.
See also
List of mathematics awards
COPSS Distinguished Achievement Award and Lectureship
Rousseeuw Prize for Statistics
References
External links
Statistical awards
International awards
Awards established in 2016 | International Prize in Statistics | [
"Technology"
] | 385 | [
"Science and technology awards",
"International science and technology awards"
] |
52,049,249 | https://en.wikipedia.org/wiki/List%20of%20viral%20music%20videos | Viral music videos are those that have gained rapid attention on the Internet. Like Internet memes, viewership of such videos tend to expand rapidly and become more widespread because the instant communication facilitates word of mouth.
This list documents music videos known to have become viral; other viral videos can be found at list of viral videos with additional videos that have become Internet phenomena for other categories can be found at list of Internet phenomena.
Major music videos
These videos are videos from various artists that have over 500 million views and gained viral popularity after their release.
"Ai Se Eu Te Pego" – a Brazilian Portuguese song made popular by the Brazilian singer Michel Teló during the height of the Música sertaneja craze. The international success of the main release of the song made the song go viral. The song peaked at number 81 on the Billboard Hot 100. The music video currently has over 1.1 billion views.
"Axel F" – a remix of the Beverly Hills Cop theme by Crazy Frog. The song peaked at number 1 in the UK Charts in 2005, as well in different countries in Europe. The song blew up internationally in recent years. Currently, Its music video has over 4.5 billion views on YouTube.
"Baby Shark Dance" – a children's viral educational music video made by South Korean education brand Pinkfong that went viral due to its poppy and repetitive lyrics. It is currently the most viewed YouTube video, with over 9.3 billion views as of September 2021.
"Bad and Boujee" – a song by rap group Migos. The song became a meme when people made edits on the line "Raindrop, droptop". The video has over 1 billion views. Takeoff's response to being left off the track spawned other memes due to interviewers not being able to hear him.
"Despacito" – the official video for "Despacito" on YouTube received its one billionth view on April 20, 2017, after 97 days, becoming the second-fastest video on the site to reach the milestone behind Adele's "Hello". By August 2017, the song was the most viewed YouTube video with 2.9 billion views. Despacito is also the first and fastest video to hit 3, 4, 5, 6 and 7 billion views. The song soared into the top 10 of the Billboard Hot 100 following a Justin Bieber remix. The song also peaked at number 1 for 16 weeks, tying Mariah Carey and Boyz II Men's "One Sweet Day". It is currently the most liked YouTube video, with over 50 million likes as of October 2022.
"Dilbar" – a remake of 1999 Bollywood song of the same name. Being sung by Neha Kakkar, Dhvani Bhanushali and Ikka in Hindi, it features Arabic, Middle Eastern and Moroccan influences. The video features Nora Fatehi performing Arabic Belly dance. A remix version of the song, in three languages: Arabic, French and Hindi was later released, sung by Moroccan-Canadian actress Nora Fatehi in collaboration with Moroccan hip hop group Fnaïre. The remake version has crossed 1.2 billion views on YouTube, as of October 2022.
"Gangnam Style" – a song and music video by South Korean rapper Psy, showing him doing an "invisible horse dance" and saying the catchphrase "Oppa Gangnam Style" across a number of quirky locations, leading to its viral spread as well as the single's reaching international music charts. On YouTube, The video was the first to reach 1 and 2 billion views, and on November 24, 2012, became the most watched video, surpassing Justin Bieber's "Baby" until it was surpassed by Wiz Khalifa's "See You Again" on July 10, 2017. As of December 2022, the video has been viewed over 4.6 billion times on YouTube.
"God's Plan" – a viral song made by Canadian rapper Drake. The lyrics, as well as some of the good deeds Drake did throughout the music video, allowed for it to go viral and become a meme. The song peaked at number one on the Billboard Hot 100 and has accumulated over 1 billion views on YouTube.
"Gucci Gang" – a song and music video by American rapper Lil Pump. The song's repetitive hook, which repeats the title of the song several times, led to the song becoming an Internet meme with other people making edits of the song. The song also peaked at number 3 on the Billboard Hot 100, and has accumulated over 1.1 billion views.
"Havana" – a song by Camila Cabello named after the Cuban city of where she was born. The song is the first song by a female artist since 1996 to top 3 multiple charts on Billboard. The song also peaked at number one on the Billboard Hot 100. The official music video has over 1 billion views on YouTube, while its audio version has over 1.9 billion views as of December 2022.
"Hello" – Adele's song released in October 2015 was a major digital commercial success, being the first song to sell 1 million units within a week of its release. Its video, which primarily features Adele's singing through a telephone conversation, led to several mashups with other songs, including Lionel Richie's song of the same name, which had a similar theme to its video. As of February 2018, the video holds the record for the fastest time to reach one billion views on YouTube, reaching this within 88 days of its release. As of December 2022, the video has over 3 billion views on YouTube.
"High Hopes" – a song by Panic! at the Disco.
"Hot Nigga" – a song by American rapper Bobby Shmurda. It became popular among Vine users in 2014 and led to the Shmoney dance meme, which has been performed by both Beyoncé and NFL receiver Brandon Gibson. The line "About a week ago!" was also heavily featured in the vines. As of October 2023 the video has 870 million views.
"Hotline Bling" – a song and video by Drake released in October 2015; the video primarily consists of Drake dancing with female performers against brightly lit backgrounds. Drake's dance style was considered "goofy" and like that "of a total fool", leading to Internet users either resampling the video against other songs they felt more fitting, or themselves recreating the dance. As of October 2018, the video has over 1.4 billion views on YouTube.
"How You Like That" – a song by South Korean girl group Blackpink released in June 2020. The song's music video broke the records for the biggest music video premiere on YouTube, with 1.66 million concurrent viewers, and the most-watched music video within 24 hours, with 86.3 million views in its first day. It became the fastest video to reach 100 million views, in just 32 hours, and 200 million views, in seven days. As of February 2022, the song's music video and dance performance video both have more than 1 billion views.
"Kill This Love" – a song by South Korean girl group Blackpink released in April 2019. The song's music video broke the records for the biggest music video premiere on YouTube, with 979,000 million concurrent viewers, and the most-watched music video within 24 hours, with 56.7 million views in its first day. It became the fastest video to reach 100 million views, in two days and 14 hours. As of September 2024, the music video has more than 2 billion views.
"Lahore" – a Punjabi Indi-pop single by Guru Randhawa released in December 2017. It was later remade for Street Dancer 3D by the name of "Lagdi Lahore Di" and sung by Guru Randhawa and Tulsi Kumar, which has crossed 400 million views. As of October 2022, the original version has more than 1 billion views.
"Laung Laachi" – a Punjabi title song of the movie Laung Laachi became the most viewed song video in India in December 2019, as well as the first music video to hit more than 1 billion views. It is also the most viewed T-Series video (uploaded on 'T-Series Apna Punjab').
"Look What You Made Me Do" – a song and video by Taylor Swift released on Aug 27, 2017. The song's music video broke the record for most-watched music video within 24 hours by achieving 43.2 million views on YouTube in its first day, topping the 27.7 million views Adele's "Hello" attracted in that timeframe, making it the third most viewed online video in the first 24 hours. It is also the fastest video to reach 200, 300 and 400 million views and the second fastest to reach 100, 500 and 600 million. As of October 2019, the video has over 1.1 billion views on YouTube.
"Old Town Road" – a song by Lil Nas X that gained popularity in early 2019. It has since become a challenge on TikTok, under the "Yeehaw Challenge". The song has received support from Justin Bieber, was played after Texas Tech's win in the NCAA tournament, and played at an Atlanta Hawks basketball game. The song peaked at number one on the Billboard Hot 100, as well in many other countries. Its longevity on top of the Billboard Hot 100 has made it one of only 12 singles to peak at number one for 13+ weeks. The visualizer has since racked up more than 76 million views on YouTube. A remix with country singer Billy Ray Cyrus was later released, boosting the songs popularity even more. The remix audio has surpassed 550 million views on YouTube. Both versions of the song have made Road the most streamed song in a week in the US with over 143 million streams, surpassing Drake's "In My Feelings" with 116.2 million streams. A music video released later starts off in 1889 and transitions into 2019. The music video also features several cameos. As of January 2021, its audio version has over 555 million views on YouTube.
