Instruction
stringlengths
45
106
input_code
stringlengths
1
13.7k
output_code
stringlengths
1
13.7k
Write the same algorithm in Go as shown in this C++ implementation.
#include <algorithm> #include <array> #include <cstdint> #include <numeric> #include <iomanip> #include <iostream> #include <string> std::array<std::uint_fast32_t, 256> generate_crc_lookup_table() noexcept { auto const reversed_polynomial = std::uint_fast32_t{0xEDB88320uL}; struct byte_checksum { std::uint_fast32_t operator()() noexcept { auto checksum = static_cast<std::uint_fast32_t>(n++); for (auto i = 0; i < 8; ++i) checksum = (checksum >> 1) ^ ((checksum & 0x1u) ? reversed_polynomial : 0); return checksum; } unsigned n = 0; }; auto table = std::array<std::uint_fast32_t, 256>{}; std::generate(table.begin(), table.end(), byte_checksum{}); return table; } template <typename InputIterator> std::uint_fast32_t crc(InputIterator first, InputIterator last) { static auto const table = generate_crc_lookup_table(); return std::uint_fast32_t{0xFFFFFFFFuL} & ~std::accumulate(first, last, ~std::uint_fast32_t{0} & std::uint_fast32_t{0xFFFFFFFFuL}, [](std::uint_fast32_t checksum, std::uint_fast8_t value) { return table[(checksum ^ value) & 0xFFu] ^ (checksum >> 8); }); } int main() { auto const s = std::string{"The quick brown fox jumps over the lazy dog"}; std::cout << std::hex << std::setw(8) << std::setfill('0') << crc(s.begin(), s.end()) << '\n'; }
package main import ( "fmt" "hash/crc32" ) func main() { s := []byte("The quick brown fox jumps over the lazy dog") result := crc32.ChecksumIEEE(s) fmt.Printf("%X\n", result) }
Port the following code from C++ to Go with equivalent syntax and logic.
#include <string> #include <boost/regex.hpp> #include <iostream> std::string csvToHTML( const std::string & ) ; int main( ) { std::string text = "Character,Speech\n" "The multitude,The messiah! Show us the messiah!\n" "Brians mother,<angry>Now you listen here! He's not the messiah; he's a very naughty boy! Now go away!</angry>\n" "The multitude,Who are you?\n" "Brians mother,I'm his mother; that's who!\n" "The multitude,Behold his mother! Behold his mother!\n" ; std::cout << csvToHTML( text ) ; return 0 ; } std::string csvToHTML( const std::string & csvtext ) { std::string regexes[ 5 ] = { "<" , ">" , "^(.+?)\\b" , "," , "\n" } ; const char* replacements [ 5 ] = { "&lt;" , "&gt;" , " <TR><TD>$1" , "</TD><TD>", "</TD></TR>\n" } ; boost::regex e1( regexes[ 0 ] ) ; std::string tabletext = boost::regex_replace( csvtext , e1 , replacements[ 0 ] , boost::match_default | boost::format_all ) ; for ( int i = 1 ; i < 5 ; i++ ) { e1.assign( regexes[ i ] ) ; tabletext = boost::regex_replace( tabletext , e1 , replacements[ i ] , boost::match_default | boost::format_all ) ; } tabletext = std::string( "<TABLE>\n" ) + tabletext ; tabletext.append( "</TABLE>\n" ) ; return tabletext ; }
package main import ( "bytes" "encoding/csv" "fmt" "html/template" "strings" ) var c = `Character,Speech The multitude,The messiah! Show us the messiah! Brians mother,<angry>Now you listen here! He's not the messiah; he's a very naughty boy! Now go away!</angry> The multitude,Who are you? Brians mother,I'm his mother; that's who! The multitude,Behold his mother! Behold his mother!` func main() { if h, err := csvToHtml(c); err != nil { fmt.Println(err) } else { fmt.Print(h) } } func csvToHtml(c string) (string, error) { data, err := csv.NewReader(bytes.NewBufferString(c)).ReadAll() if err != nil { return "", err } var b strings.Builder err = template.Must(template.New("").Parse(`<table> {{range .}} <tr>{{range .}}<td>{{.}}</td>{{end}}</tr> {{end}}</table> `)).Execute(&b, data) return b.String(), err }
Produce a functionally identical Go code for the snippet given in C++.
#include <string> #include <boost/regex.hpp> #include <iostream> std::string csvToHTML( const std::string & ) ; int main( ) { std::string text = "Character,Speech\n" "The multitude,The messiah! Show us the messiah!\n" "Brians mother,<angry>Now you listen here! He's not the messiah; he's a very naughty boy! Now go away!</angry>\n" "The multitude,Who are you?\n" "Brians mother,I'm his mother; that's who!\n" "The multitude,Behold his mother! Behold his mother!\n" ; std::cout << csvToHTML( text ) ; return 0 ; } std::string csvToHTML( const std::string & csvtext ) { std::string regexes[ 5 ] = { "<" , ">" , "^(.+?)\\b" , "," , "\n" } ; const char* replacements [ 5 ] = { "&lt;" , "&gt;" , " <TR><TD>$1" , "</TD><TD>", "</TD></TR>\n" } ; boost::regex e1( regexes[ 0 ] ) ; std::string tabletext = boost::regex_replace( csvtext , e1 , replacements[ 0 ] , boost::match_default | boost::format_all ) ; for ( int i = 1 ; i < 5 ; i++ ) { e1.assign( regexes[ i ] ) ; tabletext = boost::regex_replace( tabletext , e1 , replacements[ i ] , boost::match_default | boost::format_all ) ; } tabletext = std::string( "<TABLE>\n" ) + tabletext ; tabletext.append( "</TABLE>\n" ) ; return tabletext ; }
package main import ( "bytes" "encoding/csv" "fmt" "html/template" "strings" ) var c = `Character,Speech The multitude,The messiah! Show us the messiah! Brians mother,<angry>Now you listen here! He's not the messiah; he's a very naughty boy! Now go away!</angry> The multitude,Who are you? Brians mother,I'm his mother; that's who! The multitude,Behold his mother! Behold his mother!` func main() { if h, err := csvToHtml(c); err != nil { fmt.Println(err) } else { fmt.Print(h) } } func csvToHtml(c string) (string, error) { data, err := csv.NewReader(bytes.NewBufferString(c)).ReadAll() if err != nil { return "", err } var b strings.Builder err = template.Must(template.New("").Parse(`<table> {{range .}} <tr>{{range .}}<td>{{.}}</td>{{end}}</tr> {{end}}</table> `)).Execute(&b, data) return b.String(), err }
Translate the given C++ code snippet into Go without altering its behavior.
PRAGMA COMPILER g++ PRAGMA OPTIONS -Wno-write-strings -Wno-pointer-arith -fpermissive OPTION PARSE FALSE '---The class does the declaring for you CLASS Books public: const char* title; const char* author; const char* subject; int book_id; END CLASS '---pointer to an object declaration (we use a class called Books) DECLARE Book1 TYPE Books '--- the correct syntax for class Book1 = Books() '--- initialize the strings const char* in c++ Book1.title = "C++ Programming to bacon " Book1.author = "anyone" Book1.subject ="RECORD Tutorial" Book1.book_id = 1234567 PRINT "Book title  : " ,Book1.title FORMAT "%s%s\n" PRINT "Book author  : ", Book1.author FORMAT "%s%s\n" PRINT "Book subject : ", Book1.subject FORMAT "%s%s\n" PRINT "Book book_id : ", Book1.book_id FORMAT "%s%d\n"
package main import "fmt" type picnicBasket struct { nServings int corkscrew bool } func (b *picnicBasket) happy() bool { return b.nServings > 1 && b.corkscrew } func newPicnicBasket(nPeople int) *picnicBasket { return &picnicBasket{nPeople, nPeople > 0} } func main() { var pb picnicBasket pbl := picnicBasket{} pbp := &picnicBasket{} pbn := new(picnicBasket) forTwo := newPicnicBasket(2) forToo := &picnicBasket{nServings: 2, corkscrew: true} fmt.Println(pb.nServings, pb.corkscrew) fmt.Println(pbl.nServings, pbl.corkscrew) fmt.Println(pbp) fmt.Println(pbn) fmt.Println(forTwo) fmt.Println(forToo) }
Port the provided C++ code into Go while preserving the original functionality.
#include <vector> #include <string> #include <iostream> #include <sstream> #include <algorithm> #include <iterator> #include <utility> long string2long( const std::string & s ) { long result ; std::istringstream( s ) >> result ; return result ; } bool isKaprekar( long number ) { long long squarenumber = ((long long)number) * number ; std::ostringstream numberbuf ; numberbuf << squarenumber ; std::string numberstring = numberbuf.str( ) ; for ( int i = 0 ; i < numberstring.length( ) ; i++ ) { std::string firstpart = numberstring.substr( 0 , i ) , secondpart = numberstring.substr( i ) ; if ( secondpart.find_first_not_of( "0" ) == std::string::npos ) { return false ; } if ( string2long( firstpart ) + string2long( secondpart ) == number ) { return true ; } } return false ; } int main( ) { std::vector<long> kaprekarnumbers ; kaprekarnumbers.push_back( 1 ) ; for ( int i = 2 ; i < 1000001 ; i++ ) { if ( isKaprekar( i ) ) kaprekarnumbers.push_back( i ) ; } std::vector<long>::const_iterator svi = kaprekarnumbers.begin( ) ; std::cout << "Kaprekar numbers up to 10000: \n" ; while ( *svi < 10000 ) { std::cout << *svi << " " ; svi++ ; } std::cout << '\n' ; std::cout << "All the Kaprekar numbers up to 1000000 :\n" ; std::copy( kaprekarnumbers.begin( ) , kaprekarnumbers.end( ) , std::ostream_iterator<long>( std::cout , "\n" ) ) ; std::cout << "There are " << kaprekarnumbers.size( ) << " Kaprekar numbers less than one million!\n" ; return 0 ; }
package main import ( "fmt" "strconv" ) func kaprekar(n uint64, base uint64) (bool, int) { order := 0 if n == 1 { return true, -1 } nn, power := n*n, uint64(1) for power <= nn { power *= base order++ } power /= base order-- for ; power > 1; power /= base { q, r := nn/power, nn%power if q >= n { return false, -1 } if q+r == n { return true, order } order-- } return false, -1 } func main() { max := uint64(10000) fmt.Printf("Kaprekar numbers < %d:\n", max) for m := uint64(0); m < max; m++ { if is, _ := kaprekar(m, 10); is { fmt.Println(" ", m) } } max = 1e6 var count int for m := uint64(0); m < max; m++ { if is, _ := kaprekar(m, 10); is { count++ } } fmt.Printf("\nThere are %d Kaprekar numbers < %d.\n", count, max) const base = 17 maxB := "1000000" fmt.Printf("\nKaprekar numbers between 1 and %s(base %d):\n", maxB, base) max, _ = strconv.ParseUint(maxB, base, 64) fmt.Printf("\n Base 10 Base %d Square Split\n", base) for m := uint64(2); m < max; m++ { is, pos := kaprekar(m, base) if !is { continue } sq := strconv.FormatUint(m*m, base) str := strconv.FormatUint(m, base) split := len(sq)-pos fmt.Printf("%8d %7s %12s %6s + %s\n", m, str, sq, sq[:split], sq[split:]) } }
Translate this program into Go but keep the logic exactly as in C++.
#include <vector> #include <string> #include <iostream> #include <sstream> #include <algorithm> #include <iterator> #include <utility> long string2long( const std::string & s ) { long result ; std::istringstream( s ) >> result ; return result ; } bool isKaprekar( long number ) { long long squarenumber = ((long long)number) * number ; std::ostringstream numberbuf ; numberbuf << squarenumber ; std::string numberstring = numberbuf.str( ) ; for ( int i = 0 ; i < numberstring.length( ) ; i++ ) { std::string firstpart = numberstring.substr( 0 , i ) , secondpart = numberstring.substr( i ) ; if ( secondpart.find_first_not_of( "0" ) == std::string::npos ) { return false ; } if ( string2long( firstpart ) + string2long( secondpart ) == number ) { return true ; } } return false ; } int main( ) { std::vector<long> kaprekarnumbers ; kaprekarnumbers.push_back( 1 ) ; for ( int i = 2 ; i < 1000001 ; i++ ) { if ( isKaprekar( i ) ) kaprekarnumbers.push_back( i ) ; } std::vector<long>::const_iterator svi = kaprekarnumbers.begin( ) ; std::cout << "Kaprekar numbers up to 10000: \n" ; while ( *svi < 10000 ) { std::cout << *svi << " " ; svi++ ; } std::cout << '\n' ; std::cout << "All the Kaprekar numbers up to 1000000 :\n" ; std::copy( kaprekarnumbers.begin( ) , kaprekarnumbers.end( ) , std::ostream_iterator<long>( std::cout , "\n" ) ) ; std::cout << "There are " << kaprekarnumbers.size( ) << " Kaprekar numbers less than one million!\n" ; return 0 ; }
package main import ( "fmt" "strconv" ) func kaprekar(n uint64, base uint64) (bool, int) { order := 0 if n == 1 { return true, -1 } nn, power := n*n, uint64(1) for power <= nn { power *= base order++ } power /= base order-- for ; power > 1; power /= base { q, r := nn/power, nn%power if q >= n { return false, -1 } if q+r == n { return true, order } order-- } return false, -1 } func main() { max := uint64(10000) fmt.Printf("Kaprekar numbers < %d:\n", max) for m := uint64(0); m < max; m++ { if is, _ := kaprekar(m, 10); is { fmt.Println(" ", m) } } max = 1e6 var count int for m := uint64(0); m < max; m++ { if is, _ := kaprekar(m, 10); is { count++ } } fmt.Printf("\nThere are %d Kaprekar numbers < %d.\n", count, max) const base = 17 maxB := "1000000" fmt.Printf("\nKaprekar numbers between 1 and %s(base %d):\n", maxB, base) max, _ = strconv.ParseUint(maxB, base, 64) fmt.Printf("\n Base 10 Base %d Square Split\n", base) for m := uint64(2); m < max; m++ { is, pos := kaprekar(m, base) if !is { continue } sq := strconv.FormatUint(m*m, base) str := strconv.FormatUint(m, base) split := len(sq)-pos fmt.Printf("%8d %7s %12s %6s + %s\n", m, str, sq, sq[:split], sq[split:]) } }
Translate the given C++ code snippet into Go without altering its behavior.
#include <string> #include <map> template <typename Iterator> Iterator compress(const std::string &uncompressed, Iterator result) { int dictSize = 256; std::map<std::string,int> dictionary; for (int i = 0; i < 256; i++) dictionary[std::string(1, i)] = i; std::string w; for (std::string::const_iterator it = uncompressed.begin(); it != uncompressed.end(); ++it) { char c = *it; std::string wc = w + c; if (dictionary.count(wc)) w = wc; else { *result++ = dictionary[w]; dictionary[wc] = dictSize++; w = std::string(1, c); } } if (!w.empty()) *result++ = dictionary[w]; return result; } template <typename Iterator> std::string decompress(Iterator begin, Iterator end) { int dictSize = 256; std::map<int,std::string> dictionary; for (int i = 0; i < 256; i++) dictionary[i] = std::string(1, i); std::string w(1, *begin++); std::string result = w; std::string entry; for ( ; begin != end; begin++) { int k = *begin; if (dictionary.count(k)) entry = dictionary[k]; else if (k == dictSize) entry = w + w[0]; else throw "Bad compressed k"; result += entry; dictionary[dictSize++] = w + entry[0]; w = entry; } return result; } #include <iostream> #include <iterator> #include <vector> int main() { std::vector<int> compressed; compress("TOBEORNOTTOBEORTOBEORNOT", std::back_inserter(compressed)); copy(compressed.begin(), compressed.end(), std::ostream_iterator<int>(std::cout, ", ")); std::cout << std::endl; std::string decompressed = decompress(compressed.begin(), compressed.end()); std::cout << decompressed << std::endl; return 0; }
package main import ( "fmt" "log" "strings" ) func compress(uncompressed string) []int { dictSize := 256 dictionary := make(map[string]int, dictSize) for i := 0; i < dictSize; i++ { dictionary[string([]byte{byte(i)})] = i } var result []int var w []byte for i := 0; i < len(uncompressed); i++ { c := uncompressed[i] wc := append(w, c) if _, ok := dictionary[string(wc)]; ok { w = wc } else { result = append(result, dictionary[string(w)]) dictionary[string(wc)] = dictSize dictSize++ wc[0] = c w = wc[:1] } } if len(w) > 0 { result = append(result, dictionary[string(w)]) } return result } type BadSymbolError int func (e BadSymbolError) Error() string { return fmt.Sprint("Bad compressed symbol ", int(e)) } func decompress(compressed []int) (string, error) { dictSize := 256 dictionary := make(map[int][]byte, dictSize) for i := 0; i < dictSize; i++ { dictionary[i] = []byte{byte(i)} } var result strings.Builder var w []byte for _, k := range compressed { var entry []byte if x, ok := dictionary[k]; ok { entry = x[:len(x):len(x)] } else if k == dictSize && len(w) > 0 { entry = append(w, w[0]) } else { return result.String(), BadSymbolError(k) } result.Write(entry) if len(w) > 0 { w = append(w, entry[0]) dictionary[dictSize] = w dictSize++ } w = entry } return result.String(), nil } func main() { compressed := compress("TOBEORNOTTOBEORTOBEORNOT") fmt.Println(compressed) decompressed, err := decompress(compressed) if err != nil { log.Fatal(err) } fmt.Println(decompressed) }
Convert the following code from C++ to Go, ensuring the logic remains intact.
#include <iomanip> #include <iostream> #include <set> #include <vector> using namespace std; unsigned hofstadter(unsigned rlistSize, unsigned slistSize) { auto n = rlistSize > slistSize ? rlistSize : slistSize; auto rlist = new vector<unsigned> { 1, 3, 7 }; auto slist = new vector<unsigned> { 2, 4, 5, 6 }; auto list = rlistSize > 0 ? rlist : slist; auto target_size = rlistSize > 0 ? rlistSize : slistSize; while (list->size() > target_size) list->pop_back(); while (list->size() < target_size) { auto lastIndex = rlist->size() - 1; auto lastr = (*rlist)[lastIndex]; auto r = lastr + (*slist)[lastIndex]; rlist->push_back(r); for (auto s = lastr + 1; s < r && list->size() < target_size;) slist->push_back(s++); } auto v = (*list)[n - 1]; delete rlist; delete slist; return v; } ostream& operator<<(ostream& os, const set<unsigned>& s) { cout << '(' << s.size() << "):"; auto i = 0; for (auto c = s.begin(); c != s.end();) { if (i++ % 20 == 0) os << endl; os << setw(5) << *c++; } return os; } int main(int argc, const char* argv[]) { const auto v1 = atoi(argv[1]); const auto v2 = atoi(argv[2]); set<unsigned> r, s; for (auto n = 1; n <= v2; n++) { if (n <= v1) r.insert(hofstadter(n, 0)); s.insert(hofstadter(0, n)); } cout << "R" << r << endl; cout << "S" << s << endl; int m = max(*r.rbegin(), *s.rbegin()); for (auto n = 1; n <= m; n++) if (r.count(n) == s.count(n)) clog << "integer " << n << " either in both or neither set" << endl; return 0; }
package main import "fmt" var ffr, ffs func(int) int func init() { r := []int{0, 1} s := []int{0, 2} ffr = func(n int) int { for len(r) <= n { nrk := len(r) - 1 rNxt := r[nrk] + s[nrk] r = append(r, rNxt) for sn := r[nrk] + 2; sn < rNxt; sn++ { s = append(s, sn) } s = append(s, rNxt+1) } return r[n] } ffs = func(n int) int { for len(s) <= n { ffr(len(r)) } return s[n] } } func main() { for n := 1; n <= 10; n++ { fmt.Printf("r(%d): %d\n", n, ffr(n)) } var found [1001]int for n := 1; n <= 40; n++ { found[ffr(n)]++ } for n := 1; n <= 960; n++ { found[ffs(n)]++ } for i := 1; i <= 1000; i++ { if found[i] != 1 { fmt.Println("task 4: FAIL") return } } fmt.Println("task 4: PASS") }
Port the following code from C++ to Go with equivalent syntax and logic.
#include <iomanip> #include <iostream> #include <set> #include <vector> using namespace std; unsigned hofstadter(unsigned rlistSize, unsigned slistSize) { auto n = rlistSize > slistSize ? rlistSize : slistSize; auto rlist = new vector<unsigned> { 1, 3, 7 }; auto slist = new vector<unsigned> { 2, 4, 5, 6 }; auto list = rlistSize > 0 ? rlist : slist; auto target_size = rlistSize > 0 ? rlistSize : slistSize; while (list->size() > target_size) list->pop_back(); while (list->size() < target_size) { auto lastIndex = rlist->size() - 1; auto lastr = (*rlist)[lastIndex]; auto r = lastr + (*slist)[lastIndex]; rlist->push_back(r); for (auto s = lastr + 1; s < r && list->size() < target_size;) slist->push_back(s++); } auto v = (*list)[n - 1]; delete rlist; delete slist; return v; } ostream& operator<<(ostream& os, const set<unsigned>& s) { cout << '(' << s.size() << "):"; auto i = 0; for (auto c = s.begin(); c != s.end();) { if (i++ % 20 == 0) os << endl; os << setw(5) << *c++; } return os; } int main(int argc, const char* argv[]) { const auto v1 = atoi(argv[1]); const auto v2 = atoi(argv[2]); set<unsigned> r, s; for (auto n = 1; n <= v2; n++) { if (n <= v1) r.insert(hofstadter(n, 0)); s.insert(hofstadter(0, n)); } cout << "R" << r << endl; cout << "S" << s << endl; int m = max(*r.rbegin(), *s.rbegin()); for (auto n = 1; n <= m; n++) if (r.count(n) == s.count(n)) clog << "integer " << n << " either in both or neither set" << endl; return 0; }
package main import "fmt" var ffr, ffs func(int) int func init() { r := []int{0, 1} s := []int{0, 2} ffr = func(n int) int { for len(r) <= n { nrk := len(r) - 1 rNxt := r[nrk] + s[nrk] r = append(r, rNxt) for sn := r[nrk] + 2; sn < rNxt; sn++ { s = append(s, sn) } s = append(s, rNxt+1) } return r[n] } ffs = func(n int) int { for len(s) <= n { ffr(len(r)) } return s[n] } } func main() { for n := 1; n <= 10; n++ { fmt.Printf("r(%d): %d\n", n, ffr(n)) } var found [1001]int for n := 1; n <= 40; n++ { found[ffr(n)]++ } for n := 1; n <= 960; n++ { found[ffs(n)]++ } for i := 1; i <= 1000; i++ { if found[i] != 1 { fmt.Println("task 4: FAIL") return } } fmt.Println("task 4: PASS") }
Convert the following code from C++ to Go, ensuring the logic remains intact.
#include <iostream> #include <sstream> #include <iomanip> #include <cassert> #include <vector> using namespace std; class MagicSquare { public: MagicSquare(int d) : sqr(d*d,0), sz(d) { assert(d&1); fillSqr(); } void display() { cout << "Odd Magic Square: " << sz << " x " << sz << "\n"; cout << "It's Magic Sum is: " << magicNumber() << "\n\n"; ostringstream cvr; cvr << sz * sz; int l = cvr.str().size(); for( int y = 0; y < sz; y++ ) { int yy = y * sz; for( int x = 0; x < sz; x++ ) cout << setw( l + 2 ) << sqr[yy + x]; cout << "\n"; } cout << "\n\n"; } private: void fillSqr() { int sx = sz / 2, sy = 0, c = 0; while( c < sz * sz ) { if( !sqr[sx + sy * sz] ) { sqr[sx + sy * sz]= c + 1; inc( sx ); dec( sy ); c++; } else { dec( sx ); inc( sy ); inc( sy ); } } } int magicNumber() { return sz * ( ( sz * sz ) + 1 ) / 2; } void inc( int& a ) { if( ++a == sz ) a = 0; } void dec( int& a ) { if( --a < 0 ) a = sz - 1; } bool checkPos( int x, int y ) { return( isInside( x ) && isInside( y ) && !sqr[sz * y + x] ); } bool isInside( int s ) { return ( s < sz && s > -1 ); } vector<int> sqr; int sz; }; int main() { MagicSquare s(7); s.display(); return 0; }
package main import ( "fmt" "log" ) func ms(n int) (int, []int) { M := func(x int) int { return (x + n - 1) % n } if n <= 0 || n&1 == 0 { n = 5 log.Println("forcing size", n) } m := make([]int, n*n) i, j := 0, n/2 for k := 1; k <= n*n; k++ { m[i*n+j] = k if m[M(i)*n+M(j)] != 0 { i = (i + 1) % n } else { i, j = M(i), M(j) } } return n, m } func main() { n, m := ms(5) i := 2 for j := 1; j <= n*n; j *= 10 { i++ } f := fmt.Sprintf("%%%dd", i) for i := 0; i < n; i++ { for j := 0; j < n; j++ { fmt.Printf(f, m[i*n+j]) } fmt.Println() } }
Write the same code in Go as shown below in C++.
#include <iostream> #include <sstream> #include <iomanip> #include <cassert> #include <vector> using namespace std; class MagicSquare { public: MagicSquare(int d) : sqr(d*d,0), sz(d) { assert(d&1); fillSqr(); } void display() { cout << "Odd Magic Square: " << sz << " x " << sz << "\n"; cout << "It's Magic Sum is: " << magicNumber() << "\n\n"; ostringstream cvr; cvr << sz * sz; int l = cvr.str().size(); for( int y = 0; y < sz; y++ ) { int yy = y * sz; for( int x = 0; x < sz; x++ ) cout << setw( l + 2 ) << sqr[yy + x]; cout << "\n"; } cout << "\n\n"; } private: void fillSqr() { int sx = sz / 2, sy = 0, c = 0; while( c < sz * sz ) { if( !sqr[sx + sy * sz] ) { sqr[sx + sy * sz]= c + 1; inc( sx ); dec( sy ); c++; } else { dec( sx ); inc( sy ); inc( sy ); } } } int magicNumber() { return sz * ( ( sz * sz ) + 1 ) / 2; } void inc( int& a ) { if( ++a == sz ) a = 0; } void dec( int& a ) { if( --a < 0 ) a = sz - 1; } bool checkPos( int x, int y ) { return( isInside( x ) && isInside( y ) && !sqr[sz * y + x] ); } bool isInside( int s ) { return ( s < sz && s > -1 ); } vector<int> sqr; int sz; }; int main() { MagicSquare s(7); s.display(); return 0; }
package main import ( "fmt" "log" ) func ms(n int) (int, []int) { M := func(x int) int { return (x + n - 1) % n } if n <= 0 || n&1 == 0 { n = 5 log.Println("forcing size", n) } m := make([]int, n*n) i, j := 0, n/2 for k := 1; k <= n*n; k++ { m[i*n+j] = k if m[M(i)*n+M(j)] != 0 { i = (i + 1) % n } else { i, j = M(i), M(j) } } return n, m } func main() { n, m := ms(5) i := 2 for j := 1; j <= n*n; j *= 10 { i++ } f := fmt.Sprintf("%%%dd", i) for i := 0; i < n; i++ { for j := 0; j < n; j++ { fmt.Printf(f, m[i*n+j]) } fmt.Println() } }
Convert the following code from C++ to Go, ensuring the logic remains intact.
#include <iostream> #include <numeric> #include <set> template <typename integer> class yellowstone_generator { public: integer next() { n2_ = n1_; n1_ = n_; if (n_ < 3) { ++n_; } else { for (n_ = min_; !(sequence_.count(n_) == 0 && std::gcd(n1_, n_) == 1 && std::gcd(n2_, n_) > 1); ++n_) {} } sequence_.insert(n_); for (;;) { auto it = sequence_.find(min_); if (it == sequence_.end()) break; sequence_.erase(it); ++min_; } return n_; } private: std::set<integer> sequence_; integer min_ = 1; integer n_ = 0; integer n1_ = 0; integer n2_ = 0; }; int main() { std::cout << "First 30 Yellowstone numbers:\n"; yellowstone_generator<unsigned int> ygen; std::cout << ygen.next(); for (int i = 1; i < 30; ++i) std::cout << ' ' << ygen.next(); std::cout << '\n'; return 0; }
package main import ( "fmt" "log" "os/exec" ) func gcd(x, y int) int { for y != 0 { x, y = y, x%y } return x } func yellowstone(n int) []int { m := make(map[int]bool) a := make([]int, n+1) for i := 1; i < 4; i++ { a[i] = i m[i] = true } min := 4 for c := 4; c <= n; c++ { for i := min; ; i++ { if !m[i] && gcd(a[c-1], i) == 1 && gcd(a[c-2], i) > 1 { a[c] = i m[i] = true if i == min { min++ } break } } } return a[1:] } func check(err error) { if err != nil { log.Fatal(err) } } func main() { x := make([]int, 100) for i := 0; i < 100; i++ { x[i] = i + 1 } y := yellowstone(100) fmt.Println("The first 30 Yellowstone numbers are:") fmt.Println(y[:30]) g := exec.Command("gnuplot", "-persist") w, err := g.StdinPipe() check(err) check(g.Start()) fmt.Fprintln(w, "unset key; plot '-'") for i, xi := range x { fmt.Fprintf(w, "%d %d\n", xi, y[i]) } fmt.Fprintln(w, "e") w.Close() g.Wait() }
Translate this program into Go but keep the logic exactly as in C++.
#include <iostream> #include <numeric> #include <set> template <typename integer> class yellowstone_generator { public: integer next() { n2_ = n1_; n1_ = n_; if (n_ < 3) { ++n_; } else { for (n_ = min_; !(sequence_.count(n_) == 0 && std::gcd(n1_, n_) == 1 && std::gcd(n2_, n_) > 1); ++n_) {} } sequence_.insert(n_); for (;;) { auto it = sequence_.find(min_); if (it == sequence_.end()) break; sequence_.erase(it); ++min_; } return n_; } private: std::set<integer> sequence_; integer min_ = 1; integer n_ = 0; integer n1_ = 0; integer n2_ = 0; }; int main() { std::cout << "First 30 Yellowstone numbers:\n"; yellowstone_generator<unsigned int> ygen; std::cout << ygen.next(); for (int i = 1; i < 30; ++i) std::cout << ' ' << ygen.next(); std::cout << '\n'; return 0; }
package main import ( "fmt" "log" "os/exec" ) func gcd(x, y int) int { for y != 0 { x, y = y, x%y } return x } func yellowstone(n int) []int { m := make(map[int]bool) a := make([]int, n+1) for i := 1; i < 4; i++ { a[i] = i m[i] = true } min := 4 for c := 4; c <= n; c++ { for i := min; ; i++ { if !m[i] && gcd(a[c-1], i) == 1 && gcd(a[c-2], i) > 1 { a[c] = i m[i] = true if i == min { min++ } break } } } return a[1:] } func check(err error) { if err != nil { log.Fatal(err) } } func main() { x := make([]int, 100) for i := 0; i < 100; i++ { x[i] = i + 1 } y := yellowstone(100) fmt.Println("The first 30 Yellowstone numbers are:") fmt.Println(y[:30]) g := exec.Command("gnuplot", "-persist") w, err := g.StdinPipe() check(err) check(g.Start()) fmt.Fprintln(w, "unset key; plot '-'") for i, xi := range x { fmt.Fprintf(w, "%d %d\n", xi, y[i]) } fmt.Fprintln(w, "e") w.Close() g.Wait() }
Convert this C++ block to Go, preserving its control flow and logic.
#include <array> #include <iostream> #include <stack> #include <vector> const std::array<std::pair<int, int>, 4> DIRS = { std::make_pair(0, -1), std::make_pair(-1, 0), std::make_pair(0, 1), std::make_pair(1, 0), }; void printResult(const std::vector<std::vector<int>> &v) { for (auto &row : v) { auto it = row.cbegin(); auto end = row.cend(); std::cout << '['; if (it != end) { std::cout << *it; it = std::next(it); } while (it != end) { std::cout << ", " << *it; it = std::next(it); } std::cout << "]\n"; } } void cutRectangle(int w, int h) { if (w % 2 == 1 && h % 2 == 1) { return; } std::vector<std::vector<int>> grid(h, std::vector<int>(w)); std::stack<int> stack; int half = (w * h) / 2; long bits = (long)pow(2, half) - 1; for (; bits > 0; bits -= 2) { for (int i = 0; i < half; i++) { int r = i / w; int c = i % w; grid[r][c] = (bits & (1 << i)) != 0 ? 1 : 0; grid[h - r - 1][w - c - 1] = 1 - grid[r][c]; } stack.push(0); grid[0][0] = 2; int count = 1; while (!stack.empty()) { int pos = stack.top(); stack.pop(); int r = pos / w; int c = pos % w; for (auto dir : DIRS) { int nextR = r + dir.first; int nextC = c + dir.second; if (nextR >= 0 && nextR < h && nextC >= 0 && nextC < w) { if (grid[nextR][nextC] == 1) { stack.push(nextR * w + nextC); grid[nextR][nextC] = 2; count++; } } } } if (count == half) { printResult(grid); std::cout << '\n'; } } } int main() { cutRectangle(2, 2); cutRectangle(4, 3); return 0; }
package main import "fmt" var grid []byte var w, h, last int var cnt int var next [4]int var dir = [4][2]int{{0, -1}, {-1, 0}, {0, 1}, {1, 0}} func walk(y, x int) { if y == 0 || y == h || x == 0 || x == w { cnt += 2 return } t := y*(w+1) + x grid[t]++ grid[last-t]++ for i, d := range dir { if grid[t+next[i]] == 0 { walk(y+d[0], x+d[1]) } } grid[t]-- grid[last-t]-- } func solve(hh, ww, recur int) int { h = hh w = ww if h&1 != 0 { h, w = w, h } switch { case h&1 == 1: return 0 case w == 1: return 1 case w == 2: return h case h == 2: return w } cy := h / 2 cx := w / 2 grid = make([]byte, (h+1)*(w+1)) last = len(grid) - 1 next[0] = -1 next[1] = -w - 1 next[2] = 1 next[3] = w + 1 if recur != 0 { cnt = 0 } for x := cx + 1; x < w; x++ { t := cy*(w+1) + x grid[t] = 1 grid[last-t] = 1 walk(cy-1, x) } cnt++ if h == w { cnt *= 2 } else if w&1 == 0 && recur != 0 { solve(w, h, 0) } return cnt } func main() { for y := 1; y <= 10; y++ { for x := 1; x <= y; x++ { if x&1 == 0 || y&1 == 0 { fmt.Printf("%d x %d: %d\n", y, x, solve(y, x, 1)) } } } }
Convert this C++ snippet to Go and keep its semantics consistent.
