Instruction stringlengths 45 106 | input_code stringlengths 1 13.7k | output_code stringlengths 1 13.7k |
|---|---|---|
Translate the given PHP code snippet into Go without altering its behavior. | <?php
echo "Hello world!\n";
?>
| package main
import "fmt"
func main() { fmt.Println("Hello world!") }
|
Produce a functionally identical Go code for the snippet given in PHP. | <?php
function forwardDiff($anArray, $times = 1) {
if ($times <= 0) { return $anArray; }
for ($accumilation = array(), $i = 1, $j = count($anArray); $i < $j; ++$i) {
$accumilation[] = $anArray[$i] - $anArray[$i - 1];
}
if ($times === 1) { return $accumilation; }
return forwardDiff($accumilation, $times - 1);
}
class ForwardDiffExample extends PweExample {
function _should_run_empty_array_for_single_elem() {
$expected = array($this->rand()->int());
$this->spec(forwardDiff($expected))->shouldEqual(array());
}
function _should_give_diff_of_two_elem_as_single_elem() {
$twoNums = array($this->rand()->int(), $this->rand()->int());
$expected = array($twoNums[1] - $twoNums[0]);
$this->spec(forwardDiff($twoNums))->shouldEqual($expected);
}
function _should_compute_correct_forward_diff_for_longer_arrays() {
$diffInput = array(10, 2, 9, 6, 5);
$expected = array(-8, 7, -3, -1);
$this->spec(forwardDiff($diffInput))->shouldEqual($expected);
}
function _should_apply_more_than_once_if_specified() {
$diffInput = array(4, 6, 9, 3, 4);
$expectedAfter1 = array(2, 3, -6, 1);
$expectedAfter2 = array(1, -9, 7);
$this->spec(forwardDiff($diffInput, 1))->shouldEqual($expectedAfter1);
$this->spec(forwardDiff($diffInput, 2))->shouldEqual($expectedAfter2);
}
function _should_return_array_unaltered_if_no_times() {
$this->spec(forwardDiff($expected = array(1,2,3), 0))->shouldEqual($expected);
}
}
| package main
import "fmt"
func main() {
a := []int{90, 47, 58, 29, 22, 32, 55, 5, 55, 73}
fmt.Println(a)
fmt.Println(fd(a, 9))
}
func fd(a []int, ord int) []int {
for i := 0; i < ord; i++ {
for j := 0; j < len(a)-i-1; j++ {
a[j] = a[j+1] - a[j]
}
}
return a[:len(a)-ord]
}
|
Convert the following code from PHP to Go, ensuring the logic remains intact. | <?php
function forwardDiff($anArray, $times = 1) {
if ($times <= 0) { return $anArray; }
for ($accumilation = array(), $i = 1, $j = count($anArray); $i < $j; ++$i) {
$accumilation[] = $anArray[$i] - $anArray[$i - 1];
}
if ($times === 1) { return $accumilation; }
return forwardDiff($accumilation, $times - 1);
}
class ForwardDiffExample extends PweExample {
function _should_run_empty_array_for_single_elem() {
$expected = array($this->rand()->int());
$this->spec(forwardDiff($expected))->shouldEqual(array());
}
function _should_give_diff_of_two_elem_as_single_elem() {
$twoNums = array($this->rand()->int(), $this->rand()->int());
$expected = array($twoNums[1] - $twoNums[0]);
$this->spec(forwardDiff($twoNums))->shouldEqual($expected);
}
function _should_compute_correct_forward_diff_for_longer_arrays() {
$diffInput = array(10, 2, 9, 6, 5);
$expected = array(-8, 7, -3, -1);
$this->spec(forwardDiff($diffInput))->shouldEqual($expected);
}
function _should_apply_more_than_once_if_specified() {
$diffInput = array(4, 6, 9, 3, 4);
$expectedAfter1 = array(2, 3, -6, 1);
$expectedAfter2 = array(1, -9, 7);
$this->spec(forwardDiff($diffInput, 1))->shouldEqual($expectedAfter1);
$this->spec(forwardDiff($diffInput, 2))->shouldEqual($expectedAfter2);
}
function _should_return_array_unaltered_if_no_times() {
$this->spec(forwardDiff($expected = array(1,2,3), 0))->shouldEqual($expected);
}
}
| package main
import "fmt"
func main() {
a := []int{90, 47, 58, 29, 22, 32, 55, 5, 55, 73}
fmt.Println(a)
fmt.Println(fd(a, 9))
}
func fd(a []int, ord int) []int {
for i := 0; i < ord; i++ {
for j := 0; j < len(a)-i-1; j++ {
a[j] = a[j+1] - a[j]
}
}
return a[:len(a)-ord]
}
|
Maintain the same structure and functionality when rewriting this code in Go. | <?php
function prime($a) {
if (($a % 2 == 0 && $a != 2) || $a < 2)
return false;
$limit = sqrt($a);
for ($i = 2; $i <= $limit; $i++)
if ($a % $i == 0)
return false;
return true;
}
foreach (range(1, 100) as $x)
if (prime($x)) echo "$x\n";
?>
| func IsPrime(n int) bool {
if n < 0 { n = -n }
switch {
case n == 2:
return true
case n < 2 || n % 2 == 0:
return false
default:
for i = 3; i*i <= n; i += 2 {
if n % i == 0 { return false }
}
}
return true
}
|
Port the following code from PHP to Go with equivalent syntax and logic. | <?php
function prime($a) {
if (($a % 2 == 0 && $a != 2) || $a < 2)
return false;
$limit = sqrt($a);
for ($i = 2; $i <= $limit; $i++)
if ($a % $i == 0)
return false;
return true;
}
foreach (range(1, 100) as $x)
if (prime($x)) echo "$x\n";
?>
| func IsPrime(n int) bool {
if n < 0 { n = -n }
switch {
case n == 2:
return true
case n < 2 || n % 2 == 0:
return false
default:
for i = 3; i*i <= n; i += 2 {
if n % i == 0 { return false }
}
}
return true
}
|
Maintain the same structure and functionality when rewriting this code in Go. | <?php
$n=5;
$k=3;
function factorial($val){
for($f=2;$val-1>1;$f*=$val--);
return $f;
}
$binomial_coefficient=factorial($n)/(factorial($k)*factorial($n-$k));
echo $binomial_coefficient;
?>
| package main
import "fmt"
import "math/big"
func main() {
fmt.Println(new(big.Int).Binomial(5, 3))
fmt.Println(new(big.Int).Binomial(60, 30))
}
|
Produce a language-to-language conversion: from PHP to Go, same semantics. | <?php
$n=5;
$k=3;
function factorial($val){
for($f=2;$val-1>1;$f*=$val--);
return $f;
}
$binomial_coefficient=factorial($n)/(factorial($k)*factorial($n-$k));
echo $binomial_coefficient;
?>
| package main
import "fmt"
import "math/big"
func main() {
fmt.Println(new(big.Int).Binomial(5, 3))
fmt.Println(new(big.Int).Binomial(60, 30))
}
|
Produce a functionally identical Go code for the snippet given in PHP. | <?php
$a = array();
# add elements "at the end"
array_push($a, 55, 10, 20);
print_r($a);
# using an explicit key
$a['one'] = 1;
$a['two'] = 2;
print_r($a);
?>
| package main
import "fmt"
func main() {
var a []interface{}
a = append(a, 3)
a = append(a, "apples", "oranges")
fmt.Println(a)
}
|
Change the programming language of this snippet from PHP to Go without modifying what it does. | <?php
$a = array();
# add elements "at the end"
array_push($a, 55, 10, 20);
print_r($a);
# using an explicit key
$a['one'] = 1;
$a['two'] = 2;
print_r($a);
?>
| package main
import "fmt"
func main() {
var a []interface{}
a = append(a, 3)
a = append(a, "apples", "oranges")
fmt.Println(a)
}
|
Preserve the algorithm and functionality while converting the code from PHP to Go. | class Bitmap {
public $data;
public $w;
public $h;
public function __construct($w = 16, $h = 16){
$white = array_fill(0, $w, array(255,255,255));
$this->data = array_fill(0, $h, $white);
$this->w = $w;
$this->h = $h;
}
public function fill($x = 0, $y = 0, $w = null, $h = null, $color = array(0,0,0)){
if (is_null($w)) $w = $this->w;
if (is_null($h)) $h = $this->h;
$w += $x;
$h += $y;
for ($i = $y; $i < $h; $i++){
for ($j = $x; $j < $w; $j++){
$this->setPixel($j, $i, $color);
}
}
}
public function setPixel($x, $y, $color = array(0,0,0)){
if ($x >= $this->w) return false;
if ($x < 0) return false;
if ($y >= $this->h) return false;
if ($y < 0) return false;
$this->data[$y][$x] = $color;
}
public function getPixel($x, $y){
return $this->data[$y][$x];
}
public function writeP6($filename){
$fh = fopen($filename, 'w');
if (!$fh) return false;
fputs($fh, "P6 {$this->w} {$this->h} 255\n");
foreach ($this->data as $row){
foreach($row as $pixel){
fputs($fh, pack('C', $pixel[0]));
fputs($fh, pack('C', $pixel[1]));
fputs($fh, pack('C', $pixel[2]));
}
}
fclose($fh);
}
}
$b = new Bitmap(16,16);
$b->fill();
$b->fill(2, 2, 18, 18, array(240,240,240));
$b->setPixel(0, 15, array(255,0,0));
$b->writeP6('p6.ppm');
| package raster
import (
"fmt"
"io"
"os"
)
func (b *Bitmap) WritePpmTo(w io.Writer) (err error) {
if _, err = fmt.Fprintln(w, "P6"); err != nil {
return
}
for _, c := range b.Comments {
if _, err = fmt.Fprintln(w, c); err != nil {
return
}
}
_, err = fmt.Fprintf(w, "%d %d\n255\n", b.cols, b.rows)
if err != nil {
return
}
b3 := make([]byte, 3*len(b.px))
n1 := 0
for _, px := range b.px {
b3[n1] = px.R
b3[n1+1] = px.G
b3[n1+2] = px.B
n1 += 3
}
if _, err = w.Write(b3); err != nil {
return
}
return
}
func (b *Bitmap) WritePpmFile(fn string) (err error) {
var f *os.File
if f, err = os.Create(fn); err != nil {
return
}
if err = b.WritePpmTo(f); err != nil {
return
}
return f.Close()
}
|
Port the provided PHP code into Go while preserving the original functionality. | class Bitmap {
public $data;
public $w;
public $h;
public function __construct($w = 16, $h = 16){
$white = array_fill(0, $w, array(255,255,255));
$this->data = array_fill(0, $h, $white);
$this->w = $w;
$this->h = $h;
}
public function fill($x = 0, $y = 0, $w = null, $h = null, $color = array(0,0,0)){
if (is_null($w)) $w = $this->w;
if (is_null($h)) $h = $this->h;
$w += $x;
$h += $y;
for ($i = $y; $i < $h; $i++){
for ($j = $x; $j < $w; $j++){
$this->setPixel($j, $i, $color);
}
}
}
public function setPixel($x, $y, $color = array(0,0,0)){
if ($x >= $this->w) return false;
if ($x < 0) return false;
if ($y >= $this->h) return false;
if ($y < 0) return false;
$this->data[$y][$x] = $color;
}
public function getPixel($x, $y){
return $this->data[$y][$x];
}
public function writeP6($filename){
$fh = fopen($filename, 'w');
if (!$fh) return false;
fputs($fh, "P6 {$this->w} {$this->h} 255\n");
foreach ($this->data as $row){
foreach($row as $pixel){
fputs($fh, pack('C', $pixel[0]));
fputs($fh, pack('C', $pixel[1]));
fputs($fh, pack('C', $pixel[2]));
}
}
fclose($fh);
}
}
$b = new Bitmap(16,16);
$b->fill();
$b->fill(2, 2, 18, 18, array(240,240,240));
$b->setPixel(0, 15, array(255,0,0));
$b->writeP6('p6.ppm');
| package raster
import (
"fmt"
"io"
"os"
)
func (b *Bitmap) WritePpmTo(w io.Writer) (err error) {
if _, err = fmt.Fprintln(w, "P6"); err != nil {
return
}
for _, c := range b.Comments {
if _, err = fmt.Fprintln(w, c); err != nil {
return
}
}
_, err = fmt.Fprintf(w, "%d %d\n255\n", b.cols, b.rows)
if err != nil {
return
}
b3 := make([]byte, 3*len(b.px))
n1 := 0
for _, px := range b.px {
b3[n1] = px.R
b3[n1+1] = px.G
b3[n1+2] = px.B
n1 += 3
}
if _, err = w.Write(b3); err != nil {
return
}
return
}
func (b *Bitmap) WritePpmFile(fn string) (err error) {
var f *os.File
if f, err = os.Create(fn); err != nil {
return
}
if err = b.WritePpmTo(f); err != nil {
return
}
return f.Close()
}
|
Produce a language-to-language conversion: from PHP to Go, same semantics. | <?php
unlink('input.txt');
unlink('/input.txt');
rmdir('docs');
rmdir('/docs');
?>
| package main
import "os"
func main() {
os.Remove("input.txt")
os.Remove("/input.txt")
os.Remove("docs")
os.Remove("/docs")
os.RemoveAll("docs")
os.RemoveAll("/docs")
}
|
Maintain the same structure and functionality when rewriting this code in Go. | <?php
unlink('input.txt');
unlink('/input.txt');
rmdir('docs');
rmdir('/docs');
?>
| package main
import "os"
func main() {
os.Remove("input.txt")
os.Remove("/input.txt")
os.Remove("docs")
os.Remove("/docs")
os.RemoveAll("docs")
os.RemoveAll("/docs")
}
|
Generate a Go translation of this PHP snippet without changing its computational steps. | <?php
$Anerisia = array(31,28,31,30,31,30,31,31,30,31,30,31);
$MONTHS = array("Choas","Discord","Confusion","Bureacracy","The Aftermath");
$DAYS = array("Setting Orange","Sweetmorn","BoomTime","Pungenday","Prickle-Prickle");
$Dsuff = array('th','st','nd','rd','th','th','th','th','th','th');
$Holy5 = array("Mungday","MojoDay","Syaday","Zaraday","Maladay");
$Holy50 = array("Chaoflux","Discoflux","Confuflux","Bureflux","Afflux");
$edate = explode(" ",date('Y m j L'));
$usery = $edate[0];
$userm = $edate[1];
$userd = $edate[2];
$IsLeap = $edate[3];
if (isset($_GET['y']) && isset($_GET['m']) && isset($_GET['d'])) {
$usery = $_GET['y'];
$userm = $_GET['m'];
$userd = $_GET['d'];
$IsLeap = 0;
if (($usery%4 == 0) && ($usery%100 >0)) $IsLeap =1;
if ($usery%400 == 0) $IsLeap = 1;
}
$userdays = 0;
$i = 0;
while ($i < ($userm-1)) {
$userdays = $userdays + $Anerisia[$i];
$i = $i +1;
}
$userdays = $userdays + $userd;
$IsHolyday = 0;
$dyear = $usery + 1166;
$dmonth = $MONTHS[$userdays/73.2];
$dday = $userdays%73;
if (0 == $dday) $dday = 73;
$Dname = $DAYS[$userdays%5];
$Holyday = "St. Tibs Day";
if ($dday == 5) {
$Holyday = $Holy5[$userdays/73.2];
$IsHolyday =1;
}
if ($dday == 50) {
$Holyday = $Holy50[$userdays/73.2];
$IsHolyday =1;
}
if (($IsLeap ==1) && ($userd ==29) and ($userm ==2)) $IsHolyday = 2;
$suff = $Dsuff[$dday%10] ;
if ((11 <= $dday) && (19 >= $dday)) $suff='th';
if ($IsHolyday ==2)
echo "</br>Celeberate ",$Holyday," ",$dmonth," YOLD ",$dyear;
if ($IsHolyday ==1)
echo "</br>Celeberate for today ", $Dname , " The ", $dday,"<sup>",$suff,"</sup>", " day of ", $dmonth , " YOLD " , $dyear , " is the holy day of " , $Holyday;
if ($IsHolyday == 0)
echo "</br>Today is " , $Dname , " the " , $dday ,"<sup>",$suff, "</sup> day of " , $dmonth , " YOLD " , $dyear;
?>
| package ddate
import (
"strconv"
"strings"
"time"
)
const (
DefaultFmt = "Pungenday, Discord 5, 3131 YOLD"
OldFmt = `Today is Pungenday, the 5th day of Discord in the YOLD 3131
Celebrate Mojoday`
)
const (
protoLongSeason = "Discord"
protoShortSeason = "Dsc"
protoLongDay = "Pungenday"
protoShortDay = "PD"
protoOrdDay = "5"
protoCardDay = "5th"
protoHolyday = "Mojoday"
protoYear = "3131"
)
var (
longDay = []string{"Sweetmorn", "Boomtime", "Pungenday",
"Prickle-Prickle", "Setting Orange"}
shortDay = []string{"SM", "BT", "PD", "PP", "SO"}
longSeason = []string{
"Chaos", "Discord", "Confusion", "Bureaucracy", "The Aftermath"}
shortSeason = []string{"Chs", "Dsc", "Cfn", "Bcy", "Afm"}
holyday = [][]string{{"Mungday", "Chaoflux"}, {"Mojoday", "Discoflux"},
{"Syaday", "Confuflux"}, {"Zaraday", "Bureflux"}, {"Maladay", "Afflux"}}
)
type DiscDate struct {
StTibs bool
Dayy int
Year int
}
func New(eris time.Time) DiscDate {
t := time.Date(eris.Year(), 1, 1, eris.Hour(), eris.Minute(),
eris.Second(), eris.Nanosecond(), eris.Location())
bob := int(eris.Sub(t).Hours()) / 24
raw := eris.Year()
hastur := DiscDate{Year: raw + 1166}
if raw%4 == 0 && (raw%100 != 0 || raw%400 == 0) {
if bob > 59 {
bob--
} else if bob == 59 {
hastur.StTibs = true
return hastur
}
}
hastur.Dayy = bob
return hastur
}
func (dd DiscDate) Format(f string) (r string) {
var st, snarf string
var dateElement bool
f6 := func(proto, wibble string) {
if !dateElement {
snarf = r
dateElement = true
}
if st > "" {
r = ""
} else {
r += wibble
}
f = f[len(proto):]
}
f4 := func(proto, wibble string) {
if dd.StTibs {
st = "St. Tib's Day"
}
f6(proto, wibble)
}
season, day := dd.Dayy/73, dd.Dayy%73
for f > "" {
switch {
case strings.HasPrefix(f, protoLongDay):
f4(protoLongDay, longDay[dd.Dayy%5])
case strings.HasPrefix(f, protoShortDay):
f4(protoShortDay, shortDay[dd.Dayy%5])
case strings.HasPrefix(f, protoCardDay):
funkychickens := "th"
if day/10 != 1 {
switch day % 10 {
case 0:
funkychickens = "st"
case 1:
funkychickens = "nd"
case 2:
funkychickens = "rd"
}
}
f4(protoCardDay, strconv.Itoa(day+1)+funkychickens)
case strings.HasPrefix(f, protoOrdDay):
f4(protoOrdDay, strconv.Itoa(day+1))
case strings.HasPrefix(f, protoLongSeason):
f6(protoLongSeason, longSeason[season])
case strings.HasPrefix(f, protoShortSeason):
f6(protoShortSeason, shortSeason[season])
case strings.HasPrefix(f, protoHolyday):
if day == 4 {
r += holyday[season][0]
} else if day == 49 {
r += holyday[season][1]
}
f = f[len(protoHolyday):]
case strings.HasPrefix(f, protoYear):
r += strconv.Itoa(dd.Year)
f = f[4:]
default:
r += f[:1]
f = f[1:]
}
}
if st > "" {
r = snarf + st + r
}
return
}
|
Transform the following PHP implementation into Go, maintaining the same output and logic. | <?php
$Anerisia = array(31,28,31,30,31,30,31,31,30,31,30,31);
$MONTHS = array("Choas","Discord","Confusion","Bureacracy","The Aftermath");
$DAYS = array("Setting Orange","Sweetmorn","BoomTime","Pungenday","Prickle-Prickle");
$Dsuff = array('th','st','nd','rd','th','th','th','th','th','th');
$Holy5 = array("Mungday","MojoDay","Syaday","Zaraday","Maladay");
$Holy50 = array("Chaoflux","Discoflux","Confuflux","Bureflux","Afflux");
$edate = explode(" ",date('Y m j L'));
$usery = $edate[0];
$userm = $edate[1];
$userd = $edate[2];
$IsLeap = $edate[3];
if (isset($_GET['y']) && isset($_GET['m']) && isset($_GET['d'])) {
$usery = $_GET['y'];
$userm = $_GET['m'];
$userd = $_GET['d'];
$IsLeap = 0;
if (($usery%4 == 0) && ($usery%100 >0)) $IsLeap =1;
if ($usery%400 == 0) $IsLeap = 1;
}
$userdays = 0;
$i = 0;
while ($i < ($userm-1)) {
$userdays = $userdays + $Anerisia[$i];
$i = $i +1;
}
$userdays = $userdays + $userd;
$IsHolyday = 0;
$dyear = $usery + 1166;
$dmonth = $MONTHS[$userdays/73.2];
$dday = $userdays%73;
if (0 == $dday) $dday = 73;
$Dname = $DAYS[$userdays%5];
$Holyday = "St. Tibs Day";
if ($dday == 5) {
$Holyday = $Holy5[$userdays/73.2];
$IsHolyday =1;
}
if ($dday == 50) {
$Holyday = $Holy50[$userdays/73.2];
$IsHolyday =1;
}
if (($IsLeap ==1) && ($userd ==29) and ($userm ==2)) $IsHolyday = 2;
$suff = $Dsuff[$dday%10] ;
if ((11 <= $dday) && (19 >= $dday)) $suff='th';
if ($IsHolyday ==2)
echo "</br>Celeberate ",$Holyday," ",$dmonth," YOLD ",$dyear;
if ($IsHolyday ==1)
echo "</br>Celeberate for today ", $Dname , " The ", $dday,"<sup>",$suff,"</sup>", " day of ", $dmonth , " YOLD " , $dyear , " is the holy day of " , $Holyday;
if ($IsHolyday == 0)
echo "</br>Today is " , $Dname , " the " , $dday ,"<sup>",$suff, "</sup> day of " , $dmonth , " YOLD " , $dyear;
?>
| package ddate
import (
"strconv"
"strings"
"time"
)
const (
DefaultFmt = "Pungenday, Discord 5, 3131 YOLD"
OldFmt = `Today is Pungenday, the 5th day of Discord in the YOLD 3131
Celebrate Mojoday`
)
const (
protoLongSeason = "Discord"
protoShortSeason = "Dsc"
protoLongDay = "Pungenday"
protoShortDay = "PD"
protoOrdDay = "5"
protoCardDay = "5th"
protoHolyday = "Mojoday"
protoYear = "3131"
)
var (
longDay = []string{"Sweetmorn", "Boomtime", "Pungenday",
"Prickle-Prickle", "Setting Orange"}
shortDay = []string{"SM", "BT", "PD", "PP", "SO"}
longSeason = []string{
"Chaos", "Discord", "Confusion", "Bureaucracy", "The Aftermath"}
shortSeason = []string{"Chs", "Dsc", "Cfn", "Bcy", "Afm"}
holyday = [][]string{{"Mungday", "Chaoflux"}, {"Mojoday", "Discoflux"},
{"Syaday", "Confuflux"}, {"Zaraday", "Bureflux"}, {"Maladay", "Afflux"}}
)
type DiscDate struct {
StTibs bool
Dayy int
Year int
}
func New(eris time.Time) DiscDate {
t := time.Date(eris.Year(), 1, 1, eris.Hour(), eris.Minute(),
eris.Second(), eris.Nanosecond(), eris.Location())
bob := int(eris.Sub(t).Hours()) / 24
raw := eris.Year()
hastur := DiscDate{Year: raw + 1166}
if raw%4 == 0 && (raw%100 != 0 || raw%400 == 0) {
if bob > 59 {
bob--
} else if bob == 59 {
hastur.StTibs = true
return hastur
}
}
hastur.Dayy = bob
return hastur
}
func (dd DiscDate) Format(f string) (r string) {
var st, snarf string
var dateElement bool
f6 := func(proto, wibble string) {
if !dateElement {
snarf = r
dateElement = true
}
if st > "" {
r = ""
} else {
r += wibble
}
f = f[len(proto):]
}
f4 := func(proto, wibble string) {
if dd.StTibs {
st = "St. Tib's Day"
}
f6(proto, wibble)
}
season, day := dd.Dayy/73, dd.Dayy%73
for f > "" {
switch {
case strings.HasPrefix(f, protoLongDay):
f4(protoLongDay, longDay[dd.Dayy%5])
case strings.HasPrefix(f, protoShortDay):
f4(protoShortDay, shortDay[dd.Dayy%5])
case strings.HasPrefix(f, protoCardDay):
funkychickens := "th"
if day/10 != 1 {
switch day % 10 {
case 0:
funkychickens = "st"
case 1:
funkychickens = "nd"
case 2:
funkychickens = "rd"
}
}
f4(protoCardDay, strconv.Itoa(day+1)+funkychickens)
case strings.HasPrefix(f, protoOrdDay):
f4(protoOrdDay, strconv.Itoa(day+1))
case strings.HasPrefix(f, protoLongSeason):
f6(protoLongSeason, longSeason[season])
case strings.HasPrefix(f, protoShortSeason):
f6(protoShortSeason, shortSeason[season])