"See You Again" – the official soundtrack of the 2015 film Furious 7 sung by Wiz Khalifa and Charlie Puth. The song was a tribute to Paul Walker, as he died during the production of Furious 7 . The song became very popular, getting to 1 billion views in only 181 days. The song was also briefly the most viewed YouTube video, until it was surpassed by Despacito 24 days later. As of October 2019, the song has over 4.6 billion views, making it currently the fourth most-viewed YouTube video.
"Single Ladies (Put a Ring on It)" – a song and video released by Beyoncé in October 2008. The music video, shot in black and white, features Beyoncé wearing a one-shoulder black leotard surrounded by two backup dancers performing the choreography that would lead to the video's popularity. The video is credited with starting the "first major dance craze of both the new millennium and the Internet". Many celebrities have parodied and paid homage to the song and the video, including former President Barack Obama, Tom Hanks, Joe Jonas, Kourtney Kardashian, Khloé Kardashian, and Kim Kardashian, and Chris Colfer and Heather Morris included the dance routine as part of Glee Live! In Concert!. As of March 2019, the video has over 690 million views on YouTube.
"Thank U, Next" – a 2018 song by Ariana Grande; its music video was released on November 30. The song topped the Billboard Hot 100. The video reached 100 million views in 3 days and 10 hours, becoming one of the fastest to do so. It also reached 55.4 million views within 24 hours, breaking both the YouTube and Vevo 24 hour records. The music video features celebrities Colleen Ballinger, Jonathan Bennett, Stefanie Drummond, Scott Nicholson, Troye Sivan and Gabi DeMartino. It referenced the movies Mean Girls, Bring It On, 13 Going on 30 and Legally Blonde. As of January 2021, the music video has over 605 million views on YouTube.
"The Duck Song" – a 2009 children's song by Bryant Oden accompanying an animated music video by forrestfire101 that went viral shortly after its release on YouTube. Within three years the video received nearly 90 million views. The series ended in October 2024 with Part 5. As of December 2024, the original video has over 647 million views.
"The Fox (What Does the Fox Say?)" – a 2013 song and associated video by the Norwegian comedy duo Ylvis prepared for their television show. The song's verses note the noises other animals make; the chorus asks what noise a fox makes, at which point the song offers nonsense phrases like "gering-ding-ding-ding-dingeringeding!" and "fraka-kaka-kaka-kaka-kow!", while the video takes a similarly funny turn. The video saw over 43 million hits within a few weeks of its release, topping music charts, and leading to Ylvis being signed for more music by Warner Bros. Records. As of June 2020, the video has over 1 billion views on YouTube.
"The Gummy Bear Song" – a bubblegum dance song by Gummibär became a viral sensation and was the first song by a German independent artist to gain 1 billion views. As of March 2019, the video has over 1.6 billion views on YouTube.
"This Is America" – a viral song by Childish Gambino. The video talks about the state of America. The way Glover walks in the beginning is representative of Jim Crow. His movements represent minstrel shows, a form of entertainment that mocks African-American people. The video also references the 2015 Charleston Church massacre, the use of phones to record police officers shooting blacks, the book of Revelation, other things relating to cars, and Get Out. The video surpassed 12.9 million views in under 24 hours, and 50 million in 3 days. It had 886 million views as of July 2023.
"Turn Down for What" – a 2014 song and video by record producer DJ Snake and rapper Lil Jon. It gained viral popularity due to its bass drop after Lil Jon yells "Turn Down For What!". As of March 2019, the video had over 840 million views on YouTube.
"Watch Me (Whip/Nae Nae)" – a viral video by Silentó with unique moves imitated by other fans. The song peaked at No. 3 on the Billboard Hot 100 chart. As of March 2019, the song had accumulated over 1.6 billion views.
Other music videos
Originals
"1-800-273-8255" – a song by Logic featuring Alessia Cara and Khalid mainly focusing on the topic of suicide and suicide prevention. Its title is a direct reference to the United States National Suicide Prevention Lifeline's phone number, although as of 2022 the Lifeline is known as the 988 Suicide & Crisis Lifeline as its number is now 988. In 2021, the Lifeline reported that calls soared 50% after Logic performed the song at the 2017 MTV Video Music Awards and that suicides among 10- to 19-year-olds dropped by 5.5 percent between June 1, 2017 (34 days after the song was released) and the 2018 Grammy Awards, where the song was performed live once more.
"2 Phút Hơn"
"Badgers" – a viral song and video by Jonti Picking featuring badgers jumping up and down accompanied with catchy lyrics. The dancing badgers helped Picking's website Weebl's Stuff win a People's Choice award from users of Yahoo! in the UK.
"Bed Intruder Song" – a remix by the Gregory Brothers of a televised news interview of Antoine Dodson, the brother of a victim of a home invasion and attempted assault. The music video became a mainstream success, reaching the Billboard Hot 100, and became the most watched YouTube video of 2010. The video also coined the phrase "Hide yo kids, hide yo wife," which later became a meme.
"Bitch Lasagna" – a song by Swedish YouTuber Pewdiepie in collaboration with Dutch music producer Party In Backyard. The song satirizes Indian music label T-Series and uses racism and stereotypes of Indians as a response to predictions that T-Series would surpass PewDiePie in terms of subscriber count, which soon became true. The video was later banned in India by Delhi High Court. The song was one of the first events in the PewDiePie vs T-Series competition, in which the two channels competed for the title of the most-subscribed channel on YouTube.
"Chacarron Macarron" – a song by Panamanian artists Rodney Clark (El Chombo) and Andres de la Cruz (also known as Andy's Val Gourmet). It is a reworking of the original version from 2003 by Andy's Val Gourmet, who is credited as 'Andy's Val' on the release. The song gained attention online when the chorus was used on a YTMND page by the name of "Ualuealuealeuale", which was created sometime in late 2005. "Chacarron Macarron" went viral on the Internet owing to its nonsensical lyrics and odd music video.
"Chinese Food" – a song and music video by Alison Gold recorded with the controversial ARK Music Factory, the same company behind Rebecca Black's viral song "Friday". The song was called "The New Friday" and also called racist.
"Chocolate Rain" – a song and music video written and performed by Tay Zonday (also known as Adam Nyerere Bahner). After being posted on YouTube on 22 April 2007, the song quickly became a popular viral video. By December 2009, the video had received over 40 million views. As of October 2018, the song had over 119 million views.
"Congratulations" – a song by Swedish YouTuber PewDiePie, Swedish singer/musician Roomie and English musician Boyinaband. The single was self-released on 31 March 2019 with an accompanying music video on YouTube as a response to T-Series surpassing PewDiePie as the most subscribed channel on YouTube. The music video is banned on YouTube India.
"Crab Rave" – a song and music video written and animated by Irish DJ and music producer Eoin O'Broin (known by his stage name Noisestorm). Although the song was initially released as an April Fool's Day joke for the Canadian record label Monstercat, it soon gained popularity because of the music video featuring thousands of animated dancing crabs. The song peaked at number 32 in the "Hot Dance/Electronic Songs" category in the Billboard charts, surpassed over 1 million (U.S) online streams in the week ending November 22, 2018, and gained over 50 million views on the "Monstercat: Instinct" YouTube channel.
"Da Coconut Nut" – a song by Filipino national artist Ryan Cayabyab originally popularized by the band Smokey Mountain in 1991.
"Dat $tick" – a song by Indonesian rapper Rich Brian. It went viral after many rappers reacted to it.
"Don't Drop That Thun Thun" – a song and viral video by The FiNATTiCZ. The song became popular due to a twerking mashup of it posted on Vine. The song peaked at No. 35 on the Billboard Hot 100.
"Firework" (Katy Perry and Jodi DiPiazza duet) – a duet from the television special Night of Too Many Stars, it received 4 million views in the first 4 days and was the most viral video on YouTube for a short period of time.
"Friday" – a 2011 music video sung by 13-year-old Rebecca Black, partially funded by her mother, received over 200 million views on YouTube and spread in popularity through social media services.
"Gokuraku Jodo" – a J-pop song by Japanese pop duo Garnidelia. The song was released on July 28, 2016, accompanied with a dance music video. It spread to the Chinese video website Bilibili and quickly became viral in China, leading to various spoofs and mimicking dances. As of 27 June 2020, the video received 63 million views on YouTube.
