Instruction
stringlengths
45
106
input_code
stringlengths
1
13.7k
output_code
stringlengths
1
13.7k
Transform the following Java implementation into VB, maintaining the same output and logic.
import java.io.File; public class MainEntry { public static void main(String[] args) { walkin(new File("/home/user")); } public static void walkin(File dir) { String pattern = ".mp3"; File listFile[] = dir.listFiles(); if (listFile != null) { for (int i=0; i<listFile.length; i++) { if (listFile[i].isDirectory()) { walkin(listFile[i]); } else { if (listFile[i].getName().endsWith(pattern)) { System.out.println(listFile[i].getPath()); } } } } } }
Sub printFiles(parentDir As FolderItem, pattern As String) For i As Integer = 1 To parentDir.Count If parentDir.Item(i).Directory Then printFiles(parentDir.Item(i), pattern) Else Dim rg as New RegEx Dim myMatch as RegExMatch rg.SearchPattern = pattern myMatch = rg.search(parentDir.Item(i).Name) If myMatch <> Nil Then Print(parentDir.Item(i).AbsolutePath) End If Next End Sub
Generate an equivalent VB version of this Java code.
import java.util.zip.* ; public class CRCMaker { public static void main( String[ ] args ) { String toBeEncoded = new String( "The quick brown fox jumps over the lazy dog" ) ; CRC32 myCRC = new CRC32( ) ; myCRC.update( toBeEncoded.getBytes( ) ) ; System.out.println( "The CRC-32 value is : " + Long.toHexString( myCRC.getValue( ) ) + " !" ) ; } }
dim crctbl(255) const crcc =&hEDB88320 sub gencrctable for i= 0 to 255 k=i for j=1 to 8 if k and 1 then k=(k and &h7fffffff)\2 or (&h40000000 and ((k and &h80000000)<>0)) k=k xor crcc else k=(k and &h7fffffff)\2 or (&h40000000 and ((k and &h80000000)<>0)) end if next crctbl(i)=k next end sub function crc32 (buf) dim r,r1,i r=&hffffffff for i=1 to len(buf) r1=(r and &h7fffffff)\&h100 or (&h800000 and (r and &h80000000)<>0) r=r1 xor crctbl((asc(mid(buf,i,1))xor r) and 255) next crc32=r xor &hffffffff end function gencrctable wscript.stdout.writeline hex(crc32("The quick brown fox jumps over the lazy dog"))
Translate the given Java code snippet into VB without altering its behavior.
grammar csv2html; dialog : {System.out.println("<HTML><Table>");}header body+{System.out.println("</Table></HTML>");} ; header : {System.out.println("<THEAD align=\"center\"><TR bgcolor=\"blue\">");}row{System.out.println("</TR></THEAD");}; body : {System.out.println("<TBODY><TR>");}row{System.out.println("</TR></TBODY");}; row : field ',' field '\r'? '\n'; field : Field{System.out.println("<TD>" + $Field.text.replace("<","&lt;").replace(">","&gt;") + "</TD>");}; Field : ~[,\n\r]+;
Public Sub CSV_TO_HTML() input_ = "Character,Speech\n" & _ "The multitude,The messiah! Show us the messiah!\n" & _ "Brians mother,<angry>Now you listen here! He "he "The multitude,Who are you?\n" & _ "Brians mother,I "The multitude,Behold his mother! Behold his mother!" Debug.Print "<table>" & vbCrLf & "<tr><td>" For i = 1 To Len(input_) Select Case Mid(input_, i, 1) Case "\" If Mid(input_, i + 1, 1) = "n" Then Debug.Print "</td></tr>" & vbCrLf & "<tr><td>"; i = i + 1 Else Debug.Print Mid(input_, i, 1); End If Case ",": Debug.Print "</td><td>"; Case "<": Debug.Print "&lt;"; Case ">": Debug.Print "&gt;"; Case "&": Debug.Print "&amp;"; Case Else: Debug.Print Mid(input_, i, 1); End Select Next i Debug.Print "</td></tr>" & vbCrLf & "</table>" End Sub
Rewrite this program in VB while keeping its functionality equivalent to the Java version.
grammar csv2html; dialog : {System.out.println("<HTML><Table>");}header body+{System.out.println("</Table></HTML>");} ; header : {System.out.println("<THEAD align=\"center\"><TR bgcolor=\"blue\">");}row{System.out.println("</TR></THEAD");}; body : {System.out.println("<TBODY><TR>");}row{System.out.println("</TR></TBODY");}; row : field ',' field '\r'? '\n'; field : Field{System.out.println("<TD>" + $Field.text.replace("<","&lt;").replace(">","&gt;") + "</TD>");}; Field : ~[,\n\r]+;
Public Sub CSV_TO_HTML() input_ = "Character,Speech\n" & _ "The multitude,The messiah! Show us the messiah!\n" & _ "Brians mother,<angry>Now you listen here! He "he "The multitude,Who are you?\n" & _ "Brians mother,I "The multitude,Behold his mother! Behold his mother!" Debug.Print "<table>" & vbCrLf & "<tr><td>" For i = 1 To Len(input_) Select Case Mid(input_, i, 1) Case "\" If Mid(input_, i + 1, 1) = "n" Then Debug.Print "</td></tr>" & vbCrLf & "<tr><td>"; i = i + 1 Else Debug.Print Mid(input_, i, 1); End If Case ",": Debug.Print "</td><td>"; Case "<": Debug.Print "&lt;"; Case ">": Debug.Print "&gt;"; Case "&": Debug.Print "&amp;"; Case Else: Debug.Print Mid(input_, i, 1); End Select Next i Debug.Print "</td></tr>" & vbCrLf & "</table>" End Sub
Translate the given Java code snippet into VB without altering its behavior.
public class MyClass{ private int variable; public MyClass(){ } public void someMethod(){ this.variable = 1; } }
Class NumberContainer Private TheNumber As Integer Sub Constructor(InitialNumber As Integer) TheNumber = InitialNumber End Sub Function Number() As Integer Return TheNumber End Function Sub Number(Assigns NewNumber As Integer) TheNumber = NewNumber End Sub End Class
Produce a language-to-language conversion: from Java to VB, same semantics.
public class Kaprekar { private static String[] splitAt(String str, int idx){ String[] ans = new String[2]; ans[0] = str.substring(0, idx); if(ans[0].equals("")) ans[0] = "0"; ans[1] = str.substring(idx); return ans; } public static void main(String[] args){ int count = 0; int base = (args.length > 0) ? Integer.parseInt(args[0]) : 10; for(long i = 1; i <= 1000000; i++){ String sqrStr = Long.toString(i * i, base); for(int j = 0; j < sqrStr.length() / 2 + 1; j++){ String[] parts = splitAt(sqrStr, j); long firstNum = Long.parseLong(parts[0], base); long secNum = Long.parseLong(parts[1], base); if(secNum == 0) break; if(firstNum + secNum == i){ System.out.println(i + "\t" + Long.toString(i, base) + "\t" + sqrStr + "\t" + parts[0] + " + " + parts[1]); count++; break; } } } System.out.println(count + " Kaprekar numbers < 1000000 (base 10) in base "+base); } }
Module Module1 ReadOnly max As ULong = 1000000 Function Kaprekar(n As ULong) As Boolean If n = 1 Then Return True Dim sq = n * n Dim sq_str = Str(sq) Dim l = Len(sq_str) For x = l - 1 To 1 Step -1 If sq_str(x) = "0" Then l = l - 1 Else Exit For End If Next For x = 1 To l - 1 Dim p2 = Val(Mid(sq_str, x + 1)) If p2 > n Then Continue For End If Dim p1 = Val(Left(sq_str, x)) If p1 > n Then Return False If (p1 + p2) = n Then Return True Next Return False End Function Sub Main() Dim count = 0 Console.WriteLine("Kaprekar numbers below 10000") For n = 1 To max - 1 If Kaprekar(n) Then count = count + 1 If n < 10000 Then Console.WriteLine("{0,2} {1,4}", count, n) End If End If Next Console.WriteLine() Console.WriteLine("{0} numbers below {1} are kaprekar numbers", count, max) End Sub End Module
Change the programming language of this snippet from Java to VB without modifying what it does.
public class Kaprekar { private static String[] splitAt(String str, int idx){ String[] ans = new String[2]; ans[0] = str.substring(0, idx); if(ans[0].equals("")) ans[0] = "0"; ans[1] = str.substring(idx); return ans; } public static void main(String[] args){ int count = 0; int base = (args.length > 0) ? Integer.parseInt(args[0]) : 10; for(long i = 1; i <= 1000000; i++){ String sqrStr = Long.toString(i * i, base); for(int j = 0; j < sqrStr.length() / 2 + 1; j++){ String[] parts = splitAt(sqrStr, j); long firstNum = Long.parseLong(parts[0], base); long secNum = Long.parseLong(parts[1], base); if(secNum == 0) break; if(firstNum + secNum == i){ System.out.println(i + "\t" + Long.toString(i, base) + "\t" + sqrStr + "\t" + parts[0] + " + " + parts[1]); count++; break; } } } System.out.println(count + " Kaprekar numbers < 1000000 (base 10) in base "+base); } }
Module Module1 ReadOnly max As ULong = 1000000 Function Kaprekar(n As ULong) As Boolean If n = 1 Then Return True Dim sq = n * n Dim sq_str = Str(sq) Dim l = Len(sq_str) For x = l - 1 To 1 Step -1 If sq_str(x) = "0" Then l = l - 1 Else Exit For End If Next For x = 1 To l - 1 Dim p2 = Val(Mid(sq_str, x + 1)) If p2 > n Then Continue For End If Dim p1 = Val(Left(sq_str, x)) If p1 > n Then Return False If (p1 + p2) = n Then Return True Next Return False End Function Sub Main() Dim count = 0 Console.WriteLine("Kaprekar numbers below 10000") For n = 1 To max - 1 If Kaprekar(n) Then count = count + 1 If n < 10000 Then Console.WriteLine("{0,2} {1,4}", count, n) End If End If Next Console.WriteLine() Console.WriteLine("{0} numbers below {1} are kaprekar numbers", count, max) End Sub End Module
Keep all operations the same but rewrite the snippet in VB.
public class Kaprekar { private static String[] splitAt(String str, int idx){ String[] ans = new String[2]; ans[0] = str.substring(0, idx); if(ans[0].equals("")) ans[0] = "0"; ans[1] = str.substring(idx); return ans; } public static void main(String[] args){ int count = 0; int base = (args.length > 0) ? Integer.parseInt(args[0]) : 10; for(long i = 1; i <= 1000000; i++){ String sqrStr = Long.toString(i * i, base); for(int j = 0; j < sqrStr.length() / 2 + 1; j++){ String[] parts = splitAt(sqrStr, j); long firstNum = Long.parseLong(parts[0], base); long secNum = Long.parseLong(parts[1], base); if(secNum == 0) break; if(firstNum + secNum == i){ System.out.println(i + "\t" + Long.toString(i, base) + "\t" + sqrStr + "\t" + parts[0] + " + " + parts[1]); count++; break; } } } System.out.println(count + " Kaprekar numbers < 1000000 (base 10) in base "+base); } }
Module Module1 ReadOnly max As ULong = 1000000 Function Kaprekar(n As ULong) As Boolean If n = 1 Then Return True Dim sq = n * n Dim sq_str = Str(sq) Dim l = Len(sq_str) For x = l - 1 To 1 Step -1 If sq_str(x) = "0" Then l = l - 1 Else Exit For End If Next For x = 1 To l - 1 Dim p2 = Val(Mid(sq_str, x + 1)) If p2 > n Then Continue For End If Dim p1 = Val(Left(sq_str, x)) If p1 > n Then Return False If (p1 + p2) = n Then Return True Next Return False End Function Sub Main() Dim count = 0 Console.WriteLine("Kaprekar numbers below 10000") For n = 1 To max - 1 If Kaprekar(n) Then count = count + 1 If n < 10000 Then Console.WriteLine("{0,2} {1,4}", count, n) End If End If Next Console.WriteLine() Console.WriteLine("{0} numbers below {1} are kaprekar numbers", count, max) End Sub End Module
Translate the given Java code snippet into VB without altering its behavior.
import java.util.*; public class LZW { public static List<Integer> compress(String uncompressed) { int dictSize = 256; Map<String,Integer> dictionary = new HashMap<String,Integer>(); for (int i = 0; i < 256; i++) dictionary.put("" + (char)i, i); String w = ""; List<Integer> result = new ArrayList<Integer>(); for (char c : uncompressed.toCharArray()) { String wc = w + c; if (dictionary.containsKey(wc)) w = wc; else { result.add(dictionary.get(w)); dictionary.put(wc, dictSize++); w = "" + c; } } if (!w.equals("")) result.add(dictionary.get(w)); return result; } public static String decompress(List<Integer> compressed) { int dictSize = 256; Map<Integer,String> dictionary = new HashMap<Integer,String>(); for (int i = 0; i < 256; i++) dictionary.put(i, "" + (char)i); String w = "" + (char)(int)compressed.remove(0); StringBuffer result = new StringBuffer(w); for (int k : compressed) { String entry; if (dictionary.containsKey(k)) entry = dictionary.get(k); else if (k == dictSize) entry = w + w.charAt(0); else throw new IllegalArgumentException("Bad compressed k: " + k); result.append(entry); dictionary.put(dictSize++, w + entry.charAt(0)); w = entry; } return result.toString(); } public static void main(String[] args) { List<Integer> compressed = compress("TOBEORNOTTOBEORTOBEORNOT"); System.out.println(compressed); String decompressed = decompress(compressed); System.out.println(decompressed); } }
Option Explicit Const numchars=127 Function LZWCompress(si) Dim oDict, intMaxCode, i,z,ii,ss,strCurrent,strNext,j Set oDict = CreateObject("Scripting.Dictionary") ReDim a(Len(si)) intMaxCode = numchars For i = 0 To numchars oDict.Add Chr(i), i Next strCurrent = Left(si,1) j=0 For ii=2 To Len(si) strNext = Mid(si,ii,1) ss=strCurrent & strNext If oDict.Exists(ss) Then strCurrent = ss Else a(j)=oDict.Item(strCurrent) :j=j+1 intMaxCode = intMaxCode + 1 oDict.Add ss, intMaxCode strCurrent = strNext End If Next a(j)=oDict.Item(strCurrent) ReDim preserve a(j) LZWCompress=a Set oDict = Nothing End Function Function lzwUncompress(sc) Dim intNext, intCurrent, intMaxCode, i,ss,istr,s,j s="" reDim dict(1000) intMaxCode = numchars For i = 0 To numchars : dict(i)= Chr(i) : Next intCurrent=sc(0) For j=1 To UBound(sc) ss=dict(intCurrent) s= s & ss intMaxCode = intMaxCode + 1 intnext=sc(j) If intNext<intMaxCode Then dict(intMaxCode)=ss & Left(dict(intNext), 1) Else dict(intMaxCode)=ss & Left(ss, 1) End If intCurrent = intNext Next s= s & dict(intCurrent) lzwUncompress=s End function Sub printvec(a) Dim s,i,x s="(" For i=0 To UBound (a) s=s & x & a(i) x=", " Next WScript.echo s &")" End sub Dim a,b b="TOBEORNOTTOBEORTOBEORNOT" WScript.Echo b a=LZWCompress (b) printvec(a) WScript.echo lzwUncompress (a ) wscript.quit 1
Produce a language-to-language conversion: from Java to VB, same semantics.
