Instruction stringlengths 45 106 | input_code stringlengths 1 13.7k | output_code stringlengths 1 13.7k |
|---|---|---|
Rewrite the snippet below in C++ so it works the same as the original C code. | #include <string.h>
#include <stdlib.h>
#include <stdio.h>
int main( int argc, char ** argv ){
const char * str_a = "knight";
const char * str_b = "socks";
const char * str_c = "brooms";
char * new_a = malloc( strlen( str_a ) - 1 );
char * new_b = malloc( strlen( str_b ) - 1 );
char * new_c = malloc( strlen( str_c ) - 2 );
strcpy( new_a, str_a + 1 );
strncpy( new_b, str_b, strlen( str_b ) - 1 );
strncpy( new_c, str_c + 1, strlen( str_c ) - 2 );
printf( "%s\n%s\n%s\n", new_a, new_b, new_c );
free( new_a );
free( new_b );
free( new_c );
return 0;
}
| #include <string>
#include <iostream>
int main( ) {
std::string word( "Premier League" ) ;
std::cout << "Without first letter: " << word.substr( 1 ) << " !\n" ;
std::cout << "Without last letter: " << word.substr( 0 , word.length( ) - 1 ) << " !\n" ;
std::cout << "Without first and last letter: " << word.substr( 1 , word.length( ) - 2 ) << " !\n" ;
return 0 ;
}
|
Preserve the algorithm and functionality while converting the code from C to C++. | #include <stdio.h>
#include <math.h>
#include <stdlib.h>
#include <stdint.h>
#include <time.h>
const uint8_t masks[8] = {1, 2, 4, 8, 16, 32, 64, 128};
#define half(n) ((int64_t)((n) - 1) >> 1)
#define divide(nm, d) ((uint64_t)((double)nm / (double)d))
int64_t countPrimes(uint64_t n) {
if (n < 9) return (n < 2) ? 0 : ((int64_t)n + 1) / 2;
uint64_t rtlmt = (uint64_t)sqrt((double)n);
int64_t mxndx = (int64_t)((rtlmt - 1) / 2);
int arrlen = (int)(mxndx + 1);
uint32_t *smalls = malloc(arrlen * 4);
uint32_t *roughs = malloc(arrlen * 4);
int64_t *larges = malloc(arrlen * 8);
for (int i = 0; i < arrlen; ++i) {
smalls[i] = (uint32_t)i;
roughs[i] = (uint32_t)(i + i + 1);
larges[i] = (int64_t)((n/(uint64_t)(i + i + 1) - 1) / 2);
}
int cullbuflen = (int)((mxndx + 8) / 8);
uint8_t *cullbuf = calloc(cullbuflen, 1);
int64_t nbps = 0;
int rilmt = arrlen;
for (int64_t i = 1; ; ++i) {
int64_t sqri = (i + i) * (i + 1);
if (sqri > mxndx) break;
if (cullbuf[i >> 3] & masks[i & 7]) continue;
cullbuf[i >> 3] |= masks[i & 7];
uint64_t bp = (uint64_t)(i + i + 1);
for (int64_t c = sqri; c < (int64_t)arrlen; c += (int64_t)bp) {
cullbuf[c >> 3] |= masks[c & 7];
}
int nri = 0;
for (int ori = 0; ori < rilmt; ++ori) {
uint32_t r = roughs[ori];
int64_t rci = (int64_t)(r >> 1);
if (cullbuf[rci >> 3] & masks[rci & 7]) continue;
uint64_t d = (uint64_t)r * bp;
int64_t t = (d <= rtlmt) ? larges[(int64_t)smalls[d >> 1] - nbps] :
(int64_t)smalls[half(divide(n, d))];
larges[nri] = larges[ori] - t + nbps;
roughs[nri] = r;
nri++;
}
int64_t si = mxndx;
for (uint64_t pm = (rtlmt/bp - 1) | 1; pm >= bp; pm -= 2) {
uint32_t c = smalls[pm >> 1];
uint64_t e = (pm * bp) >> 1;
for ( ; si >= (int64_t)e; --si) smalls[si] -= c - (uint32_t)nbps;
}
rilmt = nri;
nbps++;
}
int64_t ans = larges[0] + (int64_t)((rilmt + 2*(nbps - 1)) * (rilmt - 1) / 2);
int ri, sri;
for (ri = 1; ri < rilmt; ++ri) ans -= larges[ri];
for (ri = 1; ; ++ri) {
uint64_t p = (uint64_t)roughs[ri];
uint64_t m = n / p;
int ei = (int)smalls[half((uint64_t)m/p)] - nbps;
if (ei <= ri) break;
ans -= (int64_t)((ei - ri) * (nbps + ri - 1));
for (sri = ri + 1; sri < ei + 1; ++sri) {
ans += (int64_t)smalls[half(divide(m, (uint64_t)roughs[sri]))];
}
}
free(smalls);
free(roughs);
free(larges);
free(cullbuf);
return ans + 1;
}
int main() {
uint64_t n;
int i;
clock_t start = clock();
for (i = 0, n = 1; i < 10; ++i, n *= 10) {
printf("10^%d %ld\n", i, countPrimes(n));
}
clock_t end = clock();
printf("\nTook %f seconds\n", (double) (end - start) / CLOCKS_PER_SEC);
return 0;
}
| #include <cmath>
#include <iostream>
#include <vector>
std::vector<int> generate_primes(int limit) {
std::vector<bool> sieve(limit >> 1, true);
for (int p = 3, s = 9; s < limit; p += 2) {
if (sieve[p >> 1]) {
for (int q = s; q < limit; q += p << 1)
sieve[q >> 1] = false;
}
s += (p + 1) << 2;
}
std::vector<int> primes;
if (limit > 2)
primes.push_back(2);
for (int i = 1; i < sieve.size(); ++i) {
if (sieve[i])
primes.push_back((i << 1) + 1);
}
return primes;
}
class legendre_prime_counter {
public:
explicit legendre_prime_counter(int limit);
int prime_count(int n);
private:
int phi(int x, int a);
std::vector<int> primes;
};
legendre_prime_counter::legendre_prime_counter(int limit) :
primes(generate_primes(static_cast<int>(std::sqrt(limit)))) {}
int legendre_prime_counter::prime_count(int n) {
if (n < 2)
return 0;
int a = prime_count(static_cast<int>(std::sqrt(n)));
return phi(n, a) + a - 1;
}
int legendre_prime_counter::phi(int x, int a) {
if (a == 0)
return x;
if (a == 1)
return x - (x >> 1);
int pa = primes[a - 1];
if (x <= pa)
return 1;
return phi(x, a - 1) - phi(x / pa, a - 1);
}
int main() {
legendre_prime_counter counter(1000000000);
for (int i = 0, n = 1; i < 10; ++i, n *= 10)
std::cout << "10^" << i << "\t" << counter.prime_count(n) << '\n';
}
|
Preserve the algorithm and functionality while converting the code from C to C++. | #include <stdio.h>
extern int Query (char * Data, size_t * Length);
int main (int argc, char * argv [])
{
char Buffer [1024];
size_t Size = sizeof (Buffer);
if (0 == Query (Buffer, &Size))
{
printf ("failed to call Query\n");
}
else
{
char * Ptr = Buffer;
while (Size-- > 0) putchar (*Ptr++);
putchar ('\n');
}
}
| #include <string>
using std::string;
extern "C" int
Query (char *Data, size_t *Length)
{
const string Message = "Here am I";
if (*Length < Message.length())
return false;
*Length = Message.length();
Message.copy(Data, *Length);
return true;
}
|
Generate a C++ translation of this C snippet without changing its computational steps. | #include <stdio.h>
#include <string.h>
int cmp(const char *p, const char *q)
{
while (*p && *q) p = &p[1], q = &q[1];
return *p;
}
int main()
{
char line[65536];
char buf[1000000] = {0};
char *last = buf;
char *next = buf;
while (gets(line)) {
strcat(line, "\n");
if (cmp(last, line)) continue;
if (cmp(line, last)) next = buf;
last = next;
strcpy(next, line);
while (*next) next = &next[1];
}
printf("%s", buf);
return 0;
}
| #include <iostream>
#include <string.h>
int main()
{
std::string longLine, longestLines, newLine;
while (std::cin >> newLine)
{
auto isNewLineShorter = longLine.c_str();
auto isLongLineShorter = newLine.c_str();
while (*isNewLineShorter && *isLongLineShorter)
{
isNewLineShorter = &isNewLineShorter[1];
isLongLineShorter = &isLongLineShorter[1];
}
if(*isNewLineShorter) continue;
if(*isLongLineShorter)
{
longLine = newLine;
longestLines = newLine;
}
else
{
longestLines+=newLine;
}
longestLines+="\n";
}
std::cout << "\nLongest string:\n" << longestLines;
}
|
Generate an equivalent C++ version of this C code. | #include <stdio.h>
#include <stdarg.h>
#include <stdlib.h>
#include <string.h>
enum {
LEFT,
RIGHT,
STAY
};
typedef struct {
int state1;
int symbol1;
int symbol2;
int dir;
int state2;
} transition_t;
typedef struct tape_t tape_t;
struct tape_t {
int symbol;
tape_t *left;
tape_t *right;
};
typedef struct {
int states_len;
char **states;
int final_states_len;
int *final_states;
int symbols_len;
char *symbols;
int blank;
int state;
int tape_len;
tape_t *tape;
int transitions_len;
transition_t ***transitions;
} turing_t;
int state_index (turing_t *t, char *state) {
int i;
for (i = 0; i < t->states_len; i++) {
if (!strcmp(t->states[i], state)) {
return i;
}
}
return 0;
}
int symbol_index (turing_t *t, char symbol) {
int i;
for (i = 0; i < t->symbols_len; i++) {
if (t->symbols[i] == symbol) {
return i;
}
}
return 0;
}
void move (turing_t *t, int dir) {
tape_t *orig = t->tape;
if (dir == RIGHT) {
if (orig && orig->right) {
t->tape = orig->right;
}
else {
t->tape = calloc(1, sizeof (tape_t));
t->tape->symbol = t->blank;
if (orig) {
t->tape->left = orig;
orig->right = t->tape;
}
}
}
else if (dir == LEFT) {
if (orig && orig->left) {
t->tape = orig->left;
}
else {
t->tape = calloc(1, sizeof (tape_t));
t->tape->symbol = t->blank;
if (orig) {
t->tape->right = orig;
orig->left = t->tape;
}
}
}
}
turing_t *create (int states_len, ...) {
va_list args;
va_start(args, states_len);
turing_t *t = malloc(sizeof (turing_t));
t->states_len = states_len;
t->states = malloc(states_len * sizeof (char *));
int i;
for (i = 0; i < states_len; i++) {
t->states[i] = va_arg(args, char *);
}
t->final_states_len = va_arg(args, int);
t->final_states = malloc(t->final_states_len * sizeof (int));
for (i = 0; i < t->final_states_len; i++) {
t->final_states[i] = state_index(t, va_arg(args, char *));
}
t->symbols_len = va_arg(args, int);
t->symbols = malloc(t->symbols_len);
for (i = 0; i < t->symbols_len; i++) {
t->symbols[i] = va_arg(args, int);
}
t->blank = symbol_index(t, va_arg(args, int));
t->state = state_index(t, va_arg(args, char *));
t->tape_len = va_arg(args, int);
t->tape = NULL;
for (i = 0; i < t->tape_len; i++) {
move(t, RIGHT);
t->tape->symbol = symbol_index(t, va_arg(args, int));
}
if (!t->tape_len) {
move(t, RIGHT);
}
while (t->tape->left) {
t->tape = t->tape->left;
}
t->transitions_len = va_arg(args, int);
t->transitions = malloc(t->states_len * sizeof (transition_t **));
for (i = 0; i < t->states_len; i++) {
t->transitions[i] = malloc(t->symbols_len * sizeof (transition_t *));
}
for (i = 0; i < t->transitions_len; i++) {
transition_t *tran = malloc(sizeof (transition_t));
tran->state1 = state_index(t, va_arg(args, char *));
tran->symbol1 = symbol_index(t, va_arg(args, int));
tran->symbol2 = symbol_index(t, va_arg(args, int));
tran->dir = va_arg(args, int);
tran->state2 = state_index(t, va_arg(args, char *));
t->transitions[tran->state1][tran->symbol1] = tran;
}
va_end(args);
return t;
}
void print_state (turing_t *t) {
printf("%-10s ", t->states[t->state]);
tape_t *tape = t->tape;
while (tape->left) {
tape = tape->left;
}
while (tape) {
if (tape == t->tape) {
printf("[%c]", t->symbols[tape->symbol]);
}
else {
printf(" %c ", t->symbols[tape->symbol]);
}
tape = tape->right;
}
printf("\n");
}
void run (turing_t *t) {
int i;
while (1) {
print_state(t);
for (i = 0; i < t->final_states_len; i++) {
if (t->final_states[i] == t->state) {
return;
}
}
transition_t *tran = t->transitions[t->state][t->tape->symbol];
t->tape->symbol = tran->symbol2;
move(t, tran->dir);
t->state = tran->state2;
}
}
int main () {
printf("Simple incrementer\n");
turing_t *t = create(
2, "q0", "qf",
1, "qf",
2, 'B', '1',
'B',
"q0",
3, '1', '1', '1',
2,
"q0", '1', '1', RIGHT, "q0",
"q0", 'B', '1', STAY, "qf"
);
run(t);
printf("\nThree-state busy beaver\n");
t = create(
4, "a", "b", "c", "halt",
1, "halt",
2, '0', '1',
'0',
"a",
0,
6,
"a", '0', '1', RIGHT, "b",
"a", '1', '1', LEFT, "c",
"b", '0', '1', LEFT, "a",
"b", '1', '1', RIGHT, "b",
"c", '0', '1', LEFT, "b",
"c", '1', '1', STAY, "halt"
);
run(t);
return 0;
printf("\nFive-state two-symbol probable busy beaver\n");
t = create(
6, "A", "B", "C", "D", "E", "H",
1, "H",
2, '0', '1',
'0',
"A",
0,
10,
"A", '0', '1', RIGHT, "B",
"A", '1', '1', LEFT, "C",
"B", '0', '1', RIGHT, "C",
"B", '1', '1', RIGHT, "B",
"C", '0', '1', RIGHT, "D",
"C", '1', '0', LEFT, "E",
"D", '0', '1', LEFT, "A",
"D", '1', '1', LEFT, "D",
"E", '0', '1', STAY, "H",
"E", '1', '0', LEFT, "A"
);
run(t);
}
| #include <vector>
#include <string>
#include <iostream>
#include <algorithm>
#include <fstream>
#include <iomanip>
typedef unsigned int uint;
using namespace std;
const uint TAPE_MAX_LEN = 49152;
struct action { char write, direction; };
class tape
{
public:
tape( uint startPos = TAPE_MAX_LEN >> 1 ) : MAX_LEN( TAPE_MAX_LEN ) { _sp = startPos; reset(); }
void reset() { clear( '0' ); headPos = _sp; }
char read(){ return _t[headPos]; }
void input( string a ){ if( a == "" ) return; for( uint s = 0; s < a.length(); s++ ) _t[headPos + s] = a[s]; }
void clear( char c ) { _t.clear(); blk = c; _t.resize( MAX_LEN, blk ); }
void action( const action* a ) { write( a->write ); move( a->direction ); }
void print( int c = 10 )
{
int ml = static_cast<int>( MAX_LEN ), st = static_cast<int>( headPos ) - c, ed = static_cast<int>( headPos ) + c + 1, tx;
for( int x = st; x < ed; x++ )
{ tx = x; if( tx < 0 ) tx += ml; if( tx >= ml ) tx -= ml; cout << _t[tx]; }
cout << endl << setw( c + 1 ) << "^" << endl;
}
private:
void move( char d ) { if( d == 'N' ) return; headPos += d == 'R' ? 1 : -1; if( headPos >= MAX_LEN ) headPos = d == 'R' ? 0 : MAX_LEN - 1; }
void write( char a ) { if( a != 'N' ) { if( a == 'B' ) _t[headPos] = blk; else _t[headPos] = a; } }
string _t; uint headPos, _sp; char blk; const uint MAX_LEN;
};
class state
{
public:
bool operator ==( const string o ) { return o == name; }
string name, next; char symbol, write, direction;
};
class actionTable
{
public:
bool loadTable( string file )
{
reset();
ifstream mf; mf.open( file.c_str() ); if( mf.is_open() )
{
string str; state stt;
while( mf.good() )
{
getline( mf, str ); if( str[0] == '\'' ) break;
parseState( str, stt ); states.push_back( stt );
}
while( mf.good() )
{
getline( mf, str ); if( str == "" ) continue;
if( str[0] == '!' ) blank = str.erase( 0, 1 )[0];
if( str[0] == '^' ) curState = str.erase( 0, 1 );
if( str[0] == '>' ) input = str.erase( 0, 1 );
}
mf.close(); return true;
}
cout << "Could not open " << file << endl; return false;
}
bool action( char symbol, action& a )
{
vector<state>::iterator f = states.begin();
while( true )
{
f = find( f, states.end(), curState );
if( f == states.end() ) return false;
if( ( *f ).symbol == '*' || ( *f ).symbol == symbol || ( ( *f ).symbol == 'B' && blank == symbol ) )
{ a.direction = ( *f ).direction; a.write = ( *f ).write; curState = ( *f ).next; break; }
f++;
}
return true;
}
void reset() { states.clear(); blank = '0'; curState = input = ""; }
string getInput() { return input; }
char getBlank() { return blank; }
private:
void parseState( string str, state& stt )
{
string a[5]; int idx = 0;
for( string::iterator si = str.begin(); si != str.end(); si++ )
{ if( ( *si ) == ';' ) idx++; else a[idx].append( &( *si ), 1 ); }
stt.name = a[0]; stt.symbol = a[1][0]; stt.write = a[2][0]; stt.direction = a[3][0]; stt.next = a[4];
}
vector<state> states; char blank; string curState, input;
};
class utm
{
public:
utm() { files[0] = "incrementer.utm"; files[1] = "busy_beaver.utm"; files[2] = "sort.utm"; }
void start()
{
while( true )
{
reset(); int t = showMenu(); if( t == 0 ) return;
if( !at.loadTable( files[t - 1] ) ) return; startMachine();
}
}
private:
void simulate()
{
char r; action a;
while( true ) { tp.print(); r = tp.read(); if( !( at.action( r, a ) ) ) break; tp.action( &a ); }
cout << endl << endl; system( "pause" );
}
int showMenu()
{
int t = -1;
while( t < 0 || t > 3 )
{
system( "cls" ); cout << "1. Incrementer\n2. Busy beaver\n3. Sort\n\n0. Quit";
cout << endl << endl << "Choose an action "; cin >> t;
}
return t;
}
void reset() { tp.reset(); at.reset(); }
void startMachine() { system( "cls" ); tp.clear( at.getBlank() ); tp.input( at.getInput() ); simulate(); }
tape tp; actionTable at; string files[7];
};
int main( int a, char* args[] ){ utm mm; mm.start(); return 0; }
|
Rewrite the snippet below in C++ so it works the same as the original C code. | #include <stdio.h>
#include <stdarg.h>
#include <stdlib.h>
#include <string.h>
enum {
LEFT,
RIGHT,
STAY
};
typedef struct {
int state1;
int symbol1;
int symbol2;
int dir;
int state2;
} transition_t;
typedef struct tape_t tape_t;
struct tape_t {
int symbol;
tape_t *left;
tape_t *right;
};
typedef struct {
int states_len;
char **states;
int final_states_len;
int *final_states;
int symbols_len;
char *symbols;
int blank;
int state;
int tape_len;
tape_t *tape;
int transitions_len;
transition_t ***transitions;
} turing_t;
int state_index (turing_t *t, char *state) {
int i;
for (i = 0; i < t->states_len; i++) {
if (!strcmp(t->states[i], state)) {
return i;
}
}
return 0;
}
int symbol_index (turing_t *t, char symbol) {
int i;
for (i = 0; i < t->symbols_len; i++) {
if (t->symbols[i] == symbol) {
return i;
}
}
return 0;
}
void move (turing_t *t, int dir) {
tape_t *orig = t->tape;
if (dir == RIGHT) {
if (orig && orig->right) {
t->tape = orig->right;
}
else {
t->tape = calloc(1, sizeof (tape_t));
t->tape->symbol = t->blank;
if (orig) {
t->tape->left = orig;
orig->right = t->tape;
}
}
}
else if (dir == LEFT) {
if (orig && orig->left) {
t->tape = orig->left;
}
else {
t->tape = calloc(1, sizeof (tape_t));
t->tape->symbol = t->blank;
if (orig) {
t->tape->right = orig;
orig->left = t->tape;
}
}
}
}
turing_t *create (int states_len, ...) {
va_list args;
va_start(args, states_len);
turing_t *t = malloc(sizeof (turing_t));
t->states_len = states_len;
t->states = malloc(states_len * sizeof (char *));
int i;
for (i = 0; i < states_len; i++) {
t->states[i] = va_arg(args, char *);
}
t->final_states_len = va_arg(args, int);
t->final_states = malloc(t->final_states_len * sizeof (int));
for (i = 0; i < t->final_states_len; i++) {
t->final_states[i] = state_index(t, va_arg(args, char *));
}
t->symbols_len = va_arg(args, int);
t->symbols = malloc(t->symbols_len);
for (i = 0; i < t->symbols_len; i++) {
t->symbols[i] = va_arg(args, int);
}
t->blank = symbol_index(t, va_arg(args, int));
t->state = state_index(t, va_arg(args, char *));
t->tape_len = va_arg(args, int);
t->tape = NULL;
for (i = 0; i < t->tape_len; i++) {
move(t, RIGHT);
t->tape->symbol = symbol_index(t, va_arg(args, int));
}
if (!t->tape_len) {
move(t, RIGHT);
}
while (t->tape->left) {
t->tape = t->tape->left;
}
t->transitions_len = va_arg(args, int);
t->transitions = malloc(t->states_len * sizeof (transition_t **));
for (i = 0; i < t->states_len; i++) {
t->transitions[i] = malloc(t->symbols_len * sizeof (transition_t *));
}
for (i = 0; i < t->transitions_len; i++) {
transition_t *tran = malloc(sizeof (transition_t));
tran->state1 = state_index(t, va_arg(args, char *));
tran->symbol1 = symbol_index(t, va_arg(args, int));
tran->symbol2 = symbol_index(t, va_arg(args, int));
tran->dir = va_arg(args, int);
tran->state2 = state_index(t, va_arg(args, char *));
t->transitions[tran->state1][tran->symbol1] = tran;
}
va_end(args);
return t;
}
void print_state (turing_t *t) {
printf("%-10s ", t->states[t->state]);
tape_t *tape = t->tape;
while (tape->left) {
tape = tape->left;
}
while (tape) {
if (tape == t->tape) {
printf("[%c]", t->symbols[tape->symbol]);
}
else {
printf(" %c ", t->symbols[tape->symbol]);
}
tape = tape->right;
}
printf("\n");
}
void run (turing_t *t) {
int i;
while (1) {
print_state(t);
for (i = 0; i < t->final_states_len; i++) {
if (t->final_states[i] == t->state) {
return;
}
}
transition_t *tran = t->transitions[t->state][t->tape->symbol];
t->tape->symbol = tran->symbol2;
move(t, tran->dir);
t->state = tran->state2;
}
}
int main () {
printf("Simple incrementer\n");
turing_t *t = create(
2, "q0", "qf",
1, "qf",
2, 'B', '1',
'B',
"q0",
3, '1', '1', '1',
2,
"q0", '1', '1', RIGHT, "q0",
"q0", 'B', '1', STAY, "qf"
);
run(t);
printf("\nThree-state busy beaver\n");
t = create(
4, "a", "b", "c", "halt",
1, "halt",
2, '0', '1',
'0',
"a",
0,
6,
"a", '0', '1', RIGHT, "b",
"a", '1', '1', LEFT, "c",
"b", '0', '1', LEFT, "a",
"b", '1', '1', RIGHT, "b",
"c", '0', '1', LEFT, "b",
"c", '1', '1', STAY, "halt"
);
run(t);
return 0;
printf("\nFive-state two-symbol probable busy beaver\n");
t = create(
6, "A", "B", "C", "D", "E", "H",
1, "H",
2, '0', '1',
'0',
"A",
0,
10,
"A", '0', '1', RIGHT, "B",
"A", '1', '1', LEFT, "C",
"B", '0', '1', RIGHT, "C",
"B", '1', '1', RIGHT, "B",
"C", '0', '1', RIGHT, "D",
"C", '1', '0', LEFT, "E",
"D", '0', '1', LEFT, "A",
"D", '1', '1', LEFT, "D",
"E", '0', '1', STAY, "H",
"E", '1', '0', LEFT, "A"
);
run(t);
}
| #include <vector>
#include <string>
#include <iostream>
#include <algorithm>
#include <fstream>
#include <iomanip>
typedef unsigned int uint;
using namespace std;
const uint TAPE_MAX_LEN = 49152;
struct action { char write, direction; };
class tape
{
public:
tape( uint startPos = TAPE_MAX_LEN >> 1 ) : MAX_LEN( TAPE_MAX_LEN ) { _sp = startPos; reset(); }
void reset() { clear( '0' ); headPos = _sp; }
char read(){ return _t[headPos]; }
void input( string a ){ if( a == "" ) return; for( uint s = 0; s < a.length(); s++ ) _t[headPos + s] = a[s]; }
void clear( char c ) { _t.clear(); blk = c; _t.resize( MAX_LEN, blk ); }
void action( const action* a ) { write( a->write ); move( a->direction ); }
void print( int c = 10 )
{
int ml = static_cast<int>( MAX_LEN ), st = static_cast<int>( headPos ) - c, ed = static_cast<int>( headPos ) + c + 1, tx;
for( int x = st; x < ed; x++ )
{ tx = x; if( tx < 0 ) tx += ml; if( tx >= ml ) tx -= ml; cout << _t[tx]; }
cout << endl << setw( c + 1 ) << "^" << endl;
}
private:
void move( char d ) { if( d == 'N' ) return; headPos += d == 'R' ? 1 : -1; if( headPos >= MAX_LEN ) headPos = d == 'R' ? 0 : MAX_LEN - 1; }
void write( char a ) { if( a != 'N' ) { if( a == 'B' ) _t[headPos] = blk; else _t[headPos] = a; } }
string _t; uint headPos, _sp; char blk; const uint MAX_LEN;
};
class state
{
public:
bool operator ==( const string o ) { return o == name; }
string name, next; char symbol, write, direction;
};
class actionTable
{
public:
bool loadTable( string file )
{
reset();
ifstream mf; mf.open( file.c_str() ); if( mf.is_open() )
{
string str; state stt;
while( mf.good() )
{
getline( mf, str ); if( str[0] == '\'' ) break;
parseState( str, stt ); states.push_back( stt );
}
while( mf.good() )
{
getline( mf, str ); if( str == "" ) continue;
if( str[0] == '!' ) blank = str.erase( 0, 1 )[0];
if( str[0] == '^' ) curState = str.erase( 0, 1 );
if( str[0] == '>' ) input = str.erase( 0, 1 );
}
mf.close(); return true;
}
cout << "Could not open " << file << endl; return false;
}
bool action( char symbol, action& a )
{
vector<state>::iterator f = states.begin();
while( true )
{
f = find( f, states.end(), curState );
if( f == states.end() ) return false;
if( ( *f ).symbol == '*' || ( *f ).symbol == symbol || ( ( *f ).symbol == 'B' && blank == symbol ) )
{ a.direction = ( *f ).direction; a.write = ( *f ).write; curState = ( *f ).next; break; }
f++;
}
return true;
}
void reset() { states.clear(); blank = '0'; curState = input = ""; }
string getInput() { return input; }
char getBlank() { return blank; }
private:
void parseState( string str, state& stt )
{
string a[5]; int idx = 0;
for( string::iterator si = str.begin(); si != str.end(); si++ )
{ if( ( *si ) == ';' ) idx++; else a[idx].append( &( *si ), 1 ); }
stt.name = a[0]; stt.symbol = a[1][0]; stt.write = a[2][0]; stt.direction = a[3][0]; stt.next = a[4];
}
vector<state> states; char blank; string curState, input;
};
class utm
{
public:
utm() { files[0] = "incrementer.utm"; files[1] = "busy_beaver.utm"; files[2] = "sort.utm"; }
void start()
{
while( true )
{
reset(); int t = showMenu(); if( t == 0 ) return;
if( !at.loadTable( files[t - 1] ) ) return; startMachine();
}
}
private:
void simulate()
{
char r; action a;
while( true ) { tp.print(); r = tp.read(); if( !( at.action( r, a ) ) ) break; tp.action( &a ); }
cout << endl << endl; system( "pause" );
}
int showMenu()
{
int t = -1;
while( t < 0 || t > 3 )
{
system( "cls" ); cout << "1. Incrementer\n2. Busy beaver\n3. Sort\n\n0. Quit";
cout << endl << endl << "Choose an action "; cin >> t;
}
return t;
}
void reset() { tp.reset(); at.reset(); }
void startMachine() { system( "cls" ); tp.clear( at.getBlank() ); tp.input( at.getInput() ); simulate(); }
tape tp; actionTable at; string files[7];
};
int main( int a, char* args[] ){ utm mm; mm.start(); return 0; }
|
Change the programming language of this snippet from C to C++ without modifying what it does. | #include <stdio.h>
int main() {
FILE *fh = fopen("output.txt", "w");
fclose(fh);
return 0;
}
| #include <direct.h>
#include <fstream>
int main() {
std::fstream f("output.txt", std::ios::out);
f.close();
f.open("/output.txt", std::ios::out);
f.close();
_mkdir("docs");
_mkdir("/docs");
return 0;
}
|
Please provide an equivalent version of this C code in C++. | #include <assert.h>
#include <locale.h>
#include <stdbool.h>
#include <stdint.h>
#include <stdio.h>
#include <stdlib.h>
typedef struct bit_array_tag {
uint32_t size;
uint32_t* array;
} bit_array;
bool bit_array_create(bit_array* b, uint32_t size) {
uint32_t* array = calloc((size + 31)/32, sizeof(uint32_t));
if (array == NULL)
return false;
b->size = size;
b->array = array;
return true;
}
void bit_array_destroy(bit_array* b) {
free(b->array);
b->array = NULL;
}
void bit_array_set(bit_array* b, uint32_t index, bool value) {
assert(index < b->size);
uint32_t* p = &b->array[index >> 5];
uint32_t bit = 1 << (index & 31);
if (value)
*p |= bit;
else
*p &= ~bit;
}
bool bit_array_get(const bit_array* b, uint32_t index) {
assert(index < b->size);
uint32_t* p = &b->array[index >> 5];
uint32_t bit = 1 << (index & 31);
return (*p & bit) != 0;
}
typedef struct sieve_tag {
uint32_t limit;
bit_array not_prime;
} sieve;
bool sieve_create(sieve* s, uint32_t limit) {
if (!bit_array_create(&s->not_prime, limit/2))
return false;
for (uint32_t p = 3; p * p <= limit; p += 2) {
if (bit_array_get(&s->not_prime, p/2 - 1) == false) {
uint32_t inc = 2 * p;
for (uint32_t q = p * p; q <= limit; q += inc)
bit_array_set(&s->not_prime, q/2 - 1, true);
}
}
s->limit = limit;
return true;
}
void sieve_destroy(sieve* s) {
bit_array_destroy(&s->not_prime);
}
bool is_prime(const sieve* s, uint32_t n) {
assert(n <= s->limit);
if (n == 2)
return true;
if (n < 2 || n % 2 == 0)
return false;
return bit_array_get(&s->not_prime, n/2 - 1) == false;
}
uint32_t count_digits(uint32_t n) {
uint32_t digits = 0;
for (; n > 0; ++digits)
n /= 10;
return digits;
}
uint32_t change_digit(uint32_t n, uint32_t index, uint32_t new_digit) {
uint32_t p = 1;
uint32_t changed = 0;
for (; index > 0; p *= 10, n /= 10, --index)
changed += p * (n % 10);
changed += (10 * (n/10) + new_digit) * p;
return changed;
}
bool unprimeable(const sieve* s, uint32_t n) {
if (is_prime(s, n))
return false;
uint32_t d = count_digits(n);
for (uint32_t i = 0; i < d; ++i) {
for (uint32_t j = 0; j <= 9; ++j) {
uint32_t m = change_digit(n, i, j);
if (m != n && is_prime(s, m))
return false;
}
}
return true;
}
int main() {
const uint32_t limit = 10000000;
setlocale(LC_ALL, "");
sieve s = { 0 };
if (!sieve_create(&s, limit)) {
fprintf(stderr, "Out of memory\n");
return 1;
}
printf("First 35 unprimeable numbers:\n");
uint32_t n = 100;
uint32_t lowest[10] = { 0 };
for (uint32_t count = 0, found = 0; n < limit && (found < 10 || count < 600); ++n) {
if (unprimeable(&s, n)) {
if (count < 35) {
if (count != 0)
printf(", ");
printf("%'u", n);
}
++count;
if (count == 600)
printf("\n600th unprimeable number: %'u\n", n);
uint32_t last_digit = n % 10;
if (lowest[last_digit] == 0) {
lowest[last_digit] = n;
++found;
}
}
}
sieve_destroy(&s);
for (uint32_t i = 0; i < 10; ++i)
printf("Least unprimeable number ending in %u: %'u\n" , i, lowest[i]);
return 0;
}
| #include <iostream>
#include <cstdint>
#include "prime_sieve.hpp"
typedef uint32_t integer;
int count_digits(integer n) {
int digits = 0;
for (; n > 0; ++digits)
n /= 10;
return digits;
}
integer change_digit(integer n, int index, int new_digit) {
integer p = 1;
integer changed = 0;
for (; index > 0; p *= 10, n /= 10, --index)
changed += p * (n % 10);
changed += (10 * (n/10) + new_digit) * p;
return changed;
}
bool unprimeable(const prime_sieve& sieve, integer n) {
if (sieve.is_prime(n))
return false;
int d = count_digits(n);
for (int i = 0; i < d; ++i) {
for (int j = 0; j <= 9; ++j) {
integer m = change_digit(n, i, j);
if (m != n && sieve.is_prime(m))
return false;
}
}
return true;
}
int main() {
const integer limit = 10000000;
prime_sieve sieve(limit);
std::cout.imbue(std::locale(""));
std::cout << "First 35 unprimeable numbers:\n";
integer n = 100;
integer lowest[10] = { 0 };
for (int count = 0, found = 0; n < limit && (found < 10 || count < 600); ++n) {
if (unprimeable(sieve, n)) {
if (count < 35) {
if (count != 0)
std::cout << ", ";
std::cout << n;
}
++count;
if (count == 600)
std::cout << "\n600th unprimeable number: " << n << '\n';
int last_digit = n % 10;
if (lowest[last_digit] == 0) {
lowest[last_digit] = n;
++found;
}
}
}
for (int i = 0; i < 10; ++i)
std::cout << "Least unprimeable number ending in " << i << ": " << lowest[i] << '\n';
return 0;
}
|
Convert this C snippet to C++ and keep its semantics consistent. |
#include <stdio.h>
#include <math.h>
void pascal(int a, int b, int mid, int top, int* x, int* y, int* z)
{
double ytemp = (top - 4 * (a + b)) / 7.;
if(fmod(ytemp, 1.) >= 0.0001)
{
x = 0;
return;
}
*y = ytemp;
*x = mid - 2 * a - *y;
*z = *y - *x;
}
int main()
{
int a = 11, b = 4, mid = 40, top = 151;
int x, y, z;
pascal(a, b, mid, top, &x, &y, &z);
if(x != 0)
printf("x: %d, y: %d, z: %d\n", x, y, z);
else printf("No solution\n");
return 0;
}
| #include <iostream>
#include <iomanip>
inline int sign(int i) {
return i < 0 ? -1 : i > 0;
}
inline int& E(int *x, int row, int col) {
return x[row * (row + 1) / 2 + col];
}
int iter(int *v, int *diff) {
E(v, 0, 0) = 151;
E(v, 2, 0) = 40;
E(v, 4, 1) = 11;
E(v, 4, 3) = 4;
for (auto i = 1u; i < 5u; i++)
for (auto j = 0u; j <= i; j++) {
E(diff, i, j) = 0;
if (j < i)
E(diff, i, j) += E(v, i - 1, j) - E(v, i, j + 1) - E(v, i, j);
if (j)
E(diff, i, j) += E(v, i - 1, j - 1) - E(v, i, j - 1) - E(v, i, j);
}
for (auto i = 0u; i < 4u; i++)
for (auto j = 0u; j < i; j++)
E(diff, i, j) += E(v, i + 1, j) + E(v, i + 1, j + 1) - E(v, i, j);
E(diff, 4, 2) += E(v, 4, 0) + E(v, 4, 4) - E(v, 4, 2);
uint sum;
int e = 0;
for (auto i = sum = 0u; i < 15u; i++) {
sum += !!sign(e = diff[i]);
if (e >= 4 || e <= -4)
v[i] += e / 5;
else if (rand() < RAND_MAX / 4)
v[i] += sign(e);
}
return sum;
}
void show(int *x) {
for (auto i = 0u; i < 5u; i++)
for (auto j = 0u; j <= i; j++)
std::cout << std::setw(4u) << *(x++) << (j < i ? ' ' : '\n');
}
int main() {
int v[15] = { 0 }, diff[15] = { 0 };
for (auto i = 1u, s = 1u; s; i++) {
s = iter(v, diff);
std::cout << "pass " << i << ": " << s << std::endl;
}
show(v);
return 0;
}
|
Translate the given C code snippet into C++ without altering its behavior. |
#include <stdio.h>
#include <math.h>
void pascal(int a, int b, int mid, int top, int* x, int* y, int* z)
{
double ytemp = (top - 4 * (a + b)) / 7.;
if(fmod(ytemp, 1.) >= 0.0001)
{
x = 0;
return;
}
*y = ytemp;
*x = mid - 2 * a - *y;
*z = *y - *x;
}
int main()
{
int a = 11, b = 4, mid = 40, top = 151;
int x, y, z;
pascal(a, b, mid, top, &x, &y, &z);
if(x != 0)
printf("x: %d, y: %d, z: %d\n", x, y, z);
else printf("No solution\n");
return 0;
}
| #include <iostream>
#include <iomanip>
inline int sign(int i) {
return i < 0 ? -1 : i > 0;
}
inline int& E(int *x, int row, int col) {
return x[row * (row + 1) / 2 + col];
}
int iter(int *v, int *diff) {
E(v, 0, 0) = 151;
E(v, 2, 0) = 40;
E(v, 4, 1) = 11;
E(v, 4, 3) = 4;
for (auto i = 1u; i < 5u; i++)
for (auto j = 0u; j <= i; j++) {
E(diff, i, j) = 0;
if (j < i)
E(diff, i, j) += E(v, i - 1, j) - E(v, i, j + 1) - E(v, i, j);
if (j)
E(diff, i, j) += E(v, i - 1, j - 1) - E(v, i, j - 1) - E(v, i, j);
}
for (auto i = 0u; i < 4u; i++)
for (auto j = 0u; j < i; j++)
E(diff, i, j) += E(v, i + 1, j) + E(v, i + 1, j + 1) - E(v, i, j);
E(diff, 4, 2) += E(v, 4, 0) + E(v, 4, 4) - E(v, 4, 2);
uint sum;
int e = 0;
for (auto i = sum = 0u; i < 15u; i++) {
sum += !!sign(e = diff[i]);
if (e >= 4 || e <= -4)
v[i] += e / 5;
else if (rand() < RAND_MAX / 4)
v[i] += sign(e);
}
return sum;
}
void show(int *x) {
for (auto i = 0u; i < 5u; i++)
for (auto j = 0u; j <= i; j++)
std::cout << std::setw(4u) << *(x++) << (j < i ? ' ' : '\n');
}
int main() {
int v[15] = { 0 }, diff[15] = { 0 };
for (auto i = 1u, s = 1u; s; i++) {
s = iter(v, diff);
std::cout << "pass " << i << ": " << s << std::endl;
}
show(v);
return 0;
}
|
Convert this C snippet to C++ and keep its semantics consistent. | #include <stdio.h>
#include <stdlib.h>
#include <gmp.h>
typedef unsigned long long int u64;
#define TRUE 1
#define FALSE 0
int primality_pretest(u64 k) {
if (!(k % 3) || !(k % 5) || !(k % 7) || !(k % 11) || !(k % 13) || !(k % 17) || !(k % 19) || !(k % 23)) return (k <= 23);
return TRUE;
}
int probprime(u64 k, mpz_t n) {
mpz_set_ui(n, k);
return mpz_probab_prime_p(n, 0);
}
int is_chernick(int n, u64 m, mpz_t z) {
u64 t = 9 * m;
if (primality_pretest(6 * m + 1) == FALSE) return FALSE;
if (primality_pretest(12 * m + 1) == FALSE) return FALSE;
for (int i = 1; i <= n - 2; i++) if (primality_pretest((t << i) + 1) == FALSE) return FALSE;
if (probprime(6 * m + 1, z) == FALSE) return FALSE;
if (probprime(12 * m + 1, z) == FALSE) return FALSE;
for (int i = 1; i <= n - 2; i++) if (probprime((t << i) + 1, z) == FALSE) return FALSE;
return TRUE;
}
int main(int argc, char const *argv[]) {
mpz_t z;
mpz_inits(z, NULL);
for (int n = 3; n <= 10; n ++) {
u64 multiplier = (n > 4) ? (1 << (n - 4)) : 1;
if (n > 5) multiplier *= 5;
for (u64 k = 1; ; k++) {
u64 m = k * multiplier;
if (is_chernick(n, m, z) == TRUE) {
printf("a(%d) has m = %llu\n", n, m);
break;
}
}
}
return 0;
}
| #include <gmp.h>
#include <iostream>
using namespace std;
typedef unsigned long long int u64;
bool primality_pretest(u64 k) {
if (!(k % 3) || !(k % 5) || !(k % 7) || !(k % 11) ||
!(k % 13) || !(k % 17) || !(k % 19) || !(k % 23)
) {
return (k <= 23);
}
return true;
}
bool probprime(u64 k, mpz_t n) {
mpz_set_ui(n, k);
return mpz_probab_prime_p(n, 0);
}
bool is_chernick(int n, u64 m, mpz_t z) {
if (!primality_pretest(6 * m + 1)) {
return false;
}
if (!primality_pretest(12 * m + 1)) {
return false;
}
u64 t = 9 * m;
for (int i = 1; i <= n - 2; i++) {
if (!primality_pretest((t << i) + 1)) {
return false;
}
}
if (!probprime(6 * m + 1, z)) {
return false;
}
if (!probprime(12 * m + 1, z)) {
return false;
}
for (int i = 1; i <= n - 2; i++) {
if (!probprime((t << i) + 1, z)) {
return false;
}
}
return true;
}
int main() {
mpz_t z;
mpz_inits(z, NULL);
for (int n = 3; n <= 10; n++) {
u64 multiplier = (n > 4) ? (1 << (n - 4)) : 1;
if (n > 5) {
multiplier *= 5;
}
for (u64 k = 1; ; k++) {
u64 m = k * multiplier;
if (is_chernick(n, m, z)) {
cout << "a(" << n << ") has m = " << m << endl;
break;
}
}
}
return 0;
}
|
Port the following code from C to C++ with equivalent syntax and logic. | #include <stdbool.h>
#include <stdio.h>
#include <stdlib.h>
const double EPS = 0.001;
const double EPS_SQUARE = 0.000001;
double side(double x1, double y1, double x2, double y2, double x, double y) {
return (y2 - y1) * (x - x1) + (-x2 + x1) * (y - y1);
}
bool naivePointInTriangle(double x1, double y1, double x2, double y2, double x3, double y3, double x, double y) {
double checkSide1 = side(x1, y1, x2, y2, x, y) >= 0;
double checkSide2 = side(x2, y2, x3, y3, x, y) >= 0;
double checkSide3 = side(x3, y3, x1, y1, x, y) >= 0;
return checkSide1 && checkSide2 && checkSide3;
}
bool pointInTriangleBoundingBox(double x1, double y1, double x2, double y2, double x3, double y3, double x, double y) {
double xMin = min(x1, min(x2, x3)) - EPS;
double xMax = max(x1, max(x2, x3)) + EPS;
double yMin = min(y1, min(y2, y3)) - EPS;
double yMax = max(y1, max(y2, y3)) + EPS;
return !(x < xMin || xMax < x || y < yMin || yMax < y);
}
double distanceSquarePointToSegment(double x1, double y1, double x2, double y2, double x, double y) {
double p1_p2_squareLength = (x2 - x1) * (x2 - x1) + (y2 - y1) * (y2 - y1);
double dotProduct = ((x - x1) * (x2 - x1) + (y - y1) * (y2 - y1)) / p1_p2_squareLength;
if (dotProduct < 0) {
return (x - x1) * (x - x1) + (y - y1) * (y - y1);
} else if (dotProduct <= 1) {
double p_p1_squareLength = (x1 - x) * (x1 - x) + (y1 - y) * (y1 - y);
return p_p1_squareLength - dotProduct * dotProduct * p1_p2_squareLength;
} else {
return (x - x2) * (x - x2) + (y - y2) * (y - y2);
}
}
bool accuratePointInTriangle(double x1, double y1, double x2, double y2, double x3, double y3, double x, double y) {
if (!pointInTriangleBoundingBox(x1, y1, x2, y2, x3, y3, x, y)) {
return false;
}
if (naivePointInTriangle(x1, y1, x2, y2, x3, y3, x, y)) {
return true;
}
if (distanceSquarePointToSegment(x1, y1, x2, y2, x, y) <= EPS_SQUARE) {
return true;
}
if (distanceSquarePointToSegment(x2, y2, x3, y3, x, y) <= EPS_SQUARE) {
return true;
}
if (distanceSquarePointToSegment(x3, y3, x1, y1, x, y) <= EPS_SQUARE) {
return true;
}
return false;
}
void printPoint(double x, double y) {
printf("(%f, %f)", x, y);
}
void printTriangle(double x1, double y1, double x2, double y2, double x3, double y3) {
printf("Triangle is [");
printPoint(x1, y1);
printf(", ");
printPoint(x2, y2);
printf(", ");
printPoint(x3, y3);
printf("] \n");
}
void test(double x1, double y1, double x2, double y2, double x3, double y3, double x, double y) {
printTriangle(x1, y1, x2, y2, x3, y3);
printf("Point ");
printPoint(x, y);
printf(" is within triangle? ");
if (accuratePointInTriangle(x1, y1, x2, y2, x3, y3, x, y)) {
printf("true\n");
} else {
printf("false\n");
}
}
int main() {
test(1.5, 2.4, 5.1, -3.1, -3.8, 1.2, 0, 0);
test(1.5, 2.4, 5.1, -3.1, -3.8, 1.2, 0, 1);
test(1.5, 2.4, 5.1, -3.1, -3.8, 1.2, 3, 1);
printf("\n");
test(0.1, 0.1111111111111111, 12.5, 33.333333333333336, 25, 11.11111111111111, 5.414285714285714, 14.349206349206348);
printf("\n");
test(0.1, 0.1111111111111111, 12.5, 33.333333333333336, -12.5, 16.666666666666668, 5.414285714285714, 14.349206349206348);
printf("\n");
return 0;
}
| #include <iostream>
const double EPS = 0.001;
const double EPS_SQUARE = EPS * EPS;
double side(double x1, double y1, double x2, double y2, double x, double y) {
return (y2 - y1) * (x - x1) + (-x2 + x1) * (y - y1);
}
bool naivePointInTriangle(double x1, double y1, double x2, double y2, double x3, double y3, double x, double y) {
double checkSide1 = side(x1, y1, x2, y2, x, y) >= 0;
double checkSide2 = side(x2, y2, x3, y3, x, y) >= 0;
double checkSide3 = side(x3, y3, x1, y1, x, y) >= 0;
return checkSide1 && checkSide2 && checkSide3;
}
bool pointInTriangleBoundingBox(double x1, double y1, double x2, double y2, double x3, double y3, double x, double y) {
double xMin = std::min(x1, std::min(x2, x3)) - EPS;
double xMax = std::max(x1, std::max(x2, x3)) + EPS;
double yMin = std::min(y1, std::min(y2, y3)) - EPS;
double yMax = std::max(y1, std::max(y2, y3)) + EPS;
return !(x < xMin || xMax < x || y < yMin || yMax < y);
}
double distanceSquarePointToSegment(double x1, double y1, double x2, double y2, double x, double y) {
double p1_p2_squareLength = (x2 - x1) * (x2 - x1) + (y2 - y1) * (y2 - y1);
double dotProduct = ((x - x1) * (x2 - x1) + (y - y1) * (y2 - y1)) / p1_p2_squareLength;
if (dotProduct < 0) {
return (x - x1) * (x - x1) + (y - y1) * (y - y1);
} else if (dotProduct <= 1) {
double p_p1_squareLength = (x1 - x) * (x1 - x) + (y1 - y) * (y1 - y);
return p_p1_squareLength - dotProduct * dotProduct * p1_p2_squareLength;
} else {
return (x - x2) * (x - x2) + (y - y2) * (y - y2);
}
}
bool accuratePointInTriangle(double x1, double y1, double x2, double y2, double x3, double y3, double x, double y) {
