Instruction stringlengths 45 106 | input_code stringlengths 1 13.7k | output_code stringlengths 1 13.7k |
|---|---|---|
Convert the following code from C# to VB, ensuring the logic remains intact. | public class AverageLoopLength {
private static int N = 100000;
private static double analytical(int n) {
double[] factorial = new double[n + 1];
double[] powers = new double[n + 1];
powers[0] = 1.0;
factorial[0] = 1.0;
for (int i = 1; i <= n; i++) {
factorial[i] = factorial[i - 1] * i;
powers[i] = powers[i - 1] * n;
}
double sum = 0;
for (int i = 1; i <= n; i++) {
sum += factorial[n] / factorial[n - i] / powers[i];
}
return sum;
}
private static double average(int n) {
Random rnd = new Random();
double sum = 0.0;
for (int a = 0; a < N; a++) {
int[] random = new int[n];
for (int i = 0; i < n; i++) {
random[i] = rnd.Next(n);
}
var seen = new HashSet<double>(n);
int current = 0;
int length = 0;
while (seen.Add(current)) {
length++;
current = random[current];
}
sum += length;
}
return sum / N;
}
public static void Main(string[] args) {
Console.WriteLine(" N average analytical (error)");
Console.WriteLine("=== ========= ============ =========");
for (int i = 1; i <= 20; i++) {
var average = AverageLoopLength.average(i);
var analytical = AverageLoopLength.analytical(i);
Console.WriteLine("{0,3} {1,10:N4} {2,13:N4} {3,8:N2}%", i, average, analytical, (analytical - average) / analytical * 100);
}
}
}
| Const MAX = 20
Const ITER = 1000000
Function expected(n As Long) As Double
Dim sum As Double
For i = 1 To n
sum = sum + WorksheetFunction.Fact(n) / n ^ i / WorksheetFunction.Fact(n - i)
Next i
expected = sum
End Function
Function test(n As Long) As Double
Dim count As Long
Dim x As Long, bits As Long
For i = 1 To ITER
x = 1
bits = 0
Do While Not bits And x
count = count + 1
bits = bits Or x
x = 2 ^ (Int(n * Rnd()))
Loop
Next i
test = count / ITER
End Function
Public Sub main()
Dim n As Long
Debug.Print " n avg. exp. (error%)"
Debug.Print "== ====== ====== ========"
For n = 1 To MAX
av = test(n)
ex = expected(n)
Debug.Print Format(n, "@@"); " "; Format(av, "0.0000"); " ";
Debug.Print Format(ex, "0.0000"); " ("; Format(Abs(1 - av / ex), "0.000%"); ")"
Next n
End Sub
|
Change the following C# code into VB without altering its purpose. | class Program
{
static void Main()
{
string extra = "little";
string formatted = $"Mary had a {extra} lamb.";
System.Console.WriteLine(formatted);
}
}
| Dim name as String = "J. Doe"
Dim balance as Double = 123.45
Dim prompt as String = String.Format("Hello {0}, your balance is {1}.", name, balance)
Console.WriteLine(prompt)
|
Generate an equivalent VB version of this C# code. | using System;
using static System.Console;
using LI = System.Collections.Generic.SortedSet<int>;
class Program {
static LI unl(LI res, LI set, int lft, int mul = 1, int vlu = 0) {
if (lft == 0) res.Add(vlu);
else if (lft > 0) foreach (int itm in set)
res = unl(res, set, lft - itm, mul * 10, vlu + itm * mul);
return res; }
static void Main(string[] args) { WriteLine(string.Join(" ",
unl(new LI {}, new LI { 2, 3, 5, 7 }, 13))); }
}
| Imports System
Imports System.Console
Imports LI = System.Collections.Generic.SortedSet(Of Integer)
Module Module1
Function unl(ByVal res As LI, ByVal lst As LI, ByVal lft As Integer, ByVal Optional mul As Integer = 1, ByVal Optional vlu As Integer = 0) As LI
If lft = 0 Then
res.Add(vlu)
ElseIf lft > 0 Then
For Each itm As Integer In lst
res = unl(res, lst, lft - itm, mul * 10, vlu + itm * mul)
Next
End If
Return res
End Function
Sub Main(ByVal args As String())
WriteLine(string.Join(" ",
unl(new LI From {}, new LI From { 2, 3, 5, 7 }, 13)))
End Sub
End Module
|
Convert the following code from C# to VB, ensuring the logic remains intact. | using System;
using static System.Console;
using LI = System.Collections.Generic.SortedSet<int>;
class Program {
static LI unl(LI res, LI set, int lft, int mul = 1, int vlu = 0) {
if (lft == 0) res.Add(vlu);
else if (lft > 0) foreach (int itm in set)
res = unl(res, set, lft - itm, mul * 10, vlu + itm * mul);
return res; }
static void Main(string[] args) { WriteLine(string.Join(" ",
unl(new LI {}, new LI { 2, 3, 5, 7 }, 13))); }
}
| Imports System
Imports System.Console
Imports LI = System.Collections.Generic.SortedSet(Of Integer)
Module Module1
Function unl(ByVal res As LI, ByVal lst As LI, ByVal lft As Integer, ByVal Optional mul As Integer = 1, ByVal Optional vlu As Integer = 0) As LI
If lft = 0 Then
res.Add(vlu)
ElseIf lft > 0 Then
For Each itm As Integer In lst
res = unl(res, lst, lft - itm, mul * 10, vlu + itm * mul)
Next
End If
Return res
End Function
Sub Main(ByVal args As String())
WriteLine(string.Join(" ",
unl(new LI From {}, new LI From { 2, 3, 5, 7 }, 13)))
End Sub
End Module
|
Write the same code in VB as shown below in C#. | using System;
using static System.Console;
using LI = System.Collections.Generic.SortedSet<int>;
class Program {
static LI unl(LI res, LI set, int lft, int mul = 1, int vlu = 0) {
if (lft == 0) res.Add(vlu);
else if (lft > 0) foreach (int itm in set)
res = unl(res, set, lft - itm, mul * 10, vlu + itm * mul);
return res; }
static void Main(string[] args) { WriteLine(string.Join(" ",
unl(new LI {}, new LI { 2, 3, 5, 7 }, 13))); }
}
| Imports System
Imports System.Console
Imports LI = System.Collections.Generic.SortedSet(Of Integer)
Module Module1
Function unl(ByVal res As LI, ByVal lst As LI, ByVal lft As Integer, ByVal Optional mul As Integer = 1, ByVal Optional vlu As Integer = 0) As LI
If lft = 0 Then
res.Add(vlu)
ElseIf lft > 0 Then
For Each itm As Integer In lst
res = unl(res, lst, lft - itm, mul * 10, vlu + itm * mul)
Next
End If
Return res
End Function
Sub Main(ByVal args As String())
WriteLine(string.Join(" ",
unl(new LI From {}, new LI From { 2, 3, 5, 7 }, 13)))
End Sub
End Module
|
Rewrite the snippet below in VB so it works the same as the original C# code. | using System;
using System.IO;
using System.Text;
namespace RosettaCode
{
internal class Program
{
private const string FileName = "NOTES.TXT";
private static void Main(string[] args)
{
if (args.Length==0)
{
string txt = File.ReadAllText(FileName);
Console.WriteLine(txt);
}
else
{
var sb = new StringBuilder();
sb.Append(DateTime.Now).Append("\n\t");
foreach (string s in args)
sb.Append(s).Append(" ");
sb.Append("\n");
if (File.Exists(FileName))
File.AppendAllText(FileName, sb.ToString());
else
File.WriteAllText(FileName, sb.ToString());
}
}
}
}
| Imports System.IO
Module Notes
Function Main(ByVal cmdArgs() As String) As Integer
Try
If cmdArgs.Length = 0 Then
Using sr As New StreamReader("NOTES.TXT")
Console.WriteLine(sr.ReadToEnd)
End Using
Else
Using sw As New StreamWriter("NOTES.TXT", True)
sw.WriteLine(Date.Now.ToString())
sw.WriteLine("{0}{1}", ControlChars.Tab, String.Join(" ", cmdArgs))
End Using
End If
Catch
End Try
End Function
End Module
|
Transform the following C# implementation into VB, maintaining the same output and logic. | using System;
using System.Collections.Generic;
using System.Linq;
using System.Text;
namespace RosettaCodeTasks
{
class Program
{
static void Main ( string[ ] args )
{
FindCommonDirectoryPath.Test ( );
}
}
class FindCommonDirectoryPath
{
public static void Test ( )
{
Console.WriteLine ( "Find Common Directory Path" );
Console.WriteLine ( );
List<string> PathSet1 = new List<string> ( );
PathSet1.Add ( "/home/user1/tmp/coverage/test" );
PathSet1.Add ( "/home/user1/tmp/covert/operator" );
PathSet1.Add ( "/home/user1/tmp/coven/members" );
Console.WriteLine("Path Set 1 (All Absolute Paths):");
foreach ( string path in PathSet1 )
{
Console.WriteLine ( path );
}
Console.WriteLine ( "Path Set 1 Common Path: {0}", FindCommonPath ( "/", PathSet1 ) );
}
public static string FindCommonPath ( string Separator, List<string> Paths )
{
string CommonPath = String.Empty;
List<string> SeparatedPath = Paths
.First ( str => str.Length == Paths.Max ( st2 => st2.Length ) )
.Split ( new string[ ] { Separator }, StringSplitOptions.RemoveEmptyEntries )
.ToList ( );
foreach ( string PathSegment in SeparatedPath.AsEnumerable ( ) )
{
if ( CommonPath.Length == 0 && Paths.All ( str => str.StartsWith ( PathSegment ) ) )
{
CommonPath = PathSegment;
}
else if ( Paths.All ( str => str.StartsWith ( CommonPath + Separator + PathSegment ) ) )
{
CommonPath += Separator + PathSegment;
}
else
{
break;
}
}
return CommonPath;
}
}
}
| Public Function CommonDirectoryPath(ParamArray Paths()) As String
Dim v As Variant
Dim Path() As String, s As String
Dim i As Long, j As Long, k As Long
Const PATH_SEPARATOR As String = "/"
For Each v In Paths
ReDim Preserve Path(0 To i)
Path(i) = v
i = i + 1
Next v
k = 1
Do
For i = 0 To UBound(Path)
If i Then
If InStr(k, Path(i), PATH_SEPARATOR) <> j Then
Exit Do
ElseIf Left$(Path(i), j) <> Left$(Path(0), j) Then
Exit Do
End If
Else
j = InStr(k, Path(i), PATH_SEPARATOR)
If j = 0 Then
Exit Do
End If
End If
Next i
s = Left$(Path(0), j + CLng(k <> 1))
k = j + 1
Loop
CommonDirectoryPath = s
End Function
Sub Main()
Debug.Assert CommonDirectoryPath( _
"/home/user1/tmp/coverage/test", _
"/home/user1/tmp/covert/operator", _
"/home/user1/tmp/coven/members") = _
"/home/user1/tmp"
Debug.Assert CommonDirectoryPath( _
"/home/user1/tmp/coverage/test", _
"/home/user1/tmp/covert/operator", _
"/home/user1/tmp/coven/members", _
"/home/user1/abc/coven/members") = _
"/home/user1"
Debug.Assert CommonDirectoryPath( _
"/home/user1/tmp/coverage/test", _
"/hope/user1/tmp/covert/operator", _
"/home/user1/tmp/coven/members") = _
"/"
End Sub
|
Rewrite the snippet below in VB so it works the same as the original C# code. | using System;
using System.Collections.Generic;
namespace RecamanSequence {
class Program {
static void Main(string[] args) {
List<int> a = new List<int>() { 0 };
HashSet<int> used = new HashSet<int>() { 0 };
HashSet<int> used1000 = new HashSet<int>() { 0 };
bool foundDup = false;
int n = 1;
while (n <= 15 || !foundDup || used1000.Count < 1001) {
int next = a[n - 1] - n;
if (next < 1 || used.Contains(next)) {
next += 2 * n;
}
bool alreadyUsed = used.Contains(next);
a.Add(next);
if (!alreadyUsed) {
used.Add(next);
if (0 <= next && next <= 1000) {
used1000.Add(next);
}
}
if (n == 14) {
Console.WriteLine("The first 15 terms of the Recaman sequence are: [{0}]", string.Join(", ", a));
}
if (!foundDup && alreadyUsed) {
Console.WriteLine("The first duplicated term is a[{0}] = {1}", n, next);
foundDup = true;
}
if (used1000.Count == 1001) {
Console.WriteLine("Terms up to a[{0}] are needed to generate 0 to 1000", n);
}
n++;
}
}
}
}
|
nx=15
h=1000
Wscript.StdOut.WriteLine "Recaman
Wscript.StdOut.WriteLine recaman("seq",nx)
Wscript.StdOut.WriteLine "The first duplicate number is: " & recaman("firstdup",0)
Wscript.StdOut.WriteLine "The number of terms to complete the range 0--->"& h &" is: "& recaman("numterm",h)
Wscript.StdOut.Write vbCrlf&".../...": zz=Wscript.StdIn.ReadLine()
function recaman(op,nn)
Dim b,d,h
Set b = CreateObject("Scripting.Dictionary")
Set d = CreateObject("Scripting.Dictionary")
list="0" : firstdup=0
if op="firstdup" then
nn=1000 : firstdup=1
end if
if op="numterm" then
h=nn : nn=10000000 : numterm=1
end if
ax=0
b.Add 0,1
s=0
for n=1 to nn-1
an=ax-n
if an<=0 then
an=ax+n
elseif b.Exists(an) then
an=ax+n
end if
ax=an
if not b.Exists(an) then b.Add an,1
if op="seq" then
list=list&" "&an
end if
if firstdup then
if d.Exists(an) then
recaman="a("&n&")="&an
exit function
else
d.Add an,1
end if
end if
if numterm then
if an<=h then
if not d.Exists(an) then
s=s+1
d.Add an,1
end if
if s>=h then
recaman=n
exit function
end if
end if
end if
next
recaman=list
end function
|
Change the programming language of this snippet from C# to VB without modifying what it does. | using System;
using System.Collections.Generic;
namespace RecamanSequence {
class Program {
static void Main(string[] args) {
List<int> a = new List<int>() { 0 };
HashSet<int> used = new HashSet<int>() { 0 };
HashSet<int> used1000 = new HashSet<int>() { 0 };
bool foundDup = false;
int n = 1;
while (n <= 15 || !foundDup || used1000.Count < 1001) {
int next = a[n - 1] - n;
if (next < 1 || used.Contains(next)) {
next += 2 * n;
}
bool alreadyUsed = used.Contains(next);
a.Add(next);
if (!alreadyUsed) {
used.Add(next);
if (0 <= next && next <= 1000) {
used1000.Add(next);
}
}
if (n == 14) {
Console.WriteLine("The first 15 terms of the Recaman sequence are: [{0}]", string.Join(", ", a));
}
if (!foundDup && alreadyUsed) {
Console.WriteLine("The first duplicated term is a[{0}] = {1}", n, next);
foundDup = true;
}
if (used1000.Count == 1001) {
Console.WriteLine("Terms up to a[{0}] are needed to generate 0 to 1000", n);
}
n++;
}
}
}
}
|
nx=15
h=1000
Wscript.StdOut.WriteLine "Recaman
Wscript.StdOut.WriteLine recaman("seq",nx)
Wscript.StdOut.WriteLine "The first duplicate number is: " & recaman("firstdup",0)
Wscript.StdOut.WriteLine "The number of terms to complete the range 0--->"& h &" is: "& recaman("numterm",h)
Wscript.StdOut.Write vbCrlf&".../...": zz=Wscript.StdIn.ReadLine()
function recaman(op,nn)
Dim b,d,h
Set b = CreateObject("Scripting.Dictionary")
Set d = CreateObject("Scripting.Dictionary")
list="0" : firstdup=0
if op="firstdup" then
nn=1000 : firstdup=1
end if
if op="numterm" then
h=nn : nn=10000000 : numterm=1
end if
ax=0
b.Add 0,1
s=0
for n=1 to nn-1
an=ax-n
if an<=0 then
an=ax+n
elseif b.Exists(an) then
an=ax+n
end if
ax=an
if not b.Exists(an) then b.Add an,1
if op="seq" then
list=list&" "&an
end if
if firstdup then
if d.Exists(an) then
recaman="a("&n&")="&an
exit function
else
d.Add an,1
end if
end if
if numterm then
if an<=h then
if not d.Exists(an) then
s=s+1
d.Add an,1
end if
if s>=h then
recaman=n
exit function
end if
end if
end if
next
recaman=list
end function
|
Port the following code from Go to Python with equivalent syntax and logic. | package main
import "fmt"
func bitwise(a, b int16) {
fmt.Printf("a: %016b\n", uint16(a))
fmt.Printf("b: %016b\n", uint16(b))
fmt.Printf("and: %016b\n", uint16(a&b))
fmt.Printf("or: %016b\n", uint16(a|b))
fmt.Printf("xor: %016b\n", uint16(a^b))
fmt.Printf("not: %016b\n", uint16(^a))
if b < 0 {
fmt.Println("Right operand is negative, but all shifts require an unsigned right operand (shift distance).")
return
}
ua := uint16(a)
ub := uint32(b)
fmt.Printf("shl: %016b\n", uint16(ua<<ub))
fmt.Printf("shr: %016b\n", uint16(ua>>ub))
fmt.Printf("las: %016b\n", uint16(a<<ub))
fmt.Printf("ras: %016b\n", uint16(a>>ub))
fmt.Printf("rol: %016b\n", uint16(a<<ub|int16(uint16(a)>>(16-ub))))
fmt.Printf("ror: %016b\n", uint16(int16(uint16(a)>>ub)|a<<(16-ub)))
}
func main() {
var a, b int16 = -460, 6
bitwise(a, b)
}
| def bitwise_built_ins(width, a, b):
mask = (1 << width) - 1
print(f)
def rotr(width, a, n):
"Rotate a, n times to the right"
if n < 0:
return rotl(width, a, -n)
elif n == 0:
return a
else:
mask = (1 << width) - 1
a, n = a & mask, n % width
return ((a >> n)
| ((a & ((1 << n) - 1))
<< (width - n)))
def rotl(width, a, n):
"Rotate a, n times to the left"
if n < 0:
return rotr(width, a, -n)
elif n == 0:
return a
else:
mask = (1 << width) - 1
a, n = a & mask, n % width
return (((a << n) & mask)
| (a >> (width - n)))
def asr(width, a, n):
"Arithmetic shift a, n times to the right. (sign preserving)."
mask, top_bit_mask = ((1 << width) - 1), 1 << (width - 1)
if n < 0:
return (a << -n) & mask
elif n == 0:
return a
elif n >= width:
return mask if a & top_bit_mask else 0
else:
a = a & mask
if a & top_bit_mask:
signs = (1 << n) - 1
return a >> n | (signs << width - n)
else:
return a >> n
def helper_funcs(width, a):
mask, top_bit_mask = ((1 << width) - 1), 1 << (width - 1)
aa = a | top_bit_mask
print(f)
if __name__ == '__main__':
bitwise_built_ins(8, 27, 125)
helper_funcs(8, 27)
|
Keep all operations the same but rewrite the snippet in Python. | package main
import (
"fmt"
"image"
"image/color"
"image/draw"
"image/png"
"math"
"os"
)
const sep = 512
const depth = 14
var s = math.Sqrt2 / 2
var sin = []float64{0, s, 1, s, 0, -s, -1, -s}
var cos = []float64{1, s, 0, -s, -1, -s, 0, s}
var p = color.NRGBA{64, 192, 96, 255}
var b *image.NRGBA
func main() {
width := sep * 11 / 6
height := sep * 4 / 3
bounds := image.Rect(0, 0, width, height)
b = image.NewNRGBA(bounds)
draw.Draw(b, bounds, image.NewUniform(color.White), image.ZP, draw.Src)
dragon(14, 0, 1, sep, sep/2, sep*5/6)
f, err := os.Create("dragon.png")
if err != nil {
fmt.Println(err)
return
}
if err = png.Encode(f, b); err != nil {
fmt.Println(err)
}
if err = f.Close(); err != nil {
fmt.Println(err)
}
}
func dragon(n, a, t int, d, x, y float64) {
if n <= 1 {
x1 := int(x + .5)
y1 := int(y + .5)
x2 := int(x + d*cos[a] + .5)
y2 := int(y + d*sin[a] + .5)
xInc := 1
if x1 > x2 {
xInc = -1
}
yInc := 1
if y1 > y2 {
yInc = -1
}
for x, y := x1, y1; ; x, y = x+xInc, y+yInc {
b.Set(x, y, p)
if x == x2 {
break
}
}
return
}
d *= s
a1 := (a - t) & 7
a2 := (a + t) & 7
dragon(n-1, a1, 1, d, x, y)
dragon(n-1, a2, -1, d, x+d*cos[a1], y+d*sin[a1])
}
| l = 3
ints = 13
def setup():
size(700, 600)
background(0, 0, 255)
translate(150, 100)
stroke(255)
turn_left(l, ints)
turn_right(l, ints)
def turn_right(l, ints):
if ints == 0:
line(0, 0, 0, -l)
translate(0, -l)
else:
turn_left(l, ints - 1)
rotate(radians(90))
turn_right(l, ints - 1)
def turn_left(l, ints):
if ints == 0:
line(0, 0, 0, -l)
translate(0, -l)
else:
turn_left(l, ints - 1)
rotate(radians(-90))
turn_right(l, ints - 1)
|
Rewrite this program in Python while keeping its functionality equivalent to the Go version. | package main
import (
"bufio"
"fmt"
"log"
"os"
)
func init() {
log.SetFlags(log.Lshortfile)
}
func main() {
inputFile, err := os.Open("byline.go")
if err != nil {
log.Fatal("Error opening input file:", err)
}
defer inputFile.Close()
scanner := bufio.NewScanner(inputFile)
for scanner.Scan() {
fmt.Println(scanner.Text())
}
if err := scanner.Err(); err != nil {
log.Fatal(scanner.Err())
}
}
| for line in lines open('input.txt'):
print line
|
Translate the given Go code snippet into Python without altering its behavior. | package main
import "fmt"
type dlNode struct {
string
next, prev *dlNode
}
type dlList struct {
head, tail *dlNode
}
func (list *dlList) String() string {
if list.head == nil {
return fmt.Sprint(list.head)
}
r := "[" + list.head.string
for p := list.head.next; p != nil; p = p.next {
r += " " + p.string
}
return r + "]"
}
func (list *dlList) insertTail(node *dlNode) {
if list.tail == nil {
list.head = node
} else {
list.tail.next = node
}
node.next = nil
node.prev = list.tail
list.tail = node
}
func (list *dlList) insertAfter(existing, insert *dlNode) {
insert.prev = existing
insert.next = existing.next
existing.next.prev = insert
existing.next = insert
if existing == list.tail {
list.tail = insert
}
}
func main() {
dll := &dlList{}
fmt.Println(dll)
a := &dlNode{string: "A"}
dll.insertTail(a)
dll.insertTail(&dlNode{string: "B"})
fmt.Println(dll)
dll.insertAfter(a, &dlNode{string: "C"})
fmt.Println(dll)
}
| def insert(anchor, new):
new.next = anchor.next
new.prev = anchor
anchor.next.prev = new
anchor.next = new
|
Produce a language-to-language conversion: from Go to Python, same semantics. | package main
import (
"fmt"
"math/big"
)
var b = new(big.Int)
func isSPDSPrime(n uint64) bool {
nn := n
for nn > 0 {
r := nn % 10
if r != 2 && r != 3 && r != 5 && r != 7 {
return false
}
nn /= 10
}
b.SetUint64(n)
if b.ProbablyPrime(0) {
return true
}
return false
}
func listSPDSPrimes(startFrom, countFrom, countTo uint64, printOne bool) uint64 {
count := countFrom
for n := startFrom; ; n += 2 {
if isSPDSPrime(n) {
count++
if !printOne {
fmt.Printf("%2d. %d\n", count, n)
}
if count == countTo {
if printOne {
fmt.Println(n)
}
return n
}
}
}
}
func main() {
fmt.Println("The first 25 terms of the Smarandache prime-digital sequence are:")
fmt.Println(" 1. 2")
n := listSPDSPrimes(3, 1, 25, false)
fmt.Println("\nHigher terms:")
indices := []uint64{25, 100, 200, 500, 1000, 2000, 5000, 10000, 20000, 50000, 100000}
for i := 1; i < len(indices); i++ {
fmt.Printf("%6d. ", indices[i])
n = listSPDSPrimes(n+2, indices[i-1], indices[i], true)
}
}
| def divisors(n):
divs = [1]
for ii in range(2, int(n ** 0.5) + 3):
if n % ii == 0:
divs.append(ii)
divs.append(int(n / ii))
divs.append(n)
return list(set(divs))
def is_prime(n):
return len(divisors(n)) == 2
def digit_check(n):
if len(str(n))<2:
return True
else:
for digit in str(n):
if not is_prime(int(digit)):
return False
return True
def sequence(max_n=None):
ii = 0
n = 0
while True:
ii += 1
if is_prime(ii):
if max_n is not None:
if n>max_n:
break
if digit_check(ii):
n += 1
yield ii
if __name__ == '__main__':
generator = sequence(100)
for index, item in zip(range(1, 16), generator):
print(index, item)
for index, item in zip(range(16, 100), generator):
pass
print(100, generator.__next__())
|
Write a version of this Go function in Python with identical behavior. | package main
import "fmt"
func quickselect(list []int, k int) int {
for {
px := len(list) / 2
pv := list[px]
last := len(list) - 1
list[px], list[last] = list[last], list[px]
i := 0
for j := 0; j < last; j++ {
if list[j] < pv {
list[i], list[j] = list[j], list[i]
i++
}
}
if i == k {
return pv
}
if k < i {
list = list[:i]
} else {
list[i], list[last] = list[last], list[i]
list = list[i+1:]
k -= i + 1
}
}
}
func main() {
for i := 0; ; i++ {
v := []int{9, 8, 7, 6, 5, 0, 1, 2, 3, 4}
if i == len(v) {
return
}
fmt.Println(quickselect(v, i))
}
}
| import random
def partition(vector, left, right, pivotIndex):
pivotValue = vector[pivotIndex]
vector[pivotIndex], vector[right] = vector[right], vector[pivotIndex]
storeIndex = left
for i in range(left, right):
if vector[i] < pivotValue:
vector[storeIndex], vector[i] = vector[i], vector[storeIndex]
storeIndex += 1
vector[right], vector[storeIndex] = vector[storeIndex], vector[right]
return storeIndex
def _select(vector, left, right, k):
"Returns the k-th smallest, (k >= 0), element of vector within vector[left:right+1] inclusive."