import java.util.*; class Hofstadter { private static List<Integer> getSequence(int rlistSize, int slistSize) { List<Integer> rlist = new ArrayList<Integer>(); List<Integer> slist = new ArrayList<Integer>(); Collections.addAll(rlist, 1, 3, 7); Collections.addAll(slist, 2, 4, 5, 6); List<Integer> list = (rlistSize > 0) ? rlist : slist; int targetSize = (rlistSize > 0) ? rlistSize : slistSize; while (list.size() > targetSize) list.remove(list.size() - 1); while (list.size() < targetSize) { int lastIndex = rlist.size() - 1; int lastr = rlist.get(lastIndex).intValue(); int r = lastr + slist.get(lastIndex).intValue(); rlist.add(Integer.valueOf(r)); for (int s = lastr + 1; (s < r) && (list.size() < targetSize); s++) slist.add(Integer.valueOf(s)); } return list; } public static int ffr(int n) { return getSequence(n, 0).get(n - 1).intValue(); } public static int ffs(int n) { return getSequence(0, n).get(n - 1).intValue(); } public static void main(String[] args) { System.out.print("R():"); for (int n = 1; n <= 10; n++) System.out.print(" " + ffr(n)); System.out.println(); Set<Integer> first40R = new HashSet<Integer>(); for (int n = 1; n <= 40; n++) first40R.add(Integer.valueOf(ffr(n))); Set<Integer> first960S = new HashSet<Integer>(); for (int n = 1; n <= 960; n++) first960S.add(Integer.valueOf(ffs(n))); for (int i = 1; i <= 1000; i++) { Integer n = Integer.valueOf(i); if (first40R.contains(n) == first960S.contains(n)) System.out.println("Integer " + i + " either in both or neither set"); } System.out.println("Done"); } }
Private Function ffr(n As Long) As Long Dim R As New Collection Dim S As New Collection R.Add 1 S.Add 2 For i = 2 To n R.Add R(i - 1) + S(i - 1) For j = S(S.Count) + 1 To R(i) - 1 S.Add j Next j For j = R(i) + 1 To R(i) + S(i - 1) S.Add j Next j Next i ffr = R(n) Set R = Nothing Set S = Nothing End Function Private Function ffs(n As Long) As Long Dim R As New Collection Dim S As New Collection R.Add 1 S.Add 2 For i = 2 To n R.Add R(i - 1) + S(i - 1) For j = S(S.Count) + 1 To R(i) - 1 S.Add j Next j For j = R(i) + 1 To R(i) + S(i - 1) S.Add j Next j If S.Count >= n Then Exit For Next i ffs = S(n) Set R = Nothing Set S = Nothing End Function Public Sub main() Dim i As Long Debug.Print "The first ten values of R are:" For i = 1 To 10 Debug.Print ffr(i); Next i Debug.Print Dim x As New Collection For i = 1 To 1000 x.Add i, CStr(i) Next i For i = 1 To 40 x.Remove CStr(ffr(i)) Next i For i = 1 To 960 x.Remove CStr(ffs(i)) Next i Debug.Print "The first 40 values of ffr plus the first 960 values of ffs " Debug.Print "include all the integers from 1 to 1000 exactly once is "; Format(x.Count = 0) End Sub
Port the following code from Java to VB with equivalent syntax and logic.
import java.util.*; class Hofstadter { private static List<Integer> getSequence(int rlistSize, int slistSize) { List<Integer> rlist = new ArrayList<Integer>(); List<Integer> slist = new ArrayList<Integer>(); Collections.addAll(rlist, 1, 3, 7); Collections.addAll(slist, 2, 4, 5, 6); List<Integer> list = (rlistSize > 0) ? rlist : slist; int targetSize = (rlistSize > 0) ? rlistSize : slistSize; while (list.size() > targetSize) list.remove(list.size() - 1); while (list.size() < targetSize) { int lastIndex = rlist.size() - 1; int lastr = rlist.get(lastIndex).intValue(); int r = lastr + slist.get(lastIndex).intValue(); rlist.add(Integer.valueOf(r)); for (int s = lastr + 1; (s < r) && (list.size() < targetSize); s++) slist.add(Integer.valueOf(s)); } return list; } public static int ffr(int n) { return getSequence(n, 0).get(n - 1).intValue(); } public static int ffs(int n) { return getSequence(0, n).get(n - 1).intValue(); } public static void main(String[] args) { System.out.print("R():"); for (int n = 1; n <= 10; n++) System.out.print(" " + ffr(n)); System.out.println(); Set<Integer> first40R = new HashSet<Integer>(); for (int n = 1; n <= 40; n++) first40R.add(Integer.valueOf(ffr(n))); Set<Integer> first960S = new HashSet<Integer>(); for (int n = 1; n <= 960; n++) first960S.add(Integer.valueOf(ffs(n))); for (int i = 1; i <= 1000; i++) { Integer n = Integer.valueOf(i); if (first40R.contains(n) == first960S.contains(n)) System.out.println("Integer " + i + " either in both or neither set"); } System.out.println("Done"); } }
Private Function ffr(n As Long) As Long Dim R As New Collection Dim S As New Collection R.Add 1 S.Add 2 For i = 2 To n R.Add R(i - 1) + S(i - 1) For j = S(S.Count) + 1 To R(i) - 1 S.Add j Next j For j = R(i) + 1 To R(i) + S(i - 1) S.Add j Next j Next i ffr = R(n) Set R = Nothing Set S = Nothing End Function Private Function ffs(n As Long) As Long Dim R As New Collection Dim S As New Collection R.Add 1 S.Add 2 For i = 2 To n R.Add R(i - 1) + S(i - 1) For j = S(S.Count) + 1 To R(i) - 1 S.Add j Next j For j = R(i) + 1 To R(i) + S(i - 1) S.Add j Next j If S.Count >= n Then Exit For Next i ffs = S(n) Set R = Nothing Set S = Nothing End Function Public Sub main() Dim i As Long Debug.Print "The first ten values of R are:" For i = 1 To 10 Debug.Print ffr(i); Next i Debug.Print Dim x As New Collection For i = 1 To 1000 x.Add i, CStr(i) Next i For i = 1 To 40 x.Remove CStr(ffr(i)) Next i For i = 1 To 960 x.Remove CStr(ffs(i)) Next i Debug.Print "The first 40 values of ffr plus the first 960 values of ffs " Debug.Print "include all the integers from 1 to 1000 exactly once is "; Format(x.Count = 0) End Sub
Convert the following code from Java to VB, ensuring the logic remains intact.
public class MagicSquare { public static void main(String[] args) { int n = 5; for (int[] row : magicSquareOdd(n)) { for (int x : row) System.out.format("%2s ", x); System.out.println(); } System.out.printf("\nMagic constant: %d ", (n * n + 1) * n / 2); } public static int[][] magicSquareOdd(final int base) { if (base % 2 == 0 || base < 3) throw new IllegalArgumentException("base must be odd and > 2"); int[][] grid = new int[base][base]; int r = 0, number = 0; int size = base * base; int c = base / 2; while (number++ < size) { grid[r][c] = number; if (r == 0) { if (c == base - 1) { r++; } else { r = base - 1; c++; } } else { if (c == base - 1) { r--; c = 0; } else { if (grid[r - 1][c + 1] == 0) { r--; c++; } else { r++; } } } } return grid; } }
Sub magicsquare() Const n = 9 Dim i As Integer, j As Integer, v As Integer Debug.Print "The square order is: " & n For i = 1 To n For j = 1 To n Cells(i, j) = ((i * 2 - j + n - 1) Mod n) * n + ((i * 2 + j - 2) Mod n) + 1 Next j Next i Debug.Print "The magic number of"; n; "x"; n; "square is:"; n * (n * n + 1) \ 2 End Sub
Preserve the algorithm and functionality while converting the code from Java to VB.
public class MagicSquare { public static void main(String[] args) { int n = 5; for (int[] row : magicSquareOdd(n)) { for (int x : row) System.out.format("%2s ", x); System.out.println(); } System.out.printf("\nMagic constant: %d ", (n * n + 1) * n / 2); } public static int[][] magicSquareOdd(final int base) { if (base % 2 == 0 || base < 3) throw new IllegalArgumentException("base must be odd and > 2"); int[][] grid = new int[base][base]; int r = 0, number = 0; int size = base * base; int c = base / 2; while (number++ < size) { grid[r][c] = number; if (r == 0) { if (c == base - 1) { r++; } else { r = base - 1; c++; } } else { if (c == base - 1) { r--; c = 0; } else { if (grid[r - 1][c + 1] == 0) { r--; c++; } else { r++; } } } } return grid; } }
Sub magicsquare() Const n = 9 Dim i As Integer, j As Integer, v As Integer Debug.Print "The square order is: " & n For i = 1 To n For j = 1 To n Cells(i, j) = ((i * 2 - j + n - 1) Mod n) * n + ((i * 2 + j - 2) Mod n) + 1 Next j Next i Debug.Print "The magic number of"; n; "x"; n; "square is:"; n * (n * n + 1) \ 2 End Sub
Translate this program into VB but keep the logic exactly as in Java.
import java.math.BigInteger; import java.util.Locale; public class BenfordsLaw { private static BigInteger[] generateFibonacci(int n) { BigInteger[] fib = new BigInteger[n]; fib[0] = BigInteger.ONE; fib[1] = BigInteger.ONE; for (int i = 2; i < fib.length; i++) { fib[i] = fib[i - 2].add(fib[i - 1]); } return fib; } public static void main(String[] args) { BigInteger[] numbers = generateFibonacci(1000); int[] firstDigits = new int[10]; for (BigInteger number : numbers) { firstDigits[Integer.valueOf(number.toString().substring(0, 1))]++; } for (int i = 1; i < firstDigits.length; i++) { System.out.printf(Locale.ROOT, "%d %10.6f %10.6f%n", i, (double) firstDigits[i] / numbers.length, Math.log10(1.0 + 1.0 / i)); } } }
Sub BenfordLaw() Dim BenResult(1 To 9) As Long BENref = "30,1%|17,6%|12,5%|9,7%|7,9%|6,7%|5,8%|5,1%|4,6%" For Each c In Selection.Cells If InStr(1, "-0123456789", Left(c, 1)) > 0 Then For i = 1 To 9 If CInt(Left(Abs(c), 1)) = i Then BenResult(i) = BenResult(i) + 1: Exit For Next End If Next Total= Application.Sum(BenResult) biggest= Len(CStr(BenResult(1))) txt = "# | Values | Real | Expected " & vbCrLf For i = 1 To 9 If BenResult(i) > 0 Then txt = txt & "#" & i & " | " & vbTab txt = txt & String((biggest - Len(CStr(BenResult(i)))) * 2, " ") & Format(BenResult(i), "0") & " | " & vbTab txt = txt & String((Len(CStr(Format(BenResult(1) / Total, "##0.0%"))) - Len(CStr(Format(BenResult(i) / Total, "##0.0%")))) * 2, " ") & Format(BenResult(i) / Total, "##0.0%") & " | " & vbTab txt = txt & Format(Split(BENref, "|")(i - 1), " ##0.0%") & vbCrLf End If Next MsgBox txt, vbOKOnly, "Finish" End Sub }
Transform the following Java implementation into VB, maintaining the same output and logic.
import java.math.BigInteger; import java.util.Locale; public class BenfordsLaw { private static BigInteger[] generateFibonacci(int n) { BigInteger[] fib = new BigInteger[n]; fib[0] = BigInteger.ONE; fib[1] = BigInteger.ONE; for (int i = 2; i < fib.length; i++) { fib[i] = fib[i - 2].add(fib[i - 1]); } return fib; } public static void main(String[] args) { BigInteger[] numbers = generateFibonacci(1000); int[] firstDigits = new int[10]; for (BigInteger number : numbers) { firstDigits[Integer.valueOf(number.toString().substring(0, 1))]++; } for (int i = 1; i < firstDigits.length; i++) { System.out.printf(Locale.ROOT, "%d %10.6f %10.6f%n", i, (double) firstDigits[i] / numbers.length, Math.log10(1.0 + 1.0 / i)); } } }
Sub BenfordLaw() Dim BenResult(1 To 9) As Long BENref = "30,1%|17,6%|12,5%|9,7%|7,9%|6,7%|5,8%|5,1%|4,6%" For Each c In Selection.Cells If InStr(1, "-0123456789", Left(c, 1)) > 0 Then For i = 1 To 9 If CInt(Left(Abs(c), 1)) = i Then BenResult(i) = BenResult(i) + 1: Exit For Next End If Next Total= Application.Sum(BenResult) biggest= Len(CStr(BenResult(1))) txt = "# | Values | Real | Expected " & vbCrLf For i = 1 To 9 If BenResult(i) > 0 Then txt = txt & "#" & i & " | " & vbTab txt = txt & String((biggest - Len(CStr(BenResult(i)))) * 2, " ") & Format(BenResult(i), "0") & " | " & vbTab txt = txt & String((Len(CStr(Format(BenResult(1) / Total, "##0.0%"))) - Len(CStr(Format(BenResult(i) / Total, "##0.0%")))) * 2, " ") & Format(BenResult(i) / Total, "##0.0%") & " | " & vbTab txt = txt & Format(Split(BENref, "|")(i - 1), " ##0.0%") & vbCrLf End If Next MsgBox txt, vbOKOnly, "Finish" End Sub }
Produce a functionally identical VB code for the snippet given in Java.
public static long fib(int n) { if (n < 0) throw new IllegalArgumentException("n can not be a negative number"); return new Object() { private long fibInner(int n) { return (n < 2) ? n : (fibInner(n - 1) + fibInner(n - 2)); } }.fibInner(n); }
Sub Main() Debug.Print F(-10) Debug.Print F(10) End Sub Private Function F(N As Long) As Variant If N < 0 Then F = "Error. Negative argument" ElseIf N <= 1 Then F = N Else F = F(N - 1) + F(N - 2) End If End Function
Rewrite the snippet below in VB so it works the same as the original Java code.
String strOrig = 'brooms'; String str1 = strOrig.substring(1, strOrig.length()); system.debug(str1); String str2 = strOrig.substring(0, strOrig.length()-1); system.debug(str2); String str3 = strOrig.substring(1, strOrig.length()-1); system.debug(str3); String strOrig = 'brooms'; String str1 = strOrig.replaceAll( '^.', '' ); system.debug(str1); String str2 = strOrig.replaceAll( '.$', '' ) ; system.debug(str2); String str3 = strOrig.replaceAll( '^.|.$', '' ); system.debug(str3);
string = "Small Basic" TextWindow.WriteLine(Text.GetSubTextToEnd(string, 2)) TextWindow.WriteLine(Text.GetSubText(string, 1, Text.GetLength(string) - 1)) TextWindow.WriteLine(Text.GetSubText(string, 2, Text.GetLength(string) - 2))
Maintain the same structure and functionality when rewriting this code in VB.
String strOrig = 'brooms'; String str1 = strOrig.substring(1, strOrig.length()); system.debug(str1); String str2 = strOrig.substring(0, strOrig.length()-1); system.debug(str2); String str3 = strOrig.substring(1, strOrig.length()-1); system.debug(str3); String strOrig = 'brooms'; String str1 = strOrig.replaceAll( '^.', '' ); system.debug(str1); String str2 = strOrig.replaceAll( '.$', '' ) ; system.debug(str2); String str3 = strOrig.replaceAll( '^.|.$', '' ); system.debug(str3);
string = "Small Basic" TextWindow.WriteLine(Text.GetSubTextToEnd(string, 2)) TextWindow.WriteLine(Text.GetSubText(string, 1, Text.GetLength(string) - 1)) TextWindow.WriteLine(Text.GetSubText(string, 2, Text.GetLength(string) - 2))
Produce a language-to-language conversion: from Java to VB, same semantics.