if (!pointInTriangleBoundingBox(x1, y1, x2, y2, x3, y3, x, y)) {
return false;
}
if (naivePointInTriangle(x1, y1, x2, y2, x3, y3, x, y)) {
return true;
}
if (distanceSquarePointToSegment(x1, y1, x2, y2, x, y) <= EPS_SQUARE) {
return true;
}
if (distanceSquarePointToSegment(x2, y2, x3, y3, x, y) <= EPS_SQUARE) {
return true;
}
if (distanceSquarePointToSegment(x3, y3, x1, y1, x, y) <= EPS_SQUARE) {
return true;
}
return false;
}
void printPoint(double x, double y) {
std::cout << '(' << x << ", " << y << ')';
}
void printTriangle(double x1, double y1, double x2, double y2, double x3, double y3) {
std::cout << "Triangle is [";
printPoint(x1, y1);
std::cout << ", ";
printPoint(x2, y2);
std::cout << ", ";
printPoint(x3, y3);
std::cout << "]\n";
}
void test(double x1, double y1, double x2, double y2, double x3, double y3, double x, double y) {
printTriangle(x1, y1, x2, y2, x3, y3);
std::cout << "Point ";
printPoint(x, y);
std::cout << " is within triangle? ";
if (accuratePointInTriangle(x1, y1, x2, y2, x3, y3, x, y)) {
std::cout << "true\n";
} else {
std::cout << "false\n";
}
}
int main() {
test(1.5, 2.4, 5.1, -3.1, -3.8, 1.2, 0, 0);
test(1.5, 2.4, 5.1, -3.1, -3.8, 1.2, 0, 1);
test(1.5, 2.4, 5.1, -3.1, -3.8, 1.2, 3, 1);
std::cout << '\n';
test(0.1, 0.1111111111111111, 12.5, 33.333333333333336, 25, 11.11111111111111, 5.414285714285714, 14.349206349206348);
std::cout << '\n';
test(0.1, 0.1111111111111111, 12.5, 33.333333333333336, -12.5, 16.666666666666668, 5.414285714285714, 14.349206349206348);
std::cout << '\n';
return 0;
}
|
Change the programming language of this snippet from C to C++ without modifying what it does. | #include <stdbool.h>
#include <stdio.h>
#include <stdlib.h>
const double EPS = 0.001;
const double EPS_SQUARE = 0.000001;
double side(double x1, double y1, double x2, double y2, double x, double y) {
return (y2 - y1) * (x - x1) + (-x2 + x1) * (y - y1);
}
bool naivePointInTriangle(double x1, double y1, double x2, double y2, double x3, double y3, double x, double y) {
double checkSide1 = side(x1, y1, x2, y2, x, y) >= 0;
double checkSide2 = side(x2, y2, x3, y3, x, y) >= 0;
double checkSide3 = side(x3, y3, x1, y1, x, y) >= 0;
return checkSide1 && checkSide2 && checkSide3;
}
bool pointInTriangleBoundingBox(double x1, double y1, double x2, double y2, double x3, double y3, double x, double y) {
double xMin = min(x1, min(x2, x3)) - EPS;
double xMax = max(x1, max(x2, x3)) + EPS;
double yMin = min(y1, min(y2, y3)) - EPS;
double yMax = max(y1, max(y2, y3)) + EPS;
return !(x < xMin || xMax < x || y < yMin || yMax < y);
}
double distanceSquarePointToSegment(double x1, double y1, double x2, double y2, double x, double y) {
double p1_p2_squareLength = (x2 - x1) * (x2 - x1) + (y2 - y1) * (y2 - y1);
double dotProduct = ((x - x1) * (x2 - x1) + (y - y1) * (y2 - y1)) / p1_p2_squareLength;
if (dotProduct < 0) {
return (x - x1) * (x - x1) + (y - y1) * (y - y1);
} else if (dotProduct <= 1) {
double p_p1_squareLength = (x1 - x) * (x1 - x) + (y1 - y) * (y1 - y);
return p_p1_squareLength - dotProduct * dotProduct * p1_p2_squareLength;
} else {
return (x - x2) * (x - x2) + (y - y2) * (y - y2);
}
}
bool accuratePointInTriangle(double x1, double y1, double x2, double y2, double x3, double y3, double x, double y) {
if (!pointInTriangleBoundingBox(x1, y1, x2, y2, x3, y3, x, y)) {
return false;
}
if (naivePointInTriangle(x1, y1, x2, y2, x3, y3, x, y)) {
return true;
}
if (distanceSquarePointToSegment(x1, y1, x2, y2, x, y) <= EPS_SQUARE) {
return true;
}
if (distanceSquarePointToSegment(x2, y2, x3, y3, x, y) <= EPS_SQUARE) {
return true;
}
if (distanceSquarePointToSegment(x3, y3, x1, y1, x, y) <= EPS_SQUARE) {
return true;
}
return false;
}
void printPoint(double x, double y) {
printf("(%f, %f)", x, y);
}
void printTriangle(double x1, double y1, double x2, double y2, double x3, double y3) {
printf("Triangle is [");
printPoint(x1, y1);
printf(", ");
printPoint(x2, y2);
printf(", ");
printPoint(x3, y3);
printf("] \n");
}
void test(double x1, double y1, double x2, double y2, double x3, double y3, double x, double y) {
printTriangle(x1, y1, x2, y2, x3, y3);
printf("Point ");
printPoint(x, y);
printf(" is within triangle? ");
if (accuratePointInTriangle(x1, y1, x2, y2, x3, y3, x, y)) {
printf("true\n");
} else {
printf("false\n");
}
}
int main() {
test(1.5, 2.4, 5.1, -3.1, -3.8, 1.2, 0, 0);
test(1.5, 2.4, 5.1, -3.1, -3.8, 1.2, 0, 1);
test(1.5, 2.4, 5.1, -3.1, -3.8, 1.2, 3, 1);
printf("\n");
test(0.1, 0.1111111111111111, 12.5, 33.333333333333336, 25, 11.11111111111111, 5.414285714285714, 14.349206349206348);
printf("\n");
test(0.1, 0.1111111111111111, 12.5, 33.333333333333336, -12.5, 16.666666666666668, 5.414285714285714, 14.349206349206348);
printf("\n");
return 0;
}
| #include <iostream>
const double EPS = 0.001;
const double EPS_SQUARE = EPS * EPS;
double side(double x1, double y1, double x2, double y2, double x, double y) {
return (y2 - y1) * (x - x1) + (-x2 + x1) * (y - y1);
}
bool naivePointInTriangle(double x1, double y1, double x2, double y2, double x3, double y3, double x, double y) {
double checkSide1 = side(x1, y1, x2, y2, x, y) >= 0;
double checkSide2 = side(x2, y2, x3, y3, x, y) >= 0;
double checkSide3 = side(x3, y3, x1, y1, x, y) >= 0;
return checkSide1 && checkSide2 && checkSide3;
}
bool pointInTriangleBoundingBox(double x1, double y1, double x2, double y2, double x3, double y3, double x, double y) {
double xMin = std::min(x1, std::min(x2, x3)) - EPS;
double xMax = std::max(x1, std::max(x2, x3)) + EPS;
double yMin = std::min(y1, std::min(y2, y3)) - EPS;
double yMax = std::max(y1, std::max(y2, y3)) + EPS;
return !(x < xMin || xMax < x || y < yMin || yMax < y);
}
double distanceSquarePointToSegment(double x1, double y1, double x2, double y2, double x, double y) {
double p1_p2_squareLength = (x2 - x1) * (x2 - x1) + (y2 - y1) * (y2 - y1);
double dotProduct = ((x - x1) * (x2 - x1) + (y - y1) * (y2 - y1)) / p1_p2_squareLength;
if (dotProduct < 0) {
return (x - x1) * (x - x1) + (y - y1) * (y - y1);
} else if (dotProduct <= 1) {
double p_p1_squareLength = (x1 - x) * (x1 - x) + (y1 - y) * (y1 - y);
return p_p1_squareLength - dotProduct * dotProduct * p1_p2_squareLength;
} else {
return (x - x2) * (x - x2) + (y - y2) * (y - y2);
}
}
bool accuratePointInTriangle(double x1, double y1, double x2, double y2, double x3, double y3, double x, double y) {
if (!pointInTriangleBoundingBox(x1, y1, x2, y2, x3, y3, x, y)) {
return false;
}
if (naivePointInTriangle(x1, y1, x2, y2, x3, y3, x, y)) {
return true;
}
if (distanceSquarePointToSegment(x1, y1, x2, y2, x, y) <= EPS_SQUARE) {
return true;
}
if (distanceSquarePointToSegment(x2, y2, x3, y3, x, y) <= EPS_SQUARE) {
return true;
}
if (distanceSquarePointToSegment(x3, y3, x1, y1, x, y) <= EPS_SQUARE) {
return true;
}
return false;
}
void printPoint(double x, double y) {
std::cout << '(' << x << ", " << y << ')';
}
void printTriangle(double x1, double y1, double x2, double y2, double x3, double y3) {
std::cout << "Triangle is [";
printPoint(x1, y1);
std::cout << ", ";
printPoint(x2, y2);
std::cout << ", ";
printPoint(x3, y3);
std::cout << "]\n";
}
void test(double x1, double y1, double x2, double y2, double x3, double y3, double x, double y) {
printTriangle(x1, y1, x2, y2, x3, y3);
std::cout << "Point ";
printPoint(x, y);
std::cout << " is within triangle? ";
if (accuratePointInTriangle(x1, y1, x2, y2, x3, y3, x, y)) {
std::cout << "true\n";
} else {
std::cout << "false\n";
}
}
int main() {
test(1.5, 2.4, 5.1, -3.1, -3.8, 1.2, 0, 0);
test(1.5, 2.4, 5.1, -3.1, -3.8, 1.2, 0, 1);
test(1.5, 2.4, 5.1, -3.1, -3.8, 1.2, 3, 1);
std::cout << '\n';
test(0.1, 0.1111111111111111, 12.5, 33.333333333333336, 25, 11.11111111111111, 5.414285714285714, 14.349206349206348);
std::cout << '\n';
test(0.1, 0.1111111111111111, 12.5, 33.333333333333336, -12.5, 16.666666666666668, 5.414285714285714, 14.349206349206348);
std::cout << '\n';
return 0;
}
|
Rewrite this program in C++ while keeping its functionality equivalent to the C version. | #include <stdio.h>
unsigned int divisor_count(unsigned int n) {
unsigned int total = 1;
for (; (n & 1) == 0; n >>= 1) {
++total;
}
for (unsigned int p = 3; p * p <= n; p += 2) {
unsigned int count = 1;
for (; n % p == 0; n /= p) {
++count;
}
total *= count;
}
if (n > 1) {
total *= 2;
}
return total;
}
int main() {
const unsigned int limit = 100;
unsigned int n;
printf("Count of divisors for the first %d positive integers:\n", limit);
for (n = 1; n <= limit; ++n) {
printf("%3d", divisor_count(n));
if (n % 20 == 0) {
printf("\n");
}
}
return 0;
}
| #include <iomanip>
#include <iostream>
unsigned int divisor_count(unsigned int n) {
unsigned int total = 1;
for (; (n & 1) == 0; n >>= 1)
++total;
for (unsigned int p = 3; p * p <= n; p += 2) {
unsigned int count = 1;
for (; n % p == 0; n /= p)
++count;
total *= count;
}
if (n > 1)
total *= 2;
return total;
}
int main() {
const unsigned int limit = 100;
std::cout << "Count of divisors for the first " << limit << " positive integers:\n";
for (unsigned int n = 1; n <= limit; ++n) {
std::cout << std::setw(3) << divisor_count(n);
if (n % 20 == 0)
std::cout << '\n';
}
}
|
Change the following C code into C++ without altering its purpose. | #include <stdio.h>
unsigned int divisor_count(unsigned int n) {
unsigned int total = 1;
for (; (n & 1) == 0; n >>= 1) {
++total;
}
for (unsigned int p = 3; p * p <= n; p += 2) {
unsigned int count = 1;
for (; n % p == 0; n /= p) {
++count;
}
total *= count;
}
if (n > 1) {
total *= 2;
}
return total;
}
int main() {
const unsigned int limit = 100;
unsigned int n;
printf("Count of divisors for the first %d positive integers:\n", limit);
for (n = 1; n <= limit; ++n) {
printf("%3d", divisor_count(n));
if (n % 20 == 0) {
printf("\n");
}
}
return 0;
}
| #include <iomanip>
#include <iostream>
unsigned int divisor_count(unsigned int n) {
unsigned int total = 1;
for (; (n & 1) == 0; n >>= 1)
++total;
for (unsigned int p = 3; p * p <= n; p += 2) {
unsigned int count = 1;
for (; n % p == 0; n /= p)
++count;
total *= count;
}
if (n > 1)
total *= 2;
return total;
}
int main() {
const unsigned int limit = 100;
std::cout << "Count of divisors for the first " << limit << " positive integers:\n";
for (unsigned int n = 1; n <= limit; ++n) {
std::cout << std::setw(3) << divisor_count(n);
if (n % 20 == 0)
std::cout << '\n';
}
}
|
Write a version of this C function in C++ with identical behavior. | #include <stdio.h>
int main()
{
int intspace;
int *address;
address = &intspace;
*address = 65535;
printf("%p: %08x (=%08x)\n", address, *address, intspace);
*((char*)address) = 0x00;
*((char*)address+1) = 0x00;
*((char*)address+2) = 0xff;
*((char*)address+3) = 0xff;
printf("%p: %08x (=%08x)\n", address, *address, intspace);
return 0;
}
| #include <string>
#include <iostream>
int main()
{
char* data = new char[sizeof(std::string)];
std::string* stringPtr = new (data) std::string("ABCD");
std::cout << *stringPtr << " 0x" << stringPtr << std::endl;
stringPtr->~basic_string();
stringPtr = new (data) std::string("123456");
std::cout << *stringPtr << " 0x" << stringPtr << std::endl;
stringPtr->~basic_string();
delete[] data;
}
|
Convert this C snippet to C++ and keep its semantics consistent. | #include <gmp.h>
int main(void)
{
mpz_t p, s;
mpz_init_set_ui(p, 1);
mpz_init_set_ui(s, 1);
for (int n = 1, i = 0; i < 20; n++) {
mpz_nextprime(s, s);
mpz_mul(p, p, s);
mpz_add_ui(p, p, 1);
if (mpz_probab_prime_p(p, 25)) {
mpz_sub_ui(p, p, 1);
gmp_printf("%d\n", n);
i++;
continue;
}
mpz_sub_ui(p, p, 2);
if (mpz_probab_prime_p(p, 25)) {
mpz_add_ui(p, p, 1);
gmp_printf("%d\n", n);
i++;
continue;
}
mpz_add_ui(p, p, 1);
}
mpz_clear(s);
mpz_clear(p);
}
| #include <cstdint>
#include <iostream>
#include <sstream>
#include <gmpxx.h>
typedef mpz_class integer;
bool is_probably_prime(const integer& n) {
return mpz_probab_prime_p(n.get_mpz_t(), 25) != 0;
}
bool is_prime(unsigned int n) {
if (n < 2)
return false;
if (n % 2 == 0)
return n == 2;
if (n % 3 == 0)
return n == 3;
for (unsigned int p = 5; p * p <= n; p += 4) {
if (n % p == 0)
return false;
p += 2;
if (n % p == 0)
return false;
}
return true;
}
int main() {
const unsigned int max = 20;
integer primorial = 1;
for (unsigned int p = 0, count = 0, index = 0; count < max; ++p) {
if (!is_prime(p))
continue;
primorial *= p;
++index;
if (is_probably_prime(primorial - 1) || is_probably_prime(primorial + 1)) {
if (count > 0)
std::cout << ' ';
std::cout << index;
++count;
}
}
std::cout << '\n';
return 0;
}
|
Generate an equivalent C++ version of this C code. | #include<string.h>
#include<stdlib.h>
#include<stdio.h>
typedef struct genome{
char* strand;
int length;
struct genome* next;
}genome;
genome* genomeData;
int totalLength = 0, Adenine = 0, Cytosine = 0, Guanine = 0, Thymine = 0;
int numDigits(int num){
int len = 1;
while(num>10){
num = num/10;
len++;
}
return len;
}
void buildGenome(char str[100]){
int len = strlen(str),i;
genome *genomeIterator, *newGenome;
totalLength += len;
for(i=0;i<len;i++){
switch(str[i]){
case 'A': Adenine++;
break;
case 'T': Thymine++;
break;
case 'C': Cytosine++;
break;
case 'G': Guanine++;
break;
};
}
if(genomeData==NULL){
genomeData = (genome*)malloc(sizeof(genome));
genomeData->strand = (char*)malloc(len*sizeof(char));
strcpy(genomeData->strand,str);
genomeData->length = len;
genomeData->next = NULL;
}
else{
genomeIterator = genomeData;
while(genomeIterator->next!=NULL)
genomeIterator = genomeIterator->next;
newGenome = (genome*)malloc(sizeof(genome));
newGenome->strand = (char*)malloc(len*sizeof(char));
strcpy(newGenome->strand,str);
newGenome->length = len;
newGenome->next = NULL;
genomeIterator->next = newGenome;
}
}
void printGenome(){
genome* genomeIterator = genomeData;
int width = numDigits(totalLength), len = 0;
printf("Sequence:\n");
while(genomeIterator!=NULL){
printf("\n%*d%3s%3s",width+1,len,":",genomeIterator->strand);
len += genomeIterator->length;
genomeIterator = genomeIterator->next;
}
printf("\n\nBase Count\n----------\n\n");
printf("%3c%3s%*d\n",'A',":",width+1,Adenine);
printf("%3c%3s%*d\n",'T',":",width+1,Thymine);
printf("%3c%3s%*d\n",'C',":",width+1,Cytosine);
printf("%3c%3s%*d\n",'G',":",width+1,Guanine);
printf("\n%3s%*d\n","Total:",width+1,Adenine + Thymine + Cytosine + Guanine);
free(genomeData);
}
int main(int argc,char** argv)
{
char str[100];
int counter = 0, len;
if(argc!=2){
printf("Usage : %s <Gene file name>\n",argv[0]);
return 0;
}
FILE *fp = fopen(argv[1],"r");
while(fscanf(fp,"%s",str)!=EOF)
buildGenome(str);
fclose(fp);
printGenome();
return 0;
}
| #include <map>
#include <string>
#include <iostream>
#include <iomanip>
const std::string DEFAULT_DNA = "CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATG"
"CTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTG"
"AGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGAT"
"GGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT"
"CGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGG"
"TCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA"
"TTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTAT"
"CGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTG"
"TCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGAC"
"GACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT";
class DnaBase {
public:
DnaBase(const std::string& dna = DEFAULT_DNA, int width = 50) : genome(dna), displayWidth(width) {
for (auto elm : dna) {
if (count.find(elm) == count.end())
count[elm] = 0;
++count[elm];
}
}
void viewGenome() {
std::cout << "Sequence:" << std::endl;
std::cout << std::endl;
int limit = genome.size() / displayWidth;
if (genome.size() % displayWidth != 0)
++limit;
for (int i = 0; i < limit; ++i) {
int beginPos = i * displayWidth;
std::cout << std::setw(4) << beginPos << " :" << std::setw(4) << genome.substr(beginPos, displayWidth) << std::endl;
}
std::cout << std::endl;
std::cout << "Base Count" << std::endl;
std::cout << "----------" << std::endl;
std::cout << std::endl;
int total = 0;
for (auto elm : count) {
std::cout << std::setw(4) << elm.first << " : " << elm.second << std::endl;
total += elm.second;
}
std::cout << std::endl;
std::cout << "Total: " << total << std::endl;
}
private:
std::string genome;
std::map<char, int> count;
int displayWidth;
};
int main(void) {
auto d = new DnaBase();
d->viewGenome();
delete d;
return 0;
}
|
Preserve the algorithm and functionality while converting the code from C to C++. | #include<string.h>
#include<stdlib.h>
#include<stdio.h>
typedef struct genome{
char* strand;
int length;
struct genome* next;
}genome;
genome* genomeData;
int totalLength = 0, Adenine = 0, Cytosine = 0, Guanine = 0, Thymine = 0;
int numDigits(int num){
int len = 1;
while(num>10){
num = num/10;
len++;
}
return len;
}
void buildGenome(char str[100]){
int len = strlen(str),i;
genome *genomeIterator, *newGenome;
totalLength += len;
for(i=0;i<len;i++){
switch(str[i]){
case 'A': Adenine++;
break;
case 'T': Thymine++;
break;
case 'C': Cytosine++;
break;
case 'G': Guanine++;
break;
};
}
if(genomeData==NULL){
genomeData = (genome*)malloc(sizeof(genome));
genomeData->strand = (char*)malloc(len*sizeof(char));
strcpy(genomeData->strand,str);
genomeData->length = len;
genomeData->next = NULL;
}
else{
genomeIterator = genomeData;
while(genomeIterator->next!=NULL)
genomeIterator = genomeIterator->next;
newGenome = (genome*)malloc(sizeof(genome));
newGenome->strand = (char*)malloc(len*sizeof(char));
strcpy(newGenome->strand,str);
newGenome->length = len;
newGenome->next = NULL;
genomeIterator->next = newGenome;
}
}
void printGenome(){
genome* genomeIterator = genomeData;
int width = numDigits(totalLength), len = 0;
printf("Sequence:\n");
while(genomeIterator!=NULL){
printf("\n%*d%3s%3s",width+1,len,":",genomeIterator->strand);
len += genomeIterator->length;
genomeIterator = genomeIterator->next;
}
printf("\n\nBase Count\n----------\n\n");
printf("%3c%3s%*d\n",'A',":",width+1,Adenine);
printf("%3c%3s%*d\n",'T',":",width+1,Thymine);
printf("%3c%3s%*d\n",'C',":",width+1,Cytosine);
printf("%3c%3s%*d\n",'G',":",width+1,Guanine);
printf("\n%3s%*d\n","Total:",width+1,Adenine + Thymine + Cytosine + Guanine);
free(genomeData);
}
int main(int argc,char** argv)
{
char str[100];
int counter = 0, len;
if(argc!=2){
printf("Usage : %s <Gene file name>\n",argv[0]);
return 0;
}
FILE *fp = fopen(argv[1],"r");
while(fscanf(fp,"%s",str)!=EOF)
buildGenome(str);
fclose(fp);
printGenome();
return 0;
}
| #include <map>
#include <string>
#include <iostream>
#include <iomanip>
const std::string DEFAULT_DNA = "CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATG"
"CTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTG"
"AGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGAT"
"GGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT"
"CGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGG"
"TCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA"
"TTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTAT"
"CGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTG"
"TCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGAC"
"GACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT";
class DnaBase {
public:
DnaBase(const std::string& dna = DEFAULT_DNA, int width = 50) : genome(dna), displayWidth(width) {
for (auto elm : dna) {
if (count.find(elm) == count.end())
count[elm] = 0;
++count[elm];
}
}
void viewGenome() {
std::cout << "Sequence:" << std::endl;
std::cout << std::endl;
int limit = genome.size() / displayWidth;
if (genome.size() % displayWidth != 0)
++limit;
for (int i = 0; i < limit; ++i) {
int beginPos = i * displayWidth;
std::cout << std::setw(4) << beginPos << " :" << std::setw(4) << genome.substr(beginPos, displayWidth) << std::endl;
}
std::cout << std::endl;
std::cout << "Base Count" << std::endl;
std::cout << "----------" << std::endl;
std::cout << std::endl;
int total = 0;
for (auto elm : count) {
std::cout << std::setw(4) << elm.first << " : " << elm.second << std::endl;
total += elm.second;
}
std::cout << std::endl;
std::cout << "Total: " << total << std::endl;
}
private:
std::string genome;
std::map<char, int> count;
int displayWidth;
};
int main(void) {
auto d = new DnaBase();
d->viewGenome();
delete d;
return 0;
}
|
Generate a C++ translation of this C snippet without changing its computational steps. | #include <pthread.h>
#include <stdio.h>
#include <stdlib.h>
#include <unistd.h>
#include <stdarg.h>
#define N 5
const char *names[N] = { "Aristotle", "Kant", "Spinoza", "Marx", "Russell" };
pthread_mutex_t forks[N];
#define M 5
const char *topic[M] = { "Spaghetti!", "Life", "Universe", "Everything", "Bathroom" };
#define lock pthread_mutex_lock
#define unlock pthread_mutex_unlock
#define xy(x, y) printf("\033[%d;%dH", x, y)
#define clear_eol(x) print(x, 12, "\033[K")
void print(int y, int x, const char *fmt, ...)
{
static pthread_mutex_t screen = PTHREAD_MUTEX_INITIALIZER;
va_list ap;
va_start(ap, fmt);
lock(&screen);
xy(y + 1, x), vprintf(fmt, ap);
xy(N + 1, 1), fflush(stdout);
unlock(&screen);
}
void eat(int id)
{
int f[2], ration, i;
f[0] = f[1] = id;
f[id & 1] = (id + 1) % N;
clear_eol(id);
print(id, 12, "..oO (forks, need forks)");
for (i = 0; i < 2; i++) {
lock(forks + f[i]);
if (!i) clear_eol(id);
print(id, 12 + (f[i] != id) * 6, "fork%d", f[i]);
sleep(1);
}
for (i = 0, ration = 3 + rand() % 8; i < ration; i++)
print(id, 24 + i * 4, "nom"), sleep(1);
for (i = 0; i < 2; i++) unlock(forks + f[i]);
}
void think(int id)
{
int i, t;
char buf[64] = {0};
do {
clear_eol(id);
sprintf(buf, "..oO (%s)", topic[t = rand() % M]);
for (i = 0; buf[i]; i++) {
print(id, i+12, "%c", buf[i]);
if (i < 5) usleep(200000);
}
usleep(500000 + rand() % 1000000);
} while (t);
}
void* philosophize(void *a)
{
int id = *(int*)a;
print(id, 1, "%10s", names[id]);
while(1) think(id), eat(id);
}
int main()
{
int i, id[N];
pthread_t tid[N];
for (i = 0; i < N; i++)
pthread_mutex_init(forks + (id[i] = i), 0);
for (i = 0; i < N; i++)
pthread_create(tid + i, 0, philosophize, id + i);
return pthread_join(tid[0], 0);
}
| #include <algorithm>
#include <array>
#include <chrono>
#include <iostream>
#include <mutex>
#include <random>
#include <string>
#include <string_view>
#include <thread>
const int timeScale = 42;
void Message(std::string_view message)
{
static std::mutex cout_mutex;
std::scoped_lock cout_lock(cout_mutex);
std::cout << message << std::endl;
}
struct Fork {
std::mutex mutex;
};
struct Dinner {
std::array<Fork, 5> forks;
~Dinner() { Message("Dinner is over"); }
};
class Philosopher
{
std::mt19937 rng{std::random_device {}()};
const std::string name;
Fork& left;
Fork& right;
std::thread worker;
void live();
void dine();
void ponder();
public:
Philosopher(std::string name_, Fork& l, Fork& r)
: name(std::move(name_)), left(l), right(r), worker(&Philosopher::live, this)
{}
~Philosopher()
{
worker.join();
Message(name + " went to sleep.");
}
};
void Philosopher::live()
{
for(;;)
{
{
std::scoped_lock dine_lock(left.mutex, right.mutex);
dine();
}
ponder();
}
}
void Philosopher::dine()
{
Message(name + " started eating.");
thread_local std::array<const char*, 3> foods {"chicken", "rice", "soda"};
thread_local std::array<const char*, 3> reactions {
"I like this %s!", "This %s is good.", "Mmm, %s..."
};
thread_local std::uniform_int_distribution<> dist(1, 6);
std::shuffle( foods.begin(), foods.end(), rng);
std::shuffle(reactions.begin(), reactions.end(), rng);
constexpr size_t buf_size = 64;
char buffer[buf_size];
for(int i = 0; i < 3; ++i) {
std::this_thread::sleep_for(std::chrono::milliseconds(dist(rng) * timeScale));
snprintf(buffer, buf_size, reactions[i], foods[i]);
Message(name + ": " + buffer);
}
std::this_thread::sleep_for(std::chrono::milliseconds(dist(rng)) * timeScale);
Message(name + " finished and left.");
}
void Philosopher::ponder()
{
static constexpr std::array<const char*, 5> topics {{
"politics", "art", "meaning of life", "source of morality", "how many straws makes a bale"
}};
thread_local std::uniform_int_distribution<> wait(1, 6);
thread_local std::uniform_int_distribution<> dist(0, topics.size() - 1);
while(dist(rng) > 0) {
std::this_thread::sleep_for(std::chrono::milliseconds(wait(rng) * 3 * timeScale));
Message(name + " is pondering about " + topics[dist(rng)] + ".");
}
std::this_thread::sleep_for(std::chrono::milliseconds(wait(rng) * 3 * timeScale));
Message(name + " is hungry again!");
}
int main()
{
Dinner dinner;
Message("Dinner started!");
std::array<Philosopher, 5> philosophers {{
{"Aristotle", dinner.forks[0], dinner.forks[1]},
{"Democritus", dinner.forks[1], dinner.forks[2]},
{"Plato", dinner.forks[2], dinner.forks[3]},
{"Pythagoras", dinner.forks[3], dinner.forks[4]},
{"Socrates", dinner.forks[4], dinner.forks[0]},
}};
Message("It is dark outside...");
}
|
Translate this program into C++ but keep the logic exactly as in C. | #include <stdio.h>
int main() {
int n, b, d;
unsigned long long i, j, sum, fact[12];
fact[0] = 1;
for (n = 1; n < 12; ++n) {
fact[n] = fact[n-1] * n;
}
for (b = 9; b <= 12; ++b) {
printf("The factorions for base %d are:\n", b);
for (i = 1; i < 1500000; ++i) {
sum = 0;
j = i;
while (j > 0) {
d = j % b;
sum += fact[d];
j /= b;
}
if (sum == i) printf("%llu ", i);
}
printf("\n\n");
}
return 0;
}
| #include <iostream>
class factorion_t {
public:
factorion_t() {
f[0] = 1u;
for (uint n = 1u; n < 12u; n++)
f[n] = f[n - 1] * n;
}
bool operator()(uint i, uint b) const {
uint sum = 0;
for (uint j = i; j > 0u; j /= b)
sum += f[j % b];
return sum == i;
}
private:
ulong f[12];
};
int main() {
factorion_t factorion;
for (uint b = 9u; b <= 12u; ++b) {
std::cout << "factorions for base " << b << ':';
for (uint i = 1u; i < 1500000u; ++i)
if (factorion(i, b))
std::cout << ' ' << i;
std::cout << std::endl;
}
return 0;
}
|
Transform the following C implementation into C++, maintaining the same output and logic. | #include <stdio.h>
int main() {
int n, b, d;
unsigned long long i, j, sum, fact[12];
fact[0] = 1;
for (n = 1; n < 12; ++n) {
fact[n] = fact[n-1] * n;
}
for (b = 9; b <= 12; ++b) {
printf("The factorions for base %d are:\n", b);
for (i = 1; i < 1500000; ++i) {
sum = 0;
j = i;
while (j > 0) {
d = j % b;
sum += fact[d];
j /= b;
}
if (sum == i) printf("%llu ", i);
}
printf("\n\n");
}
return 0;
}
| #include <iostream>
class factorion_t {
public:
factorion_t() {
f[0] = 1u;
for (uint n = 1u; n < 12u; n++)
f[n] = f[n - 1] * n;
}
bool operator()(uint i, uint b) const {
uint sum = 0;
for (uint j = i; j > 0u; j /= b)
sum += f[j % b];
return sum == i;
}
private:
ulong f[12];
};
int main() {
factorion_t factorion;
for (uint b = 9u; b <= 12u; ++b) {
std::cout << "factorions for base " << b << ':';
for (uint i = 1u; i < 1500000u; ++i)
if (factorion(i, b))
std::cout << ' ' << i;
std::cout << std::endl;
}
return 0;
}
|
Convert the following code from C to C++, ensuring the logic remains intact. | #include <math.h>
#include <stdio.h>
const double K = 7.8e9;
const int n0 = 27;
const double actual[] = {
27, 27, 27, 44, 44, 59, 59, 59, 59, 59, 59, 59, 59, 60, 60,
61, 61, 66, 83, 219, 239, 392, 534, 631, 897, 1350, 2023, 2820,
4587, 6067, 7823, 9826, 11946, 14554, 17372, 20615, 24522, 28273,
31491, 34933, 37552, 40540, 43105, 45177, 60328, 64543, 67103,
69265, 71332, 73327, 75191, 75723, 76719, 77804, 78812, 79339,
80132, 80995, 82101, 83365, 85203, 87024, 89068, 90664, 93077,
95316, 98172, 102133, 105824, 109695, 114232, 118610, 125497,
133852, 143227, 151367, 167418, 180096, 194836, 213150, 242364,
271106, 305117, 338133, 377918, 416845, 468049, 527767, 591704,
656866, 715353, 777796, 851308, 928436, 1000249, 1082054, 1174652
};
const size_t actual_size = sizeof(actual) / sizeof(double);
double f(double r) {
double sq = 0;
size_t i;
for (i = 0; i < actual_size; ++i) {
double eri = exp(r * i);
double guess = (n0 * eri) / (1 + n0 * (eri - 1) / K);
double diff = guess - actual[i];
sq += diff * diff;
}
return sq;
}
double solve(double (*fn)(double), double guess, double epsilon) {
double delta, f0, factor;
for (delta = guess ? guess : 1, f0 = fn(guess), factor = 2;
delta > epsilon && guess != guess - delta;
delta *= factor) {
double nf = (*fn)(guess - delta);
if (nf < f0) {
f0 = nf;
guess -= delta;
} else {
nf = fn(guess + delta);
if (nf < f0) {
f0 = nf;
guess += delta;
} else {
factor = 0.5;
}
}
}
return guess;
}
double solve_default(double (*fn)(double)) {
return solve(fn, 0.5, 0);
}
int main() {
double r = solve_default(f);
double R0 = exp(12 * r);
printf("r = %f, R0 = %f\n", r, R0);
return 0;
}
| #include <cmath>
#include <functional>
#include <iostream>
constexpr double K = 7.8e9;
constexpr int n0 = 27;
constexpr double actual[] = {
27, 27, 27, 44, 44, 59, 59, 59, 59, 59, 59, 59, 59, 60, 60,
61, 61, 66, 83, 219, 239, 392, 534, 631, 897, 1350, 2023, 2820,
4587, 6067, 7823, 9826, 11946, 14554, 17372, 20615, 24522, 28273,
31491, 34933, 37552, 40540, 43105, 45177, 60328, 64543, 67103,
69265, 71332, 73327, 75191, 75723, 76719, 77804, 78812, 79339,
80132, 80995, 82101, 83365, 85203, 87024, 89068, 90664, 93077,
95316, 98172, 102133, 105824, 109695, 114232, 118610, 125497,
133852, 143227, 151367, 167418, 180096, 194836, 213150, 242364,
271106, 305117, 338133, 377918, 416845, 468049, 527767, 591704,
656866, 715353, 777796, 851308, 928436, 1000249, 1082054, 1174652
};
double f(double r) {
double sq = 0;
constexpr size_t len = std::size(actual);
for (size_t i = 0; i < len; ++i) {
double eri = std::exp(r * i);
double guess = (n0 * eri)/(1 + n0 * (eri - 1)/K);
double diff = guess - actual[i];
sq += diff * diff;
}
return sq;
}
double solve(std::function<double(double)> fn, double guess=0.5, double epsilon=0) {
for (double delta = guess ? guess : 1, f0 = fn(guess), factor = 2;
delta > epsilon && guess != guess - delta;
delta *= factor) {
double nf = fn(guess - delta);
if (nf < f0) {
f0 = nf;
guess -= delta;
} else {
nf = fn(guess + delta);
if (nf < f0) {
f0 = nf;
guess += delta;
} else
factor = 0.5;
}
}
return guess;
}
int main() {
double r = solve(f);
double R0 = std::exp(12 * r);
std::cout << "r = " << r << ", R0 = " << R0 << '\n';
return 0;
}
|
Maintain the same structure and functionality when rewriting this code in C++. | #include <stdio.h>
typedef struct node_t *node, node_t;
struct node_t { int v; node next; };
typedef struct { node head, tail; } slist;
void push(slist *l, node e) {
if (!l->head) l->head = e;
if (l->tail) l->tail->next = e;
l->tail = e;
}
node removehead(slist *l) {
node e = l->head;
if (e) {
l->head = e->next;
e->next = 0;
}
return e;
}
void join(slist *a, slist *b) {
push(a, b->head);
a->tail = b->tail;
}
void merge(slist *a, slist *b) {
slist r = {0};
while (a->head && b->head)
push(&r, removehead(a->head->v <= b->head->v ? a : b));
join(&r, a->head ? a : b);
*a = r;
b->head = b->tail = 0;
}
void sort(int *ar, int len)
{
node_t all[len];
for (int i = 0; i < len; i++)
all[i].v = ar[i], all[i].next = i < len - 1 ? all + i + 1 : 0;
slist list = {all, all + len - 1}, rem, strand = {0}, res = {0};
for (node e = 0; list.head; list = rem) {
rem.head = rem.tail = 0;
while ((e = removehead(&list)))
push((!strand.head || e->v >= strand.tail->v) ? &strand : &rem, e);
merge(&res, &strand);
}
for (int i = 0; res.head; i++, res.head = res.head->next)
ar[i] = res.head->v;
}
void show(const char *title, int *x, int len)
{
printf("%s ", title);
for (int i = 0; i < len; i++)
printf("%3d ", x[i]);
putchar('\n');
}
int main(void)
{
int x[] = {-2,0,-2,5,5,3,-1,-3,5,5,0,2,-4,4,2};
# define SIZE sizeof(x)/sizeof(int)
show("before sort:", x, SIZE);
sort(x, sizeof(x)/sizeof(int));
show("after sort: ", x, SIZE);
return 0;
}
| #include <list>
template <typename T>
std::list<T> strandSort(std::list<T> lst) {
if (lst.size() <= 1)
return lst;
std::list<T> result;
std::list<T> sorted;
while (!lst.empty()) {
sorted.push_back(lst.front());
lst.pop_front();
for (typename std::list<T>::iterator it = lst.begin(); it != lst.end(); ) {
if (sorted.back() <= *it) {
sorted.push_back(*it);
it = lst.erase(it);
} else
it++;
}
result.merge(sorted);
}
return result;
}
|
Please provide an equivalent version of this C code in C++. | #include <stdbool.h>
#include <stdio.h>
#include <string.h>
void memoizeIsPrime( bool * result, const int N )
{
result[2] = true;
result[3] = true;
int prime[N];
prime[0] = 3;
int end = 1;
for (int n = 5; n < N; n += 2)
{
bool n_is_prime = true;
for (int i = 0; i < end; ++i)
{
const int PRIME = prime[i];
if (n % PRIME == 0)
{
n_is_prime = false;
break;
}
if (PRIME * PRIME > n)
{
break;
}
}
if (n_is_prime)
{
prime[end++] = n;
result[n] = true;
}
}
}
int sumOfDecimalDigits( int n )
{
int sum = 0;
while (n > 0)
{
sum += n % 10;
n /= 10;
}
return sum;
}
int main( void )
{
const int N = 500;
printf( "Rosetta Code: additive primes less than %d:\n", N );
bool is_prime[N];
memset( is_prime, 0, sizeof(is_prime) );
memoizeIsPrime( is_prime, N );
printf( " 2" );
int count = 1;
for (int i = 3; i < N; i += 2)
{
if (is_prime[i] && is_prime[sumOfDecimalDigits( i )])
{
printf( "%4d", i );
++count;
if ((count % 10) == 0)
{
printf( "\n" );
}
}
}
printf( "\nThose were %d additive primes.\n", count );
return 0;
}
| #include <iomanip>
#include <iostream>
bool is_prime(unsigned int n) {
if (n < 2)
return false;
if (n % 2 == 0)
return n == 2;
if (n % 3 == 0)
return n == 3;
for (unsigned int p = 5; p * p <= n; p += 4) {
if (n % p == 0)
return false;
p += 2;
if (n % p == 0)
return false;
}
return true;
}
unsigned int digit_sum(unsigned int n) {
unsigned int sum = 0;
for (; n > 0; n /= 10)
sum += n % 10;
return sum;
}
int main() {
const unsigned int limit = 500;
std::cout << "Additive primes less than " << limit << ":\n";
unsigned int count = 0;
for (unsigned int n = 1; n < limit; ++n) {
if (is_prime(digit_sum(n)) && is_prime(n)) {
std::cout << std::setw(3) << n;
if (++count % 10 == 0)
std::cout << '\n';
else
std::cout << ' ';
}
}
std::cout << '\n' << count << " additive primes found.\n";
}
|
Convert this C snippet to C++ and keep its semantics consistent. | #include <stdio.h>
#include <stdlib.h>
#define otherwise do { register int _o = 2; do { switch (_o) { case 1:
#define given(Mc) ;case 0: break; case 2: _o = !!(Mc); continue; } break; } while (1); } while (0)
int foo() { return 1; }
main()
{
int a = 0;
otherwise a = 4 given (foo());
printf("%d\n", a);
exit(0);
}
| class invertedAssign {
int data;
public:
invertedAssign(int data):data(data){}
int getData(){return data;}
void operator=(invertedAssign& other) const {
other.data = this->data;
}
};
#include <iostream>
int main(){
invertedAssign a = 0;
invertedAssign b = 42;
std::cout << a.getData() << ' ' << b.getData() << '\n';
b = a;
std::cout << a.getData() << ' ' << b.getData() << '\n';
}
|
Change the programming language of this snippet from C to C++ without modifying what it does. | #include <stdio.h>
#include <stdlib.h>
#define otherwise do { register int _o = 2; do { switch (_o) { case 1:
#define given(Mc) ;case 0: break; case 2: _o = !!(Mc); continue; } break; } while (1); } while (0)
int foo() { return 1; }
main()
{
int a = 0;
otherwise a = 4 given (foo());
printf("%d\n", a);
exit(0);
}
| class invertedAssign {
int data;
public:
invertedAssign(int data):data(data){}
int getData(){return data;}
void operator=(invertedAssign& other) const {
other.data = this->data;
}
};
#include <iostream>
int main(){
invertedAssign a = 0;
invertedAssign b = 42;
std::cout << a.getData() << ' ' << b.getData() << '\n';
b = a;
std::cout << a.getData() << ' ' << b.getData() << '\n';
}
|
Generate an equivalent C++ version of this C code. | #include <stdio.h>
#include <stdlib.h>
#define otherwise do { register int _o = 2; do { switch (_o) { case 1:
#define given(Mc) ;case 0: break; case 2: _o = !!(Mc); continue; } break; } while (1); } while (0)
int foo() { return 1; }
main()
{
int a = 0;
otherwise a = 4 given (foo());
printf("%d\n", a);
exit(0);
}
| class invertedAssign {
int data;
public:
invertedAssign(int data):data(data){}
int getData(){return data;}
void operator=(invertedAssign& other) const {
other.data = this->data;
}
};
#include <iostream>
int main(){
invertedAssign a = 0;
invertedAssign b = 42;
std::cout << a.getData() << ' ' << b.getData() << '\n';
b = a;
std::cout << a.getData() << ' ' << b.getData() << '\n';
}
|
Ensure the translated C++ code behaves exactly like the original C snippet. | #include<stdlib.h>
#include<stdio.h>
long totient(long n){
long tot = n,i;
for(i=2;i*i<=n;i+=2){
if(n%i==0){
while(n%i==0)
n/=i;
tot-=tot/i;
}
if(i==2)
i=1;
}
if(n>1)
tot-=tot/n;
return tot;
}
long* perfectTotients(long n){
long *ptList = (long*)malloc(n*sizeof(long)), m,count=0,sum,tot;
for(m=1;count<n;m++){
tot = m;
sum = 0;
while(tot != 1){
tot = totient(tot);
sum += tot;
}
if(sum == m)
ptList[count++] = m;
}
return ptList;
}
long main(long argC, char* argV[])
{
long *ptList,i,n;
if(argC!=2)
printf("Usage : %s <number of perfect Totient numbers required>",argV[0]);
else{
n = atoi(argV[1]);
ptList = perfectTotients(n);
printf("The first %d perfect Totient numbers are : \n[",n);
for(i=0;i<n;i++)
printf(" %d,",ptList[i]);
printf("\b]");
}
return 0;
}
| #include <cassert>
#include <iostream>
#include <vector>
class totient_calculator {
public:
explicit totient_calculator(int max) : totient_(max + 1) {
for (int i = 1; i <= max; ++i)
totient_[i] = i;
for (int i = 2; i <= max; ++i) {
if (totient_[i] < i)
continue;
for (int j = i; j <= max; j += i)
totient_[j] -= totient_[j] / i;
}
}
int totient(int n) const {
assert (n >= 1 && n < totient_.size());
return totient_[n];
}
bool is_prime(int n) const {
return totient(n) == n - 1;
}
private:
std::vector<int> totient_;
};
bool perfect_totient_number(const totient_calculator& tc, int n) {
int sum = 0;
for (int m = n; m > 1; ) {
int t = tc.totient(m);
sum += t;
m = t;
}
return sum == n;
}
int main() {
totient_calculator tc(10000);
int count = 0, n = 1;
std::cout << "First 20 perfect totient numbers:\n";
for (; count < 20; ++n) {
if (perfect_totient_number(tc, n)) {
if (count > 0)
std::cout << ' ';
++count;
std::cout << n;
}
}
std::cout << '\n';
return 0;
}
|
Write a version of this C function in C++ with identical behavior. | #include<stdlib.h>
#include<stdio.h>
long totient(long n){
long tot = n,i;
for(i=2;i*i<=n;i+=2){
if(n%i==0){
while(n%i==0)
n/=i;
tot-=tot/i;
}
if(i==2)
i=1;
}
if(n>1)
tot-=tot/n;
return tot;
}
long* perfectTotients(long n){
long *ptList = (long*)malloc(n*sizeof(long)), m,count=0,sum,tot;
for(m=1;count<n;m++){
tot = m;
sum = 0;
while(tot != 1){
tot = totient(tot);
sum += tot;
}
if(sum == m)
ptList[count++] = m;
}
return ptList;
}
long main(long argC, char* argV[])
{
long *ptList,i,n;
if(argC!=2)
printf("Usage : %s <number of perfect Totient numbers required>",argV[0]);
else{
n = atoi(argV[1]);
ptList = perfectTotients(n);
printf("The first %d perfect Totient numbers are : \n[",n);
for(i=0;i<n;i++)