#include <array> #include <iostream> #include <stack> #include <vector> const std::array<std::pair<int, int>, 4> DIRS = { std::make_pair(0, -1), std::make_pair(-1, 0), std::make_pair(0, 1), std::make_pair(1, 0), }; void printResult(const std::vector<std::vector<int>> &v) { for (auto &row : v) { auto it = row.cbegin(); auto end = row.cend(); std::cout << '['; if (it != end) { std::cout << *it; it = std::next(it); } while (it != end) { std::cout << ", " << *it; it = std::next(it); } std::cout << "]\n"; } } void cutRectangle(int w, int h) { if (w % 2 == 1 && h % 2 == 1) { return; } std::vector<std::vector<int>> grid(h, std::vector<int>(w)); std::stack<int> stack; int half = (w * h) / 2; long bits = (long)pow(2, half) - 1; for (; bits > 0; bits -= 2) { for (int i = 0; i < half; i++) { int r = i / w; int c = i % w; grid[r][c] = (bits & (1 << i)) != 0 ? 1 : 0; grid[h - r - 1][w - c - 1] = 1 - grid[r][c]; } stack.push(0); grid[0][0] = 2; int count = 1; while (!stack.empty()) { int pos = stack.top(); stack.pop(); int r = pos / w; int c = pos % w; for (auto dir : DIRS) { int nextR = r + dir.first; int nextC = c + dir.second; if (nextR >= 0 && nextR < h && nextC >= 0 && nextC < w) { if (grid[nextR][nextC] == 1) { stack.push(nextR * w + nextC); grid[nextR][nextC] = 2; count++; } } } } if (count == half) { printResult(grid); std::cout << '\n'; } } } int main() { cutRectangle(2, 2); cutRectangle(4, 3); return 0; }
package main import "fmt" var grid []byte var w, h, last int var cnt int var next [4]int var dir = [4][2]int{{0, -1}, {-1, 0}, {0, 1}, {1, 0}} func walk(y, x int) { if y == 0 || y == h || x == 0 || x == w { cnt += 2 return } t := y*(w+1) + x grid[t]++ grid[last-t]++ for i, d := range dir { if grid[t+next[i]] == 0 { walk(y+d[0], x+d[1]) } } grid[t]-- grid[last-t]-- } func solve(hh, ww, recur int) int { h = hh w = ww if h&1 != 0 { h, w = w, h } switch { case h&1 == 1: return 0 case w == 1: return 1 case w == 2: return h case h == 2: return w } cy := h / 2 cx := w / 2 grid = make([]byte, (h+1)*(w+1)) last = len(grid) - 1 next[0] = -1 next[1] = -w - 1 next[2] = 1 next[3] = w + 1 if recur != 0 { cnt = 0 } for x := cx + 1; x < w; x++ { t := cy*(w+1) + x grid[t] = 1 grid[last-t] = 1 walk(cy-1, x) } cnt++ if h == w { cnt *= 2 } else if w&1 == 0 && recur != 0 { solve(w, h, 0) } return cnt } func main() { for y := 1; y <= 10; y++ { for x := 1; x <= y; x++ { if x&1 == 0 || y&1 == 0 { fmt.Printf("%d x %d: %d\n", y, x, solve(y, x, 1)) } } } }
Preserve the algorithm and functionality while converting the code from C++ to Go.
#include <array> #include <iostream> #include <stack> #include <vector> const std::array<std::pair<int, int>, 4> DIRS = { std::make_pair(0, -1), std::make_pair(-1, 0), std::make_pair(0, 1), std::make_pair(1, 0), }; void printResult(const std::vector<std::vector<int>> &v) { for (auto &row : v) { auto it = row.cbegin(); auto end = row.cend(); std::cout << '['; if (it != end) { std::cout << *it; it = std::next(it); } while (it != end) { std::cout << ", " << *it; it = std::next(it); } std::cout << "]\n"; } } void cutRectangle(int w, int h) { if (w % 2 == 1 && h % 2 == 1) { return; } std::vector<std::vector<int>> grid(h, std::vector<int>(w)); std::stack<int> stack; int half = (w * h) / 2; long bits = (long)pow(2, half) - 1; for (; bits > 0; bits -= 2) { for (int i = 0; i < half; i++) { int r = i / w; int c = i % w; grid[r][c] = (bits & (1 << i)) != 0 ? 1 : 0; grid[h - r - 1][w - c - 1] = 1 - grid[r][c]; } stack.push(0); grid[0][0] = 2; int count = 1; while (!stack.empty()) { int pos = stack.top(); stack.pop(); int r = pos / w; int c = pos % w; for (auto dir : DIRS) { int nextR = r + dir.first; int nextC = c + dir.second; if (nextR >= 0 && nextR < h && nextC >= 0 && nextC < w) { if (grid[nextR][nextC] == 1) { stack.push(nextR * w + nextC); grid[nextR][nextC] = 2; count++; } } } } if (count == half) { printResult(grid); std::cout << '\n'; } } } int main() { cutRectangle(2, 2); cutRectangle(4, 3); return 0; }
package main import "fmt" var grid []byte var w, h, last int var cnt int var next [4]int var dir = [4][2]int{{0, -1}, {-1, 0}, {0, 1}, {1, 0}} func walk(y, x int) { if y == 0 || y == h || x == 0 || x == w { cnt += 2 return } t := y*(w+1) + x grid[t]++ grid[last-t]++ for i, d := range dir { if grid[t+next[i]] == 0 { walk(y+d[0], x+d[1]) } } grid[t]-- grid[last-t]-- } func solve(hh, ww, recur int) int { h = hh w = ww if h&1 != 0 { h, w = w, h } switch { case h&1 == 1: return 0 case w == 1: return 1 case w == 2: return h case h == 2: return w } cy := h / 2 cx := w / 2 grid = make([]byte, (h+1)*(w+1)) last = len(grid) - 1 next[0] = -1 next[1] = -w - 1 next[2] = 1 next[3] = w + 1 if recur != 0 { cnt = 0 } for x := cx + 1; x < w; x++ { t := cy*(w+1) + x grid[t] = 1 grid[last-t] = 1 walk(cy-1, x) } cnt++ if h == w { cnt *= 2 } else if w&1 == 0 && recur != 0 { solve(w, h, 0) } return cnt } func main() { for y := 1; y <= 10; y++ { for x := 1; x <= y; x++ { if x&1 == 0 || y&1 == 0 { fmt.Printf("%d x %d: %d\n", y, x, solve(y, x, 1)) } } } }
Write the same algorithm in Go as shown in this C++ implementation.
#include <iomanip> #include <iostream> #include <vector> std::vector<int> mertens_numbers(int max) { std::vector<int> m(max + 1, 1); for (int n = 2; n <= max; ++n) { for (int k = 2; k <= n; ++k) m[n] -= m[n / k]; } return m; } int main() { const int max = 1000; auto m(mertens_numbers(max)); std::cout << "First 199 Mertens numbers:\n"; for (int i = 0, column = 0; i < 200; ++i) { if (column > 0) std::cout << ' '; if (i == 0) std::cout << " "; else std::cout << std::setw(2) << m[i]; ++column; if (column == 20) { std::cout << '\n'; column = 0; } } int zero = 0, cross = 0, previous = 0; for (int i = 1; i <= max; ++i) { if (m[i] == 0) { ++zero; if (previous != 0) ++cross; } previous = m[i]; } std::cout << "M(n) is zero " << zero << " times for 1 <= n <= 1000.\n"; std::cout << "M(n) crosses zero " << cross << " times for 1 <= n <= 1000.\n"; return 0; }
package main import "fmt" func mertens(to int) ([]int, int, int) { if to < 1 { to = 1 } merts := make([]int, to+1) primes := []int{2} var sum, zeros, crosses int for i := 1; i <= to; i++ { j := i cp := 0 spf := false for _, p := range primes { if p > j { break } if j%p == 0 { j /= p cp++ } if j%p == 0 { spf = true break } } if cp == 0 && i > 2 { cp = 1 primes = append(primes, i) } if !spf { if cp%2 == 0 { sum++ } else { sum-- } } merts[i] = sum if sum == 0 { zeros++ if i > 1 && merts[i-1] != 0 { crosses++ } } } return merts, zeros, crosses } func main() { merts, zeros, crosses := mertens(1000) fmt.Println("Mertens sequence - First 199 terms:") for i := 0; i < 200; i++ { if i == 0 { fmt.Print(" ") continue } if i%20 == 0 { fmt.Println() } fmt.Printf("  % d", merts[i]) } fmt.Println("\n\nEquals zero", zeros, "times between 1 and 1000") fmt.Println("\nCrosses zero", crosses, "times between 1 and 1000") }
Produce a functionally identical Go code for the snippet given in C++.
#include <algorithm> #include <iostream> #include <vector> using namespace std; bool InteractiveCompare(const string& s1, const string& s2) { if(s1 == s2) return false; static int count = 0; string response; cout << "(" << ++count << ") Is " << s1 << " < " << s2 << "? "; getline(cin, response); return !response.empty() && response.front() == 'y'; } void PrintOrder(const vector<string>& items) { cout << "{ "; for(auto& item : items) cout << item << " "; cout << "}\n"; } int main() { const vector<string> items { "violet", "red", "green", "indigo", "blue", "yellow", "orange" }; vector<string> sortedItems; for(auto& item : items) { cout << "Inserting '" << item << "' into "; PrintOrder(sortedItems); auto spotToInsert = lower_bound(sortedItems.begin(), sortedItems.end(), item, InteractiveCompare); sortedItems.insert(spotToInsert, item); } PrintOrder(sortedItems); return 0; }
package main import ( "fmt" "sort" "strings" ) var count int = 0 func interactiveCompare(s1, s2 string) bool { count++ fmt.Printf("(%d) Is %s < %s? ", count, s1, s2) var response string _, err := fmt.Scanln(&response) return err == nil && strings.HasPrefix(response, "y") } func main() { items := []string{"violet", "red", "green", "indigo", "blue", "yellow", "orange"} var sortedItems []string for _, item := range items { fmt.Printf("Inserting '%s' into %s\n", item, sortedItems) spotToInsert := sort.Search(len(sortedItems), func(i int) bool { return interactiveCompare(item, sortedItems[i]) }) sortedItems = append(sortedItems[:spotToInsert], append([]string{item}, sortedItems[spotToInsert:]...)...) } fmt.Println(sortedItems) }
Can you help me rewrite this code in Go instead of C++, keeping it the same logically?
#include <cln/integer.h> #include <cln/integer_io.h> #include <iostream> #include <algorithm> #include <vector> #include <iomanip> #include <sstream> #include <string> #include <cstdlib> #include <cmath> #include <map> using namespace cln ; class NextNum { public : NextNum ( cl_I & a , cl_I & b ) : first( a ) , second ( b ) { } cl_I operator( )( ) { cl_I result = first + second ; first = second ; second = result ; return result ; } private : cl_I first ; cl_I second ; } ; void findFrequencies( const std::vector<cl_I> & fibos , std::map<int , int> &numberfrequencies ) { for ( cl_I bignumber : fibos ) { std::ostringstream os ; fprintdecimal ( os , bignumber ) ; int firstdigit = std::atoi( os.str( ).substr( 0 , 1 ).c_str( )) ; auto result = numberfrequencies.insert( std::make_pair( firstdigit , 1 ) ) ; if ( ! result.second ) numberfrequencies[ firstdigit ]++ ; } } int main( ) { std::vector<cl_I> fibonaccis( 1000 ) ; fibonaccis[ 0 ] = 0 ; fibonaccis[ 1 ] = 1 ; cl_I a = 0 ; cl_I b = 1 ; std::generate_n( fibonaccis.begin( ) + 2 , 998 , NextNum( a , b ) ) ; std::cout << std::endl ; std::map<int , int> frequencies ; findFrequencies( fibonaccis , frequencies ) ; std::cout << " found expected\n" ; for ( int i = 1 ; i < 10 ; i++ ) { double found = static_cast<double>( frequencies[ i ] ) / 1000 ; double expected = std::log10( 1 + 1 / static_cast<double>( i )) ; std::cout << i << " :" << std::setw( 16 ) << std::right << found * 100 << " %" ; std::cout.precision( 3 ) ; std::cout << std::setw( 26 ) << std::right << expected * 100 << " %\n" ; } return 0 ; }
package main import ( "fmt" "math" ) func Fib1000() []float64 { a, b, r := 0., 1., [1000]float64{} for i := range r { r[i], a, b = b, b, b+a } return r[:] } func main() { show(Fib1000(), "First 1000 Fibonacci numbers") } func show(c []float64, title string) { var f [9]int for _, v := range c { f[fmt.Sprintf("%g", v)[0]-'1']++ } fmt.Println(title) fmt.Println("Digit Observed Predicted") for i, n := range f { fmt.Printf(" %d %9.3f %8.3f\n", i+1, float64(n)/float64(len(c)), math.Log10(1+1/float64(i+1))) } }
Change the following C++ code into Go without altering its purpose.
#include <cln/integer.h> #include <cln/integer_io.h> #include <iostream> #include <algorithm> #include <vector> #include <iomanip> #include <sstream> #include <string> #include <cstdlib> #include <cmath> #include <map> using namespace cln ; class NextNum { public : NextNum ( cl_I & a , cl_I & b ) : first( a ) , second ( b ) { } cl_I operator( )( ) { cl_I result = first + second ; first = second ; second = result ; return result ; } private : cl_I first ; cl_I second ; } ; void findFrequencies( const std::vector<cl_I> & fibos , std::map<int , int> &numberfrequencies ) { for ( cl_I bignumber : fibos ) { std::ostringstream os ; fprintdecimal ( os , bignumber ) ; int firstdigit = std::atoi( os.str( ).substr( 0 , 1 ).c_str( )) ; auto result = numberfrequencies.insert( std::make_pair( firstdigit , 1 ) ) ; if ( ! result.second ) numberfrequencies[ firstdigit ]++ ; } } int main( ) { std::vector<cl_I> fibonaccis( 1000 ) ; fibonaccis[ 0 ] = 0 ; fibonaccis[ 1 ] = 1 ; cl_I a = 0 ; cl_I b = 1 ; std::generate_n( fibonaccis.begin( ) + 2 , 998 , NextNum( a , b ) ) ; std::cout << std::endl ; std::map<int , int> frequencies ; findFrequencies( fibonaccis , frequencies ) ; std::cout << " found expected\n" ; for ( int i = 1 ; i < 10 ; i++ ) { double found = static_cast<double>( frequencies[ i ] ) / 1000 ; double expected = std::log10( 1 + 1 / static_cast<double>( i )) ; std::cout << i << " :" << std::setw( 16 ) << std::right << found * 100 << " %" ; std::cout.precision( 3 ) ; std::cout << std::setw( 26 ) << std::right << expected * 100 << " %\n" ; } return 0 ; }
package main import ( "fmt" "math" ) func Fib1000() []float64 { a, b, r := 0., 1., [1000]float64{} for i := range r { r[i], a, b = b, b, b+a } return r[:] } func main() { show(Fib1000(), "First 1000 Fibonacci numbers") } func show(c []float64, title string) { var f [9]int for _, v := range c { f[fmt.Sprintf("%g", v)[0]-'1']++ } fmt.Println(title) fmt.Println("Digit Observed Predicted") for i, n := range f { fmt.Printf(" %d %9.3f %8.3f\n", i+1, float64(n)/float64(len(c)), math.Log10(1+1/float64(i+1))) } }
Write a version of this C++ function in Go with identical behavior.
#include <iostream> #include <string> #include <windows.h> using namespace std; class bells { public: void start() { watch[0] = "Middle"; watch[1] = "Morning"; watch[2] = "Forenoon"; watch[3] = "Afternoon"; watch[4] = "Dog"; watch[5] = "First"; count[0] = "One"; count[1] = "Two"; count[2] = "Three"; count[3] = "Four"; count[4] = "Five"; count[5] = "Six"; count[6] = "Seven"; count[7] = "Eight"; _inst = this; CreateThread( NULL, 0, bell, NULL, 0, NULL ); } private: static DWORD WINAPI bell( LPVOID p ) { DWORD wait = _inst->waitTime(); while( true ) { Sleep( wait ); _inst->playBell(); wait = _inst->waitTime(); } return 0; } DWORD waitTime() { GetLocalTime( &st ); int m = st.wMinute >= 30 ? st.wMinute - 30 : st.wMinute; return( 1800000 - ( ( m * 60 + st.wSecond ) * 1000 + st.wMilliseconds ) ); } void playBell() { GetLocalTime( &st ); int b = ( 2 * st.wHour + st.wMinute / 30 ) % 8; b = b == 0 ? 8 : b; int w = ( 60 * st.wHour + st.wMinute ); if( w < 1 ) w = 5; else w = ( w - 1 ) / 240; char hr[32]; wsprintf( hr, "%.2d:%.2d", st.wHour, st.wMinute ); cout << hr << " - " << watch[w] << " watch - " << count[b - 1] << " Bell"; if( b > 1 ) cout << "s"; else cout << " "; cout << " Gone." << endl; for( int x = 0, c = 1; x < b; x++, c++ ) { cout << "\7"; Sleep( 500 ); if( !( c % 2 ) ) Sleep( 300 ); } } SYSTEMTIME st; string watch[7], count[8]; static bells* _inst; }; bells* bells::_inst = 0; int main( int argc, char* argv[] ) { bells b; b.start(); while( 1 ); return 0; }
package main import ( "fmt" "strings" "time" ) func main() { watches := []string{ "First", "Middle", "Morning", "Forenoon", "Afternoon", "Dog", "First", } for { t := time.Now() h := t.Hour() m := t.Minute() s := t.Second() if (m == 0 || m == 30) && s == 0 { bell := 0 if m == 30 { bell = 1 } bells := (h*2 + bell) % 8 watch := h/4 + 1 if bells == 0 { bells = 8 watch-- } sound := strings.Repeat("\a", bells) pl := "s" if bells == 1 { pl = " " } w := watches[watch] + " watch" if watch == 5 { if bells < 5 { w = "First " + w } else { w = "Last " + w } } fmt.Printf("%s%02d:%02d = %d bell%s : %s\n", sound, h, m, bells, pl, w) } time.Sleep(1 * time.Second) } }
Convert the following code from C++ to Go, ensuring the logic remains intact.
#include <iostream> #include <string> #include <windows.h> using namespace std; class bells { public: void start() { watch[0] = "Middle"; watch[1] = "Morning"; watch[2] = "Forenoon"; watch[3] = "Afternoon"; watch[4] = "Dog"; watch[5] = "First"; count[0] = "One"; count[1] = "Two"; count[2] = "Three"; count[3] = "Four"; count[4] = "Five"; count[5] = "Six"; count[6] = "Seven"; count[7] = "Eight"; _inst = this; CreateThread( NULL, 0, bell, NULL, 0, NULL ); } private: static DWORD WINAPI bell( LPVOID p ) { DWORD wait = _inst->waitTime(); while( true ) { Sleep( wait ); _inst->playBell(); wait = _inst->waitTime(); } return 0; } DWORD waitTime() { GetLocalTime( &st ); int m = st.wMinute >= 30 ? st.wMinute - 30 : st.wMinute; return( 1800000 - ( ( m * 60 + st.wSecond ) * 1000 + st.wMilliseconds ) ); } void playBell() { GetLocalTime( &st ); int b = ( 2 * st.wHour + st.wMinute / 30 ) % 8; b = b == 0 ? 8 : b; int w = ( 60 * st.wHour + st.wMinute ); if( w < 1 ) w = 5; else w = ( w - 1 ) / 240; char hr[32]; wsprintf( hr, "%.2d:%.2d", st.wHour, st.wMinute ); cout << hr << " - " << watch[w] << " watch - " << count[b - 1] << " Bell"; if( b > 1 ) cout << "s"; else cout << " "; cout << " Gone." << endl; for( int x = 0, c = 1; x < b; x++, c++ ) { cout << "\7"; Sleep( 500 ); if( !( c % 2 ) ) Sleep( 300 ); } } SYSTEMTIME st; string watch[7], count[8]; static bells* _inst; }; bells* bells::_inst = 0; int main( int argc, char* argv[] ) { bells b; b.start(); while( 1 ); return 0; }
package main import ( "fmt" "strings" "time" ) func main() { watches := []string{ "First", "Middle", "Morning", "Forenoon", "Afternoon", "Dog", "First", } for { t := time.Now() h := t.Hour() m := t.Minute() s := t.Second() if (m == 0 || m == 30) && s == 0 { bell := 0 if m == 30 { bell = 1 } bells := (h*2 + bell) % 8 watch := h/4 + 1 if bells == 0 { bells = 8 watch-- } sound := strings.Repeat("\a", bells) pl := "s" if bells == 1 { pl = " " } w := watches[watch] + " watch" if watch == 5 { if bells < 5 { w = "First " + w } else { w = "Last " + w } } fmt.Printf("%s%02d:%02d = %d bell%s : %s\n", sound, h, m, bells, pl, w) } time.Sleep(1 * time.Second) } }
Generate an equivalent Go version of this C++ code.
double fib(double n) { if(n < 0) { throw "Invalid argument passed to fib"; } else { struct actual_fib { static double calc(double n) { if(n < 2) { return n; } else { return calc(n-1) + calc(n-2); } } }; return actual_fib::calc(n); } }
package main import "fmt" func main() { for _, n := range []int{0, 1, 2, 3, 4, 5, 10, 40, -1} { f, ok := arFib(n) if ok { fmt.Printf("fib %d = %d\n", n, f) } else { fmt.Println("fib undefined for negative numbers") } } } func arFib(n int) (int, bool) { switch { case n < 0: return 0, false case n < 2: return n, true } return yc(func(recurse fn) fn { return func(left, term1, term2 int) int { if left == 0 { return term1+term2 } return recurse(left-1, term1+term2, term1) } })(n-2, 1, 0), true } type fn func(int, int, int) int type ff func(fn) fn type fx func(fx) fn func yc(f ff) fn { return func(x fx) fn { return x(x) }(func(x fx) fn { return f(func(a1, a2, a3 int) int { return x(x)(a1, a2, a3) }) }) }
Preserve the algorithm and functionality while converting the code from C++ to Go.
#include <windows.h> #include <ctime> #include <iostream> #include <string> const int WID = 60, HEI = 30, MAX_LEN = 600; enum DIR { NORTH, EAST, SOUTH, WEST }; class snake { public: snake() { console = GetStdHandle( STD_OUTPUT_HANDLE ); SetConsoleTitle( "Snake" ); COORD coord = { WID + 1, HEI + 2 }; SetConsoleScreenBufferSize( console, coord ); SMALL_RECT rc = { 0, 0, WID, HEI + 1 }; SetConsoleWindowInfo( console, TRUE, &rc ); CONSOLE_CURSOR_INFO ci = { 1, false }; SetConsoleCursorInfo( console, &ci ); } void play() { std::string a; while( 1 ) { createField(); alive = true; while( alive ) { drawField(); readKey(); moveSnake(); Sleep( 50 ); } COORD c = { 0, HEI + 1 }; SetConsoleCursorPosition( console, c ); SetConsoleTextAttribute( console, 0x000b ); std::cout << "Play again [Y/N]? "; std::cin >> a; if( a.at( 0 ) != 'Y' && a.at( 0 ) != 'y' ) return; } } private: void createField() { COORD coord = { 0, 0 }; DWORD c; FillConsoleOutputCharacter( console, ' ', ( HEI + 2 ) * 80, coord, &c ); FillConsoleOutputAttribute( console, 0x0000, ( HEI + 2 ) * 80, coord, &c ); SetConsoleCursorPosition( console, coord ); int x = 0, y = 1; for( ; x < WID * HEI; x++ ) brd[x] = 0; for( x = 0; x < WID; x++ ) { brd[x] = brd[x + WID * ( HEI - 1 )] = '+'; } for( ; y < HEI; y++ ) { brd[0 + WID * y] = brd[WID - 1 + WID * y] = '+'; } do { x = rand() % WID; y = rand() % ( HEI >> 1 ) + ( HEI >> 1 ); } while( brd[x + WID * y] ); brd[x + WID * y] = '@'; tailIdx = 0; headIdx = 4; x = 3; y = 2; for( int c = tailIdx; c < headIdx; c++ ) { brd[x + WID * y] = '#'; snk[c].X = 3 + c; snk[c].Y = 2; } head = snk[3]; dir = EAST; points = 0; } void readKey() { if( GetAsyncKeyState( 39 ) & 0x8000 ) dir = EAST; if( GetAsyncKeyState( 37 ) & 0x8000 ) dir = WEST; if( GetAsyncKeyState( 38 ) & 0x8000 ) dir = NORTH; if( GetAsyncKeyState( 40 ) & 0x8000 ) dir = SOUTH; } void drawField() { COORD coord; char t; for( int y = 0; y < HEI; y++ ) { coord.Y = y; for( int x = 0; x < WID; x++ ) { t = brd[x + WID * y]; if( !t ) continue; coord.X = x; SetConsoleCursorPosition( console, coord ); if( coord.X == head.X && coord.Y == head.Y ) { SetConsoleTextAttribute( console, 0x002e ); std::cout << 'O'; SetConsoleTextAttribute( console, 0x0000 ); continue; } switch( t ) { case '#': SetConsoleTextAttribute( console, 0x002a ); break; case '+': SetConsoleTextAttribute( console, 0x0019 ); break; case '@': SetConsoleTextAttribute( console, 0x004c ); break; } std::cout << t; SetConsoleTextAttribute( console, 0x0000 ); } } std::cout << t; SetConsoleTextAttribute( console, 0x0007 ); COORD c = { 0, HEI }; SetConsoleCursorPosition( console, c ); std::cout << "Points: " << points; } void moveSnake() { switch( dir ) { case NORTH: head.Y--; break; case EAST: head.X++; break; case SOUTH: head.Y++; break; case WEST: head.X--; break; } char t = brd[head.X + WID * head.Y]; if( t && t != '@' ) { alive = false; return; } brd[head.X + WID * head.Y] = '#'; snk[headIdx].X = head.X; snk[headIdx].Y = head.Y; if( ++headIdx >= MAX_LEN ) headIdx = 0; if( t == '@' ) { points++; int x, y; do { x = rand() % WID; y = rand() % ( HEI >> 1 ) + ( HEI >> 1 ); } while( brd[x + WID * y] ); brd[x + WID * y] = '@'; return; } SetConsoleCursorPosition( console, snk[tailIdx] ); std::cout << ' '; brd[snk[tailIdx].X + WID * snk[tailIdx].Y] = 0; if( ++tailIdx >= MAX_LEN ) tailIdx = 0; } bool alive; char brd[WID * HEI]; HANDLE console; DIR dir; COORD snk[MAX_LEN]; COORD head; int tailIdx, headIdx, points; }; int main( int argc, char* argv[] ) { srand( static_cast<unsigned>( time( NULL ) ) ); snake s; s.play(); return 0; }
package main import ( "errors" "fmt" "log" "math/rand" "time" termbox "github.com/nsf/termbox-go" ) func main() { rand.Seed(time.Now().UnixNano()) score, err := playSnake() if err != nil { log.Fatal(err) } fmt.Println("Final score:", score) } type snake struct { body []position heading direction width, height int cells []termbox.Cell } type position struct { X int Y int } type direction int const ( North direction = iota East South West ) func (p position) next(d direction) position { switch d { case North: p.Y-- case East: p.X++ case South: p.Y++ case West: p.X-- } return p } func playSnake() (int, error) { err := termbox.Init() if err != nil { return 0, err } defer termbox.Close() termbox.Clear(fg, bg) termbox.HideCursor() s := &snake{ body: make([]position, 0, 32), cells: termbox.CellBuffer(), } s.width, s.height = termbox.Size() s.drawBorder() s.startSnake() s.placeFood() s.flush() moveCh, errCh := s.startEventLoop() const delay = 125 * time.Millisecond for t := time.NewTimer(delay); ; t.Reset(delay) { var move direction select { case err = <-errCh: return len(s.body), err case move = <-moveCh: if !t.Stop() { <-t.C } case <-t.C: move = s.heading } if s.doMove(move) { time.Sleep(1 * time.Second) break } } return len(s.body), err } func (s *snake) startEventLoop() (<-chan direction, <-chan error) { moveCh := make(chan direction) errCh := make(chan error, 1) go func() { defer close(errCh) for { switch ev := termbox.PollEvent(); ev.Type { case termbox.EventKey: switch ev.Ch { case 'w', 'W', 'k', 'K': moveCh <- North case 'a', 'A', 'h', 'H': moveCh <- West case 's', 'S', 'j', 'J': moveCh <- South case 'd', 'D', 'l', 'L': moveCh <- East case 0: switch ev.Key { case termbox.KeyArrowUp: moveCh <- North case termbox.KeyArrowDown: moveCh <- South case termbox.KeyArrowLeft: moveCh <- West case termbox.KeyArrowRight: moveCh <- East case termbox.KeyEsc: return } } case termbox.EventResize: errCh <- errors.New("terminal resizing unsupported") return case termbox.EventError: errCh <- ev.Err return case termbox.EventInterrupt: return } } }() return moveCh, errCh } func (s *snake) flush() { termbox.Flush() s.cells = termbox.CellBuffer() } func (s *snake) getCellRune(p position) rune { i := p.Y*s.width + p.X return s.cells[i].Ch } func (s *snake) setCell(p position, c termbox.Cell) { i := p.Y*s.width + p.X s.cells[i] = c } func (s *snake) drawBorder() { for x := 0; x < s.width; x++ { s.setCell(position{x, 0}, border) s.setCell(position{x, s.height - 1}, border) } for y := 0; y < s.height-1; y++ { s.setCell(position{0, y}, border) s.setCell(position{s.width - 1, y}, border) } } func (s *snake) placeFood() { for { x := rand.Intn(s.width-2) + 1 y := rand.Intn(s.height-2) + 1 foodp := position{x, y} r := s.getCellRune(foodp) if r != ' ' { continue } s.setCell(foodp, food) return } } func (s *snake) startSnake() { x := rand.Intn(s.width/2) + s.width/4 y := rand.Intn(s.height/2) + s.height/4 head := position{x, y} s.setCell(head, snakeHead) s.body = append(s.body[:0], head) s.heading = direction(rand.Intn(4)) } func (s *snake) doMove(move direction) bool { head := s.body[len(s.body)-1] s.setCell(head, snakeBody) head = head.next(move) s.heading = move s.body = append(s.body, head) r := s.getCellRune(head) s.setCell(head, snakeHead) gameOver := false switch r { case food.Ch: s.placeFood() case border.Ch, snakeBody.Ch: gameOver = true fallthrough case empty.Ch: s.setCell(s.body[0], empty) s.body = s.body[1:] default: panic(r) } s.flush() return gameOver } const ( fg = termbox.ColorWhite bg = termbox.ColorBlack ) var ( empty = termbox.Cell{Ch: ' ', Bg: bg, Fg: fg} border = termbox.Cell{Ch: '+', Bg: bg, Fg: termbox.ColorBlue} snakeBody = termbox.Cell{Ch: '#', Bg: bg, Fg: termbox.ColorGreen} snakeHead = termbox.Cell{Ch: 'O', Bg: bg, Fg: termbox.ColorYellow | termbox.AttrBold} food = termbox.Cell{Ch: '@', Bg: bg, Fg: termbox.ColorRed} )
Can you help me rewrite this code in Go instead of C++, keeping it the same logically?
#include <string> #include <iostream> int main( ) { std::string word( "Premier League" ) ; std::cout << "Without first letter: " << word.substr( 1 ) << " !\n" ; std::cout << "Without last letter: " << word.substr( 0 , word.length( ) - 1 ) << " !\n" ; std::cout << "Without first and last letter: " << word.substr( 1 , word.length( ) - 2 ) << " !\n" ; return 0 ; }
package main import ( "fmt" "unicode/utf8" ) func main() { s := "ASCII" fmt.Println("String: ", s) fmt.Println("First byte removed: ", s[1:]) fmt.Println("Last byte removed: ", s[:len(s)-1]) fmt.Println("First and last removed:", s[1:len(s)-1]) u := "Δημοτική" fmt.Println("String: ", u) _, sizeFirst := utf8.DecodeRuneInString(u) fmt.Println("First rune removed: ", u[sizeFirst:]) _, sizeLast := utf8.DecodeLastRuneInString(u) fmt.Println("Last rune removed: ", u[:len(u)-sizeLast]) fmt.Println("First and last removed:", u[sizeFirst:len(u)-sizeLast]) }
Write the same code in Go as shown below in C++.
#include <string> #include <iostream> int main( ) { std::string word( "Premier League" ) ; std::cout << "Without first letter: " << word.substr( 1 ) << " !\n" ; std::cout << "Without last letter: " << word.substr( 0 , word.length( ) - 1 ) << " !\n" ; std::cout << "Without first and last letter: " << word.substr( 1 , word.length( ) - 2 ) << " !\n" ; return 0 ; }
package main import ( "fmt" "unicode/utf8" ) func main() { s := "ASCII" fmt.Println("String: ", s) fmt.Println("First byte removed: ", s[1:]) fmt.Println("Last byte removed: ", s[:len(s)-1]) fmt.Println("First and last removed:", s[1:len(s)-1]) u := "Δημοτική" fmt.Println("String: ", u) _, sizeFirst := utf8.DecodeRuneInString(u) fmt.Println("First rune removed: ", u[sizeFirst:]) _, sizeLast := utf8.DecodeLastRuneInString(u) fmt.Println("Last rune removed: ", u[:len(u)-sizeLast]) fmt.Println("First and last removed:", u[sizeFirst:len(u)-sizeLast]) }
Convert this C++ snippet to Go and keep its semantics consistent.
#include <string> #include <iostream> int main( ) { std::string word( "Premier League" ) ; std::cout << "Without first letter: " << word.substr( 1 ) << " !\n" ; std::cout << "Without last letter: " << word.substr( 0 , word.length( ) - 1 ) << " !\n" ; std::cout << "Without first and last letter: " << word.substr( 1 , word.length( ) - 2 ) << " !\n" ; return 0 ; }
package main import ( "fmt" "unicode/utf8" ) func main() { s := "ASCII" fmt.Println("String: ", s) fmt.Println("First byte removed: ", s[1:]) fmt.Println("Last byte removed: ", s[:len(s)-1]) fmt.Println("First and last removed:", s[1:len(s)-1]) u := "Δημοτική" fmt.Println("String: ", u) _, sizeFirst := utf8.DecodeRuneInString(u) fmt.Println("First rune removed: ", u[sizeFirst:]) _, sizeLast := utf8.DecodeLastRuneInString(u) fmt.Println("Last rune removed: ", u[:len(u)-sizeLast]) fmt.Println("First and last removed:", u[sizeFirst:len(u)-sizeLast]) }
Please provide an equivalent version of this C++ code in Go.
#include <cmath> #include <iostream> #include <vector> std::vector<int> generate_primes(int limit) { std::vector<bool> sieve(limit >> 1, true); for (int p = 3, s = 9; s < limit; p += 2) { if (sieve[p >> 1]) { for (int q = s; q < limit; q += p << 1) sieve[q >> 1] = false; } s += (p + 1) << 2; } std::vector<int> primes; if (limit > 2) primes.push_back(2); for (int i = 1; i < sieve.size(); ++i) { if (sieve[i]) primes.push_back((i << 1) + 1); } return primes; } class legendre_prime_counter { public: explicit legendre_prime_counter(int limit); int prime_count(int n); private: int phi(int x, int a); std::vector<int> primes; }; legendre_prime_counter::legendre_prime_counter(int limit) : primes(generate_primes(static_cast<int>(std::sqrt(limit)))) {} int legendre_prime_counter::prime_count(int n) { if (n < 2) return 0; int a = prime_count(static_cast<int>(std::sqrt(n))); return phi(n, a) + a - 1; } int legendre_prime_counter::phi(int x, int a) { if (a == 0) return x; if (a == 1) return x - (x >> 1); int pa = primes[a - 1]; if (x <= pa) return 1; return phi(x, a - 1) - phi(x / pa, a - 1); } int main() { legendre_prime_counter counter(1000000000); for (int i = 0, n = 1; i < 10; ++i, n *= 10) std::cout << "10^" << i << "\t" << counter.prime_count(n) << '\n'; }
package main import ( "fmt" "log" "math" "rcu" ) func cantorPair(x, y int) int { if x < 0 || y < 0 { log.Fatal("Arguments must be non-negative integers.") } return (x*x + 3*x + 2*x*y + y + y*y) / 2 } func pi(n int) int { if n < 2 { return 0 } if n == 2 { return 1 } primes := rcu.Primes(int(math.Sqrt(float64(n)))) a := len(primes) memoPhi := make(map[int]int) var phi func(x, a int) int phi = func(x, a int) int { if a < 1 { return x } if a == 1 { return x - (x >> 1) } pa := primes[a-1] if x <= pa { return 1 } key := cantorPair(x, a) if v, ok := memoPhi[key]; ok { return v } memoPhi[key] = phi(x, a-1) - phi(x/pa, a-1) return memoPhi[key] } return phi(n, a) + a - 1 } func main() { for i, n := 0, 1; i <= 9; i, n = i+1, n*10 { fmt.Printf("10^%d %d\n", i, pi(n)) } }
Preserve the algorithm and functionality while converting the code from C++ to Go.