case strings.HasPrefix(f, protoHolyday):
if day == 4 {
r += holyday[season][0]
} else if day == 49 {
r += holyday[season][1]
}
f = f[len(protoHolyday):]
case strings.HasPrefix(f, protoYear):
r += strconv.Itoa(dd.Year)
f = f[4:]
default:
r += f[:1]
f = f[1:]
}
}
if st > "" {
r = snarf + st + r
}
return
}
|
Produce a functionally identical Go code for the snippet given in PHP. | <?php
$extra = 'little';
echo "Mary had a $extra lamb.\n";
printf("Mary had a %s lamb.\n", $extra);
?>
| package main
import (
"fmt"
)
func main() {
str := "Mary had a %s lamb"
txt := "little"
out := fmt.Sprintf(str, txt)
fmt.Println(out)
}
|
Can you help me rewrite this code in Go instead of PHP, keeping it the same logically? | <?php
$extra = 'little';
echo "Mary had a $extra lamb.\n";
printf("Mary had a %s lamb.\n", $extra);
?>
| package main
import (
"fmt"
)
func main() {
str := "Mary had a %s lamb"
txt := "little"
out := fmt.Sprintf(str, txt)
fmt.Println(out)
}
|
Convert this PHP snippet to Go and keep its semantics consistent. | <?php
class PilesHeap extends SplMinHeap {
public function compare($pile1, $pile2) {
return parent::compare($pile1->top(), $pile2->top());
}
}
function patience_sort(&$n) {
$piles = array();
foreach ($n as $x) {
$low = 0; $high = count($piles)-1;
while ($low <= $high) {
$mid = (int)(($low + $high) / 2);
if ($piles[$mid]->top() >= $x)
$high = $mid - 1;
else
$low = $mid + 1;
}
$i = $low;
if ($i == count($piles))
$piles[] = new SplStack();
$piles[$i]->push($x);
}
$heap = new PilesHeap();
foreach ($piles as $pile)
$heap->insert($pile);
for ($c = 0; $c < count($n); $c++) {
$smallPile = $heap->extract();
$n[$c] = $smallPile->pop();
if (!$smallPile->isEmpty())
$heap->insert($smallPile);
}
assert($heap->isEmpty());
}
$a = array(4, 65, 2, -31, 0, 99, 83, 782, 1);
patience_sort($a);
print_r($a);
?>
| package main
import (
"fmt"
"container/heap"
"sort"
)
type IntPile []int
func (self IntPile) Top() int { return self[len(self)-1] }
func (self *IntPile) Pop() int {
x := (*self)[len(*self)-1]
*self = (*self)[:len(*self)-1]
return x
}
type IntPilesHeap []IntPile
func (self IntPilesHeap) Len() int { return len(self) }
func (self IntPilesHeap) Less(i, j int) bool { return self[i].Top() < self[j].Top() }
func (self IntPilesHeap) Swap(i, j int) { self[i], self[j] = self[j], self[i] }
func (self *IntPilesHeap) Push(x interface{}) { *self = append(*self, x.(IntPile)) }
func (self *IntPilesHeap) Pop() interface{} {
x := (*self)[len(*self)-1]
*self = (*self)[:len(*self)-1]
return x
}
func patience_sort (n []int) {
var piles []IntPile
for _, x := range n {
j := sort.Search(len(piles), func (i int) bool { return piles[i].Top() >= x })
if j != len(piles) {
piles[j] = append(piles[j], x)
} else {
piles = append(piles, IntPile{ x })
}
}
hp := IntPilesHeap(piles)
heap.Init(&hp)
for i, _ := range n {
smallPile := heap.Pop(&hp).(IntPile)
n[i] = smallPile.Pop()
if len(smallPile) != 0 {
heap.Push(&hp, smallPile)
}
}
if len(hp) != 0 {
panic("something went wrong")
}
}
func main() {
a := []int{4, 65, 2, -31, 0, 99, 83, 782, 1}
patience_sort(a)
fmt.Println(a)
}
|
Write the same algorithm in Go as shown in this PHP implementation. | <?php
class PilesHeap extends SplMinHeap {
public function compare($pile1, $pile2) {
return parent::compare($pile1->top(), $pile2->top());
}
}
function patience_sort(&$n) {
$piles = array();
foreach ($n as $x) {
$low = 0; $high = count($piles)-1;
while ($low <= $high) {
$mid = (int)(($low + $high) / 2);
if ($piles[$mid]->top() >= $x)
$high = $mid - 1;
else
$low = $mid + 1;
}
$i = $low;
if ($i == count($piles))
$piles[] = new SplStack();
$piles[$i]->push($x);
}
$heap = new PilesHeap();
foreach ($piles as $pile)
$heap->insert($pile);
for ($c = 0; $c < count($n); $c++) {
$smallPile = $heap->extract();
$n[$c] = $smallPile->pop();
if (!$smallPile->isEmpty())
$heap->insert($smallPile);
}
assert($heap->isEmpty());
}
$a = array(4, 65, 2, -31, 0, 99, 83, 782, 1);
patience_sort($a);
print_r($a);
?>
| package main
import (
"fmt"
"container/heap"
"sort"
)
type IntPile []int
func (self IntPile) Top() int { return self[len(self)-1] }
func (self *IntPile) Pop() int {
x := (*self)[len(*self)-1]
*self = (*self)[:len(*self)-1]
return x
}
type IntPilesHeap []IntPile
func (self IntPilesHeap) Len() int { return len(self) }
func (self IntPilesHeap) Less(i, j int) bool { return self[i].Top() < self[j].Top() }
func (self IntPilesHeap) Swap(i, j int) { self[i], self[j] = self[j], self[i] }
func (self *IntPilesHeap) Push(x interface{}) { *self = append(*self, x.(IntPile)) }
func (self *IntPilesHeap) Pop() interface{} {
x := (*self)[len(*self)-1]
*self = (*self)[:len(*self)-1]
return x
}
func patience_sort (n []int) {
var piles []IntPile
for _, x := range n {
j := sort.Search(len(piles), func (i int) bool { return piles[i].Top() >= x })
if j != len(piles) {
piles[j] = append(piles[j], x)
} else {
piles = append(piles, IntPile{ x })
}
}
hp := IntPilesHeap(piles)
heap.Init(&hp)
for i, _ := range n {
smallPile := heap.Pop(&hp).(IntPile)
n[i] = smallPile.Pop()
if len(smallPile) != 0 {
heap.Push(&hp, smallPile)
}
}
if len(hp) != 0 {
panic("something went wrong")
}
}
func main() {
a := []int{4, 65, 2, -31, 0, 99, 83, 782, 1}
patience_sort(a)
fmt.Println(a)
}
|
Write a version of this PHP function in Go with identical behavior. | $desc = 'tH.........
. .
........
. .
Ht.. ......
..
tH.... .......
..
..
tH..... ......
..';
$steps = 30;
$world = array(array());
$row = 0;
$col = 0;
foreach(str_split($desc) as $i){
switch($i){
case "\n":
$row++;
$col = 0;
$world[] = array();
break;
case '.':
$world[$row][$col] = 1;//conductor
$col++;
break;
case 'H':
$world[$row][$col] = 2;//head
$col++;
break;
case 't':
$world[$row][$col] = 3;//tail
$col++;
break;
default:
$world[$row][$col] = 0;//insulator/air
$col++;
break;
};
};
function draw_world($world){
foreach($world as $rowc){
foreach($rowc as $cell){
switch($cell){
case 0:
echo ' ';
break;
case 1:
echo '.';
break;
case 2:
echo 'H';
break;
case 3:
echo 't';
};
};
echo "\n";
};
};
echo "Original world:\n";
draw_world($world);
for($i = 0; $i < $steps; $i++){
$old_world = $world; //backup to look up where was an electron head
foreach($world as $row => &$rowc){
foreach($rowc as $col => &$cell){
switch($cell){
case 2:
$cell = 3;
break;
case 3:
$cell = 1;
break;
case 1:
$neigh_heads = (int) @$old_world[$row - 1][$col - 1] == 2;
$neigh_heads += (int) @$old_world[$row - 1][$col] == 2;
$neigh_heads += (int) @$old_world[$row - 1][$col + 1] == 2;
$neigh_heads += (int) @$old_world[$row][$col - 1] == 2;
$neigh_heads += (int) @$old_world[$row][$col + 1] == 2;
$neigh_heads += (int) @$old_world[$row + 1][$col - 1] == 2;
$neigh_heads += (int) @$old_world[$row + 1][$col] == 2;
if($neigh_heads == 1 || $neigh_heads == 2){
$cell = 2;
};
};
};
unset($cell); //just to be safe
};
unset($rowc); //just to be safe
echo "\nStep " . ($i + 1) . ":\n";
draw_world($world);
};
| package main
import (
"bytes"
"fmt"
"io/ioutil"
"strings"
)
var rows, cols int
var rx, cx int
var mn []int
func main() {
src, err := ioutil.ReadFile("ww.config")
if err != nil {
fmt.Println(err)
return
}
srcRows := bytes.Split(src, []byte{'\n'})
rows = len(srcRows)
for _, r := range srcRows {
if len(r) > cols {
cols = len(r)
}
}
rx, cx = rows+2, cols+2
mn = []int{-cx-1, -cx, -cx+1, -1, 1, cx-1, cx, cx+1}
odd := make([]byte, rx*cx)
even := make([]byte, rx*cx)
for ri, r := range srcRows {
copy(odd[(ri+1)*cx+1:], r)
}
for {
print(odd)
step(even, odd)
fmt.Scanln()
print(even)
step(odd, even)
fmt.Scanln()
}
}
func print(grid []byte) {
fmt.Println(strings.Repeat("__", cols))
fmt.Println()
for r := 1; r <= rows; r++ {
for c := 1; c <= cols; c++ {
if grid[r*cx+c] == 0 {
fmt.Print(" ")
} else {
fmt.Printf(" %c", grid[r*cx+c])
}
}
fmt.Println()
}
}
func step(dst, src []byte) {
for r := 1; r <= rows; r++ {
for c := 1; c <= cols; c++ {
x := r*cx + c
dst[x] = src[x]
switch dst[x] {
case 'H':
dst[x] = 't'
case 't':
dst[x] = '.'
case '.':
var nn int
for _, n := range mn {
if src[x+n] == 'H' {
nn++
}
}
if nn == 1 || nn == 2 {
dst[x] = 'H'
}
}
}
}
}
|
Write the same algorithm in Go as shown in this PHP implementation. | $desc = 'tH.........
. .
........
. .
Ht.. ......
..
tH.... .......
..
..
tH..... ......
..';
$steps = 30;
$world = array(array());
$row = 0;
$col = 0;
foreach(str_split($desc) as $i){
switch($i){
case "\n":
$row++;
$col = 0;
$world[] = array();
break;
case '.':
$world[$row][$col] = 1;//conductor
$col++;
break;
case 'H':
$world[$row][$col] = 2;//head
$col++;
break;
case 't':
$world[$row][$col] = 3;//tail
$col++;
break;
default:
$world[$row][$col] = 0;//insulator/air
$col++;
break;
};
};
function draw_world($world){
foreach($world as $rowc){
foreach($rowc as $cell){
switch($cell){
case 0:
echo ' ';
break;
case 1:
echo '.';
break;
case 2:
echo 'H';
break;
case 3:
echo 't';
};
};
echo "\n";
};
};
echo "Original world:\n";
draw_world($world);
for($i = 0; $i < $steps; $i++){
$old_world = $world; //backup to look up where was an electron head
foreach($world as $row => &$rowc){
foreach($rowc as $col => &$cell){
switch($cell){
case 2:
$cell = 3;
break;
case 3:
$cell = 1;
break;
case 1:
$neigh_heads = (int) @$old_world[$row - 1][$col - 1] == 2;
$neigh_heads += (int) @$old_world[$row - 1][$col] == 2;
$neigh_heads += (int) @$old_world[$row - 1][$col + 1] == 2;
$neigh_heads += (int) @$old_world[$row][$col - 1] == 2;
$neigh_heads += (int) @$old_world[$row][$col + 1] == 2;
$neigh_heads += (int) @$old_world[$row + 1][$col - 1] == 2;
$neigh_heads += (int) @$old_world[$row + 1][$col] == 2;
if($neigh_heads == 1 || $neigh_heads == 2){
$cell = 2;
};
};
};
unset($cell); //just to be safe
};
unset($rowc); //just to be safe
echo "\nStep " . ($i + 1) . ":\n";
draw_world($world);
};
| package main
import (
"bytes"
"fmt"
"io/ioutil"
"strings"
)
var rows, cols int
var rx, cx int
var mn []int
func main() {
src, err := ioutil.ReadFile("ww.config")
if err != nil {
fmt.Println(err)
return
}
srcRows := bytes.Split(src, []byte{'\n'})
rows = len(srcRows)
for _, r := range srcRows {
if len(r) > cols {
cols = len(r)
}
}
rx, cx = rows+2, cols+2
mn = []int{-cx-1, -cx, -cx+1, -1, 1, cx-1, cx, cx+1}
odd := make([]byte, rx*cx)
even := make([]byte, rx*cx)
for ri, r := range srcRows {
copy(odd[(ri+1)*cx+1:], r)
}
for {
print(odd)
step(even, odd)
fmt.Scanln()
print(even)
step(odd, even)
fmt.Scanln()
}
}
func print(grid []byte) {
fmt.Println(strings.Repeat("__", cols))
fmt.Println()
for r := 1; r <= rows; r++ {
for c := 1; c <= cols; c++ {
if grid[r*cx+c] == 0 {
fmt.Print(" ")
} else {
fmt.Printf(" %c", grid[r*cx+c])
}
}
fmt.Println()
}
}
func step(dst, src []byte) {
for r := 1; r <= rows; r++ {
for c := 1; c <= cols; c++ {
x := r*cx + c
dst[x] = src[x]
switch dst[x] {
case 'H':
dst[x] = 't'
case 't':
dst[x] = '.'
case '.':
var nn int
for _, n := range mn {
if src[x+n] == 'H' {
nn++
}
}
if nn == 1 || nn == 2 {
dst[x] = 'H'
}
}
}
}
}
|
Write the same algorithm in Go as shown in this PHP implementation. | <?php
function contains($bounds, $lat, $lng)
{
$count = 0;
$bounds_count = count($bounds);
for ($b = 0; $b < $bounds_count; $b++) {
$vertex1 = $bounds[$b];
$vertex2 = $bounds[($b + 1) % $bounds_count];
if (west($vertex1, $vertex2, $lng, $lat))
$count++;
}
return $count % 2;
}
function west($A, $B, $x, $y)
{
if ($A['y'] <= $B['y']) {
if ($y <= $A['y'] || $y > $B['y'] ||
$x >= $A['x'] && $x >= $B['x']) {
return false;
}
if ($x < $A['x'] && $x < $B['x']) {
return true;
}
if ($x == $A['x']) {
if ($y == $A['y']) {
$result1 = NAN;
} else {
$result1 = INF;
}
} else {
$result1 = ($y - $A['y']) / ($x - $A['x']);
}
if ($B['x'] == $A['x']) {
if ($B['y'] == $A['y']) {
$result2 = NAN;
} else {
$result2 = INF;
}
} else {
$result2 = ($B['y'] - $A['y']) / ($B['x'] - $A['x']);
}
return $result1 > $result2;
}
return west($B, $A, $x, $y);
}
$square = [
'name' => 'square',
'bounds' => [['x' => 0, 'y' => 0], ['x' => 20, 'y' => 0], ['x' => 20, 'y' => 20], ['x' => 0, 'y' => 20]]
];
$squareHole = [
'name' => 'squareHole',
'bounds' => [['x' => 0, 'y' => 0], ['x' => 20, 'y' => 0], ['x' => 20, 'y' => 20], ['x' => 0, 'y' => 20], ['x' => 5, 'y' => 5], ['x' => 15, 'y' => 5], ['x' => 15, 'y' => 15], ['x' => 5, 'y' => 15]]
];
$strange = [
'name' => 'strange',
'bounds' => [['x' => 0, 'y' => 0], ['x' => 5, 'y' => 5], ['x' => 0, 'y' => 20], ['x' => 5, 'y' => 15], ['x' => 15, 'y' => 15], ['x' => 20, 'y' => 20], ['x' => 20, 'y' => 0]]
];
$hexagon = [
'name' => 'hexagon',
'bounds' => [['x' => 6, 'y' => 0], ['x' => 14, 'y' => 0], ['x' => 20, 'y' => 10], ['x' => 14, 'y' => 20], ['x' => 6, 'y' => 20], ['x' => 0, 'y' => 10]]
];
$shapes = [$square, $squareHole, $strange, $hexagon];
$testPoints = [
['lng' => 10, 'lat' => 10],
['lng' => 10, 'lat' => 16],
['lng' => -20, 'lat' => 10],
['lng' => 0, 'lat' => 10],
['lng' => 20, 'lat' => 10],
['lng' => 16, 'lat' => 10],
['lng' => 20, 'lat' => 20]
];
for ($s = 0; $s < count($shapes); $s++) {
$shape = $shapes[$s];
for ($tp = 0; $tp < count($testPoints); $tp++) {
$testPoint = $testPoints[$tp];
echo json_encode($testPoint) . "\tin " . $shape['name'] . "\t" . contains($shape['bounds'], $testPoint['lat'], $testPoint['lng']) . PHP_EOL;
}
}
| package main
import (
"fmt"
"math"
)
type xy struct {
x, y float64
}
type seg struct {
p1, p2 xy
}
type poly struct {
name string
sides []seg
}
func inside(pt xy, pg poly) (i bool) {
for _, side := range pg.sides {
if rayIntersectsSegment(pt, side) {
i = !i
}
}
return
}
func rayIntersectsSegment(p xy, s seg) bool {
var a, b xy
if s.p1.y < s.p2.y {
a, b = s.p1, s.p2
} else {
a, b = s.p2, s.p1
}
for p.y == a.y || p.y == b.y {
p.y = math.Nextafter(p.y, math.Inf(1))
}
if p.y < a.y || p.y > b.y {
return false
}
if a.x > b.x {
if p.x > a.x {
return false
}
if p.x < b.x {
return true
}
} else {
if p.x > b.x {
return false
}
if p.x < a.x {
return true
}
}
return (p.y-a.y)/(p.x-a.x) >= (b.y-a.y)/(b.x-a.x)
}
var (
p1 = xy{0, 0}
p2 = xy{10, 0}
p3 = xy{10, 10}
p4 = xy{0, 10}
p5 = xy{2.5, 2.5}
p6 = xy{7.5, 2.5}
p7 = xy{7.5, 7.5}
p8 = xy{2.5, 7.5}
p9 = xy{0, 5}
p10 = xy{10, 5}
p11 = xy{3, 0}
p12 = xy{7, 0}
p13 = xy{7, 10}
p14 = xy{3, 10}
)
var tpg = []poly{
{"square", []seg{{p1, p2}, {p2, p3}, {p3, p4}, {p4, p1}}},
{"square hole", []seg{{p1, p2}, {p2, p3}, {p3, p4}, {p4, p1},
{p5, p6}, {p6, p7}, {p7, p8}, {p8, p5}}},
{"strange", []seg{{p1, p5},
{p5, p4}, {p4, p8}, {p8, p7}, {p7, p3}, {p3, p2}, {p2, p5}}},
{"exagon", []seg{{p11, p12}, {p12, p10}, {p10, p13},
{p13, p14}, {p14, p9}, {p9, p11}}},
}
var tpt = []xy{
{5, 5}, {5, 8}, {-10, 5}, {0, 5}, {10, 5}, {8, 5}, {10, 10},
{1, 2}, {2, 1},
}
func main() {
for _, pg := range tpg {
fmt.Printf("%s:\n", pg.name)
for _, pt := range tpt {
fmt.Println(pt, inside(pt, pg))
}
}
}
|
Convert the following code from PHP to Go, ensuring the logic remains intact. | <?php
function contains($bounds, $lat, $lng)
{
$count = 0;
$bounds_count = count($bounds);
for ($b = 0; $b < $bounds_count; $b++) {
$vertex1 = $bounds[$b];
$vertex2 = $bounds[($b + 1) % $bounds_count];
if (west($vertex1, $vertex2, $lng, $lat))
$count++;
}
return $count % 2;
}
function west($A, $B, $x, $y)
{
if ($A['y'] <= $B['y']) {
if ($y <= $A['y'] || $y > $B['y'] ||
$x >= $A['x'] && $x >= $B['x']) {
return false;
}
if ($x < $A['x'] && $x < $B['x']) {
return true;
}
if ($x == $A['x']) {
if ($y == $A['y']) {
$result1 = NAN;
} else {
$result1 = INF;
}
} else {
$result1 = ($y - $A['y']) / ($x - $A['x']);
}
if ($B['x'] == $A['x']) {
if ($B['y'] == $A['y']) {
$result2 = NAN;
} else {
$result2 = INF;
}
} else {
$result2 = ($B['y'] - $A['y']) / ($B['x'] - $A['x']);
}
return $result1 > $result2;
}
return west($B, $A, $x, $y);
}
$square = [
'name' => 'square',
'bounds' => [['x' => 0, 'y' => 0], ['x' => 20, 'y' => 0], ['x' => 20, 'y' => 20], ['x' => 0, 'y' => 20]]
];
$squareHole = [
'name' => 'squareHole',
'bounds' => [['x' => 0, 'y' => 0], ['x' => 20, 'y' => 0], ['x' => 20, 'y' => 20], ['x' => 0, 'y' => 20], ['x' => 5, 'y' => 5], ['x' => 15, 'y' => 5], ['x' => 15, 'y' => 15], ['x' => 5, 'y' => 15]]
];
$strange = [
'name' => 'strange',
'bounds' => [['x' => 0, 'y' => 0], ['x' => 5, 'y' => 5], ['x' => 0, 'y' => 20], ['x' => 5, 'y' => 15], ['x' => 15, 'y' => 15], ['x' => 20, 'y' => 20], ['x' => 20, 'y' => 0]]
];
$hexagon = [
'name' => 'hexagon',
'bounds' => [['x' => 6, 'y' => 0], ['x' => 14, 'y' => 0], ['x' => 20, 'y' => 10], ['x' => 14, 'y' => 20], ['x' => 6, 'y' => 20], ['x' => 0, 'y' => 10]]
];
$shapes = [$square, $squareHole, $strange, $hexagon];
$testPoints = [
['lng' => 10, 'lat' => 10],
['lng' => 10, 'lat' => 16],
['lng' => -20, 'lat' => 10],
['lng' => 0, 'lat' => 10],
['lng' => 20, 'lat' => 10],
['lng' => 16, 'lat' => 10],
['lng' => 20, 'lat' => 20]
];
for ($s = 0; $s < count($shapes); $s++) {
$shape = $shapes[$s];
for ($tp = 0; $tp < count($testPoints); $tp++) {
$testPoint = $testPoints[$tp];
echo json_encode($testPoint) . "\tin " . $shape['name'] . "\t" . contains($shape['bounds'], $testPoint['lat'], $testPoint['lng']) . PHP_EOL;
}
}
| package main
import (
"fmt"
"math"
)
type xy struct {
x, y float64
}
type seg struct {
p1, p2 xy
}
type poly struct {
name string
sides []seg
}
func inside(pt xy, pg poly) (i bool) {
for _, side := range pg.sides {
if rayIntersectsSegment(pt, side) {
i = !i
}
}
return
}
func rayIntersectsSegment(p xy, s seg) bool {
var a, b xy
if s.p1.y < s.p2.y {
a, b = s.p1, s.p2
} else {
a, b = s.p2, s.p1
}
for p.y == a.y || p.y == b.y {
p.y = math.Nextafter(p.y, math.Inf(1))
}
if p.y < a.y || p.y > b.y {
return false
}
if a.x > b.x {
if p.x > a.x {
return false
}
if p.x < b.x {
return true
}
} else {
if p.x > b.x {
return false
}
if p.x < a.x {
return true
}
}
return (p.y-a.y)/(p.x-a.x) >= (b.y-a.y)/(b.x-a.x)
}
var (
p1 = xy{0, 0}
p2 = xy{10, 0}
p3 = xy{10, 10}
p4 = xy{0, 10}
p5 = xy{2.5, 2.5}
p6 = xy{7.5, 2.5}
p7 = xy{7.5, 7.5}
p8 = xy{2.5, 7.5}
p9 = xy{0, 5}
p10 = xy{10, 5}
p11 = xy{3, 0}
p12 = xy{7, 0}
p13 = xy{7, 10}
p14 = xy{3, 10}
)
var tpg = []poly{
{"square", []seg{{p1, p2}, {p2, p3}, {p3, p4}, {p4, p1}}},
{"square hole", []seg{{p1, p2}, {p2, p3}, {p3, p4}, {p4, p1},
{p5, p6}, {p6, p7}, {p7, p8}, {p8, p5}}},
{"strange", []seg{{p1, p5},
{p5, p4}, {p4, p8}, {p8, p7}, {p7, p3}, {p3, p2}, {p2, p5}}},
{"exagon", []seg{{p11, p12}, {p12, p10}, {p10, p13},
{p13, p14}, {p14, p9}, {p9, p11}}},
}
var tpt = []xy{
{5, 5}, {5, 8}, {-10, 5}, {0, 5}, {10, 5}, {8, 5}, {10, 10},
{1, 2}, {2, 1},
}
func main() {
for _, pg := range tpg {
fmt.Printf("%s:\n", pg.name)
for _, pt := range tpt {
fmt.Println(pt, inside(pt, pg))
}
}
}
|
Keep all operations the same but rewrite the snippet in Go. | <?php
echo substr_count("the three truths", "th"), PHP_EOL; // prints "3"
echo substr_count("ababababab", "abab"), PHP_EOL; // prints "2"
| package main
import (
"fmt"
"strings"
)
func main() {
fmt.Println(strings.Count("the three truths", "th"))
fmt.Println(strings.Count("ababababab", "abab"))
}
|
Generate an equivalent Go version of this PHP code. | <?php
echo substr_count("the three truths", "th"), PHP_EOL; // prints "3"
echo substr_count("ababababab", "abab"), PHP_EOL; // prints "2"
| package main
import (
"fmt"
"strings"
)
func main() {
fmt.Println(strings.Count("the three truths", "th"))
fmt.Println(strings.Count("ababababab", "abab"))
}
|
Convert this Python snippet to VB and keep its semantics consistent. | def bitwise_built_ins(width, a, b):
mask = (1 << width) - 1
print(f)
def rotr(width, a, n):
"Rotate a, n times to the right"
if n < 0:
return rotl(width, a, -n)
elif n == 0:
return a
else:
mask = (1 << width) - 1
a, n = a & mask, n % width
return ((a >> n)
| ((a & ((1 << n) - 1))
<< (width - n)))
def rotl(width, a, n):
"Rotate a, n times to the left"
if n < 0:
return rotr(width, a, -n)
elif n == 0:
return a
else:
mask = (1 << width) - 1
a, n = a & mask, n % width
return (((a << n) & mask)
| (a >> (width - n)))
def asr(width, a, n):
"Arithmetic shift a, n times to the right. (sign preserving)."
