Instruction
stringlengths
45
106
input_code
stringlengths
1
13.7k
output_code
stringlengths
1
13.7k
Translate the given PHP code snippet into Go without altering its behavior.
<?php echo "Hello world!\n"; ?>
package main import "fmt" func main() { fmt.Println("Hello world!") }
Produce a functionally identical Go code for the snippet given in PHP.
<?php function forwardDiff($anArray, $times = 1) { if ($times <= 0) { return $anArray; } for ($accumilation = array(), $i = 1, $j = count($anArray); $i < $j; ++$i) { $accumilation[] = $anArray[$i] - $anArray[$i - 1]; } if ($times === 1) { return $accumilation; } return forwardDiff($accumilation, $times - 1); } class ForwardDiffExample extends PweExample { function _should_run_empty_array_for_single_elem() { $expected = array($this->rand()->int()); $this->spec(forwardDiff($expected))->shouldEqual(array()); } function _should_give_diff_of_two_elem_as_single_elem() { $twoNums = array($this->rand()->int(), $this->rand()->int()); $expected = array($twoNums[1] - $twoNums[0]); $this->spec(forwardDiff($twoNums))->shouldEqual($expected); } function _should_compute_correct_forward_diff_for_longer_arrays() { $diffInput = array(10, 2, 9, 6, 5); $expected = array(-8, 7, -3, -1); $this->spec(forwardDiff($diffInput))->shouldEqual($expected); } function _should_apply_more_than_once_if_specified() { $diffInput = array(4, 6, 9, 3, 4); $expectedAfter1 = array(2, 3, -6, 1); $expectedAfter2 = array(1, -9, 7); $this->spec(forwardDiff($diffInput, 1))->shouldEqual($expectedAfter1); $this->spec(forwardDiff($diffInput, 2))->shouldEqual($expectedAfter2); } function _should_return_array_unaltered_if_no_times() { $this->spec(forwardDiff($expected = array(1,2,3), 0))->shouldEqual($expected); } }
package main import "fmt" func main() { a := []int{90, 47, 58, 29, 22, 32, 55, 5, 55, 73} fmt.Println(a) fmt.Println(fd(a, 9)) } func fd(a []int, ord int) []int { for i := 0; i < ord; i++ { for j := 0; j < len(a)-i-1; j++ { a[j] = a[j+1] - a[j] } } return a[:len(a)-ord] }
Convert the following code from PHP to Go, ensuring the logic remains intact.
<?php function forwardDiff($anArray, $times = 1) { if ($times <= 0) { return $anArray; } for ($accumilation = array(), $i = 1, $j = count($anArray); $i < $j; ++$i) { $accumilation[] = $anArray[$i] - $anArray[$i - 1]; } if ($times === 1) { return $accumilation; } return forwardDiff($accumilation, $times - 1); } class ForwardDiffExample extends PweExample { function _should_run_empty_array_for_single_elem() { $expected = array($this->rand()->int()); $this->spec(forwardDiff($expected))->shouldEqual(array()); } function _should_give_diff_of_two_elem_as_single_elem() { $twoNums = array($this->rand()->int(), $this->rand()->int()); $expected = array($twoNums[1] - $twoNums[0]); $this->spec(forwardDiff($twoNums))->shouldEqual($expected); } function _should_compute_correct_forward_diff_for_longer_arrays() { $diffInput = array(10, 2, 9, 6, 5); $expected = array(-8, 7, -3, -1); $this->spec(forwardDiff($diffInput))->shouldEqual($expected); } function _should_apply_more_than_once_if_specified() { $diffInput = array(4, 6, 9, 3, 4); $expectedAfter1 = array(2, 3, -6, 1); $expectedAfter2 = array(1, -9, 7); $this->spec(forwardDiff($diffInput, 1))->shouldEqual($expectedAfter1); $this->spec(forwardDiff($diffInput, 2))->shouldEqual($expectedAfter2); } function _should_return_array_unaltered_if_no_times() { $this->spec(forwardDiff($expected = array(1,2,3), 0))->shouldEqual($expected); } }
package main import "fmt" func main() { a := []int{90, 47, 58, 29, 22, 32, 55, 5, 55, 73} fmt.Println(a) fmt.Println(fd(a, 9)) } func fd(a []int, ord int) []int { for i := 0; i < ord; i++ { for j := 0; j < len(a)-i-1; j++ { a[j] = a[j+1] - a[j] } } return a[:len(a)-ord] }
Maintain the same structure and functionality when rewriting this code in Go.
<?php function prime($a) { if (($a % 2 == 0 && $a != 2) || $a < 2) return false; $limit = sqrt($a); for ($i = 2; $i <= $limit; $i++) if ($a % $i == 0) return false; return true; } foreach (range(1, 100) as $x) if (prime($x)) echo "$x\n"; ?>
func IsPrime(n int) bool { if n < 0 { n = -n } switch { case n == 2: return true case n < 2 || n % 2 == 0: return false default: for i = 3; i*i <= n; i += 2 { if n % i == 0 { return false } } } return true }
Port the following code from PHP to Go with equivalent syntax and logic.
<?php function prime($a) { if (($a % 2 == 0 && $a != 2) || $a < 2) return false; $limit = sqrt($a); for ($i = 2; $i <= $limit; $i++) if ($a % $i == 0) return false; return true; } foreach (range(1, 100) as $x) if (prime($x)) echo "$x\n"; ?>
func IsPrime(n int) bool { if n < 0 { n = -n } switch { case n == 2: return true case n < 2 || n % 2 == 0: return false default: for i = 3; i*i <= n; i += 2 { if n % i == 0 { return false } } } return true }
Maintain the same structure and functionality when rewriting this code in Go.
<?php $n=5; $k=3; function factorial($val){ for($f=2;$val-1>1;$f*=$val--); return $f; } $binomial_coefficient=factorial($n)/(factorial($k)*factorial($n-$k)); echo $binomial_coefficient; ?>
package main import "fmt" import "math/big" func main() { fmt.Println(new(big.Int).Binomial(5, 3)) fmt.Println(new(big.Int).Binomial(60, 30)) }
Produce a language-to-language conversion: from PHP to Go, same semantics.
<?php $n=5; $k=3; function factorial($val){ for($f=2;$val-1>1;$f*=$val--); return $f; } $binomial_coefficient=factorial($n)/(factorial($k)*factorial($n-$k)); echo $binomial_coefficient; ?>
package main import "fmt" import "math/big" func main() { fmt.Println(new(big.Int).Binomial(5, 3)) fmt.Println(new(big.Int).Binomial(60, 30)) }
Produce a functionally identical Go code for the snippet given in PHP.
<?php $a = array(); # add elements "at the end" array_push($a, 55, 10, 20); print_r($a); # using an explicit key $a['one'] = 1; $a['two'] = 2; print_r($a); ?>
package main import "fmt" func main() { var a []interface{} a = append(a, 3) a = append(a, "apples", "oranges") fmt.Println(a) }
Change the programming language of this snippet from PHP to Go without modifying what it does.
<?php $a = array(); # add elements "at the end" array_push($a, 55, 10, 20); print_r($a); # using an explicit key $a['one'] = 1; $a['two'] = 2; print_r($a); ?>
package main import "fmt" func main() { var a []interface{} a = append(a, 3) a = append(a, "apples", "oranges") fmt.Println(a) }
Preserve the algorithm and functionality while converting the code from PHP to Go.
class Bitmap { public $data; public $w; public $h; public function __construct($w = 16, $h = 16){ $white = array_fill(0, $w, array(255,255,255)); $this->data = array_fill(0, $h, $white); $this->w = $w; $this->h = $h; } public function fill($x = 0, $y = 0, $w = null, $h = null, $color = array(0,0,0)){ if (is_null($w)) $w = $this->w; if (is_null($h)) $h = $this->h; $w += $x; $h += $y; for ($i = $y; $i < $h; $i++){ for ($j = $x; $j < $w; $j++){ $this->setPixel($j, $i, $color); } } } public function setPixel($x, $y, $color = array(0,0,0)){ if ($x >= $this->w) return false; if ($x < 0) return false; if ($y >= $this->h) return false; if ($y < 0) return false; $this->data[$y][$x] = $color; } public function getPixel($x, $y){ return $this->data[$y][$x]; } public function writeP6($filename){ $fh = fopen($filename, 'w'); if (!$fh) return false; fputs($fh, "P6 {$this->w} {$this->h} 255\n"); foreach ($this->data as $row){ foreach($row as $pixel){ fputs($fh, pack('C', $pixel[0])); fputs($fh, pack('C', $pixel[1])); fputs($fh, pack('C', $pixel[2])); } } fclose($fh); } } $b = new Bitmap(16,16); $b->fill(); $b->fill(2, 2, 18, 18, array(240,240,240)); $b->setPixel(0, 15, array(255,0,0)); $b->writeP6('p6.ppm');
package raster import ( "fmt" "io" "os" ) func (b *Bitmap) WritePpmTo(w io.Writer) (err error) { if _, err = fmt.Fprintln(w, "P6"); err != nil { return } for _, c := range b.Comments { if _, err = fmt.Fprintln(w, c); err != nil { return } } _, err = fmt.Fprintf(w, "%d %d\n255\n", b.cols, b.rows) if err != nil { return } b3 := make([]byte, 3*len(b.px)) n1 := 0 for _, px := range b.px { b3[n1] = px.R b3[n1+1] = px.G b3[n1+2] = px.B n1 += 3 } if _, err = w.Write(b3); err != nil { return } return } func (b *Bitmap) WritePpmFile(fn string) (err error) { var f *os.File if f, err = os.Create(fn); err != nil { return } if err = b.WritePpmTo(f); err != nil { return } return f.Close() }
Port the provided PHP code into Go while preserving the original functionality.
class Bitmap { public $data; public $w; public $h; public function __construct($w = 16, $h = 16){ $white = array_fill(0, $w, array(255,255,255)); $this->data = array_fill(0, $h, $white); $this->w = $w; $this->h = $h; } public function fill($x = 0, $y = 0, $w = null, $h = null, $color = array(0,0,0)){ if (is_null($w)) $w = $this->w; if (is_null($h)) $h = $this->h; $w += $x; $h += $y; for ($i = $y; $i < $h; $i++){ for ($j = $x; $j < $w; $j++){ $this->setPixel($j, $i, $color); } } } public function setPixel($x, $y, $color = array(0,0,0)){ if ($x >= $this->w) return false; if ($x < 0) return false; if ($y >= $this->h) return false; if ($y < 0) return false; $this->data[$y][$x] = $color; } public function getPixel($x, $y){ return $this->data[$y][$x]; } public function writeP6($filename){ $fh = fopen($filename, 'w'); if (!$fh) return false; fputs($fh, "P6 {$this->w} {$this->h} 255\n"); foreach ($this->data as $row){ foreach($row as $pixel){ fputs($fh, pack('C', $pixel[0])); fputs($fh, pack('C', $pixel[1])); fputs($fh, pack('C', $pixel[2])); } } fclose($fh); } } $b = new Bitmap(16,16); $b->fill(); $b->fill(2, 2, 18, 18, array(240,240,240)); $b->setPixel(0, 15, array(255,0,0)); $b->writeP6('p6.ppm');
package raster import ( "fmt" "io" "os" ) func (b *Bitmap) WritePpmTo(w io.Writer) (err error) { if _, err = fmt.Fprintln(w, "P6"); err != nil { return } for _, c := range b.Comments { if _, err = fmt.Fprintln(w, c); err != nil { return } } _, err = fmt.Fprintf(w, "%d %d\n255\n", b.cols, b.rows) if err != nil { return } b3 := make([]byte, 3*len(b.px)) n1 := 0 for _, px := range b.px { b3[n1] = px.R b3[n1+1] = px.G b3[n1+2] = px.B n1 += 3 } if _, err = w.Write(b3); err != nil { return } return } func (b *Bitmap) WritePpmFile(fn string) (err error) { var f *os.File if f, err = os.Create(fn); err != nil { return } if err = b.WritePpmTo(f); err != nil { return } return f.Close() }
Produce a language-to-language conversion: from PHP to Go, same semantics.
<?php unlink('input.txt'); unlink('/input.txt'); rmdir('docs'); rmdir('/docs'); ?>
package main import "os" func main() { os.Remove("input.txt") os.Remove("/input.txt") os.Remove("docs") os.Remove("/docs") os.RemoveAll("docs") os.RemoveAll("/docs") }
Maintain the same structure and functionality when rewriting this code in Go.
<?php unlink('input.txt'); unlink('/input.txt'); rmdir('docs'); rmdir('/docs'); ?>
package main import "os" func main() { os.Remove("input.txt") os.Remove("/input.txt") os.Remove("docs") os.Remove("/docs") os.RemoveAll("docs") os.RemoveAll("/docs") }
Generate a Go translation of this PHP snippet without changing its computational steps.
<?php $Anerisia = array(31,28,31,30,31,30,31,31,30,31,30,31); $MONTHS = array("Choas","Discord","Confusion","Bureacracy","The Aftermath"); $DAYS = array("Setting Orange","Sweetmorn","BoomTime","Pungenday","Prickle-Prickle"); $Dsuff = array('th','st','nd','rd','th','th','th','th','th','th'); $Holy5 = array("Mungday","MojoDay","Syaday","Zaraday","Maladay"); $Holy50 = array("Chaoflux","Discoflux","Confuflux","Bureflux","Afflux"); $edate = explode(" ",date('Y m j L')); $usery = $edate[0]; $userm = $edate[1]; $userd = $edate[2]; $IsLeap = $edate[3]; if (isset($_GET['y']) && isset($_GET['m']) && isset($_GET['d'])) { $usery = $_GET['y']; $userm = $_GET['m']; $userd = $_GET['d']; $IsLeap = 0; if (($usery%4 == 0) && ($usery%100 >0)) $IsLeap =1; if ($usery%400 == 0) $IsLeap = 1; } $userdays = 0; $i = 0; while ($i < ($userm-1)) { $userdays = $userdays + $Anerisia[$i]; $i = $i +1; } $userdays = $userdays + $userd; $IsHolyday = 0; $dyear = $usery + 1166; $dmonth = $MONTHS[$userdays/73.2]; $dday = $userdays%73; if (0 == $dday) $dday = 73; $Dname = $DAYS[$userdays%5]; $Holyday = "St. Tibs Day"; if ($dday == 5) { $Holyday = $Holy5[$userdays/73.2]; $IsHolyday =1; } if ($dday == 50) { $Holyday = $Holy50[$userdays/73.2]; $IsHolyday =1; } if (($IsLeap ==1) && ($userd ==29) and ($userm ==2)) $IsHolyday = 2; $suff = $Dsuff[$dday%10] ; if ((11 <= $dday) && (19 >= $dday)) $suff='th'; if ($IsHolyday ==2) echo "</br>Celeberate ",$Holyday," ",$dmonth," YOLD ",$dyear; if ($IsHolyday ==1) echo "</br>Celeberate for today ", $Dname , " The ", $dday,"<sup>",$suff,"</sup>", " day of ", $dmonth , " YOLD " , $dyear , " is the holy day of " , $Holyday; if ($IsHolyday == 0) echo "</br>Today is " , $Dname , " the " , $dday ,"<sup>",$suff, "</sup> day of " , $dmonth , " YOLD " , $dyear; ?>
package ddate import ( "strconv" "strings" "time" ) const ( DefaultFmt = "Pungenday, Discord 5, 3131 YOLD" OldFmt = `Today is Pungenday, the 5th day of Discord in the YOLD 3131 Celebrate Mojoday` ) const ( protoLongSeason = "Discord" protoShortSeason = "Dsc" protoLongDay = "Pungenday" protoShortDay = "PD" protoOrdDay = "5" protoCardDay = "5th" protoHolyday = "Mojoday" protoYear = "3131" ) var ( longDay = []string{"Sweetmorn", "Boomtime", "Pungenday", "Prickle-Prickle", "Setting Orange"} shortDay = []string{"SM", "BT", "PD", "PP", "SO"} longSeason = []string{ "Chaos", "Discord", "Confusion", "Bureaucracy", "The Aftermath"} shortSeason = []string{"Chs", "Dsc", "Cfn", "Bcy", "Afm"} holyday = [][]string{{"Mungday", "Chaoflux"}, {"Mojoday", "Discoflux"}, {"Syaday", "Confuflux"}, {"Zaraday", "Bureflux"}, {"Maladay", "Afflux"}} ) type DiscDate struct { StTibs bool Dayy int Year int } func New(eris time.Time) DiscDate { t := time.Date(eris.Year(), 1, 1, eris.Hour(), eris.Minute(), eris.Second(), eris.Nanosecond(), eris.Location()) bob := int(eris.Sub(t).Hours()) / 24 raw := eris.Year() hastur := DiscDate{Year: raw + 1166} if raw%4 == 0 && (raw%100 != 0 || raw%400 == 0) { if bob > 59 { bob-- } else if bob == 59 { hastur.StTibs = true return hastur } } hastur.Dayy = bob return hastur } func (dd DiscDate) Format(f string) (r string) { var st, snarf string var dateElement bool f6 := func(proto, wibble string) { if !dateElement { snarf = r dateElement = true } if st > "" { r = "" } else { r += wibble } f = f[len(proto):] } f4 := func(proto, wibble string) { if dd.StTibs { st = "St. Tib's Day" } f6(proto, wibble) } season, day := dd.Dayy/73, dd.Dayy%73 for f > "" { switch { case strings.HasPrefix(f, protoLongDay): f4(protoLongDay, longDay[dd.Dayy%5]) case strings.HasPrefix(f, protoShortDay): f4(protoShortDay, shortDay[dd.Dayy%5]) case strings.HasPrefix(f, protoCardDay): funkychickens := "th" if day/10 != 1 { switch day % 10 { case 0: funkychickens = "st" case 1: funkychickens = "nd" case 2: funkychickens = "rd" } } f4(protoCardDay, strconv.Itoa(day+1)+funkychickens) case strings.HasPrefix(f, protoOrdDay): f4(protoOrdDay, strconv.Itoa(day+1)) case strings.HasPrefix(f, protoLongSeason): f6(protoLongSeason, longSeason[season]) case strings.HasPrefix(f, protoShortSeason): f6(protoShortSeason, shortSeason[season]) case strings.HasPrefix(f, protoHolyday): if day == 4 { r += holyday[season][0] } else if day == 49 { r += holyday[season][1] } f = f[len(protoHolyday):] case strings.HasPrefix(f, protoYear): r += strconv.Itoa(dd.Year) f = f[4:] default: r += f[:1] f = f[1:] } } if st > "" { r = snarf + st + r } return }
Transform the following PHP implementation into Go, maintaining the same output and logic.
<?php $Anerisia = array(31,28,31,30,31,30,31,31,30,31,30,31); $MONTHS = array("Choas","Discord","Confusion","Bureacracy","The Aftermath"); $DAYS = array("Setting Orange","Sweetmorn","BoomTime","Pungenday","Prickle-Prickle"); $Dsuff = array('th','st','nd','rd','th','th','th','th','th','th'); $Holy5 = array("Mungday","MojoDay","Syaday","Zaraday","Maladay"); $Holy50 = array("Chaoflux","Discoflux","Confuflux","Bureflux","Afflux"); $edate = explode(" ",date('Y m j L')); $usery = $edate[0]; $userm = $edate[1]; $userd = $edate[2]; $IsLeap = $edate[3]; if (isset($_GET['y']) && isset($_GET['m']) && isset($_GET['d'])) { $usery = $_GET['y']; $userm = $_GET['m']; $userd = $_GET['d']; $IsLeap = 0; if (($usery%4 == 0) && ($usery%100 >0)) $IsLeap =1; if ($usery%400 == 0) $IsLeap = 1; } $userdays = 0; $i = 0; while ($i < ($userm-1)) { $userdays = $userdays + $Anerisia[$i]; $i = $i +1; } $userdays = $userdays + $userd; $IsHolyday = 0; $dyear = $usery + 1166; $dmonth = $MONTHS[$userdays/73.2]; $dday = $userdays%73; if (0 == $dday) $dday = 73; $Dname = $DAYS[$userdays%5]; $Holyday = "St. Tibs Day"; if ($dday == 5) { $Holyday = $Holy5[$userdays/73.2]; $IsHolyday =1; } if ($dday == 50) { $Holyday = $Holy50[$userdays/73.2]; $IsHolyday =1; } if (($IsLeap ==1) && ($userd ==29) and ($userm ==2)) $IsHolyday = 2; $suff = $Dsuff[$dday%10] ; if ((11 <= $dday) && (19 >= $dday)) $suff='th'; if ($IsHolyday ==2) echo "</br>Celeberate ",$Holyday," ",$dmonth," YOLD ",$dyear; if ($IsHolyday ==1) echo "</br>Celeberate for today ", $Dname , " The ", $dday,"<sup>",$suff,"</sup>", " day of ", $dmonth , " YOLD " , $dyear , " is the holy day of " , $Holyday; if ($IsHolyday == 0) echo "</br>Today is " , $Dname , " the " , $dday ,"<sup>",$suff, "</sup> day of " , $dmonth , " YOLD " , $dyear; ?>
package ddate import ( "strconv" "strings" "time" ) const ( DefaultFmt = "Pungenday, Discord 5, 3131 YOLD" OldFmt = `Today is Pungenday, the 5th day of Discord in the YOLD 3131 Celebrate Mojoday` ) const ( protoLongSeason = "Discord" protoShortSeason = "Dsc" protoLongDay = "Pungenday" protoShortDay = "PD" protoOrdDay = "5" protoCardDay = "5th" protoHolyday = "Mojoday" protoYear = "3131" ) var ( longDay = []string{"Sweetmorn", "Boomtime", "Pungenday", "Prickle-Prickle", "Setting Orange"} shortDay = []string{"SM", "BT", "PD", "PP", "SO"} longSeason = []string{ "Chaos", "Discord", "Confusion", "Bureaucracy", "The Aftermath"} shortSeason = []string{"Chs", "Dsc", "Cfn", "Bcy", "Afm"} holyday = [][]string{{"Mungday", "Chaoflux"}, {"Mojoday", "Discoflux"}, {"Syaday", "Confuflux"}, {"Zaraday", "Bureflux"}, {"Maladay", "Afflux"}} ) type DiscDate struct { StTibs bool Dayy int Year int } func New(eris time.Time) DiscDate { t := time.Date(eris.Year(), 1, 1, eris.Hour(), eris.Minute(), eris.Second(), eris.Nanosecond(), eris.Location()) bob := int(eris.Sub(t).Hours()) / 24 raw := eris.Year() hastur := DiscDate{Year: raw + 1166} if raw%4 == 0 && (raw%100 != 0 || raw%400 == 0) { if bob > 59 { bob-- } else if bob == 59 { hastur.StTibs = true return hastur } } hastur.Dayy = bob return hastur } func (dd DiscDate) Format(f string) (r string) { var st, snarf string var dateElement bool f6 := func(proto, wibble string) { if !dateElement { snarf = r dateElement = true } if st > "" { r = "" } else { r += wibble } f = f[len(proto):] } f4 := func(proto, wibble string) { if dd.StTibs { st = "St. Tib's Day" } f6(proto, wibble) } season, day := dd.Dayy/73, dd.Dayy%73 for f > "" { switch { case strings.HasPrefix(f, protoLongDay): f4(protoLongDay, longDay[dd.Dayy%5]) case strings.HasPrefix(f, protoShortDay): f4(protoShortDay, shortDay[dd.Dayy%5]) case strings.HasPrefix(f, protoCardDay): funkychickens := "th" if day/10 != 1 { switch day % 10 { case 0: funkychickens = "st" case 1: funkychickens = "nd" case 2: funkychickens = "rd" } } f4(protoCardDay, strconv.Itoa(day+1)+funkychickens) case strings.HasPrefix(f, protoOrdDay): f4(protoOrdDay, strconv.Itoa(day+1)) case strings.HasPrefix(f, protoLongSeason): f6(protoLongSeason, longSeason[season]) case strings.HasPrefix(f, protoShortSeason): f6(protoShortSeason, shortSeason[season]) case strings.HasPrefix(f, protoHolyday): if day == 4 { r += holyday[season][0] } else if day == 49 { r += holyday[season][1] } f = f[len(protoHolyday):] case strings.HasPrefix(f, protoYear): r += strconv.Itoa(dd.Year) f = f[4:] default: r += f[:1] f = f[1:] } } if st > "" { r = snarf + st + r } return }
Produce a functionally identical Go code for the snippet given in PHP.
