Instruction stringlengths 45 106 | input_code stringlengths 1 13.7k | output_code stringlengths 1 13.7k |
|---|---|---|
Write the same algorithm in Go as shown in this C++ implementation. | #include <algorithm>
#include <array>
#include <cstdint>
#include <numeric>
#include <iomanip>
#include <iostream>
#include <string>
std::array<std::uint_fast32_t, 256> generate_crc_lookup_table() noexcept
{
auto const reversed_polynomial = std::uint_fast32_t{0xEDB88320uL};
struct byte_checksum
{
std::uint_fast32_t operator()() noexcept
{
auto checksum = static_cast<std::uint_fast32_t>(n++);
for (auto i = 0; i < 8; ++i)
checksum = (checksum >> 1) ^ ((checksum & 0x1u) ? reversed_polynomial : 0);
return checksum;
}
unsigned n = 0;
};
auto table = std::array<std::uint_fast32_t, 256>{};
std::generate(table.begin(), table.end(), byte_checksum{});
return table;
}
template <typename InputIterator>
std::uint_fast32_t crc(InputIterator first, InputIterator last)
{
static auto const table = generate_crc_lookup_table();
return std::uint_fast32_t{0xFFFFFFFFuL} &
~std::accumulate(first, last,
~std::uint_fast32_t{0} & std::uint_fast32_t{0xFFFFFFFFuL},
[](std::uint_fast32_t checksum, std::uint_fast8_t value)
{ return table[(checksum ^ value) & 0xFFu] ^ (checksum >> 8); });
}
int main()
{
auto const s = std::string{"The quick brown fox jumps over the lazy dog"};
std::cout << std::hex << std::setw(8) << std::setfill('0') << crc(s.begin(), s.end()) << '\n';
}
| package main
import (
"fmt"
"hash/crc32"
)
func main() {
s := []byte("The quick brown fox jumps over the lazy dog")
result := crc32.ChecksumIEEE(s)
fmt.Printf("%X\n", result)
}
|
Port the following code from C++ to Go with equivalent syntax and logic. | #include <string>
#include <boost/regex.hpp>
#include <iostream>
std::string csvToHTML( const std::string & ) ;
int main( ) {
std::string text = "Character,Speech\n"
"The multitude,The messiah! Show us the messiah!\n"
"Brians mother,<angry>Now you listen here! He's not the messiah; he's a very naughty boy! Now go away!</angry>\n"
"The multitude,Who are you?\n"
"Brians mother,I'm his mother; that's who!\n"
"The multitude,Behold his mother! Behold his mother!\n" ;
std::cout << csvToHTML( text ) ;
return 0 ;
}
std::string csvToHTML( const std::string & csvtext ) {
std::string regexes[ 5 ] = { "<" , ">" , "^(.+?)\\b" , "," , "\n" } ;
const char* replacements [ 5 ] = { "<" , ">" , " <TR><TD>$1" , "</TD><TD>", "</TD></TR>\n" } ;
boost::regex e1( regexes[ 0 ] ) ;
std::string tabletext = boost::regex_replace( csvtext , e1 ,
replacements[ 0 ] , boost::match_default | boost::format_all ) ;
for ( int i = 1 ; i < 5 ; i++ ) {
e1.assign( regexes[ i ] ) ;
tabletext = boost::regex_replace( tabletext , e1 , replacements[ i ] , boost::match_default | boost::format_all ) ;
}
tabletext = std::string( "<TABLE>\n" ) + tabletext ;
tabletext.append( "</TABLE>\n" ) ;
return tabletext ;
}
| package main
import (
"bytes"
"encoding/csv"
"fmt"
"html/template"
"strings"
)
var c = `Character,Speech
The multitude,The messiah! Show us the messiah!
Brians mother,<angry>Now you listen here! He's not the messiah; he's a very naughty boy! Now go away!</angry>
The multitude,Who are you?
Brians mother,I'm his mother; that's who!
The multitude,Behold his mother! Behold his mother!`
func main() {
if h, err := csvToHtml(c); err != nil {
fmt.Println(err)
} else {
fmt.Print(h)
}
}
func csvToHtml(c string) (string, error) {
data, err := csv.NewReader(bytes.NewBufferString(c)).ReadAll()
if err != nil {
return "", err
}
var b strings.Builder
err = template.Must(template.New("").Parse(`<table>
{{range .}} <tr>{{range .}}<td>{{.}}</td>{{end}}</tr>
{{end}}</table>
`)).Execute(&b, data)
return b.String(), err
}
|
Produce a functionally identical Go code for the snippet given in C++. | #include <string>
#include <boost/regex.hpp>
#include <iostream>
std::string csvToHTML( const std::string & ) ;
int main( ) {
std::string text = "Character,Speech\n"
"The multitude,The messiah! Show us the messiah!\n"
"Brians mother,<angry>Now you listen here! He's not the messiah; he's a very naughty boy! Now go away!</angry>\n"
"The multitude,Who are you?\n"
"Brians mother,I'm his mother; that's who!\n"
"The multitude,Behold his mother! Behold his mother!\n" ;
std::cout << csvToHTML( text ) ;
return 0 ;
}
std::string csvToHTML( const std::string & csvtext ) {
std::string regexes[ 5 ] = { "<" , ">" , "^(.+?)\\b" , "," , "\n" } ;
const char* replacements [ 5 ] = { "<" , ">" , " <TR><TD>$1" , "</TD><TD>", "</TD></TR>\n" } ;
boost::regex e1( regexes[ 0 ] ) ;
std::string tabletext = boost::regex_replace( csvtext , e1 ,
replacements[ 0 ] , boost::match_default | boost::format_all ) ;
for ( int i = 1 ; i < 5 ; i++ ) {
e1.assign( regexes[ i ] ) ;
tabletext = boost::regex_replace( tabletext , e1 , replacements[ i ] , boost::match_default | boost::format_all ) ;
}
tabletext = std::string( "<TABLE>\n" ) + tabletext ;
tabletext.append( "</TABLE>\n" ) ;
return tabletext ;
}
| package main
import (
"bytes"
"encoding/csv"
"fmt"
"html/template"
"strings"
)
var c = `Character,Speech
The multitude,The messiah! Show us the messiah!
Brians mother,<angry>Now you listen here! He's not the messiah; he's a very naughty boy! Now go away!</angry>
The multitude,Who are you?
Brians mother,I'm his mother; that's who!
The multitude,Behold his mother! Behold his mother!`
func main() {
if h, err := csvToHtml(c); err != nil {
fmt.Println(err)
} else {
fmt.Print(h)
}
}
func csvToHtml(c string) (string, error) {
data, err := csv.NewReader(bytes.NewBufferString(c)).ReadAll()
if err != nil {
return "", err
}
var b strings.Builder
err = template.Must(template.New("").Parse(`<table>
{{range .}} <tr>{{range .}}<td>{{.}}</td>{{end}}</tr>
{{end}}</table>
`)).Execute(&b, data)
return b.String(), err
}
|
Translate the given C++ code snippet into Go without altering its behavior. | PRAGMA COMPILER g++
PRAGMA OPTIONS -Wno-write-strings -Wno-pointer-arith -fpermissive
OPTION PARSE FALSE
'---The class does the declaring for you
CLASS Books
public:
const char* title;
const char* author;
const char* subject;
int book_id;
END CLASS
'---pointer to an object declaration (we use a class called Books)
DECLARE Book1 TYPE Books
'--- the correct syntax for class
Book1 = Books()
'--- initialize the strings const char* in c++
Book1.title = "C++ Programming to bacon "
Book1.author = "anyone"
Book1.subject ="RECORD Tutorial"
Book1.book_id = 1234567
PRINT "Book title : " ,Book1.title FORMAT "%s%s\n"
PRINT "Book author : ", Book1.author FORMAT "%s%s\n"
PRINT "Book subject : ", Book1.subject FORMAT "%s%s\n"
PRINT "Book book_id : ", Book1.book_id FORMAT "%s%d\n"
| package main
import "fmt"
type picnicBasket struct {
nServings int
corkscrew bool
}
func (b *picnicBasket) happy() bool {
return b.nServings > 1 && b.corkscrew
}
func newPicnicBasket(nPeople int) *picnicBasket {
return &picnicBasket{nPeople, nPeople > 0}
}
func main() {
var pb picnicBasket
pbl := picnicBasket{}
pbp := &picnicBasket{}
pbn := new(picnicBasket)
forTwo := newPicnicBasket(2)
forToo := &picnicBasket{nServings: 2, corkscrew: true}
fmt.Println(pb.nServings, pb.corkscrew)
fmt.Println(pbl.nServings, pbl.corkscrew)
fmt.Println(pbp)
fmt.Println(pbn)
fmt.Println(forTwo)
fmt.Println(forToo)
}
|
Port the provided C++ code into Go while preserving the original functionality. | #include <vector>
#include <string>
#include <iostream>
#include <sstream>
#include <algorithm>
#include <iterator>
#include <utility>
long string2long( const std::string & s ) {
long result ;
std::istringstream( s ) >> result ;
return result ;
}
bool isKaprekar( long number ) {
long long squarenumber = ((long long)number) * number ;
std::ostringstream numberbuf ;
numberbuf << squarenumber ;
std::string numberstring = numberbuf.str( ) ;
for ( int i = 0 ; i < numberstring.length( ) ; i++ ) {
std::string firstpart = numberstring.substr( 0 , i ) ,
secondpart = numberstring.substr( i ) ;
if ( secondpart.find_first_not_of( "0" ) == std::string::npos ) {
return false ;
}
if ( string2long( firstpart ) + string2long( secondpart ) == number ) {
return true ;
}
}
return false ;
}
int main( ) {
std::vector<long> kaprekarnumbers ;
kaprekarnumbers.push_back( 1 ) ;
for ( int i = 2 ; i < 1000001 ; i++ ) {
if ( isKaprekar( i ) )
kaprekarnumbers.push_back( i ) ;
}
std::vector<long>::const_iterator svi = kaprekarnumbers.begin( ) ;
std::cout << "Kaprekar numbers up to 10000: \n" ;
while ( *svi < 10000 ) {
std::cout << *svi << " " ;
svi++ ;
}
std::cout << '\n' ;
std::cout << "All the Kaprekar numbers up to 1000000 :\n" ;
std::copy( kaprekarnumbers.begin( ) , kaprekarnumbers.end( ) ,
std::ostream_iterator<long>( std::cout , "\n" ) ) ;
std::cout << "There are " << kaprekarnumbers.size( )
<< " Kaprekar numbers less than one million!\n" ;
return 0 ;
}
| package main
import (
"fmt"
"strconv"
)
func kaprekar(n uint64, base uint64) (bool, int) {
order := 0
if n == 1 {
return true, -1
}
nn, power := n*n, uint64(1)
for power <= nn {
power *= base
order++
}
power /= base
order--
for ; power > 1; power /= base {
q, r := nn/power, nn%power
if q >= n {
return false, -1
}
if q+r == n {
return true, order
}
order--
}
return false, -1
}
func main() {
max := uint64(10000)
fmt.Printf("Kaprekar numbers < %d:\n", max)
for m := uint64(0); m < max; m++ {
if is, _ := kaprekar(m, 10); is {
fmt.Println(" ", m)
}
}
max = 1e6
var count int
for m := uint64(0); m < max; m++ {
if is, _ := kaprekar(m, 10); is {
count++
}
}
fmt.Printf("\nThere are %d Kaprekar numbers < %d.\n", count, max)
const base = 17
maxB := "1000000"
fmt.Printf("\nKaprekar numbers between 1 and %s(base %d):\n", maxB, base)
max, _ = strconv.ParseUint(maxB, base, 64)
fmt.Printf("\n Base 10 Base %d Square Split\n", base)
for m := uint64(2); m < max; m++ {
is, pos := kaprekar(m, base)
if !is {
continue
}
sq := strconv.FormatUint(m*m, base)
str := strconv.FormatUint(m, base)
split := len(sq)-pos
fmt.Printf("%8d %7s %12s %6s + %s\n", m,
str, sq, sq[:split], sq[split:])
}
}
|
Translate this program into Go but keep the logic exactly as in C++. | #include <vector>
#include <string>
#include <iostream>
#include <sstream>
#include <algorithm>
#include <iterator>
#include <utility>
long string2long( const std::string & s ) {
long result ;
std::istringstream( s ) >> result ;
return result ;
}
bool isKaprekar( long number ) {
long long squarenumber = ((long long)number) * number ;
std::ostringstream numberbuf ;
numberbuf << squarenumber ;
std::string numberstring = numberbuf.str( ) ;
for ( int i = 0 ; i < numberstring.length( ) ; i++ ) {
std::string firstpart = numberstring.substr( 0 , i ) ,
secondpart = numberstring.substr( i ) ;
if ( secondpart.find_first_not_of( "0" ) == std::string::npos ) {
return false ;
}
if ( string2long( firstpart ) + string2long( secondpart ) == number ) {
return true ;
}
}
return false ;
}
int main( ) {
std::vector<long> kaprekarnumbers ;
kaprekarnumbers.push_back( 1 ) ;
for ( int i = 2 ; i < 1000001 ; i++ ) {
if ( isKaprekar( i ) )
kaprekarnumbers.push_back( i ) ;
}
std::vector<long>::const_iterator svi = kaprekarnumbers.begin( ) ;
std::cout << "Kaprekar numbers up to 10000: \n" ;
while ( *svi < 10000 ) {
std::cout << *svi << " " ;
svi++ ;
}
std::cout << '\n' ;
std::cout << "All the Kaprekar numbers up to 1000000 :\n" ;
std::copy( kaprekarnumbers.begin( ) , kaprekarnumbers.end( ) ,
std::ostream_iterator<long>( std::cout , "\n" ) ) ;
std::cout << "There are " << kaprekarnumbers.size( )
<< " Kaprekar numbers less than one million!\n" ;
return 0 ;
}
| package main
import (
"fmt"
"strconv"
)
func kaprekar(n uint64, base uint64) (bool, int) {
order := 0
if n == 1 {
return true, -1
}
nn, power := n*n, uint64(1)
for power <= nn {
power *= base
order++
}
power /= base
order--
for ; power > 1; power /= base {
q, r := nn/power, nn%power
if q >= n {
return false, -1
}
if q+r == n {
return true, order
}
order--
}
return false, -1
}
func main() {
max := uint64(10000)
fmt.Printf("Kaprekar numbers < %d:\n", max)
for m := uint64(0); m < max; m++ {
if is, _ := kaprekar(m, 10); is {
fmt.Println(" ", m)
}
}
max = 1e6
var count int
for m := uint64(0); m < max; m++ {
if is, _ := kaprekar(m, 10); is {
count++
}
}
fmt.Printf("\nThere are %d Kaprekar numbers < %d.\n", count, max)
const base = 17
maxB := "1000000"
fmt.Printf("\nKaprekar numbers between 1 and %s(base %d):\n", maxB, base)
max, _ = strconv.ParseUint(maxB, base, 64)
fmt.Printf("\n Base 10 Base %d Square Split\n", base)
for m := uint64(2); m < max; m++ {
is, pos := kaprekar(m, base)
if !is {
continue
}
sq := strconv.FormatUint(m*m, base)
str := strconv.FormatUint(m, base)
split := len(sq)-pos
fmt.Printf("%8d %7s %12s %6s + %s\n", m,
str, sq, sq[:split], sq[split:])
}
}
|
Translate the given C++ code snippet into Go without altering its behavior. | #include <string>
#include <map>
template <typename Iterator>
Iterator compress(const std::string &uncompressed, Iterator result) {
int dictSize = 256;
std::map<std::string,int> dictionary;
for (int i = 0; i < 256; i++)
dictionary[std::string(1, i)] = i;
std::string w;
for (std::string::const_iterator it = uncompressed.begin();
it != uncompressed.end(); ++it) {
char c = *it;
std::string wc = w + c;
if (dictionary.count(wc))
w = wc;
else {
*result++ = dictionary[w];
dictionary[wc] = dictSize++;
w = std::string(1, c);
}
}
if (!w.empty())
*result++ = dictionary[w];
return result;
}
template <typename Iterator>
std::string decompress(Iterator begin, Iterator end) {
int dictSize = 256;
std::map<int,std::string> dictionary;
for (int i = 0; i < 256; i++)
dictionary[i] = std::string(1, i);
std::string w(1, *begin++);
std::string result = w;
std::string entry;
for ( ; begin != end; begin++) {
int k = *begin;
if (dictionary.count(k))
entry = dictionary[k];
else if (k == dictSize)
entry = w + w[0];
else
throw "Bad compressed k";
result += entry;
dictionary[dictSize++] = w + entry[0];
w = entry;
}
return result;
}
#include <iostream>
#include <iterator>
#include <vector>
int main() {
std::vector<int> compressed;
compress("TOBEORNOTTOBEORTOBEORNOT", std::back_inserter(compressed));
copy(compressed.begin(), compressed.end(), std::ostream_iterator<int>(std::cout, ", "));
std::cout << std::endl;
std::string decompressed = decompress(compressed.begin(), compressed.end());
std::cout << decompressed << std::endl;
return 0;
}
| package main
import (
"fmt"
"log"
"strings"
)
func compress(uncompressed string) []int {
dictSize := 256
dictionary := make(map[string]int, dictSize)
for i := 0; i < dictSize; i++ {
dictionary[string([]byte{byte(i)})] = i
}
var result []int
var w []byte
for i := 0; i < len(uncompressed); i++ {
c := uncompressed[i]
wc := append(w, c)
if _, ok := dictionary[string(wc)]; ok {
w = wc
} else {
result = append(result, dictionary[string(w)])
dictionary[string(wc)] = dictSize
dictSize++
wc[0] = c
w = wc[:1]
}
}
if len(w) > 0 {
result = append(result, dictionary[string(w)])
}
return result
}
type BadSymbolError int
func (e BadSymbolError) Error() string {
return fmt.Sprint("Bad compressed symbol ", int(e))
}
func decompress(compressed []int) (string, error) {
dictSize := 256
dictionary := make(map[int][]byte, dictSize)
for i := 0; i < dictSize; i++ {
dictionary[i] = []byte{byte(i)}
}
var result strings.Builder
var w []byte
for _, k := range compressed {
var entry []byte
if x, ok := dictionary[k]; ok {
entry = x[:len(x):len(x)]
} else if k == dictSize && len(w) > 0 {
entry = append(w, w[0])
} else {
return result.String(), BadSymbolError(k)
}
result.Write(entry)
if len(w) > 0 {
w = append(w, entry[0])
dictionary[dictSize] = w
dictSize++
}
w = entry
}
return result.String(), nil
}
func main() {
compressed := compress("TOBEORNOTTOBEORTOBEORNOT")
fmt.Println(compressed)
decompressed, err := decompress(compressed)
if err != nil {
log.Fatal(err)
}
fmt.Println(decompressed)
}
|
Convert the following code from C++ to Go, ensuring the logic remains intact. | #include <iomanip>
#include <iostream>
#include <set>
#include <vector>
using namespace std;
unsigned hofstadter(unsigned rlistSize, unsigned slistSize)
{
auto n = rlistSize > slistSize ? rlistSize : slistSize;
auto rlist = new vector<unsigned> { 1, 3, 7 };
auto slist = new vector<unsigned> { 2, 4, 5, 6 };
auto list = rlistSize > 0 ? rlist : slist;
auto target_size = rlistSize > 0 ? rlistSize : slistSize;
while (list->size() > target_size) list->pop_back();
while (list->size() < target_size)
{
auto lastIndex = rlist->size() - 1;
auto lastr = (*rlist)[lastIndex];
auto r = lastr + (*slist)[lastIndex];
rlist->push_back(r);
for (auto s = lastr + 1; s < r && list->size() < target_size;)
slist->push_back(s++);
}
auto v = (*list)[n - 1];
delete rlist;
delete slist;
return v;
}
ostream& operator<<(ostream& os, const set<unsigned>& s)
{
cout << '(' << s.size() << "):";
auto i = 0;
for (auto c = s.begin(); c != s.end();)
{
if (i++ % 20 == 0) os << endl;
os << setw(5) << *c++;
}
return os;
}
int main(int argc, const char* argv[])
{
const auto v1 = atoi(argv[1]);
const auto v2 = atoi(argv[2]);
set<unsigned> r, s;
for (auto n = 1; n <= v2; n++)
{
if (n <= v1)
r.insert(hofstadter(n, 0));
s.insert(hofstadter(0, n));
}
cout << "R" << r << endl;
cout << "S" << s << endl;
int m = max(*r.rbegin(), *s.rbegin());
for (auto n = 1; n <= m; n++)
if (r.count(n) == s.count(n))
clog << "integer " << n << " either in both or neither set" << endl;
return 0;
}
| package main
import "fmt"
var ffr, ffs func(int) int
func init() {
r := []int{0, 1}
s := []int{0, 2}
ffr = func(n int) int {
for len(r) <= n {
nrk := len(r) - 1
rNxt := r[nrk] + s[nrk]
r = append(r, rNxt)
for sn := r[nrk] + 2; sn < rNxt; sn++ {
s = append(s, sn)
}
s = append(s, rNxt+1)
}
return r[n]
}
ffs = func(n int) int {
for len(s) <= n {
ffr(len(r))
}
return s[n]
}
}
func main() {
for n := 1; n <= 10; n++ {
fmt.Printf("r(%d): %d\n", n, ffr(n))
}
var found [1001]int
for n := 1; n <= 40; n++ {
found[ffr(n)]++
}
for n := 1; n <= 960; n++ {
found[ffs(n)]++
}
for i := 1; i <= 1000; i++ {
if found[i] != 1 {
fmt.Println("task 4: FAIL")
return
}
}
fmt.Println("task 4: PASS")
}
|
Port the following code from C++ to Go with equivalent syntax and logic. | #include <iomanip>
#include <iostream>
#include <set>
#include <vector>
using namespace std;
unsigned hofstadter(unsigned rlistSize, unsigned slistSize)
{
auto n = rlistSize > slistSize ? rlistSize : slistSize;
auto rlist = new vector<unsigned> { 1, 3, 7 };
auto slist = new vector<unsigned> { 2, 4, 5, 6 };
auto list = rlistSize > 0 ? rlist : slist;
auto target_size = rlistSize > 0 ? rlistSize : slistSize;
while (list->size() > target_size) list->pop_back();
while (list->size() < target_size)
{
auto lastIndex = rlist->size() - 1;
auto lastr = (*rlist)[lastIndex];
auto r = lastr + (*slist)[lastIndex];
rlist->push_back(r);
for (auto s = lastr + 1; s < r && list->size() < target_size;)
slist->push_back(s++);
}
auto v = (*list)[n - 1];
delete rlist;
delete slist;
return v;
}
ostream& operator<<(ostream& os, const set<unsigned>& s)
{
cout << '(' << s.size() << "):";
auto i = 0;
for (auto c = s.begin(); c != s.end();)
{
if (i++ % 20 == 0) os << endl;
os << setw(5) << *c++;
}
return os;
}
int main(int argc, const char* argv[])
{
const auto v1 = atoi(argv[1]);
const auto v2 = atoi(argv[2]);
set<unsigned> r, s;
for (auto n = 1; n <= v2; n++)
{
if (n <= v1)
r.insert(hofstadter(n, 0));
s.insert(hofstadter(0, n));
}
cout << "R" << r << endl;
cout << "S" << s << endl;
int m = max(*r.rbegin(), *s.rbegin());
for (auto n = 1; n <= m; n++)
if (r.count(n) == s.count(n))
clog << "integer " << n << " either in both or neither set" << endl;
return 0;
}
| package main
import "fmt"
var ffr, ffs func(int) int
func init() {
r := []int{0, 1}
s := []int{0, 2}
ffr = func(n int) int {
for len(r) <= n {
nrk := len(r) - 1
rNxt := r[nrk] + s[nrk]
r = append(r, rNxt)
for sn := r[nrk] + 2; sn < rNxt; sn++ {
s = append(s, sn)
}
s = append(s, rNxt+1)
}
return r[n]
}
ffs = func(n int) int {
for len(s) <= n {
ffr(len(r))
}
return s[n]
}
}
func main() {
for n := 1; n <= 10; n++ {
fmt.Printf("r(%d): %d\n", n, ffr(n))
}
var found [1001]int
for n := 1; n <= 40; n++ {
found[ffr(n)]++
}
for n := 1; n <= 960; n++ {
found[ffs(n)]++
}
for i := 1; i <= 1000; i++ {
if found[i] != 1 {
fmt.Println("task 4: FAIL")
return
}
}
fmt.Println("task 4: PASS")
}
|
Convert the following code from C++ to Go, ensuring the logic remains intact. | #include <iostream>
#include <sstream>
#include <iomanip>
#include <cassert>
#include <vector>
using namespace std;
class MagicSquare
{
public:
MagicSquare(int d) : sqr(d*d,0), sz(d)
{
assert(d&1);
fillSqr();
}
void display()
{
cout << "Odd Magic Square: " << sz << " x " << sz << "\n";
cout << "It's Magic Sum is: " << magicNumber() << "\n\n";
ostringstream cvr;
cvr << sz * sz;
int l = cvr.str().size();
for( int y = 0; y < sz; y++ )
{
int yy = y * sz;
for( int x = 0; x < sz; x++ )
cout << setw( l + 2 ) << sqr[yy + x];
cout << "\n";
}
cout << "\n\n";
}
private:
void fillSqr()
{
int sx = sz / 2, sy = 0, c = 0;
while( c < sz * sz )
{
if( !sqr[sx + sy * sz] )
{
sqr[sx + sy * sz]= c + 1;
inc( sx ); dec( sy );
c++;
}
else
{
dec( sx ); inc( sy ); inc( sy );
}
}
}
int magicNumber()
{ return sz * ( ( sz * sz ) + 1 ) / 2; }
void inc( int& a )
{ if( ++a == sz ) a = 0; }
void dec( int& a )
{ if( --a < 0 ) a = sz - 1; }
bool checkPos( int x, int y )
{ return( isInside( x ) && isInside( y ) && !sqr[sz * y + x] ); }
bool isInside( int s )
{ return ( s < sz && s > -1 ); }
vector<int> sqr;
int sz;
};
int main()
{
MagicSquare s(7);
s.display();
return 0;
}
| package main
import (
"fmt"
"log"
)
func ms(n int) (int, []int) {
M := func(x int) int { return (x + n - 1) % n }
if n <= 0 || n&1 == 0 {
n = 5
log.Println("forcing size", n)
}
m := make([]int, n*n)
i, j := 0, n/2
for k := 1; k <= n*n; k++ {
m[i*n+j] = k
if m[M(i)*n+M(j)] != 0 {
i = (i + 1) % n
} else {
i, j = M(i), M(j)
}
}
return n, m
}
func main() {
n, m := ms(5)
i := 2
for j := 1; j <= n*n; j *= 10 {
i++
}
f := fmt.Sprintf("%%%dd", i)
for i := 0; i < n; i++ {
for j := 0; j < n; j++ {
fmt.Printf(f, m[i*n+j])
}
fmt.Println()
}
}
|
Write the same code in Go as shown below in C++. | #include <iostream>
#include <sstream>
#include <iomanip>
#include <cassert>
#include <vector>
using namespace std;
class MagicSquare
{
public:
MagicSquare(int d) : sqr(d*d,0), sz(d)
{
assert(d&1);
fillSqr();
}
void display()
{
cout << "Odd Magic Square: " << sz << " x " << sz << "\n";
cout << "It's Magic Sum is: " << magicNumber() << "\n\n";
ostringstream cvr;
cvr << sz * sz;
int l = cvr.str().size();
for( int y = 0; y < sz; y++ )
{
int yy = y * sz;
for( int x = 0; x < sz; x++ )
cout << setw( l + 2 ) << sqr[yy + x];
cout << "\n";
}
cout << "\n\n";
}
private:
void fillSqr()
{
int sx = sz / 2, sy = 0, c = 0;
while( c < sz * sz )
{
if( !sqr[sx + sy * sz] )
{
sqr[sx + sy * sz]= c + 1;
inc( sx ); dec( sy );
c++;
}
else
{
dec( sx ); inc( sy ); inc( sy );
}
}
}
int magicNumber()
{ return sz * ( ( sz * sz ) + 1 ) / 2; }
void inc( int& a )
{ if( ++a == sz ) a = 0; }
void dec( int& a )
{ if( --a < 0 ) a = sz - 1; }
bool checkPos( int x, int y )
{ return( isInside( x ) && isInside( y ) && !sqr[sz * y + x] ); }
bool isInside( int s )
{ return ( s < sz && s > -1 ); }
vector<int> sqr;
int sz;
};
int main()
{
MagicSquare s(7);
s.display();
return 0;
}
| package main
import (
"fmt"
"log"
)
func ms(n int) (int, []int) {
M := func(x int) int { return (x + n - 1) % n }
if n <= 0 || n&1 == 0 {
n = 5
log.Println("forcing size", n)
}
m := make([]int, n*n)
i, j := 0, n/2
for k := 1; k <= n*n; k++ {
m[i*n+j] = k
if m[M(i)*n+M(j)] != 0 {
i = (i + 1) % n
} else {
i, j = M(i), M(j)
}
}
return n, m
}
func main() {
n, m := ms(5)
i := 2
for j := 1; j <= n*n; j *= 10 {
i++
}
f := fmt.Sprintf("%%%dd", i)
for i := 0; i < n; i++ {
for j := 0; j < n; j++ {
fmt.Printf(f, m[i*n+j])
}
fmt.Println()
}
}
|
Convert the following code from C++ to Go, ensuring the logic remains intact. | #include <iostream>
#include <numeric>
#include <set>
template <typename integer>
class yellowstone_generator {
public:
integer next() {
n2_ = n1_;
n1_ = n_;
if (n_ < 3) {
++n_;
} else {
for (n_ = min_; !(sequence_.count(n_) == 0
&& std::gcd(n1_, n_) == 1
&& std::gcd(n2_, n_) > 1); ++n_) {}
}
sequence_.insert(n_);
for (;;) {
auto it = sequence_.find(min_);
if (it == sequence_.end())
break;
sequence_.erase(it);
++min_;
}
return n_;
}
private:
std::set<integer> sequence_;
integer min_ = 1;
integer n_ = 0;
integer n1_ = 0;
integer n2_ = 0;
};
int main() {
std::cout << "First 30 Yellowstone numbers:\n";
yellowstone_generator<unsigned int> ygen;
std::cout << ygen.next();
for (int i = 1; i < 30; ++i)
std::cout << ' ' << ygen.next();
std::cout << '\n';
return 0;
}
| package main
import (
"fmt"
"log"
"os/exec"
)
func gcd(x, y int) int {
for y != 0 {
x, y = y, x%y
}
return x
}
func yellowstone(n int) []int {
m := make(map[int]bool)
a := make([]int, n+1)
for i := 1; i < 4; i++ {
a[i] = i
m[i] = true
}
min := 4
for c := 4; c <= n; c++ {
for i := min; ; i++ {
if !m[i] && gcd(a[c-1], i) == 1 && gcd(a[c-2], i) > 1 {
a[c] = i
m[i] = true
if i == min {
min++
}
break
}
}
}
return a[1:]
}
func check(err error) {
if err != nil {
log.Fatal(err)
}
}
func main() {
x := make([]int, 100)
for i := 0; i < 100; i++ {
x[i] = i + 1
}
y := yellowstone(100)
fmt.Println("The first 30 Yellowstone numbers are:")
fmt.Println(y[:30])
g := exec.Command("gnuplot", "-persist")
w, err := g.StdinPipe()
check(err)
check(g.Start())
fmt.Fprintln(w, "unset key; plot '-'")
for i, xi := range x {
fmt.Fprintf(w, "%d %d\n", xi, y[i])
}
fmt.Fprintln(w, "e")
w.Close()
g.Wait()
}
|
Translate this program into Go but keep the logic exactly as in C++. | #include <iostream>
#include <numeric>
#include <set>
template <typename integer>
class yellowstone_generator {
public:
integer next() {
n2_ = n1_;
n1_ = n_;
if (n_ < 3) {
++n_;
} else {
for (n_ = min_; !(sequence_.count(n_) == 0
&& std::gcd(n1_, n_) == 1
&& std::gcd(n2_, n_) > 1); ++n_) {}
}
sequence_.insert(n_);
for (;;) {
auto it = sequence_.find(min_);
if (it == sequence_.end())
break;
sequence_.erase(it);
++min_;
}
return n_;
}
private:
std::set<integer> sequence_;
integer min_ = 1;
integer n_ = 0;
integer n1_ = 0;
integer n2_ = 0;
};
int main() {
std::cout << "First 30 Yellowstone numbers:\n";
yellowstone_generator<unsigned int> ygen;
std::cout << ygen.next();
for (int i = 1; i < 30; ++i)
std::cout << ' ' << ygen.next();
std::cout << '\n';
return 0;
}
| package main
import (
"fmt"
"log"
"os/exec"
)
func gcd(x, y int) int {
for y != 0 {
x, y = y, x%y
}
return x
}
func yellowstone(n int) []int {
m := make(map[int]bool)
a := make([]int, n+1)
for i := 1; i < 4; i++ {
a[i] = i
m[i] = true
}
min := 4
for c := 4; c <= n; c++ {
for i := min; ; i++ {
if !m[i] && gcd(a[c-1], i) == 1 && gcd(a[c-2], i) > 1 {
a[c] = i
m[i] = true
if i == min {
min++
}
break
}
}
}
return a[1:]
}
func check(err error) {
if err != nil {
log.Fatal(err)
}
}
func main() {
x := make([]int, 100)
for i := 0; i < 100; i++ {
x[i] = i + 1
}
y := yellowstone(100)
fmt.Println("The first 30 Yellowstone numbers are:")
fmt.Println(y[:30])
g := exec.Command("gnuplot", "-persist")
w, err := g.StdinPipe()
check(err)
check(g.Start())
fmt.Fprintln(w, "unset key; plot '-'")
for i, xi := range x {
fmt.Fprintf(w, "%d %d\n", xi, y[i])
}
fmt.Fprintln(w, "e")
w.Close()
g.Wait()
}
|
Convert this C++ block to Go, preserving its control flow and logic. | #include <array>
#include <iostream>
#include <stack>
#include <vector>
const std::array<std::pair<int, int>, 4> DIRS = {
std::make_pair(0, -1),
std::make_pair(-1, 0),
std::make_pair(0, 1),
std::make_pair(1, 0),
};
void printResult(const std::vector<std::vector<int>> &v) {
for (auto &row : v) {
auto it = row.cbegin();
auto end = row.cend();
std::cout << '[';
if (it != end) {
std::cout << *it;
it = std::next(it);
}
while (it != end) {
std::cout << ", " << *it;
it = std::next(it);
}
std::cout << "]\n";
}
}
void cutRectangle(int w, int h) {
if (w % 2 == 1 && h % 2 == 1) {
return;
}
std::vector<std::vector<int>> grid(h, std::vector<int>(w));
std::stack<int> stack;
int half = (w * h) / 2;
long bits = (long)pow(2, half) - 1;
for (; bits > 0; bits -= 2) {
for (int i = 0; i < half; i++) {
int r = i / w;
int c = i % w;
grid[r][c] = (bits & (1 << i)) != 0 ? 1 : 0;
grid[h - r - 1][w - c - 1] = 1 - grid[r][c];
}
stack.push(0);
grid[0][0] = 2;
int count = 1;
while (!stack.empty()) {
int pos = stack.top();
stack.pop();
int r = pos / w;
int c = pos % w;
for (auto dir : DIRS) {
int nextR = r + dir.first;
int nextC = c + dir.second;
if (nextR >= 0 && nextR < h && nextC >= 0 && nextC < w) {
if (grid[nextR][nextC] == 1) {
stack.push(nextR * w + nextC);
grid[nextR][nextC] = 2;
count++;
}
}
}
}
if (count == half) {
printResult(grid);
std::cout << '\n';
}
}
}
int main() {
cutRectangle(2, 2);
cutRectangle(4, 3);
return 0;
}
| package main
import "fmt"
var grid []byte
var w, h, last int
var cnt int
var next [4]int
var dir = [4][2]int{{0, -1}, {-1, 0}, {0, 1}, {1, 0}}
func walk(y, x int) {
if y == 0 || y == h || x == 0 || x == w {
cnt += 2
return
}
t := y*(w+1) + x
grid[t]++
grid[last-t]++
for i, d := range dir {
if grid[t+next[i]] == 0 {
walk(y+d[0], x+d[1])
}
}
grid[t]--
grid[last-t]--
}
func solve(hh, ww, recur int) int {
h = hh
w = ww
if h&1 != 0 {
h, w = w, h
}
switch {
case h&1 == 1:
return 0
case w == 1:
return 1
case w == 2:
return h
case h == 2:
return w
}
cy := h / 2
cx := w / 2
grid = make([]byte, (h+1)*(w+1))
last = len(grid) - 1
next[0] = -1
next[1] = -w - 1
next[2] = 1
next[3] = w + 1
if recur != 0 {
cnt = 0
}
for x := cx + 1; x < w; x++ {
t := cy*(w+1) + x
grid[t] = 1
grid[last-t] = 1
walk(cy-1, x)
}
cnt++
if h == w {
cnt *= 2
} else if w&1 == 0 && recur != 0 {
solve(w, h, 0)
}
return cnt
}
func main() {
for y := 1; y <= 10; y++ {
for x := 1; x <= y; x++ {
if x&1 == 0 || y&1 == 0 {
fmt.Printf("%d x %d: %d\n", y, x, solve(y, x, 1))
}
}
}
}
|
Convert this C++ snippet to Go and keep its semantics consistent. | #include <array>
#include <iostream>
#include <stack>
#include <vector>
const std::array<std::pair<int, int>, 4> DIRS = {
std::make_pair(0, -1),
std::make_pair(-1, 0),
std::make_pair(0, 1),
std::make_pair(1, 0),
};
void printResult(const std::vector<std::vector<int>> &v) {
for (auto &row : v) {
auto it = row.cbegin();
auto end = row.cend();
std::cout << '[';
if (it != end) {
std::cout << *it;
it = std::next(it);
}
while (it != end) {
std::cout << ", " << *it;
it = std::next(it);
}
std::cout << "]\n";
}
}
void cutRectangle(int w, int h) {
if (w % 2 == 1 && h % 2 == 1) {
return;
}
std::vector<std::vector<int>> grid(h, std::vector<int>(w));
std::stack<int> stack;
int half = (w * h) / 2;
long bits = (long)pow(2, half) - 1;
for (; bits > 0; bits -= 2) {
for (int i = 0; i < half; i++) {
int r = i / w;
int c = i % w;
grid[r][c] = (bits & (1 << i)) != 0 ? 1 : 0;
grid[h - r - 1][w - c - 1] = 1 - grid[r][c];
}
stack.push(0);
grid[0][0] = 2;
int count = 1;
while (!stack.empty()) {
int pos = stack.top();
stack.pop();
int r = pos / w;
int c = pos % w;
for (auto dir : DIRS) {
int nextR = r + dir.first;
int nextC = c + dir.second;
if (nextR >= 0 && nextR < h && nextC >= 0 && nextC < w) {
if (grid[nextR][nextC] == 1) {
stack.push(nextR * w + nextC);
grid[nextR][nextC] = 2;
count++;
}
}
}
}
if (count == half) {
printResult(grid);
std::cout << '\n';
}
}
}
int main() {
cutRectangle(2, 2);
cutRectangle(4, 3);
return 0;
}
| package main
import "fmt"
var grid []byte
var w, h, last int
var cnt int
var next [4]int
var dir = [4][2]int{{0, -1}, {-1, 0}, {0, 1}, {1, 0}}
func walk(y, x int) {
if y == 0 || y == h || x == 0 || x == w {
cnt += 2
return
}
t := y*(w+1) + x
grid[t]++
grid[last-t]++
for i, d := range dir {
if grid[t+next[i]] == 0 {
walk(y+d[0], x+d[1])
}
}
grid[t]--
grid[last-t]--
}
func solve(hh, ww, recur int) int {
h = hh
w = ww
if h&1 != 0 {
h, w = w, h
}
switch {
case h&1 == 1:
return 0
case w == 1:
return 1
case w == 2:
return h
case h == 2:
return w
}
cy := h / 2
cx := w / 2
grid = make([]byte, (h+1)*(w+1))
last = len(grid) - 1
next[0] = -1
next[1] = -w - 1
next[2] = 1
next[3] = w + 1
if recur != 0 {
cnt = 0
}
for x := cx + 1; x < w; x++ {
t := cy*(w+1) + x
grid[t] = 1
grid[last-t] = 1
walk(cy-1, x)
}
cnt++
if h == w {
cnt *= 2
} else if w&1 == 0 && recur != 0 {
solve(w, h, 0)
}
return cnt
}
func main() {
for y := 1; y <= 10; y++ {
for x := 1; x <= y; x++ {
if x&1 == 0 || y&1 == 0 {
fmt.Printf("%d x %d: %d\n", y, x, solve(y, x, 1))
}
}
}
}
|
Preserve the algorithm and functionality while converting the code from C++ to Go. | #include <array>
#include <iostream>
#include <stack>
#include <vector>
const std::array<std::pair<int, int>, 4> DIRS = {
std::make_pair(0, -1),
std::make_pair(-1, 0),
std::make_pair(0, 1),
std::make_pair(1, 0),
};
void printResult(const std::vector<std::vector<int>> &v) {
for (auto &row : v) {
auto it = row.cbegin();
auto end = row.cend();
std::cout << '[';
if (it != end) {
std::cout << *it;
it = std::next(it);
}
while (it != end) {
std::cout << ", " << *it;
it = std::next(it);
}
std::cout << "]\n";
}
}
void cutRectangle(int w, int h) {
if (w % 2 == 1 && h % 2 == 1) {
return;
}
std::vector<std::vector<int>> grid(h, std::vector<int>(w));
std::stack<int> stack;
int half = (w * h) / 2;
long bits = (long)pow(2, half) - 1;
for (; bits > 0; bits -= 2) {
for (int i = 0; i < half; i++) {
int r = i / w;
int c = i % w;
grid[r][c] = (bits & (1 << i)) != 0 ? 1 : 0;
grid[h - r - 1][w - c - 1] = 1 - grid[r][c];
}
stack.push(0);
grid[0][0] = 2;
int count = 1;
while (!stack.empty()) {
int pos = stack.top();
stack.pop();
int r = pos / w;
int c = pos % w;
for (auto dir : DIRS) {
int nextR = r + dir.first;
int nextC = c + dir.second;
if (nextR >= 0 && nextR < h && nextC >= 0 && nextC < w) {
if (grid[nextR][nextC] == 1) {
stack.push(nextR * w + nextC);
grid[nextR][nextC] = 2;
count++;
}
}
}
}
if (count == half) {
printResult(grid);
std::cout << '\n';
}
}
}
int main() {
cutRectangle(2, 2);
cutRectangle(4, 3);
return 0;
}
| package main
import "fmt"
var grid []byte
var w, h, last int
var cnt int
var next [4]int
var dir = [4][2]int{{0, -1}, {-1, 0}, {0, 1}, {1, 0}}
func walk(y, x int) {
if y == 0 || y == h || x == 0 || x == w {
cnt += 2
return
}
t := y*(w+1) + x
grid[t]++
grid[last-t]++
for i, d := range dir {
if grid[t+next[i]] == 0 {
walk(y+d[0], x+d[1])
}
}
grid[t]--
grid[last-t]--
}
func solve(hh, ww, recur int) int {
h = hh
w = ww
if h&1 != 0 {
h, w = w, h
}
switch {
case h&1 == 1:
return 0
case w == 1:
return 1
case w == 2:
return h
case h == 2:
return w
}
cy := h / 2
cx := w / 2
grid = make([]byte, (h+1)*(w+1))
last = len(grid) - 1
next[0] = -1
next[1] = -w - 1
next[2] = 1
next[3] = w + 1
if recur != 0 {
cnt = 0
}
for x := cx + 1; x < w; x++ {
t := cy*(w+1) + x
grid[t] = 1
grid[last-t] = 1
walk(cy-1, x)
}
cnt++
if h == w {
cnt *= 2
} else if w&1 == 0 && recur != 0 {
solve(w, h, 0)
}
return cnt
}
func main() {
for y := 1; y <= 10; y++ {
for x := 1; x <= y; x++ {
if x&1 == 0 || y&1 == 0 {
fmt.Printf("%d x %d: %d\n", y, x, solve(y, x, 1))
}
}
}
}
|
Write the same algorithm in Go as shown in this C++ implementation. | #include <iomanip>
#include <iostream>
#include <vector>
std::vector<int> mertens_numbers(int max) {
std::vector<int> m(max + 1, 1);
for (int n = 2; n <= max; ++n) {
for (int k = 2; k <= n; ++k)
m[n] -= m[n / k];
}
return m;
}
int main() {
const int max = 1000;
auto m(mertens_numbers(max));
std::cout << "First 199 Mertens numbers:\n";
for (int i = 0, column = 0; i < 200; ++i) {
if (column > 0)
std::cout << ' ';
if (i == 0)
std::cout << " ";
else
std::cout << std::setw(2) << m[i];
++column;
if (column == 20) {
std::cout << '\n';
column = 0;
}
}
int zero = 0, cross = 0, previous = 0;
for (int i = 1; i <= max; ++i) {
if (m[i] == 0) {
++zero;
if (previous != 0)
++cross;
}
previous = m[i];
}
std::cout << "M(n) is zero " << zero << " times for 1 <= n <= 1000.\n";
std::cout << "M(n) crosses zero " << cross << " times for 1 <= n <= 1000.\n";
return 0;
}
| package main
import "fmt"
func mertens(to int) ([]int, int, int) {
if to < 1 {
to = 1
}
merts := make([]int, to+1)
primes := []int{2}
var sum, zeros, crosses int
for i := 1; i <= to; i++ {
j := i
cp := 0
spf := false
for _, p := range primes {
if p > j {
break
}
if j%p == 0 {
j /= p
cp++
}
if j%p == 0 {
spf = true
break
}
}
if cp == 0 && i > 2 {
cp = 1
primes = append(primes, i)
}
if !spf {
if cp%2 == 0 {
sum++
} else {
sum--
}
}
merts[i] = sum
if sum == 0 {
zeros++
if i > 1 && merts[i-1] != 0 {
crosses++
}
}
}
return merts, zeros, crosses
}
func main() {
merts, zeros, crosses := mertens(1000)
fmt.Println("Mertens sequence - First 199 terms:")
for i := 0; i < 200; i++ {
if i == 0 {
fmt.Print(" ")
continue
}
if i%20 == 0 {
fmt.Println()
}
fmt.Printf(" % d", merts[i])
}
fmt.Println("\n\nEquals zero", zeros, "times between 1 and 1000")
fmt.Println("\nCrosses zero", crosses, "times between 1 and 1000")
}
|
Produce a functionally identical Go code for the snippet given in C++. | #include <algorithm>
#include <iostream>
#include <vector>
using namespace std;
bool InteractiveCompare(const string& s1, const string& s2)
{
if(s1 == s2) return false;
static int count = 0;
string response;
cout << "(" << ++count << ") Is " << s1 << " < " << s2 << "? ";
getline(cin, response);
return !response.empty() && response.front() == 'y';
}
void PrintOrder(const vector<string>& items)
{
cout << "{ ";
for(auto& item : items) cout << item << " ";
cout << "}\n";
}
int main()
{
const vector<string> items
{
"violet", "red", "green", "indigo", "blue", "yellow", "orange"
};
vector<string> sortedItems;
for(auto& item : items)
{
cout << "Inserting '" << item << "' into ";
PrintOrder(sortedItems);
auto spotToInsert = lower_bound(sortedItems.begin(),
sortedItems.end(), item, InteractiveCompare);
sortedItems.insert(spotToInsert, item);
}
PrintOrder(sortedItems);
return 0;
}
| package main
import (
"fmt"
"sort"
"strings"
)
var count int = 0
func interactiveCompare(s1, s2 string) bool {
count++
fmt.Printf("(%d) Is %s < %s? ", count, s1, s2)
var response string
_, err := fmt.Scanln(&response)
return err == nil && strings.HasPrefix(response, "y")
}
func main() {
items := []string{"violet", "red", "green", "indigo", "blue", "yellow", "orange"}
var sortedItems []string
for _, item := range items {
fmt.Printf("Inserting '%s' into %s\n", item, sortedItems)
spotToInsert := sort.Search(len(sortedItems), func(i int) bool {
return interactiveCompare(item, sortedItems[i])
})
sortedItems = append(sortedItems[:spotToInsert],
append([]string{item}, sortedItems[spotToInsert:]...)...)
