Instruction
stringlengths
45
106
input_code
stringlengths
1
13.7k
output_code
stringlengths
1
13.7k
Change the programming language of this snippet from C++ to Python without modifying what it does.
#include <string> #include <boost/regex.hpp> #include <iostream> std::string csvToHTML( const std::string & ) ; int main( ) { std::string text = "Character,Speech\n" "The multitude,The messiah! Show us the messiah!\n" "Brians mother,<angry>Now you listen here! He's not the messiah; he's a very naughty boy! Now go away!</angry>\n" "The multitude,Who are you?\n" "Brians mother,I'm his mother; that's who!\n" "The multitude,Behold his mother! Behold his mother!\n" ; std::cout << csvToHTML( text ) ; return 0 ; } std::string csvToHTML( const std::string & csvtext ) { std::string regexes[ 5 ] = { "<" , ">" , "^(.+?)\\b" , "," , "\n" } ; const char* replacements [ 5 ] = { "&lt;" , "&gt;" , " <TR><TD>$1" , "</TD><TD>", "</TD></TR>\n" } ; boost::regex e1( regexes[ 0 ] ) ; std::string tabletext = boost::regex_replace( csvtext , e1 , replacements[ 0 ] , boost::match_default | boost::format_all ) ; for ( int i = 1 ; i < 5 ; i++ ) { e1.assign( regexes[ i ] ) ; tabletext = boost::regex_replace( tabletext , e1 , replacements[ i ] , boost::match_default | boost::format_all ) ; } tabletext = std::string( "<TABLE>\n" ) + tabletext ; tabletext.append( "</TABLE>\n" ) ; return tabletext ; }
csvtxt = from cgi import escape def _row2tr(row, attr=None): cols = escape(row).split(',') return ('<TR>' + ''.join('<TD>%s</TD>' % data for data in cols) + '</TR>') def csv2html(txt): htmltxt = '<TABLE summary="csv2html program output">\n' for rownum, row in enumerate(txt.split('\n')): htmlrow = _row2tr(row) htmlrow = ' <TBODY>%s</TBODY>\n' % htmlrow htmltxt += htmlrow htmltxt += '</TABLE>\n' return htmltxt htmltxt = csv2html(csvtxt) print(htmltxt)
Maintain the same structure and functionality when rewriting this code in Python.
PRAGMA COMPILER g++ PRAGMA OPTIONS -Wno-write-strings -Wno-pointer-arith -fpermissive OPTION PARSE FALSE '---The class does the declaring for you CLASS Books public: const char* title; const char* author; const char* subject; int book_id; END CLASS '---pointer to an object declaration (we use a class called Books) DECLARE Book1 TYPE Books '--- the correct syntax for class Book1 = Books() '--- initialize the strings const char* in c++ Book1.title = "C++ Programming to bacon " Book1.author = "anyone" Book1.subject ="RECORD Tutorial" Book1.book_id = 1234567 PRINT "Book title  : " ,Book1.title FORMAT "%s%s\n" PRINT "Book author  : ", Book1.author FORMAT "%s%s\n" PRINT "Book subject : ", Book1.subject FORMAT "%s%s\n" PRINT "Book book_id : ", Book1.book_id FORMAT "%s%d\n"
class MyClass: name2 = 2 def __init__(self): self.name1 = 0 def someMethod(self): self.name1 = 1 MyClass.name2 = 3 myclass = MyClass() class MyOtherClass: count = 0 def __init__(self, name, gender="Male", age=None): MyOtherClass.count += 1 self.name = name self.gender = gender if age is not None: self.age = age def __del__(self): MyOtherClass.count -= 1 person1 = MyOtherClass("John") print person1.name, person1.gender print person1.age person2 = MyOtherClass("Jane", "Female", 23) print person2.name, person2.gender, person2.age
Change the following C++ code into Python without altering its purpose.
#include <vector> #include <string> #include <iostream> #include <sstream> #include <algorithm> #include <iterator> #include <utility> long string2long( const std::string & s ) { long result ; std::istringstream( s ) >> result ; return result ; } bool isKaprekar( long number ) { long long squarenumber = ((long long)number) * number ; std::ostringstream numberbuf ; numberbuf << squarenumber ; std::string numberstring = numberbuf.str( ) ; for ( int i = 0 ; i < numberstring.length( ) ; i++ ) { std::string firstpart = numberstring.substr( 0 , i ) , secondpart = numberstring.substr( i ) ; if ( secondpart.find_first_not_of( "0" ) == std::string::npos ) { return false ; } if ( string2long( firstpart ) + string2long( secondpart ) == number ) { return true ; } } return false ; } int main( ) { std::vector<long> kaprekarnumbers ; kaprekarnumbers.push_back( 1 ) ; for ( int i = 2 ; i < 1000001 ; i++ ) { if ( isKaprekar( i ) ) kaprekarnumbers.push_back( i ) ; } std::vector<long>::const_iterator svi = kaprekarnumbers.begin( ) ; std::cout << "Kaprekar numbers up to 10000: \n" ; while ( *svi < 10000 ) { std::cout << *svi << " " ; svi++ ; } std::cout << '\n' ; std::cout << "All the Kaprekar numbers up to 1000000 :\n" ; std::copy( kaprekarnumbers.begin( ) , kaprekarnumbers.end( ) , std::ostream_iterator<long>( std::cout , "\n" ) ) ; std::cout << "There are " << kaprekarnumbers.size( ) << " Kaprekar numbers less than one million!\n" ; return 0 ; }
>>> def k(n): n2 = str(n**2) for i in range(len(n2)): a, b = int(n2[:i] or 0), int(n2[i:]) if b and a + b == n: return n >>> [x for x in range(1,10000) if k(x)] [1, 9, 45, 55, 99, 297, 703, 999, 2223, 2728, 4879, 4950, 5050, 5292, 7272, 7777, 9999] >>> len([x for x in range(1,1000000) if k(x)]) 54 >>>
Change the programming language of this snippet from C++ to Python without modifying what it does.
#include <vector> #include <string> #include <iostream> #include <sstream> #include <algorithm> #include <iterator> #include <utility> long string2long( const std::string & s ) { long result ; std::istringstream( s ) >> result ; return result ; } bool isKaprekar( long number ) { long long squarenumber = ((long long)number) * number ; std::ostringstream numberbuf ; numberbuf << squarenumber ; std::string numberstring = numberbuf.str( ) ; for ( int i = 0 ; i < numberstring.length( ) ; i++ ) { std::string firstpart = numberstring.substr( 0 , i ) , secondpart = numberstring.substr( i ) ; if ( secondpart.find_first_not_of( "0" ) == std::string::npos ) { return false ; } if ( string2long( firstpart ) + string2long( secondpart ) == number ) { return true ; } } return false ; } int main( ) { std::vector<long> kaprekarnumbers ; kaprekarnumbers.push_back( 1 ) ; for ( int i = 2 ; i < 1000001 ; i++ ) { if ( isKaprekar( i ) ) kaprekarnumbers.push_back( i ) ; } std::vector<long>::const_iterator svi = kaprekarnumbers.begin( ) ; std::cout << "Kaprekar numbers up to 10000: \n" ; while ( *svi < 10000 ) { std::cout << *svi << " " ; svi++ ; } std::cout << '\n' ; std::cout << "All the Kaprekar numbers up to 1000000 :\n" ; std::copy( kaprekarnumbers.begin( ) , kaprekarnumbers.end( ) , std::ostream_iterator<long>( std::cout , "\n" ) ) ; std::cout << "There are " << kaprekarnumbers.size( ) << " Kaprekar numbers less than one million!\n" ; return 0 ; }
>>> def k(n): n2 = str(n**2) for i in range(len(n2)): a, b = int(n2[:i] or 0), int(n2[i:]) if b and a + b == n: return n >>> [x for x in range(1,10000) if k(x)] [1, 9, 45, 55, 99, 297, 703, 999, 2223, 2728, 4879, 4950, 5050, 5292, 7272, 7777, 9999] >>> len([x for x in range(1,1000000) if k(x)]) 54 >>>
Produce a language-to-language conversion: from C++ to Python, same semantics.
#include <string> #include <map> template <typename Iterator> Iterator compress(const std::string &uncompressed, Iterator result) { int dictSize = 256; std::map<std::string,int> dictionary; for (int i = 0; i < 256; i++) dictionary[std::string(1, i)] = i; std::string w; for (std::string::const_iterator it = uncompressed.begin(); it != uncompressed.end(); ++it) { char c = *it; std::string wc = w + c; if (dictionary.count(wc)) w = wc; else { *result++ = dictionary[w]; dictionary[wc] = dictSize++; w = std::string(1, c); } } if (!w.empty()) *result++ = dictionary[w]; return result; } template <typename Iterator> std::string decompress(Iterator begin, Iterator end) { int dictSize = 256; std::map<int,std::string> dictionary; for (int i = 0; i < 256; i++) dictionary[i] = std::string(1, i); std::string w(1, *begin++); std::string result = w; std::string entry; for ( ; begin != end; begin++) { int k = *begin; if (dictionary.count(k)) entry = dictionary[k]; else if (k == dictSize) entry = w + w[0]; else throw "Bad compressed k"; result += entry; dictionary[dictSize++] = w + entry[0]; w = entry; } return result; } #include <iostream> #include <iterator> #include <vector> int main() { std::vector<int> compressed; compress("TOBEORNOTTOBEORTOBEORNOT", std::back_inserter(compressed)); copy(compressed.begin(), compressed.end(), std::ostream_iterator<int>(std::cout, ", ")); std::cout << std::endl; std::string decompressed = decompress(compressed.begin(), compressed.end()); std::cout << decompressed << std::endl; return 0; }
def compress(uncompressed): dict_size = 256 dictionary = dict((chr(i), i) for i in range(dict_size)) w = "" result = [] for c in uncompressed: wc = w + c if wc in dictionary: w = wc else: result.append(dictionary[w]) dictionary[wc] = dict_size dict_size += 1 w = c if w: result.append(dictionary[w]) return result def decompress(compressed): from io import StringIO dict_size = 256 dictionary = dict((i, chr(i)) for i in range(dict_size)) result = StringIO() w = chr(compressed.pop(0)) result.write(w) for k in compressed: if k in dictionary: entry = dictionary[k] elif k == dict_size: entry = w + w[0] else: raise ValueError('Bad compressed k: %s' % k) result.write(entry) dictionary[dict_size] = w + entry[0] dict_size += 1 w = entry return result.getvalue() compressed = compress('TOBEORNOTTOBEORTOBEORNOT') print (compressed) decompressed = decompress(compressed) print (decompressed)
Rewrite this program in Python while keeping its functionality equivalent to the C++ version.
#include <iomanip> #include <iostream> #include <set> #include <vector> using namespace std; unsigned hofstadter(unsigned rlistSize, unsigned slistSize) { auto n = rlistSize > slistSize ? rlistSize : slistSize; auto rlist = new vector<unsigned> { 1, 3, 7 }; auto slist = new vector<unsigned> { 2, 4, 5, 6 }; auto list = rlistSize > 0 ? rlist : slist; auto target_size = rlistSize > 0 ? rlistSize : slistSize; while (list->size() > target_size) list->pop_back(); while (list->size() < target_size) { auto lastIndex = rlist->size() - 1; auto lastr = (*rlist)[lastIndex]; auto r = lastr + (*slist)[lastIndex]; rlist->push_back(r); for (auto s = lastr + 1; s < r && list->size() < target_size;) slist->push_back(s++); } auto v = (*list)[n - 1]; delete rlist; delete slist; return v; } ostream& operator<<(ostream& os, const set<unsigned>& s) { cout << '(' << s.size() << "):"; auto i = 0; for (auto c = s.begin(); c != s.end();) { if (i++ % 20 == 0) os << endl; os << setw(5) << *c++; } return os; } int main(int argc, const char* argv[]) { const auto v1 = atoi(argv[1]); const auto v2 = atoi(argv[2]); set<unsigned> r, s; for (auto n = 1; n <= v2; n++) { if (n <= v1) r.insert(hofstadter(n, 0)); s.insert(hofstadter(0, n)); } cout << "R" << r << endl; cout << "S" << s << endl; int m = max(*r.rbegin(), *s.rbegin()); for (auto n = 1; n <= m; n++) if (r.count(n) == s.count(n)) clog << "integer " << n << " either in both or neither set" << endl; return 0; }
def ffr(n): if n < 1 or type(n) != int: raise ValueError("n must be an int >= 1") try: return ffr.r[n] except IndexError: r, s = ffr.r, ffs.s ffr_n_1 = ffr(n-1) lastr = r[-1] s += list(range(s[-1] + 1, lastr)) if s[-1] < lastr: s += [lastr + 1] len_s = len(s) ffs_n_1 = s[n-1] if len_s > n else (n - len_s) + s[-1] ans = ffr_n_1 + ffs_n_1 r.append(ans) return ans ffr.r = [None, 1] def ffs(n): if n < 1 or type(n) != int: raise ValueError("n must be an int >= 1") try: return ffs.s[n] except IndexError: r, s = ffr.r, ffs.s for i in range(len(r), n+2): ffr(i) if len(s) > n: return s[n] raise Exception("Whoops!") ffs.s = [None, 2] if __name__ == '__main__': first10 = [ffr(i) for i in range(1,11)] assert first10 == [1, 3, 7, 12, 18, 26, 35, 45, 56, 69], "ffr() value error(s)" print("ffr(n) for n = [1..10] is", first10) bin = [None] + [0]*1000 for i in range(40, 0, -1): bin[ffr(i)] += 1 for i in range(960, 0, -1): bin[ffs(i)] += 1 if all(b == 1 for b in bin[1:1000]): print("All Integers 1..1000 found OK") else: print("All Integers 1..1000 NOT found only once: ERROR")
Convert this C++ block to Python, preserving its control flow and logic.
#include <iomanip> #include <iostream> #include <set> #include <vector> using namespace std; unsigned hofstadter(unsigned rlistSize, unsigned slistSize) { auto n = rlistSize > slistSize ? rlistSize : slistSize; auto rlist = new vector<unsigned> { 1, 3, 7 }; auto slist = new vector<unsigned> { 2, 4, 5, 6 }; auto list = rlistSize > 0 ? rlist : slist; auto target_size = rlistSize > 0 ? rlistSize : slistSize; while (list->size() > target_size) list->pop_back(); while (list->size() < target_size) { auto lastIndex = rlist->size() - 1; auto lastr = (*rlist)[lastIndex]; auto r = lastr + (*slist)[lastIndex]; rlist->push_back(r); for (auto s = lastr + 1; s < r && list->size() < target_size;) slist->push_back(s++); } auto v = (*list)[n - 1]; delete rlist; delete slist; return v; } ostream& operator<<(ostream& os, const set<unsigned>& s) { cout << '(' << s.size() << "):"; auto i = 0; for (auto c = s.begin(); c != s.end();) { if (i++ % 20 == 0) os << endl; os << setw(5) << *c++; } return os; } int main(int argc, const char* argv[]) { const auto v1 = atoi(argv[1]); const auto v2 = atoi(argv[2]); set<unsigned> r, s; for (auto n = 1; n <= v2; n++) { if (n <= v1) r.insert(hofstadter(n, 0)); s.insert(hofstadter(0, n)); } cout << "R" << r << endl; cout << "S" << s << endl; int m = max(*r.rbegin(), *s.rbegin()); for (auto n = 1; n <= m; n++) if (r.count(n) == s.count(n)) clog << "integer " << n << " either in both or neither set" << endl; return 0; }
def ffr(n): if n < 1 or type(n) != int: raise ValueError("n must be an int >= 1") try: return ffr.r[n] except IndexError: r, s = ffr.r, ffs.s ffr_n_1 = ffr(n-1) lastr = r[-1] s += list(range(s[-1] + 1, lastr)) if s[-1] < lastr: s += [lastr + 1] len_s = len(s) ffs_n_1 = s[n-1] if len_s > n else (n - len_s) + s[-1] ans = ffr_n_1 + ffs_n_1 r.append(ans) return ans ffr.r = [None, 1] def ffs(n): if n < 1 or type(n) != int: raise ValueError("n must be an int >= 1") try: return ffs.s[n] except IndexError: r, s = ffr.r, ffs.s for i in range(len(r), n+2): ffr(i) if len(s) > n: return s[n] raise Exception("Whoops!") ffs.s = [None, 2] if __name__ == '__main__': first10 = [ffr(i) for i in range(1,11)] assert first10 == [1, 3, 7, 12, 18, 26, 35, 45, 56, 69], "ffr() value error(s)" print("ffr(n) for n = [1..10] is", first10) bin = [None] + [0]*1000 for i in range(40, 0, -1): bin[ffr(i)] += 1 for i in range(960, 0, -1): bin[ffs(i)] += 1 if all(b == 1 for b in bin[1:1000]): print("All Integers 1..1000 found OK") else: print("All Integers 1..1000 NOT found only once: ERROR")
Rewrite the snippet below in Python so it works the same as the original C++ code.
#include <iostream> #include <sstream> #include <iomanip> #include <cassert> #include <vector> using namespace std; class MagicSquare { public: MagicSquare(int d) : sqr(d*d,0), sz(d) { assert(d&1); fillSqr(); } void display() { cout << "Odd Magic Square: " << sz << " x " << sz << "\n"; cout << "It's Magic Sum is: " << magicNumber() << "\n\n"; ostringstream cvr; cvr << sz * sz; int l = cvr.str().size(); for( int y = 0; y < sz; y++ ) { int yy = y * sz; for( int x = 0; x < sz; x++ ) cout << setw( l + 2 ) << sqr[yy + x]; cout << "\n"; } cout << "\n\n"; } private: void fillSqr() { int sx = sz / 2, sy = 0, c = 0; while( c < sz * sz ) { if( !sqr[sx + sy * sz] ) { sqr[sx + sy * sz]= c + 1; inc( sx ); dec( sy ); c++; } else { dec( sx ); inc( sy ); inc( sy ); } } } int magicNumber() { return sz * ( ( sz * sz ) + 1 ) / 2; } void inc( int& a ) { if( ++a == sz ) a = 0; } void dec( int& a ) { if( --a < 0 ) a = sz - 1; } bool checkPos( int x, int y ) { return( isInside( x ) && isInside( y ) && !sqr[sz * y + x] ); } bool isInside( int s ) { return ( s < sz && s > -1 ); } vector<int> sqr; int sz; }; int main() { MagicSquare s(7); s.display(); return 0; }
>>> def magic(n): for row in range(1, n + 1): print(' '.join('%*i' % (len(str(n**2)), cell) for cell in (n * ((row + col - 1 + n // 2) % n) + ((row + 2 * col - 2) % n) + 1 for col in range(1, n + 1)))) print('\nAll sum to magic number %i' % ((n * n + 1) * n // 2)) >>> for n in (5, 3, 7): print('\nOrder %i\n=======' % n) magic(n) Order 5 ======= 17 24 1 8 15 23 5 7 14 16 4 6 13 20 22 10 12 19 21 3 11 18 25 2 9 All sum to magic number 65 Order 3 ======= 8 1 6 3 5 7 4 9 2 All sum to magic number 15 Order 7 ======= 30 39 48 1 10 19 28 38 47 7 9 18 27 29 46 6 8 17 26 35 37 5 14 16 25 34 36 45 13 15 24 33 42 44 4 21 23 32 41 43 3 12 22 31 40 49 2 11 20 All sum to magic number 175 >>>
Produce a functionally identical Python code for the snippet given in C++.
#include <iostream> #include <sstream> #include <iomanip> #include <cassert> #include <vector> using namespace std; class MagicSquare { public: MagicSquare(int d) : sqr(d*d,0), sz(d) { assert(d&1); fillSqr(); } void display() { cout << "Odd Magic Square: " << sz << " x " << sz << "\n"; cout << "It's Magic Sum is: " << magicNumber() << "\n\n"; ostringstream cvr; cvr << sz * sz; int l = cvr.str().size(); for( int y = 0; y < sz; y++ ) { int yy = y * sz; for( int x = 0; x < sz; x++ ) cout << setw( l + 2 ) << sqr[yy + x]; cout << "\n"; } cout << "\n\n"; } private: void fillSqr() { int sx = sz / 2, sy = 0, c = 0; while( c < sz * sz ) { if( !sqr[sx + sy * sz] ) { sqr[sx + sy * sz]= c + 1; inc( sx ); dec( sy ); c++; } else { dec( sx ); inc( sy ); inc( sy ); } } } int magicNumber() { return sz * ( ( sz * sz ) + 1 ) / 2; } void inc( int& a ) { if( ++a == sz ) a = 0; } void dec( int& a ) { if( --a < 0 ) a = sz - 1; } bool checkPos( int x, int y ) { return( isInside( x ) && isInside( y ) && !sqr[sz * y + x] ); } bool isInside( int s ) { return ( s < sz && s > -1 ); } vector<int> sqr; int sz; }; int main() { MagicSquare s(7); s.display(); return 0; }
>>> def magic(n): for row in range(1, n + 1): print(' '.join('%*i' % (len(str(n**2)), cell) for cell in (n * ((row + col - 1 + n // 2) % n) + ((row + 2 * col - 2) % n) + 1 for col in range(1, n + 1)))) print('\nAll sum to magic number %i' % ((n * n + 1) * n // 2)) >>> for n in (5, 3, 7): print('\nOrder %i\n=======' % n) magic(n) Order 5 ======= 17 24 1 8 15 23 5 7 14 16 4 6 13 20 22 10 12 19 21 3 11 18 25 2 9 All sum to magic number 65 Order 3 ======= 8 1 6 3 5 7 4 9 2 All sum to magic number 15 Order 7 ======= 30 39 48 1 10 19 28 38 47 7 9 18 27 29 46 6 8 17 26 35 37 5 14 16 25 34 36 45 13 15 24 33 42 44 4 21 23 32 41 43 3 12 22 31 40 49 2 11 20 All sum to magic number 175 >>>
Translate the given C++ code snippet into Python without altering its behavior.
#include <iostream> #include <numeric> #include <set> template <typename integer> class yellowstone_generator { public: integer next() { n2_ = n1_; n1_ = n_; if (n_ < 3) { ++n_; } else { for (n_ = min_; !(sequence_.count(n_) == 0 && std::gcd(n1_, n_) == 1 && std::gcd(n2_, n_) > 1); ++n_) {} } sequence_.insert(n_); for (;;) { auto it = sequence_.find(min_); if (it == sequence_.end()) break; sequence_.erase(it); ++min_; } return n_; } private: std::set<integer> sequence_; integer min_ = 1; integer n_ = 0; integer n1_ = 0; integer n2_ = 0; }; int main() { std::cout << "First 30 Yellowstone numbers:\n"; yellowstone_generator<unsigned int> ygen; std::cout << ygen.next(); for (int i = 1; i < 30; ++i) std::cout << ' ' << ygen.next(); std::cout << '\n'; return 0; }
from itertools import chain, count, islice from operator import itemgetter from math import gcd from matplotlib import pyplot def yellowstone(): def relativelyPrime(a): return lambda b: 1 == gcd(a, b) def nextWindow(triple): p2, p1, rest = triple [rp2, rp1] = map(relativelyPrime, [p2, p1]) def match(xxs): x, xs = uncons(xxs)['Just'] return (x, xs) if rp1(x) and not rp2(x) else ( second(cons(x))( match(xs) ) ) n, residue = match(rest) return (p1, n, residue) return chain( range(1, 3), map( itemgetter(1), iterate(nextWindow)( (2, 3, count(4)) ) ) ) def main(): print(showList( take(30)(yellowstone()) )) pyplot.plot( take(100)(yellowstone()) ) pyplot.xlabel(main.__doc__) pyplot.show() def Just(x): return {'type': 'Maybe', 'Nothing': False, 'Just': x} def Nothing(): return {'type': 'Maybe', 'Nothing': True} def cons(x): return lambda xs: [x] + xs if ( isinstance(xs, list) ) else x + xs if ( isinstance(xs, str) ) else chain([x], xs) def iterate(f): def go(x): v = x while True: yield v v = f(v) return go def second(f): return lambda xy: (xy[0], f(xy[1])) def showList(xs): return '[' + ','.join(repr(x) for x in xs) + ']' def take(n): return lambda xs: ( xs[0:n] if isinstance(xs, (list, tuple)) else list(islice(xs, n)) ) def uncons(xs): if isinstance(xs, list): return Just((xs[0], xs[1:])) if xs else Nothing() else: nxt = take(1)(xs) return Just((nxt[0], xs)) if nxt else Nothing() if __name__ == '__main__': main()
Port the following code from C++ to Python with equivalent syntax and logic.
#include <iostream> #include <numeric> #include <set> template <typename integer> class yellowstone_generator { public: integer next() { n2_ = n1_; n1_ = n_; if (n_ < 3) { ++n_; } else { for (n_ = min_; !(sequence_.count(n_) == 0 && std::gcd(n1_, n_) == 1 && std::gcd(n2_, n_) > 1); ++n_) {} } sequence_.insert(n_); for (;;) { auto it = sequence_.find(min_); if (it == sequence_.end()) break; sequence_.erase(it); ++min_; } return n_; } private: std::set<integer> sequence_; integer min_ = 1; integer n_ = 0; integer n1_ = 0; integer n2_ = 0; }; int main() { std::cout << "First 30 Yellowstone numbers:\n"; yellowstone_generator<unsigned int> ygen; std::cout << ygen.next(); for (int i = 1; i < 30; ++i) std::cout << ' ' << ygen.next(); std::cout << '\n'; return 0; }
from itertools import chain, count, islice from operator import itemgetter from math import gcd from matplotlib import pyplot def yellowstone(): def relativelyPrime(a): return lambda b: 1 == gcd(a, b) def nextWindow(triple): p2, p1, rest = triple [rp2, rp1] = map(relativelyPrime, [p2, p1]) def match(xxs): x, xs = uncons(xxs)['Just'] return (x, xs) if rp1(x) and not rp2(x) else ( second(cons(x))( match(xs) ) ) n, residue = match(rest) return (p1, n, residue) return chain( range(1, 3), map( itemgetter(1), iterate(nextWindow)( (2, 3, count(4)) ) ) ) def main(): print(showList( take(30)(yellowstone()) )) pyplot.plot( take(100)(yellowstone()) ) pyplot.xlabel(main.__doc__) pyplot.show() def Just(x): return {'type': 'Maybe', 'Nothing': False, 'Just': x} def Nothing(): return {'type': 'Maybe', 'Nothing': True} def cons(x): return lambda xs: [x] + xs if ( isinstance(xs, list) ) else x + xs if ( isinstance(xs, str) ) else chain([x], xs) def iterate(f): def go(x): v = x while True: yield v v = f(v) return go def second(f): return lambda xy: (xy[0], f(xy[1])) def showList(xs): return '[' + ','.join(repr(x) for x in xs) + ']' def take(n): return lambda xs: ( xs[0:n] if isinstance(xs, (list, tuple)) else list(islice(xs, n)) ) def uncons(xs): if isinstance(xs, list): return Just((xs[0], xs[1:])) if xs else Nothing() else: nxt = take(1)(xs) return Just((nxt[0], xs)) if nxt else Nothing() if __name__ == '__main__': main()
Write a version of this C++ function in Python with identical behavior.
#include <array> #include <iostream> #include <stack> #include <vector> const std::array<std::pair<int, int>, 4> DIRS = { std::make_pair(0, -1), std::make_pair(-1, 0), std::make_pair(0, 1), std::make_pair(1, 0), }; void printResult(const std::vector<std::vector<int>> &v) { for (auto &row : v) { auto it = row.cbegin(); auto end = row.cend(); std::cout << '['; if (it != end) { std::cout << *it; it = std::next(it); } while (it != end) { std::cout << ", " << *it; it = std::next(it); } std::cout << "]\n"; } } void cutRectangle(int w, int h) { if (w % 2 == 1 && h % 2 == 1) { return; } std::vector<std::vector<int>> grid(h, std::vector<int>(w)); std::stack<int> stack; int half = (w * h) / 2; long bits = (long)pow(2, half) - 1; for (; bits > 0; bits -= 2) { for (int i = 0; i < half; i++) { int r = i / w; int c = i % w; grid[r][c] = (bits & (1 << i)) != 0 ? 1 : 0; grid[h - r - 1][w - c - 1] = 1 - grid[r][c]; } stack.push(0); grid[0][0] = 2; int count = 1; while (!stack.empty()) { int pos = stack.top(); stack.pop(); int r = pos / w; int c = pos % w; for (auto dir : DIRS) { int nextR = r + dir.first; int nextC = c + dir.second; if (nextR >= 0 && nextR < h && nextC >= 0 && nextC < w) { if (grid[nextR][nextC] == 1) { stack.push(nextR * w + nextC); grid[nextR][nextC] = 2; count++; } } } } if (count == half) { printResult(grid); std::cout << '\n'; } } } int main() { cutRectangle(2, 2); cutRectangle(4, 3); return 0; }
def cut_it(h, w): dirs = ((1, 0), (-1, 0), (0, -1), (0, 1)) if h % 2: h, w = w, h if h % 2: return 0 if w == 1: return 1 count = 0 next = [w + 1, -w - 1, -1, 1] blen = (h + 1) * (w + 1) - 1 grid = [False] * (blen + 1) def walk(y, x, count): if not y or y == h or not x or x == w: return count + 1 t = y * (w + 1) + x grid[t] = grid[blen - t] = True if not grid[t + next[0]]: count = walk(y + dirs[0][0], x + dirs[0][1], count) if not grid[t + next[1]]: count = walk(y + dirs[1][0], x + dirs[1][1], count) if not grid[t + next[2]]: count = walk(y + dirs[2][0], x + dirs[2][1], count) if not grid[t + next[3]]: count = walk(y + dirs[3][0], x + dirs[3][1], count) grid[t] = grid[blen - t] = False return count t = h // 2 * (w + 1) + w // 2 if w % 2: grid[t] = grid[t + 1] = True count = walk(h // 2, w // 2 - 1, count) res = count count = 0 count = walk(h // 2 - 1, w // 2, count) return res + count * 2 else: grid[t] = True count = walk(h // 2, w // 2 - 1, count) if h == w: return count * 2 count = walk(h // 2 - 1, w // 2, count) return count def main(): for w in xrange(1, 10): for h in xrange(1, w + 1): if not((w * h) % 2): print "%d x %d: %d" % (w, h, cut_it(w, h)) main()
Preserve the algorithm and functionality while converting the code from C++ to Python.
#include <array> #include <iostream> #include <stack> #include <vector> const std::array<std::pair<int, int>, 4> DIRS = { std::make_pair(0, -1), std::make_pair(-1, 0), std::make_pair(0, 1), std::make_pair(1, 0), }; void printResult(const std::vector<std::vector<int>> &v) { for (auto &row : v) { auto it = row.cbegin(); auto end = row.cend(); std::cout << '['; if (it != end) { std::cout << *it; it = std::next(it); } while (it != end) { std::cout << ", " << *it; it = std::next(it); } std::cout << "]\n"; } } void cutRectangle(int w, int h) { if (w % 2 == 1 && h % 2 == 1) { return; } std::vector<std::vector<int>> grid(h, std::vector<int>(w)); std::stack<int> stack; int half = (w * h) / 2; long bits = (long)pow(2, half) - 1; for (; bits > 0; bits -= 2) { for (int i = 0; i < half; i++) { int r = i / w; int c = i % w; grid[r][c] = (bits & (1 << i)) != 0 ? 1 : 0; grid[h - r - 1][w - c - 1] = 1 - grid[r][c]; } stack.push(0); grid[0][0] = 2; int count = 1; while (!stack.empty()) { int pos = stack.top(); stack.pop(); int r = pos / w; int c = pos % w; for (auto dir : DIRS) { int nextR = r + dir.first; int nextC = c + dir.second; if (nextR >= 0 && nextR < h && nextC >= 0 && nextC < w) { if (grid[nextR][nextC] == 1) { stack.push(nextR * w + nextC); grid[nextR][nextC] = 2; count++; } } } } if (count == half) { printResult(grid); std::cout << '\n'; } } } int main() { cutRectangle(2, 2); cutRectangle(4, 3); return 0; }
def cut_it(h, w): dirs = ((1, 0), (-1, 0), (0, -1), (0, 1)) if h % 2: h, w = w, h if h % 2: return 0 if w == 1: return 1 count = 0 next = [w + 1, -w - 1, -1, 1] blen = (h + 1) * (w + 1) - 1 grid = [False] * (blen + 1) def walk(y, x, count): if not y or y == h or not x or x == w: return count + 1 t = y * (w + 1) + x grid[t] = grid[blen - t] = True if not grid[t + next[0]]: count = walk(y + dirs[0][0], x + dirs[0][1], count) if not grid[t + next[1]]: count = walk(y + dirs[1][0], x + dirs[1][1], count) if not grid[t + next[2]]: count = walk(y + dirs[2][0], x + dirs[2][1], count) if not grid[t + next[3]]: count = walk(y + dirs[3][0], x + dirs[3][1], count) grid[t] = grid[blen - t] = False return count t = h // 2 * (w + 1) + w // 2 if w % 2: grid[t] = grid[t + 1] = True count = walk(h // 2, w // 2 - 1, count) res = count count = 0 count = walk(h // 2 - 1, w // 2, count) return res + count * 2 else: grid[t] = True count = walk(h // 2, w // 2 - 1, count) if h == w: return count * 2 count = walk(h // 2 - 1, w // 2, count) return count def main(): for w in xrange(1, 10): for h in xrange(1, w + 1): if not((w * h) % 2): print "%d x %d: %d" % (w, h, cut_it(w, h)) main()
Maintain the same structure and functionality when rewriting this code in Python.
