Instruction
stringlengths
45
106
input_code
stringlengths
1
13.7k
output_code
stringlengths
1
13.7k
Rewrite the snippet below in C++ so it works the same as the original C code.
#include <string.h> #include <stdlib.h> #include <stdio.h> int main( int argc, char ** argv ){ const char * str_a = "knight"; const char * str_b = "socks"; const char * str_c = "brooms"; char * new_a = malloc( strlen( str_a ) - 1 ); char * new_b = malloc( strlen( str_b ) - 1 ); char * new_c = malloc( strlen( str_c ) - 2 ); strcpy( new_a, str_a + 1 ); strncpy( new_b, str_b, strlen( str_b ) - 1 ); strncpy( new_c, str_c + 1, strlen( str_c ) - 2 ); printf( "%s\n%s\n%s\n", new_a, new_b, new_c ); free( new_a ); free( new_b ); free( new_c ); return 0; }
#include <string> #include <iostream> int main( ) { std::string word( "Premier League" ) ; std::cout << "Without first letter: " << word.substr( 1 ) << " !\n" ; std::cout << "Without last letter: " << word.substr( 0 , word.length( ) - 1 ) << " !\n" ; std::cout << "Without first and last letter: " << word.substr( 1 , word.length( ) - 2 ) << " !\n" ; return 0 ; }
Preserve the algorithm and functionality while converting the code from C to C++.
#include <stdio.h> #include <math.h> #include <stdlib.h> #include <stdint.h> #include <time.h> const uint8_t masks[8] = {1, 2, 4, 8, 16, 32, 64, 128}; #define half(n) ((int64_t)((n) - 1) >> 1) #define divide(nm, d) ((uint64_t)((double)nm / (double)d)) int64_t countPrimes(uint64_t n) { if (n < 9) return (n < 2) ? 0 : ((int64_t)n + 1) / 2; uint64_t rtlmt = (uint64_t)sqrt((double)n); int64_t mxndx = (int64_t)((rtlmt - 1) / 2); int arrlen = (int)(mxndx + 1); uint32_t *smalls = malloc(arrlen * 4); uint32_t *roughs = malloc(arrlen * 4); int64_t *larges = malloc(arrlen * 8); for (int i = 0; i < arrlen; ++i) { smalls[i] = (uint32_t)i; roughs[i] = (uint32_t)(i + i + 1); larges[i] = (int64_t)((n/(uint64_t)(i + i + 1) - 1) / 2); } int cullbuflen = (int)((mxndx + 8) / 8); uint8_t *cullbuf = calloc(cullbuflen, 1); int64_t nbps = 0; int rilmt = arrlen; for (int64_t i = 1; ; ++i) { int64_t sqri = (i + i) * (i + 1); if (sqri > mxndx) break; if (cullbuf[i >> 3] & masks[i & 7]) continue; cullbuf[i >> 3] |= masks[i & 7]; uint64_t bp = (uint64_t)(i + i + 1); for (int64_t c = sqri; c < (int64_t)arrlen; c += (int64_t)bp) { cullbuf[c >> 3] |= masks[c & 7]; } int nri = 0; for (int ori = 0; ori < rilmt; ++ori) { uint32_t r = roughs[ori]; int64_t rci = (int64_t)(r >> 1); if (cullbuf[rci >> 3] & masks[rci & 7]) continue; uint64_t d = (uint64_t)r * bp; int64_t t = (d <= rtlmt) ? larges[(int64_t)smalls[d >> 1] - nbps] : (int64_t)smalls[half(divide(n, d))]; larges[nri] = larges[ori] - t + nbps; roughs[nri] = r; nri++; } int64_t si = mxndx; for (uint64_t pm = (rtlmt/bp - 1) | 1; pm >= bp; pm -= 2) { uint32_t c = smalls[pm >> 1]; uint64_t e = (pm * bp) >> 1; for ( ; si >= (int64_t)e; --si) smalls[si] -= c - (uint32_t)nbps; } rilmt = nri; nbps++; } int64_t ans = larges[0] + (int64_t)((rilmt + 2*(nbps - 1)) * (rilmt - 1) / 2); int ri, sri; for (ri = 1; ri < rilmt; ++ri) ans -= larges[ri]; for (ri = 1; ; ++ri) { uint64_t p = (uint64_t)roughs[ri]; uint64_t m = n / p; int ei = (int)smalls[half((uint64_t)m/p)] - nbps; if (ei <= ri) break; ans -= (int64_t)((ei - ri) * (nbps + ri - 1)); for (sri = ri + 1; sri < ei + 1; ++sri) { ans += (int64_t)smalls[half(divide(m, (uint64_t)roughs[sri]))]; } } free(smalls); free(roughs); free(larges); free(cullbuf); return ans + 1; } int main() { uint64_t n; int i; clock_t start = clock(); for (i = 0, n = 1; i < 10; ++i, n *= 10) { printf("10^%d %ld\n", i, countPrimes(n)); } clock_t end = clock(); printf("\nTook %f seconds\n", (double) (end - start) / CLOCKS_PER_SEC); return 0; }
#include <cmath> #include <iostream> #include <vector> std::vector<int> generate_primes(int limit) { std::vector<bool> sieve(limit >> 1, true); for (int p = 3, s = 9; s < limit; p += 2) { if (sieve[p >> 1]) { for (int q = s; q < limit; q += p << 1) sieve[q >> 1] = false; } s += (p + 1) << 2; } std::vector<int> primes; if (limit > 2) primes.push_back(2); for (int i = 1; i < sieve.size(); ++i) { if (sieve[i]) primes.push_back((i << 1) + 1); } return primes; } class legendre_prime_counter { public: explicit legendre_prime_counter(int limit); int prime_count(int n); private: int phi(int x, int a); std::vector<int> primes; }; legendre_prime_counter::legendre_prime_counter(int limit) : primes(generate_primes(static_cast<int>(std::sqrt(limit)))) {} int legendre_prime_counter::prime_count(int n) { if (n < 2) return 0; int a = prime_count(static_cast<int>(std::sqrt(n))); return phi(n, a) + a - 1; } int legendre_prime_counter::phi(int x, int a) { if (a == 0) return x; if (a == 1) return x - (x >> 1); int pa = primes[a - 1]; if (x <= pa) return 1; return phi(x, a - 1) - phi(x / pa, a - 1); } int main() { legendre_prime_counter counter(1000000000); for (int i = 0, n = 1; i < 10; ++i, n *= 10) std::cout << "10^" << i << "\t" << counter.prime_count(n) << '\n'; }
Preserve the algorithm and functionality while converting the code from C to C++.
#include <stdio.h> extern int Query (char * Data, size_t * Length); int main (int argc, char * argv []) { char Buffer [1024]; size_t Size = sizeof (Buffer); if (0 == Query (Buffer, &Size)) { printf ("failed to call Query\n"); } else { char * Ptr = Buffer; while (Size-- > 0) putchar (*Ptr++); putchar ('\n'); } }
#include <string> using std::string; extern "C" int Query (char *Data, size_t *Length) { const string Message = "Here am I"; if (*Length < Message.length()) return false; *Length = Message.length(); Message.copy(Data, *Length); return true; }
Generate a C++ translation of this C snippet without changing its computational steps.
#include <stdio.h> #include <string.h> int cmp(const char *p, const char *q) { while (*p && *q) p = &p[1], q = &q[1]; return *p; } int main() { char line[65536]; char buf[1000000] = {0}; char *last = buf; char *next = buf; while (gets(line)) { strcat(line, "\n"); if (cmp(last, line)) continue; if (cmp(line, last)) next = buf; last = next; strcpy(next, line); while (*next) next = &next[1]; } printf("%s", buf); return 0; }
#include <iostream> #include <string.h> int main() { std::string longLine, longestLines, newLine; while (std::cin >> newLine) { auto isNewLineShorter = longLine.c_str(); auto isLongLineShorter = newLine.c_str(); while (*isNewLineShorter && *isLongLineShorter) { isNewLineShorter = &isNewLineShorter[1]; isLongLineShorter = &isLongLineShorter[1]; } if(*isNewLineShorter) continue; if(*isLongLineShorter) { longLine = newLine; longestLines = newLine; } else { longestLines+=newLine; } longestLines+="\n"; } std::cout << "\nLongest string:\n" << longestLines; }
Generate an equivalent C++ version of this C code.
#include <stdio.h> #include <stdarg.h> #include <stdlib.h> #include <string.h> enum { LEFT, RIGHT, STAY }; typedef struct { int state1; int symbol1; int symbol2; int dir; int state2; } transition_t; typedef struct tape_t tape_t; struct tape_t { int symbol; tape_t *left; tape_t *right; }; typedef struct { int states_len; char **states; int final_states_len; int *final_states; int symbols_len; char *symbols; int blank; int state; int tape_len; tape_t *tape; int transitions_len; transition_t ***transitions; } turing_t; int state_index (turing_t *t, char *state) { int i; for (i = 0; i < t->states_len; i++) { if (!strcmp(t->states[i], state)) { return i; } } return 0; } int symbol_index (turing_t *t, char symbol) { int i; for (i = 0; i < t->symbols_len; i++) { if (t->symbols[i] == symbol) { return i; } } return 0; } void move (turing_t *t, int dir) { tape_t *orig = t->tape; if (dir == RIGHT) { if (orig && orig->right) { t->tape = orig->right; } else { t->tape = calloc(1, sizeof (tape_t)); t->tape->symbol = t->blank; if (orig) { t->tape->left = orig; orig->right = t->tape; } } } else if (dir == LEFT) { if (orig && orig->left) { t->tape = orig->left; } else { t->tape = calloc(1, sizeof (tape_t)); t->tape->symbol = t->blank; if (orig) { t->tape->right = orig; orig->left = t->tape; } } } } turing_t *create (int states_len, ...) { va_list args; va_start(args, states_len); turing_t *t = malloc(sizeof (turing_t)); t->states_len = states_len; t->states = malloc(states_len * sizeof (char *)); int i; for (i = 0; i < states_len; i++) { t->states[i] = va_arg(args, char *); } t->final_states_len = va_arg(args, int); t->final_states = malloc(t->final_states_len * sizeof (int)); for (i = 0; i < t->final_states_len; i++) { t->final_states[i] = state_index(t, va_arg(args, char *)); } t->symbols_len = va_arg(args, int); t->symbols = malloc(t->symbols_len); for (i = 0; i < t->symbols_len; i++) { t->symbols[i] = va_arg(args, int); } t->blank = symbol_index(t, va_arg(args, int)); t->state = state_index(t, va_arg(args, char *)); t->tape_len = va_arg(args, int); t->tape = NULL; for (i = 0; i < t->tape_len; i++) { move(t, RIGHT); t->tape->symbol = symbol_index(t, va_arg(args, int)); } if (!t->tape_len) { move(t, RIGHT); } while (t->tape->left) { t->tape = t->tape->left; } t->transitions_len = va_arg(args, int); t->transitions = malloc(t->states_len * sizeof (transition_t **)); for (i = 0; i < t->states_len; i++) { t->transitions[i] = malloc(t->symbols_len * sizeof (transition_t *)); } for (i = 0; i < t->transitions_len; i++) { transition_t *tran = malloc(sizeof (transition_t)); tran->state1 = state_index(t, va_arg(args, char *)); tran->symbol1 = symbol_index(t, va_arg(args, int)); tran->symbol2 = symbol_index(t, va_arg(args, int)); tran->dir = va_arg(args, int); tran->state2 = state_index(t, va_arg(args, char *)); t->transitions[tran->state1][tran->symbol1] = tran; } va_end(args); return t; } void print_state (turing_t *t) { printf("%-10s ", t->states[t->state]); tape_t *tape = t->tape; while (tape->left) { tape = tape->left; } while (tape) { if (tape == t->tape) { printf("[%c]", t->symbols[tape->symbol]); } else { printf(" %c ", t->symbols[tape->symbol]); } tape = tape->right; } printf("\n"); } void run (turing_t *t) { int i; while (1) { print_state(t); for (i = 0; i < t->final_states_len; i++) { if (t->final_states[i] == t->state) { return; } } transition_t *tran = t->transitions[t->state][t->tape->symbol]; t->tape->symbol = tran->symbol2; move(t, tran->dir); t->state = tran->state2; } } int main () { printf("Simple incrementer\n"); turing_t *t = create( 2, "q0", "qf", 1, "qf", 2, 'B', '1', 'B', "q0", 3, '1', '1', '1', 2, "q0", '1', '1', RIGHT, "q0", "q0", 'B', '1', STAY, "qf" ); run(t); printf("\nThree-state busy beaver\n"); t = create( 4, "a", "b", "c", "halt", 1, "halt", 2, '0', '1', '0', "a", 0, 6, "a", '0', '1', RIGHT, "b", "a", '1', '1', LEFT, "c", "b", '0', '1', LEFT, "a", "b", '1', '1', RIGHT, "b", "c", '0', '1', LEFT, "b", "c", '1', '1', STAY, "halt" ); run(t); return 0; printf("\nFive-state two-symbol probable busy beaver\n"); t = create( 6, "A", "B", "C", "D", "E", "H", 1, "H", 2, '0', '1', '0', "A", 0, 10, "A", '0', '1', RIGHT, "B", "A", '1', '1', LEFT, "C", "B", '0', '1', RIGHT, "C", "B", '1', '1', RIGHT, "B", "C", '0', '1', RIGHT, "D", "C", '1', '0', LEFT, "E", "D", '0', '1', LEFT, "A", "D", '1', '1', LEFT, "D", "E", '0', '1', STAY, "H", "E", '1', '0', LEFT, "A" ); run(t); }
#include <vector> #include <string> #include <iostream> #include <algorithm> #include <fstream> #include <iomanip> typedef unsigned int uint; using namespace std; const uint TAPE_MAX_LEN = 49152; struct action { char write, direction; }; class tape { public: tape( uint startPos = TAPE_MAX_LEN >> 1 ) : MAX_LEN( TAPE_MAX_LEN ) { _sp = startPos; reset(); } void reset() { clear( '0' ); headPos = _sp; } char read(){ return _t[headPos]; } void input( string a ){ if( a == "" ) return; for( uint s = 0; s < a.length(); s++ ) _t[headPos + s] = a[s]; } void clear( char c ) { _t.clear(); blk = c; _t.resize( MAX_LEN, blk ); } void action( const action* a ) { write( a->write ); move( a->direction ); } void print( int c = 10 ) { int ml = static_cast<int>( MAX_LEN ), st = static_cast<int>( headPos ) - c, ed = static_cast<int>( headPos ) + c + 1, tx; for( int x = st; x < ed; x++ ) { tx = x; if( tx < 0 ) tx += ml; if( tx >= ml ) tx -= ml; cout << _t[tx]; } cout << endl << setw( c + 1 ) << "^" << endl; } private: void move( char d ) { if( d == 'N' ) return; headPos += d == 'R' ? 1 : -1; if( headPos >= MAX_LEN ) headPos = d == 'R' ? 0 : MAX_LEN - 1; } void write( char a ) { if( a != 'N' ) { if( a == 'B' ) _t[headPos] = blk; else _t[headPos] = a; } } string _t; uint headPos, _sp; char blk; const uint MAX_LEN; }; class state { public: bool operator ==( const string o ) { return o == name; } string name, next; char symbol, write, direction; }; class actionTable { public: bool loadTable( string file ) { reset(); ifstream mf; mf.open( file.c_str() ); if( mf.is_open() ) { string str; state stt; while( mf.good() ) { getline( mf, str ); if( str[0] == '\'' ) break; parseState( str, stt ); states.push_back( stt ); } while( mf.good() ) { getline( mf, str ); if( str == "" ) continue; if( str[0] == '!' ) blank = str.erase( 0, 1 )[0]; if( str[0] == '^' ) curState = str.erase( 0, 1 ); if( str[0] == '>' ) input = str.erase( 0, 1 ); } mf.close(); return true; } cout << "Could not open " << file << endl; return false; } bool action( char symbol, action& a ) { vector<state>::iterator f = states.begin(); while( true ) { f = find( f, states.end(), curState ); if( f == states.end() ) return false; if( ( *f ).symbol == '*' || ( *f ).symbol == symbol || ( ( *f ).symbol == 'B' && blank == symbol ) ) { a.direction = ( *f ).direction; a.write = ( *f ).write; curState = ( *f ).next; break; } f++; } return true; } void reset() { states.clear(); blank = '0'; curState = input = ""; } string getInput() { return input; } char getBlank() { return blank; } private: void parseState( string str, state& stt ) { string a[5]; int idx = 0; for( string::iterator si = str.begin(); si != str.end(); si++ ) { if( ( *si ) == ';' ) idx++; else a[idx].append( &( *si ), 1 ); } stt.name = a[0]; stt.symbol = a[1][0]; stt.write = a[2][0]; stt.direction = a[3][0]; stt.next = a[4]; } vector<state> states; char blank; string curState, input; }; class utm { public: utm() { files[0] = "incrementer.utm"; files[1] = "busy_beaver.utm"; files[2] = "sort.utm"; } void start() { while( true ) { reset(); int t = showMenu(); if( t == 0 ) return; if( !at.loadTable( files[t - 1] ) ) return; startMachine(); } } private: void simulate() { char r; action a; while( true ) { tp.print(); r = tp.read(); if( !( at.action( r, a ) ) ) break; tp.action( &a ); } cout << endl << endl; system( "pause" ); } int showMenu() { int t = -1; while( t < 0 || t > 3 ) { system( "cls" ); cout << "1. Incrementer\n2. Busy beaver\n3. Sort\n\n0. Quit"; cout << endl << endl << "Choose an action "; cin >> t; } return t; } void reset() { tp.reset(); at.reset(); } void startMachine() { system( "cls" ); tp.clear( at.getBlank() ); tp.input( at.getInput() ); simulate(); } tape tp; actionTable at; string files[7]; }; int main( int a, char* args[] ){ utm mm; mm.start(); return 0; }
Rewrite the snippet below in C++ so it works the same as the original C code.
#include <stdio.h> #include <stdarg.h> #include <stdlib.h> #include <string.h> enum { LEFT, RIGHT, STAY }; typedef struct { int state1; int symbol1; int symbol2; int dir; int state2; } transition_t; typedef struct tape_t tape_t; struct tape_t { int symbol; tape_t *left; tape_t *right; }; typedef struct { int states_len; char **states; int final_states_len; int *final_states; int symbols_len; char *symbols; int blank; int state; int tape_len; tape_t *tape; int transitions_len; transition_t ***transitions; } turing_t; int state_index (turing_t *t, char *state) { int i; for (i = 0; i < t->states_len; i++) { if (!strcmp(t->states[i], state)) { return i; } } return 0; } int symbol_index (turing_t *t, char symbol) { int i; for (i = 0; i < t->symbols_len; i++) { if (t->symbols[i] == symbol) { return i; } } return 0; } void move (turing_t *t, int dir) { tape_t *orig = t->tape; if (dir == RIGHT) { if (orig && orig->right) { t->tape = orig->right; } else { t->tape = calloc(1, sizeof (tape_t)); t->tape->symbol = t->blank; if (orig) { t->tape->left = orig; orig->right = t->tape; } } } else if (dir == LEFT) { if (orig && orig->left) { t->tape = orig->left; } else { t->tape = calloc(1, sizeof (tape_t)); t->tape->symbol = t->blank; if (orig) { t->tape->right = orig; orig->left = t->tape; } } } } turing_t *create (int states_len, ...) { va_list args; va_start(args, states_len); turing_t *t = malloc(sizeof (turing_t)); t->states_len = states_len; t->states = malloc(states_len * sizeof (char *)); int i; for (i = 0; i < states_len; i++) { t->states[i] = va_arg(args, char *); } t->final_states_len = va_arg(args, int); t->final_states = malloc(t->final_states_len * sizeof (int)); for (i = 0; i < t->final_states_len; i++) { t->final_states[i] = state_index(t, va_arg(args, char *)); } t->symbols_len = va_arg(args, int); t->symbols = malloc(t->symbols_len); for (i = 0; i < t->symbols_len; i++) { t->symbols[i] = va_arg(args, int); } t->blank = symbol_index(t, va_arg(args, int)); t->state = state_index(t, va_arg(args, char *)); t->tape_len = va_arg(args, int); t->tape = NULL; for (i = 0; i < t->tape_len; i++) { move(t, RIGHT); t->tape->symbol = symbol_index(t, va_arg(args, int)); } if (!t->tape_len) { move(t, RIGHT); } while (t->tape->left) { t->tape = t->tape->left; } t->transitions_len = va_arg(args, int); t->transitions = malloc(t->states_len * sizeof (transition_t **)); for (i = 0; i < t->states_len; i++) { t->transitions[i] = malloc(t->symbols_len * sizeof (transition_t *)); } for (i = 0; i < t->transitions_len; i++) { transition_t *tran = malloc(sizeof (transition_t)); tran->state1 = state_index(t, va_arg(args, char *)); tran->symbol1 = symbol_index(t, va_arg(args, int)); tran->symbol2 = symbol_index(t, va_arg(args, int)); tran->dir = va_arg(args, int); tran->state2 = state_index(t, va_arg(args, char *)); t->transitions[tran->state1][tran->symbol1] = tran; } va_end(args); return t; } void print_state (turing_t *t) { printf("%-10s ", t->states[t->state]); tape_t *tape = t->tape; while (tape->left) { tape = tape->left; } while (tape) { if (tape == t->tape) { printf("[%c]", t->symbols[tape->symbol]); } else { printf(" %c ", t->symbols[tape->symbol]); } tape = tape->right; } printf("\n"); } void run (turing_t *t) { int i; while (1) { print_state(t); for (i = 0; i < t->final_states_len; i++) { if (t->final_states[i] == t->state) { return; } } transition_t *tran = t->transitions[t->state][t->tape->symbol]; t->tape->symbol = tran->symbol2; move(t, tran->dir); t->state = tran->state2; } } int main () { printf("Simple incrementer\n"); turing_t *t = create( 2, "q0", "qf", 1, "qf", 2, 'B', '1', 'B', "q0", 3, '1', '1', '1', 2, "q0", '1', '1', RIGHT, "q0", "q0", 'B', '1', STAY, "qf" ); run(t); printf("\nThree-state busy beaver\n"); t = create( 4, "a", "b", "c", "halt", 1, "halt", 2, '0', '1', '0', "a", 0, 6, "a", '0', '1', RIGHT, "b", "a", '1', '1', LEFT, "c", "b", '0', '1', LEFT, "a", "b", '1', '1', RIGHT, "b", "c", '0', '1', LEFT, "b", "c", '1', '1', STAY, "halt" ); run(t); return 0; printf("\nFive-state two-symbol probable busy beaver\n"); t = create( 6, "A", "B", "C", "D", "E", "H", 1, "H", 2, '0', '1', '0', "A", 0, 10, "A", '0', '1', RIGHT, "B", "A", '1', '1', LEFT, "C", "B", '0', '1', RIGHT, "C", "B", '1', '1', RIGHT, "B", "C", '0', '1', RIGHT, "D", "C", '1', '0', LEFT, "E", "D", '0', '1', LEFT, "A", "D", '1', '1', LEFT, "D", "E", '0', '1', STAY, "H", "E", '1', '0', LEFT, "A" ); run(t); }
#include <vector> #include <string> #include <iostream> #include <algorithm> #include <fstream> #include <iomanip> typedef unsigned int uint; using namespace std; const uint TAPE_MAX_LEN = 49152; struct action { char write, direction; }; class tape { public: tape( uint startPos = TAPE_MAX_LEN >> 1 ) : MAX_LEN( TAPE_MAX_LEN ) { _sp = startPos; reset(); } void reset() { clear( '0' ); headPos = _sp; } char read(){ return _t[headPos]; } void input( string a ){ if( a == "" ) return; for( uint s = 0; s < a.length(); s++ ) _t[headPos + s] = a[s]; } void clear( char c ) { _t.clear(); blk = c; _t.resize( MAX_LEN, blk ); } void action( const action* a ) { write( a->write ); move( a->direction ); } void print( int c = 10 ) { int ml = static_cast<int>( MAX_LEN ), st = static_cast<int>( headPos ) - c, ed = static_cast<int>( headPos ) + c + 1, tx; for( int x = st; x < ed; x++ ) { tx = x; if( tx < 0 ) tx += ml; if( tx >= ml ) tx -= ml; cout << _t[tx]; } cout << endl << setw( c + 1 ) << "^" << endl; } private: void move( char d ) { if( d == 'N' ) return; headPos += d == 'R' ? 1 : -1; if( headPos >= MAX_LEN ) headPos = d == 'R' ? 0 : MAX_LEN - 1; } void write( char a ) { if( a != 'N' ) { if( a == 'B' ) _t[headPos] = blk; else _t[headPos] = a; } } string _t; uint headPos, _sp; char blk; const uint MAX_LEN; }; class state { public: bool operator ==( const string o ) { return o == name; } string name, next; char symbol, write, direction; }; class actionTable { public: bool loadTable( string file ) { reset(); ifstream mf; mf.open( file.c_str() ); if( mf.is_open() ) { string str; state stt; while( mf.good() ) { getline( mf, str ); if( str[0] == '\'' ) break; parseState( str, stt ); states.push_back( stt ); } while( mf.good() ) { getline( mf, str ); if( str == "" ) continue; if( str[0] == '!' ) blank = str.erase( 0, 1 )[0]; if( str[0] == '^' ) curState = str.erase( 0, 1 ); if( str[0] == '>' ) input = str.erase( 0, 1 ); } mf.close(); return true; } cout << "Could not open " << file << endl; return false; } bool action( char symbol, action& a ) { vector<state>::iterator f = states.begin(); while( true ) { f = find( f, states.end(), curState ); if( f == states.end() ) return false; if( ( *f ).symbol == '*' || ( *f ).symbol == symbol || ( ( *f ).symbol == 'B' && blank == symbol ) ) { a.direction = ( *f ).direction; a.write = ( *f ).write; curState = ( *f ).next; break; } f++; } return true; } void reset() { states.clear(); blank = '0'; curState = input = ""; } string getInput() { return input; } char getBlank() { return blank; } private: void parseState( string str, state& stt ) { string a[5]; int idx = 0; for( string::iterator si = str.begin(); si != str.end(); si++ ) { if( ( *si ) == ';' ) idx++; else a[idx].append( &( *si ), 1 ); } stt.name = a[0]; stt.symbol = a[1][0]; stt.write = a[2][0]; stt.direction = a[3][0]; stt.next = a[4]; } vector<state> states; char blank; string curState, input; }; class utm { public: utm() { files[0] = "incrementer.utm"; files[1] = "busy_beaver.utm"; files[2] = "sort.utm"; } void start() { while( true ) { reset(); int t = showMenu(); if( t == 0 ) return; if( !at.loadTable( files[t - 1] ) ) return; startMachine(); } } private: void simulate() { char r; action a; while( true ) { tp.print(); r = tp.read(); if( !( at.action( r, a ) ) ) break; tp.action( &a ); } cout << endl << endl; system( "pause" ); } int showMenu() { int t = -1; while( t < 0 || t > 3 ) { system( "cls" ); cout << "1. Incrementer\n2. Busy beaver\n3. Sort\n\n0. Quit"; cout << endl << endl << "Choose an action "; cin >> t; } return t; } void reset() { tp.reset(); at.reset(); } void startMachine() { system( "cls" ); tp.clear( at.getBlank() ); tp.input( at.getInput() ); simulate(); } tape tp; actionTable at; string files[7]; }; int main( int a, char* args[] ){ utm mm; mm.start(); return 0; }
Change the programming language of this snippet from C to C++ without modifying what it does.
#include <stdio.h> int main() { FILE *fh = fopen("output.txt", "w"); fclose(fh); return 0; }
#include <direct.h> #include <fstream> int main() { std::fstream f("output.txt", std::ios::out); f.close(); f.open("/output.txt", std::ios::out); f.close(); _mkdir("docs"); _mkdir("/docs"); return 0; }
Please provide an equivalent version of this C code in C++.
#include <assert.h> #include <locale.h> #include <stdbool.h> #include <stdint.h> #include <stdio.h> #include <stdlib.h> typedef struct bit_array_tag { uint32_t size; uint32_t* array; } bit_array; bool bit_array_create(bit_array* b, uint32_t size) { uint32_t* array = calloc((size + 31)/32, sizeof(uint32_t)); if (array == NULL) return false; b->size = size; b->array = array; return true; } void bit_array_destroy(bit_array* b) { free(b->array); b->array = NULL; } void bit_array_set(bit_array* b, uint32_t index, bool value) { assert(index < b->size); uint32_t* p = &b->array[index >> 5]; uint32_t bit = 1 << (index & 31); if (value) *p |= bit; else *p &= ~bit; } bool bit_array_get(const bit_array* b, uint32_t index) { assert(index < b->size); uint32_t* p = &b->array[index >> 5]; uint32_t bit = 1 << (index & 31); return (*p & bit) != 0; } typedef struct sieve_tag { uint32_t limit; bit_array not_prime; } sieve; bool sieve_create(sieve* s, uint32_t limit) { if (!bit_array_create(&s->not_prime, limit/2)) return false; for (uint32_t p = 3; p * p <= limit; p += 2) { if (bit_array_get(&s->not_prime, p/2 - 1) == false) { uint32_t inc = 2 * p; for (uint32_t q = p * p; q <= limit; q += inc) bit_array_set(&s->not_prime, q/2 - 1, true); } } s->limit = limit; return true; } void sieve_destroy(sieve* s) { bit_array_destroy(&s->not_prime); } bool is_prime(const sieve* s, uint32_t n) { assert(n <= s->limit); if (n == 2) return true; if (n < 2 || n % 2 == 0) return false; return bit_array_get(&s->not_prime, n/2 - 1) == false; } uint32_t count_digits(uint32_t n) { uint32_t digits = 0; for (; n > 0; ++digits) n /= 10; return digits; } uint32_t change_digit(uint32_t n, uint32_t index, uint32_t new_digit) { uint32_t p = 1; uint32_t changed = 0; for (; index > 0; p *= 10, n /= 10, --index) changed += p * (n % 10); changed += (10 * (n/10) + new_digit) * p; return changed; } bool unprimeable(const sieve* s, uint32_t n) { if (is_prime(s, n)) return false; uint32_t d = count_digits(n); for (uint32_t i = 0; i < d; ++i) { for (uint32_t j = 0; j <= 9; ++j) { uint32_t m = change_digit(n, i, j); if (m != n && is_prime(s, m)) return false; } } return true; } int main() { const uint32_t limit = 10000000; setlocale(LC_ALL, ""); sieve s = { 0 }; if (!sieve_create(&s, limit)) { fprintf(stderr, "Out of memory\n"); return 1; } printf("First 35 unprimeable numbers:\n"); uint32_t n = 100; uint32_t lowest[10] = { 0 }; for (uint32_t count = 0, found = 0; n < limit && (found < 10 || count < 600); ++n) { if (unprimeable(&s, n)) { if (count < 35) { if (count != 0) printf(", "); printf("%'u", n); } ++count; if (count == 600) printf("\n600th unprimeable number: %'u\n", n); uint32_t last_digit = n % 10; if (lowest[last_digit] == 0) { lowest[last_digit] = n; ++found; } } } sieve_destroy(&s); for (uint32_t i = 0; i < 10; ++i) printf("Least unprimeable number ending in %u: %'u\n" , i, lowest[i]); return 0; }
#include <iostream> #include <cstdint> #include "prime_sieve.hpp" typedef uint32_t integer; int count_digits(integer n) { int digits = 0; for (; n > 0; ++digits) n /= 10; return digits; } integer change_digit(integer n, int index, int new_digit) { integer p = 1; integer changed = 0; for (; index > 0; p *= 10, n /= 10, --index) changed += p * (n % 10); changed += (10 * (n/10) + new_digit) * p; return changed; } bool unprimeable(const prime_sieve& sieve, integer n) { if (sieve.is_prime(n)) return false; int d = count_digits(n); for (int i = 0; i < d; ++i) { for (int j = 0; j <= 9; ++j) { integer m = change_digit(n, i, j); if (m != n && sieve.is_prime(m)) return false; } } return true; } int main() { const integer limit = 10000000; prime_sieve sieve(limit); std::cout.imbue(std::locale("")); std::cout << "First 35 unprimeable numbers:\n"; integer n = 100; integer lowest[10] = { 0 }; for (int count = 0, found = 0; n < limit && (found < 10 || count < 600); ++n) { if (unprimeable(sieve, n)) { if (count < 35) { if (count != 0) std::cout << ", "; std::cout << n; } ++count; if (count == 600) std::cout << "\n600th unprimeable number: " << n << '\n'; int last_digit = n % 10; if (lowest[last_digit] == 0) { lowest[last_digit] = n; ++found; } } } for (int i = 0; i < 10; ++i) std::cout << "Least unprimeable number ending in " << i << ": " << lowest[i] << '\n'; return 0; }
Convert this C snippet to C++ and keep its semantics consistent.
#include <stdio.h> #include <math.h> void pascal(int a, int b, int mid, int top, int* x, int* y, int* z) { double ytemp = (top - 4 * (a + b)) / 7.; if(fmod(ytemp, 1.) >= 0.0001) { x = 0; return; } *y = ytemp; *x = mid - 2 * a - *y; *z = *y - *x; } int main() { int a = 11, b = 4, mid = 40, top = 151; int x, y, z; pascal(a, b, mid, top, &x, &y, &z); if(x != 0) printf("x: %d, y: %d, z: %d\n", x, y, z); else printf("No solution\n"); return 0; }
#include <iostream> #include <iomanip> inline int sign(int i) { return i < 0 ? -1 : i > 0; } inline int& E(int *x, int row, int col) { return x[row * (row + 1) / 2 + col]; } int iter(int *v, int *diff) { E(v, 0, 0) = 151; E(v, 2, 0) = 40; E(v, 4, 1) = 11; E(v, 4, 3) = 4; for (auto i = 1u; i < 5u; i++) for (auto j = 0u; j <= i; j++) { E(diff, i, j) = 0; if (j < i) E(diff, i, j) += E(v, i - 1, j) - E(v, i, j + 1) - E(v, i, j); if (j) E(diff, i, j) += E(v, i - 1, j - 1) - E(v, i, j - 1) - E(v, i, j); } for (auto i = 0u; i < 4u; i++) for (auto j = 0u; j < i; j++) E(diff, i, j) += E(v, i + 1, j) + E(v, i + 1, j + 1) - E(v, i, j); E(diff, 4, 2) += E(v, 4, 0) + E(v, 4, 4) - E(v, 4, 2); uint sum; int e = 0; for (auto i = sum = 0u; i < 15u; i++) { sum += !!sign(e = diff[i]); if (e >= 4 || e <= -4) v[i] += e / 5; else if (rand() < RAND_MAX / 4) v[i] += sign(e); } return sum; } void show(int *x) { for (auto i = 0u; i < 5u; i++) for (auto j = 0u; j <= i; j++) std::cout << std::setw(4u) << *(x++) << (j < i ? ' ' : '\n'); } int main() { int v[15] = { 0 }, diff[15] = { 0 }; for (auto i = 1u, s = 1u; s; i++) { s = iter(v, diff); std::cout << "pass " << i << ": " << s << std::endl; } show(v); return 0; }
Translate the given C code snippet into C++ without altering its behavior.
#include <stdio.h> #include <math.h> void pascal(int a, int b, int mid, int top, int* x, int* y, int* z) { double ytemp = (top - 4 * (a + b)) / 7.; if(fmod(ytemp, 1.) >= 0.0001) { x = 0; return; } *y = ytemp; *x = mid - 2 * a - *y; *z = *y - *x; } int main() { int a = 11, b = 4, mid = 40, top = 151; int x, y, z; pascal(a, b, mid, top, &x, &y, &z); if(x != 0) printf("x: %d, y: %d, z: %d\n", x, y, z); else printf("No solution\n"); return 0; }
#include <iostream> #include <iomanip> inline int sign(int i) { return i < 0 ? -1 : i > 0; } inline int& E(int *x, int row, int col) { return x[row * (row + 1) / 2 + col]; } int iter(int *v, int *diff) { E(v, 0, 0) = 151; E(v, 2, 0) = 40; E(v, 4, 1) = 11; E(v, 4, 3) = 4; for (auto i = 1u; i < 5u; i++) for (auto j = 0u; j <= i; j++) { E(diff, i, j) = 0; if (j < i) E(diff, i, j) += E(v, i - 1, j) - E(v, i, j + 1) - E(v, i, j); if (j) E(diff, i, j) += E(v, i - 1, j - 1) - E(v, i, j - 1) - E(v, i, j); } for (auto i = 0u; i < 4u; i++) for (auto j = 0u; j < i; j++) E(diff, i, j) += E(v, i + 1, j) + E(v, i + 1, j + 1) - E(v, i, j); E(diff, 4, 2) += E(v, 4, 0) + E(v, 4, 4) - E(v, 4, 2); uint sum; int e = 0; for (auto i = sum = 0u; i < 15u; i++) { sum += !!sign(e = diff[i]); if (e >= 4 || e <= -4) v[i] += e / 5; else if (rand() < RAND_MAX / 4) v[i] += sign(e); } return sum; } void show(int *x) { for (auto i = 0u; i < 5u; i++) for (auto j = 0u; j <= i; j++) std::cout << std::setw(4u) << *(x++) << (j < i ? ' ' : '\n'); } int main() { int v[15] = { 0 }, diff[15] = { 0 }; for (auto i = 1u, s = 1u; s; i++) { s = iter(v, diff); std::cout << "pass " << i << ": " << s << std::endl; } show(v); return 0; }
Convert this C snippet to C++ and keep its semantics consistent.
#include <stdio.h> #include <stdlib.h> #include <gmp.h> typedef unsigned long long int u64; #define TRUE 1 #define FALSE 0 int primality_pretest(u64 k) { if (!(k % 3) || !(k % 5) || !(k % 7) || !(k % 11) || !(k % 13) || !(k % 17) || !(k % 19) || !(k % 23)) return (k <= 23); return TRUE; } int probprime(u64 k, mpz_t n) { mpz_set_ui(n, k); return mpz_probab_prime_p(n, 0); } int is_chernick(int n, u64 m, mpz_t z) { u64 t = 9 * m; if (primality_pretest(6 * m + 1) == FALSE) return FALSE; if (primality_pretest(12 * m + 1) == FALSE) return FALSE; for (int i = 1; i <= n - 2; i++) if (primality_pretest((t << i) + 1) == FALSE) return FALSE; if (probprime(6 * m + 1, z) == FALSE) return FALSE; if (probprime(12 * m + 1, z) == FALSE) return FALSE; for (int i = 1; i <= n - 2; i++) if (probprime((t << i) + 1, z) == FALSE) return FALSE; return TRUE; } int main(int argc, char const *argv[]) { mpz_t z; mpz_inits(z, NULL); for (int n = 3; n <= 10; n ++) { u64 multiplier = (n > 4) ? (1 << (n - 4)) : 1; if (n > 5) multiplier *= 5; for (u64 k = 1; ; k++) { u64 m = k * multiplier; if (is_chernick(n, m, z) == TRUE) { printf("a(%d) has m = %llu\n", n, m); break; } } } return 0; }
#include <gmp.h> #include <iostream> using namespace std; typedef unsigned long long int u64; bool primality_pretest(u64 k) { if (!(k % 3) || !(k % 5) || !(k % 7) || !(k % 11) || !(k % 13) || !(k % 17) || !(k % 19) || !(k % 23) ) { return (k <= 23); } return true; } bool probprime(u64 k, mpz_t n) { mpz_set_ui(n, k); return mpz_probab_prime_p(n, 0); } bool is_chernick(int n, u64 m, mpz_t z) { if (!primality_pretest(6 * m + 1)) { return false; } if (!primality_pretest(12 * m + 1)) { return false; } u64 t = 9 * m; for (int i = 1; i <= n - 2; i++) { if (!primality_pretest((t << i) + 1)) { return false; } } if (!probprime(6 * m + 1, z)) { return false; } if (!probprime(12 * m + 1, z)) { return false; } for (int i = 1; i <= n - 2; i++) { if (!probprime((t << i) + 1, z)) { return false; } } return true; } int main() { mpz_t z; mpz_inits(z, NULL); for (int n = 3; n <= 10; n++) { u64 multiplier = (n > 4) ? (1 << (n - 4)) : 1; if (n > 5) { multiplier *= 5; } for (u64 k = 1; ; k++) { u64 m = k * multiplier; if (is_chernick(n, m, z)) { cout << "a(" << n << ") has m = " << m << endl; break; } } } return 0; }
Port the following code from C to C++ with equivalent syntax and logic.
