Instruction
stringlengths
45
106
input_code
stringlengths
1
13.7k
output_code
stringlengths
1
13.7k
Keep all operations the same but rewrite the snippet in VB.
package turing type Symbol byte type Motion byte const ( Left Motion = 'L' Right Motion = 'R' Stay Motion = 'N' ) type Tape struct { data []Symbol pos, left int blank Symbol } func NewTape(blank Symbol, start int, data []Symbol) *Tape { t := &Tape{ data: data, blank: blank, } if start < 0 { t.Left(-start) } t.Right(start) return t } func (t *Tape) Stay() {} func (t *Tape) Data() []Symbol { return t.data[t.left:] } func (t *Tape) Read() Symbol { return t.data[t.pos] } func (t *Tape) Write(s Symbol) { t.data[t.pos] = s } func (t *Tape) Dup() *Tape { t2 := &Tape{ data: make([]Symbol, len(t.Data())), blank: t.blank, } copy(t2.data, t.Data()) t2.pos = t.pos - t.left return t2 } func (t *Tape) String() string { s := "" for i := t.left; i < len(t.data); i++ { b := t.data[i] if i == t.pos { s += "[" + string(b) + "]" } else { s += " " + string(b) + " " } } return s } func (t *Tape) Move(a Motion) { switch a { case Left: t.Left(1) case Right: t.Right(1) case Stay: t.Stay() } } const minSz = 16 func (t *Tape) Left(n int) { t.pos -= n if t.pos < 0 { var sz int for sz = minSz; cap(t.data[t.left:])-t.pos >= sz; sz <<= 1 { } newd := make([]Symbol, sz) newl := len(newd) - cap(t.data[t.left:]) n := copy(newd[newl:], t.data[t.left:]) t.data = newd[:newl+n] t.pos += newl - t.left t.left = newl } if t.pos < t.left { if t.blank != 0 { for i := t.pos; i < t.left; i++ { t.data[i] = t.blank } } t.left = t.pos } } func (t *Tape) Right(n int) { t.pos += n if t.pos >= cap(t.data) { var sz int for sz = minSz; t.pos >= sz; sz <<= 1 { } newd := make([]Symbol, sz) n := copy(newd[t.left:], t.data[t.left:]) t.data = newd[:t.left+n] } if i := len(t.data); t.pos >= i { t.data = t.data[:t.pos+1] if t.blank != 0 { for ; i < len(t.data); i++ { t.data[i] = t.blank } } } } type State string type Rule struct { State Symbol Write Symbol Motion Next State } func (i *Rule) key() key { return key{i.State, i.Symbol} } func (i *Rule) action() action { return action{i.Write, i.Motion, i.Next} } type key struct { State Symbol } type action struct { write Symbol Motion next State } type Machine struct { tape *Tape start, state State transition map[key]action l func(string, ...interface{}) } func NewMachine(rules []Rule) *Machine { m := &Machine{transition: make(map[key]action, len(rules))} if len(rules) > 0 { m.start = rules[0].State } for _, r := range rules { m.transition[r.key()] = r.action() } return m } func (m *Machine) Run(input *Tape) (int, *Tape) { m.tape = input.Dup() m.state = m.start for cnt := 0; ; cnt++ { if m.l != nil { m.l("%3d %4s: %v\n", cnt, m.state, m.tape) } sym := m.tape.Read() act, ok := m.transition[key{m.state, sym}] if !ok { return cnt, m.tape } m.tape.Write(act.write) m.tape.Move(act.Motion) m.state = act.next } }
Option Base 1 Public Enum sett name_ = 1 initState endState blank rules End Enum Public incrementer As Variant, threeStateBB As Variant, fiveStateBB As Variant Private Sub init() incrementer = Array("Simple incrementer", _ "q0", _ "qf", _ "B", _ Array( _ Array("q0", "1", "1", "right", "q0"), _ Array("q0", "B", "1", "stay", "qf"))) threeStateBB = Array("Three-state busy beaver", _ "a", _ "halt", _ "0", _ Array( _ Array("a", "0", "1", "right", "b"), _ Array("a", "1", "1", "left", "c"), _ Array("b", "0", "1", "left", "a"), _ Array("b", "1", "1", "right", "b"), _ Array("c", "0", "1", "left", "b"), _ Array("c", "1", "1", "stay", "halt"))) fiveStateBB = Array("Five-state busy beaver", _ "A", _ "H", _ "0", _ Array( _ Array("A", "0", "1", "right", "B"), _ Array("A", "1", "1", "left", "C"), _ Array("B", "0", "1", "right", "C"), _ Array("B", "1", "1", "right", "B"), _ Array("C", "0", "1", "right", "D"), _ Array("C", "1", "0", "left", "E"), _ Array("D", "0", "1", "left", "A"), _ Array("D", "1", "1", "left", "D"), _ Array("E", "0", "1", "stay", "H"), _ Array("E", "1", "0", "left", "A"))) End Sub Private Sub show(state As String, headpos As Long, tape As Collection) Debug.Print " "; state; String$(7 - Len(state), " "); "| "; For p = 1 To tape.Count Debug.Print IIf(p = headpos, "[" & tape(p) & "]", " " & tape(p) & " "); Next p Debug.Print End Sub Private Sub UTM(machine As Variant, tape As Collection, Optional countOnly As Long = 0) Dim state As String: state = machine(initState) Dim headpos As Long: headpos = 1 Dim counter As Long, rule As Variant Debug.Print machine(name_); vbCrLf; String$(Len(machine(name_)), "=") If Not countOnly Then Debug.Print " State | Tape [head]" & vbCrLf & "---------------------" Do While True If headpos > tape.Count Then tape.Add machine(blank) Else If headpos < 1 Then tape.Add machine(blank), Before:=1 headpos = 1 End If End If If Not countOnly Then show state, headpos, tape For i = LBound(machine(rules)) To UBound(machine(rules)) rule = machine(rules)(i) If rule(1) = state And rule(2) = tape(headpos) Then tape.Remove headpos If headpos > tape.Count Then tape.Add rule(3) Else tape.Add rule(3), Before:=headpos End If If rule(4) = "left" Then headpos = headpos - 1 If rule(4) = "right" Then headpos = headpos + 1 state = rule(5) Exit For End If Next i counter = counter + 1 If counter Mod 100000 = 0 Then Debug.Print counter DoEvents DoEvents End If If state = machine(endState) Then Exit Do Loop DoEvents If countOnly Then Debug.Print "Steps taken: ", counter Else show state, headpos, tape Debug.Print End If End Sub Public Sub main() init Dim tap As New Collection tap.Add "1": tap.Add "1": tap.Add "1" UTM incrementer, tap Set tap = New Collection UTM threeStateBB, tap Set tap = New Collection UTM fiveStateBB, tap, countOnly:=-1 End Sub
Write the same code in VB as shown below in Go.
package main import ( "fmt" "os" ) func createFile(fn string) { f, err := os.Create(fn) if err != nil { fmt.Println(err) return } fmt.Println("file", fn, "created!") f.Close() } func createDir(dn string) { err := os.Mkdir(dn, 0666) if err != nil { fmt.Println(err) return } fmt.Println("directory", dn, "created!") } func main() { createFile("input.txt") createFile("/input.txt") createDir("docs") createDir("/docs") }
Public Sub create_file() Dim FileNumber As Integer FileNumber = FreeFile MkDir "docs" Open "docs\output.txt" For Output As #FreeFile Close #FreeFile MkDir "C:\docs" Open "C:\docs\output.txt" For Output As #FreeFile Close #FreeFile End Sub
Translate the given Go code snippet into VB without altering its behavior.
package main import ( "fmt" "os" ) func createFile(fn string) { f, err := os.Create(fn) if err != nil { fmt.Println(err) return } fmt.Println("file", fn, "created!") f.Close() } func createDir(dn string) { err := os.Mkdir(dn, 0666) if err != nil { fmt.Println(err) return } fmt.Println("directory", dn, "created!") } func main() { createFile("input.txt") createFile("/input.txt") createDir("docs") createDir("/docs") }
Public Sub create_file() Dim FileNumber As Integer FileNumber = FreeFile MkDir "docs" Open "docs\output.txt" For Output As #FreeFile Close #FreeFile MkDir "C:\docs" Open "C:\docs\output.txt" For Output As #FreeFile Close #FreeFile End Sub
Produce a functionally identical VB code for the snippet given in Go.
package main import ( "fmt" "sort" ) func main() { dna := "" + "CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATG" + "CTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTG" + "AGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGAT" + "GGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT" + "CGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGG" + "TCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA" + "TTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTAT" + "CGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTG" + "TCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGAC" + "GACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT" fmt.Println("SEQUENCE:") le := len(dna) for i := 0; i < le; i += 50 { k := i + 50 if k > le { k = le } fmt.Printf("%5d: %s\n", i, dna[i:k]) } baseMap := make(map[byte]int) for i := 0; i < le; i++ { baseMap[dna[i]]++ } var bases []byte for k := range baseMap { bases = append(bases, k) } sort.Slice(bases, func(i, j int) bool { return bases[i] < bases[j] }) fmt.Println("\nBASE COUNT:") for _, base := range bases { fmt.Printf(" %c: %3d\n", base, baseMap[base]) } fmt.Println(" ------") fmt.Println(" Σ:", le) fmt.Println(" ======") }
b=_ "CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATG" &_ "CTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTG" &_ "AGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGAT" &_ "GGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT" &_ "CGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGG" &_ "TCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA" &_ "TTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTAT" &_ "CGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTG" &_ "TCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGAC" &_ "GACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT" s="SEQUENCE:" acnt=0:ccnt=0:gcnt=0:tcnt=0 for i=0 to len(b)-1 if (i mod 30)=0 then s = s & vbcrlf & right(" "& i+1,3)&": " if (i mod 5)=0 then s=s& " " m=mid(b,i+1,1) s=s & m select case m case "A":acnt=acnt+1 case "C":ccnt=ccnt+1 case "G":gcnt=gcnt+1 case "T":tcnt=tcnt+1 case else wscript.echo "error at ",i+1, m end select next wscript.echo s & vbcrlf wscript.echo "Count: A="&acnt & " C=" & ccnt & " G=" & gcnt & " T=" & tcnt
Convert this Go snippet to VB and keep its semantics consistent.
package main import ( "fmt" "sort" ) func main() { dna := "" + "CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATG" + "CTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTG" + "AGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGAT" + "GGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT" + "CGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGG" + "TCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA" + "TTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTAT" + "CGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTG" + "TCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGAC" + "GACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT" fmt.Println("SEQUENCE:") le := len(dna) for i := 0; i < le; i += 50 { k := i + 50 if k > le { k = le } fmt.Printf("%5d: %s\n", i, dna[i:k]) } baseMap := make(map[byte]int) for i := 0; i < le; i++ { baseMap[dna[i]]++ } var bases []byte for k := range baseMap { bases = append(bases, k) } sort.Slice(bases, func(i, j int) bool { return bases[i] < bases[j] }) fmt.Println("\nBASE COUNT:") for _, base := range bases { fmt.Printf(" %c: %3d\n", base, baseMap[base]) } fmt.Println(" ------") fmt.Println(" Σ:", le) fmt.Println(" ======") }
b=_ "CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATG" &_ "CTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTG" &_ "AGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGAT" &_ "GGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT" &_ "CGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGG" &_ "TCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA" &_ "TTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTAT" &_ "CGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTG" &_ "TCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGAC" &_ "GACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT" s="SEQUENCE:" acnt=0:ccnt=0:gcnt=0:tcnt=0 for i=0 to len(b)-1 if (i mod 30)=0 then s = s & vbcrlf & right(" "& i+1,3)&": " if (i mod 5)=0 then s=s& " " m=mid(b,i+1,1) s=s & m select case m case "A":acnt=acnt+1 case "C":ccnt=ccnt+1 case "G":gcnt=gcnt+1 case "T":tcnt=tcnt+1 case else wscript.echo "error at ",i+1, m end select next wscript.echo s & vbcrlf wscript.echo "Count: A="&acnt & " C=" & ccnt & " G=" & gcnt & " T=" & tcnt
Convert the following code from Go to VB, ensuring the logic remains intact.
package main import ( "hash/fnv" "log" "math/rand" "os" "time" ) var ph = []string{"Aristotle", "Kant", "Spinoza", "Marx", "Russell"} const hunger = 3 const think = time.Second / 100 const eat = time.Second / 100 var fmt = log.New(os.Stdout, "", 0) var done = make(chan bool) type fork byte func philosopher(phName string, dominantHand, otherHand chan fork, done chan bool) { fmt.Println(phName, "seated") h := fnv.New64a() h.Write([]byte(phName)) rg := rand.New(rand.NewSource(int64(h.Sum64()))) rSleep := func(t time.Duration) { time.Sleep(t/2 + time.Duration(rg.Int63n(int64(t)))) } for h := hunger; h > 0; h-- { fmt.Println(phName, "hungry") <-dominantHand <-otherHand fmt.Println(phName, "eating") rSleep(eat) dominantHand <- 'f' otherHand <- 'f' fmt.Println(phName, "thinking") rSleep(think) } fmt.Println(phName, "satisfied") done <- true fmt.Println(phName, "left the table") } func main() { fmt.Println("table empty") place0 := make(chan fork, 1) place0 <- 'f' placeLeft := place0 for i := 1; i < len(ph); i++ { placeRight := make(chan fork, 1) placeRight <- 'f' go philosopher(ph[i], placeLeft, placeRight, done) placeLeft = placeRight } go philosopher(ph[0], place0, placeLeft, done) for range ph { <-done } fmt.Println("table empty") }
Public Const HOLDON = False Public Const DIJKSTRASOLUTION = True Public Const X = 10 Public Const GETS = 0 Public Const PUTS = 1 Public Const EATS = 2 Public Const THKS = 5 Public Const FRSTFORK = 0 Public Const SCNDFORK = 1 Public Const SPAGHETI = 0 Public Const UNIVERSE = 1 Public Const MAXCOUNT = 100000 Public Const PHILOSOPHERS = 5 Public semaphore(PHILOSOPHERS - 1) As Integer Public positi0n(1, PHILOSOPHERS - 1) As Integer Public programcounter(PHILOSOPHERS - 1) As Long Public statistics(PHILOSOPHERS - 1, 5, 1) As Long Public names As Variant Private Sub init() names = [{"Aquinas","Babbage","Carroll","Derrida","Erasmus"}] For j = 0 To PHILOSOPHERS - 2 positi0n(0, j) = j + 1 positi0n(1, j) = j Next j If DIJKSTRASOLUTION Then positi0n(0, PHILOSOPHERS - 1) = j positi0n(1, PHILOSOPHERS - 1) = 0 Else positi0n(0, PHILOSOPHERS - 1) = 0 positi0n(1, PHILOSOPHERS - 1) = j End If End Sub Private Sub philosopher(subject As Integer, verb As Integer, objekt As Integer) statistics(subject, verb, objekt) = statistics(subject, verb, objekt) + 1 If verb < 2 Then If semaphore(positi0n(objekt, subject)) <> verb Then If Not HOLDON Then semaphore(positi0n(FRSTFORK, subject)) = 1 - objekt programcounter(subject) = 0 End If Else semaphore(positi0n(objekt, subject)) = 1 - verb programcounter(subject) = (programcounter(subject) + 1) Mod 6 End If Else programcounter(subject) = IIf(X * Rnd > 1, verb, verb + 1) Mod 6 End If End Sub Private Sub dine() Dim ph As Integer Do While TC < MAXCOUNT For ph = 0 To PHILOSOPHERS - 1 Select Case programcounter(ph) Case 0: philosopher ph, GETS, FRSTFORK Case 1: philosopher ph, GETS, SCNDFORK Case 2: philosopher ph, EATS, SPAGHETI Case 3: philosopher ph, PUTS, FRSTFORK Case 4: philosopher ph, PUTS, SCNDFORK Case 5: philosopher ph, THKS, UNIVERSE End Select TC = TC + 1 Next ph Loop End Sub Private Sub show() Debug.Print "Stats", "Gets", "Gets", "Eats", "Puts", "Puts", "Thinks" Debug.Print "", "First", "Second", "Spag-", "First", "Second", "About" Debug.Print "", "Fork", "Fork", "hetti", "Fork", "Fork", "Universe" For subject = 0 To PHILOSOPHERS - 1 Debug.Print names(subject + 1), For objekt = 0 To 1 Debug.Print statistics(subject, GETS, objekt), Next objekt Debug.Print statistics(subject, EATS, SPAGHETI), For objekt = 0 To 1 Debug.Print statistics(subject, PUTS, objekt), Next objekt Debug.Print statistics(subject, THKS, UNIVERSE) Next subject End Sub Public Sub main() init dine show End Sub
Rewrite the snippet below in VB so it works the same as the original Go code.
package main import ( "fmt" "strconv" ) func main() { var fact [12]uint64 fact[0] = 1 for n := uint64(1); n < 12; n++ { fact[n] = fact[n-1] * n } for b := 9; b <= 12; b++ { fmt.Printf("The factorions for base %d are:\n", b) for i := uint64(1); i < 1500000; i++ { digits := strconv.FormatUint(i, b) sum := uint64(0) for _, digit := range digits { if digit < 'a' { sum += fact[digit-'0'] } else { sum += fact[digit+10-'a'] } } if sum == i { fmt.Printf("%d ", i) } } fmt.Println("\n") } }
Dim fact() nn1=9 : nn2=12 lim=1499999 ReDim fact(nn2) fact(0)=1 For i=1 To nn2 fact(i)=fact(i-1)*i Next For base=nn1 To nn2 list="" For i=1 To lim s=0 t=i Do While t<>0 d=t Mod base s=s+fact(d) t=t\base Loop If s=i Then list=list &" "& i Next Wscript.Echo "the factorions for base "& right(" "& base,2) &" are: "& list Next
Generate an equivalent VB version of this Go code.
package main import ( "fmt" "strconv" ) func main() { var fact [12]uint64 fact[0] = 1 for n := uint64(1); n < 12; n++ { fact[n] = fact[n-1] * n } for b := 9; b <= 12; b++ { fmt.Printf("The factorions for base %d are:\n", b) for i := uint64(1); i < 1500000; i++ { digits := strconv.FormatUint(i, b) sum := uint64(0) for _, digit := range digits { if digit < 'a' { sum += fact[digit-'0'] } else { sum += fact[digit+10-'a'] } } if sum == i { fmt.Printf("%d ", i) } } fmt.Println("\n") } }
Dim fact() nn1=9 : nn2=12 lim=1499999 ReDim fact(nn2) fact(0)=1 For i=1 To nn2 fact(i)=fact(i-1)*i Next For base=nn1 To nn2 list="" For i=1 To lim s=0 t=i Do While t<>0 d=t Mod base s=s+fact(d) t=t\base Loop If s=i Then list=list &" "& i Next Wscript.Echo "the factorions for base "& right(" "& base,2) &" are: "& list Next
Convert this Go block to VB, preserving its control flow and logic.
package main import ( "fmt" "strings" ) var table = "Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy " + "COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find " + "NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput " + "Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO " + "MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT " + "READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT " + "RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up " func validate(commands, words []string, minLens []int) []string { results := make([]string, 0) if len(words) == 0 { return results } for _, word := range words { matchFound := false wlen := len(word) for i, command := range commands { if minLens[i] == 0 || wlen < minLens[i] || wlen > len(command) { continue } c := strings.ToUpper(command) w := strings.ToUpper(word) if strings.HasPrefix(c, w) { results = append(results, c) matchFound = true break } } if !matchFound { results = append(results, "*error*") } } return results } func main() { table = strings.TrimSpace(table) commands := strings.Fields(table) clen := len(commands) minLens := make([]int, clen) for i := 0; i < clen; i++ { count := 0 for _, c := range commands[i] { if c >= 'A' && c <= 'Z' { count++ } } minLens[i] = count } sentence := "riG rePEAT copies put mo rest types fup. 6 poweRin" words := strings.Fields(sentence) results := validate(commands, words, minLens) fmt.Print("user words: ") for j := 0; j < len(words); j++ { fmt.Printf("%-*s ", len(results[j]), words[j]) } fmt.Print("\nfull words: ") fmt.Println(strings.Join(results, " ")) }
Private Function ValidateUserWords(userstring As String) As String Dim s As String Dim user_words() As String Dim command_table As Scripting.Dictionary Set command_table = New Scripting.Dictionary Dim abbreviations As Scripting.Dictionary Set abbreviations = New Scripting.Dictionary abbreviations.CompareMode = TextCompare Dim commandtable() As String Dim commands As String s = s & "Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy " s = s & "COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find " s = s & "NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput " s = s & "Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO " s = s & "MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT " s = s & "READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT " s = s & "RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up " commandtable = Split(s, " ") Dim i As Integer For Each word In commandtable If Len(word) > 0 Then i = 1 Do While Mid(word, i, 1) >= "A" And Mid(word, i, 1) <= "Z" i = i + 1 Loop command_table.Add Key:=word, Item:=i - 1 End If Next word For Each word In command_table For i = command_table(word) To Len(word) On Error Resume Next abbreviations.Add Key:=Left(word, i), Item:=UCase(word) Next i Next word user_words() = Split(userstring, " ") For Each word In user_words If Len(word) > 0 Then If abbreviations.exists(word) Then commands = commands & abbreviations(word) & " " Else commands = commands & "*error* " End If End If Next word ValidateUserWords = commands End Function Public Sub program() Dim guserstring As String guserstring = "riG rePEAT copies put mo rest types fup. 6 poweRin" Debug.Print "user words:", guserstring Debug.Print "full words:", ValidateUserWords(guserstring) End Sub
Maintain the same structure and functionality when rewriting this code in VB.
package main import ( "fmt" "strings" ) var table = "Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy " + "COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find " + "NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput " + "Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO " + "MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT " + "READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT " + "RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up " func validate(commands, words []string, minLens []int) []string { results := make([]string, 0) if len(words) == 0 { return results } for _, word := range words { matchFound := false wlen := len(word) for i, command := range commands { if minLens[i] == 0 || wlen < minLens[i] || wlen > len(command) { continue } c := strings.ToUpper(command) w := strings.ToUpper(word) if strings.HasPrefix(c, w) { results = append(results, c) matchFound = true break } } if !matchFound { results = append(results, "*error*") } } return results } func main() { table = strings.TrimSpace(table) commands := strings.Fields(table) clen := len(commands) minLens := make([]int, clen) for i := 0; i < clen; i++ { count := 0 for _, c := range commands[i] { if c >= 'A' && c <= 'Z' { count++ } } minLens[i] = count } sentence := "riG rePEAT copies put mo rest types fup. 6 poweRin" words := strings.Fields(sentence) results := validate(commands, words, minLens) fmt.Print("user words: ") for j := 0; j < len(words); j++ { fmt.Printf("%-*s ", len(results[j]), words[j]) } fmt.Print("\nfull words: ") fmt.Println(strings.Join(results, " ")) }
Private Function ValidateUserWords(userstring As String) As String Dim s As String Dim user_words() As String Dim command_table As Scripting.Dictionary Set command_table = New Scripting.Dictionary Dim abbreviations As Scripting.Dictionary Set abbreviations = New Scripting.Dictionary abbreviations.CompareMode = TextCompare Dim commandtable() As String Dim commands As String s = s & "Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy " s = s & "COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find " s = s & "NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput " s = s & "Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO " s = s & "MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT " s = s & "READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT " s = s & "RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up " commandtable = Split(s, " ") Dim i As Integer For Each word In commandtable If Len(word) > 0 Then i = 1 Do While Mid(word, i, 1) >= "A" And Mid(word, i, 1) <= "Z" i = i + 1 Loop command_table.Add Key:=word, Item:=i - 1 End If Next word For Each word In command_table For i = command_table(word) To Len(word) On Error Resume Next abbreviations.Add Key:=Left(word, i), Item:=UCase(word) Next i Next word user_words() = Split(userstring, " ") For Each word In user_words If Len(word) > 0 Then If abbreviations.exists(word) Then commands = commands & abbreviations(word) & " " Else commands = commands & "*error* " End If End If Next word ValidateUserWords = commands End Function Public Sub program() Dim guserstring As String guserstring = "riG rePEAT copies put mo rest types fup. 6 poweRin" Debug.Print "user words:", guserstring Debug.Print "full words:", ValidateUserWords(guserstring) End Sub
Change the following Go code into VB without altering its purpose.
package main import( "fmt" "strings" ) var codes = map[rune]string { 'a' : "AAAAA", 'b' : "AAAAB", 'c' : "AAABA", 'd' : "AAABB", 'e' : "AABAA", 'f' : "AABAB", 'g' : "AABBA", 'h' : "AABBB", 'i' : "ABAAA", 'j' : "ABAAB", 'k' : "ABABA", 'l' : "ABABB", 'm' : "ABBAA", 'n' : "ABBAB", 'o' : "ABBBA", 'p' : "ABBBB", 'q' : "BAAAA", 'r' : "BAAAB", 's' : "BAABA", 't' : "BAABB", 'u' : "BABAA", 'v' : "BABAB", 'w' : "BABBA", 'x' : "BABBB", 'y' : "BBAAA", 'z' : "BBAAB", ' ' : "BBBAA", } func baconEncode(plainText string, message string) string { pt := strings.ToLower(plainText) var sb []byte for _, c := range pt { if c >= 'a' && c <= 'z' { sb = append(sb, codes[c]...) } else { sb = append(sb, codes[' ']...) } } et := string(sb) mg := strings.ToLower(message) sb = nil var count = 0 for _, c := range mg { if c >= 'a' && c <= 'z' { if et[count] == 'A' { sb = append(sb, byte(c)) } else { sb = append(sb, byte(c - 32)) } count++ if count == len(et) { break } } else { sb = append(sb, byte(c)) } } return string(sb) } func baconDecode(message string) string { var sb []byte for _, c := range message { if c >= 'a' && c <= 'z' { sb = append(sb, 'A') } else if c >= 'A' && c <= 'Z' { sb = append(sb, 'B') } } et := string(sb) sb = nil for i := 0; i < len(et); i += 5 { quintet := et[i : i + 5] for k, v := range codes { if v == quintet { sb = append(sb, byte(k)) break } } } return string(sb) } func main() { plainText := "the quick brown fox jumps over the lazy dog" message := "bacon's cipher is a method of steganography created by francis bacon." + "this task is to implement a program for encryption and decryption of " + "plaintext using the simple alphabet of the baconian cipher or some " + "other kind of representation of this alphabet (make anything signify anything). " + "the baconian alphabet may optionally be extended to encode all lower " + "case characters individually and/or adding a few punctuation characters " + "such as the space." cipherText := baconEncode(plainText, message) fmt.Printf("Cipher text ->\n\n%s\n", cipherText) decodedText := baconDecode(cipherText) fmt.Printf("\nHidden text ->\n\n%s\n", decodedText) }
Imports System.Text Module Module1 ReadOnly CODES As New Dictionary(Of Char, String) From { {"a", "AAAAA"}, {"b", "AAAAB"}, {"c", "AAABA"}, {"d", "AAABB"}, {"e", "AABAA"}, {"f", "AABAB"}, {"g", "AABBA"}, {"h", "AABBB"}, {"i", "ABAAA"}, {"j", "ABAAB"}, {"k", "ABABA"}, {"l", "ABABB"}, {"m", "ABBAA"}, {"n", "ABBAB"}, {"o", "ABBBA"}, {"p", "ABBBB"}, {"q", "BAAAA"}, {"r", "BAAAB"}, {"s", "BAABA"}, {"t", "BAABB"}, {"u", "BABAA"}, {"v", "BABAB"}, {"w", "BABBA"}, {"x", "BABBB"}, {"y", "BBAAA"}, {"z", "BBAAB"}, {" ", "BBBAA"} } Function Encode(plainText As String, message As String) As String Dim pt = plainText.ToLower() Dim sb As New StringBuilder() For Each c In pt If "a" <= c AndAlso c <= "z" Then sb.Append(CODES(c)) Else sb.Append(CODES(" ")) End If Next Dim et = sb.ToString() Dim mg = message.ToLower() sb.Length = 0 Dim count = 0 For Each c In mg If "a" <= c AndAlso c <= "z" Then If et(count) = "A" Then sb.Append(c) Else sb.Append(Chr(Asc(c) - 32)) End If count += 1 If count = et.Length Then Exit For End If Else sb.Append(c) End If Next Return sb.ToString() End Function Function Decode(message As String) As String Dim sb As New StringBuilder For Each c In message If "a" <= c AndAlso c <= "z" Then sb.Append("A") ElseIf "A" <= c AndAlso c <= "Z" Then sb.Append("B") End If Next Dim et = sb.ToString() sb.Length = 0 For index = 0 To et.Length - 1 Step 5 Dim quintet = et.Substring(index, 5) Dim key = CODES.Where(Function(a) a.Value = quintet).First().Key sb.Append(key) Next Return sb.ToString() End Function Sub Main() Dim plainText = "the quick brown fox jumps over the lazy dog" Dim message = "bacon "this task is to implement a program for encryption and decryption of " + "plaintext using the simple alphabet of the baconian cipher or some " + "other kind of representation of this alphabet (make anything signify anything). " + "the baconian alphabet may optionally be extended to encode all lower " + "case characters individually and/or adding a few punctuation characters " + "such as the space." Dim cipherText = Encode(plainText, message) Console.WriteLine("Cipher text ->" & Environment.NewLine & "{0}", cipherText) Dim decodedText = Decode(cipherText) Console.WriteLine(Environment.NewLine & "Hidden text ->" & Environment.NewLine & "{0}", decodedText) End Sub End Module
Convert the following code from Go to VB, ensuring the logic remains intact.
