Instruction
stringlengths
45
106
input_code
stringlengths
1
13.7k
output_code
stringlengths
1
13.7k
Convert the following code from C# to VB, ensuring the logic remains intact.
public class AverageLoopLength { private static int N = 100000; private static double analytical(int n) { double[] factorial = new double[n + 1]; double[] powers = new double[n + 1]; powers[0] = 1.0; factorial[0] = 1.0; for (int i = 1; i <= n; i++) { factorial[i] = factorial[i - 1] * i; powers[i] = powers[i - 1] * n; } double sum = 0; for (int i = 1; i <= n; i++) { sum += factorial[n] / factorial[n - i] / powers[i]; } return sum; } private static double average(int n) { Random rnd = new Random(); double sum = 0.0; for (int a = 0; a < N; a++) { int[] random = new int[n]; for (int i = 0; i < n; i++) { random[i] = rnd.Next(n); } var seen = new HashSet<double>(n); int current = 0; int length = 0; while (seen.Add(current)) { length++; current = random[current]; } sum += length; } return sum / N; } public static void Main(string[] args) { Console.WriteLine(" N average analytical (error)"); Console.WriteLine("=== ========= ============ ========="); for (int i = 1; i <= 20; i++) { var average = AverageLoopLength.average(i); var analytical = AverageLoopLength.analytical(i); Console.WriteLine("{0,3} {1,10:N4} {2,13:N4} {3,8:N2}%", i, average, analytical, (analytical - average) / analytical * 100); } } }
Const MAX = 20 Const ITER = 1000000 Function expected(n As Long) As Double Dim sum As Double For i = 1 To n sum = sum + WorksheetFunction.Fact(n) / n ^ i / WorksheetFunction.Fact(n - i) Next i expected = sum End Function Function test(n As Long) As Double Dim count As Long Dim x As Long, bits As Long For i = 1 To ITER x = 1 bits = 0 Do While Not bits And x count = count + 1 bits = bits Or x x = 2 ^ (Int(n * Rnd())) Loop Next i test = count / ITER End Function Public Sub main() Dim n As Long Debug.Print " n avg. exp. (error%)" Debug.Print "== ====== ====== ========" For n = 1 To MAX av = test(n) ex = expected(n) Debug.Print Format(n, "@@"); " "; Format(av, "0.0000"); " "; Debug.Print Format(ex, "0.0000"); " ("; Format(Abs(1 - av / ex), "0.000%"); ")" Next n End Sub
Change the following C# code into VB without altering its purpose.
class Program { static void Main() { string extra = "little"; string formatted = $"Mary had a {extra} lamb."; System.Console.WriteLine(formatted); } }
Dim name as String = "J. Doe" Dim balance as Double = 123.45 Dim prompt as String = String.Format("Hello {0}, your balance is {1}.", name, balance) Console.WriteLine(prompt)
Generate an equivalent VB version of this C# code.
using System; using static System.Console; using LI = System.Collections.Generic.SortedSet<int>; class Program { static LI unl(LI res, LI set, int lft, int mul = 1, int vlu = 0) { if (lft == 0) res.Add(vlu); else if (lft > 0) foreach (int itm in set) res = unl(res, set, lft - itm, mul * 10, vlu + itm * mul); return res; } static void Main(string[] args) { WriteLine(string.Join(" ", unl(new LI {}, new LI { 2, 3, 5, 7 }, 13))); } }
Imports System Imports System.Console Imports LI = System.Collections.Generic.SortedSet(Of Integer) Module Module1 Function unl(ByVal res As LI, ByVal lst As LI, ByVal lft As Integer, ByVal Optional mul As Integer = 1, ByVal Optional vlu As Integer = 0) As LI If lft = 0 Then res.Add(vlu) ElseIf lft > 0 Then For Each itm As Integer In lst res = unl(res, lst, lft - itm, mul * 10, vlu + itm * mul) Next End If Return res End Function Sub Main(ByVal args As String()) WriteLine(string.Join(" ", unl(new LI From {}, new LI From { 2, 3, 5, 7 }, 13))) End Sub End Module
Convert the following code from C# to VB, ensuring the logic remains intact.
using System; using static System.Console; using LI = System.Collections.Generic.SortedSet<int>; class Program { static LI unl(LI res, LI set, int lft, int mul = 1, int vlu = 0) { if (lft == 0) res.Add(vlu); else if (lft > 0) foreach (int itm in set) res = unl(res, set, lft - itm, mul * 10, vlu + itm * mul); return res; } static void Main(string[] args) { WriteLine(string.Join(" ", unl(new LI {}, new LI { 2, 3, 5, 7 }, 13))); } }
Imports System Imports System.Console Imports LI = System.Collections.Generic.SortedSet(Of Integer) Module Module1 Function unl(ByVal res As LI, ByVal lst As LI, ByVal lft As Integer, ByVal Optional mul As Integer = 1, ByVal Optional vlu As Integer = 0) As LI If lft = 0 Then res.Add(vlu) ElseIf lft > 0 Then For Each itm As Integer In lst res = unl(res, lst, lft - itm, mul * 10, vlu + itm * mul) Next End If Return res End Function Sub Main(ByVal args As String()) WriteLine(string.Join(" ", unl(new LI From {}, new LI From { 2, 3, 5, 7 }, 13))) End Sub End Module
Write the same code in VB as shown below in C#.
using System; using static System.Console; using LI = System.Collections.Generic.SortedSet<int>; class Program { static LI unl(LI res, LI set, int lft, int mul = 1, int vlu = 0) { if (lft == 0) res.Add(vlu); else if (lft > 0) foreach (int itm in set) res = unl(res, set, lft - itm, mul * 10, vlu + itm * mul); return res; } static void Main(string[] args) { WriteLine(string.Join(" ", unl(new LI {}, new LI { 2, 3, 5, 7 }, 13))); } }
Imports System Imports System.Console Imports LI = System.Collections.Generic.SortedSet(Of Integer) Module Module1 Function unl(ByVal res As LI, ByVal lst As LI, ByVal lft As Integer, ByVal Optional mul As Integer = 1, ByVal Optional vlu As Integer = 0) As LI If lft = 0 Then res.Add(vlu) ElseIf lft > 0 Then For Each itm As Integer In lst res = unl(res, lst, lft - itm, mul * 10, vlu + itm * mul) Next End If Return res End Function Sub Main(ByVal args As String()) WriteLine(string.Join(" ", unl(new LI From {}, new LI From { 2, 3, 5, 7 }, 13))) End Sub End Module
Rewrite the snippet below in VB so it works the same as the original C# code.
using System; using System.IO; using System.Text; namespace RosettaCode { internal class Program { private const string FileName = "NOTES.TXT"; private static void Main(string[] args) { if (args.Length==0) { string txt = File.ReadAllText(FileName); Console.WriteLine(txt); } else { var sb = new StringBuilder(); sb.Append(DateTime.Now).Append("\n\t"); foreach (string s in args) sb.Append(s).Append(" "); sb.Append("\n"); if (File.Exists(FileName)) File.AppendAllText(FileName, sb.ToString()); else File.WriteAllText(FileName, sb.ToString()); } } } }
Imports System.IO Module Notes Function Main(ByVal cmdArgs() As String) As Integer Try If cmdArgs.Length = 0 Then Using sr As New StreamReader("NOTES.TXT") Console.WriteLine(sr.ReadToEnd) End Using Else Using sw As New StreamWriter("NOTES.TXT", True) sw.WriteLine(Date.Now.ToString()) sw.WriteLine("{0}{1}", ControlChars.Tab, String.Join(" ", cmdArgs)) End Using End If Catch End Try End Function End Module
Transform the following C# implementation into VB, maintaining the same output and logic.
using System; using System.Collections.Generic; using System.Linq; using System.Text; namespace RosettaCodeTasks { class Program { static void Main ( string[ ] args ) { FindCommonDirectoryPath.Test ( ); } } class FindCommonDirectoryPath { public static void Test ( ) { Console.WriteLine ( "Find Common Directory Path" ); Console.WriteLine ( ); List<string> PathSet1 = new List<string> ( ); PathSet1.Add ( "/home/user1/tmp/coverage/test" ); PathSet1.Add ( "/home/user1/tmp/covert/operator" ); PathSet1.Add ( "/home/user1/tmp/coven/members" ); Console.WriteLine("Path Set 1 (All Absolute Paths):"); foreach ( string path in PathSet1 ) { Console.WriteLine ( path ); } Console.WriteLine ( "Path Set 1 Common Path: {0}", FindCommonPath ( "/", PathSet1 ) ); } public static string FindCommonPath ( string Separator, List<string> Paths ) { string CommonPath = String.Empty; List<string> SeparatedPath = Paths .First ( str => str.Length == Paths.Max ( st2 => st2.Length ) ) .Split ( new string[ ] { Separator }, StringSplitOptions.RemoveEmptyEntries ) .ToList ( ); foreach ( string PathSegment in SeparatedPath.AsEnumerable ( ) ) { if ( CommonPath.Length == 0 && Paths.All ( str => str.StartsWith ( PathSegment ) ) ) { CommonPath = PathSegment; } else if ( Paths.All ( str => str.StartsWith ( CommonPath + Separator + PathSegment ) ) ) { CommonPath += Separator + PathSegment; } else { break; } } return CommonPath; } } }
Public Function CommonDirectoryPath(ParamArray Paths()) As String Dim v As Variant Dim Path() As String, s As String Dim i As Long, j As Long, k As Long Const PATH_SEPARATOR As String = "/" For Each v In Paths ReDim Preserve Path(0 To i) Path(i) = v i = i + 1 Next v k = 1 Do For i = 0 To UBound(Path) If i Then If InStr(k, Path(i), PATH_SEPARATOR) <> j Then Exit Do ElseIf Left$(Path(i), j) <> Left$(Path(0), j) Then Exit Do End If Else j = InStr(k, Path(i), PATH_SEPARATOR) If j = 0 Then Exit Do End If End If Next i s = Left$(Path(0), j + CLng(k <> 1)) k = j + 1 Loop CommonDirectoryPath = s End Function Sub Main() Debug.Assert CommonDirectoryPath( _ "/home/user1/tmp/coverage/test", _ "/home/user1/tmp/covert/operator", _ "/home/user1/tmp/coven/members") = _ "/home/user1/tmp" Debug.Assert CommonDirectoryPath( _ "/home/user1/tmp/coverage/test", _ "/home/user1/tmp/covert/operator", _ "/home/user1/tmp/coven/members", _ "/home/user1/abc/coven/members") = _ "/home/user1" Debug.Assert CommonDirectoryPath( _ "/home/user1/tmp/coverage/test", _ "/hope/user1/tmp/covert/operator", _ "/home/user1/tmp/coven/members") = _ "/" End Sub
Rewrite the snippet below in VB so it works the same as the original C# code.
using System; using System.Collections.Generic; namespace RecamanSequence { class Program { static void Main(string[] args) { List<int> a = new List<int>() { 0 }; HashSet<int> used = new HashSet<int>() { 0 }; HashSet<int> used1000 = new HashSet<int>() { 0 }; bool foundDup = false; int n = 1; while (n <= 15 || !foundDup || used1000.Count < 1001) { int next = a[n - 1] - n; if (next < 1 || used.Contains(next)) { next += 2 * n; } bool alreadyUsed = used.Contains(next); a.Add(next); if (!alreadyUsed) { used.Add(next); if (0 <= next && next <= 1000) { used1000.Add(next); } } if (n == 14) { Console.WriteLine("The first 15 terms of the Recaman sequence are: [{0}]", string.Join(", ", a)); } if (!foundDup && alreadyUsed) { Console.WriteLine("The first duplicated term is a[{0}] = {1}", n, next); foundDup = true; } if (used1000.Count == 1001) { Console.WriteLine("Terms up to a[{0}] are needed to generate 0 to 1000", n); } n++; } } } }
nx=15 h=1000 Wscript.StdOut.WriteLine "Recaman Wscript.StdOut.WriteLine recaman("seq",nx) Wscript.StdOut.WriteLine "The first duplicate number is: " & recaman("firstdup",0) Wscript.StdOut.WriteLine "The number of terms to complete the range 0--->"& h &" is: "& recaman("numterm",h) Wscript.StdOut.Write vbCrlf&".../...": zz=Wscript.StdIn.ReadLine() function recaman(op,nn) Dim b,d,h Set b = CreateObject("Scripting.Dictionary") Set d = CreateObject("Scripting.Dictionary") list="0" : firstdup=0 if op="firstdup" then nn=1000 : firstdup=1 end if if op="numterm" then h=nn : nn=10000000 : numterm=1 end if ax=0 b.Add 0,1 s=0 for n=1 to nn-1 an=ax-n if an<=0 then an=ax+n elseif b.Exists(an) then an=ax+n end if ax=an if not b.Exists(an) then b.Add an,1 if op="seq" then list=list&" "&an end if if firstdup then if d.Exists(an) then recaman="a("&n&")="&an exit function else d.Add an,1 end if end if if numterm then if an<=h then if not d.Exists(an) then s=s+1 d.Add an,1 end if if s>=h then recaman=n exit function end if end if end if next recaman=list end function
Change the programming language of this snippet from C# to VB without modifying what it does.
using System; using System.Collections.Generic; namespace RecamanSequence { class Program { static void Main(string[] args) { List<int> a = new List<int>() { 0 }; HashSet<int> used = new HashSet<int>() { 0 }; HashSet<int> used1000 = new HashSet<int>() { 0 }; bool foundDup = false; int n = 1; while (n <= 15 || !foundDup || used1000.Count < 1001) { int next = a[n - 1] - n; if (next < 1 || used.Contains(next)) { next += 2 * n; } bool alreadyUsed = used.Contains(next); a.Add(next); if (!alreadyUsed) { used.Add(next); if (0 <= next && next <= 1000) { used1000.Add(next); } } if (n == 14) { Console.WriteLine("The first 15 terms of the Recaman sequence are: [{0}]", string.Join(", ", a)); } if (!foundDup && alreadyUsed) { Console.WriteLine("The first duplicated term is a[{0}] = {1}", n, next); foundDup = true; } if (used1000.Count == 1001) { Console.WriteLine("Terms up to a[{0}] are needed to generate 0 to 1000", n); } n++; } } } }
nx=15 h=1000 Wscript.StdOut.WriteLine "Recaman Wscript.StdOut.WriteLine recaman("seq",nx) Wscript.StdOut.WriteLine "The first duplicate number is: " & recaman("firstdup",0) Wscript.StdOut.WriteLine "The number of terms to complete the range 0--->"& h &" is: "& recaman("numterm",h) Wscript.StdOut.Write vbCrlf&".../...": zz=Wscript.StdIn.ReadLine() function recaman(op,nn) Dim b,d,h Set b = CreateObject("Scripting.Dictionary") Set d = CreateObject("Scripting.Dictionary") list="0" : firstdup=0 if op="firstdup" then nn=1000 : firstdup=1 end if if op="numterm" then h=nn : nn=10000000 : numterm=1 end if ax=0 b.Add 0,1 s=0 for n=1 to nn-1 an=ax-n if an<=0 then an=ax+n elseif b.Exists(an) then an=ax+n end if ax=an if not b.Exists(an) then b.Add an,1 if op="seq" then list=list&" "&an end if if firstdup then if d.Exists(an) then recaman="a("&n&")="&an exit function else d.Add an,1 end if end if if numterm then if an<=h then if not d.Exists(an) then s=s+1 d.Add an,1 end if if s>=h then recaman=n exit function end if end if end if next recaman=list end function
Port the following code from Go to Python with equivalent syntax and logic.
package main import "fmt" func bitwise(a, b int16) { fmt.Printf("a: %016b\n", uint16(a)) fmt.Printf("b: %016b\n", uint16(b)) fmt.Printf("and: %016b\n", uint16(a&b)) fmt.Printf("or: %016b\n", uint16(a|b)) fmt.Printf("xor: %016b\n", uint16(a^b)) fmt.Printf("not: %016b\n", uint16(^a)) if b < 0 { fmt.Println("Right operand is negative, but all shifts require an unsigned right operand (shift distance).") return } ua := uint16(a) ub := uint32(b) fmt.Printf("shl: %016b\n", uint16(ua<<ub)) fmt.Printf("shr: %016b\n", uint16(ua>>ub)) fmt.Printf("las: %016b\n", uint16(a<<ub)) fmt.Printf("ras: %016b\n", uint16(a>>ub)) fmt.Printf("rol: %016b\n", uint16(a<<ub|int16(uint16(a)>>(16-ub)))) fmt.Printf("ror: %016b\n", uint16(int16(uint16(a)>>ub)|a<<(16-ub))) } func main() { var a, b int16 = -460, 6 bitwise(a, b) }
def bitwise_built_ins(width, a, b): mask = (1 << width) - 1 print(f) def rotr(width, a, n): "Rotate a, n times to the right" if n < 0: return rotl(width, a, -n) elif n == 0: return a else: mask = (1 << width) - 1 a, n = a & mask, n % width return ((a >> n) | ((a & ((1 << n) - 1)) << (width - n))) def rotl(width, a, n): "Rotate a, n times to the left" if n < 0: return rotr(width, a, -n) elif n == 0: return a else: mask = (1 << width) - 1 a, n = a & mask, n % width return (((a << n) & mask) | (a >> (width - n))) def asr(width, a, n): "Arithmetic shift a, n times to the right. (sign preserving)." mask, top_bit_mask = ((1 << width) - 1), 1 << (width - 1) if n < 0: return (a << -n) & mask elif n == 0: return a elif n >= width: return mask if a & top_bit_mask else 0 else: a = a & mask if a & top_bit_mask: signs = (1 << n) - 1 return a >> n | (signs << width - n) else: return a >> n def helper_funcs(width, a): mask, top_bit_mask = ((1 << width) - 1), 1 << (width - 1) aa = a | top_bit_mask print(f) if __name__ == '__main__': bitwise_built_ins(8, 27, 125) helper_funcs(8, 27)
Keep all operations the same but rewrite the snippet in Python.
package main import ( "fmt" "image" "image/color" "image/draw" "image/png" "math" "os" ) const sep = 512 const depth = 14 var s = math.Sqrt2 / 2 var sin = []float64{0, s, 1, s, 0, -s, -1, -s} var cos = []float64{1, s, 0, -s, -1, -s, 0, s} var p = color.NRGBA{64, 192, 96, 255} var b *image.NRGBA func main() { width := sep * 11 / 6 height := sep * 4 / 3 bounds := image.Rect(0, 0, width, height) b = image.NewNRGBA(bounds) draw.Draw(b, bounds, image.NewUniform(color.White), image.ZP, draw.Src) dragon(14, 0, 1, sep, sep/2, sep*5/6) f, err := os.Create("dragon.png") if err != nil { fmt.Println(err) return } if err = png.Encode(f, b); err != nil { fmt.Println(err) } if err = f.Close(); err != nil { fmt.Println(err) } } func dragon(n, a, t int, d, x, y float64) { if n <= 1 { x1 := int(x + .5) y1 := int(y + .5) x2 := int(x + d*cos[a] + .5) y2 := int(y + d*sin[a] + .5) xInc := 1 if x1 > x2 { xInc = -1 } yInc := 1 if y1 > y2 { yInc = -1 } for x, y := x1, y1; ; x, y = x+xInc, y+yInc { b.Set(x, y, p) if x == x2 { break } } return } d *= s a1 := (a - t) & 7 a2 := (a + t) & 7 dragon(n-1, a1, 1, d, x, y) dragon(n-1, a2, -1, d, x+d*cos[a1], y+d*sin[a1]) }
l = 3 ints = 13 def setup(): size(700, 600) background(0, 0, 255) translate(150, 100) stroke(255) turn_left(l, ints) turn_right(l, ints) def turn_right(l, ints): if ints == 0: line(0, 0, 0, -l) translate(0, -l) else: turn_left(l, ints - 1) rotate(radians(90)) turn_right(l, ints - 1) def turn_left(l, ints): if ints == 0: line(0, 0, 0, -l) translate(0, -l) else: turn_left(l, ints - 1) rotate(radians(-90)) turn_right(l, ints - 1)
Rewrite this program in Python while keeping its functionality equivalent to the Go version.
package main import ( "bufio" "fmt" "log" "os" ) func init() { log.SetFlags(log.Lshortfile) } func main() { inputFile, err := os.Open("byline.go") if err != nil { log.Fatal("Error opening input file:", err) } defer inputFile.Close() scanner := bufio.NewScanner(inputFile) for scanner.Scan() { fmt.Println(scanner.Text()) } if err := scanner.Err(); err != nil { log.Fatal(scanner.Err()) } }
for line in lines open('input.txt'): print line
Translate the given Go code snippet into Python without altering its behavior.
package main import "fmt" type dlNode struct { string next, prev *dlNode } type dlList struct { head, tail *dlNode } func (list *dlList) String() string { if list.head == nil { return fmt.Sprint(list.head) } r := "[" + list.head.string for p := list.head.next; p != nil; p = p.next { r += " " + p.string } return r + "]" } func (list *dlList) insertTail(node *dlNode) { if list.tail == nil { list.head = node } else { list.tail.next = node } node.next = nil node.prev = list.tail list.tail = node } func (list *dlList) insertAfter(existing, insert *dlNode) { insert.prev = existing insert.next = existing.next existing.next.prev = insert existing.next = insert if existing == list.tail { list.tail = insert } } func main() { dll := &dlList{} fmt.Println(dll) a := &dlNode{string: "A"} dll.insertTail(a) dll.insertTail(&dlNode{string: "B"}) fmt.Println(dll) dll.insertAfter(a, &dlNode{string: "C"}) fmt.Println(dll) }
def insert(anchor, new): new.next = anchor.next new.prev = anchor anchor.next.prev = new anchor.next = new
Produce a language-to-language conversion: from Go to Python, same semantics.
package main import ( "fmt" "math/big" ) var b = new(big.Int) func isSPDSPrime(n uint64) bool { nn := n for nn > 0 { r := nn % 10 if r != 2 && r != 3 && r != 5 && r != 7 { return false } nn /= 10 } b.SetUint64(n) if b.ProbablyPrime(0) { return true } return false } func listSPDSPrimes(startFrom, countFrom, countTo uint64, printOne bool) uint64 { count := countFrom for n := startFrom; ; n += 2 { if isSPDSPrime(n) { count++ if !printOne { fmt.Printf("%2d. %d\n", count, n) } if count == countTo { if printOne { fmt.Println(n) } return n } } } } func main() { fmt.Println("The first 25 terms of the Smarandache prime-digital sequence are:") fmt.Println(" 1. 2") n := listSPDSPrimes(3, 1, 25, false) fmt.Println("\nHigher terms:") indices := []uint64{25, 100, 200, 500, 1000, 2000, 5000, 10000, 20000, 50000, 100000} for i := 1; i < len(indices); i++ { fmt.Printf("%6d. ", indices[i]) n = listSPDSPrimes(n+2, indices[i-1], indices[i], true) } }
def divisors(n): divs = [1] for ii in range(2, int(n ** 0.5) + 3): if n % ii == 0: divs.append(ii) divs.append(int(n / ii)) divs.append(n) return list(set(divs)) def is_prime(n): return len(divisors(n)) == 2 def digit_check(n): if len(str(n))<2: return True else: for digit in str(n): if not is_prime(int(digit)): return False return True def sequence(max_n=None): ii = 0 n = 0 while True: ii += 1 if is_prime(ii): if max_n is not None: if n>max_n: break if digit_check(ii): n += 1 yield ii if __name__ == '__main__': generator = sequence(100) for index, item in zip(range(1, 16), generator): print(index, item) for index, item in zip(range(16, 100), generator): pass print(100, generator.__next__())
Write a version of this Go function in Python with identical behavior.