printf(" %d,",ptList[i]);
printf("\b]");
}
return 0;
}
| #include <cassert>
#include <iostream>
#include <vector>
class totient_calculator {
public:
explicit totient_calculator(int max) : totient_(max + 1) {
for (int i = 1; i <= max; ++i)
totient_[i] = i;
for (int i = 2; i <= max; ++i) {
if (totient_[i] < i)
continue;
for (int j = i; j <= max; j += i)
totient_[j] -= totient_[j] / i;
}
}
int totient(int n) const {
assert (n >= 1 && n < totient_.size());
return totient_[n];
}
bool is_prime(int n) const {
return totient(n) == n - 1;
}
private:
std::vector<int> totient_;
};
bool perfect_totient_number(const totient_calculator& tc, int n) {
int sum = 0;
for (int m = n; m > 1; ) {
int t = tc.totient(m);
sum += t;
m = t;
}
return sum == n;
}
int main() {
totient_calculator tc(10000);
int count = 0, n = 1;
std::cout << "First 20 perfect totient numbers:\n";
for (; count < 20; ++n) {
if (perfect_totient_number(tc, n)) {
if (count > 0)
std::cout << ' ';
++count;
std::cout << n;
}
}
std::cout << '\n';
return 0;
}
|
Produce a functionally identical C++ code for the snippet given in C. | #include<stdlib.h>
#include<stdio.h>
long totient(long n){
long tot = n,i;
for(i=2;i*i<=n;i+=2){
if(n%i==0){
while(n%i==0)
n/=i;
tot-=tot/i;
}
if(i==2)
i=1;
}
if(n>1)
tot-=tot/n;
return tot;
}
long* perfectTotients(long n){
long *ptList = (long*)malloc(n*sizeof(long)), m,count=0,sum,tot;
for(m=1;count<n;m++){
tot = m;
sum = 0;
while(tot != 1){
tot = totient(tot);
sum += tot;
}
if(sum == m)
ptList[count++] = m;
}
return ptList;
}
long main(long argC, char* argV[])
{
long *ptList,i,n;
if(argC!=2)
printf("Usage : %s <number of perfect Totient numbers required>",argV[0]);
else{
n = atoi(argV[1]);
ptList = perfectTotients(n);
printf("The first %d perfect Totient numbers are : \n[",n);
for(i=0;i<n;i++)
printf(" %d,",ptList[i]);
printf("\b]");
}
return 0;
}
| #include <cassert>
#include <iostream>
#include <vector>
class totient_calculator {
public:
explicit totient_calculator(int max) : totient_(max + 1) {
for (int i = 1; i <= max; ++i)
totient_[i] = i;
for (int i = 2; i <= max; ++i) {
if (totient_[i] < i)
continue;
for (int j = i; j <= max; j += i)
totient_[j] -= totient_[j] / i;
}
}
int totient(int n) const {
assert (n >= 1 && n < totient_.size());
return totient_[n];
}
bool is_prime(int n) const {
return totient(n) == n - 1;
}
private:
std::vector<int> totient_;
};
bool perfect_totient_number(const totient_calculator& tc, int n) {
int sum = 0;
for (int m = n; m > 1; ) {
int t = tc.totient(m);
sum += t;
m = t;
}
return sum == n;
}
int main() {
totient_calculator tc(10000);
int count = 0, n = 1;
std::cout << "First 20 perfect totient numbers:\n";
for (; count < 20; ++n) {
if (perfect_totient_number(tc, n)) {
if (count > 0)
std::cout << ' ';
++count;
std::cout << n;
}
}
std::cout << '\n';
return 0;
}
|
Keep all operations the same but rewrite the snippet in C++. | #include <stdio.h>
#include <stdlib.h>
#include <string.h>
typedef const char * (*Responder)( int p1);
typedef struct sDelegate {
Responder operation;
} *Delegate;
Delegate NewDelegate( Responder rspndr )
{
Delegate dl = malloc(sizeof(struct sDelegate));
dl->operation = rspndr;
return dl;
}
const char *DelegateThing(Delegate dl, int p1)
{
return (dl->operation)? (*dl->operation)(p1) : NULL;
}
typedef struct sDelegator {
int param;
char *phrase;
Delegate delegate;
} *Delegator;
const char * defaultResponse( int p1)
{
return "default implementation";
}
static struct sDelegate defaultDel = { &defaultResponse };
Delegator NewDelegator( int p, char *phrase)
{
Delegator d = malloc(sizeof(struct sDelegator));
d->param = p;
d->phrase = phrase;
d->delegate = &defaultDel;
return d;
}
const char *Delegator_Operation( Delegator theDelegator, int p1, Delegate delroy)
{
const char *rtn;
if (delroy) {
rtn = DelegateThing(delroy, p1);
if (!rtn) {
rtn = DelegateThing(theDelegator->delegate, p1);
}
}
else
rtn = DelegateThing(theDelegator->delegate, p1);
printf("%s\n", theDelegator->phrase );
return rtn;
}
const char *thing1( int p1)
{
printf("We're in thing1 with value %d\n" , p1);
return "delegate implementation";
}
int main()
{
Delegate del1 = NewDelegate(&thing1);
Delegate del2 = NewDelegate(NULL);
Delegator theDelegator = NewDelegator( 14, "A stellar vista, Baby.");
printf("Delegator returns %s\n\n",
Delegator_Operation( theDelegator, 3, NULL));
printf("Delegator returns %s\n\n",
Delegator_Operation( theDelegator, 3, del1));
printf("Delegator returns %s\n\n",
Delegator_Operation( theDelegator, 3, del2));
return 0;
}
| #include <tr1/memory>
#include <string>
#include <iostream>
#include <tr1/functional>
using namespace std;
using namespace std::tr1;
using std::tr1::function;
class IDelegate
{
public:
virtual ~IDelegate() {}
};
class IThing
{
public:
virtual ~IThing() {}
virtual std::string Thing() = 0;
};
class DelegateA : virtual public IDelegate
{
};
class DelegateB : public IThing, public IDelegate
{
std::string Thing()
{
return "delegate implementation";
}
};
class Delegator
{
public:
std::string Operation()
{
if(Delegate)
if (IThing * pThing = dynamic_cast<IThing*>(Delegate.get()))
return pThing->Thing();
return "default implementation";
}
shared_ptr<IDelegate> Delegate;
};
int main()
{
shared_ptr<DelegateA> delegateA(new DelegateA());
shared_ptr<DelegateB> delegateB(new DelegateB());
Delegator delegator;
std::cout << delegator.Operation() << std::endl;
delegator.Delegate = delegateA;
std::cout << delegator.Operation() << std::endl;
delegator.Delegate = delegateB;
std::cout << delegator.Operation() << std::endl;
}
|
Convert this C block to C++, preserving its control flow and logic. | #include <stdio.h>
unsigned int divisor_sum(unsigned int n) {
unsigned int total = 1, power = 2;
unsigned int p;
for (; (n & 1) == 0; power <<= 1, n >>= 1) {
total += power;
}
for (p = 3; p * p <= n; p += 2) {
unsigned int sum = 1;
for (power = p; n % p == 0; power *= p, n /= p) {
sum += power;
}
total *= sum;
}
if (n > 1) {
total *= n + 1;
}
return total;
}
int main() {
const unsigned int limit = 100;
unsigned int n;
printf("Sum of divisors for the first %d positive integers:\n", limit);
for (n = 1; n <= limit; ++n) {
printf("%4d", divisor_sum(n));
if (n % 10 == 0) {
printf("\n");
}
}
return 0;
}
| #include <iomanip>
#include <iostream>
unsigned int divisor_sum(unsigned int n) {
unsigned int total = 1, power = 2;
for (; (n & 1) == 0; power <<= 1, n >>= 1)
total += power;
for (unsigned int p = 3; p * p <= n; p += 2) {
unsigned int sum = 1;
for (power = p; n % p == 0; power *= p, n /= p)
sum += power;
total *= sum;
}
if (n > 1)
total *= n + 1;
return total;
}
int main() {
const unsigned int limit = 100;
std::cout << "Sum of divisors for the first " << limit << " positive integers:\n";
for (unsigned int n = 1; n <= limit; ++n) {
std::cout << std::setw(4) << divisor_sum(n);
if (n % 10 == 0)
std::cout << '\n';
}
}
|
Ensure the translated C++ code behaves exactly like the original C snippet. | #include <stdio.h>
unsigned int divisor_sum(unsigned int n) {
unsigned int total = 1, power = 2;
unsigned int p;
for (; (n & 1) == 0; power <<= 1, n >>= 1) {
total += power;
}
for (p = 3; p * p <= n; p += 2) {
unsigned int sum = 1;
for (power = p; n % p == 0; power *= p, n /= p) {
sum += power;
}
total *= sum;
}
if (n > 1) {
total *= n + 1;
}
return total;
}
int main() {
const unsigned int limit = 100;
unsigned int n;
printf("Sum of divisors for the first %d positive integers:\n", limit);
for (n = 1; n <= limit; ++n) {
printf("%4d", divisor_sum(n));
if (n % 10 == 0) {
printf("\n");
}
}
return 0;
}
| #include <iomanip>
#include <iostream>
unsigned int divisor_sum(unsigned int n) {
unsigned int total = 1, power = 2;
for (; (n & 1) == 0; power <<= 1, n >>= 1)
total += power;
for (unsigned int p = 3; p * p <= n; p += 2) {
unsigned int sum = 1;
for (power = p; n % p == 0; power *= p, n /= p)
sum += power;
total *= sum;
}
if (n > 1)
total *= n + 1;
return total;
}
int main() {
const unsigned int limit = 100;
std::cout << "Sum of divisors for the first " << limit << " positive integers:\n";
for (unsigned int n = 1; n <= limit; ++n) {
std::cout << std::setw(4) << divisor_sum(n);
if (n % 10 == 0)
std::cout << '\n';
}
}
|
Convert this C block to C++, preserving its control flow and logic. | #include <ctype.h>
#include <stdbool.h>
#include <stdio.h>
#include <stdlib.h>
#include <string.h>
const char* command_table =
"Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy "
"COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find "
"NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput "
"Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO "
"MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT "
"READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT "
"RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up";
typedef struct command_tag {
char* cmd;
size_t length;
size_t min_len;
struct command_tag* next;
} command_t;
bool command_match(const command_t* command, const char* str) {
size_t olen = strlen(str);
return olen >= command->min_len && olen <= command->length
&& strncmp(str, command->cmd, olen) == 0;
}
char* uppercase(char* str, size_t n) {
for (size_t i = 0; i < n; ++i)
str[i] = toupper((unsigned char)str[i]);
return str;
}
size_t get_min_length(const char* str, size_t n) {
size_t len = 0;
while (len < n && isupper((unsigned char)str[len]))
++len;
return len;
}
void fatal(const char* message) {
fprintf(stderr, "%s\n", message);
exit(1);
}
void* xmalloc(size_t n) {
void* ptr = malloc(n);
if (ptr == NULL)
fatal("Out of memory");
return ptr;
}
void* xrealloc(void* p, size_t n) {
void* ptr = realloc(p, n);
if (ptr == NULL)
fatal("Out of memory");
return ptr;
}
char** split_into_words(const char* str, size_t* count) {
size_t size = 0;
size_t capacity = 16;
char** words = xmalloc(capacity * sizeof(char*));
size_t len = strlen(str);
for (size_t begin = 0; begin < len; ) {
size_t i = begin;
for (; i < len && isspace((unsigned char)str[i]); ++i) {}
begin = i;
for (; i < len && !isspace((unsigned char)str[i]); ++i) {}
size_t word_len = i - begin;
if (word_len == 0)
break;
char* word = xmalloc(word_len + 1);
memcpy(word, str + begin, word_len);
word[word_len] = 0;
begin += word_len;
if (capacity == size) {
capacity *= 2;
words = xrealloc(words, capacity * sizeof(char*));
}
words[size++] = word;
}
*count = size;
return words;
}
command_t* make_command_list(const char* table) {
command_t* cmd = NULL;
size_t count = 0;
char** words = split_into_words(table, &count);
for (size_t i = 0; i < count; ++i) {
char* word = words[i];
command_t* new_cmd = xmalloc(sizeof(command_t));
size_t word_len = strlen(word);
new_cmd->length = word_len;
new_cmd->min_len = get_min_length(word, word_len);
new_cmd->cmd = uppercase(word, word_len);
new_cmd->next = cmd;
cmd = new_cmd;
}
free(words);
return cmd;
}
void free_command_list(command_t* cmd) {
while (cmd != NULL) {
command_t* next = cmd->next;
free(cmd->cmd);
free(cmd);
cmd = next;
}
}
const command_t* find_command(const command_t* commands, const char* word) {
for (const command_t* cmd = commands; cmd != NULL; cmd = cmd->next) {
if (command_match(cmd, word))
return cmd;
}
return NULL;
}
void test(const command_t* commands, const char* input) {
printf(" input: %s\n", input);
printf("output:");
size_t count = 0;
char** words = split_into_words(input, &count);
for (size_t i = 0; i < count; ++i) {
char* word = words[i];
uppercase(word, strlen(word));
const command_t* cmd_ptr = find_command(commands, word);
printf(" %s", cmd_ptr ? cmd_ptr->cmd : "*error*");
free(word);
}
free(words);
printf("\n");
}
int main() {
command_t* commands = make_command_list(command_table);
const char* input = "riG rePEAT copies put mo rest types fup. 6 poweRin";
test(commands, input);
free_command_list(commands);
return 0;
}
| #include <algorithm>
#include <cctype>
#include <iostream>
#include <sstream>
#include <string>
#include <vector>
const char* command_table =
"Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy "
"COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find "
"NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput "
"Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO "
"MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT "
"READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT "
"RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up";
class command {
public:
command(const std::string&, size_t);
const std::string& cmd() const { return cmd_; }
size_t min_length() const { return min_len_; }
bool match(const std::string&) const;
private:
std::string cmd_;
size_t min_len_;
};
command::command(const std::string& cmd, size_t min_len)
: cmd_(cmd), min_len_(min_len) {}
bool command::match(const std::string& str) const {
size_t olen = str.length();
return olen >= min_len_ && olen <= cmd_.length()
&& cmd_.compare(0, olen, str) == 0;
}
void uppercase(std::string& str) {
std::transform(str.begin(), str.end(), str.begin(),
[](unsigned char c) -> unsigned char { return std::toupper(c); });
}
size_t get_min_length(const std::string& str) {
size_t len = 0, n = str.length();
while (len < n && std::isupper(static_cast<unsigned char>(str[len])))
++len;
return len;
}
class command_list {
public:
explicit command_list(const char*);
const command* find_command(const std::string&) const;
private:
std::vector<command> commands_;
};
command_list::command_list(const char* table) {
std::vector<command> commands;
std::istringstream is(table);
std::string word;
while (is >> word) {
size_t len = get_min_length(word);
uppercase(word);
commands_.push_back(command(word, len));
}
}
const command* command_list::find_command(const std::string& word) const {
auto iter = std::find_if(commands_.begin(), commands_.end(),
[&word](const command& cmd) { return cmd.match(word); });
return (iter != commands_.end()) ? &*iter : nullptr;
}
std::string test(const command_list& commands, const std::string& input) {
std::string output;
std::istringstream is(input);
std::string word;
while (is >> word) {
if (!output.empty())
output += ' ';
uppercase(word);
const command* cmd_ptr = commands.find_command(word);
if (cmd_ptr)
output += cmd_ptr->cmd();
else
output += "*error*";
}
return output;
}
int main() {
command_list commands(command_table);
std::string input("riG rePEAT copies put mo rest types fup. 6 poweRin");
std::string output(test(commands, input));
std::cout << " input: " << input << '\n';
std::cout << "output: " << output << '\n';
return 0;
}
|
Preserve the algorithm and functionality while converting the code from C to C++. | #include <ctype.h>
#include <stdbool.h>
#include <stdio.h>
#include <stdlib.h>
#include <string.h>
const char* command_table =
"Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy "
"COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find "
"NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput "
"Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO "
"MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT "
"READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT "
"RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up";
typedef struct command_tag {
char* cmd;
size_t length;
size_t min_len;
struct command_tag* next;
} command_t;
bool command_match(const command_t* command, const char* str) {
size_t olen = strlen(str);
return olen >= command->min_len && olen <= command->length
&& strncmp(str, command->cmd, olen) == 0;
}
char* uppercase(char* str, size_t n) {
for (size_t i = 0; i < n; ++i)
str[i] = toupper((unsigned char)str[i]);
return str;
}
size_t get_min_length(const char* str, size_t n) {
size_t len = 0;
while (len < n && isupper((unsigned char)str[len]))
++len;
return len;
}
void fatal(const char* message) {
fprintf(stderr, "%s\n", message);
exit(1);
}
void* xmalloc(size_t n) {
void* ptr = malloc(n);
if (ptr == NULL)
fatal("Out of memory");
return ptr;
}
void* xrealloc(void* p, size_t n) {
void* ptr = realloc(p, n);
if (ptr == NULL)
fatal("Out of memory");
return ptr;
}
char** split_into_words(const char* str, size_t* count) {
size_t size = 0;
size_t capacity = 16;
char** words = xmalloc(capacity * sizeof(char*));
size_t len = strlen(str);
for (size_t begin = 0; begin < len; ) {
size_t i = begin;
for (; i < len && isspace((unsigned char)str[i]); ++i) {}
begin = i;
for (; i < len && !isspace((unsigned char)str[i]); ++i) {}
size_t word_len = i - begin;
if (word_len == 0)
break;
char* word = xmalloc(word_len + 1);
memcpy(word, str + begin, word_len);
word[word_len] = 0;
begin += word_len;
if (capacity == size) {
capacity *= 2;
words = xrealloc(words, capacity * sizeof(char*));
}
words[size++] = word;
}
*count = size;
return words;
}
command_t* make_command_list(const char* table) {
command_t* cmd = NULL;
size_t count = 0;
char** words = split_into_words(table, &count);
for (size_t i = 0; i < count; ++i) {
char* word = words[i];
command_t* new_cmd = xmalloc(sizeof(command_t));
size_t word_len = strlen(word);
new_cmd->length = word_len;
new_cmd->min_len = get_min_length(word, word_len);
new_cmd->cmd = uppercase(word, word_len);
new_cmd->next = cmd;
cmd = new_cmd;
}
free(words);
return cmd;
}
void free_command_list(command_t* cmd) {
while (cmd != NULL) {
command_t* next = cmd->next;
free(cmd->cmd);
free(cmd);
cmd = next;
}
}
const command_t* find_command(const command_t* commands, const char* word) {
for (const command_t* cmd = commands; cmd != NULL; cmd = cmd->next) {
if (command_match(cmd, word))
return cmd;
}
return NULL;
}
void test(const command_t* commands, const char* input) {
printf(" input: %s\n", input);
printf("output:");
size_t count = 0;
char** words = split_into_words(input, &count);
for (size_t i = 0; i < count; ++i) {
char* word = words[i];
uppercase(word, strlen(word));
const command_t* cmd_ptr = find_command(commands, word);
printf(" %s", cmd_ptr ? cmd_ptr->cmd : "*error*");
free(word);
}
free(words);
printf("\n");
}
int main() {
command_t* commands = make_command_list(command_table);
const char* input = "riG rePEAT copies put mo rest types fup. 6 poweRin";
test(commands, input);
free_command_list(commands);
return 0;
}
| #include <algorithm>
#include <cctype>
#include <iostream>
#include <sstream>
#include <string>
#include <vector>
const char* command_table =
"Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy "
"COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find "
"NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput "
"Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO "
"MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT "
"READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT "
"RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up";
class command {
public:
command(const std::string&, size_t);
const std::string& cmd() const { return cmd_; }
size_t min_length() const { return min_len_; }
bool match(const std::string&) const;
private:
std::string cmd_;
size_t min_len_;
};
command::command(const std::string& cmd, size_t min_len)
: cmd_(cmd), min_len_(min_len) {}
bool command::match(const std::string& str) const {
size_t olen = str.length();
return olen >= min_len_ && olen <= cmd_.length()
&& cmd_.compare(0, olen, str) == 0;
}
void uppercase(std::string& str) {
std::transform(str.begin(), str.end(), str.begin(),
[](unsigned char c) -> unsigned char { return std::toupper(c); });
}
size_t get_min_length(const std::string& str) {
size_t len = 0, n = str.length();
while (len < n && std::isupper(static_cast<unsigned char>(str[len])))
++len;
return len;
}
class command_list {
public:
explicit command_list(const char*);
const command* find_command(const std::string&) const;
private:
std::vector<command> commands_;
};
command_list::command_list(const char* table) {
std::vector<command> commands;
std::istringstream is(table);
std::string word;
while (is >> word) {
size_t len = get_min_length(word);
uppercase(word);
commands_.push_back(command(word, len));
}
}
const command* command_list::find_command(const std::string& word) const {
auto iter = std::find_if(commands_.begin(), commands_.end(),
[&word](const command& cmd) { return cmd.match(word); });
return (iter != commands_.end()) ? &*iter : nullptr;
}
std::string test(const command_list& commands, const std::string& input) {
std::string output;
std::istringstream is(input);
std::string word;
while (is >> word) {
if (!output.empty())
output += ' ';
uppercase(word);
const command* cmd_ptr = commands.find_command(word);
if (cmd_ptr)
output += cmd_ptr->cmd();
else
output += "*error*";
}
return output;
}
int main() {
command_list commands(command_table);
std::string input("riG rePEAT copies put mo rest types fup. 6 poweRin");
std::string output(test(commands, input));
std::cout << " input: " << input << '\n';
std::cout << "output: " << output << '\n';
return 0;
}
|
Generate an equivalent C++ version of this C code. | #include <ctype.h>
#include <stdbool.h>
#include <stdio.h>
#include <stdlib.h>
#include <string.h>
const char* command_table =
"Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy "
"COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find "
"NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput "
"Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO "
"MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT "
"READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT "
"RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up";
typedef struct command_tag {
char* cmd;
size_t length;
size_t min_len;
struct command_tag* next;
} command_t;
bool command_match(const command_t* command, const char* str) {
size_t olen = strlen(str);
return olen >= command->min_len && olen <= command->length
&& strncmp(str, command->cmd, olen) == 0;
}
char* uppercase(char* str, size_t n) {
for (size_t i = 0; i < n; ++i)
str[i] = toupper((unsigned char)str[i]);
return str;
}
size_t get_min_length(const char* str, size_t n) {
size_t len = 0;
while (len < n && isupper((unsigned char)str[len]))
++len;
return len;
}
void fatal(const char* message) {
fprintf(stderr, "%s\n", message);
exit(1);
}
void* xmalloc(size_t n) {
void* ptr = malloc(n);
if (ptr == NULL)
fatal("Out of memory");
return ptr;
}
void* xrealloc(void* p, size_t n) {
void* ptr = realloc(p, n);
if (ptr == NULL)
fatal("Out of memory");
return ptr;
}
char** split_into_words(const char* str, size_t* count) {
size_t size = 0;
size_t capacity = 16;
char** words = xmalloc(capacity * sizeof(char*));
size_t len = strlen(str);
for (size_t begin = 0; begin < len; ) {
size_t i = begin;
for (; i < len && isspace((unsigned char)str[i]); ++i) {}
begin = i;
for (; i < len && !isspace((unsigned char)str[i]); ++i) {}
size_t word_len = i - begin;
if (word_len == 0)
break;
char* word = xmalloc(word_len + 1);
memcpy(word, str + begin, word_len);
word[word_len] = 0;
begin += word_len;
if (capacity == size) {
capacity *= 2;
words = xrealloc(words, capacity * sizeof(char*));
}
words[size++] = word;
}
*count = size;
return words;
}
command_t* make_command_list(const char* table) {
command_t* cmd = NULL;
size_t count = 0;
char** words = split_into_words(table, &count);
for (size_t i = 0; i < count; ++i) {
char* word = words[i];
command_t* new_cmd = xmalloc(sizeof(command_t));
size_t word_len = strlen(word);
new_cmd->length = word_len;
new_cmd->min_len = get_min_length(word, word_len);
new_cmd->cmd = uppercase(word, word_len);
new_cmd->next = cmd;
cmd = new_cmd;
}
free(words);
return cmd;
}
void free_command_list(command_t* cmd) {
while (cmd != NULL) {
command_t* next = cmd->next;
free(cmd->cmd);
free(cmd);
cmd = next;
}
}
const command_t* find_command(const command_t* commands, const char* word) {
for (const command_t* cmd = commands; cmd != NULL; cmd = cmd->next) {
if (command_match(cmd, word))
return cmd;
}
return NULL;
}
void test(const command_t* commands, const char* input) {
printf(" input: %s\n", input);
printf("output:");
size_t count = 0;
char** words = split_into_words(input, &count);
for (size_t i = 0; i < count; ++i) {
char* word = words[i];
uppercase(word, strlen(word));
const command_t* cmd_ptr = find_command(commands, word);
printf(" %s", cmd_ptr ? cmd_ptr->cmd : "*error*");
free(word);
}
free(words);
printf("\n");
}
int main() {
command_t* commands = make_command_list(command_table);
const char* input = "riG rePEAT copies put mo rest types fup. 6 poweRin";
test(commands, input);
free_command_list(commands);
return 0;
}
| #include <algorithm>
#include <cctype>
#include <iostream>
#include <sstream>
#include <string>
#include <vector>
const char* command_table =
"Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy "
"COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find "
"NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput "
"Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO "
"MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT "
"READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT "
"RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up";
class command {
public:
command(const std::string&, size_t);
const std::string& cmd() const { return cmd_; }
size_t min_length() const { return min_len_; }
bool match(const std::string&) const;
private:
std::string cmd_;
size_t min_len_;
};
command::command(const std::string& cmd, size_t min_len)
: cmd_(cmd), min_len_(min_len) {}
bool command::match(const std::string& str) const {
size_t olen = str.length();
return olen >= min_len_ && olen <= cmd_.length()
&& cmd_.compare(0, olen, str) == 0;
}
void uppercase(std::string& str) {
std::transform(str.begin(), str.end(), str.begin(),
[](unsigned char c) -> unsigned char { return std::toupper(c); });
}
size_t get_min_length(const std::string& str) {
size_t len = 0, n = str.length();
while (len < n && std::isupper(static_cast<unsigned char>(str[len])))
++len;
return len;
}
class command_list {
public:
explicit command_list(const char*);
const command* find_command(const std::string&) const;
private:
std::vector<command> commands_;
};
command_list::command_list(const char* table) {
std::vector<command> commands;
std::istringstream is(table);
std::string word;
while (is >> word) {
size_t len = get_min_length(word);
uppercase(word);
commands_.push_back(command(word, len));
}
}
const command* command_list::find_command(const std::string& word) const {
auto iter = std::find_if(commands_.begin(), commands_.end(),
[&word](const command& cmd) { return cmd.match(word); });
return (iter != commands_.end()) ? &*iter : nullptr;
}
std::string test(const command_list& commands, const std::string& input) {
std::string output;
std::istringstream is(input);
std::string word;
while (is >> word) {
if (!output.empty())
output += ' ';
uppercase(word);
const command* cmd_ptr = commands.find_command(word);
if (cmd_ptr)
output += cmd_ptr->cmd();
else
output += "*error*";
}
return output;
}
int main() {
command_list commands(command_table);
std::string input("riG rePEAT copies put mo rest types fup. 6 poweRin");
std::string output(test(commands, input));
std::cout << " input: " << input << '\n';
std::cout << "output: " << output << '\n';
return 0;
}
|
Write a version of this C function in C++ with identical behavior. | #define PI 3.14159265358979323
#define MINSIZE 10
#define MAXSIZE 100
| #include <iostream>
class MyOtherClass
{
public:
const int m_x;
MyOtherClass(const int initX = 0) : m_x(initX) { }
};
int main()
{
MyOtherClass mocA, mocB(7);
std::cout << mocA.m_x << std::endl;
std::cout << mocB.m_x << std::endl;
return 0;
}
|
Preserve the algorithm and functionality while converting the code from C to C++. | #include <stdio.h>
#include <stdlib.h>
#include <math.h>
typedef struct { double x, y; } vec_t, *vec;
inline double dot(vec a, vec b)
{
return a->x * b->x + a->y * b->y;
}
inline double cross(vec a, vec b)
{
return a->x * b->y - a->y * b->x;
}
inline vec vsub(vec a, vec b, vec res)
{
res->x = a->x - b->x;
res->y = a->y - b->y;
return res;
}
int left_of(vec a, vec b, vec c)
{
vec_t tmp1, tmp2;
double x;
vsub(b, a, &tmp1);
vsub(c, b, &tmp2);
x = cross(&tmp1, &tmp2);
return x < 0 ? -1 : x > 0;
}
int line_sect(vec x0, vec x1, vec y0, vec y1, vec res)
{
vec_t dx, dy, d;
vsub(x1, x0, &dx);
vsub(y1, y0, &dy);
vsub(x0, y0, &d);
double dyx = cross(&dy, &dx);
if (!dyx) return 0;
dyx = cross(&d, &dx) / dyx;
if (dyx <= 0 || dyx >= 1) return 0;
res->x = y0->x + dyx * dy.x;
res->y = y0->y + dyx * dy.y;
return 1;
}
typedef struct { int len, alloc; vec v; } poly_t, *poly;
poly poly_new()
{
return (poly)calloc(1, sizeof(poly_t));
}
void poly_free(poly p)
{
free(p->v);
free(p);
}
void poly_append(poly p, vec v)
{
if (p->len >= p->alloc) {
p->alloc *= 2;
if (!p->alloc) p->alloc = 4;
p->v = (vec)realloc(p->v, sizeof(vec_t) * p->alloc);
}
p->v[p->len++] = *v;
}
int poly_winding(poly p)
{
return left_of(p->v, p->v + 1, p->v + 2);
}
void poly_edge_clip(poly sub, vec x0, vec x1, int left, poly res)
{
int i, side0, side1;
vec_t tmp;
vec v0 = sub->v + sub->len - 1, v1;
res->len = 0;
side0 = left_of(x0, x1, v0);
if (side0 != -left) poly_append(res, v0);
for (i = 0; i < sub->len; i++) {
v1 = sub->v + i;
side1 = left_of(x0, x1, v1);
if (side0 + side1 == 0 && side0)
if (line_sect(x0, x1, v0, v1, &tmp))
poly_append(res, &tmp);
if (i == sub->len - 1) break;
if (side1 != -left) poly_append(res, v1);
v0 = v1;
side0 = side1;
}
}
poly poly_clip(poly sub, poly clip)
{
int i;
poly p1 = poly_new(), p2 = poly_new(), tmp;
int dir = poly_winding(clip);
poly_edge_clip(sub, clip->v + clip->len - 1, clip->v, dir, p2);
for (i = 0; i < clip->len - 1; i++) {
tmp = p2; p2 = p1; p1 = tmp;
if(p1->len == 0) {
p2->len = 0;
break;
}
poly_edge_clip(p1, clip->v + i, clip->v + i + 1, dir, p2);
}
poly_free(p1);
return p2;
}
int main()
{
int i;
vec_t c[] = {{100,100}, {300,100}, {300,300}, {100,300}};
vec_t s[] = { {50,150}, {200,50}, {350,150},
{350,300},{250,300},{200,250},
{150,350},{100,250},{100,200}};
#define clen (sizeof(c)/sizeof(vec_t))
#define slen (sizeof(s)/sizeof(vec_t))
poly_t clipper = {clen, 0, c};
poly_t subject = {slen, 0, s};
poly res = poly_clip(&subject, &clipper);
for (i = 0; i < res->len; i++)
printf("%g %g\n", res->v[i].x, res->v[i].y);
FILE * eps = fopen("test.eps", "w");
fprintf(eps, "%%!PS-Adobe-3.0\n%%%%BoundingBox: 40 40 360 360\n"
"/l {lineto} def /m{moveto} def /s{setrgbcolor} def"
"/c {closepath} def /gs {fill grestore stroke} def\n");
fprintf(eps, "0 setlinewidth %g %g m ", c[0].x, c[0].y);
for (i = 1; i < clen; i++)
fprintf(eps, "%g %g l ", c[i].x, c[i].y);
fprintf(eps, "c .5 0 0 s gsave 1 .7 .7 s gs\n");
fprintf(eps, "%g %g m ", s[0].x, s[0].y);
for (i = 1; i < slen; i++)
fprintf(eps, "%g %g l ", s[i].x, s[i].y);
fprintf(eps, "c 0 .2 .5 s gsave .4 .7 1 s gs\n");
fprintf(eps, "2 setlinewidth [10 8] 0 setdash %g %g m ",
res->v[0].x, res->v[0].y);
for (i = 1; i < res->len; i++)
fprintf(eps, "%g %g l ", res->v[i].x, res->v[i].y);
fprintf(eps, "c .5 0 .5 s gsave .7 .3 .8 s gs\n");
fprintf(eps, "%%%%EOF");
fclose(eps);
printf("test.eps written\n");
return 0;
}
| #include <iostream>
#include <span>
#include <vector>
struct vec2 {
float x = 0.0f, y = 0.0f;
constexpr vec2 operator+(vec2 other) const {
return vec2{x + other.x, y + other.y};
}
constexpr vec2 operator-(vec2 other) const {
return vec2{x - other.x, y - other.y};
}
};
constexpr vec2 operator*(vec2 a, float b) { return vec2{a.x * b, a.y * b}; }
constexpr float dot(vec2 a, vec2 b) { return a.x * b.x + a.y * b.y; }
constexpr float cross(vec2 a, vec2 b) { return a.x * b.y - b.x * a.y; }
constexpr bool is_inside(vec2 point, vec2 a, vec2 b) {
return (cross(a - b, point) + cross(b, a)) < 0.0f;
}
constexpr vec2 intersection(vec2 a1, vec2 a2, vec2 b1, vec2 b2) {
return ((b1 - b2) * cross(a1, a2) - (a1 - a2) * cross(b1, b2)) *
(1.0f / cross(a1 - a2, b1 - b2));
}
std::vector<vec2> suther_land_hodgman(
std::span<vec2 const> subject_polygon, std::span<vec2 const> clip_polygon) {
if (clip_polygon.empty() || subject_polygon.empty()) {
return {};
}
std::vector<vec2> ring{subject_polygon.begin(), subject_polygon.end()};
vec2 p1 = clip_polygon[clip_polygon.size() - 1];
std::vector<vec2> input;
for (vec2 p2 : clip_polygon) {
input.clear();
input.insert(input.end(), ring.begin(), ring.end());
vec2 s = input[input.size() - 1];
ring.clear();
for (vec2 e : input) {
if (is_inside(e, p1, p2)) {
if (!is_inside(s, p1, p2)) {
ring.push_back(intersection(p1, p2, s, e));
}
ring.push_back(e);
} else if (is_inside(s, p1, p2)) {
ring.push_back(intersection(p1, p2, s, e));
}
s = e;
}
p1 = p2;
}
return ring;
}
int main(int argc, char **argv) {
vec2 subject_polygon[] = {{50, 150}, {200, 50}, {350, 150},
{350, 300}, {250, 300}, {200, 250},
{150, 350}, {100, 250}, {100, 200}};
vec2 clip_polygon[] = {{100, 100}, {300, 100}, {300, 300}, {100, 300}};
std::vector<vec2> clipped_polygon =
suther_land_hodgman(subject_polygon, clip_polygon);
std::cout << "Clipped polygon points:" << std::endl;
for (vec2 p : clipped_polygon) {
std::cout << "(" << p.x << ", " << p.y << ")" << std::endl;
}
return EXIT_SUCCESS;
}
|
Translate this program into C++ but keep the logic exactly as in C. | #include <stdio.h>
#include <string.h>
#include <stdlib.h>
char *codes[] = {
"AAAAA", "AAAAB", "AAABA", "AAABB", "AABAA",
"AABAB", "AABBA", "AABBB", "ABAAA", "ABAAB",
"ABABA", "ABABB", "ABBAA", "ABBAB", "ABBBA",
"ABBBB", "BAAAA", "BAAAB", "BAABA", "BAABB",
"BABAA", "BABAB", "BABBA", "BABBB", "BBAAA",
"BBAAB", "BBBAA"
};
char *get_code(const char c) {
if (c >= 97 && c <= 122) return codes[c - 97];
return codes[26];
}
char get_char(const char *code) {
int i;
if (!strcmp(codes[26], code)) return ' ';
for (i = 0; i < 26; ++i) {
if (strcmp(codes[i], code) == 0) return 97 + i;
}
printf("\nCode \"%s\" is invalid\n", code);
exit(1);
}
void str_tolower(char s[]) {
int i;
for (i = 0; i < strlen(s); ++i) s[i] = tolower(s[i]);
}
char *bacon_encode(char plain_text[], char message[]) {
int i, count;
int plen = strlen(plain_text), mlen = strlen(message);
int elen = 5 * plen;
char c;
char *p, *et, *mt;
et = malloc(elen + 1);
str_tolower(plain_text);
for (i = 0, p = et; i < plen; ++i, p += 5) {
c = plain_text[i];
strncpy(p, get_code(c), 5);
}
*++p = '\0';
str_tolower(message);
mt = calloc(mlen + 1, 1);
for (i = 0, count = 0; i < mlen; ++i) {
c = message[i];
if (c >= 'a' && c <= 'z') {
if (et[count] == 'A')
mt[i] = c;
else
mt[i] = c - 32;
if (++count == elen) break;
}
else mt[i] = c;
}
free(et);
return mt;
}
char *bacon_decode(char cipher_text[]) {
int i, count, clen = strlen(cipher_text);
int plen;
char *p, *ct, *pt;
char c, quintet[6];
ct = calloc(clen + 1, 1);
for (i = 0, count = 0; i < clen; ++i) {
c = cipher_text[i];
if (c >= 'a' && c <= 'z')
ct[count++] = 'A';
else if (c >= 'A' && c <= 'Z')
ct[count++] = 'B';
}
plen = strlen(ct) / 5;
pt = malloc(plen + 1);
for (i = 0, p = ct; i < plen; ++i, p += 5) {
strncpy(quintet, p, 5);
quintet[5] = '\0';
pt[i] = get_char(quintet);
}
pt[plen] = '\0';
free(ct);
return pt;
}
int main() {
char plain_text[] = "the quick brown fox jumps over the lazy dog";
char message[] = "bacon's cipher is a method of steganography created by francis bacon."
"this task is to implement a program for encryption and decryption of "
"plaintext using the simple alphabet of the baconian cipher or some "
"other kind of representation of this alphabet (make anything signify anything). "
"the baconian alphabet may optionally be extended to encode all lower "
"case characters individually and/or adding a few punctuation characters "
"such as the space.";
char *cipher_text, *hidden_text;
cipher_text = bacon_encode(plain_text, message);
printf("Cipher text ->\n\n%s\n", cipher_text);
hidden_text = bacon_decode(cipher_text);
printf("\nHidden text ->\n\n%s\n", hidden_text);
free(cipher_text);
free(hidden_text);
return 0;
}
| #include <iostream>
#include <algorithm>
#include <vector>
#include <bitset>
#include <string>
class bacon {
public:
bacon() {
int x = 0;
for( ; x < 9; x++ )
bAlphabet.push_back( std::bitset<5>( x ).to_string() );
bAlphabet.push_back( bAlphabet.back() );
for( ; x < 20; x++ )
bAlphabet.push_back( std::bitset<5>( x ).to_string() );
bAlphabet.push_back( bAlphabet.back() );
for( ; x < 24; x++ )
bAlphabet.push_back( std::bitset<5>( x ).to_string() );
}
std::string encode( std::string txt ) {
std::string r;
size_t z;
for( std::string::iterator i = txt.begin(); i != txt.end(); i++ ) {
z = toupper( *i );
if( z < 'A' || z > 'Z' ) continue;
r.append( bAlphabet.at( ( *i & 31 ) - 1 ) );
}
return r;
}
std::string decode( std::string txt ) {
size_t len = txt.length();
while( len % 5 != 0 ) len--;
if( len != txt.length() ) txt = txt.substr( 0, len );
std::string r;
for( size_t i = 0; i < len; i += 5 ) {
r.append( 1, 'A' + std::distance( bAlphabet.begin(), std::find( bAlphabet.begin(), bAlphabet.end(), txt.substr( i, 5 ) ) ) );
}
return r;
}
private:
std::vector<std::string> bAlphabet;
};
|
Port the following code from C to C++ with equivalent syntax and logic. | #include <stdio.h>
#include <string.h>
#include <stdlib.h>
char *codes[] = {
"AAAAA", "AAAAB", "AAABA", "AAABB", "AABAA",
"AABAB", "AABBA", "AABBB", "ABAAA", "ABAAB",
"ABABA", "ABABB", "ABBAA", "ABBAB", "ABBBA",
"ABBBB", "BAAAA", "BAAAB", "BAABA", "BAABB",
"BABAA", "BABAB", "BABBA", "BABBB", "BBAAA",
"BBAAB", "BBBAA"
};
char *get_code(const char c) {
if (c >= 97 && c <= 122) return codes[c - 97];
return codes[26];
}
char get_char(const char *code) {
int i;
if (!strcmp(codes[26], code)) return ' ';
for (i = 0; i < 26; ++i) {
if (strcmp(codes[i], code) == 0) return 97 + i;
}
printf("\nCode \"%s\" is invalid\n", code);
exit(1);
}
void str_tolower(char s[]) {
int i;
for (i = 0; i < strlen(s); ++i) s[i] = tolower(s[i]);
}
char *bacon_encode(char plain_text[], char message[]) {
int i, count;
int plen = strlen(plain_text), mlen = strlen(message);
int elen = 5 * plen;
char c;
char *p, *et, *mt;
et = malloc(elen + 1);
str_tolower(plain_text);
for (i = 0, p = et; i < plen; ++i, p += 5) {
c = plain_text[i];
strncpy(p, get_code(c), 5);
}
*++p = '\0';
str_tolower(message);
mt = calloc(mlen + 1, 1);
for (i = 0, count = 0; i < mlen; ++i) {
c = message[i];
if (c >= 'a' && c <= 'z') {
if (et[count] == 'A')
mt[i] = c;
else
mt[i] = c - 32;
if (++count == elen) break;
}
else mt[i] = c;
}
free(et);
return mt;
}
char *bacon_decode(char cipher_text[]) {
int i, count, clen = strlen(cipher_text);
int plen;
char *p, *ct, *pt;
char c, quintet[6];
ct = calloc(clen + 1, 1);
for (i = 0, count = 0; i < clen; ++i) {
c = cipher_text[i];
if (c >= 'a' && c <= 'z')
ct[count++] = 'A';
else if (c >= 'A' && c <= 'Z')
ct[count++] = 'B';
}
plen = strlen(ct) / 5;
pt = malloc(plen + 1);
for (i = 0, p = ct; i < plen; ++i, p += 5) {
strncpy(quintet, p, 5);
quintet[5] = '\0';
pt[i] = get_char(quintet);
}
pt[plen] = '\0';
free(ct);
return pt;
}
int main() {
char plain_text[] = "the quick brown fox jumps over the lazy dog";
char message[] = "bacon's cipher is a method of steganography created by francis bacon."