package main import( "fmt" "strings" ) var codes = map[rune]string { 'a' : "AAAAA", 'b' : "AAAAB", 'c' : "AAABA", 'd' : "AAABB", 'e' : "AABAA", 'f' : "AABAB", 'g' : "AABBA", 'h' : "AABBB", 'i' : "ABAAA", 'j' : "ABAAB", 'k' : "ABABA", 'l' : "ABABB", 'm' : "ABBAA", 'n' : "ABBAB", 'o' : "ABBBA", 'p' : "ABBBB", 'q' : "BAAAA", 'r' : "BAAAB", 's' : "BAABA", 't' : "BAABB", 'u' : "BABAA", 'v' : "BABAB", 'w' : "BABBA", 'x' : "BABBB", 'y' : "BBAAA", 'z' : "BBAAB", ' ' : "BBBAA", } func baconEncode(plainText string, message string) string { pt := strings.ToLower(plainText) var sb []byte for _, c := range pt { if c >= 'a' && c <= 'z' { sb = append(sb, codes[c]...) } else { sb = append(sb, codes[' ']...) } } et := string(sb) mg := strings.ToLower(message) sb = nil var count = 0 for _, c := range mg { if c >= 'a' && c <= 'z' { if et[count] == 'A' { sb = append(sb, byte(c)) } else { sb = append(sb, byte(c - 32)) } count++ if count == len(et) { break } } else { sb = append(sb, byte(c)) } } return string(sb) } func baconDecode(message string) string { var sb []byte for _, c := range message { if c >= 'a' && c <= 'z' { sb = append(sb, 'A') } else if c >= 'A' && c <= 'Z' { sb = append(sb, 'B') } } et := string(sb) sb = nil for i := 0; i < len(et); i += 5 { quintet := et[i : i + 5] for k, v := range codes { if v == quintet { sb = append(sb, byte(k)) break } } } return string(sb) } func main() { plainText := "the quick brown fox jumps over the lazy dog" message := "bacon's cipher is a method of steganography created by francis bacon." + "this task is to implement a program for encryption and decryption of " + "plaintext using the simple alphabet of the baconian cipher or some " + "other kind of representation of this alphabet (make anything signify anything). " + "the baconian alphabet may optionally be extended to encode all lower " + "case characters individually and/or adding a few punctuation characters " + "such as the space." cipherText := baconEncode(plainText, message) fmt.Printf("Cipher text ->\n\n%s\n", cipherText) decodedText := baconDecode(cipherText) fmt.Printf("\nHidden text ->\n\n%s\n", decodedText) }
Imports System.Text Module Module1 ReadOnly CODES As New Dictionary(Of Char, String) From { {"a", "AAAAA"}, {"b", "AAAAB"}, {"c", "AAABA"}, {"d", "AAABB"}, {"e", "AABAA"}, {"f", "AABAB"}, {"g", "AABBA"}, {"h", "AABBB"}, {"i", "ABAAA"}, {"j", "ABAAB"}, {"k", "ABABA"}, {"l", "ABABB"}, {"m", "ABBAA"}, {"n", "ABBAB"}, {"o", "ABBBA"}, {"p", "ABBBB"}, {"q", "BAAAA"}, {"r", "BAAAB"}, {"s", "BAABA"}, {"t", "BAABB"}, {"u", "BABAA"}, {"v", "BABAB"}, {"w", "BABBA"}, {"x", "BABBB"}, {"y", "BBAAA"}, {"z", "BBAAB"}, {" ", "BBBAA"} } Function Encode(plainText As String, message As String) As String Dim pt = plainText.ToLower() Dim sb As New StringBuilder() For Each c In pt If "a" <= c AndAlso c <= "z" Then sb.Append(CODES(c)) Else sb.Append(CODES(" ")) End If Next Dim et = sb.ToString() Dim mg = message.ToLower() sb.Length = 0 Dim count = 0 For Each c In mg If "a" <= c AndAlso c <= "z" Then If et(count) = "A" Then sb.Append(c) Else sb.Append(Chr(Asc(c) - 32)) End If count += 1 If count = et.Length Then Exit For End If Else sb.Append(c) End If Next Return sb.ToString() End Function Function Decode(message As String) As String Dim sb As New StringBuilder For Each c In message If "a" <= c AndAlso c <= "z" Then sb.Append("A") ElseIf "A" <= c AndAlso c <= "Z" Then sb.Append("B") End If Next Dim et = sb.ToString() sb.Length = 0 For index = 0 To et.Length - 1 Step 5 Dim quintet = et.Substring(index, 5) Dim key = CODES.Where(Function(a) a.Value = quintet).First().Key sb.Append(key) Next Return sb.ToString() End Function Sub Main() Dim plainText = "the quick brown fox jumps over the lazy dog" Dim message = "bacon "this task is to implement a program for encryption and decryption of " + "plaintext using the simple alphabet of the baconian cipher or some " + "other kind of representation of this alphabet (make anything signify anything). " + "the baconian alphabet may optionally be extended to encode all lower " + "case characters individually and/or adding a few punctuation characters " + "such as the space." Dim cipherText = Encode(plainText, message) Console.WriteLine("Cipher text ->" & Environment.NewLine & "{0}", cipherText) Dim decodedText = Decode(cipherText) Console.WriteLine(Environment.NewLine & "Hidden text ->" & Environment.NewLine & "{0}", decodedText) End Sub End Module
Generate a VB translation of this Go snippet without changing its computational steps.
package main import ( "fmt" "strconv" ) var n = 5 func main() { if n < 1 { return } top, left, bottom, right := 0, 0, n-1, n-1 sz := n * n a := make([]int, sz) i := 0 for left < right { for c := left; c <= right; c++ { a[top*n+c] = i i++ } top++ for r := top; r <= bottom; r++ { a[r*n+right] = i i++ } right-- if top == bottom { break } for c := right; c >= left; c-- { a[bottom*n+c] = i i++ } bottom-- for r := bottom; r >= top; r-- { a[r*n+left] = i i++ } left++ } a[top*n+left] = i w := len(strconv.Itoa(n*n - 1)) for i, e := range a { fmt.Printf("%*d ", w, e) if i%n == n-1 { fmt.Println("") } } }
Function build_spiral(n) botcol = 0 : topcol = n - 1 botrow = 0 : toprow = n - 1 Dim matrix() ReDim matrix(topcol,toprow) dir = 0 : col = 0 : row = 0 For i = 0 To n*n-1 matrix(col,row) = i Select Case dir Case 0 If col < topcol Then col = col + 1 Else dir = 1 : row = row + 1 : botrow = botrow + 1 End If Case 1 If row < toprow Then row = row + 1 Else dir = 2 : col = col - 1 : topcol = topcol - 1 End If Case 2 If col > botcol Then col = col - 1 Else dir = 3 : row = row - 1 : toprow = toprow - 1 End If Case 3 If row > botrow Then row = row - 1 Else dir = 0 : col = col + 1 : botcol = botcol + 1 End If End Select Next For y = 0 To n-1 For x = 0 To n-1 WScript.StdOut.Write matrix(x,y) & vbTab Next WScript.StdOut.WriteLine Next End Function build_spiral(CInt(WScript.Arguments(0)))
Translate this program into VB but keep the logic exactly as in Go.
type cell string type spec struct { less func(cell, cell) bool column int reverse bool } func newSpec() (s spec) { return } t.sort(newSpec()) s := newSpec s.reverse = true t.sort(s)
Private Sub optional_parameters(theRange As String, _ Optional ordering As Integer = 0, _ Optional column As Integer = 1, _ Optional reverse As Integer = 1) ActiveSheet.Sort.SortFields.Clear ActiveSheet.Sort.SortFields.Add _ Key:=Range(theRange).Columns(column), _ SortOn:=SortOnValues, _ Order:=reverse, _ DataOption:=ordering With ActiveSheet.Sort .SetRange Range(theRange) .Header = xlGuess .MatchCase = False .Orientation = xlTopToBottom .SortMethod = xlPinYin .Apply End With End Sub Public Sub main() optional_parameters theRange:="A1:C4", ordering:=1, column:=2, reverse:=1 End Sub
Port the following code from Go to VB with equivalent syntax and logic.
package main import "C" import ( "fmt" "unsafe" ) func main() { go1 := "hello C" c1 := C.CString(go1) go1 = "" c2 := C.strdup(c1) C.free(unsafe.Pointer(c1)) go2 := C.GoString(c2) C.free(unsafe.Pointer(c2)) fmt.Println(go2) }
Declare Function CreateFileW Lib "Kernel32" (FileName As WString, DesiredAccess As Integer, ShareMode As Integer, SecurityAttributes As Integer, _ CreateDisposition As Integer, Flags As Integer, Template As Integer) As Integer Declare Function WriteFile Lib "Kernel32" (fHandle As Integer, writeData As Ptr, numOfBytes As Integer, ByRef numOfBytesWritten As Integer, _ overlapped As Ptr) As Boolean Declare Function GetLastError Lib "Kernel32" () As Integer Declare Function CloseHandle Lib "kernel32" (hObject As Integer) As Boolean Const FILE_SHARE_READ = &h00000001 Const FILE_SHARE_WRITE = &h00000002 Const OPEN_EXISTING = 3 Dim fHandle As Integer = CreateFileW("C:\foo.txt", 0, FILE_SHARE_READ Or FILE_SHARE_WRITE, 0, OPEN_EXISTING, 0, 0) If fHandle > 0 Then Dim mb As MemoryBlock = "Hello, World!" Dim bytesWritten As Integer If Not WriteFile(fHandle, mb, mb.Size, bytesWritten, Nil) Then MsgBox("Error Number: " + Str(GetLastError)) End If Call CloseHandle(fHandle) Else MsgBox("Error Number: " + Str(GetLastError)) End If
Write a version of this Go function in VB with identical behavior.
package main import ( "fmt" "math/big" ) func bernoulli(n uint) *big.Rat { a := make([]big.Rat, n+1) z := new(big.Rat) for m := range a { a[m].SetFrac64(1, int64(m+1)) for j := m; j >= 1; j-- { d := &a[j-1] d.Mul(z.SetInt64(int64(j)), d.Sub(d, &a[j])) } } if n != 1 { return &a[0] } a[0].Neg(&a[0]) return &a[0] } func binomial(n, k int) int64 { if n <= 0 || k <= 0 || n < k { return 1 } var num, den int64 = 1, 1 for i := k + 1; i <= n; i++ { num *= int64(i) } for i := 2; i <= n-k; i++ { den *= int64(i) } return num / den } func faulhaberTriangle(p int) []big.Rat { coeffs := make([]big.Rat, p+1) q := big.NewRat(1, int64(p)+1) t := new(big.Rat) u := new(big.Rat) sign := -1 for j := range coeffs { sign *= -1 d := &coeffs[p-j] t.SetInt64(int64(sign)) u.SetInt64(binomial(p+1, j)) d.Mul(q, t) d.Mul(d, u) d.Mul(d, bernoulli(uint(j))) } return coeffs } func main() { for i := 0; i < 10; i++ { coeffs := faulhaberTriangle(i) for _, coeff := range coeffs { fmt.Printf("%5s ", coeff.RatString()) } fmt.Println() } fmt.Println() k := 17 cc := faulhaberTriangle(k) n := int64(1000) nn := big.NewRat(n, 1) np := big.NewRat(1, 1) sum := new(big.Rat) tmp := new(big.Rat) for _, c := range cc { np.Mul(np, nn) tmp.Set(np) tmp.Mul(tmp, &c) sum.Add(sum, tmp) } fmt.Println(sum.RatString()) }
Module Module1 Class Frac Private ReadOnly num As Long Private ReadOnly denom As Long Public Shared ReadOnly ZERO = New Frac(0, 1) Public Shared ReadOnly ONE = New Frac(1, 1) Public Sub New(n As Long, d As Long) If d = 0 Then Throw New ArgumentException("d must not be zero") End If Dim nn = n Dim dd = d If nn = 0 Then dd = 1 ElseIf dd < 0 Then nn = -nn dd = -dd End If Dim g = Math.Abs(Gcd(nn, dd)) If g > 1 Then nn /= g dd /= g End If num = nn denom = dd End Sub Private Shared Function Gcd(a As Long, b As Long) As Long If b = 0 Then Return a Else Return Gcd(b, a Mod b) End If End Function Public Shared Operator -(self As Frac) As Frac Return New Frac(-self.num, self.denom) End Operator Public Shared Operator +(lhs As Frac, rhs As Frac) As Frac Return New Frac(lhs.num * rhs.denom + lhs.denom * rhs.num, rhs.denom * lhs.denom) End Operator Public Shared Operator -(lhs As Frac, rhs As Frac) As Frac Return lhs + -rhs End Operator Public Shared Operator *(lhs As Frac, rhs As Frac) As Frac Return New Frac(lhs.num * rhs.num, lhs.denom * rhs.denom) End Operator Public Shared Operator <(lhs As Frac, rhs As Frac) As Boolean Dim x = lhs.num / lhs.denom Dim y = rhs.num / rhs.denom Return x < y End Operator Public Shared Operator >(lhs As Frac, rhs As Frac) As Boolean Dim x = lhs.num / lhs.denom Dim y = rhs.num / rhs.denom Return x > y End Operator Public Shared Operator =(lhs As Frac, rhs As Frac) As Boolean Return lhs.num = rhs.num AndAlso lhs.denom = rhs.denom End Operator Public Shared Operator <>(lhs As Frac, rhs As Frac) As Boolean Return lhs.num <> rhs.num OrElse lhs.denom <> rhs.denom End Operator Public Overrides Function ToString() As String If denom = 1 Then Return num.ToString Else Return String.Format("{0}/{1}", num, denom) End If End Function Public Overrides Function Equals(obj As Object) As Boolean Dim frac = CType(obj, Frac) Return Not IsNothing(frac) AndAlso num = frac.num AndAlso denom = frac.denom End Function End Class Function Bernoulli(n As Integer) As Frac If n < 0 Then Throw New ArgumentException("n may not be negative or zero") End If Dim a(n + 1) As Frac For m = 0 To n a(m) = New Frac(1, m + 1) For j = m To 1 Step -1 a(j - 1) = (a(j - 1) - a(j)) * New Frac(j, 1) Next Next If n <> 1 Then Return a(0) Else Return -a(0) End If End Function Function Binomial(n As Integer, k As Integer) As Integer If n < 0 OrElse k < 0 OrElse n < k Then Throw New ArgumentException() End If If n = 0 OrElse k = 0 Then Return 1 End If Dim num = 1 For i = k + 1 To n num *= i Next Dim denom = 1 For i = 2 To n - k denom *= i Next Return num \ denom End Function Function FaulhaberTriangle(p As Integer) As Frac() Dim coeffs(p + 1) As Frac For i = 1 To p + 1 coeffs(i - 1) = Frac.ZERO Next Dim q As New Frac(1, p + 1) Dim sign = -1 For j = 0 To p sign *= -1 coeffs(p - j) = q * New Frac(sign, 1) * New Frac(Binomial(p + 1, j), 1) * Bernoulli(j) Next Return coeffs End Function Sub Main() For i = 1 To 10 Dim coeffs = FaulhaberTriangle(i - 1) For Each coeff In coeffs Console.Write("{0,5} ", coeff) Next Console.WriteLine() Next End Sub End Module
Port the provided Go code into VB while preserving the original functionality.
package main import ( "fmt" "os" ) func main() { for i, x := range os.Args[1:] { fmt.Printf("the argument #%d is %s\n", i, x) } }
Function Run(args() as String) As Integer For each arg As String In args Stdout.WriteLine(arg) Next End Function
Change the following Go code into VB without altering its purpose.
package main import ( "fmt" "os" ) func main() { for i, x := range os.Args[1:] { fmt.Printf("the argument #%d is %s\n", i, x) } }
Function Run(args() as String) As Integer For each arg As String In args Stdout.WriteLine(arg) Next End Function
Can you help me rewrite this code in VB instead of Go, keeping it the same logically?
package main import ( "bytes" "fmt" "io/ioutil" "log" "sort" "strings" ) func main() { b, err := ioutil.ReadFile("unixdict.txt") if err != nil { log.Fatal("Error reading file") } letters := "deegklnow" wordsAll := bytes.Split(b, []byte{'\n'}) var words [][]byte for _, word := range wordsAll { word = bytes.TrimSpace(word) le := len(word) if le > 2 && le < 10 { words = append(words, word) } } var found []string for _, word := range words { le := len(word) if bytes.IndexByte(word, 'k') >= 0 { lets := letters ok := true for i := 0; i < le; i++ { c := word[i] ix := sort.Search(len(lets), func(i int) bool { return lets[i] >= c }) if ix < len(lets) && lets[ix] == c { lets = lets[0:ix] + lets[ix+1:] } else { ok = false break } } if ok { found = append(found, string(word)) } } } fmt.Println("The following", len(found), "words are the solutions to the puzzle:") fmt.Println(strings.Join(found, "\n")) mostFound := 0 var mostWords9 []string var mostLetters []byte var words9 [][]byte for _, word := range words { if len(word) == 9 { words9 = append(words9, word) } } for _, word9 := range words9 { letterBytes := make([]byte, len(word9)) copy(letterBytes, word9) sort.Slice(letterBytes, func(i, j int) bool { return letterBytes[i] < letterBytes[j] }) distinctBytes := []byte{letterBytes[0]} for _, b := range letterBytes[1:] { if b != distinctBytes[len(distinctBytes)-1] { distinctBytes = append(distinctBytes, b) } } distinctLetters := string(distinctBytes) for _, letter := range distinctLetters { found := 0 letterByte := byte(letter) for _, word := range words { le := len(word) if bytes.IndexByte(word, letterByte) >= 0 { lets := string(letterBytes) ok := true for i := 0; i < le; i++ { c := word[i] ix := sort.Search(len(lets), func(i int) bool { return lets[i] >= c }) if ix < len(lets) && lets[ix] == c { lets = lets[0:ix] + lets[ix+1:] } else { ok = false break } } if ok { found = found + 1 } } } if found > mostFound { mostFound = found mostWords9 = []string{string(word9)} mostLetters = []byte{letterByte} } else if found == mostFound { mostWords9 = append(mostWords9, string(word9)) mostLetters = append(mostLetters, letterByte) } } } fmt.Println("\nMost words found =", mostFound) fmt.Println("Nine letter words producing this total:") for i := 0; i < len(mostWords9); i++ { fmt.Println(mostWords9[i], "with central letter", string(mostLetters[i])) } }
Const wheel="ndeokgelw" Sub print(s): On Error Resume Next WScript.stdout.WriteLine (s) If err= &h80070006& Then WScript.Echo " Please run this script with CScript": WScript.quit End Sub Dim oDic Set oDic = WScript.CreateObject("scripting.dictionary") Dim cnt(127) Dim fso Set fso = WScript.CreateObject("Scripting.Filesystemobject") Set ff=fso.OpenTextFile("unixdict.txt") i=0 print "reading words of 3 or more letters" While Not ff.AtEndOfStream x=LCase(ff.ReadLine) If Len(x)>=3 Then If Not odic.exists(x) Then oDic.Add x,0 End If Wend print "remaining words: "& oDic.Count & vbcrlf ff.Close Set ff=Nothing Set fso=Nothing Set re=New RegExp print "removing words with chars not in the wheel" re.pattern="[^"& wheel &"]" For Each w In oDic.Keys If re.test(w) Then oDic.remove(w) Next print "remaining words: "& oDic.Count & vbcrlf print "ensuring the mandatory letter "& Mid(wheel,5,1) & " is present" re.Pattern=Mid(wheel,5,1) For Each w In oDic.Keys If Not re.test(w) Then oDic.remove(w) Next print "remaining words: "& oDic.Count & vbcrlf print "checking number of chars" Dim nDic Set nDic = WScript.CreateObject("scripting.dictionary") For i=1 To Len(wheel) x=Mid(wheel,i,1) If nDic.Exists(x) Then a=nDic(x) nDic(x)=Array(a(0)+1,0) Else nDic.add x,Array(1,0) End If Next For Each w In oDic.Keys For Each c In nDic.Keys ndic(c)=Array(nDic(c)(0),0) Next For ii = 1 To len(w) c=Mid(w,ii,1) a=nDic(c) If (a(0)=a(1)) Then oDic.Remove(w):Exit For End If nDic(c)=Array(a(0),a(1)+1) Next Next print "Remaining words "& oDic.count For Each w In oDic.Keys print w Next
Rewrite this program in VB while keeping its functionality equivalent to the Go version.
package main import "fmt" func main() { a := []int{1, 2, 3} b := []int{7, 12, 60} c := append(a, b...) fmt.Println(c) i := []interface{}{1, 2, 3} j := []interface{}{"Crosby", "Stills", "Nash", "Young"} k := append(i, j...) fmt.Println(k) l := [...]int{1, 2, 3} m := [...]int{7, 12, 60} var n [len(l) + len(m)]int copy(n[:], l[:]) copy(n[len(l):], m[:]) fmt.Println(n) }
DEFINT A(1 to 4) = {1, 2, 3, 4} DEFINT B(1 to 4) = {10, 20, 30, 40} Redim A(1 to 8) as integer MEMCPY(varptr(A(5)), varptr(B(1)), Sizeof(integer)*4)
Write the same algorithm in VB as shown in this Go implementation.
package main import "fmt" func main() { var s string var i int if _, err := fmt.Scan(&s, &i); err == nil && i == 75000 { fmt.Println("good") } else { fmt.Println("wrong") } }
Public Sub text() Debug.Print InputBox("Input a string") Debug.Print InputBox("Input the integer 75000", "Input an integer", 75000, Context = "Long") End Sub
Convert this Go block to VB, preserving its control flow and logic.
package main import ( "encoding/binary" "log" "math" "os" "strings" ) func main() { const ( sampleRate = 44100 duration = 8 dataLength = sampleRate * duration hdrSize = 44 fileLen = dataLength + hdrSize - 8 ) buf1 := make([]byte, 1) buf2 := make([]byte, 2) buf4 := make([]byte, 4) var sb strings.Builder sb.WriteString("RIFF") binary.LittleEndian.PutUint32(buf4, fileLen) sb.Write(buf4) sb.WriteString("WAVE") sb.WriteString("fmt ") binary.LittleEndian.PutUint32(buf4, 16) sb.Write(buf4) binary.LittleEndian.PutUint16(buf2, 1) sb.Write(buf2) sb.Write(buf2) binary.LittleEndian.PutUint32(buf4, sampleRate) sb.Write(buf4) sb.Write(buf4) sb.Write(buf2) binary.LittleEndian.PutUint16(buf2, 8) sb.Write(buf2) sb.WriteString("data") binary.LittleEndian.PutUint32(buf4, dataLength) sb.Write(buf4) wavhdr := []byte(sb.String()) f, err := os.Create("notes.wav") if err != nil { log.Fatal(err) } defer f.Close() f.Write(wavhdr) freqs := [8]float64{261.6, 293.6, 329.6, 349.2, 392.0, 440.0, 493.9, 523.3} for j := 0; j < duration; j++ { freq := freqs[j] omega := 2 * math.Pi * freq for i := 0; i < dataLength/duration; i++ { y := 32 * math.Sin(omega*float64(i)/float64(sampleRate)) buf1[0] = byte(math.Round(y)) f.Write(buf1) } } }
Option Explicit Declare Function Beep Lib "kernel32" (ByVal Freq As Long, ByVal Dur As Long) As Long Sub Musical_Scale() Dim Fqs, i As Integer Fqs = Array(264, 297, 330, 352, 396, 440, 495, 528) For i = LBound(Fqs) To UBound(Fqs) Beep Fqs(i), 500 Next End Sub
Rewrite the snippet below in VB so it works the same as the original Go code.
package main import ( "encoding/binary" "log" "math" "os" "strings" ) func main() { const ( sampleRate = 44100 duration = 8 dataLength = sampleRate * duration hdrSize = 44 fileLen = dataLength + hdrSize - 8 ) buf1 := make([]byte, 1) buf2 := make([]byte, 2) buf4 := make([]byte, 4) var sb strings.Builder sb.WriteString("RIFF") binary.LittleEndian.PutUint32(buf4, fileLen) sb.Write(buf4) sb.WriteString("WAVE") sb.WriteString("fmt ") binary.LittleEndian.PutUint32(buf4, 16) sb.Write(buf4) binary.LittleEndian.PutUint16(buf2, 1) sb.Write(buf2) sb.Write(buf2) binary.LittleEndian.PutUint32(buf4, sampleRate) sb.Write(buf4) sb.Write(buf4) sb.Write(buf2) binary.LittleEndian.PutUint16(buf2, 8) sb.Write(buf2) sb.WriteString("data") binary.LittleEndian.PutUint32(buf4, dataLength) sb.Write(buf4) wavhdr := []byte(sb.String()) f, err := os.Create("notes.wav") if err != nil { log.Fatal(err) } defer f.Close() f.Write(wavhdr) freqs := [8]float64{261.6, 293.6, 329.6, 349.2, 392.0, 440.0, 493.9, 523.3} for j := 0; j < duration; j++ { freq := freqs[j] omega := 2 * math.Pi * freq for i := 0; i < dataLength/duration; i++ { y := 32 * math.Sin(omega*float64(i)/float64(sampleRate)) buf1[0] = byte(math.Round(y)) f.Write(buf1) } } }
Option Explicit Declare Function Beep Lib "kernel32" (ByVal Freq As Long, ByVal Dur As Long) As Long Sub Musical_Scale() Dim Fqs, i As Integer Fqs = Array(264, 297, 330, 352, 396, 440, 495, 528) For i = LBound(Fqs) To UBound(Fqs) Beep Fqs(i), 500 Next End Sub
Ensure the translated VB code behaves exactly like the original Go snippet.