}
fmt.Println(sortedItems)
}
|
Can you help me rewrite this code in Go instead of C++, keeping it the same logically? |
#include <cln/integer.h>
#include <cln/integer_io.h>
#include <iostream>
#include <algorithm>
#include <vector>
#include <iomanip>
#include <sstream>
#include <string>
#include <cstdlib>
#include <cmath>
#include <map>
using namespace cln ;
class NextNum {
public :
NextNum ( cl_I & a , cl_I & b ) : first( a ) , second ( b ) { }
cl_I operator( )( ) {
cl_I result = first + second ;
first = second ;
second = result ;
return result ;
}
private :
cl_I first ;
cl_I second ;
} ;
void findFrequencies( const std::vector<cl_I> & fibos , std::map<int , int> &numberfrequencies ) {
for ( cl_I bignumber : fibos ) {
std::ostringstream os ;
fprintdecimal ( os , bignumber ) ;
int firstdigit = std::atoi( os.str( ).substr( 0 , 1 ).c_str( )) ;
auto result = numberfrequencies.insert( std::make_pair( firstdigit , 1 ) ) ;
if ( ! result.second )
numberfrequencies[ firstdigit ]++ ;
}
}
int main( ) {
std::vector<cl_I> fibonaccis( 1000 ) ;
fibonaccis[ 0 ] = 0 ;
fibonaccis[ 1 ] = 1 ;
cl_I a = 0 ;
cl_I b = 1 ;
std::generate_n( fibonaccis.begin( ) + 2 , 998 , NextNum( a , b ) ) ;
std::cout << std::endl ;
std::map<int , int> frequencies ;
findFrequencies( fibonaccis , frequencies ) ;
std::cout << " found expected\n" ;
for ( int i = 1 ; i < 10 ; i++ ) {
double found = static_cast<double>( frequencies[ i ] ) / 1000 ;
double expected = std::log10( 1 + 1 / static_cast<double>( i )) ;
std::cout << i << " :" << std::setw( 16 ) << std::right << found * 100 << " %" ;
std::cout.precision( 3 ) ;
std::cout << std::setw( 26 ) << std::right << expected * 100 << " %\n" ;
}
return 0 ;
}
| package main
import (
"fmt"
"math"
)
func Fib1000() []float64 {
a, b, r := 0., 1., [1000]float64{}
for i := range r {
r[i], a, b = b, b, b+a
}
return r[:]
}
func main() {
show(Fib1000(), "First 1000 Fibonacci numbers")
}
func show(c []float64, title string) {
var f [9]int
for _, v := range c {
f[fmt.Sprintf("%g", v)[0]-'1']++
}
fmt.Println(title)
fmt.Println("Digit Observed Predicted")
for i, n := range f {
fmt.Printf(" %d %9.3f %8.3f\n", i+1, float64(n)/float64(len(c)),
math.Log10(1+1/float64(i+1)))
}
}
|
Change the following C++ code into Go without altering its purpose. |
#include <cln/integer.h>
#include <cln/integer_io.h>
#include <iostream>
#include <algorithm>
#include <vector>
#include <iomanip>
#include <sstream>
#include <string>
#include <cstdlib>
#include <cmath>
#include <map>
using namespace cln ;
class NextNum {
public :
NextNum ( cl_I & a , cl_I & b ) : first( a ) , second ( b ) { }
cl_I operator( )( ) {
cl_I result = first + second ;
first = second ;
second = result ;
return result ;
}
private :
cl_I first ;
cl_I second ;
} ;
void findFrequencies( const std::vector<cl_I> & fibos , std::map<int , int> &numberfrequencies ) {
for ( cl_I bignumber : fibos ) {
std::ostringstream os ;
fprintdecimal ( os , bignumber ) ;
int firstdigit = std::atoi( os.str( ).substr( 0 , 1 ).c_str( )) ;
auto result = numberfrequencies.insert( std::make_pair( firstdigit , 1 ) ) ;
if ( ! result.second )
numberfrequencies[ firstdigit ]++ ;
}
}
int main( ) {
std::vector<cl_I> fibonaccis( 1000 ) ;
fibonaccis[ 0 ] = 0 ;
fibonaccis[ 1 ] = 1 ;
cl_I a = 0 ;
cl_I b = 1 ;
std::generate_n( fibonaccis.begin( ) + 2 , 998 , NextNum( a , b ) ) ;
std::cout << std::endl ;
std::map<int , int> frequencies ;
findFrequencies( fibonaccis , frequencies ) ;
std::cout << " found expected\n" ;
for ( int i = 1 ; i < 10 ; i++ ) {
double found = static_cast<double>( frequencies[ i ] ) / 1000 ;
double expected = std::log10( 1 + 1 / static_cast<double>( i )) ;
std::cout << i << " :" << std::setw( 16 ) << std::right << found * 100 << " %" ;
std::cout.precision( 3 ) ;
std::cout << std::setw( 26 ) << std::right << expected * 100 << " %\n" ;
}
return 0 ;
}
| package main
import (
"fmt"
"math"
)
func Fib1000() []float64 {
a, b, r := 0., 1., [1000]float64{}
for i := range r {
r[i], a, b = b, b, b+a
}
return r[:]
}
func main() {
show(Fib1000(), "First 1000 Fibonacci numbers")
}
func show(c []float64, title string) {
var f [9]int
for _, v := range c {
f[fmt.Sprintf("%g", v)[0]-'1']++
}
fmt.Println(title)
fmt.Println("Digit Observed Predicted")
for i, n := range f {
fmt.Printf(" %d %9.3f %8.3f\n", i+1, float64(n)/float64(len(c)),
math.Log10(1+1/float64(i+1)))
}
}
|
Write a version of this C++ function in Go with identical behavior. | #include <iostream>
#include <string>
#include <windows.h>
using namespace std;
class bells
{
public:
void start()
{
watch[0] = "Middle"; watch[1] = "Morning"; watch[2] = "Forenoon"; watch[3] = "Afternoon"; watch[4] = "Dog"; watch[5] = "First";
count[0] = "One"; count[1] = "Two"; count[2] = "Three"; count[3] = "Four"; count[4] = "Five"; count[5] = "Six"; count[6] = "Seven"; count[7] = "Eight";
_inst = this; CreateThread( NULL, 0, bell, NULL, 0, NULL );
}
private:
static DWORD WINAPI bell( LPVOID p )
{
DWORD wait = _inst->waitTime();
while( true )
{
Sleep( wait );
_inst->playBell();
wait = _inst->waitTime();
}
return 0;
}
DWORD waitTime()
{
GetLocalTime( &st );
int m = st.wMinute >= 30 ? st.wMinute - 30 : st.wMinute;
return( 1800000 - ( ( m * 60 + st.wSecond ) * 1000 + st.wMilliseconds ) );
}
void playBell()
{
GetLocalTime( &st );
int b = ( 2 * st.wHour + st.wMinute / 30 ) % 8; b = b == 0 ? 8 : b;
int w = ( 60 * st.wHour + st.wMinute );
if( w < 1 ) w = 5; else w = ( w - 1 ) / 240;
char hr[32]; wsprintf( hr, "%.2d:%.2d", st.wHour, st.wMinute );
cout << hr << " - " << watch[w] << " watch - " << count[b - 1] << " Bell";
if( b > 1 ) cout << "s"; else cout << " "; cout << " Gone." << endl;
for( int x = 0, c = 1; x < b; x++, c++ )
{
cout << "\7"; Sleep( 500 );
if( !( c % 2 ) ) Sleep( 300 );
}
}
SYSTEMTIME st;
string watch[7], count[8];
static bells* _inst;
};
bells* bells::_inst = 0;
int main( int argc, char* argv[] )
{
bells b; b.start();
while( 1 );
return 0;
}
| package main
import (
"fmt"
"strings"
"time"
)
func main() {
watches := []string{
"First", "Middle", "Morning", "Forenoon",
"Afternoon", "Dog", "First",
}
for {
t := time.Now()
h := t.Hour()
m := t.Minute()
s := t.Second()
if (m == 0 || m == 30) && s == 0 {
bell := 0
if m == 30 {
bell = 1
}
bells := (h*2 + bell) % 8
watch := h/4 + 1
if bells == 0 {
bells = 8
watch--
}
sound := strings.Repeat("\a", bells)
pl := "s"
if bells == 1 {
pl = " "
}
w := watches[watch] + " watch"
if watch == 5 {
if bells < 5 {
w = "First " + w
} else {
w = "Last " + w
}
}
fmt.Printf("%s%02d:%02d = %d bell%s : %s\n", sound, h, m, bells, pl, w)
}
time.Sleep(1 * time.Second)
}
}
|
Convert the following code from C++ to Go, ensuring the logic remains intact. | #include <iostream>
#include <string>
#include <windows.h>
using namespace std;
class bells
{
public:
void start()
{
watch[0] = "Middle"; watch[1] = "Morning"; watch[2] = "Forenoon"; watch[3] = "Afternoon"; watch[4] = "Dog"; watch[5] = "First";
count[0] = "One"; count[1] = "Two"; count[2] = "Three"; count[3] = "Four"; count[4] = "Five"; count[5] = "Six"; count[6] = "Seven"; count[7] = "Eight";
_inst = this; CreateThread( NULL, 0, bell, NULL, 0, NULL );
}
private:
static DWORD WINAPI bell( LPVOID p )
{
DWORD wait = _inst->waitTime();
while( true )
{
Sleep( wait );
_inst->playBell();
wait = _inst->waitTime();
}
return 0;
}
DWORD waitTime()
{
GetLocalTime( &st );
int m = st.wMinute >= 30 ? st.wMinute - 30 : st.wMinute;
return( 1800000 - ( ( m * 60 + st.wSecond ) * 1000 + st.wMilliseconds ) );
}
void playBell()
{
GetLocalTime( &st );
int b = ( 2 * st.wHour + st.wMinute / 30 ) % 8; b = b == 0 ? 8 : b;
int w = ( 60 * st.wHour + st.wMinute );
if( w < 1 ) w = 5; else w = ( w - 1 ) / 240;
char hr[32]; wsprintf( hr, "%.2d:%.2d", st.wHour, st.wMinute );
cout << hr << " - " << watch[w] << " watch - " << count[b - 1] << " Bell";
if( b > 1 ) cout << "s"; else cout << " "; cout << " Gone." << endl;
for( int x = 0, c = 1; x < b; x++, c++ )
{
cout << "\7"; Sleep( 500 );
if( !( c % 2 ) ) Sleep( 300 );
}
}
SYSTEMTIME st;
string watch[7], count[8];
static bells* _inst;
};
bells* bells::_inst = 0;
int main( int argc, char* argv[] )
{
bells b; b.start();
while( 1 );
return 0;
}
| package main
import (
"fmt"
"strings"
"time"
)
func main() {
watches := []string{
"First", "Middle", "Morning", "Forenoon",
"Afternoon", "Dog", "First",
}
for {
t := time.Now()
h := t.Hour()
m := t.Minute()
s := t.Second()
if (m == 0 || m == 30) && s == 0 {
bell := 0
if m == 30 {
bell = 1
}
bells := (h*2 + bell) % 8
watch := h/4 + 1
if bells == 0 {
bells = 8
watch--
}
sound := strings.Repeat("\a", bells)
pl := "s"
if bells == 1 {
pl = " "
}
w := watches[watch] + " watch"
if watch == 5 {
if bells < 5 {
w = "First " + w
} else {
w = "Last " + w
}
}
fmt.Printf("%s%02d:%02d = %d bell%s : %s\n", sound, h, m, bells, pl, w)
}
time.Sleep(1 * time.Second)
}
}
|
Generate an equivalent Go version of this C++ code. | double fib(double n)
{
if(n < 0)
{
throw "Invalid argument passed to fib";
}
else
{
struct actual_fib
{
static double calc(double n)
{
if(n < 2)
{
return n;
}
else
{
return calc(n-1) + calc(n-2);
}
}
};
return actual_fib::calc(n);
}
}
| package main
import "fmt"
func main() {
for _, n := range []int{0, 1, 2, 3, 4, 5, 10, 40, -1} {
f, ok := arFib(n)
if ok {
fmt.Printf("fib %d = %d\n", n, f)
} else {
fmt.Println("fib undefined for negative numbers")
}
}
}
func arFib(n int) (int, bool) {
switch {
case n < 0:
return 0, false
case n < 2:
return n, true
}
return yc(func(recurse fn) fn {
return func(left, term1, term2 int) int {
if left == 0 {
return term1+term2
}
return recurse(left-1, term1+term2, term1)
}
})(n-2, 1, 0), true
}
type fn func(int, int, int) int
type ff func(fn) fn
type fx func(fx) fn
func yc(f ff) fn {
return func(x fx) fn {
return x(x)
}(func(x fx) fn {
return f(func(a1, a2, a3 int) int {
return x(x)(a1, a2, a3)
})
})
}
|
Preserve the algorithm and functionality while converting the code from C++ to Go. | #include <windows.h>
#include <ctime>
#include <iostream>
#include <string>
const int WID = 60, HEI = 30, MAX_LEN = 600;
enum DIR { NORTH, EAST, SOUTH, WEST };
class snake {
public:
snake() {
console = GetStdHandle( STD_OUTPUT_HANDLE ); SetConsoleTitle( "Snake" );
COORD coord = { WID + 1, HEI + 2 }; SetConsoleScreenBufferSize( console, coord );
SMALL_RECT rc = { 0, 0, WID, HEI + 1 }; SetConsoleWindowInfo( console, TRUE, &rc );
CONSOLE_CURSOR_INFO ci = { 1, false }; SetConsoleCursorInfo( console, &ci );
}
void play() {
std::string a;
while( 1 ) {
createField(); alive = true;
while( alive ) { drawField(); readKey(); moveSnake(); Sleep( 50 ); }
COORD c = { 0, HEI + 1 }; SetConsoleCursorPosition( console, c );
SetConsoleTextAttribute( console, 0x000b );
std::cout << "Play again [Y/N]? "; std::cin >> a;
if( a.at( 0 ) != 'Y' && a.at( 0 ) != 'y' ) return;
}
}
private:
void createField() {
COORD coord = { 0, 0 }; DWORD c;
FillConsoleOutputCharacter( console, ' ', ( HEI + 2 ) * 80, coord, &c );
FillConsoleOutputAttribute( console, 0x0000, ( HEI + 2 ) * 80, coord, &c );
SetConsoleCursorPosition( console, coord );
int x = 0, y = 1; for( ; x < WID * HEI; x++ ) brd[x] = 0;
for( x = 0; x < WID; x++ ) {
brd[x] = brd[x + WID * ( HEI - 1 )] = '+';
}
for( ; y < HEI; y++ ) {
brd[0 + WID * y] = brd[WID - 1 + WID * y] = '+';
}
do {
x = rand() % WID; y = rand() % ( HEI >> 1 ) + ( HEI >> 1 );
} while( brd[x + WID * y] );
brd[x + WID * y] = '@';
tailIdx = 0; headIdx = 4; x = 3; y = 2;
for( int c = tailIdx; c < headIdx; c++ ) {
brd[x + WID * y] = '#';
snk[c].X = 3 + c; snk[c].Y = 2;
}
head = snk[3]; dir = EAST; points = 0;
}
void readKey() {
if( GetAsyncKeyState( 39 ) & 0x8000 ) dir = EAST;
if( GetAsyncKeyState( 37 ) & 0x8000 ) dir = WEST;
if( GetAsyncKeyState( 38 ) & 0x8000 ) dir = NORTH;
if( GetAsyncKeyState( 40 ) & 0x8000 ) dir = SOUTH;
}
void drawField() {
COORD coord; char t;
for( int y = 0; y < HEI; y++ ) {
coord.Y = y;
for( int x = 0; x < WID; x++ ) {
t = brd[x + WID * y]; if( !t ) continue;
coord.X = x; SetConsoleCursorPosition( console, coord );
if( coord.X == head.X && coord.Y == head.Y ) {
SetConsoleTextAttribute( console, 0x002e );
std::cout << 'O'; SetConsoleTextAttribute( console, 0x0000 );
continue;
}
switch( t ) {
case '#': SetConsoleTextAttribute( console, 0x002a ); break;
case '+': SetConsoleTextAttribute( console, 0x0019 ); break;
case '@': SetConsoleTextAttribute( console, 0x004c ); break;
}
std::cout << t; SetConsoleTextAttribute( console, 0x0000 );
}
}
std::cout << t; SetConsoleTextAttribute( console, 0x0007 );
COORD c = { 0, HEI }; SetConsoleCursorPosition( console, c );
std::cout << "Points: " << points;
}
void moveSnake() {
switch( dir ) {
case NORTH: head.Y--; break;
case EAST: head.X++; break;
case SOUTH: head.Y++; break;
case WEST: head.X--; break;
}
char t = brd[head.X + WID * head.Y];
if( t && t != '@' ) { alive = false; return; }
brd[head.X + WID * head.Y] = '#';
snk[headIdx].X = head.X; snk[headIdx].Y = head.Y;
if( ++headIdx >= MAX_LEN ) headIdx = 0;
if( t == '@' ) {
points++; int x, y;
do {
x = rand() % WID; y = rand() % ( HEI >> 1 ) + ( HEI >> 1 );
} while( brd[x + WID * y] );
brd[x + WID * y] = '@'; return;
}
SetConsoleCursorPosition( console, snk[tailIdx] ); std::cout << ' ';
brd[snk[tailIdx].X + WID * snk[tailIdx].Y] = 0;
if( ++tailIdx >= MAX_LEN ) tailIdx = 0;
}
bool alive; char brd[WID * HEI];
HANDLE console; DIR dir; COORD snk[MAX_LEN];
COORD head; int tailIdx, headIdx, points;
};
int main( int argc, char* argv[] ) {
srand( static_cast<unsigned>( time( NULL ) ) );
snake s; s.play(); return 0;
}
| package main
import (
"errors"
"fmt"
"log"
"math/rand"
"time"
termbox "github.com/nsf/termbox-go"
)
func main() {
rand.Seed(time.Now().UnixNano())
score, err := playSnake()
if err != nil {
log.Fatal(err)
}
fmt.Println("Final score:", score)
}
type snake struct {
body []position
heading direction
width, height int
cells []termbox.Cell
}
type position struct {
X int
Y int
}
type direction int
const (
North direction = iota
East
South
West
)
func (p position) next(d direction) position {
switch d {
case North:
p.Y--
case East:
p.X++
case South:
p.Y++
case West:
p.X--
}
return p
}
func playSnake() (int, error) {
err := termbox.Init()
if err != nil {
return 0, err
}
defer termbox.Close()
termbox.Clear(fg, bg)
termbox.HideCursor()
s := &snake{
body: make([]position, 0, 32),
cells: termbox.CellBuffer(),
}
s.width, s.height = termbox.Size()
s.drawBorder()
s.startSnake()
s.placeFood()
s.flush()
moveCh, errCh := s.startEventLoop()
const delay = 125 * time.Millisecond
for t := time.NewTimer(delay); ; t.Reset(delay) {
var move direction
select {
case err = <-errCh:
return len(s.body), err
case move = <-moveCh:
if !t.Stop() {
<-t.C
}
case <-t.C:
move = s.heading
}
if s.doMove(move) {
time.Sleep(1 * time.Second)
break
}
}
return len(s.body), err
}
func (s *snake) startEventLoop() (<-chan direction, <-chan error) {
moveCh := make(chan direction)
errCh := make(chan error, 1)
go func() {
defer close(errCh)
for {
switch ev := termbox.PollEvent(); ev.Type {
case termbox.EventKey:
switch ev.Ch {
case 'w', 'W', 'k', 'K':
moveCh <- North
case 'a', 'A', 'h', 'H':
moveCh <- West
case 's', 'S', 'j', 'J':
moveCh <- South
case 'd', 'D', 'l', 'L':
moveCh <- East
case 0:
switch ev.Key {
case termbox.KeyArrowUp:
moveCh <- North
case termbox.KeyArrowDown:
moveCh <- South
case termbox.KeyArrowLeft:
moveCh <- West
case termbox.KeyArrowRight:
moveCh <- East
case termbox.KeyEsc:
return
}
}
case termbox.EventResize:
errCh <- errors.New("terminal resizing unsupported")
return
case termbox.EventError:
errCh <- ev.Err
return
case termbox.EventInterrupt:
return
}
}
}()
return moveCh, errCh
}
func (s *snake) flush() {
termbox.Flush()
s.cells = termbox.CellBuffer()
}
func (s *snake) getCellRune(p position) rune {
i := p.Y*s.width + p.X
return s.cells[i].Ch
}
func (s *snake) setCell(p position, c termbox.Cell) {
i := p.Y*s.width + p.X
s.cells[i] = c
}
func (s *snake) drawBorder() {
for x := 0; x < s.width; x++ {
s.setCell(position{x, 0}, border)
s.setCell(position{x, s.height - 1}, border)
}
for y := 0; y < s.height-1; y++ {
s.setCell(position{0, y}, border)
s.setCell(position{s.width - 1, y}, border)
}
}
func (s *snake) placeFood() {
for {
x := rand.Intn(s.width-2) + 1
y := rand.Intn(s.height-2) + 1
foodp := position{x, y}
r := s.getCellRune(foodp)
if r != ' ' {
continue
}
s.setCell(foodp, food)
return
}
}
func (s *snake) startSnake() {
x := rand.Intn(s.width/2) + s.width/4
y := rand.Intn(s.height/2) + s.height/4
head := position{x, y}
s.setCell(head, snakeHead)
s.body = append(s.body[:0], head)
s.heading = direction(rand.Intn(4))
}
func (s *snake) doMove(move direction) bool {
head := s.body[len(s.body)-1]
s.setCell(head, snakeBody)
head = head.next(move)
s.heading = move
s.body = append(s.body, head)
r := s.getCellRune(head)
s.setCell(head, snakeHead)
gameOver := false
switch r {
case food.Ch:
s.placeFood()
case border.Ch, snakeBody.Ch:
gameOver = true
fallthrough
case empty.Ch:
s.setCell(s.body[0], empty)
s.body = s.body[1:]
default:
panic(r)
}
s.flush()
return gameOver
}
const (
fg = termbox.ColorWhite
bg = termbox.ColorBlack
)
var (
empty = termbox.Cell{Ch: ' ', Bg: bg, Fg: fg}
border = termbox.Cell{Ch: '+', Bg: bg, Fg: termbox.ColorBlue}
snakeBody = termbox.Cell{Ch: '#', Bg: bg, Fg: termbox.ColorGreen}
snakeHead = termbox.Cell{Ch: 'O', Bg: bg, Fg: termbox.ColorYellow | termbox.AttrBold}
food = termbox.Cell{Ch: '@', Bg: bg, Fg: termbox.ColorRed}
)
|
Can you help me rewrite this code in Go instead of C++, keeping it the same logically? | #include <string>
#include <iostream>
int main( ) {
std::string word( "Premier League" ) ;
std::cout << "Without first letter: " << word.substr( 1 ) << " !\n" ;
std::cout << "Without last letter: " << word.substr( 0 , word.length( ) - 1 ) << " !\n" ;
std::cout << "Without first and last letter: " << word.substr( 1 , word.length( ) - 2 ) << " !\n" ;
return 0 ;
}
| package main
import (
"fmt"
"unicode/utf8"
)
func main() {
s := "ASCII"
fmt.Println("String: ", s)
fmt.Println("First byte removed: ", s[1:])
fmt.Println("Last byte removed: ", s[:len(s)-1])
fmt.Println("First and last removed:", s[1:len(s)-1])
u := "Δημοτική"
fmt.Println("String: ", u)
_, sizeFirst := utf8.DecodeRuneInString(u)
fmt.Println("First rune removed: ", u[sizeFirst:])
_, sizeLast := utf8.DecodeLastRuneInString(u)
fmt.Println("Last rune removed: ", u[:len(u)-sizeLast])
fmt.Println("First and last removed:", u[sizeFirst:len(u)-sizeLast])
}
|
Write the same code in Go as shown below in C++. | #include <string>
#include <iostream>
int main( ) {
std::string word( "Premier League" ) ;
std::cout << "Without first letter: " << word.substr( 1 ) << " !\n" ;
std::cout << "Without last letter: " << word.substr( 0 , word.length( ) - 1 ) << " !\n" ;
std::cout << "Without first and last letter: " << word.substr( 1 , word.length( ) - 2 ) << " !\n" ;
return 0 ;
}
| package main
import (
"fmt"
"unicode/utf8"
)
func main() {
s := "ASCII"
fmt.Println("String: ", s)
fmt.Println("First byte removed: ", s[1:])
fmt.Println("Last byte removed: ", s[:len(s)-1])
fmt.Println("First and last removed:", s[1:len(s)-1])
u := "Δημοτική"
fmt.Println("String: ", u)
_, sizeFirst := utf8.DecodeRuneInString(u)
fmt.Println("First rune removed: ", u[sizeFirst:])
_, sizeLast := utf8.DecodeLastRuneInString(u)
fmt.Println("Last rune removed: ", u[:len(u)-sizeLast])
fmt.Println("First and last removed:", u[sizeFirst:len(u)-sizeLast])
}
|
Convert this C++ snippet to Go and keep its semantics consistent. | #include <string>
#include <iostream>
int main( ) {
std::string word( "Premier League" ) ;
std::cout << "Without first letter: " << word.substr( 1 ) << " !\n" ;
std::cout << "Without last letter: " << word.substr( 0 , word.length( ) - 1 ) << " !\n" ;
std::cout << "Without first and last letter: " << word.substr( 1 , word.length( ) - 2 ) << " !\n" ;
return 0 ;
}
| package main
import (
"fmt"
"unicode/utf8"
)
func main() {
s := "ASCII"
fmt.Println("String: ", s)
fmt.Println("First byte removed: ", s[1:])
fmt.Println("Last byte removed: ", s[:len(s)-1])
fmt.Println("First and last removed:", s[1:len(s)-1])
u := "Δημοτική"
fmt.Println("String: ", u)
_, sizeFirst := utf8.DecodeRuneInString(u)
fmt.Println("First rune removed: ", u[sizeFirst:])
_, sizeLast := utf8.DecodeLastRuneInString(u)
fmt.Println("Last rune removed: ", u[:len(u)-sizeLast])
fmt.Println("First and last removed:", u[sizeFirst:len(u)-sizeLast])
}
|
Please provide an equivalent version of this C++ code in Go. | #include <cmath>
#include <iostream>
#include <vector>
std::vector<int> generate_primes(int limit) {
std::vector<bool> sieve(limit >> 1, true);
for (int p = 3, s = 9; s < limit; p += 2) {
if (sieve[p >> 1]) {
for (int q = s; q < limit; q += p << 1)
sieve[q >> 1] = false;
}
s += (p + 1) << 2;
}
std::vector<int> primes;
if (limit > 2)
primes.push_back(2);
for (int i = 1; i < sieve.size(); ++i) {
if (sieve[i])
primes.push_back((i << 1) + 1);
}
return primes;
}
class legendre_prime_counter {
public:
explicit legendre_prime_counter(int limit);
int prime_count(int n);
private:
int phi(int x, int a);
std::vector<int> primes;
};
legendre_prime_counter::legendre_prime_counter(int limit) :
primes(generate_primes(static_cast<int>(std::sqrt(limit)))) {}
int legendre_prime_counter::prime_count(int n) {
if (n < 2)
return 0;
int a = prime_count(static_cast<int>(std::sqrt(n)));
return phi(n, a) + a - 1;
}
int legendre_prime_counter::phi(int x, int a) {
if (a == 0)
return x;
if (a == 1)
return x - (x >> 1);
int pa = primes[a - 1];
if (x <= pa)
return 1;
return phi(x, a - 1) - phi(x / pa, a - 1);
}
int main() {
legendre_prime_counter counter(1000000000);
for (int i = 0, n = 1; i < 10; ++i, n *= 10)
std::cout << "10^" << i << "\t" << counter.prime_count(n) << '\n';
}
| package main
import (
"fmt"
"log"
"math"
"rcu"
)
func cantorPair(x, y int) int {
if x < 0 || y < 0 {
log.Fatal("Arguments must be non-negative integers.")
