Instruction stringlengths 45 106 | input_code stringlengths 1 13.7k | output_code stringlengths 1 13.7k |
|---|---|---|
Keep all operations the same but rewrite the snippet in VB. | package turing
type Symbol byte
type Motion byte
const (
Left Motion = 'L'
Right Motion = 'R'
Stay Motion = 'N'
)
type Tape struct {
data []Symbol
pos, left int
blank Symbol
}
func NewTape(blank Symbol, start int, data []Symbol) *Tape {
t := &Tape{
data: data,
blank: blank,
}
if start < 0 {
t.Left(-start)
}
t.Right(start)
return t
}
func (t *Tape) Stay() {}
func (t *Tape) Data() []Symbol { return t.data[t.left:] }
func (t *Tape) Read() Symbol { return t.data[t.pos] }
func (t *Tape) Write(s Symbol) { t.data[t.pos] = s }
func (t *Tape) Dup() *Tape {
t2 := &Tape{
data: make([]Symbol, len(t.Data())),
blank: t.blank,
}
copy(t2.data, t.Data())
t2.pos = t.pos - t.left
return t2
}
func (t *Tape) String() string {
s := ""
for i := t.left; i < len(t.data); i++ {
b := t.data[i]
if i == t.pos {
s += "[" + string(b) + "]"
} else {
s += " " + string(b) + " "
}
}
return s
}
func (t *Tape) Move(a Motion) {
switch a {
case Left:
t.Left(1)
case Right:
t.Right(1)
case Stay:
t.Stay()
}
}
const minSz = 16
func (t *Tape) Left(n int) {
t.pos -= n
if t.pos < 0 {
var sz int
for sz = minSz; cap(t.data[t.left:])-t.pos >= sz; sz <<= 1 {
}
newd := make([]Symbol, sz)
newl := len(newd) - cap(t.data[t.left:])
n := copy(newd[newl:], t.data[t.left:])
t.data = newd[:newl+n]
t.pos += newl - t.left
t.left = newl
}
if t.pos < t.left {
if t.blank != 0 {
for i := t.pos; i < t.left; i++ {
t.data[i] = t.blank
}
}
t.left = t.pos
}
}
func (t *Tape) Right(n int) {
t.pos += n
if t.pos >= cap(t.data) {
var sz int
for sz = minSz; t.pos >= sz; sz <<= 1 {
}
newd := make([]Symbol, sz)
n := copy(newd[t.left:], t.data[t.left:])
t.data = newd[:t.left+n]
}
if i := len(t.data); t.pos >= i {
t.data = t.data[:t.pos+1]
if t.blank != 0 {
for ; i < len(t.data); i++ {
t.data[i] = t.blank
}
}
}
}
type State string
type Rule struct {
State
Symbol
Write Symbol
Motion
Next State
}
func (i *Rule) key() key { return key{i.State, i.Symbol} }
func (i *Rule) action() action { return action{i.Write, i.Motion, i.Next} }
type key struct {
State
Symbol
}
type action struct {
write Symbol
Motion
next State
}
type Machine struct {
tape *Tape
start, state State
transition map[key]action
l func(string, ...interface{})
}
func NewMachine(rules []Rule) *Machine {
m := &Machine{transition: make(map[key]action, len(rules))}
if len(rules) > 0 {
m.start = rules[0].State
}
for _, r := range rules {
m.transition[r.key()] = r.action()
}
return m
}
func (m *Machine) Run(input *Tape) (int, *Tape) {
m.tape = input.Dup()
m.state = m.start
for cnt := 0; ; cnt++ {
if m.l != nil {
m.l("%3d %4s: %v\n", cnt, m.state, m.tape)
}
sym := m.tape.Read()
act, ok := m.transition[key{m.state, sym}]
if !ok {
return cnt, m.tape
}
m.tape.Write(act.write)
m.tape.Move(act.Motion)
m.state = act.next
}
}
| Option Base 1
Public Enum sett
name_ = 1
initState
endState
blank
rules
End Enum
Public incrementer As Variant, threeStateBB As Variant, fiveStateBB As Variant
Private Sub init()
incrementer = Array("Simple incrementer", _
"q0", _
"qf", _
"B", _
Array( _
Array("q0", "1", "1", "right", "q0"), _
Array("q0", "B", "1", "stay", "qf")))
threeStateBB = Array("Three-state busy beaver", _
"a", _
"halt", _
"0", _
Array( _
Array("a", "0", "1", "right", "b"), _
Array("a", "1", "1", "left", "c"), _
Array("b", "0", "1", "left", "a"), _
Array("b", "1", "1", "right", "b"), _
Array("c", "0", "1", "left", "b"), _
Array("c", "1", "1", "stay", "halt")))
fiveStateBB = Array("Five-state busy beaver", _
"A", _
"H", _
"0", _
Array( _
Array("A", "0", "1", "right", "B"), _
Array("A", "1", "1", "left", "C"), _
Array("B", "0", "1", "right", "C"), _
Array("B", "1", "1", "right", "B"), _
Array("C", "0", "1", "right", "D"), _
Array("C", "1", "0", "left", "E"), _
Array("D", "0", "1", "left", "A"), _
Array("D", "1", "1", "left", "D"), _
Array("E", "0", "1", "stay", "H"), _
Array("E", "1", "0", "left", "A")))
End Sub
Private Sub show(state As String, headpos As Long, tape As Collection)
Debug.Print " "; state; String$(7 - Len(state), " "); "| ";
For p = 1 To tape.Count
Debug.Print IIf(p = headpos, "[" & tape(p) & "]", " " & tape(p) & " ");
Next p
Debug.Print
End Sub
Private Sub UTM(machine As Variant, tape As Collection, Optional countOnly As Long = 0)
Dim state As String: state = machine(initState)
Dim headpos As Long: headpos = 1
Dim counter As Long, rule As Variant
Debug.Print machine(name_); vbCrLf; String$(Len(machine(name_)), "=")
If Not countOnly Then Debug.Print " State | Tape [head]" & vbCrLf & "---------------------"
Do While True
If headpos > tape.Count Then
tape.Add machine(blank)
Else
If headpos < 1 Then
tape.Add machine(blank), Before:=1
headpos = 1
End If
End If
If Not countOnly Then show state, headpos, tape
For i = LBound(machine(rules)) To UBound(machine(rules))
rule = machine(rules)(i)
If rule(1) = state And rule(2) = tape(headpos) Then
tape.Remove headpos
If headpos > tape.Count Then
tape.Add rule(3)
Else
tape.Add rule(3), Before:=headpos
End If
If rule(4) = "left" Then headpos = headpos - 1
If rule(4) = "right" Then headpos = headpos + 1
state = rule(5)
Exit For
End If
Next i
counter = counter + 1
If counter Mod 100000 = 0 Then
Debug.Print counter
DoEvents
DoEvents
End If
If state = machine(endState) Then Exit Do
Loop
DoEvents
If countOnly Then
Debug.Print "Steps taken: ", counter
Else
show state, headpos, tape
Debug.Print
End If
End Sub
Public Sub main()
init
Dim tap As New Collection
tap.Add "1": tap.Add "1": tap.Add "1"
UTM incrementer, tap
Set tap = New Collection
UTM threeStateBB, tap
Set tap = New Collection
UTM fiveStateBB, tap, countOnly:=-1
End Sub
|
Write the same code in VB as shown below in Go. | package main
import (
"fmt"
"os"
)
func createFile(fn string) {
f, err := os.Create(fn)
if err != nil {
fmt.Println(err)
return
}
fmt.Println("file", fn, "created!")
f.Close()
}
func createDir(dn string) {
err := os.Mkdir(dn, 0666)
if err != nil {
fmt.Println(err)
return
}
fmt.Println("directory", dn, "created!")
}
func main() {
createFile("input.txt")
createFile("/input.txt")
createDir("docs")
createDir("/docs")
}
| Public Sub create_file()
Dim FileNumber As Integer
FileNumber = FreeFile
MkDir "docs"
Open "docs\output.txt" For Output As #FreeFile
Close #FreeFile
MkDir "C:\docs"
Open "C:\docs\output.txt" For Output As #FreeFile
Close #FreeFile
End Sub
|
Translate the given Go code snippet into VB without altering its behavior. | package main
import (
"fmt"
"os"
)
func createFile(fn string) {
f, err := os.Create(fn)
if err != nil {
fmt.Println(err)
return
}
fmt.Println("file", fn, "created!")
f.Close()
}
func createDir(dn string) {
err := os.Mkdir(dn, 0666)
if err != nil {
fmt.Println(err)
return
}
fmt.Println("directory", dn, "created!")
}
func main() {
createFile("input.txt")
createFile("/input.txt")
createDir("docs")
createDir("/docs")
}
| Public Sub create_file()
Dim FileNumber As Integer
FileNumber = FreeFile
MkDir "docs"
Open "docs\output.txt" For Output As #FreeFile
Close #FreeFile
MkDir "C:\docs"
Open "C:\docs\output.txt" For Output As #FreeFile
Close #FreeFile
End Sub
|
Produce a functionally identical VB code for the snippet given in Go. | package main
import (
"fmt"
"sort"
)
func main() {
dna := "" +
"CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATG" +
"CTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTG" +
"AGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGAT" +
"GGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT" +
"CGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGG" +
"TCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA" +
"TTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTAT" +
"CGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTG" +
"TCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGAC" +
"GACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT"
fmt.Println("SEQUENCE:")
le := len(dna)
for i := 0; i < le; i += 50 {
k := i + 50
if k > le {
k = le
}
fmt.Printf("%5d: %s\n", i, dna[i:k])
}
baseMap := make(map[byte]int)
for i := 0; i < le; i++ {
baseMap[dna[i]]++
}
var bases []byte
for k := range baseMap {
bases = append(bases, k)
}
sort.Slice(bases, func(i, j int) bool {
return bases[i] < bases[j]
})
fmt.Println("\nBASE COUNT:")
for _, base := range bases {
fmt.Printf(" %c: %3d\n", base, baseMap[base])
}
fmt.Println(" ------")
fmt.Println(" Σ:", le)
fmt.Println(" ======")
}
| b=_
"CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATG" &_
"CTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTG" &_
"AGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGAT" &_
"GGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT" &_
"CGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGG" &_
"TCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA" &_
"TTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTAT" &_
"CGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTG" &_
"TCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGAC" &_
"GACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT"
s="SEQUENCE:"
acnt=0:ccnt=0:gcnt=0:tcnt=0
for i=0 to len(b)-1
if (i mod 30)=0 then s = s & vbcrlf & right(" "& i+1,3)&": "
if (i mod 5)=0 then s=s& " "
m=mid(b,i+1,1)
s=s & m
select case m
case "A":acnt=acnt+1
case "C":ccnt=ccnt+1
case "G":gcnt=gcnt+1
case "T":tcnt=tcnt+1
case else
wscript.echo "error at ",i+1, m
end select
next
wscript.echo s & vbcrlf
wscript.echo "Count: A="&acnt & " C=" & ccnt & " G=" & gcnt & " T=" & tcnt
|
Convert this Go snippet to VB and keep its semantics consistent. | package main
import (
"fmt"
"sort"
)
func main() {
dna := "" +
"CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATG" +
"CTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTG" +
"AGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGAT" +
"GGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT" +
"CGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGG" +
"TCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA" +
"TTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTAT" +
"CGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTG" +
"TCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGAC" +
"GACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT"
fmt.Println("SEQUENCE:")
le := len(dna)
for i := 0; i < le; i += 50 {
k := i + 50
if k > le {
k = le
}
fmt.Printf("%5d: %s\n", i, dna[i:k])
}
baseMap := make(map[byte]int)
for i := 0; i < le; i++ {
baseMap[dna[i]]++
}
var bases []byte
for k := range baseMap {
bases = append(bases, k)
}
sort.Slice(bases, func(i, j int) bool {
return bases[i] < bases[j]
})
fmt.Println("\nBASE COUNT:")
for _, base := range bases {
fmt.Printf(" %c: %3d\n", base, baseMap[base])
}
fmt.Println(" ------")
fmt.Println(" Σ:", le)
fmt.Println(" ======")
}
| b=_
"CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATG" &_
"CTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTG" &_
"AGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGAT" &_
"GGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT" &_
"CGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGG" &_
"TCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA" &_
"TTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTAT" &_
"CGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTG" &_
"TCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGAC" &_
"GACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT"
s="SEQUENCE:"
acnt=0:ccnt=0:gcnt=0:tcnt=0
for i=0 to len(b)-1
if (i mod 30)=0 then s = s & vbcrlf & right(" "& i+1,3)&": "
if (i mod 5)=0 then s=s& " "
m=mid(b,i+1,1)
s=s & m
select case m
case "A":acnt=acnt+1
case "C":ccnt=ccnt+1
case "G":gcnt=gcnt+1
case "T":tcnt=tcnt+1
case else
wscript.echo "error at ",i+1, m
end select
next
wscript.echo s & vbcrlf
wscript.echo "Count: A="&acnt & " C=" & ccnt & " G=" & gcnt & " T=" & tcnt
|
Convert the following code from Go to VB, ensuring the logic remains intact. | package main
import (
"hash/fnv"
"log"
"math/rand"
"os"
"time"
)
var ph = []string{"Aristotle", "Kant", "Spinoza", "Marx", "Russell"}
const hunger = 3
const think = time.Second / 100
const eat = time.Second / 100
var fmt = log.New(os.Stdout, "", 0)
var done = make(chan bool)
type fork byte
func philosopher(phName string,
dominantHand, otherHand chan fork, done chan bool) {
fmt.Println(phName, "seated")
h := fnv.New64a()
h.Write([]byte(phName))
rg := rand.New(rand.NewSource(int64(h.Sum64())))
rSleep := func(t time.Duration) {
time.Sleep(t/2 + time.Duration(rg.Int63n(int64(t))))
}
for h := hunger; h > 0; h-- {
fmt.Println(phName, "hungry")
<-dominantHand
<-otherHand
fmt.Println(phName, "eating")
rSleep(eat)
dominantHand <- 'f'
otherHand <- 'f'
fmt.Println(phName, "thinking")
rSleep(think)
}
fmt.Println(phName, "satisfied")
done <- true
fmt.Println(phName, "left the table")
}
func main() {
fmt.Println("table empty")
place0 := make(chan fork, 1)
place0 <- 'f'
placeLeft := place0
for i := 1; i < len(ph); i++ {
placeRight := make(chan fork, 1)
placeRight <- 'f'
go philosopher(ph[i], placeLeft, placeRight, done)
placeLeft = placeRight
}
go philosopher(ph[0], place0, placeLeft, done)
for range ph {
<-done
}
fmt.Println("table empty")
}
|
Public Const HOLDON = False
Public Const DIJKSTRASOLUTION = True
Public Const X = 10
Public Const GETS = 0
Public Const PUTS = 1
Public Const EATS = 2
Public Const THKS = 5
Public Const FRSTFORK = 0
Public Const SCNDFORK = 1
Public Const SPAGHETI = 0
Public Const UNIVERSE = 1
Public Const MAXCOUNT = 100000
Public Const PHILOSOPHERS = 5
Public semaphore(PHILOSOPHERS - 1) As Integer
Public positi0n(1, PHILOSOPHERS - 1) As Integer
Public programcounter(PHILOSOPHERS - 1) As Long
Public statistics(PHILOSOPHERS - 1, 5, 1) As Long
Public names As Variant
Private Sub init()
names = [{"Aquinas","Babbage","Carroll","Derrida","Erasmus"}]
For j = 0 To PHILOSOPHERS - 2
positi0n(0, j) = j + 1
positi0n(1, j) = j
Next j
If DIJKSTRASOLUTION Then
positi0n(0, PHILOSOPHERS - 1) = j
positi0n(1, PHILOSOPHERS - 1) = 0
Else
positi0n(0, PHILOSOPHERS - 1) = 0
positi0n(1, PHILOSOPHERS - 1) = j
End If
End Sub
Private Sub philosopher(subject As Integer, verb As Integer, objekt As Integer)
statistics(subject, verb, objekt) = statistics(subject, verb, objekt) + 1
If verb < 2 Then
If semaphore(positi0n(objekt, subject)) <> verb Then
If Not HOLDON Then
semaphore(positi0n(FRSTFORK, subject)) = 1 - objekt
programcounter(subject) = 0
End If
Else
semaphore(positi0n(objekt, subject)) = 1 - verb
programcounter(subject) = (programcounter(subject) + 1) Mod 6
End If
Else
programcounter(subject) = IIf(X * Rnd > 1, verb, verb + 1) Mod 6
End If
End Sub
Private Sub dine()
Dim ph As Integer
Do While TC < MAXCOUNT
For ph = 0 To PHILOSOPHERS - 1
Select Case programcounter(ph)
Case 0: philosopher ph, GETS, FRSTFORK
Case 1: philosopher ph, GETS, SCNDFORK
Case 2: philosopher ph, EATS, SPAGHETI
Case 3: philosopher ph, PUTS, FRSTFORK
Case 4: philosopher ph, PUTS, SCNDFORK
Case 5: philosopher ph, THKS, UNIVERSE
End Select
TC = TC + 1
Next ph
Loop
End Sub
Private Sub show()
Debug.Print "Stats", "Gets", "Gets", "Eats", "Puts", "Puts", "Thinks"
Debug.Print "", "First", "Second", "Spag-", "First", "Second", "About"
Debug.Print "", "Fork", "Fork", "hetti", "Fork", "Fork", "Universe"
For subject = 0 To PHILOSOPHERS - 1
Debug.Print names(subject + 1),
For objekt = 0 To 1
Debug.Print statistics(subject, GETS, objekt),
Next objekt
Debug.Print statistics(subject, EATS, SPAGHETI),
For objekt = 0 To 1
Debug.Print statistics(subject, PUTS, objekt),
Next objekt
Debug.Print statistics(subject, THKS, UNIVERSE)
Next subject
End Sub
Public Sub main()
init
dine
show
End Sub
|
Rewrite the snippet below in VB so it works the same as the original Go code. | package main
import (
"fmt"
"strconv"
)
func main() {
var fact [12]uint64
fact[0] = 1
for n := uint64(1); n < 12; n++ {
fact[n] = fact[n-1] * n
}
for b := 9; b <= 12; b++ {
fmt.Printf("The factorions for base %d are:\n", b)
for i := uint64(1); i < 1500000; i++ {
digits := strconv.FormatUint(i, b)
sum := uint64(0)
for _, digit := range digits {
if digit < 'a' {
sum += fact[digit-'0']
} else {
sum += fact[digit+10-'a']
}
}
if sum == i {
fmt.Printf("%d ", i)
}
}
fmt.Println("\n")
}
}
|
Dim fact()
nn1=9 : nn2=12
lim=1499999
ReDim fact(nn2)
fact(0)=1
For i=1 To nn2
fact(i)=fact(i-1)*i
Next
For base=nn1 To nn2
list=""
For i=1 To lim
s=0
t=i
Do While t<>0
d=t Mod base
s=s+fact(d)
t=t\base
Loop
If s=i Then list=list &" "& i
Next
Wscript.Echo "the factorions for base "& right(" "& base,2) &" are: "& list
Next
|
Generate an equivalent VB version of this Go code. | package main
import (
"fmt"
"strconv"
)
func main() {
var fact [12]uint64
fact[0] = 1
for n := uint64(1); n < 12; n++ {
fact[n] = fact[n-1] * n
}
for b := 9; b <= 12; b++ {
fmt.Printf("The factorions for base %d are:\n", b)
for i := uint64(1); i < 1500000; i++ {
digits := strconv.FormatUint(i, b)
sum := uint64(0)
for _, digit := range digits {
if digit < 'a' {
sum += fact[digit-'0']
} else {
sum += fact[digit+10-'a']
}
}
if sum == i {
fmt.Printf("%d ", i)
}
}
fmt.Println("\n")
}
}
|
Dim fact()
nn1=9 : nn2=12
lim=1499999
ReDim fact(nn2)
fact(0)=1
For i=1 To nn2
fact(i)=fact(i-1)*i
Next
For base=nn1 To nn2
list=""
For i=1 To lim
s=0
t=i
Do While t<>0
d=t Mod base
s=s+fact(d)
t=t\base
Loop
If s=i Then list=list &" "& i
Next
Wscript.Echo "the factorions for base "& right(" "& base,2) &" are: "& list
Next
|
Convert this Go block to VB, preserving its control flow and logic. | package main
import (
"fmt"
"strings"
)
var table =
"Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy " +
"COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find " +
"NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput " +
"Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO " +
"MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT " +
"READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT " +
"RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up "
func validate(commands, words []string, minLens []int) []string {
results := make([]string, 0)
if len(words) == 0 {
return results
}
for _, word := range words {
matchFound := false
wlen := len(word)
for i, command := range commands {
if minLens[i] == 0 || wlen < minLens[i] || wlen > len(command) {
continue
}
c := strings.ToUpper(command)
w := strings.ToUpper(word)
if strings.HasPrefix(c, w) {
results = append(results, c)
matchFound = true
break
}
}
if !matchFound {
results = append(results, "*error*")
}
}
return results
}
func main() {
table = strings.TrimSpace(table)
commands := strings.Fields(table)
clen := len(commands)
minLens := make([]int, clen)
for i := 0; i < clen; i++ {
count := 0
for _, c := range commands[i] {
if c >= 'A' && c <= 'Z' {
count++
}
}
minLens[i] = count
}
sentence := "riG rePEAT copies put mo rest types fup. 6 poweRin"
words := strings.Fields(sentence)
results := validate(commands, words, minLens)
fmt.Print("user words: ")
for j := 0; j < len(words); j++ {
fmt.Printf("%-*s ", len(results[j]), words[j])
}
fmt.Print("\nfull words: ")
fmt.Println(strings.Join(results, " "))
}
| Private Function ValidateUserWords(userstring As String) As String
Dim s As String
Dim user_words() As String
Dim command_table As Scripting.Dictionary
Set command_table = New Scripting.Dictionary
Dim abbreviations As Scripting.Dictionary
Set abbreviations = New Scripting.Dictionary
abbreviations.CompareMode = TextCompare
Dim commandtable() As String
Dim commands As String
s = s & "Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy "
s = s & "COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find "
s = s & "NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput "
s = s & "Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO "
s = s & "MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT "
s = s & "READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT "
s = s & "RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up "
commandtable = Split(s, " ")
Dim i As Integer
For Each word In commandtable
If Len(word) > 0 Then
i = 1
Do While Mid(word, i, 1) >= "A" And Mid(word, i, 1) <= "Z"
i = i + 1
Loop
command_table.Add Key:=word, Item:=i - 1
End If
Next word
For Each word In command_table
For i = command_table(word) To Len(word)
On Error Resume Next
abbreviations.Add Key:=Left(word, i), Item:=UCase(word)
Next i
Next word
user_words() = Split(userstring, " ")
For Each word In user_words
If Len(word) > 0 Then
If abbreviations.exists(word) Then
commands = commands & abbreviations(word) & " "
Else
commands = commands & "*error* "
End If
End If
Next word
ValidateUserWords = commands
End Function
Public Sub program()
Dim guserstring As String
guserstring = "riG rePEAT copies put mo rest types fup. 6 poweRin"
Debug.Print "user words:", guserstring
Debug.Print "full words:", ValidateUserWords(guserstring)
End Sub
|
Maintain the same structure and functionality when rewriting this code in VB. | package main
import (
"fmt"
"strings"
)
var table =
"Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy " +
"COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find " +
"NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput " +
"Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO " +
"MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT " +
"READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT " +
"RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up "
func validate(commands, words []string, minLens []int) []string {
results := make([]string, 0)
if len(words) == 0 {
return results
}
for _, word := range words {
matchFound := false
wlen := len(word)
for i, command := range commands {
if minLens[i] == 0 || wlen < minLens[i] || wlen > len(command) {
continue
}
c := strings.ToUpper(command)
w := strings.ToUpper(word)
if strings.HasPrefix(c, w) {
results = append(results, c)
matchFound = true
break
}
}
if !matchFound {
results = append(results, "*error*")
}
}
return results
}
func main() {
table = strings.TrimSpace(table)
commands := strings.Fields(table)
clen := len(commands)
minLens := make([]int, clen)
for i := 0; i < clen; i++ {
count := 0
for _, c := range commands[i] {
if c >= 'A' && c <= 'Z' {
count++
}
}
minLens[i] = count
}
sentence := "riG rePEAT copies put mo rest types fup. 6 poweRin"
words := strings.Fields(sentence)
results := validate(commands, words, minLens)
fmt.Print("user words: ")
for j := 0; j < len(words); j++ {
fmt.Printf("%-*s ", len(results[j]), words[j])
}
fmt.Print("\nfull words: ")
fmt.Println(strings.Join(results, " "))
}
| Private Function ValidateUserWords(userstring As String) As String
Dim s As String
Dim user_words() As String
Dim command_table As Scripting.Dictionary
Set command_table = New Scripting.Dictionary
Dim abbreviations As Scripting.Dictionary
Set abbreviations = New Scripting.Dictionary
abbreviations.CompareMode = TextCompare
Dim commandtable() As String
Dim commands As String
s = s & "Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy "
s = s & "COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find "
s = s & "NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput "
s = s & "Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO "
s = s & "MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT "
s = s & "READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT "
s = s & "RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up "
commandtable = Split(s, " ")
Dim i As Integer
For Each word In commandtable
If Len(word) > 0 Then
i = 1
Do While Mid(word, i, 1) >= "A" And Mid(word, i, 1) <= "Z"
i = i + 1
Loop
command_table.Add Key:=word, Item:=i - 1
End If
Next word
For Each word In command_table
For i = command_table(word) To Len(word)
On Error Resume Next
abbreviations.Add Key:=Left(word, i), Item:=UCase(word)
Next i
Next word
user_words() = Split(userstring, " ")
For Each word In user_words
If Len(word) > 0 Then
If abbreviations.exists(word) Then
commands = commands & abbreviations(word) & " "
Else
commands = commands & "*error* "
End If
End If
Next word
ValidateUserWords = commands
End Function
Public Sub program()
Dim guserstring As String
guserstring = "riG rePEAT copies put mo rest types fup. 6 poweRin"
Debug.Print "user words:", guserstring
Debug.Print "full words:", ValidateUserWords(guserstring)
End Sub
|
Change the following Go code into VB without altering its purpose. | package main
import(
"fmt"
"strings"
)
var codes = map[rune]string {
'a' : "AAAAA", 'b' : "AAAAB", 'c' : "AAABA", 'd' : "AAABB", 'e' : "AABAA",
'f' : "AABAB", 'g' : "AABBA", 'h' : "AABBB", 'i' : "ABAAA", 'j' : "ABAAB",
'k' : "ABABA", 'l' : "ABABB", 'm' : "ABBAA", 'n' : "ABBAB", 'o' : "ABBBA",
'p' : "ABBBB", 'q' : "BAAAA", 'r' : "BAAAB", 's' : "BAABA", 't' : "BAABB",
'u' : "BABAA", 'v' : "BABAB", 'w' : "BABBA", 'x' : "BABBB", 'y' : "BBAAA",
'z' : "BBAAB", ' ' : "BBBAA",
}
func baconEncode(plainText string, message string) string {
pt := strings.ToLower(plainText)
var sb []byte
for _, c := range pt {
if c >= 'a' && c <= 'z' {
sb = append(sb, codes[c]...)
} else {
sb = append(sb, codes[' ']...)
}
}
et := string(sb)
mg := strings.ToLower(message)
sb = nil
var count = 0
for _, c := range mg {
if c >= 'a' && c <= 'z' {
if et[count] == 'A' {
sb = append(sb, byte(c))
} else {
sb = append(sb, byte(c - 32))
}
count++
if count == len(et) { break }
} else {
sb = append(sb, byte(c))
}
}
return string(sb)
}
func baconDecode(message string) string {
var sb []byte
for _, c := range message {
if c >= 'a' && c <= 'z' {
sb = append(sb, 'A')
} else if c >= 'A' && c <= 'Z' {
sb = append(sb, 'B')
}
}
et := string(sb)
sb = nil
for i := 0; i < len(et); i += 5 {
quintet := et[i : i + 5]
for k, v := range codes {
if v == quintet {
sb = append(sb, byte(k))
break
}
}
}
return string(sb)
}
func main() {
plainText := "the quick brown fox jumps over the lazy dog"
message := "bacon's cipher is a method of steganography created by francis bacon." +
"this task is to implement a program for encryption and decryption of " +
"plaintext using the simple alphabet of the baconian cipher or some " +
"other kind of representation of this alphabet (make anything signify anything). " +
"the baconian alphabet may optionally be extended to encode all lower " +
"case characters individually and/or adding a few punctuation characters " +
"such as the space."
cipherText := baconEncode(plainText, message)
fmt.Printf("Cipher text ->\n\n%s\n", cipherText)
decodedText := baconDecode(cipherText)
fmt.Printf("\nHidden text ->\n\n%s\n", decodedText)
}
| Imports System.Text
Module Module1
ReadOnly CODES As New Dictionary(Of Char, String) From {
{"a", "AAAAA"}, {"b", "AAAAB"}, {"c", "AAABA"}, {"d", "AAABB"}, {"e", "AABAA"},
{"f", "AABAB"}, {"g", "AABBA"}, {"h", "AABBB"}, {"i", "ABAAA"}, {"j", "ABAAB"},
{"k", "ABABA"}, {"l", "ABABB"}, {"m", "ABBAA"}, {"n", "ABBAB"}, {"o", "ABBBA"},
{"p", "ABBBB"}, {"q", "BAAAA"}, {"r", "BAAAB"}, {"s", "BAABA"}, {"t", "BAABB"},
{"u", "BABAA"}, {"v", "BABAB"}, {"w", "BABBA"}, {"x", "BABBB"}, {"y", "BBAAA"},
{"z", "BBAAB"}, {" ", "BBBAA"}
}
Function Encode(plainText As String, message As String) As String
Dim pt = plainText.ToLower()
Dim sb As New StringBuilder()
For Each c In pt
If "a" <= c AndAlso c <= "z" Then
sb.Append(CODES(c))
Else
sb.Append(CODES(" "))
End If
Next
Dim et = sb.ToString()
Dim mg = message.ToLower()
sb.Length = 0
Dim count = 0
For Each c In mg
If "a" <= c AndAlso c <= "z" Then
If et(count) = "A" Then
sb.Append(c)
Else
sb.Append(Chr(Asc(c) - 32))
End If
count += 1
If count = et.Length Then
Exit For
End If
Else
sb.Append(c)
End If
Next
Return sb.ToString()
End Function
Function Decode(message As String) As String
Dim sb As New StringBuilder
For Each c In message
If "a" <= c AndAlso c <= "z" Then
sb.Append("A")
ElseIf "A" <= c AndAlso c <= "Z" Then
sb.Append("B")
End If
Next
Dim et = sb.ToString()
sb.Length = 0
For index = 0 To et.Length - 1 Step 5
Dim quintet = et.Substring(index, 5)
Dim key = CODES.Where(Function(a) a.Value = quintet).First().Key
sb.Append(key)
Next
Return sb.ToString()
End Function
Sub Main()
Dim plainText = "the quick brown fox jumps over the lazy dog"
Dim message =
"bacon
"this task is to implement a program for encryption and decryption of " +
"plaintext using the simple alphabet of the baconian cipher or some " +
"other kind of representation of this alphabet (make anything signify anything). " +
"the baconian alphabet may optionally be extended to encode all lower " +
"case characters individually and/or adding a few punctuation characters " +
"such as the space."
