Instruction
stringlengths
45
106
input_code
stringlengths
1
13.7k
output_code
stringlengths
1
13.7k
Change the programming language of this snippet from C to Python without modifying what it does.
#include <stdio.h> #include <string.h> int match(const char *s, const char *p, int overlap) { int c = 0, l = strlen(p); while (*s != '\0') { if (strncmp(s++, p, l)) continue; if (!overlap) s += l - 1; c++; } return c; } int main() { printf("%d\n", match("the three truths", "th", 0)); printf("overlap:%d\n", match("abababababa", "aba", 1)); printf("not: %d\n", match("abababababa", "aba", 0)); return 0; }
>>> "the three truths".count("th") 3 >>> "ababababab".count("abab") 2
Ensure the translated Python code behaves exactly like the original C snippet.
#include <stdbool.h> #include <stdio.h> bool primeDigitsSum13(int n) { int sum = 0; while (n > 0) { int r = n % 10; switch (r) { case 2: case 3: case 5: case 7: break; default: return false; } n /= 10; sum += r; } return sum == 13; } int main() { int i, c; c = 0; for (i = 1; i < 1000000; i++) { if (primeDigitsSum13(i)) { printf("%6d ", i); if (c++ == 10) { c = 0; printf("\n"); } } } printf("\n"); return 0; }
from collections import deque def prime_digits_sum(r): q = deque([(r, 0)]) while q: r, n = q.popleft() for d in 2, 3, 5, 7: if d >= r: if d == r: yield n + d break q.append((r - d, (n + d) * 10)) print(*prime_digits_sum(13))
Produce a language-to-language conversion: from C to Python, same semantics.
#include <stdbool.h> #include <stdio.h> bool primeDigitsSum13(int n) { int sum = 0; while (n > 0) { int r = n % 10; switch (r) { case 2: case 3: case 5: case 7: break; default: return false; } n /= 10; sum += r; } return sum == 13; } int main() { int i, c; c = 0; for (i = 1; i < 1000000; i++) { if (primeDigitsSum13(i)) { printf("%6d ", i); if (c++ == 10) { c = 0; printf("\n"); } } } printf("\n"); return 0; }
from collections import deque def prime_digits_sum(r): q = deque([(r, 0)]) while q: r, n = q.popleft() for d in 2, 3, 5, 7: if d >= r: if d == r: yield n + d break q.append((r - d, (n + d) * 10)) print(*prime_digits_sum(13))
Change the programming language of this snippet from C to Python without modifying what it does.
#include <stdbool.h> #include <stdio.h> bool primeDigitsSum13(int n) { int sum = 0; while (n > 0) { int r = n % 10; switch (r) { case 2: case 3: case 5: case 7: break; default: return false; } n /= 10; sum += r; } return sum == 13; } int main() { int i, c; c = 0; for (i = 1; i < 1000000; i++) { if (primeDigitsSum13(i)) { printf("%6d ", i); if (c++ == 10) { c = 0; printf("\n"); } } } printf("\n"); return 0; }
from collections import deque def prime_digits_sum(r): q = deque([(r, 0)]) while q: r, n = q.popleft() for d in 2, 3, 5, 7: if d >= r: if d == r: yield n + d break q.append((r - d, (n + d) * 10)) print(*prime_digits_sum(13))
Generate an equivalent Python version of this C code.
if (strcmp(a,b)) action_on_equality();
fun compare(a, b): print("\n$a is of type ${typeof(a)} and $b is of type ${typeof(b)}") if a < b: print("$a is strictly less than $b") if a <= b: print("$a is less than or equal to $b") if a > b: print("$a is strictly greater than $b") if a >= b: print("$a is greater than or equal to $b") if a == b: print("$a is equal to $b") if a != b: print("$a is not equal to $b") if a is b: print("$a has object identity with $b") if a is not b: print("$a has negated object identity with $b") compare("YUP", "YUP") compare('a', 'z') compare("24", "123") compare(24, 123) compare(5.0, 5)
Translate the given C code snippet into Python without altering its behavior.
#include <stdio.h> #include <time.h> #define note_file "NOTES.TXT" int main(int argc, char**argv) { FILE *note = 0; time_t tm; int i; char *p; if (argc < 2) { if ((note = fopen(note_file, "r"))) while ((i = fgetc(note)) != EOF) putchar(i); } else if ((note = fopen(note_file, "a"))) { tm = time(0); p = ctime(&tm); while (*p) fputc(*p != '\n'?*p:'\t', note), p++; for (i = 1; i < argc; i++) fprintf(note, "%s%c", argv[i], 1 + i - argc ? ' ' : '\n'); } if (note) fclose(note); return 0; }
import sys, datetime, shutil if len(sys.argv) == 1: try: with open('notes.txt', 'r') as f: shutil.copyfileobj(f, sys.stdout) except IOError: pass else: with open('notes.txt', 'a') as f: f.write(datetime.datetime.now().isoformat() + '\n') f.write("\t%s\n" % ' '.join(sys.argv[1:]))
Maintain the same structure and functionality when rewriting this code in Python.
#include <stdio.h> #include <time.h> #define note_file "NOTES.TXT" int main(int argc, char**argv) { FILE *note = 0; time_t tm; int i; char *p; if (argc < 2) { if ((note = fopen(note_file, "r"))) while ((i = fgetc(note)) != EOF) putchar(i); } else if ((note = fopen(note_file, "a"))) { tm = time(0); p = ctime(&tm); while (*p) fputc(*p != '\n'?*p:'\t', note), p++; for (i = 1; i < argc; i++) fprintf(note, "%s%c", argv[i], 1 + i - argc ? ' ' : '\n'); } if (note) fclose(note); return 0; }
import sys, datetime, shutil if len(sys.argv) == 1: try: with open('notes.txt', 'r') as f: shutil.copyfileobj(f, sys.stdout) except IOError: pass else: with open('notes.txt', 'a') as f: f.write(datetime.datetime.now().isoformat() + '\n') f.write("\t%s\n" % ' '.join(sys.argv[1:]))
Maintain the same structure and functionality when rewriting this code in Python.
#include <stdio.h> #include <string.h> #include <math.h> #define N 32 #define N2 (N * (N - 1) / 2) #define STEP .05 double xval[N], t_sin[N], t_cos[N], t_tan[N]; double r_sin[N2], r_cos[N2], r_tan[N2]; double rho(double *x, double *y, double *r, int i, int n) { if (n < 0) return 0; if (!n) return y[i]; int idx = (N - 1 - n) * (N - n) / 2 + i; if (r[idx] != r[idx]) r[idx] = (x[i] - x[i + n]) / (rho(x, y, r, i, n - 1) - rho(x, y, r, i + 1, n - 1)) + rho(x, y, r, i + 1, n - 2); return r[idx]; } double thiele(double *x, double *y, double *r, double xin, int n) { if (n > N - 1) return 1; return rho(x, y, r, 0, n) - rho(x, y, r, 0, n - 2) + (xin - x[n]) / thiele(x, y, r, xin, n + 1); } #define i_sin(x) thiele(t_sin, xval, r_sin, x, 0) #define i_cos(x) thiele(t_cos, xval, r_cos, x, 0) #define i_tan(x) thiele(t_tan, xval, r_tan, x, 0) int main() { int i; for (i = 0; i < N; i++) { xval[i] = i * STEP; t_sin[i] = sin(xval[i]); t_cos[i] = cos(xval[i]); t_tan[i] = t_sin[i] / t_cos[i]; } for (i = 0; i < N2; i++) r_sin[i] = r_cos[i] = r_tan[i] = 0/0.; printf("%16.14f\n", 6 * i_sin(.5)); printf("%16.14f\n", 3 * i_cos(.5)); printf("%16.14f\n", 4 * i_tan(1.)); return 0; }
import math def thieleInterpolator(x, y): ρ = [[yi]*(len(y)-i) for i, yi in enumerate(y)] for i in range(len(ρ)-1): ρ[i][1] = (x[i] - x[i+1]) / (ρ[i][0] - ρ[i+1][0]) for i in range(2, len(ρ)): for j in range(len(ρ)-i): ρ[j][i] = (x[j]-x[j+i]) / (ρ[j][i-1]-ρ[j+1][i-1]) + ρ[j+1][i-2] ρ0 = ρ[0] def t(xin): a = 0 for i in range(len(ρ0)-1, 1, -1): a = (xin - x[i-1]) / (ρ0[i] - ρ0[i-2] + a) return y[0] + (xin-x[0]) / (ρ0[1]+a) return t xVal = [i*.05 for i in range(32)] tSin = [math.sin(x) for x in xVal] tCos = [math.cos(x) for x in xVal] tTan = [math.tan(x) for x in xVal] iSin = thieleInterpolator(tSin, xVal) iCos = thieleInterpolator(tCos, xVal) iTan = thieleInterpolator(tTan, xVal) print('{:16.14f}'.format(6*iSin(.5))) print('{:16.14f}'.format(3*iCos(.5))) print('{:16.14f}'.format(4*iTan(1)))
Rewrite this program in Python while keeping its functionality equivalent to the C version.
#include <stdio.h> #include <stdlib.h> #include <string.h> #include <math.h> void print_headings() { printf("%2s", "N"); printf(" %10s", "Length"); printf(" %-20s", "Entropy"); printf(" %-40s", "Word"); printf("\n"); } double calculate_entropy(int ones, int zeros) { double result = 0; int total = ones + zeros; result -= (double) ones / total * log2((double) ones / total); result -= (double) zeros / total * log2((double) zeros / total); if (result != result) { result = 0; } return result; } void print_entropy(char *word) { int ones = 0; int zeros = 0; int i; for (i = 0; word[i]; i++) { char c = word[i]; switch (c) { case '0': zeros++; break; case '1': ones++; break; } } double entropy = calculate_entropy(ones, zeros); printf(" %-20.18f", entropy); } void print_word(int n, char *word) { printf("%2d", n); printf(" %10ld", strlen(word)); print_entropy(word); if (n < 10) { printf(" %-40s", word); } else { printf(" %-40s", "..."); } printf("\n"); } int main(int argc, char *argv[]) { print_headings(); char *last_word = malloc(2); strcpy(last_word, "1"); char *current_word = malloc(2); strcpy(current_word, "0"); print_word(1, last_word); int i; for (i = 2; i <= 37; i++) { print_word(i, current_word); char *next_word = malloc(strlen(current_word) + strlen(last_word) + 1); strcpy(next_word, current_word); strcat(next_word, last_word); free(last_word); last_word = current_word; current_word = next_word; } free(last_word); free(current_word); return 0; }
>>> import math >>> from collections import Counter >>> >>> def entropy(s): ... p, lns = Counter(s), float(len(s)) ... return -sum( count/lns * math.log(count/lns, 2) for count in p.values()) ... >>> >>> def fibword(nmax=37): ... fwords = ['1', '0'] ... print('%-3s %10s %-10s %s' % tuple('N Length Entropy Fibword'.split())) ... def pr(n, fwords): ... while len(fwords) < n: ... fwords += [''.join(fwords[-2:][::-1])] ... v = fwords[n-1] ... print('%3i %10i %10.7g %s' % (n, len(v), entropy(v), v if len(v) < 20 else '<too long>')) ... for n in range(1, nmax+1): pr(n, fwords) ... >>> fibword() N Length Entropy Fibword 1 1 -0 1 2 1 -0 0 3 2 1 01 4 3 0.9182958 010 5 5 0.9709506 01001 6 8 0.954434 01001010 7 13 0.9612366 0100101001001 8 21 0.9587119 <too long> 9 34 0.9596869 <too long> 10 55 0.959316 <too long> 11 89 0.9594579 <too long> 12 144 0.9594038 <too long> 13 233 0.9594244 <too long> 14 377 0.9594165 <too long> 15 610 0.9594196 <too long> 16 987 0.9594184 <too long> 17 1597 0.9594188 <too long> 18 2584 0.9594187 <too long> 19 4181 0.9594187 <too long> 20 6765 0.9594187 <too long> 21 10946 0.9594187 <too long> 22 17711 0.9594187 <too long> 23 28657 0.9594187 <too long> 24 46368 0.9594187 <too long> 25 75025 0.9594187 <too long> 26 121393 0.9594187 <too long> 27 196418 0.9594187 <too long> 28 317811 0.9594187 <too long> 29 514229 0.9594187 <too long> 30 832040 0.9594187 <too long> 31 1346269 0.9594187 <too long> 32 2178309 0.9594187 <too long> 33 3524578 0.9594187 <too long> 34 5702887 0.9594187 <too long> 35 9227465 0.9594187 <too long> 36 14930352 0.9594187 <too long> 37 24157817 0.9594187 <too long> >>>
Rewrite this program in Python while keeping its functionality equivalent to the C version.
#include <stdio.h> #include <stdlib.h> #include <string.h> #include <math.h> void print_headings() { printf("%2s", "N"); printf(" %10s", "Length"); printf(" %-20s", "Entropy"); printf(" %-40s", "Word"); printf("\n"); } double calculate_entropy(int ones, int zeros) { double result = 0; int total = ones + zeros; result -= (double) ones / total * log2((double) ones / total); result -= (double) zeros / total * log2((double) zeros / total); if (result != result) { result = 0; } return result; } void print_entropy(char *word) { int ones = 0; int zeros = 0; int i; for (i = 0; word[i]; i++) { char c = word[i]; switch (c) { case '0': zeros++; break; case '1': ones++; break; } } double entropy = calculate_entropy(ones, zeros); printf(" %-20.18f", entropy); } void print_word(int n, char *word) { printf("%2d", n); printf(" %10ld", strlen(word)); print_entropy(word); if (n < 10) { printf(" %-40s", word); } else { printf(" %-40s", "..."); } printf("\n"); } int main(int argc, char *argv[]) { print_headings(); char *last_word = malloc(2); strcpy(last_word, "1"); char *current_word = malloc(2); strcpy(current_word, "0"); print_word(1, last_word); int i; for (i = 2; i <= 37; i++) { print_word(i, current_word); char *next_word = malloc(strlen(current_word) + strlen(last_word) + 1); strcpy(next_word, current_word); strcat(next_word, last_word); free(last_word); last_word = current_word; current_word = next_word; } free(last_word); free(current_word); return 0; }
>>> import math >>> from collections import Counter >>> >>> def entropy(s): ... p, lns = Counter(s), float(len(s)) ... return -sum( count/lns * math.log(count/lns, 2) for count in p.values()) ... >>> >>> def fibword(nmax=37): ... fwords = ['1', '0'] ... print('%-3s %10s %-10s %s' % tuple('N Length Entropy Fibword'.split())) ... def pr(n, fwords): ... while len(fwords) < n: ... fwords += [''.join(fwords[-2:][::-1])] ... v = fwords[n-1] ... print('%3i %10i %10.7g %s' % (n, len(v), entropy(v), v if len(v) < 20 else '<too long>')) ... for n in range(1, nmax+1): pr(n, fwords) ... >>> fibword() N Length Entropy Fibword 1 1 -0 1 2 1 -0 0 3 2 1 01 4 3 0.9182958 010 5 5 0.9709506 01001 6 8 0.954434 01001010 7 13 0.9612366 0100101001001 8 21 0.9587119 <too long> 9 34 0.9596869 <too long> 10 55 0.959316 <too long> 11 89 0.9594579 <too long> 12 144 0.9594038 <too long> 13 233 0.9594244 <too long> 14 377 0.9594165 <too long> 15 610 0.9594196 <too long> 16 987 0.9594184 <too long> 17 1597 0.9594188 <too long> 18 2584 0.9594187 <too long> 19 4181 0.9594187 <too long> 20 6765 0.9594187 <too long> 21 10946 0.9594187 <too long> 22 17711 0.9594187 <too long> 23 28657 0.9594187 <too long> 24 46368 0.9594187 <too long> 25 75025 0.9594187 <too long> 26 121393 0.9594187 <too long> 27 196418 0.9594187 <too long> 28 317811 0.9594187 <too long> 29 514229 0.9594187 <too long> 30 832040 0.9594187 <too long> 31 1346269 0.9594187 <too long> 32 2178309 0.9594187 <too long> 33 3524578 0.9594187 <too long> 34 5702887 0.9594187 <too long> 35 9227465 0.9594187 <too long> 36 14930352 0.9594187 <too long> 37 24157817 0.9594187 <too long> >>>
Produce a functionally identical Python code for the snippet given in C.
#define PI 3.141592653589793 #define TWO_PI 6.283185307179586 double normalize2deg(double a) { while (a < 0) a += 360; while (a >= 360) a -= 360; return a; } double normalize2grad(double a) { while (a < 0) a += 400; while (a >= 400) a -= 400; return a; } double normalize2mil(double a) { while (a < 0) a += 6400; while (a >= 6400) a -= 6400; return a; } double normalize2rad(double a) { while (a < 0) a += TWO_PI; while (a >= TWO_PI) a -= TWO_PI; return a; } double deg2grad(double a) {return a * 10 / 9;} double deg2mil(double a) {return a * 160 / 9;} double deg2rad(double a) {return a * PI / 180;} double grad2deg(double a) {return a * 9 / 10;} double grad2mil(double a) {return a * 16;} double grad2rad(double a) {return a * PI / 200;} double mil2deg(double a) {return a * 9 / 160;} double mil2grad(double a) {return a / 16;} double mil2rad(double a) {return a * PI / 3200;} double rad2deg(double a) {return a * 180 / PI;} double rad2grad(double a) {return a * 200 / PI;} double rad2mil(double a) {return a * 3200 / PI;}
PI = 3.141592653589793 TWO_PI = 6.283185307179586 def normalize2deg(a): while a < 0: a += 360 while a >= 360: a -= 360 return a def normalize2grad(a): while a < 0: a += 400 while a >= 400: a -= 400 return a def normalize2mil(a): while a < 0: a += 6400 while a >= 6400: a -= 6400 return a def normalize2rad(a): while a < 0: a += TWO_PI while a >= TWO_PI: a -= TWO_PI return a def deg2grad(a): return a * 10.0 / 9.0 def deg2mil(a): return a * 160.0 / 9.0 def deg2rad(a): return a * PI / 180.0 def grad2deg(a): return a * 9.0 / 10.0 def grad2mil(a): return a * 16.0 def grad2rad(a): return a * PI / 200.0 def mil2deg(a): return a * 9.0 / 160.0 def mil2grad(a): return a / 16.0 def mil2rad(a): return a * PI / 3200.0 def rad2deg(a): return a * 180.0 / PI def rad2grad(a): return a * 200.0 / PI def rad2mil(a): return a * 3200.0 / PI
Convert the following code from C to Python, ensuring the logic remains intact.
#include <stdio.h> int common_len(const char *const *names, int n, char sep) { int i, pos; for (pos = 0; ; pos++) { for (i = 0; i < n; i++) { if (names[i][pos] != '\0' && names[i][pos] == names[0][pos]) continue; while (pos > 0 && names[0][--pos] != sep); return pos; } } return 0; } int main() { const char *names[] = { "/home/user1/tmp/coverage/test", "/home/user1/tmp/covert/operator", "/home/user1/tmp/coven/members", }; int len = common_len(names, sizeof(names) / sizeof(const char*), '/'); if (!len) printf("No common path\n"); else printf("Common path: %.*s\n", len, names[0]); return 0; }
>>> import os >>> os.path.commonpath(['/home/user1/tmp/coverage/test', '/home/user1/tmp/covert/operator', '/home/user1/tmp/coven/members']) '/home/user1/tmp'
Can you help me rewrite this code in Python instead of C, keeping it the same logically?
#include <stdlib.h> #include <stdio.h> #include <math.h> inline int rand5() { int r, rand_max = RAND_MAX - (RAND_MAX % 5); while ((r = rand()) >= rand_max); return r / (rand_max / 5) + 1; } inline int rand5_7() { int r; while ((r = rand5() * 5 + rand5()) >= 27); return r / 3 - 1; } int check(int (*gen)(), int n, int cnt, double delta) { int i = cnt, *bins = calloc(sizeof(int), n); double ratio; while (i--) bins[gen() - 1]++; for (i = 0; i < n; i++) { ratio = bins[i] * n / (double)cnt - 1; if (ratio > -delta && ratio < delta) continue; printf("bin %d out of range: %d (%g%% vs %g%%), ", i + 1, bins[i], ratio * 100, delta * 100); break; } free(bins); return i == n; } int main() { int cnt = 1; while ((cnt *= 10) <= 1000000) { printf("Count = %d: ", cnt); printf(check(rand5_7, 7, cnt, 0.03) ? "flat\n" : "NOT flat\n"); } return 0; }
from collections import Counter from pprint import pprint as pp def distcheck(fn, repeats, delta): bin = Counter(fn() for i in range(repeats)) target = repeats // len(bin) deltacount = int(delta / 100. * target) assert all( abs(target - count) < deltacount for count in bin.values() ), "Bin distribution skewed from %i +/- %i: %s" % ( target, deltacount, [ (key, target - count) for key, count in sorted(bin.items()) ] ) pp(dict(bin))
Write the same code in Python as shown below in C.
#include <stdbool.h> #include <stdio.h> #include <stdlib.h> typedef struct stirling_cache_tag { int max; int* values; } stirling_cache; int stirling_number2(stirling_cache* sc, int n, int k) { if (k == n) return 1; if (k == 0 || k > n || n > sc->max) return 0; return sc->values[n*(n-1)/2 + k - 1]; } bool stirling_cache_create(stirling_cache* sc, int max) { int* values = calloc(max * (max + 1)/2, sizeof(int)); if (values == NULL) return false; sc->max = max; sc->values = values; for (int n = 1; n <= max; ++n) { for (int k = 1; k < n; ++k) { int s1 = stirling_number2(sc, n - 1, k - 1); int s2 = stirling_number2(sc, n - 1, k); values[n*(n-1)/2 + k - 1] = s1 + s2 * k; } } return true; } void stirling_cache_destroy(stirling_cache* sc) { free(sc->values); sc->values = NULL; } void print_stirling_numbers(stirling_cache* sc, int max) { printf("Stirling numbers of the second kind:\nn/k"); for (int k = 0; k <= max; ++k) printf(k == 0 ? "%2d" : "%8d", k); printf("\n"); for (int n = 0; n <= max; ++n) { printf("%2d ", n); for (int k = 0; k <= n; ++k) printf(k == 0 ? "%2d" : "%8d", stirling_number2(sc, n, k)); printf("\n"); } } int main() { stirling_cache sc = { 0 }; const int max = 12; if (!stirling_cache_create(&sc, max)) { fprintf(stderr, "Out of memory\n"); return 1; } print_stirling_numbers(&sc, max); stirling_cache_destroy(&sc); return 0; }
computed = {} def sterling2(n, k): key = str(n) + "," + str(k) if key in computed.keys(): return computed[key] if n == k == 0: return 1 if (n > 0 and k == 0) or (n == 0 and k > 0): return 0 if n == k: return 1 if k > n: return 0 result = k * sterling2(n - 1, k) + sterling2(n - 1, k - 1) computed[key] = result return result print("Stirling numbers of the second kind:") MAX = 12 print("n/k".ljust(10), end="") for n in range(MAX + 1): print(str(n).rjust(10), end="") print() for n in range(MAX + 1): print(str(n).ljust(10), end="") for k in range(n + 1): print(str(sterling2(n, k)).rjust(10), end="") print() print("The maximum value of S2(100, k) = ") previous = 0 for k in range(1, 100 + 1): current = sterling2(100, k) if current > previous: previous = current else: print("{0}\n({1} digits, k = {2})\n".format(previous, len(str(previous)), k - 1)) break
Preserve the algorithm and functionality while converting the code from C to Python.
#include <stdbool.h> #include <stdio.h> #include <stdlib.h> typedef struct stirling_cache_tag { int max; int* values; } stirling_cache; int stirling_number2(stirling_cache* sc, int n, int k) { if (k == n) return 1; if (k == 0 || k > n || n > sc->max) return 0; return sc->values[n*(n-1)/2 + k - 1]; } bool stirling_cache_create(stirling_cache* sc, int max) { int* values = calloc(max * (max + 1)/2, sizeof(int)); if (values == NULL) return false; sc->max = max; sc->values = values; for (int n = 1; n <= max; ++n) { for (int k = 1; k < n; ++k) { int s1 = stirling_number2(sc, n - 1, k - 1); int s2 = stirling_number2(sc, n - 1, k); values[n*(n-1)/2 + k - 1] = s1 + s2 * k; } } return true; } void stirling_cache_destroy(stirling_cache* sc) { free(sc->values); sc->values = NULL; } void print_stirling_numbers(stirling_cache* sc, int max) { printf("Stirling numbers of the second kind:\nn/k"); for (int k = 0; k <= max; ++k) printf(k == 0 ? "%2d" : "%8d", k); printf("\n"); for (int n = 0; n <= max; ++n) { printf("%2d ", n); for (int k = 0; k <= n; ++k) printf(k == 0 ? "%2d" : "%8d", stirling_number2(sc, n, k)); printf("\n"); } } int main() { stirling_cache sc = { 0 }; const int max = 12; if (!stirling_cache_create(&sc, max)) { fprintf(stderr, "Out of memory\n"); return 1; } print_stirling_numbers(&sc, max); stirling_cache_destroy(&sc); return 0; }
computed = {} def sterling2(n, k): key = str(n) + "," + str(k) if key in computed.keys(): return computed[key] if n == k == 0: return 1 if (n > 0 and k == 0) or (n == 0 and k > 0): return 0 if n == k: return 1 if k > n: return 0 result = k * sterling2(n - 1, k) + sterling2(n - 1, k - 1) computed[key] = result return result print("Stirling numbers of the second kind:") MAX = 12 print("n/k".ljust(10), end="") for n in range(MAX + 1): print(str(n).rjust(10), end="") print() for n in range(MAX + 1): print(str(n).ljust(10), end="") for k in range(n + 1): print(str(sterling2(n, k)).rjust(10), end="") print() print("The maximum value of S2(100, k) = ") previous = 0 for k in range(1, 100 + 1): current = sterling2(100, k) if current > previous: previous = current else: print("{0}\n({1} digits, k = {2})\n".format(previous, len(str(previous)), k - 1)) break
Convert this C block to Python, preserving its control flow and logic.
#include <stdio.h> #include <stdlib.h> #include <gmodule.h> typedef int bool; int main() { int i, n, k = 0, next, *a; bool foundDup = FALSE; gboolean alreadyUsed; GHashTable* used = g_hash_table_new(g_direct_hash, g_direct_equal); GHashTable* used1000 = g_hash_table_new(g_direct_hash, g_direct_equal); a = malloc(400000 * sizeof(int)); a[0] = 0; g_hash_table_add(used, GINT_TO_POINTER(0)); g_hash_table_add(used1000, GINT_TO_POINTER(0)); for (n = 1; n <= 15 || !foundDup || k < 1001; ++n) { next = a[n - 1] - n; if (next < 1 || g_hash_table_contains(used, GINT_TO_POINTER(next))) { next += 2 * n; } alreadyUsed = g_hash_table_contains(used, GINT_TO_POINTER(next)); a[n] = next; if (!alreadyUsed) { g_hash_table_add(used, GINT_TO_POINTER(next)); if (next >= 0 && next <= 1000) { g_hash_table_add(used1000, GINT_TO_POINTER(next)); } } if (n == 14) { printf("The first 15 terms of the Recaman's sequence are: "); printf("["); for (i = 0; i < 15; ++i) printf("%d ", a[i]); printf("\b]\n"); } if (!foundDup && alreadyUsed) { printf("The first duplicated term is a[%d] = %d\n", n, next); foundDup = TRUE; } k = g_hash_table_size(used1000); if (k == 1001) { printf("Terms up to a[%d] are needed to generate 0 to 1000\n", n); } } g_hash_table_destroy(used); g_hash_table_destroy(used1000); free(a); return 0; }
from itertools import islice class Recamans(): "Recamán's sequence generator callable class" def __init__(self): self.a = None self.n = None def __call__(self): "Recamán's sequence generator" nxt = 0 a, n = {nxt}, 0 self.a = a self.n = n yield nxt while True: an1, n = nxt, n + 1 nxt = an1 - n if nxt < 0 or nxt in a: nxt = an1 + n a.add(nxt) self.n = n yield nxt if __name__ == '__main__': recamans = Recamans() print("First fifteen members of Recamans sequence:", list(islice(recamans(), 15))) so_far = set() for term in recamans(): if term in so_far: print(f"First duplicate number in series is: a({recamans.n}) = {term}") break so_far.add(term) n = 1_000 setn = set(range(n + 1)) for _ in recamans(): if setn.issubset(recamans.a): print(f"Range 0 ..{n} is covered by terms up to a({recamans.n})") break
Ensure the translated Python code behaves exactly like the original C snippet.
#include <stdio.h> #include <stdlib.h> #include <gmodule.h> typedef int bool; int main() { int i, n, k = 0, next, *a; bool foundDup = FALSE; gboolean alreadyUsed; GHashTable* used = g_hash_table_new(g_direct_hash, g_direct_equal); GHashTable* used1000 = g_hash_table_new(g_direct_hash, g_direct_equal); a = malloc(400000 * sizeof(int)); a[0] = 0; g_hash_table_add(used, GINT_TO_POINTER(0)); g_hash_table_add(used1000, GINT_TO_POINTER(0)); for (n = 1; n <= 15 || !foundDup || k < 1001; ++n) { next = a[n - 1] - n; if (next < 1 || g_hash_table_contains(used, GINT_TO_POINTER(next))) { next += 2 * n; } alreadyUsed = g_hash_table_contains(used, GINT_TO_POINTER(next)); a[n] = next; if (!alreadyUsed) { g_hash_table_add(used, GINT_TO_POINTER(next)); if (next >= 0 && next <= 1000) { g_hash_table_add(used1000, GINT_TO_POINTER(next)); } } if (n == 14) { printf("The first 15 terms of the Recaman's sequence are: "); printf("["); for (i = 0; i < 15; ++i) printf("%d ", a[i]); printf("\b]\n"); } if (!foundDup && alreadyUsed) { printf("The first duplicated term is a[%d] = %d\n", n, next); foundDup = TRUE; } k = g_hash_table_size(used1000); if (k == 1001) { printf("Terms up to a[%d] are needed to generate 0 to 1000\n", n); } } g_hash_table_destroy(used); g_hash_table_destroy(used1000); free(a); return 0; }
from itertools import islice class Recamans(): "Recamán's sequence generator callable class" def __init__(self): self.a = None self.n = None def __call__(self): "Recamán's sequence generator" nxt = 0 a, n = {nxt}, 0 self.a = a self.n = n yield nxt while True: an1, n = nxt, n + 1 nxt = an1 - n if nxt < 0 or nxt in a: nxt = an1 + n a.add(nxt) self.n = n yield nxt if __name__ == '__main__': recamans = Recamans() print("First fifteen members of Recamans sequence:", list(islice(recamans(), 15))) so_far = set() for term in recamans(): if term in so_far: print(f"First duplicate number in series is: a({recamans.n}) = {term}") break so_far.add(term) n = 1_000 setn = set(range(n + 1)) for _ in recamans(): if setn.issubset(recamans.a): print(f"Range 0 ..{n} is covered by terms up to a({recamans.n})") break
Transform the following C implementation into Python, maintaining the same output and logic.