#include <iomanip> #include <iostream> #include <vector> std::vector<int> mertens_numbers(int max) { std::vector<int> m(max + 1, 1); for (int n = 2; n <= max; ++n) { for (int k = 2; k <= n; ++k) m[n] -= m[n / k]; } return m; } int main() { const int max = 1000; auto m(mertens_numbers(max)); std::cout << "First 199 Mertens numbers:\n"; for (int i = 0, column = 0; i < 200; ++i) { if (column > 0) std::cout << ' '; if (i == 0) std::cout << " "; else std::cout << std::setw(2) << m[i]; ++column; if (column == 20) { std::cout << '\n'; column = 0; } } int zero = 0, cross = 0, previous = 0; for (int i = 1; i <= max; ++i) { if (m[i] == 0) { ++zero; if (previous != 0) ++cross; } previous = m[i]; } std::cout << "M(n) is zero " << zero << " times for 1 <= n <= 1000.\n"; std::cout << "M(n) crosses zero " << cross << " times for 1 <= n <= 1000.\n"; return 0; }
def mertens(count): m = [None, 1] for n in range(2, count+1): m.append(1) for k in range(2, n+1): m[n] -= m[n//k] return m ms = mertens(1000) print("The first 99 Mertens numbers are:") print(" ", end=' ') col = 1 for n in ms[1:100]: print("{:2d}".format(n), end=' ') col += 1 if col == 10: print() col = 0 zeroes = sum(x==0 for x in ms) crosses = sum(a!=0 and b==0 for a,b in zip(ms, ms[1:])) print("M(N) equals zero {} times.".format(zeroes)) print("M(N) crosses zero {} times.".format(crosses))
Translate this program into Python but keep the logic exactly as in C++.
#include <iomanip> #include <iostream> #include <vector> std::vector<int> mertens_numbers(int max) { std::vector<int> m(max + 1, 1); for (int n = 2; n <= max; ++n) { for (int k = 2; k <= n; ++k) m[n] -= m[n / k]; } return m; } int main() { const int max = 1000; auto m(mertens_numbers(max)); std::cout << "First 199 Mertens numbers:\n"; for (int i = 0, column = 0; i < 200; ++i) { if (column > 0) std::cout << ' '; if (i == 0) std::cout << " "; else std::cout << std::setw(2) << m[i]; ++column; if (column == 20) { std::cout << '\n'; column = 0; } } int zero = 0, cross = 0, previous = 0; for (int i = 1; i <= max; ++i) { if (m[i] == 0) { ++zero; if (previous != 0) ++cross; } previous = m[i]; } std::cout << "M(n) is zero " << zero << " times for 1 <= n <= 1000.\n"; std::cout << "M(n) crosses zero " << cross << " times for 1 <= n <= 1000.\n"; return 0; }
def mertens(count): m = [None, 1] for n in range(2, count+1): m.append(1) for k in range(2, n+1): m[n] -= m[n//k] return m ms = mertens(1000) print("The first 99 Mertens numbers are:") print(" ", end=' ') col = 1 for n in ms[1:100]: print("{:2d}".format(n), end=' ') col += 1 if col == 10: print() col = 0 zeroes = sum(x==0 for x in ms) crosses = sum(a!=0 and b==0 for a,b in zip(ms, ms[1:])) print("M(N) equals zero {} times.".format(zeroes)) print("M(N) crosses zero {} times.".format(crosses))
Transform the following C++ implementation into Python, maintaining the same output and logic.
#include <algorithm> #include <iostream> #include <vector> using namespace std; bool InteractiveCompare(const string& s1, const string& s2) { if(s1 == s2) return false; static int count = 0; string response; cout << "(" << ++count << ") Is " << s1 << " < " << s2 << "? "; getline(cin, response); return !response.empty() && response.front() == 'y'; } void PrintOrder(const vector<string>& items) { cout << "{ "; for(auto& item : items) cout << item << " "; cout << "}\n"; } int main() { const vector<string> items { "violet", "red", "green", "indigo", "blue", "yellow", "orange" }; vector<string> sortedItems; for(auto& item : items) { cout << "Inserting '" << item << "' into "; PrintOrder(sortedItems); auto spotToInsert = lower_bound(sortedItems.begin(), sortedItems.end(), item, InteractiveCompare); sortedItems.insert(spotToInsert, item); } PrintOrder(sortedItems); return 0; }
def _insort_right(a, x, q): lo, hi = 0, len(a) while lo < hi: mid = (lo+hi)//2 q += 1 less = input(f"{q:2}: IS {x:>6} LESS-THAN {a[mid]:>6} ? y/n: ").strip().lower() == 'y' if less: hi = mid else: lo = mid+1 a.insert(lo, x) return q def order(items): ordered, q = [], 0 for item in items: q = _insort_right(ordered, item, q) return ordered, q if __name__ == '__main__': items = 'violet red green indigo blue yellow orange'.split() ans, questions = order(items) print('\n' + ' '.join(ans))
Port the following code from C++ to Python with equivalent syntax and logic.
#include <cln/integer.h> #include <cln/integer_io.h> #include <iostream> #include <algorithm> #include <vector> #include <iomanip> #include <sstream> #include <string> #include <cstdlib> #include <cmath> #include <map> using namespace cln ; class NextNum { public : NextNum ( cl_I & a , cl_I & b ) : first( a ) , second ( b ) { } cl_I operator( )( ) { cl_I result = first + second ; first = second ; second = result ; return result ; } private : cl_I first ; cl_I second ; } ; void findFrequencies( const std::vector<cl_I> & fibos , std::map<int , int> &numberfrequencies ) { for ( cl_I bignumber : fibos ) { std::ostringstream os ; fprintdecimal ( os , bignumber ) ; int firstdigit = std::atoi( os.str( ).substr( 0 , 1 ).c_str( )) ; auto result = numberfrequencies.insert( std::make_pair( firstdigit , 1 ) ) ; if ( ! result.second ) numberfrequencies[ firstdigit ]++ ; } } int main( ) { std::vector<cl_I> fibonaccis( 1000 ) ; fibonaccis[ 0 ] = 0 ; fibonaccis[ 1 ] = 1 ; cl_I a = 0 ; cl_I b = 1 ; std::generate_n( fibonaccis.begin( ) + 2 , 998 , NextNum( a , b ) ) ; std::cout << std::endl ; std::map<int , int> frequencies ; findFrequencies( fibonaccis , frequencies ) ; std::cout << " found expected\n" ; for ( int i = 1 ; i < 10 ; i++ ) { double found = static_cast<double>( frequencies[ i ] ) / 1000 ; double expected = std::log10( 1 + 1 / static_cast<double>( i )) ; std::cout << i << " :" << std::setw( 16 ) << std::right << found * 100 << " %" ; std::cout.precision( 3 ) ; std::cout << std::setw( 26 ) << std::right << expected * 100 << " %\n" ; } return 0 ; }
from __future__ import division from itertools import islice, count from collections import Counter from math import log10 from random import randint expected = [log10(1+1/d) for d in range(1,10)] def fib(): a,b = 1,1 while True: yield a a,b = b,a+b def power_of_threes(): return (3**k for k in count(0)) def heads(s): for a in s: yield int(str(a)[0]) def show_dist(title, s): c = Counter(s) size = sum(c.values()) res = [c[d]/size for d in range(1,10)] print("\n%s Benfords deviation" % title) for r, e in zip(res, expected): print("%5.1f%% %5.1f%% %5.1f%%" % (r*100., e*100., abs(r - e)*100.)) def rand1000(): while True: yield randint(1,9999) if __name__ == '__main__': show_dist("fibbed", islice(heads(fib()), 1000)) show_dist("threes", islice(heads(power_of_threes()), 1000)) show_dist("random", islice(heads(rand1000()), 10000))
Convert the following code from C++ to Python, ensuring the logic remains intact.
#include <cln/integer.h> #include <cln/integer_io.h> #include <iostream> #include <algorithm> #include <vector> #include <iomanip> #include <sstream> #include <string> #include <cstdlib> #include <cmath> #include <map> using namespace cln ; class NextNum { public : NextNum ( cl_I & a , cl_I & b ) : first( a ) , second ( b ) { } cl_I operator( )( ) { cl_I result = first + second ; first = second ; second = result ; return result ; } private : cl_I first ; cl_I second ; } ; void findFrequencies( const std::vector<cl_I> & fibos , std::map<int , int> &numberfrequencies ) { for ( cl_I bignumber : fibos ) { std::ostringstream os ; fprintdecimal ( os , bignumber ) ; int firstdigit = std::atoi( os.str( ).substr( 0 , 1 ).c_str( )) ; auto result = numberfrequencies.insert( std::make_pair( firstdigit , 1 ) ) ; if ( ! result.second ) numberfrequencies[ firstdigit ]++ ; } } int main( ) { std::vector<cl_I> fibonaccis( 1000 ) ; fibonaccis[ 0 ] = 0 ; fibonaccis[ 1 ] = 1 ; cl_I a = 0 ; cl_I b = 1 ; std::generate_n( fibonaccis.begin( ) + 2 , 998 , NextNum( a , b ) ) ; std::cout << std::endl ; std::map<int , int> frequencies ; findFrequencies( fibonaccis , frequencies ) ; std::cout << " found expected\n" ; for ( int i = 1 ; i < 10 ; i++ ) { double found = static_cast<double>( frequencies[ i ] ) / 1000 ; double expected = std::log10( 1 + 1 / static_cast<double>( i )) ; std::cout << i << " :" << std::setw( 16 ) << std::right << found * 100 << " %" ; std::cout.precision( 3 ) ; std::cout << std::setw( 26 ) << std::right << expected * 100 << " %\n" ; } return 0 ; }
from __future__ import division from itertools import islice, count from collections import Counter from math import log10 from random import randint expected = [log10(1+1/d) for d in range(1,10)] def fib(): a,b = 1,1 while True: yield a a,b = b,a+b def power_of_threes(): return (3**k for k in count(0)) def heads(s): for a in s: yield int(str(a)[0]) def show_dist(title, s): c = Counter(s) size = sum(c.values()) res = [c[d]/size for d in range(1,10)] print("\n%s Benfords deviation" % title) for r, e in zip(res, expected): print("%5.1f%% %5.1f%% %5.1f%%" % (r*100., e*100., abs(r - e)*100.)) def rand1000(): while True: yield randint(1,9999) if __name__ == '__main__': show_dist("fibbed", islice(heads(fib()), 1000)) show_dist("threes", islice(heads(power_of_threes()), 1000)) show_dist("random", islice(heads(rand1000()), 10000))
Generate a Python translation of this C++ snippet without changing its computational steps.
#include <iostream> #include <string> #include <windows.h> using namespace std; class bells { public: void start() { watch[0] = "Middle"; watch[1] = "Morning"; watch[2] = "Forenoon"; watch[3] = "Afternoon"; watch[4] = "Dog"; watch[5] = "First"; count[0] = "One"; count[1] = "Two"; count[2] = "Three"; count[3] = "Four"; count[4] = "Five"; count[5] = "Six"; count[6] = "Seven"; count[7] = "Eight"; _inst = this; CreateThread( NULL, 0, bell, NULL, 0, NULL ); } private: static DWORD WINAPI bell( LPVOID p ) { DWORD wait = _inst->waitTime(); while( true ) { Sleep( wait ); _inst->playBell(); wait = _inst->waitTime(); } return 0; } DWORD waitTime() { GetLocalTime( &st ); int m = st.wMinute >= 30 ? st.wMinute - 30 : st.wMinute; return( 1800000 - ( ( m * 60 + st.wSecond ) * 1000 + st.wMilliseconds ) ); } void playBell() { GetLocalTime( &st ); int b = ( 2 * st.wHour + st.wMinute / 30 ) % 8; b = b == 0 ? 8 : b; int w = ( 60 * st.wHour + st.wMinute ); if( w < 1 ) w = 5; else w = ( w - 1 ) / 240; char hr[32]; wsprintf( hr, "%.2d:%.2d", st.wHour, st.wMinute ); cout << hr << " - " << watch[w] << " watch - " << count[b - 1] << " Bell"; if( b > 1 ) cout << "s"; else cout << " "; cout << " Gone." << endl; for( int x = 0, c = 1; x < b; x++, c++ ) { cout << "\7"; Sleep( 500 ); if( !( c % 2 ) ) Sleep( 300 ); } } SYSTEMTIME st; string watch[7], count[8]; static bells* _inst; }; bells* bells::_inst = 0; int main( int argc, char* argv[] ) { bells b; b.start(); while( 1 ); return 0; }
import time, calendar, sched, winsound duration = 750 freq = 1280 bellchar = "\u2407" watches = 'Middle,Morning,Forenoon,Afternoon,First/Last dog,First'.split(',') def gap(n=1): time.sleep(n * duration / 1000) off = gap def on(n=1): winsound.Beep(freq, n * duration) def bong(): on(); off(0.5) def bongs(m): for i in range(m): print(bellchar, end=' ') bong() if i % 2: print(' ', end='') off(0.5) print('') scheds = sched.scheduler(time.time, time.sleep) def ships_bell(now=None): def adjust_to_half_hour(atime): atime[4] = (atime[4] // 30) * 30 atime[5] = 0 return atime debug = now is not None rightnow = time.gmtime() if not debug: now = adjust_to_half_hour( list(rightnow) ) then = now[::] then[4] += 30 hr, mn = now[3:5] watch, b = divmod(int(2 * hr + mn // 30 - 1), 8) b += 1 bells = '%i bell%s' % (b, 's' if b > 1 else ' ') if debug: print("%02i:%02i, %-20s %s" % (now[3], now[4], watches[watch] + ' watch', bells), end=' ') else: print("%02i:%02i, %-20s %s" % (rightnow[3], rightnow[4], watches[watch] + ' watch', bells), end=' ') bongs(b) if not debug: scheds.enterabs(calendar.timegm(then), 0, ships_bell) scheds.run() def dbg_tester(): for h in range(24): for m in (0, 30): if (h,m) == (24,30): break ships_bell( [2013, 3, 2, h, m, 15, 5, 61, 0] ) if __name__ == '__main__': ships_bell()
Convert this C++ snippet to Python and keep its semantics consistent.
#include <iostream> #include <string> #include <windows.h> using namespace std; class bells { public: void start() { watch[0] = "Middle"; watch[1] = "Morning"; watch[2] = "Forenoon"; watch[3] = "Afternoon"; watch[4] = "Dog"; watch[5] = "First"; count[0] = "One"; count[1] = "Two"; count[2] = "Three"; count[3] = "Four"; count[4] = "Five"; count[5] = "Six"; count[6] = "Seven"; count[7] = "Eight"; _inst = this; CreateThread( NULL, 0, bell, NULL, 0, NULL ); } private: static DWORD WINAPI bell( LPVOID p ) { DWORD wait = _inst->waitTime(); while( true ) { Sleep( wait ); _inst->playBell(); wait = _inst->waitTime(); } return 0; } DWORD waitTime() { GetLocalTime( &st ); int m = st.wMinute >= 30 ? st.wMinute - 30 : st.wMinute; return( 1800000 - ( ( m * 60 + st.wSecond ) * 1000 + st.wMilliseconds ) ); } void playBell() { GetLocalTime( &st ); int b = ( 2 * st.wHour + st.wMinute / 30 ) % 8; b = b == 0 ? 8 : b; int w = ( 60 * st.wHour + st.wMinute ); if( w < 1 ) w = 5; else w = ( w - 1 ) / 240; char hr[32]; wsprintf( hr, "%.2d:%.2d", st.wHour, st.wMinute ); cout << hr << " - " << watch[w] << " watch - " << count[b - 1] << " Bell"; if( b > 1 ) cout << "s"; else cout << " "; cout << " Gone." << endl; for( int x = 0, c = 1; x < b; x++, c++ ) { cout << "\7"; Sleep( 500 ); if( !( c % 2 ) ) Sleep( 300 ); } } SYSTEMTIME st; string watch[7], count[8]; static bells* _inst; }; bells* bells::_inst = 0; int main( int argc, char* argv[] ) { bells b; b.start(); while( 1 ); return 0; }
import time, calendar, sched, winsound duration = 750 freq = 1280 bellchar = "\u2407" watches = 'Middle,Morning,Forenoon,Afternoon,First/Last dog,First'.split(',') def gap(n=1): time.sleep(n * duration / 1000) off = gap def on(n=1): winsound.Beep(freq, n * duration) def bong(): on(); off(0.5) def bongs(m): for i in range(m): print(bellchar, end=' ') bong() if i % 2: print(' ', end='') off(0.5) print('') scheds = sched.scheduler(time.time, time.sleep) def ships_bell(now=None): def adjust_to_half_hour(atime): atime[4] = (atime[4] // 30) * 30 atime[5] = 0 return atime debug = now is not None rightnow = time.gmtime() if not debug: now = adjust_to_half_hour( list(rightnow) ) then = now[::] then[4] += 30 hr, mn = now[3:5] watch, b = divmod(int(2 * hr + mn // 30 - 1), 8) b += 1 bells = '%i bell%s' % (b, 's' if b > 1 else ' ') if debug: print("%02i:%02i, %-20s %s" % (now[3], now[4], watches[watch] + ' watch', bells), end=' ') else: print("%02i:%02i, %-20s %s" % (rightnow[3], rightnow[4], watches[watch] + ' watch', bells), end=' ') bongs(b) if not debug: scheds.enterabs(calendar.timegm(then), 0, ships_bell) scheds.run() def dbg_tester(): for h in range(24): for m in (0, 30): if (h,m) == (24,30): break ships_bell( [2013, 3, 2, h, m, 15, 5, 61, 0] ) if __name__ == '__main__': ships_bell()
Change the programming language of this snippet from C++ to Python without modifying what it does.
double fib(double n) { if(n < 0) { throw "Invalid argument passed to fib"; } else { struct actual_fib { static double calc(double n) { if(n < 2) { return n; } else { return calc(n-1) + calc(n-2); } } }; return actual_fib::calc(n); } }
>>> Y = lambda f: (lambda x: x(x))(lambda y: f(lambda *args: y(y)(*args))) >>> fib = lambda f: lambda n: None if n < 0 else (0 if n == 0 else (1 if n == 1 else f(n-1) + f(n-2))) >>> [ Y(fib)(i) for i in range(-2, 10) ] [None, None, 0, 1, 1, 2, 3, 5, 8, 13, 21, 34]
Can you help me rewrite this code in Python instead of C++, keeping it the same logically?
#include <windows.h> #include <ctime> #include <iostream> #include <string> const int WID = 60, HEI = 30, MAX_LEN = 600; enum DIR { NORTH, EAST, SOUTH, WEST }; class snake { public: snake() { console = GetStdHandle( STD_OUTPUT_HANDLE ); SetConsoleTitle( "Snake" ); COORD coord = { WID + 1, HEI + 2 }; SetConsoleScreenBufferSize( console, coord ); SMALL_RECT rc = { 0, 0, WID, HEI + 1 }; SetConsoleWindowInfo( console, TRUE, &rc ); CONSOLE_CURSOR_INFO ci = { 1, false }; SetConsoleCursorInfo( console, &ci ); } void play() { std::string a; while( 1 ) { createField(); alive = true; while( alive ) { drawField(); readKey(); moveSnake(); Sleep( 50 ); } COORD c = { 0, HEI + 1 }; SetConsoleCursorPosition( console, c ); SetConsoleTextAttribute( console, 0x000b ); std::cout << "Play again [Y/N]? "; std::cin >> a; if( a.at( 0 ) != 'Y' && a.at( 0 ) != 'y' ) return; } } private: void createField() { COORD coord = { 0, 0 }; DWORD c; FillConsoleOutputCharacter( console, ' ', ( HEI + 2 ) * 80, coord, &c ); FillConsoleOutputAttribute( console, 0x0000, ( HEI + 2 ) * 80, coord, &c ); SetConsoleCursorPosition( console, coord ); int x = 0, y = 1; for( ; x < WID * HEI; x++ ) brd[x] = 0; for( x = 0; x < WID; x++ ) { brd[x] = brd[x + WID * ( HEI - 1 )] = '+'; } for( ; y < HEI; y++ ) { brd[0 + WID * y] = brd[WID - 1 + WID * y] = '+'; } do { x = rand() % WID; y = rand() % ( HEI >> 1 ) + ( HEI >> 1 ); } while( brd[x + WID * y] ); brd[x + WID * y] = '@'; tailIdx = 0; headIdx = 4; x = 3; y = 2; for( int c = tailIdx; c < headIdx; c++ ) { brd[x + WID * y] = '#'; snk[c].X = 3 + c; snk[c].Y = 2; } head = snk[3]; dir = EAST; points = 0; } void readKey() { if( GetAsyncKeyState( 39 ) & 0x8000 ) dir = EAST; if( GetAsyncKeyState( 37 ) & 0x8000 ) dir = WEST; if( GetAsyncKeyState( 38 ) & 0x8000 ) dir = NORTH; if( GetAsyncKeyState( 40 ) & 0x8000 ) dir = SOUTH; } void drawField() { COORD coord; char t; for( int y = 0; y < HEI; y++ ) { coord.Y = y; for( int x = 0; x < WID; x++ ) { t = brd[x + WID * y]; if( !t ) continue; coord.X = x; SetConsoleCursorPosition( console, coord ); if( coord.X == head.X && coord.Y == head.Y ) { SetConsoleTextAttribute( console, 0x002e ); std::cout << 'O'; SetConsoleTextAttribute( console, 0x0000 ); continue; } switch( t ) { case '#': SetConsoleTextAttribute( console, 0x002a ); break; case '+': SetConsoleTextAttribute( console, 0x0019 ); break; case '@': SetConsoleTextAttribute( console, 0x004c ); break; } std::cout << t; SetConsoleTextAttribute( console, 0x0000 ); } } std::cout << t; SetConsoleTextAttribute( console, 0x0007 ); COORD c = { 0, HEI }; SetConsoleCursorPosition( console, c ); std::cout << "Points: " << points; } void moveSnake() { switch( dir ) { case NORTH: head.Y--; break; case EAST: head.X++; break; case SOUTH: head.Y++; break; case WEST: head.X--; break; } char t = brd[head.X + WID * head.Y]; if( t && t != '@' ) { alive = false; return; } brd[head.X + WID * head.Y] = '#'; snk[headIdx].X = head.X; snk[headIdx].Y = head.Y; if( ++headIdx >= MAX_LEN ) headIdx = 0; if( t == '@' ) { points++; int x, y; do { x = rand() % WID; y = rand() % ( HEI >> 1 ) + ( HEI >> 1 ); } while( brd[x + WID * y] ); brd[x + WID * y] = '@'; return; } SetConsoleCursorPosition( console, snk[tailIdx] ); std::cout << ' '; brd[snk[tailIdx].X + WID * snk[tailIdx].Y] = 0; if( ++tailIdx >= MAX_LEN ) tailIdx = 0; } bool alive; char brd[WID * HEI]; HANDLE console; DIR dir; COORD snk[MAX_LEN]; COORD head; int tailIdx, headIdx, points; }; int main( int argc, char* argv[] ) { srand( static_cast<unsigned>( time( NULL ) ) ); snake s; s.play(); return 0; }
from __future__ import annotations import itertools import random from enum import Enum from typing import Any from typing import Tuple import pygame as pg from pygame import Color from pygame import Rect from pygame.surface import Surface from pygame.sprite import AbstractGroup from pygame.sprite import Group from pygame.sprite import RenderUpdates from pygame.sprite import Sprite class Direction(Enum): UP = (0, -1) DOWN = (0, 1) LEFT = (-1, 0) RIGHT = (1, 0) def opposite(self, other: Direction): return (self[0] + other[0], self[1] + other[1]) == (0, 0) def __getitem__(self, i: int): return self.value[i] class SnakeHead(Sprite): def __init__( self, size: int, position: Tuple[int, int], facing: Direction, bounds: Rect, ) -> None: super().__init__() self.image = Surface((size, size)) self.image.fill(Color("aquamarine4")) self.rect = self.image.get_rect() self.rect.center = position self.facing = facing self.size = size self.speed = size self.bounds = bounds def update(self, *args: Any, **kwargs: Any) -> None: self.rect.move_ip( ( self.facing[0] * self.speed, self.facing[1] * self.speed, ) ) if self.rect.right > self.bounds.right: self.rect.left = 0 elif self.rect.left < 0: self.rect.right = self.bounds.right if self.rect.bottom > self.bounds.bottom: self.rect.top = 0 elif self.rect.top < 0: self.rect.bottom = self.bounds.bottom def change_direction(self, direction: Direction): if not self.facing == direction and not direction.opposite(self.facing): self.facing = direction class SnakeBody(Sprite): def __init__( self, size: int, position: Tuple[int, int], colour: str = "white", ) -> None: super().__init__() self.image = Surface((size, size)) self.image.fill(Color(colour)) self.rect = self.image.get_rect() self.rect.center = position class Snake(RenderUpdates): def __init__(self, game: Game) -> None: self.segment_size = game.segment_size self.colours = itertools.cycle(["aquamarine1", "aquamarine3"]) self.head = SnakeHead( size=self.segment_size, position=game.rect.center, facing=Direction.RIGHT, bounds=game.rect, ) neck = [ SnakeBody( size=self.segment_size, position=game.rect.center, colour=next(self.colours), ) for _ in range(2) ] super().__init__(*[self.head, *neck]) self.body = Group() self.tail = neck[-1] def update(self, *args: Any, **kwargs: Any) -> None: self.head.update() segments = self.sprites() for i in range(len(segments) - 1, 0, -1): segments[i].rect.center = segments[i - 1].rect.center def change_direction(self, direction: Direction): self.head.change_direction(direction) def grow(self): tail = SnakeBody( size=self.segment_size, position=self.tail.rect.center, colour=next(self.colours), ) self.tail = tail self.add(self.tail) self.body.add(self.tail) class SnakeFood(Sprite): def __init__(self, game: Game, size: int, *groups: AbstractGroup) -> None: super().__init__(*groups) self.image = Surface((size, size)) self.image.fill(Color("red")) self.rect = self.image.get_rect() self.rect.topleft = ( random.randint(0, game.rect.width), random.randint(0, game.rect.height), ) self.rect.clamp_ip(game.rect) while pg.sprite.spritecollideany(self, game.snake): self.rect.topleft = ( random.randint(0, game.rect.width), random.randint(0, game.rect.height), ) self.rect.clamp_ip(game.rect) class Game: def __init__(self) -> None: self.rect = Rect(0, 0, 640, 480) self.background = Surface(self.rect.size) self.background.fill(Color("black")) self.score = 0 self.framerate = 16 self.segment_size = 10 self.snake = Snake(self) self.food_group = RenderUpdates(SnakeFood(game=self, size=self.segment_size)) pg.init() def _init_display(self) -> Surface: bestdepth = pg.display.mode_ok(self.rect.size, 0, 32) screen = pg.display.set_mode(self.rect.size, 0, bestdepth) pg.display.set_caption("Snake") pg.mouse.set_visible(False) screen.blit(self.background, (0, 0)) pg.display.flip() return screen def draw(self, screen: Surface): dirty = self.snake.draw(screen) pg.display.update(dirty) dirty = self.food_group.draw(screen) pg.display.update(dirty) def update(self, screen): self.food_group.clear(screen, self.background) self.food_group.update() self.snake.clear(screen, self.background) self.snake.update() def main(self) -> int: screen = self._init_display() clock = pg.time.Clock() while self.snake.head.alive(): for event in pg.event.get(): if event.type == pg.QUIT or ( event.type == pg.KEYDOWN and event.key in (pg.K_ESCAPE, pg.K_q) ): return self.score keystate = pg.key.get_pressed() if keystate[pg.K_RIGHT]: self.snake.change_direction(Direction.RIGHT) elif keystate[pg.K_LEFT]: self.snake.change_direction(Direction.LEFT) elif keystate[pg.K_UP]: self.snake.change_direction(Direction.UP) elif keystate[pg.K_DOWN]: self.snake.change_direction(Direction.DOWN) self.update(screen) for food in pg.sprite.spritecollide( self.snake.head, self.food_group, dokill=False ): food.kill() self.snake.grow() self.score += 1 if self.score % 5 == 0: self.framerate += 1 self.food_group.add(SnakeFood(self, self.segment_size)) if pg.sprite.spritecollideany(self.snake.head, self.snake.body): self.snake.head.kill() self.draw(screen) clock.tick(self.framerate) return self.score if __name__ == "__main__": game = Game() score = game.main() print(score)
Convert the following code from C++ to Python, ensuring the logic remains intact.
#include <string> #include <iostream> int main( ) { std::string word( "Premier League" ) ; std::cout << "Without first letter: " << word.substr( 1 ) << " !\n" ; std::cout << "Without last letter: " << word.substr( 0 , word.length( ) - 1 ) << " !\n" ; std::cout << "Without first and last letter: " << word.substr( 1 , word.length( ) - 2 ) << " !\n" ; return 0 ; }
print "knight"[1:] print "socks"[:-1] print "brooms"[1:-1]
Produce a functionally identical Python code for the snippet given in C++.
#include <string> #include <iostream> int main( ) { std::string word( "Premier League" ) ; std::cout << "Without first letter: " << word.substr( 1 ) << " !\n" ; std::cout << "Without last letter: " << word.substr( 0 , word.length( ) - 1 ) << " !\n" ; std::cout << "Without first and last letter: " << word.substr( 1 , word.length( ) - 2 ) << " !\n" ; return 0 ; }
print "knight"[1:] print "socks"[:-1] print "brooms"[1:-1]
Rewrite the snippet below in Python so it works the same as the original C++ code.
#include <string> #include <iostream> int main( ) { std::string word( "Premier League" ) ; std::cout << "Without first letter: " << word.substr( 1 ) << " !\n" ; std::cout << "Without last letter: " << word.substr( 0 , word.length( ) - 1 ) << " !\n" ; std::cout << "Without first and last letter: " << word.substr( 1 , word.length( ) - 2 ) << " !\n" ; return 0 ; }
print "knight"[1:] print "socks"[:-1] print "brooms"[1:-1]
Transform the following C++ implementation into Python, maintaining the same output and logic.
#include <cmath> #include <iostream> #include <vector> std::vector<int> generate_primes(int limit) { std::vector<bool> sieve(limit >> 1, true); for (int p = 3, s = 9; s < limit; p += 2) { if (sieve[p >> 1]) { for (int q = s; q < limit; q += p << 1) sieve[q >> 1] = false; } s += (p + 1) << 2; } std::vector<int> primes; if (limit > 2) primes.push_back(2); for (int i = 1; i < sieve.size(); ++i) { if (sieve[i]) primes.push_back((i << 1) + 1); } return primes; } class legendre_prime_counter { public: explicit legendre_prime_counter(int limit); int prime_count(int n); private: int phi(int x, int a); std::vector<int> primes; }; legendre_prime_counter::legendre_prime_counter(int limit) : primes(generate_primes(static_cast<int>(std::sqrt(limit)))) {} int legendre_prime_counter::prime_count(int n) { if (n < 2) return 0; int a = prime_count(static_cast<int>(std::sqrt(n))); return phi(n, a) + a - 1; } int legendre_prime_counter::phi(int x, int a) { if (a == 0) return x; if (a == 1) return x - (x >> 1); int pa = primes[a - 1]; if (x <= pa) return 1; return phi(x, a - 1) - phi(x / pa, a - 1); } int main() { legendre_prime_counter counter(1000000000); for (int i = 0, n = 1; i < 10; ++i, n *= 10) std::cout << "10^" << i << "\t" << counter.prime_count(n) << '\n'; }
from primesieve import primes from math import isqrt from functools import cache p = primes(isqrt(1_000_000_000)) @cache def phi(x, a): res = 0 while True: if not a or not x: return x + res a -= 1 res -= phi(x//p[a], a) def legpi(n): if n < 2: return 0 a = legpi(isqrt(n)) return phi(n, a) + a - 1 for e in range(10): print(f'10^{e}', legpi(10**e))
Write a version of this C++ function in Python with identical behavior.
#include <cmath> #include <iostream> #include <vector> std::vector<int> generate_primes(int limit) { std::vector<bool> sieve(limit >> 1, true); for (int p = 3, s = 9; s < limit; p += 2) { if (sieve[p >> 1]) { for (int q = s; q < limit; q += p << 1) sieve[q >> 1] = false; } s += (p + 1) << 2; } std::vector<int> primes; if (limit > 2) primes.push_back(2); for (int i = 1; i < sieve.size(); ++i) { if (sieve[i]) primes.push_back((i << 1) + 1); } return primes; } class legendre_prime_counter { public: explicit legendre_prime_counter(int limit); int prime_count(int n); private: int phi(int x, int a); std::vector<int> primes; }; legendre_prime_counter::legendre_prime_counter(int limit) : primes(generate_primes(static_cast<int>(std::sqrt(limit)))) {} int legendre_prime_counter::prime_count(int n) { if (n < 2) return 0; int a = prime_count(static_cast<int>(std::sqrt(n))); return phi(n, a) + a - 1; } int legendre_prime_counter::phi(int x, int a) { if (a == 0) return x; if (a == 1) return x - (x >> 1); int pa = primes[a - 1]; if (x <= pa) return 1; return phi(x, a - 1) - phi(x / pa, a - 1); } int main() { legendre_prime_counter counter(1000000000); for (int i = 0, n = 1; i < 10; ++i, n *= 10) std::cout << "10^" << i << "\t" << counter.prime_count(n) << '\n'; }
from primesieve import primes from math import isqrt from functools import cache p = primes(isqrt(1_000_000_000)) @cache def phi(x, a): res = 0 while True: if not a or not x: return x + res a -= 1 res -= phi(x//p[a], a) def legpi(n): if n < 2: return 0 a = legpi(isqrt(n)) return phi(n, a) + a - 1 for e in range(10): print(f'10^{e}', legpi(10**e))
Translate the given C++ code snippet into Python without altering its behavior.
#include <string> using std::string; extern "C" int Query (char *Data, size_t *Length) { const string Message = "Here am I"; if (*Length < Message.length()) return false; *Length = Message.length(); Message.copy(Data, *Length); return true; }
def query(buffer_length): message = b'Here am I' L = len(message) return message[0:L*(L <= buffer_length)]
Port the provided C++ code into Python while preserving the original functionality.
#include <iostream> #include <string.h> int main() { std::string longLine, longestLines, newLine; while (std::cin >> newLine) { auto isNewLineShorter = longLine.c_str(); auto isLongLineShorter = newLine.c_str(); while (*isNewLineShorter && *isLongLineShorter) { isNewLineShorter = &isNewLineShorter[1]; isLongLineShorter = &isLongLineShorter[1]; } if(*isNewLineShorter) continue; if(*isLongLineShorter) { longLine = newLine; longestLines = newLine; } else { longestLines+=newLine; } longestLines+="\n"; } std::cout << "\nLongest string:\n" << longestLines; }
import fileinput def longer(a, b): try: b[len(a)-1] return False except: return True longest, lines = '', '' for x in fileinput.input(): if longer(x, longest): lines, longest = x, x elif not longer(longest, x): lines += x print(lines, end='')
Port the following code from C++ to Python with equivalent syntax and logic.