"this task is to implement a program for encryption and decryption of "
"plaintext using the simple alphabet of the baconian cipher or some "
"other kind of representation of this alphabet (make anything signify anything). "
"the baconian alphabet may optionally be extended to encode all lower "
"case characters individually and/or adding a few punctuation characters "
"such as the space.";
char *cipher_text, *hidden_text;
cipher_text = bacon_encode(plain_text, message);
printf("Cipher text ->\n\n%s\n", cipher_text);
hidden_text = bacon_decode(cipher_text);
printf("\nHidden text ->\n\n%s\n", hidden_text);
free(cipher_text);
free(hidden_text);
return 0;
}
| #include <iostream>
#include <algorithm>
#include <vector>
#include <bitset>
#include <string>
class bacon {
public:
bacon() {
int x = 0;
for( ; x < 9; x++ )
bAlphabet.push_back( std::bitset<5>( x ).to_string() );
bAlphabet.push_back( bAlphabet.back() );
for( ; x < 20; x++ )
bAlphabet.push_back( std::bitset<5>( x ).to_string() );
bAlphabet.push_back( bAlphabet.back() );
for( ; x < 24; x++ )
bAlphabet.push_back( std::bitset<5>( x ).to_string() );
}
std::string encode( std::string txt ) {
std::string r;
size_t z;
for( std::string::iterator i = txt.begin(); i != txt.end(); i++ ) {
z = toupper( *i );
if( z < 'A' || z > 'Z' ) continue;
r.append( bAlphabet.at( ( *i & 31 ) - 1 ) );
}
return r;
}
std::string decode( std::string txt ) {
size_t len = txt.length();
while( len % 5 != 0 ) len--;
if( len != txt.length() ) txt = txt.substr( 0, len );
std::string r;
for( size_t i = 0; i < len; i += 5 ) {
r.append( 1, 'A' + std::distance( bAlphabet.begin(), std::find( bAlphabet.begin(), bAlphabet.end(), txt.substr( i, 5 ) ) ) );
}
return r;
}
private:
std::vector<std::string> bAlphabet;
};
|
Translate the given C code snippet into C++ without altering its behavior. | #include <stdio.h>
#include <stdlib.h>
#define valid(i, j) 0 <= i && i < m && 0 <= j && j < n && !s[i][j]
int main(int c, char **v)
{
int i, j, m = 0, n = 0;
if (c >= 2) m = atoi(v[1]);
if (c >= 3) n = atoi(v[2]);
if (m <= 0) m = 5;
if (n <= 0) n = m;
int **s = calloc(1, sizeof(int *) * m + sizeof(int) * m * n);
s[0] = (int*)(s + m);
for (i = 1; i < m; i++) s[i] = s[i - 1] + n;
int dx = 1, dy = 0, val = 0, t;
for (i = j = 0; valid(i, j); i += dy, j += dx ) {
for (; valid(i, j); j += dx, i += dy)
s[i][j] = ++val;
j -= dx; i -= dy;
t = dy; dy = dx; dx = -t;
}
for (t = 2; val /= 10; t++);
for(i = 0; i < m; i++)
for(j = 0; j < n || !putchar('\n'); j++)
printf("%*d", t, s[i][j]);
return 0;
}
| #include <vector>
#include <memory>
#include <cmath>
#include <iostream>
#include <iomanip>
using namespace std;
typedef vector< int > IntRow;
typedef vector< IntRow > IntTable;
auto_ptr< IntTable > getSpiralArray( int dimension )
{
auto_ptr< IntTable > spiralArrayPtr( new IntTable(
dimension, IntRow( dimension ) ) );
int numConcentricSquares = static_cast< int >( ceil(
static_cast< double >( dimension ) / 2.0 ) );
int j;
int sideLen = dimension;
int currNum = 0;
for ( int i = 0; i < numConcentricSquares; i++ )
{
for ( j = 0; j < sideLen; j++ )
( *spiralArrayPtr )[ i ][ i + j ] = currNum++;
for ( j = 1; j < sideLen; j++ )
( *spiralArrayPtr )[ i + j ][ dimension - 1 - i ] = currNum++;
for ( j = sideLen - 2; j > -1; j-- )
( *spiralArrayPtr )[ dimension - 1 - i ][ i + j ] = currNum++;
for ( j = sideLen - 2; j > 0; j-- )
( *spiralArrayPtr )[ i + j ][ i ] = currNum++;
sideLen -= 2;
}
return spiralArrayPtr;
}
void printSpiralArray( const auto_ptr< IntTable >& spiralArrayPtr )
{
size_t dimension = spiralArrayPtr->size();
int fieldWidth = static_cast< int >( floor( log10(
static_cast< double >( dimension * dimension - 1 ) ) ) ) + 2;
size_t col;
for ( size_t row = 0; row < dimension; row++ )
{
for ( col = 0; col < dimension; col++ )
cout << setw( fieldWidth ) << ( *spiralArrayPtr )[ row ][ col ];
cout << endl;
}
}
int main()
{
printSpiralArray( getSpiralArray( 5 ) );
}
|
Rewrite the snippet below in C++ so it works the same as the original C code. | #include <stdlib.h>
#include <stdarg.h>
#include <stdio.h>
#include <ctype.h>
#include <string.h>
typedef const char * String;
typedef struct sTable {
String * *rows;
int n_rows,n_cols;
} *Table;
typedef int (*CompareFctn)(String a, String b);
struct {
CompareFctn compare;
int column;
int reversed;
} sortSpec;
int CmprRows( const void *aa, const void *bb)
{
String *rA = *(String *const *)aa;
String *rB = *(String *const *)bb;
int sortCol = sortSpec.column;
String left = sortSpec.reversed ? rB[sortCol] : rA[sortCol];
String right = sortSpec.reversed ? rA[sortCol] : rB[sortCol];
return sortSpec.compare( left, right );
}
int sortTable(Table tbl, const char* argSpec,... )
{
va_list vl;
const char *p;
int c;
sortSpec.compare = &strcmp;
sortSpec.column = 0;
sortSpec.reversed = 0;
va_start(vl, argSpec);
if (argSpec)
for (p=argSpec; *p; p++) {
switch (*p) {
case 'o':
sortSpec.compare = va_arg(vl,CompareFctn);
break;
case 'c':
c = va_arg(vl,int);
if ( 0<=c && c<tbl->n_cols)
sortSpec.column = c;
break;
case 'r':
sortSpec.reversed = (0!=va_arg(vl,int));
break;
}
}
va_end(vl);
qsort( tbl->rows, tbl->n_rows, sizeof(String *), CmprRows);
return 0;
}
void printTable( Table tbl, FILE *fout, const char *colFmts[])
{
int row, col;
for (row=0; row<tbl->n_rows; row++) {
fprintf(fout, " ");
for(col=0; col<tbl->n_cols; col++) {
fprintf(fout, colFmts[col], tbl->rows[row][col]);
}
fprintf(fout, "\n");
}
fprintf(fout, "\n");
}
int ord(char v)
{
return v-'0';
}
int cmprStrgs(String s1, String s2)
{
const char *p1 = s1;
const char *p2 = s2;
const char *mrk1, *mrk2;
while ((tolower(*p1) == tolower(*p2)) && *p1) {
p1++; p2++;
}
if (isdigit(*p1) && isdigit(*p2)) {
long v1, v2;
if ((*p1 == '0') ||(*p2 == '0')) {
while (p1 > s1) {
p1--; p2--;
if (*p1 != '0') break;
}
if (!isdigit(*p1)) {
p1++; p2++;
}
}
mrk1 = p1; mrk2 = p2;
v1 = 0;
while(isdigit(*p1)) {
v1 = 10*v1+ord(*p1);
p1++;
}
v2 = 0;
while(isdigit(*p2)) {
v2 = 10*v2+ord(*p2);
p2++;
}
if (v1 == v2)
return(p2-mrk2)-(p1-mrk1);
return v1 - v2;
}
if (tolower(*p1) != tolower(*p2))
return (tolower(*p1) - tolower(*p2));
for(p1=s1, p2=s2; (*p1 == *p2) && *p1; p1++, p2++);
return (*p1 -*p2);
}
int main()
{
const char *colFmts[] = {" %-5.5s"," %-5.5s"," %-9.9s"};
String r1[] = { "a101", "red", "Java" };
String r2[] = { "ab40", "gren", "Smalltalk" };
String r3[] = { "ab9", "blue", "Fortran" };
String r4[] = { "ab09", "ylow", "Python" };
String r5[] = { "ab1a", "blak", "Factor" };
String r6[] = { "ab1b", "brwn", "C Sharp" };
String r7[] = { "Ab1b", "pink", "Ruby" };
String r8[] = { "ab1", "orng", "Scheme" };
String *rows[] = { r1, r2, r3, r4, r5, r6, r7, r8 };
struct sTable table;
table.rows = rows;
table.n_rows = 8;
table.n_cols = 3;
sortTable(&table, "");
printf("sort on col 0, ascending\n");
printTable(&table, stdout, colFmts);
sortTable(&table, "ro", 1, &cmprStrgs);
printf("sort on col 0, reverse.special\n");
printTable(&table, stdout, colFmts);
sortTable(&table, "c", 1);
printf("sort on col 1, ascending\n");
printTable(&table, stdout, colFmts);
sortTable(&table, "cr", 2, 1);
printf("sort on col 2, reverse\n");
printTable(&table, stdout, colFmts);
return 0;
}
| #include <vector>
#include <algorithm>
#include <string>
template <class T>
struct sort_table_functor {
typedef bool (*CompFun)(const T &, const T &);
const CompFun ordering;
const int column;
const bool reverse;
sort_table_functor(CompFun o, int c, bool r) :
ordering(o), column(c), reverse(r) { }
bool operator()(const std::vector<T> &x, const std::vector<T> &y) const {
const T &a = x[column],
&b = y[column];
return reverse ? ordering(b, a)
: ordering(a, b);
}
};
template <class T>
bool myLess(const T &x, const T &y) { return x < y; }
template <class T>
void sort_table(std::vector<std::vector<T> > &table,
int column = 0, bool reverse = false,
bool (*ordering)(const T &, const T &) = myLess) {
std::sort(table.begin(), table.end(),
sort_table_functor<T>(ordering, column, reverse));
}
#include <iostream>
template <class T>
void print_matrix(std::vector<std::vector<T> > &data) {
for () {
for (int j = 0; j < 3; j++)
std::cout << data[i][j] << "\t";
std::cout << std::endl;
}
}
bool desc_len_comparator(const std::string &x, const std::string &y) {
return x.length() > y.length();
}
int main() {
std::string data_array[3][3] =
{
{"a", "b", "c"},
{"", "q", "z"},
{"zap", "zip", "Zot"}
};
std::vector<std::vector<std::string> > data_orig;
for (int i = 0; i < 3; i++) {
std::vector<std::string> row;
for (int j = 0; j < 3; j++)
row.push_back(data_array[i][j]);
data_orig.push_back(row);
}
print_matrix(data_orig);
std::vector<std::vector<std::string> > data = data_orig;
sort_table(data);
print_matrix(data);
data = data_orig;
sort_table(data, 2);
print_matrix(data);
data = data_orig;
sort_table(data, 1);
print_matrix(data);
data = data_orig;
sort_table(data, 1, true);
print_matrix(data);
data = data_orig;
sort_table(data, 0, false, desc_len_comparator);
print_matrix(data);
return 0;
}
|
Generate a C++ translation of this C snippet without changing its computational steps. | #include <stdio.h>
#include <stdlib.h>
#include <string.h>
#define N_SITES 150
double site[N_SITES][2];
unsigned char rgb[N_SITES][3];
int size_x = 640, size_y = 480;
inline double sq2(double x, double y)
{
return x * x + y * y;
}
#define for_k for (k = 0; k < N_SITES; k++)
int nearest_site(double x, double y)
{
int k, ret = 0;
double d, dist = 0;
for_k {
d = sq2(x - site[k][0], y - site[k][1]);
if (!k || d < dist) {
dist = d, ret = k;
}
}
return ret;
}
int at_edge(int *color, int y, int x)
{
int i, j, c = color[y * size_x + x];
for (i = y - 1; i <= y + 1; i++) {
if (i < 0 || i >= size_y) continue;
for (j = x - 1; j <= x + 1; j++) {
if (j < 0 || j >= size_x) continue;
if (color[i * size_x + j] != c) return 1;
}
}
return 0;
}
#define AA_RES 4
void aa_color(unsigned char *pix, int y, int x)
{
int i, j, n;
double r = 0, g = 0, b = 0, xx, yy;
for (i = 0; i < AA_RES; i++) {
yy = y + 1. / AA_RES * i + .5;
for (j = 0; j < AA_RES; j++) {
xx = x + 1. / AA_RES * j + .5;
n = nearest_site(xx, yy);
r += rgb[n][0];
g += rgb[n][1];
b += rgb[n][2];
}
}
pix[0] = r / (AA_RES * AA_RES);
pix[1] = g / (AA_RES * AA_RES);
pix[2] = b / (AA_RES * AA_RES);
}
#define for_i for (i = 0; i < size_y; i++)
#define for_j for (j = 0; j < size_x; j++)
void gen_map()
{
int i, j, k;
int *nearest = malloc(sizeof(int) * size_y * size_x);
unsigned char *ptr, *buf, color;
ptr = buf = malloc(3 * size_x * size_y);
for_i for_j nearest[i * size_x + j] = nearest_site(j, i);
for_i for_j {
if (!at_edge(nearest, i, j))
memcpy(ptr, rgb[nearest[i * size_x + j]], 3);
else
aa_color(ptr, i, j);
ptr += 3;
}
for (k = 0; k < N_SITES; k++) {
color = (rgb[k][0]*.25 + rgb[k][1]*.6 + rgb[k][2]*.15 > 80) ? 0 : 255;
for (i = site[k][1] - 1; i <= site[k][1] + 1; i++) {
if (i < 0 || i >= size_y) continue;
for (j = site[k][0] - 1; j <= site[k][0] + 1; j++) {
if (j < 0 || j >= size_x) continue;
ptr = buf + 3 * (i * size_x + j);
ptr[0] = ptr[1] = ptr[2] = color;
}
}
}
printf("P6\n%d %d\n255\n", size_x, size_y);
fflush(stdout);
fwrite(buf, size_y * size_x * 3, 1, stdout);
}
#define frand(x) (rand() / (1. + RAND_MAX) * x)
int main()
{
int k;
for_k {
site[k][0] = frand(size_x);
site[k][1] = frand(size_y);
rgb [k][0] = frand(256);
rgb [k][1] = frand(256);
rgb [k][2] = frand(256);
}
gen_map();
return 0;
}
| #include <windows.h>
#include <vector>
#include <string>
using namespace std;
struct Point {
int x, y;
};
class MyBitmap {
public:
MyBitmap() : pen_(nullptr) {}
~MyBitmap() {
DeleteObject(pen_);
DeleteDC(hdc_);
DeleteObject(bmp_);
}
bool Create(int w, int h) {
BITMAPINFO bi;
ZeroMemory(&bi, sizeof(bi));
bi.bmiHeader.biSize = sizeof(bi.bmiHeader);
bi.bmiHeader.biBitCount = sizeof(DWORD) * 8;
bi.bmiHeader.biCompression = BI_RGB;
bi.bmiHeader.biPlanes = 1;
bi.bmiHeader.biWidth = w;
bi.bmiHeader.biHeight = -h;
void *bits_ptr = nullptr;
HDC dc = GetDC(GetConsoleWindow());
bmp_ = CreateDIBSection(dc, &bi, DIB_RGB_COLORS, &bits_ptr, nullptr, 0);
if (!bmp_) return false;
hdc_ = CreateCompatibleDC(dc);
SelectObject(hdc_, bmp_);
ReleaseDC(GetConsoleWindow(), dc);
width_ = w;
height_ = h;
return true;
}
void SetPenColor(DWORD clr) {
if (pen_) DeleteObject(pen_);
pen_ = CreatePen(PS_SOLID, 1, clr);
SelectObject(hdc_, pen_);
}
bool SaveBitmap(const char* path) {
HANDLE file = CreateFile(path, GENERIC_WRITE, 0, nullptr, CREATE_ALWAYS, FILE_ATTRIBUTE_NORMAL, nullptr);
if (file == INVALID_HANDLE_VALUE) {
return false;
}
BITMAPFILEHEADER fileheader;
BITMAPINFO infoheader;
BITMAP bitmap;
GetObject(bmp_, sizeof(bitmap), &bitmap);
DWORD* dwp_bits = new DWORD[bitmap.bmWidth * bitmap.bmHeight];
ZeroMemory(dwp_bits, bitmap.bmWidth * bitmap.bmHeight * sizeof(DWORD));
ZeroMemory(&infoheader, sizeof(BITMAPINFO));
ZeroMemory(&fileheader, sizeof(BITMAPFILEHEADER));
infoheader.bmiHeader.biBitCount = sizeof(DWORD) * 8;
infoheader.bmiHeader.biCompression = BI_RGB;
infoheader.bmiHeader.biPlanes = 1;
infoheader.bmiHeader.biSize = sizeof(infoheader.bmiHeader);
infoheader.bmiHeader.biHeight = bitmap.bmHeight;
infoheader.bmiHeader.biWidth = bitmap.bmWidth;
infoheader.bmiHeader.biSizeImage = bitmap.bmWidth * bitmap.bmHeight * sizeof(DWORD);
fileheader.bfType = 0x4D42;
fileheader.bfOffBits = sizeof(infoheader.bmiHeader) + sizeof(BITMAPFILEHEADER);
fileheader.bfSize = fileheader.bfOffBits + infoheader.bmiHeader.biSizeImage;
GetDIBits(hdc_, bmp_, 0, height_, (LPVOID)dwp_bits, &infoheader, DIB_RGB_COLORS);
DWORD wb;
WriteFile(file, &fileheader, sizeof(BITMAPFILEHEADER), &wb, nullptr);
WriteFile(file, &infoheader.bmiHeader, sizeof(infoheader.bmiHeader), &wb, nullptr);
WriteFile(file, dwp_bits, bitmap.bmWidth * bitmap.bmHeight * 4, &wb, nullptr);
CloseHandle(file);
delete[] dwp_bits;
return true;
}
HDC hdc() { return hdc_; }
int width() { return width_; }
int height() { return height_; }
private:
HBITMAP bmp_;
HDC hdc_;
HPEN pen_;
int width_, height_;
};
static int DistanceSqrd(const Point& point, int x, int y) {
int xd = x - point.x;
int yd = y - point.y;
return (xd * xd) + (yd * yd);
}
class Voronoi {
public:
void Make(MyBitmap* bmp, int count) {
bmp_ = bmp;
CreatePoints(count);
CreateColors();
CreateSites();
SetSitesPoints();
}
private:
void CreateSites() {
int w = bmp_->width(), h = bmp_->height(), d;
for (int hh = 0; hh < h; hh++) {
for (int ww = 0; ww < w; ww++) {
int ind = -1, dist = INT_MAX;
for (size_t it = 0; it < points_.size(); it++) {
const Point& p = points_[it];
d = DistanceSqrd(p, ww, hh);
if (d < dist) {
dist = d;
ind = it;
}
}
if (ind > -1)
SetPixel(bmp_->hdc(), ww, hh, colors_[ind]);
else
__asm nop
}
}
}
void SetSitesPoints() {
for (const auto& point : points_) {
int x = point.x, y = point.y;
for (int i = -1; i < 2; i++)
for (int j = -1; j < 2; j++)
SetPixel(bmp_->hdc(), x + i, y + j, 0);
}
}
void CreatePoints(int count) {
const int w = bmp_->width() - 20, h = bmp_->height() - 20;
for (int i = 0; i < count; i++) {
points_.push_back({ rand() % w + 10, rand() % h + 10 });
}
}
void CreateColors() {
for (size_t i = 0; i < points_.size(); i++) {
DWORD c = RGB(rand() % 200 + 50, rand() % 200 + 55, rand() % 200 + 50);
colors_.push_back(c);
}
}
vector<Point> points_;
vector<DWORD> colors_;
MyBitmap* bmp_;
};
int main(int argc, char* argv[]) {
ShowWindow(GetConsoleWindow(), SW_MAXIMIZE);
srand(GetTickCount());
MyBitmap bmp;
bmp.Create(512, 512);
bmp.SetPenColor(0);
Voronoi v;
v.Make(&bmp, 50);
BitBlt(GetDC(GetConsoleWindow()), 20, 20, 512, 512, bmp.hdc(), 0, 0, SRCCOPY);
bmp.SaveBitmap("v.bmp");
system("pause");
return 0;
}
|
Generate an equivalent C++ version of this C code. | #include <stdio.h>
#include <stdlib.h>
#include <string.h>
#define N_SITES 150
double site[N_SITES][2];
unsigned char rgb[N_SITES][3];
int size_x = 640, size_y = 480;
inline double sq2(double x, double y)
{
return x * x + y * y;
}
#define for_k for (k = 0; k < N_SITES; k++)
int nearest_site(double x, double y)
{
int k, ret = 0;
double d, dist = 0;
for_k {
d = sq2(x - site[k][0], y - site[k][1]);
if (!k || d < dist) {
dist = d, ret = k;
}
}
return ret;
}
int at_edge(int *color, int y, int x)
{
int i, j, c = color[y * size_x + x];
for (i = y - 1; i <= y + 1; i++) {
if (i < 0 || i >= size_y) continue;
for (j = x - 1; j <= x + 1; j++) {
if (j < 0 || j >= size_x) continue;
if (color[i * size_x + j] != c) return 1;
}
}
return 0;
}
#define AA_RES 4
void aa_color(unsigned char *pix, int y, int x)
{
int i, j, n;
double r = 0, g = 0, b = 0, xx, yy;
for (i = 0; i < AA_RES; i++) {
yy = y + 1. / AA_RES * i + .5;
for (j = 0; j < AA_RES; j++) {
xx = x + 1. / AA_RES * j + .5;
n = nearest_site(xx, yy);
r += rgb[n][0];
g += rgb[n][1];
b += rgb[n][2];
}
}
pix[0] = r / (AA_RES * AA_RES);
pix[1] = g / (AA_RES * AA_RES);
pix[2] = b / (AA_RES * AA_RES);
}
#define for_i for (i = 0; i < size_y; i++)
#define for_j for (j = 0; j < size_x; j++)
void gen_map()
{
int i, j, k;
int *nearest = malloc(sizeof(int) * size_y * size_x);
unsigned char *ptr, *buf, color;
ptr = buf = malloc(3 * size_x * size_y);
for_i for_j nearest[i * size_x + j] = nearest_site(j, i);
for_i for_j {
if (!at_edge(nearest, i, j))
memcpy(ptr, rgb[nearest[i * size_x + j]], 3);
else
aa_color(ptr, i, j);
ptr += 3;
}
for (k = 0; k < N_SITES; k++) {
color = (rgb[k][0]*.25 + rgb[k][1]*.6 + rgb[k][2]*.15 > 80) ? 0 : 255;
for (i = site[k][1] - 1; i <= site[k][1] + 1; i++) {
if (i < 0 || i >= size_y) continue;
for (j = site[k][0] - 1; j <= site[k][0] + 1; j++) {
if (j < 0 || j >= size_x) continue;
ptr = buf + 3 * (i * size_x + j);
ptr[0] = ptr[1] = ptr[2] = color;
}
}
}
printf("P6\n%d %d\n255\n", size_x, size_y);
fflush(stdout);
fwrite(buf, size_y * size_x * 3, 1, stdout);
}
#define frand(x) (rand() / (1. + RAND_MAX) * x)
int main()
{
int k;
for_k {
site[k][0] = frand(size_x);
site[k][1] = frand(size_y);
rgb [k][0] = frand(256);
rgb [k][1] = frand(256);
rgb [k][2] = frand(256);
}
gen_map();
return 0;
}
| #include <windows.h>
#include <vector>
#include <string>
using namespace std;
struct Point {
int x, y;
};
class MyBitmap {
public:
MyBitmap() : pen_(nullptr) {}
~MyBitmap() {
DeleteObject(pen_);
DeleteDC(hdc_);
DeleteObject(bmp_);
}
bool Create(int w, int h) {
BITMAPINFO bi;
ZeroMemory(&bi, sizeof(bi));
bi.bmiHeader.biSize = sizeof(bi.bmiHeader);
bi.bmiHeader.biBitCount = sizeof(DWORD) * 8;
bi.bmiHeader.biCompression = BI_RGB;
bi.bmiHeader.biPlanes = 1;
bi.bmiHeader.biWidth = w;
bi.bmiHeader.biHeight = -h;
void *bits_ptr = nullptr;
HDC dc = GetDC(GetConsoleWindow());
bmp_ = CreateDIBSection(dc, &bi, DIB_RGB_COLORS, &bits_ptr, nullptr, 0);
if (!bmp_) return false;
hdc_ = CreateCompatibleDC(dc);
SelectObject(hdc_, bmp_);
ReleaseDC(GetConsoleWindow(), dc);
width_ = w;
height_ = h;
return true;
}
void SetPenColor(DWORD clr) {
if (pen_) DeleteObject(pen_);
pen_ = CreatePen(PS_SOLID, 1, clr);
SelectObject(hdc_, pen_);
}
bool SaveBitmap(const char* path) {
HANDLE file = CreateFile(path, GENERIC_WRITE, 0, nullptr, CREATE_ALWAYS, FILE_ATTRIBUTE_NORMAL, nullptr);
if (file == INVALID_HANDLE_VALUE) {
return false;
}
BITMAPFILEHEADER fileheader;
BITMAPINFO infoheader;
BITMAP bitmap;
GetObject(bmp_, sizeof(bitmap), &bitmap);
DWORD* dwp_bits = new DWORD[bitmap.bmWidth * bitmap.bmHeight];
ZeroMemory(dwp_bits, bitmap.bmWidth * bitmap.bmHeight * sizeof(DWORD));
ZeroMemory(&infoheader, sizeof(BITMAPINFO));
ZeroMemory(&fileheader, sizeof(BITMAPFILEHEADER));
infoheader.bmiHeader.biBitCount = sizeof(DWORD) * 8;
infoheader.bmiHeader.biCompression = BI_RGB;
infoheader.bmiHeader.biPlanes = 1;
infoheader.bmiHeader.biSize = sizeof(infoheader.bmiHeader);
infoheader.bmiHeader.biHeight = bitmap.bmHeight;
infoheader.bmiHeader.biWidth = bitmap.bmWidth;
infoheader.bmiHeader.biSizeImage = bitmap.bmWidth * bitmap.bmHeight * sizeof(DWORD);
fileheader.bfType = 0x4D42;
fileheader.bfOffBits = sizeof(infoheader.bmiHeader) + sizeof(BITMAPFILEHEADER);
fileheader.bfSize = fileheader.bfOffBits + infoheader.bmiHeader.biSizeImage;
GetDIBits(hdc_, bmp_, 0, height_, (LPVOID)dwp_bits, &infoheader, DIB_RGB_COLORS);
DWORD wb;
WriteFile(file, &fileheader, sizeof(BITMAPFILEHEADER), &wb, nullptr);
WriteFile(file, &infoheader.bmiHeader, sizeof(infoheader.bmiHeader), &wb, nullptr);
WriteFile(file, dwp_bits, bitmap.bmWidth * bitmap.bmHeight * 4, &wb, nullptr);
CloseHandle(file);
delete[] dwp_bits;
return true;
}
HDC hdc() { return hdc_; }
int width() { return width_; }
int height() { return height_; }
private:
HBITMAP bmp_;
HDC hdc_;
HPEN pen_;
int width_, height_;
};
static int DistanceSqrd(const Point& point, int x, int y) {
int xd = x - point.x;
int yd = y - point.y;
return (xd * xd) + (yd * yd);
}
class Voronoi {
public:
void Make(MyBitmap* bmp, int count) {
bmp_ = bmp;
CreatePoints(count);
CreateColors();
CreateSites();
SetSitesPoints();
}
private:
void CreateSites() {
int w = bmp_->width(), h = bmp_->height(), d;
for (int hh = 0; hh < h; hh++) {
for (int ww = 0; ww < w; ww++) {
int ind = -1, dist = INT_MAX;
for (size_t it = 0; it < points_.size(); it++) {
const Point& p = points_[it];
d = DistanceSqrd(p, ww, hh);
if (d < dist) {
dist = d;
ind = it;
}
}
if (ind > -1)
SetPixel(bmp_->hdc(), ww, hh, colors_[ind]);
else
__asm nop
}
}
}
void SetSitesPoints() {
for (const auto& point : points_) {
int x = point.x, y = point.y;
for (int i = -1; i < 2; i++)
for (int j = -1; j < 2; j++)
SetPixel(bmp_->hdc(), x + i, y + j, 0);
}
}
void CreatePoints(int count) {
const int w = bmp_->width() - 20, h = bmp_->height() - 20;
for (int i = 0; i < count; i++) {
points_.push_back({ rand() % w + 10, rand() % h + 10 });
}
}
void CreateColors() {
for (size_t i = 0; i < points_.size(); i++) {
DWORD c = RGB(rand() % 200 + 50, rand() % 200 + 55, rand() % 200 + 50);
colors_.push_back(c);
}
}
vector<Point> points_;
vector<DWORD> colors_;
MyBitmap* bmp_;
};
int main(int argc, char* argv[]) {
ShowWindow(GetConsoleWindow(), SW_MAXIMIZE);
srand(GetTickCount());
MyBitmap bmp;
bmp.Create(512, 512);
bmp.SetPenColor(0);
Voronoi v;
v.Make(&bmp, 50);
BitBlt(GetDC(GetConsoleWindow()), 20, 20, 512, 512, bmp.hdc(), 0, 0, SRCCOPY);
bmp.SaveBitmap("v.bmp");
system("pause");
return 0;
}
|
Convert this C block to C++, preserving its control flow and logic. | #include <stdio.h>
#include <stdlib.h>
#include <string.h>
#define N_SITES 150
double site[N_SITES][2];
unsigned char rgb[N_SITES][3];
int size_x = 640, size_y = 480;
inline double sq2(double x, double y)
{
return x * x + y * y;
}
#define for_k for (k = 0; k < N_SITES; k++)
int nearest_site(double x, double y)
{
int k, ret = 0;
double d, dist = 0;
for_k {
d = sq2(x - site[k][0], y - site[k][1]);
if (!k || d < dist) {
dist = d, ret = k;
}
}
return ret;
}
int at_edge(int *color, int y, int x)
{
int i, j, c = color[y * size_x + x];
for (i = y - 1; i <= y + 1; i++) {
if (i < 0 || i >= size_y) continue;
for (j = x - 1; j <= x + 1; j++) {
if (j < 0 || j >= size_x) continue;
if (color[i * size_x + j] != c) return 1;
}
}
return 0;
}
#define AA_RES 4
void aa_color(unsigned char *pix, int y, int x)
{
int i, j, n;
double r = 0, g = 0, b = 0, xx, yy;
for (i = 0; i < AA_RES; i++) {
yy = y + 1. / AA_RES * i + .5;
for (j = 0; j < AA_RES; j++) {
xx = x + 1. / AA_RES * j + .5;
n = nearest_site(xx, yy);
r += rgb[n][0];
g += rgb[n][1];
b += rgb[n][2];
}
}
pix[0] = r / (AA_RES * AA_RES);
pix[1] = g / (AA_RES * AA_RES);
pix[2] = b / (AA_RES * AA_RES);
}
#define for_i for (i = 0; i < size_y; i++)
#define for_j for (j = 0; j < size_x; j++)
void gen_map()
{
int i, j, k;
int *nearest = malloc(sizeof(int) * size_y * size_x);
unsigned char *ptr, *buf, color;
ptr = buf = malloc(3 * size_x * size_y);
for_i for_j nearest[i * size_x + j] = nearest_site(j, i);
for_i for_j {
if (!at_edge(nearest, i, j))
memcpy(ptr, rgb[nearest[i * size_x + j]], 3);
else
aa_color(ptr, i, j);
ptr += 3;
}
for (k = 0; k < N_SITES; k++) {
color = (rgb[k][0]*.25 + rgb[k][1]*.6 + rgb[k][2]*.15 > 80) ? 0 : 255;
for (i = site[k][1] - 1; i <= site[k][1] + 1; i++) {
if (i < 0 || i >= size_y) continue;
for (j = site[k][0] - 1; j <= site[k][0] + 1; j++) {
if (j < 0 || j >= size_x) continue;
ptr = buf + 3 * (i * size_x + j);
ptr[0] = ptr[1] = ptr[2] = color;
}
}
}
printf("P6\n%d %d\n255\n", size_x, size_y);
fflush(stdout);
fwrite(buf, size_y * size_x * 3, 1, stdout);
}
#define frand(x) (rand() / (1. + RAND_MAX) * x)
int main()
{
int k;
for_k {
site[k][0] = frand(size_x);
site[k][1] = frand(size_y);
rgb [k][0] = frand(256);
rgb [k][1] = frand(256);
rgb [k][2] = frand(256);
}
gen_map();
return 0;
}
| #include <windows.h>
#include <vector>
#include <string>
using namespace std;
struct Point {
int x, y;
};
class MyBitmap {
public:
MyBitmap() : pen_(nullptr) {}
~MyBitmap() {
DeleteObject(pen_);
DeleteDC(hdc_);
DeleteObject(bmp_);
}
bool Create(int w, int h) {
BITMAPINFO bi;
ZeroMemory(&bi, sizeof(bi));
bi.bmiHeader.biSize = sizeof(bi.bmiHeader);
bi.bmiHeader.biBitCount = sizeof(DWORD) * 8;
bi.bmiHeader.biCompression = BI_RGB;
bi.bmiHeader.biPlanes = 1;
bi.bmiHeader.biWidth = w;
bi.bmiHeader.biHeight = -h;
void *bits_ptr = nullptr;
HDC dc = GetDC(GetConsoleWindow());
bmp_ = CreateDIBSection(dc, &bi, DIB_RGB_COLORS, &bits_ptr, nullptr, 0);
if (!bmp_) return false;
hdc_ = CreateCompatibleDC(dc);
SelectObject(hdc_, bmp_);
ReleaseDC(GetConsoleWindow(), dc);
width_ = w;
height_ = h;
return true;
}
void SetPenColor(DWORD clr) {
if (pen_) DeleteObject(pen_);
pen_ = CreatePen(PS_SOLID, 1, clr);
SelectObject(hdc_, pen_);
}
bool SaveBitmap(const char* path) {
HANDLE file = CreateFile(path, GENERIC_WRITE, 0, nullptr, CREATE_ALWAYS, FILE_ATTRIBUTE_NORMAL, nullptr);
if (file == INVALID_HANDLE_VALUE) {
return false;
}
BITMAPFILEHEADER fileheader;
BITMAPINFO infoheader;
BITMAP bitmap;
GetObject(bmp_, sizeof(bitmap), &bitmap);
DWORD* dwp_bits = new DWORD[bitmap.bmWidth * bitmap.bmHeight];
ZeroMemory(dwp_bits, bitmap.bmWidth * bitmap.bmHeight * sizeof(DWORD));
ZeroMemory(&infoheader, sizeof(BITMAPINFO));
ZeroMemory(&fileheader, sizeof(BITMAPFILEHEADER));
infoheader.bmiHeader.biBitCount = sizeof(DWORD) * 8;
infoheader.bmiHeader.biCompression = BI_RGB;
infoheader.bmiHeader.biPlanes = 1;
infoheader.bmiHeader.biSize = sizeof(infoheader.bmiHeader);
infoheader.bmiHeader.biHeight = bitmap.bmHeight;
infoheader.bmiHeader.biWidth = bitmap.bmWidth;
infoheader.bmiHeader.biSizeImage = bitmap.bmWidth * bitmap.bmHeight * sizeof(DWORD);
fileheader.bfType = 0x4D42;
fileheader.bfOffBits = sizeof(infoheader.bmiHeader) + sizeof(BITMAPFILEHEADER);
fileheader.bfSize = fileheader.bfOffBits + infoheader.bmiHeader.biSizeImage;
GetDIBits(hdc_, bmp_, 0, height_, (LPVOID)dwp_bits, &infoheader, DIB_RGB_COLORS);
DWORD wb;
WriteFile(file, &fileheader, sizeof(BITMAPFILEHEADER), &wb, nullptr);
WriteFile(file, &infoheader.bmiHeader, sizeof(infoheader.bmiHeader), &wb, nullptr);
WriteFile(file, dwp_bits, bitmap.bmWidth * bitmap.bmHeight * 4, &wb, nullptr);
CloseHandle(file);
delete[] dwp_bits;
return true;
}
HDC hdc() { return hdc_; }
int width() { return width_; }
int height() { return height_; }
private:
HBITMAP bmp_;
HDC hdc_;
HPEN pen_;
int width_, height_;
};
static int DistanceSqrd(const Point& point, int x, int y) {
int xd = x - point.x;
int yd = y - point.y;
return (xd * xd) + (yd * yd);
}
class Voronoi {
public:
void Make(MyBitmap* bmp, int count) {
bmp_ = bmp;
CreatePoints(count);
CreateColors();
CreateSites();
SetSitesPoints();
}
private:
void CreateSites() {
int w = bmp_->width(), h = bmp_->height(), d;
for (int hh = 0; hh < h; hh++) {
for (int ww = 0; ww < w; ww++) {
int ind = -1, dist = INT_MAX;
for (size_t it = 0; it < points_.size(); it++) {
const Point& p = points_[it];
d = DistanceSqrd(p, ww, hh);
if (d < dist) {
dist = d;
ind = it;
}
}
if (ind > -1)
SetPixel(bmp_->hdc(), ww, hh, colors_[ind]);
else
__asm nop
}
}
}
void SetSitesPoints() {
for (const auto& point : points_) {
int x = point.x, y = point.y;
for (int i = -1; i < 2; i++)
for (int j = -1; j < 2; j++)
SetPixel(bmp_->hdc(), x + i, y + j, 0);
}
}
void CreatePoints(int count) {
const int w = bmp_->width() - 20, h = bmp_->height() - 20;
for (int i = 0; i < count; i++) {
points_.push_back({ rand() % w + 10, rand() % h + 10 });
}
}
void CreateColors() {
for (size_t i = 0; i < points_.size(); i++) {
DWORD c = RGB(rand() % 200 + 50, rand() % 200 + 55, rand() % 200 + 50);
colors_.push_back(c);
}
}
vector<Point> points_;
vector<DWORD> colors_;
MyBitmap* bmp_;
};
int main(int argc, char* argv[]) {
ShowWindow(GetConsoleWindow(), SW_MAXIMIZE);
srand(GetTickCount());
MyBitmap bmp;
bmp.Create(512, 512);
bmp.SetPenColor(0);
Voronoi v;
v.Make(&bmp, 50);
BitBlt(GetDC(GetConsoleWindow()), 20, 20, 512, 512, bmp.hdc(), 0, 0, SRCCOPY);
bmp.SaveBitmap("v.bmp");
system("pause");
return 0;
}
|
Convert this C block to C++, preserving its control flow and logic. |
#include <stdio.h>
void sayHello(char* name){
printf("Hello %s!\n", name);
}
int doubleNum(int num){
return num * 2;
}
| FUNCTION MULTIPLY(X, Y)
DOUBLE PRECISION MULTIPLY, X, Y
|
Convert this C snippet to C++ and keep its semantics consistent. | #include <stdlib.h>
#include <stdio.h>
#include <string.h>
#include <time.h>
struct s_env {
unsigned int n, i;
size_t size;
void *sample;
};
void s_of_n_init(struct s_env *s_env, size_t size, unsigned int n)
{
s_env->i = 0;
s_env->n = n;
s_env->size = size;
s_env->sample = malloc(n * size);
}
void sample_set_i(struct s_env *s_env, unsigned int i, void *item)
{
memcpy(s_env->sample + i * s_env->size, item, s_env->size);
}
void *s_of_n(struct s_env *s_env, void *item)
{
s_env->i++;
if (s_env->i <= s_env->n)
sample_set_i(s_env, s_env->i - 1, item);
else if ((rand() % s_env->i) < s_env->n)
sample_set_i(s_env, rand() % s_env->n, item);
return s_env->sample;
}
int *test(unsigned int n, int *items_set, unsigned int num_items)
{
int i;
struct s_env s_env;
s_of_n_init(&s_env, sizeof(items_set[0]), n);
for (i = 0; i < num_items; i++) {
s_of_n(&s_env, (void *) &items_set[i]);
}
return (int *)s_env.sample;
}
int main()
{
unsigned int i, j;
unsigned int n = 3;
unsigned int num_items = 10;
unsigned int *frequencies;
int *items_set;
srand(time(NULL));
items_set = malloc(num_items * sizeof(int));
frequencies = malloc(num_items * sizeof(int));
for (i = 0; i < num_items; i++) {
items_set[i] = i;
frequencies[i] = 0;
}
for (i = 0; i < 100000; i++) {
int *res = test(n, items_set, num_items);
for (j = 0; j < n; j++) {
frequencies[res[j]]++;
}
free(res);
}
for (i = 0; i < num_items; i++) {
printf(" %d", frequencies[i]);
}
puts("");
return 0;
}
| #include <iostream>
#include <functional>
#include <vector>
#include <cstdlib>
#include <ctime>
template <typename T>
std::function<std::vector<T>(T)> s_of_n_creator(int n) {
std::vector<T> sample;
int i = 0;
return [=](T item) mutable {
i++;
if (i <= n) {
sample.push_back(item);
} else if (std::rand() % i < n) {
sample[std::rand() % n] = item;
}
return sample;
};
}
int main() {
std::srand(std::time(NULL));
int bin[10] = {0};
for (int trial = 0; trial < 100000; trial++) {
auto s_of_n = s_of_n_creator<int>(3);
std::vector<int> sample;
for (int i = 0; i < 10; i++)
sample = s_of_n(i);
for (int s : sample)
bin[s]++;
}
for (int x : bin)
std::cout << x << std::endl;
return 0;
}
|
Generate an equivalent C++ version of this C code. | #include <stdlib.h>
#include <stdio.h>
#include <string.h>
#include <time.h>
struct s_env {
unsigned int n, i;
size_t size;
void *sample;
};
void s_of_n_init(struct s_env *s_env, size_t size, unsigned int n)
{
s_env->i = 0;
s_env->n = n;
s_env->size = size;
s_env->sample = malloc(n * size);
}
void sample_set_i(struct s_env *s_env, unsigned int i, void *item)
{
memcpy(s_env->sample + i * s_env->size, item, s_env->size);
}
void *s_of_n(struct s_env *s_env, void *item)
{
s_env->i++;
if (s_env->i <= s_env->n)
sample_set_i(s_env, s_env->i - 1, item);
else if ((rand() % s_env->i) < s_env->n)
sample_set_i(s_env, rand() % s_env->n, item);
return s_env->sample;
}
int *test(unsigned int n, int *items_set, unsigned int num_items)
{
int i;
struct s_env s_env;
s_of_n_init(&s_env, sizeof(items_set[0]), n);
for (i = 0; i < num_items; i++) {
s_of_n(&s_env, (void *) &items_set[i]);
}
return (int *)s_env.sample;
}
int main()
{
unsigned int i, j;
unsigned int n = 3;
unsigned int num_items = 10;
unsigned int *frequencies;
int *items_set;
srand(time(NULL));
items_set = malloc(num_items * sizeof(int));
frequencies = malloc(num_items * sizeof(int));
for (i = 0; i < num_items; i++) {
items_set[i] = i;
frequencies[i] = 0;
}
for (i = 0; i < 100000; i++) {
int *res = test(n, items_set, num_items);
for (j = 0; j < n; j++) {
frequencies[res[j]]++;
}
free(res);
}
for (i = 0; i < num_items; i++) {
printf(" %d", frequencies[i]);
}
puts("");
return 0;
}
| #include <iostream>
#include <functional>
#include <vector>
#include <cstdlib>
#include <ctime>
template <typename T>
std::function<std::vector<T>(T)> s_of_n_creator(int n) {
std::vector<T> sample;
int i = 0;
return [=](T item) mutable {
i++;
if (i <= n) {
sample.push_back(item);
} else if (std::rand() % i < n) {
sample[std::rand() % n] = item;
}
return sample;
};
}
int main() {
std::srand(std::time(NULL));
int bin[10] = {0};
for (int trial = 0; trial < 100000; trial++) {
auto s_of_n = s_of_n_creator<int>(3);
std::vector<int> sample;
for (int i = 0; i < 10; i++)
sample = s_of_n(i);
for (int s : sample)
bin[s]++;
}
for (int x : bin)
std::cout << x << std::endl;
return 0;
}
|
Translate this program into C++ but keep the logic exactly as in C. | #include <stdlib.h>
#include <stdio.h>
#include <string.h>
#include <time.h>
struct s_env {
unsigned int n, i;
size_t size;
void *sample;
};
void s_of_n_init(struct s_env *s_env, size_t size, unsigned int n)
{
s_env->i = 0;
s_env->n = n;
s_env->size = size;
s_env->sample = malloc(n * size);
}
void sample_set_i(struct s_env *s_env, unsigned int i, void *item)
{
memcpy(s_env->sample + i * s_env->size, item, s_env->size);
}
void *s_of_n(struct s_env *s_env, void *item)
{
s_env->i++;
if (s_env->i <= s_env->n)
sample_set_i(s_env, s_env->i - 1, item);
else if ((rand() % s_env->i) < s_env->n)
sample_set_i(s_env, rand() % s_env->n, item);
return s_env->sample;
}
int *test(unsigned int n, int *items_set, unsigned int num_items)
{
int i;
struct s_env s_env;
s_of_n_init(&s_env, sizeof(items_set[0]), n);
for (i = 0; i < num_items; i++) {
s_of_n(&s_env, (void *) &items_set[i]);
}
return (int *)s_env.sample;
}
int main()
{
unsigned int i, j;
unsigned int n = 3;
unsigned int num_items = 10;
unsigned int *frequencies;
int *items_set;
srand(time(NULL));
items_set = malloc(num_items * sizeof(int));
frequencies = malloc(num_items * sizeof(int));
for (i = 0; i < num_items; i++) {
items_set[i] = i;
frequencies[i] = 0;
}
for (i = 0; i < 100000; i++) {
int *res = test(n, items_set, num_items);
for (j = 0; j < n; j++) {
frequencies[res[j]]++;
}
free(res);
}
for (i = 0; i < num_items; i++) {
printf(" %d", frequencies[i]);
}
puts("");
return 0;
}
| #include <iostream>
#include <functional>
#include <vector>
#include <cstdlib>
#include <ctime>
template <typename T>
std::function<std::vector<T>(T)> s_of_n_creator(int n) {
std::vector<T> sample;
int i = 0;
return [=](T item) mutable {
i++;
if (i <= n) {
sample.push_back(item);
} else if (std::rand() % i < n) {
