Instruction stringlengths 45 106 | input_code stringlengths 1 13.7k | output_code stringlengths 1 13.7k |
|---|---|---|
Convert this PHP block to Java, preserving its control flow and logic. | <?php
header("Content-type: image/png");
$width = 512;
$height = 512;
$img = imagecreatetruecolor($width,$height);
$bg = imagecolorallocate($img,255,255,255);
imagefilledrectangle($img, 0, 0, $width, $width, $bg);
$depth = 8;
function drawTree($x1, $y1, $angle, $depth){
global $img;
if ($depth != 0){
$x2 = $x1 + (int)(cos(deg2rad($angle)) * $depth * 10.0);
$y2 = $y1 + (int)(sin(deg2rad($angle)) * $depth * 10.0);
imageline($img, $x1, $y1, $x2, $y2, imagecolorallocate($img,0,0,0));
drawTree($x2, $y2, $angle - 20, $depth - 1);
drawTree($x2, $y2, $angle + 20, $depth - 1);
}
}
drawTree($width/2, $height, -90, $depth);
imagepng($img);
imagedestroy($img);
?>
| import java.awt.Color;
import java.awt.Graphics;
import javax.swing.JFrame;
public class FractalTree extends JFrame {
public FractalTree() {
super("Fractal Tree");
setBounds(100, 100, 800, 600);
setResizable(false);
setDefaultCloseOperation(EXIT_ON_CLOSE);
}
private void drawTree(Graphics g, int x1, int y1, double angle, int depth) {
if (depth == 0) return;
int x2 = x1 + (int) (Math.cos(Math.toRadians(angle)) * depth * 10.0);
int y2 = y1 + (int) (Math.sin(Math.toRadians(angle)) * depth * 10.0);
g.drawLine(x1, y1, x2, y2);
drawTree(g, x2, y2, angle - 20, depth - 1);
drawTree(g, x2, y2, angle + 20, depth - 1);
}
@Override
public void paint(Graphics g) {
g.setColor(Color.BLACK);
drawTree(g, 400, 500, -90, 9);
}
public static void main(String[] args) {
new FractalTree().setVisible(true);
}
}
|
Transform the following PHP implementation into Java, maintaining the same output and logic. | <?php
header("Content-type: image/png");
$width = 512;
$height = 512;
$img = imagecreatetruecolor($width,$height);
$bg = imagecolorallocate($img,255,255,255);
imagefilledrectangle($img, 0, 0, $width, $width, $bg);
$depth = 8;
function drawTree($x1, $y1, $angle, $depth){
global $img;
if ($depth != 0){
$x2 = $x1 + (int)(cos(deg2rad($angle)) * $depth * 10.0);
$y2 = $y1 + (int)(sin(deg2rad($angle)) * $depth * 10.0);
imageline($img, $x1, $y1, $x2, $y2, imagecolorallocate($img,0,0,0));
drawTree($x2, $y2, $angle - 20, $depth - 1);
drawTree($x2, $y2, $angle + 20, $depth - 1);
}
}
drawTree($width/2, $height, -90, $depth);
imagepng($img);
imagedestroy($img);
?>
| import java.awt.Color;
import java.awt.Graphics;
import javax.swing.JFrame;
public class FractalTree extends JFrame {
public FractalTree() {
super("Fractal Tree");
setBounds(100, 100, 800, 600);
setResizable(false);
setDefaultCloseOperation(EXIT_ON_CLOSE);
}
private void drawTree(Graphics g, int x1, int y1, double angle, int depth) {
if (depth == 0) return;
int x2 = x1 + (int) (Math.cos(Math.toRadians(angle)) * depth * 10.0);
int y2 = y1 + (int) (Math.sin(Math.toRadians(angle)) * depth * 10.0);
g.drawLine(x1, y1, x2, y2);
drawTree(g, x2, y2, angle - 20, depth - 1);
drawTree(g, x2, y2, angle + 20, depth - 1);
}
@Override
public void paint(Graphics g) {
g.setColor(Color.BLACK);
drawTree(g, 400, 500, -90, 9);
}
public static void main(String[] args) {
new FractalTree().setVisible(true);
}
}
|
Write the same code in Java as shown below in PHP. | <?php
function gray_encode($binary){
return $binary ^ ($binary >> 1);
}
function gray_decode($gray){
$binary = $gray;
while($gray >>= 1) $binary ^= $gray;
return $binary;
}
for($i=0;$i<32;$i++){
$gray_encoded = gray_encode($i);
printf("%2d : %05b => %05b => %05b : %2d \n",$i, $i, $gray_encoded, $gray_encoded, gray_decode($gray_encoded));
}
| public class Gray {
public static long grayEncode(long n){
return n ^ (n >>> 1);
}
public static long grayDecode(long n) {
long p = n;
while ((n >>>= 1) != 0)
p ^= n;
return p;
}
public static void main(String[] args){
System.out.println("i\tBinary\tGray\tDecoded");
for(int i = -1; i < 32;i++){
System.out.print(i +"\t");
System.out.print(Integer.toBinaryString(i) + "\t");
System.out.print(Long.toBinaryString(grayEncode(i))+ "\t");
System.out.println(grayDecode(grayEncode(i)));
}
}
}
|
Change the following PHP code into Java without altering its purpose. | <?php
function gray_encode($binary){
return $binary ^ ($binary >> 1);
}
function gray_decode($gray){
$binary = $gray;
while($gray >>= 1) $binary ^= $gray;
return $binary;
}
for($i=0;$i<32;$i++){
$gray_encoded = gray_encode($i);
printf("%2d : %05b => %05b => %05b : %2d \n",$i, $i, $gray_encoded, $gray_encoded, gray_decode($gray_encoded));
}
| public class Gray {
public static long grayEncode(long n){
return n ^ (n >>> 1);
}
public static long grayDecode(long n) {
long p = n;
while ((n >>>= 1) != 0)
p ^= n;
return p;
}
public static void main(String[] args){
System.out.println("i\tBinary\tGray\tDecoded");
for(int i = -1; i < 32;i++){
System.out.print(i +"\t");
System.out.print(Integer.toBinaryString(i) + "\t");
System.out.print(Long.toBinaryString(grayEncode(i))+ "\t");
System.out.println(grayDecode(grayEncode(i)));
}
}
}
|
Convert the following code from PHP to Java, ensuring the logic remains intact. | <?php
function gray_encode($binary){
return $binary ^ ($binary >> 1);
}
function gray_decode($gray){
$binary = $gray;
while($gray >>= 1) $binary ^= $gray;
return $binary;
}
for($i=0;$i<32;$i++){
$gray_encoded = gray_encode($i);
printf("%2d : %05b => %05b => %05b : %2d \n",$i, $i, $gray_encoded, $gray_encoded, gray_decode($gray_encoded));
}
| public class Gray {
public static long grayEncode(long n){
return n ^ (n >>> 1);
}
public static long grayDecode(long n) {
long p = n;
while ((n >>>= 1) != 0)
p ^= n;
return p;
}
public static void main(String[] args){
System.out.println("i\tBinary\tGray\tDecoded");
for(int i = -1; i < 32;i++){
System.out.print(i +"\t");
System.out.print(Integer.toBinaryString(i) + "\t");
System.out.print(Long.toBinaryString(grayEncode(i))+ "\t");
System.out.println(grayDecode(grayEncode(i)));
}
}
}
|
Transform the following PHP implementation into Java, maintaining the same output and logic. | <?php
function gray_encode($binary){
return $binary ^ ($binary >> 1);
}
function gray_decode($gray){
$binary = $gray;
while($gray >>= 1) $binary ^= $gray;
return $binary;
}
for($i=0;$i<32;$i++){
$gray_encoded = gray_encode($i);
printf("%2d : %05b => %05b => %05b : %2d \n",$i, $i, $gray_encoded, $gray_encoded, gray_decode($gray_encoded));
}
| public class Gray {
public static long grayEncode(long n){
return n ^ (n >>> 1);
}
public static long grayDecode(long n) {
long p = n;
while ((n >>>= 1) != 0)
p ^= n;
return p;
}
public static void main(String[] args){
System.out.println("i\tBinary\tGray\tDecoded");
for(int i = -1; i < 32;i++){
System.out.print(i +"\t");
System.out.print(Integer.toBinaryString(i) + "\t");
System.out.print(Long.toBinaryString(grayEncode(i))+ "\t");
System.out.println(grayDecode(grayEncode(i)));
}
}
}
|
Produce a functionally identical Java code for the snippet given in PHP. | class Card
{
protected static $suits = array( '♠', '♥', '♦', '♣' );
protected static $pips = array( '2', '3', '4', '5', '6', '7', '8', '9', 'T', 'J', 'Q', 'K', 'A' );
protected $suit;
protected $suitOrder;
protected $pip;
protected $pipOrder;
protected $order;
public function __construct( $suit, $pip )
{
if( !in_array( $suit, self::$suits ) )
{
throw new InvalidArgumentException( 'Invalid suit' );
}
if( !in_array( $pip, self::$pips ) )
{
throw new InvalidArgumentException( 'Invalid pip' );
}
$this->suit = $suit;
$this->pip = $pip;
}
public function getSuit()
{
return $this->suit;
}
public function getPip()
{
return $this->pip;
}
public function getSuitOrder()
{
if( !isset( $this->suitOrder ) )
{
$this->suitOrder = array_search( $this->suit, self::$suits );
}
return $this->suitOrder;
}
public function getPipOrder()
{
if( !isset( $this->pipOrder ) )
{
$this->pipOrder = array_search( $this->pip, self::$pips );
}
return $this->pipOrder;
}
public function getOrder()
{
if( !isset( $this->order ) )
{
$suitOrder = $this->getSuitOrder();
$pipOrder = $this->getPipOrder();
$this->order = $pipOrder * count( self::$suits ) + $suitOrder;
}
return $this->order;
}
public function compareSuit( Card $other )
{
return $this->getSuitOrder() - $other->getSuitOrder();
}
public function comparePip( Card $other )
{
return $this->getPipOrder() - $other->getPipOrder();
}
public function compare( Card $other )
{
return $this->getOrder() - $other->getOrder();
}
public function __toString()
{
return $this->suit . $this->pip;
}
public static function getSuits()
{
return self::$suits;
}
public static function getPips()
{
return self::$pips;
}
}
class CardCollection
implements Countable, Iterator
{
protected $cards = array();
protected function __construct( array $cards = array() )
{
foreach( $cards as $card )
{
$this->addCard( $card );
}
}
public function count()
{
return count( $this->cards );
}
public function key()
{
return key( $this->cards );
}
public function valid()
{
return null !== $this->key();
}
public function next()
{
next( $this->cards );
}
public function current()
{
return current( $this->cards );
}
public function rewind()
{
reset( $this->cards );
}
public function sort( $comparer = null )
{
$comparer = $comparer ?: function( $a, $b ) {
return $a->compare( $b );
};
if( !is_callable( $comparer ) )
{
throw new InvalidArgumentException( 'Invalid comparer; comparer should be callable' );
}
usort( $this->cards, $comparer );
return $this;
}
public function toString()
{
return implode( ' ', $this->cards );
}
public function __toString()
{
return $this->toString();
}
protected function addCard( Card $card )
{
if( in_array( $card, $this->cards ) )
{
throw new DomainException( 'Card is already present in this collection' );
}
$this->cards[] = $card;
}
}
class Deck
extends CardCollection
{
public function __construct( $shuffled = false )
{
foreach( Card::getSuits() as $suit )
{
foreach( Card::getPips() as $pip )
{
$this->addCard( new Card( $suit, $pip ) );
}
}
if( $shuffled )
{
$this->shuffle();
}
}
public function deal( $amount = 1, CardCollection $cardCollection = null )
{
if( !is_int( $amount ) || $amount < 1 )
{
throw new InvalidArgumentException( 'Invalid amount; amount should be an integer, larger than 0' );
}
if( $amount > count( $this->cards ) )
{
throw new RangeException( 'Invalid amount; requested amount is larger than the amount of available cards' );
}
$cards = array_splice( $this->cards, 0, $amount );
$cardCollection = $cardCollection ?: new CardCollection;
foreach( $cards as $card )
{
$cardCollection->addCard( $card );
}
return $cardCollection;
}
public function shuffle()
{
shuffle( $this->cards );
}
}
class Hand
extends CardCollection
{
public function __construct() {}
public function play( $position )
{
if( !isset( $this->cards[ $position ] ) )
{
throw new OutOfBoundsException( 'Invalid position; position is not present in this hand' );
}
$result = array_splice( $this->cards, $position, 1 );
return $result[ 0 ];
}
}
| public enum Pip { Two, Three, Four, Five, Six, Seven,
Eight, Nine, Ten, Jack, Queen, King, Ace }
|
Please provide an equivalent version of this PHP code in Java. | class Card
{
protected static $suits = array( '♠', '♥', '♦', '♣' );
protected static $pips = array( '2', '3', '4', '5', '6', '7', '8', '9', 'T', 'J', 'Q', 'K', 'A' );
protected $suit;
protected $suitOrder;
protected $pip;
protected $pipOrder;
protected $order;
public function __construct( $suit, $pip )
{
if( !in_array( $suit, self::$suits ) )
{
throw new InvalidArgumentException( 'Invalid suit' );
}
if( !in_array( $pip, self::$pips ) )
{
throw new InvalidArgumentException( 'Invalid pip' );
}
$this->suit = $suit;
$this->pip = $pip;
}
public function getSuit()
{
return $this->suit;
}
public function getPip()
{
return $this->pip;
}
public function getSuitOrder()
{
if( !isset( $this->suitOrder ) )
{
$this->suitOrder = array_search( $this->suit, self::$suits );
}
return $this->suitOrder;
}
public function getPipOrder()
{
if( !isset( $this->pipOrder ) )
{
$this->pipOrder = array_search( $this->pip, self::$pips );
}
return $this->pipOrder;
}
public function getOrder()
{
if( !isset( $this->order ) )
{
$suitOrder = $this->getSuitOrder();
$pipOrder = $this->getPipOrder();
$this->order = $pipOrder * count( self::$suits ) + $suitOrder;
}
return $this->order;
}
public function compareSuit( Card $other )
{
return $this->getSuitOrder() - $other->getSuitOrder();
}
public function comparePip( Card $other )
{
return $this->getPipOrder() - $other->getPipOrder();
}
public function compare( Card $other )
{
return $this->getOrder() - $other->getOrder();
}
public function __toString()
{
return $this->suit . $this->pip;
}
public static function getSuits()
{
return self::$suits;
}
public static function getPips()
{
return self::$pips;
}
}
class CardCollection
implements Countable, Iterator
{
protected $cards = array();
protected function __construct( array $cards = array() )
{
foreach( $cards as $card )
{
$this->addCard( $card );
}
}
public function count()
{
return count( $this->cards );
}
public function key()
{
return key( $this->cards );
}
public function valid()
{
return null !== $this->key();
}
public function next()
{
next( $this->cards );
}
public function current()
{
return current( $this->cards );
}
public function rewind()
{
reset( $this->cards );
}
public function sort( $comparer = null )
{
$comparer = $comparer ?: function( $a, $b ) {
return $a->compare( $b );
};
if( !is_callable( $comparer ) )
{
throw new InvalidArgumentException( 'Invalid comparer; comparer should be callable' );
}
usort( $this->cards, $comparer );
return $this;
}
public function toString()
{
return implode( ' ', $this->cards );
}
public function __toString()
{
return $this->toString();
}
protected function addCard( Card $card )
{
if( in_array( $card, $this->cards ) )
{
throw new DomainException( 'Card is already present in this collection' );
}
$this->cards[] = $card;
}
}
class Deck
extends CardCollection
{
public function __construct( $shuffled = false )
{
foreach( Card::getSuits() as $suit )
{
foreach( Card::getPips() as $pip )
{
$this->addCard( new Card( $suit, $pip ) );
}
}
if( $shuffled )
{
$this->shuffle();
}
}
public function deal( $amount = 1, CardCollection $cardCollection = null )
{
if( !is_int( $amount ) || $amount < 1 )
{
throw new InvalidArgumentException( 'Invalid amount; amount should be an integer, larger than 0' );
}
if( $amount > count( $this->cards ) )
{
throw new RangeException( 'Invalid amount; requested amount is larger than the amount of available cards' );
}
$cards = array_splice( $this->cards, 0, $amount );
$cardCollection = $cardCollection ?: new CardCollection;
foreach( $cards as $card )
{
$cardCollection->addCard( $card );
}
return $cardCollection;
}
public function shuffle()
{
shuffle( $this->cards );
}
}
class Hand
extends CardCollection
{
public function __construct() {}
public function play( $position )
{
if( !isset( $this->cards[ $position ] ) )
{
throw new OutOfBoundsException( 'Invalid position; position is not present in this hand' );
}
$result = array_splice( $this->cards, $position, 1 );
return $result[ 0 ];
}
}
| public enum Pip { Two, Three, Four, Five, Six, Seven,
Eight, Nine, Ten, Jack, Queen, King, Ace }
|
Generate an equivalent Java version of this PHP code. | $NumberArray = array(0, 1, 2, 3, 4, 5, 6);
$LetterArray = array("a", "b", "c", "d", "e", "f");
$simpleForm = ['apple', 'orange'];
| Int[] literalArray = [1,2,3];
Int[] fixedLengthArray = new Int[10];
Int[] variableArray = new Int[];
assert literalArray.size == 3;
Int n = literalArray[2];
fixedLengthArray[4] = 12345;
fixedLengthArray += 6789;
variableArray += 6789;
|
Convert this PHP block to Java, preserving its control flow and logic. | $NumberArray = array(0, 1, 2, 3, 4, 5, 6);
$LetterArray = array("a", "b", "c", "d", "e", "f");
$simpleForm = ['apple', 'orange'];
| Int[] literalArray = [1,2,3];
Int[] fixedLengthArray = new Int[10];
Int[] variableArray = new Int[];
assert literalArray.size == 3;
Int n = literalArray[2];
fixedLengthArray[4] = 12345;
fixedLengthArray += 6789;
variableArray += 6789;
|
Please provide an equivalent version of this PHP code in Java. | <?php
function isSierpinskiCarpetPixelFilled($x, $y) {
while (($x > 0) or ($y > 0)) {
if (($x % 3 == 1) and ($y % 3 == 1)) {
return false;
}
$x /= 3;
$y /= 3;
}
return true;
}
function sierpinskiCarpet($order) {
$size = pow(3, $order);
for ($y = 0 ; $y < $size ; $y++) {
for ($x = 0 ; $x < $size ; $x++) {
echo isSierpinskiCarpetPixelFilled($x, $y) ? '#' : ' ';
}
echo PHP_EOL;
}
}
for ($order = 0 ; $order <= 3 ; $order++) {
echo 'N=', $order, PHP_EOL;
sierpinskiCarpet($order);
echo PHP_EOL;
}
| public static boolean inCarpet(long x, long y) {
while (x!=0 && y!=0) {
if (x % 3 == 1 && y % 3 == 1)
return false;
x /= 3;
y /= 3;
}
return true;
}
public static void carpet(final int n) {
final double power = Math.pow(3,n);
for(long i = 0; i < power; i++) {
for(long j = 0; j < power; j++) {
System.out.print(inCarpet(i, j) ? "*" : " ");
}
System.out.println();
}
}
|
Transform the following PHP implementation into Java, maintaining the same output and logic. | <?php
function isSierpinskiCarpetPixelFilled($x, $y) {
while (($x > 0) or ($y > 0)) {
if (($x % 3 == 1) and ($y % 3 == 1)) {
return false;
}
$x /= 3;
$y /= 3;
}
return true;
}
function sierpinskiCarpet($order) {
$size = pow(3, $order);
for ($y = 0 ; $y < $size ; $y++) {
for ($x = 0 ; $x < $size ; $x++) {
echo isSierpinskiCarpetPixelFilled($x, $y) ? '#' : ' ';
}
echo PHP_EOL;
}
}
for ($order = 0 ; $order <= 3 ; $order++) {
echo 'N=', $order, PHP_EOL;
sierpinskiCarpet($order);
echo PHP_EOL;
}
| public static boolean inCarpet(long x, long y) {
while (x!=0 && y!=0) {
if (x % 3 == 1 && y % 3 == 1)
return false;
x /= 3;
y /= 3;
}
return true;
}
public static void carpet(final int n) {
final double power = Math.pow(3,n);
for(long i = 0; i < power; i++) {
for(long j = 0; j < power; j++) {
System.out.print(inCarpet(i, j) ? "*" : " ");
}
System.out.println();
}
}
|
Convert this PHP block to Java, preserving its control flow and logic. | function bogosort($l) {
while (!in_order($l))
shuffle($l);
return $l;
}
function in_order($l) {
for ($i = 1; $i < count($l); $i++)
if ($l[$i] < $l[$i-1])
return FALSE;
return TRUE;
}
| public class BogoSort
{
public static void main(String[] args)
{
int[] arr={4,5,6,0,7,8,9,1,2,3};
BogoSort now=new BogoSort();
System.out.print("Unsorted: ");
now.display1D(arr);
now.bogo(arr);
System.out.print("Sorted: ");
now.display1D(arr);
}
void bogo(int[] arr)
{
int shuffle=1;
for(;!isSorted(arr);shuffle++)
shuffle(arr);
System.out.println("This took "+shuffle+" shuffles.");
}
void shuffle(int[] arr)
{
int i=arr.length-1;
while(i>0)
swap(arr,i--,(int)(Math.random()*i));
}
void swap(int[] arr,int i,int j)
{
int temp=arr[i];
arr[i]=arr[j];
arr[j]=temp;
}
boolean isSorted(int[] arr)
{
for(int i=1;i<arr.length;i++)
if(arr[i]<arr[i-1])
return false;
return true;
}
void display1D(int[] arr)
{
for(int i=0;i<arr.length;i++)
System.out.print(arr[i]+" ");
System.out.println();
}
}
|
Maintain the same structure and functionality when rewriting this code in Java. | function bogosort($l) {
while (!in_order($l))
shuffle($l);
return $l;
}
function in_order($l) {
for ($i = 1; $i < count($l); $i++)
if ($l[$i] < $l[$i-1])
return FALSE;
return TRUE;
}
| public class BogoSort
{
public static void main(String[] args)
{
int[] arr={4,5,6,0,7,8,9,1,2,3};
BogoSort now=new BogoSort();
System.out.print("Unsorted: ");
now.display1D(arr);
now.bogo(arr);
System.out.print("Sorted: ");
now.display1D(arr);
}
void bogo(int[] arr)
{
int shuffle=1;
for(;!isSorted(arr);shuffle++)
shuffle(arr);
System.out.println("This took "+shuffle+" shuffles.");
}
void shuffle(int[] arr)
{
int i=arr.length-1;
while(i>0)
swap(arr,i--,(int)(Math.random()*i));
}
void swap(int[] arr,int i,int j)
{
int temp=arr[i];
arr[i]=arr[j];
arr[j]=temp;
}
boolean isSorted(int[] arr)
{
for(int i=1;i<arr.length;i++)
if(arr[i]<arr[i-1])
return false;
return true;
}
void display1D(int[] arr)
{
for(int i=0;i<arr.length;i++)
System.out.print(arr[i]+" ");
System.out.println();
}
}
|
Produce a functionally identical Java code for the snippet given in PHP. | <?php
for($i=1;$i<=22;$i++){
echo($i + floor(1/2 + sqrt($i)) . "\n");
}
$found_square=False;
for($i=1;$i<=1000000;$i++){
$non_square=$i + floor(1/2 + sqrt($i));
if(sqrt($non_square)==intval(sqrt($non_square))){
$found_square=True;
}
}
echo("\n");
if($found_square){
echo("Found a square number, so the formula does not always work.");
} else {
echo("Up to 1000000, found no square number in the sequence!");
}
?>
| public class SeqNonSquares {
public static int nonsqr(int n) {
return n + (int)Math.round(Math.sqrt(n));
}
public static void main(String[] args) {
for (int i = 1; i < 23; i++)
System.out.print(nonsqr(i) + " ");
System.out.println();
for (int i = 1; i < 1000000; i++) {
double j = Math.sqrt(nonsqr(i));
assert j != Math.floor(j);
}
}
}
|
Convert the following code from PHP to Java, ensuring the logic remains intact. | <?php
for($i=1;$i<=22;$i++){
echo($i + floor(1/2 + sqrt($i)) . "\n");
}
$found_square=False;
for($i=1;$i<=1000000;$i++){
$non_square=$i + floor(1/2 + sqrt($i));
if(sqrt($non_square)==intval(sqrt($non_square))){
$found_square=True;
}
}
echo("\n");
if($found_square){
echo("Found a square number, so the formula does not always work.");
} else {
echo("Up to 1000000, found no square number in the sequence!");
}
?>
| public class SeqNonSquares {
public static int nonsqr(int n) {
return n + (int)Math.round(Math.sqrt(n));
}
public static void main(String[] args) {
for (int i = 1; i < 23; i++)
System.out.print(nonsqr(i) + " ");
System.out.println();
for (int i = 1; i < 1000000; i++) {
double j = Math.sqrt(nonsqr(i));
assert j != Math.floor(j);
}
}
}
|
Ensure the translated Java code behaves exactly like the original PHP snippet. | <?php
$str = 'abcdefgh';
$n = 2;
$m = 3;
echo substr($str, $n, $m), "\n"; //cde
echo substr($str, $n), "\n"; //cdefgh
echo substr($str, 0, -1), "\n"; //abcdefg
echo substr($str, strpos($str, 'd'), $m), "\n"; //def
echo substr($str, strpos($str, 'de'), $m), "\n"; //def
?>
| public static String Substring(String str, int n, int m){
return str.substring(n, n+m);
}
public static String Substring(String str, int n){
return str.substring(n);
}
public static String Substring(String str){
return str.substring(0, str.length()-1);
}
public static String Substring(String str, char c, int m){
return str.substring(str.indexOf(c), str.indexOf(c)+m+1);
}
public static String Substring(String str, String sub, int m){
return str.substring(str.indexOf(sub), str.indexOf(sub)+m+1);
}
|
Port the provided PHP code into Java while preserving the original functionality. | <?php
$str = 'abcdefgh';
$n = 2;
$m = 3;
echo substr($str, $n, $m), "\n"; //cde
echo substr($str, $n), "\n"; //cdefgh
echo substr($str, 0, -1), "\n"; //abcdefg
echo substr($str, strpos($str, 'd'), $m), "\n"; //def
echo substr($str, strpos($str, 'de'), $m), "\n"; //def
?>
| public static String Substring(String str, int n, int m){
return str.substring(n, n+m);
}
public static String Substring(String str, int n){
return str.substring(n);
}
public static String Substring(String str){
return str.substring(0, str.length()-1);
}
public static String Substring(String str, char c, int m){
return str.substring(str.indexOf(c), str.indexOf(c)+m+1);
}
public static String Substring(String str, String sub, int m){
return str.substring(str.indexOf(sub), str.indexOf(sub)+m+1);
}
|
Can you help me rewrite this code in Java instead of PHP, keeping it the same logically? | <?php
function isLeapYear($year) {
if ($year % 100 == 0) {
return ($year % 400 == 0);
}
return ($year % 4 == 0);
}
| import java.util.GregorianCalendar;
import java.text.MessageFormat;
public class Leapyear{
public static void main(String[] argv){