#include <stdbool.h> #include <stdio.h> #include <stdlib.h> const double EPS = 0.001; const double EPS_SQUARE = 0.000001; double side(double x1, double y1, double x2, double y2, double x, double y) { return (y2 - y1) * (x - x1) + (-x2 + x1) * (y - y1); } bool naivePointInTriangle(double x1, double y1, double x2, double y2, double x3, double y3, double x, double y) { double checkSide1 = side(x1, y1, x2, y2, x, y) >= 0; double checkSide2 = side(x2, y2, x3, y3, x, y) >= 0; double checkSide3 = side(x3, y3, x1, y1, x, y) >= 0; return checkSide1 && checkSide2 && checkSide3; } bool pointInTriangleBoundingBox(double x1, double y1, double x2, double y2, double x3, double y3, double x, double y) { double xMin = min(x1, min(x2, x3)) - EPS; double xMax = max(x1, max(x2, x3)) + EPS; double yMin = min(y1, min(y2, y3)) - EPS; double yMax = max(y1, max(y2, y3)) + EPS; return !(x < xMin || xMax < x || y < yMin || yMax < y); } double distanceSquarePointToSegment(double x1, double y1, double x2, double y2, double x, double y) { double p1_p2_squareLength = (x2 - x1) * (x2 - x1) + (y2 - y1) * (y2 - y1); double dotProduct = ((x - x1) * (x2 - x1) + (y - y1) * (y2 - y1)) / p1_p2_squareLength; if (dotProduct < 0) { return (x - x1) * (x - x1) + (y - y1) * (y - y1); } else if (dotProduct <= 1) { double p_p1_squareLength = (x1 - x) * (x1 - x) + (y1 - y) * (y1 - y); return p_p1_squareLength - dotProduct * dotProduct * p1_p2_squareLength; } else { return (x - x2) * (x - x2) + (y - y2) * (y - y2); } } bool accuratePointInTriangle(double x1, double y1, double x2, double y2, double x3, double y3, double x, double y) { if (!pointInTriangleBoundingBox(x1, y1, x2, y2, x3, y3, x, y)) { return false; } if (naivePointInTriangle(x1, y1, x2, y2, x3, y3, x, y)) { return true; } if (distanceSquarePointToSegment(x1, y1, x2, y2, x, y) <= EPS_SQUARE) { return true; } if (distanceSquarePointToSegment(x2, y2, x3, y3, x, y) <= EPS_SQUARE) { return true; } if (distanceSquarePointToSegment(x3, y3, x1, y1, x, y) <= EPS_SQUARE) { return true; } return false; } void printPoint(double x, double y) { printf("(%f, %f)", x, y); } void printTriangle(double x1, double y1, double x2, double y2, double x3, double y3) { printf("Triangle is ["); printPoint(x1, y1); printf(", "); printPoint(x2, y2); printf(", "); printPoint(x3, y3); printf("] \n"); } void test(double x1, double y1, double x2, double y2, double x3, double y3, double x, double y) { printTriangle(x1, y1, x2, y2, x3, y3); printf("Point "); printPoint(x, y); printf(" is within triangle? "); if (accuratePointInTriangle(x1, y1, x2, y2, x3, y3, x, y)) { printf("true\n"); } else { printf("false\n"); } } int main() { test(1.5, 2.4, 5.1, -3.1, -3.8, 1.2, 0, 0); test(1.5, 2.4, 5.1, -3.1, -3.8, 1.2, 0, 1); test(1.5, 2.4, 5.1, -3.1, -3.8, 1.2, 3, 1); printf("\n"); test(0.1, 0.1111111111111111, 12.5, 33.333333333333336, 25, 11.11111111111111, 5.414285714285714, 14.349206349206348); printf("\n"); test(0.1, 0.1111111111111111, 12.5, 33.333333333333336, -12.5, 16.666666666666668, 5.414285714285714, 14.349206349206348); printf("\n"); return 0; }
#include <iostream> const double EPS = 0.001; const double EPS_SQUARE = EPS * EPS; double side(double x1, double y1, double x2, double y2, double x, double y) { return (y2 - y1) * (x - x1) + (-x2 + x1) * (y - y1); } bool naivePointInTriangle(double x1, double y1, double x2, double y2, double x3, double y3, double x, double y) { double checkSide1 = side(x1, y1, x2, y2, x, y) >= 0; double checkSide2 = side(x2, y2, x3, y3, x, y) >= 0; double checkSide3 = side(x3, y3, x1, y1, x, y) >= 0; return checkSide1 && checkSide2 && checkSide3; } bool pointInTriangleBoundingBox(double x1, double y1, double x2, double y2, double x3, double y3, double x, double y) { double xMin = std::min(x1, std::min(x2, x3)) - EPS; double xMax = std::max(x1, std::max(x2, x3)) + EPS; double yMin = std::min(y1, std::min(y2, y3)) - EPS; double yMax = std::max(y1, std::max(y2, y3)) + EPS; return !(x < xMin || xMax < x || y < yMin || yMax < y); } double distanceSquarePointToSegment(double x1, double y1, double x2, double y2, double x, double y) { double p1_p2_squareLength = (x2 - x1) * (x2 - x1) + (y2 - y1) * (y2 - y1); double dotProduct = ((x - x1) * (x2 - x1) + (y - y1) * (y2 - y1)) / p1_p2_squareLength; if (dotProduct < 0) { return (x - x1) * (x - x1) + (y - y1) * (y - y1); } else if (dotProduct <= 1) { double p_p1_squareLength = (x1 - x) * (x1 - x) + (y1 - y) * (y1 - y); return p_p1_squareLength - dotProduct * dotProduct * p1_p2_squareLength; } else { return (x - x2) * (x - x2) + (y - y2) * (y - y2); } } bool accuratePointInTriangle(double x1, double y1, double x2, double y2, double x3, double y3, double x, double y) { if (!pointInTriangleBoundingBox(x1, y1, x2, y2, x3, y3, x, y)) { return false; } if (naivePointInTriangle(x1, y1, x2, y2, x3, y3, x, y)) { return true; } if (distanceSquarePointToSegment(x1, y1, x2, y2, x, y) <= EPS_SQUARE) { return true; } if (distanceSquarePointToSegment(x2, y2, x3, y3, x, y) <= EPS_SQUARE) { return true; } if (distanceSquarePointToSegment(x3, y3, x1, y1, x, y) <= EPS_SQUARE) { return true; } return false; } void printPoint(double x, double y) { std::cout << '(' << x << ", " << y << ')'; } void printTriangle(double x1, double y1, double x2, double y2, double x3, double y3) { std::cout << "Triangle is ["; printPoint(x1, y1); std::cout << ", "; printPoint(x2, y2); std::cout << ", "; printPoint(x3, y3); std::cout << "]\n"; } void test(double x1, double y1, double x2, double y2, double x3, double y3, double x, double y) { printTriangle(x1, y1, x2, y2, x3, y3); std::cout << "Point "; printPoint(x, y); std::cout << " is within triangle? "; if (accuratePointInTriangle(x1, y1, x2, y2, x3, y3, x, y)) { std::cout << "true\n"; } else { std::cout << "false\n"; } } int main() { test(1.5, 2.4, 5.1, -3.1, -3.8, 1.2, 0, 0); test(1.5, 2.4, 5.1, -3.1, -3.8, 1.2, 0, 1); test(1.5, 2.4, 5.1, -3.1, -3.8, 1.2, 3, 1); std::cout << '\n'; test(0.1, 0.1111111111111111, 12.5, 33.333333333333336, 25, 11.11111111111111, 5.414285714285714, 14.349206349206348); std::cout << '\n'; test(0.1, 0.1111111111111111, 12.5, 33.333333333333336, -12.5, 16.666666666666668, 5.414285714285714, 14.349206349206348); std::cout << '\n'; return 0; }
Change the programming language of this snippet from C to C++ without modifying what it does.
#include <stdbool.h> #include <stdio.h> #include <stdlib.h> const double EPS = 0.001; const double EPS_SQUARE = 0.000001; double side(double x1, double y1, double x2, double y2, double x, double y) { return (y2 - y1) * (x - x1) + (-x2 + x1) * (y - y1); } bool naivePointInTriangle(double x1, double y1, double x2, double y2, double x3, double y3, double x, double y) { double checkSide1 = side(x1, y1, x2, y2, x, y) >= 0; double checkSide2 = side(x2, y2, x3, y3, x, y) >= 0; double checkSide3 = side(x3, y3, x1, y1, x, y) >= 0; return checkSide1 && checkSide2 && checkSide3; } bool pointInTriangleBoundingBox(double x1, double y1, double x2, double y2, double x3, double y3, double x, double y) { double xMin = min(x1, min(x2, x3)) - EPS; double xMax = max(x1, max(x2, x3)) + EPS; double yMin = min(y1, min(y2, y3)) - EPS; double yMax = max(y1, max(y2, y3)) + EPS; return !(x < xMin || xMax < x || y < yMin || yMax < y); } double distanceSquarePointToSegment(double x1, double y1, double x2, double y2, double x, double y) { double p1_p2_squareLength = (x2 - x1) * (x2 - x1) + (y2 - y1) * (y2 - y1); double dotProduct = ((x - x1) * (x2 - x1) + (y - y1) * (y2 - y1)) / p1_p2_squareLength; if (dotProduct < 0) { return (x - x1) * (x - x1) + (y - y1) * (y - y1); } else if (dotProduct <= 1) { double p_p1_squareLength = (x1 - x) * (x1 - x) + (y1 - y) * (y1 - y); return p_p1_squareLength - dotProduct * dotProduct * p1_p2_squareLength; } else { return (x - x2) * (x - x2) + (y - y2) * (y - y2); } } bool accuratePointInTriangle(double x1, double y1, double x2, double y2, double x3, double y3, double x, double y) { if (!pointInTriangleBoundingBox(x1, y1, x2, y2, x3, y3, x, y)) { return false; } if (naivePointInTriangle(x1, y1, x2, y2, x3, y3, x, y)) { return true; } if (distanceSquarePointToSegment(x1, y1, x2, y2, x, y) <= EPS_SQUARE) { return true; } if (distanceSquarePointToSegment(x2, y2, x3, y3, x, y) <= EPS_SQUARE) { return true; } if (distanceSquarePointToSegment(x3, y3, x1, y1, x, y) <= EPS_SQUARE) { return true; } return false; } void printPoint(double x, double y) { printf("(%f, %f)", x, y); } void printTriangle(double x1, double y1, double x2, double y2, double x3, double y3) { printf("Triangle is ["); printPoint(x1, y1); printf(", "); printPoint(x2, y2); printf(", "); printPoint(x3, y3); printf("] \n"); } void test(double x1, double y1, double x2, double y2, double x3, double y3, double x, double y) { printTriangle(x1, y1, x2, y2, x3, y3); printf("Point "); printPoint(x, y); printf(" is within triangle? "); if (accuratePointInTriangle(x1, y1, x2, y2, x3, y3, x, y)) { printf("true\n"); } else { printf("false\n"); } } int main() { test(1.5, 2.4, 5.1, -3.1, -3.8, 1.2, 0, 0); test(1.5, 2.4, 5.1, -3.1, -3.8, 1.2, 0, 1); test(1.5, 2.4, 5.1, -3.1, -3.8, 1.2, 3, 1); printf("\n"); test(0.1, 0.1111111111111111, 12.5, 33.333333333333336, 25, 11.11111111111111, 5.414285714285714, 14.349206349206348); printf("\n"); test(0.1, 0.1111111111111111, 12.5, 33.333333333333336, -12.5, 16.666666666666668, 5.414285714285714, 14.349206349206348); printf("\n"); return 0; }
#include <iostream> const double EPS = 0.001; const double EPS_SQUARE = EPS * EPS; double side(double x1, double y1, double x2, double y2, double x, double y) { return (y2 - y1) * (x - x1) + (-x2 + x1) * (y - y1); } bool naivePointInTriangle(double x1, double y1, double x2, double y2, double x3, double y3, double x, double y) { double checkSide1 = side(x1, y1, x2, y2, x, y) >= 0; double checkSide2 = side(x2, y2, x3, y3, x, y) >= 0; double checkSide3 = side(x3, y3, x1, y1, x, y) >= 0; return checkSide1 && checkSide2 && checkSide3; } bool pointInTriangleBoundingBox(double x1, double y1, double x2, double y2, double x3, double y3, double x, double y) { double xMin = std::min(x1, std::min(x2, x3)) - EPS; double xMax = std::max(x1, std::max(x2, x3)) + EPS; double yMin = std::min(y1, std::min(y2, y3)) - EPS; double yMax = std::max(y1, std::max(y2, y3)) + EPS; return !(x < xMin || xMax < x || y < yMin || yMax < y); } double distanceSquarePointToSegment(double x1, double y1, double x2, double y2, double x, double y) { double p1_p2_squareLength = (x2 - x1) * (x2 - x1) + (y2 - y1) * (y2 - y1); double dotProduct = ((x - x1) * (x2 - x1) + (y - y1) * (y2 - y1)) / p1_p2_squareLength; if (dotProduct < 0) { return (x - x1) * (x - x1) + (y - y1) * (y - y1); } else if (dotProduct <= 1) { double p_p1_squareLength = (x1 - x) * (x1 - x) + (y1 - y) * (y1 - y); return p_p1_squareLength - dotProduct * dotProduct * p1_p2_squareLength; } else { return (x - x2) * (x - x2) + (y - y2) * (y - y2); } } bool accuratePointInTriangle(double x1, double y1, double x2, double y2, double x3, double y3, double x, double y) { if (!pointInTriangleBoundingBox(x1, y1, x2, y2, x3, y3, x, y)) { return false; } if (naivePointInTriangle(x1, y1, x2, y2, x3, y3, x, y)) { return true; } if (distanceSquarePointToSegment(x1, y1, x2, y2, x, y) <= EPS_SQUARE) { return true; } if (distanceSquarePointToSegment(x2, y2, x3, y3, x, y) <= EPS_SQUARE) { return true; } if (distanceSquarePointToSegment(x3, y3, x1, y1, x, y) <= EPS_SQUARE) { return true; } return false; } void printPoint(double x, double y) { std::cout << '(' << x << ", " << y << ')'; } void printTriangle(double x1, double y1, double x2, double y2, double x3, double y3) { std::cout << "Triangle is ["; printPoint(x1, y1); std::cout << ", "; printPoint(x2, y2); std::cout << ", "; printPoint(x3, y3); std::cout << "]\n"; } void test(double x1, double y1, double x2, double y2, double x3, double y3, double x, double y) { printTriangle(x1, y1, x2, y2, x3, y3); std::cout << "Point "; printPoint(x, y); std::cout << " is within triangle? "; if (accuratePointInTriangle(x1, y1, x2, y2, x3, y3, x, y)) { std::cout << "true\n"; } else { std::cout << "false\n"; } } int main() { test(1.5, 2.4, 5.1, -3.1, -3.8, 1.2, 0, 0); test(1.5, 2.4, 5.1, -3.1, -3.8, 1.2, 0, 1); test(1.5, 2.4, 5.1, -3.1, -3.8, 1.2, 3, 1); std::cout << '\n'; test(0.1, 0.1111111111111111, 12.5, 33.333333333333336, 25, 11.11111111111111, 5.414285714285714, 14.349206349206348); std::cout << '\n'; test(0.1, 0.1111111111111111, 12.5, 33.333333333333336, -12.5, 16.666666666666668, 5.414285714285714, 14.349206349206348); std::cout << '\n'; return 0; }
Rewrite this program in C++ while keeping its functionality equivalent to the C version.
#include <stdio.h> unsigned int divisor_count(unsigned int n) { unsigned int total = 1; for (; (n & 1) == 0; n >>= 1) { ++total; } for (unsigned int p = 3; p * p <= n; p += 2) { unsigned int count = 1; for (; n % p == 0; n /= p) { ++count; } total *= count; } if (n > 1) { total *= 2; } return total; } int main() { const unsigned int limit = 100; unsigned int n; printf("Count of divisors for the first %d positive integers:\n", limit); for (n = 1; n <= limit; ++n) { printf("%3d", divisor_count(n)); if (n % 20 == 0) { printf("\n"); } } return 0; }
#include <iomanip> #include <iostream> unsigned int divisor_count(unsigned int n) { unsigned int total = 1; for (; (n & 1) == 0; n >>= 1) ++total; for (unsigned int p = 3; p * p <= n; p += 2) { unsigned int count = 1; for (; n % p == 0; n /= p) ++count; total *= count; } if (n > 1) total *= 2; return total; } int main() { const unsigned int limit = 100; std::cout << "Count of divisors for the first " << limit << " positive integers:\n"; for (unsigned int n = 1; n <= limit; ++n) { std::cout << std::setw(3) << divisor_count(n); if (n % 20 == 0) std::cout << '\n'; } }
Change the following C code into C++ without altering its purpose.
#include <stdio.h> unsigned int divisor_count(unsigned int n) { unsigned int total = 1; for (; (n & 1) == 0; n >>= 1) { ++total; } for (unsigned int p = 3; p * p <= n; p += 2) { unsigned int count = 1; for (; n % p == 0; n /= p) { ++count; } total *= count; } if (n > 1) { total *= 2; } return total; } int main() { const unsigned int limit = 100; unsigned int n; printf("Count of divisors for the first %d positive integers:\n", limit); for (n = 1; n <= limit; ++n) { printf("%3d", divisor_count(n)); if (n % 20 == 0) { printf("\n"); } } return 0; }
#include <iomanip> #include <iostream> unsigned int divisor_count(unsigned int n) { unsigned int total = 1; for (; (n & 1) == 0; n >>= 1) ++total; for (unsigned int p = 3; p * p <= n; p += 2) { unsigned int count = 1; for (; n % p == 0; n /= p) ++count; total *= count; } if (n > 1) total *= 2; return total; } int main() { const unsigned int limit = 100; std::cout << "Count of divisors for the first " << limit << " positive integers:\n"; for (unsigned int n = 1; n <= limit; ++n) { std::cout << std::setw(3) << divisor_count(n); if (n % 20 == 0) std::cout << '\n'; } }
Write a version of this C function in C++ with identical behavior.
#include <stdio.h> int main() { int intspace; int *address; address = &intspace; *address = 65535; printf("%p: %08x (=%08x)\n", address, *address, intspace); *((char*)address) = 0x00; *((char*)address+1) = 0x00; *((char*)address+2) = 0xff; *((char*)address+3) = 0xff; printf("%p: %08x (=%08x)\n", address, *address, intspace); return 0; }
#include <string> #include <iostream> int main() { char* data = new char[sizeof(std::string)]; std::string* stringPtr = new (data) std::string("ABCD"); std::cout << *stringPtr << " 0x" << stringPtr << std::endl; stringPtr->~basic_string(); stringPtr = new (data) std::string("123456"); std::cout << *stringPtr << " 0x" << stringPtr << std::endl; stringPtr->~basic_string(); delete[] data; }
Convert this C snippet to C++ and keep its semantics consistent.
#include <gmp.h> int main(void) { mpz_t p, s; mpz_init_set_ui(p, 1); mpz_init_set_ui(s, 1); for (int n = 1, i = 0; i < 20; n++) { mpz_nextprime(s, s); mpz_mul(p, p, s); mpz_add_ui(p, p, 1); if (mpz_probab_prime_p(p, 25)) { mpz_sub_ui(p, p, 1); gmp_printf("%d\n", n); i++; continue; } mpz_sub_ui(p, p, 2); if (mpz_probab_prime_p(p, 25)) { mpz_add_ui(p, p, 1); gmp_printf("%d\n", n); i++; continue; } mpz_add_ui(p, p, 1); } mpz_clear(s); mpz_clear(p); }
#include <cstdint> #include <iostream> #include <sstream> #include <gmpxx.h> typedef mpz_class integer; bool is_probably_prime(const integer& n) { return mpz_probab_prime_p(n.get_mpz_t(), 25) != 0; } bool is_prime(unsigned int n) { if (n < 2) return false; if (n % 2 == 0) return n == 2; if (n % 3 == 0) return n == 3; for (unsigned int p = 5; p * p <= n; p += 4) { if (n % p == 0) return false; p += 2; if (n % p == 0) return false; } return true; } int main() { const unsigned int max = 20; integer primorial = 1; for (unsigned int p = 0, count = 0, index = 0; count < max; ++p) { if (!is_prime(p)) continue; primorial *= p; ++index; if (is_probably_prime(primorial - 1) || is_probably_prime(primorial + 1)) { if (count > 0) std::cout << ' '; std::cout << index; ++count; } } std::cout << '\n'; return 0; }
Generate an equivalent C++ version of this C code.
#include<string.h> #include<stdlib.h> #include<stdio.h> typedef struct genome{ char* strand; int length; struct genome* next; }genome; genome* genomeData; int totalLength = 0, Adenine = 0, Cytosine = 0, Guanine = 0, Thymine = 0; int numDigits(int num){ int len = 1; while(num>10){ num = num/10; len++; } return len; } void buildGenome(char str[100]){ int len = strlen(str),i; genome *genomeIterator, *newGenome; totalLength += len; for(i=0;i<len;i++){ switch(str[i]){ case 'A': Adenine++; break; case 'T': Thymine++; break; case 'C': Cytosine++; break; case 'G': Guanine++; break; }; } if(genomeData==NULL){ genomeData = (genome*)malloc(sizeof(genome)); genomeData->strand = (char*)malloc(len*sizeof(char)); strcpy(genomeData->strand,str); genomeData->length = len; genomeData->next = NULL; } else{ genomeIterator = genomeData; while(genomeIterator->next!=NULL) genomeIterator = genomeIterator->next; newGenome = (genome*)malloc(sizeof(genome)); newGenome->strand = (char*)malloc(len*sizeof(char)); strcpy(newGenome->strand,str); newGenome->length = len; newGenome->next = NULL; genomeIterator->next = newGenome; } } void printGenome(){ genome* genomeIterator = genomeData; int width = numDigits(totalLength), len = 0; printf("Sequence:\n"); while(genomeIterator!=NULL){ printf("\n%*d%3s%3s",width+1,len,":",genomeIterator->strand); len += genomeIterator->length; genomeIterator = genomeIterator->next; } printf("\n\nBase Count\n----------\n\n"); printf("%3c%3s%*d\n",'A',":",width+1,Adenine); printf("%3c%3s%*d\n",'T',":",width+1,Thymine); printf("%3c%3s%*d\n",'C',":",width+1,Cytosine); printf("%3c%3s%*d\n",'G',":",width+1,Guanine); printf("\n%3s%*d\n","Total:",width+1,Adenine + Thymine + Cytosine + Guanine); free(genomeData); } int main(int argc,char** argv) { char str[100]; int counter = 0, len; if(argc!=2){ printf("Usage : %s <Gene file name>\n",argv[0]); return 0; } FILE *fp = fopen(argv[1],"r"); while(fscanf(fp,"%s",str)!=EOF) buildGenome(str); fclose(fp); printGenome(); return 0; }
#include <map> #include <string> #include <iostream> #include <iomanip> const std::string DEFAULT_DNA = "CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATG" "CTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTG" "AGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGAT" "GGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT" "CGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGG" "TCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA" "TTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTAT" "CGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTG" "TCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGAC" "GACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT"; class DnaBase { public: DnaBase(const std::string& dna = DEFAULT_DNA, int width = 50) : genome(dna), displayWidth(width) { for (auto elm : dna) { if (count.find(elm) == count.end()) count[elm] = 0; ++count[elm]; } } void viewGenome() { std::cout << "Sequence:" << std::endl; std::cout << std::endl; int limit = genome.size() / displayWidth; if (genome.size() % displayWidth != 0) ++limit; for (int i = 0; i < limit; ++i) { int beginPos = i * displayWidth; std::cout << std::setw(4) << beginPos << "  :" << std::setw(4) << genome.substr(beginPos, displayWidth) << std::endl; } std::cout << std::endl; std::cout << "Base Count" << std::endl; std::cout << "----------" << std::endl; std::cout << std::endl; int total = 0; for (auto elm : count) { std::cout << std::setw(4) << elm.first << " : " << elm.second << std::endl; total += elm.second; } std::cout << std::endl; std::cout << "Total: " << total << std::endl; } private: std::string genome; std::map<char, int> count; int displayWidth; }; int main(void) { auto d = new DnaBase(); d->viewGenome(); delete d; return 0; }
Preserve the algorithm and functionality while converting the code from C to C++.
#include<string.h> #include<stdlib.h> #include<stdio.h> typedef struct genome{ char* strand; int length; struct genome* next; }genome; genome* genomeData; int totalLength = 0, Adenine = 0, Cytosine = 0, Guanine = 0, Thymine = 0; int numDigits(int num){ int len = 1; while(num>10){ num = num/10; len++; } return len; } void buildGenome(char str[100]){ int len = strlen(str),i; genome *genomeIterator, *newGenome; totalLength += len; for(i=0;i<len;i++){ switch(str[i]){ case 'A': Adenine++; break; case 'T': Thymine++; break; case 'C': Cytosine++; break; case 'G': Guanine++; break; }; } if(genomeData==NULL){ genomeData = (genome*)malloc(sizeof(genome)); genomeData->strand = (char*)malloc(len*sizeof(char)); strcpy(genomeData->strand,str); genomeData->length = len; genomeData->next = NULL; } else{ genomeIterator = genomeData; while(genomeIterator->next!=NULL) genomeIterator = genomeIterator->next; newGenome = (genome*)malloc(sizeof(genome)); newGenome->strand = (char*)malloc(len*sizeof(char)); strcpy(newGenome->strand,str); newGenome->length = len; newGenome->next = NULL; genomeIterator->next = newGenome; } } void printGenome(){ genome* genomeIterator = genomeData; int width = numDigits(totalLength), len = 0; printf("Sequence:\n"); while(genomeIterator!=NULL){ printf("\n%*d%3s%3s",width+1,len,":",genomeIterator->strand); len += genomeIterator->length; genomeIterator = genomeIterator->next; } printf("\n\nBase Count\n----------\n\n"); printf("%3c%3s%*d\n",'A',":",width+1,Adenine); printf("%3c%3s%*d\n",'T',":",width+1,Thymine); printf("%3c%3s%*d\n",'C',":",width+1,Cytosine); printf("%3c%3s%*d\n",'G',":",width+1,Guanine); printf("\n%3s%*d\n","Total:",width+1,Adenine + Thymine + Cytosine + Guanine); free(genomeData); } int main(int argc,char** argv) { char str[100]; int counter = 0, len; if(argc!=2){ printf("Usage : %s <Gene file name>\n",argv[0]); return 0; } FILE *fp = fopen(argv[1],"r"); while(fscanf(fp,"%s",str)!=EOF) buildGenome(str); fclose(fp); printGenome(); return 0; }
#include <map> #include <string> #include <iostream> #include <iomanip> const std::string DEFAULT_DNA = "CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATG" "CTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTG" "AGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGAT" "GGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT" "CGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGG" "TCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA" "TTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTAT" "CGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTG" "TCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGAC" "GACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT"; class DnaBase { public: DnaBase(const std::string& dna = DEFAULT_DNA, int width = 50) : genome(dna), displayWidth(width) { for (auto elm : dna) { if (count.find(elm) == count.end()) count[elm] = 0; ++count[elm]; } } void viewGenome() { std::cout << "Sequence:" << std::endl; std::cout << std::endl; int limit = genome.size() / displayWidth; if (genome.size() % displayWidth != 0) ++limit; for (int i = 0; i < limit; ++i) { int beginPos = i * displayWidth; std::cout << std::setw(4) << beginPos << "  :" << std::setw(4) << genome.substr(beginPos, displayWidth) << std::endl; } std::cout << std::endl; std::cout << "Base Count" << std::endl; std::cout << "----------" << std::endl; std::cout << std::endl; int total = 0; for (auto elm : count) { std::cout << std::setw(4) << elm.first << " : " << elm.second << std::endl; total += elm.second; } std::cout << std::endl; std::cout << "Total: " << total << std::endl; } private: std::string genome; std::map<char, int> count; int displayWidth; }; int main(void) { auto d = new DnaBase(); d->viewGenome(); delete d; return 0; }
Generate a C++ translation of this C snippet without changing its computational steps.
#include <pthread.h> #include <stdio.h> #include <stdlib.h> #include <unistd.h> #include <stdarg.h> #define N 5 const char *names[N] = { "Aristotle", "Kant", "Spinoza", "Marx", "Russell" }; pthread_mutex_t forks[N]; #define M 5 const char *topic[M] = { "Spaghetti!", "Life", "Universe", "Everything", "Bathroom" }; #define lock pthread_mutex_lock #define unlock pthread_mutex_unlock #define xy(x, y) printf("\033[%d;%dH", x, y) #define clear_eol(x) print(x, 12, "\033[K") void print(int y, int x, const char *fmt, ...) { static pthread_mutex_t screen = PTHREAD_MUTEX_INITIALIZER; va_list ap; va_start(ap, fmt); lock(&screen); xy(y + 1, x), vprintf(fmt, ap); xy(N + 1, 1), fflush(stdout); unlock(&screen); } void eat(int id) { int f[2], ration, i; f[0] = f[1] = id; f[id & 1] = (id + 1) % N; clear_eol(id); print(id, 12, "..oO (forks, need forks)"); for (i = 0; i < 2; i++) { lock(forks + f[i]); if (!i) clear_eol(id); print(id, 12 + (f[i] != id) * 6, "fork%d", f[i]); sleep(1); } for (i = 0, ration = 3 + rand() % 8; i < ration; i++) print(id, 24 + i * 4, "nom"), sleep(1); for (i = 0; i < 2; i++) unlock(forks + f[i]); } void think(int id) { int i, t; char buf[64] = {0}; do { clear_eol(id); sprintf(buf, "..oO (%s)", topic[t = rand() % M]); for (i = 0; buf[i]; i++) { print(id, i+12, "%c", buf[i]); if (i < 5) usleep(200000); } usleep(500000 + rand() % 1000000); } while (t); } void* philosophize(void *a) { int id = *(int*)a; print(id, 1, "%10s", names[id]); while(1) think(id), eat(id); } int main() { int i, id[N]; pthread_t tid[N]; for (i = 0; i < N; i++) pthread_mutex_init(forks + (id[i] = i), 0); for (i = 0; i < N; i++) pthread_create(tid + i, 0, philosophize, id + i); return pthread_join(tid[0], 0); }
#include <algorithm> #include <array> #include <chrono> #include <iostream> #include <mutex> #include <random> #include <string> #include <string_view> #include <thread> const int timeScale = 42; void Message(std::string_view message) { static std::mutex cout_mutex; std::scoped_lock cout_lock(cout_mutex); std::cout << message << std::endl; } struct Fork { std::mutex mutex; }; struct Dinner { std::array<Fork, 5> forks; ~Dinner() { Message("Dinner is over"); } }; class Philosopher { std::mt19937 rng{std::random_device {}()}; const std::string name; Fork& left; Fork& right; std::thread worker; void live(); void dine(); void ponder(); public: Philosopher(std::string name_, Fork& l, Fork& r) : name(std::move(name_)), left(l), right(r), worker(&Philosopher::live, this) {} ~Philosopher() { worker.join(); Message(name + " went to sleep."); } }; void Philosopher::live() { for(;;) { { std::scoped_lock dine_lock(left.mutex, right.mutex); dine(); } ponder(); } } void Philosopher::dine() { Message(name + " started eating."); thread_local std::array<const char*, 3> foods {"chicken", "rice", "soda"}; thread_local std::array<const char*, 3> reactions { "I like this %s!", "This %s is good.", "Mmm, %s..." }; thread_local std::uniform_int_distribution<> dist(1, 6); std::shuffle( foods.begin(), foods.end(), rng); std::shuffle(reactions.begin(), reactions.end(), rng); constexpr size_t buf_size = 64; char buffer[buf_size]; for(int i = 0; i < 3; ++i) { std::this_thread::sleep_for(std::chrono::milliseconds(dist(rng) * timeScale)); snprintf(buffer, buf_size, reactions[i], foods[i]); Message(name + ": " + buffer); } std::this_thread::sleep_for(std::chrono::milliseconds(dist(rng)) * timeScale); Message(name + " finished and left."); } void Philosopher::ponder() { static constexpr std::array<const char*, 5> topics {{ "politics", "art", "meaning of life", "source of morality", "how many straws makes a bale" }}; thread_local std::uniform_int_distribution<> wait(1, 6); thread_local std::uniform_int_distribution<> dist(0, topics.size() - 1); while(dist(rng) > 0) { std::this_thread::sleep_for(std::chrono::milliseconds(wait(rng) * 3 * timeScale)); Message(name + " is pondering about " + topics[dist(rng)] + "."); } std::this_thread::sleep_for(std::chrono::milliseconds(wait(rng) * 3 * timeScale)); Message(name + " is hungry again!"); } int main() { Dinner dinner; Message("Dinner started!"); std::array<Philosopher, 5> philosophers {{ {"Aristotle", dinner.forks[0], dinner.forks[1]}, {"Democritus", dinner.forks[1], dinner.forks[2]}, {"Plato", dinner.forks[2], dinner.forks[3]}, {"Pythagoras", dinner.forks[3], dinner.forks[4]}, {"Socrates", dinner.forks[4], dinner.forks[0]}, }}; Message("It is dark outside..."); }
Translate this program into C++ but keep the logic exactly as in C.
#include <stdio.h> int main() { int n, b, d; unsigned long long i, j, sum, fact[12]; fact[0] = 1; for (n = 1; n < 12; ++n) { fact[n] = fact[n-1] * n; } for (b = 9; b <= 12; ++b) { printf("The factorions for base %d are:\n", b); for (i = 1; i < 1500000; ++i) { sum = 0; j = i; while (j > 0) { d = j % b; sum += fact[d]; j /= b; } if (sum == i) printf("%llu ", i); } printf("\n\n"); } return 0; }
#include <iostream> class factorion_t { public: factorion_t() { f[0] = 1u; for (uint n = 1u; n < 12u; n++) f[n] = f[n - 1] * n; } bool operator()(uint i, uint b) const { uint sum = 0; for (uint j = i; j > 0u; j /= b) sum += f[j % b]; return sum == i; } private: ulong f[12]; }; int main() { factorion_t factorion; for (uint b = 9u; b <= 12u; ++b) { std::cout << "factorions for base " << b << ':'; for (uint i = 1u; i < 1500000u; ++i) if (factorion(i, b)) std::cout << ' ' << i; std::cout << std::endl; } return 0; }
Transform the following C implementation into C++, maintaining the same output and logic.
#include <stdio.h> int main() { int n, b, d; unsigned long long i, j, sum, fact[12]; fact[0] = 1; for (n = 1; n < 12; ++n) { fact[n] = fact[n-1] * n; } for (b = 9; b <= 12; ++b) { printf("The factorions for base %d are:\n", b); for (i = 1; i < 1500000; ++i) { sum = 0; j = i; while (j > 0) { d = j % b; sum += fact[d]; j /= b; } if (sum == i) printf("%llu ", i); } printf("\n\n"); } return 0; }
#include <iostream> class factorion_t { public: factorion_t() { f[0] = 1u; for (uint n = 1u; n < 12u; n++) f[n] = f[n - 1] * n; } bool operator()(uint i, uint b) const { uint sum = 0; for (uint j = i; j > 0u; j /= b) sum += f[j % b]; return sum == i; } private: ulong f[12]; }; int main() { factorion_t factorion; for (uint b = 9u; b <= 12u; ++b) { std::cout << "factorions for base " << b << ':'; for (uint i = 1u; i < 1500000u; ++i) if (factorion(i, b)) std::cout << ' ' << i; std::cout << std::endl; } return 0; }
Convert the following code from C to C++, ensuring the logic remains intact.
#include <math.h> #include <stdio.h> const double K = 7.8e9; const int n0 = 27; const double actual[] = { 27, 27, 27, 44, 44, 59, 59, 59, 59, 59, 59, 59, 59, 60, 60, 61, 61, 66, 83, 219, 239, 392, 534, 631, 897, 1350, 2023, 2820, 4587, 6067, 7823, 9826, 11946, 14554, 17372, 20615, 24522, 28273, 31491, 34933, 37552, 40540, 43105, 45177, 60328, 64543, 67103, 69265, 71332, 73327, 75191, 75723, 76719, 77804, 78812, 79339, 80132, 80995, 82101, 83365, 85203, 87024, 89068, 90664, 93077, 95316, 98172, 102133, 105824, 109695, 114232, 118610, 125497, 133852, 143227, 151367, 167418, 180096, 194836, 213150, 242364, 271106, 305117, 338133, 377918, 416845, 468049, 527767, 591704, 656866, 715353, 777796, 851308, 928436, 1000249, 1082054, 1174652 }; const size_t actual_size = sizeof(actual) / sizeof(double); double f(double r) { double sq = 0; size_t i; for (i = 0; i < actual_size; ++i) { double eri = exp(r * i); double guess = (n0 * eri) / (1 + n0 * (eri - 1) / K); double diff = guess - actual[i]; sq += diff * diff; } return sq; } double solve(double (*fn)(double), double guess, double epsilon) { double delta, f0, factor; for (delta = guess ? guess : 1, f0 = fn(guess), factor = 2; delta > epsilon && guess != guess - delta; delta *= factor) { double nf = (*fn)(guess - delta); if (nf < f0) { f0 = nf; guess -= delta; } else { nf = fn(guess + delta); if (nf < f0) { f0 = nf; guess += delta; } else { factor = 0.5; } } } return guess; } double solve_default(double (*fn)(double)) { return solve(fn, 0.5, 0); } int main() { double r = solve_default(f); double R0 = exp(12 * r); printf("r = %f, R0 = %f\n", r, R0); return 0; }
#include <cmath> #include <functional> #include <iostream> constexpr double K = 7.8e9; constexpr int n0 = 27; constexpr double actual[] = { 27, 27, 27, 44, 44, 59, 59, 59, 59, 59, 59, 59, 59, 60, 60, 61, 61, 66, 83, 219, 239, 392, 534, 631, 897, 1350, 2023, 2820, 4587, 6067, 7823, 9826, 11946, 14554, 17372, 20615, 24522, 28273, 31491, 34933, 37552, 40540, 43105, 45177, 60328, 64543, 67103, 69265, 71332, 73327, 75191, 75723, 76719, 77804, 78812, 79339, 80132, 80995, 82101, 83365, 85203, 87024, 89068, 90664, 93077, 95316, 98172, 102133, 105824, 109695, 114232, 118610, 125497, 133852, 143227, 151367, 167418, 180096, 194836, 213150, 242364, 271106, 305117, 338133, 377918, 416845, 468049, 527767, 591704, 656866, 715353, 777796, 851308, 928436, 1000249, 1082054, 1174652 }; double f(double r) { double sq = 0; constexpr size_t len = std::size(actual); for (size_t i = 0; i < len; ++i) { double eri = std::exp(r * i); double guess = (n0 * eri)/(1 + n0 * (eri - 1)/K); double diff = guess - actual[i]; sq += diff * diff; } return sq; } double solve(std::function<double(double)> fn, double guess=0.5, double epsilon=0) { for (double delta = guess ? guess : 1, f0 = fn(guess), factor = 2; delta > epsilon && guess != guess - delta; delta *= factor) { double nf = fn(guess - delta); if (nf < f0) { f0 = nf; guess -= delta; } else { nf = fn(guess + delta); if (nf < f0) { f0 = nf; guess += delta; } else factor = 0.5; } } return guess; } int main() { double r = solve(f); double R0 = std::exp(12 * r); std::cout << "r = " << r << ", R0 = " << R0 << '\n'; return 0; }
Maintain the same structure and functionality when rewriting this code in C++.
#include <stdio.h> typedef struct node_t *node, node_t; struct node_t { int v; node next; }; typedef struct { node head, tail; } slist; void push(slist *l, node e) { if (!l->head) l->head = e; if (l->tail) l->tail->next = e; l->tail = e; } node removehead(slist *l) { node e = l->head; if (e) { l->head = e->next; e->next = 0; } return e; } void join(slist *a, slist *b) { push(a, b->head); a->tail = b->tail; } void merge(slist *a, slist *b) { slist r = {0}; while (a->head && b->head) push(&r, removehead(a->head->v <= b->head->v ? a : b)); join(&r, a->head ? a : b); *a = r; b->head = b->tail = 0; } void sort(int *ar, int len) { node_t all[len]; for (int i = 0; i < len; i++) all[i].v = ar[i], all[i].next = i < len - 1 ? all + i + 1 : 0; slist list = {all, all + len - 1}, rem, strand = {0}, res = {0}; for (node e = 0; list.head; list = rem) { rem.head = rem.tail = 0; while ((e = removehead(&list))) push((!strand.head || e->v >= strand.tail->v) ? &strand : &rem, e); merge(&res, &strand); } for (int i = 0; res.head; i++, res.head = res.head->next) ar[i] = res.head->v; } void show(const char *title, int *x, int len) { printf("%s ", title); for (int i = 0; i < len; i++) printf("%3d ", x[i]); putchar('\n'); } int main(void) { int x[] = {-2,0,-2,5,5,3,-1,-3,5,5,0,2,-4,4,2}; # define SIZE sizeof(x)/sizeof(int) show("before sort:", x, SIZE); sort(x, sizeof(x)/sizeof(int)); show("after sort: ", x, SIZE); return 0; }
#include <list> template <typename T> std::list<T> strandSort(std::list<T> lst) { if (lst.size() <= 1) return lst; std::list<T> result; std::list<T> sorted; while (!lst.empty()) { sorted.push_back(lst.front()); lst.pop_front(); for (typename std::list<T>::iterator it = lst.begin(); it != lst.end(); ) { if (sorted.back() <= *it) { sorted.push_back(*it); it = lst.erase(it); } else it++; } result.merge(sorted); } return result; }
Please provide an equivalent version of this C code in C++.
#include <stdbool.h> #include <stdio.h> #include <string.h> void memoizeIsPrime( bool * result, const int N ) { result[2] = true; result[3] = true; int prime[N]; prime[0] = 3; int end = 1; for (int n = 5; n < N; n += 2) { bool n_is_prime = true; for (int i = 0; i < end; ++i) { const int PRIME = prime[i]; if (n % PRIME == 0) { n_is_prime = false; break; } if (PRIME * PRIME > n) { break; } } if (n_is_prime) { prime[end++] = n; result[n] = true; } } } int sumOfDecimalDigits( int n ) { int sum = 0; while (n > 0) { sum += n % 10; n /= 10; } return sum; } int main( void ) { const int N = 500; printf( "Rosetta Code: additive primes less than %d:\n", N ); bool is_prime[N]; memset( is_prime, 0, sizeof(is_prime) ); memoizeIsPrime( is_prime, N ); printf( " 2" ); int count = 1; for (int i = 3; i < N; i += 2) { if (is_prime[i] && is_prime[sumOfDecimalDigits( i )]) { printf( "%4d", i ); ++count; if ((count % 10) == 0) { printf( "\n" ); } } } printf( "\nThose were %d additive primes.\n", count ); return 0; }
#include <iomanip> #include <iostream> bool is_prime(unsigned int n) { if (n < 2) return false; if (n % 2 == 0) return n == 2; if (n % 3 == 0) return n == 3; for (unsigned int p = 5; p * p <= n; p += 4) { if (n % p == 0) return false; p += 2; if (n % p == 0) return false; } return true; } unsigned int digit_sum(unsigned int n) { unsigned int sum = 0; for (; n > 0; n /= 10) sum += n % 10; return sum; } int main() { const unsigned int limit = 500; std::cout << "Additive primes less than " << limit << ":\n"; unsigned int count = 0; for (unsigned int n = 1; n < limit; ++n) { if (is_prime(digit_sum(n)) && is_prime(n)) { std::cout << std::setw(3) << n; if (++count % 10 == 0) std::cout << '\n'; else std::cout << ' '; } } std::cout << '\n' << count << " additive primes found.\n"; }
Convert this C snippet to C++ and keep its semantics consistent.
#include <stdio.h> #include <stdlib.h> #define otherwise do { register int _o = 2; do { switch (_o) { case 1: #define given(Mc) ;case 0: break; case 2: _o = !!(Mc); continue; } break; } while (1); } while (0) int foo() { return 1; } main() { int a = 0; otherwise a = 4 given (foo()); printf("%d\n", a); exit(0); }
class invertedAssign { int data; public: invertedAssign(int data):data(data){} int getData(){return data;} void operator=(invertedAssign& other) const { other.data = this->data; } }; #include <iostream> int main(){ invertedAssign a = 0; invertedAssign b = 42; std::cout << a.getData() << ' ' << b.getData() << '\n'; b = a; std::cout << a.getData() << ' ' << b.getData() << '\n'; }
Change the programming language of this snippet from C to C++ without modifying what it does.
#include <stdio.h> #include <stdlib.h> #define otherwise do { register int _o = 2; do { switch (_o) { case 1: #define given(Mc) ;case 0: break; case 2: _o = !!(Mc); continue; } break; } while (1); } while (0) int foo() { return 1; } main() { int a = 0; otherwise a = 4 given (foo()); printf("%d\n", a); exit(0); }
class invertedAssign { int data; public: invertedAssign(int data):data(data){} int getData(){return data;} void operator=(invertedAssign& other) const { other.data = this->data; } }; #include <iostream> int main(){ invertedAssign a = 0; invertedAssign b = 42; std::cout << a.getData() << ' ' << b.getData() << '\n'; b = a; std::cout << a.getData() << ' ' << b.getData() << '\n'; }
Generate an equivalent C++ version of this C code.
#include <stdio.h> #include <stdlib.h> #define otherwise do { register int _o = 2; do { switch (_o) { case 1: #define given(Mc) ;case 0: break; case 2: _o = !!(Mc); continue; } break; } while (1); } while (0) int foo() { return 1; } main() { int a = 0; otherwise a = 4 given (foo()); printf("%d\n", a); exit(0); }
class invertedAssign { int data; public: invertedAssign(int data):data(data){} int getData(){return data;} void operator=(invertedAssign& other) const { other.data = this->data; } }; #include <iostream> int main(){ invertedAssign a = 0; invertedAssign b = 42; std::cout << a.getData() << ' ' << b.getData() << '\n'; b = a; std::cout << a.getData() << ' ' << b.getData() << '\n'; }
Ensure the translated C++ code behaves exactly like the original C snippet.