#include <vector> #include <string> #include <iostream> #include <algorithm> #include <fstream> #include <iomanip> typedef unsigned int uint; using namespace std; const uint TAPE_MAX_LEN = 49152; struct action { char write, direction; }; class tape { public: tape( uint startPos = TAPE_MAX_LEN >> 1 ) : MAX_LEN( TAPE_MAX_LEN ) { _sp = startPos; reset(); } void reset() { clear( '0' ); headPos = _sp; } char read(){ return _t[headPos]; } void input( string a ){ if( a == "" ) return; for( uint s = 0; s < a.length(); s++ ) _t[headPos + s] = a[s]; } void clear( char c ) { _t.clear(); blk = c; _t.resize( MAX_LEN, blk ); } void action( const action* a ) { write( a->write ); move( a->direction ); } void print( int c = 10 ) { int ml = static_cast<int>( MAX_LEN ), st = static_cast<int>( headPos ) - c, ed = static_cast<int>( headPos ) + c + 1, tx; for( int x = st; x < ed; x++ ) { tx = x; if( tx < 0 ) tx += ml; if( tx >= ml ) tx -= ml; cout << _t[tx]; } cout << endl << setw( c + 1 ) << "^" << endl; } private: void move( char d ) { if( d == 'N' ) return; headPos += d == 'R' ? 1 : -1; if( headPos >= MAX_LEN ) headPos = d == 'R' ? 0 : MAX_LEN - 1; } void write( char a ) { if( a != 'N' ) { if( a == 'B' ) _t[headPos] = blk; else _t[headPos] = a; } } string _t; uint headPos, _sp; char blk; const uint MAX_LEN; }; class state { public: bool operator ==( const string o ) { return o == name; } string name, next; char symbol, write, direction; }; class actionTable { public: bool loadTable( string file ) { reset(); ifstream mf; mf.open( file.c_str() ); if( mf.is_open() ) { string str; state stt; while( mf.good() ) { getline( mf, str ); if( str[0] == '\'' ) break; parseState( str, stt ); states.push_back( stt ); } while( mf.good() ) { getline( mf, str ); if( str == "" ) continue; if( str[0] == '!' ) blank = str.erase( 0, 1 )[0]; if( str[0] == '^' ) curState = str.erase( 0, 1 ); if( str[0] == '>' ) input = str.erase( 0, 1 ); } mf.close(); return true; } cout << "Could not open " << file << endl; return false; } bool action( char symbol, action& a ) { vector<state>::iterator f = states.begin(); while( true ) { f = find( f, states.end(), curState ); if( f == states.end() ) return false; if( ( *f ).symbol == '*' || ( *f ).symbol == symbol || ( ( *f ).symbol == 'B' && blank == symbol ) ) { a.direction = ( *f ).direction; a.write = ( *f ).write; curState = ( *f ).next; break; } f++; } return true; } void reset() { states.clear(); blank = '0'; curState = input = ""; } string getInput() { return input; } char getBlank() { return blank; } private: void parseState( string str, state& stt ) { string a[5]; int idx = 0; for( string::iterator si = str.begin(); si != str.end(); si++ ) { if( ( *si ) == ';' ) idx++; else a[idx].append( &( *si ), 1 ); } stt.name = a[0]; stt.symbol = a[1][0]; stt.write = a[2][0]; stt.direction = a[3][0]; stt.next = a[4]; } vector<state> states; char blank; string curState, input; }; class utm { public: utm() { files[0] = "incrementer.utm"; files[1] = "busy_beaver.utm"; files[2] = "sort.utm"; } void start() { while( true ) { reset(); int t = showMenu(); if( t == 0 ) return; if( !at.loadTable( files[t - 1] ) ) return; startMachine(); } } private: void simulate() { char r; action a; while( true ) { tp.print(); r = tp.read(); if( !( at.action( r, a ) ) ) break; tp.action( &a ); } cout << endl << endl; system( "pause" ); } int showMenu() { int t = -1; while( t < 0 || t > 3 ) { system( "cls" ); cout << "1. Incrementer\n2. Busy beaver\n3. Sort\n\n0. Quit"; cout << endl << endl << "Choose an action "; cin >> t; } return t; } void reset() { tp.reset(); at.reset(); } void startMachine() { system( "cls" ); tp.clear( at.getBlank() ); tp.input( at.getInput() ); simulate(); } tape tp; actionTable at; string files[7]; }; int main( int a, char* args[] ){ utm mm; mm.start(); return 0; }
from __future__ import print_function def run_utm( state = None, blank = None, rules = [], tape = [], halt = None, pos = 0): st = state if not tape: tape = [blank] if pos < 0: pos += len(tape) if pos >= len(tape) or pos < 0: raise Error( "bad init position") rules = dict(((s0, v0), (v1, dr, s1)) for (s0, v0, v1, dr, s1) in rules) while True: print(st, '\t', end=" ") for i, v in enumerate(tape): if i == pos: print("[%s]" % (v,), end=" ") else: print(v, end=" ") print() if st == halt: break if (st, tape[pos]) not in rules: break (v1, dr, s1) = rules[(st, tape[pos])] tape[pos] = v1 if dr == 'left': if pos > 0: pos -= 1 else: tape.insert(0, blank) if dr == 'right': pos += 1 if pos >= len(tape): tape.append(blank) st = s1 print("incr machine\n") run_utm( halt = 'qf', state = 'q0', tape = list("111"), blank = 'B', rules = map(tuple, ["q0 1 1 right q0".split(), "q0 B 1 stay qf".split()] ) ) print("\nbusy beaver\n") run_utm( halt = 'halt', state = 'a', blank = '0', rules = map(tuple, ["a 0 1 right b".split(), "a 1 1 left c".split(), "b 0 1 left a".split(), "b 1 1 right b".split(), "c 0 1 left b".split(), "c 1 1 stay halt".split()] ) ) print("\nsorting test\n") run_utm(halt = 'STOP', state = 'A', blank = '0', tape = "2 2 2 1 2 2 1 2 1 2 1 2 1 2".split(), rules = map(tuple, ["A 1 1 right A".split(), "A 2 3 right B".split(), "A 0 0 left E".split(), "B 1 1 right B".split(), "B 2 2 right B".split(), "B 0 0 left C".split(), "C 1 2 left D".split(), "C 2 2 left C".split(), "C 3 2 left E".split(), "D 1 1 left D".split(), "D 2 2 left D".split(), "D 3 1 right A".split(), "E 1 1 left E".split(), "E 0 0 right STOP".split()] ) )
Can you help me rewrite this code in Python instead of C++, keeping it the same logically?
#include <vector> #include <string> #include <iostream> #include <algorithm> #include <fstream> #include <iomanip> typedef unsigned int uint; using namespace std; const uint TAPE_MAX_LEN = 49152; struct action { char write, direction; }; class tape { public: tape( uint startPos = TAPE_MAX_LEN >> 1 ) : MAX_LEN( TAPE_MAX_LEN ) { _sp = startPos; reset(); } void reset() { clear( '0' ); headPos = _sp; } char read(){ return _t[headPos]; } void input( string a ){ if( a == "" ) return; for( uint s = 0; s < a.length(); s++ ) _t[headPos + s] = a[s]; } void clear( char c ) { _t.clear(); blk = c; _t.resize( MAX_LEN, blk ); } void action( const action* a ) { write( a->write ); move( a->direction ); } void print( int c = 10 ) { int ml = static_cast<int>( MAX_LEN ), st = static_cast<int>( headPos ) - c, ed = static_cast<int>( headPos ) + c + 1, tx; for( int x = st; x < ed; x++ ) { tx = x; if( tx < 0 ) tx += ml; if( tx >= ml ) tx -= ml; cout << _t[tx]; } cout << endl << setw( c + 1 ) << "^" << endl; } private: void move( char d ) { if( d == 'N' ) return; headPos += d == 'R' ? 1 : -1; if( headPos >= MAX_LEN ) headPos = d == 'R' ? 0 : MAX_LEN - 1; } void write( char a ) { if( a != 'N' ) { if( a == 'B' ) _t[headPos] = blk; else _t[headPos] = a; } } string _t; uint headPos, _sp; char blk; const uint MAX_LEN; }; class state { public: bool operator ==( const string o ) { return o == name; } string name, next; char symbol, write, direction; }; class actionTable { public: bool loadTable( string file ) { reset(); ifstream mf; mf.open( file.c_str() ); if( mf.is_open() ) { string str; state stt; while( mf.good() ) { getline( mf, str ); if( str[0] == '\'' ) break; parseState( str, stt ); states.push_back( stt ); } while( mf.good() ) { getline( mf, str ); if( str == "" ) continue; if( str[0] == '!' ) blank = str.erase( 0, 1 )[0]; if( str[0] == '^' ) curState = str.erase( 0, 1 ); if( str[0] == '>' ) input = str.erase( 0, 1 ); } mf.close(); return true; } cout << "Could not open " << file << endl; return false; } bool action( char symbol, action& a ) { vector<state>::iterator f = states.begin(); while( true ) { f = find( f, states.end(), curState ); if( f == states.end() ) return false; if( ( *f ).symbol == '*' || ( *f ).symbol == symbol || ( ( *f ).symbol == 'B' && blank == symbol ) ) { a.direction = ( *f ).direction; a.write = ( *f ).write; curState = ( *f ).next; break; } f++; } return true; } void reset() { states.clear(); blank = '0'; curState = input = ""; } string getInput() { return input; } char getBlank() { return blank; } private: void parseState( string str, state& stt ) { string a[5]; int idx = 0; for( string::iterator si = str.begin(); si != str.end(); si++ ) { if( ( *si ) == ';' ) idx++; else a[idx].append( &( *si ), 1 ); } stt.name = a[0]; stt.symbol = a[1][0]; stt.write = a[2][0]; stt.direction = a[3][0]; stt.next = a[4]; } vector<state> states; char blank; string curState, input; }; class utm { public: utm() { files[0] = "incrementer.utm"; files[1] = "busy_beaver.utm"; files[2] = "sort.utm"; } void start() { while( true ) { reset(); int t = showMenu(); if( t == 0 ) return; if( !at.loadTable( files[t - 1] ) ) return; startMachine(); } } private: void simulate() { char r; action a; while( true ) { tp.print(); r = tp.read(); if( !( at.action( r, a ) ) ) break; tp.action( &a ); } cout << endl << endl; system( "pause" ); } int showMenu() { int t = -1; while( t < 0 || t > 3 ) { system( "cls" ); cout << "1. Incrementer\n2. Busy beaver\n3. Sort\n\n0. Quit"; cout << endl << endl << "Choose an action "; cin >> t; } return t; } void reset() { tp.reset(); at.reset(); } void startMachine() { system( "cls" ); tp.clear( at.getBlank() ); tp.input( at.getInput() ); simulate(); } tape tp; actionTable at; string files[7]; }; int main( int a, char* args[] ){ utm mm; mm.start(); return 0; }
from __future__ import print_function def run_utm( state = None, blank = None, rules = [], tape = [], halt = None, pos = 0): st = state if not tape: tape = [blank] if pos < 0: pos += len(tape) if pos >= len(tape) or pos < 0: raise Error( "bad init position") rules = dict(((s0, v0), (v1, dr, s1)) for (s0, v0, v1, dr, s1) in rules) while True: print(st, '\t', end=" ") for i, v in enumerate(tape): if i == pos: print("[%s]" % (v,), end=" ") else: print(v, end=" ") print() if st == halt: break if (st, tape[pos]) not in rules: break (v1, dr, s1) = rules[(st, tape[pos])] tape[pos] = v1 if dr == 'left': if pos > 0: pos -= 1 else: tape.insert(0, blank) if dr == 'right': pos += 1 if pos >= len(tape): tape.append(blank) st = s1 print("incr machine\n") run_utm( halt = 'qf', state = 'q0', tape = list("111"), blank = 'B', rules = map(tuple, ["q0 1 1 right q0".split(), "q0 B 1 stay qf".split()] ) ) print("\nbusy beaver\n") run_utm( halt = 'halt', state = 'a', blank = '0', rules = map(tuple, ["a 0 1 right b".split(), "a 1 1 left c".split(), "b 0 1 left a".split(), "b 1 1 right b".split(), "c 0 1 left b".split(), "c 1 1 stay halt".split()] ) ) print("\nsorting test\n") run_utm(halt = 'STOP', state = 'A', blank = '0', tape = "2 2 2 1 2 2 1 2 1 2 1 2 1 2".split(), rules = map(tuple, ["A 1 1 right A".split(), "A 2 3 right B".split(), "A 0 0 left E".split(), "B 1 1 right B".split(), "B 2 2 right B".split(), "B 0 0 left C".split(), "C 1 2 left D".split(), "C 2 2 left C".split(), "C 3 2 left E".split(), "D 1 1 left D".split(), "D 2 2 left D".split(), "D 3 1 right A".split(), "E 1 1 left E".split(), "E 0 0 right STOP".split()] ) )
Port the following code from C++ to Python with equivalent syntax and logic.
#include <vector> #include <string> #include <iostream> #include <algorithm> #include <fstream> #include <iomanip> typedef unsigned int uint; using namespace std; const uint TAPE_MAX_LEN = 49152; struct action { char write, direction; }; class tape { public: tape( uint startPos = TAPE_MAX_LEN >> 1 ) : MAX_LEN( TAPE_MAX_LEN ) { _sp = startPos; reset(); } void reset() { clear( '0' ); headPos = _sp; } char read(){ return _t[headPos]; } void input( string a ){ if( a == "" ) return; for( uint s = 0; s < a.length(); s++ ) _t[headPos + s] = a[s]; } void clear( char c ) { _t.clear(); blk = c; _t.resize( MAX_LEN, blk ); } void action( const action* a ) { write( a->write ); move( a->direction ); } void print( int c = 10 ) { int ml = static_cast<int>( MAX_LEN ), st = static_cast<int>( headPos ) - c, ed = static_cast<int>( headPos ) + c + 1, tx; for( int x = st; x < ed; x++ ) { tx = x; if( tx < 0 ) tx += ml; if( tx >= ml ) tx -= ml; cout << _t[tx]; } cout << endl << setw( c + 1 ) << "^" << endl; } private: void move( char d ) { if( d == 'N' ) return; headPos += d == 'R' ? 1 : -1; if( headPos >= MAX_LEN ) headPos = d == 'R' ? 0 : MAX_LEN - 1; } void write( char a ) { if( a != 'N' ) { if( a == 'B' ) _t[headPos] = blk; else _t[headPos] = a; } } string _t; uint headPos, _sp; char blk; const uint MAX_LEN; }; class state { public: bool operator ==( const string o ) { return o == name; } string name, next; char symbol, write, direction; }; class actionTable { public: bool loadTable( string file ) { reset(); ifstream mf; mf.open( file.c_str() ); if( mf.is_open() ) { string str; state stt; while( mf.good() ) { getline( mf, str ); if( str[0] == '\'' ) break; parseState( str, stt ); states.push_back( stt ); } while( mf.good() ) { getline( mf, str ); if( str == "" ) continue; if( str[0] == '!' ) blank = str.erase( 0, 1 )[0]; if( str[0] == '^' ) curState = str.erase( 0, 1 ); if( str[0] == '>' ) input = str.erase( 0, 1 ); } mf.close(); return true; } cout << "Could not open " << file << endl; return false; } bool action( char symbol, action& a ) { vector<state>::iterator f = states.begin(); while( true ) { f = find( f, states.end(), curState ); if( f == states.end() ) return false; if( ( *f ).symbol == '*' || ( *f ).symbol == symbol || ( ( *f ).symbol == 'B' && blank == symbol ) ) { a.direction = ( *f ).direction; a.write = ( *f ).write; curState = ( *f ).next; break; } f++; } return true; } void reset() { states.clear(); blank = '0'; curState = input = ""; } string getInput() { return input; } char getBlank() { return blank; } private: void parseState( string str, state& stt ) { string a[5]; int idx = 0; for( string::iterator si = str.begin(); si != str.end(); si++ ) { if( ( *si ) == ';' ) idx++; else a[idx].append( &( *si ), 1 ); } stt.name = a[0]; stt.symbol = a[1][0]; stt.write = a[2][0]; stt.direction = a[3][0]; stt.next = a[4]; } vector<state> states; char blank; string curState, input; }; class utm { public: utm() { files[0] = "incrementer.utm"; files[1] = "busy_beaver.utm"; files[2] = "sort.utm"; } void start() { while( true ) { reset(); int t = showMenu(); if( t == 0 ) return; if( !at.loadTable( files[t - 1] ) ) return; startMachine(); } } private: void simulate() { char r; action a; while( true ) { tp.print(); r = tp.read(); if( !( at.action( r, a ) ) ) break; tp.action( &a ); } cout << endl << endl; system( "pause" ); } int showMenu() { int t = -1; while( t < 0 || t > 3 ) { system( "cls" ); cout << "1. Incrementer\n2. Busy beaver\n3. Sort\n\n0. Quit"; cout << endl << endl << "Choose an action "; cin >> t; } return t; } void reset() { tp.reset(); at.reset(); } void startMachine() { system( "cls" ); tp.clear( at.getBlank() ); tp.input( at.getInput() ); simulate(); } tape tp; actionTable at; string files[7]; }; int main( int a, char* args[] ){ utm mm; mm.start(); return 0; }
from __future__ import print_function def run_utm( state = None, blank = None, rules = [], tape = [], halt = None, pos = 0): st = state if not tape: tape = [blank] if pos < 0: pos += len(tape) if pos >= len(tape) or pos < 0: raise Error( "bad init position") rules = dict(((s0, v0), (v1, dr, s1)) for (s0, v0, v1, dr, s1) in rules) while True: print(st, '\t', end=" ") for i, v in enumerate(tape): if i == pos: print("[%s]" % (v,), end=" ") else: print(v, end=" ") print() if st == halt: break if (st, tape[pos]) not in rules: break (v1, dr, s1) = rules[(st, tape[pos])] tape[pos] = v1 if dr == 'left': if pos > 0: pos -= 1 else: tape.insert(0, blank) if dr == 'right': pos += 1 if pos >= len(tape): tape.append(blank) st = s1 print("incr machine\n") run_utm( halt = 'qf', state = 'q0', tape = list("111"), blank = 'B', rules = map(tuple, ["q0 1 1 right q0".split(), "q0 B 1 stay qf".split()] ) ) print("\nbusy beaver\n") run_utm( halt = 'halt', state = 'a', blank = '0', rules = map(tuple, ["a 0 1 right b".split(), "a 1 1 left c".split(), "b 0 1 left a".split(), "b 1 1 right b".split(), "c 0 1 left b".split(), "c 1 1 stay halt".split()] ) ) print("\nsorting test\n") run_utm(halt = 'STOP', state = 'A', blank = '0', tape = "2 2 2 1 2 2 1 2 1 2 1 2 1 2".split(), rules = map(tuple, ["A 1 1 right A".split(), "A 2 3 right B".split(), "A 0 0 left E".split(), "B 1 1 right B".split(), "B 2 2 right B".split(), "B 0 0 left C".split(), "C 1 2 left D".split(), "C 2 2 left C".split(), "C 3 2 left E".split(), "D 1 1 left D".split(), "D 2 2 left D".split(), "D 3 1 right A".split(), "E 1 1 left E".split(), "E 0 0 right STOP".split()] ) )
Write the same code in Python as shown below in C++.
#include <direct.h> #include <fstream> int main() { std::fstream f("output.txt", std::ios::out); f.close(); f.open("/output.txt", std::ios::out); f.close(); _mkdir("docs"); _mkdir("/docs"); return 0; }
import os for directory in ['/', './']: open(directory + 'output.txt', 'w').close() os.mkdir(directory + 'docs')
Produce a language-to-language conversion: from C++ to Python, same semantics.
#include <iostream> #include <cstdint> #include "prime_sieve.hpp" typedef uint32_t integer; int count_digits(integer n) { int digits = 0; for (; n > 0; ++digits) n /= 10; return digits; } integer change_digit(integer n, int index, int new_digit) { integer p = 1; integer changed = 0; for (; index > 0; p *= 10, n /= 10, --index) changed += p * (n % 10); changed += (10 * (n/10) + new_digit) * p; return changed; } bool unprimeable(const prime_sieve& sieve, integer n) { if (sieve.is_prime(n)) return false; int d = count_digits(n); for (int i = 0; i < d; ++i) { for (int j = 0; j <= 9; ++j) { integer m = change_digit(n, i, j); if (m != n && sieve.is_prime(m)) return false; } } return true; } int main() { const integer limit = 10000000; prime_sieve sieve(limit); std::cout.imbue(std::locale("")); std::cout << "First 35 unprimeable numbers:\n"; integer n = 100; integer lowest[10] = { 0 }; for (int count = 0, found = 0; n < limit && (found < 10 || count < 600); ++n) { if (unprimeable(sieve, n)) { if (count < 35) { if (count != 0) std::cout << ", "; std::cout << n; } ++count; if (count == 600) std::cout << "\n600th unprimeable number: " << n << '\n'; int last_digit = n % 10; if (lowest[last_digit] == 0) { lowest[last_digit] = n; ++found; } } } for (int i = 0; i < 10; ++i) std::cout << "Least unprimeable number ending in " << i << ": " << lowest[i] << '\n'; return 0; }
from itertools import count, islice def primes(_cache=[2, 3]): yield from _cache for n in count(_cache[-1]+2, 2): if isprime(n): _cache.append(n) yield n def isprime(n, _seen={0: False, 1: False}): def _isprime(n): for p in primes(): if p*p > n: return True if n%p == 0: return False if n not in _seen: _seen[n] = _isprime(n) return _seen[n] def unprime(): for a in count(1): d = 1 while d <= a: base = (a//(d*10))*(d*10) + (a%d) if any(isprime(y) for y in range(base, base + d*10, d)): break d *= 10 else: yield a print('First 35:') print(' '.join(str(i) for i in islice(unprime(), 35))) print('\nThe 600-th:') print(list(islice(unprime(), 599, 600))[0]) print() first, need = [False]*10, 10 for p in unprime(): i = p%10 if first[i]: continue first[i] = p need -= 1 if not need: break for i,v in enumerate(first): print(f'{i} ending: {v}')
Transform the following C++ implementation into Python, maintaining the same output and logic.
#include <iostream> #include <iomanip> inline int sign(int i) { return i < 0 ? -1 : i > 0; } inline int& E(int *x, int row, int col) { return x[row * (row + 1) / 2 + col]; } int iter(int *v, int *diff) { E(v, 0, 0) = 151; E(v, 2, 0) = 40; E(v, 4, 1) = 11; E(v, 4, 3) = 4; for (auto i = 1u; i < 5u; i++) for (auto j = 0u; j <= i; j++) { E(diff, i, j) = 0; if (j < i) E(diff, i, j) += E(v, i - 1, j) - E(v, i, j + 1) - E(v, i, j); if (j) E(diff, i, j) += E(v, i - 1, j - 1) - E(v, i, j - 1) - E(v, i, j); } for (auto i = 0u; i < 4u; i++) for (auto j = 0u; j < i; j++) E(diff, i, j) += E(v, i + 1, j) + E(v, i + 1, j + 1) - E(v, i, j); E(diff, 4, 2) += E(v, 4, 0) + E(v, 4, 4) - E(v, 4, 2); uint sum; int e = 0; for (auto i = sum = 0u; i < 15u; i++) { sum += !!sign(e = diff[i]); if (e >= 4 || e <= -4) v[i] += e / 5; else if (rand() < RAND_MAX / 4) v[i] += sign(e); } return sum; } void show(int *x) { for (auto i = 0u; i < 5u; i++) for (auto j = 0u; j <= i; j++) std::cout << std::setw(4u) << *(x++) << (j < i ? ' ' : '\n'); } int main() { int v[15] = { 0 }, diff[15] = { 0 }; for (auto i = 1u, s = 1u; s; i++) { s = iter(v, diff); std::cout << "pass " << i << ": " << s << std::endl; } show(v); return 0; }
def combine( snl, snr ): cl = {} if isinstance(snl, int): cl['1'] = snl elif isinstance(snl, string): cl[snl] = 1 else: cl.update( snl) if isinstance(snr, int): n = cl.get('1', 0) cl['1'] = n + snr elif isinstance(snr, string): n = cl.get(snr, 0) cl[snr] = n + 1 else: for k,v in snr.items(): n = cl.get(k, 0) cl[k] = n+v return cl def constrain(nsum, vn ): nn = {} nn.update(vn) n = nn.get('1', 0) nn['1'] = n - nsum return nn def makeMatrix( constraints ): vmap = set() for c in constraints: vmap.update( c.keys()) vmap.remove('1') nvars = len(vmap) vmap = sorted(vmap) mtx = [] for c in constraints: row = [] for vv in vmap: row.append(float(c.get(vv, 0))) row.append(-float(c.get('1',0))) mtx.append(row) if len(constraints) == nvars: print 'System appears solvable' elif len(constraints) < nvars: print 'System is not solvable - needs more constraints.' return mtx, vmap def SolvePyramid( vl, cnstr ): vl.reverse() constraints = [cnstr] lvls = len(vl) for lvln in range(1,lvls): lvd = vl[lvln] for k in range(lvls - lvln): sn = lvd[k] ll = vl[lvln-1] vn = combine(ll[k], ll[k+1]) if sn is None: lvd[k] = vn else: constraints.append(constrain( sn, vn )) print 'Constraint Equations:' for cstr in constraints: fset = ('%d*%s'%(v,k) for k,v in cstr.items() ) print ' + '.join(fset), ' = 0' mtx,vmap = makeMatrix(constraints) MtxSolve(mtx) d = len(vmap) for j in range(d): print vmap[j],'=', mtx[j][d] def MtxSolve(mtx): mDim = len(mtx) for j in range(mDim): rw0= mtx[j] f = 1.0/rw0[j] for k in range(j, mDim+1): rw0[k] *= f for l in range(1+j,mDim): rwl = mtx[l] f = -rwl[j] for k in range(j, mDim+1): rwl[k] += f * rw0[k] for j1 in range(1,mDim): j = mDim - j1 rw0= mtx[j] for l in range(0, j): rwl = mtx[l] f = -rwl[j] rwl[j] += f * rw0[j] rwl[mDim] += f * rw0[mDim] return mtx p = [ [151], [None,None], [40,None,None], [None,None,None,None], ['X', 11, 'Y', 4, 'Z'] ] addlConstraint = { 'X':1, 'Y':-1, 'Z':1, '1':0 } SolvePyramid( p, addlConstraint)
Please provide an equivalent version of this C++ code in Python.
#include <iostream> #include <iomanip> inline int sign(int i) { return i < 0 ? -1 : i > 0; } inline int& E(int *x, int row, int col) { return x[row * (row + 1) / 2 + col]; } int iter(int *v, int *diff) { E(v, 0, 0) = 151; E(v, 2, 0) = 40; E(v, 4, 1) = 11; E(v, 4, 3) = 4; for (auto i = 1u; i < 5u; i++) for (auto j = 0u; j <= i; j++) { E(diff, i, j) = 0; if (j < i) E(diff, i, j) += E(v, i - 1, j) - E(v, i, j + 1) - E(v, i, j); if (j) E(diff, i, j) += E(v, i - 1, j - 1) - E(v, i, j - 1) - E(v, i, j); } for (auto i = 0u; i < 4u; i++) for (auto j = 0u; j < i; j++) E(diff, i, j) += E(v, i + 1, j) + E(v, i + 1, j + 1) - E(v, i, j); E(diff, 4, 2) += E(v, 4, 0) + E(v, 4, 4) - E(v, 4, 2); uint sum; int e = 0; for (auto i = sum = 0u; i < 15u; i++) { sum += !!sign(e = diff[i]); if (e >= 4 || e <= -4) v[i] += e / 5; else if (rand() < RAND_MAX / 4) v[i] += sign(e); } return sum; } void show(int *x) { for (auto i = 0u; i < 5u; i++) for (auto j = 0u; j <= i; j++) std::cout << std::setw(4u) << *(x++) << (j < i ? ' ' : '\n'); } int main() { int v[15] = { 0 }, diff[15] = { 0 }; for (auto i = 1u, s = 1u; s; i++) { s = iter(v, diff); std::cout << "pass " << i << ": " << s << std::endl; } show(v); return 0; }
def combine( snl, snr ): cl = {} if isinstance(snl, int): cl['1'] = snl elif isinstance(snl, string): cl[snl] = 1 else: cl.update( snl) if isinstance(snr, int): n = cl.get('1', 0) cl['1'] = n + snr elif isinstance(snr, string): n = cl.get(snr, 0) cl[snr] = n + 1 else: for k,v in snr.items(): n = cl.get(k, 0) cl[k] = n+v return cl def constrain(nsum, vn ): nn = {} nn.update(vn) n = nn.get('1', 0) nn['1'] = n - nsum return nn def makeMatrix( constraints ): vmap = set() for c in constraints: vmap.update( c.keys()) vmap.remove('1') nvars = len(vmap) vmap = sorted(vmap) mtx = [] for c in constraints: row = [] for vv in vmap: row.append(float(c.get(vv, 0))) row.append(-float(c.get('1',0))) mtx.append(row) if len(constraints) == nvars: print 'System appears solvable' elif len(constraints) < nvars: print 'System is not solvable - needs more constraints.' return mtx, vmap def SolvePyramid( vl, cnstr ): vl.reverse() constraints = [cnstr] lvls = len(vl) for lvln in range(1,lvls): lvd = vl[lvln] for k in range(lvls - lvln): sn = lvd[k] ll = vl[lvln-1] vn = combine(ll[k], ll[k+1]) if sn is None: lvd[k] = vn else: constraints.append(constrain( sn, vn )) print 'Constraint Equations:' for cstr in constraints: fset = ('%d*%s'%(v,k) for k,v in cstr.items() ) print ' + '.join(fset), ' = 0' mtx,vmap = makeMatrix(constraints) MtxSolve(mtx) d = len(vmap) for j in range(d): print vmap[j],'=', mtx[j][d] def MtxSolve(mtx): mDim = len(mtx) for j in range(mDim): rw0= mtx[j] f = 1.0/rw0[j] for k in range(j, mDim+1): rw0[k] *= f for l in range(1+j,mDim): rwl = mtx[l] f = -rwl[j] for k in range(j, mDim+1): rwl[k] += f * rw0[k] for j1 in range(1,mDim): j = mDim - j1 rw0= mtx[j] for l in range(0, j): rwl = mtx[l] f = -rwl[j] rwl[j] += f * rw0[j] rwl[mDim] += f * rw0[mDim] return mtx p = [ [151], [None,None], [40,None,None], [None,None,None,None], ['X', 11, 'Y', 4, 'Z'] ] addlConstraint = { 'X':1, 'Y':-1, 'Z':1, '1':0 } SolvePyramid( p, addlConstraint)
Please provide an equivalent version of this C++ code in Python.
#include <gmp.h> #include <iostream> using namespace std; typedef unsigned long long int u64; bool primality_pretest(u64 k) { if (!(k % 3) || !(k % 5) || !(k % 7) || !(k % 11) || !(k % 13) || !(k % 17) || !(k % 19) || !(k % 23) ) { return (k <= 23); } return true; } bool probprime(u64 k, mpz_t n) { mpz_set_ui(n, k); return mpz_probab_prime_p(n, 0); } bool is_chernick(int n, u64 m, mpz_t z) { if (!primality_pretest(6 * m + 1)) { return false; } if (!primality_pretest(12 * m + 1)) { return false; } u64 t = 9 * m; for (int i = 1; i <= n - 2; i++) { if (!primality_pretest((t << i) + 1)) { return false; } } if (!probprime(6 * m + 1, z)) { return false; } if (!probprime(12 * m + 1, z)) { return false; } for (int i = 1; i <= n - 2; i++) { if (!probprime((t << i) + 1, z)) { return false; } } return true; } int main() { mpz_t z; mpz_inits(z, NULL); for (int n = 3; n <= 10; n++) { u64 multiplier = (n > 4) ? (1 << (n - 4)) : 1; if (n > 5) { multiplier *= 5; } for (u64 k = 1; ; k++) { u64 m = k * multiplier; if (is_chernick(n, m, z)) { cout << "a(" << n << ") has m = " << m << endl; break; } } } return 0; }
from sympy import isprime def primality_pretest(k): if not (k % 3) or not (k % 5) or not (k % 7) or not (k % 11) or not(k % 13) or not (k % 17) or not (k % 19) or not (k % 23): return (k <= 23) return True def is_chernick(n, m): t = 9 * m if not primality_pretest(6 * m + 1): return False if not primality_pretest(12 * m + 1): return False for i in range(1,n-1): if not primality_pretest((t << i) + 1): return False if not isprime(6 * m + 1): return False if not isprime(12 * m + 1): return False for i in range(1,n - 1): if not isprime((t << i) + 1): return False return True for n in range(3,10): if n > 4: multiplier = 1 << (n - 4) else: multiplier = 1 if n > 5: multiplier *= 5 k = 1 while True: m = k * multiplier if is_chernick(n, m): print("a("+str(n)+") has m = "+str(m)) break k += 1
Produce a language-to-language conversion: from C++ to Python, same semantics.