package main import "fmt" func quickselect(list []int, k int) int { for { px := len(list) / 2 pv := list[px] last := len(list) - 1 list[px], list[last] = list[last], list[px] i := 0 for j := 0; j < last; j++ { if list[j] < pv { list[i], list[j] = list[j], list[i] i++ } } if i == k { return pv } if k < i { list = list[:i] } else { list[i], list[last] = list[last], list[i] list = list[i+1:] k -= i + 1 } } } func main() { for i := 0; ; i++ { v := []int{9, 8, 7, 6, 5, 0, 1, 2, 3, 4} if i == len(v) { return } fmt.Println(quickselect(v, i)) } }
import random def partition(vector, left, right, pivotIndex): pivotValue = vector[pivotIndex] vector[pivotIndex], vector[right] = vector[right], vector[pivotIndex] storeIndex = left for i in range(left, right): if vector[i] < pivotValue: vector[storeIndex], vector[i] = vector[i], vector[storeIndex] storeIndex += 1 vector[right], vector[storeIndex] = vector[storeIndex], vector[right] return storeIndex def _select(vector, left, right, k): "Returns the k-th smallest, (k >= 0), element of vector within vector[left:right+1] inclusive." while True: pivotIndex = random.randint(left, right) pivotNewIndex = partition(vector, left, right, pivotIndex) pivotDist = pivotNewIndex - left if pivotDist == k: return vector[pivotNewIndex] elif k < pivotDist: right = pivotNewIndex - 1 else: k -= pivotDist + 1 left = pivotNewIndex + 1 def select(vector, k, left=None, right=None): if left is None: left = 0 lv1 = len(vector) - 1 if right is None: right = lv1 assert vector and k >= 0, "Either null vector or k < 0 " assert 0 <= left <= lv1, "left is out of range" assert left <= right <= lv1, "right is out of range" return _select(vector, left, right, k) if __name__ == '__main__': v = [9, 8, 7, 6, 5, 0, 1, 2, 3, 4] print([select(v, i) for i in range(10)])
Produce a language-to-language conversion: from Go to Python, same semantics.
package main import ( "fmt" "math/big" "strconv" ) func main () { s := strconv.FormatInt(26, 16) fmt.Println(s) i, err := strconv.ParseInt("1a", 16, 64) if err == nil { fmt.Println(i) } b, ok := new(big.Int).SetString("1a", 16) if ok { fmt.Println(b) } }
i = int('1a',16)
Translate this program into Python but keep the logic exactly as in Go.
package main import ( "fmt" "os" "path/filepath" ) func VisitFile(fp string, fi os.FileInfo, err error) error { if err != nil { fmt.Println(err) return nil } if fi.IsDir() { return nil } matched, err := filepath.Match("*.mp3", fi.Name()) if err != nil { fmt.Println(err) return err } if matched { fmt.Println(fp) } return nil } func main() { filepath.Walk("/", VisitFile) }
from pathlib import Path for path in Path('.').rglob('*.*'): print(path)
Ensure the translated Python code behaves exactly like the original Go snippet.
package main import "fmt" type sBox [8][16]byte type gost struct { k87, k65, k43, k21 [256]byte enc []byte } func newGost(s *sBox) *gost { var g gost for i := range g.k87 { g.k87[i] = s[7][i>>4]<<4 | s[6][i&15] g.k65[i] = s[5][i>>4]<<4 | s[4][i&15] g.k43[i] = s[3][i>>4]<<4 | s[2][i&15] g.k21[i] = s[1][i>>4]<<4 | s[0][i&15] } g.enc = make([]byte, 8) return &g } func (g *gost) f(x uint32) uint32 { x = uint32(g.k87[x>>24&255])<<24 | uint32(g.k65[x>>16&255])<<16 | uint32(g.k43[x>>8&255])<<8 | uint32(g.k21[x&255]) return x<<11 | x>>(32-11) } var cbrf = sBox{ {4, 10, 9, 2, 13, 8, 0, 14, 6, 11, 1, 12, 7, 15, 5, 3}, {14, 11, 4, 12, 6, 13, 15, 10, 2, 3, 8, 1, 0, 7, 5, 9}, {5, 8, 1, 13, 10, 3, 4, 2, 14, 15, 12, 7, 6, 0, 9, 11}, {7, 13, 10, 1, 0, 8, 9, 15, 14, 4, 6, 12, 11, 2, 5, 3}, {6, 12, 7, 1, 5, 15, 13, 8, 4, 10, 9, 14, 0, 3, 11, 2}, {4, 11, 10, 0, 7, 2, 1, 13, 3, 6, 8, 5, 9, 12, 15, 14}, {13, 11, 4, 1, 3, 15, 5, 9, 0, 10, 14, 7, 6, 8, 2, 12}, {1, 15, 13, 0, 5, 7, 10, 4, 9, 2, 3, 14, 6, 11, 8, 12}, } func u32(b []byte) uint32 { return uint32(b[0]) | uint32(b[1])<<8 | uint32(b[2])<<16 | uint32(b[3])<<24 } func b4(u uint32, b []byte) { b[0] = byte(u) b[1] = byte(u >> 8) b[2] = byte(u >> 16) b[3] = byte(u >> 24) } func (g *gost) mainStep(input []byte, key []byte) { key32 := u32(key) input1 := u32(input[:4]) input2 := u32(input[4:]) b4(g.f(key32+input1)^input2, g.enc[:4]) copy(g.enc[4:], input[:4]) } func main() { input := []byte{0x21, 0x04, 0x3B, 0x04, 0x30, 0x04, 0x32, 0x04} key := []byte{0xF9, 0x04, 0xC1, 0xE2} g := newGost(&cbrf) g.mainStep(input, key) for _, b := range g.enc { fmt.Printf("[%02x]", b) } fmt.Println() }
k8 = [ 14, 4, 13, 1, 2, 15, 11, 8, 3, 10, 6, 12, 5, 9, 0, 7 ] k7 = [ 15, 1, 8, 14, 6, 11, 3, 4, 9, 7, 2, 13, 12, 0, 5, 10 ] k6 = [ 10, 0, 9, 14, 6, 3, 15, 5, 1, 13, 12, 7, 11, 4, 2, 8 ] k5 = [ 7, 13, 14, 3, 0, 6, 9, 10, 1, 2, 8, 5, 11, 12, 4, 15 ] k4 = [ 2, 12, 4, 1, 7, 10, 11, 6, 8, 5, 3, 15, 13, 0, 14, 9 ] k3 = [ 12, 1, 10, 15, 9, 2, 6, 8, 0, 13, 3, 4, 14, 7, 5, 11 ] k2 = [ 4, 11, 2, 14, 15, 0, 8, 13, 3, 12, 9, 7, 5, 10, 6, 1 ] k1 = [ 13, 2, 8, 4, 6, 15, 11, 1, 10, 9, 3, 14, 5, 0, 12, 7 ] k87 = [0] * 256 k65 = [0] * 256 k43 = [0] * 256 k21 = [0] * 256 def kboxinit(): for i in range(256): k87[i] = k8[i >> 4] << 4 | k7[i & 15] k65[i] = k6[i >> 4] << 4 | k5[i & 15] k43[i] = k4[i >> 4] << 4 | k3[i & 15] k21[i] = k2[i >> 4] << 4 | k1[i & 15] def f(x): x = ( k87[x>>24 & 255] << 24 | k65[x>>16 & 255] << 16 | k43[x>> 8 & 255] << 8 | k21[x & 255] ) return x<<11 | x>>(32-11)
Please provide an equivalent version of this Go code in Python.
package main import ( "fmt" "unicode" ) var states = []string{"Alabama", "Alaska", "Arizona", "Arkansas", "California", "Colorado", "Connecticut", "Delaware", "Florida", "Georgia", "Hawaii", "Idaho", "Illinois", "Indiana", "Iowa", "Kansas", "Kentucky", "Louisiana", "Maine", "Maryland", "Massachusetts", "Michigan", "Minnesota", "Mississippi", "Missouri", "Montana", "Nebraska", "Nevada", "New Hampshire", "New Jersey", "New Mexico", "New York", "North Carolina", "North Dakota", "Ohio", "Oklahoma", "Oregon", "Pennsylvania", "Rhode Island", "South Carolina", "South Dakota", "Tennessee", "Texas", "Utah", "Vermont", "Virginia", "Washington", "West Virginia", "Wisconsin", "Wyoming"} func main() { play(states) play(append(states, "New Kory", "Wen Kory", "York New", "Kory New", "New Kory")) } func play(states []string) { fmt.Println(len(states), "states:") set := make(map[string]bool, len(states)) for _, s := range states { set[s] = true } s := make([]string, len(set)) h := make([][26]byte, len(set)) var i int for us := range set { s[i] = us for _, c := range us { if u := uint(unicode.ToLower(c)) - 'a'; u < 26 { h[i][u]++ } } i++ } type pair struct { i1, i2 int } m := make(map[string][]pair) b := make([]byte, 26) for i1, h1 := range h { for i2 := i1 + 1; i2 < len(h); i2++ { for i := range b { b[i] = h1[i] + h[i2][i] } k := string(b) for _, x := range m[k] { if i1 != x.i1 && i1 != x.i2 && i2 != x.i1 && i2 != x.i2 { fmt.Printf("%s, %s = %s, %s\n", s[i1], s[i2], s[x.i1], s[x.i2]) } } m[k] = append(m[k], pair{i1, i2}) } } }
from collections import defaultdict states = ["Alabama", "Alaska", "Arizona", "Arkansas", "California", "Colorado", "Connecticut", "Delaware", "Florida", "Georgia", "Hawaii", "Idaho", "Illinois", "Indiana", "Iowa", "Kansas", "Kentucky", "Louisiana", "Maine", "Maryland", "Massachusetts", "Michigan", "Minnesota", "Mississippi", "Missouri", "Montana", "Nebraska", "Nevada", "New Hampshire", "New Jersey", "New Mexico", "New York", "North Carolina", "North Dakota", "Ohio", "Oklahoma", "Oregon", "Pennsylvania", "Rhode Island", "South Carolina", "South Dakota", "Tennessee", "Texas", "Utah", "Vermont", "Virginia", "Washington", "West Virginia", "Wisconsin", "Wyoming", ] states = sorted(set(states)) smap = defaultdict(list) for i, s1 in enumerate(states[:-1]): for s2 in states[i + 1:]: smap["".join(sorted(s1 + s2))].append(s1 + " + " + s2) for pairs in sorted(smap.itervalues()): if len(pairs) > 1: print " = ".join(pairs)
Translate the given Go code snippet into Python without altering its behavior.
package main import ( "fmt" "hash/crc32" ) func main() { s := []byte("The quick brown fox jumps over the lazy dog") result := crc32.ChecksumIEEE(s) fmt.Printf("%X\n", result) }
>>> s = 'The quick brown fox jumps over the lazy dog' >>> import zlib >>> hex(zlib.crc32(s)) '0x414fa339' >>> import binascii >>> hex(binascii.crc32(s)) '0x414fa339'
Maintain the same structure and functionality when rewriting this code in Python.
package main import ( "bytes" "encoding/csv" "fmt" "html/template" "strings" ) var c = `Character,Speech The multitude,The messiah! Show us the messiah! Brians mother,<angry>Now you listen here! He's not the messiah; he's a very naughty boy! Now go away!</angry> The multitude,Who are you? Brians mother,I'm his mother; that's who! The multitude,Behold his mother! Behold his mother!` func main() { if h, err := csvToHtml(c); err != nil { fmt.Println(err) } else { fmt.Print(h) } } func csvToHtml(c string) (string, error) { data, err := csv.NewReader(bytes.NewBufferString(c)).ReadAll() if err != nil { return "", err } var b strings.Builder err = template.Must(template.New("").Parse(`<table> {{range .}} <tr>{{range .}}<td>{{.}}</td>{{end}}</tr> {{end}}</table> `)).Execute(&b, data) return b.String(), err }
csvtxt = from cgi import escape def _row2tr(row, attr=None): cols = escape(row).split(',') return ('<TR>' + ''.join('<TD>%s</TD>' % data for data in cols) + '</TR>') def csv2html(txt): htmltxt = '<TABLE summary="csv2html program output">\n' for rownum, row in enumerate(txt.split('\n')): htmlrow = _row2tr(row) htmlrow = ' <TBODY>%s</TBODY>\n' % htmlrow htmltxt += htmlrow htmltxt += '</TABLE>\n' return htmltxt htmltxt = csv2html(csvtxt) print(htmltxt)
Transform the following Go implementation into Python, maintaining the same output and logic.
package main import ( "bytes" "encoding/csv" "fmt" "html/template" "strings" ) var c = `Character,Speech The multitude,The messiah! Show us the messiah! Brians mother,<angry>Now you listen here! He's not the messiah; he's a very naughty boy! Now go away!</angry> The multitude,Who are you? Brians mother,I'm his mother; that's who! The multitude,Behold his mother! Behold his mother!` func main() { if h, err := csvToHtml(c); err != nil { fmt.Println(err) } else { fmt.Print(h) } } func csvToHtml(c string) (string, error) { data, err := csv.NewReader(bytes.NewBufferString(c)).ReadAll() if err != nil { return "", err } var b strings.Builder err = template.Must(template.New("").Parse(`<table> {{range .}} <tr>{{range .}}<td>{{.}}</td>{{end}}</tr> {{end}}</table> `)).Execute(&b, data) return b.String(), err }
csvtxt = from cgi import escape def _row2tr(row, attr=None): cols = escape(row).split(',') return ('<TR>' + ''.join('<TD>%s</TD>' % data for data in cols) + '</TR>') def csv2html(txt): htmltxt = '<TABLE summary="csv2html program output">\n' for rownum, row in enumerate(txt.split('\n')): htmlrow = _row2tr(row) htmlrow = ' <TBODY>%s</TBODY>\n' % htmlrow htmltxt += htmlrow htmltxt += '</TABLE>\n' return htmltxt htmltxt = csv2html(csvtxt) print(htmltxt)
Ensure the translated Python code behaves exactly like the original Go snippet.
package main import "fmt" type picnicBasket struct { nServings int corkscrew bool } func (b *picnicBasket) happy() bool { return b.nServings > 1 && b.corkscrew } func newPicnicBasket(nPeople int) *picnicBasket { return &picnicBasket{nPeople, nPeople > 0} } func main() { var pb picnicBasket pbl := picnicBasket{} pbp := &picnicBasket{} pbn := new(picnicBasket) forTwo := newPicnicBasket(2) forToo := &picnicBasket{nServings: 2, corkscrew: true} fmt.Println(pb.nServings, pb.corkscrew) fmt.Println(pbl.nServings, pbl.corkscrew) fmt.Println(pbp) fmt.Println(pbn) fmt.Println(forTwo) fmt.Println(forToo) }
class MyClass: name2 = 2 def __init__(self): self.name1 = 0 def someMethod(self): self.name1 = 1 MyClass.name2 = 3 myclass = MyClass() class MyOtherClass: count = 0 def __init__(self, name, gender="Male", age=None): MyOtherClass.count += 1 self.name = name self.gender = gender if age is not None: self.age = age def __del__(self): MyOtherClass.count -= 1 person1 = MyOtherClass("John") print person1.name, person1.gender print person1.age person2 = MyOtherClass("Jane", "Female", 23) print person2.name, person2.gender, person2.age
Write the same algorithm in Python as shown in this Go implementation.
package main import ( "fmt" "strconv" ) func kaprekar(n uint64, base uint64) (bool, int) { order := 0 if n == 1 { return true, -1 } nn, power := n*n, uint64(1) for power <= nn { power *= base order++ } power /= base order-- for ; power > 1; power /= base { q, r := nn/power, nn%power if q >= n { return false, -1 } if q+r == n { return true, order } order-- } return false, -1 } func main() { max := uint64(10000) fmt.Printf("Kaprekar numbers < %d:\n", max) for m := uint64(0); m < max; m++ { if is, _ := kaprekar(m, 10); is { fmt.Println(" ", m) } } max = 1e6 var count int for m := uint64(0); m < max; m++ { if is, _ := kaprekar(m, 10); is { count++ } } fmt.Printf("\nThere are %d Kaprekar numbers < %d.\n", count, max) const base = 17 maxB := "1000000" fmt.Printf("\nKaprekar numbers between 1 and %s(base %d):\n", maxB, base) max, _ = strconv.ParseUint(maxB, base, 64) fmt.Printf("\n Base 10 Base %d Square Split\n", base) for m := uint64(2); m < max; m++ { is, pos := kaprekar(m, base) if !is { continue } sq := strconv.FormatUint(m*m, base) str := strconv.FormatUint(m, base) split := len(sq)-pos fmt.Printf("%8d %7s %12s %6s + %s\n", m, str, sq, sq[:split], sq[split:]) } }
>>> def k(n): n2 = str(n**2) for i in range(len(n2)): a, b = int(n2[:i] or 0), int(n2[i:]) if b and a + b == n: return n >>> [x for x in range(1,10000) if k(x)] [1, 9, 45, 55, 99, 297, 703, 999, 2223, 2728, 4879, 4950, 5050, 5292, 7272, 7777, 9999] >>> len([x for x in range(1,1000000) if k(x)]) 54 >>>
Change the programming language of this snippet from Go to Python without modifying what it does.
package main import ( "fmt" "strconv" ) func kaprekar(n uint64, base uint64) (bool, int) { order := 0 if n == 1 { return true, -1 } nn, power := n*n, uint64(1) for power <= nn { power *= base order++ } power /= base order-- for ; power > 1; power /= base { q, r := nn/power, nn%power if q >= n { return false, -1 } if q+r == n { return true, order } order-- } return false, -1 } func main() { max := uint64(10000) fmt.Printf("Kaprekar numbers < %d:\n", max) for m := uint64(0); m < max; m++ { if is, _ := kaprekar(m, 10); is { fmt.Println(" ", m) } } max = 1e6 var count int for m := uint64(0); m < max; m++ { if is, _ := kaprekar(m, 10); is { count++ } } fmt.Printf("\nThere are %d Kaprekar numbers < %d.\n", count, max) const base = 17 maxB := "1000000" fmt.Printf("\nKaprekar numbers between 1 and %s(base %d):\n", maxB, base) max, _ = strconv.ParseUint(maxB, base, 64) fmt.Printf("\n Base 10 Base %d Square Split\n", base) for m := uint64(2); m < max; m++ { is, pos := kaprekar(m, base) if !is { continue } sq := strconv.FormatUint(m*m, base) str := strconv.FormatUint(m, base) split := len(sq)-pos fmt.Printf("%8d %7s %12s %6s + %s\n", m, str, sq, sq[:split], sq[split:]) } }
>>> def k(n): n2 = str(n**2) for i in range(len(n2)): a, b = int(n2[:i] or 0), int(n2[i:]) if b and a + b == n: return n >>> [x for x in range(1,10000) if k(x)] [1, 9, 45, 55, 99, 297, 703, 999, 2223, 2728, 4879, 4950, 5050, 5292, 7272, 7777, 9999] >>> len([x for x in range(1,1000000) if k(x)]) 54 >>>
Translate this program into Python but keep the logic exactly as in Go.
package main import ( "fmt" "log" "strings" ) func compress(uncompressed string) []int { dictSize := 256 dictionary := make(map[string]int, dictSize) for i := 0; i < dictSize; i++ { dictionary[string([]byte{byte(i)})] = i } var result []int var w []byte for i := 0; i < len(uncompressed); i++ { c := uncompressed[i] wc := append(w, c) if _, ok := dictionary[string(wc)]; ok { w = wc } else { result = append(result, dictionary[string(w)]) dictionary[string(wc)] = dictSize dictSize++ wc[0] = c w = wc[:1] } } if len(w) > 0 { result = append(result, dictionary[string(w)]) } return result } type BadSymbolError int func (e BadSymbolError) Error() string { return fmt.Sprint("Bad compressed symbol ", int(e)) } func decompress(compressed []int) (string, error) { dictSize := 256 dictionary := make(map[int][]byte, dictSize) for i := 0; i < dictSize; i++ { dictionary[i] = []byte{byte(i)} } var result strings.Builder var w []byte for _, k := range compressed { var entry []byte if x, ok := dictionary[k]; ok { entry = x[:len(x):len(x)] } else if k == dictSize && len(w) > 0 { entry = append(w, w[0]) } else { return result.String(), BadSymbolError(k) } result.Write(entry) if len(w) > 0 { w = append(w, entry[0]) dictionary[dictSize] = w dictSize++ } w = entry } return result.String(), nil } func main() { compressed := compress("TOBEORNOTTOBEORTOBEORNOT") fmt.Println(compressed) decompressed, err := decompress(compressed) if err != nil { log.Fatal(err) } fmt.Println(decompressed) }
def compress(uncompressed): dict_size = 256 dictionary = dict((chr(i), i) for i in range(dict_size)) w = "" result = [] for c in uncompressed: wc = w + c if wc in dictionary: w = wc else: result.append(dictionary[w]) dictionary[wc] = dict_size dict_size += 1 w = c if w: result.append(dictionary[w]) return result def decompress(compressed): from io import StringIO dict_size = 256 dictionary = dict((i, chr(i)) for i in range(dict_size)) result = StringIO() w = chr(compressed.pop(0)) result.write(w) for k in compressed: if k in dictionary: entry = dictionary[k] elif k == dict_size: entry = w + w[0] else: raise ValueError('Bad compressed k: %s' % k) result.write(entry) dictionary[dict_size] = w + entry[0] dict_size += 1 w = entry return result.getvalue() compressed = compress('TOBEORNOTTOBEORTOBEORNOT') print (compressed) decompressed = decompress(compressed) print (decompressed)
Change the programming language of this snippet from Go to Python without modifying what it does.
package main import "fmt" var ffr, ffs func(int) int func init() { r := []int{0, 1} s := []int{0, 2} ffr = func(n int) int { for len(r) <= n { nrk := len(r) - 1 rNxt := r[nrk] + s[nrk] r = append(r, rNxt) for sn := r[nrk] + 2; sn < rNxt; sn++ { s = append(s, sn) } s = append(s, rNxt+1) } return r[n] } ffs = func(n int) int { for len(s) <= n { ffr(len(r)) } return s[n] } } func main() { for n := 1; n <= 10; n++ { fmt.Printf("r(%d): %d\n", n, ffr(n)) } var found [1001]int for n := 1; n <= 40; n++ { found[ffr(n)]++ } for n := 1; n <= 960; n++ { found[ffs(n)]++ } for i := 1; i <= 1000; i++ { if found[i] != 1 { fmt.Println("task 4: FAIL") return } } fmt.Println("task 4: PASS") }
def ffr(n): if n < 1 or type(n) != int: raise ValueError("n must be an int >= 1") try: return ffr.r[n] except IndexError: r, s = ffr.r, ffs.s ffr_n_1 = ffr(n-1) lastr = r[-1] s += list(range(s[-1] + 1, lastr)) if s[-1] < lastr: s += [lastr + 1] len_s = len(s) ffs_n_1 = s[n-1] if len_s > n else (n - len_s) + s[-1] ans = ffr_n_1 + ffs_n_1 r.append(ans) return ans ffr.r = [None, 1] def ffs(n): if n < 1 or type(n) != int: raise ValueError("n must be an int >= 1") try: return ffs.s[n] except IndexError: r, s = ffr.r, ffs.s for i in range(len(r), n+2): ffr(i) if len(s) > n: return s[n] raise Exception("Whoops!") ffs.s = [None, 2] if __name__ == '__main__': first10 = [ffr(i) for i in range(1,11)] assert first10 == [1, 3, 7, 12, 18, 26, 35, 45, 56, 69], "ffr() value error(s)" print("ffr(n) for n = [1..10] is", first10) bin = [None] + [0]*1000 for i in range(40, 0, -1): bin[ffr(i)] += 1 for i in range(960, 0, -1): bin[ffs(i)] += 1 if all(b == 1 for b in bin[1:1000]): print("All Integers 1..1000 found OK") else: print("All Integers 1..1000 NOT found only once: ERROR")
Port the following code from Go to Python with equivalent syntax and logic.
