Instruction
stringlengths
45
106
input_code
stringlengths
1
13.7k
output_code
stringlengths
1
13.7k
Change the programming language of this snippet from C++ to Java without modifying what it does.
#include <iomanip> #include <iostream> unsigned int divisor_count(unsigned int n) { unsigned int total = 1; for (; (n & 1) == 0; n >>= 1) ++total; for (unsigned int p = 3; p * p <= n; p += 2) { unsigned int count = 1; for (; n % p == 0; n /= p) ++count; total *= count; } if (n > 1) total *= 2; return total; } int main() { const unsigned int limit = 100; std::cout << "Count of divisors for the first " << limit << " positive integers:\n"; for (unsigned int n = 1; n <= limit; ++n) { std::cout << std::setw(3) << divisor_count(n); if (n % 20 == 0) std::cout << '\n'; } }
public class TauFunction { private static long divisorCount(long n) { long total = 1; for (; (n & 1) == 0; n >>= 1) { ++total; } for (long p = 3; p * p <= n; p += 2) { long count = 1; for (; n % p == 0; n /= p) { ++count; } total *= count; } if (n > 1) { total *= 2; } return total; } public static void main(String[] args) { final int limit = 100; System.out.printf("Count of divisors for the first %d positive integers:\n", limit); for (long n = 1; n <= limit; ++n) { System.out.printf("%3d", divisorCount(n)); if (n % 20 == 0) { System.out.println(); } } } }
Ensure the translated Java code behaves exactly like the original C++ snippet.
#include <cstdint> #include <iostream> #include <sstream> #include <gmpxx.h> typedef mpz_class integer; bool is_probably_prime(const integer& n) { return mpz_probab_prime_p(n.get_mpz_t(), 25) != 0; } bool is_prime(unsigned int n) { if (n < 2) return false; if (n % 2 == 0) return n == 2; if (n % 3 == 0) return n == 3; for (unsigned int p = 5; p * p <= n; p += 4) { if (n % p == 0) return false; p += 2; if (n % p == 0) return false; } return true; } int main() { const unsigned int max = 20; integer primorial = 1; for (unsigned int p = 0, count = 0, index = 0; count < max; ++p) { if (!is_prime(p)) continue; primorial *= p; ++index; if (is_probably_prime(primorial - 1) || is_probably_prime(primorial + 1)) { if (count > 0) std::cout << ' '; std::cout << index; ++count; } } std::cout << '\n'; return 0; }
import java.math.BigInteger; public class PrimorialPrimes { final static int sieveLimit = 1550_000; static boolean[] notPrime = sieve(sieveLimit); public static void main(String[] args) { int count = 0; for (int i = 1; i < 1000_000 && count < 20; i++) { BigInteger b = primorial(i); if (b.add(BigInteger.ONE).isProbablePrime(1) || b.subtract(BigInteger.ONE).isProbablePrime(1)) { System.out.printf("%d ", i); count++; } } } static BigInteger primorial(int n) { if (n == 0) return BigInteger.ONE; BigInteger result = BigInteger.ONE; for (int i = 0; i < sieveLimit && n > 0; i++) { if (notPrime[i]) continue; result = result.multiply(BigInteger.valueOf(i)); n--; } return result; } public static boolean[] sieve(int limit) { boolean[] composite = new boolean[limit]; composite[0] = composite[1] = true; int max = (int) Math.sqrt(limit); for (int n = 2; n <= max; n++) { if (!composite[n]) { for (int k = n * n; k < limit; k += n) { composite[k] = true; } } } return composite; } }
Keep all operations the same but rewrite the snippet in Java.
#include <map> #include <string> #include <iostream> #include <iomanip> const std::string DEFAULT_DNA = "CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATG" "CTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTG" "AGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGAT" "GGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT" "CGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGG" "TCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA" "TTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTAT" "CGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTG" "TCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGAC" "GACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT"; class DnaBase { public: DnaBase(const std::string& dna = DEFAULT_DNA, int width = 50) : genome(dna), displayWidth(width) { for (auto elm : dna) { if (count.find(elm) == count.end()) count[elm] = 0; ++count[elm]; } } void viewGenome() { std::cout << "Sequence:" << std::endl; std::cout << std::endl; int limit = genome.size() / displayWidth; if (genome.size() % displayWidth != 0) ++limit; for (int i = 0; i < limit; ++i) { int beginPos = i * displayWidth; std::cout << std::setw(4) << beginPos << "  :" << std::setw(4) << genome.substr(beginPos, displayWidth) << std::endl; } std::cout << std::endl; std::cout << "Base Count" << std::endl; std::cout << "----------" << std::endl; std::cout << std::endl; int total = 0; for (auto elm : count) { std::cout << std::setw(4) << elm.first << " : " << elm.second << std::endl; total += elm.second; } std::cout << std::endl; std::cout << "Total: " << total << std::endl; } private: std::string genome; std::map<char, int> count; int displayWidth; }; int main(void) { auto d = new DnaBase(); d->viewGenome(); delete d; return 0; }
import java.util.HashMap; import java.util.Map; public class orderedSequence { public static void main(String[] args) { Sequence gene = new Sequence("CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATGCTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTGAGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGATGGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTTCGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGGTCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATATTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTATCGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTGTCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGACGACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT"); gene.runSequence(); } } public class Sequence { private final String seq; public Sequence(String sq) { this.seq = sq; } public void prettyPrint() { System.out.println("Sequence:"); int i = 0; for ( ; i < seq.length() - 50 ; i += 50) { System.out.printf("%5s : %s\n", i + 50, seq.substring(i, i + 50)); } System.out.printf("%5s : %s\n", seq.length(), seq.substring(i)); } public void displayCount() { Map<Character, Integer> counter = new HashMap<>(); for (int i = 0 ; i < seq.length() ; ++i) { counter.merge(seq.charAt(i), 1, Integer::sum); } System.out.println("Base vs. Count:"); counter.forEach( key, value -> System.out.printf("%5s : %s\n", key, value)); System.out.printf("%5s: %s\n", "SUM", seq.length()); } public void runSequence() { this.prettyPrint(); this.displayCount(); } }
Rewrite this program in Java while keeping its functionality equivalent to the C++ version.
#include <map> #include <string> #include <iostream> #include <iomanip> const std::string DEFAULT_DNA = "CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATG" "CTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTG" "AGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGAT" "GGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT" "CGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGG" "TCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA" "TTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTAT" "CGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTG" "TCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGAC" "GACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT"; class DnaBase { public: DnaBase(const std::string& dna = DEFAULT_DNA, int width = 50) : genome(dna), displayWidth(width) { for (auto elm : dna) { if (count.find(elm) == count.end()) count[elm] = 0; ++count[elm]; } } void viewGenome() { std::cout << "Sequence:" << std::endl; std::cout << std::endl; int limit = genome.size() / displayWidth; if (genome.size() % displayWidth != 0) ++limit; for (int i = 0; i < limit; ++i) { int beginPos = i * displayWidth; std::cout << std::setw(4) << beginPos << "  :" << std::setw(4) << genome.substr(beginPos, displayWidth) << std::endl; } std::cout << std::endl; std::cout << "Base Count" << std::endl; std::cout << "----------" << std::endl; std::cout << std::endl; int total = 0; for (auto elm : count) { std::cout << std::setw(4) << elm.first << " : " << elm.second << std::endl; total += elm.second; } std::cout << std::endl; std::cout << "Total: " << total << std::endl; } private: std::string genome; std::map<char, int> count; int displayWidth; }; int main(void) { auto d = new DnaBase(); d->viewGenome(); delete d; return 0; }
import java.util.HashMap; import java.util.Map; public class orderedSequence { public static void main(String[] args) { Sequence gene = new Sequence("CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATGCTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTGAGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGATGGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTTCGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGGTCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATATTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTATCGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTGTCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGACGACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT"); gene.runSequence(); } } public class Sequence { private final String seq; public Sequence(String sq) { this.seq = sq; } public void prettyPrint() { System.out.println("Sequence:"); int i = 0; for ( ; i < seq.length() - 50 ; i += 50) { System.out.printf("%5s : %s\n", i + 50, seq.substring(i, i + 50)); } System.out.printf("%5s : %s\n", seq.length(), seq.substring(i)); } public void displayCount() { Map<Character, Integer> counter = new HashMap<>(); for (int i = 0 ; i < seq.length() ; ++i) { counter.merge(seq.charAt(i), 1, Integer::sum); } System.out.println("Base vs. Count:"); counter.forEach( key, value -> System.out.printf("%5s : %s\n", key, value)); System.out.printf("%5s: %s\n", "SUM", seq.length()); } public void runSequence() { this.prettyPrint(); this.displayCount(); } }
Maintain the same structure and functionality when rewriting this code in Java.
#include <map> #include <string> #include <iostream> #include <iomanip> const std::string DEFAULT_DNA = "CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATG" "CTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTG" "AGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGAT" "GGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT" "CGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGG" "TCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA" "TTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTAT" "CGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTG" "TCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGAC" "GACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT"; class DnaBase { public: DnaBase(const std::string& dna = DEFAULT_DNA, int width = 50) : genome(dna), displayWidth(width) { for (auto elm : dna) { if (count.find(elm) == count.end()) count[elm] = 0; ++count[elm]; } } void viewGenome() { std::cout << "Sequence:" << std::endl; std::cout << std::endl; int limit = genome.size() / displayWidth; if (genome.size() % displayWidth != 0) ++limit; for (int i = 0; i < limit; ++i) { int beginPos = i * displayWidth; std::cout << std::setw(4) << beginPos << "  :" << std::setw(4) << genome.substr(beginPos, displayWidth) << std::endl; } std::cout << std::endl; std::cout << "Base Count" << std::endl; std::cout << "----------" << std::endl; std::cout << std::endl; int total = 0; for (auto elm : count) { std::cout << std::setw(4) << elm.first << " : " << elm.second << std::endl; total += elm.second; } std::cout << std::endl; std::cout << "Total: " << total << std::endl; } private: std::string genome; std::map<char, int> count; int displayWidth; }; int main(void) { auto d = new DnaBase(); d->viewGenome(); delete d; return 0; }
import java.util.HashMap; import java.util.Map; public class orderedSequence { public static void main(String[] args) { Sequence gene = new Sequence("CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATGCTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTGAGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGATGGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTTCGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGGTCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATATTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTATCGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTGTCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGACGACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT"); gene.runSequence(); } } public class Sequence { private final String seq; public Sequence(String sq) { this.seq = sq; } public void prettyPrint() { System.out.println("Sequence:"); int i = 0; for ( ; i < seq.length() - 50 ; i += 50) { System.out.printf("%5s : %s\n", i + 50, seq.substring(i, i + 50)); } System.out.printf("%5s : %s\n", seq.length(), seq.substring(i)); } public void displayCount() { Map<Character, Integer> counter = new HashMap<>(); for (int i = 0 ; i < seq.length() ; ++i) { counter.merge(seq.charAt(i), 1, Integer::sum); } System.out.println("Base vs. Count:"); counter.forEach( key, value -> System.out.printf("%5s : %s\n", key, value)); System.out.printf("%5s: %s\n", "SUM", seq.length()); } public void runSequence() { this.prettyPrint(); this.displayCount(); } }
Keep all operations the same but rewrite the snippet in Java.
#include <map> #include <string> #include <iostream> #include <iomanip> const std::string DEFAULT_DNA = "CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATG" "CTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTG" "AGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGAT" "GGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT" "CGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGG" "TCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA" "TTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTAT" "CGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTG" "TCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGAC" "GACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT"; class DnaBase { public: DnaBase(const std::string& dna = DEFAULT_DNA, int width = 50) : genome(dna), displayWidth(width) { for (auto elm : dna) { if (count.find(elm) == count.end()) count[elm] = 0; ++count[elm]; } } void viewGenome() { std::cout << "Sequence:" << std::endl; std::cout << std::endl; int limit = genome.size() / displayWidth; if (genome.size() % displayWidth != 0) ++limit; for (int i = 0; i < limit; ++i) { int beginPos = i * displayWidth; std::cout << std::setw(4) << beginPos << "  :" << std::setw(4) << genome.substr(beginPos, displayWidth) << std::endl; } std::cout << std::endl; std::cout << "Base Count" << std::endl; std::cout << "----------" << std::endl; std::cout << std::endl; int total = 0; for (auto elm : count) { std::cout << std::setw(4) << elm.first << " : " << elm.second << std::endl; total += elm.second; } std::cout << std::endl; std::cout << "Total: " << total << std::endl; } private: std::string genome; std::map<char, int> count; int displayWidth; }; int main(void) { auto d = new DnaBase(); d->viewGenome(); delete d; return 0; }
import java.util.HashMap; import java.util.Map; public class orderedSequence { public static void main(String[] args) { Sequence gene = new Sequence("CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATGCTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTGAGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGATGGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTTCGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGGTCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATATTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTATCGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTGTCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGACGACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT"); gene.runSequence(); } } public class Sequence { private final String seq; public Sequence(String sq) { this.seq = sq; } public void prettyPrint() { System.out.println("Sequence:"); int i = 0; for ( ; i < seq.length() - 50 ; i += 50) { System.out.printf("%5s : %s\n", i + 50, seq.substring(i, i + 50)); } System.out.printf("%5s : %s\n", seq.length(), seq.substring(i)); } public void displayCount() { Map<Character, Integer> counter = new HashMap<>(); for (int i = 0 ; i < seq.length() ; ++i) { counter.merge(seq.charAt(i), 1, Integer::sum); } System.out.println("Base vs. Count:"); counter.forEach( key, value -> System.out.printf("%5s : %s\n", key, value)); System.out.printf("%5s: %s\n", "SUM", seq.length()); } public void runSequence() { this.prettyPrint(); this.displayCount(); } }
Write the same code in Java as shown below in C++.
#include <algorithm> #include <array> #include <chrono> #include <iostream> #include <mutex> #include <random> #include <string> #include <string_view> #include <thread> const int timeScale = 42; void Message(std::string_view message) { static std::mutex cout_mutex; std::scoped_lock cout_lock(cout_mutex); std::cout << message << std::endl; } struct Fork { std::mutex mutex; }; struct Dinner { std::array<Fork, 5> forks; ~Dinner() { Message("Dinner is over"); } }; class Philosopher { std::mt19937 rng{std::random_device {}()}; const std::string name; Fork& left; Fork& right; std::thread worker; void live(); void dine(); void ponder(); public: Philosopher(std::string name_, Fork& l, Fork& r) : name(std::move(name_)), left(l), right(r), worker(&Philosopher::live, this) {} ~Philosopher() { worker.join(); Message(name + " went to sleep."); } }; void Philosopher::live() { for(;;) { { std::scoped_lock dine_lock(left.mutex, right.mutex); dine(); } ponder(); } } void Philosopher::dine() { Message(name + " started eating."); thread_local std::array<const char*, 3> foods {"chicken", "rice", "soda"}; thread_local std::array<const char*, 3> reactions { "I like this %s!", "This %s is good.", "Mmm, %s..." }; thread_local std::uniform_int_distribution<> dist(1, 6); std::shuffle( foods.begin(), foods.end(), rng); std::shuffle(reactions.begin(), reactions.end(), rng); constexpr size_t buf_size = 64; char buffer[buf_size]; for(int i = 0; i < 3; ++i) { std::this_thread::sleep_for(std::chrono::milliseconds(dist(rng) * timeScale)); snprintf(buffer, buf_size, reactions[i], foods[i]); Message(name + ": " + buffer); } std::this_thread::sleep_for(std::chrono::milliseconds(dist(rng)) * timeScale); Message(name + " finished and left."); } void Philosopher::ponder() { static constexpr std::array<const char*, 5> topics {{ "politics", "art", "meaning of life", "source of morality", "how many straws makes a bale" }}; thread_local std::uniform_int_distribution<> wait(1, 6); thread_local std::uniform_int_distribution<> dist(0, topics.size() - 1); while(dist(rng) > 0) { std::this_thread::sleep_for(std::chrono::milliseconds(wait(rng) * 3 * timeScale)); Message(name + " is pondering about " + topics[dist(rng)] + "."); } std::this_thread::sleep_for(std::chrono::milliseconds(wait(rng) * 3 * timeScale)); Message(name + " is hungry again!"); } int main() { Dinner dinner; Message("Dinner started!"); std::array<Philosopher, 5> philosophers {{ {"Aristotle", dinner.forks[0], dinner.forks[1]}, {"Democritus", dinner.forks[1], dinner.forks[2]}, {"Plato", dinner.forks[2], dinner.forks[3]}, {"Pythagoras", dinner.forks[3], dinner.forks[4]}, {"Socrates", dinner.forks[4], dinner.forks[0]}, }}; Message("It is dark outside..."); }
package diningphilosophers; import java.util.ArrayList; import java.util.Random; import java.util.concurrent.atomic.AtomicBoolean; import java.util.concurrent.atomic.AtomicInteger; enum PhilosopherState { Get, Eat, Pon } class Fork { public static final int ON_TABLE = -1; static int instances = 0; public int id; public AtomicInteger holder = new AtomicInteger(ON_TABLE); Fork() { id = instances++; } } class Philosopher implements Runnable { static final int maxWaitMs = 100; static AtomicInteger token = new AtomicInteger(0); static int instances = 0; static Random rand = new Random(); AtomicBoolean end = new AtomicBoolean(false); int id; PhilosopherState state = PhilosopherState.Get; Fork left; Fork right; int timesEaten = 0; Philosopher() { id = instances++; left = Main.forks.get(id); right = Main.forks.get((id+1)%Main.philosopherCount); } void sleep() { try { Thread.sleep(rand.nextInt(maxWaitMs)); } catch (InterruptedException ex) {} } void waitForFork(Fork fork) { do { if (fork.holder.get() == Fork.ON_TABLE) { fork.holder.set(id); return; } else { sleep(); } } while (true); } public void run() { do { if (state == PhilosopherState.Pon) { state = PhilosopherState.Get; } else { if (token.get() == id) { waitForFork(left); waitForFork(right); token.set((id+2)% Main.philosopherCount); state = PhilosopherState.Eat; timesEaten++; sleep(); left.holder.set(Fork.ON_TABLE); right.holder.set(Fork.ON_TABLE); state = PhilosopherState.Pon; sleep(); } else { sleep(); } } } while (!end.get()); } } public class Main { static final int philosopherCount = 5; static final int runSeconds = 15; static ArrayList<Fork> forks = new ArrayList<Fork>(); static ArrayList<Philosopher> philosophers = new ArrayList<Philosopher>(); public static void main(String[] args) { for (int i = 0 ; i < philosopherCount ; i++) forks.add(new Fork()); for (int i = 0 ; i < philosopherCount ; i++) philosophers.add(new Philosopher()); for (Philosopher p : philosophers) new Thread(p).start(); long endTime = System.currentTimeMillis() + (runSeconds * 1000); do { StringBuilder sb = new StringBuilder("|"); for (Philosopher p : philosophers) { sb.append(p.state.toString()); sb.append("|"); } sb.append(" |"); for (Fork f : forks) { int holder = f.holder.get(); sb.append(holder==-1?" ":String.format("P%02d",holder)); sb.append("|"); } System.out.println(sb.toString()); try {Thread.sleep(1000);} catch (Exception ex) {} } while (System.currentTimeMillis() < endTime); for (Philosopher p : philosophers) p.end.set(true); for (Philosopher p : philosophers) System.out.printf("P%02d: ate %,d times, %,d/sec\n", p.id, p.timesEaten, p.timesEaten/runSeconds); } }
Write the same algorithm in Java as shown in this C++ implementation.
#include <iostream> class factorion_t { public: factorion_t() { f[0] = 1u; for (uint n = 1u; n < 12u; n++) f[n] = f[n - 1] * n; } bool operator()(uint i, uint b) const { uint sum = 0; for (uint j = i; j > 0u; j /= b) sum += f[j % b]; return sum == i; } private: ulong f[12]; }; int main() { factorion_t factorion; for (uint b = 9u; b <= 12u; ++b) { std::cout << "factorions for base " << b << ':'; for (uint i = 1u; i < 1500000u; ++i) if (factorion(i, b)) std::cout << ' ' << i; std::cout << std::endl; } return 0; }
public class Factorion { public static void main(String [] args){ System.out.println("Base 9:"); for(int i = 1; i <= 1499999; i++){ String iStri = String.valueOf(i); int multiplied = operate(iStri,9); if(multiplied == i){ System.out.print(i + "\t"); } } System.out.println("\nBase 10:"); for(int i = 1; i <= 1499999; i++){ String iStri = String.valueOf(i); int multiplied = operate(iStri,10); if(multiplied == i){ System.out.print(i + "\t"); } } System.out.println("\nBase 11:"); for(int i = 1; i <= 1499999; i++){ String iStri = String.valueOf(i); int multiplied = operate(iStri,11); if(multiplied == i){ System.out.print(i + "\t"); } } System.out.println("\nBase 12:"); for(int i = 1; i <= 1499999; i++){ String iStri = String.valueOf(i); int multiplied = operate(iStri,12); if(multiplied == i){ System.out.print(i + "\t"); } } } public static int factorialRec(int n){ int result = 1; return n == 0 ? result : result * n * factorialRec(n-1); } public static int operate(String s, int base){ int sum = 0; String strx = fromDeci(base, Integer.parseInt(s)); for(int i = 0; i < strx.length(); i++){ if(strx.charAt(i) == 'A'){ sum += factorialRec(10); }else if(strx.charAt(i) == 'B') { sum += factorialRec(11); }else if(strx.charAt(i) == 'C') { sum += factorialRec(12); }else { sum += factorialRec(Integer.parseInt(String.valueOf(strx.charAt(i)), base)); } } return sum; } static char reVal(int num) { if (num >= 0 && num <= 9) return (char)(num + 48); else return (char)(num - 10 + 65); } static String fromDeci(int base, int num){ StringBuilder s = new StringBuilder(); while (num > 0) { s.append(reVal(num % base)); num /= base; } return new String(new StringBuilder(s).reverse()); } }
Write a version of this C++ function in Java with identical behavior.
#include <iostream> class factorion_t { public: factorion_t() { f[0] = 1u; for (uint n = 1u; n < 12u; n++) f[n] = f[n - 1] * n; } bool operator()(uint i, uint b) const { uint sum = 0; for (uint j = i; j > 0u; j /= b) sum += f[j % b]; return sum == i; } private: ulong f[12]; }; int main() { factorion_t factorion; for (uint b = 9u; b <= 12u; ++b) { std::cout << "factorions for base " << b << ':'; for (uint i = 1u; i < 1500000u; ++i) if (factorion(i, b)) std::cout << ' ' << i; std::cout << std::endl; } return 0; }
public class Factorion { public static void main(String [] args){ System.out.println("Base 9:"); for(int i = 1; i <= 1499999; i++){ String iStri = String.valueOf(i); int multiplied = operate(iStri,9); if(multiplied == i){ System.out.print(i + "\t"); } } System.out.println("\nBase 10:"); for(int i = 1; i <= 1499999; i++){ String iStri = String.valueOf(i); int multiplied = operate(iStri,10); if(multiplied == i){ System.out.print(i + "\t"); } } System.out.println("\nBase 11:"); for(int i = 1; i <= 1499999; i++){ String iStri = String.valueOf(i); int multiplied = operate(iStri,11); if(multiplied == i){ System.out.print(i + "\t"); } } System.out.println("\nBase 12:"); for(int i = 1; i <= 1499999; i++){ String iStri = String.valueOf(i); int multiplied = operate(iStri,12); if(multiplied == i){ System.out.print(i + "\t"); } } } public static int factorialRec(int n){ int result = 1; return n == 0 ? result : result * n * factorialRec(n-1); } public static int operate(String s, int base){ int sum = 0; String strx = fromDeci(base, Integer.parseInt(s)); for(int i = 0; i < strx.length(); i++){ if(strx.charAt(i) == 'A'){ sum += factorialRec(10); }else if(strx.charAt(i) == 'B') { sum += factorialRec(11); }else if(strx.charAt(i) == 'C') { sum += factorialRec(12); }else { sum += factorialRec(Integer.parseInt(String.valueOf(strx.charAt(i)), base)); } } return sum; } static char reVal(int num) { if (num >= 0 && num <= 9) return (char)(num + 48); else return (char)(num - 10 + 65); } static String fromDeci(int base, int num){ StringBuilder s = new StringBuilder(); while (num > 0) { s.append(reVal(num % base)); num /= base; } return new String(new StringBuilder(s).reverse()); } }
Produce a functionally identical Java code for the snippet given in C++.
#include <iostream> class factorion_t { public: factorion_t() { f[0] = 1u; for (uint n = 1u; n < 12u; n++) f[n] = f[n - 1] * n; } bool operator()(uint i, uint b) const { uint sum = 0; for (uint j = i; j > 0u; j /= b) sum += f[j % b]; return sum == i; } private: ulong f[12]; }; int main() { factorion_t factorion; for (uint b = 9u; b <= 12u; ++b) { std::cout << "factorions for base " << b << ':'; for (uint i = 1u; i < 1500000u; ++i) if (factorion(i, b)) std::cout << ' ' << i; std::cout << std::endl; } return 0; }
public class Factorion { public static void main(String [] args){ System.out.println("Base 9:"); for(int i = 1; i <= 1499999; i++){ String iStri = String.valueOf(i); int multiplied = operate(iStri,9); if(multiplied == i){ System.out.print(i + "\t"); } } System.out.println("\nBase 10:"); for(int i = 1; i <= 1499999; i++){ String iStri = String.valueOf(i); int multiplied = operate(iStri,10); if(multiplied == i){ System.out.print(i + "\t"); } } System.out.println("\nBase 11:"); for(int i = 1; i <= 1499999; i++){ String iStri = String.valueOf(i); int multiplied = operate(iStri,11); if(multiplied == i){ System.out.print(i + "\t"); } } System.out.println("\nBase 12:"); for(int i = 1; i <= 1499999; i++){ String iStri = String.valueOf(i); int multiplied = operate(iStri,12); if(multiplied == i){ System.out.print(i + "\t"); } } } public static int factorialRec(int n){ int result = 1; return n == 0 ? result : result * n * factorialRec(n-1); } public static int operate(String s, int base){ int sum = 0; String strx = fromDeci(base, Integer.parseInt(s)); for(int i = 0; i < strx.length(); i++){ if(strx.charAt(i) == 'A'){ sum += factorialRec(10); }else if(strx.charAt(i) == 'B') { sum += factorialRec(11); }else if(strx.charAt(i) == 'C') { sum += factorialRec(12); }else { sum += factorialRec(Integer.parseInt(String.valueOf(strx.charAt(i)), base)); } } return sum; } static char reVal(int num) { if (num >= 0 && num <= 9) return (char)(num + 48); else return (char)(num - 10 + 65); } static String fromDeci(int base, int num){ StringBuilder s = new StringBuilder(); while (num > 0) { s.append(reVal(num % base)); num /= base; } return new String(new StringBuilder(s).reverse()); } }
Keep all operations the same but rewrite the snippet in Java.
#include <cmath> #include <functional> #include <iostream> constexpr double K = 7.8e9; constexpr int n0 = 27; constexpr double actual[] = { 27, 27, 27, 44, 44, 59, 59, 59, 59, 59, 59, 59, 59, 60, 60, 61, 61, 66, 83, 219, 239, 392, 534, 631, 897, 1350, 2023, 2820, 4587, 6067, 7823, 9826, 11946, 14554, 17372, 20615, 24522, 28273, 31491, 34933, 37552, 40540, 43105, 45177, 60328, 64543, 67103, 69265, 71332, 73327, 75191, 75723, 76719, 77804, 78812, 79339, 80132, 80995, 82101, 83365, 85203, 87024, 89068, 90664, 93077, 95316, 98172, 102133, 105824, 109695, 114232, 118610, 125497, 133852, 143227, 151367, 167418, 180096, 194836, 213150, 242364, 271106, 305117, 338133, 377918, 416845, 468049, 527767, 591704, 656866, 715353, 777796, 851308, 928436, 1000249, 1082054, 1174652 }; double f(double r) { double sq = 0; constexpr size_t len = std::size(actual); for (size_t i = 0; i < len; ++i) { double eri = std::exp(r * i); double guess = (n0 * eri)/(1 + n0 * (eri - 1)/K); double diff = guess - actual[i]; sq += diff * diff; } return sq; } double solve(std::function<double(double)> fn, double guess=0.5, double epsilon=0) { for (double delta = guess ? guess : 1, f0 = fn(guess), factor = 2; delta > epsilon && guess != guess - delta; delta *= factor) { double nf = fn(guess - delta); if (nf < f0) { f0 = nf; guess -= delta; } else { nf = fn(guess + delta); if (nf < f0) { f0 = nf; guess += delta; } else factor = 0.5; } } return guess; } int main() { double r = solve(f); double R0 = std::exp(12 * r); std::cout << "r = " << r << ", R0 = " << R0 << '\n'; return 0; }
import java.util.List; import java.util.function.Function; public class LogisticCurveFitting { private static final double K = 7.8e9; private static final int N0 = 27; private static final List<Double> ACTUAL = List.of( 27.0, 27.0, 27.0, 44.0, 44.0, 59.0, 59.0, 59.0, 59.0, 59.0, 59.0, 59.0, 59.0, 60.0, 60.0, 61.0, 61.0, 66.0, 83.0, 219.0, 239.0, 392.0, 534.0, 631.0, 897.0, 1350.0, 2023.0, 2820.0, 4587.0, 6067.0, 7823.0, 9826.0, 11946.0, 14554.0, 17372.0, 20615.0, 24522.0, 28273.0, 31491.0, 34933.0, 37552.0, 40540.0, 43105.0, 45177.0, 60328.0, 64543.0, 67103.0, 69265.0, 71332.0, 73327.0, 75191.0, 75723.0, 76719.0, 77804.0, 78812.0, 79339.0, 80132.0, 80995.0, 82101.0, 83365.0, 85203.0, 87024.0, 89068.0, 90664.0, 93077.0, 95316.0, 98172.0, 102133.0, 105824.0, 109695.0, 114232.0, 118610.0, 125497.0, 133852.0, 143227.0, 151367.0, 167418.0, 180096.0, 194836.0, 213150.0, 242364.0, 271106.0, 305117.0, 338133.0, 377918.0, 416845.0, 468049.0, 527767.0, 591704.0, 656866.0, 715353.0, 777796.0, 851308.0, 928436.0, 1000249.0, 1082054.0, 1174652.0 ); private static double f(double r) { var sq = 0.0; var len = ACTUAL.size(); for (int i = 0; i < len; i++) { var eri = Math.exp(r * i); var guess = (N0 * eri) / (1.0 + N0 * (eri - 1.0) / K); var diff = guess - ACTUAL.get(i); sq += diff * diff; } return sq; } private static double solve(Function<Double, Double> fn) { return solve(fn, 0.5, 0.0); } private static double solve(Function<Double, Double> fn, double guess, double epsilon) { double delta; if (guess != 0.0) { delta = guess; } else { delta = 1.0; } var f0 = fn.apply(guess); var factor = 2.0; while (delta > epsilon && guess != guess - delta) { var nf = fn.apply(guess - delta); if (nf < f0) { f0 = nf; guess -= delta; } else { nf = fn.apply(guess + delta); if (nf < f0) { f0 = nf; guess += delta; } else { factor = 0.5; } } delta *= factor; } return guess; } public static void main(String[] args) { var r = solve(LogisticCurveFitting::f); var r0 = Math.exp(12.0 * r); System.out.printf("r = %.16f, R0 = %.16f\n", r, r0); } }
Convert this C++ block to Java, preserving its control flow and logic.
#include <list> template <typename T> std::list<T> strandSort(std::list<T> lst) { if (lst.size() <= 1) return lst; std::list<T> result; std::list<T> sorted; while (!lst.empty()) { sorted.push_back(lst.front()); lst.pop_front(); for (typename std::list<T>::iterator it = lst.begin(); it != lst.end(); ) { if (sorted.back() <= *it) { sorted.push_back(*it); it = lst.erase(it); } else it++; } result.merge(sorted); } return result; }
import java.util.Arrays; import java.util.LinkedList; public class Strand{ public static <E extends Comparable<? super E>> LinkedList<E> strandSort(LinkedList<E> list){ if(list.size() <= 1) return list; LinkedList<E> result = new LinkedList<E>(); while(list.size() > 0){ LinkedList<E> sorted = new LinkedList<E>(); sorted.add(list.removeFirst()); for(Iterator<E> it = list.iterator(); it.hasNext(); ){ E elem = it.next(); if(sorted.peekLast().compareTo(elem) <= 0){ sorted.addLast(elem); it.remove(); } } result = merge(sorted, result); } return result; } private static <E extends Comparable<? super E>> LinkedList<E> merge(LinkedList<E> left, LinkedList<E> right){ LinkedList<E> result = new LinkedList<E>(); while(!left.isEmpty() && !right.isEmpty()){ if(left.peek().compareTo(right.peek()) <= 0) result.add(left.remove()); else result.add(right.remove()); } result.addAll(left); result.addAll(right); return result; } public static void main(String[] args){ System.out.println(strandSort(new LinkedList<Integer>(Arrays.asList(3,1,2,4,5)))); System.out.println(strandSort(new LinkedList<Integer>(Arrays.asList(3,3,1,2,4,5)))); System.out.println(strandSort(new LinkedList<Integer>(Arrays.asList(3,3,1,2,4,3,5,6)))); } }
Write a version of this C++ function in Java with identical behavior.
#include <iomanip> #include <iostream> bool is_prime(unsigned int n) { if (n < 2) return false; if (n % 2 == 0) return n == 2; if (n % 3 == 0) return n == 3; for (unsigned int p = 5; p * p <= n; p += 4) { if (n % p == 0) return false; p += 2; if (n % p == 0) return false; } return true; } unsigned int digit_sum(unsigned int n) { unsigned int sum = 0; for (; n > 0; n /= 10) sum += n % 10; return sum; } int main() { const unsigned int limit = 500; std::cout << "Additive primes less than " << limit << ":\n"; unsigned int count = 0; for (unsigned int n = 1; n < limit; ++n) { if (is_prime(digit_sum(n)) && is_prime(n)) { std::cout << std::setw(3) << n; if (++count % 10 == 0) std::cout << '\n'; else std::cout << ' '; } } std::cout << '\n' << count << " additive primes found.\n"; }
public class additivePrimes { public static void main(String[] args) { int additive_primes = 0; for (int i = 2; i < 500; i++) { if(isPrime(i) && isPrime(digitSum(i))){ additive_primes++; System.out.print(i + " "); } } System.out.print("\nFound " + additive_primes + " additive primes less than 500"); } static boolean isPrime(int n) { int counter = 1; if (n < 2 || (n != 2 && n % 2 == 0) || (n != 3 && n % 3 == 0)) { return false; } while (counter * 6 - 1 <= Math.sqrt(n)) { if (n % (counter * 6 - 1) == 0 || n % (counter * 6 + 1) == 0) { return false; } else { counter++; } } return true; } static int digitSum(int n) { int sum = 0; while (n > 0) { sum += n % 10; n /= 10; } return sum; } }
Write a version of this C++ function in Java with identical behavior.