package main import "fmt" type item struct { string w, v int } var wants = []item{ {"map", 9, 150}, {"compass", 13, 35}, {"water", 153, 200}, {"sandwich", 50, 160}, {"glucose", 15, 60}, {"tin", 68, 45}, {"banana", 27, 60}, {"apple", 39, 40}, {"cheese", 23, 30}, {"beer", 52, 10}, {"suntan cream", 11, 70}, {"camera", 32, 30}, {"T-shirt", 24, 15}, {"trousers", 48, 10}, {"umbrella", 73, 40}, {"waterproof trousers", 42, 70}, {"waterproof overclothes", 43, 75}, {"note-case", 22, 80}, {"sunglasses", 7, 20}, {"towel", 18, 12}, {"socks", 4, 50}, {"book", 30, 10}, } const maxWt = 400 func main() { items, w, v := m(len(wants)-1, maxWt) fmt.Println(items) fmt.Println("weight:", w) fmt.Println("value:", v) } func m(i, w int) ([]string, int, int) { if i < 0 || w == 0 { return nil, 0, 0 } else if wants[i].w > w { return m(i-1, w) } i0, w0, v0 := m(i-1, w) i1, w1, v1 := m(i-1, w-wants[i].w) v1 += wants[i].v if v1 > v0 { return append(i1, wants[i].string), w1 + wants[i].w, v1 } return i0, w0, v0 }
Option Explicit Const maxWeight = 400 Dim DataList As Variant Dim xList(64, 3) As Variant Dim nItems As Integer Dim s As String, xss As String Dim xwei As Integer, xval As Integer, nn As Integer Sub Main() Dim i As Integer, j As Integer DataList = Array("map", 9, 150, "compass", 13, 35, "water", 153, 200, "sandwich", 50, 160, _ "glucose", 15, 60, "tin", 68, 45, "banana", 27, 60, "apple", 39, 40, _ "cheese", 23, 30, "beer", 52, 10, "suntan cream", 11, 70, "camera", 32, 30, _ "T-shirt", 24, 15, "trousers", 48, 10, "umbrella", 73, 40, "book", 30, 10, _ "waterproof trousers", 42, 70, "waterproof overclothes", 43, 75, _ "note-case", 22, 80, "sunglasses", 7, 20, "towel", 18, 12, "socks", 4, 50) nItems = (UBound(DataList) + 1) / 3 j = 0 For i = 1 To nItems xList(i, 1) = DataList(j) xList(i, 2) = DataList(j + 1) xList(i, 3) = DataList(j + 2) j = j + 3 Next i s = "" For i = 1 To nItems s = s & Chr(i) Next nn = 0 Call ChoiceBin(1, "") For i = 1 To Len(xss) j = Asc(Mid(xss, i, 1)) Debug.Print xList(j, 1) Next i Debug.Print "count=" & Len(xss), "weight=" & xwei, "value=" & xval End Sub Private Sub ChoiceBin(n As String, ss As String) Dim r As String Dim i As Integer, j As Integer, iwei As Integer, ival As Integer Dim ipct As Integer If n = Len(s) + 1 Then iwei = 0: ival = 0 For i = 1 To Len(ss) j = Asc(Mid(ss, i, 1)) iwei = iwei + xList(j, 2) ival = ival + xList(j, 3) Next If iwei <= maxWeight And ival > xval Then xss = ss: xwei = iwei: xval = ival End If Else r = Mid(s, n, 1) Call ChoiceBin(n + 1, ss & r) Call ChoiceBin(n + 1, ss) End If End Sub
Write the same code in VB as shown below in Go.
package main import ( "fmt" "sort" ) func getPrimes(max int) []int { if max < 2 { return []int{} } lprimes := []int{2} outer: for x := 3; x <= max; x += 2 { for _, p := range lprimes { if x%p == 0 { continue outer } } lprimes = append(lprimes, x) } return lprimes } func main() { const maxSum = 99 descendants := make([][]int64, maxSum+1) ancestors := make([][]int, maxSum+1) for i := 0; i <= maxSum; i++ { descendants[i] = []int64{} ancestors[i] = []int{} } primes := getPrimes(maxSum) for _, p := range primes { descendants[p] = append(descendants[p], int64(p)) for s := 1; s < len(descendants)-p; s++ { temp := make([]int64, len(descendants[s])) for i := 0; i < len(descendants[s]); i++ { temp[i] = int64(p) * descendants[s][i] } descendants[s+p] = append(descendants[s+p], temp...) } } for _, p := range append(primes, 4) { le := len(descendants[p]) if le == 0 { continue } descendants[p][le-1] = 0 descendants[p] = descendants[p][:le-1] } total := 0 for s := 1; s <= maxSum; s++ { x := descendants[s] sort.Slice(x, func(i, j int) bool { return x[i] < x[j] }) total += len(descendants[s]) index := 0 for ; index < len(descendants[s]); index++ { if descendants[s][index] > int64(maxSum) { break } } for _, d := range descendants[s][:index] { ancestors[d] = append(ancestors[s], s) } if (s >= 21 && s <= 45) || (s >= 47 && s <= 73) || (s >= 75 && s < maxSum) { continue } temp := fmt.Sprintf("%v", ancestors[s]) fmt.Printf("%2d: %d Ancestor(s): %-14s", s, len(ancestors[s]), temp) le := len(descendants[s]) if le <= 10 { fmt.Printf("%5d Descendant(s): %v\n", le, descendants[s]) } else { fmt.Printf("%5d Descendant(s): %v\b ...]\n", le, descendants[s][:10]) } } fmt.Println("\nTotal descendants", total) }
Imports System.Math Module Module1 Const MAXPRIME = 99 Const MAXPARENT = 99 Const NBRCHILDREN = 547100 Public Primes As New Collection() Public PrimesR As New Collection() Public Ancestors As New Collection() Public Parents(MAXPARENT + 1) As Integer Public CptDescendants(MAXPARENT + 1) As Integer Public Children(NBRCHILDREN) As ChildStruct Public iChildren As Integer Public Delimiter As String = ", " Public Structure ChildStruct Public Child As Long Public pLower As Integer Public pHigher As Integer End Structure Sub Main() Dim Parent As Short Dim Sum As Short Dim i As Short Dim TotDesc As Integer = 0 Dim MidPrime As Integer If GetPrimes(Primes, MAXPRIME) = vbFalse Then Return End If For i = Primes.Count To 1 Step -1 PrimesR.Add(Primes.Item(i)) Next MidPrime = PrimesR.Item(1) / 2 For Each Prime In PrimesR Parents(Prime) = InsertChild(Parents(Prime), Prime) CptDescendants(Prime) += 1 If Prime > MidPrime Then Continue For End If For Parent = 1 To MAXPARENT Sum = Parent + Prime If Sum > MAXPARENT Then Exit For End If If Parents(Parent) Then InsertPreorder(Parents(Parent), Sum, Prime) CptDescendants(Sum) += CptDescendants(Parent) End If Next Next RemoveFalseChildren() If MAXPARENT > MAXPRIME Then If GetPrimes(Primes, MAXPARENT) = vbFalse Then Return End If End If FileOpen(1, "Ancestors.txt", OpenMode.Output) For Parent = 1 To MAXPARENT GetAncestors(Parent) PrintLine(1, "[" & Parent.ToString & "] Level: " & Ancestors.Count.ToString) If Ancestors.Count Then Print(1, "Ancestors: " & Ancestors.Item(1).ToString) For i = 2 To Ancestors.Count Print(1, ", " & Ancestors.Item(i).ToString) Next PrintLine(1) Ancestors.Clear() Else PrintLine(1, "Ancestors: None") End If If CptDescendants(Parent) Then PrintLine(1, "Descendants: " & CptDescendants(Parent).ToString) Delimiter = "" PrintDescendants(Parents(Parent)) PrintLine(1) TotDesc += CptDescendants(Parent) Else PrintLine(1, "Descendants: None") End If PrintLine(1) Next Primes.Clear() PrimesR.Clear() PrintLine(1, "Total descendants " & TotDesc.ToString) PrintLine(1) FileClose(1) End Sub Function InsertPreorder(_index As Integer, _sum As Short, _prime As Short) Parents(_sum) = InsertChild(Parents(_sum), Children(_index).Child * _prime) If Children(_index).pLower Then InsertPreorder(Children(_index).pLower, _sum, _prime) End If If Children(_index).pHigher Then InsertPreorder(Children(_index).pHigher, _sum, _prime) End If Return Nothing End Function Function InsertChild(_index As Integer, _child As Long) As Integer If _index Then If _child <= Children(_index).Child Then Children(_index).pLower = InsertChild(Children(_index).pLower, _child) Else Children(_index).pHigher = InsertChild(Children(_index).pHigher, _child) End If Else iChildren += 1 _index = iChildren Children(_index).Child = _child Children(_index).pLower = 0 Children(_index).pHigher = 0 End If Return _index End Function Function RemoveFalseChildren() Dim Exclusions As New Collection Exclusions.Add(4) For Each Prime In Primes Exclusions.Add(Prime) Next For Each ex In Exclusions Parents(ex) = Children(Parents(ex)).pHigher CptDescendants(ex) -= 1 Next Exclusions.Clear() Return Nothing End Function Function GetAncestors(_child As Short) Dim Child As Short = _child Dim Parent As Short = 0 For Each Prime In Primes If Child = 1 Then Exit For End If While Child Mod Prime = 0 Child /= Prime Parent += Prime End While Next If Parent = _child Or _child = 1 Then Return Nothing End If GetAncestors(Parent) Ancestors.Add(Parent) Return Nothing End Function Function PrintDescendants(_index As Integer) If Children(_index).pLower Then PrintDescendants(Children(_index).pLower) End If Print(1, Delimiter.ToString & Children(_index).Child.ToString) Delimiter = ", " If Children(_index).pHigher Then PrintDescendants(Children(_index).pHigher) End If Return Nothing End Function Function GetPrimes(ByRef _primes As Object, Optional _maxPrime As Integer = 2) As Boolean Dim Value As Integer = 3 Dim Max As Integer Dim Prime As Integer If _maxPrime < 2 Then Return vbFalse End If _primes.Add(2) While Value <= _maxPrime Max = Floor(Sqrt(Value)) For Each Prime In _primes If Prime > Max Then _primes.Add(Value) Exit For End If If Value Mod Prime = 0 Then Exit For End If Next Value += 2 End While Return vbTrue End Function End Module
Preserve the algorithm and functionality while converting the code from Go to VB.
package main import "fmt" type pair [2]int func cart2(a, b []int) []pair { p := make([]pair, len(a)*len(b)) i := 0 for _, a := range a { for _, b := range b { p[i] = pair{a, b} i++ } } return p } func main() { fmt.Println(cart2([]int{1, 2}, []int{3, 4})) fmt.Println(cart2([]int{3, 4}, []int{1, 2})) fmt.Println(cart2([]int{1, 2}, nil)) fmt.Println(cart2(nil, []int{1, 2})) }
Imports System.Runtime.CompilerServices Module Module1 <Extension()> Function CartesianProduct(Of T)(sequences As IEnumerable(Of IEnumerable(Of T))) As IEnumerable(Of IEnumerable(Of T)) Dim emptyProduct As IEnumerable(Of IEnumerable(Of T)) = {Enumerable.Empty(Of T)} Return sequences.Aggregate(emptyProduct, Function(accumulator, sequence) From acc In accumulator From item In sequence Select acc.Concat({item})) End Function Sub Main() Dim empty(-1) As Integer Dim list1 = {1, 2} Dim list2 = {3, 4} Dim list3 = {1776, 1789} Dim list4 = {7, 12} Dim list5 = {4, 14, 23} Dim list6 = {0, 1} Dim list7 = {1, 2, 3} Dim list8 = {30} Dim list9 = {500, 100} For Each sequnceList As Integer()() In { ({list1, list2}), ({list2, list1}), ({list1, empty}), ({empty, list1}), ({list3, list4, list5, list6}), ({list7, list8, list9}), ({list7, empty, list9}) } Dim cart = sequnceList.CartesianProduct().Select(Function(tuple) $"({String.Join(", ", tuple)})") Console.WriteLine($"{{{String.Join(", ", cart)}}}") Next End Sub End Module
Write the same code in VB as shown below in Go.
package main import "fmt" type pair [2]int func cart2(a, b []int) []pair { p := make([]pair, len(a)*len(b)) i := 0 for _, a := range a { for _, b := range b { p[i] = pair{a, b} i++ } } return p } func main() { fmt.Println(cart2([]int{1, 2}, []int{3, 4})) fmt.Println(cart2([]int{3, 4}, []int{1, 2})) fmt.Println(cart2([]int{1, 2}, nil)) fmt.Println(cart2(nil, []int{1, 2})) }
Imports System.Runtime.CompilerServices Module Module1 <Extension()> Function CartesianProduct(Of T)(sequences As IEnumerable(Of IEnumerable(Of T))) As IEnumerable(Of IEnumerable(Of T)) Dim emptyProduct As IEnumerable(Of IEnumerable(Of T)) = {Enumerable.Empty(Of T)} Return sequences.Aggregate(emptyProduct, Function(accumulator, sequence) From acc In accumulator From item In sequence Select acc.Concat({item})) End Function Sub Main() Dim empty(-1) As Integer Dim list1 = {1, 2} Dim list2 = {3, 4} Dim list3 = {1776, 1789} Dim list4 = {7, 12} Dim list5 = {4, 14, 23} Dim list6 = {0, 1} Dim list7 = {1, 2, 3} Dim list8 = {30} Dim list9 = {500, 100} For Each sequnceList As Integer()() In { ({list1, list2}), ({list2, list1}), ({list1, empty}), ({empty, list1}), ({list3, list4, list5, list6}), ({list7, list8, list9}), ({list7, empty, list9}) } Dim cart = sequnceList.CartesianProduct().Select(Function(tuple) $"({String.Join(", ", tuple)})") Console.WriteLine($"{{{String.Join(", ", cart)}}}") Next End Sub End Module
Convert the following code from Go to VB, ensuring the logic remains intact.
package main import ( "fmt" "strconv" ) func listProperDivisors(limit int) { if limit < 1 { return } width := len(strconv.Itoa(limit)) for i := 1; i <= limit; i++ { fmt.Printf("%*d -> ", width, i) if i == 1 { fmt.Println("(None)") continue } for j := 1; j <= i/2; j++ { if i%j == 0 { fmt.Printf(" %d", j) } } fmt.Println() } } func countProperDivisors(n int) int { if n < 2 { return 0 } count := 0 for i := 1; i <= n/2; i++ { if n%i == 0 { count++ } } return count } func main() { fmt.Println("The proper divisors of the following numbers are :\n") listProperDivisors(10) fmt.Println() maxCount := 0 most := []int{1} for n := 2; n <= 20000; n++ { count := countProperDivisors(n) if count == maxCount { most = append(most, n) } else if count > maxCount { maxCount = count most = most[0:1] most[0] = n } } fmt.Print("The following number(s) <= 20000 have the most proper divisors, ") fmt.Println("namely", maxCount, "\b\n") for _, n := range most { fmt.Println(n) } }
dim _proper_divisors(100) sub proper_divisors(n) dim i dim _proper_divisors_count = 0 if n <> 1 then for i = 1 to (n \ 2) if n %% i = 0 then _proper_divisors_count = _proper_divisors_count + 1 _proper_divisors(_proper_divisors_count) = i end if next end if return _proper_divisors_count end sub sub show_proper_divisors(n, tabbed) dim cnt = proper_divisors(n) print str$(n) + ":"; tab(4);"(" + str$(cnt) + " items) "; dim j for j = 1 to cnt if tabbed then print str$(_proper_divisors(j)), else print str$(_proper_divisors(j)); end if if (j < cnt) then print ","; next print end sub dim i for i = 1 to 10 show_proper_divisors(i, false) next dim c dim maxindex = 0 dim maxlength = 0 for t = 1 to 20000 c = proper_divisors(t) if c > maxlength then maxindex = t maxlength = c end if next print "A maximum at "; show_proper_divisors(maxindex, false)
Generate an equivalent VB version of this Go code.
package main import ( "encoding/xml" "fmt" ) func xRemarks(r CharacterRemarks) (string, error) { b, err := xml.MarshalIndent(r, "", " ") return string(b), err } type CharacterRemarks struct { Character []crm } type crm struct { Name string `xml:"name,attr"` Remark string `xml:",chardata"` } func main() { x, err := xRemarks(CharacterRemarks{[]crm{ {`April`, `Bubbly: I'm > Tam and <= Emily`}, {`Tam O'Shanter`, `Burns: "When chapman billies leave the street ..."`}, {`Emily`, `Short & shrift`}, }}) if err != nil { x = err.Error() } fmt.Println(x) }
Module XMLOutput Sub Main() Dim charRemarks As New Dictionary(Of String, String) charRemarks.Add("April", "Bubbly: I charRemarks.Add("Tam O charRemarks.Add("Emily", "Short & shrift") Dim xml = <CharacterRemarks> <%= From cr In charRemarks Select <Character name=<%= cr.Key %>><%= cr.Value %></Character> %> </CharacterRemarks> Console.WriteLine(xml) End Sub End Module
Convert the following code from Go to VB, ensuring the logic remains intact.
package main import ( "fmt" "log" "os/exec" ) var ( x = []int{0, 1, 2, 3, 4, 5, 6, 7, 8, 9} y = []float64{2.7, 2.8, 31.4, 38.1, 58.0, 76.2, 100.5, 130.0, 149.3, 180.0} ) func main() { g := exec.Command("gnuplot", "-persist") w, err := g.StdinPipe() if err != nil { log.Fatal(err) } if err = g.Start(); err != nil { log.Fatal(err) } fmt.Fprintln(w, "unset key; plot '-'") for i, xi := range x { fmt.Fprintf(w, "%d %f\n", xi, y[i]) } fmt.Fprintln(w, "e") w.Close() g.Wait() }
Private Sub plot_coordinate_pairs(x As Variant, y As Variant) Dim chrt As Chart Set chrt = ActiveSheet.Shapes.AddChart.Chart With chrt .ChartType = xlLine .HasLegend = False .HasTitle = True .ChartTitle.Text = "Time" .SeriesCollection.NewSeries .SeriesCollection.Item(1).XValues = x .SeriesCollection.Item(1).Values = y .Axes(xlValue, xlPrimary).HasTitle = True .Axes(xlValue, xlPrimary).AxisTitle.Characters.Text = "microseconds" End With End Sub Public Sub main() x = [{0, 1, 2, 3, 4, 5, 6, 7, 8, 9}] y = [{2.7, 2.8, 31.4, 38.1, 58.0, 76.2, 100.5, 130.0, 149.3, 180.0}] plot_coordinate_pairs x, y End Sub
Rewrite the snippet below in VB so it works the same as the original Go code.
package main import ( "fmt" "log" "os/exec" ) var ( x = []int{0, 1, 2, 3, 4, 5, 6, 7, 8, 9} y = []float64{2.7, 2.8, 31.4, 38.1, 58.0, 76.2, 100.5, 130.0, 149.3, 180.0} ) func main() { g := exec.Command("gnuplot", "-persist") w, err := g.StdinPipe() if err != nil { log.Fatal(err) } if err = g.Start(); err != nil { log.Fatal(err) } fmt.Fprintln(w, "unset key; plot '-'") for i, xi := range x { fmt.Fprintf(w, "%d %f\n", xi, y[i]) } fmt.Fprintln(w, "e") w.Close() g.Wait() }
Private Sub plot_coordinate_pairs(x As Variant, y As Variant) Dim chrt As Chart Set chrt = ActiveSheet.Shapes.AddChart.Chart With chrt .ChartType = xlLine .HasLegend = False .HasTitle = True .ChartTitle.Text = "Time" .SeriesCollection.NewSeries .SeriesCollection.Item(1).XValues = x .SeriesCollection.Item(1).Values = y .Axes(xlValue, xlPrimary).HasTitle = True .Axes(xlValue, xlPrimary).AxisTitle.Characters.Text = "microseconds" End With End Sub Public Sub main() x = [{0, 1, 2, 3, 4, 5, 6, 7, 8, 9}] y = [{2.7, 2.8, 31.4, 38.1, 58.0, 76.2, 100.5, 130.0, 149.3, 180.0}] plot_coordinate_pairs x, y End Sub
Write the same algorithm in VB as shown in this Go implementation.
package main import "fmt" import "regexp" func main() { str := "I am the original string" matched, _ := regexp.MatchString(".*string$", str) if matched { fmt.Println("ends with 'string'") } pattern := regexp.MustCompile("original") result := pattern.ReplaceAllString(str, "modified") fmt.Println(result) }
text = "I need more coffee!!!" Set regex = New RegExp regex.Global = True regex.Pattern = "\s" If regex.Test(text) Then WScript.StdOut.Write regex.Replace(text,vbCrLf) Else WScript.StdOut.Write "No matching pattern" End If
Change the following Go code into VB without altering its purpose.
package main import "fmt" import "regexp" func main() { str := "I am the original string" matched, _ := regexp.MatchString(".*string$", str) if matched { fmt.Println("ends with 'string'") } pattern := regexp.MustCompile("original") result := pattern.ReplaceAllString(str, "modified") fmt.Println(result) }
text = "I need more coffee!!!" Set regex = New RegExp regex.Global = True regex.Pattern = "\s" If regex.Test(text) Then WScript.StdOut.Write regex.Replace(text,vbCrLf) Else WScript.StdOut.Write "No matching pattern" End If
Change the following Go code into VB without altering its purpose.
package main import "fmt" func main() { keys := []string{"a", "b", "c"} vals := []int{1, 2, 3} hash := map[string]int{} for i, key := range keys { hash[key] = vals[i] } fmt.Println(hash) }
Set dict = CreateObject("Scripting.Dictionary") os = Array("Windows", "Linux", "MacOS") owner = Array("Microsoft", "Linus Torvalds", "Apple") For n = 0 To 2 dict.Add os(n), owner(n) Next MsgBox dict.Item("Linux") MsgBox dict.Item("MacOS") MsgBox dict.Item("Windows")
Maintain the same structure and functionality when rewriting this code in VB.
package main import "github.com/fogleman/gg" var palette = [8]string{ "000000", "FF0000", "00FF00", "0000FF", "FF00FF", "00FFFF", "FFFF00", "FFFFFF", } func pinstripe(dc *gg.Context) { w := dc.Width() h := dc.Height() / 4 for b := 1; b <= 4; b++ { for x, ci := 0, 0; x < w; x, ci = x+b, ci+1 { dc.SetHexColor(palette[ci%8]) y := h * (b - 1) dc.DrawRectangle(float64(x), float64(y), float64(b), float64(h)) dc.Fill() } } } func main() { dc := gg.NewContext(900, 600) pinstripe(dc) dc.SavePNG("color_pinstripe.png") }
Public Class Main Inherits System.Windows.Forms.Form Public Sub New() Me.FormBorderStyle = FormBorderStyle.None Me.WindowState = FormWindowState.Maximized End Sub Private Sub Main_Load(sender As Object, e As EventArgs) Handles Me.Load Dim Index As Integer Dim Colors() As Color = {Color.Black, Color.Red, Color.Green, Color.Magenta, Color.Cyan, Color.Yellow, Color.White} Dim Height = (Me.ClientSize.Height / 4) + 1 For y = 1 To 4 Dim Top = Me.ClientSize.Height / 4 * (y - 1) For x = 0 To Me.ClientSize.Width Step y If Index = 6 Then Index = 0 Else Index += 1 Me.Controls.Add(New Panel With {.Top = Top, .Height = Height, .Left = x, .Width = y, .BackColor = Colors(Index)}) Next Next End Sub End Class
Generate a VB translation of this Go snippet without changing its computational steps.
package main import ( "fmt" "math/rand" "time" ) func cocktailShakerSort(a []int) { var begin = 0 var end = len(a) - 2 for begin <= end { newBegin := end newEnd := begin for i := begin; i <= end; i++ { if a[i] > a[i+1] { a[i+1], a[i] = a[i], a[i+1] newEnd = i } } end = newEnd - 1 for i := end; i >= begin; i-- { if a[i] > a[i+1] { a[i+1], a[i] = a[i], a[i+1] newBegin = i } } begin = newBegin + 1 } } func cocktailSort(a []int) { last := len(a) - 1 for { swapped := false for i := 0; i < last; i++ { if a[i] > a[i+1] { a[i], a[i+1] = a[i+1], a[i] swapped = true } } if !swapped { return } swapped = false for i := last - 1; i >= 0; i-- { if a[i] > a[i+1] { a[i], a[i+1] = a[i+1], a[i] swapped = true } } if !swapped { return } } } func main() { a := []int{21, 4, -9, 62, -7, 107, -62, 4, 0, -170} fmt.Println("Original array:", a) b := make([]int, len(a)) copy(b, a) cocktailSort(a) fmt.Println("Cocktail sort :", a) cocktailShakerSort(b) fmt.Println("C/Shaker sort :", b) rand.Seed(time.Now().UnixNano()) fmt.Println("\nRelative speed of the two sorts") fmt.Println(" N x faster (CSS v CS)") fmt.Println("----- -------------------") const runs = 10 for _, n := range []int{1000, 2000, 4000, 8000, 10000, 20000} { sum := 0.0 for i := 1; i <= runs; i++ { nums := make([]int, n) for i := 0; i < n; i++ { rn := rand.Intn(100000) if i%2 == 1 { rn = -rn } nums[i] = rn } nums2 := make([]int, n) copy(nums2, nums) start := time.Now() cocktailSort(nums) elapsed := time.Since(start) start2 := time.Now() cocktailShakerSort(nums2) elapsed2 := time.Since(start2) sum += float64(elapsed) / float64(elapsed2) } fmt.Printf(" %2dk %0.3f\n", n/1000, sum/runs) } }
Function cocktailShakerSort(ByVal A As Variant) As Variant beginIdx = LBound(A) endIdx = UBound(A) - 1 Do While beginIdx <= endIdx newBeginIdx = endIdx newEndIdx = beginIdx For ii = beginIdx To endIdx If A(ii) > A(ii + 1) Then tmp = A(ii): A(ii) = A(ii + 1): A(ii + 1) = tmp newEndIdx = ii End If Next ii endIdx = newEndIdx - 1 For ii = endIdx To beginIdx Step -1 If A(ii) > A(ii + 1) Then tmp = A(ii): A(ii) = A(ii + 1): A(ii + 1) = tmp newBeginIdx = ii End If Next ii beginIdx = newBeginIdx + 1 Loop cocktailShakerSort = A End Function Public Sub main() Dim B(20) As Variant For i = LBound(B) To UBound(B) B(i) = Int(Rnd() * 100) Next i Debug.Print Join(B, ", ") Debug.Print Join(cocktailShakerSort(B), ", ") End Sub
Generate an equivalent VB version of this Go code.