Dim cipherText = Encode(plainText, message)
Console.WriteLine("Cipher text ->" & Environment.NewLine & "{0}", cipherText)
Dim decodedText = Decode(cipherText)
Console.WriteLine(Environment.NewLine & "Hidden text ->" & Environment.NewLine & "{0}", decodedText)
End Sub
End Module
|
Convert the following code from Go to VB, ensuring the logic remains intact. | package main
import(
"fmt"
"strings"
)
var codes = map[rune]string {
'a' : "AAAAA", 'b' : "AAAAB", 'c' : "AAABA", 'd' : "AAABB", 'e' : "AABAA",
'f' : "AABAB", 'g' : "AABBA", 'h' : "AABBB", 'i' : "ABAAA", 'j' : "ABAAB",
'k' : "ABABA", 'l' : "ABABB", 'm' : "ABBAA", 'n' : "ABBAB", 'o' : "ABBBA",
'p' : "ABBBB", 'q' : "BAAAA", 'r' : "BAAAB", 's' : "BAABA", 't' : "BAABB",
'u' : "BABAA", 'v' : "BABAB", 'w' : "BABBA", 'x' : "BABBB", 'y' : "BBAAA",
'z' : "BBAAB", ' ' : "BBBAA",
}
func baconEncode(plainText string, message string) string {
pt := strings.ToLower(plainText)
var sb []byte
for _, c := range pt {
if c >= 'a' && c <= 'z' {
sb = append(sb, codes[c]...)
} else {
sb = append(sb, codes[' ']...)
}
}
et := string(sb)
mg := strings.ToLower(message)
sb = nil
var count = 0
for _, c := range mg {
if c >= 'a' && c <= 'z' {
if et[count] == 'A' {
sb = append(sb, byte(c))
} else {
sb = append(sb, byte(c - 32))
}
count++
if count == len(et) { break }
} else {
sb = append(sb, byte(c))
}
}
return string(sb)
}
func baconDecode(message string) string {
var sb []byte
for _, c := range message {
if c >= 'a' && c <= 'z' {
sb = append(sb, 'A')
} else if c >= 'A' && c <= 'Z' {
sb = append(sb, 'B')
}
}
et := string(sb)
sb = nil
for i := 0; i < len(et); i += 5 {
quintet := et[i : i + 5]
for k, v := range codes {
if v == quintet {
sb = append(sb, byte(k))
break
}
}
}
return string(sb)
}
func main() {
plainText := "the quick brown fox jumps over the lazy dog"
message := "bacon's cipher is a method of steganography created by francis bacon." +
"this task is to implement a program for encryption and decryption of " +
"plaintext using the simple alphabet of the baconian cipher or some " +
"other kind of representation of this alphabet (make anything signify anything). " +
"the baconian alphabet may optionally be extended to encode all lower " +
"case characters individually and/or adding a few punctuation characters " +
"such as the space."
cipherText := baconEncode(plainText, message)
fmt.Printf("Cipher text ->\n\n%s\n", cipherText)
decodedText := baconDecode(cipherText)
fmt.Printf("\nHidden text ->\n\n%s\n", decodedText)
}
| Imports System.Text
Module Module1
ReadOnly CODES As New Dictionary(Of Char, String) From {
{"a", "AAAAA"}, {"b", "AAAAB"}, {"c", "AAABA"}, {"d", "AAABB"}, {"e", "AABAA"},
{"f", "AABAB"}, {"g", "AABBA"}, {"h", "AABBB"}, {"i", "ABAAA"}, {"j", "ABAAB"},
{"k", "ABABA"}, {"l", "ABABB"}, {"m", "ABBAA"}, {"n", "ABBAB"}, {"o", "ABBBA"},
{"p", "ABBBB"}, {"q", "BAAAA"}, {"r", "BAAAB"}, {"s", "BAABA"}, {"t", "BAABB"},
{"u", "BABAA"}, {"v", "BABAB"}, {"w", "BABBA"}, {"x", "BABBB"}, {"y", "BBAAA"},
{"z", "BBAAB"}, {" ", "BBBAA"}
}
Function Encode(plainText As String, message As String) As String
Dim pt = plainText.ToLower()
Dim sb As New StringBuilder()
For Each c In pt
If "a" <= c AndAlso c <= "z" Then
sb.Append(CODES(c))
Else
sb.Append(CODES(" "))
End If
Next
Dim et = sb.ToString()
Dim mg = message.ToLower()
sb.Length = 0
Dim count = 0
For Each c In mg
If "a" <= c AndAlso c <= "z" Then
If et(count) = "A" Then
sb.Append(c)
Else
sb.Append(Chr(Asc(c) - 32))
End If
count += 1
If count = et.Length Then
Exit For
End If
Else
sb.Append(c)
End If
Next
Return sb.ToString()
End Function
Function Decode(message As String) As String
Dim sb As New StringBuilder
For Each c In message
If "a" <= c AndAlso c <= "z" Then
sb.Append("A")
ElseIf "A" <= c AndAlso c <= "Z" Then
sb.Append("B")
End If
Next
Dim et = sb.ToString()
sb.Length = 0
For index = 0 To et.Length - 1 Step 5
Dim quintet = et.Substring(index, 5)
Dim key = CODES.Where(Function(a) a.Value = quintet).First().Key
sb.Append(key)
Next
Return sb.ToString()
End Function
Sub Main()
Dim plainText = "the quick brown fox jumps over the lazy dog"
Dim message =
"bacon
"this task is to implement a program for encryption and decryption of " +
"plaintext using the simple alphabet of the baconian cipher or some " +
"other kind of representation of this alphabet (make anything signify anything). " +
"the baconian alphabet may optionally be extended to encode all lower " +
"case characters individually and/or adding a few punctuation characters " +
"such as the space."
Dim cipherText = Encode(plainText, message)
Console.WriteLine("Cipher text ->" & Environment.NewLine & "{0}", cipherText)
Dim decodedText = Decode(cipherText)
Console.WriteLine(Environment.NewLine & "Hidden text ->" & Environment.NewLine & "{0}", decodedText)
End Sub
End Module
|
Generate a VB translation of this Go snippet without changing its computational steps. | package main
import (
"fmt"
"strconv"
)
var n = 5
func main() {
if n < 1 {
return
}
top, left, bottom, right := 0, 0, n-1, n-1
sz := n * n
a := make([]int, sz)
i := 0
for left < right {
for c := left; c <= right; c++ {
a[top*n+c] = i
i++
}
top++
for r := top; r <= bottom; r++ {
a[r*n+right] = i
i++
}
right--
if top == bottom {
break
}
for c := right; c >= left; c-- {
a[bottom*n+c] = i
i++
}
bottom--
for r := bottom; r >= top; r-- {
a[r*n+left] = i
i++
}
left++
}
a[top*n+left] = i
w := len(strconv.Itoa(n*n - 1))
for i, e := range a {
fmt.Printf("%*d ", w, e)
if i%n == n-1 {
fmt.Println("")
}
}
}
| Function build_spiral(n)
botcol = 0 : topcol = n - 1
botrow = 0 : toprow = n - 1
Dim matrix()
ReDim matrix(topcol,toprow)
dir = 0 : col = 0 : row = 0
For i = 0 To n*n-1
matrix(col,row) = i
Select Case dir
Case 0
If col < topcol Then
col = col + 1
Else
dir = 1 : row = row + 1 : botrow = botrow + 1
End If
Case 1
If row < toprow Then
row = row + 1
Else
dir = 2 : col = col - 1 : topcol = topcol - 1
End If
Case 2
If col > botcol Then
col = col - 1
Else
dir = 3 : row = row - 1 : toprow = toprow - 1
End If
Case 3
If row > botrow Then
row = row - 1
Else
dir = 0 : col = col + 1 : botcol = botcol + 1
End If
End Select
Next
For y = 0 To n-1
For x = 0 To n-1
WScript.StdOut.Write matrix(x,y) & vbTab
Next
WScript.StdOut.WriteLine
Next
End Function
build_spiral(CInt(WScript.Arguments(0)))
|
Translate this program into VB but keep the logic exactly as in Go. | type cell string
type spec struct {
less func(cell, cell) bool
column int
reverse bool
}
func newSpec() (s spec) {
return
}
t.sort(newSpec())
s := newSpec
s.reverse = true
t.sort(s)
| Private Sub optional_parameters(theRange As String, _
Optional ordering As Integer = 0, _
Optional column As Integer = 1, _
Optional reverse As Integer = 1)
ActiveSheet.Sort.SortFields.Clear
ActiveSheet.Sort.SortFields.Add _
Key:=Range(theRange).Columns(column), _
SortOn:=SortOnValues, _
Order:=reverse, _
DataOption:=ordering
With ActiveSheet.Sort
.SetRange Range(theRange)
.Header = xlGuess
.MatchCase = False
.Orientation = xlTopToBottom
.SortMethod = xlPinYin
.Apply
End With
End Sub
Public Sub main()
optional_parameters theRange:="A1:C4", ordering:=1, column:=2, reverse:=1
End Sub
|
Port the following code from Go to VB with equivalent syntax and logic. | package main
import "C"
import (
"fmt"
"unsafe"
)
func main() {
go1 := "hello C"
c1 := C.CString(go1)
go1 = ""
c2 := C.strdup(c1)
C.free(unsafe.Pointer(c1))
go2 := C.GoString(c2)
C.free(unsafe.Pointer(c2))
fmt.Println(go2)
}
| Declare Function CreateFileW Lib "Kernel32" (FileName As WString, DesiredAccess As Integer, ShareMode As Integer, SecurityAttributes As Integer, _
CreateDisposition As Integer, Flags As Integer, Template As Integer) As Integer
Declare Function WriteFile Lib "Kernel32" (fHandle As Integer, writeData As Ptr, numOfBytes As Integer, ByRef numOfBytesWritten As Integer, _
overlapped As Ptr) As Boolean
Declare Function GetLastError Lib "Kernel32" () As Integer
Declare Function CloseHandle Lib "kernel32" (hObject As Integer) As Boolean
Const FILE_SHARE_READ = &h00000001
Const FILE_SHARE_WRITE = &h00000002
Const OPEN_EXISTING = 3
Dim fHandle As Integer = CreateFileW("C:\foo.txt", 0, FILE_SHARE_READ Or FILE_SHARE_WRITE, 0, OPEN_EXISTING, 0, 0)
If fHandle > 0 Then
Dim mb As MemoryBlock = "Hello, World!"
Dim bytesWritten As Integer
If Not WriteFile(fHandle, mb, mb.Size, bytesWritten, Nil) Then
MsgBox("Error Number: " + Str(GetLastError))
End If
Call CloseHandle(fHandle)
Else
MsgBox("Error Number: " + Str(GetLastError))
End If
|
Write a version of this Go function in VB with identical behavior. | package main
import (
"fmt"
"math/big"
)
func bernoulli(n uint) *big.Rat {
a := make([]big.Rat, n+1)
z := new(big.Rat)
for m := range a {
a[m].SetFrac64(1, int64(m+1))
for j := m; j >= 1; j-- {
d := &a[j-1]
d.Mul(z.SetInt64(int64(j)), d.Sub(d, &a[j]))
}
}
if n != 1 {
return &a[0]
}
a[0].Neg(&a[0])
return &a[0]
}
func binomial(n, k int) int64 {
if n <= 0 || k <= 0 || n < k {
return 1
}
var num, den int64 = 1, 1
for i := k + 1; i <= n; i++ {
num *= int64(i)
}
for i := 2; i <= n-k; i++ {
den *= int64(i)
}
return num / den
}
func faulhaberTriangle(p int) []big.Rat {
coeffs := make([]big.Rat, p+1)
q := big.NewRat(1, int64(p)+1)
t := new(big.Rat)
u := new(big.Rat)
sign := -1
for j := range coeffs {
sign *= -1
d := &coeffs[p-j]
t.SetInt64(int64(sign))
u.SetInt64(binomial(p+1, j))
d.Mul(q, t)
d.Mul(d, u)
d.Mul(d, bernoulli(uint(j)))
}
return coeffs
}
func main() {
for i := 0; i < 10; i++ {
coeffs := faulhaberTriangle(i)
for _, coeff := range coeffs {
fmt.Printf("%5s ", coeff.RatString())
}
fmt.Println()
}
fmt.Println()
k := 17
cc := faulhaberTriangle(k)
n := int64(1000)
nn := big.NewRat(n, 1)
np := big.NewRat(1, 1)
sum := new(big.Rat)
tmp := new(big.Rat)
for _, c := range cc {
np.Mul(np, nn)
tmp.Set(np)
tmp.Mul(tmp, &c)
sum.Add(sum, tmp)
}
fmt.Println(sum.RatString())
}
| Module Module1
Class Frac
Private ReadOnly num As Long
Private ReadOnly denom As Long
Public Shared ReadOnly ZERO = New Frac(0, 1)
Public Shared ReadOnly ONE = New Frac(1, 1)
Public Sub New(n As Long, d As Long)
If d = 0 Then
Throw New ArgumentException("d must not be zero")
End If
Dim nn = n
Dim dd = d
If nn = 0 Then
dd = 1
ElseIf dd < 0 Then
nn = -nn
dd = -dd
End If
Dim g = Math.Abs(Gcd(nn, dd))
If g > 1 Then
nn /= g
dd /= g
End If
num = nn
denom = dd
End Sub
Private Shared Function Gcd(a As Long, b As Long) As Long
If b = 0 Then
Return a
Else
Return Gcd(b, a Mod b)
End If
End Function
Public Shared Operator -(self As Frac) As Frac
Return New Frac(-self.num, self.denom)
End Operator
Public Shared Operator +(lhs As Frac, rhs As Frac) As Frac
Return New Frac(lhs.num * rhs.denom + lhs.denom * rhs.num, rhs.denom * lhs.denom)
End Operator
Public Shared Operator -(lhs As Frac, rhs As Frac) As Frac
Return lhs + -rhs
End Operator
Public Shared Operator *(lhs As Frac, rhs As Frac) As Frac
Return New Frac(lhs.num * rhs.num, lhs.denom * rhs.denom)
End Operator
Public Shared Operator <(lhs As Frac, rhs As Frac) As Boolean
Dim x = lhs.num / lhs.denom
Dim y = rhs.num / rhs.denom
Return x < y
End Operator
Public Shared Operator >(lhs As Frac, rhs As Frac) As Boolean
Dim x = lhs.num / lhs.denom
Dim y = rhs.num / rhs.denom
Return x > y
End Operator
Public Shared Operator =(lhs As Frac, rhs As Frac) As Boolean
Return lhs.num = rhs.num AndAlso lhs.denom = rhs.denom
End Operator
Public Shared Operator <>(lhs As Frac, rhs As Frac) As Boolean
Return lhs.num <> rhs.num OrElse lhs.denom <> rhs.denom
End Operator
Public Overrides Function ToString() As String
If denom = 1 Then
Return num.ToString
Else
Return String.Format("{0}/{1}", num, denom)
End If
End Function
Public Overrides Function Equals(obj As Object) As Boolean
Dim frac = CType(obj, Frac)
Return Not IsNothing(frac) AndAlso num = frac.num AndAlso denom = frac.denom
End Function
End Class
Function Bernoulli(n As Integer) As Frac
If n < 0 Then
Throw New ArgumentException("n may not be negative or zero")
End If
Dim a(n + 1) As Frac
For m = 0 To n
a(m) = New Frac(1, m + 1)
For j = m To 1 Step -1
a(j - 1) = (a(j - 1) - a(j)) * New Frac(j, 1)
Next
Next
If n <> 1 Then
Return a(0)
Else
Return -a(0)
End If
End Function
Function Binomial(n As Integer, k As Integer) As Integer
If n < 0 OrElse k < 0 OrElse n < k Then
Throw New ArgumentException()
End If
If n = 0 OrElse k = 0 Then
Return 1
End If
Dim num = 1
For i = k + 1 To n
num *= i
Next
Dim denom = 1
For i = 2 To n - k
denom *= i
Next
Return num \ denom
End Function
Function FaulhaberTriangle(p As Integer) As Frac()
Dim coeffs(p + 1) As Frac
For i = 1 To p + 1
coeffs(i - 1) = Frac.ZERO
Next
Dim q As New Frac(1, p + 1)
Dim sign = -1
For j = 0 To p
sign *= -1
coeffs(p - j) = q * New Frac(sign, 1) * New Frac(Binomial(p + 1, j), 1) * Bernoulli(j)
Next
Return coeffs
End Function
Sub Main()
For i = 1 To 10
Dim coeffs = FaulhaberTriangle(i - 1)
For Each coeff In coeffs
Console.Write("{0,5} ", coeff)
Next
Console.WriteLine()
Next
End Sub
End Module
|
Port the provided Go code into VB while preserving the original functionality. | package main
import (
"fmt"
"os"
)
func main() {
for i, x := range os.Args[1:] {
fmt.Printf("the argument #%d is %s\n", i, x)
}
}
| Function Run(args() as String) As Integer
For each arg As String In args
Stdout.WriteLine(arg)
Next
End Function
|
Change the following Go code into VB without altering its purpose. | package main
import (
"fmt"
"os"
)
func main() {
for i, x := range os.Args[1:] {
fmt.Printf("the argument #%d is %s\n", i, x)
}
}
| Function Run(args() as String) As Integer
For each arg As String In args
Stdout.WriteLine(arg)
Next
End Function
|
Can you help me rewrite this code in VB instead of Go, keeping it the same logically? | package main
import (
"bytes"
"fmt"
"io/ioutil"
"log"
"sort"
"strings"
)
func main() {
b, err := ioutil.ReadFile("unixdict.txt")
if err != nil {
log.Fatal("Error reading file")
}
letters := "deegklnow"
wordsAll := bytes.Split(b, []byte{'\n'})
var words [][]byte
for _, word := range wordsAll {
word = bytes.TrimSpace(word)
le := len(word)
if le > 2 && le < 10 {
words = append(words, word)
}
}
var found []string
for _, word := range words {
le := len(word)
if bytes.IndexByte(word, 'k') >= 0 {
lets := letters
ok := true
for i := 0; i < le; i++ {
c := word[i]
ix := sort.Search(len(lets), func(i int) bool { return lets[i] >= c })
if ix < len(lets) && lets[ix] == c {
lets = lets[0:ix] + lets[ix+1:]
} else {
ok = false
break
}
}
if ok {
found = append(found, string(word))
}
}
}
fmt.Println("The following", len(found), "words are the solutions to the puzzle:")
fmt.Println(strings.Join(found, "\n"))
mostFound := 0
var mostWords9 []string
var mostLetters []byte
var words9 [][]byte
for _, word := range words {
if len(word) == 9 {
words9 = append(words9, word)
}
}
for _, word9 := range words9 {
letterBytes := make([]byte, len(word9))
copy(letterBytes, word9)
sort.Slice(letterBytes, func(i, j int) bool { return letterBytes[i] < letterBytes[j] })
distinctBytes := []byte{letterBytes[0]}
for _, b := range letterBytes[1:] {
if b != distinctBytes[len(distinctBytes)-1] {
distinctBytes = append(distinctBytes, b)
}
}
distinctLetters := string(distinctBytes)
for _, letter := range distinctLetters {
found := 0
letterByte := byte(letter)
for _, word := range words {
le := len(word)
if bytes.IndexByte(word, letterByte) >= 0 {
lets := string(letterBytes)
ok := true
for i := 0; i < le; i++ {
c := word[i]
ix := sort.Search(len(lets), func(i int) bool { return lets[i] >= c })
if ix < len(lets) && lets[ix] == c {
lets = lets[0:ix] + lets[ix+1:]
} else {
ok = false
break
}
}
if ok {
found = found + 1
}
}
}
if found > mostFound {
mostFound = found
mostWords9 = []string{string(word9)}
mostLetters = []byte{letterByte}
} else if found == mostFound {
mostWords9 = append(mostWords9, string(word9))
mostLetters = append(mostLetters, letterByte)
}
}
}
fmt.Println("\nMost words found =", mostFound)
fmt.Println("Nine letter words producing this total:")
for i := 0; i < len(mostWords9); i++ {
fmt.Println(mostWords9[i], "with central letter", string(mostLetters[i]))
}
}
| Const wheel="ndeokgelw"
Sub print(s):
On Error Resume Next
WScript.stdout.WriteLine (s)
If err= &h80070006& Then WScript.Echo " Please run this script with CScript": WScript.quit
End Sub
Dim oDic
Set oDic = WScript.CreateObject("scripting.dictionary")
Dim cnt(127)
Dim fso
Set fso = WScript.CreateObject("Scripting.Filesystemobject")
Set ff=fso.OpenTextFile("unixdict.txt")
i=0
print "reading words of 3 or more letters"
While Not ff.AtEndOfStream
x=LCase(ff.ReadLine)
If Len(x)>=3 Then
If Not odic.exists(x) Then oDic.Add x,0
End If
Wend
print "remaining words: "& oDic.Count & vbcrlf
ff.Close
Set ff=Nothing
Set fso=Nothing
Set re=New RegExp
print "removing words with chars not in the wheel"
re.pattern="[^"& wheel &"]"
For Each w In oDic.Keys
If re.test(w) Then oDic.remove(w)
Next
print "remaining words: "& oDic.Count & vbcrlf
print "ensuring the mandatory letter "& Mid(wheel,5,1) & " is present"
re.Pattern=Mid(wheel,5,1)
For Each w In oDic.Keys
If Not re.test(w) Then oDic.remove(w)
Next
print "remaining words: "& oDic.Count & vbcrlf
print "checking number of chars"
Dim nDic
Set nDic = WScript.CreateObject("scripting.dictionary")
For i=1 To Len(wheel)
x=Mid(wheel,i,1)
If nDic.Exists(x) Then
a=nDic(x)
nDic(x)=Array(a(0)+1,0)
Else
nDic.add x,Array(1,0)
End If
Next
For Each w In oDic.Keys
For Each c In nDic.Keys
ndic(c)=Array(nDic(c)(0),0)
Next
For ii = 1 To len(w)
c=Mid(w,ii,1)
a=nDic(c)
If (a(0)=a(1)) Then
oDic.Remove(w):Exit For
End If
nDic(c)=Array(a(0),a(1)+1)
Next
Next
print "Remaining words "& oDic.count
For Each w In oDic.Keys
print w
Next
|
Rewrite this program in VB while keeping its functionality equivalent to the Go version. | package main
import "fmt"
func main() {
a := []int{1, 2, 3}
b := []int{7, 12, 60}
c := append(a, b...)
fmt.Println(c)
i := []interface{}{1, 2, 3}
j := []interface{}{"Crosby", "Stills", "Nash", "Young"}
k := append(i, j...)
fmt.Println(k)
l := [...]int{1, 2, 3}
m := [...]int{7, 12, 60}
var n [len(l) + len(m)]int
copy(n[:], l[:])
copy(n[len(l):], m[:])
fmt.Println(n)
}
| DEFINT A(1 to 4) = {1, 2, 3, 4}
DEFINT B(1 to 4) = {10, 20, 30, 40}
Redim A(1 to 8) as integer
MEMCPY(varptr(A(5)), varptr(B(1)), Sizeof(integer)*4)
|
Write the same algorithm in VB as shown in this Go implementation. | package main
import "fmt"
func main() {
var s string
var i int
if _, err := fmt.Scan(&s, &i); err == nil && i == 75000 {
fmt.Println("good")
} else {
fmt.Println("wrong")
}
}
| Public Sub text()
Debug.Print InputBox("Input a string")
Debug.Print InputBox("Input the integer 75000", "Input an integer", 75000, Context = "Long")
End Sub
|
Convert this Go block to VB, preserving its control flow and logic. | package main
import (
"encoding/binary"
"log"
"math"
"os"
"strings"
)
func main() {
const (
sampleRate = 44100
duration = 8
dataLength = sampleRate * duration
hdrSize = 44
fileLen = dataLength + hdrSize - 8
)
buf1 := make([]byte, 1)
buf2 := make([]byte, 2)
buf4 := make([]byte, 4)
var sb strings.Builder
sb.WriteString("RIFF")
binary.LittleEndian.PutUint32(buf4, fileLen)
sb.Write(buf4)
sb.WriteString("WAVE")
sb.WriteString("fmt ")
binary.LittleEndian.PutUint32(buf4, 16)
sb.Write(buf4)
binary.LittleEndian.PutUint16(buf2, 1)
sb.Write(buf2)
sb.Write(buf2)
binary.LittleEndian.PutUint32(buf4, sampleRate)
sb.Write(buf4)
sb.Write(buf4)
sb.Write(buf2)
binary.LittleEndian.PutUint16(buf2, 8)
sb.Write(buf2)
sb.WriteString("data")
binary.LittleEndian.PutUint32(buf4, dataLength)
sb.Write(buf4)
wavhdr := []byte(sb.String())
f, err := os.Create("notes.wav")
if err != nil {
log.Fatal(err)
}
defer f.Close()
f.Write(wavhdr)
freqs := [8]float64{261.6, 293.6, 329.6, 349.2, 392.0, 440.0, 493.9, 523.3}
for j := 0; j < duration; j++ {
freq := freqs[j]
omega := 2 * math.Pi * freq
for i := 0; i < dataLength/duration; i++ {
y := 32 * math.Sin(omega*float64(i)/float64(sampleRate))
buf1[0] = byte(math.Round(y))
f.Write(buf1)
}
}
}
| Option Explicit
Declare Function Beep Lib "kernel32" (ByVal Freq As Long, ByVal Dur As Long) As Long
Sub Musical_Scale()
Dim Fqs, i As Integer
Fqs = Array(264, 297, 330, 352, 396, 440, 495, 528)
For i = LBound(Fqs) To UBound(Fqs)
Beep Fqs(i), 500
Next
End Sub
|
Rewrite the snippet below in VB so it works the same as the original Go code. | package main
import (
"encoding/binary"
"log"
"math"
"os"
"strings"
)
func main() {
const (
sampleRate = 44100
duration = 8
dataLength = sampleRate * duration
hdrSize = 44
fileLen = dataLength + hdrSize - 8
)
buf1 := make([]byte, 1)
buf2 := make([]byte, 2)
buf4 := make([]byte, 4)
var sb strings.Builder
sb.WriteString("RIFF")
binary.LittleEndian.PutUint32(buf4, fileLen)
sb.Write(buf4)
sb.WriteString("WAVE")
sb.WriteString("fmt ")
binary.LittleEndian.PutUint32(buf4, 16)
sb.Write(buf4)
binary.LittleEndian.PutUint16(buf2, 1)
sb.Write(buf2)
sb.Write(buf2)
binary.LittleEndian.PutUint32(buf4, sampleRate)
sb.Write(buf4)
sb.Write(buf4)
sb.Write(buf2)
binary.LittleEndian.PutUint16(buf2, 8)
sb.Write(buf2)
sb.WriteString("data")
binary.LittleEndian.PutUint32(buf4, dataLength)
sb.Write(buf4)
wavhdr := []byte(sb.String())
f, err := os.Create("notes.wav")
if err != nil {
log.Fatal(err)
}
defer f.Close()
f.Write(wavhdr)
freqs := [8]float64{261.6, 293.6, 329.6, 349.2, 392.0, 440.0, 493.9, 523.3}
for j := 0; j < duration; j++ {
freq := freqs[j]
omega := 2 * math.Pi * freq
for i := 0; i < dataLength/duration; i++ {
y := 32 * math.Sin(omega*float64(i)/float64(sampleRate))
buf1[0] = byte(math.Round(y))
f.Write(buf1)
}
}
}
| Option Explicit
Declare Function Beep Lib "kernel32" (ByVal Freq As Long, ByVal Dur As Long) As Long
Sub Musical_Scale()
Dim Fqs, i As Integer
Fqs = Array(264, 297, 330, 352, 396, 440, 495, 528)
For i = LBound(Fqs) To UBound(Fqs)
Beep Fqs(i), 500
Next
End Sub
|
Ensure the translated VB code behaves exactly like the original Go snippet. | package main
import "fmt"
type item struct {
string
w, v int
}
var wants = []item{
{"map", 9, 150},
{"compass", 13, 35},
{"water", 153, 200},
{"sandwich", 50, 160},
{"glucose", 15, 60},
{"tin", 68, 45},
{"banana", 27, 60},
{"apple", 39, 40},
{"cheese", 23, 30},
{"beer", 52, 10},
{"suntan cream", 11, 70},
{"camera", 32, 30},
{"T-shirt", 24, 15},
{"trousers", 48, 10},
{"umbrella", 73, 40},
{"waterproof trousers", 42, 70},
{"waterproof overclothes", 43, 75},
{"note-case", 22, 80},
{"sunglasses", 7, 20},
{"towel", 18, 12},
{"socks", 4, 50},
{"book", 30, 10},
}
const maxWt = 400
func main() {
items, w, v := m(len(wants)-1, maxWt)
fmt.Println(items)
fmt.Println("weight:", w)
fmt.Println("value:", v)
}
func m(i, w int) ([]string, int, int) {
if i < 0 || w == 0 {
return nil, 0, 0
} else if wants[i].w > w {
return m(i-1, w)
}
i0, w0, v0 := m(i-1, w)
i1, w1, v1 := m(i-1, w-wants[i].w)
v1 += wants[i].v
if v1 > v0 {
return append(i1, wants[i].string), w1 + wants[i].w, v1
}
return i0, w0, v0
}
|
Option Explicit
Const maxWeight = 400
Dim DataList As Variant
Dim xList(64, 3) As Variant
Dim nItems As Integer
Dim s As String, xss As String
Dim xwei As Integer, xval As Integer, nn As Integer
Sub Main()
Dim i As Integer, j As Integer
DataList = Array("map", 9, 150, "compass", 13, 35, "water", 153, 200, "sandwich", 50, 160, _
"glucose", 15, 60, "tin", 68, 45, "banana", 27, 60, "apple", 39, 40, _
"cheese", 23, 30, "beer", 52, 10, "suntan cream", 11, 70, "camera", 32, 30, _
"T-shirt", 24, 15, "trousers", 48, 10, "umbrella", 73, 40, "book", 30, 10, _
"waterproof trousers", 42, 70, "waterproof overclothes", 43, 75, _
"note-case", 22, 80, "sunglasses", 7, 20, "towel", 18, 12, "socks", 4, 50)
nItems = (UBound(DataList) + 1) / 3
j = 0
For i = 1 To nItems
xList(i, 1) = DataList(j)
xList(i, 2) = DataList(j + 1)
xList(i, 3) = DataList(j + 2)
j = j + 3
Next i
s = ""
For i = 1 To nItems
s = s & Chr(i)
Next
nn = 0
Call ChoiceBin(1, "")
For i = 1 To Len(xss)
j = Asc(Mid(xss, i, 1))
Debug.Print xList(j, 1)
Next i
Debug.Print "count=" & Len(xss), "weight=" & xwei, "value=" & xval
End Sub
Private Sub ChoiceBin(n As String, ss As String)
Dim r As String
Dim i As Integer, j As Integer, iwei As Integer, ival As Integer
Dim ipct As Integer
If n = Len(s) + 1 Then
iwei = 0: ival = 0
For i = 1 To Len(ss)
j = Asc(Mid(ss, i, 1))
iwei = iwei + xList(j, 2)
ival = ival + xList(j, 3)
Next
If iwei <= maxWeight And ival > xval Then
xss = ss: xwei = iwei: xval = ival
End If
Else
r = Mid(s, n, 1)
Call ChoiceBin(n + 1, ss & r)
Call ChoiceBin(n + 1, ss)
End If
End Sub
|
Write the same code in VB as shown below in Go. | package main
import (
"fmt"
"sort"
)
func getPrimes(max int) []int {
if max < 2 {
return []int{}
}
lprimes := []int{2}
outer:
for x := 3; x <= max; x += 2 {
for _, p := range lprimes {
if x%p == 0 {
continue outer
}
}
lprimes = append(lprimes, x)
}
return lprimes
}
func main() {
const maxSum = 99
descendants := make([][]int64, maxSum+1)
ancestors := make([][]int, maxSum+1)
for i := 0; i <= maxSum; i++ {
descendants[i] = []int64{}
ancestors[i] = []int{}
}
primes := getPrimes(maxSum)
for _, p := range primes {
descendants[p] = append(descendants[p], int64(p))
for s := 1; s < len(descendants)-p; s++ {
temp := make([]int64, len(descendants[s]))
for i := 0; i < len(descendants[s]); i++ {
temp[i] = int64(p) * descendants[s][i]
}
descendants[s+p] = append(descendants[s+p], temp...)