#include<stdlib.h> #include<stdio.h> long totient(long n){ long tot = n,i; for(i=2;i*i<=n;i+=2){ if(n%i==0){ while(n%i==0) n/=i; tot-=tot/i; } if(i==2) i=1; } if(n>1) tot-=tot/n; return tot; } long* perfectTotients(long n){ long *ptList = (long*)malloc(n*sizeof(long)), m,count=0,sum,tot; for(m=1;count<n;m++){ tot = m; sum = 0; while(tot != 1){ tot = totient(tot); sum += tot; } if(sum == m) ptList[count++] = m; } return ptList; } long main(long argC, char* argV[]) { long *ptList,i,n; if(argC!=2) printf("Usage : %s <number of perfect Totient numbers required>",argV[0]); else{ n = atoi(argV[1]); ptList = perfectTotients(n); printf("The first %d perfect Totient numbers are : \n[",n); for(i=0;i<n;i++) printf(" %d,",ptList[i]); printf("\b]"); } return 0; }
#include <cassert> #include <iostream> #include <vector> class totient_calculator { public: explicit totient_calculator(int max) : totient_(max + 1) { for (int i = 1; i <= max; ++i) totient_[i] = i; for (int i = 2; i <= max; ++i) { if (totient_[i] < i) continue; for (int j = i; j <= max; j += i) totient_[j] -= totient_[j] / i; } } int totient(int n) const { assert (n >= 1 && n < totient_.size()); return totient_[n]; } bool is_prime(int n) const { return totient(n) == n - 1; } private: std::vector<int> totient_; }; bool perfect_totient_number(const totient_calculator& tc, int n) { int sum = 0; for (int m = n; m > 1; ) { int t = tc.totient(m); sum += t; m = t; } return sum == n; } int main() { totient_calculator tc(10000); int count = 0, n = 1; std::cout << "First 20 perfect totient numbers:\n"; for (; count < 20; ++n) { if (perfect_totient_number(tc, n)) { if (count > 0) std::cout << ' '; ++count; std::cout << n; } } std::cout << '\n'; return 0; }
Write a version of this C function in C++ with identical behavior.
#include<stdlib.h> #include<stdio.h> long totient(long n){ long tot = n,i; for(i=2;i*i<=n;i+=2){ if(n%i==0){ while(n%i==0) n/=i; tot-=tot/i; } if(i==2) i=1; } if(n>1) tot-=tot/n; return tot; } long* perfectTotients(long n){ long *ptList = (long*)malloc(n*sizeof(long)), m,count=0,sum,tot; for(m=1;count<n;m++){ tot = m; sum = 0; while(tot != 1){ tot = totient(tot); sum += tot; } if(sum == m) ptList[count++] = m; } return ptList; } long main(long argC, char* argV[]) { long *ptList,i,n; if(argC!=2) printf("Usage : %s <number of perfect Totient numbers required>",argV[0]); else{ n = atoi(argV[1]); ptList = perfectTotients(n); printf("The first %d perfect Totient numbers are : \n[",n); for(i=0;i<n;i++) printf(" %d,",ptList[i]); printf("\b]"); } return 0; }
#include <cassert> #include <iostream> #include <vector> class totient_calculator { public: explicit totient_calculator(int max) : totient_(max + 1) { for (int i = 1; i <= max; ++i) totient_[i] = i; for (int i = 2; i <= max; ++i) { if (totient_[i] < i) continue; for (int j = i; j <= max; j += i) totient_[j] -= totient_[j] / i; } } int totient(int n) const { assert (n >= 1 && n < totient_.size()); return totient_[n]; } bool is_prime(int n) const { return totient(n) == n - 1; } private: std::vector<int> totient_; }; bool perfect_totient_number(const totient_calculator& tc, int n) { int sum = 0; for (int m = n; m > 1; ) { int t = tc.totient(m); sum += t; m = t; } return sum == n; } int main() { totient_calculator tc(10000); int count = 0, n = 1; std::cout << "First 20 perfect totient numbers:\n"; for (; count < 20; ++n) { if (perfect_totient_number(tc, n)) { if (count > 0) std::cout << ' '; ++count; std::cout << n; } } std::cout << '\n'; return 0; }
Produce a functionally identical C++ code for the snippet given in C.
#include<stdlib.h> #include<stdio.h> long totient(long n){ long tot = n,i; for(i=2;i*i<=n;i+=2){ if(n%i==0){ while(n%i==0) n/=i; tot-=tot/i; } if(i==2) i=1; } if(n>1) tot-=tot/n; return tot; } long* perfectTotients(long n){ long *ptList = (long*)malloc(n*sizeof(long)), m,count=0,sum,tot; for(m=1;count<n;m++){ tot = m; sum = 0; while(tot != 1){ tot = totient(tot); sum += tot; } if(sum == m) ptList[count++] = m; } return ptList; } long main(long argC, char* argV[]) { long *ptList,i,n; if(argC!=2) printf("Usage : %s <number of perfect Totient numbers required>",argV[0]); else{ n = atoi(argV[1]); ptList = perfectTotients(n); printf("The first %d perfect Totient numbers are : \n[",n); for(i=0;i<n;i++) printf(" %d,",ptList[i]); printf("\b]"); } return 0; }
#include <cassert> #include <iostream> #include <vector> class totient_calculator { public: explicit totient_calculator(int max) : totient_(max + 1) { for (int i = 1; i <= max; ++i) totient_[i] = i; for (int i = 2; i <= max; ++i) { if (totient_[i] < i) continue; for (int j = i; j <= max; j += i) totient_[j] -= totient_[j] / i; } } int totient(int n) const { assert (n >= 1 && n < totient_.size()); return totient_[n]; } bool is_prime(int n) const { return totient(n) == n - 1; } private: std::vector<int> totient_; }; bool perfect_totient_number(const totient_calculator& tc, int n) { int sum = 0; for (int m = n; m > 1; ) { int t = tc.totient(m); sum += t; m = t; } return sum == n; } int main() { totient_calculator tc(10000); int count = 0, n = 1; std::cout << "First 20 perfect totient numbers:\n"; for (; count < 20; ++n) { if (perfect_totient_number(tc, n)) { if (count > 0) std::cout << ' '; ++count; std::cout << n; } } std::cout << '\n'; return 0; }
Keep all operations the same but rewrite the snippet in C++.
#include <stdio.h> #include <stdlib.h> #include <string.h> typedef const char * (*Responder)( int p1); typedef struct sDelegate { Responder operation; } *Delegate; Delegate NewDelegate( Responder rspndr ) { Delegate dl = malloc(sizeof(struct sDelegate)); dl->operation = rspndr; return dl; } const char *DelegateThing(Delegate dl, int p1) { return (dl->operation)? (*dl->operation)(p1) : NULL; } typedef struct sDelegator { int param; char *phrase; Delegate delegate; } *Delegator; const char * defaultResponse( int p1) { return "default implementation"; } static struct sDelegate defaultDel = { &defaultResponse }; Delegator NewDelegator( int p, char *phrase) { Delegator d = malloc(sizeof(struct sDelegator)); d->param = p; d->phrase = phrase; d->delegate = &defaultDel; return d; } const char *Delegator_Operation( Delegator theDelegator, int p1, Delegate delroy) { const char *rtn; if (delroy) { rtn = DelegateThing(delroy, p1); if (!rtn) { rtn = DelegateThing(theDelegator->delegate, p1); } } else rtn = DelegateThing(theDelegator->delegate, p1); printf("%s\n", theDelegator->phrase ); return rtn; } const char *thing1( int p1) { printf("We're in thing1 with value %d\n" , p1); return "delegate implementation"; } int main() { Delegate del1 = NewDelegate(&thing1); Delegate del2 = NewDelegate(NULL); Delegator theDelegator = NewDelegator( 14, "A stellar vista, Baby."); printf("Delegator returns %s\n\n", Delegator_Operation( theDelegator, 3, NULL)); printf("Delegator returns %s\n\n", Delegator_Operation( theDelegator, 3, del1)); printf("Delegator returns %s\n\n", Delegator_Operation( theDelegator, 3, del2)); return 0; }
#include <tr1/memory> #include <string> #include <iostream> #include <tr1/functional> using namespace std; using namespace std::tr1; using std::tr1::function; class IDelegate { public: virtual ~IDelegate() {} }; class IThing { public: virtual ~IThing() {} virtual std::string Thing() = 0; }; class DelegateA : virtual public IDelegate { }; class DelegateB : public IThing, public IDelegate { std::string Thing() { return "delegate implementation"; } }; class Delegator { public: std::string Operation() { if(Delegate) if (IThing * pThing = dynamic_cast<IThing*>(Delegate.get())) return pThing->Thing(); return "default implementation"; } shared_ptr<IDelegate> Delegate; }; int main() { shared_ptr<DelegateA> delegateA(new DelegateA()); shared_ptr<DelegateB> delegateB(new DelegateB()); Delegator delegator; std::cout << delegator.Operation() << std::endl; delegator.Delegate = delegateA; std::cout << delegator.Operation() << std::endl; delegator.Delegate = delegateB; std::cout << delegator.Operation() << std::endl; }
Convert this C block to C++, preserving its control flow and logic.
#include <stdio.h> unsigned int divisor_sum(unsigned int n) { unsigned int total = 1, power = 2; unsigned int p; for (; (n & 1) == 0; power <<= 1, n >>= 1) { total += power; } for (p = 3; p * p <= n; p += 2) { unsigned int sum = 1; for (power = p; n % p == 0; power *= p, n /= p) { sum += power; } total *= sum; } if (n > 1) { total *= n + 1; } return total; } int main() { const unsigned int limit = 100; unsigned int n; printf("Sum of divisors for the first %d positive integers:\n", limit); for (n = 1; n <= limit; ++n) { printf("%4d", divisor_sum(n)); if (n % 10 == 0) { printf("\n"); } } return 0; }
#include <iomanip> #include <iostream> unsigned int divisor_sum(unsigned int n) { unsigned int total = 1, power = 2; for (; (n & 1) == 0; power <<= 1, n >>= 1) total += power; for (unsigned int p = 3; p * p <= n; p += 2) { unsigned int sum = 1; for (power = p; n % p == 0; power *= p, n /= p) sum += power; total *= sum; } if (n > 1) total *= n + 1; return total; } int main() { const unsigned int limit = 100; std::cout << "Sum of divisors for the first " << limit << " positive integers:\n"; for (unsigned int n = 1; n <= limit; ++n) { std::cout << std::setw(4) << divisor_sum(n); if (n % 10 == 0) std::cout << '\n'; } }
Ensure the translated C++ code behaves exactly like the original C snippet.
#include <stdio.h> unsigned int divisor_sum(unsigned int n) { unsigned int total = 1, power = 2; unsigned int p; for (; (n & 1) == 0; power <<= 1, n >>= 1) { total += power; } for (p = 3; p * p <= n; p += 2) { unsigned int sum = 1; for (power = p; n % p == 0; power *= p, n /= p) { sum += power; } total *= sum; } if (n > 1) { total *= n + 1; } return total; } int main() { const unsigned int limit = 100; unsigned int n; printf("Sum of divisors for the first %d positive integers:\n", limit); for (n = 1; n <= limit; ++n) { printf("%4d", divisor_sum(n)); if (n % 10 == 0) { printf("\n"); } } return 0; }
#include <iomanip> #include <iostream> unsigned int divisor_sum(unsigned int n) { unsigned int total = 1, power = 2; for (; (n & 1) == 0; power <<= 1, n >>= 1) total += power; for (unsigned int p = 3; p * p <= n; p += 2) { unsigned int sum = 1; for (power = p; n % p == 0; power *= p, n /= p) sum += power; total *= sum; } if (n > 1) total *= n + 1; return total; } int main() { const unsigned int limit = 100; std::cout << "Sum of divisors for the first " << limit << " positive integers:\n"; for (unsigned int n = 1; n <= limit; ++n) { std::cout << std::setw(4) << divisor_sum(n); if (n % 10 == 0) std::cout << '\n'; } }
Convert this C block to C++, preserving its control flow and logic.
#include <ctype.h> #include <stdbool.h> #include <stdio.h> #include <stdlib.h> #include <string.h> const char* command_table = "Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy " "COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find " "NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput " "Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO " "MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT " "READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT " "RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up"; typedef struct command_tag { char* cmd; size_t length; size_t min_len; struct command_tag* next; } command_t; bool command_match(const command_t* command, const char* str) { size_t olen = strlen(str); return olen >= command->min_len && olen <= command->length && strncmp(str, command->cmd, olen) == 0; } char* uppercase(char* str, size_t n) { for (size_t i = 0; i < n; ++i) str[i] = toupper((unsigned char)str[i]); return str; } size_t get_min_length(const char* str, size_t n) { size_t len = 0; while (len < n && isupper((unsigned char)str[len])) ++len; return len; } void fatal(const char* message) { fprintf(stderr, "%s\n", message); exit(1); } void* xmalloc(size_t n) { void* ptr = malloc(n); if (ptr == NULL) fatal("Out of memory"); return ptr; } void* xrealloc(void* p, size_t n) { void* ptr = realloc(p, n); if (ptr == NULL) fatal("Out of memory"); return ptr; } char** split_into_words(const char* str, size_t* count) { size_t size = 0; size_t capacity = 16; char** words = xmalloc(capacity * sizeof(char*)); size_t len = strlen(str); for (size_t begin = 0; begin < len; ) { size_t i = begin; for (; i < len && isspace((unsigned char)str[i]); ++i) {} begin = i; for (; i < len && !isspace((unsigned char)str[i]); ++i) {} size_t word_len = i - begin; if (word_len == 0) break; char* word = xmalloc(word_len + 1); memcpy(word, str + begin, word_len); word[word_len] = 0; begin += word_len; if (capacity == size) { capacity *= 2; words = xrealloc(words, capacity * sizeof(char*)); } words[size++] = word; } *count = size; return words; } command_t* make_command_list(const char* table) { command_t* cmd = NULL; size_t count = 0; char** words = split_into_words(table, &count); for (size_t i = 0; i < count; ++i) { char* word = words[i]; command_t* new_cmd = xmalloc(sizeof(command_t)); size_t word_len = strlen(word); new_cmd->length = word_len; new_cmd->min_len = get_min_length(word, word_len); new_cmd->cmd = uppercase(word, word_len); new_cmd->next = cmd; cmd = new_cmd; } free(words); return cmd; } void free_command_list(command_t* cmd) { while (cmd != NULL) { command_t* next = cmd->next; free(cmd->cmd); free(cmd); cmd = next; } } const command_t* find_command(const command_t* commands, const char* word) { for (const command_t* cmd = commands; cmd != NULL; cmd = cmd->next) { if (command_match(cmd, word)) return cmd; } return NULL; } void test(const command_t* commands, const char* input) { printf(" input: %s\n", input); printf("output:"); size_t count = 0; char** words = split_into_words(input, &count); for (size_t i = 0; i < count; ++i) { char* word = words[i]; uppercase(word, strlen(word)); const command_t* cmd_ptr = find_command(commands, word); printf(" %s", cmd_ptr ? cmd_ptr->cmd : "*error*"); free(word); } free(words); printf("\n"); } int main() { command_t* commands = make_command_list(command_table); const char* input = "riG rePEAT copies put mo rest types fup. 6 poweRin"; test(commands, input); free_command_list(commands); return 0; }
#include <algorithm> #include <cctype> #include <iostream> #include <sstream> #include <string> #include <vector> const char* command_table = "Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy " "COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find " "NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput " "Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO " "MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT " "READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT " "RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up"; class command { public: command(const std::string&, size_t); const std::string& cmd() const { return cmd_; } size_t min_length() const { return min_len_; } bool match(const std::string&) const; private: std::string cmd_; size_t min_len_; }; command::command(const std::string& cmd, size_t min_len) : cmd_(cmd), min_len_(min_len) {} bool command::match(const std::string& str) const { size_t olen = str.length(); return olen >= min_len_ && olen <= cmd_.length() && cmd_.compare(0, olen, str) == 0; } void uppercase(std::string& str) { std::transform(str.begin(), str.end(), str.begin(), [](unsigned char c) -> unsigned char { return std::toupper(c); }); } size_t get_min_length(const std::string& str) { size_t len = 0, n = str.length(); while (len < n && std::isupper(static_cast<unsigned char>(str[len]))) ++len; return len; } class command_list { public: explicit command_list(const char*); const command* find_command(const std::string&) const; private: std::vector<command> commands_; }; command_list::command_list(const char* table) { std::vector<command> commands; std::istringstream is(table); std::string word; while (is >> word) { size_t len = get_min_length(word); uppercase(word); commands_.push_back(command(word, len)); } } const command* command_list::find_command(const std::string& word) const { auto iter = std::find_if(commands_.begin(), commands_.end(), [&word](const command& cmd) { return cmd.match(word); }); return (iter != commands_.end()) ? &*iter : nullptr; } std::string test(const command_list& commands, const std::string& input) { std::string output; std::istringstream is(input); std::string word; while (is >> word) { if (!output.empty()) output += ' '; uppercase(word); const command* cmd_ptr = commands.find_command(word); if (cmd_ptr) output += cmd_ptr->cmd(); else output += "*error*"; } return output; } int main() { command_list commands(command_table); std::string input("riG rePEAT copies put mo rest types fup. 6 poweRin"); std::string output(test(commands, input)); std::cout << " input: " << input << '\n'; std::cout << "output: " << output << '\n'; return 0; }
Preserve the algorithm and functionality while converting the code from C to C++.
#include <ctype.h> #include <stdbool.h> #include <stdio.h> #include <stdlib.h> #include <string.h> const char* command_table = "Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy " "COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find " "NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput " "Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO " "MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT " "READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT " "RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up"; typedef struct command_tag { char* cmd; size_t length; size_t min_len; struct command_tag* next; } command_t; bool command_match(const command_t* command, const char* str) { size_t olen = strlen(str); return olen >= command->min_len && olen <= command->length && strncmp(str, command->cmd, olen) == 0; } char* uppercase(char* str, size_t n) { for (size_t i = 0; i < n; ++i) str[i] = toupper((unsigned char)str[i]); return str; } size_t get_min_length(const char* str, size_t n) { size_t len = 0; while (len < n && isupper((unsigned char)str[len])) ++len; return len; } void fatal(const char* message) { fprintf(stderr, "%s\n", message); exit(1); } void* xmalloc(size_t n) { void* ptr = malloc(n); if (ptr == NULL) fatal("Out of memory"); return ptr; } void* xrealloc(void* p, size_t n) { void* ptr = realloc(p, n); if (ptr == NULL) fatal("Out of memory"); return ptr; } char** split_into_words(const char* str, size_t* count) { size_t size = 0; size_t capacity = 16; char** words = xmalloc(capacity * sizeof(char*)); size_t len = strlen(str); for (size_t begin = 0; begin < len; ) { size_t i = begin; for (; i < len && isspace((unsigned char)str[i]); ++i) {} begin = i; for (; i < len && !isspace((unsigned char)str[i]); ++i) {} size_t word_len = i - begin; if (word_len == 0) break; char* word = xmalloc(word_len + 1); memcpy(word, str + begin, word_len); word[word_len] = 0; begin += word_len; if (capacity == size) { capacity *= 2; words = xrealloc(words, capacity * sizeof(char*)); } words[size++] = word; } *count = size; return words; } command_t* make_command_list(const char* table) { command_t* cmd = NULL; size_t count = 0; char** words = split_into_words(table, &count); for (size_t i = 0; i < count; ++i) { char* word = words[i]; command_t* new_cmd = xmalloc(sizeof(command_t)); size_t word_len = strlen(word); new_cmd->length = word_len; new_cmd->min_len = get_min_length(word, word_len); new_cmd->cmd = uppercase(word, word_len); new_cmd->next = cmd; cmd = new_cmd; } free(words); return cmd; } void free_command_list(command_t* cmd) { while (cmd != NULL) { command_t* next = cmd->next; free(cmd->cmd); free(cmd); cmd = next; } } const command_t* find_command(const command_t* commands, const char* word) { for (const command_t* cmd = commands; cmd != NULL; cmd = cmd->next) { if (command_match(cmd, word)) return cmd; } return NULL; } void test(const command_t* commands, const char* input) { printf(" input: %s\n", input); printf("output:"); size_t count = 0; char** words = split_into_words(input, &count); for (size_t i = 0; i < count; ++i) { char* word = words[i]; uppercase(word, strlen(word)); const command_t* cmd_ptr = find_command(commands, word); printf(" %s", cmd_ptr ? cmd_ptr->cmd : "*error*"); free(word); } free(words); printf("\n"); } int main() { command_t* commands = make_command_list(command_table); const char* input = "riG rePEAT copies put mo rest types fup. 6 poweRin"; test(commands, input); free_command_list(commands); return 0; }
#include <algorithm> #include <cctype> #include <iostream> #include <sstream> #include <string> #include <vector> const char* command_table = "Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy " "COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find " "NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput " "Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO " "MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT " "READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT " "RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up"; class command { public: command(const std::string&, size_t); const std::string& cmd() const { return cmd_; } size_t min_length() const { return min_len_; } bool match(const std::string&) const; private: std::string cmd_; size_t min_len_; }; command::command(const std::string& cmd, size_t min_len) : cmd_(cmd), min_len_(min_len) {} bool command::match(const std::string& str) const { size_t olen = str.length(); return olen >= min_len_ && olen <= cmd_.length() && cmd_.compare(0, olen, str) == 0; } void uppercase(std::string& str) { std::transform(str.begin(), str.end(), str.begin(), [](unsigned char c) -> unsigned char { return std::toupper(c); }); } size_t get_min_length(const std::string& str) { size_t len = 0, n = str.length(); while (len < n && std::isupper(static_cast<unsigned char>(str[len]))) ++len; return len; } class command_list { public: explicit command_list(const char*); const command* find_command(const std::string&) const; private: std::vector<command> commands_; }; command_list::command_list(const char* table) { std::vector<command> commands; std::istringstream is(table); std::string word; while (is >> word) { size_t len = get_min_length(word); uppercase(word); commands_.push_back(command(word, len)); } } const command* command_list::find_command(const std::string& word) const { auto iter = std::find_if(commands_.begin(), commands_.end(), [&word](const command& cmd) { return cmd.match(word); }); return (iter != commands_.end()) ? &*iter : nullptr; } std::string test(const command_list& commands, const std::string& input) { std::string output; std::istringstream is(input); std::string word; while (is >> word) { if (!output.empty()) output += ' '; uppercase(word); const command* cmd_ptr = commands.find_command(word); if (cmd_ptr) output += cmd_ptr->cmd(); else output += "*error*"; } return output; } int main() { command_list commands(command_table); std::string input("riG rePEAT copies put mo rest types fup. 6 poweRin"); std::string output(test(commands, input)); std::cout << " input: " << input << '\n'; std::cout << "output: " << output << '\n'; return 0; }
Generate an equivalent C++ version of this C code.
#include <ctype.h> #include <stdbool.h> #include <stdio.h> #include <stdlib.h> #include <string.h> const char* command_table = "Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy " "COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find " "NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput " "Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO " "MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT " "READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT " "RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up"; typedef struct command_tag { char* cmd; size_t length; size_t min_len; struct command_tag* next; } command_t; bool command_match(const command_t* command, const char* str) { size_t olen = strlen(str); return olen >= command->min_len && olen <= command->length && strncmp(str, command->cmd, olen) == 0; } char* uppercase(char* str, size_t n) { for (size_t i = 0; i < n; ++i) str[i] = toupper((unsigned char)str[i]); return str; } size_t get_min_length(const char* str, size_t n) { size_t len = 0; while (len < n && isupper((unsigned char)str[len])) ++len; return len; } void fatal(const char* message) { fprintf(stderr, "%s\n", message); exit(1); } void* xmalloc(size_t n) { void* ptr = malloc(n); if (ptr == NULL) fatal("Out of memory"); return ptr; } void* xrealloc(void* p, size_t n) { void* ptr = realloc(p, n); if (ptr == NULL) fatal("Out of memory"); return ptr; } char** split_into_words(const char* str, size_t* count) { size_t size = 0; size_t capacity = 16; char** words = xmalloc(capacity * sizeof(char*)); size_t len = strlen(str); for (size_t begin = 0; begin < len; ) { size_t i = begin; for (; i < len && isspace((unsigned char)str[i]); ++i) {} begin = i; for (; i < len && !isspace((unsigned char)str[i]); ++i) {} size_t word_len = i - begin; if (word_len == 0) break; char* word = xmalloc(word_len + 1); memcpy(word, str + begin, word_len); word[word_len] = 0; begin += word_len; if (capacity == size) { capacity *= 2; words = xrealloc(words, capacity * sizeof(char*)); } words[size++] = word; } *count = size; return words; } command_t* make_command_list(const char* table) { command_t* cmd = NULL; size_t count = 0; char** words = split_into_words(table, &count); for (size_t i = 0; i < count; ++i) { char* word = words[i]; command_t* new_cmd = xmalloc(sizeof(command_t)); size_t word_len = strlen(word); new_cmd->length = word_len; new_cmd->min_len = get_min_length(word, word_len); new_cmd->cmd = uppercase(word, word_len); new_cmd->next = cmd; cmd = new_cmd; } free(words); return cmd; } void free_command_list(command_t* cmd) { while (cmd != NULL) { command_t* next = cmd->next; free(cmd->cmd); free(cmd); cmd = next; } } const command_t* find_command(const command_t* commands, const char* word) { for (const command_t* cmd = commands; cmd != NULL; cmd = cmd->next) { if (command_match(cmd, word)) return cmd; } return NULL; } void test(const command_t* commands, const char* input) { printf(" input: %s\n", input); printf("output:"); size_t count = 0; char** words = split_into_words(input, &count); for (size_t i = 0; i < count; ++i) { char* word = words[i]; uppercase(word, strlen(word)); const command_t* cmd_ptr = find_command(commands, word); printf(" %s", cmd_ptr ? cmd_ptr->cmd : "*error*"); free(word); } free(words); printf("\n"); } int main() { command_t* commands = make_command_list(command_table); const char* input = "riG rePEAT copies put mo rest types fup. 6 poweRin"; test(commands, input); free_command_list(commands); return 0; }
#include <algorithm> #include <cctype> #include <iostream> #include <sstream> #include <string> #include <vector> const char* command_table = "Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy " "COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find " "NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput " "Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO " "MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT " "READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT " "RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up"; class command { public: command(const std::string&, size_t); const std::string& cmd() const { return cmd_; } size_t min_length() const { return min_len_; } bool match(const std::string&) const; private: std::string cmd_; size_t min_len_; }; command::command(const std::string& cmd, size_t min_len) : cmd_(cmd), min_len_(min_len) {} bool command::match(const std::string& str) const { size_t olen = str.length(); return olen >= min_len_ && olen <= cmd_.length() && cmd_.compare(0, olen, str) == 0; } void uppercase(std::string& str) { std::transform(str.begin(), str.end(), str.begin(), [](unsigned char c) -> unsigned char { return std::toupper(c); }); } size_t get_min_length(const std::string& str) { size_t len = 0, n = str.length(); while (len < n && std::isupper(static_cast<unsigned char>(str[len]))) ++len; return len; } class command_list { public: explicit command_list(const char*); const command* find_command(const std::string&) const; private: std::vector<command> commands_; }; command_list::command_list(const char* table) { std::vector<command> commands; std::istringstream is(table); std::string word; while (is >> word) { size_t len = get_min_length(word); uppercase(word); commands_.push_back(command(word, len)); } } const command* command_list::find_command(const std::string& word) const { auto iter = std::find_if(commands_.begin(), commands_.end(), [&word](const command& cmd) { return cmd.match(word); }); return (iter != commands_.end()) ? &*iter : nullptr; } std::string test(const command_list& commands, const std::string& input) { std::string output; std::istringstream is(input); std::string word; while (is >> word) { if (!output.empty()) output += ' '; uppercase(word); const command* cmd_ptr = commands.find_command(word); if (cmd_ptr) output += cmd_ptr->cmd(); else output += "*error*"; } return output; } int main() { command_list commands(command_table); std::string input("riG rePEAT copies put mo rest types fup. 6 poweRin"); std::string output(test(commands, input)); std::cout << " input: " << input << '\n'; std::cout << "output: " << output << '\n'; return 0; }
Write a version of this C function in C++ with identical behavior.
#define PI 3.14159265358979323 #define MINSIZE 10 #define MAXSIZE 100
#include <iostream> class MyOtherClass { public: const int m_x; MyOtherClass(const int initX = 0) : m_x(initX) { } }; int main() { MyOtherClass mocA, mocB(7); std::cout << mocA.m_x << std::endl; std::cout << mocB.m_x << std::endl; return 0; }
Preserve the algorithm and functionality while converting the code from C to C++.
#include <stdio.h> #include <stdlib.h> #include <math.h> typedef struct { double x, y; } vec_t, *vec; inline double dot(vec a, vec b) { return a->x * b->x + a->y * b->y; } inline double cross(vec a, vec b) { return a->x * b->y - a->y * b->x; } inline vec vsub(vec a, vec b, vec res) { res->x = a->x - b->x; res->y = a->y - b->y; return res; } int left_of(vec a, vec b, vec c) { vec_t tmp1, tmp2; double x; vsub(b, a, &tmp1); vsub(c, b, &tmp2); x = cross(&tmp1, &tmp2); return x < 0 ? -1 : x > 0; } int line_sect(vec x0, vec x1, vec y0, vec y1, vec res) { vec_t dx, dy, d; vsub(x1, x0, &dx); vsub(y1, y0, &dy); vsub(x0, y0, &d); double dyx = cross(&dy, &dx); if (!dyx) return 0; dyx = cross(&d, &dx) / dyx; if (dyx <= 0 || dyx >= 1) return 0; res->x = y0->x + dyx * dy.x; res->y = y0->y + dyx * dy.y; return 1; } typedef struct { int len, alloc; vec v; } poly_t, *poly; poly poly_new() { return (poly)calloc(1, sizeof(poly_t)); } void poly_free(poly p) { free(p->v); free(p); } void poly_append(poly p, vec v) { if (p->len >= p->alloc) { p->alloc *= 2; if (!p->alloc) p->alloc = 4; p->v = (vec)realloc(p->v, sizeof(vec_t) * p->alloc); } p->v[p->len++] = *v; } int poly_winding(poly p) { return left_of(p->v, p->v + 1, p->v + 2); } void poly_edge_clip(poly sub, vec x0, vec x1, int left, poly res) { int i, side0, side1; vec_t tmp; vec v0 = sub->v + sub->len - 1, v1; res->len = 0; side0 = left_of(x0, x1, v0); if (side0 != -left) poly_append(res, v0); for (i = 0; i < sub->len; i++) { v1 = sub->v + i; side1 = left_of(x0, x1, v1); if (side0 + side1 == 0 && side0) if (line_sect(x0, x1, v0, v1, &tmp)) poly_append(res, &tmp); if (i == sub->len - 1) break; if (side1 != -left) poly_append(res, v1); v0 = v1; side0 = side1; } } poly poly_clip(poly sub, poly clip) { int i; poly p1 = poly_new(), p2 = poly_new(), tmp; int dir = poly_winding(clip); poly_edge_clip(sub, clip->v + clip->len - 1, clip->v, dir, p2); for (i = 0; i < clip->len - 1; i++) { tmp = p2; p2 = p1; p1 = tmp; if(p1->len == 0) { p2->len = 0; break; } poly_edge_clip(p1, clip->v + i, clip->v + i + 1, dir, p2); } poly_free(p1); return p2; } int main() { int i; vec_t c[] = {{100,100}, {300,100}, {300,300}, {100,300}}; vec_t s[] = { {50,150}, {200,50}, {350,150}, {350,300},{250,300},{200,250}, {150,350},{100,250},{100,200}}; #define clen (sizeof(c)/sizeof(vec_t)) #define slen (sizeof(s)/sizeof(vec_t)) poly_t clipper = {clen, 0, c}; poly_t subject = {slen, 0, s}; poly res = poly_clip(&subject, &clipper); for (i = 0; i < res->len; i++) printf("%g %g\n", res->v[i].x, res->v[i].y); FILE * eps = fopen("test.eps", "w"); fprintf(eps, "%%!PS-Adobe-3.0\n%%%%BoundingBox: 40 40 360 360\n" "/l {lineto} def /m{moveto} def /s{setrgbcolor} def" "/c {closepath} def /gs {fill grestore stroke} def\n"); fprintf(eps, "0 setlinewidth %g %g m ", c[0].x, c[0].y); for (i = 1; i < clen; i++) fprintf(eps, "%g %g l ", c[i].x, c[i].y); fprintf(eps, "c .5 0 0 s gsave 1 .7 .7 s gs\n"); fprintf(eps, "%g %g m ", s[0].x, s[0].y); for (i = 1; i < slen; i++) fprintf(eps, "%g %g l ", s[i].x, s[i].y); fprintf(eps, "c 0 .2 .5 s gsave .4 .7 1 s gs\n"); fprintf(eps, "2 setlinewidth [10 8] 0 setdash %g %g m ", res->v[0].x, res->v[0].y); for (i = 1; i < res->len; i++) fprintf(eps, "%g %g l ", res->v[i].x, res->v[i].y); fprintf(eps, "c .5 0 .5 s gsave .7 .3 .8 s gs\n"); fprintf(eps, "%%%%EOF"); fclose(eps); printf("test.eps written\n"); return 0; }
#include <iostream> #include <span> #include <vector> struct vec2 { float x = 0.0f, y = 0.0f; constexpr vec2 operator+(vec2 other) const { return vec2{x + other.x, y + other.y}; } constexpr vec2 operator-(vec2 other) const { return vec2{x - other.x, y - other.y}; } }; constexpr vec2 operator*(vec2 a, float b) { return vec2{a.x * b, a.y * b}; } constexpr float dot(vec2 a, vec2 b) { return a.x * b.x + a.y * b.y; } constexpr float cross(vec2 a, vec2 b) { return a.x * b.y - b.x * a.y; } constexpr bool is_inside(vec2 point, vec2 a, vec2 b) { return (cross(a - b, point) + cross(b, a)) < 0.0f; } constexpr vec2 intersection(vec2 a1, vec2 a2, vec2 b1, vec2 b2) { return ((b1 - b2) * cross(a1, a2) - (a1 - a2) * cross(b1, b2)) * (1.0f / cross(a1 - a2, b1 - b2)); } std::vector<vec2> suther_land_hodgman( std::span<vec2 const> subject_polygon, std::span<vec2 const> clip_polygon) { if (clip_polygon.empty() || subject_polygon.empty()) { return {}; } std::vector<vec2> ring{subject_polygon.begin(), subject_polygon.end()}; vec2 p1 = clip_polygon[clip_polygon.size() - 1]; std::vector<vec2> input; for (vec2 p2 : clip_polygon) { input.clear(); input.insert(input.end(), ring.begin(), ring.end()); vec2 s = input[input.size() - 1]; ring.clear(); for (vec2 e : input) { if (is_inside(e, p1, p2)) { if (!is_inside(s, p1, p2)) { ring.push_back(intersection(p1, p2, s, e)); } ring.push_back(e); } else if (is_inside(s, p1, p2)) { ring.push_back(intersection(p1, p2, s, e)); } s = e; } p1 = p2; } return ring; } int main(int argc, char **argv) { vec2 subject_polygon[] = {{50, 150}, {200, 50}, {350, 150}, {350, 300}, {250, 300}, {200, 250}, {150, 350}, {100, 250}, {100, 200}}; vec2 clip_polygon[] = {{100, 100}, {300, 100}, {300, 300}, {100, 300}}; std::vector<vec2> clipped_polygon = suther_land_hodgman(subject_polygon, clip_polygon); std::cout << "Clipped polygon points:" << std::endl; for (vec2 p : clipped_polygon) { std::cout << "(" << p.x << ", " << p.y << ")" << std::endl; } return EXIT_SUCCESS; }
Translate this program into C++ but keep the logic exactly as in C.
#include <stdio.h> #include <string.h> #include <stdlib.h> char *codes[] = { "AAAAA", "AAAAB", "AAABA", "AAABB", "AABAA", "AABAB", "AABBA", "AABBB", "ABAAA", "ABAAB", "ABABA", "ABABB", "ABBAA", "ABBAB", "ABBBA", "ABBBB", "BAAAA", "BAAAB", "BAABA", "BAABB", "BABAA", "BABAB", "BABBA", "BABBB", "BBAAA", "BBAAB", "BBBAA" }; char *get_code(const char c) { if (c >= 97 && c <= 122) return codes[c - 97]; return codes[26]; } char get_char(const char *code) { int i; if (!strcmp(codes[26], code)) return ' '; for (i = 0; i < 26; ++i) { if (strcmp(codes[i], code) == 0) return 97 + i; } printf("\nCode \"%s\" is invalid\n", code); exit(1); } void str_tolower(char s[]) { int i; for (i = 0; i < strlen(s); ++i) s[i] = tolower(s[i]); } char *bacon_encode(char plain_text[], char message[]) { int i, count; int plen = strlen(plain_text), mlen = strlen(message); int elen = 5 * plen; char c; char *p, *et, *mt; et = malloc(elen + 1); str_tolower(plain_text); for (i = 0, p = et; i < plen; ++i, p += 5) { c = plain_text[i]; strncpy(p, get_code(c), 5); } *++p = '\0'; str_tolower(message); mt = calloc(mlen + 1, 1); for (i = 0, count = 0; i < mlen; ++i) { c = message[i]; if (c >= 'a' && c <= 'z') { if (et[count] == 'A') mt[i] = c; else mt[i] = c - 32; if (++count == elen) break; } else mt[i] = c; } free(et); return mt; } char *bacon_decode(char cipher_text[]) { int i, count, clen = strlen(cipher_text); int plen; char *p, *ct, *pt; char c, quintet[6]; ct = calloc(clen + 1, 1); for (i = 0, count = 0; i < clen; ++i) { c = cipher_text[i]; if (c >= 'a' && c <= 'z') ct[count++] = 'A'; else if (c >= 'A' && c <= 'Z') ct[count++] = 'B'; } plen = strlen(ct) / 5; pt = malloc(plen + 1); for (i = 0, p = ct; i < plen; ++i, p += 5) { strncpy(quintet, p, 5); quintet[5] = '\0'; pt[i] = get_char(quintet); } pt[plen] = '\0'; free(ct); return pt; } int main() { char plain_text[] = "the quick brown fox jumps over the lazy dog"; char message[] = "bacon's cipher is a method of steganography created by francis bacon." "this task is to implement a program for encryption and decryption of " "plaintext using the simple alphabet of the baconian cipher or some " "other kind of representation of this alphabet (make anything signify anything). " "the baconian alphabet may optionally be extended to encode all lower " "case characters individually and/or adding a few punctuation characters " "such as the space."; char *cipher_text, *hidden_text; cipher_text = bacon_encode(plain_text, message); printf("Cipher text ->\n\n%s\n", cipher_text); hidden_text = bacon_decode(cipher_text); printf("\nHidden text ->\n\n%s\n", hidden_text); free(cipher_text); free(hidden_text); return 0; }
#include <iostream> #include <algorithm> #include <vector> #include <bitset> #include <string> class bacon { public: bacon() { int x = 0; for( ; x < 9; x++ ) bAlphabet.push_back( std::bitset<5>( x ).to_string() ); bAlphabet.push_back( bAlphabet.back() ); for( ; x < 20; x++ ) bAlphabet.push_back( std::bitset<5>( x ).to_string() ); bAlphabet.push_back( bAlphabet.back() ); for( ; x < 24; x++ ) bAlphabet.push_back( std::bitset<5>( x ).to_string() ); } std::string encode( std::string txt ) { std::string r; size_t z; for( std::string::iterator i = txt.begin(); i != txt.end(); i++ ) { z = toupper( *i ); if( z < 'A' || z > 'Z' ) continue; r.append( bAlphabet.at( ( *i & 31 ) - 1 ) ); } return r; } std::string decode( std::string txt ) { size_t len = txt.length(); while( len % 5 != 0 ) len--; if( len != txt.length() ) txt = txt.substr( 0, len ); std::string r; for( size_t i = 0; i < len; i += 5 ) { r.append( 1, 'A' + std::distance( bAlphabet.begin(), std::find( bAlphabet.begin(), bAlphabet.end(), txt.substr( i, 5 ) ) ) ); } return r; } private: std::vector<std::string> bAlphabet; };
Port the following code from C to C++ with equivalent syntax and logic.
#include <stdio.h> #include <string.h> #include <stdlib.h> char *codes[] = { "AAAAA", "AAAAB", "AAABA", "AAABB", "AABAA", "AABAB", "AABBA", "AABBB", "ABAAA", "ABAAB", "ABABA", "ABABB", "ABBAA", "ABBAB", "ABBBA", "ABBBB", "BAAAA", "BAAAB", "BAABA", "BAABB", "BABAA", "BABAB", "BABBA", "BABBB", "BBAAA", "BBAAB", "BBBAA" }; char *get_code(const char c) { if (c >= 97 && c <= 122) return codes[c - 97]; return codes[26]; } char get_char(const char *code) { int i; if (!strcmp(codes[26], code)) return ' '; for (i = 0; i < 26; ++i) { if (strcmp(codes[i], code) == 0) return 97 + i; } printf("\nCode \"%s\" is invalid\n", code); exit(1); } void str_tolower(char s[]) { int i; for (i = 0; i < strlen(s); ++i) s[i] = tolower(s[i]); } char *bacon_encode(char plain_text[], char message[]) { int i, count; int plen = strlen(plain_text), mlen = strlen(message); int elen = 5 * plen; char c; char *p, *et, *mt; et = malloc(elen + 1); str_tolower(plain_text); for (i = 0, p = et; i < plen; ++i, p += 5) { c = plain_text[i]; strncpy(p, get_code(c), 5); } *++p = '\0'; str_tolower(message); mt = calloc(mlen + 1, 1); for (i = 0, count = 0; i < mlen; ++i) { c = message[i]; if (c >= 'a' && c <= 'z') { if (et[count] == 'A') mt[i] = c; else mt[i] = c - 32; if (++count == elen) break; } else mt[i] = c; } free(et); return mt; } char *bacon_decode(char cipher_text[]) { int i, count, clen = strlen(cipher_text); int plen; char *p, *ct, *pt; char c, quintet[6]; ct = calloc(clen + 1, 1); for (i = 0, count = 0; i < clen; ++i) { c = cipher_text[i]; if (c >= 'a' && c <= 'z') ct[count++] = 'A'; else if (c >= 'A' && c <= 'Z') ct[count++] = 'B'; } plen = strlen(ct) / 5; pt = malloc(plen + 1); for (i = 0, p = ct; i < plen; ++i, p += 5) { strncpy(quintet, p, 5); quintet[5] = '\0'; pt[i] = get_char(quintet); } pt[plen] = '\0'; free(ct); return pt; } int main() { char plain_text[] = "the quick brown fox jumps over the lazy dog"; char message[] = "bacon's cipher is a method of steganography created by francis bacon." "this task is to implement a program for encryption and decryption of " "plaintext using the simple alphabet of the baconian cipher or some " "other kind of representation of this alphabet (make anything signify anything). " "the baconian alphabet may optionally be extended to encode all lower " "case characters individually and/or adding a few punctuation characters " "such as the space."; char *cipher_text, *hidden_text; cipher_text = bacon_encode(plain_text, message); printf("Cipher text ->\n\n%s\n", cipher_text); hidden_text = bacon_decode(cipher_text); printf("\nHidden text ->\n\n%s\n", hidden_text); free(cipher_text); free(hidden_text); return 0; }
#include <iostream> #include <algorithm> #include <vector> #include <bitset> #include <string> class bacon { public: bacon() { int x = 0; for( ; x < 9; x++ ) bAlphabet.push_back( std::bitset<5>( x ).to_string() ); bAlphabet.push_back( bAlphabet.back() ); for( ; x < 20; x++ ) bAlphabet.push_back( std::bitset<5>( x ).to_string() ); bAlphabet.push_back( bAlphabet.back() ); for( ; x < 24; x++ ) bAlphabet.push_back( std::bitset<5>( x ).to_string() ); } std::string encode( std::string txt ) { std::string r; size_t z; for( std::string::iterator i = txt.begin(); i != txt.end(); i++ ) { z = toupper( *i ); if( z < 'A' || z > 'Z' ) continue; r.append( bAlphabet.at( ( *i & 31 ) - 1 ) ); } return r; } std::string decode( std::string txt ) { size_t len = txt.length(); while( len % 5 != 0 ) len--; if( len != txt.length() ) txt = txt.substr( 0, len ); std::string r; for( size_t i = 0; i < len; i += 5 ) { r.append( 1, 'A' + std::distance( bAlphabet.begin(), std::find( bAlphabet.begin(), bAlphabet.end(), txt.substr( i, 5 ) ) ) ); } return r; } private: std::vector<std::string> bAlphabet; };
Translate the given C code snippet into C++ without altering its behavior.