}
return (x*x + 3*x + 2*x*y + y + y*y) / 2
}
func pi(n int) int {
if n < 2 {
return 0
}
if n == 2 {
return 1
}
primes := rcu.Primes(int(math.Sqrt(float64(n))))
a := len(primes)
memoPhi := make(map[int]int)
var phi func(x, a int) int
phi = func(x, a int) int {
if a < 1 {
return x
}
if a == 1 {
return x - (x >> 1)
}
pa := primes[a-1]
if x <= pa {
return 1
}
key := cantorPair(x, a)
if v, ok := memoPhi[key]; ok {
return v
}
memoPhi[key] = phi(x, a-1) - phi(x/pa, a-1)
return memoPhi[key]
}
return phi(n, a) + a - 1
}
func main() {
for i, n := 0, 1; i <= 9; i, n = i+1, n*10 {
fmt.Printf("10^%d %d\n", i, pi(n))
}
}
|
Preserve the algorithm and functionality while converting the code from C++ to Go. | #include <string>
using std::string;
extern "C" int
Query (char *Data, size_t *Length)
{
const string Message = "Here am I";
if (*Length < Message.length())
return false;
*Length = Message.length();
Message.copy(Data, *Length);
return true;
}
| package main
import "C"
import "unsafe"
func main() {
C.Run()
}
const msg = "Here am I"
func Query(cbuf *C.char, csiz *C.size_t) C.int {
if int(*csiz) <= len(msg) {
return 0
}
pbuf := uintptr(unsafe.Pointer(cbuf))
for i := 0; i < len(msg); i++ {
*((*byte)(unsafe.Pointer(pbuf))) = msg[i]
pbuf++
}
*((*byte)(unsafe.Pointer(pbuf))) = 0
*csiz = C.size_t(len(msg) + 1)
return 1
}
|
Change the programming language of this snippet from C++ to Go without modifying what it does. | #include <iostream>
#include <string.h>
int main()
{
std::string longLine, longestLines, newLine;
while (std::cin >> newLine)
{
auto isNewLineShorter = longLine.c_str();
auto isLongLineShorter = newLine.c_str();
while (*isNewLineShorter && *isLongLineShorter)
{
isNewLineShorter = &isNewLineShorter[1];
isLongLineShorter = &isLongLineShorter[1];
}
if(*isNewLineShorter) continue;
if(*isLongLineShorter)
{
longLine = newLine;
longestLines = newLine;
}
else
{
longestLines+=newLine;
}
longestLines+="\n";
}
std::cout << "\nLongest string:\n" << longestLines;
}
| package main
import (
"bufio"
"os"
)
func main() {
in := bufio.NewReader(os.Stdin)
var blankLine = "\n"
var printLongest func(string) string
printLongest = func(candidate string) (longest string) {
longest = candidate
s, err := in.ReadString('\n')
defer func() {
recover()
defer func() {
recover()
}()
_ = blankLine[0]
func() {
defer func() {
recover()
}()
_ = s[len(longest)]
longest = s
}()
longest = printLongest(longest)
func() {
defer func() {
recover()
os.Stdout.WriteString(s)
}()
_ = longest[len(s)]
s = ""
}()
}()
_ = err.(error)
os.Stdout.WriteString(blankLine)
blankLine = ""
return
}
printLongest("")
}
|
Maintain the same structure and functionality when rewriting this code in Go. | #include <vector>
#include <string>
#include <iostream>
#include <algorithm>
#include <fstream>
#include <iomanip>
typedef unsigned int uint;
using namespace std;
const uint TAPE_MAX_LEN = 49152;
struct action { char write, direction; };
class tape
{
public:
tape( uint startPos = TAPE_MAX_LEN >> 1 ) : MAX_LEN( TAPE_MAX_LEN ) { _sp = startPos; reset(); }
void reset() { clear( '0' ); headPos = _sp; }
char read(){ return _t[headPos]; }
void input( string a ){ if( a == "" ) return; for( uint s = 0; s < a.length(); s++ ) _t[headPos + s] = a[s]; }
void clear( char c ) { _t.clear(); blk = c; _t.resize( MAX_LEN, blk ); }
void action( const action* a ) { write( a->write ); move( a->direction ); }
void print( int c = 10 )
{
int ml = static_cast<int>( MAX_LEN ), st = static_cast<int>( headPos ) - c, ed = static_cast<int>( headPos ) + c + 1, tx;
for( int x = st; x < ed; x++ )
{ tx = x; if( tx < 0 ) tx += ml; if( tx >= ml ) tx -= ml; cout << _t[tx]; }
cout << endl << setw( c + 1 ) << "^" << endl;
}
private:
void move( char d ) { if( d == 'N' ) return; headPos += d == 'R' ? 1 : -1; if( headPos >= MAX_LEN ) headPos = d == 'R' ? 0 : MAX_LEN - 1; }
void write( char a ) { if( a != 'N' ) { if( a == 'B' ) _t[headPos] = blk; else _t[headPos] = a; } }
string _t; uint headPos, _sp; char blk; const uint MAX_LEN;
};
class state
{
public:
bool operator ==( const string o ) { return o == name; }
string name, next; char symbol, write, direction;
};
class actionTable
{
public:
bool loadTable( string file )
{
reset();
ifstream mf; mf.open( file.c_str() ); if( mf.is_open() )
{
string str; state stt;
while( mf.good() )
{
getline( mf, str ); if( str[0] == '\'' ) break;
parseState( str, stt ); states.push_back( stt );
}
while( mf.good() )
{
getline( mf, str ); if( str == "" ) continue;
if( str[0] == '!' ) blank = str.erase( 0, 1 )[0];
if( str[0] == '^' ) curState = str.erase( 0, 1 );
if( str[0] == '>' ) input = str.erase( 0, 1 );
}
mf.close(); return true;
}
cout << "Could not open " << file << endl; return false;
}
bool action( char symbol, action& a )
{
vector<state>::iterator f = states.begin();
while( true )
{
f = find( f, states.end(), curState );
if( f == states.end() ) return false;
if( ( *f ).symbol == '*' || ( *f ).symbol == symbol || ( ( *f ).symbol == 'B' && blank == symbol ) )
{ a.direction = ( *f ).direction; a.write = ( *f ).write; curState = ( *f ).next; break; }
f++;
}
return true;
}
void reset() { states.clear(); blank = '0'; curState = input = ""; }
string getInput() { return input; }
char getBlank() { return blank; }
private:
void parseState( string str, state& stt )
{
string a[5]; int idx = 0;
for( string::iterator si = str.begin(); si != str.end(); si++ )
{ if( ( *si ) == ';' ) idx++; else a[idx].append( &( *si ), 1 ); }
stt.name = a[0]; stt.symbol = a[1][0]; stt.write = a[2][0]; stt.direction = a[3][0]; stt.next = a[4];
}
vector<state> states; char blank; string curState, input;
};
class utm
{
public:
utm() { files[0] = "incrementer.utm"; files[1] = "busy_beaver.utm"; files[2] = "sort.utm"; }
void start()
{
while( true )
{
reset(); int t = showMenu(); if( t == 0 ) return;
if( !at.loadTable( files[t - 1] ) ) return; startMachine();
}
}
private:
void simulate()
{
char r; action a;
while( true ) { tp.print(); r = tp.read(); if( !( at.action( r, a ) ) ) break; tp.action( &a ); }
cout << endl << endl; system( "pause" );
}
int showMenu()
{
int t = -1;
while( t < 0 || t > 3 )
{
system( "cls" ); cout << "1. Incrementer\n2. Busy beaver\n3. Sort\n\n0. Quit";
cout << endl << endl << "Choose an action "; cin >> t;
}
return t;
}
void reset() { tp.reset(); at.reset(); }
void startMachine() { system( "cls" ); tp.clear( at.getBlank() ); tp.input( at.getInput() ); simulate(); }
tape tp; actionTable at; string files[7];
};
int main( int a, char* args[] ){ utm mm; mm.start(); return 0; }
| package turing
type Symbol byte
type Motion byte
const (
Left Motion = 'L'
Right Motion = 'R'
Stay Motion = 'N'
)
type Tape struct {
data []Symbol
pos, left int
blank Symbol
}
func NewTape(blank Symbol, start int, data []Symbol) *Tape {
t := &Tape{
data: data,
blank: blank,
}
if start < 0 {
t.Left(-start)
}
t.Right(start)
return t
}
func (t *Tape) Stay() {}
func (t *Tape) Data() []Symbol { return t.data[t.left:] }
func (t *Tape) Read() Symbol { return t.data[t.pos] }
func (t *Tape) Write(s Symbol) { t.data[t.pos] = s }
func (t *Tape) Dup() *Tape {
t2 := &Tape{
data: make([]Symbol, len(t.Data())),
blank: t.blank,
}
copy(t2.data, t.Data())
t2.pos = t.pos - t.left
return t2
}
func (t *Tape) String() string {
s := ""
for i := t.left; i < len(t.data); i++ {
b := t.data[i]
if i == t.pos {
s += "[" + string(b) + "]"
} else {
s += " " + string(b) + " "
}
}
return s
}
func (t *Tape) Move(a Motion) {
switch a {
case Left:
t.Left(1)
case Right:
t.Right(1)
case Stay:
t.Stay()
}
}
const minSz = 16
func (t *Tape) Left(n int) {
t.pos -= n
if t.pos < 0 {
var sz int
for sz = minSz; cap(t.data[t.left:])-t.pos >= sz; sz <<= 1 {
}
newd := make([]Symbol, sz)
newl := len(newd) - cap(t.data[t.left:])
n := copy(newd[newl:], t.data[t.left:])
t.data = newd[:newl+n]
t.pos += newl - t.left
t.left = newl
}
if t.pos < t.left {
if t.blank != 0 {
for i := t.pos; i < t.left; i++ {
t.data[i] = t.blank
}
}
t.left = t.pos
}
}
func (t *Tape) Right(n int) {
t.pos += n
if t.pos >= cap(t.data) {
var sz int
for sz = minSz; t.pos >= sz; sz <<= 1 {
}
newd := make([]Symbol, sz)
n := copy(newd[t.left:], t.data[t.left:])
t.data = newd[:t.left+n]
}
if i := len(t.data); t.pos >= i {
t.data = t.data[:t.pos+1]
if t.blank != 0 {
for ; i < len(t.data); i++ {
t.data[i] = t.blank
}
}
}
}
type State string
type Rule struct {
State
Symbol
Write Symbol
Motion
Next State
}
func (i *Rule) key() key { return key{i.State, i.Symbol} }
func (i *Rule) action() action { return action{i.Write, i.Motion, i.Next} }
type key struct {
State
Symbol
}
type action struct {
write Symbol
Motion
next State
}
type Machine struct {
tape *Tape
start, state State
transition map[key]action
l func(string, ...interface{})
}
func NewMachine(rules []Rule) *Machine {
m := &Machine{transition: make(map[key]action, len(rules))}
if len(rules) > 0 {
m.start = rules[0].State
}
for _, r := range rules {
m.transition[r.key()] = r.action()
}
return m
}
func (m *Machine) Run(input *Tape) (int, *Tape) {
m.tape = input.Dup()
m.state = m.start
for cnt := 0; ; cnt++ {
if m.l != nil {
m.l("%3d %4s: %v\n", cnt, m.state, m.tape)
}
sym := m.tape.Read()
act, ok := m.transition[key{m.state, sym}]
if !ok {
return cnt, m.tape
}
m.tape.Write(act.write)
m.tape.Move(act.Motion)
m.state = act.next
}
}
|
Change the following C++ code into Go without altering its purpose. | #include <vector>
#include <string>
#include <iostream>
#include <algorithm>
#include <fstream>
#include <iomanip>
typedef unsigned int uint;
using namespace std;
const uint TAPE_MAX_LEN = 49152;
struct action { char write, direction; };
class tape
{
public:
tape( uint startPos = TAPE_MAX_LEN >> 1 ) : MAX_LEN( TAPE_MAX_LEN ) { _sp = startPos; reset(); }
void reset() { clear( '0' ); headPos = _sp; }
char read(){ return _t[headPos]; }
void input( string a ){ if( a == "" ) return; for( uint s = 0; s < a.length(); s++ ) _t[headPos + s] = a[s]; }
void clear( char c ) { _t.clear(); blk = c; _t.resize( MAX_LEN, blk ); }
void action( const action* a ) { write( a->write ); move( a->direction ); }
void print( int c = 10 )
{
int ml = static_cast<int>( MAX_LEN ), st = static_cast<int>( headPos ) - c, ed = static_cast<int>( headPos ) + c + 1, tx;
for( int x = st; x < ed; x++ )
{ tx = x; if( tx < 0 ) tx += ml; if( tx >= ml ) tx -= ml; cout << _t[tx]; }
cout << endl << setw( c + 1 ) << "^" << endl;
}
private:
void move( char d ) { if( d == 'N' ) return; headPos += d == 'R' ? 1 : -1; if( headPos >= MAX_LEN ) headPos = d == 'R' ? 0 : MAX_LEN - 1; }
void write( char a ) { if( a != 'N' ) { if( a == 'B' ) _t[headPos] = blk; else _t[headPos] = a; } }
string _t; uint headPos, _sp; char blk; const uint MAX_LEN;
};
class state
{
public:
bool operator ==( const string o ) { return o == name; }
string name, next; char symbol, write, direction;
};
class actionTable
{
public:
bool loadTable( string file )
{
reset();
ifstream mf; mf.open( file.c_str() ); if( mf.is_open() )
{
string str; state stt;
while( mf.good() )
{
getline( mf, str ); if( str[0] == '\'' ) break;
parseState( str, stt ); states.push_back( stt );
}
while( mf.good() )
{
getline( mf, str ); if( str == "" ) continue;
if( str[0] == '!' ) blank = str.erase( 0, 1 )[0];
if( str[0] == '^' ) curState = str.erase( 0, 1 );
if( str[0] == '>' ) input = str.erase( 0, 1 );
}
mf.close(); return true;
}
cout << "Could not open " << file << endl; return false;
}
bool action( char symbol, action& a )
{
vector<state>::iterator f = states.begin();
while( true )
{
f = find( f, states.end(), curState );
if( f == states.end() ) return false;
if( ( *f ).symbol == '*' || ( *f ).symbol == symbol || ( ( *f ).symbol == 'B' && blank == symbol ) )
{ a.direction = ( *f ).direction; a.write = ( *f ).write; curState = ( *f ).next; break; }
f++;
}
return true;
}
void reset() { states.clear(); blank = '0'; curState = input = ""; }
string getInput() { return input; }
char getBlank() { return blank; }
private:
void parseState( string str, state& stt )
{
string a[5]; int idx = 0;
for( string::iterator si = str.begin(); si != str.end(); si++ )
{ if( ( *si ) == ';' ) idx++; else a[idx].append( &( *si ), 1 ); }
stt.name = a[0]; stt.symbol = a[1][0]; stt.write = a[2][0]; stt.direction = a[3][0]; stt.next = a[4];
}
vector<state> states; char blank; string curState, input;
};
class utm
{
public:
utm() { files[0] = "incrementer.utm"; files[1] = "busy_beaver.utm"; files[2] = "sort.utm"; }
void start()
{
while( true )
{
reset(); int t = showMenu(); if( t == 0 ) return;
if( !at.loadTable( files[t - 1] ) ) return; startMachine();
}
}
private:
void simulate()
{
char r; action a;
while( true ) { tp.print(); r = tp.read(); if( !( at.action( r, a ) ) ) break; tp.action( &a ); }
cout << endl << endl; system( "pause" );
}
int showMenu()
{
int t = -1;
while( t < 0 || t > 3 )
{
system( "cls" ); cout << "1. Incrementer\n2. Busy beaver\n3. Sort\n\n0. Quit";
cout << endl << endl << "Choose an action "; cin >> t;
}
return t;
}
void reset() { tp.reset(); at.reset(); }
void startMachine() { system( "cls" ); tp.clear( at.getBlank() ); tp.input( at.getInput() ); simulate(); }
tape tp; actionTable at; string files[7];
};
int main( int a, char* args[] ){ utm mm; mm.start(); return 0; }
| package turing
type Symbol byte
type Motion byte
const (
Left Motion = 'L'
Right Motion = 'R'
Stay Motion = 'N'
)
type Tape struct {
data []Symbol
pos, left int
blank Symbol
}
func NewTape(blank Symbol, start int, data []Symbol) *Tape {
t := &Tape{
data: data,
blank: blank,
}
if start < 0 {
t.Left(-start)
}
t.Right(start)
return t
}
func (t *Tape) Stay() {}
func (t *Tape) Data() []Symbol { return t.data[t.left:] }
func (t *Tape) Read() Symbol { return t.data[t.pos] }
func (t *Tape) Write(s Symbol) { t.data[t.pos] = s }
func (t *Tape) Dup() *Tape {
t2 := &Tape{
data: make([]Symbol, len(t.Data())),
blank: t.blank,
}
copy(t2.data, t.Data())
t2.pos = t.pos - t.left
return t2
}
func (t *Tape) String() string {
s := ""
for i := t.left; i < len(t.data); i++ {
b := t.data[i]
if i == t.pos {
s += "[" + string(b) + "]"
} else {
s += " " + string(b) + " "
}
}
return s
}
func (t *Tape) Move(a Motion) {
switch a {
case Left:
t.Left(1)
case Right:
t.Right(1)
case Stay:
t.Stay()
}
}
const minSz = 16
func (t *Tape) Left(n int) {
t.pos -= n
if t.pos < 0 {
var sz int
for sz = minSz; cap(t.data[t.left:])-t.pos >= sz; sz <<= 1 {
}
newd := make([]Symbol, sz)
newl := len(newd) - cap(t.data[t.left:])
n := copy(newd[newl:], t.data[t.left:])
t.data = newd[:newl+n]
t.pos += newl - t.left
t.left = newl
}
if t.pos < t.left {
if t.blank != 0 {
for i := t.pos; i < t.left; i++ {
t.data[i] = t.blank
}
}
t.left = t.pos
}
}
func (t *Tape) Right(n int) {
t.pos += n
if t.pos >= cap(t.data) {
var sz int
for sz = minSz; t.pos >= sz; sz <<= 1 {
}
newd := make([]Symbol, sz)
n := copy(newd[t.left:], t.data[t.left:])
t.data = newd[:t.left+n]
}
if i := len(t.data); t.pos >= i {
t.data = t.data[:t.pos+1]
if t.blank != 0 {
for ; i < len(t.data); i++ {
t.data[i] = t.blank
}
}
}
}
type State string
type Rule struct {
State
Symbol
Write Symbol
Motion
Next State
}
func (i *Rule) key() key { return key{i.State, i.Symbol} }
func (i *Rule) action() action { return action{i.Write, i.Motion, i.Next} }
type key struct {
State
Symbol
}
type action struct {
write Symbol
Motion
next State
}
type Machine struct {
tape *Tape
start, state State
transition map[key]action
l func(string, ...interface{})
}
func NewMachine(rules []Rule) *Machine {
m := &Machine{transition: make(map[key]action, len(rules))}
if len(rules) > 0 {
m.start = rules[0].State
}
for _, r := range rules {
m.transition[r.key()] = r.action()
}
return m
}
func (m *Machine) Run(input *Tape) (int, *Tape) {
m.tape = input.Dup()
m.state = m.start
for cnt := 0; ; cnt++ {
if m.l != nil {
m.l("%3d %4s: %v\n", cnt, m.state, m.tape)
}
sym := m.tape.Read()
act, ok := m.transition[key{m.state, sym}]
if !ok {
return cnt, m.tape
}
m.tape.Write(act.write)
m.tape.Move(act.Motion)
m.state = act.next
}
}
|
Produce a language-to-language conversion: from C++ to Go, same semantics. | #include <direct.h>
#include <fstream>
int main() {
std::fstream f("output.txt", std::ios::out);
f.close();
f.open("/output.txt", std::ios::out);
f.close();
_mkdir("docs");
_mkdir("/docs");
return 0;
}
| package main
import (
"fmt"
"os"
)
func createFile(fn string) {
f, err := os.Create(fn)
if err != nil {
fmt.Println(err)
return
}
fmt.Println("file", fn, "created!")
f.Close()
}
func createDir(dn string) {
err := os.Mkdir(dn, 0666)
if err != nil {
fmt.Println(err)
return
}
fmt.Println("directory", dn, "created!")
}
func main() {
createFile("input.txt")
createFile("/input.txt")
createDir("docs")
createDir("/docs")
}
|
Produce a functionally identical Go code for the snippet given in C++. | #include <iostream>
#include <cstdint>
#include "prime_sieve.hpp"
typedef uint32_t integer;
int count_digits(integer n) {
int digits = 0;
for (; n > 0; ++digits)
n /= 10;
return digits;
}
integer change_digit(integer n, int index, int new_digit) {
integer p = 1;
integer changed = 0;
for (; index > 0; p *= 10, n /= 10, --index)
changed += p * (n % 10);
changed += (10 * (n/10) + new_digit) * p;
return changed;
}
bool unprimeable(const prime_sieve& sieve, integer n) {
if (sieve.is_prime(n))
return false;
int d = count_digits(n);
for (int i = 0; i < d; ++i) {
for (int j = 0; j <= 9; ++j) {
integer m = change_digit(n, i, j);
if (m != n && sieve.is_prime(m))
return false;
}
}
return true;
}
int main() {
const integer limit = 10000000;
prime_sieve sieve(limit);
std::cout.imbue(std::locale(""));
std::cout << "First 35 unprimeable numbers:\n";
integer n = 100;
integer lowest[10] = { 0 };
for (int count = 0, found = 0; n < limit && (found < 10 || count < 600); ++n) {
if (unprimeable(sieve, n)) {
if (count < 35) {
if (count != 0)
std::cout << ", ";
std::cout << n;
}
++count;
if (count == 600)
std::cout << "\n600th unprimeable number: " << n << '\n';
int last_digit = n % 10;
if (lowest[last_digit] == 0) {
lowest[last_digit] = n;
++found;
}
}
}
for (int i = 0; i < 10; ++i)
std::cout << "Least unprimeable number ending in " << i << ": " << lowest[i] << '\n';
return 0;
}
| package main
import (
"fmt"
"strconv"
)
func isPrime(n int) bool {
switch {
case n < 2:
return false
case n%2 == 0:
return n == 2
case n%3 == 0:
return n == 3
default:
d := 5
for d*d <= n {
if n%d == 0 {
return false
}
d += 2
if n%d == 0 {
return false
}
d += 4
}
return true
}
}
func commatize(n int) string {
s := fmt.Sprintf("%d", n)
le := len(s)
for i := le - 3; i >= 1; i -= 3 {
s = s[0:i] + "," + s[i:]
}
return s
}
func main() {
fmt.Println("The first 35 unprimeable numbers are:")
count := 0
var firstNum [10]int
outer:
for i, countFirst := 100, 0; countFirst < 10; i++ {
if isPrime(i) {
continue
}
s := strconv.Itoa(i)
le := len(s)
b := []byte(s)
for j := 0; j < le; j++ {
for k := byte('0'); k <= '9'; k++ {
if s[j] == k {
continue
}
b[j] = k
n, _ := strconv.Atoi(string(b))
if isPrime(n) {
continue outer
}
}
b[j] = s[j]
}
lastDigit := s[le-1] - '0'
if firstNum[lastDigit] == 0 {
firstNum[lastDigit] = i
countFirst++
}
count++
if count <= 35 {
fmt.Printf("%d ", i)
}
if count == 35 {
fmt.Print("\n\nThe 600th unprimeable number is: ")
}
if count == 600 {
fmt.Printf("%s\n\n", commatize(i))
}
}
fmt.Println("The first unprimeable number that ends in:")
for i := 0; i < 10; i++ {
fmt.Printf(" %d is: %9s\n", i, commatize(firstNum[i]))
}
}
|
Write a version of this C++ function in Go with identical behavior. | #include <iostream>
#include <iomanip>
inline int sign(int i) {
return i < 0 ? -1 : i > 0;
}
inline int& E(int *x, int row, int col) {
return x[row * (row + 1) / 2 + col];
}
int iter(int *v, int *diff) {
E(v, 0, 0) = 151;
E(v, 2, 0) = 40;
E(v, 4, 1) = 11;
E(v, 4, 3) = 4;
for (auto i = 1u; i < 5u; i++)
for (auto j = 0u; j <= i; j++) {
E(diff, i, j) = 0;
if (j < i)
E(diff, i, j) += E(v, i - 1, j) - E(v, i, j + 1) - E(v, i, j);
if (j)
E(diff, i, j) += E(v, i - 1, j - 1) - E(v, i, j - 1) - E(v, i, j);
}
for (auto i = 0u; i < 4u; i++)
for (auto j = 0u; j < i; j++)
E(diff, i, j) += E(v, i + 1, j) + E(v, i + 1, j + 1) - E(v, i, j);
E(diff, 4, 2) += E(v, 4, 0) + E(v, 4, 4) - E(v, 4, 2);
uint sum;
int e = 0;
for (auto i = sum = 0u; i < 15u; i++) {
sum += !!sign(e = diff[i]);
if (e >= 4 || e <= -4)
v[i] += e / 5;
else if (rand() < RAND_MAX / 4)
v[i] += sign(e);
}
return sum;
}
void show(int *x) {
for (auto i = 0u; i < 5u; i++)
for (auto j = 0u; j <= i; j++)
std::cout << std::setw(4u) << *(x++) << (j < i ? ' ' : '\n');
}
int main() {
int v[15] = { 0 }, diff[15] = { 0 };
for (auto i = 1u, s = 1u; s; i++) {
s = iter(v, diff);
std::cout << "pass " << i << ": " << s << std::endl;
}
show(v);
return 0;
}
| package main
import "fmt"
type expr struct {
x, y, z float64
c float64
}
func addExpr(a, b expr) expr {
return expr{a.x + b.x, a.y + b.y, a.z + b.z, a.c + b.c}
}
func subExpr(a, b expr) expr {
return expr{a.x - b.x, a.y - b.y, a.z - b.z, a.c - b.c}
}
func mulExpr(a expr, c float64) expr {
return expr{a.x * c, a.y * c, a.z * c, a.c * c}
}
func addRow(l []expr) []expr {
if len(l) == 0 {
panic("wrong")
}
r := make([]expr, len(l)-1)
for i := range r {
r[i] = addExpr(l[i], l[i+1])
}
return r
}
func substX(a, b expr) expr {
if b.x == 0 {
panic("wrong")
}
return subExpr(a, mulExpr(b, a.x/b.x))
}
func substY(a, b expr) expr {
if b.y == 0 {
panic("wrong")
}
return subExpr(a, mulExpr(b, a.y/b.y))
}
func substZ(a, b expr) expr {
if b.z == 0 {
panic("wrong")
}
return subExpr(a, mulExpr(b, a.z/b.z))
}
func solveX(a expr) float64 {
if a.x == 0 || a.y != 0 || a.z != 0 {
panic("wrong")
}
return -a.c / a.x
}
func solveY(a expr) float64 {
if a.x != 0 || a.y == 0 || a.z != 0 {
panic("wrong")
}
return -a.c / a.y
}
func solveZ(a expr) float64 {
if a.x != 0 || a.y != 0 || a.z == 0 {
panic("wrong")
}
return -a.c / a.z
}
func main() {
r5 := []expr{{x: 1}, {c: 11}, {y: 1}, {c: 4}, {z: 1}}
fmt.Println("bottom row:", r5)
r4 := addRow(r5)
fmt.Println("next row up:", r4)
r3 := addRow(r4)
fmt.Println("middle row:", r3)
xyz := subExpr(expr{y: 1}, expr{x: 1, z: 1})
fmt.Println("xyz relation:", xyz)
r3[2] = substZ(r3[2], xyz)
fmt.Println("middle row after substituting for z:", r3)
b := expr{c: 40}
xy := subExpr(r3[0], b)
fmt.Println("xy relation:", xy)
r3[0] = b
r3[2] = substX(r3[2], xy)
fmt.Println("middle row after substituting for x:", r3)
r2 := addRow(r3)
fmt.Println("next row up:", r2)
r1 := addRow(r2)
fmt.Println("top row:", r1)
y := subExpr(r1[0], expr{c: 151})
fmt.Println("y relation:", y)
x := substY(xy, y)
fmt.Println("x relation:", x)
z := substX(substY(xyz, y), x)
fmt.Println("z relation:", z)
fmt.Println("x =", solveX(x))
fmt.Println("y =", solveY(y))
fmt.Println("z =", solveZ(z))
}
|
Translate this program into Go but keep the logic exactly as in C++. | #include <iostream>
#include <iomanip>
inline int sign(int i) {
return i < 0 ? -1 : i > 0;
}
inline int& E(int *x, int row, int col) {
return x[row * (row + 1) / 2 + col];
}
int iter(int *v, int *diff) {
E(v, 0, 0) = 151;
E(v, 2, 0) = 40;
E(v, 4, 1) = 11;
E(v, 4, 3) = 4;
for (auto i = 1u; i < 5u; i++)
for (auto j = 0u; j <= i; j++) {
E(diff, i, j) = 0;
if (j < i)
E(diff, i, j) += E(v, i - 1, j) - E(v, i, j + 1) - E(v, i, j);
if (j)
E(diff, i, j) += E(v, i - 1, j - 1) - E(v, i, j - 1) - E(v, i, j);
}
for (auto i = 0u; i < 4u; i++)
for (auto j = 0u; j < i; j++)
E(diff, i, j) += E(v, i + 1, j) + E(v, i + 1, j + 1) - E(v, i, j);
E(diff, 4, 2) += E(v, 4, 0) + E(v, 4, 4) - E(v, 4, 2);
uint sum;
int e = 0;
for (auto i = sum = 0u; i < 15u; i++) {
sum += !!sign(e = diff[i]);
if (e >= 4 || e <= -4)
v[i] += e / 5;
else if (rand() < RAND_MAX / 4)
v[i] += sign(e);
}
return sum;
}
void show(int *x) {
for (auto i = 0u; i < 5u; i++)
for (auto j = 0u; j <= i; j++)
std::cout << std::setw(4u) << *(x++) << (j < i ? ' ' : '\n');
}
int main() {
int v[15] = { 0 }, diff[15] = { 0 };
for (auto i = 1u, s = 1u; s; i++) {
s = iter(v, diff);
std::cout << "pass " << i << ": " << s << std::endl;
}
show(v);
return 0;
}
| package main
import "fmt"
type expr struct {
x, y, z float64
c float64
}
func addExpr(a, b expr) expr {
return expr{a.x + b.x, a.y + b.y, a.z + b.z, a.c + b.c}
}
func subExpr(a, b expr) expr {
return expr{a.x - b.x, a.y - b.y, a.z - b.z, a.c - b.c}
}
func mulExpr(a expr, c float64) expr {
return expr{a.x * c, a.y * c, a.z * c, a.c * c}
}
func addRow(l []expr) []expr {
if len(l) == 0 {
panic("wrong")
}
r := make([]expr, len(l)-1)
for i := range r {
r[i] = addExpr(l[i], l[i+1])
}
return r
}
func substX(a, b expr) expr {
if b.x == 0 {
panic("wrong")
}
return subExpr(a, mulExpr(b, a.x/b.x))
}
func substY(a, b expr) expr {
if b.y == 0 {
panic("wrong")
}
return subExpr(a, mulExpr(b, a.y/b.y))
}
func substZ(a, b expr) expr {
if b.z == 0 {
panic("wrong")
}
return subExpr(a, mulExpr(b, a.z/b.z))
}
func solveX(a expr) float64 {
if a.x == 0 || a.y != 0 || a.z != 0 {
panic("wrong")
}
return -a.c / a.x
}
func solveY(a expr) float64 {
if a.x != 0 || a.y == 0 || a.z != 0 {
panic("wrong")
}
return -a.c / a.y
}
func solveZ(a expr) float64 {
if a.x != 0 || a.y != 0 || a.z == 0 {
panic("wrong")
}
return -a.c / a.z
}
func main() {
r5 := []expr{{x: 1}, {c: 11}, {y: 1}, {c: 4}, {z: 1}}
fmt.Println("bottom row:", r5)
r4 := addRow(r5)
fmt.Println("next row up:", r4)
r3 := addRow(r4)
fmt.Println("middle row:", r3)
xyz := subExpr(expr{y: 1}, expr{x: 1, z: 1})
fmt.Println("xyz relation:", xyz)
r3[2] = substZ(r3[2], xyz)
fmt.Println("middle row after substituting for z:", r3)
b := expr{c: 40}
xy := subExpr(r3[0], b)
fmt.Println("xy relation:", xy)
r3[0] = b
r3[2] = substX(r3[2], xy)
fmt.Println("middle row after substituting for x:", r3)
r2 := addRow(r3)
fmt.Println("next row up:", r2)
r1 := addRow(r2)
fmt.Println("top row:", r1)
y := subExpr(r1[0], expr{c: 151})
fmt.Println("y relation:", y)
x := substY(xy, y)
fmt.Println("x relation:", x)
z := substX(substY(xyz, y), x)
fmt.Println("z relation:", z)
fmt.Println("x =", solveX(x))
fmt.Println("y =", solveY(y))
fmt.Println("z =", solveZ(z))
}
|
Generate an equivalent Go version of this C++ code. | #include <gmp.h>
#include <iostream>
using namespace std;