int[] yrs = {1800,1900,1994,1998,1999,2000,2001,2004,2100};
GregorianCalendar cal = new GregorianCalendar();
for(int year : yrs){
System.err.println(MessageFormat.format("The year {0,number,#} is leaper: {1} / {2}.",
year, cal.isLeapYear(year), isLeapYear(year)));
}
}
public static boolean isLeapYear(int year){
return (year % 100 == 0) ? (year % 400 == 0) : (year % 4 == 0);
}
}
|
Convert the following code from PHP to Java, ensuring the logic remains intact. | <?php
function isLeapYear($year) {
if ($year % 100 == 0) {
return ($year % 400 == 0);
}
return ($year % 4 == 0);
}
| import java.util.GregorianCalendar;
import java.text.MessageFormat;
public class Leapyear{
public static void main(String[] argv){
int[] yrs = {1800,1900,1994,1998,1999,2000,2001,2004,2100};
GregorianCalendar cal = new GregorianCalendar();
for(int year : yrs){
System.err.println(MessageFormat.format("The year {0,number,#} is leaper: {1} / {2}.",
year, cal.isLeapYear(year), isLeapYear(year)));
}
}
public static boolean isLeapYear(int year){
return (year % 100 == 0) ? (year % 400 == 0) : (year % 4 == 0);
}
}
|
Write the same algorithm in Java as shown in this PHP implementation. | $orderOfMag = array('Hundred', 'Thousand,', 'Million,', 'Billion,', 'Trillion,');
$smallNumbers = array('Zero', 'One', 'Two', 'Three', 'Four', 'Five', 'Six', 'Seven', 'Eight', 'Nine',
'Ten', 'Eleven', 'Twelve', 'Thirteen', 'Fourteen', 'Fifteen', 'Sixteen', 'Seventeen', 'Eighteen', 'Nineteen');
$decades = array('', '', 'Twenty', 'Thirty', 'Forty', 'Fifty', 'Sixty', 'Seventy', 'Eighty', 'Ninety');
function NumberToEnglish($num, $count = 0){
global $orderOfMag, $smallNumbers, $decades;
$isLast = true;
$str = '';
if ($num < 0){
$str = 'Negative ';
$num = abs($num);
}
(int) $thisPart = substr((string) $num, -3);
if (strlen((string) $num) > 3){
$str .= NumberToEnglish((int) substr((string) $num, 0, strlen((string) $num) - 3), $count + 1);
$isLast = false;
}
if (($count == 0 || $isLast) && ($str == '' || $str == 'Negative '))
$and = '';
else
$and = ' and ';
if ($thisPart > 99){
$str .= ($isLast ? '' : ' ') . "{$smallNumbers[$thisPart/100]} {$orderOfMag[0]}";
if(($thisPart %= 100) == 0){
$str .= " {$orderOfMag[$count]}";
return $str;
}
$and = ' and '; // Set up our and string to the word "and" since there is something in the hundreds place of this chunk
}
if ($thisPart >= 20){
$str .= "{$and}{$decades[$thisPart /10]}";
$and = ' '; // Make sure we don't have any extranious "and"s
if(($thisPart %= 10) == 0)
return $str . ($count != 0 ? " {$orderOfMag[$count]}" : '');
}
if ($thisPart < 20 && $thisPart > 0)
return $str . "{$and}{$smallNumbers[(int) $thisPart]} " . ($count != 0 ? $orderOfMag[$count] : '');
elseif ($thisPart == 0 && strlen($thisPart) == 1)
return $str . "{$smallNumbers[(int)$thisPart]}";
}
| module NumberNames
{
void run()
{
@Inject Console console;
Int[] tests = [0, 1, -1, 11, -17, 42, 99, 100, 101, -111, 1000, 1234, 10000, 100000,
123456789000, 0x123456789ABCDEF];
for (Int test : tests)
{
console.print($"{test} = {toEnglish(test)}");
}
}
static String[] digits = ["zero", "one", "two", "three", "four",
"five", "six", "seven", "eight", "nine"];
static String[] teens = ["ten", "eleven", "twelve", "thirteen", "fourteen",
"fifteen", "sixteen", "seventeen", "eighteen", "nineteen"];
static String[] tens = ["zero", "ten", "twenty", "thirty", "forty",
"fifty", "sixty", "seventy", "eighty", "ninety"];
static String[] ten3rd = ["?", "thousand", "million", "billion", "trillion",
"quadrillion", "quintillion"];
static String toEnglish(Int n)
{
StringBuffer buf = new StringBuffer();
if (n < 0)
{
"negative ".appendTo(buf);
n = -n;
}
format3digits(n, buf);
return buf.toString();
}
static void format3digits(Int n, StringBuffer buf, Int nested=0)
{
(Int left, Int right) = n /% 1000;
if (left != 0)
{
format3digits(left, buf, nested+1);
}
if (right != 0 || (left == 0 && nested==0))
{
if (right >= 100)
{
(left, right) = (right /% 100);
digits[left].appendTo(buf);
" hundred ".appendTo(buf);
if (right != 0)
{
format2digits(right, buf);
}
}
else
{
format2digits(right, buf);
}
if (nested > 0)
{
ten3rd[nested].appendTo(buf).add(' ');
}
}
}
static void format2digits(Int n, StringBuffer buf)
{
switch (n)
{
case 0..9:
digits[n].appendTo(buf).add(' ');
break;
case 10..19:
teens[n-10].appendTo(buf).add(' ');
break;
default:
(Int left, Int right) = n /% 10;
tens[left].appendTo(buf);
if (right == 0)
{
buf.add(' ');
}
else
{
buf.add('-');
digits[right].appendTo(buf).add(' ');
}
break;
}
}
}
|
Port the provided PHP code into Java while preserving the original functionality. | $orderOfMag = array('Hundred', 'Thousand,', 'Million,', 'Billion,', 'Trillion,');
$smallNumbers = array('Zero', 'One', 'Two', 'Three', 'Four', 'Five', 'Six', 'Seven', 'Eight', 'Nine',
'Ten', 'Eleven', 'Twelve', 'Thirteen', 'Fourteen', 'Fifteen', 'Sixteen', 'Seventeen', 'Eighteen', 'Nineteen');
$decades = array('', '', 'Twenty', 'Thirty', 'Forty', 'Fifty', 'Sixty', 'Seventy', 'Eighty', 'Ninety');
function NumberToEnglish($num, $count = 0){
global $orderOfMag, $smallNumbers, $decades;
$isLast = true;
$str = '';
if ($num < 0){
$str = 'Negative ';
$num = abs($num);
}
(int) $thisPart = substr((string) $num, -3);
if (strlen((string) $num) > 3){
$str .= NumberToEnglish((int) substr((string) $num, 0, strlen((string) $num) - 3), $count + 1);
$isLast = false;
}
if (($count == 0 || $isLast) && ($str == '' || $str == 'Negative '))
$and = '';
else
$and = ' and ';
if ($thisPart > 99){
$str .= ($isLast ? '' : ' ') . "{$smallNumbers[$thisPart/100]} {$orderOfMag[0]}";
if(($thisPart %= 100) == 0){
$str .= " {$orderOfMag[$count]}";
return $str;
}
$and = ' and '; // Set up our and string to the word "and" since there is something in the hundreds place of this chunk
}
if ($thisPart >= 20){
$str .= "{$and}{$decades[$thisPart /10]}";
$and = ' '; // Make sure we don't have any extranious "and"s
if(($thisPart %= 10) == 0)
return $str . ($count != 0 ? " {$orderOfMag[$count]}" : '');
}
if ($thisPart < 20 && $thisPart > 0)
return $str . "{$and}{$smallNumbers[(int) $thisPart]} " . ($count != 0 ? $orderOfMag[$count] : '');
elseif ($thisPart == 0 && strlen($thisPart) == 1)
return $str . "{$smallNumbers[(int)$thisPart]}";
}
| module NumberNames
{
void run()
{
@Inject Console console;
Int[] tests = [0, 1, -1, 11, -17, 42, 99, 100, 101, -111, 1000, 1234, 10000, 100000,
123456789000, 0x123456789ABCDEF];
for (Int test : tests)
{
console.print($"{test} = {toEnglish(test)}");
}
}
static String[] digits = ["zero", "one", "two", "three", "four",
"five", "six", "seven", "eight", "nine"];
static String[] teens = ["ten", "eleven", "twelve", "thirteen", "fourteen",
"fifteen", "sixteen", "seventeen", "eighteen", "nineteen"];
static String[] tens = ["zero", "ten", "twenty", "thirty", "forty",
"fifty", "sixty", "seventy", "eighty", "ninety"];
static String[] ten3rd = ["?", "thousand", "million", "billion", "trillion",
"quadrillion", "quintillion"];
static String toEnglish(Int n)
{
StringBuffer buf = new StringBuffer();
if (n < 0)
{
"negative ".appendTo(buf);
n = -n;
}
format3digits(n, buf);
return buf.toString();
}
static void format3digits(Int n, StringBuffer buf, Int nested=0)
{
(Int left, Int right) = n /% 1000;
if (left != 0)
{
format3digits(left, buf, nested+1);
}
if (right != 0 || (left == 0 && nested==0))
{
if (right >= 100)
{
(left, right) = (right /% 100);
digits[left].appendTo(buf);
" hundred ".appendTo(buf);
if (right != 0)
{
format2digits(right, buf);
}
}
else
{
format2digits(right, buf);
}
if (nested > 0)
{
ten3rd[nested].appendTo(buf).add(' ');
}
}
}
static void format2digits(Int n, StringBuffer buf)
{
switch (n)
{
case 0..9:
digits[n].appendTo(buf).add(' ');
break;
case 10..19:
teens[n-10].appendTo(buf).add(' ');
break;
default:
(Int left, Int right) = n /% 10;
tens[left].appendTo(buf);
if (right == 0)
{
buf.add(' ');
}
else
{
buf.add('-');
digits[right].appendTo(buf).add(' ');
}
break;
}
}
}
|
Convert the following code from PHP to Java, ensuring the logic remains intact. | <?php
function retrieveStrings()
{
if (isset($_POST['input'])) {
$strings = explode("\n", $_POST['input']);
} else {
$strings = ['abcd', '123456789', 'abcdef', '1234567'];
}
return $strings;
}
function setInput()
{
echo join("\n", retrieveStrings());
}
function setOutput()
{
$strings = retrieveStrings();
$strings = array_map('trim', $strings);
$strings = array_filter($strings);
if (!empty($strings)) {
usort($strings, function ($a, $b) {
return strlen($b) - strlen($a);
});
$max_len = strlen($strings[0]);
$min_len = strlen($strings[count($strings) - 1]);
foreach ($strings as $s) {
$length = strlen($s);
if ($length == $max_len) {
$predicate = "is the longest string";
} elseif ($length == $min_len) {
$predicate = "is the shortest string";
} else {
$predicate = "is neither the longest nor the shortest string";
}
echo "$s has length $length and $predicate\n";
}
}
}
?>
<!DOCTYPE html>
<html lang="en">
<head>
<style>
div {
margin-top: 4ch;
margin-bottom: 4ch;
}
label {
display: block;
margin-bottom: 1ch;
}
textarea {
display: block;
}
input {
display: block;
margin-top: 4ch;
margin-bottom: 4ch;
}
</style>
</head>
<body>
<main>
<form action=<?php echo $_SERVER['SCRIPT_NAME'] ?> method="post" accept-charset="utf-8">
<div>
<label for="input">Input:
</label>
<textarea rows='20' cols='80' name='input'><?php setInput(); ?></textarea>
</label>
</div>
<input type="submit" value="press to compare strings">
</input>
<div>
<label for="Output">Output:
</label>
<textarea rows='20' cols='80' name='output'><?php setOutput(); ?></textarea>
</div>
</form>
</main>
</body>
</html>
| package stringlensort;
import java.io.PrintStream;
import java.util.Arrays;
import java.util.Comparator;
public class ReportStringLengths {
public static void main(String[] args) {
String[] list = {"abcd", "123456789", "abcdef", "1234567"};
String[] strings = args.length > 0 ? args : list;
compareAndReportStringsLength(strings);
}
public static void compareAndReportStringsLength(String[] strings) {
compareAndReportStringsLength(strings, System.out);
}
public static void compareAndReportStringsLength(String[] strings, PrintStream stream) {
if (strings.length > 0) {
strings = strings.clone();
final String QUOTE = "\"";
Arrays.sort(strings, Comparator.comparing(String::length));
int min = strings[0].length();
int max = strings[strings.length - 1].length();
for (int i = strings.length - 1; i >= 0; i--) {
int length = strings[i].length();
String predicate;
if (length == max) {
predicate = "is the longest string";
} else if (length == min) {
predicate = "is the shortest string";
} else {
predicate = "is neither the longest nor the shortest string";
}
stream.println(QUOTE + strings[i] + QUOTE + " has length " + length
+ " and " + predicate);
}
}
}
}
|
Port the provided PHP code into Java while preserving the original functionality. | <?php
function retrieveStrings()
{
if (isset($_POST['input'])) {
$strings = explode("\n", $_POST['input']);
} else {
$strings = ['abcd', '123456789', 'abcdef', '1234567'];
}
return $strings;
}
function setInput()
{
echo join("\n", retrieveStrings());
}
function setOutput()
{
$strings = retrieveStrings();
$strings = array_map('trim', $strings);
$strings = array_filter($strings);
if (!empty($strings)) {
usort($strings, function ($a, $b) {
return strlen($b) - strlen($a);
});
$max_len = strlen($strings[0]);
$min_len = strlen($strings[count($strings) - 1]);
foreach ($strings as $s) {
$length = strlen($s);
if ($length == $max_len) {
$predicate = "is the longest string";
} elseif ($length == $min_len) {
$predicate = "is the shortest string";
} else {
$predicate = "is neither the longest nor the shortest string";
}
echo "$s has length $length and $predicate\n";
}
}
}
?>
<!DOCTYPE html>
<html lang="en">
<head>
<style>
div {
margin-top: 4ch;
margin-bottom: 4ch;
}
label {
display: block;
margin-bottom: 1ch;
}
textarea {
display: block;
}
input {
display: block;
margin-top: 4ch;
margin-bottom: 4ch;
}
</style>
</head>
<body>
<main>
<form action=<?php echo $_SERVER['SCRIPT_NAME'] ?> method="post" accept-charset="utf-8">
<div>
<label for="input">Input:
</label>
<textarea rows='20' cols='80' name='input'><?php setInput(); ?></textarea>
</label>
</div>
<input type="submit" value="press to compare strings">
</input>
<div>
<label for="Output">Output:
</label>
<textarea rows='20' cols='80' name='output'><?php setOutput(); ?></textarea>
</div>
</form>
</main>
</body>
</html>
| package stringlensort;
import java.io.PrintStream;
import java.util.Arrays;
import java.util.Comparator;
public class ReportStringLengths {
public static void main(String[] args) {
String[] list = {"abcd", "123456789", "abcdef", "1234567"};
String[] strings = args.length > 0 ? args : list;
compareAndReportStringsLength(strings);
}
public static void compareAndReportStringsLength(String[] strings) {
compareAndReportStringsLength(strings, System.out);
}
public static void compareAndReportStringsLength(String[] strings, PrintStream stream) {
if (strings.length > 0) {
strings = strings.clone();
final String QUOTE = "\"";
Arrays.sort(strings, Comparator.comparing(String::length));
int min = strings[0].length();
int max = strings[strings.length - 1].length();
for (int i = strings.length - 1; i >= 0; i--) {
int length = strings[i].length();
String predicate;
if (length == max) {
predicate = "is the longest string";
} else if (length == min) {
predicate = "is the shortest string";
} else {
predicate = "is neither the longest nor the shortest string";
}
stream.println(QUOTE + strings[i] + QUOTE + " has length " + length
+ " and " + predicate);
}
}
}
}
|
Ensure the translated Java code behaves exactly like the original PHP snippet. | function shellSort($arr)
{
$inc = round(count($arr)/2);
while($inc > 0)
{
for($i = $inc; $i < count($arr);$i++){
$temp = $arr[$i];
$j = $i;
while($j >= $inc && $arr[$j-$inc] > $temp)
{
$arr[$j] = $arr[$j - $inc];
$j -= $inc;
}
$arr[$j] = $temp;
}
$inc = round($inc/2.2);
}
return $arr;
}
| public static void shell(int[] a) {
int increment = a.length / 2;
while (increment > 0) {
for (int i = increment; i < a.length; i++) {
int j = i;
int temp = a[i];
while (j >= increment && a[j - increment] > temp) {
a[j] = a[j - increment];
j = j - increment;
}
a[j] = temp;
}
if (increment == 2) {
increment = 1;
} else {
increment *= (5.0 / 11);
}
}
}
|
Preserve the algorithm and functionality while converting the code from PHP to Java. | function shellSort($arr)
{
$inc = round(count($arr)/2);
while($inc > 0)
{
for($i = $inc; $i < count($arr);$i++){
$temp = $arr[$i];
$j = $i;
while($j >= $inc && $arr[$j-$inc] > $temp)
{
$arr[$j] = $arr[$j - $inc];
$j -= $inc;
}
$arr[$j] = $temp;
}
$inc = round($inc/2.2);
}
return $arr;
}
| public static void shell(int[] a) {
int increment = a.length / 2;
while (increment > 0) {
for (int i = increment; i < a.length; i++) {
int j = i;
int temp = a[i];
while (j >= increment && a[j - increment] > temp) {
a[j] = a[j - increment];
j = j - increment;
}
a[j] = temp;
}
if (increment == 2) {
increment = 1;
} else {
increment *= (5.0 / 11);
}
}
}
|
Keep all operations the same but rewrite the snippet in Java. | <?php
print_r(array_count_values(str_split(file_get_contents($argv[1]))));
?>
| import java.io.BufferedReader;
import java.io.FileReader;
import java.io.IOException;
import java.util.Arrays;
public class LetterFreq {
public static int[] countLetters(String filename) throws IOException{
int[] freqs = new int[26];
BufferedReader in = new BufferedReader(new FileReader(filename));
String line;
while((line = in.readLine()) != null){
line = line.toUpperCase();
for(char ch:line.toCharArray()){
if(Character.isLetter(ch)){
freqs[ch - 'A']++;
}
}
}
in.close();
return freqs;
}
public static void main(String[] args) throws IOException{
System.out.println(Arrays.toString(countLetters("filename.txt")));
}
}
|
Ensure the translated Java code behaves exactly like the original PHP snippet. | <?php
print_r(array_count_values(str_split(file_get_contents($argv[1]))));
?>
| import java.io.BufferedReader;
import java.io.FileReader;
import java.io.IOException;
import java.util.Arrays;
public class LetterFreq {
public static int[] countLetters(String filename) throws IOException{
int[] freqs = new int[26];
BufferedReader in = new BufferedReader(new FileReader(filename));
String line;
while((line = in.readLine()) != null){
line = line.toUpperCase();
for(char ch:line.toCharArray()){
if(Character.isLetter(ch)){
freqs[ch - 'A']++;
}
}
}
in.close();
return freqs;
}
public static void main(String[] args) throws IOException{
System.out.println(Arrays.toString(countLetters("filename.txt")));
}
}
|
Write a version of this PHP function in Java with identical behavior. | $s = "12345";
$s++;
| String s = "12345";
IntLiteral lit1 = new IntLiteral(s);
IntLiteral lit2 = 6789;
++lit1;
++lit2;
|
Generate a Java translation of this PHP snippet without changing its computational steps. | $s = "12345";
$s++;
| String s = "12345";
IntLiteral lit1 = new IntLiteral(s);
IntLiteral lit2 = 6789;
++lit1;
++lit2;
|
Ensure the translated Java code behaves exactly like the original PHP snippet. | <?php
function stripchars($s, $chars) {
return str_replace(str_split($chars), "", $s);
}
echo stripchars("She was a soul stripper. She took my heart!", "aei"), "\n";
?>
| class StripChars {
public static String stripChars(String inString, String toStrip) {
return inString.replaceAll("[" + toStrip + "]", "");
}
public static void main(String[] args) {
String sentence = "She was a soul stripper. She took my heart!";
String chars = "aei";
System.out.println("sentence: " + sentence);
System.out.println("to strip: " + chars);
System.out.println("stripped: " + stripChars(sentence, chars));
}
}
|
Maintain the same structure and functionality when rewriting this code in Java. | <?php
function stripchars($s, $chars) {
return str_replace(str_split($chars), "", $s);
}
echo stripchars("She was a soul stripper. She took my heart!", "aei"), "\n";
?>
| class StripChars {
public static String stripChars(String inString, String toStrip) {
return inString.replaceAll("[" + toStrip + "]", "");
}
public static void main(String[] args) {
String sentence = "She was a soul stripper. She took my heart!";
String chars = "aei";
System.out.println("sentence: " + sentence);
System.out.println("to strip: " + chars);
System.out.println("stripped: " + stripChars(sentence, chars));
}
}
|
Transform the following PHP implementation into Java, maintaining the same output and logic. | function inOrder($arr){
for($i=0;$i<count($arr);$i++){
if(isset($arr[$i+1])){
if($arr[$i] > $arr[$i+1]){
return false;
}
}
}
return true;
}
function permute($items, $perms = array( )) {
if (empty($items)) {
if(inOrder($perms)){
return $perms;
}
} else {
for ($i = count($items) - 1; $i >= 0; --$i) {
$newitems = $items;
$newperms = $perms;
list($foo) = array_splice($newitems, $i, 1);
array_unshift($newperms, $foo);
$res = permute($newitems, $newperms);
if($res){
return $res;
}
}
}
}
$arr = array( 8, 3, 10, 6, 1, 9, 7, 2, 5, 4);
$arr = permute($arr);
echo implode(',',$arr);
| import java.util.List;
import java.util.ArrayList;
import java.util.Arrays;
public class PermutationSort
{
public static void main(String[] args)
{
int[] a={3,2,1,8,9,4,6};
System.out.println("Unsorted: " + Arrays.toString(a));
a=pSort(a);
System.out.println("Sorted: " + Arrays.toString(a));
}
public static int[] pSort(int[] a)
{
List<int[]> list=new ArrayList<int[]>();
permute(a,a.length,list);
for(int[] x : list)
if(isSorted(x))
return x;
return a;
}
private static void permute(int[] a, int n, List<int[]> list)
{
if (n == 1)
{
int[] b=new int[a.length];
System.arraycopy(a, 0, b, 0, a.length);
list.add(b);
return;
}
for (int i = 0; i < n; i++)
{
swap(a, i, n-1);
permute(a, n-1, list);
swap(a, i, n-1);
}
}
private static boolean isSorted(int[] a)
{
for(int i=1;i<a.length;i++)
if(a[i-1]>a[i])
return false;
return true;
}
private static void swap(int[] arr,int i, int j)
{
int temp=arr[i];
arr[i]=arr[j];
arr[j]=temp;
}
}
|
Convert the following code from PHP to Java, ensuring the logic remains intact. | function inOrder($arr){
for($i=0;$i<count($arr);$i++){
if(isset($arr[$i+1])){
if($arr[$i] > $arr[$i+1]){
return false;
}
}
}
return true;
}
function permute($items, $perms = array( )) {
if (empty($items)) {
if(inOrder($perms)){
return $perms;
}
} else {
for ($i = count($items) - 1; $i >= 0; --$i) {
$newitems = $items;
$newperms = $perms;
list($foo) = array_splice($newitems, $i, 1);
array_unshift($newperms, $foo);
$res = permute($newitems, $newperms);
if($res){
return $res;
}
}
}
}
$arr = array( 8, 3, 10, 6, 1, 9, 7, 2, 5, 4);
$arr = permute($arr);
echo implode(',',$arr);
| import java.util.List;
import java.util.ArrayList;
import java.util.Arrays;
public class PermutationSort
{
public static void main(String[] args)
{
int[] a={3,2,1,8,9,4,6};
System.out.println("Unsorted: " + Arrays.toString(a));
a=pSort(a);
System.out.println("Sorted: " + Arrays.toString(a));
}
public static int[] pSort(int[] a)
{
List<int[]> list=new ArrayList<int[]>();
permute(a,a.length,list);
for(int[] x : list)
if(isSorted(x))
return x;
return a;
}
private static void permute(int[] a, int n, List<int[]> list)
{
if (n == 1)
{
int[] b=new int[a.length];
System.arraycopy(a, 0, b, 0, a.length);
list.add(b);
return;
}
for (int i = 0; i < n; i++)
{
swap(a, i, n-1);
permute(a, n-1, list);
swap(a, i, n-1);
}
}
private static boolean isSorted(int[] a)
{
for(int i=1;i<a.length;i++)
if(a[i-1]>a[i])
return false;
return true;
}
private static void swap(int[] arr,int i, int j)
{
int temp=arr[i];
arr[i]=arr[j];
arr[j]=temp;
}
}
|
Port the provided PHP code into Java while preserving the original functionality. | $nums = array(3, 1, 4, 1, 5, 9);
if ($nums)
echo array_sum($nums) / count($nums), "\n";
else
echo "0\n";
| public static double avg(double... arr) {
double sum = 0.0;
for (double x : arr) {
sum += x;
}
return sum / arr.length;
}
|
Ensure the translated Java code behaves exactly like the original PHP snippet. | $nums = array(3, 1, 4, 1, 5, 9);
if ($nums)
echo array_sum($nums) / count($nums), "\n";
else
echo "0\n";
| public static double avg(double... arr) {
double sum = 0.0;
for (double x : arr) {
sum += x;
}
return sum / arr.length;
}
|
Maintain the same structure and functionality when rewriting this code in Java. | <?php
function shannonEntropy($string) {
$h = 0.0;
$len = strlen($string);
foreach (count_chars($string, 1) as $count) {
$h -= (double) ($count / $len) * log((double) ($count / $len), 2);
}
return $h;
}
$strings = array(
'1223334444',
'1225554444',
'aaBBcccDDDD',
'122333444455555',
'Rosetta Code',
'1234567890abcdefghijklmnopqrstuvwxyz',
);
foreach ($strings AS $string) {
printf(
'%36s : %s' . PHP_EOL,
$string,
number_format(shannonEntropy($string), 6)
);
}
| import java.lang.Math;
import java.util.Map;
import java.util.HashMap;
public class REntropy {
@SuppressWarnings("boxing")
public static double getShannonEntropy(String s) {
int n = 0;
Map<Character, Integer> occ = new HashMap<>();
for (int c_ = 0; c_ < s.length(); ++c_) {
char cx = s.charAt(c_);
if (occ.containsKey(cx)) {
occ.put(cx, occ.get(cx) + 1);
} else {
occ.put(cx, 1);
}
++n;
}
double e = 0.0;
for (Map.Entry<Character, Integer> entry : occ.entrySet()) {
char cx = entry.getKey();
double p = (double) entry.getValue() / n;
e += p * log2(p);
}
return -e;
}
private static double log2(double a) {
return Math.log(a) / Math.log(2);
}
public static void main(String[] args) {
String[] sstr = {
"1223334444",
"1223334444555555555",
"122333",
"1227774444",
"aaBBcccDDDD",
"1234567890abcdefghijklmnopqrstuvwxyz",
"Rosetta Code",
};
for (String ss : sstr) {
double entropy = REntropy.getShannonEntropy(ss);
System.out.printf("Shannon entropy of %40s: %.12f%n", "\"" + ss + "\"", entropy);
}
return;
}
}
|