#include <cassert> #include <iostream> #include <vector> class totient_calculator { public: explicit totient_calculator(int max) : totient_(max + 1) { for (int i = 1; i <= max; ++i) totient_[i] = i; for (int i = 2; i <= max; ++i) { if (totient_[i] < i) continue; for (int j = i; j <= max; j += i) totient_[j] -= totient_[j] / i; } } int totient(int n) const { assert (n >= 1 && n < totient_.size()); return totient_[n]; } bool is_prime(int n) const { return totient(n) == n - 1; } private: std::vector<int> totient_; }; bool perfect_totient_number(const totient_calculator& tc, int n) { int sum = 0; for (int m = n; m > 1; ) { int t = tc.totient(m); sum += t; m = t; } return sum == n; } int main() { totient_calculator tc(10000); int count = 0, n = 1; std::cout << "First 20 perfect totient numbers:\n"; for (; count < 20; ++n) { if (perfect_totient_number(tc, n)) { if (count > 0) std::cout << ' '; ++count; std::cout << n; } } std::cout << '\n'; return 0; }
import java.util.ArrayList; import java.util.List; public class PerfectTotientNumbers { public static void main(String[] args) { computePhi(); int n = 20; System.out.printf("The first %d perfect totient numbers:%n%s%n", n, perfectTotient(n)); } private static final List<Integer> perfectTotient(int n) { int test = 2; List<Integer> results = new ArrayList<Integer>(); for ( int i = 0 ; i < n ; test++ ) { int phiLoop = test; int sum = 0; do { phiLoop = phi[phiLoop]; sum += phiLoop; } while ( phiLoop > 1); if ( sum == test ) { i++; results.add(test); } } return results; } private static final int max = 100000; private static final int[] phi = new int[max+1]; private static final void computePhi() { for ( int i = 1 ; i <= max ; i++ ) { phi[i] = i; } for ( int i = 2 ; i <= max ; i++ ) { if (phi[i] < i) continue; for ( int j = i ; j <= max ; j += i ) { phi[j] -= phi[j] / i; } } } }
Change the following C++ code into Java without altering its purpose.
#include <cassert> #include <iostream> #include <vector> class totient_calculator { public: explicit totient_calculator(int max) : totient_(max + 1) { for (int i = 1; i <= max; ++i) totient_[i] = i; for (int i = 2; i <= max; ++i) { if (totient_[i] < i) continue; for (int j = i; j <= max; j += i) totient_[j] -= totient_[j] / i; } } int totient(int n) const { assert (n >= 1 && n < totient_.size()); return totient_[n]; } bool is_prime(int n) const { return totient(n) == n - 1; } private: std::vector<int> totient_; }; bool perfect_totient_number(const totient_calculator& tc, int n) { int sum = 0; for (int m = n; m > 1; ) { int t = tc.totient(m); sum += t; m = t; } return sum == n; } int main() { totient_calculator tc(10000); int count = 0, n = 1; std::cout << "First 20 perfect totient numbers:\n"; for (; count < 20; ++n) { if (perfect_totient_number(tc, n)) { if (count > 0) std::cout << ' '; ++count; std::cout << n; } } std::cout << '\n'; return 0; }
import java.util.ArrayList; import java.util.List; public class PerfectTotientNumbers { public static void main(String[] args) { computePhi(); int n = 20; System.out.printf("The first %d perfect totient numbers:%n%s%n", n, perfectTotient(n)); } private static final List<Integer> perfectTotient(int n) { int test = 2; List<Integer> results = new ArrayList<Integer>(); for ( int i = 0 ; i < n ; test++ ) { int phiLoop = test; int sum = 0; do { phiLoop = phi[phiLoop]; sum += phiLoop; } while ( phiLoop > 1); if ( sum == test ) { i++; results.add(test); } } return results; } private static final int max = 100000; private static final int[] phi = new int[max+1]; private static final void computePhi() { for ( int i = 1 ; i <= max ; i++ ) { phi[i] = i; } for ( int i = 2 ; i <= max ; i++ ) { if (phi[i] < i) continue; for ( int j = i ; j <= max ; j += i ) { phi[j] -= phi[j] / i; } } } }
Convert this C++ block to Java, preserving its control flow and logic.
#include <tr1/memory> #include <string> #include <iostream> #include <tr1/functional> using namespace std; using namespace std::tr1; using std::tr1::function; class IDelegate { public: virtual ~IDelegate() {} }; class IThing { public: virtual ~IThing() {} virtual std::string Thing() = 0; }; class DelegateA : virtual public IDelegate { }; class DelegateB : public IThing, public IDelegate { std::string Thing() { return "delegate implementation"; } }; class Delegator { public: std::string Operation() { if(Delegate) if (IThing * pThing = dynamic_cast<IThing*>(Delegate.get())) return pThing->Thing(); return "default implementation"; } shared_ptr<IDelegate> Delegate; }; int main() { shared_ptr<DelegateA> delegateA(new DelegateA()); shared_ptr<DelegateB> delegateB(new DelegateB()); Delegator delegator; std::cout << delegator.Operation() << std::endl; delegator.Delegate = delegateA; std::cout << delegator.Operation() << std::endl; delegator.Delegate = delegateB; std::cout << delegator.Operation() << std::endl; }
interface Thingable { String thing(); } class Delegator { public Thingable delegate; public String operation() { if (delegate == null) return "default implementation"; else return delegate.thing(); } } class Delegate implements Thingable { public String thing() { return "delegate implementation"; } } public class DelegateExample { public static void main(String[] args) { Delegator a = new Delegator(); assert a.operation().equals("default implementation"); Delegate d = new Delegate(); a.delegate = d; assert a.operation().equals("delegate implementation"); a.delegate = new Thingable() { public String thing() { return "anonymous delegate implementation"; } }; assert a.operation().equals("anonymous delegate implementation"); } }
Can you help me rewrite this code in Java instead of C++, keeping it the same logically?
#include <iomanip> #include <iostream> unsigned int divisor_sum(unsigned int n) { unsigned int total = 1, power = 2; for (; (n & 1) == 0; power <<= 1, n >>= 1) total += power; for (unsigned int p = 3; p * p <= n; p += 2) { unsigned int sum = 1; for (power = p; n % p == 0; power *= p, n /= p) sum += power; total *= sum; } if (n > 1) total *= n + 1; return total; } int main() { const unsigned int limit = 100; std::cout << "Sum of divisors for the first " << limit << " positive integers:\n"; for (unsigned int n = 1; n <= limit; ++n) { std::cout << std::setw(4) << divisor_sum(n); if (n % 10 == 0) std::cout << '\n'; } }
public class DivisorSum { private static long divisorSum(long n) { var total = 1L; var power = 2L; for (; (n & 1) == 0; power <<= 1, n >>= 1) { total += power; } for (long p = 3; p * p <= n; p += 2) { long sum = 1; for (power = p; n % p == 0; power *= p, n /= p) { sum += power; } total *= sum; } if (n > 1) { total *= n + 1; } return total; } public static void main(String[] args) { final long limit = 100; System.out.printf("Sum of divisors for the first %d positive integers:%n", limit); for (long n = 1; n <= limit; ++n) { System.out.printf("%4d", divisorSum(n)); if (n % 10 == 0) { System.out.println(); } } } }
Port the following code from C++ to Java with equivalent syntax and logic.
#include <iomanip> #include <iostream> unsigned int divisor_sum(unsigned int n) { unsigned int total = 1, power = 2; for (; (n & 1) == 0; power <<= 1, n >>= 1) total += power; for (unsigned int p = 3; p * p <= n; p += 2) { unsigned int sum = 1; for (power = p; n % p == 0; power *= p, n /= p) sum += power; total *= sum; } if (n > 1) total *= n + 1; return total; } int main() { const unsigned int limit = 100; std::cout << "Sum of divisors for the first " << limit << " positive integers:\n"; for (unsigned int n = 1; n <= limit; ++n) { std::cout << std::setw(4) << divisor_sum(n); if (n % 10 == 0) std::cout << '\n'; } }
public class DivisorSum { private static long divisorSum(long n) { var total = 1L; var power = 2L; for (; (n & 1) == 0; power <<= 1, n >>= 1) { total += power; } for (long p = 3; p * p <= n; p += 2) { long sum = 1; for (power = p; n % p == 0; power *= p, n /= p) { sum += power; } total *= sum; } if (n > 1) { total *= n + 1; } return total; } public static void main(String[] args) { final long limit = 100; System.out.printf("Sum of divisors for the first %d positive integers:%n", limit); for (long n = 1; n <= limit; ++n) { System.out.printf("%4d", divisorSum(n)); if (n % 10 == 0) { System.out.println(); } } } }
Translate the given C++ code snippet into Java without altering its behavior.
#include <algorithm> #include <cctype> #include <iostream> #include <sstream> #include <string> #include <vector> const char* command_table = "Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy " "COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find " "NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput " "Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO " "MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT " "READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT " "RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up"; class command { public: command(const std::string&, size_t); const std::string& cmd() const { return cmd_; } size_t min_length() const { return min_len_; } bool match(const std::string&) const; private: std::string cmd_; size_t min_len_; }; command::command(const std::string& cmd, size_t min_len) : cmd_(cmd), min_len_(min_len) {} bool command::match(const std::string& str) const { size_t olen = str.length(); return olen >= min_len_ && olen <= cmd_.length() && cmd_.compare(0, olen, str) == 0; } void uppercase(std::string& str) { std::transform(str.begin(), str.end(), str.begin(), [](unsigned char c) -> unsigned char { return std::toupper(c); }); } size_t get_min_length(const std::string& str) { size_t len = 0, n = str.length(); while (len < n && std::isupper(static_cast<unsigned char>(str[len]))) ++len; return len; } class command_list { public: explicit command_list(const char*); const command* find_command(const std::string&) const; private: std::vector<command> commands_; }; command_list::command_list(const char* table) { std::vector<command> commands; std::istringstream is(table); std::string word; while (is >> word) { size_t len = get_min_length(word); uppercase(word); commands_.push_back(command(word, len)); } } const command* command_list::find_command(const std::string& word) const { auto iter = std::find_if(commands_.begin(), commands_.end(), [&word](const command& cmd) { return cmd.match(word); }); return (iter != commands_.end()) ? &*iter : nullptr; } std::string test(const command_list& commands, const std::string& input) { std::string output; std::istringstream is(input); std::string word; while (is >> word) { if (!output.empty()) output += ' '; uppercase(word); const command* cmd_ptr = commands.find_command(word); if (cmd_ptr) output += cmd_ptr->cmd(); else output += "*error*"; } return output; } int main() { command_list commands(command_table); std::string input("riG rePEAT copies put mo rest types fup. 6 poweRin"); std::string output(test(commands, input)); std::cout << " input: " << input << '\n'; std::cout << "output: " << output << '\n'; return 0; }
import java.util.HashMap; import java.util.Map; import java.util.Scanner; public class AbbreviationsEasy { private static final Scanner input = new Scanner(System.in); private static final String COMMAND_TABLE = " Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy\n" + " COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find\n" + " NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput\n" + " Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO\n" + " MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT\n" + " READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT\n" + " RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up"; public static void main(String[] args) { String[] cmdTableArr = COMMAND_TABLE.split("\\s+"); Map<String, Integer> cmd_table = new HashMap<String, Integer>(); for (String word : cmdTableArr) { cmd_table.put(word, countCaps(word)); } System.out.print("Please enter your command to verify: "); String userInput = input.nextLine(); String[] user_input = userInput.split("\\s+"); for (String s : user_input) { boolean match = false; for (String cmd : cmd_table.keySet()) { if (s.length() >= cmd_table.get(cmd) && s.length() <= cmd.length()) { String temp = cmd.toUpperCase(); if (temp.startsWith(s.toUpperCase())) { System.out.print(temp + " "); match = true; } } } if (!match) { System.out.print("*error* "); } } } private static int countCaps(String word) { int numCaps = 0; for (int i = 0; i < word.length(); i++) { if (Character.isUpperCase(word.charAt(i))) { numCaps++; } } return numCaps; } }
Preserve the algorithm and functionality while converting the code from C++ to Java.
#include <algorithm> #include <cctype> #include <iostream> #include <sstream> #include <string> #include <vector> const char* command_table = "Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy " "COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find " "NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput " "Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO " "MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT " "READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT " "RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up"; class command { public: command(const std::string&, size_t); const std::string& cmd() const { return cmd_; } size_t min_length() const { return min_len_; } bool match(const std::string&) const; private: std::string cmd_; size_t min_len_; }; command::command(const std::string& cmd, size_t min_len) : cmd_(cmd), min_len_(min_len) {} bool command::match(const std::string& str) const { size_t olen = str.length(); return olen >= min_len_ && olen <= cmd_.length() && cmd_.compare(0, olen, str) == 0; } void uppercase(std::string& str) { std::transform(str.begin(), str.end(), str.begin(), [](unsigned char c) -> unsigned char { return std::toupper(c); }); } size_t get_min_length(const std::string& str) { size_t len = 0, n = str.length(); while (len < n && std::isupper(static_cast<unsigned char>(str[len]))) ++len; return len; } class command_list { public: explicit command_list(const char*); const command* find_command(const std::string&) const; private: std::vector<command> commands_; }; command_list::command_list(const char* table) { std::vector<command> commands; std::istringstream is(table); std::string word; while (is >> word) { size_t len = get_min_length(word); uppercase(word); commands_.push_back(command(word, len)); } } const command* command_list::find_command(const std::string& word) const { auto iter = std::find_if(commands_.begin(), commands_.end(), [&word](const command& cmd) { return cmd.match(word); }); return (iter != commands_.end()) ? &*iter : nullptr; } std::string test(const command_list& commands, const std::string& input) { std::string output; std::istringstream is(input); std::string word; while (is >> word) { if (!output.empty()) output += ' '; uppercase(word); const command* cmd_ptr = commands.find_command(word); if (cmd_ptr) output += cmd_ptr->cmd(); else output += "*error*"; } return output; } int main() { command_list commands(command_table); std::string input("riG rePEAT copies put mo rest types fup. 6 poweRin"); std::string output(test(commands, input)); std::cout << " input: " << input << '\n'; std::cout << "output: " << output << '\n'; return 0; }
import java.util.HashMap; import java.util.Map; import java.util.Scanner; public class AbbreviationsEasy { private static final Scanner input = new Scanner(System.in); private static final String COMMAND_TABLE = " Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy\n" + " COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find\n" + " NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput\n" + " Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO\n" + " MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT\n" + " READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT\n" + " RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up"; public static void main(String[] args) { String[] cmdTableArr = COMMAND_TABLE.split("\\s+"); Map<String, Integer> cmd_table = new HashMap<String, Integer>(); for (String word : cmdTableArr) { cmd_table.put(word, countCaps(word)); } System.out.print("Please enter your command to verify: "); String userInput = input.nextLine(); String[] user_input = userInput.split("\\s+"); for (String s : user_input) { boolean match = false; for (String cmd : cmd_table.keySet()) { if (s.length() >= cmd_table.get(cmd) && s.length() <= cmd.length()) { String temp = cmd.toUpperCase(); if (temp.startsWith(s.toUpperCase())) { System.out.print(temp + " "); match = true; } } } if (!match) { System.out.print("*error* "); } } } private static int countCaps(String word) { int numCaps = 0; for (int i = 0; i < word.length(); i++) { if (Character.isUpperCase(word.charAt(i))) { numCaps++; } } return numCaps; } }
Change the programming language of this snippet from C++ to Java without modifying what it does.
#include <iostream> class MyOtherClass { public: const int m_x; MyOtherClass(const int initX = 0) : m_x(initX) { } }; int main() { MyOtherClass mocA, mocB(7); std::cout << mocA.m_x << std::endl; std::cout << mocB.m_x << std::endl; return 0; }
final int immutableInt = 4; int mutableInt = 4; mutableInt = 6; immutableInt = 6;
Generate a Java translation of this C++ snippet without changing its computational steps.
#include <iostream> #include <span> #include <vector> struct vec2 { float x = 0.0f, y = 0.0f; constexpr vec2 operator+(vec2 other) const { return vec2{x + other.x, y + other.y}; } constexpr vec2 operator-(vec2 other) const { return vec2{x - other.x, y - other.y}; } }; constexpr vec2 operator*(vec2 a, float b) { return vec2{a.x * b, a.y * b}; } constexpr float dot(vec2 a, vec2 b) { return a.x * b.x + a.y * b.y; } constexpr float cross(vec2 a, vec2 b) { return a.x * b.y - b.x * a.y; } constexpr bool is_inside(vec2 point, vec2 a, vec2 b) { return (cross(a - b, point) + cross(b, a)) < 0.0f; } constexpr vec2 intersection(vec2 a1, vec2 a2, vec2 b1, vec2 b2) { return ((b1 - b2) * cross(a1, a2) - (a1 - a2) * cross(b1, b2)) * (1.0f / cross(a1 - a2, b1 - b2)); } std::vector<vec2> suther_land_hodgman( std::span<vec2 const> subject_polygon, std::span<vec2 const> clip_polygon) { if (clip_polygon.empty() || subject_polygon.empty()) { return {}; } std::vector<vec2> ring{subject_polygon.begin(), subject_polygon.end()}; vec2 p1 = clip_polygon[clip_polygon.size() - 1]; std::vector<vec2> input; for (vec2 p2 : clip_polygon) { input.clear(); input.insert(input.end(), ring.begin(), ring.end()); vec2 s = input[input.size() - 1]; ring.clear(); for (vec2 e : input) { if (is_inside(e, p1, p2)) { if (!is_inside(s, p1, p2)) { ring.push_back(intersection(p1, p2, s, e)); } ring.push_back(e); } else if (is_inside(s, p1, p2)) { ring.push_back(intersection(p1, p2, s, e)); } s = e; } p1 = p2; } return ring; } int main(int argc, char **argv) { vec2 subject_polygon[] = {{50, 150}, {200, 50}, {350, 150}, {350, 300}, {250, 300}, {200, 250}, {150, 350}, {100, 250}, {100, 200}}; vec2 clip_polygon[] = {{100, 100}, {300, 100}, {300, 300}, {100, 300}}; std::vector<vec2> clipped_polygon = suther_land_hodgman(subject_polygon, clip_polygon); std::cout << "Clipped polygon points:" << std::endl; for (vec2 p : clipped_polygon) { std::cout << "(" << p.x << ", " << p.y << ")" << std::endl; } return EXIT_SUCCESS; }
import java.awt.*; import java.awt.geom.Line2D; import java.util.*; import java.util.List; import javax.swing.*; public class SutherlandHodgman extends JFrame { SutherlandHodgmanPanel panel; public static void main(String[] args) { JFrame f = new SutherlandHodgman(); f.setDefaultCloseOperation(JFrame.EXIT_ON_CLOSE); f.setVisible(true); } public SutherlandHodgman() { Container content = getContentPane(); content.setLayout(new BorderLayout()); panel = new SutherlandHodgmanPanel(); content.add(panel, BorderLayout.CENTER); setTitle("SutherlandHodgman"); pack(); setLocationRelativeTo(null); } } class SutherlandHodgmanPanel extends JPanel { List<double[]> subject, clipper, result; public SutherlandHodgmanPanel() { setPreferredSize(new Dimension(600, 500)); double[][] subjPoints = {{50, 150}, {200, 50}, {350, 150}, {350, 300}, {250, 300}, {200, 250}, {150, 350}, {100, 250}, {100, 200}}; double[][] clipPoints = {{100, 100}, {300, 100}, {300, 300}, {100, 300}}; subject = new ArrayList<>(Arrays.asList(subjPoints)); result = new ArrayList<>(subject); clipper = new ArrayList<>(Arrays.asList(clipPoints)); clipPolygon(); } private void clipPolygon() { int len = clipper.size(); for (int i = 0; i < len; i++) { int len2 = result.size(); List<double[]> input = result; result = new ArrayList<>(len2); double[] A = clipper.get((i + len - 1) % len); double[] B = clipper.get(i); for (int j = 0; j < len2; j++) { double[] P = input.get((j + len2 - 1) % len2); double[] Q = input.get(j); if (isInside(A, B, Q)) { if (!isInside(A, B, P)) result.add(intersection(A, B, P, Q)); result.add(Q); } else if (isInside(A, B, P)) result.add(intersection(A, B, P, Q)); } } } private boolean isInside(double[] a, double[] b, double[] c) { return (a[0] - c[0]) * (b[1] - c[1]) > (a[1] - c[1]) * (b[0] - c[0]); } private double[] intersection(double[] a, double[] b, double[] p, double[] q) { double A1 = b[1] - a[1]; double B1 = a[0] - b[0]; double C1 = A1 * a[0] + B1 * a[1]; double A2 = q[1] - p[1]; double B2 = p[0] - q[0]; double C2 = A2 * p[0] + B2 * p[1]; double det = A1 * B2 - A2 * B1; double x = (B2 * C1 - B1 * C2) / det; double y = (A1 * C2 - A2 * C1) / det; return new double[]{x, y}; } @Override public void paintComponent(Graphics g) { super.paintComponent(g); Graphics2D g2 = (Graphics2D) g; g2.translate(80, 60); g2.setStroke(new BasicStroke(3)); g2.setRenderingHint(RenderingHints.KEY_ANTIALIASING, RenderingHints.VALUE_ANTIALIAS_ON); drawPolygon(g2, subject, Color.blue); drawPolygon(g2, clipper, Color.red); drawPolygon(g2, result, Color.green); } private void drawPolygon(Graphics2D g2, List<double[]> points, Color color) { g2.setColor(color); int len = points.size(); Line2D line = new Line2D.Double(); for (int i = 0; i < len; i++) { double[] p1 = points.get(i); double[] p2 = points.get((i + 1) % len); line.setLine(p1[0], p1[1], p2[0], p2[1]); g2.draw(line); } } }
Port the provided C++ code into Java while preserving the original functionality.
#include <iostream> #include <algorithm> #include <vector> #include <bitset> #include <string> class bacon { public: bacon() { int x = 0; for( ; x < 9; x++ ) bAlphabet.push_back( std::bitset<5>( x ).to_string() ); bAlphabet.push_back( bAlphabet.back() ); for( ; x < 20; x++ ) bAlphabet.push_back( std::bitset<5>( x ).to_string() ); bAlphabet.push_back( bAlphabet.back() ); for( ; x < 24; x++ ) bAlphabet.push_back( std::bitset<5>( x ).to_string() ); } std::string encode( std::string txt ) { std::string r; size_t z; for( std::string::iterator i = txt.begin(); i != txt.end(); i++ ) { z = toupper( *i ); if( z < 'A' || z > 'Z' ) continue; r.append( bAlphabet.at( ( *i & 31 ) - 1 ) ); } return r; } std::string decode( std::string txt ) { size_t len = txt.length(); while( len % 5 != 0 ) len--; if( len != txt.length() ) txt = txt.substr( 0, len ); std::string r; for( size_t i = 0; i < len; i += 5 ) { r.append( 1, 'A' + std::distance( bAlphabet.begin(), std::find( bAlphabet.begin(), bAlphabet.end(), txt.substr( i, 5 ) ) ) ); } return r; } private: std::vector<std::string> bAlphabet; };
import java.util.HashMap; import java.util.Map; import java.util.Objects; public class BaconCipher { private static final Map<Character, String> codes; static { codes = new HashMap<>(); codes.putAll(Map.of( 'a', "AAAAA", 'b', "AAAAB", 'c', "AAABA", 'd', "AAABB", 'e', "AABAA", 'f', "AABAB", 'g', "AABBA", 'h', "AABBB", 'i', "ABAAA", 'j', "ABAAB" )); codes.putAll(Map.of( 'k', "ABABA", 'l', "ABABB", 'm', "ABBAA", 'n', "ABBAB", 'o', "ABBBA", 'p', "ABBBB", 'q', "BAAAA", 'r', "BAAAB", 's', "BAABA", 't', "BAABB" )); codes.putAll(Map.of( 'u', "BABAA", 'v', "BABAB", 'w', "BABBA", 'x', "BABBB", 'y', "BBAAA", 'z', "BBAAB", ' ', "BBBAA" )); } private static String encode(String plainText, String message) { String pt = plainText.toLowerCase(); StringBuilder sb = new StringBuilder(); for (char c : pt.toCharArray()) { if ('a' <= c && c <= 'z') sb.append(codes.get(c)); else sb.append(codes.get(' ')); } String et = sb.toString(); String mg = message.toLowerCase(); sb.setLength(0); int count = 0; for (char c : mg.toCharArray()) { if ('a' <= c && c <= 'z') { if (et.charAt(count) == 'A') sb.append(c); else sb.append(((char) (c - 32))); count++; if (count == et.length()) break; } else sb.append(c); } return sb.toString(); } private static String decode(String message) { StringBuilder sb = new StringBuilder(); for (char c : message.toCharArray()) { if ('a' <= c && c <= 'z') sb.append('A'); if ('A' <= c && c <= 'Z') sb.append('B'); } String et = sb.toString(); sb.setLength(0); for (int i = 0; i < et.length(); i += 5) { String quintet = et.substring(i, i + 5); Character key = codes.entrySet().stream().filter(a -> Objects.equals(a.getValue(), quintet)).findFirst().map(Map.Entry::getKey).orElse(null); sb.append(key); } return sb.toString(); } public static void main(String[] args) { String plainText = "the quick brown fox jumps over the lazy dog"; String message = "bacon's cipher is a method of steganography created by francis bacon. " + "this task is to implement a program for encryption and decryption of " + "plaintext using the simple alphabet of the baconian cipher or some " + "other kind of representation of this alphabet (make anything signify anything). " + "the baconian alphabet may optionally be extended to encode all lower " + "case characters individually and/or adding a few punctuation characters " + "such as the space."; String cipherText = encode(plainText, message); System.out.printf("Cipher text ->\n\n%s\n", cipherText); String decodedText = decode(cipherText); System.out.printf("\nHidden text ->\n\n%s\n", decodedText); } }
Change the programming language of this snippet from C++ to Java without modifying what it does.
#include <iostream> #include <algorithm> #include <vector> #include <bitset> #include <string> class bacon { public: bacon() { int x = 0; for( ; x < 9; x++ ) bAlphabet.push_back( std::bitset<5>( x ).to_string() ); bAlphabet.push_back( bAlphabet.back() ); for( ; x < 20; x++ ) bAlphabet.push_back( std::bitset<5>( x ).to_string() ); bAlphabet.push_back( bAlphabet.back() ); for( ; x < 24; x++ ) bAlphabet.push_back( std::bitset<5>( x ).to_string() ); } std::string encode( std::string txt ) { std::string r; size_t z; for( std::string::iterator i = txt.begin(); i != txt.end(); i++ ) { z = toupper( *i ); if( z < 'A' || z > 'Z' ) continue; r.append( bAlphabet.at( ( *i & 31 ) - 1 ) ); } return r; } std::string decode( std::string txt ) { size_t len = txt.length(); while( len % 5 != 0 ) len--; if( len != txt.length() ) txt = txt.substr( 0, len ); std::string r; for( size_t i = 0; i < len; i += 5 ) { r.append( 1, 'A' + std::distance( bAlphabet.begin(), std::find( bAlphabet.begin(), bAlphabet.end(), txt.substr( i, 5 ) ) ) ); } return r; } private: std::vector<std::string> bAlphabet; };
import java.util.HashMap; import java.util.Map; import java.util.Objects; public class BaconCipher { private static final Map<Character, String> codes; static { codes = new HashMap<>(); codes.putAll(Map.of( 'a', "AAAAA", 'b', "AAAAB", 'c', "AAABA", 'd', "AAABB", 'e', "AABAA", 'f', "AABAB", 'g', "AABBA", 'h', "AABBB", 'i', "ABAAA", 'j', "ABAAB" )); codes.putAll(Map.of( 'k', "ABABA", 'l', "ABABB", 'm', "ABBAA", 'n', "ABBAB", 'o', "ABBBA", 'p', "ABBBB", 'q', "BAAAA", 'r', "BAAAB", 's', "BAABA", 't', "BAABB" )); codes.putAll(Map.of( 'u', "BABAA", 'v', "BABAB", 'w', "BABBA", 'x', "BABBB", 'y', "BBAAA", 'z', "BBAAB", ' ', "BBBAA" )); } private static String encode(String plainText, String message) { String pt = plainText.toLowerCase(); StringBuilder sb = new StringBuilder(); for (char c : pt.toCharArray()) { if ('a' <= c && c <= 'z') sb.append(codes.get(c)); else sb.append(codes.get(' ')); } String et = sb.toString(); String mg = message.toLowerCase(); sb.setLength(0); int count = 0; for (char c : mg.toCharArray()) { if ('a' <= c && c <= 'z') { if (et.charAt(count) == 'A') sb.append(c); else sb.append(((char) (c - 32))); count++; if (count == et.length()) break; } else sb.append(c); } return sb.toString(); } private static String decode(String message) { StringBuilder sb = new StringBuilder(); for (char c : message.toCharArray()) { if ('a' <= c && c <= 'z') sb.append('A'); if ('A' <= c && c <= 'Z') sb.append('B'); } String et = sb.toString(); sb.setLength(0); for (int i = 0; i < et.length(); i += 5) { String quintet = et.substring(i, i + 5); Character key = codes.entrySet().stream().filter(a -> Objects.equals(a.getValue(), quintet)).findFirst().map(Map.Entry::getKey).orElse(null); sb.append(key); } return sb.toString(); } public static void main(String[] args) { String plainText = "the quick brown fox jumps over the lazy dog"; String message = "bacon's cipher is a method of steganography created by francis bacon. " + "this task is to implement a program for encryption and decryption of " + "plaintext using the simple alphabet of the baconian cipher or some " + "other kind of representation of this alphabet (make anything signify anything). " + "the baconian alphabet may optionally be extended to encode all lower " + "case characters individually and/or adding a few punctuation characters " + "such as the space."; String cipherText = encode(plainText, message); System.out.printf("Cipher text ->\n\n%s\n", cipherText); String decodedText = decode(cipherText); System.out.printf("\nHidden text ->\n\n%s\n", decodedText); } }
Rewrite this program in Java while keeping its functionality equivalent to the C++ version.
#include <vector> #include <memory> #include <cmath> #include <iostream> #include <iomanip> using namespace std; typedef vector< int > IntRow; typedef vector< IntRow > IntTable; auto_ptr< IntTable > getSpiralArray( int dimension ) { auto_ptr< IntTable > spiralArrayPtr( new IntTable( dimension, IntRow( dimension ) ) ); int numConcentricSquares = static_cast< int >( ceil( static_cast< double >( dimension ) / 2.0 ) ); int j; int sideLen = dimension; int currNum = 0; for ( int i = 0; i < numConcentricSquares; i++ ) { for ( j = 0; j < sideLen; j++ ) ( *spiralArrayPtr )[ i ][ i + j ] = currNum++; for ( j = 1; j < sideLen; j++ ) ( *spiralArrayPtr )[ i + j ][ dimension - 1 - i ] = currNum++; for ( j = sideLen - 2; j > -1; j-- ) ( *spiralArrayPtr )[ dimension - 1 - i ][ i + j ] = currNum++; for ( j = sideLen - 2; j > 0; j-- ) ( *spiralArrayPtr )[ i + j ][ i ] = currNum++; sideLen -= 2; } return spiralArrayPtr; } void printSpiralArray( const auto_ptr< IntTable >& spiralArrayPtr ) { size_t dimension = spiralArrayPtr->size(); int fieldWidth = static_cast< int >( floor( log10( static_cast< double >( dimension * dimension - 1 ) ) ) ) + 2; size_t col; for ( size_t row = 0; row < dimension; row++ ) { for ( col = 0; col < dimension; col++ ) cout << setw( fieldWidth ) << ( *spiralArrayPtr )[ row ][ col ]; cout << endl; } } int main() { printSpiralArray( getSpiralArray( 5 ) ); }
public class Blah { public static void main(String[] args) { print2dArray(getSpiralArray(5)); } public static int[][] getSpiralArray(int dimension) { int[][] spiralArray = new int[dimension][dimension]; int numConcentricSquares = (int) Math.ceil((dimension) / 2.0); int j; int sideLen = dimension; int currNum = 0; for (int i = 0; i < numConcentricSquares; i++) { for (j = 0; j < sideLen; j++) { spiralArray[i][i + j] = currNum++; } for (j = 1; j < sideLen; j++) { spiralArray[i + j][dimension - 1 - i] = currNum++; } for (j = sideLen - 2; j > -1; j--) { spiralArray[dimension - 1 - i][i + j] = currNum++; } for (j = sideLen - 2; j > 0; j--) { spiralArray[i + j][i] = currNum++; } sideLen -= 2; } return spiralArray; } public static void print2dArray(int[][] array) { for (int[] row : array) { for (int elem : row) { System.out.printf("%3d", elem); } System.out.println(); } } }
Transform the following C++ implementation into Java, maintaining the same output and logic.
#include <vector> #include <algorithm> #include <string> template <class T> struct sort_table_functor { typedef bool (*CompFun)(const T &, const T &); const CompFun ordering; const int column; const bool reverse; sort_table_functor(CompFun o, int c, bool r) : ordering(o), column(c), reverse(r) { } bool operator()(const std::vector<T> &x, const std::vector<T> &y) const { const T &a = x[column], &b = y[column]; return reverse ? ordering(b, a) : ordering(a, b); } }; template <class T> bool myLess(const T &x, const T &y) { return x < y; } template <class T> void sort_table(std::vector<std::vector<T> > &table, int column = 0, bool reverse = false, bool (*ordering)(const T &, const T &) = myLess) { std::sort(table.begin(), table.end(), sort_table_functor<T>(ordering, column, reverse)); } #include <iostream> template <class T> void print_matrix(std::vector<std::vector<T> > &data) { for () { for (int j = 0; j < 3; j++) std::cout << data[i][j] << "\t"; std::cout << std::endl; } } bool desc_len_comparator(const std::string &x, const std::string &y) { return x.length() > y.length(); } int main() { std::string data_array[3][3] = { {"a", "b", "c"}, {"", "q", "z"}, {"zap", "zip", "Zot"} }; std::vector<std::vector<std::string> > data_orig; for (int i = 0; i < 3; i++) { std::vector<std::string> row; for (int j = 0; j < 3; j++) row.push_back(data_array[i][j]); data_orig.push_back(row); } print_matrix(data_orig); std::vector<std::vector<std::string> > data = data_orig; sort_table(data); print_matrix(data); data = data_orig; sort_table(data, 2); print_matrix(data); data = data_orig; sort_table(data, 1); print_matrix(data); data = data_orig; sort_table(data, 1, true); print_matrix(data); data = data_orig; sort_table(data, 0, false, desc_len_comparator); print_matrix(data); return 0; }
module OptionalParameters { typedef Type<String >.Orderer as ColumnOrderer; typedef Type<String[]>.Orderer as RowOrderer; static String[][] sort(String[][] table, ColumnOrderer? orderer = Null, Int column = 0, Boolean reverse = False, ) { orderer ?:= (s1, s2) -> s1 <=> s2; ColumnOrderer byString = reverse ? ((s1, s2) -> orderer(s1, s2).reversed) : orderer; RowOrderer byColumn = (row1, row2) -> byString(row1[column], row2[column]); return table.sorted(byColumn); } void run() { String[][] table = [ ["c", "x", "i"], ["a", "y", "p"], ["b", "z", "a"], ]; show("original input", table); show("by default sort on column 0", sort(table)); show("by column 2", sort(table, column=2)); show("by column 2 reversed", sort(table, column=2, reverse=True)); } void show(String title, String[][] table) { @Inject Console console; console.print($"{title}:"); for (val row : table) { console.print($" {row}"); } console.print(); } }
Write a version of this C++ function in Java with identical behavior.