#include <stdio.h> #include <stdlib.h> #define valid(i, j) 0 <= i && i < m && 0 <= j && j < n && !s[i][j] int main(int c, char **v) { int i, j, m = 0, n = 0; if (c >= 2) m = atoi(v[1]); if (c >= 3) n = atoi(v[2]); if (m <= 0) m = 5; if (n <= 0) n = m; int **s = calloc(1, sizeof(int *) * m + sizeof(int) * m * n); s[0] = (int*)(s + m); for (i = 1; i < m; i++) s[i] = s[i - 1] + n; int dx = 1, dy = 0, val = 0, t; for (i = j = 0; valid(i, j); i += dy, j += dx ) { for (; valid(i, j); j += dx, i += dy) s[i][j] = ++val; j -= dx; i -= dy; t = dy; dy = dx; dx = -t; } for (t = 2; val /= 10; t++); for(i = 0; i < m; i++) for(j = 0; j < n || !putchar('\n'); j++) printf("%*d", t, s[i][j]); return 0; }
#include <vector> #include <memory> #include <cmath> #include <iostream> #include <iomanip> using namespace std; typedef vector< int > IntRow; typedef vector< IntRow > IntTable; auto_ptr< IntTable > getSpiralArray( int dimension ) { auto_ptr< IntTable > spiralArrayPtr( new IntTable( dimension, IntRow( dimension ) ) ); int numConcentricSquares = static_cast< int >( ceil( static_cast< double >( dimension ) / 2.0 ) ); int j; int sideLen = dimension; int currNum = 0; for ( int i = 0; i < numConcentricSquares; i++ ) { for ( j = 0; j < sideLen; j++ ) ( *spiralArrayPtr )[ i ][ i + j ] = currNum++; for ( j = 1; j < sideLen; j++ ) ( *spiralArrayPtr )[ i + j ][ dimension - 1 - i ] = currNum++; for ( j = sideLen - 2; j > -1; j-- ) ( *spiralArrayPtr )[ dimension - 1 - i ][ i + j ] = currNum++; for ( j = sideLen - 2; j > 0; j-- ) ( *spiralArrayPtr )[ i + j ][ i ] = currNum++; sideLen -= 2; } return spiralArrayPtr; } void printSpiralArray( const auto_ptr< IntTable >& spiralArrayPtr ) { size_t dimension = spiralArrayPtr->size(); int fieldWidth = static_cast< int >( floor( log10( static_cast< double >( dimension * dimension - 1 ) ) ) ) + 2; size_t col; for ( size_t row = 0; row < dimension; row++ ) { for ( col = 0; col < dimension; col++ ) cout << setw( fieldWidth ) << ( *spiralArrayPtr )[ row ][ col ]; cout << endl; } } int main() { printSpiralArray( getSpiralArray( 5 ) ); }
Rewrite the snippet below in C++ so it works the same as the original C code.
#include <stdlib.h> #include <stdarg.h> #include <stdio.h> #include <ctype.h> #include <string.h> typedef const char * String; typedef struct sTable { String * *rows; int n_rows,n_cols; } *Table; typedef int (*CompareFctn)(String a, String b); struct { CompareFctn compare; int column; int reversed; } sortSpec; int CmprRows( const void *aa, const void *bb) { String *rA = *(String *const *)aa; String *rB = *(String *const *)bb; int sortCol = sortSpec.column; String left = sortSpec.reversed ? rB[sortCol] : rA[sortCol]; String right = sortSpec.reversed ? rA[sortCol] : rB[sortCol]; return sortSpec.compare( left, right ); } int sortTable(Table tbl, const char* argSpec,... ) { va_list vl; const char *p; int c; sortSpec.compare = &strcmp; sortSpec.column = 0; sortSpec.reversed = 0; va_start(vl, argSpec); if (argSpec) for (p=argSpec; *p; p++) { switch (*p) { case 'o': sortSpec.compare = va_arg(vl,CompareFctn); break; case 'c': c = va_arg(vl,int); if ( 0<=c && c<tbl->n_cols) sortSpec.column = c; break; case 'r': sortSpec.reversed = (0!=va_arg(vl,int)); break; } } va_end(vl); qsort( tbl->rows, tbl->n_rows, sizeof(String *), CmprRows); return 0; } void printTable( Table tbl, FILE *fout, const char *colFmts[]) { int row, col; for (row=0; row<tbl->n_rows; row++) { fprintf(fout, " "); for(col=0; col<tbl->n_cols; col++) { fprintf(fout, colFmts[col], tbl->rows[row][col]); } fprintf(fout, "\n"); } fprintf(fout, "\n"); } int ord(char v) { return v-'0'; } int cmprStrgs(String s1, String s2) { const char *p1 = s1; const char *p2 = s2; const char *mrk1, *mrk2; while ((tolower(*p1) == tolower(*p2)) && *p1) { p1++; p2++; } if (isdigit(*p1) && isdigit(*p2)) { long v1, v2; if ((*p1 == '0') ||(*p2 == '0')) { while (p1 > s1) { p1--; p2--; if (*p1 != '0') break; } if (!isdigit(*p1)) { p1++; p2++; } } mrk1 = p1; mrk2 = p2; v1 = 0; while(isdigit(*p1)) { v1 = 10*v1+ord(*p1); p1++; } v2 = 0; while(isdigit(*p2)) { v2 = 10*v2+ord(*p2); p2++; } if (v1 == v2) return(p2-mrk2)-(p1-mrk1); return v1 - v2; } if (tolower(*p1) != tolower(*p2)) return (tolower(*p1) - tolower(*p2)); for(p1=s1, p2=s2; (*p1 == *p2) && *p1; p1++, p2++); return (*p1 -*p2); } int main() { const char *colFmts[] = {" %-5.5s"," %-5.5s"," %-9.9s"}; String r1[] = { "a101", "red", "Java" }; String r2[] = { "ab40", "gren", "Smalltalk" }; String r3[] = { "ab9", "blue", "Fortran" }; String r4[] = { "ab09", "ylow", "Python" }; String r5[] = { "ab1a", "blak", "Factor" }; String r6[] = { "ab1b", "brwn", "C Sharp" }; String r7[] = { "Ab1b", "pink", "Ruby" }; String r8[] = { "ab1", "orng", "Scheme" }; String *rows[] = { r1, r2, r3, r4, r5, r6, r7, r8 }; struct sTable table; table.rows = rows; table.n_rows = 8; table.n_cols = 3; sortTable(&table, ""); printf("sort on col 0, ascending\n"); printTable(&table, stdout, colFmts); sortTable(&table, "ro", 1, &cmprStrgs); printf("sort on col 0, reverse.special\n"); printTable(&table, stdout, colFmts); sortTable(&table, "c", 1); printf("sort on col 1, ascending\n"); printTable(&table, stdout, colFmts); sortTable(&table, "cr", 2, 1); printf("sort on col 2, reverse\n"); printTable(&table, stdout, colFmts); return 0; }
#include <vector> #include <algorithm> #include <string> template <class T> struct sort_table_functor { typedef bool (*CompFun)(const T &, const T &); const CompFun ordering; const int column; const bool reverse; sort_table_functor(CompFun o, int c, bool r) : ordering(o), column(c), reverse(r) { } bool operator()(const std::vector<T> &x, const std::vector<T> &y) const { const T &a = x[column], &b = y[column]; return reverse ? ordering(b, a) : ordering(a, b); } }; template <class T> bool myLess(const T &x, const T &y) { return x < y; } template <class T> void sort_table(std::vector<std::vector<T> > &table, int column = 0, bool reverse = false, bool (*ordering)(const T &, const T &) = myLess) { std::sort(table.begin(), table.end(), sort_table_functor<T>(ordering, column, reverse)); } #include <iostream> template <class T> void print_matrix(std::vector<std::vector<T> > &data) { for () { for (int j = 0; j < 3; j++) std::cout << data[i][j] << "\t"; std::cout << std::endl; } } bool desc_len_comparator(const std::string &x, const std::string &y) { return x.length() > y.length(); } int main() { std::string data_array[3][3] = { {"a", "b", "c"}, {"", "q", "z"}, {"zap", "zip", "Zot"} }; std::vector<std::vector<std::string> > data_orig; for (int i = 0; i < 3; i++) { std::vector<std::string> row; for (int j = 0; j < 3; j++) row.push_back(data_array[i][j]); data_orig.push_back(row); } print_matrix(data_orig); std::vector<std::vector<std::string> > data = data_orig; sort_table(data); print_matrix(data); data = data_orig; sort_table(data, 2); print_matrix(data); data = data_orig; sort_table(data, 1); print_matrix(data); data = data_orig; sort_table(data, 1, true); print_matrix(data); data = data_orig; sort_table(data, 0, false, desc_len_comparator); print_matrix(data); return 0; }
Generate a C++ translation of this C snippet without changing its computational steps.
#include <stdio.h> #include <stdlib.h> #include <string.h> #define N_SITES 150 double site[N_SITES][2]; unsigned char rgb[N_SITES][3]; int size_x = 640, size_y = 480; inline double sq2(double x, double y) { return x * x + y * y; } #define for_k for (k = 0; k < N_SITES; k++) int nearest_site(double x, double y) { int k, ret = 0; double d, dist = 0; for_k { d = sq2(x - site[k][0], y - site[k][1]); if (!k || d < dist) { dist = d, ret = k; } } return ret; } int at_edge(int *color, int y, int x) { int i, j, c = color[y * size_x + x]; for (i = y - 1; i <= y + 1; i++) { if (i < 0 || i >= size_y) continue; for (j = x - 1; j <= x + 1; j++) { if (j < 0 || j >= size_x) continue; if (color[i * size_x + j] != c) return 1; } } return 0; } #define AA_RES 4 void aa_color(unsigned char *pix, int y, int x) { int i, j, n; double r = 0, g = 0, b = 0, xx, yy; for (i = 0; i < AA_RES; i++) { yy = y + 1. / AA_RES * i + .5; for (j = 0; j < AA_RES; j++) { xx = x + 1. / AA_RES * j + .5; n = nearest_site(xx, yy); r += rgb[n][0]; g += rgb[n][1]; b += rgb[n][2]; } } pix[0] = r / (AA_RES * AA_RES); pix[1] = g / (AA_RES * AA_RES); pix[2] = b / (AA_RES * AA_RES); } #define for_i for (i = 0; i < size_y; i++) #define for_j for (j = 0; j < size_x; j++) void gen_map() { int i, j, k; int *nearest = malloc(sizeof(int) * size_y * size_x); unsigned char *ptr, *buf, color; ptr = buf = malloc(3 * size_x * size_y); for_i for_j nearest[i * size_x + j] = nearest_site(j, i); for_i for_j { if (!at_edge(nearest, i, j)) memcpy(ptr, rgb[nearest[i * size_x + j]], 3); else aa_color(ptr, i, j); ptr += 3; } for (k = 0; k < N_SITES; k++) { color = (rgb[k][0]*.25 + rgb[k][1]*.6 + rgb[k][2]*.15 > 80) ? 0 : 255; for (i = site[k][1] - 1; i <= site[k][1] + 1; i++) { if (i < 0 || i >= size_y) continue; for (j = site[k][0] - 1; j <= site[k][0] + 1; j++) { if (j < 0 || j >= size_x) continue; ptr = buf + 3 * (i * size_x + j); ptr[0] = ptr[1] = ptr[2] = color; } } } printf("P6\n%d %d\n255\n", size_x, size_y); fflush(stdout); fwrite(buf, size_y * size_x * 3, 1, stdout); } #define frand(x) (rand() / (1. + RAND_MAX) * x) int main() { int k; for_k { site[k][0] = frand(size_x); site[k][1] = frand(size_y); rgb [k][0] = frand(256); rgb [k][1] = frand(256); rgb [k][2] = frand(256); } gen_map(); return 0; }
#include <windows.h> #include <vector> #include <string> using namespace std; struct Point { int x, y; }; class MyBitmap { public: MyBitmap() : pen_(nullptr) {} ~MyBitmap() { DeleteObject(pen_); DeleteDC(hdc_); DeleteObject(bmp_); } bool Create(int w, int h) { BITMAPINFO bi; ZeroMemory(&bi, sizeof(bi)); bi.bmiHeader.biSize = sizeof(bi.bmiHeader); bi.bmiHeader.biBitCount = sizeof(DWORD) * 8; bi.bmiHeader.biCompression = BI_RGB; bi.bmiHeader.biPlanes = 1; bi.bmiHeader.biWidth = w; bi.bmiHeader.biHeight = -h; void *bits_ptr = nullptr; HDC dc = GetDC(GetConsoleWindow()); bmp_ = CreateDIBSection(dc, &bi, DIB_RGB_COLORS, &bits_ptr, nullptr, 0); if (!bmp_) return false; hdc_ = CreateCompatibleDC(dc); SelectObject(hdc_, bmp_); ReleaseDC(GetConsoleWindow(), dc); width_ = w; height_ = h; return true; } void SetPenColor(DWORD clr) { if (pen_) DeleteObject(pen_); pen_ = CreatePen(PS_SOLID, 1, clr); SelectObject(hdc_, pen_); } bool SaveBitmap(const char* path) { HANDLE file = CreateFile(path, GENERIC_WRITE, 0, nullptr, CREATE_ALWAYS, FILE_ATTRIBUTE_NORMAL, nullptr); if (file == INVALID_HANDLE_VALUE) { return false; } BITMAPFILEHEADER fileheader; BITMAPINFO infoheader; BITMAP bitmap; GetObject(bmp_, sizeof(bitmap), &bitmap); DWORD* dwp_bits = new DWORD[bitmap.bmWidth * bitmap.bmHeight]; ZeroMemory(dwp_bits, bitmap.bmWidth * bitmap.bmHeight * sizeof(DWORD)); ZeroMemory(&infoheader, sizeof(BITMAPINFO)); ZeroMemory(&fileheader, sizeof(BITMAPFILEHEADER)); infoheader.bmiHeader.biBitCount = sizeof(DWORD) * 8; infoheader.bmiHeader.biCompression = BI_RGB; infoheader.bmiHeader.biPlanes = 1; infoheader.bmiHeader.biSize = sizeof(infoheader.bmiHeader); infoheader.bmiHeader.biHeight = bitmap.bmHeight; infoheader.bmiHeader.biWidth = bitmap.bmWidth; infoheader.bmiHeader.biSizeImage = bitmap.bmWidth * bitmap.bmHeight * sizeof(DWORD); fileheader.bfType = 0x4D42; fileheader.bfOffBits = sizeof(infoheader.bmiHeader) + sizeof(BITMAPFILEHEADER); fileheader.bfSize = fileheader.bfOffBits + infoheader.bmiHeader.biSizeImage; GetDIBits(hdc_, bmp_, 0, height_, (LPVOID)dwp_bits, &infoheader, DIB_RGB_COLORS); DWORD wb; WriteFile(file, &fileheader, sizeof(BITMAPFILEHEADER), &wb, nullptr); WriteFile(file, &infoheader.bmiHeader, sizeof(infoheader.bmiHeader), &wb, nullptr); WriteFile(file, dwp_bits, bitmap.bmWidth * bitmap.bmHeight * 4, &wb, nullptr); CloseHandle(file); delete[] dwp_bits; return true; } HDC hdc() { return hdc_; } int width() { return width_; } int height() { return height_; } private: HBITMAP bmp_; HDC hdc_; HPEN pen_; int width_, height_; }; static int DistanceSqrd(const Point& point, int x, int y) { int xd = x - point.x; int yd = y - point.y; return (xd * xd) + (yd * yd); } class Voronoi { public: void Make(MyBitmap* bmp, int count) { bmp_ = bmp; CreatePoints(count); CreateColors(); CreateSites(); SetSitesPoints(); } private: void CreateSites() { int w = bmp_->width(), h = bmp_->height(), d; for (int hh = 0; hh < h; hh++) { for (int ww = 0; ww < w; ww++) { int ind = -1, dist = INT_MAX; for (size_t it = 0; it < points_.size(); it++) { const Point& p = points_[it]; d = DistanceSqrd(p, ww, hh); if (d < dist) { dist = d; ind = it; } } if (ind > -1) SetPixel(bmp_->hdc(), ww, hh, colors_[ind]); else __asm nop } } } void SetSitesPoints() { for (const auto& point : points_) { int x = point.x, y = point.y; for (int i = -1; i < 2; i++) for (int j = -1; j < 2; j++) SetPixel(bmp_->hdc(), x + i, y + j, 0); } } void CreatePoints(int count) { const int w = bmp_->width() - 20, h = bmp_->height() - 20; for (int i = 0; i < count; i++) { points_.push_back({ rand() % w + 10, rand() % h + 10 }); } } void CreateColors() { for (size_t i = 0; i < points_.size(); i++) { DWORD c = RGB(rand() % 200 + 50, rand() % 200 + 55, rand() % 200 + 50); colors_.push_back(c); } } vector<Point> points_; vector<DWORD> colors_; MyBitmap* bmp_; }; int main(int argc, char* argv[]) { ShowWindow(GetConsoleWindow(), SW_MAXIMIZE); srand(GetTickCount()); MyBitmap bmp; bmp.Create(512, 512); bmp.SetPenColor(0); Voronoi v; v.Make(&bmp, 50); BitBlt(GetDC(GetConsoleWindow()), 20, 20, 512, 512, bmp.hdc(), 0, 0, SRCCOPY); bmp.SaveBitmap("v.bmp"); system("pause"); return 0; }
Generate an equivalent C++ version of this C code.
#include <stdio.h> #include <stdlib.h> #include <string.h> #define N_SITES 150 double site[N_SITES][2]; unsigned char rgb[N_SITES][3]; int size_x = 640, size_y = 480; inline double sq2(double x, double y) { return x * x + y * y; } #define for_k for (k = 0; k < N_SITES; k++) int nearest_site(double x, double y) { int k, ret = 0; double d, dist = 0; for_k { d = sq2(x - site[k][0], y - site[k][1]); if (!k || d < dist) { dist = d, ret = k; } } return ret; } int at_edge(int *color, int y, int x) { int i, j, c = color[y * size_x + x]; for (i = y - 1; i <= y + 1; i++) { if (i < 0 || i >= size_y) continue; for (j = x - 1; j <= x + 1; j++) { if (j < 0 || j >= size_x) continue; if (color[i * size_x + j] != c) return 1; } } return 0; } #define AA_RES 4 void aa_color(unsigned char *pix, int y, int x) { int i, j, n; double r = 0, g = 0, b = 0, xx, yy; for (i = 0; i < AA_RES; i++) { yy = y + 1. / AA_RES * i + .5; for (j = 0; j < AA_RES; j++) { xx = x + 1. / AA_RES * j + .5; n = nearest_site(xx, yy); r += rgb[n][0]; g += rgb[n][1]; b += rgb[n][2]; } } pix[0] = r / (AA_RES * AA_RES); pix[1] = g / (AA_RES * AA_RES); pix[2] = b / (AA_RES * AA_RES); } #define for_i for (i = 0; i < size_y; i++) #define for_j for (j = 0; j < size_x; j++) void gen_map() { int i, j, k; int *nearest = malloc(sizeof(int) * size_y * size_x); unsigned char *ptr, *buf, color; ptr = buf = malloc(3 * size_x * size_y); for_i for_j nearest[i * size_x + j] = nearest_site(j, i); for_i for_j { if (!at_edge(nearest, i, j)) memcpy(ptr, rgb[nearest[i * size_x + j]], 3); else aa_color(ptr, i, j); ptr += 3; } for (k = 0; k < N_SITES; k++) { color = (rgb[k][0]*.25 + rgb[k][1]*.6 + rgb[k][2]*.15 > 80) ? 0 : 255; for (i = site[k][1] - 1; i <= site[k][1] + 1; i++) { if (i < 0 || i >= size_y) continue; for (j = site[k][0] - 1; j <= site[k][0] + 1; j++) { if (j < 0 || j >= size_x) continue; ptr = buf + 3 * (i * size_x + j); ptr[0] = ptr[1] = ptr[2] = color; } } } printf("P6\n%d %d\n255\n", size_x, size_y); fflush(stdout); fwrite(buf, size_y * size_x * 3, 1, stdout); } #define frand(x) (rand() / (1. + RAND_MAX) * x) int main() { int k; for_k { site[k][0] = frand(size_x); site[k][1] = frand(size_y); rgb [k][0] = frand(256); rgb [k][1] = frand(256); rgb [k][2] = frand(256); } gen_map(); return 0; }
#include <windows.h> #include <vector> #include <string> using namespace std; struct Point { int x, y; }; class MyBitmap { public: MyBitmap() : pen_(nullptr) {} ~MyBitmap() { DeleteObject(pen_); DeleteDC(hdc_); DeleteObject(bmp_); } bool Create(int w, int h) { BITMAPINFO bi; ZeroMemory(&bi, sizeof(bi)); bi.bmiHeader.biSize = sizeof(bi.bmiHeader); bi.bmiHeader.biBitCount = sizeof(DWORD) * 8; bi.bmiHeader.biCompression = BI_RGB; bi.bmiHeader.biPlanes = 1; bi.bmiHeader.biWidth = w; bi.bmiHeader.biHeight = -h; void *bits_ptr = nullptr; HDC dc = GetDC(GetConsoleWindow()); bmp_ = CreateDIBSection(dc, &bi, DIB_RGB_COLORS, &bits_ptr, nullptr, 0); if (!bmp_) return false; hdc_ = CreateCompatibleDC(dc); SelectObject(hdc_, bmp_); ReleaseDC(GetConsoleWindow(), dc); width_ = w; height_ = h; return true; } void SetPenColor(DWORD clr) { if (pen_) DeleteObject(pen_); pen_ = CreatePen(PS_SOLID, 1, clr); SelectObject(hdc_, pen_); } bool SaveBitmap(const char* path) { HANDLE file = CreateFile(path, GENERIC_WRITE, 0, nullptr, CREATE_ALWAYS, FILE_ATTRIBUTE_NORMAL, nullptr); if (file == INVALID_HANDLE_VALUE) { return false; } BITMAPFILEHEADER fileheader; BITMAPINFO infoheader; BITMAP bitmap; GetObject(bmp_, sizeof(bitmap), &bitmap); DWORD* dwp_bits = new DWORD[bitmap.bmWidth * bitmap.bmHeight]; ZeroMemory(dwp_bits, bitmap.bmWidth * bitmap.bmHeight * sizeof(DWORD)); ZeroMemory(&infoheader, sizeof(BITMAPINFO)); ZeroMemory(&fileheader, sizeof(BITMAPFILEHEADER)); infoheader.bmiHeader.biBitCount = sizeof(DWORD) * 8; infoheader.bmiHeader.biCompression = BI_RGB; infoheader.bmiHeader.biPlanes = 1; infoheader.bmiHeader.biSize = sizeof(infoheader.bmiHeader); infoheader.bmiHeader.biHeight = bitmap.bmHeight; infoheader.bmiHeader.biWidth = bitmap.bmWidth; infoheader.bmiHeader.biSizeImage = bitmap.bmWidth * bitmap.bmHeight * sizeof(DWORD); fileheader.bfType = 0x4D42; fileheader.bfOffBits = sizeof(infoheader.bmiHeader) + sizeof(BITMAPFILEHEADER); fileheader.bfSize = fileheader.bfOffBits + infoheader.bmiHeader.biSizeImage; GetDIBits(hdc_, bmp_, 0, height_, (LPVOID)dwp_bits, &infoheader, DIB_RGB_COLORS); DWORD wb; WriteFile(file, &fileheader, sizeof(BITMAPFILEHEADER), &wb, nullptr); WriteFile(file, &infoheader.bmiHeader, sizeof(infoheader.bmiHeader), &wb, nullptr); WriteFile(file, dwp_bits, bitmap.bmWidth * bitmap.bmHeight * 4, &wb, nullptr); CloseHandle(file); delete[] dwp_bits; return true; } HDC hdc() { return hdc_; } int width() { return width_; } int height() { return height_; } private: HBITMAP bmp_; HDC hdc_; HPEN pen_; int width_, height_; }; static int DistanceSqrd(const Point& point, int x, int y) { int xd = x - point.x; int yd = y - point.y; return (xd * xd) + (yd * yd); } class Voronoi { public: void Make(MyBitmap* bmp, int count) { bmp_ = bmp; CreatePoints(count); CreateColors(); CreateSites(); SetSitesPoints(); } private: void CreateSites() { int w = bmp_->width(), h = bmp_->height(), d; for (int hh = 0; hh < h; hh++) { for (int ww = 0; ww < w; ww++) { int ind = -1, dist = INT_MAX; for (size_t it = 0; it < points_.size(); it++) { const Point& p = points_[it]; d = DistanceSqrd(p, ww, hh); if (d < dist) { dist = d; ind = it; } } if (ind > -1) SetPixel(bmp_->hdc(), ww, hh, colors_[ind]); else __asm nop } } } void SetSitesPoints() { for (const auto& point : points_) { int x = point.x, y = point.y; for (int i = -1; i < 2; i++) for (int j = -1; j < 2; j++) SetPixel(bmp_->hdc(), x + i, y + j, 0); } } void CreatePoints(int count) { const int w = bmp_->width() - 20, h = bmp_->height() - 20; for (int i = 0; i < count; i++) { points_.push_back({ rand() % w + 10, rand() % h + 10 }); } } void CreateColors() { for (size_t i = 0; i < points_.size(); i++) { DWORD c = RGB(rand() % 200 + 50, rand() % 200 + 55, rand() % 200 + 50); colors_.push_back(c); } } vector<Point> points_; vector<DWORD> colors_; MyBitmap* bmp_; }; int main(int argc, char* argv[]) { ShowWindow(GetConsoleWindow(), SW_MAXIMIZE); srand(GetTickCount()); MyBitmap bmp; bmp.Create(512, 512); bmp.SetPenColor(0); Voronoi v; v.Make(&bmp, 50); BitBlt(GetDC(GetConsoleWindow()), 20, 20, 512, 512, bmp.hdc(), 0, 0, SRCCOPY); bmp.SaveBitmap("v.bmp"); system("pause"); return 0; }
Convert this C block to C++, preserving its control flow and logic.
#include <stdio.h> #include <stdlib.h> #include <string.h> #define N_SITES 150 double site[N_SITES][2]; unsigned char rgb[N_SITES][3]; int size_x = 640, size_y = 480; inline double sq2(double x, double y) { return x * x + y * y; } #define for_k for (k = 0; k < N_SITES; k++) int nearest_site(double x, double y) { int k, ret = 0; double d, dist = 0; for_k { d = sq2(x - site[k][0], y - site[k][1]); if (!k || d < dist) { dist = d, ret = k; } } return ret; } int at_edge(int *color, int y, int x) { int i, j, c = color[y * size_x + x]; for (i = y - 1; i <= y + 1; i++) { if (i < 0 || i >= size_y) continue; for (j = x - 1; j <= x + 1; j++) { if (j < 0 || j >= size_x) continue; if (color[i * size_x + j] != c) return 1; } } return 0; } #define AA_RES 4 void aa_color(unsigned char *pix, int y, int x) { int i, j, n; double r = 0, g = 0, b = 0, xx, yy; for (i = 0; i < AA_RES; i++) { yy = y + 1. / AA_RES * i + .5; for (j = 0; j < AA_RES; j++) { xx = x + 1. / AA_RES * j + .5; n = nearest_site(xx, yy); r += rgb[n][0]; g += rgb[n][1]; b += rgb[n][2]; } } pix[0] = r / (AA_RES * AA_RES); pix[1] = g / (AA_RES * AA_RES); pix[2] = b / (AA_RES * AA_RES); } #define for_i for (i = 0; i < size_y; i++) #define for_j for (j = 0; j < size_x; j++) void gen_map() { int i, j, k; int *nearest = malloc(sizeof(int) * size_y * size_x); unsigned char *ptr, *buf, color; ptr = buf = malloc(3 * size_x * size_y); for_i for_j nearest[i * size_x + j] = nearest_site(j, i); for_i for_j { if (!at_edge(nearest, i, j)) memcpy(ptr, rgb[nearest[i * size_x + j]], 3); else aa_color(ptr, i, j); ptr += 3; } for (k = 0; k < N_SITES; k++) { color = (rgb[k][0]*.25 + rgb[k][1]*.6 + rgb[k][2]*.15 > 80) ? 0 : 255; for (i = site[k][1] - 1; i <= site[k][1] + 1; i++) { if (i < 0 || i >= size_y) continue; for (j = site[k][0] - 1; j <= site[k][0] + 1; j++) { if (j < 0 || j >= size_x) continue; ptr = buf + 3 * (i * size_x + j); ptr[0] = ptr[1] = ptr[2] = color; } } } printf("P6\n%d %d\n255\n", size_x, size_y); fflush(stdout); fwrite(buf, size_y * size_x * 3, 1, stdout); } #define frand(x) (rand() / (1. + RAND_MAX) * x) int main() { int k; for_k { site[k][0] = frand(size_x); site[k][1] = frand(size_y); rgb [k][0] = frand(256); rgb [k][1] = frand(256); rgb [k][2] = frand(256); } gen_map(); return 0; }
#include <windows.h> #include <vector> #include <string> using namespace std; struct Point { int x, y; }; class MyBitmap { public: MyBitmap() : pen_(nullptr) {} ~MyBitmap() { DeleteObject(pen_); DeleteDC(hdc_); DeleteObject(bmp_); } bool Create(int w, int h) { BITMAPINFO bi; ZeroMemory(&bi, sizeof(bi)); bi.bmiHeader.biSize = sizeof(bi.bmiHeader); bi.bmiHeader.biBitCount = sizeof(DWORD) * 8; bi.bmiHeader.biCompression = BI_RGB; bi.bmiHeader.biPlanes = 1; bi.bmiHeader.biWidth = w; bi.bmiHeader.biHeight = -h; void *bits_ptr = nullptr; HDC dc = GetDC(GetConsoleWindow()); bmp_ = CreateDIBSection(dc, &bi, DIB_RGB_COLORS, &bits_ptr, nullptr, 0); if (!bmp_) return false; hdc_ = CreateCompatibleDC(dc); SelectObject(hdc_, bmp_); ReleaseDC(GetConsoleWindow(), dc); width_ = w; height_ = h; return true; } void SetPenColor(DWORD clr) { if (pen_) DeleteObject(pen_); pen_ = CreatePen(PS_SOLID, 1, clr); SelectObject(hdc_, pen_); } bool SaveBitmap(const char* path) { HANDLE file = CreateFile(path, GENERIC_WRITE, 0, nullptr, CREATE_ALWAYS, FILE_ATTRIBUTE_NORMAL, nullptr); if (file == INVALID_HANDLE_VALUE) { return false; } BITMAPFILEHEADER fileheader; BITMAPINFO infoheader; BITMAP bitmap; GetObject(bmp_, sizeof(bitmap), &bitmap); DWORD* dwp_bits = new DWORD[bitmap.bmWidth * bitmap.bmHeight]; ZeroMemory(dwp_bits, bitmap.bmWidth * bitmap.bmHeight * sizeof(DWORD)); ZeroMemory(&infoheader, sizeof(BITMAPINFO)); ZeroMemory(&fileheader, sizeof(BITMAPFILEHEADER)); infoheader.bmiHeader.biBitCount = sizeof(DWORD) * 8; infoheader.bmiHeader.biCompression = BI_RGB; infoheader.bmiHeader.biPlanes = 1; infoheader.bmiHeader.biSize = sizeof(infoheader.bmiHeader); infoheader.bmiHeader.biHeight = bitmap.bmHeight; infoheader.bmiHeader.biWidth = bitmap.bmWidth; infoheader.bmiHeader.biSizeImage = bitmap.bmWidth * bitmap.bmHeight * sizeof(DWORD); fileheader.bfType = 0x4D42; fileheader.bfOffBits = sizeof(infoheader.bmiHeader) + sizeof(BITMAPFILEHEADER); fileheader.bfSize = fileheader.bfOffBits + infoheader.bmiHeader.biSizeImage; GetDIBits(hdc_, bmp_, 0, height_, (LPVOID)dwp_bits, &infoheader, DIB_RGB_COLORS); DWORD wb; WriteFile(file, &fileheader, sizeof(BITMAPFILEHEADER), &wb, nullptr); WriteFile(file, &infoheader.bmiHeader, sizeof(infoheader.bmiHeader), &wb, nullptr); WriteFile(file, dwp_bits, bitmap.bmWidth * bitmap.bmHeight * 4, &wb, nullptr); CloseHandle(file); delete[] dwp_bits; return true; } HDC hdc() { return hdc_; } int width() { return width_; } int height() { return height_; } private: HBITMAP bmp_; HDC hdc_; HPEN pen_; int width_, height_; }; static int DistanceSqrd(const Point& point, int x, int y) { int xd = x - point.x; int yd = y - point.y; return (xd * xd) + (yd * yd); } class Voronoi { public: void Make(MyBitmap* bmp, int count) { bmp_ = bmp; CreatePoints(count); CreateColors(); CreateSites(); SetSitesPoints(); } private: void CreateSites() { int w = bmp_->width(), h = bmp_->height(), d; for (int hh = 0; hh < h; hh++) { for (int ww = 0; ww < w; ww++) { int ind = -1, dist = INT_MAX; for (size_t it = 0; it < points_.size(); it++) { const Point& p = points_[it]; d = DistanceSqrd(p, ww, hh); if (d < dist) { dist = d; ind = it; } } if (ind > -1) SetPixel(bmp_->hdc(), ww, hh, colors_[ind]); else __asm nop } } } void SetSitesPoints() { for (const auto& point : points_) { int x = point.x, y = point.y; for (int i = -1; i < 2; i++) for (int j = -1; j < 2; j++) SetPixel(bmp_->hdc(), x + i, y + j, 0); } } void CreatePoints(int count) { const int w = bmp_->width() - 20, h = bmp_->height() - 20; for (int i = 0; i < count; i++) { points_.push_back({ rand() % w + 10, rand() % h + 10 }); } } void CreateColors() { for (size_t i = 0; i < points_.size(); i++) { DWORD c = RGB(rand() % 200 + 50, rand() % 200 + 55, rand() % 200 + 50); colors_.push_back(c); } } vector<Point> points_; vector<DWORD> colors_; MyBitmap* bmp_; }; int main(int argc, char* argv[]) { ShowWindow(GetConsoleWindow(), SW_MAXIMIZE); srand(GetTickCount()); MyBitmap bmp; bmp.Create(512, 512); bmp.SetPenColor(0); Voronoi v; v.Make(&bmp, 50); BitBlt(GetDC(GetConsoleWindow()), 20, 20, 512, 512, bmp.hdc(), 0, 0, SRCCOPY); bmp.SaveBitmap("v.bmp"); system("pause"); return 0; }
Convert this C block to C++, preserving its control flow and logic.
#include <stdio.h> void sayHello(char* name){ printf("Hello %s!\n", name); } int doubleNum(int num){ return num * 2; }
FUNCTION MULTIPLY(X, Y) DOUBLE PRECISION MULTIPLY, X, Y
Convert this C snippet to C++ and keep its semantics consistent.
#include <stdlib.h> #include <stdio.h> #include <string.h> #include <time.h> struct s_env { unsigned int n, i; size_t size; void *sample; }; void s_of_n_init(struct s_env *s_env, size_t size, unsigned int n) { s_env->i = 0; s_env->n = n; s_env->size = size; s_env->sample = malloc(n * size); } void sample_set_i(struct s_env *s_env, unsigned int i, void *item) { memcpy(s_env->sample + i * s_env->size, item, s_env->size); } void *s_of_n(struct s_env *s_env, void *item) { s_env->i++; if (s_env->i <= s_env->n) sample_set_i(s_env, s_env->i - 1, item); else if ((rand() % s_env->i) < s_env->n) sample_set_i(s_env, rand() % s_env->n, item); return s_env->sample; } int *test(unsigned int n, int *items_set, unsigned int num_items) { int i; struct s_env s_env; s_of_n_init(&s_env, sizeof(items_set[0]), n); for (i = 0; i < num_items; i++) { s_of_n(&s_env, (void *) &items_set[i]); } return (int *)s_env.sample; } int main() { unsigned int i, j; unsigned int n = 3; unsigned int num_items = 10; unsigned int *frequencies; int *items_set; srand(time(NULL)); items_set = malloc(num_items * sizeof(int)); frequencies = malloc(num_items * sizeof(int)); for (i = 0; i < num_items; i++) { items_set[i] = i; frequencies[i] = 0; } for (i = 0; i < 100000; i++) { int *res = test(n, items_set, num_items); for (j = 0; j < n; j++) { frequencies[res[j]]++; } free(res); } for (i = 0; i < num_items; i++) { printf(" %d", frequencies[i]); } puts(""); return 0; }
#include <iostream> #include <functional> #include <vector> #include <cstdlib> #include <ctime> template <typename T> std::function<std::vector<T>(T)> s_of_n_creator(int n) { std::vector<T> sample; int i = 0; return [=](T item) mutable { i++; if (i <= n) { sample.push_back(item); } else if (std::rand() % i < n) { sample[std::rand() % n] = item; } return sample; }; } int main() { std::srand(std::time(NULL)); int bin[10] = {0}; for (int trial = 0; trial < 100000; trial++) { auto s_of_n = s_of_n_creator<int>(3); std::vector<int> sample; for (int i = 0; i < 10; i++) sample = s_of_n(i); for (int s : sample) bin[s]++; } for (int x : bin) std::cout << x << std::endl; return 0; }
Generate an equivalent C++ version of this C code.
#include <stdlib.h> #include <stdio.h> #include <string.h> #include <time.h> struct s_env { unsigned int n, i; size_t size; void *sample; }; void s_of_n_init(struct s_env *s_env, size_t size, unsigned int n) { s_env->i = 0; s_env->n = n; s_env->size = size; s_env->sample = malloc(n * size); } void sample_set_i(struct s_env *s_env, unsigned int i, void *item) { memcpy(s_env->sample + i * s_env->size, item, s_env->size); } void *s_of_n(struct s_env *s_env, void *item) { s_env->i++; if (s_env->i <= s_env->n) sample_set_i(s_env, s_env->i - 1, item); else if ((rand() % s_env->i) < s_env->n) sample_set_i(s_env, rand() % s_env->n, item); return s_env->sample; } int *test(unsigned int n, int *items_set, unsigned int num_items) { int i; struct s_env s_env; s_of_n_init(&s_env, sizeof(items_set[0]), n); for (i = 0; i < num_items; i++) { s_of_n(&s_env, (void *) &items_set[i]); } return (int *)s_env.sample; } int main() { unsigned int i, j; unsigned int n = 3; unsigned int num_items = 10; unsigned int *frequencies; int *items_set; srand(time(NULL)); items_set = malloc(num_items * sizeof(int)); frequencies = malloc(num_items * sizeof(int)); for (i = 0; i < num_items; i++) { items_set[i] = i; frequencies[i] = 0; } for (i = 0; i < 100000; i++) { int *res = test(n, items_set, num_items); for (j = 0; j < n; j++) { frequencies[res[j]]++; } free(res); } for (i = 0; i < num_items; i++) { printf(" %d", frequencies[i]); } puts(""); return 0; }
#include <iostream> #include <functional> #include <vector> #include <cstdlib> #include <ctime> template <typename T> std::function<std::vector<T>(T)> s_of_n_creator(int n) { std::vector<T> sample; int i = 0; return [=](T item) mutable { i++; if (i <= n) { sample.push_back(item); } else if (std::rand() % i < n) { sample[std::rand() % n] = item; } return sample; }; } int main() { std::srand(std::time(NULL)); int bin[10] = {0}; for (int trial = 0; trial < 100000; trial++) { auto s_of_n = s_of_n_creator<int>(3); std::vector<int> sample; for (int i = 0; i < 10; i++) sample = s_of_n(i); for (int s : sample) bin[s]++; } for (int x : bin) std::cout << x << std::endl; return 0; }
Translate this program into C++ but keep the logic exactly as in C.
#include <stdlib.h> #include <stdio.h> #include <string.h> #include <time.h> struct s_env { unsigned int n, i; size_t size; void *sample; }; void s_of_n_init(struct s_env *s_env, size_t size, unsigned int n) { s_env->i = 0; s_env->n = n; s_env->size = size; s_env->sample = malloc(n * size); } void sample_set_i(struct s_env *s_env, unsigned int i, void *item) { memcpy(s_env->sample + i * s_env->size, item, s_env->size); } void *s_of_n(struct s_env *s_env, void *item) { s_env->i++; if (s_env->i <= s_env->n) sample_set_i(s_env, s_env->i - 1, item); else if ((rand() % s_env->i) < s_env->n) sample_set_i(s_env, rand() % s_env->n, item); return s_env->sample; } int *test(unsigned int n, int *items_set, unsigned int num_items) { int i; struct s_env s_env; s_of_n_init(&s_env, sizeof(items_set[0]), n); for (i = 0; i < num_items; i++) { s_of_n(&s_env, (void *) &items_set[i]); } return (int *)s_env.sample; } int main() { unsigned int i, j; unsigned int n = 3; unsigned int num_items = 10; unsigned int *frequencies; int *items_set; srand(time(NULL)); items_set = malloc(num_items * sizeof(int)); frequencies = malloc(num_items * sizeof(int)); for (i = 0; i < num_items; i++) { items_set[i] = i; frequencies[i] = 0; } for (i = 0; i < 100000; i++) { int *res = test(n, items_set, num_items); for (j = 0; j < n; j++) { frequencies[res[j]]++; } free(res); } for (i = 0; i < num_items; i++) { printf(" %d", frequencies[i]); } puts(""); return 0; }
#include <iostream> #include <functional> #include <vector> #include <cstdlib> #include <ctime> template <typename T> std::function<std::vector<T>(T)> s_of_n_creator(int n) { std::vector<T> sample; int i = 0; return [=](T item) mutable { i++; if (i <= n) { sample.push_back(item); } else if (std::rand() % i < n) { sample[std::rand() % n] = item; } return sample; }; } int main() { std::srand(std::time(NULL)); int bin[10] = {0}; for (int trial = 0; trial < 100000; trial++) { auto s_of_n = s_of_n_creator<int>(3); std::vector<int> sample; for (int i = 0; i < 10; i++) sample = s_of_n(i); for (int s : sample) bin[s]++; } for (int x : bin) std::cout << x << std::endl; return 0; }
Convert this C snippet to C++ and keep its semantics consistent.