"Gwiyomi" – a K-pop single by the South Korean indie musician Hari. The song, released on 18 February 2013, is based on an Internet meme known as the Gwiyomi Player, which was invented in October 2012 by the K-pop idol Jung Il Hoon. It has inspired many similar versions by Asian netizens.
"It's Everyday Bro" – a song by actor and YouTube personality Jake Paul that went viral due to a line by Nick Crompton, who stated that England was a city. The video accumulated over 216 million views and has become the seventeenth most disliked YouTube video.
"Комбайна вършачка (latinized: Kombaĭna vŭrshachka)" – an official music video for a song by Bulgarian folk band Оркестър Камчиa (Latinized: Orkestŭr Kamchi) about a combine harvester. It first became viral on TikTok in Bulgaria and other Balkan countries in August 2022, mostly because of the line "На китарата Васко Жабата, той ще свири, драги гости само за вас." ("On the guitar there's Vasko the frog, he's playing just for you, dear guests.") In September 2022, the song became globally known.
"Lolly Bomb" – an official music video by Russian rave band Little Big. It featured the fictional love story of Howard X, an impersonator of Kim Jong-Un, where he fell in love with a missile. The music video has amassed over 122 million views on YouTube.
"Manike Mage Hithe" – a viral cover of a Sri Lankan song, sung by Yohani and Satheeshan Rathnayaka. It has crossed 226 million views on YouTube and has received widespread recognition in Sri Lanka, India and abroad.
"Mesmerizer" – a 2024 Vocaloid song written by 32ki and sung by virtual singer Hatsune Miku and Kasane Teto. The song's music video was created by Japanese animator "channel". Focusing on the topic of escapism, the song has inspired multiple covers and Internet memes. As of 17 November 2024, the video received 100 million views on YouTube.
"Mine" – a viral song and meme by Bazzi. The video created the meme "You so fuckin' precious when you smile" from a lyric in the song. The song also peaked at number 11 on the Billboard Hot 100 and the music video has over 130 million views on YouTube.
OK Go music videos – several of the band's award-winning videos incorporate unique concepts, such as dancing on treadmills in "Here It Goes Again", a giant Rube Goldberg machine in "This Too Shall Pass", and a choreographed one-shot routine using over a dozen trained dogs in "White Knuckles". OK Go's videos often go viral within a few days of their release. Their music video for "The Muppet Show Theme Song" won a Webby Award for "Viral Video" in 2012.
"One Pound Fish" – a sales pitch song written and sung by Muhammad Shahid Nazir, a fish stall vendor in London, that became a viral hit and led to Nazir getting a recording contract.
"Pants on the Ground" – first sung by "General" Larry Platt during the season 9 auditions of American Idol in Atlanta, Georgia, on 13 January 2010. Within one week, the video had about 5 million views on YouTube, had over 1 million fans on Facebook, and was repeated on television by Jimmy Fallon and Brett Favre.
"Rappin' for Jesus" – a song by Pastor & Mrs. Jim Colerick. The video was made to promote a Christian youth outreach program. The video features the couple rapping about how to be a Christian. The video went viral because of the line "That's cause Jesus Christ is my nigga" which many took as a racial slur. Due to this and the strange nature of the video, it gained over 47 million views.
"Red Solo Cup" – Toby Keith's recording of a drinking song devoted to the Solo disposable cup became a viral hit, with the video logging over 49 million views on YouTube and the song eventually becoming Keith's biggest hit on the Billboard Hot 100.
"Shia LaBeouf Live" – a song by singer-songwriter Rob Cantor that depicts Shia LaBeouf as a cannibal who kills people for sport. Due to the ridiculous manner of the song, it went viral and accumulated over 57 million views.
"Sticking Out Your Gyat for the Rizzler" (also known as "Fanum Tax") – a 2023 musical parody by TikTok user ovp.9 of the 2021 song "ecstacy" by Suicidal-Idol and popularized by now defunct account papaboy020. The song has sometimes been considered "Generation Alpha's first big meme popularized beyond their demographic", because of its references to several other memes popular within them (such as Skibidi Toilet or the sigma male), and because the song has provoked several reactions among Generation Z netizens relating to their own age, worrying they are becoming "too old to keep up with Internet culture". The internet slang terms Rizz, Gyat, and Fanum Tax also achieved virality in their own right, popularised in part by American streamer and YouTuber Kai Cenat.
"Tenda Biru" – a song by Indonesian actress Desy Ratnasari that depicts her doing Mannequin Challenge. As of 2023, it has over 64 million views.
"Tiba-Tiba"
"Toy" – Israeli singer Netta Barzilai won the 2018 Eurovision Song Contest with this song. The song became viral and was played on many European radio stations. The video became the most watched video on the official Eurovision YouTube channel.
"United Breaks Guitars" – a video by the band Sons of Maxwell, recounting how United Airlines broke a guitar belonging to band member Dave Carroll. The video reached 11 million views, was named one of the top ten of 2009, and created speculation that it had caused a $180 million drop in the airline's stock value.
"What What (In the Butt)" – a viral music video set to a song about anal sex by gay recording artist Samwell. The video was posted on Valentine's Day 2007, and two weeks later had been viewed 500,000 times. It was subsequently parodied on the South Park episode "Canada on Strike", which poked fun at several other Internet memes and personalities.
Interpretations
"Kids with Down syndrome singing A Thousand Years" — A viral interpretation of A Thousand Years sung by kids with Down syndrome. The video was shared on Twitter by the song's author, Christina Perri. The video, which reached over 4.8 million views, was made for World Down Syndrome Day.
"Canon Rock" – A rock arrangement of Canon in D by JerryC that became famous when covered by funtwo and others.
"Hey Clip" – On August 24, 2005, 22-year-old Israeli female film school students in Ramle, Tasha (Lital) Mizel and Adi "Dishka" Frimmerman, uploaded a playful, entertaining lip-sync video of the song "Hey" by the Pixies, released on the band's Doolittle album in 1989. "There were no global ambitions when they shot the video in Mizel's bedroom during a sleepover ... they made the clip as a birthday present for Frimmerman's boyfriend," the Jerusalem Post said.
"Howard The Alien" – A green screen video of an alien dancing to Money Longer by Lil Uzi Vert. The original was uploaded to YouTube by the "3D Animation Land" channel in December 2017. It began gaining attention when an iFunny post combined the animation with Money Longer with the caption "imagine having sleep paralysis and seeing this as the foot of bed just fuckin breakin it down and you cant do anything about it like you hear the music in the back and everything bruh."
"I Dreamed a Dream" by Susan Boyle – In 2009, Boyle, an unknown singer, 47 at the time, auditioned for Britain's Got Talent with the song, surprising the jury, the public and the world with her interpretation. The programme received high ratings, and Boyle's performance was quickly added to sites such as YouTube, where millions viewed it in the first month alone.
"The Muppets: Bohemian Rhapsody" – A 2009 music video featuring The Muppets performing a modified version of Queen's "Bohemian Rhapsody". The video received over seven million hits within its first week of release on YouTube, and by 2012, it earned over 25 million hits. The video won the "Viral Video" category in the 14th Annual Webby Awards.
"Numa Numa" with Gary Brolsma, a video of Romanian song "Dragostea Din Tei" by O-Zone. The video, released December 6, 2004, on Newgrounds.com, shows Brolsma lip syncing the hit song with lively gesticulations and dance moves.
"Pop Culture" – A 2011 YouTube video of a live mash-up by the musician Hugo Pierre Leclercq aka "Madeon", age 17 at the time, using a Novation touchpad to mix samples from 39 different songs. The video went viral within a few days of being posted, and led to Leclercq's fame in the electronica music genre.
"Rabbit Hole" – A 2023 Vocaloid song by Deco*27. A derivative work of the song went viral in 2024.
"Redbone" by girl selling Girl Scout cookies – A video by a 6-year-old girl and her father trying to sell Girl Scout cookies. The popularity of the song led to sales of her cookies skyrocketing. The girl appeared on The Late Show with Stephen Colbert with the artist of the original song, Donald Glover.
"Space Oddity" by Canadian astronaut Chris Hadfield – Performed and recorded during a space mission on Soyuz TMA-07M. The cover of the famous David Bowie song is set in zero gravity against spectacular views of Earth with Hadfield singing and playing the guitar. The video generated a great deal of media exposure.