#include <iostream> const double EPS = 0.001; const double EPS_SQUARE = EPS * EPS; double side(double x1, double y1, double x2, double y2, double x, double y) { return (y2 - y1) * (x - x1) + (-x2 + x1) * (y - y1); } bool naivePointInTriangle(double x1, double y1, double x2, double y2, double x3, double y3, double x, double y) { double checkSide1 = side(x1, y1, x2, y2, x, y) >= 0; double checkSide2 = side(x2, y2, x3, y3, x, y) >= 0; double checkSide3 = side(x3, y3, x1, y1, x, y) >= 0; return checkSide1 && checkSide2 && checkSide3; } bool pointInTriangleBoundingBox(double x1, double y1, double x2, double y2, double x3, double y3, double x, double y) { double xMin = std::min(x1, std::min(x2, x3)) - EPS; double xMax = std::max(x1, std::max(x2, x3)) + EPS; double yMin = std::min(y1, std::min(y2, y3)) - EPS; double yMax = std::max(y1, std::max(y2, y3)) + EPS; return !(x < xMin || xMax < x || y < yMin || yMax < y); } double distanceSquarePointToSegment(double x1, double y1, double x2, double y2, double x, double y) { double p1_p2_squareLength = (x2 - x1) * (x2 - x1) + (y2 - y1) * (y2 - y1); double dotProduct = ((x - x1) * (x2 - x1) + (y - y1) * (y2 - y1)) / p1_p2_squareLength; if (dotProduct < 0) { return (x - x1) * (x - x1) + (y - y1) * (y - y1); } else if (dotProduct <= 1) { double p_p1_squareLength = (x1 - x) * (x1 - x) + (y1 - y) * (y1 - y); return p_p1_squareLength - dotProduct * dotProduct * p1_p2_squareLength; } else { return (x - x2) * (x - x2) + (y - y2) * (y - y2); } } bool accuratePointInTriangle(double x1, double y1, double x2, double y2, double x3, double y3, double x, double y) { if (!pointInTriangleBoundingBox(x1, y1, x2, y2, x3, y3, x, y)) { return false; } if (naivePointInTriangle(x1, y1, x2, y2, x3, y3, x, y)) { return true; } if (distanceSquarePointToSegment(x1, y1, x2, y2, x, y) <= EPS_SQUARE) { return true; } if (distanceSquarePointToSegment(x2, y2, x3, y3, x, y) <= EPS_SQUARE) { return true; } if (distanceSquarePointToSegment(x3, y3, x1, y1, x, y) <= EPS_SQUARE) { return true; } return false; } void printPoint(double x, double y) { std::cout << '(' << x << ", " << y << ')'; } void printTriangle(double x1, double y1, double x2, double y2, double x3, double y3) { std::cout << "Triangle is ["; printPoint(x1, y1); std::cout << ", "; printPoint(x2, y2); std::cout << ", "; printPoint(x3, y3); std::cout << "]\n"; } void test(double x1, double y1, double x2, double y2, double x3, double y3, double x, double y) { printTriangle(x1, y1, x2, y2, x3, y3); std::cout << "Point "; printPoint(x, y); std::cout << " is within triangle? "; if (accuratePointInTriangle(x1, y1, x2, y2, x3, y3, x, y)) { std::cout << "true\n"; } else { std::cout << "false\n"; } } int main() { test(1.5, 2.4, 5.1, -3.1, -3.8, 1.2, 0, 0); test(1.5, 2.4, 5.1, -3.1, -3.8, 1.2, 0, 1); test(1.5, 2.4, 5.1, -3.1, -3.8, 1.2, 3, 1); std::cout << '\n'; test(0.1, 0.1111111111111111, 12.5, 33.333333333333336, 25, 11.11111111111111, 5.414285714285714, 14.349206349206348); std::cout << '\n'; test(0.1, 0.1111111111111111, 12.5, 33.333333333333336, -12.5, 16.666666666666668, 5.414285714285714, 14.349206349206348); std::cout << '\n'; return 0; }
from sympy.geometry import Point, Triangle def sign(pt1, pt2, pt3): return (pt1.x - pt3.x) * (pt2.y - pt3.y) - (pt2.x - pt3.x) * (pt1.y - pt3.y) def iswithin(point, pt1, pt2, pt3): zval1 = sign(point, pt1, pt2) zval2 = sign(point, pt2, pt3) zval3 = sign(point, pt3, pt1) notanyneg = zval1 >= 0 and zval2 >= 0 and zval3 >= 0 notanypos = zval1 <= 0 and zval2 <= 0 and zval3 <= 0 return notanyneg or notanypos if __name__ == "__main__": POINTS = [Point(0, 0)] TRI = Triangle(Point(1.5, 2.4), Point(5.1, -3.1), Point(-3.8, 0.5)) for pnt in POINTS: a, b, c = TRI.vertices isornot = "is" if iswithin(pnt, a, b, c) else "is not" print("Point", pnt, isornot, "within the triangle", TRI)
Port the following code from C++ to Python with equivalent syntax and logic.
#include <iostream> const double EPS = 0.001; const double EPS_SQUARE = EPS * EPS; double side(double x1, double y1, double x2, double y2, double x, double y) { return (y2 - y1) * (x - x1) + (-x2 + x1) * (y - y1); } bool naivePointInTriangle(double x1, double y1, double x2, double y2, double x3, double y3, double x, double y) { double checkSide1 = side(x1, y1, x2, y2, x, y) >= 0; double checkSide2 = side(x2, y2, x3, y3, x, y) >= 0; double checkSide3 = side(x3, y3, x1, y1, x, y) >= 0; return checkSide1 && checkSide2 && checkSide3; } bool pointInTriangleBoundingBox(double x1, double y1, double x2, double y2, double x3, double y3, double x, double y) { double xMin = std::min(x1, std::min(x2, x3)) - EPS; double xMax = std::max(x1, std::max(x2, x3)) + EPS; double yMin = std::min(y1, std::min(y2, y3)) - EPS; double yMax = std::max(y1, std::max(y2, y3)) + EPS; return !(x < xMin || xMax < x || y < yMin || yMax < y); } double distanceSquarePointToSegment(double x1, double y1, double x2, double y2, double x, double y) { double p1_p2_squareLength = (x2 - x1) * (x2 - x1) + (y2 - y1) * (y2 - y1); double dotProduct = ((x - x1) * (x2 - x1) + (y - y1) * (y2 - y1)) / p1_p2_squareLength; if (dotProduct < 0) { return (x - x1) * (x - x1) + (y - y1) * (y - y1); } else if (dotProduct <= 1) { double p_p1_squareLength = (x1 - x) * (x1 - x) + (y1 - y) * (y1 - y); return p_p1_squareLength - dotProduct * dotProduct * p1_p2_squareLength; } else { return (x - x2) * (x - x2) + (y - y2) * (y - y2); } } bool accuratePointInTriangle(double x1, double y1, double x2, double y2, double x3, double y3, double x, double y) { if (!pointInTriangleBoundingBox(x1, y1, x2, y2, x3, y3, x, y)) { return false; } if (naivePointInTriangle(x1, y1, x2, y2, x3, y3, x, y)) { return true; } if (distanceSquarePointToSegment(x1, y1, x2, y2, x, y) <= EPS_SQUARE) { return true; } if (distanceSquarePointToSegment(x2, y2, x3, y3, x, y) <= EPS_SQUARE) { return true; } if (distanceSquarePointToSegment(x3, y3, x1, y1, x, y) <= EPS_SQUARE) { return true; } return false; } void printPoint(double x, double y) { std::cout << '(' << x << ", " << y << ')'; } void printTriangle(double x1, double y1, double x2, double y2, double x3, double y3) { std::cout << "Triangle is ["; printPoint(x1, y1); std::cout << ", "; printPoint(x2, y2); std::cout << ", "; printPoint(x3, y3); std::cout << "]\n"; } void test(double x1, double y1, double x2, double y2, double x3, double y3, double x, double y) { printTriangle(x1, y1, x2, y2, x3, y3); std::cout << "Point "; printPoint(x, y); std::cout << " is within triangle? "; if (accuratePointInTriangle(x1, y1, x2, y2, x3, y3, x, y)) { std::cout << "true\n"; } else { std::cout << "false\n"; } } int main() { test(1.5, 2.4, 5.1, -3.1, -3.8, 1.2, 0, 0); test(1.5, 2.4, 5.1, -3.1, -3.8, 1.2, 0, 1); test(1.5, 2.4, 5.1, -3.1, -3.8, 1.2, 3, 1); std::cout << '\n'; test(0.1, 0.1111111111111111, 12.5, 33.333333333333336, 25, 11.11111111111111, 5.414285714285714, 14.349206349206348); std::cout << '\n'; test(0.1, 0.1111111111111111, 12.5, 33.333333333333336, -12.5, 16.666666666666668, 5.414285714285714, 14.349206349206348); std::cout << '\n'; return 0; }
from sympy.geometry import Point, Triangle def sign(pt1, pt2, pt3): return (pt1.x - pt3.x) * (pt2.y - pt3.y) - (pt2.x - pt3.x) * (pt1.y - pt3.y) def iswithin(point, pt1, pt2, pt3): zval1 = sign(point, pt1, pt2) zval2 = sign(point, pt2, pt3) zval3 = sign(point, pt3, pt1) notanyneg = zval1 >= 0 and zval2 >= 0 and zval3 >= 0 notanypos = zval1 <= 0 and zval2 <= 0 and zval3 <= 0 return notanyneg or notanypos if __name__ == "__main__": POINTS = [Point(0, 0)] TRI = Triangle(Point(1.5, 2.4), Point(5.1, -3.1), Point(-3.8, 0.5)) for pnt in POINTS: a, b, c = TRI.vertices isornot = "is" if iswithin(pnt, a, b, c) else "is not" print("Point", pnt, isornot, "within the triangle", TRI)
Write the same code in Python as shown below in C++.
#include <iomanip> #include <iostream> unsigned int divisor_count(unsigned int n) { unsigned int total = 1; for (; (n & 1) == 0; n >>= 1) ++total; for (unsigned int p = 3; p * p <= n; p += 2) { unsigned int count = 1; for (; n % p == 0; n /= p) ++count; total *= count; } if (n > 1) total *= 2; return total; } int main() { const unsigned int limit = 100; std::cout << "Count of divisors for the first " << limit << " positive integers:\n"; for (unsigned int n = 1; n <= limit; ++n) { std::cout << std::setw(3) << divisor_count(n); if (n % 20 == 0) std::cout << '\n'; } }
def factorize(n): assert(isinstance(n, int)) if n < 0: n = -n if n < 2: return k = 0 while 0 == n%2: k += 1 n //= 2 if 0 < k: yield (2,k) p = 3 while p*p <= n: k = 0 while 0 == n%p: k += 1 n //= p if 0 < k: yield (p,k) p += 2 if 1 < n: yield (n,1) def tau(n): assert(n != 0) ans = 1 for (p,k) in factorize(n): ans *= 1 + k return ans if __name__ == "__main__": print(*map(tau, range(1, 101)))
Generate an equivalent Python version of this C++ code.
#include <iomanip> #include <iostream> unsigned int divisor_count(unsigned int n) { unsigned int total = 1; for (; (n & 1) == 0; n >>= 1) ++total; for (unsigned int p = 3; p * p <= n; p += 2) { unsigned int count = 1; for (; n % p == 0; n /= p) ++count; total *= count; } if (n > 1) total *= 2; return total; } int main() { const unsigned int limit = 100; std::cout << "Count of divisors for the first " << limit << " positive integers:\n"; for (unsigned int n = 1; n <= limit; ++n) { std::cout << std::setw(3) << divisor_count(n); if (n % 20 == 0) std::cout << '\n'; } }
def factorize(n): assert(isinstance(n, int)) if n < 0: n = -n if n < 2: return k = 0 while 0 == n%2: k += 1 n //= 2 if 0 < k: yield (2,k) p = 3 while p*p <= n: k = 0 while 0 == n%p: k += 1 n //= p if 0 < k: yield (p,k) p += 2 if 1 < n: yield (n,1) def tau(n): assert(n != 0) ans = 1 for (p,k) in factorize(n): ans *= 1 + k return ans if __name__ == "__main__": print(*map(tau, range(1, 101)))
Produce a functionally identical Python code for the snippet given in C++.
#include <cstdint> #include <iostream> #include <sstream> #include <gmpxx.h> typedef mpz_class integer; bool is_probably_prime(const integer& n) { return mpz_probab_prime_p(n.get_mpz_t(), 25) != 0; } bool is_prime(unsigned int n) { if (n < 2) return false; if (n % 2 == 0) return n == 2; if (n % 3 == 0) return n == 3; for (unsigned int p = 5; p * p <= n; p += 4) { if (n % p == 0) return false; p += 2; if (n % p == 0) return false; } return true; } int main() { const unsigned int max = 20; integer primorial = 1; for (unsigned int p = 0, count = 0, index = 0; count < max; ++p) { if (!is_prime(p)) continue; primorial *= p; ++index; if (is_probably_prime(primorial - 1) || is_probably_prime(primorial + 1)) { if (count > 0) std::cout << ' '; std::cout << index; ++count; } } std::cout << '\n'; return 0; }
import pyprimes def primorial_prime(_pmax=500): isprime = pyprimes.isprime n, primo = 0, 1 for prime in pyprimes.nprimes(_pmax): n, primo = n+1, primo * prime if isprime(primo-1) or isprime(primo+1): yield n if __name__ == '__main__': pyprimes.warn_probably = False for i, n in zip(range(20), primorial_prime()): print('Primorial prime %2i at primorial index: %3i' % (i+1, n))
Maintain the same structure and functionality when rewriting this code in Python.
#include <map> #include <string> #include <iostream> #include <iomanip> const std::string DEFAULT_DNA = "CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATG" "CTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTG" "AGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGAT" "GGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT" "CGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGG" "TCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA" "TTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTAT" "CGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTG" "TCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGAC" "GACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT"; class DnaBase { public: DnaBase(const std::string& dna = DEFAULT_DNA, int width = 50) : genome(dna), displayWidth(width) { for (auto elm : dna) { if (count.find(elm) == count.end()) count[elm] = 0; ++count[elm]; } } void viewGenome() { std::cout << "Sequence:" << std::endl; std::cout << std::endl; int limit = genome.size() / displayWidth; if (genome.size() % displayWidth != 0) ++limit; for (int i = 0; i < limit; ++i) { int beginPos = i * displayWidth; std::cout << std::setw(4) << beginPos << "  :" << std::setw(4) << genome.substr(beginPos, displayWidth) << std::endl; } std::cout << std::endl; std::cout << "Base Count" << std::endl; std::cout << "----------" << std::endl; std::cout << std::endl; int total = 0; for (auto elm : count) { std::cout << std::setw(4) << elm.first << " : " << elm.second << std::endl; total += elm.second; } std::cout << std::endl; std::cout << "Total: " << total << std::endl; } private: std::string genome; std::map<char, int> count; int displayWidth; }; int main(void) { auto d = new DnaBase(); d->viewGenome(); delete d; return 0; }
from collections import Counter def basecount(dna): return sorted(Counter(dna).items()) def seq_split(dna, n=50): return [dna[i: i+n] for i in range(0, len(dna), n)] def seq_pp(dna, n=50): for i, part in enumerate(seq_split(dna, n)): print(f"{i*n:>5}: {part}") print("\n BASECOUNT:") tot = 0 for base, count in basecount(dna): print(f" {base:>3}: {count}") tot += count base, count = 'TOT', tot print(f" {base:>3}= {count}") if __name__ == '__main__': print("SEQUENCE:") sequence = seq_pp(sequence)
Produce a language-to-language conversion: from C++ to Python, same semantics.
#include <map> #include <string> #include <iostream> #include <iomanip> const std::string DEFAULT_DNA = "CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATG" "CTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTG" "AGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGAT" "GGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT" "CGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGG" "TCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA" "TTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTAT" "CGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTG" "TCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGAC" "GACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT"; class DnaBase { public: DnaBase(const std::string& dna = DEFAULT_DNA, int width = 50) : genome(dna), displayWidth(width) { for (auto elm : dna) { if (count.find(elm) == count.end()) count[elm] = 0; ++count[elm]; } } void viewGenome() { std::cout << "Sequence:" << std::endl; std::cout << std::endl; int limit = genome.size() / displayWidth; if (genome.size() % displayWidth != 0) ++limit; for (int i = 0; i < limit; ++i) { int beginPos = i * displayWidth; std::cout << std::setw(4) << beginPos << "  :" << std::setw(4) << genome.substr(beginPos, displayWidth) << std::endl; } std::cout << std::endl; std::cout << "Base Count" << std::endl; std::cout << "----------" << std::endl; std::cout << std::endl; int total = 0; for (auto elm : count) { std::cout << std::setw(4) << elm.first << " : " << elm.second << std::endl; total += elm.second; } std::cout << std::endl; std::cout << "Total: " << total << std::endl; } private: std::string genome; std::map<char, int> count; int displayWidth; }; int main(void) { auto d = new DnaBase(); d->viewGenome(); delete d; return 0; }
from collections import Counter def basecount(dna): return sorted(Counter(dna).items()) def seq_split(dna, n=50): return [dna[i: i+n] for i in range(0, len(dna), n)] def seq_pp(dna, n=50): for i, part in enumerate(seq_split(dna, n)): print(f"{i*n:>5}: {part}") print("\n BASECOUNT:") tot = 0 for base, count in basecount(dna): print(f" {base:>3}: {count}") tot += count base, count = 'TOT', tot print(f" {base:>3}= {count}") if __name__ == '__main__': print("SEQUENCE:") sequence = seq_pp(sequence)
Maintain the same structure and functionality when rewriting this code in Python.
#include <algorithm> #include <array> #include <chrono> #include <iostream> #include <mutex> #include <random> #include <string> #include <string_view> #include <thread> const int timeScale = 42; void Message(std::string_view message) { static std::mutex cout_mutex; std::scoped_lock cout_lock(cout_mutex); std::cout << message << std::endl; } struct Fork { std::mutex mutex; }; struct Dinner { std::array<Fork, 5> forks; ~Dinner() { Message("Dinner is over"); } }; class Philosopher { std::mt19937 rng{std::random_device {}()}; const std::string name; Fork& left; Fork& right; std::thread worker; void live(); void dine(); void ponder(); public: Philosopher(std::string name_, Fork& l, Fork& r) : name(std::move(name_)), left(l), right(r), worker(&Philosopher::live, this) {} ~Philosopher() { worker.join(); Message(name + " went to sleep."); } }; void Philosopher::live() { for(;;) { { std::scoped_lock dine_lock(left.mutex, right.mutex); dine(); } ponder(); } } void Philosopher::dine() { Message(name + " started eating."); thread_local std::array<const char*, 3> foods {"chicken", "rice", "soda"}; thread_local std::array<const char*, 3> reactions { "I like this %s!", "This %s is good.", "Mmm, %s..." }; thread_local std::uniform_int_distribution<> dist(1, 6); std::shuffle( foods.begin(), foods.end(), rng); std::shuffle(reactions.begin(), reactions.end(), rng); constexpr size_t buf_size = 64; char buffer[buf_size]; for(int i = 0; i < 3; ++i) { std::this_thread::sleep_for(std::chrono::milliseconds(dist(rng) * timeScale)); snprintf(buffer, buf_size, reactions[i], foods[i]); Message(name + ": " + buffer); } std::this_thread::sleep_for(std::chrono::milliseconds(dist(rng)) * timeScale); Message(name + " finished and left."); } void Philosopher::ponder() { static constexpr std::array<const char*, 5> topics {{ "politics", "art", "meaning of life", "source of morality", "how many straws makes a bale" }}; thread_local std::uniform_int_distribution<> wait(1, 6); thread_local std::uniform_int_distribution<> dist(0, topics.size() - 1); while(dist(rng) > 0) { std::this_thread::sleep_for(std::chrono::milliseconds(wait(rng) * 3 * timeScale)); Message(name + " is pondering about " + topics[dist(rng)] + "."); } std::this_thread::sleep_for(std::chrono::milliseconds(wait(rng) * 3 * timeScale)); Message(name + " is hungry again!"); } int main() { Dinner dinner; Message("Dinner started!"); std::array<Philosopher, 5> philosophers {{ {"Aristotle", dinner.forks[0], dinner.forks[1]}, {"Democritus", dinner.forks[1], dinner.forks[2]}, {"Plato", dinner.forks[2], dinner.forks[3]}, {"Pythagoras", dinner.forks[3], dinner.forks[4]}, {"Socrates", dinner.forks[4], dinner.forks[0]}, }}; Message("It is dark outside..."); }
import threading import random import time class Philosopher(threading.Thread): running = True def __init__(self, xname, forkOnLeft, forkOnRight): threading.Thread.__init__(self) self.name = xname self.forkOnLeft = forkOnLeft self.forkOnRight = forkOnRight def run(self): while(self.running): time.sleep( random.uniform(3,13)) print '%s is hungry.' % self.name self.dine() def dine(self): fork1, fork2 = self.forkOnLeft, self.forkOnRight while self.running: fork1.acquire(True) locked = fork2.acquire(False) if locked: break fork1.release() print '%s swaps forks' % self.name fork1, fork2 = fork2, fork1 else: return self.dining() fork2.release() fork1.release() def dining(self): print '%s starts eating '% self.name time.sleep(random.uniform(1,10)) print '%s finishes eating and leaves to think.' % self.name def DiningPhilosophers(): forks = [threading.Lock() for n in range(5)] philosopherNames = ('Aristotle','Kant','Spinoza','Marx', 'Russel') philosophers= [Philosopher(philosopherNames[i], forks[i%5], forks[(i+1)%5]) \ for i in range(5)] random.seed(507129) Philosopher.running = True for p in philosophers: p.start() time.sleep(100) Philosopher.running = False print ("Now we're finishing.") DiningPhilosophers()
Keep all operations the same but rewrite the snippet in Python.
#include <iostream> class factorion_t { public: factorion_t() { f[0] = 1u; for (uint n = 1u; n < 12u; n++) f[n] = f[n - 1] * n; } bool operator()(uint i, uint b) const { uint sum = 0; for (uint j = i; j > 0u; j /= b) sum += f[j % b]; return sum == i; } private: ulong f[12]; }; int main() { factorion_t factorion; for (uint b = 9u; b <= 12u; ++b) { std::cout << "factorions for base " << b << ':'; for (uint i = 1u; i < 1500000u; ++i) if (factorion(i, b)) std::cout << ' ' << i; std::cout << std::endl; } return 0; }
fact = [1] for n in range(1, 12): fact.append(fact[n-1] * n) for b in range(9, 12+1): print(f"The factorions for base {b} are:") for i in range(1, 1500000): fact_sum = 0 j = i while j > 0: d = j % b fact_sum += fact[d] j = j//b if fact_sum == i: print(i, end=" ") print("\n")
Generate an equivalent Python version of this C++ code.
#include <iostream> class factorion_t { public: factorion_t() { f[0] = 1u; for (uint n = 1u; n < 12u; n++) f[n] = f[n - 1] * n; } bool operator()(uint i, uint b) const { uint sum = 0; for (uint j = i; j > 0u; j /= b) sum += f[j % b]; return sum == i; } private: ulong f[12]; }; int main() { factorion_t factorion; for (uint b = 9u; b <= 12u; ++b) { std::cout << "factorions for base " << b << ':'; for (uint i = 1u; i < 1500000u; ++i) if (factorion(i, b)) std::cout << ' ' << i; std::cout << std::endl; } return 0; }
fact = [1] for n in range(1, 12): fact.append(fact[n-1] * n) for b in range(9, 12+1): print(f"The factorions for base {b} are:") for i in range(1, 1500000): fact_sum = 0 j = i while j > 0: d = j % b fact_sum += fact[d] j = j//b if fact_sum == i: print(i, end=" ") print("\n")
Convert this C++ block to Python, preserving its control flow and logic.
#include <cmath> #include <functional> #include <iostream> constexpr double K = 7.8e9; constexpr int n0 = 27; constexpr double actual[] = { 27, 27, 27, 44, 44, 59, 59, 59, 59, 59, 59, 59, 59, 60, 60, 61, 61, 66, 83, 219, 239, 392, 534, 631, 897, 1350, 2023, 2820, 4587, 6067, 7823, 9826, 11946, 14554, 17372, 20615, 24522, 28273, 31491, 34933, 37552, 40540, 43105, 45177, 60328, 64543, 67103, 69265, 71332, 73327, 75191, 75723, 76719, 77804, 78812, 79339, 80132, 80995, 82101, 83365, 85203, 87024, 89068, 90664, 93077, 95316, 98172, 102133, 105824, 109695, 114232, 118610, 125497, 133852, 143227, 151367, 167418, 180096, 194836, 213150, 242364, 271106, 305117, 338133, 377918, 416845, 468049, 527767, 591704, 656866, 715353, 777796, 851308, 928436, 1000249, 1082054, 1174652 }; double f(double r) { double sq = 0; constexpr size_t len = std::size(actual); for (size_t i = 0; i < len; ++i) { double eri = std::exp(r * i); double guess = (n0 * eri)/(1 + n0 * (eri - 1)/K); double diff = guess - actual[i]; sq += diff * diff; } return sq; } double solve(std::function<double(double)> fn, double guess=0.5, double epsilon=0) { for (double delta = guess ? guess : 1, f0 = fn(guess), factor = 2; delta > epsilon && guess != guess - delta; delta *= factor) { double nf = fn(guess - delta); if (nf < f0) { f0 = nf; guess -= delta; } else { nf = fn(guess + delta); if (nf < f0) { f0 = nf; guess += delta; } else factor = 0.5; } } return guess; } int main() { double r = solve(f); double R0 = std::exp(12 * r); std::cout << "r = " << r << ", R0 = " << R0 << '\n'; return 0; }
import numpy as np import scipy.optimize as opt n0, K = 27, 7_800_000_000 def f(t, r): return (n0 * np.exp(r * t)) / (( 1 + n0 * (np.exp(r * t) - 1) / K)) y = [ 27, 27, 27, 44, 44, 59, 59, 59, 59, 59, 59, 59, 59, 60, 60, 61, 61, 66, 83, 219, 239, 392, 534, 631, 897, 1350, 2023, 2820, 4587, 6067, 7823, 9826, 11946, 14554, 17372, 20615, 24522, 28273, 31491, 34933, 37552, 40540, 43105, 45177, 60328, 64543, 67103, 69265, 71332, 73327, 75191, 75723, 76719, 77804, 78812, 79339, 80132, 80995, 82101, 83365, 85203, 87024, 89068, 90664, 93077, 95316, 98172, 102133, 105824, 109695, 114232, 118610, 125497, 133852, 143227, 151367, 167418, 180096, 194836, 213150, 242364, 271106, 305117, 338133, 377918, 416845, 468049, 527767, 591704, 656866, 715353, 777796, 851308, 928436, 1000249, 1082054, 1174652, ] x = np.linspace(0.0, 96, 97) r, cov = opt.curve_fit(f, x, y, [0.5]) print("The r for the world Covid-19 data is:", r, ", with covariance of", cov) print("The calculated R0 is then", np.exp(12 * r))
Change the programming language of this snippet from C++ to Python without modifying what it does.
#include <list> template <typename T> std::list<T> strandSort(std::list<T> lst) { if (lst.size() <= 1) return lst; std::list<T> result; std::list<T> sorted; while (!lst.empty()) { sorted.push_back(lst.front()); lst.pop_front(); for (typename std::list<T>::iterator it = lst.begin(); it != lst.end(); ) { if (sorted.back() <= *it) { sorted.push_back(*it); it = lst.erase(it); } else it++; } result.merge(sorted); } return result; }
def merge_list(a, b): out = [] while len(a) and len(b): if a[0] < b[0]: out.append(a.pop(0)) else: out.append(b.pop(0)) out += a out += b return out def strand(a): i, s = 0, [a.pop(0)] while i < len(a): if a[i] > s[-1]: s.append(a.pop(i)) else: i += 1 return s def strand_sort(a): out = strand(a) while len(a): out = merge_list(out, strand(a)) return out print strand_sort([1, 6, 3, 2, 1, 7, 5, 3])
Convert this C++ snippet to Python and keep its semantics consistent.
#include <iomanip> #include <iostream> bool is_prime(unsigned int n) { if (n < 2) return false; if (n % 2 == 0) return n == 2; if (n % 3 == 0) return n == 3; for (unsigned int p = 5; p * p <= n; p += 4) { if (n % p == 0) return false; p += 2; if (n % p == 0) return false; } return true; } unsigned int digit_sum(unsigned int n) { unsigned int sum = 0; for (; n > 0; n /= 10) sum += n % 10; return sum; } int main() { const unsigned int limit = 500; std::cout << "Additive primes less than " << limit << ":\n"; unsigned int count = 0; for (unsigned int n = 1; n < limit; ++n) { if (is_prime(digit_sum(n)) && is_prime(n)) { std::cout << std::setw(3) << n; if (++count % 10 == 0) std::cout << '\n'; else std::cout << ' '; } } std::cout << '\n' << count << " additive primes found.\n"; }
def is_prime(n: int) -> bool: if n <= 3: return n > 1 if n % 2 == 0 or n % 3 == 0: return False i = 5 while i ** 2 <= n: if n % i == 0 or n % (i + 2) == 0: return False i += 6 return True def digit_sum(n: int) -> int: sum = 0 while n > 0: sum += n % 10 n //= 10 return sum def main() -> None: additive_primes = 0 for i in range(2, 500): if is_prime(i) and is_prime(digit_sum(i)): additive_primes += 1 print(i, end=" ") print(f"\nFound {additive_primes} additive primes less than 500") if __name__ == "__main__": main()
Translate the given C++ code snippet into Python without altering its behavior.
class invertedAssign { int data; public: invertedAssign(int data):data(data){} int getData(){return data;} void operator=(invertedAssign& other) const { other.data = this->data; } }; #include <iostream> int main(){ invertedAssign a = 0; invertedAssign b = 42; std::cout << a.getData() << ' ' << b.getData() << '\n'; b = a; std::cout << a.getData() << ' ' << b.getData() << '\n'; }
x = truevalue if condition else falsevalue
Rewrite this program in Python while keeping its functionality equivalent to the C++ version.
class invertedAssign { int data; public: invertedAssign(int data):data(data){} int getData(){return data;} void operator=(invertedAssign& other) const { other.data = this->data; } }; #include <iostream> int main(){ invertedAssign a = 0; invertedAssign b = 42; std::cout << a.getData() << ' ' << b.getData() << '\n'; b = a; std::cout << a.getData() << ' ' << b.getData() << '\n'; }
x = truevalue if condition else falsevalue
Maintain the same structure and functionality when rewriting this code in Python.
#include <cassert> #include <iostream> #include <vector> class totient_calculator { public: explicit totient_calculator(int max) : totient_(max + 1) { for (int i = 1; i <= max; ++i) totient_[i] = i; for (int i = 2; i <= max; ++i) { if (totient_[i] < i) continue; for (int j = i; j <= max; j += i) totient_[j] -= totient_[j] / i; } } int totient(int n) const { assert (n >= 1 && n < totient_.size()); return totient_[n]; } bool is_prime(int n) const { return totient(n) == n - 1; } private: std::vector<int> totient_; }; bool perfect_totient_number(const totient_calculator& tc, int n) { int sum = 0; for (int m = n; m > 1; ) { int t = tc.totient(m); sum += t; m = t; } return sum == n; } int main() { totient_calculator tc(10000); int count = 0, n = 1; std::cout << "First 20 perfect totient numbers:\n"; for (; count < 20; ++n) { if (perfect_totient_number(tc, n)) { if (count > 0) std::cout << ' '; ++count; std::cout << n; } } std::cout << '\n'; return 0; }
from math import gcd from functools import lru_cache from itertools import islice, count @lru_cache(maxsize=None) def φ(n): return sum(1 for k in range(1, n + 1) if gcd(n, k) == 1) def perfect_totient(): for n0 in count(1): parts, n = 0, n0 while n != 1: n = φ(n) parts += n if parts == n0: yield n0 if __name__ == '__main__': print(list(islice(perfect_totient(), 20)))
Write the same code in Python as shown below in C++.
#include <cassert> #include <iostream> #include <vector> class totient_calculator { public: explicit totient_calculator(int max) : totient_(max + 1) { for (int i = 1; i <= max; ++i) totient_[i] = i; for (int i = 2; i <= max; ++i) { if (totient_[i] < i) continue; for (int j = i; j <= max; j += i) totient_[j] -= totient_[j] / i; } } int totient(int n) const { assert (n >= 1 && n < totient_.size()); return totient_[n]; } bool is_prime(int n) const { return totient(n) == n - 1; } private: std::vector<int> totient_; }; bool perfect_totient_number(const totient_calculator& tc, int n) { int sum = 0; for (int m = n; m > 1; ) { int t = tc.totient(m); sum += t; m = t; } return sum == n; } int main() { totient_calculator tc(10000); int count = 0, n = 1; std::cout << "First 20 perfect totient numbers:\n"; for (; count < 20; ++n) { if (perfect_totient_number(tc, n)) { if (count > 0) std::cout << ' '; ++count; std::cout << n; } } std::cout << '\n'; return 0; }
from math import gcd from functools import lru_cache from itertools import islice, count @lru_cache(maxsize=None) def φ(n): return sum(1 for k in range(1, n + 1) if gcd(n, k) == 1) def perfect_totient(): for n0 in count(1): parts, n = 0, n0 while n != 1: n = φ(n) parts += n if parts == n0: yield n0 if __name__ == '__main__': print(list(islice(perfect_totient(), 20)))
Convert the following code from C++ to Python, ensuring the logic remains intact.
#include <cassert> #include <iostream> #include <vector> class totient_calculator { public: explicit totient_calculator(int max) : totient_(max + 1) { for (int i = 1; i <= max; ++i) totient_[i] = i; for (int i = 2; i <= max; ++i) { if (totient_[i] < i) continue; for (int j = i; j <= max; j += i) totient_[j] -= totient_[j] / i; } } int totient(int n) const { assert (n >= 1 && n < totient_.size()); return totient_[n]; } bool is_prime(int n) const { return totient(n) == n - 1; } private: std::vector<int> totient_; }; bool perfect_totient_number(const totient_calculator& tc, int n) { int sum = 0; for (int m = n; m > 1; ) { int t = tc.totient(m); sum += t; m = t; } return sum == n; } int main() { totient_calculator tc(10000); int count = 0, n = 1; std::cout << "First 20 perfect totient numbers:\n"; for (; count < 20; ++n) { if (perfect_totient_number(tc, n)) { if (count > 0) std::cout << ' '; ++count; std::cout << n; } } std::cout << '\n'; return 0; }
from math import gcd from functools import lru_cache from itertools import islice, count @lru_cache(maxsize=None) def φ(n): return sum(1 for k in range(1, n + 1) if gcd(n, k) == 1) def perfect_totient(): for n0 in count(1): parts, n = 0, n0 while n != 1: n = φ(n) parts += n if parts == n0: yield n0 if __name__ == '__main__': print(list(islice(perfect_totient(), 20)))
Port the provided C++ code into Python while preserving the original functionality.