Convert this PHP snippet to Java and keep its semantics consistent. | <?php
function shannonEntropy($string) {
$h = 0.0;
$len = strlen($string);
foreach (count_chars($string, 1) as $count) {
$h -= (double) ($count / $len) * log((double) ($count / $len), 2);
}
return $h;
}
$strings = array(
'1223334444',
'1225554444',
'aaBBcccDDDD',
'122333444455555',
'Rosetta Code',
'1234567890abcdefghijklmnopqrstuvwxyz',
);
foreach ($strings AS $string) {
printf(
'%36s : %s' . PHP_EOL,
$string,
number_format(shannonEntropy($string), 6)
);
}
| import java.lang.Math;
import java.util.Map;
import java.util.HashMap;
public class REntropy {
@SuppressWarnings("boxing")
public static double getShannonEntropy(String s) {
int n = 0;
Map<Character, Integer> occ = new HashMap<>();
for (int c_ = 0; c_ < s.length(); ++c_) {
char cx = s.charAt(c_);
if (occ.containsKey(cx)) {
occ.put(cx, occ.get(cx) + 1);
} else {
occ.put(cx, 1);
}
++n;
}
double e = 0.0;
for (Map.Entry<Character, Integer> entry : occ.entrySet()) {
char cx = entry.getKey();
double p = (double) entry.getValue() / n;
e += p * log2(p);
}
return -e;
}
private static double log2(double a) {
return Math.log(a) / Math.log(2);
}
public static void main(String[] args) {
String[] sstr = {
"1223334444",
"1223334444555555555",
"122333",
"1227774444",
"aaBBcccDDDD",
"1234567890abcdefghijklmnopqrstuvwxyz",
"Rosetta Code",
};
for (String ss : sstr) {
double entropy = REntropy.getShannonEntropy(ss);
System.out.printf("Shannon entropy of %40s: %.12f%n", "\"" + ss + "\"", entropy);
}
return;
}
}
|
Change the following PHP code into Java without altering its purpose. | <?php
echo "Hello world!\n";
?>
| module HelloWorld
{
void run()
{
@Inject Console console;
console.print("Hello World!");
}
}
|
Port the following code from PHP to Java with equivalent syntax and logic. | <?php
echo "Hello world!\n";
?>
| module HelloWorld
{
void run()
{
@Inject Console console;
console.print("Hello World!");
}
}
|
Port the provided PHP code into Java while preserving the original functionality. | <?php
function forwardDiff($anArray, $times = 1) {
if ($times <= 0) { return $anArray; }
for ($accumilation = array(), $i = 1, $j = count($anArray); $i < $j; ++$i) {
$accumilation[] = $anArray[$i] - $anArray[$i - 1];
}
if ($times === 1) { return $accumilation; }
return forwardDiff($accumilation, $times - 1);
}
class ForwardDiffExample extends PweExample {
function _should_run_empty_array_for_single_elem() {
$expected = array($this->rand()->int());
$this->spec(forwardDiff($expected))->shouldEqual(array());
}
function _should_give_diff_of_two_elem_as_single_elem() {
$twoNums = array($this->rand()->int(), $this->rand()->int());
$expected = array($twoNums[1] - $twoNums[0]);
$this->spec(forwardDiff($twoNums))->shouldEqual($expected);
}
function _should_compute_correct_forward_diff_for_longer_arrays() {
$diffInput = array(10, 2, 9, 6, 5);
$expected = array(-8, 7, -3, -1);
$this->spec(forwardDiff($diffInput))->shouldEqual($expected);
}
function _should_apply_more_than_once_if_specified() {
$diffInput = array(4, 6, 9, 3, 4);
$expectedAfter1 = array(2, 3, -6, 1);
$expectedAfter2 = array(1, -9, 7);
$this->spec(forwardDiff($diffInput, 1))->shouldEqual($expectedAfter1);
$this->spec(forwardDiff($diffInput, 2))->shouldEqual($expectedAfter2);
}
function _should_return_array_unaltered_if_no_times() {
$this->spec(forwardDiff($expected = array(1,2,3), 0))->shouldEqual($expected);
}
}
| import java.util.Arrays;
public class FD {
public static void main(String args[]) {
double[] a = {90, 47, 58, 29, 22, 32, 55, 5, 55, 73};
System.out.println(Arrays.toString(dif(a, 1)));
System.out.println(Arrays.toString(dif(a, 2)));
System.out.println(Arrays.toString(dif(a, 9)));
System.out.println(Arrays.toString(dif(a, 10)));
System.out.println(Arrays.toString(dif(a, 11)));
System.out.println(Arrays.toString(dif(a, -1)));
System.out.println(Arrays.toString(dif(a, 0)));
}
public static double[] dif(double[] a, int n) {
if (n < 0)
return null;
for (int i = 0; i < n && a.length > 0; i++) {
double[] b = new double[a.length - 1];
for (int j = 0; j < b.length; j++){
b[j] = a[j+1] - a[j];
}
a = b;
}
return a;
}
}
|
Maintain the same structure and functionality when rewriting this code in Java. | <?php
function forwardDiff($anArray, $times = 1) {
if ($times <= 0) { return $anArray; }
for ($accumilation = array(), $i = 1, $j = count($anArray); $i < $j; ++$i) {
$accumilation[] = $anArray[$i] - $anArray[$i - 1];
}
if ($times === 1) { return $accumilation; }
return forwardDiff($accumilation, $times - 1);
}
class ForwardDiffExample extends PweExample {
function _should_run_empty_array_for_single_elem() {
$expected = array($this->rand()->int());
$this->spec(forwardDiff($expected))->shouldEqual(array());
}
function _should_give_diff_of_two_elem_as_single_elem() {
$twoNums = array($this->rand()->int(), $this->rand()->int());
$expected = array($twoNums[1] - $twoNums[0]);
$this->spec(forwardDiff($twoNums))->shouldEqual($expected);
}
function _should_compute_correct_forward_diff_for_longer_arrays() {
$diffInput = array(10, 2, 9, 6, 5);
$expected = array(-8, 7, -3, -1);
$this->spec(forwardDiff($diffInput))->shouldEqual($expected);
}
function _should_apply_more_than_once_if_specified() {
$diffInput = array(4, 6, 9, 3, 4);
$expectedAfter1 = array(2, 3, -6, 1);
$expectedAfter2 = array(1, -9, 7);
$this->spec(forwardDiff($diffInput, 1))->shouldEqual($expectedAfter1);
$this->spec(forwardDiff($diffInput, 2))->shouldEqual($expectedAfter2);
}
function _should_return_array_unaltered_if_no_times() {
$this->spec(forwardDiff($expected = array(1,2,3), 0))->shouldEqual($expected);
}
}
| import java.util.Arrays;
public class FD {
public static void main(String args[]) {
double[] a = {90, 47, 58, 29, 22, 32, 55, 5, 55, 73};
System.out.println(Arrays.toString(dif(a, 1)));
System.out.println(Arrays.toString(dif(a, 2)));
System.out.println(Arrays.toString(dif(a, 9)));
System.out.println(Arrays.toString(dif(a, 10)));
System.out.println(Arrays.toString(dif(a, 11)));
System.out.println(Arrays.toString(dif(a, -1)));
System.out.println(Arrays.toString(dif(a, 0)));
}
public static double[] dif(double[] a, int n) {
if (n < 0)
return null;
for (int i = 0; i < n && a.length > 0; i++) {
double[] b = new double[a.length - 1];
for (int j = 0; j < b.length; j++){
b[j] = a[j+1] - a[j];
}
a = b;
}
return a;
}
}
|
Transform the following PHP implementation into Java, maintaining the same output and logic. | <?php
function prime($a) {
if (($a % 2 == 0 && $a != 2) || $a < 2)
return false;
$limit = sqrt($a);
for ($i = 2; $i <= $limit; $i++)
if ($a % $i == 0)
return false;
return true;
}
foreach (range(1, 100) as $x)
if (prime($x)) echo "$x\n";
?>
| public static boolean prime(long a){
if(a == 2){
return true;
}else if(a <= 1 || a % 2 == 0){
return false;
}
long max = (long)Math.sqrt(a);
for(long n= 3; n <= max; n+= 2){
if(a % n == 0){ return false; }
}
return true;
}
|
Rewrite the snippet below in Java so it works the same as the original PHP code. | <?php
function prime($a) {
if (($a % 2 == 0 && $a != 2) || $a < 2)
return false;
$limit = sqrt($a);
for ($i = 2; $i <= $limit; $i++)
if ($a % $i == 0)
return false;
return true;
}
foreach (range(1, 100) as $x)
if (prime($x)) echo "$x\n";
?>
| public static boolean prime(long a){
if(a == 2){
return true;
}else if(a <= 1 || a % 2 == 0){
return false;
}
long max = (long)Math.sqrt(a);
for(long n= 3; n <= max; n+= 2){
if(a % n == 0){ return false; }
}
return true;
}
|
Port the provided PHP code into Java while preserving the original functionality. | <?php
$n=5;
$k=3;
function factorial($val){
for($f=2;$val-1>1;$f*=$val--);
return $f;
}
$binomial_coefficient=factorial($n)/(factorial($k)*factorial($n-$k));
echo $binomial_coefficient;
?>
| public class Binomial {
private static long binomialInt(int n, int k) {
if (k > n - k)
k = n - k;
long binom = 1;
for (int i = 1; i <= k; i++)
binom = binom * (n + 1 - i) / i;
return binom;
}
private static Object binomialIntReliable(int n, int k) {
if (k > n - k)
k = n - k;
long binom = 1;
for (int i = 1; i <= k; i++) {
try {
binom = Math.multiplyExact(binom, n + 1 - i) / i;
} catch (ArithmeticException e) {
return "overflow";
}
}
return binom;
}
private static double binomialFloat(int n, int k) {
if (k > n - k)
k = n - k;
double binom = 1.0;
for (int i = 1; i <= k; i++)
binom = binom * (n + 1 - i) / i;
return binom;
}
private static BigInteger binomialBigInt(int n, int k) {
if (k > n - k)
k = n - k;
BigInteger binom = BigInteger.ONE;
for (int i = 1; i <= k; i++) {
binom = binom.multiply(BigInteger.valueOf(n + 1 - i));
binom = binom.divide(BigInteger.valueOf(i));
}
return binom;
}
private static void demo(int n, int k) {
List<Object> data = Arrays.asList(
n,
k,
binomialInt(n, k),
binomialIntReliable(n, k),
binomialFloat(n, k),
binomialBigInt(n, k));
System.out.println(data.stream().map(Object::toString).collect(Collectors.joining("\t")));
}
public static void main(String[] args) {
demo(5, 3);
demo(1000, 300);
}
}
|
Convert this PHP snippet to Java and keep its semantics consistent. | <?php
$n=5;
$k=3;
function factorial($val){
for($f=2;$val-1>1;$f*=$val--);
return $f;
}
$binomial_coefficient=factorial($n)/(factorial($k)*factorial($n-$k));
echo $binomial_coefficient;
?>
| public class Binomial {
private static long binomialInt(int n, int k) {
if (k > n - k)
k = n - k;
long binom = 1;
for (int i = 1; i <= k; i++)
binom = binom * (n + 1 - i) / i;
return binom;
}
private static Object binomialIntReliable(int n, int k) {
if (k > n - k)
k = n - k;
long binom = 1;
for (int i = 1; i <= k; i++) {
try {
binom = Math.multiplyExact(binom, n + 1 - i) / i;
} catch (ArithmeticException e) {
return "overflow";
}
}
return binom;
}
private static double binomialFloat(int n, int k) {
if (k > n - k)
k = n - k;
double binom = 1.0;
for (int i = 1; i <= k; i++)
binom = binom * (n + 1 - i) / i;
return binom;
}
private static BigInteger binomialBigInt(int n, int k) {
if (k > n - k)
k = n - k;
BigInteger binom = BigInteger.ONE;
for (int i = 1; i <= k; i++) {
binom = binom.multiply(BigInteger.valueOf(n + 1 - i));
binom = binom.divide(BigInteger.valueOf(i));
}
return binom;
}
private static void demo(int n, int k) {
List<Object> data = Arrays.asList(
n,
k,
binomialInt(n, k),
binomialIntReliable(n, k),
binomialFloat(n, k),
binomialBigInt(n, k));
System.out.println(data.stream().map(Object::toString).collect(Collectors.joining("\t")));
}
public static void main(String[] args) {
demo(5, 3);
demo(1000, 300);
}
}
|
Convert this PHP block to Java, preserving its control flow and logic. | <?php
$a = array();
# add elements "at the end"
array_push($a, 55, 10, 20);
print_r($a);
# using an explicit key
$a['one'] = 1;
$a['two'] = 2;
print_r($a);
?>
| List arrayList = new ArrayList();
arrayList.add(new Integer(0));
arrayList.add(0);
List<Integer> myarrlist = new ArrayList<Integer>();
int sum;
for(int i = 0; i < 10; i++) {
myarrlist.add(i);
}
|
Convert the following code from PHP to Java, ensuring the logic remains intact. | <?php
$a = array();
# add elements "at the end"
array_push($a, 55, 10, 20);
print_r($a);
# using an explicit key
$a['one'] = 1;
$a['two'] = 2;
print_r($a);
?>
| List arrayList = new ArrayList();
arrayList.add(new Integer(0));
arrayList.add(0);
List<Integer> myarrlist = new ArrayList<Integer>();
int sum;
for(int i = 0; i < 10; i++) {
myarrlist.add(i);
}
|
Can you help me rewrite this code in Java instead of PHP, keeping it the same logically? | class Bitmap {
public $data;
public $w;
public $h;
public function __construct($w = 16, $h = 16){
$white = array_fill(0, $w, array(255,255,255));
$this->data = array_fill(0, $h, $white);
$this->w = $w;
$this->h = $h;
}
public function fill($x = 0, $y = 0, $w = null, $h = null, $color = array(0,0,0)){
if (is_null($w)) $w = $this->w;
if (is_null($h)) $h = $this->h;
$w += $x;
$h += $y;
for ($i = $y; $i < $h; $i++){
for ($j = $x; $j < $w; $j++){
$this->setPixel($j, $i, $color);
}
}
}
public function setPixel($x, $y, $color = array(0,0,0)){
if ($x >= $this->w) return false;
if ($x < 0) return false;
if ($y >= $this->h) return false;
if ($y < 0) return false;
$this->data[$y][$x] = $color;
}
public function getPixel($x, $y){
return $this->data[$y][$x];
}
public function writeP6($filename){
$fh = fopen($filename, 'w');
if (!$fh) return false;
fputs($fh, "P6 {$this->w} {$this->h} 255\n");
foreach ($this->data as $row){
foreach($row as $pixel){
fputs($fh, pack('C', $pixel[0]));
fputs($fh, pack('C', $pixel[1]));
fputs($fh, pack('C', $pixel[2]));
}
}
fclose($fh);
}
}
$b = new Bitmap(16,16);
$b->fill();
$b->fill(2, 2, 18, 18, array(240,240,240));
$b->setPixel(0, 15, array(255,0,0));
$b->writeP6('p6.ppm');
| import java.io.BufferedOutputStream;
import java.io.File;
import java.io.FileOutputStream;
import java.io.IOException;
import java.nio.charset.StandardCharsets;
public class PPMWriter {
public void bitmapToPPM(File file, BasicBitmapStorage bitmap) throws IOException {
file.delete();
try (var os = new FileOutputStream(file, true);
var bw = new BufferedOutputStream(os)) {
var header = String.format("P6\n%d %d\n255\n",
bitmap.getWidth(), bitmap.getHeight());
bw.write(header.getBytes(StandardCharsets.US_ASCII));
for (var y = 0; y < bitmap.getHeight(); y++) {
for (var x = 0; x < bitmap.getWidth(); x++) {
var pixel = bitmap.getPixel(x, y);
bw.write(pixel.getRed());
bw.write(pixel.getGreen());
bw.write(pixel.getBlue());
}
}
}
}
}
|
Produce a functionally identical Java code for the snippet given in PHP. | class Bitmap {
public $data;
public $w;
public $h;
public function __construct($w = 16, $h = 16){
$white = array_fill(0, $w, array(255,255,255));
$this->data = array_fill(0, $h, $white);
$this->w = $w;
$this->h = $h;
}
public function fill($x = 0, $y = 0, $w = null, $h = null, $color = array(0,0,0)){
if (is_null($w)) $w = $this->w;
if (is_null($h)) $h = $this->h;
$w += $x;
$h += $y;
for ($i = $y; $i < $h; $i++){
for ($j = $x; $j < $w; $j++){
$this->setPixel($j, $i, $color);
}
}
}
public function setPixel($x, $y, $color = array(0,0,0)){
if ($x >= $this->w) return false;
if ($x < 0) return false;
if ($y >= $this->h) return false;
if ($y < 0) return false;
$this->data[$y][$x] = $color;
}
public function getPixel($x, $y){
return $this->data[$y][$x];
}
public function writeP6($filename){
$fh = fopen($filename, 'w');
if (!$fh) return false;
fputs($fh, "P6 {$this->w} {$this->h} 255\n");
foreach ($this->data as $row){
foreach($row as $pixel){
fputs($fh, pack('C', $pixel[0]));
fputs($fh, pack('C', $pixel[1]));
fputs($fh, pack('C', $pixel[2]));
}
}
fclose($fh);
}
}
$b = new Bitmap(16,16);
$b->fill();
$b->fill(2, 2, 18, 18, array(240,240,240));
$b->setPixel(0, 15, array(255,0,0));
$b->writeP6('p6.ppm');
| import java.io.BufferedOutputStream;
import java.io.File;
import java.io.FileOutputStream;
import java.io.IOException;
import java.nio.charset.StandardCharsets;
public class PPMWriter {
public void bitmapToPPM(File file, BasicBitmapStorage bitmap) throws IOException {
file.delete();
try (var os = new FileOutputStream(file, true);
var bw = new BufferedOutputStream(os)) {
var header = String.format("P6\n%d %d\n255\n",
bitmap.getWidth(), bitmap.getHeight());
bw.write(header.getBytes(StandardCharsets.US_ASCII));
for (var y = 0; y < bitmap.getHeight(); y++) {
for (var x = 0; x < bitmap.getWidth(); x++) {
var pixel = bitmap.getPixel(x, y);
bw.write(pixel.getRed());
bw.write(pixel.getGreen());
bw.write(pixel.getBlue());
}
}
}
}
}
|
Rewrite the snippet below in Java so it works the same as the original PHP code. | <?php
unlink('input.txt');
unlink('/input.txt');
rmdir('docs');
rmdir('/docs');
?>
| import java.io.File;
public class FileDeleteTest {
public static boolean deleteFile(String filename) {
boolean exists = new File(filename).delete();
return exists;
}
public static void test(String type, String filename) {
System.out.println("The following " + type + " called " + filename +
(deleteFile(filename) ? " was deleted." : " could not be deleted.")
);
}
public static void main(String args[]) {
test("file", "input.txt");
test("file", File.seperator + "input.txt");
test("directory", "docs");
test("directory", File.seperator + "docs" + File.seperator);
}
}
|
Write the same algorithm in Java as shown in this PHP implementation. | <?php
unlink('input.txt');
unlink('/input.txt');
rmdir('docs');
rmdir('/docs');
?>
| import java.io.File;
public class FileDeleteTest {
public static boolean deleteFile(String filename) {
boolean exists = new File(filename).delete();
return exists;
}
public static void test(String type, String filename) {
System.out.println("The following " + type + " called " + filename +
(deleteFile(filename) ? " was deleted." : " could not be deleted.")
);
}
public static void main(String args[]) {
test("file", "input.txt");
test("file", File.seperator + "input.txt");
test("directory", "docs");
test("directory", File.seperator + "docs" + File.seperator);
}
}
|
Write the same algorithm in Java as shown in this PHP implementation. | <?php
$Anerisia = array(31,28,31,30,31,30,31,31,30,31,30,31);
$MONTHS = array("Choas","Discord","Confusion","Bureacracy","The Aftermath");
$DAYS = array("Setting Orange","Sweetmorn","BoomTime","Pungenday","Prickle-Prickle");
$Dsuff = array('th','st','nd','rd','th','th','th','th','th','th');
$Holy5 = array("Mungday","MojoDay","Syaday","Zaraday","Maladay");
$Holy50 = array("Chaoflux","Discoflux","Confuflux","Bureflux","Afflux");
$edate = explode(" ",date('Y m j L'));
$usery = $edate[0];
$userm = $edate[1];
$userd = $edate[2];
$IsLeap = $edate[3];
if (isset($_GET['y']) && isset($_GET['m']) && isset($_GET['d'])) {
$usery = $_GET['y'];
$userm = $_GET['m'];
$userd = $_GET['d'];
$IsLeap = 0;
if (($usery%4 == 0) && ($usery%100 >0)) $IsLeap =1;
if ($usery%400 == 0) $IsLeap = 1;
}
$userdays = 0;
$i = 0;
while ($i < ($userm-1)) {
$userdays = $userdays + $Anerisia[$i];
$i = $i +1;
}
$userdays = $userdays + $userd;
$IsHolyday = 0;
$dyear = $usery + 1166;
$dmonth = $MONTHS[$userdays/73.2];
$dday = $userdays%73;
if (0 == $dday) $dday = 73;
$Dname = $DAYS[$userdays%5];
$Holyday = "St. Tibs Day";
if ($dday == 5) {
$Holyday = $Holy5[$userdays/73.2];
$IsHolyday =1;
}
if ($dday == 50) {
$Holyday = $Holy50[$userdays/73.2];
$IsHolyday =1;
}
if (($IsLeap ==1) && ($userd ==29) and ($userm ==2)) $IsHolyday = 2;
$suff = $Dsuff[$dday%10] ;
if ((11 <= $dday) && (19 >= $dday)) $suff='th';
if ($IsHolyday ==2)
echo "</br>Celeberate ",$Holyday," ",$dmonth," YOLD ",$dyear;
if ($IsHolyday ==1)
echo "</br>Celeberate for today ", $Dname , " The ", $dday,"<sup>",$suff,"</sup>", " day of ", $dmonth , " YOLD " , $dyear , " is the holy day of " , $Holyday;
if ($IsHolyday == 0)
echo "</br>Today is " , $Dname , " the " , $dday ,"<sup>",$suff, "</sup> day of " , $dmonth , " YOLD " , $dyear;
?>
| import java.util.Calendar;
import java.util.GregorianCalendar;
public class DiscordianDate {
final static String[] seasons = {"Chaos", "Discord", "Confusion",
"Bureaucracy", "The Aftermath"};
final static String[] weekday = {"Sweetmorn", "Boomtime", "Pungenday",
"Prickle-Prickle", "Setting Orange"};
final static String[] apostle = {"Mungday", "Mojoday", "Syaday",
"Zaraday", "Maladay"};
final static String[] holiday = {"Chaoflux", "Discoflux", "Confuflux",
"Bureflux", "Afflux"};
public static String discordianDate(final GregorianCalendar date) {
int y = date.get(Calendar.YEAR);
int yold = y + 1166;
int dayOfYear = date.get(Calendar.DAY_OF_YEAR);
if (date.isLeapYear(y)) {
if (dayOfYear == 60)
return "St. Tib's Day, in the YOLD " + yold;
else if (dayOfYear > 60)
dayOfYear--;
}
dayOfYear--;
int seasonDay = dayOfYear % 73 + 1;
if (seasonDay == 5)
return apostle[dayOfYear / 73] + ", in the YOLD " + yold;
if (seasonDay == 50)
return holiday[dayOfYear / 73] + ", in the YOLD " + yold;
String season = seasons[dayOfYear / 73];
String dayOfWeek = weekday[dayOfYear % 5];
return String.format("%s, day %s of %s in the YOLD %s",
dayOfWeek, seasonDay, season, yold);
}
public static void main(String[] args) {
System.out.println(discordianDate(new GregorianCalendar()));
test(2010, 6, 22, "Pungenday, day 57 of Confusion in the YOLD 3176");
test(2012, 1, 28, "Prickle-Prickle, day 59 of Chaos in the YOLD 3178");
test(2012, 1, 29, "St. Tib's Day, in the YOLD 3178");
test(2012, 2, 1, "Setting Orange, day 60 of Chaos in the YOLD 3178");
test(2010, 0, 5, "Mungday, in the YOLD 3176");
test(2011, 4, 3, "Discoflux, in the YOLD 3177");
test(2015, 9, 19, "Boomtime, day 73 of Bureaucracy in the YOLD 3181");
}
private static void test(int y, int m, int d, final String result) {
assert (discordianDate(new GregorianCalendar(y, m, d)).equals(result));
}
}
|
Ensure the translated Java code behaves exactly like the original PHP snippet. | <?php
$Anerisia = array(31,28,31,30,31,30,31,31,30,31,30,31);
$MONTHS = array("Choas","Discord","Confusion","Bureacracy","The Aftermath");
$DAYS = array("Setting Orange","Sweetmorn","BoomTime","Pungenday","Prickle-Prickle");
$Dsuff = array('th','st','nd','rd','th','th','th','th','th','th');
$Holy5 = array("Mungday","MojoDay","Syaday","Zaraday","Maladay");
$Holy50 = array("Chaoflux","Discoflux","Confuflux","Bureflux","Afflux");
$edate = explode(" ",date('Y m j L'));
$usery = $edate[0];
$userm = $edate[1];
$userd = $edate[2];
$IsLeap = $edate[3];
if (isset($_GET['y']) && isset($_GET['m']) && isset($_GET['d'])) {
$usery = $_GET['y'];
$userm = $_GET['m'];
$userd = $_GET['d'];
$IsLeap = 0;
if (($usery%4 == 0) && ($usery%100 >0)) $IsLeap =1;
if ($usery%400 == 0) $IsLeap = 1;
}
$userdays = 0;
$i = 0;
while ($i < ($userm-1)) {
$userdays = $userdays + $Anerisia[$i];
$i = $i +1;
}
$userdays = $userdays + $userd;
$IsHolyday = 0;
$dyear = $usery + 1166;
$dmonth = $MONTHS[$userdays/73.2];
$dday = $userdays%73;
if (0 == $dday) $dday = 73;
$Dname = $DAYS[$userdays%5];
$Holyday = "St. Tibs Day";
if ($dday == 5) {
$Holyday = $Holy5[$userdays/73.2];
$IsHolyday =1;
}
if ($dday == 50) {
$Holyday = $Holy50[$userdays/73.2];
$IsHolyday =1;
}
if (($IsLeap ==1) && ($userd ==29) and ($userm ==2)) $IsHolyday = 2;
$suff = $Dsuff[$dday%10] ;
if ((11 <= $dday) && (19 >= $dday)) $suff='th';
if ($IsHolyday ==2)
echo "</br>Celeberate ",$Holyday," ",$dmonth," YOLD ",$dyear;
if ($IsHolyday ==1)
echo "</br>Celeberate for today ", $Dname , " The ", $dday,"<sup>",$suff,"</sup>", " day of ", $dmonth , " YOLD " , $dyear , " is the holy day of " , $Holyday;
if ($IsHolyday == 0)
echo "</br>Today is " , $Dname , " the " , $dday ,"<sup>",$suff, "</sup> day of " , $dmonth , " YOLD " , $dyear;
?>
| import java.util.Calendar;
import java.util.GregorianCalendar;
public class DiscordianDate {
final static String[] seasons = {"Chaos", "Discord", "Confusion",
"Bureaucracy", "The Aftermath"};
final static String[] weekday = {"Sweetmorn", "Boomtime", "Pungenday",
"Prickle-Prickle", "Setting Orange"};
final static String[] apostle = {"Mungday", "Mojoday", "Syaday",
"Zaraday", "Maladay"};
final static String[] holiday = {"Chaoflux", "Discoflux", "Confuflux",
"Bureflux", "Afflux"};
public static String discordianDate(final GregorianCalendar date) {
int y = date.get(Calendar.YEAR);
int yold = y + 1166;
int dayOfYear = date.get(Calendar.DAY_OF_YEAR);
if (date.isLeapYear(y)) {
if (dayOfYear == 60)
return "St. Tib's Day, in the YOLD " + yold;
else if (dayOfYear > 60)
dayOfYear--;
}
dayOfYear--;
int seasonDay = dayOfYear % 73 + 1;
if (seasonDay == 5)
return apostle[dayOfYear / 73] + ", in the YOLD " + yold;
if (seasonDay == 50)
return holiday[dayOfYear / 73] + ", in the YOLD " + yold;
String season = seasons[dayOfYear / 73];
String dayOfWeek = weekday[dayOfYear % 5];
return String.format("%s, day %s of %s in the YOLD %s",
dayOfWeek, seasonDay, season, yold);
}
public static void main(String[] args) {
System.out.println(discordianDate(new GregorianCalendar()));
test(2010, 6, 22, "Pungenday, day 57 of Confusion in the YOLD 3176");