"Twelve Days of Christmas" by a cappella group Straight No Chaser went viral in 2007 and led to the group being signed by Atlantic Records.
"We Are the World 25 for Haiti (YouTube edition)" is a massively collaborative crowdsourced charity video, involving 57 geographically distributed unsigned or independent contributors. It was produced by Canadian singer-songwriter and YouTube personality Lisa Lavie to raise money for victims of the 2010 Haiti earthquake. The video received repeated coverage on CNN, and its participants were collectively named ABC News "Persons of the Week" by television journalist Diane Sawyer in March 2010.
"Yodeling Walmart Boy" — A video of Mason Ramsey yodeling to Lovesick Blues in his local Walmart. The song and video went viral and led him to become a celebrity. This version made the original song peak at number 3 on the Spotify Top 50 viral charts. The song also led Mason to be on The Ellen DeGeneres Show, have a concert at his own Walmart, and perform at the Coachella Valley Music and Arts Festival.
"Xue hua piao piao bei feng xiao xiao" — A selfie video of a bald Chinese man singing the chorus verse of Fei Yu-ching's song Yi jian mei in a snowy background, first uploaded to Kuaishou in January 2020. Shared to Western social media, it quickly went viral on TikTok and Spotify by May 2020, leading to various covers and spoofs.
"Marhaban Tiba" — A viral interpretation of "Ramadan Tiba" sung by Indonesian singer Iis Dahlia.
Ads and campaigns
"Dumb Ways to Die" – A music video featuring "a variety of cute characters killing themselves in increasingly idiotic ways" that went viral through sharing and social media. It was part of a public service announcement advertisement campaign by Metro Trains in Melbourne, Australia to promote rail safety.
Mandatory Fun album and the #8days8videos campaign – A viral marketing campaign by comedy singer/songwriter "Weird Al" Yankovic to promote his 2014 album Mandatory Fun. He released eight videos for the new album over eight consecutive days across different streaming providers. The approach was considered very successful, leading to the album becoming Yankovic's first number one hit in his 32-year career. It also became the first comedy album to hit Number 1 on the Billboard charts in over 50 years.
Beat Energy Gap – A 2017 advertisement originally produced by Nestlé Philippines to promote the product MILO, with actor James Reid as the endorser. The success of the advertisement and the song's catchy lyrics and upbeat theme led many internet users to make parodies featuring the song, one notable example being remixing K-pop videos to the song.
Dance phenomena
"Crank That (Soulja Boy)" – Debut single by American rapper Soulja Boy (2007) accompanied by the "Soulja Boy dance". The song is recognized by its looping steel drum riff. The song peaked at number one on the Billboard Hot 100. As of February 2018, the video had over 330 million views on YouTube.
"STOOPID (6ix9ine)" – Single by American rapper 6ix9ine, accompanied by the "STOOPID dance". The song was used in many memes, and also became a viral dance challenge on TikTok.
Dame Tu Cosita – A viral dance song made by Panamanian rapper El Chombo that originated on social media platform Musical.ly. The video features a green alien dancing. It is accompanied with the #DameTuCosita challenge, which features people trying to recreate the dance.
"Dancing Banana" – An animated banana dancing to the song "Peanut Butter Jelly Time" by the Buckwheat Boyz.
Ghetto Kids of Uganda dancing "Sitya Loss" – A viral song of Ugandan singer Eddy Kenzo. It featured four Ugandan boys – Alex Ssempijja, Fred and Isaac Tumusiime, and Bashir Lubega – and a girl, Patricia Nabakooza, dancing improvised moves in a competitive manner. The video, made by Big Talent Entertainment and JahLive Films, was directed by Mugerwa Frank.
Hampster Dance – A page filled with hamsters dancing, linking to other animated pages. It spawned a fictional band complete with its own CD album release.
Harlem Shake – A video based on Harlem shake dance, originally created by YouTube personality Filthy Frank and using an electronica version of the song by Baauer. In such videos, one person is dancing or acting strangely among a room full of others going about routine business, until after the drop and a video cut, when everyone starts dancing or acting strangely. Attempts to recreate the dance led to a viral spread on YouTube.
"Hit the Quan" — A viral song by iLoveMemphis that started the #HitTheQuanChallenge, resulting in people dancing to the video. The song peaked at number 15 on the Billboard Hot 100. The music video reached over 57 million views on YouTube.
"Indian Thriller" – A viral scene from the Indian film Donga, with added subtitles phonetically approximating the original lyrics as English sentences.
"In My Feelings"— A 2018 song by Drake. It went viral thanks to the "In My Feelings Challenge" (also known as the Do The Shiggy Challenge). The challenge was replicated by many celebrities, such as football player Odell Beckham Jr., actor Will Smith, hosts Kelly & Ryan from the talk show Live with Kelly and Ryan, and many others. The popularity of the dance challenge led to the song reaching the top of the Billboard Hot 100.
JK Wedding Entrance Dance – The wedding procession for Jill Peterson and Kevin Heinz of St. Paul, Minnesota, choreographed to the song Forever by Chris Brown. The video reached 1.75 million views on YouTube in less than five days in 2009. The video was later imitated in an episode of The Office on NBC.
"Juju on That Beat (TZ Anthem)" – A viral song and meme made by two Detroit teenagers, Zay Hilfigerrr & Zayion McCall. Many people have tried to replicate their dance moves, with the #TZAnthem Challenge. The song charted on the Billboard Hot 100, peaking at number 5.
Little Superstar – A video of King kong, a short Indian actor, break-dancing to MC Miker G & DJ Sven's remix of the Madonna song "Holiday", in a clip from a 1990 Tamil film, Adhisaya Piravi, featuring actor Rajnikanth.
Passinho do Romano – The dance was born in the east of São Paulo, Brazil, known initially as Passinho do Romano because it was created in Jardim Romano in the region of Itaim Paulista. The dance consists of light steps, with soft uses of heels, free arms with break, dubstep, robot steps and funk.
"Rolex" – Viral song made by duo Ayo & Teo. The song is accompanied with the #RolexChallenge, which features people trying to replicate the dance. The song peaked at number 20 on the Billboard Hot 100, and has over 350 million views.
Scooby Doo Papa — A viral song and dance video made by New York disc jockey DJ Kass. Many people have tried to recreate the dance on social media. The song peaked at number 9 on the Billboard Hot Latin chart.
"Skibidi" – A song and viral music video by Russian rave band Little Big. The release sparked a dance craze in part due to the "Skibidi Challenge" issued by the band. The video went viral days after release, gaining 28 million views in two weeks.
Techno Viking – A Nordic raver dancing in a technoparade in Berlin.
"Thriller" by the CPDRC Dancing Inmates – A recreation of Michael Jackson's hit single "Thriller" performed by prisoners at the Cebu Provincial Detention and Rehabilitation Center (CPDRC) in the Philippines. In January 2010, it was among the ten most popular videos on YouTube, with over 20 million views.
Music phenomena
Anime Music Videos/MADs – A staple of anime conventions both in Japan and Western countries, these fan-made videos take footage from other anime works and re-edit them in separate order, adding new soundtracks (including to full-length songs), and making other manipulations such as lip-syncing characters to lyrics. With the propagation of the Internet and popularity of anime in the United States in 2003, this type of user-created content was extended to include footage from other works, including video games and Western/American animation.
80s remix – A series of videos in which contemporary pop music is reinterpreted as songs released during the 1980s.
Sergey Stepanov, aka Epic Sax Guy – A Moldovan musician who quickly gained Internet attention after performing in the Eurovision Song Contest 2010 as part of the SunStroke Project. The performance of Stepanov miming a saxophone solo of Moldova's entry has been remixed and looped for ten hours. The group embraced the Internet attention and mentioned 'Epic Sax Guy' in some of their singles, including a single called 'Epic Sax'. In the 2017 contest, SunStroke Project returned with Stepanov, who later played the signature riff live during an interview.
Hurra Torpedo – A Norwegian band whose coast-to-coast tour was a viral campaign to promote the Ford Fusion car.