while True:
pivotIndex = random.randint(left, right)
pivotNewIndex = partition(vector, left, right, pivotIndex)
pivotDist = pivotNewIndex - left
if pivotDist == k:
return vector[pivotNewIndex]
elif k < pivotDist:
right = pivotNewIndex - 1
else:
k -= pivotDist + 1
left = pivotNewIndex + 1
def select(vector, k, left=None, right=None):
if left is None:
left = 0
lv1 = len(vector) - 1
if right is None:
right = lv1
assert vector and k >= 0, "Either null vector or k < 0 "
assert 0 <= left <= lv1, "left is out of range"
assert left <= right <= lv1, "right is out of range"
return _select(vector, left, right, k)
if __name__ == '__main__':
v = [9, 8, 7, 6, 5, 0, 1, 2, 3, 4]
print([select(v, i) for i in range(10)])
|
Produce a language-to-language conversion: from Go to Python, same semantics. | package main
import (
"fmt"
"math/big"
"strconv"
)
func main () {
s := strconv.FormatInt(26, 16)
fmt.Println(s)
i, err := strconv.ParseInt("1a", 16, 64)
if err == nil {
fmt.Println(i)
}
b, ok := new(big.Int).SetString("1a", 16)
if ok {
fmt.Println(b)
}
}
| i = int('1a',16)
|
Translate this program into Python but keep the logic exactly as in Go. | package main
import (
"fmt"
"os"
"path/filepath"
)
func VisitFile(fp string, fi os.FileInfo, err error) error {
if err != nil {
fmt.Println(err)
return nil
}
if fi.IsDir() {
return nil
}
matched, err := filepath.Match("*.mp3", fi.Name())
if err != nil {
fmt.Println(err)
return err
}
if matched {
fmt.Println(fp)
}
return nil
}
func main() {
filepath.Walk("/", VisitFile)
}
| from pathlib import Path
for path in Path('.').rglob('*.*'):
print(path)
|
Ensure the translated Python code behaves exactly like the original Go snippet. | package main
import "fmt"
type sBox [8][16]byte
type gost struct {
k87, k65, k43, k21 [256]byte
enc []byte
}
func newGost(s *sBox) *gost {
var g gost
for i := range g.k87 {
g.k87[i] = s[7][i>>4]<<4 | s[6][i&15]
g.k65[i] = s[5][i>>4]<<4 | s[4][i&15]
g.k43[i] = s[3][i>>4]<<4 | s[2][i&15]
g.k21[i] = s[1][i>>4]<<4 | s[0][i&15]
}
g.enc = make([]byte, 8)
return &g
}
func (g *gost) f(x uint32) uint32 {
x = uint32(g.k87[x>>24&255])<<24 | uint32(g.k65[x>>16&255])<<16 |
uint32(g.k43[x>>8&255])<<8 | uint32(g.k21[x&255])
return x<<11 | x>>(32-11)
}
var cbrf = sBox{
{4, 10, 9, 2, 13, 8, 0, 14, 6, 11, 1, 12, 7, 15, 5, 3},
{14, 11, 4, 12, 6, 13, 15, 10, 2, 3, 8, 1, 0, 7, 5, 9},
{5, 8, 1, 13, 10, 3, 4, 2, 14, 15, 12, 7, 6, 0, 9, 11},
{7, 13, 10, 1, 0, 8, 9, 15, 14, 4, 6, 12, 11, 2, 5, 3},
{6, 12, 7, 1, 5, 15, 13, 8, 4, 10, 9, 14, 0, 3, 11, 2},
{4, 11, 10, 0, 7, 2, 1, 13, 3, 6, 8, 5, 9, 12, 15, 14},
{13, 11, 4, 1, 3, 15, 5, 9, 0, 10, 14, 7, 6, 8, 2, 12},
{1, 15, 13, 0, 5, 7, 10, 4, 9, 2, 3, 14, 6, 11, 8, 12},
}
func u32(b []byte) uint32 {
return uint32(b[0]) | uint32(b[1])<<8 | uint32(b[2])<<16 | uint32(b[3])<<24
}
func b4(u uint32, b []byte) {
b[0] = byte(u)
b[1] = byte(u >> 8)
b[2] = byte(u >> 16)
b[3] = byte(u >> 24)
}
func (g *gost) mainStep(input []byte, key []byte) {
key32 := u32(key)
input1 := u32(input[:4])
input2 := u32(input[4:])
b4(g.f(key32+input1)^input2, g.enc[:4])
copy(g.enc[4:], input[:4])
}
func main() {
input := []byte{0x21, 0x04, 0x3B, 0x04, 0x30, 0x04, 0x32, 0x04}
key := []byte{0xF9, 0x04, 0xC1, 0xE2}
g := newGost(&cbrf)
g.mainStep(input, key)
for _, b := range g.enc {
fmt.Printf("[%02x]", b)
}
fmt.Println()
}
| k8 = [ 14, 4, 13, 1, 2, 15, 11, 8, 3, 10, 6, 12, 5, 9, 0, 7 ]
k7 = [ 15, 1, 8, 14, 6, 11, 3, 4, 9, 7, 2, 13, 12, 0, 5, 10 ]
k6 = [ 10, 0, 9, 14, 6, 3, 15, 5, 1, 13, 12, 7, 11, 4, 2, 8 ]
k5 = [ 7, 13, 14, 3, 0, 6, 9, 10, 1, 2, 8, 5, 11, 12, 4, 15 ]
k4 = [ 2, 12, 4, 1, 7, 10, 11, 6, 8, 5, 3, 15, 13, 0, 14, 9 ]
k3 = [ 12, 1, 10, 15, 9, 2, 6, 8, 0, 13, 3, 4, 14, 7, 5, 11 ]
k2 = [ 4, 11, 2, 14, 15, 0, 8, 13, 3, 12, 9, 7, 5, 10, 6, 1 ]
k1 = [ 13, 2, 8, 4, 6, 15, 11, 1, 10, 9, 3, 14, 5, 0, 12, 7 ]
k87 = [0] * 256
k65 = [0] * 256
k43 = [0] * 256
k21 = [0] * 256
def kboxinit():
for i in range(256):
k87[i] = k8[i >> 4] << 4 | k7[i & 15]
k65[i] = k6[i >> 4] << 4 | k5[i & 15]
k43[i] = k4[i >> 4] << 4 | k3[i & 15]
k21[i] = k2[i >> 4] << 4 | k1[i & 15]
def f(x):
x = ( k87[x>>24 & 255] << 24 | k65[x>>16 & 255] << 16 |
k43[x>> 8 & 255] << 8 | k21[x & 255] )
return x<<11 | x>>(32-11)
|
Please provide an equivalent version of this Go code in Python. | package main
import (
"fmt"
"unicode"
)
var states = []string{"Alabama", "Alaska", "Arizona", "Arkansas",
"California", "Colorado", "Connecticut",
"Delaware",
"Florida", "Georgia", "Hawaii",
"Idaho", "Illinois", "Indiana", "Iowa",
"Kansas", "Kentucky", "Louisiana",
"Maine", "Maryland", "Massachusetts", "Michigan",
"Minnesota", "Mississippi", "Missouri", "Montana",
"Nebraska", "Nevada", "New Hampshire", "New Jersey",
"New Mexico", "New York", "North Carolina", "North Dakota",
"Ohio", "Oklahoma", "Oregon",
"Pennsylvania", "Rhode Island",
"South Carolina", "South Dakota", "Tennessee", "Texas",
"Utah", "Vermont", "Virginia",
"Washington", "West Virginia", "Wisconsin", "Wyoming"}
func main() {
play(states)
play(append(states,
"New Kory", "Wen Kory", "York New", "Kory New", "New Kory"))
}
func play(states []string) {
fmt.Println(len(states), "states:")
set := make(map[string]bool, len(states))
for _, s := range states {
set[s] = true
}
s := make([]string, len(set))
h := make([][26]byte, len(set))
var i int
for us := range set {
s[i] = us
for _, c := range us {
if u := uint(unicode.ToLower(c)) - 'a'; u < 26 {
h[i][u]++
}
}
i++
}
type pair struct {
i1, i2 int
}
m := make(map[string][]pair)
b := make([]byte, 26)
for i1, h1 := range h {
for i2 := i1 + 1; i2 < len(h); i2++ {
for i := range b {
b[i] = h1[i] + h[i2][i]
}
k := string(b)
for _, x := range m[k] {
if i1 != x.i1 && i1 != x.i2 && i2 != x.i1 && i2 != x.i2 {
fmt.Printf("%s, %s = %s, %s\n", s[i1], s[i2],
s[x.i1], s[x.i2])
}
}
m[k] = append(m[k], pair{i1, i2})
}
}
}
| from collections import defaultdict
states = ["Alabama", "Alaska", "Arizona", "Arkansas",
"California", "Colorado", "Connecticut", "Delaware", "Florida",
"Georgia", "Hawaii", "Idaho", "Illinois", "Indiana", "Iowa", "Kansas",
"Kentucky", "Louisiana", "Maine", "Maryland", "Massachusetts",
"Michigan", "Minnesota", "Mississippi", "Missouri", "Montana",
"Nebraska", "Nevada", "New Hampshire", "New Jersey", "New Mexico",
"New York", "North Carolina", "North Dakota", "Ohio", "Oklahoma",
"Oregon", "Pennsylvania", "Rhode Island", "South Carolina",
"South Dakota", "Tennessee", "Texas", "Utah", "Vermont", "Virginia",
"Washington", "West Virginia", "Wisconsin", "Wyoming",
]
states = sorted(set(states))
smap = defaultdict(list)
for i, s1 in enumerate(states[:-1]):
for s2 in states[i + 1:]:
smap["".join(sorted(s1 + s2))].append(s1 + " + " + s2)
for pairs in sorted(smap.itervalues()):
if len(pairs) > 1:
print " = ".join(pairs)
|
Translate the given Go code snippet into Python without altering its behavior. | package main
import (
"fmt"
"hash/crc32"
)
func main() {
s := []byte("The quick brown fox jumps over the lazy dog")
result := crc32.ChecksumIEEE(s)
fmt.Printf("%X\n", result)
}
| >>> s = 'The quick brown fox jumps over the lazy dog'
>>> import zlib
>>> hex(zlib.crc32(s))
'0x414fa339'
>>> import binascii
>>> hex(binascii.crc32(s))
'0x414fa339'
|
Maintain the same structure and functionality when rewriting this code in Python. | package main
import (
"bytes"
"encoding/csv"
"fmt"
"html/template"
"strings"
)
var c = `Character,Speech
The multitude,The messiah! Show us the messiah!
Brians mother,<angry>Now you listen here! He's not the messiah; he's a very naughty boy! Now go away!</angry>
The multitude,Who are you?
Brians mother,I'm his mother; that's who!
The multitude,Behold his mother! Behold his mother!`
func main() {
if h, err := csvToHtml(c); err != nil {
fmt.Println(err)
} else {
fmt.Print(h)
}
}
func csvToHtml(c string) (string, error) {
data, err := csv.NewReader(bytes.NewBufferString(c)).ReadAll()
if err != nil {
return "", err
}
var b strings.Builder
err = template.Must(template.New("").Parse(`<table>
{{range .}} <tr>{{range .}}<td>{{.}}</td>{{end}}</tr>
{{end}}</table>
`)).Execute(&b, data)
return b.String(), err
}
| csvtxt =
from cgi import escape
def _row2tr(row, attr=None):
cols = escape(row).split(',')
return ('<TR>'
+ ''.join('<TD>%s</TD>' % data for data in cols)
+ '</TR>')
def csv2html(txt):
htmltxt = '<TABLE summary="csv2html program output">\n'
for rownum, row in enumerate(txt.split('\n')):
htmlrow = _row2tr(row)
htmlrow = ' <TBODY>%s</TBODY>\n' % htmlrow
htmltxt += htmlrow
htmltxt += '</TABLE>\n'
return htmltxt
htmltxt = csv2html(csvtxt)
print(htmltxt)
|
Transform the following Go implementation into Python, maintaining the same output and logic. | package main
import (
"bytes"
"encoding/csv"
"fmt"
"html/template"
"strings"
)
var c = `Character,Speech
The multitude,The messiah! Show us the messiah!
Brians mother,<angry>Now you listen here! He's not the messiah; he's a very naughty boy! Now go away!</angry>
The multitude,Who are you?
Brians mother,I'm his mother; that's who!
The multitude,Behold his mother! Behold his mother!`
func main() {
if h, err := csvToHtml(c); err != nil {
fmt.Println(err)
} else {
fmt.Print(h)
}
}
func csvToHtml(c string) (string, error) {
data, err := csv.NewReader(bytes.NewBufferString(c)).ReadAll()
if err != nil {
return "", err
}
var b strings.Builder
err = template.Must(template.New("").Parse(`<table>
{{range .}} <tr>{{range .}}<td>{{.}}</td>{{end}}</tr>
{{end}}</table>
`)).Execute(&b, data)
return b.String(), err
}
| csvtxt =
from cgi import escape
def _row2tr(row, attr=None):
cols = escape(row).split(',')
return ('<TR>'
+ ''.join('<TD>%s</TD>' % data for data in cols)
+ '</TR>')
def csv2html(txt):
htmltxt = '<TABLE summary="csv2html program output">\n'
for rownum, row in enumerate(txt.split('\n')):
htmlrow = _row2tr(row)
htmlrow = ' <TBODY>%s</TBODY>\n' % htmlrow
htmltxt += htmlrow
htmltxt += '</TABLE>\n'
return htmltxt
htmltxt = csv2html(csvtxt)
print(htmltxt)
|
Ensure the translated Python code behaves exactly like the original Go snippet. | package main
import "fmt"
type picnicBasket struct {
nServings int
corkscrew bool
}
func (b *picnicBasket) happy() bool {
return b.nServings > 1 && b.corkscrew
}
func newPicnicBasket(nPeople int) *picnicBasket {
return &picnicBasket{nPeople, nPeople > 0}
}
func main() {
var pb picnicBasket
pbl := picnicBasket{}
pbp := &picnicBasket{}
pbn := new(picnicBasket)
forTwo := newPicnicBasket(2)
forToo := &picnicBasket{nServings: 2, corkscrew: true}
fmt.Println(pb.nServings, pb.corkscrew)
fmt.Println(pbl.nServings, pbl.corkscrew)
fmt.Println(pbp)
fmt.Println(pbn)
fmt.Println(forTwo)
fmt.Println(forToo)
}
| class MyClass:
name2 = 2
def __init__(self):
self.name1 = 0
def someMethod(self):
self.name1 = 1
MyClass.name2 = 3
myclass = MyClass()
class MyOtherClass:
count = 0
def __init__(self, name, gender="Male", age=None):
MyOtherClass.count += 1
self.name = name
self.gender = gender
if age is not None:
self.age = age
def __del__(self):
MyOtherClass.count -= 1
person1 = MyOtherClass("John")
print person1.name, person1.gender
print person1.age
person2 = MyOtherClass("Jane", "Female", 23)
print person2.name, person2.gender, person2.age
|
Write the same algorithm in Python as shown in this Go implementation. | package main
import (
"fmt"
"strconv"
)
func kaprekar(n uint64, base uint64) (bool, int) {
order := 0
if n == 1 {
return true, -1
}
nn, power := n*n, uint64(1)
for power <= nn {
power *= base
order++
}
power /= base
order--
for ; power > 1; power /= base {
q, r := nn/power, nn%power
if q >= n {
return false, -1
}
if q+r == n {
return true, order
}
order--
}
return false, -1
}
func main() {
max := uint64(10000)
fmt.Printf("Kaprekar numbers < %d:\n", max)
for m := uint64(0); m < max; m++ {
if is, _ := kaprekar(m, 10); is {
fmt.Println(" ", m)
}
}
max = 1e6
var count int
for m := uint64(0); m < max; m++ {
if is, _ := kaprekar(m, 10); is {
count++
}
}
fmt.Printf("\nThere are %d Kaprekar numbers < %d.\n", count, max)
const base = 17
maxB := "1000000"
fmt.Printf("\nKaprekar numbers between 1 and %s(base %d):\n", maxB, base)
max, _ = strconv.ParseUint(maxB, base, 64)
fmt.Printf("\n Base 10 Base %d Square Split\n", base)
for m := uint64(2); m < max; m++ {
is, pos := kaprekar(m, base)
if !is {
continue
}
sq := strconv.FormatUint(m*m, base)
str := strconv.FormatUint(m, base)
split := len(sq)-pos
fmt.Printf("%8d %7s %12s %6s + %s\n", m,
str, sq, sq[:split], sq[split:])
}
}
| >>> def k(n):
n2 = str(n**2)
for i in range(len(n2)):
a, b = int(n2[:i] or 0), int(n2[i:])
if b and a + b == n:
return n
>>> [x for x in range(1,10000) if k(x)]
[1, 9, 45, 55, 99, 297, 703, 999, 2223, 2728, 4879, 4950, 5050, 5292, 7272, 7777, 9999]
>>> len([x for x in range(1,1000000) if k(x)])
54
>>>
|
Change the programming language of this snippet from Go to Python without modifying what it does. | package main
import (
"fmt"
"strconv"
)
func kaprekar(n uint64, base uint64) (bool, int) {
order := 0
if n == 1 {
return true, -1
}
nn, power := n*n, uint64(1)
for power <= nn {
power *= base
order++
}
power /= base
order--
for ; power > 1; power /= base {
q, r := nn/power, nn%power
if q >= n {
return false, -1
}
if q+r == n {
return true, order
}
order--
}
return false, -1
}
func main() {
max := uint64(10000)
fmt.Printf("Kaprekar numbers < %d:\n", max)
for m := uint64(0); m < max; m++ {
if is, _ := kaprekar(m, 10); is {
fmt.Println(" ", m)
}
}
max = 1e6
var count int
for m := uint64(0); m < max; m++ {
if is, _ := kaprekar(m, 10); is {
count++
}
}
fmt.Printf("\nThere are %d Kaprekar numbers < %d.\n", count, max)
const base = 17
maxB := "1000000"
fmt.Printf("\nKaprekar numbers between 1 and %s(base %d):\n", maxB, base)
max, _ = strconv.ParseUint(maxB, base, 64)
fmt.Printf("\n Base 10 Base %d Square Split\n", base)
for m := uint64(2); m < max; m++ {
is, pos := kaprekar(m, base)
if !is {
continue
}
sq := strconv.FormatUint(m*m, base)
str := strconv.FormatUint(m, base)
split := len(sq)-pos
fmt.Printf("%8d %7s %12s %6s + %s\n", m,
str, sq, sq[:split], sq[split:])
}
}
| >>> def k(n):
n2 = str(n**2)
for i in range(len(n2)):
a, b = int(n2[:i] or 0), int(n2[i:])
if b and a + b == n:
return n
>>> [x for x in range(1,10000) if k(x)]
[1, 9, 45, 55, 99, 297, 703, 999, 2223, 2728, 4879, 4950, 5050, 5292, 7272, 7777, 9999]
>>> len([x for x in range(1,1000000) if k(x)])
54
>>>
|
Translate this program into Python but keep the logic exactly as in Go. | package main
import (
"fmt"
"log"
"strings"
)
func compress(uncompressed string) []int {
dictSize := 256
dictionary := make(map[string]int, dictSize)
for i := 0; i < dictSize; i++ {
dictionary[string([]byte{byte(i)})] = i
}
var result []int
var w []byte
for i := 0; i < len(uncompressed); i++ {
c := uncompressed[i]
wc := append(w, c)
if _, ok := dictionary[string(wc)]; ok {
w = wc
} else {
result = append(result, dictionary[string(w)])
dictionary[string(wc)] = dictSize
dictSize++
wc[0] = c
w = wc[:1]
}
}
if len(w) > 0 {
result = append(result, dictionary[string(w)])
}
return result
}
type BadSymbolError int
func (e BadSymbolError) Error() string {
return fmt.Sprint("Bad compressed symbol ", int(e))
}
func decompress(compressed []int) (string, error) {
dictSize := 256
dictionary := make(map[int][]byte, dictSize)
for i := 0; i < dictSize; i++ {
dictionary[i] = []byte{byte(i)}
}
var result strings.Builder
var w []byte
for _, k := range compressed {
var entry []byte
if x, ok := dictionary[k]; ok {
entry = x[:len(x):len(x)]
} else if k == dictSize && len(w) > 0 {
entry = append(w, w[0])
} else {
return result.String(), BadSymbolError(k)
}
result.Write(entry)
if len(w) > 0 {
w = append(w, entry[0])
dictionary[dictSize] = w
dictSize++
}
w = entry
}
return result.String(), nil
}
func main() {
compressed := compress("TOBEORNOTTOBEORTOBEORNOT")
fmt.Println(compressed)
decompressed, err := decompress(compressed)
if err != nil {
log.Fatal(err)
}
fmt.Println(decompressed)
}
| def compress(uncompressed):
dict_size = 256
dictionary = dict((chr(i), i) for i in range(dict_size))
w = ""
result = []
for c in uncompressed:
wc = w + c
if wc in dictionary:
w = wc
else:
result.append(dictionary[w])
dictionary[wc] = dict_size
dict_size += 1
w = c
if w:
result.append(dictionary[w])
return result
def decompress(compressed):
from io import StringIO
dict_size = 256
dictionary = dict((i, chr(i)) for i in range(dict_size))
result = StringIO()
w = chr(compressed.pop(0))
result.write(w)
for k in compressed:
if k in dictionary:
entry = dictionary[k]
elif k == dict_size:
entry = w + w[0]
else:
raise ValueError('Bad compressed k: %s' % k)
result.write(entry)
dictionary[dict_size] = w + entry[0]
dict_size += 1
w = entry
return result.getvalue()
compressed = compress('TOBEORNOTTOBEORTOBEORNOT')
print (compressed)
decompressed = decompress(compressed)
print (decompressed)
|
Change the programming language of this snippet from Go to Python without modifying what it does. | package main
import "fmt"
var ffr, ffs func(int) int
func init() {
r := []int{0, 1}
s := []int{0, 2}
ffr = func(n int) int {
for len(r) <= n {
nrk := len(r) - 1
rNxt := r[nrk] + s[nrk]
r = append(r, rNxt)
for sn := r[nrk] + 2; sn < rNxt; sn++ {
s = append(s, sn)
}
s = append(s, rNxt+1)
}
return r[n]
}
ffs = func(n int) int {
for len(s) <= n {
ffr(len(r))
}
return s[n]
}
}
func main() {
for n := 1; n <= 10; n++ {
fmt.Printf("r(%d): %d\n", n, ffr(n))
}
var found [1001]int
for n := 1; n <= 40; n++ {
found[ffr(n)]++
}
for n := 1; n <= 960; n++ {
found[ffs(n)]++
}
for i := 1; i <= 1000; i++ {
if found[i] != 1 {
fmt.Println("task 4: FAIL")
return
}
}
fmt.Println("task 4: PASS")
}
| def ffr(n):
if n < 1 or type(n) != int: raise ValueError("n must be an int >= 1")
try:
return ffr.r[n]
except IndexError:
r, s = ffr.r, ffs.s
ffr_n_1 = ffr(n-1)
lastr = r[-1]
s += list(range(s[-1] + 1, lastr))
if s[-1] < lastr: s += [lastr + 1]
len_s = len(s)
ffs_n_1 = s[n-1] if len_s > n else (n - len_s) + s[-1]
ans = ffr_n_1 + ffs_n_1
r.append(ans)
return ans
ffr.r = [None, 1]
def ffs(n):
if n < 1 or type(n) != int: raise ValueError("n must be an int >= 1")
try:
return ffs.s[n]
except IndexError:
r, s = ffr.r, ffs.s
for i in range(len(r), n+2):
ffr(i)
if len(s) > n:
return s[n]
raise Exception("Whoops!")
ffs.s = [None, 2]
if __name__ == '__main__':
first10 = [ffr(i) for i in range(1,11)]
assert first10 == [1, 3, 7, 12, 18, 26, 35, 45, 56, 69], "ffr() value error(s)"
print("ffr(n) for n = [1..10] is", first10)
bin = [None] + [0]*1000
for i in range(40, 0, -1):
bin[ffr(i)] += 1
for i in range(960, 0, -1):
bin[ffs(i)] += 1
if all(b == 1 for b in bin[1:1000]):
print("All Integers 1..1000 found OK")
else:
print("All Integers 1..1000 NOT found only once: ERROR")
|
Port the following code from Go to Python with equivalent syntax and logic. | package main
import "fmt"
var ffr, ffs func(int) int
func init() {
r := []int{0, 1}
s := []int{0, 2}
ffr = func(n int) int {
for len(r) <= n {
nrk := len(r) - 1
rNxt := r[nrk] + s[nrk]
r = append(r, rNxt)
for sn := r[nrk] + 2; sn < rNxt; sn++ {
s = append(s, sn)
}
s = append(s, rNxt+1)
}
return r[n]
}
ffs = func(n int) int {
for len(s) <= n {
ffr(len(r))
}
return s[n]
}
}
func main() {
for n := 1; n <= 10; n++ {
fmt.Printf("r(%d): %d\n", n, ffr(n))
}
var found [1001]int
for n := 1; n <= 40; n++ {
found[ffr(n)]++
}
for n := 1; n <= 960; n++ {
found[ffs(n)]++
}
for i := 1; i <= 1000; i++ {
if found[i] != 1 {
fmt.Println("task 4: FAIL")
return
}
}
fmt.Println("task 4: PASS")
}
| def ffr(n):
if n < 1 or type(n) != int: raise ValueError("n must be an int >= 1")
try:
return ffr.r[n]
except IndexError:
r, s = ffr.r, ffs.s
ffr_n_1 = ffr(n-1)
lastr = r[-1]
s += list(range(s[-1] + 1, lastr))
if s[-1] < lastr: s += [lastr + 1]
len_s = len(s)
ffs_n_1 = s[n-1] if len_s > n else (n - len_s) + s[-1]
ans = ffr_n_1 + ffs_n_1
r.append(ans)
return ans
ffr.r = [None, 1]
def ffs(n):
if n < 1 or type(n) != int: raise ValueError("n must be an int >= 1")
try:
return ffs.s[n]
except IndexError:
r, s = ffr.r, ffs.s
for i in range(len(r), n+2):
ffr(i)
if len(s) > n:
return s[n]
raise Exception("Whoops!")