package main import "fmt" var ffr, ffs func(int) int func init() { r := []int{0, 1} s := []int{0, 2} ffr = func(n int) int { for len(r) <= n { nrk := len(r) - 1 rNxt := r[nrk] + s[nrk] r = append(r, rNxt) for sn := r[nrk] + 2; sn < rNxt; sn++ { s = append(s, sn) } s = append(s, rNxt+1) } return r[n] } ffs = func(n int) int { for len(s) <= n { ffr(len(r)) } return s[n] } } func main() { for n := 1; n <= 10; n++ { fmt.Printf("r(%d): %d\n", n, ffr(n)) } var found [1001]int for n := 1; n <= 40; n++ { found[ffr(n)]++ } for n := 1; n <= 960; n++ { found[ffs(n)]++ } for i := 1; i <= 1000; i++ { if found[i] != 1 { fmt.Println("task 4: FAIL") return } } fmt.Println("task 4: PASS") }
def ffr(n): if n < 1 or type(n) != int: raise ValueError("n must be an int >= 1") try: return ffr.r[n] except IndexError: r, s = ffr.r, ffs.s ffr_n_1 = ffr(n-1) lastr = r[-1] s += list(range(s[-1] + 1, lastr)) if s[-1] < lastr: s += [lastr + 1] len_s = len(s) ffs_n_1 = s[n-1] if len_s > n else (n - len_s) + s[-1] ans = ffr_n_1 + ffs_n_1 r.append(ans) return ans ffr.r = [None, 1] def ffs(n): if n < 1 or type(n) != int: raise ValueError("n must be an int >= 1") try: return ffs.s[n] except IndexError: r, s = ffr.r, ffs.s for i in range(len(r), n+2): ffr(i) if len(s) > n: return s[n] raise Exception("Whoops!") ffs.s = [None, 2] if __name__ == '__main__': first10 = [ffr(i) for i in range(1,11)] assert first10 == [1, 3, 7, 12, 18, 26, 35, 45, 56, 69], "ffr() value error(s)" print("ffr(n) for n = [1..10] is", first10) bin = [None] + [0]*1000 for i in range(40, 0, -1): bin[ffr(i)] += 1 for i in range(960, 0, -1): bin[ffs(i)] += 1 if all(b == 1 for b in bin[1:1000]): print("All Integers 1..1000 found OK") else: print("All Integers 1..1000 NOT found only once: ERROR")
Produce a language-to-language conversion: from Go to Python, same semantics.
package main import ( "fmt" "log" ) func ms(n int) (int, []int) { M := func(x int) int { return (x + n - 1) % n } if n <= 0 || n&1 == 0 { n = 5 log.Println("forcing size", n) } m := make([]int, n*n) i, j := 0, n/2 for k := 1; k <= n*n; k++ { m[i*n+j] = k if m[M(i)*n+M(j)] != 0 { i = (i + 1) % n } else { i, j = M(i), M(j) } } return n, m } func main() { n, m := ms(5) i := 2 for j := 1; j <= n*n; j *= 10 { i++ } f := fmt.Sprintf("%%%dd", i) for i := 0; i < n; i++ { for j := 0; j < n; j++ { fmt.Printf(f, m[i*n+j]) } fmt.Println() } }
>>> def magic(n): for row in range(1, n + 1): print(' '.join('%*i' % (len(str(n**2)), cell) for cell in (n * ((row + col - 1 + n // 2) % n) + ((row + 2 * col - 2) % n) + 1 for col in range(1, n + 1)))) print('\nAll sum to magic number %i' % ((n * n + 1) * n // 2)) >>> for n in (5, 3, 7): print('\nOrder %i\n=======' % n) magic(n) Order 5 ======= 17 24 1 8 15 23 5 7 14 16 4 6 13 20 22 10 12 19 21 3 11 18 25 2 9 All sum to magic number 65 Order 3 ======= 8 1 6 3 5 7 4 9 2 All sum to magic number 15 Order 7 ======= 30 39 48 1 10 19 28 38 47 7 9 18 27 29 46 6 8 17 26 35 37 5 14 16 25 34 36 45 13 15 24 33 42 44 4 21 23 32 41 43 3 12 22 31 40 49 2 11 20 All sum to magic number 175 >>>
Preserve the algorithm and functionality while converting the code from Go to Python.
package main import ( "fmt" "log" ) func ms(n int) (int, []int) { M := func(x int) int { return (x + n - 1) % n } if n <= 0 || n&1 == 0 { n = 5 log.Println("forcing size", n) } m := make([]int, n*n) i, j := 0, n/2 for k := 1; k <= n*n; k++ { m[i*n+j] = k if m[M(i)*n+M(j)] != 0 { i = (i + 1) % n } else { i, j = M(i), M(j) } } return n, m } func main() { n, m := ms(5) i := 2 for j := 1; j <= n*n; j *= 10 { i++ } f := fmt.Sprintf("%%%dd", i) for i := 0; i < n; i++ { for j := 0; j < n; j++ { fmt.Printf(f, m[i*n+j]) } fmt.Println() } }
>>> def magic(n): for row in range(1, n + 1): print(' '.join('%*i' % (len(str(n**2)), cell) for cell in (n * ((row + col - 1 + n // 2) % n) + ((row + 2 * col - 2) % n) + 1 for col in range(1, n + 1)))) print('\nAll sum to magic number %i' % ((n * n + 1) * n // 2)) >>> for n in (5, 3, 7): print('\nOrder %i\n=======' % n) magic(n) Order 5 ======= 17 24 1 8 15 23 5 7 14 16 4 6 13 20 22 10 12 19 21 3 11 18 25 2 9 All sum to magic number 65 Order 3 ======= 8 1 6 3 5 7 4 9 2 All sum to magic number 15 Order 7 ======= 30 39 48 1 10 19 28 38 47 7 9 18 27 29 46 6 8 17 26 35 37 5 14 16 25 34 36 45 13 15 24 33 42 44 4 21 23 32 41 43 3 12 22 31 40 49 2 11 20 All sum to magic number 175 >>>
Produce a language-to-language conversion: from Go to Python, same semantics.
package main import ( "fmt" "log" "os/exec" ) func gcd(x, y int) int { for y != 0 { x, y = y, x%y } return x } func yellowstone(n int) []int { m := make(map[int]bool) a := make([]int, n+1) for i := 1; i < 4; i++ { a[i] = i m[i] = true } min := 4 for c := 4; c <= n; c++ { for i := min; ; i++ { if !m[i] && gcd(a[c-1], i) == 1 && gcd(a[c-2], i) > 1 { a[c] = i m[i] = true if i == min { min++ } break } } } return a[1:] } func check(err error) { if err != nil { log.Fatal(err) } } func main() { x := make([]int, 100) for i := 0; i < 100; i++ { x[i] = i + 1 } y := yellowstone(100) fmt.Println("The first 30 Yellowstone numbers are:") fmt.Println(y[:30]) g := exec.Command("gnuplot", "-persist") w, err := g.StdinPipe() check(err) check(g.Start()) fmt.Fprintln(w, "unset key; plot '-'") for i, xi := range x { fmt.Fprintf(w, "%d %d\n", xi, y[i]) } fmt.Fprintln(w, "e") w.Close() g.Wait() }
from itertools import chain, count, islice from operator import itemgetter from math import gcd from matplotlib import pyplot def yellowstone(): def relativelyPrime(a): return lambda b: 1 == gcd(a, b) def nextWindow(triple): p2, p1, rest = triple [rp2, rp1] = map(relativelyPrime, [p2, p1]) def match(xxs): x, xs = uncons(xxs)['Just'] return (x, xs) if rp1(x) and not rp2(x) else ( second(cons(x))( match(xs) ) ) n, residue = match(rest) return (p1, n, residue) return chain( range(1, 3), map( itemgetter(1), iterate(nextWindow)( (2, 3, count(4)) ) ) ) def main(): print(showList( take(30)(yellowstone()) )) pyplot.plot( take(100)(yellowstone()) ) pyplot.xlabel(main.__doc__) pyplot.show() def Just(x): return {'type': 'Maybe', 'Nothing': False, 'Just': x} def Nothing(): return {'type': 'Maybe', 'Nothing': True} def cons(x): return lambda xs: [x] + xs if ( isinstance(xs, list) ) else x + xs if ( isinstance(xs, str) ) else chain([x], xs) def iterate(f): def go(x): v = x while True: yield v v = f(v) return go def second(f): return lambda xy: (xy[0], f(xy[1])) def showList(xs): return '[' + ','.join(repr(x) for x in xs) + ']' def take(n): return lambda xs: ( xs[0:n] if isinstance(xs, (list, tuple)) else list(islice(xs, n)) ) def uncons(xs): if isinstance(xs, list): return Just((xs[0], xs[1:])) if xs else Nothing() else: nxt = take(1)(xs) return Just((nxt[0], xs)) if nxt else Nothing() if __name__ == '__main__': main()
Produce a functionally identical Python code for the snippet given in Go.
package main import ( "fmt" "log" "os/exec" ) func gcd(x, y int) int { for y != 0 { x, y = y, x%y } return x } func yellowstone(n int) []int { m := make(map[int]bool) a := make([]int, n+1) for i := 1; i < 4; i++ { a[i] = i m[i] = true } min := 4 for c := 4; c <= n; c++ { for i := min; ; i++ { if !m[i] && gcd(a[c-1], i) == 1 && gcd(a[c-2], i) > 1 { a[c] = i m[i] = true if i == min { min++ } break } } } return a[1:] } func check(err error) { if err != nil { log.Fatal(err) } } func main() { x := make([]int, 100) for i := 0; i < 100; i++ { x[i] = i + 1 } y := yellowstone(100) fmt.Println("The first 30 Yellowstone numbers are:") fmt.Println(y[:30]) g := exec.Command("gnuplot", "-persist") w, err := g.StdinPipe() check(err) check(g.Start()) fmt.Fprintln(w, "unset key; plot '-'") for i, xi := range x { fmt.Fprintf(w, "%d %d\n", xi, y[i]) } fmt.Fprintln(w, "e") w.Close() g.Wait() }
from itertools import chain, count, islice from operator import itemgetter from math import gcd from matplotlib import pyplot def yellowstone(): def relativelyPrime(a): return lambda b: 1 == gcd(a, b) def nextWindow(triple): p2, p1, rest = triple [rp2, rp1] = map(relativelyPrime, [p2, p1]) def match(xxs): x, xs = uncons(xxs)['Just'] return (x, xs) if rp1(x) and not rp2(x) else ( second(cons(x))( match(xs) ) ) n, residue = match(rest) return (p1, n, residue) return chain( range(1, 3), map( itemgetter(1), iterate(nextWindow)( (2, 3, count(4)) ) ) ) def main(): print(showList( take(30)(yellowstone()) )) pyplot.plot( take(100)(yellowstone()) ) pyplot.xlabel(main.__doc__) pyplot.show() def Just(x): return {'type': 'Maybe', 'Nothing': False, 'Just': x} def Nothing(): return {'type': 'Maybe', 'Nothing': True} def cons(x): return lambda xs: [x] + xs if ( isinstance(xs, list) ) else x + xs if ( isinstance(xs, str) ) else chain([x], xs) def iterate(f): def go(x): v = x while True: yield v v = f(v) return go def second(f): return lambda xy: (xy[0], f(xy[1])) def showList(xs): return '[' + ','.join(repr(x) for x in xs) + ']' def take(n): return lambda xs: ( xs[0:n] if isinstance(xs, (list, tuple)) else list(islice(xs, n)) ) def uncons(xs): if isinstance(xs, list): return Just((xs[0], xs[1:])) if xs else Nothing() else: nxt = take(1)(xs) return Just((nxt[0], xs)) if nxt else Nothing() if __name__ == '__main__': main()
Produce a language-to-language conversion: from Go to Python, same semantics.
package main import ( "fmt" "log" "os/exec" ) func gcd(x, y int) int { for y != 0 { x, y = y, x%y } return x } func yellowstone(n int) []int { m := make(map[int]bool) a := make([]int, n+1) for i := 1; i < 4; i++ { a[i] = i m[i] = true } min := 4 for c := 4; c <= n; c++ { for i := min; ; i++ { if !m[i] && gcd(a[c-1], i) == 1 && gcd(a[c-2], i) > 1 { a[c] = i m[i] = true if i == min { min++ } break } } } return a[1:] } func check(err error) { if err != nil { log.Fatal(err) } } func main() { x := make([]int, 100) for i := 0; i < 100; i++ { x[i] = i + 1 } y := yellowstone(100) fmt.Println("The first 30 Yellowstone numbers are:") fmt.Println(y[:30]) g := exec.Command("gnuplot", "-persist") w, err := g.StdinPipe() check(err) check(g.Start()) fmt.Fprintln(w, "unset key; plot '-'") for i, xi := range x { fmt.Fprintf(w, "%d %d\n", xi, y[i]) } fmt.Fprintln(w, "e") w.Close() g.Wait() }
from itertools import chain, count, islice from operator import itemgetter from math import gcd from matplotlib import pyplot def yellowstone(): def relativelyPrime(a): return lambda b: 1 == gcd(a, b) def nextWindow(triple): p2, p1, rest = triple [rp2, rp1] = map(relativelyPrime, [p2, p1]) def match(xxs): x, xs = uncons(xxs)['Just'] return (x, xs) if rp1(x) and not rp2(x) else ( second(cons(x))( match(xs) ) ) n, residue = match(rest) return (p1, n, residue) return chain( range(1, 3), map( itemgetter(1), iterate(nextWindow)( (2, 3, count(4)) ) ) ) def main(): print(showList( take(30)(yellowstone()) )) pyplot.plot( take(100)(yellowstone()) ) pyplot.xlabel(main.__doc__) pyplot.show() def Just(x): return {'type': 'Maybe', 'Nothing': False, 'Just': x} def Nothing(): return {'type': 'Maybe', 'Nothing': True} def cons(x): return lambda xs: [x] + xs if ( isinstance(xs, list) ) else x + xs if ( isinstance(xs, str) ) else chain([x], xs) def iterate(f): def go(x): v = x while True: yield v v = f(v) return go def second(f): return lambda xy: (xy[0], f(xy[1])) def showList(xs): return '[' + ','.join(repr(x) for x in xs) + ']' def take(n): return lambda xs: ( xs[0:n] if isinstance(xs, (list, tuple)) else list(islice(xs, n)) ) def uncons(xs): if isinstance(xs, list): return Just((xs[0], xs[1:])) if xs else Nothing() else: nxt = take(1)(xs) return Just((nxt[0], xs)) if nxt else Nothing() if __name__ == '__main__': main()
Please provide an equivalent version of this Go code in Python.
package main import "fmt" var grid []byte var w, h, last int var cnt int var next [4]int var dir = [4][2]int{{0, -1}, {-1, 0}, {0, 1}, {1, 0}} func walk(y, x int) { if y == 0 || y == h || x == 0 || x == w { cnt += 2 return } t := y*(w+1) + x grid[t]++ grid[last-t]++ for i, d := range dir { if grid[t+next[i]] == 0 { walk(y+d[0], x+d[1]) } } grid[t]-- grid[last-t]-- } func solve(hh, ww, recur int) int { h = hh w = ww if h&1 != 0 { h, w = w, h } switch { case h&1 == 1: return 0 case w == 1: return 1 case w == 2: return h case h == 2: return w } cy := h / 2 cx := w / 2 grid = make([]byte, (h+1)*(w+1)) last = len(grid) - 1 next[0] = -1 next[1] = -w - 1 next[2] = 1 next[3] = w + 1 if recur != 0 { cnt = 0 } for x := cx + 1; x < w; x++ { t := cy*(w+1) + x grid[t] = 1 grid[last-t] = 1 walk(cy-1, x) } cnt++ if h == w { cnt *= 2 } else if w&1 == 0 && recur != 0 { solve(w, h, 0) } return cnt } func main() { for y := 1; y <= 10; y++ { for x := 1; x <= y; x++ { if x&1 == 0 || y&1 == 0 { fmt.Printf("%d x %d: %d\n", y, x, solve(y, x, 1)) } } } }
def cut_it(h, w): dirs = ((1, 0), (-1, 0), (0, -1), (0, 1)) if h % 2: h, w = w, h if h % 2: return 0 if w == 1: return 1 count = 0 next = [w + 1, -w - 1, -1, 1] blen = (h + 1) * (w + 1) - 1 grid = [False] * (blen + 1) def walk(y, x, count): if not y or y == h or not x or x == w: return count + 1 t = y * (w + 1) + x grid[t] = grid[blen - t] = True if not grid[t + next[0]]: count = walk(y + dirs[0][0], x + dirs[0][1], count) if not grid[t + next[1]]: count = walk(y + dirs[1][0], x + dirs[1][1], count) if not grid[t + next[2]]: count = walk(y + dirs[2][0], x + dirs[2][1], count) if not grid[t + next[3]]: count = walk(y + dirs[3][0], x + dirs[3][1], count) grid[t] = grid[blen - t] = False return count t = h // 2 * (w + 1) + w // 2 if w % 2: grid[t] = grid[t + 1] = True count = walk(h // 2, w // 2 - 1, count) res = count count = 0 count = walk(h // 2 - 1, w // 2, count) return res + count * 2 else: grid[t] = True count = walk(h // 2, w // 2 - 1, count) if h == w: return count * 2 count = walk(h // 2 - 1, w // 2, count) return count def main(): for w in xrange(1, 10): for h in xrange(1, w + 1): if not((w * h) % 2): print "%d x %d: %d" % (w, h, cut_it(w, h)) main()
Ensure the translated Python code behaves exactly like the original Go snippet.
package main import "fmt" var grid []byte var w, h, last int var cnt int var next [4]int var dir = [4][2]int{{0, -1}, {-1, 0}, {0, 1}, {1, 0}} func walk(y, x int) { if y == 0 || y == h || x == 0 || x == w { cnt += 2 return } t := y*(w+1) + x grid[t]++ grid[last-t]++ for i, d := range dir { if grid[t+next[i]] == 0 { walk(y+d[0], x+d[1]) } } grid[t]-- grid[last-t]-- } func solve(hh, ww, recur int) int { h = hh w = ww if h&1 != 0 { h, w = w, h } switch { case h&1 == 1: return 0 case w == 1: return 1 case w == 2: return h case h == 2: return w } cy := h / 2 cx := w / 2 grid = make([]byte, (h+1)*(w+1)) last = len(grid) - 1 next[0] = -1 next[1] = -w - 1 next[2] = 1 next[3] = w + 1 if recur != 0 { cnt = 0 } for x := cx + 1; x < w; x++ { t := cy*(w+1) + x grid[t] = 1 grid[last-t] = 1 walk(cy-1, x) } cnt++ if h == w { cnt *= 2 } else if w&1 == 0 && recur != 0 { solve(w, h, 0) } return cnt } func main() { for y := 1; y <= 10; y++ { for x := 1; x <= y; x++ { if x&1 == 0 || y&1 == 0 { fmt.Printf("%d x %d: %d\n", y, x, solve(y, x, 1)) } } } }
def cut_it(h, w): dirs = ((1, 0), (-1, 0), (0, -1), (0, 1)) if h % 2: h, w = w, h if h % 2: return 0 if w == 1: return 1 count = 0 next = [w + 1, -w - 1, -1, 1] blen = (h + 1) * (w + 1) - 1 grid = [False] * (blen + 1) def walk(y, x, count): if not y or y == h or not x or x == w: return count + 1 t = y * (w + 1) + x grid[t] = grid[blen - t] = True if not grid[t + next[0]]: count = walk(y + dirs[0][0], x + dirs[0][1], count) if not grid[t + next[1]]: count = walk(y + dirs[1][0], x + dirs[1][1], count) if not grid[t + next[2]]: count = walk(y + dirs[2][0], x + dirs[2][1], count) if not grid[t + next[3]]: count = walk(y + dirs[3][0], x + dirs[3][1], count) grid[t] = grid[blen - t] = False return count t = h // 2 * (w + 1) + w // 2 if w % 2: grid[t] = grid[t + 1] = True count = walk(h // 2, w // 2 - 1, count) res = count count = 0 count = walk(h // 2 - 1, w // 2, count) return res + count * 2 else: grid[t] = True count = walk(h // 2, w // 2 - 1, count) if h == w: return count * 2 count = walk(h // 2 - 1, w // 2, count) return count def main(): for w in xrange(1, 10): for h in xrange(1, w + 1): if not((w * h) % 2): print "%d x %d: %d" % (w, h, cut_it(w, h)) main()
Please provide an equivalent version of this Go code in Python.
package main import "fmt" func mertens(to int) ([]int, int, int) { if to < 1 { to = 1 } merts := make([]int, to+1) primes := []int{2} var sum, zeros, crosses int for i := 1; i <= to; i++ { j := i cp := 0 spf := false for _, p := range primes { if p > j { break } if j%p == 0 { j /= p cp++ } if j%p == 0 { spf = true break } } if cp == 0 && i > 2 { cp = 1 primes = append(primes, i) } if !spf { if cp%2 == 0 { sum++ } else { sum-- } } merts[i] = sum if sum == 0 { zeros++ if i > 1 && merts[i-1] != 0 { crosses++ } } } return merts, zeros, crosses } func main() { merts, zeros, crosses := mertens(1000) fmt.Println("Mertens sequence - First 199 terms:") for i := 0; i < 200; i++ { if i == 0 { fmt.Print(" ") continue } if i%20 == 0 { fmt.Println() } fmt.Printf("  % d", merts[i]) } fmt.Println("\n\nEquals zero", zeros, "times between 1 and 1000") fmt.Println("\nCrosses zero", crosses, "times between 1 and 1000") }
def mertens(count): m = [None, 1] for n in range(2, count+1): m.append(1) for k in range(2, n+1): m[n] -= m[n//k] return m ms = mertens(1000) print("The first 99 Mertens numbers are:") print(" ", end=' ') col = 1 for n in ms[1:100]: print("{:2d}".format(n), end=' ') col += 1 if col == 10: print() col = 0 zeroes = sum(x==0 for x in ms) crosses = sum(a!=0 and b==0 for a,b in zip(ms, ms[1:])) print("M(N) equals zero {} times.".format(zeroes)) print("M(N) crosses zero {} times.".format(crosses))
Please provide an equivalent version of this Go code in Python.
package main import "fmt" func mertens(to int) ([]int, int, int) { if to < 1 { to = 1 } merts := make([]int, to+1) primes := []int{2} var sum, zeros, crosses int for i := 1; i <= to; i++ { j := i cp := 0 spf := false for _, p := range primes { if p > j { break } if j%p == 0 { j /= p cp++ } if j%p == 0 { spf = true break } } if cp == 0 && i > 2 { cp = 1 primes = append(primes, i) } if !spf { if cp%2 == 0 { sum++ } else { sum-- } } merts[i] = sum if sum == 0 { zeros++ if i > 1 && merts[i-1] != 0 { crosses++ } } } return merts, zeros, crosses } func main() { merts, zeros, crosses := mertens(1000) fmt.Println("Mertens sequence - First 199 terms:") for i := 0; i < 200; i++ { if i == 0 { fmt.Print(" ") continue } if i%20 == 0 { fmt.Println() } fmt.Printf("  % d", merts[i]) } fmt.Println("\n\nEquals zero", zeros, "times between 1 and 1000") fmt.Println("\nCrosses zero", crosses, "times between 1 and 1000") }
def mertens(count): m = [None, 1] for n in range(2, count+1): m.append(1) for k in range(2, n+1): m[n] -= m[n//k] return m ms = mertens(1000) print("The first 99 Mertens numbers are:") print(" ", end=' ') col = 1 for n in ms[1:100]: print("{:2d}".format(n), end=' ') col += 1 if col == 10: print() col = 0 zeroes = sum(x==0 for x in ms) crosses = sum(a!=0 and b==0 for a,b in zip(ms, ms[1:])) print("M(N) equals zero {} times.".format(zeroes)) print("M(N) crosses zero {} times.".format(crosses))
Rewrite the snippet below in Python so it works the same as the original Go code.
package main import ( "fmt" "sort" "strings" ) var count int = 0 func interactiveCompare(s1, s2 string) bool { count++ fmt.Printf("(%d) Is %s < %s? ", count, s1, s2) var response string _, err := fmt.Scanln(&response) return err == nil && strings.HasPrefix(response, "y") } func main() { items := []string{"violet", "red", "green", "indigo", "blue", "yellow", "orange"} var sortedItems []string for _, item := range items { fmt.Printf("Inserting '%s' into %s\n", item, sortedItems) spotToInsert := sort.Search(len(sortedItems), func(i int) bool { return interactiveCompare(item, sortedItems[i]) }) sortedItems = append(sortedItems[:spotToInsert], append([]string{item}, sortedItems[spotToInsert:]...)...) } fmt.Println(sortedItems) }
def _insort_right(a, x, q): lo, hi = 0, len(a) while lo < hi: mid = (lo+hi)//2 q += 1 less = input(f"{q:2}: IS {x:>6} LESS-THAN {a[mid]:>6} ? y/n: ").strip().lower() == 'y' if less: hi = mid else: lo = mid+1 a.insert(lo, x) return q def order(items): ordered, q = [], 0 for item in items: q = _insort_right(ordered, item, q) return ordered, q if __name__ == '__main__': items = 'violet red green indigo blue yellow orange'.split() ans, questions = order(items) print('\n' + ' '.join(ans))
Ensure the translated Python code behaves exactly like the original Go snippet.