}
}
for _, p := range append(primes, 4) {
le := len(descendants[p])
if le == 0 {
continue
}
descendants[p][le-1] = 0
descendants[p] = descendants[p][:le-1]
}
total := 0
for s := 1; s <= maxSum; s++ {
x := descendants[s]
sort.Slice(x, func(i, j int) bool {
return x[i] < x[j]
})
total += len(descendants[s])
index := 0
for ; index < len(descendants[s]); index++ {
if descendants[s][index] > int64(maxSum) {
break
}
}
for _, d := range descendants[s][:index] {
ancestors[d] = append(ancestors[s], s)
}
if (s >= 21 && s <= 45) || (s >= 47 && s <= 73) || (s >= 75 && s < maxSum) {
continue
}
temp := fmt.Sprintf("%v", ancestors[s])
fmt.Printf("%2d: %d Ancestor(s): %-14s", s, len(ancestors[s]), temp)
le := len(descendants[s])
if le <= 10 {
fmt.Printf("%5d Descendant(s): %v\n", le, descendants[s])
} else {
fmt.Printf("%5d Descendant(s): %v\b ...]\n", le, descendants[s][:10])
}
}
fmt.Println("\nTotal descendants", total)
}
| Imports System.Math
Module Module1
Const MAXPRIME = 99
Const MAXPARENT = 99
Const NBRCHILDREN = 547100
Public Primes As New Collection()
Public PrimesR As New Collection()
Public Ancestors As New Collection()
Public Parents(MAXPARENT + 1) As Integer
Public CptDescendants(MAXPARENT + 1) As Integer
Public Children(NBRCHILDREN) As ChildStruct
Public iChildren As Integer
Public Delimiter As String = ", "
Public Structure ChildStruct
Public Child As Long
Public pLower As Integer
Public pHigher As Integer
End Structure
Sub Main()
Dim Parent As Short
Dim Sum As Short
Dim i As Short
Dim TotDesc As Integer = 0
Dim MidPrime As Integer
If GetPrimes(Primes, MAXPRIME) = vbFalse Then
Return
End If
For i = Primes.Count To 1 Step -1
PrimesR.Add(Primes.Item(i))
Next
MidPrime = PrimesR.Item(1) / 2
For Each Prime In PrimesR
Parents(Prime) = InsertChild(Parents(Prime), Prime)
CptDescendants(Prime) += 1
If Prime > MidPrime Then
Continue For
End If
For Parent = 1 To MAXPARENT
Sum = Parent + Prime
If Sum > MAXPARENT Then
Exit For
End If
If Parents(Parent) Then
InsertPreorder(Parents(Parent), Sum, Prime)
CptDescendants(Sum) += CptDescendants(Parent)
End If
Next
Next
RemoveFalseChildren()
If MAXPARENT > MAXPRIME Then
If GetPrimes(Primes, MAXPARENT) = vbFalse Then
Return
End If
End If
FileOpen(1, "Ancestors.txt", OpenMode.Output)
For Parent = 1 To MAXPARENT
GetAncestors(Parent)
PrintLine(1, "[" & Parent.ToString & "] Level: " & Ancestors.Count.ToString)
If Ancestors.Count Then
Print(1, "Ancestors: " & Ancestors.Item(1).ToString)
For i = 2 To Ancestors.Count
Print(1, ", " & Ancestors.Item(i).ToString)
Next
PrintLine(1)
Ancestors.Clear()
Else
PrintLine(1, "Ancestors: None")
End If
If CptDescendants(Parent) Then
PrintLine(1, "Descendants: " & CptDescendants(Parent).ToString)
Delimiter = ""
PrintDescendants(Parents(Parent))
PrintLine(1)
TotDesc += CptDescendants(Parent)
Else
PrintLine(1, "Descendants: None")
End If
PrintLine(1)
Next
Primes.Clear()
PrimesR.Clear()
PrintLine(1, "Total descendants " & TotDesc.ToString)
PrintLine(1)
FileClose(1)
End Sub
Function InsertPreorder(_index As Integer, _sum As Short, _prime As Short)
Parents(_sum) = InsertChild(Parents(_sum), Children(_index).Child * _prime)
If Children(_index).pLower Then
InsertPreorder(Children(_index).pLower, _sum, _prime)
End If
If Children(_index).pHigher Then
InsertPreorder(Children(_index).pHigher, _sum, _prime)
End If
Return Nothing
End Function
Function InsertChild(_index As Integer, _child As Long) As Integer
If _index Then
If _child <= Children(_index).Child Then
Children(_index).pLower = InsertChild(Children(_index).pLower, _child)
Else
Children(_index).pHigher = InsertChild(Children(_index).pHigher, _child)
End If
Else
iChildren += 1
_index = iChildren
Children(_index).Child = _child
Children(_index).pLower = 0
Children(_index).pHigher = 0
End If
Return _index
End Function
Function RemoveFalseChildren()
Dim Exclusions As New Collection
Exclusions.Add(4)
For Each Prime In Primes
Exclusions.Add(Prime)
Next
For Each ex In Exclusions
Parents(ex) = Children(Parents(ex)).pHigher
CptDescendants(ex) -= 1
Next
Exclusions.Clear()
Return Nothing
End Function
Function GetAncestors(_child As Short)
Dim Child As Short = _child
Dim Parent As Short = 0
For Each Prime In Primes
If Child = 1 Then
Exit For
End If
While Child Mod Prime = 0
Child /= Prime
Parent += Prime
End While
Next
If Parent = _child Or _child = 1 Then
Return Nothing
End If
GetAncestors(Parent)
Ancestors.Add(Parent)
Return Nothing
End Function
Function PrintDescendants(_index As Integer)
If Children(_index).pLower Then
PrintDescendants(Children(_index).pLower)
End If
Print(1, Delimiter.ToString & Children(_index).Child.ToString)
Delimiter = ", "
If Children(_index).pHigher Then
PrintDescendants(Children(_index).pHigher)
End If
Return Nothing
End Function
Function GetPrimes(ByRef _primes As Object, Optional _maxPrime As Integer = 2) As Boolean
Dim Value As Integer = 3
Dim Max As Integer
Dim Prime As Integer
If _maxPrime < 2 Then
Return vbFalse
End If
_primes.Add(2)
While Value <= _maxPrime
Max = Floor(Sqrt(Value))
For Each Prime In _primes
If Prime > Max Then
_primes.Add(Value)
Exit For
End If
If Value Mod Prime = 0 Then
Exit For
End If
Next
Value += 2
End While
Return vbTrue
End Function
End Module
|
Preserve the algorithm and functionality while converting the code from Go to VB. | package main
import "fmt"
type pair [2]int
func cart2(a, b []int) []pair {
p := make([]pair, len(a)*len(b))
i := 0
for _, a := range a {
for _, b := range b {
p[i] = pair{a, b}
i++
}
}
return p
}
func main() {
fmt.Println(cart2([]int{1, 2}, []int{3, 4}))
fmt.Println(cart2([]int{3, 4}, []int{1, 2}))
fmt.Println(cart2([]int{1, 2}, nil))
fmt.Println(cart2(nil, []int{1, 2}))
}
| Imports System.Runtime.CompilerServices
Module Module1
<Extension()>
Function CartesianProduct(Of T)(sequences As IEnumerable(Of IEnumerable(Of T))) As IEnumerable(Of IEnumerable(Of T))
Dim emptyProduct As IEnumerable(Of IEnumerable(Of T)) = {Enumerable.Empty(Of T)}
Return sequences.Aggregate(emptyProduct, Function(accumulator, sequence) From acc In accumulator From item In sequence Select acc.Concat({item}))
End Function
Sub Main()
Dim empty(-1) As Integer
Dim list1 = {1, 2}
Dim list2 = {3, 4}
Dim list3 = {1776, 1789}
Dim list4 = {7, 12}
Dim list5 = {4, 14, 23}
Dim list6 = {0, 1}
Dim list7 = {1, 2, 3}
Dim list8 = {30}
Dim list9 = {500, 100}
For Each sequnceList As Integer()() In {
({list1, list2}),
({list2, list1}),
({list1, empty}),
({empty, list1}),
({list3, list4, list5, list6}),
({list7, list8, list9}),
({list7, empty, list9})
}
Dim cart = sequnceList.CartesianProduct().Select(Function(tuple) $"({String.Join(", ", tuple)})")
Console.WriteLine($"{{{String.Join(", ", cart)}}}")
Next
End Sub
End Module
|
Write the same code in VB as shown below in Go. | package main
import "fmt"
type pair [2]int
func cart2(a, b []int) []pair {
p := make([]pair, len(a)*len(b))
i := 0
for _, a := range a {
for _, b := range b {
p[i] = pair{a, b}
i++
}
}
return p
}
func main() {
fmt.Println(cart2([]int{1, 2}, []int{3, 4}))
fmt.Println(cart2([]int{3, 4}, []int{1, 2}))
fmt.Println(cart2([]int{1, 2}, nil))
fmt.Println(cart2(nil, []int{1, 2}))
}
| Imports System.Runtime.CompilerServices
Module Module1
<Extension()>
Function CartesianProduct(Of T)(sequences As IEnumerable(Of IEnumerable(Of T))) As IEnumerable(Of IEnumerable(Of T))
Dim emptyProduct As IEnumerable(Of IEnumerable(Of T)) = {Enumerable.Empty(Of T)}
Return sequences.Aggregate(emptyProduct, Function(accumulator, sequence) From acc In accumulator From item In sequence Select acc.Concat({item}))
End Function
Sub Main()
Dim empty(-1) As Integer
Dim list1 = {1, 2}
Dim list2 = {3, 4}
Dim list3 = {1776, 1789}
Dim list4 = {7, 12}
Dim list5 = {4, 14, 23}
Dim list6 = {0, 1}
Dim list7 = {1, 2, 3}
Dim list8 = {30}
Dim list9 = {500, 100}
For Each sequnceList As Integer()() In {
({list1, list2}),
({list2, list1}),
({list1, empty}),
({empty, list1}),
({list3, list4, list5, list6}),
({list7, list8, list9}),
({list7, empty, list9})
}
Dim cart = sequnceList.CartesianProduct().Select(Function(tuple) $"({String.Join(", ", tuple)})")
Console.WriteLine($"{{{String.Join(", ", cart)}}}")
Next
End Sub
End Module
|
Convert the following code from Go to VB, ensuring the logic remains intact. | package main
import (
"fmt"
"strconv"
)
func listProperDivisors(limit int) {
if limit < 1 {
return
}
width := len(strconv.Itoa(limit))
for i := 1; i <= limit; i++ {
fmt.Printf("%*d -> ", width, i)
if i == 1 {
fmt.Println("(None)")
continue
}
for j := 1; j <= i/2; j++ {
if i%j == 0 {
fmt.Printf(" %d", j)
}
}
fmt.Println()
}
}
func countProperDivisors(n int) int {
if n < 2 {
return 0
}
count := 0
for i := 1; i <= n/2; i++ {
if n%i == 0 {
count++
}
}
return count
}
func main() {
fmt.Println("The proper divisors of the following numbers are :\n")
listProperDivisors(10)
fmt.Println()
maxCount := 0
most := []int{1}
for n := 2; n <= 20000; n++ {
count := countProperDivisors(n)
if count == maxCount {
most = append(most, n)
} else if count > maxCount {
maxCount = count
most = most[0:1]
most[0] = n
}
}
fmt.Print("The following number(s) <= 20000 have the most proper divisors, ")
fmt.Println("namely", maxCount, "\b\n")
for _, n := range most {
fmt.Println(n)
}
}
| dim _proper_divisors(100)
sub proper_divisors(n)
dim i
dim _proper_divisors_count = 0
if n <> 1 then
for i = 1 to (n \ 2)
if n %% i = 0 then
_proper_divisors_count = _proper_divisors_count + 1
_proper_divisors(_proper_divisors_count) = i
end if
next
end if
return _proper_divisors_count
end sub
sub show_proper_divisors(n, tabbed)
dim cnt = proper_divisors(n)
print str$(n) + ":"; tab(4);"(" + str$(cnt) + " items) ";
dim j
for j = 1 to cnt
if tabbed then
print str$(_proper_divisors(j)),
else
print str$(_proper_divisors(j));
end if
if (j < cnt) then print ",";
next
print
end sub
dim i
for i = 1 to 10
show_proper_divisors(i, false)
next
dim c
dim maxindex = 0
dim maxlength = 0
for t = 1 to 20000
c = proper_divisors(t)
if c > maxlength then
maxindex = t
maxlength = c
end if
next
print "A maximum at ";
show_proper_divisors(maxindex, false)
|
Generate an equivalent VB version of this Go code. | package main
import (
"encoding/xml"
"fmt"
)
func xRemarks(r CharacterRemarks) (string, error) {
b, err := xml.MarshalIndent(r, "", " ")
return string(b), err
}
type CharacterRemarks struct {
Character []crm
}
type crm struct {
Name string `xml:"name,attr"`
Remark string `xml:",chardata"`
}
func main() {
x, err := xRemarks(CharacterRemarks{[]crm{
{`April`, `Bubbly: I'm > Tam and <= Emily`},
{`Tam O'Shanter`, `Burns: "When chapman billies leave the street ..."`},
{`Emily`, `Short & shrift`},
}})
if err != nil {
x = err.Error()
}
fmt.Println(x)
}
| Module XMLOutput
Sub Main()
Dim charRemarks As New Dictionary(Of String, String)
charRemarks.Add("April", "Bubbly: I
charRemarks.Add("Tam O
charRemarks.Add("Emily", "Short & shrift")
Dim xml = <CharacterRemarks>
<%= From cr In charRemarks Select <Character name=<%= cr.Key %>><%= cr.Value %></Character> %>
</CharacterRemarks>
Console.WriteLine(xml)
End Sub
End Module
|
Convert the following code from Go to VB, ensuring the logic remains intact. | package main
import (
"fmt"
"log"
"os/exec"
)
var (
x = []int{0, 1, 2, 3, 4, 5, 6, 7, 8, 9}
y = []float64{2.7, 2.8, 31.4, 38.1, 58.0, 76.2, 100.5, 130.0, 149.3, 180.0}
)
func main() {
g := exec.Command("gnuplot", "-persist")
w, err := g.StdinPipe()
if err != nil {
log.Fatal(err)
}
if err = g.Start(); err != nil {
log.Fatal(err)
}
fmt.Fprintln(w, "unset key; plot '-'")
for i, xi := range x {
fmt.Fprintf(w, "%d %f\n", xi, y[i])
}
fmt.Fprintln(w, "e")
w.Close()
g.Wait()
}
| Private Sub plot_coordinate_pairs(x As Variant, y As Variant)
Dim chrt As Chart
Set chrt = ActiveSheet.Shapes.AddChart.Chart
With chrt
.ChartType = xlLine
.HasLegend = False
.HasTitle = True
.ChartTitle.Text = "Time"
.SeriesCollection.NewSeries
.SeriesCollection.Item(1).XValues = x
.SeriesCollection.Item(1).Values = y
.Axes(xlValue, xlPrimary).HasTitle = True
.Axes(xlValue, xlPrimary).AxisTitle.Characters.Text = "microseconds"
End With
End Sub
Public Sub main()
x = [{0, 1, 2, 3, 4, 5, 6, 7, 8, 9}]
y = [{2.7, 2.8, 31.4, 38.1, 58.0, 76.2, 100.5, 130.0, 149.3, 180.0}]
plot_coordinate_pairs x, y
End Sub
|
Rewrite the snippet below in VB so it works the same as the original Go code. | package main
import (
"fmt"
"log"
"os/exec"
)
var (
x = []int{0, 1, 2, 3, 4, 5, 6, 7, 8, 9}
y = []float64{2.7, 2.8, 31.4, 38.1, 58.0, 76.2, 100.5, 130.0, 149.3, 180.0}
)
func main() {
g := exec.Command("gnuplot", "-persist")
w, err := g.StdinPipe()
if err != nil {
log.Fatal(err)
}
if err = g.Start(); err != nil {
log.Fatal(err)
}
fmt.Fprintln(w, "unset key; plot '-'")
for i, xi := range x {
fmt.Fprintf(w, "%d %f\n", xi, y[i])
}
fmt.Fprintln(w, "e")
w.Close()
g.Wait()
}
| Private Sub plot_coordinate_pairs(x As Variant, y As Variant)
Dim chrt As Chart
Set chrt = ActiveSheet.Shapes.AddChart.Chart
With chrt
.ChartType = xlLine
.HasLegend = False
.HasTitle = True
.ChartTitle.Text = "Time"
.SeriesCollection.NewSeries
.SeriesCollection.Item(1).XValues = x
.SeriesCollection.Item(1).Values = y
.Axes(xlValue, xlPrimary).HasTitle = True
.Axes(xlValue, xlPrimary).AxisTitle.Characters.Text = "microseconds"
End With
End Sub
Public Sub main()
x = [{0, 1, 2, 3, 4, 5, 6, 7, 8, 9}]
y = [{2.7, 2.8, 31.4, 38.1, 58.0, 76.2, 100.5, 130.0, 149.3, 180.0}]
plot_coordinate_pairs x, y
End Sub
|
Write the same algorithm in VB as shown in this Go implementation. | package main
import "fmt"
import "regexp"
func main() {
str := "I am the original string"
matched, _ := regexp.MatchString(".*string$", str)
if matched { fmt.Println("ends with 'string'") }
pattern := regexp.MustCompile("original")
result := pattern.ReplaceAllString(str, "modified")
fmt.Println(result)
}
| text = "I need more coffee!!!"
Set regex = New RegExp
regex.Global = True
regex.Pattern = "\s"
If regex.Test(text) Then
WScript.StdOut.Write regex.Replace(text,vbCrLf)
Else
WScript.StdOut.Write "No matching pattern"
End If
|
Change the following Go code into VB without altering its purpose. | package main
import "fmt"
import "regexp"
func main() {
str := "I am the original string"
matched, _ := regexp.MatchString(".*string$", str)
if matched { fmt.Println("ends with 'string'") }
pattern := regexp.MustCompile("original")
result := pattern.ReplaceAllString(str, "modified")
fmt.Println(result)
}
| text = "I need more coffee!!!"