package main import ( "fmt" "math/rand" "time" ) func cocktailShakerSort(a []int) { var begin = 0 var end = len(a) - 2 for begin <= end { newBegin := end newEnd := begin for i := begin; i <= end; i++ { if a[i] > a[i+1] { a[i+1], a[i] = a[i], a[i+1] newEnd = i } } end = newEnd - 1 for i := end; i >= begin; i-- { if a[i] > a[i+1] { a[i+1], a[i] = a[i], a[i+1] newBegin = i } } begin = newBegin + 1 } } func cocktailSort(a []int) { last := len(a) - 1 for { swapped := false for i := 0; i < last; i++ { if a[i] > a[i+1] { a[i], a[i+1] = a[i+1], a[i] swapped = true } } if !swapped { return } swapped = false for i := last - 1; i >= 0; i-- { if a[i] > a[i+1] { a[i], a[i+1] = a[i+1], a[i] swapped = true } } if !swapped { return } } } func main() { a := []int{21, 4, -9, 62, -7, 107, -62, 4, 0, -170} fmt.Println("Original array:", a) b := make([]int, len(a)) copy(b, a) cocktailSort(a) fmt.Println("Cocktail sort :", a) cocktailShakerSort(b) fmt.Println("C/Shaker sort :", b) rand.Seed(time.Now().UnixNano()) fmt.Println("\nRelative speed of the two sorts") fmt.Println(" N x faster (CSS v CS)") fmt.Println("----- -------------------") const runs = 10 for _, n := range []int{1000, 2000, 4000, 8000, 10000, 20000} { sum := 0.0 for i := 1; i <= runs; i++ { nums := make([]int, n) for i := 0; i < n; i++ { rn := rand.Intn(100000) if i%2 == 1 { rn = -rn } nums[i] = rn } nums2 := make([]int, n) copy(nums2, nums) start := time.Now() cocktailSort(nums) elapsed := time.Since(start) start2 := time.Now() cocktailShakerSort(nums2) elapsed2 := time.Since(start2) sum += float64(elapsed) / float64(elapsed2) } fmt.Printf(" %2dk %0.3f\n", n/1000, sum/runs) } }
Function cocktailShakerSort(ByVal A As Variant) As Variant beginIdx = LBound(A) endIdx = UBound(A) - 1 Do While beginIdx <= endIdx newBeginIdx = endIdx newEndIdx = beginIdx For ii = beginIdx To endIdx If A(ii) > A(ii + 1) Then tmp = A(ii): A(ii) = A(ii + 1): A(ii + 1) = tmp newEndIdx = ii End If Next ii endIdx = newEndIdx - 1 For ii = endIdx To beginIdx Step -1 If A(ii) > A(ii + 1) Then tmp = A(ii): A(ii) = A(ii + 1): A(ii + 1) = tmp newBeginIdx = ii End If Next ii beginIdx = newBeginIdx + 1 Loop cocktailShakerSort = A End Function Public Sub main() Dim B(20) As Variant For i = LBound(B) To UBound(B) B(i) = Int(Rnd() * 100) Next i Debug.Print Join(B, ", ") Debug.Print Join(cocktailShakerSort(B), ", ") End Sub
Port the following code from Go to VB with equivalent syntax and logic.
package main import ( "github.com/google/gxui" "github.com/google/gxui/drivers/gl" "github.com/google/gxui/math" "github.com/google/gxui/themes/dark" omath "math" "time" ) const ( ANIMATION_WIDTH int = 480 ANIMATION_HEIGHT int = 320 BALL_RADIUS float32 = 25.0 METER_PER_PIXEL float64 = 1.0 / 20.0 PHI_ZERO float64 = omath.Pi * 0.5 ) var ( l float64 = float64(ANIMATION_HEIGHT) * 0.5 freq float64 = omath.Sqrt(9.81 / (l * METER_PER_PIXEL)) ) type Pendulum interface { GetPhi() float64 } type mathematicalPendulum struct { start time.Time } func (p *mathematicalPendulum) GetPhi() float64 { if (p.start == time.Time{}) { p.start = time.Now() } t := float64(time.Since(p.start).Nanoseconds()) / omath.Pow10(9) return PHI_ZERO * omath.Cos(t*freq) } type numericalPendulum struct { currentPhi float64 angAcc float64 angVel float64 lastTime time.Time } func (p *numericalPendulum) GetPhi() float64 { dt := 0.0 if (p.lastTime != time.Time{}) { dt = float64(time.Since(p.lastTime).Nanoseconds()) / omath.Pow10(9) } p.lastTime = time.Now() p.angAcc = -9.81 / (float64(l) * METER_PER_PIXEL) * omath.Sin(p.currentPhi) p.angVel += p.angAcc * dt p.currentPhi += p.angVel * dt return p.currentPhi } func draw(p Pendulum, canvas gxui.Canvas, x, y int) { attachment := math.Point{X: ANIMATION_WIDTH/2 + x, Y: y} phi := p.GetPhi() ball := math.Point{X: x + ANIMATION_WIDTH/2 + math.Round(float32(l*omath.Sin(phi))), Y: y + math.Round(float32(l*omath.Cos(phi)))} line := gxui.Polygon{gxui.PolygonVertex{attachment, 0}, gxui.PolygonVertex{ball, 0}} canvas.DrawLines(line, gxui.DefaultPen) m := math.Point{int(BALL_RADIUS), int(BALL_RADIUS)} rect := math.Rect{ball.Sub(m), ball.Add(m)} canvas.DrawRoundedRect(rect, BALL_RADIUS, BALL_RADIUS, BALL_RADIUS, BALL_RADIUS, gxui.TransparentPen, gxui.CreateBrush(gxui.Yellow)) } func appMain(driver gxui.Driver) { theme := dark.CreateTheme(driver) window := theme.CreateWindow(ANIMATION_WIDTH, 2*ANIMATION_HEIGHT, "Pendulum") window.SetBackgroundBrush(gxui.CreateBrush(gxui.Gray50)) image := theme.CreateImage() ticker := time.NewTicker(time.Millisecond * 15) pendulum := &mathematicalPendulum{} pendulum2 := &numericalPendulum{PHI_ZERO, 0.0, 0.0, time.Time{}} go func() { for _ = range ticker.C { canvas := driver.CreateCanvas(math.Size{ANIMATION_WIDTH, 2 * ANIMATION_HEIGHT}) canvas.Clear(gxui.White) draw(pendulum, canvas, 0, 0) draw(pendulum2, canvas, 0, ANIMATION_HEIGHT) canvas.Complete() driver.Call(func() { image.SetCanvas(canvas) }) } }() window.AddChild(image) window.OnClose(ticker.Stop) window.OnClose(driver.Terminate) } func main() { gl.StartDriver(appMain) }
option explicit const dt = 0.15 const length=23 dim ans0:ans0=chr(27)&"[" dim Veloc,Accel,angle,olr,olc,r,c const r0=1 const c0=40 cls angle=0.7 while 1 wscript.sleep(50) Accel = -.9 * sin(Angle) Veloc = Veloc + Accel * dt Angle = Angle + Veloc * dt r = r0 + int(cos(Angle) * Length) c = c0+ int(2*sin(Angle) * Length) cls draw_line r,c,r0,c0 toxy r,c,"O" olr=r :olc=c wend sub cls() wscript.StdOut.Write ans0 &"2J"&ans0 &"?25l":end sub sub toxy(r,c,s) wscript.StdOut.Write ans0 & r & ";" & c & "f" & s :end sub Sub draw_line(r1,c1, r2,c2) Dim x,y,xf,yf,dx,dy,sx,sy,err,err2 x =r1 : y =c1 xf=r2 : yf=c2 dx=Abs(xf-x) : dy=Abs(yf-y) If x<xf Then sx=+1: Else sx=-1 If y<yf Then sy=+1: Else sy=-1 err=dx-dy Do toxy x,y,"." If x=xf And y=yf Then Exit Do err2=err+err If err2>-dy Then err=err-dy: x=x+sx If err2< dx Then err=err+dx: y=y+sy Loop End Sub
Ensure the translated VB code behaves exactly like the original Go snippet.
package main import "fmt" func enc(b int) int { return b ^ b>>1 } func dec(g int) (b int) { for ; g != 0; g >>= 1 { b ^= g } return } func main() { fmt.Println("decimal binary gray decoded") for b := 0; b < 32; b++ { g := enc(b) d := dec(g) fmt.Printf(" %2d %05b %05b %05b %2d\n", b, b, g, d, d) } }
Function Encoder(ByVal n) Encoder = n Xor (n \ 2) End Function Function Decoder(ByVal n) Dim g : g = 0 Do While n > 0 g = g Xor n n = n \ 2 Loop Decoder = g End Function Function Dec2bin(ByVal n, ByVal length) Dim i, strbin : strbin = "" For i = 1 to 5 strbin = (n Mod 2) & strbin n = n \ 2 Next Dec2Bin = strbin End Function WScript.StdOut.WriteLine("Binary -> Gray Code -> Binary") For i = 0 to 31 encoded = Encoder(i) decoded = Decoder(encoded) WScript.StdOut.WriteLine(Dec2Bin(i, 5) & " -> " & Dec2Bin(encoded, 5) & " -> " & Dec2Bin(decoded, 5)) Next
Produce a functionally identical VB code for the snippet given in Go.
package main import "fmt" func enc(b int) int { return b ^ b>>1 } func dec(g int) (b int) { for ; g != 0; g >>= 1 { b ^= g } return } func main() { fmt.Println("decimal binary gray decoded") for b := 0; b < 32; b++ { g := enc(b) d := dec(g) fmt.Printf(" %2d %05b %05b %05b %2d\n", b, b, g, d, d) } }
Function Encoder(ByVal n) Encoder = n Xor (n \ 2) End Function Function Decoder(ByVal n) Dim g : g = 0 Do While n > 0 g = g Xor n n = n \ 2 Loop Decoder = g End Function Function Dec2bin(ByVal n, ByVal length) Dim i, strbin : strbin = "" For i = 1 to 5 strbin = (n Mod 2) & strbin n = n \ 2 Next Dec2Bin = strbin End Function WScript.StdOut.WriteLine("Binary -> Gray Code -> Binary") For i = 0 to 31 encoded = Encoder(i) decoded = Decoder(encoded) WScript.StdOut.WriteLine(Dec2Bin(i, 5) & " -> " & Dec2Bin(encoded, 5) & " -> " & Dec2Bin(decoded, 5)) Next
Preserve the algorithm and functionality while converting the code from Go to VB.
package cards import ( "math/rand" ) type Suit uint8 const ( Spade Suit = 3 Heart Suit = 2 Diamond Suit = 1 Club Suit = 0 ) func (s Suit) String() string { const suites = "CDHS" return suites[s : s+1] } type Rank uint8 const ( Ace Rank = 1 Two Rank = 2 Three Rank = 3 Four Rank = 4 Five Rank = 5 Six Rank = 6 Seven Rank = 7 Eight Rank = 8 Nine Rank = 9 Ten Rank = 10 Jack Rank = 11 Queen Rank = 12 King Rank = 13 ) func (r Rank) String() string { const ranks = "A23456789TJQK" return ranks[r-1 : r] } type Card uint8 func NewCard(r Rank, s Suit) Card { return Card(13*uint8(s) + uint8(r-1)) } func (c Card) RankSuit() (Rank, Suit) { return Rank(c%13 + 1), Suit(c / 13) } func (c Card) Rank() Rank { return Rank(c%13 + 1) } func (c Card) Suit() Suit { return Suit(c / 13) } func (c Card) String() string { return c.Rank().String() + c.Suit().String() } type Deck []Card func NewDeck() Deck { d := make(Deck, 52) for i := range d { d[i] = Card(i) } return d } func (d Deck) String() string { s := "" for i, c := range d { switch { case i == 0: case i%13 == 0: s += "\n" default: s += " " } s += c.String() } return s } func (d Deck) Shuffle() { for i := range d { j := rand.Intn(i + 1) d[i], d[j] = d[j], d[i] } } func (d Deck) Contains(tc Card) bool { for _, c := range d { if c == tc { return true } } return false } func (d *Deck) AddDeck(decks ...Deck) { for _, o := range decks { *d = append(*d, o...) } } func (d *Deck) AddCard(c Card) { *d = append(*d, c) } func (d *Deck) Draw(n int) Deck { old := *d *d = old[n:] return old[:n:n] } func (d *Deck) DrawCard() (Card, bool) { if len(*d) == 0 { return 0, false } old := *d *d = old[1:] return old[0], true } func (d *Deck) Deal(cards int, hands ...Deck) ([]Deck, bool) { for i := 0; i < cards; i++ { for j := range hands { if len(*d) == 0 { return hands, false } hands[j] = append(hands[j], (*d)[0]) *d = (*d)[1:] } } return hands, true }
class playingcard dim suit dim pips end class class carddeck private suitnames private pipnames private cardno private deck(52) private nTop sub class_initialize dim suit dim pips suitnames = split("H,D,C,S",",") pipnames = split("A,2,3,4,5,6,7,8,9,10,J,Q,K",",") cardno = 0 for suit = 1 to 4 for pips = 1 to 13 set deck(cardno) = new playingcard deck(cardno).suit = suitnames(suit-1) deck(cardno).pips = pipnames(pips-1) cardno = cardno + 1 next next nTop = 0 end sub public sub showdeck dim a redim a(51-nTop) for i = nTop to 51 a(i) = deck(i).pips & deck(i).suit next wscript.echo join( a, ", ") end sub public sub shuffle dim r randomize timer for i = nTop to 51 r = int( rnd * ( 52 - nTop ) ) if r <> i then objswap deck(i),deck(r) end if next end sub public function deal() set deal = deck( nTop ) nTop = nTop + 1 end function public property get cardsRemaining cardsRemaining = 52 - nTop end property private sub objswap( a, b ) dim tmp set tmp = a set a = b set b = tmp end sub end class
Can you help me rewrite this code in VB instead of Go, keeping it the same logically?
package cards import ( "math/rand" ) type Suit uint8 const ( Spade Suit = 3 Heart Suit = 2 Diamond Suit = 1 Club Suit = 0 ) func (s Suit) String() string { const suites = "CDHS" return suites[s : s+1] } type Rank uint8 const ( Ace Rank = 1 Two Rank = 2 Three Rank = 3 Four Rank = 4 Five Rank = 5 Six Rank = 6 Seven Rank = 7 Eight Rank = 8 Nine Rank = 9 Ten Rank = 10 Jack Rank = 11 Queen Rank = 12 King Rank = 13 ) func (r Rank) String() string { const ranks = "A23456789TJQK" return ranks[r-1 : r] } type Card uint8 func NewCard(r Rank, s Suit) Card { return Card(13*uint8(s) + uint8(r-1)) } func (c Card) RankSuit() (Rank, Suit) { return Rank(c%13 + 1), Suit(c / 13) } func (c Card) Rank() Rank { return Rank(c%13 + 1) } func (c Card) Suit() Suit { return Suit(c / 13) } func (c Card) String() string { return c.Rank().String() + c.Suit().String() } type Deck []Card func NewDeck() Deck { d := make(Deck, 52) for i := range d { d[i] = Card(i) } return d } func (d Deck) String() string { s := "" for i, c := range d { switch { case i == 0: case i%13 == 0: s += "\n" default: s += " " } s += c.String() } return s } func (d Deck) Shuffle() { for i := range d { j := rand.Intn(i + 1) d[i], d[j] = d[j], d[i] } } func (d Deck) Contains(tc Card) bool { for _, c := range d { if c == tc { return true } } return false } func (d *Deck) AddDeck(decks ...Deck) { for _, o := range decks { *d = append(*d, o...) } } func (d *Deck) AddCard(c Card) { *d = append(*d, c) } func (d *Deck) Draw(n int) Deck { old := *d *d = old[n:] return old[:n:n] } func (d *Deck) DrawCard() (Card, bool) { if len(*d) == 0 { return 0, false } old := *d *d = old[1:] return old[0], true } func (d *Deck) Deal(cards int, hands ...Deck) ([]Deck, bool) { for i := 0; i < cards; i++ { for j := range hands { if len(*d) == 0 { return hands, false } hands[j] = append(hands[j], (*d)[0]) *d = (*d)[1:] } } return hands, true }
class playingcard dim suit dim pips end class class carddeck private suitnames private pipnames private cardno private deck(52) private nTop sub class_initialize dim suit dim pips suitnames = split("H,D,C,S",",") pipnames = split("A,2,3,4,5,6,7,8,9,10,J,Q,K",",") cardno = 0 for suit = 1 to 4 for pips = 1 to 13 set deck(cardno) = new playingcard deck(cardno).suit = suitnames(suit-1) deck(cardno).pips = pipnames(pips-1) cardno = cardno + 1 next next nTop = 0 end sub public sub showdeck dim a redim a(51-nTop) for i = nTop to 51 a(i) = deck(i).pips & deck(i).suit next wscript.echo join( a, ", ") end sub public sub shuffle dim r randomize timer for i = nTop to 51 r = int( rnd * ( 52 - nTop ) ) if r <> i then objswap deck(i),deck(r) end if next end sub public function deal() set deal = deck( nTop ) nTop = nTop + 1 end function public property get cardsRemaining cardsRemaining = 52 - nTop end property private sub objswap( a, b ) dim tmp set tmp = a set a = b set b = tmp end sub end class
Ensure the translated VB code behaves exactly like the original Go snippet.
package main import ( "fmt" ) func main() { var a [5]int fmt.Println("len(a) =", len(a)) fmt.Println("a =", a) a[0] = 3 fmt.Println("a =", a) fmt.Println("a[0] =", a[0]) s := a[:4] fmt.Println("s =", s) fmt.Println("len(s) =", len(s), " cap(s) =", cap(s)) s = s[:5] fmt.Println("s =", s) a[0] = 22 fmt.Println("a =", a) fmt.Println("s =", s) s = append(s, 4, 5, 6) fmt.Println("s =", s) fmt.Println("len(s) =", len(s), " cap(s) =", cap(s)) a[4] = -1 fmt.Println("a =", a) fmt.Println("s =", s) s = make([]int, 8) fmt.Println("s =", s) fmt.Println("len(s) =", len(s), " cap(s) =", cap(s)) }
Option Base {0|1}
Convert this Go snippet to VB and keep its semantics consistent.
package main import ( "fmt" "strings" "unicode/utf8" ) var order = 3 var grain = "#" func main() { carpet := []string{grain} for ; order > 0; order-- { hole := strings.Repeat(" ", utf8.RuneCountInString(carpet[0])) middle := make([]string, len(carpet)) for i, s := range carpet { middle[i] = s + hole + s carpet[i] = strings.Repeat(s, 3) } carpet = append(append(carpet, middle...), carpet...) } for _, r := range carpet { fmt.Println(r) } }
Const Order = 4 Function InCarpet(ByVal x As Integer, ByVal y As Integer) Do While x <> 0 And y <> 0 If x Mod 3 = 1 And y Mod 3 = 1 Then InCarpet = " " Exit Function End If x = x \ 3 y = y \ 3 Loop InCarpet = "#" End Function Public Sub sierpinski_carpet() Dim i As Integer, j As Integer For i = 0 To 3 ^ Order - 1 For j = 0 To 3 ^ Order - 1 Debug.Print InCarpet(i, j); Next j Debug.Print Next i End Sub
Port the provided Go code into VB while preserving the original functionality.
package main import ( "fmt" "math/rand" "sort" "time" ) func main() { list := []int{31, 41, 59, 26, 53, 58, 97, 93, 23, 84} rand.Seed(time.Now().UnixNano()) fmt.Println("unsorted:", list) temp := make([]int, len(list)) copy(temp, list) for !sort.IntsAreSorted(temp) { for i, v := range rand.Perm(len(list)) { temp[i] = list[v] } } fmt.Println("sorted! ", temp) }
Private Function Knuth(a As Variant) As Variant Dim t As Variant, i As Integer If Not IsMissing(a) Then For i = UBound(a) To LBound(a) + 1 Step -1 j = Int((UBound(a) - LBound(a) + 1) * Rnd + LBound(a)) t = a(i) a(i) = a(j) a(j) = t Next i End If Knuth = a End Function Private Function inOrder(s As Variant) i = 2 Do While i <= UBound(s) If s(i) < s(i - 1) Then inOrder = False Exit Function End If i = i + 1 Loop inOrder = True End Function Private Function bogosort(ByVal s As Variant) As Variant Do While Not inOrder(s) Debug.Print Join(s, ", ") s = Knuth(s) Loop bogosort = s End Function Public Sub main() Debug.Print Join(bogosort(Knuth([{1,2,3,4,5,6}])), ", ") End Sub
Ensure the translated VB code behaves exactly like the original Go snippet.
package main import ( "fmt" "math" ) type fdy func(float64, float64) float64 func eulerStep(f fdy, x, y, h float64) float64 { return y + h*f(x, y) } func newCoolingRate(k float64) func(float64) float64 { return func(deltaTemp float64) float64 { return -k * deltaTemp } } func newTempFunc(k, ambientTemp, initialTemp float64) func(float64) float64 { return func(time float64) float64 { return ambientTemp + (initialTemp-ambientTemp)*math.Exp(-k*time) } } func newCoolingRateDy(k, ambientTemp float64) fdy { crf := newCoolingRate(k) return func(_, objectTemp float64) float64 { return crf(objectTemp - ambientTemp) } } func main() { k := .07 tempRoom := 20. tempObject := 100. fcr := newCoolingRateDy(k, tempRoom) analytic := newTempFunc(k, tempRoom, tempObject) for _, deltaTime := range []float64{2, 5, 10} { fmt.Printf("Step size = %.1f\n", deltaTime) fmt.Println(" Time Euler's Analytic") temp := tempObject for time := 0.; time <= 100; time += deltaTime { fmt.Printf("%5.1f %7.3f %7.3f\n", time, temp, analytic(time)) temp = eulerStep(fcr, time, temp, deltaTime) } fmt.Println() } }
Private Sub ivp_euler(f As String, y As Double, step As Integer, end_t As Integer) Dim t As Integer Debug.Print " Step "; step; ": ", Do While t <= end_t If t Mod 10 = 0 Then Debug.Print Format(y, "0.000"), y = y + step * Application.Run(f, y) t = t + step Loop Debug.Print End Sub Sub analytic() Debug.Print " Time: ", For t = 0 To 100 Step 10 Debug.Print " "; t, Next t Debug.Print Debug.Print "Analytic: ", For t = 0 To 100 Step 10 Debug.Print Format(20 + 80 * Exp(-0.07 * t), "0.000"), Next t Debug.Print End Sub Private Function cooling(temp As Double) As Double cooling = -0.07 * (temp - 20) End Function Public Sub euler_method() Dim r_cooling As String r_cooling = "cooling" analytic ivp_euler r_cooling, 100, 2, 100 ivp_euler r_cooling, 100, 5, 100 ivp_euler r_cooling, 100, 10, 100 End Sub
Write the same code in VB as shown below in Go.
package main import ( "fmt" "math" ) func remarkable(n int) int { return n + int(.5+math.Sqrt(float64(n))) } func main() { fmt.Println(" n r(n)") fmt.Println("--- ---") for n := 1; n <= 22; n++ { fmt.Printf("%3d %3d\n", n, remarkable(n)) } const limit = 1e6 fmt.Println("\nChecking for squares for n <", limit) next := 2 nextSq := 4 for n := 1; n < limit; n++ { r := remarkable(n) switch { case r == nextSq: panic(n) case r > nextSq: fmt.Println(nextSq, "didn't occur") next++ nextSq = next * next } } fmt.Println("No squares occur for n <", limit) }
Sub Main() Dim i&, c&, j#, s$ Const N& = 1000000 s = "values for n in the range 1 to 22 : " For i = 1 To 22 s = s & ns(i) & ", " Next For i = 1 To N j = Sqr(ns(i)) If j = CInt(j) Then c = c + 1 Next Debug.Print s Debug.Print c & " squares less than " & N End Sub Private Function ns(l As Long) As Long ns = l + Int(1 / 2 + Sqr(l)) End Function
Translate this program into VB but keep the logic exactly as in Go.
package main import ( "fmt" "strings" ) func main() { s := "ABCDEFGH" n, m := 2, 3 fmt.Println("Index: ", "01234567") fmt.Println("String:", s) fmt.Printf("Start %d, length %d: %s\n", n, m, s[n : n+m]) fmt.Printf("Start %d, to end: %s\n", n, s[n:]) fmt.Printf("All but last: %s\n", s[:len(s)-1]) dx := strings.IndexByte(s, 'D') fmt.Printf("Start 'D', length %d: %s\n", m, s[dx : dx+m]) sx := strings.Index(s, "DE") fmt.Printf(`Start "DE", length %d: %s`+"\n", m, s[sx : sx+m]) }
Public Sub substring() sentence = "the last thing the man said was the" n = 10: m = 5 Debug.Print Mid(sentence, n, 5) Debug.Print Right(sentence, Len(sentence) - n + 1) Debug.Print Left(sentence, Len(sentence) - 1) k = InStr(1, sentence, "m") Debug.Print Mid(sentence, k, 5) k = InStr(1, sentence, "aid") Debug.Print Mid(sentence, k, 5) End Sub
Preserve the algorithm and functionality while converting the code from Go to VB.
package main import ( "log" "sort" ) func main() { log.Println(jortSort([]int{1, 2, 1, 11, 213, 2, 4})) log.Println(jortSort([]int{0, 1, 0, 0, 0, 0})) log.Println(jortSort([]int{1, 2, 4, 11, 22, 22})) log.Println(jortSort([]int{0, 0, 0, 1, 2, 2})) } func jortSort(a []int) bool { c := make([]int, len(a)) copy(c, a) sort.Ints(a) for k, v := range c { if v == a[k] { continue } else { return false } } return true }
Function JortSort(s) JortSort = True arrPreSort = Split(s,",") Set arrSorted = CreateObject("System.Collections.ArrayList") For i = 0 To UBound(arrPreSort) arrSorted.Add(arrPreSort(i)) Next arrSorted.Sort() For j = 0 To UBound(arrPreSort) If arrPreSort(j) <> arrSorted(j) Then JortSort = False Exit For End If Next End Function WScript.StdOut.Write JortSort("1,2,3,4,5") WScript.StdOut.WriteLine WScript.StdOut.Write JortSort("1,2,3,5,4") WScript.StdOut.WriteLine WScript.StdOut.Write JortSort("a,b,c") WScript.StdOut.WriteLine WScript.StdOut.Write JortSort("a,c,b")
Produce a functionally identical VB code for the snippet given in Go.
func isLeap(year int) bool { return year%400 == 0 || year%4 == 0 && year%100 != 0 }
Public Function Leap_year(year As Integer) As Boolean Leap_year = (Month(DateSerial(year, 2, 29)) = 2) End Function
Maintain the same structure and functionality when rewriting this code in VB.