#include <tr1/memory> #include <string> #include <iostream> #include <tr1/functional> using namespace std; using namespace std::tr1; using std::tr1::function; class IDelegate { public: virtual ~IDelegate() {} }; class IThing { public: virtual ~IThing() {} virtual std::string Thing() = 0; }; class DelegateA : virtual public IDelegate { }; class DelegateB : public IThing, public IDelegate { std::string Thing() { return "delegate implementation"; } }; class Delegator { public: std::string Operation() { if(Delegate) if (IThing * pThing = dynamic_cast<IThing*>(Delegate.get())) return pThing->Thing(); return "default implementation"; } shared_ptr<IDelegate> Delegate; }; int main() { shared_ptr<DelegateA> delegateA(new DelegateA()); shared_ptr<DelegateB> delegateB(new DelegateB()); Delegator delegator; std::cout << delegator.Operation() << std::endl; delegator.Delegate = delegateA; std::cout << delegator.Operation() << std::endl; delegator.Delegate = delegateB; std::cout << delegator.Operation() << std::endl; }
class Delegator: def __init__(self): self.delegate = None def operation(self): if hasattr(self.delegate, 'thing') and callable(self.delegate.thing): return self.delegate.thing() return 'default implementation' class Delegate: def thing(self): return 'delegate implementation' if __name__ == '__main__': a = Delegator() assert a.operation() == 'default implementation' a.delegate = 'A delegate may be any object' assert a.operation() == 'default implementation' a.delegate = Delegate() assert a.operation() == 'delegate implementation'
Write the same algorithm in Python as shown in this C++ implementation.
#include <iomanip> #include <iostream> unsigned int divisor_sum(unsigned int n) { unsigned int total = 1, power = 2; for (; (n & 1) == 0; power <<= 1, n >>= 1) total += power; for (unsigned int p = 3; p * p <= n; p += 2) { unsigned int sum = 1; for (power = p; n % p == 0; power *= p, n /= p) sum += power; total *= sum; } if (n > 1) total *= n + 1; return total; } int main() { const unsigned int limit = 100; std::cout << "Sum of divisors for the first " << limit << " positive integers:\n"; for (unsigned int n = 1; n <= limit; ++n) { std::cout << std::setw(4) << divisor_sum(n); if (n % 10 == 0) std::cout << '\n'; } }
def factorize(n): assert(isinstance(n, int)) if n < 0: n = -n if n < 2: return k = 0 while 0 == n%2: k += 1 n //= 2 if 0 < k: yield (2,k) p = 3 while p*p <= n: k = 0 while 0 == n%p: k += 1 n //= p if 0 < k: yield (p,k) p += 2 if 1 < n: yield (n,1) def sum_of_divisors(n): assert(n != 0) ans = 1 for (p,k) in factorize(n): ans *= (pow(p,k+1) - 1)//(p-1) return ans if __name__ == "__main__": print([sum_of_divisors(n) for n in range(1,101)])
Convert this C++ block to Python, preserving its control flow and logic.
#include <iomanip> #include <iostream> unsigned int divisor_sum(unsigned int n) { unsigned int total = 1, power = 2; for (; (n & 1) == 0; power <<= 1, n >>= 1) total += power; for (unsigned int p = 3; p * p <= n; p += 2) { unsigned int sum = 1; for (power = p; n % p == 0; power *= p, n /= p) sum += power; total *= sum; } if (n > 1) total *= n + 1; return total; } int main() { const unsigned int limit = 100; std::cout << "Sum of divisors for the first " << limit << " positive integers:\n"; for (unsigned int n = 1; n <= limit; ++n) { std::cout << std::setw(4) << divisor_sum(n); if (n % 10 == 0) std::cout << '\n'; } }
def factorize(n): assert(isinstance(n, int)) if n < 0: n = -n if n < 2: return k = 0 while 0 == n%2: k += 1 n //= 2 if 0 < k: yield (2,k) p = 3 while p*p <= n: k = 0 while 0 == n%p: k += 1 n //= p if 0 < k: yield (p,k) p += 2 if 1 < n: yield (n,1) def sum_of_divisors(n): assert(n != 0) ans = 1 for (p,k) in factorize(n): ans *= (pow(p,k+1) - 1)//(p-1) return ans if __name__ == "__main__": print([sum_of_divisors(n) for n in range(1,101)])
Write the same code in Python as shown below in C++.
#include <algorithm> #include <cctype> #include <iostream> #include <sstream> #include <string> #include <vector> const char* command_table = "Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy " "COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find " "NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput " "Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO " "MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT " "READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT " "RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up"; class command { public: command(const std::string&, size_t); const std::string& cmd() const { return cmd_; } size_t min_length() const { return min_len_; } bool match(const std::string&) const; private: std::string cmd_; size_t min_len_; }; command::command(const std::string& cmd, size_t min_len) : cmd_(cmd), min_len_(min_len) {} bool command::match(const std::string& str) const { size_t olen = str.length(); return olen >= min_len_ && olen <= cmd_.length() && cmd_.compare(0, olen, str) == 0; } void uppercase(std::string& str) { std::transform(str.begin(), str.end(), str.begin(), [](unsigned char c) -> unsigned char { return std::toupper(c); }); } size_t get_min_length(const std::string& str) { size_t len = 0, n = str.length(); while (len < n && std::isupper(static_cast<unsigned char>(str[len]))) ++len; return len; } class command_list { public: explicit command_list(const char*); const command* find_command(const std::string&) const; private: std::vector<command> commands_; }; command_list::command_list(const char* table) { std::vector<command> commands; std::istringstream is(table); std::string word; while (is >> word) { size_t len = get_min_length(word); uppercase(word); commands_.push_back(command(word, len)); } } const command* command_list::find_command(const std::string& word) const { auto iter = std::find_if(commands_.begin(), commands_.end(), [&word](const command& cmd) { return cmd.match(word); }); return (iter != commands_.end()) ? &*iter : nullptr; } std::string test(const command_list& commands, const std::string& input) { std::string output; std::istringstream is(input); std::string word; while (is >> word) { if (!output.empty()) output += ' '; uppercase(word); const command* cmd_ptr = commands.find_command(word); if (cmd_ptr) output += cmd_ptr->cmd(); else output += "*error*"; } return output; } int main() { command_list commands(command_table); std::string input("riG rePEAT copies put mo rest types fup. 6 poweRin"); std::string output(test(commands, input)); std::cout << " input: " << input << '\n'; std::cout << "output: " << output << '\n'; return 0; }
command_table_text = \ user_words = "riG rePEAT copies put mo rest types fup. 6 poweRin" def find_abbreviations_length(command_table_text): command_table = dict() for word in command_table_text.split(): abbr_len = sum(1 for c in word if c.isupper()) if abbr_len == 0: abbr_len = len(word) command_table[word] = abbr_len return command_table def find_abbreviations(command_table): abbreviations = dict() for command, min_abbr_len in command_table.items(): for l in range(min_abbr_len, len(command)+1): abbr = command[:l].lower() abbreviations[abbr] = command.upper() return abbreviations def parse_user_string(user_string, abbreviations): user_words = [word.lower() for word in user_string.split()] commands = [abbreviations.get(user_word, "*error*") for user_word in user_words] return " ".join(commands) command_table = find_abbreviations_length(command_table_text) abbreviations_table = find_abbreviations(command_table) full_words = parse_user_string(user_words, abbreviations_table) print("user words:", user_words) print("full words:", full_words)
Translate this program into Python but keep the logic exactly as in C++.
#include <algorithm> #include <cctype> #include <iostream> #include <sstream> #include <string> #include <vector> const char* command_table = "Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy " "COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find " "NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput " "Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO " "MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT " "READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT " "RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up"; class command { public: command(const std::string&, size_t); const std::string& cmd() const { return cmd_; } size_t min_length() const { return min_len_; } bool match(const std::string&) const; private: std::string cmd_; size_t min_len_; }; command::command(const std::string& cmd, size_t min_len) : cmd_(cmd), min_len_(min_len) {} bool command::match(const std::string& str) const { size_t olen = str.length(); return olen >= min_len_ && olen <= cmd_.length() && cmd_.compare(0, olen, str) == 0; } void uppercase(std::string& str) { std::transform(str.begin(), str.end(), str.begin(), [](unsigned char c) -> unsigned char { return std::toupper(c); }); } size_t get_min_length(const std::string& str) { size_t len = 0, n = str.length(); while (len < n && std::isupper(static_cast<unsigned char>(str[len]))) ++len; return len; } class command_list { public: explicit command_list(const char*); const command* find_command(const std::string&) const; private: std::vector<command> commands_; }; command_list::command_list(const char* table) { std::vector<command> commands; std::istringstream is(table); std::string word; while (is >> word) { size_t len = get_min_length(word); uppercase(word); commands_.push_back(command(word, len)); } } const command* command_list::find_command(const std::string& word) const { auto iter = std::find_if(commands_.begin(), commands_.end(), [&word](const command& cmd) { return cmd.match(word); }); return (iter != commands_.end()) ? &*iter : nullptr; } std::string test(const command_list& commands, const std::string& input) { std::string output; std::istringstream is(input); std::string word; while (is >> word) { if (!output.empty()) output += ' '; uppercase(word); const command* cmd_ptr = commands.find_command(word); if (cmd_ptr) output += cmd_ptr->cmd(); else output += "*error*"; } return output; } int main() { command_list commands(command_table); std::string input("riG rePEAT copies put mo rest types fup. 6 poweRin"); std::string output(test(commands, input)); std::cout << " input: " << input << '\n'; std::cout << "output: " << output << '\n'; return 0; }
command_table_text = \ user_words = "riG rePEAT copies put mo rest types fup. 6 poweRin" def find_abbreviations_length(command_table_text): command_table = dict() for word in command_table_text.split(): abbr_len = sum(1 for c in word if c.isupper()) if abbr_len == 0: abbr_len = len(word) command_table[word] = abbr_len return command_table def find_abbreviations(command_table): abbreviations = dict() for command, min_abbr_len in command_table.items(): for l in range(min_abbr_len, len(command)+1): abbr = command[:l].lower() abbreviations[abbr] = command.upper() return abbreviations def parse_user_string(user_string, abbreviations): user_words = [word.lower() for word in user_string.split()] commands = [abbreviations.get(user_word, "*error*") for user_word in user_words] return " ".join(commands) command_table = find_abbreviations_length(command_table_text) abbreviations_table = find_abbreviations(command_table) full_words = parse_user_string(user_words, abbreviations_table) print("user words:", user_words) print("full words:", full_words)
Transform the following C++ implementation into Python, maintaining the same output and logic.
#include <algorithm> #include <cctype> #include <iostream> #include <sstream> #include <string> #include <vector> const char* command_table = "Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy " "COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find " "NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput " "Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO " "MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT " "READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT " "RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up"; class command { public: command(const std::string&, size_t); const std::string& cmd() const { return cmd_; } size_t min_length() const { return min_len_; } bool match(const std::string&) const; private: std::string cmd_; size_t min_len_; }; command::command(const std::string& cmd, size_t min_len) : cmd_(cmd), min_len_(min_len) {} bool command::match(const std::string& str) const { size_t olen = str.length(); return olen >= min_len_ && olen <= cmd_.length() && cmd_.compare(0, olen, str) == 0; } void uppercase(std::string& str) { std::transform(str.begin(), str.end(), str.begin(), [](unsigned char c) -> unsigned char { return std::toupper(c); }); } size_t get_min_length(const std::string& str) { size_t len = 0, n = str.length(); while (len < n && std::isupper(static_cast<unsigned char>(str[len]))) ++len; return len; } class command_list { public: explicit command_list(const char*); const command* find_command(const std::string&) const; private: std::vector<command> commands_; }; command_list::command_list(const char* table) { std::vector<command> commands; std::istringstream is(table); std::string word; while (is >> word) { size_t len = get_min_length(word); uppercase(word); commands_.push_back(command(word, len)); } } const command* command_list::find_command(const std::string& word) const { auto iter = std::find_if(commands_.begin(), commands_.end(), [&word](const command& cmd) { return cmd.match(word); }); return (iter != commands_.end()) ? &*iter : nullptr; } std::string test(const command_list& commands, const std::string& input) { std::string output; std::istringstream is(input); std::string word; while (is >> word) { if (!output.empty()) output += ' '; uppercase(word); const command* cmd_ptr = commands.find_command(word); if (cmd_ptr) output += cmd_ptr->cmd(); else output += "*error*"; } return output; } int main() { command_list commands(command_table); std::string input("riG rePEAT copies put mo rest types fup. 6 poweRin"); std::string output(test(commands, input)); std::cout << " input: " << input << '\n'; std::cout << "output: " << output << '\n'; return 0; }
command_table_text = \ user_words = "riG rePEAT copies put mo rest types fup. 6 poweRin" def find_abbreviations_length(command_table_text): command_table = dict() for word in command_table_text.split(): abbr_len = sum(1 for c in word if c.isupper()) if abbr_len == 0: abbr_len = len(word) command_table[word] = abbr_len return command_table def find_abbreviations(command_table): abbreviations = dict() for command, min_abbr_len in command_table.items(): for l in range(min_abbr_len, len(command)+1): abbr = command[:l].lower() abbreviations[abbr] = command.upper() return abbreviations def parse_user_string(user_string, abbreviations): user_words = [word.lower() for word in user_string.split()] commands = [abbreviations.get(user_word, "*error*") for user_word in user_words] return " ".join(commands) command_table = find_abbreviations_length(command_table_text) abbreviations_table = find_abbreviations(command_table) full_words = parse_user_string(user_words, abbreviations_table) print("user words:", user_words) print("full words:", full_words)
Preserve the algorithm and functionality while converting the code from C++ to Python.
#include <iostream> class MyOtherClass { public: const int m_x; MyOtherClass(const int initX = 0) : m_x(initX) { } }; int main() { MyOtherClass mocA, mocB(7); std::cout << mocA.m_x << std::endl; std::cout << mocB.m_x << std::endl; return 0; }
>>> s = "Hello" >>> s[0] = "h" Traceback (most recent call last): File "<pyshell s[0] = "h" TypeError: 'str' object does not support item assignment
Ensure the translated Python code behaves exactly like the original C++ snippet.
#include <iostream> #include <span> #include <vector> struct vec2 { float x = 0.0f, y = 0.0f; constexpr vec2 operator+(vec2 other) const { return vec2{x + other.x, y + other.y}; } constexpr vec2 operator-(vec2 other) const { return vec2{x - other.x, y - other.y}; } }; constexpr vec2 operator*(vec2 a, float b) { return vec2{a.x * b, a.y * b}; } constexpr float dot(vec2 a, vec2 b) { return a.x * b.x + a.y * b.y; } constexpr float cross(vec2 a, vec2 b) { return a.x * b.y - b.x * a.y; } constexpr bool is_inside(vec2 point, vec2 a, vec2 b) { return (cross(a - b, point) + cross(b, a)) < 0.0f; } constexpr vec2 intersection(vec2 a1, vec2 a2, vec2 b1, vec2 b2) { return ((b1 - b2) * cross(a1, a2) - (a1 - a2) * cross(b1, b2)) * (1.0f / cross(a1 - a2, b1 - b2)); } std::vector<vec2> suther_land_hodgman( std::span<vec2 const> subject_polygon, std::span<vec2 const> clip_polygon) { if (clip_polygon.empty() || subject_polygon.empty()) { return {}; } std::vector<vec2> ring{subject_polygon.begin(), subject_polygon.end()}; vec2 p1 = clip_polygon[clip_polygon.size() - 1]; std::vector<vec2> input; for (vec2 p2 : clip_polygon) { input.clear(); input.insert(input.end(), ring.begin(), ring.end()); vec2 s = input[input.size() - 1]; ring.clear(); for (vec2 e : input) { if (is_inside(e, p1, p2)) { if (!is_inside(s, p1, p2)) { ring.push_back(intersection(p1, p2, s, e)); } ring.push_back(e); } else if (is_inside(s, p1, p2)) { ring.push_back(intersection(p1, p2, s, e)); } s = e; } p1 = p2; } return ring; } int main(int argc, char **argv) { vec2 subject_polygon[] = {{50, 150}, {200, 50}, {350, 150}, {350, 300}, {250, 300}, {200, 250}, {150, 350}, {100, 250}, {100, 200}}; vec2 clip_polygon[] = {{100, 100}, {300, 100}, {300, 300}, {100, 300}}; std::vector<vec2> clipped_polygon = suther_land_hodgman(subject_polygon, clip_polygon); std::cout << "Clipped polygon points:" << std::endl; for (vec2 p : clipped_polygon) { std::cout << "(" << p.x << ", " << p.y << ")" << std::endl; } return EXIT_SUCCESS; }
def clip(subjectPolygon, clipPolygon): def inside(p): return(cp2[0]-cp1[0])*(p[1]-cp1[1]) > (cp2[1]-cp1[1])*(p[0]-cp1[0]) def computeIntersection(): dc = [ cp1[0] - cp2[0], cp1[1] - cp2[1] ] dp = [ s[0] - e[0], s[1] - e[1] ] n1 = cp1[0] * cp2[1] - cp1[1] * cp2[0] n2 = s[0] * e[1] - s[1] * e[0] n3 = 1.0 / (dc[0] * dp[1] - dc[1] * dp[0]) return [(n1*dp[0] - n2*dc[0]) * n3, (n1*dp[1] - n2*dc[1]) * n3] outputList = subjectPolygon cp1 = clipPolygon[-1] for clipVertex in clipPolygon: cp2 = clipVertex inputList = outputList outputList = [] s = inputList[-1] for subjectVertex in inputList: e = subjectVertex if inside(e): if not inside(s): outputList.append(computeIntersection()) outputList.append(e) elif inside(s): outputList.append(computeIntersection()) s = e cp1 = cp2 return(outputList)
Rewrite this program in Python while keeping its functionality equivalent to the C++ version.
#include <iostream> #include <algorithm> #include <vector> #include <bitset> #include <string> class bacon { public: bacon() { int x = 0; for( ; x < 9; x++ ) bAlphabet.push_back( std::bitset<5>( x ).to_string() ); bAlphabet.push_back( bAlphabet.back() ); for( ; x < 20; x++ ) bAlphabet.push_back( std::bitset<5>( x ).to_string() ); bAlphabet.push_back( bAlphabet.back() ); for( ; x < 24; x++ ) bAlphabet.push_back( std::bitset<5>( x ).to_string() ); } std::string encode( std::string txt ) { std::string r; size_t z; for( std::string::iterator i = txt.begin(); i != txt.end(); i++ ) { z = toupper( *i ); if( z < 'A' || z > 'Z' ) continue; r.append( bAlphabet.at( ( *i & 31 ) - 1 ) ); } return r; } std::string decode( std::string txt ) { size_t len = txt.length(); while( len % 5 != 0 ) len--; if( len != txt.length() ) txt = txt.substr( 0, len ); std::string r; for( size_t i = 0; i < len; i += 5 ) { r.append( 1, 'A' + std::distance( bAlphabet.begin(), std::find( bAlphabet.begin(), bAlphabet.end(), txt.substr( i, 5 ) ) ) ); } return r; } private: std::vector<std::string> bAlphabet; };
import string sometext = .lower() lc2bin = {ch: '{:05b}'.format(i) for i, ch in enumerate(string.ascii_lowercase + ' .')} bin2lc = {val: key for key, val in lc2bin.items()} phrase = 'Rosetta code Bacon cipher example secret phrase to encode in the capitalisation of peter pan'.lower() def to_5binary(msg): return ( ch == '1' for ch in ''.join(lc2bin.get(ch, '') for ch in msg.lower())) def encrypt(message, text): bin5 = to_5binary(message) textlist = list(text.lower()) out = [] for capitalise in bin5: while textlist: ch = textlist.pop(0) if ch.isalpha(): if capitalise: ch = ch.upper() out.append(ch) break else: out.append(ch) else: raise Exception('ERROR: Ran out of characters in sometext') return ''.join(out) + '...' def decrypt(bacontext): binary = [] bin5 = [] out = [] for ch in bacontext: if ch.isalpha(): binary.append('1' if ch.isupper() else '0') if len(binary) == 5: bin5 = ''.join(binary) out.append(bin2lc[bin5]) binary = [] return ''.join(out) print('PLAINTEXT = \n%s\n' % phrase) encrypted = encrypt(phrase, sometext) print('ENCRYPTED = \n%s\n' % encrypted) decrypted = decrypt(encrypted) print('DECRYPTED = \n%s\n' % decrypted) assert phrase == decrypted, 'Round-tripping error'
Can you help me rewrite this code in Python instead of C++, keeping it the same logically?
#include <iostream> #include <algorithm> #include <vector> #include <bitset> #include <string> class bacon { public: bacon() { int x = 0; for( ; x < 9; x++ ) bAlphabet.push_back( std::bitset<5>( x ).to_string() ); bAlphabet.push_back( bAlphabet.back() ); for( ; x < 20; x++ ) bAlphabet.push_back( std::bitset<5>( x ).to_string() ); bAlphabet.push_back( bAlphabet.back() ); for( ; x < 24; x++ ) bAlphabet.push_back( std::bitset<5>( x ).to_string() ); } std::string encode( std::string txt ) { std::string r; size_t z; for( std::string::iterator i = txt.begin(); i != txt.end(); i++ ) { z = toupper( *i ); if( z < 'A' || z > 'Z' ) continue; r.append( bAlphabet.at( ( *i & 31 ) - 1 ) ); } return r; } std::string decode( std::string txt ) { size_t len = txt.length(); while( len % 5 != 0 ) len--; if( len != txt.length() ) txt = txt.substr( 0, len ); std::string r; for( size_t i = 0; i < len; i += 5 ) { r.append( 1, 'A' + std::distance( bAlphabet.begin(), std::find( bAlphabet.begin(), bAlphabet.end(), txt.substr( i, 5 ) ) ) ); } return r; } private: std::vector<std::string> bAlphabet; };
import string sometext = .lower() lc2bin = {ch: '{:05b}'.format(i) for i, ch in enumerate(string.ascii_lowercase + ' .')} bin2lc = {val: key for key, val in lc2bin.items()} phrase = 'Rosetta code Bacon cipher example secret phrase to encode in the capitalisation of peter pan'.lower() def to_5binary(msg): return ( ch == '1' for ch in ''.join(lc2bin.get(ch, '') for ch in msg.lower())) def encrypt(message, text): bin5 = to_5binary(message) textlist = list(text.lower()) out = [] for capitalise in bin5: while textlist: ch = textlist.pop(0) if ch.isalpha(): if capitalise: ch = ch.upper() out.append(ch) break else: out.append(ch) else: raise Exception('ERROR: Ran out of characters in sometext') return ''.join(out) + '...' def decrypt(bacontext): binary = [] bin5 = [] out = [] for ch in bacontext: if ch.isalpha(): binary.append('1' if ch.isupper() else '0') if len(binary) == 5: bin5 = ''.join(binary) out.append(bin2lc[bin5]) binary = [] return ''.join(out) print('PLAINTEXT = \n%s\n' % phrase) encrypted = encrypt(phrase, sometext) print('ENCRYPTED = \n%s\n' % encrypted) decrypted = decrypt(encrypted) print('DECRYPTED = \n%s\n' % decrypted) assert phrase == decrypted, 'Round-tripping error'
Generate a Python translation of this C++ snippet without changing its computational steps.
#include <vector> #include <memory> #include <cmath> #include <iostream> #include <iomanip> using namespace std; typedef vector< int > IntRow; typedef vector< IntRow > IntTable; auto_ptr< IntTable > getSpiralArray( int dimension ) { auto_ptr< IntTable > spiralArrayPtr( new IntTable( dimension, IntRow( dimension ) ) ); int numConcentricSquares = static_cast< int >( ceil( static_cast< double >( dimension ) / 2.0 ) ); int j; int sideLen = dimension; int currNum = 0; for ( int i = 0; i < numConcentricSquares; i++ ) { for ( j = 0; j < sideLen; j++ ) ( *spiralArrayPtr )[ i ][ i + j ] = currNum++; for ( j = 1; j < sideLen; j++ ) ( *spiralArrayPtr )[ i + j ][ dimension - 1 - i ] = currNum++; for ( j = sideLen - 2; j > -1; j-- ) ( *spiralArrayPtr )[ dimension - 1 - i ][ i + j ] = currNum++; for ( j = sideLen - 2; j > 0; j-- ) ( *spiralArrayPtr )[ i + j ][ i ] = currNum++; sideLen -= 2; } return spiralArrayPtr; } void printSpiralArray( const auto_ptr< IntTable >& spiralArrayPtr ) { size_t dimension = spiralArrayPtr->size(); int fieldWidth = static_cast< int >( floor( log10( static_cast< double >( dimension * dimension - 1 ) ) ) ) + 2; size_t col; for ( size_t row = 0; row < dimension; row++ ) { for ( col = 0; col < dimension; col++ ) cout << setw( fieldWidth ) << ( *spiralArrayPtr )[ row ][ col ]; cout << endl; } } int main() { printSpiralArray( getSpiralArray( 5 ) ); }
def spiral(n): dx,dy = 1,0 x,y = 0,0 myarray = [[None]* n for j in range(n)] for i in xrange(n**2): myarray[x][y] = i nx,ny = x+dx, y+dy if 0<=nx<n and 0<=ny<n and myarray[nx][ny] == None: x,y = nx,ny else: dx,dy = -dy,dx x,y = x+dx, y+dy return myarray def printspiral(myarray): n = range(len(myarray)) for y in n: for x in n: print "%2i" % myarray[x][y], print printspiral(spiral(5))
Write a version of this C++ function in Python with identical behavior.
#include <vector> #include <algorithm> #include <string> template <class T> struct sort_table_functor { typedef bool (*CompFun)(const T &, const T &); const CompFun ordering; const int column; const bool reverse; sort_table_functor(CompFun o, int c, bool r) : ordering(o), column(c), reverse(r) { } bool operator()(const std::vector<T> &x, const std::vector<T> &y) const { const T &a = x[column], &b = y[column]; return reverse ? ordering(b, a) : ordering(a, b); } }; template <class T> bool myLess(const T &x, const T &y) { return x < y; } template <class T> void sort_table(std::vector<std::vector<T> > &table, int column = 0, bool reverse = false, bool (*ordering)(const T &, const T &) = myLess) { std::sort(table.begin(), table.end(), sort_table_functor<T>(ordering, column, reverse)); } #include <iostream> template <class T> void print_matrix(std::vector<std::vector<T> > &data) { for () { for (int j = 0; j < 3; j++) std::cout << data[i][j] << "\t"; std::cout << std::endl; } } bool desc_len_comparator(const std::string &x, const std::string &y) { return x.length() > y.length(); } int main() { std::string data_array[3][3] = { {"a", "b", "c"}, {"", "q", "z"}, {"zap", "zip", "Zot"} }; std::vector<std::vector<std::string> > data_orig; for (int i = 0; i < 3; i++) { std::vector<std::string> row; for (int j = 0; j < 3; j++) row.push_back(data_array[i][j]); data_orig.push_back(row); } print_matrix(data_orig); std::vector<std::vector<std::string> > data = data_orig; sort_table(data); print_matrix(data); data = data_orig; sort_table(data, 2); print_matrix(data); data = data_orig; sort_table(data, 1); print_matrix(data); data = data_orig; sort_table(data, 1, true); print_matrix(data); data = data_orig; sort_table(data, 0, false, desc_len_comparator); print_matrix(data); return 0; }
>>> def printtable(data): for row in data: print ' '.join('%-5s' % ('"%s"' % cell) for cell in row) >>> import operator >>> def sorttable(table, ordering=None, column=0, reverse=False): return sorted(table, cmp=ordering, key=operator.itemgetter(column), reverse=reverse) >>> data = [["a", "b", "c"], ["", "q", "z"], ["zap", "zip", "Zot"]] >>> printtable(data) "a" "b" "c" "" "q" "z" "zap" "zip" "Zot" >>> printtable( sorttable(data) ) "" "q" "z" "a" "b" "c" "zap" "zip" "Zot" >>> printtable( sorttable(data, column=2) ) "zap" "zip" "Zot" "a" "b" "c" "" "q" "z" >>> printtable( sorttable(data, column=1) ) "a" "b" "c" "" "q" "z" "zap" "zip" "Zot" >>> printtable( sorttable(data, column=1, reverse=True) ) "zap" "zip" "Zot" "" "q" "z" "a" "b" "c" >>> printtable( sorttable(data, ordering=lambda a,b: cmp(len(b),len(a))) ) "zap" "zip" "Zot" "a" "b" "c" "" "q" "z" >>>
Produce a language-to-language conversion: from C++ to Python, same semantics.
#include <windows.h> #include <vector> #include <string> using namespace std; struct Point { int x, y; }; class MyBitmap { public: MyBitmap() : pen_(nullptr) {} ~MyBitmap() { DeleteObject(pen_); DeleteDC(hdc_); DeleteObject(bmp_); } bool Create(int w, int h) { BITMAPINFO bi; ZeroMemory(&bi, sizeof(bi)); bi.bmiHeader.biSize = sizeof(bi.bmiHeader); bi.bmiHeader.biBitCount = sizeof(DWORD) * 8; bi.bmiHeader.biCompression = BI_RGB; bi.bmiHeader.biPlanes = 1; bi.bmiHeader.biWidth = w; bi.bmiHeader.biHeight = -h; void *bits_ptr = nullptr; HDC dc = GetDC(GetConsoleWindow()); bmp_ = CreateDIBSection(dc, &bi, DIB_RGB_COLORS, &bits_ptr, nullptr, 0); if (!bmp_) return false; hdc_ = CreateCompatibleDC(dc); SelectObject(hdc_, bmp_); ReleaseDC(GetConsoleWindow(), dc); width_ = w; height_ = h; return true; } void SetPenColor(DWORD clr) { if (pen_) DeleteObject(pen_); pen_ = CreatePen(PS_SOLID, 1, clr); SelectObject(hdc_, pen_); } bool SaveBitmap(const char* path) { HANDLE file = CreateFile(path, GENERIC_WRITE, 0, nullptr, CREATE_ALWAYS, FILE_ATTRIBUTE_NORMAL, nullptr); if (file == INVALID_HANDLE_VALUE) { return false; } BITMAPFILEHEADER fileheader; BITMAPINFO infoheader; BITMAP bitmap; GetObject(bmp_, sizeof(bitmap), &bitmap); DWORD* dwp_bits = new DWORD[bitmap.bmWidth * bitmap.bmHeight]; ZeroMemory(dwp_bits, bitmap.bmWidth * bitmap.bmHeight * sizeof(DWORD)); ZeroMemory(&infoheader, sizeof(BITMAPINFO)); ZeroMemory(&fileheader, sizeof(BITMAPFILEHEADER)); infoheader.bmiHeader.biBitCount = sizeof(DWORD) * 8; infoheader.bmiHeader.biCompression = BI_RGB; infoheader.bmiHeader.biPlanes = 1; infoheader.bmiHeader.biSize = sizeof(infoheader.bmiHeader); infoheader.bmiHeader.biHeight = bitmap.bmHeight; infoheader.bmiHeader.biWidth = bitmap.bmWidth; infoheader.bmiHeader.biSizeImage = bitmap.bmWidth * bitmap.bmHeight * sizeof(DWORD); fileheader.bfType = 0x4D42; fileheader.bfOffBits = sizeof(infoheader.bmiHeader) + sizeof(BITMAPFILEHEADER); fileheader.bfSize = fileheader.bfOffBits + infoheader.bmiHeader.biSizeImage; GetDIBits(hdc_, bmp_, 0, height_, (LPVOID)dwp_bits, &infoheader, DIB_RGB_COLORS); DWORD wb; WriteFile(file, &fileheader, sizeof(BITMAPFILEHEADER), &wb, nullptr); WriteFile(file, &infoheader.bmiHeader, sizeof(infoheader.bmiHeader), &wb, nullptr); WriteFile(file, dwp_bits, bitmap.bmWidth * bitmap.bmHeight * 4, &wb, nullptr); CloseHandle(file); delete[] dwp_bits; return true; } HDC hdc() { return hdc_; } int width() { return width_; } int height() { return height_; } private: HBITMAP bmp_; HDC hdc_; HPEN pen_; int width_, height_; }; static int DistanceSqrd(const Point& point, int x, int y) { int xd = x - point.x; int yd = y - point.y; return (xd * xd) + (yd * yd); } class Voronoi { public: void Make(MyBitmap* bmp, int count) { bmp_ = bmp; CreatePoints(count); CreateColors(); CreateSites(); SetSitesPoints(); } private: void CreateSites() { int w = bmp_->width(), h = bmp_->height(), d; for (int hh = 0; hh < h; hh++) { for (int ww = 0; ww < w; ww++) { int ind = -1, dist = INT_MAX; for (size_t it = 0; it < points_.size(); it++) { const Point& p = points_[it]; d = DistanceSqrd(p, ww, hh); if (d < dist) { dist = d; ind = it; } } if (ind > -1) SetPixel(bmp_->hdc(), ww, hh, colors_[ind]); else __asm nop } } } void SetSitesPoints() { for (const auto& point : points_) { int x = point.x, y = point.y; for (int i = -1; i < 2; i++) for (int j = -1; j < 2; j++) SetPixel(bmp_->hdc(), x + i, y + j, 0); } } void CreatePoints(int count) { const int w = bmp_->width() - 20, h = bmp_->height() - 20; for (int i = 0; i < count; i++) { points_.push_back({ rand() % w + 10, rand() % h + 10 }); } } void CreateColors() { for (size_t i = 0; i < points_.size(); i++) { DWORD c = RGB(rand() % 200 + 50, rand() % 200 + 55, rand() % 200 + 50); colors_.push_back(c); } } vector<Point> points_; vector<DWORD> colors_; MyBitmap* bmp_; }; int main(int argc, char* argv[]) { ShowWindow(GetConsoleWindow(), SW_MAXIMIZE); srand(GetTickCount()); MyBitmap bmp; bmp.Create(512, 512); bmp.SetPenColor(0); Voronoi v; v.Make(&bmp, 50); BitBlt(GetDC(GetConsoleWindow()), 20, 20, 512, 512, bmp.hdc(), 0, 0, SRCCOPY); bmp.SaveBitmap("v.bmp"); system("pause"); return 0; }
def setup(): size(500, 500) generate_voronoi_diagram(width, height, 25) saveFrame("VoronoiDiagram.png") def generate_voronoi_diagram(w, h, num_cells): nx, ny, nr, ng, nb = [], [], [], [], [] for i in range(num_cells): nx.append(int(random(w))) ny.append(int(random(h))) nr.append(int(random(256))) ng.append(int(random(256))) nb.append(int(random(256))) for y in range(h): for x in range(w): dmin = dist(0, 0, w - 1, h - 1) j = -1 for i in range(num_cells): d = dist(0, 0, nx[i] - x, ny[i] - y) if d < dmin: dmin = d j = i set(x, y, color(nr[j], ng[j], nb[j]))
Transform the following C++ implementation into Python, maintaining the same output and logic.