#include <stdlib.h> #define SIZEOF_MEMB (sizeof(int)) #define NMEMB 100 int main() { int *ints = malloc(SIZEOF_MEMB*NMEMB); ints = realloc(ints, sizeof(int)*(NMEMB+1)); int *int2 = calloc(NMEMB, SIZEOF_MEMB); free(ints); free(int2); return 0; }
>>> from array import array >>> argslist = [('l', []), ('c', 'hello world'), ('u', u'hello \u2641'), ('l', [1, 2, 3, 4, 5]), ('d', [1.0, 2.0, 3.14])] >>> for typecode, initializer in argslist: a = array(typecode, initializer) print a del a array('l') array('c', 'hello world') array('u', u'hello \u2641') array('l', [1, 2, 3, 4, 5]) array('d', [1.0, 2.0, 3.1400000000000001]) >>>
Produce a functionally identical Python code for the snippet given in C.
#include <stdio.h> #include <stdlib.h> int b[3][3]; int check_winner() { int i; for (i = 0; i < 3; i++) { if (b[i][0] && b[i][1] == b[i][0] && b[i][2] == b[i][0]) return b[i][0]; if (b[0][i] && b[1][i] == b[0][i] && b[2][i] == b[0][i]) return b[0][i]; } if (!b[1][1]) return 0; if (b[1][1] == b[0][0] && b[2][2] == b[0][0]) return b[0][0]; if (b[1][1] == b[2][0] && b[0][2] == b[1][1]) return b[1][1]; return 0; } void showboard() { const char *t = "X O"; int i, j; for (i = 0; i < 3; i++, putchar('\n')) for (j = 0; j < 3; j++) printf("%c ", t[ b[i][j] + 1 ]); printf("-----\n"); } #define for_ij for (i = 0; i < 3; i++) for (j = 0; j < 3; j++) int best_i, best_j; int test_move(int val, int depth) { int i, j, score; int best = -1, changed = 0; if ((score = check_winner())) return (score == val) ? 1 : -1; for_ij { if (b[i][j]) continue; changed = b[i][j] = val; score = -test_move(-val, depth + 1); b[i][j] = 0; if (score <= best) continue; if (!depth) { best_i = i; best_j = j; } best = score; } return changed ? best : 0; } const char* game(int user) { int i, j, k, move, win = 0; for_ij b[i][j] = 0; printf("Board postions are numbered so:\n1 2 3\n4 5 6\n7 8 9\n"); printf("You have O, I have X.\n\n"); for (k = 0; k < 9; k++, user = !user) { while(user) { printf("your move: "); if (!scanf("%d", &move)) { scanf("%*s"); continue; } if (--move < 0 || move >= 9) continue; if (b[i = move / 3][j = move % 3]) continue; b[i][j] = 1; break; } if (!user) { if (!k) { best_i = rand() % 3; best_j = rand() % 3; } else test_move(-1, 0); b[best_i][best_j] = -1; printf("My move: %d\n", best_i * 3 + best_j + 1); } showboard(); if ((win = check_winner())) return win == 1 ? "You win.\n\n": "I win.\n\n"; } return "A draw.\n\n"; } int main() { int first = 0; while (1) printf("%s", game(first = !first)); return 0; }
import random board = list('123456789') wins = ((0,1,2), (3,4,5), (6,7,8), (0,3,6), (1,4,7), (2,5,8), (0,4,8), (2,4,6)) def printboard(): print('\n'.join(' '.join(board[x:x+3]) for x in(0,3,6))) def score(): for w in wins: b = board[w[0]] if b in 'XO' and all (board[i] == b for i in w): return b, [i+1 for i in w] return None, None def finished(): return all (b in 'XO' for b in board) def space(): return [ b for b in board if b not in 'XO'] def my_turn(xo): options = space() choice = random.choice(options) board[int(choice)-1] = xo return choice def your_turn(xo): options = space() while True: choice = input(" Put your %s in any of these positions: %s " % (xo, ''.join(options))).strip() if choice in options: break print( "Whoops I don't understand the input" ) board[int(choice)-1] = xo return choice def me(xo='X'): printboard() print('I go at', my_turn(xo)) return score() assert not s[0], "\n%s wins across %s" % s def you(xo='O'): printboard() print('You went at', your_turn(xo)) return score() assert not s[0], "\n%s wins across %s" % s print(__doc__) while not finished(): s = me('X') if s[0]: printboard() print("\n%s wins across %s" % s) break if not finished(): s = you('O') if s[0]: printboard() print("\n%s wins across %s" % s) break else: print('\nA draw')
Translate the given C code snippet into Python without altering its behavior.
#include <stdio.h> int main() { unsigned int i = 0; while (++i) printf("%u\n", i); return 0; }
i=1 while i: print(i) i += 1
Rewrite the snippet below in Python so it works the same as the original C code.
#include <stdio.h> int main() { unsigned int i = 0; while (++i) printf("%u\n", i); return 0; }
i=1 while i: print(i) i += 1
Convert the following code from C to Python, ensuring the logic remains intact.
#include <stdio.h> int main() { unsigned int i = 0; while (++i) printf("%u\n", i); return 0; }
i=1 while i: print(i) i += 1
Convert this C snippet to Python and keep its semantics consistent.
#include <stdio.h> #include <stdlib.h> #include <stdbool.h> #include <string.h> #include <math.h> #define MAXLEN 961 int makehist(char *S,int *hist,int len){ int wherechar[256]; int i,histlen; histlen=0; for(i=0;i<256;i++)wherechar[i]=-1; for(i=0;i<len;i++){ if(wherechar[(int)S[i]]==-1){ wherechar[(int)S[i]]=histlen; histlen++; } hist[wherechar[(int)S[i]]]++; } return histlen; } double entropy(int *hist,int histlen,int len){ int i; double H; H=0; for(i=0;i<histlen;i++){ H-=(double)hist[i]/len*log2((double)hist[i]/len); } return H; } int main(void){ char S[MAXLEN]; int len,*hist,histlen; double H; FILE *f; f=fopen("entropy.c","r"); for(len=0;!feof(f);len++)S[len]=fgetc(f); S[--len]='\0'; hist=(int*)calloc(len,sizeof(int)); histlen=makehist(S,hist,len); H=entropy(hist,histlen,len); printf("%lf\n",H); return 0; }
import math from collections import Counter def entropy(s): p, lns = Counter(s), float(len(s)) return -sum( count/lns * math.log(count/lns, 2) for count in p.values()) with open(__file__) as f: b=f.read() print(entropy(b))
Rewrite this program in Python while keeping its functionality equivalent to the C version.
#include <stdio.h> #include <stdlib.h> #include <stdbool.h> #include <string.h> #include <math.h> #define MAXLEN 961 int makehist(char *S,int *hist,int len){ int wherechar[256]; int i,histlen; histlen=0; for(i=0;i<256;i++)wherechar[i]=-1; for(i=0;i<len;i++){ if(wherechar[(int)S[i]]==-1){ wherechar[(int)S[i]]=histlen; histlen++; } hist[wherechar[(int)S[i]]]++; } return histlen; } double entropy(int *hist,int histlen,int len){ int i; double H; H=0; for(i=0;i<histlen;i++){ H-=(double)hist[i]/len*log2((double)hist[i]/len); } return H; } int main(void){ char S[MAXLEN]; int len,*hist,histlen; double H; FILE *f; f=fopen("entropy.c","r"); for(len=0;!feof(f);len++)S[len]=fgetc(f); S[--len]='\0'; hist=(int*)calloc(len,sizeof(int)); histlen=makehist(S,hist,len); H=entropy(hist,histlen,len); printf("%lf\n",H); return 0; }
import math from collections import Counter def entropy(s): p, lns = Counter(s), float(len(s)) return -sum( count/lns * math.log(count/lns, 2) for count in p.values()) with open(__file__) as f: b=f.read() print(entropy(b))
Convert this C block to Python, preserving its control flow and logic.
#include <sys/types.h> #include <sys/socket.h> #include <netdb.h> #include <stdio.h> #include <stdlib.h> #include <string.h> int main() { struct addrinfo hints, *res, *res0; int error; char host[NI_MAXHOST]; memset(&hints, 0, sizeof hints); hints.ai_family = PF_UNSPEC; hints.ai_socktype = SOCK_DGRAM; error = getaddrinfo("www.kame.net", NULL, &hints, &res0); if (error) { fprintf(stderr, "%s\n", gai_strerror(error)); exit(1); } for (res = res0; res; res = res->ai_next) { error = getnameinfo(res->ai_addr, res->ai_addrlen, host, sizeof host, NULL, 0, NI_NUMERICHOST); if (error) { fprintf(stderr, "%s\n", gai_strerror(error)); } else { printf("%s\n", host); } } freeaddrinfo(res0); return 0; }
>>> import socket >>> ips = set(i[4][0] for i in socket.getaddrinfo('www.kame.net', 80)) >>> for ip in ips: print ip ... 2001:200:dff:fff1:216:3eff:feb1:44d7 203.178.141.194
Can you help me rewrite this code in Python instead of C, keeping it the same logically?
#include <graphics.h> #include <math.h> void Peano(int x, int y, int lg, int i1, int i2) { if (lg == 1) { lineto(3*x,3*y); return; } lg = lg/3; Peano(x+(2*i1*lg), y+(2*i1*lg), lg, i1, i2); Peano(x+((i1-i2+1)*lg), y+((i1+i2)*lg), lg, i1, 1-i2); Peano(x+lg, y+lg, lg, i1, 1-i2); Peano(x+((i1+i2)*lg), y+((i1-i2+1)*lg), lg, 1-i1, 1-i2); Peano(x+(2*i2*lg), y+(2*(1-i2)*lg), lg, i1, i2); Peano(x+((1+i2-i1)*lg), y+((2-i1-i2)*lg), lg, i1, i2); Peano(x+(2*(1-i1)*lg), y+(2*(1-i1)*lg), lg, i1, i2); Peano(x+((2-i1-i2)*lg), y+((1+i2-i1)*lg), lg, 1-i1, i2); Peano(x+(2*(1-i2)*lg), y+(2*i2*lg), lg, 1-i1, i2); } int main(void) { initwindow(1000,1000,"Peano, Peano"); Peano(0, 0, 1000, 0, 0); getch(); cleardevice(); return 0; }
import turtle as tt import inspect stack = [] def peano(iterations=1): global stack ivan = tt.Turtle(shape = "classic", visible = True) screen = tt.Screen() screen.title("Desenhin do Peano") screen.bgcolor(" screen.delay(0) screen.setup(width=0.95, height=0.9) walk = 1 def screenlength(k): if k != 0: length = screenlength(k-1) return 2*length + 1 else: return 0 kkkj = screenlength(iterations) screen.setworldcoordinates(-1, -1, kkkj + 1, kkkj + 1) ivan.color(" def step1(k): global stack stack.append(len(inspect.stack())) if k != 0: ivan.left(90) step2(k - 1) ivan.forward(walk) ivan.right(90) step1(k - 1) ivan.forward(walk) step1(k - 1) ivan.right(90) ivan.forward(walk) step2(k - 1) ivan.left(90) def step2(k): global stack stack.append(len(inspect.stack())) if k != 0: ivan.right(90) step1(k - 1) ivan.forward(walk) ivan.left(90) step2(k - 1) ivan.forward(walk) step2(k - 1) ivan.left(90) ivan.forward(walk) step1(k - 1) ivan.right(90) ivan.left(90) step2(iterations) tt.done() if __name__ == "__main__": peano(4) import pylab as P P.plot(stack) P.show()
Translate the given C code snippet into Python without altering its behavior.
int rand5() { int r, rand_max = RAND_MAX - (RAND_MAX % 5); while ((r = rand()) >= rand_max); return r / (rand_max / 5) + 1; } int rand5_7() { int r; while ((r = rand5() * 5 + rand5()) >= 27); return r / 3 - 1; } int main() { printf(check(rand5, 5, 1000000, .05) ? "flat\n" : "not flat\n"); printf(check(rand7, 7, 1000000, .05) ? "flat\n" : "not flat\n"); return 0; }
from random import randint def dice5(): return randint(1, 5) def dice7(): r = dice5() + dice5() * 5 - 6 return (r % 7) + 1 if r < 21 else dice7()
Translate this program into Python but keep the logic exactly as in C.
#include <stdbool.h> #include <stdio.h> #include <math.h> int connections[15][2] = { {0, 2}, {0, 3}, {0, 4}, {1, 3}, {1, 4}, {1, 5}, {6, 2}, {6, 3}, {6, 4}, {7, 3}, {7, 4}, {7, 5}, {2, 3}, {3, 4}, {4, 5}, }; int pegs[8]; int num = 0; bool valid() { int i; for (i = 0; i < 15; i++) { if (abs(pegs[connections[i][0]] - pegs[connections[i][1]]) == 1) { return false; } } return true; } void swap(int *a, int *b) { int t = *a; *a = *b; *b = t; } void printSolution() { printf("----- %d -----\n", num++); printf(" %d %d\n", pegs[0], pegs[1]); printf("%d %d %d %d\n", pegs[2], pegs[3], pegs[4], pegs[5]); printf(" %d %d\n", pegs[6], pegs[7]); printf("\n"); } void solution(int le, int ri) { if (le == ri) { if (valid()) { printSolution(); } } else { int i; for (i = le; i <= ri; i++) { swap(pegs + le, pegs + i); solution(le + 1, ri); swap(pegs + le, pegs + i); } } } int main() { int i; for (i = 0; i < 8; i++) { pegs[i] = i + 1; } solution(0, 8 - 1); return 0; }
from __future__ import print_function from itertools import permutations from enum import Enum A, B, C, D, E, F, G, H = Enum('Peg', 'A, B, C, D, E, F, G, H') connections = ((A, C), (A, D), (A, E), (B, D), (B, E), (B, F), (G, C), (G, D), (G, E), (H, D), (H, E), (H, F), (C, D), (D, E), (E, F)) def ok(conn, perm): this, that = (c.value - 1 for c in conn) return abs(perm[this] - perm[that]) != 1 def solve(): return [perm for perm in permutations(range(1, 9)) if all(ok(conn, perm) for conn in connections)] if __name__ == '__main__': solutions = solve() print("A, B, C, D, E, F, G, H =", ', '.join(str(i) for i in solutions[0]))
Transform the following C implementation into Python, maintaining the same output and logic.
#include <stdio.h> #include <stdlib.h> #include <string.h> #include <math.h> #define CHUNK_BYTES (32 << 8) #define CHUNK_SIZE (CHUNK_BYTES << 6) int field[CHUNK_BYTES]; #define GET(x) (field[(x)>>6] & 1<<((x)>>1&31)) #define SET(x) (field[(x)>>6] |= 1<<((x)>>1&31)) typedef unsigned uint; typedef struct { uint *e; uint cap, len; } uarray; uarray primes, offset; void push(uarray *a, uint n) { if (a->len >= a->cap) { if (!(a->cap *= 2)) a->cap = 16; a->e = realloc(a->e, sizeof(uint) * a->cap); } a->e[a->len++] = n; } uint low; void init(void) { uint p, q; unsigned char f[1<<16]; memset(f, 0, sizeof(f)); push(&primes, 2); push(&offset, 0); for (p = 3; p < 1<<16; p += 2) { if (f[p]) continue; for (q = p*p; q < 1<<16; q += 2*p) f[q] = 1; push(&primes, p); push(&offset, q); } low = 1<<16; } void sieve(void) { uint i, p, q, hi, ptop; if (!low) init(); memset(field, 0, sizeof(field)); hi = low + CHUNK_SIZE; ptop = sqrt(hi) * 2 + 1; for (i = 1; (p = primes.e[i]*2) < ptop; i++) { for (q = offset.e[i] - low; q < CHUNK_SIZE; q += p) SET(q); offset.e[i] = q + low; } for (p = 1; p < CHUNK_SIZE; p += 2) if (!GET(p)) push(&primes, low + p); low = hi; } int main(void) { uint i, p, c; while (primes.len < 20) sieve(); printf("First 20:"); for (i = 0; i < 20; i++) printf(" %u", primes.e[i]); putchar('\n'); while (primes.e[primes.len-1] < 150) sieve(); printf("Between 100 and 150:"); for (i = 0; i < primes.len; i++) { if ((p = primes.e[i]) >= 100 && p < 150) printf(" %u", primes.e[i]); } putchar('\n'); while (primes.e[primes.len-1] < 8000) sieve(); for (i = c = 0; i < primes.len; i++) if ((p = primes.e[i]) >= 7700 && p < 8000) c++; printf("%u primes between 7700 and 8000\n", c); for (c = 10; c <= 100000000; c *= 10) { while (primes.len < c) sieve(); printf("%uth prime: %u\n", c, primes.e[c-1]); } return 0; }
islice(count(7), 0, None, 2)
Keep all operations the same but rewrite the snippet in Python.
#include <stdio.h> #include <stdlib.h> #define LEN 3 int rand_idx(double *p, int n) { double s = rand() / (RAND_MAX + 1.0); int i; for (i = 0; i < n - 1 && (s -= p[i]) >= 0; i++); return i; } int main() { int user_action, my_action; int user_rec[] = {0, 0, 0}; const char *names[] = { "Rock", "Paper", "Scissors" }; char str[2]; const char *winner[] = { "We tied.", "Meself winned.", "You win." }; double p[LEN] = { 1./3, 1./3, 1./3 }; while (1) { my_action = rand_idx(p,LEN); printf("\nYour choice [1-3]:\n" " 1. Rock\n 2. Paper\n 3. Scissors\n> "); if (!scanf("%d", &user_action)) { scanf("%1s", str); if (*str == 'q') { printf("Your choices [rock : %d , paper : %d , scissors %d] ",user_rec[0],user_rec[1], user_rec[2]); return 0; } continue; } user_action --; if (user_action > 2 || user_action < 0) { printf("invalid choice; again\n"); continue; } printf("You chose %s; I chose %s. %s\n", names[user_action], names[my_action], winner[(my_action - user_action + 3) % 3]); user_rec[user_action]++; } }
from random import choice rules = {'rock': 'paper', 'scissors': 'rock', 'paper': 'scissors'} previous = ['rock', 'paper', 'scissors'] while True: human = input('\nchoose your weapon: ') computer = rules[choice(previous)] if human in ('quit', 'exit'): break elif human in rules: previous.append(human) print('the computer played', computer, end='; ') if rules[computer] == human: print('yay you win!') elif rules[human] == computer: print('the computer beat you... :(') else: print("it's a tie!") else: print("that's not a valid choice")
Can you help me rewrite this code in Python instead of C, keeping it the same logically?
#include <stdio.h> int main(int argc, char **argv) { int user1 = 0, user2 = 0; printf("Enter two integers. Space delimited, please: "); scanf("%d %d",&user1, &user2); int array[user1][user2]; array[user1/2][user2/2] = user1 + user2; printf("array[%d][%d] is %d\n",user1/2,user2/2,array[user1/2][user2/2]); return 0; }
width = int(raw_input("Width of myarray: ")) height = int(raw_input("Height of Array: ")) myarray = [[0] * width for i in range(height)] myarray[0][0] = 3.5 print (myarray[0][0])
Write the same algorithm in Python as shown in this C implementation.
#include <stdio.h> int mul_inv(int a, int b) { int b0 = b, t, q; int x0 = 0, x1 = 1; if (b == 1) return 1; while (a > 1) { q = a / b; t = b, b = a % b, a = t; t = x0, x0 = x1 - q * x0, x1 = t; } if (x1 < 0) x1 += b0; return x1; } int chinese_remainder(int *n, int *a, int len) { int p, i, prod = 1, sum = 0; for (i = 0; i < len; i++) prod *= n[i]; for (i = 0; i < len; i++) { p = prod / n[i]; sum += a[i] * mul_inv(p, n[i]) * p; } return sum % prod; } int main(void) { int n[] = { 3, 5, 7 }; int a[] = { 2, 3, 2 }; printf("%d\n", chinese_remainder(n, a, sizeof(n)/sizeof(n[0]))); return 0; }
def chinese_remainder(n, a): sum = 0 prod = reduce(lambda a, b: a*b, n) for n_i, a_i in zip(n, a): p = prod / n_i sum += a_i * mul_inv(p, n_i) * p return sum % prod def mul_inv(a, b): b0 = b x0, x1 = 0, 1 if b == 1: return 1 while a > 1: q = a / b a, b = b, a%b x0, x1 = x1 - q * x0, x0 if x1 < 0: x1 += b0 return x1 if __name__ == '__main__': n = [3, 5, 7] a = [2, 3, 2] print chinese_remainder(n, a)
Preserve the algorithm and functionality while converting the code from C to Python.
#include <stdio.h> int mul_inv(int a, int b) { int b0 = b, t, q; int x0 = 0, x1 = 1; if (b == 1) return 1; while (a > 1) { q = a / b; t = b, b = a % b, a = t; t = x0, x0 = x1 - q * x0, x1 = t; } if (x1 < 0) x1 += b0; return x1; } int chinese_remainder(int *n, int *a, int len) { int p, i, prod = 1, sum = 0; for (i = 0; i < len; i++) prod *= n[i]; for (i = 0; i < len; i++) { p = prod / n[i]; sum += a[i] * mul_inv(p, n[i]) * p; } return sum % prod; } int main(void) { int n[] = { 3, 5, 7 }; int a[] = { 2, 3, 2 }; printf("%d\n", chinese_remainder(n, a, sizeof(n)/sizeof(n[0]))); return 0; }
def chinese_remainder(n, a): sum = 0 prod = reduce(lambda a, b: a*b, n) for n_i, a_i in zip(n, a): p = prod / n_i sum += a_i * mul_inv(p, n_i) * p return sum % prod def mul_inv(a, b): b0 = b x0, x1 = 0, 1 if b == 1: return 1 while a > 1: q = a / b a, b = b, a%b x0, x1 = x1 - q * x0, x0 if x1 < 0: x1 += b0 return x1 if __name__ == '__main__': n = [3, 5, 7] a = [2, 3, 2] print chinese_remainder(n, a)
Preserve the algorithm and functionality while converting the code from C to Python.
#include <stdio.h> #include <stdlib.h> #include <string.h> #include <ctype.h> #include <math.h> const char *encoded = "MOMUD EKAPV TQEFM OEVHP AJMII CDCTI FGYAG JSPXY ALUYM NSMYH" "VUXJE LEPXJ FXGCM JHKDZ RYICU HYPUS PGIGM OIYHF WHTCQ KMLRD" "ITLXZ LJFVQ GHOLW CUHLO MDSOE KTALU VYLNZ RFGBX PHVGA LWQIS" "FGRPH JOOFW GUBYI LAPLA LCAFA AMKLG CETDW VOELJ IKGJB XPHVG" "ALWQC SNWBU BYHCU HKOCE XJEYK BQKVY KIIEH GRLGH XEOLW AWFOJ" "ILOVV RHPKD WIHKN ATUHN VRYAQ DIVHX FHRZV QWMWV LGSHN NLVZS" "JLAKI FHXUF XJLXM TBLQV RXXHR FZXGV LRAJI EXPRV OSMNP KEPDT" "LPRWM JAZPK LQUZA ALGZX GVLKL GJTUI ITDSU REZXJ ERXZS HMPST" "MTEOE PAPJH SMFNB YVQUZ AALGA YDNMP AQOWT UHDBV TSMUE UIMVH" "QGVRW AEFSP EMPVE PKXZY WLKJA GWALT VYYOB YIXOK IHPDS EVLEV" "RVSGB JOGYW FHKBL GLXYA MVKIS KIEHY IMAPX UOISK PVAGN MZHPW" "TTZPV XFCCD TUHJH WLAPF YULTB UXJLN SIJVV YOVDJ SOLXG TGRVO" "SFRII CTMKO JFCQF KTINQ BWVHG TENLH HOGCS PSFPV GJOKM SIFPR" "ZPAAS ATPTZ FTPPD PORRF TAXZP KALQA WMIUD BWNCT LEFKO ZQDLX" "BUXJL ASIMR PNMBF ZCYLV WAPVF QRHZV ZGZEF KBYIO OFXYE VOWGB" "BXVCB XBAWG LQKCM ICRRX MACUO IKHQU AJEGL OIJHH XPVZW JEWBA" "FWAML ZZRXJ EKAHV FASMU LVVUT TGK"; const double freq[] = { 0.08167, 0.01492, 0.02782, 0.04253, 0.12702, 0.02228, 0.02015, 0.06094, 0.06966, 0.00153, 0.00772, 0.04025, 0.02406, 0.06749, 0.07507, 0.01929, 0.00095, 0.05987, 0.06327, 0.09056, 0.02758, 0.00978, 0.02360, 0.00150, 0.01974, 0.00074 }; int best_match(const double *a, const double *b) { double sum = 0, fit, d, best_fit = 1e100; int i, rotate, best_rotate = 0; for (i = 0; i < 26; i++) sum += a[i]; for (rotate = 0; rotate < 26; rotate++) { fit = 0; for (i = 0; i < 26; i++) { d = a[(i + rotate) % 26] / sum - b[i]; fit += d * d / b[i]; } if (fit < best_fit) { best_fit = fit; best_rotate = rotate; } } return best_rotate; } double freq_every_nth(const int *msg, int len, int interval, char *key) { double sum, d, ret; double out[26], accu[26] = {0}; int i, j, rot; for (j = 0; j < interval; j++) { for (i = 0; i < 26; i++) out[i] = 0; for (i = j; i < len; i += interval) out[msg[i]]++; key[j] = rot = best_match(out, freq); key[j] += 'A'; for (i = 0; i < 26; i++) accu[i] += out[(i + rot) % 26]; } for (i = 0, sum = 0; i < 26; i++) sum += accu[i]; for (i = 0, ret = 0; i < 26; i++) { d = accu[i] / sum - freq[i]; ret += d * d / freq[i]; } key[interval] = '\0'; return ret; } int main() { int txt[strlen(encoded)]; int len = 0, j; char key[100]; double fit, best_fit = 1e100; for (j = 0; encoded[j] != '\0'; j++) if (isupper(encoded[j])) txt[len++] = encoded[j] - 'A'; for (j = 1; j < 30; j++) { fit = freq_every_nth(txt, len, j, key); printf("%f, key length: %2d, %s", fit, j, key); if (fit < best_fit) { best_fit = fit; printf(" <--- best so far"); } printf("\n"); } return 0; }
from string import uppercase from operator import itemgetter def vigenere_decrypt(target_freqs, input): nchars = len(uppercase) ordA = ord('A') sorted_targets = sorted(target_freqs) def frequency(input): result = [[c, 0.0] for c in uppercase] for c in input: result[c - ordA][1] += 1 return result def correlation(input): result = 0.0 freq = frequency(input) freq.sort(key=itemgetter(1)) for i, f in enumerate(freq): result += f[1] * sorted_targets[i] return result cleaned = [ord(c) for c in input.upper() if c.isupper()] best_len = 0 best_corr = -100.0 for i in xrange(2, len(cleaned) // 20): pieces = [[] for _ in xrange(i)] for j, c in enumerate(cleaned): pieces[j % i].append(c) corr = -0.5 * i + sum(correlation(p) for p in pieces) if corr > best_corr: best_len = i best_corr = corr if best_len == 0: return ("Text is too short to analyze", "") pieces = [[] for _ in xrange(best_len)] for i, c in enumerate(cleaned): pieces[i % best_len].append(c) freqs = [frequency(p) for p in pieces] key = "" for fr in freqs: fr.sort(key=itemgetter(1), reverse=True) m = 0 max_corr = 0.0 for j in xrange(nchars): corr = 0.0 c = ordA + j for frc in fr: d = (ord(frc[0]) - c + nchars) % nchars corr += frc[1] * target_freqs[d] if corr > max_corr: m = j max_corr = corr key += chr(m + ordA) r = (chr((c - ord(key[i % best_len]) + nchars) % nchars + ordA) for i, c in enumerate(cleaned)) return (key, "".join(r)) def main(): encoded = english_frequences = [ 0.08167, 0.01492, 0.02782, 0.04253, 0.12702, 0.02228, 0.02015, 0.06094, 0.06966, 0.00153, 0.00772, 0.04025, 0.02406, 0.06749, 0.07507, 0.01929, 0.00095, 0.05987, 0.06327, 0.09056, 0.02758, 0.00978, 0.02360, 0.00150, 0.01974, 0.00074] (key, decoded) = vigenere_decrypt(english_frequences, encoded) print "Key:", key print "\nText:", decoded main()
Generate an equivalent Python version of this C code.
#include <stdio.h> #include <stdlib.h> #include <gmp.h> mpz_t tmp1, tmp2, t5, t239, pows; void actan(mpz_t res, unsigned long base, mpz_t pows) { int i, neg = 1; mpz_tdiv_q_ui(res, pows, base); mpz_set(tmp1, res); for (i = 3; ; i += 2) { mpz_tdiv_q_ui(tmp1, tmp1, base * base); mpz_tdiv_q_ui(tmp2, tmp1, i); if (mpz_cmp_ui(tmp2, 0) == 0) break; if (neg) mpz_sub(res, res, tmp2); else mpz_add(res, res, tmp2); neg = !neg; } } char * get_digits(int n, size_t* len) { mpz_ui_pow_ui(pows, 10, n + 20); actan(t5, 5, pows); mpz_mul_ui(t5, t5, 16); actan(t239, 239, pows); mpz_mul_ui(t239, t239, 4); mpz_sub(t5, t5, t239); mpz_ui_pow_ui(pows, 10, 20); mpz_tdiv_q(t5, t5, pows); *len = mpz_sizeinbase(t5, 10); return mpz_get_str(0, 0, t5); } int main(int c, char **v) { unsigned long accu = 16384, done = 0; size_t got; char *s; mpz_init(tmp1); mpz_init(tmp2); mpz_init(t5); mpz_init(t239); mpz_init(pows); while (1) { s = get_digits(accu, &got); got -= 2; while (s[got] == '0' || s[got] == '9') got--; printf("%.*s", (int)(got - done), s + done); free(s); done = got; accu *= 2; } return 0; }
def calcPi(): q, r, t, k, n, l = 1, 0, 1, 1, 3, 3 while True: if 4*q+r-t < n*t: yield n nr = 10*(r-n*t) n = ((10*(3*q+r))//t)-10*n q *= 10 r = nr else: nr = (2*q+r)*l nn = (q*(7*k)+2+(r*l))//(t*l) q *= k t *= l l += 2 k += 1 n = nn r = nr import sys pi_digits = calcPi() i = 0 for d in pi_digits: sys.stdout.write(str(d)) i += 1 if i == 40: print(""); i = 0
Translate the given C code snippet into Python without altering its behavior.
#include <stdio.h> #include <stdlib.h> #define N 100000 int main() { int i, flip, *q = (int*)malloc(sizeof(int) * N) - 1; q[1] = q[2] = 1; for (i = 3; i <= N; i++) q[i] = q[i - q[i - 1]] + q[i - q[i - 2]]; for (i = 1; i <= 10; i++) printf("%d%c", q[i], i == 10 ? '\n' : ' '); printf("%d\n", q[1000]); for (flip = 0, i = 1; i < N; i++) flip += q[i] > q[i + 1]; printf("flips: %d\n", flip); return 0; }
def q(n): if n < 1 or type(n) != int: raise ValueError("n must be an int >= 1") try: return q.seq[n] except IndexError: ans = q(n - q(n - 1)) + q(n - q(n - 2)) q.seq.append(ans) return ans q.seq = [None, 1, 1] if __name__ == '__main__': first10 = [q(i) for i in range(1,11)] assert first10 == [1, 1, 2, 3, 3, 4, 5, 5, 6, 6], "Q() value error(s)" print("Q(n) for n = [1..10] is:", ', '.join(str(i) for i in first10)) assert q(1000) == 502, "Q(1000) value error" print("Q(1000) =", q(1000))
Change the following C code into Python without altering its purpose.