<?php $extra = 'little'; echo "Mary had a $extra lamb.\n"; printf("Mary had a %s lamb.\n", $extra); ?>
package main import ( "fmt" ) func main() { str := "Mary had a %s lamb" txt := "little" out := fmt.Sprintf(str, txt) fmt.Println(out) }
Can you help me rewrite this code in Go instead of PHP, keeping it the same logically?
<?php $extra = 'little'; echo "Mary had a $extra lamb.\n"; printf("Mary had a %s lamb.\n", $extra); ?>
package main import ( "fmt" ) func main() { str := "Mary had a %s lamb" txt := "little" out := fmt.Sprintf(str, txt) fmt.Println(out) }
Convert this PHP snippet to Go and keep its semantics consistent.
<?php class PilesHeap extends SplMinHeap { public function compare($pile1, $pile2) { return parent::compare($pile1->top(), $pile2->top()); } } function patience_sort(&$n) { $piles = array(); foreach ($n as $x) { $low = 0; $high = count($piles)-1; while ($low <= $high) { $mid = (int)(($low + $high) / 2); if ($piles[$mid]->top() >= $x) $high = $mid - 1; else $low = $mid + 1; } $i = $low; if ($i == count($piles)) $piles[] = new SplStack(); $piles[$i]->push($x); } $heap = new PilesHeap(); foreach ($piles as $pile) $heap->insert($pile); for ($c = 0; $c < count($n); $c++) { $smallPile = $heap->extract(); $n[$c] = $smallPile->pop(); if (!$smallPile->isEmpty()) $heap->insert($smallPile); } assert($heap->isEmpty()); } $a = array(4, 65, 2, -31, 0, 99, 83, 782, 1); patience_sort($a); print_r($a); ?>
package main import ( "fmt" "container/heap" "sort" ) type IntPile []int func (self IntPile) Top() int { return self[len(self)-1] } func (self *IntPile) Pop() int { x := (*self)[len(*self)-1] *self = (*self)[:len(*self)-1] return x } type IntPilesHeap []IntPile func (self IntPilesHeap) Len() int { return len(self) } func (self IntPilesHeap) Less(i, j int) bool { return self[i].Top() < self[j].Top() } func (self IntPilesHeap) Swap(i, j int) { self[i], self[j] = self[j], self[i] } func (self *IntPilesHeap) Push(x interface{}) { *self = append(*self, x.(IntPile)) } func (self *IntPilesHeap) Pop() interface{} { x := (*self)[len(*self)-1] *self = (*self)[:len(*self)-1] return x } func patience_sort (n []int) { var piles []IntPile for _, x := range n { j := sort.Search(len(piles), func (i int) bool { return piles[i].Top() >= x }) if j != len(piles) { piles[j] = append(piles[j], x) } else { piles = append(piles, IntPile{ x }) } } hp := IntPilesHeap(piles) heap.Init(&hp) for i, _ := range n { smallPile := heap.Pop(&hp).(IntPile) n[i] = smallPile.Pop() if len(smallPile) != 0 { heap.Push(&hp, smallPile) } } if len(hp) != 0 { panic("something went wrong") } } func main() { a := []int{4, 65, 2, -31, 0, 99, 83, 782, 1} patience_sort(a) fmt.Println(a) }
Write the same algorithm in Go as shown in this PHP implementation.
<?php class PilesHeap extends SplMinHeap { public function compare($pile1, $pile2) { return parent::compare($pile1->top(), $pile2->top()); } } function patience_sort(&$n) { $piles = array(); foreach ($n as $x) { $low = 0; $high = count($piles)-1; while ($low <= $high) { $mid = (int)(($low + $high) / 2); if ($piles[$mid]->top() >= $x) $high = $mid - 1; else $low = $mid + 1; } $i = $low; if ($i == count($piles)) $piles[] = new SplStack(); $piles[$i]->push($x); } $heap = new PilesHeap(); foreach ($piles as $pile) $heap->insert($pile); for ($c = 0; $c < count($n); $c++) { $smallPile = $heap->extract(); $n[$c] = $smallPile->pop(); if (!$smallPile->isEmpty()) $heap->insert($smallPile); } assert($heap->isEmpty()); } $a = array(4, 65, 2, -31, 0, 99, 83, 782, 1); patience_sort($a); print_r($a); ?>
package main import ( "fmt" "container/heap" "sort" ) type IntPile []int func (self IntPile) Top() int { return self[len(self)-1] } func (self *IntPile) Pop() int { x := (*self)[len(*self)-1] *self = (*self)[:len(*self)-1] return x } type IntPilesHeap []IntPile func (self IntPilesHeap) Len() int { return len(self) } func (self IntPilesHeap) Less(i, j int) bool { return self[i].Top() < self[j].Top() } func (self IntPilesHeap) Swap(i, j int) { self[i], self[j] = self[j], self[i] } func (self *IntPilesHeap) Push(x interface{}) { *self = append(*self, x.(IntPile)) } func (self *IntPilesHeap) Pop() interface{} { x := (*self)[len(*self)-1] *self = (*self)[:len(*self)-1] return x } func patience_sort (n []int) { var piles []IntPile for _, x := range n { j := sort.Search(len(piles), func (i int) bool { return piles[i].Top() >= x }) if j != len(piles) { piles[j] = append(piles[j], x) } else { piles = append(piles, IntPile{ x }) } } hp := IntPilesHeap(piles) heap.Init(&hp) for i, _ := range n { smallPile := heap.Pop(&hp).(IntPile) n[i] = smallPile.Pop() if len(smallPile) != 0 { heap.Push(&hp, smallPile) } } if len(hp) != 0 { panic("something went wrong") } } func main() { a := []int{4, 65, 2, -31, 0, 99, 83, 782, 1} patience_sort(a) fmt.Println(a) }
Write a version of this PHP function in Go with identical behavior.
$desc = 'tH......... . . ........ . . Ht.. ...... .. tH.... ....... .. .. tH..... ...... ..'; $steps = 30; $world = array(array()); $row = 0; $col = 0; foreach(str_split($desc) as $i){ switch($i){ case "\n": $row++; $col = 0; $world[] = array(); break; case '.': $world[$row][$col] = 1;//conductor $col++; break; case 'H': $world[$row][$col] = 2;//head $col++; break; case 't': $world[$row][$col] = 3;//tail $col++; break; default: $world[$row][$col] = 0;//insulator/air $col++; break; }; }; function draw_world($world){ foreach($world as $rowc){ foreach($rowc as $cell){ switch($cell){ case 0: echo ' '; break; case 1: echo '.'; break; case 2: echo 'H'; break; case 3: echo 't'; }; }; echo "\n"; }; }; echo "Original world:\n"; draw_world($world); for($i = 0; $i < $steps; $i++){ $old_world = $world; //backup to look up where was an electron head foreach($world as $row => &$rowc){ foreach($rowc as $col => &$cell){ switch($cell){ case 2: $cell = 3; break; case 3: $cell = 1; break; case 1: $neigh_heads = (int) @$old_world[$row - 1][$col - 1] == 2; $neigh_heads += (int) @$old_world[$row - 1][$col] == 2; $neigh_heads += (int) @$old_world[$row - 1][$col + 1] == 2; $neigh_heads += (int) @$old_world[$row][$col - 1] == 2; $neigh_heads += (int) @$old_world[$row][$col + 1] == 2; $neigh_heads += (int) @$old_world[$row + 1][$col - 1] == 2; $neigh_heads += (int) @$old_world[$row + 1][$col] == 2; if($neigh_heads == 1 || $neigh_heads == 2){ $cell = 2; }; }; }; unset($cell); //just to be safe }; unset($rowc); //just to be safe echo "\nStep " . ($i + 1) . ":\n"; draw_world($world); };
package main import ( "bytes" "fmt" "io/ioutil" "strings" ) var rows, cols int var rx, cx int var mn []int func main() { src, err := ioutil.ReadFile("ww.config") if err != nil { fmt.Println(err) return } srcRows := bytes.Split(src, []byte{'\n'}) rows = len(srcRows) for _, r := range srcRows { if len(r) > cols { cols = len(r) } } rx, cx = rows+2, cols+2 mn = []int{-cx-1, -cx, -cx+1, -1, 1, cx-1, cx, cx+1} odd := make([]byte, rx*cx) even := make([]byte, rx*cx) for ri, r := range srcRows { copy(odd[(ri+1)*cx+1:], r) } for { print(odd) step(even, odd) fmt.Scanln() print(even) step(odd, even) fmt.Scanln() } } func print(grid []byte) { fmt.Println(strings.Repeat("__", cols)) fmt.Println() for r := 1; r <= rows; r++ { for c := 1; c <= cols; c++ { if grid[r*cx+c] == 0 { fmt.Print(" ") } else { fmt.Printf(" %c", grid[r*cx+c]) } } fmt.Println() } } func step(dst, src []byte) { for r := 1; r <= rows; r++ { for c := 1; c <= cols; c++ { x := r*cx + c dst[x] = src[x] switch dst[x] { case 'H': dst[x] = 't' case 't': dst[x] = '.' case '.': var nn int for _, n := range mn { if src[x+n] == 'H' { nn++ } } if nn == 1 || nn == 2 { dst[x] = 'H' } } } } }
Write the same algorithm in Go as shown in this PHP implementation.
$desc = 'tH......... . . ........ . . Ht.. ...... .. tH.... ....... .. .. tH..... ...... ..'; $steps = 30; $world = array(array()); $row = 0; $col = 0; foreach(str_split($desc) as $i){ switch($i){ case "\n": $row++; $col = 0; $world[] = array(); break; case '.': $world[$row][$col] = 1;//conductor $col++; break; case 'H': $world[$row][$col] = 2;//head $col++; break; case 't': $world[$row][$col] = 3;//tail $col++; break; default: $world[$row][$col] = 0;//insulator/air $col++; break; }; }; function draw_world($world){ foreach($world as $rowc){ foreach($rowc as $cell){ switch($cell){ case 0: echo ' '; break; case 1: echo '.'; break; case 2: echo 'H'; break; case 3: echo 't'; }; }; echo "\n"; }; }; echo "Original world:\n"; draw_world($world); for($i = 0; $i < $steps; $i++){ $old_world = $world; //backup to look up where was an electron head foreach($world as $row => &$rowc){ foreach($rowc as $col => &$cell){ switch($cell){ case 2: $cell = 3; break; case 3: $cell = 1; break; case 1: $neigh_heads = (int) @$old_world[$row - 1][$col - 1] == 2; $neigh_heads += (int) @$old_world[$row - 1][$col] == 2; $neigh_heads += (int) @$old_world[$row - 1][$col + 1] == 2; $neigh_heads += (int) @$old_world[$row][$col - 1] == 2; $neigh_heads += (int) @$old_world[$row][$col + 1] == 2; $neigh_heads += (int) @$old_world[$row + 1][$col - 1] == 2; $neigh_heads += (int) @$old_world[$row + 1][$col] == 2; if($neigh_heads == 1 || $neigh_heads == 2){ $cell = 2; }; }; }; unset($cell); //just to be safe }; unset($rowc); //just to be safe echo "\nStep " . ($i + 1) . ":\n"; draw_world($world); };
package main import ( "bytes" "fmt" "io/ioutil" "strings" ) var rows, cols int var rx, cx int var mn []int func main() { src, err := ioutil.ReadFile("ww.config") if err != nil { fmt.Println(err) return } srcRows := bytes.Split(src, []byte{'\n'}) rows = len(srcRows) for _, r := range srcRows { if len(r) > cols { cols = len(r) } } rx, cx = rows+2, cols+2 mn = []int{-cx-1, -cx, -cx+1, -1, 1, cx-1, cx, cx+1} odd := make([]byte, rx*cx) even := make([]byte, rx*cx) for ri, r := range srcRows { copy(odd[(ri+1)*cx+1:], r) } for { print(odd) step(even, odd) fmt.Scanln() print(even) step(odd, even) fmt.Scanln() } } func print(grid []byte) { fmt.Println(strings.Repeat("__", cols)) fmt.Println() for r := 1; r <= rows; r++ { for c := 1; c <= cols; c++ { if grid[r*cx+c] == 0 { fmt.Print(" ") } else { fmt.Printf(" %c", grid[r*cx+c]) } } fmt.Println() } } func step(dst, src []byte) { for r := 1; r <= rows; r++ { for c := 1; c <= cols; c++ { x := r*cx + c dst[x] = src[x] switch dst[x] { case 'H': dst[x] = 't' case 't': dst[x] = '.' case '.': var nn int for _, n := range mn { if src[x+n] == 'H' { nn++ } } if nn == 1 || nn == 2 { dst[x] = 'H' } } } } }
Write the same algorithm in Go as shown in this PHP implementation.
<?php function contains($bounds, $lat, $lng) { $count = 0; $bounds_count = count($bounds); for ($b = 0; $b < $bounds_count; $b++) { $vertex1 = $bounds[$b]; $vertex2 = $bounds[($b + 1) % $bounds_count]; if (west($vertex1, $vertex2, $lng, $lat)) $count++; } return $count % 2; } function west($A, $B, $x, $y) { if ($A['y'] <= $B['y']) { if ($y <= $A['y'] || $y > $B['y'] || $x >= $A['x'] && $x >= $B['x']) { return false; } if ($x < $A['x'] && $x < $B['x']) { return true; } if ($x == $A['x']) { if ($y == $A['y']) { $result1 = NAN; } else { $result1 = INF; } } else { $result1 = ($y - $A['y']) / ($x - $A['x']); } if ($B['x'] == $A['x']) { if ($B['y'] == $A['y']) { $result2 = NAN; } else { $result2 = INF; } } else { $result2 = ($B['y'] - $A['y']) / ($B['x'] - $A['x']); } return $result1 > $result2; } return west($B, $A, $x, $y); } $square = [ 'name' => 'square', 'bounds' => [['x' => 0, 'y' => 0], ['x' => 20, 'y' => 0], ['x' => 20, 'y' => 20], ['x' => 0, 'y' => 20]] ]; $squareHole = [ 'name' => 'squareHole', 'bounds' => [['x' => 0, 'y' => 0], ['x' => 20, 'y' => 0], ['x' => 20, 'y' => 20], ['x' => 0, 'y' => 20], ['x' => 5, 'y' => 5], ['x' => 15, 'y' => 5], ['x' => 15, 'y' => 15], ['x' => 5, 'y' => 15]] ]; $strange = [ 'name' => 'strange', 'bounds' => [['x' => 0, 'y' => 0], ['x' => 5, 'y' => 5], ['x' => 0, 'y' => 20], ['x' => 5, 'y' => 15], ['x' => 15, 'y' => 15], ['x' => 20, 'y' => 20], ['x' => 20, 'y' => 0]] ]; $hexagon = [ 'name' => 'hexagon', 'bounds' => [['x' => 6, 'y' => 0], ['x' => 14, 'y' => 0], ['x' => 20, 'y' => 10], ['x' => 14, 'y' => 20], ['x' => 6, 'y' => 20], ['x' => 0, 'y' => 10]] ]; $shapes = [$square, $squareHole, $strange, $hexagon]; $testPoints = [ ['lng' => 10, 'lat' => 10], ['lng' => 10, 'lat' => 16], ['lng' => -20, 'lat' => 10], ['lng' => 0, 'lat' => 10], ['lng' => 20, 'lat' => 10], ['lng' => 16, 'lat' => 10], ['lng' => 20, 'lat' => 20] ]; for ($s = 0; $s < count($shapes); $s++) { $shape = $shapes[$s]; for ($tp = 0; $tp < count($testPoints); $tp++) { $testPoint = $testPoints[$tp]; echo json_encode($testPoint) . "\tin " . $shape['name'] . "\t" . contains($shape['bounds'], $testPoint['lat'], $testPoint['lng']) . PHP_EOL; } }
package main import ( "fmt" "math" ) type xy struct { x, y float64 } type seg struct { p1, p2 xy } type poly struct { name string sides []seg } func inside(pt xy, pg poly) (i bool) { for _, side := range pg.sides { if rayIntersectsSegment(pt, side) { i = !i } } return } func rayIntersectsSegment(p xy, s seg) bool { var a, b xy if s.p1.y < s.p2.y { a, b = s.p1, s.p2 } else { a, b = s.p2, s.p1 } for p.y == a.y || p.y == b.y { p.y = math.Nextafter(p.y, math.Inf(1)) } if p.y < a.y || p.y > b.y { return false } if a.x > b.x { if p.x > a.x { return false } if p.x < b.x { return true } } else { if p.x > b.x { return false } if p.x < a.x { return true } } return (p.y-a.y)/(p.x-a.x) >= (b.y-a.y)/(b.x-a.x) } var ( p1 = xy{0, 0} p2 = xy{10, 0} p3 = xy{10, 10} p4 = xy{0, 10} p5 = xy{2.5, 2.5} p6 = xy{7.5, 2.5} p7 = xy{7.5, 7.5} p8 = xy{2.5, 7.5} p9 = xy{0, 5} p10 = xy{10, 5} p11 = xy{3, 0} p12 = xy{7, 0} p13 = xy{7, 10} p14 = xy{3, 10} ) var tpg = []poly{ {"square", []seg{{p1, p2}, {p2, p3}, {p3, p4}, {p4, p1}}}, {"square hole", []seg{{p1, p2}, {p2, p3}, {p3, p4}, {p4, p1}, {p5, p6}, {p6, p7}, {p7, p8}, {p8, p5}}}, {"strange", []seg{{p1, p5}, {p5, p4}, {p4, p8}, {p8, p7}, {p7, p3}, {p3, p2}, {p2, p5}}}, {"exagon", []seg{{p11, p12}, {p12, p10}, {p10, p13}, {p13, p14}, {p14, p9}, {p9, p11}}}, } var tpt = []xy{ {5, 5}, {5, 8}, {-10, 5}, {0, 5}, {10, 5}, {8, 5}, {10, 10}, {1, 2}, {2, 1}, } func main() { for _, pg := range tpg { fmt.Printf("%s:\n", pg.name) for _, pt := range tpt { fmt.Println(pt, inside(pt, pg)) } } }
Convert the following code from PHP to Go, ensuring the logic remains intact.
