Instruction
stringlengths
45
106
input_code
stringlengths
1
13.7k
output_code
stringlengths
1
13.7k
Convert this PHP block to Java, preserving its control flow and logic.
<?php header("Content-type: image/png"); $width = 512; $height = 512; $img = imagecreatetruecolor($width,$height); $bg = imagecolorallocate($img,255,255,255); imagefilledrectangle($img, 0, 0, $width, $width, $bg); $depth = 8; function drawTree($x1, $y1, $angle, $depth){ global $img; if ($depth != 0){ $x2 = $x1 + (int)(cos(deg2rad($angle)) * $depth * 10.0); $y2 = $y1 + (int)(sin(deg2rad($angle)) * $depth * 10.0); imageline($img, $x1, $y1, $x2, $y2, imagecolorallocate($img,0,0,0)); drawTree($x2, $y2, $angle - 20, $depth - 1); drawTree($x2, $y2, $angle + 20, $depth - 1); } } drawTree($width/2, $height, -90, $depth); imagepng($img); imagedestroy($img); ?>
import java.awt.Color; import java.awt.Graphics; import javax.swing.JFrame; public class FractalTree extends JFrame { public FractalTree() { super("Fractal Tree"); setBounds(100, 100, 800, 600); setResizable(false); setDefaultCloseOperation(EXIT_ON_CLOSE); } private void drawTree(Graphics g, int x1, int y1, double angle, int depth) { if (depth == 0) return; int x2 = x1 + (int) (Math.cos(Math.toRadians(angle)) * depth * 10.0); int y2 = y1 + (int) (Math.sin(Math.toRadians(angle)) * depth * 10.0); g.drawLine(x1, y1, x2, y2); drawTree(g, x2, y2, angle - 20, depth - 1); drawTree(g, x2, y2, angle + 20, depth - 1); } @Override public void paint(Graphics g) { g.setColor(Color.BLACK); drawTree(g, 400, 500, -90, 9); } public static void main(String[] args) { new FractalTree().setVisible(true); } }
Transform the following PHP implementation into Java, maintaining the same output and logic.
<?php header("Content-type: image/png"); $width = 512; $height = 512; $img = imagecreatetruecolor($width,$height); $bg = imagecolorallocate($img,255,255,255); imagefilledrectangle($img, 0, 0, $width, $width, $bg); $depth = 8; function drawTree($x1, $y1, $angle, $depth){ global $img; if ($depth != 0){ $x2 = $x1 + (int)(cos(deg2rad($angle)) * $depth * 10.0); $y2 = $y1 + (int)(sin(deg2rad($angle)) * $depth * 10.0); imageline($img, $x1, $y1, $x2, $y2, imagecolorallocate($img,0,0,0)); drawTree($x2, $y2, $angle - 20, $depth - 1); drawTree($x2, $y2, $angle + 20, $depth - 1); } } drawTree($width/2, $height, -90, $depth); imagepng($img); imagedestroy($img); ?>
import java.awt.Color; import java.awt.Graphics; import javax.swing.JFrame; public class FractalTree extends JFrame { public FractalTree() { super("Fractal Tree"); setBounds(100, 100, 800, 600); setResizable(false); setDefaultCloseOperation(EXIT_ON_CLOSE); } private void drawTree(Graphics g, int x1, int y1, double angle, int depth) { if (depth == 0) return; int x2 = x1 + (int) (Math.cos(Math.toRadians(angle)) * depth * 10.0); int y2 = y1 + (int) (Math.sin(Math.toRadians(angle)) * depth * 10.0); g.drawLine(x1, y1, x2, y2); drawTree(g, x2, y2, angle - 20, depth - 1); drawTree(g, x2, y2, angle + 20, depth - 1); } @Override public void paint(Graphics g) { g.setColor(Color.BLACK); drawTree(g, 400, 500, -90, 9); } public static void main(String[] args) { new FractalTree().setVisible(true); } }
Write the same code in Java as shown below in PHP.
<?php function gray_encode($binary){ return $binary ^ ($binary >> 1); } function gray_decode($gray){ $binary = $gray; while($gray >>= 1) $binary ^= $gray; return $binary; } for($i=0;$i<32;$i++){ $gray_encoded = gray_encode($i); printf("%2d : %05b => %05b => %05b : %2d \n",$i, $i, $gray_encoded, $gray_encoded, gray_decode($gray_encoded)); }
public class Gray { public static long grayEncode(long n){ return n ^ (n >>> 1); } public static long grayDecode(long n) { long p = n; while ((n >>>= 1) != 0) p ^= n; return p; } public static void main(String[] args){ System.out.println("i\tBinary\tGray\tDecoded"); for(int i = -1; i < 32;i++){ System.out.print(i +"\t"); System.out.print(Integer.toBinaryString(i) + "\t"); System.out.print(Long.toBinaryString(grayEncode(i))+ "\t"); System.out.println(grayDecode(grayEncode(i))); } } }
Change the following PHP code into Java without altering its purpose.
<?php function gray_encode($binary){ return $binary ^ ($binary >> 1); } function gray_decode($gray){ $binary = $gray; while($gray >>= 1) $binary ^= $gray; return $binary; } for($i=0;$i<32;$i++){ $gray_encoded = gray_encode($i); printf("%2d : %05b => %05b => %05b : %2d \n",$i, $i, $gray_encoded, $gray_encoded, gray_decode($gray_encoded)); }
public class Gray { public static long grayEncode(long n){ return n ^ (n >>> 1); } public static long grayDecode(long n) { long p = n; while ((n >>>= 1) != 0) p ^= n; return p; } public static void main(String[] args){ System.out.println("i\tBinary\tGray\tDecoded"); for(int i = -1; i < 32;i++){ System.out.print(i +"\t"); System.out.print(Integer.toBinaryString(i) + "\t"); System.out.print(Long.toBinaryString(grayEncode(i))+ "\t"); System.out.println(grayDecode(grayEncode(i))); } } }
Convert the following code from PHP to Java, ensuring the logic remains intact.
<?php function gray_encode($binary){ return $binary ^ ($binary >> 1); } function gray_decode($gray){ $binary = $gray; while($gray >>= 1) $binary ^= $gray; return $binary; } for($i=0;$i<32;$i++){ $gray_encoded = gray_encode($i); printf("%2d : %05b => %05b => %05b : %2d \n",$i, $i, $gray_encoded, $gray_encoded, gray_decode($gray_encoded)); }
public class Gray { public static long grayEncode(long n){ return n ^ (n >>> 1); } public static long grayDecode(long n) { long p = n; while ((n >>>= 1) != 0) p ^= n; return p; } public static void main(String[] args){ System.out.println("i\tBinary\tGray\tDecoded"); for(int i = -1; i < 32;i++){ System.out.print(i +"\t"); System.out.print(Integer.toBinaryString(i) + "\t"); System.out.print(Long.toBinaryString(grayEncode(i))+ "\t"); System.out.println(grayDecode(grayEncode(i))); } } }
Transform the following PHP implementation into Java, maintaining the same output and logic.
<?php function gray_encode($binary){ return $binary ^ ($binary >> 1); } function gray_decode($gray){ $binary = $gray; while($gray >>= 1) $binary ^= $gray; return $binary; } for($i=0;$i<32;$i++){ $gray_encoded = gray_encode($i); printf("%2d : %05b => %05b => %05b : %2d \n",$i, $i, $gray_encoded, $gray_encoded, gray_decode($gray_encoded)); }
public class Gray { public static long grayEncode(long n){ return n ^ (n >>> 1); } public static long grayDecode(long n) { long p = n; while ((n >>>= 1) != 0) p ^= n; return p; } public static void main(String[] args){ System.out.println("i\tBinary\tGray\tDecoded"); for(int i = -1; i < 32;i++){ System.out.print(i +"\t"); System.out.print(Integer.toBinaryString(i) + "\t"); System.out.print(Long.toBinaryString(grayEncode(i))+ "\t"); System.out.println(grayDecode(grayEncode(i))); } } }
Produce a functionally identical Java code for the snippet given in PHP.
class Card { protected static $suits = array( '♠', '♥', '♦', '♣' ); protected static $pips = array( '2', '3', '4', '5', '6', '7', '8', '9', 'T', 'J', 'Q', 'K', 'A' ); protected $suit; protected $suitOrder; protected $pip; protected $pipOrder; protected $order; public function __construct( $suit, $pip ) { if( !in_array( $suit, self::$suits ) ) { throw new InvalidArgumentException( 'Invalid suit' ); } if( !in_array( $pip, self::$pips ) ) { throw new InvalidArgumentException( 'Invalid pip' ); } $this->suit = $suit; $this->pip = $pip; } public function getSuit() { return $this->suit; } public function getPip() { return $this->pip; } public function getSuitOrder() { if( !isset( $this->suitOrder ) ) { $this->suitOrder = array_search( $this->suit, self::$suits ); } return $this->suitOrder; } public function getPipOrder() { if( !isset( $this->pipOrder ) ) { $this->pipOrder = array_search( $this->pip, self::$pips ); } return $this->pipOrder; } public function getOrder() { if( !isset( $this->order ) ) { $suitOrder = $this->getSuitOrder(); $pipOrder = $this->getPipOrder(); $this->order = $pipOrder * count( self::$suits ) + $suitOrder; } return $this->order; } public function compareSuit( Card $other ) { return $this->getSuitOrder() - $other->getSuitOrder(); } public function comparePip( Card $other ) { return $this->getPipOrder() - $other->getPipOrder(); } public function compare( Card $other ) { return $this->getOrder() - $other->getOrder(); } public function __toString() { return $this->suit . $this->pip; } public static function getSuits() { return self::$suits; } public static function getPips() { return self::$pips; } } class CardCollection implements Countable, Iterator { protected $cards = array(); protected function __construct( array $cards = array() ) { foreach( $cards as $card ) { $this->addCard( $card ); } } public function count() { return count( $this->cards ); } public function key() { return key( $this->cards ); } public function valid() { return null !== $this->key(); } public function next() { next( $this->cards ); } public function current() { return current( $this->cards ); } public function rewind() { reset( $this->cards ); } public function sort( $comparer = null ) { $comparer = $comparer ?: function( $a, $b ) { return $a->compare( $b ); }; if( !is_callable( $comparer ) ) { throw new InvalidArgumentException( 'Invalid comparer; comparer should be callable' ); } usort( $this->cards, $comparer ); return $this; } public function toString() { return implode( ' ', $this->cards ); } public function __toString() { return $this->toString(); } protected function addCard( Card $card ) { if( in_array( $card, $this->cards ) ) { throw new DomainException( 'Card is already present in this collection' ); } $this->cards[] = $card; } } class Deck extends CardCollection { public function __construct( $shuffled = false ) { foreach( Card::getSuits() as $suit ) { foreach( Card::getPips() as $pip ) { $this->addCard( new Card( $suit, $pip ) ); } } if( $shuffled ) { $this->shuffle(); } } public function deal( $amount = 1, CardCollection $cardCollection = null ) { if( !is_int( $amount ) || $amount < 1 ) { throw new InvalidArgumentException( 'Invalid amount; amount should be an integer, larger than 0' ); } if( $amount > count( $this->cards ) ) { throw new RangeException( 'Invalid amount; requested amount is larger than the amount of available cards' ); } $cards = array_splice( $this->cards, 0, $amount ); $cardCollection = $cardCollection ?: new CardCollection; foreach( $cards as $card ) { $cardCollection->addCard( $card ); } return $cardCollection; } public function shuffle() { shuffle( $this->cards ); } } class Hand extends CardCollection { public function __construct() {} public function play( $position ) { if( !isset( $this->cards[ $position ] ) ) { throw new OutOfBoundsException( 'Invalid position; position is not present in this hand' ); } $result = array_splice( $this->cards, $position, 1 ); return $result[ 0 ]; } }
public enum Pip { Two, Three, Four, Five, Six, Seven, Eight, Nine, Ten, Jack, Queen, King, Ace }
Please provide an equivalent version of this PHP code in Java.
class Card { protected static $suits = array( '♠', '♥', '♦', '♣' ); protected static $pips = array( '2', '3', '4', '5', '6', '7', '8', '9', 'T', 'J', 'Q', 'K', 'A' ); protected $suit; protected $suitOrder; protected $pip; protected $pipOrder; protected $order; public function __construct( $suit, $pip ) { if( !in_array( $suit, self::$suits ) ) { throw new InvalidArgumentException( 'Invalid suit' ); } if( !in_array( $pip, self::$pips ) ) { throw new InvalidArgumentException( 'Invalid pip' ); } $this->suit = $suit; $this->pip = $pip; } public function getSuit() { return $this->suit; } public function getPip() { return $this->pip; } public function getSuitOrder() { if( !isset( $this->suitOrder ) ) { $this->suitOrder = array_search( $this->suit, self::$suits ); } return $this->suitOrder; } public function getPipOrder() { if( !isset( $this->pipOrder ) ) { $this->pipOrder = array_search( $this->pip, self::$pips ); } return $this->pipOrder; } public function getOrder() { if( !isset( $this->order ) ) { $suitOrder = $this->getSuitOrder(); $pipOrder = $this->getPipOrder(); $this->order = $pipOrder * count( self::$suits ) + $suitOrder; } return $this->order; } public function compareSuit( Card $other ) { return $this->getSuitOrder() - $other->getSuitOrder(); } public function comparePip( Card $other ) { return $this->getPipOrder() - $other->getPipOrder(); } public function compare( Card $other ) { return $this->getOrder() - $other->getOrder(); } public function __toString() { return $this->suit . $this->pip; } public static function getSuits() { return self::$suits; } public static function getPips() { return self::$pips; } } class CardCollection implements Countable, Iterator { protected $cards = array(); protected function __construct( array $cards = array() ) { foreach( $cards as $card ) { $this->addCard( $card ); } } public function count() { return count( $this->cards ); } public function key() { return key( $this->cards ); } public function valid() { return null !== $this->key(); } public function next() { next( $this->cards ); } public function current() { return current( $this->cards ); } public function rewind() { reset( $this->cards ); } public function sort( $comparer = null ) { $comparer = $comparer ?: function( $a, $b ) { return $a->compare( $b ); }; if( !is_callable( $comparer ) ) { throw new InvalidArgumentException( 'Invalid comparer; comparer should be callable' ); } usort( $this->cards, $comparer ); return $this; } public function toString() { return implode( ' ', $this->cards ); } public function __toString() { return $this->toString(); } protected function addCard( Card $card ) { if( in_array( $card, $this->cards ) ) { throw new DomainException( 'Card is already present in this collection' ); } $this->cards[] = $card; } } class Deck extends CardCollection { public function __construct( $shuffled = false ) { foreach( Card::getSuits() as $suit ) { foreach( Card::getPips() as $pip ) { $this->addCard( new Card( $suit, $pip ) ); } } if( $shuffled ) { $this->shuffle(); } } public function deal( $amount = 1, CardCollection $cardCollection = null ) { if( !is_int( $amount ) || $amount < 1 ) { throw new InvalidArgumentException( 'Invalid amount; amount should be an integer, larger than 0' ); } if( $amount > count( $this->cards ) ) { throw new RangeException( 'Invalid amount; requested amount is larger than the amount of available cards' ); } $cards = array_splice( $this->cards, 0, $amount ); $cardCollection = $cardCollection ?: new CardCollection; foreach( $cards as $card ) { $cardCollection->addCard( $card ); } return $cardCollection; } public function shuffle() { shuffle( $this->cards ); } } class Hand extends CardCollection { public function __construct() {} public function play( $position ) { if( !isset( $this->cards[ $position ] ) ) { throw new OutOfBoundsException( 'Invalid position; position is not present in this hand' ); } $result = array_splice( $this->cards, $position, 1 ); return $result[ 0 ]; } }
public enum Pip { Two, Three, Four, Five, Six, Seven, Eight, Nine, Ten, Jack, Queen, King, Ace }
Generate an equivalent Java version of this PHP code.
$NumberArray = array(0, 1, 2, 3, 4, 5, 6); $LetterArray = array("a", "b", "c", "d", "e", "f"); $simpleForm = ['apple', 'orange'];
Int[] literalArray = [1,2,3]; Int[] fixedLengthArray = new Int[10]; Int[] variableArray = new Int[]; assert literalArray.size == 3; Int n = literalArray[2]; fixedLengthArray[4] = 12345; fixedLengthArray += 6789; variableArray += 6789;
Convert this PHP block to Java, preserving its control flow and logic.
$NumberArray = array(0, 1, 2, 3, 4, 5, 6); $LetterArray = array("a", "b", "c", "d", "e", "f"); $simpleForm = ['apple', 'orange'];
Int[] literalArray = [1,2,3]; Int[] fixedLengthArray = new Int[10]; Int[] variableArray = new Int[]; assert literalArray.size == 3; Int n = literalArray[2]; fixedLengthArray[4] = 12345; fixedLengthArray += 6789; variableArray += 6789;
Please provide an equivalent version of this PHP code in Java.
<?php function isSierpinskiCarpetPixelFilled($x, $y) { while (($x > 0) or ($y > 0)) { if (($x % 3 == 1) and ($y % 3 == 1)) { return false; } $x /= 3; $y /= 3; } return true; } function sierpinskiCarpet($order) { $size = pow(3, $order); for ($y = 0 ; $y < $size ; $y++) { for ($x = 0 ; $x < $size ; $x++) { echo isSierpinskiCarpetPixelFilled($x, $y) ? '#' : ' '; } echo PHP_EOL; } } for ($order = 0 ; $order <= 3 ; $order++) { echo 'N=', $order, PHP_EOL; sierpinskiCarpet($order); echo PHP_EOL; }
public static boolean inCarpet(long x, long y) { while (x!=0 && y!=0) { if (x % 3 == 1 && y % 3 == 1) return false; x /= 3; y /= 3; } return true; } public static void carpet(final int n) { final double power = Math.pow(3,n); for(long i = 0; i < power; i++) { for(long j = 0; j < power; j++) { System.out.print(inCarpet(i, j) ? "*" : " "); } System.out.println(); } }
Transform the following PHP implementation into Java, maintaining the same output and logic.
<?php function isSierpinskiCarpetPixelFilled($x, $y) { while (($x > 0) or ($y > 0)) { if (($x % 3 == 1) and ($y % 3 == 1)) { return false; } $x /= 3; $y /= 3; } return true; } function sierpinskiCarpet($order) { $size = pow(3, $order); for ($y = 0 ; $y < $size ; $y++) { for ($x = 0 ; $x < $size ; $x++) { echo isSierpinskiCarpetPixelFilled($x, $y) ? '#' : ' '; } echo PHP_EOL; } } for ($order = 0 ; $order <= 3 ; $order++) { echo 'N=', $order, PHP_EOL; sierpinskiCarpet($order); echo PHP_EOL; }
public static boolean inCarpet(long x, long y) { while (x!=0 && y!=0) { if (x % 3 == 1 && y % 3 == 1) return false; x /= 3; y /= 3; } return true; } public static void carpet(final int n) { final double power = Math.pow(3,n); for(long i = 0; i < power; i++) { for(long j = 0; j < power; j++) { System.out.print(inCarpet(i, j) ? "*" : " "); } System.out.println(); } }
Convert this PHP block to Java, preserving its control flow and logic.
function bogosort($l) { while (!in_order($l)) shuffle($l); return $l; } function in_order($l) { for ($i = 1; $i < count($l); $i++) if ($l[$i] < $l[$i-1]) return FALSE; return TRUE; }
public class BogoSort { public static void main(String[] args) { int[] arr={4,5,6,0,7,8,9,1,2,3}; BogoSort now=new BogoSort(); System.out.print("Unsorted: "); now.display1D(arr); now.bogo(arr); System.out.print("Sorted: "); now.display1D(arr); } void bogo(int[] arr) { int shuffle=1; for(;!isSorted(arr);shuffle++) shuffle(arr); System.out.println("This took "+shuffle+" shuffles."); } void shuffle(int[] arr) { int i=arr.length-1; while(i>0) swap(arr,i--,(int)(Math.random()*i)); } void swap(int[] arr,int i,int j) { int temp=arr[i]; arr[i]=arr[j]; arr[j]=temp; } boolean isSorted(int[] arr) { for(int i=1;i<arr.length;i++) if(arr[i]<arr[i-1]) return false; return true; } void display1D(int[] arr) { for(int i=0;i<arr.length;i++) System.out.print(arr[i]+" "); System.out.println(); } }
Maintain the same structure and functionality when rewriting this code in Java.
function bogosort($l) { while (!in_order($l)) shuffle($l); return $l; } function in_order($l) { for ($i = 1; $i < count($l); $i++) if ($l[$i] < $l[$i-1]) return FALSE; return TRUE; }
public class BogoSort { public static void main(String[] args) { int[] arr={4,5,6,0,7,8,9,1,2,3}; BogoSort now=new BogoSort(); System.out.print("Unsorted: "); now.display1D(arr); now.bogo(arr); System.out.print("Sorted: "); now.display1D(arr); } void bogo(int[] arr) { int shuffle=1; for(;!isSorted(arr);shuffle++) shuffle(arr); System.out.println("This took "+shuffle+" shuffles."); } void shuffle(int[] arr) { int i=arr.length-1; while(i>0) swap(arr,i--,(int)(Math.random()*i)); } void swap(int[] arr,int i,int j) { int temp=arr[i]; arr[i]=arr[j]; arr[j]=temp; } boolean isSorted(int[] arr) { for(int i=1;i<arr.length;i++) if(arr[i]<arr[i-1]) return false; return true; } void display1D(int[] arr) { for(int i=0;i<arr.length;i++) System.out.print(arr[i]+" "); System.out.println(); } }
Produce a functionally identical Java code for the snippet given in PHP.
<?php for($i=1;$i<=22;$i++){ echo($i + floor(1/2 + sqrt($i)) . "\n"); } $found_square=False; for($i=1;$i<=1000000;$i++){ $non_square=$i + floor(1/2 + sqrt($i)); if(sqrt($non_square)==intval(sqrt($non_square))){ $found_square=True; } } echo("\n"); if($found_square){ echo("Found a square number, so the formula does not always work."); } else { echo("Up to 1000000, found no square number in the sequence!"); } ?>
public class SeqNonSquares { public static int nonsqr(int n) { return n + (int)Math.round(Math.sqrt(n)); } public static void main(String[] args) { for (int i = 1; i < 23; i++) System.out.print(nonsqr(i) + " "); System.out.println(); for (int i = 1; i < 1000000; i++) { double j = Math.sqrt(nonsqr(i)); assert j != Math.floor(j); } } }
Convert the following code from PHP to Java, ensuring the logic remains intact.
<?php for($i=1;$i<=22;$i++){ echo($i + floor(1/2 + sqrt($i)) . "\n"); } $found_square=False; for($i=1;$i<=1000000;$i++){ $non_square=$i + floor(1/2 + sqrt($i)); if(sqrt($non_square)==intval(sqrt($non_square))){ $found_square=True; } } echo("\n"); if($found_square){ echo("Found a square number, so the formula does not always work."); } else { echo("Up to 1000000, found no square number in the sequence!"); } ?>
public class SeqNonSquares { public static int nonsqr(int n) { return n + (int)Math.round(Math.sqrt(n)); } public static void main(String[] args) { for (int i = 1; i < 23; i++) System.out.print(nonsqr(i) + " "); System.out.println(); for (int i = 1; i < 1000000; i++) { double j = Math.sqrt(nonsqr(i)); assert j != Math.floor(j); } } }
Ensure the translated Java code behaves exactly like the original PHP snippet.
<?php $str = 'abcdefgh'; $n = 2; $m = 3; echo substr($str, $n, $m), "\n"; //cde echo substr($str, $n), "\n"; //cdefgh echo substr($str, 0, -1), "\n"; //abcdefg echo substr($str, strpos($str, 'd'), $m), "\n"; //def echo substr($str, strpos($str, 'de'), $m), "\n"; //def ?>
public static String Substring(String str, int n, int m){ return str.substring(n, n+m); } public static String Substring(String str, int n){ return str.substring(n); } public static String Substring(String str){ return str.substring(0, str.length()-1); } public static String Substring(String str, char c, int m){ return str.substring(str.indexOf(c), str.indexOf(c)+m+1); } public static String Substring(String str, String sub, int m){ return str.substring(str.indexOf(sub), str.indexOf(sub)+m+1); }
Port the provided PHP code into Java while preserving the original functionality.
<?php $str = 'abcdefgh'; $n = 2; $m = 3; echo substr($str, $n, $m), "\n"; //cde echo substr($str, $n), "\n"; //cdefgh echo substr($str, 0, -1), "\n"; //abcdefg echo substr($str, strpos($str, 'd'), $m), "\n"; //def echo substr($str, strpos($str, 'de'), $m), "\n"; //def ?>
public static String Substring(String str, int n, int m){ return str.substring(n, n+m); } public static String Substring(String str, int n){ return str.substring(n); } public static String Substring(String str){ return str.substring(0, str.length()-1); } public static String Substring(String str, char c, int m){ return str.substring(str.indexOf(c), str.indexOf(c)+m+1); } public static String Substring(String str, String sub, int m){ return str.substring(str.indexOf(sub), str.indexOf(sub)+m+1); }
Can you help me rewrite this code in Java instead of PHP, keeping it the same logically?
<?php function isLeapYear($year) { if ($year % 100 == 0) { return ($year % 400 == 0); } return ($year % 4 == 0); }
import java.util.GregorianCalendar; import java.text.MessageFormat; public class Leapyear{ public static void main(String[] argv){ int[] yrs = {1800,1900,1994,1998,1999,2000,2001,2004,2100}; GregorianCalendar cal = new GregorianCalendar(); for(int year : yrs){ System.err.println(MessageFormat.format("The year {0,number,#} is leaper: {1} / {2}.", year, cal.isLeapYear(year), isLeapYear(year))); } } public static boolean isLeapYear(int year){ return (year % 100 == 0) ? (year % 400 == 0) : (year % 4 == 0); } }
Convert the following code from PHP to Java, ensuring the logic remains intact.
<?php function isLeapYear($year) { if ($year % 100 == 0) { return ($year % 400 == 0); } return ($year % 4 == 0); }
import java.util.GregorianCalendar; import java.text.MessageFormat; public class Leapyear{ public static void main(String[] argv){ int[] yrs = {1800,1900,1994,1998,1999,2000,2001,2004,2100}; GregorianCalendar cal = new GregorianCalendar(); for(int year : yrs){ System.err.println(MessageFormat.format("The year {0,number,#} is leaper: {1} / {2}.", year, cal.isLeapYear(year), isLeapYear(year))); } } public static boolean isLeapYear(int year){ return (year % 100 == 0) ? (year % 400 == 0) : (year % 4 == 0); } }
Write the same algorithm in Java as shown in this PHP implementation.