#include <windows.h> #include <vector> #include <string> using namespace std; struct Point { int x, y; }; class MyBitmap { public: MyBitmap() : pen_(nullptr) {} ~MyBitmap() { DeleteObject(pen_); DeleteDC(hdc_); DeleteObject(bmp_); } bool Create(int w, int h) { BITMAPINFO bi; ZeroMemory(&bi, sizeof(bi)); bi.bmiHeader.biSize = sizeof(bi.bmiHeader); bi.bmiHeader.biBitCount = sizeof(DWORD) * 8; bi.bmiHeader.biCompression = BI_RGB; bi.bmiHeader.biPlanes = 1; bi.bmiHeader.biWidth = w; bi.bmiHeader.biHeight = -h; void *bits_ptr = nullptr; HDC dc = GetDC(GetConsoleWindow()); bmp_ = CreateDIBSection(dc, &bi, DIB_RGB_COLORS, &bits_ptr, nullptr, 0); if (!bmp_) return false; hdc_ = CreateCompatibleDC(dc); SelectObject(hdc_, bmp_); ReleaseDC(GetConsoleWindow(), dc); width_ = w; height_ = h; return true; } void SetPenColor(DWORD clr) { if (pen_) DeleteObject(pen_); pen_ = CreatePen(PS_SOLID, 1, clr); SelectObject(hdc_, pen_); } bool SaveBitmap(const char* path) { HANDLE file = CreateFile(path, GENERIC_WRITE, 0, nullptr, CREATE_ALWAYS, FILE_ATTRIBUTE_NORMAL, nullptr); if (file == INVALID_HANDLE_VALUE) { return false; } BITMAPFILEHEADER fileheader; BITMAPINFO infoheader; BITMAP bitmap; GetObject(bmp_, sizeof(bitmap), &bitmap); DWORD* dwp_bits = new DWORD[bitmap.bmWidth * bitmap.bmHeight]; ZeroMemory(dwp_bits, bitmap.bmWidth * bitmap.bmHeight * sizeof(DWORD)); ZeroMemory(&infoheader, sizeof(BITMAPINFO)); ZeroMemory(&fileheader, sizeof(BITMAPFILEHEADER)); infoheader.bmiHeader.biBitCount = sizeof(DWORD) * 8; infoheader.bmiHeader.biCompression = BI_RGB; infoheader.bmiHeader.biPlanes = 1; infoheader.bmiHeader.biSize = sizeof(infoheader.bmiHeader); infoheader.bmiHeader.biHeight = bitmap.bmHeight; infoheader.bmiHeader.biWidth = bitmap.bmWidth; infoheader.bmiHeader.biSizeImage = bitmap.bmWidth * bitmap.bmHeight * sizeof(DWORD); fileheader.bfType = 0x4D42; fileheader.bfOffBits = sizeof(infoheader.bmiHeader) + sizeof(BITMAPFILEHEADER); fileheader.bfSize = fileheader.bfOffBits + infoheader.bmiHeader.biSizeImage; GetDIBits(hdc_, bmp_, 0, height_, (LPVOID)dwp_bits, &infoheader, DIB_RGB_COLORS); DWORD wb; WriteFile(file, &fileheader, sizeof(BITMAPFILEHEADER), &wb, nullptr); WriteFile(file, &infoheader.bmiHeader, sizeof(infoheader.bmiHeader), &wb, nullptr); WriteFile(file, dwp_bits, bitmap.bmWidth * bitmap.bmHeight * 4, &wb, nullptr); CloseHandle(file); delete[] dwp_bits; return true; } HDC hdc() { return hdc_; } int width() { return width_; } int height() { return height_; } private: HBITMAP bmp_; HDC hdc_; HPEN pen_; int width_, height_; }; static int DistanceSqrd(const Point& point, int x, int y) { int xd = x - point.x; int yd = y - point.y; return (xd * xd) + (yd * yd); } class Voronoi { public: void Make(MyBitmap* bmp, int count) { bmp_ = bmp; CreatePoints(count); CreateColors(); CreateSites(); SetSitesPoints(); } private: void CreateSites() { int w = bmp_->width(), h = bmp_->height(), d; for (int hh = 0; hh < h; hh++) { for (int ww = 0; ww < w; ww++) { int ind = -1, dist = INT_MAX; for (size_t it = 0; it < points_.size(); it++) { const Point& p = points_[it]; d = DistanceSqrd(p, ww, hh); if (d < dist) { dist = d; ind = it; } } if (ind > -1) SetPixel(bmp_->hdc(), ww, hh, colors_[ind]); else __asm nop } } } void SetSitesPoints() { for (const auto& point : points_) { int x = point.x, y = point.y; for (int i = -1; i < 2; i++) for (int j = -1; j < 2; j++) SetPixel(bmp_->hdc(), x + i, y + j, 0); } } void CreatePoints(int count) { const int w = bmp_->width() - 20, h = bmp_->height() - 20; for (int i = 0; i < count; i++) { points_.push_back({ rand() % w + 10, rand() % h + 10 }); } } void CreateColors() { for (size_t i = 0; i < points_.size(); i++) { DWORD c = RGB(rand() % 200 + 50, rand() % 200 + 55, rand() % 200 + 50); colors_.push_back(c); } } vector<Point> points_; vector<DWORD> colors_; MyBitmap* bmp_; }; int main(int argc, char* argv[]) { ShowWindow(GetConsoleWindow(), SW_MAXIMIZE); srand(GetTickCount()); MyBitmap bmp; bmp.Create(512, 512); bmp.SetPenColor(0); Voronoi v; v.Make(&bmp, 50); BitBlt(GetDC(GetConsoleWindow()), 20, 20, 512, 512, bmp.hdc(), 0, 0, SRCCOPY); bmp.SaveBitmap("v.bmp"); system("pause"); return 0; }
import java.awt.Color; import java.awt.Graphics; import java.awt.Graphics2D; import java.awt.geom.Ellipse2D; import java.awt.image.BufferedImage; import java.io.File; import java.io.IOException; import java.util.Random; import javax.imageio.ImageIO; import javax.swing.JFrame; public class Voronoi extends JFrame { static double p = 3; static BufferedImage I; static int px[], py[], color[], cells = 100, size = 1000; public Voronoi() { super("Voronoi Diagram"); setBounds(0, 0, size, size); setDefaultCloseOperation(EXIT_ON_CLOSE); int n = 0; Random rand = new Random(); I = new BufferedImage(size, size, BufferedImage.TYPE_INT_RGB); px = new int[cells]; py = new int[cells]; color = new int[cells]; for (int i = 0; i < cells; i++) { px[i] = rand.nextInt(size); py[i] = rand.nextInt(size); color[i] = rand.nextInt(16777215); } for (int x = 0; x < size; x++) { for (int y = 0; y < size; y++) { n = 0; for (byte i = 0; i < cells; i++) { if (distance(px[i], x, py[i], y) < distance(px[n], x, py[n], y)) { n = i; } } I.setRGB(x, y, color[n]); } } Graphics2D g = I.createGraphics(); g.setColor(Color.BLACK); for (int i = 0; i < cells; i++) { g.fill(new Ellipse2D .Double(px[i] - 2.5, py[i] - 2.5, 5, 5)); } try { ImageIO.write(I, "png", new File("voronoi.png")); } catch (IOException e) { } } public void paint(Graphics g) { g.drawImage(I, 0, 0, this); } static double distance(int x1, int x2, int y1, int y2) { double d; d = Math.sqrt((x1 - x2) * (x1 - x2) + (y1 - y2) * (y1 - y2)); return d; } public static void main(String[] args) { new Voronoi().setVisible(true); } }
Ensure the translated Java code behaves exactly like the original C++ snippet.
#include <windows.h> #include <vector> #include <string> using namespace std; struct Point { int x, y; }; class MyBitmap { public: MyBitmap() : pen_(nullptr) {} ~MyBitmap() { DeleteObject(pen_); DeleteDC(hdc_); DeleteObject(bmp_); } bool Create(int w, int h) { BITMAPINFO bi; ZeroMemory(&bi, sizeof(bi)); bi.bmiHeader.biSize = sizeof(bi.bmiHeader); bi.bmiHeader.biBitCount = sizeof(DWORD) * 8; bi.bmiHeader.biCompression = BI_RGB; bi.bmiHeader.biPlanes = 1; bi.bmiHeader.biWidth = w; bi.bmiHeader.biHeight = -h; void *bits_ptr = nullptr; HDC dc = GetDC(GetConsoleWindow()); bmp_ = CreateDIBSection(dc, &bi, DIB_RGB_COLORS, &bits_ptr, nullptr, 0); if (!bmp_) return false; hdc_ = CreateCompatibleDC(dc); SelectObject(hdc_, bmp_); ReleaseDC(GetConsoleWindow(), dc); width_ = w; height_ = h; return true; } void SetPenColor(DWORD clr) { if (pen_) DeleteObject(pen_); pen_ = CreatePen(PS_SOLID, 1, clr); SelectObject(hdc_, pen_); } bool SaveBitmap(const char* path) { HANDLE file = CreateFile(path, GENERIC_WRITE, 0, nullptr, CREATE_ALWAYS, FILE_ATTRIBUTE_NORMAL, nullptr); if (file == INVALID_HANDLE_VALUE) { return false; } BITMAPFILEHEADER fileheader; BITMAPINFO infoheader; BITMAP bitmap; GetObject(bmp_, sizeof(bitmap), &bitmap); DWORD* dwp_bits = new DWORD[bitmap.bmWidth * bitmap.bmHeight]; ZeroMemory(dwp_bits, bitmap.bmWidth * bitmap.bmHeight * sizeof(DWORD)); ZeroMemory(&infoheader, sizeof(BITMAPINFO)); ZeroMemory(&fileheader, sizeof(BITMAPFILEHEADER)); infoheader.bmiHeader.biBitCount = sizeof(DWORD) * 8; infoheader.bmiHeader.biCompression = BI_RGB; infoheader.bmiHeader.biPlanes = 1; infoheader.bmiHeader.biSize = sizeof(infoheader.bmiHeader); infoheader.bmiHeader.biHeight = bitmap.bmHeight; infoheader.bmiHeader.biWidth = bitmap.bmWidth; infoheader.bmiHeader.biSizeImage = bitmap.bmWidth * bitmap.bmHeight * sizeof(DWORD); fileheader.bfType = 0x4D42; fileheader.bfOffBits = sizeof(infoheader.bmiHeader) + sizeof(BITMAPFILEHEADER); fileheader.bfSize = fileheader.bfOffBits + infoheader.bmiHeader.biSizeImage; GetDIBits(hdc_, bmp_, 0, height_, (LPVOID)dwp_bits, &infoheader, DIB_RGB_COLORS); DWORD wb; WriteFile(file, &fileheader, sizeof(BITMAPFILEHEADER), &wb, nullptr); WriteFile(file, &infoheader.bmiHeader, sizeof(infoheader.bmiHeader), &wb, nullptr); WriteFile(file, dwp_bits, bitmap.bmWidth * bitmap.bmHeight * 4, &wb, nullptr); CloseHandle(file); delete[] dwp_bits; return true; } HDC hdc() { return hdc_; } int width() { return width_; } int height() { return height_; } private: HBITMAP bmp_; HDC hdc_; HPEN pen_; int width_, height_; }; static int DistanceSqrd(const Point& point, int x, int y) { int xd = x - point.x; int yd = y - point.y; return (xd * xd) + (yd * yd); } class Voronoi { public: void Make(MyBitmap* bmp, int count) { bmp_ = bmp; CreatePoints(count); CreateColors(); CreateSites(); SetSitesPoints(); } private: void CreateSites() { int w = bmp_->width(), h = bmp_->height(), d; for (int hh = 0; hh < h; hh++) { for (int ww = 0; ww < w; ww++) { int ind = -1, dist = INT_MAX; for (size_t it = 0; it < points_.size(); it++) { const Point& p = points_[it]; d = DistanceSqrd(p, ww, hh); if (d < dist) { dist = d; ind = it; } } if (ind > -1) SetPixel(bmp_->hdc(), ww, hh, colors_[ind]); else __asm nop } } } void SetSitesPoints() { for (const auto& point : points_) { int x = point.x, y = point.y; for (int i = -1; i < 2; i++) for (int j = -1; j < 2; j++) SetPixel(bmp_->hdc(), x + i, y + j, 0); } } void CreatePoints(int count) { const int w = bmp_->width() - 20, h = bmp_->height() - 20; for (int i = 0; i < count; i++) { points_.push_back({ rand() % w + 10, rand() % h + 10 }); } } void CreateColors() { for (size_t i = 0; i < points_.size(); i++) { DWORD c = RGB(rand() % 200 + 50, rand() % 200 + 55, rand() % 200 + 50); colors_.push_back(c); } } vector<Point> points_; vector<DWORD> colors_; MyBitmap* bmp_; }; int main(int argc, char* argv[]) { ShowWindow(GetConsoleWindow(), SW_MAXIMIZE); srand(GetTickCount()); MyBitmap bmp; bmp.Create(512, 512); bmp.SetPenColor(0); Voronoi v; v.Make(&bmp, 50); BitBlt(GetDC(GetConsoleWindow()), 20, 20, 512, 512, bmp.hdc(), 0, 0, SRCCOPY); bmp.SaveBitmap("v.bmp"); system("pause"); return 0; }
import java.awt.Color; import java.awt.Graphics; import java.awt.Graphics2D; import java.awt.geom.Ellipse2D; import java.awt.image.BufferedImage; import java.io.File; import java.io.IOException; import java.util.Random; import javax.imageio.ImageIO; import javax.swing.JFrame; public class Voronoi extends JFrame { static double p = 3; static BufferedImage I; static int px[], py[], color[], cells = 100, size = 1000; public Voronoi() { super("Voronoi Diagram"); setBounds(0, 0, size, size); setDefaultCloseOperation(EXIT_ON_CLOSE); int n = 0; Random rand = new Random(); I = new BufferedImage(size, size, BufferedImage.TYPE_INT_RGB); px = new int[cells]; py = new int[cells]; color = new int[cells]; for (int i = 0; i < cells; i++) { px[i] = rand.nextInt(size); py[i] = rand.nextInt(size); color[i] = rand.nextInt(16777215); } for (int x = 0; x < size; x++) { for (int y = 0; y < size; y++) { n = 0; for (byte i = 0; i < cells; i++) { if (distance(px[i], x, py[i], y) < distance(px[n], x, py[n], y)) { n = i; } } I.setRGB(x, y, color[n]); } } Graphics2D g = I.createGraphics(); g.setColor(Color.BLACK); for (int i = 0; i < cells; i++) { g.fill(new Ellipse2D .Double(px[i] - 2.5, py[i] - 2.5, 5, 5)); } try { ImageIO.write(I, "png", new File("voronoi.png")); } catch (IOException e) { } } public void paint(Graphics g) { g.drawImage(I, 0, 0, this); } static double distance(int x1, int x2, int y1, int y2) { double d; d = Math.sqrt((x1 - x2) * (x1 - x2) + (y1 - y2) * (y1 - y2)); return d; } public static void main(String[] args) { new Voronoi().setVisible(true); } }
Maintain the same structure and functionality when rewriting this code in Java.
FUNCTION MULTIPLY(X, Y) DOUBLE PRECISION MULTIPLY, X, Y
public class JNIDemo { static { System.loadLibrary("JNIDemo"); } public static void main(String[] args) { System.out.println(callStrdup("Hello World!")); } private static native String callStrdup(String s); }
Convert the following code from C++ to Java, ensuring the logic remains intact.
#include <iostream> #include <functional> #include <vector> #include <cstdlib> #include <ctime> template <typename T> std::function<std::vector<T>(T)> s_of_n_creator(int n) { std::vector<T> sample; int i = 0; return [=](T item) mutable { i++; if (i <= n) { sample.push_back(item); } else if (std::rand() % i < n) { sample[std::rand() % n] = item; } return sample; }; } int main() { std::srand(std::time(NULL)); int bin[10] = {0}; for (int trial = 0; trial < 100000; trial++) { auto s_of_n = s_of_n_creator<int>(3); std::vector<int> sample; for (int i = 0; i < 10; i++) sample = s_of_n(i); for (int s : sample) bin[s]++; } for (int x : bin) std::cout << x << std::endl; return 0; }
import java.util.*; class SOfN<T> { private static final Random rand = new Random(); private List<T> sample; private int i = 0; private int n; public SOfN(int _n) { n = _n; sample = new ArrayList<T>(n); } public List<T> process(T item) { if (++i <= n) { sample.add(item); } else if (rand.nextInt(i) < n) { sample.set(rand.nextInt(n), item); } return sample; } } public class AlgorithmS { public static void main(String[] args) { int[] bin = new int[10]; for (int trial = 0; trial < 100000; trial++) { SOfN<Integer> s_of_n = new SOfN<Integer>(3); for (int i = 0; i < 9; i++) s_of_n.process(i); for (int s : s_of_n.process(9)) bin[s]++; } System.out.println(Arrays.toString(bin)); } }
Convert this C++ block to Java, preserving its control flow and logic.
#include <iostream> #include <functional> #include <vector> #include <cstdlib> #include <ctime> template <typename T> std::function<std::vector<T>(T)> s_of_n_creator(int n) { std::vector<T> sample; int i = 0; return [=](T item) mutable { i++; if (i <= n) { sample.push_back(item); } else if (std::rand() % i < n) { sample[std::rand() % n] = item; } return sample; }; } int main() { std::srand(std::time(NULL)); int bin[10] = {0}; for (int trial = 0; trial < 100000; trial++) { auto s_of_n = s_of_n_creator<int>(3); std::vector<int> sample; for (int i = 0; i < 10; i++) sample = s_of_n(i); for (int s : sample) bin[s]++; } for (int x : bin) std::cout << x << std::endl; return 0; }
import java.util.*; class SOfN<T> { private static final Random rand = new Random(); private List<T> sample; private int i = 0; private int n; public SOfN(int _n) { n = _n; sample = new ArrayList<T>(n); } public List<T> process(T item) { if (++i <= n) { sample.add(item); } else if (rand.nextInt(i) < n) { sample.set(rand.nextInt(n), item); } return sample; } } public class AlgorithmS { public static void main(String[] args) { int[] bin = new int[10]; for (int trial = 0; trial < 100000; trial++) { SOfN<Integer> s_of_n = new SOfN<Integer>(3); for (int i = 0; i < 9; i++) s_of_n.process(i); for (int s : s_of_n.process(9)) bin[s]++; } System.out.println(Arrays.toString(bin)); } }
Generate an equivalent Java version of this C++ code.
#include <exception> #include <iomanip> #include <iostream> #include <numeric> #include <sstream> #include <vector> class Frac { public: Frac() : num(0), denom(1) {} Frac(int n, int d) { if (d == 0) { throw std::runtime_error("d must not be zero"); } int sign_of_d = d < 0 ? -1 : 1; int g = std::gcd(n, d); num = sign_of_d * n / g; denom = sign_of_d * d / g; } Frac operator-() const { return Frac(-num, denom); } Frac operator+(const Frac& rhs) const { return Frac(num*rhs.denom + denom * rhs.num, rhs.denom*denom); } Frac operator-(const Frac& rhs) const { return Frac(num*rhs.denom - denom * rhs.num, rhs.denom*denom); } Frac operator*(const Frac& rhs) const { return Frac(num*rhs.num, denom*rhs.denom); } Frac operator*(int rhs) const { return Frac(num * rhs, denom); } friend std::ostream& operator<<(std::ostream&, const Frac&); private: int num; int denom; }; std::ostream & operator<<(std::ostream & os, const Frac &f) { if (f.num == 0 || f.denom == 1) { return os << f.num; } std::stringstream ss; ss << f.num << "/" << f.denom; return os << ss.str(); } Frac bernoulli(int n) { if (n < 0) { throw std::runtime_error("n may not be negative or zero"); } std::vector<Frac> a; for (int m = 0; m <= n; m++) { a.push_back(Frac(1, m + 1)); for (int j = m; j >= 1; j--) { a[j - 1] = (a[j - 1] - a[j]) * j; } } if (n != 1) return a[0]; return -a[0]; } int binomial(int n, int k) { if (n < 0 || k < 0 || n < k) { throw std::runtime_error("parameters are invalid"); } if (n == 0 || k == 0) return 1; int num = 1; for (int i = k + 1; i <= n; i++) { num *= i; } int denom = 1; for (int i = 2; i <= n - k; i++) { denom *= i; } return num / denom; } std::vector<Frac> faulhaberTraingle(int p) { std::vector<Frac> coeffs(p + 1); Frac q{ 1, p + 1 }; int sign = -1; for (int j = 0; j <= p; j++) { sign *= -1; coeffs[p - j] = q * sign * binomial(p + 1, j) * bernoulli(j); } return coeffs; } int main() { for (int i = 0; i < 10; i++) { std::vector<Frac> coeffs = faulhaberTraingle(i); for (auto frac : coeffs) { std::cout << std::right << std::setw(5) << frac << " "; } std::cout << std::endl; } return 0; }
import java.math.BigDecimal; import java.math.MathContext; import java.util.Arrays; import java.util.stream.LongStream; public class FaulhabersTriangle { private static final MathContext MC = new MathContext(256); private static long gcd(long a, long b) { if (b == 0) { return a; } return gcd(b, a % b); } private static class Frac implements Comparable<Frac> { private long num; private long denom; public static final Frac ZERO = new Frac(0, 1); public Frac(long n, long d) { if (d == 0) throw new IllegalArgumentException("d must not be zero"); long nn = n; long dd = d; if (nn == 0) { dd = 1; } else if (dd < 0) { nn = -nn; dd = -dd; } long g = Math.abs(gcd(nn, dd)); if (g > 1) { nn /= g; dd /= g; } num = nn; denom = dd; } public Frac plus(Frac rhs) { return new Frac(num * rhs.denom + denom * rhs.num, rhs.denom * denom); } public Frac unaryMinus() { return new Frac(-num, denom); } public Frac minus(Frac rhs) { return this.plus(rhs.unaryMinus()); } public Frac times(Frac rhs) { return new Frac(this.num * rhs.num, this.denom * rhs.denom); } @Override public int compareTo(Frac o) { double diff = toDouble() - o.toDouble(); return Double.compare(diff, 0.0); } @Override public boolean equals(Object obj) { return null != obj && obj instanceof Frac && this.compareTo((Frac) obj) == 0; } @Override public String toString() { if (denom == 1) { return Long.toString(num); } return String.format("%d/%d", num, denom); } public double toDouble() { return (double) num / denom; } public BigDecimal toBigDecimal() { return BigDecimal.valueOf(num).divide(BigDecimal.valueOf(denom), MC); } } private static Frac bernoulli(int n) { if (n < 0) throw new IllegalArgumentException("n may not be negative or zero"); Frac[] a = new Frac[n + 1]; Arrays.fill(a, Frac.ZERO); for (int m = 0; m <= n; ++m) { a[m] = new Frac(1, m + 1); for (int j = m; j >= 1; --j) { a[j - 1] = a[j - 1].minus(a[j]).times(new Frac(j, 1)); } } if (n != 1) return a[0]; return a[0].unaryMinus(); } private static long binomial(int n, int k) { if (n < 0 || k < 0 || n < k) throw new IllegalArgumentException(); if (n == 0 || k == 0) return 1; long num = LongStream.rangeClosed(k + 1, n).reduce(1, (a, b) -> a * b); long den = LongStream.rangeClosed(2, n - k).reduce(1, (acc, i) -> acc * i); return num / den; } private static Frac[] faulhaberTriangle(int p) { Frac[] coeffs = new Frac[p + 1]; Arrays.fill(coeffs, Frac.ZERO); Frac q = new Frac(1, p + 1); int sign = -1; for (int j = 0; j <= p; ++j) { sign *= -1; coeffs[p - j] = q.times(new Frac(sign, 1)).times(new Frac(binomial(p + 1, j), 1)).times(bernoulli(j)); } return coeffs; } public static void main(String[] args) { for (int i = 0; i <= 9; ++i) { Frac[] coeffs = faulhaberTriangle(i); for (Frac coeff : coeffs) { System.out.printf("%5s ", coeff); } System.out.println(); } System.out.println(); int k = 17; Frac[] cc = faulhaberTriangle(k); int n = 1000; BigDecimal nn = BigDecimal.valueOf(n); BigDecimal np = BigDecimal.ONE; BigDecimal sum = BigDecimal.ZERO; for (Frac c : cc) { np = np.multiply(nn); sum = sum.add(np.multiply(c.toBigDecimal())); } System.out.println(sum.toBigInteger()); } }
Port the following code from C++ to Java with equivalent syntax and logic.
#include <iostream> int main(int argc, char* argv[]) { std::cout << "This program is named " << argv[0] << std::endl; std::cout << "There are " << argc-1 << " arguments given." << std::endl; for (int i = 1; i < argc; ++i) std::cout << "the argument #" << i << " is " << argv[i] << std::endl; return 0; }
public class Arguments { public static void main(String[] args) { System.out.println("There are " + args.length + " arguments given."); for(int i = 0; i < args.length; i++) System.out.println("The argument #" + (i+1) + " is " + args[i] + " and is at index " + i); } }
Change the following C++ code into Java without altering its purpose.
#include <iostream> int main(int argc, char* argv[]) { std::cout << "This program is named " << argv[0] << std::endl; std::cout << "There are " << argc-1 << " arguments given." << std::endl; for (int i = 1; i < argc; ++i) std::cout << "the argument #" << i << " is " << argv[i] << std::endl; return 0; }
public class Arguments { public static void main(String[] args) { System.out.println("There are " + args.length + " arguments given."); for(int i = 0; i < args.length; i++) System.out.println("The argument #" + (i+1) + " is " + args[i] + " and is at index " + i); } }
Change the programming language of this snippet from C++ to Java without modifying what it does.
#include <vector> #include <iostream> int main() { std::vector<int> a(3), b(4); a[0] = 11; a[1] = 12; a[2] = 13; b[0] = 21; b[1] = 22; b[2] = 23; b[3] = 24; a.insert(a.end(), b.begin(), b.end()); for (int i = 0; i < a.size(); ++i) std::cout << "a[" << i << "] = " << a[i] << "\n"; }
String[] fruits = ["apples", "oranges"]; String[] grains = ["wheat", "corn"]; String[] all = fruits + grains;
Keep all operations the same but rewrite the snippet in Java.
#include <iostream> #include <string> using namespace std; int main() { long int integer_input; string string_input; cout << "Enter an integer: "; cin >> integer_input; cout << "Enter a string: "; cin >> string_input; return 0; }
import java.util.Scanner; public class GetInput { public static void main(String[] args) throws Exception { Scanner s = new Scanner(System.in); System.out.print("Enter a string: "); String str = s.nextLine(); System.out.print("Enter an integer: "); int i = Integer.parseInt(s.next()); } }
Generate a Java translation of this C++ snippet without changing its computational steps.
#include <iostream> #include <windows.h> #include <mmsystem.h> #pragma comment ( lib, "winmm.lib" ) typedef unsigned char byte; typedef union { unsigned long word; unsigned char data[4]; } midi_msg; class midi { public: midi() { if( midiOutOpen( &device, 0, 0, 0, CALLBACK_NULL) != MMSYSERR_NOERROR ) { std::cout << "Error opening MIDI Output..." << std::endl; device = 0; } } ~midi() { midiOutReset( device ); midiOutClose( device ); } bool isOpen() { return device != 0; } void setInstrument( byte i ) { message.data[0] = 0xc0; message.data[1] = i; message.data[2] = 0; message.data[3] = 0; midiOutShortMsg( device, message.word ); } void playNote( byte n, unsigned i ) { playNote( n ); Sleep( i ); stopNote( n ); } private: void playNote( byte n ) { message.data[0] = 0x90; message.data[1] = n; message.data[2] = 127; message.data[3] = 0; midiOutShortMsg( device, message.word ); } void stopNote( byte n ) { message.data[0] = 0x90; message.data[1] = n; message.data[2] = 0; message.data[3] = 0; midiOutShortMsg( device, message.word ); } HMIDIOUT device; midi_msg message; }; int main( int argc, char* argv[] ) { midi m; if( m.isOpen() ) { byte notes[] = { 60, 62, 64, 65, 67, 69, 71, 72 }; m.setInstrument( 42 ); for( int x = 0; x < 8; x++ ) m.playNote( notes[x], rand() % 100 + 158 ); Sleep( 1000 ); } return 0; }
import processing.sound.*; float[] frequencies = {261.63, 293.66, 329.63, 349.23, 392.00, 440.00, 493.88, 523.25}; SinOsc sine; size(500,500); sine = new SinOsc(this); for(int i=0;i<frequencies.length;i++){ sine.freq(frequencies[i]); sine.play(); delay(500); }
Change the following C++ code into Java without altering its purpose.
#include <iostream> #include <windows.h> #include <mmsystem.h> #pragma comment ( lib, "winmm.lib" ) typedef unsigned char byte; typedef union { unsigned long word; unsigned char data[4]; } midi_msg; class midi { public: midi() { if( midiOutOpen( &device, 0, 0, 0, CALLBACK_NULL) != MMSYSERR_NOERROR ) { std::cout << "Error opening MIDI Output..." << std::endl; device = 0; } } ~midi() { midiOutReset( device ); midiOutClose( device ); } bool isOpen() { return device != 0; } void setInstrument( byte i ) { message.data[0] = 0xc0; message.data[1] = i; message.data[2] = 0; message.data[3] = 0; midiOutShortMsg( device, message.word ); } void playNote( byte n, unsigned i ) { playNote( n ); Sleep( i ); stopNote( n ); } private: void playNote( byte n ) { message.data[0] = 0x90; message.data[1] = n; message.data[2] = 127; message.data[3] = 0; midiOutShortMsg( device, message.word ); } void stopNote( byte n ) { message.data[0] = 0x90; message.data[1] = n; message.data[2] = 0; message.data[3] = 0; midiOutShortMsg( device, message.word ); } HMIDIOUT device; midi_msg message; }; int main( int argc, char* argv[] ) { midi m; if( m.isOpen() ) { byte notes[] = { 60, 62, 64, 65, 67, 69, 71, 72 }; m.setInstrument( 42 ); for( int x = 0; x < 8; x++ ) m.playNote( notes[x], rand() % 100 + 158 ); Sleep( 1000 ); } return 0; }
import processing.sound.*; float[] frequencies = {261.63, 293.66, 329.63, 349.23, 392.00, 440.00, 493.88, 523.25}; SinOsc sine; size(500,500); sine = new SinOsc(this); for(int i=0;i<frequencies.length;i++){ sine.freq(frequencies[i]); sine.play(); delay(500); }
Generate an equivalent Java version of this C++ code.