#include <stdbool.h> #include <stdio.h> #include <stdlib.h> #include <string.h> int binomial(int n, int k) { int num, denom, i; if (n < 0 || k < 0 || n < k) return -1; if (n == 0 || k == 0) return 1; num = 1; for (i = k + 1; i <= n; ++i) { num = num * i; } denom = 1; for (i = 2; i <= n - k; ++i) { denom *= i; } return num / denom; } int gcd(int a, int b) { int temp; while (b != 0) { temp = a % b; a = b; b = temp; } return a; } typedef struct tFrac { int num, denom; } Frac; Frac makeFrac(int n, int d) { Frac result; int g; if (d == 0) { result.num = 0; result.denom = 0; return result; } if (n == 0) { d = 1; } else if (d < 0) { n = -n; d = -d; } g = abs(gcd(n, d)); if (g > 1) { n = n / g; d = d / g; } result.num = n; result.denom = d; return result; } Frac negateFrac(Frac f) { return makeFrac(-f.num, f.denom); } Frac subFrac(Frac lhs, Frac rhs) { return makeFrac(lhs.num * rhs.denom - lhs.denom * rhs.num, rhs.denom * lhs.denom); } Frac multFrac(Frac lhs, Frac rhs) { return makeFrac(lhs.num * rhs.num, lhs.denom * rhs.denom); } bool equalFrac(Frac lhs, Frac rhs) { return (lhs.num == rhs.num) && (lhs.denom == rhs.denom); } bool lessFrac(Frac lhs, Frac rhs) { return (lhs.num * rhs.denom) < (rhs.num * lhs.denom); } void printFrac(Frac f) { char buffer[7]; int len; if (f.denom != 1) { snprintf(buffer, 7, "%d/%d", f.num, f.denom); } else { snprintf(buffer, 7, "%d", f.num); } len = 7 - strlen(buffer); while (len-- > 0) { putc(' ', stdout); } printf(buffer); } Frac bernoulli(int n) { Frac a[16]; int j, m; if (n < 0) { a[0].num = 0; a[0].denom = 0; return a[0]; } for (m = 0; m <= n; ++m) { a[m] = makeFrac(1, m + 1); for (j = m; j >= 1; --j) { a[j - 1] = multFrac(subFrac(a[j - 1], a[j]), makeFrac(j, 1)); } } if (n != 1) { return a[0]; } return negateFrac(a[0]); } void faulhaber(int p) { Frac q, *coeffs; int j, sign; coeffs = malloc(sizeof(Frac)*(p + 1)); q = makeFrac(1, p + 1); sign = -1; for (j = 0; j <= p; ++j) { sign = -1 * sign; coeffs[p - j] = multFrac(multFrac(multFrac(q, makeFrac(sign, 1)), makeFrac(binomial(p + 1, j), 1)), bernoulli(j)); } for (j = 0; j <= p; ++j) { printFrac(coeffs[j]); } printf("\n"); free(coeffs); } int main() { int i; for (i = 0; i < 10; ++i) { faulhaber(i); } return 0; }
#include <exception> #include <iomanip> #include <iostream> #include <numeric> #include <sstream> #include <vector> class Frac { public: Frac() : num(0), denom(1) {} Frac(int n, int d) { if (d == 0) { throw std::runtime_error("d must not be zero"); } int sign_of_d = d < 0 ? -1 : 1; int g = std::gcd(n, d); num = sign_of_d * n / g; denom = sign_of_d * d / g; } Frac operator-() const { return Frac(-num, denom); } Frac operator+(const Frac& rhs) const { return Frac(num*rhs.denom + denom * rhs.num, rhs.denom*denom); } Frac operator-(const Frac& rhs) const { return Frac(num*rhs.denom - denom * rhs.num, rhs.denom*denom); } Frac operator*(const Frac& rhs) const { return Frac(num*rhs.num, denom*rhs.denom); } Frac operator*(int rhs) const { return Frac(num * rhs, denom); } friend std::ostream& operator<<(std::ostream&, const Frac&); private: int num; int denom; }; std::ostream & operator<<(std::ostream & os, const Frac &f) { if (f.num == 0 || f.denom == 1) { return os << f.num; } std::stringstream ss; ss << f.num << "/" << f.denom; return os << ss.str(); } Frac bernoulli(int n) { if (n < 0) { throw std::runtime_error("n may not be negative or zero"); } std::vector<Frac> a; for (int m = 0; m <= n; m++) { a.push_back(Frac(1, m + 1)); for (int j = m; j >= 1; j--) { a[j - 1] = (a[j - 1] - a[j]) * j; } } if (n != 1) return a[0]; return -a[0]; } int binomial(int n, int k) { if (n < 0 || k < 0 || n < k) { throw std::runtime_error("parameters are invalid"); } if (n == 0 || k == 0) return 1; int num = 1; for (int i = k + 1; i <= n; i++) { num *= i; } int denom = 1; for (int i = 2; i <= n - k; i++) { denom *= i; } return num / denom; } std::vector<Frac> faulhaberTraingle(int p) { std::vector<Frac> coeffs(p + 1); Frac q{ 1, p + 1 }; int sign = -1; for (int j = 0; j <= p; j++) { sign *= -1; coeffs[p - j] = q * sign * binomial(p + 1, j) * bernoulli(j); } return coeffs; } int main() { for (int i = 0; i < 10; i++) { std::vector<Frac> coeffs = faulhaberTraingle(i); for (auto frac : coeffs) { std::cout << std::right << std::setw(5) << frac << " "; } std::cout << std::endl; } return 0; }
Transform the following C implementation into C++, maintaining the same output and logic.
#include <stdlib.h> #include <stdio.h> int main(int argc, char* argv[]) { int i; (void) printf("This program is named %s.\n", argv[0]); for (i = 1; i < argc; ++i) (void) printf("the argument #%d is %s\n", i, argv[i]); return EXIT_SUCCESS; }
#include <iostream> int main(int argc, char* argv[]) { std::cout << "This program is named " << argv[0] << std::endl; std::cout << "There are " << argc-1 << " arguments given." << std::endl; for (int i = 1; i < argc; ++i) std::cout << "the argument #" << i << " is " << argv[i] << std::endl; return 0; }
Write the same code in C++ as shown below in C.
#include <stdlib.h> #include <stdio.h> int main(int argc, char* argv[]) { int i; (void) printf("This program is named %s.\n", argv[0]); for (i = 1; i < argc; ++i) (void) printf("the argument #%d is %s\n", i, argv[i]); return EXIT_SUCCESS; }
#include <iostream> int main(int argc, char* argv[]) { std::cout << "This program is named " << argv[0] << std::endl; std::cout << "There are " << argc-1 << " arguments given." << std::endl; for (int i = 1; i < argc; ++i) std::cout << "the argument #" << i << " is " << argv[i] << std::endl; return 0; }
Write the same algorithm in C++ as shown in this C implementation.
#include <stdlib.h> #include <stdio.h> int main(int argc, char* argv[]) { int i; (void) printf("This program is named %s.\n", argv[0]); for (i = 1; i < argc; ++i) (void) printf("the argument #%d is %s\n", i, argv[i]); return EXIT_SUCCESS; }
#include <iostream> int main(int argc, char* argv[]) { std::cout << "This program is named " << argv[0] << std::endl; std::cout << "There are " << argc-1 << " arguments given." << std::endl; for (int i = 1; i < argc; ++i) std::cout << "the argument #" << i << " is " << argv[i] << std::endl; return 0; }
Translate this program into C++ but keep the logic exactly as in C.
#include <stdbool.h> #include <stdio.h> #define MAX_WORD 80 #define LETTERS 26 bool is_letter(char c) { return c >= 'a' && c <= 'z'; } int index(char c) { return c - 'a'; } void word_wheel(const char* letters, char central, int min_length, FILE* dict) { int max_count[LETTERS] = { 0 }; for (const char* p = letters; *p; ++p) { char c = *p; if (is_letter(c)) ++max_count[index(c)]; } char word[MAX_WORD + 1] = { 0 }; while (fgets(word, MAX_WORD, dict)) { int count[LETTERS] = { 0 }; for (const char* p = word; *p; ++p) { char c = *p; if (c == '\n') { if (p >= word + min_length && count[index(central)] > 0) printf("%s", word); } else if (is_letter(c)) { int i = index(c); if (++count[i] > max_count[i]) { break; } } else { break; } } } } int main(int argc, char** argv) { const char* dict = argc == 2 ? argv[1] : "unixdict.txt"; FILE* in = fopen(dict, "r"); if (in == NULL) { perror(dict); return 1; } word_wheel("ndeokgelw", 'k', 3, in); fclose(in); return 0; }
#include <array> #include <iostream> #include <fstream> #include <map> #include <string> #include <vector> #include <boost/program_options.hpp> class letterset { public: letterset() { count_.fill(0); } explicit letterset(const std::string& str) { count_.fill(0); for (char c : str) add(c); } bool contains(const letterset& set) const { for (size_t i = 0; i < count_.size(); ++i) { if (set.count_[i] > count_[i]) return false; } return true; } unsigned int count(char c) const { return count_[index(c)]; } bool is_valid() const { return count_[0] == 0; } void add(char c) { ++count_[index(c)]; } private: static bool is_letter(char c) { return c >= 'a' && c <= 'z'; } static int index(char c) { return is_letter(c) ? c - 'a' + 1 : 0; } std::array<unsigned int, 27> count_; }; template <typename iterator, typename separator> std::string join(iterator begin, iterator end, separator sep) { std::string result; if (begin != end) { result += *begin++; for (; begin != end; ++begin) { result += sep; result += *begin; } } return result; } using dictionary = std::vector<std::pair<std::string, letterset>>; dictionary load_dictionary(const std::string& filename, int min_length, int max_length) { std::ifstream in(filename); if (!in) throw std::runtime_error("Cannot open file " + filename); std::string word; dictionary result; while (getline(in, word)) { if (word.size() < min_length) continue; if (word.size() > max_length) continue; letterset set(word); if (set.is_valid()) result.emplace_back(word, set); } return result; } void word_wheel(const dictionary& dict, const std::string& letters, char central_letter) { letterset set(letters); if (central_letter == 0 && !letters.empty()) central_letter = letters.at(letters.size()/2); std::map<size_t, std::vector<std::string>> words; for (const auto& pair : dict) { const auto& word = pair.first; const auto& subset = pair.second; if (subset.count(central_letter) > 0 && set.contains(subset)) words[word.size()].push_back(word); } size_t total = 0; for (const auto& p : words) { const auto& v = p.second; auto n = v.size(); total += n; std::cout << "Found " << n << " " << (n == 1 ? "word" : "words") << " of length " << p.first << ": " << join(v.begin(), v.end(), ", ") << '\n'; } std::cout << "Number of words found: " << total << '\n'; } void find_max_word_count(const dictionary& dict, int word_length) { size_t max_count = 0; std::vector<std::pair<std::string, char>> max_words; for (const auto& pair : dict) { const auto& word = pair.first; if (word.size() != word_length) continue; const auto& set = pair.second; dictionary subsets; for (const auto& p : dict) { if (set.contains(p.second)) subsets.push_back(p); } letterset done; for (size_t index = 0; index < word_length; ++index) { char central_letter = word[index]; if (done.count(central_letter) > 0) continue; done.add(central_letter); size_t count = 0; for (const auto& p : subsets) { const auto& subset = p.second; if (subset.count(central_letter) > 0) ++count; } if (count > max_count) { max_words.clear(); max_count = count; } if (count == max_count) max_words.emplace_back(word, central_letter); } } std::cout << "Maximum word count: " << max_count << '\n'; std::cout << "Words of " << word_length << " letters producing this count:\n"; for (const auto& pair : max_words) std::cout << pair.first << " with central letter " << pair.second << '\n'; } constexpr const char* option_filename = "filename"; constexpr const char* option_wheel = "wheel"; constexpr const char* option_central = "central"; constexpr const char* option_min_length = "min-length"; constexpr const char* option_part2 = "part2"; int main(int argc, char** argv) { const int word_length = 9; int min_length = 3; std::string letters = "ndeokgelw"; std::string filename = "unixdict.txt"; char central_letter = 0; bool do_part2 = false; namespace po = boost::program_options; po::options_description desc("Allowed options"); desc.add_options() (option_filename, po::value<std::string>(), "name of dictionary file") (option_wheel, po::value<std::string>(), "word wheel letters") (option_central, po::value<char>(), "central letter (defaults to middle letter of word)") (option_min_length, po::value<int>(), "minimum word length") (option_part2, "include part 2"); try { po::variables_map vm; po::store(po::parse_command_line(argc, argv, desc), vm); po::notify(vm); if (vm.count(option_filename)) filename = vm[option_filename].as<std::string>(); if (vm.count(option_wheel)) letters = vm[option_wheel].as<std::string>(); if (vm.count(option_central)) central_letter = vm[option_central].as<char>(); if (vm.count(option_min_length)) min_length = vm[option_min_length].as<int>(); if (vm.count(option_part2)) do_part2 = true; auto dict = load_dictionary(filename, min_length, word_length); word_wheel(dict, letters, central_letter); if (do_part2) { std::cout << '\n'; find_max_word_count(dict, word_length); } } catch (const std::exception& ex) { std::cerr << ex.what() << '\n'; return EXIT_FAILURE; } return EXIT_SUCCESS; }
Transform the following C implementation into C++, maintaining the same output and logic.
#include <stdlib.h> #include <stdio.h> #include <string.h> #define ARRAY_CONCAT(TYPE, A, An, B, Bn) \ (TYPE *)array_concat((const void *)(A), (An), (const void *)(B), (Bn), sizeof(TYPE)); void *array_concat(const void *a, size_t an, const void *b, size_t bn, size_t s) { char *p = malloc(s * (an + bn)); memcpy(p, a, an*s); memcpy(p + an*s, b, bn*s); return p; } const int a[] = { 1, 2, 3, 4, 5 }; const int b[] = { 6, 7, 8, 9, 0 }; int main(void) { unsigned int i; int *c = ARRAY_CONCAT(int, a, 5, b, 5); for(i = 0; i < 10; i++) printf("%d\n", c[i]); free(c); return EXIT_SUCCCESS; }
#include <vector> #include <iostream> int main() { std::vector<int> a(3), b(4); a[0] = 11; a[1] = 12; a[2] = 13; b[0] = 21; b[1] = 22; b[2] = 23; b[3] = 24; a.insert(a.end(), b.begin(), b.end()); for (int i = 0; i < a.size(); ++i) std::cout << "a[" << i << "] = " << a[i] << "\n"; }
Can you help me rewrite this code in C++ instead of C, keeping it the same logically?
#include <stdio.h> #include <stdlib.h> int main(void) { char str[BUFSIZ]; puts("Enter a string: "); fgets(str, sizeof(str), stdin); long num; char buf[BUFSIZ]; do { puts("Enter 75000: "); fgets(buf, sizeof(buf), stdin); num = strtol(buf, NULL, 10); } while (num != 75000); return EXIT_SUCCESS; }
#include <iostream> #include <string> using namespace std; int main() { long int integer_input; string string_input; cout << "Enter an integer: "; cin >> integer_input; cout << "Enter a string: "; cin >> string_input; return 0; }
Generate an equivalent C++ version of this C code.
#include<stdio.h> #include<conio.h> #include<math.h> #include<dos.h> typedef struct{ char str[3]; int key; }note; note sequence[] = {{"Do",0},{"Re",2},{"Mi",4},{"Fa",5},{"So",7},{"La",9},{"Ti",11},{"Do",12}}; int main(void) { int i=0; while(!kbhit()) { printf("\t%s",sequence[i].str); sound(261.63*pow(2,sequence[i].key/12.0)); delay(sequence[i].key%12==0?500:1000); i = (i+1)%8; i==0?printf("\n"):printf(""); } nosound(); return 0; }
#include <iostream> #include <windows.h> #include <mmsystem.h> #pragma comment ( lib, "winmm.lib" ) typedef unsigned char byte; typedef union { unsigned long word; unsigned char data[4]; } midi_msg; class midi { public: midi() { if( midiOutOpen( &device, 0, 0, 0, CALLBACK_NULL) != MMSYSERR_NOERROR ) { std::cout << "Error opening MIDI Output..." << std::endl; device = 0; } } ~midi() { midiOutReset( device ); midiOutClose( device ); } bool isOpen() { return device != 0; } void setInstrument( byte i ) { message.data[0] = 0xc0; message.data[1] = i; message.data[2] = 0; message.data[3] = 0; midiOutShortMsg( device, message.word ); } void playNote( byte n, unsigned i ) { playNote( n ); Sleep( i ); stopNote( n ); } private: void playNote( byte n ) { message.data[0] = 0x90; message.data[1] = n; message.data[2] = 127; message.data[3] = 0; midiOutShortMsg( device, message.word ); } void stopNote( byte n ) { message.data[0] = 0x90; message.data[1] = n; message.data[2] = 0; message.data[3] = 0; midiOutShortMsg( device, message.word ); } HMIDIOUT device; midi_msg message; }; int main( int argc, char* argv[] ) { midi m; if( m.isOpen() ) { byte notes[] = { 60, 62, 64, 65, 67, 69, 71, 72 }; m.setInstrument( 42 ); for( int x = 0; x < 8; x++ ) m.playNote( notes[x], rand() % 100 + 158 ); Sleep( 1000 ); } return 0; }
Convert the following code from C to C++, ensuring the logic remains intact.
#include<stdio.h> #include<conio.h> #include<math.h> #include<dos.h> typedef struct{ char str[3]; int key; }note; note sequence[] = {{"Do",0},{"Re",2},{"Mi",4},{"Fa",5},{"So",7},{"La",9},{"Ti",11},{"Do",12}}; int main(void) { int i=0; while(!kbhit()) { printf("\t%s",sequence[i].str); sound(261.63*pow(2,sequence[i].key/12.0)); delay(sequence[i].key%12==0?500:1000); i = (i+1)%8; i==0?printf("\n"):printf(""); } nosound(); return 0; }
#include <iostream> #include <windows.h> #include <mmsystem.h> #pragma comment ( lib, "winmm.lib" ) typedef unsigned char byte; typedef union { unsigned long word; unsigned char data[4]; } midi_msg; class midi { public: midi() { if( midiOutOpen( &device, 0, 0, 0, CALLBACK_NULL) != MMSYSERR_NOERROR ) { std::cout << "Error opening MIDI Output..." << std::endl; device = 0; } } ~midi() { midiOutReset( device ); midiOutClose( device ); } bool isOpen() { return device != 0; } void setInstrument( byte i ) { message.data[0] = 0xc0; message.data[1] = i; message.data[2] = 0; message.data[3] = 0; midiOutShortMsg( device, message.word ); } void playNote( byte n, unsigned i ) { playNote( n ); Sleep( i ); stopNote( n ); } private: void playNote( byte n ) { message.data[0] = 0x90; message.data[1] = n; message.data[2] = 127; message.data[3] = 0; midiOutShortMsg( device, message.word ); } void stopNote( byte n ) { message.data[0] = 0x90; message.data[1] = n; message.data[2] = 0; message.data[3] = 0; midiOutShortMsg( device, message.word ); } HMIDIOUT device; midi_msg message; }; int main( int argc, char* argv[] ) { midi m; if( m.isOpen() ) { byte notes[] = { 60, 62, 64, 65, 67, 69, 71, 72 }; m.setInstrument( 42 ); for( int x = 0; x < 8; x++ ) m.playNote( notes[x], rand() % 100 + 158 ); Sleep( 1000 ); } return 0; }
Keep all operations the same but rewrite the snippet in C++.
#include<stdio.h> #include<conio.h> #include<math.h> #include<dos.h> typedef struct{ char str[3]; int key; }note; note sequence[] = {{"Do",0},{"Re",2},{"Mi",4},{"Fa",5},{"So",7},{"La",9},{"Ti",11},{"Do",12}}; int main(void) { int i=0; while(!kbhit()) { printf("\t%s",sequence[i].str); sound(261.63*pow(2,sequence[i].key/12.0)); delay(sequence[i].key%12==0?500:1000); i = (i+1)%8; i==0?printf("\n"):printf(""); } nosound(); return 0; }
#include <iostream> #include <windows.h> #include <mmsystem.h> #pragma comment ( lib, "winmm.lib" ) typedef unsigned char byte; typedef union { unsigned long word; unsigned char data[4]; } midi_msg; class midi { public: midi() { if( midiOutOpen( &device, 0, 0, 0, CALLBACK_NULL) != MMSYSERR_NOERROR ) { std::cout << "Error opening MIDI Output..." << std::endl; device = 0; } } ~midi() { midiOutReset( device ); midiOutClose( device ); } bool isOpen() { return device != 0; } void setInstrument( byte i ) { message.data[0] = 0xc0; message.data[1] = i; message.data[2] = 0; message.data[3] = 0; midiOutShortMsg( device, message.word ); } void playNote( byte n, unsigned i ) { playNote( n ); Sleep( i ); stopNote( n ); } private: void playNote( byte n ) { message.data[0] = 0x90; message.data[1] = n; message.data[2] = 127; message.data[3] = 0; midiOutShortMsg( device, message.word ); } void stopNote( byte n ) { message.data[0] = 0x90; message.data[1] = n; message.data[2] = 0; message.data[3] = 0; midiOutShortMsg( device, message.word ); } HMIDIOUT device; midi_msg message; }; int main( int argc, char* argv[] ) { midi m; if( m.isOpen() ) { byte notes[] = { 60, 62, 64, 65, 67, 69, 71, 72 }; m.setInstrument( 42 ); for( int x = 0; x < 8; x++ ) m.playNote( notes[x], rand() % 100 + 158 ); Sleep( 1000 ); } return 0; }
Port the provided C code into C++ while preserving the original functionality.
#include <stdio.h> #include <stdlib.h> typedef struct { char *name; int weight; int value; } item_t; item_t items[] = { {"map", 9, 150}, {"compass", 13, 35}, {"water", 153, 200}, {"sandwich", 50, 160}, {"glucose", 15, 60}, {"tin", 68, 45}, {"banana", 27, 60}, {"apple", 39, 40}, {"cheese", 23, 30}, {"beer", 52, 10}, {"suntan cream", 11, 70}, {"camera", 32, 30}, {"T-shirt", 24, 15}, {"trousers", 48, 10}, {"umbrella", 73, 40}, {"waterproof trousers", 42, 70}, {"waterproof overclothes", 43, 75}, {"note-case", 22, 80}, {"sunglasses", 7, 20}, {"towel", 18, 12}, {"socks", 4, 50}, {"book", 30, 10}, }; int *knapsack (item_t *items, int n, int w) { int i, j, a, b, *mm, **m, *s; mm = calloc((n + 1) * (w + 1), sizeof (int)); m = malloc((n + 1) * sizeof (int *)); m[0] = mm; for (i = 1; i <= n; i++) { m[i] = &mm[i * (w + 1)]; for (j = 0; j <= w; j++) { if (items[i - 1].weight > j) { m[i][j] = m[i - 1][j]; } else { a = m[i - 1][j]; b = m[i - 1][j - items[i - 1].weight] + items[i - 1].value; m[i][j] = a > b ? a : b; } } } s = calloc(n, sizeof (int)); for (i = n, j = w; i > 0; i--) { if (m[i][j] > m[i - 1][j]) { s[i - 1] = 1; j -= items[i - 1].weight; } } free(mm); free(m); return s; } int main () { int i, n, tw = 0, tv = 0, *s; n = sizeof (items) / sizeof (item_t); s = knapsack(items, n, 400); for (i = 0; i < n; i++) { if (s[i]) { printf("%-22s %5d %5d\n", items[i].name, items[i].weight, items[i].value); tw += items[i].weight; tv += items[i].value; } } printf("%-22s %5d %5d\n", "totals:", tw, tv); return 0; }
#include <vector> #include <string> #include <iostream> #include <boost/tuple/tuple.hpp> #include <set> int findBestPack( const std::vector<boost::tuple<std::string , int , int> > & , std::set<int> & , const int ) ; int main( ) { std::vector<boost::tuple<std::string , int , int> > items ; items.push_back( boost::make_tuple( "" , 0 , 0 ) ) ; items.push_back( boost::make_tuple( "map" , 9 , 150 ) ) ; items.push_back( boost::make_tuple( "compass" , 13 , 35 ) ) ; items.push_back( boost::make_tuple( "water" , 153 , 200 ) ) ; items.push_back( boost::make_tuple( "sandwich", 50 , 160 ) ) ; items.push_back( boost::make_tuple( "glucose" , 15 , 60 ) ) ; items.push_back( boost::make_tuple( "tin", 68 , 45 ) ) ; items.push_back( boost::make_tuple( "banana", 27 , 60 ) ) ; items.push_back( boost::make_tuple( "apple" , 39 , 40 ) ) ; items.push_back( boost::make_tuple( "cheese" , 23 , 30 ) ) ; items.push_back( boost::make_tuple( "beer" , 52 , 10 ) ) ; items.push_back( boost::make_tuple( "suntan creme" , 11 , 70 ) ) ; items.push_back( boost::make_tuple( "camera" , 32 , 30 ) ) ; items.push_back( boost::make_tuple( "T-shirt" , 24 , 15 ) ) ; items.push_back( boost::make_tuple( "trousers" , 48 , 10 ) ) ; items.push_back( boost::make_tuple( "umbrella" , 73 , 40 ) ) ; items.push_back( boost::make_tuple( "waterproof trousers" , 42 , 70 ) ) ; items.push_back( boost::make_tuple( "waterproof overclothes" , 43 , 75 ) ) ; items.push_back( boost::make_tuple( "note-case" , 22 , 80 ) ) ; items.push_back( boost::make_tuple( "sunglasses" , 7 , 20 ) ) ; items.push_back( boost::make_tuple( "towel" , 18 , 12 ) ) ; items.push_back( boost::make_tuple( "socks" , 4 , 50 ) ) ; items.push_back( boost::make_tuple( "book" , 30 , 10 ) ) ; const int maximumWeight = 400 ; std::set<int> bestItems ; int bestValue = findBestPack( items , bestItems , maximumWeight ) ; std::cout << "The best value that can be packed in the given knapsack is " << bestValue << " !\n" ; int totalweight = 0 ; std::cout << "The following items should be packed in the knapsack:\n" ; for ( std::set<int>::const_iterator si = bestItems.begin( ) ; si != bestItems.end( ) ; si++ ) { std::cout << (items.begin( ) + *si)->get<0>( ) << "\n" ; totalweight += (items.begin( ) + *si)->get<1>( ) ; } std::cout << "The total weight of all items is " << totalweight << " !\n" ; return 0 ; } int findBestPack( const std::vector<boost::tuple<std::string , int , int> > & items ,std::set<int> & bestItems , const int weightlimit ) { const int n = items.size( ) ; int bestValues [ n ][ weightlimit ] ; std::set<int> solutionSets[ n ][ weightlimit ] ; std::set<int> emptyset ; for ( int i = 0 ; i < n ; i++ ) { for ( int j = 0 ; j < weightlimit ; j++ ) { bestValues[ i ][ j ] = 0 ; solutionSets[ i ][ j ] = emptyset ; } } for ( int i = 0 ; i < n ; i++ ) { for ( int weight = 0 ; weight < weightlimit ; weight++ ) { if ( i == 0 ) bestValues[ i ][ weight ] = 0 ; else { int itemweight = (items.begin( ) + i)->get<1>( ) ; if ( weight < itemweight ) { bestValues[ i ][ weight ] = bestValues[ i - 1 ][ weight ] ; solutionSets[ i ][ weight ] = solutionSets[ i - 1 ][ weight ] ; } else { if ( bestValues[ i - 1 ][ weight - itemweight ] + (items.begin( ) + i)->get<2>( ) > bestValues[ i - 1 ][ weight ] ) { bestValues[ i ][ weight ] = bestValues[ i - 1 ][ weight - itemweight ] + (items.begin( ) + i)->get<2>( ) ; solutionSets[ i ][ weight ] = solutionSets[ i - 1 ][ weight - itemweight ] ; solutionSets[ i ][ weight ].insert( i ) ; } else { bestValues[ i ][ weight ] = bestValues[ i - 1 ][ weight ] ; solutionSets[ i ][ weight ] = solutionSets[ i - 1 ][ weight ] ; } } } } } bestItems.swap( solutionSets[ n - 1][ weightlimit - 1 ] ) ; return bestValues[ n - 1 ][ weightlimit - 1 ] ; }
Convert this C snippet to C++ and keep its semantics consistent.
#include <math.h> #include <stdio.h> #include <stdlib.h> #include <string.h> #define MAXPRIME 99 #define MAXPARENT 99 #define NBRPRIMES 30 #define NBRANCESTORS 10 FILE *FileOut; char format[] = ", %lld"; int Primes[NBRPRIMES]; int iPrimes; short Ancestors[NBRANCESTORS]; struct Children { long long Child; struct Children *pNext; }; struct Children *Parents[MAXPARENT+1][2]; int CptDescendants[MAXPARENT+1]; long long MaxDescendant = (long long) pow(3.0, 33.0); short GetParent(long long child); struct Children *AppendChild(struct Children *node, long long child); short GetAncestors(short child); void PrintDescendants(struct Children *node); int GetPrimes(int primes[], int maxPrime); int main() { long long Child; short i, Parent, Level; int TotDesc = 0; if ((iPrimes = GetPrimes(Primes, MAXPRIME)) < 0) return 1; for (Child = 1; Child <= MaxDescendant; Child++) { if (Parent = GetParent(Child)) { Parents[Parent][1] = AppendChild(Parents[Parent][1], Child); if (Parents[Parent][0] == NULL) Parents[Parent][0] = Parents[Parent][1]; CptDescendants[Parent]++; } } if (MAXPARENT > MAXPRIME) if (GetPrimes(Primes, MAXPARENT) < 0) return 1; if (fopen_s(&FileOut, "Ancestors.txt", "w")) return 1; for (Parent = 1; Parent <= MAXPARENT; Parent++) { Level = GetAncestors(Parent); fprintf(FileOut, "[%d] Level: %d\n", Parent, Level); if (Level) { fprintf(FileOut, "Ancestors: %d", Ancestors[0]); for (i = 1; i < Level; i++) fprintf(FileOut, ", %d", Ancestors[i]); } else fprintf(FileOut, "Ancestors: None"); if (CptDescendants[Parent]) { fprintf(FileOut, "\nDescendants: %d\n", CptDescendants[Parent]); strcpy_s(format, "%lld"); PrintDescendants(Parents[Parent][0]); fprintf(FileOut, "\n"); } else fprintf(FileOut, "\nDescendants: None\n"); fprintf(FileOut, "\n"); TotDesc += CptDescendants[Parent]; } fprintf(FileOut, "Total descendants %d\n\n", TotDesc); if (fclose(FileOut)) return 1; return 0; } short GetParent(long long child) { long long Child = child; short Parent = 0; short Index = 0; while (Child > 1 && Parent <= MAXPARENT) { if (Index > iPrimes) return 0; while (Child % Primes[Index] == 0) { Child /= Primes[Index]; Parent += Primes[Index]; } Index++; } if (Parent == child || Parent > MAXPARENT || child == 1) return 0; return Parent; } struct Children *AppendChild(struct Children *node, long long child) { static struct Children *NodeNew; if (NodeNew = (struct Children *) malloc(sizeof(struct Children))) { NodeNew->Child = child; NodeNew->pNext = NULL; if (node != NULL) node->pNext = NodeNew; } return NodeNew; } short GetAncestors(short child) { short Child = child; short Parent = 0; short Index = 0; while (Child > 1) { while (Child % Primes[Index] == 0) { Child /= Primes[Index]; Parent += Primes[Index]; } Index++; } if (Parent == child || child == 1) return 0; Index = GetAncestors(Parent); Ancestors[Index] = Parent; return ++Index; } void PrintDescendants(struct Children *node) { static struct Children *NodeCurr; static struct Children *NodePrev; NodeCurr = node; NodePrev = NULL; while (NodeCurr) { fprintf(FileOut, format, NodeCurr->Child); strcpy_s(format, ", %lld"); NodePrev = NodeCurr; NodeCurr = NodeCurr->pNext; free(NodePrev); } return; } int GetPrimes(int primes[], int maxPrime) { if (maxPrime < 2) return -1; int Index = 0, Value = 1; int Max, i; primes[0] = 2; while ((Value += 2) <= maxPrime) { Max = (int) floor(sqrt((double) Value)); for (i = 0; i <= Index; i++) { if (primes[i] > Max) { if (++Index >= NBRPRIMES) return -1; primes[Index] = Value; break; } if (Value % primes[i] == 0) break; } } return Index; }
#include <algorithm> #include <iostream> #include <vector> typedef unsigned long long integer; std::vector<integer> get_ancestors(const std::vector<integer>& ancestor, integer n) { std::vector<integer> result; for (integer a = ancestor[n]; a != 0 && a != n; ) { n = a; a = ancestor[n]; result.push_back(n); } return result; } void print_vector(const std::vector<integer>& vec) { if (vec.empty()) { std::cout << "none\n"; return; } auto i = vec.begin(); std::cout << *i++; for (; i != vec.end(); ++i) std::cout << ", " << *i; std::cout << '\n'; } bool is_prime(integer n) { if (n < 2) return false; if (n % 2 == 0) return n == 2; for (integer p = 3; p * p <= n; p += 2) { if (n % p == 0) return false; } return true; } int main(int argc, char** argv) { const size_t limit = 100; std::vector<integer> ancestor(limit, 0); std::vector<std::vector<integer>> descendants(limit); for (size_t prime = 0; prime < limit; ++prime) { if (!is_prime(prime)) continue; descendants[prime].push_back(prime); for (size_t i = 0; i + prime < limit; ++i) { integer s = i + prime; for (integer n : descendants[i]) { integer prod = n * prime; descendants[s].push_back(prod); if (prod < limit) ancestor[prod] = s; } } } size_t total_descendants = 0; for (integer i = 1; i < limit; ++i) { std::vector<integer> ancestors(get_ancestors(ancestor, i)); std::cout << "[" << i << "] Level: " << ancestors.size() << '\n'; std::cout << "Ancestors: "; std::sort(ancestors.begin(), ancestors.end()); print_vector(ancestors); std::cout << "Descendants: "; std::vector<integer>& desc = descendants[i]; if (!desc.empty()) { std::sort(desc.begin(), desc.end()); if (desc[0] == i) desc.erase(desc.begin()); } std::cout << desc.size() << '\n'; total_descendants += desc.size(); if (!desc.empty()) print_vector(desc); std::cout << '\n'; } std::cout << "Total descendants: " << total_descendants << '\n'; return 0; }
Convert this C block to C++, preserving its control flow and logic.
#include<string.h> #include<stdlib.h> #include<stdio.h> void cartesianProduct(int** sets, int* setLengths, int* currentSet, int numSets, int times){ int i,j; if(times==numSets){ printf("("); for(i=0;i<times;i++){ printf("%d,",currentSet[i]); } printf("\b),"); } else{ for(j=0;j<setLengths[times];j++){ currentSet[times] = sets[times][j]; cartesianProduct(sets,setLengths,currentSet,numSets,times+1); } } } void printSets(int** sets, int* setLengths, int numSets){ int i,j; printf("\nNumber of sets : %d",numSets); for(i=0;i<numSets+1;i++){ printf("\nSet %d : ",i+1); for(j=0;j<setLengths[i];j++){ printf(" %d ",sets[i][j]); } } } void processInputString(char* str){ int **sets, *currentSet, *setLengths, setLength, numSets = 0, i,j,k,l,start,counter=0; char *token,*holder,*holderToken; for(i=0;str[i]!=00;i++) if(str[i]=='x') numSets++; if(numSets==0){ printf("\n%s",str); return; } currentSet = (int*)calloc(sizeof(int),numSets + 1); setLengths = (int*)calloc(sizeof(int),numSets + 1); sets = (int**)malloc((numSets + 1)*sizeof(int*)); token = strtok(str,"x"); while(token!=NULL){ holder = (char*)malloc(strlen(token)*sizeof(char)); j = 0; for(i=0;token[i]!=00;i++){ if(token[i]>='0' && token[i]<='9') holder[j++] = token[i]; else if(token[i]==',') holder[j++] = ' '; } holder[j] = 00; setLength = 0; for(i=0;holder[i]!=00;i++) if(holder[i]==' ') setLength++; if(setLength==0 && strlen(holder)==0){ printf("\n{}"); return; } setLengths[counter] = setLength+1; sets[counter] = (int*)malloc((1+setLength)*sizeof(int)); k = 0; start = 0; for(l=0;holder[l]!=00;l++){ if(holder[l+1]==' '||holder[l+1]==00){ holderToken = (char*)malloc((l+1-start)*sizeof(char)); strncpy(holderToken,holder + start,l+1-start); sets[counter][k++] = atoi(holderToken); start = l+2; } } counter++; token = strtok(NULL,"x"); } printf("\n{"); cartesianProduct(sets,setLengths,currentSet,numSets + 1,0); printf("\b}"); } int main(int argC,char* argV[]) { if(argC!=2) printf("Usage : %s <Set product expression enclosed in double quotes>",argV[0]); else processInputString(argV[1]); return 0; }
#include <iostream> #include <vector> #include <algorithm> void print(const std::vector<std::vector<int>>& v) { std::cout << "{ "; for (const auto& p : v) { std::cout << "("; for (const auto& e : p) { std::cout << e << " "; } std::cout << ") "; } std::cout << "}" << std::endl; } auto product(const std::vector<std::vector<int>>& lists) { std::vector<std::vector<int>> result; if (std::find_if(std::begin(lists), std::end(lists), [](auto e) -> bool { return e.size() == 0; }) != std::end(lists)) { return result; } for (auto& e : lists[0]) { result.push_back({ e }); } for (size_t i = 1; i < lists.size(); ++i) { std::vector<std::vector<int>> temp; for (auto& e : result) { for (auto f : lists[i]) { auto e_tmp = e; e_tmp.push_back(f); temp.push_back(e_tmp); } } result = temp; } return result; } int main() { std::vector<std::vector<int>> prods[] = { { { 1, 2 }, { 3, 4 } }, { { 3, 4 }, { 1, 2} }, { { 1, 2 }, { } }, { { }, { 1, 2 } }, { { 1776, 1789 }, { 7, 12 }, { 4, 14, 23 }, { 0, 1 } }, { { 1, 2, 3 }, { 30 }, { 500, 100 } }, { { 1, 2, 3 }, { }, { 500, 100 } } }; for (const auto& p : prods) { print(product(p)); } std::cin.ignore(); std::cin.get(); return 0; }
Change the programming language of this snippet from C to C++ without modifying what it does.
#include<string.h> #include<stdlib.h> #include<stdio.h> void cartesianProduct(int** sets, int* setLengths, int* currentSet, int numSets, int times){ int i,j; if(times==numSets){ printf("("); for(i=0;i<times;i++){ printf("%d,",currentSet[i]); } printf("\b),"); } else{ for(j=0;j<setLengths[times];j++){ currentSet[times] = sets[times][j]; cartesianProduct(sets,setLengths,currentSet,numSets,times+1); } } } void printSets(int** sets, int* setLengths, int numSets){ int i,j; printf("\nNumber of sets : %d",numSets); for(i=0;i<numSets+1;i++){ printf("\nSet %d : ",i+1); for(j=0;j<setLengths[i];j++){ printf(" %d ",sets[i][j]); } } } void processInputString(char* str){ int **sets, *currentSet, *setLengths, setLength, numSets = 0, i,j,k,l,start,counter=0; char *token,*holder,*holderToken; for(i=0;str[i]!=00;i++) if(str[i]=='x') numSets++; if(numSets==0){ printf("\n%s",str); return; } currentSet = (int*)calloc(sizeof(int),numSets + 1); setLengths = (int*)calloc(sizeof(int),numSets + 1); sets = (int**)malloc((numSets + 1)*sizeof(int*)); token = strtok(str,"x"); while(token!=NULL){ holder = (char*)malloc(strlen(token)*sizeof(char)); j = 0; for(i=0;token[i]!=00;i++){ if(token[i]>='0' && token[i]<='9') holder[j++] = token[i]; else if(token[i]==',') holder[j++] = ' '; } holder[j] = 00; setLength = 0; for(i=0;holder[i]!=00;i++) if(holder[i]==' ') setLength++; if(setLength==0 && strlen(holder)==0){ printf("\n{}"); return; } setLengths[counter] = setLength+1; sets[counter] = (int*)malloc((1+setLength)*sizeof(int)); k = 0; start = 0; for(l=0;holder[l]!=00;l++){ if(holder[l+1]==' '||holder[l+1]==00){ holderToken = (char*)malloc((l+1-start)*sizeof(char)); strncpy(holderToken,holder + start,l+1-start); sets[counter][k++] = atoi(holderToken); start = l+2; } } counter++; token = strtok(NULL,"x"); } printf("\n{"); cartesianProduct(sets,setLengths,currentSet,numSets + 1,0); printf("\b}"); } int main(int argC,char* argV[]) { if(argC!=2) printf("Usage : %s <Set product expression enclosed in double quotes>",argV[0]); else processInputString(argV[1]); return 0; }
#include <iostream> #include <vector> #include <algorithm> void print(const std::vector<std::vector<int>>& v) { std::cout << "{ "; for (const auto& p : v) { std::cout << "("; for (const auto& e : p) { std::cout << e << " "; } std::cout << ") "; } std::cout << "}" << std::endl; } auto product(const std::vector<std::vector<int>>& lists) { std::vector<std::vector<int>> result; if (std::find_if(std::begin(lists), std::end(lists), [](auto e) -> bool { return e.size() == 0; }) != std::end(lists)) { return result; } for (auto& e : lists[0]) { result.push_back({ e }); } for (size_t i = 1; i < lists.size(); ++i) { std::vector<std::vector<int>> temp; for (auto& e : result) { for (auto f : lists[i]) { auto e_tmp = e; e_tmp.push_back(f); temp.push_back(e_tmp); } } result = temp; } return result; } int main() { std::vector<std::vector<int>> prods[] = { { { 1, 2 }, { 3, 4 } }, { { 3, 4 }, { 1, 2} }, { { 1, 2 }, { } }, { { }, { 1, 2 } }, { { 1776, 1789 }, { 7, 12 }, { 4, 14, 23 }, { 0, 1 } }, { { 1, 2, 3 }, { 30 }, { 500, 100 } }, { { 1, 2, 3 }, { }, { 500, 100 } } }; for (const auto& p : prods) { print(product(p)); } std::cin.ignore(); std::cin.get(); return 0; }
Can you help me rewrite this code in C++ instead of C, keeping it the same logically?
