Instruction
stringlengths
45
106
input_code
stringlengths
1
13.7k
output_code
stringlengths
1
13.7k
Translate this program into C++ but keep the logic exactly as in PHP.
<?php function gray_encode($binary){ return $binary ^ ($binary >> 1); } function gray_decode($gray){ $binary = $gray; while($gray >>= 1) $binary ^= $gray; return $binary; } for($i=0;$i<32;$i++){ $gray_encoded = gray_encode($i); printf("%2d : %05b => %05b => %05b : %2d \n",$i, $i, $gray_encoded, $gray_encoded, gray_decode($gray_encoded)); }
#include <bitset> #include <iostream> #include <string> #include <assert.h> uint32_t gray_encode(uint32_t b) { return b ^ (b >> 1); } uint32_t gray_decode(uint32_t g) { for (uint32_t bit = 1U << 31; bit > 1; bit >>= 1) { if (g & bit) g ^= bit >> 1; } return g; } std::string to_binary(int value) { const std::bitset<32> bs(value); const std::string str(bs.to_string()); const size_t pos(str.find('1')); return pos == std::string::npos ? "0" : str.substr(pos); } int main() { std::cout << "Number\tBinary\tGray\tDecoded\n"; for (uint32_t n = 0; n < 32; ++n) { uint32_t g = gray_encode(n); assert(gray_decode(g) == n); std::cout << n << "\t" << to_binary(n) << "\t" << to_binary(g) << "\t" << g << "\n"; } }
Produce a functionally identical C++ code for the snippet given in PHP.
class Card { protected static $suits = array( '♠', '♥', '♦', '♣' ); protected static $pips = array( '2', '3', '4', '5', '6', '7', '8', '9', 'T', 'J', 'Q', 'K', 'A' ); protected $suit; protected $suitOrder; protected $pip; protected $pipOrder; protected $order; public function __construct( $suit, $pip ) { if( !in_array( $suit, self::$suits ) ) { throw new InvalidArgumentException( 'Invalid suit' ); } if( !in_array( $pip, self::$pips ) ) { throw new InvalidArgumentException( 'Invalid pip' ); } $this->suit = $suit; $this->pip = $pip; } public function getSuit() { return $this->suit; } public function getPip() { return $this->pip; } public function getSuitOrder() { if( !isset( $this->suitOrder ) ) { $this->suitOrder = array_search( $this->suit, self::$suits ); } return $this->suitOrder; } public function getPipOrder() { if( !isset( $this->pipOrder ) ) { $this->pipOrder = array_search( $this->pip, self::$pips ); } return $this->pipOrder; } public function getOrder() { if( !isset( $this->order ) ) { $suitOrder = $this->getSuitOrder(); $pipOrder = $this->getPipOrder(); $this->order = $pipOrder * count( self::$suits ) + $suitOrder; } return $this->order; } public function compareSuit( Card $other ) { return $this->getSuitOrder() - $other->getSuitOrder(); } public function comparePip( Card $other ) { return $this->getPipOrder() - $other->getPipOrder(); } public function compare( Card $other ) { return $this->getOrder() - $other->getOrder(); } public function __toString() { return $this->suit . $this->pip; } public static function getSuits() { return self::$suits; } public static function getPips() { return self::$pips; } } class CardCollection implements Countable, Iterator { protected $cards = array(); protected function __construct( array $cards = array() ) { foreach( $cards as $card ) { $this->addCard( $card ); } } public function count() { return count( $this->cards ); } public function key() { return key( $this->cards ); } public function valid() { return null !== $this->key(); } public function next() { next( $this->cards ); } public function current() { return current( $this->cards ); } public function rewind() { reset( $this->cards ); } public function sort( $comparer = null ) { $comparer = $comparer ?: function( $a, $b ) { return $a->compare( $b ); }; if( !is_callable( $comparer ) ) { throw new InvalidArgumentException( 'Invalid comparer; comparer should be callable' ); } usort( $this->cards, $comparer ); return $this; } public function toString() { return implode( ' ', $this->cards ); } public function __toString() { return $this->toString(); } protected function addCard( Card $card ) { if( in_array( $card, $this->cards ) ) { throw new DomainException( 'Card is already present in this collection' ); } $this->cards[] = $card; } } class Deck extends CardCollection { public function __construct( $shuffled = false ) { foreach( Card::getSuits() as $suit ) { foreach( Card::getPips() as $pip ) { $this->addCard( new Card( $suit, $pip ) ); } } if( $shuffled ) { $this->shuffle(); } } public function deal( $amount = 1, CardCollection $cardCollection = null ) { if( !is_int( $amount ) || $amount < 1 ) { throw new InvalidArgumentException( 'Invalid amount; amount should be an integer, larger than 0' ); } if( $amount > count( $this->cards ) ) { throw new RangeException( 'Invalid amount; requested amount is larger than the amount of available cards' ); } $cards = array_splice( $this->cards, 0, $amount ); $cardCollection = $cardCollection ?: new CardCollection; foreach( $cards as $card ) { $cardCollection->addCard( $card ); } return $cardCollection; } public function shuffle() { shuffle( $this->cards ); } } class Hand extends CardCollection { public function __construct() {} public function play( $position ) { if( !isset( $this->cards[ $position ] ) ) { throw new OutOfBoundsException( 'Invalid position; position is not present in this hand' ); } $result = array_splice( $this->cards, $position, 1 ); return $result[ 0 ]; } }
#include <deque> #include <algorithm> #include <ostream> #include <iterator> namespace cards { class card { public: enum pip_type { two, three, four, five, six, seven, eight, nine, ten, jack, queen, king, ace, pip_count }; enum suite_type { hearts, spades, diamonds, clubs, suite_count }; enum { unique_count = pip_count * suite_count }; card(suite_type s, pip_type p): value(s + suite_count * p) {} explicit card(unsigned char v = 0): value(v) {} pip_type pip() { return pip_type(value / suite_count); } suite_type suite() { return suite_type(value % suite_count); } private: unsigned char value; }; const char* const pip_names[] = { "two", "three", "four", "five", "six", "seven", "eight", "nine", "ten", "jack", "queen", "king", "ace" }; std::ostream& operator<<(std::ostream& os, card::pip_type pip) { return os << pip_names[pip]; } const char* const suite_names[] = { "hearts", "spades", "diamonds", "clubs" }; std::ostream& operator<<(std::ostream& os, card::suite_type suite) { return os << suite_names[suite]; } std::ostream& operator<<(std::ostream& os, card c) { return os << c.pip() << " of " << c.suite(); } class deck { public: deck() { for (int i = 0; i < card::unique_count; ++i) { cards.push_back(card(i)); } } void shuffle() { std::random_shuffle(cards.begin(), cards.end()); } card deal() { card c = cards.front(); cards.pop_front(); return c; } typedef std::deque<card>::const_iterator const_iterator; const_iterator begin() const { return cards.cbegin(); } const_iterator end() const { return cards.cend(); } private: std::deque<card> cards; }; inline std::ostream& operator<<(std::ostream& os, const deck& d) { std::copy(d.begin(), d.end(), std::ostream_iterator<card>(os, "\n")); return os; } }
Produce a language-to-language conversion: from PHP to C++, same semantics.
$NumberArray = array(0, 1, 2, 3, 4, 5, 6); $LetterArray = array("a", "b", "c", "d", "e", "f"); $simpleForm = ['apple', 'orange'];
#include <array> #include <vector> #include <algorithm> #include <iostream> #include <iterator> #include <string> template <typename Array> void demonstrate(Array& array) { array[2] = "Three"; array.at(1) = "Two"; std::reverse(begin(array), end(array)); std::for_each(begin(array), end(array), [](typename Array::value_type const& element) { std::cout << element << ' '; }); std::cout << '\n'; } int main() { auto fixed_size_array = std::array<std::string, 3>{ "One", "Four", "Eight" }; auto dynamic_array = std::vector<std::string>{ "One", "Four" }; dynamic_array.push_back("Eight"); demonstrate(fixed_size_array); demonstrate(dynamic_array); }
Generate an equivalent C++ version of this PHP code.
<?php function isSierpinskiCarpetPixelFilled($x, $y) { while (($x > 0) or ($y > 0)) { if (($x % 3 == 1) and ($y % 3 == 1)) { return false; } $x /= 3; $y /= 3; } return true; } function sierpinskiCarpet($order) { $size = pow(3, $order); for ($y = 0 ; $y < $size ; $y++) { for ($x = 0 ; $x < $size ; $x++) { echo isSierpinskiCarpetPixelFilled($x, $y) ? '#' : ' '; } echo PHP_EOL; } } for ($order = 0 ; $order <= 3 ; $order++) { echo 'N=', $order, PHP_EOL; sierpinskiCarpet($order); echo PHP_EOL; }
#include <cstdint> #include <cstdlib> #include <cstdio> static constexpr int32_t bct_low_bits = 0x55555555; static int32_t bct_decrement(int32_t v) { --v; return v ^ (v & (v>>1) & bct_low_bits); } int main (int argc, char *argv[]) { const int32_t n = (1 < argc) ? std::atoi(argv[1]) : 3; if (n < 0 || 9 < n) { std::printf("N out of range (use 0..9): %ld\n", long(n)); return 1; } const int32_t size_bct = 1<<(n*2); int32_t y = size_bct; do { y = bct_decrement(y); int32_t x = size_bct; do { x = bct_decrement(x); std::putchar((x & y & bct_low_bits) ? ' ' : '#'); } while (0 < x); std::putchar('\n'); } while (0 < y); return 0; }
Convert the following code from PHP to C++, ensuring the logic remains intact.
function bogosort($l) { while (!in_order($l)) shuffle($l); return $l; } function in_order($l) { for ($i = 1; $i < count($l); $i++) if ($l[$i] < $l[$i-1]) return FALSE; return TRUE; }
#include <algorithm> #include <iostream> #include <iterator> #include <random> template <typename RandomAccessIterator, typename Predicate> void bogo_sort(RandomAccessIterator begin, RandomAccessIterator end, Predicate p) { std::random_device rd; std::mt19937 generator(rd()); while (!std::is_sorted(begin, end, p)) { std::shuffle(begin, end, generator); } } template <typename RandomAccessIterator> void bogo_sort(RandomAccessIterator begin, RandomAccessIterator end) { bogo_sort( begin, end, std::less< typename std::iterator_traits<RandomAccessIterator>::value_type>()); } int main() { int a[] = {100, 2, 56, 200, -52, 3, 99, 33, 177, -199}; bogo_sort(std::begin(a), std::end(a)); copy(std::begin(a), std::end(a), std::ostream_iterator<int>(std::cout, " ")); std::cout << "\n"; }
Write a version of this PHP function in C++ with identical behavior.
<?php for($i=1;$i<=22;$i++){ echo($i + floor(1/2 + sqrt($i)) . "\n"); } $found_square=False; for($i=1;$i<=1000000;$i++){ $non_square=$i + floor(1/2 + sqrt($i)); if(sqrt($non_square)==intval(sqrt($non_square))){ $found_square=True; } } echo("\n"); if($found_square){ echo("Found a square number, so the formula does not always work."); } else { echo("Up to 1000000, found no square number in the sequence!"); } ?>
#include <iostream> #include <algorithm> #include <vector> #include <cmath> #include <boost/bind.hpp> #include <iterator> double nextNumber( double number ) { return number + floor( 0.5 + sqrt( number ) ) ; } int main( ) { std::vector<double> non_squares ; typedef std::vector<double>::iterator SVI ; non_squares.reserve( 1000000 ) ; for ( double i = 1.0 ; i < 100001.0 ; i += 1 ) non_squares.push_back( nextNumber( i ) ) ; std::copy( non_squares.begin( ) , non_squares.begin( ) + 22 , std::ostream_iterator<double>(std::cout, " " ) ) ; std::cout << '\n' ; SVI found = std::find_if ( non_squares.begin( ) , non_squares.end( ) , boost::bind( &floor, boost::bind( &sqrt, _1 ) ) == boost::bind( &sqrt, _1 ) ) ; if ( found != non_squares.end( ) ) { std::cout << "Found a square number in the sequence!\n" ; std::cout << "It is " << *found << " !\n" ; } else { std::cout << "Up to 1000000, found no square number in the sequence!\n" ; } return 0 ; }
Write the same code in C++ as shown below in PHP.
<?php $str = 'abcdefgh'; $n = 2; $m = 3; echo substr($str, $n, $m), "\n"; //cde echo substr($str, $n), "\n"; //cdefgh echo substr($str, 0, -1), "\n"; //abcdefg echo substr($str, strpos($str, 'd'), $m), "\n"; //def echo substr($str, strpos($str, 'de'), $m), "\n"; //def ?>
#include <iostream> #include <string> int main() { std::string s = "0123456789"; int const n = 3; int const m = 4; char const c = '2'; std::string const sub = "456"; std::cout << s.substr(n, m)<< "\n"; std::cout << s.substr(n) << "\n"; std::cout << s.substr(0, s.size()-1) << "\n"; std::cout << s.substr(s.find(c), m) << "\n"; std::cout << s.substr(s.find(sub), m) << "\n"; }
Ensure the translated C++ code behaves exactly like the original PHP snippet.
<?php function isLeapYear($year) { if ($year % 100 == 0) { return ($year % 400 == 0); } return ($year % 4 == 0); }
#include <iostream> bool is_leap_year(int year) { return year % 4 == 0 && (year % 100 != 0 || year % 400 == 0); } int main() { for (auto year : {1900, 1994, 1996, 1997, 2000}) { std::cout << year << (is_leap_year(year) ? " is" : " is not") << " a leap year.\n"; } }
Maintain the same structure and functionality when rewriting this code in C++.
$orderOfMag = array('Hundred', 'Thousand,', 'Million,', 'Billion,', 'Trillion,'); $smallNumbers = array('Zero', 'One', 'Two', 'Three', 'Four', 'Five', 'Six', 'Seven', 'Eight', 'Nine', 'Ten', 'Eleven', 'Twelve', 'Thirteen', 'Fourteen', 'Fifteen', 'Sixteen', 'Seventeen', 'Eighteen', 'Nineteen'); $decades = array('', '', 'Twenty', 'Thirty', 'Forty', 'Fifty', 'Sixty', 'Seventy', 'Eighty', 'Ninety'); function NumberToEnglish($num, $count = 0){ global $orderOfMag, $smallNumbers, $decades; $isLast = true; $str = ''; if ($num < 0){ $str = 'Negative '; $num = abs($num); } (int) $thisPart = substr((string) $num, -3); if (strlen((string) $num) > 3){ $str .= NumberToEnglish((int) substr((string) $num, 0, strlen((string) $num) - 3), $count + 1); $isLast = false; } if (($count == 0 || $isLast) && ($str == '' || $str == 'Negative ')) $and = ''; else $and = ' and '; if ($thisPart > 99){ $str .= ($isLast ? '' : ' ') . "{$smallNumbers[$thisPart/100]} {$orderOfMag[0]}"; if(($thisPart %= 100) == 0){ $str .= " {$orderOfMag[$count]}"; return $str; } $and = ' and '; // Set up our and string to the word "and" since there is something in the hundreds place of this chunk } if ($thisPart >= 20){ $str .= "{$and}{$decades[$thisPart /10]}"; $and = ' '; // Make sure we don't have any extranious "and"s if(($thisPart %= 10) == 0) return $str . ($count != 0 ? " {$orderOfMag[$count]}" : ''); } if ($thisPart < 20 && $thisPart > 0) return $str . "{$and}{$smallNumbers[(int) $thisPart]} " . ($count != 0 ? $orderOfMag[$count] : ''); elseif ($thisPart == 0 && strlen($thisPart) == 1) return $str . "{$smallNumbers[(int)$thisPart]}"; }
#include <string> #include <iostream> using std::string; const char* smallNumbers[] = { "zero", "one", "two", "three", "four", "five", "six", "seven", "eight", "nine", "ten", "eleven", "twelve", "thirteen", "fourteen", "fifteen", "sixteen", "seventeen", "eighteen", "nineteen" }; string spellHundreds(unsigned n) { string res; if (n > 99) { res = smallNumbers[n/100]; res += " hundred"; n %= 100; if (n) res += " and "; } if (n >= 20) { static const char* Decades[] = { "", "", "twenty", "thirty", "forty", "fifty", "sixty", "seventy", "eighty", "ninety" }; res += Decades[n/10]; n %= 10; if (n) res += "-"; } if (n < 20 && n > 0) res += smallNumbers[n]; return res; } const char* thousandPowers[] = { " billion", " million", " thousand", "" }; typedef unsigned long Spellable; string spell(Spellable n) { if (n < 20) return smallNumbers[n]; string res; const char** pScaleName = thousandPowers; Spellable scaleFactor = 1000000000; while (scaleFactor > 0) { if (n >= scaleFactor) { Spellable h = n / scaleFactor; res += spellHundreds(h) + *pScaleName; n %= scaleFactor; if (n) res += ", "; } scaleFactor /= 1000; ++pScaleName; } return res; } int main() { #define SPELL_IT(x) std::cout << #x " " << spell(x) << std::endl; SPELL_IT( 99); SPELL_IT( 300); SPELL_IT( 310); SPELL_IT( 1501); SPELL_IT( 12609); SPELL_IT( 512609); SPELL_IT(43112609); SPELL_IT(1234567890); return 0; }
Ensure the translated C++ code behaves exactly like the original PHP snippet.
<?php function retrieveStrings() { if (isset($_POST['input'])) { $strings = explode("\n", $_POST['input']); } else { $strings = ['abcd', '123456789', 'abcdef', '1234567']; } return $strings; } function setInput() { echo join("\n", retrieveStrings()); } function setOutput() { $strings = retrieveStrings(); $strings = array_map('trim', $strings); $strings = array_filter($strings); if (!empty($strings)) { usort($strings, function ($a, $b) { return strlen($b) - strlen($a); }); $max_len = strlen($strings[0]); $min_len = strlen($strings[count($strings) - 1]); foreach ($strings as $s) { $length = strlen($s); if ($length == $max_len) { $predicate = "is the longest string"; } elseif ($length == $min_len) { $predicate = "is the shortest string"; } else { $predicate = "is neither the longest nor the shortest string"; } echo "$s has length $length and $predicate\n"; } } } ?> <!DOCTYPE html> <html lang="en"> <head> <style> div { margin-top: 4ch; margin-bottom: 4ch; } label { display: block; margin-bottom: 1ch; } textarea { display: block; } input { display: block; margin-top: 4ch; margin-bottom: 4ch; } </style> </head> <body> <main> <form action=<?php echo $_SERVER['SCRIPT_NAME'] ?> method="post" accept-charset="utf-8"> <div> <label for="input">Input: </label> <textarea rows='20' cols='80' name='input'><?php setInput(); ?></textarea> </label> </div> <input type="submit" value="press to compare strings"> </input> <div> <label for="Output">Output: </label> <textarea rows='20' cols='80' name='output'><?php setOutput(); ?></textarea> </div> </form> </main> </body> </html>
#include <iostream> #include <algorithm> #include <string> #include <list> using namespace std; bool cmp(const string& a, const string& b) { return b.length() < a.length(); } void compareAndReportStringsLength(list<string> listOfStrings) { if (!listOfStrings.empty()) { char Q = '"'; string has_length(" has length "); string predicate_max(" and is the longest string"); string predicate_min(" and is the shortest string"); string predicate_ave(" and is neither the longest nor the shortest string"); list<string> ls(listOfStrings); ls.sort(cmp); int max = ls.front().length(); int min = ls.back().length(); for (list<string>::iterator s = ls.begin(); s != ls.end(); s++) { int length = s->length(); string* predicate; if (length == max) predicate = &predicate_max; else if (length == min) predicate = &predicate_min; else predicate = &predicate_ave; cout << Q << *s << Q << has_length << length << *predicate << endl; } } } int main(int argc, char* argv[]) { list<string> listOfStrings{ "abcd", "123456789", "abcdef", "1234567" }; compareAndReportStringsLength(listOfStrings); return EXIT_SUCCESS; }
Write the same code in C++ as shown below in PHP.
function shellSort($arr) { $inc = round(count($arr)/2); while($inc > 0) { for($i = $inc; $i < count($arr);$i++){ $temp = $arr[$i]; $j = $i; while($j >= $inc && $arr[$j-$inc] > $temp) { $arr[$j] = $arr[$j - $inc]; $j -= $inc; } $arr[$j] = $temp; } $inc = round($inc/2.2); } return $arr; }
#include <time.h> #include <iostream> using namespace std; const int MAX = 126; class shell { public: shell() { _gap[0] = 1750; _gap[1] = 701; _gap[2] = 301; _gap[3] = 132; _gap[4] = 57; _gap[5] = 23; _gap[6] = 10; _gap[7] = 4; _gap[8] = 1; } void sort( int* a, int count ) { _cnt = count; for( int x = 0; x < 9; x++ ) if( count > _gap[x] ) { _idx = x; break; } sortIt( a ); } private: void sortIt( int* arr ) { bool sorted = false; while( true ) { sorted = true; int st = 0; for( int x = _gap[_idx]; x < _cnt; x += _gap[_idx] ) { if( arr[st] > arr[x] ) { swap( arr[st], arr[x] ); sorted = false; } st = x; } if( ++_idx >= 8 ) _idx = 8; if( sorted && _idx == 8 ) break; } } void swap( int& a, int& b ) { int t = a; a = b; b = t; } int _gap[9], _idx, _cnt; }; int main( int argc, char* argv[] ) { srand( static_cast<unsigned int>( time( NULL ) ) ); int arr[MAX]; for( int x = 0; x < MAX; x++ ) arr[x] = rand() % MAX - rand() % MAX; cout << " Before: \n=========\n"; for( int x = 0; x < 7; x++ ) { for( int a = 0; a < 18; a++ ) { cout << arr[x * 18 + a] << " "; } cout << endl; } cout << endl; shell s; s.sort( arr, MAX ); cout << " After: \n========\n"; for( int x = 0; x < 7; x++ ) { for( int a = 0; a < 18; a++ ) { cout << arr[x * 18 + a] << " "; } cout << endl; } cout << endl << endl; return system( "pause" ); }
Port the following code from PHP to C++ with equivalent syntax and logic.
<?php print_r(array_count_values(str_split(file_get_contents($argv[1])))); ?>
#include <fstream> #include <iostream> int main() { std::ifstream input("filename.txt", std::ios_base::binary); if (!input) { std::cerr << "error: can't open file\n"; return -1; } size_t count[256]; std::fill_n(count, 256, 0); for (char c; input.get(c); ++count[uint8_t(c)]) ; for (size_t i = 0; i < 256; ++i) { if (count[i] && isgraph(i)) { std::cout << char(i) << " = " << count[i] << '\n'; } } }
Produce a functionally identical C++ code for the snippet given in PHP.
$s = "12345"; $s++;
#include <cstdlib> #include <string> #include <sstream> std::string s = "12345"; int i; std::istringstream(s) >> i; i++; std::ostringstream oss; if (oss << i) s = oss.str();
Produce a functionally identical C++ code for the snippet given in PHP.
<?php function stripchars($s, $chars) { return str_replace(str_split($chars), "", $s); } echo stripchars("She was a soul stripper. She took my heart!", "aei"), "\n"; ?>
#include <algorithm> #include <iostream> #include <string> std::string stripchars(std::string str, const std::string &chars) { str.erase( std::remove_if(str.begin(), str.end(), [&](char c){ return chars.find(c) != std::string::npos; }), str.end() ); return str; } int main() { std::cout << stripchars("She was a soul stripper. She took my heart!", "aei") << '\n'; return 0; }
Write the same algorithm in C++ as shown in this PHP implementation.
function inOrder($arr){ for($i=0;$i<count($arr);$i++){ if(isset($arr[$i+1])){ if($arr[$i] > $arr[$i+1]){ return false; } } } return true; } function permute($items, $perms = array( )) { if (empty($items)) { if(inOrder($perms)){ return $perms; } } else { for ($i = count($items) - 1; $i >= 0; --$i) { $newitems = $items; $newperms = $perms; list($foo) = array_splice($newitems, $i, 1); array_unshift($newperms, $foo); $res = permute($newitems, $newperms); if($res){ return $res; } } } } $arr = array( 8, 3, 10, 6, 1, 9, 7, 2, 5, 4); $arr = permute($arr); echo implode(',',$arr);
#include <algorithm> template<typename ForwardIterator> void permutation_sort(ForwardIterator begin, ForwardIterator end) { while (std::next_permutation(begin, end)) { } }
Write the same code in C++ as shown below in PHP.
$nums = array(3, 1, 4, 1, 5, 9); if ($nums) echo array_sum($nums) / count($nums), "\n"; else echo "0\n";
#include <vector> double mean(const std::vector<double>& numbers) { if (numbers.size() == 0) return 0; double sum = 0; for (std::vector<double>::iterator i = numbers.begin(); i != numbers.end(); i++) sum += *i; return sum / numbers.size(); }
Convert this PHP snippet to C++ and keep its semantics consistent.
<?php function shannonEntropy($string) { $h = 0.0; $len = strlen($string); foreach (count_chars($string, 1) as $count) { $h -= (double) ($count / $len) * log((double) ($count / $len), 2); } return $h; } $strings = array( '1223334444', '1225554444', 'aaBBcccDDDD', '122333444455555', 'Rosetta Code', '1234567890abcdefghijklmnopqrstuvwxyz', ); foreach ($strings AS $string) { printf( '%36s : %s' . PHP_EOL, $string, number_format(shannonEntropy($string), 6) ); }
#include <string> #include <map> #include <iostream> #include <algorithm> #include <cmath> double log2( double number ) { return log( number ) / log( 2 ) ; } int main( int argc , char *argv[ ] ) { std::string teststring( argv[ 1 ] ) ; std::map<char , int> frequencies ; for ( char c : teststring ) frequencies[ c ] ++ ; int numlen = teststring.length( ) ; double infocontent = 0 ; for ( std::pair<char , int> p : frequencies ) { double freq = static_cast<double>( p.second ) / numlen ; infocontent -= freq * log2( freq ) ; } std::cout << "The information content of " << teststring << " is " << infocontent << std::endl ; return 0 ; }
Port the provided PHP code into C++ while preserving the original functionality.
<?php echo "Hello world!\n"; ?>
#include <iostream> int main () { std::cout << "Hello world!" << std::endl; }
Change the programming language of this snippet from PHP to C++ without modifying what it does.