Set regex = New RegExp
regex.Global = True
regex.Pattern = "\s"
If regex.Test(text) Then
WScript.StdOut.Write regex.Replace(text,vbCrLf)
Else
WScript.StdOut.Write "No matching pattern"
End If
|
Change the following Go code into VB without altering its purpose. | package main
import "fmt"
func main() {
keys := []string{"a", "b", "c"}
vals := []int{1, 2, 3}
hash := map[string]int{}
for i, key := range keys {
hash[key] = vals[i]
}
fmt.Println(hash)
}
| Set dict = CreateObject("Scripting.Dictionary")
os = Array("Windows", "Linux", "MacOS")
owner = Array("Microsoft", "Linus Torvalds", "Apple")
For n = 0 To 2
dict.Add os(n), owner(n)
Next
MsgBox dict.Item("Linux")
MsgBox dict.Item("MacOS")
MsgBox dict.Item("Windows")
|
Maintain the same structure and functionality when rewriting this code in VB. | package main
import "github.com/fogleman/gg"
var palette = [8]string{
"000000",
"FF0000",
"00FF00",
"0000FF",
"FF00FF",
"00FFFF",
"FFFF00",
"FFFFFF",
}
func pinstripe(dc *gg.Context) {
w := dc.Width()
h := dc.Height() / 4
for b := 1; b <= 4; b++ {
for x, ci := 0, 0; x < w; x, ci = x+b, ci+1 {
dc.SetHexColor(palette[ci%8])
y := h * (b - 1)
dc.DrawRectangle(float64(x), float64(y), float64(b), float64(h))
dc.Fill()
}
}
}
func main() {
dc := gg.NewContext(900, 600)
pinstripe(dc)
dc.SavePNG("color_pinstripe.png")
}
| Public Class Main
Inherits System.Windows.Forms.Form
Public Sub New()
Me.FormBorderStyle = FormBorderStyle.None
Me.WindowState = FormWindowState.Maximized
End Sub
Private Sub Main_Load(sender As Object, e As EventArgs) Handles Me.Load
Dim Index As Integer
Dim Colors() As Color = {Color.Black, Color.Red, Color.Green, Color.Magenta, Color.Cyan, Color.Yellow, Color.White}
Dim Height = (Me.ClientSize.Height / 4) + 1
For y = 1 To 4
Dim Top = Me.ClientSize.Height / 4 * (y - 1)
For x = 0 To Me.ClientSize.Width Step y
If Index = 6 Then Index = 0 Else Index += 1
Me.Controls.Add(New Panel With {.Top = Top, .Height = Height, .Left = x, .Width = y, .BackColor = Colors(Index)})
Next
Next
End Sub
End Class
|
Generate a VB translation of this Go snippet without changing its computational steps. | package main
import (
"fmt"
"math/rand"
"time"
)
func cocktailShakerSort(a []int) {
var begin = 0
var end = len(a) - 2
for begin <= end {
newBegin := end
newEnd := begin
for i := begin; i <= end; i++ {
if a[i] > a[i+1] {
a[i+1], a[i] = a[i], a[i+1]
newEnd = i
}
}
end = newEnd - 1
for i := end; i >= begin; i-- {
if a[i] > a[i+1] {
a[i+1], a[i] = a[i], a[i+1]
newBegin = i
}
}
begin = newBegin + 1
}
}
func cocktailSort(a []int) {
last := len(a) - 1
for {
swapped := false
for i := 0; i < last; i++ {
if a[i] > a[i+1] {
a[i], a[i+1] = a[i+1], a[i]
swapped = true
}
}
if !swapped {
return
}
swapped = false
for i := last - 1; i >= 0; i-- {
if a[i] > a[i+1] {
a[i], a[i+1] = a[i+1], a[i]
swapped = true
}
}
if !swapped {
return
}
}
}
func main() {
a := []int{21, 4, -9, 62, -7, 107, -62, 4, 0, -170}
fmt.Println("Original array:", a)
b := make([]int, len(a))
copy(b, a)
cocktailSort(a)
fmt.Println("Cocktail sort :", a)
cocktailShakerSort(b)
fmt.Println("C/Shaker sort :", b)
rand.Seed(time.Now().UnixNano())
fmt.Println("\nRelative speed of the two sorts")
fmt.Println(" N x faster (CSS v CS)")
fmt.Println("----- -------------------")
const runs = 10
for _, n := range []int{1000, 2000, 4000, 8000, 10000, 20000} {
sum := 0.0
for i := 1; i <= runs; i++ {
nums := make([]int, n)
for i := 0; i < n; i++ {
rn := rand.Intn(100000)
if i%2 == 1 {
rn = -rn
}
nums[i] = rn
}
nums2 := make([]int, n)
copy(nums2, nums)
start := time.Now()
cocktailSort(nums)
elapsed := time.Since(start)
start2 := time.Now()
cocktailShakerSort(nums2)
elapsed2 := time.Since(start2)
sum += float64(elapsed) / float64(elapsed2)
}
fmt.Printf(" %2dk %0.3f\n", n/1000, sum/runs)
}
}
|
Function cocktailShakerSort(ByVal A As Variant) As Variant
beginIdx = LBound(A)
endIdx = UBound(A) - 1
Do While beginIdx <= endIdx
newBeginIdx = endIdx
newEndIdx = beginIdx
For ii = beginIdx To endIdx
If A(ii) > A(ii + 1) Then
tmp = A(ii): A(ii) = A(ii + 1): A(ii + 1) = tmp
newEndIdx = ii
End If
Next ii
endIdx = newEndIdx - 1
For ii = endIdx To beginIdx Step -1
If A(ii) > A(ii + 1) Then
tmp = A(ii): A(ii) = A(ii + 1): A(ii + 1) = tmp
newBeginIdx = ii
End If
Next ii
beginIdx = newBeginIdx + 1
Loop
cocktailShakerSort = A
End Function
Public Sub main()
Dim B(20) As Variant
For i = LBound(B) To UBound(B)
B(i) = Int(Rnd() * 100)
Next i
Debug.Print Join(B, ", ")
Debug.Print Join(cocktailShakerSort(B), ", ")
End Sub
|
Generate an equivalent VB version of this Go code. | package main
import (
"fmt"
"math/rand"
"time"
)
func cocktailShakerSort(a []int) {
var begin = 0
var end = len(a) - 2
for begin <= end {
newBegin := end
newEnd := begin
for i := begin; i <= end; i++ {
if a[i] > a[i+1] {
a[i+1], a[i] = a[i], a[i+1]
newEnd = i
}
}
end = newEnd - 1
for i := end; i >= begin; i-- {
if a[i] > a[i+1] {
a[i+1], a[i] = a[i], a[i+1]
newBegin = i
}
}
begin = newBegin + 1
}
}
func cocktailSort(a []int) {
last := len(a) - 1
for {
swapped := false
for i := 0; i < last; i++ {
if a[i] > a[i+1] {
a[i], a[i+1] = a[i+1], a[i]
swapped = true
}
}
if !swapped {
return
}
swapped = false
for i := last - 1; i >= 0; i-- {
if a[i] > a[i+1] {
a[i], a[i+1] = a[i+1], a[i]
swapped = true
}
}
if !swapped {
return
}
}
}
func main() {
a := []int{21, 4, -9, 62, -7, 107, -62, 4, 0, -170}
fmt.Println("Original array:", a)
b := make([]int, len(a))
copy(b, a)
cocktailSort(a)
fmt.Println("Cocktail sort :", a)
cocktailShakerSort(b)
fmt.Println("C/Shaker sort :", b)
rand.Seed(time.Now().UnixNano())
fmt.Println("\nRelative speed of the two sorts")
fmt.Println(" N x faster (CSS v CS)")
fmt.Println("----- -------------------")
const runs = 10
for _, n := range []int{1000, 2000, 4000, 8000, 10000, 20000} {
sum := 0.0
for i := 1; i <= runs; i++ {
nums := make([]int, n)
for i := 0; i < n; i++ {
rn := rand.Intn(100000)
if i%2 == 1 {
rn = -rn
}
nums[i] = rn
}
nums2 := make([]int, n)
copy(nums2, nums)
start := time.Now()
cocktailSort(nums)
elapsed := time.Since(start)
start2 := time.Now()
cocktailShakerSort(nums2)
elapsed2 := time.Since(start2)
sum += float64(elapsed) / float64(elapsed2)
}
fmt.Printf(" %2dk %0.3f\n", n/1000, sum/runs)
}
}
|
Function cocktailShakerSort(ByVal A As Variant) As Variant
beginIdx = LBound(A)
endIdx = UBound(A) - 1
Do While beginIdx <= endIdx
newBeginIdx = endIdx
newEndIdx = beginIdx
For ii = beginIdx To endIdx
If A(ii) > A(ii + 1) Then
tmp = A(ii): A(ii) = A(ii + 1): A(ii + 1) = tmp
newEndIdx = ii
End If
Next ii
endIdx = newEndIdx - 1
For ii = endIdx To beginIdx Step -1
If A(ii) > A(ii + 1) Then
tmp = A(ii): A(ii) = A(ii + 1): A(ii + 1) = tmp
newBeginIdx = ii
End If
Next ii
beginIdx = newBeginIdx + 1
Loop
cocktailShakerSort = A
End Function
Public Sub main()
Dim B(20) As Variant
For i = LBound(B) To UBound(B)
B(i) = Int(Rnd() * 100)
Next i
Debug.Print Join(B, ", ")
Debug.Print Join(cocktailShakerSort(B), ", ")
End Sub
|
Port the following code from Go to VB with equivalent syntax and logic. | package main
import (
"github.com/google/gxui"
"github.com/google/gxui/drivers/gl"
"github.com/google/gxui/math"
"github.com/google/gxui/themes/dark"
omath "math"
"time"
)
const (
ANIMATION_WIDTH int = 480
ANIMATION_HEIGHT int = 320
BALL_RADIUS float32 = 25.0
METER_PER_PIXEL float64 = 1.0 / 20.0
PHI_ZERO float64 = omath.Pi * 0.5
)
var (
l float64 = float64(ANIMATION_HEIGHT) * 0.5
freq float64 = omath.Sqrt(9.81 / (l * METER_PER_PIXEL))
)
type Pendulum interface {
GetPhi() float64
}
type mathematicalPendulum struct {
start time.Time
}
func (p *mathematicalPendulum) GetPhi() float64 {
if (p.start == time.Time{}) {
p.start = time.Now()
}
t := float64(time.Since(p.start).Nanoseconds()) / omath.Pow10(9)
return PHI_ZERO * omath.Cos(t*freq)
}
type numericalPendulum struct {
currentPhi float64
angAcc float64
angVel float64
lastTime time.Time
}
func (p *numericalPendulum) GetPhi() float64 {
dt := 0.0
if (p.lastTime != time.Time{}) {
dt = float64(time.Since(p.lastTime).Nanoseconds()) / omath.Pow10(9)
}
p.lastTime = time.Now()
p.angAcc = -9.81 / (float64(l) * METER_PER_PIXEL) * omath.Sin(p.currentPhi)
p.angVel += p.angAcc * dt
p.currentPhi += p.angVel * dt
return p.currentPhi
}
func draw(p Pendulum, canvas gxui.Canvas, x, y int) {
attachment := math.Point{X: ANIMATION_WIDTH/2 + x, Y: y}
phi := p.GetPhi()
ball := math.Point{X: x + ANIMATION_WIDTH/2 + math.Round(float32(l*omath.Sin(phi))), Y: y + math.Round(float32(l*omath.Cos(phi)))}
line := gxui.Polygon{gxui.PolygonVertex{attachment, 0}, gxui.PolygonVertex{ball, 0}}
canvas.DrawLines(line, gxui.DefaultPen)
m := math.Point{int(BALL_RADIUS), int(BALL_RADIUS)}
rect := math.Rect{ball.Sub(m), ball.Add(m)}
canvas.DrawRoundedRect(rect, BALL_RADIUS, BALL_RADIUS, BALL_RADIUS, BALL_RADIUS, gxui.TransparentPen, gxui.CreateBrush(gxui.Yellow))
}
func appMain(driver gxui.Driver) {
theme := dark.CreateTheme(driver)
window := theme.CreateWindow(ANIMATION_WIDTH, 2*ANIMATION_HEIGHT, "Pendulum")
window.SetBackgroundBrush(gxui.CreateBrush(gxui.Gray50))
image := theme.CreateImage()
ticker := time.NewTicker(time.Millisecond * 15)
pendulum := &mathematicalPendulum{}
pendulum2 := &numericalPendulum{PHI_ZERO, 0.0, 0.0, time.Time{}}
go func() {
for _ = range ticker.C {
canvas := driver.CreateCanvas(math.Size{ANIMATION_WIDTH, 2 * ANIMATION_HEIGHT})
canvas.Clear(gxui.White)
draw(pendulum, canvas, 0, 0)
draw(pendulum2, canvas, 0, ANIMATION_HEIGHT)
canvas.Complete()
driver.Call(func() {
image.SetCanvas(canvas)
})
}
}()
window.AddChild(image)
window.OnClose(ticker.Stop)
window.OnClose(driver.Terminate)
}
func main() {
gl.StartDriver(appMain)
}
| option explicit
const dt = 0.15
const length=23
dim ans0:ans0=chr(27)&"["
dim Veloc,Accel,angle,olr,olc,r,c
const r0=1
const c0=40
cls
angle=0.7
while 1
wscript.sleep(50)
Accel = -.9 * sin(Angle)
Veloc = Veloc + Accel * dt
Angle = Angle + Veloc * dt
r = r0 + int(cos(Angle) * Length)
c = c0+ int(2*sin(Angle) * Length)
cls
draw_line r,c,r0,c0
toxy r,c,"O"
olr=r :olc=c
wend
sub cls() wscript.StdOut.Write ans0 &"2J"&ans0 &"?25l":end sub
sub toxy(r,c,s) wscript.StdOut.Write ans0 & r & ";" & c & "f" & s :end sub
Sub draw_line(r1,c1, r2,c2)
Dim x,y,xf,yf,dx,dy,sx,sy,err,err2
x =r1 : y =c1
xf=r2 : yf=c2
dx=Abs(xf-x) : dy=Abs(yf-y)
If x<xf Then sx=+1: Else sx=-1
If y<yf Then sy=+1: Else sy=-1
err=dx-dy
Do
toxy x,y,"."
If x=xf And y=yf Then Exit Do
err2=err+err
If err2>-dy Then err=err-dy: x=x+sx
If err2< dx Then err=err+dx: y=y+sy
Loop
End Sub
|
Ensure the translated VB code behaves exactly like the original Go snippet. | package main
import "fmt"
func enc(b int) int {
return b ^ b>>1
}
func dec(g int) (b int) {
for ; g != 0; g >>= 1 {
b ^= g
}
return
}
func main() {
fmt.Println("decimal binary gray decoded")
for b := 0; b < 32; b++ {
g := enc(b)
d := dec(g)
fmt.Printf(" %2d %05b %05b %05b %2d\n", b, b, g, d, d)
}
}
| Function Encoder(ByVal n)
Encoder = n Xor (n \ 2)
End Function
Function Decoder(ByVal n)
Dim g : g = 0
Do While n > 0
g = g Xor n
n = n \ 2
Loop
Decoder = g
End Function
Function Dec2bin(ByVal n, ByVal length)
Dim i, strbin : strbin = ""
For i = 1 to 5
strbin = (n Mod 2) & strbin
n = n \ 2
Next
Dec2Bin = strbin
End Function
WScript.StdOut.WriteLine("Binary -> Gray Code -> Binary")
For i = 0 to 31
encoded = Encoder(i)
decoded = Decoder(encoded)
WScript.StdOut.WriteLine(Dec2Bin(i, 5) & " -> " & Dec2Bin(encoded, 5) & " -> " & Dec2Bin(decoded, 5))
Next
|
Produce a functionally identical VB code for the snippet given in Go. | package main
import "fmt"
func enc(b int) int {
return b ^ b>>1
}
func dec(g int) (b int) {
for ; g != 0; g >>= 1 {
b ^= g
}
return
}
func main() {
fmt.Println("decimal binary gray decoded")
for b := 0; b < 32; b++ {
g := enc(b)
d := dec(g)
fmt.Printf(" %2d %05b %05b %05b %2d\n", b, b, g, d, d)
}
}
| Function Encoder(ByVal n)
Encoder = n Xor (n \ 2)
End Function
Function Decoder(ByVal n)
Dim g : g = 0
Do While n > 0
g = g Xor n
n = n \ 2
Loop
Decoder = g
End Function
Function Dec2bin(ByVal n, ByVal length)
Dim i, strbin : strbin = ""
For i = 1 to 5
strbin = (n Mod 2) & strbin
n = n \ 2
Next
Dec2Bin = strbin
End Function
WScript.StdOut.WriteLine("Binary -> Gray Code -> Binary")
For i = 0 to 31
encoded = Encoder(i)
decoded = Decoder(encoded)
WScript.StdOut.WriteLine(Dec2Bin(i, 5) & " -> " & Dec2Bin(encoded, 5) & " -> " & Dec2Bin(decoded, 5))
Next
|
Preserve the algorithm and functionality while converting the code from Go to VB. | package cards
import (
"math/rand"
)
type Suit uint8
const (
Spade Suit = 3
Heart Suit = 2
Diamond Suit = 1
Club Suit = 0
)
func (s Suit) String() string {
const suites = "CDHS"
return suites[s : s+1]
}
type Rank uint8
const (
Ace Rank = 1
Two Rank = 2
Three Rank = 3
Four Rank = 4
Five Rank = 5
Six Rank = 6
Seven Rank = 7
Eight Rank = 8
Nine Rank = 9
Ten Rank = 10
Jack Rank = 11
Queen Rank = 12
King Rank = 13
)
func (r Rank) String() string {
const ranks = "A23456789TJQK"
return ranks[r-1 : r]
}
type Card uint8
func NewCard(r Rank, s Suit) Card {
return Card(13*uint8(s) + uint8(r-1))
}
func (c Card) RankSuit() (Rank, Suit) {
return Rank(c%13 + 1), Suit(c / 13)
}
func (c Card) Rank() Rank {
return Rank(c%13 + 1)
}
func (c Card) Suit() Suit {
return Suit(c / 13)
}
func (c Card) String() string {
return c.Rank().String() + c.Suit().String()
}
type Deck []Card
func NewDeck() Deck {
d := make(Deck, 52)
for i := range d {
d[i] = Card(i)
}
return d
}
func (d Deck) String() string {
s := ""
for i, c := range d {
switch {
case i == 0:
case i%13 == 0:
s += "\n"
default:
s += " "
}
s += c.String()
}
return s
}
func (d Deck) Shuffle() {
for i := range d {
j := rand.Intn(i + 1)
d[i], d[j] = d[j], d[i]
}
}
func (d Deck) Contains(tc Card) bool {
for _, c := range d {
if c == tc {
return true
}
}
return false
}
func (d *Deck) AddDeck(decks ...Deck) {
for _, o := range decks {
*d = append(*d, o...)
}
}
func (d *Deck) AddCard(c Card) {
*d = append(*d, c)
}
func (d *Deck) Draw(n int) Deck {
old := *d
*d = old[n:]
return old[:n:n]
}
func (d *Deck) DrawCard() (Card, bool) {
if len(*d) == 0 {
return 0, false
}
old := *d
*d = old[1:]
return old[0], true
}
func (d *Deck) Deal(cards int, hands ...Deck) ([]Deck, bool) {
for i := 0; i < cards; i++ {
for j := range hands {
if len(*d) == 0 {
return hands, false
}
hands[j] = append(hands[j], (*d)[0])
*d = (*d)[1:]
}
}
return hands, true
}
| class playingcard
dim suit
dim pips
end class
class carddeck
private suitnames
private pipnames
private cardno
private deck(52)
private nTop
sub class_initialize
dim suit
dim pips
suitnames = split("H,D,C,S",",")
pipnames = split("A,2,3,4,5,6,7,8,9,10,J,Q,K",",")
cardno = 0
for suit = 1 to 4
for pips = 1 to 13
set deck(cardno) = new playingcard
deck(cardno).suit = suitnames(suit-1)
deck(cardno).pips = pipnames(pips-1)
cardno = cardno + 1
next
next
nTop = 0
end sub
public sub showdeck
dim a
redim a(51-nTop)
for i = nTop to 51
a(i) = deck(i).pips & deck(i).suit
next
wscript.echo join( a, ", ")
end sub
public sub shuffle
dim r
randomize timer
for i = nTop to 51
r = int( rnd * ( 52 - nTop ) )
if r <> i then
objswap deck(i),deck(r)
end if
next
end sub
public function deal()
set deal = deck( nTop )
nTop = nTop + 1
end function
public property get cardsRemaining
cardsRemaining = 52 - nTop
end property
private sub objswap( a, b )
dim tmp
set tmp = a
set a = b
set b = tmp
end sub
end class
|
Can you help me rewrite this code in VB instead of Go, keeping it the same logically? | package cards
import (
"math/rand"
)
type Suit uint8
const (
Spade Suit = 3
Heart Suit = 2
Diamond Suit = 1
Club Suit = 0
)
func (s Suit) String() string {
const suites = "CDHS"
return suites[s : s+1]
}
type Rank uint8
const (
Ace Rank = 1
Two Rank = 2
Three Rank = 3
Four Rank = 4
Five Rank = 5
Six Rank = 6
Seven Rank = 7
Eight Rank = 8
Nine Rank = 9
Ten Rank = 10
Jack Rank = 11
Queen Rank = 12
King Rank = 13
)
func (r Rank) String() string {
const ranks = "A23456789TJQK"
return ranks[r-1 : r]
}
type Card uint8
func NewCard(r Rank, s Suit) Card {
return Card(13*uint8(s) + uint8(r-1))
}
func (c Card) RankSuit() (Rank, Suit) {
return Rank(c%13 + 1), Suit(c / 13)
}
func (c Card) Rank() Rank {
return Rank(c%13 + 1)
}
func (c Card) Suit() Suit {
return Suit(c / 13)
}
func (c Card) String() string {
return c.Rank().String() + c.Suit().String()
}
type Deck []Card
func NewDeck() Deck {
d := make(Deck, 52)
for i := range d {
d[i] = Card(i)
}
return d
}
func (d Deck) String() string {
s := ""
for i, c := range d {
switch {
case i == 0:
case i%13 == 0:
s += "\n"
default:
s += " "
}
s += c.String()
}
return s
}
func (d Deck) Shuffle() {
for i := range d {
j := rand.Intn(i + 1)
d[i], d[j] = d[j], d[i]
}
}
func (d Deck) Contains(tc Card) bool {
for _, c := range d {
if c == tc {
return true
}
}
return false
}
func (d *Deck) AddDeck(decks ...Deck) {
for _, o := range decks {
*d = append(*d, o...)
}
}
func (d *Deck) AddCard(c Card) {
*d = append(*d, c)
}
func (d *Deck) Draw(n int) Deck {
old := *d
*d = old[n:]
return old[:n:n]
}
func (d *Deck) DrawCard() (Card, bool) {
if len(*d) == 0 {
return 0, false
}
old := *d
*d = old[1:]
return old[0], true
}
func (d *Deck) Deal(cards int, hands ...Deck) ([]Deck, bool) {
for i := 0; i < cards; i++ {
for j := range hands {
if len(*d) == 0 {
return hands, false
}
hands[j] = append(hands[j], (*d)[0])
*d = (*d)[1:]
}
}
return hands, true
}
| class playingcard
dim suit
dim pips
end class
class carddeck
private suitnames
private pipnames
private cardno
private deck(52)
private nTop
sub class_initialize
dim suit
dim pips
suitnames = split("H,D,C,S",",")
pipnames = split("A,2,3,4,5,6,7,8,9,10,J,Q,K",",")
cardno = 0
for suit = 1 to 4
for pips = 1 to 13
set deck(cardno) = new playingcard
deck(cardno).suit = suitnames(suit-1)
deck(cardno).pips = pipnames(pips-1)
cardno = cardno + 1
next
next
nTop = 0
end sub
public sub showdeck
dim a
redim a(51-nTop)
for i = nTop to 51
a(i) = deck(i).pips & deck(i).suit
next
wscript.echo join( a, ", ")
end sub
public sub shuffle
dim r
randomize timer
for i = nTop to 51
r = int( rnd * ( 52 - nTop ) )
if r <> i then
objswap deck(i),deck(r)
end if
next
end sub
public function deal()
set deal = deck( nTop )
nTop = nTop + 1
end function
public property get cardsRemaining
cardsRemaining = 52 - nTop
end property
private sub objswap( a, b )
dim tmp
set tmp = a
set a = b
set b = tmp
end sub
end class
|
Ensure the translated VB code behaves exactly like the original Go snippet. | package main
import (
"fmt"
)
func main() {
var a [5]int
fmt.Println("len(a) =", len(a))
fmt.Println("a =", a)
a[0] = 3
fmt.Println("a =", a)
fmt.Println("a[0] =", a[0])
s := a[:4]
fmt.Println("s =", s)
fmt.Println("len(s) =", len(s), " cap(s) =", cap(s))
s = s[:5]
fmt.Println("s =", s)
a[0] = 22
fmt.Println("a =", a)
fmt.Println("s =", s)
s = append(s, 4, 5, 6)
fmt.Println("s =", s)
fmt.Println("len(s) =", len(s), " cap(s) =", cap(s))
a[4] = -1
fmt.Println("a =", a)
fmt.Println("s =", s)
s = make([]int, 8)
fmt.Println("s =", s)
fmt.Println("len(s) =", len(s), " cap(s) =", cap(s))
}
| Option Base {0|1}
|
Convert this Go snippet to VB and keep its semantics consistent. | package main
import (
"fmt"
"strings"
"unicode/utf8"
)
var order = 3
var grain = "#"
func main() {
carpet := []string{grain}
for ; order > 0; order-- {
hole := strings.Repeat(" ", utf8.RuneCountInString(carpet[0]))
middle := make([]string, len(carpet))
for i, s := range carpet {
middle[i] = s + hole + s
carpet[i] = strings.Repeat(s, 3)
}
carpet = append(append(carpet, middle...), carpet...)
}
for _, r := range carpet {
fmt.Println(r)
}
}
| Const Order = 4
Function InCarpet(ByVal x As Integer, ByVal y As Integer)
Do While x <> 0 And y <> 0
If x Mod 3 = 1 And y Mod 3 = 1 Then
InCarpet = " "
Exit Function
End If
x = x \ 3
y = y \ 3
Loop
InCarpet = "#"
End Function
Public Sub sierpinski_carpet()
Dim i As Integer, j As Integer
For i = 0 To 3 ^ Order - 1
For j = 0 To 3 ^ Order - 1
Debug.Print InCarpet(i, j);
Next j
Debug.Print
Next i
End Sub
|
Port the provided Go code into VB while preserving the original functionality. | package main
import (
"fmt"
"math/rand"
"sort"
"time"
)
func main() {
list := []int{31, 41, 59, 26, 53, 58, 97, 93, 23, 84}
rand.Seed(time.Now().UnixNano())
fmt.Println("unsorted:", list)
temp := make([]int, len(list))
copy(temp, list)
for !sort.IntsAreSorted(temp) {
for i, v := range rand.Perm(len(list)) {
temp[i] = list[v]
}
}
fmt.Println("sorted! ", temp)
}
| Private Function Knuth(a As Variant) As Variant
Dim t As Variant, i As Integer
If Not IsMissing(a) Then
For i = UBound(a) To LBound(a) + 1 Step -1
j = Int((UBound(a) - LBound(a) + 1) * Rnd + LBound(a))
t = a(i)
a(i) = a(j)
a(j) = t
Next i
End If
Knuth = a
End Function
Private Function inOrder(s As Variant)
i = 2
Do While i <= UBound(s)
If s(i) < s(i - 1) Then
inOrder = False
Exit Function
End If
i = i + 1
Loop
inOrder = True
End Function
Private Function bogosort(ByVal s As Variant) As Variant
Do While Not inOrder(s)
Debug.Print Join(s, ", ")
s = Knuth(s)
Loop
bogosort = s
End Function
Public Sub main()
Debug.Print Join(bogosort(Knuth([{1,2,3,4,5,6}])), ", ")
End Sub
|
Ensure the translated VB code behaves exactly like the original Go snippet. | package main
import (
"fmt"
"math"
)
type fdy func(float64, float64) float64
func eulerStep(f fdy, x, y, h float64) float64 {
return y + h*f(x, y)
}
func newCoolingRate(k float64) func(float64) float64 {
return func(deltaTemp float64) float64 {
return -k * deltaTemp
}
}
func newTempFunc(k, ambientTemp, initialTemp float64) func(float64) float64 {
return func(time float64) float64 {
return ambientTemp + (initialTemp-ambientTemp)*math.Exp(-k*time)
}
}
func newCoolingRateDy(k, ambientTemp float64) fdy {
crf := newCoolingRate(k)
return func(_, objectTemp float64) float64 {
return crf(objectTemp - ambientTemp)
}
}
func main() {
k := .07
tempRoom := 20.
tempObject := 100.
fcr := newCoolingRateDy(k, tempRoom)
analytic := newTempFunc(k, tempRoom, tempObject)
for _, deltaTime := range []float64{2, 5, 10} {
fmt.Printf("Step size = %.1f\n", deltaTime)
fmt.Println(" Time Euler's Analytic")
temp := tempObject
for time := 0.; time <= 100; time += deltaTime {
fmt.Printf("%5.1f %7.3f %7.3f\n", time, temp, analytic(time))
temp = eulerStep(fcr, time, temp, deltaTime)
}
fmt.Println()
}
}
| Private Sub ivp_euler(f As String, y As Double, step As Integer, end_t As Integer)
Dim t As Integer
Debug.Print " Step "; step; ": ",
Do While t <= end_t
If t Mod 10 = 0 Then Debug.Print Format(y, "0.000"),
y = y + step * Application.Run(f, y)
t = t + step
Loop
Debug.Print
End Sub
Sub analytic()
Debug.Print " Time: ",
For t = 0 To 100 Step 10
Debug.Print " "; t,
Next t
Debug.Print
Debug.Print "Analytic: ",
For t = 0 To 100 Step 10
Debug.Print Format(20 + 80 * Exp(-0.07 * t), "0.000"),
Next t
Debug.Print
End Sub
Private Function cooling(temp As Double) As Double
cooling = -0.07 * (temp - 20)
End Function
Public Sub euler_method()
Dim r_cooling As String
r_cooling = "cooling"
analytic
ivp_euler r_cooling, 100, 2, 100
ivp_euler r_cooling, 100, 5, 100
ivp_euler r_cooling, 100, 10, 100
End Sub
|
Write the same code in VB as shown below in Go. | package main
import (
"fmt"
"math"
)
func remarkable(n int) int {
return n + int(.5+math.Sqrt(float64(n)))
}
func main() {
fmt.Println(" n r(n)")
fmt.Println("--- ---")
for n := 1; n <= 22; n++ {
fmt.Printf("%3d %3d\n", n, remarkable(n))
}
const limit = 1e6
fmt.Println("\nChecking for squares for n <", limit)
next := 2
nextSq := 4
for n := 1; n < limit; n++ {
r := remarkable(n)
switch {
case r == nextSq:
panic(n)
case r > nextSq:
fmt.Println(nextSq, "didn't occur")
next++
nextSq = next * next
}
}
fmt.Println("No squares occur for n <", limit)
}
| Sub Main()
Dim i&, c&, j#, s$
Const N& = 1000000
s = "values for n in the range 1 to 22 : "
For i = 1 To 22
s = s & ns(i) & ", "
Next
For i = 1 To N
j = Sqr(ns(i))
If j = CInt(j) Then c = c + 1
Next
Debug.Print s
Debug.Print c & " squares less than " & N
End Sub
Private Function ns(l As Long) As Long
ns = l + Int(1 / 2 + Sqr(l))
End Function
|
Translate this program into VB but keep the logic exactly as in Go. | package main
import (
"fmt"
"strings"
)
func main() {
s := "ABCDEFGH"
n, m := 2, 3
fmt.Println("Index: ", "01234567")
fmt.Println("String:", s)
fmt.Printf("Start %d, length %d: %s\n", n, m, s[n : n+m])
fmt.Printf("Start %d, to end: %s\n", n, s[n:])
fmt.Printf("All but last: %s\n", s[:len(s)-1])
dx := strings.IndexByte(s, 'D')
fmt.Printf("Start 'D', length %d: %s\n", m, s[dx : dx+m])
sx := strings.Index(s, "DE")
fmt.Printf(`Start "DE", length %d: %s`+"\n", m, s[sx : sx+m])
}
| Public Sub substring()
sentence = "the last thing the man said was the"
n = 10: m = 5
Debug.Print Mid(sentence, n, 5)
Debug.Print Right(sentence, Len(sentence) - n + 1)
Debug.Print Left(sentence, Len(sentence) - 1)
k = InStr(1, sentence, "m")
Debug.Print Mid(sentence, k, 5)
k = InStr(1, sentence, "aid")
Debug.Print Mid(sentence, k, 5)
End Sub
|
Preserve the algorithm and functionality while converting the code from Go to VB. | package main
import (
"log"
"sort"
)
func main() {
log.Println(jortSort([]int{1, 2, 1, 11, 213, 2, 4}))
log.Println(jortSort([]int{0, 1, 0, 0, 0, 0}))
log.Println(jortSort([]int{1, 2, 4, 11, 22, 22}))
log.Println(jortSort([]int{0, 0, 0, 1, 2, 2}))
}
func jortSort(a []int) bool {
c := make([]int, len(a))
copy(c, a)
sort.Ints(a)
for k, v := range c {
if v == a[k] {
continue
} else {
return false
}
}
return true
}
| Function JortSort(s)
JortSort = True
arrPreSort = Split(s,",")
Set arrSorted = CreateObject("System.Collections.ArrayList")
For i = 0 To UBound(arrPreSort)
arrSorted.Add(arrPreSort(i))
Next
arrSorted.Sort()
For j = 0 To UBound(arrPreSort)
If arrPreSort(j) <> arrSorted(j) Then
JortSort = False
Exit For
End If
Next
End Function
WScript.StdOut.Write JortSort("1,2,3,4,5")
WScript.StdOut.WriteLine
WScript.StdOut.Write JortSort("1,2,3,5,4")
WScript.StdOut.WriteLine
WScript.StdOut.Write JortSort("a,b,c")
WScript.StdOut.WriteLine
WScript.StdOut.Write JortSort("a,c,b")
|
Produce a functionally identical VB code for the snippet given in Go. | func isLeap(year int) bool {
return year%400 == 0 || year%4 == 0 && year%100 != 0
}
| Public Function Leap_year(year As Integer) As Boolean
Leap_year = (Month(DateSerial(year, 2, 29)) = 2)
End Function
|
Maintain the same structure and functionality when rewriting this code in VB. | package main
import (
"fmt"
"math/big"
)
func main() {
var n, p int64
fmt.Printf("A sample of permutations from 1 to 12:\n")
for n = 1; n < 13; n++ {
p = n / 3
fmt.Printf("P(%d,%d) = %d\n", n, p, perm(big.NewInt(n), big.NewInt(p)))
}
fmt.Printf("\nA sample of combinations from 10 to 60:\n")
for n = 10; n < 61; n += 10 {
p = n / 3
fmt.Printf("C(%d,%d) = %d\n", n, p, comb(big.NewInt(n), big.NewInt(p)))
}
fmt.Printf("\nA sample of permutations from 5 to 15000:\n")
nArr := [...]int64{5, 50, 500, 1000, 5000, 15000}
for _, n = range nArr {
p = n / 3
fmt.Printf("P(%d,%d) = %d\n", n, p, perm(big.NewInt(n), big.NewInt(p)))
}
fmt.Printf("\nA sample of combinations from 100 to 1000:\n")
for n = 100; n < 1001; n += 100 {
p = n / 3
fmt.Printf("C(%d,%d) = %d\n", n, p, comb(big.NewInt(n), big.NewInt(p)))
}
}
func fact(n *big.Int) *big.Int {
if n.Sign() < 1 {
return big.NewInt(0)
}
r := big.NewInt(1)
i := big.NewInt(2)
for i.Cmp(n) < 1 {
r.Mul(r, i)
i.Add(i, big.NewInt(1))
}
return r
}
func perm(n, k *big.Int) *big.Int {
r := fact(n)
r.Div(r, fact(n.Sub(n, k)))
return r
}
func comb(n, r *big.Int) *big.Int {
if r.Cmp(n) == 1 {
return big.NewInt(0)
}
if r.Cmp(n) == 0 {
return big.NewInt(1)
}
c := fact(n)
den := fact(n.Sub(n, r))
den.Mul(den, fact(r))
c.Div(c, den)
return c
}
|
dim i,j
Wscript.StdOut.WriteLine "-- Long Integer - Permutations - from 1 to 12"
for i=1 to 12
for j=1 to i
Wscript.StdOut.Write "P(" & i & "," & j & ")=" & perm(i,j) & " "
next
Wscript.StdOut.WriteLine ""
next
Wscript.StdOut.WriteLine "-- Float integer - Combinations from 10 to 60"
for i=10 to 60 step 10
for j=1 to i step i\5
Wscript.StdOut.Write "C(" & i & "," & j & ")=" & comb(i,j) & " "
next
Wscript.StdOut.WriteLine ""
next
Wscript.StdOut.WriteLine "-- Float integer - Permutations from 5000 to 15000"
for i=5000 to 15000 step 5000
for j=10 to 70 step 20
Wscript.StdOut.Write "C(" & i & "," & j & ")=" & perm(i,j) & " "
next
Wscript.StdOut.WriteLine ""
next
Wscript.StdOut.WriteLine "-- Float integer - Combinations from 200 to 1000"
for i=200 to 1000 step 200
for j=20 to 100 step 20
Wscript.StdOut.Write "P(" & i & "," & j & ")=" & comb(i,j) & " "
next
Wscript.StdOut.WriteLine ""
next
function perm(x,y)
dim i,z
z=1
for i=x-y+1 to x
z=z*i
next
perm=z
end function
function fact(x)
dim i,z
z=1
for i=2 to x
z=z*i
next
fact=z
end function
function comb(byval x,byval y)
if y>x then
comb=0
elseif x=y then
comb=1
else
if x-y<y then y=x-y
comb=perm(x,y)/fact(y)
end if
end function
|
Change the programming language of this snippet from Go to VB without modifying what it does. | package main
import (
"fmt"
"sort"
"strconv"
)
func lexOrder(n int) []int {
first, last, k := 1, n, n
if n < 1 {
first, last, k = n, 1, 2-n
}
strs := make([]string, k)
for i := first; i <= last; i++ {
strs[i-first] = strconv.Itoa(i)
}
sort.Strings(strs)
ints := make([]int, k)
for i := 0; i < k; i++ {
ints[i], _ = strconv.Atoi(strs[i])
}
return ints
}
func main() {
fmt.Println("In lexicographical order:\n")
for _, n := range []int{0, 5, 13, 21, -22} {
fmt.Printf("%3d: %v\n", n, lexOrder(n))
}
}
| Public Function sortlexicographically(N As Integer)
Dim arrList As Object
Set arrList = CreateObject("System.Collections.ArrayList")
For i = 1 To N
arrList.Add CStr(i)
Next i
arrList.Sort
Dim item As Variant
For Each item In arrList
Debug.Print item & ", ";
Next
End Function
Public Sub main()
Call sortlexicographically(13)
End Sub
|
Transform the following Go implementation into VB, maintaining the same output and logic. | package main
import "fmt"
func main() {
for _, n := range []int64{12, 1048576, 9e18, -2, 0} {
fmt.Println(say(n))
}
}
var small = [...]string{"zero", "one", "two", "three", "four", "five", "six",
"seven", "eight", "nine", "ten", "eleven", "twelve", "thirteen",
"fourteen", "fifteen", "sixteen", "seventeen", "eighteen", "nineteen"}
var tens = [...]string{"", "", "twenty", "thirty", "forty",
"fifty", "sixty", "seventy", "eighty", "ninety"}
var illions = [...]string{"", " thousand", " million", " billion",
" trillion", " quadrillion", " quintillion"}
func say(n int64) string {
var t string
if n < 0 {
t = "negative "
n = -n
}
switch {
case n < 20:
t += small[n]
case n < 100:
t += tens[n/10]
s := n % 10
if s > 0 {
t += "-" + small[s]
}
case n < 1000:
t += small[n/100] + " hundred"
s := n % 100
if s > 0 {
t += " " + say(s)
}
default:
sx := ""
for i := 0; n > 0; i++ {
p := n % 1000
n /= 1000
if p > 0 {
ix := say(p) + illions[i]
if sx != "" {
ix += " " + sx
}
sx = ix
}
}
t += sx
}
return t
}
| Public twenties As Variant
Public decades As Variant
Public orders As Variant
Private Sub init()
twenties = [{"zero","one","two","three","four","five","six","seven","eight","nine","ten", "eleven","twelve","thirteen","fourteen","fifteen","sixteen","seventeen","eighteen","nineteen"}]
decades = [{"twenty","thirty","forty","fifty","sixty","seventy","eighty","ninety"}]
orders = [{1E15,"quadrillion"; 1E12,"trillion"; 1E9,"billion"; 1E6,"million"; 1E3,"thousand"}]
End Sub
Private Function Twenty(N As Variant)
Twenty = twenties(N Mod 20 + 1)
End Function
Private Function Decade(N As Variant)
Decade = decades(N Mod 10 - 1)
End Function
Private Function Hundred(N As Variant)
If N < 20 Then
Hundred = Twenty(N)
Exit Function
Else
If N Mod 10 = 0 Then
Hundred = Decade((N \ 10) Mod 10)
Exit Function
End If
End If
Hundred = Decade(N \ 10) & "-" & Twenty(N Mod 10)
End Function
Private Function Thousand(N As Variant, withand As String)
If N < 100 Then
Thousand = withand & Hundred(N)
Exit Function
Else
If N Mod 100 = 0 Then
Thousand = withand & Twenty(WorksheetFunction.Floor_Precise(N / 100)) & " hundred"
Exit Function
End If
End If
Thousand = Twenty(N \ 100) & " hundred and " & Hundred(N Mod 100)
End Function
Private Function Triplet(N As Variant)
Dim Order, High As Variant, Low As Variant
Dim Name As String, res As String
For i = 1 To UBound(orders)
Order = orders(i, 1)
Name = orders(i, 2)
High = WorksheetFunction.Floor_Precise(N / Order)
Low = N - High * Order
If High <> 0 Then
res = res & Thousand(High, "") & " " & Name
End If
N = Low
If Low = 0 Then Exit For
If Len(res) And High <> 0 Then
res = res & ", "
End If
Next i
If N <> 0 Or res = "" Then
res = res & Thousand(WorksheetFunction.Floor_Precise(N), IIf(res = "", "", "and "))
N = N - Int(N)
If N > 0.000001 Then
res = res & " point"
For i = 1 To 10
n_ = WorksheetFunction.Floor_Precise(N * 10.0000001)
res = res & " " & twenties(n_ + 1)
N = N * 10 - n_
If Abs(N) < 0.000001 Then Exit For
Next i
End If
End If
Triplet = res
End Function
Private Function spell(N As Variant)
Dim res As String
If N < 0 Then
res = "minus "
N = -N
End If
res = res & Triplet(N)
spell = res
End Function
Private Function smartp(N As Variant)
Dim res As String
If N = WorksheetFunction.Floor_Precise(N) Then
smartp = CStr(N)
Exit Function
End If
res = CStr(N)
If InStr(1, res, ".") Then
res = Left(res, InStr(1, res, "."))