test(2012, 1, 28, "Prickle-Prickle, day 59 of Chaos in the YOLD 3178");
test(2012, 1, 29, "St. Tib's Day, in the YOLD 3178");
test(2012, 2, 1, "Setting Orange, day 60 of Chaos in the YOLD 3178");
test(2010, 0, 5, "Mungday, in the YOLD 3176");
test(2011, 4, 3, "Discoflux, in the YOLD 3177");
test(2015, 9, 19, "Boomtime, day 73 of Bureaucracy in the YOLD 3181");
}
private static void test(int y, int m, int d, final String result) {
assert (discordianDate(new GregorianCalendar(y, m, d)).equals(result));
}
}
|
Please provide an equivalent version of this PHP code in Java. | <?php
$extra = 'little';
echo "Mary had a $extra lamb.\n";
printf("Mary had a %s lamb.\n", $extra);
?>
| String original = "Mary had a X lamb";
String little = "little";
String replaced = original.replace("X", little);
System.out.println(replaced);
System.out.printf("Mary had a %s lamb.", little);
String formatted = String.format("Mary had a %s lamb.", little);
System.out.println(formatted);
|
Rewrite this program in VB while keeping its functionality equivalent to the C version. | void bitwise(int a, int b)
{
printf("a and b: %d\n", a & b);
printf("a or b: %d\n", a | b);
printf("a xor b: %d\n", a ^ b);
printf("not a: %d\n", ~a);
printf("a << n: %d\n", a << b);
printf("a >> n: %d\n", a >> b);
unsigned int c = a;
printf("c >> b: %d\n", c >> b);
return 0;
}
| Debug.Print Hex(&HF0F0 And &HFF00)
Debug.Print Hex(&HF0F0 Or &HFF00)
Debug.Print Hex(&HF0F0 Xor &HFF00)
Debug.Print Hex(Not &HF0F0)
Debug.Print Hex(&HF0F0 Eqv &HFF00)
Debug.Print Hex(&HF0F0 Imp &HFF00)
|
Write a version of this C function in VB with identical behavior. | #include <stdio.h>
#include <stdlib.h>
#include <string.h>
#include <math.h>
long long x, y, dx, dy, scale, clen;
typedef struct { double r, g, b; } rgb;
rgb ** pix;
void sc_up()
{
long long tmp = dx - dy; dy = dx + dy; dx = tmp;
scale *= 2; x *= 2; y *= 2;
}
void h_rgb(long long x, long long y)
{
rgb *p = &pix[y][x];
# define SAT 1
double h = 6.0 * clen / scale;
double VAL = 1 - (cos(3.141592653579 * 64 * clen / scale) - 1) / 4;
double c = SAT * VAL;
double X = c * (1 - fabs(fmod(h, 2) - 1));
switch((int)h) {
case 0: p->r += c; p->g += X; return;
case 1: p->r += X; p->g += c; return;
case 2: p->g += c; p->b += X; return;
case 3: p->g += X; p->b += c; return;
case 4: p->r += X; p->b += c; return;
default:
p->r += c; p->b += X;
}
}
void iter_string(const char * str, int d)
{
long tmp;
# define LEFT tmp = -dy; dy = dx; dx = tmp
# define RIGHT tmp = dy; dy = -dx; dx = tmp
while (*str != '\0') {
switch(*(str++)) {
case 'X': if (d) iter_string("X+YF+", d - 1); continue;
case 'Y': if (d) iter_string("-FX-Y", d - 1); continue;
case '+': RIGHT; continue;
case '-': LEFT; continue;
case 'F':
clen ++;
h_rgb(x/scale, y/scale);
x += dx; y += dy;
continue;
}
}
}
void dragon(long leng, int depth)
{
long i, d = leng / 3 + 1;
long h = leng + 3, w = leng + d * 3 / 2 + 2;
rgb *buf = malloc(sizeof(rgb) * w * h);
pix = malloc(sizeof(rgb *) * h);
for (i = 0; i < h; i++)
pix[i] = buf + w * i;
memset(buf, 0, sizeof(rgb) * w * h);
x = y = d; dx = leng; dy = 0; scale = 1; clen = 0;
for (i = 0; i < depth; i++) sc_up();
iter_string("FX", depth);
unsigned char *fpix = malloc(w * h * 3);
double maxv = 0, *dbuf = (double*)buf;
for (i = 3 * w * h - 1; i >= 0; i--)
if (dbuf[i] > maxv) maxv = dbuf[i];
for (i = 3 * h * w - 1; i >= 0; i--)
fpix[i] = 255 * dbuf[i] / maxv;
printf("P6\n%ld %ld\n255\n", w, h);
fflush(stdout);
fwrite(fpix, h * w * 3, 1, stdout);
}
int main(int c, char ** v)
{
int size, depth;
depth = (c > 1) ? atoi(v[1]) : 10;
size = 1 << depth;
fprintf(stderr, "size: %d depth: %d\n", size, depth);
dragon(size, depth * 2);
return 0;
}
| option explicit
const pi180= 0.01745329251994329576923690768489
const pi=3.1415926535897932384626433832795
class turtle
dim fso
dim fn
dim svg
dim iang
dim ori
dim incr
dim pdown
dim clr
dim x
dim y
public property let orient(n):ori = n*pi180 :end property
public property let iangle(n):iang= n*pi180 :end property
public sub pd() : pdown=true: end sub
public sub pu() :pdown=FALSE :end sub
public sub rt(i)
ori=ori - i*iang:
end sub
public sub lt(i):
ori=(ori + i*iang)
end sub
public sub bw(l)
x= x+ cos(ori+pi)*l*incr
y= y+ sin(ori+pi)*l*incr
end sub
public sub fw(l)
dim x1,y1
x1=x + cos(ori)*l*incr
y1=y + sin(ori)*l*incr
if pdown then line x,y,x1,y1
x=x1:y=y1
end sub
Private Sub Class_Initialize()
setlocale "us"
initsvg
x=400:y=400:incr=100
ori=90*pi180
iang=90*pi180
clr=0
pdown=true
end sub
Private Sub Class_Terminate()
disply
end sub
private sub line (x,y,x1,y1)
svg.WriteLine "<line x1=""" & x & """ y1= """& y & """ x2=""" & x1& """ y2=""" & y1 & """/>"
end sub
private sub disply()
dim shell
svg.WriteLine "</svg></body></html>"
svg.close
Set shell = CreateObject("Shell.Application")
shell.ShellExecute fn,1,False
end sub
private sub initsvg()
dim scriptpath
Set fso = CreateObject ("Scripting.Filesystemobject")
ScriptPath= Left(WScript.ScriptFullName, InStrRev(WScript.ScriptFullName, "\"))
fn=Scriptpath & "SIERP.HTML"
Set svg = fso.CreateTextFile(fn,True)
if SVG IS nothing then wscript.echo "Can
svg.WriteLine "<!DOCTYPE html>" &vbcrlf & "<html>" &vbcrlf & "<head>"
svg.writeline "<style>" & vbcrlf & "line {stroke:rgb(255,0,0);stroke-width:.5}" &vbcrlf &"</style>"
svg.writeline "</head>"&vbcrlf & "<body>"
svg.WriteLine "<svg xmlns=""http://www.w3.org/2000/svg"" width=""800"" height=""800"" viewBox=""0 0 800 800"">"
end sub
end class
sub dragon(st,le,dir)
if st=0 then x.fw le: exit sub
x.rt dir
dragon st-1, le/1.41421 ,1
x.rt dir*2
dragon st-1, le/1.41421 ,-1
x.rt dir
end sub
dim x
set x=new turtle
x.iangle=45
x.orient=45
x.incr=1
x.x=200:x.y=200
dragon 12,300,1
set x=nothing
|
Write the same code in VB as shown below in C. |
#include <conio.h>
#include <stdio.h>
int main()
{
int n1, n2, n3;
printf( "\n Introduzca el primer n%cmero (entero): ", 163 );
scanf( "%d", &n1 );
printf( "\n Introduzca el segundo n%cmero (entero): ", 163 );
scanf( "%d", &n2 );
printf( "\n Introduzca el tercer n%cmero (entero): ", 163 );
scanf( "%d", &n3 );
if ( n1 >= n2 && n1 >= n3 )
printf( "\n %d es el mayor.", n1 );
else
if ( n2 > n3 )
printf( "\n %d es el mayor.", n2 );
else
printf( "\n %d es el mayor.", n3 );
getch();
return 0;
}
| $Include "Rapidq.inc"
dim file as qfilestream
if file.open("c:\A Test.txt", fmOpenRead) then
while not File.eof
print File.readline
wend
else
print "Cannot read file"
end if
input "Press enter to exit: ";a$
|
Convert this C snippet to VB and keep its semantics consistent. | void insert(link* anchor, link* newlink) {
newlink->next = anchor->next;
newlink->prev = anchor;
(newlink->next)->prev = newlink;
anchor->next = newlink;
}
| Public Sub Insert(ByVal a As Node(Of T), ByVal b As Node(Of T), ByVal c As T)
Dim node As New Node(Of T)(value)
a.Next = node
node.Previous = a
b.Previous = node
node.Next = b
End Sub
|
Can you help me rewrite this code in VB instead of C, keeping it the same logically? | #include <stdio.h>
#include <string.h>
int qselect(int *v, int len, int k)
{
# define SWAP(a, b) { tmp = v[a]; v[a] = v[b]; v[b] = tmp; }
int i, st, tmp;
for (st = i = 0; i < len - 1; i++) {
if (v[i] > v[len-1]) continue;
SWAP(i, st);
st++;
}
SWAP(len-1, st);
return k == st ?v[st]
:st > k ? qselect(v, st, k)
: qselect(v + st, len - st, k - st);
}
int main(void)
{
# define N (sizeof(x)/sizeof(x[0]))
int x[] = {9, 8, 7, 6, 5, 0, 1, 2, 3, 4};
int y[N];
int i;
for (i = 0; i < 10; i++) {
memcpy(y, x, sizeof(x));
printf("%d: %d\n", i, qselect(y, 10, i));
}
return 0;
}
| Dim s As Variant
Private Function quick_select(ByRef s As Variant, k As Integer) As Integer
Dim left As Integer, right As Integer, pos As Integer
Dim pivotValue As Integer, tmp As Integer
left = 1: right = UBound(s)
Do While left < right
pivotValue = s(k)
tmp = s(k)
s(k) = s(right)
s(right) = tmp
pos = left
For i = left To right
If s(i) < pivotValue Then
tmp = s(i)
s(i) = s(pos)
s(pos) = tmp
pos = pos + 1
End If
Next i
tmp = s(right)
s(right) = s(pos)
s(pos) = tmp
If pos = k Then
Exit Do
End If
If pos < k Then
left = pos + 1
Else
right = pos - 1
End If
Loop
quick_select = s(k)
End Function
Public Sub main()
Dim r As Integer, i As Integer
s = [{9, 8, 7, 6, 5, 0, 1, 2, 3, 4}]
For i = 1 To 10
r = quick_select(s, i)
Debug.Print IIf(i < 10, r & ", ", "" & r);
Next i
End Sub
|
Rewrite this program in VB while keeping its functionality equivalent to the C version. | #include <stdlib.h>
#include <string.h>
#include <stdio.h>
#include <stdint.h>
char *to_base(int64_t num, int base)
{
char *tbl = "0123456789abcdefghijklmnopqrstuvwxyz";
char buf[66] = {'\0'};
char *out;
uint64_t n;
int i, len = 0, neg = 0;
if (base > 36) {
fprintf(stderr, "base %d too large\n", base);
return 0;
}
n = ((neg = num < 0)) ? (~num) + 1 : num;
do { buf[len++] = tbl[n % base]; } while(n /= base);
out = malloc(len + neg + 1);
for (i = neg; len > 0; i++) out[i] = buf[--len];
if (neg) out[0] = '-';
return out;
}
long from_base(const char *num_str, int base)
{
char *endptr;
int result = strtol(num_str, &endptr, base);
return result;
}
int main()
{
int64_t x;
x = ~(1LL << 63) + 1;
printf("%lld in base 2: %s\n", x, to_base(x, 2));
x = 383;
printf("%lld in base 16: %s\n", x, to_base(x, 16));
return 0;
}
| Private Function to_base(ByVal number As Long, base As Integer) As String
Dim digits As String, result As String
Dim i As Integer, digit As Integer
digits = "0123456789abcdefghijklmnopqrstuvwxyz"
Do While number > 0
digit = number Mod base
result = Mid(digits, digit + 1, 1) & result
number = number \ base
Loop
to_base = result
End Function
Private Function from_base(number As String, base As Integer) As Long
Dim digits As String, result As Long
Dim i As Integer
digits = "0123456789abcdefghijklmnopqrstuvwxyz"
result = Val(InStr(1, digits, Mid(number, 1, 1), vbTextCompare) - 1)
For i = 2 To Len(number)
result = result * base + Val(InStr(1, digits, Mid(number, i, 1), vbTextCompare) - 1)
Next i
from_base = result
End Function
Public Sub Non_decimal_radices_Convert()
Debug.Print "26 decimal in base 16 is: "; to_base(26, 16); ". Conversely, hexadecimal 1a in decimal is: "; from_base("1a", 16)
End Sub
|
Transform the following C implementation into VB, maintaining the same output and logic. | #include <sys/types.h>
#include <sys/stat.h>
#include <unistd.h>
#include <dirent.h>
#include <regex.h>
#include <stdio.h>
#include <string.h>
#include <errno.h>
#include <err.h>
enum {
WALK_OK = 0,
WALK_BADPATTERN,
WALK_NAMETOOLONG,
WALK_BADIO,
};
#define WS_NONE 0
#define WS_RECURSIVE (1 << 0)
#define WS_DEFAULT WS_RECURSIVE
#define WS_FOLLOWLINK (1 << 1)
#define WS_DOTFILES (1 << 2)
#define WS_MATCHDIRS (1 << 3)
int walk_recur(char *dname, regex_t *reg, int spec)
{
struct dirent *dent;
DIR *dir;
struct stat st;
char fn[FILENAME_MAX];
int res = WALK_OK;
int len = strlen(dname);
if (len >= FILENAME_MAX - 1)
return WALK_NAMETOOLONG;
strcpy(fn, dname);
fn[len++] = '/';
if (!(dir = opendir(dname))) {
warn("can't open %s", dname);
return WALK_BADIO;
}
errno = 0;
while ((dent = readdir(dir))) {
if (!(spec & WS_DOTFILES) && dent->d_name[0] == '.')
continue;
if (!strcmp(dent->d_name, ".") || !strcmp(dent->d_name, ".."))
continue;
strncpy(fn + len, dent->d_name, FILENAME_MAX - len);
if (lstat(fn, &st) == -1) {
warn("Can't stat %s", fn);
res = WALK_BADIO;
continue;
}
if (S_ISLNK(st.st_mode) && !(spec & WS_FOLLOWLINK))
continue;
if (S_ISDIR(st.st_mode)) {
if ((spec & WS_RECURSIVE))
walk_recur(fn, reg, spec);
if (!(spec & WS_MATCHDIRS)) continue;
}
if (!regexec(reg, fn, 0, 0, 0)) puts(fn);
}
if (dir) closedir(dir);
return res ? res : errno ? WALK_BADIO : WALK_OK;
}
int walk_dir(char *dname, char *pattern, int spec)
{
regex_t r;
int res;
if (regcomp(&r, pattern, REG_EXTENDED | REG_NOSUB))
return WALK_BADPATTERN;
res = walk_recur(dname, &r, spec);
regfree(&r);
return res;
}
int main()
{
int r = walk_dir(".", ".\\.c$", WS_DEFAULT|WS_MATCHDIRS);
switch(r) {
case WALK_OK: break;
case WALK_BADIO: err(1, "IO error");
case WALK_BADPATTERN: err(1, "Bad pattern");
case WALK_NAMETOOLONG: err(1, "Filename too long");
default:
err(1, "Unknown error?");
}
return 0;
}
| Sub printFiles(parentDir As FolderItem, pattern As String)
For i As Integer = 1 To parentDir.Count
If parentDir.Item(i).Directory Then
printFiles(parentDir.Item(i), pattern)
Else
Dim rg as New RegEx
Dim myMatch as RegExMatch
rg.SearchPattern = pattern
myMatch = rg.search(parentDir.Item(i).Name)
If myMatch <> Nil Then Print(parentDir.Item(i).AbsolutePath)
End If
Next
End Sub
|
Change the programming language of this snippet from C to VB without modifying what it does. | #include <stdio.h>
#include <string.h>
#include <zlib.h>
int main()
{
const char *s = "The quick brown fox jumps over the lazy dog";
printf("%lX\n", crc32(0, (const void*)s, strlen(s)));
return 0;
}
| dim crctbl(255)
const crcc =&hEDB88320
sub gencrctable
for i= 0 to 255
k=i
for j=1 to 8
if k and 1 then
k=(k and &h7fffffff)\2 or (&h40000000 and ((k and &h80000000)<>0))
k=k xor crcc
else
k=(k and &h7fffffff)\2 or (&h40000000 and ((k and &h80000000)<>0))
end if
next
crctbl(i)=k
next
end sub
function crc32 (buf)
dim r,r1,i
r=&hffffffff
for i=1 to len(buf)
r1=(r and &h7fffffff)\&h100 or (&h800000 and (r and &h80000000)<>0)
r=r1 xor crctbl((asc(mid(buf,i,1))xor r) and 255)
next
crc32=r xor &hffffffff
end function
gencrctable
wscript.stdout.writeline hex(crc32("The quick brown fox jumps over the lazy dog"))
|
Convert this C block to VB, preserving its control flow and logic. | #include <stdio.h>
const char *input =
"Character,Speech\n"
"The multitude,The messiah! Show us the messiah!\n"
"Brians mother,<angry>Now you listen here! He's not the messiah; "
"he's a very naughty boy! Now go away!</angry>\n"
"The multitude,Who are you?\n"
"Brians mother,I'm his mother; that's who!\n"
"The multitude,Behold his mother! Behold his mother!";
int main()
{
const char *s;
printf("<table>\n<tr><td>");
for (s = input; *s; s++) {
switch(*s) {
case '\n': printf("</td></tr>\n<tr><td>"); break;
case ',': printf("</td><td>"); break;
case '<': printf("<"); break;
case '>': printf(">"); break;
case '&': printf("&"); break;
default: putchar(*s);
}
}
puts("</td></tr>\n</table>");
return 0;
}
| Public Sub CSV_TO_HTML()
input_ = "Character,Speech\n" & _
"The multitude,The messiah! Show us the messiah!\n" & _
"Brians mother,<angry>Now you listen here! He
"he
"The multitude,Who are you?\n" & _
"Brians mother,I
"The multitude,Behold his mother! Behold his mother!"
Debug.Print "<table>" & vbCrLf & "<tr><td>"
For i = 1 To Len(input_)
Select Case Mid(input_, i, 1)
Case "\"
If Mid(input_, i + 1, 1) = "n" Then
Debug.Print "</td></tr>" & vbCrLf & "<tr><td>";
i = i + 1
Else
Debug.Print Mid(input_, i, 1);
End If
Case ",": Debug.Print "</td><td>";
Case "<": Debug.Print "<";
Case ">": Debug.Print ">";
Case "&": Debug.Print "&";
Case Else: Debug.Print Mid(input_, i, 1);
End Select
Next i
Debug.Print "</td></tr>" & vbCrLf & "</table>"
End Sub
|
Write the same code in VB as shown below in C. | #include <stdio.h>
const char *input =
"Character,Speech\n"
"The multitude,The messiah! Show us the messiah!\n"
"Brians mother,<angry>Now you listen here! He's not the messiah; "
"he's a very naughty boy! Now go away!</angry>\n"
"The multitude,Who are you?\n"
"Brians mother,I'm his mother; that's who!\n"
"The multitude,Behold his mother! Behold his mother!";
int main()
{
const char *s;
printf("<table>\n<tr><td>");
for (s = input; *s; s++) {
switch(*s) {
case '\n': printf("</td></tr>\n<tr><td>"); break;
case ',': printf("</td><td>"); break;
case '<': printf("<"); break;
case '>': printf(">"); break;
case '&': printf("&"); break;
default: putchar(*s);
}
}
puts("</td></tr>\n</table>");
return 0;
}
| Public Sub CSV_TO_HTML()
input_ = "Character,Speech\n" & _
"The multitude,The messiah! Show us the messiah!\n" & _
"Brians mother,<angry>Now you listen here! He
"he
"The multitude,Who are you?\n" & _
"Brians mother,I
"The multitude,Behold his mother! Behold his mother!"
Debug.Print "<table>" & vbCrLf & "<tr><td>"
For i = 1 To Len(input_)
Select Case Mid(input_, i, 1)
Case "\"
If Mid(input_, i + 1, 1) = "n" Then
Debug.Print "</td></tr>" & vbCrLf & "<tr><td>";
i = i + 1
Else
Debug.Print Mid(input_, i, 1);
End If
Case ",": Debug.Print "</td><td>";
Case "<": Debug.Print "<";
Case ">": Debug.Print ">";
Case "&": Debug.Print "&";
Case Else: Debug.Print Mid(input_, i, 1);
End Select
Next i
Debug.Print "</td></tr>" & vbCrLf & "</table>"
End Sub
|
Transform the following C implementation into VB, maintaining the same output and logic. | #include <stdlib.h>
typedef struct sMyClass
{
int variable;
} *MyClass;
MyClass MyClass_new()
{
MyClass pthis = malloc(sizeof *pthis);
pthis->variable = 0;
return pthis;
}
void MyClass_delete(MyClass* pthis)
{
if (pthis)
{
free(*pthis);
*pthis = NULL;
}
}
void MyClass_someMethod(MyClass pthis)
{
pthis->variable = 1;
}
MyClass obj = MyClass_new();
MyClass_someMethod(obj);
MyClass_delete(&obj);
| Class NumberContainer
Private TheNumber As Integer
Sub Constructor(InitialNumber As Integer)
TheNumber = InitialNumber
End Sub
Function Number() As Integer
Return TheNumber
End Function
Sub Number(Assigns NewNumber As Integer)
TheNumber = NewNumber
End Sub
End Class
|
Port the provided C code into VB while preserving the original functionality. | #include <stdio.h>
#include <stdint.h>
typedef uint64_t ulong;
int kaprekar(ulong n, int base)
{
ulong nn = n * n, r, tens = 1;
if ((nn - n) % (base - 1)) return 0;
while (tens < n) tens *= base;
if (n == tens) return 1 == n;
while ((r = nn % tens) < n) {
if (nn / tens + r == n) return tens;
tens *= base;
}
return 0;
}
void print_num(ulong n, int base)
{
ulong q, div = base;
while (div < n) div *= base;
while (n && (div /= base)) {
q = n / div;
if (q < 10) putchar(q + '0');
else putchar(q + 'a' - 10);
n -= q * div;
}
}
int main()
{
ulong i, tens;
int cnt = 0;
int base = 10;
printf("base 10:\n");
for (i = 1; i < 1000000; i++)
if (kaprekar(i, base))
printf("%3d: %llu\n", ++cnt, i);
base = 17;
printf("\nbase %d:\n 1: 1\n", base);
for (i = 2, cnt = 1; i < 1000000; i++)
if ((tens = kaprekar(i, base))) {
printf("%3d: %llu", ++cnt, i);
printf(" \t"); print_num(i, base);
printf("\t"); print_num(i * i, base);
printf("\t"); print_num(i * i / tens, base);
printf(" + "); print_num(i * i % tens, base);
printf("\n");
}
return 0;
}
| Module Module1
ReadOnly max As ULong = 1000000
Function Kaprekar(n As ULong) As Boolean
If n = 1 Then Return True
Dim sq = n * n
Dim sq_str = Str(sq)
Dim l = Len(sq_str)
For x = l - 1 To 1 Step -1
If sq_str(x) = "0" Then
l = l - 1
Else
Exit For
End If
Next
For x = 1 To l - 1
Dim p2 = Val(Mid(sq_str, x + 1))
If p2 > n Then
Continue For
End If
Dim p1 = Val(Left(sq_str, x))
If p1 > n Then Return False
If (p1 + p2) = n Then Return True
Next
Return False
End Function
Sub Main()
Dim count = 0
Console.WriteLine("Kaprekar numbers below 10000")
For n = 1 To max - 1
If Kaprekar(n) Then
count = count + 1
If n < 10000 Then
Console.WriteLine("{0,2} {1,4}", count, n)
End If
End If
Next
Console.WriteLine()
Console.WriteLine("{0} numbers below {1} are kaprekar numbers", count, max)
End Sub
End Module
|
Change the following C code into VB without altering its purpose. | #include <stdio.h>
#include <stdint.h>
typedef uint64_t ulong;
int kaprekar(ulong n, int base)
{
ulong nn = n * n, r, tens = 1;
if ((nn - n) % (base - 1)) return 0;
while (tens < n) tens *= base;
if (n == tens) return 1 == n;
while ((r = nn % tens) < n) {
if (nn / tens + r == n) return tens;
tens *= base;
}
return 0;
}
void print_num(ulong n, int base)
{
ulong q, div = base;
while (div < n) div *= base;
while (n && (div /= base)) {
q = n / div;
if (q < 10) putchar(q + '0');
else putchar(q + 'a' - 10);
n -= q * div;
}
}
int main()
{
ulong i, tens;
int cnt = 0;
int base = 10;
printf("base 10:\n");
for (i = 1; i < 1000000; i++)
if (kaprekar(i, base))
printf("%3d: %llu\n", ++cnt, i);
base = 17;
printf("\nbase %d:\n 1: 1\n", base);
for (i = 2, cnt = 1; i < 1000000; i++)
if ((tens = kaprekar(i, base))) {
printf("%3d: %llu", ++cnt, i);
printf(" \t"); print_num(i, base);
printf("\t"); print_num(i * i, base);
printf("\t"); print_num(i * i / tens, base);
printf(" + "); print_num(i * i % tens, base);
printf("\n");
}
return 0;
}
| Module Module1
ReadOnly max As ULong = 1000000
Function Kaprekar(n As ULong) As Boolean
If n = 1 Then Return True
Dim sq = n * n
Dim sq_str = Str(sq)
Dim l = Len(sq_str)
For x = l - 1 To 1 Step -1
If sq_str(x) = "0" Then
l = l - 1
Else
Exit For
End If
Next
For x = 1 To l - 1
Dim p2 = Val(Mid(sq_str, x + 1))
If p2 > n Then
Continue For
End If
Dim p1 = Val(Left(sq_str, x))
If p1 > n Then Return False
If (p1 + p2) = n Then Return True
Next
Return False
End Function
Sub Main()
Dim count = 0
Console.WriteLine("Kaprekar numbers below 10000")
For n = 1 To max - 1
If Kaprekar(n) Then
count = count + 1
If n < 10000 Then
Console.WriteLine("{0,2} {1,4}", count, n)
End If
End If
Next
Console.WriteLine()
Console.WriteLine("{0} numbers below {1} are kaprekar numbers", count, max)
End Sub
End Module
|
Generate a VB translation of this C snippet without changing its computational steps. | #include <stdio.h>
#include <stdint.h>
typedef uint64_t ulong;
int kaprekar(ulong n, int base)
{
ulong nn = n * n, r, tens = 1;
if ((nn - n) % (base - 1)) return 0;
while (tens < n) tens *= base;
if (n == tens) return 1 == n;
while ((r = nn % tens) < n) {
if (nn / tens + r == n) return tens;
tens *= base;
}
return 0;
}
void print_num(ulong n, int base)
{
ulong q, div = base;
while (div < n) div *= base;
while (n && (div /= base)) {
q = n / div;
if (q < 10) putchar(q + '0');
else putchar(q + 'a' - 10);
n -= q * div;
}
}
int main()
{
ulong i, tens;
int cnt = 0;
int base = 10;
printf("base 10:\n");
for (i = 1; i < 1000000; i++)
if (kaprekar(i, base))
printf("%3d: %llu\n", ++cnt, i);
base = 17;
printf("\nbase %d:\n 1: 1\n", base);
for (i = 2, cnt = 1; i < 1000000; i++)
if ((tens = kaprekar(i, base))) {
printf("%3d: %llu", ++cnt, i);
printf(" \t"); print_num(i, base);
printf("\t"); print_num(i * i, base);
printf("\t"); print_num(i * i / tens, base);
printf(" + "); print_num(i * i % tens, base);
printf("\n");
}
return 0;
}
| Module Module1
ReadOnly max As ULong = 1000000
Function Kaprekar(n As ULong) As Boolean
If n = 1 Then Return True
Dim sq = n * n
Dim sq_str = Str(sq)
Dim l = Len(sq_str)
For x = l - 1 To 1 Step -1
If sq_str(x) = "0" Then
l = l - 1
Else
Exit For
End If
Next
For x = 1 To l - 1
Dim p2 = Val(Mid(sq_str, x + 1))
If p2 > n Then
Continue For
End If
Dim p1 = Val(Left(sq_str, x))
If p1 > n Then Return False
If (p1 + p2) = n Then Return True
Next
Return False
End Function
Sub Main()
Dim count = 0
Console.WriteLine("Kaprekar numbers below 10000")
For n = 1 To max - 1
If Kaprekar(n) Then
count = count + 1
If n < 10000 Then
Console.WriteLine("{0,2} {1,4}", count, n)
End If
End If
Next
Console.WriteLine()
Console.WriteLine("{0} numbers below {1} are kaprekar numbers", count, max)
End Sub
End Module
|
Preserve the algorithm and functionality while converting the code from C to VB. | #include <stdio.h>
#include <stdlib.h>
#include <string.h>
#include <stdint.h>
#include <unistd.h>
#include <fcntl.h>
#include <sys/types.h>
#include <sys/stat.h>
void* mem_alloc(size_t item_size, size_t n_item)
{
size_t *x = calloc(1, sizeof(size_t)*2 + n_item * item_size);
x[0] = item_size;
x[1] = n_item;
return x + 2;
}
void* mem_extend(void *m, size_t new_n)
{
size_t *x = (size_t*)m - 2;
x = realloc(x, sizeof(size_t) * 2 + *x * new_n);
if (new_n > x[1])
memset((char*)(x + 2) + x[0] * x[1], 0, x[0] * (new_n - x[1]));
x[1] = new_n;
return x + 2;
}
inline void _clear(void *m)
{
size_t *x = (size_t*)m - 2;
memset(m, 0, x[0] * x[1]);
}
#define _new(type, n) mem_alloc(sizeof(type), n)
#define _del(m) { free((size_t*)(m) - 2); m = 0; }
#define _len(m) *((size_t*)m - 1)
#define _setsize(m, n) m = mem_extend(m, n)