<?php function forwardDiff($anArray, $times = 1) { if ($times <= 0) { return $anArray; } for ($accumilation = array(), $i = 1, $j = count($anArray); $i < $j; ++$i) { $accumilation[] = $anArray[$i] - $anArray[$i - 1]; } if ($times === 1) { return $accumilation; } return forwardDiff($accumilation, $times - 1); } class ForwardDiffExample extends PweExample { function _should_run_empty_array_for_single_elem() { $expected = array($this->rand()->int()); $this->spec(forwardDiff($expected))->shouldEqual(array()); } function _should_give_diff_of_two_elem_as_single_elem() { $twoNums = array($this->rand()->int(), $this->rand()->int()); $expected = array($twoNums[1] - $twoNums[0]); $this->spec(forwardDiff($twoNums))->shouldEqual($expected); } function _should_compute_correct_forward_diff_for_longer_arrays() { $diffInput = array(10, 2, 9, 6, 5); $expected = array(-8, 7, -3, -1); $this->spec(forwardDiff($diffInput))->shouldEqual($expected); } function _should_apply_more_than_once_if_specified() { $diffInput = array(4, 6, 9, 3, 4); $expectedAfter1 = array(2, 3, -6, 1); $expectedAfter2 = array(1, -9, 7); $this->spec(forwardDiff($diffInput, 1))->shouldEqual($expectedAfter1); $this->spec(forwardDiff($diffInput, 2))->shouldEqual($expectedAfter2); } function _should_return_array_unaltered_if_no_times() { $this->spec(forwardDiff($expected = array(1,2,3), 0))->shouldEqual($expected); } }
#include <vector> #include <iterator> #include <algorithm> template<typename InputIterator, typename OutputIterator> OutputIterator forward_difference(InputIterator first, InputIterator last, OutputIterator dest) { if (first == last) return dest; typedef typename std::iterator_traits<InputIterator>::value_type value_type; value_type temp = *first++; while (first != last) { value_type temp2 = *first++; *dest++ = temp2 - temp; temp = temp2; } return dest; } template<typename InputIterator, typename OutputIterator> OutputIterator nth_forward_difference(int order, InputIterator first, InputIterator last, OutputIterator dest) { if (order == 0) return std::copy(first, last, dest); if (order == 1) return forward_difference(first, last, dest); typedef typename std::iterator_traits<InputIterator>::value_type value_type; std::vector<value_type> temp_storage; forward_difference(first, last, std::back_inserter(temp_storage)); typename std::vector<value_type>::iterator begin = temp_storage.begin(), end = temp_storage.end(); for (int i = 1; i < order-1; ++i) end = forward_difference(begin, end, begin); return forward_difference(begin, end, dest); } #include <iostream> int main() { double array[10] = { 90.0, 47.0, 58.0, 29.0, 22.0, 32.0, 55.0, 5.0, 55.0, 73.0 }; std::vector<double> dest; nth_forward_difference(1, array, array+10, std::back_inserter(dest)); std::copy(dest.begin(), dest.end(), std::ostream_iterator<double>(std::cout, " ")); std::cout << std::endl; nth_forward_difference(2, array, array+10, std::ostream_iterator<double>(std::cout, " ")); std::cout << std::endl; nth_forward_difference(9, array, array+10, std::ostream_iterator<double>(std::cout, " ")); std::cout << std::endl; nth_forward_difference(10, array, array+10, std::ostream_iterator<double>(std::cout, " ")); std::cout << std::endl; nth_forward_difference(0, array, array+10, std::ostream_iterator<double>(std::cout, " ")); std::cout << std::endl; double* end = nth_forward_difference(3, array, array+10, array); for (double* p = array; p < end; ++p) std::cout << *p << " "; std::cout << std::endl; return 0; }
Translate this program into Python but keep the logic exactly as in Java.
module BitwiseOps { @Inject Console console; void run() { for ((Int64 n1, Int64 n2) : [0=7, 1=5, 42=2, 0x123456789ABCDEF=0xFF]) { static String hex(Int64 n) { return n.toByteArray() [(n.leadingZeroCount / 8).minOf(7) ..< 8].toString(); } console.print($|For values {n1} ({hex(n1)}) and {n2} ({hex(n2)}): | {hex(n1)} AND {hex(n2)} = {hex(n1 & n2)} | {hex(n1)} OR {hex(n2)} = {hex(n1 | n2)} | {hex(n1)} XOR {hex(n2)} = {hex(n1 ^ n2)} | NOT {hex(n1)} = {hex(~n1)} | left shift {hex(n1)} by {n2} = {hex(n1 << n2)} | right shift {hex(n1)} by {n2} = {hex(n1 >> n2)} | right arithmetic shift {hex(n1)} by {n2} = {hex(n1 >>> n2)} | left rotate {hex(n1)} by {n2} = {hex(n1.rotateLeft(n2))} | right rotate {hex(n1)} by {n2} = {hex(n1.rotateRight(n2))} | leftmost bit of {hex(n1)} = {hex(n1.leftmostBit)} | rightmost bit of {hex(n1)} = {hex(n1.rightmostBit)} | leading zero count of {hex(n1)} = {n1.leadingZeroCount} | trailing zero count of {hex(n1)} = {n1.trailingZeroCount} | bit count (aka "population") of {hex(n1)} = {n1.bitCount} | reversed bits of {hex(n1)} = {hex(n1.reverseBits())} | reverse bytes of {hex(n1)} = {hex(n1.reverseBytes())} | ); } } }
def bitwise_built_ins(width, a, b): mask = (1 << width) - 1 print(f) def rotr(width, a, n): "Rotate a, n times to the right" if n < 0: return rotl(width, a, -n) elif n == 0: return a else: mask = (1 << width) - 1 a, n = a & mask, n % width return ((a >> n) | ((a & ((1 << n) - 1)) << (width - n))) def rotl(width, a, n): "Rotate a, n times to the left" if n < 0: return rotr(width, a, -n) elif n == 0: return a else: mask = (1 << width) - 1 a, n = a & mask, n % width return (((a << n) & mask) | (a >> (width - n))) def asr(width, a, n): "Arithmetic shift a, n times to the right. (sign preserving)." mask, top_bit_mask = ((1 << width) - 1), 1 << (width - 1) if n < 0: return (a << -n) & mask elif n == 0: return a elif n >= width: return mask if a & top_bit_mask else 0 else: a = a & mask if a & top_bit_mask: signs = (1 << n) - 1 return a >> n | (signs << width - n) else: return a >> n def helper_funcs(width, a): mask, top_bit_mask = ((1 << width) - 1), 1 << (width - 1) aa = a | top_bit_mask print(f) if __name__ == '__main__': bitwise_built_ins(8, 27, 125) helper_funcs(8, 27)
Write the same code in Python as shown below in Java.
import java.awt.Color; import java.awt.Graphics; import java.util.*; import javax.swing.JFrame; public class DragonCurve extends JFrame { private List<Integer> turns; private double startingAngle, side; public DragonCurve(int iter) { super("Dragon Curve"); setBounds(100, 100, 800, 600); setDefaultCloseOperation(EXIT_ON_CLOSE); turns = getSequence(iter); startingAngle = -iter * (Math.PI / 4); side = 400 / Math.pow(2, iter / 2.); } public List<Integer> getSequence(int iterations) { List<Integer> turnSequence = new ArrayList<Integer>(); for (int i = 0; i < iterations; i++) { List<Integer> copy = new ArrayList<Integer>(turnSequence); Collections.reverse(copy); turnSequence.add(1); for (Integer turn : copy) { turnSequence.add(-turn); } } return turnSequence; } @Override public void paint(Graphics g) { g.setColor(Color.BLACK); double angle = startingAngle; int x1 = 230, y1 = 350; int x2 = x1 + (int) (Math.cos(angle) * side); int y2 = y1 + (int) (Math.sin(angle) * side); g.drawLine(x1, y1, x2, y2); x1 = x2; y1 = y2; for (Integer turn : turns) { angle += turn * (Math.PI / 2); x2 = x1 + (int) (Math.cos(angle) * side); y2 = y1 + (int) (Math.sin(angle) * side); g.drawLine(x1, y1, x2, y2); x1 = x2; y1 = y2; } } public static void main(String[] args) { new DragonCurve(14).setVisible(true); } }
l = 3 ints = 13 def setup(): size(700, 600) background(0, 0, 255) translate(150, 100) stroke(255) turn_left(l, ints) turn_right(l, ints) def turn_right(l, ints): if ints == 0: line(0, 0, 0, -l) translate(0, -l) else: turn_left(l, ints - 1) rotate(radians(90)) turn_right(l, ints - 1) def turn_left(l, ints): if ints == 0: line(0, 0, 0, -l) translate(0, -l) else: turn_left(l, ints - 1) rotate(radians(-90)) turn_right(l, ints - 1)
Write the same algorithm in Python as shown in this Java implementation.
import java.io.BufferedReader; import java.io.FileReader; public class ReadFileByLines { private static void processLine(int lineNo, String line) { } public static void main(String[] args) { for (String filename : args) { BufferedReader br = null; FileReader fr = null; try { fr = new FileReader(filename); br = new BufferedReader(fr); String line; int lineNo = 0; while ((line = br.readLine()) != null) { processLine(++lineNo, line); } } catch (Exception x) { x.printStackTrace(); } finally { if (fr != null) { try {br.close();} catch (Exception ignoreMe) {} try {fr.close();} catch (Exception ignoreMe) {} } } } } }
for line in lines open('input.txt'): print line
Write a version of this Java function in Python with identical behavior.
import java.util.LinkedList; @SuppressWarnings("serial") public class DoublyLinkedListInsertion<T> extends LinkedList<T> { public static void main(String[] args) { DoublyLinkedListInsertion<String> list = new DoublyLinkedListInsertion<String>(); list.addFirst("Add First 1"); list.addFirst("Add First 2"); list.addFirst("Add First 3"); list.addFirst("Add First 4"); list.addFirst("Add First 5"); traverseList(list); list.addAfter("Add First 3", "Add New"); traverseList(list); } public void addAfter(T after, T element) { int index = indexOf(after); if ( index >= 0 ) { add(index + 1, element); } else { addLast(element); } } private static void traverseList(LinkedList<String> list) { System.out.println("Traverse List:"); for ( int i = 0 ; i < list.size() ; i++ ) { System.out.printf("Element number %d - Element value = '%s'%n", i, list.get(i)); } System.out.println(); } }
def insert(anchor, new): new.next = anchor.next new.prev = anchor anchor.next.prev = new anchor.next = new
Ensure the translated Python code behaves exactly like the original Java snippet.
public class SmarandachePrimeDigitalSequence { public static void main(String[] args) { long s = getNextSmarandache(7); System.out.printf("First 25 Smarandache prime-digital sequence numbers:%n2 3 5 7 "); for ( int count = 1 ; count <= 21 ; s = getNextSmarandache(s) ) { if ( isPrime(s) ) { System.out.printf("%d ", s); count++; } } System.out.printf("%n%n"); for (int i = 2 ; i <=5 ; i++ ) { long n = (long) Math.pow(10, i); System.out.printf("%,dth Smarandache prime-digital sequence number = %d%n", n, getSmarandachePrime(n)); } } private static final long getSmarandachePrime(long n) { if ( n < 10 ) { switch ((int) n) { case 1: return 2; case 2: return 3; case 3: return 5; case 4: return 7; } } long s = getNextSmarandache(7); long result = 0; for ( int count = 1 ; count <= n-4 ; s = getNextSmarandache(s) ) { if ( isPrime(s) ) { count++; result = s; } } return result; } private static final boolean isPrime(long test) { if ( test % 2 == 0 ) return false; for ( long i = 3 ; i <= Math.sqrt(test) ; i += 2 ) { if ( test % i == 0 ) { return false; } } return true; } private static long getNextSmarandache(long n) { if ( n % 10 == 3 ) { return n+4; } long retVal = n-4; int k = 0; while ( n % 10 == 7 ) { k++; n /= 10; } long digit = n % 10; long coeff = (digit == 2 ? 1 : 2); retVal += coeff * Math.pow(10, k); while ( k > 1 ) { retVal -= 5 * Math.pow(10, k-1); k--; } return retVal; } }
def divisors(n): divs = [1] for ii in range(2, int(n ** 0.5) + 3): if n % ii == 0: divs.append(ii) divs.append(int(n / ii)) divs.append(n) return list(set(divs)) def is_prime(n): return len(divisors(n)) == 2 def digit_check(n): if len(str(n))<2: return True else: for digit in str(n): if not is_prime(int(digit)): return False return True def sequence(max_n=None): ii = 0 n = 0 while True: ii += 1 if is_prime(ii): if max_n is not None: if n>max_n: break if digit_check(ii): n += 1 yield ii if __name__ == '__main__': generator = sequence(100) for index, item in zip(range(1, 16), generator): print(index, item) for index, item in zip(range(16, 100), generator): pass print(100, generator.__next__())
Write a version of this Java function in Python with identical behavior.
public class SmarandachePrimeDigitalSequence { public static void main(String[] args) { long s = getNextSmarandache(7); System.out.printf("First 25 Smarandache prime-digital sequence numbers:%n2 3 5 7 "); for ( int count = 1 ; count <= 21 ; s = getNextSmarandache(s) ) { if ( isPrime(s) ) { System.out.printf("%d ", s); count++; } } System.out.printf("%n%n"); for (int i = 2 ; i <=5 ; i++ ) { long n = (long) Math.pow(10, i); System.out.printf("%,dth Smarandache prime-digital sequence number = %d%n", n, getSmarandachePrime(n)); } } private static final long getSmarandachePrime(long n) { if ( n < 10 ) { switch ((int) n) { case 1: return 2; case 2: return 3; case 3: return 5; case 4: return 7; } } long s = getNextSmarandache(7); long result = 0; for ( int count = 1 ; count <= n-4 ; s = getNextSmarandache(s) ) { if ( isPrime(s) ) { count++; result = s; } } return result; } private static final boolean isPrime(long test) { if ( test % 2 == 0 ) return false; for ( long i = 3 ; i <= Math.sqrt(test) ; i += 2 ) { if ( test % i == 0 ) { return false; } } return true; } private static long getNextSmarandache(long n) { if ( n % 10 == 3 ) { return n+4; } long retVal = n-4; int k = 0; while ( n % 10 == 7 ) { k++; n /= 10; } long digit = n % 10; long coeff = (digit == 2 ? 1 : 2); retVal += coeff * Math.pow(10, k); while ( k > 1 ) { retVal -= 5 * Math.pow(10, k-1); k--; } return retVal; } }
def divisors(n): divs = [1] for ii in range(2, int(n ** 0.5) + 3): if n % ii == 0: divs.append(ii) divs.append(int(n / ii)) divs.append(n) return list(set(divs)) def is_prime(n): return len(divisors(n)) == 2 def digit_check(n): if len(str(n))<2: return True else: for digit in str(n): if not is_prime(int(digit)): return False return True def sequence(max_n=None): ii = 0 n = 0 while True: ii += 1 if is_prime(ii): if max_n is not None: if n>max_n: break if digit_check(ii): n += 1 yield ii if __name__ == '__main__': generator = sequence(100) for index, item in zip(range(1, 16), generator): print(index, item) for index, item in zip(range(16, 100), generator): pass print(100, generator.__next__())
Produce a language-to-language conversion: from Java to Python, same semantics.
import java.util.Random; public class QuickSelect { private static <E extends Comparable<? super E>> int partition(E[] arr, int left, int right, int pivot) { E pivotVal = arr[pivot]; swap(arr, pivot, right); int storeIndex = left; for (int i = left; i < right; i++) { if (arr[i].compareTo(pivotVal) < 0) { swap(arr, i, storeIndex); storeIndex++; } } swap(arr, right, storeIndex); return storeIndex; } private static <E extends Comparable<? super E>> E select(E[] arr, int n) { int left = 0; int right = arr.length - 1; Random rand = new Random(); while (right >= left) { int pivotIndex = partition(arr, left, right, rand.nextInt(right - left + 1) + left); if (pivotIndex == n) { return arr[pivotIndex]; } else if (pivotIndex < n) { left = pivotIndex + 1; } else { right = pivotIndex - 1; } } return null; } private static void swap(Object[] arr, int i1, int i2) { if (i1 != i2) { Object temp = arr[i1]; arr[i1] = arr[i2]; arr[i2] = temp; } } public static void main(String[] args) { for (int i = 0; i < 10; i++) { Integer[] input = {9, 8, 7, 6, 5, 0, 1, 2, 3, 4}; System.out.print(select(input, i)); if (i < 9) System.out.print(", "); } System.out.println(); } }
import random def partition(vector, left, right, pivotIndex): pivotValue = vector[pivotIndex] vector[pivotIndex], vector[right] = vector[right], vector[pivotIndex] storeIndex = left for i in range(left, right): if vector[i] < pivotValue: vector[storeIndex], vector[i] = vector[i], vector[storeIndex] storeIndex += 1 vector[right], vector[storeIndex] = vector[storeIndex], vector[right] return storeIndex def _select(vector, left, right, k): "Returns the k-th smallest, (k >= 0), element of vector within vector[left:right+1] inclusive." while True: pivotIndex = random.randint(left, right) pivotNewIndex = partition(vector, left, right, pivotIndex) pivotDist = pivotNewIndex - left if pivotDist == k: return vector[pivotNewIndex] elif k < pivotDist: right = pivotNewIndex - 1 else: k -= pivotDist + 1 left = pivotNewIndex + 1 def select(vector, k, left=None, right=None): if left is None: left = 0 lv1 = len(vector) - 1 if right is None: right = lv1 assert vector and k >= 0, "Either null vector or k < 0 " assert 0 <= left <= lv1, "left is out of range" assert left <= right <= lv1, "right is out of range" return _select(vector, left, right, k) if __name__ == '__main__': v = [9, 8, 7, 6, 5, 0, 1, 2, 3, 4] print([select(v, i) for i in range(10)])
Convert the following code from Java to Python, ensuring the logic remains intact.
public static long backToTen(String num, int oldBase){ return Long.parseLong(num, oldBase); } public static String tenToBase(long num, int newBase){ return Long.toString(num, newBase); }
i = int('1a',16)
Produce a functionally identical Python code for the snippet given in Java.
import java.io.File; public class MainEntry { public static void main(String[] args) { walkin(new File("/home/user")); } public static void walkin(File dir) { String pattern = ".mp3"; File listFile[] = dir.listFiles(); if (listFile != null) { for (int i=0; i<listFile.length; i++) { if (listFile[i].isDirectory()) { walkin(listFile[i]); } else { if (listFile[i].getName().endsWith(pattern)) { System.out.println(listFile[i].getPath()); } } } } } }
from pathlib import Path for path in Path('.').rglob('*.*'): print(path)
Transform the following Java implementation into Python, maintaining the same output and logic.
import java.util.*; import java.util.stream.*; public class StateNamePuzzle { static String[] states = {"Alabama", "Alaska", "Arizona", "Arkansas", "California", "Colorado", "Connecticut", "Delaware", "Florida", "Georgia", "hawaii", "Hawaii", "Idaho", "Illinois", "Indiana", "Iowa", "Kansas", "Kentucky", "Louisiana", "Maine", "Maryland", "Massachusetts", "Michigan", "Minnesota", "Mississippi", "Missouri", "Montana", "Nebraska", "Nevada", "New Hampshire", "New Jersey", "New Mexico", "New York", "North Carolina ", "North Dakota", "Ohio", "Oklahoma", "Oregon", "Pennsylvania", "Rhode Island", "South Carolina", "South Dakota", "Tennessee", "Texas", "Utah", "Vermont", "Virginia", "Washington", "West Virginia", "Wisconsin", "Wyoming", "New Kory", "Wen Kory", "York New", "Kory New", "New Kory",}; public static void main(String[] args) { solve(Arrays.asList(states)); } static void solve(List<String> input) { Map<String, String> orig = input.stream().collect(Collectors.toMap( s -> s.replaceAll("\\s", "").toLowerCase(), s -> s, (s, a) -> s)); input = new ArrayList<>(orig.keySet()); Map<String, List<String[]>> map = new HashMap<>(); for (int i = 0; i < input.size() - 1; i++) { String pair0 = input.get(i); for (int j = i + 1; j < input.size(); j++) { String[] pair = {pair0, input.get(j)}; String s = pair0 + pair[1]; String key = Arrays.toString(s.chars().sorted().toArray()); List<String[]> val = map.getOrDefault(key, new ArrayList<>()); val.add(pair); map.put(key, val); } } map.forEach((key, list) -> { for (int i = 0; i < list.size() - 1; i++) { String[] a = list.get(i); for (int j = i + 1; j < list.size(); j++) { String[] b = list.get(j); if (Stream.of(a[0], a[1], b[0], b[1]).distinct().count() < 4) continue; System.out.printf("%s + %s = %s + %s %n", orig.get(a[0]), orig.get(a[1]), orig.get(b[0]), orig.get(b[1])); } } }); } }
from collections import defaultdict states = ["Alabama", "Alaska", "Arizona", "Arkansas", "California", "Colorado", "Connecticut", "Delaware", "Florida", "Georgia", "Hawaii", "Idaho", "Illinois", "Indiana", "Iowa", "Kansas", "Kentucky", "Louisiana", "Maine", "Maryland", "Massachusetts", "Michigan", "Minnesota", "Mississippi", "Missouri", "Montana", "Nebraska", "Nevada", "New Hampshire", "New Jersey", "New Mexico", "New York", "North Carolina", "North Dakota", "Ohio", "Oklahoma", "Oregon", "Pennsylvania", "Rhode Island", "South Carolina", "South Dakota", "Tennessee", "Texas", "Utah", "Vermont", "Virginia", "Washington", "West Virginia", "Wisconsin", "Wyoming", ] states = sorted(set(states)) smap = defaultdict(list) for i, s1 in enumerate(states[:-1]): for s2 in states[i + 1:]: smap["".join(sorted(s1 + s2))].append(s1 + " + " + s2) for pairs in sorted(smap.itervalues()): if len(pairs) > 1: print " = ".join(pairs)
Change the following Java code into Python without altering its purpose.
import java.util.zip.* ; public class CRCMaker { public static void main( String[ ] args ) { String toBeEncoded = new String( "The quick brown fox jumps over the lazy dog" ) ; CRC32 myCRC = new CRC32( ) ; myCRC.update( toBeEncoded.getBytes( ) ) ; System.out.println( "The CRC-32 value is : " + Long.toHexString( myCRC.getValue( ) ) + " !" ) ; } }
>>> s = 'The quick brown fox jumps over the lazy dog' >>> import zlib >>> hex(zlib.crc32(s)) '0x414fa339' >>> import binascii >>> hex(binascii.crc32(s)) '0x414fa339'
Can you help me rewrite this code in Python instead of Java, keeping it the same logically?
grammar csv2html; dialog : {System.out.println("<HTML><Table>");}header body+{System.out.println("</Table></HTML>");} ; header : {System.out.println("<THEAD align=\"center\"><TR bgcolor=\"blue\">");}row{System.out.println("</TR></THEAD");}; body : {System.out.println("<TBODY><TR>");}row{System.out.println("</TR></TBODY");}; row : field ',' field '\r'? '\n'; field : Field{System.out.println("<TD>" + $Field.text.replace("<","&lt;").replace(">","&gt;") + "</TD>");}; Field : ~[,\n\r]+;
csvtxt = from cgi import escape def _row2tr(row, attr=None): cols = escape(row).split(',') return ('<TR>' + ''.join('<TD>%s</TD>' % data for data in cols) + '</TR>') def csv2html(txt): htmltxt = '<TABLE summary="csv2html program output">\n' for rownum, row in enumerate(txt.split('\n')): htmlrow = _row2tr(row) htmlrow = ' <TBODY>%s</TBODY>\n' % htmlrow htmltxt += htmlrow htmltxt += '</TABLE>\n' return htmltxt htmltxt = csv2html(csvtxt) print(htmltxt)
Rewrite the snippet below in Python so it works the same as the original Java code.
grammar csv2html; dialog : {System.out.println("<HTML><Table>");}header body+{System.out.println("</Table></HTML>");} ; header : {System.out.println("<THEAD align=\"center\"><TR bgcolor=\"blue\">");}row{System.out.println("</TR></THEAD");}; body : {System.out.println("<TBODY><TR>");}row{System.out.println("</TR></TBODY");}; row : field ',' field '\r'? '\n'; field : Field{System.out.println("<TD>" + $Field.text.replace("<","&lt;").replace(">","&gt;") + "</TD>");}; Field : ~[,\n\r]+;
csvtxt = from cgi import escape def _row2tr(row, attr=None): cols = escape(row).split(',') return ('<TR>' + ''.join('<TD>%s</TD>' % data for data in cols) + '</TR>') def csv2html(txt): htmltxt = '<TABLE summary="csv2html program output">\n' for rownum, row in enumerate(txt.split('\n')): htmlrow = _row2tr(row) htmlrow = ' <TBODY>%s</TBODY>\n' % htmlrow htmltxt += htmlrow htmltxt += '</TABLE>\n' return htmltxt htmltxt = csv2html(csvtxt) print(htmltxt)
Generate an equivalent Python version of this Java code.
public class MyClass{ private int variable; public MyClass(){ } public void someMethod(){ this.variable = 1; } }
class MyClass: name2 = 2 def __init__(self): self.name1 = 0 def someMethod(self): self.name1 = 1 MyClass.name2 = 3 myclass = MyClass() class MyOtherClass: count = 0 def __init__(self, name, gender="Male", age=None): MyOtherClass.count += 1 self.name = name self.gender = gender if age is not None: self.age = age def __del__(self): MyOtherClass.count -= 1 person1 = MyOtherClass("John") print person1.name, person1.gender print person1.age person2 = MyOtherClass("Jane", "Female", 23) print person2.name, person2.gender, person2.age
Ensure the translated Python code behaves exactly like the original Java snippet.
public class Kaprekar { private static String[] splitAt(String str, int idx){ String[] ans = new String[2]; ans[0] = str.substring(0, idx); if(ans[0].equals("")) ans[0] = "0"; ans[1] = str.substring(idx); return ans; } public static void main(String[] args){ int count = 0; int base = (args.length > 0) ? Integer.parseInt(args[0]) : 10; for(long i = 1; i <= 1000000; i++){ String sqrStr = Long.toString(i * i, base); for(int j = 0; j < sqrStr.length() / 2 + 1; j++){ String[] parts = splitAt(sqrStr, j); long firstNum = Long.parseLong(parts[0], base); long secNum = Long.parseLong(parts[1], base); if(secNum == 0) break; if(firstNum + secNum == i){ System.out.println(i + "\t" + Long.toString(i, base) + "\t" + sqrStr + "\t" + parts[0] + " + " + parts[1]); count++; break; } } } System.out.println(count + " Kaprekar numbers < 1000000 (base 10) in base "+base); } }
>>> def k(n): n2 = str(n**2) for i in range(len(n2)): a, b = int(n2[:i] or 0), int(n2[i:]) if b and a + b == n: return n >>> [x for x in range(1,10000) if k(x)] [1, 9, 45, 55, 99, 297, 703, 999, 2223, 2728, 4879, 4950, 5050, 5292, 7272, 7777, 9999] >>> len([x for x in range(1,1000000) if k(x)]) 54 >>>
Translate this program into Python but keep the logic exactly as in Java.
public class Kaprekar { private static String[] splitAt(String str, int idx){ String[] ans = new String[2]; ans[0] = str.substring(0, idx); if(ans[0].equals("")) ans[0] = "0"; ans[1] = str.substring(idx); return ans; } public static void main(String[] args){ int count = 0; int base = (args.length > 0) ? Integer.parseInt(args[0]) : 10; for(long i = 1; i <= 1000000; i++){ String sqrStr = Long.toString(i * i, base); for(int j = 0; j < sqrStr.length() / 2 + 1; j++){ String[] parts = splitAt(sqrStr, j); long firstNum = Long.parseLong(parts[0], base); long secNum = Long.parseLong(parts[1], base); if(secNum == 0) break; if(firstNum + secNum == i){ System.out.println(i + "\t" + Long.toString(i, base) + "\t" + sqrStr + "\t" + parts[0] + " + " + parts[1]); count++; break; } } } System.out.println(count + " Kaprekar numbers < 1000000 (base 10) in base "+base); } }
>>> def k(n): n2 = str(n**2) for i in range(len(n2)): a, b = int(n2[:i] or 0), int(n2[i:]) if b and a + b == n: return n >>> [x for x in range(1,10000) if k(x)] [1, 9, 45, 55, 99, 297, 703, 999, 2223, 2728, 4879, 4950, 5050, 5292, 7272, 7777, 9999] >>> len([x for x in range(1,1000000) if k(x)]) 54 >>>
Convert this Java block to Python, preserving its control flow and logic.