#include <vector> #include <string> #include <iostream> #include <boost/tuple/tuple.hpp> #include <set> int findBestPack( const std::vector<boost::tuple<std::string , int , int> > & , std::set<int> & , const int ) ; int main( ) { std::vector<boost::tuple<std::string , int , int> > items ; items.push_back( boost::make_tuple( "" , 0 , 0 ) ) ; items.push_back( boost::make_tuple( "map" , 9 , 150 ) ) ; items.push_back( boost::make_tuple( "compass" , 13 , 35 ) ) ; items.push_back( boost::make_tuple( "water" , 153 , 200 ) ) ; items.push_back( boost::make_tuple( "sandwich", 50 , 160 ) ) ; items.push_back( boost::make_tuple( "glucose" , 15 , 60 ) ) ; items.push_back( boost::make_tuple( "tin", 68 , 45 ) ) ; items.push_back( boost::make_tuple( "banana", 27 , 60 ) ) ; items.push_back( boost::make_tuple( "apple" , 39 , 40 ) ) ; items.push_back( boost::make_tuple( "cheese" , 23 , 30 ) ) ; items.push_back( boost::make_tuple( "beer" , 52 , 10 ) ) ; items.push_back( boost::make_tuple( "suntan creme" , 11 , 70 ) ) ; items.push_back( boost::make_tuple( "camera" , 32 , 30 ) ) ; items.push_back( boost::make_tuple( "T-shirt" , 24 , 15 ) ) ; items.push_back( boost::make_tuple( "trousers" , 48 , 10 ) ) ; items.push_back( boost::make_tuple( "umbrella" , 73 , 40 ) ) ; items.push_back( boost::make_tuple( "waterproof trousers" , 42 , 70 ) ) ; items.push_back( boost::make_tuple( "waterproof overclothes" , 43 , 75 ) ) ; items.push_back( boost::make_tuple( "note-case" , 22 , 80 ) ) ; items.push_back( boost::make_tuple( "sunglasses" , 7 , 20 ) ) ; items.push_back( boost::make_tuple( "towel" , 18 , 12 ) ) ; items.push_back( boost::make_tuple( "socks" , 4 , 50 ) ) ; items.push_back( boost::make_tuple( "book" , 30 , 10 ) ) ; const int maximumWeight = 400 ; std::set<int> bestItems ; int bestValue = findBestPack( items , bestItems , maximumWeight ) ; std::cout << "The best value that can be packed in the given knapsack is " << bestValue << " !\n" ; int totalweight = 0 ; std::cout << "The following items should be packed in the knapsack:\n" ; for ( std::set<int>::const_iterator si = bestItems.begin( ) ; si != bestItems.end( ) ; si++ ) { std::cout << (items.begin( ) + *si)->get<0>( ) << "\n" ; totalweight += (items.begin( ) + *si)->get<1>( ) ; } std::cout << "The total weight of all items is " << totalweight << " !\n" ; return 0 ; } int findBestPack( const std::vector<boost::tuple<std::string , int , int> > & items ,std::set<int> & bestItems , const int weightlimit ) { const int n = items.size( ) ; int bestValues [ n ][ weightlimit ] ; std::set<int> solutionSets[ n ][ weightlimit ] ; std::set<int> emptyset ; for ( int i = 0 ; i < n ; i++ ) { for ( int j = 0 ; j < weightlimit ; j++ ) { bestValues[ i ][ j ] = 0 ; solutionSets[ i ][ j ] = emptyset ; } } for ( int i = 0 ; i < n ; i++ ) { for ( int weight = 0 ; weight < weightlimit ; weight++ ) { if ( i == 0 ) bestValues[ i ][ weight ] = 0 ; else { int itemweight = (items.begin( ) + i)->get<1>( ) ; if ( weight < itemweight ) { bestValues[ i ][ weight ] = bestValues[ i - 1 ][ weight ] ; solutionSets[ i ][ weight ] = solutionSets[ i - 1 ][ weight ] ; } else { if ( bestValues[ i - 1 ][ weight - itemweight ] + (items.begin( ) + i)->get<2>( ) > bestValues[ i - 1 ][ weight ] ) { bestValues[ i ][ weight ] = bestValues[ i - 1 ][ weight - itemweight ] + (items.begin( ) + i)->get<2>( ) ; solutionSets[ i ][ weight ] = solutionSets[ i - 1 ][ weight - itemweight ] ; solutionSets[ i ][ weight ].insert( i ) ; } else { bestValues[ i ][ weight ] = bestValues[ i - 1 ][ weight ] ; solutionSets[ i ][ weight ] = solutionSets[ i - 1 ][ weight ] ; } } } } } bestItems.swap( solutionSets[ n - 1][ weightlimit - 1 ] ) ; return bestValues[ n - 1 ][ weightlimit - 1 ] ; }
package hu.pj.alg.test; import hu.pj.alg.ZeroOneKnapsack; import hu.pj.obj.Item; import java.util.*; import java.text.*; public class ZeroOneKnapsackForTourists { public ZeroOneKnapsackForTourists() { ZeroOneKnapsack zok = new ZeroOneKnapsack(400); zok.add("map", 9, 150); zok.add("compass", 13, 35); zok.add("water", 153, 200); zok.add("sandwich", 50, 160); zok.add("glucose", 15, 60); zok.add("tin", 68, 45); zok.add("banana", 27, 60); zok.add("apple", 39, 40); zok.add("cheese", 23, 30); zok.add("beer", 52, 10); zok.add("suntan cream", 11, 70); zok.add("camera", 32, 30); zok.add("t-shirt", 24, 15); zok.add("trousers", 48, 10); zok.add("umbrella", 73, 40); zok.add("waterproof trousers", 42, 70); zok.add("waterproof overclothes", 43, 75); zok.add("note-case", 22, 80); zok.add("sunglasses", 7, 20); zok.add("towel", 18, 12); zok.add("socks", 4, 50); zok.add("book", 30, 10); List<Item> itemList = zok.calcSolution(); if (zok.isCalculated()) { NumberFormat nf = NumberFormat.getInstance(); System.out.println( "Maximal weight = " + nf.format(zok.getMaxWeight() / 100.0) + " kg" ); System.out.println( "Total weight of solution = " + nf.format(zok.getSolutionWeight() / 100.0) + " kg" ); System.out.println( "Total value = " + zok.getProfit() ); System.out.println(); System.out.println( "You can carry the following materials " + "in the knapsack:" ); for (Item item : itemList) { if (item.getInKnapsack() == 1) { System.out.format( "%1$-23s %2$-3s %3$-5s %4$-15s \n", item.getName(), item.getWeight(), "dag ", "(value = " + item.getValue() + ")" ); } } } else { System.out.println( "The problem is not solved. " + "Maybe you gave wrong data." ); } } public static void main(String[] args) { new ZeroOneKnapsackForTourists(); } }
Maintain the same structure and functionality when rewriting this code in Java.
#include <algorithm> #include <iostream> #include <vector> typedef unsigned long long integer; std::vector<integer> get_ancestors(const std::vector<integer>& ancestor, integer n) { std::vector<integer> result; for (integer a = ancestor[n]; a != 0 && a != n; ) { n = a; a = ancestor[n]; result.push_back(n); } return result; } void print_vector(const std::vector<integer>& vec) { if (vec.empty()) { std::cout << "none\n"; return; } auto i = vec.begin(); std::cout << *i++; for (; i != vec.end(); ++i) std::cout << ", " << *i; std::cout << '\n'; } bool is_prime(integer n) { if (n < 2) return false; if (n % 2 == 0) return n == 2; for (integer p = 3; p * p <= n; p += 2) { if (n % p == 0) return false; } return true; } int main(int argc, char** argv) { const size_t limit = 100; std::vector<integer> ancestor(limit, 0); std::vector<std::vector<integer>> descendants(limit); for (size_t prime = 0; prime < limit; ++prime) { if (!is_prime(prime)) continue; descendants[prime].push_back(prime); for (size_t i = 0; i + prime < limit; ++i) { integer s = i + prime; for (integer n : descendants[i]) { integer prod = n * prime; descendants[s].push_back(prod); if (prod < limit) ancestor[prod] = s; } } } size_t total_descendants = 0; for (integer i = 1; i < limit; ++i) { std::vector<integer> ancestors(get_ancestors(ancestor, i)); std::cout << "[" << i << "] Level: " << ancestors.size() << '\n'; std::cout << "Ancestors: "; std::sort(ancestors.begin(), ancestors.end()); print_vector(ancestors); std::cout << "Descendants: "; std::vector<integer>& desc = descendants[i]; if (!desc.empty()) { std::sort(desc.begin(), desc.end()); if (desc[0] == i) desc.erase(desc.begin()); } std::cout << desc.size() << '\n'; total_descendants += desc.size(); if (!desc.empty()) print_vector(desc); std::cout << '\n'; } std::cout << "Total descendants: " << total_descendants << '\n'; return 0; }
import java.io.*; import java.util.*; public class PrimeDescendants { public static void main(String[] args) { try (Writer writer = new BufferedWriter(new OutputStreamWriter(System.out))) { printPrimeDesc(writer, 100); } catch (IOException ex) { ex.printStackTrace(); } } private static void printPrimeDesc(Writer writer, int limit) throws IOException { List<Long> primes = findPrimes(limit); List<Long> ancestor = new ArrayList<>(limit); List<List<Long>> descendants = new ArrayList<>(limit); for (int i = 0; i < limit; ++i) { ancestor.add(Long.valueOf(0)); descendants.add(new ArrayList<Long>()); } for (Long prime : primes) { int p = prime.intValue(); descendants.get(p).add(prime); for (int i = 0; i + p < limit; ++i) { int s = i + p; for (Long n : descendants.get(i)) { Long prod = n * p; descendants.get(s).add(prod); if (prod < limit) ancestor.set(prod.intValue(), Long.valueOf(s)); } } } int totalDescendants = 0; for (int i = 1; i < limit; ++i) { List<Long> ancestors = getAncestors(ancestor, i); writer.write("[" + i + "] Level: " + ancestors.size() + "\n"); writer.write("Ancestors: "); Collections.sort(ancestors); print(writer, ancestors); writer.write("Descendants: "); List<Long> desc = descendants.get(i); if (!desc.isEmpty()) { Collections.sort(desc); if (desc.get(0) == i) desc.remove(0); } writer.write(desc.size() + "\n"); totalDescendants += desc.size(); if (!desc.isEmpty()) print(writer, desc); writer.write("\n"); } writer.write("Total descendants: " + totalDescendants + "\n"); } private static List<Long> findPrimes(int limit) { boolean[] isprime = new boolean[limit]; Arrays.fill(isprime, true); isprime[0] = isprime[1] = false; for (int p = 2; p * p < limit; ++p) { if (isprime[p]) { for (int i = p * p; i < limit; i += p) isprime[i] = false; } } List<Long> primes = new ArrayList<>(); for (int p = 2; p < limit; ++p) { if (isprime[p]) primes.add(Long.valueOf(p)); } return primes; } private static List<Long> getAncestors(List<Long> ancestor, int n) { List<Long> result = new ArrayList<>(); for (Long a = ancestor.get(n); a != 0 && a != n; ) { n = a.intValue(); a = ancestor.get(n); result.add(Long.valueOf(n)); } return result; } private static void print(Writer writer, List<Long> list) throws IOException { if (list.isEmpty()) { writer.write("none\n"); return; } int i = 0; writer.write(String.valueOf(list.get(i++))); for (; i != list.size(); ++i) writer.write(", " + list.get(i)); writer.write("\n"); } }
Translate the given C++ code snippet into Java without altering its behavior.
#include <iostream> #include <vector> #include <algorithm> void print(const std::vector<std::vector<int>>& v) { std::cout << "{ "; for (const auto& p : v) { std::cout << "("; for (const auto& e : p) { std::cout << e << " "; } std::cout << ") "; } std::cout << "}" << std::endl; } auto product(const std::vector<std::vector<int>>& lists) { std::vector<std::vector<int>> result; if (std::find_if(std::begin(lists), std::end(lists), [](auto e) -> bool { return e.size() == 0; }) != std::end(lists)) { return result; } for (auto& e : lists[0]) { result.push_back({ e }); } for (size_t i = 1; i < lists.size(); ++i) { std::vector<std::vector<int>> temp; for (auto& e : result) { for (auto f : lists[i]) { auto e_tmp = e; e_tmp.push_back(f); temp.push_back(e_tmp); } } result = temp; } return result; } int main() { std::vector<std::vector<int>> prods[] = { { { 1, 2 }, { 3, 4 } }, { { 3, 4 }, { 1, 2} }, { { 1, 2 }, { } }, { { }, { 1, 2 } }, { { 1776, 1789 }, { 7, 12 }, { 4, 14, 23 }, { 0, 1 } }, { { 1, 2, 3 }, { 30 }, { 500, 100 } }, { { 1, 2, 3 }, { }, { 500, 100 } } }; for (const auto& p : prods) { print(product(p)); } std::cin.ignore(); std::cin.get(); return 0; }
import static java.util.Arrays.asList; import static java.util.Collections.emptyList; import static java.util.Optional.of; import static java.util.stream.Collectors.toList; import java.util.List; public class CartesianProduct { public List<?> product(List<?>... a) { if (a.length >= 2) { List<?> product = a[0]; for (int i = 1; i < a.length; i++) { product = product(product, a[i]); } return product; } return emptyList(); } private <A, B> List<?> product(List<A> a, List<B> b) { return of(a.stream() .map(e1 -> of(b.stream().map(e2 -> asList(e1, e2)).collect(toList())).orElse(emptyList())) .flatMap(List::stream) .collect(toList())).orElse(emptyList()); } }
Preserve the algorithm and functionality while converting the code from C++ to Java.
#include <iostream> #include <vector> #include <algorithm> void print(const std::vector<std::vector<int>>& v) { std::cout << "{ "; for (const auto& p : v) { std::cout << "("; for (const auto& e : p) { std::cout << e << " "; } std::cout << ") "; } std::cout << "}" << std::endl; } auto product(const std::vector<std::vector<int>>& lists) { std::vector<std::vector<int>> result; if (std::find_if(std::begin(lists), std::end(lists), [](auto e) -> bool { return e.size() == 0; }) != std::end(lists)) { return result; } for (auto& e : lists[0]) { result.push_back({ e }); } for (size_t i = 1; i < lists.size(); ++i) { std::vector<std::vector<int>> temp; for (auto& e : result) { for (auto f : lists[i]) { auto e_tmp = e; e_tmp.push_back(f); temp.push_back(e_tmp); } } result = temp; } return result; } int main() { std::vector<std::vector<int>> prods[] = { { { 1, 2 }, { 3, 4 } }, { { 3, 4 }, { 1, 2} }, { { 1, 2 }, { } }, { { }, { 1, 2 } }, { { 1776, 1789 }, { 7, 12 }, { 4, 14, 23 }, { 0, 1 } }, { { 1, 2, 3 }, { 30 }, { 500, 100 } }, { { 1, 2, 3 }, { }, { 500, 100 } } }; for (const auto& p : prods) { print(product(p)); } std::cin.ignore(); std::cin.get(); return 0; }
import static java.util.Arrays.asList; import static java.util.Collections.emptyList; import static java.util.Optional.of; import static java.util.stream.Collectors.toList; import java.util.List; public class CartesianProduct { public List<?> product(List<?>... a) { if (a.length >= 2) { List<?> product = a[0]; for (int i = 1; i < a.length; i++) { product = product(product, a[i]); } return product; } return emptyList(); } private <A, B> List<?> product(List<A> a, List<B> b) { return of(a.stream() .map(e1 -> of(b.stream().map(e2 -> asList(e1, e2)).collect(toList())).orElse(emptyList())) .flatMap(List::stream) .collect(toList())).orElse(emptyList()); } }
Translate the given C++ code snippet into Java without altering its behavior.
#include <functional> #include <algorithm> #include <iostream> #include <vector> #include <cmath> using std::cout; using std::endl; using std::vector; using std::function; using std::transform; using std::back_inserter; typedef function<double(double)> FunType; vector<FunType> A = {sin, cos, tan, [](double x) { return x*x*x; } }; vector<FunType> B = {asin, acos, atan, [](double x) { return exp(log(x)/3); } }; template <typename A, typename B, typename C> function<C(A)> compose(function<C(B)> f, function<B(A)> g) { return [f,g](A x) { return f(g(x)); }; } int main() { vector<FunType> composedFuns; auto exNums = {0.0, 0.2, 0.4, 0.6, 0.8, 1.0}; transform(B.begin(), B.end(), A.begin(), back_inserter(composedFuns), compose<double, double, double>); for (auto num: exNums) for (auto fun: composedFuns) cout << u8"f\u207B\u00B9.f(" << num << ") = " << fun(num) << endl; return 0; }
import java.util.ArrayList; public class FirstClass{ public interface Function<A,B>{ B apply(A x); } public static <A,B,C> Function<A, C> compose( final Function<B, C> f, final Function<A, B> g) { return new Function<A, C>() { @Override public C apply(A x) { return f.apply(g.apply(x)); } }; } public static void main(String[] args){ ArrayList<Function<Double, Double>> functions = new ArrayList<Function<Double,Double>>(); functions.add( new Function<Double, Double>(){ @Override public Double apply(Double x){ return Math.cos(x); } }); functions.add( new Function<Double, Double>(){ @Override public Double apply(Double x){ return Math.tan(x); } }); functions.add( new Function<Double, Double>(){ @Override public Double apply(Double x){ return x * x; } }); ArrayList<Function<Double, Double>> inverse = new ArrayList<Function<Double,Double>>(); inverse.add( new Function<Double, Double>(){ @Override public Double apply(Double x){ return Math.acos(x); } }); inverse.add( new Function<Double, Double>(){ @Override public Double apply(Double x){ return Math.atan(x); } }); inverse.add( new Function<Double, Double>(){ @Override public Double apply(Double x){ return Math.sqrt(x); } }); System.out.println("Compositions:"); for(int i = 0; i < functions.size(); i++){ System.out.println(compose(functions.get(i), inverse.get(i)).apply(0.5)); } System.out.println("Hard-coded compositions:"); System.out.println(Math.cos(Math.acos(0.5))); System.out.println(Math.tan(Math.atan(0.5))); System.out.println(Math.pow(Math.sqrt(0.5), 2)); } }
Keep all operations the same but rewrite the snippet in Java.
#include <vector> #include <iostream> #include <algorithm> std::vector<int> properDivisors ( int number ) { std::vector<int> divisors ; for ( int i = 1 ; i < number / 2 + 1 ; i++ ) if ( number % i == 0 ) divisors.push_back( i ) ; return divisors ; } int main( ) { std::vector<int> divisors ; unsigned int maxdivisors = 0 ; int corresponding_number = 0 ; for ( int i = 1 ; i < 11 ; i++ ) { divisors = properDivisors ( i ) ; std::cout << "Proper divisors of " << i << ":\n" ; for ( int number : divisors ) { std::cout << number << " " ; } std::cout << std::endl ; divisors.clear( ) ; } for ( int i = 11 ; i < 20001 ; i++ ) { divisors = properDivisors ( i ) ; if ( divisors.size( ) > maxdivisors ) { maxdivisors = divisors.size( ) ; corresponding_number = i ; } divisors.clear( ) ; } std::cout << "Most divisors has " << corresponding_number << " , it has " << maxdivisors << " divisors!\n" ; return 0 ; }
import java.util.Collections; import java.util.LinkedList; import java.util.List; public class Proper{ public static List<Integer> properDivs(int n){ List<Integer> divs = new LinkedList<Integer>(); if(n == 1) return divs; divs.add(1); for(int x = 2; x < n; x++){ if(n % x == 0) divs.add(x); } Collections.sort(divs); return divs; } public static void main(String[] args){ for(int x = 1; x <= 10; x++){ System.out.println(x + ": " + properDivs(x)); } int x = 0, count = 0; for(int n = 1; n <= 20000; n++){ if(properDivs(n).size() > count){ x = n; count = properDivs(n).size(); } } System.out.println(x + ": " + count); } }
Generate an equivalent Java version of this C++ code.
#include <vector> #include <utility> #include <iostream> #include <boost/algorithm/string.hpp> std::string create_xml( std::vector<std::string> & ,std::vector<std::string> & ) ; int main( ) { std::vector<std::string> names , remarks ; names.push_back( "April" ) ; names.push_back( "Tam O'Shantor" ) ; names.push_back ( "Emily" ) ; remarks.push_back( "Bubbly, I'm > Tam and <= Emily" ) ; remarks.push_back( "Burns: \"When chapman billies leave the street ...\"" ) ; remarks.push_back( "Short & shrift" ) ; std::cout << "This is in XML:\n" ; std::cout << create_xml( names , remarks ) << std::endl ; return 0 ; } std::string create_xml( std::vector<std::string> & names , std::vector<std::string> & remarks ) { std::vector<std::pair<std::string , std::string> > entities ; entities.push_back( std::make_pair( "&" , "&amp;" ) ) ; entities.push_back( std::make_pair( "<" , "&lt;" ) ) ; entities.push_back( std::make_pair( ">" , "&gt;" ) ) ; std::string xmlstring ( "<CharacterRemarks>\n" ) ; std::vector<std::string>::iterator vsi = names.begin( ) ; typedef std::vector<std::pair<std::string , std::string> >::iterator Vpss ; for ( ; vsi != names.end( ) ; vsi++ ) { for ( Vpss vs = entities.begin( ) ; vs != entities.end( ) ; vs++ ) { boost::replace_all ( *vsi , vs->first , vs->second ) ; } } for ( vsi = remarks.begin( ) ; vsi != remarks.end( ) ; vsi++ ) { for ( Vpss vs = entities.begin( ) ; vs != entities.end( ) ; vs++ ) { boost::replace_all ( *vsi , vs->first , vs->second ) ; } } for ( int i = 0 ; i < names.size( ) ; i++ ) { xmlstring.append( "\t<Character name=\"").append( names[ i ] ).append( "\">") .append( remarks[ i ] ).append( "</Character>\n" ) ; } xmlstring.append( "</CharacterRemarks>" ) ; return xmlstring ; }
import java.io.StringWriter; import javax.xml.parsers.DocumentBuilderFactory; import javax.xml.transform.Result; import javax.xml.transform.Source; import javax.xml.transform.Transformer; import javax.xml.transform.TransformerFactory; import javax.xml.transform.dom.DOMSource; import javax.xml.transform.stream.StreamResult; import org.w3c.dom.Document; import org.w3c.dom.Element; public class XmlCreation { private static final String[] names = {"April", "Tam O'Shanter", "Emily"}; private static final String[] remarks = {"Bubbly: I'm > Tam and <= Emily", "Burns: \"When chapman billies leave the street ...\"", "Short & shrift"}; public static void main(String[] args) { try { final Document doc = DocumentBuilderFactory.newInstance().newDocumentBuilder().newDocument(); final Element root = doc.createElement("CharacterRemarks"); doc.appendChild(root); for(int i = 0; i < names.length; i++) { final Element character = doc.createElement("Character"); root.appendChild(character); character.setAttribute("name", names[i]); character.appendChild(doc.createTextNode(remarks[i])); } final Source source = new DOMSource(doc); final StringWriter buffer = new StringWriter(); final Result result = new StreamResult(buffer); final Transformer transformer = TransformerFactory.newInstance().newTransformer(); transformer.setOutputProperty("indent", "yes"); transformer.transform(source, result); System.out.println(buffer.toString()); } catch (Exception e) { e.printStackTrace(); } } }
Convert this C++ snippet to Java and keep its semantics consistent.
#include <vector> #include <utility> #include <iostream> #include <boost/algorithm/string.hpp> std::string create_xml( std::vector<std::string> & ,std::vector<std::string> & ) ; int main( ) { std::vector<std::string> names , remarks ; names.push_back( "April" ) ; names.push_back( "Tam O'Shantor" ) ; names.push_back ( "Emily" ) ; remarks.push_back( "Bubbly, I'm > Tam and <= Emily" ) ; remarks.push_back( "Burns: \"When chapman billies leave the street ...\"" ) ; remarks.push_back( "Short & shrift" ) ; std::cout << "This is in XML:\n" ; std::cout << create_xml( names , remarks ) << std::endl ; return 0 ; } std::string create_xml( std::vector<std::string> & names , std::vector<std::string> & remarks ) { std::vector<std::pair<std::string , std::string> > entities ; entities.push_back( std::make_pair( "&" , "&amp;" ) ) ; entities.push_back( std::make_pair( "<" , "&lt;" ) ) ; entities.push_back( std::make_pair( ">" , "&gt;" ) ) ; std::string xmlstring ( "<CharacterRemarks>\n" ) ; std::vector<std::string>::iterator vsi = names.begin( ) ; typedef std::vector<std::pair<std::string , std::string> >::iterator Vpss ; for ( ; vsi != names.end( ) ; vsi++ ) { for ( Vpss vs = entities.begin( ) ; vs != entities.end( ) ; vs++ ) { boost::replace_all ( *vsi , vs->first , vs->second ) ; } } for ( vsi = remarks.begin( ) ; vsi != remarks.end( ) ; vsi++ ) { for ( Vpss vs = entities.begin( ) ; vs != entities.end( ) ; vs++ ) { boost::replace_all ( *vsi , vs->first , vs->second ) ; } } for ( int i = 0 ; i < names.size( ) ; i++ ) { xmlstring.append( "\t<Character name=\"").append( names[ i ] ).append( "\">") .append( remarks[ i ] ).append( "</Character>\n" ) ; } xmlstring.append( "</CharacterRemarks>" ) ; return xmlstring ; }
import java.io.StringWriter; import javax.xml.parsers.DocumentBuilderFactory; import javax.xml.transform.Result; import javax.xml.transform.Source; import javax.xml.transform.Transformer; import javax.xml.transform.TransformerFactory; import javax.xml.transform.dom.DOMSource; import javax.xml.transform.stream.StreamResult; import org.w3c.dom.Document; import org.w3c.dom.Element; public class XmlCreation { private static final String[] names = {"April", "Tam O'Shanter", "Emily"}; private static final String[] remarks = {"Bubbly: I'm > Tam and <= Emily", "Burns: \"When chapman billies leave the street ...\"", "Short & shrift"}; public static void main(String[] args) { try { final Document doc = DocumentBuilderFactory.newInstance().newDocumentBuilder().newDocument(); final Element root = doc.createElement("CharacterRemarks"); doc.appendChild(root); for(int i = 0; i < names.length; i++) { final Element character = doc.createElement("Character"); root.appendChild(character); character.setAttribute("name", names[i]); character.appendChild(doc.createTextNode(remarks[i])); } final Source source = new DOMSource(doc); final StringWriter buffer = new StringWriter(); final Result result = new StreamResult(buffer); final Transformer transformer = TransformerFactory.newInstance().newTransformer(); transformer.setOutputProperty("indent", "yes"); transformer.transform(source, result); System.out.println(buffer.toString()); } catch (Exception e) { e.printStackTrace(); } } }
Change the following C++ code into Java without altering its purpose.
#include <windows.h> #include <string> #include <vector> using namespace std; const int HSTEP = 46, MWID = 40, MHEI = 471; const float VSTEP = 2.3f; class vector2 { public: vector2() { x = y = 0; } vector2( float a, float b ) { x = a; y = b; } void set( float a, float b ) { x = a; y = b; } float x, y; }; class myBitmap { public: myBitmap() : pen( NULL ), brush( NULL ), clr( 0 ), wid( 1 ) {} ~myBitmap() { DeleteObject( pen ); DeleteObject( brush ); DeleteDC( hdc ); DeleteObject( bmp ); } bool create( int w, int h ) { BITMAPINFO bi; ZeroMemory( &bi, sizeof( bi ) ); bi.bmiHeader.biSize = sizeof( bi.bmiHeader ); bi.bmiHeader.biBitCount = sizeof( DWORD ) * 8; bi.bmiHeader.biCompression = BI_RGB; bi.bmiHeader.biPlanes = 1; bi.bmiHeader.biWidth = w; bi.bmiHeader.biHeight = -h; HDC dc = GetDC( GetConsoleWindow() ); bmp = CreateDIBSection( dc, &bi, DIB_RGB_COLORS, &pBits, NULL, 0 ); if( !bmp ) return false; hdc = CreateCompatibleDC( dc ); SelectObject( hdc, bmp ); ReleaseDC( GetConsoleWindow(), dc ); width = w; height = h; return true; } void clear( BYTE clr = 0 ) { memset( pBits, clr, width * height * sizeof( DWORD ) ); } void setBrushColor( DWORD bClr ) { if( brush ) DeleteObject( brush ); brush = CreateSolidBrush( bClr ); SelectObject( hdc, brush ); } void setPenColor( DWORD c ) { clr = c; createPen(); } void setPenWidth( int w ) { wid = w; createPen(); } void saveBitmap( string path ) { BITMAPFILEHEADER fileheader; BITMAPINFO infoheader; BITMAP bitmap; DWORD wb; GetObject( bmp, sizeof( bitmap ), &bitmap ); DWORD* dwpBits = new DWORD[bitmap.bmWidth * bitmap.bmHeight]; ZeroMemory( dwpBits, bitmap.bmWidth * bitmap.bmHeight * sizeof( DWORD ) ); ZeroMemory( &infoheader, sizeof( BITMAPINFO ) ); ZeroMemory( &fileheader, sizeof( BITMAPFILEHEADER ) ); infoheader.bmiHeader.biBitCount = sizeof( DWORD ) * 8; infoheader.bmiHeader.biCompression = BI_RGB; infoheader.bmiHeader.biPlanes = 1; infoheader.bmiHeader.biSize = sizeof( infoheader.bmiHeader ); infoheader.bmiHeader.biHeight = bitmap.bmHeight; infoheader.bmiHeader.biWidth = bitmap.bmWidth; infoheader.bmiHeader.biSizeImage = bitmap.bmWidth * bitmap.bmHeight * sizeof( DWORD ); fileheader.bfType = 0x4D42; fileheader.bfOffBits = sizeof( infoheader.bmiHeader ) + sizeof( BITMAPFILEHEADER ); fileheader.bfSize = fileheader.bfOffBits + infoheader.bmiHeader.biSizeImage; GetDIBits( hdc, bmp, 0, height, ( LPVOID )dwpBits, &infoheader, DIB_RGB_COLORS ); HANDLE file = CreateFile( path.c_str(), GENERIC_WRITE, 0, NULL, CREATE_ALWAYS, FILE_ATTRIBUTE_NORMAL, NULL ); WriteFile( file, &fileheader, sizeof( BITMAPFILEHEADER ), &wb, NULL ); WriteFile( file, &infoheader.bmiHeader, sizeof( infoheader.bmiHeader ), &wb, NULL ); WriteFile( file, dwpBits, bitmap.bmWidth * bitmap.bmHeight * 4, &wb, NULL ); CloseHandle( file ); delete [] dwpBits; } HDC getDC() const { return hdc; } int getWidth() const { return width; } int getHeight() const { return height; } private: void createPen() { if( pen ) DeleteObject( pen ); pen = CreatePen( PS_SOLID, wid, clr ); SelectObject( hdc, pen ); } HBITMAP bmp; HDC hdc; HPEN pen; HBRUSH brush; void *pBits; int width, height, wid; DWORD clr; }; class plot { public: plot() { bmp.create( 512, 512 ); } void draw( vector<vector2>* pairs ) { bmp.clear( 0xff ); drawGraph( pairs ); plotIt( pairs ); HDC dc = GetDC( GetConsoleWindow() ); BitBlt( dc, 0, 30, 512, 512, bmp.getDC(), 0, 0, SRCCOPY ); ReleaseDC( GetConsoleWindow(), dc ); } private: void drawGraph( vector<vector2>* pairs ) { HDC dc = bmp.getDC(); bmp.setPenColor( RGB( 240, 240, 240 ) ); DWORD b = 11, c = 40, x; RECT rc; char txt[8]; for( x = 0; x < pairs->size(); x++ ) { MoveToEx( dc, 40, b, NULL ); LineTo( dc, 500, b ); MoveToEx( dc, c, 11, NULL ); LineTo( dc, c, 471 ); wsprintf( txt, "%d", ( pairs->size() - x ) * 20 ); SetRect( &rc, 0, b - 9, 36, b + 11 ); DrawText( dc, txt, lstrlen( txt ), &rc, DT_RIGHT | DT_VCENTER | DT_SINGLELINE ); wsprintf( txt, "%d", x ); SetRect( &rc, c - 8, 472, c + 8, 492 ); DrawText( dc, txt, lstrlen( txt ), &rc, DT_CENTER | DT_VCENTER | DT_SINGLELINE ); c += 46; b += 46; } SetRect( &rc, 0, b - 9, 36, b + 11 ); DrawText( dc, "0", 1, &rc, DT_RIGHT | DT_VCENTER | DT_SINGLELINE ); bmp.setPenColor( 0 ); bmp.setPenWidth( 3 ); MoveToEx( dc, 40, 11, NULL ); LineTo( dc, 40, 471 ); MoveToEx( dc, 40, 471, NULL ); LineTo( dc, 500, 471 ); } void plotIt( vector<vector2>* pairs ) { HDC dc = bmp.getDC(); HBRUSH br = CreateSolidBrush( 255 ); RECT rc; bmp.setPenColor( 255 ); bmp.setPenWidth( 2 ); vector<vector2>::iterator it = pairs->begin(); int a = MWID + HSTEP * static_cast<int>( ( *it ).x ), b = MHEI - static_cast<int>( VSTEP * ( *it ).y ); MoveToEx( dc, a, b, NULL ); SetRect( &rc, a - 3, b - 3, a + 3, b + 3 ); FillRect( dc, &rc, br ); it++; for( ; it < pairs->end(); it++ ) { a = MWID + HSTEP * static_cast<int>( ( *it ).x ); b = MHEI - static_cast<int>( VSTEP * ( *it ).y ); SetRect( &rc, a - 3, b - 3, a + 3, b + 3 ); FillRect( dc, &rc, br ); LineTo( dc, a, b ); } DeleteObject( br ); } myBitmap bmp; }; int main( int argc, char* argv[] ) { ShowWindow( GetConsoleWindow(), SW_MAXIMIZE ); plot pt; vector<vector2> pairs; pairs.push_back( vector2( 0, 2.7f ) ); pairs.push_back( vector2( 1, 2.8f ) ); pairs.push_back( vector2( 2.0f, 31.4f ) ); pairs.push_back( vector2( 3.0f, 38.1f ) ); pairs.push_back( vector2( 4.0f, 58.0f ) ); pairs.push_back( vector2( 5.0f, 76.2f ) ); pairs.push_back( vector2( 6.0f, 100.5f ) ); pairs.push_back( vector2( 7.0f, 130.0f ) ); pairs.push_back( vector2( 8.0f, 149.3f ) ); pairs.push_back( vector2( 9.0f, 180.0f ) ); pt.draw( &pairs ); system( "pause" ); return 0; }
import java.awt.*; import java.awt.event.*; import java.awt.geom.*; import javax.swing.JApplet; import javax.swing.JFrame; public class Plot2d extends JApplet { double[] xi; double[] yi; public Plot2d(double[] x, double[] y) { this.xi = x; this.yi = y; } public static double max(double[] t) { double maximum = t[0]; for (int i = 1; i < t.length; i++) { if (t[i] > maximum) { maximum = t[i]; } } return maximum; } public static double min(double[] t) { double minimum = t[0]; for (int i = 1; i < t.length; i++) { if (t[i] < minimum) { minimum = t[i]; } } return minimum; } public void init() { setBackground(Color.white); setForeground(Color.white); } public void paint(Graphics g) { Graphics2D g2 = (Graphics2D) g; g2.setRenderingHint(RenderingHints.KEY_ANTIALIASING, RenderingHints.VALUE_ANTIALIAS_ON); g2.setPaint(Color.black); int x0 = 70; int y0 = 10; int xm = 670; int ym = 410; int xspan = xm - x0; int yspan = ym - y0; double xmax = max(xi); double xmin = min(xi); double ymax = max(yi); double ymin = min(yi); g2.draw(new Line2D.Double(x0, ym, xm, ym)); g2.draw(new Line2D.Double(x0, ym, x0, y0)); for (int j = 0; j < 5; j++) { int interv = 4; g2.drawString("" + (j * (xmax - xmin) / interv + xmin), j * xspan / interv + x0 - 10, ym + 20); g2.drawString("" + (j * (ymax - ymin) / interv + ymin), x0 - 20 - (int) (9 * Math.log10(ymax)), ym - j * yspan / interv + y0 - 5); g2.draw(new Line2D.Double(j * xspan / interv + x0, ym, j * xspan / interv + x0, ym + 5)); g2.draw(new Line2D.Double(x0 - 5, j * yspan / interv + y0, x0, j * yspan / interv + y0)); } for (int i = 0; i < xi.length; i++) { int f = (int) ((xi[i] - xmin) * xspan / (xmax - xmin)); int h = (int) (((ymax - ymin) - (yi[i] - ymin)) * yspan / (ymax - ymin)); g2.drawString("o", x0 + f - 3, h + 14); } for (int i = 0; i < xi.length - 1; i++) { int f = (int) ((xi[i] - xmin) * xspan / (xmax - xmin)); int f2 = (int) ((xi[i + 1] - xmin) * xspan / (xmax - xmin)); int h = (int) (((ymax - ymin) - (yi[i] - ymin)) * yspan / (ymax - ymin)); int h2 = (int) (((ymax - ymin) - (yi[i + 1] - ymin)) * yspan / (ymax - ymin)); g2.draw(new Line2D.Double(f + x0, h + y0, f2 + x0, h2 + y0)); } } public static void main(String args[]) { JFrame f = new JFrame("ShapesDemo2D"); f.addWindowListener(new WindowAdapter() { public void windowClosing(WindowEvent e) { System.exit(0); } }); double[] r = {0, 1, 2, 3, 4, 5, 6, 7, 8, 9}; double[] t = {2.7, 2.8, 31.4, 38.1, 58.0, 76.2, 100.5, 130.0, 149.3, 180.09}; JApplet applet = new Plot2d(r, t); f.getContentPane().add("Center", applet); applet.init(); f.pack(); f.setSize(new Dimension(720, 480)); f.show(); } }
Convert this C++ snippet to Java and keep its semantics consistent.