$orderOfMag = array('Hundred', 'Thousand,', 'Million,', 'Billion,', 'Trillion,'); $smallNumbers = array('Zero', 'One', 'Two', 'Three', 'Four', 'Five', 'Six', 'Seven', 'Eight', 'Nine', 'Ten', 'Eleven', 'Twelve', 'Thirteen', 'Fourteen', 'Fifteen', 'Sixteen', 'Seventeen', 'Eighteen', 'Nineteen'); $decades = array('', '', 'Twenty', 'Thirty', 'Forty', 'Fifty', 'Sixty', 'Seventy', 'Eighty', 'Ninety'); function NumberToEnglish($num, $count = 0){ global $orderOfMag, $smallNumbers, $decades; $isLast = true; $str = ''; if ($num < 0){ $str = 'Negative '; $num = abs($num); } (int) $thisPart = substr((string) $num, -3); if (strlen((string) $num) > 3){ $str .= NumberToEnglish((int) substr((string) $num, 0, strlen((string) $num) - 3), $count + 1); $isLast = false; } if (($count == 0 || $isLast) && ($str == '' || $str == 'Negative ')) $and = ''; else $and = ' and '; if ($thisPart > 99){ $str .= ($isLast ? '' : ' ') . "{$smallNumbers[$thisPart/100]} {$orderOfMag[0]}"; if(($thisPart %= 100) == 0){ $str .= " {$orderOfMag[$count]}"; return $str; } $and = ' and '; // Set up our and string to the word "and" since there is something in the hundreds place of this chunk } if ($thisPart >= 20){ $str .= "{$and}{$decades[$thisPart /10]}"; $and = ' '; // Make sure we don't have any extranious "and"s if(($thisPart %= 10) == 0) return $str . ($count != 0 ? " {$orderOfMag[$count]}" : ''); } if ($thisPart < 20 && $thisPart > 0) return $str . "{$and}{$smallNumbers[(int) $thisPart]} " . ($count != 0 ? $orderOfMag[$count] : ''); elseif ($thisPart == 0 && strlen($thisPart) == 1) return $str . "{$smallNumbers[(int)$thisPart]}"; }
module NumberNames { void run() { @Inject Console console; Int[] tests = [0, 1, -1, 11, -17, 42, 99, 100, 101, -111, 1000, 1234, 10000, 100000, 123456789000, 0x123456789ABCDEF]; for (Int test : tests) { console.print($"{test} = {toEnglish(test)}"); } } static String[] digits = ["zero", "one", "two", "three", "four", "five", "six", "seven", "eight", "nine"]; static String[] teens = ["ten", "eleven", "twelve", "thirteen", "fourteen", "fifteen", "sixteen", "seventeen", "eighteen", "nineteen"]; static String[] tens = ["zero", "ten", "twenty", "thirty", "forty", "fifty", "sixty", "seventy", "eighty", "ninety"]; static String[] ten3rd = ["?", "thousand", "million", "billion", "trillion", "quadrillion", "quintillion"]; static String toEnglish(Int n) { StringBuffer buf = new StringBuffer(); if (n < 0) { "negative ".appendTo(buf); n = -n; } format3digits(n, buf); return buf.toString(); } static void format3digits(Int n, StringBuffer buf, Int nested=0) { (Int left, Int right) = n /% 1000; if (left != 0) { format3digits(left, buf, nested+1); } if (right != 0 || (left == 0 && nested==0)) { if (right >= 100) { (left, right) = (right /% 100); digits[left].appendTo(buf); " hundred ".appendTo(buf); if (right != 0) { format2digits(right, buf); } } else { format2digits(right, buf); } if (nested > 0) { ten3rd[nested].appendTo(buf).add(' '); } } } static void format2digits(Int n, StringBuffer buf) { switch (n) { case 0..9: digits[n].appendTo(buf).add(' '); break; case 10..19: teens[n-10].appendTo(buf).add(' '); break; default: (Int left, Int right) = n /% 10; tens[left].appendTo(buf); if (right == 0) { buf.add(' '); } else { buf.add('-'); digits[right].appendTo(buf).add(' '); } break; } } }
Port the provided PHP code into Java while preserving the original functionality.
$orderOfMag = array('Hundred', 'Thousand,', 'Million,', 'Billion,', 'Trillion,'); $smallNumbers = array('Zero', 'One', 'Two', 'Three', 'Four', 'Five', 'Six', 'Seven', 'Eight', 'Nine', 'Ten', 'Eleven', 'Twelve', 'Thirteen', 'Fourteen', 'Fifteen', 'Sixteen', 'Seventeen', 'Eighteen', 'Nineteen'); $decades = array('', '', 'Twenty', 'Thirty', 'Forty', 'Fifty', 'Sixty', 'Seventy', 'Eighty', 'Ninety'); function NumberToEnglish($num, $count = 0){ global $orderOfMag, $smallNumbers, $decades; $isLast = true; $str = ''; if ($num < 0){ $str = 'Negative '; $num = abs($num); } (int) $thisPart = substr((string) $num, -3); if (strlen((string) $num) > 3){ $str .= NumberToEnglish((int) substr((string) $num, 0, strlen((string) $num) - 3), $count + 1); $isLast = false; } if (($count == 0 || $isLast) && ($str == '' || $str == 'Negative ')) $and = ''; else $and = ' and '; if ($thisPart > 99){ $str .= ($isLast ? '' : ' ') . "{$smallNumbers[$thisPart/100]} {$orderOfMag[0]}"; if(($thisPart %= 100) == 0){ $str .= " {$orderOfMag[$count]}"; return $str; } $and = ' and '; // Set up our and string to the word "and" since there is something in the hundreds place of this chunk } if ($thisPart >= 20){ $str .= "{$and}{$decades[$thisPart /10]}"; $and = ' '; // Make sure we don't have any extranious "and"s if(($thisPart %= 10) == 0) return $str . ($count != 0 ? " {$orderOfMag[$count]}" : ''); } if ($thisPart < 20 && $thisPart > 0) return $str . "{$and}{$smallNumbers[(int) $thisPart]} " . ($count != 0 ? $orderOfMag[$count] : ''); elseif ($thisPart == 0 && strlen($thisPart) == 1) return $str . "{$smallNumbers[(int)$thisPart]}"; }
module NumberNames { void run() { @Inject Console console; Int[] tests = [0, 1, -1, 11, -17, 42, 99, 100, 101, -111, 1000, 1234, 10000, 100000, 123456789000, 0x123456789ABCDEF]; for (Int test : tests) { console.print($"{test} = {toEnglish(test)}"); } } static String[] digits = ["zero", "one", "two", "three", "four", "five", "six", "seven", "eight", "nine"]; static String[] teens = ["ten", "eleven", "twelve", "thirteen", "fourteen", "fifteen", "sixteen", "seventeen", "eighteen", "nineteen"]; static String[] tens = ["zero", "ten", "twenty", "thirty", "forty", "fifty", "sixty", "seventy", "eighty", "ninety"]; static String[] ten3rd = ["?", "thousand", "million", "billion", "trillion", "quadrillion", "quintillion"]; static String toEnglish(Int n) { StringBuffer buf = new StringBuffer(); if (n < 0) { "negative ".appendTo(buf); n = -n; } format3digits(n, buf); return buf.toString(); } static void format3digits(Int n, StringBuffer buf, Int nested=0) { (Int left, Int right) = n /% 1000; if (left != 0) { format3digits(left, buf, nested+1); } if (right != 0 || (left == 0 && nested==0)) { if (right >= 100) { (left, right) = (right /% 100); digits[left].appendTo(buf); " hundred ".appendTo(buf); if (right != 0) { format2digits(right, buf); } } else { format2digits(right, buf); } if (nested > 0) { ten3rd[nested].appendTo(buf).add(' '); } } } static void format2digits(Int n, StringBuffer buf) { switch (n) { case 0..9: digits[n].appendTo(buf).add(' '); break; case 10..19: teens[n-10].appendTo(buf).add(' '); break; default: (Int left, Int right) = n /% 10; tens[left].appendTo(buf); if (right == 0) { buf.add(' '); } else { buf.add('-'); digits[right].appendTo(buf).add(' '); } break; } } }
Convert the following code from PHP to Java, ensuring the logic remains intact.
<?php function retrieveStrings() { if (isset($_POST['input'])) { $strings = explode("\n", $_POST['input']); } else { $strings = ['abcd', '123456789', 'abcdef', '1234567']; } return $strings; } function setInput() { echo join("\n", retrieveStrings()); } function setOutput() { $strings = retrieveStrings(); $strings = array_map('trim', $strings); $strings = array_filter($strings); if (!empty($strings)) { usort($strings, function ($a, $b) { return strlen($b) - strlen($a); }); $max_len = strlen($strings[0]); $min_len = strlen($strings[count($strings) - 1]); foreach ($strings as $s) { $length = strlen($s); if ($length == $max_len) { $predicate = "is the longest string"; } elseif ($length == $min_len) { $predicate = "is the shortest string"; } else { $predicate = "is neither the longest nor the shortest string"; } echo "$s has length $length and $predicate\n"; } } } ?> <!DOCTYPE html> <html lang="en"> <head> <style> div { margin-top: 4ch; margin-bottom: 4ch; } label { display: block; margin-bottom: 1ch; } textarea { display: block; } input { display: block; margin-top: 4ch; margin-bottom: 4ch; } </style> </head> <body> <main> <form action=<?php echo $_SERVER['SCRIPT_NAME'] ?> method="post" accept-charset="utf-8"> <div> <label for="input">Input: </label> <textarea rows='20' cols='80' name='input'><?php setInput(); ?></textarea> </label> </div> <input type="submit" value="press to compare strings"> </input> <div> <label for="Output">Output: </label> <textarea rows='20' cols='80' name='output'><?php setOutput(); ?></textarea> </div> </form> </main> </body> </html>
package stringlensort; import java.io.PrintStream; import java.util.Arrays; import java.util.Comparator; public class ReportStringLengths { public static void main(String[] args) { String[] list = {"abcd", "123456789", "abcdef", "1234567"}; String[] strings = args.length > 0 ? args : list; compareAndReportStringsLength(strings); } public static void compareAndReportStringsLength(String[] strings) { compareAndReportStringsLength(strings, System.out); } public static void compareAndReportStringsLength(String[] strings, PrintStream stream) { if (strings.length > 0) { strings = strings.clone(); final String QUOTE = "\""; Arrays.sort(strings, Comparator.comparing(String::length)); int min = strings[0].length(); int max = strings[strings.length - 1].length(); for (int i = strings.length - 1; i >= 0; i--) { int length = strings[i].length(); String predicate; if (length == max) { predicate = "is the longest string"; } else if (length == min) { predicate = "is the shortest string"; } else { predicate = "is neither the longest nor the shortest string"; } stream.println(QUOTE + strings[i] + QUOTE + " has length " + length + " and " + predicate); } } } }
Port the provided PHP code into Java while preserving the original functionality.
<?php function retrieveStrings() { if (isset($_POST['input'])) { $strings = explode("\n", $_POST['input']); } else { $strings = ['abcd', '123456789', 'abcdef', '1234567']; } return $strings; } function setInput() { echo join("\n", retrieveStrings()); } function setOutput() { $strings = retrieveStrings(); $strings = array_map('trim', $strings); $strings = array_filter($strings); if (!empty($strings)) { usort($strings, function ($a, $b) { return strlen($b) - strlen($a); }); $max_len = strlen($strings[0]); $min_len = strlen($strings[count($strings) - 1]); foreach ($strings as $s) { $length = strlen($s); if ($length == $max_len) { $predicate = "is the longest string"; } elseif ($length == $min_len) { $predicate = "is the shortest string"; } else { $predicate = "is neither the longest nor the shortest string"; } echo "$s has length $length and $predicate\n"; } } } ?> <!DOCTYPE html> <html lang="en"> <head> <style> div { margin-top: 4ch; margin-bottom: 4ch; } label { display: block; margin-bottom: 1ch; } textarea { display: block; } input { display: block; margin-top: 4ch; margin-bottom: 4ch; } </style> </head> <body> <main> <form action=<?php echo $_SERVER['SCRIPT_NAME'] ?> method="post" accept-charset="utf-8"> <div> <label for="input">Input: </label> <textarea rows='20' cols='80' name='input'><?php setInput(); ?></textarea> </label> </div> <input type="submit" value="press to compare strings"> </input> <div> <label for="Output">Output: </label> <textarea rows='20' cols='80' name='output'><?php setOutput(); ?></textarea> </div> </form> </main> </body> </html>
package stringlensort; import java.io.PrintStream; import java.util.Arrays; import java.util.Comparator; public class ReportStringLengths { public static void main(String[] args) { String[] list = {"abcd", "123456789", "abcdef", "1234567"}; String[] strings = args.length > 0 ? args : list; compareAndReportStringsLength(strings); } public static void compareAndReportStringsLength(String[] strings) { compareAndReportStringsLength(strings, System.out); } public static void compareAndReportStringsLength(String[] strings, PrintStream stream) { if (strings.length > 0) { strings = strings.clone(); final String QUOTE = "\""; Arrays.sort(strings, Comparator.comparing(String::length)); int min = strings[0].length(); int max = strings[strings.length - 1].length(); for (int i = strings.length - 1; i >= 0; i--) { int length = strings[i].length(); String predicate; if (length == max) { predicate = "is the longest string"; } else if (length == min) { predicate = "is the shortest string"; } else { predicate = "is neither the longest nor the shortest string"; } stream.println(QUOTE + strings[i] + QUOTE + " has length " + length + " and " + predicate); } } } }
Ensure the translated Java code behaves exactly like the original PHP snippet.
function shellSort($arr) { $inc = round(count($arr)/2); while($inc > 0) { for($i = $inc; $i < count($arr);$i++){ $temp = $arr[$i]; $j = $i; while($j >= $inc && $arr[$j-$inc] > $temp) { $arr[$j] = $arr[$j - $inc]; $j -= $inc; } $arr[$j] = $temp; } $inc = round($inc/2.2); } return $arr; }
public static void shell(int[] a) { int increment = a.length / 2; while (increment > 0) { for (int i = increment; i < a.length; i++) { int j = i; int temp = a[i]; while (j >= increment && a[j - increment] > temp) { a[j] = a[j - increment]; j = j - increment; } a[j] = temp; } if (increment == 2) { increment = 1; } else { increment *= (5.0 / 11); } } }
Preserve the algorithm and functionality while converting the code from PHP to Java.
function shellSort($arr) { $inc = round(count($arr)/2); while($inc > 0) { for($i = $inc; $i < count($arr);$i++){ $temp = $arr[$i]; $j = $i; while($j >= $inc && $arr[$j-$inc] > $temp) { $arr[$j] = $arr[$j - $inc]; $j -= $inc; } $arr[$j] = $temp; } $inc = round($inc/2.2); } return $arr; }
public static void shell(int[] a) { int increment = a.length / 2; while (increment > 0) { for (int i = increment; i < a.length; i++) { int j = i; int temp = a[i]; while (j >= increment && a[j - increment] > temp) { a[j] = a[j - increment]; j = j - increment; } a[j] = temp; } if (increment == 2) { increment = 1; } else { increment *= (5.0 / 11); } } }
Keep all operations the same but rewrite the snippet in Java.
<?php print_r(array_count_values(str_split(file_get_contents($argv[1])))); ?>
import java.io.BufferedReader; import java.io.FileReader; import java.io.IOException; import java.util.Arrays; public class LetterFreq { public static int[] countLetters(String filename) throws IOException{ int[] freqs = new int[26]; BufferedReader in = new BufferedReader(new FileReader(filename)); String line; while((line = in.readLine()) != null){ line = line.toUpperCase(); for(char ch:line.toCharArray()){ if(Character.isLetter(ch)){ freqs[ch - 'A']++; } } } in.close(); return freqs; } public static void main(String[] args) throws IOException{ System.out.println(Arrays.toString(countLetters("filename.txt"))); } }
Ensure the translated Java code behaves exactly like the original PHP snippet.
<?php print_r(array_count_values(str_split(file_get_contents($argv[1])))); ?>
import java.io.BufferedReader; import java.io.FileReader; import java.io.IOException; import java.util.Arrays; public class LetterFreq { public static int[] countLetters(String filename) throws IOException{ int[] freqs = new int[26]; BufferedReader in = new BufferedReader(new FileReader(filename)); String line; while((line = in.readLine()) != null){ line = line.toUpperCase(); for(char ch:line.toCharArray()){ if(Character.isLetter(ch)){ freqs[ch - 'A']++; } } } in.close(); return freqs; } public static void main(String[] args) throws IOException{ System.out.println(Arrays.toString(countLetters("filename.txt"))); } }
Write a version of this PHP function in Java with identical behavior.
$s = "12345"; $s++;
String s = "12345"; IntLiteral lit1 = new IntLiteral(s); IntLiteral lit2 = 6789; ++lit1; ++lit2;
Generate a Java translation of this PHP snippet without changing its computational steps.
$s = "12345"; $s++;
String s = "12345"; IntLiteral lit1 = new IntLiteral(s); IntLiteral lit2 = 6789; ++lit1; ++lit2;
Ensure the translated Java code behaves exactly like the original PHP snippet.
<?php function stripchars($s, $chars) { return str_replace(str_split($chars), "", $s); } echo stripchars("She was a soul stripper. She took my heart!", "aei"), "\n"; ?>
class StripChars { public static String stripChars(String inString, String toStrip) { return inString.replaceAll("[" + toStrip + "]", ""); } public static void main(String[] args) { String sentence = "She was a soul stripper. She took my heart!"; String chars = "aei"; System.out.println("sentence: " + sentence); System.out.println("to strip: " + chars); System.out.println("stripped: " + stripChars(sentence, chars)); } }
Maintain the same structure and functionality when rewriting this code in Java.
<?php function stripchars($s, $chars) { return str_replace(str_split($chars), "", $s); } echo stripchars("She was a soul stripper. She took my heart!", "aei"), "\n"; ?>
class StripChars { public static String stripChars(String inString, String toStrip) { return inString.replaceAll("[" + toStrip + "]", ""); } public static void main(String[] args) { String sentence = "She was a soul stripper. She took my heart!"; String chars = "aei"; System.out.println("sentence: " + sentence); System.out.println("to strip: " + chars); System.out.println("stripped: " + stripChars(sentence, chars)); } }
Transform the following PHP implementation into Java, maintaining the same output and logic.
function inOrder($arr){ for($i=0;$i<count($arr);$i++){ if(isset($arr[$i+1])){ if($arr[$i] > $arr[$i+1]){ return false; } } } return true; } function permute($items, $perms = array( )) { if (empty($items)) { if(inOrder($perms)){ return $perms; } } else { for ($i = count($items) - 1; $i >= 0; --$i) { $newitems = $items; $newperms = $perms; list($foo) = array_splice($newitems, $i, 1); array_unshift($newperms, $foo); $res = permute($newitems, $newperms); if($res){ return $res; } } } } $arr = array( 8, 3, 10, 6, 1, 9, 7, 2, 5, 4); $arr = permute($arr); echo implode(',',$arr);
import java.util.List; import java.util.ArrayList; import java.util.Arrays; public class PermutationSort { public static void main(String[] args) { int[] a={3,2,1,8,9,4,6}; System.out.println("Unsorted: " + Arrays.toString(a)); a=pSort(a); System.out.println("Sorted: " + Arrays.toString(a)); } public static int[] pSort(int[] a) { List<int[]> list=new ArrayList<int[]>(); permute(a,a.length,list); for(int[] x : list) if(isSorted(x)) return x; return a; } private static void permute(int[] a, int n, List<int[]> list) { if (n == 1) { int[] b=new int[a.length]; System.arraycopy(a, 0, b, 0, a.length); list.add(b); return; } for (int i = 0; i < n; i++) { swap(a, i, n-1); permute(a, n-1, list); swap(a, i, n-1); } } private static boolean isSorted(int[] a) { for(int i=1;i<a.length;i++) if(a[i-1]>a[i]) return false; return true; } private static void swap(int[] arr,int i, int j) { int temp=arr[i]; arr[i]=arr[j]; arr[j]=temp; } }
Convert the following code from PHP to Java, ensuring the logic remains intact.
function inOrder($arr){ for($i=0;$i<count($arr);$i++){ if(isset($arr[$i+1])){ if($arr[$i] > $arr[$i+1]){ return false; } } } return true; } function permute($items, $perms = array( )) { if (empty($items)) { if(inOrder($perms)){ return $perms; } } else { for ($i = count($items) - 1; $i >= 0; --$i) { $newitems = $items; $newperms = $perms; list($foo) = array_splice($newitems, $i, 1); array_unshift($newperms, $foo); $res = permute($newitems, $newperms); if($res){ return $res; } } } } $arr = array( 8, 3, 10, 6, 1, 9, 7, 2, 5, 4); $arr = permute($arr); echo implode(',',$arr);
import java.util.List; import java.util.ArrayList; import java.util.Arrays; public class PermutationSort { public static void main(String[] args) { int[] a={3,2,1,8,9,4,6}; System.out.println("Unsorted: " + Arrays.toString(a)); a=pSort(a); System.out.println("Sorted: " + Arrays.toString(a)); } public static int[] pSort(int[] a) { List<int[]> list=new ArrayList<int[]>(); permute(a,a.length,list); for(int[] x : list) if(isSorted(x)) return x; return a; } private static void permute(int[] a, int n, List<int[]> list) { if (n == 1) { int[] b=new int[a.length]; System.arraycopy(a, 0, b, 0, a.length); list.add(b); return; } for (int i = 0; i < n; i++) { swap(a, i, n-1); permute(a, n-1, list); swap(a, i, n-1); } } private static boolean isSorted(int[] a) { for(int i=1;i<a.length;i++) if(a[i-1]>a[i]) return false; return true; } private static void swap(int[] arr,int i, int j) { int temp=arr[i]; arr[i]=arr[j]; arr[j]=temp; } }
Port the provided PHP code into Java while preserving the original functionality.
$nums = array(3, 1, 4, 1, 5, 9); if ($nums) echo array_sum($nums) / count($nums), "\n"; else echo "0\n";
public static double avg(double... arr) { double sum = 0.0; for (double x : arr) { sum += x; } return sum / arr.length; }
Ensure the translated Java code behaves exactly like the original PHP snippet.
$nums = array(3, 1, 4, 1, 5, 9); if ($nums) echo array_sum($nums) / count($nums), "\n"; else echo "0\n";
public static double avg(double... arr) { double sum = 0.0; for (double x : arr) { sum += x; } return sum / arr.length; }
Maintain the same structure and functionality when rewriting this code in Java.
<?php function shannonEntropy($string) { $h = 0.0; $len = strlen($string); foreach (count_chars($string, 1) as $count) { $h -= (double) ($count / $len) * log((double) ($count / $len), 2); } return $h; } $strings = array( '1223334444', '1225554444', 'aaBBcccDDDD', '122333444455555', 'Rosetta Code', '1234567890abcdefghijklmnopqrstuvwxyz', ); foreach ($strings AS $string) { printf( '%36s : %s' . PHP_EOL, $string, number_format(shannonEntropy($string), 6) ); }
import java.lang.Math; import java.util.Map; import java.util.HashMap; public class REntropy { @SuppressWarnings("boxing") public static double getShannonEntropy(String s) { int n = 0; Map<Character, Integer> occ = new HashMap<>(); for (int c_ = 0; c_ < s.length(); ++c_) { char cx = s.charAt(c_); if (occ.containsKey(cx)) { occ.put(cx, occ.get(cx) + 1); } else { occ.put(cx, 1); } ++n; } double e = 0.0; for (Map.Entry<Character, Integer> entry : occ.entrySet()) { char cx = entry.getKey(); double p = (double) entry.getValue() / n; e += p * log2(p); } return -e; } private static double log2(double a) { return Math.log(a) / Math.log(2); } public static void main(String[] args) { String[] sstr = { "1223334444", "1223334444555555555", "122333", "1227774444", "aaBBcccDDDD", "1234567890abcdefghijklmnopqrstuvwxyz", "Rosetta Code", }; for (String ss : sstr) { double entropy = REntropy.getShannonEntropy(ss); System.out.printf("Shannon entropy of %40s: %.12f%n", "\"" + ss + "\"", entropy); } return; } }
Convert this PHP snippet to Java and keep its semantics consistent.
<?php function shannonEntropy($string) { $h = 0.0; $len = strlen($string); foreach (count_chars($string, 1) as $count) { $h -= (double) ($count / $len) * log((double) ($count / $len), 2); } return $h; } $strings = array( '1223334444', '1225554444', 'aaBBcccDDDD', '122333444455555', 'Rosetta Code', '1234567890abcdefghijklmnopqrstuvwxyz', ); foreach ($strings AS $string) { printf( '%36s : %s' . PHP_EOL, $string, number_format(shannonEntropy($string), 6) ); }
import java.lang.Math; import java.util.Map; import java.util.HashMap; public class REntropy { @SuppressWarnings("boxing") public static double getShannonEntropy(String s) { int n = 0; Map<Character, Integer> occ = new HashMap<>(); for (int c_ = 0; c_ < s.length(); ++c_) { char cx = s.charAt(c_); if (occ.containsKey(cx)) { occ.put(cx, occ.get(cx) + 1); } else { occ.put(cx, 1); } ++n; } double e = 0.0; for (Map.Entry<Character, Integer> entry : occ.entrySet()) { char cx = entry.getKey(); double p = (double) entry.getValue() / n; e += p * log2(p); } return -e; } private static double log2(double a) { return Math.log(a) / Math.log(2); } public static void main(String[] args) { String[] sstr = { "1223334444", "1223334444555555555", "122333", "1227774444", "aaBBcccDDDD", "1234567890abcdefghijklmnopqrstuvwxyz", "Rosetta Code", }; for (String ss : sstr) { double entropy = REntropy.getShannonEntropy(ss); System.out.printf("Shannon entropy of %40s: %.12f%n", "\"" + ss + "\"", entropy); } return; } }
Change the following PHP code into Java without altering its purpose.
<?php echo "Hello world!\n"; ?>
module HelloWorld { void run() { @Inject Console console; console.print("Hello World!"); } }
Port the following code from PHP to Java with equivalent syntax and logic.
<?php echo "Hello world!\n"; ?>
module HelloWorld { void run() { @Inject Console console; console.print("Hello World!"); } }
Port the provided PHP code into Java while preserving the original functionality.