Lip dub – Although lip dubbing in music videos was not a new concept, Jake Lodwick, the co-founder of Vimeo, coined the term "lip dubbing" on December 14, 2006, in a video titled Lip Dubbing: Endless Dream. Lodwick subsequently directed the "Flagpole Sitta" "office lip dub" in April 2007, which The Washington Post covered. Since then, dozens of lip dubs have been coordinated around the world by students. After L'Université du Québec à Montréal (UQAM) produced a lip dub to The Black Eyed Peas' "I Gotta Feeling" in 2009, the video phenomenon gained international acclaim.
Lucian Piane, aka RevoLucian – Created several popular celebrity techno remixes, including a spoof of actor Christian Bale titled "Bale Out".
Literal music video – Covers of music videos in which the original lyrics have been replaced with lyrics that literally describe the events in the video, typically disconnected with the original lyrics of the song.
Nightcore – A type of music that started as a subgenre of trance, nightcore is characterized by a sped-up melody (sometimes), fast rhythmic beat (usually), and always higher than normal pitch. Almost all nightcore works are original songs remixed by fans. Nightcore, introduced in 2002, began its spread to the internet in mid-2005.
"Pink Season" – An album by artist and YouTube personality Filthy Frank, under his "Pink Guy" persona. The album consists of various tracks that are often overly vulgar and comedic. The album went viral on its release and soared to the top of the iTunes charts.
Rickrolling – A phenomenon involving posting a URL in an Internet forum that appears to be relevant to the topic at hand, but is actually a link to a video of Rick Astley's "Never Gonna Give You Up". The practice originated on 4chan as a "Duckroll", in which the link was to an image of a duck on wheels. The practice of Rickrolling became popular after April Fools' Day in 2008, when YouTube rigged every feature video on its home page to Astley's video.
"Sandstorm" – A phenomenon involving answering a question about a song's name, in the comments to a YouTube video, with Darude's 1999 song "Sandstorm", no matter what the song in the video is.
"You Reposted in the Wrong Neighborhood " – A mashup by SHOKK 青 of "Shake That" by Eminem featuring Nate Dogg and Casin by glue70. The song went viral when the remixes' instrumental was put to other songs.
009 Sound System – An electronic music project by Alexander Perls that gained popularity on YouTube after its implementation of the AudioSwap system on the website, which replaced copyrighted music with a Creative Commons licensed track. Since the track names were in alphabetical sorting, 009 Sound System tracks were first on the list, which made them the most used. Popular tracks included "With a Spirit", "Dreamscape", "Holy Ghost", "Space and Time" and others. During the AudioSwap era of YouTube, users reacted negatively to these songs being very frequent on the site, but in YouTube's later days, "With a Spirit" became for many users the site's unofficial anthem.
Others
"All Star" – A song by rock band Smash Mouth known for its appearance in the 2001 film Shrek and its opening line "Somebody once told me". The song became a meme often associated with Shrek. The song has also been a large part of mashup culture, often being mashed up with various songs. The band has embraced the song's memes.
"Baby I'm Yours" – A song by Breakbot typically coupled with "Ladies and Gentlemen, We Got Him", a quote originally uttered by American diplomat Paul Bremer during a 2003 press conference announcing the capture of Saddam Hussein. The song began to be widely used in various remixes on YouTube paired with clips of people being apprehended or caught off-guard in some fashion, often in the context of FBI operations or ligma jokes.
"Big Enough" – An EDM country song by Kirin J. Callinan. The music video for the song portrays Jimmy Barnes as a giant screaming cowboy in the sky. The video went viral when the sound of Barnes screaming was put over other screams in pop culture.
"Chum Drum Bedrum" – A video of Russian singer Vitas performing the 7th Element. The video went viral due to Vitas singing gibberish such as "Blr ha ha ha", which led to Vitas being known as "The Weird Russian Singer".
"Father Stretch My Hands Pt. 1" – A song by rapper Kanye West. Metro Boomin's signature producer tag, "If Young Metro don't trust you I'm gonna shoot ya" and entrance inspired various Vines and memes, usually involving somebody shooting a gun.
"Fireflies" – A 2009 song by Owl City that in May 2017 was revived as a meme in which the song would play in random clips. The song received further notability in June 2017 when Owl City was asked to interpret the lyric "I get a thousand hugs from 10,000 lightning bugs."
"For The Damaged Coda" – A 2000 song from alternative rock band Blonde Redhead, popularlized by animated television series Rick And Morty, spawned memes after the song was placed over sad moments in popular culture.
"Lazy Sunday" – A 2005 Saturday Night Live sketch written and performed by Andy Samberg and Chris Parnell in which the two engage in a hip-hop song about their plans for a lazy Sunday afternoon. The song was uploaded by fans to YouTube, at that time a relatively small, new site, and was watched by millions of users before it was taken down as a copyright violation by NBC. This created the idea of being able to provide reuse of television material on the Internet, giving shows a second life, and is said to have established YouTube as a potential revenue source for television networks, contributing toward Google's purchase of the site for $1.6 billion in 2006.
"Little Dark Age" – A 2018 song by American rock band MGMT. Starting late 2020, the song saw a surge in popularity due to remixes and samples being used in a series of video edits featuring themes of politics, social justice, war, and history.
"Man's Not Hot" – A freestyle rap by British comedian Michael Dapaah. The freestyle features Dapaah saying unintelligible phrases and words that made the video into a meme, which was remixed with various songs.
"Mooo!" – A 2018 novelty song by American rapper Doja Cat, who sings, "Bitch I'm a cow / I'm not a cat / I don't say meow". The music video, filmed with a green screen made out of a bed sheet, gained over 72 million views on YouTube.
"Nyan Cat" – A video of an animated cat running through space, accompanied with a UTAU song whose lyrics are simply "Nyanyanyanyanyanyanya!". The video went viral after bloggers started reposting the song.
"Pokemon Go Song" – A song by YouTube personality Mishovy Silenosti about the augmented reality mobile game Pokémon Go. The video surpassed 2.5 million views and became one of the most disliked YouTube videos.
"Pokémon Theme Music Video" – A video featuring Ian Hecox and Anthony Padilla lip syncing to the original English Pokémon theme song. The video became the most viewed video on YouTube at the time before it was removed. The success of their Pokémon video and other videos led Smosh to be featured in the "Person of the Year: You" issue of Time Magazine, published December 13, 2006 and on Time.com.
"PPAP (Pen-Pineapple-Apple-Pen)" – A Japanese earworm-style music video performed by Pikotaro.
"Redbone" – A 2016 song by music artist Childish Gambino. In early 2017, the song became a popular meme consisting of various remixes of the song to fit a certain theme.
"Rose's Turn" – a song from the 1959 musical Gypsy. The song later saw a resurgence in 2024 where a version of the song covered in the TV show Glee saw usage on the social media platform TikTok.
"Shooting Stars" – A 2009 song by Australian band Bag Raiders that went viral in 2017. The song is usually accompanied with people falling with surreal, spacey backgrounds. The meme has since been acknowledged by the band.
"Super Max!" – A 2016 song by Dutch Max Verstappen fan group The Pitstop Boys. The song and music video gained popularity during Verstappen's 2021 title run in Formula One.
"Surrender to Me" – A song recorded, but never released, by former Boston drummer William "Curly" Smith in 1978. In January 2022, Curly's son, Zach, discovered the song and posted a video on TikTok about the discovery. After it gained popularity, Zach and Curly released "Surrender to Me" as a single under the name "FireCityFunk" in February 2022. They performed the song on Jimmy Kimmel Live!.
Trololo – A 1976 televised performance of Russian singer Eduard Khil lip syncing the song I Am Glad to Finally Be Home (Я очень рад, ведь я, наконец, возвращаюсь домой). The video's first mainstream appearance was on The Colbert Report, on 3 March 2010; since then, its popularity has escalated, occasionally being used as part of a bait-and-switch prank, similar to Rickrolling.
To Be Continued – A series of short clips set to "Roundabout" by the progressive rock band Yes culminating with a "To Be Continued" card for humorous effect. This is parody of a standard ending of the anime JoJo's Bizarre Adventure.
"Tunak Tunak Tun" – A 1998 song by Indian artist Daler Mehndi. The music video of the song features multiple images of Mehndi green screened over computer-generated landscape images. This was done because critics complained that Mehndi's music was popular only because his music videos featured beautiful women dancing. Mehndi's response was to create a video that featured only himself.