<?php function contains($bounds, $lat, $lng) { $count = 0; $bounds_count = count($bounds); for ($b = 0; $b < $bounds_count; $b++) { $vertex1 = $bounds[$b]; $vertex2 = $bounds[($b + 1) % $bounds_count]; if (west($vertex1, $vertex2, $lng, $lat)) $count++; } return $count % 2; } function west($A, $B, $x, $y) { if ($A['y'] <= $B['y']) { if ($y <= $A['y'] || $y > $B['y'] || $x >= $A['x'] && $x >= $B['x']) { return false; } if ($x < $A['x'] && $x < $B['x']) { return true; } if ($x == $A['x']) { if ($y == $A['y']) { $result1 = NAN; } else { $result1 = INF; } } else { $result1 = ($y - $A['y']) / ($x - $A['x']); } if ($B['x'] == $A['x']) { if ($B['y'] == $A['y']) { $result2 = NAN; } else { $result2 = INF; } } else { $result2 = ($B['y'] - $A['y']) / ($B['x'] - $A['x']); } return $result1 > $result2; } return west($B, $A, $x, $y); } $square = [ 'name' => 'square', 'bounds' => [['x' => 0, 'y' => 0], ['x' => 20, 'y' => 0], ['x' => 20, 'y' => 20], ['x' => 0, 'y' => 20]] ]; $squareHole = [ 'name' => 'squareHole', 'bounds' => [['x' => 0, 'y' => 0], ['x' => 20, 'y' => 0], ['x' => 20, 'y' => 20], ['x' => 0, 'y' => 20], ['x' => 5, 'y' => 5], ['x' => 15, 'y' => 5], ['x' => 15, 'y' => 15], ['x' => 5, 'y' => 15]] ]; $strange = [ 'name' => 'strange', 'bounds' => [['x' => 0, 'y' => 0], ['x' => 5, 'y' => 5], ['x' => 0, 'y' => 20], ['x' => 5, 'y' => 15], ['x' => 15, 'y' => 15], ['x' => 20, 'y' => 20], ['x' => 20, 'y' => 0]] ]; $hexagon = [ 'name' => 'hexagon', 'bounds' => [['x' => 6, 'y' => 0], ['x' => 14, 'y' => 0], ['x' => 20, 'y' => 10], ['x' => 14, 'y' => 20], ['x' => 6, 'y' => 20], ['x' => 0, 'y' => 10]] ]; $shapes = [$square, $squareHole, $strange, $hexagon]; $testPoints = [ ['lng' => 10, 'lat' => 10], ['lng' => 10, 'lat' => 16], ['lng' => -20, 'lat' => 10], ['lng' => 0, 'lat' => 10], ['lng' => 20, 'lat' => 10], ['lng' => 16, 'lat' => 10], ['lng' => 20, 'lat' => 20] ]; for ($s = 0; $s < count($shapes); $s++) { $shape = $shapes[$s]; for ($tp = 0; $tp < count($testPoints); $tp++) { $testPoint = $testPoints[$tp]; echo json_encode($testPoint) . "\tin " . $shape['name'] . "\t" . contains($shape['bounds'], $testPoint['lat'], $testPoint['lng']) . PHP_EOL; } }
package main import ( "fmt" "math" ) type xy struct { x, y float64 } type seg struct { p1, p2 xy } type poly struct { name string sides []seg } func inside(pt xy, pg poly) (i bool) { for _, side := range pg.sides { if rayIntersectsSegment(pt, side) { i = !i } } return } func rayIntersectsSegment(p xy, s seg) bool { var a, b xy if s.p1.y < s.p2.y { a, b = s.p1, s.p2 } else { a, b = s.p2, s.p1 } for p.y == a.y || p.y == b.y { p.y = math.Nextafter(p.y, math.Inf(1)) } if p.y < a.y || p.y > b.y { return false } if a.x > b.x { if p.x > a.x { return false } if p.x < b.x { return true } } else { if p.x > b.x { return false } if p.x < a.x { return true } } return (p.y-a.y)/(p.x-a.x) >= (b.y-a.y)/(b.x-a.x) } var ( p1 = xy{0, 0} p2 = xy{10, 0} p3 = xy{10, 10} p4 = xy{0, 10} p5 = xy{2.5, 2.5} p6 = xy{7.5, 2.5} p7 = xy{7.5, 7.5} p8 = xy{2.5, 7.5} p9 = xy{0, 5} p10 = xy{10, 5} p11 = xy{3, 0} p12 = xy{7, 0} p13 = xy{7, 10} p14 = xy{3, 10} ) var tpg = []poly{ {"square", []seg{{p1, p2}, {p2, p3}, {p3, p4}, {p4, p1}}}, {"square hole", []seg{{p1, p2}, {p2, p3}, {p3, p4}, {p4, p1}, {p5, p6}, {p6, p7}, {p7, p8}, {p8, p5}}}, {"strange", []seg{{p1, p5}, {p5, p4}, {p4, p8}, {p8, p7}, {p7, p3}, {p3, p2}, {p2, p5}}}, {"exagon", []seg{{p11, p12}, {p12, p10}, {p10, p13}, {p13, p14}, {p14, p9}, {p9, p11}}}, } var tpt = []xy{ {5, 5}, {5, 8}, {-10, 5}, {0, 5}, {10, 5}, {8, 5}, {10, 10}, {1, 2}, {2, 1}, } func main() { for _, pg := range tpg { fmt.Printf("%s:\n", pg.name) for _, pt := range tpt { fmt.Println(pt, inside(pt, pg)) } } }
Keep all operations the same but rewrite the snippet in Go.
<?php echo substr_count("the three truths", "th"), PHP_EOL; // prints "3" echo substr_count("ababababab", "abab"), PHP_EOL; // prints "2"
package main import ( "fmt" "strings" ) func main() { fmt.Println(strings.Count("the three truths", "th")) fmt.Println(strings.Count("ababababab", "abab")) }
Generate an equivalent Go version of this PHP code.
<?php echo substr_count("the three truths", "th"), PHP_EOL; // prints "3" echo substr_count("ababababab", "abab"), PHP_EOL; // prints "2"
package main import ( "fmt" "strings" ) func main() { fmt.Println(strings.Count("the three truths", "th")) fmt.Println(strings.Count("ababababab", "abab")) }
Convert this Python snippet to VB and keep its semantics consistent.
def bitwise_built_ins(width, a, b): mask = (1 << width) - 1 print(f) def rotr(width, a, n): "Rotate a, n times to the right" if n < 0: return rotl(width, a, -n) elif n == 0: return a else: mask = (1 << width) - 1 a, n = a & mask, n % width return ((a >> n) | ((a & ((1 << n) - 1)) << (width - n))) def rotl(width, a, n): "Rotate a, n times to the left" if n < 0: return rotr(width, a, -n) elif n == 0: return a else: mask = (1 << width) - 1 a, n = a & mask, n % width return (((a << n) & mask) | (a >> (width - n))) def asr(width, a, n): "Arithmetic shift a, n times to the right. (sign preserving)." mask, top_bit_mask = ((1 << width) - 1), 1 << (width - 1) if n < 0: return (a << -n) & mask elif n == 0: return a elif n >= width: return mask if a & top_bit_mask else 0 else: a = a & mask if a & top_bit_mask: signs = (1 << n) - 1 return a >> n | (signs << width - n) else: return a >> n def helper_funcs(width, a): mask, top_bit_mask = ((1 << width) - 1), 1 << (width - 1) aa = a | top_bit_mask print(f) if __name__ == '__main__': bitwise_built_ins(8, 27, 125) helper_funcs(8, 27)
Debug.Print Hex(&HF0F0 And &HFF00) Debug.Print Hex(&HF0F0 Or &HFF00) Debug.Print Hex(&HF0F0 Xor &HFF00) Debug.Print Hex(Not &HF0F0) Debug.Print Hex(&HF0F0 Eqv &HFF00) Debug.Print Hex(&HF0F0 Imp &HFF00)
Convert this Python block to VB, preserving its control flow and logic.
l = 3 ints = 13 def setup(): size(700, 600) background(0, 0, 255) translate(150, 100) stroke(255) turn_left(l, ints) turn_right(l, ints) def turn_right(l, ints): if ints == 0: line(0, 0, 0, -l) translate(0, -l) else: turn_left(l, ints - 1) rotate(radians(90)) turn_right(l, ints - 1) def turn_left(l, ints): if ints == 0: line(0, 0, 0, -l) translate(0, -l) else: turn_left(l, ints - 1) rotate(radians(-90)) turn_right(l, ints - 1)
option explicit const pi180= 0.01745329251994329576923690768489 const pi=3.1415926535897932384626433832795 class turtle dim fso dim fn dim svg dim iang dim ori dim incr dim pdown dim clr dim x dim y public property let orient(n):ori = n*pi180 :end property public property let iangle(n):iang= n*pi180 :end property public sub pd() : pdown=true: end sub public sub pu() :pdown=FALSE :end sub public sub rt(i) ori=ori - i*iang: end sub public sub lt(i): ori=(ori + i*iang) end sub public sub bw(l) x= x+ cos(ori+pi)*l*incr y= y+ sin(ori+pi)*l*incr end sub public sub fw(l) dim x1,y1 x1=x + cos(ori)*l*incr y1=y + sin(ori)*l*incr if pdown then line x,y,x1,y1 x=x1:y=y1 end sub Private Sub Class_Initialize() setlocale "us" initsvg x=400:y=400:incr=100 ori=90*pi180 iang=90*pi180 clr=0 pdown=true end sub Private Sub Class_Terminate() disply end sub private sub line (x,y,x1,y1) svg.WriteLine "<line x1=""" & x & """ y1= """& y & """ x2=""" & x1& """ y2=""" & y1 & """/>" end sub private sub disply() dim shell svg.WriteLine "</svg></body></html>" svg.close Set shell = CreateObject("Shell.Application") shell.ShellExecute fn,1,False end sub private sub initsvg() dim scriptpath Set fso = CreateObject ("Scripting.Filesystemobject") ScriptPath= Left(WScript.ScriptFullName, InStrRev(WScript.ScriptFullName, "\")) fn=Scriptpath & "SIERP.HTML" Set svg = fso.CreateTextFile(fn,True) if SVG IS nothing then wscript.echo "Can svg.WriteLine "<!DOCTYPE html>" &vbcrlf & "<html>" &vbcrlf & "<head>" svg.writeline "<style>" & vbcrlf & "line {stroke:rgb(255,0,0);stroke-width:.5}" &vbcrlf &"</style>" svg.writeline "</head>"&vbcrlf & "<body>" svg.WriteLine "<svg xmlns=""http://www.w3.org/2000/svg"" width=""800"" height=""800"" viewBox=""0 0 800 800"">" end sub end class sub dragon(st,le,dir) if st=0 then x.fw le: exit sub x.rt dir dragon st-1, le/1.41421 ,1 x.rt dir*2 dragon st-1, le/1.41421 ,-1 x.rt dir end sub dim x set x=new turtle x.iangle=45 x.orient=45 x.incr=1 x.x=200:x.y=200 dragon 12,300,1 set x=nothing
Produce a functionally identical VB code for the snippet given in Python.
for line in lines open('input.txt'): print line
$Include "Rapidq.inc" dim file as qfilestream if file.open("c:\A Test.txt", fmOpenRead) then while not File.eof print File.readline wend else print "Cannot read file" end if input "Press enter to exit: ";a$
Write the same code in VB as shown below in Python.
def insert(anchor, new): new.next = anchor.next new.prev = anchor anchor.next.prev = new anchor.next = new
Public Sub Insert(ByVal a As Node(Of T), ByVal b As Node(Of T), ByVal c As T) Dim node As New Node(Of T)(value) a.Next = node node.Previous = a b.Previous = node node.Next = b End Sub
Change the following Python code into VB without altering its purpose.
import random def partition(vector, left, right, pivotIndex): pivotValue = vector[pivotIndex] vector[pivotIndex], vector[right] = vector[right], vector[pivotIndex] storeIndex = left for i in range(left, right): if vector[i] < pivotValue: vector[storeIndex], vector[i] = vector[i], vector[storeIndex] storeIndex += 1 vector[right], vector[storeIndex] = vector[storeIndex], vector[right] return storeIndex def _select(vector, left, right, k): "Returns the k-th smallest, (k >= 0), element of vector within vector[left:right+1] inclusive." while True: pivotIndex = random.randint(left, right) pivotNewIndex = partition(vector, left, right, pivotIndex) pivotDist = pivotNewIndex - left if pivotDist == k: return vector[pivotNewIndex] elif k < pivotDist: right = pivotNewIndex - 1 else: k -= pivotDist + 1 left = pivotNewIndex + 1 def select(vector, k, left=None, right=None): if left is None: left = 0 lv1 = len(vector) - 1 if right is None: right = lv1 assert vector and k >= 0, "Either null vector or k < 0 " assert 0 <= left <= lv1, "left is out of range" assert left <= right <= lv1, "right is out of range" return _select(vector, left, right, k) if __name__ == '__main__': v = [9, 8, 7, 6, 5, 0, 1, 2, 3, 4] print([select(v, i) for i in range(10)])
Dim s As Variant Private Function quick_select(ByRef s As Variant, k As Integer) As Integer Dim left As Integer, right As Integer, pos As Integer Dim pivotValue As Integer, tmp As Integer left = 1: right = UBound(s) Do While left < right pivotValue = s(k) tmp = s(k) s(k) = s(right) s(right) = tmp pos = left For i = left To right If s(i) < pivotValue Then tmp = s(i) s(i) = s(pos) s(pos) = tmp pos = pos + 1 End If Next i tmp = s(right) s(right) = s(pos) s(pos) = tmp If pos = k Then Exit Do End If If pos < k Then left = pos + 1 Else right = pos - 1 End If Loop quick_select = s(k) End Function Public Sub main() Dim r As Integer, i As Integer s = [{9, 8, 7, 6, 5, 0, 1, 2, 3, 4}] For i = 1 To 10 r = quick_select(s, i) Debug.Print IIf(i < 10, r & ", ", "" & r); Next i End Sub
Convert the following code from Python to VB, ensuring the logic remains intact.
i = int('1a',16)
Private Function to_base(ByVal number As Long, base As Integer) As String Dim digits As String, result As String Dim i As Integer, digit As Integer digits = "0123456789abcdefghijklmnopqrstuvwxyz" Do While number > 0 digit = number Mod base result = Mid(digits, digit + 1, 1) & result number = number \ base Loop to_base = result End Function Private Function from_base(number As String, base As Integer) As Long Dim digits As String, result As Long Dim i As Integer digits = "0123456789abcdefghijklmnopqrstuvwxyz" result = Val(InStr(1, digits, Mid(number, 1, 1), vbTextCompare) - 1) For i = 2 To Len(number) result = result * base + Val(InStr(1, digits, Mid(number, i, 1), vbTextCompare) - 1) Next i from_base = result End Function Public Sub Non_decimal_radices_Convert() Debug.Print "26 decimal in base 16 is: "; to_base(26, 16); ". Conversely, hexadecimal 1a in decimal is: "; from_base("1a", 16) End Sub
Produce a functionally identical VB code for the snippet given in Python.
i = int('1a',16)
Private Function to_base(ByVal number As Long, base As Integer) As String Dim digits As String, result As String Dim i As Integer, digit As Integer digits = "0123456789abcdefghijklmnopqrstuvwxyz" Do While number > 0 digit = number Mod base result = Mid(digits, digit + 1, 1) & result number = number \ base Loop to_base = result End Function Private Function from_base(number As String, base As Integer) As Long Dim digits As String, result As Long Dim i As Integer digits = "0123456789abcdefghijklmnopqrstuvwxyz" result = Val(InStr(1, digits, Mid(number, 1, 1), vbTextCompare) - 1) For i = 2 To Len(number) result = result * base + Val(InStr(1, digits, Mid(number, i, 1), vbTextCompare) - 1) Next i from_base = result End Function Public Sub Non_decimal_radices_Convert() Debug.Print "26 decimal in base 16 is: "; to_base(26, 16); ". Conversely, hexadecimal 1a in decimal is: "; from_base("1a", 16) End Sub
Write the same algorithm in VB as shown in this Python implementation.
from pathlib import Path for path in Path('.').rglob('*.*'): print(path)
Sub printFiles(parentDir As FolderItem, pattern As String) For i As Integer = 1 To parentDir.Count If parentDir.Item(i).Directory Then printFiles(parentDir.Item(i), pattern) Else Dim rg as New RegEx Dim myMatch as RegExMatch rg.SearchPattern = pattern myMatch = rg.search(parentDir.Item(i).Name) If myMatch <> Nil Then Print(parentDir.Item(i).AbsolutePath) End If Next End Sub
Rewrite this program in VB while keeping its functionality equivalent to the Python version.
>>> s = 'The quick brown fox jumps over the lazy dog' >>> import zlib >>> hex(zlib.crc32(s)) '0x414fa339' >>> import binascii >>> hex(binascii.crc32(s)) '0x414fa339'
dim crctbl(255) const crcc =&hEDB88320 sub gencrctable for i= 0 to 255 k=i for j=1 to 8 if k and 1 then k=(k and &h7fffffff)\2 or (&h40000000 and ((k and &h80000000)<>0)) k=k xor crcc else k=(k and &h7fffffff)\2 or (&h40000000 and ((k and &h80000000)<>0)) end if next crctbl(i)=k next end sub function crc32 (buf) dim r,r1,i r=&hffffffff for i=1 to len(buf) r1=(r and &h7fffffff)\&h100 or (&h800000 and (r and &h80000000)<>0) r=r1 xor crctbl((asc(mid(buf,i,1))xor r) and 255) next crc32=r xor &hffffffff end function gencrctable wscript.stdout.writeline hex(crc32("The quick brown fox jumps over the lazy dog"))
Change the programming language of this snippet from Python to VB without modifying what it does.
csvtxt = from cgi import escape def _row2tr(row, attr=None): cols = escape(row).split(',') return ('<TR>' + ''.join('<TD>%s</TD>' % data for data in cols) + '</TR>') def csv2html(txt): htmltxt = '<TABLE summary="csv2html program output">\n' for rownum, row in enumerate(txt.split('\n')): htmlrow = _row2tr(row) htmlrow = ' <TBODY>%s</TBODY>\n' % htmlrow htmltxt += htmlrow htmltxt += '</TABLE>\n' return htmltxt htmltxt = csv2html(csvtxt) print(htmltxt)
Public Sub CSV_TO_HTML() input_ = "Character,Speech\n" & _ "The multitude,The messiah! Show us the messiah!\n" & _ "Brians mother,<angry>Now you listen here! He "he "The multitude,Who are you?\n" & _ "Brians mother,I "The multitude,Behold his mother! Behold his mother!" Debug.Print "<table>" & vbCrLf & "<tr><td>" For i = 1 To Len(input_) Select Case Mid(input_, i, 1) Case "\" If Mid(input_, i + 1, 1) = "n" Then Debug.Print "</td></tr>" & vbCrLf & "<tr><td>"; i = i + 1 Else Debug.Print Mid(input_, i, 1); End If Case ",": Debug.Print "</td><td>"; Case "<": Debug.Print "&lt;"; Case ">": Debug.Print "&gt;"; Case "&": Debug.Print "&amp;"; Case Else: Debug.Print Mid(input_, i, 1); End Select Next i Debug.Print "</td></tr>" & vbCrLf & "</table>" End Sub
Write a version of this Python function in VB with identical behavior.
csvtxt = from cgi import escape def _row2tr(row, attr=None): cols = escape(row).split(',') return ('<TR>' + ''.join('<TD>%s</TD>' % data for data in cols) + '</TR>') def csv2html(txt): htmltxt = '<TABLE summary="csv2html program output">\n' for rownum, row in enumerate(txt.split('\n')): htmlrow = _row2tr(row) htmlrow = ' <TBODY>%s</TBODY>\n' % htmlrow htmltxt += htmlrow htmltxt += '</TABLE>\n' return htmltxt htmltxt = csv2html(csvtxt) print(htmltxt)
Public Sub CSV_TO_HTML() input_ = "Character,Speech\n" & _ "The multitude,The messiah! Show us the messiah!\n" & _ "Brians mother,<angry>Now you listen here! He "he "The multitude,Who are you?\n" & _ "Brians mother,I "The multitude,Behold his mother! Behold his mother!" Debug.Print "<table>" & vbCrLf & "<tr><td>" For i = 1 To Len(input_) Select Case Mid(input_, i, 1) Case "\" If Mid(input_, i + 1, 1) = "n" Then Debug.Print "</td></tr>" & vbCrLf & "<tr><td>"; i = i + 1 Else Debug.Print Mid(input_, i, 1); End If Case ",": Debug.Print "</td><td>"; Case "<": Debug.Print "&lt;"; Case ">": Debug.Print "&gt;"; Case "&": Debug.Print "&amp;"; Case Else: Debug.Print Mid(input_, i, 1); End Select Next i Debug.Print "</td></tr>" & vbCrLf & "</table>" End Sub
Write a version of this Python function in VB with identical behavior.
csvtxt = from cgi import escape def _row2tr(row, attr=None): cols = escape(row).split(',') return ('<TR>' + ''.join('<TD>%s</TD>' % data for data in cols) + '</TR>') def csv2html(txt): htmltxt = '<TABLE summary="csv2html program output">\n' for rownum, row in enumerate(txt.split('\n')): htmlrow = _row2tr(row) htmlrow = ' <TBODY>%s</TBODY>\n' % htmlrow htmltxt += htmlrow htmltxt += '</TABLE>\n' return htmltxt htmltxt = csv2html(csvtxt) print(htmltxt)
Public Sub CSV_TO_HTML() input_ = "Character,Speech\n" & _ "The multitude,The messiah! Show us the messiah!\n" & _ "Brians mother,<angry>Now you listen here! He "he "The multitude,Who are you?\n" & _ "Brians mother,I "The multitude,Behold his mother! Behold his mother!" Debug.Print "<table>" & vbCrLf & "<tr><td>" For i = 1 To Len(input_) Select Case Mid(input_, i, 1) Case "\" If Mid(input_, i + 1, 1) = "n" Then Debug.Print "</td></tr>" & vbCrLf & "<tr><td>"; i = i + 1 Else Debug.Print Mid(input_, i, 1); End If Case ",": Debug.Print "</td><td>"; Case "<": Debug.Print "&lt;"; Case ">": Debug.Print "&gt;"; Case "&": Debug.Print "&amp;"; Case Else: Debug.Print Mid(input_, i, 1); End Select Next i Debug.Print "</td></tr>" & vbCrLf & "</table>" End Sub
Convert this Python block to VB, preserving its control flow and logic.
class MyClass: name2 = 2 def __init__(self): self.name1 = 0 def someMethod(self): self.name1 = 1 MyClass.name2 = 3 myclass = MyClass() class MyOtherClass: count = 0 def __init__(self, name, gender="Male", age=None): MyOtherClass.count += 1 self.name = name self.gender = gender if age is not None: self.age = age def __del__(self): MyOtherClass.count -= 1 person1 = MyOtherClass("John") print person1.name, person1.gender print person1.age person2 = MyOtherClass("Jane", "Female", 23) print person2.name, person2.gender, person2.age
Class NumberContainer Private TheNumber As Integer Sub Constructor(InitialNumber As Integer) TheNumber = InitialNumber End Sub Function Number() As Integer Return TheNumber End Function Sub Number(Assigns NewNumber As Integer) TheNumber = NewNumber End Sub End Class
Produce a functionally identical VB code for the snippet given in Python.
class MyClass: name2 = 2 def __init__(self): self.name1 = 0 def someMethod(self): self.name1 = 1 MyClass.name2 = 3 myclass = MyClass() class MyOtherClass: count = 0 def __init__(self, name, gender="Male", age=None): MyOtherClass.count += 1 self.name = name self.gender = gender if age is not None: self.age = age def __del__(self): MyOtherClass.count -= 1 person1 = MyOtherClass("John") print person1.name, person1.gender print person1.age person2 = MyOtherClass("Jane", "Female", 23) print person2.name, person2.gender, person2.age
Class NumberContainer Private TheNumber As Integer Sub Constructor(InitialNumber As Integer) TheNumber = InitialNumber End Sub Function Number() As Integer Return TheNumber End Function Sub Number(Assigns NewNumber As Integer) TheNumber = NewNumber End Sub End Class
Translate the given Python code snippet into VB without altering its behavior.