<?php function forwardDiff($anArray, $times = 1) { if ($times <= 0) { return $anArray; } for ($accumilation = array(), $i = 1, $j = count($anArray); $i < $j; ++$i) { $accumilation[] = $anArray[$i] - $anArray[$i - 1]; } if ($times === 1) { return $accumilation; } return forwardDiff($accumilation, $times - 1); } class ForwardDiffExample extends PweExample { function _should_run_empty_array_for_single_elem() { $expected = array($this->rand()->int()); $this->spec(forwardDiff($expected))->shouldEqual(array()); } function _should_give_diff_of_two_elem_as_single_elem() { $twoNums = array($this->rand()->int(), $this->rand()->int()); $expected = array($twoNums[1] - $twoNums[0]); $this->spec(forwardDiff($twoNums))->shouldEqual($expected); } function _should_compute_correct_forward_diff_for_longer_arrays() { $diffInput = array(10, 2, 9, 6, 5); $expected = array(-8, 7, -3, -1); $this->spec(forwardDiff($diffInput))->shouldEqual($expected); } function _should_apply_more_than_once_if_specified() { $diffInput = array(4, 6, 9, 3, 4); $expectedAfter1 = array(2, 3, -6, 1); $expectedAfter2 = array(1, -9, 7); $this->spec(forwardDiff($diffInput, 1))->shouldEqual($expectedAfter1); $this->spec(forwardDiff($diffInput, 2))->shouldEqual($expectedAfter2); } function _should_return_array_unaltered_if_no_times() { $this->spec(forwardDiff($expected = array(1,2,3), 0))->shouldEqual($expected); } }
import java.util.Arrays; public class FD { public static void main(String args[]) { double[] a = {90, 47, 58, 29, 22, 32, 55, 5, 55, 73}; System.out.println(Arrays.toString(dif(a, 1))); System.out.println(Arrays.toString(dif(a, 2))); System.out.println(Arrays.toString(dif(a, 9))); System.out.println(Arrays.toString(dif(a, 10))); System.out.println(Arrays.toString(dif(a, 11))); System.out.println(Arrays.toString(dif(a, -1))); System.out.println(Arrays.toString(dif(a, 0))); } public static double[] dif(double[] a, int n) { if (n < 0) return null; for (int i = 0; i < n && a.length > 0; i++) { double[] b = new double[a.length - 1]; for (int j = 0; j < b.length; j++){ b[j] = a[j+1] - a[j]; } a = b; } return a; } }
Maintain the same structure and functionality when rewriting this code in Java.
<?php function forwardDiff($anArray, $times = 1) { if ($times <= 0) { return $anArray; } for ($accumilation = array(), $i = 1, $j = count($anArray); $i < $j; ++$i) { $accumilation[] = $anArray[$i] - $anArray[$i - 1]; } if ($times === 1) { return $accumilation; } return forwardDiff($accumilation, $times - 1); } class ForwardDiffExample extends PweExample { function _should_run_empty_array_for_single_elem() { $expected = array($this->rand()->int()); $this->spec(forwardDiff($expected))->shouldEqual(array()); } function _should_give_diff_of_two_elem_as_single_elem() { $twoNums = array($this->rand()->int(), $this->rand()->int()); $expected = array($twoNums[1] - $twoNums[0]); $this->spec(forwardDiff($twoNums))->shouldEqual($expected); } function _should_compute_correct_forward_diff_for_longer_arrays() { $diffInput = array(10, 2, 9, 6, 5); $expected = array(-8, 7, -3, -1); $this->spec(forwardDiff($diffInput))->shouldEqual($expected); } function _should_apply_more_than_once_if_specified() { $diffInput = array(4, 6, 9, 3, 4); $expectedAfter1 = array(2, 3, -6, 1); $expectedAfter2 = array(1, -9, 7); $this->spec(forwardDiff($diffInput, 1))->shouldEqual($expectedAfter1); $this->spec(forwardDiff($diffInput, 2))->shouldEqual($expectedAfter2); } function _should_return_array_unaltered_if_no_times() { $this->spec(forwardDiff($expected = array(1,2,3), 0))->shouldEqual($expected); } }
import java.util.Arrays; public class FD { public static void main(String args[]) { double[] a = {90, 47, 58, 29, 22, 32, 55, 5, 55, 73}; System.out.println(Arrays.toString(dif(a, 1))); System.out.println(Arrays.toString(dif(a, 2))); System.out.println(Arrays.toString(dif(a, 9))); System.out.println(Arrays.toString(dif(a, 10))); System.out.println(Arrays.toString(dif(a, 11))); System.out.println(Arrays.toString(dif(a, -1))); System.out.println(Arrays.toString(dif(a, 0))); } public static double[] dif(double[] a, int n) { if (n < 0) return null; for (int i = 0; i < n && a.length > 0; i++) { double[] b = new double[a.length - 1]; for (int j = 0; j < b.length; j++){ b[j] = a[j+1] - a[j]; } a = b; } return a; } }
Transform the following PHP implementation into Java, maintaining the same output and logic.
<?php function prime($a) { if (($a % 2 == 0 && $a != 2) || $a < 2) return false; $limit = sqrt($a); for ($i = 2; $i <= $limit; $i++) if ($a % $i == 0) return false; return true; } foreach (range(1, 100) as $x) if (prime($x)) echo "$x\n"; ?>
public static boolean prime(long a){ if(a == 2){ return true; }else if(a <= 1 || a % 2 == 0){ return false; } long max = (long)Math.sqrt(a); for(long n= 3; n <= max; n+= 2){ if(a % n == 0){ return false; } } return true; }
Rewrite the snippet below in Java so it works the same as the original PHP code.
<?php function prime($a) { if (($a % 2 == 0 && $a != 2) || $a < 2) return false; $limit = sqrt($a); for ($i = 2; $i <= $limit; $i++) if ($a % $i == 0) return false; return true; } foreach (range(1, 100) as $x) if (prime($x)) echo "$x\n"; ?>
public static boolean prime(long a){ if(a == 2){ return true; }else if(a <= 1 || a % 2 == 0){ return false; } long max = (long)Math.sqrt(a); for(long n= 3; n <= max; n+= 2){ if(a % n == 0){ return false; } } return true; }
Port the provided PHP code into Java while preserving the original functionality.
<?php $n=5; $k=3; function factorial($val){ for($f=2;$val-1>1;$f*=$val--); return $f; } $binomial_coefficient=factorial($n)/(factorial($k)*factorial($n-$k)); echo $binomial_coefficient; ?>
public class Binomial { private static long binomialInt(int n, int k) { if (k > n - k) k = n - k; long binom = 1; for (int i = 1; i <= k; i++) binom = binom * (n + 1 - i) / i; return binom; } private static Object binomialIntReliable(int n, int k) { if (k > n - k) k = n - k; long binom = 1; for (int i = 1; i <= k; i++) { try { binom = Math.multiplyExact(binom, n + 1 - i) / i; } catch (ArithmeticException e) { return "overflow"; } } return binom; } private static double binomialFloat(int n, int k) { if (k > n - k) k = n - k; double binom = 1.0; for (int i = 1; i <= k; i++) binom = binom * (n + 1 - i) / i; return binom; } private static BigInteger binomialBigInt(int n, int k) { if (k > n - k) k = n - k; BigInteger binom = BigInteger.ONE; for (int i = 1; i <= k; i++) { binom = binom.multiply(BigInteger.valueOf(n + 1 - i)); binom = binom.divide(BigInteger.valueOf(i)); } return binom; } private static void demo(int n, int k) { List<Object> data = Arrays.asList( n, k, binomialInt(n, k), binomialIntReliable(n, k), binomialFloat(n, k), binomialBigInt(n, k)); System.out.println(data.stream().map(Object::toString).collect(Collectors.joining("\t"))); } public static void main(String[] args) { demo(5, 3); demo(1000, 300); } }
Convert this PHP snippet to Java and keep its semantics consistent.
<?php $n=5; $k=3; function factorial($val){ for($f=2;$val-1>1;$f*=$val--); return $f; } $binomial_coefficient=factorial($n)/(factorial($k)*factorial($n-$k)); echo $binomial_coefficient; ?>
public class Binomial { private static long binomialInt(int n, int k) { if (k > n - k) k = n - k; long binom = 1; for (int i = 1; i <= k; i++) binom = binom * (n + 1 - i) / i; return binom; } private static Object binomialIntReliable(int n, int k) { if (k > n - k) k = n - k; long binom = 1; for (int i = 1; i <= k; i++) { try { binom = Math.multiplyExact(binom, n + 1 - i) / i; } catch (ArithmeticException e) { return "overflow"; } } return binom; } private static double binomialFloat(int n, int k) { if (k > n - k) k = n - k; double binom = 1.0; for (int i = 1; i <= k; i++) binom = binom * (n + 1 - i) / i; return binom; } private static BigInteger binomialBigInt(int n, int k) { if (k > n - k) k = n - k; BigInteger binom = BigInteger.ONE; for (int i = 1; i <= k; i++) { binom = binom.multiply(BigInteger.valueOf(n + 1 - i)); binom = binom.divide(BigInteger.valueOf(i)); } return binom; } private static void demo(int n, int k) { List<Object> data = Arrays.asList( n, k, binomialInt(n, k), binomialIntReliable(n, k), binomialFloat(n, k), binomialBigInt(n, k)); System.out.println(data.stream().map(Object::toString).collect(Collectors.joining("\t"))); } public static void main(String[] args) { demo(5, 3); demo(1000, 300); } }
Convert this PHP block to Java, preserving its control flow and logic.
<?php $a = array(); # add elements "at the end" array_push($a, 55, 10, 20); print_r($a); # using an explicit key $a['one'] = 1; $a['two'] = 2; print_r($a); ?>
List arrayList = new ArrayList(); arrayList.add(new Integer(0)); arrayList.add(0); List<Integer> myarrlist = new ArrayList<Integer>(); int sum; for(int i = 0; i < 10; i++) { myarrlist.add(i); }
Convert the following code from PHP to Java, ensuring the logic remains intact.
<?php $a = array(); # add elements "at the end" array_push($a, 55, 10, 20); print_r($a); # using an explicit key $a['one'] = 1; $a['two'] = 2; print_r($a); ?>
List arrayList = new ArrayList(); arrayList.add(new Integer(0)); arrayList.add(0); List<Integer> myarrlist = new ArrayList<Integer>(); int sum; for(int i = 0; i < 10; i++) { myarrlist.add(i); }
Can you help me rewrite this code in Java instead of PHP, keeping it the same logically?
class Bitmap { public $data; public $w; public $h; public function __construct($w = 16, $h = 16){ $white = array_fill(0, $w, array(255,255,255)); $this->data = array_fill(0, $h, $white); $this->w = $w; $this->h = $h; } public function fill($x = 0, $y = 0, $w = null, $h = null, $color = array(0,0,0)){ if (is_null($w)) $w = $this->w; if (is_null($h)) $h = $this->h; $w += $x; $h += $y; for ($i = $y; $i < $h; $i++){ for ($j = $x; $j < $w; $j++){ $this->setPixel($j, $i, $color); } } } public function setPixel($x, $y, $color = array(0,0,0)){ if ($x >= $this->w) return false; if ($x < 0) return false; if ($y >= $this->h) return false; if ($y < 0) return false; $this->data[$y][$x] = $color; } public function getPixel($x, $y){ return $this->data[$y][$x]; } public function writeP6($filename){ $fh = fopen($filename, 'w'); if (!$fh) return false; fputs($fh, "P6 {$this->w} {$this->h} 255\n"); foreach ($this->data as $row){ foreach($row as $pixel){ fputs($fh, pack('C', $pixel[0])); fputs($fh, pack('C', $pixel[1])); fputs($fh, pack('C', $pixel[2])); } } fclose($fh); } } $b = new Bitmap(16,16); $b->fill(); $b->fill(2, 2, 18, 18, array(240,240,240)); $b->setPixel(0, 15, array(255,0,0)); $b->writeP6('p6.ppm');
import java.io.BufferedOutputStream; import java.io.File; import java.io.FileOutputStream; import java.io.IOException; import java.nio.charset.StandardCharsets; public class PPMWriter { public void bitmapToPPM(File file, BasicBitmapStorage bitmap) throws IOException { file.delete(); try (var os = new FileOutputStream(file, true); var bw = new BufferedOutputStream(os)) { var header = String.format("P6\n%d %d\n255\n", bitmap.getWidth(), bitmap.getHeight()); bw.write(header.getBytes(StandardCharsets.US_ASCII)); for (var y = 0; y < bitmap.getHeight(); y++) { for (var x = 0; x < bitmap.getWidth(); x++) { var pixel = bitmap.getPixel(x, y); bw.write(pixel.getRed()); bw.write(pixel.getGreen()); bw.write(pixel.getBlue()); } } } } }
Produce a functionally identical Java code for the snippet given in PHP.
class Bitmap { public $data; public $w; public $h; public function __construct($w = 16, $h = 16){ $white = array_fill(0, $w, array(255,255,255)); $this->data = array_fill(0, $h, $white); $this->w = $w; $this->h = $h; } public function fill($x = 0, $y = 0, $w = null, $h = null, $color = array(0,0,0)){ if (is_null($w)) $w = $this->w; if (is_null($h)) $h = $this->h; $w += $x; $h += $y; for ($i = $y; $i < $h; $i++){ for ($j = $x; $j < $w; $j++){ $this->setPixel($j, $i, $color); } } } public function setPixel($x, $y, $color = array(0,0,0)){ if ($x >= $this->w) return false; if ($x < 0) return false; if ($y >= $this->h) return false; if ($y < 0) return false; $this->data[$y][$x] = $color; } public function getPixel($x, $y){ return $this->data[$y][$x]; } public function writeP6($filename){ $fh = fopen($filename, 'w'); if (!$fh) return false; fputs($fh, "P6 {$this->w} {$this->h} 255\n"); foreach ($this->data as $row){ foreach($row as $pixel){ fputs($fh, pack('C', $pixel[0])); fputs($fh, pack('C', $pixel[1])); fputs($fh, pack('C', $pixel[2])); } } fclose($fh); } } $b = new Bitmap(16,16); $b->fill(); $b->fill(2, 2, 18, 18, array(240,240,240)); $b->setPixel(0, 15, array(255,0,0)); $b->writeP6('p6.ppm');
import java.io.BufferedOutputStream; import java.io.File; import java.io.FileOutputStream; import java.io.IOException; import java.nio.charset.StandardCharsets; public class PPMWriter { public void bitmapToPPM(File file, BasicBitmapStorage bitmap) throws IOException { file.delete(); try (var os = new FileOutputStream(file, true); var bw = new BufferedOutputStream(os)) { var header = String.format("P6\n%d %d\n255\n", bitmap.getWidth(), bitmap.getHeight()); bw.write(header.getBytes(StandardCharsets.US_ASCII)); for (var y = 0; y < bitmap.getHeight(); y++) { for (var x = 0; x < bitmap.getWidth(); x++) { var pixel = bitmap.getPixel(x, y); bw.write(pixel.getRed()); bw.write(pixel.getGreen()); bw.write(pixel.getBlue()); } } } } }
Rewrite the snippet below in Java so it works the same as the original PHP code.
<?php unlink('input.txt'); unlink('/input.txt'); rmdir('docs'); rmdir('/docs'); ?>
import java.io.File; public class FileDeleteTest { public static boolean deleteFile(String filename) { boolean exists = new File(filename).delete(); return exists; } public static void test(String type, String filename) { System.out.println("The following " + type + " called " + filename + (deleteFile(filename) ? " was deleted." : " could not be deleted.") ); } public static void main(String args[]) { test("file", "input.txt"); test("file", File.seperator + "input.txt"); test("directory", "docs"); test("directory", File.seperator + "docs" + File.seperator); } }
Write the same algorithm in Java as shown in this PHP implementation.
<?php unlink('input.txt'); unlink('/input.txt'); rmdir('docs'); rmdir('/docs'); ?>
import java.io.File; public class FileDeleteTest { public static boolean deleteFile(String filename) { boolean exists = new File(filename).delete(); return exists; } public static void test(String type, String filename) { System.out.println("The following " + type + " called " + filename + (deleteFile(filename) ? " was deleted." : " could not be deleted.") ); } public static void main(String args[]) { test("file", "input.txt"); test("file", File.seperator + "input.txt"); test("directory", "docs"); test("directory", File.seperator + "docs" + File.seperator); } }
Write the same algorithm in Java as shown in this PHP implementation.
<?php $Anerisia = array(31,28,31,30,31,30,31,31,30,31,30,31); $MONTHS = array("Choas","Discord","Confusion","Bureacracy","The Aftermath"); $DAYS = array("Setting Orange","Sweetmorn","BoomTime","Pungenday","Prickle-Prickle"); $Dsuff = array('th','st','nd','rd','th','th','th','th','th','th'); $Holy5 = array("Mungday","MojoDay","Syaday","Zaraday","Maladay"); $Holy50 = array("Chaoflux","Discoflux","Confuflux","Bureflux","Afflux"); $edate = explode(" ",date('Y m j L')); $usery = $edate[0]; $userm = $edate[1]; $userd = $edate[2]; $IsLeap = $edate[3]; if (isset($_GET['y']) && isset($_GET['m']) && isset($_GET['d'])) { $usery = $_GET['y']; $userm = $_GET['m']; $userd = $_GET['d']; $IsLeap = 0; if (($usery%4 == 0) && ($usery%100 >0)) $IsLeap =1; if ($usery%400 == 0) $IsLeap = 1; } $userdays = 0; $i = 0; while ($i < ($userm-1)) { $userdays = $userdays + $Anerisia[$i]; $i = $i +1; } $userdays = $userdays + $userd; $IsHolyday = 0; $dyear = $usery + 1166; $dmonth = $MONTHS[$userdays/73.2]; $dday = $userdays%73; if (0 == $dday) $dday = 73; $Dname = $DAYS[$userdays%5]; $Holyday = "St. Tibs Day"; if ($dday == 5) { $Holyday = $Holy5[$userdays/73.2]; $IsHolyday =1; } if ($dday == 50) { $Holyday = $Holy50[$userdays/73.2]; $IsHolyday =1; } if (($IsLeap ==1) && ($userd ==29) and ($userm ==2)) $IsHolyday = 2; $suff = $Dsuff[$dday%10] ; if ((11 <= $dday) && (19 >= $dday)) $suff='th'; if ($IsHolyday ==2) echo "</br>Celeberate ",$Holyday," ",$dmonth," YOLD ",$dyear; if ($IsHolyday ==1) echo "</br>Celeberate for today ", $Dname , " The ", $dday,"<sup>",$suff,"</sup>", " day of ", $dmonth , " YOLD " , $dyear , " is the holy day of " , $Holyday; if ($IsHolyday == 0) echo "</br>Today is " , $Dname , " the " , $dday ,"<sup>",$suff, "</sup> day of " , $dmonth , " YOLD " , $dyear; ?>
import java.util.Calendar; import java.util.GregorianCalendar; public class DiscordianDate { final static String[] seasons = {"Chaos", "Discord", "Confusion", "Bureaucracy", "The Aftermath"}; final static String[] weekday = {"Sweetmorn", "Boomtime", "Pungenday", "Prickle-Prickle", "Setting Orange"}; final static String[] apostle = {"Mungday", "Mojoday", "Syaday", "Zaraday", "Maladay"}; final static String[] holiday = {"Chaoflux", "Discoflux", "Confuflux", "Bureflux", "Afflux"}; public static String discordianDate(final GregorianCalendar date) { int y = date.get(Calendar.YEAR); int yold = y + 1166; int dayOfYear = date.get(Calendar.DAY_OF_YEAR); if (date.isLeapYear(y)) { if (dayOfYear == 60) return "St. Tib's Day, in the YOLD " + yold; else if (dayOfYear > 60) dayOfYear--; } dayOfYear--; int seasonDay = dayOfYear % 73 + 1; if (seasonDay == 5) return apostle[dayOfYear / 73] + ", in the YOLD " + yold; if (seasonDay == 50) return holiday[dayOfYear / 73] + ", in the YOLD " + yold; String season = seasons[dayOfYear / 73]; String dayOfWeek = weekday[dayOfYear % 5]; return String.format("%s, day %s of %s in the YOLD %s", dayOfWeek, seasonDay, season, yold); } public static void main(String[] args) { System.out.println(discordianDate(new GregorianCalendar())); test(2010, 6, 22, "Pungenday, day 57 of Confusion in the YOLD 3176"); test(2012, 1, 28, "Prickle-Prickle, day 59 of Chaos in the YOLD 3178"); test(2012, 1, 29, "St. Tib's Day, in the YOLD 3178"); test(2012, 2, 1, "Setting Orange, day 60 of Chaos in the YOLD 3178"); test(2010, 0, 5, "Mungday, in the YOLD 3176"); test(2011, 4, 3, "Discoflux, in the YOLD 3177"); test(2015, 9, 19, "Boomtime, day 73 of Bureaucracy in the YOLD 3181"); } private static void test(int y, int m, int d, final String result) { assert (discordianDate(new GregorianCalendar(y, m, d)).equals(result)); } }
Ensure the translated Java code behaves exactly like the original PHP snippet.
<?php $Anerisia = array(31,28,31,30,31,30,31,31,30,31,30,31); $MONTHS = array("Choas","Discord","Confusion","Bureacracy","The Aftermath"); $DAYS = array("Setting Orange","Sweetmorn","BoomTime","Pungenday","Prickle-Prickle"); $Dsuff = array('th','st','nd','rd','th','th','th','th','th','th'); $Holy5 = array("Mungday","MojoDay","Syaday","Zaraday","Maladay"); $Holy50 = array("Chaoflux","Discoflux","Confuflux","Bureflux","Afflux"); $edate = explode(" ",date('Y m j L')); $usery = $edate[0]; $userm = $edate[1]; $userd = $edate[2]; $IsLeap = $edate[3]; if (isset($_GET['y']) && isset($_GET['m']) && isset($_GET['d'])) { $usery = $_GET['y']; $userm = $_GET['m']; $userd = $_GET['d']; $IsLeap = 0; if (($usery%4 == 0) && ($usery%100 >0)) $IsLeap =1; if ($usery%400 == 0) $IsLeap = 1; } $userdays = 0; $i = 0; while ($i < ($userm-1)) { $userdays = $userdays + $Anerisia[$i]; $i = $i +1; } $userdays = $userdays + $userd; $IsHolyday = 0; $dyear = $usery + 1166; $dmonth = $MONTHS[$userdays/73.2]; $dday = $userdays%73; if (0 == $dday) $dday = 73; $Dname = $DAYS[$userdays%5]; $Holyday = "St. Tibs Day"; if ($dday == 5) { $Holyday = $Holy5[$userdays/73.2]; $IsHolyday =1; } if ($dday == 50) { $Holyday = $Holy50[$userdays/73.2]; $IsHolyday =1; } if (($IsLeap ==1) && ($userd ==29) and ($userm ==2)) $IsHolyday = 2; $suff = $Dsuff[$dday%10] ; if ((11 <= $dday) && (19 >= $dday)) $suff='th'; if ($IsHolyday ==2) echo "</br>Celeberate ",$Holyday," ",$dmonth," YOLD ",$dyear; if ($IsHolyday ==1) echo "</br>Celeberate for today ", $Dname , " The ", $dday,"<sup>",$suff,"</sup>", " day of ", $dmonth , " YOLD " , $dyear , " is the holy day of " , $Holyday; if ($IsHolyday == 0) echo "</br>Today is " , $Dname , " the " , $dday ,"<sup>",$suff, "</sup> day of " , $dmonth , " YOLD " , $dyear; ?>
import java.util.Calendar; import java.util.GregorianCalendar; public class DiscordianDate { final static String[] seasons = {"Chaos", "Discord", "Confusion", "Bureaucracy", "The Aftermath"}; final static String[] weekday = {"Sweetmorn", "Boomtime", "Pungenday", "Prickle-Prickle", "Setting Orange"}; final static String[] apostle = {"Mungday", "Mojoday", "Syaday", "Zaraday", "Maladay"}; final static String[] holiday = {"Chaoflux", "Discoflux", "Confuflux", "Bureflux", "Afflux"}; public static String discordianDate(final GregorianCalendar date) { int y = date.get(Calendar.YEAR); int yold = y + 1166; int dayOfYear = date.get(Calendar.DAY_OF_YEAR); if (date.isLeapYear(y)) { if (dayOfYear == 60) return "St. Tib's Day, in the YOLD " + yold; else if (dayOfYear > 60) dayOfYear--; } dayOfYear--; int seasonDay = dayOfYear % 73 + 1; if (seasonDay == 5) return apostle[dayOfYear / 73] + ", in the YOLD " + yold; if (seasonDay == 50) return holiday[dayOfYear / 73] + ", in the YOLD " + yold; String season = seasons[dayOfYear / 73]; String dayOfWeek = weekday[dayOfYear % 5]; return String.format("%s, day %s of %s in the YOLD %s", dayOfWeek, seasonDay, season, yold); } public static void main(String[] args) { System.out.println(discordianDate(new GregorianCalendar())); test(2010, 6, 22, "Pungenday, day 57 of Confusion in the YOLD 3176"); test(2012, 1, 28, "Prickle-Prickle, day 59 of Chaos in the YOLD 3178"); test(2012, 1, 29, "St. Tib's Day, in the YOLD 3178"); test(2012, 2, 1, "Setting Orange, day 60 of Chaos in the YOLD 3178"); test(2010, 0, 5, "Mungday, in the YOLD 3176"); test(2011, 4, 3, "Discoflux, in the YOLD 3177"); test(2015, 9, 19, "Boomtime, day 73 of Bureaucracy in the YOLD 3181"); } private static void test(int y, int m, int d, final String result) { assert (discordianDate(new GregorianCalendar(y, m, d)).equals(result)); } }
Please provide an equivalent version of this PHP code in Java.
<?php $extra = 'little'; echo "Mary had a $extra lamb.\n"; printf("Mary had a %s lamb.\n", $extra); ?>
String original = "Mary had a X lamb"; String little = "little"; String replaced = original.replace("X", little); System.out.println(replaced); System.out.printf("Mary had a %s lamb.", little); String formatted = String.format("Mary had a %s lamb.", little); System.out.println(formatted);
Rewrite this program in VB while keeping its functionality equivalent to the C version.
void bitwise(int a, int b) { printf("a and b: %d\n", a & b); printf("a or b: %d\n", a | b); printf("a xor b: %d\n", a ^ b); printf("not a: %d\n", ~a); printf("a << n: %d\n", a << b); printf("a >> n: %d\n", a >> b); unsigned int c = a; printf("c >> b: %d\n", c >> b); return 0; }
Debug.Print Hex(&HF0F0 And &HFF00) Debug.Print Hex(&HF0F0 Or &HFF00) Debug.Print Hex(&HF0F0 Xor &HFF00) Debug.Print Hex(Not &HF0F0) Debug.Print Hex(&HF0F0 Eqv &HFF00) Debug.Print Hex(&HF0F0 Imp &HFF00)
Write a version of this C function in VB with identical behavior.