typedef unsigned long long int u64;
bool primality_pretest(u64 k) {
if (!(k % 3) || !(k % 5) || !(k % 7) || !(k % 11) ||
!(k % 13) || !(k % 17) || !(k % 19) || !(k % 23)
) {
return (k <= 23);
}
return true;
}
bool probprime(u64 k, mpz_t n) {
mpz_set_ui(n, k);
return mpz_probab_prime_p(n, 0);
}
bool is_chernick(int n, u64 m, mpz_t z) {
if (!primality_pretest(6 * m + 1)) {
return false;
}
if (!primality_pretest(12 * m + 1)) {
return false;
}
u64 t = 9 * m;
for (int i = 1; i <= n - 2; i++) {
if (!primality_pretest((t << i) + 1)) {
return false;
}
}
if (!probprime(6 * m + 1, z)) {
return false;
}
if (!probprime(12 * m + 1, z)) {
return false;
}
for (int i = 1; i <= n - 2; i++) {
if (!probprime((t << i) + 1, z)) {
return false;
}
}
return true;
}
int main() {
mpz_t z;
mpz_inits(z, NULL);
for (int n = 3; n <= 10; n++) {
u64 multiplier = (n > 4) ? (1 << (n - 4)) : 1;
if (n > 5) {
multiplier *= 5;
}
for (u64 k = 1; ; k++) {
u64 m = k * multiplier;
if (is_chernick(n, m, z)) {
cout << "a(" << n << ") has m = " << m << endl;
break;
}
}
}
return 0;
}
| package main
import (
"fmt"
"math/big"
)
var (
zero = new(big.Int)
prod = new(big.Int)
fact = new(big.Int)
)
func ccFactors(n, m uint64) (*big.Int, bool) {
prod.SetUint64(6*m + 1)
if !prod.ProbablyPrime(0) {
return zero, false
}
fact.SetUint64(12*m + 1)
if !fact.ProbablyPrime(0) {
return zero, false
}
prod.Mul(prod, fact)
for i := uint64(1); i <= n-2; i++ {
fact.SetUint64((1<<i)*9*m + 1)
if !fact.ProbablyPrime(0) {
return zero, false
}
prod.Mul(prod, fact)
}
return prod, true
}
func ccNumbers(start, end uint64) {
for n := start; n <= end; n++ {
m := uint64(1)
if n > 4 {
m = 1 << (n - 4)
}
for {
num, ok := ccFactors(n, m)
if ok {
fmt.Printf("a(%d) = %d\n", n, num)
break
}
if n <= 4 {
m++
} else {
m += 1 << (n - 4)
}
}
}
}
func main() {
ccNumbers(3, 9)
}
|
Port the provided C++ code into Go while preserving the original functionality. | #include <iostream>
const double EPS = 0.001;
const double EPS_SQUARE = EPS * EPS;
double side(double x1, double y1, double x2, double y2, double x, double y) {
return (y2 - y1) * (x - x1) + (-x2 + x1) * (y - y1);
}
bool naivePointInTriangle(double x1, double y1, double x2, double y2, double x3, double y3, double x, double y) {
double checkSide1 = side(x1, y1, x2, y2, x, y) >= 0;
double checkSide2 = side(x2, y2, x3, y3, x, y) >= 0;
double checkSide3 = side(x3, y3, x1, y1, x, y) >= 0;
return checkSide1 && checkSide2 && checkSide3;
}
bool pointInTriangleBoundingBox(double x1, double y1, double x2, double y2, double x3, double y3, double x, double y) {
double xMin = std::min(x1, std::min(x2, x3)) - EPS;
double xMax = std::max(x1, std::max(x2, x3)) + EPS;
double yMin = std::min(y1, std::min(y2, y3)) - EPS;
double yMax = std::max(y1, std::max(y2, y3)) + EPS;
return !(x < xMin || xMax < x || y < yMin || yMax < y);
}
double distanceSquarePointToSegment(double x1, double y1, double x2, double y2, double x, double y) {
double p1_p2_squareLength = (x2 - x1) * (x2 - x1) + (y2 - y1) * (y2 - y1);
double dotProduct = ((x - x1) * (x2 - x1) + (y - y1) * (y2 - y1)) / p1_p2_squareLength;
if (dotProduct < 0) {
return (x - x1) * (x - x1) + (y - y1) * (y - y1);
} else if (dotProduct <= 1) {
double p_p1_squareLength = (x1 - x) * (x1 - x) + (y1 - y) * (y1 - y);
return p_p1_squareLength - dotProduct * dotProduct * p1_p2_squareLength;
} else {
return (x - x2) * (x - x2) + (y - y2) * (y - y2);
}
}
bool accuratePointInTriangle(double x1, double y1, double x2, double y2, double x3, double y3, double x, double y) {
if (!pointInTriangleBoundingBox(x1, y1, x2, y2, x3, y3, x, y)) {
return false;
}
if (naivePointInTriangle(x1, y1, x2, y2, x3, y3, x, y)) {
return true;
}
if (distanceSquarePointToSegment(x1, y1, x2, y2, x, y) <= EPS_SQUARE) {
return true;
}
if (distanceSquarePointToSegment(x2, y2, x3, y3, x, y) <= EPS_SQUARE) {
return true;
}
if (distanceSquarePointToSegment(x3, y3, x1, y1, x, y) <= EPS_SQUARE) {
return true;
}
return false;
}
void printPoint(double x, double y) {
std::cout << '(' << x << ", " << y << ')';
}
void printTriangle(double x1, double y1, double x2, double y2, double x3, double y3) {
std::cout << "Triangle is [";
printPoint(x1, y1);
std::cout << ", ";
printPoint(x2, y2);
std::cout << ", ";
printPoint(x3, y3);
std::cout << "]\n";
}
void test(double x1, double y1, double x2, double y2, double x3, double y3, double x, double y) {
printTriangle(x1, y1, x2, y2, x3, y3);
std::cout << "Point ";
printPoint(x, y);
std::cout << " is within triangle? ";
if (accuratePointInTriangle(x1, y1, x2, y2, x3, y3, x, y)) {
std::cout << "true\n";
} else {
std::cout << "false\n";
}
}
int main() {
test(1.5, 2.4, 5.1, -3.1, -3.8, 1.2, 0, 0);
test(1.5, 2.4, 5.1, -3.1, -3.8, 1.2, 0, 1);
test(1.5, 2.4, 5.1, -3.1, -3.8, 1.2, 3, 1);
std::cout << '\n';
test(0.1, 0.1111111111111111, 12.5, 33.333333333333336, 25, 11.11111111111111, 5.414285714285714, 14.349206349206348);
std::cout << '\n';
test(0.1, 0.1111111111111111, 12.5, 33.333333333333336, -12.5, 16.666666666666668, 5.414285714285714, 14.349206349206348);
std::cout << '\n';
return 0;
}
| package main
import (
"fmt"
"math"
)
const EPS = 0.001
const EPS_SQUARE = EPS * EPS
func side(x1, y1, x2, y2, x, y float64) float64 {
return (y2-y1)*(x-x1) + (-x2+x1)*(y-y1)
}
func naivePointInTriangle(x1, y1, x2, y2, x3, y3, x, y float64) bool {
checkSide1 := side(x1, y1, x2, y2, x, y) >= 0
checkSide2 := side(x2, y2, x3, y3, x, y) >= 0
checkSide3 := side(x3, y3, x1, y1, x, y) >= 0
return checkSide1 && checkSide2 && checkSide3
}
func pointInTriangleBoundingBox(x1, y1, x2, y2, x3, y3, x, y float64) bool {
xMin := math.Min(x1, math.Min(x2, x3)) - EPS
xMax := math.Max(x1, math.Max(x2, x3)) + EPS
yMin := math.Min(y1, math.Min(y2, y3)) - EPS
yMax := math.Max(y1, math.Max(y2, y3)) + EPS
return !(x < xMin || xMax < x || y < yMin || yMax < y)
}
func distanceSquarePointToSegment(x1, y1, x2, y2, x, y float64) float64 {
p1_p2_squareLength := (x2-x1)*(x2-x1) + (y2-y1)*(y2-y1)
dotProduct := ((x-x1)*(x2-x1) + (y-y1)*(y2-y1)) / p1_p2_squareLength
if dotProduct < 0 {
return (x-x1)*(x-x1) + (y-y1)*(y-y1)
} else if dotProduct <= 1 {
p_p1_squareLength := (x1-x)*(x1-x) + (y1-y)*(y1-y)
return p_p1_squareLength - dotProduct*dotProduct*p1_p2_squareLength
} else {
return (x-x2)*(x-x2) + (y-y2)*(y-y2)
}
}
func accuratePointInTriangle(x1, y1, x2, y2, x3, y3, x, y float64) bool {
if !pointInTriangleBoundingBox(x1, y1, x2, y2, x3, y3, x, y) {
return false
}
if naivePointInTriangle(x1, y1, x2, y2, x3, y3, x, y) {
return true
}
if distanceSquarePointToSegment(x1, y1, x2, y2, x, y) <= EPS_SQUARE {
return true
}
if distanceSquarePointToSegment(x2, y2, x3, y3, x, y) <= EPS_SQUARE {
return true
}
if distanceSquarePointToSegment(x3, y3, x1, y1, x, y) <= EPS_SQUARE {
return true
}
return false
}
func main() {
pts := [][2]float64{{0, 0}, {0, 1}, {3, 1}}
tri := [][2]float64{{3.0 / 2, 12.0 / 5}, {51.0 / 10, -31.0 / 10}, {-19.0 / 5, 1.2}}
fmt.Println("Triangle is", tri)
x1, y1 := tri[0][0], tri[0][1]
x2, y2 := tri[1][0], tri[1][1]
x3, y3 := tri[2][0], tri[2][1]
for _, pt := range pts {
x, y := pt[0], pt[1]
within := accuratePointInTriangle(x1, y1, x2, y2, x3, y3, x, y)
fmt.Println("Point", pt, "is within triangle?", within)
}
fmt.Println()
tri = [][2]float64{{1.0 / 10, 1.0 / 9}, {100.0 / 8, 100.0 / 3}, {100.0 / 4, 100.0 / 9}}
fmt.Println("Triangle is", tri)
x1, y1 = tri[0][0], tri[0][1]
x2, y2 = tri[1][0], tri[1][1]
x3, y3 = tri[2][0], tri[2][1]
x := x1 + (3.0/7)*(x2-x1)
y := y1 + (3.0/7)*(y2-y1)
pt := [2]float64{x, y}
within := accuratePointInTriangle(x1, y1, x2, y2, x3, y3, x, y)
fmt.Println("Point", pt, "is within triangle ?", within)
fmt.Println()
tri = [][2]float64{{1.0 / 10, 1.0 / 9}, {100.0 / 8, 100.0 / 3}, {-100.0 / 8, 100.0 / 6}}
fmt.Println("Triangle is", tri)
x3 = tri[2][0]
y3 = tri[2][1]
within = accuratePointInTriangle(x1, y1, x2, y2, x3, y3, x, y)
fmt.Println("Point", pt, "is within triangle ?", within)
}
|
Port the following code from C++ to Go with equivalent syntax and logic. | #include <iostream>
const double EPS = 0.001;
const double EPS_SQUARE = EPS * EPS;
double side(double x1, double y1, double x2, double y2, double x, double y) {
return (y2 - y1) * (x - x1) + (-x2 + x1) * (y - y1);
}
bool naivePointInTriangle(double x1, double y1, double x2, double y2, double x3, double y3, double x, double y) {
double checkSide1 = side(x1, y1, x2, y2, x, y) >= 0;
double checkSide2 = side(x2, y2, x3, y3, x, y) >= 0;
double checkSide3 = side(x3, y3, x1, y1, x, y) >= 0;
return checkSide1 && checkSide2 && checkSide3;
}
bool pointInTriangleBoundingBox(double x1, double y1, double x2, double y2, double x3, double y3, double x, double y) {
double xMin = std::min(x1, std::min(x2, x3)) - EPS;
double xMax = std::max(x1, std::max(x2, x3)) + EPS;
double yMin = std::min(y1, std::min(y2, y3)) - EPS;
double yMax = std::max(y1, std::max(y2, y3)) + EPS;
return !(x < xMin || xMax < x || y < yMin || yMax < y);
}
double distanceSquarePointToSegment(double x1, double y1, double x2, double y2, double x, double y) {
double p1_p2_squareLength = (x2 - x1) * (x2 - x1) + (y2 - y1) * (y2 - y1);
double dotProduct = ((x - x1) * (x2 - x1) + (y - y1) * (y2 - y1)) / p1_p2_squareLength;
if (dotProduct < 0) {
return (x - x1) * (x - x1) + (y - y1) * (y - y1);
} else if (dotProduct <= 1) {
double p_p1_squareLength = (x1 - x) * (x1 - x) + (y1 - y) * (y1 - y);
return p_p1_squareLength - dotProduct * dotProduct * p1_p2_squareLength;
} else {
return (x - x2) * (x - x2) + (y - y2) * (y - y2);
}
}
bool accuratePointInTriangle(double x1, double y1, double x2, double y2, double x3, double y3, double x, double y) {
if (!pointInTriangleBoundingBox(x1, y1, x2, y2, x3, y3, x, y)) {
return false;
}
if (naivePointInTriangle(x1, y1, x2, y2, x3, y3, x, y)) {
return true;
}
if (distanceSquarePointToSegment(x1, y1, x2, y2, x, y) <= EPS_SQUARE) {
return true;
}
if (distanceSquarePointToSegment(x2, y2, x3, y3, x, y) <= EPS_SQUARE) {
return true;
}
if (distanceSquarePointToSegment(x3, y3, x1, y1, x, y) <= EPS_SQUARE) {
return true;
}
return false;
}
void printPoint(double x, double y) {
std::cout << '(' << x << ", " << y << ')';
}
void printTriangle(double x1, double y1, double x2, double y2, double x3, double y3) {
std::cout << "Triangle is [";
printPoint(x1, y1);
std::cout << ", ";
printPoint(x2, y2);
std::cout << ", ";
printPoint(x3, y3);
std::cout << "]\n";
}
void test(double x1, double y1, double x2, double y2, double x3, double y3, double x, double y) {
printTriangle(x1, y1, x2, y2, x3, y3);
std::cout << "Point ";
printPoint(x, y);
std::cout << " is within triangle? ";
if (accuratePointInTriangle(x1, y1, x2, y2, x3, y3, x, y)) {
std::cout << "true\n";
} else {
std::cout << "false\n";
}
}
int main() {
test(1.5, 2.4, 5.1, -3.1, -3.8, 1.2, 0, 0);
test(1.5, 2.4, 5.1, -3.1, -3.8, 1.2, 0, 1);
test(1.5, 2.4, 5.1, -3.1, -3.8, 1.2, 3, 1);
std::cout << '\n';
test(0.1, 0.1111111111111111, 12.5, 33.333333333333336, 25, 11.11111111111111, 5.414285714285714, 14.349206349206348);
std::cout << '\n';
test(0.1, 0.1111111111111111, 12.5, 33.333333333333336, -12.5, 16.666666666666668, 5.414285714285714, 14.349206349206348);
std::cout << '\n';
return 0;
}
| package main
import (
"fmt"
"math"
)
const EPS = 0.001
const EPS_SQUARE = EPS * EPS
func side(x1, y1, x2, y2, x, y float64) float64 {
return (y2-y1)*(x-x1) + (-x2+x1)*(y-y1)
}
func naivePointInTriangle(x1, y1, x2, y2, x3, y3, x, y float64) bool {
checkSide1 := side(x1, y1, x2, y2, x, y) >= 0
checkSide2 := side(x2, y2, x3, y3, x, y) >= 0
checkSide3 := side(x3, y3, x1, y1, x, y) >= 0
return checkSide1 && checkSide2 && checkSide3
}
func pointInTriangleBoundingBox(x1, y1, x2, y2, x3, y3, x, y float64) bool {
xMin := math.Min(x1, math.Min(x2, x3)) - EPS
xMax := math.Max(x1, math.Max(x2, x3)) + EPS
yMin := math.Min(y1, math.Min(y2, y3)) - EPS
yMax := math.Max(y1, math.Max(y2, y3)) + EPS
return !(x < xMin || xMax < x || y < yMin || yMax < y)
}
func distanceSquarePointToSegment(x1, y1, x2, y2, x, y float64) float64 {
p1_p2_squareLength := (x2-x1)*(x2-x1) + (y2-y1)*(y2-y1)
dotProduct := ((x-x1)*(x2-x1) + (y-y1)*(y2-y1)) / p1_p2_squareLength
if dotProduct < 0 {
return (x-x1)*(x-x1) + (y-y1)*(y-y1)
} else if dotProduct <= 1 {
p_p1_squareLength := (x1-x)*(x1-x) + (y1-y)*(y1-y)
return p_p1_squareLength - dotProduct*dotProduct*p1_p2_squareLength
} else {
return (x-x2)*(x-x2) + (y-y2)*(y-y2)
}
}
func accuratePointInTriangle(x1, y1, x2, y2, x3, y3, x, y float64) bool {
if !pointInTriangleBoundingBox(x1, y1, x2, y2, x3, y3, x, y) {
return false
}
if naivePointInTriangle(x1, y1, x2, y2, x3, y3, x, y) {
return true
}
if distanceSquarePointToSegment(x1, y1, x2, y2, x, y) <= EPS_SQUARE {
return true
}
if distanceSquarePointToSegment(x2, y2, x3, y3, x, y) <= EPS_SQUARE {
return true
}
if distanceSquarePointToSegment(x3, y3, x1, y1, x, y) <= EPS_SQUARE {
return true
}
return false
}
func main() {
pts := [][2]float64{{0, 0}, {0, 1}, {3, 1}}
tri := [][2]float64{{3.0 / 2, 12.0 / 5}, {51.0 / 10, -31.0 / 10}, {-19.0 / 5, 1.2}}
fmt.Println("Triangle is", tri)
x1, y1 := tri[0][0], tri[0][1]
x2, y2 := tri[1][0], tri[1][1]
x3, y3 := tri[2][0], tri[2][1]
for _, pt := range pts {
x, y := pt[0], pt[1]
within := accuratePointInTriangle(x1, y1, x2, y2, x3, y3, x, y)
fmt.Println("Point", pt, "is within triangle?", within)
}
fmt.Println()
tri = [][2]float64{{1.0 / 10, 1.0 / 9}, {100.0 / 8, 100.0 / 3}, {100.0 / 4, 100.0 / 9}}
fmt.Println("Triangle is", tri)
x1, y1 = tri[0][0], tri[0][1]
x2, y2 = tri[1][0], tri[1][1]
x3, y3 = tri[2][0], tri[2][1]
x := x1 + (3.0/7)*(x2-x1)
y := y1 + (3.0/7)*(y2-y1)
pt := [2]float64{x, y}
within := accuratePointInTriangle(x1, y1, x2, y2, x3, y3, x, y)
fmt.Println("Point", pt, "is within triangle ?", within)
fmt.Println()
tri = [][2]float64{{1.0 / 10, 1.0 / 9}, {100.0 / 8, 100.0 / 3}, {-100.0 / 8, 100.0 / 6}}
fmt.Println("Triangle is", tri)
x3 = tri[2][0]
y3 = tri[2][1]
within = accuratePointInTriangle(x1, y1, x2, y2, x3, y3, x, y)
fmt.Println("Point", pt, "is within triangle ?", within)
}
|
Keep all operations the same but rewrite the snippet in Go. | #include <iomanip>
#include <iostream>
unsigned int divisor_count(unsigned int n) {
unsigned int total = 1;
for (; (n & 1) == 0; n >>= 1)
++total;
for (unsigned int p = 3; p * p <= n; p += 2) {
unsigned int count = 1;
for (; n % p == 0; n /= p)
++count;
total *= count;
}
if (n > 1)
total *= 2;
return total;
}
int main() {
const unsigned int limit = 100;
std::cout << "Count of divisors for the first " << limit << " positive integers:\n";
for (unsigned int n = 1; n <= limit; ++n) {
std::cout << std::setw(3) << divisor_count(n);
if (n % 20 == 0)
std::cout << '\n';
}
}
| package main
import "fmt"
func countDivisors(n int) int {
count := 0
i := 1
k := 2
if n%2 == 0 {
k = 1
}
for i*i <= n {
if n%i == 0 {
count++
j := n / i
if j != i {
count++
}
}
i += k
}
return count
}
func main() {
fmt.Println("The tau functions for the first 100 positive integers are:")
for i := 1; i <= 100; i++ {
fmt.Printf("%2d ", countDivisors(i))
if i%20 == 0 {
fmt.Println()
}
}
}
|
Port the provided C++ code into Go while preserving the original functionality. | #include <iomanip>
#include <iostream>
unsigned int divisor_count(unsigned int n) {
unsigned int total = 1;
for (; (n & 1) == 0; n >>= 1)
++total;
for (unsigned int p = 3; p * p <= n; p += 2) {
unsigned int count = 1;
for (; n % p == 0; n /= p)
++count;
total *= count;
}
if (n > 1)
total *= 2;
return total;
}
int main() {
const unsigned int limit = 100;
std::cout << "Count of divisors for the first " << limit << " positive integers:\n";
for (unsigned int n = 1; n <= limit; ++n) {
std::cout << std::setw(3) << divisor_count(n);
if (n % 20 == 0)
std::cout << '\n';
}
}
| package main
import "fmt"
func countDivisors(n int) int {
count := 0
i := 1
k := 2
if n%2 == 0 {
k = 1
}
for i*i <= n {
if n%i == 0 {
count++
j := n / i
if j != i {
count++
}
}
i += k
}
return count
}
func main() {
fmt.Println("The tau functions for the first 100 positive integers are:")
for i := 1; i <= 100; i++ {
fmt.Printf("%2d ", countDivisors(i))
if i%20 == 0 {
fmt.Println()
}
}
}
|
Rewrite this program in Go while keeping its functionality equivalent to the C++ version. | #include <string>
#include <iostream>
int main()
{
char* data = new char[sizeof(std::string)];
std::string* stringPtr = new (data) std::string("ABCD");
std::cout << *stringPtr << " 0x" << stringPtr << std::endl;
stringPtr->~basic_string();
stringPtr = new (data) std::string("123456");
std::cout << *stringPtr << " 0x" << stringPtr << std::endl;
stringPtr->~basic_string();
delete[] data;
}
| package main
import(
"fmt"
"unsafe"
"reflect"
)
func pointer() {
fmt.Printf("Pointer:\n")
var i int
p := &i
fmt.Printf("Before:\n\t%v: %v, %v\n", p, *p, i)
*p = 3
fmt.Printf("After:\n\t%v: %v, %v\n", p, *p, i)
}
func slice() {
fmt.Printf("Slice:\n")
var a [10]byte
var h reflect.SliceHeader
h.Data = uintptr(unsafe.Pointer(&a))
h.Len = len(a)
h.Cap = len(a)
s := *(*[]byte)(unsafe.Pointer(&h))
fmt.Printf("Before:\n\ts: %v\n\ta: %v\n", s, a)
copy(s, "A string.")
fmt.Printf("After:\n\ts: %v\n\ta: %v\n", s, a)
}
func main() {
pointer()
fmt.Println()
slice()
}
|
Write the same code in Go as shown below in C++. | #include <cstdint>
#include <iostream>
#include <sstream>
#include <gmpxx.h>
typedef mpz_class integer;
bool is_probably_prime(const integer& n) {
return mpz_probab_prime_p(n.get_mpz_t(), 25) != 0;
}
bool is_prime(unsigned int n) {
if (n < 2)
return false;
if (n % 2 == 0)
return n == 2;
if (n % 3 == 0)
return n == 3;
for (unsigned int p = 5; p * p <= n; p += 4) {
if (n % p == 0)
return false;
p += 2;
if (n % p == 0)
return false;
}
return true;
}
int main() {
const unsigned int max = 20;
integer primorial = 1;
for (unsigned int p = 0, count = 0, index = 0; count < max; ++p) {
if (!is_prime(p))
continue;
primorial *= p;
++index;
if (is_probably_prime(primorial - 1) || is_probably_prime(primorial + 1)) {
if (count > 0)
std::cout << ' ';
std::cout << index;
++count;
}
}
std::cout << '\n';
return 0;
}
| package main
import (
"fmt"
"math/big"
)
func main() {
one := big.NewInt(1)
pm := big.NewInt(1)
var px, nx int
var pb big.Int
primes(4000, func(p int64) bool {
pm.Mul(pm, pb.SetInt64(p))
px++
if pb.Add(pm, one).ProbablyPrime(0) ||
pb.Sub(pm, one).ProbablyPrime(0) {
fmt.Print(px, " ")
nx++
if nx == 20 {
fmt.Println()
return false
}
}
return true
})
}
func primes(limit int, f func(int64) bool) {
c := make([]bool, limit)
c[0] = true
c[1] = true
lm := int64(limit)
p := int64(2)
for {
f(p)
p2 := p * p
if p2 >= lm {
break
}
for i := p2; i < lm; i += p {
c[i] = true
}
for {
p++
if !c[p] {
break
}
}
}
for p++; p < lm; p++ {
if !c[p] && !f(p) {
break
}
}
}
|
Write the same code in Go as shown below in C++. | #include <map>
#include <string>
#include <iostream>
#include <iomanip>
const std::string DEFAULT_DNA = "CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATG"
"CTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTG"
"AGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGAT"
"GGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT"
"CGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGG"
"TCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA"
"TTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTAT"
"CGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTG"
"TCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGAC"
"GACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT";
class DnaBase {
public:
DnaBase(const std::string& dna = DEFAULT_DNA, int width = 50) : genome(dna), displayWidth(width) {
for (auto elm : dna) {
if (count.find(elm) == count.end())
count[elm] = 0;
++count[elm];
}
}
void viewGenome() {
std::cout << "Sequence:" << std::endl;
std::cout << std::endl;
int limit = genome.size() / displayWidth;
if (genome.size() % displayWidth != 0)
++limit;
for (int i = 0; i < limit; ++i) {
int beginPos = i * displayWidth;
std::cout << std::setw(4) << beginPos << " :" << std::setw(4) << genome.substr(beginPos, displayWidth) << std::endl;
}
std::cout << std::endl;
std::cout << "Base Count" << std::endl;
std::cout << "----------" << std::endl;
std::cout << std::endl;
int total = 0;
for (auto elm : count) {
std::cout << std::setw(4) << elm.first << " : " << elm.second << std::endl;
total += elm.second;
}
std::cout << std::endl;
std::cout << "Total: " << total << std::endl;
}
private:
std::string genome;
std::map<char, int> count;
int displayWidth;
};
int main(void) {
auto d = new DnaBase();
d->viewGenome();
delete d;
return 0;
}
| package main
import (
"fmt"
"sort"
)
func main() {
dna := "" +
"CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATG" +
"CTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTG" +
"AGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGAT" +
"GGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT" +
"CGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGG" +
"TCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA" +
"TTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTAT" +
"CGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTG" +
"TCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGAC" +
"GACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT"
fmt.Println("SEQUENCE:")
le := len(dna)
for i := 0; i < le; i += 50 {
k := i + 50
if k > le {
k = le
}
fmt.Printf("%5d: %s\n", i, dna[i:k])
}
baseMap := make(map[byte]int)
for i := 0; i < le; i++ {
baseMap[dna[i]]++
}
var bases []byte
for k := range baseMap {
bases = append(bases, k)
}
sort.Slice(bases, func(i, j int) bool {
return bases[i] < bases[j]
})
fmt.Println("\nBASE COUNT:")
for _, base := range bases {
fmt.Printf(" %c: %3d\n", base, baseMap[base])
}
fmt.Println(" ------")
fmt.Println(" Σ:", le)
fmt.Println(" ======")
}
|
Generate an equivalent Go version of this C++ code. | #include <map>
#include <string>
#include <iostream>
#include <iomanip>
const std::string DEFAULT_DNA = "CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATG"
"CTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTG"
"AGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGAT"
"GGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT"
"CGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGG"
"TCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA"
"TTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTAT"
"CGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTG"
"TCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGAC"
"GACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT";
class DnaBase {
public:
DnaBase(const std::string& dna = DEFAULT_DNA, int width = 50) : genome(dna), displayWidth(width) {
for (auto elm : dna) {
if (count.find(elm) == count.end())
count[elm] = 0;
++count[elm];
}
}
void viewGenome() {
std::cout << "Sequence:" << std::endl;
std::cout << std::endl;
int limit = genome.size() / displayWidth;
if (genome.size() % displayWidth != 0)
++limit;
for (int i = 0; i < limit; ++i) {
int beginPos = i * displayWidth;
std::cout << std::setw(4) << beginPos << " :" << std::setw(4) << genome.substr(beginPos, displayWidth) << std::endl;
}
std::cout << std::endl;
std::cout << "Base Count" << std::endl;
std::cout << "----------" << std::endl;
std::cout << std::endl;
int total = 0;
for (auto elm : count) {
std::cout << std::setw(4) << elm.first << " : " << elm.second << std::endl;
total += elm.second;
}
std::cout << std::endl;
std::cout << "Total: " << total << std::endl;
}
private:
std::string genome;
std::map<char, int> count;
int displayWidth;
};
int main(void) {
auto d = new DnaBase();
d->viewGenome();
delete d;
return 0;
}
| package main
import (
"fmt"
"sort"
)
func main() {
dna := "" +
"CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATG" +
"CTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTG" +
"AGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGAT" +
"GGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT" +
"CGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGG" +
"TCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA" +
"TTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTAT" +
"CGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTG" +
"TCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGAC" +
"GACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT"
fmt.Println("SEQUENCE:")
le := len(dna)
for i := 0; i < le; i += 50 {
k := i + 50
if k > le {
k = le
}
fmt.Printf("%5d: %s\n", i, dna[i:k])
}
baseMap := make(map[byte]int)
for i := 0; i < le; i++ {
baseMap[dna[i]]++
}
var bases []byte
for k := range baseMap {
bases = append(bases, k)
}
sort.Slice(bases, func(i, j int) bool {
return bases[i] < bases[j]
})
fmt.Println("\nBASE COUNT:")
for _, base := range bases {
fmt.Printf(" %c: %3d\n", base, baseMap[base])
}
fmt.Println(" ------")
fmt.Println(" Σ:", le)
fmt.Println(" ======")
}
|
Convert this C++ block to Go, preserving its control flow and logic. | #include <algorithm>
#include <array>
#include <chrono>
#include <iostream>
#include <mutex>
#include <random>
#include <string>
#include <string_view>
#include <thread>
const int timeScale = 42;
void Message(std::string_view message)
{
static std::mutex cout_mutex;
std::scoped_lock cout_lock(cout_mutex);
std::cout << message << std::endl;
}
struct Fork {
std::mutex mutex;
};
struct Dinner {
std::array<Fork, 5> forks;
~Dinner() { Message("Dinner is over"); }
};
class Philosopher
{
std::mt19937 rng{std::random_device {}()};
const std::string name;
Fork& left;
Fork& right;
std::thread worker;
void live();
void dine();
void ponder();
public:
Philosopher(std::string name_, Fork& l, Fork& r)
: name(std::move(name_)), left(l), right(r), worker(&Philosopher::live, this)
{}
~Philosopher()
{
worker.join();
Message(name + " went to sleep.");
}
};
void Philosopher::live()
{
for(;;)
{
{
std::scoped_lock dine_lock(left.mutex, right.mutex);
dine();
}
ponder();
}
}
void Philosopher::dine()
{
Message(name + " started eating.");
thread_local std::array<const char*, 3> foods {"chicken", "rice", "soda"};
thread_local std::array<const char*, 3> reactions {
"I like this %s!", "This %s is good.", "Mmm, %s..."