>>> def k(n): n2 = str(n**2) for i in range(len(n2)): a, b = int(n2[:i] or 0), int(n2[i:]) if b and a + b == n: return n >>> [x for x in range(1,10000) if k(x)] [1, 9, 45, 55, 99, 297, 703, 999, 2223, 2728, 4879, 4950, 5050, 5292, 7272, 7777, 9999] >>> len([x for x in range(1,1000000) if k(x)]) 54 >>>
Module Module1 ReadOnly max As ULong = 1000000 Function Kaprekar(n As ULong) As Boolean If n = 1 Then Return True Dim sq = n * n Dim sq_str = Str(sq) Dim l = Len(sq_str) For x = l - 1 To 1 Step -1 If sq_str(x) = "0" Then l = l - 1 Else Exit For End If Next For x = 1 To l - 1 Dim p2 = Val(Mid(sq_str, x + 1)) If p2 > n Then Continue For End If Dim p1 = Val(Left(sq_str, x)) If p1 > n Then Return False If (p1 + p2) = n Then Return True Next Return False End Function Sub Main() Dim count = 0 Console.WriteLine("Kaprekar numbers below 10000") For n = 1 To max - 1 If Kaprekar(n) Then count = count + 1 If n < 10000 Then Console.WriteLine("{0,2} {1,4}", count, n) End If End If Next Console.WriteLine() Console.WriteLine("{0} numbers below {1} are kaprekar numbers", count, max) End Sub End Module
Translate this program into VB but keep the logic exactly as in Python.
>>> def k(n): n2 = str(n**2) for i in range(len(n2)): a, b = int(n2[:i] or 0), int(n2[i:]) if b and a + b == n: return n >>> [x for x in range(1,10000) if k(x)] [1, 9, 45, 55, 99, 297, 703, 999, 2223, 2728, 4879, 4950, 5050, 5292, 7272, 7777, 9999] >>> len([x for x in range(1,1000000) if k(x)]) 54 >>>
Module Module1 ReadOnly max As ULong = 1000000 Function Kaprekar(n As ULong) As Boolean If n = 1 Then Return True Dim sq = n * n Dim sq_str = Str(sq) Dim l = Len(sq_str) For x = l - 1 To 1 Step -1 If sq_str(x) = "0" Then l = l - 1 Else Exit For End If Next For x = 1 To l - 1 Dim p2 = Val(Mid(sq_str, x + 1)) If p2 > n Then Continue For End If Dim p1 = Val(Left(sq_str, x)) If p1 > n Then Return False If (p1 + p2) = n Then Return True Next Return False End Function Sub Main() Dim count = 0 Console.WriteLine("Kaprekar numbers below 10000") For n = 1 To max - 1 If Kaprekar(n) Then count = count + 1 If n < 10000 Then Console.WriteLine("{0,2} {1,4}", count, n) End If End If Next Console.WriteLine() Console.WriteLine("{0} numbers below {1} are kaprekar numbers", count, max) End Sub End Module
Change the programming language of this snippet from Python to VB without modifying what it does.
def compress(uncompressed): dict_size = 256 dictionary = dict((chr(i), i) for i in range(dict_size)) w = "" result = [] for c in uncompressed: wc = w + c if wc in dictionary: w = wc else: result.append(dictionary[w]) dictionary[wc] = dict_size dict_size += 1 w = c if w: result.append(dictionary[w]) return result def decompress(compressed): from io import StringIO dict_size = 256 dictionary = dict((i, chr(i)) for i in range(dict_size)) result = StringIO() w = chr(compressed.pop(0)) result.write(w) for k in compressed: if k in dictionary: entry = dictionary[k] elif k == dict_size: entry = w + w[0] else: raise ValueError('Bad compressed k: %s' % k) result.write(entry) dictionary[dict_size] = w + entry[0] dict_size += 1 w = entry return result.getvalue() compressed = compress('TOBEORNOTTOBEORTOBEORNOT') print (compressed) decompressed = decompress(compressed) print (decompressed)
Option Explicit Const numchars=127 Function LZWCompress(si) Dim oDict, intMaxCode, i,z,ii,ss,strCurrent,strNext,j Set oDict = CreateObject("Scripting.Dictionary") ReDim a(Len(si)) intMaxCode = numchars For i = 0 To numchars oDict.Add Chr(i), i Next strCurrent = Left(si,1) j=0 For ii=2 To Len(si) strNext = Mid(si,ii,1) ss=strCurrent & strNext If oDict.Exists(ss) Then strCurrent = ss Else a(j)=oDict.Item(strCurrent) :j=j+1 intMaxCode = intMaxCode + 1 oDict.Add ss, intMaxCode strCurrent = strNext End If Next a(j)=oDict.Item(strCurrent) ReDim preserve a(j) LZWCompress=a Set oDict = Nothing End Function Function lzwUncompress(sc) Dim intNext, intCurrent, intMaxCode, i,ss,istr,s,j s="" reDim dict(1000) intMaxCode = numchars For i = 0 To numchars : dict(i)= Chr(i) : Next intCurrent=sc(0) For j=1 To UBound(sc) ss=dict(intCurrent) s= s & ss intMaxCode = intMaxCode + 1 intnext=sc(j) If intNext<intMaxCode Then dict(intMaxCode)=ss & Left(dict(intNext), 1) Else dict(intMaxCode)=ss & Left(ss, 1) End If intCurrent = intNext Next s= s & dict(intCurrent) lzwUncompress=s End function Sub printvec(a) Dim s,i,x s="(" For i=0 To UBound (a) s=s & x & a(i) x=", " Next WScript.echo s &")" End sub Dim a,b b="TOBEORNOTTOBEORTOBEORNOT" WScript.Echo b a=LZWCompress (b) printvec(a) WScript.echo lzwUncompress (a ) wscript.quit 1
Transform the following Python implementation into VB, maintaining the same output and logic.
def ffr(n): if n < 1 or type(n) != int: raise ValueError("n must be an int >= 1") try: return ffr.r[n] except IndexError: r, s = ffr.r, ffs.s ffr_n_1 = ffr(n-1) lastr = r[-1] s += list(range(s[-1] + 1, lastr)) if s[-1] < lastr: s += [lastr + 1] len_s = len(s) ffs_n_1 = s[n-1] if len_s > n else (n - len_s) + s[-1] ans = ffr_n_1 + ffs_n_1 r.append(ans) return ans ffr.r = [None, 1] def ffs(n): if n < 1 or type(n) != int: raise ValueError("n must be an int >= 1") try: return ffs.s[n] except IndexError: r, s = ffr.r, ffs.s for i in range(len(r), n+2): ffr(i) if len(s) > n: return s[n] raise Exception("Whoops!") ffs.s = [None, 2] if __name__ == '__main__': first10 = [ffr(i) for i in range(1,11)] assert first10 == [1, 3, 7, 12, 18, 26, 35, 45, 56, 69], "ffr() value error(s)" print("ffr(n) for n = [1..10] is", first10) bin = [None] + [0]*1000 for i in range(40, 0, -1): bin[ffr(i)] += 1 for i in range(960, 0, -1): bin[ffs(i)] += 1 if all(b == 1 for b in bin[1:1000]): print("All Integers 1..1000 found OK") else: print("All Integers 1..1000 NOT found only once: ERROR")
Private Function ffr(n As Long) As Long Dim R As New Collection Dim S As New Collection R.Add 1 S.Add 2 For i = 2 To n R.Add R(i - 1) + S(i - 1) For j = S(S.Count) + 1 To R(i) - 1 S.Add j Next j For j = R(i) + 1 To R(i) + S(i - 1) S.Add j Next j Next i ffr = R(n) Set R = Nothing Set S = Nothing End Function Private Function ffs(n As Long) As Long Dim R As New Collection Dim S As New Collection R.Add 1 S.Add 2 For i = 2 To n R.Add R(i - 1) + S(i - 1) For j = S(S.Count) + 1 To R(i) - 1 S.Add j Next j For j = R(i) + 1 To R(i) + S(i - 1) S.Add j Next j If S.Count >= n Then Exit For Next i ffs = S(n) Set R = Nothing Set S = Nothing End Function Public Sub main() Dim i As Long Debug.Print "The first ten values of R are:" For i = 1 To 10 Debug.Print ffr(i); Next i Debug.Print Dim x As New Collection For i = 1 To 1000 x.Add i, CStr(i) Next i For i = 1 To 40 x.Remove CStr(ffr(i)) Next i For i = 1 To 960 x.Remove CStr(ffs(i)) Next i Debug.Print "The first 40 values of ffr plus the first 960 values of ffs " Debug.Print "include all the integers from 1 to 1000 exactly once is "; Format(x.Count = 0) End Sub
Convert the following code from Python to VB, ensuring the logic remains intact.
def ffr(n): if n < 1 or type(n) != int: raise ValueError("n must be an int >= 1") try: return ffr.r[n] except IndexError: r, s = ffr.r, ffs.s ffr_n_1 = ffr(n-1) lastr = r[-1] s += list(range(s[-1] + 1, lastr)) if s[-1] < lastr: s += [lastr + 1] len_s = len(s) ffs_n_1 = s[n-1] if len_s > n else (n - len_s) + s[-1] ans = ffr_n_1 + ffs_n_1 r.append(ans) return ans ffr.r = [None, 1] def ffs(n): if n < 1 or type(n) != int: raise ValueError("n must be an int >= 1") try: return ffs.s[n] except IndexError: r, s = ffr.r, ffs.s for i in range(len(r), n+2): ffr(i) if len(s) > n: return s[n] raise Exception("Whoops!") ffs.s = [None, 2] if __name__ == '__main__': first10 = [ffr(i) for i in range(1,11)] assert first10 == [1, 3, 7, 12, 18, 26, 35, 45, 56, 69], "ffr() value error(s)" print("ffr(n) for n = [1..10] is", first10) bin = [None] + [0]*1000 for i in range(40, 0, -1): bin[ffr(i)] += 1 for i in range(960, 0, -1): bin[ffs(i)] += 1 if all(b == 1 for b in bin[1:1000]): print("All Integers 1..1000 found OK") else: print("All Integers 1..1000 NOT found only once: ERROR")
Private Function ffr(n As Long) As Long Dim R As New Collection Dim S As New Collection R.Add 1 S.Add 2 For i = 2 To n R.Add R(i - 1) + S(i - 1) For j = S(S.Count) + 1 To R(i) - 1 S.Add j Next j For j = R(i) + 1 To R(i) + S(i - 1) S.Add j Next j Next i ffr = R(n) Set R = Nothing Set S = Nothing End Function Private Function ffs(n As Long) As Long Dim R As New Collection Dim S As New Collection R.Add 1 S.Add 2 For i = 2 To n R.Add R(i - 1) + S(i - 1) For j = S(S.Count) + 1 To R(i) - 1 S.Add j Next j For j = R(i) + 1 To R(i) + S(i - 1) S.Add j Next j If S.Count >= n Then Exit For Next i ffs = S(n) Set R = Nothing Set S = Nothing End Function Public Sub main() Dim i As Long Debug.Print "The first ten values of R are:" For i = 1 To 10 Debug.Print ffr(i); Next i Debug.Print Dim x As New Collection For i = 1 To 1000 x.Add i, CStr(i) Next i For i = 1 To 40 x.Remove CStr(ffr(i)) Next i For i = 1 To 960 x.Remove CStr(ffs(i)) Next i Debug.Print "The first 40 values of ffr plus the first 960 values of ffs " Debug.Print "include all the integers from 1 to 1000 exactly once is "; Format(x.Count = 0) End Sub
Rewrite this program in VB while keeping its functionality equivalent to the Python version.
>>> def magic(n): for row in range(1, n + 1): print(' '.join('%*i' % (len(str(n**2)), cell) for cell in (n * ((row + col - 1 + n // 2) % n) + ((row + 2 * col - 2) % n) + 1 for col in range(1, n + 1)))) print('\nAll sum to magic number %i' % ((n * n + 1) * n // 2)) >>> for n in (5, 3, 7): print('\nOrder %i\n=======' % n) magic(n) Order 5 ======= 17 24 1 8 15 23 5 7 14 16 4 6 13 20 22 10 12 19 21 3 11 18 25 2 9 All sum to magic number 65 Order 3 ======= 8 1 6 3 5 7 4 9 2 All sum to magic number 15 Order 7 ======= 30 39 48 1 10 19 28 38 47 7 9 18 27 29 46 6 8 17 26 35 37 5 14 16 25 34 36 45 13 15 24 33 42 44 4 21 23 32 41 43 3 12 22 31 40 49 2 11 20 All sum to magic number 175 >>>
Sub magicsquare() Const n = 9 Dim i As Integer, j As Integer, v As Integer Debug.Print "The square order is: " & n For i = 1 To n For j = 1 To n Cells(i, j) = ((i * 2 - j + n - 1) Mod n) * n + ((i * 2 + j - 2) Mod n) + 1 Next j Next i Debug.Print "The magic number of"; n; "x"; n; "square is:"; n * (n * n + 1) \ 2 End Sub
Write the same algorithm in VB as shown in this Python implementation.
>>> def magic(n): for row in range(1, n + 1): print(' '.join('%*i' % (len(str(n**2)), cell) for cell in (n * ((row + col - 1 + n // 2) % n) + ((row + 2 * col - 2) % n) + 1 for col in range(1, n + 1)))) print('\nAll sum to magic number %i' % ((n * n + 1) * n // 2)) >>> for n in (5, 3, 7): print('\nOrder %i\n=======' % n) magic(n) Order 5 ======= 17 24 1 8 15 23 5 7 14 16 4 6 13 20 22 10 12 19 21 3 11 18 25 2 9 All sum to magic number 65 Order 3 ======= 8 1 6 3 5 7 4 9 2 All sum to magic number 15 Order 7 ======= 30 39 48 1 10 19 28 38 47 7 9 18 27 29 46 6 8 17 26 35 37 5 14 16 25 34 36 45 13 15 24 33 42 44 4 21 23 32 41 43 3 12 22 31 40 49 2 11 20 All sum to magic number 175 >>>
Sub magicsquare() Const n = 9 Dim i As Integer, j As Integer, v As Integer Debug.Print "The square order is: " & n For i = 1 To n For j = 1 To n Cells(i, j) = ((i * 2 - j + n - 1) Mod n) * n + ((i * 2 + j - 2) Mod n) + 1 Next j Next i Debug.Print "The magic number of"; n; "x"; n; "square is:"; n * (n * n + 1) \ 2 End Sub
Convert this Python snippet to VB and keep its semantics consistent.
from __future__ import division from itertools import islice, count from collections import Counter from math import log10 from random import randint expected = [log10(1+1/d) for d in range(1,10)] def fib(): a,b = 1,1 while True: yield a a,b = b,a+b def power_of_threes(): return (3**k for k in count(0)) def heads(s): for a in s: yield int(str(a)[0]) def show_dist(title, s): c = Counter(s) size = sum(c.values()) res = [c[d]/size for d in range(1,10)] print("\n%s Benfords deviation" % title) for r, e in zip(res, expected): print("%5.1f%% %5.1f%% %5.1f%%" % (r*100., e*100., abs(r - e)*100.)) def rand1000(): while True: yield randint(1,9999) if __name__ == '__main__': show_dist("fibbed", islice(heads(fib()), 1000)) show_dist("threes", islice(heads(power_of_threes()), 1000)) show_dist("random", islice(heads(rand1000()), 10000))
Sub BenfordLaw() Dim BenResult(1 To 9) As Long BENref = "30,1%|17,6%|12,5%|9,7%|7,9%|6,7%|5,8%|5,1%|4,6%" For Each c In Selection.Cells If InStr(1, "-0123456789", Left(c, 1)) > 0 Then For i = 1 To 9 If CInt(Left(Abs(c), 1)) = i Then BenResult(i) = BenResult(i) + 1: Exit For Next End If Next Total= Application.Sum(BenResult) biggest= Len(CStr(BenResult(1))) txt = "# | Values | Real | Expected " & vbCrLf For i = 1 To 9 If BenResult(i) > 0 Then txt = txt & "#" & i & " | " & vbTab txt = txt & String((biggest - Len(CStr(BenResult(i)))) * 2, " ") & Format(BenResult(i), "0") & " | " & vbTab txt = txt & String((Len(CStr(Format(BenResult(1) / Total, "##0.0%"))) - Len(CStr(Format(BenResult(i) / Total, "##0.0%")))) * 2, " ") & Format(BenResult(i) / Total, "##0.0%") & " | " & vbTab txt = txt & Format(Split(BENref, "|")(i - 1), " ##0.0%") & vbCrLf End If Next MsgBox txt, vbOKOnly, "Finish" End Sub }
Rewrite this program in VB while keeping its functionality equivalent to the Python version.
from __future__ import division from itertools import islice, count from collections import Counter from math import log10 from random import randint expected = [log10(1+1/d) for d in range(1,10)] def fib(): a,b = 1,1 while True: yield a a,b = b,a+b def power_of_threes(): return (3**k for k in count(0)) def heads(s): for a in s: yield int(str(a)[0]) def show_dist(title, s): c = Counter(s) size = sum(c.values()) res = [c[d]/size for d in range(1,10)] print("\n%s Benfords deviation" % title) for r, e in zip(res, expected): print("%5.1f%% %5.1f%% %5.1f%%" % (r*100., e*100., abs(r - e)*100.)) def rand1000(): while True: yield randint(1,9999) if __name__ == '__main__': show_dist("fibbed", islice(heads(fib()), 1000)) show_dist("threes", islice(heads(power_of_threes()), 1000)) show_dist("random", islice(heads(rand1000()), 10000))
Sub BenfordLaw() Dim BenResult(1 To 9) As Long BENref = "30,1%|17,6%|12,5%|9,7%|7,9%|6,7%|5,8%|5,1%|4,6%" For Each c In Selection.Cells If InStr(1, "-0123456789", Left(c, 1)) > 0 Then For i = 1 To 9 If CInt(Left(Abs(c), 1)) = i Then BenResult(i) = BenResult(i) + 1: Exit For Next End If Next Total= Application.Sum(BenResult) biggest= Len(CStr(BenResult(1))) txt = "# | Values | Real | Expected " & vbCrLf For i = 1 To 9 If BenResult(i) > 0 Then txt = txt & "#" & i & " | " & vbTab txt = txt & String((biggest - Len(CStr(BenResult(i)))) * 2, " ") & Format(BenResult(i), "0") & " | " & vbTab txt = txt & String((Len(CStr(Format(BenResult(1) / Total, "##0.0%"))) - Len(CStr(Format(BenResult(i) / Total, "##0.0%")))) * 2, " ") & Format(BenResult(i) / Total, "##0.0%") & " | " & vbTab txt = txt & Format(Split(BENref, "|")(i - 1), " ##0.0%") & vbCrLf End If Next MsgBox txt, vbOKOnly, "Finish" End Sub }
Preserve the algorithm and functionality while converting the code from Python to VB.
>>> Y = lambda f: (lambda x: x(x))(lambda y: f(lambda *args: y(y)(*args))) >>> fib = lambda f: lambda n: None if n < 0 else (0 if n == 0 else (1 if n == 1 else f(n-1) + f(n-2))) >>> [ Y(fib)(i) for i in range(-2, 10) ] [None, None, 0, 1, 1, 2, 3, 5, 8, 13, 21, 34]
Sub Main() Debug.Print F(-10) Debug.Print F(10) End Sub Private Function F(N As Long) As Variant If N < 0 Then F = "Error. Negative argument" ElseIf N <= 1 Then F = N Else F = F(N - 1) + F(N - 2) End If End Function
Can you help me rewrite this code in VB instead of Python, keeping it the same logically?
print "knight"[1:] print "socks"[:-1] print "brooms"[1:-1]
string = "Small Basic" TextWindow.WriteLine(Text.GetSubTextToEnd(string, 2)) TextWindow.WriteLine(Text.GetSubText(string, 1, Text.GetLength(string) - 1)) TextWindow.WriteLine(Text.GetSubText(string, 2, Text.GetLength(string) - 2))
Write the same code in VB as shown below in Python.
print "knight"[1:] print "socks"[:-1] print "brooms"[1:-1]
string = "Small Basic" TextWindow.WriteLine(Text.GetSubTextToEnd(string, 2)) TextWindow.WriteLine(Text.GetSubText(string, 1, Text.GetLength(string) - 1)) TextWindow.WriteLine(Text.GetSubText(string, 2, Text.GetLength(string) - 2))
Convert the following code from Python to VB, ensuring the logic remains intact.
import fileinput def longer(a, b): try: b[len(a)-1] return False except: return True longest, lines = '', '' for x in fileinput.input(): if longer(x, longest): lines, longest = x, x elif not longer(longest, x): lines += x print(lines, end='')
Set objfso = CreateObject("Scripting.FileSystemObject") Set objfile = objfso.OpenTextFile(objfso.GetParentFolderName(WScript.ScriptFullName) &_ "\input.txt",1) list = "" previous_line = "" l = Len(previous_line) Do Until objfile.AtEndOfStream current_line = objfile.ReadLine If Mid(current_line,l+1,1) <> "" Then list = current_line & vbCrLf previous_line = current_line l = Len(previous_line) ElseIf Mid(current_line,l,1) <> "" And Mid(current_line,(l+1),1) = "" Then list = list & current_line & vbCrLf End If Loop WScript.Echo list objfile.Close Set objfso = Nothing
Produce a functionally identical VB code for the snippet given in Python.
import fileinput def longer(a, b): try: b[len(a)-1] return False except: return True longest, lines = '', '' for x in fileinput.input(): if longer(x, longest): lines, longest = x, x elif not longer(longest, x): lines += x print(lines, end='')
Set objfso = CreateObject("Scripting.FileSystemObject") Set objfile = objfso.OpenTextFile(objfso.GetParentFolderName(WScript.ScriptFullName) &_ "\input.txt",1) list = "" previous_line = "" l = Len(previous_line) Do Until objfile.AtEndOfStream current_line = objfile.ReadLine If Mid(current_line,l+1,1) <> "" Then list = current_line & vbCrLf previous_line = current_line l = Len(previous_line) ElseIf Mid(current_line,l,1) <> "" And Mid(current_line,(l+1),1) = "" Then list = list & current_line & vbCrLf End If Loop WScript.Echo list objfile.Close Set objfso = Nothing
Convert this Python snippet to VB and keep its semantics consistent.