mask, top_bit_mask = ((1 << width) - 1), 1 << (width - 1)
if n < 0:
return (a << -n) & mask
elif n == 0:
return a
elif n >= width:
return mask if a & top_bit_mask else 0
else:
a = a & mask
if a & top_bit_mask:
signs = (1 << n) - 1
return a >> n | (signs << width - n)
else:
return a >> n
def helper_funcs(width, a):
mask, top_bit_mask = ((1 << width) - 1), 1 << (width - 1)
aa = a | top_bit_mask
print(f)
if __name__ == '__main__':
bitwise_built_ins(8, 27, 125)
helper_funcs(8, 27)
| Debug.Print Hex(&HF0F0 And &HFF00)
Debug.Print Hex(&HF0F0 Or &HFF00)
Debug.Print Hex(&HF0F0 Xor &HFF00)
Debug.Print Hex(Not &HF0F0)
Debug.Print Hex(&HF0F0 Eqv &HFF00)
Debug.Print Hex(&HF0F0 Imp &HFF00)
|
Convert this Python block to VB, preserving its control flow and logic. | l = 3
ints = 13
def setup():
size(700, 600)
background(0, 0, 255)
translate(150, 100)
stroke(255)
turn_left(l, ints)
turn_right(l, ints)
def turn_right(l, ints):
if ints == 0:
line(0, 0, 0, -l)
translate(0, -l)
else:
turn_left(l, ints - 1)
rotate(radians(90))
turn_right(l, ints - 1)
def turn_left(l, ints):
if ints == 0:
line(0, 0, 0, -l)
translate(0, -l)
else:
turn_left(l, ints - 1)
rotate(radians(-90))
turn_right(l, ints - 1)
| option explicit
const pi180= 0.01745329251994329576923690768489
const pi=3.1415926535897932384626433832795
class turtle
dim fso
dim fn
dim svg
dim iang
dim ori
dim incr
dim pdown
dim clr
dim x
dim y
public property let orient(n):ori = n*pi180 :end property
public property let iangle(n):iang= n*pi180 :end property
public sub pd() : pdown=true: end sub
public sub pu() :pdown=FALSE :end sub
public sub rt(i)
ori=ori - i*iang:
end sub
public sub lt(i):
ori=(ori + i*iang)
end sub
public sub bw(l)
x= x+ cos(ori+pi)*l*incr
y= y+ sin(ori+pi)*l*incr
end sub
public sub fw(l)
dim x1,y1
x1=x + cos(ori)*l*incr
y1=y + sin(ori)*l*incr
if pdown then line x,y,x1,y1
x=x1:y=y1
end sub
Private Sub Class_Initialize()
setlocale "us"
initsvg
x=400:y=400:incr=100
ori=90*pi180
iang=90*pi180
clr=0
pdown=true
end sub
Private Sub Class_Terminate()
disply
end sub
private sub line (x,y,x1,y1)
svg.WriteLine "<line x1=""" & x & """ y1= """& y & """ x2=""" & x1& """ y2=""" & y1 & """/>"
end sub
private sub disply()
dim shell
svg.WriteLine "</svg></body></html>"
svg.close
Set shell = CreateObject("Shell.Application")
shell.ShellExecute fn,1,False
end sub
private sub initsvg()
dim scriptpath
Set fso = CreateObject ("Scripting.Filesystemobject")
ScriptPath= Left(WScript.ScriptFullName, InStrRev(WScript.ScriptFullName, "\"))
fn=Scriptpath & "SIERP.HTML"
Set svg = fso.CreateTextFile(fn,True)
if SVG IS nothing then wscript.echo "Can
svg.WriteLine "<!DOCTYPE html>" &vbcrlf & "<html>" &vbcrlf & "<head>"
svg.writeline "<style>" & vbcrlf & "line {stroke:rgb(255,0,0);stroke-width:.5}" &vbcrlf &"</style>"
svg.writeline "</head>"&vbcrlf & "<body>"
svg.WriteLine "<svg xmlns=""http://www.w3.org/2000/svg"" width=""800"" height=""800"" viewBox=""0 0 800 800"">"
end sub
end class
sub dragon(st,le,dir)
if st=0 then x.fw le: exit sub
x.rt dir
dragon st-1, le/1.41421 ,1
x.rt dir*2
dragon st-1, le/1.41421 ,-1
x.rt dir
end sub
dim x
set x=new turtle
x.iangle=45
x.orient=45
x.incr=1
x.x=200:x.y=200
dragon 12,300,1
set x=nothing
|
Produce a functionally identical VB code for the snippet given in Python. | for line in lines open('input.txt'):
print line
| $Include "Rapidq.inc"
dim file as qfilestream
if file.open("c:\A Test.txt", fmOpenRead) then
while not File.eof
print File.readline
wend
else
print "Cannot read file"
end if
input "Press enter to exit: ";a$
|
Write the same code in VB as shown below in Python. | def insert(anchor, new):
new.next = anchor.next
new.prev = anchor
anchor.next.prev = new
anchor.next = new
| Public Sub Insert(ByVal a As Node(Of T), ByVal b As Node(Of T), ByVal c As T)
Dim node As New Node(Of T)(value)
a.Next = node
node.Previous = a
b.Previous = node
node.Next = b
End Sub
|
Change the following Python code into VB without altering its purpose. | import random
def partition(vector, left, right, pivotIndex):
pivotValue = vector[pivotIndex]
vector[pivotIndex], vector[right] = vector[right], vector[pivotIndex]
storeIndex = left
for i in range(left, right):
if vector[i] < pivotValue:
vector[storeIndex], vector[i] = vector[i], vector[storeIndex]
storeIndex += 1
vector[right], vector[storeIndex] = vector[storeIndex], vector[right]
return storeIndex
def _select(vector, left, right, k):
"Returns the k-th smallest, (k >= 0), element of vector within vector[left:right+1] inclusive."
while True:
pivotIndex = random.randint(left, right)
pivotNewIndex = partition(vector, left, right, pivotIndex)
pivotDist = pivotNewIndex - left
if pivotDist == k:
return vector[pivotNewIndex]
elif k < pivotDist:
right = pivotNewIndex - 1
else:
k -= pivotDist + 1
left = pivotNewIndex + 1
def select(vector, k, left=None, right=None):
if left is None:
left = 0
lv1 = len(vector) - 1
if right is None:
right = lv1
assert vector and k >= 0, "Either null vector or k < 0 "
assert 0 <= left <= lv1, "left is out of range"
assert left <= right <= lv1, "right is out of range"
return _select(vector, left, right, k)
if __name__ == '__main__':
v = [9, 8, 7, 6, 5, 0, 1, 2, 3, 4]
print([select(v, i) for i in range(10)])
| Dim s As Variant
Private Function quick_select(ByRef s As Variant, k As Integer) As Integer
Dim left As Integer, right As Integer, pos As Integer
Dim pivotValue As Integer, tmp As Integer
left = 1: right = UBound(s)
Do While left < right
pivotValue = s(k)
tmp = s(k)
s(k) = s(right)
s(right) = tmp
pos = left
For i = left To right
If s(i) < pivotValue Then
tmp = s(i)
s(i) = s(pos)
s(pos) = tmp
pos = pos + 1
End If
Next i
tmp = s(right)
s(right) = s(pos)
s(pos) = tmp
If pos = k Then
Exit Do
End If
If pos < k Then
left = pos + 1
Else
right = pos - 1
End If
Loop
quick_select = s(k)
End Function
Public Sub main()
Dim r As Integer, i As Integer
s = [{9, 8, 7, 6, 5, 0, 1, 2, 3, 4}]
For i = 1 To 10
r = quick_select(s, i)
Debug.Print IIf(i < 10, r & ", ", "" & r);
Next i
End Sub
|
Convert the following code from Python to VB, ensuring the logic remains intact. | i = int('1a',16)
| Private Function to_base(ByVal number As Long, base As Integer) As String
Dim digits As String, result As String
Dim i As Integer, digit As Integer
digits = "0123456789abcdefghijklmnopqrstuvwxyz"
Do While number > 0
digit = number Mod base
result = Mid(digits, digit + 1, 1) & result
number = number \ base
Loop
to_base = result
End Function
Private Function from_base(number As String, base As Integer) As Long
Dim digits As String, result As Long
Dim i As Integer
digits = "0123456789abcdefghijklmnopqrstuvwxyz"
result = Val(InStr(1, digits, Mid(number, 1, 1), vbTextCompare) - 1)
For i = 2 To Len(number)
result = result * base + Val(InStr(1, digits, Mid(number, i, 1), vbTextCompare) - 1)
Next i
from_base = result
End Function
Public Sub Non_decimal_radices_Convert()
Debug.Print "26 decimal in base 16 is: "; to_base(26, 16); ". Conversely, hexadecimal 1a in decimal is: "; from_base("1a", 16)
End Sub
|
Produce a functionally identical VB code for the snippet given in Python. | i = int('1a',16)
| Private Function to_base(ByVal number As Long, base As Integer) As String
Dim digits As String, result As String
Dim i As Integer, digit As Integer
digits = "0123456789abcdefghijklmnopqrstuvwxyz"
Do While number > 0
digit = number Mod base
result = Mid(digits, digit + 1, 1) & result
number = number \ base
Loop
to_base = result
End Function
Private Function from_base(number As String, base As Integer) As Long
Dim digits As String, result As Long
Dim i As Integer
digits = "0123456789abcdefghijklmnopqrstuvwxyz"
result = Val(InStr(1, digits, Mid(number, 1, 1), vbTextCompare) - 1)
For i = 2 To Len(number)
result = result * base + Val(InStr(1, digits, Mid(number, i, 1), vbTextCompare) - 1)
Next i
from_base = result
End Function
Public Sub Non_decimal_radices_Convert()
Debug.Print "26 decimal in base 16 is: "; to_base(26, 16); ". Conversely, hexadecimal 1a in decimal is: "; from_base("1a", 16)
End Sub
|
Write the same algorithm in VB as shown in this Python implementation. | from pathlib import Path
for path in Path('.').rglob('*.*'):
print(path)
| Sub printFiles(parentDir As FolderItem, pattern As String)
For i As Integer = 1 To parentDir.Count
If parentDir.Item(i).Directory Then
printFiles(parentDir.Item(i), pattern)
Else
Dim rg as New RegEx
Dim myMatch as RegExMatch
rg.SearchPattern = pattern
myMatch = rg.search(parentDir.Item(i).Name)
If myMatch <> Nil Then Print(parentDir.Item(i).AbsolutePath)
End If
Next
End Sub
|
Rewrite this program in VB while keeping its functionality equivalent to the Python version. | >>> s = 'The quick brown fox jumps over the lazy dog'
>>> import zlib
>>> hex(zlib.crc32(s))
'0x414fa339'
>>> import binascii
>>> hex(binascii.crc32(s))
'0x414fa339'
| dim crctbl(255)
const crcc =&hEDB88320
sub gencrctable
for i= 0 to 255
k=i
for j=1 to 8
if k and 1 then
k=(k and &h7fffffff)\2 or (&h40000000 and ((k and &h80000000)<>0))
k=k xor crcc
else
k=(k and &h7fffffff)\2 or (&h40000000 and ((k and &h80000000)<>0))
end if
next
crctbl(i)=k
next
end sub
function crc32 (buf)
dim r,r1,i
r=&hffffffff
for i=1 to len(buf)
r1=(r and &h7fffffff)\&h100 or (&h800000 and (r and &h80000000)<>0)
r=r1 xor crctbl((asc(mid(buf,i,1))xor r) and 255)
next
crc32=r xor &hffffffff
end function
gencrctable
wscript.stdout.writeline hex(crc32("The quick brown fox jumps over the lazy dog"))
|
Change the programming language of this snippet from Python to VB without modifying what it does. | csvtxt =
from cgi import escape
def _row2tr(row, attr=None):
cols = escape(row).split(',')
return ('<TR>'
+ ''.join('<TD>%s</TD>' % data for data in cols)
+ '</TR>')
def csv2html(txt):
htmltxt = '<TABLE summary="csv2html program output">\n'
for rownum, row in enumerate(txt.split('\n')):
htmlrow = _row2tr(row)
htmlrow = ' <TBODY>%s</TBODY>\n' % htmlrow
htmltxt += htmlrow
htmltxt += '</TABLE>\n'
return htmltxt
htmltxt = csv2html(csvtxt)
print(htmltxt)
| Public Sub CSV_TO_HTML()
input_ = "Character,Speech\n" & _
"The multitude,The messiah! Show us the messiah!\n" & _
"Brians mother,<angry>Now you listen here! He
"he
"The multitude,Who are you?\n" & _
"Brians mother,I
"The multitude,Behold his mother! Behold his mother!"
Debug.Print "<table>" & vbCrLf & "<tr><td>"
For i = 1 To Len(input_)
Select Case Mid(input_, i, 1)
Case "\"
If Mid(input_, i + 1, 1) = "n" Then
Debug.Print "</td></tr>" & vbCrLf & "<tr><td>";
i = i + 1
Else
Debug.Print Mid(input_, i, 1);
End If
Case ",": Debug.Print "</td><td>";
Case "<": Debug.Print "<";
Case ">": Debug.Print ">";
Case "&": Debug.Print "&";
Case Else: Debug.Print Mid(input_, i, 1);
End Select
Next i
Debug.Print "</td></tr>" & vbCrLf & "</table>"
End Sub
|
Write a version of this Python function in VB with identical behavior. | csvtxt =
from cgi import escape
def _row2tr(row, attr=None):
cols = escape(row).split(',')
return ('<TR>'
+ ''.join('<TD>%s</TD>' % data for data in cols)
+ '</TR>')
def csv2html(txt):
htmltxt = '<TABLE summary="csv2html program output">\n'
for rownum, row in enumerate(txt.split('\n')):
htmlrow = _row2tr(row)
htmlrow = ' <TBODY>%s</TBODY>\n' % htmlrow
htmltxt += htmlrow
htmltxt += '</TABLE>\n'
return htmltxt
htmltxt = csv2html(csvtxt)
print(htmltxt)
| Public Sub CSV_TO_HTML()
input_ = "Character,Speech\n" & _
"The multitude,The messiah! Show us the messiah!\n" & _
"Brians mother,<angry>Now you listen here! He
"he
"The multitude,Who are you?\n" & _
"Brians mother,I
"The multitude,Behold his mother! Behold his mother!"
Debug.Print "<table>" & vbCrLf & "<tr><td>"
For i = 1 To Len(input_)
Select Case Mid(input_, i, 1)
Case "\"
If Mid(input_, i + 1, 1) = "n" Then
Debug.Print "</td></tr>" & vbCrLf & "<tr><td>";
i = i + 1
Else
Debug.Print Mid(input_, i, 1);
End If
Case ",": Debug.Print "</td><td>";
Case "<": Debug.Print "<";
Case ">": Debug.Print ">";
Case "&": Debug.Print "&";
Case Else: Debug.Print Mid(input_, i, 1);
End Select
Next i
Debug.Print "</td></tr>" & vbCrLf & "</table>"
End Sub
|
Write a version of this Python function in VB with identical behavior. | csvtxt =
from cgi import escape
def _row2tr(row, attr=None):
cols = escape(row).split(',')
return ('<TR>'
+ ''.join('<TD>%s</TD>' % data for data in cols)
+ '</TR>')
def csv2html(txt):
htmltxt = '<TABLE summary="csv2html program output">\n'
for rownum, row in enumerate(txt.split('\n')):
htmlrow = _row2tr(row)
htmlrow = ' <TBODY>%s</TBODY>\n' % htmlrow
htmltxt += htmlrow
htmltxt += '</TABLE>\n'
return htmltxt
htmltxt = csv2html(csvtxt)
print(htmltxt)
| Public Sub CSV_TO_HTML()
input_ = "Character,Speech\n" & _
"The multitude,The messiah! Show us the messiah!\n" & _
"Brians mother,<angry>Now you listen here! He
"he
"The multitude,Who are you?\n" & _
"Brians mother,I
"The multitude,Behold his mother! Behold his mother!"