String strOrig = 'brooms'; String str1 = strOrig.substring(1, strOrig.length()); system.debug(str1); String str2 = strOrig.substring(0, strOrig.length()-1); system.debug(str2); String str3 = strOrig.substring(1, strOrig.length()-1); system.debug(str3); String strOrig = 'brooms'; String str1 = strOrig.replaceAll( '^.', '' ); system.debug(str1); String str2 = strOrig.replaceAll( '.$', '' ) ; system.debug(str2); String str3 = strOrig.replaceAll( '^.|.$', '' ); system.debug(str3);
string = "Small Basic" TextWindow.WriteLine(Text.GetSubTextToEnd(string, 2)) TextWindow.WriteLine(Text.GetSubText(string, 1, Text.GetLength(string) - 1)) TextWindow.WriteLine(Text.GetSubText(string, 2, Text.GetLength(string) - 2))
Write the same algorithm in VB as shown in this Java implementation.
import java.io.File; import java.util.Scanner; public class LongestStringChallenge { public static void main(String[] args) throws Exception { String lines = "", longest = ""; try (Scanner sc = new Scanner(new File("lines.txt"))) { while(sc.hasNext()) { String line = sc.nextLine(); if (longer(longest, line)) lines = longest = line; else if (!longer(line, longest)) lines = lines.concat("\n").concat(line); } } System.out.println(lines); } static boolean longer(String a, String b) { try { String dummy = a.substring(b.length()); } catch (StringIndexOutOfBoundsException e) { return true; } return false; } }
Set objfso = CreateObject("Scripting.FileSystemObject") Set objfile = objfso.OpenTextFile(objfso.GetParentFolderName(WScript.ScriptFullName) &_ "\input.txt",1) list = "" previous_line = "" l = Len(previous_line) Do Until objfile.AtEndOfStream current_line = objfile.ReadLine If Mid(current_line,l+1,1) <> "" Then list = current_line & vbCrLf previous_line = current_line l = Len(previous_line) ElseIf Mid(current_line,l,1) <> "" And Mid(current_line,(l+1),1) = "" Then list = list & current_line & vbCrLf End If Loop WScript.Echo list objfile.Close Set objfso = Nothing
Please provide an equivalent version of this Java code in VB.
import java.util.HashMap; import java.util.HashSet; import java.util.LinkedList; import java.util.ListIterator; import java.util.List; import java.util.Set; import java.util.Map; public class UTM { private List<String> tape; private String blankSymbol; private ListIterator<String> head; private Map<StateTapeSymbolPair, Transition> transitions = new HashMap<StateTapeSymbolPair, Transition>(); private Set<String> terminalStates; private String initialState; public UTM(Set<Transition> transitions, Set<String> terminalStates, String initialState, String blankSymbol) { this.blankSymbol = blankSymbol; for (Transition t : transitions) { this.transitions.put(t.from, t); } this.terminalStates = terminalStates; this.initialState = initialState; } public static class StateTapeSymbolPair { private String state; private String tapeSymbol; public StateTapeSymbolPair(String state, String tapeSymbol) { this.state = state; this.tapeSymbol = tapeSymbol; } @Override public int hashCode() { final int prime = 31; int result = 1; result = prime * result + ((state == null) ? 0 : state.hashCode()); result = prime * result + ((tapeSymbol == null) ? 0 : tapeSymbol .hashCode()); return result; } @Override public boolean equals(Object obj) { if (this == obj) return true; if (obj == null) return false; if (getClass() != obj.getClass()) return false; StateTapeSymbolPair other = (StateTapeSymbolPair) obj; if (state == null) { if (other.state != null) return false; } else if (!state.equals(other.state)) return false; if (tapeSymbol == null) { if (other.tapeSymbol != null) return false; } else if (!tapeSymbol.equals(other.tapeSymbol)) return false; return true; } @Override public String toString() { return "(" + state + "," + tapeSymbol + ")"; } } public static class Transition { private StateTapeSymbolPair from; private StateTapeSymbolPair to; private int direction; public Transition(StateTapeSymbolPair from, StateTapeSymbolPair to, int direction) { this.from = from; this.to = to; this.direction = direction; } @Override public String toString() { return from + "=>" + to + "/" + direction; } } public void initializeTape(List<String> input) { tape = input; } public void initializeTape(String input) { tape = new LinkedList<String>(); for (int i = 0; i < input.length(); i++) { tape.add(input.charAt(i) + ""); } } public List<String> runTM() { if (tape.size() == 0) { tape.add(blankSymbol); } head = tape.listIterator(); head.next(); head.previous(); StateTapeSymbolPair tsp = new StateTapeSymbolPair(initialState, tape.get(0)); while (transitions.containsKey(tsp)) { System.out.println(this + " --- " + transitions.get(tsp)); Transition trans = transitions.get(tsp); head.set(trans.to.tapeSymbol); tsp.state = trans.to.state; if (trans.direction == -1) { if (!head.hasPrevious()) { head.add(blankSymbol); } tsp.tapeSymbol = head.previous(); } else if (trans.direction == 1) { head.next(); if (!head.hasNext()) { head.add(blankSymbol); head.previous(); } tsp.tapeSymbol = head.next(); head.previous(); } else { tsp.tapeSymbol = trans.to.tapeSymbol; } } System.out.println(this + " --- " + tsp); if (terminalStates.contains(tsp.state)) { return tape; } else { return null; } } @Override public String toString() { try { int headPos = head.previousIndex(); String s = "[ "; for (int i = 0; i <= headPos; i++) { s += tape.get(i) + " "; } s += "[H] "; for (int i = headPos + 1; i < tape.size(); i++) { s += tape.get(i) + " "; } return s + "]"; } catch (Exception e) { return ""; } } public static void main(String[] args) { String init = "q0"; String blank = "b"; Set<String> term = new HashSet<String>(); term.add("qf"); Set<Transition> trans = new HashSet<Transition>(); trans.add(new Transition(new StateTapeSymbolPair("q0", "1"), new StateTapeSymbolPair("q0", "1"), 1)); trans.add(new Transition(new StateTapeSymbolPair("q0", "b"), new StateTapeSymbolPair("qf", "1"), 0)); UTM machine = new UTM(trans, term, init, blank); machine.initializeTape("111"); System.out.println("Output (si): " + machine.runTM() + "\n"); init = "a"; term.clear(); term.add("halt"); blank = "0"; trans.clear(); trans.add(new Transition(new StateTapeSymbolPair("a", "0"), new StateTapeSymbolPair("b", "1"), 1)); trans.add(new Transition(new StateTapeSymbolPair("a", "1"), new StateTapeSymbolPair("c", "1"), -1)); trans.add(new Transition(new StateTapeSymbolPair("b", "0"), new StateTapeSymbolPair("a", "1"), -1)); trans.add(new Transition(new StateTapeSymbolPair("b", "1"), new StateTapeSymbolPair("b", "1"), 1)); trans.add(new Transition(new StateTapeSymbolPair("c", "0"), new StateTapeSymbolPair("b", "1"), -1)); trans.add(new Transition(new StateTapeSymbolPair("c", "1"), new StateTapeSymbolPair("halt", "1"), 0)); machine = new UTM(trans, term, init, blank); machine.initializeTape(""); System.out.println("Output (bb): " + machine.runTM()); init = "s0"; blank = "*"; term = new HashSet<String>(); term.add("see"); trans = new HashSet<Transition>(); trans.add(new Transition(new StateTapeSymbolPair("s0", "a"), new StateTapeSymbolPair("s0", "a"), 1)); trans.add(new Transition(new StateTapeSymbolPair("s0", "b"), new StateTapeSymbolPair("s1", "B"), 1)); trans.add(new Transition(new StateTapeSymbolPair("s0", "*"), new StateTapeSymbolPair("se", "*"), -1)); trans.add(new Transition(new StateTapeSymbolPair("s1", "a"), new StateTapeSymbolPair("s1", "a"), 1)); trans.add(new Transition(new StateTapeSymbolPair("s1", "b"), new StateTapeSymbolPair("s1", "b"), 1)); trans.add(new Transition(new StateTapeSymbolPair("s1", "*"), new StateTapeSymbolPair("s2", "*"), -1)); trans.add(new Transition(new StateTapeSymbolPair("s2", "a"), new StateTapeSymbolPair("s3", "b"), -1)); trans.add(new Transition(new StateTapeSymbolPair("s2", "b"), new StateTapeSymbolPair("s2", "b"), -1)); trans.add(new Transition(new StateTapeSymbolPair("s2", "B"), new StateTapeSymbolPair("se", "b"), -1)); trans.add(new Transition(new StateTapeSymbolPair("s3", "a"), new StateTapeSymbolPair("s3", "a"), -1)); trans.add(new Transition(new StateTapeSymbolPair("s3", "b"), new StateTapeSymbolPair("s3", "b"), -1)); trans.add(new Transition(new StateTapeSymbolPair("s3", "B"), new StateTapeSymbolPair("s0", "a"), 1)); trans.add(new Transition(new StateTapeSymbolPair("se", "a"), new StateTapeSymbolPair("se", "a"), -1)); trans.add(new Transition(new StateTapeSymbolPair("se", "*"), new StateTapeSymbolPair("see", "*"), 1)); machine = new UTM(trans, term, init, blank); machine.initializeTape("babbababaa"); System.out.println("Output (sort): " + machine.runTM() + "\n"); } }
Option Base 1 Public Enum sett name_ = 1 initState endState blank rules End Enum Public incrementer As Variant, threeStateBB As Variant, fiveStateBB As Variant Private Sub init() incrementer = Array("Simple incrementer", _ "q0", _ "qf", _ "B", _ Array( _ Array("q0", "1", "1", "right", "q0"), _ Array("q0", "B", "1", "stay", "qf"))) threeStateBB = Array("Three-state busy beaver", _ "a", _ "halt", _ "0", _ Array( _ Array("a", "0", "1", "right", "b"), _ Array("a", "1", "1", "left", "c"), _ Array("b", "0", "1", "left", "a"), _ Array("b", "1", "1", "right", "b"), _ Array("c", "0", "1", "left", "b"), _ Array("c", "1", "1", "stay", "halt"))) fiveStateBB = Array("Five-state busy beaver", _ "A", _ "H", _ "0", _ Array( _ Array("A", "0", "1", "right", "B"), _ Array("A", "1", "1", "left", "C"), _ Array("B", "0", "1", "right", "C"), _ Array("B", "1", "1", "right", "B"), _ Array("C", "0", "1", "right", "D"), _ Array("C", "1", "0", "left", "E"), _ Array("D", "0", "1", "left", "A"), _ Array("D", "1", "1", "left", "D"), _ Array("E", "0", "1", "stay", "H"), _ Array("E", "1", "0", "left", "A"))) End Sub Private Sub show(state As String, headpos As Long, tape As Collection) Debug.Print " "; state; String$(7 - Len(state), " "); "| "; For p = 1 To tape.Count Debug.Print IIf(p = headpos, "[" & tape(p) & "]", " " & tape(p) & " "); Next p Debug.Print End Sub Private Sub UTM(machine As Variant, tape As Collection, Optional countOnly As Long = 0) Dim state As String: state = machine(initState) Dim headpos As Long: headpos = 1 Dim counter As Long, rule As Variant Debug.Print machine(name_); vbCrLf; String$(Len(machine(name_)), "=") If Not countOnly Then Debug.Print " State | Tape [head]" & vbCrLf & "---------------------" Do While True If headpos > tape.Count Then tape.Add machine(blank) Else If headpos < 1 Then tape.Add machine(blank), Before:=1 headpos = 1 End If End If If Not countOnly Then show state, headpos, tape For i = LBound(machine(rules)) To UBound(machine(rules)) rule = machine(rules)(i) If rule(1) = state And rule(2) = tape(headpos) Then tape.Remove headpos If headpos > tape.Count Then tape.Add rule(3) Else tape.Add rule(3), Before:=headpos End If If rule(4) = "left" Then headpos = headpos - 1 If rule(4) = "right" Then headpos = headpos + 1 state = rule(5) Exit For End If Next i counter = counter + 1 If counter Mod 100000 = 0 Then Debug.Print counter DoEvents DoEvents End If If state = machine(endState) Then Exit Do Loop DoEvents If countOnly Then Debug.Print "Steps taken: ", counter Else show state, headpos, tape Debug.Print End If End Sub Public Sub main() init Dim tap As New Collection tap.Add "1": tap.Add "1": tap.Add "1" UTM incrementer, tap Set tap = New Collection UTM threeStateBB, tap Set tap = New Collection UTM fiveStateBB, tap, countOnly:=-1 End Sub
Port the provided Java code into VB while preserving the original functionality.