#define _extend(m) m = mem_extend(m, _len(m) * 2)
typedef uint8_t byte;
typedef uint16_t ushort;
#define M_CLR 256
#define M_EOD 257
#define M_NEW 258
typedef struct {
ushort next[256];
} lzw_enc_t;
typedef struct {
ushort prev, back;
byte c;
} lzw_dec_t;
byte* lzw_encode(byte *in, int max_bits)
{
int len = _len(in), bits = 9, next_shift = 512;
ushort code, c, nc, next_code = M_NEW;
lzw_enc_t *d = _new(lzw_enc_t, 512);
if (max_bits > 15) max_bits = 15;
if (max_bits < 9 ) max_bits = 12;
byte *out = _new(ushort, 4);
int out_len = 0, o_bits = 0;
uint32_t tmp = 0;
inline void write_bits(ushort x) {
tmp = (tmp << bits) | x;
o_bits += bits;
if (_len(out) <= out_len) _extend(out);
while (o_bits >= 8) {
o_bits -= 8;
out[out_len++] = tmp >> o_bits;
tmp &= (1 << o_bits) - 1;
}
}
for (code = *(in++); --len; ) {
c = *(in++);
if ((nc = d[code].next[c]))
code = nc;
else {
write_bits(code);
nc = d[code].next[c] = next_code++;
code = c;
}
if (next_code == next_shift) {
if (++bits > max_bits) {
write_bits(M_CLR);
bits = 9;
next_shift = 512;
next_code = M_NEW;
_clear(d);
} else
_setsize(d, next_shift *= 2);
}
}
write_bits(code);
write_bits(M_EOD);
if (tmp) write_bits(tmp);
_del(d);
_setsize(out, out_len);
return out;
}
byte* lzw_decode(byte *in)
{
byte *out = _new(byte, 4);
int out_len = 0;
inline void write_out(byte c)
{
while (out_len >= _len(out)) _extend(out);
out[out_len++] = c;
}
lzw_dec_t *d = _new(lzw_dec_t, 512);
int len, j, next_shift = 512, bits = 9, n_bits = 0;
ushort code, c, t, next_code = M_NEW;
uint32_t tmp = 0;
inline void get_code() {
while(n_bits < bits) {
if (len > 0) {
len --;
tmp = (tmp << 8) | *(in++);
n_bits += 8;
} else {
tmp = tmp << (bits - n_bits);
n_bits = bits;
}
}
n_bits -= bits;
code = tmp >> n_bits;
tmp &= (1 << n_bits) - 1;
}
inline void clear_table() {
_clear(d);
for (j = 0; j < 256; j++) d[j].c = j;
next_code = M_NEW;
next_shift = 512;
bits = 9;
};
clear_table();
for (len = _len(in); len;) {
get_code();
if (code == M_EOD) break;
if (code == M_CLR) {
clear_table();
continue;
}
if (code >= next_code) {
fprintf(stderr, "Bad sequence\n");
_del(out);
goto bail;
}
d[next_code].prev = c = code;
while (c > 255) {
t = d[c].prev; d[t].back = c; c = t;
}
d[next_code - 1].c = c;
while (d[c].back) {
write_out(d[c].c);
t = d[c].back; d[c].back = 0; c = t;
}
write_out(d[c].c);
if (++next_code >= next_shift) {
if (++bits > 16) {
fprintf(stderr, "Too many bits\n");
_del(out);
goto bail;
}
_setsize(d, next_shift *= 2);
}
}
if (code != M_EOD) fputs("Bits did not end in EOD\n", stderr);
_setsize(out, out_len);
bail: _del(d);
return out;
}
int main()
{
int i, fd = open("unixdict.txt", O_RDONLY);
if (fd == -1) {
fprintf(stderr, "Can't read file\n");
return 1;
};
struct stat st;
fstat(fd, &st);
byte *in = _new(char, st.st_size);
read(fd, in, st.st_size);
_setsize(in, st.st_size);
close(fd);
printf("input size: %d\n", _len(in));
byte *enc = lzw_encode(in, 9);
printf("encoded size: %d\n", _len(enc));
byte *dec = lzw_decode(enc);
printf("decoded size: %d\n", _len(dec));
for (i = 0; i < _len(dec); i++)
if (dec[i] != in[i]) {
printf("bad decode at %d\n", i);
break;
}
if (i == _len(dec)) printf("Decoded ok\n");
_del(in);
_del(enc);
_del(dec);
return 0;
}
| Option Explicit
Const numchars=127
Function LZWCompress(si)
Dim oDict, intMaxCode, i,z,ii,ss,strCurrent,strNext,j
Set oDict = CreateObject("Scripting.Dictionary")
ReDim a(Len(si))
intMaxCode = numchars
For i = 0 To numchars
oDict.Add Chr(i), i
Next
strCurrent = Left(si,1)
j=0
For ii=2 To Len(si)
strNext = Mid(si,ii,1)
ss=strCurrent & strNext
If oDict.Exists(ss) Then
strCurrent = ss
Else
a(j)=oDict.Item(strCurrent) :j=j+1
intMaxCode = intMaxCode + 1
oDict.Add ss, intMaxCode
strCurrent = strNext
End If
Next
a(j)=oDict.Item(strCurrent)
ReDim preserve a(j)
LZWCompress=a
Set oDict = Nothing
End Function
Function lzwUncompress(sc)
Dim intNext, intCurrent, intMaxCode, i,ss,istr,s,j
s=""
reDim dict(1000)
intMaxCode = numchars
For i = 0 To numchars : dict(i)= Chr(i) : Next
intCurrent=sc(0)
For j=1 To UBound(sc)
ss=dict(intCurrent)
s= s & ss
intMaxCode = intMaxCode + 1
intnext=sc(j)
If intNext<intMaxCode Then
dict(intMaxCode)=ss & Left(dict(intNext), 1)
Else
dict(intMaxCode)=ss & Left(ss, 1)
End If
intCurrent = intNext
Next
s= s & dict(intCurrent)
lzwUncompress=s
End function
Sub printvec(a)
Dim s,i,x
s="("
For i=0 To UBound (a)
s=s & x & a(i)
x=", "
Next
WScript.echo s &")"
End sub
Dim a,b
b="TOBEORNOTTOBEORTOBEORNOT"
WScript.Echo b
a=LZWCompress (b)
printvec(a)
WScript.echo lzwUncompress (a )
wscript.quit 1
|
Rewrite the snippet below in VB so it works the same as the original C code. | #include <stdio.h>
#include <stdlib.h>
typedef unsigned long long xint;
typedef struct {
size_t len, alloc;
xint *buf;
} xarray;
xarray rs, ss;
void setsize(xarray *a, size_t size)
{
size_t n = a->alloc;
if (!n) n = 1;
while (n < size) n <<= 1;
if (a->alloc < n) {
a->buf = realloc(a->buf, sizeof(xint) * n);
if (!a->buf) abort();
a->alloc = n;
}
}
void push(xarray *a, xint v)
{
while (a->alloc <= a->len)
setsize(a, a->alloc * 2);
a->buf[a->len++] = v;
}
void RS_append(void);
xint R(int n)
{
while (n > rs.len) RS_append();
return rs.buf[n - 1];
}
xint S(int n)
{
while (n > ss.len) RS_append();
return ss.buf[n - 1];
}
void RS_append()
{
int n = rs.len;
xint r = R(n) + S(n);
xint s = S(ss.len);
push(&rs, r);
while (++s < r) push(&ss, s);
push(&ss, r + 1);
}
int main(void)
{
push(&rs, 1);
push(&ss, 2);
int i;
printf("R(1 .. 10):");
for (i = 1; i <= 10; i++)
printf(" %llu", R(i));
char seen[1001] = { 0 };
for (i = 1; i <= 40; i++) seen[ R(i) ] = 1;
for (i = 1; i <= 960; i++) seen[ S(i) ] = 1;
for (i = 1; i <= 1000 && seen[i]; i++);
if (i <= 1000) {
fprintf(stderr, "%d not seen\n", i);
abort();
}
puts("\nfirst 1000 ok");
return 0;
}
| Private Function ffr(n As Long) As Long
Dim R As New Collection
Dim S As New Collection
R.Add 1
S.Add 2
For i = 2 To n
R.Add R(i - 1) + S(i - 1)
For j = S(S.Count) + 1 To R(i) - 1
S.Add j
Next j
For j = R(i) + 1 To R(i) + S(i - 1)
S.Add j
Next j
Next i
ffr = R(n)
Set R = Nothing
Set S = Nothing
End Function
Private Function ffs(n As Long) As Long
Dim R As New Collection
Dim S As New Collection
R.Add 1
S.Add 2
For i = 2 To n
R.Add R(i - 1) + S(i - 1)
For j = S(S.Count) + 1 To R(i) - 1
S.Add j
Next j
For j = R(i) + 1 To R(i) + S(i - 1)
S.Add j
Next j
If S.Count >= n Then Exit For
Next i
ffs = S(n)
Set R = Nothing
Set S = Nothing
End Function
Public Sub main()
Dim i As Long
Debug.Print "The first ten values of R are:"
For i = 1 To 10
Debug.Print ffr(i);
Next i
Debug.Print
Dim x As New Collection
For i = 1 To 1000
x.Add i, CStr(i)
Next i
For i = 1 To 40
x.Remove CStr(ffr(i))
Next i
For i = 1 To 960
x.Remove CStr(ffs(i))
Next i
Debug.Print "The first 40 values of ffr plus the first 960 values of ffs "
Debug.Print "include all the integers from 1 to 1000 exactly once is "; Format(x.Count = 0)
End Sub
|
Change the following C code into VB without altering its purpose. | #include <stdio.h>
#include <stdlib.h>
typedef unsigned long long xint;
typedef struct {
size_t len, alloc;
xint *buf;
} xarray;
xarray rs, ss;
void setsize(xarray *a, size_t size)
{
size_t n = a->alloc;
if (!n) n = 1;
while (n < size) n <<= 1;
if (a->alloc < n) {
a->buf = realloc(a->buf, sizeof(xint) * n);
if (!a->buf) abort();
a->alloc = n;
}
}
void push(xarray *a, xint v)
{
while (a->alloc <= a->len)
setsize(a, a->alloc * 2);
a->buf[a->len++] = v;
}
void RS_append(void);
xint R(int n)
{
while (n > rs.len) RS_append();
return rs.buf[n - 1];
}
xint S(int n)
{
while (n > ss.len) RS_append();
return ss.buf[n - 1];
}
void RS_append()
{
int n = rs.len;
xint r = R(n) + S(n);
xint s = S(ss.len);
push(&rs, r);
while (++s < r) push(&ss, s);
push(&ss, r + 1);
}
int main(void)
{
push(&rs, 1);
push(&ss, 2);
int i;
printf("R(1 .. 10):");
for (i = 1; i <= 10; i++)
printf(" %llu", R(i));
char seen[1001] = { 0 };
for (i = 1; i <= 40; i++) seen[ R(i) ] = 1;
for (i = 1; i <= 960; i++) seen[ S(i) ] = 1;
for (i = 1; i <= 1000 && seen[i]; i++);
if (i <= 1000) {
fprintf(stderr, "%d not seen\n", i);
abort();
}
puts("\nfirst 1000 ok");
return 0;
}
| Private Function ffr(n As Long) As Long
Dim R As New Collection
Dim S As New Collection
R.Add 1
S.Add 2
For i = 2 To n
R.Add R(i - 1) + S(i - 1)
For j = S(S.Count) + 1 To R(i) - 1
S.Add j
Next j
For j = R(i) + 1 To R(i) + S(i - 1)
S.Add j
Next j
Next i
ffr = R(n)
Set R = Nothing
Set S = Nothing
End Function
Private Function ffs(n As Long) As Long
Dim R As New Collection
Dim S As New Collection
R.Add 1
S.Add 2
For i = 2 To n
R.Add R(i - 1) + S(i - 1)
For j = S(S.Count) + 1 To R(i) - 1
S.Add j
Next j
For j = R(i) + 1 To R(i) + S(i - 1)
S.Add j
Next j
If S.Count >= n Then Exit For
Next i
ffs = S(n)
Set R = Nothing
Set S = Nothing
End Function
Public Sub main()
Dim i As Long
Debug.Print "The first ten values of R are:"
For i = 1 To 10
Debug.Print ffr(i);
Next i
Debug.Print
Dim x As New Collection
For i = 1 To 1000
x.Add i, CStr(i)
Next i
For i = 1 To 40
x.Remove CStr(ffr(i))
Next i
For i = 1 To 960
x.Remove CStr(ffs(i))
Next i
Debug.Print "The first 40 values of ffr plus the first 960 values of ffs "
Debug.Print "include all the integers from 1 to 1000 exactly once is "; Format(x.Count = 0)
End Sub
|
Convert this C block to VB, preserving its control flow and logic. | #include <stdio.h>
#include <stdlib.h>
int f(int n, int x, int y)
{
return (x + y*2 + 1)%n;
}
int main(int argc, char **argv)
{
int i, j, n;
if(argc!=2) return 1;
n = atoi(argv[1]);
if (n < 3 || (n%2) == 0) return 2;
for (i = 0; i < n; i++) {
for (j = 0; j < n; j++)
printf("% 4d", f(n, n - j - 1, i)*n + f(n, j, i) + 1);
putchar('\n');
}
printf("\n Magic Constant: %d.\n", (n*n+1)/2*n);
return 0;
}
| Sub magicsquare()
Const n = 9
Dim i As Integer, j As Integer, v As Integer
Debug.Print "The square order is: " & n
For i = 1 To n
For j = 1 To n
Cells(i, j) = ((i * 2 - j + n - 1) Mod n) * n + ((i * 2 + j - 2) Mod n) + 1
Next j
Next i
Debug.Print "The magic number of"; n; "x"; n; "square is:"; n * (n * n + 1) \ 2
End Sub
|
Write a version of this C function in VB with identical behavior. | #include <stdio.h>
#include <stdlib.h>
int f(int n, int x, int y)
{
return (x + y*2 + 1)%n;
}
int main(int argc, char **argv)
{
int i, j, n;
if(argc!=2) return 1;
n = atoi(argv[1]);
if (n < 3 || (n%2) == 0) return 2;
for (i = 0; i < n; i++) {
for (j = 0; j < n; j++)
printf("% 4d", f(n, n - j - 1, i)*n + f(n, j, i) + 1);
putchar('\n');
}
printf("\n Magic Constant: %d.\n", (n*n+1)/2*n);
return 0;
}
| Sub magicsquare()
Const n = 9
Dim i As Integer, j As Integer, v As Integer
Debug.Print "The square order is: " & n
For i = 1 To n
For j = 1 To n
Cells(i, j) = ((i * 2 - j + n - 1) Mod n) * n + ((i * 2 + j - 2) Mod n) + 1
Next j
Next i
Debug.Print "The magic number of"; n; "x"; n; "square is:"; n * (n * n + 1) \ 2
End Sub
|
Transform the following C implementation into VB, maintaining the same output and logic. | #include <stdio.h>
#include <stdlib.h>
#include <math.h>
float *benford_distribution(void)
{
static float prob[9];
for (int i = 1; i < 10; i++)
prob[i - 1] = log10f(1 + 1.0 / i);
return prob;
}
float *get_actual_distribution(char *fn)
{
FILE *input = fopen(fn, "r");
if (!input)
{
perror("Can't open file");
exit(EXIT_FAILURE);
}
int tally[9] = { 0 };
char c;
int total = 0;
while ((c = getc(input)) != EOF)
{
while (c < '1' || c > '9')
c = getc(input);
tally[c - '1']++;
total++;
while ((c = getc(input)) != '\n' && c != EOF)
;
}
fclose(input);
static float freq[9];
for (int i = 0; i < 9; i++)
freq[i] = tally[i] / (float) total;
return freq;
}
int main(int argc, char **argv)
{
if (argc != 2)
{
printf("Usage: benford <file>\n");
return EXIT_FAILURE;
}
float *actual = get_actual_distribution(argv[1]);
float *expected = benford_distribution();
puts("digit\tactual\texpected");
for (int i = 0; i < 9; i++)
printf("%d\t%.3f\t%.3f\n", i + 1, actual[i], expected[i]);
return EXIT_SUCCESS;
}
| Sub BenfordLaw()
Dim BenResult(1 To 9) As Long
BENref = "30,1%|17,6%|12,5%|9,7%|7,9%|6,7%|5,8%|5,1%|4,6%"
For Each c In Selection.Cells
If InStr(1, "-0123456789", Left(c, 1)) > 0 Then
For i = 1 To 9
If CInt(Left(Abs(c), 1)) = i Then BenResult(i) = BenResult(i) + 1: Exit For
Next
End If
Next
Total= Application.Sum(BenResult)
biggest= Len(CStr(BenResult(1)))
txt = "# | Values | Real | Expected " & vbCrLf
For i = 1 To 9
If BenResult(i) > 0 Then
txt = txt & "#" & i & " | " & vbTab
txt = txt & String((biggest - Len(CStr(BenResult(i)))) * 2, " ") & Format(BenResult(i), "0") & " | " & vbTab
txt = txt & String((Len(CStr(Format(BenResult(1) / Total, "##0.0%"))) - Len(CStr(Format(BenResult(i) / Total, "##0.0%")))) * 2, " ") & Format(BenResult(i) / Total, "##0.0%") & " | " & vbTab
txt = txt & Format(Split(BENref, "|")(i - 1), " ##0.0%") & vbCrLf
End If
Next
MsgBox txt, vbOKOnly, "Finish"
End Sub
}
|
Write the same code in VB as shown below in C. | #include <stdio.h>
#include <stdlib.h>
#include <math.h>
float *benford_distribution(void)
{
static float prob[9];
for (int i = 1; i < 10; i++)
prob[i - 1] = log10f(1 + 1.0 / i);
return prob;
}
float *get_actual_distribution(char *fn)
{
FILE *input = fopen(fn, "r");
if (!input)
{
perror("Can't open file");
exit(EXIT_FAILURE);
}
int tally[9] = { 0 };
char c;
int total = 0;
while ((c = getc(input)) != EOF)
{
while (c < '1' || c > '9')
c = getc(input);
tally[c - '1']++;
total++;
while ((c = getc(input)) != '\n' && c != EOF)
;
}
fclose(input);
static float freq[9];
for (int i = 0; i < 9; i++)
freq[i] = tally[i] / (float) total;
return freq;
}
int main(int argc, char **argv)
{
if (argc != 2)
{
printf("Usage: benford <file>\n");
return EXIT_FAILURE;
}
float *actual = get_actual_distribution(argv[1]);
float *expected = benford_distribution();
puts("digit\tactual\texpected");
for (int i = 0; i < 9; i++)
printf("%d\t%.3f\t%.3f\n", i + 1, actual[i], expected[i]);
return EXIT_SUCCESS;
}
| Sub BenfordLaw()
Dim BenResult(1 To 9) As Long
BENref = "30,1%|17,6%|12,5%|9,7%|7,9%|6,7%|5,8%|5,1%|4,6%"
For Each c In Selection.Cells
If InStr(1, "-0123456789", Left(c, 1)) > 0 Then
For i = 1 To 9
If CInt(Left(Abs(c), 1)) = i Then BenResult(i) = BenResult(i) + 1: Exit For
Next
End If
Next
Total= Application.Sum(BenResult)
biggest= Len(CStr(BenResult(1)))
txt = "# | Values | Real | Expected " & vbCrLf
For i = 1 To 9
If BenResult(i) > 0 Then
txt = txt & "#" & i & " | " & vbTab
txt = txt & String((biggest - Len(CStr(BenResult(i)))) * 2, " ") & Format(BenResult(i), "0") & " | " & vbTab
txt = txt & String((Len(CStr(Format(BenResult(1) / Total, "##0.0%"))) - Len(CStr(Format(BenResult(i) / Total, "##0.0%")))) * 2, " ") & Format(BenResult(i) / Total, "##0.0%") & " | " & vbTab
txt = txt & Format(Split(BENref, "|")(i - 1), " ##0.0%") & vbCrLf
End If
Next
MsgBox txt, vbOKOnly, "Finish"
End Sub
}
|
Produce a language-to-language conversion: from C to VB, same semantics. | #include <stdio.h>
long fib(long x)
{
long fib_i(long n) { return n < 2 ? n : fib_i(n - 2) + fib_i(n - 1); };
if (x < 0) {
printf("Bad argument: fib(%ld)\n", x);
return -1;
}
return fib_i(x);
}
long fib_i(long n)
{
printf("This is not the fib you are looking for\n");
return -1;
}
int main()
{
long x;
for (x = -1; x < 4; x ++)
printf("fib %ld = %ld\n", x, fib(x));
printf("calling fib_i from outside fib:\n");
fib_i(3);
return 0;
}
| Sub Main()
Debug.Print F(-10)
Debug.Print F(10)
End Sub
Private Function F(N As Long) As Variant
If N < 0 Then
F = "Error. Negative argument"
ElseIf N <= 1 Then
F = N
Else
F = F(N - 1) + F(N - 2)
End If
End Function
|
Translate the given C code snippet into VB without altering its behavior. | #include <string.h>
#include <stdlib.h>
#include <stdio.h>
int main( int argc, char ** argv ){
const char * str_a = "knight";
const char * str_b = "socks";
const char * str_c = "brooms";
char * new_a = malloc( strlen( str_a ) - 1 );
char * new_b = malloc( strlen( str_b ) - 1 );
char * new_c = malloc( strlen( str_c ) - 2 );
strcpy( new_a, str_a + 1 );
strncpy( new_b, str_b, strlen( str_b ) - 1 );
strncpy( new_c, str_c + 1, strlen( str_c ) - 2 );
printf( "%s\n%s\n%s\n", new_a, new_b, new_c );
free( new_a );
free( new_b );
free( new_c );
return 0;
}
| string = "Small Basic"
TextWindow.WriteLine(Text.GetSubTextToEnd(string, 2))
TextWindow.WriteLine(Text.GetSubText(string, 1, Text.GetLength(string) - 1))
TextWindow.WriteLine(Text.GetSubText(string, 2, Text.GetLength(string) - 2))
|
Write the same code in VB as shown below in C. | #include <string.h>
#include <stdlib.h>
#include <stdio.h>
int main( int argc, char ** argv ){
const char * str_a = "knight";
const char * str_b = "socks";
const char * str_c = "brooms";
char * new_a = malloc( strlen( str_a ) - 1 );
char * new_b = malloc( strlen( str_b ) - 1 );
char * new_c = malloc( strlen( str_c ) - 2 );
strcpy( new_a, str_a + 1 );
strncpy( new_b, str_b, strlen( str_b ) - 1 );
strncpy( new_c, str_c + 1, strlen( str_c ) - 2 );
printf( "%s\n%s\n%s\n", new_a, new_b, new_c );
free( new_a );
free( new_b );
free( new_c );
return 0;
}
| string = "Small Basic"
TextWindow.WriteLine(Text.GetSubTextToEnd(string, 2))
TextWindow.WriteLine(Text.GetSubText(string, 1, Text.GetLength(string) - 1))
TextWindow.WriteLine(Text.GetSubText(string, 2, Text.GetLength(string) - 2))
|
Generate a VB translation of this C snippet without changing its computational steps. | #include <stdio.h>
#include <string.h>
int cmp(const char *p, const char *q)
{
while (*p && *q) p = &p[1], q = &q[1];
return *p;
}
int main()
{
char line[65536];
char buf[1000000] = {0};
char *last = buf;
char *next = buf;
while (gets(line)) {
strcat(line, "\n");
if (cmp(last, line)) continue;
if (cmp(line, last)) next = buf;
last = next;
strcpy(next, line);
while (*next) next = &next[1];
}
printf("%s", buf);
return 0;
}
|
Set objfso = CreateObject("Scripting.FileSystemObject")
Set objfile = objfso.OpenTextFile(objfso.GetParentFolderName(WScript.ScriptFullName) &_
"\input.txt",1)
list = ""
previous_line = ""
l = Len(previous_line)
Do Until objfile.AtEndOfStream
current_line = objfile.ReadLine
If Mid(current_line,l+1,1) <> "" Then
list = current_line & vbCrLf
previous_line = current_line
l = Len(previous_line)
ElseIf Mid(current_line,l,1) <> "" And Mid(current_line,(l+1),1) = "" Then
list = list & current_line & vbCrLf
End If
Loop
WScript.Echo list
objfile.Close
Set objfso = Nothing
|
Can you help me rewrite this code in VB instead of C, keeping it the same logically? | #include <stdio.h>
#include <stdarg.h>
#include <stdlib.h>
#include <string.h>
enum {
LEFT,
RIGHT,
STAY
};
typedef struct {
int state1;
int symbol1;
int symbol2;
int dir;
int state2;
} transition_t;
typedef struct tape_t tape_t;
struct tape_t {
int symbol;
tape_t *left;
tape_t *right;
};
typedef struct {
int states_len;
char **states;
int final_states_len;
int *final_states;
int symbols_len;
char *symbols;
int blank;
int state;
int tape_len;
tape_t *tape;
int transitions_len;
transition_t ***transitions;
} turing_t;
int state_index (turing_t *t, char *state) {
int i;
for (i = 0; i < t->states_len; i++) {
if (!strcmp(t->states[i], state)) {
return i;
}
}
return 0;
}
int symbol_index (turing_t *t, char symbol) {
int i;
for (i = 0; i < t->symbols_len; i++) {
if (t->symbols[i] == symbol) {
return i;
}
}
return 0;
}
void move (turing_t *t, int dir) {
tape_t *orig = t->tape;
if (dir == RIGHT) {
if (orig && orig->right) {
t->tape = orig->right;
}
else {
t->tape = calloc(1, sizeof (tape_t));
t->tape->symbol = t->blank;
if (orig) {
t->tape->left = orig;
orig->right = t->tape;
}
}
}
else if (dir == LEFT) {
if (orig && orig->left) {
t->tape = orig->left;
}
else {
t->tape = calloc(1, sizeof (tape_t));
t->tape->symbol = t->blank;
if (orig) {
t->tape->right = orig;
orig->left = t->tape;
}
}
}
}
turing_t *create (int states_len, ...) {
va_list args;
va_start(args, states_len);
turing_t *t = malloc(sizeof (turing_t));
t->states_len = states_len;
t->states = malloc(states_len * sizeof (char *));
int i;
for (i = 0; i < states_len; i++) {
t->states[i] = va_arg(args, char *);
}
t->final_states_len = va_arg(args, int);
t->final_states = malloc(t->final_states_len * sizeof (int));
for (i = 0; i < t->final_states_len; i++) {
t->final_states[i] = state_index(t, va_arg(args, char *));
}
t->symbols_len = va_arg(args, int);
t->symbols = malloc(t->symbols_len);
for (i = 0; i < t->symbols_len; i++) {
t->symbols[i] = va_arg(args, int);
}
t->blank = symbol_index(t, va_arg(args, int));
t->state = state_index(t, va_arg(args, char *));
t->tape_len = va_arg(args, int);
t->tape = NULL;
for (i = 0; i < t->tape_len; i++) {
move(t, RIGHT);
t->tape->symbol = symbol_index(t, va_arg(args, int));
}
if (!t->tape_len) {
move(t, RIGHT);
}
while (t->tape->left) {
t->tape = t->tape->left;
}
t->transitions_len = va_arg(args, int);
t->transitions = malloc(t->states_len * sizeof (transition_t **));
for (i = 0; i < t->states_len; i++) {
t->transitions[i] = malloc(t->symbols_len * sizeof (transition_t *));
}
for (i = 0; i < t->transitions_len; i++) {
transition_t *tran = malloc(sizeof (transition_t));
tran->state1 = state_index(t, va_arg(args, char *));
tran->symbol1 = symbol_index(t, va_arg(args, int));
tran->symbol2 = symbol_index(t, va_arg(args, int));
tran->dir = va_arg(args, int);
tran->state2 = state_index(t, va_arg(args, char *));
t->transitions[tran->state1][tran->symbol1] = tran;
}
va_end(args);
return t;
}
void print_state (turing_t *t) {
printf("%-10s ", t->states[t->state]);
tape_t *tape = t->tape;
while (tape->left) {
tape = tape->left;
}
while (tape) {
if (tape == t->tape) {
printf("[%c]", t->symbols[tape->symbol]);
}
else {
printf(" %c ", t->symbols[tape->symbol]);
}
tape = tape->right;
}
printf("\n");
}
void run (turing_t *t) {
int i;
while (1) {
print_state(t);
for (i = 0; i < t->final_states_len; i++) {
if (t->final_states[i] == t->state) {
return;
}
}
transition_t *tran = t->transitions[t->state][t->tape->symbol];
t->tape->symbol = tran->symbol2;
move(t, tran->dir);
t->state = tran->state2;
}
}
int main () {
printf("Simple incrementer\n");
turing_t *t = create(
2, "q0", "qf",
1, "qf",
2, 'B', '1',
'B',
"q0",
3, '1', '1', '1',
2,
"q0", '1', '1', RIGHT, "q0",
"q0", 'B', '1', STAY, "qf"
);
run(t);
printf("\nThree-state busy beaver\n");
t = create(
4, "a", "b", "c", "halt",
1, "halt",
2, '0', '1',
'0',
"a",
0,
6,
"a", '0', '1', RIGHT, "b",
"a", '1', '1', LEFT, "c",
"b", '0', '1', LEFT, "a",
"b", '1', '1', RIGHT, "b",
"c", '0', '1', LEFT, "b",
"c", '1', '1', STAY, "halt"
);
run(t);
return 0;
printf("\nFive-state two-symbol probable busy beaver\n");
t = create(
6, "A", "B", "C", "D", "E", "H",
1, "H",
2, '0', '1',
'0',
"A",
0,
10,
"A", '0', '1', RIGHT, "B",
"A", '1', '1', LEFT, "C",
"B", '0', '1', RIGHT, "C",
"B", '1', '1', RIGHT, "B",
"C", '0', '1', RIGHT, "D",
"C", '1', '0', LEFT, "E",
"D", '0', '1', LEFT, "A",
"D", '1', '1', LEFT, "D",
"E", '0', '1', STAY, "H",
"E", '1', '0', LEFT, "A"
);
run(t);
}
| Option Base 1
Public Enum sett
name_ = 1
initState
endState
blank
rules
End Enum
Public incrementer As Variant, threeStateBB As Variant, fiveStateBB As Variant
Private Sub init()
incrementer = Array("Simple incrementer", _
"q0", _
"qf", _
"B", _
Array( _
Array("q0", "1", "1", "right", "q0"), _
Array("q0", "B", "1", "stay", "qf")))
threeStateBB = Array("Three-state busy beaver", _
"a", _
"halt", _
"0", _
Array( _
Array("a", "0", "1", "right", "b"), _
Array("a", "1", "1", "left", "c"), _
Array("b", "0", "1", "left", "a"), _
Array("b", "1", "1", "right", "b"), _
Array("c", "0", "1", "left", "b"), _
Array("c", "1", "1", "stay", "halt")))
fiveStateBB = Array("Five-state busy beaver", _
"A", _
"H", _
"0", _
Array( _
Array("A", "0", "1", "right", "B"), _
Array("A", "1", "1", "left", "C"), _
Array("B", "0", "1", "right", "C"), _
Array("B", "1", "1", "right", "B"), _
Array("C", "0", "1", "right", "D"), _
Array("C", "1", "0", "left", "E"), _
Array("D", "0", "1", "left", "A"), _