Debug.Print "<table>" & vbCrLf & "<tr><td>"
For i = 1 To Len(input_)
Select Case Mid(input_, i, 1)
Case "\"
If Mid(input_, i + 1, 1) = "n" Then
Debug.Print "</td></tr>" & vbCrLf & "<tr><td>";
i = i + 1
Else
Debug.Print Mid(input_, i, 1);
End If
Case ",": Debug.Print "</td><td>";
Case "<": Debug.Print "<";
Case ">": Debug.Print ">";
Case "&": Debug.Print "&";
Case Else: Debug.Print Mid(input_, i, 1);
End Select
Next i
Debug.Print "</td></tr>" & vbCrLf & "</table>"
End Sub
|
Convert this Python block to VB, preserving its control flow and logic. | class MyClass:
name2 = 2
def __init__(self):
self.name1 = 0
def someMethod(self):
self.name1 = 1
MyClass.name2 = 3
myclass = MyClass()
class MyOtherClass:
count = 0
def __init__(self, name, gender="Male", age=None):
MyOtherClass.count += 1
self.name = name
self.gender = gender
if age is not None:
self.age = age
def __del__(self):
MyOtherClass.count -= 1
person1 = MyOtherClass("John")
print person1.name, person1.gender
print person1.age
person2 = MyOtherClass("Jane", "Female", 23)
print person2.name, person2.gender, person2.age
| Class NumberContainer
Private TheNumber As Integer
Sub Constructor(InitialNumber As Integer)
TheNumber = InitialNumber
End Sub
Function Number() As Integer
Return TheNumber
End Function
Sub Number(Assigns NewNumber As Integer)
TheNumber = NewNumber
End Sub
End Class
|
Produce a functionally identical VB code for the snippet given in Python. | class MyClass:
name2 = 2
def __init__(self):
self.name1 = 0
def someMethod(self):
self.name1 = 1
MyClass.name2 = 3
myclass = MyClass()
class MyOtherClass:
count = 0
def __init__(self, name, gender="Male", age=None):
MyOtherClass.count += 1
self.name = name
self.gender = gender
if age is not None:
self.age = age
def __del__(self):
MyOtherClass.count -= 1
person1 = MyOtherClass("John")
print person1.name, person1.gender
print person1.age
person2 = MyOtherClass("Jane", "Female", 23)
print person2.name, person2.gender, person2.age
| Class NumberContainer
Private TheNumber As Integer
Sub Constructor(InitialNumber As Integer)
TheNumber = InitialNumber
End Sub
Function Number() As Integer
Return TheNumber
End Function
Sub Number(Assigns NewNumber As Integer)
TheNumber = NewNumber
End Sub
End Class
|
Translate the given Python code snippet into VB without altering its behavior. | >>> def k(n):
n2 = str(n**2)
for i in range(len(n2)):
a, b = int(n2[:i] or 0), int(n2[i:])
if b and a + b == n:
return n
>>> [x for x in range(1,10000) if k(x)]
[1, 9, 45, 55, 99, 297, 703, 999, 2223, 2728, 4879, 4950, 5050, 5292, 7272, 7777, 9999]
>>> len([x for x in range(1,1000000) if k(x)])
54
>>>
| Module Module1
ReadOnly max As ULong = 1000000
Function Kaprekar(n As ULong) As Boolean
If n = 1 Then Return True
Dim sq = n * n
Dim sq_str = Str(sq)
Dim l = Len(sq_str)
For x = l - 1 To 1 Step -1
If sq_str(x) = "0" Then
l = l - 1
Else
Exit For
End If
Next
For x = 1 To l - 1
Dim p2 = Val(Mid(sq_str, x + 1))
If p2 > n Then
Continue For
End If
Dim p1 = Val(Left(sq_str, x))
If p1 > n Then Return False
If (p1 + p2) = n Then Return True
Next
Return False
End Function
Sub Main()
Dim count = 0
Console.WriteLine("Kaprekar numbers below 10000")
For n = 1 To max - 1
If Kaprekar(n) Then
count = count + 1
If n < 10000 Then
Console.WriteLine("{0,2} {1,4}", count, n)
End If
End If
Next
Console.WriteLine()
Console.WriteLine("{0} numbers below {1} are kaprekar numbers", count, max)
End Sub
End Module
|
Translate this program into VB but keep the logic exactly as in Python. | >>> def k(n):
n2 = str(n**2)
for i in range(len(n2)):
a, b = int(n2[:i] or 0), int(n2[i:])
if b and a + b == n:
return n
>>> [x for x in range(1,10000) if k(x)]
[1, 9, 45, 55, 99, 297, 703, 999, 2223, 2728, 4879, 4950, 5050, 5292, 7272, 7777, 9999]
>>> len([x for x in range(1,1000000) if k(x)])
54
>>>
| Module Module1
ReadOnly max As ULong = 1000000
Function Kaprekar(n As ULong) As Boolean
If n = 1 Then Return True
Dim sq = n * n
Dim sq_str = Str(sq)
Dim l = Len(sq_str)
For x = l - 1 To 1 Step -1
If sq_str(x) = "0" Then
l = l - 1
Else
Exit For
End If
Next
For x = 1 To l - 1
Dim p2 = Val(Mid(sq_str, x + 1))
If p2 > n Then
Continue For
End If
Dim p1 = Val(Left(sq_str, x))
If p1 > n Then Return False
If (p1 + p2) = n Then Return True
Next
Return False
End Function
Sub Main()
Dim count = 0
Console.WriteLine("Kaprekar numbers below 10000")
For n = 1 To max - 1
If Kaprekar(n) Then
count = count + 1
If n < 10000 Then
Console.WriteLine("{0,2} {1,4}", count, n)
End If
End If
Next
Console.WriteLine()
Console.WriteLine("{0} numbers below {1} are kaprekar numbers", count, max)
End Sub
End Module
|
Change the programming language of this snippet from Python to VB without modifying what it does. | def compress(uncompressed):
dict_size = 256
dictionary = dict((chr(i), i) for i in range(dict_size))
w = ""
result = []
for c in uncompressed:
wc = w + c
if wc in dictionary:
w = wc
else:
result.append(dictionary[w])
dictionary[wc] = dict_size
dict_size += 1
w = c
if w:
result.append(dictionary[w])
return result
def decompress(compressed):
from io import StringIO
dict_size = 256
dictionary = dict((i, chr(i)) for i in range(dict_size))
result = StringIO()
w = chr(compressed.pop(0))
result.write(w)
for k in compressed:
if k in dictionary:
entry = dictionary[k]
elif k == dict_size:
entry = w + w[0]
else:
raise ValueError('Bad compressed k: %s' % k)
result.write(entry)
dictionary[dict_size] = w + entry[0]
dict_size += 1
w = entry
return result.getvalue()
compressed = compress('TOBEORNOTTOBEORTOBEORNOT')
print (compressed)
decompressed = decompress(compressed)
print (decompressed)
| Option Explicit
Const numchars=127
Function LZWCompress(si)
Dim oDict, intMaxCode, i,z,ii,ss,strCurrent,strNext,j
Set oDict = CreateObject("Scripting.Dictionary")
ReDim a(Len(si))
intMaxCode = numchars
For i = 0 To numchars
oDict.Add Chr(i), i
Next
strCurrent = Left(si,1)
j=0
For ii=2 To Len(si)
strNext = Mid(si,ii,1)
ss=strCurrent & strNext
If oDict.Exists(ss) Then
strCurrent = ss
Else
a(j)=oDict.Item(strCurrent) :j=j+1
intMaxCode = intMaxCode + 1
oDict.Add ss, intMaxCode
strCurrent = strNext
End If
Next
a(j)=oDict.Item(strCurrent)
ReDim preserve a(j)
LZWCompress=a
Set oDict = Nothing
End Function
Function lzwUncompress(sc)
Dim intNext, intCurrent, intMaxCode, i,ss,istr,s,j
s=""
reDim dict(1000)
intMaxCode = numchars
For i = 0 To numchars : dict(i)= Chr(i) : Next
intCurrent=sc(0)
For j=1 To UBound(sc)
ss=dict(intCurrent)
s= s & ss
intMaxCode = intMaxCode + 1
intnext=sc(j)
If intNext<intMaxCode Then
dict(intMaxCode)=ss & Left(dict(intNext), 1)
Else
dict(intMaxCode)=ss & Left(ss, 1)
End If
intCurrent = intNext
Next
s= s & dict(intCurrent)
lzwUncompress=s
End function
Sub printvec(a)
Dim s,i,x
s="("
For i=0 To UBound (a)
s=s & x & a(i)
x=", "
Next
WScript.echo s &")"
End sub
Dim a,b
b="TOBEORNOTTOBEORTOBEORNOT"
WScript.Echo b
a=LZWCompress (b)
printvec(a)
WScript.echo lzwUncompress (a )
wscript.quit 1
|
Transform the following Python implementation into VB, maintaining the same output and logic. | def ffr(n):
if n < 1 or type(n) != int: raise ValueError("n must be an int >= 1")
try:
return ffr.r[n]
except IndexError:
r, s = ffr.r, ffs.s
ffr_n_1 = ffr(n-1)
lastr = r[-1]
s += list(range(s[-1] + 1, lastr))
if s[-1] < lastr: s += [lastr + 1]
len_s = len(s)
ffs_n_1 = s[n-1] if len_s > n else (n - len_s) + s[-1]
ans = ffr_n_1 + ffs_n_1
r.append(ans)
return ans
ffr.r = [None, 1]
def ffs(n):
if n < 1 or type(n) != int: raise ValueError("n must be an int >= 1")
try:
return ffs.s[n]
except IndexError:
r, s = ffr.r, ffs.s
for i in range(len(r), n+2):
ffr(i)
if len(s) > n:
return s[n]
raise Exception("Whoops!")
ffs.s = [None, 2]
if __name__ == '__main__':
first10 = [ffr(i) for i in range(1,11)]
assert first10 == [1, 3, 7, 12, 18, 26, 35, 45, 56, 69], "ffr() value error(s)"
print("ffr(n) for n = [1..10] is", first10)
bin = [None] + [0]*1000
for i in range(40, 0, -1):
bin[ffr(i)] += 1
for i in range(960, 0, -1):
bin[ffs(i)] += 1
if all(b == 1 for b in bin[1:1000]):
print("All Integers 1..1000 found OK")
else:
print("All Integers 1..1000 NOT found only once: ERROR")
| Private Function ffr(n As Long) As Long
Dim R As New Collection
Dim S As New Collection
R.Add 1
S.Add 2
For i = 2 To n
R.Add R(i - 1) + S(i - 1)
For j = S(S.Count) + 1 To R(i) - 1
S.Add j
Next j
For j = R(i) + 1 To R(i) + S(i - 1)
S.Add j
Next j
Next i
ffr = R(n)
Set R = Nothing
Set S = Nothing
End Function
Private Function ffs(n As Long) As Long
Dim R As New Collection
Dim S As New Collection
R.Add 1
S.Add 2
For i = 2 To n
R.Add R(i - 1) + S(i - 1)
For j = S(S.Count) + 1 To R(i) - 1
S.Add j
Next j
For j = R(i) + 1 To R(i) + S(i - 1)
S.Add j
Next j
If S.Count >= n Then Exit For
Next i
ffs = S(n)
Set R = Nothing
Set S = Nothing
End Function
Public Sub main()
Dim i As Long
Debug.Print "The first ten values of R are:"
For i = 1 To 10
Debug.Print ffr(i);
Next i
Debug.Print
Dim x As New Collection
For i = 1 To 1000
x.Add i, CStr(i)
Next i
For i = 1 To 40
x.Remove CStr(ffr(i))
Next i
For i = 1 To 960
x.Remove CStr(ffs(i))
Next i
Debug.Print "The first 40 values of ffr plus the first 960 values of ffs "
Debug.Print "include all the integers from 1 to 1000 exactly once is "; Format(x.Count = 0)
End Sub
|
Convert the following code from Python to VB, ensuring the logic remains intact. | def ffr(n):
if n < 1 or type(n) != int: raise ValueError("n must be an int >= 1")
try:
return ffr.r[n]
except IndexError:
r, s = ffr.r, ffs.s
ffr_n_1 = ffr(n-1)
lastr = r[-1]
s += list(range(s[-1] + 1, lastr))
if s[-1] < lastr: s += [lastr + 1]
len_s = len(s)
ffs_n_1 = s[n-1] if len_s > n else (n - len_s) + s[-1]
ans = ffr_n_1 + ffs_n_1
r.append(ans)
return ans
ffr.r = [None, 1]
def ffs(n):
if n < 1 or type(n) != int: raise ValueError("n must be an int >= 1")
try:
return ffs.s[n]
except IndexError:
r, s = ffr.r, ffs.s
for i in range(len(r), n+2):
ffr(i)
if len(s) > n:
return s[n]
raise Exception("Whoops!")
ffs.s = [None, 2]
if __name__ == '__main__':
first10 = [ffr(i) for i in range(1,11)]
assert first10 == [1, 3, 7, 12, 18, 26, 35, 45, 56, 69], "ffr() value error(s)"
print("ffr(n) for n = [1..10] is", first10)
bin = [None] + [0]*1000
for i in range(40, 0, -1):
bin[ffr(i)] += 1
for i in range(960, 0, -1):
bin[ffs(i)] += 1
if all(b == 1 for b in bin[1:1000]):
print("All Integers 1..1000 found OK")
else:
print("All Integers 1..1000 NOT found only once: ERROR")
| Private Function ffr(n As Long) As Long
Dim R As New Collection
Dim S As New Collection
R.Add 1
S.Add 2
For i = 2 To n
R.Add R(i - 1) + S(i - 1)
For j = S(S.Count) + 1 To R(i) - 1
S.Add j
Next j
For j = R(i) + 1 To R(i) + S(i - 1)
S.Add j
Next j
Next i
ffr = R(n)
Set R = Nothing
Set S = Nothing
End Function
Private Function ffs(n As Long) As Long
Dim R As New Collection
Dim S As New Collection
R.Add 1
S.Add 2
For i = 2 To n
R.Add R(i - 1) + S(i - 1)
For j = S(S.Count) + 1 To R(i) - 1
S.Add j
Next j
For j = R(i) + 1 To R(i) + S(i - 1)
S.Add j
Next j
If S.Count >= n Then Exit For
Next i
ffs = S(n)
Set R = Nothing
Set S = Nothing
End Function
Public Sub main()
Dim i As Long
Debug.Print "The first ten values of R are:"
For i = 1 To 10
Debug.Print ffr(i);
Next i
Debug.Print
Dim x As New Collection
For i = 1 To 1000
x.Add i, CStr(i)
Next i
For i = 1 To 40
x.Remove CStr(ffr(i))
Next i
For i = 1 To 960
x.Remove CStr(ffs(i))
Next i
Debug.Print "The first 40 values of ffr plus the first 960 values of ffs "
Debug.Print "include all the integers from 1 to 1000 exactly once is "; Format(x.Count = 0)
End Sub
|
Rewrite this program in VB while keeping its functionality equivalent to the Python version. | >>> def magic(n):
for row in range(1, n + 1):
print(' '.join('%*i' % (len(str(n**2)), cell) for cell in
(n * ((row + col - 1 + n // 2) % n) +
((row + 2 * col - 2) % n) + 1
for col in range(1, n + 1))))
print('\nAll sum to magic number %i' % ((n * n + 1) * n // 2))
>>> for n in (5, 3, 7):
print('\nOrder %i\n=======' % n)
magic(n)
Order 5
=======
17 24 1 8 15
23 5 7 14 16
4 6 13 20 22
10 12 19 21 3
11 18 25 2 9
All sum to magic number 65
Order 3
=======
8 1 6
3 5 7
4 9 2
All sum to magic number 15
Order 7
=======
30 39 48 1 10 19 28
38 47 7 9 18 27 29
46 6 8 17 26 35 37
5 14 16 25 34 36 45
13 15 24 33 42 44 4
21 23 32 41 43 3 12
22 31 40 49 2 11 20
All sum to magic number 175
>>>
| Sub magicsquare()
Const n = 9
Dim i As Integer, j As Integer, v As Integer
Debug.Print "The square order is: " & n
For i = 1 To n
For j = 1 To n
Cells(i, j) = ((i * 2 - j + n - 1) Mod n) * n + ((i * 2 + j - 2) Mod n) + 1
Next j
Next i
Debug.Print "The magic number of"; n; "x"; n; "square is:"; n * (n * n + 1) \ 2
End Sub
|
Write the same algorithm in VB as shown in this Python implementation. | >>> def magic(n):
for row in range(1, n + 1):
print(' '.join('%*i' % (len(str(n**2)), cell) for cell in
(n * ((row + col - 1 + n // 2) % n) +
((row + 2 * col - 2) % n) + 1
for col in range(1, n + 1))))
print('\nAll sum to magic number %i' % ((n * n + 1) * n // 2))
>>> for n in (5, 3, 7):
print('\nOrder %i\n=======' % n)
magic(n)
Order 5
=======
17 24 1 8 15
23 5 7 14 16
4 6 13 20 22
10 12 19 21 3
11 18 25 2 9
All sum to magic number 65
Order 3
=======
8 1 6
3 5 7
4 9 2
All sum to magic number 15
Order 7
=======
30 39 48 1 10 19 28
38 47 7 9 18 27 29
46 6 8 17 26 35 37
5 14 16 25 34 36 45
13 15 24 33 42 44 4
21 23 32 41 43 3 12
22 31 40 49 2 11 20
All sum to magic number 175
>>>
| Sub magicsquare()
Const n = 9
Dim i As Integer, j As Integer, v As Integer
Debug.Print "The square order is: " & n
For i = 1 To n
For j = 1 To n
Cells(i, j) = ((i * 2 - j + n - 1) Mod n) * n + ((i * 2 + j - 2) Mod n) + 1
Next j
Next i
Debug.Print "The magic number of"; n; "x"; n; "square is:"; n * (n * n + 1) \ 2
End Sub
|
Convert this Python snippet to VB and keep its semantics consistent. | from __future__ import division
from itertools import islice, count
from collections import Counter
from math import log10
from random import randint
expected = [log10(1+1/d) for d in range(1,10)]
def fib():
a,b = 1,1
while True:
yield a
a,b = b,a+b
def power_of_threes():
return (3**k for k in count(0))
def heads(s):
for a in s: yield int(str(a)[0])
def show_dist(title, s):
c = Counter(s)
size = sum(c.values())
res = [c[d]/size for d in range(1,10)]
print("\n%s Benfords deviation" % title)
for r, e in zip(res, expected):
print("%5.1f%% %5.1f%% %5.1f%%" % (r*100., e*100., abs(r - e)*100.))
def rand1000():
while True: yield randint(1,9999)
if __name__ == '__main__':
show_dist("fibbed", islice(heads(fib()), 1000))
show_dist("threes", islice(heads(power_of_threes()), 1000))
show_dist("random", islice(heads(rand1000()), 10000))
| Sub BenfordLaw()
Dim BenResult(1 To 9) As Long
BENref = "30,1%|17,6%|12,5%|9,7%|7,9%|6,7%|5,8%|5,1%|4,6%"
For Each c In Selection.Cells
If InStr(1, "-0123456789", Left(c, 1)) > 0 Then
For i = 1 To 9
If CInt(Left(Abs(c), 1)) = i Then BenResult(i) = BenResult(i) + 1: Exit For
Next
End If
Next
Total= Application.Sum(BenResult)
biggest= Len(CStr(BenResult(1)))
txt = "# | Values | Real | Expected " & vbCrLf
For i = 1 To 9
If BenResult(i) > 0 Then
txt = txt & "#" & i & " | " & vbTab
txt = txt & String((biggest - Len(CStr(BenResult(i)))) * 2, " ") & Format(BenResult(i), "0") & " | " & vbTab
txt = txt & String((Len(CStr(Format(BenResult(1) / Total, "##0.0%"))) - Len(CStr(Format(BenResult(i) / Total, "##0.0%")))) * 2, " ") & Format(BenResult(i) / Total, "##0.0%") & " | " & vbTab
txt = txt & Format(Split(BENref, "|")(i - 1), " ##0.0%") & vbCrLf
End If
Next
MsgBox txt, vbOKOnly, "Finish"
End Sub
}
|
Rewrite this program in VB while keeping its functionality equivalent to the Python version. | from __future__ import division
from itertools import islice, count
from collections import Counter
from math import log10
from random import randint
expected = [log10(1+1/d) for d in range(1,10)]
def fib():
a,b = 1,1
while True:
yield a
a,b = b,a+b
def power_of_threes():
return (3**k for k in count(0))
def heads(s):
for a in s: yield int(str(a)[0])
def show_dist(title, s):
c = Counter(s)
size = sum(c.values())
res = [c[d]/size for d in range(1,10)]
print("\n%s Benfords deviation" % title)
for r, e in zip(res, expected):
print("%5.1f%% %5.1f%% %5.1f%%" % (r*100., e*100., abs(r - e)*100.))