#include <stdio.h> #include <stdlib.h> #include <string.h> #include <math.h> long long x, y, dx, dy, scale, clen; typedef struct { double r, g, b; } rgb; rgb ** pix; void sc_up() { long long tmp = dx - dy; dy = dx + dy; dx = tmp; scale *= 2; x *= 2; y *= 2; } void h_rgb(long long x, long long y) { rgb *p = &pix[y][x]; # define SAT 1 double h = 6.0 * clen / scale; double VAL = 1 - (cos(3.141592653579 * 64 * clen / scale) - 1) / 4; double c = SAT * VAL; double X = c * (1 - fabs(fmod(h, 2) - 1)); switch((int)h) { case 0: p->r += c; p->g += X; return; case 1: p->r += X; p->g += c; return; case 2: p->g += c; p->b += X; return; case 3: p->g += X; p->b += c; return; case 4: p->r += X; p->b += c; return; default: p->r += c; p->b += X; } } void iter_string(const char * str, int d) { long tmp; # define LEFT tmp = -dy; dy = dx; dx = tmp # define RIGHT tmp = dy; dy = -dx; dx = tmp while (*str != '\0') { switch(*(str++)) { case 'X': if (d) iter_string("X+YF+", d - 1); continue; case 'Y': if (d) iter_string("-FX-Y", d - 1); continue; case '+': RIGHT; continue; case '-': LEFT; continue; case 'F': clen ++; h_rgb(x/scale, y/scale); x += dx; y += dy; continue; } } } void dragon(long leng, int depth) { long i, d = leng / 3 + 1; long h = leng + 3, w = leng + d * 3 / 2 + 2; rgb *buf = malloc(sizeof(rgb) * w * h); pix = malloc(sizeof(rgb *) * h); for (i = 0; i < h; i++) pix[i] = buf + w * i; memset(buf, 0, sizeof(rgb) * w * h); x = y = d; dx = leng; dy = 0; scale = 1; clen = 0; for (i = 0; i < depth; i++) sc_up(); iter_string("FX", depth); unsigned char *fpix = malloc(w * h * 3); double maxv = 0, *dbuf = (double*)buf; for (i = 3 * w * h - 1; i >= 0; i--) if (dbuf[i] > maxv) maxv = dbuf[i]; for (i = 3 * h * w - 1; i >= 0; i--) fpix[i] = 255 * dbuf[i] / maxv; printf("P6\n%ld %ld\n255\n", w, h); fflush(stdout); fwrite(fpix, h * w * 3, 1, stdout); } int main(int c, char ** v) { int size, depth; depth = (c > 1) ? atoi(v[1]) : 10; size = 1 << depth; fprintf(stderr, "size: %d depth: %d\n", size, depth); dragon(size, depth * 2); return 0; }
option explicit const pi180= 0.01745329251994329576923690768489 const pi=3.1415926535897932384626433832795 class turtle dim fso dim fn dim svg dim iang dim ori dim incr dim pdown dim clr dim x dim y public property let orient(n):ori = n*pi180 :end property public property let iangle(n):iang= n*pi180 :end property public sub pd() : pdown=true: end sub public sub pu() :pdown=FALSE :end sub public sub rt(i) ori=ori - i*iang: end sub public sub lt(i): ori=(ori + i*iang) end sub public sub bw(l) x= x+ cos(ori+pi)*l*incr y= y+ sin(ori+pi)*l*incr end sub public sub fw(l) dim x1,y1 x1=x + cos(ori)*l*incr y1=y + sin(ori)*l*incr if pdown then line x,y,x1,y1 x=x1:y=y1 end sub Private Sub Class_Initialize() setlocale "us" initsvg x=400:y=400:incr=100 ori=90*pi180 iang=90*pi180 clr=0 pdown=true end sub Private Sub Class_Terminate() disply end sub private sub line (x,y,x1,y1) svg.WriteLine "<line x1=""" & x & """ y1= """& y & """ x2=""" & x1& """ y2=""" & y1 & """/>" end sub private sub disply() dim shell svg.WriteLine "</svg></body></html>" svg.close Set shell = CreateObject("Shell.Application") shell.ShellExecute fn,1,False end sub private sub initsvg() dim scriptpath Set fso = CreateObject ("Scripting.Filesystemobject") ScriptPath= Left(WScript.ScriptFullName, InStrRev(WScript.ScriptFullName, "\")) fn=Scriptpath & "SIERP.HTML" Set svg = fso.CreateTextFile(fn,True) if SVG IS nothing then wscript.echo "Can svg.WriteLine "<!DOCTYPE html>" &vbcrlf & "<html>" &vbcrlf & "<head>" svg.writeline "<style>" & vbcrlf & "line {stroke:rgb(255,0,0);stroke-width:.5}" &vbcrlf &"</style>" svg.writeline "</head>"&vbcrlf & "<body>" svg.WriteLine "<svg xmlns=""http://www.w3.org/2000/svg"" width=""800"" height=""800"" viewBox=""0 0 800 800"">" end sub end class sub dragon(st,le,dir) if st=0 then x.fw le: exit sub x.rt dir dragon st-1, le/1.41421 ,1 x.rt dir*2 dragon st-1, le/1.41421 ,-1 x.rt dir end sub dim x set x=new turtle x.iangle=45 x.orient=45 x.incr=1 x.x=200:x.y=200 dragon 12,300,1 set x=nothing
Write the same code in VB as shown below in C.
#include <conio.h> #include <stdio.h> int main() { int n1, n2, n3; printf( "\n Introduzca el primer n%cmero (entero): ", 163 ); scanf( "%d", &n1 ); printf( "\n Introduzca el segundo n%cmero (entero): ", 163 ); scanf( "%d", &n2 ); printf( "\n Introduzca el tercer n%cmero (entero): ", 163 ); scanf( "%d", &n3 ); if ( n1 >= n2 && n1 >= n3 ) printf( "\n %d es el mayor.", n1 ); else if ( n2 > n3 ) printf( "\n %d es el mayor.", n2 ); else printf( "\n %d es el mayor.", n3 ); getch(); return 0; }
$Include "Rapidq.inc" dim file as qfilestream if file.open("c:\A Test.txt", fmOpenRead) then while not File.eof print File.readline wend else print "Cannot read file" end if input "Press enter to exit: ";a$
Convert this C snippet to VB and keep its semantics consistent.
void insert(link* anchor, link* newlink) { newlink->next = anchor->next; newlink->prev = anchor; (newlink->next)->prev = newlink; anchor->next = newlink; }
Public Sub Insert(ByVal a As Node(Of T), ByVal b As Node(Of T), ByVal c As T) Dim node As New Node(Of T)(value) a.Next = node node.Previous = a b.Previous = node node.Next = b End Sub
Can you help me rewrite this code in VB instead of C, keeping it the same logically?
#include <stdio.h> #include <string.h> int qselect(int *v, int len, int k) { # define SWAP(a, b) { tmp = v[a]; v[a] = v[b]; v[b] = tmp; } int i, st, tmp; for (st = i = 0; i < len - 1; i++) { if (v[i] > v[len-1]) continue; SWAP(i, st); st++; } SWAP(len-1, st); return k == st ?v[st] :st > k ? qselect(v, st, k) : qselect(v + st, len - st, k - st); } int main(void) { # define N (sizeof(x)/sizeof(x[0])) int x[] = {9, 8, 7, 6, 5, 0, 1, 2, 3, 4}; int y[N]; int i; for (i = 0; i < 10; i++) { memcpy(y, x, sizeof(x)); printf("%d: %d\n", i, qselect(y, 10, i)); } return 0; }
Dim s As Variant Private Function quick_select(ByRef s As Variant, k As Integer) As Integer Dim left As Integer, right As Integer, pos As Integer Dim pivotValue As Integer, tmp As Integer left = 1: right = UBound(s) Do While left < right pivotValue = s(k) tmp = s(k) s(k) = s(right) s(right) = tmp pos = left For i = left To right If s(i) < pivotValue Then tmp = s(i) s(i) = s(pos) s(pos) = tmp pos = pos + 1 End If Next i tmp = s(right) s(right) = s(pos) s(pos) = tmp If pos = k Then Exit Do End If If pos < k Then left = pos + 1 Else right = pos - 1 End If Loop quick_select = s(k) End Function Public Sub main() Dim r As Integer, i As Integer s = [{9, 8, 7, 6, 5, 0, 1, 2, 3, 4}] For i = 1 To 10 r = quick_select(s, i) Debug.Print IIf(i < 10, r & ", ", "" & r); Next i End Sub
Rewrite this program in VB while keeping its functionality equivalent to the C version.
#include <stdlib.h> #include <string.h> #include <stdio.h> #include <stdint.h> char *to_base(int64_t num, int base) { char *tbl = "0123456789abcdefghijklmnopqrstuvwxyz"; char buf[66] = {'\0'}; char *out; uint64_t n; int i, len = 0, neg = 0; if (base > 36) { fprintf(stderr, "base %d too large\n", base); return 0; } n = ((neg = num < 0)) ? (~num) + 1 : num; do { buf[len++] = tbl[n % base]; } while(n /= base); out = malloc(len + neg + 1); for (i = neg; len > 0; i++) out[i] = buf[--len]; if (neg) out[0] = '-'; return out; } long from_base(const char *num_str, int base) { char *endptr; int result = strtol(num_str, &endptr, base); return result; } int main() { int64_t x; x = ~(1LL << 63) + 1; printf("%lld in base 2: %s\n", x, to_base(x, 2)); x = 383; printf("%lld in base 16: %s\n", x, to_base(x, 16)); return 0; }
Private Function to_base(ByVal number As Long, base As Integer) As String Dim digits As String, result As String Dim i As Integer, digit As Integer digits = "0123456789abcdefghijklmnopqrstuvwxyz" Do While number > 0 digit = number Mod base result = Mid(digits, digit + 1, 1) & result number = number \ base Loop to_base = result End Function Private Function from_base(number As String, base As Integer) As Long Dim digits As String, result As Long Dim i As Integer digits = "0123456789abcdefghijklmnopqrstuvwxyz" result = Val(InStr(1, digits, Mid(number, 1, 1), vbTextCompare) - 1) For i = 2 To Len(number) result = result * base + Val(InStr(1, digits, Mid(number, i, 1), vbTextCompare) - 1) Next i from_base = result End Function Public Sub Non_decimal_radices_Convert() Debug.Print "26 decimal in base 16 is: "; to_base(26, 16); ". Conversely, hexadecimal 1a in decimal is: "; from_base("1a", 16) End Sub
Transform the following C implementation into VB, maintaining the same output and logic.
#include <sys/types.h> #include <sys/stat.h> #include <unistd.h> #include <dirent.h> #include <regex.h> #include <stdio.h> #include <string.h> #include <errno.h> #include <err.h> enum { WALK_OK = 0, WALK_BADPATTERN, WALK_NAMETOOLONG, WALK_BADIO, }; #define WS_NONE 0 #define WS_RECURSIVE (1 << 0) #define WS_DEFAULT WS_RECURSIVE #define WS_FOLLOWLINK (1 << 1) #define WS_DOTFILES (1 << 2) #define WS_MATCHDIRS (1 << 3) int walk_recur(char *dname, regex_t *reg, int spec) { struct dirent *dent; DIR *dir; struct stat st; char fn[FILENAME_MAX]; int res = WALK_OK; int len = strlen(dname); if (len >= FILENAME_MAX - 1) return WALK_NAMETOOLONG; strcpy(fn, dname); fn[len++] = '/'; if (!(dir = opendir(dname))) { warn("can't open %s", dname); return WALK_BADIO; } errno = 0; while ((dent = readdir(dir))) { if (!(spec & WS_DOTFILES) && dent->d_name[0] == '.') continue; if (!strcmp(dent->d_name, ".") || !strcmp(dent->d_name, "..")) continue; strncpy(fn + len, dent->d_name, FILENAME_MAX - len); if (lstat(fn, &st) == -1) { warn("Can't stat %s", fn); res = WALK_BADIO; continue; } if (S_ISLNK(st.st_mode) && !(spec & WS_FOLLOWLINK)) continue; if (S_ISDIR(st.st_mode)) { if ((spec & WS_RECURSIVE)) walk_recur(fn, reg, spec); if (!(spec & WS_MATCHDIRS)) continue; } if (!regexec(reg, fn, 0, 0, 0)) puts(fn); } if (dir) closedir(dir); return res ? res : errno ? WALK_BADIO : WALK_OK; } int walk_dir(char *dname, char *pattern, int spec) { regex_t r; int res; if (regcomp(&r, pattern, REG_EXTENDED | REG_NOSUB)) return WALK_BADPATTERN; res = walk_recur(dname, &r, spec); regfree(&r); return res; } int main() { int r = walk_dir(".", ".\\.c$", WS_DEFAULT|WS_MATCHDIRS); switch(r) { case WALK_OK: break; case WALK_BADIO: err(1, "IO error"); case WALK_BADPATTERN: err(1, "Bad pattern"); case WALK_NAMETOOLONG: err(1, "Filename too long"); default: err(1, "Unknown error?"); } return 0; }
Sub printFiles(parentDir As FolderItem, pattern As String) For i As Integer = 1 To parentDir.Count If parentDir.Item(i).Directory Then printFiles(parentDir.Item(i), pattern) Else Dim rg as New RegEx Dim myMatch as RegExMatch rg.SearchPattern = pattern myMatch = rg.search(parentDir.Item(i).Name) If myMatch <> Nil Then Print(parentDir.Item(i).AbsolutePath) End If Next End Sub
Change the programming language of this snippet from C to VB without modifying what it does.
#include <stdio.h> #include <string.h> #include <zlib.h> int main() { const char *s = "The quick brown fox jumps over the lazy dog"; printf("%lX\n", crc32(0, (const void*)s, strlen(s))); return 0; }
dim crctbl(255) const crcc =&hEDB88320 sub gencrctable for i= 0 to 255 k=i for j=1 to 8 if k and 1 then k=(k and &h7fffffff)\2 or (&h40000000 and ((k and &h80000000)<>0)) k=k xor crcc else k=(k and &h7fffffff)\2 or (&h40000000 and ((k and &h80000000)<>0)) end if next crctbl(i)=k next end sub function crc32 (buf) dim r,r1,i r=&hffffffff for i=1 to len(buf) r1=(r and &h7fffffff)\&h100 or (&h800000 and (r and &h80000000)<>0) r=r1 xor crctbl((asc(mid(buf,i,1))xor r) and 255) next crc32=r xor &hffffffff end function gencrctable wscript.stdout.writeline hex(crc32("The quick brown fox jumps over the lazy dog"))
Convert this C block to VB, preserving its control flow and logic.
#include <stdio.h> const char *input = "Character,Speech\n" "The multitude,The messiah! Show us the messiah!\n" "Brians mother,<angry>Now you listen here! He's not the messiah; " "he's a very naughty boy! Now go away!</angry>\n" "The multitude,Who are you?\n" "Brians mother,I'm his mother; that's who!\n" "The multitude,Behold his mother! Behold his mother!"; int main() { const char *s; printf("<table>\n<tr><td>"); for (s = input; *s; s++) { switch(*s) { case '\n': printf("</td></tr>\n<tr><td>"); break; case ',': printf("</td><td>"); break; case '<': printf("&lt;"); break; case '>': printf("&gt;"); break; case '&': printf("&amp;"); break; default: putchar(*s); } } puts("</td></tr>\n</table>"); return 0; }
Public Sub CSV_TO_HTML() input_ = "Character,Speech\n" & _ "The multitude,The messiah! Show us the messiah!\n" & _ "Brians mother,<angry>Now you listen here! He "he "The multitude,Who are you?\n" & _ "Brians mother,I "The multitude,Behold his mother! Behold his mother!" Debug.Print "<table>" & vbCrLf & "<tr><td>" For i = 1 To Len(input_) Select Case Mid(input_, i, 1) Case "\" If Mid(input_, i + 1, 1) = "n" Then Debug.Print "</td></tr>" & vbCrLf & "<tr><td>"; i = i + 1 Else Debug.Print Mid(input_, i, 1); End If Case ",": Debug.Print "</td><td>"; Case "<": Debug.Print "&lt;"; Case ">": Debug.Print "&gt;"; Case "&": Debug.Print "&amp;"; Case Else: Debug.Print Mid(input_, i, 1); End Select Next i Debug.Print "</td></tr>" & vbCrLf & "</table>" End Sub
Write the same code in VB as shown below in C.
#include <stdio.h> const char *input = "Character,Speech\n" "The multitude,The messiah! Show us the messiah!\n" "Brians mother,<angry>Now you listen here! He's not the messiah; " "he's a very naughty boy! Now go away!</angry>\n" "The multitude,Who are you?\n" "Brians mother,I'm his mother; that's who!\n" "The multitude,Behold his mother! Behold his mother!"; int main() { const char *s; printf("<table>\n<tr><td>"); for (s = input; *s; s++) { switch(*s) { case '\n': printf("</td></tr>\n<tr><td>"); break; case ',': printf("</td><td>"); break; case '<': printf("&lt;"); break; case '>': printf("&gt;"); break; case '&': printf("&amp;"); break; default: putchar(*s); } } puts("</td></tr>\n</table>"); return 0; }
Public Sub CSV_TO_HTML() input_ = "Character,Speech\n" & _ "The multitude,The messiah! Show us the messiah!\n" & _ "Brians mother,<angry>Now you listen here! He "he "The multitude,Who are you?\n" & _ "Brians mother,I "The multitude,Behold his mother! Behold his mother!" Debug.Print "<table>" & vbCrLf & "<tr><td>" For i = 1 To Len(input_) Select Case Mid(input_, i, 1) Case "\" If Mid(input_, i + 1, 1) = "n" Then Debug.Print "</td></tr>" & vbCrLf & "<tr><td>"; i = i + 1 Else Debug.Print Mid(input_, i, 1); End If Case ",": Debug.Print "</td><td>"; Case "<": Debug.Print "&lt;"; Case ">": Debug.Print "&gt;"; Case "&": Debug.Print "&amp;"; Case Else: Debug.Print Mid(input_, i, 1); End Select Next i Debug.Print "</td></tr>" & vbCrLf & "</table>" End Sub
Transform the following C implementation into VB, maintaining the same output and logic.
#include <stdlib.h> typedef struct sMyClass { int variable; } *MyClass; MyClass MyClass_new() { MyClass pthis = malloc(sizeof *pthis); pthis->variable = 0; return pthis; } void MyClass_delete(MyClass* pthis) { if (pthis) { free(*pthis); *pthis = NULL; } } void MyClass_someMethod(MyClass pthis) { pthis->variable = 1; } MyClass obj = MyClass_new(); MyClass_someMethod(obj); MyClass_delete(&obj);
Class NumberContainer Private TheNumber As Integer Sub Constructor(InitialNumber As Integer) TheNumber = InitialNumber End Sub Function Number() As Integer Return TheNumber End Function Sub Number(Assigns NewNumber As Integer) TheNumber = NewNumber End Sub End Class
Port the provided C code into VB while preserving the original functionality.
#include <stdio.h> #include <stdint.h> typedef uint64_t ulong; int kaprekar(ulong n, int base) { ulong nn = n * n, r, tens = 1; if ((nn - n) % (base - 1)) return 0; while (tens < n) tens *= base; if (n == tens) return 1 == n; while ((r = nn % tens) < n) { if (nn / tens + r == n) return tens; tens *= base; } return 0; } void print_num(ulong n, int base) { ulong q, div = base; while (div < n) div *= base; while (n && (div /= base)) { q = n / div; if (q < 10) putchar(q + '0'); else putchar(q + 'a' - 10); n -= q * div; } } int main() { ulong i, tens; int cnt = 0; int base = 10; printf("base 10:\n"); for (i = 1; i < 1000000; i++) if (kaprekar(i, base)) printf("%3d: %llu\n", ++cnt, i); base = 17; printf("\nbase %d:\n 1: 1\n", base); for (i = 2, cnt = 1; i < 1000000; i++) if ((tens = kaprekar(i, base))) { printf("%3d: %llu", ++cnt, i); printf(" \t"); print_num(i, base); printf("\t"); print_num(i * i, base); printf("\t"); print_num(i * i / tens, base); printf(" + "); print_num(i * i % tens, base); printf("\n"); } return 0; }
Module Module1 ReadOnly max As ULong = 1000000 Function Kaprekar(n As ULong) As Boolean If n = 1 Then Return True Dim sq = n * n Dim sq_str = Str(sq) Dim l = Len(sq_str) For x = l - 1 To 1 Step -1 If sq_str(x) = "0" Then l = l - 1 Else Exit For End If Next For x = 1 To l - 1 Dim p2 = Val(Mid(sq_str, x + 1)) If p2 > n Then Continue For End If Dim p1 = Val(Left(sq_str, x)) If p1 > n Then Return False If (p1 + p2) = n Then Return True Next Return False End Function Sub Main() Dim count = 0 Console.WriteLine("Kaprekar numbers below 10000") For n = 1 To max - 1 If Kaprekar(n) Then count = count + 1 If n < 10000 Then Console.WriteLine("{0,2} {1,4}", count, n) End If End If Next Console.WriteLine() Console.WriteLine("{0} numbers below {1} are kaprekar numbers", count, max) End Sub End Module
Change the following C code into VB without altering its purpose.
#include <stdio.h> #include <stdint.h> typedef uint64_t ulong; int kaprekar(ulong n, int base) { ulong nn = n * n, r, tens = 1; if ((nn - n) % (base - 1)) return 0; while (tens < n) tens *= base; if (n == tens) return 1 == n; while ((r = nn % tens) < n) { if (nn / tens + r == n) return tens; tens *= base; } return 0; } void print_num(ulong n, int base) { ulong q, div = base; while (div < n) div *= base; while (n && (div /= base)) { q = n / div; if (q < 10) putchar(q + '0'); else putchar(q + 'a' - 10); n -= q * div; } } int main() { ulong i, tens; int cnt = 0; int base = 10; printf("base 10:\n"); for (i = 1; i < 1000000; i++) if (kaprekar(i, base)) printf("%3d: %llu\n", ++cnt, i); base = 17; printf("\nbase %d:\n 1: 1\n", base); for (i = 2, cnt = 1; i < 1000000; i++) if ((tens = kaprekar(i, base))) { printf("%3d: %llu", ++cnt, i); printf(" \t"); print_num(i, base); printf("\t"); print_num(i * i, base); printf("\t"); print_num(i * i / tens, base); printf(" + "); print_num(i * i % tens, base); printf("\n"); } return 0; }
Module Module1 ReadOnly max As ULong = 1000000 Function Kaprekar(n As ULong) As Boolean If n = 1 Then Return True Dim sq = n * n Dim sq_str = Str(sq) Dim l = Len(sq_str) For x = l - 1 To 1 Step -1 If sq_str(x) = "0" Then l = l - 1 Else Exit For End If Next For x = 1 To l - 1 Dim p2 = Val(Mid(sq_str, x + 1)) If p2 > n Then Continue For End If Dim p1 = Val(Left(sq_str, x)) If p1 > n Then Return False If (p1 + p2) = n Then Return True Next Return False End Function Sub Main() Dim count = 0 Console.WriteLine("Kaprekar numbers below 10000") For n = 1 To max - 1 If Kaprekar(n) Then count = count + 1 If n < 10000 Then Console.WriteLine("{0,2} {1,4}", count, n) End If End If Next Console.WriteLine() Console.WriteLine("{0} numbers below {1} are kaprekar numbers", count, max) End Sub End Module
Generate a VB translation of this C snippet without changing its computational steps.
#include <stdio.h> #include <stdint.h> typedef uint64_t ulong; int kaprekar(ulong n, int base) { ulong nn = n * n, r, tens = 1; if ((nn - n) % (base - 1)) return 0; while (tens < n) tens *= base; if (n == tens) return 1 == n; while ((r = nn % tens) < n) { if (nn / tens + r == n) return tens; tens *= base; } return 0; } void print_num(ulong n, int base) { ulong q, div = base; while (div < n) div *= base; while (n && (div /= base)) { q = n / div; if (q < 10) putchar(q + '0'); else putchar(q + 'a' - 10); n -= q * div; } } int main() { ulong i, tens; int cnt = 0; int base = 10; printf("base 10:\n"); for (i = 1; i < 1000000; i++) if (kaprekar(i, base)) printf("%3d: %llu\n", ++cnt, i); base = 17; printf("\nbase %d:\n 1: 1\n", base); for (i = 2, cnt = 1; i < 1000000; i++) if ((tens = kaprekar(i, base))) { printf("%3d: %llu", ++cnt, i); printf(" \t"); print_num(i, base); printf("\t"); print_num(i * i, base); printf("\t"); print_num(i * i / tens, base); printf(" + "); print_num(i * i % tens, base); printf("\n"); } return 0; }
Module Module1 ReadOnly max As ULong = 1000000 Function Kaprekar(n As ULong) As Boolean If n = 1 Then Return True Dim sq = n * n Dim sq_str = Str(sq) Dim l = Len(sq_str) For x = l - 1 To 1 Step -1 If sq_str(x) = "0" Then l = l - 1 Else Exit For End If Next For x = 1 To l - 1 Dim p2 = Val(Mid(sq_str, x + 1)) If p2 > n Then Continue For End If Dim p1 = Val(Left(sq_str, x)) If p1 > n Then Return False If (p1 + p2) = n Then Return True Next Return False End Function Sub Main() Dim count = 0 Console.WriteLine("Kaprekar numbers below 10000") For n = 1 To max - 1 If Kaprekar(n) Then count = count + 1 If n < 10000 Then Console.WriteLine("{0,2} {1,4}", count, n) End If End If Next Console.WriteLine() Console.WriteLine("{0} numbers below {1} are kaprekar numbers", count, max) End Sub End Module
Preserve the algorithm and functionality while converting the code from C to VB.