#include <string> using std::string; extern "C" int Query (char *Data, size_t *Length) { const string Message = "Here am I"; if (*Length < Message.length()) return false; *Length = Message.length(); Message.copy(Data, *Length); return true; }
package main import "C" import "unsafe" func main() { C.Run() } const msg = "Here am I" func Query(cbuf *C.char, csiz *C.size_t) C.int { if int(*csiz) <= len(msg) { return 0 } pbuf := uintptr(unsafe.Pointer(cbuf)) for i := 0; i < len(msg); i++ { *((*byte)(unsafe.Pointer(pbuf))) = msg[i] pbuf++ } *((*byte)(unsafe.Pointer(pbuf))) = 0 *csiz = C.size_t(len(msg) + 1) return 1 }
Change the programming language of this snippet from C++ to Go without modifying what it does.
#include <iostream> #include <string.h> int main() { std::string longLine, longestLines, newLine; while (std::cin >> newLine) { auto isNewLineShorter = longLine.c_str(); auto isLongLineShorter = newLine.c_str(); while (*isNewLineShorter && *isLongLineShorter) { isNewLineShorter = &isNewLineShorter[1]; isLongLineShorter = &isLongLineShorter[1]; } if(*isNewLineShorter) continue; if(*isLongLineShorter) { longLine = newLine; longestLines = newLine; } else { longestLines+=newLine; } longestLines+="\n"; } std::cout << "\nLongest string:\n" << longestLines; }
package main import ( "bufio" "os" ) func main() { in := bufio.NewReader(os.Stdin) var blankLine = "\n" var printLongest func(string) string printLongest = func(candidate string) (longest string) { longest = candidate s, err := in.ReadString('\n') defer func() { recover() defer func() { recover() }() _ = blankLine[0] func() { defer func() { recover() }() _ = s[len(longest)] longest = s }() longest = printLongest(longest) func() { defer func() { recover() os.Stdout.WriteString(s) }() _ = longest[len(s)] s = "" }() }() _ = err.(error) os.Stdout.WriteString(blankLine) blankLine = "" return } printLongest("") }
Maintain the same structure and functionality when rewriting this code in Go.
#include <vector> #include <string> #include <iostream> #include <algorithm> #include <fstream> #include <iomanip> typedef unsigned int uint; using namespace std; const uint TAPE_MAX_LEN = 49152; struct action { char write, direction; }; class tape { public: tape( uint startPos = TAPE_MAX_LEN >> 1 ) : MAX_LEN( TAPE_MAX_LEN ) { _sp = startPos; reset(); } void reset() { clear( '0' ); headPos = _sp; } char read(){ return _t[headPos]; } void input( string a ){ if( a == "" ) return; for( uint s = 0; s < a.length(); s++ ) _t[headPos + s] = a[s]; } void clear( char c ) { _t.clear(); blk = c; _t.resize( MAX_LEN, blk ); } void action( const action* a ) { write( a->write ); move( a->direction ); } void print( int c = 10 ) { int ml = static_cast<int>( MAX_LEN ), st = static_cast<int>( headPos ) - c, ed = static_cast<int>( headPos ) + c + 1, tx; for( int x = st; x < ed; x++ ) { tx = x; if( tx < 0 ) tx += ml; if( tx >= ml ) tx -= ml; cout << _t[tx]; } cout << endl << setw( c + 1 ) << "^" << endl; } private: void move( char d ) { if( d == 'N' ) return; headPos += d == 'R' ? 1 : -1; if( headPos >= MAX_LEN ) headPos = d == 'R' ? 0 : MAX_LEN - 1; } void write( char a ) { if( a != 'N' ) { if( a == 'B' ) _t[headPos] = blk; else _t[headPos] = a; } } string _t; uint headPos, _sp; char blk; const uint MAX_LEN; }; class state { public: bool operator ==( const string o ) { return o == name; } string name, next; char symbol, write, direction; }; class actionTable { public: bool loadTable( string file ) { reset(); ifstream mf; mf.open( file.c_str() ); if( mf.is_open() ) { string str; state stt; while( mf.good() ) { getline( mf, str ); if( str[0] == '\'' ) break; parseState( str, stt ); states.push_back( stt ); } while( mf.good() ) { getline( mf, str ); if( str == "" ) continue; if( str[0] == '!' ) blank = str.erase( 0, 1 )[0]; if( str[0] == '^' ) curState = str.erase( 0, 1 ); if( str[0] == '>' ) input = str.erase( 0, 1 ); } mf.close(); return true; } cout << "Could not open " << file << endl; return false; } bool action( char symbol, action& a ) { vector<state>::iterator f = states.begin(); while( true ) { f = find( f, states.end(), curState ); if( f == states.end() ) return false; if( ( *f ).symbol == '*' || ( *f ).symbol == symbol || ( ( *f ).symbol == 'B' && blank == symbol ) ) { a.direction = ( *f ).direction; a.write = ( *f ).write; curState = ( *f ).next; break; } f++; } return true; } void reset() { states.clear(); blank = '0'; curState = input = ""; } string getInput() { return input; } char getBlank() { return blank; } private: void parseState( string str, state& stt ) { string a[5]; int idx = 0; for( string::iterator si = str.begin(); si != str.end(); si++ ) { if( ( *si ) == ';' ) idx++; else a[idx].append( &( *si ), 1 ); } stt.name = a[0]; stt.symbol = a[1][0]; stt.write = a[2][0]; stt.direction = a[3][0]; stt.next = a[4]; } vector<state> states; char blank; string curState, input; }; class utm { public: utm() { files[0] = "incrementer.utm"; files[1] = "busy_beaver.utm"; files[2] = "sort.utm"; } void start() { while( true ) { reset(); int t = showMenu(); if( t == 0 ) return; if( !at.loadTable( files[t - 1] ) ) return; startMachine(); } } private: void simulate() { char r; action a; while( true ) { tp.print(); r = tp.read(); if( !( at.action( r, a ) ) ) break; tp.action( &a ); } cout << endl << endl; system( "pause" ); } int showMenu() { int t = -1; while( t < 0 || t > 3 ) { system( "cls" ); cout << "1. Incrementer\n2. Busy beaver\n3. Sort\n\n0. Quit"; cout << endl << endl << "Choose an action "; cin >> t; } return t; } void reset() { tp.reset(); at.reset(); } void startMachine() { system( "cls" ); tp.clear( at.getBlank() ); tp.input( at.getInput() ); simulate(); } tape tp; actionTable at; string files[7]; }; int main( int a, char* args[] ){ utm mm; mm.start(); return 0; }
package turing type Symbol byte type Motion byte const ( Left Motion = 'L' Right Motion = 'R' Stay Motion = 'N' ) type Tape struct { data []Symbol pos, left int blank Symbol } func NewTape(blank Symbol, start int, data []Symbol) *Tape { t := &Tape{ data: data, blank: blank, } if start < 0 { t.Left(-start) } t.Right(start) return t } func (t *Tape) Stay() {} func (t *Tape) Data() []Symbol { return t.data[t.left:] } func (t *Tape) Read() Symbol { return t.data[t.pos] } func (t *Tape) Write(s Symbol) { t.data[t.pos] = s } func (t *Tape) Dup() *Tape { t2 := &Tape{ data: make([]Symbol, len(t.Data())), blank: t.blank, } copy(t2.data, t.Data()) t2.pos = t.pos - t.left return t2 } func (t *Tape) String() string { s := "" for i := t.left; i < len(t.data); i++ { b := t.data[i] if i == t.pos { s += "[" + string(b) + "]" } else { s += " " + string(b) + " " } } return s } func (t *Tape) Move(a Motion) { switch a { case Left: t.Left(1) case Right: t.Right(1) case Stay: t.Stay() } } const minSz = 16 func (t *Tape) Left(n int) { t.pos -= n if t.pos < 0 { var sz int for sz = minSz; cap(t.data[t.left:])-t.pos >= sz; sz <<= 1 { } newd := make([]Symbol, sz) newl := len(newd) - cap(t.data[t.left:]) n := copy(newd[newl:], t.data[t.left:]) t.data = newd[:newl+n] t.pos += newl - t.left t.left = newl } if t.pos < t.left { if t.blank != 0 { for i := t.pos; i < t.left; i++ { t.data[i] = t.blank } } t.left = t.pos } } func (t *Tape) Right(n int) { t.pos += n if t.pos >= cap(t.data) { var sz int for sz = minSz; t.pos >= sz; sz <<= 1 { } newd := make([]Symbol, sz) n := copy(newd[t.left:], t.data[t.left:]) t.data = newd[:t.left+n] } if i := len(t.data); t.pos >= i { t.data = t.data[:t.pos+1] if t.blank != 0 { for ; i < len(t.data); i++ { t.data[i] = t.blank } } } } type State string type Rule struct { State Symbol Write Symbol Motion Next State } func (i *Rule) key() key { return key{i.State, i.Symbol} } func (i *Rule) action() action { return action{i.Write, i.Motion, i.Next} } type key struct { State Symbol } type action struct { write Symbol Motion next State } type Machine struct { tape *Tape start, state State transition map[key]action l func(string, ...interface{}) } func NewMachine(rules []Rule) *Machine { m := &Machine{transition: make(map[key]action, len(rules))} if len(rules) > 0 { m.start = rules[0].State } for _, r := range rules { m.transition[r.key()] = r.action() } return m } func (m *Machine) Run(input *Tape) (int, *Tape) { m.tape = input.Dup() m.state = m.start for cnt := 0; ; cnt++ { if m.l != nil { m.l("%3d %4s: %v\n", cnt, m.state, m.tape) } sym := m.tape.Read() act, ok := m.transition[key{m.state, sym}] if !ok { return cnt, m.tape } m.tape.Write(act.write) m.tape.Move(act.Motion) m.state = act.next } }
Change the following C++ code into Go without altering its purpose.
#include <vector> #include <string> #include <iostream> #include <algorithm> #include <fstream> #include <iomanip> typedef unsigned int uint; using namespace std; const uint TAPE_MAX_LEN = 49152; struct action { char write, direction; }; class tape { public: tape( uint startPos = TAPE_MAX_LEN >> 1 ) : MAX_LEN( TAPE_MAX_LEN ) { _sp = startPos; reset(); } void reset() { clear( '0' ); headPos = _sp; } char read(){ return _t[headPos]; } void input( string a ){ if( a == "" ) return; for( uint s = 0; s < a.length(); s++ ) _t[headPos + s] = a[s]; } void clear( char c ) { _t.clear(); blk = c; _t.resize( MAX_LEN, blk ); } void action( const action* a ) { write( a->write ); move( a->direction ); } void print( int c = 10 ) { int ml = static_cast<int>( MAX_LEN ), st = static_cast<int>( headPos ) - c, ed = static_cast<int>( headPos ) + c + 1, tx; for( int x = st; x < ed; x++ ) { tx = x; if( tx < 0 ) tx += ml; if( tx >= ml ) tx -= ml; cout << _t[tx]; } cout << endl << setw( c + 1 ) << "^" << endl; } private: void move( char d ) { if( d == 'N' ) return; headPos += d == 'R' ? 1 : -1; if( headPos >= MAX_LEN ) headPos = d == 'R' ? 0 : MAX_LEN - 1; } void write( char a ) { if( a != 'N' ) { if( a == 'B' ) _t[headPos] = blk; else _t[headPos] = a; } } string _t; uint headPos, _sp; char blk; const uint MAX_LEN; }; class state { public: bool operator ==( const string o ) { return o == name; } string name, next; char symbol, write, direction; }; class actionTable { public: bool loadTable( string file ) { reset(); ifstream mf; mf.open( file.c_str() ); if( mf.is_open() ) { string str; state stt; while( mf.good() ) { getline( mf, str ); if( str[0] == '\'' ) break; parseState( str, stt ); states.push_back( stt ); } while( mf.good() ) { getline( mf, str ); if( str == "" ) continue; if( str[0] == '!' ) blank = str.erase( 0, 1 )[0]; if( str[0] == '^' ) curState = str.erase( 0, 1 ); if( str[0] == '>' ) input = str.erase( 0, 1 ); } mf.close(); return true; } cout << "Could not open " << file << endl; return false; } bool action( char symbol, action& a ) { vector<state>::iterator f = states.begin(); while( true ) { f = find( f, states.end(), curState ); if( f == states.end() ) return false; if( ( *f ).symbol == '*' || ( *f ).symbol == symbol || ( ( *f ).symbol == 'B' && blank == symbol ) ) { a.direction = ( *f ).direction; a.write = ( *f ).write; curState = ( *f ).next; break; } f++; } return true; } void reset() { states.clear(); blank = '0'; curState = input = ""; } string getInput() { return input; } char getBlank() { return blank; } private: void parseState( string str, state& stt ) { string a[5]; int idx = 0; for( string::iterator si = str.begin(); si != str.end(); si++ ) { if( ( *si ) == ';' ) idx++; else a[idx].append( &( *si ), 1 ); } stt.name = a[0]; stt.symbol = a[1][0]; stt.write = a[2][0]; stt.direction = a[3][0]; stt.next = a[4]; } vector<state> states; char blank; string curState, input; }; class utm { public: utm() { files[0] = "incrementer.utm"; files[1] = "busy_beaver.utm"; files[2] = "sort.utm"; } void start() { while( true ) { reset(); int t = showMenu(); if( t == 0 ) return; if( !at.loadTable( files[t - 1] ) ) return; startMachine(); } } private: void simulate() { char r; action a; while( true ) { tp.print(); r = tp.read(); if( !( at.action( r, a ) ) ) break; tp.action( &a ); } cout << endl << endl; system( "pause" ); } int showMenu() { int t = -1; while( t < 0 || t > 3 ) { system( "cls" ); cout << "1. Incrementer\n2. Busy beaver\n3. Sort\n\n0. Quit"; cout << endl << endl << "Choose an action "; cin >> t; } return t; } void reset() { tp.reset(); at.reset(); } void startMachine() { system( "cls" ); tp.clear( at.getBlank() ); tp.input( at.getInput() ); simulate(); } tape tp; actionTable at; string files[7]; }; int main( int a, char* args[] ){ utm mm; mm.start(); return 0; }
package turing type Symbol byte type Motion byte const ( Left Motion = 'L' Right Motion = 'R' Stay Motion = 'N' ) type Tape struct { data []Symbol pos, left int blank Symbol } func NewTape(blank Symbol, start int, data []Symbol) *Tape { t := &Tape{ data: data, blank: blank, } if start < 0 { t.Left(-start) } t.Right(start) return t } func (t *Tape) Stay() {} func (t *Tape) Data() []Symbol { return t.data[t.left:] } func (t *Tape) Read() Symbol { return t.data[t.pos] } func (t *Tape) Write(s Symbol) { t.data[t.pos] = s } func (t *Tape) Dup() *Tape { t2 := &Tape{ data: make([]Symbol, len(t.Data())), blank: t.blank, } copy(t2.data, t.Data()) t2.pos = t.pos - t.left return t2 } func (t *Tape) String() string { s := "" for i := t.left; i < len(t.data); i++ { b := t.data[i] if i == t.pos { s += "[" + string(b) + "]" } else { s += " " + string(b) + " " } } return s } func (t *Tape) Move(a Motion) { switch a { case Left: t.Left(1) case Right: t.Right(1) case Stay: t.Stay() } } const minSz = 16 func (t *Tape) Left(n int) { t.pos -= n if t.pos < 0 { var sz int for sz = minSz; cap(t.data[t.left:])-t.pos >= sz; sz <<= 1 { } newd := make([]Symbol, sz) newl := len(newd) - cap(t.data[t.left:]) n := copy(newd[newl:], t.data[t.left:]) t.data = newd[:newl+n] t.pos += newl - t.left t.left = newl } if t.pos < t.left { if t.blank != 0 { for i := t.pos; i < t.left; i++ { t.data[i] = t.blank } } t.left = t.pos } } func (t *Tape) Right(n int) { t.pos += n if t.pos >= cap(t.data) { var sz int for sz = minSz; t.pos >= sz; sz <<= 1 { } newd := make([]Symbol, sz) n := copy(newd[t.left:], t.data[t.left:]) t.data = newd[:t.left+n] } if i := len(t.data); t.pos >= i { t.data = t.data[:t.pos+1] if t.blank != 0 { for ; i < len(t.data); i++ { t.data[i] = t.blank } } } } type State string type Rule struct { State Symbol Write Symbol Motion Next State } func (i *Rule) key() key { return key{i.State, i.Symbol} } func (i *Rule) action() action { return action{i.Write, i.Motion, i.Next} } type key struct { State Symbol } type action struct { write Symbol Motion next State } type Machine struct { tape *Tape start, state State transition map[key]action l func(string, ...interface{}) } func NewMachine(rules []Rule) *Machine { m := &Machine{transition: make(map[key]action, len(rules))} if len(rules) > 0 { m.start = rules[0].State } for _, r := range rules { m.transition[r.key()] = r.action() } return m } func (m *Machine) Run(input *Tape) (int, *Tape) { m.tape = input.Dup() m.state = m.start for cnt := 0; ; cnt++ { if m.l != nil { m.l("%3d %4s: %v\n", cnt, m.state, m.tape) } sym := m.tape.Read() act, ok := m.transition[key{m.state, sym}] if !ok { return cnt, m.tape } m.tape.Write(act.write) m.tape.Move(act.Motion) m.state = act.next } }
Produce a language-to-language conversion: from C++ to Go, same semantics.
#include <direct.h> #include <fstream> int main() { std::fstream f("output.txt", std::ios::out); f.close(); f.open("/output.txt", std::ios::out); f.close(); _mkdir("docs"); _mkdir("/docs"); return 0; }
package main import ( "fmt" "os" ) func createFile(fn string) { f, err := os.Create(fn) if err != nil { fmt.Println(err) return } fmt.Println("file", fn, "created!") f.Close() } func createDir(dn string) { err := os.Mkdir(dn, 0666) if err != nil { fmt.Println(err) return } fmt.Println("directory", dn, "created!") } func main() { createFile("input.txt") createFile("/input.txt") createDir("docs") createDir("/docs") }
Produce a functionally identical Go code for the snippet given in C++.
#include <iostream> #include <cstdint> #include "prime_sieve.hpp" typedef uint32_t integer; int count_digits(integer n) { int digits = 0; for (; n > 0; ++digits) n /= 10; return digits; } integer change_digit(integer n, int index, int new_digit) { integer p = 1; integer changed = 0; for (; index > 0; p *= 10, n /= 10, --index) changed += p * (n % 10); changed += (10 * (n/10) + new_digit) * p; return changed; } bool unprimeable(const prime_sieve& sieve, integer n) { if (sieve.is_prime(n)) return false; int d = count_digits(n); for (int i = 0; i < d; ++i) { for (int j = 0; j <= 9; ++j) { integer m = change_digit(n, i, j); if (m != n && sieve.is_prime(m)) return false; } } return true; } int main() { const integer limit = 10000000; prime_sieve sieve(limit); std::cout.imbue(std::locale("")); std::cout << "First 35 unprimeable numbers:\n"; integer n = 100; integer lowest[10] = { 0 }; for (int count = 0, found = 0; n < limit && (found < 10 || count < 600); ++n) { if (unprimeable(sieve, n)) { if (count < 35) { if (count != 0) std::cout << ", "; std::cout << n; } ++count; if (count == 600) std::cout << "\n600th unprimeable number: " << n << '\n'; int last_digit = n % 10; if (lowest[last_digit] == 0) { lowest[last_digit] = n; ++found; } } } for (int i = 0; i < 10; ++i) std::cout << "Least unprimeable number ending in " << i << ": " << lowest[i] << '\n'; return 0; }
package main import ( "fmt" "strconv" ) func isPrime(n int) bool { switch { case n < 2: return false case n%2 == 0: return n == 2 case n%3 == 0: return n == 3 default: d := 5 for d*d <= n { if n%d == 0 { return false } d += 2 if n%d == 0 { return false } d += 4 } return true } } func commatize(n int) string { s := fmt.Sprintf("%d", n) le := len(s) for i := le - 3; i >= 1; i -= 3 { s = s[0:i] + "," + s[i:] } return s } func main() { fmt.Println("The first 35 unprimeable numbers are:") count := 0 var firstNum [10]int outer: for i, countFirst := 100, 0; countFirst < 10; i++ { if isPrime(i) { continue } s := strconv.Itoa(i) le := len(s) b := []byte(s) for j := 0; j < le; j++ { for k := byte('0'); k <= '9'; k++ { if s[j] == k { continue } b[j] = k n, _ := strconv.Atoi(string(b)) if isPrime(n) { continue outer } } b[j] = s[j] } lastDigit := s[le-1] - '0' if firstNum[lastDigit] == 0 { firstNum[lastDigit] = i countFirst++ } count++ if count <= 35 { fmt.Printf("%d ", i) } if count == 35 { fmt.Print("\n\nThe 600th unprimeable number is: ") } if count == 600 { fmt.Printf("%s\n\n", commatize(i)) } } fmt.Println("The first unprimeable number that ends in:") for i := 0; i < 10; i++ { fmt.Printf(" %d is: %9s\n", i, commatize(firstNum[i])) } }
Write a version of this C++ function in Go with identical behavior.
#include <iostream> #include <iomanip> inline int sign(int i) { return i < 0 ? -1 : i > 0; } inline int& E(int *x, int row, int col) { return x[row * (row + 1) / 2 + col]; } int iter(int *v, int *diff) { E(v, 0, 0) = 151; E(v, 2, 0) = 40; E(v, 4, 1) = 11; E(v, 4, 3) = 4; for (auto i = 1u; i < 5u; i++) for (auto j = 0u; j <= i; j++) { E(diff, i, j) = 0; if (j < i) E(diff, i, j) += E(v, i - 1, j) - E(v, i, j + 1) - E(v, i, j); if (j) E(diff, i, j) += E(v, i - 1, j - 1) - E(v, i, j - 1) - E(v, i, j); } for (auto i = 0u; i < 4u; i++) for (auto j = 0u; j < i; j++) E(diff, i, j) += E(v, i + 1, j) + E(v, i + 1, j + 1) - E(v, i, j); E(diff, 4, 2) += E(v, 4, 0) + E(v, 4, 4) - E(v, 4, 2); uint sum; int e = 0; for (auto i = sum = 0u; i < 15u; i++) { sum += !!sign(e = diff[i]); if (e >= 4 || e <= -4) v[i] += e / 5; else if (rand() < RAND_MAX / 4) v[i] += sign(e); } return sum; } void show(int *x) { for (auto i = 0u; i < 5u; i++) for (auto j = 0u; j <= i; j++) std::cout << std::setw(4u) << *(x++) << (j < i ? ' ' : '\n'); } int main() { int v[15] = { 0 }, diff[15] = { 0 }; for (auto i = 1u, s = 1u; s; i++) { s = iter(v, diff); std::cout << "pass " << i << ": " << s << std::endl; } show(v); return 0; }
package main import "fmt" type expr struct { x, y, z float64 c float64 } func addExpr(a, b expr) expr { return expr{a.x + b.x, a.y + b.y, a.z + b.z, a.c + b.c} } func subExpr(a, b expr) expr { return expr{a.x - b.x, a.y - b.y, a.z - b.z, a.c - b.c} } func mulExpr(a expr, c float64) expr { return expr{a.x * c, a.y * c, a.z * c, a.c * c} } func addRow(l []expr) []expr { if len(l) == 0 { panic("wrong") } r := make([]expr, len(l)-1) for i := range r { r[i] = addExpr(l[i], l[i+1]) } return r } func substX(a, b expr) expr { if b.x == 0 { panic("wrong") } return subExpr(a, mulExpr(b, a.x/b.x)) } func substY(a, b expr) expr { if b.y == 0 { panic("wrong") } return subExpr(a, mulExpr(b, a.y/b.y)) } func substZ(a, b expr) expr { if b.z == 0 { panic("wrong") } return subExpr(a, mulExpr(b, a.z/b.z)) } func solveX(a expr) float64 { if a.x == 0 || a.y != 0 || a.z != 0 { panic("wrong") } return -a.c / a.x } func solveY(a expr) float64 { if a.x != 0 || a.y == 0 || a.z != 0 { panic("wrong") } return -a.c / a.y } func solveZ(a expr) float64 { if a.x != 0 || a.y != 0 || a.z == 0 { panic("wrong") } return -a.c / a.z } func main() { r5 := []expr{{x: 1}, {c: 11}, {y: 1}, {c: 4}, {z: 1}} fmt.Println("bottom row:", r5) r4 := addRow(r5) fmt.Println("next row up:", r4) r3 := addRow(r4) fmt.Println("middle row:", r3) xyz := subExpr(expr{y: 1}, expr{x: 1, z: 1}) fmt.Println("xyz relation:", xyz) r3[2] = substZ(r3[2], xyz) fmt.Println("middle row after substituting for z:", r3) b := expr{c: 40} xy := subExpr(r3[0], b) fmt.Println("xy relation:", xy) r3[0] = b r3[2] = substX(r3[2], xy) fmt.Println("middle row after substituting for x:", r3) r2 := addRow(r3) fmt.Println("next row up:", r2) r1 := addRow(r2) fmt.Println("top row:", r1) y := subExpr(r1[0], expr{c: 151}) fmt.Println("y relation:", y) x := substY(xy, y) fmt.Println("x relation:", x) z := substX(substY(xyz, y), x) fmt.Println("z relation:", z) fmt.Println("x =", solveX(x)) fmt.Println("y =", solveY(y)) fmt.Println("z =", solveZ(z)) }
Translate this program into Go but keep the logic exactly as in C++.
#include <iostream> #include <iomanip> inline int sign(int i) { return i < 0 ? -1 : i > 0; } inline int& E(int *x, int row, int col) { return x[row * (row + 1) / 2 + col]; } int iter(int *v, int *diff) { E(v, 0, 0) = 151; E(v, 2, 0) = 40; E(v, 4, 1) = 11; E(v, 4, 3) = 4; for (auto i = 1u; i < 5u; i++) for (auto j = 0u; j <= i; j++) { E(diff, i, j) = 0; if (j < i) E(diff, i, j) += E(v, i - 1, j) - E(v, i, j + 1) - E(v, i, j); if (j) E(diff, i, j) += E(v, i - 1, j - 1) - E(v, i, j - 1) - E(v, i, j); } for (auto i = 0u; i < 4u; i++) for (auto j = 0u; j < i; j++) E(diff, i, j) += E(v, i + 1, j) + E(v, i + 1, j + 1) - E(v, i, j); E(diff, 4, 2) += E(v, 4, 0) + E(v, 4, 4) - E(v, 4, 2); uint sum; int e = 0; for (auto i = sum = 0u; i < 15u; i++) { sum += !!sign(e = diff[i]); if (e >= 4 || e <= -4) v[i] += e / 5; else if (rand() < RAND_MAX / 4) v[i] += sign(e); } return sum; } void show(int *x) { for (auto i = 0u; i < 5u; i++) for (auto j = 0u; j <= i; j++) std::cout << std::setw(4u) << *(x++) << (j < i ? ' ' : '\n'); } int main() { int v[15] = { 0 }, diff[15] = { 0 }; for (auto i = 1u, s = 1u; s; i++) { s = iter(v, diff); std::cout << "pass " << i << ": " << s << std::endl; } show(v); return 0; }
package main import "fmt" type expr struct { x, y, z float64 c float64 } func addExpr(a, b expr) expr { return expr{a.x + b.x, a.y + b.y, a.z + b.z, a.c + b.c} } func subExpr(a, b expr) expr { return expr{a.x - b.x, a.y - b.y, a.z - b.z, a.c - b.c} } func mulExpr(a expr, c float64) expr { return expr{a.x * c, a.y * c, a.z * c, a.c * c} } func addRow(l []expr) []expr { if len(l) == 0 { panic("wrong") } r := make([]expr, len(l)-1) for i := range r { r[i] = addExpr(l[i], l[i+1]) } return r } func substX(a, b expr) expr { if b.x == 0 { panic("wrong") } return subExpr(a, mulExpr(b, a.x/b.x)) } func substY(a, b expr) expr { if b.y == 0 { panic("wrong") } return subExpr(a, mulExpr(b, a.y/b.y)) } func substZ(a, b expr) expr { if b.z == 0 { panic("wrong") } return subExpr(a, mulExpr(b, a.z/b.z)) } func solveX(a expr) float64 { if a.x == 0 || a.y != 0 || a.z != 0 { panic("wrong") } return -a.c / a.x } func solveY(a expr) float64 { if a.x != 0 || a.y == 0 || a.z != 0 { panic("wrong") } return -a.c / a.y } func solveZ(a expr) float64 { if a.x != 0 || a.y != 0 || a.z == 0 { panic("wrong") } return -a.c / a.z } func main() { r5 := []expr{{x: 1}, {c: 11}, {y: 1}, {c: 4}, {z: 1}} fmt.Println("bottom row:", r5) r4 := addRow(r5) fmt.Println("next row up:", r4) r3 := addRow(r4) fmt.Println("middle row:", r3) xyz := subExpr(expr{y: 1}, expr{x: 1, z: 1}) fmt.Println("xyz relation:", xyz) r3[2] = substZ(r3[2], xyz) fmt.Println("middle row after substituting for z:", r3) b := expr{c: 40} xy := subExpr(r3[0], b) fmt.Println("xy relation:", xy) r3[0] = b r3[2] = substX(r3[2], xy) fmt.Println("middle row after substituting for x:", r3) r2 := addRow(r3) fmt.Println("next row up:", r2) r1 := addRow(r2) fmt.Println("top row:", r1) y := subExpr(r1[0], expr{c: 151}) fmt.Println("y relation:", y) x := substY(xy, y) fmt.Println("x relation:", x) z := substX(substY(xyz, y), x) fmt.Println("z relation:", z) fmt.Println("x =", solveX(x)) fmt.Println("y =", solveY(y)) fmt.Println("z =", solveZ(z)) }
Generate an equivalent Go version of this C++ code.
#include <gmp.h> #include <iostream> using namespace std; typedef unsigned long long int u64; bool primality_pretest(u64 k) { if (!(k % 3) || !(k % 5) || !(k % 7) || !(k % 11) || !(k % 13) || !(k % 17) || !(k % 19) || !(k % 23) ) { return (k <= 23); } return true; } bool probprime(u64 k, mpz_t n) { mpz_set_ui(n, k); return mpz_probab_prime_p(n, 0); } bool is_chernick(int n, u64 m, mpz_t z) { if (!primality_pretest(6 * m + 1)) { return false; } if (!primality_pretest(12 * m + 1)) { return false; } u64 t = 9 * m; for (int i = 1; i <= n - 2; i++) { if (!primality_pretest((t << i) + 1)) { return false; } } if (!probprime(6 * m + 1, z)) { return false; } if (!probprime(12 * m + 1, z)) { return false; } for (int i = 1; i <= n - 2; i++) { if (!probprime((t << i) + 1, z)) { return false; } } return true; } int main() { mpz_t z; mpz_inits(z, NULL); for (int n = 3; n <= 10; n++) { u64 multiplier = (n > 4) ? (1 << (n - 4)) : 1; if (n > 5) { multiplier *= 5; } for (u64 k = 1; ; k++) { u64 m = k * multiplier; if (is_chernick(n, m, z)) { cout << "a(" << n << ") has m = " << m << endl; break; } } } return 0; }
package main import ( "fmt" "math/big" ) var ( zero = new(big.Int) prod = new(big.Int) fact = new(big.Int) ) func ccFactors(n, m uint64) (*big.Int, bool) { prod.SetUint64(6*m + 1) if !prod.ProbablyPrime(0) { return zero, false } fact.SetUint64(12*m + 1) if !fact.ProbablyPrime(0) { return zero, false } prod.Mul(prod, fact) for i := uint64(1); i <= n-2; i++ { fact.SetUint64((1<<i)*9*m + 1) if !fact.ProbablyPrime(0) { return zero, false } prod.Mul(prod, fact) } return prod, true } func ccNumbers(start, end uint64) { for n := start; n <= end; n++ { m := uint64(1) if n > 4 { m = 1 << (n - 4) } for { num, ok := ccFactors(n, m) if ok { fmt.Printf("a(%d) = %d\n", n, num) break } if n <= 4 { m++ } else { m += 1 << (n - 4) } } } } func main() { ccNumbers(3, 9) }
Port the provided C++ code into Go while preserving the original functionality.