ffs.s = [None, 2]
if __name__ == '__main__':
first10 = [ffr(i) for i in range(1,11)]
assert first10 == [1, 3, 7, 12, 18, 26, 35, 45, 56, 69], "ffr() value error(s)"
print("ffr(n) for n = [1..10] is", first10)
bin = [None] + [0]*1000
for i in range(40, 0, -1):
bin[ffr(i)] += 1
for i in range(960, 0, -1):
bin[ffs(i)] += 1
if all(b == 1 for b in bin[1:1000]):
print("All Integers 1..1000 found OK")
else:
print("All Integers 1..1000 NOT found only once: ERROR")
|
Produce a language-to-language conversion: from Go to Python, same semantics. | package main
import (
"fmt"
"log"
)
func ms(n int) (int, []int) {
M := func(x int) int { return (x + n - 1) % n }
if n <= 0 || n&1 == 0 {
n = 5
log.Println("forcing size", n)
}
m := make([]int, n*n)
i, j := 0, n/2
for k := 1; k <= n*n; k++ {
m[i*n+j] = k
if m[M(i)*n+M(j)] != 0 {
i = (i + 1) % n
} else {
i, j = M(i), M(j)
}
}
return n, m
}
func main() {
n, m := ms(5)
i := 2
for j := 1; j <= n*n; j *= 10 {
i++
}
f := fmt.Sprintf("%%%dd", i)
for i := 0; i < n; i++ {
for j := 0; j < n; j++ {
fmt.Printf(f, m[i*n+j])
}
fmt.Println()
}
}
| >>> def magic(n):
for row in range(1, n + 1):
print(' '.join('%*i' % (len(str(n**2)), cell) for cell in
(n * ((row + col - 1 + n // 2) % n) +
((row + 2 * col - 2) % n) + 1
for col in range(1, n + 1))))
print('\nAll sum to magic number %i' % ((n * n + 1) * n // 2))
>>> for n in (5, 3, 7):
print('\nOrder %i\n=======' % n)
magic(n)
Order 5
=======
17 24 1 8 15
23 5 7 14 16
4 6 13 20 22
10 12 19 21 3
11 18 25 2 9
All sum to magic number 65
Order 3
=======
8 1 6
3 5 7
4 9 2
All sum to magic number 15
Order 7
=======
30 39 48 1 10 19 28
38 47 7 9 18 27 29
46 6 8 17 26 35 37
5 14 16 25 34 36 45
13 15 24 33 42 44 4
21 23 32 41 43 3 12
22 31 40 49 2 11 20
All sum to magic number 175
>>>
|
Preserve the algorithm and functionality while converting the code from Go to Python. | package main
import (
"fmt"
"log"
)
func ms(n int) (int, []int) {
M := func(x int) int { return (x + n - 1) % n }
if n <= 0 || n&1 == 0 {
n = 5
log.Println("forcing size", n)
}
m := make([]int, n*n)
i, j := 0, n/2
for k := 1; k <= n*n; k++ {
m[i*n+j] = k
if m[M(i)*n+M(j)] != 0 {
i = (i + 1) % n
} else {
i, j = M(i), M(j)
}
}
return n, m
}
func main() {
n, m := ms(5)
i := 2
for j := 1; j <= n*n; j *= 10 {
i++
}
f := fmt.Sprintf("%%%dd", i)
for i := 0; i < n; i++ {
for j := 0; j < n; j++ {
fmt.Printf(f, m[i*n+j])
}
fmt.Println()
}
}
| >>> def magic(n):
for row in range(1, n + 1):
print(' '.join('%*i' % (len(str(n**2)), cell) for cell in
(n * ((row + col - 1 + n // 2) % n) +
((row + 2 * col - 2) % n) + 1
for col in range(1, n + 1))))
print('\nAll sum to magic number %i' % ((n * n + 1) * n // 2))
>>> for n in (5, 3, 7):
print('\nOrder %i\n=======' % n)
magic(n)
Order 5
=======
17 24 1 8 15
23 5 7 14 16
4 6 13 20 22
10 12 19 21 3
11 18 25 2 9
All sum to magic number 65
Order 3
=======
8 1 6
3 5 7
4 9 2
All sum to magic number 15
Order 7
=======
30 39 48 1 10 19 28
38 47 7 9 18 27 29
46 6 8 17 26 35 37
5 14 16 25 34 36 45
13 15 24 33 42 44 4
21 23 32 41 43 3 12
22 31 40 49 2 11 20
All sum to magic number 175
>>>
|
Produce a language-to-language conversion: from Go to Python, same semantics. | package main
import (
"fmt"
"log"
"os/exec"
)
func gcd(x, y int) int {
for y != 0 {
x, y = y, x%y
}
return x
}
func yellowstone(n int) []int {
m := make(map[int]bool)
a := make([]int, n+1)
for i := 1; i < 4; i++ {
a[i] = i
m[i] = true
}
min := 4
for c := 4; c <= n; c++ {
for i := min; ; i++ {
if !m[i] && gcd(a[c-1], i) == 1 && gcd(a[c-2], i) > 1 {
a[c] = i
m[i] = true
if i == min {
min++
}
break
}
}
}
return a[1:]
}
func check(err error) {
if err != nil {
log.Fatal(err)
}
}
func main() {
x := make([]int, 100)
for i := 0; i < 100; i++ {
x[i] = i + 1
}
y := yellowstone(100)
fmt.Println("The first 30 Yellowstone numbers are:")
fmt.Println(y[:30])
g := exec.Command("gnuplot", "-persist")
w, err := g.StdinPipe()
check(err)
check(g.Start())
fmt.Fprintln(w, "unset key; plot '-'")
for i, xi := range x {
fmt.Fprintf(w, "%d %d\n", xi, y[i])
}
fmt.Fprintln(w, "e")
w.Close()
g.Wait()
}
|
from itertools import chain, count, islice
from operator import itemgetter
from math import gcd
from matplotlib import pyplot
def yellowstone():
def relativelyPrime(a):
return lambda b: 1 == gcd(a, b)
def nextWindow(triple):
p2, p1, rest = triple
[rp2, rp1] = map(relativelyPrime, [p2, p1])
def match(xxs):
x, xs = uncons(xxs)['Just']
return (x, xs) if rp1(x) and not rp2(x) else (
second(cons(x))(
match(xs)
)
)
n, residue = match(rest)
return (p1, n, residue)
return chain(
range(1, 3),
map(
itemgetter(1),
iterate(nextWindow)(
(2, 3, count(4))
)
)
)
def main():
print(showList(
take(30)(yellowstone())
))
pyplot.plot(
take(100)(yellowstone())
)
pyplot.xlabel(main.__doc__)
pyplot.show()
def Just(x):
return {'type': 'Maybe', 'Nothing': False, 'Just': x}
def Nothing():
return {'type': 'Maybe', 'Nothing': True}
def cons(x):
return lambda xs: [x] + xs if (
isinstance(xs, list)
) else x + xs if (
isinstance(xs, str)
) else chain([x], xs)
def iterate(f):
def go(x):
v = x
while True:
yield v
v = f(v)
return go
def second(f):
return lambda xy: (xy[0], f(xy[1]))
def showList(xs):
return '[' + ','.join(repr(x) for x in xs) + ']'
def take(n):
return lambda xs: (
xs[0:n]
if isinstance(xs, (list, tuple))
else list(islice(xs, n))
)
def uncons(xs):
if isinstance(xs, list):
return Just((xs[0], xs[1:])) if xs else Nothing()
else:
nxt = take(1)(xs)
return Just((nxt[0], xs)) if nxt else Nothing()
if __name__ == '__main__':
main()
|
Produce a functionally identical Python code for the snippet given in Go. | package main
import (
"fmt"
"log"
"os/exec"
)
func gcd(x, y int) int {
for y != 0 {
x, y = y, x%y
}
return x
}
func yellowstone(n int) []int {
m := make(map[int]bool)
a := make([]int, n+1)
for i := 1; i < 4; i++ {
a[i] = i
m[i] = true
}
min := 4
for c := 4; c <= n; c++ {
for i := min; ; i++ {
if !m[i] && gcd(a[c-1], i) == 1 && gcd(a[c-2], i) > 1 {
a[c] = i
m[i] = true
if i == min {
min++
}
break
}
}
}
return a[1:]
}
func check(err error) {
if err != nil {
log.Fatal(err)
}
}
func main() {
x := make([]int, 100)
for i := 0; i < 100; i++ {
x[i] = i + 1
}
y := yellowstone(100)
fmt.Println("The first 30 Yellowstone numbers are:")
fmt.Println(y[:30])
g := exec.Command("gnuplot", "-persist")
w, err := g.StdinPipe()
check(err)
check(g.Start())
fmt.Fprintln(w, "unset key; plot '-'")
for i, xi := range x {
fmt.Fprintf(w, "%d %d\n", xi, y[i])
}
fmt.Fprintln(w, "e")
w.Close()
g.Wait()
}
|
from itertools import chain, count, islice
from operator import itemgetter
from math import gcd
from matplotlib import pyplot
def yellowstone():
def relativelyPrime(a):
return lambda b: 1 == gcd(a, b)
def nextWindow(triple):
p2, p1, rest = triple
[rp2, rp1] = map(relativelyPrime, [p2, p1])
def match(xxs):
x, xs = uncons(xxs)['Just']
return (x, xs) if rp1(x) and not rp2(x) else (
second(cons(x))(
match(xs)
)
)
n, residue = match(rest)
return (p1, n, residue)
return chain(
range(1, 3),
map(
itemgetter(1),
iterate(nextWindow)(
(2, 3, count(4))
)
)
)
def main():
print(showList(
take(30)(yellowstone())
))
pyplot.plot(
take(100)(yellowstone())
)
pyplot.xlabel(main.__doc__)
pyplot.show()
def Just(x):
return {'type': 'Maybe', 'Nothing': False, 'Just': x}
def Nothing():
return {'type': 'Maybe', 'Nothing': True}
def cons(x):
return lambda xs: [x] + xs if (
isinstance(xs, list)
) else x + xs if (
isinstance(xs, str)
) else chain([x], xs)
def iterate(f):
def go(x):
v = x
while True:
yield v
v = f(v)
return go
def second(f):
return lambda xy: (xy[0], f(xy[1]))
def showList(xs):
return '[' + ','.join(repr(x) for x in xs) + ']'
def take(n):
return lambda xs: (
xs[0:n]
if isinstance(xs, (list, tuple))
else list(islice(xs, n))
)
def uncons(xs):
if isinstance(xs, list):
return Just((xs[0], xs[1:])) if xs else Nothing()
else:
nxt = take(1)(xs)
return Just((nxt[0], xs)) if nxt else Nothing()
if __name__ == '__main__':
main()
|
Produce a language-to-language conversion: from Go to Python, same semantics. | package main
import (
"fmt"
"log"
"os/exec"
)
func gcd(x, y int) int {
for y != 0 {
x, y = y, x%y
}
return x
}
func yellowstone(n int) []int {
m := make(map[int]bool)
a := make([]int, n+1)
for i := 1; i < 4; i++ {
a[i] = i
m[i] = true
}
min := 4
for c := 4; c <= n; c++ {
for i := min; ; i++ {
if !m[i] && gcd(a[c-1], i) == 1 && gcd(a[c-2], i) > 1 {
a[c] = i
m[i] = true
if i == min {
min++
}
break
}
}
}
return a[1:]
}
func check(err error) {
if err != nil {
log.Fatal(err)
}
}
func main() {
x := make([]int, 100)
for i := 0; i < 100; i++ {
x[i] = i + 1
}
y := yellowstone(100)
fmt.Println("The first 30 Yellowstone numbers are:")
fmt.Println(y[:30])
g := exec.Command("gnuplot", "-persist")
w, err := g.StdinPipe()
check(err)
check(g.Start())
fmt.Fprintln(w, "unset key; plot '-'")
for i, xi := range x {
fmt.Fprintf(w, "%d %d\n", xi, y[i])
}
fmt.Fprintln(w, "e")
w.Close()
g.Wait()
}
|
from itertools import chain, count, islice
from operator import itemgetter
from math import gcd
from matplotlib import pyplot
def yellowstone():
def relativelyPrime(a):
return lambda b: 1 == gcd(a, b)
def nextWindow(triple):
p2, p1, rest = triple
[rp2, rp1] = map(relativelyPrime, [p2, p1])
def match(xxs):
x, xs = uncons(xxs)['Just']
return (x, xs) if rp1(x) and not rp2(x) else (
second(cons(x))(
match(xs)
)
)
n, residue = match(rest)
return (p1, n, residue)
return chain(
range(1, 3),
map(
itemgetter(1),
iterate(nextWindow)(
(2, 3, count(4))
)
)
)
def main():
print(showList(
take(30)(yellowstone())
))
pyplot.plot(
take(100)(yellowstone())
)
pyplot.xlabel(main.__doc__)
pyplot.show()
def Just(x):
return {'type': 'Maybe', 'Nothing': False, 'Just': x}
def Nothing():
return {'type': 'Maybe', 'Nothing': True}
def cons(x):
return lambda xs: [x] + xs if (
isinstance(xs, list)
) else x + xs if (
isinstance(xs, str)
) else chain([x], xs)
def iterate(f):
def go(x):
v = x
while True:
yield v
v = f(v)
return go
def second(f):
return lambda xy: (xy[0], f(xy[1]))
def showList(xs):
return '[' + ','.join(repr(x) for x in xs) + ']'
def take(n):
return lambda xs: (
xs[0:n]
if isinstance(xs, (list, tuple))
else list(islice(xs, n))
)
def uncons(xs):
if isinstance(xs, list):
return Just((xs[0], xs[1:])) if xs else Nothing()
else:
nxt = take(1)(xs)
return Just((nxt[0], xs)) if nxt else Nothing()
if __name__ == '__main__':
main()
|
Please provide an equivalent version of this Go code in Python. | package main
import "fmt"
var grid []byte
var w, h, last int
var cnt int
var next [4]int
var dir = [4][2]int{{0, -1}, {-1, 0}, {0, 1}, {1, 0}}
func walk(y, x int) {
if y == 0 || y == h || x == 0 || x == w {
cnt += 2
return
}
t := y*(w+1) + x
grid[t]++
grid[last-t]++
for i, d := range dir {
if grid[t+next[i]] == 0 {
walk(y+d[0], x+d[1])
}
}
grid[t]--
grid[last-t]--
}
func solve(hh, ww, recur int) int {
h = hh
w = ww
if h&1 != 0 {
h, w = w, h
}
switch {
case h&1 == 1:
return 0
case w == 1:
return 1
case w == 2:
return h
case h == 2:
return w
}
cy := h / 2
cx := w / 2
grid = make([]byte, (h+1)*(w+1))
last = len(grid) - 1
next[0] = -1
next[1] = -w - 1
next[2] = 1
next[3] = w + 1
if recur != 0 {
cnt = 0
}
for x := cx + 1; x < w; x++ {
t := cy*(w+1) + x
grid[t] = 1
grid[last-t] = 1
walk(cy-1, x)
}
cnt++
if h == w {
cnt *= 2
} else if w&1 == 0 && recur != 0 {
solve(w, h, 0)
}
return cnt
}
func main() {
for y := 1; y <= 10; y++ {
for x := 1; x <= y; x++ {
if x&1 == 0 || y&1 == 0 {
fmt.Printf("%d x %d: %d\n", y, x, solve(y, x, 1))
}
}
}
}
| def cut_it(h, w):
dirs = ((1, 0), (-1, 0), (0, -1), (0, 1))
if h % 2: h, w = w, h
if h % 2: return 0
if w == 1: return 1
count = 0
next = [w + 1, -w - 1, -1, 1]
blen = (h + 1) * (w + 1) - 1
grid = [False] * (blen + 1)
def walk(y, x, count):
if not y or y == h or not x or x == w:
return count + 1
t = y * (w + 1) + x
grid[t] = grid[blen - t] = True
if not grid[t + next[0]]:
count = walk(y + dirs[0][0], x + dirs[0][1], count)
if not grid[t + next[1]]:
count = walk(y + dirs[1][0], x + dirs[1][1], count)
if not grid[t + next[2]]:
count = walk(y + dirs[2][0], x + dirs[2][1], count)
if not grid[t + next[3]]:
count = walk(y + dirs[3][0], x + dirs[3][1], count)
grid[t] = grid[blen - t] = False
return count
t = h // 2 * (w + 1) + w // 2
if w % 2:
grid[t] = grid[t + 1] = True
count = walk(h // 2, w // 2 - 1, count)
res = count
count = 0
count = walk(h // 2 - 1, w // 2, count)
return res + count * 2
else:
grid[t] = True
count = walk(h // 2, w // 2 - 1, count)
if h == w:
return count * 2
count = walk(h // 2 - 1, w // 2, count)
return count
def main():
for w in xrange(1, 10):
for h in xrange(1, w + 1):
if not((w * h) % 2):
print "%d x %d: %d" % (w, h, cut_it(w, h))
main()
|
Ensure the translated Python code behaves exactly like the original Go snippet. | package main
import "fmt"
var grid []byte
var w, h, last int
var cnt int
var next [4]int
var dir = [4][2]int{{0, -1}, {-1, 0}, {0, 1}, {1, 0}}
func walk(y, x int) {
if y == 0 || y == h || x == 0 || x == w {
cnt += 2
return
}
t := y*(w+1) + x
grid[t]++
grid[last-t]++
for i, d := range dir {
if grid[t+next[i]] == 0 {
walk(y+d[0], x+d[1])
}
}
grid[t]--
grid[last-t]--
}
func solve(hh, ww, recur int) int {
h = hh
w = ww
if h&1 != 0 {
h, w = w, h
}
switch {
case h&1 == 1:
return 0
case w == 1:
return 1
case w == 2:
return h
case h == 2:
return w
}
cy := h / 2
cx := w / 2
grid = make([]byte, (h+1)*(w+1))
last = len(grid) - 1
next[0] = -1
next[1] = -w - 1
next[2] = 1
next[3] = w + 1
if recur != 0 {
cnt = 0
}
for x := cx + 1; x < w; x++ {
t := cy*(w+1) + x
grid[t] = 1
grid[last-t] = 1
walk(cy-1, x)
}
cnt++
if h == w {
cnt *= 2
} else if w&1 == 0 && recur != 0 {
solve(w, h, 0)
}
return cnt
}
func main() {
for y := 1; y <= 10; y++ {
for x := 1; x <= y; x++ {
if x&1 == 0 || y&1 == 0 {
fmt.Printf("%d x %d: %d\n", y, x, solve(y, x, 1))
}
}
}
}
| def cut_it(h, w):
dirs = ((1, 0), (-1, 0), (0, -1), (0, 1))
if h % 2: h, w = w, h
if h % 2: return 0
if w == 1: return 1
count = 0
next = [w + 1, -w - 1, -1, 1]
blen = (h + 1) * (w + 1) - 1
grid = [False] * (blen + 1)
def walk(y, x, count):
if not y or y == h or not x or x == w:
return count + 1
t = y * (w + 1) + x
grid[t] = grid[blen - t] = True
if not grid[t + next[0]]:
count = walk(y + dirs[0][0], x + dirs[0][1], count)
if not grid[t + next[1]]:
count = walk(y + dirs[1][0], x + dirs[1][1], count)
if not grid[t + next[2]]:
count = walk(y + dirs[2][0], x + dirs[2][1], count)
if not grid[t + next[3]]:
count = walk(y + dirs[3][0], x + dirs[3][1], count)
grid[t] = grid[blen - t] = False
return count
t = h // 2 * (w + 1) + w // 2
if w % 2:
grid[t] = grid[t + 1] = True
count = walk(h // 2, w // 2 - 1, count)
res = count
count = 0
count = walk(h // 2 - 1, w // 2, count)
return res + count * 2
else:
grid[t] = True
count = walk(h // 2, w // 2 - 1, count)
if h == w:
return count * 2
count = walk(h // 2 - 1, w // 2, count)
return count
def main():
for w in xrange(1, 10):
for h in xrange(1, w + 1):
if not((w * h) % 2):
print "%d x %d: %d" % (w, h, cut_it(w, h))
main()
|
Please provide an equivalent version of this Go code in Python. | package main
import "fmt"
func mertens(to int) ([]int, int, int) {
if to < 1 {
to = 1
}
merts := make([]int, to+1)
primes := []int{2}
var sum, zeros, crosses int
for i := 1; i <= to; i++ {
j := i
cp := 0
spf := false
for _, p := range primes {
if p > j {
break
}
if j%p == 0 {
j /= p
cp++
}
if j%p == 0 {
spf = true
break
}
}
if cp == 0 && i > 2 {
cp = 1
primes = append(primes, i)
}
if !spf {
if cp%2 == 0 {
sum++
} else {
sum--
}
}
merts[i] = sum
if sum == 0 {
zeros++
if i > 1 && merts[i-1] != 0 {
crosses++
}
}
}
return merts, zeros, crosses
}
func main() {
merts, zeros, crosses := mertens(1000)
fmt.Println("Mertens sequence - First 199 terms:")
for i := 0; i < 200; i++ {
if i == 0 {
fmt.Print(" ")
continue
}
if i%20 == 0 {
fmt.Println()
}
fmt.Printf(" % d", merts[i])
}
fmt.Println("\n\nEquals zero", zeros, "times between 1 and 1000")
fmt.Println("\nCrosses zero", crosses, "times between 1 and 1000")
}
| def mertens(count):
m = [None, 1]
for n in range(2, count+1):
m.append(1)
for k in range(2, n+1):
m[n] -= m[n//k]
return m
ms = mertens(1000)
print("The first 99 Mertens numbers are:")
print(" ", end=' ')
col = 1
for n in ms[1:100]:
print("{:2d}".format(n), end=' ')
col += 1
if col == 10:
print()
col = 0
zeroes = sum(x==0 for x in ms)
crosses = sum(a!=0 and b==0 for a,b in zip(ms, ms[1:]))
print("M(N) equals zero {} times.".format(zeroes))
print("M(N) crosses zero {} times.".format(crosses))
|
Please provide an equivalent version of this Go code in Python. | package main
import "fmt"
func mertens(to int) ([]int, int, int) {
if to < 1 {
to = 1
}
merts := make([]int, to+1)
primes := []int{2}
var sum, zeros, crosses int
for i := 1; i <= to; i++ {
j := i
cp := 0
spf := false
for _, p := range primes {
if p > j {
break
}
if j%p == 0 {
j /= p
cp++
}
if j%p == 0 {
spf = true
break
}
}
if cp == 0 && i > 2 {
cp = 1
primes = append(primes, i)
}
if !spf {
if cp%2 == 0 {
sum++
} else {
sum--
}
}
merts[i] = sum
if sum == 0 {
zeros++
if i > 1 && merts[i-1] != 0 {
crosses++
}
}
}
return merts, zeros, crosses
}
func main() {
merts, zeros, crosses := mertens(1000)
fmt.Println("Mertens sequence - First 199 terms:")
for i := 0; i < 200; i++ {
if i == 0 {
fmt.Print(" ")
continue
}
if i%20 == 0 {
fmt.Println()
}
fmt.Printf(" % d", merts[i])
}
fmt.Println("\n\nEquals zero", zeros, "times between 1 and 1000")
fmt.Println("\nCrosses zero", crosses, "times between 1 and 1000")
}
| def mertens(count):
m = [None, 1]
for n in range(2, count+1):
m.append(1)
for k in range(2, n+1):
m[n] -= m[n//k]
return m
ms = mertens(1000)
print("The first 99 Mertens numbers are:")
print(" ", end=' ')
col = 1
for n in ms[1:100]:
print("{:2d}".format(n), end=' ')
col += 1
if col == 10:
print()
col = 0
zeroes = sum(x==0 for x in ms)
crosses = sum(a!=0 and b==0 for a,b in zip(ms, ms[1:]))
print("M(N) equals zero {} times.".format(zeroes))
print("M(N) crosses zero {} times.".format(crosses))
|
Rewrite the snippet below in Python so it works the same as the original Go code. | package main
import (
"fmt"
"sort"
"strings"
)
var count int = 0
func interactiveCompare(s1, s2 string) bool {
count++
fmt.Printf("(%d) Is %s < %s? ", count, s1, s2)
var response string
_, err := fmt.Scanln(&response)
return err == nil && strings.HasPrefix(response, "y")
}
func main() {
items := []string{"violet", "red", "green", "indigo", "blue", "yellow", "orange"}
var sortedItems []string
for _, item := range items {
fmt.Printf("Inserting '%s' into %s\n", item, sortedItems)
spotToInsert := sort.Search(len(sortedItems), func(i int) bool {
return interactiveCompare(item, sortedItems[i])
})
sortedItems = append(sortedItems[:spotToInsert],
append([]string{item}, sortedItems[spotToInsert:]...)...)