import java.util.HashMap; import java.util.HashSet; import java.util.LinkedList; import java.util.ListIterator; import java.util.List; import java.util.Set; import java.util.Map; public class UTM { private List<String> tape; private String blankSymbol; private ListIterator<String> head; private Map<StateTapeSymbolPair, Transition> transitions = new HashMap<StateTapeSymbolPair, Transition>(); private Set<String> terminalStates; private String initialState; public UTM(Set<Transition> transitions, Set<String> terminalStates, String initialState, String blankSymbol) { this.blankSymbol = blankSymbol; for (Transition t : transitions) { this.transitions.put(t.from, t); } this.terminalStates = terminalStates; this.initialState = initialState; } public static class StateTapeSymbolPair { private String state; private String tapeSymbol; public StateTapeSymbolPair(String state, String tapeSymbol) { this.state = state; this.tapeSymbol = tapeSymbol; } @Override public int hashCode() { final int prime = 31; int result = 1; result = prime * result + ((state == null) ? 0 : state.hashCode()); result = prime * result + ((tapeSymbol == null) ? 0 : tapeSymbol .hashCode()); return result; } @Override public boolean equals(Object obj) { if (this == obj) return true; if (obj == null) return false; if (getClass() != obj.getClass()) return false; StateTapeSymbolPair other = (StateTapeSymbolPair) obj; if (state == null) { if (other.state != null) return false; } else if (!state.equals(other.state)) return false; if (tapeSymbol == null) { if (other.tapeSymbol != null) return false; } else if (!tapeSymbol.equals(other.tapeSymbol)) return false; return true; } @Override public String toString() { return "(" + state + "," + tapeSymbol + ")"; } } public static class Transition { private StateTapeSymbolPair from; private StateTapeSymbolPair to; private int direction; public Transition(StateTapeSymbolPair from, StateTapeSymbolPair to, int direction) { this.from = from; this.to = to; this.direction = direction; } @Override public String toString() { return from + "=>" + to + "/" + direction; } } public void initializeTape(List<String> input) { tape = input; } public void initializeTape(String input) { tape = new LinkedList<String>(); for (int i = 0; i < input.length(); i++) { tape.add(input.charAt(i) + ""); } } public List<String> runTM() { if (tape.size() == 0) { tape.add(blankSymbol); } head = tape.listIterator(); head.next(); head.previous(); StateTapeSymbolPair tsp = new StateTapeSymbolPair(initialState, tape.get(0)); while (transitions.containsKey(tsp)) { System.out.println(this + " --- " + transitions.get(tsp)); Transition trans = transitions.get(tsp); head.set(trans.to.tapeSymbol); tsp.state = trans.to.state; if (trans.direction == -1) { if (!head.hasPrevious()) { head.add(blankSymbol); } tsp.tapeSymbol = head.previous(); } else if (trans.direction == 1) { head.next(); if (!head.hasNext()) { head.add(blankSymbol); head.previous(); } tsp.tapeSymbol = head.next(); head.previous(); } else { tsp.tapeSymbol = trans.to.tapeSymbol; } } System.out.println(this + " --- " + tsp); if (terminalStates.contains(tsp.state)) { return tape; } else { return null; } } @Override public String toString() { try { int headPos = head.previousIndex(); String s = "[ "; for (int i = 0; i <= headPos; i++) { s += tape.get(i) + " "; } s += "[H] "; for (int i = headPos + 1; i < tape.size(); i++) { s += tape.get(i) + " "; } return s + "]"; } catch (Exception e) { return ""; } } public static void main(String[] args) { String init = "q0"; String blank = "b"; Set<String> term = new HashSet<String>(); term.add("qf"); Set<Transition> trans = new HashSet<Transition>(); trans.add(new Transition(new StateTapeSymbolPair("q0", "1"), new StateTapeSymbolPair("q0", "1"), 1)); trans.add(new Transition(new StateTapeSymbolPair("q0", "b"), new StateTapeSymbolPair("qf", "1"), 0)); UTM machine = new UTM(trans, term, init, blank); machine.initializeTape("111"); System.out.println("Output (si): " + machine.runTM() + "\n"); init = "a"; term.clear(); term.add("halt"); blank = "0"; trans.clear(); trans.add(new Transition(new StateTapeSymbolPair("a", "0"), new StateTapeSymbolPair("b", "1"), 1)); trans.add(new Transition(new StateTapeSymbolPair("a", "1"), new StateTapeSymbolPair("c", "1"), -1)); trans.add(new Transition(new StateTapeSymbolPair("b", "0"), new StateTapeSymbolPair("a", "1"), -1)); trans.add(new Transition(new StateTapeSymbolPair("b", "1"), new StateTapeSymbolPair("b", "1"), 1)); trans.add(new Transition(new StateTapeSymbolPair("c", "0"), new StateTapeSymbolPair("b", "1"), -1)); trans.add(new Transition(new StateTapeSymbolPair("c", "1"), new StateTapeSymbolPair("halt", "1"), 0)); machine = new UTM(trans, term, init, blank); machine.initializeTape(""); System.out.println("Output (bb): " + machine.runTM()); init = "s0"; blank = "*"; term = new HashSet<String>(); term.add("see"); trans = new HashSet<Transition>(); trans.add(new Transition(new StateTapeSymbolPair("s0", "a"), new StateTapeSymbolPair("s0", "a"), 1)); trans.add(new Transition(new StateTapeSymbolPair("s0", "b"), new StateTapeSymbolPair("s1", "B"), 1)); trans.add(new Transition(new StateTapeSymbolPair("s0", "*"), new StateTapeSymbolPair("se", "*"), -1)); trans.add(new Transition(new StateTapeSymbolPair("s1", "a"), new StateTapeSymbolPair("s1", "a"), 1)); trans.add(new Transition(new StateTapeSymbolPair("s1", "b"), new StateTapeSymbolPair("s1", "b"), 1)); trans.add(new Transition(new StateTapeSymbolPair("s1", "*"), new StateTapeSymbolPair("s2", "*"), -1)); trans.add(new Transition(new StateTapeSymbolPair("s2", "a"), new StateTapeSymbolPair("s3", "b"), -1)); trans.add(new Transition(new StateTapeSymbolPair("s2", "b"), new StateTapeSymbolPair("s2", "b"), -1)); trans.add(new Transition(new StateTapeSymbolPair("s2", "B"), new StateTapeSymbolPair("se", "b"), -1)); trans.add(new Transition(new StateTapeSymbolPair("s3", "a"), new StateTapeSymbolPair("s3", "a"), -1)); trans.add(new Transition(new StateTapeSymbolPair("s3", "b"), new StateTapeSymbolPair("s3", "b"), -1)); trans.add(new Transition(new StateTapeSymbolPair("s3", "B"), new StateTapeSymbolPair("s0", "a"), 1)); trans.add(new Transition(new StateTapeSymbolPair("se", "a"), new StateTapeSymbolPair("se", "a"), -1)); trans.add(new Transition(new StateTapeSymbolPair("se", "*"), new StateTapeSymbolPair("see", "*"), 1)); machine = new UTM(trans, term, init, blank); machine.initializeTape("babbababaa"); System.out.println("Output (sort): " + machine.runTM() + "\n"); } }
Option Base 1 Public Enum sett name_ = 1 initState endState blank rules End Enum Public incrementer As Variant, threeStateBB As Variant, fiveStateBB As Variant Private Sub init() incrementer = Array("Simple incrementer", _ "q0", _ "qf", _ "B", _ Array( _ Array("q0", "1", "1", "right", "q0"), _ Array("q0", "B", "1", "stay", "qf"))) threeStateBB = Array("Three-state busy beaver", _ "a", _ "halt", _ "0", _ Array( _ Array("a", "0", "1", "right", "b"), _ Array("a", "1", "1", "left", "c"), _ Array("b", "0", "1", "left", "a"), _ Array("b", "1", "1", "right", "b"), _ Array("c", "0", "1", "left", "b"), _ Array("c", "1", "1", "stay", "halt"))) fiveStateBB = Array("Five-state busy beaver", _ "A", _ "H", _ "0", _ Array( _ Array("A", "0", "1", "right", "B"), _ Array("A", "1", "1", "left", "C"), _ Array("B", "0", "1", "right", "C"), _ Array("B", "1", "1", "right", "B"), _ Array("C", "0", "1", "right", "D"), _ Array("C", "1", "0", "left", "E"), _ Array("D", "0", "1", "left", "A"), _ Array("D", "1", "1", "left", "D"), _ Array("E", "0", "1", "stay", "H"), _ Array("E", "1", "0", "left", "A"))) End Sub Private Sub show(state As String, headpos As Long, tape As Collection) Debug.Print " "; state; String$(7 - Len(state), " "); "| "; For p = 1 To tape.Count Debug.Print IIf(p = headpos, "[" & tape(p) & "]", " " & tape(p) & " "); Next p Debug.Print End Sub Private Sub UTM(machine As Variant, tape As Collection, Optional countOnly As Long = 0) Dim state As String: state = machine(initState) Dim headpos As Long: headpos = 1 Dim counter As Long, rule As Variant Debug.Print machine(name_); vbCrLf; String$(Len(machine(name_)), "=") If Not countOnly Then Debug.Print " State | Tape [head]" & vbCrLf & "---------------------" Do While True If headpos > tape.Count Then tape.Add machine(blank) Else If headpos < 1 Then tape.Add machine(blank), Before:=1 headpos = 1 End If End If If Not countOnly Then show state, headpos, tape For i = LBound(machine(rules)) To UBound(machine(rules)) rule = machine(rules)(i) If rule(1) = state And rule(2) = tape(headpos) Then tape.Remove headpos If headpos > tape.Count Then tape.Add rule(3) Else tape.Add rule(3), Before:=headpos End If If rule(4) = "left" Then headpos = headpos - 1 If rule(4) = "right" Then headpos = headpos + 1 state = rule(5) Exit For End If Next i counter = counter + 1 If counter Mod 100000 = 0 Then Debug.Print counter DoEvents DoEvents End If If state = machine(endState) Then Exit Do Loop DoEvents If countOnly Then Debug.Print "Steps taken: ", counter Else show state, headpos, tape Debug.Print End If End Sub Public Sub main() init Dim tap As New Collection tap.Add "1": tap.Add "1": tap.Add "1" UTM incrementer, tap Set tap = New Collection UTM threeStateBB, tap Set tap = New Collection UTM fiveStateBB, tap, countOnly:=-1 End Sub
Convert the following code from Java to VB, ensuring the logic remains intact.
import java.io.*; public class CreateFileTest { public static void main(String args[]) { try { new File("output.txt").createNewFile(); new File(File.separator + "output.txt").createNewFile(); new File("docs").mkdir(); new File(File.separator + "docs").mkdir(); } catch (IOException e) { System.err.println(e.getMessage()); } } }
Public Sub create_file() Dim FileNumber As Integer FileNumber = FreeFile MkDir "docs" Open "docs\output.txt" For Output As #FreeFile Close #FreeFile MkDir "C:\docs" Open "C:\docs\output.txt" For Output As #FreeFile Close #FreeFile End Sub
Transform the following Java implementation into VB, maintaining the same output and logic.
import java.util.HashMap; import java.util.Map; public class orderedSequence { public static void main(String[] args) { Sequence gene = new Sequence("CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATGCTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTGAGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGATGGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTTCGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGGTCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATATTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTATCGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTGTCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGACGACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT"); gene.runSequence(); } } public class Sequence { private final String seq; public Sequence(String sq) { this.seq = sq; } public void prettyPrint() { System.out.println("Sequence:"); int i = 0; for ( ; i < seq.length() - 50 ; i += 50) { System.out.printf("%5s : %s\n", i + 50, seq.substring(i, i + 50)); } System.out.printf("%5s : %s\n", seq.length(), seq.substring(i)); } public void displayCount() { Map<Character, Integer> counter = new HashMap<>(); for (int i = 0 ; i < seq.length() ; ++i) { counter.merge(seq.charAt(i), 1, Integer::sum); } System.out.println("Base vs. Count:"); counter.forEach( key, value -> System.out.printf("%5s : %s\n", key, value)); System.out.printf("%5s: %s\n", "SUM", seq.length()); } public void runSequence() { this.prettyPrint(); this.displayCount(); } }
b=_ "CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATG" &_ "CTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTG" &_ "AGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGAT" &_ "GGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT" &_ "CGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGG" &_ "TCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA" &_ "TTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTAT" &_ "CGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTG" &_ "TCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGAC" &_ "GACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT" s="SEQUENCE:" acnt=0:ccnt=0:gcnt=0:tcnt=0 for i=0 to len(b)-1 if (i mod 30)=0 then s = s & vbcrlf & right(" "& i+1,3)&": " if (i mod 5)=0 then s=s& " " m=mid(b,i+1,1) s=s & m select case m case "A":acnt=acnt+1 case "C":ccnt=ccnt+1 case "G":gcnt=gcnt+1 case "T":tcnt=tcnt+1 case else wscript.echo "error at ",i+1, m end select next wscript.echo s & vbcrlf wscript.echo "Count: A="&acnt & " C=" & ccnt & " G=" & gcnt & " T=" & tcnt
Write a version of this Java function in VB with identical behavior.
import java.util.HashMap; import java.util.Map; public class orderedSequence { public static void main(String[] args) { Sequence gene = new Sequence("CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATGCTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTGAGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGATGGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTTCGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGGTCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATATTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTATCGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTGTCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGACGACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT"); gene.runSequence(); } } public class Sequence { private final String seq; public Sequence(String sq) { this.seq = sq; } public void prettyPrint() { System.out.println("Sequence:"); int i = 0; for ( ; i < seq.length() - 50 ; i += 50) { System.out.printf("%5s : %s\n", i + 50, seq.substring(i, i + 50)); } System.out.printf("%5s : %s\n", seq.length(), seq.substring(i)); } public void displayCount() { Map<Character, Integer> counter = new HashMap<>(); for (int i = 0 ; i < seq.length() ; ++i) { counter.merge(seq.charAt(i), 1, Integer::sum); } System.out.println("Base vs. Count:"); counter.forEach( key, value -> System.out.printf("%5s : %s\n", key, value)); System.out.printf("%5s: %s\n", "SUM", seq.length()); } public void runSequence() { this.prettyPrint(); this.displayCount(); } }
b=_ "CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATG" &_ "CTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTG" &_ "AGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGAT" &_ "GGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT" &_ "CGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGG" &_ "TCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA" &_ "TTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTAT" &_ "CGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTG" &_ "TCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGAC" &_ "GACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT" s="SEQUENCE:" acnt=0:ccnt=0:gcnt=0:tcnt=0 for i=0 to len(b)-1 if (i mod 30)=0 then s = s & vbcrlf & right(" "& i+1,3)&": " if (i mod 5)=0 then s=s& " " m=mid(b,i+1,1) s=s & m select case m case "A":acnt=acnt+1 case "C":ccnt=ccnt+1 case "G":gcnt=gcnt+1 case "T":tcnt=tcnt+1 case else wscript.echo "error at ",i+1, m end select next wscript.echo s & vbcrlf wscript.echo "Count: A="&acnt & " C=" & ccnt & " G=" & gcnt & " T=" & tcnt
Convert the following code from Java to VB, ensuring the logic remains intact.
package diningphilosophers; import java.util.ArrayList; import java.util.Random; import java.util.concurrent.atomic.AtomicBoolean; import java.util.concurrent.atomic.AtomicInteger; enum PhilosopherState { Get, Eat, Pon } class Fork { public static final int ON_TABLE = -1; static int instances = 0; public int id; public AtomicInteger holder = new AtomicInteger(ON_TABLE); Fork() { id = instances++; } } class Philosopher implements Runnable { static final int maxWaitMs = 100; static AtomicInteger token = new AtomicInteger(0); static int instances = 0; static Random rand = new Random(); AtomicBoolean end = new AtomicBoolean(false); int id; PhilosopherState state = PhilosopherState.Get; Fork left; Fork right; int timesEaten = 0; Philosopher() { id = instances++; left = Main.forks.get(id); right = Main.forks.get((id+1)%Main.philosopherCount); } void sleep() { try { Thread.sleep(rand.nextInt(maxWaitMs)); } catch (InterruptedException ex) {} } void waitForFork(Fork fork) { do { if (fork.holder.get() == Fork.ON_TABLE) { fork.holder.set(id); return; } else { sleep(); } } while (true); } public void run() { do { if (state == PhilosopherState.Pon) { state = PhilosopherState.Get; } else { if (token.get() == id) { waitForFork(left); waitForFork(right); token.set((id+2)% Main.philosopherCount); state = PhilosopherState.Eat; timesEaten++; sleep(); left.holder.set(Fork.ON_TABLE); right.holder.set(Fork.ON_TABLE); state = PhilosopherState.Pon; sleep(); } else { sleep(); } } } while (!end.get()); } } public class Main { static final int philosopherCount = 5; static final int runSeconds = 15; static ArrayList<Fork> forks = new ArrayList<Fork>(); static ArrayList<Philosopher> philosophers = new ArrayList<Philosopher>(); public static void main(String[] args) { for (int i = 0 ; i < philosopherCount ; i++) forks.add(new Fork()); for (int i = 0 ; i < philosopherCount ; i++) philosophers.add(new Philosopher()); for (Philosopher p : philosophers) new Thread(p).start(); long endTime = System.currentTimeMillis() + (runSeconds * 1000); do { StringBuilder sb = new StringBuilder("|"); for (Philosopher p : philosophers) { sb.append(p.state.toString()); sb.append("|"); } sb.append(" |"); for (Fork f : forks) { int holder = f.holder.get(); sb.append(holder==-1?" ":String.format("P%02d",holder)); sb.append("|"); } System.out.println(sb.toString()); try {Thread.sleep(1000);} catch (Exception ex) {} } while (System.currentTimeMillis() < endTime); for (Philosopher p : philosophers) p.end.set(true); for (Philosopher p : philosophers) System.out.printf("P%02d: ate %,d times, %,d/sec\n", p.id, p.timesEaten, p.timesEaten/runSeconds); } }
Public Const HOLDON = False Public Const DIJKSTRASOLUTION = True Public Const X = 10 Public Const GETS = 0 Public Const PUTS = 1 Public Const EATS = 2 Public Const THKS = 5 Public Const FRSTFORK = 0 Public Const SCNDFORK = 1 Public Const SPAGHETI = 0 Public Const UNIVERSE = 1 Public Const MAXCOUNT = 100000 Public Const PHILOSOPHERS = 5 Public semaphore(PHILOSOPHERS - 1) As Integer Public positi0n(1, PHILOSOPHERS - 1) As Integer Public programcounter(PHILOSOPHERS - 1) As Long Public statistics(PHILOSOPHERS - 1, 5, 1) As Long Public names As Variant Private Sub init() names = [{"Aquinas","Babbage","Carroll","Derrida","Erasmus"}] For j = 0 To PHILOSOPHERS - 2 positi0n(0, j) = j + 1 positi0n(1, j) = j Next j If DIJKSTRASOLUTION Then positi0n(0, PHILOSOPHERS - 1) = j positi0n(1, PHILOSOPHERS - 1) = 0 Else positi0n(0, PHILOSOPHERS - 1) = 0 positi0n(1, PHILOSOPHERS - 1) = j End If End Sub Private Sub philosopher(subject As Integer, verb As Integer, objekt As Integer) statistics(subject, verb, objekt) = statistics(subject, verb, objekt) + 1 If verb < 2 Then If semaphore(positi0n(objekt, subject)) <> verb Then If Not HOLDON Then semaphore(positi0n(FRSTFORK, subject)) = 1 - objekt programcounter(subject) = 0 End If Else semaphore(positi0n(objekt, subject)) = 1 - verb programcounter(subject) = (programcounter(subject) + 1) Mod 6 End If Else programcounter(subject) = IIf(X * Rnd > 1, verb, verb + 1) Mod 6 End If End Sub Private Sub dine() Dim ph As Integer Do While TC < MAXCOUNT For ph = 0 To PHILOSOPHERS - 1 Select Case programcounter(ph) Case 0: philosopher ph, GETS, FRSTFORK Case 1: philosopher ph, GETS, SCNDFORK Case 2: philosopher ph, EATS, SPAGHETI Case 3: philosopher ph, PUTS, FRSTFORK Case 4: philosopher ph, PUTS, SCNDFORK Case 5: philosopher ph, THKS, UNIVERSE End Select TC = TC + 1 Next ph Loop End Sub Private Sub show() Debug.Print "Stats", "Gets", "Gets", "Eats", "Puts", "Puts", "Thinks" Debug.Print "", "First", "Second", "Spag-", "First", "Second", "About" Debug.Print "", "Fork", "Fork", "hetti", "Fork", "Fork", "Universe" For subject = 0 To PHILOSOPHERS - 1 Debug.Print names(subject + 1), For objekt = 0 To 1 Debug.Print statistics(subject, GETS, objekt), Next objekt Debug.Print statistics(subject, EATS, SPAGHETI), For objekt = 0 To 1 Debug.Print statistics(subject, PUTS, objekt), Next objekt Debug.Print statistics(subject, THKS, UNIVERSE) Next subject End Sub Public Sub main() init dine show End Sub
Convert this Java snippet to VB and keep its semantics consistent.