import java.util.*; public class LZW { public static List<Integer> compress(String uncompressed) { int dictSize = 256; Map<String,Integer> dictionary = new HashMap<String,Integer>(); for (int i = 0; i < 256; i++) dictionary.put("" + (char)i, i); String w = ""; List<Integer> result = new ArrayList<Integer>(); for (char c : uncompressed.toCharArray()) { String wc = w + c; if (dictionary.containsKey(wc)) w = wc; else { result.add(dictionary.get(w)); dictionary.put(wc, dictSize++); w = "" + c; } } if (!w.equals("")) result.add(dictionary.get(w)); return result; } public static String decompress(List<Integer> compressed) { int dictSize = 256; Map<Integer,String> dictionary = new HashMap<Integer,String>(); for (int i = 0; i < 256; i++) dictionary.put(i, "" + (char)i); String w = "" + (char)(int)compressed.remove(0); StringBuffer result = new StringBuffer(w); for (int k : compressed) { String entry; if (dictionary.containsKey(k)) entry = dictionary.get(k); else if (k == dictSize) entry = w + w.charAt(0); else throw new IllegalArgumentException("Bad compressed k: " + k); result.append(entry); dictionary.put(dictSize++, w + entry.charAt(0)); w = entry; } return result.toString(); } public static void main(String[] args) { List<Integer> compressed = compress("TOBEORNOTTOBEORTOBEORNOT"); System.out.println(compressed); String decompressed = decompress(compressed); System.out.println(decompressed); } }
def compress(uncompressed): dict_size = 256 dictionary = dict((chr(i), i) for i in range(dict_size)) w = "" result = [] for c in uncompressed: wc = w + c if wc in dictionary: w = wc else: result.append(dictionary[w]) dictionary[wc] = dict_size dict_size += 1 w = c if w: result.append(dictionary[w]) return result def decompress(compressed): from io import StringIO dict_size = 256 dictionary = dict((i, chr(i)) for i in range(dict_size)) result = StringIO() w = chr(compressed.pop(0)) result.write(w) for k in compressed: if k in dictionary: entry = dictionary[k] elif k == dict_size: entry = w + w[0] else: raise ValueError('Bad compressed k: %s' % k) result.write(entry) dictionary[dict_size] = w + entry[0] dict_size += 1 w = entry return result.getvalue() compressed = compress('TOBEORNOTTOBEORTOBEORNOT') print (compressed) decompressed = decompress(compressed) print (decompressed)
Convert this Java snippet to Python and keep its semantics consistent.
import java.util.*; class Hofstadter { private static List<Integer> getSequence(int rlistSize, int slistSize) { List<Integer> rlist = new ArrayList<Integer>(); List<Integer> slist = new ArrayList<Integer>(); Collections.addAll(rlist, 1, 3, 7); Collections.addAll(slist, 2, 4, 5, 6); List<Integer> list = (rlistSize > 0) ? rlist : slist; int targetSize = (rlistSize > 0) ? rlistSize : slistSize; while (list.size() > targetSize) list.remove(list.size() - 1); while (list.size() < targetSize) { int lastIndex = rlist.size() - 1; int lastr = rlist.get(lastIndex).intValue(); int r = lastr + slist.get(lastIndex).intValue(); rlist.add(Integer.valueOf(r)); for (int s = lastr + 1; (s < r) && (list.size() < targetSize); s++) slist.add(Integer.valueOf(s)); } return list; } public static int ffr(int n) { return getSequence(n, 0).get(n - 1).intValue(); } public static int ffs(int n) { return getSequence(0, n).get(n - 1).intValue(); } public static void main(String[] args) { System.out.print("R():"); for (int n = 1; n <= 10; n++) System.out.print(" " + ffr(n)); System.out.println(); Set<Integer> first40R = new HashSet<Integer>(); for (int n = 1; n <= 40; n++) first40R.add(Integer.valueOf(ffr(n))); Set<Integer> first960S = new HashSet<Integer>(); for (int n = 1; n <= 960; n++) first960S.add(Integer.valueOf(ffs(n))); for (int i = 1; i <= 1000; i++) { Integer n = Integer.valueOf(i); if (first40R.contains(n) == first960S.contains(n)) System.out.println("Integer " + i + " either in both or neither set"); } System.out.println("Done"); } }
def ffr(n): if n < 1 or type(n) != int: raise ValueError("n must be an int >= 1") try: return ffr.r[n] except IndexError: r, s = ffr.r, ffs.s ffr_n_1 = ffr(n-1) lastr = r[-1] s += list(range(s[-1] + 1, lastr)) if s[-1] < lastr: s += [lastr + 1] len_s = len(s) ffs_n_1 = s[n-1] if len_s > n else (n - len_s) + s[-1] ans = ffr_n_1 + ffs_n_1 r.append(ans) return ans ffr.r = [None, 1] def ffs(n): if n < 1 or type(n) != int: raise ValueError("n must be an int >= 1") try: return ffs.s[n] except IndexError: r, s = ffr.r, ffs.s for i in range(len(r), n+2): ffr(i) if len(s) > n: return s[n] raise Exception("Whoops!") ffs.s = [None, 2] if __name__ == '__main__': first10 = [ffr(i) for i in range(1,11)] assert first10 == [1, 3, 7, 12, 18, 26, 35, 45, 56, 69], "ffr() value error(s)" print("ffr(n) for n = [1..10] is", first10) bin = [None] + [0]*1000 for i in range(40, 0, -1): bin[ffr(i)] += 1 for i in range(960, 0, -1): bin[ffs(i)] += 1 if all(b == 1 for b in bin[1:1000]): print("All Integers 1..1000 found OK") else: print("All Integers 1..1000 NOT found only once: ERROR")
Rewrite this program in Python while keeping its functionality equivalent to the Java version.
import java.util.*; class Hofstadter { private static List<Integer> getSequence(int rlistSize, int slistSize) { List<Integer> rlist = new ArrayList<Integer>(); List<Integer> slist = new ArrayList<Integer>(); Collections.addAll(rlist, 1, 3, 7); Collections.addAll(slist, 2, 4, 5, 6); List<Integer> list = (rlistSize > 0) ? rlist : slist; int targetSize = (rlistSize > 0) ? rlistSize : slistSize; while (list.size() > targetSize) list.remove(list.size() - 1); while (list.size() < targetSize) { int lastIndex = rlist.size() - 1; int lastr = rlist.get(lastIndex).intValue(); int r = lastr + slist.get(lastIndex).intValue(); rlist.add(Integer.valueOf(r)); for (int s = lastr + 1; (s < r) && (list.size() < targetSize); s++) slist.add(Integer.valueOf(s)); } return list; } public static int ffr(int n) { return getSequence(n, 0).get(n - 1).intValue(); } public static int ffs(int n) { return getSequence(0, n).get(n - 1).intValue(); } public static void main(String[] args) { System.out.print("R():"); for (int n = 1; n <= 10; n++) System.out.print(" " + ffr(n)); System.out.println(); Set<Integer> first40R = new HashSet<Integer>(); for (int n = 1; n <= 40; n++) first40R.add(Integer.valueOf(ffr(n))); Set<Integer> first960S = new HashSet<Integer>(); for (int n = 1; n <= 960; n++) first960S.add(Integer.valueOf(ffs(n))); for (int i = 1; i <= 1000; i++) { Integer n = Integer.valueOf(i); if (first40R.contains(n) == first960S.contains(n)) System.out.println("Integer " + i + " either in both or neither set"); } System.out.println("Done"); } }
def ffr(n): if n < 1 or type(n) != int: raise ValueError("n must be an int >= 1") try: return ffr.r[n] except IndexError: r, s = ffr.r, ffs.s ffr_n_1 = ffr(n-1) lastr = r[-1] s += list(range(s[-1] + 1, lastr)) if s[-1] < lastr: s += [lastr + 1] len_s = len(s) ffs_n_1 = s[n-1] if len_s > n else (n - len_s) + s[-1] ans = ffr_n_1 + ffs_n_1 r.append(ans) return ans ffr.r = [None, 1] def ffs(n): if n < 1 or type(n) != int: raise ValueError("n must be an int >= 1") try: return ffs.s[n] except IndexError: r, s = ffr.r, ffs.s for i in range(len(r), n+2): ffr(i) if len(s) > n: return s[n] raise Exception("Whoops!") ffs.s = [None, 2] if __name__ == '__main__': first10 = [ffr(i) for i in range(1,11)] assert first10 == [1, 3, 7, 12, 18, 26, 35, 45, 56, 69], "ffr() value error(s)" print("ffr(n) for n = [1..10] is", first10) bin = [None] + [0]*1000 for i in range(40, 0, -1): bin[ffr(i)] += 1 for i in range(960, 0, -1): bin[ffs(i)] += 1 if all(b == 1 for b in bin[1:1000]): print("All Integers 1..1000 found OK") else: print("All Integers 1..1000 NOT found only once: ERROR")
Transform the following Java implementation into Python, maintaining the same output and logic.
public class MagicSquare { public static void main(String[] args) { int n = 5; for (int[] row : magicSquareOdd(n)) { for (int x : row) System.out.format("%2s ", x); System.out.println(); } System.out.printf("\nMagic constant: %d ", (n * n + 1) * n / 2); } public static int[][] magicSquareOdd(final int base) { if (base % 2 == 0 || base < 3) throw new IllegalArgumentException("base must be odd and > 2"); int[][] grid = new int[base][base]; int r = 0, number = 0; int size = base * base; int c = base / 2; while (number++ < size) { grid[r][c] = number; if (r == 0) { if (c == base - 1) { r++; } else { r = base - 1; c++; } } else { if (c == base - 1) { r--; c = 0; } else { if (grid[r - 1][c + 1] == 0) { r--; c++; } else { r++; } } } } return grid; } }
>>> def magic(n): for row in range(1, n + 1): print(' '.join('%*i' % (len(str(n**2)), cell) for cell in (n * ((row + col - 1 + n // 2) % n) + ((row + 2 * col - 2) % n) + 1 for col in range(1, n + 1)))) print('\nAll sum to magic number %i' % ((n * n + 1) * n // 2)) >>> for n in (5, 3, 7): print('\nOrder %i\n=======' % n) magic(n) Order 5 ======= 17 24 1 8 15 23 5 7 14 16 4 6 13 20 22 10 12 19 21 3 11 18 25 2 9 All sum to magic number 65 Order 3 ======= 8 1 6 3 5 7 4 9 2 All sum to magic number 15 Order 7 ======= 30 39 48 1 10 19 28 38 47 7 9 18 27 29 46 6 8 17 26 35 37 5 14 16 25 34 36 45 13 15 24 33 42 44 4 21 23 32 41 43 3 12 22 31 40 49 2 11 20 All sum to magic number 175 >>>
Generate an equivalent Python version of this Java code.
public class MagicSquare { public static void main(String[] args) { int n = 5; for (int[] row : magicSquareOdd(n)) { for (int x : row) System.out.format("%2s ", x); System.out.println(); } System.out.printf("\nMagic constant: %d ", (n * n + 1) * n / 2); } public static int[][] magicSquareOdd(final int base) { if (base % 2 == 0 || base < 3) throw new IllegalArgumentException("base must be odd and > 2"); int[][] grid = new int[base][base]; int r = 0, number = 0; int size = base * base; int c = base / 2; while (number++ < size) { grid[r][c] = number; if (r == 0) { if (c == base - 1) { r++; } else { r = base - 1; c++; } } else { if (c == base - 1) { r--; c = 0; } else { if (grid[r - 1][c + 1] == 0) { r--; c++; } else { r++; } } } } return grid; } }
>>> def magic(n): for row in range(1, n + 1): print(' '.join('%*i' % (len(str(n**2)), cell) for cell in (n * ((row + col - 1 + n // 2) % n) + ((row + 2 * col - 2) % n) + 1 for col in range(1, n + 1)))) print('\nAll sum to magic number %i' % ((n * n + 1) * n // 2)) >>> for n in (5, 3, 7): print('\nOrder %i\n=======' % n) magic(n) Order 5 ======= 17 24 1 8 15 23 5 7 14 16 4 6 13 20 22 10 12 19 21 3 11 18 25 2 9 All sum to magic number 65 Order 3 ======= 8 1 6 3 5 7 4 9 2 All sum to magic number 15 Order 7 ======= 30 39 48 1 10 19 28 38 47 7 9 18 27 29 46 6 8 17 26 35 37 5 14 16 25 34 36 45 13 15 24 33 42 44 4 21 23 32 41 43 3 12 22 31 40 49 2 11 20 All sum to magic number 175 >>>
Translate the given Java code snippet into Python without altering its behavior.
import java.util.ArrayList; import java.util.List; public class YellowstoneSequence { public static void main(String[] args) { System.out.printf("First 30 values in the yellowstone sequence:%n%s%n", yellowstoneSequence(30)); } private static List<Integer> yellowstoneSequence(int sequenceCount) { List<Integer> yellowstoneList = new ArrayList<Integer>(); yellowstoneList.add(1); yellowstoneList.add(2); yellowstoneList.add(3); int num = 4; List<Integer> notYellowstoneList = new ArrayList<Integer>(); int yellowSize = 3; while ( yellowSize < sequenceCount ) { int found = -1; for ( int index = 0 ; index < notYellowstoneList.size() ; index++ ) { int test = notYellowstoneList.get(index); if ( gcd(yellowstoneList.get(yellowSize-2), test) > 1 && gcd(yellowstoneList.get(yellowSize-1), test) == 1 ) { found = index; break; } } if ( found >= 0 ) { yellowstoneList.add(notYellowstoneList.remove(found)); yellowSize++; } else { while ( true ) { if ( gcd(yellowstoneList.get(yellowSize-2), num) > 1 && gcd(yellowstoneList.get(yellowSize-1), num) == 1 ) { yellowstoneList.add(num); yellowSize++; num++; break; } notYellowstoneList.add(num); num++; } } } return yellowstoneList; } private static final int gcd(int a, int b) { if ( b == 0 ) { return a; } return gcd(b, a%b); } }
from itertools import chain, count, islice from operator import itemgetter from math import gcd from matplotlib import pyplot def yellowstone(): def relativelyPrime(a): return lambda b: 1 == gcd(a, b) def nextWindow(triple): p2, p1, rest = triple [rp2, rp1] = map(relativelyPrime, [p2, p1]) def match(xxs): x, xs = uncons(xxs)['Just'] return (x, xs) if rp1(x) and not rp2(x) else ( second(cons(x))( match(xs) ) ) n, residue = match(rest) return (p1, n, residue) return chain( range(1, 3), map( itemgetter(1), iterate(nextWindow)( (2, 3, count(4)) ) ) ) def main(): print(showList( take(30)(yellowstone()) )) pyplot.plot( take(100)(yellowstone()) ) pyplot.xlabel(main.__doc__) pyplot.show() def Just(x): return {'type': 'Maybe', 'Nothing': False, 'Just': x} def Nothing(): return {'type': 'Maybe', 'Nothing': True} def cons(x): return lambda xs: [x] + xs if ( isinstance(xs, list) ) else x + xs if ( isinstance(xs, str) ) else chain([x], xs) def iterate(f): def go(x): v = x while True: yield v v = f(v) return go def second(f): return lambda xy: (xy[0], f(xy[1])) def showList(xs): return '[' + ','.join(repr(x) for x in xs) + ']' def take(n): return lambda xs: ( xs[0:n] if isinstance(xs, (list, tuple)) else list(islice(xs, n)) ) def uncons(xs): if isinstance(xs, list): return Just((xs[0], xs[1:])) if xs else Nothing() else: nxt = take(1)(xs) return Just((nxt[0], xs)) if nxt else Nothing() if __name__ == '__main__': main()
Convert this Java block to Python, preserving its control flow and logic.
import java.util.ArrayList; import java.util.List; public class YellowstoneSequence { public static void main(String[] args) { System.out.printf("First 30 values in the yellowstone sequence:%n%s%n", yellowstoneSequence(30)); } private static List<Integer> yellowstoneSequence(int sequenceCount) { List<Integer> yellowstoneList = new ArrayList<Integer>(); yellowstoneList.add(1); yellowstoneList.add(2); yellowstoneList.add(3); int num = 4; List<Integer> notYellowstoneList = new ArrayList<Integer>(); int yellowSize = 3; while ( yellowSize < sequenceCount ) { int found = -1; for ( int index = 0 ; index < notYellowstoneList.size() ; index++ ) { int test = notYellowstoneList.get(index); if ( gcd(yellowstoneList.get(yellowSize-2), test) > 1 && gcd(yellowstoneList.get(yellowSize-1), test) == 1 ) { found = index; break; } } if ( found >= 0 ) { yellowstoneList.add(notYellowstoneList.remove(found)); yellowSize++; } else { while ( true ) { if ( gcd(yellowstoneList.get(yellowSize-2), num) > 1 && gcd(yellowstoneList.get(yellowSize-1), num) == 1 ) { yellowstoneList.add(num); yellowSize++; num++; break; } notYellowstoneList.add(num); num++; } } } return yellowstoneList; } private static final int gcd(int a, int b) { if ( b == 0 ) { return a; } return gcd(b, a%b); } }
from itertools import chain, count, islice from operator import itemgetter from math import gcd from matplotlib import pyplot def yellowstone(): def relativelyPrime(a): return lambda b: 1 == gcd(a, b) def nextWindow(triple): p2, p1, rest = triple [rp2, rp1] = map(relativelyPrime, [p2, p1]) def match(xxs): x, xs = uncons(xxs)['Just'] return (x, xs) if rp1(x) and not rp2(x) else ( second(cons(x))( match(xs) ) ) n, residue = match(rest) return (p1, n, residue) return chain( range(1, 3), map( itemgetter(1), iterate(nextWindow)( (2, 3, count(4)) ) ) ) def main(): print(showList( take(30)(yellowstone()) )) pyplot.plot( take(100)(yellowstone()) ) pyplot.xlabel(main.__doc__) pyplot.show() def Just(x): return {'type': 'Maybe', 'Nothing': False, 'Just': x} def Nothing(): return {'type': 'Maybe', 'Nothing': True} def cons(x): return lambda xs: [x] + xs if ( isinstance(xs, list) ) else x + xs if ( isinstance(xs, str) ) else chain([x], xs) def iterate(f): def go(x): v = x while True: yield v v = f(v) return go def second(f): return lambda xy: (xy[0], f(xy[1])) def showList(xs): return '[' + ','.join(repr(x) for x in xs) + ']' def take(n): return lambda xs: ( xs[0:n] if isinstance(xs, (list, tuple)) else list(islice(xs, n)) ) def uncons(xs): if isinstance(xs, list): return Just((xs[0], xs[1:])) if xs else Nothing() else: nxt = take(1)(xs) return Just((nxt[0], xs)) if nxt else Nothing() if __name__ == '__main__': main()
Ensure the translated Python code behaves exactly like the original Java snippet.
import java.util.*; public class CutRectangle { private static int[][] dirs = {{0, -1}, {-1, 0}, {0, 1}, {1, 0}}; public static void main(String[] args) { cutRectangle(2, 2); cutRectangle(4, 3); } static void cutRectangle(int w, int h) { if (w % 2 == 1 && h % 2 == 1) return; int[][] grid = new int[h][w]; Stack<Integer> stack = new Stack<>(); int half = (w * h) / 2; long bits = (long) Math.pow(2, half) - 1; for (; bits > 0; bits -= 2) { for (int i = 0; i < half; i++) { int r = i / w; int c = i % w; grid[r][c] = (bits & (1 << i)) != 0 ? 1 : 0; grid[h - r - 1][w - c - 1] = 1 - grid[r][c]; } stack.push(0); grid[0][0] = 2; int count = 1; while (!stack.empty()) { int pos = stack.pop(); int r = pos / w; int c = pos % w; for (int[] dir : dirs) { int nextR = r + dir[0]; int nextC = c + dir[1]; if (nextR >= 0 && nextR < h && nextC >= 0 && nextC < w) { if (grid[nextR][nextC] == 1) { stack.push(nextR * w + nextC); grid[nextR][nextC] = 2; count++; } } } } if (count == half) { printResult(grid); } } } static void printResult(int[][] arr) { for (int[] a : arr) System.out.println(Arrays.toString(a)); System.out.println(); } }
def cut_it(h, w): dirs = ((1, 0), (-1, 0), (0, -1), (0, 1)) if h % 2: h, w = w, h if h % 2: return 0 if w == 1: return 1 count = 0 next = [w + 1, -w - 1, -1, 1] blen = (h + 1) * (w + 1) - 1 grid = [False] * (blen + 1) def walk(y, x, count): if not y or y == h or not x or x == w: return count + 1 t = y * (w + 1) + x grid[t] = grid[blen - t] = True if not grid[t + next[0]]: count = walk(y + dirs[0][0], x + dirs[0][1], count) if not grid[t + next[1]]: count = walk(y + dirs[1][0], x + dirs[1][1], count) if not grid[t + next[2]]: count = walk(y + dirs[2][0], x + dirs[2][1], count) if not grid[t + next[3]]: count = walk(y + dirs[3][0], x + dirs[3][1], count) grid[t] = grid[blen - t] = False return count t = h // 2 * (w + 1) + w // 2 if w % 2: grid[t] = grid[t + 1] = True count = walk(h // 2, w // 2 - 1, count) res = count count = 0 count = walk(h // 2 - 1, w // 2, count) return res + count * 2 else: grid[t] = True count = walk(h // 2, w // 2 - 1, count) if h == w: return count * 2 count = walk(h // 2 - 1, w // 2, count) return count def main(): for w in xrange(1, 10): for h in xrange(1, w + 1): if not((w * h) % 2): print "%d x %d: %d" % (w, h, cut_it(w, h)) main()
Port the provided Java code into Python while preserving the original functionality.
import java.util.*; public class CutRectangle { private static int[][] dirs = {{0, -1}, {-1, 0}, {0, 1}, {1, 0}}; public static void main(String[] args) { cutRectangle(2, 2); cutRectangle(4, 3); } static void cutRectangle(int w, int h) { if (w % 2 == 1 && h % 2 == 1) return; int[][] grid = new int[h][w]; Stack<Integer> stack = new Stack<>(); int half = (w * h) / 2; long bits = (long) Math.pow(2, half) - 1; for (; bits > 0; bits -= 2) { for (int i = 0; i < half; i++) { int r = i / w; int c = i % w; grid[r][c] = (bits & (1 << i)) != 0 ? 1 : 0; grid[h - r - 1][w - c - 1] = 1 - grid[r][c]; } stack.push(0); grid[0][0] = 2; int count = 1; while (!stack.empty()) { int pos = stack.pop(); int r = pos / w; int c = pos % w; for (int[] dir : dirs) { int nextR = r + dir[0]; int nextC = c + dir[1]; if (nextR >= 0 && nextR < h && nextC >= 0 && nextC < w) { if (grid[nextR][nextC] == 1) { stack.push(nextR * w + nextC); grid[nextR][nextC] = 2; count++; } } } } if (count == half) { printResult(grid); } } } static void printResult(int[][] arr) { for (int[] a : arr) System.out.println(Arrays.toString(a)); System.out.println(); } }
def cut_it(h, w): dirs = ((1, 0), (-1, 0), (0, -1), (0, 1)) if h % 2: h, w = w, h if h % 2: return 0 if w == 1: return 1 count = 0 next = [w + 1, -w - 1, -1, 1] blen = (h + 1) * (w + 1) - 1 grid = [False] * (blen + 1) def walk(y, x, count): if not y or y == h or not x or x == w: return count + 1 t = y * (w + 1) + x grid[t] = grid[blen - t] = True if not grid[t + next[0]]: count = walk(y + dirs[0][0], x + dirs[0][1], count) if not grid[t + next[1]]: count = walk(y + dirs[1][0], x + dirs[1][1], count) if not grid[t + next[2]]: count = walk(y + dirs[2][0], x + dirs[2][1], count) if not grid[t + next[3]]: count = walk(y + dirs[3][0], x + dirs[3][1], count) grid[t] = grid[blen - t] = False return count t = h // 2 * (w + 1) + w // 2 if w % 2: grid[t] = grid[t + 1] = True count = walk(h // 2, w // 2 - 1, count) res = count count = 0 count = walk(h // 2 - 1, w // 2, count) return res + count * 2 else: grid[t] = True count = walk(h // 2, w // 2 - 1, count) if h == w: return count * 2 count = walk(h // 2 - 1, w // 2, count) return count def main(): for w in xrange(1, 10): for h in xrange(1, w + 1): if not((w * h) % 2): print "%d x %d: %d" % (w, h, cut_it(w, h)) main()
Produce a functionally identical Python code for the snippet given in Java.
public class MertensFunction { public static void main(String[] args) { System.out.printf("First 199 terms of the merten function are as follows:%n "); for ( int n = 1 ; n < 200 ; n++ ) { System.out.printf("%2d ", mertenFunction(n)); if ( (n+1) % 20 == 0 ) { System.out.printf("%n"); } } for ( int exponent = 3 ; exponent<= 8 ; exponent++ ) { int zeroCount = 0; int zeroCrossingCount = 0; int positiveCount = 0; int negativeCount = 0; int mSum = 0; int mMin = Integer.MAX_VALUE; int mMinIndex = 0; int mMax = Integer.MIN_VALUE; int mMaxIndex = 0; int nMax = (int) Math.pow(10, exponent); for ( int n = 1 ; n <= nMax ; n++ ) { int m = mertenFunction(n); mSum += m; if ( m < mMin ) { mMin = m; mMinIndex = n; } if ( m > mMax ) { mMax = m; mMaxIndex = n; } if ( m > 0 ) { positiveCount++; } if ( m < 0 ) { negativeCount++; } if ( m == 0 ) { zeroCount++; } if ( m == 0 && mertenFunction(n - 1) != 0 ) { zeroCrossingCount++; } } System.out.printf("%nFor M(x) with x from 1 to %,d%n", nMax); System.out.printf("The maximum of M(x) is M(%,d) = %,d.%n", mMaxIndex, mMax); System.out.printf("The minimum of M(x) is M(%,d) = %,d.%n", mMinIndex, mMin); System.out.printf("The sum of M(x) is %,d.%n", mSum); System.out.printf("The count of positive M(x) is %,d, count of negative M(x) is %,d.%n", positiveCount, negativeCount); System.out.printf("M(x) has %,d zeroes in the interval.%n", zeroCount); System.out.printf("M(x) has %,d crossings in the interval.%n", zeroCrossingCount); } } private static int MU_MAX = 100_000_000; private static int[] MU = null; private static int[] MERTEN = null; private static int mertenFunction(int n) { if ( MERTEN != null ) { return MERTEN[n]; } MU = new int[MU_MAX+1]; MERTEN = new int[MU_MAX+1]; MERTEN[1] = 1; int sqrt = (int) Math.sqrt(MU_MAX); for ( int i = 0 ; i < MU_MAX ; i++ ) { MU[i] = 1; } for ( int i = 2 ; i <= sqrt ; i++ ) { if ( MU[i] == 1 ) { for ( int j = i ; j <= MU_MAX ; j += i ) { MU[j] *= -i; } for ( int j = i*i ; j <= MU_MAX ; j += i*i ) { MU[j] = 0; } } } int sum = 1; for ( int i = 2 ; i <= MU_MAX ; i++ ) { if ( MU[i] == i ) { MU[i] = 1; } else if ( MU[i] == -i ) { MU[i] = -1; } else if ( MU[i] < 0 ) { MU[i] = 1; } else if ( MU[i] > 0 ) { MU[i] = -1; } sum += MU[i]; MERTEN[i] = sum; } return MERTEN[n]; } }
def mertens(count): m = [None, 1] for n in range(2, count+1): m.append(1) for k in range(2, n+1): m[n] -= m[n//k] return m ms = mertens(1000) print("The first 99 Mertens numbers are:") print(" ", end=' ') col = 1 for n in ms[1:100]: print("{:2d}".format(n), end=' ') col += 1 if col == 10: print() col = 0 zeroes = sum(x==0 for x in ms) crosses = sum(a!=0 and b==0 for a,b in zip(ms, ms[1:])) print("M(N) equals zero {} times.".format(zeroes)) print("M(N) crosses zero {} times.".format(crosses))
Rewrite this program in Python while keeping its functionality equivalent to the Java version.