"What I've Done" – A 2007 song by American rock band Linkin Park. It became an internet meme in 2022 when the song was used as a template for various films "but [if] it came out in 2007", inspired by its usage in the closing scene of the 2007 science fiction film Transformers.
"When Mama Isn't Home" – A video of a father playing trombone and a son playing an oven door to the song 'Freaks' by Timmy Trumpet and the rapper Savage. The October 2014 video went viral on Vine and YouTube. The father and son appeared on morning TV talk shows and traveled to Europe to film a TV commercial for Hewlett Packard. The song reached the Billboard viral charts Top 10, 6× platinum status in Australia and number 1 in Savage's home country, New Zealand.
"We Are Number One"– A 2014 song by Stefán Karl Stefánsson (in character as Robbie Rotten) from the children's show LazyTown. In late 2016, the song went viral after Stefánsson was diagnosed with pancreatic cancer.
The Most Mysterious Song on the Internet – A New wave song that aired on a German radio station in 1984, thought to originate from a European band. Who created this song and the song's name in question is unknown. The mission to find the song gained popularity in 2019 after a Brazilian Reddit user asked the website if they knew of the song's origins.
Cbat – A 2011 song that became popular after a Reddit user stated that he used the song during sex and his girlfriend was turned off by it.
See also
Internet meme
List of Internet phenomena
List of viral videos
Viral marketing
References
Viral videos
viral
-2 | List of viral music videos | [
"Technology"
] | 10,851 | [
"Computing-related lists",
"Internet-related lists"
] |
52,050,132 | https://en.wikipedia.org/wiki/Chemical%20bombing%20of%20Sardasht | On 28 June 1987, Iraq dropped mustard gas bombs on Sardasht, West Azerbaijan, Iran. In two separate bombing runs on four residential areas, the attack killed 130 people and injured 8,000. The gas attacks occurred during the Iran–Iraq War when Iraq frequently used chemical weapons against Iranian civilians and soldiers.
In 2006, a quarter of the town's 20,000 residents were still experiencing severe illnesses from the attacks. The film Walnut Tree (2020) was inspired by the event.
Background
In 1986, the President of the Security Council of the United Nations stated that the Council members were "profoundly concerned by the unanimous conclusion of the specialists that chemical weapons on many occasions have been used by Iraqi forces against Iranian troops ... [and] the members of the Council strongly condemn this continued use of chemical weapons in clear violation of the Geneva Protocol of 1925, which prohibits the use in war of chemical weapons." The United States voted against the issuance of this statement.
Mustard gas is not considered a lethal agent but an incapacitating agent, causing only 3–5% mortality.
Immediate effects
Because Sardasht was not considered a military target, the population was both unprotected and unprepared for a chemical weapons assault. Living close to the border and the war front, citizens had become accustomed to Iraqi bombardment with conventional weapons. However, people later told physicians that they did not know that the bombs carried chemical weapons; in fact, at first, they had been relieved when the bombs did not explode.
Due to the direction of the wind, the hospital and convalescent center were contaminated, and the few doctors and nurses who were working there had to leave. Two public baths were used for decontamination of the victims, and a small stadium was converted into a 150-bed medical facility. About 30 people, mostly young children and old people, died within a few hours of the attack due to severe respiratory problems.
Aftermath
Out of 12,000 inhabitants, according to official reports, 8,000 were exposed. Of the 4,500 requiring medical care, 1,500 were hospitalized, 600 of them in Tehran. The other 3,000 were treated as outpatients and discharged. Many of these 3,000 victims left the city for the villages and attempted to treat themselves using traditional medicines; the lack of documentation of their exposure and treatment lead to difficulty in obtaining government benefits.
Included among the 4,500 casualties requiring medical attention were some of the rescuers.
By 2007, 130 people (109 civilians, 21 military) had died as a result of the attack. Of the civilians who died, 39 were under 18 years of age, including 11 under the age of 5, and 34 were women or girls.
Many of the 95% who survived the Sardasht gas attack developed serious long-term complications over the next few years, including serious respiratory problems, eye lesions, skin problems, and immune system problems.
Response
Iran announced this (chemical) assault on Sardasht as an inhumane attack and named Sardasht as the first city which was the victim of chemical armament in the world after the Atomic bombings of Hiroshima and Nagasaki.
In April 2004, the Tehran Public Court ruled that the United States government was liable for the attacks due to its support of Saddam Hussein's government. The US government was ordered to pay $600 million compensation to the victims.
On 28 June 2004, in commemoration of the martyrs of the chemical bombing of Sardasht and the anniversary of the National day of the fight against weapons of mass destruction, one of the streets of Sardasht was named Hiroshima. A Japanese delegation from Nagasaki and Hiroshima talked at the ceremony. 111 white pigeons were released into the sky at the site of the victims. In the city of Hiroshima, a street is named after Sardasht, and every year the mayor of Hiroshima sends a message on the occasion of 28 June, and a group of Iranian NGO related to chemical disarmament travel to Japan to participate in the anniversary of the Hiroshima bombing. Iranian NGOs also has the annual exhibition in The Hague, the Netherlands, liaising with associations of victims of weapons of mass destruction in other countries, establishing a peace museum focusing on the effects of chemical weapons, membership in the International Network of Peace Museums, participation in the anniversary of Hiroshima and Nagasaki in Japan.
See also
Sardasht, West Azerbaijan
Iraq chemical attacks against Iran
Chemical attack on Behbahan battalion
War of the Cities (of Iran-Iraq war)
Halabja chemical attack
Disabled Iranian veterans
Iraqi chemical weapons program
References
Iraqi chemical weapons program
Chemical weapons attacks
Iraqi war crimes
Military operations involving chemical weapons during the Iran–Iraq War
Sardasht County
Disability in Iran
Military operations of the Iran–Iraq War in 1987
June 1987 events in Asia
1987 in Iran
Mass murder in 1987
20th-century mass murder in Iran
History of West Azerbaijan province | Chemical bombing of Sardasht | [
"Chemistry"
] | 983 | [
"Chemical weapons attacks",
"Chemical weapons"
] |
52,050,665 | https://en.wikipedia.org/wiki/Orwell%20%28video%20game%29 | Orwell is a series of episodic simulation video games by indie developer Osmotic Studios in which the player assumes the role of a state operative and monitors surveillance sources to find national security threats.
Overview
Orwell was created by German developer Osmotic Studios. The series is named after George Orwell, the author of the dystopian novel Nineteen Eighty-Four, references to which can be found throughout the game. The first game in the series, subtitled 'Keeping an Eye on You', was released as a five-part episodic series on October 20, 2016. A three-part sequel subtitled 'Ignorance is Strength' was released February 22, 2018.
Plot
Orwell takes place in a country called The Nation, led by a paternalistic and authoritarian government known as The Party in the capital of Bonton. In 2011, The Party passed the Safety Bill, a law expanding the government's ability to spy on its citizens in the name of national security. As part of the bill the Ministry of Security, led by Secretary of Security Catherine Delacroix, commissioned a covert surveillance system codenamed Orwell.
The player takes the role of an Orwell investigator outside of The Nation, who has just been selected to use the system. Each episode takes place over one in-game day.
Orwell: Keeping an Eye on You (2016)
Orwell: Ignorance is Strength (2018)
A sequel, entitled Orwell: Ignorance is Strength, was announced in August 2017.
Reception
Orwell received an aggregate score of 77/100 on Metacritic, indicating generally favorable reviews. The first season was reviewed and generally well-received by multiple gaming news outlets. Destructoid considered it a potential game of the year, calling it "a fantastic nail-biter, taking all the best parts of Person of Interest, The Conversation, The Lives of Others, and putting them in a post-Snowden world." Polygon lauded the game for making a "thrilling adventure" from "how we balance our own liberty and our safety", particularly the dilemmas the game presents. GameSpot also liked that "choices matter and resonate", and praised how the game "uses simple mechanics to tell a complex and engaging story, one that feels particularly relevant". The Verge described that the game's "uncomfortable" decisions became a "selling point", saying that "it’s rare for a game to put you in such a morally compromising position".