Array("D", "1", "1", "left", "D"), _
Array("E", "0", "1", "stay", "H"), _
Array("E", "1", "0", "left", "A")))
End Sub
Private Sub show(state As String, headpos As Long, tape As Collection)
Debug.Print " "; state; String$(7 - Len(state), " "); "| ";
For p = 1 To tape.Count
Debug.Print IIf(p = headpos, "[" & tape(p) & "]", " " & tape(p) & " ");
Next p
Debug.Print
End Sub
Private Sub UTM(machine As Variant, tape As Collection, Optional countOnly As Long = 0)
Dim state As String: state = machine(initState)
Dim headpos As Long: headpos = 1
Dim counter As Long, rule As Variant
Debug.Print machine(name_); vbCrLf; String$(Len(machine(name_)), "=")
If Not countOnly Then Debug.Print " State | Tape [head]" & vbCrLf & "---------------------"
Do While True
If headpos > tape.Count Then
tape.Add machine(blank)
Else
If headpos < 1 Then
tape.Add machine(blank), Before:=1
headpos = 1
End If
End If
If Not countOnly Then show state, headpos, tape
For i = LBound(machine(rules)) To UBound(machine(rules))
rule = machine(rules)(i)
If rule(1) = state And rule(2) = tape(headpos) Then
tape.Remove headpos
If headpos > tape.Count Then
tape.Add rule(3)
Else
tape.Add rule(3), Before:=headpos
End If
If rule(4) = "left" Then headpos = headpos - 1
If rule(4) = "right" Then headpos = headpos + 1
state = rule(5)
Exit For
End If
Next i
counter = counter + 1
If counter Mod 100000 = 0 Then
Debug.Print counter
DoEvents
DoEvents
End If
If state = machine(endState) Then Exit Do
Loop
DoEvents
If countOnly Then
Debug.Print "Steps taken: ", counter
Else
show state, headpos, tape
Debug.Print
End If
End Sub
Public Sub main()
init
Dim tap As New Collection
tap.Add "1": tap.Add "1": tap.Add "1"
UTM incrementer, tap
Set tap = New Collection
UTM threeStateBB, tap
Set tap = New Collection
UTM fiveStateBB, tap, countOnly:=-1
End Sub
|
Ensure the translated VB code behaves exactly like the original C snippet. | #include <stdio.h>
#include <stdarg.h>
#include <stdlib.h>
#include <string.h>
enum {
LEFT,
RIGHT,
STAY
};
typedef struct {
int state1;
int symbol1;
int symbol2;
int dir;
int state2;
} transition_t;
typedef struct tape_t tape_t;
struct tape_t {
int symbol;
tape_t *left;
tape_t *right;
};
typedef struct {
int states_len;
char **states;
int final_states_len;
int *final_states;
int symbols_len;
char *symbols;
int blank;
int state;
int tape_len;
tape_t *tape;
int transitions_len;
transition_t ***transitions;
} turing_t;
int state_index (turing_t *t, char *state) {
int i;
for (i = 0; i < t->states_len; i++) {
if (!strcmp(t->states[i], state)) {
return i;
}
}
return 0;
}
int symbol_index (turing_t *t, char symbol) {
int i;
for (i = 0; i < t->symbols_len; i++) {
if (t->symbols[i] == symbol) {
return i;
}
}
return 0;
}
void move (turing_t *t, int dir) {
tape_t *orig = t->tape;
if (dir == RIGHT) {
if (orig && orig->right) {
t->tape = orig->right;
}
else {
t->tape = calloc(1, sizeof (tape_t));
t->tape->symbol = t->blank;
if (orig) {
t->tape->left = orig;
orig->right = t->tape;
}
}
}
else if (dir == LEFT) {
if (orig && orig->left) {
t->tape = orig->left;
}
else {
t->tape = calloc(1, sizeof (tape_t));
t->tape->symbol = t->blank;
if (orig) {
t->tape->right = orig;
orig->left = t->tape;
}
}
}
}
turing_t *create (int states_len, ...) {
va_list args;
va_start(args, states_len);
turing_t *t = malloc(sizeof (turing_t));
t->states_len = states_len;
t->states = malloc(states_len * sizeof (char *));
int i;
for (i = 0; i < states_len; i++) {
t->states[i] = va_arg(args, char *);
}
t->final_states_len = va_arg(args, int);
t->final_states = malloc(t->final_states_len * sizeof (int));
for (i = 0; i < t->final_states_len; i++) {
t->final_states[i] = state_index(t, va_arg(args, char *));
}
t->symbols_len = va_arg(args, int);
t->symbols = malloc(t->symbols_len);
for (i = 0; i < t->symbols_len; i++) {
t->symbols[i] = va_arg(args, int);
}
t->blank = symbol_index(t, va_arg(args, int));
t->state = state_index(t, va_arg(args, char *));
t->tape_len = va_arg(args, int);
t->tape = NULL;
for (i = 0; i < t->tape_len; i++) {
move(t, RIGHT);
t->tape->symbol = symbol_index(t, va_arg(args, int));
}
if (!t->tape_len) {
move(t, RIGHT);
}
while (t->tape->left) {
t->tape = t->tape->left;
}
t->transitions_len = va_arg(args, int);
t->transitions = malloc(t->states_len * sizeof (transition_t **));
for (i = 0; i < t->states_len; i++) {
t->transitions[i] = malloc(t->symbols_len * sizeof (transition_t *));
}
for (i = 0; i < t->transitions_len; i++) {
transition_t *tran = malloc(sizeof (transition_t));
tran->state1 = state_index(t, va_arg(args, char *));
tran->symbol1 = symbol_index(t, va_arg(args, int));
tran->symbol2 = symbol_index(t, va_arg(args, int));
tran->dir = va_arg(args, int);
tran->state2 = state_index(t, va_arg(args, char *));
t->transitions[tran->state1][tran->symbol1] = tran;
}
va_end(args);
return t;
}
void print_state (turing_t *t) {
printf("%-10s ", t->states[t->state]);
tape_t *tape = t->tape;
while (tape->left) {
tape = tape->left;
}
while (tape) {
if (tape == t->tape) {
printf("[%c]", t->symbols[tape->symbol]);
}
else {
printf(" %c ", t->symbols[tape->symbol]);
}
tape = tape->right;
}
printf("\n");
}
void run (turing_t *t) {
int i;
while (1) {
print_state(t);
for (i = 0; i < t->final_states_len; i++) {
if (t->final_states[i] == t->state) {
return;
}
}
transition_t *tran = t->transitions[t->state][t->tape->symbol];
t->tape->symbol = tran->symbol2;
move(t, tran->dir);
t->state = tran->state2;
}
}
int main () {
printf("Simple incrementer\n");
turing_t *t = create(
2, "q0", "qf",
1, "qf",
2, 'B', '1',
'B',
"q0",
3, '1', '1', '1',
2,
"q0", '1', '1', RIGHT, "q0",
"q0", 'B', '1', STAY, "qf"
);
run(t);
printf("\nThree-state busy beaver\n");
t = create(
4, "a", "b", "c", "halt",
1, "halt",
2, '0', '1',
'0',
"a",
0,
6,
"a", '0', '1', RIGHT, "b",
"a", '1', '1', LEFT, "c",
"b", '0', '1', LEFT, "a",
"b", '1', '1', RIGHT, "b",
"c", '0', '1', LEFT, "b",
"c", '1', '1', STAY, "halt"
);
run(t);
return 0;
printf("\nFive-state two-symbol probable busy beaver\n");
t = create(
6, "A", "B", "C", "D", "E", "H",
1, "H",
2, '0', '1',
'0',
"A",
0,
10,
"A", '0', '1', RIGHT, "B",
"A", '1', '1', LEFT, "C",
"B", '0', '1', RIGHT, "C",
"B", '1', '1', RIGHT, "B",
"C", '0', '1', RIGHT, "D",
"C", '1', '0', LEFT, "E",
"D", '0', '1', LEFT, "A",
"D", '1', '1', LEFT, "D",
"E", '0', '1', STAY, "H",
"E", '1', '0', LEFT, "A"
);
run(t);
}
| Option Base 1
Public Enum sett
name_ = 1
initState
endState
blank
rules
End Enum
Public incrementer As Variant, threeStateBB As Variant, fiveStateBB As Variant
Private Sub init()
incrementer = Array("Simple incrementer", _
"q0", _
"qf", _
"B", _
Array( _
Array("q0", "1", "1", "right", "q0"), _
Array("q0", "B", "1", "stay", "qf")))
threeStateBB = Array("Three-state busy beaver", _
"a", _
"halt", _
"0", _
Array( _
Array("a", "0", "1", "right", "b"), _
Array("a", "1", "1", "left", "c"), _
Array("b", "0", "1", "left", "a"), _
Array("b", "1", "1", "right", "b"), _
Array("c", "0", "1", "left", "b"), _
Array("c", "1", "1", "stay", "halt")))
fiveStateBB = Array("Five-state busy beaver", _
"A", _
"H", _
"0", _
Array( _
Array("A", "0", "1", "right", "B"), _
Array("A", "1", "1", "left", "C"), _
Array("B", "0", "1", "right", "C"), _
Array("B", "1", "1", "right", "B"), _
Array("C", "0", "1", "right", "D"), _
Array("C", "1", "0", "left", "E"), _
Array("D", "0", "1", "left", "A"), _
Array("D", "1", "1", "left", "D"), _
Array("E", "0", "1", "stay", "H"), _
Array("E", "1", "0", "left", "A")))
End Sub
Private Sub show(state As String, headpos As Long, tape As Collection)
Debug.Print " "; state; String$(7 - Len(state), " "); "| ";
For p = 1 To tape.Count
Debug.Print IIf(p = headpos, "[" & tape(p) & "]", " " & tape(p) & " ");
Next p
Debug.Print
End Sub
Private Sub UTM(machine As Variant, tape As Collection, Optional countOnly As Long = 0)
Dim state As String: state = machine(initState)
Dim headpos As Long: headpos = 1
Dim counter As Long, rule As Variant
Debug.Print machine(name_); vbCrLf; String$(Len(machine(name_)), "=")
If Not countOnly Then Debug.Print " State | Tape [head]" & vbCrLf & "---------------------"
Do While True
If headpos > tape.Count Then
tape.Add machine(blank)
Else
If headpos < 1 Then
tape.Add machine(blank), Before:=1
headpos = 1
End If
End If
If Not countOnly Then show state, headpos, tape
For i = LBound(machine(rules)) To UBound(machine(rules))
rule = machine(rules)(i)
If rule(1) = state And rule(2) = tape(headpos) Then
tape.Remove headpos
If headpos > tape.Count Then
tape.Add rule(3)
Else
tape.Add rule(3), Before:=headpos
End If
If rule(4) = "left" Then headpos = headpos - 1
If rule(4) = "right" Then headpos = headpos + 1
state = rule(5)
Exit For
End If
Next i
counter = counter + 1
If counter Mod 100000 = 0 Then
Debug.Print counter
DoEvents
DoEvents
End If
If state = machine(endState) Then Exit Do
Loop
DoEvents
If countOnly Then
Debug.Print "Steps taken: ", counter
Else
show state, headpos, tape
Debug.Print
End If
End Sub
Public Sub main()
init
Dim tap As New Collection
tap.Add "1": tap.Add "1": tap.Add "1"
UTM incrementer, tap
Set tap = New Collection
UTM threeStateBB, tap
Set tap = New Collection
UTM fiveStateBB, tap, countOnly:=-1
End Sub
|
Port the provided C code into VB while preserving the original functionality. | #include <stdio.h>
#include <stdarg.h>
#include <stdlib.h>
#include <string.h>
enum {
LEFT,
RIGHT,
STAY
};
typedef struct {
int state1;
int symbol1;
int symbol2;
int dir;
int state2;
} transition_t;
typedef struct tape_t tape_t;
struct tape_t {
int symbol;
tape_t *left;
tape_t *right;
};
typedef struct {
int states_len;
char **states;
int final_states_len;
int *final_states;
int symbols_len;
char *symbols;
int blank;
int state;
int tape_len;
tape_t *tape;
int transitions_len;
transition_t ***transitions;
} turing_t;
int state_index (turing_t *t, char *state) {
int i;
for (i = 0; i < t->states_len; i++) {
if (!strcmp(t->states[i], state)) {
return i;
}
}
return 0;
}
int symbol_index (turing_t *t, char symbol) {
int i;
for (i = 0; i < t->symbols_len; i++) {
if (t->symbols[i] == symbol) {
return i;
}
}
return 0;
}
void move (turing_t *t, int dir) {
tape_t *orig = t->tape;
if (dir == RIGHT) {
if (orig && orig->right) {
t->tape = orig->right;
}
else {
t->tape = calloc(1, sizeof (tape_t));
t->tape->symbol = t->blank;
if (orig) {
t->tape->left = orig;
orig->right = t->tape;
}
}
}
else if (dir == LEFT) {
if (orig && orig->left) {
t->tape = orig->left;
}
else {
t->tape = calloc(1, sizeof (tape_t));
t->tape->symbol = t->blank;
if (orig) {
t->tape->right = orig;
orig->left = t->tape;
}
}
}
}
turing_t *create (int states_len, ...) {
va_list args;
va_start(args, states_len);
turing_t *t = malloc(sizeof (turing_t));
t->states_len = states_len;
t->states = malloc(states_len * sizeof (char *));
int i;
for (i = 0; i < states_len; i++) {
t->states[i] = va_arg(args, char *);
}
t->final_states_len = va_arg(args, int);
t->final_states = malloc(t->final_states_len * sizeof (int));
for (i = 0; i < t->final_states_len; i++) {
t->final_states[i] = state_index(t, va_arg(args, char *));
}
t->symbols_len = va_arg(args, int);
t->symbols = malloc(t->symbols_len);
for (i = 0; i < t->symbols_len; i++) {
t->symbols[i] = va_arg(args, int);
}
t->blank = symbol_index(t, va_arg(args, int));
t->state = state_index(t, va_arg(args, char *));
t->tape_len = va_arg(args, int);
t->tape = NULL;
for (i = 0; i < t->tape_len; i++) {
move(t, RIGHT);
t->tape->symbol = symbol_index(t, va_arg(args, int));
}
if (!t->tape_len) {
move(t, RIGHT);
}
while (t->tape->left) {
t->tape = t->tape->left;
}
t->transitions_len = va_arg(args, int);
t->transitions = malloc(t->states_len * sizeof (transition_t **));
for (i = 0; i < t->states_len; i++) {
t->transitions[i] = malloc(t->symbols_len * sizeof (transition_t *));
}
for (i = 0; i < t->transitions_len; i++) {
transition_t *tran = malloc(sizeof (transition_t));
tran->state1 = state_index(t, va_arg(args, char *));
tran->symbol1 = symbol_index(t, va_arg(args, int));
tran->symbol2 = symbol_index(t, va_arg(args, int));
tran->dir = va_arg(args, int);
tran->state2 = state_index(t, va_arg(args, char *));
t->transitions[tran->state1][tran->symbol1] = tran;
}
va_end(args);
return t;
}
void print_state (turing_t *t) {
printf("%-10s ", t->states[t->state]);
tape_t *tape = t->tape;
while (tape->left) {
tape = tape->left;
}
while (tape) {
if (tape == t->tape) {
printf("[%c]", t->symbols[tape->symbol]);
}
else {
printf(" %c ", t->symbols[tape->symbol]);
}
tape = tape->right;
}
printf("\n");
}
void run (turing_t *t) {
int i;
while (1) {
print_state(t);
for (i = 0; i < t->final_states_len; i++) {
if (t->final_states[i] == t->state) {
return;
}
}
transition_t *tran = t->transitions[t->state][t->tape->symbol];
t->tape->symbol = tran->symbol2;
move(t, tran->dir);
t->state = tran->state2;
}
}
int main () {
printf("Simple incrementer\n");
turing_t *t = create(
2, "q0", "qf",
1, "qf",
2, 'B', '1',
'B',
"q0",
3, '1', '1', '1',
2,
"q0", '1', '1', RIGHT, "q0",
"q0", 'B', '1', STAY, "qf"
);
run(t);
printf("\nThree-state busy beaver\n");
t = create(
4, "a", "b", "c", "halt",
1, "halt",
2, '0', '1',
'0',
"a",
0,
6,
"a", '0', '1', RIGHT, "b",
"a", '1', '1', LEFT, "c",
"b", '0', '1', LEFT, "a",
"b", '1', '1', RIGHT, "b",
"c", '0', '1', LEFT, "b",
"c", '1', '1', STAY, "halt"
);
run(t);
return 0;
printf("\nFive-state two-symbol probable busy beaver\n");
t = create(
6, "A", "B", "C", "D", "E", "H",
1, "H",
2, '0', '1',
'0',
"A",
0,
10,
"A", '0', '1', RIGHT, "B",
"A", '1', '1', LEFT, "C",
"B", '0', '1', RIGHT, "C",
"B", '1', '1', RIGHT, "B",
"C", '0', '1', RIGHT, "D",
"C", '1', '0', LEFT, "E",
"D", '0', '1', LEFT, "A",
"D", '1', '1', LEFT, "D",
"E", '0', '1', STAY, "H",
"E", '1', '0', LEFT, "A"
);
run(t);
}
| Option Base 1
Public Enum sett
name_ = 1
initState
endState
blank
rules
End Enum
Public incrementer As Variant, threeStateBB As Variant, fiveStateBB As Variant
Private Sub init()
incrementer = Array("Simple incrementer", _
"q0", _
"qf", _
"B", _
Array( _
Array("q0", "1", "1", "right", "q0"), _
Array("q0", "B", "1", "stay", "qf")))
threeStateBB = Array("Three-state busy beaver", _
"a", _
"halt", _
"0", _
Array( _
Array("a", "0", "1", "right", "b"), _
Array("a", "1", "1", "left", "c"), _
Array("b", "0", "1", "left", "a"), _
Array("b", "1", "1", "right", "b"), _
Array("c", "0", "1", "left", "b"), _
Array("c", "1", "1", "stay", "halt")))
fiveStateBB = Array("Five-state busy beaver", _
"A", _
"H", _
"0", _
Array( _
Array("A", "0", "1", "right", "B"), _
Array("A", "1", "1", "left", "C"), _
Array("B", "0", "1", "right", "C"), _
Array("B", "1", "1", "right", "B"), _
Array("C", "0", "1", "right", "D"), _
Array("C", "1", "0", "left", "E"), _
Array("D", "0", "1", "left", "A"), _
Array("D", "1", "1", "left", "D"), _
Array("E", "0", "1", "stay", "H"), _
Array("E", "1", "0", "left", "A")))
End Sub
Private Sub show(state As String, headpos As Long, tape As Collection)
Debug.Print " "; state; String$(7 - Len(state), " "); "| ";
For p = 1 To tape.Count
Debug.Print IIf(p = headpos, "[" & tape(p) & "]", " " & tape(p) & " ");
Next p
Debug.Print
End Sub
Private Sub UTM(machine As Variant, tape As Collection, Optional countOnly As Long = 0)
Dim state As String: state = machine(initState)
Dim headpos As Long: headpos = 1
Dim counter As Long, rule As Variant
Debug.Print machine(name_); vbCrLf; String$(Len(machine(name_)), "=")
If Not countOnly Then Debug.Print " State | Tape [head]" & vbCrLf & "---------------------"
Do While True
If headpos > tape.Count Then
tape.Add machine(blank)
Else
If headpos < 1 Then
tape.Add machine(blank), Before:=1
headpos = 1
End If
End If
If Not countOnly Then show state, headpos, tape
For i = LBound(machine(rules)) To UBound(machine(rules))
rule = machine(rules)(i)
If rule(1) = state And rule(2) = tape(headpos) Then
tape.Remove headpos
If headpos > tape.Count Then
tape.Add rule(3)
Else
tape.Add rule(3), Before:=headpos
End If
If rule(4) = "left" Then headpos = headpos - 1
If rule(4) = "right" Then headpos = headpos + 1
state = rule(5)
Exit For
End If
Next i
counter = counter + 1
If counter Mod 100000 = 0 Then
Debug.Print counter
DoEvents
DoEvents
End If
If state = machine(endState) Then Exit Do
Loop
DoEvents
If countOnly Then
Debug.Print "Steps taken: ", counter
Else
show state, headpos, tape
Debug.Print
End If
End Sub
Public Sub main()
init
Dim tap As New Collection
tap.Add "1": tap.Add "1": tap.Add "1"
UTM incrementer, tap
Set tap = New Collection
UTM threeStateBB, tap
Set tap = New Collection
UTM fiveStateBB, tap, countOnly:=-1
End Sub
|
Translate this program into VB but keep the logic exactly as in C. | #include <stdio.h>
int main() {
FILE *fh = fopen("output.txt", "w");
fclose(fh);
return 0;
}
| Public Sub create_file()
Dim FileNumber As Integer
FileNumber = FreeFile
MkDir "docs"
Open "docs\output.txt" For Output As #FreeFile
Close #FreeFile
MkDir "C:\docs"
Open "C:\docs\output.txt" For Output As #FreeFile
Close #FreeFile
End Sub
|
Convert the following code from C to VB, ensuring the logic remains intact. | #include<string.h>
#include<stdlib.h>
#include<stdio.h>
typedef struct genome{
char* strand;
int length;
struct genome* next;
}genome;
genome* genomeData;
int totalLength = 0, Adenine = 0, Cytosine = 0, Guanine = 0, Thymine = 0;
int numDigits(int num){
int len = 1;
while(num>10){
num = num/10;
len++;
}
return len;
}
void buildGenome(char str[100]){
int len = strlen(str),i;
genome *genomeIterator, *newGenome;
totalLength += len;
for(i=0;i<len;i++){
switch(str[i]){
case 'A': Adenine++;
break;
case 'T': Thymine++;
break;
case 'C': Cytosine++;
break;
case 'G': Guanine++;
break;
};
}
if(genomeData==NULL){
genomeData = (genome*)malloc(sizeof(genome));
genomeData->strand = (char*)malloc(len*sizeof(char));
strcpy(genomeData->strand,str);
genomeData->length = len;
genomeData->next = NULL;
}
else{
genomeIterator = genomeData;
while(genomeIterator->next!=NULL)
genomeIterator = genomeIterator->next;
newGenome = (genome*)malloc(sizeof(genome));
newGenome->strand = (char*)malloc(len*sizeof(char));
strcpy(newGenome->strand,str);
newGenome->length = len;
newGenome->next = NULL;
genomeIterator->next = newGenome;
}
}
void printGenome(){
genome* genomeIterator = genomeData;
int width = numDigits(totalLength), len = 0;
printf("Sequence:\n");
while(genomeIterator!=NULL){
printf("\n%*d%3s%3s",width+1,len,":",genomeIterator->strand);
len += genomeIterator->length;
genomeIterator = genomeIterator->next;
}
printf("\n\nBase Count\n----------\n\n");
printf("%3c%3s%*d\n",'A',":",width+1,Adenine);
printf("%3c%3s%*d\n",'T',":",width+1,Thymine);
printf("%3c%3s%*d\n",'C',":",width+1,Cytosine);
printf("%3c%3s%*d\n",'G',":",width+1,Guanine);
printf("\n%3s%*d\n","Total:",width+1,Adenine + Thymine + Cytosine + Guanine);
free(genomeData);
}
int main(int argc,char** argv)
{
char str[100];
int counter = 0, len;
if(argc!=2){
printf("Usage : %s <Gene file name>\n",argv[0]);
return 0;
}
FILE *fp = fopen(argv[1],"r");
while(fscanf(fp,"%s",str)!=EOF)
buildGenome(str);
fclose(fp);
printGenome();
return 0;
}
| b=_
"CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATG" &_
"CTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTG" &_
"AGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGAT" &_
"GGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT" &_
"CGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGG" &_
"TCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA" &_
"TTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTAT" &_
"CGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTG" &_
"TCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGAC" &_
"GACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT"
s="SEQUENCE:"
acnt=0:ccnt=0:gcnt=0:tcnt=0
for i=0 to len(b)-1
if (i mod 30)=0 then s = s & vbcrlf & right(" "& i+1,3)&": "
if (i mod 5)=0 then s=s& " "
m=mid(b,i+1,1)
s=s & m
select case m
case "A":acnt=acnt+1
case "C":ccnt=ccnt+1
case "G":gcnt=gcnt+1
case "T":tcnt=tcnt+1
case else
wscript.echo "error at ",i+1, m
end select
next
wscript.echo s & vbcrlf
wscript.echo "Count: A="&acnt & " C=" & ccnt & " G=" & gcnt & " T=" & tcnt
|
Ensure the translated VB code behaves exactly like the original C snippet. | #include<string.h>
#include<stdlib.h>
#include<stdio.h>
typedef struct genome{
char* strand;
int length;
struct genome* next;
}genome;
genome* genomeData;
int totalLength = 0, Adenine = 0, Cytosine = 0, Guanine = 0, Thymine = 0;
int numDigits(int num){
int len = 1;
while(num>10){
num = num/10;
len++;
}
return len;
}
void buildGenome(char str[100]){
int len = strlen(str),i;
genome *genomeIterator, *newGenome;
totalLength += len;
for(i=0;i<len;i++){
switch(str[i]){
case 'A': Adenine++;
break;
case 'T': Thymine++;
break;
case 'C': Cytosine++;
break;
case 'G': Guanine++;
break;
};
}
if(genomeData==NULL){
genomeData = (genome*)malloc(sizeof(genome));
genomeData->strand = (char*)malloc(len*sizeof(char));
strcpy(genomeData->strand,str);
genomeData->length = len;
genomeData->next = NULL;
}
else{
genomeIterator = genomeData;
while(genomeIterator->next!=NULL)
genomeIterator = genomeIterator->next;
newGenome = (genome*)malloc(sizeof(genome));
newGenome->strand = (char*)malloc(len*sizeof(char));
strcpy(newGenome->strand,str);
newGenome->length = len;
newGenome->next = NULL;
genomeIterator->next = newGenome;
}
}
void printGenome(){
genome* genomeIterator = genomeData;
int width = numDigits(totalLength), len = 0;
printf("Sequence:\n");
while(genomeIterator!=NULL){
printf("\n%*d%3s%3s",width+1,len,":",genomeIterator->strand);
len += genomeIterator->length;
genomeIterator = genomeIterator->next;
}
printf("\n\nBase Count\n----------\n\n");
printf("%3c%3s%*d\n",'A',":",width+1,Adenine);
printf("%3c%3s%*d\n",'T',":",width+1,Thymine);
printf("%3c%3s%*d\n",'C',":",width+1,Cytosine);
printf("%3c%3s%*d\n",'G',":",width+1,Guanine);
printf("\n%3s%*d\n","Total:",width+1,Adenine + Thymine + Cytosine + Guanine);
free(genomeData);
}
int main(int argc,char** argv)
{
char str[100];
int counter = 0, len;
if(argc!=2){
printf("Usage : %s <Gene file name>\n",argv[0]);
return 0;
}
FILE *fp = fopen(argv[1],"r");
while(fscanf(fp,"%s",str)!=EOF)
buildGenome(str);
fclose(fp);
printGenome();
return 0;
}
| b=_
"CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATG" &_
"CTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTG" &_
"AGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGAT" &_
"GGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT" &_
"CGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGG" &_
"TCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA" &_
"TTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTAT" &_
"CGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTG" &_
"TCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGAC" &_
"GACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT"
s="SEQUENCE:"
acnt=0:ccnt=0:gcnt=0:tcnt=0
for i=0 to len(b)-1
if (i mod 30)=0 then s = s & vbcrlf & right(" "& i+1,3)&": "
if (i mod 5)=0 then s=s& " "
m=mid(b,i+1,1)
s=s & m
select case m
case "A":acnt=acnt+1
case "C":ccnt=ccnt+1
case "G":gcnt=gcnt+1
case "T":tcnt=tcnt+1
case else
wscript.echo "error at ",i+1, m
end select
next
wscript.echo s & vbcrlf
wscript.echo "Count: A="&acnt & " C=" & ccnt & " G=" & gcnt & " T=" & tcnt
|
Change the following C code into VB without altering its purpose. | #include <pthread.h>
#include <stdio.h>
#include <stdlib.h>
#include <unistd.h>
#include <stdarg.h>
#define N 5
const char *names[N] = { "Aristotle", "Kant", "Spinoza", "Marx", "Russell" };
pthread_mutex_t forks[N];
#define M 5
const char *topic[M] = { "Spaghetti!", "Life", "Universe", "Everything", "Bathroom" };
#define lock pthread_mutex_lock
#define unlock pthread_mutex_unlock
#define xy(x, y) printf("\033[%d;%dH", x, y)
#define clear_eol(x) print(x, 12, "\033[K")
void print(int y, int x, const char *fmt, ...)