import java.util.*; public class SortComp1 { public static void main(String[] args) { List<String> items = Arrays.asList("violet", "red", "green", "indigo", "blue", "yellow", "orange"); List<String> sortedItems = new ArrayList<>(); Comparator<String> interactiveCompare = new Comparator<String>() { int count = 0; Scanner s = new Scanner(System.in); public int compare(String s1, String s2) { System.out.printf("(%d) Is %s <, =, or > %s. Answer -1, 0, or 1: ", ++count, s1, s2); return s.nextInt(); } }; for (String item : items) { System.out.printf("Inserting '%s' into %s\n", item, sortedItems); int spotToInsert = Collections.binarySearch(sortedItems, item, interactiveCompare); if (spotToInsert < 0) spotToInsert = ~spotToInsert; sortedItems.add(spotToInsert, item); } System.out.println(sortedItems); } }
def _insort_right(a, x, q): lo, hi = 0, len(a) while lo < hi: mid = (lo+hi)//2 q += 1 less = input(f"{q:2}: IS {x:>6} LESS-THAN {a[mid]:>6} ? y/n: ").strip().lower() == 'y' if less: hi = mid else: lo = mid+1 a.insert(lo, x) return q def order(items): ordered, q = [], 0 for item in items: q = _insort_right(ordered, item, q) return ordered, q if __name__ == '__main__': items = 'violet red green indigo blue yellow orange'.split() ans, questions = order(items) print('\n' + ' '.join(ans))
Translate this program into Python but keep the logic exactly as in Java.
import java.math.BigInteger; import java.util.Locale; public class BenfordsLaw { private static BigInteger[] generateFibonacci(int n) { BigInteger[] fib = new BigInteger[n]; fib[0] = BigInteger.ONE; fib[1] = BigInteger.ONE; for (int i = 2; i < fib.length; i++) { fib[i] = fib[i - 2].add(fib[i - 1]); } return fib; } public static void main(String[] args) { BigInteger[] numbers = generateFibonacci(1000); int[] firstDigits = new int[10]; for (BigInteger number : numbers) { firstDigits[Integer.valueOf(number.toString().substring(0, 1))]++; } for (int i = 1; i < firstDigits.length; i++) { System.out.printf(Locale.ROOT, "%d %10.6f %10.6f%n", i, (double) firstDigits[i] / numbers.length, Math.log10(1.0 + 1.0 / i)); } } }
from __future__ import division from itertools import islice, count from collections import Counter from math import log10 from random import randint expected = [log10(1+1/d) for d in range(1,10)] def fib(): a,b = 1,1 while True: yield a a,b = b,a+b def power_of_threes(): return (3**k for k in count(0)) def heads(s): for a in s: yield int(str(a)[0]) def show_dist(title, s): c = Counter(s) size = sum(c.values()) res = [c[d]/size for d in range(1,10)] print("\n%s Benfords deviation" % title) for r, e in zip(res, expected): print("%5.1f%% %5.1f%% %5.1f%%" % (r*100., e*100., abs(r - e)*100.)) def rand1000(): while True: yield randint(1,9999) if __name__ == '__main__': show_dist("fibbed", islice(heads(fib()), 1000)) show_dist("threes", islice(heads(power_of_threes()), 1000)) show_dist("random", islice(heads(rand1000()), 10000))
Preserve the algorithm and functionality while converting the code from Java to Python.
import java.math.BigInteger; import java.util.Locale; public class BenfordsLaw { private static BigInteger[] generateFibonacci(int n) { BigInteger[] fib = new BigInteger[n]; fib[0] = BigInteger.ONE; fib[1] = BigInteger.ONE; for (int i = 2; i < fib.length; i++) { fib[i] = fib[i - 2].add(fib[i - 1]); } return fib; } public static void main(String[] args) { BigInteger[] numbers = generateFibonacci(1000); int[] firstDigits = new int[10]; for (BigInteger number : numbers) { firstDigits[Integer.valueOf(number.toString().substring(0, 1))]++; } for (int i = 1; i < firstDigits.length; i++) { System.out.printf(Locale.ROOT, "%d %10.6f %10.6f%n", i, (double) firstDigits[i] / numbers.length, Math.log10(1.0 + 1.0 / i)); } } }
from __future__ import division from itertools import islice, count from collections import Counter from math import log10 from random import randint expected = [log10(1+1/d) for d in range(1,10)] def fib(): a,b = 1,1 while True: yield a a,b = b,a+b def power_of_threes(): return (3**k for k in count(0)) def heads(s): for a in s: yield int(str(a)[0]) def show_dist(title, s): c = Counter(s) size = sum(c.values()) res = [c[d]/size for d in range(1,10)] print("\n%s Benfords deviation" % title) for r, e in zip(res, expected): print("%5.1f%% %5.1f%% %5.1f%%" % (r*100., e*100., abs(r - e)*100.)) def rand1000(): while True: yield randint(1,9999) if __name__ == '__main__': show_dist("fibbed", islice(heads(fib()), 1000)) show_dist("threes", islice(heads(power_of_threes()), 1000)) show_dist("random", islice(heads(rand1000()), 10000))
Change the programming language of this snippet from Java to Python without modifying what it does.
import java.text.DateFormat; import java.text.SimpleDateFormat; import java.util.TimeZone; public class NauticalBell extends Thread { public static void main(String[] args) { NauticalBell bells = new NauticalBell(); bells.setDaemon(true); bells.start(); try { bells.join(); } catch (InterruptedException e) { System.out.println(e); } } @Override public void run() { DateFormat sdf = new SimpleDateFormat("HH:mm:ss"); sdf.setTimeZone(TimeZone.getTimeZone("UTC")); int numBells = 0; long time = System.currentTimeMillis(); long next = time - (time % (24 * 60 * 60 * 1000)); while (next < time) { next += 30 * 60 * 1000; numBells = 1 + (numBells % 8); } while (true) { long wait = 100L; time = System.currentTimeMillis(); if (time - next >= 0) { String bells = numBells == 1 ? "bell" : "bells"; String timeString = sdf.format(time); System.out.printf("%s : %d %s\n", timeString, numBells, bells); next += 30 * 60 * 1000; wait = next - time; numBells = 1 + (numBells % 8); } try { Thread.sleep(wait); } catch (InterruptedException e) { return; } } } }
import time, calendar, sched, winsound duration = 750 freq = 1280 bellchar = "\u2407" watches = 'Middle,Morning,Forenoon,Afternoon,First/Last dog,First'.split(',') def gap(n=1): time.sleep(n * duration / 1000) off = gap def on(n=1): winsound.Beep(freq, n * duration) def bong(): on(); off(0.5) def bongs(m): for i in range(m): print(bellchar, end=' ') bong() if i % 2: print(' ', end='') off(0.5) print('') scheds = sched.scheduler(time.time, time.sleep) def ships_bell(now=None): def adjust_to_half_hour(atime): atime[4] = (atime[4] // 30) * 30 atime[5] = 0 return atime debug = now is not None rightnow = time.gmtime() if not debug: now = adjust_to_half_hour( list(rightnow) ) then = now[::] then[4] += 30 hr, mn = now[3:5] watch, b = divmod(int(2 * hr + mn // 30 - 1), 8) b += 1 bells = '%i bell%s' % (b, 's' if b > 1 else ' ') if debug: print("%02i:%02i, %-20s %s" % (now[3], now[4], watches[watch] + ' watch', bells), end=' ') else: print("%02i:%02i, %-20s %s" % (rightnow[3], rightnow[4], watches[watch] + ' watch', bells), end=' ') bongs(b) if not debug: scheds.enterabs(calendar.timegm(then), 0, ships_bell) scheds.run() def dbg_tester(): for h in range(24): for m in (0, 30): if (h,m) == (24,30): break ships_bell( [2013, 3, 2, h, m, 15, 5, 61, 0] ) if __name__ == '__main__': ships_bell()
Port the provided Java code into Python while preserving the original functionality.
import java.text.DateFormat; import java.text.SimpleDateFormat; import java.util.TimeZone; public class NauticalBell extends Thread { public static void main(String[] args) { NauticalBell bells = new NauticalBell(); bells.setDaemon(true); bells.start(); try { bells.join(); } catch (InterruptedException e) { System.out.println(e); } } @Override public void run() { DateFormat sdf = new SimpleDateFormat("HH:mm:ss"); sdf.setTimeZone(TimeZone.getTimeZone("UTC")); int numBells = 0; long time = System.currentTimeMillis(); long next = time - (time % (24 * 60 * 60 * 1000)); while (next < time) { next += 30 * 60 * 1000; numBells = 1 + (numBells % 8); } while (true) { long wait = 100L; time = System.currentTimeMillis(); if (time - next >= 0) { String bells = numBells == 1 ? "bell" : "bells"; String timeString = sdf.format(time); System.out.printf("%s : %d %s\n", timeString, numBells, bells); next += 30 * 60 * 1000; wait = next - time; numBells = 1 + (numBells % 8); } try { Thread.sleep(wait); } catch (InterruptedException e) { return; } } } }
import time, calendar, sched, winsound duration = 750 freq = 1280 bellchar = "\u2407" watches = 'Middle,Morning,Forenoon,Afternoon,First/Last dog,First'.split(',') def gap(n=1): time.sleep(n * duration / 1000) off = gap def on(n=1): winsound.Beep(freq, n * duration) def bong(): on(); off(0.5) def bongs(m): for i in range(m): print(bellchar, end=' ') bong() if i % 2: print(' ', end='') off(0.5) print('') scheds = sched.scheduler(time.time, time.sleep) def ships_bell(now=None): def adjust_to_half_hour(atime): atime[4] = (atime[4] // 30) * 30 atime[5] = 0 return atime debug = now is not None rightnow = time.gmtime() if not debug: now = adjust_to_half_hour( list(rightnow) ) then = now[::] then[4] += 30 hr, mn = now[3:5] watch, b = divmod(int(2 * hr + mn // 30 - 1), 8) b += 1 bells = '%i bell%s' % (b, 's' if b > 1 else ' ') if debug: print("%02i:%02i, %-20s %s" % (now[3], now[4], watches[watch] + ' watch', bells), end=' ') else: print("%02i:%02i, %-20s %s" % (rightnow[3], rightnow[4], watches[watch] + ' watch', bells), end=' ') bongs(b) if not debug: scheds.enterabs(calendar.timegm(then), 0, ships_bell) scheds.run() def dbg_tester(): for h in range(24): for m in (0, 30): if (h,m) == (24,30): break ships_bell( [2013, 3, 2, h, m, 15, 5, 61, 0] ) if __name__ == '__main__': ships_bell()
Convert this Java block to Python, preserving its control flow and logic.
public static long fib(int n) { if (n < 0) throw new IllegalArgumentException("n can not be a negative number"); return new Object() { private long fibInner(int n) { return (n < 2) ? n : (fibInner(n - 1) + fibInner(n - 2)); } }.fibInner(n); }
>>> Y = lambda f: (lambda x: x(x))(lambda y: f(lambda *args: y(y)(*args))) >>> fib = lambda f: lambda n: None if n < 0 else (0 if n == 0 else (1 if n == 1 else f(n-1) + f(n-2))) >>> [ Y(fib)(i) for i in range(-2, 10) ] [None, None, 0, 1, 1, 2, 3, 5, 8, 13, 21, 34]
Change the following Java code into Python without altering its purpose.
String strOrig = 'brooms'; String str1 = strOrig.substring(1, strOrig.length()); system.debug(str1); String str2 = strOrig.substring(0, strOrig.length()-1); system.debug(str2); String str3 = strOrig.substring(1, strOrig.length()-1); system.debug(str3); String strOrig = 'brooms'; String str1 = strOrig.replaceAll( '^.', '' ); system.debug(str1); String str2 = strOrig.replaceAll( '.$', '' ) ; system.debug(str2); String str3 = strOrig.replaceAll( '^.|.$', '' ); system.debug(str3);
print "knight"[1:] print "socks"[:-1] print "brooms"[1:-1]
Please provide an equivalent version of this Java code in Python.
String strOrig = 'brooms'; String str1 = strOrig.substring(1, strOrig.length()); system.debug(str1); String str2 = strOrig.substring(0, strOrig.length()-1); system.debug(str2); String str3 = strOrig.substring(1, strOrig.length()-1); system.debug(str3); String strOrig = 'brooms'; String str1 = strOrig.replaceAll( '^.', '' ); system.debug(str1); String str2 = strOrig.replaceAll( '.$', '' ) ; system.debug(str2); String str3 = strOrig.replaceAll( '^.|.$', '' ); system.debug(str3);
print "knight"[1:] print "socks"[:-1] print "brooms"[1:-1]
Produce a functionally identical Python code for the snippet given in Java.
import java.util.*; public class LegendrePrimeCounter { public static void main(String[] args) { LegendrePrimeCounter counter = new LegendrePrimeCounter(1000000000); for (int i = 0, n = 1; i < 10; ++i, n *= 10) System.out.printf("10^%d\t%d\n", i, counter.primeCount((n))); } private List<Integer> primes; public LegendrePrimeCounter(int limit) { primes = generatePrimes((int)Math.sqrt((double)limit)); } public int primeCount(int n) { if (n < 2) return 0; int a = primeCount((int)Math.sqrt((double)n)); return phi(n, a) + a - 1; } private int phi(int x, int a) { if (a == 0) return x; if (a == 1) return x - (x >> 1); int pa = primes.get(a - 1); if (x <= pa) return 1; return phi(x, a - 1) - phi(x / pa, a - 1); } private static List<Integer> generatePrimes(int limit) { boolean[] sieve = new boolean[limit >> 1]; Arrays.fill(sieve, true); for (int p = 3, s = 9; s < limit; p += 2) { if (sieve[p >> 1]) { for (int q = s; q < limit; q += p << 1) sieve[q >> 1] = false; } s += (p + 1) << 2; } List<Integer> primes = new ArrayList<>(); if (limit > 2) primes.add(2); for (int i = 1; i < sieve.length; ++i) { if (sieve[i]) primes.add((i << 1) + 1); } return primes; } }
from primesieve import primes from math import isqrt from functools import cache p = primes(isqrt(1_000_000_000)) @cache def phi(x, a): res = 0 while True: if not a or not x: return x + res a -= 1 res -= phi(x//p[a], a) def legpi(n): if n < 2: return 0 a = legpi(isqrt(n)) return phi(n, a) + a - 1 for e in range(10): print(f'10^{e}', legpi(10**e))
Generate a Python translation of this Java snippet without changing its computational steps.
public class Query { public static boolean call(byte[] data, int[] length) throws java.io.UnsupportedEncodingException { String message = "Here am I"; byte[] mb = message.getBytes("utf-8"); if (length[0] < mb.length) return false; length[0] = mb.length; System.arraycopy(mb, 0, data, 0, mb.length); return true; } }
def query(buffer_length): message = b'Here am I' L = len(message) return message[0:L*(L <= buffer_length)]
Write a version of this Java function in Python with identical behavior.
import java.io.File; import java.util.Scanner; public class LongestStringChallenge { public static void main(String[] args) throws Exception { String lines = "", longest = ""; try (Scanner sc = new Scanner(new File("lines.txt"))) { while(sc.hasNext()) { String line = sc.nextLine(); if (longer(longest, line)) lines = longest = line; else if (!longer(line, longest)) lines = lines.concat("\n").concat(line); } } System.out.println(lines); } static boolean longer(String a, String b) { try { String dummy = a.substring(b.length()); } catch (StringIndexOutOfBoundsException e) { return true; } return false; } }
import fileinput def longer(a, b): try: b[len(a)-1] return False except: return True longest, lines = '', '' for x in fileinput.input(): if longer(x, longest): lines, longest = x, x elif not longer(longest, x): lines += x print(lines, end='')
Keep all operations the same but rewrite the snippet in Python.
import java.util.HashMap; import java.util.HashSet; import java.util.LinkedList; import java.util.ListIterator; import java.util.List; import java.util.Set; import java.util.Map; public class UTM { private List<String> tape; private String blankSymbol; private ListIterator<String> head; private Map<StateTapeSymbolPair, Transition> transitions = new HashMap<StateTapeSymbolPair, Transition>(); private Set<String> terminalStates; private String initialState; public UTM(Set<Transition> transitions, Set<String> terminalStates, String initialState, String blankSymbol) { this.blankSymbol = blankSymbol; for (Transition t : transitions) { this.transitions.put(t.from, t); } this.terminalStates = terminalStates; this.initialState = initialState; } public static class StateTapeSymbolPair { private String state; private String tapeSymbol; public StateTapeSymbolPair(String state, String tapeSymbol) { this.state = state; this.tapeSymbol = tapeSymbol; } @Override public int hashCode() { final int prime = 31; int result = 1; result = prime * result + ((state == null) ? 0 : state.hashCode()); result = prime * result + ((tapeSymbol == null) ? 0 : tapeSymbol .hashCode()); return result; } @Override public boolean equals(Object obj) { if (this == obj) return true; if (obj == null) return false; if (getClass() != obj.getClass()) return false; StateTapeSymbolPair other = (StateTapeSymbolPair) obj; if (state == null) { if (other.state != null) return false; } else if (!state.equals(other.state)) return false; if (tapeSymbol == null) { if (other.tapeSymbol != null) return false; } else if (!tapeSymbol.equals(other.tapeSymbol)) return false; return true; } @Override public String toString() { return "(" + state + "," + tapeSymbol + ")"; } } public static class Transition { private StateTapeSymbolPair from; private StateTapeSymbolPair to; private int direction; public Transition(StateTapeSymbolPair from, StateTapeSymbolPair to, int direction) { this.from = from; this.to = to; this.direction = direction; } @Override public String toString() { return from + "=>" + to + "/" + direction; } } public void initializeTape(List<String> input) { tape = input; } public void initializeTape(String input) { tape = new LinkedList<String>(); for (int i = 0; i < input.length(); i++) { tape.add(input.charAt(i) + ""); } } public List<String> runTM() { if (tape.size() == 0) { tape.add(blankSymbol); } head = tape.listIterator(); head.next(); head.previous(); StateTapeSymbolPair tsp = new StateTapeSymbolPair(initialState, tape.get(0)); while (transitions.containsKey(tsp)) { System.out.println(this + " --- " + transitions.get(tsp)); Transition trans = transitions.get(tsp); head.set(trans.to.tapeSymbol); tsp.state = trans.to.state; if (trans.direction == -1) { if (!head.hasPrevious()) { head.add(blankSymbol); } tsp.tapeSymbol = head.previous(); } else if (trans.direction == 1) { head.next(); if (!head.hasNext()) { head.add(blankSymbol); head.previous(); } tsp.tapeSymbol = head.next(); head.previous(); } else { tsp.tapeSymbol = trans.to.tapeSymbol; } } System.out.println(this + " --- " + tsp); if (terminalStates.contains(tsp.state)) { return tape; } else { return null; } } @Override public String toString() { try { int headPos = head.previousIndex(); String s = "[ "; for (int i = 0; i <= headPos; i++) { s += tape.get(i) + " "; } s += "[H] "; for (int i = headPos + 1; i < tape.size(); i++) { s += tape.get(i) + " "; } return s + "]"; } catch (Exception e) { return ""; } } public static void main(String[] args) { String init = "q0"; String blank = "b"; Set<String> term = new HashSet<String>(); term.add("qf"); Set<Transition> trans = new HashSet<Transition>(); trans.add(new Transition(new StateTapeSymbolPair("q0", "1"), new StateTapeSymbolPair("q0", "1"), 1)); trans.add(new Transition(new StateTapeSymbolPair("q0", "b"), new StateTapeSymbolPair("qf", "1"), 0)); UTM machine = new UTM(trans, term, init, blank); machine.initializeTape("111"); System.out.println("Output (si): " + machine.runTM() + "\n"); init = "a"; term.clear(); term.add("halt"); blank = "0"; trans.clear(); trans.add(new Transition(new StateTapeSymbolPair("a", "0"), new StateTapeSymbolPair("b", "1"), 1)); trans.add(new Transition(new StateTapeSymbolPair("a", "1"), new StateTapeSymbolPair("c", "1"), -1)); trans.add(new Transition(new StateTapeSymbolPair("b", "0"), new StateTapeSymbolPair("a", "1"), -1)); trans.add(new Transition(new StateTapeSymbolPair("b", "1"), new StateTapeSymbolPair("b", "1"), 1)); trans.add(new Transition(new StateTapeSymbolPair("c", "0"), new StateTapeSymbolPair("b", "1"), -1)); trans.add(new Transition(new StateTapeSymbolPair("c", "1"), new StateTapeSymbolPair("halt", "1"), 0)); machine = new UTM(trans, term, init, blank); machine.initializeTape(""); System.out.println("Output (bb): " + machine.runTM()); init = "s0"; blank = "*"; term = new HashSet<String>(); term.add("see"); trans = new HashSet<Transition>(); trans.add(new Transition(new StateTapeSymbolPair("s0", "a"), new StateTapeSymbolPair("s0", "a"), 1)); trans.add(new Transition(new StateTapeSymbolPair("s0", "b"), new StateTapeSymbolPair("s1", "B"), 1)); trans.add(new Transition(new StateTapeSymbolPair("s0", "*"), new StateTapeSymbolPair("se", "*"), -1)); trans.add(new Transition(new StateTapeSymbolPair("s1", "a"), new StateTapeSymbolPair("s1", "a"), 1)); trans.add(new Transition(new StateTapeSymbolPair("s1", "b"), new StateTapeSymbolPair("s1", "b"), 1)); trans.add(new Transition(new StateTapeSymbolPair("s1", "*"), new StateTapeSymbolPair("s2", "*"), -1)); trans.add(new Transition(new StateTapeSymbolPair("s2", "a"), new StateTapeSymbolPair("s3", "b"), -1)); trans.add(new Transition(new StateTapeSymbolPair("s2", "b"), new StateTapeSymbolPair("s2", "b"), -1)); trans.add(new Transition(new StateTapeSymbolPair("s2", "B"), new StateTapeSymbolPair("se", "b"), -1)); trans.add(new Transition(new StateTapeSymbolPair("s3", "a"), new StateTapeSymbolPair("s3", "a"), -1)); trans.add(new Transition(new StateTapeSymbolPair("s3", "b"), new StateTapeSymbolPair("s3", "b"), -1)); trans.add(new Transition(new StateTapeSymbolPair("s3", "B"), new StateTapeSymbolPair("s0", "a"), 1)); trans.add(new Transition(new StateTapeSymbolPair("se", "a"), new StateTapeSymbolPair("se", "a"), -1)); trans.add(new Transition(new StateTapeSymbolPair("se", "*"), new StateTapeSymbolPair("see", "*"), 1)); machine = new UTM(trans, term, init, blank); machine.initializeTape("babbababaa"); System.out.println("Output (sort): " + machine.runTM() + "\n"); } }
from __future__ import print_function def run_utm( state = None, blank = None, rules = [], tape = [], halt = None, pos = 0): st = state if not tape: tape = [blank] if pos < 0: pos += len(tape) if pos >= len(tape) or pos < 0: raise Error( "bad init position") rules = dict(((s0, v0), (v1, dr, s1)) for (s0, v0, v1, dr, s1) in rules) while True: print(st, '\t', end=" ") for i, v in enumerate(tape): if i == pos: print("[%s]" % (v,), end=" ") else: print(v, end=" ") print() if st == halt: break if (st, tape[pos]) not in rules: break (v1, dr, s1) = rules[(st, tape[pos])] tape[pos] = v1 if dr == 'left': if pos > 0: pos -= 1 else: tape.insert(0, blank) if dr == 'right': pos += 1 if pos >= len(tape): tape.append(blank) st = s1 print("incr machine\n") run_utm( halt = 'qf', state = 'q0', tape = list("111"), blank = 'B', rules = map(tuple, ["q0 1 1 right q0".split(), "q0 B 1 stay qf".split()] ) ) print("\nbusy beaver\n") run_utm( halt = 'halt', state = 'a', blank = '0', rules = map(tuple, ["a 0 1 right b".split(), "a 1 1 left c".split(), "b 0 1 left a".split(), "b 1 1 right b".split(), "c 0 1 left b".split(), "c 1 1 stay halt".split()] ) ) print("\nsorting test\n") run_utm(halt = 'STOP', state = 'A', blank = '0', tape = "2 2 2 1 2 2 1 2 1 2 1 2 1 2".split(), rules = map(tuple, ["A 1 1 right A".split(), "A 2 3 right B".split(), "A 0 0 left E".split(), "B 1 1 right B".split(), "B 2 2 right B".split(), "B 0 0 left C".split(), "C 1 2 left D".split(), "C 2 2 left C".split(), "C 3 2 left E".split(), "D 1 1 left D".split(), "D 2 2 left D".split(), "D 3 1 right A".split(), "E 1 1 left E".split(), "E 0 0 right STOP".split()] ) )
Produce a language-to-language conversion: from Java to Python, same semantics.