#include<string.h> #include<stdlib.h> #include<stdio.h> void cartesianProduct(int** sets, int* setLengths, int* currentSet, int numSets, int times){ int i,j; if(times==numSets){ printf("("); for(i=0;i<times;i++){ printf("%d,",currentSet[i]); } printf("\b),"); } else{ for(j=0;j<setLengths[times];j++){ currentSet[times] = sets[times][j]; cartesianProduct(sets,setLengths,currentSet,numSets,times+1); } } } void printSets(int** sets, int* setLengths, int numSets){ int i,j; printf("\nNumber of sets : %d",numSets); for(i=0;i<numSets+1;i++){ printf("\nSet %d : ",i+1); for(j=0;j<setLengths[i];j++){ printf(" %d ",sets[i][j]); } } } void processInputString(char* str){ int **sets, *currentSet, *setLengths, setLength, numSets = 0, i,j,k,l,start,counter=0; char *token,*holder,*holderToken; for(i=0;str[i]!=00;i++) if(str[i]=='x') numSets++; if(numSets==0){ printf("\n%s",str); return; } currentSet = (int*)calloc(sizeof(int),numSets + 1); setLengths = (int*)calloc(sizeof(int),numSets + 1); sets = (int**)malloc((numSets + 1)*sizeof(int*)); token = strtok(str,"x"); while(token!=NULL){ holder = (char*)malloc(strlen(token)*sizeof(char)); j = 0; for(i=0;token[i]!=00;i++){ if(token[i]>='0' && token[i]<='9') holder[j++] = token[i]; else if(token[i]==',') holder[j++] = ' '; } holder[j] = 00; setLength = 0; for(i=0;holder[i]!=00;i++) if(holder[i]==' ') setLength++; if(setLength==0 && strlen(holder)==0){ printf("\n{}"); return; } setLengths[counter] = setLength+1; sets[counter] = (int*)malloc((1+setLength)*sizeof(int)); k = 0; start = 0; for(l=0;holder[l]!=00;l++){ if(holder[l+1]==' '||holder[l+1]==00){ holderToken = (char*)malloc((l+1-start)*sizeof(char)); strncpy(holderToken,holder + start,l+1-start); sets[counter][k++] = atoi(holderToken); start = l+2; } } counter++; token = strtok(NULL,"x"); } printf("\n{"); cartesianProduct(sets,setLengths,currentSet,numSets + 1,0); printf("\b}"); } int main(int argC,char* argV[]) { if(argC!=2) printf("Usage : %s <Set product expression enclosed in double quotes>",argV[0]); else processInputString(argV[1]); return 0; }
#include <iostream> #include <vector> #include <algorithm> void print(const std::vector<std::vector<int>>& v) { std::cout << "{ "; for (const auto& p : v) { std::cout << "("; for (const auto& e : p) { std::cout << e << " "; } std::cout << ") "; } std::cout << "}" << std::endl; } auto product(const std::vector<std::vector<int>>& lists) { std::vector<std::vector<int>> result; if (std::find_if(std::begin(lists), std::end(lists), [](auto e) -> bool { return e.size() == 0; }) != std::end(lists)) { return result; } for (auto& e : lists[0]) { result.push_back({ e }); } for (size_t i = 1; i < lists.size(); ++i) { std::vector<std::vector<int>> temp; for (auto& e : result) { for (auto f : lists[i]) { auto e_tmp = e; e_tmp.push_back(f); temp.push_back(e_tmp); } } result = temp; } return result; } int main() { std::vector<std::vector<int>> prods[] = { { { 1, 2 }, { 3, 4 } }, { { 3, 4 }, { 1, 2} }, { { 1, 2 }, { } }, { { }, { 1, 2 } }, { { 1776, 1789 }, { 7, 12 }, { 4, 14, 23 }, { 0, 1 } }, { { 1, 2, 3 }, { 30 }, { 500, 100 } }, { { 1, 2, 3 }, { }, { 500, 100 } } }; for (const auto& p : prods) { print(product(p)); } std::cin.ignore(); std::cin.get(); return 0; }
Change the programming language of this snippet from C to C++ without modifying what it does.
#include <stdlib.h> #include <stdio.h> #include <math.h> typedef double (*Class2Func)(double); double functionA( double v) { return v*v*v; } double functionB(double v) { return exp(log(v)/3); } double Function1( Class2Func f2, double val ) { return f2(val); } Class2Func WhichFunc( int idx) { return (idx < 4) ? &functionA : &functionB; } Class2Func funcListA[] = {&functionA, &sin, &cos, &tan }; Class2Func funcListB[] = {&functionB, &asin, &acos, &atan }; double InvokeComposed( Class2Func f1, Class2Func f2, double val ) { return f1(f2(val)); } typedef struct sComposition { Class2Func f1; Class2Func f2; } *Composition; Composition Compose( Class2Func f1, Class2Func f2) { Composition comp = malloc(sizeof(struct sComposition)); comp->f1 = f1; comp->f2 = f2; return comp; } double CallComposed( Composition comp, double val ) { return comp->f1( comp->f2(val) ); } int main(int argc, char *argv[]) { int ix; Composition c; printf("Function1(functionA, 3.0) = %f\n", Function1(WhichFunc(0), 3.0)); for (ix=0; ix<4; ix++) { c = Compose(funcListA[ix], funcListB[ix]); printf("Compostion %d(0.9) = %f\n", ix, CallComposed(c, 0.9)); } return 0; }
#include <functional> #include <algorithm> #include <iostream> #include <vector> #include <cmath> using std::cout; using std::endl; using std::vector; using std::function; using std::transform; using std::back_inserter; typedef function<double(double)> FunType; vector<FunType> A = {sin, cos, tan, [](double x) { return x*x*x; } }; vector<FunType> B = {asin, acos, atan, [](double x) { return exp(log(x)/3); } }; template <typename A, typename B, typename C> function<C(A)> compose(function<C(B)> f, function<B(A)> g) { return [f,g](A x) { return f(g(x)); }; } int main() { vector<FunType> composedFuns; auto exNums = {0.0, 0.2, 0.4, 0.6, 0.8, 1.0}; transform(B.begin(), B.end(), A.begin(), back_inserter(composedFuns), compose<double, double, double>); for (auto num: exNums) for (auto fun: composedFuns) cout << u8"f\u207B\u00B9.f(" << num << ") = " << fun(num) << endl; return 0; }
Write a version of this C function in C++ with identical behavior.
#include <stdio.h> #include <stdbool.h> int proper_divisors(const int n, bool print_flag) { int count = 0; for (int i = 1; i < n; ++i) { if (n % i == 0) { count++; if (print_flag) printf("%d ", i); } } if (print_flag) printf("\n"); return count; } int main(void) { for (int i = 1; i <= 10; ++i) { printf("%d: ", i); proper_divisors(i, true); } int max = 0; int max_i = 1; for (int i = 1; i <= 20000; ++i) { int v = proper_divisors(i, false); if (v >= max) { max = v; max_i = i; } } printf("%d with %d divisors\n", max_i, max); return 0; }
#include <vector> #include <iostream> #include <algorithm> std::vector<int> properDivisors ( int number ) { std::vector<int> divisors ; for ( int i = 1 ; i < number / 2 + 1 ; i++ ) if ( number % i == 0 ) divisors.push_back( i ) ; return divisors ; } int main( ) { std::vector<int> divisors ; unsigned int maxdivisors = 0 ; int corresponding_number = 0 ; for ( int i = 1 ; i < 11 ; i++ ) { divisors = properDivisors ( i ) ; std::cout << "Proper divisors of " << i << ":\n" ; for ( int number : divisors ) { std::cout << number << " " ; } std::cout << std::endl ; divisors.clear( ) ; } for ( int i = 11 ; i < 20001 ; i++ ) { divisors = properDivisors ( i ) ; if ( divisors.size( ) > maxdivisors ) { maxdivisors = divisors.size( ) ; corresponding_number = i ; } divisors.clear( ) ; } std::cout << "Most divisors has " << corresponding_number << " , it has " << maxdivisors << " divisors!\n" ; return 0 ; }
Write a version of this C function in C++ with identical behavior.
#include <stdio.h> #include <stdlib.h> #include <string.h> #include <libxml/parser.h> #include <libxml/tree.h> const char *names[] = { "April", "Tam O'Shanter", "Emily", NULL }; const char *remarks[] = { "Bubbly: I'm > Tam and <= Emily", "Burns: \"When chapman billies leave the street ...\"", "Short & shrift", NULL }; int main() { xmlDoc *doc = NULL; xmlNode *root = NULL, *node; const char **next; int a; doc = xmlNewDoc("1.0"); root = xmlNewNode(NULL, "CharacterRemarks"); xmlDocSetRootElement(doc, root); for(next = names, a = 0; *next != NULL; next++, a++) { node = xmlNewNode(NULL, "Character"); (void)xmlNewProp(node, "name", *next); xmlAddChild(node, xmlNewText(remarks[a])); xmlAddChild(root, node); } xmlElemDump(stdout, doc, root); xmlFreeDoc(doc); xmlCleanupParser(); return EXIT_SUCCESS; }
#include <vector> #include <utility> #include <iostream> #include <boost/algorithm/string.hpp> std::string create_xml( std::vector<std::string> & ,std::vector<std::string> & ) ; int main( ) { std::vector<std::string> names , remarks ; names.push_back( "April" ) ; names.push_back( "Tam O'Shantor" ) ; names.push_back ( "Emily" ) ; remarks.push_back( "Bubbly, I'm > Tam and <= Emily" ) ; remarks.push_back( "Burns: \"When chapman billies leave the street ...\"" ) ; remarks.push_back( "Short & shrift" ) ; std::cout << "This is in XML:\n" ; std::cout << create_xml( names , remarks ) << std::endl ; return 0 ; } std::string create_xml( std::vector<std::string> & names , std::vector<std::string> & remarks ) { std::vector<std::pair<std::string , std::string> > entities ; entities.push_back( std::make_pair( "&" , "&amp;" ) ) ; entities.push_back( std::make_pair( "<" , "&lt;" ) ) ; entities.push_back( std::make_pair( ">" , "&gt;" ) ) ; std::string xmlstring ( "<CharacterRemarks>\n" ) ; std::vector<std::string>::iterator vsi = names.begin( ) ; typedef std::vector<std::pair<std::string , std::string> >::iterator Vpss ; for ( ; vsi != names.end( ) ; vsi++ ) { for ( Vpss vs = entities.begin( ) ; vs != entities.end( ) ; vs++ ) { boost::replace_all ( *vsi , vs->first , vs->second ) ; } } for ( vsi = remarks.begin( ) ; vsi != remarks.end( ) ; vsi++ ) { for ( Vpss vs = entities.begin( ) ; vs != entities.end( ) ; vs++ ) { boost::replace_all ( *vsi , vs->first , vs->second ) ; } } for ( int i = 0 ; i < names.size( ) ; i++ ) { xmlstring.append( "\t<Character name=\"").append( names[ i ] ).append( "\">") .append( remarks[ i ] ).append( "</Character>\n" ) ; } xmlstring.append( "</CharacterRemarks>" ) ; return xmlstring ; }
Port the provided C code into C++ while preserving the original functionality.
#include <stdio.h> #include <stdlib.h> #include <math.h> #include <plot.h> #define NP 10 double x[NP] = {0, 1, 2, 3, 4, 5, 6, 7, 8, 9}; double y[NP] = {2.7, 2.8, 31.4, 38.1, 58.0, 76.2, 100.5, 130.0, 149.3, 180.0}; void minmax(double *x, double *y, double *minx, double *maxx, double *miny, double *maxy, int n) { int i; *minx = *maxx = x[0]; *miny = *maxy = y[0]; for(i=1; i < n; i++) { if ( x[i] < *minx ) *minx = x[i]; if ( x[i] > *maxx ) *maxx = x[i]; if ( y[i] < *miny ) *miny = y[i]; if ( y[i] > *maxy ) *maxy = y[i]; } } #define YLAB_HEIGHT_F 0.1 #define XLAB_WIDTH_F 0.2 #define XDIV (NP*1.0) #define YDIV (NP*1.0) #define EXTRA_W 0.01 #define EXTRA_H 0.01 #define DOTSCALE (1.0/150.0) #define MAXLABLEN 32 #define PUSHSCALE(X,Y) pl_fscale((X),(Y)) #define POPSCALE(X,Y) pl_fscale(1.0/(X), 1.0/(Y)) #define FMOVESCALE(X,Y) pl_fmove((X)/sx, (Y)/sy) int main() { int plotter, i; double minx, miny, maxx, maxy; double lx, ly; double xticstep, yticstep, nx, ny; double sx, sy; char labs[MAXLABLEN+1]; plotter = pl_newpl("png", NULL, stdout, NULL); if ( plotter < 0 ) exit(1); pl_selectpl(plotter); if ( pl_openpl() < 0 ) exit(1); minmax(x, y, &minx, &maxx, &miny, &maxy, NP); lx = maxx - minx; ly = maxy - miny; pl_fspace(floor(minx) - XLAB_WIDTH_F * lx, floor(miny) - YLAB_HEIGHT_F * ly, ceil(maxx) + EXTRA_W * lx, ceil(maxy) + EXTRA_H * ly); xticstep = (ceil(maxx) - floor(minx)) / XDIV; yticstep = (ceil(maxy) - floor(miny)) / YDIV; pl_flinewidth(0.25); if ( lx < ly ) { sx = lx/ly; sy = 1.0; } else { sx = 1.0; sy = ly/lx; } pl_erase(); pl_fbox(floor(minx), floor(miny), ceil(maxx), ceil(maxy)); pl_fontname("HersheySerif"); for(ny=floor(miny); ny < ceil(maxy); ny += yticstep) { pl_fline(floor(minx), ny, ceil(maxx), ny); snprintf(labs, MAXLABLEN, "%6.2lf", ny); FMOVESCALE(floor(minx) - XLAB_WIDTH_F * lx, ny); PUSHSCALE(sx,sy); pl_label(labs); POPSCALE(sx,sy); } for(nx=floor(minx); nx < ceil(maxx); nx += xticstep) { pl_fline(nx, floor(miny), nx, ceil(maxy)); snprintf(labs, MAXLABLEN, "%6.2lf", nx); FMOVESCALE(nx, floor(miny)); PUSHSCALE(sx,sy); pl_ftextangle(-90); pl_alabel('l', 'b', labs); POPSCALE(sx,sy); } pl_fillcolorname("red"); pl_filltype(1); for(i=0; i < NP; i++) { pl_fbox(x[i] - lx * DOTSCALE, y[i] - ly * DOTSCALE, x[i] + lx * DOTSCALE, y[i] + ly * DOTSCALE); } pl_flushpl(); pl_closepl(); }
#include <windows.h> #include <string> #include <vector> using namespace std; const int HSTEP = 46, MWID = 40, MHEI = 471; const float VSTEP = 2.3f; class vector2 { public: vector2() { x = y = 0; } vector2( float a, float b ) { x = a; y = b; } void set( float a, float b ) { x = a; y = b; } float x, y; }; class myBitmap { public: myBitmap() : pen( NULL ), brush( NULL ), clr( 0 ), wid( 1 ) {} ~myBitmap() { DeleteObject( pen ); DeleteObject( brush ); DeleteDC( hdc ); DeleteObject( bmp ); } bool create( int w, int h ) { BITMAPINFO bi; ZeroMemory( &bi, sizeof( bi ) ); bi.bmiHeader.biSize = sizeof( bi.bmiHeader ); bi.bmiHeader.biBitCount = sizeof( DWORD ) * 8; bi.bmiHeader.biCompression = BI_RGB; bi.bmiHeader.biPlanes = 1; bi.bmiHeader.biWidth = w; bi.bmiHeader.biHeight = -h; HDC dc = GetDC( GetConsoleWindow() ); bmp = CreateDIBSection( dc, &bi, DIB_RGB_COLORS, &pBits, NULL, 0 ); if( !bmp ) return false; hdc = CreateCompatibleDC( dc ); SelectObject( hdc, bmp ); ReleaseDC( GetConsoleWindow(), dc ); width = w; height = h; return true; } void clear( BYTE clr = 0 ) { memset( pBits, clr, width * height * sizeof( DWORD ) ); } void setBrushColor( DWORD bClr ) { if( brush ) DeleteObject( brush ); brush = CreateSolidBrush( bClr ); SelectObject( hdc, brush ); } void setPenColor( DWORD c ) { clr = c; createPen(); } void setPenWidth( int w ) { wid = w; createPen(); } void saveBitmap( string path ) { BITMAPFILEHEADER fileheader; BITMAPINFO infoheader; BITMAP bitmap; DWORD wb; GetObject( bmp, sizeof( bitmap ), &bitmap ); DWORD* dwpBits = new DWORD[bitmap.bmWidth * bitmap.bmHeight]; ZeroMemory( dwpBits, bitmap.bmWidth * bitmap.bmHeight * sizeof( DWORD ) ); ZeroMemory( &infoheader, sizeof( BITMAPINFO ) ); ZeroMemory( &fileheader, sizeof( BITMAPFILEHEADER ) ); infoheader.bmiHeader.biBitCount = sizeof( DWORD ) * 8; infoheader.bmiHeader.biCompression = BI_RGB; infoheader.bmiHeader.biPlanes = 1; infoheader.bmiHeader.biSize = sizeof( infoheader.bmiHeader ); infoheader.bmiHeader.biHeight = bitmap.bmHeight; infoheader.bmiHeader.biWidth = bitmap.bmWidth; infoheader.bmiHeader.biSizeImage = bitmap.bmWidth * bitmap.bmHeight * sizeof( DWORD ); fileheader.bfType = 0x4D42; fileheader.bfOffBits = sizeof( infoheader.bmiHeader ) + sizeof( BITMAPFILEHEADER ); fileheader.bfSize = fileheader.bfOffBits + infoheader.bmiHeader.biSizeImage; GetDIBits( hdc, bmp, 0, height, ( LPVOID )dwpBits, &infoheader, DIB_RGB_COLORS ); HANDLE file = CreateFile( path.c_str(), GENERIC_WRITE, 0, NULL, CREATE_ALWAYS, FILE_ATTRIBUTE_NORMAL, NULL ); WriteFile( file, &fileheader, sizeof( BITMAPFILEHEADER ), &wb, NULL ); WriteFile( file, &infoheader.bmiHeader, sizeof( infoheader.bmiHeader ), &wb, NULL ); WriteFile( file, dwpBits, bitmap.bmWidth * bitmap.bmHeight * 4, &wb, NULL ); CloseHandle( file ); delete [] dwpBits; } HDC getDC() const { return hdc; } int getWidth() const { return width; } int getHeight() const { return height; } private: void createPen() { if( pen ) DeleteObject( pen ); pen = CreatePen( PS_SOLID, wid, clr ); SelectObject( hdc, pen ); } HBITMAP bmp; HDC hdc; HPEN pen; HBRUSH brush; void *pBits; int width, height, wid; DWORD clr; }; class plot { public: plot() { bmp.create( 512, 512 ); } void draw( vector<vector2>* pairs ) { bmp.clear( 0xff ); drawGraph( pairs ); plotIt( pairs ); HDC dc = GetDC( GetConsoleWindow() ); BitBlt( dc, 0, 30, 512, 512, bmp.getDC(), 0, 0, SRCCOPY ); ReleaseDC( GetConsoleWindow(), dc ); } private: void drawGraph( vector<vector2>* pairs ) { HDC dc = bmp.getDC(); bmp.setPenColor( RGB( 240, 240, 240 ) ); DWORD b = 11, c = 40, x; RECT rc; char txt[8]; for( x = 0; x < pairs->size(); x++ ) { MoveToEx( dc, 40, b, NULL ); LineTo( dc, 500, b ); MoveToEx( dc, c, 11, NULL ); LineTo( dc, c, 471 ); wsprintf( txt, "%d", ( pairs->size() - x ) * 20 ); SetRect( &rc, 0, b - 9, 36, b + 11 ); DrawText( dc, txt, lstrlen( txt ), &rc, DT_RIGHT | DT_VCENTER | DT_SINGLELINE ); wsprintf( txt, "%d", x ); SetRect( &rc, c - 8, 472, c + 8, 492 ); DrawText( dc, txt, lstrlen( txt ), &rc, DT_CENTER | DT_VCENTER | DT_SINGLELINE ); c += 46; b += 46; } SetRect( &rc, 0, b - 9, 36, b + 11 ); DrawText( dc, "0", 1, &rc, DT_RIGHT | DT_VCENTER | DT_SINGLELINE ); bmp.setPenColor( 0 ); bmp.setPenWidth( 3 ); MoveToEx( dc, 40, 11, NULL ); LineTo( dc, 40, 471 ); MoveToEx( dc, 40, 471, NULL ); LineTo( dc, 500, 471 ); } void plotIt( vector<vector2>* pairs ) { HDC dc = bmp.getDC(); HBRUSH br = CreateSolidBrush( 255 ); RECT rc; bmp.setPenColor( 255 ); bmp.setPenWidth( 2 ); vector<vector2>::iterator it = pairs->begin(); int a = MWID + HSTEP * static_cast<int>( ( *it ).x ), b = MHEI - static_cast<int>( VSTEP * ( *it ).y ); MoveToEx( dc, a, b, NULL ); SetRect( &rc, a - 3, b - 3, a + 3, b + 3 ); FillRect( dc, &rc, br ); it++; for( ; it < pairs->end(); it++ ) { a = MWID + HSTEP * static_cast<int>( ( *it ).x ); b = MHEI - static_cast<int>( VSTEP * ( *it ).y ); SetRect( &rc, a - 3, b - 3, a + 3, b + 3 ); FillRect( dc, &rc, br ); LineTo( dc, a, b ); } DeleteObject( br ); } myBitmap bmp; }; int main( int argc, char* argv[] ) { ShowWindow( GetConsoleWindow(), SW_MAXIMIZE ); plot pt; vector<vector2> pairs; pairs.push_back( vector2( 0, 2.7f ) ); pairs.push_back( vector2( 1, 2.8f ) ); pairs.push_back( vector2( 2.0f, 31.4f ) ); pairs.push_back( vector2( 3.0f, 38.1f ) ); pairs.push_back( vector2( 4.0f, 58.0f ) ); pairs.push_back( vector2( 5.0f, 76.2f ) ); pairs.push_back( vector2( 6.0f, 100.5f ) ); pairs.push_back( vector2( 7.0f, 130.0f ) ); pairs.push_back( vector2( 8.0f, 149.3f ) ); pairs.push_back( vector2( 9.0f, 180.0f ) ); pt.draw( &pairs ); system( "pause" ); return 0; }
Please provide an equivalent version of this C code in C++.
#include <stdio.h> #include <stdlib.h> #include <math.h> #include <plot.h> #define NP 10 double x[NP] = {0, 1, 2, 3, 4, 5, 6, 7, 8, 9}; double y[NP] = {2.7, 2.8, 31.4, 38.1, 58.0, 76.2, 100.5, 130.0, 149.3, 180.0}; void minmax(double *x, double *y, double *minx, double *maxx, double *miny, double *maxy, int n) { int i; *minx = *maxx = x[0]; *miny = *maxy = y[0]; for(i=1; i < n; i++) { if ( x[i] < *minx ) *minx = x[i]; if ( x[i] > *maxx ) *maxx = x[i]; if ( y[i] < *miny ) *miny = y[i]; if ( y[i] > *maxy ) *maxy = y[i]; } } #define YLAB_HEIGHT_F 0.1 #define XLAB_WIDTH_F 0.2 #define XDIV (NP*1.0) #define YDIV (NP*1.0) #define EXTRA_W 0.01 #define EXTRA_H 0.01 #define DOTSCALE (1.0/150.0) #define MAXLABLEN 32 #define PUSHSCALE(X,Y) pl_fscale((X),(Y)) #define POPSCALE(X,Y) pl_fscale(1.0/(X), 1.0/(Y)) #define FMOVESCALE(X,Y) pl_fmove((X)/sx, (Y)/sy) int main() { int plotter, i; double minx, miny, maxx, maxy; double lx, ly; double xticstep, yticstep, nx, ny; double sx, sy; char labs[MAXLABLEN+1]; plotter = pl_newpl("png", NULL, stdout, NULL); if ( plotter < 0 ) exit(1); pl_selectpl(plotter); if ( pl_openpl() < 0 ) exit(1); minmax(x, y, &minx, &maxx, &miny, &maxy, NP); lx = maxx - minx; ly = maxy - miny; pl_fspace(floor(minx) - XLAB_WIDTH_F * lx, floor(miny) - YLAB_HEIGHT_F * ly, ceil(maxx) + EXTRA_W * lx, ceil(maxy) + EXTRA_H * ly); xticstep = (ceil(maxx) - floor(minx)) / XDIV; yticstep = (ceil(maxy) - floor(miny)) / YDIV; pl_flinewidth(0.25); if ( lx < ly ) { sx = lx/ly; sy = 1.0; } else { sx = 1.0; sy = ly/lx; } pl_erase(); pl_fbox(floor(minx), floor(miny), ceil(maxx), ceil(maxy)); pl_fontname("HersheySerif"); for(ny=floor(miny); ny < ceil(maxy); ny += yticstep) { pl_fline(floor(minx), ny, ceil(maxx), ny); snprintf(labs, MAXLABLEN, "%6.2lf", ny); FMOVESCALE(floor(minx) - XLAB_WIDTH_F * lx, ny); PUSHSCALE(sx,sy); pl_label(labs); POPSCALE(sx,sy); } for(nx=floor(minx); nx < ceil(maxx); nx += xticstep) { pl_fline(nx, floor(miny), nx, ceil(maxy)); snprintf(labs, MAXLABLEN, "%6.2lf", nx); FMOVESCALE(nx, floor(miny)); PUSHSCALE(sx,sy); pl_ftextangle(-90); pl_alabel('l', 'b', labs); POPSCALE(sx,sy); } pl_fillcolorname("red"); pl_filltype(1); for(i=0; i < NP; i++) { pl_fbox(x[i] - lx * DOTSCALE, y[i] - ly * DOTSCALE, x[i] + lx * DOTSCALE, y[i] + ly * DOTSCALE); } pl_flushpl(); pl_closepl(); }
#include <windows.h> #include <string> #include <vector> using namespace std; const int HSTEP = 46, MWID = 40, MHEI = 471; const float VSTEP = 2.3f; class vector2 { public: vector2() { x = y = 0; } vector2( float a, float b ) { x = a; y = b; } void set( float a, float b ) { x = a; y = b; } float x, y; }; class myBitmap { public: myBitmap() : pen( NULL ), brush( NULL ), clr( 0 ), wid( 1 ) {} ~myBitmap() { DeleteObject( pen ); DeleteObject( brush ); DeleteDC( hdc ); DeleteObject( bmp ); } bool create( int w, int h ) { BITMAPINFO bi; ZeroMemory( &bi, sizeof( bi ) ); bi.bmiHeader.biSize = sizeof( bi.bmiHeader ); bi.bmiHeader.biBitCount = sizeof( DWORD ) * 8; bi.bmiHeader.biCompression = BI_RGB; bi.bmiHeader.biPlanes = 1; bi.bmiHeader.biWidth = w; bi.bmiHeader.biHeight = -h; HDC dc = GetDC( GetConsoleWindow() ); bmp = CreateDIBSection( dc, &bi, DIB_RGB_COLORS, &pBits, NULL, 0 ); if( !bmp ) return false; hdc = CreateCompatibleDC( dc ); SelectObject( hdc, bmp ); ReleaseDC( GetConsoleWindow(), dc ); width = w; height = h; return true; } void clear( BYTE clr = 0 ) { memset( pBits, clr, width * height * sizeof( DWORD ) ); } void setBrushColor( DWORD bClr ) { if( brush ) DeleteObject( brush ); brush = CreateSolidBrush( bClr ); SelectObject( hdc, brush ); } void setPenColor( DWORD c ) { clr = c; createPen(); } void setPenWidth( int w ) { wid = w; createPen(); } void saveBitmap( string path ) { BITMAPFILEHEADER fileheader; BITMAPINFO infoheader; BITMAP bitmap; DWORD wb; GetObject( bmp, sizeof( bitmap ), &bitmap ); DWORD* dwpBits = new DWORD[bitmap.bmWidth * bitmap.bmHeight]; ZeroMemory( dwpBits, bitmap.bmWidth * bitmap.bmHeight * sizeof( DWORD ) ); ZeroMemory( &infoheader, sizeof( BITMAPINFO ) ); ZeroMemory( &fileheader, sizeof( BITMAPFILEHEADER ) ); infoheader.bmiHeader.biBitCount = sizeof( DWORD ) * 8; infoheader.bmiHeader.biCompression = BI_RGB; infoheader.bmiHeader.biPlanes = 1; infoheader.bmiHeader.biSize = sizeof( infoheader.bmiHeader ); infoheader.bmiHeader.biHeight = bitmap.bmHeight; infoheader.bmiHeader.biWidth = bitmap.bmWidth; infoheader.bmiHeader.biSizeImage = bitmap.bmWidth * bitmap.bmHeight * sizeof( DWORD ); fileheader.bfType = 0x4D42; fileheader.bfOffBits = sizeof( infoheader.bmiHeader ) + sizeof( BITMAPFILEHEADER ); fileheader.bfSize = fileheader.bfOffBits + infoheader.bmiHeader.biSizeImage; GetDIBits( hdc, bmp, 0, height, ( LPVOID )dwpBits, &infoheader, DIB_RGB_COLORS ); HANDLE file = CreateFile( path.c_str(), GENERIC_WRITE, 0, NULL, CREATE_ALWAYS, FILE_ATTRIBUTE_NORMAL, NULL ); WriteFile( file, &fileheader, sizeof( BITMAPFILEHEADER ), &wb, NULL ); WriteFile( file, &infoheader.bmiHeader, sizeof( infoheader.bmiHeader ), &wb, NULL ); WriteFile( file, dwpBits, bitmap.bmWidth * bitmap.bmHeight * 4, &wb, NULL ); CloseHandle( file ); delete [] dwpBits; } HDC getDC() const { return hdc; } int getWidth() const { return width; } int getHeight() const { return height; } private: void createPen() { if( pen ) DeleteObject( pen ); pen = CreatePen( PS_SOLID, wid, clr ); SelectObject( hdc, pen ); } HBITMAP bmp; HDC hdc; HPEN pen; HBRUSH brush; void *pBits; int width, height, wid; DWORD clr; }; class plot { public: plot() { bmp.create( 512, 512 ); } void draw( vector<vector2>* pairs ) { bmp.clear( 0xff ); drawGraph( pairs ); plotIt( pairs ); HDC dc = GetDC( GetConsoleWindow() ); BitBlt( dc, 0, 30, 512, 512, bmp.getDC(), 0, 0, SRCCOPY ); ReleaseDC( GetConsoleWindow(), dc ); } private: void drawGraph( vector<vector2>* pairs ) { HDC dc = bmp.getDC(); bmp.setPenColor( RGB( 240, 240, 240 ) ); DWORD b = 11, c = 40, x; RECT rc; char txt[8]; for( x = 0; x < pairs->size(); x++ ) { MoveToEx( dc, 40, b, NULL ); LineTo( dc, 500, b ); MoveToEx( dc, c, 11, NULL ); LineTo( dc, c, 471 ); wsprintf( txt, "%d", ( pairs->size() - x ) * 20 ); SetRect( &rc, 0, b - 9, 36, b + 11 ); DrawText( dc, txt, lstrlen( txt ), &rc, DT_RIGHT | DT_VCENTER | DT_SINGLELINE ); wsprintf( txt, "%d", x ); SetRect( &rc, c - 8, 472, c + 8, 492 ); DrawText( dc, txt, lstrlen( txt ), &rc, DT_CENTER | DT_VCENTER | DT_SINGLELINE ); c += 46; b += 46; } SetRect( &rc, 0, b - 9, 36, b + 11 ); DrawText( dc, "0", 1, &rc, DT_RIGHT | DT_VCENTER | DT_SINGLELINE ); bmp.setPenColor( 0 ); bmp.setPenWidth( 3 ); MoveToEx( dc, 40, 11, NULL ); LineTo( dc, 40, 471 ); MoveToEx( dc, 40, 471, NULL ); LineTo( dc, 500, 471 ); } void plotIt( vector<vector2>* pairs ) { HDC dc = bmp.getDC(); HBRUSH br = CreateSolidBrush( 255 ); RECT rc; bmp.setPenColor( 255 ); bmp.setPenWidth( 2 ); vector<vector2>::iterator it = pairs->begin(); int a = MWID + HSTEP * static_cast<int>( ( *it ).x ), b = MHEI - static_cast<int>( VSTEP * ( *it ).y ); MoveToEx( dc, a, b, NULL ); SetRect( &rc, a - 3, b - 3, a + 3, b + 3 ); FillRect( dc, &rc, br ); it++; for( ; it < pairs->end(); it++ ) { a = MWID + HSTEP * static_cast<int>( ( *it ).x ); b = MHEI - static_cast<int>( VSTEP * ( *it ).y ); SetRect( &rc, a - 3, b - 3, a + 3, b + 3 ); FillRect( dc, &rc, br ); LineTo( dc, a, b ); } DeleteObject( br ); } myBitmap bmp; }; int main( int argc, char* argv[] ) { ShowWindow( GetConsoleWindow(), SW_MAXIMIZE ); plot pt; vector<vector2> pairs; pairs.push_back( vector2( 0, 2.7f ) ); pairs.push_back( vector2( 1, 2.8f ) ); pairs.push_back( vector2( 2.0f, 31.4f ) ); pairs.push_back( vector2( 3.0f, 38.1f ) ); pairs.push_back( vector2( 4.0f, 58.0f ) ); pairs.push_back( vector2( 5.0f, 76.2f ) ); pairs.push_back( vector2( 6.0f, 100.5f ) ); pairs.push_back( vector2( 7.0f, 130.0f ) ); pairs.push_back( vector2( 8.0f, 149.3f ) ); pairs.push_back( vector2( 9.0f, 180.0f ) ); pt.draw( &pairs ); system( "pause" ); return 0; }
Write the same code in C++ as shown below in C.
#include <stdio.h> #include <stdlib.h> #include <math.h> #include <plot.h> #define NP 10 double x[NP] = {0, 1, 2, 3, 4, 5, 6, 7, 8, 9}; double y[NP] = {2.7, 2.8, 31.4, 38.1, 58.0, 76.2, 100.5, 130.0, 149.3, 180.0}; void minmax(double *x, double *y, double *minx, double *maxx, double *miny, double *maxy, int n) { int i; *minx = *maxx = x[0]; *miny = *maxy = y[0]; for(i=1; i < n; i++) { if ( x[i] < *minx ) *minx = x[i]; if ( x[i] > *maxx ) *maxx = x[i]; if ( y[i] < *miny ) *miny = y[i]; if ( y[i] > *maxy ) *maxy = y[i]; } } #define YLAB_HEIGHT_F 0.1 #define XLAB_WIDTH_F 0.2 #define XDIV (NP*1.0) #define YDIV (NP*1.0) #define EXTRA_W 0.01 #define EXTRA_H 0.01 #define DOTSCALE (1.0/150.0) #define MAXLABLEN 32 #define PUSHSCALE(X,Y) pl_fscale((X),(Y)) #define POPSCALE(X,Y) pl_fscale(1.0/(X), 1.0/(Y)) #define FMOVESCALE(X,Y) pl_fmove((X)/sx, (Y)/sy) int main() { int plotter, i; double minx, miny, maxx, maxy; double lx, ly; double xticstep, yticstep, nx, ny; double sx, sy; char labs[MAXLABLEN+1]; plotter = pl_newpl("png", NULL, stdout, NULL); if ( plotter < 0 ) exit(1); pl_selectpl(plotter); if ( pl_openpl() < 0 ) exit(1); minmax(x, y, &minx, &maxx, &miny, &maxy, NP); lx = maxx - minx; ly = maxy - miny; pl_fspace(floor(minx) - XLAB_WIDTH_F * lx, floor(miny) - YLAB_HEIGHT_F * ly, ceil(maxx) + EXTRA_W * lx, ceil(maxy) + EXTRA_H * ly); xticstep = (ceil(maxx) - floor(minx)) / XDIV; yticstep = (ceil(maxy) - floor(miny)) / YDIV; pl_flinewidth(0.25); if ( lx < ly ) { sx = lx/ly; sy = 1.0; } else { sx = 1.0; sy = ly/lx; } pl_erase(); pl_fbox(floor(minx), floor(miny), ceil(maxx), ceil(maxy)); pl_fontname("HersheySerif"); for(ny=floor(miny); ny < ceil(maxy); ny += yticstep) { pl_fline(floor(minx), ny, ceil(maxx), ny); snprintf(labs, MAXLABLEN, "%6.2lf", ny); FMOVESCALE(floor(minx) - XLAB_WIDTH_F * lx, ny); PUSHSCALE(sx,sy); pl_label(labs); POPSCALE(sx,sy); } for(nx=floor(minx); nx < ceil(maxx); nx += xticstep) { pl_fline(nx, floor(miny), nx, ceil(maxy)); snprintf(labs, MAXLABLEN, "%6.2lf", nx); FMOVESCALE(nx, floor(miny)); PUSHSCALE(sx,sy); pl_ftextangle(-90); pl_alabel('l', 'b', labs); POPSCALE(sx,sy); } pl_fillcolorname("red"); pl_filltype(1); for(i=0; i < NP; i++) { pl_fbox(x[i] - lx * DOTSCALE, y[i] - ly * DOTSCALE, x[i] + lx * DOTSCALE, y[i] + ly * DOTSCALE); } pl_flushpl(); pl_closepl(); }
#include <windows.h> #include <string> #include <vector> using namespace std; const int HSTEP = 46, MWID = 40, MHEI = 471; const float VSTEP = 2.3f; class vector2 { public: vector2() { x = y = 0; } vector2( float a, float b ) { x = a; y = b; } void set( float a, float b ) { x = a; y = b; } float x, y; }; class myBitmap { public: myBitmap() : pen( NULL ), brush( NULL ), clr( 0 ), wid( 1 ) {} ~myBitmap() { DeleteObject( pen ); DeleteObject( brush ); DeleteDC( hdc ); DeleteObject( bmp ); } bool create( int w, int h ) { BITMAPINFO bi; ZeroMemory( &bi, sizeof( bi ) ); bi.bmiHeader.biSize = sizeof( bi.bmiHeader ); bi.bmiHeader.biBitCount = sizeof( DWORD ) * 8; bi.bmiHeader.biCompression = BI_RGB; bi.bmiHeader.biPlanes = 1; bi.bmiHeader.biWidth = w; bi.bmiHeader.biHeight = -h; HDC dc = GetDC( GetConsoleWindow() ); bmp = CreateDIBSection( dc, &bi, DIB_RGB_COLORS, &pBits, NULL, 0 ); if( !bmp ) return false; hdc = CreateCompatibleDC( dc ); SelectObject( hdc, bmp ); ReleaseDC( GetConsoleWindow(), dc ); width = w; height = h; return true; } void clear( BYTE clr = 0 ) { memset( pBits, clr, width * height * sizeof( DWORD ) ); } void setBrushColor( DWORD bClr ) { if( brush ) DeleteObject( brush ); brush = CreateSolidBrush( bClr ); SelectObject( hdc, brush ); } void setPenColor( DWORD c ) { clr = c; createPen(); } void setPenWidth( int w ) { wid = w; createPen(); } void saveBitmap( string path ) { BITMAPFILEHEADER fileheader; BITMAPINFO infoheader; BITMAP bitmap; DWORD wb; GetObject( bmp, sizeof( bitmap ), &bitmap ); DWORD* dwpBits = new DWORD[bitmap.bmWidth * bitmap.bmHeight]; ZeroMemory( dwpBits, bitmap.bmWidth * bitmap.bmHeight * sizeof( DWORD ) ); ZeroMemory( &infoheader, sizeof( BITMAPINFO ) ); ZeroMemory( &fileheader, sizeof( BITMAPFILEHEADER ) ); infoheader.bmiHeader.biBitCount = sizeof( DWORD ) * 8; infoheader.bmiHeader.biCompression = BI_RGB; infoheader.bmiHeader.biPlanes = 1; infoheader.bmiHeader.biSize = sizeof( infoheader.bmiHeader ); infoheader.bmiHeader.biHeight = bitmap.bmHeight; infoheader.bmiHeader.biWidth = bitmap.bmWidth; infoheader.bmiHeader.biSizeImage = bitmap.bmWidth * bitmap.bmHeight * sizeof( DWORD ); fileheader.bfType = 0x4D42; fileheader.bfOffBits = sizeof( infoheader.bmiHeader ) + sizeof( BITMAPFILEHEADER ); fileheader.bfSize = fileheader.bfOffBits + infoheader.bmiHeader.biSizeImage; GetDIBits( hdc, bmp, 0, height, ( LPVOID )dwpBits, &infoheader, DIB_RGB_COLORS ); HANDLE file = CreateFile( path.c_str(), GENERIC_WRITE, 0, NULL, CREATE_ALWAYS, FILE_ATTRIBUTE_NORMAL, NULL ); WriteFile( file, &fileheader, sizeof( BITMAPFILEHEADER ), &wb, NULL ); WriteFile( file, &infoheader.bmiHeader, sizeof( infoheader.bmiHeader ), &wb, NULL ); WriteFile( file, dwpBits, bitmap.bmWidth * bitmap.bmHeight * 4, &wb, NULL ); CloseHandle( file ); delete [] dwpBits; } HDC getDC() const { return hdc; } int getWidth() const { return width; } int getHeight() const { return height; } private: void createPen() { if( pen ) DeleteObject( pen ); pen = CreatePen( PS_SOLID, wid, clr ); SelectObject( hdc, pen ); } HBITMAP bmp; HDC hdc; HPEN pen; HBRUSH brush; void *pBits; int width, height, wid; DWORD clr; }; class plot { public: plot() { bmp.create( 512, 512 ); } void draw( vector<vector2>* pairs ) { bmp.clear( 0xff ); drawGraph( pairs ); plotIt( pairs ); HDC dc = GetDC( GetConsoleWindow() ); BitBlt( dc, 0, 30, 512, 512, bmp.getDC(), 0, 0, SRCCOPY ); ReleaseDC( GetConsoleWindow(), dc ); } private: void drawGraph( vector<vector2>* pairs ) { HDC dc = bmp.getDC(); bmp.setPenColor( RGB( 240, 240, 240 ) ); DWORD b = 11, c = 40, x; RECT rc; char txt[8]; for( x = 0; x < pairs->size(); x++ ) { MoveToEx( dc, 40, b, NULL ); LineTo( dc, 500, b ); MoveToEx( dc, c, 11, NULL ); LineTo( dc, c, 471 ); wsprintf( txt, "%d", ( pairs->size() - x ) * 20 ); SetRect( &rc, 0, b - 9, 36, b + 11 ); DrawText( dc, txt, lstrlen( txt ), &rc, DT_RIGHT | DT_VCENTER | DT_SINGLELINE ); wsprintf( txt, "%d", x ); SetRect( &rc, c - 8, 472, c + 8, 492 ); DrawText( dc, txt, lstrlen( txt ), &rc, DT_CENTER | DT_VCENTER | DT_SINGLELINE ); c += 46; b += 46; } SetRect( &rc, 0, b - 9, 36, b + 11 ); DrawText( dc, "0", 1, &rc, DT_RIGHT | DT_VCENTER | DT_SINGLELINE ); bmp.setPenColor( 0 ); bmp.setPenWidth( 3 ); MoveToEx( dc, 40, 11, NULL ); LineTo( dc, 40, 471 ); MoveToEx( dc, 40, 471, NULL ); LineTo( dc, 500, 471 ); } void plotIt( vector<vector2>* pairs ) { HDC dc = bmp.getDC(); HBRUSH br = CreateSolidBrush( 255 ); RECT rc; bmp.setPenColor( 255 ); bmp.setPenWidth( 2 ); vector<vector2>::iterator it = pairs->begin(); int a = MWID + HSTEP * static_cast<int>( ( *it ).x ), b = MHEI - static_cast<int>( VSTEP * ( *it ).y ); MoveToEx( dc, a, b, NULL ); SetRect( &rc, a - 3, b - 3, a + 3, b + 3 ); FillRect( dc, &rc, br ); it++; for( ; it < pairs->end(); it++ ) { a = MWID + HSTEP * static_cast<int>( ( *it ).x ); b = MHEI - static_cast<int>( VSTEP * ( *it ).y ); SetRect( &rc, a - 3, b - 3, a + 3, b + 3 ); FillRect( dc, &rc, br ); LineTo( dc, a, b ); } DeleteObject( br ); } myBitmap bmp; }; int main( int argc, char* argv[] ) { ShowWindow( GetConsoleWindow(), SW_MAXIMIZE ); plot pt; vector<vector2> pairs; pairs.push_back( vector2( 0, 2.7f ) ); pairs.push_back( vector2( 1, 2.8f ) ); pairs.push_back( vector2( 2.0f, 31.4f ) ); pairs.push_back( vector2( 3.0f, 38.1f ) ); pairs.push_back( vector2( 4.0f, 58.0f ) ); pairs.push_back( vector2( 5.0f, 76.2f ) ); pairs.push_back( vector2( 6.0f, 100.5f ) ); pairs.push_back( vector2( 7.0f, 130.0f ) ); pairs.push_back( vector2( 8.0f, 149.3f ) ); pairs.push_back( vector2( 9.0f, 180.0f ) ); pt.draw( &pairs ); system( "pause" ); return 0; }
Translate this program into C++ but keep the logic exactly as in C.