}
fmt.Println(sortedItems)
}
| def _insort_right(a, x, q):
lo, hi = 0, len(a)
while lo < hi:
mid = (lo+hi)//2
q += 1
less = input(f"{q:2}: IS {x:>6} LESS-THAN {a[mid]:>6} ? y/n: ").strip().lower() == 'y'
if less: hi = mid
else: lo = mid+1
a.insert(lo, x)
return q
def order(items):
ordered, q = [], 0
for item in items:
q = _insort_right(ordered, item, q)
return ordered, q
if __name__ == '__main__':
items = 'violet red green indigo blue yellow orange'.split()
ans, questions = order(items)
print('\n' + ' '.join(ans))
|
Ensure the translated Python code behaves exactly like the original Go snippet. | package main
import (
"fmt"
"math"
)
func Fib1000() []float64 {
a, b, r := 0., 1., [1000]float64{}
for i := range r {
r[i], a, b = b, b, b+a
}
return r[:]
}
func main() {
show(Fib1000(), "First 1000 Fibonacci numbers")
}
func show(c []float64, title string) {
var f [9]int
for _, v := range c {
f[fmt.Sprintf("%g", v)[0]-'1']++
}
fmt.Println(title)
fmt.Println("Digit Observed Predicted")
for i, n := range f {
fmt.Printf(" %d %9.3f %8.3f\n", i+1, float64(n)/float64(len(c)),
math.Log10(1+1/float64(i+1)))
}
}
| from __future__ import division
from itertools import islice, count
from collections import Counter
from math import log10
from random import randint
expected = [log10(1+1/d) for d in range(1,10)]
def fib():
a,b = 1,1
while True:
yield a
a,b = b,a+b
def power_of_threes():
return (3**k for k in count(0))
def heads(s):
for a in s: yield int(str(a)[0])
def show_dist(title, s):
c = Counter(s)
size = sum(c.values())
res = [c[d]/size for d in range(1,10)]
print("\n%s Benfords deviation" % title)
for r, e in zip(res, expected):
print("%5.1f%% %5.1f%% %5.1f%%" % (r*100., e*100., abs(r - e)*100.))
def rand1000():
while True: yield randint(1,9999)
if __name__ == '__main__':
show_dist("fibbed", islice(heads(fib()), 1000))
show_dist("threes", islice(heads(power_of_threes()), 1000))
show_dist("random", islice(heads(rand1000()), 10000))
|
Maintain the same structure and functionality when rewriting this code in Python. | package main
import (
"fmt"
"math"
)
func Fib1000() []float64 {
a, b, r := 0., 1., [1000]float64{}
for i := range r {
r[i], a, b = b, b, b+a
}
return r[:]
}
func main() {
show(Fib1000(), "First 1000 Fibonacci numbers")
}
func show(c []float64, title string) {
var f [9]int
for _, v := range c {
f[fmt.Sprintf("%g", v)[0]-'1']++
}
fmt.Println(title)
fmt.Println("Digit Observed Predicted")
for i, n := range f {
fmt.Printf(" %d %9.3f %8.3f\n", i+1, float64(n)/float64(len(c)),
math.Log10(1+1/float64(i+1)))
}
}
| from __future__ import division
from itertools import islice, count
from collections import Counter
from math import log10
from random import randint
expected = [log10(1+1/d) for d in range(1,10)]
def fib():
a,b = 1,1
while True:
yield a
a,b = b,a+b
def power_of_threes():
return (3**k for k in count(0))
def heads(s):
for a in s: yield int(str(a)[0])
def show_dist(title, s):
c = Counter(s)
size = sum(c.values())
res = [c[d]/size for d in range(1,10)]
print("\n%s Benfords deviation" % title)
for r, e in zip(res, expected):
print("%5.1f%% %5.1f%% %5.1f%%" % (r*100., e*100., abs(r - e)*100.))
def rand1000():
while True: yield randint(1,9999)
if __name__ == '__main__':
show_dist("fibbed", islice(heads(fib()), 1000))
show_dist("threes", islice(heads(power_of_threes()), 1000))
show_dist("random", islice(heads(rand1000()), 10000))
|
Preserve the algorithm and functionality while converting the code from Go to Python. | package main
import (
"fmt"
"strings"
"time"
)
func main() {
watches := []string{
"First", "Middle", "Morning", "Forenoon",
"Afternoon", "Dog", "First",
}
for {
t := time.Now()
h := t.Hour()
m := t.Minute()
s := t.Second()
if (m == 0 || m == 30) && s == 0 {
bell := 0
if m == 30 {
bell = 1
}
bells := (h*2 + bell) % 8
watch := h/4 + 1
if bells == 0 {
bells = 8
watch--
}
sound := strings.Repeat("\a", bells)
pl := "s"
if bells == 1 {
pl = " "
}
w := watches[watch] + " watch"
if watch == 5 {
if bells < 5 {
w = "First " + w
} else {
w = "Last " + w
}
}
fmt.Printf("%s%02d:%02d = %d bell%s : %s\n", sound, h, m, bells, pl, w)
}
time.Sleep(1 * time.Second)
}
}
| import time, calendar, sched, winsound
duration = 750
freq = 1280
bellchar = "\u2407"
watches = 'Middle,Morning,Forenoon,Afternoon,First/Last dog,First'.split(',')
def gap(n=1):
time.sleep(n * duration / 1000)
off = gap
def on(n=1):
winsound.Beep(freq, n * duration)
def bong():
on(); off(0.5)
def bongs(m):
for i in range(m):
print(bellchar, end=' ')
bong()
if i % 2:
print(' ', end='')
off(0.5)
print('')
scheds = sched.scheduler(time.time, time.sleep)
def ships_bell(now=None):
def adjust_to_half_hour(atime):
atime[4] = (atime[4] // 30) * 30
atime[5] = 0
return atime
debug = now is not None
rightnow = time.gmtime()
if not debug:
now = adjust_to_half_hour( list(rightnow) )
then = now[::]
then[4] += 30
hr, mn = now[3:5]
watch, b = divmod(int(2 * hr + mn // 30 - 1), 8)
b += 1
bells = '%i bell%s' % (b, 's' if b > 1 else ' ')
if debug:
print("%02i:%02i, %-20s %s" % (now[3], now[4], watches[watch] + ' watch', bells), end=' ')
else:
print("%02i:%02i, %-20s %s" % (rightnow[3], rightnow[4], watches[watch] + ' watch', bells), end=' ')
bongs(b)
if not debug:
scheds.enterabs(calendar.timegm(then), 0, ships_bell)
scheds.run()
def dbg_tester():
for h in range(24):
for m in (0, 30):
if (h,m) == (24,30): break
ships_bell( [2013, 3, 2, h, m, 15, 5, 61, 0] )
if __name__ == '__main__':
ships_bell()
|
Translate this program into Python but keep the logic exactly as in Go. | package main
import (
"fmt"
"strings"
"time"
)
func main() {
watches := []string{
"First", "Middle", "Morning", "Forenoon",
"Afternoon", "Dog", "First",
}
for {
t := time.Now()
h := t.Hour()
m := t.Minute()
s := t.Second()
if (m == 0 || m == 30) && s == 0 {
bell := 0
if m == 30 {
bell = 1
}
bells := (h*2 + bell) % 8
watch := h/4 + 1
if bells == 0 {
bells = 8
watch--
}
sound := strings.Repeat("\a", bells)
pl := "s"
if bells == 1 {
pl = " "
}
w := watches[watch] + " watch"
if watch == 5 {
if bells < 5 {
w = "First " + w
} else {
w = "Last " + w
}
}
fmt.Printf("%s%02d:%02d = %d bell%s : %s\n", sound, h, m, bells, pl, w)
}
time.Sleep(1 * time.Second)
}
}
| import time, calendar, sched, winsound
duration = 750
freq = 1280
bellchar = "\u2407"
watches = 'Middle,Morning,Forenoon,Afternoon,First/Last dog,First'.split(',')
def gap(n=1):
time.sleep(n * duration / 1000)
off = gap
def on(n=1):
winsound.Beep(freq, n * duration)
def bong():
on(); off(0.5)
def bongs(m):
for i in range(m):
print(bellchar, end=' ')
bong()
if i % 2:
print(' ', end='')
off(0.5)
print('')
scheds = sched.scheduler(time.time, time.sleep)
def ships_bell(now=None):
def adjust_to_half_hour(atime):
atime[4] = (atime[4] // 30) * 30
atime[5] = 0
return atime
debug = now is not None
rightnow = time.gmtime()
if not debug:
now = adjust_to_half_hour( list(rightnow) )
then = now[::]
then[4] += 30
hr, mn = now[3:5]
watch, b = divmod(int(2 * hr + mn // 30 - 1), 8)
b += 1
bells = '%i bell%s' % (b, 's' if b > 1 else ' ')
if debug:
print("%02i:%02i, %-20s %s" % (now[3], now[4], watches[watch] + ' watch', bells), end=' ')
else:
print("%02i:%02i, %-20s %s" % (rightnow[3], rightnow[4], watches[watch] + ' watch', bells), end=' ')
bongs(b)
if not debug:
scheds.enterabs(calendar.timegm(then), 0, ships_bell)
scheds.run()
def dbg_tester():
for h in range(24):
for m in (0, 30):
if (h,m) == (24,30): break
ships_bell( [2013, 3, 2, h, m, 15, 5, 61, 0] )
if __name__ == '__main__':
ships_bell()
|
Generate an equivalent Python version of this Go code. | package main
import "fmt"
func main() {
for _, n := range []int{0, 1, 2, 3, 4, 5, 10, 40, -1} {
f, ok := arFib(n)
if ok {
fmt.Printf("fib %d = %d\n", n, f)
} else {
fmt.Println("fib undefined for negative numbers")
}
}
}
func arFib(n int) (int, bool) {
switch {
case n < 0:
return 0, false
case n < 2:
return n, true
}
return yc(func(recurse fn) fn {
return func(left, term1, term2 int) int {
if left == 0 {
return term1+term2
}
return recurse(left-1, term1+term2, term1)
}
})(n-2, 1, 0), true
}
type fn func(int, int, int) int
type ff func(fn) fn
type fx func(fx) fn
func yc(f ff) fn {
return func(x fx) fn {
return x(x)
}(func(x fx) fn {
return f(func(a1, a2, a3 int) int {
return x(x)(a1, a2, a3)
})
})
}
| >>> Y = lambda f: (lambda x: x(x))(lambda y: f(lambda *args: y(y)(*args)))
>>> fib = lambda f: lambda n: None if n < 0 else (0 if n == 0 else (1 if n == 1 else f(n-1) + f(n-2)))
>>> [ Y(fib)(i) for i in range(-2, 10) ]
[None, None, 0, 1, 1, 2, 3, 5, 8, 13, 21, 34]
|
Port the provided Go code into Python while preserving the original functionality. | package main
import (
"fmt"
"unicode/utf8"
)
func main() {
s := "ASCII"
fmt.Println("String: ", s)
fmt.Println("First byte removed: ", s[1:])
fmt.Println("Last byte removed: ", s[:len(s)-1])
fmt.Println("First and last removed:", s[1:len(s)-1])
u := "Δημοτική"
fmt.Println("String: ", u)
_, sizeFirst := utf8.DecodeRuneInString(u)
fmt.Println("First rune removed: ", u[sizeFirst:])
_, sizeLast := utf8.DecodeLastRuneInString(u)
fmt.Println("Last rune removed: ", u[:len(u)-sizeLast])
fmt.Println("First and last removed:", u[sizeFirst:len(u)-sizeLast])
}
| print "knight"[1:]
print "socks"[:-1]
print "brooms"[1:-1]
|
Produce a functionally identical Python code for the snippet given in Go. | package main
import (
"fmt"
"unicode/utf8"
)
func main() {
s := "ASCII"
fmt.Println("String: ", s)
fmt.Println("First byte removed: ", s[1:])
fmt.Println("Last byte removed: ", s[:len(s)-1])
fmt.Println("First and last removed:", s[1:len(s)-1])
u := "Δημοτική"
fmt.Println("String: ", u)
_, sizeFirst := utf8.DecodeRuneInString(u)
fmt.Println("First rune removed: ", u[sizeFirst:])
_, sizeLast := utf8.DecodeLastRuneInString(u)
fmt.Println("Last rune removed: ", u[:len(u)-sizeLast])
fmt.Println("First and last removed:", u[sizeFirst:len(u)-sizeLast])
}
| print "knight"[1:]
print "socks"[:-1]
print "brooms"[1:-1]
|
Change the programming language of this snippet from Go to Python without modifying what it does. | package main
import (
"fmt"
"unicode/utf8"
)
func main() {
s := "ASCII"
fmt.Println("String: ", s)
fmt.Println("First byte removed: ", s[1:])
fmt.Println("Last byte removed: ", s[:len(s)-1])
fmt.Println("First and last removed:", s[1:len(s)-1])
u := "Δημοτική"
fmt.Println("String: ", u)
_, sizeFirst := utf8.DecodeRuneInString(u)
fmt.Println("First rune removed: ", u[sizeFirst:])
_, sizeLast := utf8.DecodeLastRuneInString(u)
fmt.Println("Last rune removed: ", u[:len(u)-sizeLast])
fmt.Println("First and last removed:", u[sizeFirst:len(u)-sizeLast])
}
| print "knight"[1:]
print "socks"[:-1]
print "brooms"[1:-1]
|
Rewrite this program in Python while keeping its functionality equivalent to the Go version. | package main
import (
"fmt"
"log"
"math"
"rcu"
)
func cantorPair(x, y int) int {
if x < 0 || y < 0 {
log.Fatal("Arguments must be non-negative integers.")
}
return (x*x + 3*x + 2*x*y + y + y*y) / 2
}
func pi(n int) int {
if n < 2 {
return 0
}
if n == 2 {
return 1
}
primes := rcu.Primes(int(math.Sqrt(float64(n))))
a := len(primes)
memoPhi := make(map[int]int)
var phi func(x, a int) int
phi = func(x, a int) int {
if a < 1 {
return x
}
if a == 1 {
return x - (x >> 1)
}
pa := primes[a-1]
if x <= pa {
return 1
}
key := cantorPair(x, a)
if v, ok := memoPhi[key]; ok {
return v
}
memoPhi[key] = phi(x, a-1) - phi(x/pa, a-1)
return memoPhi[key]
}
return phi(n, a) + a - 1
}
func main() {
for i, n := 0, 1; i <= 9; i, n = i+1, n*10 {
fmt.Printf("10^%d %d\n", i, pi(n))
}
}
| from primesieve import primes
from math import isqrt
from functools import cache
p = primes(isqrt(1_000_000_000))
@cache
def phi(x, a):
res = 0
while True:
if not a or not x:
return x + res
a -= 1
res -= phi(x//p[a], a)
def legpi(n):
if n < 2: return 0
a = legpi(isqrt(n))
return phi(n, a) + a - 1
for e in range(10):
print(f'10^{e}', legpi(10**e))
|
Port the following code from Go to Python with equivalent syntax and logic. | package main
import "C"
import "unsafe"
func main() {
C.Run()
}
const msg = "Here am I"
func Query(cbuf *C.char, csiz *C.size_t) C.int {
if int(*csiz) <= len(msg) {
return 0
}
pbuf := uintptr(unsafe.Pointer(cbuf))
for i := 0; i < len(msg); i++ {
*((*byte)(unsafe.Pointer(pbuf))) = msg[i]
pbuf++
}
*((*byte)(unsafe.Pointer(pbuf))) = 0
*csiz = C.size_t(len(msg) + 1)
return 1
}
|
def query(buffer_length):
message = b'Here am I'
L = len(message)
return message[0:L*(L <= buffer_length)]
|
Produce a functionally identical Python code for the snippet given in Go. | package main
import (
"bufio"
"os"
)
func main() {
in := bufio.NewReader(os.Stdin)
var blankLine = "\n"
var printLongest func(string) string
printLongest = func(candidate string) (longest string) {
longest = candidate
s, err := in.ReadString('\n')
defer func() {
recover()
defer func() {
recover()
}()
_ = blankLine[0]
func() {
defer func() {
recover()
}()
_ = s[len(longest)]
longest = s
}()
longest = printLongest(longest)
func() {
defer func() {
recover()
os.Stdout.WriteString(s)
}()
_ = longest[len(s)]
s = ""
}()
}()
_ = err.(error)
os.Stdout.WriteString(blankLine)
blankLine = ""
return
}
printLongest("")
}
| import fileinput
def longer(a, b):
try:
b[len(a)-1]
return False
except:
return True
longest, lines = '', ''
for x in fileinput.input():
if longer(x, longest):
lines, longest = x, x
elif not longer(longest, x):
lines += x
print(lines, end='')
|
Produce a functionally identical Python code for the snippet given in Go. | package turing
type Symbol byte
type Motion byte
const (
Left Motion = 'L'
Right Motion = 'R'
Stay Motion = 'N'
)
type Tape struct {
data []Symbol
pos, left int
blank Symbol
}
func NewTape(blank Symbol, start int, data []Symbol) *Tape {
t := &Tape{
data: data,
blank: blank,
}
if start < 0 {
t.Left(-start)
}
t.Right(start)
return t
}
func (t *Tape) Stay() {}
func (t *Tape) Data() []Symbol { return t.data[t.left:] }
func (t *Tape) Read() Symbol { return t.data[t.pos] }
func (t *Tape) Write(s Symbol) { t.data[t.pos] = s }
func (t *Tape) Dup() *Tape {
t2 := &Tape{
data: make([]Symbol, len(t.Data())),
blank: t.blank,
}
copy(t2.data, t.Data())
t2.pos = t.pos - t.left
return t2
}
func (t *Tape) String() string {
s := ""
for i := t.left; i < len(t.data); i++ {
b := t.data[i]
if i == t.pos {
s += "[" + string(b) + "]"
} else {
s += " " + string(b) + " "
}
}
return s
}
func (t *Tape) Move(a Motion) {
switch a {
case Left:
t.Left(1)
case Right:
t.Right(1)
case Stay:
t.Stay()
}
}
const minSz = 16
func (t *Tape) Left(n int) {
t.pos -= n
if t.pos < 0 {
var sz int
for sz = minSz; cap(t.data[t.left:])-t.pos >= sz; sz <<= 1 {
}
newd := make([]Symbol, sz)
newl := len(newd) - cap(t.data[t.left:])
n := copy(newd[newl:], t.data[t.left:])
t.data = newd[:newl+n]
t.pos += newl - t.left
t.left = newl
}
if t.pos < t.left {
if t.blank != 0 {
for i := t.pos; i < t.left; i++ {
t.data[i] = t.blank
}
}
t.left = t.pos
}
}
func (t *Tape) Right(n int) {
t.pos += n
if t.pos >= cap(t.data) {
var sz int
for sz = minSz; t.pos >= sz; sz <<= 1 {
}
newd := make([]Symbol, sz)
n := copy(newd[t.left:], t.data[t.left:])
t.data = newd[:t.left+n]
}
if i := len(t.data); t.pos >= i {
t.data = t.data[:t.pos+1]
if t.blank != 0 {
for ; i < len(t.data); i++ {
t.data[i] = t.blank
}
}
}
}
type State string
type Rule struct {
State
Symbol
Write Symbol
Motion
Next State
}
func (i *Rule) key() key { return key{i.State, i.Symbol} }
func (i *Rule) action() action { return action{i.Write, i.Motion, i.Next} }
type key struct {
State
Symbol
}
type action struct {
write Symbol
Motion
next State
}
type Machine struct {
tape *Tape
start, state State
transition map[key]action
l func(string, ...interface{})
}
func NewMachine(rules []Rule) *Machine {
m := &Machine{transition: make(map[key]action, len(rules))}
if len(rules) > 0 {
m.start = rules[0].State
}
for _, r := range rules {
m.transition[r.key()] = r.action()
}
return m
}
func (m *Machine) Run(input *Tape) (int, *Tape) {
m.tape = input.Dup()
m.state = m.start
for cnt := 0; ; cnt++ {
if m.l != nil {
m.l("%3d %4s: %v\n", cnt, m.state, m.tape)
}
sym := m.tape.Read()
act, ok := m.transition[key{m.state, sym}]
if !ok {
return cnt, m.tape
}
m.tape.Write(act.write)
m.tape.Move(act.Motion)
m.state = act.next
}
}
| from __future__ import print_function
def run_utm(
state = None,
blank = None,
rules = [],
tape = [],
halt = None,
pos = 0):
st = state
if not tape: tape = [blank]
if pos < 0: pos += len(tape)
if pos >= len(tape) or pos < 0: raise Error( "bad init position")
rules = dict(((s0, v0), (v1, dr, s1)) for (s0, v0, v1, dr, s1) in rules)
while True:
print(st, '\t', end=" ")
for i, v in enumerate(tape):
if i == pos: print("[%s]" % (v,), end=" ")
else: print(v, end=" ")
print()
if st == halt: break
if (st, tape[pos]) not in rules: break
(v1, dr, s1) = rules[(st, tape[pos])]
tape[pos] = v1
if dr == 'left':
if pos > 0: pos -= 1
else: tape.insert(0, blank)
if dr == 'right':
pos += 1
if pos >= len(tape): tape.append(blank)
st = s1
print("incr machine\n")
run_utm(
halt = 'qf',
state = 'q0',
tape = list("111"),
blank = 'B',
rules = map(tuple,
["q0 1 1 right q0".split(),
"q0 B 1 stay qf".split()]
)
)
print("\nbusy beaver\n")
run_utm(
halt = 'halt',
state = 'a',
blank = '0',
rules = map(tuple,
["a 0 1 right b".split(),
"a 1 1 left c".split(),
"b 0 1 left a".split(),
"b 1 1 right b".split(),
"c 0 1 left b".split(),
"c 1 1 stay halt".split()]
)
)
print("\nsorting test\n")
run_utm(halt = 'STOP',
state = 'A',
blank = '0',
tape = "2 2 2 1 2 2 1 2 1 2 1 2 1 2".split(),
rules = map(tuple,
["A 1 1 right A".split(),
"A 2 3 right B".split(),
"A 0 0 left E".split(),
"B 1 1 right B".split(),
"B 2 2 right B".split(),
"B 0 0 left C".split(),
"C 1 2 left D".split(),
"C 2 2 left C".split(),
"C 3 2 left E".split(),
"D 1 1 left D".split(),
"D 2 2 left D".split(),
"D 3 1 right A".split(),
"E 1 1 left E".split(),
"E 0 0 right STOP".split()]
)
)
|
Generate a Python translation of this Go snippet without changing its computational steps. | package turing
type Symbol byte
type Motion byte
const (
Left Motion = 'L'
Right Motion = 'R'
Stay Motion = 'N'
)
type Tape struct {
data []Symbol
pos, left int
blank Symbol
}
func NewTape(blank Symbol, start int, data []Symbol) *Tape {
t := &Tape{
data: data,
blank: blank,
}
if start < 0 {
t.Left(-start)
}
t.Right(start)
return t
}
func (t *Tape) Stay() {}
func (t *Tape) Data() []Symbol { return t.data[t.left:] }
func (t *Tape) Read() Symbol { return t.data[t.pos] }
func (t *Tape) Write(s Symbol) { t.data[t.pos] = s }
func (t *Tape) Dup() *Tape {
t2 := &Tape{
data: make([]Symbol, len(t.Data())),
blank: t.blank,
}
copy(t2.data, t.Data())
t2.pos = t.pos - t.left
return t2
}
func (t *Tape) String() string {
s := ""
for i := t.left; i < len(t.data); i++ {
b := t.data[i]
if i == t.pos {
s += "[" + string(b) + "]"
} else {
s += " " + string(b) + " "
}
}
return s
}
func (t *Tape) Move(a Motion) {
switch a {
case Left:
t.Left(1)
case Right:
t.Right(1)
case Stay:
t.Stay()
}
}
const minSz = 16
func (t *Tape) Left(n int) {
t.pos -= n
if t.pos < 0 {
var sz int
for sz = minSz; cap(t.data[t.left:])-t.pos >= sz; sz <<= 1 {
}
newd := make([]Symbol, sz)
newl := len(newd) - cap(t.data[t.left:])
n := copy(newd[newl:], t.data[t.left:])
t.data = newd[:newl+n]
t.pos += newl - t.left
t.left = newl
}
if t.pos < t.left {
if t.blank != 0 {
for i := t.pos; i < t.left; i++ {
t.data[i] = t.blank
}
}
t.left = t.pos
}
}
func (t *Tape) Right(n int) {
t.pos += n
if t.pos >= cap(t.data) {
var sz int
for sz = minSz; t.pos >= sz; sz <<= 1 {
}
newd := make([]Symbol, sz)
n := copy(newd[t.left:], t.data[t.left:])
t.data = newd[:t.left+n]
}
if i := len(t.data); t.pos >= i {
t.data = t.data[:t.pos+1]
if t.blank != 0 {
for ; i < len(t.data); i++ {
t.data[i] = t.blank
}
}
}
}
type State string
type Rule struct {
State
Symbol
Write Symbol
Motion
Next State
}
func (i *Rule) key() key { return key{i.State, i.Symbol} }
func (i *Rule) action() action { return action{i.Write, i.Motion, i.Next} }
type key struct {
State
Symbol
}
type action struct {
write Symbol
Motion
next State
}
type Machine struct {
tape *Tape
start, state State
transition map[key]action
l func(string, ...interface{})
}
func NewMachine(rules []Rule) *Machine {
m := &Machine{transition: make(map[key]action, len(rules))}
if len(rules) > 0 {
m.start = rules[0].State
}
for _, r := range rules {
m.transition[r.key()] = r.action()
}
return m
}
func (m *Machine) Run(input *Tape) (int, *Tape) {
m.tape = input.Dup()
m.state = m.start
for cnt := 0; ; cnt++ {
if m.l != nil {
m.l("%3d %4s: %v\n", cnt, m.state, m.tape)
}
sym := m.tape.Read()
act, ok := m.transition[key{m.state, sym}]
if !ok {
return cnt, m.tape
}
m.tape.Write(act.write)
m.tape.Move(act.Motion)
m.state = act.next
}
}
| from __future__ import print_function
def run_utm(
state = None,
blank = None,
rules = [],
tape = [],
halt = None,
pos = 0):
st = state
if not tape: tape = [blank]
if pos < 0: pos += len(tape)
if pos >= len(tape) or pos < 0: raise Error( "bad init position")
rules = dict(((s0, v0), (v1, dr, s1)) for (s0, v0, v1, dr, s1) in rules)
while True:
print(st, '\t', end=" ")
for i, v in enumerate(tape):
if i == pos: print("[%s]" % (v,), end=" ")
else: print(v, end=" ")
print()
if st == halt: break
if (st, tape[pos]) not in rules: break
(v1, dr, s1) = rules[(st, tape[pos])]
tape[pos] = v1
if dr == 'left':
if pos > 0: pos -= 1
else: tape.insert(0, blank)
if dr == 'right':
pos += 1
if pos >= len(tape): tape.append(blank)
st = s1
print("incr machine\n")
run_utm(
halt = 'qf',
state = 'q0',
tape = list("111"),
blank = 'B',
rules = map(tuple,
["q0 1 1 right q0".split(),
"q0 B 1 stay qf".split()]
)
)
print("\nbusy beaver\n")
run_utm(
halt = 'halt',
state = 'a',
blank = '0',
rules = map(tuple,
["a 0 1 right b".split(),
"a 1 1 left c".split(),
"b 0 1 left a".split(),
"b 1 1 right b".split(),
"c 0 1 left b".split(),
"c 1 1 stay halt".split()]
)
)
print("\nsorting test\n")
run_utm(halt = 'STOP',
state = 'A',
blank = '0',
tape = "2 2 2 1 2 2 1 2 1 2 1 2 1 2".split(),
rules = map(tuple,
["A 1 1 right A".split(),
"A 2 3 right B".split(),
"A 0 0 left E".split(),
"B 1 1 right B".split(),
"B 2 2 right B".split(),
"B 0 0 left C".split(),
"C 1 2 left D".split(),
"C 2 2 left C".split(),
"C 3 2 left E".split(),
"D 1 1 left D".split(),
"D 2 2 left D".split(),
"D 3 1 right A".split(),
"E 1 1 left E".split(),
"E 0 0 right STOP".split()]
)
)
|
Convert this Go block to Python, preserving its control flow and logic. | package turing
type Symbol byte
type Motion byte
const (
Left Motion = 'L'
Right Motion = 'R'
Stay Motion = 'N'
)
type Tape struct {
data []Symbol
pos, left int
blank Symbol
}
func NewTape(blank Symbol, start int, data []Symbol) *Tape {
t := &Tape{
data: data,
blank: blank,
}
if start < 0 {
t.Left(-start)
}
t.Right(start)
return t
}
func (t *Tape) Stay() {}
func (t *Tape) Data() []Symbol { return t.data[t.left:] }
func (t *Tape) Read() Symbol { return t.data[t.pos] }
func (t *Tape) Write(s Symbol) { t.data[t.pos] = s }
func (t *Tape) Dup() *Tape {
t2 := &Tape{
data: make([]Symbol, len(t.Data())),
blank: t.blank,
}
copy(t2.data, t.Data())
t2.pos = t.pos - t.left
return t2
}
func (t *Tape) String() string {
s := ""
for i := t.left; i < len(t.data); i++ {
b := t.data[i]
if i == t.pos {
s += "[" + string(b) + "]"
} else {
s += " " + string(b) + " "
}
}
return s
}
func (t *Tape) Move(a Motion) {
switch a {
case Left:
t.Left(1)
case Right:
t.Right(1)
case Stay:
t.Stay()
}
}
const minSz = 16
func (t *Tape) Left(n int) {
t.pos -= n
if t.pos < 0 {
var sz int
for sz = minSz; cap(t.data[t.left:])-t.pos >= sz; sz <<= 1 {
}
newd := make([]Symbol, sz)
newl := len(newd) - cap(t.data[t.left:])
n := copy(newd[newl:], t.data[t.left:])
t.data = newd[:newl+n]
t.pos += newl - t.left
t.left = newl
}
if t.pos < t.left {
if t.blank != 0 {
for i := t.pos; i < t.left; i++ {
t.data[i] = t.blank
}
}
t.left = t.pos
}
}
func (t *Tape) Right(n int) {
t.pos += n
if t.pos >= cap(t.data) {
var sz int
for sz = minSz; t.pos >= sz; sz <<= 1 {
}
newd := make([]Symbol, sz)
n := copy(newd[t.left:], t.data[t.left:])
t.data = newd[:t.left+n]
}
if i := len(t.data); t.pos >= i {
t.data = t.data[:t.pos+1]
if t.blank != 0 {
for ; i < len(t.data); i++ {
t.data[i] = t.blank
}
}
}
}
type State string
type Rule struct {
State
Symbol
Write Symbol
Motion
Next State
}
func (i *Rule) key() key { return key{i.State, i.Symbol} }
func (i *Rule) action() action { return action{i.Write, i.Motion, i.Next} }
type key struct {
State
Symbol
}
type action struct {
write Symbol
Motion
next State
}
type Machine struct {
tape *Tape
start, state State
transition map[key]action
l func(string, ...interface{})
}
func NewMachine(rules []Rule) *Machine {
m := &Machine{transition: make(map[key]action, len(rules))}
if len(rules) > 0 {
m.start = rules[0].State
}
for _, r := range rules {
m.transition[r.key()] = r.action()
}
return m
}
func (m *Machine) Run(input *Tape) (int, *Tape) {
m.tape = input.Dup()
m.state = m.start
for cnt := 0; ; cnt++ {
if m.l != nil {
m.l("%3d %4s: %v\n", cnt, m.state, m.tape)
}
sym := m.tape.Read()
act, ok := m.transition[key{m.state, sym}]
if !ok {
return cnt, m.tape
}
m.tape.Write(act.write)
m.tape.Move(act.Motion)
m.state = act.next
}
}
| from __future__ import print_function
def run_utm(
state = None,
blank = None,
rules = [],
tape = [],
halt = None,
pos = 0):
st = state
if not tape: tape = [blank]
if pos < 0: pos += len(tape)
if pos >= len(tape) or pos < 0: raise Error( "bad init position")
rules = dict(((s0, v0), (v1, dr, s1)) for (s0, v0, v1, dr, s1) in rules)
while True:
print(st, '\t', end=" ")
for i, v in enumerate(tape):
if i == pos: print("[%s]" % (v,), end=" ")
else: print(v, end=" ")
print()
if st == halt: break
if (st, tape[pos]) not in rules: break
(v1, dr, s1) = rules[(st, tape[pos])]
tape[pos] = v1
if dr == 'left':
if pos > 0: pos -= 1
else: tape.insert(0, blank)
if dr == 'right':
pos += 1
if pos >= len(tape): tape.append(blank)
st = s1
print("incr machine\n")
run_utm(
halt = 'qf',
state = 'q0',
tape = list("111"),
blank = 'B',
rules = map(tuple,
["q0 1 1 right q0".split(),
"q0 B 1 stay qf".split()]
)
)
print("\nbusy beaver\n")
run_utm(
halt = 'halt',
state = 'a',
blank = '0',
rules = map(tuple,
["a 0 1 right b".split(),
"a 1 1 left c".split(),
"b 0 1 left a".split(),
"b 1 1 right b".split(),
"c 0 1 left b".split(),
"c 1 1 stay halt".split()]
)
)
print("\nsorting test\n")
run_utm(halt = 'STOP',
state = 'A',
blank = '0',
tape = "2 2 2 1 2 2 1 2 1 2 1 2 1 2".split(),
rules = map(tuple,
["A 1 1 right A".split(),
"A 2 3 right B".split(),
"A 0 0 left E".split(),
"B 1 1 right B".split(),
"B 2 2 right B".split(),
"B 0 0 left C".split(),
"C 1 2 left D".split(),
"C 2 2 left C".split(),
"C 3 2 left E".split(),
"D 1 1 left D".split(),
"D 2 2 left D".split(),
"D 3 1 right A".split(),
"E 1 1 left E".split(),
"E 0 0 right STOP".split()]
)
)
|
Generate an equivalent Python version of this Go code. | package main
import (
"fmt"
"os"
)
func createFile(fn string) {
f, err := os.Create(fn)
if err != nil {
fmt.Println(err)
return
}
fmt.Println("file", fn, "created!")