def rand1000():
while True: yield randint(1,9999)
if __name__ == '__main__':
show_dist("fibbed", islice(heads(fib()), 1000))
show_dist("threes", islice(heads(power_of_threes()), 1000))
show_dist("random", islice(heads(rand1000()), 10000))
| Sub BenfordLaw()
Dim BenResult(1 To 9) As Long
BENref = "30,1%|17,6%|12,5%|9,7%|7,9%|6,7%|5,8%|5,1%|4,6%"
For Each c In Selection.Cells
If InStr(1, "-0123456789", Left(c, 1)) > 0 Then
For i = 1 To 9
If CInt(Left(Abs(c), 1)) = i Then BenResult(i) = BenResult(i) + 1: Exit For
Next
End If
Next
Total= Application.Sum(BenResult)
biggest= Len(CStr(BenResult(1)))
txt = "# | Values | Real | Expected " & vbCrLf
For i = 1 To 9
If BenResult(i) > 0 Then
txt = txt & "#" & i & " | " & vbTab
txt = txt & String((biggest - Len(CStr(BenResult(i)))) * 2, " ") & Format(BenResult(i), "0") & " | " & vbTab
txt = txt & String((Len(CStr(Format(BenResult(1) / Total, "##0.0%"))) - Len(CStr(Format(BenResult(i) / Total, "##0.0%")))) * 2, " ") & Format(BenResult(i) / Total, "##0.0%") & " | " & vbTab
txt = txt & Format(Split(BENref, "|")(i - 1), " ##0.0%") & vbCrLf
End If
Next
MsgBox txt, vbOKOnly, "Finish"
End Sub
}
|
Preserve the algorithm and functionality while converting the code from Python to VB. | >>> Y = lambda f: (lambda x: x(x))(lambda y: f(lambda *args: y(y)(*args)))
>>> fib = lambda f: lambda n: None if n < 0 else (0 if n == 0 else (1 if n == 1 else f(n-1) + f(n-2)))
>>> [ Y(fib)(i) for i in range(-2, 10) ]
[None, None, 0, 1, 1, 2, 3, 5, 8, 13, 21, 34]
| Sub Main()
Debug.Print F(-10)
Debug.Print F(10)
End Sub
Private Function F(N As Long) As Variant
If N < 0 Then
F = "Error. Negative argument"
ElseIf N <= 1 Then
F = N
Else
F = F(N - 1) + F(N - 2)
End If
End Function
|
Can you help me rewrite this code in VB instead of Python, keeping it the same logically? | print "knight"[1:]
print "socks"[:-1]
print "brooms"[1:-1]
| string = "Small Basic"
TextWindow.WriteLine(Text.GetSubTextToEnd(string, 2))
TextWindow.WriteLine(Text.GetSubText(string, 1, Text.GetLength(string) - 1))
TextWindow.WriteLine(Text.GetSubText(string, 2, Text.GetLength(string) - 2))
|
Write the same code in VB as shown below in Python. | print "knight"[1:]
print "socks"[:-1]
print "brooms"[1:-1]
| string = "Small Basic"
TextWindow.WriteLine(Text.GetSubTextToEnd(string, 2))
TextWindow.WriteLine(Text.GetSubText(string, 1, Text.GetLength(string) - 1))
TextWindow.WriteLine(Text.GetSubText(string, 2, Text.GetLength(string) - 2))
|
Convert the following code from Python to VB, ensuring the logic remains intact. | import fileinput
def longer(a, b):
try:
b[len(a)-1]
return False
except:
return True
longest, lines = '', ''
for x in fileinput.input():
if longer(x, longest):
lines, longest = x, x
elif not longer(longest, x):
lines += x
print(lines, end='')
|
Set objfso = CreateObject("Scripting.FileSystemObject")
Set objfile = objfso.OpenTextFile(objfso.GetParentFolderName(WScript.ScriptFullName) &_
"\input.txt",1)
list = ""
previous_line = ""
l = Len(previous_line)
Do Until objfile.AtEndOfStream
current_line = objfile.ReadLine
If Mid(current_line,l+1,1) <> "" Then
list = current_line & vbCrLf
previous_line = current_line
l = Len(previous_line)
ElseIf Mid(current_line,l,1) <> "" And Mid(current_line,(l+1),1) = "" Then
list = list & current_line & vbCrLf
End If
Loop
WScript.Echo list
objfile.Close
Set objfso = Nothing
|
Produce a functionally identical VB code for the snippet given in Python. | import fileinput
def longer(a, b):
try:
b[len(a)-1]
return False
except:
return True
longest, lines = '', ''
for x in fileinput.input():
if longer(x, longest):
lines, longest = x, x
elif not longer(longest, x):
lines += x
print(lines, end='')
|
Set objfso = CreateObject("Scripting.FileSystemObject")
Set objfile = objfso.OpenTextFile(objfso.GetParentFolderName(WScript.ScriptFullName) &_
"\input.txt",1)
list = ""
previous_line = ""
l = Len(previous_line)
Do Until objfile.AtEndOfStream
current_line = objfile.ReadLine
If Mid(current_line,l+1,1) <> "" Then
list = current_line & vbCrLf
previous_line = current_line
l = Len(previous_line)
ElseIf Mid(current_line,l,1) <> "" And Mid(current_line,(l+1),1) = "" Then
list = list & current_line & vbCrLf
End If
Loop
WScript.Echo list
objfile.Close
Set objfso = Nothing
|
Convert this Python snippet to VB and keep its semantics consistent. | from __future__ import print_function
def run_utm(
state = None,
blank = None,
rules = [],
tape = [],
halt = None,
pos = 0):
st = state
if not tape: tape = [blank]
if pos < 0: pos += len(tape)
if pos >= len(tape) or pos < 0: raise Error( "bad init position")
rules = dict(((s0, v0), (v1, dr, s1)) for (s0, v0, v1, dr, s1) in rules)
while True:
print(st, '\t', end=" ")
for i, v in enumerate(tape):
if i == pos: print("[%s]" % (v,), end=" ")
else: print(v, end=" ")
print()
if st == halt: break
if (st, tape[pos]) not in rules: break
(v1, dr, s1) = rules[(st, tape[pos])]
tape[pos] = v1
if dr == 'left':
if pos > 0: pos -= 1
else: tape.insert(0, blank)
if dr == 'right':
pos += 1
if pos >= len(tape): tape.append(blank)
st = s1
print("incr machine\n")
run_utm(
halt = 'qf',
state = 'q0',
tape = list("111"),
blank = 'B',
rules = map(tuple,
["q0 1 1 right q0".split(),
"q0 B 1 stay qf".split()]
)
)
print("\nbusy beaver\n")
run_utm(
halt = 'halt',
state = 'a',
blank = '0',
rules = map(tuple,
["a 0 1 right b".split(),
"a 1 1 left c".split(),
"b 0 1 left a".split(),
"b 1 1 right b".split(),
"c 0 1 left b".split(),
"c 1 1 stay halt".split()]
)
)
print("\nsorting test\n")
run_utm(halt = 'STOP',
state = 'A',
blank = '0',
tape = "2 2 2 1 2 2 1 2 1 2 1 2 1 2".split(),
rules = map(tuple,
["A 1 1 right A".split(),
"A 2 3 right B".split(),
"A 0 0 left E".split(),
"B 1 1 right B".split(),
"B 2 2 right B".split(),
"B 0 0 left C".split(),
"C 1 2 left D".split(),
"C 2 2 left C".split(),
"C 3 2 left E".split(),
"D 1 1 left D".split(),
"D 2 2 left D".split(),
"D 3 1 right A".split(),
"E 1 1 left E".split(),
"E 0 0 right STOP".split()]
)
)
| Option Base 1
Public Enum sett
name_ = 1
initState
endState
blank
rules
End Enum
Public incrementer As Variant, threeStateBB As Variant, fiveStateBB As Variant
Private Sub init()
incrementer = Array("Simple incrementer", _
"q0", _
"qf", _
"B", _
Array( _
Array("q0", "1", "1", "right", "q0"), _
Array("q0", "B", "1", "stay", "qf")))
threeStateBB = Array("Three-state busy beaver", _
"a", _
"halt", _
"0", _
Array( _
Array("a", "0", "1", "right", "b"), _
Array("a", "1", "1", "left", "c"), _
Array("b", "0", "1", "left", "a"), _
Array("b", "1", "1", "right", "b"), _
Array("c", "0", "1", "left", "b"), _
Array("c", "1", "1", "stay", "halt")))
fiveStateBB = Array("Five-state busy beaver", _
"A", _
"H", _
"0", _
Array( _
Array("A", "0", "1", "right", "B"), _
Array("A", "1", "1", "left", "C"), _
Array("B", "0", "1", "right", "C"), _
Array("B", "1", "1", "right", "B"), _
Array("C", "0", "1", "right", "D"), _
Array("C", "1", "0", "left", "E"), _
Array("D", "0", "1", "left", "A"), _
Array("D", "1", "1", "left", "D"), _
Array("E", "0", "1", "stay", "H"), _
Array("E", "1", "0", "left", "A")))
End Sub
Private Sub show(state As String, headpos As Long, tape As Collection)
Debug.Print " "; state; String$(7 - Len(state), " "); "| ";
For p = 1 To tape.Count
Debug.Print IIf(p = headpos, "[" & tape(p) & "]", " " & tape(p) & " ");
Next p
Debug.Print
End Sub
Private Sub UTM(machine As Variant, tape As Collection, Optional countOnly As Long = 0)
Dim state As String: state = machine(initState)
Dim headpos As Long: headpos = 1
Dim counter As Long, rule As Variant
Debug.Print machine(name_); vbCrLf; String$(Len(machine(name_)), "=")
If Not countOnly Then Debug.Print " State | Tape [head]" & vbCrLf & "---------------------"
Do While True
If headpos > tape.Count Then
tape.Add machine(blank)
Else
If headpos < 1 Then
tape.Add machine(blank), Before:=1
headpos = 1
End If
End If
If Not countOnly Then show state, headpos, tape
For i = LBound(machine(rules)) To UBound(machine(rules))
rule = machine(rules)(i)
If rule(1) = state And rule(2) = tape(headpos) Then
tape.Remove headpos
If headpos > tape.Count Then
tape.Add rule(3)
Else
tape.Add rule(3), Before:=headpos
End If
If rule(4) = "left" Then headpos = headpos - 1
If rule(4) = "right" Then headpos = headpos + 1
state = rule(5)
Exit For
End If
Next i
counter = counter + 1
If counter Mod 100000 = 0 Then
Debug.Print counter
DoEvents
DoEvents
End If
If state = machine(endState) Then Exit Do
Loop
DoEvents
If countOnly Then
Debug.Print "Steps taken: ", counter
Else
show state, headpos, tape
Debug.Print
End If
End Sub
Public Sub main()
init
Dim tap As New Collection
tap.Add "1": tap.Add "1": tap.Add "1"
UTM incrementer, tap
Set tap = New Collection
UTM threeStateBB, tap
Set tap = New Collection
UTM fiveStateBB, tap, countOnly:=-1
End Sub
|
Port the following code from Python to VB with equivalent syntax and logic. | from __future__ import print_function
def run_utm(
state = None,
blank = None,
rules = [],
tape = [],
halt = None,
pos = 0):
st = state
if not tape: tape = [blank]
if pos < 0: pos += len(tape)
if pos >= len(tape) or pos < 0: raise Error( "bad init position")
rules = dict(((s0, v0), (v1, dr, s1)) for (s0, v0, v1, dr, s1) in rules)
while True:
print(st, '\t', end=" ")
for i, v in enumerate(tape):
if i == pos: print("[%s]" % (v,), end=" ")
else: print(v, end=" ")
print()
if st == halt: break
if (st, tape[pos]) not in rules: break
(v1, dr, s1) = rules[(st, tape[pos])]
tape[pos] = v1
if dr == 'left':
if pos > 0: pos -= 1
else: tape.insert(0, blank)
if dr == 'right':
pos += 1
if pos >= len(tape): tape.append(blank)
st = s1
print("incr machine\n")
run_utm(
halt = 'qf',
state = 'q0',
tape = list("111"),
blank = 'B',
rules = map(tuple,
["q0 1 1 right q0".split(),
"q0 B 1 stay qf".split()]
)
)
print("\nbusy beaver\n")
run_utm(
halt = 'halt',
state = 'a',
blank = '0',
rules = map(tuple,
["a 0 1 right b".split(),
"a 1 1 left c".split(),
"b 0 1 left a".split(),
"b 1 1 right b".split(),
"c 0 1 left b".split(),
"c 1 1 stay halt".split()]
)
)
print("\nsorting test\n")
run_utm(halt = 'STOP',
state = 'A',
blank = '0',
tape = "2 2 2 1 2 2 1 2 1 2 1 2 1 2".split(),
rules = map(tuple,
["A 1 1 right A".split(),
"A 2 3 right B".split(),
"A 0 0 left E".split(),
"B 1 1 right B".split(),
"B 2 2 right B".split(),
"B 0 0 left C".split(),
"C 1 2 left D".split(),
"C 2 2 left C".split(),
"C 3 2 left E".split(),
"D 1 1 left D".split(),
"D 2 2 left D".split(),
"D 3 1 right A".split(),
"E 1 1 left E".split(),
"E 0 0 right STOP".split()]
)
)
| Option Base 1
Public Enum sett
name_ = 1
initState
endState
blank
rules
End Enum
Public incrementer As Variant, threeStateBB As Variant, fiveStateBB As Variant
Private Sub init()
incrementer = Array("Simple incrementer", _
"q0", _
"qf", _
"B", _
Array( _
Array("q0", "1", "1", "right", "q0"), _
Array("q0", "B", "1", "stay", "qf")))
threeStateBB = Array("Three-state busy beaver", _
"a", _
"halt", _
"0", _
Array( _
Array("a", "0", "1", "right", "b"), _
Array("a", "1", "1", "left", "c"), _
Array("b", "0", "1", "left", "a"), _
Array("b", "1", "1", "right", "b"), _
Array("c", "0", "1", "left", "b"), _
Array("c", "1", "1", "stay", "halt")))
fiveStateBB = Array("Five-state busy beaver", _
"A", _
"H", _
"0", _
Array( _
Array("A", "0", "1", "right", "B"), _
Array("A", "1", "1", "left", "C"), _
Array("B", "0", "1", "right", "C"), _
Array("B", "1", "1", "right", "B"), _
Array("C", "0", "1", "right", "D"), _
Array("C", "1", "0", "left", "E"), _
Array("D", "0", "1", "left", "A"), _
Array("D", "1", "1", "left", "D"), _
Array("E", "0", "1", "stay", "H"), _
Array("E", "1", "0", "left", "A")))
End Sub
Private Sub show(state As String, headpos As Long, tape As Collection)
Debug.Print " "; state; String$(7 - Len(state), " "); "| ";
For p = 1 To tape.Count
Debug.Print IIf(p = headpos, "[" & tape(p) & "]", " " & tape(p) & " ");
Next p
Debug.Print
End Sub
Private Sub UTM(machine As Variant, tape As Collection, Optional countOnly As Long = 0)
Dim state As String: state = machine(initState)
Dim headpos As Long: headpos = 1
Dim counter As Long, rule As Variant
Debug.Print machine(name_); vbCrLf; String$(Len(machine(name_)), "=")
If Not countOnly Then Debug.Print " State | Tape [head]" & vbCrLf & "---------------------"
Do While True
If headpos > tape.Count Then
tape.Add machine(blank)
Else
If headpos < 1 Then
tape.Add machine(blank), Before:=1
headpos = 1
End If
End If
If Not countOnly Then show state, headpos, tape
For i = LBound(machine(rules)) To UBound(machine(rules))
rule = machine(rules)(i)
If rule(1) = state And rule(2) = tape(headpos) Then
tape.Remove headpos
If headpos > tape.Count Then
tape.Add rule(3)
Else
tape.Add rule(3), Before:=headpos
End If
If rule(4) = "left" Then headpos = headpos - 1
If rule(4) = "right" Then headpos = headpos + 1
state = rule(5)
Exit For
End If
Next i
counter = counter + 1
If counter Mod 100000 = 0 Then
Debug.Print counter
DoEvents
DoEvents
End If
If state = machine(endState) Then Exit Do
Loop
DoEvents
If countOnly Then
Debug.Print "Steps taken: ", counter
Else
show state, headpos, tape
Debug.Print
End If
End Sub
Public Sub main()
init
Dim tap As New Collection
tap.Add "1": tap.Add "1": tap.Add "1"
UTM incrementer, tap
Set tap = New Collection
UTM threeStateBB, tap
Set tap = New Collection
UTM fiveStateBB, tap, countOnly:=-1
End Sub
|
Transform the following Python implementation into VB, maintaining the same output and logic. | import os
for directory in ['/', './']:
open(directory + 'output.txt', 'w').close()
os.mkdir(directory + 'docs')
| Public Sub create_file()
Dim FileNumber As Integer
FileNumber = FreeFile
MkDir "docs"
Open "docs\output.txt" For Output As #FreeFile
Close #FreeFile
MkDir "C:\docs"
Open "C:\docs\output.txt" For Output As #FreeFile
Close #FreeFile
End Sub
|
Write a version of this Python function in VB with identical behavior. | from collections import Counter
def basecount(dna):
return sorted(Counter(dna).items())
def seq_split(dna, n=50):
return [dna[i: i+n] for i in range(0, len(dna), n)]
def seq_pp(dna, n=50):
for i, part in enumerate(seq_split(dna, n)):
print(f"{i*n:>5}: {part}")
print("\n BASECOUNT:")
tot = 0
for base, count in basecount(dna):
print(f" {base:>3}: {count}")
tot += count
base, count = 'TOT', tot
print(f" {base:>3}= {count}")
if __name__ == '__main__':
print("SEQUENCE:")
sequence =
seq_pp(sequence)
| b=_
"CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATG" &_
"CTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTG" &_
"AGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGAT" &_
"GGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT" &_
"CGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGG" &_
"TCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA" &_
"TTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTAT" &_
"CGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTG" &_
"TCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGAC" &_
"GACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT"
s="SEQUENCE:"
acnt=0:ccnt=0:gcnt=0:tcnt=0
for i=0 to len(b)-1
if (i mod 30)=0 then s = s & vbcrlf & right(" "& i+1,3)&": "
if (i mod 5)=0 then s=s& " "
m=mid(b,i+1,1)
s=s & m
select case m
case "A":acnt=acnt+1
case "C":ccnt=ccnt+1
case "G":gcnt=gcnt+1
case "T":tcnt=tcnt+1
case else
wscript.echo "error at ",i+1, m
end select
next
wscript.echo s & vbcrlf
wscript.echo "Count: A="&acnt & " C=" & ccnt & " G=" & gcnt & " T=" & tcnt
|
Write the same code in VB as shown below in Python. | from collections import Counter
def basecount(dna):
return sorted(Counter(dna).items())
def seq_split(dna, n=50):
return [dna[i: i+n] for i in range(0, len(dna), n)]
def seq_pp(dna, n=50):
for i, part in enumerate(seq_split(dna, n)):
print(f"{i*n:>5}: {part}")
print("\n BASECOUNT:")
tot = 0
for base, count in basecount(dna):
print(f" {base:>3}: {count}")
tot += count
base, count = 'TOT', tot
print(f" {base:>3}= {count}")
if __name__ == '__main__':
print("SEQUENCE:")
sequence =
seq_pp(sequence)
| b=_
"CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATG" &_
"CTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTG" &_
"AGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGAT" &_
"GGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT" &_
"CGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGG" &_
"TCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA" &_
"TTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTAT" &_
"CGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTG" &_
"TCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGAC" &_
"GACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT"
s="SEQUENCE:"
acnt=0:ccnt=0:gcnt=0:tcnt=0
for i=0 to len(b)-1
if (i mod 30)=0 then s = s & vbcrlf & right(" "& i+1,3)&": "
if (i mod 5)=0 then s=s& " "
m=mid(b,i+1,1)
s=s & m
select case m
case "A":acnt=acnt+1
case "C":ccnt=ccnt+1
case "G":gcnt=gcnt+1
case "T":tcnt=tcnt+1
case else
wscript.echo "error at ",i+1, m
end select
next
wscript.echo s & vbcrlf
wscript.echo "Count: A="&acnt & " C=" & ccnt & " G=" & gcnt & " T=" & tcnt
|
Produce a language-to-language conversion: from Python to VB, same semantics. | from collections import Counter
def basecount(dna):
return sorted(Counter(dna).items())
def seq_split(dna, n=50):
return [dna[i: i+n] for i in range(0, len(dna), n)]
def seq_pp(dna, n=50):
for i, part in enumerate(seq_split(dna, n)):
print(f"{i*n:>5}: {part}")
print("\n BASECOUNT:")
tot = 0
for base, count in basecount(dna):
print(f" {base:>3}: {count}")
tot += count
base, count = 'TOT', tot
print(f" {base:>3}= {count}")
if __name__ == '__main__':
print("SEQUENCE:")
sequence =
seq_pp(sequence)
| b=_
"CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATG" &_
"CTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTG" &_
"AGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGAT" &_
"GGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT" &_
"CGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGG" &_
"TCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA" &_
"TTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTAT" &_
"CGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTG" &_
"TCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGAC" &_
"GACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT"
s="SEQUENCE:"
acnt=0:ccnt=0:gcnt=0:tcnt=0
for i=0 to len(b)-1
if (i mod 30)=0 then s = s & vbcrlf & right(" "& i+1,3)&": "
if (i mod 5)=0 then s=s& " "
m=mid(b,i+1,1)
s=s & m
select case m
case "A":acnt=acnt+1
case "C":ccnt=ccnt+1
case "G":gcnt=gcnt+1
case "T":tcnt=tcnt+1
case else
wscript.echo "error at ",i+1, m
end select
next
wscript.echo s & vbcrlf
wscript.echo "Count: A="&acnt & " C=" & ccnt & " G=" & gcnt & " T=" & tcnt
|
Please provide an equivalent version of this Python code in VB. | import threading
import random
import time
class Philosopher(threading.Thread):
running = True
def __init__(self, xname, forkOnLeft, forkOnRight):
threading.Thread.__init__(self)
self.name = xname
self.forkOnLeft = forkOnLeft
self.forkOnRight = forkOnRight
def run(self):
while(self.running):
time.sleep( random.uniform(3,13))
print '%s is hungry.' % self.name
self.dine()
def dine(self):
fork1, fork2 = self.forkOnLeft, self.forkOnRight
while self.running:
fork1.acquire(True)
locked = fork2.acquire(False)
if locked: break
fork1.release()
print '%s swaps forks' % self.name
fork1, fork2 = fork2, fork1
else:
return
self.dining()
fork2.release()
fork1.release()
def dining(self):
print '%s starts eating '% self.name
time.sleep(random.uniform(1,10))
print '%s finishes eating and leaves to think.' % self.name
def DiningPhilosophers():
forks = [threading.Lock() for n in range(5)]
philosopherNames = ('Aristotle','Kant','Spinoza','Marx', 'Russel')
philosophers= [Philosopher(philosopherNames[i], forks[i%5], forks[(i+1)%5]) \
for i in range(5)]
random.seed(507129)
Philosopher.running = True
for p in philosophers: p.start()
time.sleep(100)
Philosopher.running = False
print ("Now we're finishing.")
DiningPhilosophers()
|
Public Const HOLDON = False
Public Const DIJKSTRASOLUTION = True
Public Const X = 10
Public Const GETS = 0
Public Const PUTS = 1
Public Const EATS = 2
Public Const THKS = 5
Public Const FRSTFORK = 0
Public Const SCNDFORK = 1
Public Const SPAGHETI = 0
Public Const UNIVERSE = 1
Public Const MAXCOUNT = 100000
Public Const PHILOSOPHERS = 5
Public semaphore(PHILOSOPHERS - 1) As Integer
Public positi0n(1, PHILOSOPHERS - 1) As Integer
Public programcounter(PHILOSOPHERS - 1) As Long
Public statistics(PHILOSOPHERS - 1, 5, 1) As Long
Public names As Variant
Private Sub init()
names = [{"Aquinas","Babbage","Carroll","Derrida","Erasmus"}]
For j = 0 To PHILOSOPHERS - 2
positi0n(0, j) = j + 1
positi0n(1, j) = j
Next j
If DIJKSTRASOLUTION Then
positi0n(0, PHILOSOPHERS - 1) = j
positi0n(1, PHILOSOPHERS - 1) = 0
Else
positi0n(0, PHILOSOPHERS - 1) = 0
positi0n(1, PHILOSOPHERS - 1) = j
End If
End Sub
Private Sub philosopher(subject As Integer, verb As Integer, objekt As Integer)
statistics(subject, verb, objekt) = statistics(subject, verb, objekt) + 1
If verb < 2 Then
If semaphore(positi0n(objekt, subject)) <> verb Then
If Not HOLDON Then
semaphore(positi0n(FRSTFORK, subject)) = 1 - objekt
programcounter(subject) = 0
End If
Else
semaphore(positi0n(objekt, subject)) = 1 - verb
programcounter(subject) = (programcounter(subject) + 1) Mod 6
End If
Else
programcounter(subject) = IIf(X * Rnd > 1, verb, verb + 1) Mod 6
End If
End Sub
Private Sub dine()
Dim ph As Integer
Do While TC < MAXCOUNT
For ph = 0 To PHILOSOPHERS - 1
Select Case programcounter(ph)
Case 0: philosopher ph, GETS, FRSTFORK
Case 1: philosopher ph, GETS, SCNDFORK
Case 2: philosopher ph, EATS, SPAGHETI
Case 3: philosopher ph, PUTS, FRSTFORK
Case 4: philosopher ph, PUTS, SCNDFORK
Case 5: philosopher ph, THKS, UNIVERSE
End Select
TC = TC + 1
Next ph
Loop
End Sub
Private Sub show()
Debug.Print "Stats", "Gets", "Gets", "Eats", "Puts", "Puts", "Thinks"
Debug.Print "", "First", "Second", "Spag-", "First", "Second", "About"
Debug.Print "", "Fork", "Fork", "hetti", "Fork", "Fork", "Universe"
For subject = 0 To PHILOSOPHERS - 1
Debug.Print names(subject + 1),
For objekt = 0 To 1
Debug.Print statistics(subject, GETS, objekt),
Next objekt
Debug.Print statistics(subject, EATS, SPAGHETI),
For objekt = 0 To 1
Debug.Print statistics(subject, PUTS, objekt),
Next objekt
Debug.Print statistics(subject, THKS, UNIVERSE)
Next subject
End Sub
Public Sub main()
init
dine
show
End Sub
|
Translate this program into VB but keep the logic exactly as in Python. | fact = [1]
for n in range(1, 12):
fact.append(fact[n-1] * n)
for b in range(9, 12+1):
print(f"The factorions for base {b} are:")
for i in range(1, 1500000):
fact_sum = 0
j = i
while j > 0:
d = j % b
fact_sum += fact[d]
j = j//b
if fact_sum == i:
print(i, end=" ")
print("\n")
|
Dim fact()
nn1=9 : nn2=12
lim=1499999
ReDim fact(nn2)
fact(0)=1
For i=1 To nn2
fact(i)=fact(i-1)*i
Next
For base=nn1 To nn2
list=""
For i=1 To lim
s=0
t=i
Do While t<>0
d=t Mod base
s=s+fact(d)
t=t\base
Loop
If s=i Then list=list &" "& i
Next
Wscript.Echo "the factorions for base "& right(" "& base,2) &" are: "& list
Next
|
Please provide an equivalent version of this Python code in VB. | fact = [1]
for n in range(1, 12):
fact.append(fact[n-1] * n)
for b in range(9, 12+1):
print(f"The factorions for base {b} are:")
for i in range(1, 1500000):
fact_sum = 0
j = i
while j > 0:
d = j % b
fact_sum += fact[d]
j = j//b
if fact_sum == i:
print(i, end=" ")
print("\n")
|
Dim fact()
nn1=9 : nn2=12
lim=1499999
ReDim fact(nn2)
fact(0)=1
For i=1 To nn2
fact(i)=fact(i-1)*i
Next
For base=nn1 To nn2
list=""
For i=1 To lim
s=0
t=i
Do While t<>0
d=t Mod base
s=s+fact(d)
t=t\base
Loop
If s=i Then list=list &" "& i
Next
Wscript.Echo "the factorions for base "& right(" "& base,2) &" are: "& list
Next
|
Keep all operations the same but rewrite the snippet in VB. | command_table_text = \
user_words = "riG rePEAT copies put mo rest types fup. 6 poweRin"
def find_abbreviations_length(command_table_text):
command_table = dict()
for word in command_table_text.split():
abbr_len = sum(1 for c in word if c.isupper())
if abbr_len == 0:
abbr_len = len(word)
command_table[word] = abbr_len
return command_table
def find_abbreviations(command_table):
abbreviations = dict()
for command, min_abbr_len in command_table.items():
for l in range(min_abbr_len, len(command)+1):
abbr = command[:l].lower()
abbreviations[abbr] = command.upper()
return abbreviations
def parse_user_string(user_string, abbreviations):
user_words = [word.lower() for word in user_string.split()]
commands = [abbreviations.get(user_word, "*error*") for user_word in user_words]
return " ".join(commands)
command_table = find_abbreviations_length(command_table_text)
abbreviations_table = find_abbreviations(command_table)
full_words = parse_user_string(user_words, abbreviations_table)
print("user words:", user_words)
print("full words:", full_words)
| Private Function ValidateUserWords(userstring As String) As String
Dim s As String
Dim user_words() As String
Dim command_table As Scripting.Dictionary
Set command_table = New Scripting.Dictionary
Dim abbreviations As Scripting.Dictionary
Set abbreviations = New Scripting.Dictionary
abbreviations.CompareMode = TextCompare
Dim commandtable() As String
Dim commands As String
s = s & "Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy "
s = s & "COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find "
s = s & "NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput "
s = s & "Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO "
s = s & "MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT "
s = s & "READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT "
s = s & "RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up "
commandtable = Split(s, " ")
Dim i As Integer
For Each word In commandtable
If Len(word) > 0 Then
i = 1
Do While Mid(word, i, 1) >= "A" And Mid(word, i, 1) <= "Z"
i = i + 1
Loop
command_table.Add Key:=word, Item:=i - 1
End If
Next word
For Each word In command_table
For i = command_table(word) To Len(word)
On Error Resume Next
abbreviations.Add Key:=Left(word, i), Item:=UCase(word)
Next i
Next word
user_words() = Split(userstring, " ")
For Each word In user_words
If Len(word) > 0 Then
If abbreviations.exists(word) Then
commands = commands & abbreviations(word) & " "
Else
commands = commands & "*error* "
End If
End If
Next word
ValidateUserWords = commands
End Function
Public Sub program()
Dim guserstring As String
guserstring = "riG rePEAT copies put mo rest types fup. 6 poweRin"
Debug.Print "user words:", guserstring
Debug.Print "full words:", ValidateUserWords(guserstring)
End Sub
|
Preserve the algorithm and functionality while converting the code from Python to VB. | command_table_text = \
user_words = "riG rePEAT copies put mo rest types fup. 6 poweRin"
def find_abbreviations_length(command_table_text):
command_table = dict()
for word in command_table_text.split():
abbr_len = sum(1 for c in word if c.isupper())
if abbr_len == 0:
abbr_len = len(word)
command_table[word] = abbr_len
return command_table
def find_abbreviations(command_table):
abbreviations = dict()
for command, min_abbr_len in command_table.items():
for l in range(min_abbr_len, len(command)+1):
abbr = command[:l].lower()
abbreviations[abbr] = command.upper()
return abbreviations
def parse_user_string(user_string, abbreviations):
user_words = [word.lower() for word in user_string.split()]
commands = [abbreviations.get(user_word, "*error*") for user_word in user_words]
return " ".join(commands)
command_table = find_abbreviations_length(command_table_text)
abbreviations_table = find_abbreviations(command_table)
full_words = parse_user_string(user_words, abbreviations_table)
print("user words:", user_words)
print("full words:", full_words)
| Private Function ValidateUserWords(userstring As String) As String
Dim s As String
Dim user_words() As String
Dim command_table As Scripting.Dictionary
Set command_table = New Scripting.Dictionary
Dim abbreviations As Scripting.Dictionary
Set abbreviations = New Scripting.Dictionary
abbreviations.CompareMode = TextCompare
Dim commandtable() As String
Dim commands As String
s = s & "Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy "
s = s & "COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find "
s = s & "NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput "
s = s & "Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO "
s = s & "MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT "
s = s & "READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT "
s = s & "RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up "
commandtable = Split(s, " ")
Dim i As Integer
For Each word In commandtable
If Len(word) > 0 Then
i = 1
Do While Mid(word, i, 1) >= "A" And Mid(word, i, 1) <= "Z"
i = i + 1
Loop
command_table.Add Key:=word, Item:=i - 1
End If
Next word
For Each word In command_table
For i = command_table(word) To Len(word)
On Error Resume Next
abbreviations.Add Key:=Left(word, i), Item:=UCase(word)
Next i
Next word
user_words() = Split(userstring, " ")
For Each word In user_words
If Len(word) > 0 Then
If abbreviations.exists(word) Then
commands = commands & abbreviations(word) & " "
Else
commands = commands & "*error* "
End If
End If
Next word
ValidateUserWords = commands
End Function
Public Sub program()
Dim guserstring As String
guserstring = "riG rePEAT copies put mo rest types fup. 6 poweRin"
Debug.Print "user words:", guserstring
Debug.Print "full words:", ValidateUserWords(guserstring)
End Sub
|
Maintain the same structure and functionality when rewriting this code in VB. | import string
sometext = .lower()
lc2bin = {ch: '{:05b}'.format(i)
for i, ch in enumerate(string.ascii_lowercase + ' .')}
bin2lc = {val: key for key, val in lc2bin.items()}
phrase = 'Rosetta code Bacon cipher example secret phrase to encode in the capitalisation of peter pan'.lower()
def to_5binary(msg):
return ( ch == '1' for ch in ''.join(lc2bin.get(ch, '') for ch in msg.lower()))
def encrypt(message, text):
bin5 = to_5binary(message)
textlist = list(text.lower())
out = []
for capitalise in bin5:
while textlist:
ch = textlist.pop(0)
if ch.isalpha():
if capitalise:
ch = ch.upper()
out.append(ch)
break
else:
out.append(ch)
else:
raise Exception('ERROR: Ran out of characters in sometext')
return ''.join(out) + '...'