package main import ( "fmt" "math/big" ) func main() { var n, p int64 fmt.Printf("A sample of permutations from 1 to 12:\n") for n = 1; n < 13; n++ { p = n / 3 fmt.Printf("P(%d,%d) = %d\n", n, p, perm(big.NewInt(n), big.NewInt(p))) } fmt.Printf("\nA sample of combinations from 10 to 60:\n") for n = 10; n < 61; n += 10 { p = n / 3 fmt.Printf("C(%d,%d) = %d\n", n, p, comb(big.NewInt(n), big.NewInt(p))) } fmt.Printf("\nA sample of permutations from 5 to 15000:\n") nArr := [...]int64{5, 50, 500, 1000, 5000, 15000} for _, n = range nArr { p = n / 3 fmt.Printf("P(%d,%d) = %d\n", n, p, perm(big.NewInt(n), big.NewInt(p))) } fmt.Printf("\nA sample of combinations from 100 to 1000:\n") for n = 100; n < 1001; n += 100 { p = n / 3 fmt.Printf("C(%d,%d) = %d\n", n, p, comb(big.NewInt(n), big.NewInt(p))) } } func fact(n *big.Int) *big.Int { if n.Sign() < 1 { return big.NewInt(0) } r := big.NewInt(1) i := big.NewInt(2) for i.Cmp(n) < 1 { r.Mul(r, i) i.Add(i, big.NewInt(1)) } return r } func perm(n, k *big.Int) *big.Int { r := fact(n) r.Div(r, fact(n.Sub(n, k))) return r } func comb(n, r *big.Int) *big.Int { if r.Cmp(n) == 1 { return big.NewInt(0) } if r.Cmp(n) == 0 { return big.NewInt(1) } c := fact(n) den := fact(n.Sub(n, r)) den.Mul(den, fact(r)) c.Div(c, den) return c }
dim i,j Wscript.StdOut.WriteLine "-- Long Integer - Permutations - from 1 to 12" for i=1 to 12 for j=1 to i Wscript.StdOut.Write "P(" & i & "," & j & ")=" & perm(i,j) & " " next Wscript.StdOut.WriteLine "" next Wscript.StdOut.WriteLine "-- Float integer - Combinations from 10 to 60" for i=10 to 60 step 10 for j=1 to i step i\5 Wscript.StdOut.Write "C(" & i & "," & j & ")=" & comb(i,j) & " " next Wscript.StdOut.WriteLine "" next Wscript.StdOut.WriteLine "-- Float integer - Permutations from 5000 to 15000" for i=5000 to 15000 step 5000 for j=10 to 70 step 20 Wscript.StdOut.Write "C(" & i & "," & j & ")=" & perm(i,j) & " " next Wscript.StdOut.WriteLine "" next Wscript.StdOut.WriteLine "-- Float integer - Combinations from 200 to 1000" for i=200 to 1000 step 200 for j=20 to 100 step 20 Wscript.StdOut.Write "P(" & i & "," & j & ")=" & comb(i,j) & " " next Wscript.StdOut.WriteLine "" next function perm(x,y) dim i,z z=1 for i=x-y+1 to x z=z*i next perm=z end function function fact(x) dim i,z z=1 for i=2 to x z=z*i next fact=z end function function comb(byval x,byval y) if y>x then comb=0 elseif x=y then comb=1 else if x-y<y then y=x-y comb=perm(x,y)/fact(y) end if end function
Change the programming language of this snippet from Go to VB without modifying what it does.
package main import ( "fmt" "sort" "strconv" ) func lexOrder(n int) []int { first, last, k := 1, n, n if n < 1 { first, last, k = n, 1, 2-n } strs := make([]string, k) for i := first; i <= last; i++ { strs[i-first] = strconv.Itoa(i) } sort.Strings(strs) ints := make([]int, k) for i := 0; i < k; i++ { ints[i], _ = strconv.Atoi(strs[i]) } return ints } func main() { fmt.Println("In lexicographical order:\n") for _, n := range []int{0, 5, 13, 21, -22} { fmt.Printf("%3d: %v\n", n, lexOrder(n)) } }
Public Function sortlexicographically(N As Integer) Dim arrList As Object Set arrList = CreateObject("System.Collections.ArrayList") For i = 1 To N arrList.Add CStr(i) Next i arrList.Sort Dim item As Variant For Each item In arrList Debug.Print item & ", "; Next End Function Public Sub main() Call sortlexicographically(13) End Sub
Transform the following Go implementation into VB, maintaining the same output and logic.
package main import "fmt" func main() { for _, n := range []int64{12, 1048576, 9e18, -2, 0} { fmt.Println(say(n)) } } var small = [...]string{"zero", "one", "two", "three", "four", "five", "six", "seven", "eight", "nine", "ten", "eleven", "twelve", "thirteen", "fourteen", "fifteen", "sixteen", "seventeen", "eighteen", "nineteen"} var tens = [...]string{"", "", "twenty", "thirty", "forty", "fifty", "sixty", "seventy", "eighty", "ninety"} var illions = [...]string{"", " thousand", " million", " billion", " trillion", " quadrillion", " quintillion"} func say(n int64) string { var t string if n < 0 { t = "negative " n = -n } switch { case n < 20: t += small[n] case n < 100: t += tens[n/10] s := n % 10 if s > 0 { t += "-" + small[s] } case n < 1000: t += small[n/100] + " hundred" s := n % 100 if s > 0 { t += " " + say(s) } default: sx := "" for i := 0; n > 0; i++ { p := n % 1000 n /= 1000 if p > 0 { ix := say(p) + illions[i] if sx != "" { ix += " " + sx } sx = ix } } t += sx } return t }
Public twenties As Variant Public decades As Variant Public orders As Variant Private Sub init() twenties = [{"zero","one","two","three","four","five","six","seven","eight","nine","ten", "eleven","twelve","thirteen","fourteen","fifteen","sixteen","seventeen","eighteen","nineteen"}] decades = [{"twenty","thirty","forty","fifty","sixty","seventy","eighty","ninety"}] orders = [{1E15,"quadrillion"; 1E12,"trillion"; 1E9,"billion"; 1E6,"million"; 1E3,"thousand"}] End Sub Private Function Twenty(N As Variant) Twenty = twenties(N Mod 20 + 1) End Function Private Function Decade(N As Variant) Decade = decades(N Mod 10 - 1) End Function Private Function Hundred(N As Variant) If N < 20 Then Hundred = Twenty(N) Exit Function Else If N Mod 10 = 0 Then Hundred = Decade((N \ 10) Mod 10) Exit Function End If End If Hundred = Decade(N \ 10) & "-" & Twenty(N Mod 10) End Function Private Function Thousand(N As Variant, withand As String) If N < 100 Then Thousand = withand & Hundred(N) Exit Function Else If N Mod 100 = 0 Then Thousand = withand & Twenty(WorksheetFunction.Floor_Precise(N / 100)) & " hundred" Exit Function End If End If Thousand = Twenty(N \ 100) & " hundred and " & Hundred(N Mod 100) End Function Private Function Triplet(N As Variant) Dim Order, High As Variant, Low As Variant Dim Name As String, res As String For i = 1 To UBound(orders) Order = orders(i, 1) Name = orders(i, 2) High = WorksheetFunction.Floor_Precise(N / Order) Low = N - High * Order If High <> 0 Then res = res & Thousand(High, "") & " " & Name End If N = Low If Low = 0 Then Exit For If Len(res) And High <> 0 Then res = res & ", " End If Next i If N <> 0 Or res = "" Then res = res & Thousand(WorksheetFunction.Floor_Precise(N), IIf(res = "", "", "and ")) N = N - Int(N) If N > 0.000001 Then res = res & " point" For i = 1 To 10 n_ = WorksheetFunction.Floor_Precise(N * 10.0000001) res = res & " " & twenties(n_ + 1) N = N * 10 - n_ If Abs(N) < 0.000001 Then Exit For Next i End If End If Triplet = res End Function Private Function spell(N As Variant) Dim res As String If N < 0 Then res = "minus " N = -N End If res = res & Triplet(N) spell = res End Function Private Function smartp(N As Variant) Dim res As String If N = WorksheetFunction.Floor_Precise(N) Then smartp = CStr(N) Exit Function End If res = CStr(N) If InStr(1, res, ".") Then res = Left(res, InStr(1, res, ".")) End If smartp = res End Function Sub Main() Dim si As Variant init Samples1 = [{99, 300, 310, 417, 1501, 12609, 200000000000100, 999999999999999, -123456787654321,102003000400005,1020030004,102003,102,1,0,-1,-99, -1501,1234,12.34}] Samples2 = [{10000001.2,1E-3,-2.7182818, 201021002001,-20102100200,2010210020,-201021002,20102100,-2010210, 201021,-20102,2010,-201,20,-2}] For i = 1 To UBound(Samples1) si = Samples1(i) Debug.Print Format(smartp(si), "@@@@@@@@@@@@@@@@"); " "; spell(si) Next i For i = 1 To UBound(Samples2) si = Samples2(i) Debug.Print Format(smartp(si), "@@@@@@@@@@@@@@@@"); " "; spell(si) Next i End Sub
Ensure the translated VB code behaves exactly like the original Go snippet.
package main import "fmt" var a = []int{170, 45, 75, -90, -802, 24, 2, 66} func main() { fmt.Println("before:", a) for inc := len(a) / 2; inc > 0; inc = (inc + 1) * 5 / 11 { for i := inc; i < len(a); i++ { j, temp := i, a[i] for ; j >= inc && a[j-inc] > temp; j -= inc { a[j] = a[j-inc] } a[j] = temp } } fmt.Println("after: ", a) }
Sub arrShellSort(ByVal arrData As Variant) Dim lngHold, lngGap As Long Dim lngCount, lngMin, lngMax As Long Dim varItem As Variant lngMin = LBound(arrData) lngMax = UBound(arrData) lngGap = lngMin Do While (lngGap < lngMax) lngGap = 3 * lngGap + 1 Loop Do While (lngGap > 1) lngGap = lngGap \ 3 For lngCount = lngGap + lngMin To lngMax varItem = arrData(lngCount) lngHold = lngCount Do While ((arrData(lngHold - lngGap) > varItem)) arrData(lngHold) = arrData(lngHold - lngGap) lngHold = lngHold - lngGap If (lngHold < lngMin + lngGap) Then Exit Do Loop arrData(lngHold) = varItem Next Loop arrShellSort = arrData End Sub
Rewrite this program in VB while keeping its functionality equivalent to the Go version.
type dlNode struct { int next, prev *dlNode } type dlList struct { members map[*dlNode]int head, tail **dlNode }
Public Class DoubleLinkList(Of T) Private m_Head As Node(Of T) Private m_Tail As Node(Of T) Public Sub AddHead(ByVal value As T) Dim node As New Node(Of T)(Me, value) If m_Head Is Nothing Then m_Head = Node m_Tail = m_Head Else node.Next = m_Head m_Head = node End If End Sub Public Sub AddTail(ByVal value As T) Dim node As New Node(Of T)(Me, value) If m_Tail Is Nothing Then m_Head = node m_Tail = m_Head Else node.Previous = m_Tail m_Tail = node End If End Sub Public ReadOnly Property Head() As Node(Of T) Get Return m_Head End Get End Property Public ReadOnly Property Tail() As Node(Of T) Get Return m_Tail End Get End Property Public Sub RemoveTail() If m_Tail Is Nothing Then Return If m_Tail.Previous Is Nothing Then m_Head = Nothing m_Tail = Nothing Else m_Tail = m_Tail.Previous m_Tail.Next = Nothing End If End Sub Public Sub RemoveHead() If m_Head Is Nothing Then Return If m_Head.Next Is Nothing Then m_Head = Nothing m_Tail = Nothing Else m_Head = m_Head.Next m_Head.Previous = Nothing End If End Sub End Class Public Class Node(Of T) Private ReadOnly m_Value As T Private m_Next As Node(Of T) Private m_Previous As Node(Of T) Private ReadOnly m_Parent As DoubleLinkList(Of T) Public Sub New(ByVal parent As DoubleLinkList(Of T), ByVal value As T) m_Parent = parent m_Value = value End Sub Public Property [Next]() As Node(Of T) Get Return m_Next End Get Friend Set(ByVal value As Node(Of T)) m_Next = value End Set End Property Public Property Previous() As Node(Of T) Get Return m_Previous End Get Friend Set(ByVal value As Node(Of T)) m_Previous = value End Set End Property Public ReadOnly Property Value() As T Get Return m_Value End Get End Property Public Sub InsertAfter(ByVal value As T) If m_Next Is Nothing Then m_Parent.AddTail(value) ElseIf m_Previous Is Nothing Then m_Parent.AddHead(value) Else Dim node As New Node(Of T)(m_Parent, value) node.Previous = Me node.Next = Me.Next Me.Next.Previous = node Me.Next = node End If End Sub Public Sub Remove() If m_Next Is Nothing Then m_Parent.RemoveTail() ElseIf m_Previous Is Nothing Then m_Parent.RemoveHead() Else m_Previous.Next = Me.Next m_Next.Previous = Me.Previous End If End Sub End Class
Convert the following code from Go to VB, ensuring the logic remains intact.
package main import ( "fmt" "io/ioutil" "sort" "unicode" ) const file = "unixdict.txt" func main() { bs, err := ioutil.ReadFile(file) if err != nil { fmt.Println(err) return } m := make(map[rune]int) for _, r := range string(bs) { m[r]++ } lfs := make(lfList, 0, len(m)) for l, f := range m { lfs = append(lfs, &letterFreq{l, f}) } sort.Sort(lfs) fmt.Println("file:", file) fmt.Println("letter frequency") for _, lf := range lfs { if unicode.IsGraphic(lf.rune) { fmt.Printf(" %c %7d\n", lf.rune, lf.freq) } else { fmt.Printf("%U %7d\n", lf.rune, lf.freq) } } } type letterFreq struct { rune freq int } type lfList []*letterFreq func (lfs lfList) Len() int { return len(lfs) } func (lfs lfList) Less(i, j int) bool { switch fd := lfs[i].freq - lfs[j].freq; { case fd < 0: return false case fd > 0: return true } return lfs[i].rune < lfs[j].rune } func (lfs lfList) Swap(i, j int) { lfs[i], lfs[j] = lfs[j], lfs[i] }
TYPE regChar Character AS STRING * 3 Count AS LONG END TYPE DIM iChar AS INTEGER DIM iCL AS INTEGER DIM iCountChars AS INTEGER DIM iFile AS INTEGER DIM i AS INTEGER DIM lMUC AS LONG DIM iMUI AS INTEGER DIM lLUC AS LONG DIM iLUI AS INTEGER DIM iMaxIdx AS INTEGER DIM iP AS INTEGER DIM iPause AS INTEGER DIM iPMI AS INTEGER DIM iPrint AS INTEGER DIM lHowMany AS LONG DIM lTotChars AS LONG DIM sTime AS SINGLE DIM strFile AS STRING DIM strTxt AS STRING DIM strDate AS STRING DIM strTime AS STRING DIM strKey AS STRING CONST LngReg = 256 CONST Letters = 1 CONST FALSE = 0 CONST TRUE = NOT FALSE strDate = DATE$ strTime = TIME$ iFile = FREEFILE DO CLS PRINT "This program counts letters or characters in a text file." PRINT INPUT "File to open: ", strFile OPEN strFile FOR BINARY AS #iFile IF LOF(iFile) > 0 THEN PRINT "Count: 1) Letters 2) Characters (1 or 2)"; DO strKey = INKEY$ LOOP UNTIL strKey = "1" OR strKey = "2" PRINT ". Option selected: "; strKey iCL = VAL(strKey) sTime = TIMER iP = POS(0) lHowMany = LOF(iFile) strTxt = SPACE$(LngReg) IF iCL = Letters THEN iMaxIdx = 26 ELSE iMaxIdx = 255 END IF IF iMaxIdx <> iPMI THEN iPMI = iMaxIdx REDIM rChar(0 TO iMaxIdx) AS regChar FOR i = 0 TO iMaxIdx IF iCL = Letters THEN strTxt = CHR$(i + 65) IF i = 26 THEN strTxt = CHR$(165) ELSE SELECT CASE i CASE 0: strTxt = "nul" CASE 7: strTxt = "bel" CASE 9: strTxt = "tab" CASE 10: strTxt = "lf" CASE 11: strTxt = "vt" CASE 12: strTxt = "ff" CASE 13: strTxt = "cr" CASE 28: strTxt = "fs" CASE 29: strTxt = "gs" CASE 30: strTxt = "rs" CASE 31: strTxt = "us" CASE 32: strTxt = "sp" CASE ELSE: strTxt = CHR$(i) END SELECT END IF rChar(i).Character = strTxt NEXT i ELSE FOR i = 0 TO iMaxIdx rChar(i).Count = 0 NEXT i END IF PRINT "Looking for "; IF iCL = Letters THEN PRINT "letters."; ELSE PRINT "characters."; PRINT " File is"; STR$(lHowMany); " in size. Working"; : COLOR 23: PRINT "..."; : COLOR (7) DO WHILE LOC(iFile) < LOF(iFile) IF LOC(iFile) + LngReg > LOF(iFile) THEN strTxt = SPACE$(LOF(iFile) - LOC(iFile)) END IF GET #iFile, , strTxt FOR i = 1 TO LEN(strTxt) IF iCL = Letters THEN iChar = ASC(UCASE$(MID$(strTxt, i, 1))) SELECT CASE iChar CASE 164: iChar = 165 CASE 160: iChar = 65 CASE 130, 144: iChar = 69 CASE 161: iChar = 73 CASE 162: iChar = 79 CASE 163, 129: iChar = 85 END SELECT iChar = iChar - 65 IF iChar >= 0 AND iChar <= 25 THEN rChar(iChar).Count = rChar(iChar).Count + 1 ELSEIF iChar = 100 THEN rChar(iMaxIdx).Count = rChar(iMaxIdx).Count + 1 END IF ELSE iChar = ASC(MID$(strTxt, i, 1)) rChar(iChar).Count = rChar(iChar).Count + 1 END IF NEXT i LOOP CLOSE #iFile lMUC = 0 iMUI = 0 lLUC = 2147483647 iLUI = 0 iPrint = FALSE lTotChars = 0 iCountChars = 0 iPause = FALSE CLS IF iCL = Letters THEN PRINT "Letters found: "; ELSE PRINT "Characters found: "; FOR i = 0 TO iMaxIdx IF lMUC < rChar(i).Count THEN lMUC = rChar(i).Count iMUI = i END IF IF rChar(i).Count > 0 THEN strTxt = "" IF iPrint THEN strTxt = ", " ELSE iPrint = TRUE strTxt = strTxt + LTRIM$(RTRIM$(rChar(i).Character)) strTxt = strTxt + "=" + LTRIM$(STR$(rChar(i).Count)) iP = POS(0) IF iP + LEN(strTxt) + 1 >= 80 AND iPrint THEN PRINT "," IF CSRLIN >= 23 AND NOT iPause THEN iPause = TRUE PRINT "Press a key to continue..." DO strKey = INKEY$ LOOP UNTIL strKey <> "" END IF strTxt = MID$(strTxt, 3) END IF PRINT strTxt; lTotChars = lTotChars + rChar(i).Count iCountChars = iCountChars + 1 IF lLUC > rChar(i).Count THEN lLUC = rChar(i).Count iLUI = i END IF END IF NEXT i PRINT "." PRINT PRINT "File analyzed....................: "; strFile PRINT "Looked for.......................: "; : IF iCL = Letters THEN PRINT "Letters" ELSE PRINT "Characters" PRINT "Total characters in file.........:"; lHowMany PRINT "Total characters counted.........:"; lTotChars IF iCL = Letters THEN PRINT "Characters discarded on count....:"; lHowMany - lTotChars PRINT "Distinct characters found in file:"; iCountChars; "of"; iMaxIdx + 1 PRINT "Most used character was..........: "; iPrint = FALSE FOR i = 0 TO iMaxIdx IF rChar(i).Count = lMUC THEN IF iPrint THEN PRINT ", "; ELSE iPrint = TRUE PRINT RTRIM$(LTRIM$(rChar(i).Character)); END IF NEXT i PRINT " ("; LTRIM$(STR$(rChar(iMUI).Count)); " times)" PRINT "Least used character was.........: "; iPrint = FALSE FOR i = 0 TO iMaxIdx IF rChar(i).Count = lLUC THEN IF iPrint THEN PRINT ", "; ELSE iPrint = TRUE PRINT RTRIM$(LTRIM$(rChar(i).Character)); END IF NEXT i PRINT " ("; LTRIM$(STR$(rChar(iLUI).Count)); " times)" PRINT "Time spent in the process........:"; TIMER - sTime; "seconds" ELSE CLOSE #iFile KILL strFile PRINT PRINT "File does not exist." END IF PRINT PRINT "Again? (Y/n)" DO strTxt = UCASE$(INKEY$) LOOP UNTIL strTxt = "N" OR strTxt = "Y" OR strTxt = CHR$(13) OR strTxt = CHR$(27) LOOP UNTIL strTxt = "N" OR strTxt = CHR$(27) CLS PRINT "End of execution." PRINT "Start time: "; strDate; " "; strTime; ", end time: "; DATE$; " "; TIME$; "." END
Ensure the translated VB code behaves exactly like the original Go snippet.
package main import "fmt" import "strconv" func main() { i, _ := strconv.Atoi("1234") fmt.Println(strconv.Itoa(i + 1)) }
Dim s As String = "123" s = CStr(CInt("123") + 1) s = (CInt("123") + 1).ToString
Generate a VB translation of this Go snippet without changing its computational steps.
package main import ( "fmt" "strings" ) func stripchars(str, chr string) string { return strings.Map(func(r rune) rune { if strings.IndexRune(chr, r) < 0 { return r } return -1 }, str) } func main() { fmt.Println(stripchars("She was a soul stripper. She took my heart!", "aei")) }
Function StripChars(stString As String, stStripChars As String, Optional bSpace As Boolean) Dim i As Integer, stReplace As String If bSpace = True Then stReplace = " " Else stReplace = "" End If For i = 1 To Len(stStripChars) stString = Replace(stString, Mid(stStripChars, i, 1), stReplace) Next i StripChars = stString End Function
Convert the following code from Go to VB, ensuring the logic remains intact.
package main import ( "fmt" "math" ) func mean(v []float64) (m float64, ok bool) { if len(v) == 0 { return } var parts []float64 for _, x := range v { var i int for _, p := range parts { sum := p + x var err float64 switch ax, ap := math.Abs(x), math.Abs(p); { case ax < ap: err = x - (sum - p) case ap < ax: err = p - (sum - x) } if err != 0 { parts[i] = err i++ } x = sum } parts = append(parts[:i], x) } var sum float64 for _, x := range parts { sum += x } return sum / float64(len(v)), true } func main() { for _, v := range [][]float64{ []float64{}, []float64{math.Inf(1), math.Inf(1)}, []float64{math.Inf(1), math.Inf(-1)}, []float64{3, 1, 4, 1, 5, 9}, []float64{1e20, 3, 1, 4, 1, 5, 9, -1e20}, []float64{10, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 0, 0, 0, .11}, []float64{10, 20, 30, 40, 50, -100, 4.7, -11e2}, } { fmt.Println("Vector:", v) if m, ok := mean(v); ok { fmt.Printf("Mean of %d numbers is %g\n\n", len(v), m) } else { fmt.Println("Mean undefined\n") } } }
Private Function mean(v() As Double, ByVal leng As Integer) As Variant Dim sum As Double, i As Integer sum = 0: i = 0 For i = 0 To leng - 1 sum = sum + vv Next i If leng = 0 Then mean = CVErr(xlErrDiv0) Else mean = sum / leng End If End Function Public Sub main() Dim v(4) As Double Dim i As Integer, leng As Integer v(0) = 1# v(1) = 2# v(2) = 2.178 v(3) = 3# v(4) = 3.142 For leng = 5 To 0 Step -1 Debug.Print "mean["; For i = 0 To leng - 1 Debug.Print IIf(i, "; " & v(i), "" & v(i)); Next i Debug.Print "] = "; mean(v, leng) Next leng End Sub
Produce a language-to-language conversion: from Go to VB, same semantics.
package main import ( "io" "os" "strconv" "strings" "text/tabwriter" ) func readTable(table string) ([]string, []int) { fields := strings.Fields(table) var commands []string var minLens []int for i, max := 0, len(fields); i < max; { cmd := fields[i] cmdLen := len(cmd) i++ if i < max { num, err := strconv.Atoi(fields[i]) if err == nil && 1 <= num && num < cmdLen { cmdLen = num i++ } } commands = append(commands, cmd) minLens = append(minLens, cmdLen) } return commands, minLens } func validateCommands(commands []string, minLens []int, words []string) []string { var results []string for _, word := range words { matchFound := false wlen := len(word) for i, command := range commands { if minLens[i] == 0 || wlen < minLens[i] || wlen > len(command) { continue } c := strings.ToUpper(command) w := strings.ToUpper(word) if strings.HasPrefix(c, w) { results = append(results, c) matchFound = true break } } if !matchFound { results = append(results, "*error*") } } return results } func printResults(words []string, results []string) { wr := tabwriter.NewWriter(os.Stdout, 0, 1, 1, ' ', 0) io.WriteString(wr, "user words:") for _, word := range words { io.WriteString(wr, "\t"+word) } io.WriteString(wr, "\n") io.WriteString(wr, "full words:\t"+strings.Join(results, "\t")+"\n") wr.Flush() } func main() { const table = "" + "add 1 alter 3 backup 2 bottom 1 Cappend 2 change 1 Schange Cinsert 2 Clast 3 " + "compress 4 copy 2 count 3 Coverlay 3 cursor 3 delete 3 Cdelete 2 down 1 duplicate " + "3 xEdit 1 expand 3 extract 3 find 1 Nfind 2 Nfindup 6 NfUP 3 Cfind 2 findUP 3 fUP 2 " + "forward 2 get help 1 hexType 4 input 1 powerInput 3 join 1 split 2 spltJOIN load " + "locate 1 Clocate 2 lowerCase 3 upperCase 3 Lprefix 2 macro merge 2 modify 3 move 2 " + "msg next 1 overlay 1 parse preserve 4 purge 3 put putD query 1 quit read recover 3 " + "refresh renum 3 repeat 3 replace 1 Creplace 2 reset 3 restore 4 rgtLEFT right 2 left " + "2 save set shift 2 si sort sos stack 3 status 4 top transfer 3 type 1 up 1 " const sentence = "riG rePEAT copies put mo rest types fup. 6 poweRin" commands, minLens := readTable(table) words := strings.Fields(sentence) results := validateCommands(commands, minLens, words) printResults(words, results) }
Private Function ValidateUserWords(userstring As String) As String Dim s As String Dim user_words() As String Dim command_table As Scripting.Dictionary Set command_table = New Scripting.Dictionary Dim abbreviations As Scripting.Dictionary Set abbreviations = New Scripting.Dictionary abbreviations.CompareMode = TextCompare Dim commandtable() As String Dim commands As String s = s & "add 1 alter 3 backup 2 bottom 1 Cappend 2 change 1 Schange Cinsert 2 Clast 3 " s = s & "compress 4 copy 2 count 3 Coverlay 3 cursor 3 delete 3 Cdelete 2 down 1 duplicate " s = s & "3 xEdit 1 expand 3 extract 3 find 1 Nfind 2 Nfindup 6 NfUP 3 Cfind 2 findUP 3 fUP 2 " s = s & "forward 2 get help 1 hexType 4 input 1 powerInput 3 join 1 split 2 spltJOIN load " s = s & "locate 1 Clocate 2 lowerCase 3 upperCase 3 Lprefix 2 macro merge 2 modify 3 move 2 " s = s & "msg next 1 overlay 1 parse preserve 4 purge 3 put putD query 1 quit read recover 3 " s = s & "refresh renum 3 repeat 3 replace 1 Creplace 2 reset 3 restore 4 rgtLEFT right 2 left " s = s & "2 save set shift 2 si sort sos stack 3 status 4 top transfer 3 type 1 up 1 " commandtable = Split(s, " ") Dim i As Integer, word As Variant, number As Integer For i = LBound(commandtable) To UBound(commandtable) word = commandtable(i) If Len(word) > 0 Then i = i + 1 Do While Len(commandtable(i)) = 0: i = i + 1: Loop number = Val(commandtable(i)) If number > 0 Then command_table.Add Key:=word, Item:=number Else command_table.Add Key:=word, Item:=Len(word) i = i - 1 End If End If Next i For Each word In command_table For i = command_table(word) To Len(word) On Error Resume Next abbreviations.Add Key:=Left(word, i), Item:=UCase(word) Next i Next word user_words() = Split(userstring, " ") For Each word In user_words If Len(word) > 0 Then If abbreviations.exists(word) Then commands = commands & abbreviations(word) & " " Else commands = commands & "*error* " End If End If Next word ValidateUserWords = commands End Function Public Sub program() Dim guserstring As String guserstring = "riG rePEAT copies put mo rest types fup. 6 poweRin" Debug.Print "user words:", guserstring Debug.Print "full words:", ValidateUserWords(guserstring) End Sub
Maintain the same structure and functionality when rewriting this code in VB.