#include <iostream> const double EPS = 0.001; const double EPS_SQUARE = EPS * EPS; double side(double x1, double y1, double x2, double y2, double x, double y) { return (y2 - y1) * (x - x1) + (-x2 + x1) * (y - y1); } bool naivePointInTriangle(double x1, double y1, double x2, double y2, double x3, double y3, double x, double y) { double checkSide1 = side(x1, y1, x2, y2, x, y) >= 0; double checkSide2 = side(x2, y2, x3, y3, x, y) >= 0; double checkSide3 = side(x3, y3, x1, y1, x, y) >= 0; return checkSide1 && checkSide2 && checkSide3; } bool pointInTriangleBoundingBox(double x1, double y1, double x2, double y2, double x3, double y3, double x, double y) { double xMin = std::min(x1, std::min(x2, x3)) - EPS; double xMax = std::max(x1, std::max(x2, x3)) + EPS; double yMin = std::min(y1, std::min(y2, y3)) - EPS; double yMax = std::max(y1, std::max(y2, y3)) + EPS; return !(x < xMin || xMax < x || y < yMin || yMax < y); } double distanceSquarePointToSegment(double x1, double y1, double x2, double y2, double x, double y) { double p1_p2_squareLength = (x2 - x1) * (x2 - x1) + (y2 - y1) * (y2 - y1); double dotProduct = ((x - x1) * (x2 - x1) + (y - y1) * (y2 - y1)) / p1_p2_squareLength; if (dotProduct < 0) { return (x - x1) * (x - x1) + (y - y1) * (y - y1); } else if (dotProduct <= 1) { double p_p1_squareLength = (x1 - x) * (x1 - x) + (y1 - y) * (y1 - y); return p_p1_squareLength - dotProduct * dotProduct * p1_p2_squareLength; } else { return (x - x2) * (x - x2) + (y - y2) * (y - y2); } } bool accuratePointInTriangle(double x1, double y1, double x2, double y2, double x3, double y3, double x, double y) { if (!pointInTriangleBoundingBox(x1, y1, x2, y2, x3, y3, x, y)) { return false; } if (naivePointInTriangle(x1, y1, x2, y2, x3, y3, x, y)) { return true; } if (distanceSquarePointToSegment(x1, y1, x2, y2, x, y) <= EPS_SQUARE) { return true; } if (distanceSquarePointToSegment(x2, y2, x3, y3, x, y) <= EPS_SQUARE) { return true; } if (distanceSquarePointToSegment(x3, y3, x1, y1, x, y) <= EPS_SQUARE) { return true; } return false; } void printPoint(double x, double y) { std::cout << '(' << x << ", " << y << ')'; } void printTriangle(double x1, double y1, double x2, double y2, double x3, double y3) { std::cout << "Triangle is ["; printPoint(x1, y1); std::cout << ", "; printPoint(x2, y2); std::cout << ", "; printPoint(x3, y3); std::cout << "]\n"; } void test(double x1, double y1, double x2, double y2, double x3, double y3, double x, double y) { printTriangle(x1, y1, x2, y2, x3, y3); std::cout << "Point "; printPoint(x, y); std::cout << " is within triangle? "; if (accuratePointInTriangle(x1, y1, x2, y2, x3, y3, x, y)) { std::cout << "true\n"; } else { std::cout << "false\n"; } } int main() { test(1.5, 2.4, 5.1, -3.1, -3.8, 1.2, 0, 0); test(1.5, 2.4, 5.1, -3.1, -3.8, 1.2, 0, 1); test(1.5, 2.4, 5.1, -3.1, -3.8, 1.2, 3, 1); std::cout << '\n'; test(0.1, 0.1111111111111111, 12.5, 33.333333333333336, 25, 11.11111111111111, 5.414285714285714, 14.349206349206348); std::cout << '\n'; test(0.1, 0.1111111111111111, 12.5, 33.333333333333336, -12.5, 16.666666666666668, 5.414285714285714, 14.349206349206348); std::cout << '\n'; return 0; }
package main import ( "fmt" "math" ) const EPS = 0.001 const EPS_SQUARE = EPS * EPS func side(x1, y1, x2, y2, x, y float64) float64 { return (y2-y1)*(x-x1) + (-x2+x1)*(y-y1) } func naivePointInTriangle(x1, y1, x2, y2, x3, y3, x, y float64) bool { checkSide1 := side(x1, y1, x2, y2, x, y) >= 0 checkSide2 := side(x2, y2, x3, y3, x, y) >= 0 checkSide3 := side(x3, y3, x1, y1, x, y) >= 0 return checkSide1 && checkSide2 && checkSide3 } func pointInTriangleBoundingBox(x1, y1, x2, y2, x3, y3, x, y float64) bool { xMin := math.Min(x1, math.Min(x2, x3)) - EPS xMax := math.Max(x1, math.Max(x2, x3)) + EPS yMin := math.Min(y1, math.Min(y2, y3)) - EPS yMax := math.Max(y1, math.Max(y2, y3)) + EPS return !(x < xMin || xMax < x || y < yMin || yMax < y) } func distanceSquarePointToSegment(x1, y1, x2, y2, x, y float64) float64 { p1_p2_squareLength := (x2-x1)*(x2-x1) + (y2-y1)*(y2-y1) dotProduct := ((x-x1)*(x2-x1) + (y-y1)*(y2-y1)) / p1_p2_squareLength if dotProduct < 0 { return (x-x1)*(x-x1) + (y-y1)*(y-y1) } else if dotProduct <= 1 { p_p1_squareLength := (x1-x)*(x1-x) + (y1-y)*(y1-y) return p_p1_squareLength - dotProduct*dotProduct*p1_p2_squareLength } else { return (x-x2)*(x-x2) + (y-y2)*(y-y2) } } func accuratePointInTriangle(x1, y1, x2, y2, x3, y3, x, y float64) bool { if !pointInTriangleBoundingBox(x1, y1, x2, y2, x3, y3, x, y) { return false } if naivePointInTriangle(x1, y1, x2, y2, x3, y3, x, y) { return true } if distanceSquarePointToSegment(x1, y1, x2, y2, x, y) <= EPS_SQUARE { return true } if distanceSquarePointToSegment(x2, y2, x3, y3, x, y) <= EPS_SQUARE { return true } if distanceSquarePointToSegment(x3, y3, x1, y1, x, y) <= EPS_SQUARE { return true } return false } func main() { pts := [][2]float64{{0, 0}, {0, 1}, {3, 1}} tri := [][2]float64{{3.0 / 2, 12.0 / 5}, {51.0 / 10, -31.0 / 10}, {-19.0 / 5, 1.2}} fmt.Println("Triangle is", tri) x1, y1 := tri[0][0], tri[0][1] x2, y2 := tri[1][0], tri[1][1] x3, y3 := tri[2][0], tri[2][1] for _, pt := range pts { x, y := pt[0], pt[1] within := accuratePointInTriangle(x1, y1, x2, y2, x3, y3, x, y) fmt.Println("Point", pt, "is within triangle?", within) } fmt.Println() tri = [][2]float64{{1.0 / 10, 1.0 / 9}, {100.0 / 8, 100.0 / 3}, {100.0 / 4, 100.0 / 9}} fmt.Println("Triangle is", tri) x1, y1 = tri[0][0], tri[0][1] x2, y2 = tri[1][0], tri[1][1] x3, y3 = tri[2][0], tri[2][1] x := x1 + (3.0/7)*(x2-x1) y := y1 + (3.0/7)*(y2-y1) pt := [2]float64{x, y} within := accuratePointInTriangle(x1, y1, x2, y2, x3, y3, x, y) fmt.Println("Point", pt, "is within triangle ?", within) fmt.Println() tri = [][2]float64{{1.0 / 10, 1.0 / 9}, {100.0 / 8, 100.0 / 3}, {-100.0 / 8, 100.0 / 6}} fmt.Println("Triangle is", tri) x3 = tri[2][0] y3 = tri[2][1] within = accuratePointInTriangle(x1, y1, x2, y2, x3, y3, x, y) fmt.Println("Point", pt, "is within triangle ?", within) }
Port the following code from C++ to Go with equivalent syntax and logic.
#include <iostream> const double EPS = 0.001; const double EPS_SQUARE = EPS * EPS; double side(double x1, double y1, double x2, double y2, double x, double y) { return (y2 - y1) * (x - x1) + (-x2 + x1) * (y - y1); } bool naivePointInTriangle(double x1, double y1, double x2, double y2, double x3, double y3, double x, double y) { double checkSide1 = side(x1, y1, x2, y2, x, y) >= 0; double checkSide2 = side(x2, y2, x3, y3, x, y) >= 0; double checkSide3 = side(x3, y3, x1, y1, x, y) >= 0; return checkSide1 && checkSide2 && checkSide3; } bool pointInTriangleBoundingBox(double x1, double y1, double x2, double y2, double x3, double y3, double x, double y) { double xMin = std::min(x1, std::min(x2, x3)) - EPS; double xMax = std::max(x1, std::max(x2, x3)) + EPS; double yMin = std::min(y1, std::min(y2, y3)) - EPS; double yMax = std::max(y1, std::max(y2, y3)) + EPS; return !(x < xMin || xMax < x || y < yMin || yMax < y); } double distanceSquarePointToSegment(double x1, double y1, double x2, double y2, double x, double y) { double p1_p2_squareLength = (x2 - x1) * (x2 - x1) + (y2 - y1) * (y2 - y1); double dotProduct = ((x - x1) * (x2 - x1) + (y - y1) * (y2 - y1)) / p1_p2_squareLength; if (dotProduct < 0) { return (x - x1) * (x - x1) + (y - y1) * (y - y1); } else if (dotProduct <= 1) { double p_p1_squareLength = (x1 - x) * (x1 - x) + (y1 - y) * (y1 - y); return p_p1_squareLength - dotProduct * dotProduct * p1_p2_squareLength; } else { return (x - x2) * (x - x2) + (y - y2) * (y - y2); } } bool accuratePointInTriangle(double x1, double y1, double x2, double y2, double x3, double y3, double x, double y) { if (!pointInTriangleBoundingBox(x1, y1, x2, y2, x3, y3, x, y)) { return false; } if (naivePointInTriangle(x1, y1, x2, y2, x3, y3, x, y)) { return true; } if (distanceSquarePointToSegment(x1, y1, x2, y2, x, y) <= EPS_SQUARE) { return true; } if (distanceSquarePointToSegment(x2, y2, x3, y3, x, y) <= EPS_SQUARE) { return true; } if (distanceSquarePointToSegment(x3, y3, x1, y1, x, y) <= EPS_SQUARE) { return true; } return false; } void printPoint(double x, double y) { std::cout << '(' << x << ", " << y << ')'; } void printTriangle(double x1, double y1, double x2, double y2, double x3, double y3) { std::cout << "Triangle is ["; printPoint(x1, y1); std::cout << ", "; printPoint(x2, y2); std::cout << ", "; printPoint(x3, y3); std::cout << "]\n"; } void test(double x1, double y1, double x2, double y2, double x3, double y3, double x, double y) { printTriangle(x1, y1, x2, y2, x3, y3); std::cout << "Point "; printPoint(x, y); std::cout << " is within triangle? "; if (accuratePointInTriangle(x1, y1, x2, y2, x3, y3, x, y)) { std::cout << "true\n"; } else { std::cout << "false\n"; } } int main() { test(1.5, 2.4, 5.1, -3.1, -3.8, 1.2, 0, 0); test(1.5, 2.4, 5.1, -3.1, -3.8, 1.2, 0, 1); test(1.5, 2.4, 5.1, -3.1, -3.8, 1.2, 3, 1); std::cout << '\n'; test(0.1, 0.1111111111111111, 12.5, 33.333333333333336, 25, 11.11111111111111, 5.414285714285714, 14.349206349206348); std::cout << '\n'; test(0.1, 0.1111111111111111, 12.5, 33.333333333333336, -12.5, 16.666666666666668, 5.414285714285714, 14.349206349206348); std::cout << '\n'; return 0; }
package main import ( "fmt" "math" ) const EPS = 0.001 const EPS_SQUARE = EPS * EPS func side(x1, y1, x2, y2, x, y float64) float64 { return (y2-y1)*(x-x1) + (-x2+x1)*(y-y1) } func naivePointInTriangle(x1, y1, x2, y2, x3, y3, x, y float64) bool { checkSide1 := side(x1, y1, x2, y2, x, y) >= 0 checkSide2 := side(x2, y2, x3, y3, x, y) >= 0 checkSide3 := side(x3, y3, x1, y1, x, y) >= 0 return checkSide1 && checkSide2 && checkSide3 } func pointInTriangleBoundingBox(x1, y1, x2, y2, x3, y3, x, y float64) bool { xMin := math.Min(x1, math.Min(x2, x3)) - EPS xMax := math.Max(x1, math.Max(x2, x3)) + EPS yMin := math.Min(y1, math.Min(y2, y3)) - EPS yMax := math.Max(y1, math.Max(y2, y3)) + EPS return !(x < xMin || xMax < x || y < yMin || yMax < y) } func distanceSquarePointToSegment(x1, y1, x2, y2, x, y float64) float64 { p1_p2_squareLength := (x2-x1)*(x2-x1) + (y2-y1)*(y2-y1) dotProduct := ((x-x1)*(x2-x1) + (y-y1)*(y2-y1)) / p1_p2_squareLength if dotProduct < 0 { return (x-x1)*(x-x1) + (y-y1)*(y-y1) } else if dotProduct <= 1 { p_p1_squareLength := (x1-x)*(x1-x) + (y1-y)*(y1-y) return p_p1_squareLength - dotProduct*dotProduct*p1_p2_squareLength } else { return (x-x2)*(x-x2) + (y-y2)*(y-y2) } } func accuratePointInTriangle(x1, y1, x2, y2, x3, y3, x, y float64) bool { if !pointInTriangleBoundingBox(x1, y1, x2, y2, x3, y3, x, y) { return false } if naivePointInTriangle(x1, y1, x2, y2, x3, y3, x, y) { return true } if distanceSquarePointToSegment(x1, y1, x2, y2, x, y) <= EPS_SQUARE { return true } if distanceSquarePointToSegment(x2, y2, x3, y3, x, y) <= EPS_SQUARE { return true } if distanceSquarePointToSegment(x3, y3, x1, y1, x, y) <= EPS_SQUARE { return true } return false } func main() { pts := [][2]float64{{0, 0}, {0, 1}, {3, 1}} tri := [][2]float64{{3.0 / 2, 12.0 / 5}, {51.0 / 10, -31.0 / 10}, {-19.0 / 5, 1.2}} fmt.Println("Triangle is", tri) x1, y1 := tri[0][0], tri[0][1] x2, y2 := tri[1][0], tri[1][1] x3, y3 := tri[2][0], tri[2][1] for _, pt := range pts { x, y := pt[0], pt[1] within := accuratePointInTriangle(x1, y1, x2, y2, x3, y3, x, y) fmt.Println("Point", pt, "is within triangle?", within) } fmt.Println() tri = [][2]float64{{1.0 / 10, 1.0 / 9}, {100.0 / 8, 100.0 / 3}, {100.0 / 4, 100.0 / 9}} fmt.Println("Triangle is", tri) x1, y1 = tri[0][0], tri[0][1] x2, y2 = tri[1][0], tri[1][1] x3, y3 = tri[2][0], tri[2][1] x := x1 + (3.0/7)*(x2-x1) y := y1 + (3.0/7)*(y2-y1) pt := [2]float64{x, y} within := accuratePointInTriangle(x1, y1, x2, y2, x3, y3, x, y) fmt.Println("Point", pt, "is within triangle ?", within) fmt.Println() tri = [][2]float64{{1.0 / 10, 1.0 / 9}, {100.0 / 8, 100.0 / 3}, {-100.0 / 8, 100.0 / 6}} fmt.Println("Triangle is", tri) x3 = tri[2][0] y3 = tri[2][1] within = accuratePointInTriangle(x1, y1, x2, y2, x3, y3, x, y) fmt.Println("Point", pt, "is within triangle ?", within) }
Keep all operations the same but rewrite the snippet in Go.
#include <iomanip> #include <iostream> unsigned int divisor_count(unsigned int n) { unsigned int total = 1; for (; (n & 1) == 0; n >>= 1) ++total; for (unsigned int p = 3; p * p <= n; p += 2) { unsigned int count = 1; for (; n % p == 0; n /= p) ++count; total *= count; } if (n > 1) total *= 2; return total; } int main() { const unsigned int limit = 100; std::cout << "Count of divisors for the first " << limit << " positive integers:\n"; for (unsigned int n = 1; n <= limit; ++n) { std::cout << std::setw(3) << divisor_count(n); if (n % 20 == 0) std::cout << '\n'; } }
package main import "fmt" func countDivisors(n int) int { count := 0 i := 1 k := 2 if n%2 == 0 { k = 1 } for i*i <= n { if n%i == 0 { count++ j := n / i if j != i { count++ } } i += k } return count } func main() { fmt.Println("The tau functions for the first 100 positive integers are:") for i := 1; i <= 100; i++ { fmt.Printf("%2d ", countDivisors(i)) if i%20 == 0 { fmt.Println() } } }
Port the provided C++ code into Go while preserving the original functionality.
#include <iomanip> #include <iostream> unsigned int divisor_count(unsigned int n) { unsigned int total = 1; for (; (n & 1) == 0; n >>= 1) ++total; for (unsigned int p = 3; p * p <= n; p += 2) { unsigned int count = 1; for (; n % p == 0; n /= p) ++count; total *= count; } if (n > 1) total *= 2; return total; } int main() { const unsigned int limit = 100; std::cout << "Count of divisors for the first " << limit << " positive integers:\n"; for (unsigned int n = 1; n <= limit; ++n) { std::cout << std::setw(3) << divisor_count(n); if (n % 20 == 0) std::cout << '\n'; } }
package main import "fmt" func countDivisors(n int) int { count := 0 i := 1 k := 2 if n%2 == 0 { k = 1 } for i*i <= n { if n%i == 0 { count++ j := n / i if j != i { count++ } } i += k } return count } func main() { fmt.Println("The tau functions for the first 100 positive integers are:") for i := 1; i <= 100; i++ { fmt.Printf("%2d ", countDivisors(i)) if i%20 == 0 { fmt.Println() } } }
Rewrite this program in Go while keeping its functionality equivalent to the C++ version.
#include <string> #include <iostream> int main() { char* data = new char[sizeof(std::string)]; std::string* stringPtr = new (data) std::string("ABCD"); std::cout << *stringPtr << " 0x" << stringPtr << std::endl; stringPtr->~basic_string(); stringPtr = new (data) std::string("123456"); std::cout << *stringPtr << " 0x" << stringPtr << std::endl; stringPtr->~basic_string(); delete[] data; }
package main import( "fmt" "unsafe" "reflect" ) func pointer() { fmt.Printf("Pointer:\n") var i int p := &i fmt.Printf("Before:\n\t%v: %v, %v\n", p, *p, i) *p = 3 fmt.Printf("After:\n\t%v: %v, %v\n", p, *p, i) } func slice() { fmt.Printf("Slice:\n") var a [10]byte var h reflect.SliceHeader h.Data = uintptr(unsafe.Pointer(&a)) h.Len = len(a) h.Cap = len(a) s := *(*[]byte)(unsafe.Pointer(&h)) fmt.Printf("Before:\n\ts: %v\n\ta: %v\n", s, a) copy(s, "A string.") fmt.Printf("After:\n\ts: %v\n\ta: %v\n", s, a) } func main() { pointer() fmt.Println() slice() }
Write the same code in Go as shown below in C++.
#include <cstdint> #include <iostream> #include <sstream> #include <gmpxx.h> typedef mpz_class integer; bool is_probably_prime(const integer& n) { return mpz_probab_prime_p(n.get_mpz_t(), 25) != 0; } bool is_prime(unsigned int n) { if (n < 2) return false; if (n % 2 == 0) return n == 2; if (n % 3 == 0) return n == 3; for (unsigned int p = 5; p * p <= n; p += 4) { if (n % p == 0) return false; p += 2; if (n % p == 0) return false; } return true; } int main() { const unsigned int max = 20; integer primorial = 1; for (unsigned int p = 0, count = 0, index = 0; count < max; ++p) { if (!is_prime(p)) continue; primorial *= p; ++index; if (is_probably_prime(primorial - 1) || is_probably_prime(primorial + 1)) { if (count > 0) std::cout << ' '; std::cout << index; ++count; } } std::cout << '\n'; return 0; }
package main import ( "fmt" "math/big" ) func main() { one := big.NewInt(1) pm := big.NewInt(1) var px, nx int var pb big.Int primes(4000, func(p int64) bool { pm.Mul(pm, pb.SetInt64(p)) px++ if pb.Add(pm, one).ProbablyPrime(0) || pb.Sub(pm, one).ProbablyPrime(0) { fmt.Print(px, " ") nx++ if nx == 20 { fmt.Println() return false } } return true }) } func primes(limit int, f func(int64) bool) { c := make([]bool, limit) c[0] = true c[1] = true lm := int64(limit) p := int64(2) for { f(p) p2 := p * p if p2 >= lm { break } for i := p2; i < lm; i += p { c[i] = true } for { p++ if !c[p] { break } } } for p++; p < lm; p++ { if !c[p] && !f(p) { break } } }
Write the same code in Go as shown below in C++.
#include <map> #include <string> #include <iostream> #include <iomanip> const std::string DEFAULT_DNA = "CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATG" "CTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTG" "AGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGAT" "GGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT" "CGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGG" "TCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA" "TTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTAT" "CGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTG" "TCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGAC" "GACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT"; class DnaBase { public: DnaBase(const std::string& dna = DEFAULT_DNA, int width = 50) : genome(dna), displayWidth(width) { for (auto elm : dna) { if (count.find(elm) == count.end()) count[elm] = 0; ++count[elm]; } } void viewGenome() { std::cout << "Sequence:" << std::endl; std::cout << std::endl; int limit = genome.size() / displayWidth; if (genome.size() % displayWidth != 0) ++limit; for (int i = 0; i < limit; ++i) { int beginPos = i * displayWidth; std::cout << std::setw(4) << beginPos << "  :" << std::setw(4) << genome.substr(beginPos, displayWidth) << std::endl; } std::cout << std::endl; std::cout << "Base Count" << std::endl; std::cout << "----------" << std::endl; std::cout << std::endl; int total = 0; for (auto elm : count) { std::cout << std::setw(4) << elm.first << " : " << elm.second << std::endl; total += elm.second; } std::cout << std::endl; std::cout << "Total: " << total << std::endl; } private: std::string genome; std::map<char, int> count; int displayWidth; }; int main(void) { auto d = new DnaBase(); d->viewGenome(); delete d; return 0; }
package main import ( "fmt" "sort" ) func main() { dna := "" + "CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATG" + "CTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTG" + "AGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGAT" + "GGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT" + "CGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGG" + "TCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA" + "TTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTAT" + "CGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTG" + "TCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGAC" + "GACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT" fmt.Println("SEQUENCE:") le := len(dna) for i := 0; i < le; i += 50 { k := i + 50 if k > le { k = le } fmt.Printf("%5d: %s\n", i, dna[i:k]) } baseMap := make(map[byte]int) for i := 0; i < le; i++ { baseMap[dna[i]]++ } var bases []byte for k := range baseMap { bases = append(bases, k) } sort.Slice(bases, func(i, j int) bool { return bases[i] < bases[j] }) fmt.Println("\nBASE COUNT:") for _, base := range bases { fmt.Printf(" %c: %3d\n", base, baseMap[base]) } fmt.Println(" ------") fmt.Println(" Σ:", le) fmt.Println(" ======") }
Generate an equivalent Go version of this C++ code.
#include <map> #include <string> #include <iostream> #include <iomanip> const std::string DEFAULT_DNA = "CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATG" "CTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTG" "AGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGAT" "GGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT" "CGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGG" "TCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA" "TTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTAT" "CGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTG" "TCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGAC" "GACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT"; class DnaBase { public: DnaBase(const std::string& dna = DEFAULT_DNA, int width = 50) : genome(dna), displayWidth(width) { for (auto elm : dna) { if (count.find(elm) == count.end()) count[elm] = 0; ++count[elm]; } } void viewGenome() { std::cout << "Sequence:" << std::endl; std::cout << std::endl; int limit = genome.size() / displayWidth; if (genome.size() % displayWidth != 0) ++limit; for (int i = 0; i < limit; ++i) { int beginPos = i * displayWidth; std::cout << std::setw(4) << beginPos << "  :" << std::setw(4) << genome.substr(beginPos, displayWidth) << std::endl; } std::cout << std::endl; std::cout << "Base Count" << std::endl; std::cout << "----------" << std::endl; std::cout << std::endl; int total = 0; for (auto elm : count) { std::cout << std::setw(4) << elm.first << " : " << elm.second << std::endl; total += elm.second; } std::cout << std::endl; std::cout << "Total: " << total << std::endl; } private: std::string genome; std::map<char, int> count; int displayWidth; }; int main(void) { auto d = new DnaBase(); d->viewGenome(); delete d; return 0; }
package main import ( "fmt" "sort" ) func main() { dna := "" + "CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATG" + "CTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTG" + "AGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGAT" + "GGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT" + "CGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGG" + "TCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA" + "TTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTAT" + "CGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTG" + "TCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGAC" + "GACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT" fmt.Println("SEQUENCE:") le := len(dna) for i := 0; i < le; i += 50 { k := i + 50 if k > le { k = le } fmt.Printf("%5d: %s\n", i, dna[i:k]) } baseMap := make(map[byte]int) for i := 0; i < le; i++ { baseMap[dna[i]]++ } var bases []byte for k := range baseMap { bases = append(bases, k) } sort.Slice(bases, func(i, j int) bool { return bases[i] < bases[j] }) fmt.Println("\nBASE COUNT:") for _, base := range bases { fmt.Printf(" %c: %3d\n", base, baseMap[base]) } fmt.Println(" ------") fmt.Println(" Σ:", le) fmt.Println(" ======") }
Convert this C++ block to Go, preserving its control flow and logic.
#include <algorithm> #include <array> #include <chrono> #include <iostream> #include <mutex> #include <random> #include <string> #include <string_view> #include <thread> const int timeScale = 42; void Message(std::string_view message) { static std::mutex cout_mutex; std::scoped_lock cout_lock(cout_mutex); std::cout << message << std::endl; } struct Fork { std::mutex mutex; }; struct Dinner { std::array<Fork, 5> forks; ~Dinner() { Message("Dinner is over"); } }; class Philosopher { std::mt19937 rng{std::random_device {}()}; const std::string name; Fork& left; Fork& right; std::thread worker; void live(); void dine(); void ponder(); public: Philosopher(std::string name_, Fork& l, Fork& r) : name(std::move(name_)), left(l), right(r), worker(&Philosopher::live, this) {} ~Philosopher() { worker.join(); Message(name + " went to sleep."); } }; void Philosopher::live() { for(;;) { { std::scoped_lock dine_lock(left.mutex, right.mutex); dine(); } ponder(); } } void Philosopher::dine() { Message(name + " started eating."); thread_local std::array<const char*, 3> foods {"chicken", "rice", "soda"}; thread_local std::array<const char*, 3> reactions { "I like this %s!", "This %s is good.", "Mmm, %s..." }; thread_local std::uniform_int_distribution<> dist(1, 6); std::shuffle( foods.begin(), foods.end(), rng); std::shuffle(reactions.begin(), reactions.end(), rng); constexpr size_t buf_size = 64; char buffer[buf_size]; for(int i = 0; i < 3; ++i) { std::this_thread::sleep_for(std::chrono::milliseconds(dist(rng) * timeScale)); snprintf(buffer, buf_size, reactions[i], foods[i]); Message(name + ": " + buffer); } std::this_thread::sleep_for(std::chrono::milliseconds(dist(rng)) * timeScale); Message(name + " finished and left."); } void Philosopher::ponder() { static constexpr std::array<const char*, 5> topics {{ "politics", "art", "meaning of life", "source of morality", "how many straws makes a bale" }}; thread_local std::uniform_int_distribution<> wait(1, 6); thread_local std::uniform_int_distribution<> dist(0, topics.size() - 1); while(dist(rng) > 0) { std::this_thread::sleep_for(std::chrono::milliseconds(wait(rng) * 3 * timeScale)); Message(name + " is pondering about " + topics[dist(rng)] + "."); } std::this_thread::sleep_for(std::chrono::milliseconds(wait(rng) * 3 * timeScale)); Message(name + " is hungry again!"); } int main() { Dinner dinner; Message("Dinner started!"); std::array<Philosopher, 5> philosophers {{ {"Aristotle", dinner.forks[0], dinner.forks[1]}, {"Democritus", dinner.forks[1], dinner.forks[2]}, {"Plato", dinner.forks[2], dinner.forks[3]}, {"Pythagoras", dinner.forks[3], dinner.forks[4]}, {"Socrates", dinner.forks[4], dinner.forks[0]}, }}; Message("It is dark outside..."); }
package main import ( "hash/fnv" "log" "math/rand" "os" "time" ) var ph = []string{"Aristotle", "Kant", "Spinoza", "Marx", "Russell"} const hunger = 3 const think = time.Second / 100 const eat = time.Second / 100 var fmt = log.New(os.Stdout, "", 0) var done = make(chan bool) type fork byte func philosopher(phName string, dominantHand, otherHand chan fork, done chan bool) { fmt.Println(phName, "seated") h := fnv.New64a() h.Write([]byte(phName)) rg := rand.New(rand.NewSource(int64(h.Sum64()))) rSleep := func(t time.Duration) { time.Sleep(t/2 + time.Duration(rg.Int63n(int64(t)))) } for h := hunger; h > 0; h-- { fmt.Println(phName, "hungry") <-dominantHand <-otherHand fmt.Println(phName, "eating") rSleep(eat) dominantHand <- 'f' otherHand <- 'f' fmt.Println(phName, "thinking") rSleep(think) } fmt.Println(phName, "satisfied") done <- true fmt.Println(phName, "left the table") } func main() { fmt.Println("table empty") place0 := make(chan fork, 1) place0 <- 'f' placeLeft := place0 for i := 1; i < len(ph); i++ { placeRight := make(chan fork, 1) placeRight <- 'f' go philosopher(ph[i], placeLeft, placeRight, done) placeLeft = placeRight } go philosopher(ph[0], place0, placeLeft, done) for range ph { <-done } fmt.Println("table empty") }
Translate this program into Go but keep the logic exactly as in C++.
#include <iostream> class factorion_t { public: factorion_t() { f[0] = 1u; for (uint n = 1u; n < 12u; n++) f[n] = f[n - 1] * n; } bool operator()(uint i, uint b) const { uint sum = 0; for (uint j = i; j > 0u; j /= b) sum += f[j % b]; return sum == i; } private: ulong f[12]; }; int main() { factorion_t factorion; for (uint b = 9u; b <= 12u; ++b) { std::cout << "factorions for base " << b << ':'; for (uint i = 1u; i < 1500000u; ++i) if (factorion(i, b)) std::cout << ' ' << i; std::cout << std::endl; } return 0; }
package main import ( "fmt" "strconv" ) func main() { var fact [12]uint64 fact[0] = 1 for n := uint64(1); n < 12; n++ { fact[n] = fact[n-1] * n } for b := 9; b <= 12; b++ { fmt.Printf("The factorions for base %d are:\n", b) for i := uint64(1); i < 1500000; i++ { digits := strconv.FormatUint(i, b) sum := uint64(0) for _, digit := range digits { if digit < 'a' { sum += fact[digit-'0'] } else { sum += fact[digit+10-'a'] } } if sum == i { fmt.Printf("%d ", i) } } fmt.Println("\n") } }
Convert this C++ block to Go, preserving its control flow and logic.
#include <iostream> class factorion_t { public: factorion_t() { f[0] = 1u; for (uint n = 1u; n < 12u; n++) f[n] = f[n - 1] * n; } bool operator()(uint i, uint b) const { uint sum = 0; for (uint j = i; j > 0u; j /= b) sum += f[j % b]; return sum == i; } private: ulong f[12]; }; int main() { factorion_t factorion; for (uint b = 9u; b <= 12u; ++b) { std::cout << "factorions for base " << b << ':'; for (uint i = 1u; i < 1500000u; ++i) if (factorion(i, b)) std::cout << ' ' << i; std::cout << std::endl; } return 0; }
package main import ( "fmt" "strconv" ) func main() { var fact [12]uint64 fact[0] = 1 for n := uint64(1); n < 12; n++ { fact[n] = fact[n-1] * n } for b := 9; b <= 12; b++ { fmt.Printf("The factorions for base %d are:\n", b) for i := uint64(1); i < 1500000; i++ { digits := strconv.FormatUint(i, b) sum := uint64(0) for _, digit := range digits { if digit < 'a' { sum += fact[digit-'0'] } else { sum += fact[digit+10-'a'] } } if sum == i { fmt.Printf("%d ", i) } } fmt.Println("\n") } }
Ensure the translated Go code behaves exactly like the original C++ snippet.
#include <cmath> #include <functional> #include <iostream> constexpr double K = 7.8e9; constexpr int n0 = 27; constexpr double actual[] = { 27, 27, 27, 44, 44, 59, 59, 59, 59, 59, 59, 59, 59, 60, 60, 61, 61, 66, 83, 219, 239, 392, 534, 631, 897, 1350, 2023, 2820, 4587, 6067, 7823, 9826, 11946, 14554, 17372, 20615, 24522, 28273, 31491, 34933, 37552, 40540, 43105, 45177, 60328, 64543, 67103, 69265, 71332, 73327, 75191, 75723, 76719, 77804, 78812, 79339, 80132, 80995, 82101, 83365, 85203, 87024, 89068, 90664, 93077, 95316, 98172, 102133, 105824, 109695, 114232, 118610, 125497, 133852, 143227, 151367, 167418, 180096, 194836, 213150, 242364, 271106, 305117, 338133, 377918, 416845, 468049, 527767, 591704, 656866, 715353, 777796, 851308, 928436, 1000249, 1082054, 1174652 }; double f(double r) { double sq = 0; constexpr size_t len = std::size(actual); for (size_t i = 0; i < len; ++i) { double eri = std::exp(r * i); double guess = (n0 * eri)/(1 + n0 * (eri - 1)/K); double diff = guess - actual[i]; sq += diff * diff; } return sq; } double solve(std::function<double(double)> fn, double guess=0.5, double epsilon=0) { for (double delta = guess ? guess : 1, f0 = fn(guess), factor = 2; delta > epsilon && guess != guess - delta; delta *= factor) { double nf = fn(guess - delta); if (nf < f0) { f0 = nf; guess -= delta; } else { nf = fn(guess + delta); if (nf < f0) { f0 = nf; guess += delta; } else factor = 0.5; } } return guess; } int main() { double r = solve(f); double R0 = std::exp(12 * r); std::cout << "r = " << r << ", R0 = " << R0 << '\n'; return 0; }
package main import ( "fmt" "github.com/maorshutman/lm" "log" "math" ) const ( K = 7_800_000_000 n0 = 27 ) var y = []float64{ 27, 27, 27, 44, 44, 59, 59, 59, 59, 59, 59, 59, 59, 60, 60, 61, 61, 66, 83, 219, 239, 392, 534, 631, 897, 1350, 2023, 2820, 4587, 6067, 7823, 9826, 11946, 14554, 17372, 20615, 24522, 28273, 31491, 34933, 37552, 40540, 43105, 45177, 60328, 64543, 67103, 69265, 71332, 73327, 75191, 75723, 76719, 77804, 78812, 79339, 80132, 80995, 82101, 83365, 85203, 87024, 89068, 90664, 93077, 95316, 98172, 102133, 105824, 109695, 114232, 118610, 125497, 133852, 143227, 151367, 167418, 180096, 194836, 213150, 242364, 271106, 305117, 338133, 377918, 416845, 468049, 527767, 591704, 656866, 715353, 777796, 851308, 928436, 1000249, 1082054, 1174652, } func f(dst, p []float64) { for i := 0; i < len(y); i++ { t := float64(i) dst[i] = (n0*math.Exp(p[0]*t))/(1+n0*(math.Exp(p[0]*t)-1)/K) - y[i] } } func main() { j := lm.NumJac{Func: f} prob := lm.LMProblem{ Dim: 1, Size: len(y), Func: f, Jac: j.Jac, InitParams: []float64{0.5}, Tau: 1e-6, Eps1: 1e-8, Eps2: 1e-8, } res, err := lm.LM(prob, &lm.Settings{Iterations: 100, ObjectiveTol: 1e-16}) if err != nil { log.Fatal(err) } r := res.X[0] fmt.Printf("The logistic curve r for the world data is %.8f\n", r) fmt.Printf("R0 is then approximately equal to %.7f\n", math.Exp(12*r)) }
Rewrite this program in Go while keeping its functionality equivalent to the C++ version.
#include <list> template <typename T> std::list<T> strandSort(std::list<T> lst) { if (lst.size() <= 1) return lst; std::list<T> result; std::list<T> sorted; while (!lst.empty()) { sorted.push_back(lst.front()); lst.pop_front(); for (typename std::list<T>::iterator it = lst.begin(); it != lst.end(); ) { if (sorted.back() <= *it) { sorted.push_back(*it); it = lst.erase(it); } else it++; } result.merge(sorted); } return result; }
package main import "fmt" type link struct { int next *link } func linkInts(s []int) *link { if len(s) == 0 { return nil } return &link{s[0], linkInts(s[1:])} } func (l *link) String() string { if l == nil { return "nil" } r := fmt.Sprintf("[%d", l.int) for l = l.next; l != nil; l = l.next { r = fmt.Sprintf("%s %d", r, l.int) } return r + "]" } func main() { a := linkInts([]int{170, 45, 75, -90, -802, 24, 2, 66}) fmt.Println("before:", a) b := strandSort(a) fmt.Println("after: ", b) } func strandSort(a *link) (result *link) { for a != nil { sublist := a a = a.next sTail := sublist for p, pPrev := a, a; p != nil; p = p.next { if p.int > sTail.int { sTail.next = p sTail = p if p == a { a = p.next } else { pPrev.next = p.next } } else { pPrev = p } } sTail.next = nil if result == nil { result = sublist continue } var m, rr *link if sublist.int < result.int { m = sublist sublist = m.next rr = result } else { m = result rr = m.next } result = m for { if sublist == nil { m.next = rr break } if rr == nil { m.next = sublist break } if sublist.int < rr.int { m.next = sublist m = sublist sublist = m.next } else { m.next = rr m = rr rr = m.next } } } return }
Rewrite this program in Go while keeping its functionality equivalent to the C++ version.