#include <windows.h> #include <string> #include <vector> using namespace std; const int HSTEP = 46, MWID = 40, MHEI = 471; const float VSTEP = 2.3f; class vector2 { public: vector2() { x = y = 0; } vector2( float a, float b ) { x = a; y = b; } void set( float a, float b ) { x = a; y = b; } float x, y; }; class myBitmap { public: myBitmap() : pen( NULL ), brush( NULL ), clr( 0 ), wid( 1 ) {} ~myBitmap() { DeleteObject( pen ); DeleteObject( brush ); DeleteDC( hdc ); DeleteObject( bmp ); } bool create( int w, int h ) { BITMAPINFO bi; ZeroMemory( &bi, sizeof( bi ) ); bi.bmiHeader.biSize = sizeof( bi.bmiHeader ); bi.bmiHeader.biBitCount = sizeof( DWORD ) * 8; bi.bmiHeader.biCompression = BI_RGB; bi.bmiHeader.biPlanes = 1; bi.bmiHeader.biWidth = w; bi.bmiHeader.biHeight = -h; HDC dc = GetDC( GetConsoleWindow() ); bmp = CreateDIBSection( dc, &bi, DIB_RGB_COLORS, &pBits, NULL, 0 ); if( !bmp ) return false; hdc = CreateCompatibleDC( dc ); SelectObject( hdc, bmp ); ReleaseDC( GetConsoleWindow(), dc ); width = w; height = h; return true; } void clear( BYTE clr = 0 ) { memset( pBits, clr, width * height * sizeof( DWORD ) ); } void setBrushColor( DWORD bClr ) { if( brush ) DeleteObject( brush ); brush = CreateSolidBrush( bClr ); SelectObject( hdc, brush ); } void setPenColor( DWORD c ) { clr = c; createPen(); } void setPenWidth( int w ) { wid = w; createPen(); } void saveBitmap( string path ) { BITMAPFILEHEADER fileheader; BITMAPINFO infoheader; BITMAP bitmap; DWORD wb; GetObject( bmp, sizeof( bitmap ), &bitmap ); DWORD* dwpBits = new DWORD[bitmap.bmWidth * bitmap.bmHeight]; ZeroMemory( dwpBits, bitmap.bmWidth * bitmap.bmHeight * sizeof( DWORD ) ); ZeroMemory( &infoheader, sizeof( BITMAPINFO ) ); ZeroMemory( &fileheader, sizeof( BITMAPFILEHEADER ) ); infoheader.bmiHeader.biBitCount = sizeof( DWORD ) * 8; infoheader.bmiHeader.biCompression = BI_RGB; infoheader.bmiHeader.biPlanes = 1; infoheader.bmiHeader.biSize = sizeof( infoheader.bmiHeader ); infoheader.bmiHeader.biHeight = bitmap.bmHeight; infoheader.bmiHeader.biWidth = bitmap.bmWidth; infoheader.bmiHeader.biSizeImage = bitmap.bmWidth * bitmap.bmHeight * sizeof( DWORD ); fileheader.bfType = 0x4D42; fileheader.bfOffBits = sizeof( infoheader.bmiHeader ) + sizeof( BITMAPFILEHEADER ); fileheader.bfSize = fileheader.bfOffBits + infoheader.bmiHeader.biSizeImage; GetDIBits( hdc, bmp, 0, height, ( LPVOID )dwpBits, &infoheader, DIB_RGB_COLORS ); HANDLE file = CreateFile( path.c_str(), GENERIC_WRITE, 0, NULL, CREATE_ALWAYS, FILE_ATTRIBUTE_NORMAL, NULL ); WriteFile( file, &fileheader, sizeof( BITMAPFILEHEADER ), &wb, NULL ); WriteFile( file, &infoheader.bmiHeader, sizeof( infoheader.bmiHeader ), &wb, NULL ); WriteFile( file, dwpBits, bitmap.bmWidth * bitmap.bmHeight * 4, &wb, NULL ); CloseHandle( file ); delete [] dwpBits; } HDC getDC() const { return hdc; } int getWidth() const { return width; } int getHeight() const { return height; } private: void createPen() { if( pen ) DeleteObject( pen ); pen = CreatePen( PS_SOLID, wid, clr ); SelectObject( hdc, pen ); } HBITMAP bmp; HDC hdc; HPEN pen; HBRUSH brush; void *pBits; int width, height, wid; DWORD clr; }; class plot { public: plot() { bmp.create( 512, 512 ); } void draw( vector<vector2>* pairs ) { bmp.clear( 0xff ); drawGraph( pairs ); plotIt( pairs ); HDC dc = GetDC( GetConsoleWindow() ); BitBlt( dc, 0, 30, 512, 512, bmp.getDC(), 0, 0, SRCCOPY ); ReleaseDC( GetConsoleWindow(), dc ); } private: void drawGraph( vector<vector2>* pairs ) { HDC dc = bmp.getDC(); bmp.setPenColor( RGB( 240, 240, 240 ) ); DWORD b = 11, c = 40, x; RECT rc; char txt[8]; for( x = 0; x < pairs->size(); x++ ) { MoveToEx( dc, 40, b, NULL ); LineTo( dc, 500, b ); MoveToEx( dc, c, 11, NULL ); LineTo( dc, c, 471 ); wsprintf( txt, "%d", ( pairs->size() - x ) * 20 ); SetRect( &rc, 0, b - 9, 36, b + 11 ); DrawText( dc, txt, lstrlen( txt ), &rc, DT_RIGHT | DT_VCENTER | DT_SINGLELINE ); wsprintf( txt, "%d", x ); SetRect( &rc, c - 8, 472, c + 8, 492 ); DrawText( dc, txt, lstrlen( txt ), &rc, DT_CENTER | DT_VCENTER | DT_SINGLELINE ); c += 46; b += 46; } SetRect( &rc, 0, b - 9, 36, b + 11 ); DrawText( dc, "0", 1, &rc, DT_RIGHT | DT_VCENTER | DT_SINGLELINE ); bmp.setPenColor( 0 ); bmp.setPenWidth( 3 ); MoveToEx( dc, 40, 11, NULL ); LineTo( dc, 40, 471 ); MoveToEx( dc, 40, 471, NULL ); LineTo( dc, 500, 471 ); } void plotIt( vector<vector2>* pairs ) { HDC dc = bmp.getDC(); HBRUSH br = CreateSolidBrush( 255 ); RECT rc; bmp.setPenColor( 255 ); bmp.setPenWidth( 2 ); vector<vector2>::iterator it = pairs->begin(); int a = MWID + HSTEP * static_cast<int>( ( *it ).x ), b = MHEI - static_cast<int>( VSTEP * ( *it ).y ); MoveToEx( dc, a, b, NULL ); SetRect( &rc, a - 3, b - 3, a + 3, b + 3 ); FillRect( dc, &rc, br ); it++; for( ; it < pairs->end(); it++ ) { a = MWID + HSTEP * static_cast<int>( ( *it ).x ); b = MHEI - static_cast<int>( VSTEP * ( *it ).y ); SetRect( &rc, a - 3, b - 3, a + 3, b + 3 ); FillRect( dc, &rc, br ); LineTo( dc, a, b ); } DeleteObject( br ); } myBitmap bmp; }; int main( int argc, char* argv[] ) { ShowWindow( GetConsoleWindow(), SW_MAXIMIZE ); plot pt; vector<vector2> pairs; pairs.push_back( vector2( 0, 2.7f ) ); pairs.push_back( vector2( 1, 2.8f ) ); pairs.push_back( vector2( 2.0f, 31.4f ) ); pairs.push_back( vector2( 3.0f, 38.1f ) ); pairs.push_back( vector2( 4.0f, 58.0f ) ); pairs.push_back( vector2( 5.0f, 76.2f ) ); pairs.push_back( vector2( 6.0f, 100.5f ) ); pairs.push_back( vector2( 7.0f, 130.0f ) ); pairs.push_back( vector2( 8.0f, 149.3f ) ); pairs.push_back( vector2( 9.0f, 180.0f ) ); pt.draw( &pairs ); system( "pause" ); return 0; }
import java.awt.*; import java.awt.event.*; import java.awt.geom.*; import javax.swing.JApplet; import javax.swing.JFrame; public class Plot2d extends JApplet { double[] xi; double[] yi; public Plot2d(double[] x, double[] y) { this.xi = x; this.yi = y; } public static double max(double[] t) { double maximum = t[0]; for (int i = 1; i < t.length; i++) { if (t[i] > maximum) { maximum = t[i]; } } return maximum; } public static double min(double[] t) { double minimum = t[0]; for (int i = 1; i < t.length; i++) { if (t[i] < minimum) { minimum = t[i]; } } return minimum; } public void init() { setBackground(Color.white); setForeground(Color.white); } public void paint(Graphics g) { Graphics2D g2 = (Graphics2D) g; g2.setRenderingHint(RenderingHints.KEY_ANTIALIASING, RenderingHints.VALUE_ANTIALIAS_ON); g2.setPaint(Color.black); int x0 = 70; int y0 = 10; int xm = 670; int ym = 410; int xspan = xm - x0; int yspan = ym - y0; double xmax = max(xi); double xmin = min(xi); double ymax = max(yi); double ymin = min(yi); g2.draw(new Line2D.Double(x0, ym, xm, ym)); g2.draw(new Line2D.Double(x0, ym, x0, y0)); for (int j = 0; j < 5; j++) { int interv = 4; g2.drawString("" + (j * (xmax - xmin) / interv + xmin), j * xspan / interv + x0 - 10, ym + 20); g2.drawString("" + (j * (ymax - ymin) / interv + ymin), x0 - 20 - (int) (9 * Math.log10(ymax)), ym - j * yspan / interv + y0 - 5); g2.draw(new Line2D.Double(j * xspan / interv + x0, ym, j * xspan / interv + x0, ym + 5)); g2.draw(new Line2D.Double(x0 - 5, j * yspan / interv + y0, x0, j * yspan / interv + y0)); } for (int i = 0; i < xi.length; i++) { int f = (int) ((xi[i] - xmin) * xspan / (xmax - xmin)); int h = (int) (((ymax - ymin) - (yi[i] - ymin)) * yspan / (ymax - ymin)); g2.drawString("o", x0 + f - 3, h + 14); } for (int i = 0; i < xi.length - 1; i++) { int f = (int) ((xi[i] - xmin) * xspan / (xmax - xmin)); int f2 = (int) ((xi[i + 1] - xmin) * xspan / (xmax - xmin)); int h = (int) (((ymax - ymin) - (yi[i] - ymin)) * yspan / (ymax - ymin)); int h2 = (int) (((ymax - ymin) - (yi[i + 1] - ymin)) * yspan / (ymax - ymin)); g2.draw(new Line2D.Double(f + x0, h + y0, f2 + x0, h2 + y0)); } } public static void main(String args[]) { JFrame f = new JFrame("ShapesDemo2D"); f.addWindowListener(new WindowAdapter() { public void windowClosing(WindowEvent e) { System.exit(0); } }); double[] r = {0, 1, 2, 3, 4, 5, 6, 7, 8, 9}; double[] t = {2.7, 2.8, 31.4, 38.1, 58.0, 76.2, 100.5, 130.0, 149.3, 180.09}; JApplet applet = new Plot2d(r, t); f.getContentPane().add("Center", applet); applet.init(); f.pack(); f.setSize(new Dimension(720, 480)); f.show(); } }
Translate this program into Java but keep the logic exactly as in C++.
#include <windows.h> #include <string> #include <vector> using namespace std; const int HSTEP = 46, MWID = 40, MHEI = 471; const float VSTEP = 2.3f; class vector2 { public: vector2() { x = y = 0; } vector2( float a, float b ) { x = a; y = b; } void set( float a, float b ) { x = a; y = b; } float x, y; }; class myBitmap { public: myBitmap() : pen( NULL ), brush( NULL ), clr( 0 ), wid( 1 ) {} ~myBitmap() { DeleteObject( pen ); DeleteObject( brush ); DeleteDC( hdc ); DeleteObject( bmp ); } bool create( int w, int h ) { BITMAPINFO bi; ZeroMemory( &bi, sizeof( bi ) ); bi.bmiHeader.biSize = sizeof( bi.bmiHeader ); bi.bmiHeader.biBitCount = sizeof( DWORD ) * 8; bi.bmiHeader.biCompression = BI_RGB; bi.bmiHeader.biPlanes = 1; bi.bmiHeader.biWidth = w; bi.bmiHeader.biHeight = -h; HDC dc = GetDC( GetConsoleWindow() ); bmp = CreateDIBSection( dc, &bi, DIB_RGB_COLORS, &pBits, NULL, 0 ); if( !bmp ) return false; hdc = CreateCompatibleDC( dc ); SelectObject( hdc, bmp ); ReleaseDC( GetConsoleWindow(), dc ); width = w; height = h; return true; } void clear( BYTE clr = 0 ) { memset( pBits, clr, width * height * sizeof( DWORD ) ); } void setBrushColor( DWORD bClr ) { if( brush ) DeleteObject( brush ); brush = CreateSolidBrush( bClr ); SelectObject( hdc, brush ); } void setPenColor( DWORD c ) { clr = c; createPen(); } void setPenWidth( int w ) { wid = w; createPen(); } void saveBitmap( string path ) { BITMAPFILEHEADER fileheader; BITMAPINFO infoheader; BITMAP bitmap; DWORD wb; GetObject( bmp, sizeof( bitmap ), &bitmap ); DWORD* dwpBits = new DWORD[bitmap.bmWidth * bitmap.bmHeight]; ZeroMemory( dwpBits, bitmap.bmWidth * bitmap.bmHeight * sizeof( DWORD ) ); ZeroMemory( &infoheader, sizeof( BITMAPINFO ) ); ZeroMemory( &fileheader, sizeof( BITMAPFILEHEADER ) ); infoheader.bmiHeader.biBitCount = sizeof( DWORD ) * 8; infoheader.bmiHeader.biCompression = BI_RGB; infoheader.bmiHeader.biPlanes = 1; infoheader.bmiHeader.biSize = sizeof( infoheader.bmiHeader ); infoheader.bmiHeader.biHeight = bitmap.bmHeight; infoheader.bmiHeader.biWidth = bitmap.bmWidth; infoheader.bmiHeader.biSizeImage = bitmap.bmWidth * bitmap.bmHeight * sizeof( DWORD ); fileheader.bfType = 0x4D42; fileheader.bfOffBits = sizeof( infoheader.bmiHeader ) + sizeof( BITMAPFILEHEADER ); fileheader.bfSize = fileheader.bfOffBits + infoheader.bmiHeader.biSizeImage; GetDIBits( hdc, bmp, 0, height, ( LPVOID )dwpBits, &infoheader, DIB_RGB_COLORS ); HANDLE file = CreateFile( path.c_str(), GENERIC_WRITE, 0, NULL, CREATE_ALWAYS, FILE_ATTRIBUTE_NORMAL, NULL ); WriteFile( file, &fileheader, sizeof( BITMAPFILEHEADER ), &wb, NULL ); WriteFile( file, &infoheader.bmiHeader, sizeof( infoheader.bmiHeader ), &wb, NULL ); WriteFile( file, dwpBits, bitmap.bmWidth * bitmap.bmHeight * 4, &wb, NULL ); CloseHandle( file ); delete [] dwpBits; } HDC getDC() const { return hdc; } int getWidth() const { return width; } int getHeight() const { return height; } private: void createPen() { if( pen ) DeleteObject( pen ); pen = CreatePen( PS_SOLID, wid, clr ); SelectObject( hdc, pen ); } HBITMAP bmp; HDC hdc; HPEN pen; HBRUSH brush; void *pBits; int width, height, wid; DWORD clr; }; class plot { public: plot() { bmp.create( 512, 512 ); } void draw( vector<vector2>* pairs ) { bmp.clear( 0xff ); drawGraph( pairs ); plotIt( pairs ); HDC dc = GetDC( GetConsoleWindow() ); BitBlt( dc, 0, 30, 512, 512, bmp.getDC(), 0, 0, SRCCOPY ); ReleaseDC( GetConsoleWindow(), dc ); } private: void drawGraph( vector<vector2>* pairs ) { HDC dc = bmp.getDC(); bmp.setPenColor( RGB( 240, 240, 240 ) ); DWORD b = 11, c = 40, x; RECT rc; char txt[8]; for( x = 0; x < pairs->size(); x++ ) { MoveToEx( dc, 40, b, NULL ); LineTo( dc, 500, b ); MoveToEx( dc, c, 11, NULL ); LineTo( dc, c, 471 ); wsprintf( txt, "%d", ( pairs->size() - x ) * 20 ); SetRect( &rc, 0, b - 9, 36, b + 11 ); DrawText( dc, txt, lstrlen( txt ), &rc, DT_RIGHT | DT_VCENTER | DT_SINGLELINE ); wsprintf( txt, "%d", x ); SetRect( &rc, c - 8, 472, c + 8, 492 ); DrawText( dc, txt, lstrlen( txt ), &rc, DT_CENTER | DT_VCENTER | DT_SINGLELINE ); c += 46; b += 46; } SetRect( &rc, 0, b - 9, 36, b + 11 ); DrawText( dc, "0", 1, &rc, DT_RIGHT | DT_VCENTER | DT_SINGLELINE ); bmp.setPenColor( 0 ); bmp.setPenWidth( 3 ); MoveToEx( dc, 40, 11, NULL ); LineTo( dc, 40, 471 ); MoveToEx( dc, 40, 471, NULL ); LineTo( dc, 500, 471 ); } void plotIt( vector<vector2>* pairs ) { HDC dc = bmp.getDC(); HBRUSH br = CreateSolidBrush( 255 ); RECT rc; bmp.setPenColor( 255 ); bmp.setPenWidth( 2 ); vector<vector2>::iterator it = pairs->begin(); int a = MWID + HSTEP * static_cast<int>( ( *it ).x ), b = MHEI - static_cast<int>( VSTEP * ( *it ).y ); MoveToEx( dc, a, b, NULL ); SetRect( &rc, a - 3, b - 3, a + 3, b + 3 ); FillRect( dc, &rc, br ); it++; for( ; it < pairs->end(); it++ ) { a = MWID + HSTEP * static_cast<int>( ( *it ).x ); b = MHEI - static_cast<int>( VSTEP * ( *it ).y ); SetRect( &rc, a - 3, b - 3, a + 3, b + 3 ); FillRect( dc, &rc, br ); LineTo( dc, a, b ); } DeleteObject( br ); } myBitmap bmp; }; int main( int argc, char* argv[] ) { ShowWindow( GetConsoleWindow(), SW_MAXIMIZE ); plot pt; vector<vector2> pairs; pairs.push_back( vector2( 0, 2.7f ) ); pairs.push_back( vector2( 1, 2.8f ) ); pairs.push_back( vector2( 2.0f, 31.4f ) ); pairs.push_back( vector2( 3.0f, 38.1f ) ); pairs.push_back( vector2( 4.0f, 58.0f ) ); pairs.push_back( vector2( 5.0f, 76.2f ) ); pairs.push_back( vector2( 6.0f, 100.5f ) ); pairs.push_back( vector2( 7.0f, 130.0f ) ); pairs.push_back( vector2( 8.0f, 149.3f ) ); pairs.push_back( vector2( 9.0f, 180.0f ) ); pt.draw( &pairs ); system( "pause" ); return 0; }
import java.awt.*; import java.awt.event.*; import java.awt.geom.*; import javax.swing.JApplet; import javax.swing.JFrame; public class Plot2d extends JApplet { double[] xi; double[] yi; public Plot2d(double[] x, double[] y) { this.xi = x; this.yi = y; } public static double max(double[] t) { double maximum = t[0]; for (int i = 1; i < t.length; i++) { if (t[i] > maximum) { maximum = t[i]; } } return maximum; } public static double min(double[] t) { double minimum = t[0]; for (int i = 1; i < t.length; i++) { if (t[i] < minimum) { minimum = t[i]; } } return minimum; } public void init() { setBackground(Color.white); setForeground(Color.white); } public void paint(Graphics g) { Graphics2D g2 = (Graphics2D) g; g2.setRenderingHint(RenderingHints.KEY_ANTIALIASING, RenderingHints.VALUE_ANTIALIAS_ON); g2.setPaint(Color.black); int x0 = 70; int y0 = 10; int xm = 670; int ym = 410; int xspan = xm - x0; int yspan = ym - y0; double xmax = max(xi); double xmin = min(xi); double ymax = max(yi); double ymin = min(yi); g2.draw(new Line2D.Double(x0, ym, xm, ym)); g2.draw(new Line2D.Double(x0, ym, x0, y0)); for (int j = 0; j < 5; j++) { int interv = 4; g2.drawString("" + (j * (xmax - xmin) / interv + xmin), j * xspan / interv + x0 - 10, ym + 20); g2.drawString("" + (j * (ymax - ymin) / interv + ymin), x0 - 20 - (int) (9 * Math.log10(ymax)), ym - j * yspan / interv + y0 - 5); g2.draw(new Line2D.Double(j * xspan / interv + x0, ym, j * xspan / interv + x0, ym + 5)); g2.draw(new Line2D.Double(x0 - 5, j * yspan / interv + y0, x0, j * yspan / interv + y0)); } for (int i = 0; i < xi.length; i++) { int f = (int) ((xi[i] - xmin) * xspan / (xmax - xmin)); int h = (int) (((ymax - ymin) - (yi[i] - ymin)) * yspan / (ymax - ymin)); g2.drawString("o", x0 + f - 3, h + 14); } for (int i = 0; i < xi.length - 1; i++) { int f = (int) ((xi[i] - xmin) * xspan / (xmax - xmin)); int f2 = (int) ((xi[i + 1] - xmin) * xspan / (xmax - xmin)); int h = (int) (((ymax - ymin) - (yi[i] - ymin)) * yspan / (ymax - ymin)); int h2 = (int) (((ymax - ymin) - (yi[i + 1] - ymin)) * yspan / (ymax - ymin)); g2.draw(new Line2D.Double(f + x0, h + y0, f2 + x0, h2 + y0)); } } public static void main(String args[]) { JFrame f = new JFrame("ShapesDemo2D"); f.addWindowListener(new WindowAdapter() { public void windowClosing(WindowEvent e) { System.exit(0); } }); double[] r = {0, 1, 2, 3, 4, 5, 6, 7, 8, 9}; double[] t = {2.7, 2.8, 31.4, 38.1, 58.0, 76.2, 100.5, 130.0, 149.3, 180.09}; JApplet applet = new Plot2d(r, t); f.getContentPane().add("Center", applet); applet.init(); f.pack(); f.setSize(new Dimension(720, 480)); f.show(); } }
Write the same code in Java as shown below in C++.
#include <iostream> #include <string> #include <iterator> #include <regex> int main() { std::regex re(".* string$"); std::string s = "Hi, I am a string"; if (std::regex_match(s, re)) std::cout << "The string matches.\n"; else std::cout << "Oops - not found?\n"; std::regex re2(" a.*a"); std::smatch match; if (std::regex_search(s, match, re2)) { std::cout << "Matched " << match.length() << " characters starting at " << match.position() << ".\n"; std::cout << "Matched character sequence: \"" << match.str() << "\"\n"; } else { std::cout << "Oops - not found?\n"; } std::string dest_string; std::regex_replace(std::back_inserter(dest_string), s.begin(), s.end(), re2, "'m now a changed"); std::cout << dest_string << std::endl; }
String str = "I am a string"; if (str.matches(".*string")) { System.out.println("ends with 'string'"); }
Convert this C++ snippet to Java and keep its semantics consistent.
#include <iostream> #include <algorithm> #include <string> #include <iterator> struct GuessNumberIterator : std::iterator<std::random_access_iterator_tag, int> { int i; GuessNumberIterator() { } GuessNumberIterator(int _i) : i(_i) { } GuessNumberIterator& operator++() { ++i; return *this; } GuessNumberIterator operator++(int) { GuessNumberIterator tmp = *this; ++(*this); return tmp; } bool operator==(const GuessNumberIterator& y) { return i == y.i; } bool operator!=(const GuessNumberIterator& y) { return i != y.i; } int operator*() { std::cout << "Is your number less than or equal to " << i << "? "; std::string s; std::cin >> s; return (s != "" && (s[0] == 'y' || s[0] == 'Y')) ? 0 : -1; } GuessNumberIterator& operator--() { --i; return *this; } GuessNumberIterator operator--(int) { GuessNumberIterator tmp = *this; --(*this); return tmp; } GuessNumberIterator& operator+=(int n) { i += n; return *this; } GuessNumberIterator& operator-=(int n) { i -= n; return *this; } GuessNumberIterator operator+(int n) { GuessNumberIterator tmp = *this; return tmp += n; } GuessNumberIterator operator-(int n) { GuessNumberIterator tmp = *this; return tmp -= n; } int operator-(const GuessNumberIterator &y) { return i - y.i; } int operator[](int n) { return *(*this + n); } bool operator<(const GuessNumberIterator &y) { return i < y.i; } bool operator>(const GuessNumberIterator &y) { return i > y.i; } bool operator<=(const GuessNumberIterator &y) { return i <= y.i; } bool operator>=(const GuessNumberIterator &y) { return i >= y.i; } }; inline GuessNumberIterator operator+(int n, GuessNumberIterator &i) { return i + n; } const int lower = 0; const int upper = 100; int main() { std::cout << "Instructions:\n" << "Think of integer number from " << lower << " (inclusive) to " << upper << " (exclusive) and\n" << "I will guess it. After each guess, I will ask you if it is less than\n" << "or equal to some number, and you will respond with \"yes\" or \"no\".\n"; int answer = std::lower_bound(GuessNumberIterator(lower), GuessNumberIterator(upper), 0).i; std::cout << "Your number is " << answer << ".\n"; return 0; }
import java.util.AbstractList; import java.util.Collections; import java.util.Scanner; public class GuessNumber { public static final int LOWER = 0, UPPER = 100; public static void main(String[] args) { System.out.printf("Instructions:\n" + "Think of integer number from %d (inclusive) to %d (exclusive) and\n" + "I will guess it. After each guess, you respond with L, H, or C depending\n" + "on if my guess was too low, too high, or correct.\n", LOWER, UPPER); int result = Collections.binarySearch(new AbstractList<Integer>() { private final Scanner in = new Scanner(System.in); public int size() { return UPPER - LOWER; } public Integer get(int i) { System.out.printf("My guess is: %d. Is it too high, too low, or correct? (H/L/C) ", LOWER+i); String s = in.nextLine(); assert s.length() > 0; switch (Character.toLowerCase(s.charAt(0))) { case 'l': return -1; case 'h': return 1; case 'c': return 0; } return -1; } }, 0); if (result < 0) System.out.println("That is impossible."); else System.out.printf("Your number is %d.\n", result); } }
Please provide an equivalent version of this C++ code in Java.
#include <iostream> #include <algorithm> #include <string> #include <iterator> struct GuessNumberIterator : std::iterator<std::random_access_iterator_tag, int> { int i; GuessNumberIterator() { } GuessNumberIterator(int _i) : i(_i) { } GuessNumberIterator& operator++() { ++i; return *this; } GuessNumberIterator operator++(int) { GuessNumberIterator tmp = *this; ++(*this); return tmp; } bool operator==(const GuessNumberIterator& y) { return i == y.i; } bool operator!=(const GuessNumberIterator& y) { return i != y.i; } int operator*() { std::cout << "Is your number less than or equal to " << i << "? "; std::string s; std::cin >> s; return (s != "" && (s[0] == 'y' || s[0] == 'Y')) ? 0 : -1; } GuessNumberIterator& operator--() { --i; return *this; } GuessNumberIterator operator--(int) { GuessNumberIterator tmp = *this; --(*this); return tmp; } GuessNumberIterator& operator+=(int n) { i += n; return *this; } GuessNumberIterator& operator-=(int n) { i -= n; return *this; } GuessNumberIterator operator+(int n) { GuessNumberIterator tmp = *this; return tmp += n; } GuessNumberIterator operator-(int n) { GuessNumberIterator tmp = *this; return tmp -= n; } int operator-(const GuessNumberIterator &y) { return i - y.i; } int operator[](int n) { return *(*this + n); } bool operator<(const GuessNumberIterator &y) { return i < y.i; } bool operator>(const GuessNumberIterator &y) { return i > y.i; } bool operator<=(const GuessNumberIterator &y) { return i <= y.i; } bool operator>=(const GuessNumberIterator &y) { return i >= y.i; } }; inline GuessNumberIterator operator+(int n, GuessNumberIterator &i) { return i + n; } const int lower = 0; const int upper = 100; int main() { std::cout << "Instructions:\n" << "Think of integer number from " << lower << " (inclusive) to " << upper << " (exclusive) and\n" << "I will guess it. After each guess, I will ask you if it is less than\n" << "or equal to some number, and you will respond with \"yes\" or \"no\".\n"; int answer = std::lower_bound(GuessNumberIterator(lower), GuessNumberIterator(upper), 0).i; std::cout << "Your number is " << answer << ".\n"; return 0; }
import java.util.AbstractList; import java.util.Collections; import java.util.Scanner; public class GuessNumber { public static final int LOWER = 0, UPPER = 100; public static void main(String[] args) { System.out.printf("Instructions:\n" + "Think of integer number from %d (inclusive) to %d (exclusive) and\n" + "I will guess it. After each guess, you respond with L, H, or C depending\n" + "on if my guess was too low, too high, or correct.\n", LOWER, UPPER); int result = Collections.binarySearch(new AbstractList<Integer>() { private final Scanner in = new Scanner(System.in); public int size() { return UPPER - LOWER; } public Integer get(int i) { System.out.printf("My guess is: %d. Is it too high, too low, or correct? (H/L/C) ", LOWER+i); String s = in.nextLine(); assert s.length() > 0; switch (Character.toLowerCase(s.charAt(0))) { case 'l': return -1; case 'h': return 1; case 'c': return 0; } return -1; } }, 0); if (result < 0) System.out.println("That is impossible."); else System.out.printf("Your number is %d.\n", result); } }
Preserve the algorithm and functionality while converting the code from C++ to Java.
#include <unordered_map> #include <string> int main() { std::string keys[] = { "1", "2", "3" }; std::string vals[] = { "a", "b", "c" }; std::unordered_map<std::string, std::string> hash; for( int i = 0 ; i < 3 ; i++ ) hash[ keys[i] ] = vals[i] ; }
import java.util.HashMap; public static void main(String[] args){ String[] keys= {"a", "b", "c"}; int[] vals= {1, 2, 3}; HashMap<String, Integer> hash= new HashMap<String, Integer>(); for(int i= 0; i < keys.length; i++){ hash.put(keys[i], vals[i]); } }
Convert this C++ snippet to Java and keep its semantics consistent.
#include <algorithm> #include <cassert> #include <iomanip> #include <iostream> #include <vector> std::vector<int> bins(const std::vector<int>& limits, const std::vector<int>& data) { std::vector<int> result(limits.size() + 1, 0); for (int n : data) { auto i = std::upper_bound(limits.begin(), limits.end(), n); ++result[i - limits.begin()]; } return result; } void print_bins(const std::vector<int>& limits, const std::vector<int>& bins) { size_t n = limits.size(); if (n == 0) return; assert(n + 1 == bins.size()); std::cout << " < " << std::setw(3) << limits[0] << ": " << std::setw(2) << bins[0] << '\n'; for (size_t i = 1; i < n; ++i) std::cout << ">= " << std::setw(3) << limits[i - 1] << " and < " << std::setw(3) << limits[i] << ": " << std::setw(2) << bins[i] << '\n'; std::cout << ">= " << std::setw(3) << limits[n - 1] << "  : " << std::setw(2) << bins[n] << '\n'; } int main() { const std::vector<int> limits1{23, 37, 43, 53, 67, 83}; const std::vector<int> data1{ 95, 21, 94, 12, 99, 4, 70, 75, 83, 93, 52, 80, 57, 5, 53, 86, 65, 17, 92, 83, 71, 61, 54, 58, 47, 16, 8, 9, 32, 84, 7, 87, 46, 19, 30, 37, 96, 6, 98, 40, 79, 97, 45, 64, 60, 29, 49, 36, 43, 55}; std::cout << "Example 1:\n"; print_bins(limits1, bins(limits1, data1)); const std::vector<int> limits2{14, 18, 249, 312, 389, 392, 513, 591, 634, 720}; const std::vector<int> data2{ 445, 814, 519, 697, 700, 130, 255, 889, 481, 122, 932, 77, 323, 525, 570, 219, 367, 523, 442, 933, 416, 589, 930, 373, 202, 253, 775, 47, 731, 685, 293, 126, 133, 450, 545, 100, 741, 583, 763, 306, 655, 267, 248, 477, 549, 238, 62, 678, 98, 534, 622, 907, 406, 714, 184, 391, 913, 42, 560, 247, 346, 860, 56, 138, 546, 38, 985, 948, 58, 213, 799, 319, 390, 634, 458, 945, 733, 507, 916, 123, 345, 110, 720, 917, 313, 845, 426, 9, 457, 628, 410, 723, 354, 895, 881, 953, 677, 137, 397, 97, 854, 740, 83, 216, 421, 94, 517, 479, 292, 963, 376, 981, 480, 39, 257, 272, 157, 5, 316, 395, 787, 942, 456, 242, 759, 898, 576, 67, 298, 425, 894, 435, 831, 241, 989, 614, 987, 770, 384, 692, 698, 765, 331, 487, 251, 600, 879, 342, 982, 527, 736, 795, 585, 40, 54, 901, 408, 359, 577, 237, 605, 847, 353, 968, 832, 205, 838, 427, 876, 959, 686, 646, 835, 127, 621, 892, 443, 198, 988, 791, 466, 23, 707, 467, 33, 670, 921, 180, 991, 396, 160, 436, 717, 918, 8, 374, 101, 684, 727, 749}; std::cout << "\nExample 2:\n"; print_bins(limits2, bins(limits2, data2)); }
import java.util.Arrays; import java.util.Collections; import java.util.List; public class Bins { public static <T extends Comparable<? super T>> int[] bins( List<? extends T> limits, Iterable<? extends T> data) { int[] result = new int[limits.size() + 1]; for (T n : data) { int i = Collections.binarySearch(limits, n); if (i >= 0) { i = i+1; } else { i = ~i; } result[i]++; } return result; } public static void printBins(List<?> limits, int[] bins) { int n = limits.size(); if (n == 0) { return; } assert n+1 == bins.length; System.out.printf(" < %3s: %2d\n", limits.get(0), bins[0]); for (int i = 1; i < n; i++) { System.out.printf(">= %3s and < %3s: %2d\n", limits.get(i-1), limits.get(i), bins[i]); } System.out.printf(">= %3s  : %2d\n", limits.get(n-1), bins[n]); } public static void main(String[] args) { List<Integer> limits = Arrays.asList(23, 37, 43, 53, 67, 83); List<Integer> data = Arrays.asList( 95, 21, 94, 12, 99, 4, 70, 75, 83, 93, 52, 80, 57, 5, 53, 86, 65, 17, 92, 83, 71, 61, 54, 58, 47, 16, 8, 9, 32, 84, 7, 87, 46, 19, 30, 37, 96, 6, 98, 40, 79, 97, 45, 64, 60, 29, 49, 36, 43, 55); System.out.println("Example 1:"); printBins(limits, bins(limits, data)); limits = Arrays.asList(14, 18, 249, 312, 389, 392, 513, 591, 634, 720); data = Arrays.asList( 445, 814, 519, 697, 700, 130, 255, 889, 481, 122, 932, 77, 323, 525, 570, 219, 367, 523, 442, 933, 416, 589, 930, 373, 202, 253, 775, 47, 731, 685, 293, 126, 133, 450, 545, 100, 741, 583, 763, 306, 655, 267, 248, 477, 549, 238, 62, 678, 98, 534, 622, 907, 406, 714, 184, 391, 913, 42, 560, 247, 346, 860, 56, 138, 546, 38, 985, 948, 58, 213, 799, 319, 390, 634, 458, 945, 733, 507, 916, 123, 345, 110, 720, 917, 313, 845, 426, 9, 457, 628, 410, 723, 354, 895, 881, 953, 677, 137, 397, 97, 854, 740, 83, 216, 421, 94, 517, 479, 292, 963, 376, 981, 480, 39, 257, 272, 157, 5, 316, 395, 787, 942, 456, 242, 759, 898, 576, 67, 298, 425, 894, 435, 831, 241, 989, 614, 987, 770, 384, 692, 698, 765, 331, 487, 251, 600, 879, 342, 982, 527, 736, 795, 585, 40, 54, 901, 408, 359, 577, 237, 605, 847, 353, 968, 832, 205, 838, 427, 876, 959, 686, 646, 835, 127, 621, 892, 443, 198, 988, 791, 466, 23, 707, 467, 33, 670, 921, 180, 991, 396, 160, 436, 717, 918, 8, 374, 101, 684, 727, 749); System.out.println(); System.out.println("Example 2:"); printBins(limits, bins(limits, data)); } }
Change the following C++ code into Java without altering its purpose.