#include <stdio.h> #include <stdlib.h> #define N 100000 int main() { int i, flip, *q = (int*)malloc(sizeof(int) * N) - 1; q[1] = q[2] = 1; for (i = 3; i <= N; i++) q[i] = q[i - q[i - 1]] + q[i - q[i - 2]]; for (i = 1; i <= 10; i++) printf("%d%c", q[i], i == 10 ? '\n' : ' '); printf("%d\n", q[1000]); for (flip = 0, i = 1; i < N; i++) flip += q[i] > q[i + 1]; printf("flips: %d\n", flip); return 0; }
def q(n): if n < 1 or type(n) != int: raise ValueError("n must be an int >= 1") try: return q.seq[n] except IndexError: ans = q(n - q(n - 1)) + q(n - q(n - 2)) q.seq.append(ans) return ans q.seq = [None, 1, 1] if __name__ == '__main__': first10 = [q(i) for i in range(1,11)] assert first10 == [1, 1, 2, 3, 3, 4, 5, 5, 6, 6], "Q() value error(s)" print("Q(n) for n = [1..10] is:", ', '.join(str(i) for i in first10)) assert q(1000) == 502, "Q(1000) value error" print("Q(1000) =", q(1000))
Translate this program into Java but keep the logic exactly as in C.
void bitwise(int a, int b) { printf("a and b: %d\n", a & b); printf("a or b: %d\n", a | b); printf("a xor b: %d\n", a ^ b); printf("not a: %d\n", ~a); printf("a << n: %d\n", a << b); printf("a >> n: %d\n", a >> b); unsigned int c = a; printf("c >> b: %d\n", c >> b); return 0; }
module BitwiseOps { @Inject Console console; void run() { for ((Int64 n1, Int64 n2) : [0=7, 1=5, 42=2, 0x123456789ABCDEF=0xFF]) { static String hex(Int64 n) { return n.toByteArray() [(n.leadingZeroCount / 8).minOf(7) ..< 8].toString(); } console.print($|For values {n1} ({hex(n1)}) and {n2} ({hex(n2)}): | {hex(n1)} AND {hex(n2)} = {hex(n1 & n2)} | {hex(n1)} OR {hex(n2)} = {hex(n1 | n2)} | {hex(n1)} XOR {hex(n2)} = {hex(n1 ^ n2)} | NOT {hex(n1)} = {hex(~n1)} | left shift {hex(n1)} by {n2} = {hex(n1 << n2)} | right shift {hex(n1)} by {n2} = {hex(n1 >> n2)} | right arithmetic shift {hex(n1)} by {n2} = {hex(n1 >>> n2)} | left rotate {hex(n1)} by {n2} = {hex(n1.rotateLeft(n2))} | right rotate {hex(n1)} by {n2} = {hex(n1.rotateRight(n2))} | leftmost bit of {hex(n1)} = {hex(n1.leftmostBit)} | rightmost bit of {hex(n1)} = {hex(n1.rightmostBit)} | leading zero count of {hex(n1)} = {n1.leadingZeroCount} | trailing zero count of {hex(n1)} = {n1.trailingZeroCount} | bit count (aka "population") of {hex(n1)} = {n1.bitCount} | reversed bits of {hex(n1)} = {hex(n1.reverseBits())} | reverse bytes of {hex(n1)} = {hex(n1.reverseBytes())} | ); } } }
Convert this C snippet to Java and keep its semantics consistent.
#include <stdio.h> #include <stdlib.h> #include <string.h> #include <math.h> long long x, y, dx, dy, scale, clen; typedef struct { double r, g, b; } rgb; rgb ** pix; void sc_up() { long long tmp = dx - dy; dy = dx + dy; dx = tmp; scale *= 2; x *= 2; y *= 2; } void h_rgb(long long x, long long y) { rgb *p = &pix[y][x]; # define SAT 1 double h = 6.0 * clen / scale; double VAL = 1 - (cos(3.141592653579 * 64 * clen / scale) - 1) / 4; double c = SAT * VAL; double X = c * (1 - fabs(fmod(h, 2) - 1)); switch((int)h) { case 0: p->r += c; p->g += X; return; case 1: p->r += X; p->g += c; return; case 2: p->g += c; p->b += X; return; case 3: p->g += X; p->b += c; return; case 4: p->r += X; p->b += c; return; default: p->r += c; p->b += X; } } void iter_string(const char * str, int d) { long tmp; # define LEFT tmp = -dy; dy = dx; dx = tmp # define RIGHT tmp = dy; dy = -dx; dx = tmp while (*str != '\0') { switch(*(str++)) { case 'X': if (d) iter_string("X+YF+", d - 1); continue; case 'Y': if (d) iter_string("-FX-Y", d - 1); continue; case '+': RIGHT; continue; case '-': LEFT; continue; case 'F': clen ++; h_rgb(x/scale, y/scale); x += dx; y += dy; continue; } } } void dragon(long leng, int depth) { long i, d = leng / 3 + 1; long h = leng + 3, w = leng + d * 3 / 2 + 2; rgb *buf = malloc(sizeof(rgb) * w * h); pix = malloc(sizeof(rgb *) * h); for (i = 0; i < h; i++) pix[i] = buf + w * i; memset(buf, 0, sizeof(rgb) * w * h); x = y = d; dx = leng; dy = 0; scale = 1; clen = 0; for (i = 0; i < depth; i++) sc_up(); iter_string("FX", depth); unsigned char *fpix = malloc(w * h * 3); double maxv = 0, *dbuf = (double*)buf; for (i = 3 * w * h - 1; i >= 0; i--) if (dbuf[i] > maxv) maxv = dbuf[i]; for (i = 3 * h * w - 1; i >= 0; i--) fpix[i] = 255 * dbuf[i] / maxv; printf("P6\n%ld %ld\n255\n", w, h); fflush(stdout); fwrite(fpix, h * w * 3, 1, stdout); } int main(int c, char ** v) { int size, depth; depth = (c > 1) ? atoi(v[1]) : 10; size = 1 << depth; fprintf(stderr, "size: %d depth: %d\n", size, depth); dragon(size, depth * 2); return 0; }
import java.awt.Color; import java.awt.Graphics; import java.util.*; import javax.swing.JFrame; public class DragonCurve extends JFrame { private List<Integer> turns; private double startingAngle, side; public DragonCurve(int iter) { super("Dragon Curve"); setBounds(100, 100, 800, 600); setDefaultCloseOperation(EXIT_ON_CLOSE); turns = getSequence(iter); startingAngle = -iter * (Math.PI / 4); side = 400 / Math.pow(2, iter / 2.); } public List<Integer> getSequence(int iterations) { List<Integer> turnSequence = new ArrayList<Integer>(); for (int i = 0; i < iterations; i++) { List<Integer> copy = new ArrayList<Integer>(turnSequence); Collections.reverse(copy); turnSequence.add(1); for (Integer turn : copy) { turnSequence.add(-turn); } } return turnSequence; } @Override public void paint(Graphics g) { g.setColor(Color.BLACK); double angle = startingAngle; int x1 = 230, y1 = 350; int x2 = x1 + (int) (Math.cos(angle) * side); int y2 = y1 + (int) (Math.sin(angle) * side); g.drawLine(x1, y1, x2, y2); x1 = x2; y1 = y2; for (Integer turn : turns) { angle += turn * (Math.PI / 2); x2 = x1 + (int) (Math.cos(angle) * side); y2 = y1 + (int) (Math.sin(angle) * side); g.drawLine(x1, y1, x2, y2); x1 = x2; y1 = y2; } } public static void main(String[] args) { new DragonCurve(14).setVisible(true); } }
Write the same algorithm in Java as shown in this C implementation.
#include <conio.h> #include <stdio.h> int main() { int n1, n2, n3; printf( "\n Introduzca el primer n%cmero (entero): ", 163 ); scanf( "%d", &n1 ); printf( "\n Introduzca el segundo n%cmero (entero): ", 163 ); scanf( "%d", &n2 ); printf( "\n Introduzca el tercer n%cmero (entero): ", 163 ); scanf( "%d", &n3 ); if ( n1 >= n2 && n1 >= n3 ) printf( "\n %d es el mayor.", n1 ); else if ( n2 > n3 ) printf( "\n %d es el mayor.", n2 ); else printf( "\n %d es el mayor.", n3 ); getch(); return 0; }
import java.io.BufferedReader; import java.io.FileReader; public class ReadFileByLines { private static void processLine(int lineNo, String line) { } public static void main(String[] args) { for (String filename : args) { BufferedReader br = null; FileReader fr = null; try { fr = new FileReader(filename); br = new BufferedReader(fr); String line; int lineNo = 0; while ((line = br.readLine()) != null) { processLine(++lineNo, line); } } catch (Exception x) { x.printStackTrace(); } finally { if (fr != null) { try {br.close();} catch (Exception ignoreMe) {} try {fr.close();} catch (Exception ignoreMe) {} } } } } }
Change the programming language of this snippet from C to Java without modifying what it does.
void insert(link* anchor, link* newlink) { newlink->next = anchor->next; newlink->prev = anchor; (newlink->next)->prev = newlink; anchor->next = newlink; }
import java.util.LinkedList; @SuppressWarnings("serial") public class DoublyLinkedListInsertion<T> extends LinkedList<T> { public static void main(String[] args) { DoublyLinkedListInsertion<String> list = new DoublyLinkedListInsertion<String>(); list.addFirst("Add First 1"); list.addFirst("Add First 2"); list.addFirst("Add First 3"); list.addFirst("Add First 4"); list.addFirst("Add First 5"); traverseList(list); list.addAfter("Add First 3", "Add New"); traverseList(list); } public void addAfter(T after, T element) { int index = indexOf(after); if ( index >= 0 ) { add(index + 1, element); } else { addLast(element); } } private static void traverseList(LinkedList<String> list) { System.out.println("Traverse List:"); for ( int i = 0 ; i < list.size() ; i++ ) { System.out.printf("Element number %d - Element value = '%s'%n", i, list.get(i)); } System.out.println(); } }
Port the provided C code into Java while preserving the original functionality.
#include <locale.h> #include <stdbool.h> #include <stdint.h> #include <stdio.h> typedef uint32_t integer; integer next_prime_digit_number(integer n) { if (n == 0) return 2; switch (n % 10) { case 2: return n + 1; case 3: case 5: return n + 2; default: return 2 + next_prime_digit_number(n/10) * 10; } } bool is_prime(integer n) { if (n < 2) return false; if (n % 2 == 0) return n == 2; if (n % 3 == 0) return n == 3; if (n % 5 == 0) return n == 5; static const integer wheel[] = { 4,2,4,2,4,6,2,6 }; integer p = 7; for (;;) { for (int i = 0; i < 8; ++i) { if (p * p > n) return true; if (n % p == 0) return false; p += wheel[i]; } } } int main() { setlocale(LC_ALL, ""); const integer limit = 1000000000; integer n = 0, max = 0; printf("First 25 SPDS primes:\n"); for (int i = 0; n < limit; ) { n = next_prime_digit_number(n); if (!is_prime(n)) continue; if (i < 25) { if (i > 0) printf(" "); printf("%'u", n); } else if (i == 25) printf("\n"); ++i; if (i == 100) printf("Hundredth SPDS prime: %'u\n", n); else if (i == 1000) printf("Thousandth SPDS prime: %'u\n", n); else if (i == 10000) printf("Ten thousandth SPDS prime: %'u\n", n); max = n; } printf("Largest SPDS prime less than %'u: %'u\n", limit, max); return 0; }
public class SmarandachePrimeDigitalSequence { public static void main(String[] args) { long s = getNextSmarandache(7); System.out.printf("First 25 Smarandache prime-digital sequence numbers:%n2 3 5 7 "); for ( int count = 1 ; count <= 21 ; s = getNextSmarandache(s) ) { if ( isPrime(s) ) { System.out.printf("%d ", s); count++; } } System.out.printf("%n%n"); for (int i = 2 ; i <=5 ; i++ ) { long n = (long) Math.pow(10, i); System.out.printf("%,dth Smarandache prime-digital sequence number = %d%n", n, getSmarandachePrime(n)); } } private static final long getSmarandachePrime(long n) { if ( n < 10 ) { switch ((int) n) { case 1: return 2; case 2: return 3; case 3: return 5; case 4: return 7; } } long s = getNextSmarandache(7); long result = 0; for ( int count = 1 ; count <= n-4 ; s = getNextSmarandache(s) ) { if ( isPrime(s) ) { count++; result = s; } } return result; } private static final boolean isPrime(long test) { if ( test % 2 == 0 ) return false; for ( long i = 3 ; i <= Math.sqrt(test) ; i += 2 ) { if ( test % i == 0 ) { return false; } } return true; } private static long getNextSmarandache(long n) { if ( n % 10 == 3 ) { return n+4; } long retVal = n-4; int k = 0; while ( n % 10 == 7 ) { k++; n /= 10; } long digit = n % 10; long coeff = (digit == 2 ? 1 : 2); retVal += coeff * Math.pow(10, k); while ( k > 1 ) { retVal -= 5 * Math.pow(10, k-1); k--; } return retVal; } }
Convert this C block to Java, preserving its control flow and logic.
#include <locale.h> #include <stdbool.h> #include <stdint.h> #include <stdio.h> typedef uint32_t integer; integer next_prime_digit_number(integer n) { if (n == 0) return 2; switch (n % 10) { case 2: return n + 1; case 3: case 5: return n + 2; default: return 2 + next_prime_digit_number(n/10) * 10; } } bool is_prime(integer n) { if (n < 2) return false; if (n % 2 == 0) return n == 2; if (n % 3 == 0) return n == 3; if (n % 5 == 0) return n == 5; static const integer wheel[] = { 4,2,4,2,4,6,2,6 }; integer p = 7; for (;;) { for (int i = 0; i < 8; ++i) { if (p * p > n) return true; if (n % p == 0) return false; p += wheel[i]; } } } int main() { setlocale(LC_ALL, ""); const integer limit = 1000000000; integer n = 0, max = 0; printf("First 25 SPDS primes:\n"); for (int i = 0; n < limit; ) { n = next_prime_digit_number(n); if (!is_prime(n)) continue; if (i < 25) { if (i > 0) printf(" "); printf("%'u", n); } else if (i == 25) printf("\n"); ++i; if (i == 100) printf("Hundredth SPDS prime: %'u\n", n); else if (i == 1000) printf("Thousandth SPDS prime: %'u\n", n); else if (i == 10000) printf("Ten thousandth SPDS prime: %'u\n", n); max = n; } printf("Largest SPDS prime less than %'u: %'u\n", limit, max); return 0; }
public class SmarandachePrimeDigitalSequence { public static void main(String[] args) { long s = getNextSmarandache(7); System.out.printf("First 25 Smarandache prime-digital sequence numbers:%n2 3 5 7 "); for ( int count = 1 ; count <= 21 ; s = getNextSmarandache(s) ) { if ( isPrime(s) ) { System.out.printf("%d ", s); count++; } } System.out.printf("%n%n"); for (int i = 2 ; i <=5 ; i++ ) { long n = (long) Math.pow(10, i); System.out.printf("%,dth Smarandache prime-digital sequence number = %d%n", n, getSmarandachePrime(n)); } } private static final long getSmarandachePrime(long n) { if ( n < 10 ) { switch ((int) n) { case 1: return 2; case 2: return 3; case 3: return 5; case 4: return 7; } } long s = getNextSmarandache(7); long result = 0; for ( int count = 1 ; count <= n-4 ; s = getNextSmarandache(s) ) { if ( isPrime(s) ) { count++; result = s; } } return result; } private static final boolean isPrime(long test) { if ( test % 2 == 0 ) return false; for ( long i = 3 ; i <= Math.sqrt(test) ; i += 2 ) { if ( test % i == 0 ) { return false; } } return true; } private static long getNextSmarandache(long n) { if ( n % 10 == 3 ) { return n+4; } long retVal = n-4; int k = 0; while ( n % 10 == 7 ) { k++; n /= 10; } long digit = n % 10; long coeff = (digit == 2 ? 1 : 2); retVal += coeff * Math.pow(10, k); while ( k > 1 ) { retVal -= 5 * Math.pow(10, k-1); k--; } return retVal; } }
Produce a language-to-language conversion: from C to Java, same semantics.
#include <stdio.h> #include <string.h> int qselect(int *v, int len, int k) { # define SWAP(a, b) { tmp = v[a]; v[a] = v[b]; v[b] = tmp; } int i, st, tmp; for (st = i = 0; i < len - 1; i++) { if (v[i] > v[len-1]) continue; SWAP(i, st); st++; } SWAP(len-1, st); return k == st ?v[st] :st > k ? qselect(v, st, k) : qselect(v + st, len - st, k - st); } int main(void) { # define N (sizeof(x)/sizeof(x[0])) int x[] = {9, 8, 7, 6, 5, 0, 1, 2, 3, 4}; int y[N]; int i; for (i = 0; i < 10; i++) { memcpy(y, x, sizeof(x)); printf("%d: %d\n", i, qselect(y, 10, i)); } return 0; }
import java.util.Random; public class QuickSelect { private static <E extends Comparable<? super E>> int partition(E[] arr, int left, int right, int pivot) { E pivotVal = arr[pivot]; swap(arr, pivot, right); int storeIndex = left; for (int i = left; i < right; i++) { if (arr[i].compareTo(pivotVal) < 0) { swap(arr, i, storeIndex); storeIndex++; } } swap(arr, right, storeIndex); return storeIndex; } private static <E extends Comparable<? super E>> E select(E[] arr, int n) { int left = 0; int right = arr.length - 1; Random rand = new Random(); while (right >= left) { int pivotIndex = partition(arr, left, right, rand.nextInt(right - left + 1) + left); if (pivotIndex == n) { return arr[pivotIndex]; } else if (pivotIndex < n) { left = pivotIndex + 1; } else { right = pivotIndex - 1; } } return null; } private static void swap(Object[] arr, int i1, int i2) { if (i1 != i2) { Object temp = arr[i1]; arr[i1] = arr[i2]; arr[i2] = temp; } } public static void main(String[] args) { for (int i = 0; i < 10; i++) { Integer[] input = {9, 8, 7, 6, 5, 0, 1, 2, 3, 4}; System.out.print(select(input, i)); if (i < 9) System.out.print(", "); } System.out.println(); } }
Convert this C snippet to Java and keep its semantics consistent.
#include <stdlib.h> #include <string.h> #include <stdio.h> #include <stdint.h> char *to_base(int64_t num, int base) { char *tbl = "0123456789abcdefghijklmnopqrstuvwxyz"; char buf[66] = {'\0'}; char *out; uint64_t n; int i, len = 0, neg = 0; if (base > 36) { fprintf(stderr, "base %d too large\n", base); return 0; } n = ((neg = num < 0)) ? (~num) + 1 : num; do { buf[len++] = tbl[n % base]; } while(n /= base); out = malloc(len + neg + 1); for (i = neg; len > 0; i++) out[i] = buf[--len]; if (neg) out[0] = '-'; return out; } long from_base(const char *num_str, int base) { char *endptr; int result = strtol(num_str, &endptr, base); return result; } int main() { int64_t x; x = ~(1LL << 63) + 1; printf("%lld in base 2: %s\n", x, to_base(x, 2)); x = 383; printf("%lld in base 16: %s\n", x, to_base(x, 16)); return 0; }
public static long backToTen(String num, int oldBase){ return Long.parseLong(num, oldBase); } public static String tenToBase(long num, int newBase){ return Long.toString(num, newBase); }
Preserve the algorithm and functionality while converting the code from C to Java.
#include <sys/types.h> #include <sys/stat.h> #include <unistd.h> #include <dirent.h> #include <regex.h> #include <stdio.h> #include <string.h> #include <errno.h> #include <err.h> enum { WALK_OK = 0, WALK_BADPATTERN, WALK_NAMETOOLONG, WALK_BADIO, }; #define WS_NONE 0 #define WS_RECURSIVE (1 << 0) #define WS_DEFAULT WS_RECURSIVE #define WS_FOLLOWLINK (1 << 1) #define WS_DOTFILES (1 << 2) #define WS_MATCHDIRS (1 << 3) int walk_recur(char *dname, regex_t *reg, int spec) { struct dirent *dent; DIR *dir; struct stat st; char fn[FILENAME_MAX]; int res = WALK_OK; int len = strlen(dname); if (len >= FILENAME_MAX - 1) return WALK_NAMETOOLONG; strcpy(fn, dname); fn[len++] = '/'; if (!(dir = opendir(dname))) { warn("can't open %s", dname); return WALK_BADIO; } errno = 0; while ((dent = readdir(dir))) { if (!(spec & WS_DOTFILES) && dent->d_name[0] == '.') continue; if (!strcmp(dent->d_name, ".") || !strcmp(dent->d_name, "..")) continue; strncpy(fn + len, dent->d_name, FILENAME_MAX - len); if (lstat(fn, &st) == -1) { warn("Can't stat %s", fn); res = WALK_BADIO; continue; } if (S_ISLNK(st.st_mode) && !(spec & WS_FOLLOWLINK)) continue; if (S_ISDIR(st.st_mode)) { if ((spec & WS_RECURSIVE)) walk_recur(fn, reg, spec); if (!(spec & WS_MATCHDIRS)) continue; } if (!regexec(reg, fn, 0, 0, 0)) puts(fn); } if (dir) closedir(dir); return res ? res : errno ? WALK_BADIO : WALK_OK; } int walk_dir(char *dname, char *pattern, int spec) { regex_t r; int res; if (regcomp(&r, pattern, REG_EXTENDED | REG_NOSUB)) return WALK_BADPATTERN; res = walk_recur(dname, &r, spec); regfree(&r); return res; } int main() { int r = walk_dir(".", ".\\.c$", WS_DEFAULT|WS_MATCHDIRS); switch(r) { case WALK_OK: break; case WALK_BADIO: err(1, "IO error"); case WALK_BADPATTERN: err(1, "Bad pattern"); case WALK_NAMETOOLONG: err(1, "Filename too long"); default: err(1, "Unknown error?"); } return 0; }
import java.io.File; public class MainEntry { public static void main(String[] args) { walkin(new File("/home/user")); } public static void walkin(File dir) { String pattern = ".mp3"; File listFile[] = dir.listFiles(); if (listFile != null) { for (int i=0; i<listFile.length; i++) { if (listFile[i].isDirectory()) { walkin(listFile[i]); } else { if (listFile[i].getName().endsWith(pattern)) { System.out.println(listFile[i].getPath()); } } } } } }
Translate this program into Java but keep the logic exactly as in C.
#include <stdio.h> #include <stdlib.h> #include <string.h> #define USE_FAKES 1 const char *states[] = { #if USE_FAKES "New Kory", "Wen Kory", "York New", "Kory New", "New Kory", #endif "Alabama", "Alaska", "Arizona", "Arkansas", "California", "Colorado", "Connecticut", "Delaware", "Florida", "Georgia", "Hawaii", "Idaho", "Illinois", "Indiana", "Iowa", "Kansas", "Kentucky", "Louisiana", "Maine", "Maryland", "Massachusetts", "Michigan", "Minnesota", "Mississippi", "Missouri", "Montana", "Nebraska", "Nevada", "New Hampshire", "New Jersey", "New Mexico", "New York", "North Carolina", "North Dakota", "Ohio", "Oklahoma", "Oregon", "Pennsylvania", "Rhode Island", "South Carolina", "South Dakota", "Tennessee", "Texas", "Utah", "Vermont", "Virginia", "Washington", "West Virginia", "Wisconsin", "Wyoming" }; int n_states = sizeof(states)/sizeof(*states); typedef struct { unsigned char c[26]; const char *name[2]; } letters; void count_letters(letters *l, const char *s) { int c; if (!l->name[0]) l->name[0] = s; else l->name[1] = s; while ((c = *s++)) { if (c >= 'a' && c <= 'z') l->c[c - 'a']++; if (c >= 'A' && c <= 'Z') l->c[c - 'A']++; } } int lcmp(const void *aa, const void *bb) { int i; const letters *a = aa, *b = bb; for (i = 0; i < 26; i++) if (a->c[i] > b->c[i]) return 1; else if (a->c[i] < b->c[i]) return -1; return 0; } int scmp(const void *a, const void *b) { return strcmp(*(const char *const *)a, *(const char *const *)b); } void no_dup() { int i, j; qsort(states, n_states, sizeof(const char*), scmp); for (i = j = 0; i < n_states;) { while (++i < n_states && !strcmp(states[i], states[j])); if (i < n_states) states[++j] = states[i]; } n_states = j + 1; } void find_mix() { int i, j, n; letters *l, *p; no_dup(); n = n_states * (n_states - 1) / 2; p = l = calloc(n, sizeof(letters)); for (i = 0; i < n_states; i++) for (j = i + 1; j < n_states; j++, p++) { count_letters(p, states[i]); count_letters(p, states[j]); } qsort(l, n, sizeof(letters), lcmp); for (j = 0; j < n; j++) { for (i = j + 1; i < n && !lcmp(l + j, l + i); i++) { if (l[j].name[0] == l[i].name[0] || l[j].name[1] == l[i].name[0] || l[j].name[1] == l[i].name[1]) continue; printf("%s + %s => %s + %s\n", l[j].name[0], l[j].name[1], l[i].name[0], l[i].name[1]); } } free(l); } int main(void) { find_mix(); return 0; }
import java.util.*; import java.util.stream.*; public class StateNamePuzzle { static String[] states = {"Alabama", "Alaska", "Arizona", "Arkansas", "California", "Colorado", "Connecticut", "Delaware", "Florida", "Georgia", "hawaii", "Hawaii", "Idaho", "Illinois", "Indiana", "Iowa", "Kansas", "Kentucky", "Louisiana", "Maine", "Maryland", "Massachusetts", "Michigan", "Minnesota", "Mississippi", "Missouri", "Montana", "Nebraska", "Nevada", "New Hampshire", "New Jersey", "New Mexico", "New York", "North Carolina ", "North Dakota", "Ohio", "Oklahoma", "Oregon", "Pennsylvania", "Rhode Island", "South Carolina", "South Dakota", "Tennessee", "Texas", "Utah", "Vermont", "Virginia", "Washington", "West Virginia", "Wisconsin", "Wyoming", "New Kory", "Wen Kory", "York New", "Kory New", "New Kory",}; public static void main(String[] args) { solve(Arrays.asList(states)); } static void solve(List<String> input) { Map<String, String> orig = input.stream().collect(Collectors.toMap( s -> s.replaceAll("\\s", "").toLowerCase(), s -> s, (s, a) -> s)); input = new ArrayList<>(orig.keySet()); Map<String, List<String[]>> map = new HashMap<>(); for (int i = 0; i < input.size() - 1; i++) { String pair0 = input.get(i); for (int j = i + 1; j < input.size(); j++) { String[] pair = {pair0, input.get(j)}; String s = pair0 + pair[1]; String key = Arrays.toString(s.chars().sorted().toArray()); List<String[]> val = map.getOrDefault(key, new ArrayList<>()); val.add(pair); map.put(key, val); } } map.forEach((key, list) -> { for (int i = 0; i < list.size() - 1; i++) { String[] a = list.get(i); for (int j = i + 1; j < list.size(); j++) { String[] b = list.get(j); if (Stream.of(a[0], a[1], b[0], b[1]).distinct().count() < 4) continue; System.out.printf("%s + %s = %s + %s %n", orig.get(a[0]), orig.get(a[1]), orig.get(b[0]), orig.get(b[1])); } } }); } }
Produce a language-to-language conversion: from C to Java, same semantics.
#include <stdio.h> #include <string.h> #include <zlib.h> int main() { const char *s = "The quick brown fox jumps over the lazy dog"; printf("%lX\n", crc32(0, (const void*)s, strlen(s))); return 0; }
import java.util.zip.* ; public class CRCMaker { public static void main( String[ ] args ) { String toBeEncoded = new String( "The quick brown fox jumps over the lazy dog" ) ; CRC32 myCRC = new CRC32( ) ; myCRC.update( toBeEncoded.getBytes( ) ) ; System.out.println( "The CRC-32 value is : " + Long.toHexString( myCRC.getValue( ) ) + " !" ) ; } }
Please provide an equivalent version of this C code in Java.
#include <stdio.h> const char *input = "Character,Speech\n" "The multitude,The messiah! Show us the messiah!\n" "Brians mother,<angry>Now you listen here! He's not the messiah; " "he's a very naughty boy! Now go away!</angry>\n" "The multitude,Who are you?\n" "Brians mother,I'm his mother; that's who!\n" "The multitude,Behold his mother! Behold his mother!"; int main() { const char *s; printf("<table>\n<tr><td>"); for (s = input; *s; s++) { switch(*s) { case '\n': printf("</td></tr>\n<tr><td>"); break; case ',': printf("</td><td>"); break; case '<': printf("&lt;"); break; case '>': printf("&gt;"); break; case '&': printf("&amp;"); break; default: putchar(*s); } } puts("</td></tr>\n</table>"); return 0; }
grammar csv2html; dialog : {System.out.println("<HTML><Table>");}header body+{System.out.println("</Table></HTML>");} ; header : {System.out.println("<THEAD align=\"center\"><TR bgcolor=\"blue\">");}row{System.out.println("</TR></THEAD");}; body : {System.out.println("<TBODY><TR>");}row{System.out.println("</TR></TBODY");}; row : field ',' field '\r'? '\n'; field : Field{System.out.println("<TD>" + $Field.text.replace("<","&lt;").replace(">","&gt;") + "</TD>");}; Field : ~[,\n\r]+;
Translate this program into Java but keep the logic exactly as in C.
#include <stdio.h> const char *input = "Character,Speech\n" "The multitude,The messiah! Show us the messiah!\n" "Brians mother,<angry>Now you listen here! He's not the messiah; " "he's a very naughty boy! Now go away!</angry>\n" "The multitude,Who are you?\n" "Brians mother,I'm his mother; that's who!\n" "The multitude,Behold his mother! Behold his mother!"; int main() { const char *s; printf("<table>\n<tr><td>"); for (s = input; *s; s++) { switch(*s) { case '\n': printf("</td></tr>\n<tr><td>"); break; case ',': printf("</td><td>"); break; case '<': printf("&lt;"); break; case '>': printf("&gt;"); break; case '&': printf("&amp;"); break; default: putchar(*s); } } puts("</td></tr>\n</table>"); return 0; }
grammar csv2html; dialog : {System.out.println("<HTML><Table>");}header body+{System.out.println("</Table></HTML>");} ; header : {System.out.println("<THEAD align=\"center\"><TR bgcolor=\"blue\">");}row{System.out.println("</TR></THEAD");}; body : {System.out.println("<TBODY><TR>");}row{System.out.println("</TR></TBODY");}; row : field ',' field '\r'? '\n'; field : Field{System.out.println("<TD>" + $Field.text.replace("<","&lt;").replace(">","&gt;") + "</TD>");}; Field : ~[,\n\r]+;
Preserve the algorithm and functionality while converting the code from C to Java.