#include <stdio.h> #include <stdlib.h> #include <string.h> #include <stdint.h> #include <unistd.h> #include <fcntl.h> #include <sys/types.h> #include <sys/stat.h> void* mem_alloc(size_t item_size, size_t n_item) { size_t *x = calloc(1, sizeof(size_t)*2 + n_item * item_size); x[0] = item_size; x[1] = n_item; return x + 2; } void* mem_extend(void *m, size_t new_n) { size_t *x = (size_t*)m - 2; x = realloc(x, sizeof(size_t) * 2 + *x * new_n); if (new_n > x[1]) memset((char*)(x + 2) + x[0] * x[1], 0, x[0] * (new_n - x[1])); x[1] = new_n; return x + 2; } inline void _clear(void *m) { size_t *x = (size_t*)m - 2; memset(m, 0, x[0] * x[1]); } #define _new(type, n) mem_alloc(sizeof(type), n) #define _del(m) { free((size_t*)(m) - 2); m = 0; } #define _len(m) *((size_t*)m - 1) #define _setsize(m, n) m = mem_extend(m, n) #define _extend(m) m = mem_extend(m, _len(m) * 2) typedef uint8_t byte; typedef uint16_t ushort; #define M_CLR 256 #define M_EOD 257 #define M_NEW 258 typedef struct { ushort next[256]; } lzw_enc_t; typedef struct { ushort prev, back; byte c; } lzw_dec_t; byte* lzw_encode(byte *in, int max_bits) { int len = _len(in), bits = 9, next_shift = 512; ushort code, c, nc, next_code = M_NEW; lzw_enc_t *d = _new(lzw_enc_t, 512); if (max_bits > 15) max_bits = 15; if (max_bits < 9 ) max_bits = 12; byte *out = _new(ushort, 4); int out_len = 0, o_bits = 0; uint32_t tmp = 0; inline void write_bits(ushort x) { tmp = (tmp << bits) | x; o_bits += bits; if (_len(out) <= out_len) _extend(out); while (o_bits >= 8) { o_bits -= 8; out[out_len++] = tmp >> o_bits; tmp &= (1 << o_bits) - 1; } } for (code = *(in++); --len; ) { c = *(in++); if ((nc = d[code].next[c])) code = nc; else { write_bits(code); nc = d[code].next[c] = next_code++; code = c; } if (next_code == next_shift) { if (++bits > max_bits) { write_bits(M_CLR); bits = 9; next_shift = 512; next_code = M_NEW; _clear(d); } else _setsize(d, next_shift *= 2); } } write_bits(code); write_bits(M_EOD); if (tmp) write_bits(tmp); _del(d); _setsize(out, out_len); return out; } byte* lzw_decode(byte *in) { byte *out = _new(byte, 4); int out_len = 0; inline void write_out(byte c) { while (out_len >= _len(out)) _extend(out); out[out_len++] = c; } lzw_dec_t *d = _new(lzw_dec_t, 512); int len, j, next_shift = 512, bits = 9, n_bits = 0; ushort code, c, t, next_code = M_NEW; uint32_t tmp = 0; inline void get_code() { while(n_bits < bits) { if (len > 0) { len --; tmp = (tmp << 8) | *(in++); n_bits += 8; } else { tmp = tmp << (bits - n_bits); n_bits = bits; } } n_bits -= bits; code = tmp >> n_bits; tmp &= (1 << n_bits) - 1; } inline void clear_table() { _clear(d); for (j = 0; j < 256; j++) d[j].c = j; next_code = M_NEW; next_shift = 512; bits = 9; }; clear_table(); for (len = _len(in); len;) { get_code(); if (code == M_EOD) break; if (code == M_CLR) { clear_table(); continue; } if (code >= next_code) { fprintf(stderr, "Bad sequence\n"); _del(out); goto bail; } d[next_code].prev = c = code; while (c > 255) { t = d[c].prev; d[t].back = c; c = t; } d[next_code - 1].c = c; while (d[c].back) { write_out(d[c].c); t = d[c].back; d[c].back = 0; c = t; } write_out(d[c].c); if (++next_code >= next_shift) { if (++bits > 16) { fprintf(stderr, "Too many bits\n"); _del(out); goto bail; } _setsize(d, next_shift *= 2); } } if (code != M_EOD) fputs("Bits did not end in EOD\n", stderr); _setsize(out, out_len); bail: _del(d); return out; } int main() { int i, fd = open("unixdict.txt", O_RDONLY); if (fd == -1) { fprintf(stderr, "Can't read file\n"); return 1; }; struct stat st; fstat(fd, &st); byte *in = _new(char, st.st_size); read(fd, in, st.st_size); _setsize(in, st.st_size); close(fd); printf("input size: %d\n", _len(in)); byte *enc = lzw_encode(in, 9); printf("encoded size: %d\n", _len(enc)); byte *dec = lzw_decode(enc); printf("decoded size: %d\n", _len(dec)); for (i = 0; i < _len(dec); i++) if (dec[i] != in[i]) { printf("bad decode at %d\n", i); break; } if (i == _len(dec)) printf("Decoded ok\n"); _del(in); _del(enc); _del(dec); return 0; }
Option Explicit Const numchars=127 Function LZWCompress(si) Dim oDict, intMaxCode, i,z,ii,ss,strCurrent,strNext,j Set oDict = CreateObject("Scripting.Dictionary") ReDim a(Len(si)) intMaxCode = numchars For i = 0 To numchars oDict.Add Chr(i), i Next strCurrent = Left(si,1) j=0 For ii=2 To Len(si) strNext = Mid(si,ii,1) ss=strCurrent & strNext If oDict.Exists(ss) Then strCurrent = ss Else a(j)=oDict.Item(strCurrent) :j=j+1 intMaxCode = intMaxCode + 1 oDict.Add ss, intMaxCode strCurrent = strNext End If Next a(j)=oDict.Item(strCurrent) ReDim preserve a(j) LZWCompress=a Set oDict = Nothing End Function Function lzwUncompress(sc) Dim intNext, intCurrent, intMaxCode, i,ss,istr,s,j s="" reDim dict(1000) intMaxCode = numchars For i = 0 To numchars : dict(i)= Chr(i) : Next intCurrent=sc(0) For j=1 To UBound(sc) ss=dict(intCurrent) s= s & ss intMaxCode = intMaxCode + 1 intnext=sc(j) If intNext<intMaxCode Then dict(intMaxCode)=ss & Left(dict(intNext), 1) Else dict(intMaxCode)=ss & Left(ss, 1) End If intCurrent = intNext Next s= s & dict(intCurrent) lzwUncompress=s End function Sub printvec(a) Dim s,i,x s="(" For i=0 To UBound (a) s=s & x & a(i) x=", " Next WScript.echo s &")" End sub Dim a,b b="TOBEORNOTTOBEORTOBEORNOT" WScript.Echo b a=LZWCompress (b) printvec(a) WScript.echo lzwUncompress (a ) wscript.quit 1
Rewrite the snippet below in VB so it works the same as the original C code.
#include <stdio.h> #include <stdlib.h> typedef unsigned long long xint; typedef struct { size_t len, alloc; xint *buf; } xarray; xarray rs, ss; void setsize(xarray *a, size_t size) { size_t n = a->alloc; if (!n) n = 1; while (n < size) n <<= 1; if (a->alloc < n) { a->buf = realloc(a->buf, sizeof(xint) * n); if (!a->buf) abort(); a->alloc = n; } } void push(xarray *a, xint v) { while (a->alloc <= a->len) setsize(a, a->alloc * 2); a->buf[a->len++] = v; } void RS_append(void); xint R(int n) { while (n > rs.len) RS_append(); return rs.buf[n - 1]; } xint S(int n) { while (n > ss.len) RS_append(); return ss.buf[n - 1]; } void RS_append() { int n = rs.len; xint r = R(n) + S(n); xint s = S(ss.len); push(&rs, r); while (++s < r) push(&ss, s); push(&ss, r + 1); } int main(void) { push(&rs, 1); push(&ss, 2); int i; printf("R(1 .. 10):"); for (i = 1; i <= 10; i++) printf(" %llu", R(i)); char seen[1001] = { 0 }; for (i = 1; i <= 40; i++) seen[ R(i) ] = 1; for (i = 1; i <= 960; i++) seen[ S(i) ] = 1; for (i = 1; i <= 1000 && seen[i]; i++); if (i <= 1000) { fprintf(stderr, "%d not seen\n", i); abort(); } puts("\nfirst 1000 ok"); return 0; }
Private Function ffr(n As Long) As Long Dim R As New Collection Dim S As New Collection R.Add 1 S.Add 2 For i = 2 To n R.Add R(i - 1) + S(i - 1) For j = S(S.Count) + 1 To R(i) - 1 S.Add j Next j For j = R(i) + 1 To R(i) + S(i - 1) S.Add j Next j Next i ffr = R(n) Set R = Nothing Set S = Nothing End Function Private Function ffs(n As Long) As Long Dim R As New Collection Dim S As New Collection R.Add 1 S.Add 2 For i = 2 To n R.Add R(i - 1) + S(i - 1) For j = S(S.Count) + 1 To R(i) - 1 S.Add j Next j For j = R(i) + 1 To R(i) + S(i - 1) S.Add j Next j If S.Count >= n Then Exit For Next i ffs = S(n) Set R = Nothing Set S = Nothing End Function Public Sub main() Dim i As Long Debug.Print "The first ten values of R are:" For i = 1 To 10 Debug.Print ffr(i); Next i Debug.Print Dim x As New Collection For i = 1 To 1000 x.Add i, CStr(i) Next i For i = 1 To 40 x.Remove CStr(ffr(i)) Next i For i = 1 To 960 x.Remove CStr(ffs(i)) Next i Debug.Print "The first 40 values of ffr plus the first 960 values of ffs " Debug.Print "include all the integers from 1 to 1000 exactly once is "; Format(x.Count = 0) End Sub
Change the following C code into VB without altering its purpose.
#include <stdio.h> #include <stdlib.h> typedef unsigned long long xint; typedef struct { size_t len, alloc; xint *buf; } xarray; xarray rs, ss; void setsize(xarray *a, size_t size) { size_t n = a->alloc; if (!n) n = 1; while (n < size) n <<= 1; if (a->alloc < n) { a->buf = realloc(a->buf, sizeof(xint) * n); if (!a->buf) abort(); a->alloc = n; } } void push(xarray *a, xint v) { while (a->alloc <= a->len) setsize(a, a->alloc * 2); a->buf[a->len++] = v; } void RS_append(void); xint R(int n) { while (n > rs.len) RS_append(); return rs.buf[n - 1]; } xint S(int n) { while (n > ss.len) RS_append(); return ss.buf[n - 1]; } void RS_append() { int n = rs.len; xint r = R(n) + S(n); xint s = S(ss.len); push(&rs, r); while (++s < r) push(&ss, s); push(&ss, r + 1); } int main(void) { push(&rs, 1); push(&ss, 2); int i; printf("R(1 .. 10):"); for (i = 1; i <= 10; i++) printf(" %llu", R(i)); char seen[1001] = { 0 }; for (i = 1; i <= 40; i++) seen[ R(i) ] = 1; for (i = 1; i <= 960; i++) seen[ S(i) ] = 1; for (i = 1; i <= 1000 && seen[i]; i++); if (i <= 1000) { fprintf(stderr, "%d not seen\n", i); abort(); } puts("\nfirst 1000 ok"); return 0; }
Private Function ffr(n As Long) As Long Dim R As New Collection Dim S As New Collection R.Add 1 S.Add 2 For i = 2 To n R.Add R(i - 1) + S(i - 1) For j = S(S.Count) + 1 To R(i) - 1 S.Add j Next j For j = R(i) + 1 To R(i) + S(i - 1) S.Add j Next j Next i ffr = R(n) Set R = Nothing Set S = Nothing End Function Private Function ffs(n As Long) As Long Dim R As New Collection Dim S As New Collection R.Add 1 S.Add 2 For i = 2 To n R.Add R(i - 1) + S(i - 1) For j = S(S.Count) + 1 To R(i) - 1 S.Add j Next j For j = R(i) + 1 To R(i) + S(i - 1) S.Add j Next j If S.Count >= n Then Exit For Next i ffs = S(n) Set R = Nothing Set S = Nothing End Function Public Sub main() Dim i As Long Debug.Print "The first ten values of R are:" For i = 1 To 10 Debug.Print ffr(i); Next i Debug.Print Dim x As New Collection For i = 1 To 1000 x.Add i, CStr(i) Next i For i = 1 To 40 x.Remove CStr(ffr(i)) Next i For i = 1 To 960 x.Remove CStr(ffs(i)) Next i Debug.Print "The first 40 values of ffr plus the first 960 values of ffs " Debug.Print "include all the integers from 1 to 1000 exactly once is "; Format(x.Count = 0) End Sub
Convert this C block to VB, preserving its control flow and logic.
#include <stdio.h> #include <stdlib.h> int f(int n, int x, int y) { return (x + y*2 + 1)%n; } int main(int argc, char **argv) { int i, j, n; if(argc!=2) return 1; n = atoi(argv[1]); if (n < 3 || (n%2) == 0) return 2; for (i = 0; i < n; i++) { for (j = 0; j < n; j++) printf("% 4d", f(n, n - j - 1, i)*n + f(n, j, i) + 1); putchar('\n'); } printf("\n Magic Constant: %d.\n", (n*n+1)/2*n); return 0; }
Sub magicsquare() Const n = 9 Dim i As Integer, j As Integer, v As Integer Debug.Print "The square order is: " & n For i = 1 To n For j = 1 To n Cells(i, j) = ((i * 2 - j + n - 1) Mod n) * n + ((i * 2 + j - 2) Mod n) + 1 Next j Next i Debug.Print "The magic number of"; n; "x"; n; "square is:"; n * (n * n + 1) \ 2 End Sub
Write a version of this C function in VB with identical behavior.
#include <stdio.h> #include <stdlib.h> int f(int n, int x, int y) { return (x + y*2 + 1)%n; } int main(int argc, char **argv) { int i, j, n; if(argc!=2) return 1; n = atoi(argv[1]); if (n < 3 || (n%2) == 0) return 2; for (i = 0; i < n; i++) { for (j = 0; j < n; j++) printf("% 4d", f(n, n - j - 1, i)*n + f(n, j, i) + 1); putchar('\n'); } printf("\n Magic Constant: %d.\n", (n*n+1)/2*n); return 0; }
Sub magicsquare() Const n = 9 Dim i As Integer, j As Integer, v As Integer Debug.Print "The square order is: " & n For i = 1 To n For j = 1 To n Cells(i, j) = ((i * 2 - j + n - 1) Mod n) * n + ((i * 2 + j - 2) Mod n) + 1 Next j Next i Debug.Print "The magic number of"; n; "x"; n; "square is:"; n * (n * n + 1) \ 2 End Sub
Transform the following C implementation into VB, maintaining the same output and logic.
#include <stdio.h> #include <stdlib.h> #include <math.h> float *benford_distribution(void) { static float prob[9]; for (int i = 1; i < 10; i++) prob[i - 1] = log10f(1 + 1.0 / i); return prob; } float *get_actual_distribution(char *fn) { FILE *input = fopen(fn, "r"); if (!input) { perror("Can't open file"); exit(EXIT_FAILURE); } int tally[9] = { 0 }; char c; int total = 0; while ((c = getc(input)) != EOF) { while (c < '1' || c > '9') c = getc(input); tally[c - '1']++; total++; while ((c = getc(input)) != '\n' && c != EOF) ; } fclose(input); static float freq[9]; for (int i = 0; i < 9; i++) freq[i] = tally[i] / (float) total; return freq; } int main(int argc, char **argv) { if (argc != 2) { printf("Usage: benford <file>\n"); return EXIT_FAILURE; } float *actual = get_actual_distribution(argv[1]); float *expected = benford_distribution(); puts("digit\tactual\texpected"); for (int i = 0; i < 9; i++) printf("%d\t%.3f\t%.3f\n", i + 1, actual[i], expected[i]); return EXIT_SUCCESS; }
Sub BenfordLaw() Dim BenResult(1 To 9) As Long BENref = "30,1%|17,6%|12,5%|9,7%|7,9%|6,7%|5,8%|5,1%|4,6%" For Each c In Selection.Cells If InStr(1, "-0123456789", Left(c, 1)) > 0 Then For i = 1 To 9 If CInt(Left(Abs(c), 1)) = i Then BenResult(i) = BenResult(i) + 1: Exit For Next End If Next Total= Application.Sum(BenResult) biggest= Len(CStr(BenResult(1))) txt = "# | Values | Real | Expected " & vbCrLf For i = 1 To 9 If BenResult(i) > 0 Then txt = txt & "#" & i & " | " & vbTab txt = txt & String((biggest - Len(CStr(BenResult(i)))) * 2, " ") & Format(BenResult(i), "0") & " | " & vbTab txt = txt & String((Len(CStr(Format(BenResult(1) / Total, "##0.0%"))) - Len(CStr(Format(BenResult(i) / Total, "##0.0%")))) * 2, " ") & Format(BenResult(i) / Total, "##0.0%") & " | " & vbTab txt = txt & Format(Split(BENref, "|")(i - 1), " ##0.0%") & vbCrLf End If Next MsgBox txt, vbOKOnly, "Finish" End Sub }
Write the same code in VB as shown below in C.
#include <stdio.h> #include <stdlib.h> #include <math.h> float *benford_distribution(void) { static float prob[9]; for (int i = 1; i < 10; i++) prob[i - 1] = log10f(1 + 1.0 / i); return prob; } float *get_actual_distribution(char *fn) { FILE *input = fopen(fn, "r"); if (!input) { perror("Can't open file"); exit(EXIT_FAILURE); } int tally[9] = { 0 }; char c; int total = 0; while ((c = getc(input)) != EOF) { while (c < '1' || c > '9') c = getc(input); tally[c - '1']++; total++; while ((c = getc(input)) != '\n' && c != EOF) ; } fclose(input); static float freq[9]; for (int i = 0; i < 9; i++) freq[i] = tally[i] / (float) total; return freq; } int main(int argc, char **argv) { if (argc != 2) { printf("Usage: benford <file>\n"); return EXIT_FAILURE; } float *actual = get_actual_distribution(argv[1]); float *expected = benford_distribution(); puts("digit\tactual\texpected"); for (int i = 0; i < 9; i++) printf("%d\t%.3f\t%.3f\n", i + 1, actual[i], expected[i]); return EXIT_SUCCESS; }
Sub BenfordLaw() Dim BenResult(1 To 9) As Long BENref = "30,1%|17,6%|12,5%|9,7%|7,9%|6,7%|5,8%|5,1%|4,6%" For Each c In Selection.Cells If InStr(1, "-0123456789", Left(c, 1)) > 0 Then For i = 1 To 9 If CInt(Left(Abs(c), 1)) = i Then BenResult(i) = BenResult(i) + 1: Exit For Next End If Next Total= Application.Sum(BenResult) biggest= Len(CStr(BenResult(1))) txt = "# | Values | Real | Expected " & vbCrLf For i = 1 To 9 If BenResult(i) > 0 Then txt = txt & "#" & i & " | " & vbTab txt = txt & String((biggest - Len(CStr(BenResult(i)))) * 2, " ") & Format(BenResult(i), "0") & " | " & vbTab txt = txt & String((Len(CStr(Format(BenResult(1) / Total, "##0.0%"))) - Len(CStr(Format(BenResult(i) / Total, "##0.0%")))) * 2, " ") & Format(BenResult(i) / Total, "##0.0%") & " | " & vbTab txt = txt & Format(Split(BENref, "|")(i - 1), " ##0.0%") & vbCrLf End If Next MsgBox txt, vbOKOnly, "Finish" End Sub }
Produce a language-to-language conversion: from C to VB, same semantics.
#include <stdio.h> long fib(long x) { long fib_i(long n) { return n < 2 ? n : fib_i(n - 2) + fib_i(n - 1); }; if (x < 0) { printf("Bad argument: fib(%ld)\n", x); return -1; } return fib_i(x); } long fib_i(long n) { printf("This is not the fib you are looking for\n"); return -1; } int main() { long x; for (x = -1; x < 4; x ++) printf("fib %ld = %ld\n", x, fib(x)); printf("calling fib_i from outside fib:\n"); fib_i(3); return 0; }
Sub Main() Debug.Print F(-10) Debug.Print F(10) End Sub Private Function F(N As Long) As Variant If N < 0 Then F = "Error. Negative argument" ElseIf N <= 1 Then F = N Else F = F(N - 1) + F(N - 2) End If End Function
Translate the given C code snippet into VB without altering its behavior.
#include <string.h> #include <stdlib.h> #include <stdio.h> int main( int argc, char ** argv ){ const char * str_a = "knight"; const char * str_b = "socks"; const char * str_c = "brooms"; char * new_a = malloc( strlen( str_a ) - 1 ); char * new_b = malloc( strlen( str_b ) - 1 ); char * new_c = malloc( strlen( str_c ) - 2 ); strcpy( new_a, str_a + 1 ); strncpy( new_b, str_b, strlen( str_b ) - 1 ); strncpy( new_c, str_c + 1, strlen( str_c ) - 2 ); printf( "%s\n%s\n%s\n", new_a, new_b, new_c ); free( new_a ); free( new_b ); free( new_c ); return 0; }
string = "Small Basic" TextWindow.WriteLine(Text.GetSubTextToEnd(string, 2)) TextWindow.WriteLine(Text.GetSubText(string, 1, Text.GetLength(string) - 1)) TextWindow.WriteLine(Text.GetSubText(string, 2, Text.GetLength(string) - 2))
Write the same code in VB as shown below in C.
#include <string.h> #include <stdlib.h> #include <stdio.h> int main( int argc, char ** argv ){ const char * str_a = "knight"; const char * str_b = "socks"; const char * str_c = "brooms"; char * new_a = malloc( strlen( str_a ) - 1 ); char * new_b = malloc( strlen( str_b ) - 1 ); char * new_c = malloc( strlen( str_c ) - 2 ); strcpy( new_a, str_a + 1 ); strncpy( new_b, str_b, strlen( str_b ) - 1 ); strncpy( new_c, str_c + 1, strlen( str_c ) - 2 ); printf( "%s\n%s\n%s\n", new_a, new_b, new_c ); free( new_a ); free( new_b ); free( new_c ); return 0; }
string = "Small Basic" TextWindow.WriteLine(Text.GetSubTextToEnd(string, 2)) TextWindow.WriteLine(Text.GetSubText(string, 1, Text.GetLength(string) - 1)) TextWindow.WriteLine(Text.GetSubText(string, 2, Text.GetLength(string) - 2))
Generate a VB translation of this C snippet without changing its computational steps.
#include <stdio.h> #include <string.h> int cmp(const char *p, const char *q) { while (*p && *q) p = &p[1], q = &q[1]; return *p; } int main() { char line[65536]; char buf[1000000] = {0}; char *last = buf; char *next = buf; while (gets(line)) { strcat(line, "\n"); if (cmp(last, line)) continue; if (cmp(line, last)) next = buf; last = next; strcpy(next, line); while (*next) next = &next[1]; } printf("%s", buf); return 0; }
Set objfso = CreateObject("Scripting.FileSystemObject") Set objfile = objfso.OpenTextFile(objfso.GetParentFolderName(WScript.ScriptFullName) &_ "\input.txt",1) list = "" previous_line = "" l = Len(previous_line) Do Until objfile.AtEndOfStream current_line = objfile.ReadLine If Mid(current_line,l+1,1) <> "" Then list = current_line & vbCrLf previous_line = current_line l = Len(previous_line) ElseIf Mid(current_line,l,1) <> "" And Mid(current_line,(l+1),1) = "" Then list = list & current_line & vbCrLf End If Loop WScript.Echo list objfile.Close Set objfso = Nothing
Can you help me rewrite this code in VB instead of C, keeping it the same logically?