#include <windows.h> #include <vector> #include <string> using namespace std; struct Point { int x, y; }; class MyBitmap { public: MyBitmap() : pen_(nullptr) {} ~MyBitmap() { DeleteObject(pen_); DeleteDC(hdc_); DeleteObject(bmp_); } bool Create(int w, int h) { BITMAPINFO bi; ZeroMemory(&bi, sizeof(bi)); bi.bmiHeader.biSize = sizeof(bi.bmiHeader); bi.bmiHeader.biBitCount = sizeof(DWORD) * 8; bi.bmiHeader.biCompression = BI_RGB; bi.bmiHeader.biPlanes = 1; bi.bmiHeader.biWidth = w; bi.bmiHeader.biHeight = -h; void *bits_ptr = nullptr; HDC dc = GetDC(GetConsoleWindow()); bmp_ = CreateDIBSection(dc, &bi, DIB_RGB_COLORS, &bits_ptr, nullptr, 0); if (!bmp_) return false; hdc_ = CreateCompatibleDC(dc); SelectObject(hdc_, bmp_); ReleaseDC(GetConsoleWindow(), dc); width_ = w; height_ = h; return true; } void SetPenColor(DWORD clr) { if (pen_) DeleteObject(pen_); pen_ = CreatePen(PS_SOLID, 1, clr); SelectObject(hdc_, pen_); } bool SaveBitmap(const char* path) { HANDLE file = CreateFile(path, GENERIC_WRITE, 0, nullptr, CREATE_ALWAYS, FILE_ATTRIBUTE_NORMAL, nullptr); if (file == INVALID_HANDLE_VALUE) { return false; } BITMAPFILEHEADER fileheader; BITMAPINFO infoheader; BITMAP bitmap; GetObject(bmp_, sizeof(bitmap), &bitmap); DWORD* dwp_bits = new DWORD[bitmap.bmWidth * bitmap.bmHeight]; ZeroMemory(dwp_bits, bitmap.bmWidth * bitmap.bmHeight * sizeof(DWORD)); ZeroMemory(&infoheader, sizeof(BITMAPINFO)); ZeroMemory(&fileheader, sizeof(BITMAPFILEHEADER)); infoheader.bmiHeader.biBitCount = sizeof(DWORD) * 8; infoheader.bmiHeader.biCompression = BI_RGB; infoheader.bmiHeader.biPlanes = 1; infoheader.bmiHeader.biSize = sizeof(infoheader.bmiHeader); infoheader.bmiHeader.biHeight = bitmap.bmHeight; infoheader.bmiHeader.biWidth = bitmap.bmWidth; infoheader.bmiHeader.biSizeImage = bitmap.bmWidth * bitmap.bmHeight * sizeof(DWORD); fileheader.bfType = 0x4D42; fileheader.bfOffBits = sizeof(infoheader.bmiHeader) + sizeof(BITMAPFILEHEADER); fileheader.bfSize = fileheader.bfOffBits + infoheader.bmiHeader.biSizeImage; GetDIBits(hdc_, bmp_, 0, height_, (LPVOID)dwp_bits, &infoheader, DIB_RGB_COLORS); DWORD wb; WriteFile(file, &fileheader, sizeof(BITMAPFILEHEADER), &wb, nullptr); WriteFile(file, &infoheader.bmiHeader, sizeof(infoheader.bmiHeader), &wb, nullptr); WriteFile(file, dwp_bits, bitmap.bmWidth * bitmap.bmHeight * 4, &wb, nullptr); CloseHandle(file); delete[] dwp_bits; return true; } HDC hdc() { return hdc_; } int width() { return width_; } int height() { return height_; } private: HBITMAP bmp_; HDC hdc_; HPEN pen_; int width_, height_; }; static int DistanceSqrd(const Point& point, int x, int y) { int xd = x - point.x; int yd = y - point.y; return (xd * xd) + (yd * yd); } class Voronoi { public: void Make(MyBitmap* bmp, int count) { bmp_ = bmp; CreatePoints(count); CreateColors(); CreateSites(); SetSitesPoints(); } private: void CreateSites() { int w = bmp_->width(), h = bmp_->height(), d; for (int hh = 0; hh < h; hh++) { for (int ww = 0; ww < w; ww++) { int ind = -1, dist = INT_MAX; for (size_t it = 0; it < points_.size(); it++) { const Point& p = points_[it]; d = DistanceSqrd(p, ww, hh); if (d < dist) { dist = d; ind = it; } } if (ind > -1) SetPixel(bmp_->hdc(), ww, hh, colors_[ind]); else __asm nop } } } void SetSitesPoints() { for (const auto& point : points_) { int x = point.x, y = point.y; for (int i = -1; i < 2; i++) for (int j = -1; j < 2; j++) SetPixel(bmp_->hdc(), x + i, y + j, 0); } } void CreatePoints(int count) { const int w = bmp_->width() - 20, h = bmp_->height() - 20; for (int i = 0; i < count; i++) { points_.push_back({ rand() % w + 10, rand() % h + 10 }); } } void CreateColors() { for (size_t i = 0; i < points_.size(); i++) { DWORD c = RGB(rand() % 200 + 50, rand() % 200 + 55, rand() % 200 + 50); colors_.push_back(c); } } vector<Point> points_; vector<DWORD> colors_; MyBitmap* bmp_; }; int main(int argc, char* argv[]) { ShowWindow(GetConsoleWindow(), SW_MAXIMIZE); srand(GetTickCount()); MyBitmap bmp; bmp.Create(512, 512); bmp.SetPenColor(0); Voronoi v; v.Make(&bmp, 50); BitBlt(GetDC(GetConsoleWindow()), 20, 20, 512, 512, bmp.hdc(), 0, 0, SRCCOPY); bmp.SaveBitmap("v.bmp"); system("pause"); return 0; }
def setup(): size(500, 500) generate_voronoi_diagram(width, height, 25) saveFrame("VoronoiDiagram.png") def generate_voronoi_diagram(w, h, num_cells): nx, ny, nr, ng, nb = [], [], [], [], [] for i in range(num_cells): nx.append(int(random(w))) ny.append(int(random(h))) nr.append(int(random(256))) ng.append(int(random(256))) nb.append(int(random(256))) for y in range(h): for x in range(w): dmin = dist(0, 0, w - 1, h - 1) j = -1 for i in range(num_cells): d = dist(0, 0, nx[i] - x, ny[i] - y) if d < dmin: dmin = d j = i set(x, y, color(nr[j], ng[j], nb[j]))
Change the following C++ code into Python without altering its purpose.
FUNCTION MULTIPLY(X, Y) DOUBLE PRECISION MULTIPLY, X, Y
import ctypes libc = ctypes.CDLL("/lib/libc.so.6") libc.strcmp("abc", "def") libc.strcmp("hello", "hello")
Write the same code in Python as shown below in C++.
#include <iostream> #include <functional> #include <vector> #include <cstdlib> #include <ctime> template <typename T> std::function<std::vector<T>(T)> s_of_n_creator(int n) { std::vector<T> sample; int i = 0; return [=](T item) mutable { i++; if (i <= n) { sample.push_back(item); } else if (std::rand() % i < n) { sample[std::rand() % n] = item; } return sample; }; } int main() { std::srand(std::time(NULL)); int bin[10] = {0}; for (int trial = 0; trial < 100000; trial++) { auto s_of_n = s_of_n_creator<int>(3); std::vector<int> sample; for (int i = 0; i < 10; i++) sample = s_of_n(i); for (int s : sample) bin[s]++; } for (int x : bin) std::cout << x << std::endl; return 0; }
from random import randrange def s_of_n_creator(n): sample, i = [], 0 def s_of_n(item): nonlocal i i += 1 if i <= n: sample.append(item) elif randrange(i) < n: sample[randrange(n)] = item return sample return s_of_n if __name__ == '__main__': bin = [0]* 10 items = range(10) print("Single run samples for n = 3:") s_of_n = s_of_n_creator(3) for item in items: sample = s_of_n(item) print(" Item: %i -> sample: %s" % (item, sample)) for trial in range(100000): s_of_n = s_of_n_creator(3) for item in items: sample = s_of_n(item) for s in sample: bin[s] += 1 print("\nTest item frequencies for 100000 runs:\n ", '\n '.join("%i:%i" % x for x in enumerate(bin)))
Can you help me rewrite this code in Python instead of C++, keeping it the same logically?
#include <iostream> #include <functional> #include <vector> #include <cstdlib> #include <ctime> template <typename T> std::function<std::vector<T>(T)> s_of_n_creator(int n) { std::vector<T> sample; int i = 0; return [=](T item) mutable { i++; if (i <= n) { sample.push_back(item); } else if (std::rand() % i < n) { sample[std::rand() % n] = item; } return sample; }; } int main() { std::srand(std::time(NULL)); int bin[10] = {0}; for (int trial = 0; trial < 100000; trial++) { auto s_of_n = s_of_n_creator<int>(3); std::vector<int> sample; for (int i = 0; i < 10; i++) sample = s_of_n(i); for (int s : sample) bin[s]++; } for (int x : bin) std::cout << x << std::endl; return 0; }
from random import randrange def s_of_n_creator(n): sample, i = [], 0 def s_of_n(item): nonlocal i i += 1 if i <= n: sample.append(item) elif randrange(i) < n: sample[randrange(n)] = item return sample return s_of_n if __name__ == '__main__': bin = [0]* 10 items = range(10) print("Single run samples for n = 3:") s_of_n = s_of_n_creator(3) for item in items: sample = s_of_n(item) print(" Item: %i -> sample: %s" % (item, sample)) for trial in range(100000): s_of_n = s_of_n_creator(3) for item in items: sample = s_of_n(item) for s in sample: bin[s] += 1 print("\nTest item frequencies for 100000 runs:\n ", '\n '.join("%i:%i" % x for x in enumerate(bin)))
Convert the following code from C++ to Python, ensuring the logic remains intact.
#include <exception> #include <iomanip> #include <iostream> #include <numeric> #include <sstream> #include <vector> class Frac { public: Frac() : num(0), denom(1) {} Frac(int n, int d) { if (d == 0) { throw std::runtime_error("d must not be zero"); } int sign_of_d = d < 0 ? -1 : 1; int g = std::gcd(n, d); num = sign_of_d * n / g; denom = sign_of_d * d / g; } Frac operator-() const { return Frac(-num, denom); } Frac operator+(const Frac& rhs) const { return Frac(num*rhs.denom + denom * rhs.num, rhs.denom*denom); } Frac operator-(const Frac& rhs) const { return Frac(num*rhs.denom - denom * rhs.num, rhs.denom*denom); } Frac operator*(const Frac& rhs) const { return Frac(num*rhs.num, denom*rhs.denom); } Frac operator*(int rhs) const { return Frac(num * rhs, denom); } friend std::ostream& operator<<(std::ostream&, const Frac&); private: int num; int denom; }; std::ostream & operator<<(std::ostream & os, const Frac &f) { if (f.num == 0 || f.denom == 1) { return os << f.num; } std::stringstream ss; ss << f.num << "/" << f.denom; return os << ss.str(); } Frac bernoulli(int n) { if (n < 0) { throw std::runtime_error("n may not be negative or zero"); } std::vector<Frac> a; for (int m = 0; m <= n; m++) { a.push_back(Frac(1, m + 1)); for (int j = m; j >= 1; j--) { a[j - 1] = (a[j - 1] - a[j]) * j; } } if (n != 1) return a[0]; return -a[0]; } int binomial(int n, int k) { if (n < 0 || k < 0 || n < k) { throw std::runtime_error("parameters are invalid"); } if (n == 0 || k == 0) return 1; int num = 1; for (int i = k + 1; i <= n; i++) { num *= i; } int denom = 1; for (int i = 2; i <= n - k; i++) { denom *= i; } return num / denom; } std::vector<Frac> faulhaberTraingle(int p) { std::vector<Frac> coeffs(p + 1); Frac q{ 1, p + 1 }; int sign = -1; for (int j = 0; j <= p; j++) { sign *= -1; coeffs[p - j] = q * sign * binomial(p + 1, j) * bernoulli(j); } return coeffs; } int main() { for (int i = 0; i < 10; i++) { std::vector<Frac> coeffs = faulhaberTraingle(i); for (auto frac : coeffs) { std::cout << std::right << std::setw(5) << frac << " "; } std::cout << std::endl; } return 0; }
from itertools import accumulate, chain, count, islice from fractions import Fraction def faulhaberTriangle(m): def go(rs, n): def f(x, y): return Fraction(n, x) * y xs = list(map(f, islice(count(2), m), rs)) return [Fraction(1 - sum(xs), 1)] + xs return list(accumulate( [[]] + list(islice(count(0), 1 + m)), go ))[1:] def faulhaberSum(p, n): def go(x, y): return y * (n ** x) return sum( map(go, count(1), faulhaberTriangle(p)[-1]) ) def main(): fs = faulhaberTriangle(9) print( fTable(__doc__ + ':\n')(str)( compose(concat)( fmap(showRatio(3)(3)) ) )( index(fs) )(range(0, len(fs))) ) print('') print( faulhaberSum(17, 1000) ) def fTable(s): def gox(xShow): def gofx(fxShow): def gof(f): def goxs(xs): ys = [xShow(x) for x in xs] w = max(map(len, ys)) def arrowed(x, y): return y.rjust(w, ' ') + ' -> ' + ( fxShow(f(x)) ) return s + '\n' + '\n'.join( map(arrowed, xs, ys) ) return goxs return gof return gofx return gox def compose(g): return lambda f: lambda x: g(f(x)) def concat(xs): def f(ys): zs = list(chain(*ys)) return ''.join(zs) if isinstance(ys[0], str) else zs return ( f(xs) if isinstance(xs, list) else ( chain.from_iterable(xs) ) ) if xs else [] def fmap(f): def go(xs): return list(map(f, xs)) return go def index(xs): return lambda n: None if 0 > n else ( xs[n] if ( hasattr(xs, "__getitem__") ) else next(islice(xs, n, None)) ) def showRatio(m): def go(n): def f(r): d = r.denominator return str(r.numerator).rjust(m, ' ') + ( ('/' + str(d).ljust(n, ' ')) if 1 != d else ( ' ' * (1 + n) ) ) return f return go if __name__ == '__main__': main()
Write the same code in Python as shown below in C++.
#include <iostream> int main(int argc, char* argv[]) { std::cout << "This program is named " << argv[0] << std::endl; std::cout << "There are " << argc-1 << " arguments given." << std::endl; for (int i = 1; i < argc; ++i) std::cout << "the argument #" << i << " is " << argv[i] << std::endl; return 0; }
import sys program_name = sys.argv[0] arguments = sys.argv[1:] count = len(arguments)
Port the following code from C++ to Python with equivalent syntax and logic.
#include <iostream> int main(int argc, char* argv[]) { std::cout << "This program is named " << argv[0] << std::endl; std::cout << "There are " << argc-1 << " arguments given." << std::endl; for (int i = 1; i < argc; ++i) std::cout << "the argument #" << i << " is " << argv[i] << std::endl; return 0; }
import sys program_name = sys.argv[0] arguments = sys.argv[1:] count = len(arguments)
Change the programming language of this snippet from C++ to Python without modifying what it does.
#include <array> #include <iostream> #include <fstream> #include <map> #include <string> #include <vector> #include <boost/program_options.hpp> class letterset { public: letterset() { count_.fill(0); } explicit letterset(const std::string& str) { count_.fill(0); for (char c : str) add(c); } bool contains(const letterset& set) const { for (size_t i = 0; i < count_.size(); ++i) { if (set.count_[i] > count_[i]) return false; } return true; } unsigned int count(char c) const { return count_[index(c)]; } bool is_valid() const { return count_[0] == 0; } void add(char c) { ++count_[index(c)]; } private: static bool is_letter(char c) { return c >= 'a' && c <= 'z'; } static int index(char c) { return is_letter(c) ? c - 'a' + 1 : 0; } std::array<unsigned int, 27> count_; }; template <typename iterator, typename separator> std::string join(iterator begin, iterator end, separator sep) { std::string result; if (begin != end) { result += *begin++; for (; begin != end; ++begin) { result += sep; result += *begin; } } return result; } using dictionary = std::vector<std::pair<std::string, letterset>>; dictionary load_dictionary(const std::string& filename, int min_length, int max_length) { std::ifstream in(filename); if (!in) throw std::runtime_error("Cannot open file " + filename); std::string word; dictionary result; while (getline(in, word)) { if (word.size() < min_length) continue; if (word.size() > max_length) continue; letterset set(word); if (set.is_valid()) result.emplace_back(word, set); } return result; } void word_wheel(const dictionary& dict, const std::string& letters, char central_letter) { letterset set(letters); if (central_letter == 0 && !letters.empty()) central_letter = letters.at(letters.size()/2); std::map<size_t, std::vector<std::string>> words; for (const auto& pair : dict) { const auto& word = pair.first; const auto& subset = pair.second; if (subset.count(central_letter) > 0 && set.contains(subset)) words[word.size()].push_back(word); } size_t total = 0; for (const auto& p : words) { const auto& v = p.second; auto n = v.size(); total += n; std::cout << "Found " << n << " " << (n == 1 ? "word" : "words") << " of length " << p.first << ": " << join(v.begin(), v.end(), ", ") << '\n'; } std::cout << "Number of words found: " << total << '\n'; } void find_max_word_count(const dictionary& dict, int word_length) { size_t max_count = 0; std::vector<std::pair<std::string, char>> max_words; for (const auto& pair : dict) { const auto& word = pair.first; if (word.size() != word_length) continue; const auto& set = pair.second; dictionary subsets; for (const auto& p : dict) { if (set.contains(p.second)) subsets.push_back(p); } letterset done; for (size_t index = 0; index < word_length; ++index) { char central_letter = word[index]; if (done.count(central_letter) > 0) continue; done.add(central_letter); size_t count = 0; for (const auto& p : subsets) { const auto& subset = p.second; if (subset.count(central_letter) > 0) ++count; } if (count > max_count) { max_words.clear(); max_count = count; } if (count == max_count) max_words.emplace_back(word, central_letter); } } std::cout << "Maximum word count: " << max_count << '\n'; std::cout << "Words of " << word_length << " letters producing this count:\n"; for (const auto& pair : max_words) std::cout << pair.first << " with central letter " << pair.second << '\n'; } constexpr const char* option_filename = "filename"; constexpr const char* option_wheel = "wheel"; constexpr const char* option_central = "central"; constexpr const char* option_min_length = "min-length"; constexpr const char* option_part2 = "part2"; int main(int argc, char** argv) { const int word_length = 9; int min_length = 3; std::string letters = "ndeokgelw"; std::string filename = "unixdict.txt"; char central_letter = 0; bool do_part2 = false; namespace po = boost::program_options; po::options_description desc("Allowed options"); desc.add_options() (option_filename, po::value<std::string>(), "name of dictionary file") (option_wheel, po::value<std::string>(), "word wheel letters") (option_central, po::value<char>(), "central letter (defaults to middle letter of word)") (option_min_length, po::value<int>(), "minimum word length") (option_part2, "include part 2"); try { po::variables_map vm; po::store(po::parse_command_line(argc, argv, desc), vm); po::notify(vm); if (vm.count(option_filename)) filename = vm[option_filename].as<std::string>(); if (vm.count(option_wheel)) letters = vm[option_wheel].as<std::string>(); if (vm.count(option_central)) central_letter = vm[option_central].as<char>(); if (vm.count(option_min_length)) min_length = vm[option_min_length].as<int>(); if (vm.count(option_part2)) do_part2 = true; auto dict = load_dictionary(filename, min_length, word_length); word_wheel(dict, letters, central_letter); if (do_part2) { std::cout << '\n'; find_max_word_count(dict, word_length); } } catch (const std::exception& ex) { std::cerr << ex.what() << '\n'; return EXIT_FAILURE; } return EXIT_SUCCESS; }
import urllib.request from collections import Counter GRID = def getwords(url='http://wiki.puzzlers.org/pub/wordlists/unixdict.txt'): "Return lowercased words of 3 to 9 characters" words = urllib.request.urlopen(url).read().decode().strip().lower().split() return (w for w in words if 2 < len(w) < 10) def solve(grid, dictionary): gridcount = Counter(grid) mid = grid[4] return [word for word in dictionary if mid in word and not (Counter(word) - gridcount)] if __name__ == '__main__': chars = ''.join(GRID.strip().lower().split()) found = solve(chars, dictionary=getwords()) print('\n'.join(found))
Port the following code from C++ to Python with equivalent syntax and logic.
#include <vector> #include <iostream> int main() { std::vector<int> a(3), b(4); a[0] = 11; a[1] = 12; a[2] = 13; b[0] = 21; b[1] = 22; b[2] = 23; b[3] = 24; a.insert(a.end(), b.begin(), b.end()); for (int i = 0; i < a.size(); ++i) std::cout << "a[" << i << "] = " << a[i] << "\n"; }
arr1 = [1, 2, 3] arr2 = [4, 5, 6] arr3 = [7, 8, 9] arr4 = arr1 + arr2 assert arr4 == [1, 2, 3, 4, 5, 6] arr4.extend(arr3) assert arr4 == [1, 2, 3, 4, 5, 6, 7, 8, 9]
Produce a language-to-language conversion: from C++ to Python, same semantics.
#include <iostream> #include <string> using namespace std; int main() { long int integer_input; string string_input; cout << "Enter an integer: "; cin >> integer_input; cout << "Enter a string: "; cin >> string_input; return 0; }
string = raw_input("Input a string: ")
Convert this C++ block to Python, preserving its control flow and logic.
#include <iostream> #include <windows.h> #include <mmsystem.h> #pragma comment ( lib, "winmm.lib" ) typedef unsigned char byte; typedef union { unsigned long word; unsigned char data[4]; } midi_msg; class midi { public: midi() { if( midiOutOpen( &device, 0, 0, 0, CALLBACK_NULL) != MMSYSERR_NOERROR ) { std::cout << "Error opening MIDI Output..." << std::endl; device = 0; } } ~midi() { midiOutReset( device ); midiOutClose( device ); } bool isOpen() { return device != 0; } void setInstrument( byte i ) { message.data[0] = 0xc0; message.data[1] = i; message.data[2] = 0; message.data[3] = 0; midiOutShortMsg( device, message.word ); } void playNote( byte n, unsigned i ) { playNote( n ); Sleep( i ); stopNote( n ); } private: void playNote( byte n ) { message.data[0] = 0x90; message.data[1] = n; message.data[2] = 127; message.data[3] = 0; midiOutShortMsg( device, message.word ); } void stopNote( byte n ) { message.data[0] = 0x90; message.data[1] = n; message.data[2] = 0; message.data[3] = 0; midiOutShortMsg( device, message.word ); } HMIDIOUT device; midi_msg message; }; int main( int argc, char* argv[] ) { midi m; if( m.isOpen() ) { byte notes[] = { 60, 62, 64, 65, 67, 69, 71, 72 }; m.setInstrument( 42 ); for( int x = 0; x < 8; x++ ) m.playNote( notes[x], rand() % 100 + 158 ); Sleep( 1000 ); } return 0; }
>>> import winsound >>> for note in [261.63, 293.66, 329.63, 349.23, 392.00, 440.00, 493.88, 523.25]: winsound.Beep(int(note+.5), 500) >>>
Convert this C++ block to Python, preserving its control flow and logic.
#include <iostream> #include <windows.h> #include <mmsystem.h> #pragma comment ( lib, "winmm.lib" ) typedef unsigned char byte; typedef union { unsigned long word; unsigned char data[4]; } midi_msg; class midi { public: midi() { if( midiOutOpen( &device, 0, 0, 0, CALLBACK_NULL) != MMSYSERR_NOERROR ) { std::cout << "Error opening MIDI Output..." << std::endl; device = 0; } } ~midi() { midiOutReset( device ); midiOutClose( device ); } bool isOpen() { return device != 0; } void setInstrument( byte i ) { message.data[0] = 0xc0; message.data[1] = i; message.data[2] = 0; message.data[3] = 0; midiOutShortMsg( device, message.word ); } void playNote( byte n, unsigned i ) { playNote( n ); Sleep( i ); stopNote( n ); } private: void playNote( byte n ) { message.data[0] = 0x90; message.data[1] = n; message.data[2] = 127; message.data[3] = 0; midiOutShortMsg( device, message.word ); } void stopNote( byte n ) { message.data[0] = 0x90; message.data[1] = n; message.data[2] = 0; message.data[3] = 0; midiOutShortMsg( device, message.word ); } HMIDIOUT device; midi_msg message; }; int main( int argc, char* argv[] ) { midi m; if( m.isOpen() ) { byte notes[] = { 60, 62, 64, 65, 67, 69, 71, 72 }; m.setInstrument( 42 ); for( int x = 0; x < 8; x++ ) m.playNote( notes[x], rand() % 100 + 158 ); Sleep( 1000 ); } return 0; }
>>> import winsound >>> for note in [261.63, 293.66, 329.63, 349.23, 392.00, 440.00, 493.88, 523.25]: winsound.Beep(int(note+.5), 500) >>>
Produce a functionally identical Python code for the snippet given in C++.
#include <iostream> #include <windows.h> #include <mmsystem.h> #pragma comment ( lib, "winmm.lib" ) typedef unsigned char byte; typedef union { unsigned long word; unsigned char data[4]; } midi_msg; class midi { public: midi() { if( midiOutOpen( &device, 0, 0, 0, CALLBACK_NULL) != MMSYSERR_NOERROR ) { std::cout << "Error opening MIDI Output..." << std::endl; device = 0; } } ~midi() { midiOutReset( device ); midiOutClose( device ); } bool isOpen() { return device != 0; } void setInstrument( byte i ) { message.data[0] = 0xc0; message.data[1] = i; message.data[2] = 0; message.data[3] = 0; midiOutShortMsg( device, message.word ); } void playNote( byte n, unsigned i ) { playNote( n ); Sleep( i ); stopNote( n ); } private: void playNote( byte n ) { message.data[0] = 0x90; message.data[1] = n; message.data[2] = 127; message.data[3] = 0; midiOutShortMsg( device, message.word ); } void stopNote( byte n ) { message.data[0] = 0x90; message.data[1] = n; message.data[2] = 0; message.data[3] = 0; midiOutShortMsg( device, message.word ); } HMIDIOUT device; midi_msg message; }; int main( int argc, char* argv[] ) { midi m; if( m.isOpen() ) { byte notes[] = { 60, 62, 64, 65, 67, 69, 71, 72 }; m.setInstrument( 42 ); for( int x = 0; x < 8; x++ ) m.playNote( notes[x], rand() % 100 + 158 ); Sleep( 1000 ); } return 0; }
>>> import winsound >>> for note in [261.63, 293.66, 329.63, 349.23, 392.00, 440.00, 493.88, 523.25]: winsound.Beep(int(note+.5), 500) >>>
Rewrite the snippet below in Python so it works the same as the original C++ code.
#include <vector> #include <string> #include <iostream> #include <boost/tuple/tuple.hpp> #include <set> int findBestPack( const std::vector<boost::tuple<std::string , int , int> > & , std::set<int> & , const int ) ; int main( ) { std::vector<boost::tuple<std::string , int , int> > items ; items.push_back( boost::make_tuple( "" , 0 , 0 ) ) ; items.push_back( boost::make_tuple( "map" , 9 , 150 ) ) ; items.push_back( boost::make_tuple( "compass" , 13 , 35 ) ) ; items.push_back( boost::make_tuple( "water" , 153 , 200 ) ) ; items.push_back( boost::make_tuple( "sandwich", 50 , 160 ) ) ; items.push_back( boost::make_tuple( "glucose" , 15 , 60 ) ) ; items.push_back( boost::make_tuple( "tin", 68 , 45 ) ) ; items.push_back( boost::make_tuple( "banana", 27 , 60 ) ) ; items.push_back( boost::make_tuple( "apple" , 39 , 40 ) ) ; items.push_back( boost::make_tuple( "cheese" , 23 , 30 ) ) ; items.push_back( boost::make_tuple( "beer" , 52 , 10 ) ) ; items.push_back( boost::make_tuple( "suntan creme" , 11 , 70 ) ) ; items.push_back( boost::make_tuple( "camera" , 32 , 30 ) ) ; items.push_back( boost::make_tuple( "T-shirt" , 24 , 15 ) ) ; items.push_back( boost::make_tuple( "trousers" , 48 , 10 ) ) ; items.push_back( boost::make_tuple( "umbrella" , 73 , 40 ) ) ; items.push_back( boost::make_tuple( "waterproof trousers" , 42 , 70 ) ) ; items.push_back( boost::make_tuple( "waterproof overclothes" , 43 , 75 ) ) ; items.push_back( boost::make_tuple( "note-case" , 22 , 80 ) ) ; items.push_back( boost::make_tuple( "sunglasses" , 7 , 20 ) ) ; items.push_back( boost::make_tuple( "towel" , 18 , 12 ) ) ; items.push_back( boost::make_tuple( "socks" , 4 , 50 ) ) ; items.push_back( boost::make_tuple( "book" , 30 , 10 ) ) ; const int maximumWeight = 400 ; std::set<int> bestItems ; int bestValue = findBestPack( items , bestItems , maximumWeight ) ; std::cout << "The best value that can be packed in the given knapsack is " << bestValue << " !\n" ; int totalweight = 0 ; std::cout << "The following items should be packed in the knapsack:\n" ; for ( std::set<int>::const_iterator si = bestItems.begin( ) ; si != bestItems.end( ) ; si++ ) { std::cout << (items.begin( ) + *si)->get<0>( ) << "\n" ; totalweight += (items.begin( ) + *si)->get<1>( ) ; } std::cout << "The total weight of all items is " << totalweight << " !\n" ; return 0 ; } int findBestPack( const std::vector<boost::tuple<std::string , int , int> > & items ,std::set<int> & bestItems , const int weightlimit ) { const int n = items.size( ) ; int bestValues [ n ][ weightlimit ] ; std::set<int> solutionSets[ n ][ weightlimit ] ; std::set<int> emptyset ; for ( int i = 0 ; i < n ; i++ ) { for ( int j = 0 ; j < weightlimit ; j++ ) { bestValues[ i ][ j ] = 0 ; solutionSets[ i ][ j ] = emptyset ; } } for ( int i = 0 ; i < n ; i++ ) { for ( int weight = 0 ; weight < weightlimit ; weight++ ) { if ( i == 0 ) bestValues[ i ][ weight ] = 0 ; else { int itemweight = (items.begin( ) + i)->get<1>( ) ; if ( weight < itemweight ) { bestValues[ i ][ weight ] = bestValues[ i - 1 ][ weight ] ; solutionSets[ i ][ weight ] = solutionSets[ i - 1 ][ weight ] ; } else { if ( bestValues[ i - 1 ][ weight - itemweight ] + (items.begin( ) + i)->get<2>( ) > bestValues[ i - 1 ][ weight ] ) { bestValues[ i ][ weight ] = bestValues[ i - 1 ][ weight - itemweight ] + (items.begin( ) + i)->get<2>( ) ; solutionSets[ i ][ weight ] = solutionSets[ i - 1 ][ weight - itemweight ] ; solutionSets[ i ][ weight ].insert( i ) ; } else { bestValues[ i ][ weight ] = bestValues[ i - 1 ][ weight ] ; solutionSets[ i ][ weight ] = solutionSets[ i - 1 ][ weight ] ; } } } } } bestItems.swap( solutionSets[ n - 1][ weightlimit - 1 ] ) ; return bestValues[ n - 1 ][ weightlimit - 1 ] ; }
from itertools import combinations def anycomb(items): ' return combinations of any length from the items ' return ( comb for r in range(1, len(items)+1) for comb in combinations(items, r) ) def totalvalue(comb): ' Totalise a particular combination of items' totwt = totval = 0 for item, wt, val in comb: totwt += wt totval += val return (totval, -totwt) if totwt <= 400 else (0, 0) items = ( ("map", 9, 150), ("compass", 13, 35), ("water", 153, 200), ("sandwich", 50, 160), ("glucose", 15, 60), ("tin", 68, 45), ("banana", 27, 60), ("apple", 39, 40), ("cheese", 23, 30), ("beer", 52, 10), ("suntan cream", 11, 70), ("camera", 32, 30), ("t-shirt", 24, 15), ("trousers", 48, 10), ("umbrella", 73, 40), ("waterproof trousers", 42, 70), ("waterproof overclothes", 43, 75), ("note-case", 22, 80), ("sunglasses", 7, 20), ("towel", 18, 12), ("socks", 4, 50), ("book", 30, 10), ) bagged = max( anycomb(items), key=totalvalue) print("Bagged the following items\n " + '\n '.join(sorted(item for item,_,_ in bagged))) val, wt = totalvalue(bagged) print("for a total value of %i and a total weight of %i" % (val, -wt))
Translate this program into Python but keep the logic exactly as in C++.