#include <stdlib.h> typedef struct sMyClass { int variable; } *MyClass; MyClass MyClass_new() { MyClass pthis = malloc(sizeof *pthis); pthis->variable = 0; return pthis; } void MyClass_delete(MyClass* pthis) { if (pthis) { free(*pthis); *pthis = NULL; } } void MyClass_someMethod(MyClass pthis) { pthis->variable = 1; } MyClass obj = MyClass_new(); MyClass_someMethod(obj); MyClass_delete(&obj);
public class MyClass{ private int variable; public MyClass(){ } public void someMethod(){ this.variable = 1; } }
Generate an equivalent Java version of this C code.
#include <stdio.h> #include <stdint.h> typedef uint64_t ulong; int kaprekar(ulong n, int base) { ulong nn = n * n, r, tens = 1; if ((nn - n) % (base - 1)) return 0; while (tens < n) tens *= base; if (n == tens) return 1 == n; while ((r = nn % tens) < n) { if (nn / tens + r == n) return tens; tens *= base; } return 0; } void print_num(ulong n, int base) { ulong q, div = base; while (div < n) div *= base; while (n && (div /= base)) { q = n / div; if (q < 10) putchar(q + '0'); else putchar(q + 'a' - 10); n -= q * div; } } int main() { ulong i, tens; int cnt = 0; int base = 10; printf("base 10:\n"); for (i = 1; i < 1000000; i++) if (kaprekar(i, base)) printf("%3d: %llu\n", ++cnt, i); base = 17; printf("\nbase %d:\n 1: 1\n", base); for (i = 2, cnt = 1; i < 1000000; i++) if ((tens = kaprekar(i, base))) { printf("%3d: %llu", ++cnt, i); printf(" \t"); print_num(i, base); printf("\t"); print_num(i * i, base); printf("\t"); print_num(i * i / tens, base); printf(" + "); print_num(i * i % tens, base); printf("\n"); } return 0; }
public class Kaprekar { private static String[] splitAt(String str, int idx){ String[] ans = new String[2]; ans[0] = str.substring(0, idx); if(ans[0].equals("")) ans[0] = "0"; ans[1] = str.substring(idx); return ans; } public static void main(String[] args){ int count = 0; int base = (args.length > 0) ? Integer.parseInt(args[0]) : 10; for(long i = 1; i <= 1000000; i++){ String sqrStr = Long.toString(i * i, base); for(int j = 0; j < sqrStr.length() / 2 + 1; j++){ String[] parts = splitAt(sqrStr, j); long firstNum = Long.parseLong(parts[0], base); long secNum = Long.parseLong(parts[1], base); if(secNum == 0) break; if(firstNum + secNum == i){ System.out.println(i + "\t" + Long.toString(i, base) + "\t" + sqrStr + "\t" + parts[0] + " + " + parts[1]); count++; break; } } } System.out.println(count + " Kaprekar numbers < 1000000 (base 10) in base "+base); } }
Change the following C code into Java without altering its purpose.
#include <stdio.h> #include <stdint.h> typedef uint64_t ulong; int kaprekar(ulong n, int base) { ulong nn = n * n, r, tens = 1; if ((nn - n) % (base - 1)) return 0; while (tens < n) tens *= base; if (n == tens) return 1 == n; while ((r = nn % tens) < n) { if (nn / tens + r == n) return tens; tens *= base; } return 0; } void print_num(ulong n, int base) { ulong q, div = base; while (div < n) div *= base; while (n && (div /= base)) { q = n / div; if (q < 10) putchar(q + '0'); else putchar(q + 'a' - 10); n -= q * div; } } int main() { ulong i, tens; int cnt = 0; int base = 10; printf("base 10:\n"); for (i = 1; i < 1000000; i++) if (kaprekar(i, base)) printf("%3d: %llu\n", ++cnt, i); base = 17; printf("\nbase %d:\n 1: 1\n", base); for (i = 2, cnt = 1; i < 1000000; i++) if ((tens = kaprekar(i, base))) { printf("%3d: %llu", ++cnt, i); printf(" \t"); print_num(i, base); printf("\t"); print_num(i * i, base); printf("\t"); print_num(i * i / tens, base); printf(" + "); print_num(i * i % tens, base); printf("\n"); } return 0; }
public class Kaprekar { private static String[] splitAt(String str, int idx){ String[] ans = new String[2]; ans[0] = str.substring(0, idx); if(ans[0].equals("")) ans[0] = "0"; ans[1] = str.substring(idx); return ans; } public static void main(String[] args){ int count = 0; int base = (args.length > 0) ? Integer.parseInt(args[0]) : 10; for(long i = 1; i <= 1000000; i++){ String sqrStr = Long.toString(i * i, base); for(int j = 0; j < sqrStr.length() / 2 + 1; j++){ String[] parts = splitAt(sqrStr, j); long firstNum = Long.parseLong(parts[0], base); long secNum = Long.parseLong(parts[1], base); if(secNum == 0) break; if(firstNum + secNum == i){ System.out.println(i + "\t" + Long.toString(i, base) + "\t" + sqrStr + "\t" + parts[0] + " + " + parts[1]); count++; break; } } } System.out.println(count + " Kaprekar numbers < 1000000 (base 10) in base "+base); } }
Please provide an equivalent version of this C code in Java.
#include <stdio.h> #include <stdlib.h> #include <string.h> #include <stdint.h> #include <unistd.h> #include <fcntl.h> #include <sys/types.h> #include <sys/stat.h> void* mem_alloc(size_t item_size, size_t n_item) { size_t *x = calloc(1, sizeof(size_t)*2 + n_item * item_size); x[0] = item_size; x[1] = n_item; return x + 2; } void* mem_extend(void *m, size_t new_n) { size_t *x = (size_t*)m - 2; x = realloc(x, sizeof(size_t) * 2 + *x * new_n); if (new_n > x[1]) memset((char*)(x + 2) + x[0] * x[1], 0, x[0] * (new_n - x[1])); x[1] = new_n; return x + 2; } inline void _clear(void *m) { size_t *x = (size_t*)m - 2; memset(m, 0, x[0] * x[1]); } #define _new(type, n) mem_alloc(sizeof(type), n) #define _del(m) { free((size_t*)(m) - 2); m = 0; } #define _len(m) *((size_t*)m - 1) #define _setsize(m, n) m = mem_extend(m, n) #define _extend(m) m = mem_extend(m, _len(m) * 2) typedef uint8_t byte; typedef uint16_t ushort; #define M_CLR 256 #define M_EOD 257 #define M_NEW 258 typedef struct { ushort next[256]; } lzw_enc_t; typedef struct { ushort prev, back; byte c; } lzw_dec_t; byte* lzw_encode(byte *in, int max_bits) { int len = _len(in), bits = 9, next_shift = 512; ushort code, c, nc, next_code = M_NEW; lzw_enc_t *d = _new(lzw_enc_t, 512); if (max_bits > 15) max_bits = 15; if (max_bits < 9 ) max_bits = 12; byte *out = _new(ushort, 4); int out_len = 0, o_bits = 0; uint32_t tmp = 0; inline void write_bits(ushort x) { tmp = (tmp << bits) | x; o_bits += bits; if (_len(out) <= out_len) _extend(out); while (o_bits >= 8) { o_bits -= 8; out[out_len++] = tmp >> o_bits; tmp &= (1 << o_bits) - 1; } } for (code = *(in++); --len; ) { c = *(in++); if ((nc = d[code].next[c])) code = nc; else { write_bits(code); nc = d[code].next[c] = next_code++; code = c; } if (next_code == next_shift) { if (++bits > max_bits) { write_bits(M_CLR); bits = 9; next_shift = 512; next_code = M_NEW; _clear(d); } else _setsize(d, next_shift *= 2); } } write_bits(code); write_bits(M_EOD); if (tmp) write_bits(tmp); _del(d); _setsize(out, out_len); return out; } byte* lzw_decode(byte *in) { byte *out = _new(byte, 4); int out_len = 0; inline void write_out(byte c) { while (out_len >= _len(out)) _extend(out); out[out_len++] = c; } lzw_dec_t *d = _new(lzw_dec_t, 512); int len, j, next_shift = 512, bits = 9, n_bits = 0; ushort code, c, t, next_code = M_NEW; uint32_t tmp = 0; inline void get_code() { while(n_bits < bits) { if (len > 0) { len --; tmp = (tmp << 8) | *(in++); n_bits += 8; } else { tmp = tmp << (bits - n_bits); n_bits = bits; } } n_bits -= bits; code = tmp >> n_bits; tmp &= (1 << n_bits) - 1; } inline void clear_table() { _clear(d); for (j = 0; j < 256; j++) d[j].c = j; next_code = M_NEW; next_shift = 512; bits = 9; }; clear_table(); for (len = _len(in); len;) { get_code(); if (code == M_EOD) break; if (code == M_CLR) { clear_table(); continue; } if (code >= next_code) { fprintf(stderr, "Bad sequence\n"); _del(out); goto bail; } d[next_code].prev = c = code; while (c > 255) { t = d[c].prev; d[t].back = c; c = t; } d[next_code - 1].c = c; while (d[c].back) { write_out(d[c].c); t = d[c].back; d[c].back = 0; c = t; } write_out(d[c].c); if (++next_code >= next_shift) { if (++bits > 16) { fprintf(stderr, "Too many bits\n"); _del(out); goto bail; } _setsize(d, next_shift *= 2); } } if (code != M_EOD) fputs("Bits did not end in EOD\n", stderr); _setsize(out, out_len); bail: _del(d); return out; } int main() { int i, fd = open("unixdict.txt", O_RDONLY); if (fd == -1) { fprintf(stderr, "Can't read file\n"); return 1; }; struct stat st; fstat(fd, &st); byte *in = _new(char, st.st_size); read(fd, in, st.st_size); _setsize(in, st.st_size); close(fd); printf("input size: %d\n", _len(in)); byte *enc = lzw_encode(in, 9); printf("encoded size: %d\n", _len(enc)); byte *dec = lzw_decode(enc); printf("decoded size: %d\n", _len(dec)); for (i = 0; i < _len(dec); i++) if (dec[i] != in[i]) { printf("bad decode at %d\n", i); break; } if (i == _len(dec)) printf("Decoded ok\n"); _del(in); _del(enc); _del(dec); return 0; }
import java.util.*; public class LZW { public static List<Integer> compress(String uncompressed) { int dictSize = 256; Map<String,Integer> dictionary = new HashMap<String,Integer>(); for (int i = 0; i < 256; i++) dictionary.put("" + (char)i, i); String w = ""; List<Integer> result = new ArrayList<Integer>(); for (char c : uncompressed.toCharArray()) { String wc = w + c; if (dictionary.containsKey(wc)) w = wc; else { result.add(dictionary.get(w)); dictionary.put(wc, dictSize++); w = "" + c; } } if (!w.equals("")) result.add(dictionary.get(w)); return result; } public static String decompress(List<Integer> compressed) { int dictSize = 256; Map<Integer,String> dictionary = new HashMap<Integer,String>(); for (int i = 0; i < 256; i++) dictionary.put(i, "" + (char)i); String w = "" + (char)(int)compressed.remove(0); StringBuffer result = new StringBuffer(w); for (int k : compressed) { String entry; if (dictionary.containsKey(k)) entry = dictionary.get(k); else if (k == dictSize) entry = w + w.charAt(0); else throw new IllegalArgumentException("Bad compressed k: " + k); result.append(entry); dictionary.put(dictSize++, w + entry.charAt(0)); w = entry; } return result.toString(); } public static void main(String[] args) { List<Integer> compressed = compress("TOBEORNOTTOBEORTOBEORNOT"); System.out.println(compressed); String decompressed = decompress(compressed); System.out.println(decompressed); } }
Generate an equivalent Java version of this C code.
#include <stdio.h> #include <stdlib.h> typedef unsigned long long xint; typedef struct { size_t len, alloc; xint *buf; } xarray; xarray rs, ss; void setsize(xarray *a, size_t size) { size_t n = a->alloc; if (!n) n = 1; while (n < size) n <<= 1; if (a->alloc < n) { a->buf = realloc(a->buf, sizeof(xint) * n); if (!a->buf) abort(); a->alloc = n; } } void push(xarray *a, xint v) { while (a->alloc <= a->len) setsize(a, a->alloc * 2); a->buf[a->len++] = v; } void RS_append(void); xint R(int n) { while (n > rs.len) RS_append(); return rs.buf[n - 1]; } xint S(int n) { while (n > ss.len) RS_append(); return ss.buf[n - 1]; } void RS_append() { int n = rs.len; xint r = R(n) + S(n); xint s = S(ss.len); push(&rs, r); while (++s < r) push(&ss, s); push(&ss, r + 1); } int main(void) { push(&rs, 1); push(&ss, 2); int i; printf("R(1 .. 10):"); for (i = 1; i <= 10; i++) printf(" %llu", R(i)); char seen[1001] = { 0 }; for (i = 1; i <= 40; i++) seen[ R(i) ] = 1; for (i = 1; i <= 960; i++) seen[ S(i) ] = 1; for (i = 1; i <= 1000 && seen[i]; i++); if (i <= 1000) { fprintf(stderr, "%d not seen\n", i); abort(); } puts("\nfirst 1000 ok"); return 0; }
import java.util.*; class Hofstadter { private static List<Integer> getSequence(int rlistSize, int slistSize) { List<Integer> rlist = new ArrayList<Integer>(); List<Integer> slist = new ArrayList<Integer>(); Collections.addAll(rlist, 1, 3, 7); Collections.addAll(slist, 2, 4, 5, 6); List<Integer> list = (rlistSize > 0) ? rlist : slist; int targetSize = (rlistSize > 0) ? rlistSize : slistSize; while (list.size() > targetSize) list.remove(list.size() - 1); while (list.size() < targetSize) { int lastIndex = rlist.size() - 1; int lastr = rlist.get(lastIndex).intValue(); int r = lastr + slist.get(lastIndex).intValue(); rlist.add(Integer.valueOf(r)); for (int s = lastr + 1; (s < r) && (list.size() < targetSize); s++) slist.add(Integer.valueOf(s)); } return list; } public static int ffr(int n) { return getSequence(n, 0).get(n - 1).intValue(); } public static int ffs(int n) { return getSequence(0, n).get(n - 1).intValue(); } public static void main(String[] args) { System.out.print("R():"); for (int n = 1; n <= 10; n++) System.out.print(" " + ffr(n)); System.out.println(); Set<Integer> first40R = new HashSet<Integer>(); for (int n = 1; n <= 40; n++) first40R.add(Integer.valueOf(ffr(n))); Set<Integer> first960S = new HashSet<Integer>(); for (int n = 1; n <= 960; n++) first960S.add(Integer.valueOf(ffs(n))); for (int i = 1; i <= 1000; i++) { Integer n = Integer.valueOf(i); if (first40R.contains(n) == first960S.contains(n)) System.out.println("Integer " + i + " either in both or neither set"); } System.out.println("Done"); } }
Write the same algorithm in Java as shown in this C implementation.
#include <stdio.h> #include <stdlib.h> typedef unsigned long long xint; typedef struct { size_t len, alloc; xint *buf; } xarray; xarray rs, ss; void setsize(xarray *a, size_t size) { size_t n = a->alloc; if (!n) n = 1; while (n < size) n <<= 1; if (a->alloc < n) { a->buf = realloc(a->buf, sizeof(xint) * n); if (!a->buf) abort(); a->alloc = n; } } void push(xarray *a, xint v) { while (a->alloc <= a->len) setsize(a, a->alloc * 2); a->buf[a->len++] = v; } void RS_append(void); xint R(int n) { while (n > rs.len) RS_append(); return rs.buf[n - 1]; } xint S(int n) { while (n > ss.len) RS_append(); return ss.buf[n - 1]; } void RS_append() { int n = rs.len; xint r = R(n) + S(n); xint s = S(ss.len); push(&rs, r); while (++s < r) push(&ss, s); push(&ss, r + 1); } int main(void) { push(&rs, 1); push(&ss, 2); int i; printf("R(1 .. 10):"); for (i = 1; i <= 10; i++) printf(" %llu", R(i)); char seen[1001] = { 0 }; for (i = 1; i <= 40; i++) seen[ R(i) ] = 1; for (i = 1; i <= 960; i++) seen[ S(i) ] = 1; for (i = 1; i <= 1000 && seen[i]; i++); if (i <= 1000) { fprintf(stderr, "%d not seen\n", i); abort(); } puts("\nfirst 1000 ok"); return 0; }
import java.util.*; class Hofstadter { private static List<Integer> getSequence(int rlistSize, int slistSize) { List<Integer> rlist = new ArrayList<Integer>(); List<Integer> slist = new ArrayList<Integer>(); Collections.addAll(rlist, 1, 3, 7); Collections.addAll(slist, 2, 4, 5, 6); List<Integer> list = (rlistSize > 0) ? rlist : slist; int targetSize = (rlistSize > 0) ? rlistSize : slistSize; while (list.size() > targetSize) list.remove(list.size() - 1); while (list.size() < targetSize) { int lastIndex = rlist.size() - 1; int lastr = rlist.get(lastIndex).intValue(); int r = lastr + slist.get(lastIndex).intValue(); rlist.add(Integer.valueOf(r)); for (int s = lastr + 1; (s < r) && (list.size() < targetSize); s++) slist.add(Integer.valueOf(s)); } return list; } public static int ffr(int n) { return getSequence(n, 0).get(n - 1).intValue(); } public static int ffs(int n) { return getSequence(0, n).get(n - 1).intValue(); } public static void main(String[] args) { System.out.print("R():"); for (int n = 1; n <= 10; n++) System.out.print(" " + ffr(n)); System.out.println(); Set<Integer> first40R = new HashSet<Integer>(); for (int n = 1; n <= 40; n++) first40R.add(Integer.valueOf(ffr(n))); Set<Integer> first960S = new HashSet<Integer>(); for (int n = 1; n <= 960; n++) first960S.add(Integer.valueOf(ffs(n))); for (int i = 1; i <= 1000; i++) { Integer n = Integer.valueOf(i); if (first40R.contains(n) == first960S.contains(n)) System.out.println("Integer " + i + " either in both or neither set"); } System.out.println("Done"); } }
Change the programming language of this snippet from C to Java without modifying what it does.
#include <stdio.h> #include <stdlib.h> int f(int n, int x, int y) { return (x + y*2 + 1)%n; } int main(int argc, char **argv) { int i, j, n; if(argc!=2) return 1; n = atoi(argv[1]); if (n < 3 || (n%2) == 0) return 2; for (i = 0; i < n; i++) { for (j = 0; j < n; j++) printf("% 4d", f(n, n - j - 1, i)*n + f(n, j, i) + 1); putchar('\n'); } printf("\n Magic Constant: %d.\n", (n*n+1)/2*n); return 0; }
public class MagicSquare { public static void main(String[] args) { int n = 5; for (int[] row : magicSquareOdd(n)) { for (int x : row) System.out.format("%2s ", x); System.out.println(); } System.out.printf("\nMagic constant: %d ", (n * n + 1) * n / 2); } public static int[][] magicSquareOdd(final int base) { if (base % 2 == 0 || base < 3) throw new IllegalArgumentException("base must be odd and > 2"); int[][] grid = new int[base][base]; int r = 0, number = 0; int size = base * base; int c = base / 2; while (number++ < size) { grid[r][c] = number; if (r == 0) { if (c == base - 1) { r++; } else { r = base - 1; c++; } } else { if (c == base - 1) { r--; c = 0; } else { if (grid[r - 1][c + 1] == 0) { r--; c++; } else { r++; } } } } return grid; } }
Change the following C code into Java without altering its purpose.
#include <stdio.h> #include <stdlib.h> int f(int n, int x, int y) { return (x + y*2 + 1)%n; } int main(int argc, char **argv) { int i, j, n; if(argc!=2) return 1; n = atoi(argv[1]); if (n < 3 || (n%2) == 0) return 2; for (i = 0; i < n; i++) { for (j = 0; j < n; j++) printf("% 4d", f(n, n - j - 1, i)*n + f(n, j, i) + 1); putchar('\n'); } printf("\n Magic Constant: %d.\n", (n*n+1)/2*n); return 0; }
public class MagicSquare { public static void main(String[] args) { int n = 5; for (int[] row : magicSquareOdd(n)) { for (int x : row) System.out.format("%2s ", x); System.out.println(); } System.out.printf("\nMagic constant: %d ", (n * n + 1) * n / 2); } public static int[][] magicSquareOdd(final int base) { if (base % 2 == 0 || base < 3) throw new IllegalArgumentException("base must be odd and > 2"); int[][] grid = new int[base][base]; int r = 0, number = 0; int size = base * base; int c = base / 2; while (number++ < size) { grid[r][c] = number; if (r == 0) { if (c == base - 1) { r++; } else { r = base - 1; c++; } } else { if (c == base - 1) { r--; c = 0; } else { if (grid[r - 1][c + 1] == 0) { r--; c++; } else { r++; } } } } return grid; } }
Translate this program into Java but keep the logic exactly as in C.
#include <stdbool.h> #include <stdio.h> #include <stdlib.h> typedef struct lnode_t { struct lnode_t *prev; struct lnode_t *next; int v; } Lnode; Lnode *make_list_node(int v) { Lnode *node = malloc(sizeof(Lnode)); if (node == NULL) { return NULL; } node->v = v; node->prev = NULL; node->next = NULL; return node; } void free_lnode(Lnode *node) { if (node == NULL) { return; } node->v = 0; node->prev = NULL; free_lnode(node->next); node->next = NULL; } typedef struct list_t { Lnode *front; Lnode *back; size_t len; } List; List *make_list() { List *list = malloc(sizeof(List)); if (list == NULL) { return NULL; } list->front = NULL; list->back = NULL; list->len = 0; return list; } void free_list(List *list) { if (list == NULL) { return; } list->len = 0; list->back = NULL; free_lnode(list->front); list->front = NULL; } void list_insert(List *list, int v) { Lnode *node; if (list == NULL) { return; } node = make_list_node(v); if (list->front == NULL) { list->front = node; list->back = node; list->len = 1; } else { node->prev = list->back; list->back->next = node; list->back = node; list->len++; } } void list_print(List *list) { Lnode *it; if (list == NULL) { return; } for (it = list->front; it != NULL; it = it->next) { printf("%d ", it->v); } } int list_get(List *list, int idx) { Lnode *it = NULL; if (list != NULL && list->front != NULL) { int i; if (idx < 0) { it = list->back; i = -1; while (it != NULL && i > idx) { it = it->prev; i--; } } else { it = list->front; i = 0; while (it != NULL && i < idx) { it = it->next; i++; } } } if (it == NULL) { return INT_MIN; } return it->v; } typedef struct mnode_t { int k; bool v; struct mnode_t *next; } Mnode; Mnode *make_map_node(int k, bool v) { Mnode *node = malloc(sizeof(Mnode)); if (node == NULL) { return node; } node->k = k; node->v = v; node->next = NULL; return node; } void free_mnode(Mnode *node) { if (node == NULL) { return; } node->k = 0; node->v = false; free_mnode(node->next); node->next = NULL; } typedef struct map_t { Mnode *front; } Map; Map *make_map() { Map *map = malloc(sizeof(Map)); if (map == NULL) { return NULL; } map->front = NULL; return map; } void free_map(Map *map) { if (map == NULL) { return; } free_mnode(map->front); map->front = NULL; } void map_insert(Map *map, int k, bool v) { if (map == NULL) { return; } if (map->front == NULL) { map->front = make_map_node(k, v); } else { Mnode *it = map->front; while (it->next != NULL) { it = it->next; } it->next = make_map_node(k, v); } } bool map_get(Map *map, int k) { if (map != NULL) { Mnode *it = map->front; while (it != NULL && it->k != k) { it = it->next; } if (it != NULL) { return it->v; } } return false; } int gcd(int u, int v) { if (u < 0) u = -u; if (v < 0) v = -v; if (v) { while ((u %= v) && (v %= u)); } return u + v; } List *yellow(size_t n) { List *a; Map *b; int i; a = make_list(); list_insert(a, 1); list_insert(a, 2); list_insert(a, 3); b = make_map(); map_insert(b, 1, true); map_insert(b, 2, true); map_insert(b, 3, true); i = 4; while (n > a->len) { if (!map_get(b, i) && gcd(i, list_get(a, -1)) == 1 && gcd(i, list_get(a, -2)) > 1) { list_insert(a, i); map_insert(b, i, true); i = 4; } i++; } free_map(b); return a; } int main() { List *a = yellow(30); list_print(a); free_list(a); putc('\n', stdout); return 0; }
import java.util.ArrayList; import java.util.List; public class YellowstoneSequence { public static void main(String[] args) { System.out.printf("First 30 values in the yellowstone sequence:%n%s%n", yellowstoneSequence(30)); } private static List<Integer> yellowstoneSequence(int sequenceCount) { List<Integer> yellowstoneList = new ArrayList<Integer>(); yellowstoneList.add(1); yellowstoneList.add(2); yellowstoneList.add(3); int num = 4; List<Integer> notYellowstoneList = new ArrayList<Integer>(); int yellowSize = 3; while ( yellowSize < sequenceCount ) { int found = -1; for ( int index = 0 ; index < notYellowstoneList.size() ; index++ ) { int test = notYellowstoneList.get(index); if ( gcd(yellowstoneList.get(yellowSize-2), test) > 1 && gcd(yellowstoneList.get(yellowSize-1), test) == 1 ) { found = index; break; } } if ( found >= 0 ) { yellowstoneList.add(notYellowstoneList.remove(found)); yellowSize++; } else { while ( true ) { if ( gcd(yellowstoneList.get(yellowSize-2), num) > 1 && gcd(yellowstoneList.get(yellowSize-1), num) == 1 ) { yellowstoneList.add(num); yellowSize++; num++; break; } notYellowstoneList.add(num); num++; } } } return yellowstoneList; } private static final int gcd(int a, int b) { if ( b == 0 ) { return a; } return gcd(b, a%b); } }
Port the following code from C to Java with equivalent syntax and logic.
#include <stdbool.h> #include <stdio.h> #include <stdlib.h> typedef struct lnode_t { struct lnode_t *prev; struct lnode_t *next; int v; } Lnode; Lnode *make_list_node(int v) { Lnode *node = malloc(sizeof(Lnode)); if (node == NULL) { return NULL; } node->v = v; node->prev = NULL; node->next = NULL; return node; } void free_lnode(Lnode *node) { if (node == NULL) { return; } node->v = 0; node->prev = NULL; free_lnode(node->next); node->next = NULL; } typedef struct list_t { Lnode *front; Lnode *back; size_t len; } List; List *make_list() { List *list = malloc(sizeof(List)); if (list == NULL) { return NULL; } list->front = NULL; list->back = NULL; list->len = 0; return list; } void free_list(List *list) { if (list == NULL) { return; } list->len = 0; list->back = NULL; free_lnode(list->front); list->front = NULL; } void list_insert(List *list, int v) { Lnode *node; if (list == NULL) { return; } node = make_list_node(v); if (list->front == NULL) { list->front = node; list->back = node; list->len = 1; } else { node->prev = list->back; list->back->next = node; list->back = node; list->len++; } } void list_print(List *list) { Lnode *it; if (list == NULL) { return; } for (it = list->front; it != NULL; it = it->next) { printf("%d ", it->v); } } int list_get(List *list, int idx) { Lnode *it = NULL; if (list != NULL && list->front != NULL) { int i; if (idx < 0) { it = list->back; i = -1; while (it != NULL && i > idx) { it = it->prev; i--; } } else { it = list->front; i = 0; while (it != NULL && i < idx) { it = it->next; i++; } } } if (it == NULL) { return INT_MIN; } return it->v; } typedef struct mnode_t { int k; bool v; struct mnode_t *next; } Mnode; Mnode *make_map_node(int k, bool v) { Mnode *node = malloc(sizeof(Mnode)); if (node == NULL) { return node; } node->k = k; node->v = v; node->next = NULL; return node; } void free_mnode(Mnode *node) { if (node == NULL) { return; } node->k = 0; node->v = false; free_mnode(node->next); node->next = NULL; } typedef struct map_t { Mnode *front; } Map; Map *make_map() { Map *map = malloc(sizeof(Map)); if (map == NULL) { return NULL; } map->front = NULL; return map; } void free_map(Map *map) { if (map == NULL) { return; } free_mnode(map->front); map->front = NULL; } void map_insert(Map *map, int k, bool v) { if (map == NULL) { return; } if (map->front == NULL) { map->front = make_map_node(k, v); } else { Mnode *it = map->front; while (it->next != NULL) { it = it->next; } it->next = make_map_node(k, v); } } bool map_get(Map *map, int k) { if (map != NULL) { Mnode *it = map->front; while (it != NULL && it->k != k) { it = it->next; } if (it != NULL) { return it->v; } } return false; } int gcd(int u, int v) { if (u < 0) u = -u; if (v < 0) v = -v; if (v) { while ((u %= v) && (v %= u)); } return u + v; } List *yellow(size_t n) { List *a; Map *b; int i; a = make_list(); list_insert(a, 1); list_insert(a, 2); list_insert(a, 3); b = make_map(); map_insert(b, 1, true); map_insert(b, 2, true); map_insert(b, 3, true); i = 4; while (n > a->len) { if (!map_get(b, i) && gcd(i, list_get(a, -1)) == 1 && gcd(i, list_get(a, -2)) > 1) { list_insert(a, i); map_insert(b, i, true); i = 4; } i++; } free_map(b); return a; } int main() { List *a = yellow(30); list_print(a); free_list(a); putc('\n', stdout); return 0; }
import java.util.ArrayList; import java.util.List; public class YellowstoneSequence { public static void main(String[] args) { System.out.printf("First 30 values in the yellowstone sequence:%n%s%n", yellowstoneSequence(30)); } private static List<Integer> yellowstoneSequence(int sequenceCount) { List<Integer> yellowstoneList = new ArrayList<Integer>(); yellowstoneList.add(1); yellowstoneList.add(2); yellowstoneList.add(3); int num = 4; List<Integer> notYellowstoneList = new ArrayList<Integer>(); int yellowSize = 3; while ( yellowSize < sequenceCount ) { int found = -1; for ( int index = 0 ; index < notYellowstoneList.size() ; index++ ) { int test = notYellowstoneList.get(index); if ( gcd(yellowstoneList.get(yellowSize-2), test) > 1 && gcd(yellowstoneList.get(yellowSize-1), test) == 1 ) { found = index; break; } } if ( found >= 0 ) { yellowstoneList.add(notYellowstoneList.remove(found)); yellowSize++; } else { while ( true ) { if ( gcd(yellowstoneList.get(yellowSize-2), num) > 1 && gcd(yellowstoneList.get(yellowSize-1), num) == 1 ) { yellowstoneList.add(num); yellowSize++; num++; break; } notYellowstoneList.add(num); num++; } } } return yellowstoneList; } private static final int gcd(int a, int b) { if ( b == 0 ) { return a; } return gcd(b, a%b); } }
Transform the following C implementation into Java, maintaining the same output and logic.