End If
smartp = res
End Function
Sub Main()
Dim si As Variant
init
Samples1 = [{99, 300, 310, 417, 1501, 12609, 200000000000100, 999999999999999, -123456787654321,102003000400005,1020030004,102003,102,1,0,-1,-99, -1501,1234,12.34}]
Samples2 = [{10000001.2,1E-3,-2.7182818, 201021002001,-20102100200,2010210020,-201021002,20102100,-2010210, 201021,-20102,2010,-201,20,-2}]
For i = 1 To UBound(Samples1)
si = Samples1(i)
Debug.Print Format(smartp(si), "@@@@@@@@@@@@@@@@"); " "; spell(si)
Next i
For i = 1 To UBound(Samples2)
si = Samples2(i)
Debug.Print Format(smartp(si), "@@@@@@@@@@@@@@@@"); " "; spell(si)
Next i
End Sub
|
Ensure the translated VB code behaves exactly like the original Go snippet. | package main
import "fmt"
var a = []int{170, 45, 75, -90, -802, 24, 2, 66}
func main() {
fmt.Println("before:", a)
for inc := len(a) / 2; inc > 0; inc = (inc + 1) * 5 / 11 {
for i := inc; i < len(a); i++ {
j, temp := i, a[i]
for ; j >= inc && a[j-inc] > temp; j -= inc {
a[j] = a[j-inc]
}
a[j] = temp
}
}
fmt.Println("after: ", a)
}
| Sub arrShellSort(ByVal arrData As Variant)
Dim lngHold, lngGap As Long
Dim lngCount, lngMin, lngMax As Long
Dim varItem As Variant
lngMin = LBound(arrData)
lngMax = UBound(arrData)
lngGap = lngMin
Do While (lngGap < lngMax)
lngGap = 3 * lngGap + 1
Loop
Do While (lngGap > 1)
lngGap = lngGap \ 3
For lngCount = lngGap + lngMin To lngMax
varItem = arrData(lngCount)
lngHold = lngCount
Do While ((arrData(lngHold - lngGap) > varItem))
arrData(lngHold) = arrData(lngHold - lngGap)
lngHold = lngHold - lngGap
If (lngHold < lngMin + lngGap) Then Exit Do
Loop
arrData(lngHold) = varItem
Next
Loop
arrShellSort = arrData
End Sub
|
Rewrite this program in VB while keeping its functionality equivalent to the Go version. | type dlNode struct {
int
next, prev *dlNode
}
type dlList struct {
members map[*dlNode]int
head, tail **dlNode
}
| Public Class DoubleLinkList(Of T)
Private m_Head As Node(Of T)
Private m_Tail As Node(Of T)
Public Sub AddHead(ByVal value As T)
Dim node As New Node(Of T)(Me, value)
If m_Head Is Nothing Then
m_Head = Node
m_Tail = m_Head
Else
node.Next = m_Head
m_Head = node
End If
End Sub
Public Sub AddTail(ByVal value As T)
Dim node As New Node(Of T)(Me, value)
If m_Tail Is Nothing Then
m_Head = node
m_Tail = m_Head
Else
node.Previous = m_Tail
m_Tail = node
End If
End Sub
Public ReadOnly Property Head() As Node(Of T)
Get
Return m_Head
End Get
End Property
Public ReadOnly Property Tail() As Node(Of T)
Get
Return m_Tail
End Get
End Property
Public Sub RemoveTail()
If m_Tail Is Nothing Then Return
If m_Tail.Previous Is Nothing Then
m_Head = Nothing
m_Tail = Nothing
Else
m_Tail = m_Tail.Previous
m_Tail.Next = Nothing
End If
End Sub
Public Sub RemoveHead()
If m_Head Is Nothing Then Return
If m_Head.Next Is Nothing Then
m_Head = Nothing
m_Tail = Nothing
Else
m_Head = m_Head.Next
m_Head.Previous = Nothing
End If
End Sub
End Class
Public Class Node(Of T)
Private ReadOnly m_Value As T
Private m_Next As Node(Of T)
Private m_Previous As Node(Of T)
Private ReadOnly m_Parent As DoubleLinkList(Of T)
Public Sub New(ByVal parent As DoubleLinkList(Of T), ByVal value As T)
m_Parent = parent
m_Value = value
End Sub
Public Property [Next]() As Node(Of T)
Get
Return m_Next
End Get
Friend Set(ByVal value As Node(Of T))
m_Next = value
End Set
End Property
Public Property Previous() As Node(Of T)
Get
Return m_Previous
End Get
Friend Set(ByVal value As Node(Of T))
m_Previous = value
End Set
End Property
Public ReadOnly Property Value() As T
Get
Return m_Value
End Get
End Property
Public Sub InsertAfter(ByVal value As T)
If m_Next Is Nothing Then
m_Parent.AddTail(value)
ElseIf m_Previous Is Nothing Then
m_Parent.AddHead(value)
Else
Dim node As New Node(Of T)(m_Parent, value)
node.Previous = Me
node.Next = Me.Next
Me.Next.Previous = node
Me.Next = node
End If
End Sub
Public Sub Remove()
If m_Next Is Nothing Then
m_Parent.RemoveTail()
ElseIf m_Previous Is Nothing Then
m_Parent.RemoveHead()
Else
m_Previous.Next = Me.Next
m_Next.Previous = Me.Previous
End If
End Sub
End Class
|
Convert the following code from Go to VB, ensuring the logic remains intact. | package main
import (
"fmt"
"io/ioutil"
"sort"
"unicode"
)
const file = "unixdict.txt"
func main() {
bs, err := ioutil.ReadFile(file)
if err != nil {
fmt.Println(err)
return
}
m := make(map[rune]int)
for _, r := range string(bs) {
m[r]++
}
lfs := make(lfList, 0, len(m))
for l, f := range m {
lfs = append(lfs, &letterFreq{l, f})
}
sort.Sort(lfs)
fmt.Println("file:", file)
fmt.Println("letter frequency")
for _, lf := range lfs {
if unicode.IsGraphic(lf.rune) {
fmt.Printf(" %c %7d\n", lf.rune, lf.freq)
} else {
fmt.Printf("%U %7d\n", lf.rune, lf.freq)
}
}
}
type letterFreq struct {
rune
freq int
}
type lfList []*letterFreq
func (lfs lfList) Len() int { return len(lfs) }
func (lfs lfList) Less(i, j int) bool {
switch fd := lfs[i].freq - lfs[j].freq; {
case fd < 0:
return false
case fd > 0:
return true
}
return lfs[i].rune < lfs[j].rune
}
func (lfs lfList) Swap(i, j int) {
lfs[i], lfs[j] = lfs[j], lfs[i]
}
|
TYPE regChar
Character AS STRING * 3
Count AS LONG
END TYPE
DIM iChar AS INTEGER
DIM iCL AS INTEGER
DIM iCountChars AS INTEGER
DIM iFile AS INTEGER
DIM i AS INTEGER
DIM lMUC AS LONG
DIM iMUI AS INTEGER
DIM lLUC AS LONG
DIM iLUI AS INTEGER
DIM iMaxIdx AS INTEGER
DIM iP AS INTEGER
DIM iPause AS INTEGER
DIM iPMI AS INTEGER
DIM iPrint AS INTEGER
DIM lHowMany AS LONG
DIM lTotChars AS LONG
DIM sTime AS SINGLE
DIM strFile AS STRING
DIM strTxt AS STRING
DIM strDate AS STRING
DIM strTime AS STRING
DIM strKey AS STRING
CONST LngReg = 256
CONST Letters = 1
CONST FALSE = 0
CONST TRUE = NOT FALSE
strDate = DATE$
strTime = TIME$
iFile = FREEFILE
DO
CLS
PRINT "This program counts letters or characters in a text file."
PRINT
INPUT "File to open: ", strFile
OPEN strFile FOR BINARY AS #iFile
IF LOF(iFile) > 0 THEN
PRINT "Count: 1) Letters 2) Characters (1 or 2)";
DO
strKey = INKEY$
LOOP UNTIL strKey = "1" OR strKey = "2"
PRINT ". Option selected: "; strKey
iCL = VAL(strKey)
sTime = TIMER
iP = POS(0)
lHowMany = LOF(iFile)
strTxt = SPACE$(LngReg)
IF iCL = Letters THEN
iMaxIdx = 26
ELSE
iMaxIdx = 255
END IF
IF iMaxIdx <> iPMI THEN
iPMI = iMaxIdx
REDIM rChar(0 TO iMaxIdx) AS regChar
FOR i = 0 TO iMaxIdx
IF iCL = Letters THEN
strTxt = CHR$(i + 65)
IF i = 26 THEN strTxt = CHR$(165)
ELSE
SELECT CASE i
CASE 0: strTxt = "nul"
CASE 7: strTxt = "bel"
CASE 9: strTxt = "tab"
CASE 10: strTxt = "lf"
CASE 11: strTxt = "vt"
CASE 12: strTxt = "ff"
CASE 13: strTxt = "cr"
CASE 28: strTxt = "fs"
CASE 29: strTxt = "gs"
CASE 30: strTxt = "rs"
CASE 31: strTxt = "us"
CASE 32: strTxt = "sp"
CASE ELSE: strTxt = CHR$(i)
END SELECT
END IF
rChar(i).Character = strTxt
NEXT i
ELSE
FOR i = 0 TO iMaxIdx
rChar(i).Count = 0
NEXT i
END IF
PRINT "Looking for ";
IF iCL = Letters THEN PRINT "letters."; ELSE PRINT "characters.";
PRINT " File is"; STR$(lHowMany); " in size. Working"; : COLOR 23: PRINT "..."; : COLOR (7)
DO WHILE LOC(iFile) < LOF(iFile)
IF LOC(iFile) + LngReg > LOF(iFile) THEN
strTxt = SPACE$(LOF(iFile) - LOC(iFile))
END IF
GET #iFile, , strTxt
FOR i = 1 TO LEN(strTxt)
IF iCL = Letters THEN
iChar = ASC(UCASE$(MID$(strTxt, i, 1)))
SELECT CASE iChar
CASE 164: iChar = 165
CASE 160: iChar = 65
CASE 130, 144: iChar = 69
CASE 161: iChar = 73
CASE 162: iChar = 79
CASE 163, 129: iChar = 85
END SELECT
iChar = iChar - 65
IF iChar >= 0 AND iChar <= 25 THEN
rChar(iChar).Count = rChar(iChar).Count + 1
ELSEIF iChar = 100 THEN
rChar(iMaxIdx).Count = rChar(iMaxIdx).Count + 1
END IF
ELSE
iChar = ASC(MID$(strTxt, i, 1))
rChar(iChar).Count = rChar(iChar).Count + 1
END IF
NEXT i
LOOP
CLOSE #iFile
lMUC = 0
iMUI = 0
lLUC = 2147483647
iLUI = 0
iPrint = FALSE
lTotChars = 0
iCountChars = 0
iPause = FALSE
CLS
IF iCL = Letters THEN PRINT "Letters found: "; ELSE PRINT "Characters found: ";
FOR i = 0 TO iMaxIdx
IF lMUC < rChar(i).Count THEN
lMUC = rChar(i).Count
iMUI = i
END IF
IF rChar(i).Count > 0 THEN
strTxt = ""
IF iPrint THEN strTxt = ", " ELSE iPrint = TRUE
strTxt = strTxt + LTRIM$(RTRIM$(rChar(i).Character))
strTxt = strTxt + "=" + LTRIM$(STR$(rChar(i).Count))
iP = POS(0)
IF iP + LEN(strTxt) + 1 >= 80 AND iPrint THEN
PRINT ","
IF CSRLIN >= 23 AND NOT iPause THEN
iPause = TRUE
PRINT "Press a key to continue..."
DO
strKey = INKEY$
LOOP UNTIL strKey <> ""
END IF
strTxt = MID$(strTxt, 3)
END IF
PRINT strTxt;
lTotChars = lTotChars + rChar(i).Count
iCountChars = iCountChars + 1
IF lLUC > rChar(i).Count THEN
lLUC = rChar(i).Count
iLUI = i
END IF
END IF
NEXT i
PRINT "."
PRINT
PRINT "File analyzed....................: "; strFile
PRINT "Looked for.......................: "; : IF iCL = Letters THEN PRINT "Letters" ELSE PRINT "Characters"
PRINT "Total characters in file.........:"; lHowMany
PRINT "Total characters counted.........:"; lTotChars
IF iCL = Letters THEN PRINT "Characters discarded on count....:"; lHowMany - lTotChars
PRINT "Distinct characters found in file:"; iCountChars; "of"; iMaxIdx + 1
PRINT "Most used character was..........: ";
iPrint = FALSE
FOR i = 0 TO iMaxIdx
IF rChar(i).Count = lMUC THEN
IF iPrint THEN PRINT ", "; ELSE iPrint = TRUE
PRINT RTRIM$(LTRIM$(rChar(i).Character));
END IF
NEXT i
PRINT " ("; LTRIM$(STR$(rChar(iMUI).Count)); " times)"
PRINT "Least used character was.........: ";
iPrint = FALSE
FOR i = 0 TO iMaxIdx
IF rChar(i).Count = lLUC THEN
IF iPrint THEN PRINT ", "; ELSE iPrint = TRUE
PRINT RTRIM$(LTRIM$(rChar(i).Character));
END IF
NEXT i
PRINT " ("; LTRIM$(STR$(rChar(iLUI).Count)); " times)"
PRINT "Time spent in the process........:"; TIMER - sTime; "seconds"
ELSE
CLOSE #iFile
KILL strFile
PRINT
PRINT "File does not exist."
END IF
PRINT
PRINT "Again? (Y/n)"
DO
strTxt = UCASE$(INKEY$)
LOOP UNTIL strTxt = "N" OR strTxt = "Y" OR strTxt = CHR$(13) OR strTxt = CHR$(27)
LOOP UNTIL strTxt = "N" OR strTxt = CHR$(27)
CLS
PRINT "End of execution."
PRINT "Start time: "; strDate; " "; strTime; ", end time: "; DATE$; " "; TIME$; "."