f.Close()
}
func createDir(dn string) {
err := os.Mkdir(dn, 0666)
if err != nil {
fmt.Println(err)
return
}
fmt.Println("directory", dn, "created!")
}
func main() {
createFile("input.txt")
createFile("/input.txt")
createDir("docs")
createDir("/docs")
}
| import os
for directory in ['/', './']:
open(directory + 'output.txt', 'w').close()
os.mkdir(directory + 'docs')
|
Convert the following code from Go to Python, ensuring the logic remains intact. | package main
import (
"fmt"
"strconv"
)
func isPrime(n int) bool {
switch {
case n < 2:
return false
case n%2 == 0:
return n == 2
case n%3 == 0:
return n == 3
default:
d := 5
for d*d <= n {
if n%d == 0 {
return false
}
d += 2
if n%d == 0 {
return false
}
d += 4
}
return true
}
}
func commatize(n int) string {
s := fmt.Sprintf("%d", n)
le := len(s)
for i := le - 3; i >= 1; i -= 3 {
s = s[0:i] + "," + s[i:]
}
return s
}
func main() {
fmt.Println("The first 35 unprimeable numbers are:")
count := 0
var firstNum [10]int
outer:
for i, countFirst := 100, 0; countFirst < 10; i++ {
if isPrime(i) {
continue
}
s := strconv.Itoa(i)
le := len(s)
b := []byte(s)
for j := 0; j < le; j++ {
for k := byte('0'); k <= '9'; k++ {
if s[j] == k {
continue
}
b[j] = k
n, _ := strconv.Atoi(string(b))
if isPrime(n) {
continue outer
}
}
b[j] = s[j]
}
lastDigit := s[le-1] - '0'
if firstNum[lastDigit] == 0 {
firstNum[lastDigit] = i
countFirst++
}
count++
if count <= 35 {
fmt.Printf("%d ", i)
}
if count == 35 {
fmt.Print("\n\nThe 600th unprimeable number is: ")
}
if count == 600 {
fmt.Printf("%s\n\n", commatize(i))
}
}
fmt.Println("The first unprimeable number that ends in:")
for i := 0; i < 10; i++ {
fmt.Printf(" %d is: %9s\n", i, commatize(firstNum[i]))
}
}
| from itertools import count, islice
def primes(_cache=[2, 3]):
yield from _cache
for n in count(_cache[-1]+2, 2):
if isprime(n):
_cache.append(n)
yield n
def isprime(n, _seen={0: False, 1: False}):
def _isprime(n):
for p in primes():
if p*p > n:
return True
if n%p == 0:
return False
if n not in _seen:
_seen[n] = _isprime(n)
return _seen[n]
def unprime():
for a in count(1):
d = 1
while d <= a:
base = (a//(d*10))*(d*10) + (a%d)
if any(isprime(y) for y in range(base, base + d*10, d)):
break
d *= 10
else:
yield a
print('First 35:')
print(' '.join(str(i) for i in islice(unprime(), 35)))
print('\nThe 600-th:')
print(list(islice(unprime(), 599, 600))[0])
print()
first, need = [False]*10, 10
for p in unprime():
i = p%10
if first[i]: continue
first[i] = p
need -= 1
if not need:
break
for i,v in enumerate(first):
print(f'{i} ending: {v}')
|
Translate this program into Python but keep the logic exactly as in Go. | package main
import "fmt"
type expr struct {
x, y, z float64
c float64
}
func addExpr(a, b expr) expr {
return expr{a.x + b.x, a.y + b.y, a.z + b.z, a.c + b.c}
}
func subExpr(a, b expr) expr {
return expr{a.x - b.x, a.y - b.y, a.z - b.z, a.c - b.c}
}
func mulExpr(a expr, c float64) expr {
return expr{a.x * c, a.y * c, a.z * c, a.c * c}
}
func addRow(l []expr) []expr {
if len(l) == 0 {
panic("wrong")
}
r := make([]expr, len(l)-1)
for i := range r {
r[i] = addExpr(l[i], l[i+1])
}
return r
}
func substX(a, b expr) expr {
if b.x == 0 {
panic("wrong")
}
return subExpr(a, mulExpr(b, a.x/b.x))
}
func substY(a, b expr) expr {
if b.y == 0 {
panic("wrong")
}
return subExpr(a, mulExpr(b, a.y/b.y))
}
func substZ(a, b expr) expr {
if b.z == 0 {
panic("wrong")
}
return subExpr(a, mulExpr(b, a.z/b.z))
}
func solveX(a expr) float64 {
if a.x == 0 || a.y != 0 || a.z != 0 {
panic("wrong")
}
return -a.c / a.x
}
func solveY(a expr) float64 {
if a.x != 0 || a.y == 0 || a.z != 0 {
panic("wrong")
}
return -a.c / a.y
}
func solveZ(a expr) float64 {
if a.x != 0 || a.y != 0 || a.z == 0 {
panic("wrong")
}
return -a.c / a.z
}
func main() {
r5 := []expr{{x: 1}, {c: 11}, {y: 1}, {c: 4}, {z: 1}}
fmt.Println("bottom row:", r5)
r4 := addRow(r5)
fmt.Println("next row up:", r4)
r3 := addRow(r4)
fmt.Println("middle row:", r3)
xyz := subExpr(expr{y: 1}, expr{x: 1, z: 1})
fmt.Println("xyz relation:", xyz)
r3[2] = substZ(r3[2], xyz)
fmt.Println("middle row after substituting for z:", r3)
b := expr{c: 40}
xy := subExpr(r3[0], b)
fmt.Println("xy relation:", xy)
r3[0] = b
r3[2] = substX(r3[2], xy)
fmt.Println("middle row after substituting for x:", r3)
r2 := addRow(r3)
fmt.Println("next row up:", r2)
r1 := addRow(r2)
fmt.Println("top row:", r1)
y := subExpr(r1[0], expr{c: 151})
fmt.Println("y relation:", y)
x := substY(xy, y)
fmt.Println("x relation:", x)
z := substX(substY(xyz, y), x)
fmt.Println("z relation:", z)
fmt.Println("x =", solveX(x))
fmt.Println("y =", solveY(y))
fmt.Println("z =", solveZ(z))
}
|
def combine( snl, snr ):
cl = {}
if isinstance(snl, int):
cl['1'] = snl
elif isinstance(snl, string):
cl[snl] = 1
else:
cl.update( snl)
if isinstance(snr, int):
n = cl.get('1', 0)
cl['1'] = n + snr
elif isinstance(snr, string):
n = cl.get(snr, 0)
cl[snr] = n + 1
else:
for k,v in snr.items():
n = cl.get(k, 0)
cl[k] = n+v
return cl
def constrain(nsum, vn ):
nn = {}
nn.update(vn)
n = nn.get('1', 0)
nn['1'] = n - nsum
return nn
def makeMatrix( constraints ):
vmap = set()
for c in constraints:
vmap.update( c.keys())
vmap.remove('1')
nvars = len(vmap)
vmap = sorted(vmap)
mtx = []
for c in constraints:
row = []
for vv in vmap:
row.append(float(c.get(vv, 0)))
row.append(-float(c.get('1',0)))
mtx.append(row)
if len(constraints) == nvars:
print 'System appears solvable'
elif len(constraints) < nvars:
print 'System is not solvable - needs more constraints.'
return mtx, vmap
def SolvePyramid( vl, cnstr ):
vl.reverse()
constraints = [cnstr]
lvls = len(vl)
for lvln in range(1,lvls):
lvd = vl[lvln]
for k in range(lvls - lvln):
sn = lvd[k]
ll = vl[lvln-1]
vn = combine(ll[k], ll[k+1])
if sn is None:
lvd[k] = vn
else:
constraints.append(constrain( sn, vn ))
print 'Constraint Equations:'
for cstr in constraints:
fset = ('%d*%s'%(v,k) for k,v in cstr.items() )
print ' + '.join(fset), ' = 0'
mtx,vmap = makeMatrix(constraints)
MtxSolve(mtx)
d = len(vmap)
for j in range(d):
print vmap[j],'=', mtx[j][d]
def MtxSolve(mtx):
mDim = len(mtx)
for j in range(mDim):
rw0= mtx[j]
f = 1.0/rw0[j]
for k in range(j, mDim+1):
rw0[k] *= f
for l in range(1+j,mDim):
rwl = mtx[l]
f = -rwl[j]
for k in range(j, mDim+1):
rwl[k] += f * rw0[k]
for j1 in range(1,mDim):
j = mDim - j1
rw0= mtx[j]
for l in range(0, j):
rwl = mtx[l]
f = -rwl[j]
rwl[j] += f * rw0[j]
rwl[mDim] += f * rw0[mDim]
return mtx
p = [ [151], [None,None], [40,None,None], [None,None,None,None], ['X', 11, 'Y', 4, 'Z'] ]
addlConstraint = { 'X':1, 'Y':-1, 'Z':1, '1':0 }
SolvePyramid( p, addlConstraint)
|
Write the same algorithm in Python as shown in this Go implementation. | package main
import "fmt"
type expr struct {
x, y, z float64
c float64
}
func addExpr(a, b expr) expr {
return expr{a.x + b.x, a.y + b.y, a.z + b.z, a.c + b.c}
}
func subExpr(a, b expr) expr {
return expr{a.x - b.x, a.y - b.y, a.z - b.z, a.c - b.c}
}
func mulExpr(a expr, c float64) expr {
return expr{a.x * c, a.y * c, a.z * c, a.c * c}
}
func addRow(l []expr) []expr {
if len(l) == 0 {
panic("wrong")
}
r := make([]expr, len(l)-1)
for i := range r {
r[i] = addExpr(l[i], l[i+1])
}
return r
}
func substX(a, b expr) expr {
if b.x == 0 {
panic("wrong")
}
return subExpr(a, mulExpr(b, a.x/b.x))
}
func substY(a, b expr) expr {
if b.y == 0 {
panic("wrong")
}
return subExpr(a, mulExpr(b, a.y/b.y))
}
func substZ(a, b expr) expr {
if b.z == 0 {
panic("wrong")
}
return subExpr(a, mulExpr(b, a.z/b.z))
}
func solveX(a expr) float64 {
if a.x == 0 || a.y != 0 || a.z != 0 {
panic("wrong")
}
return -a.c / a.x
}
func solveY(a expr) float64 {
if a.x != 0 || a.y == 0 || a.z != 0 {
panic("wrong")
}
return -a.c / a.y
}
func solveZ(a expr) float64 {
if a.x != 0 || a.y != 0 || a.z == 0 {
panic("wrong")
}
return -a.c / a.z
}
func main() {
r5 := []expr{{x: 1}, {c: 11}, {y: 1}, {c: 4}, {z: 1}}
fmt.Println("bottom row:", r5)
r4 := addRow(r5)
fmt.Println("next row up:", r4)
r3 := addRow(r4)
fmt.Println("middle row:", r3)
xyz := subExpr(expr{y: 1}, expr{x: 1, z: 1})
fmt.Println("xyz relation:", xyz)
r3[2] = substZ(r3[2], xyz)
fmt.Println("middle row after substituting for z:", r3)
b := expr{c: 40}
xy := subExpr(r3[0], b)
fmt.Println("xy relation:", xy)
r3[0] = b
r3[2] = substX(r3[2], xy)
fmt.Println("middle row after substituting for x:", r3)
r2 := addRow(r3)
fmt.Println("next row up:", r2)
r1 := addRow(r2)
fmt.Println("top row:", r1)
y := subExpr(r1[0], expr{c: 151})
fmt.Println("y relation:", y)
x := substY(xy, y)
fmt.Println("x relation:", x)
z := substX(substY(xyz, y), x)
fmt.Println("z relation:", z)
fmt.Println("x =", solveX(x))
fmt.Println("y =", solveY(y))
fmt.Println("z =", solveZ(z))
}
|
def combine( snl, snr ):
cl = {}
if isinstance(snl, int):
cl['1'] = snl
elif isinstance(snl, string):
cl[snl] = 1
else:
cl.update( snl)
if isinstance(snr, int):
n = cl.get('1', 0)
cl['1'] = n + snr
elif isinstance(snr, string):
n = cl.get(snr, 0)
cl[snr] = n + 1
else:
for k,v in snr.items():
n = cl.get(k, 0)
cl[k] = n+v
return cl
def constrain(nsum, vn ):
nn = {}
nn.update(vn)
n = nn.get('1', 0)
nn['1'] = n - nsum
return nn
def makeMatrix( constraints ):
vmap = set()
for c in constraints:
vmap.update( c.keys())
vmap.remove('1')
nvars = len(vmap)
vmap = sorted(vmap)
mtx = []
for c in constraints:
row = []
for vv in vmap:
row.append(float(c.get(vv, 0)))
row.append(-float(c.get('1',0)))
mtx.append(row)
if len(constraints) == nvars:
print 'System appears solvable'
elif len(constraints) < nvars:
print 'System is not solvable - needs more constraints.'