package main import ( "fmt" "math" ) func Fib1000() []float64 { a, b, r := 0., 1., [1000]float64{} for i := range r { r[i], a, b = b, b, b+a } return r[:] } func main() { show(Fib1000(), "First 1000 Fibonacci numbers") } func show(c []float64, title string) { var f [9]int for _, v := range c { f[fmt.Sprintf("%g", v)[0]-'1']++ } fmt.Println(title) fmt.Println("Digit Observed Predicted") for i, n := range f { fmt.Printf(" %d %9.3f %8.3f\n", i+1, float64(n)/float64(len(c)), math.Log10(1+1/float64(i+1))) } }
from __future__ import division from itertools import islice, count from collections import Counter from math import log10 from random import randint expected = [log10(1+1/d) for d in range(1,10)] def fib(): a,b = 1,1 while True: yield a a,b = b,a+b def power_of_threes(): return (3**k for k in count(0)) def heads(s): for a in s: yield int(str(a)[0]) def show_dist(title, s): c = Counter(s) size = sum(c.values()) res = [c[d]/size for d in range(1,10)] print("\n%s Benfords deviation" % title) for r, e in zip(res, expected): print("%5.1f%% %5.1f%% %5.1f%%" % (r*100., e*100., abs(r - e)*100.)) def rand1000(): while True: yield randint(1,9999) if __name__ == '__main__': show_dist("fibbed", islice(heads(fib()), 1000)) show_dist("threes", islice(heads(power_of_threes()), 1000)) show_dist("random", islice(heads(rand1000()), 10000))
Maintain the same structure and functionality when rewriting this code in Python.
package main import ( "fmt" "math" ) func Fib1000() []float64 { a, b, r := 0., 1., [1000]float64{} for i := range r { r[i], a, b = b, b, b+a } return r[:] } func main() { show(Fib1000(), "First 1000 Fibonacci numbers") } func show(c []float64, title string) { var f [9]int for _, v := range c { f[fmt.Sprintf("%g", v)[0]-'1']++ } fmt.Println(title) fmt.Println("Digit Observed Predicted") for i, n := range f { fmt.Printf(" %d %9.3f %8.3f\n", i+1, float64(n)/float64(len(c)), math.Log10(1+1/float64(i+1))) } }
from __future__ import division from itertools import islice, count from collections import Counter from math import log10 from random import randint expected = [log10(1+1/d) for d in range(1,10)] def fib(): a,b = 1,1 while True: yield a a,b = b,a+b def power_of_threes(): return (3**k for k in count(0)) def heads(s): for a in s: yield int(str(a)[0]) def show_dist(title, s): c = Counter(s) size = sum(c.values()) res = [c[d]/size for d in range(1,10)] print("\n%s Benfords deviation" % title) for r, e in zip(res, expected): print("%5.1f%% %5.1f%% %5.1f%%" % (r*100., e*100., abs(r - e)*100.)) def rand1000(): while True: yield randint(1,9999) if __name__ == '__main__': show_dist("fibbed", islice(heads(fib()), 1000)) show_dist("threes", islice(heads(power_of_threes()), 1000)) show_dist("random", islice(heads(rand1000()), 10000))
Preserve the algorithm and functionality while converting the code from Go to Python.
package main import ( "fmt" "strings" "time" ) func main() { watches := []string{ "First", "Middle", "Morning", "Forenoon", "Afternoon", "Dog", "First", } for { t := time.Now() h := t.Hour() m := t.Minute() s := t.Second() if (m == 0 || m == 30) && s == 0 { bell := 0 if m == 30 { bell = 1 } bells := (h*2 + bell) % 8 watch := h/4 + 1 if bells == 0 { bells = 8 watch-- } sound := strings.Repeat("\a", bells) pl := "s" if bells == 1 { pl = " " } w := watches[watch] + " watch" if watch == 5 { if bells < 5 { w = "First " + w } else { w = "Last " + w } } fmt.Printf("%s%02d:%02d = %d bell%s : %s\n", sound, h, m, bells, pl, w) } time.Sleep(1 * time.Second) } }
import time, calendar, sched, winsound duration = 750 freq = 1280 bellchar = "\u2407" watches = 'Middle,Morning,Forenoon,Afternoon,First/Last dog,First'.split(',') def gap(n=1): time.sleep(n * duration / 1000) off = gap def on(n=1): winsound.Beep(freq, n * duration) def bong(): on(); off(0.5) def bongs(m): for i in range(m): print(bellchar, end=' ') bong() if i % 2: print(' ', end='') off(0.5) print('') scheds = sched.scheduler(time.time, time.sleep) def ships_bell(now=None): def adjust_to_half_hour(atime): atime[4] = (atime[4] // 30) * 30 atime[5] = 0 return atime debug = now is not None rightnow = time.gmtime() if not debug: now = adjust_to_half_hour( list(rightnow) ) then = now[::] then[4] += 30 hr, mn = now[3:5] watch, b = divmod(int(2 * hr + mn // 30 - 1), 8) b += 1 bells = '%i bell%s' % (b, 's' if b > 1 else ' ') if debug: print("%02i:%02i, %-20s %s" % (now[3], now[4], watches[watch] + ' watch', bells), end=' ') else: print("%02i:%02i, %-20s %s" % (rightnow[3], rightnow[4], watches[watch] + ' watch', bells), end=' ') bongs(b) if not debug: scheds.enterabs(calendar.timegm(then), 0, ships_bell) scheds.run() def dbg_tester(): for h in range(24): for m in (0, 30): if (h,m) == (24,30): break ships_bell( [2013, 3, 2, h, m, 15, 5, 61, 0] ) if __name__ == '__main__': ships_bell()
Translate this program into Python but keep the logic exactly as in Go.
package main import ( "fmt" "strings" "time" ) func main() { watches := []string{ "First", "Middle", "Morning", "Forenoon", "Afternoon", "Dog", "First", } for { t := time.Now() h := t.Hour() m := t.Minute() s := t.Second() if (m == 0 || m == 30) && s == 0 { bell := 0 if m == 30 { bell = 1 } bells := (h*2 + bell) % 8 watch := h/4 + 1 if bells == 0 { bells = 8 watch-- } sound := strings.Repeat("\a", bells) pl := "s" if bells == 1 { pl = " " } w := watches[watch] + " watch" if watch == 5 { if bells < 5 { w = "First " + w } else { w = "Last " + w } } fmt.Printf("%s%02d:%02d = %d bell%s : %s\n", sound, h, m, bells, pl, w) } time.Sleep(1 * time.Second) } }
import time, calendar, sched, winsound duration = 750 freq = 1280 bellchar = "\u2407" watches = 'Middle,Morning,Forenoon,Afternoon,First/Last dog,First'.split(',') def gap(n=1): time.sleep(n * duration / 1000) off = gap def on(n=1): winsound.Beep(freq, n * duration) def bong(): on(); off(0.5) def bongs(m): for i in range(m): print(bellchar, end=' ') bong() if i % 2: print(' ', end='') off(0.5) print('') scheds = sched.scheduler(time.time, time.sleep) def ships_bell(now=None): def adjust_to_half_hour(atime): atime[4] = (atime[4] // 30) * 30 atime[5] = 0 return atime debug = now is not None rightnow = time.gmtime() if not debug: now = adjust_to_half_hour( list(rightnow) ) then = now[::] then[4] += 30 hr, mn = now[3:5] watch, b = divmod(int(2 * hr + mn // 30 - 1), 8) b += 1 bells = '%i bell%s' % (b, 's' if b > 1 else ' ') if debug: print("%02i:%02i, %-20s %s" % (now[3], now[4], watches[watch] + ' watch', bells), end=' ') else: print("%02i:%02i, %-20s %s" % (rightnow[3], rightnow[4], watches[watch] + ' watch', bells), end=' ') bongs(b) if not debug: scheds.enterabs(calendar.timegm(then), 0, ships_bell) scheds.run() def dbg_tester(): for h in range(24): for m in (0, 30): if (h,m) == (24,30): break ships_bell( [2013, 3, 2, h, m, 15, 5, 61, 0] ) if __name__ == '__main__': ships_bell()
Generate an equivalent Python version of this Go code.
package main import "fmt" func main() { for _, n := range []int{0, 1, 2, 3, 4, 5, 10, 40, -1} { f, ok := arFib(n) if ok { fmt.Printf("fib %d = %d\n", n, f) } else { fmt.Println("fib undefined for negative numbers") } } } func arFib(n int) (int, bool) { switch { case n < 0: return 0, false case n < 2: return n, true } return yc(func(recurse fn) fn { return func(left, term1, term2 int) int { if left == 0 { return term1+term2 } return recurse(left-1, term1+term2, term1) } })(n-2, 1, 0), true } type fn func(int, int, int) int type ff func(fn) fn type fx func(fx) fn func yc(f ff) fn { return func(x fx) fn { return x(x) }(func(x fx) fn { return f(func(a1, a2, a3 int) int { return x(x)(a1, a2, a3) }) }) }
>>> Y = lambda f: (lambda x: x(x))(lambda y: f(lambda *args: y(y)(*args))) >>> fib = lambda f: lambda n: None if n < 0 else (0 if n == 0 else (1 if n == 1 else f(n-1) + f(n-2))) >>> [ Y(fib)(i) for i in range(-2, 10) ] [None, None, 0, 1, 1, 2, 3, 5, 8, 13, 21, 34]
Port the provided Go code into Python while preserving the original functionality.
package main import ( "fmt" "unicode/utf8" ) func main() { s := "ASCII" fmt.Println("String: ", s) fmt.Println("First byte removed: ", s[1:]) fmt.Println("Last byte removed: ", s[:len(s)-1]) fmt.Println("First and last removed:", s[1:len(s)-1]) u := "Δημοτική" fmt.Println("String: ", u) _, sizeFirst := utf8.DecodeRuneInString(u) fmt.Println("First rune removed: ", u[sizeFirst:]) _, sizeLast := utf8.DecodeLastRuneInString(u) fmt.Println("Last rune removed: ", u[:len(u)-sizeLast]) fmt.Println("First and last removed:", u[sizeFirst:len(u)-sizeLast]) }
print "knight"[1:] print "socks"[:-1] print "brooms"[1:-1]
Produce a functionally identical Python code for the snippet given in Go.
package main import ( "fmt" "unicode/utf8" ) func main() { s := "ASCII" fmt.Println("String: ", s) fmt.Println("First byte removed: ", s[1:]) fmt.Println("Last byte removed: ", s[:len(s)-1]) fmt.Println("First and last removed:", s[1:len(s)-1]) u := "Δημοτική" fmt.Println("String: ", u) _, sizeFirst := utf8.DecodeRuneInString(u) fmt.Println("First rune removed: ", u[sizeFirst:]) _, sizeLast := utf8.DecodeLastRuneInString(u) fmt.Println("Last rune removed: ", u[:len(u)-sizeLast]) fmt.Println("First and last removed:", u[sizeFirst:len(u)-sizeLast]) }
print "knight"[1:] print "socks"[:-1] print "brooms"[1:-1]
Change the programming language of this snippet from Go to Python without modifying what it does.
package main import ( "fmt" "unicode/utf8" ) func main() { s := "ASCII" fmt.Println("String: ", s) fmt.Println("First byte removed: ", s[1:]) fmt.Println("Last byte removed: ", s[:len(s)-1]) fmt.Println("First and last removed:", s[1:len(s)-1]) u := "Δημοτική" fmt.Println("String: ", u) _, sizeFirst := utf8.DecodeRuneInString(u) fmt.Println("First rune removed: ", u[sizeFirst:]) _, sizeLast := utf8.DecodeLastRuneInString(u) fmt.Println("Last rune removed: ", u[:len(u)-sizeLast]) fmt.Println("First and last removed:", u[sizeFirst:len(u)-sizeLast]) }
print "knight"[1:] print "socks"[:-1] print "brooms"[1:-1]
Rewrite this program in Python while keeping its functionality equivalent to the Go version.
package main import ( "fmt" "log" "math" "rcu" ) func cantorPair(x, y int) int { if x < 0 || y < 0 { log.Fatal("Arguments must be non-negative integers.") } return (x*x + 3*x + 2*x*y + y + y*y) / 2 } func pi(n int) int { if n < 2 { return 0 } if n == 2 { return 1 } primes := rcu.Primes(int(math.Sqrt(float64(n)))) a := len(primes) memoPhi := make(map[int]int) var phi func(x, a int) int phi = func(x, a int) int { if a < 1 { return x } if a == 1 { return x - (x >> 1) } pa := primes[a-1] if x <= pa { return 1 } key := cantorPair(x, a) if v, ok := memoPhi[key]; ok { return v } memoPhi[key] = phi(x, a-1) - phi(x/pa, a-1) return memoPhi[key] } return phi(n, a) + a - 1 } func main() { for i, n := 0, 1; i <= 9; i, n = i+1, n*10 { fmt.Printf("10^%d %d\n", i, pi(n)) } }
from primesieve import primes from math import isqrt from functools import cache p = primes(isqrt(1_000_000_000)) @cache def phi(x, a): res = 0 while True: if not a or not x: return x + res a -= 1 res -= phi(x//p[a], a) def legpi(n): if n < 2: return 0 a = legpi(isqrt(n)) return phi(n, a) + a - 1 for e in range(10): print(f'10^{e}', legpi(10**e))
Port the following code from Go to Python with equivalent syntax and logic.
package main import "C" import "unsafe" func main() { C.Run() } const msg = "Here am I" func Query(cbuf *C.char, csiz *C.size_t) C.int { if int(*csiz) <= len(msg) { return 0 } pbuf := uintptr(unsafe.Pointer(cbuf)) for i := 0; i < len(msg); i++ { *((*byte)(unsafe.Pointer(pbuf))) = msg[i] pbuf++ } *((*byte)(unsafe.Pointer(pbuf))) = 0 *csiz = C.size_t(len(msg) + 1) return 1 }
def query(buffer_length): message = b'Here am I' L = len(message) return message[0:L*(L <= buffer_length)]
Produce a functionally identical Python code for the snippet given in Go.
package main import ( "bufio" "os" ) func main() { in := bufio.NewReader(os.Stdin) var blankLine = "\n" var printLongest func(string) string printLongest = func(candidate string) (longest string) { longest = candidate s, err := in.ReadString('\n') defer func() { recover() defer func() { recover() }() _ = blankLine[0] func() { defer func() { recover() }() _ = s[len(longest)] longest = s }() longest = printLongest(longest) func() { defer func() { recover() os.Stdout.WriteString(s) }() _ = longest[len(s)] s = "" }() }() _ = err.(error) os.Stdout.WriteString(blankLine) blankLine = "" return } printLongest("") }
import fileinput def longer(a, b): try: b[len(a)-1] return False except: return True longest, lines = '', '' for x in fileinput.input(): if longer(x, longest): lines, longest = x, x elif not longer(longest, x): lines += x print(lines, end='')
Produce a functionally identical Python code for the snippet given in Go.
package turing type Symbol byte type Motion byte const ( Left Motion = 'L' Right Motion = 'R' Stay Motion = 'N' ) type Tape struct { data []Symbol pos, left int blank Symbol } func NewTape(blank Symbol, start int, data []Symbol) *Tape { t := &Tape{ data: data, blank: blank, } if start < 0 { t.Left(-start) } t.Right(start) return t } func (t *Tape) Stay() {} func (t *Tape) Data() []Symbol { return t.data[t.left:] } func (t *Tape) Read() Symbol { return t.data[t.pos] } func (t *Tape) Write(s Symbol) { t.data[t.pos] = s } func (t *Tape) Dup() *Tape { t2 := &Tape{ data: make([]Symbol, len(t.Data())), blank: t.blank, } copy(t2.data, t.Data()) t2.pos = t.pos - t.left return t2 } func (t *Tape) String() string { s := "" for i := t.left; i < len(t.data); i++ { b := t.data[i] if i == t.pos { s += "[" + string(b) + "]" } else { s += " " + string(b) + " " } } return s } func (t *Tape) Move(a Motion) { switch a { case Left: t.Left(1) case Right: t.Right(1) case Stay: t.Stay() } } const minSz = 16 func (t *Tape) Left(n int) { t.pos -= n if t.pos < 0 { var sz int for sz = minSz; cap(t.data[t.left:])-t.pos >= sz; sz <<= 1 { } newd := make([]Symbol, sz) newl := len(newd) - cap(t.data[t.left:]) n := copy(newd[newl:], t.data[t.left:]) t.data = newd[:newl+n] t.pos += newl - t.left t.left = newl } if t.pos < t.left { if t.blank != 0 { for i := t.pos; i < t.left; i++ { t.data[i] = t.blank } } t.left = t.pos } } func (t *Tape) Right(n int) { t.pos += n if t.pos >= cap(t.data) { var sz int for sz = minSz; t.pos >= sz; sz <<= 1 { } newd := make([]Symbol, sz) n := copy(newd[t.left:], t.data[t.left:]) t.data = newd[:t.left+n] } if i := len(t.data); t.pos >= i { t.data = t.data[:t.pos+1] if t.blank != 0 { for ; i < len(t.data); i++ { t.data[i] = t.blank } } } } type State string type Rule struct { State Symbol Write Symbol Motion Next State } func (i *Rule) key() key { return key{i.State, i.Symbol} } func (i *Rule) action() action { return action{i.Write, i.Motion, i.Next} } type key struct { State Symbol } type action struct { write Symbol Motion next State } type Machine struct { tape *Tape start, state State transition map[key]action l func(string, ...interface{}) } func NewMachine(rules []Rule) *Machine { m := &Machine{transition: make(map[key]action, len(rules))} if len(rules) > 0 { m.start = rules[0].State } for _, r := range rules { m.transition[r.key()] = r.action() } return m } func (m *Machine) Run(input *Tape) (int, *Tape) { m.tape = input.Dup() m.state = m.start for cnt := 0; ; cnt++ { if m.l != nil { m.l("%3d %4s: %v\n", cnt, m.state, m.tape) } sym := m.tape.Read() act, ok := m.transition[key{m.state, sym}] if !ok { return cnt, m.tape } m.tape.Write(act.write) m.tape.Move(act.Motion) m.state = act.next } }
from __future__ import print_function def run_utm( state = None, blank = None, rules = [], tape = [], halt = None, pos = 0): st = state if not tape: tape = [blank] if pos < 0: pos += len(tape) if pos >= len(tape) or pos < 0: raise Error( "bad init position") rules = dict(((s0, v0), (v1, dr, s1)) for (s0, v0, v1, dr, s1) in rules) while True: print(st, '\t', end=" ") for i, v in enumerate(tape): if i == pos: print("[%s]" % (v,), end=" ") else: print(v, end=" ") print() if st == halt: break if (st, tape[pos]) not in rules: break (v1, dr, s1) = rules[(st, tape[pos])] tape[pos] = v1 if dr == 'left': if pos > 0: pos -= 1 else: tape.insert(0, blank) if dr == 'right': pos += 1 if pos >= len(tape): tape.append(blank) st = s1 print("incr machine\n") run_utm( halt = 'qf', state = 'q0', tape = list("111"), blank = 'B', rules = map(tuple, ["q0 1 1 right q0".split(), "q0 B 1 stay qf".split()] ) ) print("\nbusy beaver\n") run_utm( halt = 'halt', state = 'a', blank = '0', rules = map(tuple, ["a 0 1 right b".split(), "a 1 1 left c".split(), "b 0 1 left a".split(), "b 1 1 right b".split(), "c 0 1 left b".split(), "c 1 1 stay halt".split()] ) ) print("\nsorting test\n") run_utm(halt = 'STOP', state = 'A', blank = '0', tape = "2 2 2 1 2 2 1 2 1 2 1 2 1 2".split(), rules = map(tuple, ["A 1 1 right A".split(), "A 2 3 right B".split(), "A 0 0 left E".split(), "B 1 1 right B".split(), "B 2 2 right B".split(), "B 0 0 left C".split(), "C 1 2 left D".split(), "C 2 2 left C".split(), "C 3 2 left E".split(), "D 1 1 left D".split(), "D 2 2 left D".split(), "D 3 1 right A".split(), "E 1 1 left E".split(), "E 0 0 right STOP".split()] ) )
Generate a Python translation of this Go snippet without changing its computational steps.
package turing type Symbol byte type Motion byte const ( Left Motion = 'L' Right Motion = 'R' Stay Motion = 'N' ) type Tape struct { data []Symbol pos, left int blank Symbol } func NewTape(blank Symbol, start int, data []Symbol) *Tape { t := &Tape{ data: data, blank: blank, } if start < 0 { t.Left(-start) } t.Right(start) return t } func (t *Tape) Stay() {} func (t *Tape) Data() []Symbol { return t.data[t.left:] } func (t *Tape) Read() Symbol { return t.data[t.pos] } func (t *Tape) Write(s Symbol) { t.data[t.pos] = s } func (t *Tape) Dup() *Tape { t2 := &Tape{ data: make([]Symbol, len(t.Data())), blank: t.blank, } copy(t2.data, t.Data()) t2.pos = t.pos - t.left return t2 } func (t *Tape) String() string { s := "" for i := t.left; i < len(t.data); i++ { b := t.data[i] if i == t.pos { s += "[" + string(b) + "]" } else { s += " " + string(b) + " " } } return s } func (t *Tape) Move(a Motion) { switch a { case Left: t.Left(1) case Right: t.Right(1) case Stay: t.Stay() } } const minSz = 16 func (t *Tape) Left(n int) { t.pos -= n if t.pos < 0 { var sz int for sz = minSz; cap(t.data[t.left:])-t.pos >= sz; sz <<= 1 { } newd := make([]Symbol, sz) newl := len(newd) - cap(t.data[t.left:]) n := copy(newd[newl:], t.data[t.left:]) t.data = newd[:newl+n] t.pos += newl - t.left t.left = newl } if t.pos < t.left { if t.blank != 0 { for i := t.pos; i < t.left; i++ { t.data[i] = t.blank } } t.left = t.pos } } func (t *Tape) Right(n int) { t.pos += n if t.pos >= cap(t.data) { var sz int for sz = minSz; t.pos >= sz; sz <<= 1 { } newd := make([]Symbol, sz) n := copy(newd[t.left:], t.data[t.left:]) t.data = newd[:t.left+n] } if i := len(t.data); t.pos >= i { t.data = t.data[:t.pos+1] if t.blank != 0 { for ; i < len(t.data); i++ { t.data[i] = t.blank } } } } type State string type Rule struct { State Symbol Write Symbol Motion Next State } func (i *Rule) key() key { return key{i.State, i.Symbol} } func (i *Rule) action() action { return action{i.Write, i.Motion, i.Next} } type key struct { State Symbol } type action struct { write Symbol Motion next State } type Machine struct { tape *Tape start, state State transition map[key]action l func(string, ...interface{}) } func NewMachine(rules []Rule) *Machine { m := &Machine{transition: make(map[key]action, len(rules))} if len(rules) > 0 { m.start = rules[0].State } for _, r := range rules { m.transition[r.key()] = r.action() } return m } func (m *Machine) Run(input *Tape) (int, *Tape) { m.tape = input.Dup() m.state = m.start for cnt := 0; ; cnt++ { if m.l != nil { m.l("%3d %4s: %v\n", cnt, m.state, m.tape) } sym := m.tape.Read() act, ok := m.transition[key{m.state, sym}] if !ok { return cnt, m.tape } m.tape.Write(act.write) m.tape.Move(act.Motion) m.state = act.next } }
from __future__ import print_function def run_utm( state = None, blank = None, rules = [], tape = [], halt = None, pos = 0): st = state if not tape: tape = [blank] if pos < 0: pos += len(tape) if pos >= len(tape) or pos < 0: raise Error( "bad init position") rules = dict(((s0, v0), (v1, dr, s1)) for (s0, v0, v1, dr, s1) in rules) while True: print(st, '\t', end=" ") for i, v in enumerate(tape): if i == pos: print("[%s]" % (v,), end=" ") else: print(v, end=" ") print() if st == halt: break if (st, tape[pos]) not in rules: break (v1, dr, s1) = rules[(st, tape[pos])] tape[pos] = v1 if dr == 'left': if pos > 0: pos -= 1 else: tape.insert(0, blank) if dr == 'right': pos += 1 if pos >= len(tape): tape.append(blank) st = s1 print("incr machine\n") run_utm( halt = 'qf', state = 'q0', tape = list("111"), blank = 'B', rules = map(tuple, ["q0 1 1 right q0".split(), "q0 B 1 stay qf".split()] ) ) print("\nbusy beaver\n") run_utm( halt = 'halt', state = 'a', blank = '0', rules = map(tuple, ["a 0 1 right b".split(), "a 1 1 left c".split(), "b 0 1 left a".split(), "b 1 1 right b".split(), "c 0 1 left b".split(), "c 1 1 stay halt".split()] ) ) print("\nsorting test\n") run_utm(halt = 'STOP', state = 'A', blank = '0', tape = "2 2 2 1 2 2 1 2 1 2 1 2 1 2".split(), rules = map(tuple, ["A 1 1 right A".split(), "A 2 3 right B".split(), "A 0 0 left E".split(), "B 1 1 right B".split(), "B 2 2 right B".split(), "B 0 0 left C".split(), "C 1 2 left D".split(), "C 2 2 left C".split(), "C 3 2 left E".split(), "D 1 1 left D".split(), "D 2 2 left D".split(), "D 3 1 right A".split(), "E 1 1 left E".split(), "E 0 0 right STOP".split()] ) )
Convert this Go block to Python, preserving its control flow and logic.