package main import ( "io" "os" "strconv" "strings" "text/tabwriter" ) func readTable(table string) ([]string, []int) { fields := strings.Fields(table) var commands []string var minLens []int for i, max := 0, len(fields); i < max; { cmd := fields[i] cmdLen := len(cmd) i++ if i < max { num, err := strconv.Atoi(fields[i]) if err == nil && 1 <= num && num < cmdLen { cmdLen = num i++ } } commands = append(commands, cmd) minLens = append(minLens, cmdLen) } return commands, minLens } func validateCommands(commands []string, minLens []int, words []string) []string { var results []string for _, word := range words { matchFound := false wlen := len(word) for i, command := range commands { if minLens[i] == 0 || wlen < minLens[i] || wlen > len(command) { continue } c := strings.ToUpper(command) w := strings.ToUpper(word) if strings.HasPrefix(c, w) { results = append(results, c) matchFound = true break } } if !matchFound { results = append(results, "*error*") } } return results } func printResults(words []string, results []string) { wr := tabwriter.NewWriter(os.Stdout, 0, 1, 1, ' ', 0) io.WriteString(wr, "user words:") for _, word := range words { io.WriteString(wr, "\t"+word) } io.WriteString(wr, "\n") io.WriteString(wr, "full words:\t"+strings.Join(results, "\t")+"\n") wr.Flush() } func main() { const table = "" + "add 1 alter 3 backup 2 bottom 1 Cappend 2 change 1 Schange Cinsert 2 Clast 3 " + "compress 4 copy 2 count 3 Coverlay 3 cursor 3 delete 3 Cdelete 2 down 1 duplicate " + "3 xEdit 1 expand 3 extract 3 find 1 Nfind 2 Nfindup 6 NfUP 3 Cfind 2 findUP 3 fUP 2 " + "forward 2 get help 1 hexType 4 input 1 powerInput 3 join 1 split 2 spltJOIN load " + "locate 1 Clocate 2 lowerCase 3 upperCase 3 Lprefix 2 macro merge 2 modify 3 move 2 " + "msg next 1 overlay 1 parse preserve 4 purge 3 put putD query 1 quit read recover 3 " + "refresh renum 3 repeat 3 replace 1 Creplace 2 reset 3 restore 4 rgtLEFT right 2 left " + "2 save set shift 2 si sort sos stack 3 status 4 top transfer 3 type 1 up 1 " const sentence = "riG rePEAT copies put mo rest types fup. 6 poweRin" commands, minLens := readTable(table) words := strings.Fields(sentence) results := validateCommands(commands, minLens, words) printResults(words, results) }
Private Function ValidateUserWords(userstring As String) As String Dim s As String Dim user_words() As String Dim command_table As Scripting.Dictionary Set command_table = New Scripting.Dictionary Dim abbreviations As Scripting.Dictionary Set abbreviations = New Scripting.Dictionary abbreviations.CompareMode = TextCompare Dim commandtable() As String Dim commands As String s = s & "add 1 alter 3 backup 2 bottom 1 Cappend 2 change 1 Schange Cinsert 2 Clast 3 " s = s & "compress 4 copy 2 count 3 Coverlay 3 cursor 3 delete 3 Cdelete 2 down 1 duplicate " s = s & "3 xEdit 1 expand 3 extract 3 find 1 Nfind 2 Nfindup 6 NfUP 3 Cfind 2 findUP 3 fUP 2 " s = s & "forward 2 get help 1 hexType 4 input 1 powerInput 3 join 1 split 2 spltJOIN load " s = s & "locate 1 Clocate 2 lowerCase 3 upperCase 3 Lprefix 2 macro merge 2 modify 3 move 2 " s = s & "msg next 1 overlay 1 parse preserve 4 purge 3 put putD query 1 quit read recover 3 " s = s & "refresh renum 3 repeat 3 replace 1 Creplace 2 reset 3 restore 4 rgtLEFT right 2 left " s = s & "2 save set shift 2 si sort sos stack 3 status 4 top transfer 3 type 1 up 1 " commandtable = Split(s, " ") Dim i As Integer, word As Variant, number As Integer For i = LBound(commandtable) To UBound(commandtable) word = commandtable(i) If Len(word) > 0 Then i = i + 1 Do While Len(commandtable(i)) = 0: i = i + 1: Loop number = Val(commandtable(i)) If number > 0 Then command_table.Add Key:=word, Item:=number Else command_table.Add Key:=word, Item:=Len(word) i = i - 1 End If End If Next i For Each word In command_table For i = command_table(word) To Len(word) On Error Resume Next abbreviations.Add Key:=Left(word, i), Item:=UCase(word) Next i Next word user_words() = Split(userstring, " ") For Each word In user_words If Len(word) > 0 Then If abbreviations.exists(word) Then commands = commands & abbreviations(word) & " " Else commands = commands & "*error* " End If End If Next word ValidateUserWords = commands End Function Public Sub program() Dim guserstring As String guserstring = "riG rePEAT copies put mo rest types fup. 6 poweRin" Debug.Print "user words:", guserstring Debug.Print "full words:", ValidateUserWords(guserstring) End Sub
Port the following code from Go to VB with equivalent syntax and logic.
package main import ( "errors" "fmt" ) func TokenizeString(s string, sep, escape rune) (tokens []string, err error) { var runes []rune inEscape := false for _, r := range s { switch { case inEscape: inEscape = false fallthrough default: runes = append(runes, r) case r == escape: inEscape = true case r == sep: tokens = append(tokens, string(runes)) runes = runes[:0] } } tokens = append(tokens, string(runes)) if inEscape { err = errors.New("invalid terminal escape") } return tokens, err } func main() { const sample = "one^|uno||three^^^^|four^^^|^cuatro|" const separator = '|' const escape = '^' fmt.Printf("Input: %q\n", sample) tokens, err := TokenizeString(sample, separator, escape) if err != nil { fmt.Println("error:", err) } else { fmt.Printf("Tokens: %q\n", tokens) } }
Private Function tokenize(s As String, sep As String, esc As String) As Collection Dim ret As New Collection Dim this As String Dim skip As Boolean If Len(s) <> 0 Then For i = 1 To Len(s) si = Mid(s, i, 1) If skip Then this = this & si skip = False Else If si = esc Then skip = True Else If si = sep Then ret.Add this this = "" Else this = this & si End If End If End If Next i ret.Add this End If Set tokenize = ret End Function Public Sub main() Dim out As Collection Set out = tokenize("one^|uno||three^^^^|four^^^|^cuatro|", "|", "^") Dim outstring() As String ReDim outstring(out.Count - 1) For i = 0 To out.Count - 1 outstring(i) = out(i + 1) Next i Debug.Print Join(outstring, ", ") End Sub
Rewrite this program in VB while keeping its functionality equivalent to the Go version.
package main import ( "errors" "fmt" ) func TokenizeString(s string, sep, escape rune) (tokens []string, err error) { var runes []rune inEscape := false for _, r := range s { switch { case inEscape: inEscape = false fallthrough default: runes = append(runes, r) case r == escape: inEscape = true case r == sep: tokens = append(tokens, string(runes)) runes = runes[:0] } } tokens = append(tokens, string(runes)) if inEscape { err = errors.New("invalid terminal escape") } return tokens, err } func main() { const sample = "one^|uno||three^^^^|four^^^|^cuatro|" const separator = '|' const escape = '^' fmt.Printf("Input: %q\n", sample) tokens, err := TokenizeString(sample, separator, escape) if err != nil { fmt.Println("error:", err) } else { fmt.Printf("Tokens: %q\n", tokens) } }
Private Function tokenize(s As String, sep As String, esc As String) As Collection Dim ret As New Collection Dim this As String Dim skip As Boolean If Len(s) <> 0 Then For i = 1 To Len(s) si = Mid(s, i, 1) If skip Then this = this & si skip = False Else If si = esc Then skip = True Else If si = sep Then ret.Add this this = "" Else this = this & si End If End If End If Next i ret.Add this End If Set tokenize = ret End Function Public Sub main() Dim out As Collection Set out = tokenize("one^|uno||three^^^^|four^^^|^cuatro|", "|", "^") Dim outstring() As String ReDim outstring(out.Count - 1) For i = 0 To out.Count - 1 outstring(i) = out(i + 1) Next i Debug.Print Join(outstring, ", ") End Sub
Maintain the same structure and functionality when rewriting this code in VB.
package main import "fmt" func main() { fmt.Println("Hello world!") }
Public Sub hello_world_text Debug.Print "Hello World!" End Sub
Maintain the same structure and functionality when rewriting this code in VB.
package main import "fmt" func main() { a := []int{90, 47, 58, 29, 22, 32, 55, 5, 55, 73} fmt.Println(a) fmt.Println(fd(a, 9)) } func fd(a []int, ord int) []int { for i := 0; i < ord; i++ { for j := 0; j < len(a)-i-1; j++ { a[j] = a[j+1] - a[j] } } return a[:len(a)-ord] }
Module ForwardDifference Sub Main() Dim lNum As New List(Of Integer)(New Integer() {90, 47, 58, 29, 22, 32, 55, 5, 55, 73}) For i As UInteger = 0 To 9 Console.WriteLine(String.Join(" ", (From n In Difference(i, lNum) Select String.Format("{0,5}", n)).ToArray())) Next Console.ReadKey() End Sub Private Function Difference(ByVal Level As UInteger, ByVal Numbers As List(Of Integer)) As List(Of Integer) If Level >= Numbers.Count Then Throw New ArgumentOutOfRangeException("Level", "Level must be less than number of items in Numbers") For i As Integer = 1 To Level Numbers = (From n In Enumerable.Range(0, Numbers.Count - 1) _ Select Numbers(n + 1) - Numbers(n)).ToList() Next Return Numbers End Function End Module
Write the same algorithm in VB as shown in this Go implementation.
func IsPrime(n int) bool { if n < 0 { n = -n } switch { case n == 2: return true case n < 2 || n % 2 == 0: return false default: for i = 3; i*i <= n; i += 2 { if n % i == 0 { return false } } } return true }
Option Explicit Sub FirstTwentyPrimes() Dim count As Integer, i As Long, t(19) As String Do i = i + 1 If IsPrime(i) Then t(count) = i count = count + 1 End If Loop While count <= UBound(t) Debug.Print Join(t, ", ") End Sub Function IsPrime(Nb As Long) As Boolean If Nb = 2 Then IsPrime = True ElseIf Nb < 2 Or Nb Mod 2 = 0 Then Exit Function Else Dim i As Long For i = 3 To Sqr(Nb) Step 2 If Nb Mod i = 0 Then Exit Function Next IsPrime = True End If End Function
Convert this Go block to VB, preserving its control flow and logic.
package main import "fmt" import "math/big" func main() { fmt.Println(new(big.Int).Binomial(5, 3)) fmt.Println(new(big.Int).Binomial(60, 30)) }
Function binomial(n,k) binomial = factorial(n)/(factorial(n-k)*factorial(k)) End Function Function factorial(n) If n = 0 Then factorial = 1 Else For i = n To 1 Step -1 If i = n Then factorial = n Else factorial = factorial * i End If Next End If End Function WScript.StdOut.Write "the binomial coefficient of 5 and 3 = " & binomial(5,3) WScript.StdOut.WriteLine
Please provide an equivalent version of this Go code in VB.
package main import "fmt" func main() { var a []interface{} a = append(a, 3) a = append(a, "apples", "oranges") fmt.Println(a) }
Dim coll As New Collection coll.Add "apple" coll.Add "banana"
Change the following Go code into VB without altering its purpose.
start := &Ele{"tacos", nil} end := start.Append("burritos") end = end.Append("fajitas") end = end.Append("enchilatas") for iter := start; iter != nil; iter = iter.Next { fmt.Println(iter) }
Private Sub Iterate(ByVal list As LinkedList(Of Integer)) Dim node = list.First Do Until node Is Nothing node = node.Next Loop End Sub
Port the provided Go code into VB while preserving the original functionality.
start := &Ele{"tacos", nil} end := start.Append("burritos") end = end.Append("fajitas") end = end.Append("enchilatas") for iter := start; iter != nil; iter = iter.Next { fmt.Println(iter) }
Private Sub Iterate(ByVal list As LinkedList(Of Integer)) Dim node = list.First Do Until node Is Nothing node = node.Next Loop End Sub
Port the provided Go code into VB while preserving the original functionality.
package raster import ( "fmt" "io" "os" ) func (b *Bitmap) WritePpmTo(w io.Writer) (err error) { if _, err = fmt.Fprintln(w, "P6"); err != nil { return } for _, c := range b.Comments { if _, err = fmt.Fprintln(w, c); err != nil { return } } _, err = fmt.Fprintf(w, "%d %d\n255\n", b.cols, b.rows) if err != nil { return } b3 := make([]byte, 3*len(b.px)) n1 := 0 for _, px := range b.px { b3[n1] = px.R b3[n1+1] = px.G b3[n1+2] = px.B n1 += 3 } if _, err = w.Write(b3); err != nil { return } return } func (b *Bitmap) WritePpmFile(fn string) (err error) { var f *os.File if f, err = os.Create(fn); err != nil { return } if err = b.WritePpmTo(f); err != nil { return } return f.Close() }
Public Shared Sub SaveRasterBitmapToPpmFile(ByVal rasterBitmap As RasterBitmap, ByVal filepath As String) Dim header As String = String.Format("P6{0}{1}{2}{3}{0}255{0}", vbLf, rasterBitmap.Width, " "c, rasterBitmap.Height) Dim bufferSize As Integer = header.Length + (rasterBitmap.Width * rasterBitmap.Height * 3) Dim bytes(bufferSize - 1) As Byte Buffer.BlockCopy(Encoding.ASCII.GetBytes(header.ToString), 0, bytes, 0, header.Length) Dim index As Integer = header.Length For y As Integer = 0 To rasterBitmap.Height - 1 For x As Integer = 0 To rasterBitmap.Width - 1 Dim color As Rgb = rasterBitmap.GetPixel(x, y) bytes(index) = color.R bytes(index + 1) = color.G bytes(index + 2) = color.B index += 3 Next Next My.Computer.FileSystem.WriteAllBytes(filepath, bytes, False) End Sub
Write the same code in VB as shown below in Go.
package main import "os" func main() { os.Remove("input.txt") os.Remove("/input.txt") os.Remove("docs") os.Remove("/docs") os.RemoveAll("docs") os.RemoveAll("/docs") }
Option Explicit Sub DeleteFileOrDirectory() Dim myPath As String myPath = "C:\Users\surname.name\Desktop\Docs" Kill myPath & "\input.txt" RmDir myPath End Sub
Generate an equivalent VB version of this Go code.
package main import ( "fmt" "math" "math/rand" ) const nmax = 20 func main() { fmt.Println(" N average analytical (error)") fmt.Println("=== ========= ============ =========") for n := 1; n <= nmax; n++ { a := avg(n) b := ana(n) fmt.Printf("%3d %9.4f %12.4f (%6.2f%%)\n", n, a, b, math.Abs(a-b)/b*100) } } func avg(n int) float64 { const tests = 1e4 sum := 0 for t := 0; t < tests; t++ { var v [nmax]bool for x := 0; !v[x]; x = rand.Intn(n) { v[x] = true sum++ } } return float64(sum) / tests } func ana(n int) float64 { nn := float64(n) term := 1. sum := 1. for i := nn - 1; i >= 1; i-- { term *= i / nn sum += term } return sum }
Const MAX = 20 Const ITER = 1000000 Function expected(n As Long) As Double Dim sum As Double For i = 1 To n sum = sum + WorksheetFunction.Fact(n) / n ^ i / WorksheetFunction.Fact(n - i) Next i expected = sum End Function Function test(n As Long) As Double Dim count As Long Dim x As Long, bits As Long For i = 1 To ITER x = 1 bits = 0 Do While Not bits And x count = count + 1 bits = bits Or x x = 2 ^ (Int(n * Rnd())) Loop Next i test = count / ITER End Function Public Sub main() Dim n As Long Debug.Print " n avg. exp. (error%)" Debug.Print "== ====== ====== ========" For n = 1 To MAX av = test(n) ex = expected(n) Debug.Print Format(n, "@@"); " "; Format(av, "0.0000"); " "; Debug.Print Format(ex, "0.0000"); " ("; Format(Abs(1 - av / ex), "0.000%"); ")" Next n End Sub
Port the following code from Go to VB with equivalent syntax and logic.
package main import ( "fmt" "math" "math/rand" ) const nmax = 20 func main() { fmt.Println(" N average analytical (error)") fmt.Println("=== ========= ============ =========") for n := 1; n <= nmax; n++ { a := avg(n) b := ana(n) fmt.Printf("%3d %9.4f %12.4f (%6.2f%%)\n", n, a, b, math.Abs(a-b)/b*100) } } func avg(n int) float64 { const tests = 1e4 sum := 0 for t := 0; t < tests; t++ { var v [nmax]bool for x := 0; !v[x]; x = rand.Intn(n) { v[x] = true sum++ } } return float64(sum) / tests } func ana(n int) float64 { nn := float64(n) term := 1. sum := 1. for i := nn - 1; i >= 1; i-- { term *= i / nn sum += term } return sum }
Const MAX = 20 Const ITER = 1000000 Function expected(n As Long) As Double Dim sum As Double For i = 1 To n sum = sum + WorksheetFunction.Fact(n) / n ^ i / WorksheetFunction.Fact(n - i) Next i expected = sum End Function Function test(n As Long) As Double Dim count As Long Dim x As Long, bits As Long For i = 1 To ITER x = 1 bits = 0 Do While Not bits And x count = count + 1 bits = bits Or x x = 2 ^ (Int(n * Rnd())) Loop Next i test = count / ITER End Function Public Sub main() Dim n As Long Debug.Print " n avg. exp. (error%)" Debug.Print "== ====== ====== ========" For n = 1 To MAX av = test(n) ex = expected(n) Debug.Print Format(n, "@@"); " "; Format(av, "0.0000"); " "; Debug.Print Format(ex, "0.0000"); " ("; Format(Abs(1 - av / ex), "0.000%"); ")" Next n End Sub
Write a version of this Go function in VB with identical behavior.
package main import ( "fmt" ) func main() { str := "Mary had a %s lamb" txt := "little" out := fmt.Sprintf(str, txt) fmt.Println(out) }
Dim name as String = "J. Doe" Dim balance as Double = 123.45 Dim prompt as String = String.Format("Hello {0}, your balance is {1}.", name, balance) Console.WriteLine(prompt)
Ensure the translated VB code behaves exactly like the original Go snippet.
package main import ( "fmt" "permute" ) func determinant(m [][]float64) (d float64) { p := make([]int, len(m)) for i := range p { p[i] = i } it := permute.Iter(p) for s := it(); s != 0; s = it() { pr := 1. for i, σ := range p { pr *= m[i][σ] } d += float64(s) * pr } return } func permanent(m [][]float64) (d float64) { p := make([]int, len(m)) for i := range p { p[i] = i } it := permute.Iter(p) for s := it(); s != 0; s = it() { pr := 1. for i, σ := range p { pr *= m[i][σ] } d += pr } return } var m2 = [][]float64{ {1, 2}, {3, 4}} var m3 = [][]float64{ {2, 9, 4}, {7, 5, 3}, {6, 1, 8}} func main() { fmt.Println(determinant(m2), permanent(m2)) fmt.Println(determinant(m3), permanent(m3)) }
Module Module1 Function Minor(a As Double(,), x As Integer, y As Integer) As Double(,) Dim length = a.GetLength(0) - 1 Dim result(length - 1, length - 1) As Double For i = 1 To length For j = 1 To length If i < x AndAlso j < y Then result(i - 1, j - 1) = a(i - 1, j - 1) ElseIf i >= x AndAlso j < y Then result(i - 1, j - 1) = a(i, j - 1) ElseIf i < x AndAlso j >= y Then result(i - 1, j - 1) = a(i - 1, j) Else result(i - 1, j - 1) = a(i, j) End If Next Next Return result End Function Function Det(a As Double(,)) As Double If a.GetLength(0) = 1 Then Return a(0, 0) Else Dim sign = 1 Dim sum = 0.0 For i = 1 To a.GetLength(0) sum += sign * a(0, i - 1) * Det(Minor(a, 0, i)) sign *= -1 Next Return sum End If End Function Function Perm(a As Double(,)) As Double If a.GetLength(0) = 1 Then Return a(0, 0) Else Dim sum = 0.0 For i = 1 To a.GetLength(0) sum += a(0, i - 1) * Perm(Minor(a, 0, i)) Next Return sum End If End Function Sub WriteLine(a As Double(,)) For i = 1 To a.GetLength(0) Console.Write("[") For j = 1 To a.GetLength(1) If j > 1 Then Console.Write(", ") End If Console.Write(a(i - 1, j - 1)) Next Console.WriteLine("]") Next End Sub Sub Test(a As Double(,)) If a.GetLength(0) <> a.GetLength(1) Then Throw New ArgumentException("The dimensions must be equal") End If WriteLine(a) Console.WriteLine("Permanant  : {0}", Perm(a)) Console.WriteLine("Determinant: {0}", Det(a)) Console.WriteLine() End Sub Sub Main() Test({{1, 2}, {3, 4}}) Test({{1, 2, 3, 4}, {4, 5, 6, 7}, {7, 8, 9, 10}, {10, 11, 12, 13}}) Test({{0, 1, 2, 3, 4}, {5, 6, 7, 8, 9}, {10, 11, 12, 13, 14}, {15, 16, 17, 18, 19}, {20, 21, 22, 23, 24}}) End Sub End Module
Write the same code in VB as shown below in Go.
package main import ( "fmt" "permute" ) func determinant(m [][]float64) (d float64) { p := make([]int, len(m)) for i := range p { p[i] = i } it := permute.Iter(p) for s := it(); s != 0; s = it() { pr := 1. for i, σ := range p { pr *= m[i][σ] } d += float64(s) * pr } return } func permanent(m [][]float64) (d float64) { p := make([]int, len(m)) for i := range p { p[i] = i } it := permute.Iter(p) for s := it(); s != 0; s = it() { pr := 1. for i, σ := range p { pr *= m[i][σ] } d += pr } return } var m2 = [][]float64{ {1, 2}, {3, 4}} var m3 = [][]float64{ {2, 9, 4}, {7, 5, 3}, {6, 1, 8}} func main() { fmt.Println(determinant(m2), permanent(m2)) fmt.Println(determinant(m3), permanent(m3)) }
Module Module1 Function Minor(a As Double(,), x As Integer, y As Integer) As Double(,) Dim length = a.GetLength(0) - 1 Dim result(length - 1, length - 1) As Double For i = 1 To length For j = 1 To length If i < x AndAlso j < y Then result(i - 1, j - 1) = a(i - 1, j - 1) ElseIf i >= x AndAlso j < y Then result(i - 1, j - 1) = a(i, j - 1) ElseIf i < x AndAlso j >= y Then result(i - 1, j - 1) = a(i - 1, j) Else result(i - 1, j - 1) = a(i, j) End If Next Next Return result End Function Function Det(a As Double(,)) As Double If a.GetLength(0) = 1 Then Return a(0, 0) Else Dim sign = 1 Dim sum = 0.0 For i = 1 To a.GetLength(0) sum += sign * a(0, i - 1) * Det(Minor(a, 0, i)) sign *= -1 Next Return sum End If End Function Function Perm(a As Double(,)) As Double If a.GetLength(0) = 1 Then Return a(0, 0) Else Dim sum = 0.0 For i = 1 To a.GetLength(0) sum += a(0, i - 1) * Perm(Minor(a, 0, i)) Next Return sum End If End Function Sub WriteLine(a As Double(,)) For i = 1 To a.GetLength(0) Console.Write("[") For j = 1 To a.GetLength(1) If j > 1 Then Console.Write(", ") End If Console.Write(a(i - 1, j - 1)) Next Console.WriteLine("]") Next End Sub Sub Test(a As Double(,)) If a.GetLength(0) <> a.GetLength(1) Then Throw New ArgumentException("The dimensions must be equal") End If WriteLine(a) Console.WriteLine("Permanant  : {0}", Perm(a)) Console.WriteLine("Determinant: {0}", Det(a)) Console.WriteLine() End Sub Sub Main() Test({{1, 2}, {3, 4}}) Test({{1, 2, 3, 4}, {4, 5, 6, 7}, {7, 8, 9, 10}, {10, 11, 12, 13}}) Test({{0, 1, 2, 3, 4}, {5, 6, 7, 8, 9}, {10, 11, 12, 13, 14}, {15, 16, 17, 18, 19}, {20, 21, 22, 23, 24}}) End Sub End Module
Write a version of this Go function in VB with identical behavior.
package main import ( "fmt" "math" ) type xy struct { x, y float64 } type seg struct { p1, p2 xy } type poly struct { name string sides []seg } func inside(pt xy, pg poly) (i bool) { for _, side := range pg.sides { if rayIntersectsSegment(pt, side) { i = !i } } return } func rayIntersectsSegment(p xy, s seg) bool { var a, b xy if s.p1.y < s.p2.y { a, b = s.p1, s.p2 } else { a, b = s.p2, s.p1 } for p.y == a.y || p.y == b.y { p.y = math.Nextafter(p.y, math.Inf(1)) } if p.y < a.y || p.y > b.y { return false } if a.x > b.x { if p.x > a.x { return false } if p.x < b.x { return true } } else { if p.x > b.x { return false } if p.x < a.x { return true } } return (p.y-a.y)/(p.x-a.x) >= (b.y-a.y)/(b.x-a.x) } var ( p1 = xy{0, 0} p2 = xy{10, 0} p3 = xy{10, 10} p4 = xy{0, 10} p5 = xy{2.5, 2.5} p6 = xy{7.5, 2.5} p7 = xy{7.5, 7.5} p8 = xy{2.5, 7.5} p9 = xy{0, 5} p10 = xy{10, 5} p11 = xy{3, 0} p12 = xy{7, 0} p13 = xy{7, 10} p14 = xy{3, 10} ) var tpg = []poly{ {"square", []seg{{p1, p2}, {p2, p3}, {p3, p4}, {p4, p1}}}, {"square hole", []seg{{p1, p2}, {p2, p3}, {p3, p4}, {p4, p1}, {p5, p6}, {p6, p7}, {p7, p8}, {p8, p5}}}, {"strange", []seg{{p1, p5}, {p5, p4}, {p4, p8}, {p8, p7}, {p7, p3}, {p3, p2}, {p2, p5}}}, {"exagon", []seg{{p11, p12}, {p12, p10}, {p10, p13}, {p13, p14}, {p14, p9}, {p9, p11}}}, } var tpt = []xy{ {5, 5}, {5, 8}, {-10, 5}, {0, 5}, {10, 5}, {8, 5}, {10, 10}, {1, 2}, {2, 1}, } func main() { for _, pg := range tpg { fmt.Printf("%s:\n", pg.name) for _, pt := range tpt { fmt.Println(pt, inside(pt, pg)) } } }
Imports System.Math Module RayCasting Private square As Integer()() = {New Integer() {0, 0}, New Integer() {20, 0}, New Integer() {20, 20}, New Integer() {0, 20}} Private squareHole As Integer()() = {New Integer() {0, 0}, New Integer() {20, 0}, New Integer() {20, 20}, New Integer() {0, 20}, New Integer() {5, 5}, New Integer() {15, 5}, New Integer() {15, 15}, New Integer() {5, 15}} Private strange As Integer()() = {New Integer() {0, 0}, New Integer() {5, 5}, New Integer() {0, 20}, New Integer() {5, 15}, New Integer() {15, 15}, New Integer() {20, 20}, New Integer() {20, 0}} Private hexagon As Integer()() = {New Integer() {6, 0}, New Integer() {14, 0}, New Integer() {20, 10}, New Integer() {14, 20}, New Integer() {6, 20}, New Integer() {0, 10}} Private shapes As Integer()()() = {square, squareHole, strange, hexagon} Public Sub Main() Dim testPoints As Double()() = {New Double() {10, 10}, New Double() {10, 16}, New Double() {-20, 10}, New Double() {0, 10}, New Double() {20, 10}, New Double() {16, 10}, New Double() {20, 20}} For Each shape As Integer()() In shapes For Each point As Double() In testPoints Console.Write(String.Format("{0} ", Contains(shape, point).ToString.PadLeft(7))) Next Console.WriteLine() Next End Sub Private Function Contains(shape As Integer()(), point As Double()) As Boolean Dim inside As Boolean = False Dim length As Integer = shape.Length For i As Integer = 0 To length - 1 If Intersects(shape(i), shape((i + 1) Mod length), point) Then inside = Not inside End If Next Return inside End Function Private Function Intersects(a As Integer(), b As Integer(), p As Double()) As Boolean If a(1) > b(1) Then Return Intersects(b, a, p) If p(1) = a(1) Or p(1) = b(1) Then p(1) += 0.0001 If p(1) > b(1) Or p(1) < a(1) Or p(0) >= Max(a(0), b(0)) Then Return False If p(0) < Min(a(0), b(0)) Then Return True Dim red As Double = (p(1) - a(1)) / (p(0) - a(0)) Dim blue As Double = (b(1) - a(1)) / (b(0) - a(0)) Return red >= blue End Function End Module
Rewrite the snippet below in VB so it works the same as the original Go code.