#include <stdbool.h> #include <stdio.h> #include <stdlib.h> typedef struct lnode_t { struct lnode_t *prev; struct lnode_t *next; int v; } Lnode; Lnode *make_list_node(int v) { Lnode *node = malloc(sizeof(Lnode)); if (node == NULL) { return NULL; } node->v = v; node->prev = NULL; node->next = NULL; return node; } void free_lnode(Lnode *node) { if (node == NULL) { return; } node->v = 0; node->prev = NULL; free_lnode(node->next); node->next = NULL; } typedef struct list_t { Lnode *front; Lnode *back; size_t len; } List; List *make_list() { List *list = malloc(sizeof(List)); if (list == NULL) { return NULL; } list->front = NULL; list->back = NULL; list->len = 0; return list; } void free_list(List *list) { if (list == NULL) { return; } list->len = 0; list->back = NULL; free_lnode(list->front); list->front = NULL; } void list_insert(List *list, int v) { Lnode *node; if (list == NULL) { return; } node = make_list_node(v); if (list->front == NULL) { list->front = node; list->back = node; list->len = 1; } else { node->prev = list->back; list->back->next = node; list->back = node; list->len++; } } void list_print(List *list) { Lnode *it; if (list == NULL) { return; } for (it = list->front; it != NULL; it = it->next) { printf("%d ", it->v); } } int list_get(List *list, int idx) { Lnode *it = NULL; if (list != NULL && list->front != NULL) { int i; if (idx < 0) { it = list->back; i = -1; while (it != NULL && i > idx) { it = it->prev; i--; } } else { it = list->front; i = 0; while (it != NULL && i < idx) { it = it->next; i++; } } } if (it == NULL) { return INT_MIN; } return it->v; } typedef struct mnode_t { int k; bool v; struct mnode_t *next; } Mnode; Mnode *make_map_node(int k, bool v) { Mnode *node = malloc(sizeof(Mnode)); if (node == NULL) { return node; } node->k = k; node->v = v; node->next = NULL; return node; } void free_mnode(Mnode *node) { if (node == NULL) { return; } node->k = 0; node->v = false; free_mnode(node->next); node->next = NULL; } typedef struct map_t { Mnode *front; } Map; Map *make_map() { Map *map = malloc(sizeof(Map)); if (map == NULL) { return NULL; } map->front = NULL; return map; } void free_map(Map *map) { if (map == NULL) { return; } free_mnode(map->front); map->front = NULL; } void map_insert(Map *map, int k, bool v) { if (map == NULL) { return; } if (map->front == NULL) { map->front = make_map_node(k, v); } else { Mnode *it = map->front; while (it->next != NULL) { it = it->next; } it->next = make_map_node(k, v); } } bool map_get(Map *map, int k) { if (map != NULL) { Mnode *it = map->front; while (it != NULL && it->k != k) { it = it->next; } if (it != NULL) { return it->v; } } return false; } int gcd(int u, int v) { if (u < 0) u = -u; if (v < 0) v = -v; if (v) { while ((u %= v) && (v %= u)); } return u + v; } List *yellow(size_t n) { List *a; Map *b; int i; a = make_list(); list_insert(a, 1); list_insert(a, 2); list_insert(a, 3); b = make_map(); map_insert(b, 1, true); map_insert(b, 2, true); map_insert(b, 3, true); i = 4; while (n > a->len) { if (!map_get(b, i) && gcd(i, list_get(a, -1)) == 1 && gcd(i, list_get(a, -2)) > 1) { list_insert(a, i); map_insert(b, i, true); i = 4; } i++; } free_map(b); return a; } int main() { List *a = yellow(30); list_print(a); free_list(a); putc('\n', stdout); return 0; }
import java.util.ArrayList; import java.util.List; public class YellowstoneSequence { public static void main(String[] args) { System.out.printf("First 30 values in the yellowstone sequence:%n%s%n", yellowstoneSequence(30)); } private static List<Integer> yellowstoneSequence(int sequenceCount) { List<Integer> yellowstoneList = new ArrayList<Integer>(); yellowstoneList.add(1); yellowstoneList.add(2); yellowstoneList.add(3); int num = 4; List<Integer> notYellowstoneList = new ArrayList<Integer>(); int yellowSize = 3; while ( yellowSize < sequenceCount ) { int found = -1; for ( int index = 0 ; index < notYellowstoneList.size() ; index++ ) { int test = notYellowstoneList.get(index); if ( gcd(yellowstoneList.get(yellowSize-2), test) > 1 && gcd(yellowstoneList.get(yellowSize-1), test) == 1 ) { found = index; break; } } if ( found >= 0 ) { yellowstoneList.add(notYellowstoneList.remove(found)); yellowSize++; } else { while ( true ) { if ( gcd(yellowstoneList.get(yellowSize-2), num) > 1 && gcd(yellowstoneList.get(yellowSize-1), num) == 1 ) { yellowstoneList.add(num); yellowSize++; num++; break; } notYellowstoneList.add(num); num++; } } } return yellowstoneList; } private static final int gcd(int a, int b) { if ( b == 0 ) { return a; } return gcd(b, a%b); } }
Write the same algorithm in Java as shown in this C implementation.
#include <stdio.h> #include <stdlib.h> #include <string.h> typedef unsigned char byte; byte *grid = 0; int w, h, len; unsigned long long cnt; static int next[4], dir[4][2] = {{0, -1}, {-1, 0}, {0, 1}, {1, 0}}; void walk(int y, int x) { int i, t; if (!y || y == h || !x || x == w) { cnt += 2; return; } t = y * (w + 1) + x; grid[t]++, grid[len - t]++; for (i = 0; i < 4; i++) if (!grid[t + next[i]]) walk(y + dir[i][0], x + dir[i][1]); grid[t]--, grid[len - t]--; } unsigned long long solve(int hh, int ww, int recur) { int t, cx, cy, x; h = hh, w = ww; if (h & 1) t = w, w = h, h = t; if (h & 1) return 0; if (w == 1) return 1; if (w == 2) return h; if (h == 2) return w; cy = h / 2, cx = w / 2; len = (h + 1) * (w + 1); grid = realloc(grid, len); memset(grid, 0, len--); next[0] = -1; next[1] = -w - 1; next[2] = 1; next[3] = w + 1; if (recur) cnt = 0; for (x = cx + 1; x < w; x++) { t = cy * (w + 1) + x; grid[t] = 1; grid[len - t] = 1; walk(cy - 1, x); } cnt++; if (h == w) cnt *= 2; else if (!(w & 1) && recur) solve(w, h, 0); return cnt; } int main() { int y, x; for (y = 1; y <= 10; y++) for (x = 1; x <= y; x++) if (!(x & 1) || !(y & 1)) printf("%d x %d: %llu\n", y, x, solve(y, x, 1)); return 0; }
import java.util.*; public class CutRectangle { private static int[][] dirs = {{0, -1}, {-1, 0}, {0, 1}, {1, 0}}; public static void main(String[] args) { cutRectangle(2, 2); cutRectangle(4, 3); } static void cutRectangle(int w, int h) { if (w % 2 == 1 && h % 2 == 1) return; int[][] grid = new int[h][w]; Stack<Integer> stack = new Stack<>(); int half = (w * h) / 2; long bits = (long) Math.pow(2, half) - 1; for (; bits > 0; bits -= 2) { for (int i = 0; i < half; i++) { int r = i / w; int c = i % w; grid[r][c] = (bits & (1 << i)) != 0 ? 1 : 0; grid[h - r - 1][w - c - 1] = 1 - grid[r][c]; } stack.push(0); grid[0][0] = 2; int count = 1; while (!stack.empty()) { int pos = stack.pop(); int r = pos / w; int c = pos % w; for (int[] dir : dirs) { int nextR = r + dir[0]; int nextC = c + dir[1]; if (nextR >= 0 && nextR < h && nextC >= 0 && nextC < w) { if (grid[nextR][nextC] == 1) { stack.push(nextR * w + nextC); grid[nextR][nextC] = 2; count++; } } } } if (count == half) { printResult(grid); } } } static void printResult(int[][] arr) { for (int[] a : arr) System.out.println(Arrays.toString(a)); System.out.println(); } }
Convert this C snippet to Java and keep its semantics consistent.
#include <stdio.h> #include <stdlib.h> #include <string.h> typedef unsigned char byte; byte *grid = 0; int w, h, len; unsigned long long cnt; static int next[4], dir[4][2] = {{0, -1}, {-1, 0}, {0, 1}, {1, 0}}; void walk(int y, int x) { int i, t; if (!y || y == h || !x || x == w) { cnt += 2; return; } t = y * (w + 1) + x; grid[t]++, grid[len - t]++; for (i = 0; i < 4; i++) if (!grid[t + next[i]]) walk(y + dir[i][0], x + dir[i][1]); grid[t]--, grid[len - t]--; } unsigned long long solve(int hh, int ww, int recur) { int t, cx, cy, x; h = hh, w = ww; if (h & 1) t = w, w = h, h = t; if (h & 1) return 0; if (w == 1) return 1; if (w == 2) return h; if (h == 2) return w; cy = h / 2, cx = w / 2; len = (h + 1) * (w + 1); grid = realloc(grid, len); memset(grid, 0, len--); next[0] = -1; next[1] = -w - 1; next[2] = 1; next[3] = w + 1; if (recur) cnt = 0; for (x = cx + 1; x < w; x++) { t = cy * (w + 1) + x; grid[t] = 1; grid[len - t] = 1; walk(cy - 1, x); } cnt++; if (h == w) cnt *= 2; else if (!(w & 1) && recur) solve(w, h, 0); return cnt; } int main() { int y, x; for (y = 1; y <= 10; y++) for (x = 1; x <= y; x++) if (!(x & 1) || !(y & 1)) printf("%d x %d: %llu\n", y, x, solve(y, x, 1)); return 0; }
import java.util.*; public class CutRectangle { private static int[][] dirs = {{0, -1}, {-1, 0}, {0, 1}, {1, 0}}; public static void main(String[] args) { cutRectangle(2, 2); cutRectangle(4, 3); } static void cutRectangle(int w, int h) { if (w % 2 == 1 && h % 2 == 1) return; int[][] grid = new int[h][w]; Stack<Integer> stack = new Stack<>(); int half = (w * h) / 2; long bits = (long) Math.pow(2, half) - 1; for (; bits > 0; bits -= 2) { for (int i = 0; i < half; i++) { int r = i / w; int c = i % w; grid[r][c] = (bits & (1 << i)) != 0 ? 1 : 0; grid[h - r - 1][w - c - 1] = 1 - grid[r][c]; } stack.push(0); grid[0][0] = 2; int count = 1; while (!stack.empty()) { int pos = stack.pop(); int r = pos / w; int c = pos % w; for (int[] dir : dirs) { int nextR = r + dir[0]; int nextC = c + dir[1]; if (nextR >= 0 && nextR < h && nextC >= 0 && nextC < w) { if (grid[nextR][nextC] == 1) { stack.push(nextR * w + nextC); grid[nextR][nextC] = 2; count++; } } } } if (count == half) { printResult(grid); } } } static void printResult(int[][] arr) { for (int[] a : arr) System.out.println(Arrays.toString(a)); System.out.println(); } }
Translate the given C code snippet into Java without altering its behavior.
#include <stdio.h> #include <stdlib.h> int* mertens_numbers(int max) { int* m = malloc((max + 1) * sizeof(int)); if (m == NULL) return m; m[1] = 1; for (int n = 2; n <= max; ++n) { m[n] = 1; for (int k = 2; k <= n; ++k) m[n] -= m[n/k]; } return m; } int main() { const int max = 1000; int* mertens = mertens_numbers(max); if (mertens == NULL) { fprintf(stderr, "Out of memory\n"); return 1; } printf("First 199 Mertens numbers:\n"); const int count = 200; for (int i = 0, column = 0; i < count; ++i) { if (column > 0) printf(" "); if (i == 0) printf(" "); else printf("%2d", mertens[i]); ++column; if (column == 20) { printf("\n"); column = 0; } } int zero = 0, cross = 0, previous = 0; for (int i = 1; i <= max; ++i) { int m = mertens[i]; if (m == 0) { ++zero; if (previous != 0) ++cross; } previous = m; } free(mertens); printf("M(n) is zero %d times for 1 <= n <= %d.\n", zero, max); printf("M(n) crosses zero %d times for 1 <= n <= %d.\n", cross, max); return 0; }
public class MertensFunction { public static void main(String[] args) { System.out.printf("First 199 terms of the merten function are as follows:%n "); for ( int n = 1 ; n < 200 ; n++ ) { System.out.printf("%2d ", mertenFunction(n)); if ( (n+1) % 20 == 0 ) { System.out.printf("%n"); } } for ( int exponent = 3 ; exponent<= 8 ; exponent++ ) { int zeroCount = 0; int zeroCrossingCount = 0; int positiveCount = 0; int negativeCount = 0; int mSum = 0; int mMin = Integer.MAX_VALUE; int mMinIndex = 0; int mMax = Integer.MIN_VALUE; int mMaxIndex = 0; int nMax = (int) Math.pow(10, exponent); for ( int n = 1 ; n <= nMax ; n++ ) { int m = mertenFunction(n); mSum += m; if ( m < mMin ) { mMin = m; mMinIndex = n; } if ( m > mMax ) { mMax = m; mMaxIndex = n; } if ( m > 0 ) { positiveCount++; } if ( m < 0 ) { negativeCount++; } if ( m == 0 ) { zeroCount++; } if ( m == 0 && mertenFunction(n - 1) != 0 ) { zeroCrossingCount++; } } System.out.printf("%nFor M(x) with x from 1 to %,d%n", nMax); System.out.printf("The maximum of M(x) is M(%,d) = %,d.%n", mMaxIndex, mMax); System.out.printf("The minimum of M(x) is M(%,d) = %,d.%n", mMinIndex, mMin); System.out.printf("The sum of M(x) is %,d.%n", mSum); System.out.printf("The count of positive M(x) is %,d, count of negative M(x) is %,d.%n", positiveCount, negativeCount); System.out.printf("M(x) has %,d zeroes in the interval.%n", zeroCount); System.out.printf("M(x) has %,d crossings in the interval.%n", zeroCrossingCount); } } private static int MU_MAX = 100_000_000; private static int[] MU = null; private static int[] MERTEN = null; private static int mertenFunction(int n) { if ( MERTEN != null ) { return MERTEN[n]; } MU = new int[MU_MAX+1]; MERTEN = new int[MU_MAX+1]; MERTEN[1] = 1; int sqrt = (int) Math.sqrt(MU_MAX); for ( int i = 0 ; i < MU_MAX ; i++ ) { MU[i] = 1; } for ( int i = 2 ; i <= sqrt ; i++ ) { if ( MU[i] == 1 ) { for ( int j = i ; j <= MU_MAX ; j += i ) { MU[j] *= -i; } for ( int j = i*i ; j <= MU_MAX ; j += i*i ) { MU[j] = 0; } } } int sum = 1; for ( int i = 2 ; i <= MU_MAX ; i++ ) { if ( MU[i] == i ) { MU[i] = 1; } else if ( MU[i] == -i ) { MU[i] = -1; } else if ( MU[i] < 0 ) { MU[i] = 1; } else if ( MU[i] > 0 ) { MU[i] = -1; } sum += MU[i]; MERTEN[i] = sum; } return MERTEN[n]; } }
Write the same code in Java as shown below in C.
#include <stdio.h> #include <string.h> #include <stdlib.h> int interactiveCompare(const void *x1, const void *x2) { const char *s1 = *(const char * const *)x1; const char *s2 = *(const char * const *)x2; static int count = 0; printf("(%d) Is %s <, ==, or > %s? Answer -1, 0, or 1: ", ++count, s1, s2); int response; scanf("%d", &response); return response; } void printOrder(const char *items[], int len) { printf("{ "); for (int i = 0; i < len; ++i) printf("%s ", items[i]); printf("}\n"); } int main(void) { const char *items[] = { "violet", "red", "green", "indigo", "blue", "yellow", "orange" }; qsort(items, sizeof(items)/sizeof(*items), sizeof(*items), interactiveCompare); printOrder(items, sizeof(items)/sizeof(*items)); return 0; }
import java.util.*; public class SortComp1 { public static void main(String[] args) { List<String> items = Arrays.asList("violet", "red", "green", "indigo", "blue", "yellow", "orange"); List<String> sortedItems = new ArrayList<>(); Comparator<String> interactiveCompare = new Comparator<String>() { int count = 0; Scanner s = new Scanner(System.in); public int compare(String s1, String s2) { System.out.printf("(%d) Is %s <, =, or > %s. Answer -1, 0, or 1: ", ++count, s1, s2); return s.nextInt(); } }; for (String item : items) { System.out.printf("Inserting '%s' into %s\n", item, sortedItems); int spotToInsert = Collections.binarySearch(sortedItems, item, interactiveCompare); if (spotToInsert < 0) spotToInsert = ~spotToInsert; sortedItems.add(spotToInsert, item); } System.out.println(sortedItems); } }
Change the programming language of this snippet from C to Java without modifying what it does.
#include <stdio.h> #include <string.h> #include <stdlib.h> int interactiveCompare(const void *x1, const void *x2) { const char *s1 = *(const char * const *)x1; const char *s2 = *(const char * const *)x2; static int count = 0; printf("(%d) Is %s <, ==, or > %s? Answer -1, 0, or 1: ", ++count, s1, s2); int response; scanf("%d", &response); return response; } void printOrder(const char *items[], int len) { printf("{ "); for (int i = 0; i < len; ++i) printf("%s ", items[i]); printf("}\n"); } int main(void) { const char *items[] = { "violet", "red", "green", "indigo", "blue", "yellow", "orange" }; qsort(items, sizeof(items)/sizeof(*items), sizeof(*items), interactiveCompare); printOrder(items, sizeof(items)/sizeof(*items)); return 0; }
import java.util.*; public class SortComp1 { public static void main(String[] args) { List<String> items = Arrays.asList("violet", "red", "green", "indigo", "blue", "yellow", "orange"); List<String> sortedItems = new ArrayList<>(); Comparator<String> interactiveCompare = new Comparator<String>() { int count = 0; Scanner s = new Scanner(System.in); public int compare(String s1, String s2) { System.out.printf("(%d) Is %s <, =, or > %s. Answer -1, 0, or 1: ", ++count, s1, s2); return s.nextInt(); } }; for (String item : items) { System.out.printf("Inserting '%s' into %s\n", item, sortedItems); int spotToInsert = Collections.binarySearch(sortedItems, item, interactiveCompare); if (spotToInsert < 0) spotToInsert = ~spotToInsert; sortedItems.add(spotToInsert, item); } System.out.println(sortedItems); } }
Rewrite this program in Java while keeping its functionality equivalent to the C version.
#include <stdio.h> #include <stdlib.h> #include <math.h> float *benford_distribution(void) { static float prob[9]; for (int i = 1; i < 10; i++) prob[i - 1] = log10f(1 + 1.0 / i); return prob; } float *get_actual_distribution(char *fn) { FILE *input = fopen(fn, "r"); if (!input) { perror("Can't open file"); exit(EXIT_FAILURE); } int tally[9] = { 0 }; char c; int total = 0; while ((c = getc(input)) != EOF) { while (c < '1' || c > '9') c = getc(input); tally[c - '1']++; total++; while ((c = getc(input)) != '\n' && c != EOF) ; } fclose(input); static float freq[9]; for (int i = 0; i < 9; i++) freq[i] = tally[i] / (float) total; return freq; } int main(int argc, char **argv) { if (argc != 2) { printf("Usage: benford <file>\n"); return EXIT_FAILURE; } float *actual = get_actual_distribution(argv[1]); float *expected = benford_distribution(); puts("digit\tactual\texpected"); for (int i = 0; i < 9; i++) printf("%d\t%.3f\t%.3f\n", i + 1, actual[i], expected[i]); return EXIT_SUCCESS; }
import java.math.BigInteger; import java.util.Locale; public class BenfordsLaw { private static BigInteger[] generateFibonacci(int n) { BigInteger[] fib = new BigInteger[n]; fib[0] = BigInteger.ONE; fib[1] = BigInteger.ONE; for (int i = 2; i < fib.length; i++) { fib[i] = fib[i - 2].add(fib[i - 1]); } return fib; } public static void main(String[] args) { BigInteger[] numbers = generateFibonacci(1000); int[] firstDigits = new int[10]; for (BigInteger number : numbers) { firstDigits[Integer.valueOf(number.toString().substring(0, 1))]++; } for (int i = 1; i < firstDigits.length; i++) { System.out.printf(Locale.ROOT, "%d %10.6f %10.6f%n", i, (double) firstDigits[i] / numbers.length, Math.log10(1.0 + 1.0 / i)); } } }
Port the provided C code into Java while preserving the original functionality.
#include <stdio.h> #include <stdlib.h> #include <math.h> float *benford_distribution(void) { static float prob[9]; for (int i = 1; i < 10; i++) prob[i - 1] = log10f(1 + 1.0 / i); return prob; } float *get_actual_distribution(char *fn) { FILE *input = fopen(fn, "r"); if (!input) { perror("Can't open file"); exit(EXIT_FAILURE); } int tally[9] = { 0 }; char c; int total = 0; while ((c = getc(input)) != EOF) { while (c < '1' || c > '9') c = getc(input); tally[c - '1']++; total++; while ((c = getc(input)) != '\n' && c != EOF) ; } fclose(input); static float freq[9]; for (int i = 0; i < 9; i++) freq[i] = tally[i] / (float) total; return freq; } int main(int argc, char **argv) { if (argc != 2) { printf("Usage: benford <file>\n"); return EXIT_FAILURE; } float *actual = get_actual_distribution(argv[1]); float *expected = benford_distribution(); puts("digit\tactual\texpected"); for (int i = 0; i < 9; i++) printf("%d\t%.3f\t%.3f\n", i + 1, actual[i], expected[i]); return EXIT_SUCCESS; }
import java.math.BigInteger; import java.util.Locale; public class BenfordsLaw { private static BigInteger[] generateFibonacci(int n) { BigInteger[] fib = new BigInteger[n]; fib[0] = BigInteger.ONE; fib[1] = BigInteger.ONE; for (int i = 2; i < fib.length; i++) { fib[i] = fib[i - 2].add(fib[i - 1]); } return fib; } public static void main(String[] args) { BigInteger[] numbers = generateFibonacci(1000); int[] firstDigits = new int[10]; for (BigInteger number : numbers) { firstDigits[Integer.valueOf(number.toString().substring(0, 1))]++; } for (int i = 1; i < firstDigits.length; i++) { System.out.printf(Locale.ROOT, "%d %10.6f %10.6f%n", i, (double) firstDigits[i] / numbers.length, Math.log10(1.0 + 1.0 / i)); } } }
Convert the following code from C to Java, ensuring the logic remains intact.
#include <stdio.h> #include <stdlib.h> #include <math.h> float *benford_distribution(void) { static float prob[9]; for (int i = 1; i < 10; i++) prob[i - 1] = log10f(1 + 1.0 / i); return prob; } float *get_actual_distribution(char *fn) { FILE *input = fopen(fn, "r"); if (!input) { perror("Can't open file"); exit(EXIT_FAILURE); } int tally[9] = { 0 }; char c; int total = 0; while ((c = getc(input)) != EOF) { while (c < '1' || c > '9') c = getc(input); tally[c - '1']++; total++; while ((c = getc(input)) != '\n' && c != EOF) ; } fclose(input); static float freq[9]; for (int i = 0; i < 9; i++) freq[i] = tally[i] / (float) total; return freq; } int main(int argc, char **argv) { if (argc != 2) { printf("Usage: benford <file>\n"); return EXIT_FAILURE; } float *actual = get_actual_distribution(argv[1]); float *expected = benford_distribution(); puts("digit\tactual\texpected"); for (int i = 0; i < 9; i++) printf("%d\t%.3f\t%.3f\n", i + 1, actual[i], expected[i]); return EXIT_SUCCESS; }
import java.math.BigInteger; import java.util.Locale; public class BenfordsLaw { private static BigInteger[] generateFibonacci(int n) { BigInteger[] fib = new BigInteger[n]; fib[0] = BigInteger.ONE; fib[1] = BigInteger.ONE; for (int i = 2; i < fib.length; i++) { fib[i] = fib[i - 2].add(fib[i - 1]); } return fib; } public static void main(String[] args) { BigInteger[] numbers = generateFibonacci(1000); int[] firstDigits = new int[10]; for (BigInteger number : numbers) { firstDigits[Integer.valueOf(number.toString().substring(0, 1))]++; } for (int i = 1; i < firstDigits.length; i++) { System.out.printf(Locale.ROOT, "%d %10.6f %10.6f%n", i, (double) firstDigits[i] / numbers.length, Math.log10(1.0 + 1.0 / i)); } } }
Keep all operations the same but rewrite the snippet in Java.
#include<unistd.h> #include<stdio.h> #include<time.h> #define SHORTLAG 1000 #define LONGLAG 2000 int main(){ int i,times,hour,min,sec,min1,min2; time_t t; struct tm* currentTime; while(1){ time(&t); currentTime = localtime(&t); hour = currentTime->tm_hour; min = currentTime->tm_min; sec = currentTime->tm_sec; hour = 12; min = 0; sec = 0; if((min==0 || min==30) && sec==0) times = ((hour*60 + min)%240)%8; if(times==0){ times = 8; } if(min==0){ min1 = 0; min2 = 0; } else{ min1 = 3; min2 = 0; } if((min==0 || min==30) && sec==0){ printf("\nIt is now %d:%d%d %s. Sounding the bell %d times.",hour,min1,min2,(hour>11)?"PM":"AM",times); for(i=1;i<=times;i++){ printf("\a"); (i%2==0)?sleep(LONGLAG):sleep(SHORTLAG); } } } return 0; }
import java.text.DateFormat; import java.text.SimpleDateFormat; import java.util.TimeZone; public class NauticalBell extends Thread { public static void main(String[] args) { NauticalBell bells = new NauticalBell(); bells.setDaemon(true); bells.start(); try { bells.join(); } catch (InterruptedException e) { System.out.println(e); } } @Override public void run() { DateFormat sdf = new SimpleDateFormat("HH:mm:ss"); sdf.setTimeZone(TimeZone.getTimeZone("UTC")); int numBells = 0; long time = System.currentTimeMillis(); long next = time - (time % (24 * 60 * 60 * 1000)); while (next < time) { next += 30 * 60 * 1000; numBells = 1 + (numBells % 8); } while (true) { long wait = 100L; time = System.currentTimeMillis(); if (time - next >= 0) { String bells = numBells == 1 ? "bell" : "bells"; String timeString = sdf.format(time); System.out.printf("%s : %d %s\n", timeString, numBells, bells); next += 30 * 60 * 1000; wait = next - time; numBells = 1 + (numBells % 8); } try { Thread.sleep(wait); } catch (InterruptedException e) { return; } } } }
Ensure the translated Java code behaves exactly like the original C snippet.
#include<unistd.h> #include<stdio.h> #include<time.h> #define SHORTLAG 1000 #define LONGLAG 2000 int main(){ int i,times,hour,min,sec,min1,min2; time_t t; struct tm* currentTime; while(1){ time(&t); currentTime = localtime(&t); hour = currentTime->tm_hour; min = currentTime->tm_min; sec = currentTime->tm_sec; hour = 12; min = 0; sec = 0; if((min==0 || min==30) && sec==0) times = ((hour*60 + min)%240)%8; if(times==0){ times = 8; } if(min==0){ min1 = 0; min2 = 0; } else{ min1 = 3; min2 = 0; } if((min==0 || min==30) && sec==0){ printf("\nIt is now %d:%d%d %s. Sounding the bell %d times.",hour,min1,min2,(hour>11)?"PM":"AM",times); for(i=1;i<=times;i++){ printf("\a"); (i%2==0)?sleep(LONGLAG):sleep(SHORTLAG); } } } return 0; }
import java.text.DateFormat; import java.text.SimpleDateFormat; import java.util.TimeZone; public class NauticalBell extends Thread { public static void main(String[] args) { NauticalBell bells = new NauticalBell(); bells.setDaemon(true); bells.start(); try { bells.join(); } catch (InterruptedException e) { System.out.println(e); } } @Override public void run() { DateFormat sdf = new SimpleDateFormat("HH:mm:ss"); sdf.setTimeZone(TimeZone.getTimeZone("UTC")); int numBells = 0; long time = System.currentTimeMillis(); long next = time - (time % (24 * 60 * 60 * 1000)); while (next < time) { next += 30 * 60 * 1000; numBells = 1 + (numBells % 8); } while (true) { long wait = 100L; time = System.currentTimeMillis(); if (time - next >= 0) { String bells = numBells == 1 ? "bell" : "bells"; String timeString = sdf.format(time); System.out.printf("%s : %d %s\n", timeString, numBells, bells); next += 30 * 60 * 1000; wait = next - time; numBells = 1 + (numBells % 8); } try { Thread.sleep(wait); } catch (InterruptedException e) { return; } } } }
Generate an equivalent Java version of this C code.
#include <stdio.h> long fib(long x) { long fib_i(long n) { return n < 2 ? n : fib_i(n - 2) + fib_i(n - 1); }; if (x < 0) { printf("Bad argument: fib(%ld)\n", x); return -1; } return fib_i(x); } long fib_i(long n) { printf("This is not the fib you are looking for\n"); return -1; } int main() { long x; for (x = -1; x < 4; x ++) printf("fib %ld = %ld\n", x, fib(x)); printf("calling fib_i from outside fib:\n"); fib_i(3); return 0; }
public static long fib(int n) { if (n < 0) throw new IllegalArgumentException("n can not be a negative number"); return new Object() { private long fibInner(int n) { return (n < 2) ? n : (fibInner(n - 1) + fibInner(n - 2)); } }.fibInner(n); }
Generate a Java translation of this C snippet without changing its computational steps.
#include <stdio.h> long fib(long x) { long fib_i(long n) { return n < 2 ? n : fib_i(n - 2) + fib_i(n - 1); }; if (x < 0) { printf("Bad argument: fib(%ld)\n", x); return -1; } return fib_i(x); } long fib_i(long n) { printf("This is not the fib you are looking for\n"); return -1; } int main() { long x; for (x = -1; x < 4; x ++) printf("fib %ld = %ld\n", x, fib(x)); printf("calling fib_i from outside fib:\n"); fib_i(3); return 0; }
public static long fib(int n) { if (n < 0) throw new IllegalArgumentException("n can not be a negative number"); return new Object() { private long fibInner(int n) { return (n < 2) ? n : (fibInner(n - 1) + fibInner(n - 2)); } }.fibInner(n); }
Maintain the same structure and functionality when rewriting this code in Java.