#include <stdio.h> #include <stdarg.h> #include <stdlib.h> #include <string.h> enum { LEFT, RIGHT, STAY }; typedef struct { int state1; int symbol1; int symbol2; int dir; int state2; } transition_t; typedef struct tape_t tape_t; struct tape_t { int symbol; tape_t *left; tape_t *right; }; typedef struct { int states_len; char **states; int final_states_len; int *final_states; int symbols_len; char *symbols; int blank; int state; int tape_len; tape_t *tape; int transitions_len; transition_t ***transitions; } turing_t; int state_index (turing_t *t, char *state) { int i; for (i = 0; i < t->states_len; i++) { if (!strcmp(t->states[i], state)) { return i; } } return 0; } int symbol_index (turing_t *t, char symbol) { int i; for (i = 0; i < t->symbols_len; i++) { if (t->symbols[i] == symbol) { return i; } } return 0; } void move (turing_t *t, int dir) { tape_t *orig = t->tape; if (dir == RIGHT) { if (orig && orig->right) { t->tape = orig->right; } else { t->tape = calloc(1, sizeof (tape_t)); t->tape->symbol = t->blank; if (orig) { t->tape->left = orig; orig->right = t->tape; } } } else if (dir == LEFT) { if (orig && orig->left) { t->tape = orig->left; } else { t->tape = calloc(1, sizeof (tape_t)); t->tape->symbol = t->blank; if (orig) { t->tape->right = orig; orig->left = t->tape; } } } } turing_t *create (int states_len, ...) { va_list args; va_start(args, states_len); turing_t *t = malloc(sizeof (turing_t)); t->states_len = states_len; t->states = malloc(states_len * sizeof (char *)); int i; for (i = 0; i < states_len; i++) { t->states[i] = va_arg(args, char *); } t->final_states_len = va_arg(args, int); t->final_states = malloc(t->final_states_len * sizeof (int)); for (i = 0; i < t->final_states_len; i++) { t->final_states[i] = state_index(t, va_arg(args, char *)); } t->symbols_len = va_arg(args, int); t->symbols = malloc(t->symbols_len); for (i = 0; i < t->symbols_len; i++) { t->symbols[i] = va_arg(args, int); } t->blank = symbol_index(t, va_arg(args, int)); t->state = state_index(t, va_arg(args, char *)); t->tape_len = va_arg(args, int); t->tape = NULL; for (i = 0; i < t->tape_len; i++) { move(t, RIGHT); t->tape->symbol = symbol_index(t, va_arg(args, int)); } if (!t->tape_len) { move(t, RIGHT); } while (t->tape->left) { t->tape = t->tape->left; } t->transitions_len = va_arg(args, int); t->transitions = malloc(t->states_len * sizeof (transition_t **)); for (i = 0; i < t->states_len; i++) { t->transitions[i] = malloc(t->symbols_len * sizeof (transition_t *)); } for (i = 0; i < t->transitions_len; i++) { transition_t *tran = malloc(sizeof (transition_t)); tran->state1 = state_index(t, va_arg(args, char *)); tran->symbol1 = symbol_index(t, va_arg(args, int)); tran->symbol2 = symbol_index(t, va_arg(args, int)); tran->dir = va_arg(args, int); tran->state2 = state_index(t, va_arg(args, char *)); t->transitions[tran->state1][tran->symbol1] = tran; } va_end(args); return t; } void print_state (turing_t *t) { printf("%-10s ", t->states[t->state]); tape_t *tape = t->tape; while (tape->left) { tape = tape->left; } while (tape) { if (tape == t->tape) { printf("[%c]", t->symbols[tape->symbol]); } else { printf(" %c ", t->symbols[tape->symbol]); } tape = tape->right; } printf("\n"); } void run (turing_t *t) { int i; while (1) { print_state(t); for (i = 0; i < t->final_states_len; i++) { if (t->final_states[i] == t->state) { return; } } transition_t *tran = t->transitions[t->state][t->tape->symbol]; t->tape->symbol = tran->symbol2; move(t, tran->dir); t->state = tran->state2; } } int main () { printf("Simple incrementer\n"); turing_t *t = create( 2, "q0", "qf", 1, "qf", 2, 'B', '1', 'B', "q0", 3, '1', '1', '1', 2, "q0", '1', '1', RIGHT, "q0", "q0", 'B', '1', STAY, "qf" ); run(t); printf("\nThree-state busy beaver\n"); t = create( 4, "a", "b", "c", "halt", 1, "halt", 2, '0', '1', '0', "a", 0, 6, "a", '0', '1', RIGHT, "b", "a", '1', '1', LEFT, "c", "b", '0', '1', LEFT, "a", "b", '1', '1', RIGHT, "b", "c", '0', '1', LEFT, "b", "c", '1', '1', STAY, "halt" ); run(t); return 0; printf("\nFive-state two-symbol probable busy beaver\n"); t = create( 6, "A", "B", "C", "D", "E", "H", 1, "H", 2, '0', '1', '0', "A", 0, 10, "A", '0', '1', RIGHT, "B", "A", '1', '1', LEFT, "C", "B", '0', '1', RIGHT, "C", "B", '1', '1', RIGHT, "B", "C", '0', '1', RIGHT, "D", "C", '1', '0', LEFT, "E", "D", '0', '1', LEFT, "A", "D", '1', '1', LEFT, "D", "E", '0', '1', STAY, "H", "E", '1', '0', LEFT, "A" ); run(t); }
Option Base 1 Public Enum sett name_ = 1 initState endState blank rules End Enum Public incrementer As Variant, threeStateBB As Variant, fiveStateBB As Variant Private Sub init() incrementer = Array("Simple incrementer", _ "q0", _ "qf", _ "B", _ Array( _ Array("q0", "1", "1", "right", "q0"), _ Array("q0", "B", "1", "stay", "qf"))) threeStateBB = Array("Three-state busy beaver", _ "a", _ "halt", _ "0", _ Array( _ Array("a", "0", "1", "right", "b"), _ Array("a", "1", "1", "left", "c"), _ Array("b", "0", "1", "left", "a"), _ Array("b", "1", "1", "right", "b"), _ Array("c", "0", "1", "left", "b"), _ Array("c", "1", "1", "stay", "halt"))) fiveStateBB = Array("Five-state busy beaver", _ "A", _ "H", _ "0", _ Array( _ Array("A", "0", "1", "right", "B"), _ Array("A", "1", "1", "left", "C"), _ Array("B", "0", "1", "right", "C"), _ Array("B", "1", "1", "right", "B"), _ Array("C", "0", "1", "right", "D"), _ Array("C", "1", "0", "left", "E"), _ Array("D", "0", "1", "left", "A"), _ Array("D", "1", "1", "left", "D"), _ Array("E", "0", "1", "stay", "H"), _ Array("E", "1", "0", "left", "A"))) End Sub Private Sub show(state As String, headpos As Long, tape As Collection) Debug.Print " "; state; String$(7 - Len(state), " "); "| "; For p = 1 To tape.Count Debug.Print IIf(p = headpos, "[" & tape(p) & "]", " " & tape(p) & " "); Next p Debug.Print End Sub Private Sub UTM(machine As Variant, tape As Collection, Optional countOnly As Long = 0) Dim state As String: state = machine(initState) Dim headpos As Long: headpos = 1 Dim counter As Long, rule As Variant Debug.Print machine(name_); vbCrLf; String$(Len(machine(name_)), "=") If Not countOnly Then Debug.Print " State | Tape [head]" & vbCrLf & "---------------------" Do While True If headpos > tape.Count Then tape.Add machine(blank) Else If headpos < 1 Then tape.Add machine(blank), Before:=1 headpos = 1 End If End If If Not countOnly Then show state, headpos, tape For i = LBound(machine(rules)) To UBound(machine(rules)) rule = machine(rules)(i) If rule(1) = state And rule(2) = tape(headpos) Then tape.Remove headpos If headpos > tape.Count Then tape.Add rule(3) Else tape.Add rule(3), Before:=headpos End If If rule(4) = "left" Then headpos = headpos - 1 If rule(4) = "right" Then headpos = headpos + 1 state = rule(5) Exit For End If Next i counter = counter + 1 If counter Mod 100000 = 0 Then Debug.Print counter DoEvents DoEvents End If If state = machine(endState) Then Exit Do Loop DoEvents If countOnly Then Debug.Print "Steps taken: ", counter Else show state, headpos, tape Debug.Print End If End Sub Public Sub main() init Dim tap As New Collection tap.Add "1": tap.Add "1": tap.Add "1" UTM incrementer, tap Set tap = New Collection UTM threeStateBB, tap Set tap = New Collection UTM fiveStateBB, tap, countOnly:=-1 End Sub
Ensure the translated VB code behaves exactly like the original C snippet.
#include <stdio.h> #include <stdarg.h> #include <stdlib.h> #include <string.h> enum { LEFT, RIGHT, STAY }; typedef struct { int state1; int symbol1; int symbol2; int dir; int state2; } transition_t; typedef struct tape_t tape_t; struct tape_t { int symbol; tape_t *left; tape_t *right; }; typedef struct { int states_len; char **states; int final_states_len; int *final_states; int symbols_len; char *symbols; int blank; int state; int tape_len; tape_t *tape; int transitions_len; transition_t ***transitions; } turing_t; int state_index (turing_t *t, char *state) { int i; for (i = 0; i < t->states_len; i++) { if (!strcmp(t->states[i], state)) { return i; } } return 0; } int symbol_index (turing_t *t, char symbol) { int i; for (i = 0; i < t->symbols_len; i++) { if (t->symbols[i] == symbol) { return i; } } return 0; } void move (turing_t *t, int dir) { tape_t *orig = t->tape; if (dir == RIGHT) { if (orig && orig->right) { t->tape = orig->right; } else { t->tape = calloc(1, sizeof (tape_t)); t->tape->symbol = t->blank; if (orig) { t->tape->left = orig; orig->right = t->tape; } } } else if (dir == LEFT) { if (orig && orig->left) { t->tape = orig->left; } else { t->tape = calloc(1, sizeof (tape_t)); t->tape->symbol = t->blank; if (orig) { t->tape->right = orig; orig->left = t->tape; } } } } turing_t *create (int states_len, ...) { va_list args; va_start(args, states_len); turing_t *t = malloc(sizeof (turing_t)); t->states_len = states_len; t->states = malloc(states_len * sizeof (char *)); int i; for (i = 0; i < states_len; i++) { t->states[i] = va_arg(args, char *); } t->final_states_len = va_arg(args, int); t->final_states = malloc(t->final_states_len * sizeof (int)); for (i = 0; i < t->final_states_len; i++) { t->final_states[i] = state_index(t, va_arg(args, char *)); } t->symbols_len = va_arg(args, int); t->symbols = malloc(t->symbols_len); for (i = 0; i < t->symbols_len; i++) { t->symbols[i] = va_arg(args, int); } t->blank = symbol_index(t, va_arg(args, int)); t->state = state_index(t, va_arg(args, char *)); t->tape_len = va_arg(args, int); t->tape = NULL; for (i = 0; i < t->tape_len; i++) { move(t, RIGHT); t->tape->symbol = symbol_index(t, va_arg(args, int)); } if (!t->tape_len) { move(t, RIGHT); } while (t->tape->left) { t->tape = t->tape->left; } t->transitions_len = va_arg(args, int); t->transitions = malloc(t->states_len * sizeof (transition_t **)); for (i = 0; i < t->states_len; i++) { t->transitions[i] = malloc(t->symbols_len * sizeof (transition_t *)); } for (i = 0; i < t->transitions_len; i++) { transition_t *tran = malloc(sizeof (transition_t)); tran->state1 = state_index(t, va_arg(args, char *)); tran->symbol1 = symbol_index(t, va_arg(args, int)); tran->symbol2 = symbol_index(t, va_arg(args, int)); tran->dir = va_arg(args, int); tran->state2 = state_index(t, va_arg(args, char *)); t->transitions[tran->state1][tran->symbol1] = tran; } va_end(args); return t; } void print_state (turing_t *t) { printf("%-10s ", t->states[t->state]); tape_t *tape = t->tape; while (tape->left) { tape = tape->left; } while (tape) { if (tape == t->tape) { printf("[%c]", t->symbols[tape->symbol]); } else { printf(" %c ", t->symbols[tape->symbol]); } tape = tape->right; } printf("\n"); } void run (turing_t *t) { int i; while (1) { print_state(t); for (i = 0; i < t->final_states_len; i++) { if (t->final_states[i] == t->state) { return; } } transition_t *tran = t->transitions[t->state][t->tape->symbol]; t->tape->symbol = tran->symbol2; move(t, tran->dir); t->state = tran->state2; } } int main () { printf("Simple incrementer\n"); turing_t *t = create( 2, "q0", "qf", 1, "qf", 2, 'B', '1', 'B', "q0", 3, '1', '1', '1', 2, "q0", '1', '1', RIGHT, "q0", "q0", 'B', '1', STAY, "qf" ); run(t); printf("\nThree-state busy beaver\n"); t = create( 4, "a", "b", "c", "halt", 1, "halt", 2, '0', '1', '0', "a", 0, 6, "a", '0', '1', RIGHT, "b", "a", '1', '1', LEFT, "c", "b", '0', '1', LEFT, "a", "b", '1', '1', RIGHT, "b", "c", '0', '1', LEFT, "b", "c", '1', '1', STAY, "halt" ); run(t); return 0; printf("\nFive-state two-symbol probable busy beaver\n"); t = create( 6, "A", "B", "C", "D", "E", "H", 1, "H", 2, '0', '1', '0', "A", 0, 10, "A", '0', '1', RIGHT, "B", "A", '1', '1', LEFT, "C", "B", '0', '1', RIGHT, "C", "B", '1', '1', RIGHT, "B", "C", '0', '1', RIGHT, "D", "C", '1', '0', LEFT, "E", "D", '0', '1', LEFT, "A", "D", '1', '1', LEFT, "D", "E", '0', '1', STAY, "H", "E", '1', '0', LEFT, "A" ); run(t); }
Option Base 1 Public Enum sett name_ = 1 initState endState blank rules End Enum Public incrementer As Variant, threeStateBB As Variant, fiveStateBB As Variant Private Sub init() incrementer = Array("Simple incrementer", _ "q0", _ "qf", _ "B", _ Array( _ Array("q0", "1", "1", "right", "q0"), _ Array("q0", "B", "1", "stay", "qf"))) threeStateBB = Array("Three-state busy beaver", _ "a", _ "halt", _ "0", _ Array( _ Array("a", "0", "1", "right", "b"), _ Array("a", "1", "1", "left", "c"), _ Array("b", "0", "1", "left", "a"), _ Array("b", "1", "1", "right", "b"), _ Array("c", "0", "1", "left", "b"), _ Array("c", "1", "1", "stay", "halt"))) fiveStateBB = Array("Five-state busy beaver", _ "A", _ "H", _ "0", _ Array( _ Array("A", "0", "1", "right", "B"), _ Array("A", "1", "1", "left", "C"), _ Array("B", "0", "1", "right", "C"), _ Array("B", "1", "1", "right", "B"), _ Array("C", "0", "1", "right", "D"), _ Array("C", "1", "0", "left", "E"), _ Array("D", "0", "1", "left", "A"), _ Array("D", "1", "1", "left", "D"), _ Array("E", "0", "1", "stay", "H"), _ Array("E", "1", "0", "left", "A"))) End Sub Private Sub show(state As String, headpos As Long, tape As Collection) Debug.Print " "; state; String$(7 - Len(state), " "); "| "; For p = 1 To tape.Count Debug.Print IIf(p = headpos, "[" & tape(p) & "]", " " & tape(p) & " "); Next p Debug.Print End Sub Private Sub UTM(machine As Variant, tape As Collection, Optional countOnly As Long = 0) Dim state As String: state = machine(initState) Dim headpos As Long: headpos = 1 Dim counter As Long, rule As Variant Debug.Print machine(name_); vbCrLf; String$(Len(machine(name_)), "=") If Not countOnly Then Debug.Print " State | Tape [head]" & vbCrLf & "---------------------" Do While True If headpos > tape.Count Then tape.Add machine(blank) Else If headpos < 1 Then tape.Add machine(blank), Before:=1 headpos = 1 End If End If If Not countOnly Then show state, headpos, tape For i = LBound(machine(rules)) To UBound(machine(rules)) rule = machine(rules)(i) If rule(1) = state And rule(2) = tape(headpos) Then tape.Remove headpos If headpos > tape.Count Then tape.Add rule(3) Else tape.Add rule(3), Before:=headpos End If If rule(4) = "left" Then headpos = headpos - 1 If rule(4) = "right" Then headpos = headpos + 1 state = rule(5) Exit For End If Next i counter = counter + 1 If counter Mod 100000 = 0 Then Debug.Print counter DoEvents DoEvents End If If state = machine(endState) Then Exit Do Loop DoEvents If countOnly Then Debug.Print "Steps taken: ", counter Else show state, headpos, tape Debug.Print End If End Sub Public Sub main() init Dim tap As New Collection tap.Add "1": tap.Add "1": tap.Add "1" UTM incrementer, tap Set tap = New Collection UTM threeStateBB, tap Set tap = New Collection UTM fiveStateBB, tap, countOnly:=-1 End Sub
Port the provided C code into VB while preserving the original functionality.
#include <stdio.h> #include <stdarg.h> #include <stdlib.h> #include <string.h> enum { LEFT, RIGHT, STAY }; typedef struct { int state1; int symbol1; int symbol2; int dir; int state2; } transition_t; typedef struct tape_t tape_t; struct tape_t { int symbol; tape_t *left; tape_t *right; }; typedef struct { int states_len; char **states; int final_states_len; int *final_states; int symbols_len; char *symbols; int blank; int state; int tape_len; tape_t *tape; int transitions_len; transition_t ***transitions; } turing_t; int state_index (turing_t *t, char *state) { int i; for (i = 0; i < t->states_len; i++) { if (!strcmp(t->states[i], state)) { return i; } } return 0; } int symbol_index (turing_t *t, char symbol) { int i; for (i = 0; i < t->symbols_len; i++) { if (t->symbols[i] == symbol) { return i; } } return 0; } void move (turing_t *t, int dir) { tape_t *orig = t->tape; if (dir == RIGHT) { if (orig && orig->right) { t->tape = orig->right; } else { t->tape = calloc(1, sizeof (tape_t)); t->tape->symbol = t->blank; if (orig) { t->tape->left = orig; orig->right = t->tape; } } } else if (dir == LEFT) { if (orig && orig->left) { t->tape = orig->left; } else { t->tape = calloc(1, sizeof (tape_t)); t->tape->symbol = t->blank; if (orig) { t->tape->right = orig; orig->left = t->tape; } } } } turing_t *create (int states_len, ...) { va_list args; va_start(args, states_len); turing_t *t = malloc(sizeof (turing_t)); t->states_len = states_len; t->states = malloc(states_len * sizeof (char *)); int i; for (i = 0; i < states_len; i++) { t->states[i] = va_arg(args, char *); } t->final_states_len = va_arg(args, int); t->final_states = malloc(t->final_states_len * sizeof (int)); for (i = 0; i < t->final_states_len; i++) { t->final_states[i] = state_index(t, va_arg(args, char *)); } t->symbols_len = va_arg(args, int); t->symbols = malloc(t->symbols_len); for (i = 0; i < t->symbols_len; i++) { t->symbols[i] = va_arg(args, int); } t->blank = symbol_index(t, va_arg(args, int)); t->state = state_index(t, va_arg(args, char *)); t->tape_len = va_arg(args, int); t->tape = NULL; for (i = 0; i < t->tape_len; i++) { move(t, RIGHT); t->tape->symbol = symbol_index(t, va_arg(args, int)); } if (!t->tape_len) { move(t, RIGHT); } while (t->tape->left) { t->tape = t->tape->left; } t->transitions_len = va_arg(args, int); t->transitions = malloc(t->states_len * sizeof (transition_t **)); for (i = 0; i < t->states_len; i++) { t->transitions[i] = malloc(t->symbols_len * sizeof (transition_t *)); } for (i = 0; i < t->transitions_len; i++) { transition_t *tran = malloc(sizeof (transition_t)); tran->state1 = state_index(t, va_arg(args, char *)); tran->symbol1 = symbol_index(t, va_arg(args, int)); tran->symbol2 = symbol_index(t, va_arg(args, int)); tran->dir = va_arg(args, int); tran->state2 = state_index(t, va_arg(args, char *)); t->transitions[tran->state1][tran->symbol1] = tran; } va_end(args); return t; } void print_state (turing_t *t) { printf("%-10s ", t->states[t->state]); tape_t *tape = t->tape; while (tape->left) { tape = tape->left; } while (tape) { if (tape == t->tape) { printf("[%c]", t->symbols[tape->symbol]); } else { printf(" %c ", t->symbols[tape->symbol]); } tape = tape->right; } printf("\n"); } void run (turing_t *t) { int i; while (1) { print_state(t); for (i = 0; i < t->final_states_len; i++) { if (t->final_states[i] == t->state) { return; } } transition_t *tran = t->transitions[t->state][t->tape->symbol]; t->tape->symbol = tran->symbol2; move(t, tran->dir); t->state = tran->state2; } } int main () { printf("Simple incrementer\n"); turing_t *t = create( 2, "q0", "qf", 1, "qf", 2, 'B', '1', 'B', "q0", 3, '1', '1', '1', 2, "q0", '1', '1', RIGHT, "q0", "q0", 'B', '1', STAY, "qf" ); run(t); printf("\nThree-state busy beaver\n"); t = create( 4, "a", "b", "c", "halt", 1, "halt", 2, '0', '1', '0', "a", 0, 6, "a", '0', '1', RIGHT, "b", "a", '1', '1', LEFT, "c", "b", '0', '1', LEFT, "a", "b", '1', '1', RIGHT, "b", "c", '0', '1', LEFT, "b", "c", '1', '1', STAY, "halt" ); run(t); return 0; printf("\nFive-state two-symbol probable busy beaver\n"); t = create( 6, "A", "B", "C", "D", "E", "H", 1, "H", 2, '0', '1', '0', "A", 0, 10, "A", '0', '1', RIGHT, "B", "A", '1', '1', LEFT, "C", "B", '0', '1', RIGHT, "C", "B", '1', '1', RIGHT, "B", "C", '0', '1', RIGHT, "D", "C", '1', '0', LEFT, "E", "D", '0', '1', LEFT, "A", "D", '1', '1', LEFT, "D", "E", '0', '1', STAY, "H", "E", '1', '0', LEFT, "A" ); run(t); }
Option Base 1 Public Enum sett name_ = 1 initState endState blank rules End Enum Public incrementer As Variant, threeStateBB As Variant, fiveStateBB As Variant Private Sub init() incrementer = Array("Simple incrementer", _ "q0", _ "qf", _ "B", _ Array( _ Array("q0", "1", "1", "right", "q0"), _ Array("q0", "B", "1", "stay", "qf"))) threeStateBB = Array("Three-state busy beaver", _ "a", _ "halt", _ "0", _ Array( _ Array("a", "0", "1", "right", "b"), _ Array("a", "1", "1", "left", "c"), _ Array("b", "0", "1", "left", "a"), _ Array("b", "1", "1", "right", "b"), _ Array("c", "0", "1", "left", "b"), _ Array("c", "1", "1", "stay", "halt"))) fiveStateBB = Array("Five-state busy beaver", _ "A", _ "H", _ "0", _ Array( _ Array("A", "0", "1", "right", "B"), _ Array("A", "1", "1", "left", "C"), _ Array("B", "0", "1", "right", "C"), _ Array("B", "1", "1", "right", "B"), _ Array("C", "0", "1", "right", "D"), _ Array("C", "1", "0", "left", "E"), _ Array("D", "0", "1", "left", "A"), _ Array("D", "1", "1", "left", "D"), _ Array("E", "0", "1", "stay", "H"), _ Array("E", "1", "0", "left", "A"))) End Sub Private Sub show(state As String, headpos As Long, tape As Collection) Debug.Print " "; state; String$(7 - Len(state), " "); "| "; For p = 1 To tape.Count Debug.Print IIf(p = headpos, "[" & tape(p) & "]", " " & tape(p) & " "); Next p Debug.Print End Sub Private Sub UTM(machine As Variant, tape As Collection, Optional countOnly As Long = 0) Dim state As String: state = machine(initState) Dim headpos As Long: headpos = 1 Dim counter As Long, rule As Variant Debug.Print machine(name_); vbCrLf; String$(Len(machine(name_)), "=") If Not countOnly Then Debug.Print " State | Tape [head]" & vbCrLf & "---------------------" Do While True If headpos > tape.Count Then tape.Add machine(blank) Else If headpos < 1 Then tape.Add machine(blank), Before:=1 headpos = 1 End If End If If Not countOnly Then show state, headpos, tape For i = LBound(machine(rules)) To UBound(machine(rules)) rule = machine(rules)(i) If rule(1) = state And rule(2) = tape(headpos) Then tape.Remove headpos If headpos > tape.Count Then tape.Add rule(3) Else tape.Add rule(3), Before:=headpos End If If rule(4) = "left" Then headpos = headpos - 1 If rule(4) = "right" Then headpos = headpos + 1 state = rule(5) Exit For End If Next i counter = counter + 1 If counter Mod 100000 = 0 Then Debug.Print counter DoEvents DoEvents End If If state = machine(endState) Then Exit Do Loop DoEvents If countOnly Then Debug.Print "Steps taken: ", counter Else show state, headpos, tape Debug.Print End If End Sub Public Sub main() init Dim tap As New Collection tap.Add "1": tap.Add "1": tap.Add "1" UTM incrementer, tap Set tap = New Collection UTM threeStateBB, tap Set tap = New Collection UTM fiveStateBB, tap, countOnly:=-1 End Sub
Translate this program into VB but keep the logic exactly as in C.
#include <stdio.h> int main() { FILE *fh = fopen("output.txt", "w"); fclose(fh); return 0; }
Public Sub create_file() Dim FileNumber As Integer FileNumber = FreeFile MkDir "docs" Open "docs\output.txt" For Output As #FreeFile Close #FreeFile MkDir "C:\docs" Open "C:\docs\output.txt" For Output As #FreeFile Close #FreeFile End Sub
Convert the following code from C to VB, ensuring the logic remains intact.
#include<string.h> #include<stdlib.h> #include<stdio.h> typedef struct genome{ char* strand; int length; struct genome* next; }genome; genome* genomeData; int totalLength = 0, Adenine = 0, Cytosine = 0, Guanine = 0, Thymine = 0; int numDigits(int num){ int len = 1; while(num>10){ num = num/10; len++; } return len; } void buildGenome(char str[100]){ int len = strlen(str),i; genome *genomeIterator, *newGenome; totalLength += len; for(i=0;i<len;i++){ switch(str[i]){ case 'A': Adenine++; break; case 'T': Thymine++; break; case 'C': Cytosine++; break; case 'G': Guanine++; break; }; } if(genomeData==NULL){ genomeData = (genome*)malloc(sizeof(genome)); genomeData->strand = (char*)malloc(len*sizeof(char)); strcpy(genomeData->strand,str); genomeData->length = len; genomeData->next = NULL; } else{ genomeIterator = genomeData; while(genomeIterator->next!=NULL) genomeIterator = genomeIterator->next; newGenome = (genome*)malloc(sizeof(genome)); newGenome->strand = (char*)malloc(len*sizeof(char)); strcpy(newGenome->strand,str); newGenome->length = len; newGenome->next = NULL; genomeIterator->next = newGenome; } } void printGenome(){ genome* genomeIterator = genomeData; int width = numDigits(totalLength), len = 0; printf("Sequence:\n"); while(genomeIterator!=NULL){ printf("\n%*d%3s%3s",width+1,len,":",genomeIterator->strand); len += genomeIterator->length; genomeIterator = genomeIterator->next; } printf("\n\nBase Count\n----------\n\n"); printf("%3c%3s%*d\n",'A',":",width+1,Adenine); printf("%3c%3s%*d\n",'T',":",width+1,Thymine); printf("%3c%3s%*d\n",'C',":",width+1,Cytosine); printf("%3c%3s%*d\n",'G',":",width+1,Guanine); printf("\n%3s%*d\n","Total:",width+1,Adenine + Thymine + Cytosine + Guanine); free(genomeData); } int main(int argc,char** argv) { char str[100]; int counter = 0, len; if(argc!=2){ printf("Usage : %s <Gene file name>\n",argv[0]); return 0; } FILE *fp = fopen(argv[1],"r"); while(fscanf(fp,"%s",str)!=EOF) buildGenome(str); fclose(fp); printGenome(); return 0; }
b=_ "CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATG" &_ "CTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTG" &_ "AGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGAT" &_ "GGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT" &_ "CGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGG" &_ "TCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA" &_ "TTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTAT" &_ "CGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTG" &_ "TCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGAC" &_ "GACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT" s="SEQUENCE:" acnt=0:ccnt=0:gcnt=0:tcnt=0 for i=0 to len(b)-1 if (i mod 30)=0 then s = s & vbcrlf & right(" "& i+1,3)&": " if (i mod 5)=0 then s=s& " " m=mid(b,i+1,1) s=s & m select case m case "A":acnt=acnt+1 case "C":ccnt=ccnt+1 case "G":gcnt=gcnt+1 case "T":tcnt=tcnt+1 case else wscript.echo "error at ",i+1, m end select next wscript.echo s & vbcrlf wscript.echo "Count: A="&acnt & " C=" & ccnt & " G=" & gcnt & " T=" & tcnt
Ensure the translated VB code behaves exactly like the original C snippet.