public class Factorion { public static void main(String [] args){ System.out.println("Base 9:"); for(int i = 1; i <= 1499999; i++){ String iStri = String.valueOf(i); int multiplied = operate(iStri,9); if(multiplied == i){ System.out.print(i + "\t"); } } System.out.println("\nBase 10:"); for(int i = 1; i <= 1499999; i++){ String iStri = String.valueOf(i); int multiplied = operate(iStri,10); if(multiplied == i){ System.out.print(i + "\t"); } } System.out.println("\nBase 11:"); for(int i = 1; i <= 1499999; i++){ String iStri = String.valueOf(i); int multiplied = operate(iStri,11); if(multiplied == i){ System.out.print(i + "\t"); } } System.out.println("\nBase 12:"); for(int i = 1; i <= 1499999; i++){ String iStri = String.valueOf(i); int multiplied = operate(iStri,12); if(multiplied == i){ System.out.print(i + "\t"); } } } public static int factorialRec(int n){ int result = 1; return n == 0 ? result : result * n * factorialRec(n-1); } public static int operate(String s, int base){ int sum = 0; String strx = fromDeci(base, Integer.parseInt(s)); for(int i = 0; i < strx.length(); i++){ if(strx.charAt(i) == 'A'){ sum += factorialRec(10); }else if(strx.charAt(i) == 'B') { sum += factorialRec(11); }else if(strx.charAt(i) == 'C') { sum += factorialRec(12); }else { sum += factorialRec(Integer.parseInt(String.valueOf(strx.charAt(i)), base)); } } return sum; } static char reVal(int num) { if (num >= 0 && num <= 9) return (char)(num + 48); else return (char)(num - 10 + 65); } static String fromDeci(int base, int num){ StringBuilder s = new StringBuilder(); while (num > 0) { s.append(reVal(num % base)); num /= base; } return new String(new StringBuilder(s).reverse()); } }
Dim fact() nn1=9 : nn2=12 lim=1499999 ReDim fact(nn2) fact(0)=1 For i=1 To nn2 fact(i)=fact(i-1)*i Next For base=nn1 To nn2 list="" For i=1 To lim s=0 t=i Do While t<>0 d=t Mod base s=s+fact(d) t=t\base Loop If s=i Then list=list &" "& i Next Wscript.Echo "the factorions for base "& right(" "& base,2) &" are: "& list Next
Write a version of this Java function in VB with identical behavior.
public class Factorion { public static void main(String [] args){ System.out.println("Base 9:"); for(int i = 1; i <= 1499999; i++){ String iStri = String.valueOf(i); int multiplied = operate(iStri,9); if(multiplied == i){ System.out.print(i + "\t"); } } System.out.println("\nBase 10:"); for(int i = 1; i <= 1499999; i++){ String iStri = String.valueOf(i); int multiplied = operate(iStri,10); if(multiplied == i){ System.out.print(i + "\t"); } } System.out.println("\nBase 11:"); for(int i = 1; i <= 1499999; i++){ String iStri = String.valueOf(i); int multiplied = operate(iStri,11); if(multiplied == i){ System.out.print(i + "\t"); } } System.out.println("\nBase 12:"); for(int i = 1; i <= 1499999; i++){ String iStri = String.valueOf(i); int multiplied = operate(iStri,12); if(multiplied == i){ System.out.print(i + "\t"); } } } public static int factorialRec(int n){ int result = 1; return n == 0 ? result : result * n * factorialRec(n-1); } public static int operate(String s, int base){ int sum = 0; String strx = fromDeci(base, Integer.parseInt(s)); for(int i = 0; i < strx.length(); i++){ if(strx.charAt(i) == 'A'){ sum += factorialRec(10); }else if(strx.charAt(i) == 'B') { sum += factorialRec(11); }else if(strx.charAt(i) == 'C') { sum += factorialRec(12); }else { sum += factorialRec(Integer.parseInt(String.valueOf(strx.charAt(i)), base)); } } return sum; } static char reVal(int num) { if (num >= 0 && num <= 9) return (char)(num + 48); else return (char)(num - 10 + 65); } static String fromDeci(int base, int num){ StringBuilder s = new StringBuilder(); while (num > 0) { s.append(reVal(num % base)); num /= base; } return new String(new StringBuilder(s).reverse()); } }
Dim fact() nn1=9 : nn2=12 lim=1499999 ReDim fact(nn2) fact(0)=1 For i=1 To nn2 fact(i)=fact(i-1)*i Next For base=nn1 To nn2 list="" For i=1 To lim s=0 t=i Do While t<>0 d=t Mod base s=s+fact(d) t=t\base Loop If s=i Then list=list &" "& i Next Wscript.Echo "the factorions for base "& right(" "& base,2) &" are: "& list Next
Change the programming language of this snippet from Java to VB without modifying what it does.
import java.util.HashMap; import java.util.Map; import java.util.Scanner; public class AbbreviationsEasy { private static final Scanner input = new Scanner(System.in); private static final String COMMAND_TABLE = " Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy\n" + " COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find\n" + " NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput\n" + " Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO\n" + " MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT\n" + " READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT\n" + " RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up"; public static void main(String[] args) { String[] cmdTableArr = COMMAND_TABLE.split("\\s+"); Map<String, Integer> cmd_table = new HashMap<String, Integer>(); for (String word : cmdTableArr) { cmd_table.put(word, countCaps(word)); } System.out.print("Please enter your command to verify: "); String userInput = input.nextLine(); String[] user_input = userInput.split("\\s+"); for (String s : user_input) { boolean match = false; for (String cmd : cmd_table.keySet()) { if (s.length() >= cmd_table.get(cmd) && s.length() <= cmd.length()) { String temp = cmd.toUpperCase(); if (temp.startsWith(s.toUpperCase())) { System.out.print(temp + " "); match = true; } } } if (!match) { System.out.print("*error* "); } } } private static int countCaps(String word) { int numCaps = 0; for (int i = 0; i < word.length(); i++) { if (Character.isUpperCase(word.charAt(i))) { numCaps++; } } return numCaps; } }
Private Function ValidateUserWords(userstring As String) As String Dim s As String Dim user_words() As String Dim command_table As Scripting.Dictionary Set command_table = New Scripting.Dictionary Dim abbreviations As Scripting.Dictionary Set abbreviations = New Scripting.Dictionary abbreviations.CompareMode = TextCompare Dim commandtable() As String Dim commands As String s = s & "Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy " s = s & "COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find " s = s & "NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput " s = s & "Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO " s = s & "MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT " s = s & "READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT " s = s & "RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up " commandtable = Split(s, " ") Dim i As Integer For Each word In commandtable If Len(word) > 0 Then i = 1 Do While Mid(word, i, 1) >= "A" And Mid(word, i, 1) <= "Z" i = i + 1 Loop command_table.Add Key:=word, Item:=i - 1 End If Next word For Each word In command_table For i = command_table(word) To Len(word) On Error Resume Next abbreviations.Add Key:=Left(word, i), Item:=UCase(word) Next i Next word user_words() = Split(userstring, " ") For Each word In user_words If Len(word) > 0 Then If abbreviations.exists(word) Then commands = commands & abbreviations(word) & " " Else commands = commands & "*error* " End If End If Next word ValidateUserWords = commands End Function Public Sub program() Dim guserstring As String guserstring = "riG rePEAT copies put mo rest types fup. 6 poweRin" Debug.Print "user words:", guserstring Debug.Print "full words:", ValidateUserWords(guserstring) End Sub
Convert this Java snippet to VB and keep its semantics consistent.
import java.util.HashMap; import java.util.Map; import java.util.Scanner; public class AbbreviationsEasy { private static final Scanner input = new Scanner(System.in); private static final String COMMAND_TABLE = " Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy\n" + " COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find\n" + " NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput\n" + " Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO\n" + " MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT\n" + " READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT\n" + " RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up"; public static void main(String[] args) { String[] cmdTableArr = COMMAND_TABLE.split("\\s+"); Map<String, Integer> cmd_table = new HashMap<String, Integer>(); for (String word : cmdTableArr) { cmd_table.put(word, countCaps(word)); } System.out.print("Please enter your command to verify: "); String userInput = input.nextLine(); String[] user_input = userInput.split("\\s+"); for (String s : user_input) { boolean match = false; for (String cmd : cmd_table.keySet()) { if (s.length() >= cmd_table.get(cmd) && s.length() <= cmd.length()) { String temp = cmd.toUpperCase(); if (temp.startsWith(s.toUpperCase())) { System.out.print(temp + " "); match = true; } } } if (!match) { System.out.print("*error* "); } } } private static int countCaps(String word) { int numCaps = 0; for (int i = 0; i < word.length(); i++) { if (Character.isUpperCase(word.charAt(i))) { numCaps++; } } return numCaps; } }
Private Function ValidateUserWords(userstring As String) As String Dim s As String Dim user_words() As String Dim command_table As Scripting.Dictionary Set command_table = New Scripting.Dictionary Dim abbreviations As Scripting.Dictionary Set abbreviations = New Scripting.Dictionary abbreviations.CompareMode = TextCompare Dim commandtable() As String Dim commands As String s = s & "Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy " s = s & "COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find " s = s & "NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput " s = s & "Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO " s = s & "MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT " s = s & "READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT " s = s & "RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up " commandtable = Split(s, " ") Dim i As Integer For Each word In commandtable If Len(word) > 0 Then i = 1 Do While Mid(word, i, 1) >= "A" And Mid(word, i, 1) <= "Z" i = i + 1 Loop command_table.Add Key:=word, Item:=i - 1 End If Next word For Each word In command_table For i = command_table(word) To Len(word) On Error Resume Next abbreviations.Add Key:=Left(word, i), Item:=UCase(word) Next i Next word user_words() = Split(userstring, " ") For Each word In user_words If Len(word) > 0 Then If abbreviations.exists(word) Then commands = commands & abbreviations(word) & " " Else commands = commands & "*error* " End If End If Next word ValidateUserWords = commands End Function Public Sub program() Dim guserstring As String guserstring = "riG rePEAT copies put mo rest types fup. 6 poweRin" Debug.Print "user words:", guserstring Debug.Print "full words:", ValidateUserWords(guserstring) End Sub
Write a version of this Java function in VB with identical behavior.
import java.util.HashMap; import java.util.Map; import java.util.Scanner; public class AbbreviationsEasy { private static final Scanner input = new Scanner(System.in); private static final String COMMAND_TABLE = " Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy\n" + " COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find\n" + " NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput\n" + " Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO\n" + " MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT\n" + " READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT\n" + " RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up"; public static void main(String[] args) { String[] cmdTableArr = COMMAND_TABLE.split("\\s+"); Map<String, Integer> cmd_table = new HashMap<String, Integer>(); for (String word : cmdTableArr) { cmd_table.put(word, countCaps(word)); } System.out.print("Please enter your command to verify: "); String userInput = input.nextLine(); String[] user_input = userInput.split("\\s+"); for (String s : user_input) { boolean match = false; for (String cmd : cmd_table.keySet()) { if (s.length() >= cmd_table.get(cmd) && s.length() <= cmd.length()) { String temp = cmd.toUpperCase(); if (temp.startsWith(s.toUpperCase())) { System.out.print(temp + " "); match = true; } } } if (!match) { System.out.print("*error* "); } } } private static int countCaps(String word) { int numCaps = 0; for (int i = 0; i < word.length(); i++) { if (Character.isUpperCase(word.charAt(i))) { numCaps++; } } return numCaps; } }
Private Function ValidateUserWords(userstring As String) As String Dim s As String Dim user_words() As String Dim command_table As Scripting.Dictionary Set command_table = New Scripting.Dictionary Dim abbreviations As Scripting.Dictionary Set abbreviations = New Scripting.Dictionary abbreviations.CompareMode = TextCompare Dim commandtable() As String Dim commands As String s = s & "Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy " s = s & "COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find " s = s & "NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput " s = s & "Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO " s = s & "MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT " s = s & "READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT " s = s & "RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up " commandtable = Split(s, " ") Dim i As Integer For Each word In commandtable If Len(word) > 0 Then i = 1 Do While Mid(word, i, 1) >= "A" And Mid(word, i, 1) <= "Z" i = i + 1 Loop command_table.Add Key:=word, Item:=i - 1 End If Next word For Each word In command_table For i = command_table(word) To Len(word) On Error Resume Next abbreviations.Add Key:=Left(word, i), Item:=UCase(word) Next i Next word user_words() = Split(userstring, " ") For Each word In user_words If Len(word) > 0 Then If abbreviations.exists(word) Then commands = commands & abbreviations(word) & " " Else commands = commands & "*error* " End If End If Next word ValidateUserWords = commands End Function Public Sub program() Dim guserstring As String guserstring = "riG rePEAT copies put mo rest types fup. 6 poweRin" Debug.Print "user words:", guserstring Debug.Print "full words:", ValidateUserWords(guserstring) End Sub
Rewrite this program in VB while keeping its functionality equivalent to the Java version.