END
|
Ensure the translated VB code behaves exactly like the original Go snippet. | package main
import "fmt"
import "strconv"
func main() {
i, _ := strconv.Atoi("1234")
fmt.Println(strconv.Itoa(i + 1))
}
| Dim s As String = "123"
s = CStr(CInt("123") + 1)
s = (CInt("123") + 1).ToString
|
Generate a VB translation of this Go snippet without changing its computational steps. | package main
import (
"fmt"
"strings"
)
func stripchars(str, chr string) string {
return strings.Map(func(r rune) rune {
if strings.IndexRune(chr, r) < 0 {
return r
}
return -1
}, str)
}
func main() {
fmt.Println(stripchars("She was a soul stripper. She took my heart!",
"aei"))
}
| Function StripChars(stString As String, stStripChars As String, Optional bSpace As Boolean)
Dim i As Integer, stReplace As String
If bSpace = True Then
stReplace = " "
Else
stReplace = ""
End If
For i = 1 To Len(stStripChars)
stString = Replace(stString, Mid(stStripChars, i, 1), stReplace)
Next i
StripChars = stString
End Function
|
Convert the following code from Go to VB, ensuring the logic remains intact. | package main
import (
"fmt"
"math"
)
func mean(v []float64) (m float64, ok bool) {
if len(v) == 0 {
return
}
var parts []float64
for _, x := range v {
var i int
for _, p := range parts {
sum := p + x
var err float64
switch ax, ap := math.Abs(x), math.Abs(p); {
case ax < ap:
err = x - (sum - p)
case ap < ax:
err = p - (sum - x)
}
if err != 0 {
parts[i] = err
i++
}
x = sum
}
parts = append(parts[:i], x)
}
var sum float64
for _, x := range parts {
sum += x
}
return sum / float64(len(v)), true
}
func main() {
for _, v := range [][]float64{
[]float64{},
[]float64{math.Inf(1), math.Inf(1)},
[]float64{math.Inf(1), math.Inf(-1)},
[]float64{3, 1, 4, 1, 5, 9},
[]float64{1e20, 3, 1, 4, 1, 5, 9, -1e20},
[]float64{10, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 0, 0, 0, .11},
[]float64{10, 20, 30, 40, 50, -100, 4.7, -11e2},
} {
fmt.Println("Vector:", v)
if m, ok := mean(v); ok {
fmt.Printf("Mean of %d numbers is %g\n\n", len(v), m)
} else {
fmt.Println("Mean undefined\n")
}
}
}
| Private Function mean(v() As Double, ByVal leng As Integer) As Variant
Dim sum As Double, i As Integer
sum = 0: i = 0
For i = 0 To leng - 1
sum = sum + vv
Next i
If leng = 0 Then
mean = CVErr(xlErrDiv0)
Else
mean = sum / leng
End If
End Function
Public Sub main()
Dim v(4) As Double
Dim i As Integer, leng As Integer
v(0) = 1#
v(1) = 2#
v(2) = 2.178
v(3) = 3#
v(4) = 3.142
For leng = 5 To 0 Step -1
Debug.Print "mean[";
For i = 0 To leng - 1
Debug.Print IIf(i, "; " & v(i), "" & v(i));
Next i
Debug.Print "] = "; mean(v, leng)
Next leng
End Sub
|
Produce a language-to-language conversion: from Go to VB, same semantics. | package main
import (
"io"
"os"
"strconv"
"strings"
"text/tabwriter"
)
func readTable(table string) ([]string, []int) {
fields := strings.Fields(table)
var commands []string
var minLens []int
for i, max := 0, len(fields); i < max; {
cmd := fields[i]
cmdLen := len(cmd)
i++
if i < max {
num, err := strconv.Atoi(fields[i])
if err == nil && 1 <= num && num < cmdLen {
cmdLen = num
i++
}
}
commands = append(commands, cmd)
minLens = append(minLens, cmdLen)
}
return commands, minLens
}
func validateCommands(commands []string, minLens []int, words []string) []string {
var results []string
for _, word := range words {
matchFound := false
wlen := len(word)
for i, command := range commands {
if minLens[i] == 0 || wlen < minLens[i] || wlen > len(command) {
continue
}
c := strings.ToUpper(command)
w := strings.ToUpper(word)
if strings.HasPrefix(c, w) {
results = append(results, c)
matchFound = true
break
}
}
if !matchFound {
results = append(results, "*error*")
}
}
return results
}
func printResults(words []string, results []string) {
wr := tabwriter.NewWriter(os.Stdout, 0, 1, 1, ' ', 0)
io.WriteString(wr, "user words:")
for _, word := range words {
io.WriteString(wr, "\t"+word)
}
io.WriteString(wr, "\n")
io.WriteString(wr, "full words:\t"+strings.Join(results, "\t")+"\n")
wr.Flush()
}
func main() {
const table = "" +
"add 1 alter 3 backup 2 bottom 1 Cappend 2 change 1 Schange Cinsert 2 Clast 3 " +
"compress 4 copy 2 count 3 Coverlay 3 cursor 3 delete 3 Cdelete 2 down 1 duplicate " +
"3 xEdit 1 expand 3 extract 3 find 1 Nfind 2 Nfindup 6 NfUP 3 Cfind 2 findUP 3 fUP 2 " +
"forward 2 get help 1 hexType 4 input 1 powerInput 3 join 1 split 2 spltJOIN load " +
"locate 1 Clocate 2 lowerCase 3 upperCase 3 Lprefix 2 macro merge 2 modify 3 move 2 " +
"msg next 1 overlay 1 parse preserve 4 purge 3 put putD query 1 quit read recover 3 " +
"refresh renum 3 repeat 3 replace 1 Creplace 2 reset 3 restore 4 rgtLEFT right 2 left " +
"2 save set shift 2 si sort sos stack 3 status 4 top transfer 3 type 1 up 1 "
const sentence = "riG rePEAT copies put mo rest types fup. 6 poweRin"
commands, minLens := readTable(table)
words := strings.Fields(sentence)
results := validateCommands(commands, minLens, words)
printResults(words, results)
}
| Private Function ValidateUserWords(userstring As String) As String
Dim s As String
Dim user_words() As String
Dim command_table As Scripting.Dictionary
Set command_table = New Scripting.Dictionary
Dim abbreviations As Scripting.Dictionary
Set abbreviations = New Scripting.Dictionary
abbreviations.CompareMode = TextCompare
Dim commandtable() As String
Dim commands As String
s = s & "add 1 alter 3 backup 2 bottom 1 Cappend 2 change 1 Schange Cinsert 2 Clast 3 "
s = s & "compress 4 copy 2 count 3 Coverlay 3 cursor 3 delete 3 Cdelete 2 down 1 duplicate "
s = s & "3 xEdit 1 expand 3 extract 3 find 1 Nfind 2 Nfindup 6 NfUP 3 Cfind 2 findUP 3 fUP 2 "
s = s & "forward 2 get help 1 hexType 4 input 1 powerInput 3 join 1 split 2 spltJOIN load "
s = s & "locate 1 Clocate 2 lowerCase 3 upperCase 3 Lprefix 2 macro merge 2 modify 3 move 2 "
s = s & "msg next 1 overlay 1 parse preserve 4 purge 3 put putD query 1 quit read recover 3 "
s = s & "refresh renum 3 repeat 3 replace 1 Creplace 2 reset 3 restore 4 rgtLEFT right 2 left "
s = s & "2 save set shift 2 si sort sos stack 3 status 4 top transfer 3 type 1 up 1 "
commandtable = Split(s, " ")
Dim i As Integer, word As Variant, number As Integer
For i = LBound(commandtable) To UBound(commandtable)
word = commandtable(i)
If Len(word) > 0 Then
i = i + 1
Do While Len(commandtable(i)) = 0: i = i + 1: Loop
number = Val(commandtable(i))
If number > 0 Then
command_table.Add Key:=word, Item:=number
Else
command_table.Add Key:=word, Item:=Len(word)
i = i - 1
End If
End If
Next i
For Each word In command_table
For i = command_table(word) To Len(word)
On Error Resume Next
abbreviations.Add Key:=Left(word, i), Item:=UCase(word)
Next i
Next word
user_words() = Split(userstring, " ")
For Each word In user_words
If Len(word) > 0 Then
If abbreviations.exists(word) Then
commands = commands & abbreviations(word) & " "
Else
commands = commands & "*error* "
End If
End If
Next word
ValidateUserWords = commands
End Function
Public Sub program()
Dim guserstring As String
guserstring = "riG rePEAT copies put mo rest types fup. 6 poweRin"
Debug.Print "user words:", guserstring
Debug.Print "full words:", ValidateUserWords(guserstring)
End Sub
|
Maintain the same structure and functionality when rewriting this code in VB. | package main
import (
"io"
"os"
"strconv"
"strings"
"text/tabwriter"
)
func readTable(table string) ([]string, []int) {
fields := strings.Fields(table)
var commands []string
var minLens []int
for i, max := 0, len(fields); i < max; {
cmd := fields[i]
cmdLen := len(cmd)
i++
if i < max {
num, err := strconv.Atoi(fields[i])
if err == nil && 1 <= num && num < cmdLen {
cmdLen = num
i++
}
}
commands = append(commands, cmd)
minLens = append(minLens, cmdLen)
}
return commands, minLens
}
func validateCommands(commands []string, minLens []int, words []string) []string {
var results []string
for _, word := range words {
matchFound := false
wlen := len(word)
for i, command := range commands {
if minLens[i] == 0 || wlen < minLens[i] || wlen > len(command) {
continue
}
c := strings.ToUpper(command)
w := strings.ToUpper(word)
if strings.HasPrefix(c, w) {
results = append(results, c)
matchFound = true
break
}
}
if !matchFound {
results = append(results, "*error*")
}
}
return results
}
func printResults(words []string, results []string) {
wr := tabwriter.NewWriter(os.Stdout, 0, 1, 1, ' ', 0)
io.WriteString(wr, "user words:")
for _, word := range words {
io.WriteString(wr, "\t"+word)
}
io.WriteString(wr, "\n")
io.WriteString(wr, "full words:\t"+strings.Join(results, "\t")+"\n")
wr.Flush()
}
func main() {
const table = "" +
"add 1 alter 3 backup 2 bottom 1 Cappend 2 change 1 Schange Cinsert 2 Clast 3 " +
"compress 4 copy 2 count 3 Coverlay 3 cursor 3 delete 3 Cdelete 2 down 1 duplicate " +
"3 xEdit 1 expand 3 extract 3 find 1 Nfind 2 Nfindup 6 NfUP 3 Cfind 2 findUP 3 fUP 2 " +
"forward 2 get help 1 hexType 4 input 1 powerInput 3 join 1 split 2 spltJOIN load " +
"locate 1 Clocate 2 lowerCase 3 upperCase 3 Lprefix 2 macro merge 2 modify 3 move 2 " +
"msg next 1 overlay 1 parse preserve 4 purge 3 put putD query 1 quit read recover 3 " +
"refresh renum 3 repeat 3 replace 1 Creplace 2 reset 3 restore 4 rgtLEFT right 2 left " +
"2 save set shift 2 si sort sos stack 3 status 4 top transfer 3 type 1 up 1 "
const sentence = "riG rePEAT copies put mo rest types fup. 6 poweRin"
commands, minLens := readTable(table)
words := strings.Fields(sentence)
results := validateCommands(commands, minLens, words)
printResults(words, results)
}
| Private Function ValidateUserWords(userstring As String) As String
Dim s As String
Dim user_words() As String
Dim command_table As Scripting.Dictionary
Set command_table = New Scripting.Dictionary
Dim abbreviations As Scripting.Dictionary
Set abbreviations = New Scripting.Dictionary
abbreviations.CompareMode = TextCompare
Dim commandtable() As String
Dim commands As String
s = s & "add 1 alter 3 backup 2 bottom 1 Cappend 2 change 1 Schange Cinsert 2 Clast 3 "
s = s & "compress 4 copy 2 count 3 Coverlay 3 cursor 3 delete 3 Cdelete 2 down 1 duplicate "
s = s & "3 xEdit 1 expand 3 extract 3 find 1 Nfind 2 Nfindup 6 NfUP 3 Cfind 2 findUP 3 fUP 2 "
s = s & "forward 2 get help 1 hexType 4 input 1 powerInput 3 join 1 split 2 spltJOIN load "
s = s & "locate 1 Clocate 2 lowerCase 3 upperCase 3 Lprefix 2 macro merge 2 modify 3 move 2 "
s = s & "msg next 1 overlay 1 parse preserve 4 purge 3 put putD query 1 quit read recover 3 "
s = s & "refresh renum 3 repeat 3 replace 1 Creplace 2 reset 3 restore 4 rgtLEFT right 2 left "
s = s & "2 save set shift 2 si sort sos stack 3 status 4 top transfer 3 type 1 up 1 "
commandtable = Split(s, " ")
Dim i As Integer, word As Variant, number As Integer
For i = LBound(commandtable) To UBound(commandtable)
word = commandtable(i)
If Len(word) > 0 Then
i = i + 1
Do While Len(commandtable(i)) = 0: i = i + 1: Loop
number = Val(commandtable(i))
If number > 0 Then
command_table.Add Key:=word, Item:=number
Else
command_table.Add Key:=word, Item:=Len(word)
i = i - 1
End If
End If
Next i
For Each word In command_table
For i = command_table(word) To Len(word)
On Error Resume Next
abbreviations.Add Key:=Left(word, i), Item:=UCase(word)
Next i
Next word
user_words() = Split(userstring, " ")
For Each word In user_words
If Len(word) > 0 Then
If abbreviations.exists(word) Then
commands = commands & abbreviations(word) & " "
Else
commands = commands & "*error* "
End If
End If
Next word
ValidateUserWords = commands
End Function
Public Sub program()
Dim guserstring As String
guserstring = "riG rePEAT copies put mo rest types fup. 6 poweRin"
Debug.Print "user words:", guserstring
Debug.Print "full words:", ValidateUserWords(guserstring)
End Sub
|
Port the following code from Go to VB with equivalent syntax and logic. | package main
import (
"errors"
"fmt"
)
func TokenizeString(s string, sep, escape rune) (tokens []string, err error) {
var runes []rune
inEscape := false
for _, r := range s {
switch {
case inEscape:
inEscape = false
fallthrough
default:
runes = append(runes, r)
case r == escape:
inEscape = true
case r == sep:
tokens = append(tokens, string(runes))
runes = runes[:0]
}
}
tokens = append(tokens, string(runes))
if inEscape {
err = errors.New("invalid terminal escape")
}
return tokens, err
}
func main() {
const sample = "one^|uno||three^^^^|four^^^|^cuatro|"
const separator = '|'
const escape = '^'
fmt.Printf("Input: %q\n", sample)
tokens, err := TokenizeString(sample, separator, escape)
if err != nil {
fmt.Println("error:", err)
} else {
fmt.Printf("Tokens: %q\n", tokens)
}
}
| Private Function tokenize(s As String, sep As String, esc As String) As Collection
Dim ret As New Collection
Dim this As String
Dim skip As Boolean
If Len(s) <> 0 Then
For i = 1 To Len(s)
si = Mid(s, i, 1)
If skip Then
this = this & si
skip = False
Else
If si = esc Then
skip = True
Else
If si = sep Then
ret.Add this
this = ""
Else
this = this & si
End If
End If
End If
Next i
ret.Add this
End If
Set tokenize = ret
End Function
Public Sub main()
Dim out As Collection
Set out = tokenize("one^|uno||three^^^^|four^^^|^cuatro|", "|", "^")
Dim outstring() As String
ReDim outstring(out.Count - 1)
For i = 0 To out.Count - 1
outstring(i) = out(i + 1)
Next i
Debug.Print Join(outstring, ", ")
End Sub
|
Rewrite this program in VB while keeping its functionality equivalent to the Go version. | package main
import (
"errors"
"fmt"
)
func TokenizeString(s string, sep, escape rune) (tokens []string, err error) {
var runes []rune
inEscape := false
for _, r := range s {
switch {
case inEscape:
inEscape = false
fallthrough
default:
runes = append(runes, r)
case r == escape:
inEscape = true
case r == sep:
tokens = append(tokens, string(runes))
runes = runes[:0]
}
}
tokens = append(tokens, string(runes))
if inEscape {
err = errors.New("invalid terminal escape")
}
return tokens, err
}
func main() {
const sample = "one^|uno||three^^^^|four^^^|^cuatro|"
const separator = '|'
const escape = '^'
fmt.Printf("Input: %q\n", sample)
tokens, err := TokenizeString(sample, separator, escape)
if err != nil {
fmt.Println("error:", err)
} else {
fmt.Printf("Tokens: %q\n", tokens)
}
}
| Private Function tokenize(s As String, sep As String, esc As String) As Collection
Dim ret As New Collection
Dim this As String
Dim skip As Boolean
If Len(s) <> 0 Then
For i = 1 To Len(s)
si = Mid(s, i, 1)
If skip Then
this = this & si
skip = False
Else
If si = esc Then
skip = True
Else
If si = sep Then
ret.Add this
this = ""
Else
this = this & si
End If
End If
End If
Next i
ret.Add this
End If
Set tokenize = ret
End Function
Public Sub main()
Dim out As Collection
Set out = tokenize("one^|uno||three^^^^|four^^^|^cuatro|", "|", "^")
Dim outstring() As String
ReDim outstring(out.Count - 1)
For i = 0 To out.Count - 1
outstring(i) = out(i + 1)
Next i
Debug.Print Join(outstring, ", ")
End Sub
|
Maintain the same structure and functionality when rewriting this code in VB. | package main
import "fmt"
func main() { fmt.Println("Hello world!") }
| Public Sub hello_world_text
Debug.Print "Hello World!"
End Sub
|
Maintain the same structure and functionality when rewriting this code in VB. | package main
import "fmt"
func main() {
a := []int{90, 47, 58, 29, 22, 32, 55, 5, 55, 73}
fmt.Println(a)
fmt.Println(fd(a, 9))
}
func fd(a []int, ord int) []int {
for i := 0; i < ord; i++ {
for j := 0; j < len(a)-i-1; j++ {
a[j] = a[j+1] - a[j]
}
}
return a[:len(a)-ord]
}
| Module ForwardDifference
Sub Main()
Dim lNum As New List(Of Integer)(New Integer() {90, 47, 58, 29, 22, 32, 55, 5, 55, 73})
For i As UInteger = 0 To 9
Console.WriteLine(String.Join(" ", (From n In Difference(i, lNum) Select String.Format("{0,5}", n)).ToArray()))
Next
Console.ReadKey()
End Sub
Private Function Difference(ByVal Level As UInteger, ByVal Numbers As List(Of Integer)) As List(Of Integer)
If Level >= Numbers.Count Then Throw New ArgumentOutOfRangeException("Level", "Level must be less than number of items in Numbers")
For i As Integer = 1 To Level
Numbers = (From n In Enumerable.Range(0, Numbers.Count - 1) _
Select Numbers(n + 1) - Numbers(n)).ToList()
Next
Return Numbers
End Function
End Module
|
Write the same algorithm in VB as shown in this Go implementation. | func IsPrime(n int) bool {
if n < 0 { n = -n }
switch {
case n == 2:
return true
case n < 2 || n % 2 == 0:
return false
default:
for i = 3; i*i <= n; i += 2 {
if n % i == 0 { return false }
}
}
return true
}
| Option Explicit
Sub FirstTwentyPrimes()
Dim count As Integer, i As Long, t(19) As String
Do
i = i + 1
If IsPrime(i) Then
t(count) = i
count = count + 1
End If
Loop While count <= UBound(t)
Debug.Print Join(t, ", ")
End Sub
Function IsPrime(Nb As Long) As Boolean
If Nb = 2 Then
IsPrime = True
ElseIf Nb < 2 Or Nb Mod 2 = 0 Then
Exit Function
Else
Dim i As Long
For i = 3 To Sqr(Nb) Step 2
If Nb Mod i = 0 Then Exit Function
Next
IsPrime = True
End If
End Function
|
Convert this Go block to VB, preserving its control flow and logic. | package main
import "fmt"
import "math/big"
func main() {
fmt.Println(new(big.Int).Binomial(5, 3))
fmt.Println(new(big.Int).Binomial(60, 30))
}
| Function binomial(n,k)
binomial = factorial(n)/(factorial(n-k)*factorial(k))
End Function
Function factorial(n)
If n = 0 Then
factorial = 1
Else
For i = n To 1 Step -1
If i = n Then
factorial = n
Else
factorial = factorial * i
End If
Next
End If
End Function
WScript.StdOut.Write "the binomial coefficient of 5 and 3 = " & binomial(5,3)
WScript.StdOut.WriteLine
|
Please provide an equivalent version of this Go code in VB. | package main
import "fmt"
func main() {
var a []interface{}
a = append(a, 3)
a = append(a, "apples", "oranges")
fmt.Println(a)
}
| Dim coll As New Collection
coll.Add "apple"
coll.Add "banana"
|
Change the following Go code into VB without altering its purpose. | start := &Ele{"tacos", nil}
end := start.Append("burritos")
end = end.Append("fajitas")
end = end.Append("enchilatas")
for iter := start; iter != nil; iter = iter.Next {
fmt.Println(iter)
}
| Private Sub Iterate(ByVal list As LinkedList(Of Integer))
Dim node = list.First
Do Until node Is Nothing
node = node.Next
Loop
End Sub
|
Port the provided Go code into VB while preserving the original functionality. | start := &Ele{"tacos", nil}
end := start.Append("burritos")
end = end.Append("fajitas")
end = end.Append("enchilatas")
for iter := start; iter != nil; iter = iter.Next {
fmt.Println(iter)
}
| Private Sub Iterate(ByVal list As LinkedList(Of Integer))
Dim node = list.First
Do Until node Is Nothing
node = node.Next
Loop
End Sub
|
Port the provided Go code into VB while preserving the original functionality. | package raster
import (
"fmt"
"io"
"os"
)
func (b *Bitmap) WritePpmTo(w io.Writer) (err error) {
if _, err = fmt.Fprintln(w, "P6"); err != nil {
return
}
for _, c := range b.Comments {
if _, err = fmt.Fprintln(w, c); err != nil {
return
}
}
_, err = fmt.Fprintf(w, "%d %d\n255\n", b.cols, b.rows)
if err != nil {
return
}
b3 := make([]byte, 3*len(b.px))
n1 := 0
for _, px := range b.px {
b3[n1] = px.R
b3[n1+1] = px.G
b3[n1+2] = px.B
n1 += 3
}
if _, err = w.Write(b3); err != nil {
return
}
return
}
func (b *Bitmap) WritePpmFile(fn string) (err error) {
var f *os.File
if f, err = os.Create(fn); err != nil {
return
}
if err = b.WritePpmTo(f); err != nil {
return
}
return f.Close()
}
| Public Shared Sub SaveRasterBitmapToPpmFile(ByVal rasterBitmap As RasterBitmap, ByVal filepath As String)
Dim header As String = String.Format("P6{0}{1}{2}{3}{0}255{0}", vbLf, rasterBitmap.Width, " "c, rasterBitmap.Height)
Dim bufferSize As Integer = header.Length + (rasterBitmap.Width * rasterBitmap.Height * 3)
Dim bytes(bufferSize - 1) As Byte
Buffer.BlockCopy(Encoding.ASCII.GetBytes(header.ToString), 0, bytes, 0, header.Length)
Dim index As Integer = header.Length
For y As Integer = 0 To rasterBitmap.Height - 1
For x As Integer = 0 To rasterBitmap.Width - 1
Dim color As Rgb = rasterBitmap.GetPixel(x, y)
bytes(index) = color.R
bytes(index + 1) = color.G
bytes(index + 2) = color.B
index += 3
Next
Next
My.Computer.FileSystem.WriteAllBytes(filepath, bytes, False)
End Sub
|
Write the same code in VB as shown below in Go. | package main
import "os"
func main() {
os.Remove("input.txt")
os.Remove("/input.txt")
os.Remove("docs")
os.Remove("/docs")
os.RemoveAll("docs")
os.RemoveAll("/docs")
}
| Option Explicit
Sub DeleteFileOrDirectory()
Dim myPath As String
myPath = "C:\Users\surname.name\Desktop\Docs"
Kill myPath & "\input.txt"
RmDir myPath
End Sub
|
Generate an equivalent VB version of this Go code. | package main
import (
"fmt"
"math"
"math/rand"
)
const nmax = 20
func main() {
fmt.Println(" N average analytical (error)")
fmt.Println("=== ========= ============ =========")
for n := 1; n <= nmax; n++ {
a := avg(n)
b := ana(n)
fmt.Printf("%3d %9.4f %12.4f (%6.2f%%)\n",
n, a, b, math.Abs(a-b)/b*100)
}
}
func avg(n int) float64 {
const tests = 1e4
sum := 0
for t := 0; t < tests; t++ {
var v [nmax]bool
for x := 0; !v[x]; x = rand.Intn(n) {
v[x] = true
sum++
}
}
return float64(sum) / tests
}
func ana(n int) float64 {
nn := float64(n)
term := 1.
sum := 1.
for i := nn - 1; i >= 1; i-- {
term *= i / nn
sum += term
}
return sum
}
| Const MAX = 20
Const ITER = 1000000
Function expected(n As Long) As Double
Dim sum As Double
For i = 1 To n
sum = sum + WorksheetFunction.Fact(n) / n ^ i / WorksheetFunction.Fact(n - i)
Next i
expected = sum
End Function
Function test(n As Long) As Double
Dim count As Long
Dim x As Long, bits As Long
For i = 1 To ITER
x = 1
bits = 0
Do While Not bits And x
count = count + 1
bits = bits Or x
x = 2 ^ (Int(n * Rnd()))
Loop
Next i
test = count / ITER
End Function
Public Sub main()
Dim n As Long
Debug.Print " n avg. exp. (error%)"
Debug.Print "== ====== ====== ========"
For n = 1 To MAX
av = test(n)
ex = expected(n)
Debug.Print Format(n, "@@"); " "; Format(av, "0.0000"); " ";
Debug.Print Format(ex, "0.0000"); " ("; Format(Abs(1 - av / ex), "0.000%"); ")"
Next n
End Sub
|
Port the following code from Go to VB with equivalent syntax and logic. | package main
import (
"fmt"
"math"
"math/rand"
)
const nmax = 20
func main() {
fmt.Println(" N average analytical (error)")
fmt.Println("=== ========= ============ =========")
for n := 1; n <= nmax; n++ {
a := avg(n)
b := ana(n)
fmt.Printf("%3d %9.4f %12.4f (%6.2f%%)\n",
n, a, b, math.Abs(a-b)/b*100)
}
}
func avg(n int) float64 {
const tests = 1e4
sum := 0
for t := 0; t < tests; t++ {
var v [nmax]bool
for x := 0; !v[x]; x = rand.Intn(n) {
v[x] = true
sum++
}
}
return float64(sum) / tests
}
func ana(n int) float64 {
nn := float64(n)
term := 1.
sum := 1.
for i := nn - 1; i >= 1; i-- {
term *= i / nn
sum += term
}
return sum
}
| Const MAX = 20
Const ITER = 1000000
Function expected(n As Long) As Double
Dim sum As Double
For i = 1 To n
sum = sum + WorksheetFunction.Fact(n) / n ^ i / WorksheetFunction.Fact(n - i)
Next i
expected = sum
End Function
Function test(n As Long) As Double
Dim count As Long
Dim x As Long, bits As Long
For i = 1 To ITER
x = 1
bits = 0
Do While Not bits And x
count = count + 1
bits = bits Or x
x = 2 ^ (Int(n * Rnd()))
Loop
Next i
test = count / ITER
End Function
Public Sub main()
Dim n As Long
Debug.Print " n avg. exp. (error%)"
Debug.Print "== ====== ====== ========"
For n = 1 To MAX
av = test(n)
ex = expected(n)
Debug.Print Format(n, "@@"); " "; Format(av, "0.0000"); " ";
Debug.Print Format(ex, "0.0000"); " ("; Format(Abs(1 - av / ex), "0.000%"); ")"
Next n
End Sub
|
Write a version of this Go function in VB with identical behavior. | package main
import (
"fmt"
)
func main() {
str := "Mary had a %s lamb"
txt := "little"
out := fmt.Sprintf(str, txt)
fmt.Println(out)
}
| Dim name as String = "J. Doe"
Dim balance as Double = 123.45
Dim prompt as String = String.Format("Hello {0}, your balance is {1}.", name, balance)
Console.WriteLine(prompt)
|
Ensure the translated VB code behaves exactly like the original Go snippet. | package main
import (
"fmt"
"permute"
)
func determinant(m [][]float64) (d float64) {
p := make([]int, len(m))
for i := range p {
p[i] = i
}
it := permute.Iter(p)
for s := it(); s != 0; s = it() {
pr := 1.
for i, σ := range p {
pr *= m[i][σ]
}
d += float64(s) * pr
}
return
}
func permanent(m [][]float64) (d float64) {
p := make([]int, len(m))
for i := range p {
p[i] = i
}
it := permute.Iter(p)
for s := it(); s != 0; s = it() {
pr := 1.
for i, σ := range p {
pr *= m[i][σ]
}
d += pr
}
return
}
var m2 = [][]float64{
{1, 2},
{3, 4}}
var m3 = [][]float64{
{2, 9, 4},
{7, 5, 3},
{6, 1, 8}}
func main() {
fmt.Println(determinant(m2), permanent(m2))
fmt.Println(determinant(m3), permanent(m3))
}
| Module Module1
Function Minor(a As Double(,), x As Integer, y As Integer) As Double(,)
Dim length = a.GetLength(0) - 1
Dim result(length - 1, length - 1) As Double
For i = 1 To length
For j = 1 To length
If i < x AndAlso j < y Then
result(i - 1, j - 1) = a(i - 1, j - 1)
ElseIf i >= x AndAlso j < y Then
result(i - 1, j - 1) = a(i, j - 1)
ElseIf i < x AndAlso j >= y Then
result(i - 1, j - 1) = a(i - 1, j)
Else
result(i - 1, j - 1) = a(i, j)
End If
Next
Next
Return result
End Function
Function Det(a As Double(,)) As Double
If a.GetLength(0) = 1 Then
Return a(0, 0)
Else
Dim sign = 1
Dim sum = 0.0
For i = 1 To a.GetLength(0)
sum += sign * a(0, i - 1) * Det(Minor(a, 0, i))
sign *= -1
Next
Return sum
End If
End Function
Function Perm(a As Double(,)) As Double
If a.GetLength(0) = 1 Then
Return a(0, 0)
Else
Dim sum = 0.0
For i = 1 To a.GetLength(0)
sum += a(0, i - 1) * Perm(Minor(a, 0, i))
Next
Return sum
End If
End Function
Sub WriteLine(a As Double(,))
For i = 1 To a.GetLength(0)
Console.Write("[")
For j = 1 To a.GetLength(1)
If j > 1 Then
Console.Write(", ")
End If
Console.Write(a(i - 1, j - 1))
Next
Console.WriteLine("]")
Next
End Sub
Sub Test(a As Double(,))
If a.GetLength(0) <> a.GetLength(1) Then
Throw New ArgumentException("The dimensions must be equal")
End If
WriteLine(a)
Console.WriteLine("Permanant : {0}", Perm(a))
Console.WriteLine("Determinant: {0}", Det(a))
Console.WriteLine()
End Sub
Sub Main()
Test({{1, 2}, {3, 4}})
Test({{1, 2, 3, 4}, {4, 5, 6, 7}, {7, 8, 9, 10}, {10, 11, 12, 13}})
Test({{0, 1, 2, 3, 4}, {5, 6, 7, 8, 9}, {10, 11, 12, 13, 14}, {15, 16, 17, 18, 19}, {20, 21, 22, 23, 24}})
End Sub
End Module
|
Write the same code in VB as shown below in Go. | package main
import (
"fmt"
"permute"
)
func determinant(m [][]float64) (d float64) {
p := make([]int, len(m))
for i := range p {
p[i] = i
}
it := permute.Iter(p)
for s := it(); s != 0; s = it() {
pr := 1.
for i, σ := range p {
pr *= m[i][σ]
}
d += float64(s) * pr
}
return
}
func permanent(m [][]float64) (d float64) {
p := make([]int, len(m))
for i := range p {
p[i] = i
}
it := permute.Iter(p)
for s := it(); s != 0; s = it() {
pr := 1.
for i, σ := range p {
pr *= m[i][σ]
}
d += pr
}
return
}
var m2 = [][]float64{
{1, 2},
{3, 4}}
var m3 = [][]float64{
{2, 9, 4},
{7, 5, 3},
{6, 1, 8}}
func main() {
fmt.Println(determinant(m2), permanent(m2))
fmt.Println(determinant(m3), permanent(m3))
}
| Module Module1
Function Minor(a As Double(,), x As Integer, y As Integer) As Double(,)
Dim length = a.GetLength(0) - 1
Dim result(length - 1, length - 1) As Double
For i = 1 To length
For j = 1 To length
If i < x AndAlso j < y Then
result(i - 1, j - 1) = a(i - 1, j - 1)
ElseIf i >= x AndAlso j < y Then
result(i - 1, j - 1) = a(i, j - 1)
ElseIf i < x AndAlso j >= y Then
result(i - 1, j - 1) = a(i - 1, j)
Else
result(i - 1, j - 1) = a(i, j)
End If
Next
Next
Return result
End Function
Function Det(a As Double(,)) As Double
If a.GetLength(0) = 1 Then
Return a(0, 0)
Else
Dim sign = 1
Dim sum = 0.0
For i = 1 To a.GetLength(0)
sum += sign * a(0, i - 1) * Det(Minor(a, 0, i))
sign *= -1
Next
Return sum
End If
End Function
Function Perm(a As Double(,)) As Double
If a.GetLength(0) = 1 Then
Return a(0, 0)
Else
Dim sum = 0.0
For i = 1 To a.GetLength(0)
sum += a(0, i - 1) * Perm(Minor(a, 0, i))
Next
Return sum
End If
End Function
Sub WriteLine(a As Double(,))
For i = 1 To a.GetLength(0)
Console.Write("[")
For j = 1 To a.GetLength(1)
If j > 1 Then
Console.Write(", ")
End If
Console.Write(a(i - 1, j - 1))
Next
Console.WriteLine("]")
Next
End Sub
Sub Test(a As Double(,))
If a.GetLength(0) <> a.GetLength(1) Then
Throw New ArgumentException("The dimensions must be equal")
End If
WriteLine(a)
Console.WriteLine("Permanant : {0}", Perm(a))
Console.WriteLine("Determinant: {0}", Det(a))
Console.WriteLine()
End Sub
Sub Main()
Test({{1, 2}, {3, 4}})
Test({{1, 2, 3, 4}, {4, 5, 6, 7}, {7, 8, 9, 10}, {10, 11, 12, 13}})
Test({{0, 1, 2, 3, 4}, {5, 6, 7, 8, 9}, {10, 11, 12, 13, 14}, {15, 16, 17, 18, 19}, {20, 21, 22, 23, 24}})
End Sub
End Module
|
Write a version of this Go function in VB with identical behavior. | package main
import (
"fmt"
"math"
)
type xy struct {
x, y float64
}
type seg struct {
p1, p2 xy
}
type poly struct {
name string
sides []seg
}
func inside(pt xy, pg poly) (i bool) {
for _, side := range pg.sides {
if rayIntersectsSegment(pt, side) {
i = !i
}
}
return
}
func rayIntersectsSegment(p xy, s seg) bool {
var a, b xy
if s.p1.y < s.p2.y {
a, b = s.p1, s.p2
} else {
a, b = s.p2, s.p1
}
for p.y == a.y || p.y == b.y {
p.y = math.Nextafter(p.y, math.Inf(1))
}
if p.y < a.y || p.y > b.y {
return false
}
if a.x > b.x {
if p.x > a.x {
return false
}
if p.x < b.x {
return true
}
} else {
if p.x > b.x {
return false
}
if p.x < a.x {
return true
}
}
return (p.y-a.y)/(p.x-a.x) >= (b.y-a.y)/(b.x-a.x)
}
var (
p1 = xy{0, 0}
p2 = xy{10, 0}
p3 = xy{10, 10}
p4 = xy{0, 10}
p5 = xy{2.5, 2.5}
p6 = xy{7.5, 2.5}
p7 = xy{7.5, 7.5}
p8 = xy{2.5, 7.5}
p9 = xy{0, 5}
p10 = xy{10, 5}
p11 = xy{3, 0}
p12 = xy{7, 0}
p13 = xy{7, 10}
p14 = xy{3, 10}
)
var tpg = []poly{
{"square", []seg{{p1, p2}, {p2, p3}, {p3, p4}, {p4, p1}}},
{"square hole", []seg{{p1, p2}, {p2, p3}, {p3, p4}, {p4, p1},
{p5, p6}, {p6, p7}, {p7, p8}, {p8, p5}}},
{"strange", []seg{{p1, p5},
{p5, p4}, {p4, p8}, {p8, p7}, {p7, p3}, {p3, p2}, {p2, p5}}},
{"exagon", []seg{{p11, p12}, {p12, p10}, {p10, p13},
{p13, p14}, {p14, p9}, {p9, p11}}},
}
var tpt = []xy{
{5, 5}, {5, 8}, {-10, 5}, {0, 5}, {10, 5}, {8, 5}, {10, 10},
{1, 2}, {2, 1},
}
func main() {
for _, pg := range tpg {
fmt.Printf("%s:\n", pg.name)
for _, pt := range tpt {
fmt.Println(pt, inside(pt, pg))
}
}
}
| Imports System.Math
Module RayCasting
Private square As Integer()() = {New Integer() {0, 0}, New Integer() {20, 0}, New Integer() {20, 20}, New Integer() {0, 20}}
Private squareHole As Integer()() = {New Integer() {0, 0}, New Integer() {20, 0}, New Integer() {20, 20}, New Integer() {0, 20}, New Integer() {5, 5}, New Integer() {15, 5}, New Integer() {15, 15}, New Integer() {5, 15}}
Private strange As Integer()() = {New Integer() {0, 0}, New Integer() {5, 5}, New Integer() {0, 20}, New Integer() {5, 15}, New Integer() {15, 15}, New Integer() {20, 20}, New Integer() {20, 0}}
Private hexagon As Integer()() = {New Integer() {6, 0}, New Integer() {14, 0}, New Integer() {20, 10}, New Integer() {14, 20}, New Integer() {6, 20}, New Integer() {0, 10}}
Private shapes As Integer()()() = {square, squareHole, strange, hexagon}
Public Sub Main()
Dim testPoints As Double()() = {New Double() {10, 10}, New Double() {10, 16}, New Double() {-20, 10}, New Double() {0, 10}, New Double() {20, 10}, New Double() {16, 10}, New Double() {20, 20}}
For Each shape As Integer()() In shapes
For Each point As Double() In testPoints
Console.Write(String.Format("{0} ", Contains(shape, point).ToString.PadLeft(7)))
Next
Console.WriteLine()
Next
End Sub
Private Function Contains(shape As Integer()(), point As Double()) As Boolean
Dim inside As Boolean = False
Dim length As Integer = shape.Length
For i As Integer = 0 To length - 1
If Intersects(shape(i), shape((i + 1) Mod length), point) Then
inside = Not inside
End If
Next
Return inside
End Function
Private Function Intersects(a As Integer(), b As Integer(), p As Double()) As Boolean
If a(1) > b(1) Then Return Intersects(b, a, p)
If p(1) = a(1) Or p(1) = b(1) Then p(1) += 0.0001
If p(1) > b(1) Or p(1) < a(1) Or p(0) >= Max(a(0), b(0)) Then Return False
If p(0) < Min(a(0), b(0)) Then Return True
Dim red As Double = (p(1) - a(1)) / (p(0) - a(0))
Dim blue As Double = (b(1) - a(1)) / (b(0) - a(0))
Return red >= blue
End Function
End Module
|
Rewrite the snippet below in VB so it works the same as the original Go code. | package main
import (
"fmt"
"strings"
)
func main() {
fmt.Println(strings.Count("the three truths", "th"))
fmt.Println(strings.Count("ababababab", "abab"))
}
| Function CountSubstring(str,substr)
CountSubstring = 0
For i = 1 To Len(str)
If Len(str) >= Len(substr) Then
If InStr(i,str,substr) Then
CountSubstring = CountSubstring + 1
i = InStr(i,str,substr) + Len(substr) - 1
End If
Else
Exit For
End If
Next
End Function
WScript.StdOut.Write CountSubstring("the three truths","th") & vbCrLf
WScript.StdOut.Write CountSubstring("ababababab","abab") & vbCrLf
|
Convert this Go block to VB, preserving its control flow and logic. | package main
import (
"fmt"
"sort"
"strconv"
)
func combrep(n int, lst []byte) [][]byte {
if n == 0 {
return [][]byte{nil}
}
if len(lst) == 0 {
return nil
}
r := combrep(n, lst[1:])
for _, x := range combrep(n-1, lst) {
r = append(r, append(x, lst[0]))
}
return r
}
func shouldSwap(s []byte, start, curr int) bool {
for i := start; i < curr; i++ {
if s[i] == s[curr] {
return false
}
}
return true
}
func findPerms(s []byte, index, n int, res *[]string) {
if index >= n {
*res = append(*res, string(s))
return
}
for i := index; i < n; i++ {
check := shouldSwap(s, index, i)
if check {
s[index], s[i] = s[i], s[index]
findPerms(s, index+1, n, res)
s[index], s[i] = s[i], s[index]
}
}
}
func main() {
primes := []byte{2, 3, 5, 7}
var res []string
for n := 3; n <= 6; n++ {
reps := combrep(n, primes)
for _, rep := range reps {
sum := byte(0)
for _, r := range rep {
sum += r
}
if sum == 13 {
var perms []string
for i := 0; i < len(rep); i++ {
rep[i] += 48
}
findPerms(rep, 0, len(rep), &perms)
res = append(res, perms...)