package main import ( "fmt" "strings" ) func main() { fmt.Println(strings.Count("the three truths", "th")) fmt.Println(strings.Count("ababababab", "abab")) }
Function CountSubstring(str,substr) CountSubstring = 0 For i = 1 To Len(str) If Len(str) >= Len(substr) Then If InStr(i,str,substr) Then CountSubstring = CountSubstring + 1 i = InStr(i,str,substr) + Len(substr) - 1 End If Else Exit For End If Next End Function WScript.StdOut.Write CountSubstring("the three truths","th") & vbCrLf WScript.StdOut.Write CountSubstring("ababababab","abab") & vbCrLf
Convert this Go block to VB, preserving its control flow and logic.
package main import ( "fmt" "sort" "strconv" ) func combrep(n int, lst []byte) [][]byte { if n == 0 { return [][]byte{nil} } if len(lst) == 0 { return nil } r := combrep(n, lst[1:]) for _, x := range combrep(n-1, lst) { r = append(r, append(x, lst[0])) } return r } func shouldSwap(s []byte, start, curr int) bool { for i := start; i < curr; i++ { if s[i] == s[curr] { return false } } return true } func findPerms(s []byte, index, n int, res *[]string) { if index >= n { *res = append(*res, string(s)) return } for i := index; i < n; i++ { check := shouldSwap(s, index, i) if check { s[index], s[i] = s[i], s[index] findPerms(s, index+1, n, res) s[index], s[i] = s[i], s[index] } } } func main() { primes := []byte{2, 3, 5, 7} var res []string for n := 3; n <= 6; n++ { reps := combrep(n, primes) for _, rep := range reps { sum := byte(0) for _, r := range rep { sum += r } if sum == 13 { var perms []string for i := 0; i < len(rep); i++ { rep[i] += 48 } findPerms(rep, 0, len(rep), &perms) res = append(res, perms...) } } } res2 := make([]int, len(res)) for i, r := range res { res2[i], _ = strconv.Atoi(r) } sort.Ints(res2) fmt.Println("Those numbers whose digits are all prime and sum to 13 are:") fmt.Println(res2) }
Imports System Imports System.Console Imports LI = System.Collections.Generic.SortedSet(Of Integer) Module Module1 Function unl(ByVal res As LI, ByVal lst As LI, ByVal lft As Integer, ByVal Optional mul As Integer = 1, ByVal Optional vlu As Integer = 0) As LI If lft = 0 Then res.Add(vlu) ElseIf lft > 0 Then For Each itm As Integer In lst res = unl(res, lst, lft - itm, mul * 10, vlu + itm * mul) Next End If Return res End Function Sub Main(ByVal args As String()) WriteLine(string.Join(" ", unl(new LI From {}, new LI From { 2, 3, 5, 7 }, 13))) End Sub End Module
Generate a VB translation of this Go snippet without changing its computational steps.
package main import ( "fmt" "sort" "strconv" ) func combrep(n int, lst []byte) [][]byte { if n == 0 { return [][]byte{nil} } if len(lst) == 0 { return nil } r := combrep(n, lst[1:]) for _, x := range combrep(n-1, lst) { r = append(r, append(x, lst[0])) } return r } func shouldSwap(s []byte, start, curr int) bool { for i := start; i < curr; i++ { if s[i] == s[curr] { return false } } return true } func findPerms(s []byte, index, n int, res *[]string) { if index >= n { *res = append(*res, string(s)) return } for i := index; i < n; i++ { check := shouldSwap(s, index, i) if check { s[index], s[i] = s[i], s[index] findPerms(s, index+1, n, res) s[index], s[i] = s[i], s[index] } } } func main() { primes := []byte{2, 3, 5, 7} var res []string for n := 3; n <= 6; n++ { reps := combrep(n, primes) for _, rep := range reps { sum := byte(0) for _, r := range rep { sum += r } if sum == 13 { var perms []string for i := 0; i < len(rep); i++ { rep[i] += 48 } findPerms(rep, 0, len(rep), &perms) res = append(res, perms...) } } } res2 := make([]int, len(res)) for i, r := range res { res2[i], _ = strconv.Atoi(r) } sort.Ints(res2) fmt.Println("Those numbers whose digits are all prime and sum to 13 are:") fmt.Println(res2) }
Imports System Imports System.Console Imports LI = System.Collections.Generic.SortedSet(Of Integer) Module Module1 Function unl(ByVal res As LI, ByVal lst As LI, ByVal lft As Integer, ByVal Optional mul As Integer = 1, ByVal Optional vlu As Integer = 0) As LI If lft = 0 Then res.Add(vlu) ElseIf lft > 0 Then For Each itm As Integer In lst res = unl(res, lst, lft - itm, mul * 10, vlu + itm * mul) Next End If Return res End Function Sub Main(ByVal args As String()) WriteLine(string.Join(" ", unl(new LI From {}, new LI From { 2, 3, 5, 7 }, 13))) End Sub End Module
Produce a language-to-language conversion: from Go to VB, same semantics.
package main import ( "fmt" "io" "os" "strings" "time" ) func addNote(fn string, note string) error { f, err := os.OpenFile(fn, os.O_RDWR|os.O_APPEND|os.O_CREATE, 0666) if err != nil { return err } _, err = fmt.Fprint(f, time.Now().Format(time.RFC1123), "\n\t", note, "\n") if cErr := f.Close(); err == nil { err = cErr } return err } func showNotes(w io.Writer, fn string) error { f, err := os.Open(fn) if err != nil { if os.IsNotExist(err) { return nil } return err } _, err = io.Copy(w, f) f.Close() return err } func main() { const fn = "NOTES.TXT" var err error if len(os.Args) > 1 { err = addNote(fn, strings.Join(os.Args[1:], " ")) } else { err = showNotes(os.Stdout, fn) } if err != nil { fmt.Fprintln(os.Stderr, err) os.Exit(1) } }
Imports System.IO Module Notes Function Main(ByVal cmdArgs() As String) As Integer Try If cmdArgs.Length = 0 Then Using sr As New StreamReader("NOTES.TXT") Console.WriteLine(sr.ReadToEnd) End Using Else Using sw As New StreamWriter("NOTES.TXT", True) sw.WriteLine(Date.Now.ToString()) sw.WriteLine("{0}{1}", ControlChars.Tab, String.Join(" ", cmdArgs)) End Using End If Catch End Try End Function End Module
Please provide an equivalent version of this Go code in VB.
package main import ( "fmt" "os" "path" ) func CommonPrefix(sep byte, paths ...string) string { switch len(paths) { case 0: return "" case 1: return path.Clean(paths[0]) } c := []byte(path.Clean(paths[0])) c = append(c, sep) for _, v := range paths[1:] { v = path.Clean(v) + string(sep) if len(v) < len(c) { c = c[:len(v)] } for i := 0; i < len(c); i++ { if v[i] != c[i] { c = c[:i] break } } } for i := len(c) - 1; i >= 0; i-- { if c[i] == sep { c = c[:i] break } } return string(c) } func main() { c := CommonPrefix(os.PathSeparator, "/home/user1/tmp/coverage/test", "/home/user1/tmp/covert/operator", "/home/user1/tmp/coven/members", "/home "/home/user1/././tmp/covertly/foo", "/home/bob/../user1/tmp/coved/bar", ) if c == "" { fmt.Println("No common path") } else { fmt.Println("Common path:", c) } }
Public Function CommonDirectoryPath(ParamArray Paths()) As String Dim v As Variant Dim Path() As String, s As String Dim i As Long, j As Long, k As Long Const PATH_SEPARATOR As String = "/" For Each v In Paths ReDim Preserve Path(0 To i) Path(i) = v i = i + 1 Next v k = 1 Do For i = 0 To UBound(Path) If i Then If InStr(k, Path(i), PATH_SEPARATOR) <> j Then Exit Do ElseIf Left$(Path(i), j) <> Left$(Path(0), j) Then Exit Do End If Else j = InStr(k, Path(i), PATH_SEPARATOR) If j = 0 Then Exit Do End If End If Next i s = Left$(Path(0), j + CLng(k <> 1)) k = j + 1 Loop CommonDirectoryPath = s End Function Sub Main() Debug.Assert CommonDirectoryPath( _ "/home/user1/tmp/coverage/test", _ "/home/user1/tmp/covert/operator", _ "/home/user1/tmp/coven/members") = _ "/home/user1/tmp" Debug.Assert CommonDirectoryPath( _ "/home/user1/tmp/coverage/test", _ "/home/user1/tmp/covert/operator", _ "/home/user1/tmp/coven/members", _ "/home/user1/abc/coven/members") = _ "/home/user1" Debug.Assert CommonDirectoryPath( _ "/home/user1/tmp/coverage/test", _ "/hope/user1/tmp/covert/operator", _ "/home/user1/tmp/coven/members") = _ "/" End Sub
Translate the given Go code snippet into VB without altering its behavior.
package main import ( "fmt" "math" "math/rand" "time" ) func dice5() int { return rand.Intn(5) + 1 } func dice7() (i int) { for { i = 5*dice5() + dice5() if i < 27 { break } } return (i / 3) - 1 } func distCheck(f func() int, n int, repeats int, delta float64) (max float64, flatEnough bool) { count := make([]int, n) for i := 0; i < repeats; i++ { count[f()-1]++ } expected := float64(repeats) / float64(n) for _, c := range count { max = math.Max(max, math.Abs(float64(c)-expected)) } return max, max < delta } func main() { rand.Seed(time.Now().UnixNano()) const calls = 1000000 max, flatEnough := distCheck(dice7, 7, calls, 500) fmt.Println("Max delta:", max, "Flat enough:", flatEnough) max, flatEnough = distCheck(dice7, 7, calls, 500) fmt.Println("Max delta:", max, "Flat enough:", flatEnough) }
Option Explicit sub verifydistribution(calledfunction, samples, delta) Dim i, n, maxdiff Dim d : Set d = CreateObject("Scripting.Dictionary") wscript.echo "Running """ & calledfunction & """ " & samples & " times..." for i = 1 to samples Execute "n = " & calledfunction d(n) = d(n) + 1 next n = d.Count maxdiff = 0 wscript.echo "Expected average count is " & Int(samples/n) & " across " & n & " buckets." for each i in d.Keys dim diff : diff = abs(1 - d(i) / (samples/n)) if diff > maxdiff then maxdiff = diff wscript.echo "Bucket " & i & " had " & d(i) & " occurences" _ & vbTab & " difference from expected=" & FormatPercent(diff, 2) next wscript.echo "Maximum found variation is " & FormatPercent(maxdiff, 2) _ & ", desired limit is " & FormatPercent(delta, 2) & "." if maxdiff > delta then wscript.echo "Skewed!" else wscript.echo "Smooth!" end sub
Write a version of this Go function in VB with identical behavior.
package main import ( "fmt" "math/big" ) func main() { limit := 100 last := 12 s2 := make([][]*big.Int, limit+1) for n := 0; n <= limit; n++ { s2[n] = make([]*big.Int, limit+1) for k := 0; k <= limit; k++ { s2[n][k] = new(big.Int) } s2[n][n].SetInt64(int64(1)) } var t big.Int for n := 1; n <= limit; n++ { for k := 1; k <= n; k++ { t.SetInt64(int64(k)) t.Mul(&t, s2[n-1][k]) s2[n][k].Add(&t, s2[n-1][k-1]) } } fmt.Println("Stirling numbers of the second kind: S2(n, k):") fmt.Printf("n/k") for i := 0; i <= last; i++ { fmt.Printf("%9d ", i) } fmt.Printf("\n--") for i := 0; i <= last; i++ { fmt.Printf("----------") } fmt.Println() for n := 0; n <= last; n++ { fmt.Printf("%2d ", n) for k := 0; k <= n; k++ { fmt.Printf("%9d ", s2[n][k]) } fmt.Println() } fmt.Println("\nMaximum value from the S2(100, *) row:") max := new(big.Int).Set(s2[limit][0]) for k := 1; k <= limit; k++ { if s2[limit][k].Cmp(max) > 0 { max.Set(s2[limit][k]) } } fmt.Println(max) fmt.Printf("which has %d digits.\n", len(max.String())) }
Imports System.Numerics Module Module1 Class Sterling Private Shared ReadOnly COMPUTED As New Dictionary(Of String, BigInteger) Private Shared Function CacheKey(n As Integer, k As Integer) As String Return String.Format("{0}:{1}", n, k) End Function Private Shared Function Impl(n As Integer, k As Integer) As BigInteger If n = 0 AndAlso k = 0 Then Return 1 End If If (n > 0 AndAlso k = 0) OrElse (n = 0 AndAlso k > 0) Then Return 0 End If If n = k Then Return 1 End If If k > n Then Return 0 End If Return k * Sterling2(n - 1, k) + Sterling2(n - 1, k - 1) End Function Public Shared Function Sterling2(n As Integer, k As Integer) As BigInteger Dim key = CacheKey(n, k) If COMPUTED.ContainsKey(key) Then Return COMPUTED(key) End If Dim result = Impl(n, k) COMPUTED.Add(key, result) Return result End Function End Class Sub Main() Console.WriteLine("Stirling numbers of the second kind:") Dim max = 12 Console.Write("n/k") For n = 0 To max Console.Write("{0,10}", n) Next Console.WriteLine() For n = 0 To max Console.Write("{0,3}", n) For k = 0 To n Console.Write("{0,10}", Sterling.Sterling2(n, k)) Next Console.WriteLine() Next Console.WriteLine("The maximum value of S2(100, k) = ") Dim previous = BigInteger.Zero For k = 1 To 100 Dim current = Sterling.Sterling2(100, k) If current > previous Then previous = current Else Console.WriteLine(previous) Console.WriteLine("({0} digits, k = {1})", previous.ToString().Length, k - 1) Exit For End If Next End Sub End Module
Translate this program into VB but keep the logic exactly as in Go.
package main import ( "fmt" "math/big" ) func main() { limit := 100 last := 12 s2 := make([][]*big.Int, limit+1) for n := 0; n <= limit; n++ { s2[n] = make([]*big.Int, limit+1) for k := 0; k <= limit; k++ { s2[n][k] = new(big.Int) } s2[n][n].SetInt64(int64(1)) } var t big.Int for n := 1; n <= limit; n++ { for k := 1; k <= n; k++ { t.SetInt64(int64(k)) t.Mul(&t, s2[n-1][k]) s2[n][k].Add(&t, s2[n-1][k-1]) } } fmt.Println("Stirling numbers of the second kind: S2(n, k):") fmt.Printf("n/k") for i := 0; i <= last; i++ { fmt.Printf("%9d ", i) } fmt.Printf("\n--") for i := 0; i <= last; i++ { fmt.Printf("----------") } fmt.Println() for n := 0; n <= last; n++ { fmt.Printf("%2d ", n) for k := 0; k <= n; k++ { fmt.Printf("%9d ", s2[n][k]) } fmt.Println() } fmt.Println("\nMaximum value from the S2(100, *) row:") max := new(big.Int).Set(s2[limit][0]) for k := 1; k <= limit; k++ { if s2[limit][k].Cmp(max) > 0 { max.Set(s2[limit][k]) } } fmt.Println(max) fmt.Printf("which has %d digits.\n", len(max.String())) }
Imports System.Numerics Module Module1 Class Sterling Private Shared ReadOnly COMPUTED As New Dictionary(Of String, BigInteger) Private Shared Function CacheKey(n As Integer, k As Integer) As String Return String.Format("{0}:{1}", n, k) End Function Private Shared Function Impl(n As Integer, k As Integer) As BigInteger If n = 0 AndAlso k = 0 Then Return 1 End If If (n > 0 AndAlso k = 0) OrElse (n = 0 AndAlso k > 0) Then Return 0 End If If n = k Then Return 1 End If If k > n Then Return 0 End If Return k * Sterling2(n - 1, k) + Sterling2(n - 1, k - 1) End Function Public Shared Function Sterling2(n As Integer, k As Integer) As BigInteger Dim key = CacheKey(n, k) If COMPUTED.ContainsKey(key) Then Return COMPUTED(key) End If Dim result = Impl(n, k) COMPUTED.Add(key, result) Return result End Function End Class Sub Main() Console.WriteLine("Stirling numbers of the second kind:") Dim max = 12 Console.Write("n/k") For n = 0 To max Console.Write("{0,10}", n) Next Console.WriteLine() For n = 0 To max Console.Write("{0,3}", n) For k = 0 To n Console.Write("{0,10}", Sterling.Sterling2(n, k)) Next Console.WriteLine() Next Console.WriteLine("The maximum value of S2(100, k) = ") Dim previous = BigInteger.Zero For k = 1 To 100 Dim current = Sterling.Sterling2(100, k) If current > previous Then previous = current Else Console.WriteLine(previous) Console.WriteLine("({0} digits, k = {1})", previous.ToString().Length, k - 1) Exit For End If Next End Sub End Module
Preserve the algorithm and functionality while converting the code from Go to VB.
package main import "fmt" func main() { a := []int{0} used := make(map[int]bool, 1001) used[0] = true used1000 := make(map[int]bool, 1001) used1000[0] = true for n, foundDup := 1, false; n <= 15 || !foundDup || len(used1000) < 1001; n++ { next := a[n-1] - n if next < 1 || used[next] { next += 2 * n } alreadyUsed := used[next] a = append(a, next) if !alreadyUsed { used[next] = true if next >= 0 && next <= 1000 { used1000[next] = true } } if n == 14 { fmt.Println("The first 15 terms of the Recaman's sequence are:", a) } if !foundDup && alreadyUsed { fmt.Printf("The first duplicated term is a[%d] = %d\n", n, next) foundDup = true } if len(used1000) == 1001 { fmt.Printf("Terms up to a[%d] are needed to generate 0 to 1000\n", n) } } }
nx=15 h=1000 Wscript.StdOut.WriteLine "Recaman Wscript.StdOut.WriteLine recaman("seq",nx) Wscript.StdOut.WriteLine "The first duplicate number is: " & recaman("firstdup",0) Wscript.StdOut.WriteLine "The number of terms to complete the range 0--->"& h &" is: "& recaman("numterm",h) Wscript.StdOut.Write vbCrlf&".../...": zz=Wscript.StdIn.ReadLine() function recaman(op,nn) Dim b,d,h Set b = CreateObject("Scripting.Dictionary") Set d = CreateObject("Scripting.Dictionary") list="0" : firstdup=0 if op="firstdup" then nn=1000 : firstdup=1 end if if op="numterm" then h=nn : nn=10000000 : numterm=1 end if ax=0 b.Add 0,1 s=0 for n=1 to nn-1 an=ax-n if an<=0 then an=ax+n elseif b.Exists(an) then an=ax+n end if ax=an if not b.Exists(an) then b.Add an,1 if op="seq" then list=list&" "&an end if if firstdup then if d.Exists(an) then recaman="a("&n&")="&an exit function else d.Add an,1 end if end if if numterm then if an<=h then if not d.Exists(an) then s=s+1 d.Add an,1 end if if s>=h then recaman=n exit function end if end if end if next recaman=list end function
Produce a functionally identical VB code for the snippet given in Go.
package main import "fmt" func main() { a := []int{0} used := make(map[int]bool, 1001) used[0] = true used1000 := make(map[int]bool, 1001) used1000[0] = true for n, foundDup := 1, false; n <= 15 || !foundDup || len(used1000) < 1001; n++ { next := a[n-1] - n if next < 1 || used[next] { next += 2 * n } alreadyUsed := used[next] a = append(a, next) if !alreadyUsed { used[next] = true if next >= 0 && next <= 1000 { used1000[next] = true } } if n == 14 { fmt.Println("The first 15 terms of the Recaman's sequence are:", a) } if !foundDup && alreadyUsed { fmt.Printf("The first duplicated term is a[%d] = %d\n", n, next) foundDup = true } if len(used1000) == 1001 { fmt.Printf("Terms up to a[%d] are needed to generate 0 to 1000\n", n) } } }
nx=15 h=1000 Wscript.StdOut.WriteLine "Recaman Wscript.StdOut.WriteLine recaman("seq",nx) Wscript.StdOut.WriteLine "The first duplicate number is: " & recaman("firstdup",0) Wscript.StdOut.WriteLine "The number of terms to complete the range 0--->"& h &" is: "& recaman("numterm",h) Wscript.StdOut.Write vbCrlf&".../...": zz=Wscript.StdIn.ReadLine() function recaman(op,nn) Dim b,d,h Set b = CreateObject("Scripting.Dictionary") Set d = CreateObject("Scripting.Dictionary") list="0" : firstdup=0 if op="firstdup" then nn=1000 : firstdup=1 end if if op="numterm" then h=nn : nn=10000000 : numterm=1 end if ax=0 b.Add 0,1 s=0 for n=1 to nn-1 an=ax-n if an<=0 then an=ax+n elseif b.Exists(an) then an=ax+n end if ax=an if not b.Exists(an) then b.Add an,1 if op="seq" then list=list&" "&an end if if firstdup then if d.Exists(an) then recaman="a("&n&")="&an exit function else d.Add an,1 end if end if if numterm then if an<=h then if not d.Exists(an) then s=s+1 d.Add an,1 end if if s>=h then recaman=n exit function end if end if end if next recaman=list end function
Please provide an equivalent version of this Go code in VB.
package main import ( "bufio" "fmt" "math/rand" "os" "strings" ) var b []byte func printBoard() { fmt.Printf("%s\n%s\n%s\n", b[0:3], b[3:6], b[6:9]) } var pScore, cScore int var pMark, cMark byte = 'X', 'O' var in = bufio.NewReader(os.Stdin) func main() { b = make([]byte, 9) fmt.Println("Play by entering a digit.") for { for i := range b { b[i] = '1' + byte(i) } computerStart := cMark == 'X' if computerStart { fmt.Println("I go first, playing X's") } else { fmt.Println("You go first, playing X's") } TakeTurns: for { if !computerStart { if !playerTurn() { return } if gameOver() { break TakeTurns } } computerStart = false computerTurn() if gameOver() { break TakeTurns } } fmt.Println("Score: you", pScore, "me", cScore) fmt.Println("\nLet's play again.") } } func playerTurn() bool { var pm string var err error for i := 0; i < 3; i++ { printBoard() fmt.Printf("%c's move? ", pMark) if pm, err = in.ReadString('\n'); err != nil { fmt.Println(err) return false } pm = strings.TrimSpace(pm) if pm >= "1" && pm <= "9" && b[pm[0]-'1'] == pm[0] { x := pm[0] - '1' b[x] = pMark return true } } fmt.Println("You're not playing right.") return false } var choices = make([]int, 9) func computerTurn() { printBoard() var x int defer func() { fmt.Println("My move:", x+1) b[x] = cMark }() block := -1 for _, l := range lines { var mine, yours int x = -1 for _, sq := range l { switch b[sq] { case cMark: mine++ case pMark: yours++ default: x = sq } } if mine == 2 && x >= 0 { return } if yours == 2 && x >= 0 { block = x } } if block >= 0 { x = block return } choices = choices[:0] for i, sq := range b { if sq == '1'+byte(i) { choices = append(choices, i) } } x = choices[rand.Intn(len(choices))] } func gameOver() bool { for _, l := range lines { if b[l[0]] == b[l[1]] && b[l[1]] == b[l[2]] { printBoard() if b[l[0]] == cMark { fmt.Println("I win!") cScore++ pMark, cMark = 'X', 'O' } else { fmt.Println("You win!") pScore++ pMark, cMark = 'O', 'X' } return true } } for i, sq := range b { if sq == '1'+byte(i) { return false } } fmt.Println("Cat game.") pMark, cMark = cMark, pMark return true } var lines = [][]int{ {0, 1, 2}, {3, 4, 5}, {6, 7, 8}, {0, 3, 6}, {1, 4, 7}, {2, 5, 8}, {0, 4, 8}, {2, 4, 6}, }
Option Explicit Private Lines(1 To 3, 1 To 3) As String Private Nb As Byte, player As Byte Private GameWin As Boolean, GameOver As Boolean Sub Main_TicTacToe() Dim p As String InitLines printLines Nb Do p = WhoPlay Debug.Print p & " play" If p = "Human" Then Call HumanPlay GameWin = IsWinner("X") Else Call ComputerPlay GameWin = IsWinner("O") End If If Not GameWin Then GameOver = IsEnd Loop Until GameWin Or GameOver If Not GameOver Then Debug.Print p & " Win !" Else Debug.Print "Game Over!" End If End Sub Sub InitLines(Optional S As String) Dim i As Byte, j As Byte Nb = 0: player = 0 For i = LBound(Lines, 1) To UBound(Lines, 1) For j = LBound(Lines, 2) To UBound(Lines, 2) Lines(i, j) = "#" Next j Next i End Sub Sub printLines(Nb As Byte) Dim i As Byte, j As Byte, strT As String Debug.Print "Loop " & Nb For i = LBound(Lines, 1) To UBound(Lines, 1) For j = LBound(Lines, 2) To UBound(Lines, 2) strT = strT & Lines(i, j) Next j Debug.Print strT strT = vbNullString Next i End Sub Function WhoPlay(Optional S As String) As String If player = 0 Then player = 1 WhoPlay = "Human" Else player = 0 WhoPlay = "Computer" End If End Function Sub HumanPlay(Optional S As String) Dim L As Byte, C As Byte, GoodPlay As Boolean Do L = Application.InputBox("Choose the row", "Numeric only", Type:=1) If L > 0 And L < 4 Then C = Application.InputBox("Choose the column", "Numeric only", Type:=1) If C > 0 And C < 4 Then If Lines(L, C) = "#" And Not Lines(L, C) = "X" And Not Lines(L, C) = "O" Then Lines(L, C) = "X" Nb = Nb + 1 printLines Nb GoodPlay = True End If End If End If Loop Until GoodPlay End Sub Sub ComputerPlay(Optional S As String) Dim L As Byte, C As Byte, GoodPlay As Boolean Randomize Timer Do L = Int((Rnd * 3) + 1) C = Int((Rnd * 3) + 1) If Lines(L, C) = "#" And Not Lines(L, C) = "X" And Not Lines(L, C) = "O" Then Lines(L, C) = "O" Nb = Nb + 1 printLines Nb GoodPlay = True End If Loop Until GoodPlay End Sub Function IsWinner(S As String) As Boolean Dim i As Byte, j As Byte, Ch As String, strTL As String, strTC As String Ch = String(UBound(Lines, 1), S) For i = LBound(Lines, 1) To UBound(Lines, 1) For j = LBound(Lines, 2) To UBound(Lines, 2) strTL = strTL & Lines(i, j) strTC = strTC & Lines(j, i) Next j If strTL = Ch Or strTC = Ch Then IsWinner = True: Exit For strTL = vbNullString: strTC = vbNullString Next i strTL = Lines(1, 1) & Lines(2, 2) & Lines(3, 3) strTC = Lines(1, 3) & Lines(2, 2) & Lines(3, 1) If strTL = Ch Or strTC = Ch Then IsWinner = True End Function Function IsEnd() As Boolean Dim i As Byte, j As Byte For i = LBound(Lines, 1) To UBound(Lines, 1) For j = LBound(Lines, 2) To UBound(Lines, 2) If Lines(i, j) = "#" Then Exit Function Next j Next i IsEnd = True End Function
Produce a functionally identical Go code for the snippet given in C++.