#include <string.h> #include <stdlib.h> #include <stdio.h> int main( int argc, char ** argv ){ const char * str_a = "knight"; const char * str_b = "socks"; const char * str_c = "brooms"; char * new_a = malloc( strlen( str_a ) - 1 ); char * new_b = malloc( strlen( str_b ) - 1 ); char * new_c = malloc( strlen( str_c ) - 2 ); strcpy( new_a, str_a + 1 ); strncpy( new_b, str_b, strlen( str_b ) - 1 ); strncpy( new_c, str_c + 1, strlen( str_c ) - 2 ); printf( "%s\n%s\n%s\n", new_a, new_b, new_c ); free( new_a ); free( new_b ); free( new_c ); return 0; }
String strOrig = 'brooms'; String str1 = strOrig.substring(1, strOrig.length()); system.debug(str1); String str2 = strOrig.substring(0, strOrig.length()-1); system.debug(str2); String str3 = strOrig.substring(1, strOrig.length()-1); system.debug(str3); String strOrig = 'brooms'; String str1 = strOrig.replaceAll( '^.', '' ); system.debug(str1); String str2 = strOrig.replaceAll( '.$', '' ) ; system.debug(str2); String str3 = strOrig.replaceAll( '^.|.$', '' ); system.debug(str3);
Port the provided C code into Java while preserving the original functionality.
#include <string.h> #include <stdlib.h> #include <stdio.h> int main( int argc, char ** argv ){ const char * str_a = "knight"; const char * str_b = "socks"; const char * str_c = "brooms"; char * new_a = malloc( strlen( str_a ) - 1 ); char * new_b = malloc( strlen( str_b ) - 1 ); char * new_c = malloc( strlen( str_c ) - 2 ); strcpy( new_a, str_a + 1 ); strncpy( new_b, str_b, strlen( str_b ) - 1 ); strncpy( new_c, str_c + 1, strlen( str_c ) - 2 ); printf( "%s\n%s\n%s\n", new_a, new_b, new_c ); free( new_a ); free( new_b ); free( new_c ); return 0; }
String strOrig = 'brooms'; String str1 = strOrig.substring(1, strOrig.length()); system.debug(str1); String str2 = strOrig.substring(0, strOrig.length()-1); system.debug(str2); String str3 = strOrig.substring(1, strOrig.length()-1); system.debug(str3); String strOrig = 'brooms'; String str1 = strOrig.replaceAll( '^.', '' ); system.debug(str1); String str2 = strOrig.replaceAll( '.$', '' ) ; system.debug(str2); String str3 = strOrig.replaceAll( '^.|.$', '' ); system.debug(str3);
Can you help me rewrite this code in Java instead of C, keeping it the same logically?
#include <stdio.h> #include <math.h> #include <stdlib.h> #include <stdint.h> #include <time.h> const uint8_t masks[8] = {1, 2, 4, 8, 16, 32, 64, 128}; #define half(n) ((int64_t)((n) - 1) >> 1) #define divide(nm, d) ((uint64_t)((double)nm / (double)d)) int64_t countPrimes(uint64_t n) { if (n < 9) return (n < 2) ? 0 : ((int64_t)n + 1) / 2; uint64_t rtlmt = (uint64_t)sqrt((double)n); int64_t mxndx = (int64_t)((rtlmt - 1) / 2); int arrlen = (int)(mxndx + 1); uint32_t *smalls = malloc(arrlen * 4); uint32_t *roughs = malloc(arrlen * 4); int64_t *larges = malloc(arrlen * 8); for (int i = 0; i < arrlen; ++i) { smalls[i] = (uint32_t)i; roughs[i] = (uint32_t)(i + i + 1); larges[i] = (int64_t)((n/(uint64_t)(i + i + 1) - 1) / 2); } int cullbuflen = (int)((mxndx + 8) / 8); uint8_t *cullbuf = calloc(cullbuflen, 1); int64_t nbps = 0; int rilmt = arrlen; for (int64_t i = 1; ; ++i) { int64_t sqri = (i + i) * (i + 1); if (sqri > mxndx) break; if (cullbuf[i >> 3] & masks[i & 7]) continue; cullbuf[i >> 3] |= masks[i & 7]; uint64_t bp = (uint64_t)(i + i + 1); for (int64_t c = sqri; c < (int64_t)arrlen; c += (int64_t)bp) { cullbuf[c >> 3] |= masks[c & 7]; } int nri = 0; for (int ori = 0; ori < rilmt; ++ori) { uint32_t r = roughs[ori]; int64_t rci = (int64_t)(r >> 1); if (cullbuf[rci >> 3] & masks[rci & 7]) continue; uint64_t d = (uint64_t)r * bp; int64_t t = (d <= rtlmt) ? larges[(int64_t)smalls[d >> 1] - nbps] : (int64_t)smalls[half(divide(n, d))]; larges[nri] = larges[ori] - t + nbps; roughs[nri] = r; nri++; } int64_t si = mxndx; for (uint64_t pm = (rtlmt/bp - 1) | 1; pm >= bp; pm -= 2) { uint32_t c = smalls[pm >> 1]; uint64_t e = (pm * bp) >> 1; for ( ; si >= (int64_t)e; --si) smalls[si] -= c - (uint32_t)nbps; } rilmt = nri; nbps++; } int64_t ans = larges[0] + (int64_t)((rilmt + 2*(nbps - 1)) * (rilmt - 1) / 2); int ri, sri; for (ri = 1; ri < rilmt; ++ri) ans -= larges[ri]; for (ri = 1; ; ++ri) { uint64_t p = (uint64_t)roughs[ri]; uint64_t m = n / p; int ei = (int)smalls[half((uint64_t)m/p)] - nbps; if (ei <= ri) break; ans -= (int64_t)((ei - ri) * (nbps + ri - 1)); for (sri = ri + 1; sri < ei + 1; ++sri) { ans += (int64_t)smalls[half(divide(m, (uint64_t)roughs[sri]))]; } } free(smalls); free(roughs); free(larges); free(cullbuf); return ans + 1; } int main() { uint64_t n; int i; clock_t start = clock(); for (i = 0, n = 1; i < 10; ++i, n *= 10) { printf("10^%d %ld\n", i, countPrimes(n)); } clock_t end = clock(); printf("\nTook %f seconds\n", (double) (end - start) / CLOCKS_PER_SEC); return 0; }
import java.util.*; public class LegendrePrimeCounter { public static void main(String[] args) { LegendrePrimeCounter counter = new LegendrePrimeCounter(1000000000); for (int i = 0, n = 1; i < 10; ++i, n *= 10) System.out.printf("10^%d\t%d\n", i, counter.primeCount((n))); } private List<Integer> primes; public LegendrePrimeCounter(int limit) { primes = generatePrimes((int)Math.sqrt((double)limit)); } public int primeCount(int n) { if (n < 2) return 0; int a = primeCount((int)Math.sqrt((double)n)); return phi(n, a) + a - 1; } private int phi(int x, int a) { if (a == 0) return x; if (a == 1) return x - (x >> 1); int pa = primes.get(a - 1); if (x <= pa) return 1; return phi(x, a - 1) - phi(x / pa, a - 1); } private static List<Integer> generatePrimes(int limit) { boolean[] sieve = new boolean[limit >> 1]; Arrays.fill(sieve, true); for (int p = 3, s = 9; s < limit; p += 2) { if (sieve[p >> 1]) { for (int q = s; q < limit; q += p << 1) sieve[q >> 1] = false; } s += (p + 1) << 2; } List<Integer> primes = new ArrayList<>(); if (limit > 2) primes.add(2); for (int i = 1; i < sieve.length; ++i) { if (sieve[i]) primes.add((i << 1) + 1); } return primes; } }
Port the following code from C to Java with equivalent syntax and logic.
#include <stdio.h> extern int Query (char * Data, size_t * Length); int main (int argc, char * argv []) { char Buffer [1024]; size_t Size = sizeof (Buffer); if (0 == Query (Buffer, &Size)) { printf ("failed to call Query\n"); } else { char * Ptr = Buffer; while (Size-- > 0) putchar (*Ptr++); putchar ('\n'); } }
public class Query { public static boolean call(byte[] data, int[] length) throws java.io.UnsupportedEncodingException { String message = "Here am I"; byte[] mb = message.getBytes("utf-8"); if (length[0] < mb.length) return false; length[0] = mb.length; System.arraycopy(mb, 0, data, 0, mb.length); return true; } }
Keep all operations the same but rewrite the snippet in Java.
#include <stdio.h> #include <string.h> int cmp(const char *p, const char *q) { while (*p && *q) p = &p[1], q = &q[1]; return *p; } int main() { char line[65536]; char buf[1000000] = {0}; char *last = buf; char *next = buf; while (gets(line)) { strcat(line, "\n"); if (cmp(last, line)) continue; if (cmp(line, last)) next = buf; last = next; strcpy(next, line); while (*next) next = &next[1]; } printf("%s", buf); return 0; }
import java.io.File; import java.util.Scanner; public class LongestStringChallenge { public static void main(String[] args) throws Exception { String lines = "", longest = ""; try (Scanner sc = new Scanner(new File("lines.txt"))) { while(sc.hasNext()) { String line = sc.nextLine(); if (longer(longest, line)) lines = longest = line; else if (!longer(line, longest)) lines = lines.concat("\n").concat(line); } } System.out.println(lines); } static boolean longer(String a, String b) { try { String dummy = a.substring(b.length()); } catch (StringIndexOutOfBoundsException e) { return true; } return false; } }
Can you help me rewrite this code in Java instead of C, keeping it the same logically?
#include <stdio.h> int main() { FILE *fh = fopen("output.txt", "w"); fclose(fh); return 0; }
import java.io.*; public class CreateFileTest { public static void main(String args[]) { try { new File("output.txt").createNewFile(); new File(File.separator + "output.txt").createNewFile(); new File("docs").mkdir(); new File(File.separator + "docs").mkdir(); } catch (IOException e) { System.err.println(e.getMessage()); } } }
Change the programming language of this snippet from C to Java without modifying what it does.
#include <assert.h> #include <locale.h> #include <stdbool.h> #include <stdint.h> #include <stdio.h> #include <stdlib.h> typedef struct bit_array_tag { uint32_t size; uint32_t* array; } bit_array; bool bit_array_create(bit_array* b, uint32_t size) { uint32_t* array = calloc((size + 31)/32, sizeof(uint32_t)); if (array == NULL) return false; b->size = size; b->array = array; return true; } void bit_array_destroy(bit_array* b) { free(b->array); b->array = NULL; } void bit_array_set(bit_array* b, uint32_t index, bool value) { assert(index < b->size); uint32_t* p = &b->array[index >> 5]; uint32_t bit = 1 << (index & 31); if (value) *p |= bit; else *p &= ~bit; } bool bit_array_get(const bit_array* b, uint32_t index) { assert(index < b->size); uint32_t* p = &b->array[index >> 5]; uint32_t bit = 1 << (index & 31); return (*p & bit) != 0; } typedef struct sieve_tag { uint32_t limit; bit_array not_prime; } sieve; bool sieve_create(sieve* s, uint32_t limit) { if (!bit_array_create(&s->not_prime, limit/2)) return false; for (uint32_t p = 3; p * p <= limit; p += 2) { if (bit_array_get(&s->not_prime, p/2 - 1) == false) { uint32_t inc = 2 * p; for (uint32_t q = p * p; q <= limit; q += inc) bit_array_set(&s->not_prime, q/2 - 1, true); } } s->limit = limit; return true; } void sieve_destroy(sieve* s) { bit_array_destroy(&s->not_prime); } bool is_prime(const sieve* s, uint32_t n) { assert(n <= s->limit); if (n == 2) return true; if (n < 2 || n % 2 == 0) return false; return bit_array_get(&s->not_prime, n/2 - 1) == false; } uint32_t count_digits(uint32_t n) { uint32_t digits = 0; for (; n > 0; ++digits) n /= 10; return digits; } uint32_t change_digit(uint32_t n, uint32_t index, uint32_t new_digit) { uint32_t p = 1; uint32_t changed = 0; for (; index > 0; p *= 10, n /= 10, --index) changed += p * (n % 10); changed += (10 * (n/10) + new_digit) * p; return changed; } bool unprimeable(const sieve* s, uint32_t n) { if (is_prime(s, n)) return false; uint32_t d = count_digits(n); for (uint32_t i = 0; i < d; ++i) { for (uint32_t j = 0; j <= 9; ++j) { uint32_t m = change_digit(n, i, j); if (m != n && is_prime(s, m)) return false; } } return true; } int main() { const uint32_t limit = 10000000; setlocale(LC_ALL, ""); sieve s = { 0 }; if (!sieve_create(&s, limit)) { fprintf(stderr, "Out of memory\n"); return 1; } printf("First 35 unprimeable numbers:\n"); uint32_t n = 100; uint32_t lowest[10] = { 0 }; for (uint32_t count = 0, found = 0; n < limit && (found < 10 || count < 600); ++n) { if (unprimeable(&s, n)) { if (count < 35) { if (count != 0) printf(", "); printf("%'u", n); } ++count; if (count == 600) printf("\n600th unprimeable number: %'u\n", n); uint32_t last_digit = n % 10; if (lowest[last_digit] == 0) { lowest[last_digit] = n; ++found; } } } sieve_destroy(&s); for (uint32_t i = 0; i < 10; ++i) printf("Least unprimeable number ending in %u: %'u\n" , i, lowest[i]); return 0; }
public class UnprimeableNumbers { private static int MAX = 10_000_000; private static boolean[] primes = new boolean[MAX]; public static void main(String[] args) { sieve(); System.out.println("First 35 unprimeable numbers:"); displayUnprimeableNumbers(35); int n = 600; System.out.printf("%nThe %dth unprimeable number = %,d%n%n", n, nthUnprimeableNumber(n)); int[] lowest = genLowest(); System.out.println("Least unprimeable number that ends in:"); for ( int i = 0 ; i <= 9 ; i++ ) { System.out.printf(" %d is %,d%n", i, lowest[i]); } } private static int[] genLowest() { int[] lowest = new int[10]; int count = 0; int test = 1; while ( count < 10 ) { test++; if ( unPrimable(test) && lowest[test % 10] == 0 ) { lowest[test % 10] = test; count++; } } return lowest; } private static int nthUnprimeableNumber(int maxCount) { int test = 1; int count = 0; int result = 0; while ( count < maxCount ) { test++; if ( unPrimable(test) ) { count++; result = test; } } return result; } private static void displayUnprimeableNumbers(int maxCount) { int test = 1; int count = 0; while ( count < maxCount ) { test++; if ( unPrimable(test) ) { count++; System.out.printf("%d ", test); } } System.out.println(); } private static boolean unPrimable(int test) { if ( primes[test] ) { return false; } String s = test + ""; for ( int i = 0 ; i < s.length() ; i++ ) { for ( int j = 0 ; j <= 9 ; j++ ) { if ( primes[Integer.parseInt(replace(s, i, j))] ) { return false; } } } return true; } private static String replace(String str, int position, int value) { char[] sChar = str.toCharArray(); sChar[position] = (char) value; return str.substring(0, position) + value + str.substring(position + 1); } private static final void sieve() { for ( int i = 2 ; i < MAX ; i++ ) { primes[i] = true; } for ( int i = 2 ; i < MAX ; i++ ) { if ( primes[i] ) { for ( int j = 2*i ; j < MAX ; j += i ) { primes[j] = false; } } } } }
Produce a functionally identical Java code for the snippet given in C.
#include <stdio.h> #include <math.h> void pascal(int a, int b, int mid, int top, int* x, int* y, int* z) { double ytemp = (top - 4 * (a + b)) / 7.; if(fmod(ytemp, 1.) >= 0.0001) { x = 0; return; } *y = ytemp; *x = mid - 2 * a - *y; *z = *y - *x; } int main() { int a = 11, b = 4, mid = 40, top = 151; int x, y, z; pascal(a, b, mid, top, &x, &y, &z); if(x != 0) printf("x: %d, y: %d, z: %d\n", x, y, z); else printf("No solution\n"); return 0; }
import java.util.ArrayList; import java.util.Arrays; import java.util.List; public class PascalsTrianglePuzzle { public static void main(String[] args) { Matrix mat = new Matrix(Arrays.asList(1d, 0d, 0d, 0d, 0d, 0d, 0d, 0d, -1d, 0d, 0d), Arrays.asList(0d, 1d, 0d, 0d, 0d, 0d, 0d, 0d, 0d, -1d, 0d), Arrays.asList(0d, 0d, 0d, 0d, 0d, 0d, 0d, 0d, -1d, 1d, -1d), Arrays.asList(0d, 0d, 1d, 0d, 0d, 0d, 0d, 0d, 0d, -1d, 0d), Arrays.asList(0d, 0d, 0d, 1d, 0d, 0d, 0d, 0d, 0d, 0d, -1d), Arrays.asList(1d, 1d, 0d, 0d, 0d, 0d, 0d, 0d, 0d, 0d, 0d), Arrays.asList(0d, 1d, 1d, 0d, -1d, 0d, 0d, 0d, 0d, 0d, 0d), Arrays.asList(0d, 0d, 1d, 1d, 0d, -1d, 0d, 0d, 0d, 0d, 0d), Arrays.asList(0d, 0d, 0d, 0d, -1d, 0d, 1d, 0d, 0d, 0d, 0d), Arrays.asList(0d, 0d, 0d, 0d, 1d, 1d, 0d, -1d, 0d, 0d, 0d), Arrays.asList(0d, 0d, 0d, 0d, 0d, 0d, 1d, 1d, 0d, 0d, 0d)); List<Double> b = Arrays.asList(11d, 11d, 0d, 4d, 4d, 40d, 0d, 0d, 40d, 0d, 151d); List<Double> solution = cramersRule(mat, b); System.out.println("Solution = " + cramersRule(mat, b)); System.out.printf("X = %.2f%n", solution.get(8)); System.out.printf("Y = %.2f%n", solution.get(9)); System.out.printf("Z = %.2f%n", solution.get(10)); } private static List<Double> cramersRule(Matrix matrix, List<Double> b) { double denominator = matrix.determinant(); List<Double> result = new ArrayList<>(); for ( int i = 0 ; i < b.size() ; i++ ) { result.add(matrix.replaceColumn(b, i).determinant() / denominator); } return result; } private static class Matrix { private List<List<Double>> matrix; @Override public String toString() { return matrix.toString(); } @SafeVarargs public Matrix(List<Double> ... lists) { matrix = new ArrayList<>(); for ( List<Double> list : lists) { matrix.add(list); } } public Matrix(List<List<Double>> mat) { matrix = mat; } public double determinant() { if ( matrix.size() == 1 ) { return get(0, 0); } if ( matrix.size() == 2 ) { return get(0, 0) * get(1, 1) - get(0, 1) * get(1, 0); } double sum = 0; double sign = 1; for ( int i = 0 ; i < matrix.size() ; i++ ) { sum += sign * get(0, i) * coFactor(0, i).determinant(); sign *= -1; } return sum; } private Matrix coFactor(int row, int col) { List<List<Double>> mat = new ArrayList<>(); for ( int i = 0 ; i < matrix.size() ; i++ ) { if ( i == row ) { continue; } List<Double> list = new ArrayList<>(); for ( int j = 0 ; j < matrix.size() ; j++ ) { if ( j == col ) { continue; } list.add(get(i, j)); } mat.add(list); } return new Matrix(mat); } private Matrix replaceColumn(List<Double> b, int column) { List<List<Double>> mat = new ArrayList<>(); for ( int row = 0 ; row < matrix.size() ; row++ ) { List<Double> list = new ArrayList<>(); for ( int col = 0 ; col < matrix.size() ; col++ ) { double value = get(row, col); if ( col == column ) { value = b.get(row); } list.add(value); } mat.add(list); } return new Matrix(mat); } private double get(int row, int col) { return matrix.get(row).get(col); } } }
Transform the following C implementation into Java, maintaining the same output and logic.
#include <stdio.h> #include <math.h> void pascal(int a, int b, int mid, int top, int* x, int* y, int* z) { double ytemp = (top - 4 * (a + b)) / 7.; if(fmod(ytemp, 1.) >= 0.0001) { x = 0; return; } *y = ytemp; *x = mid - 2 * a - *y; *z = *y - *x; } int main() { int a = 11, b = 4, mid = 40, top = 151; int x, y, z; pascal(a, b, mid, top, &x, &y, &z); if(x != 0) printf("x: %d, y: %d, z: %d\n", x, y, z); else printf("No solution\n"); return 0; }
import java.util.ArrayList; import java.util.Arrays; import java.util.List; public class PascalsTrianglePuzzle { public static void main(String[] args) { Matrix mat = new Matrix(Arrays.asList(1d, 0d, 0d, 0d, 0d, 0d, 0d, 0d, -1d, 0d, 0d), Arrays.asList(0d, 1d, 0d, 0d, 0d, 0d, 0d, 0d, 0d, -1d, 0d), Arrays.asList(0d, 0d, 0d, 0d, 0d, 0d, 0d, 0d, -1d, 1d, -1d), Arrays.asList(0d, 0d, 1d, 0d, 0d, 0d, 0d, 0d, 0d, -1d, 0d), Arrays.asList(0d, 0d, 0d, 1d, 0d, 0d, 0d, 0d, 0d, 0d, -1d), Arrays.asList(1d, 1d, 0d, 0d, 0d, 0d, 0d, 0d, 0d, 0d, 0d), Arrays.asList(0d, 1d, 1d, 0d, -1d, 0d, 0d, 0d, 0d, 0d, 0d), Arrays.asList(0d, 0d, 1d, 1d, 0d, -1d, 0d, 0d, 0d, 0d, 0d), Arrays.asList(0d, 0d, 0d, 0d, -1d, 0d, 1d, 0d, 0d, 0d, 0d), Arrays.asList(0d, 0d, 0d, 0d, 1d, 1d, 0d, -1d, 0d, 0d, 0d), Arrays.asList(0d, 0d, 0d, 0d, 0d, 0d, 1d, 1d, 0d, 0d, 0d)); List<Double> b = Arrays.asList(11d, 11d, 0d, 4d, 4d, 40d, 0d, 0d, 40d, 0d, 151d); List<Double> solution = cramersRule(mat, b); System.out.println("Solution = " + cramersRule(mat, b)); System.out.printf("X = %.2f%n", solution.get(8)); System.out.printf("Y = %.2f%n", solution.get(9)); System.out.printf("Z = %.2f%n", solution.get(10)); } private static List<Double> cramersRule(Matrix matrix, List<Double> b) { double denominator = matrix.determinant(); List<Double> result = new ArrayList<>(); for ( int i = 0 ; i < b.size() ; i++ ) { result.add(matrix.replaceColumn(b, i).determinant() / denominator); } return result; } private static class Matrix { private List<List<Double>> matrix; @Override public String toString() { return matrix.toString(); } @SafeVarargs public Matrix(List<Double> ... lists) { matrix = new ArrayList<>(); for ( List<Double> list : lists) { matrix.add(list); } } public Matrix(List<List<Double>> mat) { matrix = mat; } public double determinant() { if ( matrix.size() == 1 ) { return get(0, 0); } if ( matrix.size() == 2 ) { return get(0, 0) * get(1, 1) - get(0, 1) * get(1, 0); } double sum = 0; double sign = 1; for ( int i = 0 ; i < matrix.size() ; i++ ) { sum += sign * get(0, i) * coFactor(0, i).determinant(); sign *= -1; } return sum; } private Matrix coFactor(int row, int col) { List<List<Double>> mat = new ArrayList<>(); for ( int i = 0 ; i < matrix.size() ; i++ ) { if ( i == row ) { continue; } List<Double> list = new ArrayList<>(); for ( int j = 0 ; j < matrix.size() ; j++ ) { if ( j == col ) { continue; } list.add(get(i, j)); } mat.add(list); } return new Matrix(mat); } private Matrix replaceColumn(List<Double> b, int column) { List<List<Double>> mat = new ArrayList<>(); for ( int row = 0 ; row < matrix.size() ; row++ ) { List<Double> list = new ArrayList<>(); for ( int col = 0 ; col < matrix.size() ; col++ ) { double value = get(row, col); if ( col == column ) { value = b.get(row); } list.add(value); } mat.add(list); } return new Matrix(mat); } private double get(int row, int col) { return matrix.get(row).get(col); } } }
Rewrite the snippet below in Java so it works the same as the original C code.
#include <stdio.h> #include <math.h> void pascal(int a, int b, int mid, int top, int* x, int* y, int* z) { double ytemp = (top - 4 * (a + b)) / 7.; if(fmod(ytemp, 1.) >= 0.0001) { x = 0; return; } *y = ytemp; *x = mid - 2 * a - *y; *z = *y - *x; } int main() { int a = 11, b = 4, mid = 40, top = 151; int x, y, z; pascal(a, b, mid, top, &x, &y, &z); if(x != 0) printf("x: %d, y: %d, z: %d\n", x, y, z); else printf("No solution\n"); return 0; }
import java.util.ArrayList; import java.util.Arrays; import java.util.List; public class PascalsTrianglePuzzle { public static void main(String[] args) { Matrix mat = new Matrix(Arrays.asList(1d, 0d, 0d, 0d, 0d, 0d, 0d, 0d, -1d, 0d, 0d), Arrays.asList(0d, 1d, 0d, 0d, 0d, 0d, 0d, 0d, 0d, -1d, 0d), Arrays.asList(0d, 0d, 0d, 0d, 0d, 0d, 0d, 0d, -1d, 1d, -1d), Arrays.asList(0d, 0d, 1d, 0d, 0d, 0d, 0d, 0d, 0d, -1d, 0d), Arrays.asList(0d, 0d, 0d, 1d, 0d, 0d, 0d, 0d, 0d, 0d, -1d), Arrays.asList(1d, 1d, 0d, 0d, 0d, 0d, 0d, 0d, 0d, 0d, 0d), Arrays.asList(0d, 1d, 1d, 0d, -1d, 0d, 0d, 0d, 0d, 0d, 0d), Arrays.asList(0d, 0d, 1d, 1d, 0d, -1d, 0d, 0d, 0d, 0d, 0d), Arrays.asList(0d, 0d, 0d, 0d, -1d, 0d, 1d, 0d, 0d, 0d, 0d), Arrays.asList(0d, 0d, 0d, 0d, 1d, 1d, 0d, -1d, 0d, 0d, 0d), Arrays.asList(0d, 0d, 0d, 0d, 0d, 0d, 1d, 1d, 0d, 0d, 0d)); List<Double> b = Arrays.asList(11d, 11d, 0d, 4d, 4d, 40d, 0d, 0d, 40d, 0d, 151d); List<Double> solution = cramersRule(mat, b); System.out.println("Solution = " + cramersRule(mat, b)); System.out.printf("X = %.2f%n", solution.get(8)); System.out.printf("Y = %.2f%n", solution.get(9)); System.out.printf("Z = %.2f%n", solution.get(10)); } private static List<Double> cramersRule(Matrix matrix, List<Double> b) { double denominator = matrix.determinant(); List<Double> result = new ArrayList<>(); for ( int i = 0 ; i < b.size() ; i++ ) { result.add(matrix.replaceColumn(b, i).determinant() / denominator); } return result; } private static class Matrix { private List<List<Double>> matrix; @Override public String toString() { return matrix.toString(); } @SafeVarargs public Matrix(List<Double> ... lists) { matrix = new ArrayList<>(); for ( List<Double> list : lists) { matrix.add(list); } } public Matrix(List<List<Double>> mat) { matrix = mat; } public double determinant() { if ( matrix.size() == 1 ) { return get(0, 0); } if ( matrix.size() == 2 ) { return get(0, 0) * get(1, 1) - get(0, 1) * get(1, 0); } double sum = 0; double sign = 1; for ( int i = 0 ; i < matrix.size() ; i++ ) { sum += sign * get(0, i) * coFactor(0, i).determinant(); sign *= -1; } return sum; } private Matrix coFactor(int row, int col) { List<List<Double>> mat = new ArrayList<>(); for ( int i = 0 ; i < matrix.size() ; i++ ) { if ( i == row ) { continue; } List<Double> list = new ArrayList<>(); for ( int j = 0 ; j < matrix.size() ; j++ ) { if ( j == col ) { continue; } list.add(get(i, j)); } mat.add(list); } return new Matrix(mat); } private Matrix replaceColumn(List<Double> b, int column) { List<List<Double>> mat = new ArrayList<>(); for ( int row = 0 ; row < matrix.size() ; row++ ) { List<Double> list = new ArrayList<>(); for ( int col = 0 ; col < matrix.size() ; col++ ) { double value = get(row, col); if ( col == column ) { value = b.get(row); } list.add(value); } mat.add(list); } return new Matrix(mat); } private double get(int row, int col) { return matrix.get(row).get(col); } } }
Change the programming language of this snippet from C to Java without modifying what it does.
#include <stdio.h> #include <stdlib.h> #include <gmp.h> typedef unsigned long long int u64; #define TRUE 1 #define FALSE 0 int primality_pretest(u64 k) { if (!(k % 3) || !(k % 5) || !(k % 7) || !(k % 11) || !(k % 13) || !(k % 17) || !(k % 19) || !(k % 23)) return (k <= 23); return TRUE; } int probprime(u64 k, mpz_t n) { mpz_set_ui(n, k); return mpz_probab_prime_p(n, 0); } int is_chernick(int n, u64 m, mpz_t z) { u64 t = 9 * m; if (primality_pretest(6 * m + 1) == FALSE) return FALSE; if (primality_pretest(12 * m + 1) == FALSE) return FALSE; for (int i = 1; i <= n - 2; i++) if (primality_pretest((t << i) + 1) == FALSE) return FALSE; if (probprime(6 * m + 1, z) == FALSE) return FALSE; if (probprime(12 * m + 1, z) == FALSE) return FALSE; for (int i = 1; i <= n - 2; i++) if (probprime((t << i) + 1, z) == FALSE) return FALSE; return TRUE; } int main(int argc, char const *argv[]) { mpz_t z; mpz_inits(z, NULL); for (int n = 3; n <= 10; n ++) { u64 multiplier = (n > 4) ? (1 << (n - 4)) : 1; if (n > 5) multiplier *= 5; for (u64 k = 1; ; k++) { u64 m = k * multiplier; if (is_chernick(n, m, z) == TRUE) { printf("a(%d) has m = %llu\n", n, m); break; } } } return 0; }
import java.math.BigInteger; import java.util.ArrayList; import java.util.List; public class ChernicksCarmichaelNumbers { public static void main(String[] args) { for ( long n = 3 ; n < 10 ; n++ ) { long m = 0; boolean foundComposite = true; List<Long> factors = null; while ( foundComposite ) { m += (n <= 4 ? 1 : (long) Math.pow(2, n-4) * 5); factors = U(n, m); foundComposite = false; for ( long factor : factors ) { if ( ! isPrime(factor) ) { foundComposite = true; break; } } } System.out.printf("U(%d, %d) = %s = %s %n", n, m, display(factors), multiply(factors)); } } private static String display(List<Long> factors) { return factors.toString().replace("[", "").replace("]", "").replaceAll(", ", " * "); } private static BigInteger multiply(List<Long> factors) { BigInteger result = BigInteger.ONE; for ( long factor : factors ) { result = result.multiply(BigInteger.valueOf(factor)); } return result; } private static List<Long> U(long n, long m) { List<Long> factors = new ArrayList<>(); factors.add(6*m + 1); factors.add(12*m + 1); for ( int i = 1 ; i <= n-2 ; i++ ) { factors.add(((long)Math.pow(2, i)) * 9 * m + 1); } return factors; } private static final int MAX = 100_000; private static final boolean[] primes = new boolean[MAX]; private static boolean SIEVE_COMPLETE = false; private static final boolean isPrimeTrivial(long test) { if ( ! SIEVE_COMPLETE ) { sieve(); SIEVE_COMPLETE = true; } return primes[(int) test]; } private static final void sieve() { for ( int i = 2 ; i < MAX ; i++ ) { primes[i] = true; } for ( int i = 2 ; i < MAX ; i++ ) { if ( primes[i] ) { for ( int j = 2*i ; j < MAX ; j += i ) { primes[j] = false; } } } } public static final boolean isPrime(long testValue) { if ( testValue == 2 ) return true; if ( testValue % 2 == 0 ) return false; if ( testValue <= MAX ) return isPrimeTrivial(testValue); long d = testValue-1; int s = 0; while ( d % 2 == 0 ) { s += 1; d /= 2; } if ( testValue < 1373565L ) { if ( ! aSrp(2, s, d, testValue) ) { return false; } if ( ! aSrp(3, s, d, testValue) ) { return false; } return true; } if ( testValue < 4759123141L ) { if ( ! aSrp(2, s, d, testValue) ) { return false; } if ( ! aSrp(7, s, d, testValue) ) { return false; } if ( ! aSrp(61, s, d, testValue) ) { return false; } return true; } if ( testValue < 10000000000000000L ) { if ( ! aSrp(3, s, d, testValue) ) { return false; } if ( ! aSrp(24251, s, d, testValue) ) { return false; } return true; } if ( ! aSrp(37, s, d, testValue) ) { return false; } if ( ! aSrp(47, s, d, testValue) ) { return false; } if ( ! aSrp(61, s, d, testValue) ) { return false; } if ( ! aSrp(73, s, d, testValue) ) { return false; } if ( ! aSrp(83, s, d, testValue) ) { return false; } return true; } private static final boolean aSrp(int a, int s, long d, long n) { long modPow = modPow(a, d, n); if ( modPow == 1 ) { return true; } int twoExpR = 1; for ( int r = 0 ; r < s ; r++ ) { if ( modPow(modPow, twoExpR, n) == n-1 ) { return true; } twoExpR *= 2; } return false; } private static final long SQRT = (long) Math.sqrt(Long.MAX_VALUE); public static final long modPow(long base, long exponent, long modulus) { long result = 1; while ( exponent > 0 ) { if ( exponent % 2 == 1 ) { if ( result > SQRT || base > SQRT ) { result = multiply(result, base, modulus); } else { result = (result * base) % modulus; } } exponent >>= 1; if ( base > SQRT ) { base = multiply(base, base, modulus); } else { base = (base * base) % modulus; } } return result; } public static final long multiply(long a, long b, long modulus) { long x = 0; long y = a % modulus; long t; while ( b > 0 ) { if ( b % 2 == 1 ) { t = x + y; x = (t > modulus ? t-modulus : t); } t = y << 1; y = (t > modulus ? t-modulus : t); b >>= 1; } return x % modulus; } }
Convert this C snippet to Java and keep its semantics consistent.