def decrypt(bacontext):
binary = []
bin5 = []
out = []
for ch in bacontext:
if ch.isalpha():
binary.append('1' if ch.isupper() else '0')
if len(binary) == 5:
bin5 = ''.join(binary)
out.append(bin2lc[bin5])
binary = []
return ''.join(out)
print('PLAINTEXT = \n%s\n' % phrase)
encrypted = encrypt(phrase, sometext)
print('ENCRYPTED = \n%s\n' % encrypted)
decrypted = decrypt(encrypted)
print('DECRYPTED = \n%s\n' % decrypted)
assert phrase == decrypted, 'Round-tripping error'
| Imports System.Text
Module Module1
ReadOnly CODES As New Dictionary(Of Char, String) From {
{"a", "AAAAA"}, {"b", "AAAAB"}, {"c", "AAABA"}, {"d", "AAABB"}, {"e", "AABAA"},
{"f", "AABAB"}, {"g", "AABBA"}, {"h", "AABBB"}, {"i", "ABAAA"}, {"j", "ABAAB"},
{"k", "ABABA"}, {"l", "ABABB"}, {"m", "ABBAA"}, {"n", "ABBAB"}, {"o", "ABBBA"},
{"p", "ABBBB"}, {"q", "BAAAA"}, {"r", "BAAAB"}, {"s", "BAABA"}, {"t", "BAABB"},
{"u", "BABAA"}, {"v", "BABAB"}, {"w", "BABBA"}, {"x", "BABBB"}, {"y", "BBAAA"},
{"z", "BBAAB"}, {" ", "BBBAA"}
}
Function Encode(plainText As String, message As String) As String
Dim pt = plainText.ToLower()
Dim sb As New StringBuilder()
For Each c In pt
If "a" <= c AndAlso c <= "z" Then
sb.Append(CODES(c))
Else
sb.Append(CODES(" "))
End If
Next
Dim et = sb.ToString()
Dim mg = message.ToLower()
sb.Length = 0
Dim count = 0
For Each c In mg
If "a" <= c AndAlso c <= "z" Then
If et(count) = "A" Then
sb.Append(c)
Else
sb.Append(Chr(Asc(c) - 32))
End If
count += 1
If count = et.Length Then
Exit For
End If
Else
sb.Append(c)
End If
Next
Return sb.ToString()
End Function
Function Decode(message As String) As String
Dim sb As New StringBuilder
For Each c In message
If "a" <= c AndAlso c <= "z" Then
sb.Append("A")
ElseIf "A" <= c AndAlso c <= "Z" Then
sb.Append("B")
End If
Next
Dim et = sb.ToString()
sb.Length = 0
For index = 0 To et.Length - 1 Step 5
Dim quintet = et.Substring(index, 5)
Dim key = CODES.Where(Function(a) a.Value = quintet).First().Key
sb.Append(key)
Next
Return sb.ToString()
End Function
Sub Main()
Dim plainText = "the quick brown fox jumps over the lazy dog"
Dim message =
"bacon
"this task is to implement a program for encryption and decryption of " +
"plaintext using the simple alphabet of the baconian cipher or some " +
"other kind of representation of this alphabet (make anything signify anything). " +
"the baconian alphabet may optionally be extended to encode all lower " +
"case characters individually and/or adding a few punctuation characters " +
"such as the space."
Dim cipherText = Encode(plainText, message)
Console.WriteLine("Cipher text ->" & Environment.NewLine & "{0}", cipherText)
Dim decodedText = Decode(cipherText)
Console.WriteLine(Environment.NewLine & "Hidden text ->" & Environment.NewLine & "{0}", decodedText)
End Sub
End Module
|
Change the following Python code into VB without altering its purpose. | import string
sometext = .lower()
lc2bin = {ch: '{:05b}'.format(i)
for i, ch in enumerate(string.ascii_lowercase + ' .')}
bin2lc = {val: key for key, val in lc2bin.items()}
phrase = 'Rosetta code Bacon cipher example secret phrase to encode in the capitalisation of peter pan'.lower()
def to_5binary(msg):
return ( ch == '1' for ch in ''.join(lc2bin.get(ch, '') for ch in msg.lower()))
def encrypt(message, text):
bin5 = to_5binary(message)
textlist = list(text.lower())
out = []
for capitalise in bin5:
while textlist:
ch = textlist.pop(0)
if ch.isalpha():
if capitalise:
ch = ch.upper()
out.append(ch)
break
else:
out.append(ch)
else:
raise Exception('ERROR: Ran out of characters in sometext')
return ''.join(out) + '...'
def decrypt(bacontext):
binary = []
bin5 = []
out = []
for ch in bacontext:
if ch.isalpha():
binary.append('1' if ch.isupper() else '0')
if len(binary) == 5:
bin5 = ''.join(binary)
out.append(bin2lc[bin5])
binary = []
return ''.join(out)
print('PLAINTEXT = \n%s\n' % phrase)
encrypted = encrypt(phrase, sometext)
print('ENCRYPTED = \n%s\n' % encrypted)
decrypted = decrypt(encrypted)
print('DECRYPTED = \n%s\n' % decrypted)
assert phrase == decrypted, 'Round-tripping error'
| Imports System.Text
Module Module1
ReadOnly CODES As New Dictionary(Of Char, String) From {
{"a", "AAAAA"}, {"b", "AAAAB"}, {"c", "AAABA"}, {"d", "AAABB"}, {"e", "AABAA"},
{"f", "AABAB"}, {"g", "AABBA"}, {"h", "AABBB"}, {"i", "ABAAA"}, {"j", "ABAAB"},
{"k", "ABABA"}, {"l", "ABABB"}, {"m", "ABBAA"}, {"n", "ABBAB"}, {"o", "ABBBA"},
{"p", "ABBBB"}, {"q", "BAAAA"}, {"r", "BAAAB"}, {"s", "BAABA"}, {"t", "BAABB"},
{"u", "BABAA"}, {"v", "BABAB"}, {"w", "BABBA"}, {"x", "BABBB"}, {"y", "BBAAA"},
{"z", "BBAAB"}, {" ", "BBBAA"}
}
Function Encode(plainText As String, message As String) As String
Dim pt = plainText.ToLower()
Dim sb As New StringBuilder()
For Each c In pt
If "a" <= c AndAlso c <= "z" Then
sb.Append(CODES(c))
Else
sb.Append(CODES(" "))
End If
Next
Dim et = sb.ToString()
Dim mg = message.ToLower()
sb.Length = 0
Dim count = 0
For Each c In mg
If "a" <= c AndAlso c <= "z" Then
If et(count) = "A" Then
sb.Append(c)
Else
sb.Append(Chr(Asc(c) - 32))
End If
count += 1
If count = et.Length Then
Exit For
End If
Else
sb.Append(c)
End If
Next
Return sb.ToString()
End Function
Function Decode(message As String) As String
Dim sb As New StringBuilder
For Each c In message
If "a" <= c AndAlso c <= "z" Then
sb.Append("A")
ElseIf "A" <= c AndAlso c <= "Z" Then
sb.Append("B")
End If
Next
Dim et = sb.ToString()
sb.Length = 0
For index = 0 To et.Length - 1 Step 5
Dim quintet = et.Substring(index, 5)
Dim key = CODES.Where(Function(a) a.Value = quintet).First().Key
sb.Append(key)
Next
Return sb.ToString()
End Function
Sub Main()
Dim plainText = "the quick brown fox jumps over the lazy dog"
Dim message =
"bacon
"this task is to implement a program for encryption and decryption of " +
"plaintext using the simple alphabet of the baconian cipher or some " +
"other kind of representation of this alphabet (make anything signify anything). " +
"the baconian alphabet may optionally be extended to encode all lower " +
"case characters individually and/or adding a few punctuation characters " +
"such as the space."
Dim cipherText = Encode(plainText, message)
Console.WriteLine("Cipher text ->" & Environment.NewLine & "{0}", cipherText)
Dim decodedText = Decode(cipherText)
Console.WriteLine(Environment.NewLine & "Hidden text ->" & Environment.NewLine & "{0}", decodedText)
End Sub
End Module
|
Port the following code from Python to VB with equivalent syntax and logic. | import string
sometext = .lower()
lc2bin = {ch: '{:05b}'.format(i)
for i, ch in enumerate(string.ascii_lowercase + ' .')}
bin2lc = {val: key for key, val in lc2bin.items()}
phrase = 'Rosetta code Bacon cipher example secret phrase to encode in the capitalisation of peter pan'.lower()
def to_5binary(msg):
return ( ch == '1' for ch in ''.join(lc2bin.get(ch, '') for ch in msg.lower()))
def encrypt(message, text):
bin5 = to_5binary(message)
textlist = list(text.lower())
out = []
for capitalise in bin5:
while textlist:
ch = textlist.pop(0)
if ch.isalpha():
if capitalise:
ch = ch.upper()
out.append(ch)
break
else:
out.append(ch)
else:
raise Exception('ERROR: Ran out of characters in sometext')
return ''.join(out) + '...'
def decrypt(bacontext):
binary = []
bin5 = []
out = []
for ch in bacontext:
if ch.isalpha():
binary.append('1' if ch.isupper() else '0')
if len(binary) == 5:
bin5 = ''.join(binary)
out.append(bin2lc[bin5])
binary = []
return ''.join(out)
print('PLAINTEXT = \n%s\n' % phrase)
encrypted = encrypt(phrase, sometext)
print('ENCRYPTED = \n%s\n' % encrypted)
decrypted = decrypt(encrypted)
print('DECRYPTED = \n%s\n' % decrypted)
assert phrase == decrypted, 'Round-tripping error'
| Imports System.Text
Module Module1
ReadOnly CODES As New Dictionary(Of Char, String) From {
{"a", "AAAAA"}, {"b", "AAAAB"}, {"c", "AAABA"}, {"d", "AAABB"}, {"e", "AABAA"},
{"f", "AABAB"}, {"g", "AABBA"}, {"h", "AABBB"}, {"i", "ABAAA"}, {"j", "ABAAB"},
{"k", "ABABA"}, {"l", "ABABB"}, {"m", "ABBAA"}, {"n", "ABBAB"}, {"o", "ABBBA"},
{"p", "ABBBB"}, {"q", "BAAAA"}, {"r", "BAAAB"}, {"s", "BAABA"}, {"t", "BAABB"},
{"u", "BABAA"}, {"v", "BABAB"}, {"w", "BABBA"}, {"x", "BABBB"}, {"y", "BBAAA"},
{"z", "BBAAB"}, {" ", "BBBAA"}
}
Function Encode(plainText As String, message As String) As String
Dim pt = plainText.ToLower()
Dim sb As New StringBuilder()
For Each c In pt
If "a" <= c AndAlso c <= "z" Then
sb.Append(CODES(c))
Else
sb.Append(CODES(" "))
End If
Next
Dim et = sb.ToString()
Dim mg = message.ToLower()
sb.Length = 0
Dim count = 0
For Each c In mg
If "a" <= c AndAlso c <= "z" Then
If et(count) = "A" Then
sb.Append(c)
Else
sb.Append(Chr(Asc(c) - 32))
End If
count += 1
If count = et.Length Then
Exit For
End If
Else
sb.Append(c)
End If
Next
Return sb.ToString()
End Function
Function Decode(message As String) As String
Dim sb As New StringBuilder
For Each c In message
If "a" <= c AndAlso c <= "z" Then
sb.Append("A")
ElseIf "A" <= c AndAlso c <= "Z" Then
sb.Append("B")
End If
Next
Dim et = sb.ToString()
sb.Length = 0
For index = 0 To et.Length - 1 Step 5
Dim quintet = et.Substring(index, 5)
Dim key = CODES.Where(Function(a) a.Value = quintet).First().Key
sb.Append(key)
Next
Return sb.ToString()
End Function
Sub Main()
Dim plainText = "the quick brown fox jumps over the lazy dog"
Dim message =
"bacon
"this task is to implement a program for encryption and decryption of " +
"plaintext using the simple alphabet of the baconian cipher or some " +
"other kind of representation of this alphabet (make anything signify anything). " +
"the baconian alphabet may optionally be extended to encode all lower " +
"case characters individually and/or adding a few punctuation characters " +
"such as the space."
Dim cipherText = Encode(plainText, message)
Console.WriteLine("Cipher text ->" & Environment.NewLine & "{0}", cipherText)
Dim decodedText = Decode(cipherText)
Console.WriteLine(Environment.NewLine & "Hidden text ->" & Environment.NewLine & "{0}", decodedText)
End Sub
End Module
|
Preserve the algorithm and functionality while converting the code from Python to VB. | def spiral(n):
dx,dy = 1,0
x,y = 0,0
myarray = [[None]* n for j in range(n)]
for i in xrange(n**2):
myarray[x][y] = i
nx,ny = x+dx, y+dy
if 0<=nx<n and 0<=ny<n and myarray[nx][ny] == None:
x,y = nx,ny
else:
dx,dy = -dy,dx
x,y = x+dx, y+dy
return myarray
def printspiral(myarray):
n = range(len(myarray))
for y in n:
for x in n:
print "%2i" % myarray[x][y],
print
printspiral(spiral(5))
| Function build_spiral(n)
botcol = 0 : topcol = n - 1
botrow = 0 : toprow = n - 1
Dim matrix()
ReDim matrix(topcol,toprow)
dir = 0 : col = 0 : row = 0
For i = 0 To n*n-1
matrix(col,row) = i
Select Case dir
Case 0
If col < topcol Then
col = col + 1
Else
dir = 1 : row = row + 1 : botrow = botrow + 1
End If
Case 1
If row < toprow Then
row = row + 1
Else
dir = 2 : col = col - 1 : topcol = topcol - 1
End If
Case 2
If col > botcol Then
col = col - 1
Else
dir = 3 : row = row - 1 : toprow = toprow - 1
End If
Case 3
If row > botrow Then
row = row - 1
Else
dir = 0 : col = col + 1 : botcol = botcol + 1
End If
End Select
Next
For y = 0 To n-1
For x = 0 To n-1
WScript.StdOut.Write matrix(x,y) & vbTab
Next
WScript.StdOut.WriteLine
Next
End Function
build_spiral(CInt(WScript.Arguments(0)))
|
Produce a language-to-language conversion: from Python to VB, same semantics. | >>> def printtable(data):
for row in data:
print ' '.join('%-5s' % ('"%s"' % cell) for cell in row)
>>> import operator
>>> def sorttable(table, ordering=None, column=0, reverse=False):
return sorted(table, cmp=ordering, key=operator.itemgetter(column), reverse=reverse)
>>> data = [["a", "b", "c"], ["", "q", "z"], ["zap", "zip", "Zot"]]
>>> printtable(data)
"a" "b" "c"
"" "q" "z"
"zap" "zip" "Zot"
>>> printtable( sorttable(data) )
"" "q" "z"
"a" "b" "c"
"zap" "zip" "Zot"
>>> printtable( sorttable(data, column=2) )
"zap" "zip" "Zot"
"a" "b" "c"
"" "q" "z"
>>> printtable( sorttable(data, column=1) )
"a" "b" "c"
"" "q" "z"
"zap" "zip" "Zot"
>>> printtable( sorttable(data, column=1, reverse=True) )
"zap" "zip" "Zot"
"" "q" "z"
"a" "b" "c"
>>> printtable( sorttable(data, ordering=lambda a,b: cmp(len(b),len(a))) )
"zap" "zip" "Zot"
"a" "b" "c"
"" "q" "z"
>>>
| Private Sub optional_parameters(theRange As String, _
Optional ordering As Integer = 0, _
Optional column As Integer = 1, _
Optional reverse As Integer = 1)
ActiveSheet.Sort.SortFields.Clear
ActiveSheet.Sort.SortFields.Add _
Key:=Range(theRange).Columns(column), _
SortOn:=SortOnValues, _
Order:=reverse, _
DataOption:=ordering
With ActiveSheet.Sort
.SetRange Range(theRange)
.Header = xlGuess
.MatchCase = False
.Orientation = xlTopToBottom
.SortMethod = xlPinYin
.Apply
End With
End Sub
Public Sub main()
optional_parameters theRange:="A1:C4", ordering:=1, column:=2, reverse:=1
End Sub
|
Rewrite this program in VB while keeping its functionality equivalent to the Python version. | import ctypes
libc = ctypes.CDLL("/lib/libc.so.6")
libc.strcmp("abc", "def")
libc.strcmp("hello", "hello")
| Declare Function CreateFileW Lib "Kernel32" (FileName As WString, DesiredAccess As Integer, ShareMode As Integer, SecurityAttributes As Integer, _
CreateDisposition As Integer, Flags As Integer, Template As Integer) As Integer
Declare Function WriteFile Lib "Kernel32" (fHandle As Integer, writeData As Ptr, numOfBytes As Integer, ByRef numOfBytesWritten As Integer, _
overlapped As Ptr) As Boolean
Declare Function GetLastError Lib "Kernel32" () As Integer
Declare Function CloseHandle Lib "kernel32" (hObject As Integer) As Boolean
Const FILE_SHARE_READ = &h00000001
Const FILE_SHARE_WRITE = &h00000002
Const OPEN_EXISTING = 3
Dim fHandle As Integer = CreateFileW("C:\foo.txt", 0, FILE_SHARE_READ Or FILE_SHARE_WRITE, 0, OPEN_EXISTING, 0, 0)
If fHandle > 0 Then
Dim mb As MemoryBlock = "Hello, World!"