#include <iostream> void bitwise(int a, int b) { std::cout << "a and b: " << (a & b) << '\n'; std::cout << "a or b: " << (a | b) << '\n'; std::cout << "a xor b: " << (a ^ b) << '\n'; std::cout << "not a: " << ~a << '\n'; std::cout << "a shl b: " << (a << b) << '\n'; std::cout << "a shr b: " << (a >> b) << '\n'; unsigned int ua = a; std::cout << "a lsr b: " << (ua >> b) << '\n'; std::cout << "a rol b: " << std::rotl(ua, b) << '\n'; std::cout << "a ror b: " << std::rotr(ua, b) << '\n'; }
package main import "fmt" func bitwise(a, b int16) { fmt.Printf("a: %016b\n", uint16(a)) fmt.Printf("b: %016b\n", uint16(b)) fmt.Printf("and: %016b\n", uint16(a&b)) fmt.Printf("or: %016b\n", uint16(a|b)) fmt.Printf("xor: %016b\n", uint16(a^b)) fmt.Printf("not: %016b\n", uint16(^a)) if b < 0 { fmt.Println("Right operand is negative, but all shifts require an unsigned right operand (shift distance).") return } ua := uint16(a) ub := uint32(b) fmt.Printf("shl: %016b\n", uint16(ua<<ub)) fmt.Printf("shr: %016b\n", uint16(ua>>ub)) fmt.Printf("las: %016b\n", uint16(a<<ub)) fmt.Printf("ras: %016b\n", uint16(a>>ub)) fmt.Printf("rol: %016b\n", uint16(a<<ub|int16(uint16(a)>>(16-ub)))) fmt.Printf("ror: %016b\n", uint16(int16(uint16(a)>>ub)|a<<(16-ub))) } func main() { var a, b int16 = -460, 6 bitwise(a, b) }
Write the same code in Go as shown below in C++.
#include <windows.h> #include <iostream> using namespace std; const int BMP_SIZE = 800, NORTH = 1, EAST = 2, SOUTH = 4, WEST = 8, LEN = 1; class myBitmap { public: myBitmap() : pen( NULL ), brush( NULL ), clr( 0 ), wid( 1 ) {} ~myBitmap() { DeleteObject( pen ); DeleteObject( brush ); DeleteDC( hdc ); DeleteObject( bmp ); } bool create( int w, int h ) { BITMAPINFO bi; ZeroMemory( &bi, sizeof( bi ) ); bi.bmiHeader.biSize = sizeof( bi.bmiHeader ); bi.bmiHeader.biBitCount = sizeof( DWORD ) * 8; bi.bmiHeader.biCompression = BI_RGB; bi.bmiHeader.biPlanes = 1; bi.bmiHeader.biWidth = w; bi.bmiHeader.biHeight = -h; HDC dc = GetDC( GetConsoleWindow() ); bmp = CreateDIBSection( dc, &bi, DIB_RGB_COLORS, &pBits, NULL, 0 ); if( !bmp ) return false; hdc = CreateCompatibleDC( dc ); SelectObject( hdc, bmp ); ReleaseDC( GetConsoleWindow(), dc ); width = w; height = h; return true; } void clear( BYTE clr = 0 ) { memset( pBits, clr, width * height * sizeof( DWORD ) ); } void setBrushColor( DWORD bClr ) { if( brush ) DeleteObject( brush ); brush = CreateSolidBrush( bClr ); SelectObject( hdc, brush ); } void setPenColor( DWORD c ) { clr = c; createPen(); } void setPenWidth( int w ) { wid = w; createPen(); } void saveBitmap( string path ) { BITMAPFILEHEADER fileheader; BITMAPINFO infoheader; BITMAP bitmap; DWORD wb; GetObject( bmp, sizeof( bitmap ), &bitmap ); DWORD* dwpBits = new DWORD[bitmap.bmWidth * bitmap.bmHeight]; ZeroMemory( dwpBits, bitmap.bmWidth * bitmap.bmHeight * sizeof( DWORD ) ); ZeroMemory( &infoheader, sizeof( BITMAPINFO ) ); ZeroMemory( &fileheader, sizeof( BITMAPFILEHEADER ) ); infoheader.bmiHeader.biBitCount = sizeof( DWORD ) * 8; infoheader.bmiHeader.biCompression = BI_RGB; infoheader.bmiHeader.biPlanes = 1; infoheader.bmiHeader.biSize = sizeof( infoheader.bmiHeader ); infoheader.bmiHeader.biHeight = bitmap.bmHeight; infoheader.bmiHeader.biWidth = bitmap.bmWidth; infoheader.bmiHeader.biSizeImage = bitmap.bmWidth * bitmap.bmHeight * sizeof( DWORD ); fileheader.bfType = 0x4D42; fileheader.bfOffBits = sizeof( infoheader.bmiHeader ) + sizeof( BITMAPFILEHEADER ); fileheader.bfSize = fileheader.bfOffBits + infoheader.bmiHeader.biSizeImage; GetDIBits( hdc, bmp, 0, height, ( LPVOID )dwpBits, &infoheader, DIB_RGB_COLORS ); HANDLE file = CreateFile( path.c_str(), GENERIC_WRITE, 0, NULL, CREATE_ALWAYS, FILE_ATTRIBUTE_NORMAL, NULL ); WriteFile( file, &fileheader, sizeof( BITMAPFILEHEADER ), &wb, NULL ); WriteFile( file, &infoheader.bmiHeader, sizeof( infoheader.bmiHeader ), &wb, NULL ); WriteFile( file, dwpBits, bitmap.bmWidth * bitmap.bmHeight * 4, &wb, NULL ); CloseHandle( file ); delete [] dwpBits; } HDC getDC() const { return hdc; } int getWidth() const { return width; } int getHeight() const { return height; } private: void createPen() { if( pen ) DeleteObject( pen ); pen = CreatePen( PS_SOLID, wid, clr ); SelectObject( hdc, pen ); } HBITMAP bmp; HDC hdc; HPEN pen; HBRUSH brush; void *pBits; int width, height, wid; DWORD clr; }; class dragonC { public: dragonC() { bmp.create( BMP_SIZE, BMP_SIZE ); dir = WEST; } void draw( int iterations ) { generate( iterations ); draw(); } private: void generate( int it ) { generator.push_back( 1 ); string temp; for( int y = 0; y < it - 1; y++ ) { temp = generator; temp.push_back( 1 ); for( string::reverse_iterator x = generator.rbegin(); x != generator.rend(); x++ ) temp.push_back( !( *x ) ); generator = temp; } } void draw() { HDC dc = bmp.getDC(); unsigned int clr[] = { 0xff, 0xff00, 0xff0000, 0x00ffff }; int mov[] = { 0, 0, 1, -1, 1, -1, 1, 0 }; int i = 0; for( int t = 0; t < 4; t++ ) { int a = BMP_SIZE / 2, b = a; a += mov[i++]; b += mov[i++]; MoveToEx( dc, a, b, NULL ); bmp.setPenColor( clr[t] ); for( string::iterator x = generator.begin(); x < generator.end(); x++ ) { switch( dir ) { case NORTH: if( *x ) { a += LEN; dir = EAST; } else { a -= LEN; dir = WEST; } break; case EAST: if( *x ) { b += LEN; dir = SOUTH; } else { b -= LEN; dir = NORTH; } break; case SOUTH: if( *x ) { a -= LEN; dir = WEST; } else { a += LEN; dir = EAST; } break; case WEST: if( *x ) { b -= LEN; dir = NORTH; } else { b += LEN; dir = SOUTH; } } LineTo( dc, a, b ); } } bmp.saveBitmap( "f:/rc/dragonCpp.bmp" ); } int dir; myBitmap bmp; string generator; }; int main( int argc, char* argv[] ) { dragonC d; d.draw( 17 ); return system( "pause" ); }
package main import ( "fmt" "image" "image/color" "image/draw" "image/png" "math" "os" ) const sep = 512 const depth = 14 var s = math.Sqrt2 / 2 var sin = []float64{0, s, 1, s, 0, -s, -1, -s} var cos = []float64{1, s, 0, -s, -1, -s, 0, s} var p = color.NRGBA{64, 192, 96, 255} var b *image.NRGBA func main() { width := sep * 11 / 6 height := sep * 4 / 3 bounds := image.Rect(0, 0, width, height) b = image.NewNRGBA(bounds) draw.Draw(b, bounds, image.NewUniform(color.White), image.ZP, draw.Src) dragon(14, 0, 1, sep, sep/2, sep*5/6) f, err := os.Create("dragon.png") if err != nil { fmt.Println(err) return } if err = png.Encode(f, b); err != nil { fmt.Println(err) } if err = f.Close(); err != nil { fmt.Println(err) } } func dragon(n, a, t int, d, x, y float64) { if n <= 1 { x1 := int(x + .5) y1 := int(y + .5) x2 := int(x + d*cos[a] + .5) y2 := int(y + d*sin[a] + .5) xInc := 1 if x1 > x2 { xInc = -1 } yInc := 1 if y1 > y2 { yInc = -1 } for x, y := x1, y1; ; x, y = x+xInc, y+yInc { b.Set(x, y, p) if x == x2 { break } } return } d *= s a1 := (a - t) & 7 a2 := (a + t) & 7 dragon(n-1, a1, 1, d, x, y) dragon(n-1, a2, -1, d, x+d*cos[a1], y+d*sin[a1]) }
Ensure the translated Go code behaves exactly like the original C++ snippet.
#include <fstream> #include <string> #include <iostream> int main( int argc , char** argv ) { int linecount = 0 ; std::string line ; std::ifstream infile( argv[ 1 ] ) ; if ( infile ) { while ( getline( infile , line ) ) { std::cout << linecount << ": " << line << '\n' ; linecount++ ; } } infile.close( ) ; return 0 ; }
package main import ( "bufio" "fmt" "log" "os" ) func init() { log.SetFlags(log.Lshortfile) } func main() { inputFile, err := os.Open("byline.go") if err != nil { log.Fatal("Error opening input file:", err) } defer inputFile.Close() scanner := bufio.NewScanner(inputFile) for scanner.Scan() { fmt.Println(scanner.Text()) } if err := scanner.Err(); err != nil { log.Fatal(scanner.Err()) } }
Port the following code from C++ to Go with equivalent syntax and logic.
template <typename T> void insert_after(Node<T>* N, T&& data) { auto node = new Node<T>{N, N->next, std::forward(data)}; if(N->next != nullptr) N->next->prev = node; N->next = node; }
package main import "fmt" type dlNode struct { string next, prev *dlNode } type dlList struct { head, tail *dlNode } func (list *dlList) String() string { if list.head == nil { return fmt.Sprint(list.head) } r := "[" + list.head.string for p := list.head.next; p != nil; p = p.next { r += " " + p.string } return r + "]" } func (list *dlList) insertTail(node *dlNode) { if list.tail == nil { list.head = node } else { list.tail.next = node } node.next = nil node.prev = list.tail list.tail = node } func (list *dlList) insertAfter(existing, insert *dlNode) { insert.prev = existing insert.next = existing.next existing.next.prev = insert existing.next = insert if existing == list.tail { list.tail = insert } } func main() { dll := &dlList{} fmt.Println(dll) a := &dlNode{string: "A"} dll.insertTail(a) dll.insertTail(&dlNode{string: "B"}) fmt.Println(dll) dll.insertAfter(a, &dlNode{string: "C"}) fmt.Println(dll) }
Change the following C++ code into Go without altering its purpose.
#include <iostream> #include <cstdint> using integer = uint32_t; integer next_prime_digit_number(integer n) { if (n == 0) return 2; switch (n % 10) { case 2: return n + 1; case 3: case 5: return n + 2; default: return 2 + next_prime_digit_number(n/10) * 10; } } bool is_prime(integer n) { if (n < 2) return false; if (n % 2 == 0) return n == 2; if (n % 3 == 0) return n == 3; if (n % 5 == 0) return n == 5; constexpr integer wheel[] = { 4,2,4,2,4,6,2,6 }; integer p = 7; for (;;) { for (integer w : wheel) { if (p * p > n) return true; if (n % p == 0) return false; p += w; } } } int main() { std::cout.imbue(std::locale("")); const integer limit = 1000000000; integer n = 0, max = 0; std::cout << "First 25 SPDS primes:\n"; for (int i = 0; n < limit; ) { n = next_prime_digit_number(n); if (!is_prime(n)) continue; if (i < 25) { if (i > 0) std::cout << ' '; std::cout << n; } else if (i == 25) std::cout << '\n'; ++i; if (i == 100) std::cout << "Hundredth SPDS prime: " << n << '\n'; else if (i == 1000) std::cout << "Thousandth SPDS prime: " << n << '\n'; else if (i == 10000) std::cout << "Ten thousandth SPDS prime: " << n << '\n'; max = n; } std::cout << "Largest SPDS prime less than " << limit << ": " << max << '\n'; return 0; }
package main import ( "fmt" "math/big" ) var b = new(big.Int) func isSPDSPrime(n uint64) bool { nn := n for nn > 0 { r := nn % 10 if r != 2 && r != 3 && r != 5 && r != 7 { return false } nn /= 10 } b.SetUint64(n) if b.ProbablyPrime(0) { return true } return false } func listSPDSPrimes(startFrom, countFrom, countTo uint64, printOne bool) uint64 { count := countFrom for n := startFrom; ; n += 2 { if isSPDSPrime(n) { count++ if !printOne { fmt.Printf("%2d. %d\n", count, n) } if count == countTo { if printOne { fmt.Println(n) } return n } } } } func main() { fmt.Println("The first 25 terms of the Smarandache prime-digital sequence are:") fmt.Println(" 1. 2") n := listSPDSPrimes(3, 1, 25, false) fmt.Println("\nHigher terms:") indices := []uint64{25, 100, 200, 500, 1000, 2000, 5000, 10000, 20000, 50000, 100000} for i := 1; i < len(indices); i++ { fmt.Printf("%6d. ", indices[i]) n = listSPDSPrimes(n+2, indices[i-1], indices[i], true) } }
Change the following C++ code into Go without altering its purpose.
#include <algorithm> #include <iostream> int main() { for (int i = 0; i < 10; i++) { int a[] = {9, 8, 7, 6, 5, 0, 1, 2, 3, 4}; std::nth_element(a, a + i, a + sizeof(a)/sizeof(*a)); std::cout << a[i]; if (i < 9) std::cout << ", "; } std::cout << std::endl; return 0; }
package main import "fmt" func quickselect(list []int, k int) int { for { px := len(list) / 2 pv := list[px] last := len(list) - 1 list[px], list[last] = list[last], list[px] i := 0 for j := 0; j < last; j++ { if list[j] < pv { list[i], list[j] = list[j], list[i] i++ } } if i == k { return pv } if k < i { list = list[:i] } else { list[i], list[last] = list[last], list[i] list = list[i+1:] k -= i + 1 } } } func main() { for i := 0; ; i++ { v := []int{9, 8, 7, 6, 5, 0, 1, 2, 3, 4} if i == len(v) { return } fmt.Println(quickselect(v, i)) } }
Preserve the algorithm and functionality while converting the code from C++ to Go.
#include <algorithm> #include <iostream> int main() { for (int i = 0; i < 10; i++) { int a[] = {9, 8, 7, 6, 5, 0, 1, 2, 3, 4}; std::nth_element(a, a + i, a + sizeof(a)/sizeof(*a)); std::cout << a[i]; if (i < 9) std::cout << ", "; } std::cout << std::endl; return 0; }
package main import "fmt" func quickselect(list []int, k int) int { for { px := len(list) / 2 pv := list[px] last := len(list) - 1 list[px], list[last] = list[last], list[px] i := 0 for j := 0; j < last; j++ { if list[j] < pv { list[i], list[j] = list[j], list[i] i++ } } if i == k { return pv } if k < i { list = list[:i] } else { list[i], list[last] = list[last], list[i] list = list[i+1:] k -= i + 1 } } } func main() { for i := 0; ; i++ { v := []int{9, 8, 7, 6, 5, 0, 1, 2, 3, 4} if i == len(v) { return } fmt.Println(quickselect(v, i)) } }
Preserve the algorithm and functionality while converting the code from C++ to Go.
#include <string> #include <cstdlib> #include <algorithm> #include <cassert> std::string const digits = "0123456789abcdefghijklmnopqrstuvwxyz"; std::string to_base(unsigned long num, int base) { if (num == 0) return "0"; std::string result; while (num > 0) { std::ldiv_t temp = std::div(num, (long)base); result += digits[temp.rem]; num = temp.quot; } std::reverse(result.begin(), result.end()); return result; } unsigned long from_base(std::string const& num_str, int base) { unsigned long result = 0; for (std::string::size_type pos = 0; pos < num_str.length(); ++pos) result = result * base + digits.find(num_str[pos]); return result; }
package main import ( "fmt" "math/big" "strconv" ) func main () { s := strconv.FormatInt(26, 16) fmt.Println(s) i, err := strconv.ParseInt("1a", 16, 64) if err == nil { fmt.Println(i) } b, ok := new(big.Int).SetString("1a", 16) if ok { fmt.Println(b) } }
Transform the following C++ implementation into Go, maintaining the same output and logic.
#include "boost/filesystem.hpp" #include "boost/regex.hpp" #include <iostream> using namespace boost::filesystem; int main() { path current_dir("."); boost::regex pattern("a.*"); for (recursive_directory_iterator iter(current_dir), end; iter != end; ++iter) { std::string name = iter->path().filename().string(); if (regex_match(name, pattern)) std::cout << iter->path() << "\n"; } }
package main import ( "fmt" "os" "path/filepath" ) func VisitFile(fp string, fi os.FileInfo, err error) error { if err != nil { fmt.Println(err) return nil } if fi.IsDir() { return nil } matched, err := filepath.Match("*.mp3", fi.Name()) if err != nil { fmt.Println(err) return err } if matched { fmt.Println(fp) } return nil } func main() { filepath.Walk("/", VisitFile) }
Generate a Go translation of this C++ snippet without changing its computational steps.
UINT_64 TGost::SWAP32(UINT_32 N1, UINT_32 N2) { UINT_64 N; N = N1; N = (N<<32)|N2; return UINT_64(N); } UINT_32 TGost::ReplaceBlock(UINT_32 x) { register i; UINT_32 res = 0UL; for(i=7;i>=0;i--) { ui4_0 = x>>(i*4); ui4_0 = BS[ui4_0][i]; res = (res<<4)|ui4_0; } return res; } UINT_64 TGost::MainStep(UINT_64 N,UINT_32 X) { UINT_32 N1,N2,S=0UL; N1=UINT_32(N); N2=N>>32; S = N1 + X % 0x4000000000000; S = ReplaceBlock(S); S = (S<<11)|(S>>21); S ^= N2; N2 = N1; N1 = S; return SWAP32(N2,N1); }
package main import "fmt" type sBox [8][16]byte type gost struct { k87, k65, k43, k21 [256]byte enc []byte } func newGost(s *sBox) *gost { var g gost for i := range g.k87 { g.k87[i] = s[7][i>>4]<<4 | s[6][i&15] g.k65[i] = s[5][i>>4]<<4 | s[4][i&15] g.k43[i] = s[3][i>>4]<<4 | s[2][i&15] g.k21[i] = s[1][i>>4]<<4 | s[0][i&15] } g.enc = make([]byte, 8) return &g } func (g *gost) f(x uint32) uint32 { x = uint32(g.k87[x>>24&255])<<24 | uint32(g.k65[x>>16&255])<<16 | uint32(g.k43[x>>8&255])<<8 | uint32(g.k21[x&255]) return x<<11 | x>>(32-11) } var cbrf = sBox{ {4, 10, 9, 2, 13, 8, 0, 14, 6, 11, 1, 12, 7, 15, 5, 3}, {14, 11, 4, 12, 6, 13, 15, 10, 2, 3, 8, 1, 0, 7, 5, 9}, {5, 8, 1, 13, 10, 3, 4, 2, 14, 15, 12, 7, 6, 0, 9, 11}, {7, 13, 10, 1, 0, 8, 9, 15, 14, 4, 6, 12, 11, 2, 5, 3}, {6, 12, 7, 1, 5, 15, 13, 8, 4, 10, 9, 14, 0, 3, 11, 2}, {4, 11, 10, 0, 7, 2, 1, 13, 3, 6, 8, 5, 9, 12, 15, 14}, {13, 11, 4, 1, 3, 15, 5, 9, 0, 10, 14, 7, 6, 8, 2, 12}, {1, 15, 13, 0, 5, 7, 10, 4, 9, 2, 3, 14, 6, 11, 8, 12}, } func u32(b []byte) uint32 { return uint32(b[0]) | uint32(b[1])<<8 | uint32(b[2])<<16 | uint32(b[3])<<24 } func b4(u uint32, b []byte) { b[0] = byte(u) b[1] = byte(u >> 8) b[2] = byte(u >> 16) b[3] = byte(u >> 24) } func (g *gost) mainStep(input []byte, key []byte) { key32 := u32(key) input1 := u32(input[:4]) input2 := u32(input[4:]) b4(g.f(key32+input1)^input2, g.enc[:4]) copy(g.enc[4:], input[:4]) } func main() { input := []byte{0x21, 0x04, 0x3B, 0x04, 0x30, 0x04, 0x32, 0x04} key := []byte{0xF9, 0x04, 0xC1, 0xE2} g := newGost(&cbrf) g.mainStep(input, key) for _, b := range g.enc { fmt.Printf("[%02x]", b) } fmt.Println() }
Ensure the translated Go code behaves exactly like the original C++ snippet.
#include <algorithm> #include <iostream> #include <string> #include <array> #include <vector> template<typename T> T unique(T&& src) { T retval(std::move(src)); std::sort(retval.begin(), retval.end(), std::less<typename T::value_type>()); retval.erase(std::unique(retval.begin(), retval.end()), retval.end()); return retval; } #define USE_FAKES 1 auto states = unique(std::vector<std::string>({ #if USE_FAKES "Slender Dragon", "Abalamara", #endif "Alabama", "Alaska", "Arizona", "Arkansas", "California", "Colorado", "Connecticut", "Delaware", "Florida", "Georgia", "Hawaii", "Idaho", "Illinois", "Indiana", "Iowa", "Kansas", "Kentucky", "Louisiana", "Maine", "Maryland", "Massachusetts", "Michigan", "Minnesota", "Mississippi", "Missouri", "Montana", "Nebraska", "Nevada", "New Hampshire", "New Jersey", "New Mexico", "New York", "North Carolina", "North Dakota", "Ohio", "Oklahoma", "Oregon", "Pennsylvania", "Rhode Island", "South Carolina", "South Dakota", "Tennessee", "Texas", "Utah", "Vermont", "Virginia", "Washington", "West Virginia", "Wisconsin", "Wyoming" })); struct counted_pair { std::string name; std::array<int, 26> count{}; void count_characters(const std::string& s) { for (auto&& c : s) { if (c >= 'a' && c <= 'z') count[c - 'a']++; if (c >= 'A' && c <= 'Z') count[c - 'A']++; } } counted_pair(const std::string& s1, const std::string& s2) : name(s1 + " + " + s2) { count_characters(s1); count_characters(s2); } }; bool operator<(const counted_pair& lhs, const counted_pair& rhs) { auto lhs_size = lhs.name.size(); auto rhs_size = rhs.name.size(); return lhs_size == rhs_size ? std::lexicographical_compare(lhs.count.begin(), lhs.count.end(), rhs.count.begin(), rhs.count.end()) : lhs_size < rhs_size; } bool operator==(const counted_pair& lhs, const counted_pair& rhs) { return lhs.name.size() == rhs.name.size() && lhs.count == rhs.count; } int main() { const int n_states = states.size(); std::vector<counted_pair> pairs; for (int i = 0; i < n_states; i++) { for (int j = 0; j < i; j++) { pairs.emplace_back(counted_pair(states[i], states[j])); } } std::sort(pairs.begin(), pairs.end()); auto start = pairs.begin(); while (true) { auto match = std::adjacent_find(start, pairs.end()); if (match == pairs.end()) { break; } auto next = match + 1; std::cout << match->name << " => " << next->name << "\n"; start = next; } }
package main import ( "fmt" "unicode" ) var states = []string{"Alabama", "Alaska", "Arizona", "Arkansas", "California", "Colorado", "Connecticut", "Delaware", "Florida", "Georgia", "Hawaii", "Idaho", "Illinois", "Indiana", "Iowa", "Kansas", "Kentucky", "Louisiana", "Maine", "Maryland", "Massachusetts", "Michigan", "Minnesota", "Mississippi", "Missouri", "Montana", "Nebraska", "Nevada", "New Hampshire", "New Jersey", "New Mexico", "New York", "North Carolina", "North Dakota", "Ohio", "Oklahoma", "Oregon", "Pennsylvania", "Rhode Island", "South Carolina", "South Dakota", "Tennessee", "Texas", "Utah", "Vermont", "Virginia", "Washington", "West Virginia", "Wisconsin", "Wyoming"} func main() { play(states) play(append(states, "New Kory", "Wen Kory", "York New", "Kory New", "New Kory")) } func play(states []string) { fmt.Println(len(states), "states:") set := make(map[string]bool, len(states)) for _, s := range states { set[s] = true } s := make([]string, len(set)) h := make([][26]byte, len(set)) var i int for us := range set { s[i] = us for _, c := range us { if u := uint(unicode.ToLower(c)) - 'a'; u < 26 { h[i][u]++ } } i++ } type pair struct { i1, i2 int } m := make(map[string][]pair) b := make([]byte, 26) for i1, h1 := range h { for i2 := i1 + 1; i2 < len(h); i2++ { for i := range b { b[i] = h1[i] + h[i2][i] } k := string(b) for _, x := range m[k] { if i1 != x.i1 && i1 != x.i2 && i2 != x.i1 && i2 != x.i2 { fmt.Printf("%s, %s = %s, %s\n", s[i1], s[i2], s[x.i1], s[x.i2]) } } m[k] = append(m[k], pair{i1, i2}) } } }