package turing type Symbol byte type Motion byte const ( Left Motion = 'L' Right Motion = 'R' Stay Motion = 'N' ) type Tape struct { data []Symbol pos, left int blank Symbol } func NewTape(blank Symbol, start int, data []Symbol) *Tape { t := &Tape{ data: data, blank: blank, } if start < 0 { t.Left(-start) } t.Right(start) return t } func (t *Tape) Stay() {} func (t *Tape) Data() []Symbol { return t.data[t.left:] } func (t *Tape) Read() Symbol { return t.data[t.pos] } func (t *Tape) Write(s Symbol) { t.data[t.pos] = s } func (t *Tape) Dup() *Tape { t2 := &Tape{ data: make([]Symbol, len(t.Data())), blank: t.blank, } copy(t2.data, t.Data()) t2.pos = t.pos - t.left return t2 } func (t *Tape) String() string { s := "" for i := t.left; i < len(t.data); i++ { b := t.data[i] if i == t.pos { s += "[" + string(b) + "]" } else { s += " " + string(b) + " " } } return s } func (t *Tape) Move(a Motion) { switch a { case Left: t.Left(1) case Right: t.Right(1) case Stay: t.Stay() } } const minSz = 16 func (t *Tape) Left(n int) { t.pos -= n if t.pos < 0 { var sz int for sz = minSz; cap(t.data[t.left:])-t.pos >= sz; sz <<= 1 { } newd := make([]Symbol, sz) newl := len(newd) - cap(t.data[t.left:]) n := copy(newd[newl:], t.data[t.left:]) t.data = newd[:newl+n] t.pos += newl - t.left t.left = newl } if t.pos < t.left { if t.blank != 0 { for i := t.pos; i < t.left; i++ { t.data[i] = t.blank } } t.left = t.pos } } func (t *Tape) Right(n int) { t.pos += n if t.pos >= cap(t.data) { var sz int for sz = minSz; t.pos >= sz; sz <<= 1 { } newd := make([]Symbol, sz) n := copy(newd[t.left:], t.data[t.left:]) t.data = newd[:t.left+n] } if i := len(t.data); t.pos >= i { t.data = t.data[:t.pos+1] if t.blank != 0 { for ; i < len(t.data); i++ { t.data[i] = t.blank } } } } type State string type Rule struct { State Symbol Write Symbol Motion Next State } func (i *Rule) key() key { return key{i.State, i.Symbol} } func (i *Rule) action() action { return action{i.Write, i.Motion, i.Next} } type key struct { State Symbol } type action struct { write Symbol Motion next State } type Machine struct { tape *Tape start, state State transition map[key]action l func(string, ...interface{}) } func NewMachine(rules []Rule) *Machine { m := &Machine{transition: make(map[key]action, len(rules))} if len(rules) > 0 { m.start = rules[0].State } for _, r := range rules { m.transition[r.key()] = r.action() } return m } func (m *Machine) Run(input *Tape) (int, *Tape) { m.tape = input.Dup() m.state = m.start for cnt := 0; ; cnt++ { if m.l != nil { m.l("%3d %4s: %v\n", cnt, m.state, m.tape) } sym := m.tape.Read() act, ok := m.transition[key{m.state, sym}] if !ok { return cnt, m.tape } m.tape.Write(act.write) m.tape.Move(act.Motion) m.state = act.next } }
from __future__ import print_function def run_utm( state = None, blank = None, rules = [], tape = [], halt = None, pos = 0): st = state if not tape: tape = [blank] if pos < 0: pos += len(tape) if pos >= len(tape) or pos < 0: raise Error( "bad init position") rules = dict(((s0, v0), (v1, dr, s1)) for (s0, v0, v1, dr, s1) in rules) while True: print(st, '\t', end=" ") for i, v in enumerate(tape): if i == pos: print("[%s]" % (v,), end=" ") else: print(v, end=" ") print() if st == halt: break if (st, tape[pos]) not in rules: break (v1, dr, s1) = rules[(st, tape[pos])] tape[pos] = v1 if dr == 'left': if pos > 0: pos -= 1 else: tape.insert(0, blank) if dr == 'right': pos += 1 if pos >= len(tape): tape.append(blank) st = s1 print("incr machine\n") run_utm( halt = 'qf', state = 'q0', tape = list("111"), blank = 'B', rules = map(tuple, ["q0 1 1 right q0".split(), "q0 B 1 stay qf".split()] ) ) print("\nbusy beaver\n") run_utm( halt = 'halt', state = 'a', blank = '0', rules = map(tuple, ["a 0 1 right b".split(), "a 1 1 left c".split(), "b 0 1 left a".split(), "b 1 1 right b".split(), "c 0 1 left b".split(), "c 1 1 stay halt".split()] ) ) print("\nsorting test\n") run_utm(halt = 'STOP', state = 'A', blank = '0', tape = "2 2 2 1 2 2 1 2 1 2 1 2 1 2".split(), rules = map(tuple, ["A 1 1 right A".split(), "A 2 3 right B".split(), "A 0 0 left E".split(), "B 1 1 right B".split(), "B 2 2 right B".split(), "B 0 0 left C".split(), "C 1 2 left D".split(), "C 2 2 left C".split(), "C 3 2 left E".split(), "D 1 1 left D".split(), "D 2 2 left D".split(), "D 3 1 right A".split(), "E 1 1 left E".split(), "E 0 0 right STOP".split()] ) )
Generate an equivalent Python version of this Go code.
package main import ( "fmt" "os" ) func createFile(fn string) { f, err := os.Create(fn) if err != nil { fmt.Println(err) return } fmt.Println("file", fn, "created!") f.Close() } func createDir(dn string) { err := os.Mkdir(dn, 0666) if err != nil { fmt.Println(err) return } fmt.Println("directory", dn, "created!") } func main() { createFile("input.txt") createFile("/input.txt") createDir("docs") createDir("/docs") }
import os for directory in ['/', './']: open(directory + 'output.txt', 'w').close() os.mkdir(directory + 'docs')
Convert the following code from Go to Python, ensuring the logic remains intact.
package main import ( "fmt" "strconv" ) func isPrime(n int) bool { switch { case n < 2: return false case n%2 == 0: return n == 2 case n%3 == 0: return n == 3 default: d := 5 for d*d <= n { if n%d == 0 { return false } d += 2 if n%d == 0 { return false } d += 4 } return true } } func commatize(n int) string { s := fmt.Sprintf("%d", n) le := len(s) for i := le - 3; i >= 1; i -= 3 { s = s[0:i] + "," + s[i:] } return s } func main() { fmt.Println("The first 35 unprimeable numbers are:") count := 0 var firstNum [10]int outer: for i, countFirst := 100, 0; countFirst < 10; i++ { if isPrime(i) { continue } s := strconv.Itoa(i) le := len(s) b := []byte(s) for j := 0; j < le; j++ { for k := byte('0'); k <= '9'; k++ { if s[j] == k { continue } b[j] = k n, _ := strconv.Atoi(string(b)) if isPrime(n) { continue outer } } b[j] = s[j] } lastDigit := s[le-1] - '0' if firstNum[lastDigit] == 0 { firstNum[lastDigit] = i countFirst++ } count++ if count <= 35 { fmt.Printf("%d ", i) } if count == 35 { fmt.Print("\n\nThe 600th unprimeable number is: ") } if count == 600 { fmt.Printf("%s\n\n", commatize(i)) } } fmt.Println("The first unprimeable number that ends in:") for i := 0; i < 10; i++ { fmt.Printf(" %d is: %9s\n", i, commatize(firstNum[i])) } }
from itertools import count, islice def primes(_cache=[2, 3]): yield from _cache for n in count(_cache[-1]+2, 2): if isprime(n): _cache.append(n) yield n def isprime(n, _seen={0: False, 1: False}): def _isprime(n): for p in primes(): if p*p > n: return True if n%p == 0: return False if n not in _seen: _seen[n] = _isprime(n) return _seen[n] def unprime(): for a in count(1): d = 1 while d <= a: base = (a//(d*10))*(d*10) + (a%d) if any(isprime(y) for y in range(base, base + d*10, d)): break d *= 10 else: yield a print('First 35:') print(' '.join(str(i) for i in islice(unprime(), 35))) print('\nThe 600-th:') print(list(islice(unprime(), 599, 600))[0]) print() first, need = [False]*10, 10 for p in unprime(): i = p%10 if first[i]: continue first[i] = p need -= 1 if not need: break for i,v in enumerate(first): print(f'{i} ending: {v}')
Translate this program into Python but keep the logic exactly as in Go.
package main import "fmt" type expr struct { x, y, z float64 c float64 } func addExpr(a, b expr) expr { return expr{a.x + b.x, a.y + b.y, a.z + b.z, a.c + b.c} } func subExpr(a, b expr) expr { return expr{a.x - b.x, a.y - b.y, a.z - b.z, a.c - b.c} } func mulExpr(a expr, c float64) expr { return expr{a.x * c, a.y * c, a.z * c, a.c * c} } func addRow(l []expr) []expr { if len(l) == 0 { panic("wrong") } r := make([]expr, len(l)-1) for i := range r { r[i] = addExpr(l[i], l[i+1]) } return r } func substX(a, b expr) expr { if b.x == 0 { panic("wrong") } return subExpr(a, mulExpr(b, a.x/b.x)) } func substY(a, b expr) expr { if b.y == 0 { panic("wrong") } return subExpr(a, mulExpr(b, a.y/b.y)) } func substZ(a, b expr) expr { if b.z == 0 { panic("wrong") } return subExpr(a, mulExpr(b, a.z/b.z)) } func solveX(a expr) float64 { if a.x == 0 || a.y != 0 || a.z != 0 { panic("wrong") } return -a.c / a.x } func solveY(a expr) float64 { if a.x != 0 || a.y == 0 || a.z != 0 { panic("wrong") } return -a.c / a.y } func solveZ(a expr) float64 { if a.x != 0 || a.y != 0 || a.z == 0 { panic("wrong") } return -a.c / a.z } func main() { r5 := []expr{{x: 1}, {c: 11}, {y: 1}, {c: 4}, {z: 1}} fmt.Println("bottom row:", r5) r4 := addRow(r5) fmt.Println("next row up:", r4) r3 := addRow(r4) fmt.Println("middle row:", r3) xyz := subExpr(expr{y: 1}, expr{x: 1, z: 1}) fmt.Println("xyz relation:", xyz) r3[2] = substZ(r3[2], xyz) fmt.Println("middle row after substituting for z:", r3) b := expr{c: 40} xy := subExpr(r3[0], b) fmt.Println("xy relation:", xy) r3[0] = b r3[2] = substX(r3[2], xy) fmt.Println("middle row after substituting for x:", r3) r2 := addRow(r3) fmt.Println("next row up:", r2) r1 := addRow(r2) fmt.Println("top row:", r1) y := subExpr(r1[0], expr{c: 151}) fmt.Println("y relation:", y) x := substY(xy, y) fmt.Println("x relation:", x) z := substX(substY(xyz, y), x) fmt.Println("z relation:", z) fmt.Println("x =", solveX(x)) fmt.Println("y =", solveY(y)) fmt.Println("z =", solveZ(z)) }
def combine( snl, snr ): cl = {} if isinstance(snl, int): cl['1'] = snl elif isinstance(snl, string): cl[snl] = 1 else: cl.update( snl) if isinstance(snr, int): n = cl.get('1', 0) cl['1'] = n + snr elif isinstance(snr, string): n = cl.get(snr, 0) cl[snr] = n + 1 else: for k,v in snr.items(): n = cl.get(k, 0) cl[k] = n+v return cl def constrain(nsum, vn ): nn = {} nn.update(vn) n = nn.get('1', 0) nn['1'] = n - nsum return nn def makeMatrix( constraints ): vmap = set() for c in constraints: vmap.update( c.keys()) vmap.remove('1') nvars = len(vmap) vmap = sorted(vmap) mtx = [] for c in constraints: row = [] for vv in vmap: row.append(float(c.get(vv, 0))) row.append(-float(c.get('1',0))) mtx.append(row) if len(constraints) == nvars: print 'System appears solvable' elif len(constraints) < nvars: print 'System is not solvable - needs more constraints.' return mtx, vmap def SolvePyramid( vl, cnstr ): vl.reverse() constraints = [cnstr] lvls = len(vl) for lvln in range(1,lvls): lvd = vl[lvln] for k in range(lvls - lvln): sn = lvd[k] ll = vl[lvln-1] vn = combine(ll[k], ll[k+1]) if sn is None: lvd[k] = vn else: constraints.append(constrain( sn, vn )) print 'Constraint Equations:' for cstr in constraints: fset = ('%d*%s'%(v,k) for k,v in cstr.items() ) print ' + '.join(fset), ' = 0' mtx,vmap = makeMatrix(constraints) MtxSolve(mtx) d = len(vmap) for j in range(d): print vmap[j],'=', mtx[j][d] def MtxSolve(mtx): mDim = len(mtx) for j in range(mDim): rw0= mtx[j] f = 1.0/rw0[j] for k in range(j, mDim+1): rw0[k] *= f for l in range(1+j,mDim): rwl = mtx[l] f = -rwl[j] for k in range(j, mDim+1): rwl[k] += f * rw0[k] for j1 in range(1,mDim): j = mDim - j1 rw0= mtx[j] for l in range(0, j): rwl = mtx[l] f = -rwl[j] rwl[j] += f * rw0[j] rwl[mDim] += f * rw0[mDim] return mtx p = [ [151], [None,None], [40,None,None], [None,None,None,None], ['X', 11, 'Y', 4, 'Z'] ] addlConstraint = { 'X':1, 'Y':-1, 'Z':1, '1':0 } SolvePyramid( p, addlConstraint)
Write the same algorithm in Python as shown in this Go implementation.
package main import "fmt" type expr struct { x, y, z float64 c float64 } func addExpr(a, b expr) expr { return expr{a.x + b.x, a.y + b.y, a.z + b.z, a.c + b.c} } func subExpr(a, b expr) expr { return expr{a.x - b.x, a.y - b.y, a.z - b.z, a.c - b.c} } func mulExpr(a expr, c float64) expr { return expr{a.x * c, a.y * c, a.z * c, a.c * c} } func addRow(l []expr) []expr { if len(l) == 0 { panic("wrong") } r := make([]expr, len(l)-1) for i := range r { r[i] = addExpr(l[i], l[i+1]) } return r } func substX(a, b expr) expr { if b.x == 0 { panic("wrong") } return subExpr(a, mulExpr(b, a.x/b.x)) } func substY(a, b expr) expr { if b.y == 0 { panic("wrong") } return subExpr(a, mulExpr(b, a.y/b.y)) } func substZ(a, b expr) expr { if b.z == 0 { panic("wrong") } return subExpr(a, mulExpr(b, a.z/b.z)) } func solveX(a expr) float64 { if a.x == 0 || a.y != 0 || a.z != 0 { panic("wrong") } return -a.c / a.x } func solveY(a expr) float64 { if a.x != 0 || a.y == 0 || a.z != 0 { panic("wrong") } return -a.c / a.y } func solveZ(a expr) float64 { if a.x != 0 || a.y != 0 || a.z == 0 { panic("wrong") } return -a.c / a.z } func main() { r5 := []expr{{x: 1}, {c: 11}, {y: 1}, {c: 4}, {z: 1}} fmt.Println("bottom row:", r5) r4 := addRow(r5) fmt.Println("next row up:", r4) r3 := addRow(r4) fmt.Println("middle row:", r3) xyz := subExpr(expr{y: 1}, expr{x: 1, z: 1}) fmt.Println("xyz relation:", xyz) r3[2] = substZ(r3[2], xyz) fmt.Println("middle row after substituting for z:", r3) b := expr{c: 40} xy := subExpr(r3[0], b) fmt.Println("xy relation:", xy) r3[0] = b r3[2] = substX(r3[2], xy) fmt.Println("middle row after substituting for x:", r3) r2 := addRow(r3) fmt.Println("next row up:", r2) r1 := addRow(r2) fmt.Println("top row:", r1) y := subExpr(r1[0], expr{c: 151}) fmt.Println("y relation:", y) x := substY(xy, y) fmt.Println("x relation:", x) z := substX(substY(xyz, y), x) fmt.Println("z relation:", z) fmt.Println("x =", solveX(x)) fmt.Println("y =", solveY(y)) fmt.Println("z =", solveZ(z)) }
def combine( snl, snr ): cl = {} if isinstance(snl, int): cl['1'] = snl elif isinstance(snl, string): cl[snl] = 1 else: cl.update( snl) if isinstance(snr, int): n = cl.get('1', 0) cl['1'] = n + snr elif isinstance(snr, string): n = cl.get(snr, 0) cl[snr] = n + 1 else: for k,v in snr.items(): n = cl.get(k, 0) cl[k] = n+v return cl def constrain(nsum, vn ): nn = {} nn.update(vn) n = nn.get('1', 0) nn['1'] = n - nsum return nn def makeMatrix( constraints ): vmap = set() for c in constraints: vmap.update( c.keys()) vmap.remove('1') nvars = len(vmap) vmap = sorted(vmap) mtx = [] for c in constraints: row = [] for vv in vmap: row.append(float(c.get(vv, 0))) row.append(-float(c.get('1',0))) mtx.append(row) if len(constraints) == nvars: print 'System appears solvable' elif len(constraints) < nvars: print 'System is not solvable - needs more constraints.' return mtx, vmap def SolvePyramid( vl, cnstr ): vl.reverse() constraints = [cnstr] lvls = len(vl) for lvln in range(1,lvls): lvd = vl[lvln] for k in range(lvls - lvln): sn = lvd[k] ll = vl[lvln-1] vn = combine(ll[k], ll[k+1]) if sn is None: lvd[k] = vn else: constraints.append(constrain( sn, vn )) print 'Constraint Equations:' for cstr in constraints: fset = ('%d*%s'%(v,k) for k,v in cstr.items() ) print ' + '.join(fset), ' = 0' mtx,vmap = makeMatrix(constraints) MtxSolve(mtx) d = len(vmap) for j in range(d): print vmap[j],'=', mtx[j][d] def MtxSolve(mtx): mDim = len(mtx) for j in range(mDim): rw0= mtx[j] f = 1.0/rw0[j] for k in range(j, mDim+1): rw0[k] *= f for l in range(1+j,mDim): rwl = mtx[l] f = -rwl[j] for k in range(j, mDim+1): rwl[k] += f * rw0[k] for j1 in range(1,mDim): j = mDim - j1 rw0= mtx[j] for l in range(0, j): rwl = mtx[l] f = -rwl[j] rwl[j] += f * rw0[j] rwl[mDim] += f * rw0[mDim] return mtx p = [ [151], [None,None], [40,None,None], [None,None,None,None], ['X', 11, 'Y', 4, 'Z'] ] addlConstraint = { 'X':1, 'Y':-1, 'Z':1, '1':0 } SolvePyramid( p, addlConstraint)
Generate a Python translation of this Go snippet without changing its computational steps.
package main import ( "fmt" "math/big" ) var ( zero = new(big.Int) prod = new(big.Int) fact = new(big.Int) ) func ccFactors(n, m uint64) (*big.Int, bool) { prod.SetUint64(6*m + 1) if !prod.ProbablyPrime(0) { return zero, false } fact.SetUint64(12*m + 1) if !fact.ProbablyPrime(0) { return zero, false } prod.Mul(prod, fact) for i := uint64(1); i <= n-2; i++ { fact.SetUint64((1<<i)*9*m + 1) if !fact.ProbablyPrime(0) { return zero, false } prod.Mul(prod, fact) } return prod, true } func ccNumbers(start, end uint64) { for n := start; n <= end; n++ { m := uint64(1) if n > 4 { m = 1 << (n - 4) } for { num, ok := ccFactors(n, m) if ok { fmt.Printf("a(%d) = %d\n", n, num) break } if n <= 4 { m++ } else { m += 1 << (n - 4) } } } } func main() { ccNumbers(3, 9) }
from sympy import isprime def primality_pretest(k): if not (k % 3) or not (k % 5) or not (k % 7) or not (k % 11) or not(k % 13) or not (k % 17) or not (k % 19) or not (k % 23): return (k <= 23) return True def is_chernick(n, m): t = 9 * m if not primality_pretest(6 * m + 1): return False if not primality_pretest(12 * m + 1): return False for i in range(1,n-1): if not primality_pretest((t << i) + 1): return False if not isprime(6 * m + 1): return False if not isprime(12 * m + 1): return False for i in range(1,n - 1): if not isprime((t << i) + 1): return False return True for n in range(3,10): if n > 4: multiplier = 1 << (n - 4) else: multiplier = 1 if n > 5: multiplier *= 5 k = 1 while True: m = k * multiplier if is_chernick(n, m): print("a("+str(n)+") has m = "+str(m)) break k += 1
Write the same code in Python as shown below in Go.
package main import ( "fmt" "math/big" ) var ( zero = new(big.Int) prod = new(big.Int) fact = new(big.Int) ) func ccFactors(n, m uint64) (*big.Int, bool) { prod.SetUint64(6*m + 1) if !prod.ProbablyPrime(0) { return zero, false } fact.SetUint64(12*m + 1) if !fact.ProbablyPrime(0) { return zero, false } prod.Mul(prod, fact) for i := uint64(1); i <= n-2; i++ { fact.SetUint64((1<<i)*9*m + 1) if !fact.ProbablyPrime(0) { return zero, false } prod.Mul(prod, fact) } return prod, true } func ccNumbers(start, end uint64) { for n := start; n <= end; n++ { m := uint64(1) if n > 4 { m = 1 << (n - 4) } for { num, ok := ccFactors(n, m) if ok { fmt.Printf("a(%d) = %d\n", n, num) break } if n <= 4 { m++ } else { m += 1 << (n - 4) } } } } func main() { ccNumbers(3, 9) }
from sympy import isprime def primality_pretest(k): if not (k % 3) or not (k % 5) or not (k % 7) or not (k % 11) or not(k % 13) or not (k % 17) or not (k % 19) or not (k % 23): return (k <= 23) return True def is_chernick(n, m): t = 9 * m if not primality_pretest(6 * m + 1): return False if not primality_pretest(12 * m + 1): return False for i in range(1,n-1): if not primality_pretest((t << i) + 1): return False if not isprime(6 * m + 1): return False if not isprime(12 * m + 1): return False for i in range(1,n - 1): if not isprime((t << i) + 1): return False return True for n in range(3,10): if n > 4: multiplier = 1 << (n - 4) else: multiplier = 1 if n > 5: multiplier *= 5 k = 1 while True: m = k * multiplier if is_chernick(n, m): print("a("+str(n)+") has m = "+str(m)) break k += 1
Produce a language-to-language conversion: from Go to Python, same semantics.