import java.util.HashMap; import java.util.HashSet; import java.util.LinkedList; import java.util.ListIterator; import java.util.List; import java.util.Set; import java.util.Map; public class UTM { private List<String> tape; private String blankSymbol; private ListIterator<String> head; private Map<StateTapeSymbolPair, Transition> transitions = new HashMap<StateTapeSymbolPair, Transition>(); private Set<String> terminalStates; private String initialState; public UTM(Set<Transition> transitions, Set<String> terminalStates, String initialState, String blankSymbol) { this.blankSymbol = blankSymbol; for (Transition t : transitions) { this.transitions.put(t.from, t); } this.terminalStates = terminalStates; this.initialState = initialState; } public static class StateTapeSymbolPair { private String state; private String tapeSymbol; public StateTapeSymbolPair(String state, String tapeSymbol) { this.state = state; this.tapeSymbol = tapeSymbol; } @Override public int hashCode() { final int prime = 31; int result = 1; result = prime * result + ((state == null) ? 0 : state.hashCode()); result = prime * result + ((tapeSymbol == null) ? 0 : tapeSymbol .hashCode()); return result; } @Override public boolean equals(Object obj) { if (this == obj) return true; if (obj == null) return false; if (getClass() != obj.getClass()) return false; StateTapeSymbolPair other = (StateTapeSymbolPair) obj; if (state == null) { if (other.state != null) return false; } else if (!state.equals(other.state)) return false; if (tapeSymbol == null) { if (other.tapeSymbol != null) return false; } else if (!tapeSymbol.equals(other.tapeSymbol)) return false; return true; } @Override public String toString() { return "(" + state + "," + tapeSymbol + ")"; } } public static class Transition { private StateTapeSymbolPair from; private StateTapeSymbolPair to; private int direction; public Transition(StateTapeSymbolPair from, StateTapeSymbolPair to, int direction) { this.from = from; this.to = to; this.direction = direction; } @Override public String toString() { return from + "=>" + to + "/" + direction; } } public void initializeTape(List<String> input) { tape = input; } public void initializeTape(String input) { tape = new LinkedList<String>(); for (int i = 0; i < input.length(); i++) { tape.add(input.charAt(i) + ""); } } public List<String> runTM() { if (tape.size() == 0) { tape.add(blankSymbol); } head = tape.listIterator(); head.next(); head.previous(); StateTapeSymbolPair tsp = new StateTapeSymbolPair(initialState, tape.get(0)); while (transitions.containsKey(tsp)) { System.out.println(this + " --- " + transitions.get(tsp)); Transition trans = transitions.get(tsp); head.set(trans.to.tapeSymbol); tsp.state = trans.to.state; if (trans.direction == -1) { if (!head.hasPrevious()) { head.add(blankSymbol); } tsp.tapeSymbol = head.previous(); } else if (trans.direction == 1) { head.next(); if (!head.hasNext()) { head.add(blankSymbol); head.previous(); } tsp.tapeSymbol = head.next(); head.previous(); } else { tsp.tapeSymbol = trans.to.tapeSymbol; } } System.out.println(this + " --- " + tsp); if (terminalStates.contains(tsp.state)) { return tape; } else { return null; } } @Override public String toString() { try { int headPos = head.previousIndex(); String s = "[ "; for (int i = 0; i <= headPos; i++) { s += tape.get(i) + " "; } s += "[H] "; for (int i = headPos + 1; i < tape.size(); i++) { s += tape.get(i) + " "; } return s + "]"; } catch (Exception e) { return ""; } } public static void main(String[] args) { String init = "q0"; String blank = "b"; Set<String> term = new HashSet<String>(); term.add("qf"); Set<Transition> trans = new HashSet<Transition>(); trans.add(new Transition(new StateTapeSymbolPair("q0", "1"), new StateTapeSymbolPair("q0", "1"), 1)); trans.add(new Transition(new StateTapeSymbolPair("q0", "b"), new StateTapeSymbolPair("qf", "1"), 0)); UTM machine = new UTM(trans, term, init, blank); machine.initializeTape("111"); System.out.println("Output (si): " + machine.runTM() + "\n"); init = "a"; term.clear(); term.add("halt"); blank = "0"; trans.clear(); trans.add(new Transition(new StateTapeSymbolPair("a", "0"), new StateTapeSymbolPair("b", "1"), 1)); trans.add(new Transition(new StateTapeSymbolPair("a", "1"), new StateTapeSymbolPair("c", "1"), -1)); trans.add(new Transition(new StateTapeSymbolPair("b", "0"), new StateTapeSymbolPair("a", "1"), -1)); trans.add(new Transition(new StateTapeSymbolPair("b", "1"), new StateTapeSymbolPair("b", "1"), 1)); trans.add(new Transition(new StateTapeSymbolPair("c", "0"), new StateTapeSymbolPair("b", "1"), -1)); trans.add(new Transition(new StateTapeSymbolPair("c", "1"), new StateTapeSymbolPair("halt", "1"), 0)); machine = new UTM(trans, term, init, blank); machine.initializeTape(""); System.out.println("Output (bb): " + machine.runTM()); init = "s0"; blank = "*"; term = new HashSet<String>(); term.add("see"); trans = new HashSet<Transition>(); trans.add(new Transition(new StateTapeSymbolPair("s0", "a"), new StateTapeSymbolPair("s0", "a"), 1)); trans.add(new Transition(new StateTapeSymbolPair("s0", "b"), new StateTapeSymbolPair("s1", "B"), 1)); trans.add(new Transition(new StateTapeSymbolPair("s0", "*"), new StateTapeSymbolPair("se", "*"), -1)); trans.add(new Transition(new StateTapeSymbolPair("s1", "a"), new StateTapeSymbolPair("s1", "a"), 1)); trans.add(new Transition(new StateTapeSymbolPair("s1", "b"), new StateTapeSymbolPair("s1", "b"), 1)); trans.add(new Transition(new StateTapeSymbolPair("s1", "*"), new StateTapeSymbolPair("s2", "*"), -1)); trans.add(new Transition(new StateTapeSymbolPair("s2", "a"), new StateTapeSymbolPair("s3", "b"), -1)); trans.add(new Transition(new StateTapeSymbolPair("s2", "b"), new StateTapeSymbolPair("s2", "b"), -1)); trans.add(new Transition(new StateTapeSymbolPair("s2", "B"), new StateTapeSymbolPair("se", "b"), -1)); trans.add(new Transition(new StateTapeSymbolPair("s3", "a"), new StateTapeSymbolPair("s3", "a"), -1)); trans.add(new Transition(new StateTapeSymbolPair("s3", "b"), new StateTapeSymbolPair("s3", "b"), -1)); trans.add(new Transition(new StateTapeSymbolPair("s3", "B"), new StateTapeSymbolPair("s0", "a"), 1)); trans.add(new Transition(new StateTapeSymbolPair("se", "a"), new StateTapeSymbolPair("se", "a"), -1)); trans.add(new Transition(new StateTapeSymbolPair("se", "*"), new StateTapeSymbolPair("see", "*"), 1)); machine = new UTM(trans, term, init, blank); machine.initializeTape("babbababaa"); System.out.println("Output (sort): " + machine.runTM() + "\n"); } }
from __future__ import print_function def run_utm( state = None, blank = None, rules = [], tape = [], halt = None, pos = 0): st = state if not tape: tape = [blank] if pos < 0: pos += len(tape) if pos >= len(tape) or pos < 0: raise Error( "bad init position") rules = dict(((s0, v0), (v1, dr, s1)) for (s0, v0, v1, dr, s1) in rules) while True: print(st, '\t', end=" ") for i, v in enumerate(tape): if i == pos: print("[%s]" % (v,), end=" ") else: print(v, end=" ") print() if st == halt: break if (st, tape[pos]) not in rules: break (v1, dr, s1) = rules[(st, tape[pos])] tape[pos] = v1 if dr == 'left': if pos > 0: pos -= 1 else: tape.insert(0, blank) if dr == 'right': pos += 1 if pos >= len(tape): tape.append(blank) st = s1 print("incr machine\n") run_utm( halt = 'qf', state = 'q0', tape = list("111"), blank = 'B', rules = map(tuple, ["q0 1 1 right q0".split(), "q0 B 1 stay qf".split()] ) ) print("\nbusy beaver\n") run_utm( halt = 'halt', state = 'a', blank = '0', rules = map(tuple, ["a 0 1 right b".split(), "a 1 1 left c".split(), "b 0 1 left a".split(), "b 1 1 right b".split(), "c 0 1 left b".split(), "c 1 1 stay halt".split()] ) ) print("\nsorting test\n") run_utm(halt = 'STOP', state = 'A', blank = '0', tape = "2 2 2 1 2 2 1 2 1 2 1 2 1 2".split(), rules = map(tuple, ["A 1 1 right A".split(), "A 2 3 right B".split(), "A 0 0 left E".split(), "B 1 1 right B".split(), "B 2 2 right B".split(), "B 0 0 left C".split(), "C 1 2 left D".split(), "C 2 2 left C".split(), "C 3 2 left E".split(), "D 1 1 left D".split(), "D 2 2 left D".split(), "D 3 1 right A".split(), "E 1 1 left E".split(), "E 0 0 right STOP".split()] ) )
Write a version of this Java function in Python with identical behavior.
import java.io.*; public class CreateFileTest { public static void main(String args[]) { try { new File("output.txt").createNewFile(); new File(File.separator + "output.txt").createNewFile(); new File("docs").mkdir(); new File(File.separator + "docs").mkdir(); } catch (IOException e) { System.err.println(e.getMessage()); } } }
import os for directory in ['/', './']: open(directory + 'output.txt', 'w').close() os.mkdir(directory + 'docs')
Write the same code in Python as shown below in Java.
public class UnprimeableNumbers { private static int MAX = 10_000_000; private static boolean[] primes = new boolean[MAX]; public static void main(String[] args) { sieve(); System.out.println("First 35 unprimeable numbers:"); displayUnprimeableNumbers(35); int n = 600; System.out.printf("%nThe %dth unprimeable number = %,d%n%n", n, nthUnprimeableNumber(n)); int[] lowest = genLowest(); System.out.println("Least unprimeable number that ends in:"); for ( int i = 0 ; i <= 9 ; i++ ) { System.out.printf(" %d is %,d%n", i, lowest[i]); } } private static int[] genLowest() { int[] lowest = new int[10]; int count = 0; int test = 1; while ( count < 10 ) { test++; if ( unPrimable(test) && lowest[test % 10] == 0 ) { lowest[test % 10] = test; count++; } } return lowest; } private static int nthUnprimeableNumber(int maxCount) { int test = 1; int count = 0; int result = 0; while ( count < maxCount ) { test++; if ( unPrimable(test) ) { count++; result = test; } } return result; } private static void displayUnprimeableNumbers(int maxCount) { int test = 1; int count = 0; while ( count < maxCount ) { test++; if ( unPrimable(test) ) { count++; System.out.printf("%d ", test); } } System.out.println(); } private static boolean unPrimable(int test) { if ( primes[test] ) { return false; } String s = test + ""; for ( int i = 0 ; i < s.length() ; i++ ) { for ( int j = 0 ; j <= 9 ; j++ ) { if ( primes[Integer.parseInt(replace(s, i, j))] ) { return false; } } } return true; } private static String replace(String str, int position, int value) { char[] sChar = str.toCharArray(); sChar[position] = (char) value; return str.substring(0, position) + value + str.substring(position + 1); } private static final void sieve() { for ( int i = 2 ; i < MAX ; i++ ) { primes[i] = true; } for ( int i = 2 ; i < MAX ; i++ ) { if ( primes[i] ) { for ( int j = 2*i ; j < MAX ; j += i ) { primes[j] = false; } } } } }
from itertools import count, islice def primes(_cache=[2, 3]): yield from _cache for n in count(_cache[-1]+2, 2): if isprime(n): _cache.append(n) yield n def isprime(n, _seen={0: False, 1: False}): def _isprime(n): for p in primes(): if p*p > n: return True if n%p == 0: return False if n not in _seen: _seen[n] = _isprime(n) return _seen[n] def unprime(): for a in count(1): d = 1 while d <= a: base = (a//(d*10))*(d*10) + (a%d) if any(isprime(y) for y in range(base, base + d*10, d)): break d *= 10 else: yield a print('First 35:') print(' '.join(str(i) for i in islice(unprime(), 35))) print('\nThe 600-th:') print(list(islice(unprime(), 599, 600))[0]) print() first, need = [False]*10, 10 for p in unprime(): i = p%10 if first[i]: continue first[i] = p need -= 1 if not need: break for i,v in enumerate(first): print(f'{i} ending: {v}')
Convert this Java snippet to Python and keep its semantics consistent.
import java.util.ArrayList; import java.util.Arrays; import java.util.List; public class PascalsTrianglePuzzle { public static void main(String[] args) { Matrix mat = new Matrix(Arrays.asList(1d, 0d, 0d, 0d, 0d, 0d, 0d, 0d, -1d, 0d, 0d), Arrays.asList(0d, 1d, 0d, 0d, 0d, 0d, 0d, 0d, 0d, -1d, 0d), Arrays.asList(0d, 0d, 0d, 0d, 0d, 0d, 0d, 0d, -1d, 1d, -1d), Arrays.asList(0d, 0d, 1d, 0d, 0d, 0d, 0d, 0d, 0d, -1d, 0d), Arrays.asList(0d, 0d, 0d, 1d, 0d, 0d, 0d, 0d, 0d, 0d, -1d), Arrays.asList(1d, 1d, 0d, 0d, 0d, 0d, 0d, 0d, 0d, 0d, 0d), Arrays.asList(0d, 1d, 1d, 0d, -1d, 0d, 0d, 0d, 0d, 0d, 0d), Arrays.asList(0d, 0d, 1d, 1d, 0d, -1d, 0d, 0d, 0d, 0d, 0d), Arrays.asList(0d, 0d, 0d, 0d, -1d, 0d, 1d, 0d, 0d, 0d, 0d), Arrays.asList(0d, 0d, 0d, 0d, 1d, 1d, 0d, -1d, 0d, 0d, 0d), Arrays.asList(0d, 0d, 0d, 0d, 0d, 0d, 1d, 1d, 0d, 0d, 0d)); List<Double> b = Arrays.asList(11d, 11d, 0d, 4d, 4d, 40d, 0d, 0d, 40d, 0d, 151d); List<Double> solution = cramersRule(mat, b); System.out.println("Solution = " + cramersRule(mat, b)); System.out.printf("X = %.2f%n", solution.get(8)); System.out.printf("Y = %.2f%n", solution.get(9)); System.out.printf("Z = %.2f%n", solution.get(10)); } private static List<Double> cramersRule(Matrix matrix, List<Double> b) { double denominator = matrix.determinant(); List<Double> result = new ArrayList<>(); for ( int i = 0 ; i < b.size() ; i++ ) { result.add(matrix.replaceColumn(b, i).determinant() / denominator); } return result; } private static class Matrix { private List<List<Double>> matrix; @Override public String toString() { return matrix.toString(); } @SafeVarargs public Matrix(List<Double> ... lists) { matrix = new ArrayList<>(); for ( List<Double> list : lists) { matrix.add(list); } } public Matrix(List<List<Double>> mat) { matrix = mat; } public double determinant() { if ( matrix.size() == 1 ) { return get(0, 0); } if ( matrix.size() == 2 ) { return get(0, 0) * get(1, 1) - get(0, 1) * get(1, 0); } double sum = 0; double sign = 1; for ( int i = 0 ; i < matrix.size() ; i++ ) { sum += sign * get(0, i) * coFactor(0, i).determinant(); sign *= -1; } return sum; } private Matrix coFactor(int row, int col) { List<List<Double>> mat = new ArrayList<>(); for ( int i = 0 ; i < matrix.size() ; i++ ) { if ( i == row ) { continue; } List<Double> list = new ArrayList<>(); for ( int j = 0 ; j < matrix.size() ; j++ ) { if ( j == col ) { continue; } list.add(get(i, j)); } mat.add(list); } return new Matrix(mat); } private Matrix replaceColumn(List<Double> b, int column) { List<List<Double>> mat = new ArrayList<>(); for ( int row = 0 ; row < matrix.size() ; row++ ) { List<Double> list = new ArrayList<>(); for ( int col = 0 ; col < matrix.size() ; col++ ) { double value = get(row, col); if ( col == column ) { value = b.get(row); } list.add(value); } mat.add(list); } return new Matrix(mat); } private double get(int row, int col) { return matrix.get(row).get(col); } } }
def combine( snl, snr ): cl = {} if isinstance(snl, int): cl['1'] = snl elif isinstance(snl, string): cl[snl] = 1 else: cl.update( snl) if isinstance(snr, int): n = cl.get('1', 0) cl['1'] = n + snr elif isinstance(snr, string): n = cl.get(snr, 0) cl[snr] = n + 1 else: for k,v in snr.items(): n = cl.get(k, 0) cl[k] = n+v return cl def constrain(nsum, vn ): nn = {} nn.update(vn) n = nn.get('1', 0) nn['1'] = n - nsum return nn def makeMatrix( constraints ): vmap = set() for c in constraints: vmap.update( c.keys()) vmap.remove('1') nvars = len(vmap) vmap = sorted(vmap) mtx = [] for c in constraints: row = [] for vv in vmap: row.append(float(c.get(vv, 0))) row.append(-float(c.get('1',0))) mtx.append(row) if len(constraints) == nvars: print 'System appears solvable' elif len(constraints) < nvars: print 'System is not solvable - needs more constraints.' return mtx, vmap def SolvePyramid( vl, cnstr ): vl.reverse() constraints = [cnstr] lvls = len(vl) for lvln in range(1,lvls): lvd = vl[lvln] for k in range(lvls - lvln): sn = lvd[k] ll = vl[lvln-1] vn = combine(ll[k], ll[k+1]) if sn is None: lvd[k] = vn else: constraints.append(constrain( sn, vn )) print 'Constraint Equations:' for cstr in constraints: fset = ('%d*%s'%(v,k) for k,v in cstr.items() ) print ' + '.join(fset), ' = 0' mtx,vmap = makeMatrix(constraints) MtxSolve(mtx) d = len(vmap) for j in range(d): print vmap[j],'=', mtx[j][d] def MtxSolve(mtx): mDim = len(mtx) for j in range(mDim): rw0= mtx[j] f = 1.0/rw0[j] for k in range(j, mDim+1): rw0[k] *= f for l in range(1+j,mDim): rwl = mtx[l] f = -rwl[j] for k in range(j, mDim+1): rwl[k] += f * rw0[k] for j1 in range(1,mDim): j = mDim - j1 rw0= mtx[j] for l in range(0, j): rwl = mtx[l] f = -rwl[j] rwl[j] += f * rw0[j] rwl[mDim] += f * rw0[mDim] return mtx p = [ [151], [None,None], [40,None,None], [None,None,None,None], ['X', 11, 'Y', 4, 'Z'] ] addlConstraint = { 'X':1, 'Y':-1, 'Z':1, '1':0 } SolvePyramid( p, addlConstraint)
Transform the following Java implementation into Python, maintaining the same output and logic.
import java.util.ArrayList; import java.util.Arrays; import java.util.List; public class PascalsTrianglePuzzle { public static void main(String[] args) { Matrix mat = new Matrix(Arrays.asList(1d, 0d, 0d, 0d, 0d, 0d, 0d, 0d, -1d, 0d, 0d), Arrays.asList(0d, 1d, 0d, 0d, 0d, 0d, 0d, 0d, 0d, -1d, 0d), Arrays.asList(0d, 0d, 0d, 0d, 0d, 0d, 0d, 0d, -1d, 1d, -1d), Arrays.asList(0d, 0d, 1d, 0d, 0d, 0d, 0d, 0d, 0d, -1d, 0d), Arrays.asList(0d, 0d, 0d, 1d, 0d, 0d, 0d, 0d, 0d, 0d, -1d), Arrays.asList(1d, 1d, 0d, 0d, 0d, 0d, 0d, 0d, 0d, 0d, 0d), Arrays.asList(0d, 1d, 1d, 0d, -1d, 0d, 0d, 0d, 0d, 0d, 0d), Arrays.asList(0d, 0d, 1d, 1d, 0d, -1d, 0d, 0d, 0d, 0d, 0d), Arrays.asList(0d, 0d, 0d, 0d, -1d, 0d, 1d, 0d, 0d, 0d, 0d), Arrays.asList(0d, 0d, 0d, 0d, 1d, 1d, 0d, -1d, 0d, 0d, 0d), Arrays.asList(0d, 0d, 0d, 0d, 0d, 0d, 1d, 1d, 0d, 0d, 0d)); List<Double> b = Arrays.asList(11d, 11d, 0d, 4d, 4d, 40d, 0d, 0d, 40d, 0d, 151d); List<Double> solution = cramersRule(mat, b); System.out.println("Solution = " + cramersRule(mat, b)); System.out.printf("X = %.2f%n", solution.get(8)); System.out.printf("Y = %.2f%n", solution.get(9)); System.out.printf("Z = %.2f%n", solution.get(10)); } private static List<Double> cramersRule(Matrix matrix, List<Double> b) { double denominator = matrix.determinant(); List<Double> result = new ArrayList<>(); for ( int i = 0 ; i < b.size() ; i++ ) { result.add(matrix.replaceColumn(b, i).determinant() / denominator); } return result; } private static class Matrix { private List<List<Double>> matrix; @Override public String toString() { return matrix.toString(); } @SafeVarargs public Matrix(List<Double> ... lists) { matrix = new ArrayList<>(); for ( List<Double> list : lists) { matrix.add(list); } } public Matrix(List<List<Double>> mat) { matrix = mat; } public double determinant() { if ( matrix.size() == 1 ) { return get(0, 0); } if ( matrix.size() == 2 ) { return get(0, 0) * get(1, 1) - get(0, 1) * get(1, 0); } double sum = 0; double sign = 1; for ( int i = 0 ; i < matrix.size() ; i++ ) { sum += sign * get(0, i) * coFactor(0, i).determinant(); sign *= -1; } return sum; } private Matrix coFactor(int row, int col) { List<List<Double>> mat = new ArrayList<>(); for ( int i = 0 ; i < matrix.size() ; i++ ) { if ( i == row ) { continue; } List<Double> list = new ArrayList<>(); for ( int j = 0 ; j < matrix.size() ; j++ ) { if ( j == col ) { continue; } list.add(get(i, j)); } mat.add(list); } return new Matrix(mat); } private Matrix replaceColumn(List<Double> b, int column) { List<List<Double>> mat = new ArrayList<>(); for ( int row = 0 ; row < matrix.size() ; row++ ) { List<Double> list = new ArrayList<>(); for ( int col = 0 ; col < matrix.size() ; col++ ) { double value = get(row, col); if ( col == column ) { value = b.get(row); } list.add(value); } mat.add(list); } return new Matrix(mat); } private double get(int row, int col) { return matrix.get(row).get(col); } } }
def combine( snl, snr ): cl = {} if isinstance(snl, int): cl['1'] = snl elif isinstance(snl, string): cl[snl] = 1 else: cl.update( snl) if isinstance(snr, int): n = cl.get('1', 0) cl['1'] = n + snr elif isinstance(snr, string): n = cl.get(snr, 0) cl[snr] = n + 1 else: for k,v in snr.items(): n = cl.get(k, 0) cl[k] = n+v return cl def constrain(nsum, vn ): nn = {} nn.update(vn) n = nn.get('1', 0) nn['1'] = n - nsum return nn def makeMatrix( constraints ): vmap = set() for c in constraints: vmap.update( c.keys()) vmap.remove('1') nvars = len(vmap) vmap = sorted(vmap) mtx = [] for c in constraints: row = [] for vv in vmap: row.append(float(c.get(vv, 0))) row.append(-float(c.get('1',0))) mtx.append(row) if len(constraints) == nvars: print 'System appears solvable' elif len(constraints) < nvars: print 'System is not solvable - needs more constraints.' return mtx, vmap def SolvePyramid( vl, cnstr ): vl.reverse() constraints = [cnstr] lvls = len(vl) for lvln in range(1,lvls): lvd = vl[lvln] for k in range(lvls - lvln): sn = lvd[k] ll = vl[lvln-1] vn = combine(ll[k], ll[k+1]) if sn is None: lvd[k] = vn else: constraints.append(constrain( sn, vn )) print 'Constraint Equations:' for cstr in constraints: fset = ('%d*%s'%(v,k) for k,v in cstr.items() ) print ' + '.join(fset), ' = 0' mtx,vmap = makeMatrix(constraints) MtxSolve(mtx) d = len(vmap) for j in range(d): print vmap[j],'=', mtx[j][d] def MtxSolve(mtx): mDim = len(mtx) for j in range(mDim): rw0= mtx[j] f = 1.0/rw0[j] for k in range(j, mDim+1): rw0[k] *= f for l in range(1+j,mDim): rwl = mtx[l] f = -rwl[j] for k in range(j, mDim+1): rwl[k] += f * rw0[k] for j1 in range(1,mDim): j = mDim - j1 rw0= mtx[j] for l in range(0, j): rwl = mtx[l] f = -rwl[j] rwl[j] += f * rw0[j] rwl[mDim] += f * rw0[mDim] return mtx p = [ [151], [None,None], [40,None,None], [None,None,None,None], ['X', 11, 'Y', 4, 'Z'] ] addlConstraint = { 'X':1, 'Y':-1, 'Z':1, '1':0 } SolvePyramid( p, addlConstraint)
Ensure the translated Python code behaves exactly like the original Java snippet.
import java.math.BigInteger; import java.util.ArrayList; import java.util.List; public class ChernicksCarmichaelNumbers { public static void main(String[] args) { for ( long n = 3 ; n < 10 ; n++ ) { long m = 0; boolean foundComposite = true; List<Long> factors = null; while ( foundComposite ) { m += (n <= 4 ? 1 : (long) Math.pow(2, n-4) * 5); factors = U(n, m); foundComposite = false; for ( long factor : factors ) { if ( ! isPrime(factor) ) { foundComposite = true; break; } } } System.out.printf("U(%d, %d) = %s = %s %n", n, m, display(factors), multiply(factors)); } } private static String display(List<Long> factors) { return factors.toString().replace("[", "").replace("]", "").replaceAll(", ", " * "); } private static BigInteger multiply(List<Long> factors) { BigInteger result = BigInteger.ONE; for ( long factor : factors ) { result = result.multiply(BigInteger.valueOf(factor)); } return result; } private static List<Long> U(long n, long m) { List<Long> factors = new ArrayList<>(); factors.add(6*m + 1); factors.add(12*m + 1); for ( int i = 1 ; i <= n-2 ; i++ ) { factors.add(((long)Math.pow(2, i)) * 9 * m + 1); } return factors; } private static final int MAX = 100_000; private static final boolean[] primes = new boolean[MAX]; private static boolean SIEVE_COMPLETE = false; private static final boolean isPrimeTrivial(long test) { if ( ! SIEVE_COMPLETE ) { sieve(); SIEVE_COMPLETE = true; } return primes[(int) test]; } private static final void sieve() { for ( int i = 2 ; i < MAX ; i++ ) { primes[i] = true; } for ( int i = 2 ; i < MAX ; i++ ) { if ( primes[i] ) { for ( int j = 2*i ; j < MAX ; j += i ) { primes[j] = false; } } } } public static final boolean isPrime(long testValue) { if ( testValue == 2 ) return true; if ( testValue % 2 == 0 ) return false; if ( testValue <= MAX ) return isPrimeTrivial(testValue); long d = testValue-1; int s = 0; while ( d % 2 == 0 ) { s += 1; d /= 2; } if ( testValue < 1373565L ) { if ( ! aSrp(2, s, d, testValue) ) { return false; } if ( ! aSrp(3, s, d, testValue) ) { return false; } return true; } if ( testValue < 4759123141L ) { if ( ! aSrp(2, s, d, testValue) ) { return false; } if ( ! aSrp(7, s, d, testValue) ) { return false; } if ( ! aSrp(61, s, d, testValue) ) { return false; } return true; } if ( testValue < 10000000000000000L ) { if ( ! aSrp(3, s, d, testValue) ) { return false; } if ( ! aSrp(24251, s, d, testValue) ) { return false; } return true; } if ( ! aSrp(37, s, d, testValue) ) { return false; } if ( ! aSrp(47, s, d, testValue) ) { return false; } if ( ! aSrp(61, s, d, testValue) ) { return false; } if ( ! aSrp(73, s, d, testValue) ) { return false; } if ( ! aSrp(83, s, d, testValue) ) { return false; } return true; } private static final boolean aSrp(int a, int s, long d, long n) { long modPow = modPow(a, d, n); if ( modPow == 1 ) { return true; } int twoExpR = 1; for ( int r = 0 ; r < s ; r++ ) { if ( modPow(modPow, twoExpR, n) == n-1 ) { return true; } twoExpR *= 2; } return false; } private static final long SQRT = (long) Math.sqrt(Long.MAX_VALUE); public static final long modPow(long base, long exponent, long modulus) { long result = 1; while ( exponent > 0 ) { if ( exponent % 2 == 1 ) { if ( result > SQRT || base > SQRT ) { result = multiply(result, base, modulus); } else { result = (result * base) % modulus; } } exponent >>= 1; if ( base > SQRT ) { base = multiply(base, base, modulus); } else { base = (base * base) % modulus; } } return result; } public static final long multiply(long a, long b, long modulus) { long x = 0; long y = a % modulus; long t; while ( b > 0 ) { if ( b % 2 == 1 ) { t = x + y; x = (t > modulus ? t-modulus : t); } t = y << 1; y = (t > modulus ? t-modulus : t); b >>= 1; } return x % modulus; } }
from sympy import isprime def primality_pretest(k): if not (k % 3) or not (k % 5) or not (k % 7) or not (k % 11) or not(k % 13) or not (k % 17) or not (k % 19) or not (k % 23): return (k <= 23) return True def is_chernick(n, m): t = 9 * m if not primality_pretest(6 * m + 1): return False if not primality_pretest(12 * m + 1): return False for i in range(1,n-1): if not primality_pretest((t << i) + 1): return False if not isprime(6 * m + 1): return False if not isprime(12 * m + 1): return False for i in range(1,n - 1): if not isprime((t << i) + 1): return False return True for n in range(3,10): if n > 4: multiplier = 1 << (n - 4) else: multiplier = 1 if n > 5: multiplier *= 5 k = 1 while True: m = k * multiplier if is_chernick(n, m): print("a("+str(n)+") has m = "+str(m)) break k += 1
Produce a language-to-language conversion: from Java to Python, same semantics.