Dim bytesWritten As Integer
If Not WriteFile(fHandle, mb, mb.Size, bytesWritten, Nil) Then
MsgBox("Error Number: " + Str(GetLastError))
End If
Call CloseHandle(fHandle)
Else
MsgBox("Error Number: " + Str(GetLastError))
End If
|
Keep all operations the same but rewrite the snippet in VB. |
from itertools import accumulate, chain, count, islice
from fractions import Fraction
def faulhaberTriangle(m):
def go(rs, n):
def f(x, y):
return Fraction(n, x) * y
xs = list(map(f, islice(count(2), m), rs))
return [Fraction(1 - sum(xs), 1)] + xs
return list(accumulate(
[[]] + list(islice(count(0), 1 + m)),
go
))[1:]
def faulhaberSum(p, n):
def go(x, y):
return y * (n ** x)
return sum(
map(go, count(1), faulhaberTriangle(p)[-1])
)
def main():
fs = faulhaberTriangle(9)
print(
fTable(__doc__ + ':\n')(str)(
compose(concat)(
fmap(showRatio(3)(3))
)
)(
index(fs)
)(range(0, len(fs)))
)
print('')
print(
faulhaberSum(17, 1000)
)
def fTable(s):
def gox(xShow):
def gofx(fxShow):
def gof(f):
def goxs(xs):
ys = [xShow(x) for x in xs]
w = max(map(len, ys))
def arrowed(x, y):
return y.rjust(w, ' ') + ' -> ' + (
fxShow(f(x))
)
return s + '\n' + '\n'.join(
map(arrowed, xs, ys)
)
return goxs
return gof
return gofx
return gox
def compose(g):
return lambda f: lambda x: g(f(x))
def concat(xs):
def f(ys):
zs = list(chain(*ys))
return ''.join(zs) if isinstance(ys[0], str) else zs
return (
f(xs) if isinstance(xs, list) else (
chain.from_iterable(xs)
)
) if xs else []
def fmap(f):
def go(xs):
return list(map(f, xs))
return go
def index(xs):
return lambda n: None if 0 > n else (
xs[n] if (
hasattr(xs, "__getitem__")
) else next(islice(xs, n, None))
)
def showRatio(m):
def go(n):
def f(r):
d = r.denominator
return str(r.numerator).rjust(m, ' ') + (
('/' + str(d).ljust(n, ' ')) if 1 != d else (
' ' * (1 + n)
)
)
return f
return go
if __name__ == '__main__':
main()
| Module Module1
Class Frac
Private ReadOnly num As Long
Private ReadOnly denom As Long
Public Shared ReadOnly ZERO = New Frac(0, 1)
Public Shared ReadOnly ONE = New Frac(1, 1)
Public Sub New(n As Long, d As Long)
If d = 0 Then
Throw New ArgumentException("d must not be zero")
End If
Dim nn = n
Dim dd = d
If nn = 0 Then
dd = 1
ElseIf dd < 0 Then
nn = -nn
dd = -dd
End If
Dim g = Math.Abs(Gcd(nn, dd))
If g > 1 Then
nn /= g
dd /= g
End If
num = nn
denom = dd
End Sub
Private Shared Function Gcd(a As Long, b As Long) As Long
If b = 0 Then
Return a
Else
Return Gcd(b, a Mod b)
End If
End Function
Public Shared Operator -(self As Frac) As Frac
Return New Frac(-self.num, self.denom)
End Operator
Public Shared Operator +(lhs As Frac, rhs As Frac) As Frac
Return New Frac(lhs.num * rhs.denom + lhs.denom * rhs.num, rhs.denom * lhs.denom)
End Operator
Public Shared Operator -(lhs As Frac, rhs As Frac) As Frac
Return lhs + -rhs
End Operator
Public Shared Operator *(lhs As Frac, rhs As Frac) As Frac
Return New Frac(lhs.num * rhs.num, lhs.denom * rhs.denom)
End Operator
Public Shared Operator <(lhs As Frac, rhs As Frac) As Boolean
Dim x = lhs.num / lhs.denom
Dim y = rhs.num / rhs.denom
Return x < y
End Operator
Public Shared Operator >(lhs As Frac, rhs As Frac) As Boolean
Dim x = lhs.num / lhs.denom
Dim y = rhs.num / rhs.denom
Return x > y
End Operator
Public Shared Operator =(lhs As Frac, rhs As Frac) As Boolean
Return lhs.num = rhs.num AndAlso lhs.denom = rhs.denom
End Operator
Public Shared Operator <>(lhs As Frac, rhs As Frac) As Boolean
Return lhs.num <> rhs.num OrElse lhs.denom <> rhs.denom
End Operator
Public Overrides Function ToString() As String
If denom = 1 Then
Return num.ToString
Else
Return String.Format("{0}/{1}", num, denom)
End If
End Function
Public Overrides Function Equals(obj As Object) As Boolean
Dim frac = CType(obj, Frac)
Return Not IsNothing(frac) AndAlso num = frac.num AndAlso denom = frac.denom
End Function
End Class
Function Bernoulli(n As Integer) As Frac
If n < 0 Then
Throw New ArgumentException("n may not be negative or zero")
End If
Dim a(n + 1) As Frac
For m = 0 To n
a(m) = New Frac(1, m + 1)
For j = m To 1 Step -1
a(j - 1) = (a(j - 1) - a(j)) * New Frac(j, 1)
Next
Next
If n <> 1 Then
Return a(0)
Else
Return -a(0)
End If
End Function
Function Binomial(n As Integer, k As Integer) As Integer
If n < 0 OrElse k < 0 OrElse n < k Then
Throw New ArgumentException()
End If
If n = 0 OrElse k = 0 Then
Return 1
End If
Dim num = 1
For i = k + 1 To n
num *= i
Next
Dim denom = 1
For i = 2 To n - k
denom *= i
Next
Return num \ denom
End Function
Function FaulhaberTriangle(p As Integer) As Frac()
Dim coeffs(p + 1) As Frac
For i = 1 To p + 1
coeffs(i - 1) = Frac.ZERO
Next
Dim q As New Frac(1, p + 1)
Dim sign = -1
For j = 0 To p
sign *= -1
coeffs(p - j) = q * New Frac(sign, 1) * New Frac(Binomial(p + 1, j), 1) * Bernoulli(j)
Next
Return coeffs
End Function
Sub Main()
For i = 1 To 10
Dim coeffs = FaulhaberTriangle(i - 1)
For Each coeff In coeffs
Console.Write("{0,5} ", coeff)
Next
Console.WriteLine()
Next
End Sub
End Module
|
Rewrite this program in VB while keeping its functionality equivalent to the Python version. | import sys
program_name = sys.argv[0]
arguments = sys.argv[1:]
count = len(arguments)
| Function Run(args() as String) As Integer
For each arg As String In args
Stdout.WriteLine(arg)
Next
End Function
|
Port the following code from Python to VB with equivalent syntax and logic. | import sys
program_name = sys.argv[0]
arguments = sys.argv[1:]
count = len(arguments)
| Function Run(args() as String) As Integer
For each arg As String In args
Stdout.WriteLine(arg)
Next
End Function
|
Write the same code in VB as shown below in Python. | import urllib.request
from collections import Counter
GRID =
def getwords(url='http://wiki.puzzlers.org/pub/wordlists/unixdict.txt'):
"Return lowercased words of 3 to 9 characters"
words = urllib.request.urlopen(url).read().decode().strip().lower().split()
return (w for w in words if 2 < len(w) < 10)
def solve(grid, dictionary):
gridcount = Counter(grid)
mid = grid[4]
return [word for word in dictionary
if mid in word and not (Counter(word) - gridcount)]
if __name__ == '__main__':
chars = ''.join(GRID.strip().lower().split())
found = solve(chars, dictionary=getwords())
print('\n'.join(found))
| Const wheel="ndeokgelw"
Sub print(s):
On Error Resume Next
WScript.stdout.WriteLine (s)
If err= &h80070006& Then WScript.Echo " Please run this script with CScript": WScript.quit
End Sub
Dim oDic
Set oDic = WScript.CreateObject("scripting.dictionary")
Dim cnt(127)
Dim fso
Set fso = WScript.CreateObject("Scripting.Filesystemobject")
Set ff=fso.OpenTextFile("unixdict.txt")
i=0
print "reading words of 3 or more letters"
While Not ff.AtEndOfStream
x=LCase(ff.ReadLine)
If Len(x)>=3 Then
If Not odic.exists(x) Then oDic.Add x,0
End If
Wend
print "remaining words: "& oDic.Count & vbcrlf
ff.Close
Set ff=Nothing
Set fso=Nothing
Set re=New RegExp
print "removing words with chars not in the wheel"
re.pattern="[^"& wheel &"]"
For Each w In oDic.Keys
If re.test(w) Then oDic.remove(w)
Next
print "remaining words: "& oDic.Count & vbcrlf
print "ensuring the mandatory letter "& Mid(wheel,5,1) & " is present"
re.Pattern=Mid(wheel,5,1)
For Each w In oDic.Keys
If Not re.test(w) Then oDic.remove(w)
Next
print "remaining words: "& oDic.Count & vbcrlf
print "checking number of chars"
Dim nDic
Set nDic = WScript.CreateObject("scripting.dictionary")
For i=1 To Len(wheel)
x=Mid(wheel,i,1)
If nDic.Exists(x) Then
a=nDic(x)
nDic(x)=Array(a(0)+1,0)
Else
nDic.add x,Array(1,0)
End If
Next
For Each w In oDic.Keys
For Each c In nDic.Keys
ndic(c)=Array(nDic(c)(0),0)
Next
For ii = 1 To len(w)
c=Mid(w,ii,1)
a=nDic(c)
If (a(0)=a(1)) Then
oDic.Remove(w):Exit For
End If
nDic(c)=Array(a(0),a(1)+1)
Next
Next
print "Remaining words "& oDic.count
For Each w In oDic.Keys
print w
Next
|
Convert this Python block to VB, preserving its control flow and logic. | arr1 = [1, 2, 3]
arr2 = [4, 5, 6]
arr3 = [7, 8, 9]
arr4 = arr1 + arr2
assert arr4 == [1, 2, 3, 4, 5, 6]
arr4.extend(arr3)
assert arr4 == [1, 2, 3, 4, 5, 6, 7, 8, 9]
| DEFINT A(1 to 4) = {1, 2, 3, 4}
DEFINT B(1 to 4) = {10, 20, 30, 40}
Redim A(1 to 8) as integer
MEMCPY(varptr(A(5)), varptr(B(1)), Sizeof(integer)*4)
|
Convert the following code from Python to VB, ensuring the logic remains intact. | string = raw_input("Input a string: ")
| Public Sub text()
Debug.Print InputBox("Input a string")
Debug.Print InputBox("Input the integer 75000", "Input an integer", 75000, Context = "Long")
End Sub
|
Rewrite the snippet below in VB so it works the same as the original Python code. | string = raw_input("Input a string: ")
| Public Sub text()
Debug.Print InputBox("Input a string")
Debug.Print InputBox("Input the integer 75000", "Input an integer", 75000, Context = "Long")
End Sub
|
Write the same algorithm in VB as shown in this Python implementation. | >>> import winsound
>>> for note in [261.63, 293.66, 329.63, 349.23, 392.00, 440.00, 493.88, 523.25]:
winsound.Beep(int(note+.5), 500)
>>>
| Option Explicit
Declare Function Beep Lib "kernel32" (ByVal Freq As Long, ByVal Dur As Long) As Long
Sub Musical_Scale()
Dim Fqs, i As Integer
Fqs = Array(264, 297, 330, 352, 396, 440, 495, 528)
For i = LBound(Fqs) To UBound(Fqs)
Beep Fqs(i), 500
Next
End Sub
|
Port the following code from Python to VB with equivalent syntax and logic. | >>> import winsound
>>> for note in [261.63, 293.66, 329.63, 349.23, 392.00, 440.00, 493.88, 523.25]:
winsound.Beep(int(note+.5), 500)
>>>
| Option Explicit
Declare Function Beep Lib "kernel32" (ByVal Freq As Long, ByVal Dur As Long) As Long
Sub Musical_Scale()
Dim Fqs, i As Integer
Fqs = Array(264, 297, 330, 352, 396, 440, 495, 528)
For i = LBound(Fqs) To UBound(Fqs)
Beep Fqs(i), 500
Next
End Sub
|
Port the provided Python code into VB while preserving the original functionality. | from itertools import combinations
def anycomb(items):
' return combinations of any length from the items '
return ( comb
for r in range(1, len(items)+1)
for comb in combinations(items, r)
)
def totalvalue(comb):
' Totalise a particular combination of items'
totwt = totval = 0
for item, wt, val in comb:
totwt += wt
totval += val
return (totval, -totwt) if totwt <= 400 else (0, 0)
items = (
("map", 9, 150), ("compass", 13, 35), ("water", 153, 200), ("sandwich", 50, 160),
("glucose", 15, 60), ("tin", 68, 45), ("banana", 27, 60), ("apple", 39, 40),
("cheese", 23, 30), ("beer", 52, 10), ("suntan cream", 11, 70), ("camera", 32, 30),
("t-shirt", 24, 15), ("trousers", 48, 10), ("umbrella", 73, 40),
("waterproof trousers", 42, 70), ("waterproof overclothes", 43, 75),
("note-case", 22, 80), ("sunglasses", 7, 20), ("towel", 18, 12),
("socks", 4, 50), ("book", 30, 10),
)
bagged = max( anycomb(items), key=totalvalue)
print("Bagged the following items\n " +
'\n '.join(sorted(item for item,_,_ in bagged)))
val, wt = totalvalue(bagged)
print("for a total value of %i and a total weight of %i" % (val, -wt))
|
Option Explicit
Const maxWeight = 400
Dim DataList As Variant
Dim xList(64, 3) As Variant
Dim nItems As Integer
Dim s As String, xss As String
Dim xwei As Integer, xval As Integer, nn As Integer
Sub Main()
Dim i As Integer, j As Integer
DataList = Array("map", 9, 150, "compass", 13, 35, "water", 153, 200, "sandwich", 50, 160, _
"glucose", 15, 60, "tin", 68, 45, "banana", 27, 60, "apple", 39, 40, _
"cheese", 23, 30, "beer", 52, 10, "suntan cream", 11, 70, "camera", 32, 30, _
"T-shirt", 24, 15, "trousers", 48, 10, "umbrella", 73, 40, "book", 30, 10, _
"waterproof trousers", 42, 70, "waterproof overclothes", 43, 75, _
"note-case", 22, 80, "sunglasses", 7, 20, "towel", 18, 12, "socks", 4, 50)
nItems = (UBound(DataList) + 1) / 3
j = 0
For i = 1 To nItems
xList(i, 1) = DataList(j)
xList(i, 2) = DataList(j + 1)
xList(i, 3) = DataList(j + 2)
j = j + 3
Next i
s = ""
For i = 1 To nItems
s = s & Chr(i)
Next
nn = 0
Call ChoiceBin(1, "")
For i = 1 To Len(xss)
j = Asc(Mid(xss, i, 1))
Debug.Print xList(j, 1)
Next i
Debug.Print "count=" & Len(xss), "weight=" & xwei, "value=" & xval
End Sub
Private Sub ChoiceBin(n As String, ss As String)
Dim r As String
Dim i As Integer, j As Integer, iwei As Integer, ival As Integer
Dim ipct As Integer
If n = Len(s) + 1 Then
iwei = 0: ival = 0
For i = 1 To Len(ss)
j = Asc(Mid(ss, i, 1))
iwei = iwei + xList(j, 2)
ival = ival + xList(j, 3)
Next
If iwei <= maxWeight And ival > xval Then
xss = ss: xwei = iwei: xval = ival
End If
Else
r = Mid(s, n, 1)
Call ChoiceBin(n + 1, ss & r)
Call ChoiceBin(n + 1, ss)
End If
End Sub
|
Change the following Python code into VB without altering its purpose. | from __future__ import print_function
from itertools import takewhile
maxsum = 99
def get_primes(max):
if max < 2:
return []
lprimes = [2]
for x in range(3, max + 1, 2):
for p in lprimes:
if x % p == 0:
break
else:
lprimes.append(x)
return lprimes
descendants = [[] for _ in range(maxsum + 1)]
ancestors = [[] for _ in range(maxsum + 1)]
primes = get_primes(maxsum)
for p in primes:
descendants[p].append(p)
for s in range(1, len(descendants) - p):
descendants[s + p] += [p * pr for pr in descendants[s]]
for p in primes + [4]:
descendants[p].pop()
total = 0
for s in range(1, maxsum + 1):
descendants[s].sort()
for d in takewhile(lambda x: x <= maxsum, descendants[s]):
ancestors[d] = ancestors[s] + [s]
print([s], "Level:", len(ancestors[s]))
print("Ancestors:", ancestors[s] if len(ancestors[s]) else "None")
print("Descendants:", len(descendants[s]) if len(descendants[s]) else "None")
if len(descendants[s]):
print(descendants[s])
print()
total += len(descendants[s])
print("Total descendants", total)
| Imports System.Math
Module Module1
Const MAXPRIME = 99
Const MAXPARENT = 99
Const NBRCHILDREN = 547100
Public Primes As New Collection()
Public PrimesR As New Collection()
Public Ancestors As New Collection()
Public Parents(MAXPARENT + 1) As Integer
Public CptDescendants(MAXPARENT + 1) As Integer
Public Children(NBRCHILDREN) As ChildStruct
Public iChildren As Integer
Public Delimiter As String = ", "
Public Structure ChildStruct
Public Child As Long
Public pLower As Integer
Public pHigher As Integer
End Structure
Sub Main()
Dim Parent As Short
Dim Sum As Short
Dim i As Short
Dim TotDesc As Integer = 0
Dim MidPrime As Integer
If GetPrimes(Primes, MAXPRIME) = vbFalse Then
Return
End If
For i = Primes.Count To 1 Step -1
PrimesR.Add(Primes.Item(i))
Next
MidPrime = PrimesR.Item(1) / 2
For Each Prime In PrimesR
Parents(Prime) = InsertChild(Parents(Prime), Prime)
CptDescendants(Prime) += 1
If Prime > MidPrime Then
Continue For
End If
For Parent = 1 To MAXPARENT
Sum = Parent + Prime
If Sum > MAXPARENT Then
Exit For
End If
If Parents(Parent) Then
InsertPreorder(Parents(Parent), Sum, Prime)
CptDescendants(Sum) += CptDescendants(Parent)
End If
Next
Next
RemoveFalseChildren()
If MAXPARENT > MAXPRIME Then
If GetPrimes(Primes, MAXPARENT) = vbFalse Then
Return
End If
End If
FileOpen(1, "Ancestors.txt", OpenMode.Output)
For Parent = 1 To MAXPARENT
GetAncestors(Parent)
PrintLine(1, "[" & Parent.ToString & "] Level: " & Ancestors.Count.ToString)
If Ancestors.Count Then
Print(1, "Ancestors: " & Ancestors.Item(1).ToString)
For i = 2 To Ancestors.Count
Print(1, ", " & Ancestors.Item(i).ToString)
Next
PrintLine(1)
Ancestors.Clear()
Else
PrintLine(1, "Ancestors: None")
End If
If CptDescendants(Parent) Then
PrintLine(1, "Descendants: " & CptDescendants(Parent).ToString)
Delimiter = ""
PrintDescendants(Parents(Parent))
PrintLine(1)
TotDesc += CptDescendants(Parent)
Else
PrintLine(1, "Descendants: None")
End If
PrintLine(1)
Next
Primes.Clear()
PrimesR.Clear()
PrintLine(1, "Total descendants " & TotDesc.ToString)
PrintLine(1)
FileClose(1)
End Sub
Function InsertPreorder(_index As Integer, _sum As Short, _prime As Short)
Parents(_sum) = InsertChild(Parents(_sum), Children(_index).Child * _prime)
If Children(_index).pLower Then
InsertPreorder(Children(_index).pLower, _sum, _prime)
End If
If Children(_index).pHigher Then
InsertPreorder(Children(_index).pHigher, _sum, _prime)
End If
Return Nothing
End Function
Function InsertChild(_index As Integer, _child As Long) As Integer
If _index Then
If _child <= Children(_index).Child Then
Children(_index).pLower = InsertChild(Children(_index).pLower, _child)
Else
Children(_index).pHigher = InsertChild(Children(_index).pHigher, _child)
End If
Else
iChildren += 1
_index = iChildren
Children(_index).Child = _child
Children(_index).pLower = 0
Children(_index).pHigher = 0
End If
Return _index
End Function
Function RemoveFalseChildren()
Dim Exclusions As New Collection
Exclusions.Add(4)
For Each Prime In Primes
Exclusions.Add(Prime)
Next
For Each ex In Exclusions
Parents(ex) = Children(Parents(ex)).pHigher
CptDescendants(ex) -= 1
Next
Exclusions.Clear()
Return Nothing
End Function
Function GetAncestors(_child As Short)
Dim Child As Short = _child
Dim Parent As Short = 0
For Each Prime In Primes
If Child = 1 Then
Exit For
End If
While Child Mod Prime = 0
Child /= Prime
Parent += Prime
End While
Next
If Parent = _child Or _child = 1 Then
Return Nothing
End If
GetAncestors(Parent)
Ancestors.Add(Parent)
Return Nothing
End Function
Function PrintDescendants(_index As Integer)
If Children(_index).pLower Then
PrintDescendants(Children(_index).pLower)
End If
Print(1, Delimiter.ToString & Children(_index).Child.ToString)
Delimiter = ", "
If Children(_index).pHigher Then
PrintDescendants(Children(_index).pHigher)
End If
Return Nothing
End Function
Function GetPrimes(ByRef _primes As Object, Optional _maxPrime As Integer = 2) As Boolean
Dim Value As Integer = 3
Dim Max As Integer
Dim Prime As Integer
If _maxPrime < 2 Then
Return vbFalse
End If
_primes.Add(2)
While Value <= _maxPrime
Max = Floor(Sqrt(Value))
For Each Prime In _primes
If Prime > Max Then
_primes.Add(Value)
Exit For
End If
If Value Mod Prime = 0 Then
Exit For
End If
Next
Value += 2
End While
Return vbTrue
End Function
End Module
|
Convert this Python block to VB, preserving its control flow and logic. | import itertools
def cp(lsts):
return list(itertools.product(*lsts))
if __name__ == '__main__':
from pprint import pprint as pp
for lists in [[[1,2],[3,4]], [[3,4],[1,2]], [[], [1, 2]], [[1, 2], []],
((1776, 1789), (7, 12), (4, 14, 23), (0, 1)),
((1, 2, 3), (30,), (500, 100)),
((1, 2, 3), (), (500, 100))]:
print(lists, '=>')
pp(cp(lists), indent=2)
| Imports System.Runtime.CompilerServices
Module Module1
<Extension()>
Function CartesianProduct(Of T)(sequences As IEnumerable(Of IEnumerable(Of T))) As IEnumerable(Of IEnumerable(Of T))
Dim emptyProduct As IEnumerable(Of IEnumerable(Of T)) = {Enumerable.Empty(Of T)}
Return sequences.Aggregate(emptyProduct, Function(accumulator, sequence) From acc In accumulator From item In sequence Select acc.Concat({item}))
End Function
Sub Main()
Dim empty(-1) As Integer
Dim list1 = {1, 2}
Dim list2 = {3, 4}
Dim list3 = {1776, 1789}
Dim list4 = {7, 12}
Dim list5 = {4, 14, 23}
Dim list6 = {0, 1}
Dim list7 = {1, 2, 3}
Dim list8 = {30}
Dim list9 = {500, 100}
For Each sequnceList As Integer()() In {
({list1, list2}),
({list2, list1}),
({list1, empty}),
({empty, list1}),
({list3, list4, list5, list6}),
({list7, list8, list9}),
({list7, empty, list9})
}
Dim cart = sequnceList.CartesianProduct().Select(Function(tuple) $"({String.Join(", ", tuple)})")
Console.WriteLine($"{{{String.Join(", ", cart)}}}")
Next
End Sub
End Module
|
Write the same algorithm in VB as shown in this Python implementation. | import itertools
def cp(lsts):
return list(itertools.product(*lsts))
if __name__ == '__main__':
from pprint import pprint as pp
for lists in [[[1,2],[3,4]], [[3,4],[1,2]], [[], [1, 2]], [[1, 2], []],
((1776, 1789), (7, 12), (4, 14, 23), (0, 1)),
((1, 2, 3), (30,), (500, 100)),
((1, 2, 3), (), (500, 100))]:
print(lists, '=>')
pp(cp(lists), indent=2)
| Imports System.Runtime.CompilerServices
Module Module1
<Extension()>
Function CartesianProduct(Of T)(sequences As IEnumerable(Of IEnumerable(Of T))) As IEnumerable(Of IEnumerable(Of T))
Dim emptyProduct As IEnumerable(Of IEnumerable(Of T)) = {Enumerable.Empty(Of T)}
Return sequences.Aggregate(emptyProduct, Function(accumulator, sequence) From acc In accumulator From item In sequence Select acc.Concat({item}))
End Function
Sub Main()
Dim empty(-1) As Integer
Dim list1 = {1, 2}
Dim list2 = {3, 4}
Dim list3 = {1776, 1789}
Dim list4 = {7, 12}
Dim list5 = {4, 14, 23}
Dim list6 = {0, 1}
Dim list7 = {1, 2, 3}
Dim list8 = {30}
Dim list9 = {500, 100}
For Each sequnceList As Integer()() In {
({list1, list2}),
({list2, list1}),
({list1, empty}),
({empty, list1}),
({list3, list4, list5, list6}),
({list7, list8, list9}),
({list7, empty, list9})
}
Dim cart = sequnceList.CartesianProduct().Select(Function(tuple) $"({String.Join(", ", tuple)})")
Console.WriteLine($"{{{String.Join(", ", cart)}}}")
Next
End Sub
End Module
|
Convert this Python block to VB, preserving its control flow and logic. | >>> def proper_divs2(n):
... return {x for x in range(1, (n + 1) // 2 + 1) if n % x == 0 and n != x}
...