};
thread_local std::uniform_int_distribution<> dist(1, 6);
std::shuffle( foods.begin(), foods.end(), rng);
std::shuffle(reactions.begin(), reactions.end(), rng);
constexpr size_t buf_size = 64;
char buffer[buf_size];
for(int i = 0; i < 3; ++i) {
std::this_thread::sleep_for(std::chrono::milliseconds(dist(rng) * timeScale));
snprintf(buffer, buf_size, reactions[i], foods[i]);
Message(name + ": " + buffer);
}
std::this_thread::sleep_for(std::chrono::milliseconds(dist(rng)) * timeScale);
Message(name + " finished and left.");
}
void Philosopher::ponder()
{
static constexpr std::array<const char*, 5> topics {{
"politics", "art", "meaning of life", "source of morality", "how many straws makes a bale"
}};
thread_local std::uniform_int_distribution<> wait(1, 6);
thread_local std::uniform_int_distribution<> dist(0, topics.size() - 1);
while(dist(rng) > 0) {
std::this_thread::sleep_for(std::chrono::milliseconds(wait(rng) * 3 * timeScale));
Message(name + " is pondering about " + topics[dist(rng)] + ".");
}
std::this_thread::sleep_for(std::chrono::milliseconds(wait(rng) * 3 * timeScale));
Message(name + " is hungry again!");
}
int main()
{
Dinner dinner;
Message("Dinner started!");
std::array<Philosopher, 5> philosophers {{
{"Aristotle", dinner.forks[0], dinner.forks[1]},
{"Democritus", dinner.forks[1], dinner.forks[2]},
{"Plato", dinner.forks[2], dinner.forks[3]},
{"Pythagoras", dinner.forks[3], dinner.forks[4]},
{"Socrates", dinner.forks[4], dinner.forks[0]},
}};
Message("It is dark outside...");
}
| package main
import (
"hash/fnv"
"log"
"math/rand"
"os"
"time"
)
var ph = []string{"Aristotle", "Kant", "Spinoza", "Marx", "Russell"}
const hunger = 3
const think = time.Second / 100
const eat = time.Second / 100
var fmt = log.New(os.Stdout, "", 0)
var done = make(chan bool)
type fork byte
func philosopher(phName string,
dominantHand, otherHand chan fork, done chan bool) {
fmt.Println(phName, "seated")
h := fnv.New64a()
h.Write([]byte(phName))
rg := rand.New(rand.NewSource(int64(h.Sum64())))
rSleep := func(t time.Duration) {
time.Sleep(t/2 + time.Duration(rg.Int63n(int64(t))))
}
for h := hunger; h > 0; h-- {
fmt.Println(phName, "hungry")
<-dominantHand
<-otherHand
fmt.Println(phName, "eating")
rSleep(eat)
dominantHand <- 'f'
otherHand <- 'f'
fmt.Println(phName, "thinking")
rSleep(think)
}
fmt.Println(phName, "satisfied")
done <- true
fmt.Println(phName, "left the table")
}
func main() {
fmt.Println("table empty")
place0 := make(chan fork, 1)
place0 <- 'f'
placeLeft := place0
for i := 1; i < len(ph); i++ {
placeRight := make(chan fork, 1)
placeRight <- 'f'
go philosopher(ph[i], placeLeft, placeRight, done)
placeLeft = placeRight
}
go philosopher(ph[0], place0, placeLeft, done)
for range ph {
<-done
}
fmt.Println("table empty")
}
|
Translate this program into Go but keep the logic exactly as in C++. | #include <iostream>
class factorion_t {
public:
factorion_t() {
f[0] = 1u;
for (uint n = 1u; n < 12u; n++)
f[n] = f[n - 1] * n;
}
bool operator()(uint i, uint b) const {
uint sum = 0;
for (uint j = i; j > 0u; j /= b)
sum += f[j % b];
return sum == i;
}
private:
ulong f[12];
};
int main() {
factorion_t factorion;
for (uint b = 9u; b <= 12u; ++b) {
std::cout << "factorions for base " << b << ':';
for (uint i = 1u; i < 1500000u; ++i)
if (factorion(i, b))
std::cout << ' ' << i;
std::cout << std::endl;
}
return 0;
}
| package main
import (
"fmt"
"strconv"
)
func main() {
var fact [12]uint64
fact[0] = 1
for n := uint64(1); n < 12; n++ {
fact[n] = fact[n-1] * n
}
for b := 9; b <= 12; b++ {
fmt.Printf("The factorions for base %d are:\n", b)
for i := uint64(1); i < 1500000; i++ {
digits := strconv.FormatUint(i, b)
sum := uint64(0)
for _, digit := range digits {
if digit < 'a' {
sum += fact[digit-'0']
} else {
sum += fact[digit+10-'a']
}
}
if sum == i {
fmt.Printf("%d ", i)
}
}
fmt.Println("\n")
}
}
|
Convert this C++ block to Go, preserving its control flow and logic. | #include <iostream>
class factorion_t {
public:
factorion_t() {
f[0] = 1u;
for (uint n = 1u; n < 12u; n++)
f[n] = f[n - 1] * n;
}
bool operator()(uint i, uint b) const {
uint sum = 0;
for (uint j = i; j > 0u; j /= b)
sum += f[j % b];
return sum == i;
}
private:
ulong f[12];
};
int main() {
factorion_t factorion;
for (uint b = 9u; b <= 12u; ++b) {
std::cout << "factorions for base " << b << ':';
for (uint i = 1u; i < 1500000u; ++i)
if (factorion(i, b))
std::cout << ' ' << i;
std::cout << std::endl;
}
return 0;
}
| package main
import (
"fmt"
"strconv"
)
func main() {
var fact [12]uint64
fact[0] = 1
for n := uint64(1); n < 12; n++ {
fact[n] = fact[n-1] * n
}
for b := 9; b <= 12; b++ {
fmt.Printf("The factorions for base %d are:\n", b)
for i := uint64(1); i < 1500000; i++ {
digits := strconv.FormatUint(i, b)
sum := uint64(0)
for _, digit := range digits {
if digit < 'a' {
sum += fact[digit-'0']
} else {
sum += fact[digit+10-'a']
}
}
if sum == i {
fmt.Printf("%d ", i)
}
}
fmt.Println("\n")
}
}
|
Ensure the translated Go code behaves exactly like the original C++ snippet. | #include <cmath>
#include <functional>
#include <iostream>
constexpr double K = 7.8e9;
constexpr int n0 = 27;
constexpr double actual[] = {
27, 27, 27, 44, 44, 59, 59, 59, 59, 59, 59, 59, 59, 60, 60,
61, 61, 66, 83, 219, 239, 392, 534, 631, 897, 1350, 2023, 2820,
4587, 6067, 7823, 9826, 11946, 14554, 17372, 20615, 24522, 28273,
31491, 34933, 37552, 40540, 43105, 45177, 60328, 64543, 67103,
69265, 71332, 73327, 75191, 75723, 76719, 77804, 78812, 79339,
80132, 80995, 82101, 83365, 85203, 87024, 89068, 90664, 93077,
95316, 98172, 102133, 105824, 109695, 114232, 118610, 125497,
133852, 143227, 151367, 167418, 180096, 194836, 213150, 242364,
271106, 305117, 338133, 377918, 416845, 468049, 527767, 591704,
656866, 715353, 777796, 851308, 928436, 1000249, 1082054, 1174652
};
double f(double r) {
double sq = 0;
constexpr size_t len = std::size(actual);
for (size_t i = 0; i < len; ++i) {
double eri = std::exp(r * i);
double guess = (n0 * eri)/(1 + n0 * (eri - 1)/K);
double diff = guess - actual[i];
sq += diff * diff;
}
return sq;
}
double solve(std::function<double(double)> fn, double guess=0.5, double epsilon=0) {
for (double delta = guess ? guess : 1, f0 = fn(guess), factor = 2;
delta > epsilon && guess != guess - delta;
delta *= factor) {
double nf = fn(guess - delta);
if (nf < f0) {
f0 = nf;
guess -= delta;
} else {
nf = fn(guess + delta);
if (nf < f0) {
f0 = nf;
guess += delta;
} else
factor = 0.5;
}
}
return guess;
}
int main() {
double r = solve(f);
double R0 = std::exp(12 * r);
std::cout << "r = " << r << ", R0 = " << R0 << '\n';
return 0;
}
| package main
import (
"fmt"
"github.com/maorshutman/lm"
"log"
"math"
)
const (
K = 7_800_000_000
n0 = 27
)
var y = []float64{
27, 27, 27, 44, 44, 59, 59, 59, 59, 59, 59, 59, 59, 60, 60,
61, 61, 66, 83, 219, 239, 392, 534, 631, 897, 1350, 2023,
2820, 4587, 6067, 7823, 9826, 11946, 14554, 17372, 20615,
24522, 28273, 31491, 34933, 37552, 40540, 43105, 45177,
60328, 64543, 67103, 69265, 71332, 73327, 75191, 75723,
76719, 77804, 78812, 79339, 80132, 80995, 82101, 83365,
85203, 87024, 89068, 90664, 93077, 95316, 98172, 102133,
105824, 109695, 114232, 118610, 125497, 133852, 143227,
151367, 167418, 180096, 194836, 213150, 242364, 271106,
305117, 338133, 377918, 416845, 468049, 527767, 591704,
656866, 715353, 777796, 851308, 928436, 1000249, 1082054,
1174652,
}
func f(dst, p []float64) {
for i := 0; i < len(y); i++ {
t := float64(i)
dst[i] = (n0*math.Exp(p[0]*t))/(1+n0*(math.Exp(p[0]*t)-1)/K) - y[i]
}
}
func main() {
j := lm.NumJac{Func: f}
prob := lm.LMProblem{
Dim: 1,
Size: len(y),
Func: f,
Jac: j.Jac,
InitParams: []float64{0.5},
Tau: 1e-6,
Eps1: 1e-8,
Eps2: 1e-8,
}
res, err := lm.LM(prob, &lm.Settings{Iterations: 100, ObjectiveTol: 1e-16})
if err != nil {
log.Fatal(err)
}
r := res.X[0]
fmt.Printf("The logistic curve r for the world data is %.8f\n", r)
fmt.Printf("R0 is then approximately equal to %.7f\n", math.Exp(12*r))
}
|
Rewrite this program in Go while keeping its functionality equivalent to the C++ version. | #include <list>
template <typename T>
std::list<T> strandSort(std::list<T> lst) {
if (lst.size() <= 1)
return lst;
std::list<T> result;
std::list<T> sorted;
while (!lst.empty()) {
sorted.push_back(lst.front());
lst.pop_front();
for (typename std::list<T>::iterator it = lst.begin(); it != lst.end(); ) {
if (sorted.back() <= *it) {
sorted.push_back(*it);
it = lst.erase(it);
} else
it++;
}
result.merge(sorted);
}
return result;
}
| package main
import "fmt"
type link struct {
int
next *link
}
func linkInts(s []int) *link {
if len(s) == 0 {
return nil
}
return &link{s[0], linkInts(s[1:])}
}
func (l *link) String() string {
if l == nil {
return "nil"
}
r := fmt.Sprintf("[%d", l.int)
for l = l.next; l != nil; l = l.next {
r = fmt.Sprintf("%s %d", r, l.int)
}
return r + "]"
}
func main() {
a := linkInts([]int{170, 45, 75, -90, -802, 24, 2, 66})
fmt.Println("before:", a)
b := strandSort(a)
fmt.Println("after: ", b)
}
func strandSort(a *link) (result *link) {
for a != nil {
sublist := a
a = a.next
sTail := sublist
for p, pPrev := a, a; p != nil; p = p.next {
if p.int > sTail.int {
sTail.next = p
sTail = p
if p == a {
a = p.next
} else {
pPrev.next = p.next
}
} else {
pPrev = p
}
}
sTail.next = nil
if result == nil {
result = sublist
continue
}
var m, rr *link
if sublist.int < result.int {
m = sublist
sublist = m.next
rr = result
} else {
m = result
rr = m.next
}
result = m
for {
if sublist == nil {
m.next = rr
break
}
if rr == nil {
m.next = sublist
break
}
if sublist.int < rr.int {
m.next = sublist
m = sublist
sublist = m.next
} else {
m.next = rr
m = rr
rr = m.next
}
}
}
return
}
|
Rewrite this program in Go while keeping its functionality equivalent to the C++ version. | #include <iomanip>
#include <iostream>
bool is_prime(unsigned int n) {
if (n < 2)
return false;
if (n % 2 == 0)
return n == 2;
if (n % 3 == 0)
return n == 3;
for (unsigned int p = 5; p * p <= n; p += 4) {
if (n % p == 0)
return false;
p += 2;
if (n % p == 0)
return false;
}
return true;
}
unsigned int digit_sum(unsigned int n) {
unsigned int sum = 0;
for (; n > 0; n /= 10)
sum += n % 10;
return sum;
}
int main() {
const unsigned int limit = 500;
std::cout << "Additive primes less than " << limit << ":\n";
unsigned int count = 0;
for (unsigned int n = 1; n < limit; ++n) {
if (is_prime(digit_sum(n)) && is_prime(n)) {
std::cout << std::setw(3) << n;
if (++count % 10 == 0)
std::cout << '\n';
else
std::cout << ' ';
}
}
std::cout << '\n' << count << " additive primes found.\n";
}
| package main
import "fmt"
func isPrime(n int) bool {
switch {
case n < 2:
return false
case n%2 == 0:
return n == 2
case n%3 == 0:
return n == 3
default:
d := 5
for d*d <= n {
if n%d == 0 {
return false
}
d += 2
if n%d == 0 {
return false
}
d += 4
}
return true
}
}
func sumDigits(n int) int {
sum := 0
for n > 0 {
sum += n % 10
n /= 10
}
return sum
}
func main() {
fmt.Println("Additive primes less than 500:")
i := 2
count := 0
for {
if isPrime(i) && isPrime(sumDigits(i)) {
count++
fmt.Printf("%3d ", i)
if count%10 == 0 {
fmt.Println()
}
}
if i > 2 {
i += 2
} else {
i++
}
if i > 499 {
break
}
}
fmt.Printf("\n\n%d additive primes found.\n", count)
}
|
Change the following C++ code into Go without altering its purpose. | class invertedAssign {
int data;
public:
invertedAssign(int data):data(data){}
int getData(){return data;}
void operator=(invertedAssign& other) const {
other.data = this->data;
}
};
#include <iostream>
int main(){
invertedAssign a = 0;
invertedAssign b = 42;
std::cout << a.getData() << ' ' << b.getData() << '\n';
b = a;
std::cout << a.getData() << ' ' << b.getData() << '\n';
}
| package main
import "fmt"
type ibool bool
const itrue ibool = true
func (ib ibool) iif(cond bool) bool {
if cond {
return bool(ib)
}
return bool(!ib)
}
func main() {
var needUmbrella bool
raining := true
if raining {
needUmbrella = true
}
fmt.Printf("Is it raining? %t. Do I need an umbrella? %t\n", raining, needUmbrella)
raining = false
needUmbrella = itrue.iif(raining)
fmt.Printf("Is it raining? %t. Do I need an umbrella? %t\n", raining, needUmbrella)
}
|
Change the following C++ code into Go without altering its purpose. | class invertedAssign {
int data;
public:
invertedAssign(int data):data(data){}
int getData(){return data;}
void operator=(invertedAssign& other) const {
other.data = this->data;
}
};
#include <iostream>
int main(){
invertedAssign a = 0;
invertedAssign b = 42;
std::cout << a.getData() << ' ' << b.getData() << '\n';
b = a;
std::cout << a.getData() << ' ' << b.getData() << '\n';
}
| package main
import "fmt"
type ibool bool
const itrue ibool = true
func (ib ibool) iif(cond bool) bool {
if cond {
return bool(ib)
}
return bool(!ib)
}
func main() {
var needUmbrella bool
raining := true
if raining {
needUmbrella = true
}
fmt.Printf("Is it raining? %t. Do I need an umbrella? %t\n", raining, needUmbrella)
raining = false
needUmbrella = itrue.iif(raining)
fmt.Printf("Is it raining? %t. Do I need an umbrella? %t\n", raining, needUmbrella)
}
|
Please provide an equivalent version of this C++ code in Go. | #include <cassert>
#include <iostream>
#include <vector>
class totient_calculator {
public:
explicit totient_calculator(int max) : totient_(max + 1) {
for (int i = 1; i <= max; ++i)
totient_[i] = i;
for (int i = 2; i <= max; ++i) {
if (totient_[i] < i)
continue;
for (int j = i; j <= max; j += i)
totient_[j] -= totient_[j] / i;
}
}
int totient(int n) const {
assert (n >= 1 && n < totient_.size());
return totient_[n];
}
bool is_prime(int n) const {
return totient(n) == n - 1;
}
private:
std::vector<int> totient_;
};
bool perfect_totient_number(const totient_calculator& tc, int n) {
int sum = 0;
for (int m = n; m > 1; ) {
int t = tc.totient(m);
sum += t;
m = t;
}
return sum == n;
}
int main() {
totient_calculator tc(10000);
int count = 0, n = 1;
std::cout << "First 20 perfect totient numbers:\n";
for (; count < 20; ++n) {
if (perfect_totient_number(tc, n)) {
if (count > 0)
std::cout << ' ';
++count;
std::cout << n;
}
}
std::cout << '\n';
return 0;
}
| package main
import "fmt"
func gcd(n, k int) int {
if n < k || k < 1 {
panic("Need n >= k and k >= 1")
}
s := 1
for n&1 == 0 && k&1 == 0 {
n >>= 1
k >>= 1
s <<= 1
}
t := n
if n&1 != 0 {
t = -k
}
for t != 0 {
for t&1 == 0 {
t >>= 1
}
if t > 0 {
n = t
} else {
k = -t
}
t = n - k
}
return n * s
}
func totient(n int) int {
tot := 0
for k := 1; k <= n; k++ {
if gcd(n, k) == 1 {
tot++
}
}
return tot
}
func main() {
var perfect []int
for n := 1; len(perfect) < 20; n += 2 {
tot := n
sum := 0
for tot != 1 {
tot = totient(tot)
sum += tot
}
if sum == n {
perfect = append(perfect, n)
}
}
fmt.Println("The first 20 perfect totient numbers are:")
fmt.Println(perfect)
}
|
Ensure the translated Go code behaves exactly like the original C++ snippet. | #include <cassert>
#include <iostream>
#include <vector>
class totient_calculator {
public:
explicit totient_calculator(int max) : totient_(max + 1) {
for (int i = 1; i <= max; ++i)
totient_[i] = i;
for (int i = 2; i <= max; ++i) {
if (totient_[i] < i)
continue;
for (int j = i; j <= max; j += i)
totient_[j] -= totient_[j] / i;
}
}
int totient(int n) const {
assert (n >= 1 && n < totient_.size());
return totient_[n];
}
bool is_prime(int n) const {
return totient(n) == n - 1;
}
private:
std::vector<int> totient_;
};
bool perfect_totient_number(const totient_calculator& tc, int n) {
int sum = 0;
for (int m = n; m > 1; ) {
int t = tc.totient(m);
sum += t;
m = t;
}
return sum == n;
}
int main() {
totient_calculator tc(10000);
int count = 0, n = 1;
std::cout << "First 20 perfect totient numbers:\n";
for (; count < 20; ++n) {
if (perfect_totient_number(tc, n)) {
if (count > 0)
std::cout << ' ';
++count;
std::cout << n;
}
}
std::cout << '\n';
return 0;
}
| package main
import "fmt"
func gcd(n, k int) int {
if n < k || k < 1 {
panic("Need n >= k and k >= 1")
}
s := 1
for n&1 == 0 && k&1 == 0 {
n >>= 1
k >>= 1
s <<= 1
}
t := n
if n&1 != 0 {
t = -k
}
for t != 0 {
for t&1 == 0 {
t >>= 1
}
if t > 0 {
n = t
} else {
k = -t
}
t = n - k
}
return n * s
}
func totient(n int) int {
tot := 0
for k := 1; k <= n; k++ {
if gcd(n, k) == 1 {
tot++
}
}
return tot
}
func main() {
var perfect []int
for n := 1; len(perfect) < 20; n += 2 {
tot := n
sum := 0
for tot != 1 {
tot = totient(tot)
sum += tot
}
if sum == n {
perfect = append(perfect, n)
}
}
fmt.Println("The first 20 perfect totient numbers are:")
fmt.Println(perfect)
}
|
Please provide an equivalent version of this C++ code in Go. | #include <cassert>
#include <iostream>
#include <vector>
class totient_calculator {
public:
explicit totient_calculator(int max) : totient_(max + 1) {
for (int i = 1; i <= max; ++i)
totient_[i] = i;
for (int i = 2; i <= max; ++i) {
if (totient_[i] < i)
continue;
for (int j = i; j <= max; j += i)
totient_[j] -= totient_[j] / i;
}
}
int totient(int n) const {
assert (n >= 1 && n < totient_.size());
return totient_[n];
}
bool is_prime(int n) const {
return totient(n) == n - 1;
}
private:
std::vector<int> totient_;
};
bool perfect_totient_number(const totient_calculator& tc, int n) {
int sum = 0;
for (int m = n; m > 1; ) {
int t = tc.totient(m);
sum += t;
m = t;
}
return sum == n;
}
int main() {
totient_calculator tc(10000);
int count = 0, n = 1;
std::cout << "First 20 perfect totient numbers:\n";
for (; count < 20; ++n) {
if (perfect_totient_number(tc, n)) {
if (count > 0)
std::cout << ' ';
++count;
std::cout << n;
}
}
std::cout << '\n';
return 0;
}
| package main
import "fmt"
func gcd(n, k int) int {
if n < k || k < 1 {
panic("Need n >= k and k >= 1")
}
s := 1
for n&1 == 0 && k&1 == 0 {
n >>= 1
k >>= 1
s <<= 1
}
t := n
if n&1 != 0 {
t = -k
}
for t != 0 {
for t&1 == 0 {
t >>= 1
}
if t > 0 {
n = t
} else {
k = -t
}
t = n - k
}
return n * s
}
func totient(n int) int {
tot := 0
for k := 1; k <= n; k++ {
if gcd(n, k) == 1 {
tot++
}
}
return tot
}
func main() {
var perfect []int
for n := 1; len(perfect) < 20; n += 2 {
tot := n
sum := 0
for tot != 1 {
tot = totient(tot)
sum += tot
}
if sum == n {
perfect = append(perfect, n)
}
}
fmt.Println("The first 20 perfect totient numbers are:")
fmt.Println(perfect)
}
|
Port the following code from C++ to Go with equivalent syntax and logic. | #include <tr1/memory>
#include <string>
#include <iostream>
#include <tr1/functional>
using namespace std;
using namespace std::tr1;
using std::tr1::function;
class IDelegate
{
public:
virtual ~IDelegate() {}
};
class IThing
{
public:
virtual ~IThing() {}
virtual std::string Thing() = 0;
};
class DelegateA : virtual public IDelegate
{
};
class DelegateB : public IThing, public IDelegate
{
std::string Thing()
{
return "delegate implementation";
}
};
class Delegator
{
public:
std::string Operation()
{
if(Delegate)
if (IThing * pThing = dynamic_cast<IThing*>(Delegate.get()))
return pThing->Thing();
return "default implementation";
}
shared_ptr<IDelegate> Delegate;
};
int main()
{
shared_ptr<DelegateA> delegateA(new DelegateA());
shared_ptr<DelegateB> delegateB(new DelegateB());
Delegator delegator;
std::cout << delegator.Operation() << std::endl;
delegator.Delegate = delegateA;
std::cout << delegator.Operation() << std::endl;
delegator.Delegate = delegateB;
std::cout << delegator.Operation() << std::endl;
}
| package main
import "fmt"
type Delegator struct {
delegate interface{}
}
type Thingable interface {
thing() string
}
func (self Delegator) operation() string {
if v, ok := self.delegate.(Thingable); ok {
return v.thing()
}
return "default implementation"
}
type Delegate int
func (Delegate) thing() string {
return "delegate implementation"
}
func main() {
a := Delegator{}
fmt.Println(a.operation())
a.delegate = "A delegate may be any object"
fmt.Println(a.operation())
var d Delegate
a.delegate = d
fmt.Println(a.operation())
}
|
Rewrite this program in Go while keeping its functionality equivalent to the C++ version. | #include <iomanip>
#include <iostream>
unsigned int divisor_sum(unsigned int n) {
unsigned int total = 1, power = 2;
for (; (n & 1) == 0; power <<= 1, n >>= 1)
total += power;
for (unsigned int p = 3; p * p <= n; p += 2) {
unsigned int sum = 1;
for (power = p; n % p == 0; power *= p, n /= p)
sum += power;
total *= sum;
}
if (n > 1)
total *= n + 1;
return total;
}
int main() {
const unsigned int limit = 100;
std::cout << "Sum of divisors for the first " << limit << " positive integers:\n";
for (unsigned int n = 1; n <= limit; ++n) {
std::cout << std::setw(4) << divisor_sum(n);
if (n % 10 == 0)
std::cout << '\n';
}
}
| package main
import "fmt"
func sumDivisors(n int) int {
sum := 0
i := 1
k := 2
if n%2 == 0 {
k = 1
}
for i*i <= n {
if n%i == 0 {
sum += i
j := n / i
if j != i {
sum += j
}
}
i += k
}
return sum
}
func main() {
fmt.Println("The sums of positive divisors for the first 100 positive integers are:")
for i := 1; i <= 100; i++ {
fmt.Printf("%3d ", sumDivisors(i))
if i%10 == 0 {
fmt.Println()
}
}
}
|
Generate a Go translation of this C++ snippet without changing its computational steps. | #include <iomanip>
#include <iostream>
unsigned int divisor_sum(unsigned int n) {
unsigned int total = 1, power = 2;
for (; (n & 1) == 0; power <<= 1, n >>= 1)
total += power;
for (unsigned int p = 3; p * p <= n; p += 2) {
unsigned int sum = 1;
for (power = p; n % p == 0; power *= p, n /= p)
sum += power;
total *= sum;
}
if (n > 1)
total *= n + 1;
return total;
}
int main() {
const unsigned int limit = 100;
std::cout << "Sum of divisors for the first " << limit << " positive integers:\n";
for (unsigned int n = 1; n <= limit; ++n) {
std::cout << std::setw(4) << divisor_sum(n);
if (n % 10 == 0)
std::cout << '\n';
}
}
| package main
import "fmt"
func sumDivisors(n int) int {
sum := 0
i := 1
k := 2
if n%2 == 0 {
k = 1
}
for i*i <= n {
if n%i == 0 {
sum += i
j := n / i
if j != i {
sum += j
}
}
i += k
}
return sum
}
func main() {
fmt.Println("The sums of positive divisors for the first 100 positive integers are:")
for i := 1; i <= 100; i++ {
fmt.Printf("%3d ", sumDivisors(i))
if i%10 == 0 {
fmt.Println()
}
}
}
|
Transform the following C++ implementation into Go, maintaining the same output and logic. | #include <iomanip>
#include <iostream>
unsigned int divisor_sum(unsigned int n) {
unsigned int total = 1, power = 2;
for (; (n & 1) == 0; power <<= 1, n >>= 1)
total += power;
for (unsigned int p = 3; p * p <= n; p += 2) {
unsigned int sum = 1;
for (power = p; n % p == 0; power *= p, n /= p)
sum += power;
total *= sum;
}
if (n > 1)
total *= n + 1;
return total;
}
int main() {
const unsigned int limit = 100;
std::cout << "Sum of divisors for the first " << limit << " positive integers:\n";
for (unsigned int n = 1; n <= limit; ++n) {
std::cout << std::setw(4) << divisor_sum(n);
if (n % 10 == 0)
std::cout << '\n';
}
}
| package main
import "fmt"
func sumDivisors(n int) int {
sum := 0
i := 1
k := 2
if n%2 == 0 {
k = 1
}
for i*i <= n {
if n%i == 0 {
sum += i
j := n / i
if j != i {
sum += j
}
}
i += k
}
return sum
}
func main() {
fmt.Println("The sums of positive divisors for the first 100 positive integers are:")
for i := 1; i <= 100; i++ {
fmt.Printf("%3d ", sumDivisors(i))
if i%10 == 0 {
fmt.Println()
}
}
}
|
Change the following C++ code into Go without altering its purpose. | #include <algorithm>
#include <cctype>
#include <iostream>
#include <sstream>
#include <string>
#include <vector>
const char* command_table =
"Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy "
"COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find "
"NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput "
"Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO "
"MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT "
"READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT "
"RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up";
class command {
public:
command(const std::string&, size_t);
const std::string& cmd() const { return cmd_; }
size_t min_length() const { return min_len_; }
bool match(const std::string&) const;
private:
std::string cmd_;
size_t min_len_;
};
command::command(const std::string& cmd, size_t min_len)
: cmd_(cmd), min_len_(min_len) {}
bool command::match(const std::string& str) const {
size_t olen = str.length();
return olen >= min_len_ && olen <= cmd_.length()
&& cmd_.compare(0, olen, str) == 0;
}
void uppercase(std::string& str) {
std::transform(str.begin(), str.end(), str.begin(),
[](unsigned char c) -> unsigned char { return std::toupper(c); });
}
size_t get_min_length(const std::string& str) {
size_t len = 0, n = str.length();
while (len < n && std::isupper(static_cast<unsigned char>(str[len])))
++len;
return len;
}
class command_list {
public:
explicit command_list(const char*);
const command* find_command(const std::string&) const;
private:
std::vector<command> commands_;
};
command_list::command_list(const char* table) {
std::vector<command> commands;
std::istringstream is(table);
std::string word;
while (is >> word) {
size_t len = get_min_length(word);
uppercase(word);
commands_.push_back(command(word, len));
}
}
const command* command_list::find_command(const std::string& word) const {
auto iter = std::find_if(commands_.begin(), commands_.end(),
[&word](const command& cmd) { return cmd.match(word); });
return (iter != commands_.end()) ? &*iter : nullptr;
}
std::string test(const command_list& commands, const std::string& input) {
std::string output;
std::istringstream is(input);
std::string word;
while (is >> word) {
if (!output.empty())
output += ' ';
uppercase(word);
const command* cmd_ptr = commands.find_command(word);
if (cmd_ptr)
output += cmd_ptr->cmd();
else
output += "*error*";
}
return output;
}
int main() {
command_list commands(command_table);
std::string input("riG rePEAT copies put mo rest types fup. 6 poweRin");
std::string output(test(commands, input));
std::cout << " input: " << input << '\n';
std::cout << "output: " << output << '\n';
return 0;
}
| package main
import (
"fmt"
"strings"
)
var table =
"Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy " +
"COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find " +
"NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput " +
"Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO " +
"MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT " +
"READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT " +
"RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up "
func validate(commands, words []string, minLens []int) []string {
results := make([]string, 0)
if len(words) == 0 {
return results
}
for _, word := range words {
matchFound := false
wlen := len(word)
for i, command := range commands {
if minLens[i] == 0 || wlen < minLens[i] || wlen > len(command) {
continue
}
c := strings.ToUpper(command)
w := strings.ToUpper(word)
if strings.HasPrefix(c, w) {
results = append(results, c)
matchFound = true
break
}
}
if !matchFound {
results = append(results, "*error*")
}
}
return results
}
func main() {
table = strings.TrimSpace(table)
commands := strings.Fields(table)
clen := len(commands)
minLens := make([]int, clen)
for i := 0; i < clen; i++ {
count := 0
for _, c := range commands[i] {
if c >= 'A' && c <= 'Z' {
count++
}
}
minLens[i] = count
}
sentence := "riG rePEAT copies put mo rest types fup. 6 poweRin"
words := strings.Fields(sentence)
results := validate(commands, words, minLens)
fmt.Print("user words: ")
for j := 0; j < len(words); j++ {
fmt.Printf("%-*s ", len(results[j]), words[j])
}
fmt.Print("\nfull words: ")
fmt.Println(strings.Join(results, " "))
}
|
Write a version of this C++ function in Go with identical behavior. | #include <algorithm>
#include <cctype>
#include <iostream>
#include <sstream>
#include <string>
#include <vector>
const char* command_table =
"Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy "
"COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find "
"NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput "
"Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO "
"MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT "
"READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT "
"RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up";
class command {
public:
command(const std::string&, size_t);
const std::string& cmd() const { return cmd_; }
size_t min_length() const { return min_len_; }
bool match(const std::string&) const;
private:
std::string cmd_;
size_t min_len_;
};
command::command(const std::string& cmd, size_t min_len)
: cmd_(cmd), min_len_(min_len) {}
bool command::match(const std::string& str) const {
size_t olen = str.length();
return olen >= min_len_ && olen <= cmd_.length()
&& cmd_.compare(0, olen, str) == 0;
}
void uppercase(std::string& str) {
std::transform(str.begin(), str.end(), str.begin(),
[](unsigned char c) -> unsigned char { return std::toupper(c); });
}
size_t get_min_length(const std::string& str) {
size_t len = 0, n = str.length();
while (len < n && std::isupper(static_cast<unsigned char>(str[len])))
++len;
return len;
}
class command_list {
public:
explicit command_list(const char*);
const command* find_command(const std::string&) const;
private:
std::vector<command> commands_;
};
command_list::command_list(const char* table) {
std::vector<command> commands;
std::istringstream is(table);
std::string word;
while (is >> word) {
size_t len = get_min_length(word);
uppercase(word);
commands_.push_back(command(word, len));
}
}
const command* command_list::find_command(const std::string& word) const {
auto iter = std::find_if(commands_.begin(), commands_.end(),
[&word](const command& cmd) { return cmd.match(word); });
return (iter != commands_.end()) ? &*iter : nullptr;
}
std::string test(const command_list& commands, const std::string& input) {
std::string output;
std::istringstream is(input);
std::string word;
while (is >> word) {
if (!output.empty())
output += ' ';
uppercase(word);
const command* cmd_ptr = commands.find_command(word);
if (cmd_ptr)
output += cmd_ptr->cmd();
else
output += "*error*";
}
return output;
}
int main() {
command_list commands(command_table);
std::string input("riG rePEAT copies put mo rest types fup. 6 poweRin");
std::string output(test(commands, input));
std::cout << " input: " << input << '\n';
std::cout << "output: " << output << '\n';
return 0;
}
| package main
import (
"fmt"
"strings"
)
var table =
"Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy " +
"COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find " +
"NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput " +
"Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO " +
"MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT " +
"READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT " +
"RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up "
func validate(commands, words []string, minLens []int) []string {
results := make([]string, 0)
if len(words) == 0 {
return results
}
for _, word := range words {
matchFound := false
wlen := len(word)
for i, command := range commands {
if minLens[i] == 0 || wlen < minLens[i] || wlen > len(command) {
continue
}
c := strings.ToUpper(command)
w := strings.ToUpper(word)
if strings.HasPrefix(c, w) {
results = append(results, c)
matchFound = true
break
}
}
if !matchFound {
results = append(results, "*error*")
}
}
return results
}
func main() {
table = strings.TrimSpace(table)
commands := strings.Fields(table)
clen := len(commands)
minLens := make([]int, clen)
for i := 0; i < clen; i++ {
count := 0
for _, c := range commands[i] {
if c >= 'A' && c <= 'Z' {
count++
}
}
minLens[i] = count
}
sentence := "riG rePEAT copies put mo rest types fup. 6 poweRin"
words := strings.Fields(sentence)
results := validate(commands, words, minLens)
fmt.Print("user words: ")
for j := 0; j < len(words); j++ {
fmt.Printf("%-*s ", len(results[j]), words[j])
}
fmt.Print("\nfull words: ")
fmt.Println(strings.Join(results, " "))
}
|
Keep all operations the same but rewrite the snippet in Go. | #include <iostream>
class MyOtherClass
{
public:
const int m_x;
MyOtherClass(const int initX = 0) : m_x(initX) { }
};
int main()
{
MyOtherClass mocA, mocB(7);
std::cout << mocA.m_x << std::endl;
std::cout << mocB.m_x << std::endl;
return 0;
}
| package main
func main() {
s := "immutable"
s[0] = 'a'
}
|
Produce a functionally identical Go code for the snippet given in C++. | #include <iostream>
#include <span>
#include <vector>
struct vec2 {
float x = 0.0f, y = 0.0f;
constexpr vec2 operator+(vec2 other) const {
return vec2{x + other.x, y + other.y};
}
constexpr vec2 operator-(vec2 other) const {
return vec2{x - other.x, y - other.y};
}
};
constexpr vec2 operator*(vec2 a, float b) { return vec2{a.x * b, a.y * b}; }
constexpr float dot(vec2 a, vec2 b) { return a.x * b.x + a.y * b.y; }
constexpr float cross(vec2 a, vec2 b) { return a.x * b.y - b.x * a.y; }
constexpr bool is_inside(vec2 point, vec2 a, vec2 b) {
return (cross(a - b, point) + cross(b, a)) < 0.0f;
}
constexpr vec2 intersection(vec2 a1, vec2 a2, vec2 b1, vec2 b2) {
return ((b1 - b2) * cross(a1, a2) - (a1 - a2) * cross(b1, b2)) *
(1.0f / cross(a1 - a2, b1 - b2));
}
std::vector<vec2> suther_land_hodgman(
std::span<vec2 const> subject_polygon, std::span<vec2 const> clip_polygon) {
if (clip_polygon.empty() || subject_polygon.empty()) {
return {};
}
std::vector<vec2> ring{subject_polygon.begin(), subject_polygon.end()};
vec2 p1 = clip_polygon[clip_polygon.size() - 1];
std::vector<vec2> input;
for (vec2 p2 : clip_polygon) {
input.clear();
input.insert(input.end(), ring.begin(), ring.end());
vec2 s = input[input.size() - 1];
ring.clear();
for (vec2 e : input) {
if (is_inside(e, p1, p2)) {
if (!is_inside(s, p1, p2)) {
ring.push_back(intersection(p1, p2, s, e));
}
ring.push_back(e);
} else if (is_inside(s, p1, p2)) {
ring.push_back(intersection(p1, p2, s, e));
}
s = e;
}
p1 = p2;
}
return ring;
}
int main(int argc, char **argv) {
vec2 subject_polygon[] = {{50, 150}, {200, 50}, {350, 150},
{350, 300}, {250, 300}, {200, 250},
{150, 350}, {100, 250}, {100, 200}};
vec2 clip_polygon[] = {{100, 100}, {300, 100}, {300, 300}, {100, 300}};
std::vector<vec2> clipped_polygon =
suther_land_hodgman(subject_polygon, clip_polygon);
std::cout << "Clipped polygon points:" << std::endl;
for (vec2 p : clipped_polygon) {
std::cout << "(" << p.x << ", " << p.y << ")" << std::endl;
}
return EXIT_SUCCESS;
}
| package main
import "fmt"
type point struct {
x, y float32
}
var subjectPolygon = []point{{50, 150}, {200, 50}, {350, 150}, {350, 300},
{250, 300}, {200, 250}, {150, 350}, {100, 250}, {100, 200}}
var clipPolygon = []point{{100, 100}, {300, 100}, {300, 300}, {100, 300}}
func main() {
var cp1, cp2, s, e point
inside := func(p point) bool {
return (cp2.x-cp1.x)*(p.y-cp1.y) > (cp2.y-cp1.y)*(p.x-cp1.x)
}
intersection := func() (p point) {
dcx, dcy := cp1.x-cp2.x, cp1.y-cp2.y
dpx, dpy := s.x-e.x, s.y-e.y
n1 := cp1.x*cp2.y - cp1.y*cp2.x
n2 := s.x*e.y - s.y*e.x
n3 := 1 / (dcx*dpy - dcy*dpx)
p.x = (n1*dpx - n2*dcx) * n3
p.y = (n1*dpy - n2*dcy) * n3
return
}
outputList := subjectPolygon
cp1 = clipPolygon[len(clipPolygon)-1]
for _, cp2 = range clipPolygon {
inputList := outputList
outputList = nil
s = inputList[len(inputList)-1]
for _, e = range inputList {
if inside(e) {
if !inside(s) {
outputList = append(outputList, intersection())
}
outputList = append(outputList, e)
} else if inside(s) {
outputList = append(outputList, intersection())
}
s = e
}
cp1 = cp2
}
fmt.Println(outputList)
}
|
Port the following code from C++ to Go with equivalent syntax and logic. | #include <iostream>
#include <algorithm>
#include <vector>
#include <bitset>
#include <string>
class bacon {
public:
bacon() {
int x = 0;
for( ; x < 9; x++ )
bAlphabet.push_back( std::bitset<5>( x ).to_string() );
bAlphabet.push_back( bAlphabet.back() );
for( ; x < 20; x++ )
bAlphabet.push_back( std::bitset<5>( x ).to_string() );
bAlphabet.push_back( bAlphabet.back() );
for( ; x < 24; x++ )
bAlphabet.push_back( std::bitset<5>( x ).to_string() );
}
std::string encode( std::string txt ) {
std::string r;
size_t z;
for( std::string::iterator i = txt.begin(); i != txt.end(); i++ ) {
z = toupper( *i );
if( z < 'A' || z > 'Z' ) continue;
r.append( bAlphabet.at( ( *i & 31 ) - 1 ) );
}
return r;
}
std::string decode( std::string txt ) {
size_t len = txt.length();
while( len % 5 != 0 ) len--;
if( len != txt.length() ) txt = txt.substr( 0, len );
std::string r;
for( size_t i = 0; i < len; i += 5 ) {
r.append( 1, 'A' + std::distance( bAlphabet.begin(), std::find( bAlphabet.begin(), bAlphabet.end(), txt.substr( i, 5 ) ) ) );
}
return r;
}
private:
std::vector<std::string> bAlphabet;
};
| package main
import(
"fmt"
"strings"
)
var codes = map[rune]string {
'a' : "AAAAA", 'b' : "AAAAB", 'c' : "AAABA", 'd' : "AAABB", 'e' : "AABAA",
'f' : "AABAB", 'g' : "AABBA", 'h' : "AABBB", 'i' : "ABAAA", 'j' : "ABAAB",
'k' : "ABABA", 'l' : "ABABB", 'm' : "ABBAA", 'n' : "ABBAB", 'o' : "ABBBA",
'p' : "ABBBB", 'q' : "BAAAA", 'r' : "BAAAB", 's' : "BAABA", 't' : "BAABB",
'u' : "BABAA", 'v' : "BABAB", 'w' : "BABBA", 'x' : "BABBB", 'y' : "BBAAA",
'z' : "BBAAB", ' ' : "BBBAA",
}
func baconEncode(plainText string, message string) string {
pt := strings.ToLower(plainText)
var sb []byte
for _, c := range pt {
if c >= 'a' && c <= 'z' {
sb = append(sb, codes[c]...)
} else {
sb = append(sb, codes[' ']...)
}
}
et := string(sb)
mg := strings.ToLower(message)
sb = nil
var count = 0
for _, c := range mg {
if c >= 'a' && c <= 'z' {
if et[count] == 'A' {
sb = append(sb, byte(c))
} else {
sb = append(sb, byte(c - 32))
}
count++
if count == len(et) { break }
} else {
sb = append(sb, byte(c))
}
}
return string(sb)
}
func baconDecode(message string) string {
var sb []byte
for _, c := range message {
if c >= 'a' && c <= 'z' {
sb = append(sb, 'A')
} else if c >= 'A' && c <= 'Z' {
sb = append(sb, 'B')
}
}
et := string(sb)
sb = nil
for i := 0; i < len(et); i += 5 {
quintet := et[i : i + 5]
for k, v := range codes {
if v == quintet {
sb = append(sb, byte(k))
break
}
}
}
return string(sb)
}
func main() {
plainText := "the quick brown fox jumps over the lazy dog"
message := "bacon's cipher is a method of steganography created by francis bacon." +
"this task is to implement a program for encryption and decryption of " +
"plaintext using the simple alphabet of the baconian cipher or some " +
"other kind of representation of this alphabet (make anything signify anything). " +
"the baconian alphabet may optionally be extended to encode all lower " +
"case characters individually and/or adding a few punctuation characters " +
"such as the space."
cipherText := baconEncode(plainText, message)
fmt.Printf("Cipher text ->\n\n%s\n", cipherText)
decodedText := baconDecode(cipherText)
fmt.Printf("\nHidden text ->\n\n%s\n", decodedText)
}
|
Rewrite the snippet below in Go so it works the same as the original C++ code. | #include <iostream>
#include <algorithm>
#include <vector>
#include <bitset>
#include <string>
class bacon {
public:
bacon() {
int x = 0;
for( ; x < 9; x++ )
bAlphabet.push_back( std::bitset<5>( x ).to_string() );
bAlphabet.push_back( bAlphabet.back() );
for( ; x < 20; x++ )
bAlphabet.push_back( std::bitset<5>( x ).to_string() );
bAlphabet.push_back( bAlphabet.back() );
for( ; x < 24; x++ )
bAlphabet.push_back( std::bitset<5>( x ).to_string() );
}
std::string encode( std::string txt ) {
std::string r;
size_t z;
for( std::string::iterator i = txt.begin(); i != txt.end(); i++ ) {
z = toupper( *i );
if( z < 'A' || z > 'Z' ) continue;
r.append( bAlphabet.at( ( *i & 31 ) - 1 ) );
}
return r;
}
std::string decode( std::string txt ) {
size_t len = txt.length();
while( len % 5 != 0 ) len--;
if( len != txt.length() ) txt = txt.substr( 0, len );
std::string r;
for( size_t i = 0; i < len; i += 5 ) {
r.append( 1, 'A' + std::distance( bAlphabet.begin(), std::find( bAlphabet.begin(), bAlphabet.end(), txt.substr( i, 5 ) ) ) );
}
return r;
}
private:
std::vector<std::string> bAlphabet;
};
| package main
import(
"fmt"
"strings"
)
var codes = map[rune]string {
'a' : "AAAAA", 'b' : "AAAAB", 'c' : "AAABA", 'd' : "AAABB", 'e' : "AABAA",
'f' : "AABAB", 'g' : "AABBA", 'h' : "AABBB", 'i' : "ABAAA", 'j' : "ABAAB",
'k' : "ABABA", 'l' : "ABABB", 'm' : "ABBAA", 'n' : "ABBAB", 'o' : "ABBBA",
'p' : "ABBBB", 'q' : "BAAAA", 'r' : "BAAAB", 's' : "BAABA", 't' : "BAABB",
'u' : "BABAA", 'v' : "BABAB", 'w' : "BABBA", 'x' : "BABBB", 'y' : "BBAAA",
'z' : "BBAAB", ' ' : "BBBAA",
}
func baconEncode(plainText string, message string) string {
pt := strings.ToLower(plainText)
var sb []byte
for _, c := range pt {
if c >= 'a' && c <= 'z' {
sb = append(sb, codes[c]...)
} else {
sb = append(sb, codes[' ']...)
}
}
et := string(sb)
mg := strings.ToLower(message)
sb = nil
var count = 0
for _, c := range mg {
if c >= 'a' && c <= 'z' {
if et[count] == 'A' {
sb = append(sb, byte(c))
} else {
sb = append(sb, byte(c - 32))
}
count++
if count == len(et) { break }
} else {
sb = append(sb, byte(c))
}
}
return string(sb)
}
func baconDecode(message string) string {
var sb []byte
for _, c := range message {
if c >= 'a' && c <= 'z' {
sb = append(sb, 'A')
} else if c >= 'A' && c <= 'Z' {
sb = append(sb, 'B')
}
}
et := string(sb)
sb = nil
for i := 0; i < len(et); i += 5 {
quintet := et[i : i + 5]
for k, v := range codes {
if v == quintet {
sb = append(sb, byte(k))
break
}
}
}
return string(sb)
}
func main() {
plainText := "the quick brown fox jumps over the lazy dog"
message := "bacon's cipher is a method of steganography created by francis bacon." +
"this task is to implement a program for encryption and decryption of " +
"plaintext using the simple alphabet of the baconian cipher or some " +
"other kind of representation of this alphabet (make anything signify anything). " +
"the baconian alphabet may optionally be extended to encode all lower " +
"case characters individually and/or adding a few punctuation characters " +
"such as the space."
cipherText := baconEncode(plainText, message)
fmt.Printf("Cipher text ->\n\n%s\n", cipherText)
decodedText := baconDecode(cipherText)
fmt.Printf("\nHidden text ->\n\n%s\n", decodedText)
}
|
Maintain the same structure and functionality when rewriting this code in Go. | #include <iostream>
#include <algorithm>
#include <vector>
#include <bitset>
#include <string>
class bacon {
public:
bacon() {
int x = 0;
for( ; x < 9; x++ )
bAlphabet.push_back( std::bitset<5>( x ).to_string() );
bAlphabet.push_back( bAlphabet.back() );
for( ; x < 20; x++ )
bAlphabet.push_back( std::bitset<5>( x ).to_string() );
bAlphabet.push_back( bAlphabet.back() );
for( ; x < 24; x++ )
bAlphabet.push_back( std::bitset<5>( x ).to_string() );
}
std::string encode( std::string txt ) {
std::string r;
size_t z;
for( std::string::iterator i = txt.begin(); i != txt.end(); i++ ) {
z = toupper( *i );
if( z < 'A' || z > 'Z' ) continue;
r.append( bAlphabet.at( ( *i & 31 ) - 1 ) );
}
return r;
}
std::string decode( std::string txt ) {
size_t len = txt.length();
while( len % 5 != 0 ) len--;
if( len != txt.length() ) txt = txt.substr( 0, len );
std::string r;
for( size_t i = 0; i < len; i += 5 ) {
r.append( 1, 'A' + std::distance( bAlphabet.begin(), std::find( bAlphabet.begin(), bAlphabet.end(), txt.substr( i, 5 ) ) ) );
}
return r;
}
private:
std::vector<std::string> bAlphabet;
};
| package main
import(
"fmt"
"strings"
)
var codes = map[rune]string {
'a' : "AAAAA", 'b' : "AAAAB", 'c' : "AAABA", 'd' : "AAABB", 'e' : "AABAA",
'f' : "AABAB", 'g' : "AABBA", 'h' : "AABBB", 'i' : "ABAAA", 'j' : "ABAAB",
'k' : "ABABA", 'l' : "ABABB", 'm' : "ABBAA", 'n' : "ABBAB", 'o' : "ABBBA",
'p' : "ABBBB", 'q' : "BAAAA", 'r' : "BAAAB", 's' : "BAABA", 't' : "BAABB",
'u' : "BABAA", 'v' : "BABAB", 'w' : "BABBA", 'x' : "BABBB", 'y' : "BBAAA",
'z' : "BBAAB", ' ' : "BBBAA",
}
func baconEncode(plainText string, message string) string {
pt := strings.ToLower(plainText)
var sb []byte
for _, c := range pt {
if c >= 'a' && c <= 'z' {
sb = append(sb, codes[c]...)