import java.util.Objects; public class FindTriangle { private static final double EPS = 0.001; private static final double EPS_SQUARE = EPS * EPS; public static class Point { private final double x, y; public Point(double x, double y) { this.x = x; this.y = y; } public double getX() { return x; } public double getY() { return y; } @Override public String toString() { return String.format("(%f, %f)", x, y); } } public static class Triangle { private final Point p1, p2, p3; public Triangle(Point p1, Point p2, Point p3) { this.p1 = Objects.requireNonNull(p1); this.p2 = Objects.requireNonNull(p2); this.p3 = Objects.requireNonNull(p3); } public Point getP1() { return p1; } public Point getP2() { return p2; } public Point getP3() { return p3; } private boolean pointInTriangleBoundingBox(Point p) { var xMin = Math.min(p1.getX(), Math.min(p2.getX(), p3.getX())) - EPS; var xMax = Math.max(p1.getX(), Math.max(p2.getX(), p3.getX())) + EPS; var yMin = Math.min(p1.getY(), Math.min(p2.getY(), p3.getY())) - EPS; var yMax = Math.max(p1.getY(), Math.max(p2.getY(), p3.getY())) + EPS; return !(p.getX() < xMin || xMax < p.getX() || p.getY() < yMin || yMax < p.getY()); } private static double side(Point p1, Point p2, Point p) { return (p2.getY() - p1.getY()) * (p.getX() - p1.getX()) + (-p2.getX() + p1.getX()) * (p.getY() - p1.getY()); } private boolean nativePointInTriangle(Point p) { boolean checkSide1 = side(p1, p2, p) >= 0; boolean checkSide2 = side(p2, p3, p) >= 0; boolean checkSide3 = side(p3, p1, p) >= 0; return checkSide1 && checkSide2 && checkSide3; } private double distanceSquarePointToSegment(Point p1, Point p2, Point p) { double p1_p2_squareLength = (p2.getX() - p1.getX()) * (p2.getX() - p1.getX()) + (p2.getY() - p1.getY()) * (p2.getY() - p1.getY()); double dotProduct = ((p.getX() - p1.getX()) * (p2.getX() - p1.getX()) + (p.getY() - p1.getY()) * (p2.getY() - p1.getY())) / p1_p2_squareLength; if (dotProduct < 0) { return (p.getX() - p1.getX()) * (p.getX() - p1.getX()) + (p.getY() - p1.getY()) * (p.getY() - p1.getY()); } if (dotProduct <= 1) { double p_p1_squareLength = (p1.getX() - p.getX()) * (p1.getX() - p.getX()) + (p1.getY() - p.getY()) * (p1.getY() - p.getY()); return p_p1_squareLength - dotProduct * dotProduct * p1_p2_squareLength; } return (p.getX() - p2.getX()) * (p.getX() - p2.getX()) + (p.getY() - p2.getY()) * (p.getY() - p2.getY()); } private boolean accuratePointInTriangle(Point p) { if (!pointInTriangleBoundingBox(p)) { return false; } if (nativePointInTriangle(p)) { return true; } if (distanceSquarePointToSegment(p1, p2, p) <= EPS_SQUARE) { return true; } if (distanceSquarePointToSegment(p2, p3, p) <= EPS_SQUARE) { return true; } return distanceSquarePointToSegment(p3, p1, p) <= EPS_SQUARE; } public boolean within(Point p) { Objects.requireNonNull(p); return accuratePointInTriangle(p); } @Override public String toString() { return String.format("Triangle[%s, %s, %s]", p1, p2, p3); } } private static void test(Triangle t, Point p) { System.out.println(t); System.out.printf("Point %s is within triangle? %s\n", p, t.within(p)); } public static void main(String[] args) { var p1 = new Point(1.5, 2.4); var p2 = new Point(5.1, -3.1); var p3 = new Point(-3.8, 1.2); var tri = new Triangle(p1, p2, p3); test(tri, new Point(0, 0)); test(tri, new Point(0, 1)); test(tri, new Point(3, 1)); System.out.println(); p1 = new Point(1.0 / 10, 1.0 / 9); p2 = new Point(100.0 / 8, 100.0 / 3); p3 = new Point(100.0 / 4, 100.0 / 9); tri = new Triangle(p1, p2, p3); var pt = new Point(p1.getX() + (3.0 / 7) * (p2.getX() - p1.getX()), p1.getY() + (3.0 / 7) * (p2.getY() - p1.getY())); test(tri, pt); System.out.println(); p3 = new Point(-100.0 / 8, 100.0 / 6); tri = new Triangle(p1, p2, p3); test(tri, pt); } }
from sympy.geometry import Point, Triangle def sign(pt1, pt2, pt3): return (pt1.x - pt3.x) * (pt2.y - pt3.y) - (pt2.x - pt3.x) * (pt1.y - pt3.y) def iswithin(point, pt1, pt2, pt3): zval1 = sign(point, pt1, pt2) zval2 = sign(point, pt2, pt3) zval3 = sign(point, pt3, pt1) notanyneg = zval1 >= 0 and zval2 >= 0 and zval3 >= 0 notanypos = zval1 <= 0 and zval2 <= 0 and zval3 <= 0 return notanyneg or notanypos if __name__ == "__main__": POINTS = [Point(0, 0)] TRI = Triangle(Point(1.5, 2.4), Point(5.1, -3.1), Point(-3.8, 0.5)) for pnt in POINTS: a, b, c = TRI.vertices isornot = "is" if iswithin(pnt, a, b, c) else "is not" print("Point", pnt, isornot, "within the triangle", TRI)
Generate a Python translation of this Java snippet without changing its computational steps.
import java.util.Objects; public class FindTriangle { private static final double EPS = 0.001; private static final double EPS_SQUARE = EPS * EPS; public static class Point { private final double x, y; public Point(double x, double y) { this.x = x; this.y = y; } public double getX() { return x; } public double getY() { return y; } @Override public String toString() { return String.format("(%f, %f)", x, y); } } public static class Triangle { private final Point p1, p2, p3; public Triangle(Point p1, Point p2, Point p3) { this.p1 = Objects.requireNonNull(p1); this.p2 = Objects.requireNonNull(p2); this.p3 = Objects.requireNonNull(p3); } public Point getP1() { return p1; } public Point getP2() { return p2; } public Point getP3() { return p3; } private boolean pointInTriangleBoundingBox(Point p) { var xMin = Math.min(p1.getX(), Math.min(p2.getX(), p3.getX())) - EPS; var xMax = Math.max(p1.getX(), Math.max(p2.getX(), p3.getX())) + EPS; var yMin = Math.min(p1.getY(), Math.min(p2.getY(), p3.getY())) - EPS; var yMax = Math.max(p1.getY(), Math.max(p2.getY(), p3.getY())) + EPS; return !(p.getX() < xMin || xMax < p.getX() || p.getY() < yMin || yMax < p.getY()); } private static double side(Point p1, Point p2, Point p) { return (p2.getY() - p1.getY()) * (p.getX() - p1.getX()) + (-p2.getX() + p1.getX()) * (p.getY() - p1.getY()); } private boolean nativePointInTriangle(Point p) { boolean checkSide1 = side(p1, p2, p) >= 0; boolean checkSide2 = side(p2, p3, p) >= 0; boolean checkSide3 = side(p3, p1, p) >= 0; return checkSide1 && checkSide2 && checkSide3; } private double distanceSquarePointToSegment(Point p1, Point p2, Point p) { double p1_p2_squareLength = (p2.getX() - p1.getX()) * (p2.getX() - p1.getX()) + (p2.getY() - p1.getY()) * (p2.getY() - p1.getY()); double dotProduct = ((p.getX() - p1.getX()) * (p2.getX() - p1.getX()) + (p.getY() - p1.getY()) * (p2.getY() - p1.getY())) / p1_p2_squareLength; if (dotProduct < 0) { return (p.getX() - p1.getX()) * (p.getX() - p1.getX()) + (p.getY() - p1.getY()) * (p.getY() - p1.getY()); } if (dotProduct <= 1) { double p_p1_squareLength = (p1.getX() - p.getX()) * (p1.getX() - p.getX()) + (p1.getY() - p.getY()) * (p1.getY() - p.getY()); return p_p1_squareLength - dotProduct * dotProduct * p1_p2_squareLength; } return (p.getX() - p2.getX()) * (p.getX() - p2.getX()) + (p.getY() - p2.getY()) * (p.getY() - p2.getY()); } private boolean accuratePointInTriangle(Point p) { if (!pointInTriangleBoundingBox(p)) { return false; } if (nativePointInTriangle(p)) { return true; } if (distanceSquarePointToSegment(p1, p2, p) <= EPS_SQUARE) { return true; } if (distanceSquarePointToSegment(p2, p3, p) <= EPS_SQUARE) { return true; } return distanceSquarePointToSegment(p3, p1, p) <= EPS_SQUARE; } public boolean within(Point p) { Objects.requireNonNull(p); return accuratePointInTriangle(p); } @Override public String toString() { return String.format("Triangle[%s, %s, %s]", p1, p2, p3); } } private static void test(Triangle t, Point p) { System.out.println(t); System.out.printf("Point %s is within triangle? %s\n", p, t.within(p)); } public static void main(String[] args) { var p1 = new Point(1.5, 2.4); var p2 = new Point(5.1, -3.1); var p3 = new Point(-3.8, 1.2); var tri = new Triangle(p1, p2, p3); test(tri, new Point(0, 0)); test(tri, new Point(0, 1)); test(tri, new Point(3, 1)); System.out.println(); p1 = new Point(1.0 / 10, 1.0 / 9); p2 = new Point(100.0 / 8, 100.0 / 3); p3 = new Point(100.0 / 4, 100.0 / 9); tri = new Triangle(p1, p2, p3); var pt = new Point(p1.getX() + (3.0 / 7) * (p2.getX() - p1.getX()), p1.getY() + (3.0 / 7) * (p2.getY() - p1.getY())); test(tri, pt); System.out.println(); p3 = new Point(-100.0 / 8, 100.0 / 6); tri = new Triangle(p1, p2, p3); test(tri, pt); } }
from sympy.geometry import Point, Triangle def sign(pt1, pt2, pt3): return (pt1.x - pt3.x) * (pt2.y - pt3.y) - (pt2.x - pt3.x) * (pt1.y - pt3.y) def iswithin(point, pt1, pt2, pt3): zval1 = sign(point, pt1, pt2) zval2 = sign(point, pt2, pt3) zval3 = sign(point, pt3, pt1) notanyneg = zval1 >= 0 and zval2 >= 0 and zval3 >= 0 notanypos = zval1 <= 0 and zval2 <= 0 and zval3 <= 0 return notanyneg or notanypos if __name__ == "__main__": POINTS = [Point(0, 0)] TRI = Triangle(Point(1.5, 2.4), Point(5.1, -3.1), Point(-3.8, 0.5)) for pnt in POINTS: a, b, c = TRI.vertices isornot = "is" if iswithin(pnt, a, b, c) else "is not" print("Point", pnt, isornot, "within the triangle", TRI)
Keep all operations the same but rewrite the snippet in Python.
public class TauFunction { private static long divisorCount(long n) { long total = 1; for (; (n & 1) == 0; n >>= 1) { ++total; } for (long p = 3; p * p <= n; p += 2) { long count = 1; for (; n % p == 0; n /= p) { ++count; } total *= count; } if (n > 1) { total *= 2; } return total; } public static void main(String[] args) { final int limit = 100; System.out.printf("Count of divisors for the first %d positive integers:\n", limit); for (long n = 1; n <= limit; ++n) { System.out.printf("%3d", divisorCount(n)); if (n % 20 == 0) { System.out.println(); } } } }
def factorize(n): assert(isinstance(n, int)) if n < 0: n = -n if n < 2: return k = 0 while 0 == n%2: k += 1 n //= 2 if 0 < k: yield (2,k) p = 3 while p*p <= n: k = 0 while 0 == n%p: k += 1 n //= p if 0 < k: yield (p,k) p += 2 if 1 < n: yield (n,1) def tau(n): assert(n != 0) ans = 1 for (p,k) in factorize(n): ans *= 1 + k return ans if __name__ == "__main__": print(*map(tau, range(1, 101)))
Rewrite this program in Python while keeping its functionality equivalent to the Java version.
public class TauFunction { private static long divisorCount(long n) { long total = 1; for (; (n & 1) == 0; n >>= 1) { ++total; } for (long p = 3; p * p <= n; p += 2) { long count = 1; for (; n % p == 0; n /= p) { ++count; } total *= count; } if (n > 1) { total *= 2; } return total; } public static void main(String[] args) { final int limit = 100; System.out.printf("Count of divisors for the first %d positive integers:\n", limit); for (long n = 1; n <= limit; ++n) { System.out.printf("%3d", divisorCount(n)); if (n % 20 == 0) { System.out.println(); } } } }
def factorize(n): assert(isinstance(n, int)) if n < 0: n = -n if n < 2: return k = 0 while 0 == n%2: k += 1 n //= 2 if 0 < k: yield (2,k) p = 3 while p*p <= n: k = 0 while 0 == n%p: k += 1 n //= p if 0 < k: yield (p,k) p += 2 if 1 < n: yield (n,1) def tau(n): assert(n != 0) ans = 1 for (p,k) in factorize(n): ans *= 1 + k return ans if __name__ == "__main__": print(*map(tau, range(1, 101)))
Port the provided Java code into Python while preserving the original functionality.
public class TauFunction { private static long divisorCount(long n) { long total = 1; for (; (n & 1) == 0; n >>= 1) { ++total; } for (long p = 3; p * p <= n; p += 2) { long count = 1; for (; n % p == 0; n /= p) { ++count; } total *= count; } if (n > 1) { total *= 2; } return total; } public static void main(String[] args) { final int limit = 100; System.out.printf("Count of divisors for the first %d positive integers:\n", limit); for (long n = 1; n <= limit; ++n) { System.out.printf("%3d", divisorCount(n)); if (n % 20 == 0) { System.out.println(); } } } }
def factorize(n): assert(isinstance(n, int)) if n < 0: n = -n if n < 2: return k = 0 while 0 == n%2: k += 1 n //= 2 if 0 < k: yield (2,k) p = 3 while p*p <= n: k = 0 while 0 == n%p: k += 1 n //= p if 0 < k: yield (p,k) p += 2 if 1 < n: yield (n,1) def tau(n): assert(n != 0) ans = 1 for (p,k) in factorize(n): ans *= 1 + k return ans if __name__ == "__main__": print(*map(tau, range(1, 101)))
Generate an equivalent Python version of this Java code.
import java.math.BigInteger; public class PrimorialPrimes { final static int sieveLimit = 1550_000; static boolean[] notPrime = sieve(sieveLimit); public static void main(String[] args) { int count = 0; for (int i = 1; i < 1000_000 && count < 20; i++) { BigInteger b = primorial(i); if (b.add(BigInteger.ONE).isProbablePrime(1) || b.subtract(BigInteger.ONE).isProbablePrime(1)) { System.out.printf("%d ", i); count++; } } } static BigInteger primorial(int n) { if (n == 0) return BigInteger.ONE; BigInteger result = BigInteger.ONE; for (int i = 0; i < sieveLimit && n > 0; i++) { if (notPrime[i]) continue; result = result.multiply(BigInteger.valueOf(i)); n--; } return result; } public static boolean[] sieve(int limit) { boolean[] composite = new boolean[limit]; composite[0] = composite[1] = true; int max = (int) Math.sqrt(limit); for (int n = 2; n <= max; n++) { if (!composite[n]) { for (int k = n * n; k < limit; k += n) { composite[k] = true; } } } return composite; } }
import pyprimes def primorial_prime(_pmax=500): isprime = pyprimes.isprime n, primo = 0, 1 for prime in pyprimes.nprimes(_pmax): n, primo = n+1, primo * prime if isprime(primo-1) or isprime(primo+1): yield n if __name__ == '__main__': pyprimes.warn_probably = False for i, n in zip(range(20), primorial_prime()): print('Primorial prime %2i at primorial index: %3i' % (i+1, n))
Produce a language-to-language conversion: from Java to Python, same semantics.
import java.math.BigInteger; public class PrimorialPrimes { final static int sieveLimit = 1550_000; static boolean[] notPrime = sieve(sieveLimit); public static void main(String[] args) { int count = 0; for (int i = 1; i < 1000_000 && count < 20; i++) { BigInteger b = primorial(i); if (b.add(BigInteger.ONE).isProbablePrime(1) || b.subtract(BigInteger.ONE).isProbablePrime(1)) { System.out.printf("%d ", i); count++; } } } static BigInteger primorial(int n) { if (n == 0) return BigInteger.ONE; BigInteger result = BigInteger.ONE; for (int i = 0; i < sieveLimit && n > 0; i++) { if (notPrime[i]) continue; result = result.multiply(BigInteger.valueOf(i)); n--; } return result; } public static boolean[] sieve(int limit) { boolean[] composite = new boolean[limit]; composite[0] = composite[1] = true; int max = (int) Math.sqrt(limit); for (int n = 2; n <= max; n++) { if (!composite[n]) { for (int k = n * n; k < limit; k += n) { composite[k] = true; } } } return composite; } }
import pyprimes def primorial_prime(_pmax=500): isprime = pyprimes.isprime n, primo = 0, 1 for prime in pyprimes.nprimes(_pmax): n, primo = n+1, primo * prime if isprime(primo-1) or isprime(primo+1): yield n if __name__ == '__main__': pyprimes.warn_probably = False for i, n in zip(range(20), primorial_prime()): print('Primorial prime %2i at primorial index: %3i' % (i+1, n))
Preserve the algorithm and functionality while converting the code from Java to Python.
import java.util.HashMap; import java.util.Map; public class orderedSequence { public static void main(String[] args) { Sequence gene = new Sequence("CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATGCTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTGAGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGATGGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTTCGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGGTCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATATTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTATCGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTGTCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGACGACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT"); gene.runSequence(); } } public class Sequence { private final String seq; public Sequence(String sq) { this.seq = sq; } public void prettyPrint() { System.out.println("Sequence:"); int i = 0; for ( ; i < seq.length() - 50 ; i += 50) { System.out.printf("%5s : %s\n", i + 50, seq.substring(i, i + 50)); } System.out.printf("%5s : %s\n", seq.length(), seq.substring(i)); } public void displayCount() { Map<Character, Integer> counter = new HashMap<>(); for (int i = 0 ; i < seq.length() ; ++i) { counter.merge(seq.charAt(i), 1, Integer::sum); } System.out.println("Base vs. Count:"); counter.forEach( key, value -> System.out.printf("%5s : %s\n", key, value)); System.out.printf("%5s: %s\n", "SUM", seq.length()); } public void runSequence() { this.prettyPrint(); this.displayCount(); } }
from collections import Counter def basecount(dna): return sorted(Counter(dna).items()) def seq_split(dna, n=50): return [dna[i: i+n] for i in range(0, len(dna), n)] def seq_pp(dna, n=50): for i, part in enumerate(seq_split(dna, n)): print(f"{i*n:>5}: {part}") print("\n BASECOUNT:") tot = 0 for base, count in basecount(dna): print(f" {base:>3}: {count}") tot += count base, count = 'TOT', tot print(f" {base:>3}= {count}") if __name__ == '__main__': print("SEQUENCE:") sequence = seq_pp(sequence)
Write the same algorithm in Python as shown in this Java implementation.
import java.util.HashMap; import java.util.Map; public class orderedSequence { public static void main(String[] args) { Sequence gene = new Sequence("CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATGCTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTGAGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGATGGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTTCGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGGTCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATATTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTATCGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTGTCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGACGACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT"); gene.runSequence(); } } public class Sequence { private final String seq; public Sequence(String sq) { this.seq = sq; } public void prettyPrint() { System.out.println("Sequence:"); int i = 0; for ( ; i < seq.length() - 50 ; i += 50) { System.out.printf("%5s : %s\n", i + 50, seq.substring(i, i + 50)); } System.out.printf("%5s : %s\n", seq.length(), seq.substring(i)); } public void displayCount() { Map<Character, Integer> counter = new HashMap<>(); for (int i = 0 ; i < seq.length() ; ++i) { counter.merge(seq.charAt(i), 1, Integer::sum); } System.out.println("Base vs. Count:"); counter.forEach( key, value -> System.out.printf("%5s : %s\n", key, value)); System.out.printf("%5s: %s\n", "SUM", seq.length()); } public void runSequence() { this.prettyPrint(); this.displayCount(); } }
from collections import Counter def basecount(dna): return sorted(Counter(dna).items()) def seq_split(dna, n=50): return [dna[i: i+n] for i in range(0, len(dna), n)] def seq_pp(dna, n=50): for i, part in enumerate(seq_split(dna, n)): print(f"{i*n:>5}: {part}") print("\n BASECOUNT:") tot = 0 for base, count in basecount(dna): print(f" {base:>3}: {count}") tot += count base, count = 'TOT', tot print(f" {base:>3}= {count}") if __name__ == '__main__': print("SEQUENCE:") sequence = seq_pp(sequence)
Generate a Python translation of this Java snippet without changing its computational steps.
package diningphilosophers; import java.util.ArrayList; import java.util.Random; import java.util.concurrent.atomic.AtomicBoolean; import java.util.concurrent.atomic.AtomicInteger; enum PhilosopherState { Get, Eat, Pon } class Fork { public static final int ON_TABLE = -1; static int instances = 0; public int id; public AtomicInteger holder = new AtomicInteger(ON_TABLE); Fork() { id = instances++; } } class Philosopher implements Runnable { static final int maxWaitMs = 100; static AtomicInteger token = new AtomicInteger(0); static int instances = 0; static Random rand = new Random(); AtomicBoolean end = new AtomicBoolean(false); int id; PhilosopherState state = PhilosopherState.Get; Fork left; Fork right; int timesEaten = 0; Philosopher() { id = instances++; left = Main.forks.get(id); right = Main.forks.get((id+1)%Main.philosopherCount); } void sleep() { try { Thread.sleep(rand.nextInt(maxWaitMs)); } catch (InterruptedException ex) {} } void waitForFork(Fork fork) { do { if (fork.holder.get() == Fork.ON_TABLE) { fork.holder.set(id); return; } else { sleep(); } } while (true); } public void run() { do { if (state == PhilosopherState.Pon) { state = PhilosopherState.Get; } else { if (token.get() == id) { waitForFork(left); waitForFork(right); token.set((id+2)% Main.philosopherCount); state = PhilosopherState.Eat; timesEaten++; sleep(); left.holder.set(Fork.ON_TABLE); right.holder.set(Fork.ON_TABLE); state = PhilosopherState.Pon; sleep(); } else { sleep(); } } } while (!end.get()); } } public class Main { static final int philosopherCount = 5; static final int runSeconds = 15; static ArrayList<Fork> forks = new ArrayList<Fork>(); static ArrayList<Philosopher> philosophers = new ArrayList<Philosopher>(); public static void main(String[] args) { for (int i = 0 ; i < philosopherCount ; i++) forks.add(new Fork()); for (int i = 0 ; i < philosopherCount ; i++) philosophers.add(new Philosopher()); for (Philosopher p : philosophers) new Thread(p).start(); long endTime = System.currentTimeMillis() + (runSeconds * 1000); do { StringBuilder sb = new StringBuilder("|"); for (Philosopher p : philosophers) { sb.append(p.state.toString()); sb.append("|"); } sb.append(" |"); for (Fork f : forks) { int holder = f.holder.get(); sb.append(holder==-1?" ":String.format("P%02d",holder)); sb.append("|"); } System.out.println(sb.toString()); try {Thread.sleep(1000);} catch (Exception ex) {} } while (System.currentTimeMillis() < endTime); for (Philosopher p : philosophers) p.end.set(true); for (Philosopher p : philosophers) System.out.printf("P%02d: ate %,d times, %,d/sec\n", p.id, p.timesEaten, p.timesEaten/runSeconds); } }
import threading import random import time class Philosopher(threading.Thread): running = True def __init__(self, xname, forkOnLeft, forkOnRight): threading.Thread.__init__(self) self.name = xname self.forkOnLeft = forkOnLeft self.forkOnRight = forkOnRight def run(self): while(self.running): time.sleep( random.uniform(3,13)) print '%s is hungry.' % self.name self.dine() def dine(self): fork1, fork2 = self.forkOnLeft, self.forkOnRight while self.running: fork1.acquire(True) locked = fork2.acquire(False) if locked: break fork1.release() print '%s swaps forks' % self.name fork1, fork2 = fork2, fork1 else: return self.dining() fork2.release() fork1.release() def dining(self): print '%s starts eating '% self.name time.sleep(random.uniform(1,10)) print '%s finishes eating and leaves to think.' % self.name def DiningPhilosophers(): forks = [threading.Lock() for n in range(5)] philosopherNames = ('Aristotle','Kant','Spinoza','Marx', 'Russel') philosophers= [Philosopher(philosopherNames[i], forks[i%5], forks[(i+1)%5]) \ for i in range(5)] random.seed(507129) Philosopher.running = True for p in philosophers: p.start() time.sleep(100) Philosopher.running = False print ("Now we're finishing.") DiningPhilosophers()
Rewrite this program in Python while keeping its functionality equivalent to the Java version.