#include <algorithm> #include <iostream> #include <vector> typedef unsigned long long integer; std::vector<integer> get_ancestors(const std::vector<integer>& ancestor, integer n) { std::vector<integer> result; for (integer a = ancestor[n]; a != 0 && a != n; ) { n = a; a = ancestor[n]; result.push_back(n); } return result; } void print_vector(const std::vector<integer>& vec) { if (vec.empty()) { std::cout << "none\n"; return; } auto i = vec.begin(); std::cout << *i++; for (; i != vec.end(); ++i) std::cout << ", " << *i; std::cout << '\n'; } bool is_prime(integer n) { if (n < 2) return false; if (n % 2 == 0) return n == 2; for (integer p = 3; p * p <= n; p += 2) { if (n % p == 0) return false; } return true; } int main(int argc, char** argv) { const size_t limit = 100; std::vector<integer> ancestor(limit, 0); std::vector<std::vector<integer>> descendants(limit); for (size_t prime = 0; prime < limit; ++prime) { if (!is_prime(prime)) continue; descendants[prime].push_back(prime); for (size_t i = 0; i + prime < limit; ++i) { integer s = i + prime; for (integer n : descendants[i]) { integer prod = n * prime; descendants[s].push_back(prod); if (prod < limit) ancestor[prod] = s; } } } size_t total_descendants = 0; for (integer i = 1; i < limit; ++i) { std::vector<integer> ancestors(get_ancestors(ancestor, i)); std::cout << "[" << i << "] Level: " << ancestors.size() << '\n'; std::cout << "Ancestors: "; std::sort(ancestors.begin(), ancestors.end()); print_vector(ancestors); std::cout << "Descendants: "; std::vector<integer>& desc = descendants[i]; if (!desc.empty()) { std::sort(desc.begin(), desc.end()); if (desc[0] == i) desc.erase(desc.begin()); } std::cout << desc.size() << '\n'; total_descendants += desc.size(); if (!desc.empty()) print_vector(desc); std::cout << '\n'; } std::cout << "Total descendants: " << total_descendants << '\n'; return 0; }
from __future__ import print_function from itertools import takewhile maxsum = 99 def get_primes(max): if max < 2: return [] lprimes = [2] for x in range(3, max + 1, 2): for p in lprimes: if x % p == 0: break else: lprimes.append(x) return lprimes descendants = [[] for _ in range(maxsum + 1)] ancestors = [[] for _ in range(maxsum + 1)] primes = get_primes(maxsum) for p in primes: descendants[p].append(p) for s in range(1, len(descendants) - p): descendants[s + p] += [p * pr for pr in descendants[s]] for p in primes + [4]: descendants[p].pop() total = 0 for s in range(1, maxsum + 1): descendants[s].sort() for d in takewhile(lambda x: x <= maxsum, descendants[s]): ancestors[d] = ancestors[s] + [s] print([s], "Level:", len(ancestors[s])) print("Ancestors:", ancestors[s] if len(ancestors[s]) else "None") print("Descendants:", len(descendants[s]) if len(descendants[s]) else "None") if len(descendants[s]): print(descendants[s]) print() total += len(descendants[s]) print("Total descendants", total)
Write the same algorithm in Python as shown in this C++ implementation.
#include <algorithm> #include <iostream> #include <vector> typedef unsigned long long integer; std::vector<integer> get_ancestors(const std::vector<integer>& ancestor, integer n) { std::vector<integer> result; for (integer a = ancestor[n]; a != 0 && a != n; ) { n = a; a = ancestor[n]; result.push_back(n); } return result; } void print_vector(const std::vector<integer>& vec) { if (vec.empty()) { std::cout << "none\n"; return; } auto i = vec.begin(); std::cout << *i++; for (; i != vec.end(); ++i) std::cout << ", " << *i; std::cout << '\n'; } bool is_prime(integer n) { if (n < 2) return false; if (n % 2 == 0) return n == 2; for (integer p = 3; p * p <= n; p += 2) { if (n % p == 0) return false; } return true; } int main(int argc, char** argv) { const size_t limit = 100; std::vector<integer> ancestor(limit, 0); std::vector<std::vector<integer>> descendants(limit); for (size_t prime = 0; prime < limit; ++prime) { if (!is_prime(prime)) continue; descendants[prime].push_back(prime); for (size_t i = 0; i + prime < limit; ++i) { integer s = i + prime; for (integer n : descendants[i]) { integer prod = n * prime; descendants[s].push_back(prod); if (prod < limit) ancestor[prod] = s; } } } size_t total_descendants = 0; for (integer i = 1; i < limit; ++i) { std::vector<integer> ancestors(get_ancestors(ancestor, i)); std::cout << "[" << i << "] Level: " << ancestors.size() << '\n'; std::cout << "Ancestors: "; std::sort(ancestors.begin(), ancestors.end()); print_vector(ancestors); std::cout << "Descendants: "; std::vector<integer>& desc = descendants[i]; if (!desc.empty()) { std::sort(desc.begin(), desc.end()); if (desc[0] == i) desc.erase(desc.begin()); } std::cout << desc.size() << '\n'; total_descendants += desc.size(); if (!desc.empty()) print_vector(desc); std::cout << '\n'; } std::cout << "Total descendants: " << total_descendants << '\n'; return 0; }
from __future__ import print_function from itertools import takewhile maxsum = 99 def get_primes(max): if max < 2: return [] lprimes = [2] for x in range(3, max + 1, 2): for p in lprimes: if x % p == 0: break else: lprimes.append(x) return lprimes descendants = [[] for _ in range(maxsum + 1)] ancestors = [[] for _ in range(maxsum + 1)] primes = get_primes(maxsum) for p in primes: descendants[p].append(p) for s in range(1, len(descendants) - p): descendants[s + p] += [p * pr for pr in descendants[s]] for p in primes + [4]: descendants[p].pop() total = 0 for s in range(1, maxsum + 1): descendants[s].sort() for d in takewhile(lambda x: x <= maxsum, descendants[s]): ancestors[d] = ancestors[s] + [s] print([s], "Level:", len(ancestors[s])) print("Ancestors:", ancestors[s] if len(ancestors[s]) else "None") print("Descendants:", len(descendants[s]) if len(descendants[s]) else "None") if len(descendants[s]): print(descendants[s]) print() total += len(descendants[s]) print("Total descendants", total)
Convert this C++ block to Python, preserving its control flow and logic.
#include <iostream> #include <vector> #include <algorithm> void print(const std::vector<std::vector<int>>& v) { std::cout << "{ "; for (const auto& p : v) { std::cout << "("; for (const auto& e : p) { std::cout << e << " "; } std::cout << ") "; } std::cout << "}" << std::endl; } auto product(const std::vector<std::vector<int>>& lists) { std::vector<std::vector<int>> result; if (std::find_if(std::begin(lists), std::end(lists), [](auto e) -> bool { return e.size() == 0; }) != std::end(lists)) { return result; } for (auto& e : lists[0]) { result.push_back({ e }); } for (size_t i = 1; i < lists.size(); ++i) { std::vector<std::vector<int>> temp; for (auto& e : result) { for (auto f : lists[i]) { auto e_tmp = e; e_tmp.push_back(f); temp.push_back(e_tmp); } } result = temp; } return result; } int main() { std::vector<std::vector<int>> prods[] = { { { 1, 2 }, { 3, 4 } }, { { 3, 4 }, { 1, 2} }, { { 1, 2 }, { } }, { { }, { 1, 2 } }, { { 1776, 1789 }, { 7, 12 }, { 4, 14, 23 }, { 0, 1 } }, { { 1, 2, 3 }, { 30 }, { 500, 100 } }, { { 1, 2, 3 }, { }, { 500, 100 } } }; for (const auto& p : prods) { print(product(p)); } std::cin.ignore(); std::cin.get(); return 0; }
import itertools def cp(lsts): return list(itertools.product(*lsts)) if __name__ == '__main__': from pprint import pprint as pp for lists in [[[1,2],[3,4]], [[3,4],[1,2]], [[], [1, 2]], [[1, 2], []], ((1776, 1789), (7, 12), (4, 14, 23), (0, 1)), ((1, 2, 3), (30,), (500, 100)), ((1, 2, 3), (), (500, 100))]: print(lists, '=>') pp(cp(lists), indent=2)
Translate this program into Python but keep the logic exactly as in C++.
#include <iostream> #include <vector> #include <algorithm> void print(const std::vector<std::vector<int>>& v) { std::cout << "{ "; for (const auto& p : v) { std::cout << "("; for (const auto& e : p) { std::cout << e << " "; } std::cout << ") "; } std::cout << "}" << std::endl; } auto product(const std::vector<std::vector<int>>& lists) { std::vector<std::vector<int>> result; if (std::find_if(std::begin(lists), std::end(lists), [](auto e) -> bool { return e.size() == 0; }) != std::end(lists)) { return result; } for (auto& e : lists[0]) { result.push_back({ e }); } for (size_t i = 1; i < lists.size(); ++i) { std::vector<std::vector<int>> temp; for (auto& e : result) { for (auto f : lists[i]) { auto e_tmp = e; e_tmp.push_back(f); temp.push_back(e_tmp); } } result = temp; } return result; } int main() { std::vector<std::vector<int>> prods[] = { { { 1, 2 }, { 3, 4 } }, { { 3, 4 }, { 1, 2} }, { { 1, 2 }, { } }, { { }, { 1, 2 } }, { { 1776, 1789 }, { 7, 12 }, { 4, 14, 23 }, { 0, 1 } }, { { 1, 2, 3 }, { 30 }, { 500, 100 } }, { { 1, 2, 3 }, { }, { 500, 100 } } }; for (const auto& p : prods) { print(product(p)); } std::cin.ignore(); std::cin.get(); return 0; }
import itertools def cp(lsts): return list(itertools.product(*lsts)) if __name__ == '__main__': from pprint import pprint as pp for lists in [[[1,2],[3,4]], [[3,4],[1,2]], [[], [1, 2]], [[1, 2], []], ((1776, 1789), (7, 12), (4, 14, 23), (0, 1)), ((1, 2, 3), (30,), (500, 100)), ((1, 2, 3), (), (500, 100))]: print(lists, '=>') pp(cp(lists), indent=2)
Maintain the same structure and functionality when rewriting this code in Python.
#include <functional> #include <algorithm> #include <iostream> #include <vector> #include <cmath> using std::cout; using std::endl; using std::vector; using std::function; using std::transform; using std::back_inserter; typedef function<double(double)> FunType; vector<FunType> A = {sin, cos, tan, [](double x) { return x*x*x; } }; vector<FunType> B = {asin, acos, atan, [](double x) { return exp(log(x)/3); } }; template <typename A, typename B, typename C> function<C(A)> compose(function<C(B)> f, function<B(A)> g) { return [f,g](A x) { return f(g(x)); }; } int main() { vector<FunType> composedFuns; auto exNums = {0.0, 0.2, 0.4, 0.6, 0.8, 1.0}; transform(B.begin(), B.end(), A.begin(), back_inserter(composedFuns), compose<double, double, double>); for (auto num: exNums) for (auto fun: composedFuns) cout << u8"f\u207B\u00B9.f(" << num << ") = " << fun(num) << endl; return 0; }
>>> >>> from math import sin, cos, acos, asin >>> >>> cube = lambda x: x * x * x >>> croot = lambda x: x ** (1/3.0) >>> >>> >>> compose = lambda f1, f2: ( lambda x: f1(f2(x)) ) >>> >>> funclist = [sin, cos, cube] >>> funclisti = [asin, acos, croot] >>> >>> [compose(inversef, f)(.5) for f, inversef in zip(funclist, funclisti)] [0.5, 0.4999999999999999, 0.5] >>>
Produce a functionally identical Python code for the snippet given in C++.
#include <vector> #include <iostream> #include <algorithm> std::vector<int> properDivisors ( int number ) { std::vector<int> divisors ; for ( int i = 1 ; i < number / 2 + 1 ; i++ ) if ( number % i == 0 ) divisors.push_back( i ) ; return divisors ; } int main( ) { std::vector<int> divisors ; unsigned int maxdivisors = 0 ; int corresponding_number = 0 ; for ( int i = 1 ; i < 11 ; i++ ) { divisors = properDivisors ( i ) ; std::cout << "Proper divisors of " << i << ":\n" ; for ( int number : divisors ) { std::cout << number << " " ; } std::cout << std::endl ; divisors.clear( ) ; } for ( int i = 11 ; i < 20001 ; i++ ) { divisors = properDivisors ( i ) ; if ( divisors.size( ) > maxdivisors ) { maxdivisors = divisors.size( ) ; corresponding_number = i ; } divisors.clear( ) ; } std::cout << "Most divisors has " << corresponding_number << " , it has " << maxdivisors << " divisors!\n" ; return 0 ; }
>>> def proper_divs2(n): ... return {x for x in range(1, (n + 1) // 2 + 1) if n % x == 0 and n != x} ... >>> [proper_divs2(n) for n in range(1, 11)] [set(), {1}, {1}, {1, 2}, {1}, {1, 2, 3}, {1}, {1, 2, 4}, {1, 3}, {1, 2, 5}] >>> >>> n, length = max(((n, len(proper_divs2(n))) for n in range(1, 20001)), key=lambda pd: pd[1]) >>> n 15120 >>> length 79 >>>
Maintain the same structure and functionality when rewriting this code in Python.
#include <vector> #include <utility> #include <iostream> #include <boost/algorithm/string.hpp> std::string create_xml( std::vector<std::string> & ,std::vector<std::string> & ) ; int main( ) { std::vector<std::string> names , remarks ; names.push_back( "April" ) ; names.push_back( "Tam O'Shantor" ) ; names.push_back ( "Emily" ) ; remarks.push_back( "Bubbly, I'm > Tam and <= Emily" ) ; remarks.push_back( "Burns: \"When chapman billies leave the street ...\"" ) ; remarks.push_back( "Short & shrift" ) ; std::cout << "This is in XML:\n" ; std::cout << create_xml( names , remarks ) << std::endl ; return 0 ; } std::string create_xml( std::vector<std::string> & names , std::vector<std::string> & remarks ) { std::vector<std::pair<std::string , std::string> > entities ; entities.push_back( std::make_pair( "&" , "&amp;" ) ) ; entities.push_back( std::make_pair( "<" , "&lt;" ) ) ; entities.push_back( std::make_pair( ">" , "&gt;" ) ) ; std::string xmlstring ( "<CharacterRemarks>\n" ) ; std::vector<std::string>::iterator vsi = names.begin( ) ; typedef std::vector<std::pair<std::string , std::string> >::iterator Vpss ; for ( ; vsi != names.end( ) ; vsi++ ) { for ( Vpss vs = entities.begin( ) ; vs != entities.end( ) ; vs++ ) { boost::replace_all ( *vsi , vs->first , vs->second ) ; } } for ( vsi = remarks.begin( ) ; vsi != remarks.end( ) ; vsi++ ) { for ( Vpss vs = entities.begin( ) ; vs != entities.end( ) ; vs++ ) { boost::replace_all ( *vsi , vs->first , vs->second ) ; } } for ( int i = 0 ; i < names.size( ) ; i++ ) { xmlstring.append( "\t<Character name=\"").append( names[ i ] ).append( "\">") .append( remarks[ i ] ).append( "</Character>\n" ) ; } xmlstring.append( "</CharacterRemarks>" ) ; return xmlstring ; }
>>> from xml.etree import ElementTree as ET >>> from itertools import izip >>> def characterstoxml(names, remarks): root = ET.Element("CharacterRemarks") for name, remark in izip(names, remarks): c = ET.SubElement(root, "Character", {'name': name}) c.text = remark return ET.tostring(root) >>> print characterstoxml( names = ["April", "Tam O'Shanter", "Emily"], remarks = [ "Bubbly: I'm > Tam and <= Emily", 'Burns: "When chapman billies leave the street ..."', 'Short & shrift' ] ).replace('><','>\n<')
Write the same code in Python as shown below in C++.
#include <windows.h> #include <string> #include <vector> using namespace std; const int HSTEP = 46, MWID = 40, MHEI = 471; const float VSTEP = 2.3f; class vector2 { public: vector2() { x = y = 0; } vector2( float a, float b ) { x = a; y = b; } void set( float a, float b ) { x = a; y = b; } float x, y; }; class myBitmap { public: myBitmap() : pen( NULL ), brush( NULL ), clr( 0 ), wid( 1 ) {} ~myBitmap() { DeleteObject( pen ); DeleteObject( brush ); DeleteDC( hdc ); DeleteObject( bmp ); } bool create( int w, int h ) { BITMAPINFO bi; ZeroMemory( &bi, sizeof( bi ) ); bi.bmiHeader.biSize = sizeof( bi.bmiHeader ); bi.bmiHeader.biBitCount = sizeof( DWORD ) * 8; bi.bmiHeader.biCompression = BI_RGB; bi.bmiHeader.biPlanes = 1; bi.bmiHeader.biWidth = w; bi.bmiHeader.biHeight = -h; HDC dc = GetDC( GetConsoleWindow() ); bmp = CreateDIBSection( dc, &bi, DIB_RGB_COLORS, &pBits, NULL, 0 ); if( !bmp ) return false; hdc = CreateCompatibleDC( dc ); SelectObject( hdc, bmp ); ReleaseDC( GetConsoleWindow(), dc ); width = w; height = h; return true; } void clear( BYTE clr = 0 ) { memset( pBits, clr, width * height * sizeof( DWORD ) ); } void setBrushColor( DWORD bClr ) { if( brush ) DeleteObject( brush ); brush = CreateSolidBrush( bClr ); SelectObject( hdc, brush ); } void setPenColor( DWORD c ) { clr = c; createPen(); } void setPenWidth( int w ) { wid = w; createPen(); } void saveBitmap( string path ) { BITMAPFILEHEADER fileheader; BITMAPINFO infoheader; BITMAP bitmap; DWORD wb; GetObject( bmp, sizeof( bitmap ), &bitmap ); DWORD* dwpBits = new DWORD[bitmap.bmWidth * bitmap.bmHeight]; ZeroMemory( dwpBits, bitmap.bmWidth * bitmap.bmHeight * sizeof( DWORD ) ); ZeroMemory( &infoheader, sizeof( BITMAPINFO ) ); ZeroMemory( &fileheader, sizeof( BITMAPFILEHEADER ) ); infoheader.bmiHeader.biBitCount = sizeof( DWORD ) * 8; infoheader.bmiHeader.biCompression = BI_RGB; infoheader.bmiHeader.biPlanes = 1; infoheader.bmiHeader.biSize = sizeof( infoheader.bmiHeader ); infoheader.bmiHeader.biHeight = bitmap.bmHeight; infoheader.bmiHeader.biWidth = bitmap.bmWidth; infoheader.bmiHeader.biSizeImage = bitmap.bmWidth * bitmap.bmHeight * sizeof( DWORD ); fileheader.bfType = 0x4D42; fileheader.bfOffBits = sizeof( infoheader.bmiHeader ) + sizeof( BITMAPFILEHEADER ); fileheader.bfSize = fileheader.bfOffBits + infoheader.bmiHeader.biSizeImage; GetDIBits( hdc, bmp, 0, height, ( LPVOID )dwpBits, &infoheader, DIB_RGB_COLORS ); HANDLE file = CreateFile( path.c_str(), GENERIC_WRITE, 0, NULL, CREATE_ALWAYS, FILE_ATTRIBUTE_NORMAL, NULL ); WriteFile( file, &fileheader, sizeof( BITMAPFILEHEADER ), &wb, NULL ); WriteFile( file, &infoheader.bmiHeader, sizeof( infoheader.bmiHeader ), &wb, NULL ); WriteFile( file, dwpBits, bitmap.bmWidth * bitmap.bmHeight * 4, &wb, NULL ); CloseHandle( file ); delete [] dwpBits; } HDC getDC() const { return hdc; } int getWidth() const { return width; } int getHeight() const { return height; } private: void createPen() { if( pen ) DeleteObject( pen ); pen = CreatePen( PS_SOLID, wid, clr ); SelectObject( hdc, pen ); } HBITMAP bmp; HDC hdc; HPEN pen; HBRUSH brush; void *pBits; int width, height, wid; DWORD clr; }; class plot { public: plot() { bmp.create( 512, 512 ); } void draw( vector<vector2>* pairs ) { bmp.clear( 0xff ); drawGraph( pairs ); plotIt( pairs ); HDC dc = GetDC( GetConsoleWindow() ); BitBlt( dc, 0, 30, 512, 512, bmp.getDC(), 0, 0, SRCCOPY ); ReleaseDC( GetConsoleWindow(), dc ); } private: void drawGraph( vector<vector2>* pairs ) { HDC dc = bmp.getDC(); bmp.setPenColor( RGB( 240, 240, 240 ) ); DWORD b = 11, c = 40, x; RECT rc; char txt[8]; for( x = 0; x < pairs->size(); x++ ) { MoveToEx( dc, 40, b, NULL ); LineTo( dc, 500, b ); MoveToEx( dc, c, 11, NULL ); LineTo( dc, c, 471 ); wsprintf( txt, "%d", ( pairs->size() - x ) * 20 ); SetRect( &rc, 0, b - 9, 36, b + 11 ); DrawText( dc, txt, lstrlen( txt ), &rc, DT_RIGHT | DT_VCENTER | DT_SINGLELINE ); wsprintf( txt, "%d", x ); SetRect( &rc, c - 8, 472, c + 8, 492 ); DrawText( dc, txt, lstrlen( txt ), &rc, DT_CENTER | DT_VCENTER | DT_SINGLELINE ); c += 46; b += 46; } SetRect( &rc, 0, b - 9, 36, b + 11 ); DrawText( dc, "0", 1, &rc, DT_RIGHT | DT_VCENTER | DT_SINGLELINE ); bmp.setPenColor( 0 ); bmp.setPenWidth( 3 ); MoveToEx( dc, 40, 11, NULL ); LineTo( dc, 40, 471 ); MoveToEx( dc, 40, 471, NULL ); LineTo( dc, 500, 471 ); } void plotIt( vector<vector2>* pairs ) { HDC dc = bmp.getDC(); HBRUSH br = CreateSolidBrush( 255 ); RECT rc; bmp.setPenColor( 255 ); bmp.setPenWidth( 2 ); vector<vector2>::iterator it = pairs->begin(); int a = MWID + HSTEP * static_cast<int>( ( *it ).x ), b = MHEI - static_cast<int>( VSTEP * ( *it ).y ); MoveToEx( dc, a, b, NULL ); SetRect( &rc, a - 3, b - 3, a + 3, b + 3 ); FillRect( dc, &rc, br ); it++; for( ; it < pairs->end(); it++ ) { a = MWID + HSTEP * static_cast<int>( ( *it ).x ); b = MHEI - static_cast<int>( VSTEP * ( *it ).y ); SetRect( &rc, a - 3, b - 3, a + 3, b + 3 ); FillRect( dc, &rc, br ); LineTo( dc, a, b ); } DeleteObject( br ); } myBitmap bmp; }; int main( int argc, char* argv[] ) { ShowWindow( GetConsoleWindow(), SW_MAXIMIZE ); plot pt; vector<vector2> pairs; pairs.push_back( vector2( 0, 2.7f ) ); pairs.push_back( vector2( 1, 2.8f ) ); pairs.push_back( vector2( 2.0f, 31.4f ) ); pairs.push_back( vector2( 3.0f, 38.1f ) ); pairs.push_back( vector2( 4.0f, 58.0f ) ); pairs.push_back( vector2( 5.0f, 76.2f ) ); pairs.push_back( vector2( 6.0f, 100.5f ) ); pairs.push_back( vector2( 7.0f, 130.0f ) ); pairs.push_back( vector2( 8.0f, 149.3f ) ); pairs.push_back( vector2( 9.0f, 180.0f ) ); pt.draw( &pairs ); system( "pause" ); return 0; }
>>> x = [0, 1, 2, 3, 4, 5, 6, 7, 8, 9] >>> y = [2.7, 2.8, 31.4, 38.1, 58.0, 76.2, 100.5, 130.0, 149.3, 180.0] >>> import pylab >>> pylab.plot(x, y, 'bo') >>> pylab.savefig('qsort-range-10-9.png')
Generate an equivalent Python version of this C++ code.
#include <windows.h> #include <string> #include <vector> using namespace std; const int HSTEP = 46, MWID = 40, MHEI = 471; const float VSTEP = 2.3f; class vector2 { public: vector2() { x = y = 0; } vector2( float a, float b ) { x = a; y = b; } void set( float a, float b ) { x = a; y = b; } float x, y; }; class myBitmap { public: myBitmap() : pen( NULL ), brush( NULL ), clr( 0 ), wid( 1 ) {} ~myBitmap() { DeleteObject( pen ); DeleteObject( brush ); DeleteDC( hdc ); DeleteObject( bmp ); } bool create( int w, int h ) { BITMAPINFO bi; ZeroMemory( &bi, sizeof( bi ) ); bi.bmiHeader.biSize = sizeof( bi.bmiHeader ); bi.bmiHeader.biBitCount = sizeof( DWORD ) * 8; bi.bmiHeader.biCompression = BI_RGB; bi.bmiHeader.biPlanes = 1; bi.bmiHeader.biWidth = w; bi.bmiHeader.biHeight = -h; HDC dc = GetDC( GetConsoleWindow() ); bmp = CreateDIBSection( dc, &bi, DIB_RGB_COLORS, &pBits, NULL, 0 ); if( !bmp ) return false; hdc = CreateCompatibleDC( dc ); SelectObject( hdc, bmp ); ReleaseDC( GetConsoleWindow(), dc ); width = w; height = h; return true; } void clear( BYTE clr = 0 ) { memset( pBits, clr, width * height * sizeof( DWORD ) ); } void setBrushColor( DWORD bClr ) { if( brush ) DeleteObject( brush ); brush = CreateSolidBrush( bClr ); SelectObject( hdc, brush ); } void setPenColor( DWORD c ) { clr = c; createPen(); } void setPenWidth( int w ) { wid = w; createPen(); } void saveBitmap( string path ) { BITMAPFILEHEADER fileheader; BITMAPINFO infoheader; BITMAP bitmap; DWORD wb; GetObject( bmp, sizeof( bitmap ), &bitmap ); DWORD* dwpBits = new DWORD[bitmap.bmWidth * bitmap.bmHeight]; ZeroMemory( dwpBits, bitmap.bmWidth * bitmap.bmHeight * sizeof( DWORD ) ); ZeroMemory( &infoheader, sizeof( BITMAPINFO ) ); ZeroMemory( &fileheader, sizeof( BITMAPFILEHEADER ) ); infoheader.bmiHeader.biBitCount = sizeof( DWORD ) * 8; infoheader.bmiHeader.biCompression = BI_RGB; infoheader.bmiHeader.biPlanes = 1; infoheader.bmiHeader.biSize = sizeof( infoheader.bmiHeader ); infoheader.bmiHeader.biHeight = bitmap.bmHeight; infoheader.bmiHeader.biWidth = bitmap.bmWidth; infoheader.bmiHeader.biSizeImage = bitmap.bmWidth * bitmap.bmHeight * sizeof( DWORD ); fileheader.bfType = 0x4D42; fileheader.bfOffBits = sizeof( infoheader.bmiHeader ) + sizeof( BITMAPFILEHEADER ); fileheader.bfSize = fileheader.bfOffBits + infoheader.bmiHeader.biSizeImage; GetDIBits( hdc, bmp, 0, height, ( LPVOID )dwpBits, &infoheader, DIB_RGB_COLORS ); HANDLE file = CreateFile( path.c_str(), GENERIC_WRITE, 0, NULL, CREATE_ALWAYS, FILE_ATTRIBUTE_NORMAL, NULL ); WriteFile( file, &fileheader, sizeof( BITMAPFILEHEADER ), &wb, NULL ); WriteFile( file, &infoheader.bmiHeader, sizeof( infoheader.bmiHeader ), &wb, NULL ); WriteFile( file, dwpBits, bitmap.bmWidth * bitmap.bmHeight * 4, &wb, NULL ); CloseHandle( file ); delete [] dwpBits; } HDC getDC() const { return hdc; } int getWidth() const { return width; } int getHeight() const { return height; } private: void createPen() { if( pen ) DeleteObject( pen ); pen = CreatePen( PS_SOLID, wid, clr ); SelectObject( hdc, pen ); } HBITMAP bmp; HDC hdc; HPEN pen; HBRUSH brush; void *pBits; int width, height, wid; DWORD clr; }; class plot { public: plot() { bmp.create( 512, 512 ); } void draw( vector<vector2>* pairs ) { bmp.clear( 0xff ); drawGraph( pairs ); plotIt( pairs ); HDC dc = GetDC( GetConsoleWindow() ); BitBlt( dc, 0, 30, 512, 512, bmp.getDC(), 0, 0, SRCCOPY ); ReleaseDC( GetConsoleWindow(), dc ); } private: void drawGraph( vector<vector2>* pairs ) { HDC dc = bmp.getDC(); bmp.setPenColor( RGB( 240, 240, 240 ) ); DWORD b = 11, c = 40, x; RECT rc; char txt[8]; for( x = 0; x < pairs->size(); x++ ) { MoveToEx( dc, 40, b, NULL ); LineTo( dc, 500, b ); MoveToEx( dc, c, 11, NULL ); LineTo( dc, c, 471 ); wsprintf( txt, "%d", ( pairs->size() - x ) * 20 ); SetRect( &rc, 0, b - 9, 36, b + 11 ); DrawText( dc, txt, lstrlen( txt ), &rc, DT_RIGHT | DT_VCENTER | DT_SINGLELINE ); wsprintf( txt, "%d", x ); SetRect( &rc, c - 8, 472, c + 8, 492 ); DrawText( dc, txt, lstrlen( txt ), &rc, DT_CENTER | DT_VCENTER | DT_SINGLELINE ); c += 46; b += 46; } SetRect( &rc, 0, b - 9, 36, b + 11 ); DrawText( dc, "0", 1, &rc, DT_RIGHT | DT_VCENTER | DT_SINGLELINE ); bmp.setPenColor( 0 ); bmp.setPenWidth( 3 ); MoveToEx( dc, 40, 11, NULL ); LineTo( dc, 40, 471 ); MoveToEx( dc, 40, 471, NULL ); LineTo( dc, 500, 471 ); } void plotIt( vector<vector2>* pairs ) { HDC dc = bmp.getDC(); HBRUSH br = CreateSolidBrush( 255 ); RECT rc; bmp.setPenColor( 255 ); bmp.setPenWidth( 2 ); vector<vector2>::iterator it = pairs->begin(); int a = MWID + HSTEP * static_cast<int>( ( *it ).x ), b = MHEI - static_cast<int>( VSTEP * ( *it ).y ); MoveToEx( dc, a, b, NULL ); SetRect( &rc, a - 3, b - 3, a + 3, b + 3 ); FillRect( dc, &rc, br ); it++; for( ; it < pairs->end(); it++ ) { a = MWID + HSTEP * static_cast<int>( ( *it ).x ); b = MHEI - static_cast<int>( VSTEP * ( *it ).y ); SetRect( &rc, a - 3, b - 3, a + 3, b + 3 ); FillRect( dc, &rc, br ); LineTo( dc, a, b ); } DeleteObject( br ); } myBitmap bmp; }; int main( int argc, char* argv[] ) { ShowWindow( GetConsoleWindow(), SW_MAXIMIZE ); plot pt; vector<vector2> pairs; pairs.push_back( vector2( 0, 2.7f ) ); pairs.push_back( vector2( 1, 2.8f ) ); pairs.push_back( vector2( 2.0f, 31.4f ) ); pairs.push_back( vector2( 3.0f, 38.1f ) ); pairs.push_back( vector2( 4.0f, 58.0f ) ); pairs.push_back( vector2( 5.0f, 76.2f ) ); pairs.push_back( vector2( 6.0f, 100.5f ) ); pairs.push_back( vector2( 7.0f, 130.0f ) ); pairs.push_back( vector2( 8.0f, 149.3f ) ); pairs.push_back( vector2( 9.0f, 180.0f ) ); pt.draw( &pairs ); system( "pause" ); return 0; }
>>> x = [0, 1, 2, 3, 4, 5, 6, 7, 8, 9] >>> y = [2.7, 2.8, 31.4, 38.1, 58.0, 76.2, 100.5, 130.0, 149.3, 180.0] >>> import pylab >>> pylab.plot(x, y, 'bo') >>> pylab.savefig('qsort-range-10-9.png')
Port the following code from C++ to Python with equivalent syntax and logic.