#include<string.h> #include<stdlib.h> #include<stdio.h> typedef struct genome{ char* strand; int length; struct genome* next; }genome; genome* genomeData; int totalLength = 0, Adenine = 0, Cytosine = 0, Guanine = 0, Thymine = 0; int numDigits(int num){ int len = 1; while(num>10){ num = num/10; len++; } return len; } void buildGenome(char str[100]){ int len = strlen(str),i; genome *genomeIterator, *newGenome; totalLength += len; for(i=0;i<len;i++){ switch(str[i]){ case 'A': Adenine++; break; case 'T': Thymine++; break; case 'C': Cytosine++; break; case 'G': Guanine++; break; }; } if(genomeData==NULL){ genomeData = (genome*)malloc(sizeof(genome)); genomeData->strand = (char*)malloc(len*sizeof(char)); strcpy(genomeData->strand,str); genomeData->length = len; genomeData->next = NULL; } else{ genomeIterator = genomeData; while(genomeIterator->next!=NULL) genomeIterator = genomeIterator->next; newGenome = (genome*)malloc(sizeof(genome)); newGenome->strand = (char*)malloc(len*sizeof(char)); strcpy(newGenome->strand,str); newGenome->length = len; newGenome->next = NULL; genomeIterator->next = newGenome; } } void printGenome(){ genome* genomeIterator = genomeData; int width = numDigits(totalLength), len = 0; printf("Sequence:\n"); while(genomeIterator!=NULL){ printf("\n%*d%3s%3s",width+1,len,":",genomeIterator->strand); len += genomeIterator->length; genomeIterator = genomeIterator->next; } printf("\n\nBase Count\n----------\n\n"); printf("%3c%3s%*d\n",'A',":",width+1,Adenine); printf("%3c%3s%*d\n",'T',":",width+1,Thymine); printf("%3c%3s%*d\n",'C',":",width+1,Cytosine); printf("%3c%3s%*d\n",'G',":",width+1,Guanine); printf("\n%3s%*d\n","Total:",width+1,Adenine + Thymine + Cytosine + Guanine); free(genomeData); } int main(int argc,char** argv) { char str[100]; int counter = 0, len; if(argc!=2){ printf("Usage : %s <Gene file name>\n",argv[0]); return 0; } FILE *fp = fopen(argv[1],"r"); while(fscanf(fp,"%s",str)!=EOF) buildGenome(str); fclose(fp); printGenome(); return 0; }
b=_ "CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATG" &_ "CTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTG" &_ "AGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGAT" &_ "GGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT" &_ "CGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGG" &_ "TCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA" &_ "TTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTAT" &_ "CGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTG" &_ "TCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGAC" &_ "GACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT" s="SEQUENCE:" acnt=0:ccnt=0:gcnt=0:tcnt=0 for i=0 to len(b)-1 if (i mod 30)=0 then s = s & vbcrlf & right(" "& i+1,3)&": " if (i mod 5)=0 then s=s& " " m=mid(b,i+1,1) s=s & m select case m case "A":acnt=acnt+1 case "C":ccnt=ccnt+1 case "G":gcnt=gcnt+1 case "T":tcnt=tcnt+1 case else wscript.echo "error at ",i+1, m end select next wscript.echo s & vbcrlf wscript.echo "Count: A="&acnt & " C=" & ccnt & " G=" & gcnt & " T=" & tcnt
Change the following C code into VB without altering its purpose.
#include <pthread.h> #include <stdio.h> #include <stdlib.h> #include <unistd.h> #include <stdarg.h> #define N 5 const char *names[N] = { "Aristotle", "Kant", "Spinoza", "Marx", "Russell" }; pthread_mutex_t forks[N]; #define M 5 const char *topic[M] = { "Spaghetti!", "Life", "Universe", "Everything", "Bathroom" }; #define lock pthread_mutex_lock #define unlock pthread_mutex_unlock #define xy(x, y) printf("\033[%d;%dH", x, y) #define clear_eol(x) print(x, 12, "\033[K") void print(int y, int x, const char *fmt, ...) { static pthread_mutex_t screen = PTHREAD_MUTEX_INITIALIZER; va_list ap; va_start(ap, fmt); lock(&screen); xy(y + 1, x), vprintf(fmt, ap); xy(N + 1, 1), fflush(stdout); unlock(&screen); } void eat(int id) { int f[2], ration, i; f[0] = f[1] = id; f[id & 1] = (id + 1) % N; clear_eol(id); print(id, 12, "..oO (forks, need forks)"); for (i = 0; i < 2; i++) { lock(forks + f[i]); if (!i) clear_eol(id); print(id, 12 + (f[i] != id) * 6, "fork%d", f[i]); sleep(1); } for (i = 0, ration = 3 + rand() % 8; i < ration; i++) print(id, 24 + i * 4, "nom"), sleep(1); for (i = 0; i < 2; i++) unlock(forks + f[i]); } void think(int id) { int i, t; char buf[64] = {0}; do { clear_eol(id); sprintf(buf, "..oO (%s)", topic[t = rand() % M]); for (i = 0; buf[i]; i++) { print(id, i+12, "%c", buf[i]); if (i < 5) usleep(200000); } usleep(500000 + rand() % 1000000); } while (t); } void* philosophize(void *a) { int id = *(int*)a; print(id, 1, "%10s", names[id]); while(1) think(id), eat(id); } int main() { int i, id[N]; pthread_t tid[N]; for (i = 0; i < N; i++) pthread_mutex_init(forks + (id[i] = i), 0); for (i = 0; i < N; i++) pthread_create(tid + i, 0, philosophize, id + i); return pthread_join(tid[0], 0); }
Public Const HOLDON = False Public Const DIJKSTRASOLUTION = True Public Const X = 10 Public Const GETS = 0 Public Const PUTS = 1 Public Const EATS = 2 Public Const THKS = 5 Public Const FRSTFORK = 0 Public Const SCNDFORK = 1 Public Const SPAGHETI = 0 Public Const UNIVERSE = 1 Public Const MAXCOUNT = 100000 Public Const PHILOSOPHERS = 5 Public semaphore(PHILOSOPHERS - 1) As Integer Public positi0n(1, PHILOSOPHERS - 1) As Integer Public programcounter(PHILOSOPHERS - 1) As Long Public statistics(PHILOSOPHERS - 1, 5, 1) As Long Public names As Variant Private Sub init() names = [{"Aquinas","Babbage","Carroll","Derrida","Erasmus"}] For j = 0 To PHILOSOPHERS - 2 positi0n(0, j) = j + 1 positi0n(1, j) = j Next j If DIJKSTRASOLUTION Then positi0n(0, PHILOSOPHERS - 1) = j positi0n(1, PHILOSOPHERS - 1) = 0 Else positi0n(0, PHILOSOPHERS - 1) = 0 positi0n(1, PHILOSOPHERS - 1) = j End If End Sub Private Sub philosopher(subject As Integer, verb As Integer, objekt As Integer) statistics(subject, verb, objekt) = statistics(subject, verb, objekt) + 1 If verb < 2 Then If semaphore(positi0n(objekt, subject)) <> verb Then If Not HOLDON Then semaphore(positi0n(FRSTFORK, subject)) = 1 - objekt programcounter(subject) = 0 End If Else semaphore(positi0n(objekt, subject)) = 1 - verb programcounter(subject) = (programcounter(subject) + 1) Mod 6 End If Else programcounter(subject) = IIf(X * Rnd > 1, verb, verb + 1) Mod 6 End If End Sub Private Sub dine() Dim ph As Integer Do While TC < MAXCOUNT For ph = 0 To PHILOSOPHERS - 1 Select Case programcounter(ph) Case 0: philosopher ph, GETS, FRSTFORK Case 1: philosopher ph, GETS, SCNDFORK Case 2: philosopher ph, EATS, SPAGHETI Case 3: philosopher ph, PUTS, FRSTFORK Case 4: philosopher ph, PUTS, SCNDFORK Case 5: philosopher ph, THKS, UNIVERSE End Select TC = TC + 1 Next ph Loop End Sub Private Sub show() Debug.Print "Stats", "Gets", "Gets", "Eats", "Puts", "Puts", "Thinks" Debug.Print "", "First", "Second", "Spag-", "First", "Second", "About" Debug.Print "", "Fork", "Fork", "hetti", "Fork", "Fork", "Universe" For subject = 0 To PHILOSOPHERS - 1 Debug.Print names(subject + 1), For objekt = 0 To 1 Debug.Print statistics(subject, GETS, objekt), Next objekt Debug.Print statistics(subject, EATS, SPAGHETI), For objekt = 0 To 1 Debug.Print statistics(subject, PUTS, objekt), Next objekt Debug.Print statistics(subject, THKS, UNIVERSE) Next subject End Sub Public Sub main() init dine show End Sub
Preserve the algorithm and functionality while converting the code from C to VB.
#include <stdio.h> int main() { int n, b, d; unsigned long long i, j, sum, fact[12]; fact[0] = 1; for (n = 1; n < 12; ++n) { fact[n] = fact[n-1] * n; } for (b = 9; b <= 12; ++b) { printf("The factorions for base %d are:\n", b); for (i = 1; i < 1500000; ++i) { sum = 0; j = i; while (j > 0) { d = j % b; sum += fact[d]; j /= b; } if (sum == i) printf("%llu ", i); } printf("\n\n"); } return 0; }
Dim fact() nn1=9 : nn2=12 lim=1499999 ReDim fact(nn2) fact(0)=1 For i=1 To nn2 fact(i)=fact(i-1)*i Next For base=nn1 To nn2 list="" For i=1 To lim s=0 t=i Do While t<>0 d=t Mod base s=s+fact(d) t=t\base Loop If s=i Then list=list &" "& i Next Wscript.Echo "the factorions for base "& right(" "& base,2) &" are: "& list Next
Write the same algorithm in VB as shown in this C implementation.
#include <stdio.h> int main() { int n, b, d; unsigned long long i, j, sum, fact[12]; fact[0] = 1; for (n = 1; n < 12; ++n) { fact[n] = fact[n-1] * n; } for (b = 9; b <= 12; ++b) { printf("The factorions for base %d are:\n", b); for (i = 1; i < 1500000; ++i) { sum = 0; j = i; while (j > 0) { d = j % b; sum += fact[d]; j /= b; } if (sum == i) printf("%llu ", i); } printf("\n\n"); } return 0; }
Dim fact() nn1=9 : nn2=12 lim=1499999 ReDim fact(nn2) fact(0)=1 For i=1 To nn2 fact(i)=fact(i-1)*i Next For base=nn1 To nn2 list="" For i=1 To lim s=0 t=i Do While t<>0 d=t Mod base s=s+fact(d) t=t\base Loop If s=i Then list=list &" "& i Next Wscript.Echo "the factorions for base "& right(" "& base,2) &" are: "& list Next
Convert the following code from C to VB, ensuring the logic remains intact.
#include <ctype.h> #include <stdbool.h> #include <stdio.h> #include <stdlib.h> #include <string.h> const char* command_table = "Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy " "COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find " "NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput " "Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO " "MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT " "READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT " "RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up"; typedef struct command_tag { char* cmd; size_t length; size_t min_len; struct command_tag* next; } command_t; bool command_match(const command_t* command, const char* str) { size_t olen = strlen(str); return olen >= command->min_len && olen <= command->length && strncmp(str, command->cmd, olen) == 0; } char* uppercase(char* str, size_t n) { for (size_t i = 0; i < n; ++i) str[i] = toupper((unsigned char)str[i]); return str; } size_t get_min_length(const char* str, size_t n) { size_t len = 0; while (len < n && isupper((unsigned char)str[len])) ++len; return len; } void fatal(const char* message) { fprintf(stderr, "%s\n", message); exit(1); } void* xmalloc(size_t n) { void* ptr = malloc(n); if (ptr == NULL) fatal("Out of memory"); return ptr; } void* xrealloc(void* p, size_t n) { void* ptr = realloc(p, n); if (ptr == NULL) fatal("Out of memory"); return ptr; } char** split_into_words(const char* str, size_t* count) { size_t size = 0; size_t capacity = 16; char** words = xmalloc(capacity * sizeof(char*)); size_t len = strlen(str); for (size_t begin = 0; begin < len; ) { size_t i = begin; for (; i < len && isspace((unsigned char)str[i]); ++i) {} begin = i; for (; i < len && !isspace((unsigned char)str[i]); ++i) {} size_t word_len = i - begin; if (word_len == 0) break; char* word = xmalloc(word_len + 1); memcpy(word, str + begin, word_len); word[word_len] = 0; begin += word_len; if (capacity == size) { capacity *= 2; words = xrealloc(words, capacity * sizeof(char*)); } words[size++] = word; } *count = size; return words; } command_t* make_command_list(const char* table) { command_t* cmd = NULL; size_t count = 0; char** words = split_into_words(table, &count); for (size_t i = 0; i < count; ++i) { char* word = words[i]; command_t* new_cmd = xmalloc(sizeof(command_t)); size_t word_len = strlen(word); new_cmd->length = word_len; new_cmd->min_len = get_min_length(word, word_len); new_cmd->cmd = uppercase(word, word_len); new_cmd->next = cmd; cmd = new_cmd; } free(words); return cmd; } void free_command_list(command_t* cmd) { while (cmd != NULL) { command_t* next = cmd->next; free(cmd->cmd); free(cmd); cmd = next; } } const command_t* find_command(const command_t* commands, const char* word) { for (const command_t* cmd = commands; cmd != NULL; cmd = cmd->next) { if (command_match(cmd, word)) return cmd; } return NULL; } void test(const command_t* commands, const char* input) { printf(" input: %s\n", input); printf("output:"); size_t count = 0; char** words = split_into_words(input, &count); for (size_t i = 0; i < count; ++i) { char* word = words[i]; uppercase(word, strlen(word)); const command_t* cmd_ptr = find_command(commands, word); printf(" %s", cmd_ptr ? cmd_ptr->cmd : "*error*"); free(word); } free(words); printf("\n"); } int main() { command_t* commands = make_command_list(command_table); const char* input = "riG rePEAT copies put mo rest types fup. 6 poweRin"; test(commands, input); free_command_list(commands); return 0; }
Private Function ValidateUserWords(userstring As String) As String Dim s As String Dim user_words() As String Dim command_table As Scripting.Dictionary Set command_table = New Scripting.Dictionary Dim abbreviations As Scripting.Dictionary Set abbreviations = New Scripting.Dictionary abbreviations.CompareMode = TextCompare Dim commandtable() As String Dim commands As String s = s & "Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy " s = s & "COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find " s = s & "NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput " s = s & "Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO " s = s & "MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT " s = s & "READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT " s = s & "RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up " commandtable = Split(s, " ") Dim i As Integer For Each word In commandtable If Len(word) > 0 Then i = 1 Do While Mid(word, i, 1) >= "A" And Mid(word, i, 1) <= "Z" i = i + 1 Loop command_table.Add Key:=word, Item:=i - 1 End If Next word For Each word In command_table For i = command_table(word) To Len(word) On Error Resume Next abbreviations.Add Key:=Left(word, i), Item:=UCase(word) Next i Next word user_words() = Split(userstring, " ") For Each word In user_words If Len(word) > 0 Then If abbreviations.exists(word) Then commands = commands & abbreviations(word) & " " Else commands = commands & "*error* " End If End If Next word ValidateUserWords = commands End Function Public Sub program() Dim guserstring As String guserstring = "riG rePEAT copies put mo rest types fup. 6 poweRin" Debug.Print "user words:", guserstring Debug.Print "full words:", ValidateUserWords(guserstring) End Sub
Change the following C code into VB without altering its purpose.
#include <ctype.h> #include <stdbool.h> #include <stdio.h> #include <stdlib.h> #include <string.h> const char* command_table = "Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy " "COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find " "NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput " "Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO " "MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT " "READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT " "RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up"; typedef struct command_tag { char* cmd; size_t length; size_t min_len; struct command_tag* next; } command_t; bool command_match(const command_t* command, const char* str) { size_t olen = strlen(str); return olen >= command->min_len && olen <= command->length && strncmp(str, command->cmd, olen) == 0; } char* uppercase(char* str, size_t n) { for (size_t i = 0; i < n; ++i) str[i] = toupper((unsigned char)str[i]); return str; } size_t get_min_length(const char* str, size_t n) { size_t len = 0; while (len < n && isupper((unsigned char)str[len])) ++len; return len; } void fatal(const char* message) { fprintf(stderr, "%s\n", message); exit(1); } void* xmalloc(size_t n) { void* ptr = malloc(n); if (ptr == NULL) fatal("Out of memory"); return ptr; } void* xrealloc(void* p, size_t n) { void* ptr = realloc(p, n); if (ptr == NULL) fatal("Out of memory"); return ptr; } char** split_into_words(const char* str, size_t* count) { size_t size = 0; size_t capacity = 16; char** words = xmalloc(capacity * sizeof(char*)); size_t len = strlen(str); for (size_t begin = 0; begin < len; ) { size_t i = begin; for (; i < len && isspace((unsigned char)str[i]); ++i) {} begin = i; for (; i < len && !isspace((unsigned char)str[i]); ++i) {} size_t word_len = i - begin; if (word_len == 0) break; char* word = xmalloc(word_len + 1); memcpy(word, str + begin, word_len); word[word_len] = 0; begin += word_len; if (capacity == size) { capacity *= 2; words = xrealloc(words, capacity * sizeof(char*)); } words[size++] = word; } *count = size; return words; } command_t* make_command_list(const char* table) { command_t* cmd = NULL; size_t count = 0; char** words = split_into_words(table, &count); for (size_t i = 0; i < count; ++i) { char* word = words[i]; command_t* new_cmd = xmalloc(sizeof(command_t)); size_t word_len = strlen(word); new_cmd->length = word_len; new_cmd->min_len = get_min_length(word, word_len); new_cmd->cmd = uppercase(word, word_len); new_cmd->next = cmd; cmd = new_cmd; } free(words); return cmd; } void free_command_list(command_t* cmd) { while (cmd != NULL) { command_t* next = cmd->next; free(cmd->cmd); free(cmd); cmd = next; } } const command_t* find_command(const command_t* commands, const char* word) { for (const command_t* cmd = commands; cmd != NULL; cmd = cmd->next) { if (command_match(cmd, word)) return cmd; } return NULL; } void test(const command_t* commands, const char* input) { printf(" input: %s\n", input); printf("output:"); size_t count = 0; char** words = split_into_words(input, &count); for (size_t i = 0; i < count; ++i) { char* word = words[i]; uppercase(word, strlen(word)); const command_t* cmd_ptr = find_command(commands, word); printf(" %s", cmd_ptr ? cmd_ptr->cmd : "*error*"); free(word); } free(words); printf("\n"); } int main() { command_t* commands = make_command_list(command_table); const char* input = "riG rePEAT copies put mo rest types fup. 6 poweRin"; test(commands, input); free_command_list(commands); return 0; }
Private Function ValidateUserWords(userstring As String) As String Dim s As String Dim user_words() As String Dim command_table As Scripting.Dictionary Set command_table = New Scripting.Dictionary Dim abbreviations As Scripting.Dictionary Set abbreviations = New Scripting.Dictionary abbreviations.CompareMode = TextCompare Dim commandtable() As String Dim commands As String s = s & "Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy " s = s & "COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find " s = s & "NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput " s = s & "Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO " s = s & "MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT " s = s & "READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT " s = s & "RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up " commandtable = Split(s, " ") Dim i As Integer For Each word In commandtable If Len(word) > 0 Then i = 1 Do While Mid(word, i, 1) >= "A" And Mid(word, i, 1) <= "Z" i = i + 1 Loop command_table.Add Key:=word, Item:=i - 1 End If Next word For Each word In command_table For i = command_table(word) To Len(word) On Error Resume Next abbreviations.Add Key:=Left(word, i), Item:=UCase(word) Next i Next word user_words() = Split(userstring, " ") For Each word In user_words If Len(word) > 0 Then If abbreviations.exists(word) Then commands = commands & abbreviations(word) & " " Else commands = commands & "*error* " End If End If Next word ValidateUserWords = commands End Function Public Sub program() Dim guserstring As String guserstring = "riG rePEAT copies put mo rest types fup. 6 poweRin" Debug.Print "user words:", guserstring Debug.Print "full words:", ValidateUserWords(guserstring) End Sub
Convert this C block to VB, preserving its control flow and logic.
#include <ctype.h> #include <stdbool.h> #include <stdio.h> #include <stdlib.h> #include <string.h> const char* command_table = "Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy " "COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find " "NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput " "Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO " "MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT " "READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT " "RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up"; typedef struct command_tag { char* cmd; size_t length; size_t min_len; struct command_tag* next; } command_t; bool command_match(const command_t* command, const char* str) { size_t olen = strlen(str); return olen >= command->min_len && olen <= command->length && strncmp(str, command->cmd, olen) == 0; } char* uppercase(char* str, size_t n) { for (size_t i = 0; i < n; ++i) str[i] = toupper((unsigned char)str[i]); return str; } size_t get_min_length(const char* str, size_t n) { size_t len = 0; while (len < n && isupper((unsigned char)str[len])) ++len; return len; } void fatal(const char* message) { fprintf(stderr, "%s\n", message); exit(1); } void* xmalloc(size_t n) { void* ptr = malloc(n); if (ptr == NULL) fatal("Out of memory"); return ptr; } void* xrealloc(void* p, size_t n) { void* ptr = realloc(p, n); if (ptr == NULL) fatal("Out of memory"); return ptr; } char** split_into_words(const char* str, size_t* count) { size_t size = 0; size_t capacity = 16; char** words = xmalloc(capacity * sizeof(char*)); size_t len = strlen(str); for (size_t begin = 0; begin < len; ) { size_t i = begin; for (; i < len && isspace((unsigned char)str[i]); ++i) {} begin = i; for (; i < len && !isspace((unsigned char)str[i]); ++i) {} size_t word_len = i - begin; if (word_len == 0) break; char* word = xmalloc(word_len + 1); memcpy(word, str + begin, word_len); word[word_len] = 0; begin += word_len; if (capacity == size) { capacity *= 2; words = xrealloc(words, capacity * sizeof(char*)); } words[size++] = word; } *count = size; return words; } command_t* make_command_list(const char* table) { command_t* cmd = NULL; size_t count = 0; char** words = split_into_words(table, &count); for (size_t i = 0; i < count; ++i) { char* word = words[i]; command_t* new_cmd = xmalloc(sizeof(command_t)); size_t word_len = strlen(word); new_cmd->length = word_len; new_cmd->min_len = get_min_length(word, word_len); new_cmd->cmd = uppercase(word, word_len); new_cmd->next = cmd; cmd = new_cmd; } free(words); return cmd; } void free_command_list(command_t* cmd) { while (cmd != NULL) { command_t* next = cmd->next; free(cmd->cmd); free(cmd); cmd = next; } } const command_t* find_command(const command_t* commands, const char* word) { for (const command_t* cmd = commands; cmd != NULL; cmd = cmd->next) { if (command_match(cmd, word)) return cmd; } return NULL; } void test(const command_t* commands, const char* input) { printf(" input: %s\n", input); printf("output:"); size_t count = 0; char** words = split_into_words(input, &count); for (size_t i = 0; i < count; ++i) { char* word = words[i]; uppercase(word, strlen(word)); const command_t* cmd_ptr = find_command(commands, word); printf(" %s", cmd_ptr ? cmd_ptr->cmd : "*error*"); free(word); } free(words); printf("\n"); } int main() { command_t* commands = make_command_list(command_table); const char* input = "riG rePEAT copies put mo rest types fup. 6 poweRin"; test(commands, input); free_command_list(commands); return 0; }
Private Function ValidateUserWords(userstring As String) As String Dim s As String Dim user_words() As String Dim command_table As Scripting.Dictionary Set command_table = New Scripting.Dictionary Dim abbreviations As Scripting.Dictionary Set abbreviations = New Scripting.Dictionary abbreviations.CompareMode = TextCompare Dim commandtable() As String Dim commands As String s = s & "Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy " s = s & "COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find " s = s & "NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput " s = s & "Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO " s = s & "MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT " s = s & "READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT " s = s & "RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up " commandtable = Split(s, " ") Dim i As Integer For Each word In commandtable If Len(word) > 0 Then i = 1 Do While Mid(word, i, 1) >= "A" And Mid(word, i, 1) <= "Z" i = i + 1 Loop command_table.Add Key:=word, Item:=i - 1 End If Next word For Each word In command_table For i = command_table(word) To Len(word) On Error Resume Next abbreviations.Add Key:=Left(word, i), Item:=UCase(word) Next i Next word user_words() = Split(userstring, " ") For Each word In user_words If Len(word) > 0 Then If abbreviations.exists(word) Then commands = commands & abbreviations(word) & " " Else commands = commands & "*error* " End If End If Next word ValidateUserWords = commands End Function Public Sub program() Dim guserstring As String guserstring = "riG rePEAT copies put mo rest types fup. 6 poweRin" Debug.Print "user words:", guserstring Debug.Print "full words:", ValidateUserWords(guserstring) End Sub
Convert this C block to VB, preserving its control flow and logic.