public class Factorion { public static void main(String [] args){ System.out.println("Base 9:"); for(int i = 1; i <= 1499999; i++){ String iStri = String.valueOf(i); int multiplied = operate(iStri,9); if(multiplied == i){ System.out.print(i + "\t"); } } System.out.println("\nBase 10:"); for(int i = 1; i <= 1499999; i++){ String iStri = String.valueOf(i); int multiplied = operate(iStri,10); if(multiplied == i){ System.out.print(i + "\t"); } } System.out.println("\nBase 11:"); for(int i = 1; i <= 1499999; i++){ String iStri = String.valueOf(i); int multiplied = operate(iStri,11); if(multiplied == i){ System.out.print(i + "\t"); } } System.out.println("\nBase 12:"); for(int i = 1; i <= 1499999; i++){ String iStri = String.valueOf(i); int multiplied = operate(iStri,12); if(multiplied == i){ System.out.print(i + "\t"); } } } public static int factorialRec(int n){ int result = 1; return n == 0 ? result : result * n * factorialRec(n-1); } public static int operate(String s, int base){ int sum = 0; String strx = fromDeci(base, Integer.parseInt(s)); for(int i = 0; i < strx.length(); i++){ if(strx.charAt(i) == 'A'){ sum += factorialRec(10); }else if(strx.charAt(i) == 'B') { sum += factorialRec(11); }else if(strx.charAt(i) == 'C') { sum += factorialRec(12); }else { sum += factorialRec(Integer.parseInt(String.valueOf(strx.charAt(i)), base)); } } return sum; } static char reVal(int num) { if (num >= 0 && num <= 9) return (char)(num + 48); else return (char)(num - 10 + 65); } static String fromDeci(int base, int num){ StringBuilder s = new StringBuilder(); while (num > 0) { s.append(reVal(num % base)); num /= base; } return new String(new StringBuilder(s).reverse()); } }
fact = [1] for n in range(1, 12): fact.append(fact[n-1] * n) for b in range(9, 12+1): print(f"The factorions for base {b} are:") for i in range(1, 1500000): fact_sum = 0 j = i while j > 0: d = j % b fact_sum += fact[d] j = j//b if fact_sum == i: print(i, end=" ") print("\n")
Change the following Java code into Python without altering its purpose.
public class Factorion { public static void main(String [] args){ System.out.println("Base 9:"); for(int i = 1; i <= 1499999; i++){ String iStri = String.valueOf(i); int multiplied = operate(iStri,9); if(multiplied == i){ System.out.print(i + "\t"); } } System.out.println("\nBase 10:"); for(int i = 1; i <= 1499999; i++){ String iStri = String.valueOf(i); int multiplied = operate(iStri,10); if(multiplied == i){ System.out.print(i + "\t"); } } System.out.println("\nBase 11:"); for(int i = 1; i <= 1499999; i++){ String iStri = String.valueOf(i); int multiplied = operate(iStri,11); if(multiplied == i){ System.out.print(i + "\t"); } } System.out.println("\nBase 12:"); for(int i = 1; i <= 1499999; i++){ String iStri = String.valueOf(i); int multiplied = operate(iStri,12); if(multiplied == i){ System.out.print(i + "\t"); } } } public static int factorialRec(int n){ int result = 1; return n == 0 ? result : result * n * factorialRec(n-1); } public static int operate(String s, int base){ int sum = 0; String strx = fromDeci(base, Integer.parseInt(s)); for(int i = 0; i < strx.length(); i++){ if(strx.charAt(i) == 'A'){ sum += factorialRec(10); }else if(strx.charAt(i) == 'B') { sum += factorialRec(11); }else if(strx.charAt(i) == 'C') { sum += factorialRec(12); }else { sum += factorialRec(Integer.parseInt(String.valueOf(strx.charAt(i)), base)); } } return sum; } static char reVal(int num) { if (num >= 0 && num <= 9) return (char)(num + 48); else return (char)(num - 10 + 65); } static String fromDeci(int base, int num){ StringBuilder s = new StringBuilder(); while (num > 0) { s.append(reVal(num % base)); num /= base; } return new String(new StringBuilder(s).reverse()); } }
fact = [1] for n in range(1, 12): fact.append(fact[n-1] * n) for b in range(9, 12+1): print(f"The factorions for base {b} are:") for i in range(1, 1500000): fact_sum = 0 j = i while j > 0: d = j % b fact_sum += fact[d] j = j//b if fact_sum == i: print(i, end=" ") print("\n")
Rewrite this program in Python while keeping its functionality equivalent to the Java version.
import java.util.List; import java.util.function.Function; public class LogisticCurveFitting { private static final double K = 7.8e9; private static final int N0 = 27; private static final List<Double> ACTUAL = List.of( 27.0, 27.0, 27.0, 44.0, 44.0, 59.0, 59.0, 59.0, 59.0, 59.0, 59.0, 59.0, 59.0, 60.0, 60.0, 61.0, 61.0, 66.0, 83.0, 219.0, 239.0, 392.0, 534.0, 631.0, 897.0, 1350.0, 2023.0, 2820.0, 4587.0, 6067.0, 7823.0, 9826.0, 11946.0, 14554.0, 17372.0, 20615.0, 24522.0, 28273.0, 31491.0, 34933.0, 37552.0, 40540.0, 43105.0, 45177.0, 60328.0, 64543.0, 67103.0, 69265.0, 71332.0, 73327.0, 75191.0, 75723.0, 76719.0, 77804.0, 78812.0, 79339.0, 80132.0, 80995.0, 82101.0, 83365.0, 85203.0, 87024.0, 89068.0, 90664.0, 93077.0, 95316.0, 98172.0, 102133.0, 105824.0, 109695.0, 114232.0, 118610.0, 125497.0, 133852.0, 143227.0, 151367.0, 167418.0, 180096.0, 194836.0, 213150.0, 242364.0, 271106.0, 305117.0, 338133.0, 377918.0, 416845.0, 468049.0, 527767.0, 591704.0, 656866.0, 715353.0, 777796.0, 851308.0, 928436.0, 1000249.0, 1082054.0, 1174652.0 ); private static double f(double r) { var sq = 0.0; var len = ACTUAL.size(); for (int i = 0; i < len; i++) { var eri = Math.exp(r * i); var guess = (N0 * eri) / (1.0 + N0 * (eri - 1.0) / K); var diff = guess - ACTUAL.get(i); sq += diff * diff; } return sq; } private static double solve(Function<Double, Double> fn) { return solve(fn, 0.5, 0.0); } private static double solve(Function<Double, Double> fn, double guess, double epsilon) { double delta; if (guess != 0.0) { delta = guess; } else { delta = 1.0; } var f0 = fn.apply(guess); var factor = 2.0; while (delta > epsilon && guess != guess - delta) { var nf = fn.apply(guess - delta); if (nf < f0) { f0 = nf; guess -= delta; } else { nf = fn.apply(guess + delta); if (nf < f0) { f0 = nf; guess += delta; } else { factor = 0.5; } } delta *= factor; } return guess; } public static void main(String[] args) { var r = solve(LogisticCurveFitting::f); var r0 = Math.exp(12.0 * r); System.out.printf("r = %.16f, R0 = %.16f\n", r, r0); } }
import numpy as np import scipy.optimize as opt n0, K = 27, 7_800_000_000 def f(t, r): return (n0 * np.exp(r * t)) / (( 1 + n0 * (np.exp(r * t) - 1) / K)) y = [ 27, 27, 27, 44, 44, 59, 59, 59, 59, 59, 59, 59, 59, 60, 60, 61, 61, 66, 83, 219, 239, 392, 534, 631, 897, 1350, 2023, 2820, 4587, 6067, 7823, 9826, 11946, 14554, 17372, 20615, 24522, 28273, 31491, 34933, 37552, 40540, 43105, 45177, 60328, 64543, 67103, 69265, 71332, 73327, 75191, 75723, 76719, 77804, 78812, 79339, 80132, 80995, 82101, 83365, 85203, 87024, 89068, 90664, 93077, 95316, 98172, 102133, 105824, 109695, 114232, 118610, 125497, 133852, 143227, 151367, 167418, 180096, 194836, 213150, 242364, 271106, 305117, 338133, 377918, 416845, 468049, 527767, 591704, 656866, 715353, 777796, 851308, 928436, 1000249, 1082054, 1174652, ] x = np.linspace(0.0, 96, 97) r, cov = opt.curve_fit(f, x, y, [0.5]) print("The r for the world Covid-19 data is:", r, ", with covariance of", cov) print("The calculated R0 is then", np.exp(12 * r))
Change the programming language of this snippet from Java to Python without modifying what it does.
import java.util.Arrays; import java.util.LinkedList; public class Strand{ public static <E extends Comparable<? super E>> LinkedList<E> strandSort(LinkedList<E> list){ if(list.size() <= 1) return list; LinkedList<E> result = new LinkedList<E>(); while(list.size() > 0){ LinkedList<E> sorted = new LinkedList<E>(); sorted.add(list.removeFirst()); for(Iterator<E> it = list.iterator(); it.hasNext(); ){ E elem = it.next(); if(sorted.peekLast().compareTo(elem) <= 0){ sorted.addLast(elem); it.remove(); } } result = merge(sorted, result); } return result; } private static <E extends Comparable<? super E>> LinkedList<E> merge(LinkedList<E> left, LinkedList<E> right){ LinkedList<E> result = new LinkedList<E>(); while(!left.isEmpty() && !right.isEmpty()){ if(left.peek().compareTo(right.peek()) <= 0) result.add(left.remove()); else result.add(right.remove()); } result.addAll(left); result.addAll(right); return result; } public static void main(String[] args){ System.out.println(strandSort(new LinkedList<Integer>(Arrays.asList(3,1,2,4,5)))); System.out.println(strandSort(new LinkedList<Integer>(Arrays.asList(3,3,1,2,4,5)))); System.out.println(strandSort(new LinkedList<Integer>(Arrays.asList(3,3,1,2,4,3,5,6)))); } }
def merge_list(a, b): out = [] while len(a) and len(b): if a[0] < b[0]: out.append(a.pop(0)) else: out.append(b.pop(0)) out += a out += b return out def strand(a): i, s = 0, [a.pop(0)] while i < len(a): if a[i] > s[-1]: s.append(a.pop(i)) else: i += 1 return s def strand_sort(a): out = strand(a) while len(a): out = merge_list(out, strand(a)) return out print strand_sort([1, 6, 3, 2, 1, 7, 5, 3])
Change the programming language of this snippet from Java to Python without modifying what it does.
public class additivePrimes { public static void main(String[] args) { int additive_primes = 0; for (int i = 2; i < 500; i++) { if(isPrime(i) && isPrime(digitSum(i))){ additive_primes++; System.out.print(i + " "); } } System.out.print("\nFound " + additive_primes + " additive primes less than 500"); } static boolean isPrime(int n) { int counter = 1; if (n < 2 || (n != 2 && n % 2 == 0) || (n != 3 && n % 3 == 0)) { return false; } while (counter * 6 - 1 <= Math.sqrt(n)) { if (n % (counter * 6 - 1) == 0 || n % (counter * 6 + 1) == 0) { return false; } else { counter++; } } return true; } static int digitSum(int n) { int sum = 0; while (n > 0) { sum += n % 10; n /= 10; } return sum; } }
def is_prime(n: int) -> bool: if n <= 3: return n > 1 if n % 2 == 0 or n % 3 == 0: return False i = 5 while i ** 2 <= n: if n % i == 0 or n % (i + 2) == 0: return False i += 6 return True def digit_sum(n: int) -> int: sum = 0 while n > 0: sum += n % 10 n //= 10 return sum def main() -> None: additive_primes = 0 for i in range(2, 500): if is_prime(i) and is_prime(digit_sum(i)): additive_primes += 1 print(i, end=" ") print(f"\nFound {additive_primes} additive primes less than 500") if __name__ == "__main__": main()
Generate an equivalent Python version of this Java code.
import java.util.ArrayList; import java.util.List; public class PerfectTotientNumbers { public static void main(String[] args) { computePhi(); int n = 20; System.out.printf("The first %d perfect totient numbers:%n%s%n", n, perfectTotient(n)); } private static final List<Integer> perfectTotient(int n) { int test = 2; List<Integer> results = new ArrayList<Integer>(); for ( int i = 0 ; i < n ; test++ ) { int phiLoop = test; int sum = 0; do { phiLoop = phi[phiLoop]; sum += phiLoop; } while ( phiLoop > 1); if ( sum == test ) { i++; results.add(test); } } return results; } private static final int max = 100000; private static final int[] phi = new int[max+1]; private static final void computePhi() { for ( int i = 1 ; i <= max ; i++ ) { phi[i] = i; } for ( int i = 2 ; i <= max ; i++ ) { if (phi[i] < i) continue; for ( int j = i ; j <= max ; j += i ) { phi[j] -= phi[j] / i; } } } }
from math import gcd from functools import lru_cache from itertools import islice, count @lru_cache(maxsize=None) def φ(n): return sum(1 for k in range(1, n + 1) if gcd(n, k) == 1) def perfect_totient(): for n0 in count(1): parts, n = 0, n0 while n != 1: n = φ(n) parts += n if parts == n0: yield n0 if __name__ == '__main__': print(list(islice(perfect_totient(), 20)))
Port the following code from Java to Python with equivalent syntax and logic.
import java.util.ArrayList; import java.util.List; public class PerfectTotientNumbers { public static void main(String[] args) { computePhi(); int n = 20; System.out.printf("The first %d perfect totient numbers:%n%s%n", n, perfectTotient(n)); } private static final List<Integer> perfectTotient(int n) { int test = 2; List<Integer> results = new ArrayList<Integer>(); for ( int i = 0 ; i < n ; test++ ) { int phiLoop = test; int sum = 0; do { phiLoop = phi[phiLoop]; sum += phiLoop; } while ( phiLoop > 1); if ( sum == test ) { i++; results.add(test); } } return results; } private static final int max = 100000; private static final int[] phi = new int[max+1]; private static final void computePhi() { for ( int i = 1 ; i <= max ; i++ ) { phi[i] = i; } for ( int i = 2 ; i <= max ; i++ ) { if (phi[i] < i) continue; for ( int j = i ; j <= max ; j += i ) { phi[j] -= phi[j] / i; } } } }
from math import gcd from functools import lru_cache from itertools import islice, count @lru_cache(maxsize=None) def φ(n): return sum(1 for k in range(1, n + 1) if gcd(n, k) == 1) def perfect_totient(): for n0 in count(1): parts, n = 0, n0 while n != 1: n = φ(n) parts += n if parts == n0: yield n0 if __name__ == '__main__': print(list(islice(perfect_totient(), 20)))
Transform the following Java implementation into Python, maintaining the same output and logic.
interface Thingable { String thing(); } class Delegator { public Thingable delegate; public String operation() { if (delegate == null) return "default implementation"; else return delegate.thing(); } } class Delegate implements Thingable { public String thing() { return "delegate implementation"; } } public class DelegateExample { public static void main(String[] args) { Delegator a = new Delegator(); assert a.operation().equals("default implementation"); Delegate d = new Delegate(); a.delegate = d; assert a.operation().equals("delegate implementation"); a.delegate = new Thingable() { public String thing() { return "anonymous delegate implementation"; } }; assert a.operation().equals("anonymous delegate implementation"); } }
class Delegator: def __init__(self): self.delegate = None def operation(self): if hasattr(self.delegate, 'thing') and callable(self.delegate.thing): return self.delegate.thing() return 'default implementation' class Delegate: def thing(self): return 'delegate implementation' if __name__ == '__main__': a = Delegator() assert a.operation() == 'default implementation' a.delegate = 'A delegate may be any object' assert a.operation() == 'default implementation' a.delegate = Delegate() assert a.operation() == 'delegate implementation'
Please provide an equivalent version of this Java code in Python.
public class DivisorSum { private static long divisorSum(long n) { var total = 1L; var power = 2L; for (; (n & 1) == 0; power <<= 1, n >>= 1) { total += power; } for (long p = 3; p * p <= n; p += 2) { long sum = 1; for (power = p; n % p == 0; power *= p, n /= p) { sum += power; } total *= sum; } if (n > 1) { total *= n + 1; } return total; } public static void main(String[] args) { final long limit = 100; System.out.printf("Sum of divisors for the first %d positive integers:%n", limit); for (long n = 1; n <= limit; ++n) { System.out.printf("%4d", divisorSum(n)); if (n % 10 == 0) { System.out.println(); } } } }
def factorize(n): assert(isinstance(n, int)) if n < 0: n = -n if n < 2: return k = 0 while 0 == n%2: k += 1 n //= 2 if 0 < k: yield (2,k) p = 3 while p*p <= n: k = 0 while 0 == n%p: k += 1 n //= p if 0 < k: yield (p,k) p += 2 if 1 < n: yield (n,1) def sum_of_divisors(n): assert(n != 0) ans = 1 for (p,k) in factorize(n): ans *= (pow(p,k+1) - 1)//(p-1) return ans if __name__ == "__main__": print([sum_of_divisors(n) for n in range(1,101)])
Write the same code in Python as shown below in Java.
public class DivisorSum { private static long divisorSum(long n) { var total = 1L; var power = 2L; for (; (n & 1) == 0; power <<= 1, n >>= 1) { total += power; } for (long p = 3; p * p <= n; p += 2) { long sum = 1; for (power = p; n % p == 0; power *= p, n /= p) { sum += power; } total *= sum; } if (n > 1) { total *= n + 1; } return total; } public static void main(String[] args) { final long limit = 100; System.out.printf("Sum of divisors for the first %d positive integers:%n", limit); for (long n = 1; n <= limit; ++n) { System.out.printf("%4d", divisorSum(n)); if (n % 10 == 0) { System.out.println(); } } } }
def factorize(n): assert(isinstance(n, int)) if n < 0: n = -n if n < 2: return k = 0 while 0 == n%2: k += 1 n //= 2 if 0 < k: yield (2,k) p = 3 while p*p <= n: k = 0 while 0 == n%p: k += 1 n //= p if 0 < k: yield (p,k) p += 2 if 1 < n: yield (n,1) def sum_of_divisors(n): assert(n != 0) ans = 1 for (p,k) in factorize(n): ans *= (pow(p,k+1) - 1)//(p-1) return ans if __name__ == "__main__": print([sum_of_divisors(n) for n in range(1,101)])
Write a version of this Java function in Python with identical behavior.
public class DivisorSum { private static long divisorSum(long n) { var total = 1L; var power = 2L; for (; (n & 1) == 0; power <<= 1, n >>= 1) { total += power; } for (long p = 3; p * p <= n; p += 2) { long sum = 1; for (power = p; n % p == 0; power *= p, n /= p) { sum += power; } total *= sum; } if (n > 1) { total *= n + 1; } return total; } public static void main(String[] args) { final long limit = 100; System.out.printf("Sum of divisors for the first %d positive integers:%n", limit); for (long n = 1; n <= limit; ++n) { System.out.printf("%4d", divisorSum(n)); if (n % 10 == 0) { System.out.println(); } } } }
def factorize(n): assert(isinstance(n, int)) if n < 0: n = -n if n < 2: return k = 0 while 0 == n%2: k += 1 n //= 2 if 0 < k: yield (2,k) p = 3 while p*p <= n: k = 0 while 0 == n%p: k += 1 n //= p if 0 < k: yield (p,k) p += 2 if 1 < n: yield (n,1) def sum_of_divisors(n): assert(n != 0) ans = 1 for (p,k) in factorize(n): ans *= (pow(p,k+1) - 1)//(p-1) return ans if __name__ == "__main__": print([sum_of_divisors(n) for n in range(1,101)])
Can you help me rewrite this code in Python instead of Java, keeping it the same logically?
import java.util.HashMap; import java.util.Map; import java.util.Scanner; public class AbbreviationsEasy { private static final Scanner input = new Scanner(System.in); private static final String COMMAND_TABLE = " Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy\n" + " COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find\n" + " NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput\n" + " Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO\n" + " MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT\n" + " READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT\n" + " RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up"; public static void main(String[] args) { String[] cmdTableArr = COMMAND_TABLE.split("\\s+"); Map<String, Integer> cmd_table = new HashMap<String, Integer>(); for (String word : cmdTableArr) { cmd_table.put(word, countCaps(word)); } System.out.print("Please enter your command to verify: "); String userInput = input.nextLine(); String[] user_input = userInput.split("\\s+"); for (String s : user_input) { boolean match = false; for (String cmd : cmd_table.keySet()) { if (s.length() >= cmd_table.get(cmd) && s.length() <= cmd.length()) { String temp = cmd.toUpperCase(); if (temp.startsWith(s.toUpperCase())) { System.out.print(temp + " "); match = true; } } } if (!match) { System.out.print("*error* "); } } } private static int countCaps(String word) { int numCaps = 0; for (int i = 0; i < word.length(); i++) { if (Character.isUpperCase(word.charAt(i))) { numCaps++; } } return numCaps; } }
command_table_text = \ user_words = "riG rePEAT copies put mo rest types fup. 6 poweRin" def find_abbreviations_length(command_table_text): command_table = dict() for word in command_table_text.split(): abbr_len = sum(1 for c in word if c.isupper()) if abbr_len == 0: abbr_len = len(word) command_table[word] = abbr_len return command_table def find_abbreviations(command_table): abbreviations = dict() for command, min_abbr_len in command_table.items(): for l in range(min_abbr_len, len(command)+1): abbr = command[:l].lower() abbreviations[abbr] = command.upper() return abbreviations def parse_user_string(user_string, abbreviations): user_words = [word.lower() for word in user_string.split()] commands = [abbreviations.get(user_word, "*error*") for user_word in user_words] return " ".join(commands) command_table = find_abbreviations_length(command_table_text) abbreviations_table = find_abbreviations(command_table) full_words = parse_user_string(user_words, abbreviations_table) print("user words:", user_words) print("full words:", full_words)
Translate this program into Python but keep the logic exactly as in Java.
import java.util.HashMap; import java.util.Map; import java.util.Scanner; public class AbbreviationsEasy { private static final Scanner input = new Scanner(System.in); private static final String COMMAND_TABLE = " Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy\n" + " COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find\n" + " NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput\n" + " Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO\n" + " MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT\n" + " READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT\n" + " RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up"; public static void main(String[] args) { String[] cmdTableArr = COMMAND_TABLE.split("\\s+"); Map<String, Integer> cmd_table = new HashMap<String, Integer>(); for (String word : cmdTableArr) { cmd_table.put(word, countCaps(word)); } System.out.print("Please enter your command to verify: "); String userInput = input.nextLine(); String[] user_input = userInput.split("\\s+"); for (String s : user_input) { boolean match = false; for (String cmd : cmd_table.keySet()) { if (s.length() >= cmd_table.get(cmd) && s.length() <= cmd.length()) { String temp = cmd.toUpperCase(); if (temp.startsWith(s.toUpperCase())) { System.out.print(temp + " "); match = true; } } } if (!match) { System.out.print("*error* "); } } } private static int countCaps(String word) { int numCaps = 0; for (int i = 0; i < word.length(); i++) { if (Character.isUpperCase(word.charAt(i))) { numCaps++; } } return numCaps; } }
command_table_text = \ user_words = "riG rePEAT copies put mo rest types fup. 6 poweRin" def find_abbreviations_length(command_table_text): command_table = dict() for word in command_table_text.split(): abbr_len = sum(1 for c in word if c.isupper()) if abbr_len == 0: abbr_len = len(word) command_table[word] = abbr_len return command_table def find_abbreviations(command_table): abbreviations = dict() for command, min_abbr_len in command_table.items(): for l in range(min_abbr_len, len(command)+1): abbr = command[:l].lower() abbreviations[abbr] = command.upper() return abbreviations def parse_user_string(user_string, abbreviations): user_words = [word.lower() for word in user_string.split()] commands = [abbreviations.get(user_word, "*error*") for user_word in user_words] return " ".join(commands) command_table = find_abbreviations_length(command_table_text) abbreviations_table = find_abbreviations(command_table) full_words = parse_user_string(user_words, abbreviations_table) print("user words:", user_words) print("full words:", full_words)
Ensure the translated Python code behaves exactly like the original Java snippet.
final int immutableInt = 4; int mutableInt = 4; mutableInt = 6; immutableInt = 6;
>>> s = "Hello" >>> s[0] = "h" Traceback (most recent call last): File "<pyshell s[0] = "h" TypeError: 'str' object does not support item assignment
Produce a language-to-language conversion: from Java to Python, same semantics.
import java.awt.*; import java.awt.geom.Line2D; import java.util.*; import java.util.List; import javax.swing.*; public class SutherlandHodgman extends JFrame { SutherlandHodgmanPanel panel; public static void main(String[] args) { JFrame f = new SutherlandHodgman(); f.setDefaultCloseOperation(JFrame.EXIT_ON_CLOSE); f.setVisible(true); } public SutherlandHodgman() { Container content = getContentPane(); content.setLayout(new BorderLayout()); panel = new SutherlandHodgmanPanel(); content.add(panel, BorderLayout.CENTER); setTitle("SutherlandHodgman"); pack(); setLocationRelativeTo(null); } } class SutherlandHodgmanPanel extends JPanel { List<double[]> subject, clipper, result; public SutherlandHodgmanPanel() { setPreferredSize(new Dimension(600, 500)); double[][] subjPoints = {{50, 150}, {200, 50}, {350, 150}, {350, 300}, {250, 300}, {200, 250}, {150, 350}, {100, 250}, {100, 200}}; double[][] clipPoints = {{100, 100}, {300, 100}, {300, 300}, {100, 300}}; subject = new ArrayList<>(Arrays.asList(subjPoints)); result = new ArrayList<>(subject); clipper = new ArrayList<>(Arrays.asList(clipPoints)); clipPolygon(); } private void clipPolygon() { int len = clipper.size(); for (int i = 0; i < len; i++) { int len2 = result.size(); List<double[]> input = result; result = new ArrayList<>(len2); double[] A = clipper.get((i + len - 1) % len); double[] B = clipper.get(i); for (int j = 0; j < len2; j++) { double[] P = input.get((j + len2 - 1) % len2); double[] Q = input.get(j); if (isInside(A, B, Q)) { if (!isInside(A, B, P)) result.add(intersection(A, B, P, Q)); result.add(Q); } else if (isInside(A, B, P)) result.add(intersection(A, B, P, Q)); } } } private boolean isInside(double[] a, double[] b, double[] c) { return (a[0] - c[0]) * (b[1] - c[1]) > (a[1] - c[1]) * (b[0] - c[0]); } private double[] intersection(double[] a, double[] b, double[] p, double[] q) { double A1 = b[1] - a[1]; double B1 = a[0] - b[0]; double C1 = A1 * a[0] + B1 * a[1]; double A2 = q[1] - p[1]; double B2 = p[0] - q[0]; double C2 = A2 * p[0] + B2 * p[1]; double det = A1 * B2 - A2 * B1; double x = (B2 * C1 - B1 * C2) / det; double y = (A1 * C2 - A2 * C1) / det; return new double[]{x, y}; } @Override public void paintComponent(Graphics g) { super.paintComponent(g); Graphics2D g2 = (Graphics2D) g; g2.translate(80, 60); g2.setStroke(new BasicStroke(3)); g2.setRenderingHint(RenderingHints.KEY_ANTIALIASING, RenderingHints.VALUE_ANTIALIAS_ON); drawPolygon(g2, subject, Color.blue); drawPolygon(g2, clipper, Color.red); drawPolygon(g2, result, Color.green); } private void drawPolygon(Graphics2D g2, List<double[]> points, Color color) { g2.setColor(color); int len = points.size(); Line2D line = new Line2D.Double(); for (int i = 0; i < len; i++) { double[] p1 = points.get(i); double[] p2 = points.get((i + 1) % len); line.setLine(p1[0], p1[1], p2[0], p2[1]); g2.draw(line); } } }
def clip(subjectPolygon, clipPolygon): def inside(p): return(cp2[0]-cp1[0])*(p[1]-cp1[1]) > (cp2[1]-cp1[1])*(p[0]-cp1[0]) def computeIntersection(): dc = [ cp1[0] - cp2[0], cp1[1] - cp2[1] ] dp = [ s[0] - e[0], s[1] - e[1] ] n1 = cp1[0] * cp2[1] - cp1[1] * cp2[0] n2 = s[0] * e[1] - s[1] * e[0] n3 = 1.0 / (dc[0] * dp[1] - dc[1] * dp[0]) return [(n1*dp[0] - n2*dc[0]) * n3, (n1*dp[1] - n2*dc[1]) * n3] outputList = subjectPolygon cp1 = clipPolygon[-1] for clipVertex in clipPolygon: cp2 = clipVertex inputList = outputList outputList = [] s = inputList[-1] for subjectVertex in inputList: e = subjectVertex if inside(e): if not inside(s): outputList.append(computeIntersection()) outputList.append(e) elif inside(s): outputList.append(computeIntersection()) s = e cp1 = cp2 return(outputList)
Please provide an equivalent version of this Java code in Python.