import java.util.HashMap; import java.util.Map; import java.util.Objects; public class BaconCipher { private static final Map<Character, String> codes; static { codes = new HashMap<>(); codes.putAll(Map.of( 'a', "AAAAA", 'b', "AAAAB", 'c', "AAABA", 'd', "AAABB", 'e', "AABAA", 'f', "AABAB", 'g', "AABBA", 'h', "AABBB", 'i', "ABAAA", 'j', "ABAAB" )); codes.putAll(Map.of( 'k', "ABABA", 'l', "ABABB", 'm', "ABBAA", 'n', "ABBAB", 'o', "ABBBA", 'p', "ABBBB", 'q', "BAAAA", 'r', "BAAAB", 's', "BAABA", 't', "BAABB" )); codes.putAll(Map.of( 'u', "BABAA", 'v', "BABAB", 'w', "BABBA", 'x', "BABBB", 'y', "BBAAA", 'z', "BBAAB", ' ', "BBBAA" )); } private static String encode(String plainText, String message) { String pt = plainText.toLowerCase(); StringBuilder sb = new StringBuilder(); for (char c : pt.toCharArray()) { if ('a' <= c && c <= 'z') sb.append(codes.get(c)); else sb.append(codes.get(' ')); } String et = sb.toString(); String mg = message.toLowerCase(); sb.setLength(0); int count = 0; for (char c : mg.toCharArray()) { if ('a' <= c && c <= 'z') { if (et.charAt(count) == 'A') sb.append(c); else sb.append(((char) (c - 32))); count++; if (count == et.length()) break; } else sb.append(c); } return sb.toString(); } private static String decode(String message) { StringBuilder sb = new StringBuilder(); for (char c : message.toCharArray()) { if ('a' <= c && c <= 'z') sb.append('A'); if ('A' <= c && c <= 'Z') sb.append('B'); } String et = sb.toString(); sb.setLength(0); for (int i = 0; i < et.length(); i += 5) { String quintet = et.substring(i, i + 5); Character key = codes.entrySet().stream().filter(a -> Objects.equals(a.getValue(), quintet)).findFirst().map(Map.Entry::getKey).orElse(null); sb.append(key); } return sb.toString(); } public static void main(String[] args) { String plainText = "the quick brown fox jumps over the lazy dog"; String message = "bacon's cipher is a method of steganography created by francis bacon. " + "this task is to implement a program for encryption and decryption of " + "plaintext using the simple alphabet of the baconian cipher or some " + "other kind of representation of this alphabet (make anything signify anything). " + "the baconian alphabet may optionally be extended to encode all lower " + "case characters individually and/or adding a few punctuation characters " + "such as the space."; String cipherText = encode(plainText, message); System.out.printf("Cipher text ->\n\n%s\n", cipherText); String decodedText = decode(cipherText); System.out.printf("\nHidden text ->\n\n%s\n", decodedText); } }
Imports System.Text Module Module1 ReadOnly CODES As New Dictionary(Of Char, String) From { {"a", "AAAAA"}, {"b", "AAAAB"}, {"c", "AAABA"}, {"d", "AAABB"}, {"e", "AABAA"}, {"f", "AABAB"}, {"g", "AABBA"}, {"h", "AABBB"}, {"i", "ABAAA"}, {"j", "ABAAB"}, {"k", "ABABA"}, {"l", "ABABB"}, {"m", "ABBAA"}, {"n", "ABBAB"}, {"o", "ABBBA"}, {"p", "ABBBB"}, {"q", "BAAAA"}, {"r", "BAAAB"}, {"s", "BAABA"}, {"t", "BAABB"}, {"u", "BABAA"}, {"v", "BABAB"}, {"w", "BABBA"}, {"x", "BABBB"}, {"y", "BBAAA"}, {"z", "BBAAB"}, {" ", "BBBAA"} } Function Encode(plainText As String, message As String) As String Dim pt = plainText.ToLower() Dim sb As New StringBuilder() For Each c In pt If "a" <= c AndAlso c <= "z" Then sb.Append(CODES(c)) Else sb.Append(CODES(" ")) End If Next Dim et = sb.ToString() Dim mg = message.ToLower() sb.Length = 0 Dim count = 0 For Each c In mg If "a" <= c AndAlso c <= "z" Then If et(count) = "A" Then sb.Append(c) Else sb.Append(Chr(Asc(c) - 32)) End If count += 1 If count = et.Length Then Exit For End If Else sb.Append(c) End If Next Return sb.ToString() End Function Function Decode(message As String) As String Dim sb As New StringBuilder For Each c In message If "a" <= c AndAlso c <= "z" Then sb.Append("A") ElseIf "A" <= c AndAlso c <= "Z" Then sb.Append("B") End If Next Dim et = sb.ToString() sb.Length = 0 For index = 0 To et.Length - 1 Step 5 Dim quintet = et.Substring(index, 5) Dim key = CODES.Where(Function(a) a.Value = quintet).First().Key sb.Append(key) Next Return sb.ToString() End Function Sub Main() Dim plainText = "the quick brown fox jumps over the lazy dog" Dim message = "bacon "this task is to implement a program for encryption and decryption of " + "plaintext using the simple alphabet of the baconian cipher or some " + "other kind of representation of this alphabet (make anything signify anything). " + "the baconian alphabet may optionally be extended to encode all lower " + "case characters individually and/or adding a few punctuation characters " + "such as the space." Dim cipherText = Encode(plainText, message) Console.WriteLine("Cipher text ->" & Environment.NewLine & "{0}", cipherText) Dim decodedText = Decode(cipherText) Console.WriteLine(Environment.NewLine & "Hidden text ->" & Environment.NewLine & "{0}", decodedText) End Sub End Module
Please provide an equivalent version of this Java code in VB.
import java.util.HashMap; import java.util.Map; import java.util.Objects; public class BaconCipher { private static final Map<Character, String> codes; static { codes = new HashMap<>(); codes.putAll(Map.of( 'a', "AAAAA", 'b', "AAAAB", 'c', "AAABA", 'd', "AAABB", 'e', "AABAA", 'f', "AABAB", 'g', "AABBA", 'h', "AABBB", 'i', "ABAAA", 'j', "ABAAB" )); codes.putAll(Map.of( 'k', "ABABA", 'l', "ABABB", 'm', "ABBAA", 'n', "ABBAB", 'o', "ABBBA", 'p', "ABBBB", 'q', "BAAAA", 'r', "BAAAB", 's', "BAABA", 't', "BAABB" )); codes.putAll(Map.of( 'u', "BABAA", 'v', "BABAB", 'w', "BABBA", 'x', "BABBB", 'y', "BBAAA", 'z', "BBAAB", ' ', "BBBAA" )); } private static String encode(String plainText, String message) { String pt = plainText.toLowerCase(); StringBuilder sb = new StringBuilder(); for (char c : pt.toCharArray()) { if ('a' <= c && c <= 'z') sb.append(codes.get(c)); else sb.append(codes.get(' ')); } String et = sb.toString(); String mg = message.toLowerCase(); sb.setLength(0); int count = 0; for (char c : mg.toCharArray()) { if ('a' <= c && c <= 'z') { if (et.charAt(count) == 'A') sb.append(c); else sb.append(((char) (c - 32))); count++; if (count == et.length()) break; } else sb.append(c); } return sb.toString(); } private static String decode(String message) { StringBuilder sb = new StringBuilder(); for (char c : message.toCharArray()) { if ('a' <= c && c <= 'z') sb.append('A'); if ('A' <= c && c <= 'Z') sb.append('B'); } String et = sb.toString(); sb.setLength(0); for (int i = 0; i < et.length(); i += 5) { String quintet = et.substring(i, i + 5); Character key = codes.entrySet().stream().filter(a -> Objects.equals(a.getValue(), quintet)).findFirst().map(Map.Entry::getKey).orElse(null); sb.append(key); } return sb.toString(); } public static void main(String[] args) { String plainText = "the quick brown fox jumps over the lazy dog"; String message = "bacon's cipher is a method of steganography created by francis bacon. " + "this task is to implement a program for encryption and decryption of " + "plaintext using the simple alphabet of the baconian cipher or some " + "other kind of representation of this alphabet (make anything signify anything). " + "the baconian alphabet may optionally be extended to encode all lower " + "case characters individually and/or adding a few punctuation characters " + "such as the space."; String cipherText = encode(plainText, message); System.out.printf("Cipher text ->\n\n%s\n", cipherText); String decodedText = decode(cipherText); System.out.printf("\nHidden text ->\n\n%s\n", decodedText); } }
Imports System.Text Module Module1 ReadOnly CODES As New Dictionary(Of Char, String) From { {"a", "AAAAA"}, {"b", "AAAAB"}, {"c", "AAABA"}, {"d", "AAABB"}, {"e", "AABAA"}, {"f", "AABAB"}, {"g", "AABBA"}, {"h", "AABBB"}, {"i", "ABAAA"}, {"j", "ABAAB"}, {"k", "ABABA"}, {"l", "ABABB"}, {"m", "ABBAA"}, {"n", "ABBAB"}, {"o", "ABBBA"}, {"p", "ABBBB"}, {"q", "BAAAA"}, {"r", "BAAAB"}, {"s", "BAABA"}, {"t", "BAABB"}, {"u", "BABAA"}, {"v", "BABAB"}, {"w", "BABBA"}, {"x", "BABBB"}, {"y", "BBAAA"}, {"z", "BBAAB"}, {" ", "BBBAA"} } Function Encode(plainText As String, message As String) As String Dim pt = plainText.ToLower() Dim sb As New StringBuilder() For Each c In pt If "a" <= c AndAlso c <= "z" Then sb.Append(CODES(c)) Else sb.Append(CODES(" ")) End If Next Dim et = sb.ToString() Dim mg = message.ToLower() sb.Length = 0 Dim count = 0 For Each c In mg If "a" <= c AndAlso c <= "z" Then If et(count) = "A" Then sb.Append(c) Else sb.Append(Chr(Asc(c) - 32)) End If count += 1 If count = et.Length Then Exit For End If Else sb.Append(c) End If Next Return sb.ToString() End Function Function Decode(message As String) As String Dim sb As New StringBuilder For Each c In message If "a" <= c AndAlso c <= "z" Then sb.Append("A") ElseIf "A" <= c AndAlso c <= "Z" Then sb.Append("B") End If Next Dim et = sb.ToString() sb.Length = 0 For index = 0 To et.Length - 1 Step 5 Dim quintet = et.Substring(index, 5) Dim key = CODES.Where(Function(a) a.Value = quintet).First().Key sb.Append(key) Next Return sb.ToString() End Function Sub Main() Dim plainText = "the quick brown fox jumps over the lazy dog" Dim message = "bacon "this task is to implement a program for encryption and decryption of " + "plaintext using the simple alphabet of the baconian cipher or some " + "other kind of representation of this alphabet (make anything signify anything). " + "the baconian alphabet may optionally be extended to encode all lower " + "case characters individually and/or adding a few punctuation characters " + "such as the space." Dim cipherText = Encode(plainText, message) Console.WriteLine("Cipher text ->" & Environment.NewLine & "{0}", cipherText) Dim decodedText = Decode(cipherText) Console.WriteLine(Environment.NewLine & "Hidden text ->" & Environment.NewLine & "{0}", decodedText) End Sub End Module
Transform the following Java implementation into VB, maintaining the same output and logic.
public class Blah { public static void main(String[] args) { print2dArray(getSpiralArray(5)); } public static int[][] getSpiralArray(int dimension) { int[][] spiralArray = new int[dimension][dimension]; int numConcentricSquares = (int) Math.ceil((dimension) / 2.0); int j; int sideLen = dimension; int currNum = 0; for (int i = 0; i < numConcentricSquares; i++) { for (j = 0; j < sideLen; j++) { spiralArray[i][i + j] = currNum++; } for (j = 1; j < sideLen; j++) { spiralArray[i + j][dimension - 1 - i] = currNum++; } for (j = sideLen - 2; j > -1; j--) { spiralArray[dimension - 1 - i][i + j] = currNum++; } for (j = sideLen - 2; j > 0; j--) { spiralArray[i + j][i] = currNum++; } sideLen -= 2; } return spiralArray; } public static void print2dArray(int[][] array) { for (int[] row : array) { for (int elem : row) { System.out.printf("%3d", elem); } System.out.println(); } } }
Function build_spiral(n) botcol = 0 : topcol = n - 1 botrow = 0 : toprow = n - 1 Dim matrix() ReDim matrix(topcol,toprow) dir = 0 : col = 0 : row = 0 For i = 0 To n*n-1 matrix(col,row) = i Select Case dir Case 0 If col < topcol Then col = col + 1 Else dir = 1 : row = row + 1 : botrow = botrow + 1 End If Case 1 If row < toprow Then row = row + 1 Else dir = 2 : col = col - 1 : topcol = topcol - 1 End If Case 2 If col > botcol Then col = col - 1 Else dir = 3 : row = row - 1 : toprow = toprow - 1 End If Case 3 If row > botrow Then row = row - 1 Else dir = 0 : col = col + 1 : botcol = botcol + 1 End If End Select Next For y = 0 To n-1 For x = 0 To n-1 WScript.StdOut.Write matrix(x,y) & vbTab Next WScript.StdOut.WriteLine Next End Function build_spiral(CInt(WScript.Arguments(0)))
Keep all operations the same but rewrite the snippet in VB.
module OptionalParameters { typedef Type<String >.Orderer as ColumnOrderer; typedef Type<String[]>.Orderer as RowOrderer; static String[][] sort(String[][] table, ColumnOrderer? orderer = Null, Int column = 0, Boolean reverse = False, ) { orderer ?:= (s1, s2) -> s1 <=> s2; ColumnOrderer byString = reverse ? ((s1, s2) -> orderer(s1, s2).reversed) : orderer; RowOrderer byColumn = (row1, row2) -> byString(row1[column], row2[column]); return table.sorted(byColumn); } void run() { String[][] table = [ ["c", "x", "i"], ["a", "y", "p"], ["b", "z", "a"], ]; show("original input", table); show("by default sort on column 0", sort(table)); show("by column 2", sort(table, column=2)); show("by column 2 reversed", sort(table, column=2, reverse=True)); } void show(String title, String[][] table) { @Inject Console console; console.print($"{title}:"); for (val row : table) { console.print($" {row}"); } console.print(); } }
Private Sub optional_parameters(theRange As String, _ Optional ordering As Integer = 0, _ Optional column As Integer = 1, _ Optional reverse As Integer = 1) ActiveSheet.Sort.SortFields.Clear ActiveSheet.Sort.SortFields.Add _ Key:=Range(theRange).Columns(column), _ SortOn:=SortOnValues, _ Order:=reverse, _ DataOption:=ordering With ActiveSheet.Sort .SetRange Range(theRange) .Header = xlGuess .MatchCase = False .Orientation = xlTopToBottom .SortMethod = xlPinYin .Apply End With End Sub Public Sub main() optional_parameters theRange:="A1:C4", ordering:=1, column:=2, reverse:=1 End Sub
Change the following Java code into VB without altering its purpose.