} else {
sb = append(sb, codes[' ']...)
}
}
et := string(sb)
mg := strings.ToLower(message)
sb = nil
var count = 0
for _, c := range mg {
if c >= 'a' && c <= 'z' {
if et[count] == 'A' {
sb = append(sb, byte(c))
} else {
sb = append(sb, byte(c - 32))
}
count++
if count == len(et) { break }
} else {
sb = append(sb, byte(c))
}
}
return string(sb)
}
func baconDecode(message string) string {
var sb []byte
for _, c := range message {
if c >= 'a' && c <= 'z' {
sb = append(sb, 'A')
} else if c >= 'A' && c <= 'Z' {
sb = append(sb, 'B')
}
}
et := string(sb)
sb = nil
for i := 0; i < len(et); i += 5 {
quintet := et[i : i + 5]
for k, v := range codes {
if v == quintet {
sb = append(sb, byte(k))
break
}
}
}
return string(sb)
}
func main() {
plainText := "the quick brown fox jumps over the lazy dog"
message := "bacon's cipher is a method of steganography created by francis bacon." +
"this task is to implement a program for encryption and decryption of " +
"plaintext using the simple alphabet of the baconian cipher or some " +
"other kind of representation of this alphabet (make anything signify anything). " +
"the baconian alphabet may optionally be extended to encode all lower " +
"case characters individually and/or adding a few punctuation characters " +
"such as the space."
cipherText := baconEncode(plainText, message)
fmt.Printf("Cipher text ->\n\n%s\n", cipherText)
decodedText := baconDecode(cipherText)
fmt.Printf("\nHidden text ->\n\n%s\n", decodedText)
}
|
Produce a language-to-language conversion: from C++ to Go, same semantics. | #include <vector>
#include <memory>
#include <cmath>
#include <iostream>
#include <iomanip>
using namespace std;
typedef vector< int > IntRow;
typedef vector< IntRow > IntTable;
auto_ptr< IntTable > getSpiralArray( int dimension )
{
auto_ptr< IntTable > spiralArrayPtr( new IntTable(
dimension, IntRow( dimension ) ) );
int numConcentricSquares = static_cast< int >( ceil(
static_cast< double >( dimension ) / 2.0 ) );
int j;
int sideLen = dimension;
int currNum = 0;
for ( int i = 0; i < numConcentricSquares; i++ )
{
for ( j = 0; j < sideLen; j++ )
( *spiralArrayPtr )[ i ][ i + j ] = currNum++;
for ( j = 1; j < sideLen; j++ )
( *spiralArrayPtr )[ i + j ][ dimension - 1 - i ] = currNum++;
for ( j = sideLen - 2; j > -1; j-- )
( *spiralArrayPtr )[ dimension - 1 - i ][ i + j ] = currNum++;
for ( j = sideLen - 2; j > 0; j-- )
( *spiralArrayPtr )[ i + j ][ i ] = currNum++;
sideLen -= 2;
}
return spiralArrayPtr;
}
void printSpiralArray( const auto_ptr< IntTable >& spiralArrayPtr )
{
size_t dimension = spiralArrayPtr->size();
int fieldWidth = static_cast< int >( floor( log10(
static_cast< double >( dimension * dimension - 1 ) ) ) ) + 2;
size_t col;
for ( size_t row = 0; row < dimension; row++ )
{
for ( col = 0; col < dimension; col++ )
cout << setw( fieldWidth ) << ( *spiralArrayPtr )[ row ][ col ];
cout << endl;
}
}
int main()
{
printSpiralArray( getSpiralArray( 5 ) );
}
| package main
import (
"fmt"
"strconv"
)
var n = 5
func main() {
if n < 1 {
return
}
top, left, bottom, right := 0, 0, n-1, n-1
sz := n * n
a := make([]int, sz)
i := 0
for left < right {
for c := left; c <= right; c++ {
a[top*n+c] = i
i++
}
top++
for r := top; r <= bottom; r++ {
a[r*n+right] = i
i++
}
right--
if top == bottom {
break
}
for c := right; c >= left; c-- {
a[bottom*n+c] = i
i++
}
bottom--
for r := bottom; r >= top; r-- {
a[r*n+left] = i
i++
}
left++
}
a[top*n+left] = i
w := len(strconv.Itoa(n*n - 1))
for i, e := range a {
fmt.Printf("%*d ", w, e)
if i%n == n-1 {
fmt.Println("")
}
}
}
|
Write the same algorithm in Go as shown in this C++ implementation. | #include <vector>
#include <memory>
#include <cmath>
#include <iostream>
#include <iomanip>
using namespace std;
typedef vector< int > IntRow;
typedef vector< IntRow > IntTable;
auto_ptr< IntTable > getSpiralArray( int dimension )
{
auto_ptr< IntTable > spiralArrayPtr( new IntTable(
dimension, IntRow( dimension ) ) );
int numConcentricSquares = static_cast< int >( ceil(
static_cast< double >( dimension ) / 2.0 ) );
int j;
int sideLen = dimension;
int currNum = 0;
for ( int i = 0; i < numConcentricSquares; i++ )
{
for ( j = 0; j < sideLen; j++ )
( *spiralArrayPtr )[ i ][ i + j ] = currNum++;
for ( j = 1; j < sideLen; j++ )
( *spiralArrayPtr )[ i + j ][ dimension - 1 - i ] = currNum++;
for ( j = sideLen - 2; j > -1; j-- )
( *spiralArrayPtr )[ dimension - 1 - i ][ i + j ] = currNum++;
for ( j = sideLen - 2; j > 0; j-- )
( *spiralArrayPtr )[ i + j ][ i ] = currNum++;
sideLen -= 2;
}
return spiralArrayPtr;
}
void printSpiralArray( const auto_ptr< IntTable >& spiralArrayPtr )
{
size_t dimension = spiralArrayPtr->size();
int fieldWidth = static_cast< int >( floor( log10(
static_cast< double >( dimension * dimension - 1 ) ) ) ) + 2;
size_t col;
for ( size_t row = 0; row < dimension; row++ )
{
for ( col = 0; col < dimension; col++ )
cout << setw( fieldWidth ) << ( *spiralArrayPtr )[ row ][ col ];
cout << endl;
}
}
int main()
{
printSpiralArray( getSpiralArray( 5 ) );
}
| package main
import (
"fmt"
"strconv"
)
var n = 5
func main() {
if n < 1 {
return
}
top, left, bottom, right := 0, 0, n-1, n-1
sz := n * n
a := make([]int, sz)
i := 0
for left < right {
for c := left; c <= right; c++ {
a[top*n+c] = i
i++
}
top++
for r := top; r <= bottom; r++ {
a[r*n+right] = i
i++
}
right--
if top == bottom {
break
}
for c := right; c >= left; c-- {
a[bottom*n+c] = i
i++
}
bottom--
for r := bottom; r >= top; r-- {
a[r*n+left] = i
i++
}
left++
}
a[top*n+left] = i
w := len(strconv.Itoa(n*n - 1))
for i, e := range a {
fmt.Printf("%*d ", w, e)
if i%n == n-1 {
fmt.Println("")
}
}
}
|
Preserve the algorithm and functionality while converting the code from C++ to Go. | #include <vector>
#include <algorithm>
#include <string>
template <class T>
struct sort_table_functor {
typedef bool (*CompFun)(const T &, const T &);
const CompFun ordering;
const int column;
const bool reverse;
sort_table_functor(CompFun o, int c, bool r) :
ordering(o), column(c), reverse(r) { }
bool operator()(const std::vector<T> &x, const std::vector<T> &y) const {
const T &a = x[column],
&b = y[column];
return reverse ? ordering(b, a)
: ordering(a, b);
}
};
template <class T>
bool myLess(const T &x, const T &y) { return x < y; }
template <class T>
void sort_table(std::vector<std::vector<T> > &table,
int column = 0, bool reverse = false,
bool (*ordering)(const T &, const T &) = myLess) {
std::sort(table.begin(), table.end(),
sort_table_functor<T>(ordering, column, reverse));
}
#include <iostream>
template <class T>
void print_matrix(std::vector<std::vector<T> > &data) {
for () {
for (int j = 0; j < 3; j++)
std::cout << data[i][j] << "\t";
std::cout << std::endl;
}
}
bool desc_len_comparator(const std::string &x, const std::string &y) {
return x.length() > y.length();
}
int main() {
std::string data_array[3][3] =
{
{"a", "b", "c"},
{"", "q", "z"},
{"zap", "zip", "Zot"}
};
std::vector<std::vector<std::string> > data_orig;
for (int i = 0; i < 3; i++) {
std::vector<std::string> row;
for (int j = 0; j < 3; j++)
row.push_back(data_array[i][j]);
data_orig.push_back(row);
}
print_matrix(data_orig);
std::vector<std::vector<std::string> > data = data_orig;
sort_table(data);
print_matrix(data);
data = data_orig;
sort_table(data, 2);
print_matrix(data);
data = data_orig;
sort_table(data, 1);
print_matrix(data);
data = data_orig;
sort_table(data, 1, true);
print_matrix(data);
data = data_orig;
sort_table(data, 0, false, desc_len_comparator);
print_matrix(data);
return 0;
}
| type cell string
type spec struct {
less func(cell, cell) bool
column int
reverse bool
}
func newSpec() (s spec) {
return
}
t.sort(newSpec())
s := newSpec
s.reverse = true
t.sort(s)
|
Can you help me rewrite this code in Go instead of C++, keeping it the same logically? | #include <windows.h>
#include <vector>
#include <string>
using namespace std;
struct Point {
int x, y;
};
class MyBitmap {
public:
MyBitmap() : pen_(nullptr) {}
~MyBitmap() {
DeleteObject(pen_);
DeleteDC(hdc_);
DeleteObject(bmp_);
}
bool Create(int w, int h) {
BITMAPINFO bi;
ZeroMemory(&bi, sizeof(bi));
bi.bmiHeader.biSize = sizeof(bi.bmiHeader);
bi.bmiHeader.biBitCount = sizeof(DWORD) * 8;
bi.bmiHeader.biCompression = BI_RGB;
bi.bmiHeader.biPlanes = 1;
bi.bmiHeader.biWidth = w;
bi.bmiHeader.biHeight = -h;
void *bits_ptr = nullptr;
HDC dc = GetDC(GetConsoleWindow());
bmp_ = CreateDIBSection(dc, &bi, DIB_RGB_COLORS, &bits_ptr, nullptr, 0);
if (!bmp_) return false;
hdc_ = CreateCompatibleDC(dc);
SelectObject(hdc_, bmp_);
ReleaseDC(GetConsoleWindow(), dc);
width_ = w;
height_ = h;
return true;
}
void SetPenColor(DWORD clr) {
if (pen_) DeleteObject(pen_);
pen_ = CreatePen(PS_SOLID, 1, clr);
SelectObject(hdc_, pen_);
}
bool SaveBitmap(const char* path) {
HANDLE file = CreateFile(path, GENERIC_WRITE, 0, nullptr, CREATE_ALWAYS, FILE_ATTRIBUTE_NORMAL, nullptr);
if (file == INVALID_HANDLE_VALUE) {
return false;
}
BITMAPFILEHEADER fileheader;
BITMAPINFO infoheader;
BITMAP bitmap;
GetObject(bmp_, sizeof(bitmap), &bitmap);
DWORD* dwp_bits = new DWORD[bitmap.bmWidth * bitmap.bmHeight];
ZeroMemory(dwp_bits, bitmap.bmWidth * bitmap.bmHeight * sizeof(DWORD));
ZeroMemory(&infoheader, sizeof(BITMAPINFO));
ZeroMemory(&fileheader, sizeof(BITMAPFILEHEADER));
infoheader.bmiHeader.biBitCount = sizeof(DWORD) * 8;
infoheader.bmiHeader.biCompression = BI_RGB;
infoheader.bmiHeader.biPlanes = 1;
infoheader.bmiHeader.biSize = sizeof(infoheader.bmiHeader);
infoheader.bmiHeader.biHeight = bitmap.bmHeight;
infoheader.bmiHeader.biWidth = bitmap.bmWidth;
infoheader.bmiHeader.biSizeImage = bitmap.bmWidth * bitmap.bmHeight * sizeof(DWORD);
fileheader.bfType = 0x4D42;
fileheader.bfOffBits = sizeof(infoheader.bmiHeader) + sizeof(BITMAPFILEHEADER);
fileheader.bfSize = fileheader.bfOffBits + infoheader.bmiHeader.biSizeImage;
GetDIBits(hdc_, bmp_, 0, height_, (LPVOID)dwp_bits, &infoheader, DIB_RGB_COLORS);
DWORD wb;
WriteFile(file, &fileheader, sizeof(BITMAPFILEHEADER), &wb, nullptr);
WriteFile(file, &infoheader.bmiHeader, sizeof(infoheader.bmiHeader), &wb, nullptr);
WriteFile(file, dwp_bits, bitmap.bmWidth * bitmap.bmHeight * 4, &wb, nullptr);
CloseHandle(file);
delete[] dwp_bits;
return true;
}
HDC hdc() { return hdc_; }
int width() { return width_; }
int height() { return height_; }
private:
HBITMAP bmp_;
HDC hdc_;
HPEN pen_;
int width_, height_;
};
static int DistanceSqrd(const Point& point, int x, int y) {
int xd = x - point.x;
int yd = y - point.y;
return (xd * xd) + (yd * yd);
}
class Voronoi {
public:
void Make(MyBitmap* bmp, int count) {
bmp_ = bmp;
CreatePoints(count);
CreateColors();
CreateSites();
SetSitesPoints();
}
private:
void CreateSites() {
int w = bmp_->width(), h = bmp_->height(), d;
for (int hh = 0; hh < h; hh++) {
for (int ww = 0; ww < w; ww++) {
int ind = -1, dist = INT_MAX;
for (size_t it = 0; it < points_.size(); it++) {
const Point& p = points_[it];
d = DistanceSqrd(p, ww, hh);
if (d < dist) {
dist = d;
ind = it;
}
}
if (ind > -1)
SetPixel(bmp_->hdc(), ww, hh, colors_[ind]);
else
__asm nop
}
}
}
void SetSitesPoints() {
for (const auto& point : points_) {
int x = point.x, y = point.y;
for (int i = -1; i < 2; i++)
for (int j = -1; j < 2; j++)
SetPixel(bmp_->hdc(), x + i, y + j, 0);
}
}
void CreatePoints(int count) {
const int w = bmp_->width() - 20, h = bmp_->height() - 20;
for (int i = 0; i < count; i++) {
points_.push_back({ rand() % w + 10, rand() % h + 10 });
}
}
void CreateColors() {
for (size_t i = 0; i < points_.size(); i++) {
DWORD c = RGB(rand() % 200 + 50, rand() % 200 + 55, rand() % 200 + 50);
colors_.push_back(c);
}
}
vector<Point> points_;
vector<DWORD> colors_;
MyBitmap* bmp_;
};
int main(int argc, char* argv[]) {
ShowWindow(GetConsoleWindow(), SW_MAXIMIZE);
srand(GetTickCount());
MyBitmap bmp;
bmp.Create(512, 512);
bmp.SetPenColor(0);
Voronoi v;
v.Make(&bmp, 50);
BitBlt(GetDC(GetConsoleWindow()), 20, 20, 512, 512, bmp.hdc(), 0, 0, SRCCOPY);
bmp.SaveBitmap("v.bmp");
system("pause");
return 0;
}
| package main
import (
"fmt"
"image"
"image/color"
"image/draw"
"image/png"
"math/rand"
"os"
"time"
)
const (
imageWidth = 300
imageHeight = 200
nSites = 10
)
func main() {
writePngFile(generateVoronoi(randomSites()))
}
func generateVoronoi(sx, sy []int) image.Image {
sc := make([]color.NRGBA, nSites)
for i := range sx {
sc[i] = color.NRGBA{uint8(rand.Intn(256)), uint8(rand.Intn(256)),
uint8(rand.Intn(256)), 255}
}
img := image.NewNRGBA(image.Rect(0, 0, imageWidth, imageHeight))
for x := 0; x < imageWidth; x++ {
for y := 0; y < imageHeight; y++ {
dMin := dot(imageWidth, imageHeight)
var sMin int
for s := 0; s < nSites; s++ {
if d := dot(sx[s]-x, sy[s]-y); d < dMin {
sMin = s
dMin = d
}
}
img.SetNRGBA(x, y, sc[sMin])
}
}
black := image.NewUniform(color.Black)
for s := 0; s < nSites; s++ {
draw.Draw(img, image.Rect(sx[s]-2, sy[s]-2, sx[s]+2, sy[s]+2),
black, image.ZP, draw.Src)
}
return img
}
func dot(x, y int) int {
return x*x + y*y
}
func randomSites() (sx, sy []int) {
rand.Seed(time.Now().Unix())
sx = make([]int, nSites)
sy = make([]int, nSites)
for i := range sx {
sx[i] = rand.Intn(imageWidth)
sy[i] = rand.Intn(imageHeight)
}
return
}
func writePngFile(img image.Image) {
f, err := os.Create("voronoi.png")
if err != nil {
fmt.Println(err)
return
}
if err = png.Encode(f, img); err != nil {
fmt.Println(err)
}
if err = f.Close(); err != nil {
fmt.Println(err)
}
}
|
Translate the given C++ code snippet into Go without altering its behavior. | #include <windows.h>
#include <vector>
#include <string>
using namespace std;
struct Point {
int x, y;
};
class MyBitmap {
public:
MyBitmap() : pen_(nullptr) {}
~MyBitmap() {
DeleteObject(pen_);
DeleteDC(hdc_);
DeleteObject(bmp_);
}
bool Create(int w, int h) {
BITMAPINFO bi;
ZeroMemory(&bi, sizeof(bi));
bi.bmiHeader.biSize = sizeof(bi.bmiHeader);
bi.bmiHeader.biBitCount = sizeof(DWORD) * 8;
bi.bmiHeader.biCompression = BI_RGB;
bi.bmiHeader.biPlanes = 1;
bi.bmiHeader.biWidth = w;
bi.bmiHeader.biHeight = -h;
void *bits_ptr = nullptr;
HDC dc = GetDC(GetConsoleWindow());
bmp_ = CreateDIBSection(dc, &bi, DIB_RGB_COLORS, &bits_ptr, nullptr, 0);
if (!bmp_) return false;
hdc_ = CreateCompatibleDC(dc);
SelectObject(hdc_, bmp_);
ReleaseDC(GetConsoleWindow(), dc);
width_ = w;
height_ = h;
return true;
}
void SetPenColor(DWORD clr) {
if (pen_) DeleteObject(pen_);
pen_ = CreatePen(PS_SOLID, 1, clr);
SelectObject(hdc_, pen_);
}
bool SaveBitmap(const char* path) {
HANDLE file = CreateFile(path, GENERIC_WRITE, 0, nullptr, CREATE_ALWAYS, FILE_ATTRIBUTE_NORMAL, nullptr);
if (file == INVALID_HANDLE_VALUE) {
return false;
}
BITMAPFILEHEADER fileheader;
BITMAPINFO infoheader;
BITMAP bitmap;
GetObject(bmp_, sizeof(bitmap), &bitmap);
DWORD* dwp_bits = new DWORD[bitmap.bmWidth * bitmap.bmHeight];
ZeroMemory(dwp_bits, bitmap.bmWidth * bitmap.bmHeight * sizeof(DWORD));
ZeroMemory(&infoheader, sizeof(BITMAPINFO));
ZeroMemory(&fileheader, sizeof(BITMAPFILEHEADER));
infoheader.bmiHeader.biBitCount = sizeof(DWORD) * 8;
infoheader.bmiHeader.biCompression = BI_RGB;
infoheader.bmiHeader.biPlanes = 1;
infoheader.bmiHeader.biSize = sizeof(infoheader.bmiHeader);
infoheader.bmiHeader.biHeight = bitmap.bmHeight;
infoheader.bmiHeader.biWidth = bitmap.bmWidth;
infoheader.bmiHeader.biSizeImage = bitmap.bmWidth * bitmap.bmHeight * sizeof(DWORD);
fileheader.bfType = 0x4D42;
fileheader.bfOffBits = sizeof(infoheader.bmiHeader) + sizeof(BITMAPFILEHEADER);
fileheader.bfSize = fileheader.bfOffBits + infoheader.bmiHeader.biSizeImage;
GetDIBits(hdc_, bmp_, 0, height_, (LPVOID)dwp_bits, &infoheader, DIB_RGB_COLORS);
DWORD wb;
WriteFile(file, &fileheader, sizeof(BITMAPFILEHEADER), &wb, nullptr);
WriteFile(file, &infoheader.bmiHeader, sizeof(infoheader.bmiHeader), &wb, nullptr);
WriteFile(file, dwp_bits, bitmap.bmWidth * bitmap.bmHeight * 4, &wb, nullptr);
CloseHandle(file);
delete[] dwp_bits;
return true;
}
HDC hdc() { return hdc_; }
int width() { return width_; }
int height() { return height_; }
private:
HBITMAP bmp_;
HDC hdc_;
HPEN pen_;
int width_, height_;
};
static int DistanceSqrd(const Point& point, int x, int y) {
int xd = x - point.x;
int yd = y - point.y;
return (xd * xd) + (yd * yd);
}
class Voronoi {
public:
void Make(MyBitmap* bmp, int count) {
bmp_ = bmp;
CreatePoints(count);
CreateColors();
CreateSites();
SetSitesPoints();
}
private:
void CreateSites() {
int w = bmp_->width(), h = bmp_->height(), d;
for (int hh = 0; hh < h; hh++) {
for (int ww = 0; ww < w; ww++) {
int ind = -1, dist = INT_MAX;
for (size_t it = 0; it < points_.size(); it++) {
const Point& p = points_[it];
d = DistanceSqrd(p, ww, hh);
if (d < dist) {
dist = d;
ind = it;
}
}
if (ind > -1)
SetPixel(bmp_->hdc(), ww, hh, colors_[ind]);
else
__asm nop
}
}
}
void SetSitesPoints() {
for (const auto& point : points_) {
int x = point.x, y = point.y;
for (int i = -1; i < 2; i++)
for (int j = -1; j < 2; j++)
SetPixel(bmp_->hdc(), x + i, y + j, 0);
}
}
void CreatePoints(int count) {
const int w = bmp_->width() - 20, h = bmp_->height() - 20;
for (int i = 0; i < count; i++) {
points_.push_back({ rand() % w + 10, rand() % h + 10 });
}
}
void CreateColors() {
for (size_t i = 0; i < points_.size(); i++) {
DWORD c = RGB(rand() % 200 + 50, rand() % 200 + 55, rand() % 200 + 50);
colors_.push_back(c);
}
}
vector<Point> points_;
vector<DWORD> colors_;
MyBitmap* bmp_;
};
int main(int argc, char* argv[]) {
ShowWindow(GetConsoleWindow(), SW_MAXIMIZE);
srand(GetTickCount());
MyBitmap bmp;
bmp.Create(512, 512);
bmp.SetPenColor(0);
Voronoi v;
v.Make(&bmp, 50);
BitBlt(GetDC(GetConsoleWindow()), 20, 20, 512, 512, bmp.hdc(), 0, 0, SRCCOPY);
bmp.SaveBitmap("v.bmp");
system("pause");
return 0;
}
| package main
import (
"fmt"
"image"
"image/color"
"image/draw"
"image/png"
"math/rand"
"os"
"time"
)
const (
imageWidth = 300
imageHeight = 200
nSites = 10
)
func main() {
writePngFile(generateVoronoi(randomSites()))
}
func generateVoronoi(sx, sy []int) image.Image {
sc := make([]color.NRGBA, nSites)
for i := range sx {
sc[i] = color.NRGBA{uint8(rand.Intn(256)), uint8(rand.Intn(256)),
uint8(rand.Intn(256)), 255}
}
img := image.NewNRGBA(image.Rect(0, 0, imageWidth, imageHeight))
for x := 0; x < imageWidth; x++ {
for y := 0; y < imageHeight; y++ {
dMin := dot(imageWidth, imageHeight)
var sMin int
for s := 0; s < nSites; s++ {
if d := dot(sx[s]-x, sy[s]-y); d < dMin {
sMin = s
dMin = d
}
}
img.SetNRGBA(x, y, sc[sMin])
}
}
black := image.NewUniform(color.Black)
for s := 0; s < nSites; s++ {
draw.Draw(img, image.Rect(sx[s]-2, sy[s]-2, sx[s]+2, sy[s]+2),
black, image.ZP, draw.Src)
}
return img
}
func dot(x, y int) int {
return x*x + y*y
}
func randomSites() (sx, sy []int) {
rand.Seed(time.Now().Unix())
sx = make([]int, nSites)
sy = make([]int, nSites)
for i := range sx {
sx[i] = rand.Intn(imageWidth)
sy[i] = rand.Intn(imageHeight)
}
return
}
func writePngFile(img image.Image) {
f, err := os.Create("voronoi.png")
if err != nil {
fmt.Println(err)
return
}
if err = png.Encode(f, img); err != nil {
fmt.Println(err)
}
if err = f.Close(); err != nil {
fmt.Println(err)
}
}
|
Can you help me rewrite this code in Go instead of C++, keeping it the same logically? | FUNCTION MULTIPLY(X, Y)
DOUBLE PRECISION MULTIPLY, X, Y
| package main
import "C"
import (
"fmt"
"unsafe"
)
func main() {
go1 := "hello C"
c1 := C.CString(go1)
go1 = ""
c2 := C.strdup(c1)
C.free(unsafe.Pointer(c1))
go2 := C.GoString(c2)
C.free(unsafe.Pointer(c2))
fmt.Println(go2)
}
|
Produce a language-to-language conversion: from C++ to Go, same semantics. | #include <iostream>
#include <functional>
#include <vector>
#include <cstdlib>
#include <ctime>
template <typename T>
std::function<std::vector<T>(T)> s_of_n_creator(int n) {
std::vector<T> sample;
int i = 0;
return [=](T item) mutable {
i++;
if (i <= n) {
sample.push_back(item);
} else if (std::rand() % i < n) {
sample[std::rand() % n] = item;
}
return sample;
};
}
int main() {
std::srand(std::time(NULL));
int bin[10] = {0};
for (int trial = 0; trial < 100000; trial++) {
auto s_of_n = s_of_n_creator<int>(3);
std::vector<int> sample;
for (int i = 0; i < 10; i++)
sample = s_of_n(i);
for (int s : sample)
bin[s]++;
}
for (int x : bin)
std::cout << x << std::endl;
return 0;
}
| package main
import (
"fmt"
"math/rand"
"time"
)
func sOfNCreator(n int) func(byte) []byte {
s := make([]byte, 0, n)
m := n
return func(item byte) []byte {
if len(s) < n {
s = append(s, item)
} else {
m++
if rand.Intn(m) < n {
s[rand.Intn(n)] = item
}
}
return s
}
}
func main() {
rand.Seed(time.Now().UnixNano())
var freq [10]int
for r := 0; r < 1e5; r++ {
sOfN := sOfNCreator(3)
for d := byte('0'); d < '9'; d++ {
sOfN(d)
}
for _, d := range sOfN('9') {
freq[d-'0']++
}
}
fmt.Println(freq)
}
|
Can you help me rewrite this code in Go instead of C++, keeping it the same logically? | #include <iostream>
#include <functional>
#include <vector>
#include <cstdlib>
#include <ctime>
template <typename T>
std::function<std::vector<T>(T)> s_of_n_creator(int n) {
std::vector<T> sample;
int i = 0;
return [=](T item) mutable {
i++;
if (i <= n) {
sample.push_back(item);
} else if (std::rand() % i < n) {
sample[std::rand() % n] = item;
}
return sample;
};
}
int main() {
std::srand(std::time(NULL));
int bin[10] = {0};
for (int trial = 0; trial < 100000; trial++) {
auto s_of_n = s_of_n_creator<int>(3);
std::vector<int> sample;
for (int i = 0; i < 10; i++)
sample = s_of_n(i);
for (int s : sample)
bin[s]++;
}
for (int x : bin)
std::cout << x << std::endl;
return 0;
}
| package main
import (
"fmt"
"math/rand"
"time"
)
func sOfNCreator(n int) func(byte) []byte {
s := make([]byte, 0, n)
m := n
return func(item byte) []byte {
if len(s) < n {
s = append(s, item)
} else {
m++
if rand.Intn(m) < n {
s[rand.Intn(n)] = item
}
}
return s
}
}
func main() {
rand.Seed(time.Now().UnixNano())
var freq [10]int
for r := 0; r < 1e5; r++ {
sOfN := sOfNCreator(3)
for d := byte('0'); d < '9'; d++ {
sOfN(d)
}
for _, d := range sOfN('9') {
freq[d-'0']++
}
}
fmt.Println(freq)
}
|
Can you help me rewrite this code in Go instead of C++, keeping it the same logically? | #include <exception>
#include <iomanip>
#include <iostream>
#include <numeric>
#include <sstream>
#include <vector>
class Frac {
public:
Frac() : num(0), denom(1) {}
Frac(int n, int d) {
if (d == 0) {
throw std::runtime_error("d must not be zero");
}
int sign_of_d = d < 0 ? -1 : 1;
int g = std::gcd(n, d);
num = sign_of_d * n / g;
denom = sign_of_d * d / g;
}
Frac operator-() const {
return Frac(-num, denom);
}
Frac operator+(const Frac& rhs) const {
return Frac(num*rhs.denom + denom * rhs.num, rhs.denom*denom);
}
Frac operator-(const Frac& rhs) const {
return Frac(num*rhs.denom - denom * rhs.num, rhs.denom*denom);
}
Frac operator*(const Frac& rhs) const {
return Frac(num*rhs.num, denom*rhs.denom);
}
Frac operator*(int rhs) const {
return Frac(num * rhs, denom);
}
friend std::ostream& operator<<(std::ostream&, const Frac&);
private:
int num;
int denom;
};
std::ostream & operator<<(std::ostream & os, const Frac &f) {
if (f.num == 0 || f.denom == 1) {
return os << f.num;
}
std::stringstream ss;
ss << f.num << "/" << f.denom;
return os << ss.str();
}
Frac bernoulli(int n) {
if (n < 0) {
throw std::runtime_error("n may not be negative or zero");
}
std::vector<Frac> a;
for (int m = 0; m <= n; m++) {
a.push_back(Frac(1, m + 1));
for (int j = m; j >= 1; j--) {
a[j - 1] = (a[j - 1] - a[j]) * j;
}
}
if (n != 1) return a[0];
return -a[0];
}
int binomial(int n, int k) {
if (n < 0 || k < 0 || n < k) {
throw std::runtime_error("parameters are invalid");
}
if (n == 0 || k == 0) return 1;
int num = 1;
for (int i = k + 1; i <= n; i++) {
num *= i;
}
int denom = 1;
for (int i = 2; i <= n - k; i++) {
denom *= i;
}
return num / denom;
}
std::vector<Frac> faulhaberTraingle(int p) {
std::vector<Frac> coeffs(p + 1);
Frac q{ 1, p + 1 };
int sign = -1;
for (int j = 0; j <= p; j++) {
sign *= -1;
coeffs[p - j] = q * sign * binomial(p + 1, j) * bernoulli(j);
}
return coeffs;
}
int main() {
for (int i = 0; i < 10; i++) {
std::vector<Frac> coeffs = faulhaberTraingle(i);
for (auto frac : coeffs) {
std::cout << std::right << std::setw(5) << frac << " ";
}
std::cout << std::endl;
}
return 0;
}
| package main
import (
"fmt"
"math/big"
)
func bernoulli(n uint) *big.Rat {
a := make([]big.Rat, n+1)
z := new(big.Rat)
for m := range a {
a[m].SetFrac64(1, int64(m+1))
for j := m; j >= 1; j-- {
d := &a[j-1]
d.Mul(z.SetInt64(int64(j)), d.Sub(d, &a[j]))
}
}
if n != 1 {
return &a[0]
}
a[0].Neg(&a[0])
return &a[0]
}
func binomial(n, k int) int64 {
if n <= 0 || k <= 0 || n < k {
return 1
}
var num, den int64 = 1, 1
for i := k + 1; i <= n; i++ {
num *= int64(i)
}
for i := 2; i <= n-k; i++ {
den *= int64(i)
}
return num / den
}
func faulhaberTriangle(p int) []big.Rat {
coeffs := make([]big.Rat, p+1)
q := big.NewRat(1, int64(p)+1)
t := new(big.Rat)
u := new(big.Rat)
sign := -1
for j := range coeffs {
sign *= -1
d := &coeffs[p-j]
t.SetInt64(int64(sign))
u.SetInt64(binomial(p+1, j))
d.Mul(q, t)
d.Mul(d, u)
d.Mul(d, bernoulli(uint(j)))
}
return coeffs
}
func main() {
for i := 0; i < 10; i++ {
coeffs := faulhaberTriangle(i)
for _, coeff := range coeffs {
fmt.Printf("%5s ", coeff.RatString())
}
fmt.Println()
}
fmt.Println()
k := 17
cc := faulhaberTriangle(k)
n := int64(1000)
nn := big.NewRat(n, 1)
np := big.NewRat(1, 1)
sum := new(big.Rat)
tmp := new(big.Rat)
for _, c := range cc {
np.Mul(np, nn)
tmp.Set(np)
tmp.Mul(tmp, &c)
sum.Add(sum, tmp)
}
fmt.Println(sum.RatString())
}
|
Rewrite the snippet below in Go so it works the same as the original C++ code. | #include <iostream>
int main(int argc, char* argv[])
{
std::cout << "This program is named " << argv[0] << std::endl;
std::cout << "There are " << argc-1 << " arguments given." << std::endl;
for (int i = 1; i < argc; ++i)
std::cout << "the argument #" << i << " is " << argv[i] << std::endl;
return 0;
}
| package main
import (
"fmt"
"os"
)
func main() {
for i, x := range os.Args[1:] {
fmt.Printf("the argument #%d is %s\n", i, x)
}
}
|
Rewrite the snippet below in Go so it works the same as the original C++ code. | #include <iostream>
int main(int argc, char* argv[])
{
std::cout << "This program is named " << argv[0] << std::endl;
std::cout << "There are " << argc-1 << " arguments given." << std::endl;
for (int i = 1; i < argc; ++i)
std::cout << "the argument #" << i << " is " << argv[i] << std::endl;
return 0;
}
| package main
import (
"fmt"
"os"
)
func main() {
for i, x := range os.Args[1:] {
fmt.Printf("the argument #%d is %s\n", i, x)
}
}
|
Maintain the same structure and functionality when rewriting this code in Go. | #include <array>
#include <iostream>
#include <fstream>
#include <map>
#include <string>
#include <vector>
#include <boost/program_options.hpp>
class letterset {
public:
letterset() {
count_.fill(0);
}
explicit letterset(const std::string& str) {
count_.fill(0);
for (char c : str)
add(c);
}
bool contains(const letterset& set) const {
for (size_t i = 0; i < count_.size(); ++i) {
if (set.count_[i] > count_[i])
return false;
}
return true;
}
unsigned int count(char c) const {
return count_[index(c)];
}
bool is_valid() const {
return count_[0] == 0;
}
void add(char c) {
++count_[index(c)];
}
private:
static bool is_letter(char c) { return c >= 'a' && c <= 'z'; }
static int index(char c) { return is_letter(c) ? c - 'a' + 1 : 0; }
std::array<unsigned int, 27> count_;
};
template <typename iterator, typename separator>
std::string join(iterator begin, iterator end, separator sep) {
std::string result;
if (begin != end) {
result += *begin++;
for (; begin != end; ++begin) {
result += sep;
result += *begin;
}
}
return result;
}
using dictionary = std::vector<std::pair<std::string, letterset>>;
dictionary load_dictionary(const std::string& filename, int min_length,
int max_length) {
std::ifstream in(filename);
if (!in)
throw std::runtime_error("Cannot open file " + filename);
std::string word;
dictionary result;
while (getline(in, word)) {
if (word.size() < min_length)
continue;
if (word.size() > max_length)
continue;
letterset set(word);
if (set.is_valid())
result.emplace_back(word, set);
}
return result;
}
void word_wheel(const dictionary& dict, const std::string& letters,
char central_letter) {
letterset set(letters);
if (central_letter == 0 && !letters.empty())
central_letter = letters.at(letters.size()/2);
std::map<size_t, std::vector<std::string>> words;
for (const auto& pair : dict) {
const auto& word = pair.first;
const auto& subset = pair.second;
if (subset.count(central_letter) > 0 && set.contains(subset))
words[word.size()].push_back(word);
}
size_t total = 0;
for (const auto& p : words) {
const auto& v = p.second;
auto n = v.size();
total += n;
std::cout << "Found " << n << " " << (n == 1 ? "word" : "words")
<< " of length " << p.first << ": "
<< join(v.begin(), v.end(), ", ") << '\n';
}
std::cout << "Number of words found: " << total << '\n';
}
void find_max_word_count(const dictionary& dict, int word_length) {
size_t max_count = 0;
std::vector<std::pair<std::string, char>> max_words;
for (const auto& pair : dict) {
const auto& word = pair.first;
if (word.size() != word_length)
continue;
const auto& set = pair.second;
dictionary subsets;
for (const auto& p : dict) {
if (set.contains(p.second))
subsets.push_back(p);
}
letterset done;
for (size_t index = 0; index < word_length; ++index) {
char central_letter = word[index];
if (done.count(central_letter) > 0)
continue;
done.add(central_letter);
size_t count = 0;
for (const auto& p : subsets) {
const auto& subset = p.second;
if (subset.count(central_letter) > 0)
++count;
}
if (count > max_count) {
max_words.clear();
max_count = count;
}
if (count == max_count)
max_words.emplace_back(word, central_letter);
}
}
std::cout << "Maximum word count: " << max_count << '\n';
std::cout << "Words of " << word_length << " letters producing this count:\n";
for (const auto& pair : max_words)
std::cout << pair.first << " with central letter " << pair.second << '\n';
}
constexpr const char* option_filename = "filename";
constexpr const char* option_wheel = "wheel";
constexpr const char* option_central = "central";
constexpr const char* option_min_length = "min-length";
constexpr const char* option_part2 = "part2";
int main(int argc, char** argv) {
const int word_length = 9;
int min_length = 3;
std::string letters = "ndeokgelw";
std::string filename = "unixdict.txt";
char central_letter = 0;
bool do_part2 = false;
namespace po = boost::program_options;
po::options_description desc("Allowed options");
desc.add_options()
(option_filename, po::value<std::string>(), "name of dictionary file")
(option_wheel, po::value<std::string>(), "word wheel letters")
(option_central, po::value<char>(), "central letter (defaults to middle letter of word)")
(option_min_length, po::value<int>(), "minimum word length")
(option_part2, "include part 2");
try {
po::variables_map vm;
po::store(po::parse_command_line(argc, argv, desc), vm);
po::notify(vm);
if (vm.count(option_filename))
filename = vm[option_filename].as<std::string>();
if (vm.count(option_wheel))
letters = vm[option_wheel].as<std::string>();
if (vm.count(option_central))
central_letter = vm[option_central].as<char>();
if (vm.count(option_min_length))
min_length = vm[option_min_length].as<int>();
if (vm.count(option_part2))
do_part2 = true;
auto dict = load_dictionary(filename, min_length, word_length);
word_wheel(dict, letters, central_letter);
if (do_part2) {
std::cout << '\n';
find_max_word_count(dict, word_length);
}
} catch (const std::exception& ex) {
std::cerr << ex.what() << '\n';
return EXIT_FAILURE;
}
return EXIT_SUCCESS;
}
| package main
import (
"bytes"
"fmt"
"io/ioutil"
"log"
"sort"
"strings"
)
func main() {
b, err := ioutil.ReadFile("unixdict.txt")
if err != nil {
log.Fatal("Error reading file")
}
letters := "deegklnow"
wordsAll := bytes.Split(b, []byte{'\n'})
var words [][]byte
for _, word := range wordsAll {
word = bytes.TrimSpace(word)
le := len(word)
if le > 2 && le < 10 {
words = append(words, word)
}
}
var found []string
for _, word := range words {
le := len(word)
if bytes.IndexByte(word, 'k') >= 0 {
lets := letters
ok := true
for i := 0; i < le; i++ {
c := word[i]
ix := sort.Search(len(lets), func(i int) bool { return lets[i] >= c })
if ix < len(lets) && lets[ix] == c {
lets = lets[0:ix] + lets[ix+1:]
} else {
ok = false
break
}
}
if ok {
found = append(found, string(word))
}
}
}
fmt.Println("The following", len(found), "words are the solutions to the puzzle:")
fmt.Println(strings.Join(found, "\n"))
mostFound := 0
var mostWords9 []string
var mostLetters []byte
var words9 [][]byte
for _, word := range words {
if len(word) == 9 {
words9 = append(words9, word)
}
}
for _, word9 := range words9 {
letterBytes := make([]byte, len(word9))
copy(letterBytes, word9)
sort.Slice(letterBytes, func(i, j int) bool { return letterBytes[i] < letterBytes[j] })
distinctBytes := []byte{letterBytes[0]}
for _, b := range letterBytes[1:] {
if b != distinctBytes[len(distinctBytes)-1] {
distinctBytes = append(distinctBytes, b)
}
}
distinctLetters := string(distinctBytes)
for _, letter := range distinctLetters {
found := 0
letterByte := byte(letter)
for _, word := range words {
le := len(word)
if bytes.IndexByte(word, letterByte) >= 0 {
lets := string(letterBytes)
ok := true
for i := 0; i < le; i++ {
c := word[i]
ix := sort.Search(len(lets), func(i int) bool { return lets[i] >= c })
if ix < len(lets) && lets[ix] == c {
lets = lets[0:ix] + lets[ix+1:]
} else {
ok = false
break
}
}
if ok {
found = found + 1
}
}
}
if found > mostFound {
mostFound = found
mostWords9 = []string{string(word9)}
mostLetters = []byte{letterByte}
} else if found == mostFound {
mostWords9 = append(mostWords9, string(word9))
mostLetters = append(mostLetters, letterByte)
}
}
}
fmt.Println("\nMost words found =", mostFound)
fmt.Println("Nine letter words producing this total:")
for i := 0; i < len(mostWords9); i++ {
fmt.Println(mostWords9[i], "with central letter", string(mostLetters[i]))
}
}
|
Transform the following C++ implementation into Go, maintaining the same output and logic. | #include <vector>
#include <iostream>
int main()
{
std::vector<int> a(3), b(4);
a[0] = 11; a[1] = 12; a[2] = 13;
b[0] = 21; b[1] = 22; b[2] = 23; b[3] = 24;
a.insert(a.end(), b.begin(), b.end());
for (int i = 0; i < a.size(); ++i)
std::cout << "a[" << i << "] = " << a[i] << "\n";
}
| package main
import "fmt"
func main() {
a := []int{1, 2, 3}
b := []int{7, 12, 60}
c := append(a, b...)