package main import ( "fmt" "math" ) const EPS = 0.001 const EPS_SQUARE = EPS * EPS func side(x1, y1, x2, y2, x, y float64) float64 { return (y2-y1)*(x-x1) + (-x2+x1)*(y-y1) } func naivePointInTriangle(x1, y1, x2, y2, x3, y3, x, y float64) bool { checkSide1 := side(x1, y1, x2, y2, x, y) >= 0 checkSide2 := side(x2, y2, x3, y3, x, y) >= 0 checkSide3 := side(x3, y3, x1, y1, x, y) >= 0 return checkSide1 && checkSide2 && checkSide3 } func pointInTriangleBoundingBox(x1, y1, x2, y2, x3, y3, x, y float64) bool { xMin := math.Min(x1, math.Min(x2, x3)) - EPS xMax := math.Max(x1, math.Max(x2, x3)) + EPS yMin := math.Min(y1, math.Min(y2, y3)) - EPS yMax := math.Max(y1, math.Max(y2, y3)) + EPS return !(x < xMin || xMax < x || y < yMin || yMax < y) } func distanceSquarePointToSegment(x1, y1, x2, y2, x, y float64) float64 { p1_p2_squareLength := (x2-x1)*(x2-x1) + (y2-y1)*(y2-y1) dotProduct := ((x-x1)*(x2-x1) + (y-y1)*(y2-y1)) / p1_p2_squareLength if dotProduct < 0 { return (x-x1)*(x-x1) + (y-y1)*(y-y1) } else if dotProduct <= 1 { p_p1_squareLength := (x1-x)*(x1-x) + (y1-y)*(y1-y) return p_p1_squareLength - dotProduct*dotProduct*p1_p2_squareLength } else { return (x-x2)*(x-x2) + (y-y2)*(y-y2) } } func accuratePointInTriangle(x1, y1, x2, y2, x3, y3, x, y float64) bool { if !pointInTriangleBoundingBox(x1, y1, x2, y2, x3, y3, x, y) { return false } if naivePointInTriangle(x1, y1, x2, y2, x3, y3, x, y) { return true } if distanceSquarePointToSegment(x1, y1, x2, y2, x, y) <= EPS_SQUARE { return true } if distanceSquarePointToSegment(x2, y2, x3, y3, x, y) <= EPS_SQUARE { return true } if distanceSquarePointToSegment(x3, y3, x1, y1, x, y) <= EPS_SQUARE { return true } return false } func main() { pts := [][2]float64{{0, 0}, {0, 1}, {3, 1}} tri := [][2]float64{{3.0 / 2, 12.0 / 5}, {51.0 / 10, -31.0 / 10}, {-19.0 / 5, 1.2}} fmt.Println("Triangle is", tri) x1, y1 := tri[0][0], tri[0][1] x2, y2 := tri[1][0], tri[1][1] x3, y3 := tri[2][0], tri[2][1] for _, pt := range pts { x, y := pt[0], pt[1] within := accuratePointInTriangle(x1, y1, x2, y2, x3, y3, x, y) fmt.Println("Point", pt, "is within triangle?", within) } fmt.Println() tri = [][2]float64{{1.0 / 10, 1.0 / 9}, {100.0 / 8, 100.0 / 3}, {100.0 / 4, 100.0 / 9}} fmt.Println("Triangle is", tri) x1, y1 = tri[0][0], tri[0][1] x2, y2 = tri[1][0], tri[1][1] x3, y3 = tri[2][0], tri[2][1] x := x1 + (3.0/7)*(x2-x1) y := y1 + (3.0/7)*(y2-y1) pt := [2]float64{x, y} within := accuratePointInTriangle(x1, y1, x2, y2, x3, y3, x, y) fmt.Println("Point", pt, "is within triangle ?", within) fmt.Println() tri = [][2]float64{{1.0 / 10, 1.0 / 9}, {100.0 / 8, 100.0 / 3}, {-100.0 / 8, 100.0 / 6}} fmt.Println("Triangle is", tri) x3 = tri[2][0] y3 = tri[2][1] within = accuratePointInTriangle(x1, y1, x2, y2, x3, y3, x, y) fmt.Println("Point", pt, "is within triangle ?", within) }
from sympy.geometry import Point, Triangle def sign(pt1, pt2, pt3): return (pt1.x - pt3.x) * (pt2.y - pt3.y) - (pt2.x - pt3.x) * (pt1.y - pt3.y) def iswithin(point, pt1, pt2, pt3): zval1 = sign(point, pt1, pt2) zval2 = sign(point, pt2, pt3) zval3 = sign(point, pt3, pt1) notanyneg = zval1 >= 0 and zval2 >= 0 and zval3 >= 0 notanypos = zval1 <= 0 and zval2 <= 0 and zval3 <= 0 return notanyneg or notanypos if __name__ == "__main__": POINTS = [Point(0, 0)] TRI = Triangle(Point(1.5, 2.4), Point(5.1, -3.1), Point(-3.8, 0.5)) for pnt in POINTS: a, b, c = TRI.vertices isornot = "is" if iswithin(pnt, a, b, c) else "is not" print("Point", pnt, isornot, "within the triangle", TRI)
Write a version of this Go function in Python with identical behavior.
package main import ( "fmt" "math" ) const EPS = 0.001 const EPS_SQUARE = EPS * EPS func side(x1, y1, x2, y2, x, y float64) float64 { return (y2-y1)*(x-x1) + (-x2+x1)*(y-y1) } func naivePointInTriangle(x1, y1, x2, y2, x3, y3, x, y float64) bool { checkSide1 := side(x1, y1, x2, y2, x, y) >= 0 checkSide2 := side(x2, y2, x3, y3, x, y) >= 0 checkSide3 := side(x3, y3, x1, y1, x, y) >= 0 return checkSide1 && checkSide2 && checkSide3 } func pointInTriangleBoundingBox(x1, y1, x2, y2, x3, y3, x, y float64) bool { xMin := math.Min(x1, math.Min(x2, x3)) - EPS xMax := math.Max(x1, math.Max(x2, x3)) + EPS yMin := math.Min(y1, math.Min(y2, y3)) - EPS yMax := math.Max(y1, math.Max(y2, y3)) + EPS return !(x < xMin || xMax < x || y < yMin || yMax < y) } func distanceSquarePointToSegment(x1, y1, x2, y2, x, y float64) float64 { p1_p2_squareLength := (x2-x1)*(x2-x1) + (y2-y1)*(y2-y1) dotProduct := ((x-x1)*(x2-x1) + (y-y1)*(y2-y1)) / p1_p2_squareLength if dotProduct < 0 { return (x-x1)*(x-x1) + (y-y1)*(y-y1) } else if dotProduct <= 1 { p_p1_squareLength := (x1-x)*(x1-x) + (y1-y)*(y1-y) return p_p1_squareLength - dotProduct*dotProduct*p1_p2_squareLength } else { return (x-x2)*(x-x2) + (y-y2)*(y-y2) } } func accuratePointInTriangle(x1, y1, x2, y2, x3, y3, x, y float64) bool { if !pointInTriangleBoundingBox(x1, y1, x2, y2, x3, y3, x, y) { return false } if naivePointInTriangle(x1, y1, x2, y2, x3, y3, x, y) { return true } if distanceSquarePointToSegment(x1, y1, x2, y2, x, y) <= EPS_SQUARE { return true } if distanceSquarePointToSegment(x2, y2, x3, y3, x, y) <= EPS_SQUARE { return true } if distanceSquarePointToSegment(x3, y3, x1, y1, x, y) <= EPS_SQUARE { return true } return false } func main() { pts := [][2]float64{{0, 0}, {0, 1}, {3, 1}} tri := [][2]float64{{3.0 / 2, 12.0 / 5}, {51.0 / 10, -31.0 / 10}, {-19.0 / 5, 1.2}} fmt.Println("Triangle is", tri) x1, y1 := tri[0][0], tri[0][1] x2, y2 := tri[1][0], tri[1][1] x3, y3 := tri[2][0], tri[2][1] for _, pt := range pts { x, y := pt[0], pt[1] within := accuratePointInTriangle(x1, y1, x2, y2, x3, y3, x, y) fmt.Println("Point", pt, "is within triangle?", within) } fmt.Println() tri = [][2]float64{{1.0 / 10, 1.0 / 9}, {100.0 / 8, 100.0 / 3}, {100.0 / 4, 100.0 / 9}} fmt.Println("Triangle is", tri) x1, y1 = tri[0][0], tri[0][1] x2, y2 = tri[1][0], tri[1][1] x3, y3 = tri[2][0], tri[2][1] x := x1 + (3.0/7)*(x2-x1) y := y1 + (3.0/7)*(y2-y1) pt := [2]float64{x, y} within := accuratePointInTriangle(x1, y1, x2, y2, x3, y3, x, y) fmt.Println("Point", pt, "is within triangle ?", within) fmt.Println() tri = [][2]float64{{1.0 / 10, 1.0 / 9}, {100.0 / 8, 100.0 / 3}, {-100.0 / 8, 100.0 / 6}} fmt.Println("Triangle is", tri) x3 = tri[2][0] y3 = tri[2][1] within = accuratePointInTriangle(x1, y1, x2, y2, x3, y3, x, y) fmt.Println("Point", pt, "is within triangle ?", within) }
from sympy.geometry import Point, Triangle def sign(pt1, pt2, pt3): return (pt1.x - pt3.x) * (pt2.y - pt3.y) - (pt2.x - pt3.x) * (pt1.y - pt3.y) def iswithin(point, pt1, pt2, pt3): zval1 = sign(point, pt1, pt2) zval2 = sign(point, pt2, pt3) zval3 = sign(point, pt3, pt1) notanyneg = zval1 >= 0 and zval2 >= 0 and zval3 >= 0 notanypos = zval1 <= 0 and zval2 <= 0 and zval3 <= 0 return notanyneg or notanypos if __name__ == "__main__": POINTS = [Point(0, 0)] TRI = Triangle(Point(1.5, 2.4), Point(5.1, -3.1), Point(-3.8, 0.5)) for pnt in POINTS: a, b, c = TRI.vertices isornot = "is" if iswithin(pnt, a, b, c) else "is not" print("Point", pnt, isornot, "within the triangle", TRI)
Keep all operations the same but rewrite the snippet in Python.
package main import "fmt" func countDivisors(n int) int { count := 0 i := 1 k := 2 if n%2 == 0 { k = 1 } for i*i <= n { if n%i == 0 { count++ j := n / i if j != i { count++ } } i += k } return count } func main() { fmt.Println("The tau functions for the first 100 positive integers are:") for i := 1; i <= 100; i++ { fmt.Printf("%2d ", countDivisors(i)) if i%20 == 0 { fmt.Println() } } }
def factorize(n): assert(isinstance(n, int)) if n < 0: n = -n if n < 2: return k = 0 while 0 == n%2: k += 1 n //= 2 if 0 < k: yield (2,k) p = 3 while p*p <= n: k = 0 while 0 == n%p: k += 1 n //= p if 0 < k: yield (p,k) p += 2 if 1 < n: yield (n,1) def tau(n): assert(n != 0) ans = 1 for (p,k) in factorize(n): ans *= 1 + k return ans if __name__ == "__main__": print(*map(tau, range(1, 101)))
Change the programming language of this snippet from Go to Python without modifying what it does.
package main import "fmt" func countDivisors(n int) int { count := 0 i := 1 k := 2 if n%2 == 0 { k = 1 } for i*i <= n { if n%i == 0 { count++ j := n / i if j != i { count++ } } i += k } return count } func main() { fmt.Println("The tau functions for the first 100 positive integers are:") for i := 1; i <= 100; i++ { fmt.Printf("%2d ", countDivisors(i)) if i%20 == 0 { fmt.Println() } } }
def factorize(n): assert(isinstance(n, int)) if n < 0: n = -n if n < 2: return k = 0 while 0 == n%2: k += 1 n //= 2 if 0 < k: yield (2,k) p = 3 while p*p <= n: k = 0 while 0 == n%p: k += 1 n //= p if 0 < k: yield (p,k) p += 2 if 1 < n: yield (n,1) def tau(n): assert(n != 0) ans = 1 for (p,k) in factorize(n): ans *= 1 + k return ans if __name__ == "__main__": print(*map(tau, range(1, 101)))
Change the programming language of this snippet from Go to Python without modifying what it does.
package main import ( "fmt" "math/big" ) func main() { one := big.NewInt(1) pm := big.NewInt(1) var px, nx int var pb big.Int primes(4000, func(p int64) bool { pm.Mul(pm, pb.SetInt64(p)) px++ if pb.Add(pm, one).ProbablyPrime(0) || pb.Sub(pm, one).ProbablyPrime(0) { fmt.Print(px, " ") nx++ if nx == 20 { fmt.Println() return false } } return true }) } func primes(limit int, f func(int64) bool) { c := make([]bool, limit) c[0] = true c[1] = true lm := int64(limit) p := int64(2) for { f(p) p2 := p * p if p2 >= lm { break } for i := p2; i < lm; i += p { c[i] = true } for { p++ if !c[p] { break } } } for p++; p < lm; p++ { if !c[p] && !f(p) { break } } }
import pyprimes def primorial_prime(_pmax=500): isprime = pyprimes.isprime n, primo = 0, 1 for prime in pyprimes.nprimes(_pmax): n, primo = n+1, primo * prime if isprime(primo-1) or isprime(primo+1): yield n if __name__ == '__main__': pyprimes.warn_probably = False for i, n in zip(range(20), primorial_prime()): print('Primorial prime %2i at primorial index: %3i' % (i+1, n))
Translate the given Go code snippet into Python without altering its behavior.
package main import ( "fmt" "sort" ) func main() { dna := "" + "CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATG" + "CTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTG" + "AGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGAT" + "GGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT" + "CGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGG" + "TCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA" + "TTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTAT" + "CGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTG" + "TCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGAC" + "GACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT" fmt.Println("SEQUENCE:") le := len(dna) for i := 0; i < le; i += 50 { k := i + 50 if k > le { k = le } fmt.Printf("%5d: %s\n", i, dna[i:k]) } baseMap := make(map[byte]int) for i := 0; i < le; i++ { baseMap[dna[i]]++ } var bases []byte for k := range baseMap { bases = append(bases, k) } sort.Slice(bases, func(i, j int) bool { return bases[i] < bases[j] }) fmt.Println("\nBASE COUNT:") for _, base := range bases { fmt.Printf(" %c: %3d\n", base, baseMap[base]) } fmt.Println(" ------") fmt.Println(" Σ:", le) fmt.Println(" ======") }
from collections import Counter def basecount(dna): return sorted(Counter(dna).items()) def seq_split(dna, n=50): return [dna[i: i+n] for i in range(0, len(dna), n)] def seq_pp(dna, n=50): for i, part in enumerate(seq_split(dna, n)): print(f"{i*n:>5}: {part}") print("\n BASECOUNT:") tot = 0 for base, count in basecount(dna): print(f" {base:>3}: {count}") tot += count base, count = 'TOT', tot print(f" {base:>3}= {count}") if __name__ == '__main__': print("SEQUENCE:") sequence = seq_pp(sequence)
Write the same algorithm in Python as shown in this Go implementation.
package main import ( "fmt" "sort" ) func main() { dna := "" + "CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATG" + "CTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTG" + "AGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGAT" + "GGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT" + "CGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGG" + "TCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA" + "TTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTAT" + "CGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTG" + "TCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGAC" + "GACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT" fmt.Println("SEQUENCE:") le := len(dna) for i := 0; i < le; i += 50 { k := i + 50 if k > le { k = le } fmt.Printf("%5d: %s\n", i, dna[i:k]) } baseMap := make(map[byte]int) for i := 0; i < le; i++ { baseMap[dna[i]]++ } var bases []byte for k := range baseMap { bases = append(bases, k) } sort.Slice(bases, func(i, j int) bool { return bases[i] < bases[j] }) fmt.Println("\nBASE COUNT:") for _, base := range bases { fmt.Printf(" %c: %3d\n", base, baseMap[base]) } fmt.Println(" ------") fmt.Println(" Σ:", le) fmt.Println(" ======") }
from collections import Counter def basecount(dna): return sorted(Counter(dna).items()) def seq_split(dna, n=50): return [dna[i: i+n] for i in range(0, len(dna), n)] def seq_pp(dna, n=50): for i, part in enumerate(seq_split(dna, n)): print(f"{i*n:>5}: {part}") print("\n BASECOUNT:") tot = 0 for base, count in basecount(dna): print(f" {base:>3}: {count}") tot += count base, count = 'TOT', tot print(f" {base:>3}= {count}") if __name__ == '__main__': print("SEQUENCE:") sequence = seq_pp(sequence)
Translate the given Go code snippet into Python without altering its behavior.
package main import ( "fmt" "sort" ) func main() { dna := "" + "CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATG" + "CTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTG" + "AGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGAT" + "GGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT" + "CGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGG" + "TCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA" + "TTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTAT" + "CGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTG" + "TCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGAC" + "GACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT" fmt.Println("SEQUENCE:") le := len(dna) for i := 0; i < le; i += 50 { k := i + 50 if k > le { k = le } fmt.Printf("%5d: %s\n", i, dna[i:k]) } baseMap := make(map[byte]int) for i := 0; i < le; i++ { baseMap[dna[i]]++ } var bases []byte for k := range baseMap { bases = append(bases, k) } sort.Slice(bases, func(i, j int) bool { return bases[i] < bases[j] }) fmt.Println("\nBASE COUNT:") for _, base := range bases { fmt.Printf(" %c: %3d\n", base, baseMap[base]) } fmt.Println(" ------") fmt.Println(" Σ:", le) fmt.Println(" ======") }
from collections import Counter def basecount(dna): return sorted(Counter(dna).items()) def seq_split(dna, n=50): return [dna[i: i+n] for i in range(0, len(dna), n)] def seq_pp(dna, n=50): for i, part in enumerate(seq_split(dna, n)): print(f"{i*n:>5}: {part}") print("\n BASECOUNT:") tot = 0 for base, count in basecount(dna): print(f" {base:>3}: {count}") tot += count base, count = 'TOT', tot print(f" {base:>3}= {count}") if __name__ == '__main__': print("SEQUENCE:") sequence = seq_pp(sequence)
Produce a functionally identical Python code for the snippet given in Go.
package main import ( "hash/fnv" "log" "math/rand" "os" "time" ) var ph = []string{"Aristotle", "Kant", "Spinoza", "Marx", "Russell"} const hunger = 3 const think = time.Second / 100 const eat = time.Second / 100 var fmt = log.New(os.Stdout, "", 0) var done = make(chan bool) type fork byte func philosopher(phName string, dominantHand, otherHand chan fork, done chan bool) { fmt.Println(phName, "seated") h := fnv.New64a() h.Write([]byte(phName)) rg := rand.New(rand.NewSource(int64(h.Sum64()))) rSleep := func(t time.Duration) { time.Sleep(t/2 + time.Duration(rg.Int63n(int64(t)))) } for h := hunger; h > 0; h-- { fmt.Println(phName, "hungry") <-dominantHand <-otherHand fmt.Println(phName, "eating") rSleep(eat) dominantHand <- 'f' otherHand <- 'f' fmt.Println(phName, "thinking") rSleep(think) } fmt.Println(phName, "satisfied") done <- true fmt.Println(phName, "left the table") } func main() { fmt.Println("table empty") place0 := make(chan fork, 1) place0 <- 'f' placeLeft := place0 for i := 1; i < len(ph); i++ { placeRight := make(chan fork, 1) placeRight <- 'f' go philosopher(ph[i], placeLeft, placeRight, done) placeLeft = placeRight } go philosopher(ph[0], place0, placeLeft, done) for range ph { <-done } fmt.Println("table empty") }
import threading import random import time class Philosopher(threading.Thread): running = True def __init__(self, xname, forkOnLeft, forkOnRight): threading.Thread.__init__(self) self.name = xname self.forkOnLeft = forkOnLeft self.forkOnRight = forkOnRight def run(self): while(self.running): time.sleep( random.uniform(3,13)) print '%s is hungry.' % self.name self.dine() def dine(self): fork1, fork2 = self.forkOnLeft, self.forkOnRight while self.running: fork1.acquire(True) locked = fork2.acquire(False) if locked: break fork1.release() print '%s swaps forks' % self.name fork1, fork2 = fork2, fork1 else: return self.dining() fork2.release() fork1.release() def dining(self): print '%s starts eating '% self.name time.sleep(random.uniform(1,10)) print '%s finishes eating and leaves to think.' % self.name def DiningPhilosophers(): forks = [threading.Lock() for n in range(5)] philosopherNames = ('Aristotle','Kant','Spinoza','Marx', 'Russel') philosophers= [Philosopher(philosopherNames[i], forks[i%5], forks[(i+1)%5]) \ for i in range(5)] random.seed(507129) Philosopher.running = True for p in philosophers: p.start() time.sleep(100) Philosopher.running = False print ("Now we're finishing.") DiningPhilosophers()
Write the same code in Python as shown below in Go.
package main import ( "fmt" "strconv" ) func main() { var fact [12]uint64 fact[0] = 1 for n := uint64(1); n < 12; n++ { fact[n] = fact[n-1] * n } for b := 9; b <= 12; b++ { fmt.Printf("The factorions for base %d are:\n", b) for i := uint64(1); i < 1500000; i++ { digits := strconv.FormatUint(i, b) sum := uint64(0) for _, digit := range digits { if digit < 'a' { sum += fact[digit-'0'] } else { sum += fact[digit+10-'a'] } } if sum == i { fmt.Printf("%d ", i) } } fmt.Println("\n") } }
fact = [1] for n in range(1, 12): fact.append(fact[n-1] * n) for b in range(9, 12+1): print(f"The factorions for base {b} are:") for i in range(1, 1500000): fact_sum = 0 j = i while j > 0: d = j % b fact_sum += fact[d] j = j//b if fact_sum == i: print(i, end=" ") print("\n")
Maintain the same structure and functionality when rewriting this code in Python.
package main import ( "fmt" "strconv" ) func main() { var fact [12]uint64 fact[0] = 1 for n := uint64(1); n < 12; n++ { fact[n] = fact[n-1] * n } for b := 9; b <= 12; b++ { fmt.Printf("The factorions for base %d are:\n", b) for i := uint64(1); i < 1500000; i++ { digits := strconv.FormatUint(i, b) sum := uint64(0) for _, digit := range digits { if digit < 'a' { sum += fact[digit-'0'] } else { sum += fact[digit+10-'a'] } } if sum == i { fmt.Printf("%d ", i) } } fmt.Println("\n") } }
fact = [1] for n in range(1, 12): fact.append(fact[n-1] * n) for b in range(9, 12+1): print(f"The factorions for base {b} are:") for i in range(1, 1500000): fact_sum = 0 j = i while j > 0: d = j % b fact_sum += fact[d] j = j//b if fact_sum == i: print(i, end=" ") print("\n")
Generate an equivalent Python version of this Go code.
package main import ( "fmt" "strconv" ) func main() { var fact [12]uint64 fact[0] = 1 for n := uint64(1); n < 12; n++ { fact[n] = fact[n-1] * n } for b := 9; b <= 12; b++ { fmt.Printf("The factorions for base %d are:\n", b) for i := uint64(1); i < 1500000; i++ { digits := strconv.FormatUint(i, b) sum := uint64(0) for _, digit := range digits { if digit < 'a' { sum += fact[digit-'0'] } else { sum += fact[digit+10-'a'] } } if sum == i { fmt.Printf("%d ", i) } } fmt.Println("\n") } }
fact = [1] for n in range(1, 12): fact.append(fact[n-1] * n) for b in range(9, 12+1): print(f"The factorions for base {b} are:") for i in range(1, 1500000): fact_sum = 0 j = i while j > 0: d = j % b fact_sum += fact[d] j = j//b if fact_sum == i: print(i, end=" ") print("\n")
Write a version of this Go function in Python with identical behavior.