public class JNIDemo { static { System.loadLibrary("JNIDemo"); } public static void main(String[] args) { System.out.println(callStrdup("Hello World!")); } private static native String callStrdup(String s); }
Declare Function CreateFileW Lib "Kernel32" (FileName As WString, DesiredAccess As Integer, ShareMode As Integer, SecurityAttributes As Integer, _ CreateDisposition As Integer, Flags As Integer, Template As Integer) As Integer Declare Function WriteFile Lib "Kernel32" (fHandle As Integer, writeData As Ptr, numOfBytes As Integer, ByRef numOfBytesWritten As Integer, _ overlapped As Ptr) As Boolean Declare Function GetLastError Lib "Kernel32" () As Integer Declare Function CloseHandle Lib "kernel32" (hObject As Integer) As Boolean Const FILE_SHARE_READ = &h00000001 Const FILE_SHARE_WRITE = &h00000002 Const OPEN_EXISTING = 3 Dim fHandle As Integer = CreateFileW("C:\foo.txt", 0, FILE_SHARE_READ Or FILE_SHARE_WRITE, 0, OPEN_EXISTING, 0, 0) If fHandle > 0 Then Dim mb As MemoryBlock = "Hello, World!" Dim bytesWritten As Integer If Not WriteFile(fHandle, mb, mb.Size, bytesWritten, Nil) Then MsgBox("Error Number: " + Str(GetLastError)) End If Call CloseHandle(fHandle) Else MsgBox("Error Number: " + Str(GetLastError)) End If
Translate the given Java code snippet into VB without altering its behavior.
import java.math.BigDecimal; import java.math.MathContext; import java.util.Arrays; import java.util.stream.LongStream; public class FaulhabersTriangle { private static final MathContext MC = new MathContext(256); private static long gcd(long a, long b) { if (b == 0) { return a; } return gcd(b, a % b); } private static class Frac implements Comparable<Frac> { private long num; private long denom; public static final Frac ZERO = new Frac(0, 1); public Frac(long n, long d) { if (d == 0) throw new IllegalArgumentException("d must not be zero"); long nn = n; long dd = d; if (nn == 0) { dd = 1; } else if (dd < 0) { nn = -nn; dd = -dd; } long g = Math.abs(gcd(nn, dd)); if (g > 1) { nn /= g; dd /= g; } num = nn; denom = dd; } public Frac plus(Frac rhs) { return new Frac(num * rhs.denom + denom * rhs.num, rhs.denom * denom); } public Frac unaryMinus() { return new Frac(-num, denom); } public Frac minus(Frac rhs) { return this.plus(rhs.unaryMinus()); } public Frac times(Frac rhs) { return new Frac(this.num * rhs.num, this.denom * rhs.denom); } @Override public int compareTo(Frac o) { double diff = toDouble() - o.toDouble(); return Double.compare(diff, 0.0); } @Override public boolean equals(Object obj) { return null != obj && obj instanceof Frac && this.compareTo((Frac) obj) == 0; } @Override public String toString() { if (denom == 1) { return Long.toString(num); } return String.format("%d/%d", num, denom); } public double toDouble() { return (double) num / denom; } public BigDecimal toBigDecimal() { return BigDecimal.valueOf(num).divide(BigDecimal.valueOf(denom), MC); } } private static Frac bernoulli(int n) { if (n < 0) throw new IllegalArgumentException("n may not be negative or zero"); Frac[] a = new Frac[n + 1]; Arrays.fill(a, Frac.ZERO); for (int m = 0; m <= n; ++m) { a[m] = new Frac(1, m + 1); for (int j = m; j >= 1; --j) { a[j - 1] = a[j - 1].minus(a[j]).times(new Frac(j, 1)); } } if (n != 1) return a[0]; return a[0].unaryMinus(); } private static long binomial(int n, int k) { if (n < 0 || k < 0 || n < k) throw new IllegalArgumentException(); if (n == 0 || k == 0) return 1; long num = LongStream.rangeClosed(k + 1, n).reduce(1, (a, b) -> a * b); long den = LongStream.rangeClosed(2, n - k).reduce(1, (acc, i) -> acc * i); return num / den; } private static Frac[] faulhaberTriangle(int p) { Frac[] coeffs = new Frac[p + 1]; Arrays.fill(coeffs, Frac.ZERO); Frac q = new Frac(1, p + 1); int sign = -1; for (int j = 0; j <= p; ++j) { sign *= -1; coeffs[p - j] = q.times(new Frac(sign, 1)).times(new Frac(binomial(p + 1, j), 1)).times(bernoulli(j)); } return coeffs; } public static void main(String[] args) { for (int i = 0; i <= 9; ++i) { Frac[] coeffs = faulhaberTriangle(i); for (Frac coeff : coeffs) { System.out.printf("%5s ", coeff); } System.out.println(); } System.out.println(); int k = 17; Frac[] cc = faulhaberTriangle(k); int n = 1000; BigDecimal nn = BigDecimal.valueOf(n); BigDecimal np = BigDecimal.ONE; BigDecimal sum = BigDecimal.ZERO; for (Frac c : cc) { np = np.multiply(nn); sum = sum.add(np.multiply(c.toBigDecimal())); } System.out.println(sum.toBigInteger()); } }
Module Module1 Class Frac Private ReadOnly num As Long Private ReadOnly denom As Long Public Shared ReadOnly ZERO = New Frac(0, 1) Public Shared ReadOnly ONE = New Frac(1, 1) Public Sub New(n As Long, d As Long) If d = 0 Then Throw New ArgumentException("d must not be zero") End If Dim nn = n Dim dd = d If nn = 0 Then dd = 1 ElseIf dd < 0 Then nn = -nn dd = -dd End If Dim g = Math.Abs(Gcd(nn, dd)) If g > 1 Then nn /= g dd /= g End If num = nn denom = dd End Sub Private Shared Function Gcd(a As Long, b As Long) As Long If b = 0 Then Return a Else Return Gcd(b, a Mod b) End If End Function Public Shared Operator -(self As Frac) As Frac Return New Frac(-self.num, self.denom) End Operator Public Shared Operator +(lhs As Frac, rhs As Frac) As Frac Return New Frac(lhs.num * rhs.denom + lhs.denom * rhs.num, rhs.denom * lhs.denom) End Operator Public Shared Operator -(lhs As Frac, rhs As Frac) As Frac Return lhs + -rhs End Operator Public Shared Operator *(lhs As Frac, rhs As Frac) As Frac Return New Frac(lhs.num * rhs.num, lhs.denom * rhs.denom) End Operator Public Shared Operator <(lhs As Frac, rhs As Frac) As Boolean Dim x = lhs.num / lhs.denom Dim y = rhs.num / rhs.denom Return x < y End Operator Public Shared Operator >(lhs As Frac, rhs As Frac) As Boolean Dim x = lhs.num / lhs.denom Dim y = rhs.num / rhs.denom Return x > y End Operator Public Shared Operator =(lhs As Frac, rhs As Frac) As Boolean Return lhs.num = rhs.num AndAlso lhs.denom = rhs.denom End Operator Public Shared Operator <>(lhs As Frac, rhs As Frac) As Boolean Return lhs.num <> rhs.num OrElse lhs.denom <> rhs.denom End Operator Public Overrides Function ToString() As String If denom = 1 Then Return num.ToString Else Return String.Format("{0}/{1}", num, denom) End If End Function Public Overrides Function Equals(obj As Object) As Boolean Dim frac = CType(obj, Frac) Return Not IsNothing(frac) AndAlso num = frac.num AndAlso denom = frac.denom End Function End Class Function Bernoulli(n As Integer) As Frac If n < 0 Then Throw New ArgumentException("n may not be negative or zero") End If Dim a(n + 1) As Frac For m = 0 To n a(m) = New Frac(1, m + 1) For j = m To 1 Step -1 a(j - 1) = (a(j - 1) - a(j)) * New Frac(j, 1) Next Next If n <> 1 Then Return a(0) Else Return -a(0) End If End Function Function Binomial(n As Integer, k As Integer) As Integer If n < 0 OrElse k < 0 OrElse n < k Then Throw New ArgumentException() End If If n = 0 OrElse k = 0 Then Return 1 End If Dim num = 1 For i = k + 1 To n num *= i Next Dim denom = 1 For i = 2 To n - k denom *= i Next Return num \ denom End Function Function FaulhaberTriangle(p As Integer) As Frac() Dim coeffs(p + 1) As Frac For i = 1 To p + 1 coeffs(i - 1) = Frac.ZERO Next Dim q As New Frac(1, p + 1) Dim sign = -1 For j = 0 To p sign *= -1 coeffs(p - j) = q * New Frac(sign, 1) * New Frac(Binomial(p + 1, j), 1) * Bernoulli(j) Next Return coeffs End Function Sub Main() For i = 1 To 10 Dim coeffs = FaulhaberTriangle(i - 1) For Each coeff In coeffs Console.Write("{0,5} ", coeff) Next Console.WriteLine() Next End Sub End Module
Write the same code in VB as shown below in Java.
public class Arguments { public static void main(String[] args) { System.out.println("There are " + args.length + " arguments given."); for(int i = 0; i < args.length; i++) System.out.println("The argument #" + (i+1) + " is " + args[i] + " and is at index " + i); } }
Function Run(args() as String) As Integer For each arg As String In args Stdout.WriteLine(arg) Next End Function
Write the same algorithm in VB as shown in this Java implementation.
public class Arguments { public static void main(String[] args) { System.out.println("There are " + args.length + " arguments given."); for(int i = 0; i < args.length; i++) System.out.println("The argument #" + (i+1) + " is " + args[i] + " and is at index " + i); } }
Function Run(args() as String) As Integer For each arg As String In args Stdout.WriteLine(arg) Next End Function
Translate the given Java code snippet into VB without altering its behavior.
public class Arguments { public static void main(String[] args) { System.out.println("There are " + args.length + " arguments given."); for(int i = 0; i < args.length; i++) System.out.println("The argument #" + (i+1) + " is " + args[i] + " and is at index " + i); } }
Function Run(args() as String) As Integer For each arg As String In args Stdout.WriteLine(arg) Next End Function
Translate this program into VB but keep the logic exactly as in Java.
String[] fruits = ["apples", "oranges"]; String[] grains = ["wheat", "corn"]; String[] all = fruits + grains;
DEFINT A(1 to 4) = {1, 2, 3, 4} DEFINT B(1 to 4) = {10, 20, 30, 40} Redim A(1 to 8) as integer MEMCPY(varptr(A(5)), varptr(B(1)), Sizeof(integer)*4)
Convert the following code from Java to VB, ensuring the logic remains intact.
String[] fruits = ["apples", "oranges"]; String[] grains = ["wheat", "corn"]; String[] all = fruits + grains;
DEFINT A(1 to 4) = {1, 2, 3, 4} DEFINT B(1 to 4) = {10, 20, 30, 40} Redim A(1 to 8) as integer MEMCPY(varptr(A(5)), varptr(B(1)), Sizeof(integer)*4)
Produce a functionally identical VB code for the snippet given in Java.
import java.util.Scanner; public class GetInput { public static void main(String[] args) throws Exception { Scanner s = new Scanner(System.in); System.out.print("Enter a string: "); String str = s.nextLine(); System.out.print("Enter an integer: "); int i = Integer.parseInt(s.next()); } }
Public Sub text() Debug.Print InputBox("Input a string") Debug.Print InputBox("Input the integer 75000", "Input an integer", 75000, Context = "Long") End Sub
Convert this Java block to VB, preserving its control flow and logic.
import processing.sound.*; float[] frequencies = {261.63, 293.66, 329.63, 349.23, 392.00, 440.00, 493.88, 523.25}; SinOsc sine; size(500,500); sine = new SinOsc(this); for(int i=0;i<frequencies.length;i++){ sine.freq(frequencies[i]); sine.play(); delay(500); }
Option Explicit Declare Function Beep Lib "kernel32" (ByVal Freq As Long, ByVal Dur As Long) As Long Sub Musical_Scale() Dim Fqs, i As Integer Fqs = Array(264, 297, 330, 352, 396, 440, 495, 528) For i = LBound(Fqs) To UBound(Fqs) Beep Fqs(i), 500 Next End Sub
Preserve the algorithm and functionality while converting the code from Java to VB.
import processing.sound.*; float[] frequencies = {261.63, 293.66, 329.63, 349.23, 392.00, 440.00, 493.88, 523.25}; SinOsc sine; size(500,500); sine = new SinOsc(this); for(int i=0;i<frequencies.length;i++){ sine.freq(frequencies[i]); sine.play(); delay(500); }
Option Explicit Declare Function Beep Lib "kernel32" (ByVal Freq As Long, ByVal Dur As Long) As Long Sub Musical_Scale() Dim Fqs, i As Integer Fqs = Array(264, 297, 330, 352, 396, 440, 495, 528) For i = LBound(Fqs) To UBound(Fqs) Beep Fqs(i), 500 Next End Sub
Port the provided Java code into VB while preserving the original functionality.
package hu.pj.alg.test; import hu.pj.alg.ZeroOneKnapsack; import hu.pj.obj.Item; import java.util.*; import java.text.*; public class ZeroOneKnapsackForTourists { public ZeroOneKnapsackForTourists() { ZeroOneKnapsack zok = new ZeroOneKnapsack(400); zok.add("map", 9, 150); zok.add("compass", 13, 35); zok.add("water", 153, 200); zok.add("sandwich", 50, 160); zok.add("glucose", 15, 60); zok.add("tin", 68, 45); zok.add("banana", 27, 60); zok.add("apple", 39, 40); zok.add("cheese", 23, 30); zok.add("beer", 52, 10); zok.add("suntan cream", 11, 70); zok.add("camera", 32, 30); zok.add("t-shirt", 24, 15); zok.add("trousers", 48, 10); zok.add("umbrella", 73, 40); zok.add("waterproof trousers", 42, 70); zok.add("waterproof overclothes", 43, 75); zok.add("note-case", 22, 80); zok.add("sunglasses", 7, 20); zok.add("towel", 18, 12); zok.add("socks", 4, 50); zok.add("book", 30, 10); List<Item> itemList = zok.calcSolution(); if (zok.isCalculated()) { NumberFormat nf = NumberFormat.getInstance(); System.out.println( "Maximal weight = " + nf.format(zok.getMaxWeight() / 100.0) + " kg" ); System.out.println( "Total weight of solution = " + nf.format(zok.getSolutionWeight() / 100.0) + " kg" ); System.out.println( "Total value = " + zok.getProfit() ); System.out.println(); System.out.println( "You can carry the following materials " + "in the knapsack:" ); for (Item item : itemList) { if (item.getInKnapsack() == 1) { System.out.format( "%1$-23s %2$-3s %3$-5s %4$-15s \n", item.getName(), item.getWeight(), "dag ", "(value = " + item.getValue() + ")" ); } } } else { System.out.println( "The problem is not solved. " + "Maybe you gave wrong data." ); } } public static void main(String[] args) { new ZeroOneKnapsackForTourists(); } }
Option Explicit Const maxWeight = 400 Dim DataList As Variant Dim xList(64, 3) As Variant Dim nItems As Integer Dim s As String, xss As String Dim xwei As Integer, xval As Integer, nn As Integer Sub Main() Dim i As Integer, j As Integer DataList = Array("map", 9, 150, "compass", 13, 35, "water", 153, 200, "sandwich", 50, 160, _ "glucose", 15, 60, "tin", 68, 45, "banana", 27, 60, "apple", 39, 40, _ "cheese", 23, 30, "beer", 52, 10, "suntan cream", 11, 70, "camera", 32, 30, _ "T-shirt", 24, 15, "trousers", 48, 10, "umbrella", 73, 40, "book", 30, 10, _ "waterproof trousers", 42, 70, "waterproof overclothes", 43, 75, _ "note-case", 22, 80, "sunglasses", 7, 20, "towel", 18, 12, "socks", 4, 50) nItems = (UBound(DataList) + 1) / 3 j = 0 For i = 1 To nItems xList(i, 1) = DataList(j) xList(i, 2) = DataList(j + 1) xList(i, 3) = DataList(j + 2) j = j + 3 Next i s = "" For i = 1 To nItems s = s & Chr(i) Next nn = 0 Call ChoiceBin(1, "") For i = 1 To Len(xss) j = Asc(Mid(xss, i, 1)) Debug.Print xList(j, 1) Next i Debug.Print "count=" & Len(xss), "weight=" & xwei, "value=" & xval End Sub Private Sub ChoiceBin(n As String, ss As String) Dim r As String Dim i As Integer, j As Integer, iwei As Integer, ival As Integer Dim ipct As Integer If n = Len(s) + 1 Then iwei = 0: ival = 0 For i = 1 To Len(ss) j = Asc(Mid(ss, i, 1)) iwei = iwei + xList(j, 2) ival = ival + xList(j, 3) Next If iwei <= maxWeight And ival > xval Then xss = ss: xwei = iwei: xval = ival End If Else r = Mid(s, n, 1) Call ChoiceBin(n + 1, ss & r) Call ChoiceBin(n + 1, ss) End If End Sub
Port the provided Java code into VB while preserving the original functionality.