#include <stdio.h> #include <string.h> #include <stdlib.h> char *codes[] = { "AAAAA", "AAAAB", "AAABA", "AAABB", "AABAA", "AABAB", "AABBA", "AABBB", "ABAAA", "ABAAB", "ABABA", "ABABB", "ABBAA", "ABBAB", "ABBBA", "ABBBB", "BAAAA", "BAAAB", "BAABA", "BAABB", "BABAA", "BABAB", "BABBA", "BABBB", "BBAAA", "BBAAB", "BBBAA" }; char *get_code(const char c) { if (c >= 97 && c <= 122) return codes[c - 97]; return codes[26]; } char get_char(const char *code) { int i; if (!strcmp(codes[26], code)) return ' '; for (i = 0; i < 26; ++i) { if (strcmp(codes[i], code) == 0) return 97 + i; } printf("\nCode \"%s\" is invalid\n", code); exit(1); } void str_tolower(char s[]) { int i; for (i = 0; i < strlen(s); ++i) s[i] = tolower(s[i]); } char *bacon_encode(char plain_text[], char message[]) { int i, count; int plen = strlen(plain_text), mlen = strlen(message); int elen = 5 * plen; char c; char *p, *et, *mt; et = malloc(elen + 1); str_tolower(plain_text); for (i = 0, p = et; i < plen; ++i, p += 5) { c = plain_text[i]; strncpy(p, get_code(c), 5); } *++p = '\0'; str_tolower(message); mt = calloc(mlen + 1, 1); for (i = 0, count = 0; i < mlen; ++i) { c = message[i]; if (c >= 'a' && c <= 'z') { if (et[count] == 'A') mt[i] = c; else mt[i] = c - 32; if (++count == elen) break; } else mt[i] = c; } free(et); return mt; } char *bacon_decode(char cipher_text[]) { int i, count, clen = strlen(cipher_text); int plen; char *p, *ct, *pt; char c, quintet[6]; ct = calloc(clen + 1, 1); for (i = 0, count = 0; i < clen; ++i) { c = cipher_text[i]; if (c >= 'a' && c <= 'z') ct[count++] = 'A'; else if (c >= 'A' && c <= 'Z') ct[count++] = 'B'; } plen = strlen(ct) / 5; pt = malloc(plen + 1); for (i = 0, p = ct; i < plen; ++i, p += 5) { strncpy(quintet, p, 5); quintet[5] = '\0'; pt[i] = get_char(quintet); } pt[plen] = '\0'; free(ct); return pt; } int main() { char plain_text[] = "the quick brown fox jumps over the lazy dog"; char message[] = "bacon's cipher is a method of steganography created by francis bacon." "this task is to implement a program for encryption and decryption of " "plaintext using the simple alphabet of the baconian cipher or some " "other kind of representation of this alphabet (make anything signify anything). " "the baconian alphabet may optionally be extended to encode all lower " "case characters individually and/or adding a few punctuation characters " "such as the space."; char *cipher_text, *hidden_text; cipher_text = bacon_encode(plain_text, message); printf("Cipher text ->\n\n%s\n", cipher_text); hidden_text = bacon_decode(cipher_text); printf("\nHidden text ->\n\n%s\n", hidden_text); free(cipher_text); free(hidden_text); return 0; }
Imports System.Text Module Module1 ReadOnly CODES As New Dictionary(Of Char, String) From { {"a", "AAAAA"}, {"b", "AAAAB"}, {"c", "AAABA"}, {"d", "AAABB"}, {"e", "AABAA"}, {"f", "AABAB"}, {"g", "AABBA"}, {"h", "AABBB"}, {"i", "ABAAA"}, {"j", "ABAAB"}, {"k", "ABABA"}, {"l", "ABABB"}, {"m", "ABBAA"}, {"n", "ABBAB"}, {"o", "ABBBA"}, {"p", "ABBBB"}, {"q", "BAAAA"}, {"r", "BAAAB"}, {"s", "BAABA"}, {"t", "BAABB"}, {"u", "BABAA"}, {"v", "BABAB"}, {"w", "BABBA"}, {"x", "BABBB"}, {"y", "BBAAA"}, {"z", "BBAAB"}, {" ", "BBBAA"} } Function Encode(plainText As String, message As String) As String Dim pt = plainText.ToLower() Dim sb As New StringBuilder() For Each c In pt If "a" <= c AndAlso c <= "z" Then sb.Append(CODES(c)) Else sb.Append(CODES(" ")) End If Next Dim et = sb.ToString() Dim mg = message.ToLower() sb.Length = 0 Dim count = 0 For Each c In mg If "a" <= c AndAlso c <= "z" Then If et(count) = "A" Then sb.Append(c) Else sb.Append(Chr(Asc(c) - 32)) End If count += 1 If count = et.Length Then Exit For End If Else sb.Append(c) End If Next Return sb.ToString() End Function Function Decode(message As String) As String Dim sb As New StringBuilder For Each c In message If "a" <= c AndAlso c <= "z" Then sb.Append("A") ElseIf "A" <= c AndAlso c <= "Z" Then sb.Append("B") End If Next Dim et = sb.ToString() sb.Length = 0 For index = 0 To et.Length - 1 Step 5 Dim quintet = et.Substring(index, 5) Dim key = CODES.Where(Function(a) a.Value = quintet).First().Key sb.Append(key) Next Return sb.ToString() End Function Sub Main() Dim plainText = "the quick brown fox jumps over the lazy dog" Dim message = "bacon "this task is to implement a program for encryption and decryption of " + "plaintext using the simple alphabet of the baconian cipher or some " + "other kind of representation of this alphabet (make anything signify anything). " + "the baconian alphabet may optionally be extended to encode all lower " + "case characters individually and/or adding a few punctuation characters " + "such as the space." Dim cipherText = Encode(plainText, message) Console.WriteLine("Cipher text ->" & Environment.NewLine & "{0}", cipherText) Dim decodedText = Decode(cipherText) Console.WriteLine(Environment.NewLine & "Hidden text ->" & Environment.NewLine & "{0}", decodedText) End Sub End Module
Port the provided C code into VB while preserving the original functionality.
#include <stdio.h> #include <string.h> #include <stdlib.h> char *codes[] = { "AAAAA", "AAAAB", "AAABA", "AAABB", "AABAA", "AABAB", "AABBA", "AABBB", "ABAAA", "ABAAB", "ABABA", "ABABB", "ABBAA", "ABBAB", "ABBBA", "ABBBB", "BAAAA", "BAAAB", "BAABA", "BAABB", "BABAA", "BABAB", "BABBA", "BABBB", "BBAAA", "BBAAB", "BBBAA" }; char *get_code(const char c) { if (c >= 97 && c <= 122) return codes[c - 97]; return codes[26]; } char get_char(const char *code) { int i; if (!strcmp(codes[26], code)) return ' '; for (i = 0; i < 26; ++i) { if (strcmp(codes[i], code) == 0) return 97 + i; } printf("\nCode \"%s\" is invalid\n", code); exit(1); } void str_tolower(char s[]) { int i; for (i = 0; i < strlen(s); ++i) s[i] = tolower(s[i]); } char *bacon_encode(char plain_text[], char message[]) { int i, count; int plen = strlen(plain_text), mlen = strlen(message); int elen = 5 * plen; char c; char *p, *et, *mt; et = malloc(elen + 1); str_tolower(plain_text); for (i = 0, p = et; i < plen; ++i, p += 5) { c = plain_text[i]; strncpy(p, get_code(c), 5); } *++p = '\0'; str_tolower(message); mt = calloc(mlen + 1, 1); for (i = 0, count = 0; i < mlen; ++i) { c = message[i]; if (c >= 'a' && c <= 'z') { if (et[count] == 'A') mt[i] = c; else mt[i] = c - 32; if (++count == elen) break; } else mt[i] = c; } free(et); return mt; } char *bacon_decode(char cipher_text[]) { int i, count, clen = strlen(cipher_text); int plen; char *p, *ct, *pt; char c, quintet[6]; ct = calloc(clen + 1, 1); for (i = 0, count = 0; i < clen; ++i) { c = cipher_text[i]; if (c >= 'a' && c <= 'z') ct[count++] = 'A'; else if (c >= 'A' && c <= 'Z') ct[count++] = 'B'; } plen = strlen(ct) / 5; pt = malloc(plen + 1); for (i = 0, p = ct; i < plen; ++i, p += 5) { strncpy(quintet, p, 5); quintet[5] = '\0'; pt[i] = get_char(quintet); } pt[plen] = '\0'; free(ct); return pt; } int main() { char plain_text[] = "the quick brown fox jumps over the lazy dog"; char message[] = "bacon's cipher is a method of steganography created by francis bacon." "this task is to implement a program for encryption and decryption of " "plaintext using the simple alphabet of the baconian cipher or some " "other kind of representation of this alphabet (make anything signify anything). " "the baconian alphabet may optionally be extended to encode all lower " "case characters individually and/or adding a few punctuation characters " "such as the space."; char *cipher_text, *hidden_text; cipher_text = bacon_encode(plain_text, message); printf("Cipher text ->\n\n%s\n", cipher_text); hidden_text = bacon_decode(cipher_text); printf("\nHidden text ->\n\n%s\n", hidden_text); free(cipher_text); free(hidden_text); return 0; }
Imports System.Text Module Module1 ReadOnly CODES As New Dictionary(Of Char, String) From { {"a", "AAAAA"}, {"b", "AAAAB"}, {"c", "AAABA"}, {"d", "AAABB"}, {"e", "AABAA"}, {"f", "AABAB"}, {"g", "AABBA"}, {"h", "AABBB"}, {"i", "ABAAA"}, {"j", "ABAAB"}, {"k", "ABABA"}, {"l", "ABABB"}, {"m", "ABBAA"}, {"n", "ABBAB"}, {"o", "ABBBA"}, {"p", "ABBBB"}, {"q", "BAAAA"}, {"r", "BAAAB"}, {"s", "BAABA"}, {"t", "BAABB"}, {"u", "BABAA"}, {"v", "BABAB"}, {"w", "BABBA"}, {"x", "BABBB"}, {"y", "BBAAA"}, {"z", "BBAAB"}, {" ", "BBBAA"} } Function Encode(plainText As String, message As String) As String Dim pt = plainText.ToLower() Dim sb As New StringBuilder() For Each c In pt If "a" <= c AndAlso c <= "z" Then sb.Append(CODES(c)) Else sb.Append(CODES(" ")) End If Next Dim et = sb.ToString() Dim mg = message.ToLower() sb.Length = 0 Dim count = 0 For Each c In mg If "a" <= c AndAlso c <= "z" Then If et(count) = "A" Then sb.Append(c) Else sb.Append(Chr(Asc(c) - 32)) End If count += 1 If count = et.Length Then Exit For End If Else sb.Append(c) End If Next Return sb.ToString() End Function Function Decode(message As String) As String Dim sb As New StringBuilder For Each c In message If "a" <= c AndAlso c <= "z" Then sb.Append("A") ElseIf "A" <= c AndAlso c <= "Z" Then sb.Append("B") End If Next Dim et = sb.ToString() sb.Length = 0 For index = 0 To et.Length - 1 Step 5 Dim quintet = et.Substring(index, 5) Dim key = CODES.Where(Function(a) a.Value = quintet).First().Key sb.Append(key) Next Return sb.ToString() End Function Sub Main() Dim plainText = "the quick brown fox jumps over the lazy dog" Dim message = "bacon "this task is to implement a program for encryption and decryption of " + "plaintext using the simple alphabet of the baconian cipher or some " + "other kind of representation of this alphabet (make anything signify anything). " + "the baconian alphabet may optionally be extended to encode all lower " + "case characters individually and/or adding a few punctuation characters " + "such as the space." Dim cipherText = Encode(plainText, message) Console.WriteLine("Cipher text ->" & Environment.NewLine & "{0}", cipherText) Dim decodedText = Decode(cipherText) Console.WriteLine(Environment.NewLine & "Hidden text ->" & Environment.NewLine & "{0}", decodedText) End Sub End Module
Keep all operations the same but rewrite the snippet in VB.
#include <stdio.h> #include <stdlib.h> #define valid(i, j) 0 <= i && i < m && 0 <= j && j < n && !s[i][j] int main(int c, char **v) { int i, j, m = 0, n = 0; if (c >= 2) m = atoi(v[1]); if (c >= 3) n = atoi(v[2]); if (m <= 0) m = 5; if (n <= 0) n = m; int **s = calloc(1, sizeof(int *) * m + sizeof(int) * m * n); s[0] = (int*)(s + m); for (i = 1; i < m; i++) s[i] = s[i - 1] + n; int dx = 1, dy = 0, val = 0, t; for (i = j = 0; valid(i, j); i += dy, j += dx ) { for (; valid(i, j); j += dx, i += dy) s[i][j] = ++val; j -= dx; i -= dy; t = dy; dy = dx; dx = -t; } for (t = 2; val /= 10; t++); for(i = 0; i < m; i++) for(j = 0; j < n || !putchar('\n'); j++) printf("%*d", t, s[i][j]); return 0; }
Function build_spiral(n) botcol = 0 : topcol = n - 1 botrow = 0 : toprow = n - 1 Dim matrix() ReDim matrix(topcol,toprow) dir = 0 : col = 0 : row = 0 For i = 0 To n*n-1 matrix(col,row) = i Select Case dir Case 0 If col < topcol Then col = col + 1 Else dir = 1 : row = row + 1 : botrow = botrow + 1 End If Case 1 If row < toprow Then row = row + 1 Else dir = 2 : col = col - 1 : topcol = topcol - 1 End If Case 2 If col > botcol Then col = col - 1 Else dir = 3 : row = row - 1 : toprow = toprow - 1 End If Case 3 If row > botrow Then row = row - 1 Else dir = 0 : col = col + 1 : botcol = botcol + 1 End If End Select Next For y = 0 To n-1 For x = 0 To n-1 WScript.StdOut.Write matrix(x,y) & vbTab Next WScript.StdOut.WriteLine Next End Function build_spiral(CInt(WScript.Arguments(0)))
Translate this program into VB but keep the logic exactly as in C.
#include <stdio.h> #include <stdlib.h> #define valid(i, j) 0 <= i && i < m && 0 <= j && j < n && !s[i][j] int main(int c, char **v) { int i, j, m = 0, n = 0; if (c >= 2) m = atoi(v[1]); if (c >= 3) n = atoi(v[2]); if (m <= 0) m = 5; if (n <= 0) n = m; int **s = calloc(1, sizeof(int *) * m + sizeof(int) * m * n); s[0] = (int*)(s + m); for (i = 1; i < m; i++) s[i] = s[i - 1] + n; int dx = 1, dy = 0, val = 0, t; for (i = j = 0; valid(i, j); i += dy, j += dx ) { for (; valid(i, j); j += dx, i += dy) s[i][j] = ++val; j -= dx; i -= dy; t = dy; dy = dx; dx = -t; } for (t = 2; val /= 10; t++); for(i = 0; i < m; i++) for(j = 0; j < n || !putchar('\n'); j++) printf("%*d", t, s[i][j]); return 0; }
Function build_spiral(n) botcol = 0 : topcol = n - 1 botrow = 0 : toprow = n - 1 Dim matrix() ReDim matrix(topcol,toprow) dir = 0 : col = 0 : row = 0 For i = 0 To n*n-1 matrix(col,row) = i Select Case dir Case 0 If col < topcol Then col = col + 1 Else dir = 1 : row = row + 1 : botrow = botrow + 1 End If Case 1 If row < toprow Then row = row + 1 Else dir = 2 : col = col - 1 : topcol = topcol - 1 End If Case 2 If col > botcol Then col = col - 1 Else dir = 3 : row = row - 1 : toprow = toprow - 1 End If Case 3 If row > botrow Then row = row - 1 Else dir = 0 : col = col + 1 : botcol = botcol + 1 End If End Select Next For y = 0 To n-1 For x = 0 To n-1 WScript.StdOut.Write matrix(x,y) & vbTab Next WScript.StdOut.WriteLine Next End Function build_spiral(CInt(WScript.Arguments(0)))
Please provide an equivalent version of this C code in VB.
#include <stdlib.h> #include <stdarg.h> #include <stdio.h> #include <ctype.h> #include <string.h> typedef const char * String; typedef struct sTable { String * *rows; int n_rows,n_cols; } *Table; typedef int (*CompareFctn)(String a, String b); struct { CompareFctn compare; int column; int reversed; } sortSpec; int CmprRows( const void *aa, const void *bb) { String *rA = *(String *const *)aa; String *rB = *(String *const *)bb; int sortCol = sortSpec.column; String left = sortSpec.reversed ? rB[sortCol] : rA[sortCol]; String right = sortSpec.reversed ? rA[sortCol] : rB[sortCol]; return sortSpec.compare( left, right ); } int sortTable(Table tbl, const char* argSpec,... ) { va_list vl; const char *p; int c; sortSpec.compare = &strcmp; sortSpec.column = 0; sortSpec.reversed = 0; va_start(vl, argSpec); if (argSpec) for (p=argSpec; *p; p++) { switch (*p) { case 'o': sortSpec.compare = va_arg(vl,CompareFctn); break; case 'c': c = va_arg(vl,int); if ( 0<=c && c<tbl->n_cols) sortSpec.column = c; break; case 'r': sortSpec.reversed = (0!=va_arg(vl,int)); break; } } va_end(vl); qsort( tbl->rows, tbl->n_rows, sizeof(String *), CmprRows); return 0; } void printTable( Table tbl, FILE *fout, const char *colFmts[]) { int row, col; for (row=0; row<tbl->n_rows; row++) { fprintf(fout, " "); for(col=0; col<tbl->n_cols; col++) { fprintf(fout, colFmts[col], tbl->rows[row][col]); } fprintf(fout, "\n"); } fprintf(fout, "\n"); } int ord(char v) { return v-'0'; } int cmprStrgs(String s1, String s2) { const char *p1 = s1; const char *p2 = s2; const char *mrk1, *mrk2; while ((tolower(*p1) == tolower(*p2)) && *p1) { p1++; p2++; } if (isdigit(*p1) && isdigit(*p2)) { long v1, v2; if ((*p1 == '0') ||(*p2 == '0')) { while (p1 > s1) { p1--; p2--; if (*p1 != '0') break; } if (!isdigit(*p1)) { p1++; p2++; } } mrk1 = p1; mrk2 = p2; v1 = 0; while(isdigit(*p1)) { v1 = 10*v1+ord(*p1); p1++; } v2 = 0; while(isdigit(*p2)) { v2 = 10*v2+ord(*p2); p2++; } if (v1 == v2) return(p2-mrk2)-(p1-mrk1); return v1 - v2; } if (tolower(*p1) != tolower(*p2)) return (tolower(*p1) - tolower(*p2)); for(p1=s1, p2=s2; (*p1 == *p2) && *p1; p1++, p2++); return (*p1 -*p2); } int main() { const char *colFmts[] = {" %-5.5s"," %-5.5s"," %-9.9s"}; String r1[] = { "a101", "red", "Java" }; String r2[] = { "ab40", "gren", "Smalltalk" }; String r3[] = { "ab9", "blue", "Fortran" }; String r4[] = { "ab09", "ylow", "Python" }; String r5[] = { "ab1a", "blak", "Factor" }; String r6[] = { "ab1b", "brwn", "C Sharp" }; String r7[] = { "Ab1b", "pink", "Ruby" }; String r8[] = { "ab1", "orng", "Scheme" }; String *rows[] = { r1, r2, r3, r4, r5, r6, r7, r8 }; struct sTable table; table.rows = rows; table.n_rows = 8; table.n_cols = 3; sortTable(&table, ""); printf("sort on col 0, ascending\n"); printTable(&table, stdout, colFmts); sortTable(&table, "ro", 1, &cmprStrgs); printf("sort on col 0, reverse.special\n"); printTable(&table, stdout, colFmts); sortTable(&table, "c", 1); printf("sort on col 1, ascending\n"); printTable(&table, stdout, colFmts); sortTable(&table, "cr", 2, 1); printf("sort on col 2, reverse\n"); printTable(&table, stdout, colFmts); return 0; }
Private Sub optional_parameters(theRange As String, _ Optional ordering As Integer = 0, _ Optional column As Integer = 1, _ Optional reverse As Integer = 1) ActiveSheet.Sort.SortFields.Clear ActiveSheet.Sort.SortFields.Add _ Key:=Range(theRange).Columns(column), _ SortOn:=SortOnValues, _ Order:=reverse, _ DataOption:=ordering With ActiveSheet.Sort .SetRange Range(theRange) .Header = xlGuess .MatchCase = False .Orientation = xlTopToBottom .SortMethod = xlPinYin .Apply End With End Sub Public Sub main() optional_parameters theRange:="A1:C4", ordering:=1, column:=2, reverse:=1 End Sub
Write the same code in VB as shown below in C.
#include <stdio.h> void sayHello(char* name){ printf("Hello %s!\n", name); } int doubleNum(int num){ return num * 2; }
Declare Function CreateFileW Lib "Kernel32" (FileName As WString, DesiredAccess As Integer, ShareMode As Integer, SecurityAttributes As Integer, _ CreateDisposition As Integer, Flags As Integer, Template As Integer) As Integer Declare Function WriteFile Lib "Kernel32" (fHandle As Integer, writeData As Ptr, numOfBytes As Integer, ByRef numOfBytesWritten As Integer, _ overlapped As Ptr) As Boolean Declare Function GetLastError Lib "Kernel32" () As Integer Declare Function CloseHandle Lib "kernel32" (hObject As Integer) As Boolean Const FILE_SHARE_READ = &h00000001 Const FILE_SHARE_WRITE = &h00000002 Const OPEN_EXISTING = 3 Dim fHandle As Integer = CreateFileW("C:\foo.txt", 0, FILE_SHARE_READ Or FILE_SHARE_WRITE, 0, OPEN_EXISTING, 0, 0) If fHandle > 0 Then Dim mb As MemoryBlock = "Hello, World!" Dim bytesWritten As Integer If Not WriteFile(fHandle, mb, mb.Size, bytesWritten, Nil) Then MsgBox("Error Number: " + Str(GetLastError)) End If Call CloseHandle(fHandle) Else MsgBox("Error Number: " + Str(GetLastError)) End If
Port the provided C code into VB while preserving the original functionality.
#include <stdbool.h> #include <stdio.h> #include <stdlib.h> #include <string.h> int binomial(int n, int k) { int num, denom, i; if (n < 0 || k < 0 || n < k) return -1; if (n == 0 || k == 0) return 1; num = 1; for (i = k + 1; i <= n; ++i) { num = num * i; } denom = 1; for (i = 2; i <= n - k; ++i) { denom *= i; } return num / denom; } int gcd(int a, int b) { int temp; while (b != 0) { temp = a % b; a = b; b = temp; } return a; } typedef struct tFrac { int num, denom; } Frac; Frac makeFrac(int n, int d) { Frac result; int g; if (d == 0) { result.num = 0; result.denom = 0; return result; } if (n == 0) { d = 1; } else if (d < 0) { n = -n; d = -d; } g = abs(gcd(n, d)); if (g > 1) { n = n / g; d = d / g; } result.num = n; result.denom = d; return result; } Frac negateFrac(Frac f) { return makeFrac(-f.num, f.denom); } Frac subFrac(Frac lhs, Frac rhs) { return makeFrac(lhs.num * rhs.denom - lhs.denom * rhs.num, rhs.denom * lhs.denom); } Frac multFrac(Frac lhs, Frac rhs) { return makeFrac(lhs.num * rhs.num, lhs.denom * rhs.denom); } bool equalFrac(Frac lhs, Frac rhs) { return (lhs.num == rhs.num) && (lhs.denom == rhs.denom); } bool lessFrac(Frac lhs, Frac rhs) { return (lhs.num * rhs.denom) < (rhs.num * lhs.denom); } void printFrac(Frac f) { char buffer[7]; int len; if (f.denom != 1) { snprintf(buffer, 7, "%d/%d", f.num, f.denom); } else { snprintf(buffer, 7, "%d", f.num); } len = 7 - strlen(buffer); while (len-- > 0) { putc(' ', stdout); } printf(buffer); } Frac bernoulli(int n) { Frac a[16]; int j, m; if (n < 0) { a[0].num = 0; a[0].denom = 0; return a[0]; } for (m = 0; m <= n; ++m) { a[m] = makeFrac(1, m + 1); for (j = m; j >= 1; --j) { a[j - 1] = multFrac(subFrac(a[j - 1], a[j]), makeFrac(j, 1)); } } if (n != 1) { return a[0]; } return negateFrac(a[0]); } void faulhaber(int p) { Frac q, *coeffs; int j, sign; coeffs = malloc(sizeof(Frac)*(p + 1)); q = makeFrac(1, p + 1); sign = -1; for (j = 0; j <= p; ++j) { sign = -1 * sign; coeffs[p - j] = multFrac(multFrac(multFrac(q, makeFrac(sign, 1)), makeFrac(binomial(p + 1, j), 1)), bernoulli(j)); } for (j = 0; j <= p; ++j) { printFrac(coeffs[j]); } printf("\n"); free(coeffs); } int main() { int i; for (i = 0; i < 10; ++i) { faulhaber(i); } return 0; }
Module Module1 Class Frac Private ReadOnly num As Long Private ReadOnly denom As Long Public Shared ReadOnly ZERO = New Frac(0, 1) Public Shared ReadOnly ONE = New Frac(1, 1) Public Sub New(n As Long, d As Long) If d = 0 Then Throw New ArgumentException("d must not be zero") End If Dim nn = n Dim dd = d If nn = 0 Then dd = 1 ElseIf dd < 0 Then nn = -nn dd = -dd End If Dim g = Math.Abs(Gcd(nn, dd)) If g > 1 Then nn /= g dd /= g End If num = nn denom = dd End Sub Private Shared Function Gcd(a As Long, b As Long) As Long If b = 0 Then Return a Else Return Gcd(b, a Mod b) End If End Function Public Shared Operator -(self As Frac) As Frac Return New Frac(-self.num, self.denom) End Operator Public Shared Operator +(lhs As Frac, rhs As Frac) As Frac Return New Frac(lhs.num * rhs.denom + lhs.denom * rhs.num, rhs.denom * lhs.denom) End Operator Public Shared Operator -(lhs As Frac, rhs As Frac) As Frac Return lhs + -rhs End Operator Public Shared Operator *(lhs As Frac, rhs As Frac) As Frac Return New Frac(lhs.num * rhs.num, lhs.denom * rhs.denom) End Operator Public Shared Operator <(lhs As Frac, rhs As Frac) As Boolean Dim x = lhs.num / lhs.denom Dim y = rhs.num / rhs.denom Return x < y End Operator Public Shared Operator >(lhs As Frac, rhs As Frac) As Boolean Dim x = lhs.num / lhs.denom Dim y = rhs.num / rhs.denom Return x > y End Operator Public Shared Operator =(lhs As Frac, rhs As Frac) As Boolean Return lhs.num = rhs.num AndAlso lhs.denom = rhs.denom End Operator Public Shared Operator <>(lhs As Frac, rhs As Frac) As Boolean Return lhs.num <> rhs.num OrElse lhs.denom <> rhs.denom End Operator Public Overrides Function ToString() As String If denom = 1 Then Return num.ToString Else Return String.Format("{0}/{1}", num, denom) End If End Function Public Overrides Function Equals(obj As Object) As Boolean Dim frac = CType(obj, Frac) Return Not IsNothing(frac) AndAlso num = frac.num AndAlso denom = frac.denom End Function End Class Function Bernoulli(n As Integer) As Frac If n < 0 Then Throw New ArgumentException("n may not be negative or zero") End If Dim a(n + 1) As Frac For m = 0 To n a(m) = New Frac(1, m + 1) For j = m To 1 Step -1 a(j - 1) = (a(j - 1) - a(j)) * New Frac(j, 1) Next Next If n <> 1 Then Return a(0) Else Return -a(0) End If End Function Function Binomial(n As Integer, k As Integer) As Integer If n < 0 OrElse k < 0 OrElse n < k Then Throw New ArgumentException() End If If n = 0 OrElse k = 0 Then Return 1 End If Dim num = 1 For i = k + 1 To n num *= i Next Dim denom = 1 For i = 2 To n - k denom *= i Next Return num \ denom End Function Function FaulhaberTriangle(p As Integer) As Frac() Dim coeffs(p + 1) As Frac For i = 1 To p + 1 coeffs(i - 1) = Frac.ZERO Next Dim q As New Frac(1, p + 1) Dim sign = -1 For j = 0 To p sign *= -1 coeffs(p - j) = q * New Frac(sign, 1) * New Frac(Binomial(p + 1, j), 1) * Bernoulli(j) Next Return coeffs End Function Sub Main() For i = 1 To 10 Dim coeffs = FaulhaberTriangle(i - 1) For Each coeff In coeffs Console.Write("{0,5} ", coeff) Next Console.WriteLine() Next End Sub End Module
Rewrite this program in VB while keeping its functionality equivalent to the C version.
#include <stdlib.h> #include <stdio.h> int main(int argc, char* argv[]) { int i; (void) printf("This program is named %s.\n", argv[0]); for (i = 1; i < argc; ++i) (void) printf("the argument #%d is %s\n", i, argv[i]); return EXIT_SUCCESS; }
Function Run(args() as String) As Integer For each arg As String In args Stdout.WriteLine(arg) Next End Function