sample[std::rand() % n] = item;
}
return sample;
};
}
int main() {
std::srand(std::time(NULL));
int bin[10] = {0};
for (int trial = 0; trial < 100000; trial++) {
auto s_of_n = s_of_n_creator<int>(3);
std::vector<int> sample;
for (int i = 0; i < 10; i++)
sample = s_of_n(i);
for (int s : sample)
bin[s]++;
}
for (int x : bin)
std::cout << x << std::endl;
return 0;
}
|
Convert this C snippet to C++ and keep its semantics consistent. | #include <stdbool.h>
#include <stdio.h>
#include <stdlib.h>
#include <string.h>
int binomial(int n, int k) {
int num, denom, i;
if (n < 0 || k < 0 || n < k) return -1;
if (n == 0 || k == 0) return 1;
num = 1;
for (i = k + 1; i <= n; ++i) {
num = num * i;
}
denom = 1;
for (i = 2; i <= n - k; ++i) {
denom *= i;
}
return num / denom;
}
int gcd(int a, int b) {
int temp;
while (b != 0) {
temp = a % b;
a = b;
b = temp;
}
return a;
}
typedef struct tFrac {
int num, denom;
} Frac;
Frac makeFrac(int n, int d) {
Frac result;
int g;
if (d == 0) {
result.num = 0;
result.denom = 0;
return result;
}
if (n == 0) {
d = 1;
} else if (d < 0) {
n = -n;
d = -d;
}
g = abs(gcd(n, d));
if (g > 1) {
n = n / g;
d = d / g;
}
result.num = n;
result.denom = d;
return result;
}
Frac negateFrac(Frac f) {
return makeFrac(-f.num, f.denom);
}
Frac subFrac(Frac lhs, Frac rhs) {
return makeFrac(lhs.num * rhs.denom - lhs.denom * rhs.num, rhs.denom * lhs.denom);
}
Frac multFrac(Frac lhs, Frac rhs) {
return makeFrac(lhs.num * rhs.num, lhs.denom * rhs.denom);
}
bool equalFrac(Frac lhs, Frac rhs) {
return (lhs.num == rhs.num) && (lhs.denom == rhs.denom);
}
bool lessFrac(Frac lhs, Frac rhs) {
return (lhs.num * rhs.denom) < (rhs.num * lhs.denom);
}
void printFrac(Frac f) {
char buffer[7];
int len;
if (f.denom != 1) {
snprintf(buffer, 7, "%d/%d", f.num, f.denom);
} else {
snprintf(buffer, 7, "%d", f.num);
}
len = 7 - strlen(buffer);
while (len-- > 0) {
putc(' ', stdout);
}
printf(buffer);
}
Frac bernoulli(int n) {
Frac a[16];
int j, m;
if (n < 0) {
a[0].num = 0;
a[0].denom = 0;
return a[0];
}
for (m = 0; m <= n; ++m) {
a[m] = makeFrac(1, m + 1);
for (j = m; j >= 1; --j) {
a[j - 1] = multFrac(subFrac(a[j - 1], a[j]), makeFrac(j, 1));
}
}
if (n != 1) {
return a[0];
}
return negateFrac(a[0]);
}
void faulhaber(int p) {
Frac q, *coeffs;
int j, sign;
coeffs = malloc(sizeof(Frac)*(p + 1));
q = makeFrac(1, p + 1);
sign = -1;
for (j = 0; j <= p; ++j) {
sign = -1 * sign;
coeffs[p - j] = multFrac(multFrac(multFrac(q, makeFrac(sign, 1)), makeFrac(binomial(p + 1, j), 1)), bernoulli(j));
}
for (j = 0; j <= p; ++j) {
printFrac(coeffs[j]);
}
printf("\n");
free(coeffs);
}
int main() {
int i;
for (i = 0; i < 10; ++i) {
faulhaber(i);
}
return 0;
}
| #include <exception>
#include <iomanip>
#include <iostream>
#include <numeric>
#include <sstream>
#include <vector>
class Frac {
public:
Frac() : num(0), denom(1) {}
Frac(int n, int d) {
if (d == 0) {
throw std::runtime_error("d must not be zero");
}
int sign_of_d = d < 0 ? -1 : 1;
int g = std::gcd(n, d);
num = sign_of_d * n / g;
denom = sign_of_d * d / g;
}
Frac operator-() const {
return Frac(-num, denom);
}
Frac operator+(const Frac& rhs) const {
return Frac(num*rhs.denom + denom * rhs.num, rhs.denom*denom);
}
Frac operator-(const Frac& rhs) const {
return Frac(num*rhs.denom - denom * rhs.num, rhs.denom*denom);
}
Frac operator*(const Frac& rhs) const {
return Frac(num*rhs.num, denom*rhs.denom);
}
Frac operator*(int rhs) const {
return Frac(num * rhs, denom);
}
friend std::ostream& operator<<(std::ostream&, const Frac&);
private:
int num;
int denom;
};
std::ostream & operator<<(std::ostream & os, const Frac &f) {
if (f.num == 0 || f.denom == 1) {
return os << f.num;
}
std::stringstream ss;
ss << f.num << "/" << f.denom;
return os << ss.str();
}
Frac bernoulli(int n) {
if (n < 0) {
throw std::runtime_error("n may not be negative or zero");
}
std::vector<Frac> a;
for (int m = 0; m <= n; m++) {
a.push_back(Frac(1, m + 1));
for (int j = m; j >= 1; j--) {
a[j - 1] = (a[j - 1] - a[j]) * j;
}
}
if (n != 1) return a[0];
return -a[0];
}
int binomial(int n, int k) {
if (n < 0 || k < 0 || n < k) {
throw std::runtime_error("parameters are invalid");
}
if (n == 0 || k == 0) return 1;
int num = 1;
for (int i = k + 1; i <= n; i++) {
num *= i;
}
int denom = 1;
for (int i = 2; i <= n - k; i++) {
denom *= i;
}
return num / denom;
}
std::vector<Frac> faulhaberTraingle(int p) {
std::vector<Frac> coeffs(p + 1);
Frac q{ 1, p + 1 };
int sign = -1;
for (int j = 0; j <= p; j++) {
sign *= -1;
coeffs[p - j] = q * sign * binomial(p + 1, j) * bernoulli(j);
}
return coeffs;
}
int main() {
for (int i = 0; i < 10; i++) {
std::vector<Frac> coeffs = faulhaberTraingle(i);
for (auto frac : coeffs) {
std::cout << std::right << std::setw(5) << frac << " ";
}
std::cout << std::endl;
}
return 0;
}
|
Transform the following C implementation into C++, maintaining the same output and logic. | #include <stdlib.h>
#include <stdio.h>
int main(int argc, char* argv[])
{
int i;
(void) printf("This program is named %s.\n", argv[0]);
for (i = 1; i < argc; ++i)
(void) printf("the argument #%d is %s\n", i, argv[i]);
return EXIT_SUCCESS;
}
| #include <iostream>
int main(int argc, char* argv[])
{
std::cout << "This program is named " << argv[0] << std::endl;
std::cout << "There are " << argc-1 << " arguments given." << std::endl;
for (int i = 1; i < argc; ++i)
std::cout << "the argument #" << i << " is " << argv[i] << std::endl;
return 0;
}
|
Write the same code in C++ as shown below in C. | #include <stdlib.h>
#include <stdio.h>
int main(int argc, char* argv[])
{
int i;
(void) printf("This program is named %s.\n", argv[0]);
for (i = 1; i < argc; ++i)
(void) printf("the argument #%d is %s\n", i, argv[i]);
return EXIT_SUCCESS;
}
| #include <iostream>
int main(int argc, char* argv[])
{
std::cout << "This program is named " << argv[0] << std::endl;
std::cout << "There are " << argc-1 << " arguments given." << std::endl;
for (int i = 1; i < argc; ++i)
std::cout << "the argument #" << i << " is " << argv[i] << std::endl;
return 0;
}
|
Write the same algorithm in C++ as shown in this C implementation. | #include <stdlib.h>
#include <stdio.h>
int main(int argc, char* argv[])
{
int i;
(void) printf("This program is named %s.\n", argv[0]);
for (i = 1; i < argc; ++i)
(void) printf("the argument #%d is %s\n", i, argv[i]);
return EXIT_SUCCESS;
}
| #include <iostream>
int main(int argc, char* argv[])
{
std::cout << "This program is named " << argv[0] << std::endl;
std::cout << "There are " << argc-1 << " arguments given." << std::endl;
for (int i = 1; i < argc; ++i)
std::cout << "the argument #" << i << " is " << argv[i] << std::endl;
return 0;
}
|
Translate this program into C++ but keep the logic exactly as in C. | #include <stdbool.h>
#include <stdio.h>
#define MAX_WORD 80
#define LETTERS 26
bool is_letter(char c) { return c >= 'a' && c <= 'z'; }
int index(char c) { return c - 'a'; }
void word_wheel(const char* letters, char central, int min_length, FILE* dict) {
int max_count[LETTERS] = { 0 };
for (const char* p = letters; *p; ++p) {
char c = *p;
if (is_letter(c))
++max_count[index(c)];
}
char word[MAX_WORD + 1] = { 0 };
while (fgets(word, MAX_WORD, dict)) {
int count[LETTERS] = { 0 };
for (const char* p = word; *p; ++p) {
char c = *p;
if (c == '\n') {
if (p >= word + min_length && count[index(central)] > 0)
printf("%s", word);
} else if (is_letter(c)) {
int i = index(c);
if (++count[i] > max_count[i]) {
break;
}
} else {
break;
}
}
}
}
int main(int argc, char** argv) {
const char* dict = argc == 2 ? argv[1] : "unixdict.txt";
FILE* in = fopen(dict, "r");
if (in == NULL) {
perror(dict);
return 1;
}
word_wheel("ndeokgelw", 'k', 3, in);
fclose(in);
return 0;
}
| #include <array>
#include <iostream>
#include <fstream>
#include <map>
#include <string>
#include <vector>
#include <boost/program_options.hpp>
class letterset {
public:
letterset() {
count_.fill(0);
}
explicit letterset(const std::string& str) {
count_.fill(0);
for (char c : str)
add(c);
}
bool contains(const letterset& set) const {
for (size_t i = 0; i < count_.size(); ++i) {
if (set.count_[i] > count_[i])
return false;
}
return true;
}
unsigned int count(char c) const {
return count_[index(c)];
}
bool is_valid() const {
return count_[0] == 0;
}
void add(char c) {
++count_[index(c)];
}
private:
static bool is_letter(char c) { return c >= 'a' && c <= 'z'; }
static int index(char c) { return is_letter(c) ? c - 'a' + 1 : 0; }
std::array<unsigned int, 27> count_;
};
template <typename iterator, typename separator>
std::string join(iterator begin, iterator end, separator sep) {
std::string result;
if (begin != end) {
result += *begin++;
for (; begin != end; ++begin) {
result += sep;
result += *begin;
}
}
return result;
}
using dictionary = std::vector<std::pair<std::string, letterset>>;
dictionary load_dictionary(const std::string& filename, int min_length,
int max_length) {
std::ifstream in(filename);
if (!in)
throw std::runtime_error("Cannot open file " + filename);
std::string word;
dictionary result;
while (getline(in, word)) {
if (word.size() < min_length)
continue;
if (word.size() > max_length)
continue;
letterset set(word);
if (set.is_valid())
result.emplace_back(word, set);
}
return result;
}
void word_wheel(const dictionary& dict, const std::string& letters,
char central_letter) {
letterset set(letters);
if (central_letter == 0 && !letters.empty())
central_letter = letters.at(letters.size()/2);
std::map<size_t, std::vector<std::string>> words;
for (const auto& pair : dict) {
const auto& word = pair.first;
const auto& subset = pair.second;
if (subset.count(central_letter) > 0 && set.contains(subset))
words[word.size()].push_back(word);
}
size_t total = 0;
for (const auto& p : words) {
const auto& v = p.second;
auto n = v.size();
total += n;
std::cout << "Found " << n << " " << (n == 1 ? "word" : "words")
<< " of length " << p.first << ": "
<< join(v.begin(), v.end(), ", ") << '\n';
}
std::cout << "Number of words found: " << total << '\n';
}
void find_max_word_count(const dictionary& dict, int word_length) {
size_t max_count = 0;
std::vector<std::pair<std::string, char>> max_words;
for (const auto& pair : dict) {
const auto& word = pair.first;
if (word.size() != word_length)
continue;
const auto& set = pair.second;
dictionary subsets;
for (const auto& p : dict) {
if (set.contains(p.second))
subsets.push_back(p);
}
letterset done;
for (size_t index = 0; index < word_length; ++index) {
char central_letter = word[index];
if (done.count(central_letter) > 0)
continue;
done.add(central_letter);
size_t count = 0;
for (const auto& p : subsets) {
const auto& subset = p.second;
if (subset.count(central_letter) > 0)
++count;
}
if (count > max_count) {
max_words.clear();
max_count = count;
}
if (count == max_count)
max_words.emplace_back(word, central_letter);
}
}
std::cout << "Maximum word count: " << max_count << '\n';
std::cout << "Words of " << word_length << " letters producing this count:\n";
for (const auto& pair : max_words)
std::cout << pair.first << " with central letter " << pair.second << '\n';
}
constexpr const char* option_filename = "filename";
constexpr const char* option_wheel = "wheel";
constexpr const char* option_central = "central";
constexpr const char* option_min_length = "min-length";
constexpr const char* option_part2 = "part2";
int main(int argc, char** argv) {
const int word_length = 9;
int min_length = 3;
std::string letters = "ndeokgelw";
std::string filename = "unixdict.txt";
char central_letter = 0;
bool do_part2 = false;
namespace po = boost::program_options;
po::options_description desc("Allowed options");
desc.add_options()
(option_filename, po::value<std::string>(), "name of dictionary file")
(option_wheel, po::value<std::string>(), "word wheel letters")
(option_central, po::value<char>(), "central letter (defaults to middle letter of word)")
(option_min_length, po::value<int>(), "minimum word length")
(option_part2, "include part 2");
try {
po::variables_map vm;
po::store(po::parse_command_line(argc, argv, desc), vm);
po::notify(vm);
if (vm.count(option_filename))
filename = vm[option_filename].as<std::string>();
if (vm.count(option_wheel))
letters = vm[option_wheel].as<std::string>();
if (vm.count(option_central))
central_letter = vm[option_central].as<char>();
if (vm.count(option_min_length))
min_length = vm[option_min_length].as<int>();
if (vm.count(option_part2))
do_part2 = true;
auto dict = load_dictionary(filename, min_length, word_length);
word_wheel(dict, letters, central_letter);
if (do_part2) {
std::cout << '\n';
find_max_word_count(dict, word_length);
}
} catch (const std::exception& ex) {
std::cerr << ex.what() << '\n';
return EXIT_FAILURE;
}
return EXIT_SUCCESS;
}
|
Transform the following C implementation into C++, maintaining the same output and logic. | #include <stdlib.h>
#include <stdio.h>
#include <string.h>
#define ARRAY_CONCAT(TYPE, A, An, B, Bn) \
(TYPE *)array_concat((const void *)(A), (An), (const void *)(B), (Bn), sizeof(TYPE));
void *array_concat(const void *a, size_t an,
const void *b, size_t bn, size_t s)
{
char *p = malloc(s * (an + bn));
memcpy(p, a, an*s);
memcpy(p + an*s, b, bn*s);
return p;
}
const int a[] = { 1, 2, 3, 4, 5 };
const int b[] = { 6, 7, 8, 9, 0 };
int main(void)
{
unsigned int i;
int *c = ARRAY_CONCAT(int, a, 5, b, 5);
for(i = 0; i < 10; i++)
printf("%d\n", c[i]);
free(c);
return EXIT_SUCCCESS;
}
| #include <vector>
#include <iostream>
int main()
{
std::vector<int> a(3), b(4);
a[0] = 11; a[1] = 12; a[2] = 13;
b[0] = 21; b[1] = 22; b[2] = 23; b[3] = 24;
a.insert(a.end(), b.begin(), b.end());
for (int i = 0; i < a.size(); ++i)
std::cout << "a[" << i << "] = " << a[i] << "\n";
}
|
Can you help me rewrite this code in C++ instead of C, keeping it the same logically? | #include <stdio.h>
#include <stdlib.h>
int main(void)
{
char str[BUFSIZ];
puts("Enter a string: ");
fgets(str, sizeof(str), stdin);
long num;
char buf[BUFSIZ];
do
{
puts("Enter 75000: ");
fgets(buf, sizeof(buf), stdin);
num = strtol(buf, NULL, 10);
} while (num != 75000);
return EXIT_SUCCESS;
}
| #include <iostream>
#include <string>
using namespace std;
int main()
{
long int integer_input;
string string_input;
cout << "Enter an integer: ";
cin >> integer_input;
cout << "Enter a string: ";
cin >> string_input;
return 0;
}
|
Generate an equivalent C++ version of this C code. | #include<stdio.h>
#include<conio.h>
#include<math.h>
#include<dos.h>
typedef struct{
char str[3];
int key;
}note;
note sequence[] = {{"Do",0},{"Re",2},{"Mi",4},{"Fa",5},{"So",7},{"La",9},{"Ti",11},{"Do",12}};
int main(void)
{
int i=0;
while(!kbhit())
{
printf("\t%s",sequence[i].str);
sound(261.63*pow(2,sequence[i].key/12.0));
delay(sequence[i].key%12==0?500:1000);
i = (i+1)%8;
i==0?printf("\n"):printf("");
}
nosound();
return 0;
}
| #include <iostream>
#include <windows.h>
#include <mmsystem.h>
#pragma comment ( lib, "winmm.lib" )
typedef unsigned char byte;
typedef union
{
unsigned long word;
unsigned char data[4];
}
midi_msg;
class midi
{
public:
midi()
{
if( midiOutOpen( &device, 0, 0, 0, CALLBACK_NULL) != MMSYSERR_NOERROR )
{
std::cout << "Error opening MIDI Output..." << std::endl;
device = 0;
}
}
~midi()
{
midiOutReset( device );
midiOutClose( device );
}
bool isOpen() { return device != 0; }
void setInstrument( byte i )
{
message.data[0] = 0xc0; message.data[1] = i;
message.data[2] = 0; message.data[3] = 0;
midiOutShortMsg( device, message.word );
}
void playNote( byte n, unsigned i )
{
playNote( n ); Sleep( i ); stopNote( n );
}
private:
void playNote( byte n )
{
message.data[0] = 0x90; message.data[1] = n;
message.data[2] = 127; message.data[3] = 0;
midiOutShortMsg( device, message.word );
}
void stopNote( byte n )
{
message.data[0] = 0x90; message.data[1] = n;
message.data[2] = 0; message.data[3] = 0;
midiOutShortMsg( device, message.word );
}
HMIDIOUT device;
midi_msg message;
};
int main( int argc, char* argv[] )
{
midi m;
if( m.isOpen() )
{
byte notes[] = { 60, 62, 64, 65, 67, 69, 71, 72 };
m.setInstrument( 42 );
for( int x = 0; x < 8; x++ )
m.playNote( notes[x], rand() % 100 + 158 );
Sleep( 1000 );
}
return 0;
}
|
Convert the following code from C to C++, ensuring the logic remains intact. | #include<stdio.h>
#include<conio.h>
#include<math.h>
#include<dos.h>
typedef struct{
char str[3];
int key;
}note;
note sequence[] = {{"Do",0},{"Re",2},{"Mi",4},{"Fa",5},{"So",7},{"La",9},{"Ti",11},{"Do",12}};
int main(void)
{
int i=0;
while(!kbhit())
{
printf("\t%s",sequence[i].str);
sound(261.63*pow(2,sequence[i].key/12.0));
delay(sequence[i].key%12==0?500:1000);
i = (i+1)%8;
i==0?printf("\n"):printf("");
}
nosound();
return 0;
}
| #include <iostream>
#include <windows.h>
#include <mmsystem.h>
#pragma comment ( lib, "winmm.lib" )
typedef unsigned char byte;
typedef union
{
unsigned long word;
unsigned char data[4];
}
midi_msg;
class midi
{
public:
midi()
{
if( midiOutOpen( &device, 0, 0, 0, CALLBACK_NULL) != MMSYSERR_NOERROR )
{
std::cout << "Error opening MIDI Output..." << std::endl;
device = 0;
}
}
~midi()
{
midiOutReset( device );
midiOutClose( device );
}
bool isOpen() { return device != 0; }
void setInstrument( byte i )
{
message.data[0] = 0xc0; message.data[1] = i;
message.data[2] = 0; message.data[3] = 0;
midiOutShortMsg( device, message.word );
}
void playNote( byte n, unsigned i )
{
playNote( n ); Sleep( i ); stopNote( n );
}
private:
void playNote( byte n )
{
message.data[0] = 0x90; message.data[1] = n;
message.data[2] = 127; message.data[3] = 0;
midiOutShortMsg( device, message.word );
}
void stopNote( byte n )
{
message.data[0] = 0x90; message.data[1] = n;
message.data[2] = 0; message.data[3] = 0;
midiOutShortMsg( device, message.word );
}
HMIDIOUT device;
midi_msg message;
};
int main( int argc, char* argv[] )
{
midi m;
if( m.isOpen() )
{
byte notes[] = { 60, 62, 64, 65, 67, 69, 71, 72 };
m.setInstrument( 42 );
for( int x = 0; x < 8; x++ )
m.playNote( notes[x], rand() % 100 + 158 );
Sleep( 1000 );
}
return 0;
}
|
Keep all operations the same but rewrite the snippet in C++. | #include<stdio.h>
#include<conio.h>
#include<math.h>
#include<dos.h>
typedef struct{
char str[3];
int key;
}note;
note sequence[] = {{"Do",0},{"Re",2},{"Mi",4},{"Fa",5},{"So",7},{"La",9},{"Ti",11},{"Do",12}};
int main(void)
{
int i=0;
while(!kbhit())
{
printf("\t%s",sequence[i].str);
sound(261.63*pow(2,sequence[i].key/12.0));
delay(sequence[i].key%12==0?500:1000);
i = (i+1)%8;
i==0?printf("\n"):printf("");
}
nosound();
return 0;
}
| #include <iostream>
#include <windows.h>
#include <mmsystem.h>
#pragma comment ( lib, "winmm.lib" )
typedef unsigned char byte;
typedef union
{
unsigned long word;
unsigned char data[4];
}
midi_msg;
class midi
{
public:
midi()
{
if( midiOutOpen( &device, 0, 0, 0, CALLBACK_NULL) != MMSYSERR_NOERROR )
{
std::cout << "Error opening MIDI Output..." << std::endl;
device = 0;
}
}
~midi()
{
midiOutReset( device );
midiOutClose( device );
}
bool isOpen() { return device != 0; }
void setInstrument( byte i )
{
message.data[0] = 0xc0; message.data[1] = i;
message.data[2] = 0; message.data[3] = 0;
midiOutShortMsg( device, message.word );
}
void playNote( byte n, unsigned i )
{
playNote( n ); Sleep( i ); stopNote( n );
}
private:
void playNote( byte n )
{
message.data[0] = 0x90; message.data[1] = n;
message.data[2] = 127; message.data[3] = 0;
midiOutShortMsg( device, message.word );
}
void stopNote( byte n )
{
message.data[0] = 0x90; message.data[1] = n;
message.data[2] = 0; message.data[3] = 0;
midiOutShortMsg( device, message.word );
}
HMIDIOUT device;
midi_msg message;
};
int main( int argc, char* argv[] )
{
midi m;
if( m.isOpen() )
{
byte notes[] = { 60, 62, 64, 65, 67, 69, 71, 72 };
m.setInstrument( 42 );
for( int x = 0; x < 8; x++ )
m.playNote( notes[x], rand() % 100 + 158 );
Sleep( 1000 );
}
return 0;
}
|
Port the provided C code into C++ while preserving the original functionality. | #include <stdio.h>
#include <stdlib.h>
typedef struct {
char *name;
int weight;
int value;
} item_t;
item_t items[] = {
{"map", 9, 150},
{"compass", 13, 35},
{"water", 153, 200},
{"sandwich", 50, 160},
{"glucose", 15, 60},
{"tin", 68, 45},
{"banana", 27, 60},
{"apple", 39, 40},
{"cheese", 23, 30},
{"beer", 52, 10},
{"suntan cream", 11, 70},
{"camera", 32, 30},
{"T-shirt", 24, 15},
{"trousers", 48, 10},
{"umbrella", 73, 40},
{"waterproof trousers", 42, 70},
{"waterproof overclothes", 43, 75},
{"note-case", 22, 80},
{"sunglasses", 7, 20},
{"towel", 18, 12},
{"socks", 4, 50},
{"book", 30, 10},
};
int *knapsack (item_t *items, int n, int w) {
int i, j, a, b, *mm, **m, *s;
mm = calloc((n + 1) * (w + 1), sizeof (int));
m = malloc((n + 1) * sizeof (int *));
m[0] = mm;
for (i = 1; i <= n; i++) {
m[i] = &mm[i * (w + 1)];
for (j = 0; j <= w; j++) {
if (items[i - 1].weight > j) {
m[i][j] = m[i - 1][j];
}
else {
a = m[i - 1][j];
b = m[i - 1][j - items[i - 1].weight] + items[i - 1].value;
m[i][j] = a > b ? a : b;
}
}
}
s = calloc(n, sizeof (int));
for (i = n, j = w; i > 0; i--) {
if (m[i][j] > m[i - 1][j]) {
s[i - 1] = 1;
j -= items[i - 1].weight;
}
}
free(mm);
free(m);
return s;
}
int main () {
int i, n, tw = 0, tv = 0, *s;
n = sizeof (items) / sizeof (item_t);
s = knapsack(items, n, 400);
for (i = 0; i < n; i++) {
if (s[i]) {
printf("%-22s %5d %5d\n", items[i].name, items[i].weight, items[i].value);
tw += items[i].weight;
tv += items[i].value;
}
}
printf("%-22s %5d %5d\n", "totals:", tw, tv);
return 0;
}
| #include <vector>
#include <string>
#include <iostream>
#include <boost/tuple/tuple.hpp>
#include <set>
int findBestPack( const std::vector<boost::tuple<std::string , int , int> > & ,
std::set<int> & , const int ) ;
int main( ) {
std::vector<boost::tuple<std::string , int , int> > items ;
items.push_back( boost::make_tuple( "" , 0 , 0 ) ) ;
items.push_back( boost::make_tuple( "map" , 9 , 150 ) ) ;
items.push_back( boost::make_tuple( "compass" , 13 , 35 ) ) ;
items.push_back( boost::make_tuple( "water" , 153 , 200 ) ) ;
items.push_back( boost::make_tuple( "sandwich", 50 , 160 ) ) ;
items.push_back( boost::make_tuple( "glucose" , 15 , 60 ) ) ;
items.push_back( boost::make_tuple( "tin", 68 , 45 ) ) ;
items.push_back( boost::make_tuple( "banana", 27 , 60 ) ) ;
items.push_back( boost::make_tuple( "apple" , 39 , 40 ) ) ;
items.push_back( boost::make_tuple( "cheese" , 23 , 30 ) ) ;
items.push_back( boost::make_tuple( "beer" , 52 , 10 ) ) ;
items.push_back( boost::make_tuple( "suntan creme" , 11 , 70 ) ) ;
items.push_back( boost::make_tuple( "camera" , 32 , 30 ) ) ;
items.push_back( boost::make_tuple( "T-shirt" , 24 , 15 ) ) ;
items.push_back( boost::make_tuple( "trousers" , 48 , 10 ) ) ;
items.push_back( boost::make_tuple( "umbrella" , 73 , 40 ) ) ;
items.push_back( boost::make_tuple( "waterproof trousers" , 42 , 70 ) ) ;
items.push_back( boost::make_tuple( "waterproof overclothes" , 43 , 75 ) ) ;
items.push_back( boost::make_tuple( "note-case" , 22 , 80 ) ) ;
items.push_back( boost::make_tuple( "sunglasses" , 7 , 20 ) ) ;
items.push_back( boost::make_tuple( "towel" , 18 , 12 ) ) ;
items.push_back( boost::make_tuple( "socks" , 4 , 50 ) ) ;
items.push_back( boost::make_tuple( "book" , 30 , 10 ) ) ;
const int maximumWeight = 400 ;
std::set<int> bestItems ;
int bestValue = findBestPack( items , bestItems , maximumWeight ) ;
std::cout << "The best value that can be packed in the given knapsack is " <<
bestValue << " !\n" ;
int totalweight = 0 ;
std::cout << "The following items should be packed in the knapsack:\n" ;
for ( std::set<int>::const_iterator si = bestItems.begin( ) ;
si != bestItems.end( ) ; si++ ) {
std::cout << (items.begin( ) + *si)->get<0>( ) << "\n" ;
totalweight += (items.begin( ) + *si)->get<1>( ) ;
}
std::cout << "The total weight of all items is " << totalweight << " !\n" ;
return 0 ;
}
int findBestPack( const std::vector<boost::tuple<std::string , int , int> > & items ,std::set<int> & bestItems , const int weightlimit ) {
const int n = items.size( ) ;
int bestValues [ n ][ weightlimit ] ;
std::set<int> solutionSets[ n ][ weightlimit ] ;
std::set<int> emptyset ;
for ( int i = 0 ; i < n ; i++ ) {
for ( int j = 0 ; j < weightlimit ; j++ ) {
bestValues[ i ][ j ] = 0 ;
solutionSets[ i ][ j ] = emptyset ;
}
}
for ( int i = 0 ; i < n ; i++ ) {
for ( int weight = 0 ; weight < weightlimit ; weight++ ) {
if ( i == 0 )
bestValues[ i ][ weight ] = 0 ;
else {
int itemweight = (items.begin( ) + i)->get<1>( ) ;
if ( weight < itemweight ) {
bestValues[ i ][ weight ] = bestValues[ i - 1 ][ weight ] ;
solutionSets[ i ][ weight ] = solutionSets[ i - 1 ][ weight ] ;
} else {
if ( bestValues[ i - 1 ][ weight - itemweight ] +
(items.begin( ) + i)->get<2>( ) >
bestValues[ i - 1 ][ weight ] ) {
bestValues[ i ][ weight ] =
bestValues[ i - 1 ][ weight - itemweight ] +
(items.begin( ) + i)->get<2>( ) ;
solutionSets[ i ][ weight ] =
solutionSets[ i - 1 ][ weight - itemweight ] ;
solutionSets[ i ][ weight ].insert( i ) ;
}
else {
bestValues[ i ][ weight ] = bestValues[ i - 1 ][ weight ] ;
solutionSets[ i ][ weight ] = solutionSets[ i - 1 ][ weight ] ;
}
}
}
}
}
bestItems.swap( solutionSets[ n - 1][ weightlimit - 1 ] ) ;
return bestValues[ n - 1 ][ weightlimit - 1 ] ;
}
|
Convert this C snippet to C++ and keep its semantics consistent. | #include <math.h>
#include <stdio.h>
#include <stdlib.h>
#include <string.h>
#define MAXPRIME 99
#define MAXPARENT 99
#define NBRPRIMES 30
#define NBRANCESTORS 10
FILE *FileOut;
char format[] = ", %lld";
int Primes[NBRPRIMES];
int iPrimes;
short Ancestors[NBRANCESTORS];
struct Children {
long long Child;
struct Children *pNext;
};
struct Children *Parents[MAXPARENT+1][2];
int CptDescendants[MAXPARENT+1];
long long MaxDescendant = (long long) pow(3.0, 33.0);
short GetParent(long long child);
struct Children *AppendChild(struct Children *node, long long child);
short GetAncestors(short child);
void PrintDescendants(struct Children *node);
int GetPrimes(int primes[], int maxPrime);
int main()
{
long long Child;
short i, Parent, Level;
int TotDesc = 0;
if ((iPrimes = GetPrimes(Primes, MAXPRIME)) < 0)
return 1;
for (Child = 1; Child <= MaxDescendant; Child++)
{
if (Parent = GetParent(Child))
{
Parents[Parent][1] = AppendChild(Parents[Parent][1], Child);
if (Parents[Parent][0] == NULL)
Parents[Parent][0] = Parents[Parent][1];
CptDescendants[Parent]++;
}
}
if (MAXPARENT > MAXPRIME)
if (GetPrimes(Primes, MAXPARENT) < 0)
return 1;
if (fopen_s(&FileOut, "Ancestors.txt", "w"))
return 1;
for (Parent = 1; Parent <= MAXPARENT; Parent++)
{
Level = GetAncestors(Parent);
fprintf(FileOut, "[%d] Level: %d\n", Parent, Level);
if (Level)
{
fprintf(FileOut, "Ancestors: %d", Ancestors[0]);
for (i = 1; i < Level; i++)
fprintf(FileOut, ", %d", Ancestors[i]);
}
else
fprintf(FileOut, "Ancestors: None");
if (CptDescendants[Parent])
{
fprintf(FileOut, "\nDescendants: %d\n", CptDescendants[Parent]);
strcpy_s(format, "%lld");
PrintDescendants(Parents[Parent][0]);
fprintf(FileOut, "\n");
}
else
fprintf(FileOut, "\nDescendants: None\n");
fprintf(FileOut, "\n");
TotDesc += CptDescendants[Parent];
}
fprintf(FileOut, "Total descendants %d\n\n", TotDesc);
if (fclose(FileOut))
return 1;
return 0;
}
short GetParent(long long child)
{
long long Child = child;
short Parent = 0;
short Index = 0;
while (Child > 1 && Parent <= MAXPARENT)
{
if (Index > iPrimes)
return 0;
while (Child % Primes[Index] == 0)
{
Child /= Primes[Index];
Parent += Primes[Index];
}
Index++;
}
if (Parent == child || Parent > MAXPARENT || child == 1)
return 0;
return Parent;
}
struct Children *AppendChild(struct Children *node, long long child)
{
static struct Children *NodeNew;
if (NodeNew = (struct Children *) malloc(sizeof(struct Children)))
{
NodeNew->Child = child;
NodeNew->pNext = NULL;
if (node != NULL)
node->pNext = NodeNew;
}
return NodeNew;
}
short GetAncestors(short child)
{
short Child = child;
short Parent = 0;
short Index = 0;
while (Child > 1)
{
while (Child % Primes[Index] == 0)
{
Child /= Primes[Index];
Parent += Primes[Index];
}
Index++;
}
if (Parent == child || child == 1)
return 0;
Index = GetAncestors(Parent);
Ancestors[Index] = Parent;
return ++Index;
}
void PrintDescendants(struct Children *node)
{
static struct Children *NodeCurr;
static struct Children *NodePrev;
NodeCurr = node;
NodePrev = NULL;
while (NodeCurr)
{
fprintf(FileOut, format, NodeCurr->Child);
strcpy_s(format, ", %lld");
NodePrev = NodeCurr;
NodeCurr = NodeCurr->pNext;
free(NodePrev);
}
return;
}
int GetPrimes(int primes[], int maxPrime)
{
if (maxPrime < 2)
return -1;
int Index = 0, Value = 1;
int Max, i;
primes[0] = 2;
while ((Value += 2) <= maxPrime)
{
Max = (int) floor(sqrt((double) Value));
for (i = 0; i <= Index; i++)
{
if (primes[i] > Max)
{
if (++Index >= NBRPRIMES)
return -1;
primes[Index] = Value;
break;
}
if (Value % primes[i] == 0)
break;
}
}
return Index;
}
| #include <algorithm>
#include <iostream>
#include <vector>
typedef unsigned long long integer;
std::vector<integer> get_ancestors(const std::vector<integer>& ancestor, integer n) {
std::vector<integer> result;
for (integer a = ancestor[n]; a != 0 && a != n; ) {
n = a;
a = ancestor[n];
result.push_back(n);
}
return result;
}
void print_vector(const std::vector<integer>& vec) {
if (vec.empty()) {
std::cout << "none\n";
return;
}
auto i = vec.begin();
std::cout << *i++;
for (; i != vec.end(); ++i)
std::cout << ", " << *i;
std::cout << '\n';
}
bool is_prime(integer n) {
if (n < 2)
return false;
if (n % 2 == 0)
return n == 2;
for (integer p = 3; p * p <= n; p += 2) {
if (n % p == 0)
return false;
}
return true;
}
int main(int argc, char** argv) {
const size_t limit = 100;
std::vector<integer> ancestor(limit, 0);
std::vector<std::vector<integer>> descendants(limit);
for (size_t prime = 0; prime < limit; ++prime) {
if (!is_prime(prime))
continue;
descendants[prime].push_back(prime);
for (size_t i = 0; i + prime < limit; ++i) {
integer s = i + prime;
for (integer n : descendants[i]) {
integer prod = n * prime;
descendants[s].push_back(prod);
if (prod < limit)
ancestor[prod] = s;
}
}
}
size_t total_descendants = 0;
for (integer i = 1; i < limit; ++i) {
std::vector<integer> ancestors(get_ancestors(ancestor, i));
std::cout << "[" << i << "] Level: " << ancestors.size() << '\n';
std::cout << "Ancestors: ";
std::sort(ancestors.begin(), ancestors.end());
print_vector(ancestors);
std::cout << "Descendants: ";
std::vector<integer>& desc = descendants[i];
if (!desc.empty()) {
std::sort(desc.begin(), desc.end());
if (desc[0] == i)
desc.erase(desc.begin());
}
std::cout << desc.size() << '\n';
total_descendants += desc.size();
if (!desc.empty())
print_vector(desc);
std::cout << '\n';
}
std::cout << "Total descendants: " << total_descendants << '\n';
return 0;
}
|
Convert this C block to C++, preserving its control flow and logic. | #include<string.h>
#include<stdlib.h>
#include<stdio.h>
void cartesianProduct(int** sets, int* setLengths, int* currentSet, int numSets, int times){
int i,j;
if(times==numSets){
printf("(");
for(i=0;i<times;i++){
printf("%d,",currentSet[i]);
}
printf("\b),");
}
else{
for(j=0;j<setLengths[times];j++){
currentSet[times] = sets[times][j];
cartesianProduct(sets,setLengths,currentSet,numSets,times+1);
}
}
}
void printSets(int** sets, int* setLengths, int numSets){
int i,j;
printf("\nNumber of sets : %d",numSets);
for(i=0;i<numSets+1;i++){
printf("\nSet %d : ",i+1);
for(j=0;j<setLengths[i];j++){
printf(" %d ",sets[i][j]);
}
}
}
void processInputString(char* str){
int **sets, *currentSet, *setLengths, setLength, numSets = 0, i,j,k,l,start,counter=0;
char *token,*holder,*holderToken;
for(i=0;str[i]!=00;i++)
if(str[i]=='x')
numSets++;
if(numSets==0){
printf("\n%s",str);
return;
}
currentSet = (int*)calloc(sizeof(int),numSets + 1);
setLengths = (int*)calloc(sizeof(int),numSets + 1);
sets = (int**)malloc((numSets + 1)*sizeof(int*));
token = strtok(str,"x");
while(token!=NULL){
holder = (char*)malloc(strlen(token)*sizeof(char));
j = 0;
for(i=0;token[i]!=00;i++){
if(token[i]>='0' && token[i]<='9')
holder[j++] = token[i];
else if(token[i]==',')
holder[j++] = ' ';
}
holder[j] = 00;
setLength = 0;
for(i=0;holder[i]!=00;i++)
if(holder[i]==' ')
setLength++;
if(setLength==0 && strlen(holder)==0){
printf("\n{}");
return;
}
setLengths[counter] = setLength+1;
sets[counter] = (int*)malloc((1+setLength)*sizeof(int));
k = 0;
start = 0;
for(l=0;holder[l]!=00;l++){
if(holder[l+1]==' '||holder[l+1]==00){
holderToken = (char*)malloc((l+1-start)*sizeof(char));
strncpy(holderToken,holder + start,l+1-start);
sets[counter][k++] = atoi(holderToken);
start = l+2;
}
}
counter++;
token = strtok(NULL,"x");
}
printf("\n{");
cartesianProduct(sets,setLengths,currentSet,numSets + 1,0);
printf("\b}");
}
int main(int argC,char* argV[])
{
if(argC!=2)
printf("Usage : %s <Set product expression enclosed in double quotes>",argV[0]);
else
processInputString(argV[1]);
return 0;
}
| #include <iostream>
#include <vector>
#include <algorithm>
void print(const std::vector<std::vector<int>>& v) {
std::cout << "{ ";
for (const auto& p : v) {
std::cout << "(";
for (const auto& e : p) {
std::cout << e << " ";
}
std::cout << ") ";
}
std::cout << "}" << std::endl;
}
auto product(const std::vector<std::vector<int>>& lists) {
std::vector<std::vector<int>> result;
if (std::find_if(std::begin(lists), std::end(lists),
[](auto e) -> bool { return e.size() == 0; }) != std::end(lists)) {
return result;
}
for (auto& e : lists[0]) {
result.push_back({ e });
}
for (size_t i = 1; i < lists.size(); ++i) {
std::vector<std::vector<int>> temp;
for (auto& e : result) {
for (auto f : lists[i]) {
auto e_tmp = e;
e_tmp.push_back(f);
temp.push_back(e_tmp);
}
}
result = temp;
}
return result;
}
int main() {
std::vector<std::vector<int>> prods[] = {
{ { 1, 2 }, { 3, 4 } },
{ { 3, 4 }, { 1, 2} },
{ { 1, 2 }, { } },
{ { }, { 1, 2 } },
{ { 1776, 1789 }, { 7, 12 }, { 4, 14, 23 }, { 0, 1 } },
{ { 1, 2, 3 }, { 30 }, { 500, 100 } },
{ { 1, 2, 3 }, { }, { 500, 100 } }
};
for (const auto& p : prods) {
print(product(p));
}
std::cin.ignore();
std::cin.get();
return 0;
}
|
Change the programming language of this snippet from C to C++ without modifying what it does. | #include<string.h>
#include<stdlib.h>
#include<stdio.h>
void cartesianProduct(int** sets, int* setLengths, int* currentSet, int numSets, int times){
int i,j;
if(times==numSets){
printf("(");
for(i=0;i<times;i++){
printf("%d,",currentSet[i]);
}
printf("\b),");
}
else{
for(j=0;j<setLengths[times];j++){
currentSet[times] = sets[times][j];
cartesianProduct(sets,setLengths,currentSet,numSets,times+1);
}
}
}
void printSets(int** sets, int* setLengths, int numSets){
int i,j;
printf("\nNumber of sets : %d",numSets);
for(i=0;i<numSets+1;i++){
printf("\nSet %d : ",i+1);
for(j=0;j<setLengths[i];j++){
printf(" %d ",sets[i][j]);
}
}
}
void processInputString(char* str){
int **sets, *currentSet, *setLengths, setLength, numSets = 0, i,j,k,l,start,counter=0;
char *token,*holder,*holderToken;
for(i=0;str[i]!=00;i++)
if(str[i]=='x')
numSets++;
if(numSets==0){
printf("\n%s",str);
return;
}
currentSet = (int*)calloc(sizeof(int),numSets + 1);
setLengths = (int*)calloc(sizeof(int),numSets + 1);
sets = (int**)malloc((numSets + 1)*sizeof(int*));