import java.util.HashMap; import java.util.Map; import java.util.Objects; public class BaconCipher { private static final Map<Character, String> codes; static { codes = new HashMap<>(); codes.putAll(Map.of( 'a', "AAAAA", 'b', "AAAAB", 'c', "AAABA", 'd', "AAABB", 'e', "AABAA", 'f', "AABAB", 'g', "AABBA", 'h', "AABBB", 'i', "ABAAA", 'j', "ABAAB" )); codes.putAll(Map.of( 'k', "ABABA", 'l', "ABABB", 'm', "ABBAA", 'n', "ABBAB", 'o', "ABBBA", 'p', "ABBBB", 'q', "BAAAA", 'r', "BAAAB", 's', "BAABA", 't', "BAABB" )); codes.putAll(Map.of( 'u', "BABAA", 'v', "BABAB", 'w', "BABBA", 'x', "BABBB", 'y', "BBAAA", 'z', "BBAAB", ' ', "BBBAA" )); } private static String encode(String plainText, String message) { String pt = plainText.toLowerCase(); StringBuilder sb = new StringBuilder(); for (char c : pt.toCharArray()) { if ('a' <= c && c <= 'z') sb.append(codes.get(c)); else sb.append(codes.get(' ')); } String et = sb.toString(); String mg = message.toLowerCase(); sb.setLength(0); int count = 0; for (char c : mg.toCharArray()) { if ('a' <= c && c <= 'z') { if (et.charAt(count) == 'A') sb.append(c); else sb.append(((char) (c - 32))); count++; if (count == et.length()) break; } else sb.append(c); } return sb.toString(); } private static String decode(String message) { StringBuilder sb = new StringBuilder(); for (char c : message.toCharArray()) { if ('a' <= c && c <= 'z') sb.append('A'); if ('A' <= c && c <= 'Z') sb.append('B'); } String et = sb.toString(); sb.setLength(0); for (int i = 0; i < et.length(); i += 5) { String quintet = et.substring(i, i + 5); Character key = codes.entrySet().stream().filter(a -> Objects.equals(a.getValue(), quintet)).findFirst().map(Map.Entry::getKey).orElse(null); sb.append(key); } return sb.toString(); } public static void main(String[] args) { String plainText = "the quick brown fox jumps over the lazy dog"; String message = "bacon's cipher is a method of steganography created by francis bacon. " + "this task is to implement a program for encryption and decryption of " + "plaintext using the simple alphabet of the baconian cipher or some " + "other kind of representation of this alphabet (make anything signify anything). " + "the baconian alphabet may optionally be extended to encode all lower " + "case characters individually and/or adding a few punctuation characters " + "such as the space."; String cipherText = encode(plainText, message); System.out.printf("Cipher text ->\n\n%s\n", cipherText); String decodedText = decode(cipherText); System.out.printf("\nHidden text ->\n\n%s\n", decodedText); } }
import string sometext = .lower() lc2bin = {ch: '{:05b}'.format(i) for i, ch in enumerate(string.ascii_lowercase + ' .')} bin2lc = {val: key for key, val in lc2bin.items()} phrase = 'Rosetta code Bacon cipher example secret phrase to encode in the capitalisation of peter pan'.lower() def to_5binary(msg): return ( ch == '1' for ch in ''.join(lc2bin.get(ch, '') for ch in msg.lower())) def encrypt(message, text): bin5 = to_5binary(message) textlist = list(text.lower()) out = [] for capitalise in bin5: while textlist: ch = textlist.pop(0) if ch.isalpha(): if capitalise: ch = ch.upper() out.append(ch) break else: out.append(ch) else: raise Exception('ERROR: Ran out of characters in sometext') return ''.join(out) + '...' def decrypt(bacontext): binary = [] bin5 = [] out = [] for ch in bacontext: if ch.isalpha(): binary.append('1' if ch.isupper() else '0') if len(binary) == 5: bin5 = ''.join(binary) out.append(bin2lc[bin5]) binary = [] return ''.join(out) print('PLAINTEXT = \n%s\n' % phrase) encrypted = encrypt(phrase, sometext) print('ENCRYPTED = \n%s\n' % encrypted) decrypted = decrypt(encrypted) print('DECRYPTED = \n%s\n' % decrypted) assert phrase == decrypted, 'Round-tripping error'
Generate a Python translation of this Java snippet without changing its computational steps.
import java.util.HashMap; import java.util.Map; import java.util.Objects; public class BaconCipher { private static final Map<Character, String> codes; static { codes = new HashMap<>(); codes.putAll(Map.of( 'a', "AAAAA", 'b', "AAAAB", 'c', "AAABA", 'd', "AAABB", 'e', "AABAA", 'f', "AABAB", 'g', "AABBA", 'h', "AABBB", 'i', "ABAAA", 'j', "ABAAB" )); codes.putAll(Map.of( 'k', "ABABA", 'l', "ABABB", 'm', "ABBAA", 'n', "ABBAB", 'o', "ABBBA", 'p', "ABBBB", 'q', "BAAAA", 'r', "BAAAB", 's', "BAABA", 't', "BAABB" )); codes.putAll(Map.of( 'u', "BABAA", 'v', "BABAB", 'w', "BABBA", 'x', "BABBB", 'y', "BBAAA", 'z', "BBAAB", ' ', "BBBAA" )); } private static String encode(String plainText, String message) { String pt = plainText.toLowerCase(); StringBuilder sb = new StringBuilder(); for (char c : pt.toCharArray()) { if ('a' <= c && c <= 'z') sb.append(codes.get(c)); else sb.append(codes.get(' ')); } String et = sb.toString(); String mg = message.toLowerCase(); sb.setLength(0); int count = 0; for (char c : mg.toCharArray()) { if ('a' <= c && c <= 'z') { if (et.charAt(count) == 'A') sb.append(c); else sb.append(((char) (c - 32))); count++; if (count == et.length()) break; } else sb.append(c); } return sb.toString(); } private static String decode(String message) { StringBuilder sb = new StringBuilder(); for (char c : message.toCharArray()) { if ('a' <= c && c <= 'z') sb.append('A'); if ('A' <= c && c <= 'Z') sb.append('B'); } String et = sb.toString(); sb.setLength(0); for (int i = 0; i < et.length(); i += 5) { String quintet = et.substring(i, i + 5); Character key = codes.entrySet().stream().filter(a -> Objects.equals(a.getValue(), quintet)).findFirst().map(Map.Entry::getKey).orElse(null); sb.append(key); } return sb.toString(); } public static void main(String[] args) { String plainText = "the quick brown fox jumps over the lazy dog"; String message = "bacon's cipher is a method of steganography created by francis bacon. " + "this task is to implement a program for encryption and decryption of " + "plaintext using the simple alphabet of the baconian cipher or some " + "other kind of representation of this alphabet (make anything signify anything). " + "the baconian alphabet may optionally be extended to encode all lower " + "case characters individually and/or adding a few punctuation characters " + "such as the space."; String cipherText = encode(plainText, message); System.out.printf("Cipher text ->\n\n%s\n", cipherText); String decodedText = decode(cipherText); System.out.printf("\nHidden text ->\n\n%s\n", decodedText); } }
import string sometext = .lower() lc2bin = {ch: '{:05b}'.format(i) for i, ch in enumerate(string.ascii_lowercase + ' .')} bin2lc = {val: key for key, val in lc2bin.items()} phrase = 'Rosetta code Bacon cipher example secret phrase to encode in the capitalisation of peter pan'.lower() def to_5binary(msg): return ( ch == '1' for ch in ''.join(lc2bin.get(ch, '') for ch in msg.lower())) def encrypt(message, text): bin5 = to_5binary(message) textlist = list(text.lower()) out = [] for capitalise in bin5: while textlist: ch = textlist.pop(0) if ch.isalpha(): if capitalise: ch = ch.upper() out.append(ch) break else: out.append(ch) else: raise Exception('ERROR: Ran out of characters in sometext') return ''.join(out) + '...' def decrypt(bacontext): binary = [] bin5 = [] out = [] for ch in bacontext: if ch.isalpha(): binary.append('1' if ch.isupper() else '0') if len(binary) == 5: bin5 = ''.join(binary) out.append(bin2lc[bin5]) binary = [] return ''.join(out) print('PLAINTEXT = \n%s\n' % phrase) encrypted = encrypt(phrase, sometext) print('ENCRYPTED = \n%s\n' % encrypted) decrypted = decrypt(encrypted) print('DECRYPTED = \n%s\n' % decrypted) assert phrase == decrypted, 'Round-tripping error'
Port the provided Java code into Python while preserving the original functionality.
public class Blah { public static void main(String[] args) { print2dArray(getSpiralArray(5)); } public static int[][] getSpiralArray(int dimension) { int[][] spiralArray = new int[dimension][dimension]; int numConcentricSquares = (int) Math.ceil((dimension) / 2.0); int j; int sideLen = dimension; int currNum = 0; for (int i = 0; i < numConcentricSquares; i++) { for (j = 0; j < sideLen; j++) { spiralArray[i][i + j] = currNum++; } for (j = 1; j < sideLen; j++) { spiralArray[i + j][dimension - 1 - i] = currNum++; } for (j = sideLen - 2; j > -1; j--) { spiralArray[dimension - 1 - i][i + j] = currNum++; } for (j = sideLen - 2; j > 0; j--) { spiralArray[i + j][i] = currNum++; } sideLen -= 2; } return spiralArray; } public static void print2dArray(int[][] array) { for (int[] row : array) { for (int elem : row) { System.out.printf("%3d", elem); } System.out.println(); } } }
def spiral(n): dx,dy = 1,0 x,y = 0,0 myarray = [[None]* n for j in range(n)] for i in xrange(n**2): myarray[x][y] = i nx,ny = x+dx, y+dy if 0<=nx<n and 0<=ny<n and myarray[nx][ny] == None: x,y = nx,ny else: dx,dy = -dy,dx x,y = x+dx, y+dy return myarray def printspiral(myarray): n = range(len(myarray)) for y in n: for x in n: print "%2i" % myarray[x][y], print printspiral(spiral(5))
Keep all operations the same but rewrite the snippet in Python.
module OptionalParameters { typedef Type<String >.Orderer as ColumnOrderer; typedef Type<String[]>.Orderer as RowOrderer; static String[][] sort(String[][] table, ColumnOrderer? orderer = Null, Int column = 0, Boolean reverse = False, ) { orderer ?:= (s1, s2) -> s1 <=> s2; ColumnOrderer byString = reverse ? ((s1, s2) -> orderer(s1, s2).reversed) : orderer; RowOrderer byColumn = (row1, row2) -> byString(row1[column], row2[column]); return table.sorted(byColumn); } void run() { String[][] table = [ ["c", "x", "i"], ["a", "y", "p"], ["b", "z", "a"], ]; show("original input", table); show("by default sort on column 0", sort(table)); show("by column 2", sort(table, column=2)); show("by column 2 reversed", sort(table, column=2, reverse=True)); } void show(String title, String[][] table) { @Inject Console console; console.print($"{title}:"); for (val row : table) { console.print($" {row}"); } console.print(); } }
>>> def printtable(data): for row in data: print ' '.join('%-5s' % ('"%s"' % cell) for cell in row) >>> import operator >>> def sorttable(table, ordering=None, column=0, reverse=False): return sorted(table, cmp=ordering, key=operator.itemgetter(column), reverse=reverse) >>> data = [["a", "b", "c"], ["", "q", "z"], ["zap", "zip", "Zot"]] >>> printtable(data) "a" "b" "c" "" "q" "z" "zap" "zip" "Zot" >>> printtable( sorttable(data) ) "" "q" "z" "a" "b" "c" "zap" "zip" "Zot" >>> printtable( sorttable(data, column=2) ) "zap" "zip" "Zot" "a" "b" "c" "" "q" "z" >>> printtable( sorttable(data, column=1) ) "a" "b" "c" "" "q" "z" "zap" "zip" "Zot" >>> printtable( sorttable(data, column=1, reverse=True) ) "zap" "zip" "Zot" "" "q" "z" "a" "b" "c" >>> printtable( sorttable(data, ordering=lambda a,b: cmp(len(b),len(a))) ) "zap" "zip" "Zot" "a" "b" "c" "" "q" "z" >>>
Convert the following code from Java to Python, ensuring the logic remains intact.
import java.awt.Color; import java.awt.Graphics; import java.awt.Graphics2D; import java.awt.geom.Ellipse2D; import java.awt.image.BufferedImage; import java.io.File; import java.io.IOException; import java.util.Random; import javax.imageio.ImageIO; import javax.swing.JFrame; public class Voronoi extends JFrame { static double p = 3; static BufferedImage I; static int px[], py[], color[], cells = 100, size = 1000; public Voronoi() { super("Voronoi Diagram"); setBounds(0, 0, size, size); setDefaultCloseOperation(EXIT_ON_CLOSE); int n = 0; Random rand = new Random(); I = new BufferedImage(size, size, BufferedImage.TYPE_INT_RGB); px = new int[cells]; py = new int[cells]; color = new int[cells]; for (int i = 0; i < cells; i++) { px[i] = rand.nextInt(size); py[i] = rand.nextInt(size); color[i] = rand.nextInt(16777215); } for (int x = 0; x < size; x++) { for (int y = 0; y < size; y++) { n = 0; for (byte i = 0; i < cells; i++) { if (distance(px[i], x, py[i], y) < distance(px[n], x, py[n], y)) { n = i; } } I.setRGB(x, y, color[n]); } } Graphics2D g = I.createGraphics(); g.setColor(Color.BLACK); for (int i = 0; i < cells; i++) { g.fill(new Ellipse2D .Double(px[i] - 2.5, py[i] - 2.5, 5, 5)); } try { ImageIO.write(I, "png", new File("voronoi.png")); } catch (IOException e) { } } public void paint(Graphics g) { g.drawImage(I, 0, 0, this); } static double distance(int x1, int x2, int y1, int y2) { double d; d = Math.sqrt((x1 - x2) * (x1 - x2) + (y1 - y2) * (y1 - y2)); return d; } public static void main(String[] args) { new Voronoi().setVisible(true); } }
def setup(): size(500, 500) generate_voronoi_diagram(width, height, 25) saveFrame("VoronoiDiagram.png") def generate_voronoi_diagram(w, h, num_cells): nx, ny, nr, ng, nb = [], [], [], [], [] for i in range(num_cells): nx.append(int(random(w))) ny.append(int(random(h))) nr.append(int(random(256))) ng.append(int(random(256))) nb.append(int(random(256))) for y in range(h): for x in range(w): dmin = dist(0, 0, w - 1, h - 1) j = -1 for i in range(num_cells): d = dist(0, 0, nx[i] - x, ny[i] - y) if d < dmin: dmin = d j = i set(x, y, color(nr[j], ng[j], nb[j]))
Produce a functionally identical Python code for the snippet given in Java.
import java.awt.Color; import java.awt.Graphics; import java.awt.Graphics2D; import java.awt.geom.Ellipse2D; import java.awt.image.BufferedImage; import java.io.File; import java.io.IOException; import java.util.Random; import javax.imageio.ImageIO; import javax.swing.JFrame; public class Voronoi extends JFrame { static double p = 3; static BufferedImage I; static int px[], py[], color[], cells = 100, size = 1000; public Voronoi() { super("Voronoi Diagram"); setBounds(0, 0, size, size); setDefaultCloseOperation(EXIT_ON_CLOSE); int n = 0; Random rand = new Random(); I = new BufferedImage(size, size, BufferedImage.TYPE_INT_RGB); px = new int[cells]; py = new int[cells]; color = new int[cells]; for (int i = 0; i < cells; i++) { px[i] = rand.nextInt(size); py[i] = rand.nextInt(size); color[i] = rand.nextInt(16777215); } for (int x = 0; x < size; x++) { for (int y = 0; y < size; y++) { n = 0; for (byte i = 0; i < cells; i++) { if (distance(px[i], x, py[i], y) < distance(px[n], x, py[n], y)) { n = i; } } I.setRGB(x, y, color[n]); } } Graphics2D g = I.createGraphics(); g.setColor(Color.BLACK); for (int i = 0; i < cells; i++) { g.fill(new Ellipse2D .Double(px[i] - 2.5, py[i] - 2.5, 5, 5)); } try { ImageIO.write(I, "png", new File("voronoi.png")); } catch (IOException e) { } } public void paint(Graphics g) { g.drawImage(I, 0, 0, this); } static double distance(int x1, int x2, int y1, int y2) { double d; d = Math.sqrt((x1 - x2) * (x1 - x2) + (y1 - y2) * (y1 - y2)); return d; } public static void main(String[] args) { new Voronoi().setVisible(true); } }
def setup(): size(500, 500) generate_voronoi_diagram(width, height, 25) saveFrame("VoronoiDiagram.png") def generate_voronoi_diagram(w, h, num_cells): nx, ny, nr, ng, nb = [], [], [], [], [] for i in range(num_cells): nx.append(int(random(w))) ny.append(int(random(h))) nr.append(int(random(256))) ng.append(int(random(256))) nb.append(int(random(256))) for y in range(h): for x in range(w): dmin = dist(0, 0, w - 1, h - 1) j = -1 for i in range(num_cells): d = dist(0, 0, nx[i] - x, ny[i] - y) if d < dmin: dmin = d j = i set(x, y, color(nr[j], ng[j], nb[j]))
Please provide an equivalent version of this Java code in Python.
public class JNIDemo { static { System.loadLibrary("JNIDemo"); } public static void main(String[] args) { System.out.println(callStrdup("Hello World!")); } private static native String callStrdup(String s); }
import ctypes libc = ctypes.CDLL("/lib/libc.so.6") libc.strcmp("abc", "def") libc.strcmp("hello", "hello")
Change the following Java code into Python without altering its purpose.
import java.util.*; class SOfN<T> { private static final Random rand = new Random(); private List<T> sample; private int i = 0; private int n; public SOfN(int _n) { n = _n; sample = new ArrayList<T>(n); } public List<T> process(T item) { if (++i <= n) { sample.add(item); } else if (rand.nextInt(i) < n) { sample.set(rand.nextInt(n), item); } return sample; } } public class AlgorithmS { public static void main(String[] args) { int[] bin = new int[10]; for (int trial = 0; trial < 100000; trial++) { SOfN<Integer> s_of_n = new SOfN<Integer>(3); for (int i = 0; i < 9; i++) s_of_n.process(i); for (int s : s_of_n.process(9)) bin[s]++; } System.out.println(Arrays.toString(bin)); } }
from random import randrange def s_of_n_creator(n): sample, i = [], 0 def s_of_n(item): nonlocal i i += 1 if i <= n: sample.append(item) elif randrange(i) < n: sample[randrange(n)] = item return sample return s_of_n if __name__ == '__main__': bin = [0]* 10 items = range(10) print("Single run samples for n = 3:") s_of_n = s_of_n_creator(3) for item in items: sample = s_of_n(item) print(" Item: %i -> sample: %s" % (item, sample)) for trial in range(100000): s_of_n = s_of_n_creator(3) for item in items: sample = s_of_n(item) for s in sample: bin[s] += 1 print("\nTest item frequencies for 100000 runs:\n ", '\n '.join("%i:%i" % x for x in enumerate(bin)))
Convert this Java block to Python, preserving its control flow and logic.
import java.util.*; class SOfN<T> { private static final Random rand = new Random(); private List<T> sample; private int i = 0; private int n; public SOfN(int _n) { n = _n; sample = new ArrayList<T>(n); } public List<T> process(T item) { if (++i <= n) { sample.add(item); } else if (rand.nextInt(i) < n) { sample.set(rand.nextInt(n), item); } return sample; } } public class AlgorithmS { public static void main(String[] args) { int[] bin = new int[10]; for (int trial = 0; trial < 100000; trial++) { SOfN<Integer> s_of_n = new SOfN<Integer>(3); for (int i = 0; i < 9; i++) s_of_n.process(i); for (int s : s_of_n.process(9)) bin[s]++; } System.out.println(Arrays.toString(bin)); } }
from random import randrange def s_of_n_creator(n): sample, i = [], 0 def s_of_n(item): nonlocal i i += 1 if i <= n: sample.append(item) elif randrange(i) < n: sample[randrange(n)] = item return sample return s_of_n if __name__ == '__main__': bin = [0]* 10 items = range(10) print("Single run samples for n = 3:") s_of_n = s_of_n_creator(3) for item in items: sample = s_of_n(item) print(" Item: %i -> sample: %s" % (item, sample)) for trial in range(100000): s_of_n = s_of_n_creator(3) for item in items: sample = s_of_n(item) for s in sample: bin[s] += 1 print("\nTest item frequencies for 100000 runs:\n ", '\n '.join("%i:%i" % x for x in enumerate(bin)))
Generate an equivalent Python version of this Java code.
import java.math.BigDecimal; import java.math.MathContext; import java.util.Arrays; import java.util.stream.LongStream; public class FaulhabersTriangle { private static final MathContext MC = new MathContext(256); private static long gcd(long a, long b) { if (b == 0) { return a; } return gcd(b, a % b); } private static class Frac implements Comparable<Frac> { private long num; private long denom; public static final Frac ZERO = new Frac(0, 1); public Frac(long n, long d) { if (d == 0) throw new IllegalArgumentException("d must not be zero"); long nn = n; long dd = d; if (nn == 0) { dd = 1; } else if (dd < 0) { nn = -nn; dd = -dd; } long g = Math.abs(gcd(nn, dd)); if (g > 1) { nn /= g; dd /= g; } num = nn; denom = dd; } public Frac plus(Frac rhs) { return new Frac(num * rhs.denom + denom * rhs.num, rhs.denom * denom); } public Frac unaryMinus() { return new Frac(-num, denom); } public Frac minus(Frac rhs) { return this.plus(rhs.unaryMinus()); } public Frac times(Frac rhs) { return new Frac(this.num * rhs.num, this.denom * rhs.denom); } @Override public int compareTo(Frac o) { double diff = toDouble() - o.toDouble(); return Double.compare(diff, 0.0); } @Override public boolean equals(Object obj) { return null != obj && obj instanceof Frac && this.compareTo((Frac) obj) == 0; } @Override public String toString() { if (denom == 1) { return Long.toString(num); } return String.format("%d/%d", num, denom); } public double toDouble() { return (double) num / denom; } public BigDecimal toBigDecimal() { return BigDecimal.valueOf(num).divide(BigDecimal.valueOf(denom), MC); } } private static Frac bernoulli(int n) { if (n < 0) throw new IllegalArgumentException("n may not be negative or zero"); Frac[] a = new Frac[n + 1]; Arrays.fill(a, Frac.ZERO); for (int m = 0; m <= n; ++m) { a[m] = new Frac(1, m + 1); for (int j = m; j >= 1; --j) { a[j - 1] = a[j - 1].minus(a[j]).times(new Frac(j, 1)); } } if (n != 1) return a[0]; return a[0].unaryMinus(); } private static long binomial(int n, int k) { if (n < 0 || k < 0 || n < k) throw new IllegalArgumentException(); if (n == 0 || k == 0) return 1; long num = LongStream.rangeClosed(k + 1, n).reduce(1, (a, b) -> a * b); long den = LongStream.rangeClosed(2, n - k).reduce(1, (acc, i) -> acc * i); return num / den; } private static Frac[] faulhaberTriangle(int p) { Frac[] coeffs = new Frac[p + 1]; Arrays.fill(coeffs, Frac.ZERO); Frac q = new Frac(1, p + 1); int sign = -1; for (int j = 0; j <= p; ++j) { sign *= -1; coeffs[p - j] = q.times(new Frac(sign, 1)).times(new Frac(binomial(p + 1, j), 1)).times(bernoulli(j)); } return coeffs; } public static void main(String[] args) { for (int i = 0; i <= 9; ++i) { Frac[] coeffs = faulhaberTriangle(i); for (Frac coeff : coeffs) { System.out.printf("%5s ", coeff); } System.out.println(); } System.out.println(); int k = 17; Frac[] cc = faulhaberTriangle(k); int n = 1000; BigDecimal nn = BigDecimal.valueOf(n); BigDecimal np = BigDecimal.ONE; BigDecimal sum = BigDecimal.ZERO; for (Frac c : cc) { np = np.multiply(nn); sum = sum.add(np.multiply(c.toBigDecimal())); } System.out.println(sum.toBigInteger()); } }
from itertools import accumulate, chain, count, islice from fractions import Fraction def faulhaberTriangle(m): def go(rs, n): def f(x, y): return Fraction(n, x) * y xs = list(map(f, islice(count(2), m), rs)) return [Fraction(1 - sum(xs), 1)] + xs return list(accumulate( [[]] + list(islice(count(0), 1 + m)), go ))[1:] def faulhaberSum(p, n): def go(x, y): return y * (n ** x) return sum( map(go, count(1), faulhaberTriangle(p)[-1]) ) def main(): fs = faulhaberTriangle(9) print( fTable(__doc__ + ':\n')(str)( compose(concat)( fmap(showRatio(3)(3)) ) )( index(fs) )(range(0, len(fs))) ) print('') print( faulhaberSum(17, 1000) ) def fTable(s): def gox(xShow): def gofx(fxShow): def gof(f): def goxs(xs): ys = [xShow(x) for x in xs] w = max(map(len, ys)) def arrowed(x, y): return y.rjust(w, ' ') + ' -> ' + ( fxShow(f(x)) ) return s + '\n' + '\n'.join( map(arrowed, xs, ys) ) return goxs return gof return gofx return gox def compose(g): return lambda f: lambda x: g(f(x)) def concat(xs): def f(ys): zs = list(chain(*ys)) return ''.join(zs) if isinstance(ys[0], str) else zs return ( f(xs) if isinstance(xs, list) else ( chain.from_iterable(xs) ) ) if xs else [] def fmap(f): def go(xs): return list(map(f, xs)) return go def index(xs): return lambda n: None if 0 > n else ( xs[n] if ( hasattr(xs, "__getitem__") ) else next(islice(xs, n, None)) ) def showRatio(m): def go(n): def f(r): d = r.denominator return str(r.numerator).rjust(m, ' ') + ( ('/' + str(d).ljust(n, ' ')) if 1 != d else ( ' ' * (1 + n) ) ) return f return go if __name__ == '__main__': main()
Port the provided Java code into Python while preserving the original functionality.
public class Arguments { public static void main(String[] args) { System.out.println("There are " + args.length + " arguments given."); for(int i = 0; i < args.length; i++) System.out.println("The argument #" + (i+1) + " is " + args[i] + " and is at index " + i); } }
import sys program_name = sys.argv[0] arguments = sys.argv[1:] count = len(arguments)
Rewrite the snippet below in Python so it works the same as the original Java code.
public class Arguments { public static void main(String[] args) { System.out.println("There are " + args.length + " arguments given."); for(int i = 0; i < args.length; i++) System.out.println("The argument #" + (i+1) + " is " + args[i] + " and is at index " + i); } }
import sys program_name = sys.argv[0] arguments = sys.argv[1:] count = len(arguments)