#include <windows.h> #include <string> #include <vector> using namespace std; const int HSTEP = 46, MWID = 40, MHEI = 471; const float VSTEP = 2.3f; class vector2 { public: vector2() { x = y = 0; } vector2( float a, float b ) { x = a; y = b; } void set( float a, float b ) { x = a; y = b; } float x, y; }; class myBitmap { public: myBitmap() : pen( NULL ), brush( NULL ), clr( 0 ), wid( 1 ) {} ~myBitmap() { DeleteObject( pen ); DeleteObject( brush ); DeleteDC( hdc ); DeleteObject( bmp ); } bool create( int w, int h ) { BITMAPINFO bi; ZeroMemory( &bi, sizeof( bi ) ); bi.bmiHeader.biSize = sizeof( bi.bmiHeader ); bi.bmiHeader.biBitCount = sizeof( DWORD ) * 8; bi.bmiHeader.biCompression = BI_RGB; bi.bmiHeader.biPlanes = 1; bi.bmiHeader.biWidth = w; bi.bmiHeader.biHeight = -h; HDC dc = GetDC( GetConsoleWindow() ); bmp = CreateDIBSection( dc, &bi, DIB_RGB_COLORS, &pBits, NULL, 0 ); if( !bmp ) return false; hdc = CreateCompatibleDC( dc ); SelectObject( hdc, bmp ); ReleaseDC( GetConsoleWindow(), dc ); width = w; height = h; return true; } void clear( BYTE clr = 0 ) { memset( pBits, clr, width * height * sizeof( DWORD ) ); } void setBrushColor( DWORD bClr ) { if( brush ) DeleteObject( brush ); brush = CreateSolidBrush( bClr ); SelectObject( hdc, brush ); } void setPenColor( DWORD c ) { clr = c; createPen(); } void setPenWidth( int w ) { wid = w; createPen(); } void saveBitmap( string path ) { BITMAPFILEHEADER fileheader; BITMAPINFO infoheader; BITMAP bitmap; DWORD wb; GetObject( bmp, sizeof( bitmap ), &bitmap ); DWORD* dwpBits = new DWORD[bitmap.bmWidth * bitmap.bmHeight]; ZeroMemory( dwpBits, bitmap.bmWidth * bitmap.bmHeight * sizeof( DWORD ) ); ZeroMemory( &infoheader, sizeof( BITMAPINFO ) ); ZeroMemory( &fileheader, sizeof( BITMAPFILEHEADER ) ); infoheader.bmiHeader.biBitCount = sizeof( DWORD ) * 8; infoheader.bmiHeader.biCompression = BI_RGB; infoheader.bmiHeader.biPlanes = 1; infoheader.bmiHeader.biSize = sizeof( infoheader.bmiHeader ); infoheader.bmiHeader.biHeight = bitmap.bmHeight; infoheader.bmiHeader.biWidth = bitmap.bmWidth; infoheader.bmiHeader.biSizeImage = bitmap.bmWidth * bitmap.bmHeight * sizeof( DWORD ); fileheader.bfType = 0x4D42; fileheader.bfOffBits = sizeof( infoheader.bmiHeader ) + sizeof( BITMAPFILEHEADER ); fileheader.bfSize = fileheader.bfOffBits + infoheader.bmiHeader.biSizeImage; GetDIBits( hdc, bmp, 0, height, ( LPVOID )dwpBits, &infoheader, DIB_RGB_COLORS ); HANDLE file = CreateFile( path.c_str(), GENERIC_WRITE, 0, NULL, CREATE_ALWAYS, FILE_ATTRIBUTE_NORMAL, NULL ); WriteFile( file, &fileheader, sizeof( BITMAPFILEHEADER ), &wb, NULL ); WriteFile( file, &infoheader.bmiHeader, sizeof( infoheader.bmiHeader ), &wb, NULL ); WriteFile( file, dwpBits, bitmap.bmWidth * bitmap.bmHeight * 4, &wb, NULL ); CloseHandle( file ); delete [] dwpBits; } HDC getDC() const { return hdc; } int getWidth() const { return width; } int getHeight() const { return height; } private: void createPen() { if( pen ) DeleteObject( pen ); pen = CreatePen( PS_SOLID, wid, clr ); SelectObject( hdc, pen ); } HBITMAP bmp; HDC hdc; HPEN pen; HBRUSH brush; void *pBits; int width, height, wid; DWORD clr; }; class plot { public: plot() { bmp.create( 512, 512 ); } void draw( vector<vector2>* pairs ) { bmp.clear( 0xff ); drawGraph( pairs ); plotIt( pairs ); HDC dc = GetDC( GetConsoleWindow() ); BitBlt( dc, 0, 30, 512, 512, bmp.getDC(), 0, 0, SRCCOPY ); ReleaseDC( GetConsoleWindow(), dc ); } private: void drawGraph( vector<vector2>* pairs ) { HDC dc = bmp.getDC(); bmp.setPenColor( RGB( 240, 240, 240 ) ); DWORD b = 11, c = 40, x; RECT rc; char txt[8]; for( x = 0; x < pairs->size(); x++ ) { MoveToEx( dc, 40, b, NULL ); LineTo( dc, 500, b ); MoveToEx( dc, c, 11, NULL ); LineTo( dc, c, 471 ); wsprintf( txt, "%d", ( pairs->size() - x ) * 20 ); SetRect( &rc, 0, b - 9, 36, b + 11 ); DrawText( dc, txt, lstrlen( txt ), &rc, DT_RIGHT | DT_VCENTER | DT_SINGLELINE ); wsprintf( txt, "%d", x ); SetRect( &rc, c - 8, 472, c + 8, 492 ); DrawText( dc, txt, lstrlen( txt ), &rc, DT_CENTER | DT_VCENTER | DT_SINGLELINE ); c += 46; b += 46; } SetRect( &rc, 0, b - 9, 36, b + 11 ); DrawText( dc, "0", 1, &rc, DT_RIGHT | DT_VCENTER | DT_SINGLELINE ); bmp.setPenColor( 0 ); bmp.setPenWidth( 3 ); MoveToEx( dc, 40, 11, NULL ); LineTo( dc, 40, 471 ); MoveToEx( dc, 40, 471, NULL ); LineTo( dc, 500, 471 ); } void plotIt( vector<vector2>* pairs ) { HDC dc = bmp.getDC(); HBRUSH br = CreateSolidBrush( 255 ); RECT rc; bmp.setPenColor( 255 ); bmp.setPenWidth( 2 ); vector<vector2>::iterator it = pairs->begin(); int a = MWID + HSTEP * static_cast<int>( ( *it ).x ), b = MHEI - static_cast<int>( VSTEP * ( *it ).y ); MoveToEx( dc, a, b, NULL ); SetRect( &rc, a - 3, b - 3, a + 3, b + 3 ); FillRect( dc, &rc, br ); it++; for( ; it < pairs->end(); it++ ) { a = MWID + HSTEP * static_cast<int>( ( *it ).x ); b = MHEI - static_cast<int>( VSTEP * ( *it ).y ); SetRect( &rc, a - 3, b - 3, a + 3, b + 3 ); FillRect( dc, &rc, br ); LineTo( dc, a, b ); } DeleteObject( br ); } myBitmap bmp; }; int main( int argc, char* argv[] ) { ShowWindow( GetConsoleWindow(), SW_MAXIMIZE ); plot pt; vector<vector2> pairs; pairs.push_back( vector2( 0, 2.7f ) ); pairs.push_back( vector2( 1, 2.8f ) ); pairs.push_back( vector2( 2.0f, 31.4f ) ); pairs.push_back( vector2( 3.0f, 38.1f ) ); pairs.push_back( vector2( 4.0f, 58.0f ) ); pairs.push_back( vector2( 5.0f, 76.2f ) ); pairs.push_back( vector2( 6.0f, 100.5f ) ); pairs.push_back( vector2( 7.0f, 130.0f ) ); pairs.push_back( vector2( 8.0f, 149.3f ) ); pairs.push_back( vector2( 9.0f, 180.0f ) ); pt.draw( &pairs ); system( "pause" ); return 0; }
>>> x = [0, 1, 2, 3, 4, 5, 6, 7, 8, 9] >>> y = [2.7, 2.8, 31.4, 38.1, 58.0, 76.2, 100.5, 130.0, 149.3, 180.0] >>> import pylab >>> pylab.plot(x, y, 'bo') >>> pylab.savefig('qsort-range-10-9.png')
Rewrite this program in Python while keeping its functionality equivalent to the C++ version.
#include <iostream> #include <string> #include <iterator> #include <regex> int main() { std::regex re(".* string$"); std::string s = "Hi, I am a string"; if (std::regex_match(s, re)) std::cout << "The string matches.\n"; else std::cout << "Oops - not found?\n"; std::regex re2(" a.*a"); std::smatch match; if (std::regex_search(s, match, re2)) { std::cout << "Matched " << match.length() << " characters starting at " << match.position() << ".\n"; std::cout << "Matched character sequence: \"" << match.str() << "\"\n"; } else { std::cout << "Oops - not found?\n"; } std::string dest_string; std::regex_replace(std::back_inserter(dest_string), s.begin(), s.end(), re2, "'m now a changed"); std::cout << dest_string << std::endl; }
import re string = "This is a string" if re.search('string$', string): print("Ends with string.") string = re.sub(" a ", " another ", string) print(string)
Change the programming language of this snippet from C++ to Python without modifying what it does.
#include <iostream> #include <algorithm> #include <string> #include <iterator> struct GuessNumberIterator : std::iterator<std::random_access_iterator_tag, int> { int i; GuessNumberIterator() { } GuessNumberIterator(int _i) : i(_i) { } GuessNumberIterator& operator++() { ++i; return *this; } GuessNumberIterator operator++(int) { GuessNumberIterator tmp = *this; ++(*this); return tmp; } bool operator==(const GuessNumberIterator& y) { return i == y.i; } bool operator!=(const GuessNumberIterator& y) { return i != y.i; } int operator*() { std::cout << "Is your number less than or equal to " << i << "? "; std::string s; std::cin >> s; return (s != "" && (s[0] == 'y' || s[0] == 'Y')) ? 0 : -1; } GuessNumberIterator& operator--() { --i; return *this; } GuessNumberIterator operator--(int) { GuessNumberIterator tmp = *this; --(*this); return tmp; } GuessNumberIterator& operator+=(int n) { i += n; return *this; } GuessNumberIterator& operator-=(int n) { i -= n; return *this; } GuessNumberIterator operator+(int n) { GuessNumberIterator tmp = *this; return tmp += n; } GuessNumberIterator operator-(int n) { GuessNumberIterator tmp = *this; return tmp -= n; } int operator-(const GuessNumberIterator &y) { return i - y.i; } int operator[](int n) { return *(*this + n); } bool operator<(const GuessNumberIterator &y) { return i < y.i; } bool operator>(const GuessNumberIterator &y) { return i > y.i; } bool operator<=(const GuessNumberIterator &y) { return i <= y.i; } bool operator>=(const GuessNumberIterator &y) { return i >= y.i; } }; inline GuessNumberIterator operator+(int n, GuessNumberIterator &i) { return i + n; } const int lower = 0; const int upper = 100; int main() { std::cout << "Instructions:\n" << "Think of integer number from " << lower << " (inclusive) to " << upper << " (exclusive) and\n" << "I will guess it. After each guess, I will ask you if it is less than\n" << "or equal to some number, and you will respond with \"yes\" or \"no\".\n"; int answer = std::lower_bound(GuessNumberIterator(lower), GuessNumberIterator(upper), 0).i; std::cout << "Your number is " << answer << ".\n"; return 0; }
inclusive_range = mn, mx = (1, 10) print( % inclusive_range) i = 0 while True: i += 1 guess = (mn+mx)//2 txt = input("Guess %2i is: %2i. The score for which is (h,l,=): " % (i, guess)).strip().lower()[0] if txt not in 'hl=': print(" I don't understand your input of '%s' ?" % txt) continue if txt == 'h': mx = guess-1 if txt == 'l': mn = guess+1 if txt == '=': print(" Ye-Haw!!") break if (mn > mx) or (mn < inclusive_range[0]) or (mx > inclusive_range[1]): print("Please check your scoring as I cannot find the value") break print("\nThanks for keeping score.")
Please provide an equivalent version of this C++ code in Python.
#include <unordered_map> #include <string> int main() { std::string keys[] = { "1", "2", "3" }; std::string vals[] = { "a", "b", "c" }; std::unordered_map<std::string, std::string> hash; for( int i = 0 ; i < 3 ; i++ ) hash[ keys[i] ] = vals[i] ; }
keys = ['a', 'b', 'c'] values = [1, 2, 3] hash = {key: value for key, value in zip(keys, values)}
Transform the following C++ implementation into Python, maintaining the same output and logic.
#include <algorithm> #include <cassert> #include <iomanip> #include <iostream> #include <vector> std::vector<int> bins(const std::vector<int>& limits, const std::vector<int>& data) { std::vector<int> result(limits.size() + 1, 0); for (int n : data) { auto i = std::upper_bound(limits.begin(), limits.end(), n); ++result[i - limits.begin()]; } return result; } void print_bins(const std::vector<int>& limits, const std::vector<int>& bins) { size_t n = limits.size(); if (n == 0) return; assert(n + 1 == bins.size()); std::cout << " < " << std::setw(3) << limits[0] << ": " << std::setw(2) << bins[0] << '\n'; for (size_t i = 1; i < n; ++i) std::cout << ">= " << std::setw(3) << limits[i - 1] << " and < " << std::setw(3) << limits[i] << ": " << std::setw(2) << bins[i] << '\n'; std::cout << ">= " << std::setw(3) << limits[n - 1] << "  : " << std::setw(2) << bins[n] << '\n'; } int main() { const std::vector<int> limits1{23, 37, 43, 53, 67, 83}; const std::vector<int> data1{ 95, 21, 94, 12, 99, 4, 70, 75, 83, 93, 52, 80, 57, 5, 53, 86, 65, 17, 92, 83, 71, 61, 54, 58, 47, 16, 8, 9, 32, 84, 7, 87, 46, 19, 30, 37, 96, 6, 98, 40, 79, 97, 45, 64, 60, 29, 49, 36, 43, 55}; std::cout << "Example 1:\n"; print_bins(limits1, bins(limits1, data1)); const std::vector<int> limits2{14, 18, 249, 312, 389, 392, 513, 591, 634, 720}; const std::vector<int> data2{ 445, 814, 519, 697, 700, 130, 255, 889, 481, 122, 932, 77, 323, 525, 570, 219, 367, 523, 442, 933, 416, 589, 930, 373, 202, 253, 775, 47, 731, 685, 293, 126, 133, 450, 545, 100, 741, 583, 763, 306, 655, 267, 248, 477, 549, 238, 62, 678, 98, 534, 622, 907, 406, 714, 184, 391, 913, 42, 560, 247, 346, 860, 56, 138, 546, 38, 985, 948, 58, 213, 799, 319, 390, 634, 458, 945, 733, 507, 916, 123, 345, 110, 720, 917, 313, 845, 426, 9, 457, 628, 410, 723, 354, 895, 881, 953, 677, 137, 397, 97, 854, 740, 83, 216, 421, 94, 517, 479, 292, 963, 376, 981, 480, 39, 257, 272, 157, 5, 316, 395, 787, 942, 456, 242, 759, 898, 576, 67, 298, 425, 894, 435, 831, 241, 989, 614, 987, 770, 384, 692, 698, 765, 331, 487, 251, 600, 879, 342, 982, 527, 736, 795, 585, 40, 54, 901, 408, 359, 577, 237, 605, 847, 353, 968, 832, 205, 838, 427, 876, 959, 686, 646, 835, 127, 621, 892, 443, 198, 988, 791, 466, 23, 707, 467, 33, 670, 921, 180, 991, 396, 160, 436, 717, 918, 8, 374, 101, 684, 727, 749}; std::cout << "\nExample 2:\n"; print_bins(limits2, bins(limits2, data2)); }
from bisect import bisect_right def bin_it(limits: list, data: list) -> list: "Bin data according to (ascending) limits." bins = [0] * (len(limits) + 1) for d in data: bins[bisect_right(limits, d)] += 1 return bins def bin_print(limits: list, bins: list) -> list: print(f" < {limits[0]:3} := {bins[0]:3}") for lo, hi, count in zip(limits, limits[1:], bins[1:]): print(f">= {lo:3} .. < {hi:3} := {count:3}") print(f">= {limits[-1]:3}  := {bins[-1]:3}") if __name__ == "__main__": print("RC FIRST EXAMPLE\n") limits = [23, 37, 43, 53, 67, 83] data = [95,21,94,12,99,4,70,75,83,93,52,80,57,5,53,86,65,17,92,83,71,61,54,58,47, 16, 8, 9,32,84,7,87,46,19,30,37,96,6,98,40,79,97,45,64,60,29,49,36,43,55] bins = bin_it(limits, data) bin_print(limits, bins) print("\nRC SECOND EXAMPLE\n") limits = [14, 18, 249, 312, 389, 392, 513, 591, 634, 720] data = [445,814,519,697,700,130,255,889,481,122,932, 77,323,525,570,219,367,523,442,933, 416,589,930,373,202,253,775, 47,731,685,293,126,133,450,545,100,741,583,763,306, 655,267,248,477,549,238, 62,678, 98,534,622,907,406,714,184,391,913, 42,560,247, 346,860, 56,138,546, 38,985,948, 58,213,799,319,390,634,458,945,733,507,916,123, 345,110,720,917,313,845,426, 9,457,628,410,723,354,895,881,953,677,137,397, 97, 854,740, 83,216,421, 94,517,479,292,963,376,981,480, 39,257,272,157, 5,316,395, 787,942,456,242,759,898,576, 67,298,425,894,435,831,241,989,614,987,770,384,692, 698,765,331,487,251,600,879,342,982,527,736,795,585, 40, 54,901,408,359,577,237, 605,847,353,968,832,205,838,427,876,959,686,646,835,127,621,892,443,198,988,791, 466, 23,707,467, 33,670,921,180,991,396,160,436,717,918, 8,374,101,684,727,749] bins = bin_it(limits, data) bin_print(limits, bins)
Can you help me rewrite this code in Python instead of C++, keeping it the same logically?
#include <algorithm> #include <cassert> #include <iomanip> #include <iostream> #include <vector> std::vector<int> bins(const std::vector<int>& limits, const std::vector<int>& data) { std::vector<int> result(limits.size() + 1, 0); for (int n : data) { auto i = std::upper_bound(limits.begin(), limits.end(), n); ++result[i - limits.begin()]; } return result; } void print_bins(const std::vector<int>& limits, const std::vector<int>& bins) { size_t n = limits.size(); if (n == 0) return; assert(n + 1 == bins.size()); std::cout << " < " << std::setw(3) << limits[0] << ": " << std::setw(2) << bins[0] << '\n'; for (size_t i = 1; i < n; ++i) std::cout << ">= " << std::setw(3) << limits[i - 1] << " and < " << std::setw(3) << limits[i] << ": " << std::setw(2) << bins[i] << '\n'; std::cout << ">= " << std::setw(3) << limits[n - 1] << "  : " << std::setw(2) << bins[n] << '\n'; } int main() { const std::vector<int> limits1{23, 37, 43, 53, 67, 83}; const std::vector<int> data1{ 95, 21, 94, 12, 99, 4, 70, 75, 83, 93, 52, 80, 57, 5, 53, 86, 65, 17, 92, 83, 71, 61, 54, 58, 47, 16, 8, 9, 32, 84, 7, 87, 46, 19, 30, 37, 96, 6, 98, 40, 79, 97, 45, 64, 60, 29, 49, 36, 43, 55}; std::cout << "Example 1:\n"; print_bins(limits1, bins(limits1, data1)); const std::vector<int> limits2{14, 18, 249, 312, 389, 392, 513, 591, 634, 720}; const std::vector<int> data2{ 445, 814, 519, 697, 700, 130, 255, 889, 481, 122, 932, 77, 323, 525, 570, 219, 367, 523, 442, 933, 416, 589, 930, 373, 202, 253, 775, 47, 731, 685, 293, 126, 133, 450, 545, 100, 741, 583, 763, 306, 655, 267, 248, 477, 549, 238, 62, 678, 98, 534, 622, 907, 406, 714, 184, 391, 913, 42, 560, 247, 346, 860, 56, 138, 546, 38, 985, 948, 58, 213, 799, 319, 390, 634, 458, 945, 733, 507, 916, 123, 345, 110, 720, 917, 313, 845, 426, 9, 457, 628, 410, 723, 354, 895, 881, 953, 677, 137, 397, 97, 854, 740, 83, 216, 421, 94, 517, 479, 292, 963, 376, 981, 480, 39, 257, 272, 157, 5, 316, 395, 787, 942, 456, 242, 759, 898, 576, 67, 298, 425, 894, 435, 831, 241, 989, 614, 987, 770, 384, 692, 698, 765, 331, 487, 251, 600, 879, 342, 982, 527, 736, 795, 585, 40, 54, 901, 408, 359, 577, 237, 605, 847, 353, 968, 832, 205, 838, 427, 876, 959, 686, 646, 835, 127, 621, 892, 443, 198, 988, 791, 466, 23, 707, 467, 33, 670, 921, 180, 991, 396, 160, 436, 717, 918, 8, 374, 101, 684, 727, 749}; std::cout << "\nExample 2:\n"; print_bins(limits2, bins(limits2, data2)); }
from bisect import bisect_right def bin_it(limits: list, data: list) -> list: "Bin data according to (ascending) limits." bins = [0] * (len(limits) + 1) for d in data: bins[bisect_right(limits, d)] += 1 return bins def bin_print(limits: list, bins: list) -> list: print(f" < {limits[0]:3} := {bins[0]:3}") for lo, hi, count in zip(limits, limits[1:], bins[1:]): print(f">= {lo:3} .. < {hi:3} := {count:3}") print(f">= {limits[-1]:3}  := {bins[-1]:3}") if __name__ == "__main__": print("RC FIRST EXAMPLE\n") limits = [23, 37, 43, 53, 67, 83] data = [95,21,94,12,99,4,70,75,83,93,52,80,57,5,53,86,65,17,92,83,71,61,54,58,47, 16, 8, 9,32,84,7,87,46,19,30,37,96,6,98,40,79,97,45,64,60,29,49,36,43,55] bins = bin_it(limits, data) bin_print(limits, bins) print("\nRC SECOND EXAMPLE\n") limits = [14, 18, 249, 312, 389, 392, 513, 591, 634, 720] data = [445,814,519,697,700,130,255,889,481,122,932, 77,323,525,570,219,367,523,442,933, 416,589,930,373,202,253,775, 47,731,685,293,126,133,450,545,100,741,583,763,306, 655,267,248,477,549,238, 62,678, 98,534,622,907,406,714,184,391,913, 42,560,247, 346,860, 56,138,546, 38,985,948, 58,213,799,319,390,634,458,945,733,507,916,123, 345,110,720,917,313,845,426, 9,457,628,410,723,354,895,881,953,677,137,397, 97, 854,740, 83,216,421, 94,517,479,292,963,376,981,480, 39,257,272,157, 5,316,395, 787,942,456,242,759,898,576, 67,298,425,894,435,831,241,989,614,987,770,384,692, 698,765,331,487,251,600,879,342,982,527,736,795,585, 40, 54,901,408,359,577,237, 605,847,353,968,832,205,838,427,876,959,686,646,835,127,621,892,443,198,988,791, 466, 23,707,467, 33,670,921,180,991,396,160,436,717,918, 8,374,101,684,727,749] bins = bin_it(limits, data) bin_print(limits, bins)
Change the following C++ code into Python without altering its purpose.
#include <windows.h> #include <string> #include <math.h> using namespace std; const float PI = 3.1415926536f; class myBitmap { public: myBitmap() : pen( NULL ) {} ~myBitmap() { DeleteObject( pen ); DeleteDC( hdc ); DeleteObject( bmp ); } bool create( int w, int h ) { BITMAPINFO bi; void *pBits; ZeroMemory( &bi, sizeof( bi ) ); bi.bmiHeader.biSize = sizeof( bi.bmiHeader ); bi.bmiHeader.biBitCount = sizeof( DWORD ) * 8; bi.bmiHeader.biCompression = BI_RGB; bi.bmiHeader.biPlanes = 1; bi.bmiHeader.biWidth = w; bi.bmiHeader.biHeight = -h; HDC dc = GetDC( GetConsoleWindow() ); bmp = CreateDIBSection( dc, &bi, DIB_RGB_COLORS, &pBits, NULL, 0 ); if( !bmp ) return false; hdc = CreateCompatibleDC( dc ); SelectObject( hdc, bmp ); ReleaseDC( GetConsoleWindow(), dc ); width = w; height = h; return true; } void setPenColor( DWORD clr ) { if( pen ) DeleteObject( pen ); pen = CreatePen( PS_SOLID, 1, clr ); SelectObject( hdc, pen ); } void saveBitmap( string path ) { BITMAPFILEHEADER fileheader; BITMAPINFO infoheader; BITMAP bitmap; DWORD* dwpBits; DWORD wb; HANDLE file; GetObject( bmp, sizeof( bitmap ), &bitmap ); dwpBits = new DWORD[bitmap.bmWidth * bitmap.bmHeight]; ZeroMemory( dwpBits, bitmap.bmWidth * bitmap.bmHeight * sizeof( DWORD ) ); ZeroMemory( &infoheader, sizeof( BITMAPINFO ) ); ZeroMemory( &fileheader, sizeof( BITMAPFILEHEADER ) ); infoheader.bmiHeader.biBitCount = sizeof( DWORD ) * 8; infoheader.bmiHeader.biCompression = BI_RGB; infoheader.bmiHeader.biPlanes = 1; infoheader.bmiHeader.biSize = sizeof( infoheader.bmiHeader ); infoheader.bmiHeader.biHeight = bitmap.bmHeight; infoheader.bmiHeader.biWidth = bitmap.bmWidth; infoheader.bmiHeader.biSizeImage = bitmap.bmWidth * bitmap.bmHeight * sizeof( DWORD ); fileheader.bfType = 0x4D42; fileheader.bfOffBits = sizeof( infoheader.bmiHeader ) + sizeof( BITMAPFILEHEADER ); fileheader.bfSize = fileheader.bfOffBits + infoheader.bmiHeader.biSizeImage; GetDIBits( hdc, bmp, 0, height, ( LPVOID )dwpBits, &infoheader, DIB_RGB_COLORS ); file = CreateFile( path.c_str(), GENERIC_WRITE, 0, NULL, CREATE_ALWAYS, FILE_ATTRIBUTE_NORMAL, NULL ); WriteFile( file, &fileheader, sizeof( BITMAPFILEHEADER ), &wb, NULL ); WriteFile( file, &infoheader.bmiHeader, sizeof( infoheader.bmiHeader ), &wb, NULL ); WriteFile( file, dwpBits, bitmap.bmWidth * bitmap.bmHeight * 4, &wb, NULL ); CloseHandle( file ); delete [] dwpBits; } HDC getDC() { return hdc; } int getWidth() { return width; } int getHeight() { return height; } private: HBITMAP bmp; HDC hdc; HPEN pen; int width, height; }; class vector2 { public: vector2() { x = y = 0; } vector2( int a, int b ) { x = a; y = b; } void set( int a, int b ) { x = a; y = b; } void rotate( float angle_r ) { float _x = static_cast<float>( x ), _y = static_cast<float>( y ), s = sinf( angle_r ), c = cosf( angle_r ), a = _x * c - _y * s, b = _x * s + _y * c; x = static_cast<int>( a ); y = static_cast<int>( b ); } int x, y; }; class fractalTree { public: fractalTree() { _ang = DegToRadian( 24.0f ); } float DegToRadian( float degree ) { return degree * ( PI / 180.0f ); } void create( myBitmap* bmp ) { _bmp = bmp; float line_len = 130.0f; vector2 sp( _bmp->getWidth() / 2, _bmp->getHeight() - 1 ); MoveToEx( _bmp->getDC(), sp.x, sp.y, NULL ); sp.y -= static_cast<int>( line_len ); LineTo( _bmp->getDC(), sp.x, sp.y); drawRL( &sp, line_len, 0, true ); drawRL( &sp, line_len, 0, false ); } private: void drawRL( vector2* sp, float line_len, float a, bool rg ) { line_len *= .75f; if( line_len < 2.0f ) return; MoveToEx( _bmp->getDC(), sp->x, sp->y, NULL ); vector2 r( 0, static_cast<int>( line_len ) ); if( rg ) a -= _ang; else a += _ang; r.rotate( a ); r.x += sp->x; r.y = sp->y - r.y; LineTo( _bmp->getDC(), r.x, r.y ); drawRL( &r, line_len, a, true ); drawRL( &r, line_len, a, false ); } myBitmap* _bmp; float _ang; }; int main( int argc, char* argv[] ) { ShowWindow( GetConsoleWindow(), SW_MAXIMIZE ); myBitmap bmp; bmp.create( 640, 512 ); bmp.setPenColor( RGB( 255, 255, 0 ) ); fractalTree tree; tree.create( &bmp ); BitBlt( GetDC( GetConsoleWindow() ), 0, 20, 648, 512, bmp.getDC(), 0, 0, SRCCOPY ); bmp.saveBitmap( "f: system( "pause" ); return 0; }
def setup(): size(600, 600) background(0) stroke(255) drawTree(300, 550, 9) def drawTree(x, y, depth): fork_ang = radians(20) base_len = 10 if depth > 0: pushMatrix() translate(x, y - baseLen * depth) line(0, baseLen * depth, 0, 0) rotate(fork_ang) drawTree(0, 0, depth - 1) rotate(2 * -fork_ang) drawTree(0, 0, depth - 1) popMatrix()
Port the provided C++ code into Python while preserving the original functionality.
#include <windows.h> class pinstripe { public: pinstripe() { createColors(); } void setDimensions( int x, int y ) { _mw = x; _mh = y; } void createColors() { colors[0] = 0; colors[1] = 255; colors[2] = RGB( 0, 255, 0 ); colors[3] = RGB( 0, 0, 255 ); colors[4] = RGB( 255, 0, 255 ); colors[5] = RGB( 0, 255, 255 ); colors[6] = RGB( 255, 255, 0 ); colors[7] = RGB( 255, 255, 255 ); } void draw( HDC dc ) { HPEN pen; int lh = _mh / 4, row, cp; for( int lw = 1; lw < 5; lw++ ) { cp = 0; row = ( lw - 1 ) * lh; for( int x = 0 + lw > 1 ? lw > 3 ? 2 : 1 : 0; x < _mw; x += lw ) { pen = CreatePen( PS_SOLID, lw, colors[cp] ); ++cp %= 8; SelectObject( dc, pen ); MoveToEx( dc, x, row, NULL ); LineTo( dc, x, row + lh ); DeleteObject( pen ); } } } private: int _mw, _mh; DWORD colors[8]; }; pinstripe pin; void PaintWnd( HWND hWnd ) { PAINTSTRUCT ps; HDC hdc = BeginPaint( hWnd, &ps ); pin.draw( hdc ); EndPaint( hWnd, &ps ); } LRESULT CALLBACK WndProc( HWND hWnd, UINT msg, WPARAM wParam, LPARAM lParam ) { switch( msg ) { case WM_DESTROY: PostQuitMessage( 0 ); break; case WM_PAINT: PaintWnd( hWnd ); break; default: return DefWindowProc( hWnd, msg, wParam, lParam ); } return 0; } HWND InitAll( HINSTANCE hInstance ) { WNDCLASSEX wcex; ZeroMemory( &wcex, sizeof( wcex ) ); wcex.cbSize = sizeof( WNDCLASSEX ); wcex.style = CS_HREDRAW | CS_VREDRAW; wcex.lpfnWndProc = WndProc; wcex.hInstance = hInstance; wcex.hCursor = LoadCursor( NULL, IDC_ARROW ); wcex.hbrBackground = ( HBRUSH )( COLOR_WINDOW + 1 ); wcex.lpszClassName = "_CLR_PS_"; RegisterClassEx( &wcex ); return CreateWindow( "_CLR_PS_", ".: Clr Pinstripe -- PJorente :.", WS_POPUP, CW_USEDEFAULT, 0, 200, 200, NULL, NULL, hInstance, NULL ); } int APIENTRY _tWinMain( HINSTANCE hInstance, HINSTANCE hPrevInstance, LPTSTR lpCmdLine, int nCmdShow ) { srand( GetTickCount() ); HWND hwnd = InitAll( hInstance ); if( !hwnd ) return -1; int mw = GetSystemMetrics( SM_CXSCREEN ), mh = GetSystemMetrics( SM_CYSCREEN ); pin.setDimensions( mw, mh ); RECT rc = { 0, 0, mw, mh }; AdjustWindowRectEx( &rc, WS_POPUP, FALSE, 0 ); int w = rc.right - rc.left, h = rc.bottom - rc.top; int posX = ( GetSystemMetrics( SM_CXSCREEN ) >> 1 ) - ( w >> 1 ), posY = ( GetSystemMetrics( SM_CYSCREEN ) >> 1 ) - ( h >> 1 ); SetWindowPos( hwnd, HWND_TOP, posX, posY, w, h, SWP_NOZORDER ); ShowWindow( hwnd, nCmdShow ); UpdateWindow( hwnd ); MSG msg; ZeroMemory( &msg, sizeof( msg ) ); while( msg.message != WM_QUIT ) { if( PeekMessage( &msg, NULL, 0, 0, PM_REMOVE ) != 0 ) { TranslateMessage( &msg ); DispatchMessage( &msg ); } } return UnregisterClass( "_CLR_PS_", hInstance ); }
from turtle import * colors = ["black", "red", "green", "blue", "magenta", "cyan", "yellow", "white"] screen = getscreen() left_edge = -screen.window_width()//2 right_edge = screen.window_width()//2 quarter_height = screen.window_height()//4 half_height = quarter_height * 2 speed("fastest") for quarter in range(4): pensize(quarter+1) colornum = 0 min_y = half_height - ((quarter + 1) * quarter_height) max_y = half_height - ((quarter) * quarter_height) for x in range(left_edge,right_edge,quarter+1): penup() pencolor(colors[colornum]) colornum = (colornum + 1) % len(colors) setposition(x,min_y) pendown() setposition(x,max_y) notused = input("Hit enter to continue: ")
Preserve the algorithm and functionality while converting the code from C++ to Python.
#include <iostream> #include <cstdint> struct Date { std::uint16_t year; std::uint8_t month; std::uint8_t day; }; constexpr bool leap(int year) { return year%4==0 && (year%100!=0 || year%400==0); } const std::string& weekday(const Date& date) { static const std::uint8_t leapdoom[] = {4,1,7,2,4,6,4,1,5,3,7,5}; static const std::uint8_t normdoom[] = {3,7,7,4,2,6,4,1,5,3,7,5}; static const std::string days[] = { "Sunday", "Monday", "Tuesday", "Wednesday", "Thursday", "Friday", "Saturday" }; unsigned const c = date.year/100, r = date.year%100; unsigned const s = r/12, t = r%12; unsigned const c_anchor = (5 * (c%4) + 2) % 7; unsigned const doom = (s + t + t/4 + c_anchor) % 7; unsigned const anchor = (leap(date.year) ? leapdoom : normdoom)[date.month-1]; return days[(doom+date.day-anchor+7)%7]; } int main(void) { const std::string months[] = {"", "January", "February", "March", "April", "May", "June", "July", "August", "September", "October", "November", "December" }; const Date dates[] = { {1800,1,6}, {1875,3,29}, {1915,12,7}, {1970,12,23}, {2043,5,14}, {2077,2,12}, {2101,4,2} }; for (const Date& d : dates) { std::cout << months[d.month] << " " << (int)d.day << ", " << d.year; std::cout << (d.year > 2021 ? " will be " : " was "); std::cout << "on a " << weekday(d) << std::endl; } return 0; }
from datetime import date from calendar import isleap def weekday(d): days = ["Sunday", "Monday", "Tuesday", "Wednesday", "Thursday", "Friday", "Saturday"] dooms = [ [3, 7, 7, 4, 2, 6, 4, 1, 5, 3, 7, 5], [4, 1, 7, 4, 2, 6, 4, 1, 5, 3, 7, 5] ] c = d.year // 100 r = d.year % 100 s = r // 12 t = r % 12 c_anchor = (5 * (c % 4) + 2) % 7 doomsday = (s + t + (t // 4) + c_anchor) % 7 anchorday = dooms[isleap(d.year)][d.month - 1] weekday = (doomsday + d.day - anchorday + 7) % 7 return days[weekday] dates = [date(*x) for x in [(1800, 1, 6), (1875, 3, 29), (1915, 12, 7), (1970, 12, 23), (2043, 5, 14), (2077, 2, 12), (2101, 4, 2)] ] for d in dates: tense = "was" if d < date.today() else "is" if d == date.today() else "will be" print("{} {} a {}".format(d.strftime("%B %d, %Y"), tense, weekday(d)))