token = strtok(str,"x");
while(token!=NULL){
holder = (char*)malloc(strlen(token)*sizeof(char));
j = 0;
for(i=0;token[i]!=00;i++){
if(token[i]>='0' && token[i]<='9')
holder[j++] = token[i];
else if(token[i]==',')
holder[j++] = ' ';
}
holder[j] = 00;
setLength = 0;
for(i=0;holder[i]!=00;i++)
if(holder[i]==' ')
setLength++;
if(setLength==0 && strlen(holder)==0){
printf("\n{}");
return;
}
setLengths[counter] = setLength+1;
sets[counter] = (int*)malloc((1+setLength)*sizeof(int));
k = 0;
start = 0;
for(l=0;holder[l]!=00;l++){
if(holder[l+1]==' '||holder[l+1]==00){
holderToken = (char*)malloc((l+1-start)*sizeof(char));
strncpy(holderToken,holder + start,l+1-start);
sets[counter][k++] = atoi(holderToken);
start = l+2;
}
}
counter++;
token = strtok(NULL,"x");
}
printf("\n{");
cartesianProduct(sets,setLengths,currentSet,numSets + 1,0);
printf("\b}");
}
int main(int argC,char* argV[])
{
if(argC!=2)
printf("Usage : %s <Set product expression enclosed in double quotes>",argV[0]);
else
processInputString(argV[1]);
return 0;
}
| #include <iostream>
#include <vector>
#include <algorithm>
void print(const std::vector<std::vector<int>>& v) {
std::cout << "{ ";
for (const auto& p : v) {
std::cout << "(";
for (const auto& e : p) {
std::cout << e << " ";
}
std::cout << ") ";
}
std::cout << "}" << std::endl;
}
auto product(const std::vector<std::vector<int>>& lists) {
std::vector<std::vector<int>> result;
if (std::find_if(std::begin(lists), std::end(lists),
[](auto e) -> bool { return e.size() == 0; }) != std::end(lists)) {
return result;
}
for (auto& e : lists[0]) {
result.push_back({ e });
}
for (size_t i = 1; i < lists.size(); ++i) {
std::vector<std::vector<int>> temp;
for (auto& e : result) {
for (auto f : lists[i]) {
auto e_tmp = e;
e_tmp.push_back(f);
temp.push_back(e_tmp);
}
}
result = temp;
}
return result;
}
int main() {
std::vector<std::vector<int>> prods[] = {
{ { 1, 2 }, { 3, 4 } },
{ { 3, 4 }, { 1, 2} },
{ { 1, 2 }, { } },
{ { }, { 1, 2 } },
{ { 1776, 1789 }, { 7, 12 }, { 4, 14, 23 }, { 0, 1 } },
{ { 1, 2, 3 }, { 30 }, { 500, 100 } },
{ { 1, 2, 3 }, { }, { 500, 100 } }
};
for (const auto& p : prods) {
print(product(p));
}
std::cin.ignore();
std::cin.get();
return 0;
}
|
Can you help me rewrite this code in C++ instead of C, keeping it the same logically? | #include<string.h>
#include<stdlib.h>
#include<stdio.h>
void cartesianProduct(int** sets, int* setLengths, int* currentSet, int numSets, int times){
int i,j;
if(times==numSets){
printf("(");
for(i=0;i<times;i++){
printf("%d,",currentSet[i]);
}
printf("\b),");
}
else{
for(j=0;j<setLengths[times];j++){
currentSet[times] = sets[times][j];
cartesianProduct(sets,setLengths,currentSet,numSets,times+1);
}
}
}
void printSets(int** sets, int* setLengths, int numSets){
int i,j;
printf("\nNumber of sets : %d",numSets);
for(i=0;i<numSets+1;i++){
printf("\nSet %d : ",i+1);
for(j=0;j<setLengths[i];j++){
printf(" %d ",sets[i][j]);
}
}
}
void processInputString(char* str){
int **sets, *currentSet, *setLengths, setLength, numSets = 0, i,j,k,l,start,counter=0;
char *token,*holder,*holderToken;
for(i=0;str[i]!=00;i++)
if(str[i]=='x')
numSets++;
if(numSets==0){
printf("\n%s",str);
return;
}
currentSet = (int*)calloc(sizeof(int),numSets + 1);
setLengths = (int*)calloc(sizeof(int),numSets + 1);
sets = (int**)malloc((numSets + 1)*sizeof(int*));
token = strtok(str,"x");
while(token!=NULL){
holder = (char*)malloc(strlen(token)*sizeof(char));
j = 0;
for(i=0;token[i]!=00;i++){
if(token[i]>='0' && token[i]<='9')
holder[j++] = token[i];
else if(token[i]==',')
holder[j++] = ' ';
}
holder[j] = 00;
setLength = 0;
for(i=0;holder[i]!=00;i++)
if(holder[i]==' ')
setLength++;
if(setLength==0 && strlen(holder)==0){
printf("\n{}");
return;
}
setLengths[counter] = setLength+1;
sets[counter] = (int*)malloc((1+setLength)*sizeof(int));
k = 0;
start = 0;
for(l=0;holder[l]!=00;l++){
if(holder[l+1]==' '||holder[l+1]==00){
holderToken = (char*)malloc((l+1-start)*sizeof(char));
strncpy(holderToken,holder + start,l+1-start);
sets[counter][k++] = atoi(holderToken);
start = l+2;
}
}
counter++;
token = strtok(NULL,"x");
}
printf("\n{");
cartesianProduct(sets,setLengths,currentSet,numSets + 1,0);
printf("\b}");
}
int main(int argC,char* argV[])
{
if(argC!=2)
printf("Usage : %s <Set product expression enclosed in double quotes>",argV[0]);
else
processInputString(argV[1]);
return 0;
}
| #include <iostream>
#include <vector>
#include <algorithm>
void print(const std::vector<std::vector<int>>& v) {
std::cout << "{ ";
for (const auto& p : v) {
std::cout << "(";
for (const auto& e : p) {
std::cout << e << " ";
}
std::cout << ") ";
}
std::cout << "}" << std::endl;
}
auto product(const std::vector<std::vector<int>>& lists) {
std::vector<std::vector<int>> result;
if (std::find_if(std::begin(lists), std::end(lists),
[](auto e) -> bool { return e.size() == 0; }) != std::end(lists)) {
return result;
}
for (auto& e : lists[0]) {
result.push_back({ e });
}
for (size_t i = 1; i < lists.size(); ++i) {
std::vector<std::vector<int>> temp;
for (auto& e : result) {
for (auto f : lists[i]) {
auto e_tmp = e;
e_tmp.push_back(f);
temp.push_back(e_tmp);
}
}
result = temp;
}
return result;
}
int main() {
std::vector<std::vector<int>> prods[] = {
{ { 1, 2 }, { 3, 4 } },
{ { 3, 4 }, { 1, 2} },
{ { 1, 2 }, { } },
{ { }, { 1, 2 } },
{ { 1776, 1789 }, { 7, 12 }, { 4, 14, 23 }, { 0, 1 } },
{ { 1, 2, 3 }, { 30 }, { 500, 100 } },
{ { 1, 2, 3 }, { }, { 500, 100 } }
};
for (const auto& p : prods) {
print(product(p));
}
std::cin.ignore();
std::cin.get();
return 0;
}
|
Change the programming language of this snippet from C to C++ without modifying what it does. | #include <stdlib.h>
#include <stdio.h>
#include <math.h>
typedef double (*Class2Func)(double);
double functionA( double v)
{
return v*v*v;
}
double functionB(double v)
{
return exp(log(v)/3);
}
double Function1( Class2Func f2, double val )
{
return f2(val);
}
Class2Func WhichFunc( int idx)
{
return (idx < 4) ? &functionA : &functionB;
}
Class2Func funcListA[] = {&functionA, &sin, &cos, &tan };
Class2Func funcListB[] = {&functionB, &asin, &acos, &atan };
double InvokeComposed( Class2Func f1, Class2Func f2, double val )
{
return f1(f2(val));
}
typedef struct sComposition {
Class2Func f1;
Class2Func f2;
} *Composition;
Composition Compose( Class2Func f1, Class2Func f2)
{
Composition comp = malloc(sizeof(struct sComposition));
comp->f1 = f1;
comp->f2 = f2;
return comp;
}
double CallComposed( Composition comp, double val )
{
return comp->f1( comp->f2(val) );
}
int main(int argc, char *argv[])
{
int ix;
Composition c;
printf("Function1(functionA, 3.0) = %f\n", Function1(WhichFunc(0), 3.0));
for (ix=0; ix<4; ix++) {
c = Compose(funcListA[ix], funcListB[ix]);
printf("Compostion %d(0.9) = %f\n", ix, CallComposed(c, 0.9));
}
return 0;
}
| #include <functional>
#include <algorithm>
#include <iostream>
#include <vector>
#include <cmath>
using std::cout;
using std::endl;
using std::vector;
using std::function;
using std::transform;
using std::back_inserter;
typedef function<double(double)> FunType;
vector<FunType> A = {sin, cos, tan, [](double x) { return x*x*x; } };
vector<FunType> B = {asin, acos, atan, [](double x) { return exp(log(x)/3); } };
template <typename A, typename B, typename C>
function<C(A)> compose(function<C(B)> f, function<B(A)> g) {
return [f,g](A x) { return f(g(x)); };
}
int main() {
vector<FunType> composedFuns;
auto exNums = {0.0, 0.2, 0.4, 0.6, 0.8, 1.0};
transform(B.begin(), B.end(),
A.begin(),
back_inserter(composedFuns),
compose<double, double, double>);
for (auto num: exNums)
for (auto fun: composedFuns)
cout << u8"f\u207B\u00B9.f(" << num << ") = " << fun(num) << endl;
return 0;
}
|
Write a version of this C function in C++ with identical behavior. | #include <stdio.h>
#include <stdbool.h>
int proper_divisors(const int n, bool print_flag)
{
int count = 0;
for (int i = 1; i < n; ++i) {
if (n % i == 0) {
count++;
if (print_flag)
printf("%d ", i);
}
}
if (print_flag)
printf("\n");
return count;
}
int main(void)
{
for (int i = 1; i <= 10; ++i) {
printf("%d: ", i);
proper_divisors(i, true);
}
int max = 0;
int max_i = 1;
for (int i = 1; i <= 20000; ++i) {
int v = proper_divisors(i, false);
if (v >= max) {
max = v;
max_i = i;
}
}
printf("%d with %d divisors\n", max_i, max);
return 0;
}
| #include <vector>
#include <iostream>
#include <algorithm>
std::vector<int> properDivisors ( int number ) {
std::vector<int> divisors ;
for ( int i = 1 ; i < number / 2 + 1 ; i++ )
if ( number % i == 0 )
divisors.push_back( i ) ;
return divisors ;
}
int main( ) {
std::vector<int> divisors ;
unsigned int maxdivisors = 0 ;
int corresponding_number = 0 ;
for ( int i = 1 ; i < 11 ; i++ ) {
divisors = properDivisors ( i ) ;
std::cout << "Proper divisors of " << i << ":\n" ;
for ( int number : divisors ) {
std::cout << number << " " ;
}
std::cout << std::endl ;
divisors.clear( ) ;
}
for ( int i = 11 ; i < 20001 ; i++ ) {
divisors = properDivisors ( i ) ;
if ( divisors.size( ) > maxdivisors ) {
maxdivisors = divisors.size( ) ;
corresponding_number = i ;
}
divisors.clear( ) ;
}
std::cout << "Most divisors has " << corresponding_number <<
" , it has " << maxdivisors << " divisors!\n" ;
return 0 ;
}
|
Write a version of this C function in C++ with identical behavior. | #include <stdio.h>
#include <stdlib.h>
#include <string.h>
#include <libxml/parser.h>
#include <libxml/tree.h>
const char *names[] = {
"April", "Tam O'Shanter", "Emily", NULL
};
const char *remarks[] = {
"Bubbly: I'm > Tam and <= Emily",
"Burns: \"When chapman billies leave the street ...\"",
"Short & shrift", NULL
};
int main()
{
xmlDoc *doc = NULL;
xmlNode *root = NULL, *node;
const char **next;
int a;
doc = xmlNewDoc("1.0");
root = xmlNewNode(NULL, "CharacterRemarks");
xmlDocSetRootElement(doc, root);
for(next = names, a = 0; *next != NULL; next++, a++) {
node = xmlNewNode(NULL, "Character");
(void)xmlNewProp(node, "name", *next);
xmlAddChild(node, xmlNewText(remarks[a]));
xmlAddChild(root, node);
}
xmlElemDump(stdout, doc, root);
xmlFreeDoc(doc);
xmlCleanupParser();
return EXIT_SUCCESS;
}
| #include <vector>
#include <utility>
#include <iostream>
#include <boost/algorithm/string.hpp>
std::string create_xml( std::vector<std::string> & ,std::vector<std::string> & ) ;
int main( ) {
std::vector<std::string> names , remarks ;
names.push_back( "April" ) ;
names.push_back( "Tam O'Shantor" ) ;
names.push_back ( "Emily" ) ;
remarks.push_back( "Bubbly, I'm > Tam and <= Emily" ) ;
remarks.push_back( "Burns: \"When chapman billies leave the street ...\"" ) ;
remarks.push_back( "Short & shrift" ) ;
std::cout << "This is in XML:\n" ;
std::cout << create_xml( names , remarks ) << std::endl ;
return 0 ;
}
std::string create_xml( std::vector<std::string> & names ,
std::vector<std::string> & remarks ) {
std::vector<std::pair<std::string , std::string> > entities ;
entities.push_back( std::make_pair( "&" , "&" ) ) ;
entities.push_back( std::make_pair( "<" , "<" ) ) ;
entities.push_back( std::make_pair( ">" , ">" ) ) ;
std::string xmlstring ( "<CharacterRemarks>\n" ) ;
std::vector<std::string>::iterator vsi = names.begin( ) ;
typedef std::vector<std::pair<std::string , std::string> >::iterator Vpss ;
for ( ; vsi != names.end( ) ; vsi++ ) {
for ( Vpss vs = entities.begin( ) ; vs != entities.end( ) ; vs++ ) {
boost::replace_all ( *vsi , vs->first , vs->second ) ;
}
}
for ( vsi = remarks.begin( ) ; vsi != remarks.end( ) ; vsi++ ) {
for ( Vpss vs = entities.begin( ) ; vs != entities.end( ) ; vs++ ) {
boost::replace_all ( *vsi , vs->first , vs->second ) ;
}
}
for ( int i = 0 ; i < names.size( ) ; i++ ) {
xmlstring.append( "\t<Character name=\"").append( names[ i ] ).append( "\">")
.append( remarks[ i ] ).append( "</Character>\n" ) ;
}
xmlstring.append( "</CharacterRemarks>" ) ;
return xmlstring ;
}
|
Port the provided C code into C++ while preserving the original functionality. | #include <stdio.h>
#include <stdlib.h>
#include <math.h>
#include <plot.h>
#define NP 10
double x[NP] = {0, 1, 2, 3, 4, 5, 6, 7, 8, 9};
double y[NP] = {2.7, 2.8, 31.4, 38.1, 58.0, 76.2, 100.5, 130.0, 149.3, 180.0};
void minmax(double *x, double *y,
double *minx, double *maxx,
double *miny, double *maxy, int n)
{
int i;
*minx = *maxx = x[0];
*miny = *maxy = y[0];
for(i=1; i < n; i++) {
if ( x[i] < *minx ) *minx = x[i];
if ( x[i] > *maxx ) *maxx = x[i];
if ( y[i] < *miny ) *miny = y[i];
if ( y[i] > *maxy ) *maxy = y[i];
}
}
#define YLAB_HEIGHT_F 0.1
#define XLAB_WIDTH_F 0.2
#define XDIV (NP*1.0)
#define YDIV (NP*1.0)
#define EXTRA_W 0.01
#define EXTRA_H 0.01
#define DOTSCALE (1.0/150.0)
#define MAXLABLEN 32
#define PUSHSCALE(X,Y) pl_fscale((X),(Y))
#define POPSCALE(X,Y) pl_fscale(1.0/(X), 1.0/(Y))
#define FMOVESCALE(X,Y) pl_fmove((X)/sx, (Y)/sy)
int main()
{
int plotter, i;
double minx, miny, maxx, maxy;
double lx, ly;
double xticstep, yticstep, nx, ny;
double sx, sy;
char labs[MAXLABLEN+1];
plotter = pl_newpl("png", NULL, stdout, NULL);
if ( plotter < 0 ) exit(1);
pl_selectpl(plotter);
if ( pl_openpl() < 0 ) exit(1);
minmax(x, y, &minx, &maxx, &miny, &maxy, NP);
lx = maxx - minx;
ly = maxy - miny;
pl_fspace(floor(minx) - XLAB_WIDTH_F * lx, floor(miny) - YLAB_HEIGHT_F * ly,
ceil(maxx) + EXTRA_W * lx, ceil(maxy) + EXTRA_H * ly);
xticstep = (ceil(maxx) - floor(minx)) / XDIV;
yticstep = (ceil(maxy) - floor(miny)) / YDIV;
pl_flinewidth(0.25);
if ( lx < ly ) {
sx = lx/ly;
sy = 1.0;
} else {
sx = 1.0;
sy = ly/lx;
}
pl_erase();
pl_fbox(floor(minx), floor(miny),
ceil(maxx), ceil(maxy));
pl_fontname("HersheySerif");
for(ny=floor(miny); ny < ceil(maxy); ny += yticstep) {
pl_fline(floor(minx), ny, ceil(maxx), ny);
snprintf(labs, MAXLABLEN, "%6.2lf", ny);
FMOVESCALE(floor(minx) - XLAB_WIDTH_F * lx, ny);
PUSHSCALE(sx,sy);
pl_label(labs);
POPSCALE(sx,sy);
}
for(nx=floor(minx); nx < ceil(maxx); nx += xticstep) {
pl_fline(nx, floor(miny), nx, ceil(maxy));
snprintf(labs, MAXLABLEN, "%6.2lf", nx);
FMOVESCALE(nx, floor(miny));
PUSHSCALE(sx,sy);
pl_ftextangle(-90);
pl_alabel('l', 'b', labs);
POPSCALE(sx,sy);
}
pl_fillcolorname("red");
pl_filltype(1);
for(i=0; i < NP; i++)
{
pl_fbox(x[i] - lx * DOTSCALE, y[i] - ly * DOTSCALE,
x[i] + lx * DOTSCALE, y[i] + ly * DOTSCALE);
}
pl_flushpl();
pl_closepl();
}
| #include <windows.h>
#include <string>
#include <vector>
using namespace std;
const int HSTEP = 46, MWID = 40, MHEI = 471;
const float VSTEP = 2.3f;
class vector2
{
public:
vector2() { x = y = 0; }
vector2( float a, float b ) { x = a; y = b; }
void set( float a, float b ) { x = a; y = b; }
float x, y;
};
class myBitmap
{
public:
myBitmap() : pen( NULL ), brush( NULL ), clr( 0 ), wid( 1 ) {}
~myBitmap()
{
DeleteObject( pen );
DeleteObject( brush );
DeleteDC( hdc );
DeleteObject( bmp );
}
bool create( int w, int h )
{
BITMAPINFO bi;
ZeroMemory( &bi, sizeof( bi ) );
bi.bmiHeader.biSize = sizeof( bi.bmiHeader );
bi.bmiHeader.biBitCount = sizeof( DWORD ) * 8;
bi.bmiHeader.biCompression = BI_RGB;
bi.bmiHeader.biPlanes = 1;
bi.bmiHeader.biWidth = w;
bi.bmiHeader.biHeight = -h;
HDC dc = GetDC( GetConsoleWindow() );
bmp = CreateDIBSection( dc, &bi, DIB_RGB_COLORS, &pBits, NULL, 0 );
if( !bmp ) return false;
hdc = CreateCompatibleDC( dc );
SelectObject( hdc, bmp );
ReleaseDC( GetConsoleWindow(), dc );
width = w; height = h;
return true;
}
void clear( BYTE clr = 0 )
{
memset( pBits, clr, width * height * sizeof( DWORD ) );
}
void setBrushColor( DWORD bClr )
{
if( brush ) DeleteObject( brush );
brush = CreateSolidBrush( bClr );
SelectObject( hdc, brush );
}
void setPenColor( DWORD c ) { clr = c; createPen(); }
void setPenWidth( int w ) { wid = w; createPen(); }
void saveBitmap( string path )
{
BITMAPFILEHEADER fileheader;
BITMAPINFO infoheader;
BITMAP bitmap;
DWORD wb;
GetObject( bmp, sizeof( bitmap ), &bitmap );
DWORD* dwpBits = new DWORD[bitmap.bmWidth * bitmap.bmHeight];
ZeroMemory( dwpBits, bitmap.bmWidth * bitmap.bmHeight * sizeof( DWORD ) );
ZeroMemory( &infoheader, sizeof( BITMAPINFO ) );
ZeroMemory( &fileheader, sizeof( BITMAPFILEHEADER ) );
infoheader.bmiHeader.biBitCount = sizeof( DWORD ) * 8;
infoheader.bmiHeader.biCompression = BI_RGB;
infoheader.bmiHeader.biPlanes = 1;
infoheader.bmiHeader.biSize = sizeof( infoheader.bmiHeader );
infoheader.bmiHeader.biHeight = bitmap.bmHeight;
infoheader.bmiHeader.biWidth = bitmap.bmWidth;
infoheader.bmiHeader.biSizeImage = bitmap.bmWidth * bitmap.bmHeight * sizeof( DWORD );
fileheader.bfType = 0x4D42;
fileheader.bfOffBits = sizeof( infoheader.bmiHeader ) + sizeof( BITMAPFILEHEADER );
fileheader.bfSize = fileheader.bfOffBits + infoheader.bmiHeader.biSizeImage;
GetDIBits( hdc, bmp, 0, height, ( LPVOID )dwpBits, &infoheader, DIB_RGB_COLORS );
HANDLE file = CreateFile( path.c_str(), GENERIC_WRITE, 0, NULL, CREATE_ALWAYS, FILE_ATTRIBUTE_NORMAL, NULL );
WriteFile( file, &fileheader, sizeof( BITMAPFILEHEADER ), &wb, NULL );
WriteFile( file, &infoheader.bmiHeader, sizeof( infoheader.bmiHeader ), &wb, NULL );
WriteFile( file, dwpBits, bitmap.bmWidth * bitmap.bmHeight * 4, &wb, NULL );
CloseHandle( file );
delete [] dwpBits;
}
HDC getDC() const { return hdc; }
int getWidth() const { return width; }
int getHeight() const { return height; }
private:
void createPen()
{
if( pen ) DeleteObject( pen );
pen = CreatePen( PS_SOLID, wid, clr );
SelectObject( hdc, pen );
}
HBITMAP bmp;
HDC hdc;
HPEN pen;
HBRUSH brush;
void *pBits;
int width, height, wid;
DWORD clr;
};
class plot
{
public:
plot() { bmp.create( 512, 512 ); }
void draw( vector<vector2>* pairs )
{
bmp.clear( 0xff );
drawGraph( pairs );
plotIt( pairs );
HDC dc = GetDC( GetConsoleWindow() );
BitBlt( dc, 0, 30, 512, 512, bmp.getDC(), 0, 0, SRCCOPY );
ReleaseDC( GetConsoleWindow(), dc );
}
private:
void drawGraph( vector<vector2>* pairs )
{
HDC dc = bmp.getDC();
bmp.setPenColor( RGB( 240, 240, 240 ) );
DWORD b = 11, c = 40, x;
RECT rc; char txt[8];
for( x = 0; x < pairs->size(); x++ )
{
MoveToEx( dc, 40, b, NULL ); LineTo( dc, 500, b );
MoveToEx( dc, c, 11, NULL ); LineTo( dc, c, 471 );
wsprintf( txt, "%d", ( pairs->size() - x ) * 20 );
SetRect( &rc, 0, b - 9, 36, b + 11 );
DrawText( dc, txt, lstrlen( txt ), &rc, DT_RIGHT | DT_VCENTER | DT_SINGLELINE );
wsprintf( txt, "%d", x );
SetRect( &rc, c - 8, 472, c + 8, 492 );
DrawText( dc, txt, lstrlen( txt ), &rc, DT_CENTER | DT_VCENTER | DT_SINGLELINE );
c += 46; b += 46;
}
SetRect( &rc, 0, b - 9, 36, b + 11 );
DrawText( dc, "0", 1, &rc, DT_RIGHT | DT_VCENTER | DT_SINGLELINE );
bmp.setPenColor( 0 ); bmp.setPenWidth( 3 );
MoveToEx( dc, 40, 11, NULL ); LineTo( dc, 40, 471 );
MoveToEx( dc, 40, 471, NULL ); LineTo( dc, 500, 471 );
}
void plotIt( vector<vector2>* pairs )
{
HDC dc = bmp.getDC();
HBRUSH br = CreateSolidBrush( 255 );
RECT rc;
bmp.setPenColor( 255 ); bmp.setPenWidth( 2 );
vector<vector2>::iterator it = pairs->begin();
int a = MWID + HSTEP * static_cast<int>( ( *it ).x ), b = MHEI - static_cast<int>( VSTEP * ( *it ).y );
MoveToEx( dc, a, b, NULL );
SetRect( &rc, a - 3, b - 3, a + 3, b + 3 ); FillRect( dc, &rc, br );
it++;
for( ; it < pairs->end(); it++ )
{
a = MWID + HSTEP * static_cast<int>( ( *it ).x );
b = MHEI - static_cast<int>( VSTEP * ( *it ).y );
SetRect( &rc, a - 3, b - 3, a + 3, b + 3 );
FillRect( dc, &rc, br ); LineTo( dc, a, b );
}
DeleteObject( br );
}
myBitmap bmp;
};
int main( int argc, char* argv[] )
{
ShowWindow( GetConsoleWindow(), SW_MAXIMIZE );
plot pt;
vector<vector2> pairs;
pairs.push_back( vector2( 0, 2.7f ) ); pairs.push_back( vector2( 1, 2.8f ) );
pairs.push_back( vector2( 2.0f, 31.4f ) ); pairs.push_back( vector2( 3.0f, 38.1f ) );
pairs.push_back( vector2( 4.0f, 58.0f ) ); pairs.push_back( vector2( 5.0f, 76.2f ) );
pairs.push_back( vector2( 6.0f, 100.5f ) ); pairs.push_back( vector2( 7.0f, 130.0f ) );
pairs.push_back( vector2( 8.0f, 149.3f ) ); pairs.push_back( vector2( 9.0f, 180.0f ) );
pt.draw( &pairs );
system( "pause" );
return 0;
}
|
Please provide an equivalent version of this C code in C++. | #include <stdio.h>
#include <stdlib.h>
#include <math.h>
#include <plot.h>
#define NP 10
double x[NP] = {0, 1, 2, 3, 4, 5, 6, 7, 8, 9};
double y[NP] = {2.7, 2.8, 31.4, 38.1, 58.0, 76.2, 100.5, 130.0, 149.3, 180.0};
void minmax(double *x, double *y,
double *minx, double *maxx,
double *miny, double *maxy, int n)
{
int i;
*minx = *maxx = x[0];
*miny = *maxy = y[0];
for(i=1; i < n; i++) {
if ( x[i] < *minx ) *minx = x[i];
if ( x[i] > *maxx ) *maxx = x[i];
if ( y[i] < *miny ) *miny = y[i];
if ( y[i] > *maxy ) *maxy = y[i];
}
}
#define YLAB_HEIGHT_F 0.1
#define XLAB_WIDTH_F 0.2
#define XDIV (NP*1.0)
#define YDIV (NP*1.0)
#define EXTRA_W 0.01
#define EXTRA_H 0.01
#define DOTSCALE (1.0/150.0)
#define MAXLABLEN 32
#define PUSHSCALE(X,Y) pl_fscale((X),(Y))
#define POPSCALE(X,Y) pl_fscale(1.0/(X), 1.0/(Y))
#define FMOVESCALE(X,Y) pl_fmove((X)/sx, (Y)/sy)
int main()
{
int plotter, i;
double minx, miny, maxx, maxy;
double lx, ly;
double xticstep, yticstep, nx, ny;
double sx, sy;
char labs[MAXLABLEN+1];
plotter = pl_newpl("png", NULL, stdout, NULL);
if ( plotter < 0 ) exit(1);
pl_selectpl(plotter);
if ( pl_openpl() < 0 ) exit(1);
minmax(x, y, &minx, &maxx, &miny, &maxy, NP);
lx = maxx - minx;
ly = maxy - miny;
pl_fspace(floor(minx) - XLAB_WIDTH_F * lx, floor(miny) - YLAB_HEIGHT_F * ly,
ceil(maxx) + EXTRA_W * lx, ceil(maxy) + EXTRA_H * ly);
xticstep = (ceil(maxx) - floor(minx)) / XDIV;
yticstep = (ceil(maxy) - floor(miny)) / YDIV;
pl_flinewidth(0.25);
if ( lx < ly ) {
sx = lx/ly;
sy = 1.0;
} else {
sx = 1.0;
sy = ly/lx;
}
pl_erase();
pl_fbox(floor(minx), floor(miny),
ceil(maxx), ceil(maxy));
pl_fontname("HersheySerif");
for(ny=floor(miny); ny < ceil(maxy); ny += yticstep) {
pl_fline(floor(minx), ny, ceil(maxx), ny);
snprintf(labs, MAXLABLEN, "%6.2lf", ny);
FMOVESCALE(floor(minx) - XLAB_WIDTH_F * lx, ny);
PUSHSCALE(sx,sy);
pl_label(labs);
POPSCALE(sx,sy);
}
for(nx=floor(minx); nx < ceil(maxx); nx += xticstep) {
pl_fline(nx, floor(miny), nx, ceil(maxy));
snprintf(labs, MAXLABLEN, "%6.2lf", nx);
FMOVESCALE(nx, floor(miny));
PUSHSCALE(sx,sy);
pl_ftextangle(-90);
pl_alabel('l', 'b', labs);
POPSCALE(sx,sy);
}
pl_fillcolorname("red");
pl_filltype(1);
for(i=0; i < NP; i++)
{
pl_fbox(x[i] - lx * DOTSCALE, y[i] - ly * DOTSCALE,
x[i] + lx * DOTSCALE, y[i] + ly * DOTSCALE);
}
pl_flushpl();
pl_closepl();
}
| #include <windows.h>
#include <string>
#include <vector>
using namespace std;
const int HSTEP = 46, MWID = 40, MHEI = 471;
const float VSTEP = 2.3f;
class vector2
{
public:
vector2() { x = y = 0; }
vector2( float a, float b ) { x = a; y = b; }
void set( float a, float b ) { x = a; y = b; }
float x, y;
};
class myBitmap
{
public:
myBitmap() : pen( NULL ), brush( NULL ), clr( 0 ), wid( 1 ) {}
~myBitmap()
{
DeleteObject( pen );
DeleteObject( brush );
DeleteDC( hdc );
DeleteObject( bmp );
}
bool create( int w, int h )
{
BITMAPINFO bi;
ZeroMemory( &bi, sizeof( bi ) );
bi.bmiHeader.biSize = sizeof( bi.bmiHeader );
bi.bmiHeader.biBitCount = sizeof( DWORD ) * 8;
bi.bmiHeader.biCompression = BI_RGB;
bi.bmiHeader.biPlanes = 1;
bi.bmiHeader.biWidth = w;
bi.bmiHeader.biHeight = -h;
HDC dc = GetDC( GetConsoleWindow() );
bmp = CreateDIBSection( dc, &bi, DIB_RGB_COLORS, &pBits, NULL, 0 );
if( !bmp ) return false;
hdc = CreateCompatibleDC( dc );
SelectObject( hdc, bmp );
ReleaseDC( GetConsoleWindow(), dc );
width = w; height = h;
return true;
}
void clear( BYTE clr = 0 )
{
memset( pBits, clr, width * height * sizeof( DWORD ) );
}
void setBrushColor( DWORD bClr )
{
if( brush ) DeleteObject( brush );
brush = CreateSolidBrush( bClr );
SelectObject( hdc, brush );
}
void setPenColor( DWORD c ) { clr = c; createPen(); }
void setPenWidth( int w ) { wid = w; createPen(); }
void saveBitmap( string path )
{
BITMAPFILEHEADER fileheader;
BITMAPINFO infoheader;
BITMAP bitmap;
DWORD wb;
GetObject( bmp, sizeof( bitmap ), &bitmap );
DWORD* dwpBits = new DWORD[bitmap.bmWidth * bitmap.bmHeight];
ZeroMemory( dwpBits, bitmap.bmWidth * bitmap.bmHeight * sizeof( DWORD ) );
ZeroMemory( &infoheader, sizeof( BITMAPINFO ) );
ZeroMemory( &fileheader, sizeof( BITMAPFILEHEADER ) );
infoheader.bmiHeader.biBitCount = sizeof( DWORD ) * 8;
infoheader.bmiHeader.biCompression = BI_RGB;
infoheader.bmiHeader.biPlanes = 1;
infoheader.bmiHeader.biSize = sizeof( infoheader.bmiHeader );
infoheader.bmiHeader.biHeight = bitmap.bmHeight;
infoheader.bmiHeader.biWidth = bitmap.bmWidth;
infoheader.bmiHeader.biSizeImage = bitmap.bmWidth * bitmap.bmHeight * sizeof( DWORD );
fileheader.bfType = 0x4D42;
fileheader.bfOffBits = sizeof( infoheader.bmiHeader ) + sizeof( BITMAPFILEHEADER );
fileheader.bfSize = fileheader.bfOffBits + infoheader.bmiHeader.biSizeImage;
GetDIBits( hdc, bmp, 0, height, ( LPVOID )dwpBits, &infoheader, DIB_RGB_COLORS );
HANDLE file = CreateFile( path.c_str(), GENERIC_WRITE, 0, NULL, CREATE_ALWAYS, FILE_ATTRIBUTE_NORMAL, NULL );
WriteFile( file, &fileheader, sizeof( BITMAPFILEHEADER ), &wb, NULL );
WriteFile( file, &infoheader.bmiHeader, sizeof( infoheader.bmiHeader ), &wb, NULL );
WriteFile( file, dwpBits, bitmap.bmWidth * bitmap.bmHeight * 4, &wb, NULL );
CloseHandle( file );
delete [] dwpBits;
}
HDC getDC() const { return hdc; }
int getWidth() const { return width; }
int getHeight() const { return height; }
private:
void createPen()
{
if( pen ) DeleteObject( pen );
pen = CreatePen( PS_SOLID, wid, clr );
SelectObject( hdc, pen );
}
HBITMAP bmp;
HDC hdc;
HPEN pen;
HBRUSH brush;
void *pBits;
int width, height, wid;
DWORD clr;
};
class plot
{
public:
plot() { bmp.create( 512, 512 ); }
void draw( vector<vector2>* pairs )
{
bmp.clear( 0xff );
drawGraph( pairs );
plotIt( pairs );
HDC dc = GetDC( GetConsoleWindow() );
BitBlt( dc, 0, 30, 512, 512, bmp.getDC(), 0, 0, SRCCOPY );
ReleaseDC( GetConsoleWindow(), dc );
}
private:
void drawGraph( vector<vector2>* pairs )
{
HDC dc = bmp.getDC();
bmp.setPenColor( RGB( 240, 240, 240 ) );
DWORD b = 11, c = 40, x;
RECT rc; char txt[8];
for( x = 0; x < pairs->size(); x++ )
{
MoveToEx( dc, 40, b, NULL ); LineTo( dc, 500, b );
MoveToEx( dc, c, 11, NULL ); LineTo( dc, c, 471 );
wsprintf( txt, "%d", ( pairs->size() - x ) * 20 );
SetRect( &rc, 0, b - 9, 36, b + 11 );
DrawText( dc, txt, lstrlen( txt ), &rc, DT_RIGHT | DT_VCENTER | DT_SINGLELINE );
wsprintf( txt, "%d", x );
SetRect( &rc, c - 8, 472, c + 8, 492 );
DrawText( dc, txt, lstrlen( txt ), &rc, DT_CENTER | DT_VCENTER | DT_SINGLELINE );
c += 46; b += 46;
}
SetRect( &rc, 0, b - 9, 36, b + 11 );
DrawText( dc, "0", 1, &rc, DT_RIGHT | DT_VCENTER | DT_SINGLELINE );
bmp.setPenColor( 0 ); bmp.setPenWidth( 3 );
MoveToEx( dc, 40, 11, NULL ); LineTo( dc, 40, 471 );
MoveToEx( dc, 40, 471, NULL ); LineTo( dc, 500, 471 );
}
void plotIt( vector<vector2>* pairs )
{
HDC dc = bmp.getDC();
HBRUSH br = CreateSolidBrush( 255 );
RECT rc;
bmp.setPenColor( 255 ); bmp.setPenWidth( 2 );
vector<vector2>::iterator it = pairs->begin();
int a = MWID + HSTEP * static_cast<int>( ( *it ).x ), b = MHEI - static_cast<int>( VSTEP * ( *it ).y );
MoveToEx( dc, a, b, NULL );
SetRect( &rc, a - 3, b - 3, a + 3, b + 3 ); FillRect( dc, &rc, br );
it++;
for( ; it < pairs->end(); it++ )
{
a = MWID + HSTEP * static_cast<int>( ( *it ).x );
b = MHEI - static_cast<int>( VSTEP * ( *it ).y );
SetRect( &rc, a - 3, b - 3, a + 3, b + 3 );
FillRect( dc, &rc, br ); LineTo( dc, a, b );
}
DeleteObject( br );
}
myBitmap bmp;
};
int main( int argc, char* argv[] )
{
ShowWindow( GetConsoleWindow(), SW_MAXIMIZE );
plot pt;
vector<vector2> pairs;
pairs.push_back( vector2( 0, 2.7f ) ); pairs.push_back( vector2( 1, 2.8f ) );
pairs.push_back( vector2( 2.0f, 31.4f ) ); pairs.push_back( vector2( 3.0f, 38.1f ) );
pairs.push_back( vector2( 4.0f, 58.0f ) ); pairs.push_back( vector2( 5.0f, 76.2f ) );
pairs.push_back( vector2( 6.0f, 100.5f ) ); pairs.push_back( vector2( 7.0f, 130.0f ) );
pairs.push_back( vector2( 8.0f, 149.3f ) ); pairs.push_back( vector2( 9.0f, 180.0f ) );
pt.draw( &pairs );
system( "pause" );
return 0;
}
|
Write the same code in C++ as shown below in C. | #include <stdio.h>
#include <stdlib.h>
#include <math.h>
#include <plot.h>
#define NP 10
double x[NP] = {0, 1, 2, 3, 4, 5, 6, 7, 8, 9};
double y[NP] = {2.7, 2.8, 31.4, 38.1, 58.0, 76.2, 100.5, 130.0, 149.3, 180.0};
void minmax(double *x, double *y,
double *minx, double *maxx,
double *miny, double *maxy, int n)
{
int i;
*minx = *maxx = x[0];
*miny = *maxy = y[0];
for(i=1; i < n; i++) {
if ( x[i] < *minx ) *minx = x[i];
if ( x[i] > *maxx ) *maxx = x[i];
if ( y[i] < *miny ) *miny = y[i];
if ( y[i] > *maxy ) *maxy = y[i];
}
}
#define YLAB_HEIGHT_F 0.1
#define XLAB_WIDTH_F 0.2
#define XDIV (NP*1.0)
#define YDIV (NP*1.0)
#define EXTRA_W 0.01
#define EXTRA_H 0.01
#define DOTSCALE (1.0/150.0)
#define MAXLABLEN 32
#define PUSHSCALE(X,Y) pl_fscale((X),(Y))
#define POPSCALE(X,Y) pl_fscale(1.0/(X), 1.0/(Y))
#define FMOVESCALE(X,Y) pl_fmove((X)/sx, (Y)/sy)
int main()
{
int plotter, i;
double minx, miny, maxx, maxy;
double lx, ly;
double xticstep, yticstep, nx, ny;
double sx, sy;
char labs[MAXLABLEN+1];
plotter = pl_newpl("png", NULL, stdout, NULL);
if ( plotter < 0 ) exit(1);
pl_selectpl(plotter);
if ( pl_openpl() < 0 ) exit(1);
minmax(x, y, &minx, &maxx, &miny, &maxy, NP);
lx = maxx - minx;
ly = maxy - miny;
pl_fspace(floor(minx) - XLAB_WIDTH_F * lx, floor(miny) - YLAB_HEIGHT_F * ly,
ceil(maxx) + EXTRA_W * lx, ceil(maxy) + EXTRA_H * ly);
xticstep = (ceil(maxx) - floor(minx)) / XDIV;
yticstep = (ceil(maxy) - floor(miny)) / YDIV;
pl_flinewidth(0.25);
if ( lx < ly ) {
sx = lx/ly;
sy = 1.0;
} else {
sx = 1.0;
sy = ly/lx;
}
pl_erase();
pl_fbox(floor(minx), floor(miny),
ceil(maxx), ceil(maxy));
pl_fontname("HersheySerif");
for(ny=floor(miny); ny < ceil(maxy); ny += yticstep) {
pl_fline(floor(minx), ny, ceil(maxx), ny);
snprintf(labs, MAXLABLEN, "%6.2lf", ny);
FMOVESCALE(floor(minx) - XLAB_WIDTH_F * lx, ny);
PUSHSCALE(sx,sy);
pl_label(labs);
POPSCALE(sx,sy);
}
for(nx=floor(minx); nx < ceil(maxx); nx += xticstep) {
pl_fline(nx, floor(miny), nx, ceil(maxy));
snprintf(labs, MAXLABLEN, "%6.2lf", nx);
FMOVESCALE(nx, floor(miny));
PUSHSCALE(sx,sy);
pl_ftextangle(-90);
pl_alabel('l', 'b', labs);
POPSCALE(sx,sy);
}
pl_fillcolorname("red");
pl_filltype(1);
for(i=0; i < NP; i++)
{
pl_fbox(x[i] - lx * DOTSCALE, y[i] - ly * DOTSCALE,
x[i] + lx * DOTSCALE, y[i] + ly * DOTSCALE);
}
pl_flushpl();
pl_closepl();
}
| #include <windows.h>
#include <string>
#include <vector>
using namespace std;
const int HSTEP = 46, MWID = 40, MHEI = 471;
const float VSTEP = 2.3f;
class vector2
{
public:
vector2() { x = y = 0; }
vector2( float a, float b ) { x = a; y = b; }
void set( float a, float b ) { x = a; y = b; }
float x, y;
};
class myBitmap
{
public:
myBitmap() : pen( NULL ), brush( NULL ), clr( 0 ), wid( 1 ) {}
~myBitmap()
{
DeleteObject( pen );
DeleteObject( brush );
DeleteDC( hdc );
DeleteObject( bmp );
}
bool create( int w, int h )
{
BITMAPINFO bi;
ZeroMemory( &bi, sizeof( bi ) );
bi.bmiHeader.biSize = sizeof( bi.bmiHeader );
bi.bmiHeader.biBitCount = sizeof( DWORD ) * 8;
bi.bmiHeader.biCompression = BI_RGB;
bi.bmiHeader.biPlanes = 1;
bi.bmiHeader.biWidth = w;
bi.bmiHeader.biHeight = -h;
HDC dc = GetDC( GetConsoleWindow() );
bmp = CreateDIBSection( dc, &bi, DIB_RGB_COLORS, &pBits, NULL, 0 );
if( !bmp ) return false;
hdc = CreateCompatibleDC( dc );
SelectObject( hdc, bmp );
ReleaseDC( GetConsoleWindow(), dc );
width = w; height = h;
return true;
}
void clear( BYTE clr = 0 )
{
memset( pBits, clr, width * height * sizeof( DWORD ) );
}
void setBrushColor( DWORD bClr )
{
if( brush ) DeleteObject( brush );
brush = CreateSolidBrush( bClr );
SelectObject( hdc, brush );
}
void setPenColor( DWORD c ) { clr = c; createPen(); }
void setPenWidth( int w ) { wid = w; createPen(); }
void saveBitmap( string path )
{
BITMAPFILEHEADER fileheader;
BITMAPINFO infoheader;
BITMAP bitmap;
DWORD wb;
GetObject( bmp, sizeof( bitmap ), &bitmap );
DWORD* dwpBits = new DWORD[bitmap.bmWidth * bitmap.bmHeight];
ZeroMemory( dwpBits, bitmap.bmWidth * bitmap.bmHeight * sizeof( DWORD ) );
ZeroMemory( &infoheader, sizeof( BITMAPINFO ) );
ZeroMemory( &fileheader, sizeof( BITMAPFILEHEADER ) );
infoheader.bmiHeader.biBitCount = sizeof( DWORD ) * 8;
infoheader.bmiHeader.biCompression = BI_RGB;
infoheader.bmiHeader.biPlanes = 1;
infoheader.bmiHeader.biSize = sizeof( infoheader.bmiHeader );
infoheader.bmiHeader.biHeight = bitmap.bmHeight;
infoheader.bmiHeader.biWidth = bitmap.bmWidth;
infoheader.bmiHeader.biSizeImage = bitmap.bmWidth * bitmap.bmHeight * sizeof( DWORD );
fileheader.bfType = 0x4D42;
fileheader.bfOffBits = sizeof( infoheader.bmiHeader ) + sizeof( BITMAPFILEHEADER );
fileheader.bfSize = fileheader.bfOffBits + infoheader.bmiHeader.biSizeImage;
GetDIBits( hdc, bmp, 0, height, ( LPVOID )dwpBits, &infoheader, DIB_RGB_COLORS );
HANDLE file = CreateFile( path.c_str(), GENERIC_WRITE, 0, NULL, CREATE_ALWAYS, FILE_ATTRIBUTE_NORMAL, NULL );
WriteFile( file, &fileheader, sizeof( BITMAPFILEHEADER ), &wb, NULL );
WriteFile( file, &infoheader.bmiHeader, sizeof( infoheader.bmiHeader ), &wb, NULL );
WriteFile( file, dwpBits, bitmap.bmWidth * bitmap.bmHeight * 4, &wb, NULL );
CloseHandle( file );
delete [] dwpBits;
}
HDC getDC() const { return hdc; }
int getWidth() const { return width; }
int getHeight() const { return height; }
private:
void createPen()
{
if( pen ) DeleteObject( pen );
pen = CreatePen( PS_SOLID, wid, clr );
SelectObject( hdc, pen );
}
HBITMAP bmp;
HDC hdc;
HPEN pen;
HBRUSH brush;
void *pBits;
int width, height, wid;
DWORD clr;
};
class plot
{
public:
plot() { bmp.create( 512, 512 ); }
void draw( vector<vector2>* pairs )
{
bmp.clear( 0xff );
drawGraph( pairs );
plotIt( pairs );
HDC dc = GetDC( GetConsoleWindow() );
BitBlt( dc, 0, 30, 512, 512, bmp.getDC(), 0, 0, SRCCOPY );
ReleaseDC( GetConsoleWindow(), dc );
}
private:
void drawGraph( vector<vector2>* pairs )
{
HDC dc = bmp.getDC();
bmp.setPenColor( RGB( 240, 240, 240 ) );
DWORD b = 11, c = 40, x;
RECT rc; char txt[8];
for( x = 0; x < pairs->size(); x++ )
{
MoveToEx( dc, 40, b, NULL ); LineTo( dc, 500, b );
MoveToEx( dc, c, 11, NULL ); LineTo( dc, c, 471 );
wsprintf( txt, "%d", ( pairs->size() - x ) * 20 );
SetRect( &rc, 0, b - 9, 36, b + 11 );
DrawText( dc, txt, lstrlen( txt ), &rc, DT_RIGHT | DT_VCENTER | DT_SINGLELINE );
wsprintf( txt, "%d", x );
SetRect( &rc, c - 8, 472, c + 8, 492 );
DrawText( dc, txt, lstrlen( txt ), &rc, DT_CENTER | DT_VCENTER | DT_SINGLELINE );
c += 46; b += 46;
}
SetRect( &rc, 0, b - 9, 36, b + 11 );
DrawText( dc, "0", 1, &rc, DT_RIGHT | DT_VCENTER | DT_SINGLELINE );
bmp.setPenColor( 0 ); bmp.setPenWidth( 3 );
MoveToEx( dc, 40, 11, NULL ); LineTo( dc, 40, 471 );
MoveToEx( dc, 40, 471, NULL ); LineTo( dc, 500, 471 );
}
void plotIt( vector<vector2>* pairs )
{
HDC dc = bmp.getDC();
HBRUSH br = CreateSolidBrush( 255 );
RECT rc;
bmp.setPenColor( 255 ); bmp.setPenWidth( 2 );
vector<vector2>::iterator it = pairs->begin();
int a = MWID + HSTEP * static_cast<int>( ( *it ).x ), b = MHEI - static_cast<int>( VSTEP * ( *it ).y );
MoveToEx( dc, a, b, NULL );
SetRect( &rc, a - 3, b - 3, a + 3, b + 3 ); FillRect( dc, &rc, br );
it++;
for( ; it < pairs->end(); it++ )
{
a = MWID + HSTEP * static_cast<int>( ( *it ).x );