However, Rock Paper Shotgun said that the game "takes a significant bite out of the thrill of the snoop" because "the actual research is severely limited", and "the sense of achievement is mightily diminished". PC Gamer also criticized the game because "you don't do much actual investigation", and "the drama hangs on you deciding between two conflicting pieces of information—a gut instinct guess, with no way to further your understanding of the situation". Game Informer was even more critical of the game, saying that they did not find Orwell's treatment of surveillance and terrorism compelling, and that the game is "simply content to repeat what novels and films have more eloquently".
The follow-up Ignorance is Strength received an aggregate score of 74/100 on Metacritic, suggesting "mixed or average reviews". Destructoid said "Orwell continues to be a solid thriller" and "the fact it’s got me thinking at all is a success in itself." However, GameSpot said that the sequel "does not leave as strong an impression as the first game did, even if the central mechanics are still inherently compelling". Rock Paper Shotgun criticized the pacing of the episodes, and that the game's introduction was not very interesting.
References
External links
Osmotic Studios
2016 video games
Dystopian video games
Episodic video games
Indie games
Single-player video games
Video games about computing
Video games developed in Germany
Fellow Traveller Games games
Windows games
Video games about mass surveillance
George Orwell
Linux games
MacOS games
Video games set in 2017
Android (operating system) games
IOS games | Orwell (video game) | [
"Technology"
] | 832 | [
"Works about computing",
"Video games about computing"
] |
52,050,918 | https://en.wikipedia.org/wiki/Poisoning | Poisoning is the harmful effect which occurs when toxic substances are introduced into the body. The term "poisoning" is a derivative of poison, a term describing any chemical substance that may harm or kill a living organism upon ingestion. Poisoning can be brought on by swallowing, inhaling, injecting or absorbing toxins through the skin. Toxicology is the practice and study of symptoms, mechanisms, diagnoses, and treatments correlated to poisoning.
Levels of Exposure
When a living organism is introduced to a poison, the symptoms that follow successful contact develop in close relation to the degree of exposure.
Acute exposure
Acute toxicity/poisoning consists of a living organism being harmfully exposed to poison once or more times during a brief period, with symptoms manifesting within 14 days since administration.
Chronic exposure
Chronic toxicity/poisoning involves a living organism being exposed to a toxin on multiple instances over an extended period of time, whereas the symptoms either develop gradually or after a protracted latent period. Chronic poisoning most commonly occurs following exposure to poisons that bioaccumulate, or are biomagnified, such as mercury, gadolinium, and lead.
Methods of Poisoning
Accidental poisoning
In 2020, America's Poison Centers' NPDS (National Poison Data System) report determined that 76.9% of recorded toxin exposures were accidental, with the rest of the statistics either being deliberate or unexpected. A large portion of these accidental incidents occurred due to mistakenly taking the incorrect medicine, or doubling one's dose by mistake.
Industry and Warfare
Nerve gases are synthetic substances used in industry or warfare that are specifically engineered to bring harm to living organisms. They may paralyze a person in a matter of seconds or cease organ function, quickly resulting in death.They're considered to be biologically derived neurotoxins, which are a genre of toxic agents that act specifically against the nervous system. Inhaled or ingested cyanide (or Zyklon B) was used as a method of execution in gas chambers. This method of poisoning instantly starved the body of energy by inhibiting the enzymes in mitochondria that produce ATP. Intravenous injection of an unnaturally high concentration of potassium chloride, such as in the execution of prisoners in parts of the United States, quickly stops the heart by eliminating the cell potential necessary for muscle contraction.
Pesticide exposure
Most biocides, including pesticides, are created to act as poisons to target organisms. Although acute or less observable chronic poisoning can also occur in non-target organisms (secondary poisoning), including the humans who apply the biocides and other beneficial organisms. For example, the herbicide 2,4-D imitates the action of a plant hormone, which makes its lethal toxicity specific to plants. Indeed, 2,4-D is not a poison, but is classified as harmful.
Toxication
Many substances regarded as poisons are toxic only indirectly through toxication. An example is "wood alcohol" or methanol, which is not poisonous itself but is chemically converted to toxic formaldehyde and formic acid once it reaches the liver. Many drug molecules are made toxic in the liver, and the genetic variability of certain liver enzymes makes the toxicity of many compounds differ between people.
Precautionary Measures
As mandated in GHS, various safety-orientated government agencies from around the globe have put into place the usage of pictograms when labelling toxic substances. The hazard symbol which labels a substance as capable of poisoning depicts the imagery of a human skull in front of two bones crossing one another.
GHS precautionary statements, which advise users to exercise caution or be aware of the substance's potentially dangerous features, are added to a legal toxins' labelling. Toxic substances can also come with instructions on how to handle the product, what compounds to avoid mixing the product with, and how to treat a victim at risk of poisoning who has come in contact with the product.
Various poison control centers are also available to assist in diagnosing, managing, and preventing possible incidents of poisoning. Many are accessible through phone calls or official websites.
Treatment
Seeking medical attention is strongly advised if someone is thought to have been exposed to or consumed a poison, mainly from a nearby poison control centre. It is advised to provide medical personnel with information regarding the poisoning, the patient's age, weight, and any other drugs they may be taking in addition to the symptoms of the illness. Try to determine what was ingested, the amount and how long since the person was exposed to it. If possible, have on hand the pill bottle, medication package or other suspect container.
The treatment will depend on the substance to which the patient is exposed. Depending on the type of poisoning, some first aid measures may help. Treatments include activated charcoal, induction of vomiting and dilution or neutralizing of the poison.
See also
EPA list of extremely hazardous substances
Lists of poisonings
List of poisonous plants
List of types of poison
Toxicity
Opioid epidemic in the United States
References
External links
Toxicology
Poisons
Killings by type | Poisoning | [
"Environmental_science"
] | 1,030 | [
"Poisons",
"Toxicology"
] |
61,162,657 | https://en.wikipedia.org/wiki/C20H11N2Na3O10S3 | {{DISPLAYTITLE:C20H11N2Na3O10S3}}
The molecular formula C20H11N2Na3O10S3 (molar mass: 604.47 g/mol, exact mass: 603.9269 u) may refer to:
Amaranth (dye)
Ponceau 4R | C20H11N2Na3O10S3 | [
"Chemistry"
] | 76 | [
"Isomerism",
"Set index articles on molecular formulas"
] |
61,162,823 | https://en.wikipedia.org/wiki/C18H16N2O3 | {{DISPLAYTITLE:C18H16N2O3}}
The molecular formula C18H16N2O3 (molar mass: 308.3329 g/mol) may refer to:
Amfonelic acid
Citrus Red 2
Roquinimex
Molecular formulas | C18H16N2O3 | [
"Physics",
"Chemistry"
] | 61 | [
"Molecules",
"Set index articles on molecular formulas",
"Isomerism",
"Molecular formulas",
"Matter"
] |
61,163,125 | https://en.wikipedia.org/wiki/C11H11Cl2N | {{DISPLAYTITLE:C11H11Cl2N}}
The molecular formula C11H11Cl2N (molar mass: 228.118 g/mol, exact mass: 227.0269 u) may refer to:
Amitifadine
DOV-102,677
DOV-216,303
Molecular formulas | C11H11Cl2N | [
"Physics",
"Chemistry"
] | 73 | [
"Molecules",
"Set index articles on molecular formulas",
"Isomerism",
"Molecular formulas",
"Matter"
] |
61,163,346 | https://en.wikipedia.org/wiki/Pilar%20Bayer | Pilar Bayer Isant (born 1946) is a Spanish mathematician specializing in number theory. She is a professor emerita in the Faculty of Mathematics and Computer Science of the University of Barcelona.
Education and career
Bayer was born in Barcelona on February 13, 1946.
Before becoming a mathematician, she was certified as a piano teacher by the Municipal Conservatory of Barcelona in 1967.
She graduated from the University of Barcelona in 1968, and completed her Ph.D. there in 1975. Her dissertation, Extensiones maximales de un cuerpo global en las que un divisor primo descompone completamente, was jointly supervised by Rafael Mallol Balmaña and Jürgen Neukirch. She was one of the first two women to earn a Ph.D. from the university; the other was her high school teacher.
She was an assistant at Universität Regensburg from 1977 to 1980.
After briefly working for the University of Santander and Autonomous University of Barcelona, she joined the faculty at the University of Barcelona in 1982. She retired in 2016.