{
static pthread_mutex_t screen = PTHREAD_MUTEX_INITIALIZER;
va_list ap;
va_start(ap, fmt);
lock(&screen);
xy(y + 1, x), vprintf(fmt, ap);
xy(N + 1, 1), fflush(stdout);
unlock(&screen);
}
void eat(int id)
{
int f[2], ration, i;
f[0] = f[1] = id;
f[id & 1] = (id + 1) % N;
clear_eol(id);
print(id, 12, "..oO (forks, need forks)");
for (i = 0; i < 2; i++) {
lock(forks + f[i]);
if (!i) clear_eol(id);
print(id, 12 + (f[i] != id) * 6, "fork%d", f[i]);
sleep(1);
}
for (i = 0, ration = 3 + rand() % 8; i < ration; i++)
print(id, 24 + i * 4, "nom"), sleep(1);
for (i = 0; i < 2; i++) unlock(forks + f[i]);
}
void think(int id)
{
int i, t;
char buf[64] = {0};
do {
clear_eol(id);
sprintf(buf, "..oO (%s)", topic[t = rand() % M]);
for (i = 0; buf[i]; i++) {
print(id, i+12, "%c", buf[i]);
if (i < 5) usleep(200000);
}
usleep(500000 + rand() % 1000000);
} while (t);
}
void* philosophize(void *a)
{
int id = *(int*)a;
print(id, 1, "%10s", names[id]);
while(1) think(id), eat(id);
}
int main()
{
int i, id[N];
pthread_t tid[N];
for (i = 0; i < N; i++)
pthread_mutex_init(forks + (id[i] = i), 0);
for (i = 0; i < N; i++)
pthread_create(tid + i, 0, philosophize, id + i);
return pthread_join(tid[0], 0);
}
|
Public Const HOLDON = False
Public Const DIJKSTRASOLUTION = True
Public Const X = 10
Public Const GETS = 0
Public Const PUTS = 1
Public Const EATS = 2
Public Const THKS = 5
Public Const FRSTFORK = 0
Public Const SCNDFORK = 1
Public Const SPAGHETI = 0
Public Const UNIVERSE = 1
Public Const MAXCOUNT = 100000
Public Const PHILOSOPHERS = 5
Public semaphore(PHILOSOPHERS - 1) As Integer
Public positi0n(1, PHILOSOPHERS - 1) As Integer
Public programcounter(PHILOSOPHERS - 1) As Long
Public statistics(PHILOSOPHERS - 1, 5, 1) As Long
Public names As Variant
Private Sub init()
names = [{"Aquinas","Babbage","Carroll","Derrida","Erasmus"}]
For j = 0 To PHILOSOPHERS - 2
positi0n(0, j) = j + 1
positi0n(1, j) = j
Next j
If DIJKSTRASOLUTION Then
positi0n(0, PHILOSOPHERS - 1) = j
positi0n(1, PHILOSOPHERS - 1) = 0
Else
positi0n(0, PHILOSOPHERS - 1) = 0
positi0n(1, PHILOSOPHERS - 1) = j
End If
End Sub
Private Sub philosopher(subject As Integer, verb As Integer, objekt As Integer)
statistics(subject, verb, objekt) = statistics(subject, verb, objekt) + 1
If verb < 2 Then
If semaphore(positi0n(objekt, subject)) <> verb Then
If Not HOLDON Then
semaphore(positi0n(FRSTFORK, subject)) = 1 - objekt
programcounter(subject) = 0
End If
Else
semaphore(positi0n(objekt, subject)) = 1 - verb
programcounter(subject) = (programcounter(subject) + 1) Mod 6
End If
Else
programcounter(subject) = IIf(X * Rnd > 1, verb, verb + 1) Mod 6
End If
End Sub
Private Sub dine()
Dim ph As Integer
Do While TC < MAXCOUNT
For ph = 0 To PHILOSOPHERS - 1
Select Case programcounter(ph)
Case 0: philosopher ph, GETS, FRSTFORK
Case 1: philosopher ph, GETS, SCNDFORK
Case 2: philosopher ph, EATS, SPAGHETI
Case 3: philosopher ph, PUTS, FRSTFORK
Case 4: philosopher ph, PUTS, SCNDFORK
Case 5: philosopher ph, THKS, UNIVERSE
End Select
TC = TC + 1
Next ph
Loop
End Sub
Private Sub show()
Debug.Print "Stats", "Gets", "Gets", "Eats", "Puts", "Puts", "Thinks"
Debug.Print "", "First", "Second", "Spag-", "First", "Second", "About"
Debug.Print "", "Fork", "Fork", "hetti", "Fork", "Fork", "Universe"
For subject = 0 To PHILOSOPHERS - 1
Debug.Print names(subject + 1),
For objekt = 0 To 1
Debug.Print statistics(subject, GETS, objekt),
Next objekt
Debug.Print statistics(subject, EATS, SPAGHETI),
For objekt = 0 To 1
Debug.Print statistics(subject, PUTS, objekt),
Next objekt
Debug.Print statistics(subject, THKS, UNIVERSE)
Next subject
End Sub
Public Sub main()
init
dine
show
End Sub
|
Preserve the algorithm and functionality while converting the code from C to VB. | #include <stdio.h>
int main() {
int n, b, d;
unsigned long long i, j, sum, fact[12];
fact[0] = 1;
for (n = 1; n < 12; ++n) {
fact[n] = fact[n-1] * n;
}
for (b = 9; b <= 12; ++b) {
printf("The factorions for base %d are:\n", b);
for (i = 1; i < 1500000; ++i) {
sum = 0;
j = i;
while (j > 0) {
d = j % b;
sum += fact[d];
j /= b;
}
if (sum == i) printf("%llu ", i);
}
printf("\n\n");
}
return 0;
}
|
Dim fact()
nn1=9 : nn2=12
lim=1499999
ReDim fact(nn2)
fact(0)=1
For i=1 To nn2
fact(i)=fact(i-1)*i
Next
For base=nn1 To nn2
list=""
For i=1 To lim
s=0
t=i
Do While t<>0
d=t Mod base
s=s+fact(d)
t=t\base
Loop
If s=i Then list=list &" "& i
Next
Wscript.Echo "the factorions for base "& right(" "& base,2) &" are: "& list
Next
|
Write the same algorithm in VB as shown in this C implementation. | #include <stdio.h>
int main() {
int n, b, d;
unsigned long long i, j, sum, fact[12];
fact[0] = 1;
for (n = 1; n < 12; ++n) {
fact[n] = fact[n-1] * n;
}
for (b = 9; b <= 12; ++b) {
printf("The factorions for base %d are:\n", b);
for (i = 1; i < 1500000; ++i) {
sum = 0;
j = i;
while (j > 0) {
d = j % b;
sum += fact[d];
j /= b;
}
if (sum == i) printf("%llu ", i);
}
printf("\n\n");
}
return 0;
}
|
Dim fact()
nn1=9 : nn2=12
lim=1499999
ReDim fact(nn2)
fact(0)=1
For i=1 To nn2
fact(i)=fact(i-1)*i
Next
For base=nn1 To nn2
list=""
For i=1 To lim
s=0
t=i
Do While t<>0
d=t Mod base
s=s+fact(d)
t=t\base
Loop
If s=i Then list=list &" "& i
Next
Wscript.Echo "the factorions for base "& right(" "& base,2) &" are: "& list
Next
|
Convert the following code from C to VB, ensuring the logic remains intact. | #include <ctype.h>
#include <stdbool.h>
#include <stdio.h>
#include <stdlib.h>
#include <string.h>
const char* command_table =
"Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy "
"COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find "
"NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput "
"Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO "
"MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT "
"READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT "
"RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up";
typedef struct command_tag {
char* cmd;
size_t length;
size_t min_len;
struct command_tag* next;
} command_t;
bool command_match(const command_t* command, const char* str) {
size_t olen = strlen(str);
return olen >= command->min_len && olen <= command->length
&& strncmp(str, command->cmd, olen) == 0;
}
char* uppercase(char* str, size_t n) {
for (size_t i = 0; i < n; ++i)
str[i] = toupper((unsigned char)str[i]);
return str;
}
size_t get_min_length(const char* str, size_t n) {
size_t len = 0;
while (len < n && isupper((unsigned char)str[len]))
++len;
return len;
}
void fatal(const char* message) {
fprintf(stderr, "%s\n", message);
exit(1);
}
void* xmalloc(size_t n) {
void* ptr = malloc(n);
if (ptr == NULL)
fatal("Out of memory");
return ptr;
}
void* xrealloc(void* p, size_t n) {
void* ptr = realloc(p, n);
if (ptr == NULL)
fatal("Out of memory");
return ptr;
}
char** split_into_words(const char* str, size_t* count) {
size_t size = 0;
size_t capacity = 16;
char** words = xmalloc(capacity * sizeof(char*));
size_t len = strlen(str);
for (size_t begin = 0; begin < len; ) {
size_t i = begin;
for (; i < len && isspace((unsigned char)str[i]); ++i) {}
begin = i;
for (; i < len && !isspace((unsigned char)str[i]); ++i) {}
size_t word_len = i - begin;
if (word_len == 0)
break;
char* word = xmalloc(word_len + 1);
memcpy(word, str + begin, word_len);
word[word_len] = 0;
begin += word_len;
if (capacity == size) {
capacity *= 2;
words = xrealloc(words, capacity * sizeof(char*));
}
words[size++] = word;
}
*count = size;
return words;
}
command_t* make_command_list(const char* table) {
command_t* cmd = NULL;
size_t count = 0;
char** words = split_into_words(table, &count);
for (size_t i = 0; i < count; ++i) {
char* word = words[i];
command_t* new_cmd = xmalloc(sizeof(command_t));
size_t word_len = strlen(word);
new_cmd->length = word_len;
new_cmd->min_len = get_min_length(word, word_len);
new_cmd->cmd = uppercase(word, word_len);
new_cmd->next = cmd;
cmd = new_cmd;
}
free(words);
return cmd;
}
void free_command_list(command_t* cmd) {
while (cmd != NULL) {
command_t* next = cmd->next;
free(cmd->cmd);
free(cmd);
cmd = next;
}
}
const command_t* find_command(const command_t* commands, const char* word) {
for (const command_t* cmd = commands; cmd != NULL; cmd = cmd->next) {
if (command_match(cmd, word))
return cmd;
}
return NULL;
}
void test(const command_t* commands, const char* input) {
printf(" input: %s\n", input);
printf("output:");
size_t count = 0;
char** words = split_into_words(input, &count);
for (size_t i = 0; i < count; ++i) {
char* word = words[i];
uppercase(word, strlen(word));
const command_t* cmd_ptr = find_command(commands, word);
printf(" %s", cmd_ptr ? cmd_ptr->cmd : "*error*");
free(word);
}
free(words);
printf("\n");
}
int main() {
command_t* commands = make_command_list(command_table);
const char* input = "riG rePEAT copies put mo rest types fup. 6 poweRin";
test(commands, input);
free_command_list(commands);
return 0;
}
| Private Function ValidateUserWords(userstring As String) As String
Dim s As String
Dim user_words() As String
Dim command_table As Scripting.Dictionary
Set command_table = New Scripting.Dictionary
Dim abbreviations As Scripting.Dictionary
Set abbreviations = New Scripting.Dictionary
abbreviations.CompareMode = TextCompare
Dim commandtable() As String
Dim commands As String
s = s & "Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy "
s = s & "COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find "
s = s & "NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput "
s = s & "Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO "
s = s & "MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT "
s = s & "READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT "
s = s & "RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up "
commandtable = Split(s, " ")
Dim i As Integer
For Each word In commandtable
If Len(word) > 0 Then
i = 1
Do While Mid(word, i, 1) >= "A" And Mid(word, i, 1) <= "Z"
i = i + 1
Loop
command_table.Add Key:=word, Item:=i - 1
End If
Next word
For Each word In command_table
For i = command_table(word) To Len(word)
On Error Resume Next
abbreviations.Add Key:=Left(word, i), Item:=UCase(word)
Next i
Next word
user_words() = Split(userstring, " ")
For Each word In user_words
If Len(word) > 0 Then
If abbreviations.exists(word) Then
commands = commands & abbreviations(word) & " "
Else
commands = commands & "*error* "
End If
End If
Next word
ValidateUserWords = commands
End Function
Public Sub program()
Dim guserstring As String
guserstring = "riG rePEAT copies put mo rest types fup. 6 poweRin"
Debug.Print "user words:", guserstring
Debug.Print "full words:", ValidateUserWords(guserstring)
End Sub
|
Change the following C code into VB without altering its purpose. | #include <ctype.h>
#include <stdbool.h>
#include <stdio.h>
#include <stdlib.h>
#include <string.h>
const char* command_table =
"Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy "
"COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find "
"NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput "
"Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO "
"MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT "
"READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT "
"RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up";
typedef struct command_tag {
char* cmd;
size_t length;
size_t min_len;
struct command_tag* next;
} command_t;
bool command_match(const command_t* command, const char* str) {
size_t olen = strlen(str);
return olen >= command->min_len && olen <= command->length
&& strncmp(str, command->cmd, olen) == 0;
}
char* uppercase(char* str, size_t n) {
for (size_t i = 0; i < n; ++i)
str[i] = toupper((unsigned char)str[i]);
return str;
}
size_t get_min_length(const char* str, size_t n) {
size_t len = 0;
while (len < n && isupper((unsigned char)str[len]))
++len;
return len;
}
void fatal(const char* message) {
fprintf(stderr, "%s\n", message);
exit(1);
}
void* xmalloc(size_t n) {
void* ptr = malloc(n);
if (ptr == NULL)
fatal("Out of memory");
return ptr;
}
void* xrealloc(void* p, size_t n) {
void* ptr = realloc(p, n);
if (ptr == NULL)
fatal("Out of memory");
return ptr;
}
char** split_into_words(const char* str, size_t* count) {
size_t size = 0;
size_t capacity = 16;
char** words = xmalloc(capacity * sizeof(char*));
size_t len = strlen(str);
for (size_t begin = 0; begin < len; ) {
size_t i = begin;
for (; i < len && isspace((unsigned char)str[i]); ++i) {}
begin = i;
for (; i < len && !isspace((unsigned char)str[i]); ++i) {}
size_t word_len = i - begin;
if (word_len == 0)
break;
char* word = xmalloc(word_len + 1);
memcpy(word, str + begin, word_len);
word[word_len] = 0;
begin += word_len;
if (capacity == size) {
capacity *= 2;
words = xrealloc(words, capacity * sizeof(char*));
}
words[size++] = word;
}
*count = size;
return words;
}
command_t* make_command_list(const char* table) {
command_t* cmd = NULL;
size_t count = 0;
char** words = split_into_words(table, &count);
for (size_t i = 0; i < count; ++i) {
char* word = words[i];
command_t* new_cmd = xmalloc(sizeof(command_t));
size_t word_len = strlen(word);
new_cmd->length = word_len;
new_cmd->min_len = get_min_length(word, word_len);
new_cmd->cmd = uppercase(word, word_len);
new_cmd->next = cmd;
cmd = new_cmd;
}
free(words);
return cmd;
}
void free_command_list(command_t* cmd) {
while (cmd != NULL) {
command_t* next = cmd->next;
free(cmd->cmd);
free(cmd);
cmd = next;
}
}
const command_t* find_command(const command_t* commands, const char* word) {
for (const command_t* cmd = commands; cmd != NULL; cmd = cmd->next) {
if (command_match(cmd, word))
return cmd;
}
return NULL;
}
void test(const command_t* commands, const char* input) {
printf(" input: %s\n", input);
printf("output:");
size_t count = 0;
char** words = split_into_words(input, &count);
for (size_t i = 0; i < count; ++i) {
char* word = words[i];
uppercase(word, strlen(word));
const command_t* cmd_ptr = find_command(commands, word);
printf(" %s", cmd_ptr ? cmd_ptr->cmd : "*error*");
free(word);
}
free(words);
printf("\n");
}
int main() {
command_t* commands = make_command_list(command_table);
const char* input = "riG rePEAT copies put mo rest types fup. 6 poweRin";
test(commands, input);
free_command_list(commands);
return 0;
}
| Private Function ValidateUserWords(userstring As String) As String
Dim s As String
Dim user_words() As String
Dim command_table As Scripting.Dictionary
Set command_table = New Scripting.Dictionary
Dim abbreviations As Scripting.Dictionary
Set abbreviations = New Scripting.Dictionary
abbreviations.CompareMode = TextCompare
Dim commandtable() As String
Dim commands As String
s = s & "Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy "
s = s & "COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find "
s = s & "NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput "
s = s & "Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO "
s = s & "MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT "
s = s & "READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT "
s = s & "RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up "
commandtable = Split(s, " ")
Dim i As Integer
For Each word In commandtable
If Len(word) > 0 Then
i = 1
Do While Mid(word, i, 1) >= "A" And Mid(word, i, 1) <= "Z"
i = i + 1
Loop
command_table.Add Key:=word, Item:=i - 1
End If
Next word
For Each word In command_table
For i = command_table(word) To Len(word)
On Error Resume Next
abbreviations.Add Key:=Left(word, i), Item:=UCase(word)
Next i
Next word
user_words() = Split(userstring, " ")
For Each word In user_words
If Len(word) > 0 Then
If abbreviations.exists(word) Then
commands = commands & abbreviations(word) & " "
Else
commands = commands & "*error* "
End If
End If
Next word
ValidateUserWords = commands
End Function
Public Sub program()
Dim guserstring As String
guserstring = "riG rePEAT copies put mo rest types fup. 6 poweRin"
Debug.Print "user words:", guserstring
Debug.Print "full words:", ValidateUserWords(guserstring)
End Sub
|
Convert this C block to VB, preserving its control flow and logic. | #include <ctype.h>
#include <stdbool.h>
#include <stdio.h>
#include <stdlib.h>
#include <string.h>
const char* command_table =
"Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy "
"COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find "
"NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput "
"Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO "
"MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT "
"READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT "
"RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up";
typedef struct command_tag {
char* cmd;
size_t length;
size_t min_len;
struct command_tag* next;
} command_t;
bool command_match(const command_t* command, const char* str) {
size_t olen = strlen(str);
return olen >= command->min_len && olen <= command->length
&& strncmp(str, command->cmd, olen) == 0;
}
char* uppercase(char* str, size_t n) {
for (size_t i = 0; i < n; ++i)
str[i] = toupper((unsigned char)str[i]);
return str;
}
size_t get_min_length(const char* str, size_t n) {
size_t len = 0;
while (len < n && isupper((unsigned char)str[len]))
++len;
return len;
}
void fatal(const char* message) {
fprintf(stderr, "%s\n", message);
exit(1);
}
void* xmalloc(size_t n) {
void* ptr = malloc(n);
if (ptr == NULL)
fatal("Out of memory");
return ptr;
}
void* xrealloc(void* p, size_t n) {
void* ptr = realloc(p, n);
if (ptr == NULL)
fatal("Out of memory");
return ptr;
}
char** split_into_words(const char* str, size_t* count) {
size_t size = 0;
size_t capacity = 16;
char** words = xmalloc(capacity * sizeof(char*));
size_t len = strlen(str);
for (size_t begin = 0; begin < len; ) {
size_t i = begin;
for (; i < len && isspace((unsigned char)str[i]); ++i) {}
begin = i;
for (; i < len && !isspace((unsigned char)str[i]); ++i) {}
size_t word_len = i - begin;
if (word_len == 0)
break;
char* word = xmalloc(word_len + 1);
memcpy(word, str + begin, word_len);
word[word_len] = 0;
begin += word_len;
if (capacity == size) {
capacity *= 2;
words = xrealloc(words, capacity * sizeof(char*));
}
words[size++] = word;
}
*count = size;
return words;
}
command_t* make_command_list(const char* table) {
command_t* cmd = NULL;
size_t count = 0;
char** words = split_into_words(table, &count);
for (size_t i = 0; i < count; ++i) {
char* word = words[i];
command_t* new_cmd = xmalloc(sizeof(command_t));
size_t word_len = strlen(word);
new_cmd->length = word_len;
new_cmd->min_len = get_min_length(word, word_len);
new_cmd->cmd = uppercase(word, word_len);
new_cmd->next = cmd;
cmd = new_cmd;
}
free(words);
return cmd;
}
void free_command_list(command_t* cmd) {
while (cmd != NULL) {
command_t* next = cmd->next;
free(cmd->cmd);
free(cmd);
cmd = next;
}
}
const command_t* find_command(const command_t* commands, const char* word) {
for (const command_t* cmd = commands; cmd != NULL; cmd = cmd->next) {
if (command_match(cmd, word))
return cmd;
}
return NULL;
}
void test(const command_t* commands, const char* input) {
printf(" input: %s\n", input);
printf("output:");
size_t count = 0;
char** words = split_into_words(input, &count);
for (size_t i = 0; i < count; ++i) {
char* word = words[i];
uppercase(word, strlen(word));
const command_t* cmd_ptr = find_command(commands, word);
printf(" %s", cmd_ptr ? cmd_ptr->cmd : "*error*");
free(word);
}
free(words);
printf("\n");
}
int main() {
command_t* commands = make_command_list(command_table);
const char* input = "riG rePEAT copies put mo rest types fup. 6 poweRin";
test(commands, input);
free_command_list(commands);
return 0;
}
| Private Function ValidateUserWords(userstring As String) As String
Dim s As String
Dim user_words() As String
Dim command_table As Scripting.Dictionary
Set command_table = New Scripting.Dictionary
Dim abbreviations As Scripting.Dictionary
Set abbreviations = New Scripting.Dictionary
abbreviations.CompareMode = TextCompare
Dim commandtable() As String
Dim commands As String
s = s & "Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy "
s = s & "COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find "
s = s & "NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput "
s = s & "Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO "
s = s & "MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT "
s = s & "READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT "
s = s & "RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up "
commandtable = Split(s, " ")
Dim i As Integer
For Each word In commandtable
If Len(word) > 0 Then
i = 1
Do While Mid(word, i, 1) >= "A" And Mid(word, i, 1) <= "Z"
i = i + 1
Loop
command_table.Add Key:=word, Item:=i - 1
End If
Next word
For Each word In command_table
For i = command_table(word) To Len(word)
On Error Resume Next
abbreviations.Add Key:=Left(word, i), Item:=UCase(word)
Next i
Next word
user_words() = Split(userstring, " ")
For Each word In user_words
If Len(word) > 0 Then
If abbreviations.exists(word) Then
commands = commands & abbreviations(word) & " "
Else
commands = commands & "*error* "
End If
End If
Next word
ValidateUserWords = commands
End Function
Public Sub program()
Dim guserstring As String
guserstring = "riG rePEAT copies put mo rest types fup. 6 poweRin"
Debug.Print "user words:", guserstring
Debug.Print "full words:", ValidateUserWords(guserstring)
End Sub
|
Convert this C block to VB, preserving its control flow and logic. | #include <stdio.h>
#include <string.h>
#include <stdlib.h>
char *codes[] = {
"AAAAA", "AAAAB", "AAABA", "AAABB", "AABAA",
"AABAB", "AABBA", "AABBB", "ABAAA", "ABAAB",
"ABABA", "ABABB", "ABBAA", "ABBAB", "ABBBA",
"ABBBB", "BAAAA", "BAAAB", "BAABA", "BAABB",
"BABAA", "BABAB", "BABBA", "BABBB", "BBAAA",
"BBAAB", "BBBAA"
};
char *get_code(const char c) {
if (c >= 97 && c <= 122) return codes[c - 97];
return codes[26];
}
char get_char(const char *code) {
int i;
if (!strcmp(codes[26], code)) return ' ';
for (i = 0; i < 26; ++i) {
if (strcmp(codes[i], code) == 0) return 97 + i;
}
printf("\nCode \"%s\" is invalid\n", code);
exit(1);
}
void str_tolower(char s[]) {
int i;
for (i = 0; i < strlen(s); ++i) s[i] = tolower(s[i]);
}
char *bacon_encode(char plain_text[], char message[]) {
int i, count;
int plen = strlen(plain_text), mlen = strlen(message);
int elen = 5 * plen;
char c;
char *p, *et, *mt;
et = malloc(elen + 1);
str_tolower(plain_text);
for (i = 0, p = et; i < plen; ++i, p += 5) {
c = plain_text[i];
strncpy(p, get_code(c), 5);
}
*++p = '\0';
str_tolower(message);
mt = calloc(mlen + 1, 1);
for (i = 0, count = 0; i < mlen; ++i) {
c = message[i];
if (c >= 'a' && c <= 'z') {
if (et[count] == 'A')
mt[i] = c;
else
mt[i] = c - 32;
if (++count == elen) break;
}
else mt[i] = c;
}
free(et);
return mt;
}
char *bacon_decode(char cipher_text[]) {
int i, count, clen = strlen(cipher_text);
int plen;
char *p, *ct, *pt;
char c, quintet[6];
ct = calloc(clen + 1, 1);
for (i = 0, count = 0; i < clen; ++i) {
c = cipher_text[i];
if (c >= 'a' && c <= 'z')
ct[count++] = 'A';
else if (c >= 'A' && c <= 'Z')
ct[count++] = 'B';
}
plen = strlen(ct) / 5;
pt = malloc(plen + 1);
for (i = 0, p = ct; i < plen; ++i, p += 5) {
strncpy(quintet, p, 5);
quintet[5] = '\0';
pt[i] = get_char(quintet);
}
pt[plen] = '\0';
free(ct);
return pt;
}
int main() {
char plain_text[] = "the quick brown fox jumps over the lazy dog";
char message[] = "bacon's cipher is a method of steganography created by francis bacon."