package main import ( "fmt" "github.com/maorshutman/lm" "log" "math" ) const ( K = 7_800_000_000 n0 = 27 ) var y = []float64{ 27, 27, 27, 44, 44, 59, 59, 59, 59, 59, 59, 59, 59, 60, 60, 61, 61, 66, 83, 219, 239, 392, 534, 631, 897, 1350, 2023, 2820, 4587, 6067, 7823, 9826, 11946, 14554, 17372, 20615, 24522, 28273, 31491, 34933, 37552, 40540, 43105, 45177, 60328, 64543, 67103, 69265, 71332, 73327, 75191, 75723, 76719, 77804, 78812, 79339, 80132, 80995, 82101, 83365, 85203, 87024, 89068, 90664, 93077, 95316, 98172, 102133, 105824, 109695, 114232, 118610, 125497, 133852, 143227, 151367, 167418, 180096, 194836, 213150, 242364, 271106, 305117, 338133, 377918, 416845, 468049, 527767, 591704, 656866, 715353, 777796, 851308, 928436, 1000249, 1082054, 1174652, } func f(dst, p []float64) { for i := 0; i < len(y); i++ { t := float64(i) dst[i] = (n0*math.Exp(p[0]*t))/(1+n0*(math.Exp(p[0]*t)-1)/K) - y[i] } } func main() { j := lm.NumJac{Func: f} prob := lm.LMProblem{ Dim: 1, Size: len(y), Func: f, Jac: j.Jac, InitParams: []float64{0.5}, Tau: 1e-6, Eps1: 1e-8, Eps2: 1e-8, } res, err := lm.LM(prob, &lm.Settings{Iterations: 100, ObjectiveTol: 1e-16}) if err != nil { log.Fatal(err) } r := res.X[0] fmt.Printf("The logistic curve r for the world data is %.8f\n", r) fmt.Printf("R0 is then approximately equal to %.7f\n", math.Exp(12*r)) }
import numpy as np import scipy.optimize as opt n0, K = 27, 7_800_000_000 def f(t, r): return (n0 * np.exp(r * t)) / (( 1 + n0 * (np.exp(r * t) - 1) / K)) y = [ 27, 27, 27, 44, 44, 59, 59, 59, 59, 59, 59, 59, 59, 60, 60, 61, 61, 66, 83, 219, 239, 392, 534, 631, 897, 1350, 2023, 2820, 4587, 6067, 7823, 9826, 11946, 14554, 17372, 20615, 24522, 28273, 31491, 34933, 37552, 40540, 43105, 45177, 60328, 64543, 67103, 69265, 71332, 73327, 75191, 75723, 76719, 77804, 78812, 79339, 80132, 80995, 82101, 83365, 85203, 87024, 89068, 90664, 93077, 95316, 98172, 102133, 105824, 109695, 114232, 118610, 125497, 133852, 143227, 151367, 167418, 180096, 194836, 213150, 242364, 271106, 305117, 338133, 377918, 416845, 468049, 527767, 591704, 656866, 715353, 777796, 851308, 928436, 1000249, 1082054, 1174652, ] x = np.linspace(0.0, 96, 97) r, cov = opt.curve_fit(f, x, y, [0.5]) print("The r for the world Covid-19 data is:", r, ", with covariance of", cov) print("The calculated R0 is then", np.exp(12 * r))
Keep all operations the same but rewrite the snippet in Python.
package main import "fmt" type link struct { int next *link } func linkInts(s []int) *link { if len(s) == 0 { return nil } return &link{s[0], linkInts(s[1:])} } func (l *link) String() string { if l == nil { return "nil" } r := fmt.Sprintf("[%d", l.int) for l = l.next; l != nil; l = l.next { r = fmt.Sprintf("%s %d", r, l.int) } return r + "]" } func main() { a := linkInts([]int{170, 45, 75, -90, -802, 24, 2, 66}) fmt.Println("before:", a) b := strandSort(a) fmt.Println("after: ", b) } func strandSort(a *link) (result *link) { for a != nil { sublist := a a = a.next sTail := sublist for p, pPrev := a, a; p != nil; p = p.next { if p.int > sTail.int { sTail.next = p sTail = p if p == a { a = p.next } else { pPrev.next = p.next } } else { pPrev = p } } sTail.next = nil if result == nil { result = sublist continue } var m, rr *link if sublist.int < result.int { m = sublist sublist = m.next rr = result } else { m = result rr = m.next } result = m for { if sublist == nil { m.next = rr break } if rr == nil { m.next = sublist break } if sublist.int < rr.int { m.next = sublist m = sublist sublist = m.next } else { m.next = rr m = rr rr = m.next } } } return }
def merge_list(a, b): out = [] while len(a) and len(b): if a[0] < b[0]: out.append(a.pop(0)) else: out.append(b.pop(0)) out += a out += b return out def strand(a): i, s = 0, [a.pop(0)] while i < len(a): if a[i] > s[-1]: s.append(a.pop(i)) else: i += 1 return s def strand_sort(a): out = strand(a) while len(a): out = merge_list(out, strand(a)) return out print strand_sort([1, 6, 3, 2, 1, 7, 5, 3])
Rewrite this program in Python while keeping its functionality equivalent to the Go version.
package main import "fmt" func isPrime(n int) bool { switch { case n < 2: return false case n%2 == 0: return n == 2 case n%3 == 0: return n == 3 default: d := 5 for d*d <= n { if n%d == 0 { return false } d += 2 if n%d == 0 { return false } d += 4 } return true } } func sumDigits(n int) int { sum := 0 for n > 0 { sum += n % 10 n /= 10 } return sum } func main() { fmt.Println("Additive primes less than 500:") i := 2 count := 0 for { if isPrime(i) && isPrime(sumDigits(i)) { count++ fmt.Printf("%3d ", i) if count%10 == 0 { fmt.Println() } } if i > 2 { i += 2 } else { i++ } if i > 499 { break } } fmt.Printf("\n\n%d additive primes found.\n", count) }
def is_prime(n: int) -> bool: if n <= 3: return n > 1 if n % 2 == 0 or n % 3 == 0: return False i = 5 while i ** 2 <= n: if n % i == 0 or n % (i + 2) == 0: return False i += 6 return True def digit_sum(n: int) -> int: sum = 0 while n > 0: sum += n % 10 n //= 10 return sum def main() -> None: additive_primes = 0 for i in range(2, 500): if is_prime(i) and is_prime(digit_sum(i)): additive_primes += 1 print(i, end=" ") print(f"\nFound {additive_primes} additive primes less than 500") if __name__ == "__main__": main()
Can you help me rewrite this code in Python instead of Go, keeping it the same logically?
package main import "fmt" type ibool bool const itrue ibool = true func (ib ibool) iif(cond bool) bool { if cond { return bool(ib) } return bool(!ib) } func main() { var needUmbrella bool raining := true if raining { needUmbrella = true } fmt.Printf("Is it raining? %t. Do I need an umbrella? %t\n", raining, needUmbrella) raining = false needUmbrella = itrue.iif(raining) fmt.Printf("Is it raining? %t. Do I need an umbrella? %t\n", raining, needUmbrella) }
x = truevalue if condition else falsevalue
Translate the given Go code snippet into Python without altering its behavior.
package main import "fmt" type ibool bool const itrue ibool = true func (ib ibool) iif(cond bool) bool { if cond { return bool(ib) } return bool(!ib) } func main() { var needUmbrella bool raining := true if raining { needUmbrella = true } fmt.Printf("Is it raining? %t. Do I need an umbrella? %t\n", raining, needUmbrella) raining = false needUmbrella = itrue.iif(raining) fmt.Printf("Is it raining? %t. Do I need an umbrella? %t\n", raining, needUmbrella) }
x = truevalue if condition else falsevalue
Translate this program into Python but keep the logic exactly as in Go.
package main import "fmt" func gcd(n, k int) int { if n < k || k < 1 { panic("Need n >= k and k >= 1") } s := 1 for n&1 == 0 && k&1 == 0 { n >>= 1 k >>= 1 s <<= 1 } t := n if n&1 != 0 { t = -k } for t != 0 { for t&1 == 0 { t >>= 1 } if t > 0 { n = t } else { k = -t } t = n - k } return n * s } func totient(n int) int { tot := 0 for k := 1; k <= n; k++ { if gcd(n, k) == 1 { tot++ } } return tot } func main() { var perfect []int for n := 1; len(perfect) < 20; n += 2 { tot := n sum := 0 for tot != 1 { tot = totient(tot) sum += tot } if sum == n { perfect = append(perfect, n) } } fmt.Println("The first 20 perfect totient numbers are:") fmt.Println(perfect) }
from math import gcd from functools import lru_cache from itertools import islice, count @lru_cache(maxsize=None) def φ(n): return sum(1 for k in range(1, n + 1) if gcd(n, k) == 1) def perfect_totient(): for n0 in count(1): parts, n = 0, n0 while n != 1: n = φ(n) parts += n if parts == n0: yield n0 if __name__ == '__main__': print(list(islice(perfect_totient(), 20)))
Keep all operations the same but rewrite the snippet in Python.
package main import "fmt" func gcd(n, k int) int { if n < k || k < 1 { panic("Need n >= k and k >= 1") } s := 1 for n&1 == 0 && k&1 == 0 { n >>= 1 k >>= 1 s <<= 1 } t := n if n&1 != 0 { t = -k } for t != 0 { for t&1 == 0 { t >>= 1 } if t > 0 { n = t } else { k = -t } t = n - k } return n * s } func totient(n int) int { tot := 0 for k := 1; k <= n; k++ { if gcd(n, k) == 1 { tot++ } } return tot } func main() { var perfect []int for n := 1; len(perfect) < 20; n += 2 { tot := n sum := 0 for tot != 1 { tot = totient(tot) sum += tot } if sum == n { perfect = append(perfect, n) } } fmt.Println("The first 20 perfect totient numbers are:") fmt.Println(perfect) }
from math import gcd from functools import lru_cache from itertools import islice, count @lru_cache(maxsize=None) def φ(n): return sum(1 for k in range(1, n + 1) if gcd(n, k) == 1) def perfect_totient(): for n0 in count(1): parts, n = 0, n0 while n != 1: n = φ(n) parts += n if parts == n0: yield n0 if __name__ == '__main__': print(list(islice(perfect_totient(), 20)))
Keep all operations the same but rewrite the snippet in Python.
package main import "fmt" type Delegator struct { delegate interface{} } type Thingable interface { thing() string } func (self Delegator) operation() string { if v, ok := self.delegate.(Thingable); ok { return v.thing() } return "default implementation" } type Delegate int func (Delegate) thing() string { return "delegate implementation" } func main() { a := Delegator{} fmt.Println(a.operation()) a.delegate = "A delegate may be any object" fmt.Println(a.operation()) var d Delegate a.delegate = d fmt.Println(a.operation()) }
class Delegator: def __init__(self): self.delegate = None def operation(self): if hasattr(self.delegate, 'thing') and callable(self.delegate.thing): return self.delegate.thing() return 'default implementation' class Delegate: def thing(self): return 'delegate implementation' if __name__ == '__main__': a = Delegator() assert a.operation() == 'default implementation' a.delegate = 'A delegate may be any object' assert a.operation() == 'default implementation' a.delegate = Delegate() assert a.operation() == 'delegate implementation'
Change the programming language of this snippet from Go to Python without modifying what it does.
package main import "fmt" func sumDivisors(n int) int { sum := 0 i := 1 k := 2 if n%2 == 0 { k = 1 } for i*i <= n { if n%i == 0 { sum += i j := n / i if j != i { sum += j } } i += k } return sum } func main() { fmt.Println("The sums of positive divisors for the first 100 positive integers are:") for i := 1; i <= 100; i++ { fmt.Printf("%3d ", sumDivisors(i)) if i%10 == 0 { fmt.Println() } } }
def factorize(n): assert(isinstance(n, int)) if n < 0: n = -n if n < 2: return k = 0 while 0 == n%2: k += 1 n //= 2 if 0 < k: yield (2,k) p = 3 while p*p <= n: k = 0 while 0 == n%p: k += 1 n //= p if 0 < k: yield (p,k) p += 2 if 1 < n: yield (n,1) def sum_of_divisors(n): assert(n != 0) ans = 1 for (p,k) in factorize(n): ans *= (pow(p,k+1) - 1)//(p-1) return ans if __name__ == "__main__": print([sum_of_divisors(n) for n in range(1,101)])
Ensure the translated Python code behaves exactly like the original Go snippet.
package main import "fmt" func sumDivisors(n int) int { sum := 0 i := 1 k := 2 if n%2 == 0 { k = 1 } for i*i <= n { if n%i == 0 { sum += i j := n / i if j != i { sum += j } } i += k } return sum } func main() { fmt.Println("The sums of positive divisors for the first 100 positive integers are:") for i := 1; i <= 100; i++ { fmt.Printf("%3d ", sumDivisors(i)) if i%10 == 0 { fmt.Println() } } }
def factorize(n): assert(isinstance(n, int)) if n < 0: n = -n if n < 2: return k = 0 while 0 == n%2: k += 1 n //= 2 if 0 < k: yield (2,k) p = 3 while p*p <= n: k = 0 while 0 == n%p: k += 1 n //= p if 0 < k: yield (p,k) p += 2 if 1 < n: yield (n,1) def sum_of_divisors(n): assert(n != 0) ans = 1 for (p,k) in factorize(n): ans *= (pow(p,k+1) - 1)//(p-1) return ans if __name__ == "__main__": print([sum_of_divisors(n) for n in range(1,101)])
Write the same algorithm in Python as shown in this Go implementation.
package main import ( "fmt" "strings" ) var table = "Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy " + "COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find " + "NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput " + "Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO " + "MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT " + "READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT " + "RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up " func validate(commands, words []string, minLens []int) []string { results := make([]string, 0) if len(words) == 0 { return results } for _, word := range words { matchFound := false wlen := len(word) for i, command := range commands { if minLens[i] == 0 || wlen < minLens[i] || wlen > len(command) { continue } c := strings.ToUpper(command) w := strings.ToUpper(word) if strings.HasPrefix(c, w) { results = append(results, c) matchFound = true break } } if !matchFound { results = append(results, "*error*") } } return results } func main() { table = strings.TrimSpace(table) commands := strings.Fields(table) clen := len(commands) minLens := make([]int, clen) for i := 0; i < clen; i++ { count := 0 for _, c := range commands[i] { if c >= 'A' && c <= 'Z' { count++ } } minLens[i] = count } sentence := "riG rePEAT copies put mo rest types fup. 6 poweRin" words := strings.Fields(sentence) results := validate(commands, words, minLens) fmt.Print("user words: ") for j := 0; j < len(words); j++ { fmt.Printf("%-*s ", len(results[j]), words[j]) } fmt.Print("\nfull words: ") fmt.Println(strings.Join(results, " ")) }
command_table_text = \ user_words = "riG rePEAT copies put mo rest types fup. 6 poweRin" def find_abbreviations_length(command_table_text): command_table = dict() for word in command_table_text.split(): abbr_len = sum(1 for c in word if c.isupper()) if abbr_len == 0: abbr_len = len(word) command_table[word] = abbr_len return command_table def find_abbreviations(command_table): abbreviations = dict() for command, min_abbr_len in command_table.items(): for l in range(min_abbr_len, len(command)+1): abbr = command[:l].lower() abbreviations[abbr] = command.upper() return abbreviations def parse_user_string(user_string, abbreviations): user_words = [word.lower() for word in user_string.split()] commands = [abbreviations.get(user_word, "*error*") for user_word in user_words] return " ".join(commands) command_table = find_abbreviations_length(command_table_text) abbreviations_table = find_abbreviations(command_table) full_words = parse_user_string(user_words, abbreviations_table) print("user words:", user_words) print("full words:", full_words)
Can you help me rewrite this code in Python instead of Go, keeping it the same logically?
package main import ( "fmt" "strings" ) var table = "Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy " + "COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find " + "NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput " + "Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO " + "MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT " + "READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT " + "RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up " func validate(commands, words []string, minLens []int) []string { results := make([]string, 0) if len(words) == 0 { return results } for _, word := range words { matchFound := false wlen := len(word) for i, command := range commands { if minLens[i] == 0 || wlen < minLens[i] || wlen > len(command) { continue } c := strings.ToUpper(command) w := strings.ToUpper(word) if strings.HasPrefix(c, w) { results = append(results, c) matchFound = true break } } if !matchFound { results = append(results, "*error*") } } return results } func main() { table = strings.TrimSpace(table) commands := strings.Fields(table) clen := len(commands) minLens := make([]int, clen) for i := 0; i < clen; i++ { count := 0 for _, c := range commands[i] { if c >= 'A' && c <= 'Z' { count++ } } minLens[i] = count } sentence := "riG rePEAT copies put mo rest types fup. 6 poweRin" words := strings.Fields(sentence) results := validate(commands, words, minLens) fmt.Print("user words: ") for j := 0; j < len(words); j++ { fmt.Printf("%-*s ", len(results[j]), words[j]) } fmt.Print("\nfull words: ") fmt.Println(strings.Join(results, " ")) }
command_table_text = \ user_words = "riG rePEAT copies put mo rest types fup. 6 poweRin" def find_abbreviations_length(command_table_text): command_table = dict() for word in command_table_text.split(): abbr_len = sum(1 for c in word if c.isupper()) if abbr_len == 0: abbr_len = len(word) command_table[word] = abbr_len return command_table def find_abbreviations(command_table): abbreviations = dict() for command, min_abbr_len in command_table.items(): for l in range(min_abbr_len, len(command)+1): abbr = command[:l].lower() abbreviations[abbr] = command.upper() return abbreviations def parse_user_string(user_string, abbreviations): user_words = [word.lower() for word in user_string.split()] commands = [abbreviations.get(user_word, "*error*") for user_word in user_words] return " ".join(commands) command_table = find_abbreviations_length(command_table_text) abbreviations_table = find_abbreviations(command_table) full_words = parse_user_string(user_words, abbreviations_table) print("user words:", user_words) print("full words:", full_words)
Convert the following code from Go to Python, ensuring the logic remains intact.
package main func main() { s := "immutable" s[0] = 'a' }
>>> s = "Hello" >>> s[0] = "h" Traceback (most recent call last): File "<pyshell s[0] = "h" TypeError: 'str' object does not support item assignment
Port the provided Go code into Python while preserving the original functionality.
package main import "fmt" type point struct { x, y float32 } var subjectPolygon = []point{{50, 150}, {200, 50}, {350, 150}, {350, 300}, {250, 300}, {200, 250}, {150, 350}, {100, 250}, {100, 200}} var clipPolygon = []point{{100, 100}, {300, 100}, {300, 300}, {100, 300}} func main() { var cp1, cp2, s, e point inside := func(p point) bool { return (cp2.x-cp1.x)*(p.y-cp1.y) > (cp2.y-cp1.y)*(p.x-cp1.x) } intersection := func() (p point) { dcx, dcy := cp1.x-cp2.x, cp1.y-cp2.y dpx, dpy := s.x-e.x, s.y-e.y n1 := cp1.x*cp2.y - cp1.y*cp2.x n2 := s.x*e.y - s.y*e.x n3 := 1 / (dcx*dpy - dcy*dpx) p.x = (n1*dpx - n2*dcx) * n3 p.y = (n1*dpy - n2*dcy) * n3 return } outputList := subjectPolygon cp1 = clipPolygon[len(clipPolygon)-1] for _, cp2 = range clipPolygon { inputList := outputList outputList = nil s = inputList[len(inputList)-1] for _, e = range inputList { if inside(e) { if !inside(s) { outputList = append(outputList, intersection()) } outputList = append(outputList, e) } else if inside(s) { outputList = append(outputList, intersection()) } s = e } cp1 = cp2 } fmt.Println(outputList) }
def clip(subjectPolygon, clipPolygon): def inside(p): return(cp2[0]-cp1[0])*(p[1]-cp1[1]) > (cp2[1]-cp1[1])*(p[0]-cp1[0]) def computeIntersection(): dc = [ cp1[0] - cp2[0], cp1[1] - cp2[1] ] dp = [ s[0] - e[0], s[1] - e[1] ] n1 = cp1[0] * cp2[1] - cp1[1] * cp2[0] n2 = s[0] * e[1] - s[1] * e[0] n3 = 1.0 / (dc[0] * dp[1] - dc[1] * dp[0]) return [(n1*dp[0] - n2*dc[0]) * n3, (n1*dp[1] - n2*dc[1]) * n3] outputList = subjectPolygon cp1 = clipPolygon[-1] for clipVertex in clipPolygon: cp2 = clipVertex inputList = outputList outputList = [] s = inputList[-1] for subjectVertex in inputList: e = subjectVertex if inside(e): if not inside(s): outputList.append(computeIntersection()) outputList.append(e) elif inside(s): outputList.append(computeIntersection()) s = e cp1 = cp2 return(outputList)
Convert this Go snippet to Python and keep its semantics consistent.
package main import( "fmt" "strings" ) var codes = map[rune]string { 'a' : "AAAAA", 'b' : "AAAAB", 'c' : "AAABA", 'd' : "AAABB", 'e' : "AABAA", 'f' : "AABAB", 'g' : "AABBA", 'h' : "AABBB", 'i' : "ABAAA", 'j' : "ABAAB", 'k' : "ABABA", 'l' : "ABABB", 'm' : "ABBAA", 'n' : "ABBAB", 'o' : "ABBBA", 'p' : "ABBBB", 'q' : "BAAAA", 'r' : "BAAAB", 's' : "BAABA", 't' : "BAABB", 'u' : "BABAA", 'v' : "BABAB", 'w' : "BABBA", 'x' : "BABBB", 'y' : "BBAAA", 'z' : "BBAAB", ' ' : "BBBAA", } func baconEncode(plainText string, message string) string { pt := strings.ToLower(plainText) var sb []byte for _, c := range pt { if c >= 'a' && c <= 'z' { sb = append(sb, codes[c]...) } else { sb = append(sb, codes[' ']...) } } et := string(sb) mg := strings.ToLower(message) sb = nil var count = 0 for _, c := range mg { if c >= 'a' && c <= 'z' { if et[count] == 'A' { sb = append(sb, byte(c)) } else { sb = append(sb, byte(c - 32)) } count++ if count == len(et) { break } } else { sb = append(sb, byte(c)) } } return string(sb) } func baconDecode(message string) string { var sb []byte for _, c := range message { if c >= 'a' && c <= 'z' { sb = append(sb, 'A') } else if c >= 'A' && c <= 'Z' { sb = append(sb, 'B') } } et := string(sb) sb = nil for i := 0; i < len(et); i += 5 { quintet := et[i : i + 5] for k, v := range codes { if v == quintet { sb = append(sb, byte(k)) break } } } return string(sb) } func main() { plainText := "the quick brown fox jumps over the lazy dog" message := "bacon's cipher is a method of steganography created by francis bacon." + "this task is to implement a program for encryption and decryption of " + "plaintext using the simple alphabet of the baconian cipher or some " + "other kind of representation of this alphabet (make anything signify anything). " + "the baconian alphabet may optionally be extended to encode all lower " + "case characters individually and/or adding a few punctuation characters " + "such as the space." cipherText := baconEncode(plainText, message) fmt.Printf("Cipher text ->\n\n%s\n", cipherText) decodedText := baconDecode(cipherText) fmt.Printf("\nHidden text ->\n\n%s\n", decodedText) }
import string sometext = .lower() lc2bin = {ch: '{:05b}'.format(i) for i, ch in enumerate(string.ascii_lowercase + ' .')} bin2lc = {val: key for key, val in lc2bin.items()} phrase = 'Rosetta code Bacon cipher example secret phrase to encode in the capitalisation of peter pan'.lower() def to_5binary(msg): return ( ch == '1' for ch in ''.join(lc2bin.get(ch, '') for ch in msg.lower())) def encrypt(message, text): bin5 = to_5binary(message) textlist = list(text.lower()) out = [] for capitalise in bin5: while textlist: ch = textlist.pop(0) if ch.isalpha(): if capitalise: ch = ch.upper() out.append(ch) break else: out.append(ch) else: raise Exception('ERROR: Ran out of characters in sometext') return ''.join(out) + '...' def decrypt(bacontext): binary = [] bin5 = [] out = [] for ch in bacontext: if ch.isalpha(): binary.append('1' if ch.isupper() else '0') if len(binary) == 5: bin5 = ''.join(binary) out.append(bin2lc[bin5]) binary = [] return ''.join(out) print('PLAINTEXT = \n%s\n' % phrase) encrypted = encrypt(phrase, sometext) print('ENCRYPTED = \n%s\n' % encrypted) decrypted = decrypt(encrypted) print('DECRYPTED = \n%s\n' % decrypted) assert phrase == decrypted, 'Round-tripping error'
Write a version of this Go function in Python with identical behavior.