fmt.Println(c)
i := []interface{}{1, 2, 3}
j := []interface{}{"Crosby", "Stills", "Nash", "Young"}
k := append(i, j...)
fmt.Println(k)
l := [...]int{1, 2, 3}
m := [...]int{7, 12, 60}
var n [len(l) + len(m)]int
copy(n[:], l[:])
copy(n[len(l):], m[:])
fmt.Println(n)
}
|
Port the provided C++ code into Go while preserving the original functionality. | #include <iostream>
#include <string>
using namespace std;
int main()
{
long int integer_input;
string string_input;
cout << "Enter an integer: ";
cin >> integer_input;
cout << "Enter a string: ";
cin >> string_input;
return 0;
}
| package main
import "fmt"
func main() {
var s string
var i int
if _, err := fmt.Scan(&s, &i); err == nil && i == 75000 {
fmt.Println("good")
} else {
fmt.Println("wrong")
}
}
|
Change the programming language of this snippet from C++ to Go without modifying what it does. | #include <iostream>
#include <string>
using namespace std;
int main()
{
long int integer_input;
string string_input;
cout << "Enter an integer: ";
cin >> integer_input;
cout << "Enter a string: ";
cin >> string_input;
return 0;
}
| package main
import "fmt"
func main() {
var s string
var i int
if _, err := fmt.Scan(&s, &i); err == nil && i == 75000 {
fmt.Println("good")
} else {
fmt.Println("wrong")
}
}
|
Change the following C++ code into Go without altering its purpose. | #include <iostream>
#include <windows.h>
#include <mmsystem.h>
#pragma comment ( lib, "winmm.lib" )
typedef unsigned char byte;
typedef union
{
unsigned long word;
unsigned char data[4];
}
midi_msg;
class midi
{
public:
midi()
{
if( midiOutOpen( &device, 0, 0, 0, CALLBACK_NULL) != MMSYSERR_NOERROR )
{
std::cout << "Error opening MIDI Output..." << std::endl;
device = 0;
}
}
~midi()
{
midiOutReset( device );
midiOutClose( device );
}
bool isOpen() { return device != 0; }
void setInstrument( byte i )
{
message.data[0] = 0xc0; message.data[1] = i;
message.data[2] = 0; message.data[3] = 0;
midiOutShortMsg( device, message.word );
}
void playNote( byte n, unsigned i )
{
playNote( n ); Sleep( i ); stopNote( n );
}
private:
void playNote( byte n )
{
message.data[0] = 0x90; message.data[1] = n;
message.data[2] = 127; message.data[3] = 0;
midiOutShortMsg( device, message.word );
}
void stopNote( byte n )
{
message.data[0] = 0x90; message.data[1] = n;
message.data[2] = 0; message.data[3] = 0;
midiOutShortMsg( device, message.word );
}
HMIDIOUT device;
midi_msg message;
};
int main( int argc, char* argv[] )
{
midi m;
if( m.isOpen() )
{
byte notes[] = { 60, 62, 64, 65, 67, 69, 71, 72 };
m.setInstrument( 42 );
for( int x = 0; x < 8; x++ )
m.playNote( notes[x], rand() % 100 + 158 );
Sleep( 1000 );
}
return 0;
}
| package main
import (
"encoding/binary"
"log"
"math"
"os"
"strings"
)
func main() {
const (
sampleRate = 44100
duration = 8
dataLength = sampleRate * duration
hdrSize = 44
fileLen = dataLength + hdrSize - 8
)
buf1 := make([]byte, 1)
buf2 := make([]byte, 2)
buf4 := make([]byte, 4)
var sb strings.Builder
sb.WriteString("RIFF")
binary.LittleEndian.PutUint32(buf4, fileLen)
sb.Write(buf4)
sb.WriteString("WAVE")
sb.WriteString("fmt ")
binary.LittleEndian.PutUint32(buf4, 16)
sb.Write(buf4)
binary.LittleEndian.PutUint16(buf2, 1)
sb.Write(buf2)
sb.Write(buf2)
binary.LittleEndian.PutUint32(buf4, sampleRate)
sb.Write(buf4)
sb.Write(buf4)
sb.Write(buf2)
binary.LittleEndian.PutUint16(buf2, 8)
sb.Write(buf2)
sb.WriteString("data")
binary.LittleEndian.PutUint32(buf4, dataLength)
sb.Write(buf4)
wavhdr := []byte(sb.String())
f, err := os.Create("notes.wav")
if err != nil {
log.Fatal(err)
}
defer f.Close()
f.Write(wavhdr)
freqs := [8]float64{261.6, 293.6, 329.6, 349.2, 392.0, 440.0, 493.9, 523.3}
for j := 0; j < duration; j++ {
freq := freqs[j]
omega := 2 * math.Pi * freq
for i := 0; i < dataLength/duration; i++ {
y := 32 * math.Sin(omega*float64(i)/float64(sampleRate))
buf1[0] = byte(math.Round(y))
f.Write(buf1)
}
}
}
|
Ensure the translated Go code behaves exactly like the original C++ snippet. | #include <iostream>
#include <windows.h>
#include <mmsystem.h>
#pragma comment ( lib, "winmm.lib" )
typedef unsigned char byte;
typedef union
{
unsigned long word;
unsigned char data[4];
}
midi_msg;
class midi
{
public:
midi()
{
if( midiOutOpen( &device, 0, 0, 0, CALLBACK_NULL) != MMSYSERR_NOERROR )
{
std::cout << "Error opening MIDI Output..." << std::endl;
device = 0;
}
}
~midi()
{
midiOutReset( device );
midiOutClose( device );
}
bool isOpen() { return device != 0; }
void setInstrument( byte i )
{
message.data[0] = 0xc0; message.data[1] = i;
message.data[2] = 0; message.data[3] = 0;
midiOutShortMsg( device, message.word );
}
void playNote( byte n, unsigned i )
{
playNote( n ); Sleep( i ); stopNote( n );
}
private:
void playNote( byte n )
{
message.data[0] = 0x90; message.data[1] = n;
message.data[2] = 127; message.data[3] = 0;
midiOutShortMsg( device, message.word );
}
void stopNote( byte n )
{
message.data[0] = 0x90; message.data[1] = n;
message.data[2] = 0; message.data[3] = 0;
midiOutShortMsg( device, message.word );
}
HMIDIOUT device;
midi_msg message;
};
int main( int argc, char* argv[] )
{
midi m;
if( m.isOpen() )
{
byte notes[] = { 60, 62, 64, 65, 67, 69, 71, 72 };
m.setInstrument( 42 );
for( int x = 0; x < 8; x++ )
m.playNote( notes[x], rand() % 100 + 158 );
Sleep( 1000 );
}
return 0;
}
| package main
import (
"encoding/binary"
"log"
"math"
"os"
"strings"
)
func main() {
const (
sampleRate = 44100
duration = 8
dataLength = sampleRate * duration
hdrSize = 44
fileLen = dataLength + hdrSize - 8
)
buf1 := make([]byte, 1)
buf2 := make([]byte, 2)
buf4 := make([]byte, 4)
var sb strings.Builder
sb.WriteString("RIFF")
binary.LittleEndian.PutUint32(buf4, fileLen)
sb.Write(buf4)
sb.WriteString("WAVE")
sb.WriteString("fmt ")
binary.LittleEndian.PutUint32(buf4, 16)
sb.Write(buf4)
binary.LittleEndian.PutUint16(buf2, 1)
sb.Write(buf2)
sb.Write(buf2)
binary.LittleEndian.PutUint32(buf4, sampleRate)
sb.Write(buf4)
sb.Write(buf4)
sb.Write(buf2)
binary.LittleEndian.PutUint16(buf2, 8)
sb.Write(buf2)
sb.WriteString("data")
binary.LittleEndian.PutUint32(buf4, dataLength)
sb.Write(buf4)
wavhdr := []byte(sb.String())
f, err := os.Create("notes.wav")
if err != nil {
log.Fatal(err)
}
defer f.Close()
f.Write(wavhdr)
freqs := [8]float64{261.6, 293.6, 329.6, 349.2, 392.0, 440.0, 493.9, 523.3}
for j := 0; j < duration; j++ {
freq := freqs[j]
omega := 2 * math.Pi * freq
for i := 0; i < dataLength/duration; i++ {
y := 32 * math.Sin(omega*float64(i)/float64(sampleRate))
buf1[0] = byte(math.Round(y))
f.Write(buf1)
}
}
}
|
Convert this C++ snippet to Go and keep its semantics consistent. | #include <vector>
#include <string>
#include <iostream>
#include <boost/tuple/tuple.hpp>
#include <set>
int findBestPack( const std::vector<boost::tuple<std::string , int , int> > & ,
std::set<int> & , const int ) ;
int main( ) {
std::vector<boost::tuple<std::string , int , int> > items ;
items.push_back( boost::make_tuple( "" , 0 , 0 ) ) ;
items.push_back( boost::make_tuple( "map" , 9 , 150 ) ) ;
items.push_back( boost::make_tuple( "compass" , 13 , 35 ) ) ;
items.push_back( boost::make_tuple( "water" , 153 , 200 ) ) ;
items.push_back( boost::make_tuple( "sandwich", 50 , 160 ) ) ;
items.push_back( boost::make_tuple( "glucose" , 15 , 60 ) ) ;
items.push_back( boost::make_tuple( "tin", 68 , 45 ) ) ;
items.push_back( boost::make_tuple( "banana", 27 , 60 ) ) ;
items.push_back( boost::make_tuple( "apple" , 39 , 40 ) ) ;
items.push_back( boost::make_tuple( "cheese" , 23 , 30 ) ) ;
items.push_back( boost::make_tuple( "beer" , 52 , 10 ) ) ;
items.push_back( boost::make_tuple( "suntan creme" , 11 , 70 ) ) ;
items.push_back( boost::make_tuple( "camera" , 32 , 30 ) ) ;
items.push_back( boost::make_tuple( "T-shirt" , 24 , 15 ) ) ;
items.push_back( boost::make_tuple( "trousers" , 48 , 10 ) ) ;
items.push_back( boost::make_tuple( "umbrella" , 73 , 40 ) ) ;
items.push_back( boost::make_tuple( "waterproof trousers" , 42 , 70 ) ) ;
items.push_back( boost::make_tuple( "waterproof overclothes" , 43 , 75 ) ) ;
items.push_back( boost::make_tuple( "note-case" , 22 , 80 ) ) ;
items.push_back( boost::make_tuple( "sunglasses" , 7 , 20 ) ) ;
items.push_back( boost::make_tuple( "towel" , 18 , 12 ) ) ;
items.push_back( boost::make_tuple( "socks" , 4 , 50 ) ) ;
items.push_back( boost::make_tuple( "book" , 30 , 10 ) ) ;
const int maximumWeight = 400 ;
std::set<int> bestItems ;
int bestValue = findBestPack( items , bestItems , maximumWeight ) ;
std::cout << "The best value that can be packed in the given knapsack is " <<
bestValue << " !\n" ;
int totalweight = 0 ;
std::cout << "The following items should be packed in the knapsack:\n" ;
for ( std::set<int>::const_iterator si = bestItems.begin( ) ;
si != bestItems.end( ) ; si++ ) {
std::cout << (items.begin( ) + *si)->get<0>( ) << "\n" ;
totalweight += (items.begin( ) + *si)->get<1>( ) ;
}
std::cout << "The total weight of all items is " << totalweight << " !\n" ;
return 0 ;
}
int findBestPack( const std::vector<boost::tuple<std::string , int , int> > & items ,std::set<int> & bestItems , const int weightlimit ) {
const int n = items.size( ) ;
int bestValues [ n ][ weightlimit ] ;
std::set<int> solutionSets[ n ][ weightlimit ] ;
std::set<int> emptyset ;
for ( int i = 0 ; i < n ; i++ ) {
for ( int j = 0 ; j < weightlimit ; j++ ) {
bestValues[ i ][ j ] = 0 ;
solutionSets[ i ][ j ] = emptyset ;
}
}
for ( int i = 0 ; i < n ; i++ ) {
for ( int weight = 0 ; weight < weightlimit ; weight++ ) {
if ( i == 0 )
bestValues[ i ][ weight ] = 0 ;
else {
int itemweight = (items.begin( ) + i)->get<1>( ) ;
if ( weight < itemweight ) {
bestValues[ i ][ weight ] = bestValues[ i - 1 ][ weight ] ;
solutionSets[ i ][ weight ] = solutionSets[ i - 1 ][ weight ] ;
} else {
if ( bestValues[ i - 1 ][ weight - itemweight ] +
(items.begin( ) + i)->get<2>( ) >
bestValues[ i - 1 ][ weight ] ) {
bestValues[ i ][ weight ] =
bestValues[ i - 1 ][ weight - itemweight ] +
(items.begin( ) + i)->get<2>( ) ;
solutionSets[ i ][ weight ] =
solutionSets[ i - 1 ][ weight - itemweight ] ;
solutionSets[ i ][ weight ].insert( i ) ;
}
else {
bestValues[ i ][ weight ] = bestValues[ i - 1 ][ weight ] ;
solutionSets[ i ][ weight ] = solutionSets[ i - 1 ][ weight ] ;
}
}
}
}
}
bestItems.swap( solutionSets[ n - 1][ weightlimit - 1 ] ) ;
return bestValues[ n - 1 ][ weightlimit - 1 ] ;
}
| package main
import "fmt"
type item struct {
string
w, v int
}
var wants = []item{
{"map", 9, 150},
{"compass", 13, 35},
{"water", 153, 200},
{"sandwich", 50, 160},
{"glucose", 15, 60},
{"tin", 68, 45},
{"banana", 27, 60},
{"apple", 39, 40},
{"cheese", 23, 30},
{"beer", 52, 10},
{"suntan cream", 11, 70},
{"camera", 32, 30},
{"T-shirt", 24, 15},
{"trousers", 48, 10},
{"umbrella", 73, 40},
{"waterproof trousers", 42, 70},
{"waterproof overclothes", 43, 75},
{"note-case", 22, 80},
{"sunglasses", 7, 20},
{"towel", 18, 12},
{"socks", 4, 50},
{"book", 30, 10},
}
const maxWt = 400
func main() {
items, w, v := m(len(wants)-1, maxWt)
fmt.Println(items)
fmt.Println("weight:", w)
fmt.Println("value:", v)
}
func m(i, w int) ([]string, int, int) {
if i < 0 || w == 0 {
return nil, 0, 0
} else if wants[i].w > w {
return m(i-1, w)
}
i0, w0, v0 := m(i-1, w)
i1, w1, v1 := m(i-1, w-wants[i].w)
v1 += wants[i].v
if v1 > v0 {
return append(i1, wants[i].string), w1 + wants[i].w, v1
}
return i0, w0, v0
}
|
Rewrite this program in Go while keeping its functionality equivalent to the C++ version. | #include <algorithm>
#include <iostream>
#include <vector>
typedef unsigned long long integer;
std::vector<integer> get_ancestors(const std::vector<integer>& ancestor, integer n) {
std::vector<integer> result;
for (integer a = ancestor[n]; a != 0 && a != n; ) {
n = a;
a = ancestor[n];
result.push_back(n);
}
return result;
}
void print_vector(const std::vector<integer>& vec) {
if (vec.empty()) {
std::cout << "none\n";
return;
}
auto i = vec.begin();
std::cout << *i++;
for (; i != vec.end(); ++i)
std::cout << ", " << *i;
std::cout << '\n';
}
bool is_prime(integer n) {
if (n < 2)
return false;
if (n % 2 == 0)
return n == 2;
for (integer p = 3; p * p <= n; p += 2) {
if (n % p == 0)
return false;
}
return true;
}
int main(int argc, char** argv) {
const size_t limit = 100;
std::vector<integer> ancestor(limit, 0);
std::vector<std::vector<integer>> descendants(limit);
for (size_t prime = 0; prime < limit; ++prime) {
if (!is_prime(prime))
continue;
descendants[prime].push_back(prime);
for (size_t i = 0; i + prime < limit; ++i) {
integer s = i + prime;
for (integer n : descendants[i]) {
integer prod = n * prime;
descendants[s].push_back(prod);
if (prod < limit)
ancestor[prod] = s;
}
}
}
size_t total_descendants = 0;
for (integer i = 1; i < limit; ++i) {
std::vector<integer> ancestors(get_ancestors(ancestor, i));
std::cout << "[" << i << "] Level: " << ancestors.size() << '\n';
std::cout << "Ancestors: ";
std::sort(ancestors.begin(), ancestors.end());
print_vector(ancestors);
std::cout << "Descendants: ";
std::vector<integer>& desc = descendants[i];
if (!desc.empty()) {
std::sort(desc.begin(), desc.end());
if (desc[0] == i)
desc.erase(desc.begin());
}
std::cout << desc.size() << '\n';
total_descendants += desc.size();
if (!desc.empty())
print_vector(desc);
std::cout << '\n';
}
std::cout << "Total descendants: " << total_descendants << '\n';
return 0;
}
| package main
import (
"fmt"
"sort"
)
func getPrimes(max int) []int {
if max < 2 {
return []int{}
}
lprimes := []int{2}
outer:
for x := 3; x <= max; x += 2 {
for _, p := range lprimes {
if x%p == 0 {
continue outer
}
}
lprimes = append(lprimes, x)
}
return lprimes
}
func main() {
const maxSum = 99
descendants := make([][]int64, maxSum+1)
ancestors := make([][]int, maxSum+1)
for i := 0; i <= maxSum; i++ {
descendants[i] = []int64{}
ancestors[i] = []int{}
}
primes := getPrimes(maxSum)
for _, p := range primes {
descendants[p] = append(descendants[p], int64(p))
for s := 1; s < len(descendants)-p; s++ {
temp := make([]int64, len(descendants[s]))
for i := 0; i < len(descendants[s]); i++ {
temp[i] = int64(p) * descendants[s][i]
}
descendants[s+p] = append(descendants[s+p], temp...)
}
}
for _, p := range append(primes, 4) {
le := len(descendants[p])
if le == 0 {
continue
}
descendants[p][le-1] = 0
descendants[p] = descendants[p][:le-1]
}
total := 0
for s := 1; s <= maxSum; s++ {
x := descendants[s]
sort.Slice(x, func(i, j int) bool {
return x[i] < x[j]
})
total += len(descendants[s])
index := 0
for ; index < len(descendants[s]); index++ {
if descendants[s][index] > int64(maxSum) {
break
}
}
for _, d := range descendants[s][:index] {
ancestors[d] = append(ancestors[s], s)
}
if (s >= 21 && s <= 45) || (s >= 47 && s <= 73) || (s >= 75 && s < maxSum) {
continue
}
temp := fmt.Sprintf("%v", ancestors[s])
fmt.Printf("%2d: %d Ancestor(s): %-14s", s, len(ancestors[s]), temp)
le := len(descendants[s])
if le <= 10 {
fmt.Printf("%5d Descendant(s): %v\n", le, descendants[s])
} else {
fmt.Printf("%5d Descendant(s): %v\b ...]\n", le, descendants[s][:10])
}
}
fmt.Println("\nTotal descendants", total)
}
|
Preserve the algorithm and functionality while converting the code from C++ to Go. | #include <iostream>
#include <vector>
#include <algorithm>
void print(const std::vector<std::vector<int>>& v) {
std::cout << "{ ";
for (const auto& p : v) {
std::cout << "(";
for (const auto& e : p) {
std::cout << e << " ";
}
std::cout << ") ";
}
std::cout << "}" << std::endl;
}
auto product(const std::vector<std::vector<int>>& lists) {
std::vector<std::vector<int>> result;
if (std::find_if(std::begin(lists), std::end(lists),
[](auto e) -> bool { return e.size() == 0; }) != std::end(lists)) {
return result;
}
for (auto& e : lists[0]) {
result.push_back({ e });
}
for (size_t i = 1; i < lists.size(); ++i) {
std::vector<std::vector<int>> temp;
for (auto& e : result) {
for (auto f : lists[i]) {
auto e_tmp = e;
e_tmp.push_back(f);
temp.push_back(e_tmp);
}
}
result = temp;
}
return result;
}
int main() {
std::vector<std::vector<int>> prods[] = {
{ { 1, 2 }, { 3, 4 } },
{ { 3, 4 }, { 1, 2} },
{ { 1, 2 }, { } },
{ { }, { 1, 2 } },
{ { 1776, 1789 }, { 7, 12 }, { 4, 14, 23 }, { 0, 1 } },
{ { 1, 2, 3 }, { 30 }, { 500, 100 } },
{ { 1, 2, 3 }, { }, { 500, 100 } }
};
for (const auto& p : prods) {
print(product(p));
}
std::cin.ignore();
std::cin.get();
return 0;
}
| package main
import "fmt"
type pair [2]int
func cart2(a, b []int) []pair {
p := make([]pair, len(a)*len(b))
i := 0
for _, a := range a {
for _, b := range b {
p[i] = pair{a, b}
i++
}
}
return p
}
func main() {
fmt.Println(cart2([]int{1, 2}, []int{3, 4}))
fmt.Println(cart2([]int{3, 4}, []int{1, 2}))
fmt.Println(cart2([]int{1, 2}, nil))
fmt.Println(cart2(nil, []int{1, 2}))
}
|
Write a version of this C++ function in Go with identical behavior. | #include <iostream>
#include <vector>
#include <algorithm>
void print(const std::vector<std::vector<int>>& v) {
std::cout << "{ ";
for (const auto& p : v) {
std::cout << "(";
for (const auto& e : p) {
std::cout << e << " ";
}
std::cout << ") ";
}
std::cout << "}" << std::endl;
}
auto product(const std::vector<std::vector<int>>& lists) {
std::vector<std::vector<int>> result;
if (std::find_if(std::begin(lists), std::end(lists),
[](auto e) -> bool { return e.size() == 0; }) != std::end(lists)) {
return result;
}
for (auto& e : lists[0]) {
result.push_back({ e });
}
for (size_t i = 1; i < lists.size(); ++i) {
std::vector<std::vector<int>> temp;
for (auto& e : result) {
for (auto f : lists[i]) {
auto e_tmp = e;
e_tmp.push_back(f);
temp.push_back(e_tmp);
}
}
result = temp;
}
return result;
}
int main() {
std::vector<std::vector<int>> prods[] = {
{ { 1, 2 }, { 3, 4 } },
{ { 3, 4 }, { 1, 2} },
{ { 1, 2 }, { } },
{ { }, { 1, 2 } },
{ { 1776, 1789 }, { 7, 12 }, { 4, 14, 23 }, { 0, 1 } },
{ { 1, 2, 3 }, { 30 }, { 500, 100 } },
{ { 1, 2, 3 }, { }, { 500, 100 } }
};
for (const auto& p : prods) {
print(product(p));
}
std::cin.ignore();
std::cin.get();
return 0;
}
| package main
import "fmt"
type pair [2]int
func cart2(a, b []int) []pair {
p := make([]pair, len(a)*len(b))
i := 0
for _, a := range a {
for _, b := range b {
p[i] = pair{a, b}
i++
}
}
return p
}
func main() {
fmt.Println(cart2([]int{1, 2}, []int{3, 4}))
fmt.Println(cart2([]int{3, 4}, []int{1, 2}))
fmt.Println(cart2([]int{1, 2}, nil))
fmt.Println(cart2(nil, []int{1, 2}))
}
|
Translate this program into Go but keep the logic exactly as in C++. | #include <functional>
#include <algorithm>
#include <iostream>
#include <vector>
#include <cmath>
using std::cout;
using std::endl;
using std::vector;
using std::function;
using std::transform;
using std::back_inserter;
typedef function<double(double)> FunType;
vector<FunType> A = {sin, cos, tan, [](double x) { return x*x*x; } };
vector<FunType> B = {asin, acos, atan, [](double x) { return exp(log(x)/3); } };
template <typename A, typename B, typename C>
function<C(A)> compose(function<C(B)> f, function<B(A)> g) {
return [f,g](A x) { return f(g(x)); };
}
int main() {
vector<FunType> composedFuns;
auto exNums = {0.0, 0.2, 0.4, 0.6, 0.8, 1.0};
transform(B.begin(), B.end(),
A.begin(),
back_inserter(composedFuns),
compose<double, double, double>);
for (auto num: exNums)
for (auto fun: composedFuns)
cout << u8"f\u207B\u00B9.f(" << num << ") = " << fun(num) << endl;
return 0;
}
| package main
import "math"
import "fmt"
func cube(x float64) float64 { return math.Pow(x, 3) }
type ffType func(float64) float64
func compose(f, g ffType) ffType {
return func(x float64) float64 {
return f(g(x))
}
}
func main() {
funclist := []ffType{math.Sin, math.Cos, cube}
funclisti := []ffType{math.Asin, math.Acos, math.Cbrt}
for i := 0; i < 3; i++ {
fmt.Println(compose(funclisti[i], funclist[i])(.5))
}
}
|
Change the following C++ code into Go without altering its purpose. | #include <functional>
#include <algorithm>
#include <iostream>
#include <vector>
#include <cmath>
using std::cout;
using std::endl;
using std::vector;
using std::function;
using std::transform;
using std::back_inserter;
typedef function<double(double)> FunType;
vector<FunType> A = {sin, cos, tan, [](double x) { return x*x*x; } };
vector<FunType> B = {asin, acos, atan, [](double x) { return exp(log(x)/3); } };
template <typename A, typename B, typename C>
function<C(A)> compose(function<C(B)> f, function<B(A)> g) {
return [f,g](A x) { return f(g(x)); };
}
int main() {
vector<FunType> composedFuns;
auto exNums = {0.0, 0.2, 0.4, 0.6, 0.8, 1.0};
transform(B.begin(), B.end(),
A.begin(),
back_inserter(composedFuns),
compose<double, double, double>);
for (auto num: exNums)
for (auto fun: composedFuns)
cout << u8"f\u207B\u00B9.f(" << num << ") = " << fun(num) << endl;
return 0;
}
| package main
import "math"
import "fmt"
func cube(x float64) float64 { return math.Pow(x, 3) }
type ffType func(float64) float64
func compose(f, g ffType) ffType {
return func(x float64) float64 {
return f(g(x))
}
}
func main() {
funclist := []ffType{math.Sin, math.Cos, cube}
funclisti := []ffType{math.Asin, math.Acos, math.Cbrt}
for i := 0; i < 3; i++ {
fmt.Println(compose(funclisti[i], funclist[i])(.5))
}
}
|
Generate an equivalent Go version of this C++ code. | #include <vector>
#include <iostream>
#include <algorithm>
std::vector<int> properDivisors ( int number ) {
std::vector<int> divisors ;
for ( int i = 1 ; i < number / 2 + 1 ; i++ )
if ( number % i == 0 )
divisors.push_back( i ) ;
return divisors ;
}
int main( ) {
std::vector<int> divisors ;
unsigned int maxdivisors = 0 ;
int corresponding_number = 0 ;
for ( int i = 1 ; i < 11 ; i++ ) {
divisors = properDivisors ( i ) ;
std::cout << "Proper divisors of " << i << ":\n" ;
for ( int number : divisors ) {
std::cout << number << " " ;
}
std::cout << std::endl ;
divisors.clear( ) ;
}
for ( int i = 11 ; i < 20001 ; i++ ) {
divisors = properDivisors ( i ) ;
if ( divisors.size( ) > maxdivisors ) {
maxdivisors = divisors.size( ) ;
corresponding_number = i ;
}
divisors.clear( ) ;
}
std::cout << "Most divisors has " << corresponding_number <<
" , it has " << maxdivisors << " divisors!\n" ;
return 0 ;
}
| package main
import (
"fmt"
"strconv"
)
func listProperDivisors(limit int) {
if limit < 1 {
return
}
width := len(strconv.Itoa(limit))
for i := 1; i <= limit; i++ {
fmt.Printf("%*d -> ", width, i)
if i == 1 {
fmt.Println("(None)")
continue
}
for j := 1; j <= i/2; j++ {
if i%j == 0 {
fmt.Printf(" %d", j)
}
}
fmt.Println()
}
}
func countProperDivisors(n int) int {
if n < 2 {
return 0
}
count := 0
for i := 1; i <= n/2; i++ {
if n%i == 0 {
count++
}
}
return count
}
func main() {
fmt.Println("The proper divisors of the following numbers are :\n")
listProperDivisors(10)
fmt.Println()
maxCount := 0
most := []int{1}
for n := 2; n <= 20000; n++ {
count := countProperDivisors(n)
if count == maxCount {
most = append(most, n)
} else if count > maxCount {
maxCount = count
most = most[0:1]
most[0] = n
}
}
fmt.Print("The following number(s) <= 20000 have the most proper divisors, ")
fmt.Println("namely", maxCount, "\b\n")
for _, n := range most {
fmt.Println(n)
}
}
|
Can you help me rewrite this code in Go instead of C++, keeping it the same logically? | #include <vector>
#include <utility>
#include <iostream>
#include <boost/algorithm/string.hpp>
std::string create_xml( std::vector<std::string> & ,std::vector<std::string> & ) ;
int main( ) {
std::vector<std::string> names , remarks ;
names.push_back( "April" ) ;
names.push_back( "Tam O'Shantor" ) ;
names.push_back ( "Emily" ) ;
remarks.push_back( "Bubbly, I'm > Tam and <= Emily" ) ;
remarks.push_back( "Burns: \"When chapman billies leave the street ...\"" ) ;
remarks.push_back( "Short & shrift" ) ;
std::cout << "This is in XML:\n" ;
std::cout << create_xml( names , remarks ) << std::endl ;
return 0 ;
}
std::string create_xml( std::vector<std::string> & names ,
std::vector<std::string> & remarks ) {
std::vector<std::pair<std::string , std::string> > entities ;
entities.push_back( std::make_pair( "&" , "&" ) ) ;
entities.push_back( std::make_pair( "<" , "<" ) ) ;
entities.push_back( std::make_pair( ">" , ">" ) ) ;
std::string xmlstring ( "<CharacterRemarks>\n" ) ;
std::vector<std::string>::iterator vsi = names.begin( ) ;
typedef std::vector<std::pair<std::string , std::string> >::iterator Vpss ;
for ( ; vsi != names.end( ) ; vsi++ ) {
for ( Vpss vs = entities.begin( ) ; vs != entities.end( ) ; vs++ ) {
boost::replace_all ( *vsi , vs->first , vs->second ) ;
}
}
for ( vsi = remarks.begin( ) ; vsi != remarks.end( ) ; vsi++ ) {
for ( Vpss vs = entities.begin( ) ; vs != entities.end( ) ; vs++ ) {
boost::replace_all ( *vsi , vs->first , vs->second ) ;
}
}
for ( int i = 0 ; i < names.size( ) ; i++ ) {
xmlstring.append( "\t<Character name=\"").append( names[ i ] ).append( "\">")
.append( remarks[ i ] ).append( "</Character>\n" ) ;
}
xmlstring.append( "</CharacterRemarks>" ) ;
return xmlstring ;
}
| package main
import (
"encoding/xml"
"fmt"
)
func xRemarks(r CharacterRemarks) (string, error) {
b, err := xml.MarshalIndent(r, "", " ")
return string(b), err
}
type CharacterRemarks struct {
Character []crm
}
type crm struct {
Name string `xml:"name,attr"`
Remark string `xml:",chardata"`
}
func main() {
x, err := xRemarks(CharacterRemarks{[]crm{
{`April`, `Bubbly: I'm > Tam and <= Emily`},
{`Tam O'Shanter`, `Burns: "When chapman billies leave the street ..."`},
{`Emily`, `Short & shrift`},
}})
if err != nil {
x = err.Error()
}
fmt.Println(x)
}
|
Translate the given C++ code snippet into Go without altering its behavior. | #include <vector>
#include <utility>
#include <iostream>
#include <boost/algorithm/string.hpp>
std::string create_xml( std::vector<std::string> & ,std::vector<std::string> & ) ;
int main( ) {
std::vector<std::string> names , remarks ;
names.push_back( "April" ) ;
names.push_back( "Tam O'Shantor" ) ;
names.push_back ( "Emily" ) ;
remarks.push_back( "Bubbly, I'm > Tam and <= Emily" ) ;
remarks.push_back( "Burns: \"When chapman billies leave the street ...\"" ) ;
remarks.push_back( "Short & shrift" ) ;
std::cout << "This is in XML:\n" ;
std::cout << create_xml( names , remarks ) << std::endl ;
return 0 ;
}
std::string create_xml( std::vector<std::string> & names ,
std::vector<std::string> & remarks ) {
std::vector<std::pair<std::string , std::string> > entities ;
entities.push_back( std::make_pair( "&" , "&" ) ) ;
entities.push_back( std::make_pair( "<" , "<" ) ) ;
entities.push_back( std::make_pair( ">" , ">" ) ) ;
std::string xmlstring ( "<CharacterRemarks>\n" ) ;
std::vector<std::string>::iterator vsi = names.begin( ) ;
typedef std::vector<std::pair<std::string , std::string> >::iterator Vpss ;
for ( ; vsi != names.end( ) ; vsi++ ) {
for ( Vpss vs = entities.begin( ) ; vs != entities.end( ) ; vs++ ) {
boost::replace_all ( *vsi , vs->first , vs->second ) ;
}
}
for ( vsi = remarks.begin( ) ; vsi != remarks.end( ) ; vsi++ ) {