#include <iomanip> #include <iostream> bool is_prime(unsigned int n) { if (n < 2) return false; if (n % 2 == 0) return n == 2; if (n % 3 == 0) return n == 3; for (unsigned int p = 5; p * p <= n; p += 4) { if (n % p == 0) return false; p += 2; if (n % p == 0) return false; } return true; } unsigned int digit_sum(unsigned int n) { unsigned int sum = 0; for (; n > 0; n /= 10) sum += n % 10; return sum; } int main() { const unsigned int limit = 500; std::cout << "Additive primes less than " << limit << ":\n"; unsigned int count = 0; for (unsigned int n = 1; n < limit; ++n) { if (is_prime(digit_sum(n)) && is_prime(n)) { std::cout << std::setw(3) << n; if (++count % 10 == 0) std::cout << '\n'; else std::cout << ' '; } } std::cout << '\n' << count << " additive primes found.\n"; }
package main import "fmt" func isPrime(n int) bool { switch { case n < 2: return false case n%2 == 0: return n == 2 case n%3 == 0: return n == 3 default: d := 5 for d*d <= n { if n%d == 0 { return false } d += 2 if n%d == 0 { return false } d += 4 } return true } } func sumDigits(n int) int { sum := 0 for n > 0 { sum += n % 10 n /= 10 } return sum } func main() { fmt.Println("Additive primes less than 500:") i := 2 count := 0 for { if isPrime(i) && isPrime(sumDigits(i)) { count++ fmt.Printf("%3d ", i) if count%10 == 0 { fmt.Println() } } if i > 2 { i += 2 } else { i++ } if i > 499 { break } } fmt.Printf("\n\n%d additive primes found.\n", count) }
Change the following C++ code into Go without altering its purpose.
class invertedAssign { int data; public: invertedAssign(int data):data(data){} int getData(){return data;} void operator=(invertedAssign& other) const { other.data = this->data; } }; #include <iostream> int main(){ invertedAssign a = 0; invertedAssign b = 42; std::cout << a.getData() << ' ' << b.getData() << '\n'; b = a; std::cout << a.getData() << ' ' << b.getData() << '\n'; }
package main import "fmt" type ibool bool const itrue ibool = true func (ib ibool) iif(cond bool) bool { if cond { return bool(ib) } return bool(!ib) } func main() { var needUmbrella bool raining := true if raining { needUmbrella = true } fmt.Printf("Is it raining? %t. Do I need an umbrella? %t\n", raining, needUmbrella) raining = false needUmbrella = itrue.iif(raining) fmt.Printf("Is it raining? %t. Do I need an umbrella? %t\n", raining, needUmbrella) }
Change the following C++ code into Go without altering its purpose.
class invertedAssign { int data; public: invertedAssign(int data):data(data){} int getData(){return data;} void operator=(invertedAssign& other) const { other.data = this->data; } }; #include <iostream> int main(){ invertedAssign a = 0; invertedAssign b = 42; std::cout << a.getData() << ' ' << b.getData() << '\n'; b = a; std::cout << a.getData() << ' ' << b.getData() << '\n'; }
package main import "fmt" type ibool bool const itrue ibool = true func (ib ibool) iif(cond bool) bool { if cond { return bool(ib) } return bool(!ib) } func main() { var needUmbrella bool raining := true if raining { needUmbrella = true } fmt.Printf("Is it raining? %t. Do I need an umbrella? %t\n", raining, needUmbrella) raining = false needUmbrella = itrue.iif(raining) fmt.Printf("Is it raining? %t. Do I need an umbrella? %t\n", raining, needUmbrella) }
Please provide an equivalent version of this C++ code in Go.
#include <cassert> #include <iostream> #include <vector> class totient_calculator { public: explicit totient_calculator(int max) : totient_(max + 1) { for (int i = 1; i <= max; ++i) totient_[i] = i; for (int i = 2; i <= max; ++i) { if (totient_[i] < i) continue; for (int j = i; j <= max; j += i) totient_[j] -= totient_[j] / i; } } int totient(int n) const { assert (n >= 1 && n < totient_.size()); return totient_[n]; } bool is_prime(int n) const { return totient(n) == n - 1; } private: std::vector<int> totient_; }; bool perfect_totient_number(const totient_calculator& tc, int n) { int sum = 0; for (int m = n; m > 1; ) { int t = tc.totient(m); sum += t; m = t; } return sum == n; } int main() { totient_calculator tc(10000); int count = 0, n = 1; std::cout << "First 20 perfect totient numbers:\n"; for (; count < 20; ++n) { if (perfect_totient_number(tc, n)) { if (count > 0) std::cout << ' '; ++count; std::cout << n; } } std::cout << '\n'; return 0; }
package main import "fmt" func gcd(n, k int) int { if n < k || k < 1 { panic("Need n >= k and k >= 1") } s := 1 for n&1 == 0 && k&1 == 0 { n >>= 1 k >>= 1 s <<= 1 } t := n if n&1 != 0 { t = -k } for t != 0 { for t&1 == 0 { t >>= 1 } if t > 0 { n = t } else { k = -t } t = n - k } return n * s } func totient(n int) int { tot := 0 for k := 1; k <= n; k++ { if gcd(n, k) == 1 { tot++ } } return tot } func main() { var perfect []int for n := 1; len(perfect) < 20; n += 2 { tot := n sum := 0 for tot != 1 { tot = totient(tot) sum += tot } if sum == n { perfect = append(perfect, n) } } fmt.Println("The first 20 perfect totient numbers are:") fmt.Println(perfect) }
Ensure the translated Go code behaves exactly like the original C++ snippet.
#include <cassert> #include <iostream> #include <vector> class totient_calculator { public: explicit totient_calculator(int max) : totient_(max + 1) { for (int i = 1; i <= max; ++i) totient_[i] = i; for (int i = 2; i <= max; ++i) { if (totient_[i] < i) continue; for (int j = i; j <= max; j += i) totient_[j] -= totient_[j] / i; } } int totient(int n) const { assert (n >= 1 && n < totient_.size()); return totient_[n]; } bool is_prime(int n) const { return totient(n) == n - 1; } private: std::vector<int> totient_; }; bool perfect_totient_number(const totient_calculator& tc, int n) { int sum = 0; for (int m = n; m > 1; ) { int t = tc.totient(m); sum += t; m = t; } return sum == n; } int main() { totient_calculator tc(10000); int count = 0, n = 1; std::cout << "First 20 perfect totient numbers:\n"; for (; count < 20; ++n) { if (perfect_totient_number(tc, n)) { if (count > 0) std::cout << ' '; ++count; std::cout << n; } } std::cout << '\n'; return 0; }
package main import "fmt" func gcd(n, k int) int { if n < k || k < 1 { panic("Need n >= k and k >= 1") } s := 1 for n&1 == 0 && k&1 == 0 { n >>= 1 k >>= 1 s <<= 1 } t := n if n&1 != 0 { t = -k } for t != 0 { for t&1 == 0 { t >>= 1 } if t > 0 { n = t } else { k = -t } t = n - k } return n * s } func totient(n int) int { tot := 0 for k := 1; k <= n; k++ { if gcd(n, k) == 1 { tot++ } } return tot } func main() { var perfect []int for n := 1; len(perfect) < 20; n += 2 { tot := n sum := 0 for tot != 1 { tot = totient(tot) sum += tot } if sum == n { perfect = append(perfect, n) } } fmt.Println("The first 20 perfect totient numbers are:") fmt.Println(perfect) }
Please provide an equivalent version of this C++ code in Go.
#include <cassert> #include <iostream> #include <vector> class totient_calculator { public: explicit totient_calculator(int max) : totient_(max + 1) { for (int i = 1; i <= max; ++i) totient_[i] = i; for (int i = 2; i <= max; ++i) { if (totient_[i] < i) continue; for (int j = i; j <= max; j += i) totient_[j] -= totient_[j] / i; } } int totient(int n) const { assert (n >= 1 && n < totient_.size()); return totient_[n]; } bool is_prime(int n) const { return totient(n) == n - 1; } private: std::vector<int> totient_; }; bool perfect_totient_number(const totient_calculator& tc, int n) { int sum = 0; for (int m = n; m > 1; ) { int t = tc.totient(m); sum += t; m = t; } return sum == n; } int main() { totient_calculator tc(10000); int count = 0, n = 1; std::cout << "First 20 perfect totient numbers:\n"; for (; count < 20; ++n) { if (perfect_totient_number(tc, n)) { if (count > 0) std::cout << ' '; ++count; std::cout << n; } } std::cout << '\n'; return 0; }
package main import "fmt" func gcd(n, k int) int { if n < k || k < 1 { panic("Need n >= k and k >= 1") } s := 1 for n&1 == 0 && k&1 == 0 { n >>= 1 k >>= 1 s <<= 1 } t := n if n&1 != 0 { t = -k } for t != 0 { for t&1 == 0 { t >>= 1 } if t > 0 { n = t } else { k = -t } t = n - k } return n * s } func totient(n int) int { tot := 0 for k := 1; k <= n; k++ { if gcd(n, k) == 1 { tot++ } } return tot } func main() { var perfect []int for n := 1; len(perfect) < 20; n += 2 { tot := n sum := 0 for tot != 1 { tot = totient(tot) sum += tot } if sum == n { perfect = append(perfect, n) } } fmt.Println("The first 20 perfect totient numbers are:") fmt.Println(perfect) }
Port the following code from C++ to Go with equivalent syntax and logic.
#include <tr1/memory> #include <string> #include <iostream> #include <tr1/functional> using namespace std; using namespace std::tr1; using std::tr1::function; class IDelegate { public: virtual ~IDelegate() {} }; class IThing { public: virtual ~IThing() {} virtual std::string Thing() = 0; }; class DelegateA : virtual public IDelegate { }; class DelegateB : public IThing, public IDelegate { std::string Thing() { return "delegate implementation"; } }; class Delegator { public: std::string Operation() { if(Delegate) if (IThing * pThing = dynamic_cast<IThing*>(Delegate.get())) return pThing->Thing(); return "default implementation"; } shared_ptr<IDelegate> Delegate; }; int main() { shared_ptr<DelegateA> delegateA(new DelegateA()); shared_ptr<DelegateB> delegateB(new DelegateB()); Delegator delegator; std::cout << delegator.Operation() << std::endl; delegator.Delegate = delegateA; std::cout << delegator.Operation() << std::endl; delegator.Delegate = delegateB; std::cout << delegator.Operation() << std::endl; }
package main import "fmt" type Delegator struct { delegate interface{} } type Thingable interface { thing() string } func (self Delegator) operation() string { if v, ok := self.delegate.(Thingable); ok { return v.thing() } return "default implementation" } type Delegate int func (Delegate) thing() string { return "delegate implementation" } func main() { a := Delegator{} fmt.Println(a.operation()) a.delegate = "A delegate may be any object" fmt.Println(a.operation()) var d Delegate a.delegate = d fmt.Println(a.operation()) }
Rewrite this program in Go while keeping its functionality equivalent to the C++ version.
#include <iomanip> #include <iostream> unsigned int divisor_sum(unsigned int n) { unsigned int total = 1, power = 2; for (; (n & 1) == 0; power <<= 1, n >>= 1) total += power; for (unsigned int p = 3; p * p <= n; p += 2) { unsigned int sum = 1; for (power = p; n % p == 0; power *= p, n /= p) sum += power; total *= sum; } if (n > 1) total *= n + 1; return total; } int main() { const unsigned int limit = 100; std::cout << "Sum of divisors for the first " << limit << " positive integers:\n"; for (unsigned int n = 1; n <= limit; ++n) { std::cout << std::setw(4) << divisor_sum(n); if (n % 10 == 0) std::cout << '\n'; } }
package main import "fmt" func sumDivisors(n int) int { sum := 0 i := 1 k := 2 if n%2 == 0 { k = 1 } for i*i <= n { if n%i == 0 { sum += i j := n / i if j != i { sum += j } } i += k } return sum } func main() { fmt.Println("The sums of positive divisors for the first 100 positive integers are:") for i := 1; i <= 100; i++ { fmt.Printf("%3d ", sumDivisors(i)) if i%10 == 0 { fmt.Println() } } }
Generate a Go translation of this C++ snippet without changing its computational steps.
#include <iomanip> #include <iostream> unsigned int divisor_sum(unsigned int n) { unsigned int total = 1, power = 2; for (; (n & 1) == 0; power <<= 1, n >>= 1) total += power; for (unsigned int p = 3; p * p <= n; p += 2) { unsigned int sum = 1; for (power = p; n % p == 0; power *= p, n /= p) sum += power; total *= sum; } if (n > 1) total *= n + 1; return total; } int main() { const unsigned int limit = 100; std::cout << "Sum of divisors for the first " << limit << " positive integers:\n"; for (unsigned int n = 1; n <= limit; ++n) { std::cout << std::setw(4) << divisor_sum(n); if (n % 10 == 0) std::cout << '\n'; } }
package main import "fmt" func sumDivisors(n int) int { sum := 0 i := 1 k := 2 if n%2 == 0 { k = 1 } for i*i <= n { if n%i == 0 { sum += i j := n / i if j != i { sum += j } } i += k } return sum } func main() { fmt.Println("The sums of positive divisors for the first 100 positive integers are:") for i := 1; i <= 100; i++ { fmt.Printf("%3d ", sumDivisors(i)) if i%10 == 0 { fmt.Println() } } }
Transform the following C++ implementation into Go, maintaining the same output and logic.
#include <iomanip> #include <iostream> unsigned int divisor_sum(unsigned int n) { unsigned int total = 1, power = 2; for (; (n & 1) == 0; power <<= 1, n >>= 1) total += power; for (unsigned int p = 3; p * p <= n; p += 2) { unsigned int sum = 1; for (power = p; n % p == 0; power *= p, n /= p) sum += power; total *= sum; } if (n > 1) total *= n + 1; return total; } int main() { const unsigned int limit = 100; std::cout << "Sum of divisors for the first " << limit << " positive integers:\n"; for (unsigned int n = 1; n <= limit; ++n) { std::cout << std::setw(4) << divisor_sum(n); if (n % 10 == 0) std::cout << '\n'; } }
package main import "fmt" func sumDivisors(n int) int { sum := 0 i := 1 k := 2 if n%2 == 0 { k = 1 } for i*i <= n { if n%i == 0 { sum += i j := n / i if j != i { sum += j } } i += k } return sum } func main() { fmt.Println("The sums of positive divisors for the first 100 positive integers are:") for i := 1; i <= 100; i++ { fmt.Printf("%3d ", sumDivisors(i)) if i%10 == 0 { fmt.Println() } } }
Change the following C++ code into Go without altering its purpose.
#include <algorithm> #include <cctype> #include <iostream> #include <sstream> #include <string> #include <vector> const char* command_table = "Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy " "COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find " "NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput " "Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO " "MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT " "READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT " "RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up"; class command { public: command(const std::string&, size_t); const std::string& cmd() const { return cmd_; } size_t min_length() const { return min_len_; } bool match(const std::string&) const; private: std::string cmd_; size_t min_len_; }; command::command(const std::string& cmd, size_t min_len) : cmd_(cmd), min_len_(min_len) {} bool command::match(const std::string& str) const { size_t olen = str.length(); return olen >= min_len_ && olen <= cmd_.length() && cmd_.compare(0, olen, str) == 0; } void uppercase(std::string& str) { std::transform(str.begin(), str.end(), str.begin(), [](unsigned char c) -> unsigned char { return std::toupper(c); }); } size_t get_min_length(const std::string& str) { size_t len = 0, n = str.length(); while (len < n && std::isupper(static_cast<unsigned char>(str[len]))) ++len; return len; } class command_list { public: explicit command_list(const char*); const command* find_command(const std::string&) const; private: std::vector<command> commands_; }; command_list::command_list(const char* table) { std::vector<command> commands; std::istringstream is(table); std::string word; while (is >> word) { size_t len = get_min_length(word); uppercase(word); commands_.push_back(command(word, len)); } } const command* command_list::find_command(const std::string& word) const { auto iter = std::find_if(commands_.begin(), commands_.end(), [&word](const command& cmd) { return cmd.match(word); }); return (iter != commands_.end()) ? &*iter : nullptr; } std::string test(const command_list& commands, const std::string& input) { std::string output; std::istringstream is(input); std::string word; while (is >> word) { if (!output.empty()) output += ' '; uppercase(word); const command* cmd_ptr = commands.find_command(word); if (cmd_ptr) output += cmd_ptr->cmd(); else output += "*error*"; } return output; } int main() { command_list commands(command_table); std::string input("riG rePEAT copies put mo rest types fup. 6 poweRin"); std::string output(test(commands, input)); std::cout << " input: " << input << '\n'; std::cout << "output: " << output << '\n'; return 0; }
package main import ( "fmt" "strings" ) var table = "Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy " + "COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find " + "NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput " + "Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO " + "MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT " + "READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT " + "RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up " func validate(commands, words []string, minLens []int) []string { results := make([]string, 0) if len(words) == 0 { return results } for _, word := range words { matchFound := false wlen := len(word) for i, command := range commands { if minLens[i] == 0 || wlen < minLens[i] || wlen > len(command) { continue } c := strings.ToUpper(command) w := strings.ToUpper(word) if strings.HasPrefix(c, w) { results = append(results, c) matchFound = true break } } if !matchFound { results = append(results, "*error*") } } return results } func main() { table = strings.TrimSpace(table) commands := strings.Fields(table) clen := len(commands) minLens := make([]int, clen) for i := 0; i < clen; i++ { count := 0 for _, c := range commands[i] { if c >= 'A' && c <= 'Z' { count++ } } minLens[i] = count } sentence := "riG rePEAT copies put mo rest types fup. 6 poweRin" words := strings.Fields(sentence) results := validate(commands, words, minLens) fmt.Print("user words: ") for j := 0; j < len(words); j++ { fmt.Printf("%-*s ", len(results[j]), words[j]) } fmt.Print("\nfull words: ") fmt.Println(strings.Join(results, " ")) }
Write a version of this C++ function in Go with identical behavior.
#include <algorithm> #include <cctype> #include <iostream> #include <sstream> #include <string> #include <vector> const char* command_table = "Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy " "COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find " "NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput " "Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO " "MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT " "READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT " "RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up"; class command { public: command(const std::string&, size_t); const std::string& cmd() const { return cmd_; } size_t min_length() const { return min_len_; } bool match(const std::string&) const; private: std::string cmd_; size_t min_len_; }; command::command(const std::string& cmd, size_t min_len) : cmd_(cmd), min_len_(min_len) {} bool command::match(const std::string& str) const { size_t olen = str.length(); return olen >= min_len_ && olen <= cmd_.length() && cmd_.compare(0, olen, str) == 0; } void uppercase(std::string& str) { std::transform(str.begin(), str.end(), str.begin(), [](unsigned char c) -> unsigned char { return std::toupper(c); }); } size_t get_min_length(const std::string& str) { size_t len = 0, n = str.length(); while (len < n && std::isupper(static_cast<unsigned char>(str[len]))) ++len; return len; } class command_list { public: explicit command_list(const char*); const command* find_command(const std::string&) const; private: std::vector<command> commands_; }; command_list::command_list(const char* table) { std::vector<command> commands; std::istringstream is(table); std::string word; while (is >> word) { size_t len = get_min_length(word); uppercase(word); commands_.push_back(command(word, len)); } } const command* command_list::find_command(const std::string& word) const { auto iter = std::find_if(commands_.begin(), commands_.end(), [&word](const command& cmd) { return cmd.match(word); }); return (iter != commands_.end()) ? &*iter : nullptr; } std::string test(const command_list& commands, const std::string& input) { std::string output; std::istringstream is(input); std::string word; while (is >> word) { if (!output.empty()) output += ' '; uppercase(word); const command* cmd_ptr = commands.find_command(word); if (cmd_ptr) output += cmd_ptr->cmd(); else output += "*error*"; } return output; } int main() { command_list commands(command_table); std::string input("riG rePEAT copies put mo rest types fup. 6 poweRin"); std::string output(test(commands, input)); std::cout << " input: " << input << '\n'; std::cout << "output: " << output << '\n'; return 0; }
package main import ( "fmt" "strings" ) var table = "Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy " + "COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find " + "NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput " + "Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO " + "MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT " + "READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT " + "RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up " func validate(commands, words []string, minLens []int) []string { results := make([]string, 0) if len(words) == 0 { return results } for _, word := range words { matchFound := false wlen := len(word) for i, command := range commands { if minLens[i] == 0 || wlen < minLens[i] || wlen > len(command) { continue } c := strings.ToUpper(command) w := strings.ToUpper(word) if strings.HasPrefix(c, w) { results = append(results, c) matchFound = true break } } if !matchFound { results = append(results, "*error*") } } return results } func main() { table = strings.TrimSpace(table) commands := strings.Fields(table) clen := len(commands) minLens := make([]int, clen) for i := 0; i < clen; i++ { count := 0 for _, c := range commands[i] { if c >= 'A' && c <= 'Z' { count++ } } minLens[i] = count } sentence := "riG rePEAT copies put mo rest types fup. 6 poweRin" words := strings.Fields(sentence) results := validate(commands, words, minLens) fmt.Print("user words: ") for j := 0; j < len(words); j++ { fmt.Printf("%-*s ", len(results[j]), words[j]) } fmt.Print("\nfull words: ") fmt.Println(strings.Join(results, " ")) }
Keep all operations the same but rewrite the snippet in Go.
#include <iostream> class MyOtherClass { public: const int m_x; MyOtherClass(const int initX = 0) : m_x(initX) { } }; int main() { MyOtherClass mocA, mocB(7); std::cout << mocA.m_x << std::endl; std::cout << mocB.m_x << std::endl; return 0; }
package main func main() { s := "immutable" s[0] = 'a' }
Produce a functionally identical Go code for the snippet given in C++.
#include <iostream> #include <span> #include <vector> struct vec2 { float x = 0.0f, y = 0.0f; constexpr vec2 operator+(vec2 other) const { return vec2{x + other.x, y + other.y}; } constexpr vec2 operator-(vec2 other) const { return vec2{x - other.x, y - other.y}; } }; constexpr vec2 operator*(vec2 a, float b) { return vec2{a.x * b, a.y * b}; } constexpr float dot(vec2 a, vec2 b) { return a.x * b.x + a.y * b.y; } constexpr float cross(vec2 a, vec2 b) { return a.x * b.y - b.x * a.y; } constexpr bool is_inside(vec2 point, vec2 a, vec2 b) { return (cross(a - b, point) + cross(b, a)) < 0.0f; } constexpr vec2 intersection(vec2 a1, vec2 a2, vec2 b1, vec2 b2) { return ((b1 - b2) * cross(a1, a2) - (a1 - a2) * cross(b1, b2)) * (1.0f / cross(a1 - a2, b1 - b2)); } std::vector<vec2> suther_land_hodgman( std::span<vec2 const> subject_polygon, std::span<vec2 const> clip_polygon) { if (clip_polygon.empty() || subject_polygon.empty()) { return {}; } std::vector<vec2> ring{subject_polygon.begin(), subject_polygon.end()}; vec2 p1 = clip_polygon[clip_polygon.size() - 1]; std::vector<vec2> input; for (vec2 p2 : clip_polygon) { input.clear(); input.insert(input.end(), ring.begin(), ring.end()); vec2 s = input[input.size() - 1]; ring.clear(); for (vec2 e : input) { if (is_inside(e, p1, p2)) { if (!is_inside(s, p1, p2)) { ring.push_back(intersection(p1, p2, s, e)); } ring.push_back(e); } else if (is_inside(s, p1, p2)) { ring.push_back(intersection(p1, p2, s, e)); } s = e; } p1 = p2; } return ring; } int main(int argc, char **argv) { vec2 subject_polygon[] = {{50, 150}, {200, 50}, {350, 150}, {350, 300}, {250, 300}, {200, 250}, {150, 350}, {100, 250}, {100, 200}}; vec2 clip_polygon[] = {{100, 100}, {300, 100}, {300, 300}, {100, 300}}; std::vector<vec2> clipped_polygon = suther_land_hodgman(subject_polygon, clip_polygon); std::cout << "Clipped polygon points:" << std::endl; for (vec2 p : clipped_polygon) { std::cout << "(" << p.x << ", " << p.y << ")" << std::endl; } return EXIT_SUCCESS; }
package main import "fmt" type point struct { x, y float32 } var subjectPolygon = []point{{50, 150}, {200, 50}, {350, 150}, {350, 300}, {250, 300}, {200, 250}, {150, 350}, {100, 250}, {100, 200}} var clipPolygon = []point{{100, 100}, {300, 100}, {300, 300}, {100, 300}} func main() { var cp1, cp2, s, e point inside := func(p point) bool { return (cp2.x-cp1.x)*(p.y-cp1.y) > (cp2.y-cp1.y)*(p.x-cp1.x) } intersection := func() (p point) { dcx, dcy := cp1.x-cp2.x, cp1.y-cp2.y dpx, dpy := s.x-e.x, s.y-e.y n1 := cp1.x*cp2.y - cp1.y*cp2.x n2 := s.x*e.y - s.y*e.x n3 := 1 / (dcx*dpy - dcy*dpx) p.x = (n1*dpx - n2*dcx) * n3 p.y = (n1*dpy - n2*dcy) * n3 return } outputList := subjectPolygon cp1 = clipPolygon[len(clipPolygon)-1] for _, cp2 = range clipPolygon { inputList := outputList outputList = nil s = inputList[len(inputList)-1] for _, e = range inputList { if inside(e) { if !inside(s) { outputList = append(outputList, intersection()) } outputList = append(outputList, e) } else if inside(s) { outputList = append(outputList, intersection()) } s = e } cp1 = cp2 } fmt.Println(outputList) }
Port the following code from C++ to Go with equivalent syntax and logic.
#include <iostream> #include <algorithm> #include <vector> #include <bitset> #include <string> class bacon { public: bacon() { int x = 0; for( ; x < 9; x++ ) bAlphabet.push_back( std::bitset<5>( x ).to_string() ); bAlphabet.push_back( bAlphabet.back() ); for( ; x < 20; x++ ) bAlphabet.push_back( std::bitset<5>( x ).to_string() ); bAlphabet.push_back( bAlphabet.back() ); for( ; x < 24; x++ ) bAlphabet.push_back( std::bitset<5>( x ).to_string() ); } std::string encode( std::string txt ) { std::string r; size_t z; for( std::string::iterator i = txt.begin(); i != txt.end(); i++ ) { z = toupper( *i ); if( z < 'A' || z > 'Z' ) continue; r.append( bAlphabet.at( ( *i & 31 ) - 1 ) ); } return r; } std::string decode( std::string txt ) { size_t len = txt.length(); while( len % 5 != 0 ) len--; if( len != txt.length() ) txt = txt.substr( 0, len ); std::string r; for( size_t i = 0; i < len; i += 5 ) { r.append( 1, 'A' + std::distance( bAlphabet.begin(), std::find( bAlphabet.begin(), bAlphabet.end(), txt.substr( i, 5 ) ) ) ); } return r; } private: std::vector<std::string> bAlphabet; };
package main import( "fmt" "strings" ) var codes = map[rune]string { 'a' : "AAAAA", 'b' : "AAAAB", 'c' : "AAABA", 'd' : "AAABB", 'e' : "AABAA", 'f' : "AABAB", 'g' : "AABBA", 'h' : "AABBB", 'i' : "ABAAA", 'j' : "ABAAB", 'k' : "ABABA", 'l' : "ABABB", 'm' : "ABBAA", 'n' : "ABBAB", 'o' : "ABBBA", 'p' : "ABBBB", 'q' : "BAAAA", 'r' : "BAAAB", 's' : "BAABA", 't' : "BAABB", 'u' : "BABAA", 'v' : "BABAB", 'w' : "BABBA", 'x' : "BABBB", 'y' : "BBAAA", 'z' : "BBAAB", ' ' : "BBBAA", } func baconEncode(plainText string, message string) string { pt := strings.ToLower(plainText) var sb []byte for _, c := range pt { if c >= 'a' && c <= 'z' { sb = append(sb, codes[c]...) } else { sb = append(sb, codes[' ']...) } } et := string(sb) mg := strings.ToLower(message) sb = nil var count = 0 for _, c := range mg { if c >= 'a' && c <= 'z' { if et[count] == 'A' { sb = append(sb, byte(c)) } else { sb = append(sb, byte(c - 32)) } count++ if count == len(et) { break } } else { sb = append(sb, byte(c)) } } return string(sb) } func baconDecode(message string) string { var sb []byte for _, c := range message { if c >= 'a' && c <= 'z' { sb = append(sb, 'A') } else if c >= 'A' && c <= 'Z' { sb = append(sb, 'B') } } et := string(sb) sb = nil for i := 0; i < len(et); i += 5 { quintet := et[i : i + 5] for k, v := range codes { if v == quintet { sb = append(sb, byte(k)) break } } } return string(sb) } func main() { plainText := "the quick brown fox jumps over the lazy dog" message := "bacon's cipher is a method of steganography created by francis bacon." + "this task is to implement a program for encryption and decryption of " + "plaintext using the simple alphabet of the baconian cipher or some " + "other kind of representation of this alphabet (make anything signify anything). " + "the baconian alphabet may optionally be extended to encode all lower " + "case characters individually and/or adding a few punctuation characters " + "such as the space." cipherText := baconEncode(plainText, message) fmt.Printf("Cipher text ->\n\n%s\n", cipherText) decodedText := baconDecode(cipherText) fmt.Printf("\nHidden text ->\n\n%s\n", decodedText) }
Rewrite the snippet below in Go so it works the same as the original C++ code.
#include <iostream> #include <algorithm> #include <vector> #include <bitset> #include <string> class bacon { public: bacon() { int x = 0; for( ; x < 9; x++ ) bAlphabet.push_back( std::bitset<5>( x ).to_string() ); bAlphabet.push_back( bAlphabet.back() ); for( ; x < 20; x++ ) bAlphabet.push_back( std::bitset<5>( x ).to_string() ); bAlphabet.push_back( bAlphabet.back() ); for( ; x < 24; x++ ) bAlphabet.push_back( std::bitset<5>( x ).to_string() ); } std::string encode( std::string txt ) { std::string r; size_t z; for( std::string::iterator i = txt.begin(); i != txt.end(); i++ ) { z = toupper( *i ); if( z < 'A' || z > 'Z' ) continue; r.append( bAlphabet.at( ( *i & 31 ) - 1 ) ); } return r; } std::string decode( std::string txt ) { size_t len = txt.length(); while( len % 5 != 0 ) len--; if( len != txt.length() ) txt = txt.substr( 0, len ); std::string r; for( size_t i = 0; i < len; i += 5 ) { r.append( 1, 'A' + std::distance( bAlphabet.begin(), std::find( bAlphabet.begin(), bAlphabet.end(), txt.substr( i, 5 ) ) ) ); } return r; } private: std::vector<std::string> bAlphabet; };
package main import( "fmt" "strings" ) var codes = map[rune]string { 'a' : "AAAAA", 'b' : "AAAAB", 'c' : "AAABA", 'd' : "AAABB", 'e' : "AABAA", 'f' : "AABAB", 'g' : "AABBA", 'h' : "AABBB", 'i' : "ABAAA", 'j' : "ABAAB", 'k' : "ABABA", 'l' : "ABABB", 'm' : "ABBAA", 'n' : "ABBAB", 'o' : "ABBBA", 'p' : "ABBBB", 'q' : "BAAAA", 'r' : "BAAAB", 's' : "BAABA", 't' : "BAABB", 'u' : "BABAA", 'v' : "BABAB", 'w' : "BABBA", 'x' : "BABBB", 'y' : "BBAAA", 'z' : "BBAAB", ' ' : "BBBAA", } func baconEncode(plainText string, message string) string { pt := strings.ToLower(plainText) var sb []byte for _, c := range pt { if c >= 'a' && c <= 'z' { sb = append(sb, codes[c]...) } else { sb = append(sb, codes[' ']...) } } et := string(sb) mg := strings.ToLower(message) sb = nil var count = 0 for _, c := range mg { if c >= 'a' && c <= 'z' { if et[count] == 'A' { sb = append(sb, byte(c)) } else { sb = append(sb, byte(c - 32)) } count++ if count == len(et) { break } } else { sb = append(sb, byte(c)) } } return string(sb) } func baconDecode(message string) string { var sb []byte for _, c := range message { if c >= 'a' && c <= 'z' { sb = append(sb, 'A') } else if c >= 'A' && c <= 'Z' { sb = append(sb, 'B') } } et := string(sb) sb = nil for i := 0; i < len(et); i += 5 { quintet := et[i : i + 5] for k, v := range codes { if v == quintet { sb = append(sb, byte(k)) break } } } return string(sb) } func main() { plainText := "the quick brown fox jumps over the lazy dog" message := "bacon's cipher is a method of steganography created by francis bacon." + "this task is to implement a program for encryption and decryption of " + "plaintext using the simple alphabet of the baconian cipher or some " + "other kind of representation of this alphabet (make anything signify anything). " + "the baconian alphabet may optionally be extended to encode all lower " + "case characters individually and/or adding a few punctuation characters " + "such as the space." cipherText := baconEncode(plainText, message) fmt.Printf("Cipher text ->\n\n%s\n", cipherText) decodedText := baconDecode(cipherText) fmt.Printf("\nHidden text ->\n\n%s\n", decodedText) }
Maintain the same structure and functionality when rewriting this code in Go.