#include <algorithm> #include <cassert> #include <iomanip> #include <iostream> #include <vector> std::vector<int> bins(const std::vector<int>& limits, const std::vector<int>& data) { std::vector<int> result(limits.size() + 1, 0); for (int n : data) { auto i = std::upper_bound(limits.begin(), limits.end(), n); ++result[i - limits.begin()]; } return result; } void print_bins(const std::vector<int>& limits, const std::vector<int>& bins) { size_t n = limits.size(); if (n == 0) return; assert(n + 1 == bins.size()); std::cout << " < " << std::setw(3) << limits[0] << ": " << std::setw(2) << bins[0] << '\n'; for (size_t i = 1; i < n; ++i) std::cout << ">= " << std::setw(3) << limits[i - 1] << " and < " << std::setw(3) << limits[i] << ": " << std::setw(2) << bins[i] << '\n'; std::cout << ">= " << std::setw(3) << limits[n - 1] << "  : " << std::setw(2) << bins[n] << '\n'; } int main() { const std::vector<int> limits1{23, 37, 43, 53, 67, 83}; const std::vector<int> data1{ 95, 21, 94, 12, 99, 4, 70, 75, 83, 93, 52, 80, 57, 5, 53, 86, 65, 17, 92, 83, 71, 61, 54, 58, 47, 16, 8, 9, 32, 84, 7, 87, 46, 19, 30, 37, 96, 6, 98, 40, 79, 97, 45, 64, 60, 29, 49, 36, 43, 55}; std::cout << "Example 1:\n"; print_bins(limits1, bins(limits1, data1)); const std::vector<int> limits2{14, 18, 249, 312, 389, 392, 513, 591, 634, 720}; const std::vector<int> data2{ 445, 814, 519, 697, 700, 130, 255, 889, 481, 122, 932, 77, 323, 525, 570, 219, 367, 523, 442, 933, 416, 589, 930, 373, 202, 253, 775, 47, 731, 685, 293, 126, 133, 450, 545, 100, 741, 583, 763, 306, 655, 267, 248, 477, 549, 238, 62, 678, 98, 534, 622, 907, 406, 714, 184, 391, 913, 42, 560, 247, 346, 860, 56, 138, 546, 38, 985, 948, 58, 213, 799, 319, 390, 634, 458, 945, 733, 507, 916, 123, 345, 110, 720, 917, 313, 845, 426, 9, 457, 628, 410, 723, 354, 895, 881, 953, 677, 137, 397, 97, 854, 740, 83, 216, 421, 94, 517, 479, 292, 963, 376, 981, 480, 39, 257, 272, 157, 5, 316, 395, 787, 942, 456, 242, 759, 898, 576, 67, 298, 425, 894, 435, 831, 241, 989, 614, 987, 770, 384, 692, 698, 765, 331, 487, 251, 600, 879, 342, 982, 527, 736, 795, 585, 40, 54, 901, 408, 359, 577, 237, 605, 847, 353, 968, 832, 205, 838, 427, 876, 959, 686, 646, 835, 127, 621, 892, 443, 198, 988, 791, 466, 23, 707, 467, 33, 670, 921, 180, 991, 396, 160, 436, 717, 918, 8, 374, 101, 684, 727, 749}; std::cout << "\nExample 2:\n"; print_bins(limits2, bins(limits2, data2)); }
import java.util.Arrays; import java.util.Collections; import java.util.List; public class Bins { public static <T extends Comparable<? super T>> int[] bins( List<? extends T> limits, Iterable<? extends T> data) { int[] result = new int[limits.size() + 1]; for (T n : data) { int i = Collections.binarySearch(limits, n); if (i >= 0) { i = i+1; } else { i = ~i; } result[i]++; } return result; } public static void printBins(List<?> limits, int[] bins) { int n = limits.size(); if (n == 0) { return; } assert n+1 == bins.length; System.out.printf(" < %3s: %2d\n", limits.get(0), bins[0]); for (int i = 1; i < n; i++) { System.out.printf(">= %3s and < %3s: %2d\n", limits.get(i-1), limits.get(i), bins[i]); } System.out.printf(">= %3s  : %2d\n", limits.get(n-1), bins[n]); } public static void main(String[] args) { List<Integer> limits = Arrays.asList(23, 37, 43, 53, 67, 83); List<Integer> data = Arrays.asList( 95, 21, 94, 12, 99, 4, 70, 75, 83, 93, 52, 80, 57, 5, 53, 86, 65, 17, 92, 83, 71, 61, 54, 58, 47, 16, 8, 9, 32, 84, 7, 87, 46, 19, 30, 37, 96, 6, 98, 40, 79, 97, 45, 64, 60, 29, 49, 36, 43, 55); System.out.println("Example 1:"); printBins(limits, bins(limits, data)); limits = Arrays.asList(14, 18, 249, 312, 389, 392, 513, 591, 634, 720); data = Arrays.asList( 445, 814, 519, 697, 700, 130, 255, 889, 481, 122, 932, 77, 323, 525, 570, 219, 367, 523, 442, 933, 416, 589, 930, 373, 202, 253, 775, 47, 731, 685, 293, 126, 133, 450, 545, 100, 741, 583, 763, 306, 655, 267, 248, 477, 549, 238, 62, 678, 98, 534, 622, 907, 406, 714, 184, 391, 913, 42, 560, 247, 346, 860, 56, 138, 546, 38, 985, 948, 58, 213, 799, 319, 390, 634, 458, 945, 733, 507, 916, 123, 345, 110, 720, 917, 313, 845, 426, 9, 457, 628, 410, 723, 354, 895, 881, 953, 677, 137, 397, 97, 854, 740, 83, 216, 421, 94, 517, 479, 292, 963, 376, 981, 480, 39, 257, 272, 157, 5, 316, 395, 787, 942, 456, 242, 759, 898, 576, 67, 298, 425, 894, 435, 831, 241, 989, 614, 987, 770, 384, 692, 698, 765, 331, 487, 251, 600, 879, 342, 982, 527, 736, 795, 585, 40, 54, 901, 408, 359, 577, 237, 605, 847, 353, 968, 832, 205, 838, 427, 876, 959, 686, 646, 835, 127, 621, 892, 443, 198, 988, 791, 466, 23, 707, 467, 33, 670, 921, 180, 991, 396, 160, 436, 717, 918, 8, 374, 101, 684, 727, 749); System.out.println(); System.out.println("Example 2:"); printBins(limits, bins(limits, data)); } }
Port the provided C++ code into Java while preserving the original functionality.
#include <windows.h> #include <string> #include <math.h> using namespace std; const float PI = 3.1415926536f; class myBitmap { public: myBitmap() : pen( NULL ) {} ~myBitmap() { DeleteObject( pen ); DeleteDC( hdc ); DeleteObject( bmp ); } bool create( int w, int h ) { BITMAPINFO bi; void *pBits; ZeroMemory( &bi, sizeof( bi ) ); bi.bmiHeader.biSize = sizeof( bi.bmiHeader ); bi.bmiHeader.biBitCount = sizeof( DWORD ) * 8; bi.bmiHeader.biCompression = BI_RGB; bi.bmiHeader.biPlanes = 1; bi.bmiHeader.biWidth = w; bi.bmiHeader.biHeight = -h; HDC dc = GetDC( GetConsoleWindow() ); bmp = CreateDIBSection( dc, &bi, DIB_RGB_COLORS, &pBits, NULL, 0 ); if( !bmp ) return false; hdc = CreateCompatibleDC( dc ); SelectObject( hdc, bmp ); ReleaseDC( GetConsoleWindow(), dc ); width = w; height = h; return true; } void setPenColor( DWORD clr ) { if( pen ) DeleteObject( pen ); pen = CreatePen( PS_SOLID, 1, clr ); SelectObject( hdc, pen ); } void saveBitmap( string path ) { BITMAPFILEHEADER fileheader; BITMAPINFO infoheader; BITMAP bitmap; DWORD* dwpBits; DWORD wb; HANDLE file; GetObject( bmp, sizeof( bitmap ), &bitmap ); dwpBits = new DWORD[bitmap.bmWidth * bitmap.bmHeight]; ZeroMemory( dwpBits, bitmap.bmWidth * bitmap.bmHeight * sizeof( DWORD ) ); ZeroMemory( &infoheader, sizeof( BITMAPINFO ) ); ZeroMemory( &fileheader, sizeof( BITMAPFILEHEADER ) ); infoheader.bmiHeader.biBitCount = sizeof( DWORD ) * 8; infoheader.bmiHeader.biCompression = BI_RGB; infoheader.bmiHeader.biPlanes = 1; infoheader.bmiHeader.biSize = sizeof( infoheader.bmiHeader ); infoheader.bmiHeader.biHeight = bitmap.bmHeight; infoheader.bmiHeader.biWidth = bitmap.bmWidth; infoheader.bmiHeader.biSizeImage = bitmap.bmWidth * bitmap.bmHeight * sizeof( DWORD ); fileheader.bfType = 0x4D42; fileheader.bfOffBits = sizeof( infoheader.bmiHeader ) + sizeof( BITMAPFILEHEADER ); fileheader.bfSize = fileheader.bfOffBits + infoheader.bmiHeader.biSizeImage; GetDIBits( hdc, bmp, 0, height, ( LPVOID )dwpBits, &infoheader, DIB_RGB_COLORS ); file = CreateFile( path.c_str(), GENERIC_WRITE, 0, NULL, CREATE_ALWAYS, FILE_ATTRIBUTE_NORMAL, NULL ); WriteFile( file, &fileheader, sizeof( BITMAPFILEHEADER ), &wb, NULL ); WriteFile( file, &infoheader.bmiHeader, sizeof( infoheader.bmiHeader ), &wb, NULL ); WriteFile( file, dwpBits, bitmap.bmWidth * bitmap.bmHeight * 4, &wb, NULL ); CloseHandle( file ); delete [] dwpBits; } HDC getDC() { return hdc; } int getWidth() { return width; } int getHeight() { return height; } private: HBITMAP bmp; HDC hdc; HPEN pen; int width, height; }; class vector2 { public: vector2() { x = y = 0; } vector2( int a, int b ) { x = a; y = b; } void set( int a, int b ) { x = a; y = b; } void rotate( float angle_r ) { float _x = static_cast<float>( x ), _y = static_cast<float>( y ), s = sinf( angle_r ), c = cosf( angle_r ), a = _x * c - _y * s, b = _x * s + _y * c; x = static_cast<int>( a ); y = static_cast<int>( b ); } int x, y; }; class fractalTree { public: fractalTree() { _ang = DegToRadian( 24.0f ); } float DegToRadian( float degree ) { return degree * ( PI / 180.0f ); } void create( myBitmap* bmp ) { _bmp = bmp; float line_len = 130.0f; vector2 sp( _bmp->getWidth() / 2, _bmp->getHeight() - 1 ); MoveToEx( _bmp->getDC(), sp.x, sp.y, NULL ); sp.y -= static_cast<int>( line_len ); LineTo( _bmp->getDC(), sp.x, sp.y); drawRL( &sp, line_len, 0, true ); drawRL( &sp, line_len, 0, false ); } private: void drawRL( vector2* sp, float line_len, float a, bool rg ) { line_len *= .75f; if( line_len < 2.0f ) return; MoveToEx( _bmp->getDC(), sp->x, sp->y, NULL ); vector2 r( 0, static_cast<int>( line_len ) ); if( rg ) a -= _ang; else a += _ang; r.rotate( a ); r.x += sp->x; r.y = sp->y - r.y; LineTo( _bmp->getDC(), r.x, r.y ); drawRL( &r, line_len, a, true ); drawRL( &r, line_len, a, false ); } myBitmap* _bmp; float _ang; }; int main( int argc, char* argv[] ) { ShowWindow( GetConsoleWindow(), SW_MAXIMIZE ); myBitmap bmp; bmp.create( 640, 512 ); bmp.setPenColor( RGB( 255, 255, 0 ) ); fractalTree tree; tree.create( &bmp ); BitBlt( GetDC( GetConsoleWindow() ), 0, 20, 648, 512, bmp.getDC(), 0, 0, SRCCOPY ); bmp.saveBitmap( "f: system( "pause" ); return 0; }
import java.awt.Color; import java.awt.Graphics; import javax.swing.JFrame; public class FractalTree extends JFrame { public FractalTree() { super("Fractal Tree"); setBounds(100, 100, 800, 600); setResizable(false); setDefaultCloseOperation(EXIT_ON_CLOSE); } private void drawTree(Graphics g, int x1, int y1, double angle, int depth) { if (depth == 0) return; int x2 = x1 + (int) (Math.cos(Math.toRadians(angle)) * depth * 10.0); int y2 = y1 + (int) (Math.sin(Math.toRadians(angle)) * depth * 10.0); g.drawLine(x1, y1, x2, y2); drawTree(g, x2, y2, angle - 20, depth - 1); drawTree(g, x2, y2, angle + 20, depth - 1); } @Override public void paint(Graphics g) { g.setColor(Color.BLACK); drawTree(g, 400, 500, -90, 9); } public static void main(String[] args) { new FractalTree().setVisible(true); } }
Produce a language-to-language conversion: from C++ to Java, same semantics.
#include <windows.h> class pinstripe { public: pinstripe() { createColors(); } void setDimensions( int x, int y ) { _mw = x; _mh = y; } void createColors() { colors[0] = 0; colors[1] = 255; colors[2] = RGB( 0, 255, 0 ); colors[3] = RGB( 0, 0, 255 ); colors[4] = RGB( 255, 0, 255 ); colors[5] = RGB( 0, 255, 255 ); colors[6] = RGB( 255, 255, 0 ); colors[7] = RGB( 255, 255, 255 ); } void draw( HDC dc ) { HPEN pen; int lh = _mh / 4, row, cp; for( int lw = 1; lw < 5; lw++ ) { cp = 0; row = ( lw - 1 ) * lh; for( int x = 0 + lw > 1 ? lw > 3 ? 2 : 1 : 0; x < _mw; x += lw ) { pen = CreatePen( PS_SOLID, lw, colors[cp] ); ++cp %= 8; SelectObject( dc, pen ); MoveToEx( dc, x, row, NULL ); LineTo( dc, x, row + lh ); DeleteObject( pen ); } } } private: int _mw, _mh; DWORD colors[8]; }; pinstripe pin; void PaintWnd( HWND hWnd ) { PAINTSTRUCT ps; HDC hdc = BeginPaint( hWnd, &ps ); pin.draw( hdc ); EndPaint( hWnd, &ps ); } LRESULT CALLBACK WndProc( HWND hWnd, UINT msg, WPARAM wParam, LPARAM lParam ) { switch( msg ) { case WM_DESTROY: PostQuitMessage( 0 ); break; case WM_PAINT: PaintWnd( hWnd ); break; default: return DefWindowProc( hWnd, msg, wParam, lParam ); } return 0; } HWND InitAll( HINSTANCE hInstance ) { WNDCLASSEX wcex; ZeroMemory( &wcex, sizeof( wcex ) ); wcex.cbSize = sizeof( WNDCLASSEX ); wcex.style = CS_HREDRAW | CS_VREDRAW; wcex.lpfnWndProc = WndProc; wcex.hInstance = hInstance; wcex.hCursor = LoadCursor( NULL, IDC_ARROW ); wcex.hbrBackground = ( HBRUSH )( COLOR_WINDOW + 1 ); wcex.lpszClassName = "_CLR_PS_"; RegisterClassEx( &wcex ); return CreateWindow( "_CLR_PS_", ".: Clr Pinstripe -- PJorente :.", WS_POPUP, CW_USEDEFAULT, 0, 200, 200, NULL, NULL, hInstance, NULL ); } int APIENTRY _tWinMain( HINSTANCE hInstance, HINSTANCE hPrevInstance, LPTSTR lpCmdLine, int nCmdShow ) { srand( GetTickCount() ); HWND hwnd = InitAll( hInstance ); if( !hwnd ) return -1; int mw = GetSystemMetrics( SM_CXSCREEN ), mh = GetSystemMetrics( SM_CYSCREEN ); pin.setDimensions( mw, mh ); RECT rc = { 0, 0, mw, mh }; AdjustWindowRectEx( &rc, WS_POPUP, FALSE, 0 ); int w = rc.right - rc.left, h = rc.bottom - rc.top; int posX = ( GetSystemMetrics( SM_CXSCREEN ) >> 1 ) - ( w >> 1 ), posY = ( GetSystemMetrics( SM_CYSCREEN ) >> 1 ) - ( h >> 1 ); SetWindowPos( hwnd, HWND_TOP, posX, posY, w, h, SWP_NOZORDER ); ShowWindow( hwnd, nCmdShow ); UpdateWindow( hwnd ); MSG msg; ZeroMemory( &msg, sizeof( msg ) ); while( msg.message != WM_QUIT ) { if( PeekMessage( &msg, NULL, 0, 0, PM_REMOVE ) != 0 ) { TranslateMessage( &msg ); DispatchMessage( &msg ); } } return UnregisterClass( "_CLR_PS_", hInstance ); }
import java.awt.*; import static java.awt.Color.*; import javax.swing.*; public class ColourPinstripeDisplay extends JPanel { final static Color[] palette = {black, red, green, blue, magenta,cyan, yellow, white}; final int bands = 4; public ColourPinstripeDisplay() { setPreferredSize(new Dimension(900, 600)); } @Override public void paintComponent(Graphics g) { super.paintComponent(g); int h = getHeight(); for (int b = 1; b <= bands; b++) { for (int x = 0, colIndex = 0; x < getWidth(); x += b, colIndex++) { g.setColor(palette[colIndex % palette.length]); g.fillRect(x, (b - 1) * (h / bands), x + b, b * (h / bands)); } } } public static void main(String[] args) { SwingUtilities.invokeLater(() -> { JFrame f = new JFrame(); f.setDefaultCloseOperation(JFrame.EXIT_ON_CLOSE); f.setTitle("ColourPinstripeDisplay"); f.add(new ColourPinstripeDisplay(), BorderLayout.CENTER); f.pack(); f.setLocationRelativeTo(null); f.setVisible(true); }); } }
Produce a functionally identical Java code for the snippet given in C++.
#include <iostream> #include <cstdint> struct Date { std::uint16_t year; std::uint8_t month; std::uint8_t day; }; constexpr bool leap(int year) { return year%4==0 && (year%100!=0 || year%400==0); } const std::string& weekday(const Date& date) { static const std::uint8_t leapdoom[] = {4,1,7,2,4,6,4,1,5,3,7,5}; static const std::uint8_t normdoom[] = {3,7,7,4,2,6,4,1,5,3,7,5}; static const std::string days[] = { "Sunday", "Monday", "Tuesday", "Wednesday", "Thursday", "Friday", "Saturday" }; unsigned const c = date.year/100, r = date.year%100; unsigned const s = r/12, t = r%12; unsigned const c_anchor = (5 * (c%4) + 2) % 7; unsigned const doom = (s + t + t/4 + c_anchor) % 7; unsigned const anchor = (leap(date.year) ? leapdoom : normdoom)[date.month-1]; return days[(doom+date.day-anchor+7)%7]; } int main(void) { const std::string months[] = {"", "January", "February", "March", "April", "May", "June", "July", "August", "September", "October", "November", "December" }; const Date dates[] = { {1800,1,6}, {1875,3,29}, {1915,12,7}, {1970,12,23}, {2043,5,14}, {2077,2,12}, {2101,4,2} }; for (const Date& d : dates) { std::cout << months[d.month] << " " << (int)d.day << ", " << d.year; std::cout << (d.year > 2021 ? " will be " : " was "); std::cout << "on a " << weekday(d) << std::endl; } return 0; }
class Doom { public static void main(String[] args) { final Date[] dates = { new Date(1800,1,6), new Date(1875,3,29), new Date(1915,12,7), new Date(1970,12,23), new Date(2043,5,14), new Date(2077,2,12), new Date(2101,4,2) }; for (Date d : dates) System.out.println( String.format("%s: %s", d.format(), d.weekday())); } } class Date { private int year, month, day; private static final int[] leapdoom = {4,1,7,4,2,6,4,1,5,3,7,5}; private static final int[] normdoom = {3,7,7,4,2,6,4,1,5,3,7,5}; public static final String[] weekdays = { "Sunday", "Monday", "Tuesday", "Wednesday", "Thursday", "Friday", "Saturday" }; public Date(int year, int month, int day) { this.year = year; this.month = month; this.day = day; } public boolean isLeapYear() { return year%4 == 0 && (year%100 != 0 || year%400 == 0); } public String format() { return String.format("%02d/%02d/%04d", month, day, year); } public String weekday() { final int c = year/100; final int r = year%100; final int s = r/12; final int t = r%12; final int c_anchor = (5 * (c%4) + 2) % 7; final int doom = (s + t + t/4 + c_anchor) % 7; final int anchor = isLeapYear() ? leapdoom[month-1] : normdoom[month-1]; return weekdays[(doom + day - anchor + 7) % 7]; } }
Write the same code in Java as shown below in C++.
#include <iostream> #include <cstdint> struct Date { std::uint16_t year; std::uint8_t month; std::uint8_t day; }; constexpr bool leap(int year) { return year%4==0 && (year%100!=0 || year%400==0); } const std::string& weekday(const Date& date) { static const std::uint8_t leapdoom[] = {4,1,7,2,4,6,4,1,5,3,7,5}; static const std::uint8_t normdoom[] = {3,7,7,4,2,6,4,1,5,3,7,5}; static const std::string days[] = { "Sunday", "Monday", "Tuesday", "Wednesday", "Thursday", "Friday", "Saturday" }; unsigned const c = date.year/100, r = date.year%100; unsigned const s = r/12, t = r%12; unsigned const c_anchor = (5 * (c%4) + 2) % 7; unsigned const doom = (s + t + t/4 + c_anchor) % 7; unsigned const anchor = (leap(date.year) ? leapdoom : normdoom)[date.month-1]; return days[(doom+date.day-anchor+7)%7]; } int main(void) { const std::string months[] = {"", "January", "February", "March", "April", "May", "June", "July", "August", "September", "October", "November", "December" }; const Date dates[] = { {1800,1,6}, {1875,3,29}, {1915,12,7}, {1970,12,23}, {2043,5,14}, {2077,2,12}, {2101,4,2} }; for (const Date& d : dates) { std::cout << months[d.month] << " " << (int)d.day << ", " << d.year; std::cout << (d.year > 2021 ? " will be " : " was "); std::cout << "on a " << weekday(d) << std::endl; } return 0; }
class Doom { public static void main(String[] args) { final Date[] dates = { new Date(1800,1,6), new Date(1875,3,29), new Date(1915,12,7), new Date(1970,12,23), new Date(2043,5,14), new Date(2077,2,12), new Date(2101,4,2) }; for (Date d : dates) System.out.println( String.format("%s: %s", d.format(), d.weekday())); } } class Date { private int year, month, day; private static final int[] leapdoom = {4,1,7,4,2,6,4,1,5,3,7,5}; private static final int[] normdoom = {3,7,7,4,2,6,4,1,5,3,7,5}; public static final String[] weekdays = { "Sunday", "Monday", "Tuesday", "Wednesday", "Thursday", "Friday", "Saturday" }; public Date(int year, int month, int day) { this.year = year; this.month = month; this.day = day; } public boolean isLeapYear() { return year%4 == 0 && (year%100 != 0 || year%400 == 0); } public String format() { return String.format("%02d/%02d/%04d", month, day, year); } public String weekday() { final int c = year/100; final int r = year%100; final int s = r/12; final int t = r%12; final int c_anchor = (5 * (c%4) + 2) % 7; final int doom = (s + t + t/4 + c_anchor) % 7; final int anchor = isLeapYear() ? leapdoom[month-1] : normdoom[month-1]; return weekdays[(doom + day - anchor + 7) % 7]; } }
Translate the given C++ code snippet into Java without altering its behavior.
#include <iostream> #include <cstdint> struct Date { std::uint16_t year; std::uint8_t month; std::uint8_t day; }; constexpr bool leap(int year) { return year%4==0 && (year%100!=0 || year%400==0); } const std::string& weekday(const Date& date) { static const std::uint8_t leapdoom[] = {4,1,7,2,4,6,4,1,5,3,7,5}; static const std::uint8_t normdoom[] = {3,7,7,4,2,6,4,1,5,3,7,5}; static const std::string days[] = { "Sunday", "Monday", "Tuesday", "Wednesday", "Thursday", "Friday", "Saturday" }; unsigned const c = date.year/100, r = date.year%100; unsigned const s = r/12, t = r%12; unsigned const c_anchor = (5 * (c%4) + 2) % 7; unsigned const doom = (s + t + t/4 + c_anchor) % 7; unsigned const anchor = (leap(date.year) ? leapdoom : normdoom)[date.month-1]; return days[(doom+date.day-anchor+7)%7]; } int main(void) { const std::string months[] = {"", "January", "February", "March", "April", "May", "June", "July", "August", "September", "October", "November", "December" }; const Date dates[] = { {1800,1,6}, {1875,3,29}, {1915,12,7}, {1970,12,23}, {2043,5,14}, {2077,2,12}, {2101,4,2} }; for (const Date& d : dates) { std::cout << months[d.month] << " " << (int)d.day << ", " << d.year; std::cout << (d.year > 2021 ? " will be " : " was "); std::cout << "on a " << weekday(d) << std::endl; } return 0; }
class Doom { public static void main(String[] args) { final Date[] dates = { new Date(1800,1,6), new Date(1875,3,29), new Date(1915,12,7), new Date(1970,12,23), new Date(2043,5,14), new Date(2077,2,12), new Date(2101,4,2) }; for (Date d : dates) System.out.println( String.format("%s: %s", d.format(), d.weekday())); } } class Date { private int year, month, day; private static final int[] leapdoom = {4,1,7,4,2,6,4,1,5,3,7,5}; private static final int[] normdoom = {3,7,7,4,2,6,4,1,5,3,7,5}; public static final String[] weekdays = { "Sunday", "Monday", "Tuesday", "Wednesday", "Thursday", "Friday", "Saturday" }; public Date(int year, int month, int day) { this.year = year; this.month = month; this.day = day; } public boolean isLeapYear() { return year%4 == 0 && (year%100 != 0 || year%400 == 0); } public String format() { return String.format("%02d/%02d/%04d", month, day, year); } public String weekday() { final int c = year/100; final int r = year%100; final int s = r/12; final int t = r%12; final int c_anchor = (5 * (c%4) + 2) % 7; final int doom = (s + t + t/4 + c_anchor) % 7; final int anchor = isLeapYear() ? leapdoom[month-1] : normdoom[month-1]; return weekdays[(doom + day - anchor + 7) % 7]; } }
Rewrite this program in Java while keeping its functionality equivalent to the C++ version.
#include <algorithm> #include <cassert> #include <iostream> #include <iterator> #include <vector> template <typename iterator> void cocktail_shaker_sort(iterator begin, iterator end) { if (begin == end) return; for (--end; begin < end; ) { iterator new_begin = end; iterator new_end = begin; for (iterator i = begin; i < end; ++i) { iterator j = i + 1; if (*j < *i) { std::iter_swap(i, j); new_end = i; } } end = new_end; for (iterator i = end; i > begin; --i) { iterator j = i - 1; if (*i < *j) { std::iter_swap(i, j); new_begin = i; } } begin = new_begin; } } template <typename iterator> void print(iterator begin, iterator end) { if (begin == end) return; std::cout << *begin++; while (begin != end) std::cout << ' ' << *begin++; std::cout << '\n'; } int main() { std::vector<int> v{5, 1, -6, 12, 3, 13, 2, 4, 0, 15}; std::cout << "before: "; print(v.begin(), v.end()); cocktail_shaker_sort(v.begin(), v.end()); assert(std::is_sorted(v.begin(), v.end())); std::cout << "after: "; print(v.begin(), v.end()); return 0; }
import java.util.*; public class CocktailSort { public static void main(String[] args) { Integer[] array = new Integer[]{ 5, 1, -6, 12, 3, 13, 2, 4, 0, 15 }; System.out.println("before: " + Arrays.toString(array)); cocktailSort(array); System.out.println("after: " + Arrays.toString(array)); } public static void cocktailSort(Object[] array) { int begin = 0; int end = array.length; if (end == 0) return; for (--end; begin < end; ) { int new_begin = end; int new_end = begin; for (int i = begin; i < end; ++i) { Comparable c1 = (Comparable)array[i]; Comparable c2 = (Comparable)array[i + 1]; if (c1.compareTo(c2) > 0) { swap(array, i, i + 1); new_end = i; } } end = new_end; for (int i = end; i > begin; --i) { Comparable c1 = (Comparable)array[i - 1]; Comparable c2 = (Comparable)array[i]; if (c1.compareTo(c2) > 0) { swap(array, i, i - 1); new_begin = i; } } begin = new_begin; } } private static void swap(Object[] array, int i, int j) { Object tmp = array[i]; array[i] = array[j]; array[j] = tmp; } }
Write the same code in Java as shown below in C++.
#ifndef __wxPendulumDlg_h__ #define __wxPendulumDlg_h__ #ifdef __BORLANDC__ #pragma hdrstop #endif #ifndef WX_PRECOMP #include <wx/wx.h> #include <wx/dialog.h> #else #include <wx/wxprec.h> #endif #include <wx/timer.h> #include <wx/dcbuffer.h> #include <cmath> class wxPendulumDlgApp : public wxApp { public: bool OnInit(); int OnExit(); }; class wxPendulumDlg : public wxDialog { public: wxPendulumDlg(wxWindow *parent, wxWindowID id = 1, const wxString &title = wxT("wxPendulum"), const wxPoint& pos = wxDefaultPosition, const wxSize& size = wxDefaultSize, long style = wxSUNKEN_BORDER | wxCAPTION | wxRESIZE_BORDER | wxSYSTEM_MENU | wxDIALOG_NO_PARENT | wxMINIMIZE_BOX | wxMAXIMIZE_BOX | wxCLOSE_BOX); virtual ~wxPendulumDlg(); void wxPendulumDlgPaint(wxPaintEvent& event); void wxPendulumDlgSize(wxSizeEvent& event); void OnTimer(wxTimerEvent& event); private: wxTimer *m_timer; unsigned int m_uiLength; double m_Angle; double m_AngleVelocity; enum wxIDs { ID_WXTIMER1 = 1001, ID_DUMMY_VALUE_ }; void OnClose(wxCloseEvent& event); void CreateGUIControls(); DECLARE_EVENT_TABLE() }; #endif
import java.awt.*; import javax.swing.*; public class Pendulum extends JPanel implements Runnable { private double angle = Math.PI / 2; private int length; public Pendulum(int length) { this.length = length; setDoubleBuffered(true); } @Override public void paint(Graphics g) { g.setColor(Color.WHITE); g.fillRect(0, 0, getWidth(), getHeight()); g.setColor(Color.BLACK); int anchorX = getWidth() / 2, anchorY = getHeight() / 4; int ballX = anchorX + (int) (Math.sin(angle) * length); int ballY = anchorY + (int) (Math.cos(angle) * length); g.drawLine(anchorX, anchorY, ballX, ballY); g.fillOval(anchorX - 3, anchorY - 4, 7, 7); g.fillOval(ballX - 7, ballY - 7, 14, 14); } public void run() { double angleAccel, angleVelocity = 0, dt = 0.1; while (true) { angleAccel = -9.81 / length * Math.sin(angle); angleVelocity += angleAccel * dt; angle += angleVelocity * dt; repaint(); try { Thread.sleep(15); } catch (InterruptedException ex) {} } } @Override public Dimension getPreferredSize() { return new Dimension(2 * length + 50, length / 2 * 3); } public static void main(String[] args) { JFrame f = new JFrame("Pendulum"); Pendulum p = new Pendulum(200); f.add(p); f.setDefaultCloseOperation(JFrame.EXIT_ON_CLOSE); f.pack(); f.setVisible(true); new Thread(p).start(); } }
Keep all operations the same but rewrite the snippet in Java.