return mtx, vmap
def SolvePyramid( vl, cnstr ):
vl.reverse()
constraints = [cnstr]
lvls = len(vl)
for lvln in range(1,lvls):
lvd = vl[lvln]
for k in range(lvls - lvln):
sn = lvd[k]
ll = vl[lvln-1]
vn = combine(ll[k], ll[k+1])
if sn is None:
lvd[k] = vn
else:
constraints.append(constrain( sn, vn ))
print 'Constraint Equations:'
for cstr in constraints:
fset = ('%d*%s'%(v,k) for k,v in cstr.items() )
print ' + '.join(fset), ' = 0'
mtx,vmap = makeMatrix(constraints)
MtxSolve(mtx)
d = len(vmap)
for j in range(d):
print vmap[j],'=', mtx[j][d]
def MtxSolve(mtx):
mDim = len(mtx)
for j in range(mDim):
rw0= mtx[j]
f = 1.0/rw0[j]
for k in range(j, mDim+1):
rw0[k] *= f
for l in range(1+j,mDim):
rwl = mtx[l]
f = -rwl[j]
for k in range(j, mDim+1):
rwl[k] += f * rw0[k]
for j1 in range(1,mDim):
j = mDim - j1
rw0= mtx[j]
for l in range(0, j):
rwl = mtx[l]
f = -rwl[j]
rwl[j] += f * rw0[j]
rwl[mDim] += f * rw0[mDim]
return mtx
p = [ [151], [None,None], [40,None,None], [None,None,None,None], ['X', 11, 'Y', 4, 'Z'] ]
addlConstraint = { 'X':1, 'Y':-1, 'Z':1, '1':0 }
SolvePyramid( p, addlConstraint)
|
Generate a Python translation of this Go snippet without changing its computational steps. | package main
import (
"fmt"
"math/big"
)
var (
zero = new(big.Int)
prod = new(big.Int)
fact = new(big.Int)
)
func ccFactors(n, m uint64) (*big.Int, bool) {
prod.SetUint64(6*m + 1)
if !prod.ProbablyPrime(0) {
return zero, false
}
fact.SetUint64(12*m + 1)
if !fact.ProbablyPrime(0) {
return zero, false
}
prod.Mul(prod, fact)
for i := uint64(1); i <= n-2; i++ {
fact.SetUint64((1<<i)*9*m + 1)
if !fact.ProbablyPrime(0) {
return zero, false
}
prod.Mul(prod, fact)
}
return prod, true
}
func ccNumbers(start, end uint64) {
for n := start; n <= end; n++ {
m := uint64(1)
if n > 4 {
m = 1 << (n - 4)
}
for {
num, ok := ccFactors(n, m)
if ok {
fmt.Printf("a(%d) = %d\n", n, num)
break
}
if n <= 4 {
m++
} else {
m += 1 << (n - 4)
}
}
}
}
func main() {
ccNumbers(3, 9)
}
|
from sympy import isprime
def primality_pretest(k):
if not (k % 3) or not (k % 5) or not (k % 7) or not (k % 11) or not(k % 13) or not (k % 17) or not (k % 19) or not (k % 23):
return (k <= 23)
return True
def is_chernick(n, m):
t = 9 * m
if not primality_pretest(6 * m + 1):
return False
if not primality_pretest(12 * m + 1):
return False
for i in range(1,n-1):
if not primality_pretest((t << i) + 1):
return False
if not isprime(6 * m + 1):
return False
if not isprime(12 * m + 1):
return False
for i in range(1,n - 1):
if not isprime((t << i) + 1):
return False
return True
for n in range(3,10):
if n > 4:
multiplier = 1 << (n - 4)
else:
multiplier = 1
if n > 5:
multiplier *= 5
k = 1
while True:
m = k * multiplier
if is_chernick(n, m):
print("a("+str(n)+") has m = "+str(m))
break
k += 1
|
Write the same code in Python as shown below in Go. | package main
import (
"fmt"
"math/big"
)
var (
zero = new(big.Int)
prod = new(big.Int)
fact = new(big.Int)
)
func ccFactors(n, m uint64) (*big.Int, bool) {
prod.SetUint64(6*m + 1)
if !prod.ProbablyPrime(0) {
return zero, false
}
fact.SetUint64(12*m + 1)
if !fact.ProbablyPrime(0) {
return zero, false
}
prod.Mul(prod, fact)
for i := uint64(1); i <= n-2; i++ {
fact.SetUint64((1<<i)*9*m + 1)
if !fact.ProbablyPrime(0) {
return zero, false
}
prod.Mul(prod, fact)
}
return prod, true
}
func ccNumbers(start, end uint64) {
for n := start; n <= end; n++ {
m := uint64(1)
if n > 4 {
m = 1 << (n - 4)
}
for {
num, ok := ccFactors(n, m)
if ok {
fmt.Printf("a(%d) = %d\n", n, num)
break
}
if n <= 4 {
m++
} else {
m += 1 << (n - 4)
}
}
}
}
func main() {
ccNumbers(3, 9)
}
|
from sympy import isprime
def primality_pretest(k):
if not (k % 3) or not (k % 5) or not (k % 7) or not (k % 11) or not(k % 13) or not (k % 17) or not (k % 19) or not (k % 23):
return (k <= 23)
return True
def is_chernick(n, m):
t = 9 * m
if not primality_pretest(6 * m + 1):
return False
if not primality_pretest(12 * m + 1):
return False
for i in range(1,n-1):
if not primality_pretest((t << i) + 1):
return False
if not isprime(6 * m + 1):
return False
if not isprime(12 * m + 1):
return False
for i in range(1,n - 1):
if not isprime((t << i) + 1):
return False
return True
for n in range(3,10):
if n > 4:
multiplier = 1 << (n - 4)
else:
multiplier = 1
if n > 5:
multiplier *= 5
k = 1
while True:
m = k * multiplier
if is_chernick(n, m):
print("a("+str(n)+") has m = "+str(m))
break
k += 1
|
Produce a language-to-language conversion: from Go to Python, same semantics. | package main
import (
"fmt"
"math"
)
const EPS = 0.001
const EPS_SQUARE = EPS * EPS
func side(x1, y1, x2, y2, x, y float64) float64 {
return (y2-y1)*(x-x1) + (-x2+x1)*(y-y1)
}
func naivePointInTriangle(x1, y1, x2, y2, x3, y3, x, y float64) bool {
checkSide1 := side(x1, y1, x2, y2, x, y) >= 0
checkSide2 := side(x2, y2, x3, y3, x, y) >= 0
checkSide3 := side(x3, y3, x1, y1, x, y) >= 0
return checkSide1 && checkSide2 && checkSide3
}
func pointInTriangleBoundingBox(x1, y1, x2, y2, x3, y3, x, y float64) bool {
xMin := math.Min(x1, math.Min(x2, x3)) - EPS
xMax := math.Max(x1, math.Max(x2, x3)) + EPS
yMin := math.Min(y1, math.Min(y2, y3)) - EPS
yMax := math.Max(y1, math.Max(y2, y3)) + EPS
return !(x < xMin || xMax < x || y < yMin || yMax < y)
}
func distanceSquarePointToSegment(x1, y1, x2, y2, x, y float64) float64 {
p1_p2_squareLength := (x2-x1)*(x2-x1) + (y2-y1)*(y2-y1)
dotProduct := ((x-x1)*(x2-x1) + (y-y1)*(y2-y1)) / p1_p2_squareLength
if dotProduct < 0 {
return (x-x1)*(x-x1) + (y-y1)*(y-y1)
} else if dotProduct <= 1 {
p_p1_squareLength := (x1-x)*(x1-x) + (y1-y)*(y1-y)
return p_p1_squareLength - dotProduct*dotProduct*p1_p2_squareLength
} else {
return (x-x2)*(x-x2) + (y-y2)*(y-y2)
}
}
func accuratePointInTriangle(x1, y1, x2, y2, x3, y3, x, y float64) bool {
if !pointInTriangleBoundingBox(x1, y1, x2, y2, x3, y3, x, y) {
return false
}
if naivePointInTriangle(x1, y1, x2, y2, x3, y3, x, y) {
return true
}
if distanceSquarePointToSegment(x1, y1, x2, y2, x, y) <= EPS_SQUARE {
return true
}
if distanceSquarePointToSegment(x2, y2, x3, y3, x, y) <= EPS_SQUARE {
return true
}
if distanceSquarePointToSegment(x3, y3, x1, y1, x, y) <= EPS_SQUARE {
return true
}
return false
}
func main() {
pts := [][2]float64{{0, 0}, {0, 1}, {3, 1}}
tri := [][2]float64{{3.0 / 2, 12.0 / 5}, {51.0 / 10, -31.0 / 10}, {-19.0 / 5, 1.2}}
fmt.Println("Triangle is", tri)
x1, y1 := tri[0][0], tri[0][1]
x2, y2 := tri[1][0], tri[1][1]
x3, y3 := tri[2][0], tri[2][1]
for _, pt := range pts {
x, y := pt[0], pt[1]
within := accuratePointInTriangle(x1, y1, x2, y2, x3, y3, x, y)
fmt.Println("Point", pt, "is within triangle?", within)
}
fmt.Println()
tri = [][2]float64{{1.0 / 10, 1.0 / 9}, {100.0 / 8, 100.0 / 3}, {100.0 / 4, 100.0 / 9}}
fmt.Println("Triangle is", tri)
x1, y1 = tri[0][0], tri[0][1]
x2, y2 = tri[1][0], tri[1][1]
x3, y3 = tri[2][0], tri[2][1]
x := x1 + (3.0/7)*(x2-x1)
y := y1 + (3.0/7)*(y2-y1)
pt := [2]float64{x, y}
within := accuratePointInTriangle(x1, y1, x2, y2, x3, y3, x, y)
fmt.Println("Point", pt, "is within triangle ?", within)
fmt.Println()
tri = [][2]float64{{1.0 / 10, 1.0 / 9}, {100.0 / 8, 100.0 / 3}, {-100.0 / 8, 100.0 / 6}}
fmt.Println("Triangle is", tri)
x3 = tri[2][0]
y3 = tri[2][1]
within = accuratePointInTriangle(x1, y1, x2, y2, x3, y3, x, y)
fmt.Println("Point", pt, "is within triangle ?", within)
}
|
from sympy.geometry import Point, Triangle
def sign(pt1, pt2, pt3):
return (pt1.x - pt3.x) * (pt2.y - pt3.y) - (pt2.x - pt3.x) * (pt1.y - pt3.y)
def iswithin(point, pt1, pt2, pt3):
zval1 = sign(point, pt1, pt2)
zval2 = sign(point, pt2, pt3)
zval3 = sign(point, pt3, pt1)
notanyneg = zval1 >= 0 and zval2 >= 0 and zval3 >= 0
notanypos = zval1 <= 0 and zval2 <= 0 and zval3 <= 0
return notanyneg or notanypos
if __name__ == "__main__":
POINTS = [Point(0, 0)]
TRI = Triangle(Point(1.5, 2.4), Point(5.1, -3.1), Point(-3.8, 0.5))
for pnt in POINTS:
a, b, c = TRI.vertices
isornot = "is" if iswithin(pnt, a, b, c) else "is not"
print("Point", pnt, isornot, "within the triangle", TRI)
|
Write a version of this Go function in Python with identical behavior. | package main
import (
"fmt"
"math"
)
const EPS = 0.001
const EPS_SQUARE = EPS * EPS
func side(x1, y1, x2, y2, x, y float64) float64 {
return (y2-y1)*(x-x1) + (-x2+x1)*(y-y1)
}
func naivePointInTriangle(x1, y1, x2, y2, x3, y3, x, y float64) bool {
checkSide1 := side(x1, y1, x2, y2, x, y) >= 0
checkSide2 := side(x2, y2, x3, y3, x, y) >= 0
checkSide3 := side(x3, y3, x1, y1, x, y) >= 0
return checkSide1 && checkSide2 && checkSide3
}
func pointInTriangleBoundingBox(x1, y1, x2, y2, x3, y3, x, y float64) bool {
xMin := math.Min(x1, math.Min(x2, x3)) - EPS
xMax := math.Max(x1, math.Max(x2, x3)) + EPS
yMin := math.Min(y1, math.Min(y2, y3)) - EPS
yMax := math.Max(y1, math.Max(y2, y3)) + EPS
return !(x < xMin || xMax < x || y < yMin || yMax < y)
}
func distanceSquarePointToSegment(x1, y1, x2, y2, x, y float64) float64 {
p1_p2_squareLength := (x2-x1)*(x2-x1) + (y2-y1)*(y2-y1)
dotProduct := ((x-x1)*(x2-x1) + (y-y1)*(y2-y1)) / p1_p2_squareLength
if dotProduct < 0 {
return (x-x1)*(x-x1) + (y-y1)*(y-y1)
} else if dotProduct <= 1 {
p_p1_squareLength := (x1-x)*(x1-x) + (y1-y)*(y1-y)
return p_p1_squareLength - dotProduct*dotProduct*p1_p2_squareLength
} else {
return (x-x2)*(x-x2) + (y-y2)*(y-y2)
}
}
func accuratePointInTriangle(x1, y1, x2, y2, x3, y3, x, y float64) bool {
if !pointInTriangleBoundingBox(x1, y1, x2, y2, x3, y3, x, y) {
return false
}
if naivePointInTriangle(x1, y1, x2, y2, x3, y3, x, y) {
return true
}
if distanceSquarePointToSegment(x1, y1, x2, y2, x, y) <= EPS_SQUARE {
return true
}
if distanceSquarePointToSegment(x2, y2, x3, y3, x, y) <= EPS_SQUARE {
return true
}
if distanceSquarePointToSegment(x3, y3, x1, y1, x, y) <= EPS_SQUARE {
return true
}
return false
}
func main() {
pts := [][2]float64{{0, 0}, {0, 1}, {3, 1}}
tri := [][2]float64{{3.0 / 2, 12.0 / 5}, {51.0 / 10, -31.0 / 10}, {-19.0 / 5, 1.2}}
fmt.Println("Triangle is", tri)
x1, y1 := tri[0][0], tri[0][1]
x2, y2 := tri[1][0], tri[1][1]
x3, y3 := tri[2][0], tri[2][1]
for _, pt := range pts {
x, y := pt[0], pt[1]
within := accuratePointInTriangle(x1, y1, x2, y2, x3, y3, x, y)
fmt.Println("Point", pt, "is within triangle?", within)
}
fmt.Println()
tri = [][2]float64{{1.0 / 10, 1.0 / 9}, {100.0 / 8, 100.0 / 3}, {100.0 / 4, 100.0 / 9}}
fmt.Println("Triangle is", tri)
x1, y1 = tri[0][0], tri[0][1]
x2, y2 = tri[1][0], tri[1][1]
x3, y3 = tri[2][0], tri[2][1]
x := x1 + (3.0/7)*(x2-x1)
y := y1 + (3.0/7)*(y2-y1)
pt := [2]float64{x, y}
within := accuratePointInTriangle(x1, y1, x2, y2, x3, y3, x, y)
fmt.Println("Point", pt, "is within triangle ?", within)
fmt.Println()
tri = [][2]float64{{1.0 / 10, 1.0 / 9}, {100.0 / 8, 100.0 / 3}, {-100.0 / 8, 100.0 / 6}}
fmt.Println("Triangle is", tri)
x3 = tri[2][0]
y3 = tri[2][1]
within = accuratePointInTriangle(x1, y1, x2, y2, x3, y3, x, y)
fmt.Println("Point", pt, "is within triangle ?", within)
}
|
from sympy.geometry import Point, Triangle
def sign(pt1, pt2, pt3):
return (pt1.x - pt3.x) * (pt2.y - pt3.y) - (pt2.x - pt3.x) * (pt1.y - pt3.y)
def iswithin(point, pt1, pt2, pt3):
zval1 = sign(point, pt1, pt2)
zval2 = sign(point, pt2, pt3)
zval3 = sign(point, pt3, pt1)
notanyneg = zval1 >= 0 and zval2 >= 0 and zval3 >= 0
notanypos = zval1 <= 0 and zval2 <= 0 and zval3 <= 0
return notanyneg or notanypos
if __name__ == "__main__":
POINTS = [Point(0, 0)]
TRI = Triangle(Point(1.5, 2.4), Point(5.1, -3.1), Point(-3.8, 0.5))
for pnt in POINTS:
a, b, c = TRI.vertices
isornot = "is" if iswithin(pnt, a, b, c) else "is not"
print("Point", pnt, isornot, "within the triangle", TRI)
|
Keep all operations the same but rewrite the snippet in Python. | package main
import "fmt"
func countDivisors(n int) int {
count := 0
i := 1
k := 2
if n%2 == 0 {
k = 1
}
for i*i <= n {
if n%i == 0 {
count++
j := n / i
if j != i {
count++
}
}
i += k
}
return count
}
func main() {
fmt.Println("The tau functions for the first 100 positive integers are:")
for i := 1; i <= 100; i++ {
fmt.Printf("%2d ", countDivisors(i))
if i%20 == 0 {
fmt.Println()
}
}
}
| def factorize(n):
assert(isinstance(n, int))
if n < 0:
n = -n
if n < 2:
return
k = 0
while 0 == n%2:
k += 1
n //= 2
if 0 < k:
yield (2,k)
p = 3
while p*p <= n:
k = 0
while 0 == n%p:
k += 1
n //= p
if 0 < k:
yield (p,k)
p += 2
if 1 < n:
yield (n,1)
def tau(n):
assert(n != 0)
ans = 1
for (p,k) in factorize(n):
ans *= 1 + k
return ans
if __name__ == "__main__":
print(*map(tau, range(1, 101)))
|
Change the programming language of this snippet from Go to Python without modifying what it does. | package main
import "fmt"
func countDivisors(n int) int {
count := 0
i := 1
k := 2
if n%2 == 0 {
k = 1
}
for i*i <= n {
if n%i == 0 {
count++
j := n / i
if j != i {
count++
}
}
i += k
}
return count
}
func main() {
fmt.Println("The tau functions for the first 100 positive integers are:")
for i := 1; i <= 100; i++ {
fmt.Printf("%2d ", countDivisors(i))
if i%20 == 0 {
fmt.Println()
}
}
}
| def factorize(n):
assert(isinstance(n, int))
if n < 0:
n = -n
if n < 2:
return
k = 0
while 0 == n%2:
k += 1
n //= 2
if 0 < k:
yield (2,k)
p = 3
while p*p <= n:
k = 0
while 0 == n%p:
k += 1
n //= p
if 0 < k:
yield (p,k)
p += 2
if 1 < n:
yield (n,1)
def tau(n):
assert(n != 0)
ans = 1
for (p,k) in factorize(n):
ans *= 1 + k
return ans
if __name__ == "__main__":
print(*map(tau, range(1, 101)))
|
Change the programming language of this snippet from Go to Python without modifying what it does. | package main
import (
"fmt"
"math/big"
)
func main() {
one := big.NewInt(1)
pm := big.NewInt(1)
var px, nx int
var pb big.Int
primes(4000, func(p int64) bool {
pm.Mul(pm, pb.SetInt64(p))
px++
if pb.Add(pm, one).ProbablyPrime(0) ||
pb.Sub(pm, one).ProbablyPrime(0) {
fmt.Print(px, " ")
nx++
if nx == 20 {
fmt.Println()
return false
}
}
return true
})
}
func primes(limit int, f func(int64) bool) {
c := make([]bool, limit)
c[0] = true
c[1] = true
lm := int64(limit)
p := int64(2)
for {
f(p)
p2 := p * p
if p2 >= lm {
break
}
for i := p2; i < lm; i += p {
c[i] = true
}
for {
p++
if !c[p] {
break
}
}
}
for p++; p < lm; p++ {
if !c[p] && !f(p) {
break
}
}
}
| import pyprimes
def primorial_prime(_pmax=500):
isprime = pyprimes.isprime
n, primo = 0, 1
for prime in pyprimes.nprimes(_pmax):
n, primo = n+1, primo * prime
if isprime(primo-1) or isprime(primo+1):
yield n
if __name__ == '__main__':
pyprimes.warn_probably = False
for i, n in zip(range(20), primorial_prime()):
print('Primorial prime %2i at primorial index: %3i' % (i+1, n))
|
Translate the given Go code snippet into Python without altering its behavior. | package main
import (
"fmt"
"sort"
)
func main() {
dna := "" +
"CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATG" +
"CTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTG" +
"AGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGAT" +
"GGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT" +
"CGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGG" +
"TCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA" +
"TTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTAT" +
"CGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTG" +
"TCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGAC" +
"GACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT"
fmt.Println("SEQUENCE:")
le := len(dna)
for i := 0; i < le; i += 50 {
k := i + 50
if k > le {
k = le
}
fmt.Printf("%5d: %s\n", i, dna[i:k])
}
baseMap := make(map[byte]int)
for i := 0; i < le; i++ {
baseMap[dna[i]]++
}
var bases []byte
for k := range baseMap {
bases = append(bases, k)
}
sort.Slice(bases, func(i, j int) bool {
return bases[i] < bases[j]
})
fmt.Println("\nBASE COUNT:")
for _, base := range bases {
fmt.Printf(" %c: %3d\n", base, baseMap[base])
}
fmt.Println(" ------")
fmt.Println(" Σ:", le)
fmt.Println(" ======")
}
| from collections import Counter
def basecount(dna):
return sorted(Counter(dna).items())
def seq_split(dna, n=50):
return [dna[i: i+n] for i in range(0, len(dna), n)]
def seq_pp(dna, n=50):
for i, part in enumerate(seq_split(dna, n)):
print(f"{i*n:>5}: {part}")
print("\n BASECOUNT:")
tot = 0
for base, count in basecount(dna):
print(f" {base:>3}: {count}")
tot += count
base, count = 'TOT', tot
print(f" {base:>3}= {count}")
if __name__ == '__main__':
print("SEQUENCE:")
sequence =
seq_pp(sequence)
|
Write the same algorithm in Python as shown in this Go implementation. | package main
import (
"fmt"
"sort"
)
func main() {
dna := "" +
"CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATG" +
"CTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTG" +
"AGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGAT" +
"GGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT" +
"CGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGG" +
"TCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA" +
"TTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTAT" +
"CGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTG" +
"TCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGAC" +
"GACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT"
fmt.Println("SEQUENCE:")
le := len(dna)
for i := 0; i < le; i += 50 {
k := i + 50
if k > le {
k = le
}
fmt.Printf("%5d: %s\n", i, dna[i:k])
}
baseMap := make(map[byte]int)
for i := 0; i < le; i++ {
baseMap[dna[i]]++
}
var bases []byte
for k := range baseMap {
bases = append(bases, k)
}
sort.Slice(bases, func(i, j int) bool {
return bases[i] < bases[j]
})
fmt.Println("\nBASE COUNT:")
for _, base := range bases {
fmt.Printf(" %c: %3d\n", base, baseMap[base])
}
fmt.Println(" ------")
fmt.Println(" Σ:", le)
fmt.Println(" ======")
}
| from collections import Counter
def basecount(dna):
return sorted(Counter(dna).items())
def seq_split(dna, n=50):
return [dna[i: i+n] for i in range(0, len(dna), n)]
def seq_pp(dna, n=50):
for i, part in enumerate(seq_split(dna, n)):
print(f"{i*n:>5}: {part}")
print("\n BASECOUNT:")
tot = 0
for base, count in basecount(dna):
print(f" {base:>3}: {count}")
tot += count
base, count = 'TOT', tot
print(f" {base:>3}= {count}")
if __name__ == '__main__':
print("SEQUENCE:")
sequence =
seq_pp(sequence)
|
Translate the given Go code snippet into Python without altering its behavior. | package main
import (
"fmt"
"sort"
)
func main() {
dna := "" +
"CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATG" +
"CTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTG" +
"AGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGAT" +
"GGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT" +
"CGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGG" +
"TCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA" +
"TTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTAT" +
"CGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTG" +
"TCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGAC" +
"GACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT"
fmt.Println("SEQUENCE:")
le := len(dna)
for i := 0; i < le; i += 50 {
k := i + 50
if k > le {
k = le
}
fmt.Printf("%5d: %s\n", i, dna[i:k])
}
baseMap := make(map[byte]int)
for i := 0; i < le; i++ {
baseMap[dna[i]]++
}
var bases []byte
for k := range baseMap {
bases = append(bases, k)
}
sort.Slice(bases, func(i, j int) bool {
return bases[i] < bases[j]
})
fmt.Println("\nBASE COUNT:")
for _, base := range bases {
fmt.Printf(" %c: %3d\n", base, baseMap[base])
}
fmt.Println(" ------")
fmt.Println(" Σ:", le)
fmt.Println(" ======")
}
| from collections import Counter
def basecount(dna):
return sorted(Counter(dna).items())
def seq_split(dna, n=50):
return [dna[i: i+n] for i in range(0, len(dna), n)]
def seq_pp(dna, n=50):
for i, part in enumerate(seq_split(dna, n)):
print(f"{i*n:>5}: {part}")
print("\n BASECOUNT:")
tot = 0
for base, count in basecount(dna):
print(f" {base:>3}: {count}")
tot += count
base, count = 'TOT', tot
print(f" {base:>3}= {count}")
if __name__ == '__main__':
print("SEQUENCE:")
sequence =
seq_pp(sequence)
|
Produce a functionally identical Python code for the snippet given in Go. | package main
import (
"hash/fnv"
"log"
"math/rand"
"os"
"time"
)
var ph = []string{"Aristotle", "Kant", "Spinoza", "Marx", "Russell"}
const hunger = 3
const think = time.Second / 100
const eat = time.Second / 100
var fmt = log.New(os.Stdout, "", 0)
var done = make(chan bool)
type fork byte
func philosopher(phName string,
dominantHand, otherHand chan fork, done chan bool) {
fmt.Println(phName, "seated")
h := fnv.New64a()
h.Write([]byte(phName))
rg := rand.New(rand.NewSource(int64(h.Sum64())))
rSleep := func(t time.Duration) {
time.Sleep(t/2 + time.Duration(rg.Int63n(int64(t))))
}
for h := hunger; h > 0; h-- {
fmt.Println(phName, "hungry")
<-dominantHand
<-otherHand
fmt.Println(phName, "eating")
rSleep(eat)
dominantHand <- 'f'
otherHand <- 'f'
fmt.Println(phName, "thinking")
rSleep(think)
}
fmt.Println(phName, "satisfied")
done <- true
fmt.Println(phName, "left the table")
}
func main() {
fmt.Println("table empty")
place0 := make(chan fork, 1)
place0 <- 'f'
placeLeft := place0
for i := 1; i < len(ph); i++ {
placeRight := make(chan fork, 1)
placeRight <- 'f'
go philosopher(ph[i], placeLeft, placeRight, done)
placeLeft = placeRight
}
go philosopher(ph[0], place0, placeLeft, done)
for range ph {
<-done
}
fmt.Println("table empty")
}
| import threading
import random
import time
class Philosopher(threading.Thread):
running = True
def __init__(self, xname, forkOnLeft, forkOnRight):
threading.Thread.__init__(self)
self.name = xname
self.forkOnLeft = forkOnLeft
self.forkOnRight = forkOnRight
def run(self):
while(self.running):
time.sleep( random.uniform(3,13))
print '%s is hungry.' % self.name
self.dine()
def dine(self):
fork1, fork2 = self.forkOnLeft, self.forkOnRight
while self.running:
fork1.acquire(True)
locked = fork2.acquire(False)
if locked: break
fork1.release()
print '%s swaps forks' % self.name
fork1, fork2 = fork2, fork1
else:
return
self.dining()
fork2.release()
fork1.release()
def dining(self):
print '%s starts eating '% self.name
time.sleep(random.uniform(1,10))
print '%s finishes eating and leaves to think.' % self.name
def DiningPhilosophers():
forks = [threading.Lock() for n in range(5)]
philosopherNames = ('Aristotle','Kant','Spinoza','Marx', 'Russel')
philosophers= [Philosopher(philosopherNames[i], forks[i%5], forks[(i+1)%5]) \
for i in range(5)]
random.seed(507129)
Philosopher.running = True
for p in philosophers: p.start()
time.sleep(100)
Philosopher.running = False
print ("Now we're finishing.")