#include <iostream> #include <algorithm> #include <vector> #include <bitset> #include <string> class bacon { public: bacon() { int x = 0; for( ; x < 9; x++ ) bAlphabet.push_back( std::bitset<5>( x ).to_string() ); bAlphabet.push_back( bAlphabet.back() ); for( ; x < 20; x++ ) bAlphabet.push_back( std::bitset<5>( x ).to_string() ); bAlphabet.push_back( bAlphabet.back() ); for( ; x < 24; x++ ) bAlphabet.push_back( std::bitset<5>( x ).to_string() ); } std::string encode( std::string txt ) { std::string r; size_t z; for( std::string::iterator i = txt.begin(); i != txt.end(); i++ ) { z = toupper( *i ); if( z < 'A' || z > 'Z' ) continue; r.append( bAlphabet.at( ( *i & 31 ) - 1 ) ); } return r; } std::string decode( std::string txt ) { size_t len = txt.length(); while( len % 5 != 0 ) len--; if( len != txt.length() ) txt = txt.substr( 0, len ); std::string r; for( size_t i = 0; i < len; i += 5 ) { r.append( 1, 'A' + std::distance( bAlphabet.begin(), std::find( bAlphabet.begin(), bAlphabet.end(), txt.substr( i, 5 ) ) ) ); } return r; } private: std::vector<std::string> bAlphabet; };
package main import( "fmt" "strings" ) var codes = map[rune]string { 'a' : "AAAAA", 'b' : "AAAAB", 'c' : "AAABA", 'd' : "AAABB", 'e' : "AABAA", 'f' : "AABAB", 'g' : "AABBA", 'h' : "AABBB", 'i' : "ABAAA", 'j' : "ABAAB", 'k' : "ABABA", 'l' : "ABABB", 'm' : "ABBAA", 'n' : "ABBAB", 'o' : "ABBBA", 'p' : "ABBBB", 'q' : "BAAAA", 'r' : "BAAAB", 's' : "BAABA", 't' : "BAABB", 'u' : "BABAA", 'v' : "BABAB", 'w' : "BABBA", 'x' : "BABBB", 'y' : "BBAAA", 'z' : "BBAAB", ' ' : "BBBAA", } func baconEncode(plainText string, message string) string { pt := strings.ToLower(plainText) var sb []byte for _, c := range pt { if c >= 'a' && c <= 'z' { sb = append(sb, codes[c]...) } else { sb = append(sb, codes[' ']...) } } et := string(sb) mg := strings.ToLower(message) sb = nil var count = 0 for _, c := range mg { if c >= 'a' && c <= 'z' { if et[count] == 'A' { sb = append(sb, byte(c)) } else { sb = append(sb, byte(c - 32)) } count++ if count == len(et) { break } } else { sb = append(sb, byte(c)) } } return string(sb) } func baconDecode(message string) string { var sb []byte for _, c := range message { if c >= 'a' && c <= 'z' { sb = append(sb, 'A') } else if c >= 'A' && c <= 'Z' { sb = append(sb, 'B') } } et := string(sb) sb = nil for i := 0; i < len(et); i += 5 { quintet := et[i : i + 5] for k, v := range codes { if v == quintet { sb = append(sb, byte(k)) break } } } return string(sb) } func main() { plainText := "the quick brown fox jumps over the lazy dog" message := "bacon's cipher is a method of steganography created by francis bacon." + "this task is to implement a program for encryption and decryption of " + "plaintext using the simple alphabet of the baconian cipher or some " + "other kind of representation of this alphabet (make anything signify anything). " + "the baconian alphabet may optionally be extended to encode all lower " + "case characters individually and/or adding a few punctuation characters " + "such as the space." cipherText := baconEncode(plainText, message) fmt.Printf("Cipher text ->\n\n%s\n", cipherText) decodedText := baconDecode(cipherText) fmt.Printf("\nHidden text ->\n\n%s\n", decodedText) }
Produce a language-to-language conversion: from C++ to Go, same semantics.
#include <vector> #include <memory> #include <cmath> #include <iostream> #include <iomanip> using namespace std; typedef vector< int > IntRow; typedef vector< IntRow > IntTable; auto_ptr< IntTable > getSpiralArray( int dimension ) { auto_ptr< IntTable > spiralArrayPtr( new IntTable( dimension, IntRow( dimension ) ) ); int numConcentricSquares = static_cast< int >( ceil( static_cast< double >( dimension ) / 2.0 ) ); int j; int sideLen = dimension; int currNum = 0; for ( int i = 0; i < numConcentricSquares; i++ ) { for ( j = 0; j < sideLen; j++ ) ( *spiralArrayPtr )[ i ][ i + j ] = currNum++; for ( j = 1; j < sideLen; j++ ) ( *spiralArrayPtr )[ i + j ][ dimension - 1 - i ] = currNum++; for ( j = sideLen - 2; j > -1; j-- ) ( *spiralArrayPtr )[ dimension - 1 - i ][ i + j ] = currNum++; for ( j = sideLen - 2; j > 0; j-- ) ( *spiralArrayPtr )[ i + j ][ i ] = currNum++; sideLen -= 2; } return spiralArrayPtr; } void printSpiralArray( const auto_ptr< IntTable >& spiralArrayPtr ) { size_t dimension = spiralArrayPtr->size(); int fieldWidth = static_cast< int >( floor( log10( static_cast< double >( dimension * dimension - 1 ) ) ) ) + 2; size_t col; for ( size_t row = 0; row < dimension; row++ ) { for ( col = 0; col < dimension; col++ ) cout << setw( fieldWidth ) << ( *spiralArrayPtr )[ row ][ col ]; cout << endl; } } int main() { printSpiralArray( getSpiralArray( 5 ) ); }
package main import ( "fmt" "strconv" ) var n = 5 func main() { if n < 1 { return } top, left, bottom, right := 0, 0, n-1, n-1 sz := n * n a := make([]int, sz) i := 0 for left < right { for c := left; c <= right; c++ { a[top*n+c] = i i++ } top++ for r := top; r <= bottom; r++ { a[r*n+right] = i i++ } right-- if top == bottom { break } for c := right; c >= left; c-- { a[bottom*n+c] = i i++ } bottom-- for r := bottom; r >= top; r-- { a[r*n+left] = i i++ } left++ } a[top*n+left] = i w := len(strconv.Itoa(n*n - 1)) for i, e := range a { fmt.Printf("%*d ", w, e) if i%n == n-1 { fmt.Println("") } } }
Write the same algorithm in Go as shown in this C++ implementation.
#include <vector> #include <memory> #include <cmath> #include <iostream> #include <iomanip> using namespace std; typedef vector< int > IntRow; typedef vector< IntRow > IntTable; auto_ptr< IntTable > getSpiralArray( int dimension ) { auto_ptr< IntTable > spiralArrayPtr( new IntTable( dimension, IntRow( dimension ) ) ); int numConcentricSquares = static_cast< int >( ceil( static_cast< double >( dimension ) / 2.0 ) ); int j; int sideLen = dimension; int currNum = 0; for ( int i = 0; i < numConcentricSquares; i++ ) { for ( j = 0; j < sideLen; j++ ) ( *spiralArrayPtr )[ i ][ i + j ] = currNum++; for ( j = 1; j < sideLen; j++ ) ( *spiralArrayPtr )[ i + j ][ dimension - 1 - i ] = currNum++; for ( j = sideLen - 2; j > -1; j-- ) ( *spiralArrayPtr )[ dimension - 1 - i ][ i + j ] = currNum++; for ( j = sideLen - 2; j > 0; j-- ) ( *spiralArrayPtr )[ i + j ][ i ] = currNum++; sideLen -= 2; } return spiralArrayPtr; } void printSpiralArray( const auto_ptr< IntTable >& spiralArrayPtr ) { size_t dimension = spiralArrayPtr->size(); int fieldWidth = static_cast< int >( floor( log10( static_cast< double >( dimension * dimension - 1 ) ) ) ) + 2; size_t col; for ( size_t row = 0; row < dimension; row++ ) { for ( col = 0; col < dimension; col++ ) cout << setw( fieldWidth ) << ( *spiralArrayPtr )[ row ][ col ]; cout << endl; } } int main() { printSpiralArray( getSpiralArray( 5 ) ); }
package main import ( "fmt" "strconv" ) var n = 5 func main() { if n < 1 { return } top, left, bottom, right := 0, 0, n-1, n-1 sz := n * n a := make([]int, sz) i := 0 for left < right { for c := left; c <= right; c++ { a[top*n+c] = i i++ } top++ for r := top; r <= bottom; r++ { a[r*n+right] = i i++ } right-- if top == bottom { break } for c := right; c >= left; c-- { a[bottom*n+c] = i i++ } bottom-- for r := bottom; r >= top; r-- { a[r*n+left] = i i++ } left++ } a[top*n+left] = i w := len(strconv.Itoa(n*n - 1)) for i, e := range a { fmt.Printf("%*d ", w, e) if i%n == n-1 { fmt.Println("") } } }
Preserve the algorithm and functionality while converting the code from C++ to Go.
#include <vector> #include <algorithm> #include <string> template <class T> struct sort_table_functor { typedef bool (*CompFun)(const T &, const T &); const CompFun ordering; const int column; const bool reverse; sort_table_functor(CompFun o, int c, bool r) : ordering(o), column(c), reverse(r) { } bool operator()(const std::vector<T> &x, const std::vector<T> &y) const { const T &a = x[column], &b = y[column]; return reverse ? ordering(b, a) : ordering(a, b); } }; template <class T> bool myLess(const T &x, const T &y) { return x < y; } template <class T> void sort_table(std::vector<std::vector<T> > &table, int column = 0, bool reverse = false, bool (*ordering)(const T &, const T &) = myLess) { std::sort(table.begin(), table.end(), sort_table_functor<T>(ordering, column, reverse)); } #include <iostream> template <class T> void print_matrix(std::vector<std::vector<T> > &data) { for () { for (int j = 0; j < 3; j++) std::cout << data[i][j] << "\t"; std::cout << std::endl; } } bool desc_len_comparator(const std::string &x, const std::string &y) { return x.length() > y.length(); } int main() { std::string data_array[3][3] = { {"a", "b", "c"}, {"", "q", "z"}, {"zap", "zip", "Zot"} }; std::vector<std::vector<std::string> > data_orig; for (int i = 0; i < 3; i++) { std::vector<std::string> row; for (int j = 0; j < 3; j++) row.push_back(data_array[i][j]); data_orig.push_back(row); } print_matrix(data_orig); std::vector<std::vector<std::string> > data = data_orig; sort_table(data); print_matrix(data); data = data_orig; sort_table(data, 2); print_matrix(data); data = data_orig; sort_table(data, 1); print_matrix(data); data = data_orig; sort_table(data, 1, true); print_matrix(data); data = data_orig; sort_table(data, 0, false, desc_len_comparator); print_matrix(data); return 0; }
type cell string type spec struct { less func(cell, cell) bool column int reverse bool } func newSpec() (s spec) { return } t.sort(newSpec()) s := newSpec s.reverse = true t.sort(s)
Can you help me rewrite this code in Go instead of C++, keeping it the same logically?
#include <windows.h> #include <vector> #include <string> using namespace std; struct Point { int x, y; }; class MyBitmap { public: MyBitmap() : pen_(nullptr) {} ~MyBitmap() { DeleteObject(pen_); DeleteDC(hdc_); DeleteObject(bmp_); } bool Create(int w, int h) { BITMAPINFO bi; ZeroMemory(&bi, sizeof(bi)); bi.bmiHeader.biSize = sizeof(bi.bmiHeader); bi.bmiHeader.biBitCount = sizeof(DWORD) * 8; bi.bmiHeader.biCompression = BI_RGB; bi.bmiHeader.biPlanes = 1; bi.bmiHeader.biWidth = w; bi.bmiHeader.biHeight = -h; void *bits_ptr = nullptr; HDC dc = GetDC(GetConsoleWindow()); bmp_ = CreateDIBSection(dc, &bi, DIB_RGB_COLORS, &bits_ptr, nullptr, 0); if (!bmp_) return false; hdc_ = CreateCompatibleDC(dc); SelectObject(hdc_, bmp_); ReleaseDC(GetConsoleWindow(), dc); width_ = w; height_ = h; return true; } void SetPenColor(DWORD clr) { if (pen_) DeleteObject(pen_); pen_ = CreatePen(PS_SOLID, 1, clr); SelectObject(hdc_, pen_); } bool SaveBitmap(const char* path) { HANDLE file = CreateFile(path, GENERIC_WRITE, 0, nullptr, CREATE_ALWAYS, FILE_ATTRIBUTE_NORMAL, nullptr); if (file == INVALID_HANDLE_VALUE) { return false; } BITMAPFILEHEADER fileheader; BITMAPINFO infoheader; BITMAP bitmap; GetObject(bmp_, sizeof(bitmap), &bitmap); DWORD* dwp_bits = new DWORD[bitmap.bmWidth * bitmap.bmHeight]; ZeroMemory(dwp_bits, bitmap.bmWidth * bitmap.bmHeight * sizeof(DWORD)); ZeroMemory(&infoheader, sizeof(BITMAPINFO)); ZeroMemory(&fileheader, sizeof(BITMAPFILEHEADER)); infoheader.bmiHeader.biBitCount = sizeof(DWORD) * 8; infoheader.bmiHeader.biCompression = BI_RGB; infoheader.bmiHeader.biPlanes = 1; infoheader.bmiHeader.biSize = sizeof(infoheader.bmiHeader); infoheader.bmiHeader.biHeight = bitmap.bmHeight; infoheader.bmiHeader.biWidth = bitmap.bmWidth; infoheader.bmiHeader.biSizeImage = bitmap.bmWidth * bitmap.bmHeight * sizeof(DWORD); fileheader.bfType = 0x4D42; fileheader.bfOffBits = sizeof(infoheader.bmiHeader) + sizeof(BITMAPFILEHEADER); fileheader.bfSize = fileheader.bfOffBits + infoheader.bmiHeader.biSizeImage; GetDIBits(hdc_, bmp_, 0, height_, (LPVOID)dwp_bits, &infoheader, DIB_RGB_COLORS); DWORD wb; WriteFile(file, &fileheader, sizeof(BITMAPFILEHEADER), &wb, nullptr); WriteFile(file, &infoheader.bmiHeader, sizeof(infoheader.bmiHeader), &wb, nullptr); WriteFile(file, dwp_bits, bitmap.bmWidth * bitmap.bmHeight * 4, &wb, nullptr); CloseHandle(file); delete[] dwp_bits; return true; } HDC hdc() { return hdc_; } int width() { return width_; } int height() { return height_; } private: HBITMAP bmp_; HDC hdc_; HPEN pen_; int width_, height_; }; static int DistanceSqrd(const Point& point, int x, int y) { int xd = x - point.x; int yd = y - point.y; return (xd * xd) + (yd * yd); } class Voronoi { public: void Make(MyBitmap* bmp, int count) { bmp_ = bmp; CreatePoints(count); CreateColors(); CreateSites(); SetSitesPoints(); } private: void CreateSites() { int w = bmp_->width(), h = bmp_->height(), d; for (int hh = 0; hh < h; hh++) { for (int ww = 0; ww < w; ww++) { int ind = -1, dist = INT_MAX; for (size_t it = 0; it < points_.size(); it++) { const Point& p = points_[it]; d = DistanceSqrd(p, ww, hh); if (d < dist) { dist = d; ind = it; } } if (ind > -1) SetPixel(bmp_->hdc(), ww, hh, colors_[ind]); else __asm nop } } } void SetSitesPoints() { for (const auto& point : points_) { int x = point.x, y = point.y; for (int i = -1; i < 2; i++) for (int j = -1; j < 2; j++) SetPixel(bmp_->hdc(), x + i, y + j, 0); } } void CreatePoints(int count) { const int w = bmp_->width() - 20, h = bmp_->height() - 20; for (int i = 0; i < count; i++) { points_.push_back({ rand() % w + 10, rand() % h + 10 }); } } void CreateColors() { for (size_t i = 0; i < points_.size(); i++) { DWORD c = RGB(rand() % 200 + 50, rand() % 200 + 55, rand() % 200 + 50); colors_.push_back(c); } } vector<Point> points_; vector<DWORD> colors_; MyBitmap* bmp_; }; int main(int argc, char* argv[]) { ShowWindow(GetConsoleWindow(), SW_MAXIMIZE); srand(GetTickCount()); MyBitmap bmp; bmp.Create(512, 512); bmp.SetPenColor(0); Voronoi v; v.Make(&bmp, 50); BitBlt(GetDC(GetConsoleWindow()), 20, 20, 512, 512, bmp.hdc(), 0, 0, SRCCOPY); bmp.SaveBitmap("v.bmp"); system("pause"); return 0; }
package main import ( "fmt" "image" "image/color" "image/draw" "image/png" "math/rand" "os" "time" ) const ( imageWidth = 300 imageHeight = 200 nSites = 10 ) func main() { writePngFile(generateVoronoi(randomSites())) } func generateVoronoi(sx, sy []int) image.Image { sc := make([]color.NRGBA, nSites) for i := range sx { sc[i] = color.NRGBA{uint8(rand.Intn(256)), uint8(rand.Intn(256)), uint8(rand.Intn(256)), 255} } img := image.NewNRGBA(image.Rect(0, 0, imageWidth, imageHeight)) for x := 0; x < imageWidth; x++ { for y := 0; y < imageHeight; y++ { dMin := dot(imageWidth, imageHeight) var sMin int for s := 0; s < nSites; s++ { if d := dot(sx[s]-x, sy[s]-y); d < dMin { sMin = s dMin = d } } img.SetNRGBA(x, y, sc[sMin]) } } black := image.NewUniform(color.Black) for s := 0; s < nSites; s++ { draw.Draw(img, image.Rect(sx[s]-2, sy[s]-2, sx[s]+2, sy[s]+2), black, image.ZP, draw.Src) } return img } func dot(x, y int) int { return x*x + y*y } func randomSites() (sx, sy []int) { rand.Seed(time.Now().Unix()) sx = make([]int, nSites) sy = make([]int, nSites) for i := range sx { sx[i] = rand.Intn(imageWidth) sy[i] = rand.Intn(imageHeight) } return } func writePngFile(img image.Image) { f, err := os.Create("voronoi.png") if err != nil { fmt.Println(err) return } if err = png.Encode(f, img); err != nil { fmt.Println(err) } if err = f.Close(); err != nil { fmt.Println(err) } }
Translate the given C++ code snippet into Go without altering its behavior.
#include <windows.h> #include <vector> #include <string> using namespace std; struct Point { int x, y; }; class MyBitmap { public: MyBitmap() : pen_(nullptr) {} ~MyBitmap() { DeleteObject(pen_); DeleteDC(hdc_); DeleteObject(bmp_); } bool Create(int w, int h) { BITMAPINFO bi; ZeroMemory(&bi, sizeof(bi)); bi.bmiHeader.biSize = sizeof(bi.bmiHeader); bi.bmiHeader.biBitCount = sizeof(DWORD) * 8; bi.bmiHeader.biCompression = BI_RGB; bi.bmiHeader.biPlanes = 1; bi.bmiHeader.biWidth = w; bi.bmiHeader.biHeight = -h; void *bits_ptr = nullptr; HDC dc = GetDC(GetConsoleWindow()); bmp_ = CreateDIBSection(dc, &bi, DIB_RGB_COLORS, &bits_ptr, nullptr, 0); if (!bmp_) return false; hdc_ = CreateCompatibleDC(dc); SelectObject(hdc_, bmp_); ReleaseDC(GetConsoleWindow(), dc); width_ = w; height_ = h; return true; } void SetPenColor(DWORD clr) { if (pen_) DeleteObject(pen_); pen_ = CreatePen(PS_SOLID, 1, clr); SelectObject(hdc_, pen_); } bool SaveBitmap(const char* path) { HANDLE file = CreateFile(path, GENERIC_WRITE, 0, nullptr, CREATE_ALWAYS, FILE_ATTRIBUTE_NORMAL, nullptr); if (file == INVALID_HANDLE_VALUE) { return false; } BITMAPFILEHEADER fileheader; BITMAPINFO infoheader; BITMAP bitmap; GetObject(bmp_, sizeof(bitmap), &bitmap); DWORD* dwp_bits = new DWORD[bitmap.bmWidth * bitmap.bmHeight]; ZeroMemory(dwp_bits, bitmap.bmWidth * bitmap.bmHeight * sizeof(DWORD)); ZeroMemory(&infoheader, sizeof(BITMAPINFO)); ZeroMemory(&fileheader, sizeof(BITMAPFILEHEADER)); infoheader.bmiHeader.biBitCount = sizeof(DWORD) * 8; infoheader.bmiHeader.biCompression = BI_RGB; infoheader.bmiHeader.biPlanes = 1; infoheader.bmiHeader.biSize = sizeof(infoheader.bmiHeader); infoheader.bmiHeader.biHeight = bitmap.bmHeight; infoheader.bmiHeader.biWidth = bitmap.bmWidth; infoheader.bmiHeader.biSizeImage = bitmap.bmWidth * bitmap.bmHeight * sizeof(DWORD); fileheader.bfType = 0x4D42; fileheader.bfOffBits = sizeof(infoheader.bmiHeader) + sizeof(BITMAPFILEHEADER); fileheader.bfSize = fileheader.bfOffBits + infoheader.bmiHeader.biSizeImage; GetDIBits(hdc_, bmp_, 0, height_, (LPVOID)dwp_bits, &infoheader, DIB_RGB_COLORS); DWORD wb; WriteFile(file, &fileheader, sizeof(BITMAPFILEHEADER), &wb, nullptr); WriteFile(file, &infoheader.bmiHeader, sizeof(infoheader.bmiHeader), &wb, nullptr); WriteFile(file, dwp_bits, bitmap.bmWidth * bitmap.bmHeight * 4, &wb, nullptr); CloseHandle(file); delete[] dwp_bits; return true; } HDC hdc() { return hdc_; } int width() { return width_; } int height() { return height_; } private: HBITMAP bmp_; HDC hdc_; HPEN pen_; int width_, height_; }; static int DistanceSqrd(const Point& point, int x, int y) { int xd = x - point.x; int yd = y - point.y; return (xd * xd) + (yd * yd); } class Voronoi { public: void Make(MyBitmap* bmp, int count) { bmp_ = bmp; CreatePoints(count); CreateColors(); CreateSites(); SetSitesPoints(); } private: void CreateSites() { int w = bmp_->width(), h = bmp_->height(), d; for (int hh = 0; hh < h; hh++) { for (int ww = 0; ww < w; ww++) { int ind = -1, dist = INT_MAX; for (size_t it = 0; it < points_.size(); it++) { const Point& p = points_[it]; d = DistanceSqrd(p, ww, hh); if (d < dist) { dist = d; ind = it; } } if (ind > -1) SetPixel(bmp_->hdc(), ww, hh, colors_[ind]); else __asm nop } } } void SetSitesPoints() { for (const auto& point : points_) { int x = point.x, y = point.y; for (int i = -1; i < 2; i++) for (int j = -1; j < 2; j++) SetPixel(bmp_->hdc(), x + i, y + j, 0); } } void CreatePoints(int count) { const int w = bmp_->width() - 20, h = bmp_->height() - 20; for (int i = 0; i < count; i++) { points_.push_back({ rand() % w + 10, rand() % h + 10 }); } } void CreateColors() { for (size_t i = 0; i < points_.size(); i++) { DWORD c = RGB(rand() % 200 + 50, rand() % 200 + 55, rand() % 200 + 50); colors_.push_back(c); } } vector<Point> points_; vector<DWORD> colors_; MyBitmap* bmp_; }; int main(int argc, char* argv[]) { ShowWindow(GetConsoleWindow(), SW_MAXIMIZE); srand(GetTickCount()); MyBitmap bmp; bmp.Create(512, 512); bmp.SetPenColor(0); Voronoi v; v.Make(&bmp, 50); BitBlt(GetDC(GetConsoleWindow()), 20, 20, 512, 512, bmp.hdc(), 0, 0, SRCCOPY); bmp.SaveBitmap("v.bmp"); system("pause"); return 0; }
package main import ( "fmt" "image" "image/color" "image/draw" "image/png" "math/rand" "os" "time" ) const ( imageWidth = 300 imageHeight = 200 nSites = 10 ) func main() { writePngFile(generateVoronoi(randomSites())) } func generateVoronoi(sx, sy []int) image.Image { sc := make([]color.NRGBA, nSites) for i := range sx { sc[i] = color.NRGBA{uint8(rand.Intn(256)), uint8(rand.Intn(256)), uint8(rand.Intn(256)), 255} } img := image.NewNRGBA(image.Rect(0, 0, imageWidth, imageHeight)) for x := 0; x < imageWidth; x++ { for y := 0; y < imageHeight; y++ { dMin := dot(imageWidth, imageHeight) var sMin int for s := 0; s < nSites; s++ { if d := dot(sx[s]-x, sy[s]-y); d < dMin { sMin = s dMin = d } } img.SetNRGBA(x, y, sc[sMin]) } } black := image.NewUniform(color.Black) for s := 0; s < nSites; s++ { draw.Draw(img, image.Rect(sx[s]-2, sy[s]-2, sx[s]+2, sy[s]+2), black, image.ZP, draw.Src) } return img } func dot(x, y int) int { return x*x + y*y } func randomSites() (sx, sy []int) { rand.Seed(time.Now().Unix()) sx = make([]int, nSites) sy = make([]int, nSites) for i := range sx { sx[i] = rand.Intn(imageWidth) sy[i] = rand.Intn(imageHeight) } return } func writePngFile(img image.Image) { f, err := os.Create("voronoi.png") if err != nil { fmt.Println(err) return } if err = png.Encode(f, img); err != nil { fmt.Println(err) } if err = f.Close(); err != nil { fmt.Println(err) } }
Can you help me rewrite this code in Go instead of C++, keeping it the same logically?
FUNCTION MULTIPLY(X, Y) DOUBLE PRECISION MULTIPLY, X, Y
package main import "C" import ( "fmt" "unsafe" ) func main() { go1 := "hello C" c1 := C.CString(go1) go1 = "" c2 := C.strdup(c1) C.free(unsafe.Pointer(c1)) go2 := C.GoString(c2) C.free(unsafe.Pointer(c2)) fmt.Println(go2) }
Produce a language-to-language conversion: from C++ to Go, same semantics.
#include <iostream> #include <functional> #include <vector> #include <cstdlib> #include <ctime> template <typename T> std::function<std::vector<T>(T)> s_of_n_creator(int n) { std::vector<T> sample; int i = 0; return [=](T item) mutable { i++; if (i <= n) { sample.push_back(item); } else if (std::rand() % i < n) { sample[std::rand() % n] = item; } return sample; }; } int main() { std::srand(std::time(NULL)); int bin[10] = {0}; for (int trial = 0; trial < 100000; trial++) { auto s_of_n = s_of_n_creator<int>(3); std::vector<int> sample; for (int i = 0; i < 10; i++) sample = s_of_n(i); for (int s : sample) bin[s]++; } for (int x : bin) std::cout << x << std::endl; return 0; }
package main import ( "fmt" "math/rand" "time" ) func sOfNCreator(n int) func(byte) []byte { s := make([]byte, 0, n) m := n return func(item byte) []byte { if len(s) < n { s = append(s, item) } else { m++ if rand.Intn(m) < n { s[rand.Intn(n)] = item } } return s } } func main() { rand.Seed(time.Now().UnixNano()) var freq [10]int for r := 0; r < 1e5; r++ { sOfN := sOfNCreator(3) for d := byte('0'); d < '9'; d++ { sOfN(d) } for _, d := range sOfN('9') { freq[d-'0']++ } } fmt.Println(freq) }
Can you help me rewrite this code in Go instead of C++, keeping it the same logically?
#include <iostream> #include <functional> #include <vector> #include <cstdlib> #include <ctime> template <typename T> std::function<std::vector<T>(T)> s_of_n_creator(int n) { std::vector<T> sample; int i = 0; return [=](T item) mutable { i++; if (i <= n) { sample.push_back(item); } else if (std::rand() % i < n) { sample[std::rand() % n] = item; } return sample; }; } int main() { std::srand(std::time(NULL)); int bin[10] = {0}; for (int trial = 0; trial < 100000; trial++) { auto s_of_n = s_of_n_creator<int>(3); std::vector<int> sample; for (int i = 0; i < 10; i++) sample = s_of_n(i); for (int s : sample) bin[s]++; } for (int x : bin) std::cout << x << std::endl; return 0; }
package main import ( "fmt" "math/rand" "time" ) func sOfNCreator(n int) func(byte) []byte { s := make([]byte, 0, n) m := n return func(item byte) []byte { if len(s) < n { s = append(s, item) } else { m++ if rand.Intn(m) < n { s[rand.Intn(n)] = item } } return s } } func main() { rand.Seed(time.Now().UnixNano()) var freq [10]int for r := 0; r < 1e5; r++ { sOfN := sOfNCreator(3) for d := byte('0'); d < '9'; d++ { sOfN(d) } for _, d := range sOfN('9') { freq[d-'0']++ } } fmt.Println(freq) }
Can you help me rewrite this code in Go instead of C++, keeping it the same logically?
#include <exception> #include <iomanip> #include <iostream> #include <numeric> #include <sstream> #include <vector> class Frac { public: Frac() : num(0), denom(1) {} Frac(int n, int d) { if (d == 0) { throw std::runtime_error("d must not be zero"); } int sign_of_d = d < 0 ? -1 : 1; int g = std::gcd(n, d); num = sign_of_d * n / g; denom = sign_of_d * d / g; } Frac operator-() const { return Frac(-num, denom); } Frac operator+(const Frac& rhs) const { return Frac(num*rhs.denom + denom * rhs.num, rhs.denom*denom); } Frac operator-(const Frac& rhs) const { return Frac(num*rhs.denom - denom * rhs.num, rhs.denom*denom); } Frac operator*(const Frac& rhs) const { return Frac(num*rhs.num, denom*rhs.denom); } Frac operator*(int rhs) const { return Frac(num * rhs, denom); } friend std::ostream& operator<<(std::ostream&, const Frac&); private: int num; int denom; }; std::ostream & operator<<(std::ostream & os, const Frac &f) { if (f.num == 0 || f.denom == 1) { return os << f.num; } std::stringstream ss; ss << f.num << "/" << f.denom; return os << ss.str(); } Frac bernoulli(int n) { if (n < 0) { throw std::runtime_error("n may not be negative or zero"); } std::vector<Frac> a; for (int m = 0; m <= n; m++) { a.push_back(Frac(1, m + 1)); for (int j = m; j >= 1; j--) { a[j - 1] = (a[j - 1] - a[j]) * j; } } if (n != 1) return a[0]; return -a[0]; } int binomial(int n, int k) { if (n < 0 || k < 0 || n < k) { throw std::runtime_error("parameters are invalid"); } if (n == 0 || k == 0) return 1; int num = 1; for (int i = k + 1; i <= n; i++) { num *= i; } int denom = 1; for (int i = 2; i <= n - k; i++) { denom *= i; } return num / denom; } std::vector<Frac> faulhaberTraingle(int p) { std::vector<Frac> coeffs(p + 1); Frac q{ 1, p + 1 }; int sign = -1; for (int j = 0; j <= p; j++) { sign *= -1; coeffs[p - j] = q * sign * binomial(p + 1, j) * bernoulli(j); } return coeffs; } int main() { for (int i = 0; i < 10; i++) { std::vector<Frac> coeffs = faulhaberTraingle(i); for (auto frac : coeffs) { std::cout << std::right << std::setw(5) << frac << " "; } std::cout << std::endl; } return 0; }
package main import ( "fmt" "math/big" ) func bernoulli(n uint) *big.Rat { a := make([]big.Rat, n+1) z := new(big.Rat) for m := range a { a[m].SetFrac64(1, int64(m+1)) for j := m; j >= 1; j-- { d := &a[j-1] d.Mul(z.SetInt64(int64(j)), d.Sub(d, &a[j])) } } if n != 1 { return &a[0] } a[0].Neg(&a[0]) return &a[0] } func binomial(n, k int) int64 { if n <= 0 || k <= 0 || n < k { return 1 } var num, den int64 = 1, 1 for i := k + 1; i <= n; i++ { num *= int64(i) } for i := 2; i <= n-k; i++ { den *= int64(i) } return num / den } func faulhaberTriangle(p int) []big.Rat { coeffs := make([]big.Rat, p+1) q := big.NewRat(1, int64(p)+1) t := new(big.Rat) u := new(big.Rat) sign := -1 for j := range coeffs { sign *= -1 d := &coeffs[p-j] t.SetInt64(int64(sign)) u.SetInt64(binomial(p+1, j)) d.Mul(q, t) d.Mul(d, u) d.Mul(d, bernoulli(uint(j))) } return coeffs } func main() { for i := 0; i < 10; i++ { coeffs := faulhaberTriangle(i) for _, coeff := range coeffs { fmt.Printf("%5s ", coeff.RatString()) } fmt.Println() } fmt.Println() k := 17 cc := faulhaberTriangle(k) n := int64(1000) nn := big.NewRat(n, 1) np := big.NewRat(1, 1) sum := new(big.Rat) tmp := new(big.Rat) for _, c := range cc { np.Mul(np, nn) tmp.Set(np) tmp.Mul(tmp, &c) sum.Add(sum, tmp) } fmt.Println(sum.RatString()) }
Rewrite the snippet below in Go so it works the same as the original C++ code.
#include <iostream> int main(int argc, char* argv[]) { std::cout << "This program is named " << argv[0] << std::endl; std::cout << "There are " << argc-1 << " arguments given." << std::endl; for (int i = 1; i < argc; ++i) std::cout << "the argument #" << i << " is " << argv[i] << std::endl; return 0; }
package main import ( "fmt" "os" ) func main() { for i, x := range os.Args[1:] { fmt.Printf("the argument #%d is %s\n", i, x) } }
Rewrite the snippet below in Go so it works the same as the original C++ code.
#include <iostream> int main(int argc, char* argv[]) { std::cout << "This program is named " << argv[0] << std::endl; std::cout << "There are " << argc-1 << " arguments given." << std::endl; for (int i = 1; i < argc; ++i) std::cout << "the argument #" << i << " is " << argv[i] << std::endl; return 0; }
package main import ( "fmt" "os" ) func main() { for i, x := range os.Args[1:] { fmt.Printf("the argument #%d is %s\n", i, x) } }
Maintain the same structure and functionality when rewriting this code in Go.