#include <bitset> #include <iostream> #include <string> #include <assert.h> uint32_t gray_encode(uint32_t b) { return b ^ (b >> 1); } uint32_t gray_decode(uint32_t g) { for (uint32_t bit = 1U << 31; bit > 1; bit >>= 1) { if (g & bit) g ^= bit >> 1; } return g; } std::string to_binary(int value) { const std::bitset<32> bs(value); const std::string str(bs.to_string()); const size_t pos(str.find('1')); return pos == std::string::npos ? "0" : str.substr(pos); } int main() { std::cout << "Number\tBinary\tGray\tDecoded\n"; for (uint32_t n = 0; n < 32; ++n) { uint32_t g = gray_encode(n); assert(gray_decode(g) == n); std::cout << n << "\t" << to_binary(n) << "\t" << to_binary(g) << "\t" << g << "\n"; } }
public class Gray { public static long grayEncode(long n){ return n ^ (n >>> 1); } public static long grayDecode(long n) { long p = n; while ((n >>>= 1) != 0) p ^= n; return p; } public static void main(String[] args){ System.out.println("i\tBinary\tGray\tDecoded"); for(int i = -1; i < 32;i++){ System.out.print(i +"\t"); System.out.print(Integer.toBinaryString(i) + "\t"); System.out.print(Long.toBinaryString(grayEncode(i))+ "\t"); System.out.println(grayDecode(grayEncode(i))); } } }
Change the following C++ code into Java without altering its purpose.
#include <bitset> #include <iostream> #include <string> #include <assert.h> uint32_t gray_encode(uint32_t b) { return b ^ (b >> 1); } uint32_t gray_decode(uint32_t g) { for (uint32_t bit = 1U << 31; bit > 1; bit >>= 1) { if (g & bit) g ^= bit >> 1; } return g; } std::string to_binary(int value) { const std::bitset<32> bs(value); const std::string str(bs.to_string()); const size_t pos(str.find('1')); return pos == std::string::npos ? "0" : str.substr(pos); } int main() { std::cout << "Number\tBinary\tGray\tDecoded\n"; for (uint32_t n = 0; n < 32; ++n) { uint32_t g = gray_encode(n); assert(gray_decode(g) == n); std::cout << n << "\t" << to_binary(n) << "\t" << to_binary(g) << "\t" << g << "\n"; } }
public class Gray { public static long grayEncode(long n){ return n ^ (n >>> 1); } public static long grayDecode(long n) { long p = n; while ((n >>>= 1) != 0) p ^= n; return p; } public static void main(String[] args){ System.out.println("i\tBinary\tGray\tDecoded"); for(int i = -1; i < 32;i++){ System.out.print(i +"\t"); System.out.print(Integer.toBinaryString(i) + "\t"); System.out.print(Long.toBinaryString(grayEncode(i))+ "\t"); System.out.println(grayDecode(grayEncode(i))); } } }
Generate a Java translation of this C++ snippet without changing its computational steps.
#include <iostream> #include <fstream> #if defined(_WIN32) || defined(WIN32) constexpr auto FILENAME = "tape.file"; #else constexpr auto FILENAME = "/dev/tape"; #endif int main() { std::filebuf fb; fb.open(FILENAME,std::ios::out); std::ostream os(&fb); os << "Hello World\n"; fb.close(); return 0; }
import java.io.IOException; import java.nio.file.Files; import java.nio.file.Path; import java.nio.file.Paths; import java.util.Collections; public class CreateFile { public static void main(String[] args) throws IOException { String os = System.getProperty("os.name"); if (os.contains("Windows")) { Path path = Paths.get("tape.file"); Files.write(path, Collections.singletonList("Hello World!")); } else { Path path = Paths.get("/dev/tape"); Files.write(path, Collections.singletonList("Hello World!")); } } }
Translate the given C++ code snippet into Java without altering its behavior.
#include <algorithm> #include <iterator> #include <iostream> template<typename RandomAccessIterator> void heap_sort(RandomAccessIterator begin, RandomAccessIterator end) { std::make_heap(begin, end); std::sort_heap(begin, end); } int main() { int a[] = {100, 2, 56, 200, -52, 3, 99, 33, 177, -199}; heap_sort(std::begin(a), std::end(a)); copy(std::begin(a), std::end(a), std::ostream_iterator<int>(std::cout, " ")); std::cout << "\n"; }
public static void heapSort(int[] a){ int count = a.length; heapify(a, count); int end = count - 1; while(end > 0){ int tmp = a[end]; a[end] = a[0]; a[0] = tmp; siftDown(a, 0, end - 1); end--; } } public static void heapify(int[] a, int count){ int start = (count - 2) / 2; while(start >= 0){ siftDown(a, start, count - 1); start--; } } public static void siftDown(int[] a, int start, int end){ int root = start; while((root * 2 + 1) <= end){ int child = root * 2 + 1; if(child + 1 <= end && a[child] < a[child + 1]) child = child + 1; if(a[root] < a[child]){ int tmp = a[root]; a[root] = a[child]; a[child] = tmp; root = child; }else return; } }
Write the same code in Java as shown below in C++.
#include <deque> #include <algorithm> #include <ostream> #include <iterator> namespace cards { class card { public: enum pip_type { two, three, four, five, six, seven, eight, nine, ten, jack, queen, king, ace, pip_count }; enum suite_type { hearts, spades, diamonds, clubs, suite_count }; enum { unique_count = pip_count * suite_count }; card(suite_type s, pip_type p): value(s + suite_count * p) {} explicit card(unsigned char v = 0): value(v) {} pip_type pip() { return pip_type(value / suite_count); } suite_type suite() { return suite_type(value % suite_count); } private: unsigned char value; }; const char* const pip_names[] = { "two", "three", "four", "five", "six", "seven", "eight", "nine", "ten", "jack", "queen", "king", "ace" }; std::ostream& operator<<(std::ostream& os, card::pip_type pip) { return os << pip_names[pip]; } const char* const suite_names[] = { "hearts", "spades", "diamonds", "clubs" }; std::ostream& operator<<(std::ostream& os, card::suite_type suite) { return os << suite_names[suite]; } std::ostream& operator<<(std::ostream& os, card c) { return os << c.pip() << " of " << c.suite(); } class deck { public: deck() { for (int i = 0; i < card::unique_count; ++i) { cards.push_back(card(i)); } } void shuffle() { std::random_shuffle(cards.begin(), cards.end()); } card deal() { card c = cards.front(); cards.pop_front(); return c; } typedef std::deque<card>::const_iterator const_iterator; const_iterator begin() const { return cards.cbegin(); } const_iterator end() const { return cards.cend(); } private: std::deque<card> cards; }; inline std::ostream& operator<<(std::ostream& os, const deck& d) { std::copy(d.begin(), d.end(), std::ostream_iterator<card>(os, "\n")); return os; } }
public enum Pip { Two, Three, Four, Five, Six, Seven, Eight, Nine, Ten, Jack, Queen, King, Ace }
Maintain the same structure and functionality when rewriting this code in Java.
#include <array> #include <vector> #include <algorithm> #include <iostream> #include <iterator> #include <string> template <typename Array> void demonstrate(Array& array) { array[2] = "Three"; array.at(1) = "Two"; std::reverse(begin(array), end(array)); std::for_each(begin(array), end(array), [](typename Array::value_type const& element) { std::cout << element << ' '; }); std::cout << '\n'; } int main() { auto fixed_size_array = std::array<std::string, 3>{ "One", "Four", "Eight" }; auto dynamic_array = std::vector<std::string>{ "One", "Four" }; dynamic_array.push_back("Eight"); demonstrate(fixed_size_array); demonstrate(dynamic_array); }
Int[] literalArray = [1,2,3]; Int[] fixedLengthArray = new Int[10]; Int[] variableArray = new Int[]; assert literalArray.size == 3; Int n = literalArray[2]; fixedLengthArray[4] = 12345; fixedLengthArray += 6789; variableArray += 6789;
Write the same code in Java as shown below in C++.
#include <cstdint> #include <cstdlib> #include <cstdio> static constexpr int32_t bct_low_bits = 0x55555555; static int32_t bct_decrement(int32_t v) { --v; return v ^ (v & (v>>1) & bct_low_bits); } int main (int argc, char *argv[]) { const int32_t n = (1 < argc) ? std::atoi(argv[1]) : 3; if (n < 0 || 9 < n) { std::printf("N out of range (use 0..9): %ld\n", long(n)); return 1; } const int32_t size_bct = 1<<(n*2); int32_t y = size_bct; do { y = bct_decrement(y); int32_t x = size_bct; do { x = bct_decrement(x); std::putchar((x & y & bct_low_bits) ? ' ' : '#'); } while (0 < x); std::putchar('\n'); } while (0 < y); return 0; }
public static boolean inCarpet(long x, long y) { while (x!=0 && y!=0) { if (x % 3 == 1 && y % 3 == 1) return false; x /= 3; y /= 3; } return true; } public static void carpet(final int n) { final double power = Math.pow(3,n); for(long i = 0; i < power; i++) { for(long j = 0; j < power; j++) { System.out.print(inCarpet(i, j) ? "*" : " "); } System.out.println(); } }
Preserve the algorithm and functionality while converting the code from C++ to Java.
#include <algorithm> #include <iostream> #include <iterator> #include <random> template <typename RandomAccessIterator, typename Predicate> void bogo_sort(RandomAccessIterator begin, RandomAccessIterator end, Predicate p) { std::random_device rd; std::mt19937 generator(rd()); while (!std::is_sorted(begin, end, p)) { std::shuffle(begin, end, generator); } } template <typename RandomAccessIterator> void bogo_sort(RandomAccessIterator begin, RandomAccessIterator end) { bogo_sort( begin, end, std::less< typename std::iterator_traits<RandomAccessIterator>::value_type>()); } int main() { int a[] = {100, 2, 56, 200, -52, 3, 99, 33, 177, -199}; bogo_sort(std::begin(a), std::end(a)); copy(std::begin(a), std::end(a), std::ostream_iterator<int>(std::cout, " ")); std::cout << "\n"; }
public class BogoSort { public static void main(String[] args) { int[] arr={4,5,6,0,7,8,9,1,2,3}; BogoSort now=new BogoSort(); System.out.print("Unsorted: "); now.display1D(arr); now.bogo(arr); System.out.print("Sorted: "); now.display1D(arr); } void bogo(int[] arr) { int shuffle=1; for(;!isSorted(arr);shuffle++) shuffle(arr); System.out.println("This took "+shuffle+" shuffles."); } void shuffle(int[] arr) { int i=arr.length-1; while(i>0) swap(arr,i--,(int)(Math.random()*i)); } void swap(int[] arr,int i,int j) { int temp=arr[i]; arr[i]=arr[j]; arr[j]=temp; } boolean isSorted(int[] arr) { for(int i=1;i<arr.length;i++) if(arr[i]<arr[i-1]) return false; return true; } void display1D(int[] arr) { for(int i=0;i<arr.length;i++) System.out.print(arr[i]+" "); System.out.println(); } }
Change the programming language of this snippet from C++ to Java without modifying what it does.
#include <iomanip> #include <iostream> typedef double F(double,double); void euler(F f, double y0, double a, double b, double h) { double y = y0; for (double t = a; t < b; t += h) { std::cout << std::fixed << std::setprecision(3) << t << " " << y << "\n"; y += h * f(t, y); } std::cout << "done\n"; } double newtonCoolingLaw(double, double t) { return -0.07 * (t - 20); } int main() { euler(newtonCoolingLaw, 100, 0, 100, 2); euler(newtonCoolingLaw, 100, 0, 100, 5); euler(newtonCoolingLaw, 100, 0, 100, 10); }
public class Euler { private static void euler (Callable f, double y0, int a, int b, int h) { int t = a; double y = y0; while (t < b) { System.out.println ("" + t + " " + y); t += h; y += h * f.compute (t, y); } System.out.println ("DONE"); } public static void main (String[] args) { Callable cooling = new Cooling (); int[] steps = {2, 5, 10}; for (int stepSize : steps) { System.out.println ("Step size: " + stepSize); euler (cooling, 100.0, 0, 100, stepSize); } } } interface Callable { public double compute (int time, double t); } class Cooling implements Callable { public double compute (int time, double t) { return -0.07 * (t - 20); } }
Produce a functionally identical Java code for the snippet given in C++.
#include <iostream> #include <algorithm> #include <vector> #include <cmath> #include <boost/bind.hpp> #include <iterator> double nextNumber( double number ) { return number + floor( 0.5 + sqrt( number ) ) ; } int main( ) { std::vector<double> non_squares ; typedef std::vector<double>::iterator SVI ; non_squares.reserve( 1000000 ) ; for ( double i = 1.0 ; i < 100001.0 ; i += 1 ) non_squares.push_back( nextNumber( i ) ) ; std::copy( non_squares.begin( ) , non_squares.begin( ) + 22 , std::ostream_iterator<double>(std::cout, " " ) ) ; std::cout << '\n' ; SVI found = std::find_if ( non_squares.begin( ) , non_squares.end( ) , boost::bind( &floor, boost::bind( &sqrt, _1 ) ) == boost::bind( &sqrt, _1 ) ) ; if ( found != non_squares.end( ) ) { std::cout << "Found a square number in the sequence!\n" ; std::cout << "It is " << *found << " !\n" ; } else { std::cout << "Up to 1000000, found no square number in the sequence!\n" ; } return 0 ; }
public class SeqNonSquares { public static int nonsqr(int n) { return n + (int)Math.round(Math.sqrt(n)); } public static void main(String[] args) { for (int i = 1; i < 23; i++) System.out.print(nonsqr(i) + " "); System.out.println(); for (int i = 1; i < 1000000; i++) { double j = Math.sqrt(nonsqr(i)); assert j != Math.floor(j); } } }
Generate a Java translation of this C++ snippet without changing its computational steps.
#include <iostream> #include <string> int main() { std::string s = "0123456789"; int const n = 3; int const m = 4; char const c = '2'; std::string const sub = "456"; std::cout << s.substr(n, m)<< "\n"; std::cout << s.substr(n) << "\n"; std::cout << s.substr(0, s.size()-1) << "\n"; std::cout << s.substr(s.find(c), m) << "\n"; std::cout << s.substr(s.find(sub), m) << "\n"; }
public static String Substring(String str, int n, int m){ return str.substring(n, n+m); } public static String Substring(String str, int n){ return str.substring(n); } public static String Substring(String str){ return str.substring(0, str.length()-1); } public static String Substring(String str, char c, int m){ return str.substring(str.indexOf(c), str.indexOf(c)+m+1); } public static String Substring(String str, String sub, int m){ return str.substring(str.indexOf(sub), str.indexOf(sub)+m+1); }
Preserve the algorithm and functionality while converting the code from C++ to Java.
#include <algorithm> #include <string> #include <iostream> #include <iterator> class jortSort { public: template<class T> bool jort_sort( T* o, size_t s ) { T* n = copy_array( o, s ); sort_array( n, s ); bool r = false; if( n ) { r = check( o, n, s ); delete [] n; } return r; } private: template<class T> T* copy_array( T* o, size_t s ) { T* z = new T[s]; memcpy( z, o, s * sizeof( T ) ); return z; } template<class T> void sort_array( T* n, size_t s ) { std::sort( n, n + s ); } template<class T> bool check( T* n, T* o, size_t s ) { for( size_t x = 0; x < s; x++ ) if( n[x] != o[x] ) return false; return true; } }; jortSort js; template<class T> void displayTest( T* o, size_t s ) { std::copy( o, o + s, std::ostream_iterator<T>( std::cout, " " ) ); std::cout << ": -> The array is " << ( js.jort_sort( o, s ) ? "sorted!" : "not sorted!" ) << "\n\n"; } int main( int argc, char* argv[] ) { const size_t s = 5; std::string oStr[] = { "5", "A", "D", "R", "S" }; displayTest( oStr, s ); std::swap( oStr[0], oStr[1] ); displayTest( oStr, s ); int oInt[] = { 1, 2, 3, 4, 5 }; displayTest( oInt, s ); std::swap( oInt[0], oInt[1] ); displayTest( oInt, s ); return 0; }
public class JortSort { public static void main(String[] args) { System.out.println(jortSort(new int[]{1, 2, 3})); } static boolean jortSort(int[] arr) { return true; } }
Write a version of this C++ function in Java with identical behavior.
#include <iostream> bool is_leap_year(int year) { return year % 4 == 0 && (year % 100 != 0 || year % 400 == 0); } int main() { for (auto year : {1900, 1994, 1996, 1997, 2000}) { std::cout << year << (is_leap_year(year) ? " is" : " is not") << " a leap year.\n"; } }
import java.util.GregorianCalendar; import java.text.MessageFormat; public class Leapyear{ public static void main(String[] argv){ int[] yrs = {1800,1900,1994,1998,1999,2000,2001,2004,2100}; GregorianCalendar cal = new GregorianCalendar(); for(int year : yrs){ System.err.println(MessageFormat.format("The year {0,number,#} is leaper: {1} / {2}.", year, cal.isLeapYear(year), isLeapYear(year))); } } public static boolean isLeapYear(int year){ return (year % 100 == 0) ? (year % 400 == 0) : (year % 4 == 0); } }
Convert this C++ block to Java, preserving its control flow and logic.
#include <boost/multiprecision/gmp.hpp> #include <iostream> using namespace boost::multiprecision; mpz_int p(uint n, uint p) { mpz_int r = 1; mpz_int k = n - p; while (n > k) r *= n--; return r; } mpz_int c(uint n, uint k) { mpz_int r = p(n, k); while (k) r /= k--; return r; } int main() { for (uint i = 1u; i < 12u; i++) std::cout << "P(12," << i << ") = " << p(12u, i) << std::endl; for (uint i = 10u; i < 60u; i += 10u) std::cout << "C(60," << i << ") = " << c(60u, i) << std::endl; return 0; }
import java.math.BigInteger; public class CombinationsAndPermutations { public static void main(String[] args) { System.out.println(Double.MAX_VALUE); System.out.println("A sample of permutations from 1 to 12 with exact Integer arithmetic:"); for ( int n = 1 ; n <= 12 ; n++ ) { int k = n / 2; System.out.printf("%d P %d = %s%n", n, k, permutation(n, k)); } System.out.println(); System.out.println("A sample of combinations from 10 to 60 with exact Integer arithmetic:"); for ( int n = 10 ; n <= 60 ; n += 5 ) { int k = n / 2; System.out.printf("%d C %d = %s%n", n, k, combination(n, k)); } System.out.println(); System.out.println("A sample of permutations from 5 to 15000 displayed in floating point arithmetic:"); System.out.printf("%d P %d = %s%n", 5, 2, display(permutation(5, 2), 50)); for ( int n = 1000 ; n <= 15000 ; n += 1000 ) { int k = n / 2; System.out.printf("%d P %d = %s%n", n, k, display(permutation(n, k), 50)); } System.out.println(); System.out.println("A sample of combinations from 100 to 1000 displayed in floating point arithmetic:"); for ( int n = 100 ; n <= 1000 ; n += 100 ) { int k = n / 2; System.out.printf("%d C %d = %s%n", n, k, display(combination(n, k), 50)); } } private static String display(BigInteger val, int precision) { String s = val.toString(); precision = Math.min(precision, s.length()); StringBuilder sb = new StringBuilder(); sb.append(s.substring(0, 1)); sb.append("."); sb.append(s.substring(1, precision)); sb.append(" * 10^"); sb.append(s.length()-1); return sb.toString(); } public static BigInteger combination(int n, int k) { if ( n-k < k ) { k = n-k; } BigInteger result = permutation(n, k); while ( k > 0 ) { result = result.divide(BigInteger.valueOf(k)); k--; } return result; } public static BigInteger permutation(int n, int k) { BigInteger result = BigInteger.ONE; for ( int i = n ; i >= n-k+1 ; i-- ) { result = result.multiply(BigInteger.valueOf(i)); } return result; } }
Convert this C++ snippet to Java and keep its semantics consistent.
#include <algorithm> #include <iostream> #include <numeric> #include <string> #include <vector> void lexicographical_sort(std::vector<int>& numbers) { std::vector<std::string> strings(numbers.size()); std::transform(numbers.begin(), numbers.end(), strings.begin(), [](int i) { return std::to_string(i); }); std::sort(strings.begin(), strings.end()); std::transform(strings.begin(), strings.end(), numbers.begin(), [](const std::string& s) { return std::stoi(s); }); } std::vector<int> lexicographically_sorted_vector(int n) { std::vector<int> numbers(n >= 1 ? n : 2 - n); std::iota(numbers.begin(), numbers.end(), std::min(1, n)); lexicographical_sort(numbers); return numbers; } template <typename T> void print_vector(std::ostream& out, const std::vector<T>& v) { out << '['; if (!v.empty()) { auto i = v.begin(); out << *i++; for (; i != v.end(); ++i) out << ',' << *i; } out << "]\n"; } int main(int argc, char** argv) { for (int i : { 0, 5, 13, 21, -22 }) { std::cout << i << ": "; print_vector(std::cout, lexicographically_sorted_vector(i)); } return 0; }
import java.util.List; import java.util.stream.*; public class LexicographicalNumbers { static List<Integer> lexOrder(int n) { int first = 1, last = n; if (n < 1) { first = n; last = 1; } return IntStream.rangeClosed(first, last) .mapToObj(Integer::toString) .sorted() .map(Integer::valueOf) .collect(Collectors.toList()); } public static void main(String[] args) { System.out.println("In lexicographical order:\n"); int[] ints = {0, 5, 13, 21, -22}; for (int n : ints) { System.out.printf("%3d: %s\n", n, lexOrder(n)); } } }
Convert this C++ block to Java, preserving its control flow and logic.
#include <string> #include <iostream> using std::string; const char* smallNumbers[] = { "zero", "one", "two", "three", "four", "five", "six", "seven", "eight", "nine", "ten", "eleven", "twelve", "thirteen", "fourteen", "fifteen", "sixteen", "seventeen", "eighteen", "nineteen" }; string spellHundreds(unsigned n) { string res; if (n > 99) { res = smallNumbers[n/100]; res += " hundred"; n %= 100; if (n) res += " and "; } if (n >= 20) { static const char* Decades[] = { "", "", "twenty", "thirty", "forty", "fifty", "sixty", "seventy", "eighty", "ninety" }; res += Decades[n/10]; n %= 10; if (n) res += "-"; } if (n < 20 && n > 0) res += smallNumbers[n]; return res; } const char* thousandPowers[] = { " billion", " million", " thousand", "" }; typedef unsigned long Spellable; string spell(Spellable n) { if (n < 20) return smallNumbers[n]; string res; const char** pScaleName = thousandPowers; Spellable scaleFactor = 1000000000; while (scaleFactor > 0) { if (n >= scaleFactor) { Spellable h = n / scaleFactor; res += spellHundreds(h) + *pScaleName; n %= scaleFactor; if (n) res += ", "; } scaleFactor /= 1000; ++pScaleName; } return res; } int main() { #define SPELL_IT(x) std::cout << #x " " << spell(x) << std::endl; SPELL_IT( 99); SPELL_IT( 300); SPELL_IT( 310); SPELL_IT( 1501); SPELL_IT( 12609); SPELL_IT( 512609); SPELL_IT(43112609); SPELL_IT(1234567890); return 0; }
module NumberNames { void run() { @Inject Console console; Int[] tests = [0, 1, -1, 11, -17, 42, 99, 100, 101, -111, 1000, 1234, 10000, 100000, 123456789000, 0x123456789ABCDEF]; for (Int test : tests) { console.print($"{test} = {toEnglish(test)}"); } } static String[] digits = ["zero", "one", "two", "three", "four", "five", "six", "seven", "eight", "nine"]; static String[] teens = ["ten", "eleven", "twelve", "thirteen", "fourteen", "fifteen", "sixteen", "seventeen", "eighteen", "nineteen"]; static String[] tens = ["zero", "ten", "twenty", "thirty", "forty", "fifty", "sixty", "seventy", "eighty", "ninety"]; static String[] ten3rd = ["?", "thousand", "million", "billion", "trillion", "quadrillion", "quintillion"]; static String toEnglish(Int n) { StringBuffer buf = new StringBuffer(); if (n < 0) { "negative ".appendTo(buf); n = -n; } format3digits(n, buf); return buf.toString(); } static void format3digits(Int n, StringBuffer buf, Int nested=0) { (Int left, Int right) = n /% 1000; if (left != 0) { format3digits(left, buf, nested+1); } if (right != 0 || (left == 0 && nested==0)) { if (right >= 100) { (left, right) = (right /% 100); digits[left].appendTo(buf); " hundred ".appendTo(buf); if (right != 0) { format2digits(right, buf); } } else { format2digits(right, buf); } if (nested > 0) { ten3rd[nested].appendTo(buf).add(' '); } } } static void format2digits(Int n, StringBuffer buf) { switch (n) { case 0..9: digits[n].appendTo(buf).add(' '); break; case 10..19: teens[n-10].appendTo(buf).add(' '); break; default: (Int left, Int right) = n /% 10; tens[left].appendTo(buf); if (right == 0) { buf.add(' '); } else { buf.add('-'); digits[right].appendTo(buf).add(' '); } break; } } }
Convert this C++ block to Java, preserving its control flow and logic.
#include <iostream> #include <algorithm> #include <string> #include <list> using namespace std; bool cmp(const string& a, const string& b) { return b.length() < a.length(); } void compareAndReportStringsLength(list<string> listOfStrings) { if (!listOfStrings.empty()) { char Q = '"'; string has_length(" has length "); string predicate_max(" and is the longest string"); string predicate_min(" and is the shortest string"); string predicate_ave(" and is neither the longest nor the shortest string"); list<string> ls(listOfStrings); ls.sort(cmp); int max = ls.front().length(); int min = ls.back().length(); for (list<string>::iterator s = ls.begin(); s != ls.end(); s++) { int length = s->length(); string* predicate; if (length == max) predicate = &predicate_max; else if (length == min) predicate = &predicate_min; else predicate = &predicate_ave; cout << Q << *s << Q << has_length << length << *predicate << endl; } } } int main(int argc, char* argv[]) { list<string> listOfStrings{ "abcd", "123456789", "abcdef", "1234567" }; compareAndReportStringsLength(listOfStrings); return EXIT_SUCCESS; }
package stringlensort; import java.io.PrintStream; import java.util.Arrays; import java.util.Comparator; public class ReportStringLengths { public static void main(String[] args) { String[] list = {"abcd", "123456789", "abcdef", "1234567"}; String[] strings = args.length > 0 ? args : list; compareAndReportStringsLength(strings); } public static void compareAndReportStringsLength(String[] strings) { compareAndReportStringsLength(strings, System.out); } public static void compareAndReportStringsLength(String[] strings, PrintStream stream) { if (strings.length > 0) { strings = strings.clone(); final String QUOTE = "\""; Arrays.sort(strings, Comparator.comparing(String::length)); int min = strings[0].length(); int max = strings[strings.length - 1].length(); for (int i = strings.length - 1; i >= 0; i--) { int length = strings[i].length(); String predicate; if (length == max) { predicate = "is the longest string"; } else if (length == min) { predicate = "is the shortest string"; } else { predicate = "is neither the longest nor the shortest string"; } stream.println(QUOTE + strings[i] + QUOTE + " has length " + length + " and " + predicate); } } } }
Write the same code in Java as shown below in C++.
#include <time.h> #include <iostream> using namespace std; const int MAX = 126; class shell { public: shell() { _gap[0] = 1750; _gap[1] = 701; _gap[2] = 301; _gap[3] = 132; _gap[4] = 57; _gap[5] = 23; _gap[6] = 10; _gap[7] = 4; _gap[8] = 1; } void sort( int* a, int count ) { _cnt = count; for( int x = 0; x < 9; x++ ) if( count > _gap[x] ) { _idx = x; break; } sortIt( a ); } private: void sortIt( int* arr ) { bool sorted = false; while( true ) { sorted = true; int st = 0; for( int x = _gap[_idx]; x < _cnt; x += _gap[_idx] ) { if( arr[st] > arr[x] ) { swap( arr[st], arr[x] ); sorted = false; } st = x; } if( ++_idx >= 8 ) _idx = 8; if( sorted && _idx == 8 ) break; } } void swap( int& a, int& b ) { int t = a; a = b; b = t; } int _gap[9], _idx, _cnt; }; int main( int argc, char* argv[] ) { srand( static_cast<unsigned int>( time( NULL ) ) ); int arr[MAX]; for( int x = 0; x < MAX; x++ ) arr[x] = rand() % MAX - rand() % MAX; cout << " Before: \n=========\n"; for( int x = 0; x < 7; x++ ) { for( int a = 0; a < 18; a++ ) { cout << arr[x * 18 + a] << " "; } cout << endl; } cout << endl; shell s; s.sort( arr, MAX ); cout << " After: \n========\n"; for( int x = 0; x < 7; x++ ) { for( int a = 0; a < 18; a++ ) { cout << arr[x * 18 + a] << " "; } cout << endl; } cout << endl << endl; return system( "pause" ); }
public static void shell(int[] a) { int increment = a.length / 2; while (increment > 0) { for (int i = increment; i < a.length; i++) { int j = i; int temp = a[i]; while (j >= increment && a[j - increment] > temp) { a[j] = a[j - increment]; j = j - increment; } a[j] = temp; } if (increment == 2) { increment = 1; } else { increment *= (5.0 / 11); } } }
Port the provided C++ code into Java while preserving the original functionality.
#include <iostream> #include <list> int main () { std::list<int> numbers {1, 5, 7, 0, 3, 2}; numbers.insert(numbers.begin(), 9); numbers.insert(numbers.end(), 4); auto it = std::next(numbers.begin(), numbers.size() / 2); numbers.insert(it, 6); for(const auto& i: numbers) std::cout << i << ' '; std::cout << '\n'; }
import java.util.LinkedList; public class DoublyLinkedList { public static void main(String[] args) { LinkedList<String> list = new LinkedList<String>(); list.addFirst("Add First"); list.addLast("Add Last 1"); list.addLast("Add Last 2"); list.addLast("Add Last 1"); traverseList(list); list.removeFirstOccurrence("Add Last 1"); traverseList(list); } private static void traverseList(LinkedList<String> list) { System.out.println("Traverse List:"); for ( int i = 0 ; i < list.size() ; i++ ) { System.out.printf("Element number %d - Element value = '%s'%n", i, list.get(i)); } System.out.println(); } }
Keep all operations the same but rewrite the snippet in Java.
#include <fstream> #include <iostream> int main() { std::ifstream input("filename.txt", std::ios_base::binary); if (!input) { std::cerr << "error: can't open file\n"; return -1; } size_t count[256]; std::fill_n(count, 256, 0); for (char c; input.get(c); ++count[uint8_t(c)]) ; for (size_t i = 0; i < 256; ++i) { if (count[i] && isgraph(i)) { std::cout << char(i) << " = " << count[i] << '\n'; } } }
import java.io.BufferedReader; import java.io.FileReader; import java.io.IOException; import java.util.Arrays; public class LetterFreq { public static int[] countLetters(String filename) throws IOException{ int[] freqs = new int[26]; BufferedReader in = new BufferedReader(new FileReader(filename)); String line; while((line = in.readLine()) != null){ line = line.toUpperCase(); for(char ch:line.toCharArray()){ if(Character.isLetter(ch)){ freqs[ch - 'A']++; } } } in.close(); return freqs; } public static void main(String[] args) throws IOException{ System.out.println(Arrays.toString(countLetters("filename.txt"))); } }
Ensure the translated Java code behaves exactly like the original C++ snippet.
#include<iostream> #include<vector> #include<numeric> #include<functional> class { public: int64_t operator()(int n, int k){ return partial_factorial(n, k) / factorial(n - k);} private: int64_t partial_factorial(int from, int to) { return from == to ? 1 : from * partial_factorial(from - 1, to); } int64_t factorial(int n) { return n == 0 ? 1 : n * factorial(n - 1);} }combinations; int main() { static constexpr int treatment = 9; const std::vector<int> data{ 85, 88, 75, 66, 25, 29, 83, 39, 97, 68, 41, 10, 49, 16, 65, 32, 92, 28, 98 }; int treated = std::accumulate(data.begin(), data.begin() + treatment, 0); std::function<int (int, int, int)> pick; pick = [&](int n, int from, int accumulated) { if(n == 0) return accumulated > treated ? 1 : 0; else return pick(n - 1, from - 1, accumulated + data[from - 1]) + (from > n ? pick(n, from - 1, accumulated) : 0); }; int total = combinations(data.size(), treatment); int greater = pick(treatment, data.size(), 0); int lesser = total - greater; std::cout << "<= : " << 100.0 * lesser / total << "% " << lesser << std::endl << " > : " << 100.0 * greater / total << "% " << greater << std::endl; }
public class PermutationTest { private static final int[] data = new int[]{ 85, 88, 75, 66, 25, 29, 83, 39, 97, 68, 41, 10, 49, 16, 65, 32, 92, 28, 98 }; private static int pick(int at, int remain, int accu, int treat) { if (remain == 0) return (accu > treat) ? 1 : 0; return pick(at - 1, remain - 1, accu + data[at - 1], treat) + ((at > remain) ? pick(at - 1, remain, accu, treat) : 0); } public static void main(String[] args) { int treat = 0; double total = 1.0; for (int i = 0; i <= 8; ++i) { treat += data[i]; } for (int i = 19; i >= 11; --i) { total *= i; } for (int i = 9; i >= 1; --i) { total /= i; } int gt = pick(19, 9, 0, treat); int le = (int) (total - gt); System.out.printf("<= : %f%% %d\n", 100.0 * le / total, le); System.out.printf(" > : %f%% %d\n", 100.0 * gt / total, gt); } }
Produce a language-to-language conversion: from C++ to Java, same semantics.