Contributions
With Montserrat Alsina, Bayer is the author of the book Quaternion Orders, Quadratic Forms, and Shimura Curves (American Mathematical Society, 2004).
As well as quaternion algebras, Eichler orders, quadratic forms, and Shimura curves (the subject of the book), other topics in her research include automorphic forms, diophantine equations, elliptic curves, modular curves, and zeta functions.
Beyond number theory, with Jordi Guàrdia and Artur Travesa she is the author of Arrels germàniques de la matemàtica contemporània: amb una antologia de textos matemàtics de 1850 a 1950 (Institut d'Estudis Catalans, 2012), on the history of mathematics in Germany from the mid-19th century to the mid-20th century. In total she is an author or editor of 19 books.
Recognition
Bayer won the Narcís Monturiol Medal of the Generalitat de Catalunya in 1998.
Her book Arrels germàniques de la matemàtica contemporània: amb una antologia de textos matemàtics de 1850 a 1950 won the Serra d'Or Critic's Prize in 2013.
She was Emmy Noether Visiting Professor at the University of Göttingen in 2004.
She is an academician of the Spanish Royal Academy of Sciences, the , the Royal Academy of Sciences and Arts of Barcelona, and the Institute for Catalan Studies.
In honor of her 70th birthday, the University of Barcelona published a two-volume edition of her selected works in 2016.
References
Living people
20th-century Spanish mathematicians
Spanish women mathematicians
University of Barcelona alumni
Academic staff of the University of Barcelona
Number theorists
Historians of mathematics
1946 births
21st-century Spanish mathematicians | Pilar Bayer | [
"Mathematics"
] | 583 | [
"Number theorists",
"Number theory"
] |
61,164,045 | https://en.wikipedia.org/wiki/C16H14O7 | {{DISPLAYTITLE:C16H14O7}}
The chemical formula C16H14O7 can refer to:
Cedeodarin
1,3-Dihydroxy-2,4,7-trimethoxyxanthone
1,6-Dihydroxy-3,4,7-trimethoxyxanthone
1,8-Dihydroxy-3,4,7-trimethoxyxanthone
Filifolin
Lecanoric acid
8-Methoxyeriodictyol
Mycochromone
Padmatin
Ulocladol | C16H14O7 | [
"Chemistry"
] | 125 | [
"Isomerism",
"Set index articles on molecular formulas"
] |
61,164,204 | https://en.wikipedia.org/wiki/Large%20number%20of%20rare%20events | In statistics, large number of rare events (LNRE) modeling summarizes methods that allow improvements in frequency distribution estimation over the maximum likelihood estimation when "rare events are common".
It can be applied to problems in linguistics (see Zipf distribution), in various natural phenomena, in chemistry, in demography and in bibliography, amongst others.
References
Frequency distribution | Large number of rare events | [
"Mathematics"
] | 76 | [
"Mathematical objects",
"Functions and mappings",
"Mathematical relations",
"Frequency distribution"
] |
61,164,975 | https://en.wikipedia.org/wiki/C16H17N3O3 | {{DISPLAYTITLE:C16H17N3O3}}
The molecular formula C16H17N3O3 (molar mass: 299.325 g/mol, exact mass: 299.1270 u) may refer to:
Amonafide
Menitrazepam
Molecular formulas | C16H17N3O3 | [
"Physics",
"Chemistry"
] | 65 | [
"Molecules",
"Set index articles on molecular formulas",
"Isomerism",
"Molecular formulas",
"Matter"
] |
61,165,805 | https://en.wikipedia.org/wiki/Toxic%20vacuolation | Toxic vacuolation, also known as toxic vacuolization, is the formation of vacuoles in the cytoplasm of neutrophils in response to severe infections or inflammatory conditions.
Clinical significance
Toxic vacuolation is associated with sepsis, particularly when accompanied by toxic granulation. The finding is also associated with bacterial infection, alcohol toxicity, liver failure, and treatment with granulocyte colony-stimulating factor, a cytokine drug used to increase the absolute neutrophil count in patients with neutropenia.
The formation of toxic vacuoles represents increased phagocytic activity, which is stimulated by the release of cytokines in response to inflammation or tissue injury. Toxic vacuolation frequently occurs in conjunction with toxic granulation and Döhle bodies in inflammatory states, and these findings are collectively referred to as toxic changes. Neutrophilia and left shift (the presence of immature neutrophil precursors such as band neutrophils and metamyelocytes in the peripheral blood) often accompany toxic changes, as these phenomena also occur in response to inflammation.
It has been suggested that neutrophil vacuoles not be labelled "toxic vacuoles" unless they are accompanied by other toxic changes, as vacuolation can occur in other conditions.
Similar conditions
Vacuoles may form in neutrophils if a blood sample is left standing for several hours prior to blood smear preparation, but this is an artifactual change with no clinical significance. Artifactual vacuoles are small and of uniform size and distribution, in contrast to toxic vacuoles whose size and placement are variable. Individuals with neutral lipid storage disease may exhibit persistent lipid-filled vacuoles in neutrophils and other granulocytes, which is a distinct phenomenon termed Jordans' anomaly.
See also
Leukemoid reaction
Acute phase reaction
References
Histopathology
Hematology
Hematopathology
Abnormal clinical and laboratory findings for blood | Toxic vacuolation | [
"Chemistry"
] | 414 | [
"Histopathology",
"Microscopy"
] |
61,165,916 | https://en.wikipedia.org/wiki/C13H25N9O3 | {{DISPLAYTITLE:C13H25N9O3}}
The molecular formula C13H25N9O3 (molar mass: 355.403 g/mol, exact mass: 355.2080 u) may refer to:
TAN-1057_A
TAN-1057_C
Molecular formulas | C13H25N9O3 | [
"Physics",
"Chemistry"
] | 69 | [
"Molecules",
"Set index articles on molecular formulas",
"Isomerism",
"Molecular formulas",
"Matter"
] |
61,166,113 | https://en.wikipedia.org/wiki/C22H34O3 | The molecular formula (molar mass: 346.50 g/mol, exact mass: 346.2508 u) may refer to:
Androstanolone propionate
Molecular formulas | C22H34O3 | [
"Physics",
"Chemistry"
] | 43 | [
"Molecules",
"Set index articles on molecular formulas",
"Isomerism",
"Molecular formulas",
"Matter"
] |
61,166,280 | https://en.wikipedia.org/wiki/C19H30O5S | {{DISPLAYTITLE:C19H30O5S}}
The molecular formula C19H30O5S (molar mass: 370.50 g/mol, exact mass: 370.1814 u) may refer to:
Androstenediol sulfate
Androsterone sulfate
Molecular formulas | C19H30O5S | [
"Physics",
"Chemistry"
] | 65 | [
"Molecules",
"Set index articles on molecular formulas",
"Isomerism",
"Molecular formulas",
"Matter"
] |
61,166,674 | https://en.wikipedia.org/wiki/C14H19NO4 | {{DISPLAYTITLE:C14H19NO4}}
The molecular formula C14H19NO4 (molar mass: 265.31 g/mol, exact mass: 265.1314 u) may refer to:
Anisomycin, also known as flagecidin
Filenadol
Molecular formulas | C14H19NO4 | [
"Physics",
"Chemistry"
] | 68 | [
"Molecules",
"Set index articles on molecular formulas",
"Isomerism",
"Molecular formulas",
"Matter"
] |
61,169,373 | https://en.wikipedia.org/wiki/C16H19N3 | {{DISPLAYTITLE:C16H19N3}}
The molecular formula C16H19N3 (molar mass: 253.342 g/mol, exact mass: 253.1579 u) may refer to:
Aptazapine (CGS-7525A)
Solvent Yellow 56
Molecular formulas | C16H19N3 | [
"Physics",
"Chemistry"
] | 69 | [
"Molecules",
"Set index articles on molecular formulas",
"Isomerism",
"Molecular formulas",
"Matter"
] |
61,169,662 | https://en.wikipedia.org/wiki/C25H28O6 | {{DISPLAYTITLE:C25H28O6}}
The molecular formula C25H28O6 (molar mass: 424.49 g/mol, exact mass: 424.1886 u) may refer to:
Arugosin C
Sophoraflavanone G | C25H28O6 | [
"Chemistry"
] | 65 | [
"Isomerism",
"Set index articles on molecular formulas"
] |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.