from __future__ import print_function def run_utm( state = None, blank = None, rules = [], tape = [], halt = None, pos = 0): st = state if not tape: tape = [blank] if pos < 0: pos += len(tape) if pos >= len(tape) or pos < 0: raise Error( "bad init position") rules = dict(((s0, v0), (v1, dr, s1)) for (s0, v0, v1, dr, s1) in rules) while True: print(st, '\t', end=" ") for i, v in enumerate(tape): if i == pos: print("[%s]" % (v,), end=" ") else: print(v, end=" ") print() if st == halt: break if (st, tape[pos]) not in rules: break (v1, dr, s1) = rules[(st, tape[pos])] tape[pos] = v1 if dr == 'left': if pos > 0: pos -= 1 else: tape.insert(0, blank) if dr == 'right': pos += 1 if pos >= len(tape): tape.append(blank) st = s1 print("incr machine\n") run_utm( halt = 'qf', state = 'q0', tape = list("111"), blank = 'B', rules = map(tuple, ["q0 1 1 right q0".split(), "q0 B 1 stay qf".split()] ) ) print("\nbusy beaver\n") run_utm( halt = 'halt', state = 'a', blank = '0', rules = map(tuple, ["a 0 1 right b".split(), "a 1 1 left c".split(), "b 0 1 left a".split(), "b 1 1 right b".split(), "c 0 1 left b".split(), "c 1 1 stay halt".split()] ) ) print("\nsorting test\n") run_utm(halt = 'STOP', state = 'A', blank = '0', tape = "2 2 2 1 2 2 1 2 1 2 1 2 1 2".split(), rules = map(tuple, ["A 1 1 right A".split(), "A 2 3 right B".split(), "A 0 0 left E".split(), "B 1 1 right B".split(), "B 2 2 right B".split(), "B 0 0 left C".split(), "C 1 2 left D".split(), "C 2 2 left C".split(), "C 3 2 left E".split(), "D 1 1 left D".split(), "D 2 2 left D".split(), "D 3 1 right A".split(), "E 1 1 left E".split(), "E 0 0 right STOP".split()] ) )
Option Base 1 Public Enum sett name_ = 1 initState endState blank rules End Enum Public incrementer As Variant, threeStateBB As Variant, fiveStateBB As Variant Private Sub init() incrementer = Array("Simple incrementer", _ "q0", _ "qf", _ "B", _ Array( _ Array("q0", "1", "1", "right", "q0"), _ Array("q0", "B", "1", "stay", "qf"))) threeStateBB = Array("Three-state busy beaver", _ "a", _ "halt", _ "0", _ Array( _ Array("a", "0", "1", "right", "b"), _ Array("a", "1", "1", "left", "c"), _ Array("b", "0", "1", "left", "a"), _ Array("b", "1", "1", "right", "b"), _ Array("c", "0", "1", "left", "b"), _ Array("c", "1", "1", "stay", "halt"))) fiveStateBB = Array("Five-state busy beaver", _ "A", _ "H", _ "0", _ Array( _ Array("A", "0", "1", "right", "B"), _ Array("A", "1", "1", "left", "C"), _ Array("B", "0", "1", "right", "C"), _ Array("B", "1", "1", "right", "B"), _ Array("C", "0", "1", "right", "D"), _ Array("C", "1", "0", "left", "E"), _ Array("D", "0", "1", "left", "A"), _ Array("D", "1", "1", "left", "D"), _ Array("E", "0", "1", "stay", "H"), _ Array("E", "1", "0", "left", "A"))) End Sub Private Sub show(state As String, headpos As Long, tape As Collection) Debug.Print " "; state; String$(7 - Len(state), " "); "| "; For p = 1 To tape.Count Debug.Print IIf(p = headpos, "[" & tape(p) & "]", " " & tape(p) & " "); Next p Debug.Print End Sub Private Sub UTM(machine As Variant, tape As Collection, Optional countOnly As Long = 0) Dim state As String: state = machine(initState) Dim headpos As Long: headpos = 1 Dim counter As Long, rule As Variant Debug.Print machine(name_); vbCrLf; String$(Len(machine(name_)), "=") If Not countOnly Then Debug.Print " State | Tape [head]" & vbCrLf & "---------------------" Do While True If headpos > tape.Count Then tape.Add machine(blank) Else If headpos < 1 Then tape.Add machine(blank), Before:=1 headpos = 1 End If End If If Not countOnly Then show state, headpos, tape For i = LBound(machine(rules)) To UBound(machine(rules)) rule = machine(rules)(i) If rule(1) = state And rule(2) = tape(headpos) Then tape.Remove headpos If headpos > tape.Count Then tape.Add rule(3) Else tape.Add rule(3), Before:=headpos End If If rule(4) = "left" Then headpos = headpos - 1 If rule(4) = "right" Then headpos = headpos + 1 state = rule(5) Exit For End If Next i counter = counter + 1 If counter Mod 100000 = 0 Then Debug.Print counter DoEvents DoEvents End If If state = machine(endState) Then Exit Do Loop DoEvents If countOnly Then Debug.Print "Steps taken: ", counter Else show state, headpos, tape Debug.Print End If End Sub Public Sub main() init Dim tap As New Collection tap.Add "1": tap.Add "1": tap.Add "1" UTM incrementer, tap Set tap = New Collection UTM threeStateBB, tap Set tap = New Collection UTM fiveStateBB, tap, countOnly:=-1 End Sub
Port the following code from Python to VB with equivalent syntax and logic.
from __future__ import print_function def run_utm( state = None, blank = None, rules = [], tape = [], halt = None, pos = 0): st = state if not tape: tape = [blank] if pos < 0: pos += len(tape) if pos >= len(tape) or pos < 0: raise Error( "bad init position") rules = dict(((s0, v0), (v1, dr, s1)) for (s0, v0, v1, dr, s1) in rules) while True: print(st, '\t', end=" ") for i, v in enumerate(tape): if i == pos: print("[%s]" % (v,), end=" ") else: print(v, end=" ") print() if st == halt: break if (st, tape[pos]) not in rules: break (v1, dr, s1) = rules[(st, tape[pos])] tape[pos] = v1 if dr == 'left': if pos > 0: pos -= 1 else: tape.insert(0, blank) if dr == 'right': pos += 1 if pos >= len(tape): tape.append(blank) st = s1 print("incr machine\n") run_utm( halt = 'qf', state = 'q0', tape = list("111"), blank = 'B', rules = map(tuple, ["q0 1 1 right q0".split(), "q0 B 1 stay qf".split()] ) ) print("\nbusy beaver\n") run_utm( halt = 'halt', state = 'a', blank = '0', rules = map(tuple, ["a 0 1 right b".split(), "a 1 1 left c".split(), "b 0 1 left a".split(), "b 1 1 right b".split(), "c 0 1 left b".split(), "c 1 1 stay halt".split()] ) ) print("\nsorting test\n") run_utm(halt = 'STOP', state = 'A', blank = '0', tape = "2 2 2 1 2 2 1 2 1 2 1 2 1 2".split(), rules = map(tuple, ["A 1 1 right A".split(), "A 2 3 right B".split(), "A 0 0 left E".split(), "B 1 1 right B".split(), "B 2 2 right B".split(), "B 0 0 left C".split(), "C 1 2 left D".split(), "C 2 2 left C".split(), "C 3 2 left E".split(), "D 1 1 left D".split(), "D 2 2 left D".split(), "D 3 1 right A".split(), "E 1 1 left E".split(), "E 0 0 right STOP".split()] ) )
Option Base 1 Public Enum sett name_ = 1 initState endState blank rules End Enum Public incrementer As Variant, threeStateBB As Variant, fiveStateBB As Variant Private Sub init() incrementer = Array("Simple incrementer", _ "q0", _ "qf", _ "B", _ Array( _ Array("q0", "1", "1", "right", "q0"), _ Array("q0", "B", "1", "stay", "qf"))) threeStateBB = Array("Three-state busy beaver", _ "a", _ "halt", _ "0", _ Array( _ Array("a", "0", "1", "right", "b"), _ Array("a", "1", "1", "left", "c"), _ Array("b", "0", "1", "left", "a"), _ Array("b", "1", "1", "right", "b"), _ Array("c", "0", "1", "left", "b"), _ Array("c", "1", "1", "stay", "halt"))) fiveStateBB = Array("Five-state busy beaver", _ "A", _ "H", _ "0", _ Array( _ Array("A", "0", "1", "right", "B"), _ Array("A", "1", "1", "left", "C"), _ Array("B", "0", "1", "right", "C"), _ Array("B", "1", "1", "right", "B"), _ Array("C", "0", "1", "right", "D"), _ Array("C", "1", "0", "left", "E"), _ Array("D", "0", "1", "left", "A"), _ Array("D", "1", "1", "left", "D"), _ Array("E", "0", "1", "stay", "H"), _ Array("E", "1", "0", "left", "A"))) End Sub Private Sub show(state As String, headpos As Long, tape As Collection) Debug.Print " "; state; String$(7 - Len(state), " "); "| "; For p = 1 To tape.Count Debug.Print IIf(p = headpos, "[" & tape(p) & "]", " " & tape(p) & " "); Next p Debug.Print End Sub Private Sub UTM(machine As Variant, tape As Collection, Optional countOnly As Long = 0) Dim state As String: state = machine(initState) Dim headpos As Long: headpos = 1 Dim counter As Long, rule As Variant Debug.Print machine(name_); vbCrLf; String$(Len(machine(name_)), "=") If Not countOnly Then Debug.Print " State | Tape [head]" & vbCrLf & "---------------------" Do While True If headpos > tape.Count Then tape.Add machine(blank) Else If headpos < 1 Then tape.Add machine(blank), Before:=1 headpos = 1 End If End If If Not countOnly Then show state, headpos, tape For i = LBound(machine(rules)) To UBound(machine(rules)) rule = machine(rules)(i) If rule(1) = state And rule(2) = tape(headpos) Then tape.Remove headpos If headpos > tape.Count Then tape.Add rule(3) Else tape.Add rule(3), Before:=headpos End If If rule(4) = "left" Then headpos = headpos - 1 If rule(4) = "right" Then headpos = headpos + 1 state = rule(5) Exit For End If Next i counter = counter + 1 If counter Mod 100000 = 0 Then Debug.Print counter DoEvents DoEvents End If If state = machine(endState) Then Exit Do Loop DoEvents If countOnly Then Debug.Print "Steps taken: ", counter Else show state, headpos, tape Debug.Print End If End Sub Public Sub main() init Dim tap As New Collection tap.Add "1": tap.Add "1": tap.Add "1" UTM incrementer, tap Set tap = New Collection UTM threeStateBB, tap Set tap = New Collection UTM fiveStateBB, tap, countOnly:=-1 End Sub
Transform the following Python implementation into VB, maintaining the same output and logic.
import os for directory in ['/', './']: open(directory + 'output.txt', 'w').close() os.mkdir(directory + 'docs')
Public Sub create_file() Dim FileNumber As Integer FileNumber = FreeFile MkDir "docs" Open "docs\output.txt" For Output As #FreeFile Close #FreeFile MkDir "C:\docs" Open "C:\docs\output.txt" For Output As #FreeFile Close #FreeFile End Sub
Write a version of this Python function in VB with identical behavior.
from collections import Counter def basecount(dna): return sorted(Counter(dna).items()) def seq_split(dna, n=50): return [dna[i: i+n] for i in range(0, len(dna), n)] def seq_pp(dna, n=50): for i, part in enumerate(seq_split(dna, n)): print(f"{i*n:>5}: {part}") print("\n BASECOUNT:") tot = 0 for base, count in basecount(dna): print(f" {base:>3}: {count}") tot += count base, count = 'TOT', tot print(f" {base:>3}= {count}") if __name__ == '__main__': print("SEQUENCE:") sequence = seq_pp(sequence)
b=_ "CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATG" &_ "CTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTG" &_ "AGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGAT" &_ "GGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT" &_ "CGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGG" &_ "TCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA" &_ "TTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTAT" &_ "CGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTG" &_ "TCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGAC" &_ "GACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT" s="SEQUENCE:" acnt=0:ccnt=0:gcnt=0:tcnt=0 for i=0 to len(b)-1 if (i mod 30)=0 then s = s & vbcrlf & right(" "& i+1,3)&": " if (i mod 5)=0 then s=s& " " m=mid(b,i+1,1) s=s & m select case m case "A":acnt=acnt+1 case "C":ccnt=ccnt+1 case "G":gcnt=gcnt+1 case "T":tcnt=tcnt+1 case else wscript.echo "error at ",i+1, m end select next wscript.echo s & vbcrlf wscript.echo "Count: A="&acnt & " C=" & ccnt & " G=" & gcnt & " T=" & tcnt
Write the same code in VB as shown below in Python.
from collections import Counter def basecount(dna): return sorted(Counter(dna).items()) def seq_split(dna, n=50): return [dna[i: i+n] for i in range(0, len(dna), n)] def seq_pp(dna, n=50): for i, part in enumerate(seq_split(dna, n)): print(f"{i*n:>5}: {part}") print("\n BASECOUNT:") tot = 0 for base, count in basecount(dna): print(f" {base:>3}: {count}") tot += count base, count = 'TOT', tot print(f" {base:>3}= {count}") if __name__ == '__main__': print("SEQUENCE:") sequence = seq_pp(sequence)
b=_ "CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATG" &_ "CTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTG" &_ "AGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGAT" &_ "GGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT" &_ "CGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGG" &_ "TCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA" &_ "TTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTAT" &_ "CGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTG" &_ "TCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGAC" &_ "GACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT" s="SEQUENCE:" acnt=0:ccnt=0:gcnt=0:tcnt=0 for i=0 to len(b)-1 if (i mod 30)=0 then s = s & vbcrlf & right(" "& i+1,3)&": " if (i mod 5)=0 then s=s& " " m=mid(b,i+1,1) s=s & m select case m case "A":acnt=acnt+1 case "C":ccnt=ccnt+1 case "G":gcnt=gcnt+1 case "T":tcnt=tcnt+1 case else wscript.echo "error at ",i+1, m end select next wscript.echo s & vbcrlf wscript.echo "Count: A="&acnt & " C=" & ccnt & " G=" & gcnt & " T=" & tcnt
Produce a language-to-language conversion: from Python to VB, same semantics.
from collections import Counter def basecount(dna): return sorted(Counter(dna).items()) def seq_split(dna, n=50): return [dna[i: i+n] for i in range(0, len(dna), n)] def seq_pp(dna, n=50): for i, part in enumerate(seq_split(dna, n)): print(f"{i*n:>5}: {part}") print("\n BASECOUNT:") tot = 0 for base, count in basecount(dna): print(f" {base:>3}: {count}") tot += count base, count = 'TOT', tot print(f" {base:>3}= {count}") if __name__ == '__main__': print("SEQUENCE:") sequence = seq_pp(sequence)
b=_ "CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATG" &_ "CTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTG" &_ "AGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGAT" &_ "GGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT" &_ "CGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGG" &_ "TCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA" &_ "TTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTAT" &_ "CGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTG" &_ "TCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGAC" &_ "GACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT" s="SEQUENCE:" acnt=0:ccnt=0:gcnt=0:tcnt=0 for i=0 to len(b)-1 if (i mod 30)=0 then s = s & vbcrlf & right(" "& i+1,3)&": " if (i mod 5)=0 then s=s& " " m=mid(b,i+1,1) s=s & m select case m case "A":acnt=acnt+1 case "C":ccnt=ccnt+1 case "G":gcnt=gcnt+1 case "T":tcnt=tcnt+1 case else wscript.echo "error at ",i+1, m end select next wscript.echo s & vbcrlf wscript.echo "Count: A="&acnt & " C=" & ccnt & " G=" & gcnt & " T=" & tcnt
Please provide an equivalent version of this Python code in VB.
import threading import random import time class Philosopher(threading.Thread): running = True def __init__(self, xname, forkOnLeft, forkOnRight): threading.Thread.__init__(self) self.name = xname self.forkOnLeft = forkOnLeft self.forkOnRight = forkOnRight def run(self): while(self.running): time.sleep( random.uniform(3,13)) print '%s is hungry.' % self.name self.dine() def dine(self): fork1, fork2 = self.forkOnLeft, self.forkOnRight while self.running: fork1.acquire(True) locked = fork2.acquire(False) if locked: break fork1.release() print '%s swaps forks' % self.name fork1, fork2 = fork2, fork1 else: return self.dining() fork2.release() fork1.release() def dining(self): print '%s starts eating '% self.name time.sleep(random.uniform(1,10)) print '%s finishes eating and leaves to think.' % self.name def DiningPhilosophers(): forks = [threading.Lock() for n in range(5)] philosopherNames = ('Aristotle','Kant','Spinoza','Marx', 'Russel') philosophers= [Philosopher(philosopherNames[i], forks[i%5], forks[(i+1)%5]) \ for i in range(5)] random.seed(507129) Philosopher.running = True for p in philosophers: p.start() time.sleep(100) Philosopher.running = False print ("Now we're finishing.") DiningPhilosophers()
Public Const HOLDON = False Public Const DIJKSTRASOLUTION = True Public Const X = 10 Public Const GETS = 0 Public Const PUTS = 1 Public Const EATS = 2 Public Const THKS = 5 Public Const FRSTFORK = 0 Public Const SCNDFORK = 1 Public Const SPAGHETI = 0 Public Const UNIVERSE = 1 Public Const MAXCOUNT = 100000 Public Const PHILOSOPHERS = 5 Public semaphore(PHILOSOPHERS - 1) As Integer Public positi0n(1, PHILOSOPHERS - 1) As Integer Public programcounter(PHILOSOPHERS - 1) As Long Public statistics(PHILOSOPHERS - 1, 5, 1) As Long Public names As Variant Private Sub init() names = [{"Aquinas","Babbage","Carroll","Derrida","Erasmus"}] For j = 0 To PHILOSOPHERS - 2 positi0n(0, j) = j + 1 positi0n(1, j) = j Next j If DIJKSTRASOLUTION Then positi0n(0, PHILOSOPHERS - 1) = j positi0n(1, PHILOSOPHERS - 1) = 0 Else positi0n(0, PHILOSOPHERS - 1) = 0 positi0n(1, PHILOSOPHERS - 1) = j End If End Sub Private Sub philosopher(subject As Integer, verb As Integer, objekt As Integer) statistics(subject, verb, objekt) = statistics(subject, verb, objekt) + 1 If verb < 2 Then If semaphore(positi0n(objekt, subject)) <> verb Then If Not HOLDON Then semaphore(positi0n(FRSTFORK, subject)) = 1 - objekt programcounter(subject) = 0 End If Else semaphore(positi0n(objekt, subject)) = 1 - verb programcounter(subject) = (programcounter(subject) + 1) Mod 6 End If Else programcounter(subject) = IIf(X * Rnd > 1, verb, verb + 1) Mod 6 End If End Sub Private Sub dine() Dim ph As Integer Do While TC < MAXCOUNT For ph = 0 To PHILOSOPHERS - 1 Select Case programcounter(ph) Case 0: philosopher ph, GETS, FRSTFORK Case 1: philosopher ph, GETS, SCNDFORK Case 2: philosopher ph, EATS, SPAGHETI Case 3: philosopher ph, PUTS, FRSTFORK Case 4: philosopher ph, PUTS, SCNDFORK Case 5: philosopher ph, THKS, UNIVERSE End Select TC = TC + 1 Next ph Loop End Sub Private Sub show() Debug.Print "Stats", "Gets", "Gets", "Eats", "Puts", "Puts", "Thinks" Debug.Print "", "First", "Second", "Spag-", "First", "Second", "About" Debug.Print "", "Fork", "Fork", "hetti", "Fork", "Fork", "Universe" For subject = 0 To PHILOSOPHERS - 1 Debug.Print names(subject + 1), For objekt = 0 To 1 Debug.Print statistics(subject, GETS, objekt), Next objekt Debug.Print statistics(subject, EATS, SPAGHETI), For objekt = 0 To 1 Debug.Print statistics(subject, PUTS, objekt), Next objekt Debug.Print statistics(subject, THKS, UNIVERSE) Next subject End Sub Public Sub main() init dine show End Sub
Translate this program into VB but keep the logic exactly as in Python.
fact = [1] for n in range(1, 12): fact.append(fact[n-1] * n) for b in range(9, 12+1): print(f"The factorions for base {b} are:") for i in range(1, 1500000): fact_sum = 0 j = i while j > 0: d = j % b fact_sum += fact[d] j = j//b if fact_sum == i: print(i, end=" ") print("\n")
Dim fact() nn1=9 : nn2=12 lim=1499999 ReDim fact(nn2) fact(0)=1 For i=1 To nn2 fact(i)=fact(i-1)*i Next For base=nn1 To nn2 list="" For i=1 To lim s=0 t=i Do While t<>0 d=t Mod base s=s+fact(d) t=t\base Loop If s=i Then list=list &" "& i Next Wscript.Echo "the factorions for base "& right(" "& base,2) &" are: "& list Next
Please provide an equivalent version of this Python code in VB.
fact = [1] for n in range(1, 12): fact.append(fact[n-1] * n) for b in range(9, 12+1): print(f"The factorions for base {b} are:") for i in range(1, 1500000): fact_sum = 0 j = i while j > 0: d = j % b fact_sum += fact[d] j = j//b if fact_sum == i: print(i, end=" ") print("\n")
Dim fact() nn1=9 : nn2=12 lim=1499999 ReDim fact(nn2) fact(0)=1 For i=1 To nn2 fact(i)=fact(i-1)*i Next For base=nn1 To nn2 list="" For i=1 To lim s=0 t=i Do While t<>0 d=t Mod base s=s+fact(d) t=t\base Loop If s=i Then list=list &" "& i Next Wscript.Echo "the factorions for base "& right(" "& base,2) &" are: "& list Next
Keep all operations the same but rewrite the snippet in VB.