#include <stdio.h> #include <stdlib.h> #include <sys/types.h> #include <regex.h> #include <string.h> int main() { regex_t preg; regmatch_t substmatch[1]; const char *tp = "string$"; const char *t1 = "this is a matching string"; const char *t2 = "this is not a matching string!"; const char *ss = "istyfied"; regcomp(&preg, "string$", REG_EXTENDED); printf("'%s' %smatched with '%s'\n", t1, (regexec(&preg, t1, 0, NULL, 0)==0) ? "" : "did not ", tp); printf("'%s' %smatched with '%s'\n", t2, (regexec(&preg, t2, 0, NULL, 0)==0) ? "" : "did not ", tp); regfree(&preg); regcomp(&preg, "a[a-z]+", REG_EXTENDED); if ( regexec(&preg, t1, 1, substmatch, 0) == 0 ) { char *ns = malloc(substmatch[0].rm_so + 1 + strlen(ss) + (strlen(t1) - substmatch[0].rm_eo) + 2); memcpy(ns, t1, substmatch[0].rm_so+1); memcpy(&ns[substmatch[0].rm_so], ss, strlen(ss)); memcpy(&ns[substmatch[0].rm_so+strlen(ss)], &t1[substmatch[0].rm_eo], strlen(&t1[substmatch[0].rm_eo])); ns[ substmatch[0].rm_so + strlen(ss) + strlen(&t1[substmatch[0].rm_eo]) ] = 0; printf("mod string: '%s'\n", ns); free(ns); } else { printf("the string '%s' is the same: no matching!\n", t1); } regfree(&preg); return 0; }
#include <iostream> #include <string> #include <iterator> #include <regex> int main() { std::regex re(".* string$"); std::string s = "Hi, I am a string"; if (std::regex_match(s, re)) std::cout << "The string matches.\n"; else std::cout << "Oops - not found?\n"; std::regex re2(" a.*a"); std::smatch match; if (std::regex_search(s, match, re2)) { std::cout << "Matched " << match.length() << " characters starting at " << match.position() << ".\n"; std::cout << "Matched character sequence: \"" << match.str() << "\"\n"; } else { std::cout << "Oops - not found?\n"; } std::string dest_string; std::regex_replace(std::back_inserter(dest_string), s.begin(), s.end(), re2, "'m now a changed"); std::cout << dest_string << std::endl; }
Maintain the same structure and functionality when rewriting this code in C++.
#include <stdio.h> int main(){ int bounds[ 2 ] = {1, 100}; char input[ 2 ] = " "; int choice = (bounds[ 0 ] + bounds[ 1 ]) / 2; printf( "Choose a number between %d and %d.\n", bounds[ 0 ], bounds[ 1 ] ); do{ switch( input[ 0 ] ){ case 'H': bounds[ 1 ] = choice; break; case 'L': bounds[ 0 ] = choice; break; case 'Y': printf( "\nAwwwright\n" ); return 0; } choice = (bounds[ 0 ] + bounds[ 1 ]) / 2; printf( "Is the number %d? (Y/H/L) ", choice ); }while( scanf( "%1s", input ) == 1 ); return 0; }
#include <iostream> #include <algorithm> #include <string> #include <iterator> struct GuessNumberIterator : std::iterator<std::random_access_iterator_tag, int> { int i; GuessNumberIterator() { } GuessNumberIterator(int _i) : i(_i) { } GuessNumberIterator& operator++() { ++i; return *this; } GuessNumberIterator operator++(int) { GuessNumberIterator tmp = *this; ++(*this); return tmp; } bool operator==(const GuessNumberIterator& y) { return i == y.i; } bool operator!=(const GuessNumberIterator& y) { return i != y.i; } int operator*() { std::cout << "Is your number less than or equal to " << i << "? "; std::string s; std::cin >> s; return (s != "" && (s[0] == 'y' || s[0] == 'Y')) ? 0 : -1; } GuessNumberIterator& operator--() { --i; return *this; } GuessNumberIterator operator--(int) { GuessNumberIterator tmp = *this; --(*this); return tmp; } GuessNumberIterator& operator+=(int n) { i += n; return *this; } GuessNumberIterator& operator-=(int n) { i -= n; return *this; } GuessNumberIterator operator+(int n) { GuessNumberIterator tmp = *this; return tmp += n; } GuessNumberIterator operator-(int n) { GuessNumberIterator tmp = *this; return tmp -= n; } int operator-(const GuessNumberIterator &y) { return i - y.i; } int operator[](int n) { return *(*this + n); } bool operator<(const GuessNumberIterator &y) { return i < y.i; } bool operator>(const GuessNumberIterator &y) { return i > y.i; } bool operator<=(const GuessNumberIterator &y) { return i <= y.i; } bool operator>=(const GuessNumberIterator &y) { return i >= y.i; } }; inline GuessNumberIterator operator+(int n, GuessNumberIterator &i) { return i + n; } const int lower = 0; const int upper = 100; int main() { std::cout << "Instructions:\n" << "Think of integer number from " << lower << " (inclusive) to " << upper << " (exclusive) and\n" << "I will guess it. After each guess, I will ask you if it is less than\n" << "or equal to some number, and you will respond with \"yes\" or \"no\".\n"; int answer = std::lower_bound(GuessNumberIterator(lower), GuessNumberIterator(upper), 0).i; std::cout << "Your number is " << answer << ".\n"; return 0; }
Preserve the algorithm and functionality while converting the code from C to C++.
#include <stdio.h> #include <stdlib.h> #include <string.h> #define KeyType const char * #define ValType int #define HASH_SIZE 4096 unsigned strhashkey( const char * key, int max) { unsigned h=0; unsigned hl, hr; while(*key) { h += *key; hl= 0x5C5 ^ (h&0xfff00000 )>>18; hr =(h&0x000fffff ); h = hl ^ hr ^ *key++; } return h % max; } typedef struct sHme { KeyType key; ValType value; struct sHme *link; } *MapEntry; typedef struct he { MapEntry first, last; } HashElement; HashElement hash[HASH_SIZE]; typedef void (*KeyCopyF)(KeyType *kdest, KeyType ksrc); typedef void (*ValCopyF)(ValType *vdest, ValType vsrc); typedef unsigned (*KeyHashF)( KeyType key, int upperBound ); typedef int (*KeyCmprF)(KeyType key1, KeyType key2); void HashAddH( KeyType key, ValType value, KeyCopyF copyKey, ValCopyF copyVal, KeyHashF hashKey, KeyCmprF keySame ) { unsigned hix = (*hashKey)(key, HASH_SIZE); MapEntry m_ent; for (m_ent= hash[hix].first; m_ent && !(*keySame)(m_ent->key,key); m_ent=m_ent->link); if (m_ent) { (*copyVal)(&m_ent->value, value); } else { MapEntry last; MapEntry hme = malloc(sizeof(struct sHme)); (*copyKey)(&hme->key, key); (*copyVal)(&hme->value, value); hme->link = NULL; last = hash[hix].last; if (last) { last->link = hme; } else hash[hix].first = hme; hash[hix].last = hme; } } int HashGetH(ValType *val, KeyType key, KeyHashF hashKey, KeyCmprF keySame ) { unsigned hix = (*hashKey)(key, HASH_SIZE); MapEntry m_ent; for (m_ent= hash[hix].first; m_ent && !(*keySame)(m_ent->key,key); m_ent=m_ent->link); if (m_ent) { *val = m_ent->value; } return (m_ent != NULL); } void copyStr(const char**dest, const char *src) { *dest = strdup(src); } void copyInt( int *dest, int src) { *dest = src; } int strCompare( const char *key1, const char *key2) { return strcmp(key1, key2) == 0; } void HashAdd( KeyType key, ValType value ) { HashAddH( key, value, &copyStr, &copyInt, &strhashkey, &strCompare); } int HashGet(ValType *val, KeyType key) { return HashGetH( val, key, &strhashkey, &strCompare); } int main() { static const char * keyList[] = {"red","orange","yellow","green", "blue", "violet" }; static int valuList[] = {1,43,640, 747, 42, 42}; int ix; for (ix=0; ix<6; ix++) { HashAdd(keyList[ix], valuList[ix]); } return 0; }
#include <unordered_map> #include <string> int main() { std::string keys[] = { "1", "2", "3" }; std::string vals[] = { "a", "b", "c" }; std::unordered_map<std::string, std::string> hash; for( int i = 0 ; i < 3 ; i++ ) hash[ keys[i] ] = vals[i] ; }
Convert this C block to C++, preserving its control flow and logic.
#include <stdio.h> #include <stdlib.h> size_t upper_bound(const int* array, size_t n, int value) { size_t start = 0; while (n > 0) { size_t step = n / 2; size_t index = start + step; if (value >= array[index]) { start = index + 1; n -= step + 1; } else { n = step; } } return start; } int* bins(const int* limits, size_t nlimits, const int* data, size_t ndata) { int* result = calloc(nlimits + 1, sizeof(int)); if (result == NULL) return NULL; for (size_t i = 0; i < ndata; ++i) ++result[upper_bound(limits, nlimits, data[i])]; return result; } void print_bins(const int* limits, size_t n, const int* bins) { if (n == 0) return; printf(" < %3d: %2d\n", limits[0], bins[0]); for (size_t i = 1; i < n; ++i) printf(">= %3d and < %3d: %2d\n", limits[i - 1], limits[i], bins[i]); printf(">= %3d  : %2d\n", limits[n - 1], bins[n]); } int main() { const int limits1[] = {23, 37, 43, 53, 67, 83}; const int data1[] = {95, 21, 94, 12, 99, 4, 70, 75, 83, 93, 52, 80, 57, 5, 53, 86, 65, 17, 92, 83, 71, 61, 54, 58, 47, 16, 8, 9, 32, 84, 7, 87, 46, 19, 30, 37, 96, 6, 98, 40, 79, 97, 45, 64, 60, 29, 49, 36, 43, 55}; printf("Example 1:\n"); size_t n = sizeof(limits1) / sizeof(int); int* b = bins(limits1, n, data1, sizeof(data1) / sizeof(int)); if (b == NULL) { fprintf(stderr, "Out of memory\n"); return EXIT_FAILURE; } print_bins(limits1, n, b); free(b); const int limits2[] = {14, 18, 249, 312, 389, 392, 513, 591, 634, 720}; const int data2[] = { 445, 814, 519, 697, 700, 130, 255, 889, 481, 122, 932, 77, 323, 525, 570, 219, 367, 523, 442, 933, 416, 589, 930, 373, 202, 253, 775, 47, 731, 685, 293, 126, 133, 450, 545, 100, 741, 583, 763, 306, 655, 267, 248, 477, 549, 238, 62, 678, 98, 534, 622, 907, 406, 714, 184, 391, 913, 42, 560, 247, 346, 860, 56, 138, 546, 38, 985, 948, 58, 213, 799, 319, 390, 634, 458, 945, 733, 507, 916, 123, 345, 110, 720, 917, 313, 845, 426, 9, 457, 628, 410, 723, 354, 895, 881, 953, 677, 137, 397, 97, 854, 740, 83, 216, 421, 94, 517, 479, 292, 963, 376, 981, 480, 39, 257, 272, 157, 5, 316, 395, 787, 942, 456, 242, 759, 898, 576, 67, 298, 425, 894, 435, 831, 241, 989, 614, 987, 770, 384, 692, 698, 765, 331, 487, 251, 600, 879, 342, 982, 527, 736, 795, 585, 40, 54, 901, 408, 359, 577, 237, 605, 847, 353, 968, 832, 205, 838, 427, 876, 959, 686, 646, 835, 127, 621, 892, 443, 198, 988, 791, 466, 23, 707, 467, 33, 670, 921, 180, 991, 396, 160, 436, 717, 918, 8, 374, 101, 684, 727, 749}; printf("\nExample 2:\n"); n = sizeof(limits2) / sizeof(int); b = bins(limits2, n, data2, sizeof(data2) / sizeof(int)); if (b == NULL) { fprintf(stderr, "Out of memory\n"); return EXIT_FAILURE; } print_bins(limits2, n, b); free(b); return EXIT_SUCCESS; }
#include <algorithm> #include <cassert> #include <iomanip> #include <iostream> #include <vector> std::vector<int> bins(const std::vector<int>& limits, const std::vector<int>& data) { std::vector<int> result(limits.size() + 1, 0); for (int n : data) { auto i = std::upper_bound(limits.begin(), limits.end(), n); ++result[i - limits.begin()]; } return result; } void print_bins(const std::vector<int>& limits, const std::vector<int>& bins) { size_t n = limits.size(); if (n == 0) return; assert(n + 1 == bins.size()); std::cout << " < " << std::setw(3) << limits[0] << ": " << std::setw(2) << bins[0] << '\n'; for (size_t i = 1; i < n; ++i) std::cout << ">= " << std::setw(3) << limits[i - 1] << " and < " << std::setw(3) << limits[i] << ": " << std::setw(2) << bins[i] << '\n'; std::cout << ">= " << std::setw(3) << limits[n - 1] << "  : " << std::setw(2) << bins[n] << '\n'; } int main() { const std::vector<int> limits1{23, 37, 43, 53, 67, 83}; const std::vector<int> data1{ 95, 21, 94, 12, 99, 4, 70, 75, 83, 93, 52, 80, 57, 5, 53, 86, 65, 17, 92, 83, 71, 61, 54, 58, 47, 16, 8, 9, 32, 84, 7, 87, 46, 19, 30, 37, 96, 6, 98, 40, 79, 97, 45, 64, 60, 29, 49, 36, 43, 55}; std::cout << "Example 1:\n"; print_bins(limits1, bins(limits1, data1)); const std::vector<int> limits2{14, 18, 249, 312, 389, 392, 513, 591, 634, 720}; const std::vector<int> data2{ 445, 814, 519, 697, 700, 130, 255, 889, 481, 122, 932, 77, 323, 525, 570, 219, 367, 523, 442, 933, 416, 589, 930, 373, 202, 253, 775, 47, 731, 685, 293, 126, 133, 450, 545, 100, 741, 583, 763, 306, 655, 267, 248, 477, 549, 238, 62, 678, 98, 534, 622, 907, 406, 714, 184, 391, 913, 42, 560, 247, 346, 860, 56, 138, 546, 38, 985, 948, 58, 213, 799, 319, 390, 634, 458, 945, 733, 507, 916, 123, 345, 110, 720, 917, 313, 845, 426, 9, 457, 628, 410, 723, 354, 895, 881, 953, 677, 137, 397, 97, 854, 740, 83, 216, 421, 94, 517, 479, 292, 963, 376, 981, 480, 39, 257, 272, 157, 5, 316, 395, 787, 942, 456, 242, 759, 898, 576, 67, 298, 425, 894, 435, 831, 241, 989, 614, 987, 770, 384, 692, 698, 765, 331, 487, 251, 600, 879, 342, 982, 527, 736, 795, 585, 40, 54, 901, 408, 359, 577, 237, 605, 847, 353, 968, 832, 205, 838, 427, 876, 959, 686, 646, 835, 127, 621, 892, 443, 198, 988, 791, 466, 23, 707, 467, 33, 670, 921, 180, 991, 396, 160, 436, 717, 918, 8, 374, 101, 684, 727, 749}; std::cout << "\nExample 2:\n"; print_bins(limits2, bins(limits2, data2)); }
Port the provided C code into C++ while preserving the original functionality.
#include <stdio.h> #include <stdlib.h> size_t upper_bound(const int* array, size_t n, int value) { size_t start = 0; while (n > 0) { size_t step = n / 2; size_t index = start + step; if (value >= array[index]) { start = index + 1; n -= step + 1; } else { n = step; } } return start; } int* bins(const int* limits, size_t nlimits, const int* data, size_t ndata) { int* result = calloc(nlimits + 1, sizeof(int)); if (result == NULL) return NULL; for (size_t i = 0; i < ndata; ++i) ++result[upper_bound(limits, nlimits, data[i])]; return result; } void print_bins(const int* limits, size_t n, const int* bins) { if (n == 0) return; printf(" < %3d: %2d\n", limits[0], bins[0]); for (size_t i = 1; i < n; ++i) printf(">= %3d and < %3d: %2d\n", limits[i - 1], limits[i], bins[i]); printf(">= %3d  : %2d\n", limits[n - 1], bins[n]); } int main() { const int limits1[] = {23, 37, 43, 53, 67, 83}; const int data1[] = {95, 21, 94, 12, 99, 4, 70, 75, 83, 93, 52, 80, 57, 5, 53, 86, 65, 17, 92, 83, 71, 61, 54, 58, 47, 16, 8, 9, 32, 84, 7, 87, 46, 19, 30, 37, 96, 6, 98, 40, 79, 97, 45, 64, 60, 29, 49, 36, 43, 55}; printf("Example 1:\n"); size_t n = sizeof(limits1) / sizeof(int); int* b = bins(limits1, n, data1, sizeof(data1) / sizeof(int)); if (b == NULL) { fprintf(stderr, "Out of memory\n"); return EXIT_FAILURE; } print_bins(limits1, n, b); free(b); const int limits2[] = {14, 18, 249, 312, 389, 392, 513, 591, 634, 720}; const int data2[] = { 445, 814, 519, 697, 700, 130, 255, 889, 481, 122, 932, 77, 323, 525, 570, 219, 367, 523, 442, 933, 416, 589, 930, 373, 202, 253, 775, 47, 731, 685, 293, 126, 133, 450, 545, 100, 741, 583, 763, 306, 655, 267, 248, 477, 549, 238, 62, 678, 98, 534, 622, 907, 406, 714, 184, 391, 913, 42, 560, 247, 346, 860, 56, 138, 546, 38, 985, 948, 58, 213, 799, 319, 390, 634, 458, 945, 733, 507, 916, 123, 345, 110, 720, 917, 313, 845, 426, 9, 457, 628, 410, 723, 354, 895, 881, 953, 677, 137, 397, 97, 854, 740, 83, 216, 421, 94, 517, 479, 292, 963, 376, 981, 480, 39, 257, 272, 157, 5, 316, 395, 787, 942, 456, 242, 759, 898, 576, 67, 298, 425, 894, 435, 831, 241, 989, 614, 987, 770, 384, 692, 698, 765, 331, 487, 251, 600, 879, 342, 982, 527, 736, 795, 585, 40, 54, 901, 408, 359, 577, 237, 605, 847, 353, 968, 832, 205, 838, 427, 876, 959, 686, 646, 835, 127, 621, 892, 443, 198, 988, 791, 466, 23, 707, 467, 33, 670, 921, 180, 991, 396, 160, 436, 717, 918, 8, 374, 101, 684, 727, 749}; printf("\nExample 2:\n"); n = sizeof(limits2) / sizeof(int); b = bins(limits2, n, data2, sizeof(data2) / sizeof(int)); if (b == NULL) { fprintf(stderr, "Out of memory\n"); return EXIT_FAILURE; } print_bins(limits2, n, b); free(b); return EXIT_SUCCESS; }
#include <algorithm> #include <cassert> #include <iomanip> #include <iostream> #include <vector> std::vector<int> bins(const std::vector<int>& limits, const std::vector<int>& data) { std::vector<int> result(limits.size() + 1, 0); for (int n : data) { auto i = std::upper_bound(limits.begin(), limits.end(), n); ++result[i - limits.begin()]; } return result; } void print_bins(const std::vector<int>& limits, const std::vector<int>& bins) { size_t n = limits.size(); if (n == 0) return; assert(n + 1 == bins.size()); std::cout << " < " << std::setw(3) << limits[0] << ": " << std::setw(2) << bins[0] << '\n'; for (size_t i = 1; i < n; ++i) std::cout << ">= " << std::setw(3) << limits[i - 1] << " and < " << std::setw(3) << limits[i] << ": " << std::setw(2) << bins[i] << '\n'; std::cout << ">= " << std::setw(3) << limits[n - 1] << "  : " << std::setw(2) << bins[n] << '\n'; } int main() { const std::vector<int> limits1{23, 37, 43, 53, 67, 83}; const std::vector<int> data1{ 95, 21, 94, 12, 99, 4, 70, 75, 83, 93, 52, 80, 57, 5, 53, 86, 65, 17, 92, 83, 71, 61, 54, 58, 47, 16, 8, 9, 32, 84, 7, 87, 46, 19, 30, 37, 96, 6, 98, 40, 79, 97, 45, 64, 60, 29, 49, 36, 43, 55}; std::cout << "Example 1:\n"; print_bins(limits1, bins(limits1, data1)); const std::vector<int> limits2{14, 18, 249, 312, 389, 392, 513, 591, 634, 720}; const std::vector<int> data2{ 445, 814, 519, 697, 700, 130, 255, 889, 481, 122, 932, 77, 323, 525, 570, 219, 367, 523, 442, 933, 416, 589, 930, 373, 202, 253, 775, 47, 731, 685, 293, 126, 133, 450, 545, 100, 741, 583, 763, 306, 655, 267, 248, 477, 549, 238, 62, 678, 98, 534, 622, 907, 406, 714, 184, 391, 913, 42, 560, 247, 346, 860, 56, 138, 546, 38, 985, 948, 58, 213, 799, 319, 390, 634, 458, 945, 733, 507, 916, 123, 345, 110, 720, 917, 313, 845, 426, 9, 457, 628, 410, 723, 354, 895, 881, 953, 677, 137, 397, 97, 854, 740, 83, 216, 421, 94, 517, 479, 292, 963, 376, 981, 480, 39, 257, 272, 157, 5, 316, 395, 787, 942, 456, 242, 759, 898, 576, 67, 298, 425, 894, 435, 831, 241, 989, 614, 987, 770, 384, 692, 698, 765, 331, 487, 251, 600, 879, 342, 982, 527, 736, 795, 585, 40, 54, 901, 408, 359, 577, 237, 605, 847, 353, 968, 832, 205, 838, 427, 876, 959, 686, 646, 835, 127, 621, 892, 443, 198, 988, 791, 466, 23, 707, 467, 33, 670, 921, 180, 991, 396, 160, 436, 717, 918, 8, 374, 101, 684, 727, 749}; std::cout << "\nExample 2:\n"; print_bins(limits2, bins(limits2, data2)); }
Translate this program into C++ but keep the logic exactly as in C.
#include <stdio.h> #include <stdlib.h> size_t upper_bound(const int* array, size_t n, int value) { size_t start = 0; while (n > 0) { size_t step = n / 2; size_t index = start + step; if (value >= array[index]) { start = index + 1; n -= step + 1; } else { n = step; } } return start; } int* bins(const int* limits, size_t nlimits, const int* data, size_t ndata) { int* result = calloc(nlimits + 1, sizeof(int)); if (result == NULL) return NULL; for (size_t i = 0; i < ndata; ++i) ++result[upper_bound(limits, nlimits, data[i])]; return result; } void print_bins(const int* limits, size_t n, const int* bins) { if (n == 0) return; printf(" < %3d: %2d\n", limits[0], bins[0]); for (size_t i = 1; i < n; ++i) printf(">= %3d and < %3d: %2d\n", limits[i - 1], limits[i], bins[i]); printf(">= %3d  : %2d\n", limits[n - 1], bins[n]); } int main() { const int limits1[] = {23, 37, 43, 53, 67, 83}; const int data1[] = {95, 21, 94, 12, 99, 4, 70, 75, 83, 93, 52, 80, 57, 5, 53, 86, 65, 17, 92, 83, 71, 61, 54, 58, 47, 16, 8, 9, 32, 84, 7, 87, 46, 19, 30, 37, 96, 6, 98, 40, 79, 97, 45, 64, 60, 29, 49, 36, 43, 55}; printf("Example 1:\n"); size_t n = sizeof(limits1) / sizeof(int); int* b = bins(limits1, n, data1, sizeof(data1) / sizeof(int)); if (b == NULL) { fprintf(stderr, "Out of memory\n"); return EXIT_FAILURE; } print_bins(limits1, n, b); free(b); const int limits2[] = {14, 18, 249, 312, 389, 392, 513, 591, 634, 720}; const int data2[] = { 445, 814, 519, 697, 700, 130, 255, 889, 481, 122, 932, 77, 323, 525, 570, 219, 367, 523, 442, 933, 416, 589, 930, 373, 202, 253, 775, 47, 731, 685, 293, 126, 133, 450, 545, 100, 741, 583, 763, 306, 655, 267, 248, 477, 549, 238, 62, 678, 98, 534, 622, 907, 406, 714, 184, 391, 913, 42, 560, 247, 346, 860, 56, 138, 546, 38, 985, 948, 58, 213, 799, 319, 390, 634, 458, 945, 733, 507, 916, 123, 345, 110, 720, 917, 313, 845, 426, 9, 457, 628, 410, 723, 354, 895, 881, 953, 677, 137, 397, 97, 854, 740, 83, 216, 421, 94, 517, 479, 292, 963, 376, 981, 480, 39, 257, 272, 157, 5, 316, 395, 787, 942, 456, 242, 759, 898, 576, 67, 298, 425, 894, 435, 831, 241, 989, 614, 987, 770, 384, 692, 698, 765, 331, 487, 251, 600, 879, 342, 982, 527, 736, 795, 585, 40, 54, 901, 408, 359, 577, 237, 605, 847, 353, 968, 832, 205, 838, 427, 876, 959, 686, 646, 835, 127, 621, 892, 443, 198, 988, 791, 466, 23, 707, 467, 33, 670, 921, 180, 991, 396, 160, 436, 717, 918, 8, 374, 101, 684, 727, 749}; printf("\nExample 2:\n"); n = sizeof(limits2) / sizeof(int); b = bins(limits2, n, data2, sizeof(data2) / sizeof(int)); if (b == NULL) { fprintf(stderr, "Out of memory\n"); return EXIT_FAILURE; } print_bins(limits2, n, b); free(b); return EXIT_SUCCESS; }
#include <algorithm> #include <cassert> #include <iomanip> #include <iostream> #include <vector> std::vector<int> bins(const std::vector<int>& limits, const std::vector<int>& data) { std::vector<int> result(limits.size() + 1, 0); for (int n : data) { auto i = std::upper_bound(limits.begin(), limits.end(), n); ++result[i - limits.begin()]; } return result; } void print_bins(const std::vector<int>& limits, const std::vector<int>& bins) { size_t n = limits.size(); if (n == 0) return; assert(n + 1 == bins.size()); std::cout << " < " << std::setw(3) << limits[0] << ": " << std::setw(2) << bins[0] << '\n'; for (size_t i = 1; i < n; ++i) std::cout << ">= " << std::setw(3) << limits[i - 1] << " and < " << std::setw(3) << limits[i] << ": " << std::setw(2) << bins[i] << '\n'; std::cout << ">= " << std::setw(3) << limits[n - 1] << "  : " << std::setw(2) << bins[n] << '\n'; } int main() { const std::vector<int> limits1{23, 37, 43, 53, 67, 83}; const std::vector<int> data1{ 95, 21, 94, 12, 99, 4, 70, 75, 83, 93, 52, 80, 57, 5, 53, 86, 65, 17, 92, 83, 71, 61, 54, 58, 47, 16, 8, 9, 32, 84, 7, 87, 46, 19, 30, 37, 96, 6, 98, 40, 79, 97, 45, 64, 60, 29, 49, 36, 43, 55}; std::cout << "Example 1:\n"; print_bins(limits1, bins(limits1, data1)); const std::vector<int> limits2{14, 18, 249, 312, 389, 392, 513, 591, 634, 720}; const std::vector<int> data2{ 445, 814, 519, 697, 700, 130, 255, 889, 481, 122, 932, 77, 323, 525, 570, 219, 367, 523, 442, 933, 416, 589, 930, 373, 202, 253, 775, 47, 731, 685, 293, 126, 133, 450, 545, 100, 741, 583, 763, 306, 655, 267, 248, 477, 549, 238, 62, 678, 98, 534, 622, 907, 406, 714, 184, 391, 913, 42, 560, 247, 346, 860, 56, 138, 546, 38, 985, 948, 58, 213, 799, 319, 390, 634, 458, 945, 733, 507, 916, 123, 345, 110, 720, 917, 313, 845, 426, 9, 457, 628, 410, 723, 354, 895, 881, 953, 677, 137, 397, 97, 854, 740, 83, 216, 421, 94, 517, 479, 292, 963, 376, 981, 480, 39, 257, 272, 157, 5, 316, 395, 787, 942, 456, 242, 759, 898, 576, 67, 298, 425, 894, 435, 831, 241, 989, 614, 987, 770, 384, 692, 698, 765, 331, 487, 251, 600, 879, 342, 982, 527, 736, 795, 585, 40, 54, 901, 408, 359, 577, 237, 605, 847, 353, 968, 832, 205, 838, 427, 876, 959, 686, 646, 835, 127, 621, 892, 443, 198, 988, 791, 466, 23, 707, 467, 33, 670, 921, 180, 991, 396, 160, 436, 717, 918, 8, 374, 101, 684, 727, 749}; std::cout << "\nExample 2:\n"; print_bins(limits2, bins(limits2, data2)); }
Port the provided C code into C++ while preserving the original functionality.
#include <SDL/SDL.h> #ifdef WITH_CAIRO #include <cairo.h> #else #include <SDL/sge.h> #endif #include <cairo.h> #include <stdlib.h> #include <time.h> #include <math.h> #ifdef WITH_CAIRO #define PI 3.1415926535 #endif #define SIZE 800 #define SCALE 5 #define BRANCHES 14 #define ROTATION_SCALE 0.75 #define INITIAL_LENGTH 50 double rand_fl(){ return (double)rand() / (double)RAND_MAX; } void draw_tree(SDL_Surface * surface, double offsetx, double offsety, double directionx, double directiony, double size, double rotation, int depth) { #ifdef WITH_CAIRO cairo_surface_t *surf = cairo_image_surface_create_for_data( surface->pixels, CAIRO_FORMAT_RGB24, surface->w, surface->h, surface->pitch ); cairo_t *ct = cairo_create(surf); cairo_set_line_width(ct, 1); cairo_set_source_rgba(ct, 0,0,0,1); cairo_move_to(ct, (int)offsetx, (int)offsety); cairo_line_to(ct, (int)(offsetx + directionx * size), (int)(offsety + directiony * size)); cairo_stroke(ct); #else sge_AALine(surface, (int)offsetx, (int)offsety, (int)(offsetx + directionx * size), (int)(offsety + directiony * size), SDL_MapRGB(surface->format, 0, 0, 0)); #endif if (depth > 0){ draw_tree(surface, offsetx + directionx * size, offsety + directiony * size, directionx * cos(rotation) + directiony * sin(rotation), directionx * -sin(rotation) + directiony * cos(rotation), size * rand_fl() / SCALE + size * (SCALE - 1) / SCALE, rotation * ROTATION_SCALE, depth - 1); draw_tree(surface, offsetx + directionx * size, offsety + directiony * size, directionx * cos(-rotation) + directiony * sin(-rotation), directionx * -sin(-rotation) + directiony * cos(-rotation), size * rand_fl() / SCALE + size * (SCALE - 1) / SCALE, rotation * ROTATION_SCALE, depth - 1); } } void render(SDL_Surface * surface){ SDL_FillRect(surface, NULL, SDL_MapRGB(surface->format, 255, 255, 255)); draw_tree(surface, surface->w / 2.0, surface->h - 10.0, 0.0, -1.0, INITIAL_LENGTH, PI / 8, BRANCHES); SDL_UpdateRect(surface, 0, 0, 0, 0); } int main(){ SDL_Surface * screen; SDL_Event evt; SDL_Init(SDL_INIT_VIDEO); srand((unsigned)time(NULL)); screen = SDL_SetVideoMode(SIZE, SIZE, 32, SDL_HWSURFACE); render(screen); while(1){ if (SDL_PollEvent(&evt)){ if(evt.type == SDL_QUIT) break; } SDL_Delay(1); } SDL_Quit(); return 0; }
#include <windows.h> #include <string> #include <math.h> using namespace std; const float PI = 3.1415926536f; class myBitmap { public: myBitmap() : pen( NULL ) {} ~myBitmap() { DeleteObject( pen ); DeleteDC( hdc ); DeleteObject( bmp ); } bool create( int w, int h ) { BITMAPINFO bi; void *pBits; ZeroMemory( &bi, sizeof( bi ) ); bi.bmiHeader.biSize = sizeof( bi.bmiHeader ); bi.bmiHeader.biBitCount = sizeof( DWORD ) * 8; bi.bmiHeader.biCompression = BI_RGB; bi.bmiHeader.biPlanes = 1; bi.bmiHeader.biWidth = w; bi.bmiHeader.biHeight = -h; HDC dc = GetDC( GetConsoleWindow() ); bmp = CreateDIBSection( dc, &bi, DIB_RGB_COLORS, &pBits, NULL, 0 ); if( !bmp ) return false; hdc = CreateCompatibleDC( dc ); SelectObject( hdc, bmp ); ReleaseDC( GetConsoleWindow(), dc ); width = w; height = h; return true; } void setPenColor( DWORD clr ) { if( pen ) DeleteObject( pen ); pen = CreatePen( PS_SOLID, 1, clr ); SelectObject( hdc, pen ); } void saveBitmap( string path ) { BITMAPFILEHEADER fileheader; BITMAPINFO infoheader; BITMAP bitmap; DWORD* dwpBits; DWORD wb; HANDLE file; GetObject( bmp, sizeof( bitmap ), &bitmap ); dwpBits = new DWORD[bitmap.bmWidth * bitmap.bmHeight]; ZeroMemory( dwpBits, bitmap.bmWidth * bitmap.bmHeight * sizeof( DWORD ) ); ZeroMemory( &infoheader, sizeof( BITMAPINFO ) ); ZeroMemory( &fileheader, sizeof( BITMAPFILEHEADER ) ); infoheader.bmiHeader.biBitCount = sizeof( DWORD ) * 8; infoheader.bmiHeader.biCompression = BI_RGB; infoheader.bmiHeader.biPlanes = 1; infoheader.bmiHeader.biSize = sizeof( infoheader.bmiHeader ); infoheader.bmiHeader.biHeight = bitmap.bmHeight; infoheader.bmiHeader.biWidth = bitmap.bmWidth; infoheader.bmiHeader.biSizeImage = bitmap.bmWidth * bitmap.bmHeight * sizeof( DWORD ); fileheader.bfType = 0x4D42; fileheader.bfOffBits = sizeof( infoheader.bmiHeader ) + sizeof( BITMAPFILEHEADER ); fileheader.bfSize = fileheader.bfOffBits + infoheader.bmiHeader.biSizeImage; GetDIBits( hdc, bmp, 0, height, ( LPVOID )dwpBits, &infoheader, DIB_RGB_COLORS ); file = CreateFile( path.c_str(), GENERIC_WRITE, 0, NULL, CREATE_ALWAYS, FILE_ATTRIBUTE_NORMAL, NULL ); WriteFile( file, &fileheader, sizeof( BITMAPFILEHEADER ), &wb, NULL ); WriteFile( file, &infoheader.bmiHeader, sizeof( infoheader.bmiHeader ), &wb, NULL ); WriteFile( file, dwpBits, bitmap.bmWidth * bitmap.bmHeight * 4, &wb, NULL ); CloseHandle( file ); delete [] dwpBits; } HDC getDC() { return hdc; } int getWidth() { return width; } int getHeight() { return height; } private: HBITMAP bmp; HDC hdc; HPEN pen; int width, height; }; class vector2 { public: vector2() { x = y = 0; } vector2( int a, int b ) { x = a; y = b; } void set( int a, int b ) { x = a; y = b; } void rotate( float angle_r ) { float _x = static_cast<float>( x ), _y = static_cast<float>( y ), s = sinf( angle_r ), c = cosf( angle_r ), a = _x * c - _y * s, b = _x * s + _y * c; x = static_cast<int>( a ); y = static_cast<int>( b ); } int x, y; }; class fractalTree { public: fractalTree() { _ang = DegToRadian( 24.0f ); } float DegToRadian( float degree ) { return degree * ( PI / 180.0f ); } void create( myBitmap* bmp ) { _bmp = bmp; float line_len = 130.0f; vector2 sp( _bmp->getWidth() / 2, _bmp->getHeight() - 1 ); MoveToEx( _bmp->getDC(), sp.x, sp.y, NULL ); sp.y -= static_cast<int>( line_len ); LineTo( _bmp->getDC(), sp.x, sp.y); drawRL( &sp, line_len, 0, true ); drawRL( &sp, line_len, 0, false ); } private: void drawRL( vector2* sp, float line_len, float a, bool rg ) { line_len *= .75f; if( line_len < 2.0f ) return; MoveToEx( _bmp->getDC(), sp->x, sp->y, NULL ); vector2 r( 0, static_cast<int>( line_len ) ); if( rg ) a -= _ang; else a += _ang; r.rotate( a ); r.x += sp->x; r.y = sp->y - r.y; LineTo( _bmp->getDC(), r.x, r.y ); drawRL( &r, line_len, a, true ); drawRL( &r, line_len, a, false ); } myBitmap* _bmp; float _ang; }; int main( int argc, char* argv[] ) { ShowWindow( GetConsoleWindow(), SW_MAXIMIZE ); myBitmap bmp; bmp.create( 640, 512 ); bmp.setPenColor( RGB( 255, 255, 0 ) ); fractalTree tree; tree.create( &bmp ); BitBlt( GetDC( GetConsoleWindow() ), 0, 20, 648, 512, bmp.getDC(), 0, 0, SRCCOPY ); bmp.saveBitmap( "f: system( "pause" ); return 0; }
Generate a C++ translation of this C snippet without changing its computational steps.
#include<graphics.h> #include<conio.h> #define sections 4 int main() { int d=DETECT,m,maxX,maxY,x,y,colour=0,increment=1; initgraph(&d,&m,"c:/turboc3/bgi"); maxX = getmaxx(); maxY = getmaxy(); for(y=0;y<maxY;y+=maxY/sections) { for(x=0;x<maxX;x+=increment) { setfillstyle(SOLID_FILL,(colour++)%16); bar(x,y,x+increment,y+maxY/sections); } increment++; colour = 0; } getch(); closegraph(); return 0; }
#include <windows.h> class pinstripe { public: pinstripe() { createColors(); } void setDimensions( int x, int y ) { _mw = x; _mh = y; } void createColors() { colors[0] = 0; colors[1] = 255; colors[2] = RGB( 0, 255, 0 ); colors[3] = RGB( 0, 0, 255 ); colors[4] = RGB( 255, 0, 255 ); colors[5] = RGB( 0, 255, 255 ); colors[6] = RGB( 255, 255, 0 ); colors[7] = RGB( 255, 255, 255 ); } void draw( HDC dc ) { HPEN pen; int lh = _mh / 4, row, cp; for( int lw = 1; lw < 5; lw++ ) { cp = 0; row = ( lw - 1 ) * lh; for( int x = 0 + lw > 1 ? lw > 3 ? 2 : 1 : 0; x < _mw; x += lw ) { pen = CreatePen( PS_SOLID, lw, colors[cp] ); ++cp %= 8; SelectObject( dc, pen ); MoveToEx( dc, x, row, NULL ); LineTo( dc, x, row + lh ); DeleteObject( pen ); } } } private: int _mw, _mh; DWORD colors[8]; }; pinstripe pin; void PaintWnd( HWND hWnd ) { PAINTSTRUCT ps; HDC hdc = BeginPaint( hWnd, &ps ); pin.draw( hdc ); EndPaint( hWnd, &ps ); } LRESULT CALLBACK WndProc( HWND hWnd, UINT msg, WPARAM wParam, LPARAM lParam ) { switch( msg ) { case WM_DESTROY: PostQuitMessage( 0 ); break; case WM_PAINT: PaintWnd( hWnd ); break; default: return DefWindowProc( hWnd, msg, wParam, lParam ); } return 0; } HWND InitAll( HINSTANCE hInstance ) { WNDCLASSEX wcex; ZeroMemory( &wcex, sizeof( wcex ) ); wcex.cbSize = sizeof( WNDCLASSEX ); wcex.style = CS_HREDRAW | CS_VREDRAW; wcex.lpfnWndProc = WndProc; wcex.hInstance = hInstance; wcex.hCursor = LoadCursor( NULL, IDC_ARROW ); wcex.hbrBackground = ( HBRUSH )( COLOR_WINDOW + 1 ); wcex.lpszClassName = "_CLR_PS_"; RegisterClassEx( &wcex ); return CreateWindow( "_CLR_PS_", ".: Clr Pinstripe -- PJorente :.", WS_POPUP, CW_USEDEFAULT, 0, 200, 200, NULL, NULL, hInstance, NULL ); } int APIENTRY _tWinMain( HINSTANCE hInstance, HINSTANCE hPrevInstance, LPTSTR lpCmdLine, int nCmdShow ) { srand( GetTickCount() ); HWND hwnd = InitAll( hInstance ); if( !hwnd ) return -1; int mw = GetSystemMetrics( SM_CXSCREEN ), mh = GetSystemMetrics( SM_CYSCREEN ); pin.setDimensions( mw, mh ); RECT rc = { 0, 0, mw, mh }; AdjustWindowRectEx( &rc, WS_POPUP, FALSE, 0 ); int w = rc.right - rc.left, h = rc.bottom - rc.top; int posX = ( GetSystemMetrics( SM_CXSCREEN ) >> 1 ) - ( w >> 1 ), posY = ( GetSystemMetrics( SM_CYSCREEN ) >> 1 ) - ( h >> 1 ); SetWindowPos( hwnd, HWND_TOP, posX, posY, w, h, SWP_NOZORDER ); ShowWindow( hwnd, nCmdShow ); UpdateWindow( hwnd ); MSG msg; ZeroMemory( &msg, sizeof( msg ) ); while( msg.message != WM_QUIT ) { if( PeekMessage( &msg, NULL, 0, 0, PM_REMOVE ) != 0 ) { TranslateMessage( &msg ); DispatchMessage( &msg ); } } return UnregisterClass( "_CLR_PS_", hInstance ); }
Convert this C snippet to C++ and keep its semantics consistent.