b = MHEI - static_cast<int>( VSTEP * ( *it ).y );
SetRect( &rc, a - 3, b - 3, a + 3, b + 3 );
FillRect( dc, &rc, br ); LineTo( dc, a, b );
}
DeleteObject( br );
}
myBitmap bmp;
};
int main( int argc, char* argv[] )
{
ShowWindow( GetConsoleWindow(), SW_MAXIMIZE );
plot pt;
vector<vector2> pairs;
pairs.push_back( vector2( 0, 2.7f ) ); pairs.push_back( vector2( 1, 2.8f ) );
pairs.push_back( vector2( 2.0f, 31.4f ) ); pairs.push_back( vector2( 3.0f, 38.1f ) );
pairs.push_back( vector2( 4.0f, 58.0f ) ); pairs.push_back( vector2( 5.0f, 76.2f ) );
pairs.push_back( vector2( 6.0f, 100.5f ) ); pairs.push_back( vector2( 7.0f, 130.0f ) );
pairs.push_back( vector2( 8.0f, 149.3f ) ); pairs.push_back( vector2( 9.0f, 180.0f ) );
pt.draw( &pairs );
system( "pause" );
return 0;
}
|
Translate this program into C++ but keep the logic exactly as in C. | #include <stdio.h>
#include <stdlib.h>
#include <sys/types.h>
#include <regex.h>
#include <string.h>
int main()
{
regex_t preg;
regmatch_t substmatch[1];
const char *tp = "string$";
const char *t1 = "this is a matching string";
const char *t2 = "this is not a matching string!";
const char *ss = "istyfied";
regcomp(&preg, "string$", REG_EXTENDED);
printf("'%s' %smatched with '%s'\n", t1,
(regexec(&preg, t1, 0, NULL, 0)==0) ? "" : "did not ", tp);
printf("'%s' %smatched with '%s'\n", t2,
(regexec(&preg, t2, 0, NULL, 0)==0) ? "" : "did not ", tp);
regfree(&preg);
regcomp(&preg, "a[a-z]+", REG_EXTENDED);
if ( regexec(&preg, t1, 1, substmatch, 0) == 0 )
{
char *ns = malloc(substmatch[0].rm_so + 1 + strlen(ss) +
(strlen(t1) - substmatch[0].rm_eo) + 2);
memcpy(ns, t1, substmatch[0].rm_so+1);
memcpy(&ns[substmatch[0].rm_so], ss, strlen(ss));
memcpy(&ns[substmatch[0].rm_so+strlen(ss)], &t1[substmatch[0].rm_eo],
strlen(&t1[substmatch[0].rm_eo]));
ns[ substmatch[0].rm_so + strlen(ss) +
strlen(&t1[substmatch[0].rm_eo]) ] = 0;
printf("mod string: '%s'\n", ns);
free(ns);
} else {
printf("the string '%s' is the same: no matching!\n", t1);
}
regfree(&preg);
return 0;
}
| #include <iostream>
#include <string>
#include <iterator>
#include <regex>
int main()
{
std::regex re(".* string$");
std::string s = "Hi, I am a string";
if (std::regex_match(s, re))
std::cout << "The string matches.\n";
else
std::cout << "Oops - not found?\n";
std::regex re2(" a.*a");
std::smatch match;
if (std::regex_search(s, match, re2))
{
std::cout << "Matched " << match.length()
<< " characters starting at " << match.position() << ".\n";
std::cout << "Matched character sequence: \""
<< match.str() << "\"\n";
}
else
{
std::cout << "Oops - not found?\n";
}
std::string dest_string;
std::regex_replace(std::back_inserter(dest_string),
s.begin(), s.end(),
re2,
"'m now a changed");
std::cout << dest_string << std::endl;
}
|
Maintain the same structure and functionality when rewriting this code in C++. | #include <stdio.h>
int main(){
int bounds[ 2 ] = {1, 100};
char input[ 2 ] = " ";
int choice = (bounds[ 0 ] + bounds[ 1 ]) / 2;
printf( "Choose a number between %d and %d.\n", bounds[ 0 ], bounds[ 1 ] );
do{
switch( input[ 0 ] ){
case 'H':
bounds[ 1 ] = choice;
break;
case 'L':
bounds[ 0 ] = choice;
break;
case 'Y':
printf( "\nAwwwright\n" );
return 0;
}
choice = (bounds[ 0 ] + bounds[ 1 ]) / 2;
printf( "Is the number %d? (Y/H/L) ", choice );
}while( scanf( "%1s", input ) == 1 );
return 0;
}
| #include <iostream>
#include <algorithm>
#include <string>
#include <iterator>
struct GuessNumberIterator : std::iterator<std::random_access_iterator_tag, int> {
int i;
GuessNumberIterator() { }
GuessNumberIterator(int _i) : i(_i) { }
GuessNumberIterator& operator++() { ++i; return *this; }
GuessNumberIterator operator++(int) {
GuessNumberIterator tmp = *this; ++(*this); return tmp; }
bool operator==(const GuessNumberIterator& y) { return i == y.i; }
bool operator!=(const GuessNumberIterator& y) { return i != y.i; }
int operator*() {
std::cout << "Is your number less than or equal to " << i << "? ";
std::string s;
std::cin >> s;
return (s != "" && (s[0] == 'y' || s[0] == 'Y')) ? 0 : -1;
}
GuessNumberIterator& operator--() { --i; return *this; }
GuessNumberIterator operator--(int) {
GuessNumberIterator tmp = *this; --(*this); return tmp; }
GuessNumberIterator& operator+=(int n) { i += n; return *this; }
GuessNumberIterator& operator-=(int n) { i -= n; return *this; }
GuessNumberIterator operator+(int n) {
GuessNumberIterator tmp = *this; return tmp += n; }
GuessNumberIterator operator-(int n) {
GuessNumberIterator tmp = *this; return tmp -= n; }
int operator-(const GuessNumberIterator &y) { return i - y.i; }
int operator[](int n) { return *(*this + n); }
bool operator<(const GuessNumberIterator &y) { return i < y.i; }
bool operator>(const GuessNumberIterator &y) { return i > y.i; }
bool operator<=(const GuessNumberIterator &y) { return i <= y.i; }
bool operator>=(const GuessNumberIterator &y) { return i >= y.i; }
};
inline GuessNumberIterator operator+(int n, GuessNumberIterator &i) { return i + n; }
const int lower = 0;
const int upper = 100;
int main() {
std::cout << "Instructions:\n"
<< "Think of integer number from " << lower << " (inclusive) to "
<< upper << " (exclusive) and\n"
<< "I will guess it. After each guess, I will ask you if it is less than\n"
<< "or equal to some number, and you will respond with \"yes\" or \"no\".\n";
int answer = std::lower_bound(GuessNumberIterator(lower), GuessNumberIterator(upper), 0).i;
std::cout << "Your number is " << answer << ".\n";
return 0;
}
|
Preserve the algorithm and functionality while converting the code from C to C++. | #include <stdio.h>
#include <stdlib.h>
#include <string.h>
#define KeyType const char *
#define ValType int
#define HASH_SIZE 4096
unsigned strhashkey( const char * key, int max)
{
unsigned h=0;
unsigned hl, hr;
while(*key) {
h += *key;
hl= 0x5C5 ^ (h&0xfff00000 )>>18;
hr =(h&0x000fffff );
h = hl ^ hr ^ *key++;
}
return h % max;
}
typedef struct sHme {
KeyType key;
ValType value;
struct sHme *link;
} *MapEntry;
typedef struct he {
MapEntry first, last;
} HashElement;
HashElement hash[HASH_SIZE];
typedef void (*KeyCopyF)(KeyType *kdest, KeyType ksrc);
typedef void (*ValCopyF)(ValType *vdest, ValType vsrc);
typedef unsigned (*KeyHashF)( KeyType key, int upperBound );
typedef int (*KeyCmprF)(KeyType key1, KeyType key2);
void HashAddH( KeyType key, ValType value,
KeyCopyF copyKey, ValCopyF copyVal, KeyHashF hashKey, KeyCmprF keySame )
{
unsigned hix = (*hashKey)(key, HASH_SIZE);
MapEntry m_ent;
for (m_ent= hash[hix].first;
m_ent && !(*keySame)(m_ent->key,key); m_ent=m_ent->link);
if (m_ent) {
(*copyVal)(&m_ent->value, value);
}
else {
MapEntry last;
MapEntry hme = malloc(sizeof(struct sHme));
(*copyKey)(&hme->key, key);
(*copyVal)(&hme->value, value);
hme->link = NULL;
last = hash[hix].last;
if (last) {
last->link = hme;
}
else
hash[hix].first = hme;
hash[hix].last = hme;
}
}
int HashGetH(ValType *val, KeyType key, KeyHashF hashKey, KeyCmprF keySame )
{
unsigned hix = (*hashKey)(key, HASH_SIZE);
MapEntry m_ent;
for (m_ent= hash[hix].first;
m_ent && !(*keySame)(m_ent->key,key); m_ent=m_ent->link);
if (m_ent) {
*val = m_ent->value;
}
return (m_ent != NULL);
}
void copyStr(const char**dest, const char *src)
{
*dest = strdup(src);
}
void copyInt( int *dest, int src)
{
*dest = src;
}
int strCompare( const char *key1, const char *key2)
{
return strcmp(key1, key2) == 0;
}
void HashAdd( KeyType key, ValType value )
{
HashAddH( key, value, ©Str, ©Int, &strhashkey, &strCompare);
}
int HashGet(ValType *val, KeyType key)
{
return HashGetH( val, key, &strhashkey, &strCompare);
}
int main()
{
static const char * keyList[] = {"red","orange","yellow","green", "blue", "violet" };
static int valuList[] = {1,43,640, 747, 42, 42};
int ix;
for (ix=0; ix<6; ix++) {
HashAdd(keyList[ix], valuList[ix]);
}
return 0;
}
| #include <unordered_map>
#include <string>
int main()
{
std::string keys[] = { "1", "2", "3" };
std::string vals[] = { "a", "b", "c" };
std::unordered_map<std::string, std::string> hash;
for( int i = 0 ; i < 3 ; i++ )
hash[ keys[i] ] = vals[i] ;
}
|
Convert this C block to C++, preserving its control flow and logic. | #include <stdio.h>
#include <stdlib.h>
size_t upper_bound(const int* array, size_t n, int value) {
size_t start = 0;
while (n > 0) {
size_t step = n / 2;
size_t index = start + step;
if (value >= array[index]) {
start = index + 1;
n -= step + 1;
} else {
n = step;
}
}
return start;
}
int* bins(const int* limits, size_t nlimits, const int* data, size_t ndata) {
int* result = calloc(nlimits + 1, sizeof(int));
if (result == NULL)
return NULL;
for (size_t i = 0; i < ndata; ++i)
++result[upper_bound(limits, nlimits, data[i])];
return result;
}
void print_bins(const int* limits, size_t n, const int* bins) {
if (n == 0)
return;
printf(" < %3d: %2d\n", limits[0], bins[0]);
for (size_t i = 1; i < n; ++i)
printf(">= %3d and < %3d: %2d\n", limits[i - 1], limits[i], bins[i]);
printf(">= %3d : %2d\n", limits[n - 1], bins[n]);
}
int main() {
const int limits1[] = {23, 37, 43, 53, 67, 83};
const int data1[] = {95, 21, 94, 12, 99, 4, 70, 75, 83, 93, 52, 80, 57,
5, 53, 86, 65, 17, 92, 83, 71, 61, 54, 58, 47, 16,
8, 9, 32, 84, 7, 87, 46, 19, 30, 37, 96, 6, 98,
40, 79, 97, 45, 64, 60, 29, 49, 36, 43, 55};
printf("Example 1:\n");
size_t n = sizeof(limits1) / sizeof(int);
int* b = bins(limits1, n, data1, sizeof(data1) / sizeof(int));
if (b == NULL) {
fprintf(stderr, "Out of memory\n");
return EXIT_FAILURE;
}
print_bins(limits1, n, b);
free(b);
const int limits2[] = {14, 18, 249, 312, 389, 392, 513, 591, 634, 720};
const int data2[] = {
445, 814, 519, 697, 700, 130, 255, 889, 481, 122, 932, 77, 323, 525,
570, 219, 367, 523, 442, 933, 416, 589, 930, 373, 202, 253, 775, 47,
731, 685, 293, 126, 133, 450, 545, 100, 741, 583, 763, 306, 655, 267,
248, 477, 549, 238, 62, 678, 98, 534, 622, 907, 406, 714, 184, 391,
913, 42, 560, 247, 346, 860, 56, 138, 546, 38, 985, 948, 58, 213,
799, 319, 390, 634, 458, 945, 733, 507, 916, 123, 345, 110, 720, 917,
313, 845, 426, 9, 457, 628, 410, 723, 354, 895, 881, 953, 677, 137,
397, 97, 854, 740, 83, 216, 421, 94, 517, 479, 292, 963, 376, 981,
480, 39, 257, 272, 157, 5, 316, 395, 787, 942, 456, 242, 759, 898,
576, 67, 298, 425, 894, 435, 831, 241, 989, 614, 987, 770, 384, 692,
698, 765, 331, 487, 251, 600, 879, 342, 982, 527, 736, 795, 585, 40,
54, 901, 408, 359, 577, 237, 605, 847, 353, 968, 832, 205, 838, 427,
876, 959, 686, 646, 835, 127, 621, 892, 443, 198, 988, 791, 466, 23,
707, 467, 33, 670, 921, 180, 991, 396, 160, 436, 717, 918, 8, 374,
101, 684, 727, 749};
printf("\nExample 2:\n");
n = sizeof(limits2) / sizeof(int);
b = bins(limits2, n, data2, sizeof(data2) / sizeof(int));
if (b == NULL) {
fprintf(stderr, "Out of memory\n");
return EXIT_FAILURE;
}
print_bins(limits2, n, b);
free(b);
return EXIT_SUCCESS;
}
| #include <algorithm>
#include <cassert>
#include <iomanip>
#include <iostream>
#include <vector>
std::vector<int> bins(const std::vector<int>& limits,
const std::vector<int>& data) {
std::vector<int> result(limits.size() + 1, 0);
for (int n : data) {
auto i = std::upper_bound(limits.begin(), limits.end(), n);
++result[i - limits.begin()];
}
return result;
}
void print_bins(const std::vector<int>& limits, const std::vector<int>& bins) {
size_t n = limits.size();
if (n == 0)
return;
assert(n + 1 == bins.size());
std::cout << " < " << std::setw(3) << limits[0] << ": "
<< std::setw(2) << bins[0] << '\n';
for (size_t i = 1; i < n; ++i)
std::cout << ">= " << std::setw(3) << limits[i - 1] << " and < "
<< std::setw(3) << limits[i] << ": " << std::setw(2)
<< bins[i] << '\n';
std::cout << ">= " << std::setw(3) << limits[n - 1] << " : "
<< std::setw(2) << bins[n] << '\n';
}
int main() {
const std::vector<int> limits1{23, 37, 43, 53, 67, 83};
const std::vector<int> data1{
95, 21, 94, 12, 99, 4, 70, 75, 83, 93, 52, 80, 57, 5, 53, 86, 65,
17, 92, 83, 71, 61, 54, 58, 47, 16, 8, 9, 32, 84, 7, 87, 46, 19,
30, 37, 96, 6, 98, 40, 79, 97, 45, 64, 60, 29, 49, 36, 43, 55};
std::cout << "Example 1:\n";
print_bins(limits1, bins(limits1, data1));
const std::vector<int> limits2{14, 18, 249, 312, 389,
392, 513, 591, 634, 720};
const std::vector<int> data2{
445, 814, 519, 697, 700, 130, 255, 889, 481, 122, 932, 77, 323, 525,
570, 219, 367, 523, 442, 933, 416, 589, 930, 373, 202, 253, 775, 47,
731, 685, 293, 126, 133, 450, 545, 100, 741, 583, 763, 306, 655, 267,
248, 477, 549, 238, 62, 678, 98, 534, 622, 907, 406, 714, 184, 391,
913, 42, 560, 247, 346, 860, 56, 138, 546, 38, 985, 948, 58, 213,
799, 319, 390, 634, 458, 945, 733, 507, 916, 123, 345, 110, 720, 917,
313, 845, 426, 9, 457, 628, 410, 723, 354, 895, 881, 953, 677, 137,
397, 97, 854, 740, 83, 216, 421, 94, 517, 479, 292, 963, 376, 981,
480, 39, 257, 272, 157, 5, 316, 395, 787, 942, 456, 242, 759, 898,
576, 67, 298, 425, 894, 435, 831, 241, 989, 614, 987, 770, 384, 692,
698, 765, 331, 487, 251, 600, 879, 342, 982, 527, 736, 795, 585, 40,
54, 901, 408, 359, 577, 237, 605, 847, 353, 968, 832, 205, 838, 427,
876, 959, 686, 646, 835, 127, 621, 892, 443, 198, 988, 791, 466, 23,
707, 467, 33, 670, 921, 180, 991, 396, 160, 436, 717, 918, 8, 374,
101, 684, 727, 749};
std::cout << "\nExample 2:\n";
print_bins(limits2, bins(limits2, data2));
}
|
Port the provided C code into C++ while preserving the original functionality. | #include <stdio.h>
#include <stdlib.h>
size_t upper_bound(const int* array, size_t n, int value) {
size_t start = 0;
while (n > 0) {
size_t step = n / 2;
size_t index = start + step;
if (value >= array[index]) {
start = index + 1;
n -= step + 1;
} else {
n = step;
}
}
return start;
}
int* bins(const int* limits, size_t nlimits, const int* data, size_t ndata) {
int* result = calloc(nlimits + 1, sizeof(int));
if (result == NULL)
return NULL;
for (size_t i = 0; i < ndata; ++i)
++result[upper_bound(limits, nlimits, data[i])];
return result;
}
void print_bins(const int* limits, size_t n, const int* bins) {
if (n == 0)
return;
printf(" < %3d: %2d\n", limits[0], bins[0]);
for (size_t i = 1; i < n; ++i)
printf(">= %3d and < %3d: %2d\n", limits[i - 1], limits[i], bins[i]);
printf(">= %3d : %2d\n", limits[n - 1], bins[n]);
}
int main() {
const int limits1[] = {23, 37, 43, 53, 67, 83};
const int data1[] = {95, 21, 94, 12, 99, 4, 70, 75, 83, 93, 52, 80, 57,
5, 53, 86, 65, 17, 92, 83, 71, 61, 54, 58, 47, 16,
8, 9, 32, 84, 7, 87, 46, 19, 30, 37, 96, 6, 98,
40, 79, 97, 45, 64, 60, 29, 49, 36, 43, 55};
printf("Example 1:\n");
size_t n = sizeof(limits1) / sizeof(int);
int* b = bins(limits1, n, data1, sizeof(data1) / sizeof(int));
if (b == NULL) {
fprintf(stderr, "Out of memory\n");
return EXIT_FAILURE;
}
print_bins(limits1, n, b);
free(b);
const int limits2[] = {14, 18, 249, 312, 389, 392, 513, 591, 634, 720};
const int data2[] = {
445, 814, 519, 697, 700, 130, 255, 889, 481, 122, 932, 77, 323, 525,
570, 219, 367, 523, 442, 933, 416, 589, 930, 373, 202, 253, 775, 47,
731, 685, 293, 126, 133, 450, 545, 100, 741, 583, 763, 306, 655, 267,
248, 477, 549, 238, 62, 678, 98, 534, 622, 907, 406, 714, 184, 391,
913, 42, 560, 247, 346, 860, 56, 138, 546, 38, 985, 948, 58, 213,
799, 319, 390, 634, 458, 945, 733, 507, 916, 123, 345, 110, 720, 917,
313, 845, 426, 9, 457, 628, 410, 723, 354, 895, 881, 953, 677, 137,
397, 97, 854, 740, 83, 216, 421, 94, 517, 479, 292, 963, 376, 981,
480, 39, 257, 272, 157, 5, 316, 395, 787, 942, 456, 242, 759, 898,
576, 67, 298, 425, 894, 435, 831, 241, 989, 614, 987, 770, 384, 692,
698, 765, 331, 487, 251, 600, 879, 342, 982, 527, 736, 795, 585, 40,
54, 901, 408, 359, 577, 237, 605, 847, 353, 968, 832, 205, 838, 427,
876, 959, 686, 646, 835, 127, 621, 892, 443, 198, 988, 791, 466, 23,
707, 467, 33, 670, 921, 180, 991, 396, 160, 436, 717, 918, 8, 374,
101, 684, 727, 749};
printf("\nExample 2:\n");
n = sizeof(limits2) / sizeof(int);
b = bins(limits2, n, data2, sizeof(data2) / sizeof(int));
if (b == NULL) {
fprintf(stderr, "Out of memory\n");
return EXIT_FAILURE;
}
print_bins(limits2, n, b);
free(b);
return EXIT_SUCCESS;
}
| #include <algorithm>
#include <cassert>
#include <iomanip>
#include <iostream>
#include <vector>
std::vector<int> bins(const std::vector<int>& limits,
const std::vector<int>& data) {
std::vector<int> result(limits.size() + 1, 0);
for (int n : data) {
auto i = std::upper_bound(limits.begin(), limits.end(), n);
++result[i - limits.begin()];
}
return result;
}
void print_bins(const std::vector<int>& limits, const std::vector<int>& bins) {
size_t n = limits.size();
if (n == 0)
return;
assert(n + 1 == bins.size());
std::cout << " < " << std::setw(3) << limits[0] << ": "
<< std::setw(2) << bins[0] << '\n';
for (size_t i = 1; i < n; ++i)
std::cout << ">= " << std::setw(3) << limits[i - 1] << " and < "
<< std::setw(3) << limits[i] << ": " << std::setw(2)
<< bins[i] << '\n';
std::cout << ">= " << std::setw(3) << limits[n - 1] << " : "
<< std::setw(2) << bins[n] << '\n';
}
int main() {
const std::vector<int> limits1{23, 37, 43, 53, 67, 83};
const std::vector<int> data1{
95, 21, 94, 12, 99, 4, 70, 75, 83, 93, 52, 80, 57, 5, 53, 86, 65,
17, 92, 83, 71, 61, 54, 58, 47, 16, 8, 9, 32, 84, 7, 87, 46, 19,
30, 37, 96, 6, 98, 40, 79, 97, 45, 64, 60, 29, 49, 36, 43, 55};
std::cout << "Example 1:\n";
print_bins(limits1, bins(limits1, data1));
const std::vector<int> limits2{14, 18, 249, 312, 389,
392, 513, 591, 634, 720};
const std::vector<int> data2{
445, 814, 519, 697, 700, 130, 255, 889, 481, 122, 932, 77, 323, 525,
570, 219, 367, 523, 442, 933, 416, 589, 930, 373, 202, 253, 775, 47,
731, 685, 293, 126, 133, 450, 545, 100, 741, 583, 763, 306, 655, 267,
248, 477, 549, 238, 62, 678, 98, 534, 622, 907, 406, 714, 184, 391,
913, 42, 560, 247, 346, 860, 56, 138, 546, 38, 985, 948, 58, 213,
799, 319, 390, 634, 458, 945, 733, 507, 916, 123, 345, 110, 720, 917,
313, 845, 426, 9, 457, 628, 410, 723, 354, 895, 881, 953, 677, 137,
397, 97, 854, 740, 83, 216, 421, 94, 517, 479, 292, 963, 376, 981,
480, 39, 257, 272, 157, 5, 316, 395, 787, 942, 456, 242, 759, 898,
576, 67, 298, 425, 894, 435, 831, 241, 989, 614, 987, 770, 384, 692,
698, 765, 331, 487, 251, 600, 879, 342, 982, 527, 736, 795, 585, 40,
54, 901, 408, 359, 577, 237, 605, 847, 353, 968, 832, 205, 838, 427,
876, 959, 686, 646, 835, 127, 621, 892, 443, 198, 988, 791, 466, 23,
707, 467, 33, 670, 921, 180, 991, 396, 160, 436, 717, 918, 8, 374,
101, 684, 727, 749};
std::cout << "\nExample 2:\n";
print_bins(limits2, bins(limits2, data2));
}
|
Translate this program into C++ but keep the logic exactly as in C. | #include <stdio.h>
#include <stdlib.h>
size_t upper_bound(const int* array, size_t n, int value) {
size_t start = 0;
while (n > 0) {
size_t step = n / 2;
size_t index = start + step;
if (value >= array[index]) {
start = index + 1;
n -= step + 1;
} else {
n = step;
}
}
return start;
}
int* bins(const int* limits, size_t nlimits, const int* data, size_t ndata) {
int* result = calloc(nlimits + 1, sizeof(int));
if (result == NULL)
return NULL;
for (size_t i = 0; i < ndata; ++i)
++result[upper_bound(limits, nlimits, data[i])];
return result;
}
void print_bins(const int* limits, size_t n, const int* bins) {
if (n == 0)
return;
printf(" < %3d: %2d\n", limits[0], bins[0]);
for (size_t i = 1; i < n; ++i)
printf(">= %3d and < %3d: %2d\n", limits[i - 1], limits[i], bins[i]);
printf(">= %3d : %2d\n", limits[n - 1], bins[n]);
}
int main() {
const int limits1[] = {23, 37, 43, 53, 67, 83};
const int data1[] = {95, 21, 94, 12, 99, 4, 70, 75, 83, 93, 52, 80, 57,
5, 53, 86, 65, 17, 92, 83, 71, 61, 54, 58, 47, 16,
8, 9, 32, 84, 7, 87, 46, 19, 30, 37, 96, 6, 98,
40, 79, 97, 45, 64, 60, 29, 49, 36, 43, 55};
printf("Example 1:\n");
size_t n = sizeof(limits1) / sizeof(int);
int* b = bins(limits1, n, data1, sizeof(data1) / sizeof(int));
if (b == NULL) {
fprintf(stderr, "Out of memory\n");
return EXIT_FAILURE;
}
print_bins(limits1, n, b);
free(b);
const int limits2[] = {14, 18, 249, 312, 389, 392, 513, 591, 634, 720};
const int data2[] = {
445, 814, 519, 697, 700, 130, 255, 889, 481, 122, 932, 77, 323, 525,
570, 219, 367, 523, 442, 933, 416, 589, 930, 373, 202, 253, 775, 47,
731, 685, 293, 126, 133, 450, 545, 100, 741, 583, 763, 306, 655, 267,
248, 477, 549, 238, 62, 678, 98, 534, 622, 907, 406, 714, 184, 391,
913, 42, 560, 247, 346, 860, 56, 138, 546, 38, 985, 948, 58, 213,
799, 319, 390, 634, 458, 945, 733, 507, 916, 123, 345, 110, 720, 917,
313, 845, 426, 9, 457, 628, 410, 723, 354, 895, 881, 953, 677, 137,
397, 97, 854, 740, 83, 216, 421, 94, 517, 479, 292, 963, 376, 981,
480, 39, 257, 272, 157, 5, 316, 395, 787, 942, 456, 242, 759, 898,
576, 67, 298, 425, 894, 435, 831, 241, 989, 614, 987, 770, 384, 692,
698, 765, 331, 487, 251, 600, 879, 342, 982, 527, 736, 795, 585, 40,
54, 901, 408, 359, 577, 237, 605, 847, 353, 968, 832, 205, 838, 427,
876, 959, 686, 646, 835, 127, 621, 892, 443, 198, 988, 791, 466, 23,
707, 467, 33, 670, 921, 180, 991, 396, 160, 436, 717, 918, 8, 374,
101, 684, 727, 749};
printf("\nExample 2:\n");
n = sizeof(limits2) / sizeof(int);
b = bins(limits2, n, data2, sizeof(data2) / sizeof(int));
if (b == NULL) {
fprintf(stderr, "Out of memory\n");
return EXIT_FAILURE;
}
print_bins(limits2, n, b);
free(b);
return EXIT_SUCCESS;
}
| #include <algorithm>
#include <cassert>
#include <iomanip>
#include <iostream>
#include <vector>
std::vector<int> bins(const std::vector<int>& limits,
const std::vector<int>& data) {
std::vector<int> result(limits.size() + 1, 0);
for (int n : data) {
auto i = std::upper_bound(limits.begin(), limits.end(), n);
++result[i - limits.begin()];
}
return result;
}
void print_bins(const std::vector<int>& limits, const std::vector<int>& bins) {
size_t n = limits.size();
if (n == 0)
return;
assert(n + 1 == bins.size());
std::cout << " < " << std::setw(3) << limits[0] << ": "
<< std::setw(2) << bins[0] << '\n';
for (size_t i = 1; i < n; ++i)
std::cout << ">= " << std::setw(3) << limits[i - 1] << " and < "
<< std::setw(3) << limits[i] << ": " << std::setw(2)
<< bins[i] << '\n';
std::cout << ">= " << std::setw(3) << limits[n - 1] << " : "
<< std::setw(2) << bins[n] << '\n';
}
int main() {
const std::vector<int> limits1{23, 37, 43, 53, 67, 83};
const std::vector<int> data1{
95, 21, 94, 12, 99, 4, 70, 75, 83, 93, 52, 80, 57, 5, 53, 86, 65,
17, 92, 83, 71, 61, 54, 58, 47, 16, 8, 9, 32, 84, 7, 87, 46, 19,
30, 37, 96, 6, 98, 40, 79, 97, 45, 64, 60, 29, 49, 36, 43, 55};
std::cout << "Example 1:\n";
print_bins(limits1, bins(limits1, data1));
const std::vector<int> limits2{14, 18, 249, 312, 389,
392, 513, 591, 634, 720};
const std::vector<int> data2{
445, 814, 519, 697, 700, 130, 255, 889, 481, 122, 932, 77, 323, 525,
570, 219, 367, 523, 442, 933, 416, 589, 930, 373, 202, 253, 775, 47,
731, 685, 293, 126, 133, 450, 545, 100, 741, 583, 763, 306, 655, 267,
248, 477, 549, 238, 62, 678, 98, 534, 622, 907, 406, 714, 184, 391,
913, 42, 560, 247, 346, 860, 56, 138, 546, 38, 985, 948, 58, 213,
799, 319, 390, 634, 458, 945, 733, 507, 916, 123, 345, 110, 720, 917,
313, 845, 426, 9, 457, 628, 410, 723, 354, 895, 881, 953, 677, 137,
397, 97, 854, 740, 83, 216, 421, 94, 517, 479, 292, 963, 376, 981,
480, 39, 257, 272, 157, 5, 316, 395, 787, 942, 456, 242, 759, 898,
576, 67, 298, 425, 894, 435, 831, 241, 989, 614, 987, 770, 384, 692,
698, 765, 331, 487, 251, 600, 879, 342, 982, 527, 736, 795, 585, 40,
54, 901, 408, 359, 577, 237, 605, 847, 353, 968, 832, 205, 838, 427,
876, 959, 686, 646, 835, 127, 621, 892, 443, 198, 988, 791, 466, 23,
707, 467, 33, 670, 921, 180, 991, 396, 160, 436, 717, 918, 8, 374,
101, 684, 727, 749};
std::cout << "\nExample 2:\n";
print_bins(limits2, bins(limits2, data2));
}
|
Port the provided C code into C++ while preserving the original functionality. | #include <SDL/SDL.h>
#ifdef WITH_CAIRO
#include <cairo.h>
#else
#include <SDL/sge.h>
#endif
#include <cairo.h>
#include <stdlib.h>
#include <time.h>
#include <math.h>
#ifdef WITH_CAIRO
#define PI 3.1415926535
#endif
#define SIZE 800
#define SCALE 5
#define BRANCHES 14
#define ROTATION_SCALE 0.75
#define INITIAL_LENGTH 50
double rand_fl(){
return (double)rand() / (double)RAND_MAX;
}
void draw_tree(SDL_Surface * surface, double offsetx, double offsety,
double directionx, double directiony, double size,
double rotation, int depth) {
#ifdef WITH_CAIRO
cairo_surface_t *surf = cairo_image_surface_create_for_data( surface->pixels,
CAIRO_FORMAT_RGB24,
surface->w, surface->h,
surface->pitch );
cairo_t *ct = cairo_create(surf);
cairo_set_line_width(ct, 1);
cairo_set_source_rgba(ct, 0,0,0,1);
cairo_move_to(ct, (int)offsetx, (int)offsety);
cairo_line_to(ct, (int)(offsetx + directionx * size), (int)(offsety + directiony * size));
cairo_stroke(ct);
#else
sge_AALine(surface,
(int)offsetx, (int)offsety,
(int)(offsetx + directionx * size), (int)(offsety + directiony * size),
SDL_MapRGB(surface->format, 0, 0, 0));
#endif
if (depth > 0){
draw_tree(surface,
offsetx + directionx * size,
offsety + directiony * size,
directionx * cos(rotation) + directiony * sin(rotation),
directionx * -sin(rotation) + directiony * cos(rotation),
size * rand_fl() / SCALE + size * (SCALE - 1) / SCALE,
rotation * ROTATION_SCALE,
depth - 1);
draw_tree(surface,
offsetx + directionx * size,
offsety + directiony * size,
directionx * cos(-rotation) + directiony * sin(-rotation),
directionx * -sin(-rotation) + directiony * cos(-rotation),
size * rand_fl() / SCALE + size * (SCALE - 1) / SCALE,
rotation * ROTATION_SCALE,
depth - 1);
}
}
void render(SDL_Surface * surface){
SDL_FillRect(surface, NULL, SDL_MapRGB(surface->format, 255, 255, 255));
draw_tree(surface,
surface->w / 2.0,
surface->h - 10.0,
0.0, -1.0,
INITIAL_LENGTH,
PI / 8,
BRANCHES);
SDL_UpdateRect(surface, 0, 0, 0, 0);
}
int main(){
SDL_Surface * screen;
SDL_Event evt;
SDL_Init(SDL_INIT_VIDEO);
srand((unsigned)time(NULL));
screen = SDL_SetVideoMode(SIZE, SIZE, 32, SDL_HWSURFACE);
render(screen);
while(1){
if (SDL_PollEvent(&evt)){
if(evt.type == SDL_QUIT) break;
}
SDL_Delay(1);
}
SDL_Quit();
return 0;
}
| #include <windows.h>
#include <string>
#include <math.h>
using namespace std;
const float PI = 3.1415926536f;
class myBitmap
{
public:
myBitmap() : pen( NULL ) {}
~myBitmap()
{
DeleteObject( pen );
DeleteDC( hdc );
DeleteObject( bmp );
}
bool create( int w, int h )
{
BITMAPINFO bi;
void *pBits;
ZeroMemory( &bi, sizeof( bi ) );
bi.bmiHeader.biSize = sizeof( bi.bmiHeader );
bi.bmiHeader.biBitCount = sizeof( DWORD ) * 8;
bi.bmiHeader.biCompression = BI_RGB;
bi.bmiHeader.biPlanes = 1;
bi.bmiHeader.biWidth = w;
bi.bmiHeader.biHeight = -h;
HDC dc = GetDC( GetConsoleWindow() );
bmp = CreateDIBSection( dc, &bi, DIB_RGB_COLORS, &pBits, NULL, 0 );
if( !bmp ) return false;
hdc = CreateCompatibleDC( dc );
SelectObject( hdc, bmp );
ReleaseDC( GetConsoleWindow(), dc );
width = w; height = h;
return true;
}
void setPenColor( DWORD clr )
{
if( pen ) DeleteObject( pen );
pen = CreatePen( PS_SOLID, 1, clr );
SelectObject( hdc, pen );
}
void saveBitmap( string path )
{
BITMAPFILEHEADER fileheader;
BITMAPINFO infoheader;
BITMAP bitmap;
DWORD* dwpBits;
DWORD wb;
HANDLE file;
GetObject( bmp, sizeof( bitmap ), &bitmap );
dwpBits = new DWORD[bitmap.bmWidth * bitmap.bmHeight];
ZeroMemory( dwpBits, bitmap.bmWidth * bitmap.bmHeight * sizeof( DWORD ) );
ZeroMemory( &infoheader, sizeof( BITMAPINFO ) );
ZeroMemory( &fileheader, sizeof( BITMAPFILEHEADER ) );
infoheader.bmiHeader.biBitCount = sizeof( DWORD ) * 8;
infoheader.bmiHeader.biCompression = BI_RGB;
infoheader.bmiHeader.biPlanes = 1;
infoheader.bmiHeader.biSize = sizeof( infoheader.bmiHeader );
infoheader.bmiHeader.biHeight = bitmap.bmHeight;
infoheader.bmiHeader.biWidth = bitmap.bmWidth;
infoheader.bmiHeader.biSizeImage = bitmap.bmWidth * bitmap.bmHeight * sizeof( DWORD );
fileheader.bfType = 0x4D42;
fileheader.bfOffBits = sizeof( infoheader.bmiHeader ) + sizeof( BITMAPFILEHEADER );
fileheader.bfSize = fileheader.bfOffBits + infoheader.bmiHeader.biSizeImage;
GetDIBits( hdc, bmp, 0, height, ( LPVOID )dwpBits, &infoheader, DIB_RGB_COLORS );
file = CreateFile( path.c_str(), GENERIC_WRITE, 0, NULL, CREATE_ALWAYS, FILE_ATTRIBUTE_NORMAL, NULL );
WriteFile( file, &fileheader, sizeof( BITMAPFILEHEADER ), &wb, NULL );
WriteFile( file, &infoheader.bmiHeader, sizeof( infoheader.bmiHeader ), &wb, NULL );
WriteFile( file, dwpBits, bitmap.bmWidth * bitmap.bmHeight * 4, &wb, NULL );
CloseHandle( file );
delete [] dwpBits;
}
HDC getDC() { return hdc; }
int getWidth() { return width; }
int getHeight() { return height; }
private:
HBITMAP bmp;
HDC hdc;
HPEN pen;
int width, height;
};
class vector2
{
public:
vector2() { x = y = 0; }
vector2( int a, int b ) { x = a; y = b; }
void set( int a, int b ) { x = a; y = b; }
void rotate( float angle_r )
{
float _x = static_cast<float>( x ),
_y = static_cast<float>( y ),
s = sinf( angle_r ),
c = cosf( angle_r ),
a = _x * c - _y * s,
b = _x * s + _y * c;
x = static_cast<int>( a );
y = static_cast<int>( b );
}
int x, y;
};
class fractalTree
{
public:
fractalTree() { _ang = DegToRadian( 24.0f ); }
float DegToRadian( float degree ) { return degree * ( PI / 180.0f ); }
void create( myBitmap* bmp )
{
_bmp = bmp;
float line_len = 130.0f;
vector2 sp( _bmp->getWidth() / 2, _bmp->getHeight() - 1 );
MoveToEx( _bmp->getDC(), sp.x, sp.y, NULL );
sp.y -= static_cast<int>( line_len );
LineTo( _bmp->getDC(), sp.x, sp.y);
drawRL( &sp, line_len, 0, true );
drawRL( &sp, line_len, 0, false );
}
private:
void drawRL( vector2* sp, float line_len, float a, bool rg )
{
line_len *= .75f;
if( line_len < 2.0f ) return;
MoveToEx( _bmp->getDC(), sp->x, sp->y, NULL );
vector2 r( 0, static_cast<int>( line_len ) );
if( rg ) a -= _ang;
else a += _ang;
r.rotate( a );
r.x += sp->x; r.y = sp->y - r.y;
LineTo( _bmp->getDC(), r.x, r.y );
drawRL( &r, line_len, a, true );
drawRL( &r, line_len, a, false );
}
myBitmap* _bmp;
float _ang;
};
int main( int argc, char* argv[] )
{
ShowWindow( GetConsoleWindow(), SW_MAXIMIZE );
myBitmap bmp;
bmp.create( 640, 512 );
bmp.setPenColor( RGB( 255, 255, 0 ) );
fractalTree tree;
tree.create( &bmp );
BitBlt( GetDC( GetConsoleWindow() ), 0, 20, 648, 512, bmp.getDC(), 0, 0, SRCCOPY );
bmp.saveBitmap( "f:
system( "pause" );
return 0;
}
|
Generate a C++ translation of this C snippet without changing its computational steps. | #include<graphics.h>
#include<conio.h>
#define sections 4
int main()
{
int d=DETECT,m,maxX,maxY,x,y,colour=0,increment=1;
initgraph(&d,&m,"c:/turboc3/bgi");
maxX = getmaxx();
maxY = getmaxy();
for(y=0;y<maxY;y+=maxY/sections)
{
for(x=0;x<maxX;x+=increment)
{
setfillstyle(SOLID_FILL,(colour++)%16);
bar(x,y,x+increment,y+maxY/sections);
}
increment++;
colour = 0;
}
getch();
closegraph();
return 0;
}
| #include <windows.h>
class pinstripe
{
public:
pinstripe() { createColors(); }
void setDimensions( int x, int y ) { _mw = x; _mh = y; }
void createColors()
{
colors[0] = 0; colors[1] = 255; colors[2] = RGB( 0, 255, 0 );
colors[3] = RGB( 0, 0, 255 ); colors[4] = RGB( 255, 0, 255 );
colors[5] = RGB( 0, 255, 255 ); colors[6] = RGB( 255, 255, 0 );
colors[7] = RGB( 255, 255, 255 );
}
void draw( HDC dc )
{
HPEN pen;
int lh = _mh / 4, row, cp;
for( int lw = 1; lw < 5; lw++ )
{
cp = 0;
row = ( lw - 1 ) * lh;
for( int x = 0 + lw > 1 ? lw > 3 ? 2 : 1 : 0; x < _mw; x += lw )
{
pen = CreatePen( PS_SOLID, lw, colors[cp] );
++cp %= 8;
SelectObject( dc, pen );
MoveToEx( dc, x, row, NULL );
LineTo( dc, x, row + lh );
DeleteObject( pen );
}
}
}
private:
int _mw, _mh;
DWORD colors[8];
};
pinstripe pin;
void PaintWnd( HWND hWnd )
{
PAINTSTRUCT ps;
HDC hdc = BeginPaint( hWnd, &ps );
pin.draw( hdc );
EndPaint( hWnd, &ps );
}
LRESULT CALLBACK WndProc( HWND hWnd, UINT msg, WPARAM wParam, LPARAM lParam )
{
switch( msg )
{
case WM_DESTROY: PostQuitMessage( 0 ); break;
case WM_PAINT: PaintWnd( hWnd ); break;
default:
return DefWindowProc( hWnd, msg, wParam, lParam );
}
return 0;
}
HWND InitAll( HINSTANCE hInstance )
{
WNDCLASSEX wcex;
ZeroMemory( &wcex, sizeof( wcex ) );
wcex.cbSize = sizeof( WNDCLASSEX );
wcex.style = CS_HREDRAW | CS_VREDRAW;
wcex.lpfnWndProc = WndProc;
wcex.hInstance = hInstance;
wcex.hCursor = LoadCursor( NULL, IDC_ARROW );
wcex.hbrBackground = ( HBRUSH )( COLOR_WINDOW + 1 );
wcex.lpszClassName = "_CLR_PS_";
RegisterClassEx( &wcex );
return CreateWindow( "_CLR_PS_", ".: Clr Pinstripe -- PJorente :.", WS_POPUP, CW_USEDEFAULT, 0, 200, 200, NULL, NULL, hInstance, NULL );
}
int APIENTRY _tWinMain( HINSTANCE hInstance, HINSTANCE hPrevInstance, LPTSTR lpCmdLine, int nCmdShow )
{
srand( GetTickCount() );
HWND hwnd = InitAll( hInstance );
if( !hwnd ) return -1;
int mw = GetSystemMetrics( SM_CXSCREEN ),
mh = GetSystemMetrics( SM_CYSCREEN );
pin.setDimensions( mw, mh );
RECT rc = { 0, 0, mw, mh };
AdjustWindowRectEx( &rc, WS_POPUP, FALSE, 0 );
int w = rc.right - rc.left,
h = rc.bottom - rc.top;
int posX = ( GetSystemMetrics( SM_CXSCREEN ) >> 1 ) - ( w >> 1 ),
posY = ( GetSystemMetrics( SM_CYSCREEN ) >> 1 ) - ( h >> 1 );
SetWindowPos( hwnd, HWND_TOP, posX, posY, w, h, SWP_NOZORDER );
ShowWindow( hwnd, nCmdShow );
UpdateWindow( hwnd );
MSG msg;
ZeroMemory( &msg, sizeof( msg ) );
while( msg.message != WM_QUIT )
{
if( PeekMessage( &msg, NULL, 0, 0, PM_REMOVE ) != 0 )
{
TranslateMessage( &msg );
DispatchMessage( &msg );
}
}
return UnregisterClass( "_CLR_PS_", hInstance );
}
|
Convert this C snippet to C++ and keep its semantics consistent. | #include <stdio.h>
#include <stdint.h>
#include <stdbool.h>
typedef struct {
uint16_t year;
uint8_t month;
uint8_t day;
} Date;
bool leap(uint16_t year) {
return year%4==0 && (year%100!=0 || year%400==0);
}
const char *weekday(Date date) {
static const uint8_t leapdoom[] = {4,1,7,2,4,6,4,1,5,3,7,5};
static const uint8_t normdoom[] = {3,7,7,4,2,6,4,1,5,3,7,5};
static const char *days[] = {
"Sunday", "Monday", "Tuesday", "Wednesday",
"Thursday", "Friday", "Saturday"
};
unsigned c = date.year/100, r = date.year%100;
unsigned s = r/12, t = r%12;
unsigned c_anchor = (5 * (c%4) + 2) % 7;
unsigned doom = (s + t + (t/4) + c_anchor) % 7;
unsigned anchor = (leap(date.year) ? leapdoom : normdoom)[date.month-1];
return days[(doom+date.day-anchor+7)%7];
}
int main(void) {
const char *past = "was", *future = "will be";
const char *months[] = { "",
"January", "February", "March", "April", "May", "June",
"July", "August", "September", "October", "November", "December"
};
const Date dates[] = {
{1800,1,6}, {1875,3,29}, {1915,12,7}, {1970,12,23}, {2043,5,14},
{2077,2,12}, {2101,4,2}
};
int i;
for (i=0; i < sizeof(dates)/sizeof(Date); i++) {
printf("%s %d, %d %s on a %s.\n",
months[dates[i].month], dates[i].day, dates[i].year,
dates[i].year > 2021 ? future : past,
weekday(dates[i]));
}
return 0;
}
| #include <iostream>
#include <cstdint>
struct Date {
std::uint16_t year;
std::uint8_t month;
std::uint8_t day;
};
constexpr bool leap(int year) {
return year%4==0 && (year%100!=0 || year%400==0);
}
const std::string& weekday(const Date& date) {
static const std::uint8_t leapdoom[] = {4,1,7,2,4,6,4,1,5,3,7,5};
static const std::uint8_t normdoom[] = {3,7,7,4,2,6,4,1,5,3,7,5};
static const std::string days[] = {
"Sunday", "Monday", "Tuesday", "Wednesday", "Thursday",
"Friday", "Saturday"
};