command_table_text = \ user_words = "riG rePEAT copies put mo rest types fup. 6 poweRin" def find_abbreviations_length(command_table_text): command_table = dict() for word in command_table_text.split(): abbr_len = sum(1 for c in word if c.isupper()) if abbr_len == 0: abbr_len = len(word) command_table[word] = abbr_len return command_table def find_abbreviations(command_table): abbreviations = dict() for command, min_abbr_len in command_table.items(): for l in range(min_abbr_len, len(command)+1): abbr = command[:l].lower() abbreviations[abbr] = command.upper() return abbreviations def parse_user_string(user_string, abbreviations): user_words = [word.lower() for word in user_string.split()] commands = [abbreviations.get(user_word, "*error*") for user_word in user_words] return " ".join(commands) command_table = find_abbreviations_length(command_table_text) abbreviations_table = find_abbreviations(command_table) full_words = parse_user_string(user_words, abbreviations_table) print("user words:", user_words) print("full words:", full_words)
Private Function ValidateUserWords(userstring As String) As String Dim s As String Dim user_words() As String Dim command_table As Scripting.Dictionary Set command_table = New Scripting.Dictionary Dim abbreviations As Scripting.Dictionary Set abbreviations = New Scripting.Dictionary abbreviations.CompareMode = TextCompare Dim commandtable() As String Dim commands As String s = s & "Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy " s = s & "COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find " s = s & "NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput " s = s & "Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO " s = s & "MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT " s = s & "READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT " s = s & "RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up " commandtable = Split(s, " ") Dim i As Integer For Each word In commandtable If Len(word) > 0 Then i = 1 Do While Mid(word, i, 1) >= "A" And Mid(word, i, 1) <= "Z" i = i + 1 Loop command_table.Add Key:=word, Item:=i - 1 End If Next word For Each word In command_table For i = command_table(word) To Len(word) On Error Resume Next abbreviations.Add Key:=Left(word, i), Item:=UCase(word) Next i Next word user_words() = Split(userstring, " ") For Each word In user_words If Len(word) > 0 Then If abbreviations.exists(word) Then commands = commands & abbreviations(word) & " " Else commands = commands & "*error* " End If End If Next word ValidateUserWords = commands End Function Public Sub program() Dim guserstring As String guserstring = "riG rePEAT copies put mo rest types fup. 6 poweRin" Debug.Print "user words:", guserstring Debug.Print "full words:", ValidateUserWords(guserstring) End Sub
Preserve the algorithm and functionality while converting the code from Python to VB.
command_table_text = \ user_words = "riG rePEAT copies put mo rest types fup. 6 poweRin" def find_abbreviations_length(command_table_text): command_table = dict() for word in command_table_text.split(): abbr_len = sum(1 for c in word if c.isupper()) if abbr_len == 0: abbr_len = len(word) command_table[word] = abbr_len return command_table def find_abbreviations(command_table): abbreviations = dict() for command, min_abbr_len in command_table.items(): for l in range(min_abbr_len, len(command)+1): abbr = command[:l].lower() abbreviations[abbr] = command.upper() return abbreviations def parse_user_string(user_string, abbreviations): user_words = [word.lower() for word in user_string.split()] commands = [abbreviations.get(user_word, "*error*") for user_word in user_words] return " ".join(commands) command_table = find_abbreviations_length(command_table_text) abbreviations_table = find_abbreviations(command_table) full_words = parse_user_string(user_words, abbreviations_table) print("user words:", user_words) print("full words:", full_words)
Private Function ValidateUserWords(userstring As String) As String Dim s As String Dim user_words() As String Dim command_table As Scripting.Dictionary Set command_table = New Scripting.Dictionary Dim abbreviations As Scripting.Dictionary Set abbreviations = New Scripting.Dictionary abbreviations.CompareMode = TextCompare Dim commandtable() As String Dim commands As String s = s & "Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy " s = s & "COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find " s = s & "NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput " s = s & "Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO " s = s & "MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT " s = s & "READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT " s = s & "RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up " commandtable = Split(s, " ") Dim i As Integer For Each word In commandtable If Len(word) > 0 Then i = 1 Do While Mid(word, i, 1) >= "A" And Mid(word, i, 1) <= "Z" i = i + 1 Loop command_table.Add Key:=word, Item:=i - 1 End If Next word For Each word In command_table For i = command_table(word) To Len(word) On Error Resume Next abbreviations.Add Key:=Left(word, i), Item:=UCase(word) Next i Next word user_words() = Split(userstring, " ") For Each word In user_words If Len(word) > 0 Then If abbreviations.exists(word) Then commands = commands & abbreviations(word) & " " Else commands = commands & "*error* " End If End If Next word ValidateUserWords = commands End Function Public Sub program() Dim guserstring As String guserstring = "riG rePEAT copies put mo rest types fup. 6 poweRin" Debug.Print "user words:", guserstring Debug.Print "full words:", ValidateUserWords(guserstring) End Sub
Maintain the same structure and functionality when rewriting this code in VB.
import string sometext = .lower() lc2bin = {ch: '{:05b}'.format(i) for i, ch in enumerate(string.ascii_lowercase + ' .')} bin2lc = {val: key for key, val in lc2bin.items()} phrase = 'Rosetta code Bacon cipher example secret phrase to encode in the capitalisation of peter pan'.lower() def to_5binary(msg): return ( ch == '1' for ch in ''.join(lc2bin.get(ch, '') for ch in msg.lower())) def encrypt(message, text): bin5 = to_5binary(message) textlist = list(text.lower()) out = [] for capitalise in bin5: while textlist: ch = textlist.pop(0) if ch.isalpha(): if capitalise: ch = ch.upper() out.append(ch) break else: out.append(ch) else: raise Exception('ERROR: Ran out of characters in sometext') return ''.join(out) + '...' def decrypt(bacontext): binary = [] bin5 = [] out = [] for ch in bacontext: if ch.isalpha(): binary.append('1' if ch.isupper() else '0') if len(binary) == 5: bin5 = ''.join(binary) out.append(bin2lc[bin5]) binary = [] return ''.join(out) print('PLAINTEXT = \n%s\n' % phrase) encrypted = encrypt(phrase, sometext) print('ENCRYPTED = \n%s\n' % encrypted) decrypted = decrypt(encrypted) print('DECRYPTED = \n%s\n' % decrypted) assert phrase == decrypted, 'Round-tripping error'
Imports System.Text Module Module1 ReadOnly CODES As New Dictionary(Of Char, String) From { {"a", "AAAAA"}, {"b", "AAAAB"}, {"c", "AAABA"}, {"d", "AAABB"}, {"e", "AABAA"}, {"f", "AABAB"}, {"g", "AABBA"}, {"h", "AABBB"}, {"i", "ABAAA"}, {"j", "ABAAB"}, {"k", "ABABA"}, {"l", "ABABB"}, {"m", "ABBAA"}, {"n", "ABBAB"}, {"o", "ABBBA"}, {"p", "ABBBB"}, {"q", "BAAAA"}, {"r", "BAAAB"}, {"s", "BAABA"}, {"t", "BAABB"}, {"u", "BABAA"}, {"v", "BABAB"}, {"w", "BABBA"}, {"x", "BABBB"}, {"y", "BBAAA"}, {"z", "BBAAB"}, {" ", "BBBAA"} } Function Encode(plainText As String, message As String) As String Dim pt = plainText.ToLower() Dim sb As New StringBuilder() For Each c In pt If "a" <= c AndAlso c <= "z" Then sb.Append(CODES(c)) Else sb.Append(CODES(" ")) End If Next Dim et = sb.ToString() Dim mg = message.ToLower() sb.Length = 0 Dim count = 0 For Each c In mg If "a" <= c AndAlso c <= "z" Then If et(count) = "A" Then sb.Append(c) Else sb.Append(Chr(Asc(c) - 32)) End If count += 1 If count = et.Length Then Exit For End If Else sb.Append(c) End If Next Return sb.ToString() End Function Function Decode(message As String) As String Dim sb As New StringBuilder For Each c In message If "a" <= c AndAlso c <= "z" Then sb.Append("A") ElseIf "A" <= c AndAlso c <= "Z" Then sb.Append("B") End If Next Dim et = sb.ToString() sb.Length = 0 For index = 0 To et.Length - 1 Step 5 Dim quintet = et.Substring(index, 5) Dim key = CODES.Where(Function(a) a.Value = quintet).First().Key sb.Append(key) Next Return sb.ToString() End Function Sub Main() Dim plainText = "the quick brown fox jumps over the lazy dog" Dim message = "bacon "this task is to implement a program for encryption and decryption of " + "plaintext using the simple alphabet of the baconian cipher or some " + "other kind of representation of this alphabet (make anything signify anything). " + "the baconian alphabet may optionally be extended to encode all lower " + "case characters individually and/or adding a few punctuation characters " + "such as the space." Dim cipherText = Encode(plainText, message) Console.WriteLine("Cipher text ->" & Environment.NewLine & "{0}", cipherText) Dim decodedText = Decode(cipherText) Console.WriteLine(Environment.NewLine & "Hidden text ->" & Environment.NewLine & "{0}", decodedText) End Sub End Module
Change the following Python code into VB without altering its purpose.
import string sometext = .lower() lc2bin = {ch: '{:05b}'.format(i) for i, ch in enumerate(string.ascii_lowercase + ' .')} bin2lc = {val: key for key, val in lc2bin.items()} phrase = 'Rosetta code Bacon cipher example secret phrase to encode in the capitalisation of peter pan'.lower() def to_5binary(msg): return ( ch == '1' for ch in ''.join(lc2bin.get(ch, '') for ch in msg.lower())) def encrypt(message, text): bin5 = to_5binary(message) textlist = list(text.lower()) out = [] for capitalise in bin5: while textlist: ch = textlist.pop(0) if ch.isalpha(): if capitalise: ch = ch.upper() out.append(ch) break else: out.append(ch) else: raise Exception('ERROR: Ran out of characters in sometext') return ''.join(out) + '...' def decrypt(bacontext): binary = [] bin5 = [] out = [] for ch in bacontext: if ch.isalpha(): binary.append('1' if ch.isupper() else '0') if len(binary) == 5: bin5 = ''.join(binary) out.append(bin2lc[bin5]) binary = [] return ''.join(out) print('PLAINTEXT = \n%s\n' % phrase) encrypted = encrypt(phrase, sometext) print('ENCRYPTED = \n%s\n' % encrypted) decrypted = decrypt(encrypted) print('DECRYPTED = \n%s\n' % decrypted) assert phrase == decrypted, 'Round-tripping error'
Imports System.Text Module Module1 ReadOnly CODES As New Dictionary(Of Char, String) From { {"a", "AAAAA"}, {"b", "AAAAB"}, {"c", "AAABA"}, {"d", "AAABB"}, {"e", "AABAA"}, {"f", "AABAB"}, {"g", "AABBA"}, {"h", "AABBB"}, {"i", "ABAAA"}, {"j", "ABAAB"}, {"k", "ABABA"}, {"l", "ABABB"}, {"m", "ABBAA"}, {"n", "ABBAB"}, {"o", "ABBBA"}, {"p", "ABBBB"}, {"q", "BAAAA"}, {"r", "BAAAB"}, {"s", "BAABA"}, {"t", "BAABB"}, {"u", "BABAA"}, {"v", "BABAB"}, {"w", "BABBA"}, {"x", "BABBB"}, {"y", "BBAAA"}, {"z", "BBAAB"}, {" ", "BBBAA"} } Function Encode(plainText As String, message As String) As String Dim pt = plainText.ToLower() Dim sb As New StringBuilder() For Each c In pt If "a" <= c AndAlso c <= "z" Then sb.Append(CODES(c)) Else sb.Append(CODES(" ")) End If Next Dim et = sb.ToString() Dim mg = message.ToLower() sb.Length = 0 Dim count = 0 For Each c In mg If "a" <= c AndAlso c <= "z" Then If et(count) = "A" Then sb.Append(c) Else sb.Append(Chr(Asc(c) - 32)) End If count += 1 If count = et.Length Then Exit For End If Else sb.Append(c) End If Next Return sb.ToString() End Function Function Decode(message As String) As String Dim sb As New StringBuilder For Each c In message If "a" <= c AndAlso c <= "z" Then sb.Append("A") ElseIf "A" <= c AndAlso c <= "Z" Then sb.Append("B") End If Next Dim et = sb.ToString() sb.Length = 0 For index = 0 To et.Length - 1 Step 5 Dim quintet = et.Substring(index, 5) Dim key = CODES.Where(Function(a) a.Value = quintet).First().Key sb.Append(key) Next Return sb.ToString() End Function Sub Main() Dim plainText = "the quick brown fox jumps over the lazy dog" Dim message = "bacon "this task is to implement a program for encryption and decryption of " + "plaintext using the simple alphabet of the baconian cipher or some " + "other kind of representation of this alphabet (make anything signify anything). " + "the baconian alphabet may optionally be extended to encode all lower " + "case characters individually and/or adding a few punctuation characters " + "such as the space." Dim cipherText = Encode(plainText, message) Console.WriteLine("Cipher text ->" & Environment.NewLine & "{0}", cipherText) Dim decodedText = Decode(cipherText) Console.WriteLine(Environment.NewLine & "Hidden text ->" & Environment.NewLine & "{0}", decodedText) End Sub End Module
Port the following code from Python to VB with equivalent syntax and logic.
import string sometext = .lower() lc2bin = {ch: '{:05b}'.format(i) for i, ch in enumerate(string.ascii_lowercase + ' .')} bin2lc = {val: key for key, val in lc2bin.items()} phrase = 'Rosetta code Bacon cipher example secret phrase to encode in the capitalisation of peter pan'.lower() def to_5binary(msg): return ( ch == '1' for ch in ''.join(lc2bin.get(ch, '') for ch in msg.lower())) def encrypt(message, text): bin5 = to_5binary(message) textlist = list(text.lower()) out = [] for capitalise in bin5: while textlist: ch = textlist.pop(0) if ch.isalpha(): if capitalise: ch = ch.upper() out.append(ch) break else: out.append(ch) else: raise Exception('ERROR: Ran out of characters in sometext') return ''.join(out) + '...' def decrypt(bacontext): binary = [] bin5 = [] out = [] for ch in bacontext: if ch.isalpha(): binary.append('1' if ch.isupper() else '0') if len(binary) == 5: bin5 = ''.join(binary) out.append(bin2lc[bin5]) binary = [] return ''.join(out) print('PLAINTEXT = \n%s\n' % phrase) encrypted = encrypt(phrase, sometext) print('ENCRYPTED = \n%s\n' % encrypted) decrypted = decrypt(encrypted) print('DECRYPTED = \n%s\n' % decrypted) assert phrase == decrypted, 'Round-tripping error'
Imports System.Text Module Module1 ReadOnly CODES As New Dictionary(Of Char, String) From { {"a", "AAAAA"}, {"b", "AAAAB"}, {"c", "AAABA"}, {"d", "AAABB"}, {"e", "AABAA"}, {"f", "AABAB"}, {"g", "AABBA"}, {"h", "AABBB"}, {"i", "ABAAA"}, {"j", "ABAAB"}, {"k", "ABABA"}, {"l", "ABABB"}, {"m", "ABBAA"}, {"n", "ABBAB"}, {"o", "ABBBA"}, {"p", "ABBBB"}, {"q", "BAAAA"}, {"r", "BAAAB"}, {"s", "BAABA"}, {"t", "BAABB"}, {"u", "BABAA"}, {"v", "BABAB"}, {"w", "BABBA"}, {"x", "BABBB"}, {"y", "BBAAA"}, {"z", "BBAAB"}, {" ", "BBBAA"} } Function Encode(plainText As String, message As String) As String Dim pt = plainText.ToLower() Dim sb As New StringBuilder() For Each c In pt If "a" <= c AndAlso c <= "z" Then sb.Append(CODES(c)) Else sb.Append(CODES(" ")) End If Next Dim et = sb.ToString() Dim mg = message.ToLower() sb.Length = 0 Dim count = 0 For Each c In mg If "a" <= c AndAlso c <= "z" Then If et(count) = "A" Then sb.Append(c) Else sb.Append(Chr(Asc(c) - 32)) End If count += 1 If count = et.Length Then Exit For End If Else sb.Append(c) End If Next Return sb.ToString() End Function Function Decode(message As String) As String Dim sb As New StringBuilder For Each c In message If "a" <= c AndAlso c <= "z" Then sb.Append("A") ElseIf "A" <= c AndAlso c <= "Z" Then sb.Append("B") End If Next Dim et = sb.ToString() sb.Length = 0 For index = 0 To et.Length - 1 Step 5 Dim quintet = et.Substring(index, 5) Dim key = CODES.Where(Function(a) a.Value = quintet).First().Key sb.Append(key) Next Return sb.ToString() End Function Sub Main() Dim plainText = "the quick brown fox jumps over the lazy dog" Dim message = "bacon "this task is to implement a program for encryption and decryption of " + "plaintext using the simple alphabet of the baconian cipher or some " + "other kind of representation of this alphabet (make anything signify anything). " + "the baconian alphabet may optionally be extended to encode all lower " + "case characters individually and/or adding a few punctuation characters " + "such as the space." Dim cipherText = Encode(plainText, message) Console.WriteLine("Cipher text ->" & Environment.NewLine & "{0}", cipherText) Dim decodedText = Decode(cipherText) Console.WriteLine(Environment.NewLine & "Hidden text ->" & Environment.NewLine & "{0}", decodedText) End Sub End Module
Preserve the algorithm and functionality while converting the code from Python to VB.
def spiral(n): dx,dy = 1,0 x,y = 0,0 myarray = [[None]* n for j in range(n)] for i in xrange(n**2): myarray[x][y] = i nx,ny = x+dx, y+dy if 0<=nx<n and 0<=ny<n and myarray[nx][ny] == None: x,y = nx,ny else: dx,dy = -dy,dx x,y = x+dx, y+dy return myarray def printspiral(myarray): n = range(len(myarray)) for y in n: for x in n: print "%2i" % myarray[x][y], print printspiral(spiral(5))
Function build_spiral(n) botcol = 0 : topcol = n - 1 botrow = 0 : toprow = n - 1 Dim matrix() ReDim matrix(topcol,toprow) dir = 0 : col = 0 : row = 0 For i = 0 To n*n-1 matrix(col,row) = i Select Case dir Case 0 If col < topcol Then col = col + 1 Else dir = 1 : row = row + 1 : botrow = botrow + 1 End If Case 1 If row < toprow Then row = row + 1 Else dir = 2 : col = col - 1 : topcol = topcol - 1 End If Case 2 If col > botcol Then col = col - 1 Else dir = 3 : row = row - 1 : toprow = toprow - 1 End If Case 3 If row > botrow Then row = row - 1 Else dir = 0 : col = col + 1 : botcol = botcol + 1 End If End Select Next For y = 0 To n-1 For x = 0 To n-1 WScript.StdOut.Write matrix(x,y) & vbTab Next WScript.StdOut.WriteLine Next End Function build_spiral(CInt(WScript.Arguments(0)))
Produce a language-to-language conversion: from Python to VB, same semantics.
>>> def printtable(data): for row in data: print ' '.join('%-5s' % ('"%s"' % cell) for cell in row) >>> import operator >>> def sorttable(table, ordering=None, column=0, reverse=False): return sorted(table, cmp=ordering, key=operator.itemgetter(column), reverse=reverse) >>> data = [["a", "b", "c"], ["", "q", "z"], ["zap", "zip", "Zot"]] >>> printtable(data) "a" "b" "c" "" "q" "z" "zap" "zip" "Zot" >>> printtable( sorttable(data) ) "" "q" "z" "a" "b" "c" "zap" "zip" "Zot" >>> printtable( sorttable(data, column=2) ) "zap" "zip" "Zot" "a" "b" "c" "" "q" "z" >>> printtable( sorttable(data, column=1) ) "a" "b" "c" "" "q" "z" "zap" "zip" "Zot" >>> printtable( sorttable(data, column=1, reverse=True) ) "zap" "zip" "Zot" "" "q" "z" "a" "b" "c" >>> printtable( sorttable(data, ordering=lambda a,b: cmp(len(b),len(a))) ) "zap" "zip" "Zot" "a" "b" "c" "" "q" "z" >>>
Private Sub optional_parameters(theRange As String, _ Optional ordering As Integer = 0, _ Optional column As Integer = 1, _ Optional reverse As Integer = 1) ActiveSheet.Sort.SortFields.Clear ActiveSheet.Sort.SortFields.Add _ Key:=Range(theRange).Columns(column), _ SortOn:=SortOnValues, _ Order:=reverse, _ DataOption:=ordering With ActiveSheet.Sort .SetRange Range(theRange) .Header = xlGuess .MatchCase = False .Orientation = xlTopToBottom .SortMethod = xlPinYin .Apply End With End Sub Public Sub main() optional_parameters theRange:="A1:C4", ordering:=1, column:=2, reverse:=1 End Sub
Rewrite this program in VB while keeping its functionality equivalent to the Python version.
import ctypes libc = ctypes.CDLL("/lib/libc.so.6") libc.strcmp("abc", "def") libc.strcmp("hello", "hello")
Declare Function CreateFileW Lib "Kernel32" (FileName As WString, DesiredAccess As Integer, ShareMode As Integer, SecurityAttributes As Integer, _ CreateDisposition As Integer, Flags As Integer, Template As Integer) As Integer Declare Function WriteFile Lib "Kernel32" (fHandle As Integer, writeData As Ptr, numOfBytes As Integer, ByRef numOfBytesWritten As Integer, _ overlapped As Ptr) As Boolean Declare Function GetLastError Lib "Kernel32" () As Integer Declare Function CloseHandle Lib "kernel32" (hObject As Integer) As Boolean Const FILE_SHARE_READ = &h00000001 Const FILE_SHARE_WRITE = &h00000002 Const OPEN_EXISTING = 3 Dim fHandle As Integer = CreateFileW("C:\foo.txt", 0, FILE_SHARE_READ Or FILE_SHARE_WRITE, 0, OPEN_EXISTING, 0, 0) If fHandle > 0 Then Dim mb As MemoryBlock = "Hello, World!" Dim bytesWritten As Integer If Not WriteFile(fHandle, mb, mb.Size, bytesWritten, Nil) Then MsgBox("Error Number: " + Str(GetLastError)) End If Call CloseHandle(fHandle) Else MsgBox("Error Number: " + Str(GetLastError)) End If
Keep all operations the same but rewrite the snippet in VB.