for ( Vpss vs = entities.begin( ) ; vs != entities.end( ) ; vs++ ) {
boost::replace_all ( *vsi , vs->first , vs->second ) ;
}
}
for ( int i = 0 ; i < names.size( ) ; i++ ) {
xmlstring.append( "\t<Character name=\"").append( names[ i ] ).append( "\">")
.append( remarks[ i ] ).append( "</Character>\n" ) ;
}
xmlstring.append( "</CharacterRemarks>" ) ;
return xmlstring ;
}
| package main
import (
"encoding/xml"
"fmt"
)
func xRemarks(r CharacterRemarks) (string, error) {
b, err := xml.MarshalIndent(r, "", " ")
return string(b), err
}
type CharacterRemarks struct {
Character []crm
}
type crm struct {
Name string `xml:"name,attr"`
Remark string `xml:",chardata"`
}
func main() {
x, err := xRemarks(CharacterRemarks{[]crm{
{`April`, `Bubbly: I'm > Tam and <= Emily`},
{`Tam O'Shanter`, `Burns: "When chapman billies leave the street ..."`},
{`Emily`, `Short & shrift`},
}})
if err != nil {
x = err.Error()
}
fmt.Println(x)
}
|
Port the provided C++ code into Go while preserving the original functionality. | #include <windows.h>
#include <string>
#include <vector>
using namespace std;
const int HSTEP = 46, MWID = 40, MHEI = 471;
const float VSTEP = 2.3f;
class vector2
{
public:
vector2() { x = y = 0; }
vector2( float a, float b ) { x = a; y = b; }
void set( float a, float b ) { x = a; y = b; }
float x, y;
};
class myBitmap
{
public:
myBitmap() : pen( NULL ), brush( NULL ), clr( 0 ), wid( 1 ) {}
~myBitmap()
{
DeleteObject( pen );
DeleteObject( brush );
DeleteDC( hdc );
DeleteObject( bmp );
}
bool create( int w, int h )
{
BITMAPINFO bi;
ZeroMemory( &bi, sizeof( bi ) );
bi.bmiHeader.biSize = sizeof( bi.bmiHeader );
bi.bmiHeader.biBitCount = sizeof( DWORD ) * 8;
bi.bmiHeader.biCompression = BI_RGB;
bi.bmiHeader.biPlanes = 1;
bi.bmiHeader.biWidth = w;
bi.bmiHeader.biHeight = -h;
HDC dc = GetDC( GetConsoleWindow() );
bmp = CreateDIBSection( dc, &bi, DIB_RGB_COLORS, &pBits, NULL, 0 );
if( !bmp ) return false;
hdc = CreateCompatibleDC( dc );
SelectObject( hdc, bmp );
ReleaseDC( GetConsoleWindow(), dc );
width = w; height = h;
return true;
}
void clear( BYTE clr = 0 )
{
memset( pBits, clr, width * height * sizeof( DWORD ) );
}
void setBrushColor( DWORD bClr )
{
if( brush ) DeleteObject( brush );
brush = CreateSolidBrush( bClr );
SelectObject( hdc, brush );
}
void setPenColor( DWORD c ) { clr = c; createPen(); }
void setPenWidth( int w ) { wid = w; createPen(); }
void saveBitmap( string path )
{
BITMAPFILEHEADER fileheader;
BITMAPINFO infoheader;
BITMAP bitmap;
DWORD wb;
GetObject( bmp, sizeof( bitmap ), &bitmap );
DWORD* dwpBits = new DWORD[bitmap.bmWidth * bitmap.bmHeight];
ZeroMemory( dwpBits, bitmap.bmWidth * bitmap.bmHeight * sizeof( DWORD ) );
ZeroMemory( &infoheader, sizeof( BITMAPINFO ) );
ZeroMemory( &fileheader, sizeof( BITMAPFILEHEADER ) );
infoheader.bmiHeader.biBitCount = sizeof( DWORD ) * 8;
infoheader.bmiHeader.biCompression = BI_RGB;
infoheader.bmiHeader.biPlanes = 1;
infoheader.bmiHeader.biSize = sizeof( infoheader.bmiHeader );
infoheader.bmiHeader.biHeight = bitmap.bmHeight;
infoheader.bmiHeader.biWidth = bitmap.bmWidth;
infoheader.bmiHeader.biSizeImage = bitmap.bmWidth * bitmap.bmHeight * sizeof( DWORD );
fileheader.bfType = 0x4D42;
fileheader.bfOffBits = sizeof( infoheader.bmiHeader ) + sizeof( BITMAPFILEHEADER );
fileheader.bfSize = fileheader.bfOffBits + infoheader.bmiHeader.biSizeImage;
GetDIBits( hdc, bmp, 0, height, ( LPVOID )dwpBits, &infoheader, DIB_RGB_COLORS );
HANDLE file = CreateFile( path.c_str(), GENERIC_WRITE, 0, NULL, CREATE_ALWAYS, FILE_ATTRIBUTE_NORMAL, NULL );
WriteFile( file, &fileheader, sizeof( BITMAPFILEHEADER ), &wb, NULL );
WriteFile( file, &infoheader.bmiHeader, sizeof( infoheader.bmiHeader ), &wb, NULL );
WriteFile( file, dwpBits, bitmap.bmWidth * bitmap.bmHeight * 4, &wb, NULL );
CloseHandle( file );
delete [] dwpBits;
}
HDC getDC() const { return hdc; }
int getWidth() const { return width; }
int getHeight() const { return height; }
private:
void createPen()
{
if( pen ) DeleteObject( pen );
pen = CreatePen( PS_SOLID, wid, clr );
SelectObject( hdc, pen );
}
HBITMAP bmp;
HDC hdc;
HPEN pen;
HBRUSH brush;
void *pBits;
int width, height, wid;
DWORD clr;
};
class plot
{
public:
plot() { bmp.create( 512, 512 ); }
void draw( vector<vector2>* pairs )
{
bmp.clear( 0xff );
drawGraph( pairs );
plotIt( pairs );
HDC dc = GetDC( GetConsoleWindow() );
BitBlt( dc, 0, 30, 512, 512, bmp.getDC(), 0, 0, SRCCOPY );
ReleaseDC( GetConsoleWindow(), dc );
}
private:
void drawGraph( vector<vector2>* pairs )
{
HDC dc = bmp.getDC();
bmp.setPenColor( RGB( 240, 240, 240 ) );
DWORD b = 11, c = 40, x;
RECT rc; char txt[8];
for( x = 0; x < pairs->size(); x++ )
{
MoveToEx( dc, 40, b, NULL ); LineTo( dc, 500, b );
MoveToEx( dc, c, 11, NULL ); LineTo( dc, c, 471 );
wsprintf( txt, "%d", ( pairs->size() - x ) * 20 );
SetRect( &rc, 0, b - 9, 36, b + 11 );
DrawText( dc, txt, lstrlen( txt ), &rc, DT_RIGHT | DT_VCENTER | DT_SINGLELINE );
wsprintf( txt, "%d", x );
SetRect( &rc, c - 8, 472, c + 8, 492 );
DrawText( dc, txt, lstrlen( txt ), &rc, DT_CENTER | DT_VCENTER | DT_SINGLELINE );
c += 46; b += 46;
}
SetRect( &rc, 0, b - 9, 36, b + 11 );
DrawText( dc, "0", 1, &rc, DT_RIGHT | DT_VCENTER | DT_SINGLELINE );
bmp.setPenColor( 0 ); bmp.setPenWidth( 3 );
MoveToEx( dc, 40, 11, NULL ); LineTo( dc, 40, 471 );
MoveToEx( dc, 40, 471, NULL ); LineTo( dc, 500, 471 );
}
void plotIt( vector<vector2>* pairs )
{
HDC dc = bmp.getDC();
HBRUSH br = CreateSolidBrush( 255 );
RECT rc;
bmp.setPenColor( 255 ); bmp.setPenWidth( 2 );
vector<vector2>::iterator it = pairs->begin();
int a = MWID + HSTEP * static_cast<int>( ( *it ).x ), b = MHEI - static_cast<int>( VSTEP * ( *it ).y );
MoveToEx( dc, a, b, NULL );
SetRect( &rc, a - 3, b - 3, a + 3, b + 3 ); FillRect( dc, &rc, br );
it++;
for( ; it < pairs->end(); it++ )
{
a = MWID + HSTEP * static_cast<int>( ( *it ).x );
b = MHEI - static_cast<int>( VSTEP * ( *it ).y );
SetRect( &rc, a - 3, b - 3, a + 3, b + 3 );
FillRect( dc, &rc, br ); LineTo( dc, a, b );
}
DeleteObject( br );
}
myBitmap bmp;
};
int main( int argc, char* argv[] )
{
ShowWindow( GetConsoleWindow(), SW_MAXIMIZE );
plot pt;
vector<vector2> pairs;
pairs.push_back( vector2( 0, 2.7f ) ); pairs.push_back( vector2( 1, 2.8f ) );
pairs.push_back( vector2( 2.0f, 31.4f ) ); pairs.push_back( vector2( 3.0f, 38.1f ) );
pairs.push_back( vector2( 4.0f, 58.0f ) ); pairs.push_back( vector2( 5.0f, 76.2f ) );
pairs.push_back( vector2( 6.0f, 100.5f ) ); pairs.push_back( vector2( 7.0f, 130.0f ) );
pairs.push_back( vector2( 8.0f, 149.3f ) ); pairs.push_back( vector2( 9.0f, 180.0f ) );
pt.draw( &pairs );
system( "pause" );
return 0;
}
| package main
import (
"fmt"
"log"
"os/exec"
)
var (
x = []int{0, 1, 2, 3, 4, 5, 6, 7, 8, 9}
y = []float64{2.7, 2.8, 31.4, 38.1, 58.0, 76.2, 100.5, 130.0, 149.3, 180.0}
)
func main() {
g := exec.Command("gnuplot", "-persist")
w, err := g.StdinPipe()
if err != nil {
log.Fatal(err)
}
if err = g.Start(); err != nil {
log.Fatal(err)
}
fmt.Fprintln(w, "unset key; plot '-'")
for i, xi := range x {
fmt.Fprintf(w, "%d %f\n", xi, y[i])
}
fmt.Fprintln(w, "e")
w.Close()
g.Wait()
}
|
Can you help me rewrite this code in Go instead of C++, keeping it the same logically? | #include <windows.h>
#include <string>
#include <vector>
using namespace std;
const int HSTEP = 46, MWID = 40, MHEI = 471;
const float VSTEP = 2.3f;
class vector2
{
public:
vector2() { x = y = 0; }
vector2( float a, float b ) { x = a; y = b; }
void set( float a, float b ) { x = a; y = b; }
float x, y;
};
class myBitmap
{
public:
myBitmap() : pen( NULL ), brush( NULL ), clr( 0 ), wid( 1 ) {}
~myBitmap()
{
DeleteObject( pen );
DeleteObject( brush );
DeleteDC( hdc );
DeleteObject( bmp );
}
bool create( int w, int h )
{
BITMAPINFO bi;
ZeroMemory( &bi, sizeof( bi ) );
bi.bmiHeader.biSize = sizeof( bi.bmiHeader );
bi.bmiHeader.biBitCount = sizeof( DWORD ) * 8;
bi.bmiHeader.biCompression = BI_RGB;
bi.bmiHeader.biPlanes = 1;
bi.bmiHeader.biWidth = w;
bi.bmiHeader.biHeight = -h;
HDC dc = GetDC( GetConsoleWindow() );
bmp = CreateDIBSection( dc, &bi, DIB_RGB_COLORS, &pBits, NULL, 0 );
if( !bmp ) return false;
hdc = CreateCompatibleDC( dc );
SelectObject( hdc, bmp );
ReleaseDC( GetConsoleWindow(), dc );
width = w; height = h;
return true;
}
void clear( BYTE clr = 0 )
{
memset( pBits, clr, width * height * sizeof( DWORD ) );
}
void setBrushColor( DWORD bClr )
{
if( brush ) DeleteObject( brush );
brush = CreateSolidBrush( bClr );
SelectObject( hdc, brush );
}
void setPenColor( DWORD c ) { clr = c; createPen(); }
void setPenWidth( int w ) { wid = w; createPen(); }
void saveBitmap( string path )
{
BITMAPFILEHEADER fileheader;
BITMAPINFO infoheader;
BITMAP bitmap;
DWORD wb;
GetObject( bmp, sizeof( bitmap ), &bitmap );
DWORD* dwpBits = new DWORD[bitmap.bmWidth * bitmap.bmHeight];
ZeroMemory( dwpBits, bitmap.bmWidth * bitmap.bmHeight * sizeof( DWORD ) );
ZeroMemory( &infoheader, sizeof( BITMAPINFO ) );
ZeroMemory( &fileheader, sizeof( BITMAPFILEHEADER ) );
infoheader.bmiHeader.biBitCount = sizeof( DWORD ) * 8;
infoheader.bmiHeader.biCompression = BI_RGB;
infoheader.bmiHeader.biPlanes = 1;
infoheader.bmiHeader.biSize = sizeof( infoheader.bmiHeader );
infoheader.bmiHeader.biHeight = bitmap.bmHeight;
infoheader.bmiHeader.biWidth = bitmap.bmWidth;
infoheader.bmiHeader.biSizeImage = bitmap.bmWidth * bitmap.bmHeight * sizeof( DWORD );
fileheader.bfType = 0x4D42;
fileheader.bfOffBits = sizeof( infoheader.bmiHeader ) + sizeof( BITMAPFILEHEADER );
fileheader.bfSize = fileheader.bfOffBits + infoheader.bmiHeader.biSizeImage;
GetDIBits( hdc, bmp, 0, height, ( LPVOID )dwpBits, &infoheader, DIB_RGB_COLORS );
HANDLE file = CreateFile( path.c_str(), GENERIC_WRITE, 0, NULL, CREATE_ALWAYS, FILE_ATTRIBUTE_NORMAL, NULL );
WriteFile( file, &fileheader, sizeof( BITMAPFILEHEADER ), &wb, NULL );
WriteFile( file, &infoheader.bmiHeader, sizeof( infoheader.bmiHeader ), &wb, NULL );
WriteFile( file, dwpBits, bitmap.bmWidth * bitmap.bmHeight * 4, &wb, NULL );
CloseHandle( file );
delete [] dwpBits;
}
HDC getDC() const { return hdc; }
int getWidth() const { return width; }
int getHeight() const { return height; }
private:
void createPen()
{
if( pen ) DeleteObject( pen );
pen = CreatePen( PS_SOLID, wid, clr );
SelectObject( hdc, pen );
}
HBITMAP bmp;
HDC hdc;
HPEN pen;
HBRUSH brush;
void *pBits;
int width, height, wid;
DWORD clr;
};
class plot
{
public:
plot() { bmp.create( 512, 512 ); }
void draw( vector<vector2>* pairs )
{
bmp.clear( 0xff );
drawGraph( pairs );
plotIt( pairs );
HDC dc = GetDC( GetConsoleWindow() );
BitBlt( dc, 0, 30, 512, 512, bmp.getDC(), 0, 0, SRCCOPY );
ReleaseDC( GetConsoleWindow(), dc );
}
private:
void drawGraph( vector<vector2>* pairs )
{
HDC dc = bmp.getDC();
bmp.setPenColor( RGB( 240, 240, 240 ) );
DWORD b = 11, c = 40, x;
RECT rc; char txt[8];
for( x = 0; x < pairs->size(); x++ )
{
MoveToEx( dc, 40, b, NULL ); LineTo( dc, 500, b );
MoveToEx( dc, c, 11, NULL ); LineTo( dc, c, 471 );
wsprintf( txt, "%d", ( pairs->size() - x ) * 20 );
SetRect( &rc, 0, b - 9, 36, b + 11 );
DrawText( dc, txt, lstrlen( txt ), &rc, DT_RIGHT | DT_VCENTER | DT_SINGLELINE );
wsprintf( txt, "%d", x );
SetRect( &rc, c - 8, 472, c + 8, 492 );
DrawText( dc, txt, lstrlen( txt ), &rc, DT_CENTER | DT_VCENTER | DT_SINGLELINE );
c += 46; b += 46;
}
SetRect( &rc, 0, b - 9, 36, b + 11 );
DrawText( dc, "0", 1, &rc, DT_RIGHT | DT_VCENTER | DT_SINGLELINE );
bmp.setPenColor( 0 ); bmp.setPenWidth( 3 );
MoveToEx( dc, 40, 11, NULL ); LineTo( dc, 40, 471 );
MoveToEx( dc, 40, 471, NULL ); LineTo( dc, 500, 471 );
}
void plotIt( vector<vector2>* pairs )
{
HDC dc = bmp.getDC();
HBRUSH br = CreateSolidBrush( 255 );
RECT rc;
bmp.setPenColor( 255 ); bmp.setPenWidth( 2 );
vector<vector2>::iterator it = pairs->begin();
int a = MWID + HSTEP * static_cast<int>( ( *it ).x ), b = MHEI - static_cast<int>( VSTEP * ( *it ).y );
MoveToEx( dc, a, b, NULL );
SetRect( &rc, a - 3, b - 3, a + 3, b + 3 ); FillRect( dc, &rc, br );
it++;
for( ; it < pairs->end(); it++ )
{
a = MWID + HSTEP * static_cast<int>( ( *it ).x );
b = MHEI - static_cast<int>( VSTEP * ( *it ).y );
SetRect( &rc, a - 3, b - 3, a + 3, b + 3 );
FillRect( dc, &rc, br ); LineTo( dc, a, b );
}
DeleteObject( br );
}
myBitmap bmp;
};
int main( int argc, char* argv[] )
{
ShowWindow( GetConsoleWindow(), SW_MAXIMIZE );
plot pt;
vector<vector2> pairs;
pairs.push_back( vector2( 0, 2.7f ) ); pairs.push_back( vector2( 1, 2.8f ) );
pairs.push_back( vector2( 2.0f, 31.4f ) ); pairs.push_back( vector2( 3.0f, 38.1f ) );
pairs.push_back( vector2( 4.0f, 58.0f ) ); pairs.push_back( vector2( 5.0f, 76.2f ) );
pairs.push_back( vector2( 6.0f, 100.5f ) ); pairs.push_back( vector2( 7.0f, 130.0f ) );
pairs.push_back( vector2( 8.0f, 149.3f ) ); pairs.push_back( vector2( 9.0f, 180.0f ) );
pt.draw( &pairs );
system( "pause" );
return 0;
}
| package main
import (
"fmt"
"log"
"os/exec"
)
var (
x = []int{0, 1, 2, 3, 4, 5, 6, 7, 8, 9}
y = []float64{2.7, 2.8, 31.4, 38.1, 58.0, 76.2, 100.5, 130.0, 149.3, 180.0}
)
func main() {
g := exec.Command("gnuplot", "-persist")
w, err := g.StdinPipe()
if err != nil {
log.Fatal(err)
}
if err = g.Start(); err != nil {
log.Fatal(err)
}
fmt.Fprintln(w, "unset key; plot '-'")
for i, xi := range x {
fmt.Fprintf(w, "%d %f\n", xi, y[i])
}
fmt.Fprintln(w, "e")
w.Close()
g.Wait()
}
|
Write the same code in Go as shown below in C++. | #include <iostream>
#include <string>
#include <iterator>
#include <regex>
int main()
{
std::regex re(".* string$");
std::string s = "Hi, I am a string";
if (std::regex_match(s, re))
std::cout << "The string matches.\n";
else
std::cout << "Oops - not found?\n";
std::regex re2(" a.*a");
std::smatch match;
if (std::regex_search(s, match, re2))
{
std::cout << "Matched " << match.length()
<< " characters starting at " << match.position() << ".\n";
std::cout << "Matched character sequence: \""
<< match.str() << "\"\n";
}
else
{
std::cout << "Oops - not found?\n";
}
std::string dest_string;
std::regex_replace(std::back_inserter(dest_string),
s.begin(), s.end(),
re2,
"'m now a changed");
std::cout << dest_string << std::endl;
}
| package main
import "fmt"
import "regexp"
func main() {
str := "I am the original string"
matched, _ := regexp.MatchString(".*string$", str)
if matched { fmt.Println("ends with 'string'") }
pattern := regexp.MustCompile("original")
result := pattern.ReplaceAllString(str, "modified")
fmt.Println(result)
}
|
Transform the following C++ implementation into Go, maintaining the same output and logic. | #include <iostream>
#include <algorithm>
#include <string>
#include <iterator>
struct GuessNumberIterator : std::iterator<std::random_access_iterator_tag, int> {
int i;
GuessNumberIterator() { }
GuessNumberIterator(int _i) : i(_i) { }
GuessNumberIterator& operator++() { ++i; return *this; }
GuessNumberIterator operator++(int) {
GuessNumberIterator tmp = *this; ++(*this); return tmp; }
bool operator==(const GuessNumberIterator& y) { return i == y.i; }
bool operator!=(const GuessNumberIterator& y) { return i != y.i; }
int operator*() {
std::cout << "Is your number less than or equal to " << i << "? ";
std::string s;
std::cin >> s;
return (s != "" && (s[0] == 'y' || s[0] == 'Y')) ? 0 : -1;
}
GuessNumberIterator& operator--() { --i; return *this; }
GuessNumberIterator operator--(int) {
GuessNumberIterator tmp = *this; --(*this); return tmp; }
GuessNumberIterator& operator+=(int n) { i += n; return *this; }
GuessNumberIterator& operator-=(int n) { i -= n; return *this; }
GuessNumberIterator operator+(int n) {
GuessNumberIterator tmp = *this; return tmp += n; }
GuessNumberIterator operator-(int n) {
GuessNumberIterator tmp = *this; return tmp -= n; }
int operator-(const GuessNumberIterator &y) { return i - y.i; }
int operator[](int n) { return *(*this + n); }
bool operator<(const GuessNumberIterator &y) { return i < y.i; }
bool operator>(const GuessNumberIterator &y) { return i > y.i; }
bool operator<=(const GuessNumberIterator &y) { return i <= y.i; }
bool operator>=(const GuessNumberIterator &y) { return i >= y.i; }
};
inline GuessNumberIterator operator+(int n, GuessNumberIterator &i) { return i + n; }
const int lower = 0;
const int upper = 100;
int main() {
std::cout << "Instructions:\n"
<< "Think of integer number from " << lower << " (inclusive) to "
<< upper << " (exclusive) and\n"
<< "I will guess it. After each guess, I will ask you if it is less than\n"
<< "or equal to some number, and you will respond with \"yes\" or \"no\".\n";
int answer = std::lower_bound(GuessNumberIterator(lower), GuessNumberIterator(upper), 0).i;
std::cout << "Your number is " << answer << ".\n";
return 0;
}
| package main
import (
"fmt"
"sort"
)
func main() {
lower, upper := 0, 100
fmt.Printf(`Instructions:
Think of integer number from %d (inclusive) to %d (exclusive) and
I will guess it. After each guess, I will ask you if it is less than
or equal to some number, and you will respond with "yes" or "no".
`, lower, upper)
answer := sort.Search(upper-lower, func (i int) bool {
fmt.Printf("Is your number less than or equal to %d? ", lower+i)
s := ""
fmt.Scanf("%s", &s)
return s != "" && s[0] == 'y'
})
fmt.Printf("Your number is %d.\n", lower+answer)
}
|
Ensure the translated Go code behaves exactly like the original C++ snippet. | #include <unordered_map>
#include <string>
int main()
{
std::string keys[] = { "1", "2", "3" };
std::string vals[] = { "a", "b", "c" };
std::unordered_map<std::string, std::string> hash;
for( int i = 0 ; i < 3 ; i++ )
hash[ keys[i] ] = vals[i] ;
}
| package main
import "fmt"
func main() {
keys := []string{"a", "b", "c"}
vals := []int{1, 2, 3}
hash := map[string]int{}
for i, key := range keys {
hash[key] = vals[i]
}
fmt.Println(hash)
}
|
Generate a Go translation of this C++ snippet without changing its computational steps. | #include <algorithm>
#include <cassert>
#include <iomanip>
#include <iostream>
#include <vector>
std::vector<int> bins(const std::vector<int>& limits,
const std::vector<int>& data) {
std::vector<int> result(limits.size() + 1, 0);
for (int n : data) {
auto i = std::upper_bound(limits.begin(), limits.end(), n);
++result[i - limits.begin()];
}
return result;
}
void print_bins(const std::vector<int>& limits, const std::vector<int>& bins) {
size_t n = limits.size();
if (n == 0)
return;
assert(n + 1 == bins.size());
std::cout << " < " << std::setw(3) << limits[0] << ": "
<< std::setw(2) << bins[0] << '\n';
for (size_t i = 1; i < n; ++i)
std::cout << ">= " << std::setw(3) << limits[i - 1] << " and < "
<< std::setw(3) << limits[i] << ": " << std::setw(2)
<< bins[i] << '\n';
std::cout << ">= " << std::setw(3) << limits[n - 1] << " : "
<< std::setw(2) << bins[n] << '\n';
}
int main() {
const std::vector<int> limits1{23, 37, 43, 53, 67, 83};
const std::vector<int> data1{
95, 21, 94, 12, 99, 4, 70, 75, 83, 93, 52, 80, 57, 5, 53, 86, 65,
17, 92, 83, 71, 61, 54, 58, 47, 16, 8, 9, 32, 84, 7, 87, 46, 19,
30, 37, 96, 6, 98, 40, 79, 97, 45, 64, 60, 29, 49, 36, 43, 55};
std::cout << "Example 1:\n";
print_bins(limits1, bins(limits1, data1));
const std::vector<int> limits2{14, 18, 249, 312, 389,
392, 513, 591, 634, 720};
const std::vector<int> data2{
445, 814, 519, 697, 700, 130, 255, 889, 481, 122, 932, 77, 323, 525,
570, 219, 367, 523, 442, 933, 416, 589, 930, 373, 202, 253, 775, 47,
731, 685, 293, 126, 133, 450, 545, 100, 741, 583, 763, 306, 655, 267,
248, 477, 549, 238, 62, 678, 98, 534, 622, 907, 406, 714, 184, 391,
913, 42, 560, 247, 346, 860, 56, 138, 546, 38, 985, 948, 58, 213,
799, 319, 390, 634, 458, 945, 733, 507, 916, 123, 345, 110, 720, 917,
313, 845, 426, 9, 457, 628, 410, 723, 354, 895, 881, 953, 677, 137,
397, 97, 854, 740, 83, 216, 421, 94, 517, 479, 292, 963, 376, 981,
480, 39, 257, 272, 157, 5, 316, 395, 787, 942, 456, 242, 759, 898,
576, 67, 298, 425, 894, 435, 831, 241, 989, 614, 987, 770, 384, 692,
698, 765, 331, 487, 251, 600, 879, 342, 982, 527, 736, 795, 585, 40,
54, 901, 408, 359, 577, 237, 605, 847, 353, 968, 832, 205, 838, 427,
876, 959, 686, 646, 835, 127, 621, 892, 443, 198, 988, 791, 466, 23,
707, 467, 33, 670, 921, 180, 991, 396, 160, 436, 717, 918, 8, 374,
101, 684, 727, 749};
std::cout << "\nExample 2:\n";
print_bins(limits2, bins(limits2, data2));
}
| package main
import (
"fmt"
"sort"
)
func getBins(limits, data []int) []int {
n := len(limits)
bins := make([]int, n+1)
for _, d := range data {
index := sort.SearchInts(limits, d)
if index < len(limits) && d == limits[index] {
index++
}
bins[index]++
}
return bins
}
func printBins(limits, bins []int) {
n := len(limits)
fmt.Printf(" < %3d = %2d\n", limits[0], bins[0])
for i := 1; i < n; i++ {
fmt.Printf(">= %3d and < %3d = %2d\n", limits[i-1], limits[i], bins[i])
}
fmt.Printf(">= %3d = %2d\n", limits[n-1], bins[n])
fmt.Println()
}
func main() {
limitsList := [][]int{
{23, 37, 43, 53, 67, 83},
{14, 18, 249, 312, 389, 392, 513, 591, 634, 720},
}
dataList := [][]int{
{
95, 21, 94, 12, 99, 4, 70, 75, 83, 93, 52, 80, 57, 5, 53, 86, 65, 17, 92, 83, 71, 61, 54, 58, 47,
16, 8, 9, 32, 84, 7, 87, 46, 19, 30, 37, 96, 6, 98, 40, 79, 97, 45, 64, 60, 29, 49, 36, 43, 55,
},
{
445, 814, 519, 697, 700, 130, 255, 889, 481, 122, 932, 77, 323, 525, 570, 219, 367, 523, 442, 933,
416, 589, 930, 373, 202, 253, 775, 47, 731, 685, 293, 126, 133, 450, 545, 100, 741, 583, 763, 306,
655, 267, 248, 477, 549, 238, 62, 678, 98, 534, 622, 907, 406, 714, 184, 391, 913, 42, 560, 247,
346, 860, 56, 138, 546, 38, 985, 948, 58, 213, 799, 319, 390, 634, 458, 945, 733, 507, 916, 123,
345, 110, 720, 917, 313, 845, 426, 9, 457, 628, 410, 723, 354, 895, 881, 953, 677, 137, 397, 97,
854, 740, 83, 216, 421, 94, 517, 479, 292, 963, 376, 981, 480, 39, 257, 272, 157, 5, 316, 395,
787, 942, 456, 242, 759, 898, 576, 67, 298, 425, 894, 435, 831, 241, 989, 614, 987, 770, 384, 692,
698, 765, 331, 487, 251, 600, 879, 342, 982, 527, 736, 795, 585, 40, 54, 901, 408, 359, 577, 237,
605, 847, 353, 968, 832, 205, 838, 427, 876, 959, 686, 646, 835, 127, 621, 892, 443, 198, 988, 791,
466, 23, 707, 467, 33, 670, 921, 180, 991, 396, 160, 436, 717, 918, 8, 374, 101, 684, 727, 749,
},
}
for i := 0; i < len(limitsList); i++ {
fmt.Println("Example", i+1, "\b\n")
bins := getBins(limitsList[i], dataList[i])
printBins(limitsList[i], bins)
}
}
|
Rewrite the snippet below in Go so it works the same as the original C++ code. | #include <algorithm>
#include <cassert>
#include <iomanip>
#include <iostream>
#include <vector>
std::vector<int> bins(const std::vector<int>& limits,
const std::vector<int>& data) {
std::vector<int> result(limits.size() + 1, 0);
for (int n : data) {
auto i = std::upper_bound(limits.begin(), limits.end(), n);
++result[i - limits.begin()];
}
return result;
}
void print_bins(const std::vector<int>& limits, const std::vector<int>& bins) {
size_t n = limits.size();
if (n == 0)
return;
assert(n + 1 == bins.size());
std::cout << " < " << std::setw(3) << limits[0] << ": "
<< std::setw(2) << bins[0] << '\n';
for (size_t i = 1; i < n; ++i)
std::cout << ">= " << std::setw(3) << limits[i - 1] << " and < "
<< std::setw(3) << limits[i] << ": " << std::setw(2)
<< bins[i] << '\n';
std::cout << ">= " << std::setw(3) << limits[n - 1] << " : "
<< std::setw(2) << bins[n] << '\n';
}
int main() {
const std::vector<int> limits1{23, 37, 43, 53, 67, 83};
const std::vector<int> data1{
95, 21, 94, 12, 99, 4, 70, 75, 83, 93, 52, 80, 57, 5, 53, 86, 65,
17, 92, 83, 71, 61, 54, 58, 47, 16, 8, 9, 32, 84, 7, 87, 46, 19,
30, 37, 96, 6, 98, 40, 79, 97, 45, 64, 60, 29, 49, 36, 43, 55};
std::cout << "Example 1:\n";
print_bins(limits1, bins(limits1, data1));
const std::vector<int> limits2{14, 18, 249, 312, 389,
392, 513, 591, 634, 720};
const std::vector<int> data2{
445, 814, 519, 697, 700, 130, 255, 889, 481, 122, 932, 77, 323, 525,
570, 219, 367, 523, 442, 933, 416, 589, 930, 373, 202, 253, 775, 47,
731, 685, 293, 126, 133, 450, 545, 100, 741, 583, 763, 306, 655, 267,
248, 477, 549, 238, 62, 678, 98, 534, 622, 907, 406, 714, 184, 391,
913, 42, 560, 247, 346, 860, 56, 138, 546, 38, 985, 948, 58, 213,
799, 319, 390, 634, 458, 945, 733, 507, 916, 123, 345, 110, 720, 917,
313, 845, 426, 9, 457, 628, 410, 723, 354, 895, 881, 953, 677, 137,
397, 97, 854, 740, 83, 216, 421, 94, 517, 479, 292, 963, 376, 981,
480, 39, 257, 272, 157, 5, 316, 395, 787, 942, 456, 242, 759, 898,
576, 67, 298, 425, 894, 435, 831, 241, 989, 614, 987, 770, 384, 692,
698, 765, 331, 487, 251, 600, 879, 342, 982, 527, 736, 795, 585, 40,
54, 901, 408, 359, 577, 237, 605, 847, 353, 968, 832, 205, 838, 427,
876, 959, 686, 646, 835, 127, 621, 892, 443, 198, 988, 791, 466, 23,
707, 467, 33, 670, 921, 180, 991, 396, 160, 436, 717, 918, 8, 374,
101, 684, 727, 749};
std::cout << "\nExample 2:\n";
print_bins(limits2, bins(limits2, data2));
}
| package main
import (
"fmt"
"sort"
)
func getBins(limits, data []int) []int {
n := len(limits)
bins := make([]int, n+1)
for _, d := range data {
index := sort.SearchInts(limits, d)
if index < len(limits) && d == limits[index] {
index++
}
bins[index]++
}
return bins
}
func printBins(limits, bins []int) {
n := len(limits)
fmt.Printf(" < %3d = %2d\n", limits[0], bins[0])
for i := 1; i < n; i++ {
fmt.Printf(">= %3d and < %3d = %2d\n", limits[i-1], limits[i], bins[i])
}
fmt.Printf(">= %3d = %2d\n", limits[n-1], bins[n])
fmt.Println()
}
func main() {
limitsList := [][]int{
{23, 37, 43, 53, 67, 83},
{14, 18, 249, 312, 389, 392, 513, 591, 634, 720},
}
dataList := [][]int{
{
95, 21, 94, 12, 99, 4, 70, 75, 83, 93, 52, 80, 57, 5, 53, 86, 65, 17, 92, 83, 71, 61, 54, 58, 47,
16, 8, 9, 32, 84, 7, 87, 46, 19, 30, 37, 96, 6, 98, 40, 79, 97, 45, 64, 60, 29, 49, 36, 43, 55,
},
{
445, 814, 519, 697, 700, 130, 255, 889, 481, 122, 932, 77, 323, 525, 570, 219, 367, 523, 442, 933,
416, 589, 930, 373, 202, 253, 775, 47, 731, 685, 293, 126, 133, 450, 545, 100, 741, 583, 763, 306,
655, 267, 248, 477, 549, 238, 62, 678, 98, 534, 622, 907, 406, 714, 184, 391, 913, 42, 560, 247,
346, 860, 56, 138, 546, 38, 985, 948, 58, 213, 799, 319, 390, 634, 458, 945, 733, 507, 916, 123,
345, 110, 720, 917, 313, 845, 426, 9, 457, 628, 410, 723, 354, 895, 881, 953, 677, 137, 397, 97,
854, 740, 83, 216, 421, 94, 517, 479, 292, 963, 376, 981, 480, 39, 257, 272, 157, 5, 316, 395,
787, 942, 456, 242, 759, 898, 576, 67, 298, 425, 894, 435, 831, 241, 989, 614, 987, 770, 384, 692,
698, 765, 331, 487, 251, 600, 879, 342, 982, 527, 736, 795, 585, 40, 54, 901, 408, 359, 577, 237,
605, 847, 353, 968, 832, 205, 838, 427, 876, 959, 686, 646, 835, 127, 621, 892, 443, 198, 988, 791,
466, 23, 707, 467, 33, 670, 921, 180, 991, 396, 160, 436, 717, 918, 8, 374, 101, 684, 727, 749,
},
}
for i := 0; i < len(limitsList); i++ {
fmt.Println("Example", i+1, "\b\n")
bins := getBins(limitsList[i], dataList[i])
printBins(limitsList[i], bins)
}
}
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.