#include <array> #include <iostream> #include <fstream> #include <map> #include <string> #include <vector> #include <boost/program_options.hpp> class letterset { public: letterset() { count_.fill(0); } explicit letterset(const std::string& str) { count_.fill(0); for (char c : str) add(c); } bool contains(const letterset& set) const { for (size_t i = 0; i < count_.size(); ++i) { if (set.count_[i] > count_[i]) return false; } return true; } unsigned int count(char c) const { return count_[index(c)]; } bool is_valid() const { return count_[0] == 0; } void add(char c) { ++count_[index(c)]; } private: static bool is_letter(char c) { return c >= 'a' && c <= 'z'; } static int index(char c) { return is_letter(c) ? c - 'a' + 1 : 0; } std::array<unsigned int, 27> count_; }; template <typename iterator, typename separator> std::string join(iterator begin, iterator end, separator sep) { std::string result; if (begin != end) { result += *begin++; for (; begin != end; ++begin) { result += sep; result += *begin; } } return result; } using dictionary = std::vector<std::pair<std::string, letterset>>; dictionary load_dictionary(const std::string& filename, int min_length, int max_length) { std::ifstream in(filename); if (!in) throw std::runtime_error("Cannot open file " + filename); std::string word; dictionary result; while (getline(in, word)) { if (word.size() < min_length) continue; if (word.size() > max_length) continue; letterset set(word); if (set.is_valid()) result.emplace_back(word, set); } return result; } void word_wheel(const dictionary& dict, const std::string& letters, char central_letter) { letterset set(letters); if (central_letter == 0 && !letters.empty()) central_letter = letters.at(letters.size()/2); std::map<size_t, std::vector<std::string>> words; for (const auto& pair : dict) { const auto& word = pair.first; const auto& subset = pair.second; if (subset.count(central_letter) > 0 && set.contains(subset)) words[word.size()].push_back(word); } size_t total = 0; for (const auto& p : words) { const auto& v = p.second; auto n = v.size(); total += n; std::cout << "Found " << n << " " << (n == 1 ? "word" : "words") << " of length " << p.first << ": " << join(v.begin(), v.end(), ", ") << '\n'; } std::cout << "Number of words found: " << total << '\n'; } void find_max_word_count(const dictionary& dict, int word_length) { size_t max_count = 0; std::vector<std::pair<std::string, char>> max_words; for (const auto& pair : dict) { const auto& word = pair.first; if (word.size() != word_length) continue; const auto& set = pair.second; dictionary subsets; for (const auto& p : dict) { if (set.contains(p.second)) subsets.push_back(p); } letterset done; for (size_t index = 0; index < word_length; ++index) { char central_letter = word[index]; if (done.count(central_letter) > 0) continue; done.add(central_letter); size_t count = 0; for (const auto& p : subsets) { const auto& subset = p.second; if (subset.count(central_letter) > 0) ++count; } if (count > max_count) { max_words.clear(); max_count = count; } if (count == max_count) max_words.emplace_back(word, central_letter); } } std::cout << "Maximum word count: " << max_count << '\n'; std::cout << "Words of " << word_length << " letters producing this count:\n"; for (const auto& pair : max_words) std::cout << pair.first << " with central letter " << pair.second << '\n'; } constexpr const char* option_filename = "filename"; constexpr const char* option_wheel = "wheel"; constexpr const char* option_central = "central"; constexpr const char* option_min_length = "min-length"; constexpr const char* option_part2 = "part2"; int main(int argc, char** argv) { const int word_length = 9; int min_length = 3; std::string letters = "ndeokgelw"; std::string filename = "unixdict.txt"; char central_letter = 0; bool do_part2 = false; namespace po = boost::program_options; po::options_description desc("Allowed options"); desc.add_options() (option_filename, po::value<std::string>(), "name of dictionary file") (option_wheel, po::value<std::string>(), "word wheel letters") (option_central, po::value<char>(), "central letter (defaults to middle letter of word)") (option_min_length, po::value<int>(), "minimum word length") (option_part2, "include part 2"); try { po::variables_map vm; po::store(po::parse_command_line(argc, argv, desc), vm); po::notify(vm); if (vm.count(option_filename)) filename = vm[option_filename].as<std::string>(); if (vm.count(option_wheel)) letters = vm[option_wheel].as<std::string>(); if (vm.count(option_central)) central_letter = vm[option_central].as<char>(); if (vm.count(option_min_length)) min_length = vm[option_min_length].as<int>(); if (vm.count(option_part2)) do_part2 = true; auto dict = load_dictionary(filename, min_length, word_length); word_wheel(dict, letters, central_letter); if (do_part2) { std::cout << '\n'; find_max_word_count(dict, word_length); } } catch (const std::exception& ex) { std::cerr << ex.what() << '\n'; return EXIT_FAILURE; } return EXIT_SUCCESS; }
package main import ( "bytes" "fmt" "io/ioutil" "log" "sort" "strings" ) func main() { b, err := ioutil.ReadFile("unixdict.txt") if err != nil { log.Fatal("Error reading file") } letters := "deegklnow" wordsAll := bytes.Split(b, []byte{'\n'}) var words [][]byte for _, word := range wordsAll { word = bytes.TrimSpace(word) le := len(word) if le > 2 && le < 10 { words = append(words, word) } } var found []string for _, word := range words { le := len(word) if bytes.IndexByte(word, 'k') >= 0 { lets := letters ok := true for i := 0; i < le; i++ { c := word[i] ix := sort.Search(len(lets), func(i int) bool { return lets[i] >= c }) if ix < len(lets) && lets[ix] == c { lets = lets[0:ix] + lets[ix+1:] } else { ok = false break } } if ok { found = append(found, string(word)) } } } fmt.Println("The following", len(found), "words are the solutions to the puzzle:") fmt.Println(strings.Join(found, "\n")) mostFound := 0 var mostWords9 []string var mostLetters []byte var words9 [][]byte for _, word := range words { if len(word) == 9 { words9 = append(words9, word) } } for _, word9 := range words9 { letterBytes := make([]byte, len(word9)) copy(letterBytes, word9) sort.Slice(letterBytes, func(i, j int) bool { return letterBytes[i] < letterBytes[j] }) distinctBytes := []byte{letterBytes[0]} for _, b := range letterBytes[1:] { if b != distinctBytes[len(distinctBytes)-1] { distinctBytes = append(distinctBytes, b) } } distinctLetters := string(distinctBytes) for _, letter := range distinctLetters { found := 0 letterByte := byte(letter) for _, word := range words { le := len(word) if bytes.IndexByte(word, letterByte) >= 0 { lets := string(letterBytes) ok := true for i := 0; i < le; i++ { c := word[i] ix := sort.Search(len(lets), func(i int) bool { return lets[i] >= c }) if ix < len(lets) && lets[ix] == c { lets = lets[0:ix] + lets[ix+1:] } else { ok = false break } } if ok { found = found + 1 } } } if found > mostFound { mostFound = found mostWords9 = []string{string(word9)} mostLetters = []byte{letterByte} } else if found == mostFound { mostWords9 = append(mostWords9, string(word9)) mostLetters = append(mostLetters, letterByte) } } } fmt.Println("\nMost words found =", mostFound) fmt.Println("Nine letter words producing this total:") for i := 0; i < len(mostWords9); i++ { fmt.Println(mostWords9[i], "with central letter", string(mostLetters[i])) } }
Transform the following C++ implementation into Go, maintaining the same output and logic.
#include <vector> #include <iostream> int main() { std::vector<int> a(3), b(4); a[0] = 11; a[1] = 12; a[2] = 13; b[0] = 21; b[1] = 22; b[2] = 23; b[3] = 24; a.insert(a.end(), b.begin(), b.end()); for (int i = 0; i < a.size(); ++i) std::cout << "a[" << i << "] = " << a[i] << "\n"; }
package main import "fmt" func main() { a := []int{1, 2, 3} b := []int{7, 12, 60} c := append(a, b...) fmt.Println(c) i := []interface{}{1, 2, 3} j := []interface{}{"Crosby", "Stills", "Nash", "Young"} k := append(i, j...) fmt.Println(k) l := [...]int{1, 2, 3} m := [...]int{7, 12, 60} var n [len(l) + len(m)]int copy(n[:], l[:]) copy(n[len(l):], m[:]) fmt.Println(n) }
Port the provided C++ code into Go while preserving the original functionality.
#include <iostream> #include <string> using namespace std; int main() { long int integer_input; string string_input; cout << "Enter an integer: "; cin >> integer_input; cout << "Enter a string: "; cin >> string_input; return 0; }
package main import "fmt" func main() { var s string var i int if _, err := fmt.Scan(&s, &i); err == nil && i == 75000 { fmt.Println("good") } else { fmt.Println("wrong") } }
Change the programming language of this snippet from C++ to Go without modifying what it does.
#include <iostream> #include <string> using namespace std; int main() { long int integer_input; string string_input; cout << "Enter an integer: "; cin >> integer_input; cout << "Enter a string: "; cin >> string_input; return 0; }
package main import "fmt" func main() { var s string var i int if _, err := fmt.Scan(&s, &i); err == nil && i == 75000 { fmt.Println("good") } else { fmt.Println("wrong") } }
Change the following C++ code into Go without altering its purpose.
#include <iostream> #include <windows.h> #include <mmsystem.h> #pragma comment ( lib, "winmm.lib" ) typedef unsigned char byte; typedef union { unsigned long word; unsigned char data[4]; } midi_msg; class midi { public: midi() { if( midiOutOpen( &device, 0, 0, 0, CALLBACK_NULL) != MMSYSERR_NOERROR ) { std::cout << "Error opening MIDI Output..." << std::endl; device = 0; } } ~midi() { midiOutReset( device ); midiOutClose( device ); } bool isOpen() { return device != 0; } void setInstrument( byte i ) { message.data[0] = 0xc0; message.data[1] = i; message.data[2] = 0; message.data[3] = 0; midiOutShortMsg( device, message.word ); } void playNote( byte n, unsigned i ) { playNote( n ); Sleep( i ); stopNote( n ); } private: void playNote( byte n ) { message.data[0] = 0x90; message.data[1] = n; message.data[2] = 127; message.data[3] = 0; midiOutShortMsg( device, message.word ); } void stopNote( byte n ) { message.data[0] = 0x90; message.data[1] = n; message.data[2] = 0; message.data[3] = 0; midiOutShortMsg( device, message.word ); } HMIDIOUT device; midi_msg message; }; int main( int argc, char* argv[] ) { midi m; if( m.isOpen() ) { byte notes[] = { 60, 62, 64, 65, 67, 69, 71, 72 }; m.setInstrument( 42 ); for( int x = 0; x < 8; x++ ) m.playNote( notes[x], rand() % 100 + 158 ); Sleep( 1000 ); } return 0; }
package main import ( "encoding/binary" "log" "math" "os" "strings" ) func main() { const ( sampleRate = 44100 duration = 8 dataLength = sampleRate * duration hdrSize = 44 fileLen = dataLength + hdrSize - 8 ) buf1 := make([]byte, 1) buf2 := make([]byte, 2) buf4 := make([]byte, 4) var sb strings.Builder sb.WriteString("RIFF") binary.LittleEndian.PutUint32(buf4, fileLen) sb.Write(buf4) sb.WriteString("WAVE") sb.WriteString("fmt ") binary.LittleEndian.PutUint32(buf4, 16) sb.Write(buf4) binary.LittleEndian.PutUint16(buf2, 1) sb.Write(buf2) sb.Write(buf2) binary.LittleEndian.PutUint32(buf4, sampleRate) sb.Write(buf4) sb.Write(buf4) sb.Write(buf2) binary.LittleEndian.PutUint16(buf2, 8) sb.Write(buf2) sb.WriteString("data") binary.LittleEndian.PutUint32(buf4, dataLength) sb.Write(buf4) wavhdr := []byte(sb.String()) f, err := os.Create("notes.wav") if err != nil { log.Fatal(err) } defer f.Close() f.Write(wavhdr) freqs := [8]float64{261.6, 293.6, 329.6, 349.2, 392.0, 440.0, 493.9, 523.3} for j := 0; j < duration; j++ { freq := freqs[j] omega := 2 * math.Pi * freq for i := 0; i < dataLength/duration; i++ { y := 32 * math.Sin(omega*float64(i)/float64(sampleRate)) buf1[0] = byte(math.Round(y)) f.Write(buf1) } } }
Ensure the translated Go code behaves exactly like the original C++ snippet.
#include <iostream> #include <windows.h> #include <mmsystem.h> #pragma comment ( lib, "winmm.lib" ) typedef unsigned char byte; typedef union { unsigned long word; unsigned char data[4]; } midi_msg; class midi { public: midi() { if( midiOutOpen( &device, 0, 0, 0, CALLBACK_NULL) != MMSYSERR_NOERROR ) { std::cout << "Error opening MIDI Output..." << std::endl; device = 0; } } ~midi() { midiOutReset( device ); midiOutClose( device ); } bool isOpen() { return device != 0; } void setInstrument( byte i ) { message.data[0] = 0xc0; message.data[1] = i; message.data[2] = 0; message.data[3] = 0; midiOutShortMsg( device, message.word ); } void playNote( byte n, unsigned i ) { playNote( n ); Sleep( i ); stopNote( n ); } private: void playNote( byte n ) { message.data[0] = 0x90; message.data[1] = n; message.data[2] = 127; message.data[3] = 0; midiOutShortMsg( device, message.word ); } void stopNote( byte n ) { message.data[0] = 0x90; message.data[1] = n; message.data[2] = 0; message.data[3] = 0; midiOutShortMsg( device, message.word ); } HMIDIOUT device; midi_msg message; }; int main( int argc, char* argv[] ) { midi m; if( m.isOpen() ) { byte notes[] = { 60, 62, 64, 65, 67, 69, 71, 72 }; m.setInstrument( 42 ); for( int x = 0; x < 8; x++ ) m.playNote( notes[x], rand() % 100 + 158 ); Sleep( 1000 ); } return 0; }
package main import ( "encoding/binary" "log" "math" "os" "strings" ) func main() { const ( sampleRate = 44100 duration = 8 dataLength = sampleRate * duration hdrSize = 44 fileLen = dataLength + hdrSize - 8 ) buf1 := make([]byte, 1) buf2 := make([]byte, 2) buf4 := make([]byte, 4) var sb strings.Builder sb.WriteString("RIFF") binary.LittleEndian.PutUint32(buf4, fileLen) sb.Write(buf4) sb.WriteString("WAVE") sb.WriteString("fmt ") binary.LittleEndian.PutUint32(buf4, 16) sb.Write(buf4) binary.LittleEndian.PutUint16(buf2, 1) sb.Write(buf2) sb.Write(buf2) binary.LittleEndian.PutUint32(buf4, sampleRate) sb.Write(buf4) sb.Write(buf4) sb.Write(buf2) binary.LittleEndian.PutUint16(buf2, 8) sb.Write(buf2) sb.WriteString("data") binary.LittleEndian.PutUint32(buf4, dataLength) sb.Write(buf4) wavhdr := []byte(sb.String()) f, err := os.Create("notes.wav") if err != nil { log.Fatal(err) } defer f.Close() f.Write(wavhdr) freqs := [8]float64{261.6, 293.6, 329.6, 349.2, 392.0, 440.0, 493.9, 523.3} for j := 0; j < duration; j++ { freq := freqs[j] omega := 2 * math.Pi * freq for i := 0; i < dataLength/duration; i++ { y := 32 * math.Sin(omega*float64(i)/float64(sampleRate)) buf1[0] = byte(math.Round(y)) f.Write(buf1) } } }
Convert this C++ snippet to Go and keep its semantics consistent.
#include <vector> #include <string> #include <iostream> #include <boost/tuple/tuple.hpp> #include <set> int findBestPack( const std::vector<boost::tuple<std::string , int , int> > & , std::set<int> & , const int ) ; int main( ) { std::vector<boost::tuple<std::string , int , int> > items ; items.push_back( boost::make_tuple( "" , 0 , 0 ) ) ; items.push_back( boost::make_tuple( "map" , 9 , 150 ) ) ; items.push_back( boost::make_tuple( "compass" , 13 , 35 ) ) ; items.push_back( boost::make_tuple( "water" , 153 , 200 ) ) ; items.push_back( boost::make_tuple( "sandwich", 50 , 160 ) ) ; items.push_back( boost::make_tuple( "glucose" , 15 , 60 ) ) ; items.push_back( boost::make_tuple( "tin", 68 , 45 ) ) ; items.push_back( boost::make_tuple( "banana", 27 , 60 ) ) ; items.push_back( boost::make_tuple( "apple" , 39 , 40 ) ) ; items.push_back( boost::make_tuple( "cheese" , 23 , 30 ) ) ; items.push_back( boost::make_tuple( "beer" , 52 , 10 ) ) ; items.push_back( boost::make_tuple( "suntan creme" , 11 , 70 ) ) ; items.push_back( boost::make_tuple( "camera" , 32 , 30 ) ) ; items.push_back( boost::make_tuple( "T-shirt" , 24 , 15 ) ) ; items.push_back( boost::make_tuple( "trousers" , 48 , 10 ) ) ; items.push_back( boost::make_tuple( "umbrella" , 73 , 40 ) ) ; items.push_back( boost::make_tuple( "waterproof trousers" , 42 , 70 ) ) ; items.push_back( boost::make_tuple( "waterproof overclothes" , 43 , 75 ) ) ; items.push_back( boost::make_tuple( "note-case" , 22 , 80 ) ) ; items.push_back( boost::make_tuple( "sunglasses" , 7 , 20 ) ) ; items.push_back( boost::make_tuple( "towel" , 18 , 12 ) ) ; items.push_back( boost::make_tuple( "socks" , 4 , 50 ) ) ; items.push_back( boost::make_tuple( "book" , 30 , 10 ) ) ; const int maximumWeight = 400 ; std::set<int> bestItems ; int bestValue = findBestPack( items , bestItems , maximumWeight ) ; std::cout << "The best value that can be packed in the given knapsack is " << bestValue << " !\n" ; int totalweight = 0 ; std::cout << "The following items should be packed in the knapsack:\n" ; for ( std::set<int>::const_iterator si = bestItems.begin( ) ; si != bestItems.end( ) ; si++ ) { std::cout << (items.begin( ) + *si)->get<0>( ) << "\n" ; totalweight += (items.begin( ) + *si)->get<1>( ) ; } std::cout << "The total weight of all items is " << totalweight << " !\n" ; return 0 ; } int findBestPack( const std::vector<boost::tuple<std::string , int , int> > & items ,std::set<int> & bestItems , const int weightlimit ) { const int n = items.size( ) ; int bestValues [ n ][ weightlimit ] ; std::set<int> solutionSets[ n ][ weightlimit ] ; std::set<int> emptyset ; for ( int i = 0 ; i < n ; i++ ) { for ( int j = 0 ; j < weightlimit ; j++ ) { bestValues[ i ][ j ] = 0 ; solutionSets[ i ][ j ] = emptyset ; } } for ( int i = 0 ; i < n ; i++ ) { for ( int weight = 0 ; weight < weightlimit ; weight++ ) { if ( i == 0 ) bestValues[ i ][ weight ] = 0 ; else { int itemweight = (items.begin( ) + i)->get<1>( ) ; if ( weight < itemweight ) { bestValues[ i ][ weight ] = bestValues[ i - 1 ][ weight ] ; solutionSets[ i ][ weight ] = solutionSets[ i - 1 ][ weight ] ; } else { if ( bestValues[ i - 1 ][ weight - itemweight ] + (items.begin( ) + i)->get<2>( ) > bestValues[ i - 1 ][ weight ] ) { bestValues[ i ][ weight ] = bestValues[ i - 1 ][ weight - itemweight ] + (items.begin( ) + i)->get<2>( ) ; solutionSets[ i ][ weight ] = solutionSets[ i - 1 ][ weight - itemweight ] ; solutionSets[ i ][ weight ].insert( i ) ; } else { bestValues[ i ][ weight ] = bestValues[ i - 1 ][ weight ] ; solutionSets[ i ][ weight ] = solutionSets[ i - 1 ][ weight ] ; } } } } } bestItems.swap( solutionSets[ n - 1][ weightlimit - 1 ] ) ; return bestValues[ n - 1 ][ weightlimit - 1 ] ; }
package main import "fmt" type item struct { string w, v int } var wants = []item{ {"map", 9, 150}, {"compass", 13, 35}, {"water", 153, 200}, {"sandwich", 50, 160}, {"glucose", 15, 60}, {"tin", 68, 45}, {"banana", 27, 60}, {"apple", 39, 40}, {"cheese", 23, 30}, {"beer", 52, 10}, {"suntan cream", 11, 70}, {"camera", 32, 30}, {"T-shirt", 24, 15}, {"trousers", 48, 10}, {"umbrella", 73, 40}, {"waterproof trousers", 42, 70}, {"waterproof overclothes", 43, 75}, {"note-case", 22, 80}, {"sunglasses", 7, 20}, {"towel", 18, 12}, {"socks", 4, 50}, {"book", 30, 10}, } const maxWt = 400 func main() { items, w, v := m(len(wants)-1, maxWt) fmt.Println(items) fmt.Println("weight:", w) fmt.Println("value:", v) } func m(i, w int) ([]string, int, int) { if i < 0 || w == 0 { return nil, 0, 0 } else if wants[i].w > w { return m(i-1, w) } i0, w0, v0 := m(i-1, w) i1, w1, v1 := m(i-1, w-wants[i].w) v1 += wants[i].v if v1 > v0 { return append(i1, wants[i].string), w1 + wants[i].w, v1 } return i0, w0, v0 }
Rewrite this program in Go while keeping its functionality equivalent to the C++ version.
#include <algorithm> #include <iostream> #include <vector> typedef unsigned long long integer; std::vector<integer> get_ancestors(const std::vector<integer>& ancestor, integer n) { std::vector<integer> result; for (integer a = ancestor[n]; a != 0 && a != n; ) { n = a; a = ancestor[n]; result.push_back(n); } return result; } void print_vector(const std::vector<integer>& vec) { if (vec.empty()) { std::cout << "none\n"; return; } auto i = vec.begin(); std::cout << *i++; for (; i != vec.end(); ++i) std::cout << ", " << *i; std::cout << '\n'; } bool is_prime(integer n) { if (n < 2) return false; if (n % 2 == 0) return n == 2; for (integer p = 3; p * p <= n; p += 2) { if (n % p == 0) return false; } return true; } int main(int argc, char** argv) { const size_t limit = 100; std::vector<integer> ancestor(limit, 0); std::vector<std::vector<integer>> descendants(limit); for (size_t prime = 0; prime < limit; ++prime) { if (!is_prime(prime)) continue; descendants[prime].push_back(prime); for (size_t i = 0; i + prime < limit; ++i) { integer s = i + prime; for (integer n : descendants[i]) { integer prod = n * prime; descendants[s].push_back(prod); if (prod < limit) ancestor[prod] = s; } } } size_t total_descendants = 0; for (integer i = 1; i < limit; ++i) { std::vector<integer> ancestors(get_ancestors(ancestor, i)); std::cout << "[" << i << "] Level: " << ancestors.size() << '\n'; std::cout << "Ancestors: "; std::sort(ancestors.begin(), ancestors.end()); print_vector(ancestors); std::cout << "Descendants: "; std::vector<integer>& desc = descendants[i]; if (!desc.empty()) { std::sort(desc.begin(), desc.end()); if (desc[0] == i) desc.erase(desc.begin()); } std::cout << desc.size() << '\n'; total_descendants += desc.size(); if (!desc.empty()) print_vector(desc); std::cout << '\n'; } std::cout << "Total descendants: " << total_descendants << '\n'; return 0; }
package main import ( "fmt" "sort" ) func getPrimes(max int) []int { if max < 2 { return []int{} } lprimes := []int{2} outer: for x := 3; x <= max; x += 2 { for _, p := range lprimes { if x%p == 0 { continue outer } } lprimes = append(lprimes, x) } return lprimes } func main() { const maxSum = 99 descendants := make([][]int64, maxSum+1) ancestors := make([][]int, maxSum+1) for i := 0; i <= maxSum; i++ { descendants[i] = []int64{} ancestors[i] = []int{} } primes := getPrimes(maxSum) for _, p := range primes { descendants[p] = append(descendants[p], int64(p)) for s := 1; s < len(descendants)-p; s++ { temp := make([]int64, len(descendants[s])) for i := 0; i < len(descendants[s]); i++ { temp[i] = int64(p) * descendants[s][i] } descendants[s+p] = append(descendants[s+p], temp...) } } for _, p := range append(primes, 4) { le := len(descendants[p]) if le == 0 { continue } descendants[p][le-1] = 0 descendants[p] = descendants[p][:le-1] } total := 0 for s := 1; s <= maxSum; s++ { x := descendants[s] sort.Slice(x, func(i, j int) bool { return x[i] < x[j] }) total += len(descendants[s]) index := 0 for ; index < len(descendants[s]); index++ { if descendants[s][index] > int64(maxSum) { break } } for _, d := range descendants[s][:index] { ancestors[d] = append(ancestors[s], s) } if (s >= 21 && s <= 45) || (s >= 47 && s <= 73) || (s >= 75 && s < maxSum) { continue } temp := fmt.Sprintf("%v", ancestors[s]) fmt.Printf("%2d: %d Ancestor(s): %-14s", s, len(ancestors[s]), temp) le := len(descendants[s]) if le <= 10 { fmt.Printf("%5d Descendant(s): %v\n", le, descendants[s]) } else { fmt.Printf("%5d Descendant(s): %v\b ...]\n", le, descendants[s][:10]) } } fmt.Println("\nTotal descendants", total) }
Preserve the algorithm and functionality while converting the code from C++ to Go.
#include <iostream> #include <vector> #include <algorithm> void print(const std::vector<std::vector<int>>& v) { std::cout << "{ "; for (const auto& p : v) { std::cout << "("; for (const auto& e : p) { std::cout << e << " "; } std::cout << ") "; } std::cout << "}" << std::endl; } auto product(const std::vector<std::vector<int>>& lists) { std::vector<std::vector<int>> result; if (std::find_if(std::begin(lists), std::end(lists), [](auto e) -> bool { return e.size() == 0; }) != std::end(lists)) { return result; } for (auto& e : lists[0]) { result.push_back({ e }); } for (size_t i = 1; i < lists.size(); ++i) { std::vector<std::vector<int>> temp; for (auto& e : result) { for (auto f : lists[i]) { auto e_tmp = e; e_tmp.push_back(f); temp.push_back(e_tmp); } } result = temp; } return result; } int main() { std::vector<std::vector<int>> prods[] = { { { 1, 2 }, { 3, 4 } }, { { 3, 4 }, { 1, 2} }, { { 1, 2 }, { } }, { { }, { 1, 2 } }, { { 1776, 1789 }, { 7, 12 }, { 4, 14, 23 }, { 0, 1 } }, { { 1, 2, 3 }, { 30 }, { 500, 100 } }, { { 1, 2, 3 }, { }, { 500, 100 } } }; for (const auto& p : prods) { print(product(p)); } std::cin.ignore(); std::cin.get(); return 0; }
package main import "fmt" type pair [2]int func cart2(a, b []int) []pair { p := make([]pair, len(a)*len(b)) i := 0 for _, a := range a { for _, b := range b { p[i] = pair{a, b} i++ } } return p } func main() { fmt.Println(cart2([]int{1, 2}, []int{3, 4})) fmt.Println(cart2([]int{3, 4}, []int{1, 2})) fmt.Println(cart2([]int{1, 2}, nil)) fmt.Println(cart2(nil, []int{1, 2})) }
Write a version of this C++ function in Go with identical behavior.
#include <iostream> #include <vector> #include <algorithm> void print(const std::vector<std::vector<int>>& v) { std::cout << "{ "; for (const auto& p : v) { std::cout << "("; for (const auto& e : p) { std::cout << e << " "; } std::cout << ") "; } std::cout << "}" << std::endl; } auto product(const std::vector<std::vector<int>>& lists) { std::vector<std::vector<int>> result; if (std::find_if(std::begin(lists), std::end(lists), [](auto e) -> bool { return e.size() == 0; }) != std::end(lists)) { return result; } for (auto& e : lists[0]) { result.push_back({ e }); } for (size_t i = 1; i < lists.size(); ++i) { std::vector<std::vector<int>> temp; for (auto& e : result) { for (auto f : lists[i]) { auto e_tmp = e; e_tmp.push_back(f); temp.push_back(e_tmp); } } result = temp; } return result; } int main() { std::vector<std::vector<int>> prods[] = { { { 1, 2 }, { 3, 4 } }, { { 3, 4 }, { 1, 2} }, { { 1, 2 }, { } }, { { }, { 1, 2 } }, { { 1776, 1789 }, { 7, 12 }, { 4, 14, 23 }, { 0, 1 } }, { { 1, 2, 3 }, { 30 }, { 500, 100 } }, { { 1, 2, 3 }, { }, { 500, 100 } } }; for (const auto& p : prods) { print(product(p)); } std::cin.ignore(); std::cin.get(); return 0; }
package main import "fmt" type pair [2]int func cart2(a, b []int) []pair { p := make([]pair, len(a)*len(b)) i := 0 for _, a := range a { for _, b := range b { p[i] = pair{a, b} i++ } } return p } func main() { fmt.Println(cart2([]int{1, 2}, []int{3, 4})) fmt.Println(cart2([]int{3, 4}, []int{1, 2})) fmt.Println(cart2([]int{1, 2}, nil)) fmt.Println(cart2(nil, []int{1, 2})) }
Translate this program into Go but keep the logic exactly as in C++.
#include <functional> #include <algorithm> #include <iostream> #include <vector> #include <cmath> using std::cout; using std::endl; using std::vector; using std::function; using std::transform; using std::back_inserter; typedef function<double(double)> FunType; vector<FunType> A = {sin, cos, tan, [](double x) { return x*x*x; } }; vector<FunType> B = {asin, acos, atan, [](double x) { return exp(log(x)/3); } }; template <typename A, typename B, typename C> function<C(A)> compose(function<C(B)> f, function<B(A)> g) { return [f,g](A x) { return f(g(x)); }; } int main() { vector<FunType> composedFuns; auto exNums = {0.0, 0.2, 0.4, 0.6, 0.8, 1.0}; transform(B.begin(), B.end(), A.begin(), back_inserter(composedFuns), compose<double, double, double>); for (auto num: exNums) for (auto fun: composedFuns) cout << u8"f\u207B\u00B9.f(" << num << ") = " << fun(num) << endl; return 0; }
package main import "math" import "fmt" func cube(x float64) float64 { return math.Pow(x, 3) } type ffType func(float64) float64 func compose(f, g ffType) ffType { return func(x float64) float64 { return f(g(x)) } } func main() { funclist := []ffType{math.Sin, math.Cos, cube} funclisti := []ffType{math.Asin, math.Acos, math.Cbrt} for i := 0; i < 3; i++ { fmt.Println(compose(funclisti[i], funclist[i])(.5)) } }
Change the following C++ code into Go without altering its purpose.
#include <functional> #include <algorithm> #include <iostream> #include <vector> #include <cmath> using std::cout; using std::endl; using std::vector; using std::function; using std::transform; using std::back_inserter; typedef function<double(double)> FunType; vector<FunType> A = {sin, cos, tan, [](double x) { return x*x*x; } }; vector<FunType> B = {asin, acos, atan, [](double x) { return exp(log(x)/3); } }; template <typename A, typename B, typename C> function<C(A)> compose(function<C(B)> f, function<B(A)> g) { return [f,g](A x) { return f(g(x)); }; } int main() { vector<FunType> composedFuns; auto exNums = {0.0, 0.2, 0.4, 0.6, 0.8, 1.0}; transform(B.begin(), B.end(), A.begin(), back_inserter(composedFuns), compose<double, double, double>); for (auto num: exNums) for (auto fun: composedFuns) cout << u8"f\u207B\u00B9.f(" << num << ") = " << fun(num) << endl; return 0; }
package main import "math" import "fmt" func cube(x float64) float64 { return math.Pow(x, 3) } type ffType func(float64) float64 func compose(f, g ffType) ffType { return func(x float64) float64 { return f(g(x)) } } func main() { funclist := []ffType{math.Sin, math.Cos, cube} funclisti := []ffType{math.Asin, math.Acos, math.Cbrt} for i := 0; i < 3; i++ { fmt.Println(compose(funclisti[i], funclist[i])(.5)) } }
Generate an equivalent Go version of this C++ code.
#include <vector> #include <iostream> #include <algorithm> std::vector<int> properDivisors ( int number ) { std::vector<int> divisors ; for ( int i = 1 ; i < number / 2 + 1 ; i++ ) if ( number % i == 0 ) divisors.push_back( i ) ; return divisors ; } int main( ) { std::vector<int> divisors ; unsigned int maxdivisors = 0 ; int corresponding_number = 0 ; for ( int i = 1 ; i < 11 ; i++ ) { divisors = properDivisors ( i ) ; std::cout << "Proper divisors of " << i << ":\n" ; for ( int number : divisors ) { std::cout << number << " " ; } std::cout << std::endl ; divisors.clear( ) ; } for ( int i = 11 ; i < 20001 ; i++ ) { divisors = properDivisors ( i ) ; if ( divisors.size( ) > maxdivisors ) { maxdivisors = divisors.size( ) ; corresponding_number = i ; } divisors.clear( ) ; } std::cout << "Most divisors has " << corresponding_number << " , it has " << maxdivisors << " divisors!\n" ; return 0 ; }
package main import ( "fmt" "strconv" ) func listProperDivisors(limit int) { if limit < 1 { return } width := len(strconv.Itoa(limit)) for i := 1; i <= limit; i++ { fmt.Printf("%*d -> ", width, i) if i == 1 { fmt.Println("(None)") continue } for j := 1; j <= i/2; j++ { if i%j == 0 { fmt.Printf(" %d", j) } } fmt.Println() } } func countProperDivisors(n int) int { if n < 2 { return 0 } count := 0 for i := 1; i <= n/2; i++ { if n%i == 0 { count++ } } return count } func main() { fmt.Println("The proper divisors of the following numbers are :\n") listProperDivisors(10) fmt.Println() maxCount := 0 most := []int{1} for n := 2; n <= 20000; n++ { count := countProperDivisors(n) if count == maxCount { most = append(most, n) } else if count > maxCount { maxCount = count most = most[0:1] most[0] = n } } fmt.Print("The following number(s) <= 20000 have the most proper divisors, ") fmt.Println("namely", maxCount, "\b\n") for _, n := range most { fmt.Println(n) } }
Can you help me rewrite this code in Go instead of C++, keeping it the same logically?
#include <vector> #include <utility> #include <iostream> #include <boost/algorithm/string.hpp> std::string create_xml( std::vector<std::string> & ,std::vector<std::string> & ) ; int main( ) { std::vector<std::string> names , remarks ; names.push_back( "April" ) ; names.push_back( "Tam O'Shantor" ) ; names.push_back ( "Emily" ) ; remarks.push_back( "Bubbly, I'm > Tam and <= Emily" ) ; remarks.push_back( "Burns: \"When chapman billies leave the street ...\"" ) ; remarks.push_back( "Short & shrift" ) ; std::cout << "This is in XML:\n" ; std::cout << create_xml( names , remarks ) << std::endl ; return 0 ; } std::string create_xml( std::vector<std::string> & names , std::vector<std::string> & remarks ) { std::vector<std::pair<std::string , std::string> > entities ; entities.push_back( std::make_pair( "&" , "&amp;" ) ) ; entities.push_back( std::make_pair( "<" , "&lt;" ) ) ; entities.push_back( std::make_pair( ">" , "&gt;" ) ) ; std::string xmlstring ( "<CharacterRemarks>\n" ) ; std::vector<std::string>::iterator vsi = names.begin( ) ; typedef std::vector<std::pair<std::string , std::string> >::iterator Vpss ; for ( ; vsi != names.end( ) ; vsi++ ) { for ( Vpss vs = entities.begin( ) ; vs != entities.end( ) ; vs++ ) { boost::replace_all ( *vsi , vs->first , vs->second ) ; } } for ( vsi = remarks.begin( ) ; vsi != remarks.end( ) ; vsi++ ) { for ( Vpss vs = entities.begin( ) ; vs != entities.end( ) ; vs++ ) { boost::replace_all ( *vsi , vs->first , vs->second ) ; } } for ( int i = 0 ; i < names.size( ) ; i++ ) { xmlstring.append( "\t<Character name=\"").append( names[ i ] ).append( "\">") .append( remarks[ i ] ).append( "</Character>\n" ) ; } xmlstring.append( "</CharacterRemarks>" ) ; return xmlstring ; }
package main import ( "encoding/xml" "fmt" ) func xRemarks(r CharacterRemarks) (string, error) { b, err := xml.MarshalIndent(r, "", " ") return string(b), err } type CharacterRemarks struct { Character []crm } type crm struct { Name string `xml:"name,attr"` Remark string `xml:",chardata"` } func main() { x, err := xRemarks(CharacterRemarks{[]crm{ {`April`, `Bubbly: I'm > Tam and <= Emily`}, {`Tam O'Shanter`, `Burns: "When chapman billies leave the street ..."`}, {`Emily`, `Short & shrift`}, }}) if err != nil { x = err.Error() } fmt.Println(x) }
Translate the given C++ code snippet into Go without altering its behavior.