from itertools import accumulate, chain, count, islice from fractions import Fraction def faulhaberTriangle(m): def go(rs, n): def f(x, y): return Fraction(n, x) * y xs = list(map(f, islice(count(2), m), rs)) return [Fraction(1 - sum(xs), 1)] + xs return list(accumulate( [[]] + list(islice(count(0), 1 + m)), go ))[1:] def faulhaberSum(p, n): def go(x, y): return y * (n ** x) return sum( map(go, count(1), faulhaberTriangle(p)[-1]) ) def main(): fs = faulhaberTriangle(9) print( fTable(__doc__ + ':\n')(str)( compose(concat)( fmap(showRatio(3)(3)) ) )( index(fs) )(range(0, len(fs))) ) print('') print( faulhaberSum(17, 1000) ) def fTable(s): def gox(xShow): def gofx(fxShow): def gof(f): def goxs(xs): ys = [xShow(x) for x in xs] w = max(map(len, ys)) def arrowed(x, y): return y.rjust(w, ' ') + ' -> ' + ( fxShow(f(x)) ) return s + '\n' + '\n'.join( map(arrowed, xs, ys) ) return goxs return gof return gofx return gox def compose(g): return lambda f: lambda x: g(f(x)) def concat(xs): def f(ys): zs = list(chain(*ys)) return ''.join(zs) if isinstance(ys[0], str) else zs return ( f(xs) if isinstance(xs, list) else ( chain.from_iterable(xs) ) ) if xs else [] def fmap(f): def go(xs): return list(map(f, xs)) return go def index(xs): return lambda n: None if 0 > n else ( xs[n] if ( hasattr(xs, "__getitem__") ) else next(islice(xs, n, None)) ) def showRatio(m): def go(n): def f(r): d = r.denominator return str(r.numerator).rjust(m, ' ') + ( ('/' + str(d).ljust(n, ' ')) if 1 != d else ( ' ' * (1 + n) ) ) return f return go if __name__ == '__main__': main()
Module Module1 Class Frac Private ReadOnly num As Long Private ReadOnly denom As Long Public Shared ReadOnly ZERO = New Frac(0, 1) Public Shared ReadOnly ONE = New Frac(1, 1) Public Sub New(n As Long, d As Long) If d = 0 Then Throw New ArgumentException("d must not be zero") End If Dim nn = n Dim dd = d If nn = 0 Then dd = 1 ElseIf dd < 0 Then nn = -nn dd = -dd End If Dim g = Math.Abs(Gcd(nn, dd)) If g > 1 Then nn /= g dd /= g End If num = nn denom = dd End Sub Private Shared Function Gcd(a As Long, b As Long) As Long If b = 0 Then Return a Else Return Gcd(b, a Mod b) End If End Function Public Shared Operator -(self As Frac) As Frac Return New Frac(-self.num, self.denom) End Operator Public Shared Operator +(lhs As Frac, rhs As Frac) As Frac Return New Frac(lhs.num * rhs.denom + lhs.denom * rhs.num, rhs.denom * lhs.denom) End Operator Public Shared Operator -(lhs As Frac, rhs As Frac) As Frac Return lhs + -rhs End Operator Public Shared Operator *(lhs As Frac, rhs As Frac) As Frac Return New Frac(lhs.num * rhs.num, lhs.denom * rhs.denom) End Operator Public Shared Operator <(lhs As Frac, rhs As Frac) As Boolean Dim x = lhs.num / lhs.denom Dim y = rhs.num / rhs.denom Return x < y End Operator Public Shared Operator >(lhs As Frac, rhs As Frac) As Boolean Dim x = lhs.num / lhs.denom Dim y = rhs.num / rhs.denom Return x > y End Operator Public Shared Operator =(lhs As Frac, rhs As Frac) As Boolean Return lhs.num = rhs.num AndAlso lhs.denom = rhs.denom End Operator Public Shared Operator <>(lhs As Frac, rhs As Frac) As Boolean Return lhs.num <> rhs.num OrElse lhs.denom <> rhs.denom End Operator Public Overrides Function ToString() As String If denom = 1 Then Return num.ToString Else Return String.Format("{0}/{1}", num, denom) End If End Function Public Overrides Function Equals(obj As Object) As Boolean Dim frac = CType(obj, Frac) Return Not IsNothing(frac) AndAlso num = frac.num AndAlso denom = frac.denom End Function End Class Function Bernoulli(n As Integer) As Frac If n < 0 Then Throw New ArgumentException("n may not be negative or zero") End If Dim a(n + 1) As Frac For m = 0 To n a(m) = New Frac(1, m + 1) For j = m To 1 Step -1 a(j - 1) = (a(j - 1) - a(j)) * New Frac(j, 1) Next Next If n <> 1 Then Return a(0) Else Return -a(0) End If End Function Function Binomial(n As Integer, k As Integer) As Integer If n < 0 OrElse k < 0 OrElse n < k Then Throw New ArgumentException() End If If n = 0 OrElse k = 0 Then Return 1 End If Dim num = 1 For i = k + 1 To n num *= i Next Dim denom = 1 For i = 2 To n - k denom *= i Next Return num \ denom End Function Function FaulhaberTriangle(p As Integer) As Frac() Dim coeffs(p + 1) As Frac For i = 1 To p + 1 coeffs(i - 1) = Frac.ZERO Next Dim q As New Frac(1, p + 1) Dim sign = -1 For j = 0 To p sign *= -1 coeffs(p - j) = q * New Frac(sign, 1) * New Frac(Binomial(p + 1, j), 1) * Bernoulli(j) Next Return coeffs End Function Sub Main() For i = 1 To 10 Dim coeffs = FaulhaberTriangle(i - 1) For Each coeff In coeffs Console.Write("{0,5} ", coeff) Next Console.WriteLine() Next End Sub End Module
Rewrite this program in VB while keeping its functionality equivalent to the Python version.
import sys program_name = sys.argv[0] arguments = sys.argv[1:] count = len(arguments)
Function Run(args() as String) As Integer For each arg As String In args Stdout.WriteLine(arg) Next End Function
Port the following code from Python to VB with equivalent syntax and logic.
import sys program_name = sys.argv[0] arguments = sys.argv[1:] count = len(arguments)
Function Run(args() as String) As Integer For each arg As String In args Stdout.WriteLine(arg) Next End Function
Write the same code in VB as shown below in Python.
import urllib.request from collections import Counter GRID = def getwords(url='http://wiki.puzzlers.org/pub/wordlists/unixdict.txt'): "Return lowercased words of 3 to 9 characters" words = urllib.request.urlopen(url).read().decode().strip().lower().split() return (w for w in words if 2 < len(w) < 10) def solve(grid, dictionary): gridcount = Counter(grid) mid = grid[4] return [word for word in dictionary if mid in word and not (Counter(word) - gridcount)] if __name__ == '__main__': chars = ''.join(GRID.strip().lower().split()) found = solve(chars, dictionary=getwords()) print('\n'.join(found))
Const wheel="ndeokgelw" Sub print(s): On Error Resume Next WScript.stdout.WriteLine (s) If err= &h80070006& Then WScript.Echo " Please run this script with CScript": WScript.quit End Sub Dim oDic Set oDic = WScript.CreateObject("scripting.dictionary") Dim cnt(127) Dim fso Set fso = WScript.CreateObject("Scripting.Filesystemobject") Set ff=fso.OpenTextFile("unixdict.txt") i=0 print "reading words of 3 or more letters" While Not ff.AtEndOfStream x=LCase(ff.ReadLine) If Len(x)>=3 Then If Not odic.exists(x) Then oDic.Add x,0 End If Wend print "remaining words: "& oDic.Count & vbcrlf ff.Close Set ff=Nothing Set fso=Nothing Set re=New RegExp print "removing words with chars not in the wheel" re.pattern="[^"& wheel &"]" For Each w In oDic.Keys If re.test(w) Then oDic.remove(w) Next print "remaining words: "& oDic.Count & vbcrlf print "ensuring the mandatory letter "& Mid(wheel,5,1) & " is present" re.Pattern=Mid(wheel,5,1) For Each w In oDic.Keys If Not re.test(w) Then oDic.remove(w) Next print "remaining words: "& oDic.Count & vbcrlf print "checking number of chars" Dim nDic Set nDic = WScript.CreateObject("scripting.dictionary") For i=1 To Len(wheel) x=Mid(wheel,i,1) If nDic.Exists(x) Then a=nDic(x) nDic(x)=Array(a(0)+1,0) Else nDic.add x,Array(1,0) End If Next For Each w In oDic.Keys For Each c In nDic.Keys ndic(c)=Array(nDic(c)(0),0) Next For ii = 1 To len(w) c=Mid(w,ii,1) a=nDic(c) If (a(0)=a(1)) Then oDic.Remove(w):Exit For End If nDic(c)=Array(a(0),a(1)+1) Next Next print "Remaining words "& oDic.count For Each w In oDic.Keys print w Next
Convert this Python block to VB, preserving its control flow and logic.
arr1 = [1, 2, 3] arr2 = [4, 5, 6] arr3 = [7, 8, 9] arr4 = arr1 + arr2 assert arr4 == [1, 2, 3, 4, 5, 6] arr4.extend(arr3) assert arr4 == [1, 2, 3, 4, 5, 6, 7, 8, 9]
DEFINT A(1 to 4) = {1, 2, 3, 4} DEFINT B(1 to 4) = {10, 20, 30, 40} Redim A(1 to 8) as integer MEMCPY(varptr(A(5)), varptr(B(1)), Sizeof(integer)*4)
Convert the following code from Python to VB, ensuring the logic remains intact.
string = raw_input("Input a string: ")
Public Sub text() Debug.Print InputBox("Input a string") Debug.Print InputBox("Input the integer 75000", "Input an integer", 75000, Context = "Long") End Sub
Rewrite the snippet below in VB so it works the same as the original Python code.
string = raw_input("Input a string: ")
Public Sub text() Debug.Print InputBox("Input a string") Debug.Print InputBox("Input the integer 75000", "Input an integer", 75000, Context = "Long") End Sub
Write the same algorithm in VB as shown in this Python implementation.
>>> import winsound >>> for note in [261.63, 293.66, 329.63, 349.23, 392.00, 440.00, 493.88, 523.25]: winsound.Beep(int(note+.5), 500) >>>
Option Explicit Declare Function Beep Lib "kernel32" (ByVal Freq As Long, ByVal Dur As Long) As Long Sub Musical_Scale() Dim Fqs, i As Integer Fqs = Array(264, 297, 330, 352, 396, 440, 495, 528) For i = LBound(Fqs) To UBound(Fqs) Beep Fqs(i), 500 Next End Sub
Port the following code from Python to VB with equivalent syntax and logic.
>>> import winsound >>> for note in [261.63, 293.66, 329.63, 349.23, 392.00, 440.00, 493.88, 523.25]: winsound.Beep(int(note+.5), 500) >>>
Option Explicit Declare Function Beep Lib "kernel32" (ByVal Freq As Long, ByVal Dur As Long) As Long Sub Musical_Scale() Dim Fqs, i As Integer Fqs = Array(264, 297, 330, 352, 396, 440, 495, 528) For i = LBound(Fqs) To UBound(Fqs) Beep Fqs(i), 500 Next End Sub
Port the provided Python code into VB while preserving the original functionality.
from itertools import combinations def anycomb(items): ' return combinations of any length from the items ' return ( comb for r in range(1, len(items)+1) for comb in combinations(items, r) ) def totalvalue(comb): ' Totalise a particular combination of items' totwt = totval = 0 for item, wt, val in comb: totwt += wt totval += val return (totval, -totwt) if totwt <= 400 else (0, 0) items = ( ("map", 9, 150), ("compass", 13, 35), ("water", 153, 200), ("sandwich", 50, 160), ("glucose", 15, 60), ("tin", 68, 45), ("banana", 27, 60), ("apple", 39, 40), ("cheese", 23, 30), ("beer", 52, 10), ("suntan cream", 11, 70), ("camera", 32, 30), ("t-shirt", 24, 15), ("trousers", 48, 10), ("umbrella", 73, 40), ("waterproof trousers", 42, 70), ("waterproof overclothes", 43, 75), ("note-case", 22, 80), ("sunglasses", 7, 20), ("towel", 18, 12), ("socks", 4, 50), ("book", 30, 10), ) bagged = max( anycomb(items), key=totalvalue) print("Bagged the following items\n " + '\n '.join(sorted(item for item,_,_ in bagged))) val, wt = totalvalue(bagged) print("for a total value of %i and a total weight of %i" % (val, -wt))
Option Explicit Const maxWeight = 400 Dim DataList As Variant Dim xList(64, 3) As Variant Dim nItems As Integer Dim s As String, xss As String Dim xwei As Integer, xval As Integer, nn As Integer Sub Main() Dim i As Integer, j As Integer DataList = Array("map", 9, 150, "compass", 13, 35, "water", 153, 200, "sandwich", 50, 160, _ "glucose", 15, 60, "tin", 68, 45, "banana", 27, 60, "apple", 39, 40, _ "cheese", 23, 30, "beer", 52, 10, "suntan cream", 11, 70, "camera", 32, 30, _ "T-shirt", 24, 15, "trousers", 48, 10, "umbrella", 73, 40, "book", 30, 10, _ "waterproof trousers", 42, 70, "waterproof overclothes", 43, 75, _ "note-case", 22, 80, "sunglasses", 7, 20, "towel", 18, 12, "socks", 4, 50) nItems = (UBound(DataList) + 1) / 3 j = 0 For i = 1 To nItems xList(i, 1) = DataList(j) xList(i, 2) = DataList(j + 1) xList(i, 3) = DataList(j + 2) j = j + 3 Next i s = "" For i = 1 To nItems s = s & Chr(i) Next nn = 0 Call ChoiceBin(1, "") For i = 1 To Len(xss) j = Asc(Mid(xss, i, 1)) Debug.Print xList(j, 1) Next i Debug.Print "count=" & Len(xss), "weight=" & xwei, "value=" & xval End Sub Private Sub ChoiceBin(n As String, ss As String) Dim r As String Dim i As Integer, j As Integer, iwei As Integer, ival As Integer Dim ipct As Integer If n = Len(s) + 1 Then iwei = 0: ival = 0 For i = 1 To Len(ss) j = Asc(Mid(ss, i, 1)) iwei = iwei + xList(j, 2) ival = ival + xList(j, 3) Next If iwei <= maxWeight And ival > xval Then xss = ss: xwei = iwei: xval = ival End If Else r = Mid(s, n, 1) Call ChoiceBin(n + 1, ss & r) Call ChoiceBin(n + 1, ss) End If End Sub
Change the following Python code into VB without altering its purpose.
from __future__ import print_function from itertools import takewhile maxsum = 99 def get_primes(max): if max < 2: return [] lprimes = [2] for x in range(3, max + 1, 2): for p in lprimes: if x % p == 0: break else: lprimes.append(x) return lprimes descendants = [[] for _ in range(maxsum + 1)] ancestors = [[] for _ in range(maxsum + 1)] primes = get_primes(maxsum) for p in primes: descendants[p].append(p) for s in range(1, len(descendants) - p): descendants[s + p] += [p * pr for pr in descendants[s]] for p in primes + [4]: descendants[p].pop() total = 0 for s in range(1, maxsum + 1): descendants[s].sort() for d in takewhile(lambda x: x <= maxsum, descendants[s]): ancestors[d] = ancestors[s] + [s] print([s], "Level:", len(ancestors[s])) print("Ancestors:", ancestors[s] if len(ancestors[s]) else "None") print("Descendants:", len(descendants[s]) if len(descendants[s]) else "None") if len(descendants[s]): print(descendants[s]) print() total += len(descendants[s]) print("Total descendants", total)
Imports System.Math Module Module1 Const MAXPRIME = 99 Const MAXPARENT = 99 Const NBRCHILDREN = 547100 Public Primes As New Collection() Public PrimesR As New Collection() Public Ancestors As New Collection() Public Parents(MAXPARENT + 1) As Integer Public CptDescendants(MAXPARENT + 1) As Integer Public Children(NBRCHILDREN) As ChildStruct Public iChildren As Integer Public Delimiter As String = ", " Public Structure ChildStruct Public Child As Long Public pLower As Integer Public pHigher As Integer End Structure Sub Main() Dim Parent As Short Dim Sum As Short Dim i As Short Dim TotDesc As Integer = 0 Dim MidPrime As Integer If GetPrimes(Primes, MAXPRIME) = vbFalse Then Return End If For i = Primes.Count To 1 Step -1 PrimesR.Add(Primes.Item(i)) Next MidPrime = PrimesR.Item(1) / 2 For Each Prime In PrimesR Parents(Prime) = InsertChild(Parents(Prime), Prime) CptDescendants(Prime) += 1 If Prime > MidPrime Then Continue For End If For Parent = 1 To MAXPARENT Sum = Parent + Prime If Sum > MAXPARENT Then Exit For End If If Parents(Parent) Then InsertPreorder(Parents(Parent), Sum, Prime) CptDescendants(Sum) += CptDescendants(Parent) End If Next Next RemoveFalseChildren() If MAXPARENT > MAXPRIME Then If GetPrimes(Primes, MAXPARENT) = vbFalse Then Return End If End If FileOpen(1, "Ancestors.txt", OpenMode.Output) For Parent = 1 To MAXPARENT GetAncestors(Parent) PrintLine(1, "[" & Parent.ToString & "] Level: " & Ancestors.Count.ToString) If Ancestors.Count Then Print(1, "Ancestors: " & Ancestors.Item(1).ToString) For i = 2 To Ancestors.Count Print(1, ", " & Ancestors.Item(i).ToString) Next PrintLine(1) Ancestors.Clear() Else PrintLine(1, "Ancestors: None") End If If CptDescendants(Parent) Then PrintLine(1, "Descendants: " & CptDescendants(Parent).ToString) Delimiter = "" PrintDescendants(Parents(Parent)) PrintLine(1) TotDesc += CptDescendants(Parent) Else PrintLine(1, "Descendants: None") End If PrintLine(1) Next Primes.Clear() PrimesR.Clear() PrintLine(1, "Total descendants " & TotDesc.ToString) PrintLine(1) FileClose(1) End Sub Function InsertPreorder(_index As Integer, _sum As Short, _prime As Short) Parents(_sum) = InsertChild(Parents(_sum), Children(_index).Child * _prime) If Children(_index).pLower Then InsertPreorder(Children(_index).pLower, _sum, _prime) End If If Children(_index).pHigher Then InsertPreorder(Children(_index).pHigher, _sum, _prime) End If Return Nothing End Function Function InsertChild(_index As Integer, _child As Long) As Integer If _index Then If _child <= Children(_index).Child Then Children(_index).pLower = InsertChild(Children(_index).pLower, _child) Else Children(_index).pHigher = InsertChild(Children(_index).pHigher, _child) End If Else iChildren += 1 _index = iChildren Children(_index).Child = _child Children(_index).pLower = 0 Children(_index).pHigher = 0 End If Return _index End Function Function RemoveFalseChildren() Dim Exclusions As New Collection Exclusions.Add(4) For Each Prime In Primes Exclusions.Add(Prime) Next For Each ex In Exclusions Parents(ex) = Children(Parents(ex)).pHigher CptDescendants(ex) -= 1 Next Exclusions.Clear() Return Nothing End Function Function GetAncestors(_child As Short) Dim Child As Short = _child Dim Parent As Short = 0 For Each Prime In Primes If Child = 1 Then Exit For End If While Child Mod Prime = 0 Child /= Prime Parent += Prime End While Next If Parent = _child Or _child = 1 Then Return Nothing End If GetAncestors(Parent) Ancestors.Add(Parent) Return Nothing End Function Function PrintDescendants(_index As Integer) If Children(_index).pLower Then PrintDescendants(Children(_index).pLower) End If Print(1, Delimiter.ToString & Children(_index).Child.ToString) Delimiter = ", " If Children(_index).pHigher Then PrintDescendants(Children(_index).pHigher) End If Return Nothing End Function Function GetPrimes(ByRef _primes As Object, Optional _maxPrime As Integer = 2) As Boolean Dim Value As Integer = 3 Dim Max As Integer Dim Prime As Integer If _maxPrime < 2 Then Return vbFalse End If _primes.Add(2) While Value <= _maxPrime Max = Floor(Sqrt(Value)) For Each Prime In _primes If Prime > Max Then _primes.Add(Value) Exit For End If If Value Mod Prime = 0 Then Exit For End If Next Value += 2 End While Return vbTrue End Function End Module
Convert this Python block to VB, preserving its control flow and logic.
import itertools def cp(lsts): return list(itertools.product(*lsts)) if __name__ == '__main__': from pprint import pprint as pp for lists in [[[1,2],[3,4]], [[3,4],[1,2]], [[], [1, 2]], [[1, 2], []], ((1776, 1789), (7, 12), (4, 14, 23), (0, 1)), ((1, 2, 3), (30,), (500, 100)), ((1, 2, 3), (), (500, 100))]: print(lists, '=>') pp(cp(lists), indent=2)
Imports System.Runtime.CompilerServices Module Module1 <Extension()> Function CartesianProduct(Of T)(sequences As IEnumerable(Of IEnumerable(Of T))) As IEnumerable(Of IEnumerable(Of T)) Dim emptyProduct As IEnumerable(Of IEnumerable(Of T)) = {Enumerable.Empty(Of T)} Return sequences.Aggregate(emptyProduct, Function(accumulator, sequence) From acc In accumulator From item In sequence Select acc.Concat({item})) End Function Sub Main() Dim empty(-1) As Integer Dim list1 = {1, 2} Dim list2 = {3, 4} Dim list3 = {1776, 1789} Dim list4 = {7, 12} Dim list5 = {4, 14, 23} Dim list6 = {0, 1} Dim list7 = {1, 2, 3} Dim list8 = {30} Dim list9 = {500, 100} For Each sequnceList As Integer()() In { ({list1, list2}), ({list2, list1}), ({list1, empty}), ({empty, list1}), ({list3, list4, list5, list6}), ({list7, list8, list9}), ({list7, empty, list9}) } Dim cart = sequnceList.CartesianProduct().Select(Function(tuple) $"({String.Join(", ", tuple)})") Console.WriteLine($"{{{String.Join(", ", cart)}}}") Next End Sub End Module
Write the same algorithm in VB as shown in this Python implementation.
import itertools def cp(lsts): return list(itertools.product(*lsts)) if __name__ == '__main__': from pprint import pprint as pp for lists in [[[1,2],[3,4]], [[3,4],[1,2]], [[], [1, 2]], [[1, 2], []], ((1776, 1789), (7, 12), (4, 14, 23), (0, 1)), ((1, 2, 3), (30,), (500, 100)), ((1, 2, 3), (), (500, 100))]: print(lists, '=>') pp(cp(lists), indent=2)
Imports System.Runtime.CompilerServices Module Module1 <Extension()> Function CartesianProduct(Of T)(sequences As IEnumerable(Of IEnumerable(Of T))) As IEnumerable(Of IEnumerable(Of T)) Dim emptyProduct As IEnumerable(Of IEnumerable(Of T)) = {Enumerable.Empty(Of T)} Return sequences.Aggregate(emptyProduct, Function(accumulator, sequence) From acc In accumulator From item In sequence Select acc.Concat({item})) End Function Sub Main() Dim empty(-1) As Integer Dim list1 = {1, 2} Dim list2 = {3, 4} Dim list3 = {1776, 1789} Dim list4 = {7, 12} Dim list5 = {4, 14, 23} Dim list6 = {0, 1} Dim list7 = {1, 2, 3} Dim list8 = {30} Dim list9 = {500, 100} For Each sequnceList As Integer()() In { ({list1, list2}), ({list2, list1}), ({list1, empty}), ({empty, list1}), ({list3, list4, list5, list6}), ({list7, list8, list9}), ({list7, empty, list9}) } Dim cart = sequnceList.CartesianProduct().Select(Function(tuple) $"({String.Join(", ", tuple)})") Console.WriteLine($"{{{String.Join(", ", cart)}}}") Next End Sub End Module
Convert this Python block to VB, preserving its control flow and logic.