#include <stdio.h> #include <stdint.h> #include <stdbool.h> typedef struct { uint16_t year; uint8_t month; uint8_t day; } Date; bool leap(uint16_t year) { return year%4==0 && (year%100!=0 || year%400==0); } const char *weekday(Date date) { static const uint8_t leapdoom[] = {4,1,7,2,4,6,4,1,5,3,7,5}; static const uint8_t normdoom[] = {3,7,7,4,2,6,4,1,5,3,7,5}; static const char *days[] = { "Sunday", "Monday", "Tuesday", "Wednesday", "Thursday", "Friday", "Saturday" }; unsigned c = date.year/100, r = date.year%100; unsigned s = r/12, t = r%12; unsigned c_anchor = (5 * (c%4) + 2) % 7; unsigned doom = (s + t + (t/4) + c_anchor) % 7; unsigned anchor = (leap(date.year) ? leapdoom : normdoom)[date.month-1]; return days[(doom+date.day-anchor+7)%7]; } int main(void) { const char *past = "was", *future = "will be"; const char *months[] = { "", "January", "February", "March", "April", "May", "June", "July", "August", "September", "October", "November", "December" }; const Date dates[] = { {1800,1,6}, {1875,3,29}, {1915,12,7}, {1970,12,23}, {2043,5,14}, {2077,2,12}, {2101,4,2} }; int i; for (i=0; i < sizeof(dates)/sizeof(Date); i++) { printf("%s %d, %d %s on a %s.\n", months[dates[i].month], dates[i].day, dates[i].year, dates[i].year > 2021 ? future : past, weekday(dates[i])); } return 0; }
#include <iostream> #include <cstdint> struct Date { std::uint16_t year; std::uint8_t month; std::uint8_t day; }; constexpr bool leap(int year) { return year%4==0 && (year%100!=0 || year%400==0); } const std::string& weekday(const Date& date) { static const std::uint8_t leapdoom[] = {4,1,7,2,4,6,4,1,5,3,7,5}; static const std::uint8_t normdoom[] = {3,7,7,4,2,6,4,1,5,3,7,5}; static const std::string days[] = { "Sunday", "Monday", "Tuesday", "Wednesday", "Thursday", "Friday", "Saturday" }; unsigned const c = date.year/100, r = date.year%100; unsigned const s = r/12, t = r%12; unsigned const c_anchor = (5 * (c%4) + 2) % 7; unsigned const doom = (s + t + t/4 + c_anchor) % 7; unsigned const anchor = (leap(date.year) ? leapdoom : normdoom)[date.month-1]; return days[(doom+date.day-anchor+7)%7]; } int main(void) { const std::string months[] = {"", "January", "February", "March", "April", "May", "June", "July", "August", "September", "October", "November", "December" }; const Date dates[] = { {1800,1,6}, {1875,3,29}, {1915,12,7}, {1970,12,23}, {2043,5,14}, {2077,2,12}, {2101,4,2} }; for (const Date& d : dates) { std::cout << months[d.month] << " " << (int)d.day << ", " << d.year; std::cout << (d.year > 2021 ? " will be " : " was "); std::cout << "on a " << weekday(d) << std::endl; } return 0; }
Produce a language-to-language conversion: from C to C++, same semantics.
#include <stdio.h> #include <stdint.h> #include <stdbool.h> typedef struct { uint16_t year; uint8_t month; uint8_t day; } Date; bool leap(uint16_t year) { return year%4==0 && (year%100!=0 || year%400==0); } const char *weekday(Date date) { static const uint8_t leapdoom[] = {4,1,7,2,4,6,4,1,5,3,7,5}; static const uint8_t normdoom[] = {3,7,7,4,2,6,4,1,5,3,7,5}; static const char *days[] = { "Sunday", "Monday", "Tuesday", "Wednesday", "Thursday", "Friday", "Saturday" }; unsigned c = date.year/100, r = date.year%100; unsigned s = r/12, t = r%12; unsigned c_anchor = (5 * (c%4) + 2) % 7; unsigned doom = (s + t + (t/4) + c_anchor) % 7; unsigned anchor = (leap(date.year) ? leapdoom : normdoom)[date.month-1]; return days[(doom+date.day-anchor+7)%7]; } int main(void) { const char *past = "was", *future = "will be"; const char *months[] = { "", "January", "February", "March", "April", "May", "June", "July", "August", "September", "October", "November", "December" }; const Date dates[] = { {1800,1,6}, {1875,3,29}, {1915,12,7}, {1970,12,23}, {2043,5,14}, {2077,2,12}, {2101,4,2} }; int i; for (i=0; i < sizeof(dates)/sizeof(Date); i++) { printf("%s %d, %d %s on a %s.\n", months[dates[i].month], dates[i].day, dates[i].year, dates[i].year > 2021 ? future : past, weekday(dates[i])); } return 0; }
#include <iostream> #include <cstdint> struct Date { std::uint16_t year; std::uint8_t month; std::uint8_t day; }; constexpr bool leap(int year) { return year%4==0 && (year%100!=0 || year%400==0); } const std::string& weekday(const Date& date) { static const std::uint8_t leapdoom[] = {4,1,7,2,4,6,4,1,5,3,7,5}; static const std::uint8_t normdoom[] = {3,7,7,4,2,6,4,1,5,3,7,5}; static const std::string days[] = { "Sunday", "Monday", "Tuesday", "Wednesday", "Thursday", "Friday", "Saturday" }; unsigned const c = date.year/100, r = date.year%100; unsigned const s = r/12, t = r%12; unsigned const c_anchor = (5 * (c%4) + 2) % 7; unsigned const doom = (s + t + t/4 + c_anchor) % 7; unsigned const anchor = (leap(date.year) ? leapdoom : normdoom)[date.month-1]; return days[(doom+date.day-anchor+7)%7]; } int main(void) { const std::string months[] = {"", "January", "February", "March", "April", "May", "June", "July", "August", "September", "October", "November", "December" }; const Date dates[] = { {1800,1,6}, {1875,3,29}, {1915,12,7}, {1970,12,23}, {2043,5,14}, {2077,2,12}, {2101,4,2} }; for (const Date& d : dates) { std::cout << months[d.month] << " " << (int)d.day << ", " << d.year; std::cout << (d.year > 2021 ? " will be " : " was "); std::cout << "on a " << weekday(d) << std::endl; } return 0; }
Keep all operations the same but rewrite the snippet in C++.
#include <stdio.h> #include <string.h> void swap(char* p1, char* p2, size_t size) { for (; size-- > 0; ++p1, ++p2) { char tmp = *p1; *p1 = *p2; *p2 = tmp; } } void cocktail_shaker_sort(void* base, size_t count, size_t size, int (*cmp)(const void*, const void*)) { char* begin = base; char* end = base + size * count; if (end == begin) return; for (end -= size; begin < end; ) { char* new_begin = end; char* new_end = begin; for (char* p = begin; p < end; p += size) { char* q = p + size; if (cmp(p, q) > 0) { swap(p, q, size); new_end = p; } } end = new_end; for (char* p = end; p > begin; p -= size) { char* q = p - size; if (cmp(q, p) > 0) { swap(p, q, size); new_begin = p; } } begin = new_begin; } } int string_compare(const void* p1, const void* p2) { const char* const* s1 = p1; const char* const* s2 = p2; return strcmp(*s1, *s2); } void print(const char** a, size_t len) { for (size_t i = 0; i < len; ++i) printf("%s ", a[i]); printf("\n"); } int main() { const char* a[] = { "one", "two", "three", "four", "five", "six", "seven", "eight" }; const size_t len = sizeof(a)/sizeof(a[0]); printf("before: "); print(a, len); cocktail_shaker_sort(a, len, sizeof(char*), string_compare); printf("after: "); print(a, len); return 0; }
#include <algorithm> #include <cassert> #include <iostream> #include <iterator> #include <vector> template <typename iterator> void cocktail_shaker_sort(iterator begin, iterator end) { if (begin == end) return; for (--end; begin < end; ) { iterator new_begin = end; iterator new_end = begin; for (iterator i = begin; i < end; ++i) { iterator j = i + 1; if (*j < *i) { std::iter_swap(i, j); new_end = i; } } end = new_end; for (iterator i = end; i > begin; --i) { iterator j = i - 1; if (*i < *j) { std::iter_swap(i, j); new_begin = i; } } begin = new_begin; } } template <typename iterator> void print(iterator begin, iterator end) { if (begin == end) return; std::cout << *begin++; while (begin != end) std::cout << ' ' << *begin++; std::cout << '\n'; } int main() { std::vector<int> v{5, 1, -6, 12, 3, 13, 2, 4, 0, 15}; std::cout << "before: "; print(v.begin(), v.end()); cocktail_shaker_sort(v.begin(), v.end()); assert(std::is_sorted(v.begin(), v.end())); std::cout << "after: "; print(v.begin(), v.end()); return 0; }
Keep all operations the same but rewrite the snippet in C++.
#include <stdlib.h> #include <math.h> #include <GL/glut.h> #include <GL/gl.h> #include <sys/time.h> #define length 5 #define g 9.8 double alpha, accl, omega = 0, E; struct timeval tv; double elappsed() { struct timeval now; gettimeofday(&now, 0); int ret = (now.tv_sec - tv.tv_sec) * 1000000 + now.tv_usec - tv.tv_usec; tv = now; return ret / 1.e6; } void resize(int w, int h) { glViewport(0, 0, w, h); glMatrixMode(GL_PROJECTION); glLoadIdentity(); glMatrixMode(GL_MODELVIEW); glLoadIdentity(); glOrtho(0, w, h, 0, -1, 1); } void render() { double x = 320 + 300 * sin(alpha), y = 300 * cos(alpha); resize(640, 320); glClear(GL_COLOR_BUFFER_BIT); glBegin(GL_LINES); glVertex2d(320, 0); glVertex2d(x, y); glEnd(); glFlush(); double us = elappsed(); alpha += (omega + us * accl / 2) * us; omega += accl * us; if (length * g * (1 - cos(alpha)) >= E) { alpha = (alpha < 0 ? -1 : 1) * acos(1 - E / length / g); omega = 0; } accl = -g / length * sin(alpha); } void init_gfx(int *c, char **v) { glutInit(c, v); glutInitDisplayMode(GLUT_RGB); glutInitWindowSize(640, 320); glutIdleFunc(render); glutCreateWindow("Pendulum"); } int main(int c, char **v) { alpha = 4 * atan2(1, 1) / 2.1; E = length * g * (1 - cos(alpha)); accl = -g / length * sin(alpha); omega = 0; gettimeofday(&tv, 0); init_gfx(&c, v); glutMainLoop(); return 0; }
#ifndef __wxPendulumDlg_h__ #define __wxPendulumDlg_h__ #ifdef __BORLANDC__ #pragma hdrstop #endif #ifndef WX_PRECOMP #include <wx/wx.h> #include <wx/dialog.h> #else #include <wx/wxprec.h> #endif #include <wx/timer.h> #include <wx/dcbuffer.h> #include <cmath> class wxPendulumDlgApp : public wxApp { public: bool OnInit(); int OnExit(); }; class wxPendulumDlg : public wxDialog { public: wxPendulumDlg(wxWindow *parent, wxWindowID id = 1, const wxString &title = wxT("wxPendulum"), const wxPoint& pos = wxDefaultPosition, const wxSize& size = wxDefaultSize, long style = wxSUNKEN_BORDER | wxCAPTION | wxRESIZE_BORDER | wxSYSTEM_MENU | wxDIALOG_NO_PARENT | wxMINIMIZE_BOX | wxMAXIMIZE_BOX | wxCLOSE_BOX); virtual ~wxPendulumDlg(); void wxPendulumDlgPaint(wxPaintEvent& event); void wxPendulumDlgSize(wxSizeEvent& event); void OnTimer(wxTimerEvent& event); private: wxTimer *m_timer; unsigned int m_uiLength; double m_Angle; double m_AngleVelocity; enum wxIDs { ID_WXTIMER1 = 1001, ID_DUMMY_VALUE_ }; void OnClose(wxCloseEvent& event); void CreateGUIControls(); DECLARE_EVENT_TABLE() }; #endif
Write a version of this C function in C++ with identical behavior.
int gray_encode(int n) { return n ^ (n >> 1); } int gray_decode(int n) { int p = n; while (n >>= 1) p ^= n; return p; }
#include <bitset> #include <iostream> #include <string> #include <assert.h> uint32_t gray_encode(uint32_t b) { return b ^ (b >> 1); } uint32_t gray_decode(uint32_t g) { for (uint32_t bit = 1U << 31; bit > 1; bit >>= 1) { if (g & bit) g ^= bit >> 1; } return g; } std::string to_binary(int value) { const std::bitset<32> bs(value); const std::string str(bs.to_string()); const size_t pos(str.find('1')); return pos == std::string::npos ? "0" : str.substr(pos); } int main() { std::cout << "Number\tBinary\tGray\tDecoded\n"; for (uint32_t n = 0; n < 32; ++n) { uint32_t g = gray_encode(n); assert(gray_decode(g) == n); std::cout << n << "\t" << to_binary(n) << "\t" << to_binary(g) << "\t" << g << "\n"; } }
Translate the given C code snippet into C++ without altering its behavior.
int gray_encode(int n) { return n ^ (n >> 1); } int gray_decode(int n) { int p = n; while (n >>= 1) p ^= n; return p; }
#include <bitset> #include <iostream> #include <string> #include <assert.h> uint32_t gray_encode(uint32_t b) { return b ^ (b >> 1); } uint32_t gray_decode(uint32_t g) { for (uint32_t bit = 1U << 31; bit > 1; bit >>= 1) { if (g & bit) g ^= bit >> 1; } return g; } std::string to_binary(int value) { const std::bitset<32> bs(value); const std::string str(bs.to_string()); const size_t pos(str.find('1')); return pos == std::string::npos ? "0" : str.substr(pos); } int main() { std::cout << "Number\tBinary\tGray\tDecoded\n"; for (uint32_t n = 0; n < 32; ++n) { uint32_t g = gray_encode(n); assert(gray_decode(g) == n); std::cout << n << "\t" << to_binary(n) << "\t" << to_binary(g) << "\t" << g << "\n"; } }
Ensure the translated C++ code behaves exactly like the original C snippet.
#include<stdio.h> int main() { FILE* fp = fopen("TAPE.FILE","w"); fprintf(fp,"This code should be able to write a file to magnetic tape.\n"); fprintf(fp,"The Wikipedia page on Magnetic tape data storage shows that magnetic tapes are still in use.\n"); fprintf(fp,"In fact, the latest format, at the time of writing this code is TS1155 released in 2017.\n"); fprintf(fp,"And since C is already 44, maybe 45, years old in 2017, I am sure someone somewhere did use a C compiler on magnetic tapes.\n"); fprintf(fp,"If you happen to have one, please try to compile and execute me on that system.\n"); fprintf(fp,"My creator tested me on an i5 machine with SSD and RAM that couldn't have even been dreamt of by Denis Ritchie.\n"); fprintf(fp,"Who knows ? Maybe he did foresee today, after all he created something which is still young after 44-45 years and counting...\n"); fprintf(fp,"EOF"); fclose(fp); return 0; }
#include <iostream> #include <fstream> #if defined(_WIN32) || defined(WIN32) constexpr auto FILENAME = "tape.file"; #else constexpr auto FILENAME = "/dev/tape"; #endif int main() { std::filebuf fb; fb.open(FILENAME,std::ios::out); std::ostream os(&fb); os << "Hello World\n"; fb.close(); return 0; }
Generate an equivalent C++ version of this C code.
#include <stdio.h> int max (int *a, int n, int i, int j, int k) { int m = i; if (j < n && a[j] > a[m]) { m = j; } if (k < n && a[k] > a[m]) { m = k; } return m; } void downheap (int *a, int n, int i) { while (1) { int j = max(a, n, i, 2 * i + 1, 2 * i + 2); if (j == i) { break; } int t = a[i]; a[i] = a[j]; a[j] = t; i = j; } } void heapsort (int *a, int n) { int i; for (i = (n - 2) / 2; i >= 0; i--) { downheap(a, n, i); } for (i = 0; i < n; i++) { int t = a[n - i - 1]; a[n - i - 1] = a[0]; a[0] = t; downheap(a, n - i - 1, 0); } } int main () { int a[] = {4, 65, 2, -31, 0, 99, 2, 83, 782, 1}; int n = sizeof a / sizeof a[0]; int i; for (i = 0; i < n; i++) printf("%d%s", a[i], i == n - 1 ? "\n" : " "); heapsort(a, n); for (i = 0; i < n; i++) printf("%d%s", a[i], i == n - 1 ? "\n" : " "); return 0; }
#include <algorithm> #include <iterator> #include <iostream> template<typename RandomAccessIterator> void heap_sort(RandomAccessIterator begin, RandomAccessIterator end) { std::make_heap(begin, end); std::sort_heap(begin, end); } int main() { int a[] = {100, 2, 56, 200, -52, 3, 99, 33, 177, -199}; heap_sort(std::begin(a), std::end(a)); copy(std::begin(a), std::end(a), std::ostream_iterator<int>(std::cout, " ")); std::cout << "\n"; }
Produce a functionally identical C++ code for the snippet given in C.
#include <stdio.h> #include <stdlib.h> #include <locale.h> int locale_ok = 0; wchar_t s_suits[] = L"♠♥♦♣"; const char *s_suits_ascii[] = { "S", "H", "D", "C" }; const char *s_nums[] = { "WHAT", "A", "2", "3", "4", "5", "6", "7", "8", "9", "10", "J", "Q", "K", "OVERFLOW" }; typedef struct { int suit, number, _s; } card_t, *card; typedef struct { int n; card_t cards[52]; } deck_t, *deck; void show_card(card c) { if (locale_ok) printf(" %lc%s", s_suits[c->suit], s_nums[c->number]); else printf(" %s%s", s_suits_ascii[c->suit], s_nums[c->number]); } deck new_deck() { int i, j, k; deck d = malloc(sizeof(deck_t)); d->n = 52; for (i = k = 0; i < 4; i++) for (j = 1; j <= 13; j++, k++) { d->cards[k].suit = i; d->cards[k].number = j; } return d; } void show_deck(deck d) { int i; printf("%d cards:", d->n); for (i = 0; i < d->n; i++) show_card(d->cards + i); printf("\n"); } int cmp_card(const void *a, const void *b) { int x = ((card)a)->_s, y = ((card)b)->_s; return x < y ? -1 : x > y; } card deal_card(deck d) { if (!d->n) return 0; return d->cards + --d->n; } void shuffle_deck(deck d) { int i; for (i = 0; i < d->n; i++) d->cards[i]._s = rand(); qsort(d->cards, d->n, sizeof(card_t), cmp_card); } int main() { int i, j; deck d = new_deck(); locale_ok = (0 != setlocale(LC_CTYPE, "")); printf("New deck, "); show_deck(d); printf("\nShuffle and deal to three players:\n"); shuffle_deck(d); for (i = 0; i < 3; i++) { for (j = 0; j < 5; j++) show_card(deal_card(d)); printf("\n"); } printf("Left in deck "); show_deck(d); return 0; }
#include <deque> #include <algorithm> #include <ostream> #include <iterator> namespace cards { class card { public: enum pip_type { two, three, four, five, six, seven, eight, nine, ten, jack, queen, king, ace, pip_count }; enum suite_type { hearts, spades, diamonds, clubs, suite_count }; enum { unique_count = pip_count * suite_count }; card(suite_type s, pip_type p): value(s + suite_count * p) {} explicit card(unsigned char v = 0): value(v) {} pip_type pip() { return pip_type(value / suite_count); } suite_type suite() { return suite_type(value % suite_count); } private: unsigned char value; }; const char* const pip_names[] = { "two", "three", "four", "five", "six", "seven", "eight", "nine", "ten", "jack", "queen", "king", "ace" }; std::ostream& operator<<(std::ostream& os, card::pip_type pip) { return os << pip_names[pip]; } const char* const suite_names[] = { "hearts", "spades", "diamonds", "clubs" }; std::ostream& operator<<(std::ostream& os, card::suite_type suite) { return os << suite_names[suite]; } std::ostream& operator<<(std::ostream& os, card c) { return os << c.pip() << " of " << c.suite(); } class deck { public: deck() { for (int i = 0; i < card::unique_count; ++i) { cards.push_back(card(i)); } } void shuffle() { std::random_shuffle(cards.begin(), cards.end()); } card deal() { card c = cards.front(); cards.pop_front(); return c; } typedef std::deque<card>::const_iterator const_iterator; const_iterator begin() const { return cards.cbegin(); } const_iterator end() const { return cards.cend(); } private: std::deque<card> cards; }; inline std::ostream& operator<<(std::ostream& os, const deck& d) { std::copy(d.begin(), d.end(), std::ostream_iterator<card>(os, "\n")); return os; } }
Transform the following C implementation into C++, maintaining the same output and logic.
char foo() { char array[5] = {3,6,9,12,15}; return array[2]; }
#include <array> #include <vector> #include <algorithm> #include <iostream> #include <iterator> #include <string> template <typename Array> void demonstrate(Array& array) { array[2] = "Three"; array.at(1) = "Two"; std::reverse(begin(array), end(array)); std::for_each(begin(array), end(array), [](typename Array::value_type const& element) { std::cout << element << ' '; }); std::cout << '\n'; } int main() { auto fixed_size_array = std::array<std::string, 3>{ "One", "Four", "Eight" }; auto dynamic_array = std::vector<std::string>{ "One", "Four" }; dynamic_array.push_back("Eight"); demonstrate(fixed_size_array); demonstrate(dynamic_array); }
Translate the given C code snippet into C++ without altering its behavior.
#include <stdio.h> int main() { int i, j, dim, d; int depth = 3; for (i = 0, dim = 1; i < depth; i++, dim *= 3); for (i = 0; i < dim; i++) { for (j = 0; j < dim; j++) { for (d = dim / 3; d; d /= 3) if ((i % (d * 3)) / d == 1 && (j % (d * 3)) / d == 1) break; printf(d ? " " : "##"); } printf("\n"); } return 0; }
#include <cstdint> #include <cstdlib> #include <cstdio> static constexpr int32_t bct_low_bits = 0x55555555; static int32_t bct_decrement(int32_t v) { --v; return v ^ (v & (v>>1) & bct_low_bits); } int main (int argc, char *argv[]) { const int32_t n = (1 < argc) ? std::atoi(argv[1]) : 3; if (n < 0 || 9 < n) { std::printf("N out of range (use 0..9): %ld\n", long(n)); return 1; } const int32_t size_bct = 1<<(n*2); int32_t y = size_bct; do { y = bct_decrement(y); int32_t x = size_bct; do { x = bct_decrement(x); std::putchar((x & y & bct_low_bits) ? ' ' : '#'); } while (0 < x); std::putchar('\n'); } while (0 < y); return 0; }
Translate the given C code snippet into C++ without altering its behavior.
#include <stdio.h> #include <stdlib.h> #include <stdbool.h> bool is_sorted(int *a, int n) { while ( --n >= 1 ) { if ( a[n] < a[n-1] ) return false; } return true; } void shuffle(int *a, int n) { int i, t, r; for(i=0; i < n; i++) { t = a[i]; r = rand() % n; a[i] = a[r]; a[r] = t; } } void bogosort(int *a, int n) { while ( !is_sorted(a, n) ) shuffle(a, n); } int main() { int numbers[] = { 1, 10, 9, 7, 3, 0 }; int i; bogosort(numbers, 6); for (i=0; i < 6; i++) printf("%d ", numbers[i]); printf("\n"); }
#include <algorithm> #include <iostream> #include <iterator> #include <random> template <typename RandomAccessIterator, typename Predicate> void bogo_sort(RandomAccessIterator begin, RandomAccessIterator end, Predicate p) { std::random_device rd; std::mt19937 generator(rd()); while (!std::is_sorted(begin, end, p)) { std::shuffle(begin, end, generator); } } template <typename RandomAccessIterator> void bogo_sort(RandomAccessIterator begin, RandomAccessIterator end) { bogo_sort( begin, end, std::less< typename std::iterator_traits<RandomAccessIterator>::value_type>()); } int main() { int a[] = {100, 2, 56, 200, -52, 3, 99, 33, 177, -199}; bogo_sort(std::begin(a), std::end(a)); copy(std::begin(a), std::end(a), std::ostream_iterator<int>(std::cout, " ")); std::cout << "\n"; }
Translate the given C code snippet into C++ without altering its behavior.
#include <ctime> #include <cstdint> extern "C" { int64_t from date(const char* string) { struct tm tmInfo = {0}; strptime(string, "%Y-%m-%d", &tmInfo); return mktime(&tmInfo); } }
#include <iostream> #include <optional> #include <ranges> #include <string> #include <vector> using namespace std; struct Patient { string ID; string LastName; }; struct Visit { string PatientID; string Date; optional<float> Score; }; int main(void) { auto patients = vector<Patient> { {"1001", "Hopper"}, {"4004", "Wirth"}, {"3003", "Kemeny"}, {"2002", "Gosling"}, {"5005", "Kurtz"}}; auto visits = vector<Visit> { {"2002", "2020-09-10", 6.8}, {"1001", "2020-09-17", 5.5}, {"4004", "2020-09-24", 8.4}, {"2002", "2020-10-08", }, {"1001", "" , 6.6}, {"3003", "2020-11-12", }, {"4004", "2020-11-05", 7.0}, {"1001", "2020-11-19", 5.3}}; sort(patients.begin(), patients.end(), [](const auto& a, const auto&b){ return a.ID < b.ID;}); cout << "| PATIENT_ID | LASTNAME | LAST_VISIT | SCORE_SUM | SCORE_AVG |\n"; for(const auto& patient : patients) { string lastVisit; float sum = 0; int numScores = 0; auto patientFilter = [&patient](const Visit &v){return v.PatientID == patient.ID;}; for(const auto& visit : visits | views::filter( patientFilter )) { if(visit.Score) { sum += *visit.Score; numScores++; } lastVisit = max(lastVisit, visit.Date); } cout << "| " << patient.ID << " | "; cout.width(8); cout << patient.LastName << " | "; cout.width(10); cout << lastVisit << " | "; if(numScores > 0) { cout.width(9); cout << sum << " | "; cout.width(9); cout << (sum / float(numScores)); } else cout << " | "; cout << " |\n"; } }
Write the same code in C++ as shown below in C.
#include <stdio.h> #include <math.h> typedef double (*deriv_f)(double, double); #define FMT " %7.3f" void ivp_euler(deriv_f f, double y, int step, int end_t) { int t = 0; printf(" Step %2d: ", (int)step); do { if (t % 10 == 0) printf(FMT, y); y += step * f(t, y); } while ((t += step) <= end_t); printf("\n"); } void analytic() { double t; printf(" Time: "); for (t = 0; t <= 100; t += 10) printf(" %7g", t); printf("\nAnalytic: "); for (t = 0; t <= 100; t += 10) printf(FMT, 20 + 80 * exp(-0.07 * t)); printf("\n"); } double cooling(double t, double temp) { return -0.07 * (temp - 20); } int main() { analytic(); ivp_euler(cooling, 100, 2, 100); ivp_euler(cooling, 100, 5, 100); ivp_euler(cooling, 100, 10, 100); return 0; }
#include <iomanip> #include <iostream> typedef double F(double,double); void euler(F f, double y0, double a, double b, double h) { double y = y0; for (double t = a; t < b; t += h) { std::cout << std::fixed << std::setprecision(3) << t << " " << y << "\n"; y += h * f(t, y); } std::cout << "done\n"; } double newtonCoolingLaw(double, double t) { return -0.07 * (t - 20); } int main() { euler(newtonCoolingLaw, 100, 0, 100, 2); euler(newtonCoolingLaw, 100, 0, 100, 5); euler(newtonCoolingLaw, 100, 0, 100, 10); }
Transform the following C implementation into C++, maintaining the same output and logic.
#include <math.h> #include <stdio.h> #include <assert.h> int nonsqr(int n) { return n + (int)(0.5 + sqrt(n)); } int main() { int i; for (i = 1; i < 23; i++) printf("%d ", nonsqr(i)); printf("\n"); for (i = 1; i < 1000000; i++) { double j = sqrt(nonsqr(i)); assert(j != floor(j)); } return 0; }
#include <iostream> #include <algorithm> #include <vector> #include <cmath> #include <boost/bind.hpp> #include <iterator> double nextNumber( double number ) { return number + floor( 0.5 + sqrt( number ) ) ; } int main( ) { std::vector<double> non_squares ; typedef std::vector<double>::iterator SVI ; non_squares.reserve( 1000000 ) ; for ( double i = 1.0 ; i < 100001.0 ; i += 1 ) non_squares.push_back( nextNumber( i ) ) ; std::copy( non_squares.begin( ) , non_squares.begin( ) + 22 , std::ostream_iterator<double>(std::cout, " " ) ) ; std::cout << '\n' ; SVI found = std::find_if ( non_squares.begin( ) , non_squares.end( ) , boost::bind( &floor, boost::bind( &sqrt, _1 ) ) == boost::bind( &sqrt, _1 ) ) ; if ( found != non_squares.end( ) ) { std::cout << "Found a square number in the sequence!\n" ; std::cout << "It is " << *found << " !\n" ; } else { std::cout << "Up to 1000000, found no square number in the sequence!\n" ; } return 0 ; }
Write the same algorithm in C++ as shown in this C implementation.
#define _CRT_SECURE_NO_WARNINGS #include <stdio.h> #include <stdlib.h> #include <string.h> void putm(char* string, size_t m) { while(*string && m--) putchar(*string++); } int main(void) { char string[] = "Programs for other encodings (such as 8-bit ASCII, or EUC-JP)." int n = 3; int m = 4; char knownCharacter = '('; char knownSubstring[] = "encodings"; putm(string+n-1, m ); putchar('\n'); puts(string+n+1); putchar('\n'); putm(string, strlen(string)-1); putchar('\n'); putm(strchr(string, knownCharacter), m ); putchar('\n'); putm(strstr(string, knownSubstring), m ); putchar('\n'); return EXIT_SUCCESS; }
#include <iostream> #include <string> int main() { std::string s = "0123456789"; int const n = 3; int const m = 4; char const c = '2'; std::string const sub = "456"; std::cout << s.substr(n, m)<< "\n"; std::cout << s.substr(n) << "\n"; std::cout << s.substr(0, s.size()-1) << "\n"; std::cout << s.substr(s.find(c), m) << "\n"; std::cout << s.substr(s.find(sub), m) << "\n"; }
Change the following C code into C++ without altering its purpose.
#include <stdio.h> #include <stdlib.h> int number_of_digits(int x){ int NumberOfDigits; for(NumberOfDigits=0;x!=0;NumberOfDigits++){ x=x/10; } return NumberOfDigits; } int* convert_array(char array[], int NumberOfElements) { int *convertedArray=malloc(NumberOfElements*sizeof(int)); int originalElement, convertedElement; for(convertedElement=0, originalElement=0; convertedElement<NumberOfElements; convertedElement++) { convertedArray[convertedElement]=atoi(&array[originalElement]); originalElement+=number_of_digits(convertedArray[convertedElement])+1; } return convertedArray; } int isSorted(int array[], int numberOfElements){ int sorted=1; for(int counter=0;counter<numberOfElements;counter++){ if(counter!=0 && array[counter-1]>array[counter]) sorted--; } return sorted; } int main(int argc, char* argv[]) { int* convertedArray; convertedArray=convert_array(*(argv+1), argc-1); if(isSorted(convertedArray, argc-1)==1) printf("Did you forgot to turn on your brain?! This array is already sorted!\n"); else if(argc-1<=10) printf("Am I really supposed to sort this? Sort it by yourself!\n"); else printf("Am I really supposed to sort this? Bhahahaha!\n"); free(convertedArray); return 0; }
#include <algorithm> #include <string> #include <iostream> #include <iterator> class jortSort { public: template<class T> bool jort_sort( T* o, size_t s ) { T* n = copy_array( o, s ); sort_array( n, s ); bool r = false; if( n ) { r = check( o, n, s ); delete [] n; } return r; } private: template<class T> T* copy_array( T* o, size_t s ) { T* z = new T[s]; memcpy( z, o, s * sizeof( T ) ); return z; } template<class T> void sort_array( T* n, size_t s ) { std::sort( n, n + s ); } template<class T> bool check( T* n, T* o, size_t s ) { for( size_t x = 0; x < s; x++ ) if( n[x] != o[x] ) return false; return true; } }; jortSort js; template<class T> void displayTest( T* o, size_t s ) { std::copy( o, o + s, std::ostream_iterator<T>( std::cout, " " ) ); std::cout << ": -> The array is " << ( js.jort_sort( o, s ) ? "sorted!" : "not sorted!" ) << "\n\n"; } int main( int argc, char* argv[] ) { const size_t s = 5; std::string oStr[] = { "5", "A", "D", "R", "S" }; displayTest( oStr, s ); std::swap( oStr[0], oStr[1] ); displayTest( oStr, s ); int oInt[] = { 1, 2, 3, 4, 5 }; displayTest( oInt, s ); std::swap( oInt[0], oInt[1] ); displayTest( oInt, s ); return 0; }
Translate the given C code snippet into C++ without altering its behavior.
#include <stdio.h> int is_leap_year(unsigned year) { return !(year & (year % 100 ? 3 : 15)); } int main(void) { const unsigned test_case[] = { 1900, 1994, 1996, 1997, 2000, 2024, 2025, 2026, 2100 }; const unsigned n = sizeof test_case / sizeof test_case[0]; for (unsigned i = 0; i != n; ++i) { unsigned year = test_case[i]; printf("%u is %sa leap year.\n", year, is_leap_year(year) ? "" : "not "); } return 0; }
#include <iostream> bool is_leap_year(int year) { return year % 4 == 0 && (year % 100 != 0 || year % 400 == 0); } int main() { for (auto year : {1900, 1994, 1996, 1997, 2000}) { std::cout << year << (is_leap_year(year) ? " is" : " is not") << " a leap year.\n"; } }
Write the same code in C++ as shown below in C.
#include <gmp.h> void perm(mpz_t out, int n, int k) { mpz_set_ui(out, 1); k = n - k; while (n > k) mpz_mul_ui(out, out, n--); } void comb(mpz_t out, int n, int k) { perm(out, n, k); while (k) mpz_divexact_ui(out, out, k--); } int main(void) { mpz_t x; mpz_init(x); perm(x, 1000, 969); gmp_printf("P(1000,969) = %Zd\n", x); comb(x, 1000, 969); gmp_printf("C(1000,969) = %Zd\n", x); return 0; }
#include <boost/multiprecision/gmp.hpp> #include <iostream> using namespace boost::multiprecision; mpz_int p(uint n, uint p) { mpz_int r = 1; mpz_int k = n - p; while (n > k) r *= n--; return r; } mpz_int c(uint n, uint k) { mpz_int r = p(n, k); while (k) r /= k--; return r; } int main() { for (uint i = 1u; i < 12u; i++) std::cout << "P(12," << i << ") = " << p(12u, i) << std::endl; for (uint i = 10u; i < 60u; i += 10u) std::cout << "C(60," << i << ") = " << c(60u, i) << std::endl; return 0; }
Transform the following C implementation into C++, maintaining the same output and logic.
#include <math.h> #include <stdio.h> #include <stdlib.h> #include <string.h> int compareStrings(const void *a, const void *b) { const char **aa = (const char **)a; const char **bb = (const char **)b; return strcmp(*aa, *bb); } void lexOrder(int n, int *ints) { char **strs; int i, first = 1, last = n, k = n, len; if (n < 1) { first = n; last = 1; k = 2 - n; } strs = malloc(k * sizeof(char *)); for (i = first; i <= last; ++i) { if (i >= 1) len = (int)log10(i) + 2; else if (i == 0) len = 2; else len = (int)log10(-i) + 3; strs[i-first] = malloc(len); sprintf(strs[i-first], "%d", i); } qsort(strs, k, sizeof(char *), compareStrings); for (i = 0; i < k; ++i) { ints[i] = atoi(strs[i]); free(strs[i]); } free(strs); } int main() { int i, j, k, n, *ints; int numbers[5] = {0, 5, 13, 21, -22}; printf("In lexicographical order:\n\n"); for (i = 0; i < 5; ++i) { k = n = numbers[i]; if (k < 1) k = 2 - k; ints = malloc(k * sizeof(int)); lexOrder(n, ints); printf("%3d: [", n); for (j = 0; j < k; ++j) { printf("%d ", ints[j]); } printf("\b]\n"); free(ints); } return 0; }
#include <algorithm> #include <iostream> #include <numeric> #include <string> #include <vector> void lexicographical_sort(std::vector<int>& numbers) { std::vector<std::string> strings(numbers.size()); std::transform(numbers.begin(), numbers.end(), strings.begin(), [](int i) { return std::to_string(i); }); std::sort(strings.begin(), strings.end()); std::transform(strings.begin(), strings.end(), numbers.begin(), [](const std::string& s) { return std::stoi(s); }); } std::vector<int> lexicographically_sorted_vector(int n) { std::vector<int> numbers(n >= 1 ? n : 2 - n); std::iota(numbers.begin(), numbers.end(), std::min(1, n)); lexicographical_sort(numbers); return numbers; } template <typename T> void print_vector(std::ostream& out, const std::vector<T>& v) { out << '['; if (!v.empty()) { auto i = v.begin(); out << *i++; for (; i != v.end(); ++i) out << ',' << *i; } out << "]\n"; } int main(int argc, char** argv) { for (int i : { 0, 5, 13, 21, -22 }) { std::cout << i << ": "; print_vector(std::cout, lexicographically_sorted_vector(i)); } return 0; }
Translate this program into C++ but keep the logic exactly as in C.
#include <stdio.h> #include <string.h> const char *ones[] = { 0, "one", "two", "three", "four", "five", "six", "seven", "eight", "nine", "ten", "eleven", "twelve", "thirteen", "fourteen", "fifteen", "sixteen", "seventeen", "eighteen", "nineteen" }; const char *tens[] = { 0, "ten", "twenty", "thirty", "forty", "fifty", "sixty", "seventy", "eighty", "ninety" }; const char *llions[] = { 0, "thousand", "million", "billion", "trillion", }; const int maxillion = sizeof(llions) / sizeof(llions[0]) * 3 - 3; int say_hundred(const char *s, int len, int depth, int has_lead) { int c[3], i; for (i = -3; i < 0; i++) { if (len + i >= 0) c[i + 3] = s[len + i] - '0'; else c[i + 3] = 0; } if (!(c[0] + c[1] + c[2])) return 0; if (c[0]) { printf("%s hundred", ones[c[0]]); has_lead = 1; } if (has_lead && (c[1] || c[2])) printf((!depth || c[0]) && (!c[0] || !c[1]) ? "and " : c[0] ? " " : ""); if (c[1] < 2) { if (c[1] || c[2]) printf("%s", ones[c[1] * 10 + c[2]]); } else { if (c[1]) { printf("%s", tens[c[1]]); if (c[2]) putchar('-'); } if (c[2]) printf("%s", ones[c[2]]); } return 1; } int say_maxillion(const char *s, int len, int depth, int has_lead) { int n = len / 3, r = len % 3; if (!r) { n--; r = 3; } const char *e = s + r; do { if (say_hundred(s, r, n, has_lead) && n) { has_lead = 1; printf(" %s", llions[n]); if (!depth) printf(", "); else printf(" "); } s = e; e += 3; } while (r = 3, n--); return 1; } void say_number(const char *s) { int len, i, got_sign = 0; while (*s == ' ') s++; if (*s < '0' || *s > '9') { if (*s == '-') got_sign = -1; else if (*s == '+') got_sign = 1; else goto nan; s++; } else got_sign = 1; while (*s == '0') { s++; if (*s == '\0') { printf("zero\n"); return; } } len = strlen(s); if (!len) goto nan; for (i = 0; i < len; i++) { if (s[i] < '0' || s[i] > '9') { printf("(not a number)"); return; } } if (got_sign == -1) printf("minus "); int n = len / maxillion; int r = len % maxillion; if (!r) { r = maxillion; n--; } const char *end = s + len - n * maxillion; int has_lead = 0; do { if ((has_lead = say_maxillion(s, r, n, has_lead))) { for (i = 0; i < n; i++) printf(" %s", llions[maxillion / 3]); if (n) printf(", "); } n--; r = maxillion; s = end; end += r; } while (n >= 0); printf("\n"); return; nan: printf("not a number\n"); return; } int main() { say_number("-42"); say_number("1984"); say_number("10000"); say_number("1024"); say_number("1001001001001"); say_number("123456789012345678901234567890123456789012345678900000001"); return 0; }
#include <string> #include <iostream> using std::string; const char* smallNumbers[] = { "zero", "one", "two", "three", "four", "five", "six", "seven", "eight", "nine", "ten", "eleven", "twelve", "thirteen", "fourteen", "fifteen", "sixteen", "seventeen", "eighteen", "nineteen" }; string spellHundreds(unsigned n) { string res; if (n > 99) { res = smallNumbers[n/100]; res += " hundred"; n %= 100; if (n) res += " and "; } if (n >= 20) { static const char* Decades[] = { "", "", "twenty", "thirty", "forty", "fifty", "sixty", "seventy", "eighty", "ninety" }; res += Decades[n/10]; n %= 10; if (n) res += "-"; } if (n < 20 && n > 0) res += smallNumbers[n]; return res; } const char* thousandPowers[] = { " billion", " million", " thousand", "" }; typedef unsigned long Spellable; string spell(Spellable n) { if (n < 20) return smallNumbers[n]; string res; const char** pScaleName = thousandPowers; Spellable scaleFactor = 1000000000; while (scaleFactor > 0) { if (n >= scaleFactor) { Spellable h = n / scaleFactor; res += spellHundreds(h) + *pScaleName; n %= scaleFactor; if (n) res += ", "; } scaleFactor /= 1000; ++pScaleName; } return res; } int main() { #define SPELL_IT(x) std::cout << #x " " << spell(x) << std::endl; SPELL_IT( 99); SPELL_IT( 300); SPELL_IT( 310); SPELL_IT( 1501); SPELL_IT( 12609); SPELL_IT( 512609); SPELL_IT(43112609); SPELL_IT(1234567890); return 0; }