unsigned const c = date.year/100, r = date.year%100;
unsigned const s = r/12, t = r%12;
unsigned const c_anchor = (5 * (c%4) + 2) % 7;
unsigned const doom = (s + t + t/4 + c_anchor) % 7;
unsigned const anchor = (leap(date.year) ? leapdoom : normdoom)[date.month-1];
return days[(doom+date.day-anchor+7)%7];
}
int main(void) {
const std::string months[] = {"",
"January", "February", "March", "April", "May", "June",
"July", "August", "September", "October", "November", "December"
};
const Date dates[] = {
{1800,1,6}, {1875,3,29}, {1915,12,7}, {1970,12,23}, {2043,5,14},
{2077,2,12}, {2101,4,2}
};
for (const Date& d : dates) {
std::cout << months[d.month] << " " << (int)d.day << ", " << d.year;
std::cout << (d.year > 2021 ? " will be " : " was ");
std::cout << "on a " << weekday(d) << std::endl;
}
return 0;
}
|
Produce a language-to-language conversion: from C to C++, same semantics. | #include <stdio.h>
#include <stdint.h>
#include <stdbool.h>
typedef struct {
uint16_t year;
uint8_t month;
uint8_t day;
} Date;
bool leap(uint16_t year) {
return year%4==0 && (year%100!=0 || year%400==0);
}
const char *weekday(Date date) {
static const uint8_t leapdoom[] = {4,1,7,2,4,6,4,1,5,3,7,5};
static const uint8_t normdoom[] = {3,7,7,4,2,6,4,1,5,3,7,5};
static const char *days[] = {
"Sunday", "Monday", "Tuesday", "Wednesday",
"Thursday", "Friday", "Saturday"
};
unsigned c = date.year/100, r = date.year%100;
unsigned s = r/12, t = r%12;
unsigned c_anchor = (5 * (c%4) + 2) % 7;
unsigned doom = (s + t + (t/4) + c_anchor) % 7;
unsigned anchor = (leap(date.year) ? leapdoom : normdoom)[date.month-1];
return days[(doom+date.day-anchor+7)%7];
}
int main(void) {
const char *past = "was", *future = "will be";
const char *months[] = { "",
"January", "February", "March", "April", "May", "June",
"July", "August", "September", "October", "November", "December"
};
const Date dates[] = {
{1800,1,6}, {1875,3,29}, {1915,12,7}, {1970,12,23}, {2043,5,14},
{2077,2,12}, {2101,4,2}
};
int i;
for (i=0; i < sizeof(dates)/sizeof(Date); i++) {
printf("%s %d, %d %s on a %s.\n",
months[dates[i].month], dates[i].day, dates[i].year,
dates[i].year > 2021 ? future : past,
weekday(dates[i]));
}
return 0;
}
| #include <iostream>
#include <cstdint>
struct Date {
std::uint16_t year;
std::uint8_t month;
std::uint8_t day;
};
constexpr bool leap(int year) {
return year%4==0 && (year%100!=0 || year%400==0);
}
const std::string& weekday(const Date& date) {
static const std::uint8_t leapdoom[] = {4,1,7,2,4,6,4,1,5,3,7,5};
static const std::uint8_t normdoom[] = {3,7,7,4,2,6,4,1,5,3,7,5};
static const std::string days[] = {
"Sunday", "Monday", "Tuesday", "Wednesday", "Thursday",
"Friday", "Saturday"
};
unsigned const c = date.year/100, r = date.year%100;
unsigned const s = r/12, t = r%12;
unsigned const c_anchor = (5 * (c%4) + 2) % 7;
unsigned const doom = (s + t + t/4 + c_anchor) % 7;
unsigned const anchor = (leap(date.year) ? leapdoom : normdoom)[date.month-1];
return days[(doom+date.day-anchor+7)%7];
}
int main(void) {
const std::string months[] = {"",
"January", "February", "March", "April", "May", "June",
"July", "August", "September", "October", "November", "December"
};
const Date dates[] = {
{1800,1,6}, {1875,3,29}, {1915,12,7}, {1970,12,23}, {2043,5,14},
{2077,2,12}, {2101,4,2}
};
for (const Date& d : dates) {
std::cout << months[d.month] << " " << (int)d.day << ", " << d.year;
std::cout << (d.year > 2021 ? " will be " : " was ");
std::cout << "on a " << weekday(d) << std::endl;
}
return 0;
}
|
Keep all operations the same but rewrite the snippet in C++. | #include <stdio.h>
#include <string.h>
void swap(char* p1, char* p2, size_t size) {
for (; size-- > 0; ++p1, ++p2) {
char tmp = *p1;
*p1 = *p2;
*p2 = tmp;
}
}
void cocktail_shaker_sort(void* base, size_t count, size_t size,
int (*cmp)(const void*, const void*)) {
char* begin = base;
char* end = base + size * count;
if (end == begin)
return;
for (end -= size; begin < end; ) {
char* new_begin = end;
char* new_end = begin;
for (char* p = begin; p < end; p += size) {
char* q = p + size;
if (cmp(p, q) > 0) {
swap(p, q, size);
new_end = p;
}
}
end = new_end;
for (char* p = end; p > begin; p -= size) {
char* q = p - size;
if (cmp(q, p) > 0) {
swap(p, q, size);
new_begin = p;
}
}
begin = new_begin;
}
}
int string_compare(const void* p1, const void* p2) {
const char* const* s1 = p1;
const char* const* s2 = p2;
return strcmp(*s1, *s2);
}
void print(const char** a, size_t len) {
for (size_t i = 0; i < len; ++i)
printf("%s ", a[i]);
printf("\n");
}
int main() {
const char* a[] = { "one", "two", "three", "four", "five",
"six", "seven", "eight" };
const size_t len = sizeof(a)/sizeof(a[0]);
printf("before: ");
print(a, len);
cocktail_shaker_sort(a, len, sizeof(char*), string_compare);
printf("after: ");
print(a, len);
return 0;
}
| #include <algorithm>
#include <cassert>
#include <iostream>
#include <iterator>
#include <vector>
template <typename iterator>
void cocktail_shaker_sort(iterator begin, iterator end) {
if (begin == end)
return;
for (--end; begin < end; ) {
iterator new_begin = end;
iterator new_end = begin;
for (iterator i = begin; i < end; ++i) {
iterator j = i + 1;
if (*j < *i) {
std::iter_swap(i, j);
new_end = i;
}
}
end = new_end;
for (iterator i = end; i > begin; --i) {
iterator j = i - 1;
if (*i < *j) {
std::iter_swap(i, j);
new_begin = i;
}
}
begin = new_begin;
}
}
template <typename iterator>
void print(iterator begin, iterator end) {
if (begin == end)
return;
std::cout << *begin++;
while (begin != end)
std::cout << ' ' << *begin++;
std::cout << '\n';
}
int main() {
std::vector<int> v{5, 1, -6, 12, 3, 13, 2, 4, 0, 15};
std::cout << "before: ";
print(v.begin(), v.end());
cocktail_shaker_sort(v.begin(), v.end());
assert(std::is_sorted(v.begin(), v.end()));
std::cout << "after: ";
print(v.begin(), v.end());
return 0;
}
|
Keep all operations the same but rewrite the snippet in C++. | #include <stdlib.h>
#include <math.h>
#include <GL/glut.h>
#include <GL/gl.h>
#include <sys/time.h>
#define length 5
#define g 9.8
double alpha, accl, omega = 0, E;
struct timeval tv;
double elappsed() {
struct timeval now;
gettimeofday(&now, 0);
int ret = (now.tv_sec - tv.tv_sec) * 1000000
+ now.tv_usec - tv.tv_usec;
tv = now;
return ret / 1.e6;
}
void resize(int w, int h)
{
glViewport(0, 0, w, h);
glMatrixMode(GL_PROJECTION);
glLoadIdentity();
glMatrixMode(GL_MODELVIEW);
glLoadIdentity();
glOrtho(0, w, h, 0, -1, 1);
}
void render()
{
double x = 320 + 300 * sin(alpha), y = 300 * cos(alpha);
resize(640, 320);
glClear(GL_COLOR_BUFFER_BIT);
glBegin(GL_LINES);
glVertex2d(320, 0);
glVertex2d(x, y);
glEnd();
glFlush();
double us = elappsed();
alpha += (omega + us * accl / 2) * us;
omega += accl * us;
if (length * g * (1 - cos(alpha)) >= E) {
alpha = (alpha < 0 ? -1 : 1) * acos(1 - E / length / g);
omega = 0;
}
accl = -g / length * sin(alpha);
}
void init_gfx(int *c, char **v)
{
glutInit(c, v);
glutInitDisplayMode(GLUT_RGB);
glutInitWindowSize(640, 320);
glutIdleFunc(render);
glutCreateWindow("Pendulum");
}
int main(int c, char **v)
{
alpha = 4 * atan2(1, 1) / 2.1;
E = length * g * (1 - cos(alpha));
accl = -g / length * sin(alpha);
omega = 0;
gettimeofday(&tv, 0);
init_gfx(&c, v);
glutMainLoop();
return 0;
}
| #ifndef __wxPendulumDlg_h__
#define __wxPendulumDlg_h__
#ifdef __BORLANDC__
#pragma hdrstop
#endif
#ifndef WX_PRECOMP
#include <wx/wx.h>
#include <wx/dialog.h>
#else
#include <wx/wxprec.h>
#endif
#include <wx/timer.h>
#include <wx/dcbuffer.h>
#include <cmath>
class wxPendulumDlgApp : public wxApp
{
public:
bool OnInit();
int OnExit();
};
class wxPendulumDlg : public wxDialog
{
public:
wxPendulumDlg(wxWindow *parent, wxWindowID id = 1, const wxString &title = wxT("wxPendulum"),
const wxPoint& pos = wxDefaultPosition, const wxSize& size = wxDefaultSize,
long style = wxSUNKEN_BORDER | wxCAPTION | wxRESIZE_BORDER | wxSYSTEM_MENU | wxDIALOG_NO_PARENT | wxMINIMIZE_BOX | wxMAXIMIZE_BOX | wxCLOSE_BOX);
virtual ~wxPendulumDlg();
void wxPendulumDlgPaint(wxPaintEvent& event);
void wxPendulumDlgSize(wxSizeEvent& event);
void OnTimer(wxTimerEvent& event);
private:
wxTimer *m_timer;
unsigned int m_uiLength;
double m_Angle;
double m_AngleVelocity;
enum wxIDs
{
ID_WXTIMER1 = 1001,
ID_DUMMY_VALUE_
};
void OnClose(wxCloseEvent& event);
void CreateGUIControls();
DECLARE_EVENT_TABLE()
};
#endif
|
Write a version of this C function in C++ with identical behavior. | int gray_encode(int n) {
return n ^ (n >> 1);
}
int gray_decode(int n) {
int p = n;
while (n >>= 1) p ^= n;
return p;
}
| #include <bitset>
#include <iostream>
#include <string>
#include <assert.h>
uint32_t gray_encode(uint32_t b)
{
return b ^ (b >> 1);
}
uint32_t gray_decode(uint32_t g)
{
for (uint32_t bit = 1U << 31; bit > 1; bit >>= 1)
{
if (g & bit) g ^= bit >> 1;
}
return g;
}
std::string to_binary(int value)
{
const std::bitset<32> bs(value);
const std::string str(bs.to_string());
const size_t pos(str.find('1'));
return pos == std::string::npos ? "0" : str.substr(pos);
}
int main()
{
std::cout << "Number\tBinary\tGray\tDecoded\n";
for (uint32_t n = 0; n < 32; ++n)
{
uint32_t g = gray_encode(n);
assert(gray_decode(g) == n);
std::cout << n << "\t" << to_binary(n) << "\t" << to_binary(g) << "\t" << g << "\n";
}
}
|
Translate the given C code snippet into C++ without altering its behavior. | int gray_encode(int n) {
return n ^ (n >> 1);
}
int gray_decode(int n) {
int p = n;
while (n >>= 1) p ^= n;
return p;
}
| #include <bitset>
#include <iostream>
#include <string>
#include <assert.h>
uint32_t gray_encode(uint32_t b)
{
return b ^ (b >> 1);
}
uint32_t gray_decode(uint32_t g)
{
for (uint32_t bit = 1U << 31; bit > 1; bit >>= 1)
{
if (g & bit) g ^= bit >> 1;
}
return g;
}
std::string to_binary(int value)
{
const std::bitset<32> bs(value);
const std::string str(bs.to_string());
const size_t pos(str.find('1'));
return pos == std::string::npos ? "0" : str.substr(pos);
}
int main()
{
std::cout << "Number\tBinary\tGray\tDecoded\n";
for (uint32_t n = 0; n < 32; ++n)
{
uint32_t g = gray_encode(n);
assert(gray_decode(g) == n);
std::cout << n << "\t" << to_binary(n) << "\t" << to_binary(g) << "\t" << g << "\n";
}
}
|
Ensure the translated C++ code behaves exactly like the original C snippet. | #include<stdio.h>
int main()
{
FILE* fp = fopen("TAPE.FILE","w");
fprintf(fp,"This code should be able to write a file to magnetic tape.\n");
fprintf(fp,"The Wikipedia page on Magnetic tape data storage shows that magnetic tapes are still in use.\n");
fprintf(fp,"In fact, the latest format, at the time of writing this code is TS1155 released in 2017.\n");
fprintf(fp,"And since C is already 44, maybe 45, years old in 2017, I am sure someone somewhere did use a C compiler on magnetic tapes.\n");
fprintf(fp,"If you happen to have one, please try to compile and execute me on that system.\n");
fprintf(fp,"My creator tested me on an i5 machine with SSD and RAM that couldn't have even been dreamt of by Denis Ritchie.\n");
fprintf(fp,"Who knows ? Maybe he did foresee today, after all he created something which is still young after 44-45 years and counting...\n");
fprintf(fp,"EOF");
fclose(fp);
return 0;
}
| #include <iostream>
#include <fstream>
#if defined(_WIN32) || defined(WIN32)
constexpr auto FILENAME = "tape.file";
#else
constexpr auto FILENAME = "/dev/tape";
#endif
int main() {
std::filebuf fb;
fb.open(FILENAME,std::ios::out);
std::ostream os(&fb);
os << "Hello World\n";
fb.close();
return 0;
}
|
Generate an equivalent C++ version of this C code. | #include <stdio.h>
int max (int *a, int n, int i, int j, int k) {
int m = i;
if (j < n && a[j] > a[m]) {
m = j;
}
if (k < n && a[k] > a[m]) {
m = k;
}
return m;
}
void downheap (int *a, int n, int i) {
while (1) {
int j = max(a, n, i, 2 * i + 1, 2 * i + 2);
if (j == i) {
break;
}
int t = a[i];
a[i] = a[j];
a[j] = t;
i = j;
}
}
void heapsort (int *a, int n) {
int i;
for (i = (n - 2) / 2; i >= 0; i--) {
downheap(a, n, i);
}
for (i = 0; i < n; i++) {
int t = a[n - i - 1];
a[n - i - 1] = a[0];
a[0] = t;
downheap(a, n - i - 1, 0);
}
}
int main () {
int a[] = {4, 65, 2, -31, 0, 99, 2, 83, 782, 1};
int n = sizeof a / sizeof a[0];
int i;
for (i = 0; i < n; i++)
printf("%d%s", a[i], i == n - 1 ? "\n" : " ");
heapsort(a, n);
for (i = 0; i < n; i++)
printf("%d%s", a[i], i == n - 1 ? "\n" : " ");
return 0;
}
| #include <algorithm>
#include <iterator>
#include <iostream>
template<typename RandomAccessIterator>
void heap_sort(RandomAccessIterator begin, RandomAccessIterator end) {
std::make_heap(begin, end);
std::sort_heap(begin, end);
}
int main() {
int a[] = {100, 2, 56, 200, -52, 3, 99, 33, 177, -199};
heap_sort(std::begin(a), std::end(a));
copy(std::begin(a), std::end(a), std::ostream_iterator<int>(std::cout, " "));
std::cout << "\n";
}
|
Produce a functionally identical C++ code for the snippet given in C. | #include <stdio.h>
#include <stdlib.h>
#include <locale.h>
int locale_ok = 0;
wchar_t s_suits[] = L"♠♥♦♣";
const char *s_suits_ascii[] = { "S", "H", "D", "C" };
const char *s_nums[] = { "WHAT",
"A", "2", "3", "4", "5", "6", "7", "8", "9", "10", "J", "Q", "K",
"OVERFLOW"
};
typedef struct { int suit, number, _s; } card_t, *card;
typedef struct { int n; card_t cards[52]; } deck_t, *deck;
void show_card(card c)
{
if (locale_ok)
printf(" %lc%s", s_suits[c->suit], s_nums[c->number]);
else
printf(" %s%s", s_suits_ascii[c->suit], s_nums[c->number]);
}
deck new_deck()
{
int i, j, k;
deck d = malloc(sizeof(deck_t));
d->n = 52;
for (i = k = 0; i < 4; i++)
for (j = 1; j <= 13; j++, k++) {
d->cards[k].suit = i;
d->cards[k].number = j;
}
return d;
}
void show_deck(deck d)
{
int i;
printf("%d cards:", d->n);
for (i = 0; i < d->n; i++)
show_card(d->cards + i);
printf("\n");
}
int cmp_card(const void *a, const void *b)
{
int x = ((card)a)->_s, y = ((card)b)->_s;
return x < y ? -1 : x > y;
}
card deal_card(deck d)
{
if (!d->n) return 0;
return d->cards + --d->n;
}
void shuffle_deck(deck d)
{
int i;
for (i = 0; i < d->n; i++)
d->cards[i]._s = rand();
qsort(d->cards, d->n, sizeof(card_t), cmp_card);
}
int main()
{
int i, j;
deck d = new_deck();
locale_ok = (0 != setlocale(LC_CTYPE, ""));
printf("New deck, "); show_deck(d);
printf("\nShuffle and deal to three players:\n");
shuffle_deck(d);
for (i = 0; i < 3; i++) {
for (j = 0; j < 5; j++)
show_card(deal_card(d));
printf("\n");
}
printf("Left in deck "); show_deck(d);
return 0;
}
| #include <deque>
#include <algorithm>
#include <ostream>
#include <iterator>
namespace cards
{
class card
{
public:
enum pip_type { two, three, four, five, six, seven, eight, nine, ten,
jack, queen, king, ace, pip_count };
enum suite_type { hearts, spades, diamonds, clubs, suite_count };
enum { unique_count = pip_count * suite_count };
card(suite_type s, pip_type p): value(s + suite_count * p) {}
explicit card(unsigned char v = 0): value(v) {}
pip_type pip() { return pip_type(value / suite_count); }
suite_type suite() { return suite_type(value % suite_count); }
private:
unsigned char value;
};
const char* const pip_names[] =
{ "two", "three", "four", "five", "six", "seven", "eight", "nine", "ten",
"jack", "queen", "king", "ace" };
std::ostream& operator<<(std::ostream& os, card::pip_type pip)
{
return os << pip_names[pip];
}
const char* const suite_names[] =
{ "hearts", "spades", "diamonds", "clubs" };
std::ostream& operator<<(std::ostream& os, card::suite_type suite)
{
return os << suite_names[suite];
}
std::ostream& operator<<(std::ostream& os, card c)
{
return os << c.pip() << " of " << c.suite();
}
class deck
{
public:
deck()
{
for (int i = 0; i < card::unique_count; ++i) {
cards.push_back(card(i));
}
}
void shuffle() { std::random_shuffle(cards.begin(), cards.end()); }
card deal() { card c = cards.front(); cards.pop_front(); return c; }
typedef std::deque<card>::const_iterator const_iterator;
const_iterator begin() const { return cards.cbegin(); }
const_iterator end() const { return cards.cend(); }
private:
std::deque<card> cards;
};
inline std::ostream& operator<<(std::ostream& os, const deck& d)
{
std::copy(d.begin(), d.end(), std::ostream_iterator<card>(os, "\n"));
return os;
}
}
|
Transform the following C implementation into C++, maintaining the same output and logic. | char foo()
{
char array[5] = {3,6,9,12,15};
return array[2];
}
| #include <array>
#include <vector>
#include <algorithm>
#include <iostream>
#include <iterator>
#include <string>
template <typename Array>
void demonstrate(Array& array)
{
array[2] = "Three";
array.at(1) = "Two";
std::reverse(begin(array), end(array));
std::for_each(begin(array), end(array),
[](typename Array::value_type const& element)
{
std::cout << element << ' ';
});
std::cout << '\n';
}
int main()
{
auto fixed_size_array = std::array<std::string, 3>{ "One", "Four", "Eight" };
auto dynamic_array = std::vector<std::string>{ "One", "Four" };
dynamic_array.push_back("Eight");
demonstrate(fixed_size_array);
demonstrate(dynamic_array);
}
|
Translate the given C code snippet into C++ without altering its behavior. | #include <stdio.h>
int main()
{
int i, j, dim, d;
int depth = 3;
for (i = 0, dim = 1; i < depth; i++, dim *= 3);
for (i = 0; i < dim; i++) {
for (j = 0; j < dim; j++) {
for (d = dim / 3; d; d /= 3)
if ((i % (d * 3)) / d == 1 && (j % (d * 3)) / d == 1)
break;
printf(d ? " " : "##");
}
printf("\n");
}
return 0;
}
|
#include <cstdint>
#include <cstdlib>
#include <cstdio>
static constexpr int32_t bct_low_bits = 0x55555555;
static int32_t bct_decrement(int32_t v) {
--v;
return v ^ (v & (v>>1) & bct_low_bits);
}
int main (int argc, char *argv[])
{
const int32_t n = (1 < argc) ? std::atoi(argv[1]) : 3;
if (n < 0 || 9 < n) {
std::printf("N out of range (use 0..9): %ld\n", long(n));
return 1;
}
const int32_t size_bct = 1<<(n*2);
int32_t y = size_bct;
do {
y = bct_decrement(y);
int32_t x = size_bct;
do {
x = bct_decrement(x);
std::putchar((x & y & bct_low_bits) ? ' ' : '#');
} while (0 < x);
std::putchar('\n');
} while (0 < y);
return 0;
}
|
Translate the given C code snippet into C++ without altering its behavior. | #include <stdio.h>
#include <stdlib.h>
#include <stdbool.h>
bool is_sorted(int *a, int n)
{
while ( --n >= 1 ) {
if ( a[n] < a[n-1] ) return false;
}
return true;
}
void shuffle(int *a, int n)
{
int i, t, r;
for(i=0; i < n; i++) {
t = a[i];
r = rand() % n;
a[i] = a[r];
a[r] = t;
}
}
void bogosort(int *a, int n)
{
while ( !is_sorted(a, n) ) shuffle(a, n);
}
int main()
{
int numbers[] = { 1, 10, 9, 7, 3, 0 };
int i;
bogosort(numbers, 6);
for (i=0; i < 6; i++) printf("%d ", numbers[i]);
printf("\n");
}
| #include <algorithm>
#include <iostream>
#include <iterator>
#include <random>
template <typename RandomAccessIterator, typename Predicate>
void bogo_sort(RandomAccessIterator begin, RandomAccessIterator end,
Predicate p) {
std::random_device rd;
std::mt19937 generator(rd());
while (!std::is_sorted(begin, end, p)) {
std::shuffle(begin, end, generator);
}
}
template <typename RandomAccessIterator>
void bogo_sort(RandomAccessIterator begin, RandomAccessIterator end) {
bogo_sort(
begin, end,
std::less<
typename std::iterator_traits<RandomAccessIterator>::value_type>());
}
int main() {
int a[] = {100, 2, 56, 200, -52, 3, 99, 33, 177, -199};
bogo_sort(std::begin(a), std::end(a));
copy(std::begin(a), std::end(a), std::ostream_iterator<int>(std::cout, " "));
std::cout << "\n";
}
|
Translate the given C code snippet into C++ without altering its behavior. |
#include <ctime>
#include <cstdint>
extern "C" {
int64_t from date(const char* string) {
struct tm tmInfo = {0};
strptime(string, "%Y-%m-%d", &tmInfo);
return mktime(&tmInfo);
}
}
| #include <iostream>
#include <optional>
#include <ranges>
#include <string>
#include <vector>
using namespace std;
struct Patient
{
string ID;
string LastName;
};
struct Visit
{
string PatientID;
string Date;
optional<float> Score;
};
int main(void)
{
auto patients = vector<Patient> {
{"1001", "Hopper"},
{"4004", "Wirth"},
{"3003", "Kemeny"},
{"2002", "Gosling"},
{"5005", "Kurtz"}};
auto visits = vector<Visit> {
{"2002", "2020-09-10", 6.8},
{"1001", "2020-09-17", 5.5},
{"4004", "2020-09-24", 8.4},
{"2002", "2020-10-08", },
{"1001", "" , 6.6},
{"3003", "2020-11-12", },
{"4004", "2020-11-05", 7.0},
{"1001", "2020-11-19", 5.3}};
sort(patients.begin(), patients.end(),
[](const auto& a, const auto&b){ return a.ID < b.ID;});
cout << "| PATIENT_ID | LASTNAME | LAST_VISIT | SCORE_SUM | SCORE_AVG |\n";
for(const auto& patient : patients)
{
string lastVisit;
float sum = 0;
int numScores = 0;
auto patientFilter = [&patient](const Visit &v){return v.PatientID == patient.ID;};
for(const auto& visit : visits | views::filter( patientFilter ))
{
if(visit.Score)
{
sum += *visit.Score;
numScores++;
}
lastVisit = max(lastVisit, visit.Date);
}
cout << "| " << patient.ID << " | ";
cout.width(8); cout << patient.LastName << " | ";
cout.width(10); cout << lastVisit << " | ";
if(numScores > 0)
{
cout.width(9); cout << sum << " | ";
cout.width(9); cout << (sum / float(numScores));
}
else cout << " | ";
cout << " |\n";
}
}
|
Write the same code in C++ as shown below in C. | #include <stdio.h>
#include <math.h>
typedef double (*deriv_f)(double, double);
#define FMT " %7.3f"
void ivp_euler(deriv_f f, double y, int step, int end_t)
{
int t = 0;
printf(" Step %2d: ", (int)step);
do {
if (t % 10 == 0) printf(FMT, y);
y += step * f(t, y);
} while ((t += step) <= end_t);
printf("\n");
}
void analytic()
{
double t;
printf(" Time: ");
for (t = 0; t <= 100; t += 10) printf(" %7g", t);
printf("\nAnalytic: ");
for (t = 0; t <= 100; t += 10)
printf(FMT, 20 + 80 * exp(-0.07 * t));
printf("\n");
}
double cooling(double t, double temp)
{
return -0.07 * (temp - 20);
}
int main()
{
analytic();
ivp_euler(cooling, 100, 2, 100);
ivp_euler(cooling, 100, 5, 100);
ivp_euler(cooling, 100, 10, 100);
return 0;
}
| #include <iomanip>
#include <iostream>
typedef double F(double,double);
void euler(F f, double y0, double a, double b, double h)
{
double y = y0;
for (double t = a; t < b; t += h)
{
std::cout << std::fixed << std::setprecision(3) << t << " " << y << "\n";
y += h * f(t, y);
}
std::cout << "done\n";
}
double newtonCoolingLaw(double, double t)
{
return -0.07 * (t - 20);
}
int main()
{
euler(newtonCoolingLaw, 100, 0, 100, 2);
euler(newtonCoolingLaw, 100, 0, 100, 5);
euler(newtonCoolingLaw, 100, 0, 100, 10);
}
|
Transform the following C implementation into C++, maintaining the same output and logic. | #include <math.h>
#include <stdio.h>
#include <assert.h>
int nonsqr(int n) {
return n + (int)(0.5 + sqrt(n));
}
int main() {
int i;
for (i = 1; i < 23; i++)
printf("%d ", nonsqr(i));
printf("\n");
for (i = 1; i < 1000000; i++) {
double j = sqrt(nonsqr(i));
assert(j != floor(j));
}
return 0;
}
| #include <iostream>
#include <algorithm>
#include <vector>
#include <cmath>
#include <boost/bind.hpp>
#include <iterator>
double nextNumber( double number ) {
return number + floor( 0.5 + sqrt( number ) ) ;
}
int main( ) {
std::vector<double> non_squares ;
typedef std::vector<double>::iterator SVI ;
non_squares.reserve( 1000000 ) ;
for ( double i = 1.0 ; i < 100001.0 ; i += 1 )
non_squares.push_back( nextNumber( i ) ) ;
std::copy( non_squares.begin( ) , non_squares.begin( ) + 22 ,
std::ostream_iterator<double>(std::cout, " " ) ) ;
std::cout << '\n' ;
SVI found = std::find_if ( non_squares.begin( ) , non_squares.end( ) ,
boost::bind( &floor, boost::bind( &sqrt, _1 ) ) == boost::bind( &sqrt, _1 ) ) ;
if ( found != non_squares.end( ) ) {
std::cout << "Found a square number in the sequence!\n" ;
std::cout << "It is " << *found << " !\n" ;
}
else {
std::cout << "Up to 1000000, found no square number in the sequence!\n" ;
}
return 0 ;
}
|
Write the same algorithm in C++ as shown in this C implementation. |
#define _CRT_SECURE_NO_WARNINGS
#include <stdio.h>
#include <stdlib.h>
#include <string.h>
void putm(char* string, size_t m)
{
while(*string && m--)
putchar(*string++);
}
int main(void)
{
char string[] =
"Programs for other encodings (such as 8-bit ASCII, or EUC-JP)."
int n = 3;
int m = 4;
char knownCharacter = '(';
char knownSubstring[] = "encodings";
putm(string+n-1, m ); putchar('\n');
puts(string+n+1); putchar('\n');
putm(string, strlen(string)-1); putchar('\n');
putm(strchr(string, knownCharacter), m ); putchar('\n');
putm(strstr(string, knownSubstring), m ); putchar('\n');
return EXIT_SUCCESS;
}
| #include <iostream>
#include <string>
int main()
{
std::string s = "0123456789";
int const n = 3;
int const m = 4;
char const c = '2';
std::string const sub = "456";
std::cout << s.substr(n, m)<< "\n";
std::cout << s.substr(n) << "\n";
std::cout << s.substr(0, s.size()-1) << "\n";
std::cout << s.substr(s.find(c), m) << "\n";
std::cout << s.substr(s.find(sub), m) << "\n";
}
|
Change the following C code into C++ without altering its purpose. | #include <stdio.h>
#include <stdlib.h>
int number_of_digits(int x){
int NumberOfDigits;
for(NumberOfDigits=0;x!=0;NumberOfDigits++){
x=x/10;
}
return NumberOfDigits;
}
int* convert_array(char array[], int NumberOfElements)
{
int *convertedArray=malloc(NumberOfElements*sizeof(int));
int originalElement, convertedElement;
for(convertedElement=0, originalElement=0; convertedElement<NumberOfElements; convertedElement++)
{
convertedArray[convertedElement]=atoi(&array[originalElement]);
originalElement+=number_of_digits(convertedArray[convertedElement])+1;
}
return convertedArray;
}
int isSorted(int array[], int numberOfElements){
int sorted=1;
for(int counter=0;counter<numberOfElements;counter++){
if(counter!=0 && array[counter-1]>array[counter]) sorted--;
}
return sorted;
}
int main(int argc, char* argv[])
{
int* convertedArray;
convertedArray=convert_array(*(argv+1), argc-1);
if(isSorted(convertedArray, argc-1)==1) printf("Did you forgot to turn on your brain?! This array is already sorted!\n");
else if(argc-1<=10) printf("Am I really supposed to sort this? Sort it by yourself!\n");
else printf("Am I really supposed to sort this? Bhahahaha!\n");
free(convertedArray);
return 0;
}
| #include <algorithm>
#include <string>
#include <iostream>
#include <iterator>
class jortSort {
public:
template<class T>
bool jort_sort( T* o, size_t s ) {
T* n = copy_array( o, s );
sort_array( n, s );
bool r = false;
if( n ) {
r = check( o, n, s );
delete [] n;
}
return r;
}
private:
template<class T>
T* copy_array( T* o, size_t s ) {
T* z = new T[s];
memcpy( z, o, s * sizeof( T ) );
return z;
}
template<class T>
void sort_array( T* n, size_t s ) {
std::sort( n, n + s );
}
template<class T>
bool check( T* n, T* o, size_t s ) {
for( size_t x = 0; x < s; x++ )
if( n[x] != o[x] ) return false;
return true;
}
};
jortSort js;
template<class T>
void displayTest( T* o, size_t s ) {
std::copy( o, o + s, std::ostream_iterator<T>( std::cout, " " ) );
std::cout << ": -> The array is " << ( js.jort_sort( o, s ) ? "sorted!" : "not sorted!" ) << "\n\n";
}
int main( int argc, char* argv[] ) {
const size_t s = 5;
std::string oStr[] = { "5", "A", "D", "R", "S" };
displayTest( oStr, s );
std::swap( oStr[0], oStr[1] );
displayTest( oStr, s );
int oInt[] = { 1, 2, 3, 4, 5 };
displayTest( oInt, s );
std::swap( oInt[0], oInt[1] );
displayTest( oInt, s );
return 0;
}
|
Translate the given C code snippet into C++ without altering its behavior. | #include <stdio.h>
int is_leap_year(unsigned year)
{
return !(year & (year % 100 ? 3 : 15));
}
int main(void)
{
const unsigned test_case[] = {
1900, 1994, 1996, 1997, 2000, 2024, 2025, 2026, 2100
};
const unsigned n = sizeof test_case / sizeof test_case[0];
for (unsigned i = 0; i != n; ++i) {
unsigned year = test_case[i];
printf("%u is %sa leap year.\n", year, is_leap_year(year) ? "" : "not ");
}
return 0;
}
| #include <iostream>
bool is_leap_year(int year) {
return year % 4 == 0 && (year % 100 != 0 || year % 400 == 0);
}
int main() {
for (auto year : {1900, 1994, 1996, 1997, 2000}) {
std::cout << year << (is_leap_year(year) ? " is" : " is not") << " a leap year.\n";
}
}
|
Write the same code in C++ as shown below in C. | #include <gmp.h>
void perm(mpz_t out, int n, int k)
{
mpz_set_ui(out, 1);
k = n - k;
while (n > k) mpz_mul_ui(out, out, n--);
}
void comb(mpz_t out, int n, int k)
{
perm(out, n, k);
while (k) mpz_divexact_ui(out, out, k--);
}
int main(void)
{
mpz_t x;
mpz_init(x);
perm(x, 1000, 969);
gmp_printf("P(1000,969) = %Zd\n", x);
comb(x, 1000, 969);
gmp_printf("C(1000,969) = %Zd\n", x);
return 0;
}
| #include <boost/multiprecision/gmp.hpp>
#include <iostream>
using namespace boost::multiprecision;
mpz_int p(uint n, uint p) {
mpz_int r = 1;
mpz_int k = n - p;
while (n > k)
r *= n--;
return r;
}
mpz_int c(uint n, uint k) {
mpz_int r = p(n, k);
while (k)
r /= k--;
return r;
}
int main() {
for (uint i = 1u; i < 12u; i++)
std::cout << "P(12," << i << ") = " << p(12u, i) << std::endl;
for (uint i = 10u; i < 60u; i += 10u)
std::cout << "C(60," << i << ") = " << c(60u, i) << std::endl;
return 0;
}
|
Transform the following C implementation into C++, maintaining the same output and logic. | #include <math.h>
#include <stdio.h>
#include <stdlib.h>
#include <string.h>
int compareStrings(const void *a, const void *b) {
const char **aa = (const char **)a;
const char **bb = (const char **)b;
return strcmp(*aa, *bb);
}
void lexOrder(int n, int *ints) {
char **strs;
int i, first = 1, last = n, k = n, len;
if (n < 1) {
first = n; last = 1; k = 2 - n;
}
strs = malloc(k * sizeof(char *));
for (i = first; i <= last; ++i) {
if (i >= 1) len = (int)log10(i) + 2;
else if (i == 0) len = 2;
else len = (int)log10(-i) + 3;
strs[i-first] = malloc(len);
sprintf(strs[i-first], "%d", i);
}
qsort(strs, k, sizeof(char *), compareStrings);
for (i = 0; i < k; ++i) {
ints[i] = atoi(strs[i]);
free(strs[i]);
}
free(strs);
}
int main() {
int i, j, k, n, *ints;
int numbers[5] = {0, 5, 13, 21, -22};
printf("In lexicographical order:\n\n");
for (i = 0; i < 5; ++i) {
k = n = numbers[i];
if (k < 1) k = 2 - k;
ints = malloc(k * sizeof(int));
lexOrder(n, ints);
printf("%3d: [", n);
for (j = 0; j < k; ++j) {
printf("%d ", ints[j]);
}
printf("\b]\n");
free(ints);
}
return 0;
}
| #include <algorithm>
#include <iostream>
#include <numeric>
#include <string>
#include <vector>
void lexicographical_sort(std::vector<int>& numbers) {
std::vector<std::string> strings(numbers.size());
std::transform(numbers.begin(), numbers.end(), strings.begin(),
[](int i) { return std::to_string(i); });
std::sort(strings.begin(), strings.end());
std::transform(strings.begin(), strings.end(), numbers.begin(),
[](const std::string& s) { return std::stoi(s); });
}
std::vector<int> lexicographically_sorted_vector(int n) {
std::vector<int> numbers(n >= 1 ? n : 2 - n);
std::iota(numbers.begin(), numbers.end(), std::min(1, n));
lexicographical_sort(numbers);
return numbers;
}
template <typename T>
void print_vector(std::ostream& out, const std::vector<T>& v) {
out << '[';
if (!v.empty()) {
auto i = v.begin();
out << *i++;
for (; i != v.end(); ++i)
out << ',' << *i;
}
out << "]\n";
}
int main(int argc, char** argv) {
for (int i : { 0, 5, 13, 21, -22 }) {
std::cout << i << ": ";
print_vector(std::cout, lexicographically_sorted_vector(i));
}
return 0;
}
|
Translate this program into C++ but keep the logic exactly as in C. | #include <stdio.h>
#include <string.h>
const char *ones[] = { 0, "one", "two", "three", "four",
"five", "six", "seven", "eight", "nine",
"ten", "eleven", "twelve", "thirteen", "fourteen",
"fifteen", "sixteen", "seventeen", "eighteen", "nineteen" };
const char *tens[] = { 0, "ten", "twenty", "thirty", "forty",
"fifty", "sixty", "seventy", "eighty", "ninety" };
const char *llions[] = { 0, "thousand", "million", "billion", "trillion",
};
const int maxillion = sizeof(llions) / sizeof(llions[0]) * 3 - 3;
int say_hundred(const char *s, int len, int depth, int has_lead)
{
int c[3], i;
for (i = -3; i < 0; i++) {
if (len + i >= 0) c[i + 3] = s[len + i] - '0';
else c[i + 3] = 0;
}
if (!(c[0] + c[1] + c[2])) return 0;
if (c[0]) {
printf("%s hundred", ones[c[0]]);
has_lead = 1;
}
if (has_lead && (c[1] || c[2]))
printf((!depth || c[0]) && (!c[0] || !c[1]) ? "and " :
c[0] ? " " : "");
if (c[1] < 2) {
if (c[1] || c[2]) printf("%s", ones[c[1] * 10 + c[2]]);
} else {
if (c[1]) {
printf("%s", tens[c[1]]);
if (c[2]) putchar('-');
}
if (c[2]) printf("%s", ones[c[2]]);
}
return 1;
}
int say_maxillion(const char *s, int len, int depth, int has_lead)
{
int n = len / 3, r = len % 3;
if (!r) {
n--;
r = 3;
}
const char *e = s + r;
do {
if (say_hundred(s, r, n, has_lead) && n) {
has_lead = 1;
printf(" %s", llions[n]);
if (!depth) printf(", ");
else printf(" ");
}
s = e; e += 3;
} while (r = 3, n--);
return 1;
}
void say_number(const char *s)
{
int len, i, got_sign = 0;
while (*s == ' ') s++;
if (*s < '0' || *s > '9') {
if (*s == '-') got_sign = -1;
else if (*s == '+') got_sign = 1;
else goto nan;
s++;
} else
got_sign = 1;
while (*s == '0') {
s++;
if (*s == '\0') {
printf("zero\n");
return;
}
}
len = strlen(s);
if (!len) goto nan;
for (i = 0; i < len; i++) {
if (s[i] < '0' || s[i] > '9') {
printf("(not a number)");
return;
}
}
if (got_sign == -1) printf("minus ");
int n = len / maxillion;
int r = len % maxillion;
if (!r) {
r = maxillion;
n--;
}
const char *end = s + len - n * maxillion;
int has_lead = 0;
do {
if ((has_lead = say_maxillion(s, r, n, has_lead))) {
for (i = 0; i < n; i++)
printf(" %s", llions[maxillion / 3]);
if (n) printf(", ");
}
n--;
r = maxillion;
s = end;
end += r;
} while (n >= 0);
printf("\n");
return;
nan: printf("not a number\n");
return;
}
int main()
{
say_number("-42");
say_number("1984");
say_number("10000");
say_number("1024");
say_number("1001001001001");
say_number("123456789012345678901234567890123456789012345678900000001");
return 0;
}
| #include <string>
#include <iostream>
using std::string;
const char* smallNumbers[] = {
"zero", "one", "two", "three", "four", "five",
"six", "seven", "eight", "nine", "ten",
"eleven", "twelve", "thirteen", "fourteen", "fifteen",
"sixteen", "seventeen", "eighteen", "nineteen"
};
string spellHundreds(unsigned n) {
string res;
if (n > 99) {
res = smallNumbers[n/100];
res += " hundred";
n %= 100;
if (n) res += " and ";
}
if (n >= 20) {
static const char* Decades[] = {
"", "", "twenty", "thirty", "forty",
"fifty", "sixty", "seventy", "eighty", "ninety"
};
res += Decades[n/10];
n %= 10;
if (n) res += "-";
}
if (n < 20 && n > 0)
res += smallNumbers[n];
return res;
}
const char* thousandPowers[] = {
" billion", " million", " thousand", "" };
typedef unsigned long Spellable;
string spell(Spellable n) {
if (n < 20) return smallNumbers[n];
string res;
const char** pScaleName = thousandPowers;
Spellable scaleFactor = 1000000000;
while (scaleFactor > 0) {
if (n >= scaleFactor) {
Spellable h = n / scaleFactor;
res += spellHundreds(h) + *pScaleName;
n %= scaleFactor;
if (n) res += ", ";
}
scaleFactor /= 1000;
++pScaleName;
}
return res;
}
int main() {
#define SPELL_IT(x) std::cout << #x " " << spell(x) << std::endl;
SPELL_IT( 99);
SPELL_IT( 300);
SPELL_IT( 310);
SPELL_IT( 1501);
SPELL_IT( 12609);
SPELL_IT( 512609);
SPELL_IT(43112609);
SPELL_IT(1234567890);
return 0;
}
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.