>>> def proper_divs2(n): ... return {x for x in range(1, (n + 1) // 2 + 1) if n % x == 0 and n != x} ... >>> [proper_divs2(n) for n in range(1, 11)] [set(), {1}, {1}, {1, 2}, {1}, {1, 2, 3}, {1}, {1, 2, 4}, {1, 3}, {1, 2, 5}] >>> >>> n, length = max(((n, len(proper_divs2(n))) for n in range(1, 20001)), key=lambda pd: pd[1]) >>> n 15120 >>> length 79 >>>
dim _proper_divisors(100) sub proper_divisors(n) dim i dim _proper_divisors_count = 0 if n <> 1 then for i = 1 to (n \ 2) if n %% i = 0 then _proper_divisors_count = _proper_divisors_count + 1 _proper_divisors(_proper_divisors_count) = i end if next end if return _proper_divisors_count end sub sub show_proper_divisors(n, tabbed) dim cnt = proper_divisors(n) print str$(n) + ":"; tab(4);"(" + str$(cnt) + " items) "; dim j for j = 1 to cnt if tabbed then print str$(_proper_divisors(j)), else print str$(_proper_divisors(j)); end if if (j < cnt) then print ","; next print end sub dim i for i = 1 to 10 show_proper_divisors(i, false) next dim c dim maxindex = 0 dim maxlength = 0 for t = 1 to 20000 c = proper_divisors(t) if c > maxlength then maxindex = t maxlength = c end if next print "A maximum at "; show_proper_divisors(maxindex, false)
Maintain the same structure and functionality when rewriting this code in VB.
>>> from xml.etree import ElementTree as ET >>> from itertools import izip >>> def characterstoxml(names, remarks): root = ET.Element("CharacterRemarks") for name, remark in izip(names, remarks): c = ET.SubElement(root, "Character", {'name': name}) c.text = remark return ET.tostring(root) >>> print characterstoxml( names = ["April", "Tam O'Shanter", "Emily"], remarks = [ "Bubbly: I'm > Tam and <= Emily", 'Burns: "When chapman billies leave the street ..."', 'Short & shrift' ] ).replace('><','>\n<')
Module XMLOutput Sub Main() Dim charRemarks As New Dictionary(Of String, String) charRemarks.Add("April", "Bubbly: I charRemarks.Add("Tam O charRemarks.Add("Emily", "Short & shrift") Dim xml = <CharacterRemarks> <%= From cr In charRemarks Select <Character name=<%= cr.Key %>><%= cr.Value %></Character> %> </CharacterRemarks> Console.WriteLine(xml) End Sub End Module
Transform the following Python implementation into VB, maintaining the same output and logic.
>>> x = [0, 1, 2, 3, 4, 5, 6, 7, 8, 9] >>> y = [2.7, 2.8, 31.4, 38.1, 58.0, 76.2, 100.5, 130.0, 149.3, 180.0] >>> import pylab >>> pylab.plot(x, y, 'bo') >>> pylab.savefig('qsort-range-10-9.png')
Private Sub plot_coordinate_pairs(x As Variant, y As Variant) Dim chrt As Chart Set chrt = ActiveSheet.Shapes.AddChart.Chart With chrt .ChartType = xlLine .HasLegend = False .HasTitle = True .ChartTitle.Text = "Time" .SeriesCollection.NewSeries .SeriesCollection.Item(1).XValues = x .SeriesCollection.Item(1).Values = y .Axes(xlValue, xlPrimary).HasTitle = True .Axes(xlValue, xlPrimary).AxisTitle.Characters.Text = "microseconds" End With End Sub Public Sub main() x = [{0, 1, 2, 3, 4, 5, 6, 7, 8, 9}] y = [{2.7, 2.8, 31.4, 38.1, 58.0, 76.2, 100.5, 130.0, 149.3, 180.0}] plot_coordinate_pairs x, y End Sub
Rewrite the snippet below in VB so it works the same as the original Python code.
>>> x = [0, 1, 2, 3, 4, 5, 6, 7, 8, 9] >>> y = [2.7, 2.8, 31.4, 38.1, 58.0, 76.2, 100.5, 130.0, 149.3, 180.0] >>> import pylab >>> pylab.plot(x, y, 'bo') >>> pylab.savefig('qsort-range-10-9.png')
Private Sub plot_coordinate_pairs(x As Variant, y As Variant) Dim chrt As Chart Set chrt = ActiveSheet.Shapes.AddChart.Chart With chrt .ChartType = xlLine .HasLegend = False .HasTitle = True .ChartTitle.Text = "Time" .SeriesCollection.NewSeries .SeriesCollection.Item(1).XValues = x .SeriesCollection.Item(1).Values = y .Axes(xlValue, xlPrimary).HasTitle = True .Axes(xlValue, xlPrimary).AxisTitle.Characters.Text = "microseconds" End With End Sub Public Sub main() x = [{0, 1, 2, 3, 4, 5, 6, 7, 8, 9}] y = [{2.7, 2.8, 31.4, 38.1, 58.0, 76.2, 100.5, 130.0, 149.3, 180.0}] plot_coordinate_pairs x, y End Sub
Produce a language-to-language conversion: from Python to VB, same semantics.
import re string = "This is a string" if re.search('string$', string): print("Ends with string.") string = re.sub(" a ", " another ", string) print(string)
text = "I need more coffee!!!" Set regex = New RegExp regex.Global = True regex.Pattern = "\s" If regex.Test(text) Then WScript.StdOut.Write regex.Replace(text,vbCrLf) Else WScript.StdOut.Write "No matching pattern" End If
Change the following Python code into VB without altering its purpose.
keys = ['a', 'b', 'c'] values = [1, 2, 3] hash = {key: value for key, value in zip(keys, values)}
Set dict = CreateObject("Scripting.Dictionary") os = Array("Windows", "Linux", "MacOS") owner = Array("Microsoft", "Linus Torvalds", "Apple") For n = 0 To 2 dict.Add os(n), owner(n) Next MsgBox dict.Item("Linux") MsgBox dict.Item("MacOS") MsgBox dict.Item("Windows")
Can you help me rewrite this code in VB instead of Python, keeping it the same logically?
from turtle import * colors = ["black", "red", "green", "blue", "magenta", "cyan", "yellow", "white"] screen = getscreen() left_edge = -screen.window_width()//2 right_edge = screen.window_width()//2 quarter_height = screen.window_height()//4 half_height = quarter_height * 2 speed("fastest") for quarter in range(4): pensize(quarter+1) colornum = 0 min_y = half_height - ((quarter + 1) * quarter_height) max_y = half_height - ((quarter) * quarter_height) for x in range(left_edge,right_edge,quarter+1): penup() pencolor(colors[colornum]) colornum = (colornum + 1) % len(colors) setposition(x,min_y) pendown() setposition(x,max_y) notused = input("Hit enter to continue: ")
Public Class Main Inherits System.Windows.Forms.Form Public Sub New() Me.FormBorderStyle = FormBorderStyle.None Me.WindowState = FormWindowState.Maximized End Sub Private Sub Main_Load(sender As Object, e As EventArgs) Handles Me.Load Dim Index As Integer Dim Colors() As Color = {Color.Black, Color.Red, Color.Green, Color.Magenta, Color.Cyan, Color.Yellow, Color.White} Dim Height = (Me.ClientSize.Height / 4) + 1 For y = 1 To 4 Dim Top = Me.ClientSize.Height / 4 * (y - 1) For x = 0 To Me.ClientSize.Width Step y If Index = 6 Then Index = 0 Else Index += 1 Me.Controls.Add(New Panel With {.Top = Top, .Height = Height, .Left = x, .Width = y, .BackColor = Colors(Index)}) Next Next End Sub End Class
Write the same code in VB as shown below in Python.
def cocktailshiftingbounds(A): beginIdx = 0 endIdx = len(A) - 1 while beginIdx <= endIdx: newBeginIdx = endIdx newEndIdx = beginIdx for ii in range(beginIdx,endIdx): if A[ii] > A[ii + 1]: A[ii+1], A[ii] = A[ii], A[ii+1] newEndIdx = ii endIdx = newEndIdx for ii in range(endIdx,beginIdx-1,-1): if A[ii] > A[ii + 1]: A[ii+1], A[ii] = A[ii], A[ii+1] newBeginIdx = ii beginIdx = newBeginIdx + 1 test1 = [7, 6, 5, 9, 8, 4, 3, 1, 2, 0] cocktailshiftingbounds(test1) print(test1) test2=list('big fjords vex quick waltz nymph') cocktailshiftingbounds(test2) print(''.join(test2))
Function cocktailShakerSort(ByVal A As Variant) As Variant beginIdx = LBound(A) endIdx = UBound(A) - 1 Do While beginIdx <= endIdx newBeginIdx = endIdx newEndIdx = beginIdx For ii = beginIdx To endIdx If A(ii) > A(ii + 1) Then tmp = A(ii): A(ii) = A(ii + 1): A(ii + 1) = tmp newEndIdx = ii End If Next ii endIdx = newEndIdx - 1 For ii = endIdx To beginIdx Step -1 If A(ii) > A(ii + 1) Then tmp = A(ii): A(ii) = A(ii + 1): A(ii + 1) = tmp newBeginIdx = ii End If Next ii beginIdx = newBeginIdx + 1 Loop cocktailShakerSort = A End Function Public Sub main() Dim B(20) As Variant For i = LBound(B) To UBound(B) B(i) = Int(Rnd() * 100) Next i Debug.Print Join(B, ", ") Debug.Print Join(cocktailShakerSort(B), ", ") End Sub
Keep all operations the same but rewrite the snippet in VB.
import pygame, sys from pygame.locals import * from math import sin, cos, radians pygame.init() WINDOWSIZE = 250 TIMETICK = 100 BOBSIZE = 15 window = pygame.display.set_mode((WINDOWSIZE, WINDOWSIZE)) pygame.display.set_caption("Pendulum") screen = pygame.display.get_surface() screen.fill((255,255,255)) PIVOT = (WINDOWSIZE/2, WINDOWSIZE/10) SWINGLENGTH = PIVOT[1]*4 class BobMass(pygame.sprite.Sprite): def __init__(self): pygame.sprite.Sprite.__init__(self) self.theta = 45 self.dtheta = 0 self.rect = pygame.Rect(PIVOT[0]-SWINGLENGTH*cos(radians(self.theta)), PIVOT[1]+SWINGLENGTH*sin(radians(self.theta)), 1,1) self.draw() def recomputeAngle(self): scaling = 3000.0/(SWINGLENGTH**2) firstDDtheta = -sin(radians(self.theta))*scaling midDtheta = self.dtheta + firstDDtheta midtheta = self.theta + (self.dtheta + midDtheta)/2.0 midDDtheta = -sin(radians(midtheta))*scaling midDtheta = self.dtheta + (firstDDtheta + midDDtheta)/2 midtheta = self.theta + (self.dtheta + midDtheta)/2 midDDtheta = -sin(radians(midtheta)) * scaling lastDtheta = midDtheta + midDDtheta lasttheta = midtheta + (midDtheta + lastDtheta)/2.0 lastDDtheta = -sin(radians(lasttheta)) * scaling lastDtheta = midDtheta + (midDDtheta + lastDDtheta)/2.0 lasttheta = midtheta + (midDtheta + lastDtheta)/2.0 self.dtheta = lastDtheta self.theta = lasttheta self.rect = pygame.Rect(PIVOT[0]- SWINGLENGTH*sin(radians(self.theta)), PIVOT[1]+ SWINGLENGTH*cos(radians(self.theta)),1,1) def draw(self): pygame.draw.circle(screen, (0,0,0), PIVOT, 5, 0) pygame.draw.circle(screen, (0,0,0), self.rect.center, BOBSIZE, 0) pygame.draw.aaline(screen, (0,0,0), PIVOT, self.rect.center) pygame.draw.line(screen, (0,0,0), (0, PIVOT[1]), (WINDOWSIZE, PIVOT[1])) def update(self): self.recomputeAngle() screen.fill((255,255,255)) self.draw() bob = BobMass() TICK = USEREVENT + 2 pygame.time.set_timer(TICK, TIMETICK) def input(events): for event in events: if event.type == QUIT: sys.exit(0) elif event.type == TICK: bob.update() while True: input(pygame.event.get()) pygame.display.flip()
option explicit const dt = 0.15 const length=23 dim ans0:ans0=chr(27)&"[" dim Veloc,Accel,angle,olr,olc,r,c const r0=1 const c0=40 cls angle=0.7 while 1 wscript.sleep(50) Accel = -.9 * sin(Angle) Veloc = Veloc + Accel * dt Angle = Angle + Veloc * dt r = r0 + int(cos(Angle) * Length) c = c0+ int(2*sin(Angle) * Length) cls draw_line r,c,r0,c0 toxy r,c,"O" olr=r :olc=c wend sub cls() wscript.StdOut.Write ans0 &"2J"&ans0 &"?25l":end sub sub toxy(r,c,s) wscript.StdOut.Write ans0 & r & ";" & c & "f" & s :end sub Sub draw_line(r1,c1, r2,c2) Dim x,y,xf,yf,dx,dy,sx,sy,err,err2 x =r1 : y =c1 xf=r2 : yf=c2 dx=Abs(xf-x) : dy=Abs(yf-y) If x<xf Then sx=+1: Else sx=-1 If y<yf Then sy=+1: Else sy=-1 err=dx-dy Do toxy x,y,"." If x=xf And y=yf Then Exit Do err2=err+err If err2>-dy Then err=err-dy: x=x+sx If err2< dx Then err=err+dx: y=y+sy Loop End Sub
Translate this program into VB but keep the logic exactly as in Python.
>>> def int2bin(n): 'From positive integer to list of binary bits, msb at index 0' if n: bits = [] while n: n,remainder = divmod(n, 2) bits.insert(0, remainder) return bits else: return [0] >>> def bin2int(bits): 'From binary bits, msb at index 0 to integer' i = 0 for bit in bits: i = i * 2 + bit return i
Function Encoder(ByVal n) Encoder = n Xor (n \ 2) End Function Function Decoder(ByVal n) Dim g : g = 0 Do While n > 0 g = g Xor n n = n \ 2 Loop Decoder = g End Function Function Dec2bin(ByVal n, ByVal length) Dim i, strbin : strbin = "" For i = 1 to 5 strbin = (n Mod 2) & strbin n = n \ 2 Next Dec2Bin = strbin End Function WScript.StdOut.WriteLine("Binary -> Gray Code -> Binary") For i = 0 to 31 encoded = Encoder(i) decoded = Decoder(encoded) WScript.StdOut.WriteLine(Dec2Bin(i, 5) & " -> " & Dec2Bin(encoded, 5) & " -> " & Dec2Bin(decoded, 5)) Next
Translate the given Python code snippet into VB without altering its behavior.
>>> def int2bin(n): 'From positive integer to list of binary bits, msb at index 0' if n: bits = [] while n: n,remainder = divmod(n, 2) bits.insert(0, remainder) return bits else: return [0] >>> def bin2int(bits): 'From binary bits, msb at index 0 to integer' i = 0 for bit in bits: i = i * 2 + bit return i
Function Encoder(ByVal n) Encoder = n Xor (n \ 2) End Function Function Decoder(ByVal n) Dim g : g = 0 Do While n > 0 g = g Xor n n = n \ 2 Loop Decoder = g End Function Function Dec2bin(ByVal n, ByVal length) Dim i, strbin : strbin = "" For i = 1 to 5 strbin = (n Mod 2) & strbin n = n \ 2 Next Dec2Bin = strbin End Function WScript.StdOut.WriteLine("Binary -> Gray Code -> Binary") For i = 0 to 31 encoded = Encoder(i) decoded = Decoder(encoded) WScript.StdOut.WriteLine(Dec2Bin(i, 5) & " -> " & Dec2Bin(encoded, 5) & " -> " & Dec2Bin(decoded, 5)) Next
Maintain the same structure and functionality when rewriting this code in VB.
>>> def int2bin(n): 'From positive integer to list of binary bits, msb at index 0' if n: bits = [] while n: n,remainder = divmod(n, 2) bits.insert(0, remainder) return bits else: return [0] >>> def bin2int(bits): 'From binary bits, msb at index 0 to integer' i = 0 for bit in bits: i = i * 2 + bit return i
Function Encoder(ByVal n) Encoder = n Xor (n \ 2) End Function Function Decoder(ByVal n) Dim g : g = 0 Do While n > 0 g = g Xor n n = n \ 2 Loop Decoder = g End Function Function Dec2bin(ByVal n, ByVal length) Dim i, strbin : strbin = "" For i = 1 to 5 strbin = (n Mod 2) & strbin n = n \ 2 Next Dec2Bin = strbin End Function WScript.StdOut.WriteLine("Binary -> Gray Code -> Binary") For i = 0 to 31 encoded = Encoder(i) decoded = Decoder(encoded) WScript.StdOut.WriteLine(Dec2Bin(i, 5) & " -> " & Dec2Bin(encoded, 5) & " -> " & Dec2Bin(decoded, 5)) Next
Rewrite the snippet below in VB so it works the same as the original Python code.
import random class Card(object): suits = ("Clubs","Hearts","Spades","Diamonds") pips = ("2","3","4","5","6","7","8","9","10","Jack","Queen","King","Ace") def __init__(self, pip,suit): self.pip=pip self.suit=suit def __str__(self): return "%s %s"%(self.pip,self.suit) class Deck(object): def __init__(self): self.deck = [Card(pip,suit) for suit in Card.suits for pip in Card.pips] def __str__(self): return "[%s]"%", ".join( (str(card) for card in self.deck)) def shuffle(self): random.shuffle(self.deck) def deal(self): self.shuffle() return self.deck.pop(0)
class playingcard dim suit dim pips end class class carddeck private suitnames private pipnames private cardno private deck(52) private nTop sub class_initialize dim suit dim pips suitnames = split("H,D,C,S",",") pipnames = split("A,2,3,4,5,6,7,8,9,10,J,Q,K",",") cardno = 0 for suit = 1 to 4 for pips = 1 to 13 set deck(cardno) = new playingcard deck(cardno).suit = suitnames(suit-1) deck(cardno).pips = pipnames(pips-1) cardno = cardno + 1 next next nTop = 0 end sub public sub showdeck dim a redim a(51-nTop) for i = nTop to 51 a(i) = deck(i).pips & deck(i).suit next wscript.echo join( a, ", ") end sub public sub shuffle dim r randomize timer for i = nTop to 51 r = int( rnd * ( 52 - nTop ) ) if r <> i then objswap deck(i),deck(r) end if next end sub public function deal() set deal = deck( nTop ) nTop = nTop + 1 end function public property get cardsRemaining cardsRemaining = 52 - nTop end property private sub objswap( a, b ) dim tmp set tmp = a set a = b set b = tmp end sub end class
Produce a language-to-language conversion: from Python to VB, same semantics.
array = [] array.append(1) array.append(3) array[0] = 2 print array[0]
Option Base {0|1}
Keep all operations the same but rewrite the snippet in VB.
array = [] array.append(1) array.append(3) array[0] = 2 print array[0]
Option Base {0|1}
Transform the following Python implementation into VB, maintaining the same output and logic.
def setup(): size(729, 729) fill(0) background(255) noStroke() rect(width / 3, height / 3, width / 3, width / 3) rectangles(width / 3, height / 3, width / 3) def rectangles(x, y, s): if s < 1: return xc, yc = x - s, y - s for row in range(3): for col in range(3): if not (row == 1 and col == 1): xx, yy = xc + row * s, yc + col * s delta = s / 3 rect(xx + delta, yy + delta, delta, delta) rectangles(xx + s / 3, yy + s / 3, s / 3)
Const Order = 4 Function InCarpet(ByVal x As Integer, ByVal y As Integer) Do While x <> 0 And y <> 0 If x Mod 3 = 1 And y Mod 3 = 1 Then InCarpet = " " Exit Function End If x = x \ 3 y = y \ 3 Loop InCarpet = "#" End Function Public Sub sierpinski_carpet() Dim i As Integer, j As Integer For i = 0 To 3 ^ Order - 1 For j = 0 To 3 ^ Order - 1 Debug.Print InCarpet(i, j); Next j Debug.Print Next i End Sub
Rewrite the snippet below in VB so it works the same as the original Python code.
import random def bogosort(l): while not in_order(l): random.shuffle(l) return l def in_order(l): if not l: return True last = l[0] for x in l[1:]: if x < last: return False last = x return True
Private Function Knuth(a As Variant) As Variant Dim t As Variant, i As Integer If Not IsMissing(a) Then For i = UBound(a) To LBound(a) + 1 Step -1 j = Int((UBound(a) - LBound(a) + 1) * Rnd + LBound(a)) t = a(i) a(i) = a(j) a(j) = t Next i End If Knuth = a End Function Private Function inOrder(s As Variant) i = 2 Do While i <= UBound(s) If s(i) < s(i - 1) Then inOrder = False Exit Function End If i = i + 1 Loop inOrder = True End Function Private Function bogosort(ByVal s As Variant) As Variant Do While Not inOrder(s) Debug.Print Join(s, ", ") s = Knuth(s) Loop bogosort = s End Function Public Sub main() Debug.Print Join(bogosort(Knuth([{1,2,3,4,5,6}])), ", ") End Sub