DiningPhilosophers()
|
Write the same code in Python as shown below in Go. | package main
import (
"fmt"
"strconv"
)
func main() {
var fact [12]uint64
fact[0] = 1
for n := uint64(1); n < 12; n++ {
fact[n] = fact[n-1] * n
}
for b := 9; b <= 12; b++ {
fmt.Printf("The factorions for base %d are:\n", b)
for i := uint64(1); i < 1500000; i++ {
digits := strconv.FormatUint(i, b)
sum := uint64(0)
for _, digit := range digits {
if digit < 'a' {
sum += fact[digit-'0']
} else {
sum += fact[digit+10-'a']
}
}
if sum == i {
fmt.Printf("%d ", i)
}
}
fmt.Println("\n")
}
}
| fact = [1]
for n in range(1, 12):
fact.append(fact[n-1] * n)
for b in range(9, 12+1):
print(f"The factorions for base {b} are:")
for i in range(1, 1500000):
fact_sum = 0
j = i
while j > 0:
d = j % b
fact_sum += fact[d]
j = j//b
if fact_sum == i:
print(i, end=" ")
print("\n")
|
Maintain the same structure and functionality when rewriting this code in Python. | package main
import (
"fmt"
"strconv"
)
func main() {
var fact [12]uint64
fact[0] = 1
for n := uint64(1); n < 12; n++ {
fact[n] = fact[n-1] * n
}
for b := 9; b <= 12; b++ {
fmt.Printf("The factorions for base %d are:\n", b)
for i := uint64(1); i < 1500000; i++ {
digits := strconv.FormatUint(i, b)
sum := uint64(0)
for _, digit := range digits {
if digit < 'a' {
sum += fact[digit-'0']
} else {
sum += fact[digit+10-'a']
}
}
if sum == i {
fmt.Printf("%d ", i)
}
}
fmt.Println("\n")
}
}
| fact = [1]
for n in range(1, 12):
fact.append(fact[n-1] * n)
for b in range(9, 12+1):
print(f"The factorions for base {b} are:")
for i in range(1, 1500000):
fact_sum = 0
j = i
while j > 0:
d = j % b
fact_sum += fact[d]
j = j//b
if fact_sum == i:
print(i, end=" ")
print("\n")
|
Generate an equivalent Python version of this Go code. | package main
import (
"fmt"
"strconv"
)
func main() {
var fact [12]uint64
fact[0] = 1
for n := uint64(1); n < 12; n++ {
fact[n] = fact[n-1] * n
}
for b := 9; b <= 12; b++ {
fmt.Printf("The factorions for base %d are:\n", b)
for i := uint64(1); i < 1500000; i++ {
digits := strconv.FormatUint(i, b)
sum := uint64(0)
for _, digit := range digits {
if digit < 'a' {
sum += fact[digit-'0']
} else {
sum += fact[digit+10-'a']
}
}
if sum == i {
fmt.Printf("%d ", i)
}
}
fmt.Println("\n")
}
}
| fact = [1]
for n in range(1, 12):
fact.append(fact[n-1] * n)
for b in range(9, 12+1):
print(f"The factorions for base {b} are:")
for i in range(1, 1500000):
fact_sum = 0
j = i
while j > 0:
d = j % b
fact_sum += fact[d]
j = j//b
if fact_sum == i:
print(i, end=" ")
print("\n")
|
Write a version of this Go function in Python with identical behavior. | package main
import (
"fmt"
"github.com/maorshutman/lm"
"log"
"math"
)
const (
K = 7_800_000_000
n0 = 27
)
var y = []float64{
27, 27, 27, 44, 44, 59, 59, 59, 59, 59, 59, 59, 59, 60, 60,
61, 61, 66, 83, 219, 239, 392, 534, 631, 897, 1350, 2023,
2820, 4587, 6067, 7823, 9826, 11946, 14554, 17372, 20615,
24522, 28273, 31491, 34933, 37552, 40540, 43105, 45177,
60328, 64543, 67103, 69265, 71332, 73327, 75191, 75723,
76719, 77804, 78812, 79339, 80132, 80995, 82101, 83365,
85203, 87024, 89068, 90664, 93077, 95316, 98172, 102133,
105824, 109695, 114232, 118610, 125497, 133852, 143227,
151367, 167418, 180096, 194836, 213150, 242364, 271106,
305117, 338133, 377918, 416845, 468049, 527767, 591704,
656866, 715353, 777796, 851308, 928436, 1000249, 1082054,
1174652,
}
func f(dst, p []float64) {
for i := 0; i < len(y); i++ {
t := float64(i)
dst[i] = (n0*math.Exp(p[0]*t))/(1+n0*(math.Exp(p[0]*t)-1)/K) - y[i]
}
}
func main() {
j := lm.NumJac{Func: f}
prob := lm.LMProblem{
Dim: 1,
Size: len(y),
Func: f,
Jac: j.Jac,
InitParams: []float64{0.5},
Tau: 1e-6,
Eps1: 1e-8,
Eps2: 1e-8,
}
res, err := lm.LM(prob, &lm.Settings{Iterations: 100, ObjectiveTol: 1e-16})
if err != nil {
log.Fatal(err)
}
r := res.X[0]
fmt.Printf("The logistic curve r for the world data is %.8f\n", r)
fmt.Printf("R0 is then approximately equal to %.7f\n", math.Exp(12*r))
}
| import numpy as np
import scipy.optimize as opt
n0, K = 27, 7_800_000_000
def f(t, r):
return (n0 * np.exp(r * t)) / (( 1 + n0 * (np.exp(r * t) - 1) / K))
y = [
27, 27, 27, 44, 44, 59, 59, 59, 59, 59, 59, 59, 59, 60, 60,
61, 61, 66, 83, 219, 239, 392, 534, 631, 897, 1350, 2023,
2820, 4587, 6067, 7823, 9826, 11946, 14554, 17372, 20615,
24522, 28273, 31491, 34933, 37552, 40540, 43105, 45177,
60328, 64543, 67103, 69265, 71332, 73327, 75191, 75723,
76719, 77804, 78812, 79339, 80132, 80995, 82101, 83365,
85203, 87024, 89068, 90664, 93077, 95316, 98172, 102133,
105824, 109695, 114232, 118610, 125497, 133852, 143227,
151367, 167418, 180096, 194836, 213150, 242364, 271106,
305117, 338133, 377918, 416845, 468049, 527767, 591704,
656866, 715353, 777796, 851308, 928436, 1000249, 1082054,
1174652,
]
x = np.linspace(0.0, 96, 97)
r, cov = opt.curve_fit(f, x, y, [0.5])
print("The r for the world Covid-19 data is:", r,
", with covariance of", cov)
print("The calculated R0 is then", np.exp(12 * r))
|
Keep all operations the same but rewrite the snippet in Python. | package main
import "fmt"
type link struct {
int
next *link
}
func linkInts(s []int) *link {
if len(s) == 0 {
return nil
}
return &link{s[0], linkInts(s[1:])}
}
func (l *link) String() string {
if l == nil {
return "nil"
}
r := fmt.Sprintf("[%d", l.int)
for l = l.next; l != nil; l = l.next {
r = fmt.Sprintf("%s %d", r, l.int)
}
return r + "]"
}
func main() {
a := linkInts([]int{170, 45, 75, -90, -802, 24, 2, 66})
fmt.Println("before:", a)
b := strandSort(a)
fmt.Println("after: ", b)
}
func strandSort(a *link) (result *link) {
for a != nil {
sublist := a
a = a.next
sTail := sublist
for p, pPrev := a, a; p != nil; p = p.next {
if p.int > sTail.int {
sTail.next = p
sTail = p
if p == a {
a = p.next
} else {
pPrev.next = p.next
}
} else {
pPrev = p
}
}
sTail.next = nil
if result == nil {
result = sublist
continue
}
var m, rr *link
if sublist.int < result.int {
m = sublist
sublist = m.next
rr = result
} else {
m = result
rr = m.next
}
result = m
for {
if sublist == nil {
m.next = rr
break
}
if rr == nil {
m.next = sublist
break
}
if sublist.int < rr.int {
m.next = sublist
m = sublist
sublist = m.next
} else {
m.next = rr
m = rr
rr = m.next
}
}
}
return
}
| def merge_list(a, b):
out = []
while len(a) and len(b):
if a[0] < b[0]:
out.append(a.pop(0))
else:
out.append(b.pop(0))
out += a
out += b
return out
def strand(a):
i, s = 0, [a.pop(0)]
while i < len(a):
if a[i] > s[-1]:
s.append(a.pop(i))
else:
i += 1
return s
def strand_sort(a):
out = strand(a)
while len(a):
out = merge_list(out, strand(a))
return out
print strand_sort([1, 6, 3, 2, 1, 7, 5, 3])
|
Rewrite this program in Python while keeping its functionality equivalent to the Go version. | package main
import "fmt"
func isPrime(n int) bool {
switch {
case n < 2:
return false
case n%2 == 0:
return n == 2
case n%3 == 0:
return n == 3
default:
d := 5
for d*d <= n {
if n%d == 0 {
return false
}
d += 2
if n%d == 0 {
return false
}
d += 4
}
return true
}
}
func sumDigits(n int) int {
sum := 0
for n > 0 {
sum += n % 10
n /= 10
}
return sum
}
func main() {
fmt.Println("Additive primes less than 500:")
i := 2
count := 0
for {
if isPrime(i) && isPrime(sumDigits(i)) {
count++
fmt.Printf("%3d ", i)
if count%10 == 0 {
fmt.Println()
}
}
if i > 2 {
i += 2
} else {
i++
}
if i > 499 {
break
}
}
fmt.Printf("\n\n%d additive primes found.\n", count)
}
| def is_prime(n: int) -> bool:
if n <= 3:
return n > 1
if n % 2 == 0 or n % 3 == 0:
return False
i = 5
while i ** 2 <= n:
if n % i == 0 or n % (i + 2) == 0:
return False
i += 6
return True
def digit_sum(n: int) -> int:
sum = 0
while n > 0:
sum += n % 10
n //= 10
return sum
def main() -> None:
additive_primes = 0
for i in range(2, 500):
if is_prime(i) and is_prime(digit_sum(i)):
additive_primes += 1
print(i, end=" ")
print(f"\nFound {additive_primes} additive primes less than 500")
if __name__ == "__main__":
main()
|
Can you help me rewrite this code in Python instead of Go, keeping it the same logically? | package main
import "fmt"
type ibool bool
const itrue ibool = true
func (ib ibool) iif(cond bool) bool {
if cond {
return bool(ib)
}
return bool(!ib)
}
func main() {
var needUmbrella bool
raining := true
if raining {
needUmbrella = true
}
fmt.Printf("Is it raining? %t. Do I need an umbrella? %t\n", raining, needUmbrella)
raining = false
needUmbrella = itrue.iif(raining)
fmt.Printf("Is it raining? %t. Do I need an umbrella? %t\n", raining, needUmbrella)
}
| x = truevalue if condition else falsevalue
|
Translate the given Go code snippet into Python without altering its behavior. | package main
import "fmt"
type ibool bool
const itrue ibool = true
func (ib ibool) iif(cond bool) bool {
if cond {
return bool(ib)
}
return bool(!ib)
}
func main() {
var needUmbrella bool
raining := true
if raining {
needUmbrella = true
}
fmt.Printf("Is it raining? %t. Do I need an umbrella? %t\n", raining, needUmbrella)
raining = false
needUmbrella = itrue.iif(raining)
fmt.Printf("Is it raining? %t. Do I need an umbrella? %t\n", raining, needUmbrella)
}
| x = truevalue if condition else falsevalue
|
Translate this program into Python but keep the logic exactly as in Go. | package main
import "fmt"
func gcd(n, k int) int {
if n < k || k < 1 {
panic("Need n >= k and k >= 1")
}
s := 1
for n&1 == 0 && k&1 == 0 {
n >>= 1
k >>= 1
s <<= 1
}
t := n
if n&1 != 0 {
t = -k
}
for t != 0 {
for t&1 == 0 {
t >>= 1
}
if t > 0 {
n = t
} else {
k = -t
}
t = n - k
}
return n * s
}
func totient(n int) int {
tot := 0
for k := 1; k <= n; k++ {
if gcd(n, k) == 1 {
tot++
}
}
return tot
}
func main() {
var perfect []int
for n := 1; len(perfect) < 20; n += 2 {
tot := n
sum := 0
for tot != 1 {
tot = totient(tot)
sum += tot
}
if sum == n {
perfect = append(perfect, n)
}
}
fmt.Println("The first 20 perfect totient numbers are:")
fmt.Println(perfect)
}
| from math import gcd
from functools import lru_cache
from itertools import islice, count
@lru_cache(maxsize=None)
def φ(n):
return sum(1 for k in range(1, n + 1) if gcd(n, k) == 1)
def perfect_totient():
for n0 in count(1):
parts, n = 0, n0
while n != 1:
n = φ(n)
parts += n
if parts == n0:
yield n0
if __name__ == '__main__':
print(list(islice(perfect_totient(), 20)))
|
Keep all operations the same but rewrite the snippet in Python. | package main
import "fmt"
func gcd(n, k int) int {
if n < k || k < 1 {
panic("Need n >= k and k >= 1")
}
s := 1
for n&1 == 0 && k&1 == 0 {
n >>= 1
k >>= 1
s <<= 1
}
t := n
if n&1 != 0 {
t = -k
}
for t != 0 {
for t&1 == 0 {
t >>= 1
}
if t > 0 {
n = t
} else {
k = -t
}
t = n - k
}
return n * s
}
func totient(n int) int {
tot := 0
for k := 1; k <= n; k++ {
if gcd(n, k) == 1 {
tot++
}
}
return tot
}
func main() {
var perfect []int
for n := 1; len(perfect) < 20; n += 2 {
tot := n
sum := 0
for tot != 1 {
tot = totient(tot)
sum += tot
}
if sum == n {
perfect = append(perfect, n)
}
}
fmt.Println("The first 20 perfect totient numbers are:")
fmt.Println(perfect)
}
| from math import gcd
from functools import lru_cache
from itertools import islice, count
@lru_cache(maxsize=None)
def φ(n):
return sum(1 for k in range(1, n + 1) if gcd(n, k) == 1)
def perfect_totient():
for n0 in count(1):
parts, n = 0, n0
while n != 1:
n = φ(n)
parts += n
if parts == n0:
yield n0
if __name__ == '__main__':
print(list(islice(perfect_totient(), 20)))
|
Keep all operations the same but rewrite the snippet in Python. | package main
import "fmt"
type Delegator struct {
delegate interface{}
}
type Thingable interface {
thing() string
}
func (self Delegator) operation() string {
if v, ok := self.delegate.(Thingable); ok {
return v.thing()
}
return "default implementation"
}
type Delegate int
func (Delegate) thing() string {
return "delegate implementation"
}
func main() {
a := Delegator{}
fmt.Println(a.operation())
a.delegate = "A delegate may be any object"
fmt.Println(a.operation())
var d Delegate
a.delegate = d
fmt.Println(a.operation())
}
| class Delegator:
def __init__(self):
self.delegate = None
def operation(self):
if hasattr(self.delegate, 'thing') and callable(self.delegate.thing):
return self.delegate.thing()
return 'default implementation'
class Delegate:
def thing(self):
return 'delegate implementation'
if __name__ == '__main__':
a = Delegator()
assert a.operation() == 'default implementation'
a.delegate = 'A delegate may be any object'
assert a.operation() == 'default implementation'
a.delegate = Delegate()
assert a.operation() == 'delegate implementation'
|
Change the programming language of this snippet from Go to Python without modifying what it does. | package main
import "fmt"
func sumDivisors(n int) int {
sum := 0
i := 1
k := 2
if n%2 == 0 {
k = 1
}
for i*i <= n {
if n%i == 0 {
sum += i
j := n / i
if j != i {
sum += j
}
}
i += k
}
return sum
}
func main() {
fmt.Println("The sums of positive divisors for the first 100 positive integers are:")
for i := 1; i <= 100; i++ {
fmt.Printf("%3d ", sumDivisors(i))
if i%10 == 0 {
fmt.Println()
}
}
}
| def factorize(n):
assert(isinstance(n, int))
if n < 0:
n = -n
if n < 2:
return
k = 0
while 0 == n%2:
k += 1
n //= 2
if 0 < k:
yield (2,k)
p = 3
while p*p <= n:
k = 0
while 0 == n%p:
k += 1
n //= p
if 0 < k:
yield (p,k)
p += 2
if 1 < n:
yield (n,1)
def sum_of_divisors(n):
assert(n != 0)
ans = 1
for (p,k) in factorize(n):
ans *= (pow(p,k+1) - 1)//(p-1)
return ans
if __name__ == "__main__":
print([sum_of_divisors(n) for n in range(1,101)])
|
Ensure the translated Python code behaves exactly like the original Go snippet. | package main
import "fmt"
func sumDivisors(n int) int {
sum := 0
i := 1
k := 2
if n%2 == 0 {
k = 1
}
for i*i <= n {
if n%i == 0 {
sum += i
j := n / i
if j != i {
sum += j
}
}
i += k
}
return sum
}
func main() {
fmt.Println("The sums of positive divisors for the first 100 positive integers are:")
for i := 1; i <= 100; i++ {
fmt.Printf("%3d ", sumDivisors(i))
if i%10 == 0 {
fmt.Println()
}
}
}
| def factorize(n):
assert(isinstance(n, int))
if n < 0:
n = -n
if n < 2:
return
k = 0
while 0 == n%2:
k += 1
n //= 2
if 0 < k:
yield (2,k)
p = 3
while p*p <= n:
k = 0
while 0 == n%p:
k += 1
n //= p
if 0 < k:
yield (p,k)
p += 2
if 1 < n:
yield (n,1)
def sum_of_divisors(n):
assert(n != 0)
ans = 1
for (p,k) in factorize(n):
ans *= (pow(p,k+1) - 1)//(p-1)
return ans
if __name__ == "__main__":
print([sum_of_divisors(n) for n in range(1,101)])
|
Write the same algorithm in Python as shown in this Go implementation. | package main
import (
"fmt"
"strings"
)
var table =
"Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy " +
"COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find " +
"NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput " +
"Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO " +
"MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT " +
"READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT " +
"RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up "
func validate(commands, words []string, minLens []int) []string {
results := make([]string, 0)
if len(words) == 0 {
return results
}
for _, word := range words {
matchFound := false
wlen := len(word)
for i, command := range commands {
if minLens[i] == 0 || wlen < minLens[i] || wlen > len(command) {
continue
}
c := strings.ToUpper(command)
w := strings.ToUpper(word)
if strings.HasPrefix(c, w) {
results = append(results, c)
matchFound = true
break
}
}
if !matchFound {
results = append(results, "*error*")
}
}
return results
}
func main() {
table = strings.TrimSpace(table)
commands := strings.Fields(table)
clen := len(commands)
minLens := make([]int, clen)
for i := 0; i < clen; i++ {
count := 0
for _, c := range commands[i] {
if c >= 'A' && c <= 'Z' {
count++
}
}
minLens[i] = count
}
sentence := "riG rePEAT copies put mo rest types fup. 6 poweRin"
words := strings.Fields(sentence)
results := validate(commands, words, minLens)
fmt.Print("user words: ")
for j := 0; j < len(words); j++ {
fmt.Printf("%-*s ", len(results[j]), words[j])
}
fmt.Print("\nfull words: ")
fmt.Println(strings.Join(results, " "))
}
| command_table_text = \
user_words = "riG rePEAT copies put mo rest types fup. 6 poweRin"
def find_abbreviations_length(command_table_text):
command_table = dict()
for word in command_table_text.split():
abbr_len = sum(1 for c in word if c.isupper())
if abbr_len == 0:
abbr_len = len(word)
command_table[word] = abbr_len
return command_table
def find_abbreviations(command_table):
abbreviations = dict()
for command, min_abbr_len in command_table.items():
for l in range(min_abbr_len, len(command)+1):
abbr = command[:l].lower()
abbreviations[abbr] = command.upper()
return abbreviations
def parse_user_string(user_string, abbreviations):
user_words = [word.lower() for word in user_string.split()]
commands = [abbreviations.get(user_word, "*error*") for user_word in user_words]
return " ".join(commands)
command_table = find_abbreviations_length(command_table_text)
abbreviations_table = find_abbreviations(command_table)
full_words = parse_user_string(user_words, abbreviations_table)
print("user words:", user_words)
print("full words:", full_words)
|
Can you help me rewrite this code in Python instead of Go, keeping it the same logically? | package main
import (
"fmt"
"strings"
)
var table =
"Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy " +
"COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find " +
"NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput " +
"Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO " +
"MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT " +
"READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT " +
"RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up "
func validate(commands, words []string, minLens []int) []string {
results := make([]string, 0)
if len(words) == 0 {
return results
}
for _, word := range words {
matchFound := false
wlen := len(word)
for i, command := range commands {
if minLens[i] == 0 || wlen < minLens[i] || wlen > len(command) {
continue
}
c := strings.ToUpper(command)
w := strings.ToUpper(word)
if strings.HasPrefix(c, w) {
results = append(results, c)
matchFound = true
break
}
}
if !matchFound {
results = append(results, "*error*")
}
}
return results
}
func main() {
table = strings.TrimSpace(table)
commands := strings.Fields(table)
clen := len(commands)
minLens := make([]int, clen)
for i := 0; i < clen; i++ {
count := 0
for _, c := range commands[i] {
if c >= 'A' && c <= 'Z' {
count++
}
}
minLens[i] = count
}
sentence := "riG rePEAT copies put mo rest types fup. 6 poweRin"
words := strings.Fields(sentence)
results := validate(commands, words, minLens)
fmt.Print("user words: ")
for j := 0; j < len(words); j++ {
fmt.Printf("%-*s ", len(results[j]), words[j])
}
fmt.Print("\nfull words: ")
fmt.Println(strings.Join(results, " "))
}
| command_table_text = \
user_words = "riG rePEAT copies put mo rest types fup. 6 poweRin"
def find_abbreviations_length(command_table_text):
command_table = dict()
for word in command_table_text.split():
abbr_len = sum(1 for c in word if c.isupper())
if abbr_len == 0:
abbr_len = len(word)
command_table[word] = abbr_len
return command_table
def find_abbreviations(command_table):
abbreviations = dict()
for command, min_abbr_len in command_table.items():
for l in range(min_abbr_len, len(command)+1):
abbr = command[:l].lower()
abbreviations[abbr] = command.upper()
return abbreviations
def parse_user_string(user_string, abbreviations):
user_words = [word.lower() for word in user_string.split()]
commands = [abbreviations.get(user_word, "*error*") for user_word in user_words]
return " ".join(commands)
command_table = find_abbreviations_length(command_table_text)
abbreviations_table = find_abbreviations(command_table)
full_words = parse_user_string(user_words, abbreviations_table)
print("user words:", user_words)
print("full words:", full_words)
|
Convert the following code from Go to Python, ensuring the logic remains intact. | package main
func main() {
s := "immutable"
s[0] = 'a'
}
| >>> s = "Hello"
>>> s[0] = "h"
Traceback (most recent call last):
File "<pyshell
s[0] = "h"
TypeError: 'str' object does not support item assignment
|
Port the provided Go code into Python while preserving the original functionality. | package main
import "fmt"
type point struct {
x, y float32
}
var subjectPolygon = []point{{50, 150}, {200, 50}, {350, 150}, {350, 300},
{250, 300}, {200, 250}, {150, 350}, {100, 250}, {100, 200}}
var clipPolygon = []point{{100, 100}, {300, 100}, {300, 300}, {100, 300}}
func main() {
var cp1, cp2, s, e point
inside := func(p point) bool {
return (cp2.x-cp1.x)*(p.y-cp1.y) > (cp2.y-cp1.y)*(p.x-cp1.x)
}
intersection := func() (p point) {
dcx, dcy := cp1.x-cp2.x, cp1.y-cp2.y
dpx, dpy := s.x-e.x, s.y-e.y
n1 := cp1.x*cp2.y - cp1.y*cp2.x
n2 := s.x*e.y - s.y*e.x
n3 := 1 / (dcx*dpy - dcy*dpx)
p.x = (n1*dpx - n2*dcx) * n3
p.y = (n1*dpy - n2*dcy) * n3
return
}
outputList := subjectPolygon
cp1 = clipPolygon[len(clipPolygon)-1]
for _, cp2 = range clipPolygon {
inputList := outputList
outputList = nil
s = inputList[len(inputList)-1]
for _, e = range inputList {
if inside(e) {
if !inside(s) {
outputList = append(outputList, intersection())
}
outputList = append(outputList, e)
} else if inside(s) {
outputList = append(outputList, intersection())
}
s = e
}
cp1 = cp2
}
fmt.Println(outputList)
}
| def clip(subjectPolygon, clipPolygon):
def inside(p):
return(cp2[0]-cp1[0])*(p[1]-cp1[1]) > (cp2[1]-cp1[1])*(p[0]-cp1[0])
def computeIntersection():
dc = [ cp1[0] - cp2[0], cp1[1] - cp2[1] ]
dp = [ s[0] - e[0], s[1] - e[1] ]
n1 = cp1[0] * cp2[1] - cp1[1] * cp2[0]
n2 = s[0] * e[1] - s[1] * e[0]
n3 = 1.0 / (dc[0] * dp[1] - dc[1] * dp[0])
return [(n1*dp[0] - n2*dc[0]) * n3, (n1*dp[1] - n2*dc[1]) * n3]
outputList = subjectPolygon
cp1 = clipPolygon[-1]
for clipVertex in clipPolygon:
cp2 = clipVertex
inputList = outputList
outputList = []
s = inputList[-1]
for subjectVertex in inputList:
e = subjectVertex
if inside(e):
if not inside(s):
outputList.append(computeIntersection())
outputList.append(e)
elif inside(s):
outputList.append(computeIntersection())
s = e
cp1 = cp2
return(outputList)
|
Convert this Go snippet to Python and keep its semantics consistent. | package main
import(
"fmt"
"strings"
)
var codes = map[rune]string {
'a' : "AAAAA", 'b' : "AAAAB", 'c' : "AAABA", 'd' : "AAABB", 'e' : "AABAA",
'f' : "AABAB", 'g' : "AABBA", 'h' : "AABBB", 'i' : "ABAAA", 'j' : "ABAAB",
'k' : "ABABA", 'l' : "ABABB", 'm' : "ABBAA", 'n' : "ABBAB", 'o' : "ABBBA",
'p' : "ABBBB", 'q' : "BAAAA", 'r' : "BAAAB", 's' : "BAABA", 't' : "BAABB",
'u' : "BABAA", 'v' : "BABAB", 'w' : "BABBA", 'x' : "BABBB", 'y' : "BBAAA",
'z' : "BBAAB", ' ' : "BBBAA",
}
func baconEncode(plainText string, message string) string {
pt := strings.ToLower(plainText)
var sb []byte
for _, c := range pt {
if c >= 'a' && c <= 'z' {
sb = append(sb, codes[c]...)
} else {
sb = append(sb, codes[' ']...)
}
}
et := string(sb)
mg := strings.ToLower(message)
sb = nil
var count = 0
for _, c := range mg {
if c >= 'a' && c <= 'z' {
if et[count] == 'A' {
sb = append(sb, byte(c))
} else {
sb = append(sb, byte(c - 32))
}
count++
if count == len(et) { break }
} else {
sb = append(sb, byte(c))
}
}
return string(sb)
}
func baconDecode(message string) string {
var sb []byte
for _, c := range message {
if c >= 'a' && c <= 'z' {
sb = append(sb, 'A')
} else if c >= 'A' && c <= 'Z' {
sb = append(sb, 'B')
}
}
et := string(sb)
sb = nil
for i := 0; i < len(et); i += 5 {
quintet := et[i : i + 5]
for k, v := range codes {
if v == quintet {
sb = append(sb, byte(k))
break
}
}
}
return string(sb)
}
func main() {
plainText := "the quick brown fox jumps over the lazy dog"
message := "bacon's cipher is a method of steganography created by francis bacon." +
"this task is to implement a program for encryption and decryption of " +
"plaintext using the simple alphabet of the baconian cipher or some " +
"other kind of representation of this alphabet (make anything signify anything). " +
"the baconian alphabet may optionally be extended to encode all lower " +
"case characters individually and/or adding a few punctuation characters " +
"such as the space."
cipherText := baconEncode(plainText, message)
fmt.Printf("Cipher text ->\n\n%s\n", cipherText)
decodedText := baconDecode(cipherText)
fmt.Printf("\nHidden text ->\n\n%s\n", decodedText)
}
| import string
sometext = .lower()
lc2bin = {ch: '{:05b}'.format(i)
for i, ch in enumerate(string.ascii_lowercase + ' .')}
bin2lc = {val: key for key, val in lc2bin.items()}
phrase = 'Rosetta code Bacon cipher example secret phrase to encode in the capitalisation of peter pan'.lower()
def to_5binary(msg):
return ( ch == '1' for ch in ''.join(lc2bin.get(ch, '') for ch in msg.lower()))
def encrypt(message, text):
bin5 = to_5binary(message)
textlist = list(text.lower())
out = []
for capitalise in bin5:
while textlist:
ch = textlist.pop(0)
if ch.isalpha():
if capitalise:
ch = ch.upper()
out.append(ch)
break
else:
out.append(ch)
else:
raise Exception('ERROR: Ran out of characters in sometext')
return ''.join(out) + '...'
def decrypt(bacontext):
binary = []
bin5 = []
out = []
for ch in bacontext:
if ch.isalpha():
binary.append('1' if ch.isupper() else '0')
if len(binary) == 5:
bin5 = ''.join(binary)
out.append(bin2lc[bin5])
binary = []
return ''.join(out)
print('PLAINTEXT = \n%s\n' % phrase)
encrypted = encrypt(phrase, sometext)
print('ENCRYPTED = \n%s\n' % encrypted)
decrypted = decrypt(encrypted)
print('DECRYPTED = \n%s\n' % decrypted)
assert phrase == decrypted, 'Round-tripping error'
|
Write a version of this Go function in Python with identical behavior. | package main
import(
"fmt"
"strings"
)
var codes = map[rune]string {
'a' : "AAAAA", 'b' : "AAAAB", 'c' : "AAABA", 'd' : "AAABB", 'e' : "AABAA",
'f' : "AABAB", 'g' : "AABBA", 'h' : "AABBB", 'i' : "ABAAA", 'j' : "ABAAB",
'k' : "ABABA", 'l' : "ABABB", 'm' : "ABBAA", 'n' : "ABBAB", 'o' : "ABBBA",
'p' : "ABBBB", 'q' : "BAAAA", 'r' : "BAAAB", 's' : "BAABA", 't' : "BAABB",
'u' : "BABAA", 'v' : "BABAB", 'w' : "BABBA", 'x' : "BABBB", 'y' : "BBAAA",
'z' : "BBAAB", ' ' : "BBBAA",
}
func baconEncode(plainText string, message string) string {
pt := strings.ToLower(plainText)
var sb []byte
for _, c := range pt {
if c >= 'a' && c <= 'z' {
sb = append(sb, codes[c]...)