#include <stdbool.h> #include <stdio.h> #include <stdlib.h> const double EPS = 0.001; const double EPS_SQUARE = 0.000001; double side(double x1, double y1, double x2, double y2, double x, double y) { return (y2 - y1) * (x - x1) + (-x2 + x1) * (y - y1); } bool naivePointInTriangle(double x1, double y1, double x2, double y2, double x3, double y3, double x, double y) { double checkSide1 = side(x1, y1, x2, y2, x, y) >= 0; double checkSide2 = side(x2, y2, x3, y3, x, y) >= 0; double checkSide3 = side(x3, y3, x1, y1, x, y) >= 0; return checkSide1 && checkSide2 && checkSide3; } bool pointInTriangleBoundingBox(double x1, double y1, double x2, double y2, double x3, double y3, double x, double y) { double xMin = min(x1, min(x2, x3)) - EPS; double xMax = max(x1, max(x2, x3)) + EPS; double yMin = min(y1, min(y2, y3)) - EPS; double yMax = max(y1, max(y2, y3)) + EPS; return !(x < xMin || xMax < x || y < yMin || yMax < y); } double distanceSquarePointToSegment(double x1, double y1, double x2, double y2, double x, double y) { double p1_p2_squareLength = (x2 - x1) * (x2 - x1) + (y2 - y1) * (y2 - y1); double dotProduct = ((x - x1) * (x2 - x1) + (y - y1) * (y2 - y1)) / p1_p2_squareLength; if (dotProduct < 0) { return (x - x1) * (x - x1) + (y - y1) * (y - y1); } else if (dotProduct <= 1) { double p_p1_squareLength = (x1 - x) * (x1 - x) + (y1 - y) * (y1 - y); return p_p1_squareLength - dotProduct * dotProduct * p1_p2_squareLength; } else { return (x - x2) * (x - x2) + (y - y2) * (y - y2); } } bool accuratePointInTriangle(double x1, double y1, double x2, double y2, double x3, double y3, double x, double y) { if (!pointInTriangleBoundingBox(x1, y1, x2, y2, x3, y3, x, y)) { return false; } if (naivePointInTriangle(x1, y1, x2, y2, x3, y3, x, y)) { return true; } if (distanceSquarePointToSegment(x1, y1, x2, y2, x, y) <= EPS_SQUARE) { return true; } if (distanceSquarePointToSegment(x2, y2, x3, y3, x, y) <= EPS_SQUARE) { return true; } if (distanceSquarePointToSegment(x3, y3, x1, y1, x, y) <= EPS_SQUARE) { return true; } return false; } void printPoint(double x, double y) { printf("(%f, %f)", x, y); } void printTriangle(double x1, double y1, double x2, double y2, double x3, double y3) { printf("Triangle is ["); printPoint(x1, y1); printf(", "); printPoint(x2, y2); printf(", "); printPoint(x3, y3); printf("] \n"); } void test(double x1, double y1, double x2, double y2, double x3, double y3, double x, double y) { printTriangle(x1, y1, x2, y2, x3, y3); printf("Point "); printPoint(x, y); printf(" is within triangle? "); if (accuratePointInTriangle(x1, y1, x2, y2, x3, y3, x, y)) { printf("true\n"); } else { printf("false\n"); } } int main() { test(1.5, 2.4, 5.1, -3.1, -3.8, 1.2, 0, 0); test(1.5, 2.4, 5.1, -3.1, -3.8, 1.2, 0, 1); test(1.5, 2.4, 5.1, -3.1, -3.8, 1.2, 3, 1); printf("\n"); test(0.1, 0.1111111111111111, 12.5, 33.333333333333336, 25, 11.11111111111111, 5.414285714285714, 14.349206349206348); printf("\n"); test(0.1, 0.1111111111111111, 12.5, 33.333333333333336, -12.5, 16.666666666666668, 5.414285714285714, 14.349206349206348); printf("\n"); return 0; }
import java.util.Objects; public class FindTriangle { private static final double EPS = 0.001; private static final double EPS_SQUARE = EPS * EPS; public static class Point { private final double x, y; public Point(double x, double y) { this.x = x; this.y = y; } public double getX() { return x; } public double getY() { return y; } @Override public String toString() { return String.format("(%f, %f)", x, y); } } public static class Triangle { private final Point p1, p2, p3; public Triangle(Point p1, Point p2, Point p3) { this.p1 = Objects.requireNonNull(p1); this.p2 = Objects.requireNonNull(p2); this.p3 = Objects.requireNonNull(p3); } public Point getP1() { return p1; } public Point getP2() { return p2; } public Point getP3() { return p3; } private boolean pointInTriangleBoundingBox(Point p) { var xMin = Math.min(p1.getX(), Math.min(p2.getX(), p3.getX())) - EPS; var xMax = Math.max(p1.getX(), Math.max(p2.getX(), p3.getX())) + EPS; var yMin = Math.min(p1.getY(), Math.min(p2.getY(), p3.getY())) - EPS; var yMax = Math.max(p1.getY(), Math.max(p2.getY(), p3.getY())) + EPS; return !(p.getX() < xMin || xMax < p.getX() || p.getY() < yMin || yMax < p.getY()); } private static double side(Point p1, Point p2, Point p) { return (p2.getY() - p1.getY()) * (p.getX() - p1.getX()) + (-p2.getX() + p1.getX()) * (p.getY() - p1.getY()); } private boolean nativePointInTriangle(Point p) { boolean checkSide1 = side(p1, p2, p) >= 0; boolean checkSide2 = side(p2, p3, p) >= 0; boolean checkSide3 = side(p3, p1, p) >= 0; return checkSide1 && checkSide2 && checkSide3; } private double distanceSquarePointToSegment(Point p1, Point p2, Point p) { double p1_p2_squareLength = (p2.getX() - p1.getX()) * (p2.getX() - p1.getX()) + (p2.getY() - p1.getY()) * (p2.getY() - p1.getY()); double dotProduct = ((p.getX() - p1.getX()) * (p2.getX() - p1.getX()) + (p.getY() - p1.getY()) * (p2.getY() - p1.getY())) / p1_p2_squareLength; if (dotProduct < 0) { return (p.getX() - p1.getX()) * (p.getX() - p1.getX()) + (p.getY() - p1.getY()) * (p.getY() - p1.getY()); } if (dotProduct <= 1) { double p_p1_squareLength = (p1.getX() - p.getX()) * (p1.getX() - p.getX()) + (p1.getY() - p.getY()) * (p1.getY() - p.getY()); return p_p1_squareLength - dotProduct * dotProduct * p1_p2_squareLength; } return (p.getX() - p2.getX()) * (p.getX() - p2.getX()) + (p.getY() - p2.getY()) * (p.getY() - p2.getY()); } private boolean accuratePointInTriangle(Point p) { if (!pointInTriangleBoundingBox(p)) { return false; } if (nativePointInTriangle(p)) { return true; } if (distanceSquarePointToSegment(p1, p2, p) <= EPS_SQUARE) { return true; } if (distanceSquarePointToSegment(p2, p3, p) <= EPS_SQUARE) { return true; } return distanceSquarePointToSegment(p3, p1, p) <= EPS_SQUARE; } public boolean within(Point p) { Objects.requireNonNull(p); return accuratePointInTriangle(p); } @Override public String toString() { return String.format("Triangle[%s, %s, %s]", p1, p2, p3); } } private static void test(Triangle t, Point p) { System.out.println(t); System.out.printf("Point %s is within triangle? %s\n", p, t.within(p)); } public static void main(String[] args) { var p1 = new Point(1.5, 2.4); var p2 = new Point(5.1, -3.1); var p3 = new Point(-3.8, 1.2); var tri = new Triangle(p1, p2, p3); test(tri, new Point(0, 0)); test(tri, new Point(0, 1)); test(tri, new Point(3, 1)); System.out.println(); p1 = new Point(1.0 / 10, 1.0 / 9); p2 = new Point(100.0 / 8, 100.0 / 3); p3 = new Point(100.0 / 4, 100.0 / 9); tri = new Triangle(p1, p2, p3); var pt = new Point(p1.getX() + (3.0 / 7) * (p2.getX() - p1.getX()), p1.getY() + (3.0 / 7) * (p2.getY() - p1.getY())); test(tri, pt); System.out.println(); p3 = new Point(-100.0 / 8, 100.0 / 6); tri = new Triangle(p1, p2, p3); test(tri, pt); } }
Can you help me rewrite this code in Java instead of C, keeping it the same logically?
#include <stdbool.h> #include <stdio.h> #include <stdlib.h> const double EPS = 0.001; const double EPS_SQUARE = 0.000001; double side(double x1, double y1, double x2, double y2, double x, double y) { return (y2 - y1) * (x - x1) + (-x2 + x1) * (y - y1); } bool naivePointInTriangle(double x1, double y1, double x2, double y2, double x3, double y3, double x, double y) { double checkSide1 = side(x1, y1, x2, y2, x, y) >= 0; double checkSide2 = side(x2, y2, x3, y3, x, y) >= 0; double checkSide3 = side(x3, y3, x1, y1, x, y) >= 0; return checkSide1 && checkSide2 && checkSide3; } bool pointInTriangleBoundingBox(double x1, double y1, double x2, double y2, double x3, double y3, double x, double y) { double xMin = min(x1, min(x2, x3)) - EPS; double xMax = max(x1, max(x2, x3)) + EPS; double yMin = min(y1, min(y2, y3)) - EPS; double yMax = max(y1, max(y2, y3)) + EPS; return !(x < xMin || xMax < x || y < yMin || yMax < y); } double distanceSquarePointToSegment(double x1, double y1, double x2, double y2, double x, double y) { double p1_p2_squareLength = (x2 - x1) * (x2 - x1) + (y2 - y1) * (y2 - y1); double dotProduct = ((x - x1) * (x2 - x1) + (y - y1) * (y2 - y1)) / p1_p2_squareLength; if (dotProduct < 0) { return (x - x1) * (x - x1) + (y - y1) * (y - y1); } else if (dotProduct <= 1) { double p_p1_squareLength = (x1 - x) * (x1 - x) + (y1 - y) * (y1 - y); return p_p1_squareLength - dotProduct * dotProduct * p1_p2_squareLength; } else { return (x - x2) * (x - x2) + (y - y2) * (y - y2); } } bool accuratePointInTriangle(double x1, double y1, double x2, double y2, double x3, double y3, double x, double y) { if (!pointInTriangleBoundingBox(x1, y1, x2, y2, x3, y3, x, y)) { return false; } if (naivePointInTriangle(x1, y1, x2, y2, x3, y3, x, y)) { return true; } if (distanceSquarePointToSegment(x1, y1, x2, y2, x, y) <= EPS_SQUARE) { return true; } if (distanceSquarePointToSegment(x2, y2, x3, y3, x, y) <= EPS_SQUARE) { return true; } if (distanceSquarePointToSegment(x3, y3, x1, y1, x, y) <= EPS_SQUARE) { return true; } return false; } void printPoint(double x, double y) { printf("(%f, %f)", x, y); } void printTriangle(double x1, double y1, double x2, double y2, double x3, double y3) { printf("Triangle is ["); printPoint(x1, y1); printf(", "); printPoint(x2, y2); printf(", "); printPoint(x3, y3); printf("] \n"); } void test(double x1, double y1, double x2, double y2, double x3, double y3, double x, double y) { printTriangle(x1, y1, x2, y2, x3, y3); printf("Point "); printPoint(x, y); printf(" is within triangle? "); if (accuratePointInTriangle(x1, y1, x2, y2, x3, y3, x, y)) { printf("true\n"); } else { printf("false\n"); } } int main() { test(1.5, 2.4, 5.1, -3.1, -3.8, 1.2, 0, 0); test(1.5, 2.4, 5.1, -3.1, -3.8, 1.2, 0, 1); test(1.5, 2.4, 5.1, -3.1, -3.8, 1.2, 3, 1); printf("\n"); test(0.1, 0.1111111111111111, 12.5, 33.333333333333336, 25, 11.11111111111111, 5.414285714285714, 14.349206349206348); printf("\n"); test(0.1, 0.1111111111111111, 12.5, 33.333333333333336, -12.5, 16.666666666666668, 5.414285714285714, 14.349206349206348); printf("\n"); return 0; }
import java.util.Objects; public class FindTriangle { private static final double EPS = 0.001; private static final double EPS_SQUARE = EPS * EPS; public static class Point { private final double x, y; public Point(double x, double y) { this.x = x; this.y = y; } public double getX() { return x; } public double getY() { return y; } @Override public String toString() { return String.format("(%f, %f)", x, y); } } public static class Triangle { private final Point p1, p2, p3; public Triangle(Point p1, Point p2, Point p3) { this.p1 = Objects.requireNonNull(p1); this.p2 = Objects.requireNonNull(p2); this.p3 = Objects.requireNonNull(p3); } public Point getP1() { return p1; } public Point getP2() { return p2; } public Point getP3() { return p3; } private boolean pointInTriangleBoundingBox(Point p) { var xMin = Math.min(p1.getX(), Math.min(p2.getX(), p3.getX())) - EPS; var xMax = Math.max(p1.getX(), Math.max(p2.getX(), p3.getX())) + EPS; var yMin = Math.min(p1.getY(), Math.min(p2.getY(), p3.getY())) - EPS; var yMax = Math.max(p1.getY(), Math.max(p2.getY(), p3.getY())) + EPS; return !(p.getX() < xMin || xMax < p.getX() || p.getY() < yMin || yMax < p.getY()); } private static double side(Point p1, Point p2, Point p) { return (p2.getY() - p1.getY()) * (p.getX() - p1.getX()) + (-p2.getX() + p1.getX()) * (p.getY() - p1.getY()); } private boolean nativePointInTriangle(Point p) { boolean checkSide1 = side(p1, p2, p) >= 0; boolean checkSide2 = side(p2, p3, p) >= 0; boolean checkSide3 = side(p3, p1, p) >= 0; return checkSide1 && checkSide2 && checkSide3; } private double distanceSquarePointToSegment(Point p1, Point p2, Point p) { double p1_p2_squareLength = (p2.getX() - p1.getX()) * (p2.getX() - p1.getX()) + (p2.getY() - p1.getY()) * (p2.getY() - p1.getY()); double dotProduct = ((p.getX() - p1.getX()) * (p2.getX() - p1.getX()) + (p.getY() - p1.getY()) * (p2.getY() - p1.getY())) / p1_p2_squareLength; if (dotProduct < 0) { return (p.getX() - p1.getX()) * (p.getX() - p1.getX()) + (p.getY() - p1.getY()) * (p.getY() - p1.getY()); } if (dotProduct <= 1) { double p_p1_squareLength = (p1.getX() - p.getX()) * (p1.getX() - p.getX()) + (p1.getY() - p.getY()) * (p1.getY() - p.getY()); return p_p1_squareLength - dotProduct * dotProduct * p1_p2_squareLength; } return (p.getX() - p2.getX()) * (p.getX() - p2.getX()) + (p.getY() - p2.getY()) * (p.getY() - p2.getY()); } private boolean accuratePointInTriangle(Point p) { if (!pointInTriangleBoundingBox(p)) { return false; } if (nativePointInTriangle(p)) { return true; } if (distanceSquarePointToSegment(p1, p2, p) <= EPS_SQUARE) { return true; } if (distanceSquarePointToSegment(p2, p3, p) <= EPS_SQUARE) { return true; } return distanceSquarePointToSegment(p3, p1, p) <= EPS_SQUARE; } public boolean within(Point p) { Objects.requireNonNull(p); return accuratePointInTriangle(p); } @Override public String toString() { return String.format("Triangle[%s, %s, %s]", p1, p2, p3); } } private static void test(Triangle t, Point p) { System.out.println(t); System.out.printf("Point %s is within triangle? %s\n", p, t.within(p)); } public static void main(String[] args) { var p1 = new Point(1.5, 2.4); var p2 = new Point(5.1, -3.1); var p3 = new Point(-3.8, 1.2); var tri = new Triangle(p1, p2, p3); test(tri, new Point(0, 0)); test(tri, new Point(0, 1)); test(tri, new Point(3, 1)); System.out.println(); p1 = new Point(1.0 / 10, 1.0 / 9); p2 = new Point(100.0 / 8, 100.0 / 3); p3 = new Point(100.0 / 4, 100.0 / 9); tri = new Triangle(p1, p2, p3); var pt = new Point(p1.getX() + (3.0 / 7) * (p2.getX() - p1.getX()), p1.getY() + (3.0 / 7) * (p2.getY() - p1.getY())); test(tri, pt); System.out.println(); p3 = new Point(-100.0 / 8, 100.0 / 6); tri = new Triangle(p1, p2, p3); test(tri, pt); } }
Can you help me rewrite this code in Java instead of C, keeping it the same logically?
#include <stdbool.h> #include <stdio.h> #include <stdlib.h> const double EPS = 0.001; const double EPS_SQUARE = 0.000001; double side(double x1, double y1, double x2, double y2, double x, double y) { return (y2 - y1) * (x - x1) + (-x2 + x1) * (y - y1); } bool naivePointInTriangle(double x1, double y1, double x2, double y2, double x3, double y3, double x, double y) { double checkSide1 = side(x1, y1, x2, y2, x, y) >= 0; double checkSide2 = side(x2, y2, x3, y3, x, y) >= 0; double checkSide3 = side(x3, y3, x1, y1, x, y) >= 0; return checkSide1 && checkSide2 && checkSide3; } bool pointInTriangleBoundingBox(double x1, double y1, double x2, double y2, double x3, double y3, double x, double y) { double xMin = min(x1, min(x2, x3)) - EPS; double xMax = max(x1, max(x2, x3)) + EPS; double yMin = min(y1, min(y2, y3)) - EPS; double yMax = max(y1, max(y2, y3)) + EPS; return !(x < xMin || xMax < x || y < yMin || yMax < y); } double distanceSquarePointToSegment(double x1, double y1, double x2, double y2, double x, double y) { double p1_p2_squareLength = (x2 - x1) * (x2 - x1) + (y2 - y1) * (y2 - y1); double dotProduct = ((x - x1) * (x2 - x1) + (y - y1) * (y2 - y1)) / p1_p2_squareLength; if (dotProduct < 0) { return (x - x1) * (x - x1) + (y - y1) * (y - y1); } else if (dotProduct <= 1) { double p_p1_squareLength = (x1 - x) * (x1 - x) + (y1 - y) * (y1 - y); return p_p1_squareLength - dotProduct * dotProduct * p1_p2_squareLength; } else { return (x - x2) * (x - x2) + (y - y2) * (y - y2); } } bool accuratePointInTriangle(double x1, double y1, double x2, double y2, double x3, double y3, double x, double y) { if (!pointInTriangleBoundingBox(x1, y1, x2, y2, x3, y3, x, y)) { return false; } if (naivePointInTriangle(x1, y1, x2, y2, x3, y3, x, y)) { return true; } if (distanceSquarePointToSegment(x1, y1, x2, y2, x, y) <= EPS_SQUARE) { return true; } if (distanceSquarePointToSegment(x2, y2, x3, y3, x, y) <= EPS_SQUARE) { return true; } if (distanceSquarePointToSegment(x3, y3, x1, y1, x, y) <= EPS_SQUARE) { return true; } return false; } void printPoint(double x, double y) { printf("(%f, %f)", x, y); } void printTriangle(double x1, double y1, double x2, double y2, double x3, double y3) { printf("Triangle is ["); printPoint(x1, y1); printf(", "); printPoint(x2, y2); printf(", "); printPoint(x3, y3); printf("] \n"); } void test(double x1, double y1, double x2, double y2, double x3, double y3, double x, double y) { printTriangle(x1, y1, x2, y2, x3, y3); printf("Point "); printPoint(x, y); printf(" is within triangle? "); if (accuratePointInTriangle(x1, y1, x2, y2, x3, y3, x, y)) { printf("true\n"); } else { printf("false\n"); } } int main() { test(1.5, 2.4, 5.1, -3.1, -3.8, 1.2, 0, 0); test(1.5, 2.4, 5.1, -3.1, -3.8, 1.2, 0, 1); test(1.5, 2.4, 5.1, -3.1, -3.8, 1.2, 3, 1); printf("\n"); test(0.1, 0.1111111111111111, 12.5, 33.333333333333336, 25, 11.11111111111111, 5.414285714285714, 14.349206349206348); printf("\n"); test(0.1, 0.1111111111111111, 12.5, 33.333333333333336, -12.5, 16.666666666666668, 5.414285714285714, 14.349206349206348); printf("\n"); return 0; }
import java.util.Objects; public class FindTriangle { private static final double EPS = 0.001; private static final double EPS_SQUARE = EPS * EPS; public static class Point { private final double x, y; public Point(double x, double y) { this.x = x; this.y = y; } public double getX() { return x; } public double getY() { return y; } @Override public String toString() { return String.format("(%f, %f)", x, y); } } public static class Triangle { private final Point p1, p2, p3; public Triangle(Point p1, Point p2, Point p3) { this.p1 = Objects.requireNonNull(p1); this.p2 = Objects.requireNonNull(p2); this.p3 = Objects.requireNonNull(p3); } public Point getP1() { return p1; } public Point getP2() { return p2; } public Point getP3() { return p3; } private boolean pointInTriangleBoundingBox(Point p) { var xMin = Math.min(p1.getX(), Math.min(p2.getX(), p3.getX())) - EPS; var xMax = Math.max(p1.getX(), Math.max(p2.getX(), p3.getX())) + EPS; var yMin = Math.min(p1.getY(), Math.min(p2.getY(), p3.getY())) - EPS; var yMax = Math.max(p1.getY(), Math.max(p2.getY(), p3.getY())) + EPS; return !(p.getX() < xMin || xMax < p.getX() || p.getY() < yMin || yMax < p.getY()); } private static double side(Point p1, Point p2, Point p) { return (p2.getY() - p1.getY()) * (p.getX() - p1.getX()) + (-p2.getX() + p1.getX()) * (p.getY() - p1.getY()); } private boolean nativePointInTriangle(Point p) { boolean checkSide1 = side(p1, p2, p) >= 0; boolean checkSide2 = side(p2, p3, p) >= 0; boolean checkSide3 = side(p3, p1, p) >= 0; return checkSide1 && checkSide2 && checkSide3; } private double distanceSquarePointToSegment(Point p1, Point p2, Point p) { double p1_p2_squareLength = (p2.getX() - p1.getX()) * (p2.getX() - p1.getX()) + (p2.getY() - p1.getY()) * (p2.getY() - p1.getY()); double dotProduct = ((p.getX() - p1.getX()) * (p2.getX() - p1.getX()) + (p.getY() - p1.getY()) * (p2.getY() - p1.getY())) / p1_p2_squareLength; if (dotProduct < 0) { return (p.getX() - p1.getX()) * (p.getX() - p1.getX()) + (p.getY() - p1.getY()) * (p.getY() - p1.getY()); } if (dotProduct <= 1) { double p_p1_squareLength = (p1.getX() - p.getX()) * (p1.getX() - p.getX()) + (p1.getY() - p.getY()) * (p1.getY() - p.getY()); return p_p1_squareLength - dotProduct * dotProduct * p1_p2_squareLength; } return (p.getX() - p2.getX()) * (p.getX() - p2.getX()) + (p.getY() - p2.getY()) * (p.getY() - p2.getY()); } private boolean accuratePointInTriangle(Point p) { if (!pointInTriangleBoundingBox(p)) { return false; } if (nativePointInTriangle(p)) { return true; } if (distanceSquarePointToSegment(p1, p2, p) <= EPS_SQUARE) { return true; } if (distanceSquarePointToSegment(p2, p3, p) <= EPS_SQUARE) { return true; } return distanceSquarePointToSegment(p3, p1, p) <= EPS_SQUARE; } public boolean within(Point p) { Objects.requireNonNull(p); return accuratePointInTriangle(p); } @Override public String toString() { return String.format("Triangle[%s, %s, %s]", p1, p2, p3); } } private static void test(Triangle t, Point p) { System.out.println(t); System.out.printf("Point %s is within triangle? %s\n", p, t.within(p)); } public static void main(String[] args) { var p1 = new Point(1.5, 2.4); var p2 = new Point(5.1, -3.1); var p3 = new Point(-3.8, 1.2); var tri = new Triangle(p1, p2, p3); test(tri, new Point(0, 0)); test(tri, new Point(0, 1)); test(tri, new Point(3, 1)); System.out.println(); p1 = new Point(1.0 / 10, 1.0 / 9); p2 = new Point(100.0 / 8, 100.0 / 3); p3 = new Point(100.0 / 4, 100.0 / 9); tri = new Triangle(p1, p2, p3); var pt = new Point(p1.getX() + (3.0 / 7) * (p2.getX() - p1.getX()), p1.getY() + (3.0 / 7) * (p2.getY() - p1.getY())); test(tri, pt); System.out.println(); p3 = new Point(-100.0 / 8, 100.0 / 6); tri = new Triangle(p1, p2, p3); test(tri, pt); } }
Keep all operations the same but rewrite the snippet in Java.
#include <stdio.h> unsigned int divisor_count(unsigned int n) { unsigned int total = 1; for (; (n & 1) == 0; n >>= 1) { ++total; } for (unsigned int p = 3; p * p <= n; p += 2) { unsigned int count = 1; for (; n % p == 0; n /= p) { ++count; } total *= count; } if (n > 1) { total *= 2; } return total; } int main() { const unsigned int limit = 100; unsigned int n; printf("Count of divisors for the first %d positive integers:\n", limit); for (n = 1; n <= limit; ++n) { printf("%3d", divisor_count(n)); if (n % 20 == 0) { printf("\n"); } } return 0; }
public class TauFunction { private static long divisorCount(long n) { long total = 1; for (; (n & 1) == 0; n >>= 1) { ++total; } for (long p = 3; p * p <= n; p += 2) { long count = 1; for (; n % p == 0; n /= p) { ++count; } total *= count; } if (n > 1) { total *= 2; } return total; } public static void main(String[] args) { final int limit = 100; System.out.printf("Count of divisors for the first %d positive integers:\n", limit); for (long n = 1; n <= limit; ++n) { System.out.printf("%3d", divisorCount(n)); if (n % 20 == 0) { System.out.println(); } } } }
Maintain the same structure and functionality when rewriting this code in Java.
#include <stdio.h> unsigned int divisor_count(unsigned int n) { unsigned int total = 1; for (; (n & 1) == 0; n >>= 1) { ++total; } for (unsigned int p = 3; p * p <= n; p += 2) { unsigned int count = 1; for (; n % p == 0; n /= p) { ++count; } total *= count; } if (n > 1) { total *= 2; } return total; } int main() { const unsigned int limit = 100; unsigned int n; printf("Count of divisors for the first %d positive integers:\n", limit); for (n = 1; n <= limit; ++n) { printf("%3d", divisor_count(n)); if (n % 20 == 0) { printf("\n"); } } return 0; }
public class TauFunction { private static long divisorCount(long n) { long total = 1; for (; (n & 1) == 0; n >>= 1) { ++total; } for (long p = 3; p * p <= n; p += 2) { long count = 1; for (; n % p == 0; n /= p) { ++count; } total *= count; } if (n > 1) { total *= 2; } return total; } public static void main(String[] args) { final int limit = 100; System.out.printf("Count of divisors for the first %d positive integers:\n", limit); for (long n = 1; n <= limit; ++n) { System.out.printf("%3d", divisorCount(n)); if (n % 20 == 0) { System.out.println(); } } } }
Write the same algorithm in Java as shown in this C implementation.
#include <gmp.h> int main(void) { mpz_t p, s; mpz_init_set_ui(p, 1); mpz_init_set_ui(s, 1); for (int n = 1, i = 0; i < 20; n++) { mpz_nextprime(s, s); mpz_mul(p, p, s); mpz_add_ui(p, p, 1); if (mpz_probab_prime_p(p, 25)) { mpz_sub_ui(p, p, 1); gmp_printf("%d\n", n); i++; continue; } mpz_sub_ui(p, p, 2); if (mpz_probab_prime_p(p, 25)) { mpz_add_ui(p, p, 1); gmp_printf("%d\n", n); i++; continue; } mpz_add_ui(p, p, 1); } mpz_clear(s); mpz_clear(p); }
import java.math.BigInteger; public class PrimorialPrimes { final static int sieveLimit = 1550_000; static boolean[] notPrime = sieve(sieveLimit); public static void main(String[] args) { int count = 0; for (int i = 1; i < 1000_000 && count < 20; i++) { BigInteger b = primorial(i); if (b.add(BigInteger.ONE).isProbablePrime(1) || b.subtract(BigInteger.ONE).isProbablePrime(1)) { System.out.printf("%d ", i); count++; } } } static BigInteger primorial(int n) { if (n == 0) return BigInteger.ONE; BigInteger result = BigInteger.ONE; for (int i = 0; i < sieveLimit && n > 0; i++) { if (notPrime[i]) continue; result = result.multiply(BigInteger.valueOf(i)); n--; } return result; } public static boolean[] sieve(int limit) { boolean[] composite = new boolean[limit]; composite[0] = composite[1] = true; int max = (int) Math.sqrt(limit); for (int n = 2; n <= max; n++) { if (!composite[n]) { for (int k = n * n; k < limit; k += n) { composite[k] = true; } } } return composite; } }
Ensure the translated Java code behaves exactly like the original C snippet.