package main import( "fmt" "strings" ) var codes = map[rune]string { 'a' : "AAAAA", 'b' : "AAAAB", 'c' : "AAABA", 'd' : "AAABB", 'e' : "AABAA", 'f' : "AABAB", 'g' : "AABBA", 'h' : "AABBB", 'i' : "ABAAA", 'j' : "ABAAB", 'k' : "ABABA", 'l' : "ABABB", 'm' : "ABBAA", 'n' : "ABBAB", 'o' : "ABBBA", 'p' : "ABBBB", 'q' : "BAAAA", 'r' : "BAAAB", 's' : "BAABA", 't' : "BAABB", 'u' : "BABAA", 'v' : "BABAB", 'w' : "BABBA", 'x' : "BABBB", 'y' : "BBAAA", 'z' : "BBAAB", ' ' : "BBBAA", } func baconEncode(plainText string, message string) string { pt := strings.ToLower(plainText) var sb []byte for _, c := range pt { if c >= 'a' && c <= 'z' { sb = append(sb, codes[c]...) } else { sb = append(sb, codes[' ']...) } } et := string(sb) mg := strings.ToLower(message) sb = nil var count = 0 for _, c := range mg { if c >= 'a' && c <= 'z' { if et[count] == 'A' { sb = append(sb, byte(c)) } else { sb = append(sb, byte(c - 32)) } count++ if count == len(et) { break } } else { sb = append(sb, byte(c)) } } return string(sb) } func baconDecode(message string) string { var sb []byte for _, c := range message { if c >= 'a' && c <= 'z' { sb = append(sb, 'A') } else if c >= 'A' && c <= 'Z' { sb = append(sb, 'B') } } et := string(sb) sb = nil for i := 0; i < len(et); i += 5 { quintet := et[i : i + 5] for k, v := range codes { if v == quintet { sb = append(sb, byte(k)) break } } } return string(sb) } func main() { plainText := "the quick brown fox jumps over the lazy dog" message := "bacon's cipher is a method of steganography created by francis bacon." + "this task is to implement a program for encryption and decryption of " + "plaintext using the simple alphabet of the baconian cipher or some " + "other kind of representation of this alphabet (make anything signify anything). " + "the baconian alphabet may optionally be extended to encode all lower " + "case characters individually and/or adding a few punctuation characters " + "such as the space." cipherText := baconEncode(plainText, message) fmt.Printf("Cipher text ->\n\n%s\n", cipherText) decodedText := baconDecode(cipherText) fmt.Printf("\nHidden text ->\n\n%s\n", decodedText) }
import string sometext = .lower() lc2bin = {ch: '{:05b}'.format(i) for i, ch in enumerate(string.ascii_lowercase + ' .')} bin2lc = {val: key for key, val in lc2bin.items()} phrase = 'Rosetta code Bacon cipher example secret phrase to encode in the capitalisation of peter pan'.lower() def to_5binary(msg): return ( ch == '1' for ch in ''.join(lc2bin.get(ch, '') for ch in msg.lower())) def encrypt(message, text): bin5 = to_5binary(message) textlist = list(text.lower()) out = [] for capitalise in bin5: while textlist: ch = textlist.pop(0) if ch.isalpha(): if capitalise: ch = ch.upper() out.append(ch) break else: out.append(ch) else: raise Exception('ERROR: Ran out of characters in sometext') return ''.join(out) + '...' def decrypt(bacontext): binary = [] bin5 = [] out = [] for ch in bacontext: if ch.isalpha(): binary.append('1' if ch.isupper() else '0') if len(binary) == 5: bin5 = ''.join(binary) out.append(bin2lc[bin5]) binary = [] return ''.join(out) print('PLAINTEXT = \n%s\n' % phrase) encrypted = encrypt(phrase, sometext) print('ENCRYPTED = \n%s\n' % encrypted) decrypted = decrypt(encrypted) print('DECRYPTED = \n%s\n' % decrypted) assert phrase == decrypted, 'Round-tripping error'
Produce a language-to-language conversion: from Go to Python, same semantics.
package main import ( "fmt" "strconv" ) var n = 5 func main() { if n < 1 { return } top, left, bottom, right := 0, 0, n-1, n-1 sz := n * n a := make([]int, sz) i := 0 for left < right { for c := left; c <= right; c++ { a[top*n+c] = i i++ } top++ for r := top; r <= bottom; r++ { a[r*n+right] = i i++ } right-- if top == bottom { break } for c := right; c >= left; c-- { a[bottom*n+c] = i i++ } bottom-- for r := bottom; r >= top; r-- { a[r*n+left] = i i++ } left++ } a[top*n+left] = i w := len(strconv.Itoa(n*n - 1)) for i, e := range a { fmt.Printf("%*d ", w, e) if i%n == n-1 { fmt.Println("") } } }
def spiral(n): dx,dy = 1,0 x,y = 0,0 myarray = [[None]* n for j in range(n)] for i in xrange(n**2): myarray[x][y] = i nx,ny = x+dx, y+dy if 0<=nx<n and 0<=ny<n and myarray[nx][ny] == None: x,y = nx,ny else: dx,dy = -dy,dx x,y = x+dx, y+dy return myarray def printspiral(myarray): n = range(len(myarray)) for y in n: for x in n: print "%2i" % myarray[x][y], print printspiral(spiral(5))
Change the following Go code into Python without altering its purpose.
type cell string type spec struct { less func(cell, cell) bool column int reverse bool } func newSpec() (s spec) { return } t.sort(newSpec()) s := newSpec s.reverse = true t.sort(s)
>>> def printtable(data): for row in data: print ' '.join('%-5s' % ('"%s"' % cell) for cell in row) >>> import operator >>> def sorttable(table, ordering=None, column=0, reverse=False): return sorted(table, cmp=ordering, key=operator.itemgetter(column), reverse=reverse) >>> data = [["a", "b", "c"], ["", "q", "z"], ["zap", "zip", "Zot"]] >>> printtable(data) "a" "b" "c" "" "q" "z" "zap" "zip" "Zot" >>> printtable( sorttable(data) ) "" "q" "z" "a" "b" "c" "zap" "zip" "Zot" >>> printtable( sorttable(data, column=2) ) "zap" "zip" "Zot" "a" "b" "c" "" "q" "z" >>> printtable( sorttable(data, column=1) ) "a" "b" "c" "" "q" "z" "zap" "zip" "Zot" >>> printtable( sorttable(data, column=1, reverse=True) ) "zap" "zip" "Zot" "" "q" "z" "a" "b" "c" >>> printtable( sorttable(data, ordering=lambda a,b: cmp(len(b),len(a))) ) "zap" "zip" "Zot" "a" "b" "c" "" "q" "z" >>>
Keep all operations the same but rewrite the snippet in Python.
package main import ( "fmt" "image" "image/color" "image/draw" "image/png" "math/rand" "os" "time" ) const ( imageWidth = 300 imageHeight = 200 nSites = 10 ) func main() { writePngFile(generateVoronoi(randomSites())) } func generateVoronoi(sx, sy []int) image.Image { sc := make([]color.NRGBA, nSites) for i := range sx { sc[i] = color.NRGBA{uint8(rand.Intn(256)), uint8(rand.Intn(256)), uint8(rand.Intn(256)), 255} } img := image.NewNRGBA(image.Rect(0, 0, imageWidth, imageHeight)) for x := 0; x < imageWidth; x++ { for y := 0; y < imageHeight; y++ { dMin := dot(imageWidth, imageHeight) var sMin int for s := 0; s < nSites; s++ { if d := dot(sx[s]-x, sy[s]-y); d < dMin { sMin = s dMin = d } } img.SetNRGBA(x, y, sc[sMin]) } } black := image.NewUniform(color.Black) for s := 0; s < nSites; s++ { draw.Draw(img, image.Rect(sx[s]-2, sy[s]-2, sx[s]+2, sy[s]+2), black, image.ZP, draw.Src) } return img } func dot(x, y int) int { return x*x + y*y } func randomSites() (sx, sy []int) { rand.Seed(time.Now().Unix()) sx = make([]int, nSites) sy = make([]int, nSites) for i := range sx { sx[i] = rand.Intn(imageWidth) sy[i] = rand.Intn(imageHeight) } return } func writePngFile(img image.Image) { f, err := os.Create("voronoi.png") if err != nil { fmt.Println(err) return } if err = png.Encode(f, img); err != nil { fmt.Println(err) } if err = f.Close(); err != nil { fmt.Println(err) } }
def setup(): size(500, 500) generate_voronoi_diagram(width, height, 25) saveFrame("VoronoiDiagram.png") def generate_voronoi_diagram(w, h, num_cells): nx, ny, nr, ng, nb = [], [], [], [], [] for i in range(num_cells): nx.append(int(random(w))) ny.append(int(random(h))) nr.append(int(random(256))) ng.append(int(random(256))) nb.append(int(random(256))) for y in range(h): for x in range(w): dmin = dist(0, 0, w - 1, h - 1) j = -1 for i in range(num_cells): d = dist(0, 0, nx[i] - x, ny[i] - y) if d < dmin: dmin = d j = i set(x, y, color(nr[j], ng[j], nb[j]))
Keep all operations the same but rewrite the snippet in Python.
package main import ( "fmt" "image" "image/color" "image/draw" "image/png" "math/rand" "os" "time" ) const ( imageWidth = 300 imageHeight = 200 nSites = 10 ) func main() { writePngFile(generateVoronoi(randomSites())) } func generateVoronoi(sx, sy []int) image.Image { sc := make([]color.NRGBA, nSites) for i := range sx { sc[i] = color.NRGBA{uint8(rand.Intn(256)), uint8(rand.Intn(256)), uint8(rand.Intn(256)), 255} } img := image.NewNRGBA(image.Rect(0, 0, imageWidth, imageHeight)) for x := 0; x < imageWidth; x++ { for y := 0; y < imageHeight; y++ { dMin := dot(imageWidth, imageHeight) var sMin int for s := 0; s < nSites; s++ { if d := dot(sx[s]-x, sy[s]-y); d < dMin { sMin = s dMin = d } } img.SetNRGBA(x, y, sc[sMin]) } } black := image.NewUniform(color.Black) for s := 0; s < nSites; s++ { draw.Draw(img, image.Rect(sx[s]-2, sy[s]-2, sx[s]+2, sy[s]+2), black, image.ZP, draw.Src) } return img } func dot(x, y int) int { return x*x + y*y } func randomSites() (sx, sy []int) { rand.Seed(time.Now().Unix()) sx = make([]int, nSites) sy = make([]int, nSites) for i := range sx { sx[i] = rand.Intn(imageWidth) sy[i] = rand.Intn(imageHeight) } return } func writePngFile(img image.Image) { f, err := os.Create("voronoi.png") if err != nil { fmt.Println(err) return } if err = png.Encode(f, img); err != nil { fmt.Println(err) } if err = f.Close(); err != nil { fmt.Println(err) } }
def setup(): size(500, 500) generate_voronoi_diagram(width, height, 25) saveFrame("VoronoiDiagram.png") def generate_voronoi_diagram(w, h, num_cells): nx, ny, nr, ng, nb = [], [], [], [], [] for i in range(num_cells): nx.append(int(random(w))) ny.append(int(random(h))) nr.append(int(random(256))) ng.append(int(random(256))) nb.append(int(random(256))) for y in range(h): for x in range(w): dmin = dist(0, 0, w - 1, h - 1) j = -1 for i in range(num_cells): d = dist(0, 0, nx[i] - x, ny[i] - y) if d < dmin: dmin = d j = i set(x, y, color(nr[j], ng[j], nb[j]))
Ensure the translated Python code behaves exactly like the original Go snippet.
package main import "C" import ( "fmt" "unsafe" ) func main() { go1 := "hello C" c1 := C.CString(go1) go1 = "" c2 := C.strdup(c1) C.free(unsafe.Pointer(c1)) go2 := C.GoString(c2) C.free(unsafe.Pointer(c2)) fmt.Println(go2) }
import ctypes libc = ctypes.CDLL("/lib/libc.so.6") libc.strcmp("abc", "def") libc.strcmp("hello", "hello")
Produce a functionally identical Python code for the snippet given in Go.
package main import ( "fmt" "math/rand" "time" ) func sOfNCreator(n int) func(byte) []byte { s := make([]byte, 0, n) m := n return func(item byte) []byte { if len(s) < n { s = append(s, item) } else { m++ if rand.Intn(m) < n { s[rand.Intn(n)] = item } } return s } } func main() { rand.Seed(time.Now().UnixNano()) var freq [10]int for r := 0; r < 1e5; r++ { sOfN := sOfNCreator(3) for d := byte('0'); d < '9'; d++ { sOfN(d) } for _, d := range sOfN('9') { freq[d-'0']++ } } fmt.Println(freq) }
from random import randrange def s_of_n_creator(n): sample, i = [], 0 def s_of_n(item): nonlocal i i += 1 if i <= n: sample.append(item) elif randrange(i) < n: sample[randrange(n)] = item return sample return s_of_n if __name__ == '__main__': bin = [0]* 10 items = range(10) print("Single run samples for n = 3:") s_of_n = s_of_n_creator(3) for item in items: sample = s_of_n(item) print(" Item: %i -> sample: %s" % (item, sample)) for trial in range(100000): s_of_n = s_of_n_creator(3) for item in items: sample = s_of_n(item) for s in sample: bin[s] += 1 print("\nTest item frequencies for 100000 runs:\n ", '\n '.join("%i:%i" % x for x in enumerate(bin)))
Ensure the translated Python code behaves exactly like the original Go snippet.
package main import ( "fmt" "math/rand" "time" ) func sOfNCreator(n int) func(byte) []byte { s := make([]byte, 0, n) m := n return func(item byte) []byte { if len(s) < n { s = append(s, item) } else { m++ if rand.Intn(m) < n { s[rand.Intn(n)] = item } } return s } } func main() { rand.Seed(time.Now().UnixNano()) var freq [10]int for r := 0; r < 1e5; r++ { sOfN := sOfNCreator(3) for d := byte('0'); d < '9'; d++ { sOfN(d) } for _, d := range sOfN('9') { freq[d-'0']++ } } fmt.Println(freq) }
from random import randrange def s_of_n_creator(n): sample, i = [], 0 def s_of_n(item): nonlocal i i += 1 if i <= n: sample.append(item) elif randrange(i) < n: sample[randrange(n)] = item return sample return s_of_n if __name__ == '__main__': bin = [0]* 10 items = range(10) print("Single run samples for n = 3:") s_of_n = s_of_n_creator(3) for item in items: sample = s_of_n(item) print(" Item: %i -> sample: %s" % (item, sample)) for trial in range(100000): s_of_n = s_of_n_creator(3) for item in items: sample = s_of_n(item) for s in sample: bin[s] += 1 print("\nTest item frequencies for 100000 runs:\n ", '\n '.join("%i:%i" % x for x in enumerate(bin)))
Produce a language-to-language conversion: from Go to Python, same semantics.
package main import ( "fmt" "math/big" ) func bernoulli(n uint) *big.Rat { a := make([]big.Rat, n+1) z := new(big.Rat) for m := range a { a[m].SetFrac64(1, int64(m+1)) for j := m; j >= 1; j-- { d := &a[j-1] d.Mul(z.SetInt64(int64(j)), d.Sub(d, &a[j])) } } if n != 1 { return &a[0] } a[0].Neg(&a[0]) return &a[0] } func binomial(n, k int) int64 { if n <= 0 || k <= 0 || n < k { return 1 } var num, den int64 = 1, 1 for i := k + 1; i <= n; i++ { num *= int64(i) } for i := 2; i <= n-k; i++ { den *= int64(i) } return num / den } func faulhaberTriangle(p int) []big.Rat { coeffs := make([]big.Rat, p+1) q := big.NewRat(1, int64(p)+1) t := new(big.Rat) u := new(big.Rat) sign := -1 for j := range coeffs { sign *= -1 d := &coeffs[p-j] t.SetInt64(int64(sign)) u.SetInt64(binomial(p+1, j)) d.Mul(q, t) d.Mul(d, u) d.Mul(d, bernoulli(uint(j))) } return coeffs } func main() { for i := 0; i < 10; i++ { coeffs := faulhaberTriangle(i) for _, coeff := range coeffs { fmt.Printf("%5s ", coeff.RatString()) } fmt.Println() } fmt.Println() k := 17 cc := faulhaberTriangle(k) n := int64(1000) nn := big.NewRat(n, 1) np := big.NewRat(1, 1) sum := new(big.Rat) tmp := new(big.Rat) for _, c := range cc { np.Mul(np, nn) tmp.Set(np) tmp.Mul(tmp, &c) sum.Add(sum, tmp) } fmt.Println(sum.RatString()) }
from itertools import accumulate, chain, count, islice from fractions import Fraction def faulhaberTriangle(m): def go(rs, n): def f(x, y): return Fraction(n, x) * y xs = list(map(f, islice(count(2), m), rs)) return [Fraction(1 - sum(xs), 1)] + xs return list(accumulate( [[]] + list(islice(count(0), 1 + m)), go ))[1:] def faulhaberSum(p, n): def go(x, y): return y * (n ** x) return sum( map(go, count(1), faulhaberTriangle(p)[-1]) ) def main(): fs = faulhaberTriangle(9) print( fTable(__doc__ + ':\n')(str)( compose(concat)( fmap(showRatio(3)(3)) ) )( index(fs) )(range(0, len(fs))) ) print('') print( faulhaberSum(17, 1000) ) def fTable(s): def gox(xShow): def gofx(fxShow): def gof(f): def goxs(xs): ys = [xShow(x) for x in xs] w = max(map(len, ys)) def arrowed(x, y): return y.rjust(w, ' ') + ' -> ' + ( fxShow(f(x)) ) return s + '\n' + '\n'.join( map(arrowed, xs, ys) ) return goxs return gof return gofx return gox def compose(g): return lambda f: lambda x: g(f(x)) def concat(xs): def f(ys): zs = list(chain(*ys)) return ''.join(zs) if isinstance(ys[0], str) else zs return ( f(xs) if isinstance(xs, list) else ( chain.from_iterable(xs) ) ) if xs else [] def fmap(f): def go(xs): return list(map(f, xs)) return go def index(xs): return lambda n: None if 0 > n else ( xs[n] if ( hasattr(xs, "__getitem__") ) else next(islice(xs, n, None)) ) def showRatio(m): def go(n): def f(r): d = r.denominator return str(r.numerator).rjust(m, ' ') + ( ('/' + str(d).ljust(n, ' ')) if 1 != d else ( ' ' * (1 + n) ) ) return f return go if __name__ == '__main__': main()
Port the following code from Go to Python with equivalent syntax and logic.
package main import ( "fmt" "os" ) func main() { for i, x := range os.Args[1:] { fmt.Printf("the argument #%d is %s\n", i, x) } }
import sys program_name = sys.argv[0] arguments = sys.argv[1:] count = len(arguments)
Convert this Go snippet to Python and keep its semantics consistent.
package main import ( "fmt" "os" ) func main() { for i, x := range os.Args[1:] { fmt.Printf("the argument #%d is %s\n", i, x) } }
import sys program_name = sys.argv[0] arguments = sys.argv[1:] count = len(arguments)
Write the same algorithm in Python as shown in this Go implementation.
package main import ( "bytes" "fmt" "io/ioutil" "log" "sort" "strings" ) func main() { b, err := ioutil.ReadFile("unixdict.txt") if err != nil { log.Fatal("Error reading file") } letters := "deegklnow" wordsAll := bytes.Split(b, []byte{'\n'}) var words [][]byte for _, word := range wordsAll { word = bytes.TrimSpace(word) le := len(word) if le > 2 && le < 10 { words = append(words, word) } } var found []string for _, word := range words { le := len(word) if bytes.IndexByte(word, 'k') >= 0 { lets := letters ok := true for i := 0; i < le; i++ { c := word[i] ix := sort.Search(len(lets), func(i int) bool { return lets[i] >= c }) if ix < len(lets) && lets[ix] == c { lets = lets[0:ix] + lets[ix+1:] } else { ok = false break } } if ok { found = append(found, string(word)) } } } fmt.Println("The following", len(found), "words are the solutions to the puzzle:") fmt.Println(strings.Join(found, "\n")) mostFound := 0 var mostWords9 []string var mostLetters []byte var words9 [][]byte for _, word := range words { if len(word) == 9 { words9 = append(words9, word) } } for _, word9 := range words9 { letterBytes := make([]byte, len(word9)) copy(letterBytes, word9) sort.Slice(letterBytes, func(i, j int) bool { return letterBytes[i] < letterBytes[j] }) distinctBytes := []byte{letterBytes[0]} for _, b := range letterBytes[1:] { if b != distinctBytes[len(distinctBytes)-1] { distinctBytes = append(distinctBytes, b) } } distinctLetters := string(distinctBytes) for _, letter := range distinctLetters { found := 0 letterByte := byte(letter) for _, word := range words { le := len(word) if bytes.IndexByte(word, letterByte) >= 0 { lets := string(letterBytes) ok := true for i := 0; i < le; i++ { c := word[i] ix := sort.Search(len(lets), func(i int) bool { return lets[i] >= c }) if ix < len(lets) && lets[ix] == c { lets = lets[0:ix] + lets[ix+1:] } else { ok = false break } } if ok { found = found + 1 } } } if found > mostFound { mostFound = found mostWords9 = []string{string(word9)} mostLetters = []byte{letterByte} } else if found == mostFound { mostWords9 = append(mostWords9, string(word9)) mostLetters = append(mostLetters, letterByte) } } } fmt.Println("\nMost words found =", mostFound) fmt.Println("Nine letter words producing this total:") for i := 0; i < len(mostWords9); i++ { fmt.Println(mostWords9[i], "with central letter", string(mostLetters[i])) } }
import urllib.request from collections import Counter GRID = def getwords(url='http://wiki.puzzlers.org/pub/wordlists/unixdict.txt'): "Return lowercased words of 3 to 9 characters" words = urllib.request.urlopen(url).read().decode().strip().lower().split() return (w for w in words if 2 < len(w) < 10) def solve(grid, dictionary): gridcount = Counter(grid) mid = grid[4] return [word for word in dictionary if mid in word and not (Counter(word) - gridcount)] if __name__ == '__main__': chars = ''.join(GRID.strip().lower().split()) found = solve(chars, dictionary=getwords()) print('\n'.join(found))
Write the same algorithm in Python as shown in this Go implementation.
package main import "fmt" func main() { a := []int{1, 2, 3} b := []int{7, 12, 60} c := append(a, b...) fmt.Println(c) i := []interface{}{1, 2, 3} j := []interface{}{"Crosby", "Stills", "Nash", "Young"} k := append(i, j...) fmt.Println(k) l := [...]int{1, 2, 3} m := [...]int{7, 12, 60} var n [len(l) + len(m)]int copy(n[:], l[:]) copy(n[len(l):], m[:]) fmt.Println(n) }
arr1 = [1, 2, 3] arr2 = [4, 5, 6] arr3 = [7, 8, 9] arr4 = arr1 + arr2 assert arr4 == [1, 2, 3, 4, 5, 6] arr4.extend(arr3) assert arr4 == [1, 2, 3, 4, 5, 6, 7, 8, 9]
Please provide an equivalent version of this Go code in Python.
package main import "fmt" func main() { var s string var i int if _, err := fmt.Scan(&s, &i); err == nil && i == 75000 { fmt.Println("good") } else { fmt.Println("wrong") } }
string = raw_input("Input a string: ")
Produce a functionally identical Python code for the snippet given in Go.
package main import ( "encoding/binary" "log" "math" "os" "strings" ) func main() { const ( sampleRate = 44100 duration = 8 dataLength = sampleRate * duration hdrSize = 44 fileLen = dataLength + hdrSize - 8 ) buf1 := make([]byte, 1) buf2 := make([]byte, 2) buf4 := make([]byte, 4) var sb strings.Builder sb.WriteString("RIFF") binary.LittleEndian.PutUint32(buf4, fileLen) sb.Write(buf4) sb.WriteString("WAVE") sb.WriteString("fmt ") binary.LittleEndian.PutUint32(buf4, 16) sb.Write(buf4) binary.LittleEndian.PutUint16(buf2, 1) sb.Write(buf2) sb.Write(buf2) binary.LittleEndian.PutUint32(buf4, sampleRate) sb.Write(buf4) sb.Write(buf4) sb.Write(buf2) binary.LittleEndian.PutUint16(buf2, 8) sb.Write(buf2) sb.WriteString("data") binary.LittleEndian.PutUint32(buf4, dataLength) sb.Write(buf4) wavhdr := []byte(sb.String()) f, err := os.Create("notes.wav") if err != nil { log.Fatal(err) } defer f.Close() f.Write(wavhdr) freqs := [8]float64{261.6, 293.6, 329.6, 349.2, 392.0, 440.0, 493.9, 523.3} for j := 0; j < duration; j++ { freq := freqs[j] omega := 2 * math.Pi * freq for i := 0; i < dataLength/duration; i++ { y := 32 * math.Sin(omega*float64(i)/float64(sampleRate)) buf1[0] = byte(math.Round(y)) f.Write(buf1) } } }
>>> import winsound >>> for note in [261.63, 293.66, 329.63, 349.23, 392.00, 440.00, 493.88, 523.25]: winsound.Beep(int(note+.5), 500) >>>