"this task is to implement a program for encryption and decryption of "
"plaintext using the simple alphabet of the baconian cipher or some "
"other kind of representation of this alphabet (make anything signify anything). "
"the baconian alphabet may optionally be extended to encode all lower "
"case characters individually and/or adding a few punctuation characters "
"such as the space.";
char *cipher_text, *hidden_text;
cipher_text = bacon_encode(plain_text, message);
printf("Cipher text ->\n\n%s\n", cipher_text);
hidden_text = bacon_decode(cipher_text);
printf("\nHidden text ->\n\n%s\n", hidden_text);
free(cipher_text);
free(hidden_text);
return 0;
}
| Imports System.Text
Module Module1
ReadOnly CODES As New Dictionary(Of Char, String) From {
{"a", "AAAAA"}, {"b", "AAAAB"}, {"c", "AAABA"}, {"d", "AAABB"}, {"e", "AABAA"},
{"f", "AABAB"}, {"g", "AABBA"}, {"h", "AABBB"}, {"i", "ABAAA"}, {"j", "ABAAB"},
{"k", "ABABA"}, {"l", "ABABB"}, {"m", "ABBAA"}, {"n", "ABBAB"}, {"o", "ABBBA"},
{"p", "ABBBB"}, {"q", "BAAAA"}, {"r", "BAAAB"}, {"s", "BAABA"}, {"t", "BAABB"},
{"u", "BABAA"}, {"v", "BABAB"}, {"w", "BABBA"}, {"x", "BABBB"}, {"y", "BBAAA"},
{"z", "BBAAB"}, {" ", "BBBAA"}
}
Function Encode(plainText As String, message As String) As String
Dim pt = plainText.ToLower()
Dim sb As New StringBuilder()
For Each c In pt
If "a" <= c AndAlso c <= "z" Then
sb.Append(CODES(c))
Else
sb.Append(CODES(" "))
End If
Next
Dim et = sb.ToString()
Dim mg = message.ToLower()
sb.Length = 0
Dim count = 0
For Each c In mg
If "a" <= c AndAlso c <= "z" Then
If et(count) = "A" Then
sb.Append(c)
Else
sb.Append(Chr(Asc(c) - 32))
End If
count += 1
If count = et.Length Then
Exit For
End If
Else
sb.Append(c)
End If
Next
Return sb.ToString()
End Function
Function Decode(message As String) As String
Dim sb As New StringBuilder
For Each c In message
If "a" <= c AndAlso c <= "z" Then
sb.Append("A")
ElseIf "A" <= c AndAlso c <= "Z" Then
sb.Append("B")
End If
Next
Dim et = sb.ToString()
sb.Length = 0
For index = 0 To et.Length - 1 Step 5
Dim quintet = et.Substring(index, 5)
Dim key = CODES.Where(Function(a) a.Value = quintet).First().Key
sb.Append(key)
Next
Return sb.ToString()
End Function
Sub Main()
Dim plainText = "the quick brown fox jumps over the lazy dog"
Dim message =
"bacon
"this task is to implement a program for encryption and decryption of " +
"plaintext using the simple alphabet of the baconian cipher or some " +
"other kind of representation of this alphabet (make anything signify anything). " +
"the baconian alphabet may optionally be extended to encode all lower " +
"case characters individually and/or adding a few punctuation characters " +
"such as the space."
Dim cipherText = Encode(plainText, message)
Console.WriteLine("Cipher text ->" & Environment.NewLine & "{0}", cipherText)
Dim decodedText = Decode(cipherText)
Console.WriteLine(Environment.NewLine & "Hidden text ->" & Environment.NewLine & "{0}", decodedText)
End Sub
End Module
|
Port the provided C code into VB while preserving the original functionality. | #include <stdio.h>
#include <string.h>
#include <stdlib.h>
char *codes[] = {
"AAAAA", "AAAAB", "AAABA", "AAABB", "AABAA",
"AABAB", "AABBA", "AABBB", "ABAAA", "ABAAB",
"ABABA", "ABABB", "ABBAA", "ABBAB", "ABBBA",
"ABBBB", "BAAAA", "BAAAB", "BAABA", "BAABB",
"BABAA", "BABAB", "BABBA", "BABBB", "BBAAA",
"BBAAB", "BBBAA"
};
char *get_code(const char c) {
if (c >= 97 && c <= 122) return codes[c - 97];
return codes[26];
}
char get_char(const char *code) {
int i;
if (!strcmp(codes[26], code)) return ' ';
for (i = 0; i < 26; ++i) {
if (strcmp(codes[i], code) == 0) return 97 + i;
}
printf("\nCode \"%s\" is invalid\n", code);
exit(1);
}
void str_tolower(char s[]) {
int i;
for (i = 0; i < strlen(s); ++i) s[i] = tolower(s[i]);
}
char *bacon_encode(char plain_text[], char message[]) {
int i, count;
int plen = strlen(plain_text), mlen = strlen(message);
int elen = 5 * plen;
char c;
char *p, *et, *mt;
et = malloc(elen + 1);
str_tolower(plain_text);
for (i = 0, p = et; i < plen; ++i, p += 5) {
c = plain_text[i];
strncpy(p, get_code(c), 5);
}
*++p = '\0';
str_tolower(message);
mt = calloc(mlen + 1, 1);
for (i = 0, count = 0; i < mlen; ++i) {
c = message[i];
if (c >= 'a' && c <= 'z') {
if (et[count] == 'A')
mt[i] = c;
else
mt[i] = c - 32;
if (++count == elen) break;
}
else mt[i] = c;
}
free(et);
return mt;
}
char *bacon_decode(char cipher_text[]) {
int i, count, clen = strlen(cipher_text);
int plen;
char *p, *ct, *pt;
char c, quintet[6];
ct = calloc(clen + 1, 1);
for (i = 0, count = 0; i < clen; ++i) {
c = cipher_text[i];
if (c >= 'a' && c <= 'z')
ct[count++] = 'A';
else if (c >= 'A' && c <= 'Z')
ct[count++] = 'B';
}
plen = strlen(ct) / 5;
pt = malloc(plen + 1);
for (i = 0, p = ct; i < plen; ++i, p += 5) {
strncpy(quintet, p, 5);
quintet[5] = '\0';
pt[i] = get_char(quintet);
}
pt[plen] = '\0';
free(ct);
return pt;
}
int main() {
char plain_text[] = "the quick brown fox jumps over the lazy dog";
char message[] = "bacon's cipher is a method of steganography created by francis bacon."
"this task is to implement a program for encryption and decryption of "
"plaintext using the simple alphabet of the baconian cipher or some "
"other kind of representation of this alphabet (make anything signify anything). "
"the baconian alphabet may optionally be extended to encode all lower "
"case characters individually and/or adding a few punctuation characters "
"such as the space.";
char *cipher_text, *hidden_text;
cipher_text = bacon_encode(plain_text, message);
printf("Cipher text ->\n\n%s\n", cipher_text);
hidden_text = bacon_decode(cipher_text);
printf("\nHidden text ->\n\n%s\n", hidden_text);
free(cipher_text);
free(hidden_text);
return 0;
}
| Imports System.Text
Module Module1
ReadOnly CODES As New Dictionary(Of Char, String) From {
{"a", "AAAAA"}, {"b", "AAAAB"}, {"c", "AAABA"}, {"d", "AAABB"}, {"e", "AABAA"},
{"f", "AABAB"}, {"g", "AABBA"}, {"h", "AABBB"}, {"i", "ABAAA"}, {"j", "ABAAB"},
{"k", "ABABA"}, {"l", "ABABB"}, {"m", "ABBAA"}, {"n", "ABBAB"}, {"o", "ABBBA"},
{"p", "ABBBB"}, {"q", "BAAAA"}, {"r", "BAAAB"}, {"s", "BAABA"}, {"t", "BAABB"},
{"u", "BABAA"}, {"v", "BABAB"}, {"w", "BABBA"}, {"x", "BABBB"}, {"y", "BBAAA"},
{"z", "BBAAB"}, {" ", "BBBAA"}
}
Function Encode(plainText As String, message As String) As String
Dim pt = plainText.ToLower()
Dim sb As New StringBuilder()
For Each c In pt
If "a" <= c AndAlso c <= "z" Then
sb.Append(CODES(c))
Else
sb.Append(CODES(" "))
End If
Next
Dim et = sb.ToString()
Dim mg = message.ToLower()
sb.Length = 0
Dim count = 0
For Each c In mg
If "a" <= c AndAlso c <= "z" Then
If et(count) = "A" Then
sb.Append(c)
Else
sb.Append(Chr(Asc(c) - 32))
End If
count += 1
If count = et.Length Then
Exit For
End If
Else
sb.Append(c)
End If
Next
Return sb.ToString()
End Function
Function Decode(message As String) As String
Dim sb As New StringBuilder
For Each c In message
If "a" <= c AndAlso c <= "z" Then
sb.Append("A")
ElseIf "A" <= c AndAlso c <= "Z" Then
sb.Append("B")
End If
Next
Dim et = sb.ToString()
sb.Length = 0
For index = 0 To et.Length - 1 Step 5
Dim quintet = et.Substring(index, 5)
Dim key = CODES.Where(Function(a) a.Value = quintet).First().Key
sb.Append(key)
Next
Return sb.ToString()
End Function
Sub Main()
Dim plainText = "the quick brown fox jumps over the lazy dog"
Dim message =
"bacon
"this task is to implement a program for encryption and decryption of " +
"plaintext using the simple alphabet of the baconian cipher or some " +
"other kind of representation of this alphabet (make anything signify anything). " +
"the baconian alphabet may optionally be extended to encode all lower " +
"case characters individually and/or adding a few punctuation characters " +
"such as the space."
Dim cipherText = Encode(plainText, message)
Console.WriteLine("Cipher text ->" & Environment.NewLine & "{0}", cipherText)
Dim decodedText = Decode(cipherText)
Console.WriteLine(Environment.NewLine & "Hidden text ->" & Environment.NewLine & "{0}", decodedText)
End Sub
End Module
|
Keep all operations the same but rewrite the snippet in VB. | #include <stdio.h>
#include <stdlib.h>
#define valid(i, j) 0 <= i && i < m && 0 <= j && j < n && !s[i][j]
int main(int c, char **v)
{
int i, j, m = 0, n = 0;
if (c >= 2) m = atoi(v[1]);
if (c >= 3) n = atoi(v[2]);
if (m <= 0) m = 5;
if (n <= 0) n = m;
int **s = calloc(1, sizeof(int *) * m + sizeof(int) * m * n);
s[0] = (int*)(s + m);
for (i = 1; i < m; i++) s[i] = s[i - 1] + n;
int dx = 1, dy = 0, val = 0, t;
for (i = j = 0; valid(i, j); i += dy, j += dx ) {
for (; valid(i, j); j += dx, i += dy)
s[i][j] = ++val;
j -= dx; i -= dy;
t = dy; dy = dx; dx = -t;
}
for (t = 2; val /= 10; t++);
for(i = 0; i < m; i++)
for(j = 0; j < n || !putchar('\n'); j++)
printf("%*d", t, s[i][j]);
return 0;
}
| Function build_spiral(n)
botcol = 0 : topcol = n - 1
botrow = 0 : toprow = n - 1
Dim matrix()
ReDim matrix(topcol,toprow)
dir = 0 : col = 0 : row = 0
For i = 0 To n*n-1
matrix(col,row) = i
Select Case dir
Case 0
If col < topcol Then
col = col + 1
Else
dir = 1 : row = row + 1 : botrow = botrow + 1
End If
Case 1
If row < toprow Then
row = row + 1
Else
dir = 2 : col = col - 1 : topcol = topcol - 1
End If
Case 2
If col > botcol Then
col = col - 1
Else
dir = 3 : row = row - 1 : toprow = toprow - 1
End If
Case 3
If row > botrow Then
row = row - 1
Else
dir = 0 : col = col + 1 : botcol = botcol + 1
End If
End Select
Next
For y = 0 To n-1
For x = 0 To n-1
WScript.StdOut.Write matrix(x,y) & vbTab
Next
WScript.StdOut.WriteLine
Next
End Function
build_spiral(CInt(WScript.Arguments(0)))
|
Translate this program into VB but keep the logic exactly as in C. | #include <stdio.h>
#include <stdlib.h>
#define valid(i, j) 0 <= i && i < m && 0 <= j && j < n && !s[i][j]
int main(int c, char **v)
{
int i, j, m = 0, n = 0;
if (c >= 2) m = atoi(v[1]);
if (c >= 3) n = atoi(v[2]);
if (m <= 0) m = 5;
if (n <= 0) n = m;
int **s = calloc(1, sizeof(int *) * m + sizeof(int) * m * n);
s[0] = (int*)(s + m);
for (i = 1; i < m; i++) s[i] = s[i - 1] + n;
int dx = 1, dy = 0, val = 0, t;
for (i = j = 0; valid(i, j); i += dy, j += dx ) {
for (; valid(i, j); j += dx, i += dy)
s[i][j] = ++val;
j -= dx; i -= dy;
t = dy; dy = dx; dx = -t;
}
for (t = 2; val /= 10; t++);
for(i = 0; i < m; i++)
for(j = 0; j < n || !putchar('\n'); j++)
printf("%*d", t, s[i][j]);
return 0;
}
| Function build_spiral(n)
botcol = 0 : topcol = n - 1
botrow = 0 : toprow = n - 1
Dim matrix()
ReDim matrix(topcol,toprow)
dir = 0 : col = 0 : row = 0
For i = 0 To n*n-1
matrix(col,row) = i
Select Case dir
Case 0
If col < topcol Then
col = col + 1
Else
dir = 1 : row = row + 1 : botrow = botrow + 1
End If
Case 1
If row < toprow Then
row = row + 1
Else
dir = 2 : col = col - 1 : topcol = topcol - 1
End If
Case 2
If col > botcol Then
col = col - 1
Else
dir = 3 : row = row - 1 : toprow = toprow - 1
End If
Case 3
If row > botrow Then
row = row - 1
Else
dir = 0 : col = col + 1 : botcol = botcol + 1
End If
End Select
Next
For y = 0 To n-1
For x = 0 To n-1
WScript.StdOut.Write matrix(x,y) & vbTab
Next
WScript.StdOut.WriteLine
Next
End Function
build_spiral(CInt(WScript.Arguments(0)))
|
Please provide an equivalent version of this C code in VB. | #include <stdlib.h>
#include <stdarg.h>
#include <stdio.h>
#include <ctype.h>
#include <string.h>
typedef const char * String;
typedef struct sTable {
String * *rows;
int n_rows,n_cols;
} *Table;
typedef int (*CompareFctn)(String a, String b);
struct {
CompareFctn compare;
int column;
int reversed;
} sortSpec;
int CmprRows( const void *aa, const void *bb)
{
String *rA = *(String *const *)aa;
String *rB = *(String *const *)bb;
int sortCol = sortSpec.column;
String left = sortSpec.reversed ? rB[sortCol] : rA[sortCol];
String right = sortSpec.reversed ? rA[sortCol] : rB[sortCol];
return sortSpec.compare( left, right );
}
int sortTable(Table tbl, const char* argSpec,... )
{
va_list vl;
const char *p;
int c;
sortSpec.compare = &strcmp;
sortSpec.column = 0;
sortSpec.reversed = 0;
va_start(vl, argSpec);
if (argSpec)
for (p=argSpec; *p; p++) {
switch (*p) {
case 'o':
sortSpec.compare = va_arg(vl,CompareFctn);
break;
case 'c':
c = va_arg(vl,int);
if ( 0<=c && c<tbl->n_cols)
sortSpec.column = c;
break;
case 'r':
sortSpec.reversed = (0!=va_arg(vl,int));
break;
}
}
va_end(vl);
qsort( tbl->rows, tbl->n_rows, sizeof(String *), CmprRows);
return 0;
}
void printTable( Table tbl, FILE *fout, const char *colFmts[])
{
int row, col;
for (row=0; row<tbl->n_rows; row++) {
fprintf(fout, " ");
for(col=0; col<tbl->n_cols; col++) {
fprintf(fout, colFmts[col], tbl->rows[row][col]);
}
fprintf(fout, "\n");
}
fprintf(fout, "\n");
}
int ord(char v)
{
return v-'0';
}
int cmprStrgs(String s1, String s2)
{
const char *p1 = s1;
const char *p2 = s2;
const char *mrk1, *mrk2;
while ((tolower(*p1) == tolower(*p2)) && *p1) {
p1++; p2++;
}
if (isdigit(*p1) && isdigit(*p2)) {
long v1, v2;
if ((*p1 == '0') ||(*p2 == '0')) {
while (p1 > s1) {
p1--; p2--;
if (*p1 != '0') break;
}
if (!isdigit(*p1)) {
p1++; p2++;
}
}
mrk1 = p1; mrk2 = p2;
v1 = 0;
while(isdigit(*p1)) {
v1 = 10*v1+ord(*p1);
p1++;
}
v2 = 0;
while(isdigit(*p2)) {
v2 = 10*v2+ord(*p2);
p2++;
}
if (v1 == v2)
return(p2-mrk2)-(p1-mrk1);
return v1 - v2;
}
if (tolower(*p1) != tolower(*p2))
return (tolower(*p1) - tolower(*p2));
for(p1=s1, p2=s2; (*p1 == *p2) && *p1; p1++, p2++);
return (*p1 -*p2);
}
int main()
{
const char *colFmts[] = {" %-5.5s"," %-5.5s"," %-9.9s"};
String r1[] = { "a101", "red", "Java" };
String r2[] = { "ab40", "gren", "Smalltalk" };
String r3[] = { "ab9", "blue", "Fortran" };
String r4[] = { "ab09", "ylow", "Python" };
String r5[] = { "ab1a", "blak", "Factor" };
String r6[] = { "ab1b", "brwn", "C Sharp" };
String r7[] = { "Ab1b", "pink", "Ruby" };
String r8[] = { "ab1", "orng", "Scheme" };
String *rows[] = { r1, r2, r3, r4, r5, r6, r7, r8 };
struct sTable table;
table.rows = rows;
table.n_rows = 8;
table.n_cols = 3;
sortTable(&table, "");
printf("sort on col 0, ascending\n");
printTable(&table, stdout, colFmts);
sortTable(&table, "ro", 1, &cmprStrgs);
printf("sort on col 0, reverse.special\n");
printTable(&table, stdout, colFmts);
sortTable(&table, "c", 1);
printf("sort on col 1, ascending\n");
printTable(&table, stdout, colFmts);
sortTable(&table, "cr", 2, 1);
printf("sort on col 2, reverse\n");
printTable(&table, stdout, colFmts);
return 0;
}
| Private Sub optional_parameters(theRange As String, _
Optional ordering As Integer = 0, _
Optional column As Integer = 1, _
Optional reverse As Integer = 1)
ActiveSheet.Sort.SortFields.Clear
ActiveSheet.Sort.SortFields.Add _
Key:=Range(theRange).Columns(column), _
SortOn:=SortOnValues, _
Order:=reverse, _
DataOption:=ordering
With ActiveSheet.Sort
.SetRange Range(theRange)
.Header = xlGuess
.MatchCase = False
.Orientation = xlTopToBottom
.SortMethod = xlPinYin
.Apply
End With
End Sub
Public Sub main()
optional_parameters theRange:="A1:C4", ordering:=1, column:=2, reverse:=1
End Sub
|
Write the same code in VB as shown below in C. |
#include <stdio.h>
void sayHello(char* name){
printf("Hello %s!\n", name);
}
int doubleNum(int num){
return num * 2;
}
| Declare Function CreateFileW Lib "Kernel32" (FileName As WString, DesiredAccess As Integer, ShareMode As Integer, SecurityAttributes As Integer, _
CreateDisposition As Integer, Flags As Integer, Template As Integer) As Integer
Declare Function WriteFile Lib "Kernel32" (fHandle As Integer, writeData As Ptr, numOfBytes As Integer, ByRef numOfBytesWritten As Integer, _
overlapped As Ptr) As Boolean
Declare Function GetLastError Lib "Kernel32" () As Integer
Declare Function CloseHandle Lib "kernel32" (hObject As Integer) As Boolean
Const FILE_SHARE_READ = &h00000001
Const FILE_SHARE_WRITE = &h00000002
Const OPEN_EXISTING = 3
Dim fHandle As Integer = CreateFileW("C:\foo.txt", 0, FILE_SHARE_READ Or FILE_SHARE_WRITE, 0, OPEN_EXISTING, 0, 0)
If fHandle > 0 Then
Dim mb As MemoryBlock = "Hello, World!"
Dim bytesWritten As Integer
If Not WriteFile(fHandle, mb, mb.Size, bytesWritten, Nil) Then
MsgBox("Error Number: " + Str(GetLastError))
End If
Call CloseHandle(fHandle)
Else
MsgBox("Error Number: " + Str(GetLastError))
End If
|
Port the provided C code into VB while preserving the original functionality. | #include <stdbool.h>
#include <stdio.h>
#include <stdlib.h>
#include <string.h>
int binomial(int n, int k) {
int num, denom, i;
if (n < 0 || k < 0 || n < k) return -1;
if (n == 0 || k == 0) return 1;
num = 1;
for (i = k + 1; i <= n; ++i) {
num = num * i;
}
denom = 1;
for (i = 2; i <= n - k; ++i) {
denom *= i;
}
return num / denom;
}
int gcd(int a, int b) {
int temp;
while (b != 0) {
temp = a % b;
a = b;
b = temp;
}
return a;
}
typedef struct tFrac {
int num, denom;
} Frac;
Frac makeFrac(int n, int d) {
Frac result;
int g;
if (d == 0) {
result.num = 0;
result.denom = 0;
return result;
}
if (n == 0) {
d = 1;
} else if (d < 0) {
n = -n;
d = -d;
}
g = abs(gcd(n, d));
if (g > 1) {
n = n / g;
d = d / g;
}
result.num = n;
result.denom = d;
return result;
}
Frac negateFrac(Frac f) {
return makeFrac(-f.num, f.denom);
}
Frac subFrac(Frac lhs, Frac rhs) {
return makeFrac(lhs.num * rhs.denom - lhs.denom * rhs.num, rhs.denom * lhs.denom);
}
Frac multFrac(Frac lhs, Frac rhs) {
return makeFrac(lhs.num * rhs.num, lhs.denom * rhs.denom);
}
bool equalFrac(Frac lhs, Frac rhs) {
return (lhs.num == rhs.num) && (lhs.denom == rhs.denom);
}
bool lessFrac(Frac lhs, Frac rhs) {
return (lhs.num * rhs.denom) < (rhs.num * lhs.denom);
}
void printFrac(Frac f) {
char buffer[7];
int len;
if (f.denom != 1) {
snprintf(buffer, 7, "%d/%d", f.num, f.denom);
} else {
snprintf(buffer, 7, "%d", f.num);
}
len = 7 - strlen(buffer);
while (len-- > 0) {
putc(' ', stdout);
}
printf(buffer);
}
Frac bernoulli(int n) {
Frac a[16];
int j, m;
if (n < 0) {
a[0].num = 0;
a[0].denom = 0;
return a[0];
}
for (m = 0; m <= n; ++m) {
a[m] = makeFrac(1, m + 1);
for (j = m; j >= 1; --j) {
a[j - 1] = multFrac(subFrac(a[j - 1], a[j]), makeFrac(j, 1));
}
}
if (n != 1) {
return a[0];
}
return negateFrac(a[0]);
}
void faulhaber(int p) {
Frac q, *coeffs;
int j, sign;
coeffs = malloc(sizeof(Frac)*(p + 1));
q = makeFrac(1, p + 1);
sign = -1;
for (j = 0; j <= p; ++j) {
sign = -1 * sign;
coeffs[p - j] = multFrac(multFrac(multFrac(q, makeFrac(sign, 1)), makeFrac(binomial(p + 1, j), 1)), bernoulli(j));
}
for (j = 0; j <= p; ++j) {
printFrac(coeffs[j]);
}
printf("\n");
free(coeffs);
}
int main() {
int i;
for (i = 0; i < 10; ++i) {
faulhaber(i);
}
return 0;
}
| Module Module1
Class Frac
Private ReadOnly num As Long
Private ReadOnly denom As Long
Public Shared ReadOnly ZERO = New Frac(0, 1)
Public Shared ReadOnly ONE = New Frac(1, 1)
Public Sub New(n As Long, d As Long)
If d = 0 Then
Throw New ArgumentException("d must not be zero")
End If
Dim nn = n
Dim dd = d
If nn = 0 Then
dd = 1
ElseIf dd < 0 Then
nn = -nn
dd = -dd
End If
Dim g = Math.Abs(Gcd(nn, dd))
If g > 1 Then
nn /= g
dd /= g
End If
num = nn
denom = dd
End Sub
Private Shared Function Gcd(a As Long, b As Long) As Long
If b = 0 Then
Return a
Else
Return Gcd(b, a Mod b)
End If
End Function
Public Shared Operator -(self As Frac) As Frac
Return New Frac(-self.num, self.denom)
End Operator
Public Shared Operator +(lhs As Frac, rhs As Frac) As Frac
Return New Frac(lhs.num * rhs.denom + lhs.denom * rhs.num, rhs.denom * lhs.denom)
End Operator
Public Shared Operator -(lhs As Frac, rhs As Frac) As Frac
Return lhs + -rhs
End Operator
Public Shared Operator *(lhs As Frac, rhs As Frac) As Frac
Return New Frac(lhs.num * rhs.num, lhs.denom * rhs.denom)
End Operator
Public Shared Operator <(lhs As Frac, rhs As Frac) As Boolean
Dim x = lhs.num / lhs.denom
Dim y = rhs.num / rhs.denom
Return x < y
End Operator
Public Shared Operator >(lhs As Frac, rhs As Frac) As Boolean
Dim x = lhs.num / lhs.denom
Dim y = rhs.num / rhs.denom
Return x > y
End Operator
Public Shared Operator =(lhs As Frac, rhs As Frac) As Boolean
Return lhs.num = rhs.num AndAlso lhs.denom = rhs.denom
End Operator
Public Shared Operator <>(lhs As Frac, rhs As Frac) As Boolean
Return lhs.num <> rhs.num OrElse lhs.denom <> rhs.denom
End Operator
Public Overrides Function ToString() As String
If denom = 1 Then
Return num.ToString
Else
Return String.Format("{0}/{1}", num, denom)
End If
End Function
Public Overrides Function Equals(obj As Object) As Boolean
Dim frac = CType(obj, Frac)
Return Not IsNothing(frac) AndAlso num = frac.num AndAlso denom = frac.denom
End Function
End Class
Function Bernoulli(n As Integer) As Frac
If n < 0 Then
Throw New ArgumentException("n may not be negative or zero")
End If
Dim a(n + 1) As Frac
For m = 0 To n
a(m) = New Frac(1, m + 1)
For j = m To 1 Step -1
a(j - 1) = (a(j - 1) - a(j)) * New Frac(j, 1)
Next
Next
If n <> 1 Then
Return a(0)
Else
Return -a(0)
End If
End Function
Function Binomial(n As Integer, k As Integer) As Integer
If n < 0 OrElse k < 0 OrElse n < k Then
Throw New ArgumentException()
End If
If n = 0 OrElse k = 0 Then
Return 1
End If
Dim num = 1
For i = k + 1 To n
num *= i
Next
Dim denom = 1
For i = 2 To n - k
denom *= i
Next
Return num \ denom
End Function
Function FaulhaberTriangle(p As Integer) As Frac()
Dim coeffs(p + 1) As Frac
For i = 1 To p + 1
coeffs(i - 1) = Frac.ZERO
Next
Dim q As New Frac(1, p + 1)
Dim sign = -1
For j = 0 To p
sign *= -1
coeffs(p - j) = q * New Frac(sign, 1) * New Frac(Binomial(p + 1, j), 1) * Bernoulli(j)
Next
Return coeffs
End Function
Sub Main()
For i = 1 To 10
Dim coeffs = FaulhaberTriangle(i - 1)
For Each coeff In coeffs
Console.Write("{0,5} ", coeff)
Next
Console.WriteLine()
Next
End Sub
End Module
|
Rewrite this program in VB while keeping its functionality equivalent to the C version. | #include <stdlib.h>
#include <stdio.h>
int main(int argc, char* argv[])
{
int i;
(void) printf("This program is named %s.\n", argv[0]);
for (i = 1; i < argc; ++i)
(void) printf("the argument #%d is %s\n", i, argv[i]);
return EXIT_SUCCESS;
}
| Function Run(args() as String) As Integer
For each arg As String In args
Stdout.WriteLine(arg)
Next
End Function
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.