#include <gmp.h> int main(void) { mpz_t p, s; mpz_init_set_ui(p, 1); mpz_init_set_ui(s, 1); for (int n = 1, i = 0; i < 20; n++) { mpz_nextprime(s, s); mpz_mul(p, p, s); mpz_add_ui(p, p, 1); if (mpz_probab_prime_p(p, 25)) { mpz_sub_ui(p, p, 1); gmp_printf("%d\n", n); i++; continue; } mpz_sub_ui(p, p, 2); if (mpz_probab_prime_p(p, 25)) { mpz_add_ui(p, p, 1); gmp_printf("%d\n", n); i++; continue; } mpz_add_ui(p, p, 1); } mpz_clear(s); mpz_clear(p); }
import java.math.BigInteger; public class PrimorialPrimes { final static int sieveLimit = 1550_000; static boolean[] notPrime = sieve(sieveLimit); public static void main(String[] args) { int count = 0; for (int i = 1; i < 1000_000 && count < 20; i++) { BigInteger b = primorial(i); if (b.add(BigInteger.ONE).isProbablePrime(1) || b.subtract(BigInteger.ONE).isProbablePrime(1)) { System.out.printf("%d ", i); count++; } } } static BigInteger primorial(int n) { if (n == 0) return BigInteger.ONE; BigInteger result = BigInteger.ONE; for (int i = 0; i < sieveLimit && n > 0; i++) { if (notPrime[i]) continue; result = result.multiply(BigInteger.valueOf(i)); n--; } return result; } public static boolean[] sieve(int limit) { boolean[] composite = new boolean[limit]; composite[0] = composite[1] = true; int max = (int) Math.sqrt(limit); for (int n = 2; n <= max; n++) { if (!composite[n]) { for (int k = n * n; k < limit; k += n) { composite[k] = true; } } } return composite; } }
Generate an equivalent Java version of this C code.
#include<string.h> #include<stdlib.h> #include<stdio.h> typedef struct genome{ char* strand; int length; struct genome* next; }genome; genome* genomeData; int totalLength = 0, Adenine = 0, Cytosine = 0, Guanine = 0, Thymine = 0; int numDigits(int num){ int len = 1; while(num>10){ num = num/10; len++; } return len; } void buildGenome(char str[100]){ int len = strlen(str),i; genome *genomeIterator, *newGenome; totalLength += len; for(i=0;i<len;i++){ switch(str[i]){ case 'A': Adenine++; break; case 'T': Thymine++; break; case 'C': Cytosine++; break; case 'G': Guanine++; break; }; } if(genomeData==NULL){ genomeData = (genome*)malloc(sizeof(genome)); genomeData->strand = (char*)malloc(len*sizeof(char)); strcpy(genomeData->strand,str); genomeData->length = len; genomeData->next = NULL; } else{ genomeIterator = genomeData; while(genomeIterator->next!=NULL) genomeIterator = genomeIterator->next; newGenome = (genome*)malloc(sizeof(genome)); newGenome->strand = (char*)malloc(len*sizeof(char)); strcpy(newGenome->strand,str); newGenome->length = len; newGenome->next = NULL; genomeIterator->next = newGenome; } } void printGenome(){ genome* genomeIterator = genomeData; int width = numDigits(totalLength), len = 0; printf("Sequence:\n"); while(genomeIterator!=NULL){ printf("\n%*d%3s%3s",width+1,len,":",genomeIterator->strand); len += genomeIterator->length; genomeIterator = genomeIterator->next; } printf("\n\nBase Count\n----------\n\n"); printf("%3c%3s%*d\n",'A',":",width+1,Adenine); printf("%3c%3s%*d\n",'T',":",width+1,Thymine); printf("%3c%3s%*d\n",'C',":",width+1,Cytosine); printf("%3c%3s%*d\n",'G',":",width+1,Guanine); printf("\n%3s%*d\n","Total:",width+1,Adenine + Thymine + Cytosine + Guanine); free(genomeData); } int main(int argc,char** argv) { char str[100]; int counter = 0, len; if(argc!=2){ printf("Usage : %s <Gene file name>\n",argv[0]); return 0; } FILE *fp = fopen(argv[1],"r"); while(fscanf(fp,"%s",str)!=EOF) buildGenome(str); fclose(fp); printGenome(); return 0; }
import java.util.HashMap; import java.util.Map; public class orderedSequence { public static void main(String[] args) { Sequence gene = new Sequence("CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATGCTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTGAGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGATGGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTTCGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGGTCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATATTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTATCGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTGTCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGACGACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT"); gene.runSequence(); } } public class Sequence { private final String seq; public Sequence(String sq) { this.seq = sq; } public void prettyPrint() { System.out.println("Sequence:"); int i = 0; for ( ; i < seq.length() - 50 ; i += 50) { System.out.printf("%5s : %s\n", i + 50, seq.substring(i, i + 50)); } System.out.printf("%5s : %s\n", seq.length(), seq.substring(i)); } public void displayCount() { Map<Character, Integer> counter = new HashMap<>(); for (int i = 0 ; i < seq.length() ; ++i) { counter.merge(seq.charAt(i), 1, Integer::sum); } System.out.println("Base vs. Count:"); counter.forEach( key, value -> System.out.printf("%5s : %s\n", key, value)); System.out.printf("%5s: %s\n", "SUM", seq.length()); } public void runSequence() { this.prettyPrint(); this.displayCount(); } }
Transform the following C implementation into Java, maintaining the same output and logic.
#include<string.h> #include<stdlib.h> #include<stdio.h> typedef struct genome{ char* strand; int length; struct genome* next; }genome; genome* genomeData; int totalLength = 0, Adenine = 0, Cytosine = 0, Guanine = 0, Thymine = 0; int numDigits(int num){ int len = 1; while(num>10){ num = num/10; len++; } return len; } void buildGenome(char str[100]){ int len = strlen(str),i; genome *genomeIterator, *newGenome; totalLength += len; for(i=0;i<len;i++){ switch(str[i]){ case 'A': Adenine++; break; case 'T': Thymine++; break; case 'C': Cytosine++; break; case 'G': Guanine++; break; }; } if(genomeData==NULL){ genomeData = (genome*)malloc(sizeof(genome)); genomeData->strand = (char*)malloc(len*sizeof(char)); strcpy(genomeData->strand,str); genomeData->length = len; genomeData->next = NULL; } else{ genomeIterator = genomeData; while(genomeIterator->next!=NULL) genomeIterator = genomeIterator->next; newGenome = (genome*)malloc(sizeof(genome)); newGenome->strand = (char*)malloc(len*sizeof(char)); strcpy(newGenome->strand,str); newGenome->length = len; newGenome->next = NULL; genomeIterator->next = newGenome; } } void printGenome(){ genome* genomeIterator = genomeData; int width = numDigits(totalLength), len = 0; printf("Sequence:\n"); while(genomeIterator!=NULL){ printf("\n%*d%3s%3s",width+1,len,":",genomeIterator->strand); len += genomeIterator->length; genomeIterator = genomeIterator->next; } printf("\n\nBase Count\n----------\n\n"); printf("%3c%3s%*d\n",'A',":",width+1,Adenine); printf("%3c%3s%*d\n",'T',":",width+1,Thymine); printf("%3c%3s%*d\n",'C',":",width+1,Cytosine); printf("%3c%3s%*d\n",'G',":",width+1,Guanine); printf("\n%3s%*d\n","Total:",width+1,Adenine + Thymine + Cytosine + Guanine); free(genomeData); } int main(int argc,char** argv) { char str[100]; int counter = 0, len; if(argc!=2){ printf("Usage : %s <Gene file name>\n",argv[0]); return 0; } FILE *fp = fopen(argv[1],"r"); while(fscanf(fp,"%s",str)!=EOF) buildGenome(str); fclose(fp); printGenome(); return 0; }
import java.util.HashMap; import java.util.Map; public class orderedSequence { public static void main(String[] args) { Sequence gene = new Sequence("CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATGCTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTGAGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGATGGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTTCGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGGTCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATATTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTATCGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTGTCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGACGACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT"); gene.runSequence(); } } public class Sequence { private final String seq; public Sequence(String sq) { this.seq = sq; } public void prettyPrint() { System.out.println("Sequence:"); int i = 0; for ( ; i < seq.length() - 50 ; i += 50) { System.out.printf("%5s : %s\n", i + 50, seq.substring(i, i + 50)); } System.out.printf("%5s : %s\n", seq.length(), seq.substring(i)); } public void displayCount() { Map<Character, Integer> counter = new HashMap<>(); for (int i = 0 ; i < seq.length() ; ++i) { counter.merge(seq.charAt(i), 1, Integer::sum); } System.out.println("Base vs. Count:"); counter.forEach( key, value -> System.out.printf("%5s : %s\n", key, value)); System.out.printf("%5s: %s\n", "SUM", seq.length()); } public void runSequence() { this.prettyPrint(); this.displayCount(); } }
Rewrite this program in Java while keeping its functionality equivalent to the C version.
#include <pthread.h> #include <stdio.h> #include <stdlib.h> #include <unistd.h> #include <stdarg.h> #define N 5 const char *names[N] = { "Aristotle", "Kant", "Spinoza", "Marx", "Russell" }; pthread_mutex_t forks[N]; #define M 5 const char *topic[M] = { "Spaghetti!", "Life", "Universe", "Everything", "Bathroom" }; #define lock pthread_mutex_lock #define unlock pthread_mutex_unlock #define xy(x, y) printf("\033[%d;%dH", x, y) #define clear_eol(x) print(x, 12, "\033[K") void print(int y, int x, const char *fmt, ...) { static pthread_mutex_t screen = PTHREAD_MUTEX_INITIALIZER; va_list ap; va_start(ap, fmt); lock(&screen); xy(y + 1, x), vprintf(fmt, ap); xy(N + 1, 1), fflush(stdout); unlock(&screen); } void eat(int id) { int f[2], ration, i; f[0] = f[1] = id; f[id & 1] = (id + 1) % N; clear_eol(id); print(id, 12, "..oO (forks, need forks)"); for (i = 0; i < 2; i++) { lock(forks + f[i]); if (!i) clear_eol(id); print(id, 12 + (f[i] != id) * 6, "fork%d", f[i]); sleep(1); } for (i = 0, ration = 3 + rand() % 8; i < ration; i++) print(id, 24 + i * 4, "nom"), sleep(1); for (i = 0; i < 2; i++) unlock(forks + f[i]); } void think(int id) { int i, t; char buf[64] = {0}; do { clear_eol(id); sprintf(buf, "..oO (%s)", topic[t = rand() % M]); for (i = 0; buf[i]; i++) { print(id, i+12, "%c", buf[i]); if (i < 5) usleep(200000); } usleep(500000 + rand() % 1000000); } while (t); } void* philosophize(void *a) { int id = *(int*)a; print(id, 1, "%10s", names[id]); while(1) think(id), eat(id); } int main() { int i, id[N]; pthread_t tid[N]; for (i = 0; i < N; i++) pthread_mutex_init(forks + (id[i] = i), 0); for (i = 0; i < N; i++) pthread_create(tid + i, 0, philosophize, id + i); return pthread_join(tid[0], 0); }
package diningphilosophers; import java.util.ArrayList; import java.util.Random; import java.util.concurrent.atomic.AtomicBoolean; import java.util.concurrent.atomic.AtomicInteger; enum PhilosopherState { Get, Eat, Pon } class Fork { public static final int ON_TABLE = -1; static int instances = 0; public int id; public AtomicInteger holder = new AtomicInteger(ON_TABLE); Fork() { id = instances++; } } class Philosopher implements Runnable { static final int maxWaitMs = 100; static AtomicInteger token = new AtomicInteger(0); static int instances = 0; static Random rand = new Random(); AtomicBoolean end = new AtomicBoolean(false); int id; PhilosopherState state = PhilosopherState.Get; Fork left; Fork right; int timesEaten = 0; Philosopher() { id = instances++; left = Main.forks.get(id); right = Main.forks.get((id+1)%Main.philosopherCount); } void sleep() { try { Thread.sleep(rand.nextInt(maxWaitMs)); } catch (InterruptedException ex) {} } void waitForFork(Fork fork) { do { if (fork.holder.get() == Fork.ON_TABLE) { fork.holder.set(id); return; } else { sleep(); } } while (true); } public void run() { do { if (state == PhilosopherState.Pon) { state = PhilosopherState.Get; } else { if (token.get() == id) { waitForFork(left); waitForFork(right); token.set((id+2)% Main.philosopherCount); state = PhilosopherState.Eat; timesEaten++; sleep(); left.holder.set(Fork.ON_TABLE); right.holder.set(Fork.ON_TABLE); state = PhilosopherState.Pon; sleep(); } else { sleep(); } } } while (!end.get()); } } public class Main { static final int philosopherCount = 5; static final int runSeconds = 15; static ArrayList<Fork> forks = new ArrayList<Fork>(); static ArrayList<Philosopher> philosophers = new ArrayList<Philosopher>(); public static void main(String[] args) { for (int i = 0 ; i < philosopherCount ; i++) forks.add(new Fork()); for (int i = 0 ; i < philosopherCount ; i++) philosophers.add(new Philosopher()); for (Philosopher p : philosophers) new Thread(p).start(); long endTime = System.currentTimeMillis() + (runSeconds * 1000); do { StringBuilder sb = new StringBuilder("|"); for (Philosopher p : philosophers) { sb.append(p.state.toString()); sb.append("|"); } sb.append(" |"); for (Fork f : forks) { int holder = f.holder.get(); sb.append(holder==-1?" ":String.format("P%02d",holder)); sb.append("|"); } System.out.println(sb.toString()); try {Thread.sleep(1000);} catch (Exception ex) {} } while (System.currentTimeMillis() < endTime); for (Philosopher p : philosophers) p.end.set(true); for (Philosopher p : philosophers) System.out.printf("P%02d: ate %,d times, %,d/sec\n", p.id, p.timesEaten, p.timesEaten/runSeconds); } }
Preserve the algorithm and functionality while converting the code from C to Java.
#include <stdio.h> int main() { int n, b, d; unsigned long long i, j, sum, fact[12]; fact[0] = 1; for (n = 1; n < 12; ++n) { fact[n] = fact[n-1] * n; } for (b = 9; b <= 12; ++b) { printf("The factorions for base %d are:\n", b); for (i = 1; i < 1500000; ++i) { sum = 0; j = i; while (j > 0) { d = j % b; sum += fact[d]; j /= b; } if (sum == i) printf("%llu ", i); } printf("\n\n"); } return 0; }
public class Factorion { public static void main(String [] args){ System.out.println("Base 9:"); for(int i = 1; i <= 1499999; i++){ String iStri = String.valueOf(i); int multiplied = operate(iStri,9); if(multiplied == i){ System.out.print(i + "\t"); } } System.out.println("\nBase 10:"); for(int i = 1; i <= 1499999; i++){ String iStri = String.valueOf(i); int multiplied = operate(iStri,10); if(multiplied == i){ System.out.print(i + "\t"); } } System.out.println("\nBase 11:"); for(int i = 1; i <= 1499999; i++){ String iStri = String.valueOf(i); int multiplied = operate(iStri,11); if(multiplied == i){ System.out.print(i + "\t"); } } System.out.println("\nBase 12:"); for(int i = 1; i <= 1499999; i++){ String iStri = String.valueOf(i); int multiplied = operate(iStri,12); if(multiplied == i){ System.out.print(i + "\t"); } } } public static int factorialRec(int n){ int result = 1; return n == 0 ? result : result * n * factorialRec(n-1); } public static int operate(String s, int base){ int sum = 0; String strx = fromDeci(base, Integer.parseInt(s)); for(int i = 0; i < strx.length(); i++){ if(strx.charAt(i) == 'A'){ sum += factorialRec(10); }else if(strx.charAt(i) == 'B') { sum += factorialRec(11); }else if(strx.charAt(i) == 'C') { sum += factorialRec(12); }else { sum += factorialRec(Integer.parseInt(String.valueOf(strx.charAt(i)), base)); } } return sum; } static char reVal(int num) { if (num >= 0 && num <= 9) return (char)(num + 48); else return (char)(num - 10 + 65); } static String fromDeci(int base, int num){ StringBuilder s = new StringBuilder(); while (num > 0) { s.append(reVal(num % base)); num /= base; } return new String(new StringBuilder(s).reverse()); } }
Produce a language-to-language conversion: from C to Java, same semantics.
#include <stdio.h> int main() { int n, b, d; unsigned long long i, j, sum, fact[12]; fact[0] = 1; for (n = 1; n < 12; ++n) { fact[n] = fact[n-1] * n; } for (b = 9; b <= 12; ++b) { printf("The factorions for base %d are:\n", b); for (i = 1; i < 1500000; ++i) { sum = 0; j = i; while (j > 0) { d = j % b; sum += fact[d]; j /= b; } if (sum == i) printf("%llu ", i); } printf("\n\n"); } return 0; }
public class Factorion { public static void main(String [] args){ System.out.println("Base 9:"); for(int i = 1; i <= 1499999; i++){ String iStri = String.valueOf(i); int multiplied = operate(iStri,9); if(multiplied == i){ System.out.print(i + "\t"); } } System.out.println("\nBase 10:"); for(int i = 1; i <= 1499999; i++){ String iStri = String.valueOf(i); int multiplied = operate(iStri,10); if(multiplied == i){ System.out.print(i + "\t"); } } System.out.println("\nBase 11:"); for(int i = 1; i <= 1499999; i++){ String iStri = String.valueOf(i); int multiplied = operate(iStri,11); if(multiplied == i){ System.out.print(i + "\t"); } } System.out.println("\nBase 12:"); for(int i = 1; i <= 1499999; i++){ String iStri = String.valueOf(i); int multiplied = operate(iStri,12); if(multiplied == i){ System.out.print(i + "\t"); } } } public static int factorialRec(int n){ int result = 1; return n == 0 ? result : result * n * factorialRec(n-1); } public static int operate(String s, int base){ int sum = 0; String strx = fromDeci(base, Integer.parseInt(s)); for(int i = 0; i < strx.length(); i++){ if(strx.charAt(i) == 'A'){ sum += factorialRec(10); }else if(strx.charAt(i) == 'B') { sum += factorialRec(11); }else if(strx.charAt(i) == 'C') { sum += factorialRec(12); }else { sum += factorialRec(Integer.parseInt(String.valueOf(strx.charAt(i)), base)); } } return sum; } static char reVal(int num) { if (num >= 0 && num <= 9) return (char)(num + 48); else return (char)(num - 10 + 65); } static String fromDeci(int base, int num){ StringBuilder s = new StringBuilder(); while (num > 0) { s.append(reVal(num % base)); num /= base; } return new String(new StringBuilder(s).reverse()); } }
Translate the given C code snippet into Java without altering its behavior.
#include <math.h> #include <stdio.h> const double K = 7.8e9; const int n0 = 27; const double actual[] = { 27, 27, 27, 44, 44, 59, 59, 59, 59, 59, 59, 59, 59, 60, 60, 61, 61, 66, 83, 219, 239, 392, 534, 631, 897, 1350, 2023, 2820, 4587, 6067, 7823, 9826, 11946, 14554, 17372, 20615, 24522, 28273, 31491, 34933, 37552, 40540, 43105, 45177, 60328, 64543, 67103, 69265, 71332, 73327, 75191, 75723, 76719, 77804, 78812, 79339, 80132, 80995, 82101, 83365, 85203, 87024, 89068, 90664, 93077, 95316, 98172, 102133, 105824, 109695, 114232, 118610, 125497, 133852, 143227, 151367, 167418, 180096, 194836, 213150, 242364, 271106, 305117, 338133, 377918, 416845, 468049, 527767, 591704, 656866, 715353, 777796, 851308, 928436, 1000249, 1082054, 1174652 }; const size_t actual_size = sizeof(actual) / sizeof(double); double f(double r) { double sq = 0; size_t i; for (i = 0; i < actual_size; ++i) { double eri = exp(r * i); double guess = (n0 * eri) / (1 + n0 * (eri - 1) / K); double diff = guess - actual[i]; sq += diff * diff; } return sq; } double solve(double (*fn)(double), double guess, double epsilon) { double delta, f0, factor; for (delta = guess ? guess : 1, f0 = fn(guess), factor = 2; delta > epsilon && guess != guess - delta; delta *= factor) { double nf = (*fn)(guess - delta); if (nf < f0) { f0 = nf; guess -= delta; } else { nf = fn(guess + delta); if (nf < f0) { f0 = nf; guess += delta; } else { factor = 0.5; } } } return guess; } double solve_default(double (*fn)(double)) { return solve(fn, 0.5, 0); } int main() { double r = solve_default(f); double R0 = exp(12 * r); printf("r = %f, R0 = %f\n", r, R0); return 0; }
import java.util.List; import java.util.function.Function; public class LogisticCurveFitting { private static final double K = 7.8e9; private static final int N0 = 27; private static final List<Double> ACTUAL = List.of( 27.0, 27.0, 27.0, 44.0, 44.0, 59.0, 59.0, 59.0, 59.0, 59.0, 59.0, 59.0, 59.0, 60.0, 60.0, 61.0, 61.0, 66.0, 83.0, 219.0, 239.0, 392.0, 534.0, 631.0, 897.0, 1350.0, 2023.0, 2820.0, 4587.0, 6067.0, 7823.0, 9826.0, 11946.0, 14554.0, 17372.0, 20615.0, 24522.0, 28273.0, 31491.0, 34933.0, 37552.0, 40540.0, 43105.0, 45177.0, 60328.0, 64543.0, 67103.0, 69265.0, 71332.0, 73327.0, 75191.0, 75723.0, 76719.0, 77804.0, 78812.0, 79339.0, 80132.0, 80995.0, 82101.0, 83365.0, 85203.0, 87024.0, 89068.0, 90664.0, 93077.0, 95316.0, 98172.0, 102133.0, 105824.0, 109695.0, 114232.0, 118610.0, 125497.0, 133852.0, 143227.0, 151367.0, 167418.0, 180096.0, 194836.0, 213150.0, 242364.0, 271106.0, 305117.0, 338133.0, 377918.0, 416845.0, 468049.0, 527767.0, 591704.0, 656866.0, 715353.0, 777796.0, 851308.0, 928436.0, 1000249.0, 1082054.0, 1174652.0 ); private static double f(double r) { var sq = 0.0; var len = ACTUAL.size(); for (int i = 0; i < len; i++) { var eri = Math.exp(r * i); var guess = (N0 * eri) / (1.0 + N0 * (eri - 1.0) / K); var diff = guess - ACTUAL.get(i); sq += diff * diff; } return sq; } private static double solve(Function<Double, Double> fn) { return solve(fn, 0.5, 0.0); } private static double solve(Function<Double, Double> fn, double guess, double epsilon) { double delta; if (guess != 0.0) { delta = guess; } else { delta = 1.0; } var f0 = fn.apply(guess); var factor = 2.0; while (delta > epsilon && guess != guess - delta) { var nf = fn.apply(guess - delta); if (nf < f0) { f0 = nf; guess -= delta; } else { nf = fn.apply(guess + delta); if (nf < f0) { f0 = nf; guess += delta; } else { factor = 0.5; } } delta *= factor; } return guess; } public static void main(String[] args) { var r = solve(LogisticCurveFitting::f); var r0 = Math.exp(12.0 * r); System.out.printf("r = %.16f, R0 = %.16f\n", r, r0); } }
Please provide an equivalent version of this C code in Java.
#include <stdio.h> typedef struct node_t *node, node_t; struct node_t { int v; node next; }; typedef struct { node head, tail; } slist; void push(slist *l, node e) { if (!l->head) l->head = e; if (l->tail) l->tail->next = e; l->tail = e; } node removehead(slist *l) { node e = l->head; if (e) { l->head = e->next; e->next = 0; } return e; } void join(slist *a, slist *b) { push(a, b->head); a->tail = b->tail; } void merge(slist *a, slist *b) { slist r = {0}; while (a->head && b->head) push(&r, removehead(a->head->v <= b->head->v ? a : b)); join(&r, a->head ? a : b); *a = r; b->head = b->tail = 0; } void sort(int *ar, int len) { node_t all[len]; for (int i = 0; i < len; i++) all[i].v = ar[i], all[i].next = i < len - 1 ? all + i + 1 : 0; slist list = {all, all + len - 1}, rem, strand = {0}, res = {0}; for (node e = 0; list.head; list = rem) { rem.head = rem.tail = 0; while ((e = removehead(&list))) push((!strand.head || e->v >= strand.tail->v) ? &strand : &rem, e); merge(&res, &strand); } for (int i = 0; res.head; i++, res.head = res.head->next) ar[i] = res.head->v; } void show(const char *title, int *x, int len) { printf("%s ", title); for (int i = 0; i < len; i++) printf("%3d ", x[i]); putchar('\n'); } int main(void) { int x[] = {-2,0,-2,5,5,3,-1,-3,5,5,0,2,-4,4,2}; # define SIZE sizeof(x)/sizeof(int) show("before sort:", x, SIZE); sort(x, sizeof(x)/sizeof(int)); show("after sort: ", x, SIZE); return 0; }
import java.util.Arrays; import java.util.LinkedList; public class Strand{ public static <E extends Comparable<? super E>> LinkedList<E> strandSort(LinkedList<E> list){ if(list.size() <= 1) return list; LinkedList<E> result = new LinkedList<E>(); while(list.size() > 0){ LinkedList<E> sorted = new LinkedList<E>(); sorted.add(list.removeFirst()); for(Iterator<E> it = list.iterator(); it.hasNext(); ){ E elem = it.next(); if(sorted.peekLast().compareTo(elem) <= 0){ sorted.addLast(elem); it.remove(); } } result = merge(sorted, result); } return result; } private static <E extends Comparable<? super E>> LinkedList<E> merge(LinkedList<E> left, LinkedList<E> right){ LinkedList<E> result = new LinkedList<E>(); while(!left.isEmpty() && !right.isEmpty()){ if(left.peek().compareTo(right.peek()) <= 0) result.add(left.remove()); else result.add(right.remove()); } result.addAll(left); result.addAll(right); return result; } public static void main(String[] args){ System.out.println(strandSort(new LinkedList<Integer>(Arrays.asList(3,1,2,4,5)))); System.out.println(strandSort(new LinkedList<Integer>(Arrays.asList(3,3,1,2,4,5)))); System.out.println(strandSort(new LinkedList<Integer>(Arrays.asList(3,3,1,2,4,3,5,6)))); } }
Generate a Java translation of this C snippet without changing its computational steps.
#include <stdbool.h> #include <stdio.h> #include <string.h> void memoizeIsPrime( bool * result, const int N ) { result[2] = true; result[3] = true; int prime[N]; prime[0] = 3; int end = 1; for (int n = 5; n < N; n += 2) { bool n_is_prime = true; for (int i = 0; i < end; ++i) { const int PRIME = prime[i]; if (n % PRIME == 0) { n_is_prime = false; break; } if (PRIME * PRIME > n) { break; } } if (n_is_prime) { prime[end++] = n; result[n] = true; } } } int sumOfDecimalDigits( int n ) { int sum = 0; while (n > 0) { sum += n % 10; n /= 10; } return sum; } int main( void ) { const int N = 500; printf( "Rosetta Code: additive primes less than %d:\n", N ); bool is_prime[N]; memset( is_prime, 0, sizeof(is_prime) ); memoizeIsPrime( is_prime, N ); printf( " 2" ); int count = 1; for (int i = 3; i < N; i += 2) { if (is_prime[i] && is_prime[sumOfDecimalDigits( i )]) { printf( "%4d", i ); ++count; if ((count % 10) == 0) { printf( "\n" ); } } } printf( "\nThose were %d additive primes.\n", count ); return 0; }
public class additivePrimes { public static void main(String[] args) { int additive_primes = 0; for (int i = 2; i < 500; i++) { if(isPrime(i) && isPrime(digitSum(i))){ additive_primes++; System.out.print(i + " "); } } System.out.print("\nFound " + additive_primes + " additive primes less than 500"); } static boolean isPrime(int n) { int counter = 1; if (n < 2 || (n != 2 && n % 2 == 0) || (n != 3 && n % 3 == 0)) { return false; } while (counter * 6 - 1 <= Math.sqrt(n)) { if (n % (counter * 6 - 1) == 0 || n % (counter * 6 + 1) == 0) { return false; } else { counter++; } } return true; } static int digitSum(int n) { int sum = 0; while (n > 0) { sum += n % 10; n /= 10; } return sum; } }
Ensure the translated Java code behaves exactly like the original C snippet.
#include<stdlib.h> #include<stdio.h> long totient(long n){ long tot = n,i; for(i=2;i*i<=n;i+=2){ if(n%i==0){ while(n%i==0) n/=i; tot-=tot/i; } if(i==2) i=1; } if(n>1) tot-=tot/n; return tot; } long* perfectTotients(long n){ long *ptList = (long*)malloc(n*sizeof(long)), m,count=0,sum,tot; for(m=1;count<n;m++){ tot = m; sum = 0; while(tot != 1){ tot = totient(tot); sum += tot; } if(sum == m) ptList[count++] = m; } return ptList; } long main(long argC, char* argV[]) { long *ptList,i,n; if(argC!=2) printf("Usage : %s <number of perfect Totient numbers required>",argV[0]); else{ n = atoi(argV[1]); ptList = perfectTotients(n); printf("The first %d perfect Totient numbers are : \n[",n); for(i=0;i<n;i++) printf(" %d,",ptList[i]); printf("\b]"); } return 0; }
import java.util.ArrayList; import java.util.List; public class PerfectTotientNumbers { public static void main(String[] args) { computePhi(); int n = 20; System.out.printf("The first %d perfect totient numbers:%n%s%n", n, perfectTotient(n)); } private static final List<Integer> perfectTotient(int n) { int test = 2; List<Integer> results = new ArrayList<Integer>(); for ( int i = 0 ; i < n ; test++ ) { int phiLoop = test; int sum = 0; do { phiLoop = phi[phiLoop]; sum += phiLoop; } while ( phiLoop > 1); if ( sum == test ) { i++; results.add(test); } } return results; } private static final int max = 100000; private static final int[] phi = new int[max+1]; private static final void computePhi() { for ( int i = 1 ; i <= max ; i++ ) { phi[i] = i; } for ( int i = 2 ; i <= max ; i++ ) { if (phi[i] < i) continue; for ( int j = i ; j <= max ; j += i ) { phi[j] -= phi[j] / i; } } } }