>>> [proper_divs2(n) for n in range(1, 11)]
[set(), {1}, {1}, {1, 2}, {1}, {1, 2, 3}, {1}, {1, 2, 4}, {1, 3}, {1, 2, 5}]
>>>
>>> n, length = max(((n, len(proper_divs2(n))) for n in range(1, 20001)), key=lambda pd: pd[1])
>>> n
15120
>>> length
79
>>>
| dim _proper_divisors(100)
sub proper_divisors(n)
dim i
dim _proper_divisors_count = 0
if n <> 1 then
for i = 1 to (n \ 2)
if n %% i = 0 then
_proper_divisors_count = _proper_divisors_count + 1
_proper_divisors(_proper_divisors_count) = i
end if
next
end if
return _proper_divisors_count
end sub
sub show_proper_divisors(n, tabbed)
dim cnt = proper_divisors(n)
print str$(n) + ":"; tab(4);"(" + str$(cnt) + " items) ";
dim j
for j = 1 to cnt
if tabbed then
print str$(_proper_divisors(j)),
else
print str$(_proper_divisors(j));
end if
if (j < cnt) then print ",";
next
print
end sub
dim i
for i = 1 to 10
show_proper_divisors(i, false)
next
dim c
dim maxindex = 0
dim maxlength = 0
for t = 1 to 20000
c = proper_divisors(t)
if c > maxlength then
maxindex = t
maxlength = c
end if
next
print "A maximum at ";
show_proper_divisors(maxindex, false)
|
Maintain the same structure and functionality when rewriting this code in VB. | >>> from xml.etree import ElementTree as ET
>>> from itertools import izip
>>> def characterstoxml(names, remarks):
root = ET.Element("CharacterRemarks")
for name, remark in izip(names, remarks):
c = ET.SubElement(root, "Character", {'name': name})
c.text = remark
return ET.tostring(root)
>>> print characterstoxml(
names = ["April", "Tam O'Shanter", "Emily"],
remarks = [ "Bubbly: I'm > Tam and <= Emily",
'Burns: "When chapman billies leave the street ..."',
'Short & shrift' ] ).replace('><','>\n<')
| Module XMLOutput
Sub Main()
Dim charRemarks As New Dictionary(Of String, String)
charRemarks.Add("April", "Bubbly: I
charRemarks.Add("Tam O
charRemarks.Add("Emily", "Short & shrift")
Dim xml = <CharacterRemarks>
<%= From cr In charRemarks Select <Character name=<%= cr.Key %>><%= cr.Value %></Character> %>
</CharacterRemarks>
Console.WriteLine(xml)
End Sub
End Module
|
Transform the following Python implementation into VB, maintaining the same output and logic. | >>> x = [0, 1, 2, 3, 4, 5, 6, 7, 8, 9]
>>> y = [2.7, 2.8, 31.4, 38.1, 58.0, 76.2, 100.5, 130.0, 149.3, 180.0]
>>> import pylab
>>> pylab.plot(x, y, 'bo')
>>> pylab.savefig('qsort-range-10-9.png')
| Private Sub plot_coordinate_pairs(x As Variant, y As Variant)
Dim chrt As Chart
Set chrt = ActiveSheet.Shapes.AddChart.Chart
With chrt
.ChartType = xlLine
.HasLegend = False
.HasTitle = True
.ChartTitle.Text = "Time"
.SeriesCollection.NewSeries
.SeriesCollection.Item(1).XValues = x
.SeriesCollection.Item(1).Values = y
.Axes(xlValue, xlPrimary).HasTitle = True
.Axes(xlValue, xlPrimary).AxisTitle.Characters.Text = "microseconds"
End With
End Sub
Public Sub main()
x = [{0, 1, 2, 3, 4, 5, 6, 7, 8, 9}]
y = [{2.7, 2.8, 31.4, 38.1, 58.0, 76.2, 100.5, 130.0, 149.3, 180.0}]
plot_coordinate_pairs x, y
End Sub
|
Rewrite the snippet below in VB so it works the same as the original Python code. | >>> x = [0, 1, 2, 3, 4, 5, 6, 7, 8, 9]
>>> y = [2.7, 2.8, 31.4, 38.1, 58.0, 76.2, 100.5, 130.0, 149.3, 180.0]
>>> import pylab
>>> pylab.plot(x, y, 'bo')
>>> pylab.savefig('qsort-range-10-9.png')
| Private Sub plot_coordinate_pairs(x As Variant, y As Variant)
Dim chrt As Chart
Set chrt = ActiveSheet.Shapes.AddChart.Chart
With chrt
.ChartType = xlLine
.HasLegend = False
.HasTitle = True
.ChartTitle.Text = "Time"
.SeriesCollection.NewSeries
.SeriesCollection.Item(1).XValues = x
.SeriesCollection.Item(1).Values = y
.Axes(xlValue, xlPrimary).HasTitle = True
.Axes(xlValue, xlPrimary).AxisTitle.Characters.Text = "microseconds"
End With
End Sub
Public Sub main()
x = [{0, 1, 2, 3, 4, 5, 6, 7, 8, 9}]
y = [{2.7, 2.8, 31.4, 38.1, 58.0, 76.2, 100.5, 130.0, 149.3, 180.0}]
plot_coordinate_pairs x, y
End Sub
|
Produce a language-to-language conversion: from Python to VB, same semantics. | import re
string = "This is a string"
if re.search('string$', string):
print("Ends with string.")
string = re.sub(" a ", " another ", string)
print(string)
| text = "I need more coffee!!!"
Set regex = New RegExp
regex.Global = True
regex.Pattern = "\s"
If regex.Test(text) Then
WScript.StdOut.Write regex.Replace(text,vbCrLf)
Else
WScript.StdOut.Write "No matching pattern"
End If
|
Change the following Python code into VB without altering its purpose. | keys = ['a', 'b', 'c']
values = [1, 2, 3]
hash = {key: value for key, value in zip(keys, values)}
| Set dict = CreateObject("Scripting.Dictionary")
os = Array("Windows", "Linux", "MacOS")
owner = Array("Microsoft", "Linus Torvalds", "Apple")
For n = 0 To 2
dict.Add os(n), owner(n)
Next
MsgBox dict.Item("Linux")
MsgBox dict.Item("MacOS")
MsgBox dict.Item("Windows")
|
Can you help me rewrite this code in VB instead of Python, keeping it the same logically? | from turtle import *
colors = ["black", "red", "green", "blue", "magenta", "cyan", "yellow", "white"]
screen = getscreen()
left_edge = -screen.window_width()//2
right_edge = screen.window_width()//2
quarter_height = screen.window_height()//4
half_height = quarter_height * 2
speed("fastest")
for quarter in range(4):
pensize(quarter+1)
colornum = 0
min_y = half_height - ((quarter + 1) * quarter_height)
max_y = half_height - ((quarter) * quarter_height)
for x in range(left_edge,right_edge,quarter+1):
penup()
pencolor(colors[colornum])
colornum = (colornum + 1) % len(colors)
setposition(x,min_y)
pendown()
setposition(x,max_y)
notused = input("Hit enter to continue: ")
| Public Class Main
Inherits System.Windows.Forms.Form
Public Sub New()
Me.FormBorderStyle = FormBorderStyle.None
Me.WindowState = FormWindowState.Maximized
End Sub
Private Sub Main_Load(sender As Object, e As EventArgs) Handles Me.Load
Dim Index As Integer
Dim Colors() As Color = {Color.Black, Color.Red, Color.Green, Color.Magenta, Color.Cyan, Color.Yellow, Color.White}
Dim Height = (Me.ClientSize.Height / 4) + 1
For y = 1 To 4
Dim Top = Me.ClientSize.Height / 4 * (y - 1)
For x = 0 To Me.ClientSize.Width Step y
If Index = 6 Then Index = 0 Else Index += 1
Me.Controls.Add(New Panel With {.Top = Top, .Height = Height, .Left = x, .Width = y, .BackColor = Colors(Index)})
Next
Next
End Sub
End Class
|
Write the same code in VB as shown below in Python. |
def cocktailshiftingbounds(A):
beginIdx = 0
endIdx = len(A) - 1
while beginIdx <= endIdx:
newBeginIdx = endIdx
newEndIdx = beginIdx
for ii in range(beginIdx,endIdx):
if A[ii] > A[ii + 1]:
A[ii+1], A[ii] = A[ii], A[ii+1]
newEndIdx = ii
endIdx = newEndIdx
for ii in range(endIdx,beginIdx-1,-1):
if A[ii] > A[ii + 1]:
A[ii+1], A[ii] = A[ii], A[ii+1]
newBeginIdx = ii
beginIdx = newBeginIdx + 1
test1 = [7, 6, 5, 9, 8, 4, 3, 1, 2, 0]
cocktailshiftingbounds(test1)
print(test1)
test2=list('big fjords vex quick waltz nymph')
cocktailshiftingbounds(test2)
print(''.join(test2))
|
Function cocktailShakerSort(ByVal A As Variant) As Variant
beginIdx = LBound(A)
endIdx = UBound(A) - 1
Do While beginIdx <= endIdx
newBeginIdx = endIdx
newEndIdx = beginIdx
For ii = beginIdx To endIdx
If A(ii) > A(ii + 1) Then
tmp = A(ii): A(ii) = A(ii + 1): A(ii + 1) = tmp
newEndIdx = ii
End If
Next ii
endIdx = newEndIdx - 1
For ii = endIdx To beginIdx Step -1
If A(ii) > A(ii + 1) Then
tmp = A(ii): A(ii) = A(ii + 1): A(ii + 1) = tmp
newBeginIdx = ii
End If
Next ii
beginIdx = newBeginIdx + 1
Loop
cocktailShakerSort = A
End Function
Public Sub main()
Dim B(20) As Variant
For i = LBound(B) To UBound(B)
B(i) = Int(Rnd() * 100)
Next i
Debug.Print Join(B, ", ")
Debug.Print Join(cocktailShakerSort(B), ", ")
End Sub
|
Keep all operations the same but rewrite the snippet in VB. | import pygame, sys
from pygame.locals import *
from math import sin, cos, radians
pygame.init()
WINDOWSIZE = 250
TIMETICK = 100
BOBSIZE = 15
window = pygame.display.set_mode((WINDOWSIZE, WINDOWSIZE))
pygame.display.set_caption("Pendulum")
screen = pygame.display.get_surface()
screen.fill((255,255,255))
PIVOT = (WINDOWSIZE/2, WINDOWSIZE/10)
SWINGLENGTH = PIVOT[1]*4
class BobMass(pygame.sprite.Sprite):
def __init__(self):
pygame.sprite.Sprite.__init__(self)
self.theta = 45
self.dtheta = 0
self.rect = pygame.Rect(PIVOT[0]-SWINGLENGTH*cos(radians(self.theta)),
PIVOT[1]+SWINGLENGTH*sin(radians(self.theta)),
1,1)
self.draw()
def recomputeAngle(self):
scaling = 3000.0/(SWINGLENGTH**2)
firstDDtheta = -sin(radians(self.theta))*scaling
midDtheta = self.dtheta + firstDDtheta
midtheta = self.theta + (self.dtheta + midDtheta)/2.0
midDDtheta = -sin(radians(midtheta))*scaling
midDtheta = self.dtheta + (firstDDtheta + midDDtheta)/2
midtheta = self.theta + (self.dtheta + midDtheta)/2
midDDtheta = -sin(radians(midtheta)) * scaling
lastDtheta = midDtheta + midDDtheta
lasttheta = midtheta + (midDtheta + lastDtheta)/2.0
lastDDtheta = -sin(radians(lasttheta)) * scaling
lastDtheta = midDtheta + (midDDtheta + lastDDtheta)/2.0
lasttheta = midtheta + (midDtheta + lastDtheta)/2.0
self.dtheta = lastDtheta
self.theta = lasttheta
self.rect = pygame.Rect(PIVOT[0]-
SWINGLENGTH*sin(radians(self.theta)),
PIVOT[1]+
SWINGLENGTH*cos(radians(self.theta)),1,1)
def draw(self):
pygame.draw.circle(screen, (0,0,0), PIVOT, 5, 0)
pygame.draw.circle(screen, (0,0,0), self.rect.center, BOBSIZE, 0)
pygame.draw.aaline(screen, (0,0,0), PIVOT, self.rect.center)
pygame.draw.line(screen, (0,0,0), (0, PIVOT[1]), (WINDOWSIZE, PIVOT[1]))
def update(self):
self.recomputeAngle()
screen.fill((255,255,255))
self.draw()
bob = BobMass()
TICK = USEREVENT + 2
pygame.time.set_timer(TICK, TIMETICK)
def input(events):
for event in events:
if event.type == QUIT:
sys.exit(0)
elif event.type == TICK:
bob.update()
while True:
input(pygame.event.get())
pygame.display.flip()
| option explicit
const dt = 0.15
const length=23
dim ans0:ans0=chr(27)&"["
dim Veloc,Accel,angle,olr,olc,r,c
const r0=1
const c0=40
cls
angle=0.7
while 1
wscript.sleep(50)
Accel = -.9 * sin(Angle)
Veloc = Veloc + Accel * dt
Angle = Angle + Veloc * dt
r = r0 + int(cos(Angle) * Length)
c = c0+ int(2*sin(Angle) * Length)
cls
draw_line r,c,r0,c0
toxy r,c,"O"
olr=r :olc=c
wend
sub cls() wscript.StdOut.Write ans0 &"2J"&ans0 &"?25l":end sub
sub toxy(r,c,s) wscript.StdOut.Write ans0 & r & ";" & c & "f" & s :end sub
Sub draw_line(r1,c1, r2,c2)
Dim x,y,xf,yf,dx,dy,sx,sy,err,err2
x =r1 : y =c1
xf=r2 : yf=c2
dx=Abs(xf-x) : dy=Abs(yf-y)
If x<xf Then sx=+1: Else sx=-1
If y<yf Then sy=+1: Else sy=-1
err=dx-dy
Do
toxy x,y,"."
If x=xf And y=yf Then Exit Do
err2=err+err
If err2>-dy Then err=err-dy: x=x+sx
If err2< dx Then err=err+dx: y=y+sy
Loop
End Sub
|
Translate this program into VB but keep the logic exactly as in Python. | >>> def int2bin(n):
'From positive integer to list of binary bits, msb at index 0'
if n:
bits = []
while n:
n,remainder = divmod(n, 2)
bits.insert(0, remainder)
return bits
else: return [0]
>>> def bin2int(bits):
'From binary bits, msb at index 0 to integer'
i = 0
for bit in bits:
i = i * 2 + bit
return i
| Function Encoder(ByVal n)
Encoder = n Xor (n \ 2)
End Function
Function Decoder(ByVal n)
Dim g : g = 0
Do While n > 0
g = g Xor n
n = n \ 2
Loop
Decoder = g
End Function
Function Dec2bin(ByVal n, ByVal length)
Dim i, strbin : strbin = ""
For i = 1 to 5
strbin = (n Mod 2) & strbin
n = n \ 2
Next
Dec2Bin = strbin
End Function
WScript.StdOut.WriteLine("Binary -> Gray Code -> Binary")
For i = 0 to 31
encoded = Encoder(i)
decoded = Decoder(encoded)
WScript.StdOut.WriteLine(Dec2Bin(i, 5) & " -> " & Dec2Bin(encoded, 5) & " -> " & Dec2Bin(decoded, 5))
Next
|
Translate the given Python code snippet into VB without altering its behavior. | >>> def int2bin(n):
'From positive integer to list of binary bits, msb at index 0'
if n:
bits = []
while n:
n,remainder = divmod(n, 2)
bits.insert(0, remainder)
return bits
else: return [0]
>>> def bin2int(bits):
'From binary bits, msb at index 0 to integer'
i = 0
for bit in bits:
i = i * 2 + bit
return i
| Function Encoder(ByVal n)
Encoder = n Xor (n \ 2)
End Function
Function Decoder(ByVal n)
Dim g : g = 0
Do While n > 0
g = g Xor n
n = n \ 2
Loop
Decoder = g
End Function
Function Dec2bin(ByVal n, ByVal length)
Dim i, strbin : strbin = ""
For i = 1 to 5
strbin = (n Mod 2) & strbin
n = n \ 2
Next
Dec2Bin = strbin
End Function
WScript.StdOut.WriteLine("Binary -> Gray Code -> Binary")
For i = 0 to 31
encoded = Encoder(i)
decoded = Decoder(encoded)
WScript.StdOut.WriteLine(Dec2Bin(i, 5) & " -> " & Dec2Bin(encoded, 5) & " -> " & Dec2Bin(decoded, 5))
Next
|
Maintain the same structure and functionality when rewriting this code in VB. | >>> def int2bin(n):
'From positive integer to list of binary bits, msb at index 0'
if n:
bits = []
while n:
n,remainder = divmod(n, 2)
bits.insert(0, remainder)
return bits
else: return [0]
>>> def bin2int(bits):
'From binary bits, msb at index 0 to integer'
i = 0
for bit in bits:
i = i * 2 + bit
return i
| Function Encoder(ByVal n)
Encoder = n Xor (n \ 2)
End Function
Function Decoder(ByVal n)
Dim g : g = 0
Do While n > 0
g = g Xor n
n = n \ 2
Loop
Decoder = g
End Function
Function Dec2bin(ByVal n, ByVal length)
Dim i, strbin : strbin = ""
For i = 1 to 5
strbin = (n Mod 2) & strbin
n = n \ 2
Next
Dec2Bin = strbin
End Function
WScript.StdOut.WriteLine("Binary -> Gray Code -> Binary")
For i = 0 to 31
encoded = Encoder(i)
decoded = Decoder(encoded)
WScript.StdOut.WriteLine(Dec2Bin(i, 5) & " -> " & Dec2Bin(encoded, 5) & " -> " & Dec2Bin(decoded, 5))
Next
|
Rewrite the snippet below in VB so it works the same as the original Python code. | import random
class Card(object):
suits = ("Clubs","Hearts","Spades","Diamonds")
pips = ("2","3","4","5","6","7","8","9","10","Jack","Queen","King","Ace")
def __init__(self, pip,suit):
self.pip=pip
self.suit=suit
def __str__(self):
return "%s %s"%(self.pip,self.suit)
class Deck(object):
def __init__(self):
self.deck = [Card(pip,suit) for suit in Card.suits for pip in Card.pips]
def __str__(self):
return "[%s]"%", ".join( (str(card) for card in self.deck))
def shuffle(self):
random.shuffle(self.deck)
def deal(self):
self.shuffle()
return self.deck.pop(0)
| class playingcard
dim suit
dim pips
end class
class carddeck
private suitnames
private pipnames
private cardno
private deck(52)
private nTop
sub class_initialize
dim suit
dim pips
suitnames = split("H,D,C,S",",")
pipnames = split("A,2,3,4,5,6,7,8,9,10,J,Q,K",",")
cardno = 0
for suit = 1 to 4
for pips = 1 to 13
set deck(cardno) = new playingcard
deck(cardno).suit = suitnames(suit-1)
deck(cardno).pips = pipnames(pips-1)
cardno = cardno + 1
next
next
nTop = 0
end sub
public sub showdeck
dim a
redim a(51-nTop)
for i = nTop to 51
a(i) = deck(i).pips & deck(i).suit
next
wscript.echo join( a, ", ")
end sub
public sub shuffle
dim r
randomize timer
for i = nTop to 51
r = int( rnd * ( 52 - nTop ) )
if r <> i then
objswap deck(i),deck(r)
end if
next
end sub
public function deal()
set deal = deck( nTop )
nTop = nTop + 1
end function
public property get cardsRemaining
cardsRemaining = 52 - nTop
end property
private sub objswap( a, b )
dim tmp
set tmp = a
set a = b
set b = tmp
end sub
end class
|
Produce a language-to-language conversion: from Python to VB, same semantics. | array = []
array.append(1)
array.append(3)
array[0] = 2
print array[0]
| Option Base {0|1}
|
Keep all operations the same but rewrite the snippet in VB. | array = []
array.append(1)
array.append(3)
array[0] = 2
print array[0]
| Option Base {0|1}
|
Transform the following Python implementation into VB, maintaining the same output and logic. | def setup():
size(729, 729)
fill(0)
background(255)
noStroke()
rect(width / 3, height / 3, width / 3, width / 3)
rectangles(width / 3, height / 3, width / 3)
def rectangles(x, y, s):
if s < 1: return
xc, yc = x - s, y - s
for row in range(3):
for col in range(3):
if not (row == 1 and col == 1):
xx, yy = xc + row * s, yc + col * s
delta = s / 3
rect(xx + delta, yy + delta, delta, delta)
rectangles(xx + s / 3, yy + s / 3, s / 3)
| Const Order = 4
Function InCarpet(ByVal x As Integer, ByVal y As Integer)
Do While x <> 0 And y <> 0
If x Mod 3 = 1 And y Mod 3 = 1 Then
InCarpet = " "
Exit Function
End If
x = x \ 3
y = y \ 3
Loop
InCarpet = "#"
End Function
Public Sub sierpinski_carpet()
Dim i As Integer, j As Integer
For i = 0 To 3 ^ Order - 1
For j = 0 To 3 ^ Order - 1
Debug.Print InCarpet(i, j);
Next j
Debug.Print
Next i
End Sub
|
Rewrite the snippet below in VB so it works the same as the original Python code. | import random
def bogosort(l):
while not in_order(l):
random.shuffle(l)
return l
def in_order(l):
if not l:
return True
last = l[0]
for x in l[1:]:
if x < last:
return False
last = x
return True
| Private Function Knuth(a As Variant) As Variant
Dim t As Variant, i As Integer
If Not IsMissing(a) Then
For i = UBound(a) To LBound(a) + 1 Step -1
j = Int((UBound(a) - LBound(a) + 1) * Rnd + LBound(a))
t = a(i)
a(i) = a(j)
a(j) = t
Next i
End If
Knuth = a
End Function
Private Function inOrder(s As Variant)
i = 2
Do While i <= UBound(s)
If s(i) < s(i - 1) Then
inOrder = False
Exit Function
End If
i = i + 1
Loop
inOrder = True
End Function
Private Function bogosort(ByVal s As Variant) As Variant
Do While Not inOrder(s)
Debug.Print Join(s, ", ")
s = Knuth(s)
Loop
bogosort = s
End Function
Public Sub main()
Debug.Print Join(bogosort(Knuth([{1,2,3,4,5,6}])), ", ")
End Sub
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.