#include <vector> #include <utility> #include <iostream> #include <boost/algorithm/string.hpp> std::string create_xml( std::vector<std::string> & ,std::vector<std::string> & ) ; int main( ) { std::vector<std::string> names , remarks ; names.push_back( "April" ) ; names.push_back( "Tam O'Shantor" ) ; names.push_back ( "Emily" ) ; remarks.push_back( "Bubbly, I'm > Tam and <= Emily" ) ; remarks.push_back( "Burns: \"When chapman billies leave the street ...\"" ) ; remarks.push_back( "Short & shrift" ) ; std::cout << "This is in XML:\n" ; std::cout << create_xml( names , remarks ) << std::endl ; return 0 ; } std::string create_xml( std::vector<std::string> & names , std::vector<std::string> & remarks ) { std::vector<std::pair<std::string , std::string> > entities ; entities.push_back( std::make_pair( "&" , "&amp;" ) ) ; entities.push_back( std::make_pair( "<" , "&lt;" ) ) ; entities.push_back( std::make_pair( ">" , "&gt;" ) ) ; std::string xmlstring ( "<CharacterRemarks>\n" ) ; std::vector<std::string>::iterator vsi = names.begin( ) ; typedef std::vector<std::pair<std::string , std::string> >::iterator Vpss ; for ( ; vsi != names.end( ) ; vsi++ ) { for ( Vpss vs = entities.begin( ) ; vs != entities.end( ) ; vs++ ) { boost::replace_all ( *vsi , vs->first , vs->second ) ; } } for ( vsi = remarks.begin( ) ; vsi != remarks.end( ) ; vsi++ ) { for ( Vpss vs = entities.begin( ) ; vs != entities.end( ) ; vs++ ) { boost::replace_all ( *vsi , vs->first , vs->second ) ; } } for ( int i = 0 ; i < names.size( ) ; i++ ) { xmlstring.append( "\t<Character name=\"").append( names[ i ] ).append( "\">") .append( remarks[ i ] ).append( "</Character>\n" ) ; } xmlstring.append( "</CharacterRemarks>" ) ; return xmlstring ; }
package main import ( "encoding/xml" "fmt" ) func xRemarks(r CharacterRemarks) (string, error) { b, err := xml.MarshalIndent(r, "", " ") return string(b), err } type CharacterRemarks struct { Character []crm } type crm struct { Name string `xml:"name,attr"` Remark string `xml:",chardata"` } func main() { x, err := xRemarks(CharacterRemarks{[]crm{ {`April`, `Bubbly: I'm > Tam and <= Emily`}, {`Tam O'Shanter`, `Burns: "When chapman billies leave the street ..."`}, {`Emily`, `Short & shrift`}, }}) if err != nil { x = err.Error() } fmt.Println(x) }
Port the provided C++ code into Go while preserving the original functionality.
#include <windows.h> #include <string> #include <vector> using namespace std; const int HSTEP = 46, MWID = 40, MHEI = 471; const float VSTEP = 2.3f; class vector2 { public: vector2() { x = y = 0; } vector2( float a, float b ) { x = a; y = b; } void set( float a, float b ) { x = a; y = b; } float x, y; }; class myBitmap { public: myBitmap() : pen( NULL ), brush( NULL ), clr( 0 ), wid( 1 ) {} ~myBitmap() { DeleteObject( pen ); DeleteObject( brush ); DeleteDC( hdc ); DeleteObject( bmp ); } bool create( int w, int h ) { BITMAPINFO bi; ZeroMemory( &bi, sizeof( bi ) ); bi.bmiHeader.biSize = sizeof( bi.bmiHeader ); bi.bmiHeader.biBitCount = sizeof( DWORD ) * 8; bi.bmiHeader.biCompression = BI_RGB; bi.bmiHeader.biPlanes = 1; bi.bmiHeader.biWidth = w; bi.bmiHeader.biHeight = -h; HDC dc = GetDC( GetConsoleWindow() ); bmp = CreateDIBSection( dc, &bi, DIB_RGB_COLORS, &pBits, NULL, 0 ); if( !bmp ) return false; hdc = CreateCompatibleDC( dc ); SelectObject( hdc, bmp ); ReleaseDC( GetConsoleWindow(), dc ); width = w; height = h; return true; } void clear( BYTE clr = 0 ) { memset( pBits, clr, width * height * sizeof( DWORD ) ); } void setBrushColor( DWORD bClr ) { if( brush ) DeleteObject( brush ); brush = CreateSolidBrush( bClr ); SelectObject( hdc, brush ); } void setPenColor( DWORD c ) { clr = c; createPen(); } void setPenWidth( int w ) { wid = w; createPen(); } void saveBitmap( string path ) { BITMAPFILEHEADER fileheader; BITMAPINFO infoheader; BITMAP bitmap; DWORD wb; GetObject( bmp, sizeof( bitmap ), &bitmap ); DWORD* dwpBits = new DWORD[bitmap.bmWidth * bitmap.bmHeight]; ZeroMemory( dwpBits, bitmap.bmWidth * bitmap.bmHeight * sizeof( DWORD ) ); ZeroMemory( &infoheader, sizeof( BITMAPINFO ) ); ZeroMemory( &fileheader, sizeof( BITMAPFILEHEADER ) ); infoheader.bmiHeader.biBitCount = sizeof( DWORD ) * 8; infoheader.bmiHeader.biCompression = BI_RGB; infoheader.bmiHeader.biPlanes = 1; infoheader.bmiHeader.biSize = sizeof( infoheader.bmiHeader ); infoheader.bmiHeader.biHeight = bitmap.bmHeight; infoheader.bmiHeader.biWidth = bitmap.bmWidth; infoheader.bmiHeader.biSizeImage = bitmap.bmWidth * bitmap.bmHeight * sizeof( DWORD ); fileheader.bfType = 0x4D42; fileheader.bfOffBits = sizeof( infoheader.bmiHeader ) + sizeof( BITMAPFILEHEADER ); fileheader.bfSize = fileheader.bfOffBits + infoheader.bmiHeader.biSizeImage; GetDIBits( hdc, bmp, 0, height, ( LPVOID )dwpBits, &infoheader, DIB_RGB_COLORS ); HANDLE file = CreateFile( path.c_str(), GENERIC_WRITE, 0, NULL, CREATE_ALWAYS, FILE_ATTRIBUTE_NORMAL, NULL ); WriteFile( file, &fileheader, sizeof( BITMAPFILEHEADER ), &wb, NULL ); WriteFile( file, &infoheader.bmiHeader, sizeof( infoheader.bmiHeader ), &wb, NULL ); WriteFile( file, dwpBits, bitmap.bmWidth * bitmap.bmHeight * 4, &wb, NULL ); CloseHandle( file ); delete [] dwpBits; } HDC getDC() const { return hdc; } int getWidth() const { return width; } int getHeight() const { return height; } private: void createPen() { if( pen ) DeleteObject( pen ); pen = CreatePen( PS_SOLID, wid, clr ); SelectObject( hdc, pen ); } HBITMAP bmp; HDC hdc; HPEN pen; HBRUSH brush; void *pBits; int width, height, wid; DWORD clr; }; class plot { public: plot() { bmp.create( 512, 512 ); } void draw( vector<vector2>* pairs ) { bmp.clear( 0xff ); drawGraph( pairs ); plotIt( pairs ); HDC dc = GetDC( GetConsoleWindow() ); BitBlt( dc, 0, 30, 512, 512, bmp.getDC(), 0, 0, SRCCOPY ); ReleaseDC( GetConsoleWindow(), dc ); } private: void drawGraph( vector<vector2>* pairs ) { HDC dc = bmp.getDC(); bmp.setPenColor( RGB( 240, 240, 240 ) ); DWORD b = 11, c = 40, x; RECT rc; char txt[8]; for( x = 0; x < pairs->size(); x++ ) { MoveToEx( dc, 40, b, NULL ); LineTo( dc, 500, b ); MoveToEx( dc, c, 11, NULL ); LineTo( dc, c, 471 ); wsprintf( txt, "%d", ( pairs->size() - x ) * 20 ); SetRect( &rc, 0, b - 9, 36, b + 11 ); DrawText( dc, txt, lstrlen( txt ), &rc, DT_RIGHT | DT_VCENTER | DT_SINGLELINE ); wsprintf( txt, "%d", x ); SetRect( &rc, c - 8, 472, c + 8, 492 ); DrawText( dc, txt, lstrlen( txt ), &rc, DT_CENTER | DT_VCENTER | DT_SINGLELINE ); c += 46; b += 46; } SetRect( &rc, 0, b - 9, 36, b + 11 ); DrawText( dc, "0", 1, &rc, DT_RIGHT | DT_VCENTER | DT_SINGLELINE ); bmp.setPenColor( 0 ); bmp.setPenWidth( 3 ); MoveToEx( dc, 40, 11, NULL ); LineTo( dc, 40, 471 ); MoveToEx( dc, 40, 471, NULL ); LineTo( dc, 500, 471 ); } void plotIt( vector<vector2>* pairs ) { HDC dc = bmp.getDC(); HBRUSH br = CreateSolidBrush( 255 ); RECT rc; bmp.setPenColor( 255 ); bmp.setPenWidth( 2 ); vector<vector2>::iterator it = pairs->begin(); int a = MWID + HSTEP * static_cast<int>( ( *it ).x ), b = MHEI - static_cast<int>( VSTEP * ( *it ).y ); MoveToEx( dc, a, b, NULL ); SetRect( &rc, a - 3, b - 3, a + 3, b + 3 ); FillRect( dc, &rc, br ); it++; for( ; it < pairs->end(); it++ ) { a = MWID + HSTEP * static_cast<int>( ( *it ).x ); b = MHEI - static_cast<int>( VSTEP * ( *it ).y ); SetRect( &rc, a - 3, b - 3, a + 3, b + 3 ); FillRect( dc, &rc, br ); LineTo( dc, a, b ); } DeleteObject( br ); } myBitmap bmp; }; int main( int argc, char* argv[] ) { ShowWindow( GetConsoleWindow(), SW_MAXIMIZE ); plot pt; vector<vector2> pairs; pairs.push_back( vector2( 0, 2.7f ) ); pairs.push_back( vector2( 1, 2.8f ) ); pairs.push_back( vector2( 2.0f, 31.4f ) ); pairs.push_back( vector2( 3.0f, 38.1f ) ); pairs.push_back( vector2( 4.0f, 58.0f ) ); pairs.push_back( vector2( 5.0f, 76.2f ) ); pairs.push_back( vector2( 6.0f, 100.5f ) ); pairs.push_back( vector2( 7.0f, 130.0f ) ); pairs.push_back( vector2( 8.0f, 149.3f ) ); pairs.push_back( vector2( 9.0f, 180.0f ) ); pt.draw( &pairs ); system( "pause" ); return 0; }
package main import ( "fmt" "log" "os/exec" ) var ( x = []int{0, 1, 2, 3, 4, 5, 6, 7, 8, 9} y = []float64{2.7, 2.8, 31.4, 38.1, 58.0, 76.2, 100.5, 130.0, 149.3, 180.0} ) func main() { g := exec.Command("gnuplot", "-persist") w, err := g.StdinPipe() if err != nil { log.Fatal(err) } if err = g.Start(); err != nil { log.Fatal(err) } fmt.Fprintln(w, "unset key; plot '-'") for i, xi := range x { fmt.Fprintf(w, "%d %f\n", xi, y[i]) } fmt.Fprintln(w, "e") w.Close() g.Wait() }
Can you help me rewrite this code in Go instead of C++, keeping it the same logically?
#include <windows.h> #include <string> #include <vector> using namespace std; const int HSTEP = 46, MWID = 40, MHEI = 471; const float VSTEP = 2.3f; class vector2 { public: vector2() { x = y = 0; } vector2( float a, float b ) { x = a; y = b; } void set( float a, float b ) { x = a; y = b; } float x, y; }; class myBitmap { public: myBitmap() : pen( NULL ), brush( NULL ), clr( 0 ), wid( 1 ) {} ~myBitmap() { DeleteObject( pen ); DeleteObject( brush ); DeleteDC( hdc ); DeleteObject( bmp ); } bool create( int w, int h ) { BITMAPINFO bi; ZeroMemory( &bi, sizeof( bi ) ); bi.bmiHeader.biSize = sizeof( bi.bmiHeader ); bi.bmiHeader.biBitCount = sizeof( DWORD ) * 8; bi.bmiHeader.biCompression = BI_RGB; bi.bmiHeader.biPlanes = 1; bi.bmiHeader.biWidth = w; bi.bmiHeader.biHeight = -h; HDC dc = GetDC( GetConsoleWindow() ); bmp = CreateDIBSection( dc, &bi, DIB_RGB_COLORS, &pBits, NULL, 0 ); if( !bmp ) return false; hdc = CreateCompatibleDC( dc ); SelectObject( hdc, bmp ); ReleaseDC( GetConsoleWindow(), dc ); width = w; height = h; return true; } void clear( BYTE clr = 0 ) { memset( pBits, clr, width * height * sizeof( DWORD ) ); } void setBrushColor( DWORD bClr ) { if( brush ) DeleteObject( brush ); brush = CreateSolidBrush( bClr ); SelectObject( hdc, brush ); } void setPenColor( DWORD c ) { clr = c; createPen(); } void setPenWidth( int w ) { wid = w; createPen(); } void saveBitmap( string path ) { BITMAPFILEHEADER fileheader; BITMAPINFO infoheader; BITMAP bitmap; DWORD wb; GetObject( bmp, sizeof( bitmap ), &bitmap ); DWORD* dwpBits = new DWORD[bitmap.bmWidth * bitmap.bmHeight]; ZeroMemory( dwpBits, bitmap.bmWidth * bitmap.bmHeight * sizeof( DWORD ) ); ZeroMemory( &infoheader, sizeof( BITMAPINFO ) ); ZeroMemory( &fileheader, sizeof( BITMAPFILEHEADER ) ); infoheader.bmiHeader.biBitCount = sizeof( DWORD ) * 8; infoheader.bmiHeader.biCompression = BI_RGB; infoheader.bmiHeader.biPlanes = 1; infoheader.bmiHeader.biSize = sizeof( infoheader.bmiHeader ); infoheader.bmiHeader.biHeight = bitmap.bmHeight; infoheader.bmiHeader.biWidth = bitmap.bmWidth; infoheader.bmiHeader.biSizeImage = bitmap.bmWidth * bitmap.bmHeight * sizeof( DWORD ); fileheader.bfType = 0x4D42; fileheader.bfOffBits = sizeof( infoheader.bmiHeader ) + sizeof( BITMAPFILEHEADER ); fileheader.bfSize = fileheader.bfOffBits + infoheader.bmiHeader.biSizeImage; GetDIBits( hdc, bmp, 0, height, ( LPVOID )dwpBits, &infoheader, DIB_RGB_COLORS ); HANDLE file = CreateFile( path.c_str(), GENERIC_WRITE, 0, NULL, CREATE_ALWAYS, FILE_ATTRIBUTE_NORMAL, NULL ); WriteFile( file, &fileheader, sizeof( BITMAPFILEHEADER ), &wb, NULL ); WriteFile( file, &infoheader.bmiHeader, sizeof( infoheader.bmiHeader ), &wb, NULL ); WriteFile( file, dwpBits, bitmap.bmWidth * bitmap.bmHeight * 4, &wb, NULL ); CloseHandle( file ); delete [] dwpBits; } HDC getDC() const { return hdc; } int getWidth() const { return width; } int getHeight() const { return height; } private: void createPen() { if( pen ) DeleteObject( pen ); pen = CreatePen( PS_SOLID, wid, clr ); SelectObject( hdc, pen ); } HBITMAP bmp; HDC hdc; HPEN pen; HBRUSH brush; void *pBits; int width, height, wid; DWORD clr; }; class plot { public: plot() { bmp.create( 512, 512 ); } void draw( vector<vector2>* pairs ) { bmp.clear( 0xff ); drawGraph( pairs ); plotIt( pairs ); HDC dc = GetDC( GetConsoleWindow() ); BitBlt( dc, 0, 30, 512, 512, bmp.getDC(), 0, 0, SRCCOPY ); ReleaseDC( GetConsoleWindow(), dc ); } private: void drawGraph( vector<vector2>* pairs ) { HDC dc = bmp.getDC(); bmp.setPenColor( RGB( 240, 240, 240 ) ); DWORD b = 11, c = 40, x; RECT rc; char txt[8]; for( x = 0; x < pairs->size(); x++ ) { MoveToEx( dc, 40, b, NULL ); LineTo( dc, 500, b ); MoveToEx( dc, c, 11, NULL ); LineTo( dc, c, 471 ); wsprintf( txt, "%d", ( pairs->size() - x ) * 20 ); SetRect( &rc, 0, b - 9, 36, b + 11 ); DrawText( dc, txt, lstrlen( txt ), &rc, DT_RIGHT | DT_VCENTER | DT_SINGLELINE ); wsprintf( txt, "%d", x ); SetRect( &rc, c - 8, 472, c + 8, 492 ); DrawText( dc, txt, lstrlen( txt ), &rc, DT_CENTER | DT_VCENTER | DT_SINGLELINE ); c += 46; b += 46; } SetRect( &rc, 0, b - 9, 36, b + 11 ); DrawText( dc, "0", 1, &rc, DT_RIGHT | DT_VCENTER | DT_SINGLELINE ); bmp.setPenColor( 0 ); bmp.setPenWidth( 3 ); MoveToEx( dc, 40, 11, NULL ); LineTo( dc, 40, 471 ); MoveToEx( dc, 40, 471, NULL ); LineTo( dc, 500, 471 ); } void plotIt( vector<vector2>* pairs ) { HDC dc = bmp.getDC(); HBRUSH br = CreateSolidBrush( 255 ); RECT rc; bmp.setPenColor( 255 ); bmp.setPenWidth( 2 ); vector<vector2>::iterator it = pairs->begin(); int a = MWID + HSTEP * static_cast<int>( ( *it ).x ), b = MHEI - static_cast<int>( VSTEP * ( *it ).y ); MoveToEx( dc, a, b, NULL ); SetRect( &rc, a - 3, b - 3, a + 3, b + 3 ); FillRect( dc, &rc, br ); it++; for( ; it < pairs->end(); it++ ) { a = MWID + HSTEP * static_cast<int>( ( *it ).x ); b = MHEI - static_cast<int>( VSTEP * ( *it ).y ); SetRect( &rc, a - 3, b - 3, a + 3, b + 3 ); FillRect( dc, &rc, br ); LineTo( dc, a, b ); } DeleteObject( br ); } myBitmap bmp; }; int main( int argc, char* argv[] ) { ShowWindow( GetConsoleWindow(), SW_MAXIMIZE ); plot pt; vector<vector2> pairs; pairs.push_back( vector2( 0, 2.7f ) ); pairs.push_back( vector2( 1, 2.8f ) ); pairs.push_back( vector2( 2.0f, 31.4f ) ); pairs.push_back( vector2( 3.0f, 38.1f ) ); pairs.push_back( vector2( 4.0f, 58.0f ) ); pairs.push_back( vector2( 5.0f, 76.2f ) ); pairs.push_back( vector2( 6.0f, 100.5f ) ); pairs.push_back( vector2( 7.0f, 130.0f ) ); pairs.push_back( vector2( 8.0f, 149.3f ) ); pairs.push_back( vector2( 9.0f, 180.0f ) ); pt.draw( &pairs ); system( "pause" ); return 0; }
package main import ( "fmt" "log" "os/exec" ) var ( x = []int{0, 1, 2, 3, 4, 5, 6, 7, 8, 9} y = []float64{2.7, 2.8, 31.4, 38.1, 58.0, 76.2, 100.5, 130.0, 149.3, 180.0} ) func main() { g := exec.Command("gnuplot", "-persist") w, err := g.StdinPipe() if err != nil { log.Fatal(err) } if err = g.Start(); err != nil { log.Fatal(err) } fmt.Fprintln(w, "unset key; plot '-'") for i, xi := range x { fmt.Fprintf(w, "%d %f\n", xi, y[i]) } fmt.Fprintln(w, "e") w.Close() g.Wait() }
Write the same code in Go as shown below in C++.
#include <iostream> #include <string> #include <iterator> #include <regex> int main() { std::regex re(".* string$"); std::string s = "Hi, I am a string"; if (std::regex_match(s, re)) std::cout << "The string matches.\n"; else std::cout << "Oops - not found?\n"; std::regex re2(" a.*a"); std::smatch match; if (std::regex_search(s, match, re2)) { std::cout << "Matched " << match.length() << " characters starting at " << match.position() << ".\n"; std::cout << "Matched character sequence: \"" << match.str() << "\"\n"; } else { std::cout << "Oops - not found?\n"; } std::string dest_string; std::regex_replace(std::back_inserter(dest_string), s.begin(), s.end(), re2, "'m now a changed"); std::cout << dest_string << std::endl; }
package main import "fmt" import "regexp" func main() { str := "I am the original string" matched, _ := regexp.MatchString(".*string$", str) if matched { fmt.Println("ends with 'string'") } pattern := regexp.MustCompile("original") result := pattern.ReplaceAllString(str, "modified") fmt.Println(result) }
Transform the following C++ implementation into Go, maintaining the same output and logic.
#include <iostream> #include <algorithm> #include <string> #include <iterator> struct GuessNumberIterator : std::iterator<std::random_access_iterator_tag, int> { int i; GuessNumberIterator() { } GuessNumberIterator(int _i) : i(_i) { } GuessNumberIterator& operator++() { ++i; return *this; } GuessNumberIterator operator++(int) { GuessNumberIterator tmp = *this; ++(*this); return tmp; } bool operator==(const GuessNumberIterator& y) { return i == y.i; } bool operator!=(const GuessNumberIterator& y) { return i != y.i; } int operator*() { std::cout << "Is your number less than or equal to " << i << "? "; std::string s; std::cin >> s; return (s != "" && (s[0] == 'y' || s[0] == 'Y')) ? 0 : -1; } GuessNumberIterator& operator--() { --i; return *this; } GuessNumberIterator operator--(int) { GuessNumberIterator tmp = *this; --(*this); return tmp; } GuessNumberIterator& operator+=(int n) { i += n; return *this; } GuessNumberIterator& operator-=(int n) { i -= n; return *this; } GuessNumberIterator operator+(int n) { GuessNumberIterator tmp = *this; return tmp += n; } GuessNumberIterator operator-(int n) { GuessNumberIterator tmp = *this; return tmp -= n; } int operator-(const GuessNumberIterator &y) { return i - y.i; } int operator[](int n) { return *(*this + n); } bool operator<(const GuessNumberIterator &y) { return i < y.i; } bool operator>(const GuessNumberIterator &y) { return i > y.i; } bool operator<=(const GuessNumberIterator &y) { return i <= y.i; } bool operator>=(const GuessNumberIterator &y) { return i >= y.i; } }; inline GuessNumberIterator operator+(int n, GuessNumberIterator &i) { return i + n; } const int lower = 0; const int upper = 100; int main() { std::cout << "Instructions:\n" << "Think of integer number from " << lower << " (inclusive) to " << upper << " (exclusive) and\n" << "I will guess it. After each guess, I will ask you if it is less than\n" << "or equal to some number, and you will respond with \"yes\" or \"no\".\n"; int answer = std::lower_bound(GuessNumberIterator(lower), GuessNumberIterator(upper), 0).i; std::cout << "Your number is " << answer << ".\n"; return 0; }
package main import ( "fmt" "sort" ) func main() { lower, upper := 0, 100 fmt.Printf(`Instructions: Think of integer number from %d (inclusive) to %d (exclusive) and I will guess it. After each guess, I will ask you if it is less than or equal to some number, and you will respond with "yes" or "no". `, lower, upper) answer := sort.Search(upper-lower, func (i int) bool { fmt.Printf("Is your number less than or equal to %d? ", lower+i) s := "" fmt.Scanf("%s", &s) return s != "" && s[0] == 'y' }) fmt.Printf("Your number is %d.\n", lower+answer) }
Ensure the translated Go code behaves exactly like the original C++ snippet.
#include <unordered_map> #include <string> int main() { std::string keys[] = { "1", "2", "3" }; std::string vals[] = { "a", "b", "c" }; std::unordered_map<std::string, std::string> hash; for( int i = 0 ; i < 3 ; i++ ) hash[ keys[i] ] = vals[i] ; }
package main import "fmt" func main() { keys := []string{"a", "b", "c"} vals := []int{1, 2, 3} hash := map[string]int{} for i, key := range keys { hash[key] = vals[i] } fmt.Println(hash) }
Generate a Go translation of this C++ snippet without changing its computational steps.
#include <algorithm> #include <cassert> #include <iomanip> #include <iostream> #include <vector> std::vector<int> bins(const std::vector<int>& limits, const std::vector<int>& data) { std::vector<int> result(limits.size() + 1, 0); for (int n : data) { auto i = std::upper_bound(limits.begin(), limits.end(), n); ++result[i - limits.begin()]; } return result; } void print_bins(const std::vector<int>& limits, const std::vector<int>& bins) { size_t n = limits.size(); if (n == 0) return; assert(n + 1 == bins.size()); std::cout << " < " << std::setw(3) << limits[0] << ": " << std::setw(2) << bins[0] << '\n'; for (size_t i = 1; i < n; ++i) std::cout << ">= " << std::setw(3) << limits[i - 1] << " and < " << std::setw(3) << limits[i] << ": " << std::setw(2) << bins[i] << '\n'; std::cout << ">= " << std::setw(3) << limits[n - 1] << "  : " << std::setw(2) << bins[n] << '\n'; } int main() { const std::vector<int> limits1{23, 37, 43, 53, 67, 83}; const std::vector<int> data1{ 95, 21, 94, 12, 99, 4, 70, 75, 83, 93, 52, 80, 57, 5, 53, 86, 65, 17, 92, 83, 71, 61, 54, 58, 47, 16, 8, 9, 32, 84, 7, 87, 46, 19, 30, 37, 96, 6, 98, 40, 79, 97, 45, 64, 60, 29, 49, 36, 43, 55}; std::cout << "Example 1:\n"; print_bins(limits1, bins(limits1, data1)); const std::vector<int> limits2{14, 18, 249, 312, 389, 392, 513, 591, 634, 720}; const std::vector<int> data2{ 445, 814, 519, 697, 700, 130, 255, 889, 481, 122, 932, 77, 323, 525, 570, 219, 367, 523, 442, 933, 416, 589, 930, 373, 202, 253, 775, 47, 731, 685, 293, 126, 133, 450, 545, 100, 741, 583, 763, 306, 655, 267, 248, 477, 549, 238, 62, 678, 98, 534, 622, 907, 406, 714, 184, 391, 913, 42, 560, 247, 346, 860, 56, 138, 546, 38, 985, 948, 58, 213, 799, 319, 390, 634, 458, 945, 733, 507, 916, 123, 345, 110, 720, 917, 313, 845, 426, 9, 457, 628, 410, 723, 354, 895, 881, 953, 677, 137, 397, 97, 854, 740, 83, 216, 421, 94, 517, 479, 292, 963, 376, 981, 480, 39, 257, 272, 157, 5, 316, 395, 787, 942, 456, 242, 759, 898, 576, 67, 298, 425, 894, 435, 831, 241, 989, 614, 987, 770, 384, 692, 698, 765, 331, 487, 251, 600, 879, 342, 982, 527, 736, 795, 585, 40, 54, 901, 408, 359, 577, 237, 605, 847, 353, 968, 832, 205, 838, 427, 876, 959, 686, 646, 835, 127, 621, 892, 443, 198, 988, 791, 466, 23, 707, 467, 33, 670, 921, 180, 991, 396, 160, 436, 717, 918, 8, 374, 101, 684, 727, 749}; std::cout << "\nExample 2:\n"; print_bins(limits2, bins(limits2, data2)); }
package main import ( "fmt" "sort" ) func getBins(limits, data []int) []int { n := len(limits) bins := make([]int, n+1) for _, d := range data { index := sort.SearchInts(limits, d) if index < len(limits) && d == limits[index] { index++ } bins[index]++ } return bins } func printBins(limits, bins []int) { n := len(limits) fmt.Printf(" < %3d = %2d\n", limits[0], bins[0]) for i := 1; i < n; i++ { fmt.Printf(">= %3d and < %3d = %2d\n", limits[i-1], limits[i], bins[i]) } fmt.Printf(">= %3d = %2d\n", limits[n-1], bins[n]) fmt.Println() } func main() { limitsList := [][]int{ {23, 37, 43, 53, 67, 83}, {14, 18, 249, 312, 389, 392, 513, 591, 634, 720}, } dataList := [][]int{ { 95, 21, 94, 12, 99, 4, 70, 75, 83, 93, 52, 80, 57, 5, 53, 86, 65, 17, 92, 83, 71, 61, 54, 58, 47, 16, 8, 9, 32, 84, 7, 87, 46, 19, 30, 37, 96, 6, 98, 40, 79, 97, 45, 64, 60, 29, 49, 36, 43, 55, }, { 445, 814, 519, 697, 700, 130, 255, 889, 481, 122, 932, 77, 323, 525, 570, 219, 367, 523, 442, 933, 416, 589, 930, 373, 202, 253, 775, 47, 731, 685, 293, 126, 133, 450, 545, 100, 741, 583, 763, 306, 655, 267, 248, 477, 549, 238, 62, 678, 98, 534, 622, 907, 406, 714, 184, 391, 913, 42, 560, 247, 346, 860, 56, 138, 546, 38, 985, 948, 58, 213, 799, 319, 390, 634, 458, 945, 733, 507, 916, 123, 345, 110, 720, 917, 313, 845, 426, 9, 457, 628, 410, 723, 354, 895, 881, 953, 677, 137, 397, 97, 854, 740, 83, 216, 421, 94, 517, 479, 292, 963, 376, 981, 480, 39, 257, 272, 157, 5, 316, 395, 787, 942, 456, 242, 759, 898, 576, 67, 298, 425, 894, 435, 831, 241, 989, 614, 987, 770, 384, 692, 698, 765, 331, 487, 251, 600, 879, 342, 982, 527, 736, 795, 585, 40, 54, 901, 408, 359, 577, 237, 605, 847, 353, 968, 832, 205, 838, 427, 876, 959, 686, 646, 835, 127, 621, 892, 443, 198, 988, 791, 466, 23, 707, 467, 33, 670, 921, 180, 991, 396, 160, 436, 717, 918, 8, 374, 101, 684, 727, 749, }, } for i := 0; i < len(limitsList); i++ { fmt.Println("Example", i+1, "\b\n") bins := getBins(limitsList[i], dataList[i]) printBins(limitsList[i], bins) } }
Rewrite the snippet below in Go so it works the same as the original C++ code.
#include <algorithm> #include <cassert> #include <iomanip> #include <iostream> #include <vector> std::vector<int> bins(const std::vector<int>& limits, const std::vector<int>& data) { std::vector<int> result(limits.size() + 1, 0); for (int n : data) { auto i = std::upper_bound(limits.begin(), limits.end(), n); ++result[i - limits.begin()]; } return result; } void print_bins(const std::vector<int>& limits, const std::vector<int>& bins) { size_t n = limits.size(); if (n == 0) return; assert(n + 1 == bins.size()); std::cout << " < " << std::setw(3) << limits[0] << ": " << std::setw(2) << bins[0] << '\n'; for (size_t i = 1; i < n; ++i) std::cout << ">= " << std::setw(3) << limits[i - 1] << " and < " << std::setw(3) << limits[i] << ": " << std::setw(2) << bins[i] << '\n'; std::cout << ">= " << std::setw(3) << limits[n - 1] << "  : " << std::setw(2) << bins[n] << '\n'; } int main() { const std::vector<int> limits1{23, 37, 43, 53, 67, 83}; const std::vector<int> data1{ 95, 21, 94, 12, 99, 4, 70, 75, 83, 93, 52, 80, 57, 5, 53, 86, 65, 17, 92, 83, 71, 61, 54, 58, 47, 16, 8, 9, 32, 84, 7, 87, 46, 19, 30, 37, 96, 6, 98, 40, 79, 97, 45, 64, 60, 29, 49, 36, 43, 55}; std::cout << "Example 1:\n"; print_bins(limits1, bins(limits1, data1)); const std::vector<int> limits2{14, 18, 249, 312, 389, 392, 513, 591, 634, 720}; const std::vector<int> data2{ 445, 814, 519, 697, 700, 130, 255, 889, 481, 122, 932, 77, 323, 525, 570, 219, 367, 523, 442, 933, 416, 589, 930, 373, 202, 253, 775, 47, 731, 685, 293, 126, 133, 450, 545, 100, 741, 583, 763, 306, 655, 267, 248, 477, 549, 238, 62, 678, 98, 534, 622, 907, 406, 714, 184, 391, 913, 42, 560, 247, 346, 860, 56, 138, 546, 38, 985, 948, 58, 213, 799, 319, 390, 634, 458, 945, 733, 507, 916, 123, 345, 110, 720, 917, 313, 845, 426, 9, 457, 628, 410, 723, 354, 895, 881, 953, 677, 137, 397, 97, 854, 740, 83, 216, 421, 94, 517, 479, 292, 963, 376, 981, 480, 39, 257, 272, 157, 5, 316, 395, 787, 942, 456, 242, 759, 898, 576, 67, 298, 425, 894, 435, 831, 241, 989, 614, 987, 770, 384, 692, 698, 765, 331, 487, 251, 600, 879, 342, 982, 527, 736, 795, 585, 40, 54, 901, 408, 359, 577, 237, 605, 847, 353, 968, 832, 205, 838, 427, 876, 959, 686, 646, 835, 127, 621, 892, 443, 198, 988, 791, 466, 23, 707, 467, 33, 670, 921, 180, 991, 396, 160, 436, 717, 918, 8, 374, 101, 684, 727, 749}; std::cout << "\nExample 2:\n"; print_bins(limits2, bins(limits2, data2)); }
package main import ( "fmt" "sort" ) func getBins(limits, data []int) []int { n := len(limits) bins := make([]int, n+1) for _, d := range data { index := sort.SearchInts(limits, d) if index < len(limits) && d == limits[index] { index++ } bins[index]++ } return bins } func printBins(limits, bins []int) { n := len(limits) fmt.Printf(" < %3d = %2d\n", limits[0], bins[0]) for i := 1; i < n; i++ { fmt.Printf(">= %3d and < %3d = %2d\n", limits[i-1], limits[i], bins[i]) } fmt.Printf(">= %3d = %2d\n", limits[n-1], bins[n]) fmt.Println() } func main() { limitsList := [][]int{ {23, 37, 43, 53, 67, 83}, {14, 18, 249, 312, 389, 392, 513, 591, 634, 720}, } dataList := [][]int{ { 95, 21, 94, 12, 99, 4, 70, 75, 83, 93, 52, 80, 57, 5, 53, 86, 65, 17, 92, 83, 71, 61, 54, 58, 47, 16, 8, 9, 32, 84, 7, 87, 46, 19, 30, 37, 96, 6, 98, 40, 79, 97, 45, 64, 60, 29, 49, 36, 43, 55, }, { 445, 814, 519, 697, 700, 130, 255, 889, 481, 122, 932, 77, 323, 525, 570, 219, 367, 523, 442, 933, 416, 589, 930, 373, 202, 253, 775, 47, 731, 685, 293, 126, 133, 450, 545, 100, 741, 583, 763, 306, 655, 267, 248, 477, 549, 238, 62, 678, 98, 534, 622, 907, 406, 714, 184, 391, 913, 42, 560, 247, 346, 860, 56, 138, 546, 38, 985, 948, 58, 213, 799, 319, 390, 634, 458, 945, 733, 507, 916, 123, 345, 110, 720, 917, 313, 845, 426, 9, 457, 628, 410, 723, 354, 895, 881, 953, 677, 137, 397, 97, 854, 740, 83, 216, 421, 94, 517, 479, 292, 963, 376, 981, 480, 39, 257, 272, 157, 5, 316, 395, 787, 942, 456, 242, 759, 898, 576, 67, 298, 425, 894, 435, 831, 241, 989, 614, 987, 770, 384, 692, 698, 765, 331, 487, 251, 600, 879, 342, 982, 527, 736, 795, 585, 40, 54, 901, 408, 359, 577, 237, 605, 847, 353, 968, 832, 205, 838, 427, 876, 959, 686, 646, 835, 127, 621, 892, 443, 198, 988, 791, 466, 23, 707, 467, 33, 670, 921, 180, 991, 396, 160, 436, 717, 918, 8, 374, 101, 684, 727, 749, }, } for i := 0; i < len(limitsList); i++ { fmt.Println("Example", i+1, "\b\n") bins := getBins(limitsList[i], dataList[i]) printBins(limitsList[i], bins) } }