} else {
sb = append(sb, codes[' ']...)
}
}
et := string(sb)
mg := strings.ToLower(message)
sb = nil
var count = 0
for _, c := range mg {
if c >= 'a' && c <= 'z' {
if et[count] == 'A' {
sb = append(sb, byte(c))
} else {
sb = append(sb, byte(c - 32))
}
count++
if count == len(et) { break }
} else {
sb = append(sb, byte(c))
}
}
return string(sb)
}
func baconDecode(message string) string {
var sb []byte
for _, c := range message {
if c >= 'a' && c <= 'z' {
sb = append(sb, 'A')
} else if c >= 'A' && c <= 'Z' {
sb = append(sb, 'B')
}
}
et := string(sb)
sb = nil
for i := 0; i < len(et); i += 5 {
quintet := et[i : i + 5]
for k, v := range codes {
if v == quintet {
sb = append(sb, byte(k))
break
}
}
}
return string(sb)
}
func main() {
plainText := "the quick brown fox jumps over the lazy dog"
message := "bacon's cipher is a method of steganography created by francis bacon." +
"this task is to implement a program for encryption and decryption of " +
"plaintext using the simple alphabet of the baconian cipher or some " +
"other kind of representation of this alphabet (make anything signify anything). " +
"the baconian alphabet may optionally be extended to encode all lower " +
"case characters individually and/or adding a few punctuation characters " +
"such as the space."
cipherText := baconEncode(plainText, message)
fmt.Printf("Cipher text ->\n\n%s\n", cipherText)
decodedText := baconDecode(cipherText)
fmt.Printf("\nHidden text ->\n\n%s\n", decodedText)
}
| import string
sometext = .lower()
lc2bin = {ch: '{:05b}'.format(i)
for i, ch in enumerate(string.ascii_lowercase + ' .')}
bin2lc = {val: key for key, val in lc2bin.items()}
phrase = 'Rosetta code Bacon cipher example secret phrase to encode in the capitalisation of peter pan'.lower()
def to_5binary(msg):
return ( ch == '1' for ch in ''.join(lc2bin.get(ch, '') for ch in msg.lower()))
def encrypt(message, text):
bin5 = to_5binary(message)
textlist = list(text.lower())
out = []
for capitalise in bin5:
while textlist:
ch = textlist.pop(0)
if ch.isalpha():
if capitalise:
ch = ch.upper()
out.append(ch)
break
else:
out.append(ch)
else:
raise Exception('ERROR: Ran out of characters in sometext')
return ''.join(out) + '...'
def decrypt(bacontext):
binary = []
bin5 = []
out = []
for ch in bacontext:
if ch.isalpha():
binary.append('1' if ch.isupper() else '0')
if len(binary) == 5:
bin5 = ''.join(binary)
out.append(bin2lc[bin5])
binary = []
return ''.join(out)
print('PLAINTEXT = \n%s\n' % phrase)
encrypted = encrypt(phrase, sometext)
print('ENCRYPTED = \n%s\n' % encrypted)
decrypted = decrypt(encrypted)
print('DECRYPTED = \n%s\n' % decrypted)
assert phrase == decrypted, 'Round-tripping error'
|
Produce a language-to-language conversion: from Go to Python, same semantics. | package main
import (
"fmt"
"strconv"
)
var n = 5
func main() {
if n < 1 {
return
}
top, left, bottom, right := 0, 0, n-1, n-1
sz := n * n
a := make([]int, sz)
i := 0
for left < right {
for c := left; c <= right; c++ {
a[top*n+c] = i
i++
}
top++
for r := top; r <= bottom; r++ {
a[r*n+right] = i
i++
}
right--
if top == bottom {
break
}
for c := right; c >= left; c-- {
a[bottom*n+c] = i
i++
}
bottom--
for r := bottom; r >= top; r-- {
a[r*n+left] = i
i++
}
left++
}
a[top*n+left] = i
w := len(strconv.Itoa(n*n - 1))
for i, e := range a {
fmt.Printf("%*d ", w, e)
if i%n == n-1 {
fmt.Println("")
}
}
}
| def spiral(n):
dx,dy = 1,0
x,y = 0,0
myarray = [[None]* n for j in range(n)]
for i in xrange(n**2):
myarray[x][y] = i
nx,ny = x+dx, y+dy
if 0<=nx<n and 0<=ny<n and myarray[nx][ny] == None:
x,y = nx,ny
else:
dx,dy = -dy,dx
x,y = x+dx, y+dy
return myarray
def printspiral(myarray):
n = range(len(myarray))
for y in n:
for x in n:
print "%2i" % myarray[x][y],
print
printspiral(spiral(5))
|
Change the following Go code into Python without altering its purpose. | type cell string
type spec struct {
less func(cell, cell) bool
column int
reverse bool
}
func newSpec() (s spec) {
return
}
t.sort(newSpec())
s := newSpec
s.reverse = true
t.sort(s)
| >>> def printtable(data):
for row in data:
print ' '.join('%-5s' % ('"%s"' % cell) for cell in row)
>>> import operator
>>> def sorttable(table, ordering=None, column=0, reverse=False):
return sorted(table, cmp=ordering, key=operator.itemgetter(column), reverse=reverse)
>>> data = [["a", "b", "c"], ["", "q", "z"], ["zap", "zip", "Zot"]]
>>> printtable(data)
"a" "b" "c"
"" "q" "z"
"zap" "zip" "Zot"
>>> printtable( sorttable(data) )
"" "q" "z"
"a" "b" "c"
"zap" "zip" "Zot"
>>> printtable( sorttable(data, column=2) )
"zap" "zip" "Zot"
"a" "b" "c"
"" "q" "z"
>>> printtable( sorttable(data, column=1) )
"a" "b" "c"
"" "q" "z"
"zap" "zip" "Zot"
>>> printtable( sorttable(data, column=1, reverse=True) )
"zap" "zip" "Zot"
"" "q" "z"
"a" "b" "c"
>>> printtable( sorttable(data, ordering=lambda a,b: cmp(len(b),len(a))) )
"zap" "zip" "Zot"
"a" "b" "c"
"" "q" "z"
>>>
|
Keep all operations the same but rewrite the snippet in Python. | package main
import (
"fmt"
"image"
"image/color"
"image/draw"
"image/png"
"math/rand"
"os"
"time"
)
const (
imageWidth = 300
imageHeight = 200
nSites = 10
)
func main() {
writePngFile(generateVoronoi(randomSites()))
}
func generateVoronoi(sx, sy []int) image.Image {
sc := make([]color.NRGBA, nSites)
for i := range sx {
sc[i] = color.NRGBA{uint8(rand.Intn(256)), uint8(rand.Intn(256)),
uint8(rand.Intn(256)), 255}
}
img := image.NewNRGBA(image.Rect(0, 0, imageWidth, imageHeight))
for x := 0; x < imageWidth; x++ {
for y := 0; y < imageHeight; y++ {
dMin := dot(imageWidth, imageHeight)
var sMin int
for s := 0; s < nSites; s++ {
if d := dot(sx[s]-x, sy[s]-y); d < dMin {
sMin = s
dMin = d
}
}
img.SetNRGBA(x, y, sc[sMin])
}
}
black := image.NewUniform(color.Black)
for s := 0; s < nSites; s++ {
draw.Draw(img, image.Rect(sx[s]-2, sy[s]-2, sx[s]+2, sy[s]+2),
black, image.ZP, draw.Src)
}
return img
}
func dot(x, y int) int {
return x*x + y*y
}
func randomSites() (sx, sy []int) {
rand.Seed(time.Now().Unix())
sx = make([]int, nSites)
sy = make([]int, nSites)
for i := range sx {
sx[i] = rand.Intn(imageWidth)
sy[i] = rand.Intn(imageHeight)
}
return
}
func writePngFile(img image.Image) {
f, err := os.Create("voronoi.png")
if err != nil {
fmt.Println(err)
return
}
if err = png.Encode(f, img); err != nil {
fmt.Println(err)
}
if err = f.Close(); err != nil {
fmt.Println(err)
}
}
| def setup():
size(500, 500)
generate_voronoi_diagram(width, height, 25)
saveFrame("VoronoiDiagram.png")
def generate_voronoi_diagram(w, h, num_cells):
nx, ny, nr, ng, nb = [], [], [], [], []
for i in range(num_cells):
nx.append(int(random(w)))
ny.append(int(random(h)))
nr.append(int(random(256)))
ng.append(int(random(256)))
nb.append(int(random(256)))
for y in range(h):
for x in range(w):
dmin = dist(0, 0, w - 1, h - 1)
j = -1
for i in range(num_cells):
d = dist(0, 0, nx[i] - x, ny[i] - y)
if d < dmin:
dmin = d
j = i
set(x, y, color(nr[j], ng[j], nb[j]))
|
Keep all operations the same but rewrite the snippet in Python. | package main
import (
"fmt"
"image"
"image/color"
"image/draw"
"image/png"
"math/rand"
"os"
"time"
)
const (
imageWidth = 300
imageHeight = 200
nSites = 10
)
func main() {
writePngFile(generateVoronoi(randomSites()))
}
func generateVoronoi(sx, sy []int) image.Image {
sc := make([]color.NRGBA, nSites)
for i := range sx {
sc[i] = color.NRGBA{uint8(rand.Intn(256)), uint8(rand.Intn(256)),
uint8(rand.Intn(256)), 255}
}
img := image.NewNRGBA(image.Rect(0, 0, imageWidth, imageHeight))
for x := 0; x < imageWidth; x++ {
for y := 0; y < imageHeight; y++ {
dMin := dot(imageWidth, imageHeight)
var sMin int
for s := 0; s < nSites; s++ {
if d := dot(sx[s]-x, sy[s]-y); d < dMin {
sMin = s
dMin = d
}
}
img.SetNRGBA(x, y, sc[sMin])
}
}
black := image.NewUniform(color.Black)
for s := 0; s < nSites; s++ {
draw.Draw(img, image.Rect(sx[s]-2, sy[s]-2, sx[s]+2, sy[s]+2),
black, image.ZP, draw.Src)
}
return img
}
func dot(x, y int) int {
return x*x + y*y
}
func randomSites() (sx, sy []int) {
rand.Seed(time.Now().Unix())
sx = make([]int, nSites)
sy = make([]int, nSites)
for i := range sx {
sx[i] = rand.Intn(imageWidth)
sy[i] = rand.Intn(imageHeight)
}
return
}
func writePngFile(img image.Image) {
f, err := os.Create("voronoi.png")
if err != nil {
fmt.Println(err)
return
}
if err = png.Encode(f, img); err != nil {
fmt.Println(err)
}
if err = f.Close(); err != nil {
fmt.Println(err)
}
}
| def setup():
size(500, 500)
generate_voronoi_diagram(width, height, 25)
saveFrame("VoronoiDiagram.png")
def generate_voronoi_diagram(w, h, num_cells):
nx, ny, nr, ng, nb = [], [], [], [], []
for i in range(num_cells):
nx.append(int(random(w)))
ny.append(int(random(h)))
nr.append(int(random(256)))
ng.append(int(random(256)))
nb.append(int(random(256)))
for y in range(h):
for x in range(w):
dmin = dist(0, 0, w - 1, h - 1)
j = -1
for i in range(num_cells):
d = dist(0, 0, nx[i] - x, ny[i] - y)
if d < dmin:
dmin = d
j = i
set(x, y, color(nr[j], ng[j], nb[j]))
|
Ensure the translated Python code behaves exactly like the original Go snippet. | package main
import "C"
import (
"fmt"
"unsafe"
)
func main() {
go1 := "hello C"
c1 := C.CString(go1)
go1 = ""
c2 := C.strdup(c1)
C.free(unsafe.Pointer(c1))
go2 := C.GoString(c2)
C.free(unsafe.Pointer(c2))
fmt.Println(go2)
}
| import ctypes
libc = ctypes.CDLL("/lib/libc.so.6")
libc.strcmp("abc", "def")
libc.strcmp("hello", "hello")
|
Produce a functionally identical Python code for the snippet given in Go. | package main
import (
"fmt"
"math/rand"
"time"
)
func sOfNCreator(n int) func(byte) []byte {
s := make([]byte, 0, n)
m := n
return func(item byte) []byte {
if len(s) < n {
s = append(s, item)
} else {
m++
if rand.Intn(m) < n {
s[rand.Intn(n)] = item
}
}
return s
}
}
func main() {
rand.Seed(time.Now().UnixNano())
var freq [10]int
for r := 0; r < 1e5; r++ {
sOfN := sOfNCreator(3)
for d := byte('0'); d < '9'; d++ {
sOfN(d)
}
for _, d := range sOfN('9') {
freq[d-'0']++
}
}
fmt.Println(freq)
}
| from random import randrange
def s_of_n_creator(n):
sample, i = [], 0
def s_of_n(item):
nonlocal i
i += 1
if i <= n:
sample.append(item)
elif randrange(i) < n:
sample[randrange(n)] = item
return sample
return s_of_n
if __name__ == '__main__':
bin = [0]* 10
items = range(10)
print("Single run samples for n = 3:")
s_of_n = s_of_n_creator(3)
for item in items:
sample = s_of_n(item)
print(" Item: %i -> sample: %s" % (item, sample))
for trial in range(100000):
s_of_n = s_of_n_creator(3)
for item in items:
sample = s_of_n(item)
for s in sample:
bin[s] += 1
print("\nTest item frequencies for 100000 runs:\n ",
'\n '.join("%i:%i" % x for x in enumerate(bin)))
|
Ensure the translated Python code behaves exactly like the original Go snippet. | package main
import (
"fmt"
"math/rand"
"time"
)
func sOfNCreator(n int) func(byte) []byte {
s := make([]byte, 0, n)
m := n
return func(item byte) []byte {
if len(s) < n {
s = append(s, item)
} else {
m++
if rand.Intn(m) < n {
s[rand.Intn(n)] = item
}
}
return s
}
}
func main() {
rand.Seed(time.Now().UnixNano())
var freq [10]int
for r := 0; r < 1e5; r++ {
sOfN := sOfNCreator(3)
for d := byte('0'); d < '9'; d++ {
sOfN(d)
}
for _, d := range sOfN('9') {
freq[d-'0']++
}
}
fmt.Println(freq)
}
| from random import randrange
def s_of_n_creator(n):
sample, i = [], 0
def s_of_n(item):
nonlocal i
i += 1
if i <= n:
sample.append(item)
elif randrange(i) < n:
sample[randrange(n)] = item
return sample
return s_of_n
if __name__ == '__main__':
bin = [0]* 10
items = range(10)
print("Single run samples for n = 3:")
s_of_n = s_of_n_creator(3)
for item in items:
sample = s_of_n(item)
print(" Item: %i -> sample: %s" % (item, sample))
for trial in range(100000):
s_of_n = s_of_n_creator(3)
for item in items:
sample = s_of_n(item)
for s in sample:
bin[s] += 1
print("\nTest item frequencies for 100000 runs:\n ",
'\n '.join("%i:%i" % x for x in enumerate(bin)))
|
Produce a language-to-language conversion: from Go to Python, same semantics. | package main
import (
"fmt"
"math/big"
)
func bernoulli(n uint) *big.Rat {
a := make([]big.Rat, n+1)
z := new(big.Rat)
for m := range a {
a[m].SetFrac64(1, int64(m+1))
for j := m; j >= 1; j-- {
d := &a[j-1]
d.Mul(z.SetInt64(int64(j)), d.Sub(d, &a[j]))
}
}
if n != 1 {
return &a[0]
}
a[0].Neg(&a[0])
return &a[0]
}
func binomial(n, k int) int64 {
if n <= 0 || k <= 0 || n < k {
return 1
}
var num, den int64 = 1, 1
for i := k + 1; i <= n; i++ {
num *= int64(i)
}
for i := 2; i <= n-k; i++ {
den *= int64(i)
}
return num / den
}
func faulhaberTriangle(p int) []big.Rat {
coeffs := make([]big.Rat, p+1)
q := big.NewRat(1, int64(p)+1)
t := new(big.Rat)
u := new(big.Rat)
sign := -1
for j := range coeffs {
sign *= -1
d := &coeffs[p-j]
t.SetInt64(int64(sign))
u.SetInt64(binomial(p+1, j))
d.Mul(q, t)
d.Mul(d, u)
d.Mul(d, bernoulli(uint(j)))
}
return coeffs
}
func main() {
for i := 0; i < 10; i++ {
coeffs := faulhaberTriangle(i)
for _, coeff := range coeffs {
fmt.Printf("%5s ", coeff.RatString())
}
fmt.Println()
}
fmt.Println()
k := 17
cc := faulhaberTriangle(k)
n := int64(1000)
nn := big.NewRat(n, 1)
np := big.NewRat(1, 1)
sum := new(big.Rat)
tmp := new(big.Rat)
for _, c := range cc {
np.Mul(np, nn)
tmp.Set(np)
tmp.Mul(tmp, &c)
sum.Add(sum, tmp)
}
fmt.Println(sum.RatString())
}
|
from itertools import accumulate, chain, count, islice
from fractions import Fraction
def faulhaberTriangle(m):
def go(rs, n):
def f(x, y):
return Fraction(n, x) * y
xs = list(map(f, islice(count(2), m), rs))
return [Fraction(1 - sum(xs), 1)] + xs
return list(accumulate(
[[]] + list(islice(count(0), 1 + m)),
go
))[1:]
def faulhaberSum(p, n):
def go(x, y):
return y * (n ** x)
return sum(
map(go, count(1), faulhaberTriangle(p)[-1])
)
def main():
fs = faulhaberTriangle(9)
print(
fTable(__doc__ + ':\n')(str)(
compose(concat)(
fmap(showRatio(3)(3))
)
)(
index(fs)
)(range(0, len(fs)))
)
print('')
print(
faulhaberSum(17, 1000)
)
def fTable(s):
def gox(xShow):
def gofx(fxShow):
def gof(f):
def goxs(xs):
ys = [xShow(x) for x in xs]
w = max(map(len, ys))
def arrowed(x, y):
return y.rjust(w, ' ') + ' -> ' + (
fxShow(f(x))
)
return s + '\n' + '\n'.join(
map(arrowed, xs, ys)
)
return goxs
return gof
return gofx
return gox
def compose(g):
return lambda f: lambda x: g(f(x))
def concat(xs):
def f(ys):
zs = list(chain(*ys))
return ''.join(zs) if isinstance(ys[0], str) else zs
return (
f(xs) if isinstance(xs, list) else (
chain.from_iterable(xs)
)
) if xs else []
def fmap(f):
def go(xs):
return list(map(f, xs))
return go
def index(xs):
return lambda n: None if 0 > n else (
xs[n] if (
hasattr(xs, "__getitem__")
) else next(islice(xs, n, None))
)
def showRatio(m):
def go(n):
def f(r):
d = r.denominator
return str(r.numerator).rjust(m, ' ') + (
('/' + str(d).ljust(n, ' ')) if 1 != d else (
' ' * (1 + n)
)
)
return f
return go
if __name__ == '__main__':
main()
|
Port the following code from Go to Python with equivalent syntax and logic. | package main
import (
"fmt"
"os"
)
func main() {
for i, x := range os.Args[1:] {
fmt.Printf("the argument #%d is %s\n", i, x)
}
}
| import sys
program_name = sys.argv[0]
arguments = sys.argv[1:]
count = len(arguments)
|
Convert this Go snippet to Python and keep its semantics consistent. | package main
import (
"fmt"
"os"
)
func main() {
for i, x := range os.Args[1:] {
fmt.Printf("the argument #%d is %s\n", i, x)
}
}
| import sys
program_name = sys.argv[0]
arguments = sys.argv[1:]
count = len(arguments)
|
Write the same algorithm in Python as shown in this Go implementation. | package main
import (
"bytes"
"fmt"
"io/ioutil"
"log"
"sort"
"strings"
)
func main() {
b, err := ioutil.ReadFile("unixdict.txt")
if err != nil {
log.Fatal("Error reading file")
}
letters := "deegklnow"
wordsAll := bytes.Split(b, []byte{'\n'})
var words [][]byte
for _, word := range wordsAll {
word = bytes.TrimSpace(word)
le := len(word)
if le > 2 && le < 10 {
words = append(words, word)
}
}
var found []string
for _, word := range words {
le := len(word)
if bytes.IndexByte(word, 'k') >= 0 {
lets := letters
ok := true
for i := 0; i < le; i++ {
c := word[i]
ix := sort.Search(len(lets), func(i int) bool { return lets[i] >= c })
if ix < len(lets) && lets[ix] == c {
lets = lets[0:ix] + lets[ix+1:]
} else {
ok = false
break
}
}
if ok {
found = append(found, string(word))
}
}
}
fmt.Println("The following", len(found), "words are the solutions to the puzzle:")
fmt.Println(strings.Join(found, "\n"))
mostFound := 0
var mostWords9 []string
var mostLetters []byte
var words9 [][]byte
for _, word := range words {
if len(word) == 9 {
words9 = append(words9, word)
}
}
for _, word9 := range words9 {
letterBytes := make([]byte, len(word9))
copy(letterBytes, word9)
sort.Slice(letterBytes, func(i, j int) bool { return letterBytes[i] < letterBytes[j] })
distinctBytes := []byte{letterBytes[0]}
for _, b := range letterBytes[1:] {
if b != distinctBytes[len(distinctBytes)-1] {
distinctBytes = append(distinctBytes, b)
}
}
distinctLetters := string(distinctBytes)
for _, letter := range distinctLetters {
found := 0
letterByte := byte(letter)
for _, word := range words {
le := len(word)
if bytes.IndexByte(word, letterByte) >= 0 {
lets := string(letterBytes)
ok := true
for i := 0; i < le; i++ {
c := word[i]
ix := sort.Search(len(lets), func(i int) bool { return lets[i] >= c })
if ix < len(lets) && lets[ix] == c {
lets = lets[0:ix] + lets[ix+1:]
} else {
ok = false
break
}
}
if ok {
found = found + 1
}
}
}
if found > mostFound {
mostFound = found
mostWords9 = []string{string(word9)}
mostLetters = []byte{letterByte}
} else if found == mostFound {
mostWords9 = append(mostWords9, string(word9))
mostLetters = append(mostLetters, letterByte)
}
}
}
fmt.Println("\nMost words found =", mostFound)
fmt.Println("Nine letter words producing this total:")
for i := 0; i < len(mostWords9); i++ {
fmt.Println(mostWords9[i], "with central letter", string(mostLetters[i]))
}
}
| import urllib.request
from collections import Counter
GRID =
def getwords(url='http://wiki.puzzlers.org/pub/wordlists/unixdict.txt'):
"Return lowercased words of 3 to 9 characters"
words = urllib.request.urlopen(url).read().decode().strip().lower().split()
return (w for w in words if 2 < len(w) < 10)
def solve(grid, dictionary):
gridcount = Counter(grid)
mid = grid[4]
return [word for word in dictionary
if mid in word and not (Counter(word) - gridcount)]
if __name__ == '__main__':
chars = ''.join(GRID.strip().lower().split())
found = solve(chars, dictionary=getwords())
print('\n'.join(found))
|
Write the same algorithm in Python as shown in this Go implementation. | package main
import "fmt"
func main() {
a := []int{1, 2, 3}
b := []int{7, 12, 60}
c := append(a, b...)
fmt.Println(c)
i := []interface{}{1, 2, 3}
j := []interface{}{"Crosby", "Stills", "Nash", "Young"}
k := append(i, j...)
fmt.Println(k)
l := [...]int{1, 2, 3}
m := [...]int{7, 12, 60}
var n [len(l) + len(m)]int
copy(n[:], l[:])
copy(n[len(l):], m[:])
fmt.Println(n)
}
| arr1 = [1, 2, 3]
arr2 = [4, 5, 6]
arr3 = [7, 8, 9]
arr4 = arr1 + arr2
assert arr4 == [1, 2, 3, 4, 5, 6]
arr4.extend(arr3)
assert arr4 == [1, 2, 3, 4, 5, 6, 7, 8, 9]
|
Please provide an equivalent version of this Go code in Python. | package main
import "fmt"
func main() {
var s string
var i int
if _, err := fmt.Scan(&s, &i); err == nil && i == 75000 {
fmt.Println("good")
} else {
fmt.Println("wrong")
}
}
| string = raw_input("Input a string: ")
|
Produce a functionally identical Python code for the snippet given in Go. | package main
import (
"encoding/binary"
"log"
"math"
"os"
"strings"
)
func main() {
const (
sampleRate = 44100
duration = 8
dataLength = sampleRate * duration
hdrSize = 44
fileLen = dataLength + hdrSize - 8
)
buf1 := make([]byte, 1)
buf2 := make([]byte, 2)
buf4 := make([]byte, 4)
var sb strings.Builder
sb.WriteString("RIFF")
binary.LittleEndian.PutUint32(buf4, fileLen)
sb.Write(buf4)
sb.WriteString("WAVE")
sb.WriteString("fmt ")
binary.LittleEndian.PutUint32(buf4, 16)
sb.Write(buf4)
binary.LittleEndian.PutUint16(buf2, 1)
sb.Write(buf2)
sb.Write(buf2)
binary.LittleEndian.PutUint32(buf4, sampleRate)
sb.Write(buf4)
sb.Write(buf4)
sb.Write(buf2)
binary.LittleEndian.PutUint16(buf2, 8)
sb.Write(buf2)
sb.WriteString("data")
binary.LittleEndian.PutUint32(buf4, dataLength)
sb.Write(buf4)
wavhdr := []byte(sb.String())
f, err := os.Create("notes.wav")
if err != nil {
log.Fatal(err)
}
defer f.Close()
f.Write(wavhdr)
freqs := [8]float64{261.6, 293.6, 329.6, 349.2, 392.0, 440.0, 493.9, 523.3}
for j := 0; j < duration; j++ {
freq := freqs[j]
omega := 2 * math.Pi * freq
for i := 0; i < dataLength/duration; i++ {
y := 32 * math.Sin(omega*float64(i)/float64(sampleRate))
buf1[0] = byte(math.Round(y))
f.Write(buf1)
}
}
}
| >>> import winsound
>>> for note in [261.63, 293.66, 329.63, 349.23, 392.00, 440.00, 493.88, 523.25]:
winsound.Beep(int(note+.5), 500)
>>>
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.