#include <iomanip> #include <iostream> #include <vector> constexpr int MU_MAX = 1'000'000; std::vector<int> MU; int mobiusFunction(int n) { if (!MU.empty()) { return MU[n]; } MU.resize(MU_MAX + 1, 1); int root = sqrt(MU_MAX); for (int i = 2; i <= root; i++) { if (MU[i] == 1) { for (int j = i; j <= MU_MAX; j += i) { MU[j] *= -i; } for (int j = i * i; j <= MU_MAX; j += i * i) { MU[j] = 0; } } } for (int i = 2; i <= MU_MAX; i++) { if (MU[i] == i) { MU[i] = 1; } else if (MU[i] == -i) { MU[i] = -1; } else if (MU[i] < 0) { MU[i] = 1; } else if (MU[i] > 0) { MU[i] = -1; } } return MU[n]; } int main() { std::cout << "First 199 terms of the möbius function are as follows:\n "; for (int n = 1; n < 200; n++) { std::cout << std::setw(2) << mobiusFunction(n) << " "; if ((n + 1) % 20 == 0) { std::cout << '\n'; } } return 0; }
public class MöbiusFunction { public static void main(String[] args) { System.out.printf("First 199 terms of the möbius function are as follows:%n "); for ( int n = 1 ; n < 200 ; n++ ) { System.out.printf("%2d ", möbiusFunction(n)); if ( (n+1) % 20 == 0 ) { System.out.printf("%n"); } } } private static int MU_MAX = 1_000_000; private static int[] MU = null; private static int möbiusFunction(int n) { if ( MU != null ) { return MU[n]; } MU = new int[MU_MAX+1]; int sqrt = (int) Math.sqrt(MU_MAX); for ( int i = 0 ; i < MU_MAX ; i++ ) { MU[i] = 1; } for ( int i = 2 ; i <= sqrt ; i++ ) { if ( MU[i] == 1 ) { for ( int j = i ; j <= MU_MAX ; j += i ) { MU[j] *= -i; } for ( int j = i*i ; j <= MU_MAX ; j += i*i ) { MU[j] = 0; } } } for ( int i = 2 ; i <= MU_MAX ; i++ ) { if ( MU[i] == i ) { MU[i] = 1; } else if ( MU[i] == -i ) { MU[i] = -1; } else if ( MU[i] < 0 ) { MU[i] = 1; } else if ( MU[i] > 0 ) { MU[i] = -1; } } return MU[n]; } }
Port the provided C++ code into Java while preserving the original functionality.
#include <cstdlib> #include <string> #include <sstream> std::string s = "12345"; int i; std::istringstream(s) >> i; i++; std::ostringstream oss; if (oss << i) s = oss.str();
String s = "12345"; IntLiteral lit1 = new IntLiteral(s); IntLiteral lit2 = 6789; ++lit1; ++lit2;
Write a version of this C++ function in Java with identical behavior.
#include <algorithm> #include <iostream> #include <string> std::string stripchars(std::string str, const std::string &chars) { str.erase( std::remove_if(str.begin(), str.end(), [&](char c){ return chars.find(c) != std::string::npos; }), str.end() ); return str; } int main() { std::cout << stripchars("She was a soul stripper. She took my heart!", "aei") << '\n'; return 0; }
class StripChars { public static String stripChars(String inString, String toStrip) { return inString.replaceAll("[" + toStrip + "]", ""); } public static void main(String[] args) { String sentence = "She was a soul stripper. She took my heart!"; String chars = "aei"; System.out.println("sentence: " + sentence); System.out.println("to strip: " + chars); System.out.println("stripped: " + stripChars(sentence, chars)); } }
Rewrite this program in Java while keeping its functionality equivalent to the C++ version.
#include <algorithm> template<typename ForwardIterator> void permutation_sort(ForwardIterator begin, ForwardIterator end) { while (std::next_permutation(begin, end)) { } }
import java.util.List; import java.util.ArrayList; import java.util.Arrays; public class PermutationSort { public static void main(String[] args) { int[] a={3,2,1,8,9,4,6}; System.out.println("Unsorted: " + Arrays.toString(a)); a=pSort(a); System.out.println("Sorted: " + Arrays.toString(a)); } public static int[] pSort(int[] a) { List<int[]> list=new ArrayList<int[]>(); permute(a,a.length,list); for(int[] x : list) if(isSorted(x)) return x; return a; } private static void permute(int[] a, int n, List<int[]> list) { if (n == 1) { int[] b=new int[a.length]; System.arraycopy(a, 0, b, 0, a.length); list.add(b); return; } for (int i = 0; i < n; i++) { swap(a, i, n-1); permute(a, n-1, list); swap(a, i, n-1); } } private static boolean isSorted(int[] a) { for(int i=1;i<a.length;i++) if(a[i-1]>a[i]) return false; return true; } private static void swap(int[] arr,int i, int j) { int temp=arr[i]; arr[i]=arr[j]; arr[j]=temp; } }
Ensure the translated Java code behaves exactly like the original C++ snippet.
#include <vector> double mean(const std::vector<double>& numbers) { if (numbers.size() == 0) return 0; double sum = 0; for (std::vector<double>::iterator i = numbers.begin(); i != numbers.end(); i++) sum += *i; return sum / numbers.size(); }
public static double avg(double... arr) { double sum = 0.0; for (double x : arr) { sum += x; } return sum / arr.length; }
Convert the following code from C++ to Java, ensuring the logic remains intact.
#include <algorithm> #include <cctype> #include <iostream> #include <sstream> #include <string> #include <vector> const char* command_table = "add 1 alter 3 backup 2 bottom 1 Cappend 2 change 1 Schange Cinsert 2 Clast 3 " "compress 4 copy 2 count 3 Coverlay 3 cursor 3 delete 3 Cdelete 2 down 1 duplicate " "3 xEdit 1 expand 3 extract 3 find 1 Nfind 2 Nfindup 6 NfUP 3 Cfind 2 findUP 3 fUP 2 " "forward 2 get help 1 hexType 4 input 1 powerInput 3 join 1 split 2 spltJOIN load " "locate 1 Clocate 2 lowerCase 3 upperCase 3 Lprefix 2 macro merge 2 modify 3 move 2 " "msg next 1 overlay 1 parse preserve 4 purge 3 put putD query 1 quit read recover 3 " "refresh renum 3 repeat 3 replace 1 Creplace 2 reset 3 restore 4 rgtLEFT right 2 left " "2 save set shift 2 si sort sos stack 3 status 4 top transfer 3 type 1 up 1"; class command { public: command(const std::string&, size_t); const std::string& cmd() const { return cmd_; } size_t min_length() const { return min_len_; } bool match(const std::string&) const; private: std::string cmd_; size_t min_len_; }; command::command(const std::string& cmd, size_t min_len) : cmd_(cmd), min_len_(min_len) {} bool command::match(const std::string& str) const { size_t olen = str.length(); return olen >= min_len_ && olen <= cmd_.length() && cmd_.compare(0, olen, str) == 0; } bool parse_integer(const std::string& word, int& value) { try { size_t pos; int i = std::stoi(word, &pos, 10); if (pos < word.length()) return false; value = i; return true; } catch (const std::exception& ex) { return false; } } void uppercase(std::string& str) { std::transform(str.begin(), str.end(), str.begin(), [](unsigned char c) -> unsigned char { return std::toupper(c); }); } class command_list { public: explicit command_list(const char*); const command* find_command(const std::string&) const; private: std::vector<command> commands_; }; command_list::command_list(const char* table) { std::istringstream is(table); std::string word; std::vector<std::string> words; while (is >> word) { uppercase(word); words.push_back(word); } for (size_t i = 0, n = words.size(); i < n; ++i) { word = words[i]; int len = word.length(); if (i + 1 < n && parse_integer(words[i + 1], len)) ++i; commands_.push_back(command(word, len)); } } const command* command_list::find_command(const std::string& word) const { auto iter = std::find_if(commands_.begin(), commands_.end(), [&word](const command& cmd) { return cmd.match(word); }); return (iter != commands_.end()) ? &*iter : nullptr; } std::string test(const command_list& commands, const std::string& input) { std::string output; std::istringstream is(input); std::string word; while (is >> word) { if (!output.empty()) output += ' '; uppercase(word); const command* cmd_ptr = commands.find_command(word); if (cmd_ptr) output += cmd_ptr->cmd(); else output += "*error*"; } return output; } int main() { command_list commands(command_table); std::string input("riG rePEAT copies put mo rest types fup. 6 poweRin"); std::string output(test(commands, input)); std::cout << " input: " << input << '\n'; std::cout << "output: " << output << '\n'; return 0; }
import java.util.*; public class Abbreviations { public static void main(String[] args) { CommandList commands = new CommandList(commandTable); String input = "riG rePEAT copies put mo rest types fup. 6 poweRin"; System.out.println(" input: " + input); System.out.println("output: " + test(commands, input)); } private static String test(CommandList commands, String input) { StringBuilder output = new StringBuilder(); Scanner scanner = new Scanner(input); while (scanner.hasNext()) { String word = scanner.next(); if (output.length() > 0) output.append(' '); Command cmd = commands.findCommand(word); if (cmd != null) output.append(cmd.cmd); else output.append("*error*"); } return output.toString(); } private static String commandTable = "add 1 alter 3 backup 2 bottom 1 Cappend 2 change 1 Schange Cinsert 2 Clast 3 " + "compress 4 copy 2 count 3 Coverlay 3 cursor 3 delete 3 Cdelete 2 down 1 duplicate " + "3 xEdit 1 expand 3 extract 3 find 1 Nfind 2 Nfindup 6 NfUP 3 Cfind 2 findUP 3 fUP 2 " + "forward 2 get help 1 hexType 4 input 1 powerInput 3 join 1 split 2 spltJOIN load " + "locate 1 Clocate 2 lowerCase 3 upperCase 3 Lprefix 2 macro merge 2 modify 3 move 2 " + "msg next 1 overlay 1 parse preserve 4 purge 3 put putD query 1 quit read recover 3 " + "refresh renum 3 repeat 3 replace 1 Creplace 2 reset 3 restore 4 rgtLEFT right 2 left " + "2 save set shift 2 si sort sos stack 3 status 4 top transfer 3 type 1 up 1"; private static class Command { private Command(String cmd, int minLength) { this.cmd = cmd; this.minLength = minLength; } private boolean match(String str) { int olen = str.length(); return olen >= minLength && olen <= cmd.length() && cmd.regionMatches(true, 0, str, 0, olen); } private String cmd; private int minLength; } private static Integer parseInteger(String word) { try { return Integer.valueOf(word); } catch (NumberFormatException ex) { return null; } } private static class CommandList { private CommandList(String table) { Scanner scanner = new Scanner(table); List<String> words = new ArrayList<>(); while (scanner.hasNext()) { String word = scanner.next(); words.add(word.toUpperCase()); } for (int i = 0, n = words.size(); i < n; ++i) { String word = words.get(i); int len = word.length(); if (i + 1 < n) { Integer number = parseInteger(words.get(i + 1)); if (number != null) { len = number.intValue(); ++i; } } commands.add(new Command(word, len)); } } private Command findCommand(String word) { for (Command command : commands) { if (command.match(word)) return command; } return null; } private List<Command> commands = new ArrayList<>(); } }
Produce a functionally identical Java code for the snippet given in C++.
#include <algorithm> #include <cctype> #include <iostream> #include <sstream> #include <string> #include <vector> const char* command_table = "add 1 alter 3 backup 2 bottom 1 Cappend 2 change 1 Schange Cinsert 2 Clast 3 " "compress 4 copy 2 count 3 Coverlay 3 cursor 3 delete 3 Cdelete 2 down 1 duplicate " "3 xEdit 1 expand 3 extract 3 find 1 Nfind 2 Nfindup 6 NfUP 3 Cfind 2 findUP 3 fUP 2 " "forward 2 get help 1 hexType 4 input 1 powerInput 3 join 1 split 2 spltJOIN load " "locate 1 Clocate 2 lowerCase 3 upperCase 3 Lprefix 2 macro merge 2 modify 3 move 2 " "msg next 1 overlay 1 parse preserve 4 purge 3 put putD query 1 quit read recover 3 " "refresh renum 3 repeat 3 replace 1 Creplace 2 reset 3 restore 4 rgtLEFT right 2 left " "2 save set shift 2 si sort sos stack 3 status 4 top transfer 3 type 1 up 1"; class command { public: command(const std::string&, size_t); const std::string& cmd() const { return cmd_; } size_t min_length() const { return min_len_; } bool match(const std::string&) const; private: std::string cmd_; size_t min_len_; }; command::command(const std::string& cmd, size_t min_len) : cmd_(cmd), min_len_(min_len) {} bool command::match(const std::string& str) const { size_t olen = str.length(); return olen >= min_len_ && olen <= cmd_.length() && cmd_.compare(0, olen, str) == 0; } bool parse_integer(const std::string& word, int& value) { try { size_t pos; int i = std::stoi(word, &pos, 10); if (pos < word.length()) return false; value = i; return true; } catch (const std::exception& ex) { return false; } } void uppercase(std::string& str) { std::transform(str.begin(), str.end(), str.begin(), [](unsigned char c) -> unsigned char { return std::toupper(c); }); } class command_list { public: explicit command_list(const char*); const command* find_command(const std::string&) const; private: std::vector<command> commands_; }; command_list::command_list(const char* table) { std::istringstream is(table); std::string word; std::vector<std::string> words; while (is >> word) { uppercase(word); words.push_back(word); } for (size_t i = 0, n = words.size(); i < n; ++i) { word = words[i]; int len = word.length(); if (i + 1 < n && parse_integer(words[i + 1], len)) ++i; commands_.push_back(command(word, len)); } } const command* command_list::find_command(const std::string& word) const { auto iter = std::find_if(commands_.begin(), commands_.end(), [&word](const command& cmd) { return cmd.match(word); }); return (iter != commands_.end()) ? &*iter : nullptr; } std::string test(const command_list& commands, const std::string& input) { std::string output; std::istringstream is(input); std::string word; while (is >> word) { if (!output.empty()) output += ' '; uppercase(word); const command* cmd_ptr = commands.find_command(word); if (cmd_ptr) output += cmd_ptr->cmd(); else output += "*error*"; } return output; } int main() { command_list commands(command_table); std::string input("riG rePEAT copies put mo rest types fup. 6 poweRin"); std::string output(test(commands, input)); std::cout << " input: " << input << '\n'; std::cout << "output: " << output << '\n'; return 0; }
import java.util.*; public class Abbreviations { public static void main(String[] args) { CommandList commands = new CommandList(commandTable); String input = "riG rePEAT copies put mo rest types fup. 6 poweRin"; System.out.println(" input: " + input); System.out.println("output: " + test(commands, input)); } private static String test(CommandList commands, String input) { StringBuilder output = new StringBuilder(); Scanner scanner = new Scanner(input); while (scanner.hasNext()) { String word = scanner.next(); if (output.length() > 0) output.append(' '); Command cmd = commands.findCommand(word); if (cmd != null) output.append(cmd.cmd); else output.append("*error*"); } return output.toString(); } private static String commandTable = "add 1 alter 3 backup 2 bottom 1 Cappend 2 change 1 Schange Cinsert 2 Clast 3 " + "compress 4 copy 2 count 3 Coverlay 3 cursor 3 delete 3 Cdelete 2 down 1 duplicate " + "3 xEdit 1 expand 3 extract 3 find 1 Nfind 2 Nfindup 6 NfUP 3 Cfind 2 findUP 3 fUP 2 " + "forward 2 get help 1 hexType 4 input 1 powerInput 3 join 1 split 2 spltJOIN load " + "locate 1 Clocate 2 lowerCase 3 upperCase 3 Lprefix 2 macro merge 2 modify 3 move 2 " + "msg next 1 overlay 1 parse preserve 4 purge 3 put putD query 1 quit read recover 3 " + "refresh renum 3 repeat 3 replace 1 Creplace 2 reset 3 restore 4 rgtLEFT right 2 left " + "2 save set shift 2 si sort sos stack 3 status 4 top transfer 3 type 1 up 1"; private static class Command { private Command(String cmd, int minLength) { this.cmd = cmd; this.minLength = minLength; } private boolean match(String str) { int olen = str.length(); return olen >= minLength && olen <= cmd.length() && cmd.regionMatches(true, 0, str, 0, olen); } private String cmd; private int minLength; } private static Integer parseInteger(String word) { try { return Integer.valueOf(word); } catch (NumberFormatException ex) { return null; } } private static class CommandList { private CommandList(String table) { Scanner scanner = new Scanner(table); List<String> words = new ArrayList<>(); while (scanner.hasNext()) { String word = scanner.next(); words.add(word.toUpperCase()); } for (int i = 0, n = words.size(); i < n; ++i) { String word = words.get(i); int len = word.length(); if (i + 1 < n) { Integer number = parseInteger(words.get(i + 1)); if (number != null) { len = number.intValue(); ++i; } } commands.add(new Command(word, len)); } } private Command findCommand(String word) { for (Command command : commands) { if (command.match(word)) return command; } return null; } private List<Command> commands = new ArrayList<>(); } }
Ensure the translated Java code behaves exactly like the original C++ snippet.
#include <string> #include <map> #include <iostream> #include <algorithm> #include <cmath> double log2( double number ) { return log( number ) / log( 2 ) ; } int main( int argc , char *argv[ ] ) { std::string teststring( argv[ 1 ] ) ; std::map<char , int> frequencies ; for ( char c : teststring ) frequencies[ c ] ++ ; int numlen = teststring.length( ) ; double infocontent = 0 ; for ( std::pair<char , int> p : frequencies ) { double freq = static_cast<double>( p.second ) / numlen ; infocontent -= freq * log2( freq ) ; } std::cout << "The information content of " << teststring << " is " << infocontent << std::endl ; return 0 ; }
import java.lang.Math; import java.util.Map; import java.util.HashMap; public class REntropy { @SuppressWarnings("boxing") public static double getShannonEntropy(String s) { int n = 0; Map<Character, Integer> occ = new HashMap<>(); for (int c_ = 0; c_ < s.length(); ++c_) { char cx = s.charAt(c_); if (occ.containsKey(cx)) { occ.put(cx, occ.get(cx) + 1); } else { occ.put(cx, 1); } ++n; } double e = 0.0; for (Map.Entry<Character, Integer> entry : occ.entrySet()) { char cx = entry.getKey(); double p = (double) entry.getValue() / n; e += p * log2(p); } return -e; } private static double log2(double a) { return Math.log(a) / Math.log(2); } public static void main(String[] args) { String[] sstr = { "1223334444", "1223334444555555555", "122333", "1227774444", "aaBBcccDDDD", "1234567890abcdefghijklmnopqrstuvwxyz", "Rosetta Code", }; for (String ss : sstr) { double entropy = REntropy.getShannonEntropy(ss); System.out.printf("Shannon entropy of %40s: %.12f%n", "\"" + ss + "\"", entropy); } return; } }
Please provide an equivalent version of this C++ code in Java.
#include <iostream> #include <stdexcept> #include <string> #include <vector> using namespace std; vector<string> tokenize(const string& input, char seperator, char escape) { vector<string> output; string token; bool inEsc = false; for (char ch : input) { if (inEsc) { inEsc = false; } else if (ch == escape) { inEsc = true; continue; } else if (ch == seperator) { output.push_back(token); token = ""; continue; } token += ch; } if (inEsc) throw new invalid_argument("Invalid terminal escape"); output.push_back(token); return output; } int main() { string sample = "one^|uno||three^^^^|four^^^|^cuatro|"; cout << sample << endl; cout << '['; for (auto t : tokenize(sample, '|', '^')) { cout << '"' << t << "\", "; } cout << ']' << endl; return 0; }
import java.util.*; public class TokenizeStringWithEscaping { public static void main(String[] args) { String sample = "one^|uno||three^^^^|four^^^|^cuatro|"; char separator = '|'; char escape = '^'; System.out.println(sample); try { System.out.println(tokenizeString(sample, separator, escape)); } catch (Exception e) { System.out.println(e); } } public static List<String> tokenizeString(String s, char sep, char escape) throws Exception { List<String> tokens = new ArrayList<>(); StringBuilder sb = new StringBuilder(); boolean inEscape = false; for (char c : s.toCharArray()) { if (inEscape) { inEscape = false; } else if (c == escape) { inEscape = true; continue; } else if (c == sep) { tokens.add(sb.toString()); sb.setLength(0); continue; } sb.append(c); } if (inEscape) throw new Exception("Invalid terminal escape"); tokens.add(sb.toString()); return tokens; } }
Translate this program into Java but keep the logic exactly as in C++.
#include <iostream> int main () { std::cout << "Hello world!" << std::endl; }
module HelloWorld { void run() { @Inject Console console; console.print("Hello World!"); } }
Write the same algorithm in Java as shown in this C++ implementation.
#include <array> #include <iostream> #include <vector> #include <boost/circular_buffer.hpp> #include "prime_sieve.hpp" int main() { using std::cout; using std::vector; using boost::circular_buffer; using group_buffer = circular_buffer<vector<int>>; const int max = 1000035; const int max_group_size = 5; const int diff = 6; const int array_size = max + diff; const int max_groups = 5; const int max_unsexy = 10; prime_sieve sieve(array_size); std::array<int, max_group_size> group_count{0}; vector<group_buffer> groups(max_group_size, group_buffer(max_groups)); int unsexy_count = 0; circular_buffer<int> unsexy_primes(max_unsexy); vector<int> group; for (int p = 2; p < max; ++p) { if (!sieve.is_prime(p)) continue; if (!sieve.is_prime(p + diff) && (p - diff < 2 || !sieve.is_prime(p - diff))) { ++unsexy_count; unsexy_primes.push_back(p); } else { group.clear(); group.push_back(p); for (int group_size = 1; group_size < max_group_size; group_size++) { int next_p = p + group_size * diff; if (next_p >= max || !sieve.is_prime(next_p)) break; group.push_back(next_p); ++group_count[group_size]; groups[group_size].push_back(group); } } } for (int size = 1; size < max_group_size; ++size) { cout << "number of groups of size " << size + 1 << " is " << group_count[size] << '\n'; cout << "last " << groups[size].size() << " groups of size " << size + 1 << ":"; for (const vector<int>& group : groups[size]) { cout << " ("; for (size_t i = 0; i < group.size(); ++i) { if (i > 0) cout << ' '; cout << group[i]; } cout << ")"; } cout << "\n\n"; } cout << "number of unsexy primes is " << unsexy_count << '\n'; cout << "last " << unsexy_primes.size() << " unsexy primes:"; for (int prime : unsexy_primes) cout << ' ' << prime; cout << '\n'; return 0; }
import java.util.ArrayList; import java.util.List; public class SexyPrimes { public static void main(String[] args) { sieve(); int pairs = 0; List<String> pairList = new ArrayList<>(); int triples = 0; List<String> tripleList = new ArrayList<>(); int quadruplets = 0; List<String> quadrupletList = new ArrayList<>(); int unsexyCount = 1; List<String> unsexyList = new ArrayList<>(); for ( int i = 3 ; i < MAX ; i++ ) { if ( i-6 >= 3 && primes[i-6] && primes[i] ) { pairs++; pairList.add((i-6) + " " + i); if ( pairList.size() > 5 ) { pairList.remove(0); } } else if ( i < MAX-2 && primes[i] && ! (i+6<MAX && primes[i] && primes[i+6])) { unsexyCount++; unsexyList.add("" + i); if ( unsexyList.size() > 10 ) { unsexyList.remove(0); } } if ( i-12 >= 3 && primes[i-12] && primes[i-6] && primes[i] ) { triples++; tripleList.add((i-12) + " " + (i-6) + " " + i); if ( tripleList.size() > 5 ) { tripleList.remove(0); } } if ( i-16 >= 3 && primes[i-18] && primes[i-12] && primes[i-6] && primes[i] ) { quadruplets++; quadrupletList.add((i-18) + " " + (i-12) + " " + (i-6) + " " + i); if ( quadrupletList.size() > 5 ) { quadrupletList.remove(0); } } } System.out.printf("Count of sexy triples less than %,d = %,d%n", MAX, pairs); System.out.printf("The last 5 sexy pairs:%n %s%n%n", pairList.toString().replaceAll(", ", "], [")); System.out.printf("Count of sexy triples less than %,d = %,d%n", MAX, triples); System.out.printf("The last 5 sexy triples:%n %s%n%n", tripleList.toString().replaceAll(", ", "], [")); System.out.printf("Count of sexy quadruplets less than %,d = %,d%n", MAX, quadruplets); System.out.printf("The last 5 sexy quadruplets:%n %s%n%n", quadrupletList.toString().replaceAll(", ", "], [")); System.out.printf("Count of unsexy primes less than %,d = %,d%n", MAX, unsexyCount); System.out.printf("The last 10 unsexy primes:%n %s%n%n", unsexyList.toString().replaceAll(", ", "], [")); } private static int MAX = 1_000_035; private static boolean[] primes = new boolean[MAX]; private static final void sieve() { for ( int i = 2 ; i < MAX ; i++ ) { primes[i] = true; } for ( int i = 2 ; i < MAX ; i++ ) { if ( primes[i] ) { for ( int j = 2*i ; j < MAX ; j += i ) { primes[j] = false; } } } } }
Maintain the same structure and functionality when rewriting this code in Java.
#include <array> #include <iostream> #include <vector> #include <boost/circular_buffer.hpp> #include "prime_sieve.hpp" int main() { using std::cout; using std::vector; using boost::circular_buffer; using group_buffer = circular_buffer<vector<int>>; const int max = 1000035; const int max_group_size = 5; const int diff = 6; const int array_size = max + diff; const int max_groups = 5; const int max_unsexy = 10; prime_sieve sieve(array_size); std::array<int, max_group_size> group_count{0}; vector<group_buffer> groups(max_group_size, group_buffer(max_groups)); int unsexy_count = 0; circular_buffer<int> unsexy_primes(max_unsexy); vector<int> group; for (int p = 2; p < max; ++p) { if (!sieve.is_prime(p)) continue; if (!sieve.is_prime(p + diff) && (p - diff < 2 || !sieve.is_prime(p - diff))) { ++unsexy_count; unsexy_primes.push_back(p); } else { group.clear(); group.push_back(p); for (int group_size = 1; group_size < max_group_size; group_size++) { int next_p = p + group_size * diff; if (next_p >= max || !sieve.is_prime(next_p)) break; group.push_back(next_p); ++group_count[group_size]; groups[group_size].push_back(group); } } } for (int size = 1; size < max_group_size; ++size) { cout << "number of groups of size " << size + 1 << " is " << group_count[size] << '\n'; cout << "last " << groups[size].size() << " groups of size " << size + 1 << ":"; for (const vector<int>& group : groups[size]) { cout << " ("; for (size_t i = 0; i < group.size(); ++i) { if (i > 0) cout << ' '; cout << group[i]; } cout << ")"; } cout << "\n\n"; } cout << "number of unsexy primes is " << unsexy_count << '\n'; cout << "last " << unsexy_primes.size() << " unsexy primes:"; for (int prime : unsexy_primes) cout << ' ' << prime; cout << '\n'; return 0; }
import java.util.ArrayList; import java.util.List; public class SexyPrimes { public static void main(String[] args) { sieve(); int pairs = 0; List<String> pairList = new ArrayList<>(); int triples = 0; List<String> tripleList = new ArrayList<>(); int quadruplets = 0; List<String> quadrupletList = new ArrayList<>(); int unsexyCount = 1; List<String> unsexyList = new ArrayList<>(); for ( int i = 3 ; i < MAX ; i++ ) { if ( i-6 >= 3 && primes[i-6] && primes[i] ) { pairs++; pairList.add((i-6) + " " + i); if ( pairList.size() > 5 ) { pairList.remove(0); } } else if ( i < MAX-2 && primes[i] && ! (i+6<MAX && primes[i] && primes[i+6])) { unsexyCount++; unsexyList.add("" + i); if ( unsexyList.size() > 10 ) { unsexyList.remove(0); } } if ( i-12 >= 3 && primes[i-12] && primes[i-6] && primes[i] ) { triples++; tripleList.add((i-12) + " " + (i-6) + " " + i); if ( tripleList.size() > 5 ) { tripleList.remove(0); } } if ( i-16 >= 3 && primes[i-18] && primes[i-12] && primes[i-6] && primes[i] ) { quadruplets++; quadrupletList.add((i-18) + " " + (i-12) + " " + (i-6) + " " + i); if ( quadrupletList.size() > 5 ) { quadrupletList.remove(0); } } } System.out.printf("Count of sexy triples less than %,d = %,d%n", MAX, pairs); System.out.printf("The last 5 sexy pairs:%n %s%n%n", pairList.toString().replaceAll(", ", "], [")); System.out.printf("Count of sexy triples less than %,d = %,d%n", MAX, triples); System.out.printf("The last 5 sexy triples:%n %s%n%n", tripleList.toString().replaceAll(", ", "], [")); System.out.printf("Count of sexy quadruplets less than %,d = %,d%n", MAX, quadruplets); System.out.printf("The last 5 sexy quadruplets:%n %s%n%n", quadrupletList.toString().replaceAll(", ", "], [")); System.out.printf("Count of unsexy primes less than %,d = %,d%n", MAX, unsexyCount); System.out.printf("The last 10 unsexy primes:%n %s%n%n", unsexyList.toString().replaceAll(", ", "], [")); } private static int MAX = 1_000_035; private static boolean[] primes = new boolean[MAX]; private static final void sieve() { for ( int i = 2 ; i < MAX ; i++ ) { primes[i] = true; } for ( int i = 2 ; i < MAX ; i++ ) { if ( primes[i] ) { for ( int j = 2*i ; j < MAX ; j += i ) { primes[j] = false; } } } } }
Write a version of this C++ function in Java with identical behavior.
#include <vector> #include <iterator> #include <algorithm> template<typename InputIterator, typename OutputIterator> OutputIterator forward_difference(InputIterator first, InputIterator last, OutputIterator dest) { if (first == last) return dest; typedef typename std::iterator_traits<InputIterator>::value_type value_type; value_type temp = *first++; while (first != last) { value_type temp2 = *first++; *dest++ = temp2 - temp; temp = temp2; } return dest; } template<typename InputIterator, typename OutputIterator> OutputIterator nth_forward_difference(int order, InputIterator first, InputIterator last, OutputIterator dest) { if (order == 0) return std::copy(first, last, dest); if (order == 1) return forward_difference(first, last, dest); typedef typename std::iterator_traits<InputIterator>::value_type value_type; std::vector<value_type> temp_storage; forward_difference(first, last, std::back_inserter(temp_storage)); typename std::vector<value_type>::iterator begin = temp_storage.begin(), end = temp_storage.end(); for (int i = 1; i < order-1; ++i) end = forward_difference(begin, end, begin); return forward_difference(begin, end, dest); } #include <iostream> int main() { double array[10] = { 90.0, 47.0, 58.0, 29.0, 22.0, 32.0, 55.0, 5.0, 55.0, 73.0 }; std::vector<double> dest; nth_forward_difference(1, array, array+10, std::back_inserter(dest)); std::copy(dest.begin(), dest.end(), std::ostream_iterator<double>(std::cout, " ")); std::cout << std::endl; nth_forward_difference(2, array, array+10, std::ostream_iterator<double>(std::cout, " ")); std::cout << std::endl; nth_forward_difference(9, array, array+10, std::ostream_iterator<double>(std::cout, " ")); std::cout << std::endl; nth_forward_difference(10, array, array+10, std::ostream_iterator<double>(std::cout, " ")); std::cout << std::endl; nth_forward_difference(0, array, array+10, std::ostream_iterator<double>(std::cout, " ")); std::cout << std::endl; double* end = nth_forward_difference(3, array, array+10, array); for (double* p = array; p < end; ++p) std::cout << *p << " "; std::cout << std::endl; return 0; }
import java.util.Arrays; public class FD { public static void main(String args[]) { double[] a = {90, 47, 58, 29, 22, 32, 55, 5, 55, 73}; System.out.println(Arrays.toString(dif(a, 1))); System.out.println(Arrays.toString(dif(a, 2))); System.out.println(Arrays.toString(dif(a, 9))); System.out.println(Arrays.toString(dif(a, 10))); System.out.println(Arrays.toString(dif(a, 11))); System.out.println(Arrays.toString(dif(a, -1))); System.out.println(Arrays.toString(dif(a, 0))); } public static double[] dif(double[] a, int n) { if (n < 0) return null; for (int i = 0; i < n && a.length > 0; i++) { double[] b = new double[a.length - 1]; for (int j = 0; j < b.length; j++){ b[j] = a[j+1] - a[j]; } a = b; } return a; } }
Change the following C++ code into Java without altering its purpose.
#include <cmath> bool is_prime(unsigned int n) { if (n <= 1) return false; if (n == 2) return true; for (unsigned int i = 2; i <= sqrt(n); ++i) if (n % i == 0) return false; return true; }
public static boolean prime(long a){ if(a == 2){ return true; }else if(a <= 1 || a % 2 == 0){ return false; } long max = (long)Math.sqrt(a); for(long n= 3; n <= max; n+= 2){ if(a % n == 0){ return false; } } return true; }
Keep all operations the same but rewrite the snippet in Java.
double Factorial(double nValue) { double result = nValue; double result_next; double pc = nValue; do { result_next = result*(pc-1); result = result_next; pc--; }while(pc>2); nValue = result; return nValue; } double binomialCoefficient(double n, double k) { if (abs(n - k) < 1e-7 || k < 1e-7) return 1.0; if( abs(k-1.0) < 1e-7 || abs(k - (n-1)) < 1e-7)return n; return Factorial(n) /(Factorial(k)*Factorial((n - k))); }
public class Binomial { private static long binomialInt(int n, int k) { if (k > n - k) k = n - k; long binom = 1; for (int i = 1; i <= k; i++) binom = binom * (n + 1 - i) / i; return binom; } private static Object binomialIntReliable(int n, int k) { if (k > n - k) k = n - k; long binom = 1; for (int i = 1; i <= k; i++) { try { binom = Math.multiplyExact(binom, n + 1 - i) / i; } catch (ArithmeticException e) { return "overflow"; } } return binom; } private static double binomialFloat(int n, int k) { if (k > n - k) k = n - k; double binom = 1.0; for (int i = 1; i <= k; i++) binom = binom * (n + 1 - i) / i; return binom; } private static BigInteger binomialBigInt(int n, int k) { if (k > n - k) k = n - k; BigInteger binom = BigInteger.ONE; for (int i = 1; i <= k; i++) { binom = binom.multiply(BigInteger.valueOf(n + 1 - i)); binom = binom.divide(BigInteger.valueOf(i)); } return binom; } private static void demo(int n, int k) { List<Object> data = Arrays.asList( n, k, binomialInt(n, k), binomialIntReliable(n, k), binomialFloat(n, k), binomialBigInt(n, k)); System.out.println(data.stream().map(Object::toString).collect(Collectors.joining("\t"))); } public static void main(String[] args) { demo(5, 3); demo(1000, 300); } }
Translate this program into Java but keep the logic exactly as in C++.
int a[5]; a[0] = 1; int primes[10] = { 2, 3, 5, 7, 11, 13, 17, 19, 23, 29 }; #include <string> std::string strings[4];
List arrayList = new ArrayList(); arrayList.add(new Integer(0)); arrayList.add(0); List<Integer> myarrlist = new ArrayList<Integer>(); int sum; for(int i = 0; i < 10; i++) { myarrlist.add(i); }
Change the following C++ code into Java without altering its purpose.
int a[5]; a[0] = 1; int primes[10] = { 2, 3, 5, 7, 11, 13, 17, 19, 23, 29 }; #include <string> std::string strings[4];
List arrayList = new ArrayList(); arrayList.add(new Integer(0)); arrayList.add(0); List<Integer> myarrlist = new ArrayList<Integer>(); int sum; for(int i = 0; i < 10; i++) { myarrlist.add(i); }