}
}
}
res2 := make([]int, len(res))
for i, r := range res {
res2[i], _ = strconv.Atoi(r)
}
sort.Ints(res2)
fmt.Println("Those numbers whose digits are all prime and sum to 13 are:")
fmt.Println(res2)
}
| Imports System
Imports System.Console
Imports LI = System.Collections.Generic.SortedSet(Of Integer)
Module Module1
Function unl(ByVal res As LI, ByVal lst As LI, ByVal lft As Integer, ByVal Optional mul As Integer = 1, ByVal Optional vlu As Integer = 0) As LI
If lft = 0 Then
res.Add(vlu)
ElseIf lft > 0 Then
For Each itm As Integer In lst
res = unl(res, lst, lft - itm, mul * 10, vlu + itm * mul)
Next
End If
Return res
End Function
Sub Main(ByVal args As String())
WriteLine(string.Join(" ",
unl(new LI From {}, new LI From { 2, 3, 5, 7 }, 13)))
End Sub
End Module
|
Generate a VB translation of this Go snippet without changing its computational steps. | package main
import (
"fmt"
"sort"
"strconv"
)
func combrep(n int, lst []byte) [][]byte {
if n == 0 {
return [][]byte{nil}
}
if len(lst) == 0 {
return nil
}
r := combrep(n, lst[1:])
for _, x := range combrep(n-1, lst) {
r = append(r, append(x, lst[0]))
}
return r
}
func shouldSwap(s []byte, start, curr int) bool {
for i := start; i < curr; i++ {
if s[i] == s[curr] {
return false
}
}
return true
}
func findPerms(s []byte, index, n int, res *[]string) {
if index >= n {
*res = append(*res, string(s))
return
}
for i := index; i < n; i++ {
check := shouldSwap(s, index, i)
if check {
s[index], s[i] = s[i], s[index]
findPerms(s, index+1, n, res)
s[index], s[i] = s[i], s[index]
}
}
}
func main() {
primes := []byte{2, 3, 5, 7}
var res []string
for n := 3; n <= 6; n++ {
reps := combrep(n, primes)
for _, rep := range reps {
sum := byte(0)
for _, r := range rep {
sum += r
}
if sum == 13 {
var perms []string
for i := 0; i < len(rep); i++ {
rep[i] += 48
}
findPerms(rep, 0, len(rep), &perms)
res = append(res, perms...)
}
}
}
res2 := make([]int, len(res))
for i, r := range res {
res2[i], _ = strconv.Atoi(r)
}
sort.Ints(res2)
fmt.Println("Those numbers whose digits are all prime and sum to 13 are:")
fmt.Println(res2)
}
| Imports System
Imports System.Console
Imports LI = System.Collections.Generic.SortedSet(Of Integer)
Module Module1
Function unl(ByVal res As LI, ByVal lst As LI, ByVal lft As Integer, ByVal Optional mul As Integer = 1, ByVal Optional vlu As Integer = 0) As LI
If lft = 0 Then
res.Add(vlu)
ElseIf lft > 0 Then
For Each itm As Integer In lst
res = unl(res, lst, lft - itm, mul * 10, vlu + itm * mul)
Next
End If
Return res
End Function
Sub Main(ByVal args As String())
WriteLine(string.Join(" ",
unl(new LI From {}, new LI From { 2, 3, 5, 7 }, 13)))
End Sub
End Module
|
Produce a language-to-language conversion: from Go to VB, same semantics. | package main
import (
"fmt"
"io"
"os"
"strings"
"time"
)
func addNote(fn string, note string) error {
f, err := os.OpenFile(fn, os.O_RDWR|os.O_APPEND|os.O_CREATE, 0666)
if err != nil {
return err
}
_, err = fmt.Fprint(f, time.Now().Format(time.RFC1123), "\n\t", note, "\n")
if cErr := f.Close(); err == nil {
err = cErr
}
return err
}
func showNotes(w io.Writer, fn string) error {
f, err := os.Open(fn)
if err != nil {
if os.IsNotExist(err) {
return nil
}
return err
}
_, err = io.Copy(w, f)
f.Close()
return err
}
func main() {
const fn = "NOTES.TXT"
var err error
if len(os.Args) > 1 {
err = addNote(fn, strings.Join(os.Args[1:], " "))
} else {
err = showNotes(os.Stdout, fn)
}
if err != nil {
fmt.Fprintln(os.Stderr, err)
os.Exit(1)
}
}
| Imports System.IO
Module Notes
Function Main(ByVal cmdArgs() As String) As Integer
Try
If cmdArgs.Length = 0 Then
Using sr As New StreamReader("NOTES.TXT")
Console.WriteLine(sr.ReadToEnd)
End Using
Else
Using sw As New StreamWriter("NOTES.TXT", True)
sw.WriteLine(Date.Now.ToString())
sw.WriteLine("{0}{1}", ControlChars.Tab, String.Join(" ", cmdArgs))
End Using
End If
Catch
End Try
End Function
End Module
|
Please provide an equivalent version of this Go code in VB. | package main
import (
"fmt"
"os"
"path"
)
func CommonPrefix(sep byte, paths ...string) string {
switch len(paths) {
case 0:
return ""
case 1:
return path.Clean(paths[0])
}
c := []byte(path.Clean(paths[0]))
c = append(c, sep)
for _, v := range paths[1:] {
v = path.Clean(v) + string(sep)
if len(v) < len(c) {
c = c[:len(v)]
}
for i := 0; i < len(c); i++ {
if v[i] != c[i] {
c = c[:i]
break
}
}
}
for i := len(c) - 1; i >= 0; i-- {
if c[i] == sep {
c = c[:i]
break
}
}
return string(c)
}
func main() {
c := CommonPrefix(os.PathSeparator,
"/home/user1/tmp/coverage/test",
"/home/user1/tmp/covert/operator",
"/home/user1/tmp/coven/members",
"/home
"/home/user1/././tmp/covertly/foo",
"/home/bob/../user1/tmp/coved/bar",
)
if c == "" {
fmt.Println("No common path")
} else {
fmt.Println("Common path:", c)
}
}
| Public Function CommonDirectoryPath(ParamArray Paths()) As String
Dim v As Variant
Dim Path() As String, s As String
Dim i As Long, j As Long, k As Long
Const PATH_SEPARATOR As String = "/"
For Each v In Paths
ReDim Preserve Path(0 To i)
Path(i) = v
i = i + 1
Next v
k = 1
Do
For i = 0 To UBound(Path)
If i Then
If InStr(k, Path(i), PATH_SEPARATOR) <> j Then
Exit Do
ElseIf Left$(Path(i), j) <> Left$(Path(0), j) Then
Exit Do
End If
Else
j = InStr(k, Path(i), PATH_SEPARATOR)
If j = 0 Then
Exit Do
End If
End If
Next i
s = Left$(Path(0), j + CLng(k <> 1))
k = j + 1
Loop
CommonDirectoryPath = s
End Function
Sub Main()
Debug.Assert CommonDirectoryPath( _
"/home/user1/tmp/coverage/test", _
"/home/user1/tmp/covert/operator", _
"/home/user1/tmp/coven/members") = _
"/home/user1/tmp"
Debug.Assert CommonDirectoryPath( _
"/home/user1/tmp/coverage/test", _
"/home/user1/tmp/covert/operator", _
"/home/user1/tmp/coven/members", _
"/home/user1/abc/coven/members") = _
"/home/user1"
Debug.Assert CommonDirectoryPath( _
"/home/user1/tmp/coverage/test", _
"/hope/user1/tmp/covert/operator", _
"/home/user1/tmp/coven/members") = _
"/"
End Sub
|
Translate the given Go code snippet into VB without altering its behavior. | package main
import (
"fmt"
"math"
"math/rand"
"time"
)
func dice5() int {
return rand.Intn(5) + 1
}
func dice7() (i int) {
for {
i = 5*dice5() + dice5()
if i < 27 {
break
}
}
return (i / 3) - 1
}
func distCheck(f func() int, n int,
repeats int, delta float64) (max float64, flatEnough bool) {
count := make([]int, n)
for i := 0; i < repeats; i++ {
count[f()-1]++
}
expected := float64(repeats) / float64(n)
for _, c := range count {
max = math.Max(max, math.Abs(float64(c)-expected))
}
return max, max < delta
}
func main() {
rand.Seed(time.Now().UnixNano())
const calls = 1000000
max, flatEnough := distCheck(dice7, 7, calls, 500)
fmt.Println("Max delta:", max, "Flat enough:", flatEnough)
max, flatEnough = distCheck(dice7, 7, calls, 500)
fmt.Println("Max delta:", max, "Flat enough:", flatEnough)
}
| Option Explicit
sub verifydistribution(calledfunction, samples, delta)
Dim i, n, maxdiff
Dim d : Set d = CreateObject("Scripting.Dictionary")
wscript.echo "Running """ & calledfunction & """ " & samples & " times..."
for i = 1 to samples
Execute "n = " & calledfunction
d(n) = d(n) + 1
next
n = d.Count
maxdiff = 0
wscript.echo "Expected average count is " & Int(samples/n) & " across " & n & " buckets."
for each i in d.Keys
dim diff : diff = abs(1 - d(i) / (samples/n))
if diff > maxdiff then maxdiff = diff
wscript.echo "Bucket " & i & " had " & d(i) & " occurences" _
& vbTab & " difference from expected=" & FormatPercent(diff, 2)
next
wscript.echo "Maximum found variation is " & FormatPercent(maxdiff, 2) _
& ", desired limit is " & FormatPercent(delta, 2) & "."
if maxdiff > delta then wscript.echo "Skewed!" else wscript.echo "Smooth!"
end sub
|
Write a version of this Go function in VB with identical behavior. | package main
import (
"fmt"
"math/big"
)
func main() {
limit := 100
last := 12
s2 := make([][]*big.Int, limit+1)
for n := 0; n <= limit; n++ {
s2[n] = make([]*big.Int, limit+1)
for k := 0; k <= limit; k++ {
s2[n][k] = new(big.Int)
}
s2[n][n].SetInt64(int64(1))
}
var t big.Int
for n := 1; n <= limit; n++ {
for k := 1; k <= n; k++ {
t.SetInt64(int64(k))
t.Mul(&t, s2[n-1][k])
s2[n][k].Add(&t, s2[n-1][k-1])
}
}
fmt.Println("Stirling numbers of the second kind: S2(n, k):")
fmt.Printf("n/k")
for i := 0; i <= last; i++ {
fmt.Printf("%9d ", i)
}
fmt.Printf("\n--")
for i := 0; i <= last; i++ {
fmt.Printf("----------")
}
fmt.Println()
for n := 0; n <= last; n++ {
fmt.Printf("%2d ", n)
for k := 0; k <= n; k++ {
fmt.Printf("%9d ", s2[n][k])
}
fmt.Println()
}
fmt.Println("\nMaximum value from the S2(100, *) row:")
max := new(big.Int).Set(s2[limit][0])
for k := 1; k <= limit; k++ {
if s2[limit][k].Cmp(max) > 0 {
max.Set(s2[limit][k])
}
}
fmt.Println(max)
fmt.Printf("which has %d digits.\n", len(max.String()))
}
| Imports System.Numerics
Module Module1
Class Sterling
Private Shared ReadOnly COMPUTED As New Dictionary(Of String, BigInteger)
Private Shared Function CacheKey(n As Integer, k As Integer) As String
Return String.Format("{0}:{1}", n, k)
End Function
Private Shared Function Impl(n As Integer, k As Integer) As BigInteger
If n = 0 AndAlso k = 0 Then
Return 1
End If
If (n > 0 AndAlso k = 0) OrElse (n = 0 AndAlso k > 0) Then
Return 0
End If
If n = k Then
Return 1
End If
If k > n Then
Return 0
End If
Return k * Sterling2(n - 1, k) + Sterling2(n - 1, k - 1)
End Function
Public Shared Function Sterling2(n As Integer, k As Integer) As BigInteger
Dim key = CacheKey(n, k)
If COMPUTED.ContainsKey(key) Then
Return COMPUTED(key)
End If
Dim result = Impl(n, k)
COMPUTED.Add(key, result)
Return result
End Function
End Class
Sub Main()
Console.WriteLine("Stirling numbers of the second kind:")
Dim max = 12
Console.Write("n/k")
For n = 0 To max
Console.Write("{0,10}", n)
Next
Console.WriteLine()
For n = 0 To max
Console.Write("{0,3}", n)
For k = 0 To n
Console.Write("{0,10}", Sterling.Sterling2(n, k))
Next
Console.WriteLine()
Next
Console.WriteLine("The maximum value of S2(100, k) = ")
Dim previous = BigInteger.Zero
For k = 1 To 100
Dim current = Sterling.Sterling2(100, k)
If current > previous Then
previous = current
Else
Console.WriteLine(previous)
Console.WriteLine("({0} digits, k = {1})", previous.ToString().Length, k - 1)
Exit For
End If
Next
End Sub
End Module
|
Translate this program into VB but keep the logic exactly as in Go. | package main
import (
"fmt"
"math/big"
)
func main() {
limit := 100
last := 12
s2 := make([][]*big.Int, limit+1)
for n := 0; n <= limit; n++ {
s2[n] = make([]*big.Int, limit+1)
for k := 0; k <= limit; k++ {
s2[n][k] = new(big.Int)
}
s2[n][n].SetInt64(int64(1))
}
var t big.Int
for n := 1; n <= limit; n++ {
for k := 1; k <= n; k++ {
t.SetInt64(int64(k))
t.Mul(&t, s2[n-1][k])
s2[n][k].Add(&t, s2[n-1][k-1])
}
}
fmt.Println("Stirling numbers of the second kind: S2(n, k):")
fmt.Printf("n/k")
for i := 0; i <= last; i++ {
fmt.Printf("%9d ", i)
}
fmt.Printf("\n--")
for i := 0; i <= last; i++ {
fmt.Printf("----------")
}
fmt.Println()
for n := 0; n <= last; n++ {
fmt.Printf("%2d ", n)
for k := 0; k <= n; k++ {
fmt.Printf("%9d ", s2[n][k])
}
fmt.Println()
}
fmt.Println("\nMaximum value from the S2(100, *) row:")
max := new(big.Int).Set(s2[limit][0])
for k := 1; k <= limit; k++ {
if s2[limit][k].Cmp(max) > 0 {
max.Set(s2[limit][k])
}
}
fmt.Println(max)
fmt.Printf("which has %d digits.\n", len(max.String()))
}
| Imports System.Numerics
Module Module1
Class Sterling
Private Shared ReadOnly COMPUTED As New Dictionary(Of String, BigInteger)
Private Shared Function CacheKey(n As Integer, k As Integer) As String
Return String.Format("{0}:{1}", n, k)
End Function
Private Shared Function Impl(n As Integer, k As Integer) As BigInteger
If n = 0 AndAlso k = 0 Then
Return 1
End If
If (n > 0 AndAlso k = 0) OrElse (n = 0 AndAlso k > 0) Then
Return 0
End If
If n = k Then
Return 1
End If
If k > n Then
Return 0
End If
Return k * Sterling2(n - 1, k) + Sterling2(n - 1, k - 1)
End Function
Public Shared Function Sterling2(n As Integer, k As Integer) As BigInteger
Dim key = CacheKey(n, k)
If COMPUTED.ContainsKey(key) Then
Return COMPUTED(key)
End If
Dim result = Impl(n, k)
COMPUTED.Add(key, result)
Return result
End Function
End Class
Sub Main()
Console.WriteLine("Stirling numbers of the second kind:")
Dim max = 12
Console.Write("n/k")
For n = 0 To max
Console.Write("{0,10}", n)
Next
Console.WriteLine()
For n = 0 To max
Console.Write("{0,3}", n)
For k = 0 To n
Console.Write("{0,10}", Sterling.Sterling2(n, k))
Next
Console.WriteLine()
Next
Console.WriteLine("The maximum value of S2(100, k) = ")
Dim previous = BigInteger.Zero
For k = 1 To 100
Dim current = Sterling.Sterling2(100, k)
If current > previous Then
previous = current
Else
Console.WriteLine(previous)
Console.WriteLine("({0} digits, k = {1})", previous.ToString().Length, k - 1)
Exit For
End If
Next
End Sub
End Module
|
Preserve the algorithm and functionality while converting the code from Go to VB. | package main
import "fmt"
func main() {
a := []int{0}
used := make(map[int]bool, 1001)
used[0] = true
used1000 := make(map[int]bool, 1001)
used1000[0] = true
for n, foundDup := 1, false; n <= 15 || !foundDup || len(used1000) < 1001; n++ {
next := a[n-1] - n
if next < 1 || used[next] {
next += 2 * n
}
alreadyUsed := used[next]
a = append(a, next)
if !alreadyUsed {
used[next] = true
if next >= 0 && next <= 1000 {
used1000[next] = true
}
}
if n == 14 {
fmt.Println("The first 15 terms of the Recaman's sequence are:", a)
}
if !foundDup && alreadyUsed {
fmt.Printf("The first duplicated term is a[%d] = %d\n", n, next)
foundDup = true
}
if len(used1000) == 1001 {
fmt.Printf("Terms up to a[%d] are needed to generate 0 to 1000\n", n)
}
}
}
|
nx=15
h=1000
Wscript.StdOut.WriteLine "Recaman
Wscript.StdOut.WriteLine recaman("seq",nx)
Wscript.StdOut.WriteLine "The first duplicate number is: " & recaman("firstdup",0)
Wscript.StdOut.WriteLine "The number of terms to complete the range 0--->"& h &" is: "& recaman("numterm",h)
Wscript.StdOut.Write vbCrlf&".../...": zz=Wscript.StdIn.ReadLine()
function recaman(op,nn)
Dim b,d,h
Set b = CreateObject("Scripting.Dictionary")
Set d = CreateObject("Scripting.Dictionary")
list="0" : firstdup=0
if op="firstdup" then
nn=1000 : firstdup=1
end if
if op="numterm" then
h=nn : nn=10000000 : numterm=1
end if
ax=0
b.Add 0,1
s=0
for n=1 to nn-1
an=ax-n
if an<=0 then
an=ax+n
elseif b.Exists(an) then
an=ax+n
end if
ax=an
if not b.Exists(an) then b.Add an,1
if op="seq" then
list=list&" "&an
end if
if firstdup then
if d.Exists(an) then
recaman="a("&n&")="&an
exit function
else
d.Add an,1
end if
end if
if numterm then
if an<=h then
if not d.Exists(an) then
s=s+1
d.Add an,1
end if
if s>=h then
recaman=n
exit function
end if
end if
end if
next
recaman=list
end function
|
Produce a functionally identical VB code for the snippet given in Go. | package main
import "fmt"
func main() {
a := []int{0}
used := make(map[int]bool, 1001)
used[0] = true
used1000 := make(map[int]bool, 1001)
used1000[0] = true
for n, foundDup := 1, false; n <= 15 || !foundDup || len(used1000) < 1001; n++ {
next := a[n-1] - n
if next < 1 || used[next] {
next += 2 * n
}
alreadyUsed := used[next]
a = append(a, next)
if !alreadyUsed {
used[next] = true
if next >= 0 && next <= 1000 {
used1000[next] = true
}
}
if n == 14 {
fmt.Println("The first 15 terms of the Recaman's sequence are:", a)
}
if !foundDup && alreadyUsed {
fmt.Printf("The first duplicated term is a[%d] = %d\n", n, next)
foundDup = true
}
if len(used1000) == 1001 {
fmt.Printf("Terms up to a[%d] are needed to generate 0 to 1000\n", n)
}
}
}
|
nx=15
h=1000
Wscript.StdOut.WriteLine "Recaman
Wscript.StdOut.WriteLine recaman("seq",nx)
Wscript.StdOut.WriteLine "The first duplicate number is: " & recaman("firstdup",0)
Wscript.StdOut.WriteLine "The number of terms to complete the range 0--->"& h &" is: "& recaman("numterm",h)
Wscript.StdOut.Write vbCrlf&".../...": zz=Wscript.StdIn.ReadLine()
function recaman(op,nn)
Dim b,d,h
Set b = CreateObject("Scripting.Dictionary")
Set d = CreateObject("Scripting.Dictionary")
list="0" : firstdup=0
if op="firstdup" then
nn=1000 : firstdup=1
end if
if op="numterm" then
h=nn : nn=10000000 : numterm=1
end if
ax=0
b.Add 0,1
s=0
for n=1 to nn-1
an=ax-n
if an<=0 then
an=ax+n
elseif b.Exists(an) then
an=ax+n
end if
ax=an
if not b.Exists(an) then b.Add an,1
if op="seq" then
list=list&" "&an
end if
if firstdup then
if d.Exists(an) then
recaman="a("&n&")="&an
exit function
else
d.Add an,1
end if
end if
if numterm then
if an<=h then
if not d.Exists(an) then
s=s+1
d.Add an,1
end if
if s>=h then
recaman=n
exit function
end if
end if
end if
next
recaman=list
end function
|
Please provide an equivalent version of this Go code in VB. | package main
import (
"bufio"
"fmt"
"math/rand"
"os"
"strings"
)
var b []byte
func printBoard() {
fmt.Printf("%s\n%s\n%s\n", b[0:3], b[3:6], b[6:9])
}
var pScore, cScore int
var pMark, cMark byte = 'X', 'O'
var in = bufio.NewReader(os.Stdin)
func main() {
b = make([]byte, 9)
fmt.Println("Play by entering a digit.")
for {
for i := range b {
b[i] = '1' + byte(i)
}
computerStart := cMark == 'X'
if computerStart {
fmt.Println("I go first, playing X's")
} else {
fmt.Println("You go first, playing X's")
}
TakeTurns:
for {
if !computerStart {
if !playerTurn() {
return
}
if gameOver() {
break TakeTurns
}
}
computerStart = false
computerTurn()
if gameOver() {
break TakeTurns
}
}
fmt.Println("Score: you", pScore, "me", cScore)
fmt.Println("\nLet's play again.")
}
}
func playerTurn() bool {
var pm string
var err error
for i := 0; i < 3; i++ {
printBoard()
fmt.Printf("%c's move? ", pMark)
if pm, err = in.ReadString('\n'); err != nil {
fmt.Println(err)
return false
}
pm = strings.TrimSpace(pm)
if pm >= "1" && pm <= "9" && b[pm[0]-'1'] == pm[0] {
x := pm[0] - '1'
b[x] = pMark
return true
}
}
fmt.Println("You're not playing right.")
return false
}
var choices = make([]int, 9)
func computerTurn() {
printBoard()
var x int
defer func() {
fmt.Println("My move:", x+1)
b[x] = cMark
}()
block := -1
for _, l := range lines {
var mine, yours int
x = -1
for _, sq := range l {
switch b[sq] {
case cMark:
mine++
case pMark:
yours++
default:
x = sq
}
}
if mine == 2 && x >= 0 {
return
}
if yours == 2 && x >= 0 {
block = x
}
}
if block >= 0 {
x = block
return
}
choices = choices[:0]
for i, sq := range b {
if sq == '1'+byte(i) {
choices = append(choices, i)
}
}
x = choices[rand.Intn(len(choices))]
}
func gameOver() bool {
for _, l := range lines {
if b[l[0]] == b[l[1]] && b[l[1]] == b[l[2]] {
printBoard()
if b[l[0]] == cMark {
fmt.Println("I win!")
cScore++
pMark, cMark = 'X', 'O'
} else {
fmt.Println("You win!")
pScore++
pMark, cMark = 'O', 'X'
}
return true
}
}
for i, sq := range b {
if sq == '1'+byte(i) {
return false
}
}
fmt.Println("Cat game.")
pMark, cMark = cMark, pMark
return true
}
var lines = [][]int{
{0, 1, 2},
{3, 4, 5},
{6, 7, 8},
{0, 3, 6},
{1, 4, 7},
{2, 5, 8},
{0, 4, 8},
{2, 4, 6},
}
| Option Explicit
Private Lines(1 To 3, 1 To 3) As String
Private Nb As Byte, player As Byte
Private GameWin As Boolean, GameOver As Boolean
Sub Main_TicTacToe()
Dim p As String
InitLines
printLines Nb
Do
p = WhoPlay
Debug.Print p & " play"
If p = "Human" Then
Call HumanPlay
GameWin = IsWinner("X")
Else
Call ComputerPlay
GameWin = IsWinner("O")
End If
If Not GameWin Then GameOver = IsEnd
Loop Until GameWin Or GameOver
If Not GameOver Then
Debug.Print p & " Win !"
Else
Debug.Print "Game Over!"
End If
End Sub
Sub InitLines(Optional S As String)
Dim i As Byte, j As Byte
Nb = 0: player = 0
For i = LBound(Lines, 1) To UBound(Lines, 1)
For j = LBound(Lines, 2) To UBound(Lines, 2)
Lines(i, j) = "#"
Next j
Next i
End Sub
Sub printLines(Nb As Byte)
Dim i As Byte, j As Byte, strT As String
Debug.Print "Loop " & Nb
For i = LBound(Lines, 1) To UBound(Lines, 1)
For j = LBound(Lines, 2) To UBound(Lines, 2)
strT = strT & Lines(i, j)
Next j
Debug.Print strT
strT = vbNullString
Next i
End Sub
Function WhoPlay(Optional S As String) As String
If player = 0 Then
player = 1
WhoPlay = "Human"
Else
player = 0
WhoPlay = "Computer"
End If
End Function
Sub HumanPlay(Optional S As String)
Dim L As Byte, C As Byte, GoodPlay As Boolean
Do
L = Application.InputBox("Choose the row", "Numeric only", Type:=1)
If L > 0 And L < 4 Then
C = Application.InputBox("Choose the column", "Numeric only", Type:=1)
If C > 0 And C < 4 Then
If Lines(L, C) = "#" And Not Lines(L, C) = "X" And Not Lines(L, C) = "O" Then
Lines(L, C) = "X"
Nb = Nb + 1
printLines Nb
GoodPlay = True
End If
End If
End If
Loop Until GoodPlay
End Sub
Sub ComputerPlay(Optional S As String)
Dim L As Byte, C As Byte, GoodPlay As Boolean
Randomize Timer
Do
L = Int((Rnd * 3) + 1)
C = Int((Rnd * 3) + 1)
If Lines(L, C) = "#" And Not Lines(L, C) = "X" And Not Lines(L, C) = "O" Then
Lines(L, C) = "O"
Nb = Nb + 1
printLines Nb
GoodPlay = True
End If
Loop Until GoodPlay
End Sub
Function IsWinner(S As String) As Boolean
Dim i As Byte, j As Byte, Ch As String, strTL As String, strTC As String
Ch = String(UBound(Lines, 1), S)
For i = LBound(Lines, 1) To UBound(Lines, 1)
For j = LBound(Lines, 2) To UBound(Lines, 2)
strTL = strTL & Lines(i, j)
strTC = strTC & Lines(j, i)
Next j
If strTL = Ch Or strTC = Ch Then IsWinner = True: Exit For
strTL = vbNullString: strTC = vbNullString
Next i
strTL = Lines(1, 1) & Lines(2, 2) & Lines(3, 3)
strTC = Lines(1, 3) & Lines(2, 2) & Lines(3, 1)
If strTL = Ch Or strTC = Ch Then IsWinner = True
End Function
Function IsEnd() As Boolean
Dim i As Byte, j As Byte
For i = LBound(Lines, 1) To UBound(Lines, 1)
For j = LBound(Lines, 2) To UBound(Lines, 2)
If Lines(i, j) = "#" Then Exit Function
Next j
Next i
IsEnd = True
End Function
|
Produce a functionally identical Go code for the snippet given in C++. | #include <iostream>
void bitwise(int a, int b)
{
std::cout << "a and b: " << (a & b) << '\n';
std::cout << "a or b: " << (a | b) << '\n';
std::cout << "a xor b: " << (a ^ b) << '\n';
std::cout << "not a: " << ~a << '\n';
std::cout << "a shl b: " << (a << b) << '\n';
std::cout << "a shr b: " << (a >> b) << '\n';
unsigned int ua = a;
std::cout << "a lsr b: " << (ua >> b) << '\n';
std::cout << "a rol b: " << std::rotl(ua, b) << '\n';
std::cout << "a ror b: " << std::rotr(ua, b) << '\n';
}
| package main
import "fmt"
func bitwise(a, b int16) {
fmt.Printf("a: %016b\n", uint16(a))
fmt.Printf("b: %016b\n", uint16(b))
fmt.Printf("and: %016b\n", uint16(a&b))
fmt.Printf("or: %016b\n", uint16(a|b))
fmt.Printf("xor: %016b\n", uint16(a^b))
fmt.Printf("not: %016b\n", uint16(^a))
if b < 0 {
fmt.Println("Right operand is negative, but all shifts require an unsigned right operand (shift distance).")
return
}
ua := uint16(a)
ub := uint32(b)
fmt.Printf("shl: %016b\n", uint16(ua<<ub))
fmt.Printf("shr: %016b\n", uint16(ua>>ub))
fmt.Printf("las: %016b\n", uint16(a<<ub))
fmt.Printf("ras: %016b\n", uint16(a>>ub))
fmt.Printf("rol: %016b\n", uint16(a<<ub|int16(uint16(a)>>(16-ub))))
fmt.Printf("ror: %016b\n", uint16(int16(uint16(a)>>ub)|a<<(16-ub)))
}
func main() {
var a, b int16 = -460, 6
bitwise(a, b)
}
|
Write the same code in Go as shown below in C++. | #include <windows.h>
#include <iostream>
using namespace std;
const int BMP_SIZE = 800, NORTH = 1, EAST = 2, SOUTH = 4, WEST = 8, LEN = 1;
class myBitmap
{
public:
myBitmap() : pen( NULL ), brush( NULL ), clr( 0 ), wid( 1 ) {}
~myBitmap()
{
DeleteObject( pen ); DeleteObject( brush );
DeleteDC( hdc ); DeleteObject( bmp );
}
bool create( int w, int h )
{
BITMAPINFO bi;
ZeroMemory( &bi, sizeof( bi ) );
bi.bmiHeader.biSize = sizeof( bi.bmiHeader );
bi.bmiHeader.biBitCount = sizeof( DWORD ) * 8;
bi.bmiHeader.biCompression = BI_RGB;
bi.bmiHeader.biPlanes = 1;
bi.bmiHeader.biWidth = w;
bi.bmiHeader.biHeight = -h;
HDC dc = GetDC( GetConsoleWindow() );
bmp = CreateDIBSection( dc, &bi, DIB_RGB_COLORS, &pBits, NULL, 0 );
if( !bmp ) return false;
hdc = CreateCompatibleDC( dc );
SelectObject( hdc, bmp );
ReleaseDC( GetConsoleWindow(), dc );
width = w; height = h;
return true;
}
void clear( BYTE clr = 0 )
{
memset( pBits, clr, width * height * sizeof( DWORD ) );
}
void setBrushColor( DWORD bClr )
{
if( brush ) DeleteObject( brush );
brush = CreateSolidBrush( bClr );
SelectObject( hdc, brush );
}
void setPenColor( DWORD c )
{
clr = c; createPen();
}
void setPenWidth( int w )
{
wid = w; createPen();
}
void saveBitmap( string path )
{
BITMAPFILEHEADER fileheader;
BITMAPINFO infoheader;
BITMAP bitmap;
DWORD wb;
GetObject( bmp, sizeof( bitmap ), &bitmap );
DWORD* dwpBits = new DWORD[bitmap.bmWidth * bitmap.bmHeight];
ZeroMemory( dwpBits, bitmap.bmWidth * bitmap.bmHeight * sizeof( DWORD ) );
ZeroMemory( &infoheader, sizeof( BITMAPINFO ) );
ZeroMemory( &fileheader, sizeof( BITMAPFILEHEADER ) );
infoheader.bmiHeader.biBitCount = sizeof( DWORD ) * 8;
infoheader.bmiHeader.biCompression = BI_RGB;
infoheader.bmiHeader.biPlanes = 1;
infoheader.bmiHeader.biSize = sizeof( infoheader.bmiHeader );
infoheader.bmiHeader.biHeight = bitmap.bmHeight;
infoheader.bmiHeader.biWidth = bitmap.bmWidth;
infoheader.bmiHeader.biSizeImage = bitmap.bmWidth * bitmap.bmHeight * sizeof( DWORD );
fileheader.bfType = 0x4D42;
fileheader.bfOffBits = sizeof( infoheader.bmiHeader ) + sizeof( BITMAPFILEHEADER );
fileheader.bfSize = fileheader.bfOffBits + infoheader.bmiHeader.biSizeImage;
GetDIBits( hdc, bmp, 0, height, ( LPVOID )dwpBits, &infoheader, DIB_RGB_COLORS );
HANDLE file = CreateFile( path.c_str(), GENERIC_WRITE, 0, NULL, CREATE_ALWAYS, FILE_ATTRIBUTE_NORMAL, NULL );
WriteFile( file, &fileheader, sizeof( BITMAPFILEHEADER ), &wb, NULL );
WriteFile( file, &infoheader.bmiHeader, sizeof( infoheader.bmiHeader ), &wb, NULL );
WriteFile( file, dwpBits, bitmap.bmWidth * bitmap.bmHeight * 4, &wb, NULL );
CloseHandle( file );
delete [] dwpBits;
}
HDC getDC() const { return hdc; }
int getWidth() const { return width; }
int getHeight() const { return height; }
private:
void createPen()
{
if( pen ) DeleteObject( pen );
pen = CreatePen( PS_SOLID, wid, clr );
SelectObject( hdc, pen );
}
HBITMAP bmp;
HDC hdc;
HPEN pen;
HBRUSH brush;
void *pBits;
int width, height, wid;
DWORD clr;
};
class dragonC
{
public:
dragonC() { bmp.create( BMP_SIZE, BMP_SIZE ); dir = WEST; }
void draw( int iterations ) { generate( iterations ); draw(); }
private:
void generate( int it )
{
generator.push_back( 1 );
string temp;
for( int y = 0; y < it - 1; y++ )
{
temp = generator; temp.push_back( 1 );
for( string::reverse_iterator x = generator.rbegin(); x != generator.rend(); x++ )
temp.push_back( !( *x ) );
generator = temp;
}
}
void draw()
{
HDC dc = bmp.getDC();
unsigned int clr[] = { 0xff, 0xff00, 0xff0000, 0x00ffff };
int mov[] = { 0, 0, 1, -1, 1, -1, 1, 0 }; int i = 0;
for( int t = 0; t < 4; t++ )
{
int a = BMP_SIZE / 2, b = a; a += mov[i++]; b += mov[i++];
MoveToEx( dc, a, b, NULL );
bmp.setPenColor( clr[t] );
for( string::iterator x = generator.begin(); x < generator.end(); x++ )
{
switch( dir )
{
case NORTH:
if( *x ) { a += LEN; dir = EAST; }
else { a -= LEN; dir = WEST; }
break;
case EAST:
if( *x ) { b += LEN; dir = SOUTH; }
else { b -= LEN; dir = NORTH; }
break;
case SOUTH:
if( *x ) { a -= LEN; dir = WEST; }
else { a += LEN; dir = EAST; }
break;
case WEST:
if( *x ) { b -= LEN; dir = NORTH; }
else { b += LEN; dir = SOUTH; }
}
LineTo( dc, a, b );
}
}
bmp.saveBitmap( "f:/rc/dragonCpp.bmp" );
}
int dir;
myBitmap bmp;
string generator;
};
int main( int argc, char* argv[] )
{
dragonC d; d.draw( 17 );
return system( "pause" );
}
| package main
import (
"fmt"
"image"
"image/color"
"image/draw"
"image/png"
"math"
"os"
)
const sep = 512
const depth = 14
var s = math.Sqrt2 / 2
var sin = []float64{0, s, 1, s, 0, -s, -1, -s}
var cos = []float64{1, s, 0, -s, -1, -s, 0, s}
var p = color.NRGBA{64, 192, 96, 255}
var b *image.NRGBA
func main() {
width := sep * 11 / 6
height := sep * 4 / 3
bounds := image.Rect(0, 0, width, height)
b = image.NewNRGBA(bounds)
draw.Draw(b, bounds, image.NewUniform(color.White), image.ZP, draw.Src)
dragon(14, 0, 1, sep, sep/2, sep*5/6)
f, err := os.Create("dragon.png")
if err != nil {
fmt.Println(err)
return
}
if err = png.Encode(f, b); err != nil {
fmt.Println(err)
}
if err = f.Close(); err != nil {
fmt.Println(err)
}
}
func dragon(n, a, t int, d, x, y float64) {
if n <= 1 {
x1 := int(x + .5)
y1 := int(y + .5)
x2 := int(x + d*cos[a] + .5)
y2 := int(y + d*sin[a] + .5)
xInc := 1
if x1 > x2 {
xInc = -1
}
yInc := 1
if y1 > y2 {
yInc = -1
}
for x, y := x1, y1; ; x, y = x+xInc, y+yInc {
b.Set(x, y, p)
if x == x2 {
break
}
}
return
}
d *= s
a1 := (a - t) & 7
a2 := (a + t) & 7
dragon(n-1, a1, 1, d, x, y)
dragon(n-1, a2, -1, d, x+d*cos[a1], y+d*sin[a1])
}
|
Ensure the translated Go code behaves exactly like the original C++ snippet. | #include <fstream>
#include <string>
#include <iostream>
int main( int argc , char** argv ) {
int linecount = 0 ;
std::string line ;
std::ifstream infile( argv[ 1 ] ) ;
if ( infile ) {
while ( getline( infile , line ) ) {
std::cout << linecount << ": "
<< line << '\n' ;
linecount++ ;
}
}
infile.close( ) ;
return 0 ;
}
| package main
import (
"bufio"
"fmt"
"log"
"os"
)
func init() {
log.SetFlags(log.Lshortfile)
}
func main() {
inputFile, err := os.Open("byline.go")
if err != nil {
log.Fatal("Error opening input file:", err)
}
defer inputFile.Close()
scanner := bufio.NewScanner(inputFile)
for scanner.Scan() {
fmt.Println(scanner.Text())
}
if err := scanner.Err(); err != nil {
log.Fatal(scanner.Err())
}
}
|
Port the following code from C++ to Go with equivalent syntax and logic. | template <typename T>
void insert_after(Node<T>* N, T&& data)
{
auto node = new Node<T>{N, N->next, std::forward(data)};
if(N->next != nullptr)
N->next->prev = node;
N->next = node;
}
| package main
import "fmt"
type dlNode struct {
string
next, prev *dlNode
}
type dlList struct {
head, tail *dlNode
}
func (list *dlList) String() string {
if list.head == nil {
return fmt.Sprint(list.head)
}
r := "[" + list.head.string
for p := list.head.next; p != nil; p = p.next {
r += " " + p.string
}
return r + "]"
}
func (list *dlList) insertTail(node *dlNode) {
if list.tail == nil {
list.head = node
} else {
list.tail.next = node
}
node.next = nil
node.prev = list.tail
list.tail = node
}
func (list *dlList) insertAfter(existing, insert *dlNode) {
insert.prev = existing
insert.next = existing.next
existing.next.prev = insert
existing.next = insert
if existing == list.tail {
list.tail = insert
}
}
func main() {
dll := &dlList{}
fmt.Println(dll)
a := &dlNode{string: "A"}
dll.insertTail(a)
dll.insertTail(&dlNode{string: "B"})
fmt.Println(dll)
dll.insertAfter(a, &dlNode{string: "C"})
fmt.Println(dll)
}
|
Change the following C++ code into Go without altering its purpose. | #include <iostream>
#include <cstdint>
using integer = uint32_t;
integer next_prime_digit_number(integer n) {
if (n == 0)
return 2;
switch (n % 10) {
case 2:
return n + 1;
case 3:
case 5:
return n + 2;
default:
return 2 + next_prime_digit_number(n/10) * 10;
}
}
bool is_prime(integer n) {
if (n < 2)
return false;
if (n % 2 == 0)
return n == 2;
if (n % 3 == 0)
return n == 3;
if (n % 5 == 0)
return n == 5;
constexpr integer wheel[] = { 4,2,4,2,4,6,2,6 };
integer p = 7;
for (;;) {
for (integer w : wheel) {
if (p * p > n)
return true;
if (n % p == 0)
return false;
p += w;
}
}
}
int main() {
std::cout.imbue(std::locale(""));
const integer limit = 1000000000;
integer n = 0, max = 0;
std::cout << "First 25 SPDS primes:\n";
for (int i = 0; n < limit; ) {
n = next_prime_digit_number(n);
if (!is_prime(n))
continue;
if (i < 25) {
if (i > 0)
std::cout << ' ';
std::cout << n;
}
else if (i == 25)
std::cout << '\n';
++i;
if (i == 100)
std::cout << "Hundredth SPDS prime: " << n << '\n';
else if (i == 1000)
std::cout << "Thousandth SPDS prime: " << n << '\n';
else if (i == 10000)
std::cout << "Ten thousandth SPDS prime: " << n << '\n';
max = n;
}
std::cout << "Largest SPDS prime less than " << limit << ": " << max << '\n';
return 0;
}
| package main
import (
"fmt"
"math/big"
)
var b = new(big.Int)
func isSPDSPrime(n uint64) bool {
nn := n
for nn > 0 {
r := nn % 10
if r != 2 && r != 3 && r != 5 && r != 7 {
return false
}
nn /= 10
}
b.SetUint64(n)
if b.ProbablyPrime(0) {
return true
}
return false
}
func listSPDSPrimes(startFrom, countFrom, countTo uint64, printOne bool) uint64 {
count := countFrom
for n := startFrom; ; n += 2 {
if isSPDSPrime(n) {
count++
if !printOne {
fmt.Printf("%2d. %d\n", count, n)
}
if count == countTo {
if printOne {
fmt.Println(n)
}
return n
}
}
}
}
func main() {
fmt.Println("The first 25 terms of the Smarandache prime-digital sequence are:")
fmt.Println(" 1. 2")
n := listSPDSPrimes(3, 1, 25, false)
fmt.Println("\nHigher terms:")
indices := []uint64{25, 100, 200, 500, 1000, 2000, 5000, 10000, 20000, 50000, 100000}
for i := 1; i < len(indices); i++ {
fmt.Printf("%6d. ", indices[i])
n = listSPDSPrimes(n+2, indices[i-1], indices[i], true)
}
}
|
Change the following C++ code into Go without altering its purpose. | #include <algorithm>
#include <iostream>
int main() {
for (int i = 0; i < 10; i++) {
int a[] = {9, 8, 7, 6, 5, 0, 1, 2, 3, 4};
std::nth_element(a, a + i, a + sizeof(a)/sizeof(*a));
std::cout << a[i];
if (i < 9) std::cout << ", ";
}
std::cout << std::endl;
return 0;
}
| package main
import "fmt"
func quickselect(list []int, k int) int {
for {
px := len(list) / 2
pv := list[px]
last := len(list) - 1
list[px], list[last] = list[last], list[px]
i := 0
for j := 0; j < last; j++ {
if list[j] < pv {
list[i], list[j] = list[j], list[i]
i++
}
}
if i == k {
return pv
}
if k < i {
list = list[:i]
} else {
list[i], list[last] = list[last], list[i]
list = list[i+1:]
k -= i + 1
}
}
}
func main() {
for i := 0; ; i++ {
v := []int{9, 8, 7, 6, 5, 0, 1, 2, 3, 4}
if i == len(v) {
return
}
fmt.Println(quickselect(v, i))
}
}
|
Preserve the algorithm and functionality while converting the code from C++ to Go. | #include <algorithm>
#include <iostream>
int main() {
for (int i = 0; i < 10; i++) {
int a[] = {9, 8, 7, 6, 5, 0, 1, 2, 3, 4};
std::nth_element(a, a + i, a + sizeof(a)/sizeof(*a));
std::cout << a[i];
if (i < 9) std::cout << ", ";
}
std::cout << std::endl;
return 0;
}
| package main
import "fmt"
func quickselect(list []int, k int) int {
for {
px := len(list) / 2
pv := list[px]
last := len(list) - 1
list[px], list[last] = list[last], list[px]
i := 0
for j := 0; j < last; j++ {
if list[j] < pv {
list[i], list[j] = list[j], list[i]
i++
}
}
if i == k {
return pv
}
if k < i {
list = list[:i]
} else {
list[i], list[last] = list[last], list[i]
list = list[i+1:]
k -= i + 1
}
}
}
func main() {
for i := 0; ; i++ {
v := []int{9, 8, 7, 6, 5, 0, 1, 2, 3, 4}
if i == len(v) {
return
}
fmt.Println(quickselect(v, i))
}
}
|
Preserve the algorithm and functionality while converting the code from C++ to Go. | #include <string>
#include <cstdlib>
#include <algorithm>
#include <cassert>
std::string const digits = "0123456789abcdefghijklmnopqrstuvwxyz";
std::string to_base(unsigned long num, int base)
{
if (num == 0)
return "0";
std::string result;
while (num > 0) {
std::ldiv_t temp = std::div(num, (long)base);
result += digits[temp.rem];
num = temp.quot;
}
std::reverse(result.begin(), result.end());
return result;
}
unsigned long from_base(std::string const& num_str, int base)
{
unsigned long result = 0;
for (std::string::size_type pos = 0; pos < num_str.length(); ++pos)
result = result * base + digits.find(num_str[pos]);
return result;
}
| package main
import (
"fmt"
"math/big"
"strconv"
)
func main () {
s := strconv.FormatInt(26, 16)
fmt.Println(s)
i, err := strconv.ParseInt("1a", 16, 64)
if err == nil {
fmt.Println(i)
}
b, ok := new(big.Int).SetString("1a", 16)
if ok {
fmt.Println(b)
}
}
|
Transform the following C++ implementation into Go, maintaining the same output and logic. | #include "boost/filesystem.hpp"
#include "boost/regex.hpp"
#include <iostream>
using namespace boost::filesystem;
int main()
{
path current_dir(".");
boost::regex pattern("a.*");
for (recursive_directory_iterator iter(current_dir), end;
iter != end;
++iter)
{
std::string name = iter->path().filename().string();
if (regex_match(name, pattern))
std::cout << iter->path() << "\n";
}
}
| package main
import (
"fmt"
"os"
"path/filepath"
)
func VisitFile(fp string, fi os.FileInfo, err error) error {
if err != nil {
fmt.Println(err)
return nil
}
if fi.IsDir() {
return nil
}
matched, err := filepath.Match("*.mp3", fi.Name())
if err != nil {
fmt.Println(err)
return err
}
if matched {
fmt.Println(fp)
}
return nil
}
func main() {
filepath.Walk("/", VisitFile)
}
|
Generate a Go translation of this C++ snippet without changing its computational steps. | UINT_64 TGost::SWAP32(UINT_32 N1, UINT_32 N2)
{
UINT_64 N;
N = N1;
N = (N<<32)|N2;
return UINT_64(N);
}
UINT_32 TGost::ReplaceBlock(UINT_32 x)
{
register i;
UINT_32 res = 0UL;
for(i=7;i>=0;i--)
{
ui4_0 = x>>(i*4);
ui4_0 = BS[ui4_0][i];
res = (res<<4)|ui4_0;
}
return res;
}
UINT_64 TGost::MainStep(UINT_64 N,UINT_32 X)
{
UINT_32 N1,N2,S=0UL;
N1=UINT_32(N);
N2=N>>32;
S = N1 + X % 0x4000000000000;
S = ReplaceBlock(S);
S = (S<<11)|(S>>21);
S ^= N2;
N2 = N1;
N1 = S;
return SWAP32(N2,N1);
}
| package main
import "fmt"
type sBox [8][16]byte
type gost struct {
k87, k65, k43, k21 [256]byte
enc []byte
}
func newGost(s *sBox) *gost {
var g gost
for i := range g.k87 {
g.k87[i] = s[7][i>>4]<<4 | s[6][i&15]
g.k65[i] = s[5][i>>4]<<4 | s[4][i&15]
g.k43[i] = s[3][i>>4]<<4 | s[2][i&15]
g.k21[i] = s[1][i>>4]<<4 | s[0][i&15]
}
g.enc = make([]byte, 8)
return &g
}
func (g *gost) f(x uint32) uint32 {
x = uint32(g.k87[x>>24&255])<<24 | uint32(g.k65[x>>16&255])<<16 |
uint32(g.k43[x>>8&255])<<8 | uint32(g.k21[x&255])
return x<<11 | x>>(32-11)
}
var cbrf = sBox{
{4, 10, 9, 2, 13, 8, 0, 14, 6, 11, 1, 12, 7, 15, 5, 3},
{14, 11, 4, 12, 6, 13, 15, 10, 2, 3, 8, 1, 0, 7, 5, 9},
{5, 8, 1, 13, 10, 3, 4, 2, 14, 15, 12, 7, 6, 0, 9, 11},
{7, 13, 10, 1, 0, 8, 9, 15, 14, 4, 6, 12, 11, 2, 5, 3},
{6, 12, 7, 1, 5, 15, 13, 8, 4, 10, 9, 14, 0, 3, 11, 2},
{4, 11, 10, 0, 7, 2, 1, 13, 3, 6, 8, 5, 9, 12, 15, 14},
{13, 11, 4, 1, 3, 15, 5, 9, 0, 10, 14, 7, 6, 8, 2, 12},
{1, 15, 13, 0, 5, 7, 10, 4, 9, 2, 3, 14, 6, 11, 8, 12},
}
func u32(b []byte) uint32 {
return uint32(b[0]) | uint32(b[1])<<8 | uint32(b[2])<<16 | uint32(b[3])<<24
}
func b4(u uint32, b []byte) {
b[0] = byte(u)
b[1] = byte(u >> 8)
b[2] = byte(u >> 16)
b[3] = byte(u >> 24)
}
func (g *gost) mainStep(input []byte, key []byte) {
key32 := u32(key)
input1 := u32(input[:4])
input2 := u32(input[4:])
b4(g.f(key32+input1)^input2, g.enc[:4])
copy(g.enc[4:], input[:4])
}
func main() {
input := []byte{0x21, 0x04, 0x3B, 0x04, 0x30, 0x04, 0x32, 0x04}
key := []byte{0xF9, 0x04, 0xC1, 0xE2}
g := newGost(&cbrf)
g.mainStep(input, key)
for _, b := range g.enc {
fmt.Printf("[%02x]", b)
}
fmt.Println()
}
|
Ensure the translated Go code behaves exactly like the original C++ snippet. | #include <algorithm>
#include <iostream>
#include <string>
#include <array>
#include <vector>
template<typename T>
T unique(T&& src)
{
T retval(std::move(src));
std::sort(retval.begin(), retval.end(), std::less<typename T::value_type>());
retval.erase(std::unique(retval.begin(), retval.end()), retval.end());
return retval;
}
#define USE_FAKES 1
auto states = unique(std::vector<std::string>({
#if USE_FAKES
"Slender Dragon", "Abalamara",
#endif
"Alabama", "Alaska", "Arizona", "Arkansas",
"California", "Colorado", "Connecticut",
"Delaware",
"Florida", "Georgia", "Hawaii",
"Idaho", "Illinois", "Indiana", "Iowa",
"Kansas", "Kentucky", "Louisiana",
"Maine", "Maryland", "Massachusetts", "Michigan",
"Minnesota", "Mississippi", "Missouri", "Montana",
"Nebraska", "Nevada", "New Hampshire", "New Jersey",
"New Mexico", "New York", "North Carolina", "North Dakota",
"Ohio", "Oklahoma", "Oregon",
"Pennsylvania", "Rhode Island",
"South Carolina", "South Dakota", "Tennessee", "Texas",
"Utah", "Vermont", "Virginia",
"Washington", "West Virginia", "Wisconsin", "Wyoming"
}));
struct counted_pair
{
std::string name;
std::array<int, 26> count{};
void count_characters(const std::string& s)
{
for (auto&& c : s) {
if (c >= 'a' && c <= 'z') count[c - 'a']++;
if (c >= 'A' && c <= 'Z') count[c - 'A']++;
}
}
counted_pair(const std::string& s1, const std::string& s2)
: name(s1 + " + " + s2)
{
count_characters(s1);
count_characters(s2);
}
};
bool operator<(const counted_pair& lhs, const counted_pair& rhs)
{
auto lhs_size = lhs.name.size();
auto rhs_size = rhs.name.size();
return lhs_size == rhs_size
? std::lexicographical_compare(lhs.count.begin(),
lhs.count.end(),
rhs.count.begin(),
rhs.count.end())
: lhs_size < rhs_size;
}
bool operator==(const counted_pair& lhs, const counted_pair& rhs)
{
return lhs.name.size() == rhs.name.size() && lhs.count == rhs.count;
}
int main()
{
const int n_states = states.size();
std::vector<counted_pair> pairs;
for (int i = 0; i < n_states; i++) {
for (int j = 0; j < i; j++) {
pairs.emplace_back(counted_pair(states[i], states[j]));
}
}
std::sort(pairs.begin(), pairs.end());
auto start = pairs.begin();
while (true) {
auto match = std::adjacent_find(start, pairs.end());
if (match == pairs.end()) {
break;
}
auto next = match + 1;
std::cout << match->name << " => " << next->name << "\n";
start = next;
}
}
| package main
import (
"fmt"
"unicode"
)
var states = []string{"Alabama", "Alaska", "Arizona", "Arkansas",
"California", "Colorado", "Connecticut",
"Delaware",
"Florida", "Georgia", "Hawaii",
"Idaho", "Illinois", "Indiana", "Iowa",
"Kansas", "Kentucky", "Louisiana",
"Maine", "Maryland", "Massachusetts", "Michigan",
"Minnesota", "Mississippi", "Missouri", "Montana",
"Nebraska", "Nevada", "New Hampshire", "New Jersey",
"New Mexico", "New York", "North Carolina", "North Dakota",
"Ohio", "Oklahoma", "Oregon",
"Pennsylvania", "Rhode Island",
"South Carolina", "South Dakota", "Tennessee", "Texas",
"Utah", "Vermont", "Virginia",
"Washington", "West Virginia", "Wisconsin", "Wyoming"}
func main() {
play(states)
play(append(states,
"New Kory", "Wen Kory", "York New", "Kory New", "New Kory"))
}
func play(states []string) {
fmt.Println(len(states), "states:")
set := make(map[string]bool, len(states))
for _, s := range states {
set[s] = true
}
s := make([]string, len(set))
h := make([][26]byte, len(set))
var i int
for us := range set {
s[i] = us
for _, c := range us {
if u := uint(unicode.ToLower(c)) - 'a'; u < 26 {
h[i][u]++
}
}
i++
}
type pair struct {
i1, i2 int
}
m := make(map[string][]pair)
b := make([]byte, 26)
for i1, h1 := range h {
for i2 := i1 + 1; i2 < len(h); i2++ {
for i := range b {
b[i] = h1[i] + h[i2][i]
}
k := string(b)
for _, x := range m[k] {
if i1 != x.i1 && i1 != x.i2 && i2 != x.i1 && i2 != x.i2 {
fmt.Printf("%s, %s = %s, %s\n", s[i1], s[i2],
s[x.i1], s[x.i2])
}
}
m[k] = append(m[k], pair{i1, i2})
}
}
}
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.