package hu.pj.alg.test; import hu.pj.alg.ZeroOneKnapsack; import hu.pj.obj.Item; import java.util.*; import java.text.*; public class ZeroOneKnapsackForTourists { public ZeroOneKnapsackForTourists() { ZeroOneKnapsack zok = new ZeroOneKnapsack(400); zok.add("map", 9, 150); zok.add("compass", 13, 35); zok.add("water", 153, 200); zok.add("sandwich", 50, 160); zok.add("glucose", 15, 60); zok.add("tin", 68, 45); zok.add("banana", 27, 60); zok.add("apple", 39, 40); zok.add("cheese", 23, 30); zok.add("beer", 52, 10); zok.add("suntan cream", 11, 70); zok.add("camera", 32, 30); zok.add("t-shirt", 24, 15); zok.add("trousers", 48, 10); zok.add("umbrella", 73, 40); zok.add("waterproof trousers", 42, 70); zok.add("waterproof overclothes", 43, 75); zok.add("note-case", 22, 80); zok.add("sunglasses", 7, 20); zok.add("towel", 18, 12); zok.add("socks", 4, 50); zok.add("book", 30, 10); List<Item> itemList = zok.calcSolution(); if (zok.isCalculated()) { NumberFormat nf = NumberFormat.getInstance(); System.out.println( "Maximal weight = " + nf.format(zok.getMaxWeight() / 100.0) + " kg" ); System.out.println( "Total weight of solution = " + nf.format(zok.getSolutionWeight() / 100.0) + " kg" ); System.out.println( "Total value = " + zok.getProfit() ); System.out.println(); System.out.println( "You can carry the following materials " + "in the knapsack:" ); for (Item item : itemList) { if (item.getInKnapsack() == 1) { System.out.format( "%1$-23s %2$-3s %3$-5s %4$-15s \n", item.getName(), item.getWeight(), "dag ", "(value = " + item.getValue() + ")" ); } } } else { System.out.println( "The problem is not solved. " + "Maybe you gave wrong data." ); } } public static void main(String[] args) { new ZeroOneKnapsackForTourists(); } }
Option Explicit Const maxWeight = 400 Dim DataList As Variant Dim xList(64, 3) As Variant Dim nItems As Integer Dim s As String, xss As String Dim xwei As Integer, xval As Integer, nn As Integer Sub Main() Dim i As Integer, j As Integer DataList = Array("map", 9, 150, "compass", 13, 35, "water", 153, 200, "sandwich", 50, 160, _ "glucose", 15, 60, "tin", 68, 45, "banana", 27, 60, "apple", 39, 40, _ "cheese", 23, 30, "beer", 52, 10, "suntan cream", 11, 70, "camera", 32, 30, _ "T-shirt", 24, 15, "trousers", 48, 10, "umbrella", 73, 40, "book", 30, 10, _ "waterproof trousers", 42, 70, "waterproof overclothes", 43, 75, _ "note-case", 22, 80, "sunglasses", 7, 20, "towel", 18, 12, "socks", 4, 50) nItems = (UBound(DataList) + 1) / 3 j = 0 For i = 1 To nItems xList(i, 1) = DataList(j) xList(i, 2) = DataList(j + 1) xList(i, 3) = DataList(j + 2) j = j + 3 Next i s = "" For i = 1 To nItems s = s & Chr(i) Next nn = 0 Call ChoiceBin(1, "") For i = 1 To Len(xss) j = Asc(Mid(xss, i, 1)) Debug.Print xList(j, 1) Next i Debug.Print "count=" & Len(xss), "weight=" & xwei, "value=" & xval End Sub Private Sub ChoiceBin(n As String, ss As String) Dim r As String Dim i As Integer, j As Integer, iwei As Integer, ival As Integer Dim ipct As Integer If n = Len(s) + 1 Then iwei = 0: ival = 0 For i = 1 To Len(ss) j = Asc(Mid(ss, i, 1)) iwei = iwei + xList(j, 2) ival = ival + xList(j, 3) Next If iwei <= maxWeight And ival > xval Then xss = ss: xwei = iwei: xval = ival End If Else r = Mid(s, n, 1) Call ChoiceBin(n + 1, ss & r) Call ChoiceBin(n + 1, ss) End If End Sub
Write the same algorithm in VB as shown in this Java implementation.
import java.io.*; import java.util.*; public class PrimeDescendants { public static void main(String[] args) { try (Writer writer = new BufferedWriter(new OutputStreamWriter(System.out))) { printPrimeDesc(writer, 100); } catch (IOException ex) { ex.printStackTrace(); } } private static void printPrimeDesc(Writer writer, int limit) throws IOException { List<Long> primes = findPrimes(limit); List<Long> ancestor = new ArrayList<>(limit); List<List<Long>> descendants = new ArrayList<>(limit); for (int i = 0; i < limit; ++i) { ancestor.add(Long.valueOf(0)); descendants.add(new ArrayList<Long>()); } for (Long prime : primes) { int p = prime.intValue(); descendants.get(p).add(prime); for (int i = 0; i + p < limit; ++i) { int s = i + p; for (Long n : descendants.get(i)) { Long prod = n * p; descendants.get(s).add(prod); if (prod < limit) ancestor.set(prod.intValue(), Long.valueOf(s)); } } } int totalDescendants = 0; for (int i = 1; i < limit; ++i) { List<Long> ancestors = getAncestors(ancestor, i); writer.write("[" + i + "] Level: " + ancestors.size() + "\n"); writer.write("Ancestors: "); Collections.sort(ancestors); print(writer, ancestors); writer.write("Descendants: "); List<Long> desc = descendants.get(i); if (!desc.isEmpty()) { Collections.sort(desc); if (desc.get(0) == i) desc.remove(0); } writer.write(desc.size() + "\n"); totalDescendants += desc.size(); if (!desc.isEmpty()) print(writer, desc); writer.write("\n"); } writer.write("Total descendants: " + totalDescendants + "\n"); } private static List<Long> findPrimes(int limit) { boolean[] isprime = new boolean[limit]; Arrays.fill(isprime, true); isprime[0] = isprime[1] = false; for (int p = 2; p * p < limit; ++p) { if (isprime[p]) { for (int i = p * p; i < limit; i += p) isprime[i] = false; } } List<Long> primes = new ArrayList<>(); for (int p = 2; p < limit; ++p) { if (isprime[p]) primes.add(Long.valueOf(p)); } return primes; } private static List<Long> getAncestors(List<Long> ancestor, int n) { List<Long> result = new ArrayList<>(); for (Long a = ancestor.get(n); a != 0 && a != n; ) { n = a.intValue(); a = ancestor.get(n); result.add(Long.valueOf(n)); } return result; } private static void print(Writer writer, List<Long> list) throws IOException { if (list.isEmpty()) { writer.write("none\n"); return; } int i = 0; writer.write(String.valueOf(list.get(i++))); for (; i != list.size(); ++i) writer.write(", " + list.get(i)); writer.write("\n"); } }
Imports System.Math Module Module1 Const MAXPRIME = 99 Const MAXPARENT = 99 Const NBRCHILDREN = 547100 Public Primes As New Collection() Public PrimesR As New Collection() Public Ancestors As New Collection() Public Parents(MAXPARENT + 1) As Integer Public CptDescendants(MAXPARENT + 1) As Integer Public Children(NBRCHILDREN) As ChildStruct Public iChildren As Integer Public Delimiter As String = ", " Public Structure ChildStruct Public Child As Long Public pLower As Integer Public pHigher As Integer End Structure Sub Main() Dim Parent As Short Dim Sum As Short Dim i As Short Dim TotDesc As Integer = 0 Dim MidPrime As Integer If GetPrimes(Primes, MAXPRIME) = vbFalse Then Return End If For i = Primes.Count To 1 Step -1 PrimesR.Add(Primes.Item(i)) Next MidPrime = PrimesR.Item(1) / 2 For Each Prime In PrimesR Parents(Prime) = InsertChild(Parents(Prime), Prime) CptDescendants(Prime) += 1 If Prime > MidPrime Then Continue For End If For Parent = 1 To MAXPARENT Sum = Parent + Prime If Sum > MAXPARENT Then Exit For End If If Parents(Parent) Then InsertPreorder(Parents(Parent), Sum, Prime) CptDescendants(Sum) += CptDescendants(Parent) End If Next Next RemoveFalseChildren() If MAXPARENT > MAXPRIME Then If GetPrimes(Primes, MAXPARENT) = vbFalse Then Return End If End If FileOpen(1, "Ancestors.txt", OpenMode.Output) For Parent = 1 To MAXPARENT GetAncestors(Parent) PrintLine(1, "[" & Parent.ToString & "] Level: " & Ancestors.Count.ToString) If Ancestors.Count Then Print(1, "Ancestors: " & Ancestors.Item(1).ToString) For i = 2 To Ancestors.Count Print(1, ", " & Ancestors.Item(i).ToString) Next PrintLine(1) Ancestors.Clear() Else PrintLine(1, "Ancestors: None") End If If CptDescendants(Parent) Then PrintLine(1, "Descendants: " & CptDescendants(Parent).ToString) Delimiter = "" PrintDescendants(Parents(Parent)) PrintLine(1) TotDesc += CptDescendants(Parent) Else PrintLine(1, "Descendants: None") End If PrintLine(1) Next Primes.Clear() PrimesR.Clear() PrintLine(1, "Total descendants " & TotDesc.ToString) PrintLine(1) FileClose(1) End Sub Function InsertPreorder(_index As Integer, _sum As Short, _prime As Short) Parents(_sum) = InsertChild(Parents(_sum), Children(_index).Child * _prime) If Children(_index).pLower Then InsertPreorder(Children(_index).pLower, _sum, _prime) End If If Children(_index).pHigher Then InsertPreorder(Children(_index).pHigher, _sum, _prime) End If Return Nothing End Function Function InsertChild(_index As Integer, _child As Long) As Integer If _index Then If _child <= Children(_index).Child Then Children(_index).pLower = InsertChild(Children(_index).pLower, _child) Else Children(_index).pHigher = InsertChild(Children(_index).pHigher, _child) End If Else iChildren += 1 _index = iChildren Children(_index).Child = _child Children(_index).pLower = 0 Children(_index).pHigher = 0 End If Return _index End Function Function RemoveFalseChildren() Dim Exclusions As New Collection Exclusions.Add(4) For Each Prime In Primes Exclusions.Add(Prime) Next For Each ex In Exclusions Parents(ex) = Children(Parents(ex)).pHigher CptDescendants(ex) -= 1 Next Exclusions.Clear() Return Nothing End Function Function GetAncestors(_child As Short) Dim Child As Short = _child Dim Parent As Short = 0 For Each Prime In Primes If Child = 1 Then Exit For End If While Child Mod Prime = 0 Child /= Prime Parent += Prime End While Next If Parent = _child Or _child = 1 Then Return Nothing End If GetAncestors(Parent) Ancestors.Add(Parent) Return Nothing End Function Function PrintDescendants(_index As Integer) If Children(_index).pLower Then PrintDescendants(Children(_index).pLower) End If Print(1, Delimiter.ToString & Children(_index).Child.ToString) Delimiter = ", " If Children(_index).pHigher Then PrintDescendants(Children(_index).pHigher) End If Return Nothing End Function Function GetPrimes(ByRef _primes As Object, Optional _maxPrime As Integer = 2) As Boolean Dim Value As Integer = 3 Dim Max As Integer Dim Prime As Integer If _maxPrime < 2 Then Return vbFalse End If _primes.Add(2) While Value <= _maxPrime Max = Floor(Sqrt(Value)) For Each Prime In _primes If Prime > Max Then _primes.Add(Value) Exit For End If If Value Mod Prime = 0 Then Exit For End If Next Value += 2 End While Return vbTrue End Function End Module
Write a version of this Java function in VB with identical behavior.
import static java.util.Arrays.asList; import static java.util.Collections.emptyList; import static java.util.Optional.of; import static java.util.stream.Collectors.toList; import java.util.List; public class CartesianProduct { public List<?> product(List<?>... a) { if (a.length >= 2) { List<?> product = a[0]; for (int i = 1; i < a.length; i++) { product = product(product, a[i]); } return product; } return emptyList(); } private <A, B> List<?> product(List<A> a, List<B> b) { return of(a.stream() .map(e1 -> of(b.stream().map(e2 -> asList(e1, e2)).collect(toList())).orElse(emptyList())) .flatMap(List::stream) .collect(toList())).orElse(emptyList()); } }
Imports System.Runtime.CompilerServices Module Module1 <Extension()> Function CartesianProduct(Of T)(sequences As IEnumerable(Of IEnumerable(Of T))) As IEnumerable(Of IEnumerable(Of T)) Dim emptyProduct As IEnumerable(Of IEnumerable(Of T)) = {Enumerable.Empty(Of T)} Return sequences.Aggregate(emptyProduct, Function(accumulator, sequence) From acc In accumulator From item In sequence Select acc.Concat({item})) End Function Sub Main() Dim empty(-1) As Integer Dim list1 = {1, 2} Dim list2 = {3, 4} Dim list3 = {1776, 1789} Dim list4 = {7, 12} Dim list5 = {4, 14, 23} Dim list6 = {0, 1} Dim list7 = {1, 2, 3} Dim list8 = {30} Dim list9 = {500, 100} For Each sequnceList As Integer()() In { ({list1, list2}), ({list2, list1}), ({list1, empty}), ({empty, list1}), ({list3, list4, list5, list6}), ({list7, list8, list9}), ({list7, empty, list9}) } Dim cart = sequnceList.CartesianProduct().Select(Function(tuple) $"({String.Join(", ", tuple)})") Console.WriteLine($"{{{String.Join(", ", cart)}}}") Next End Sub End Module
Convert this Java block to VB, preserving its control flow and logic.
import static java.util.Arrays.asList; import static java.util.Collections.emptyList; import static java.util.Optional.of; import static java.util.stream.Collectors.toList; import java.util.List; public class CartesianProduct { public List<?> product(List<?>... a) { if (a.length >= 2) { List<?> product = a[0]; for (int i = 1; i < a.length; i++) { product = product(product, a[i]); } return product; } return emptyList(); } private <A, B> List<?> product(List<A> a, List<B> b) { return of(a.stream() .map(e1 -> of(b.stream().map(e2 -> asList(e1, e2)).collect(toList())).orElse(emptyList())) .flatMap(List::stream) .collect(toList())).orElse(emptyList()); } }
Imports System.Runtime.CompilerServices Module Module1 <Extension()> Function CartesianProduct(Of T)(sequences As IEnumerable(Of IEnumerable(Of T))) As IEnumerable(Of IEnumerable(Of T)) Dim emptyProduct As IEnumerable(Of IEnumerable(Of T)) = {Enumerable.Empty(Of T)} Return sequences.Aggregate(emptyProduct, Function(accumulator, sequence) From acc In accumulator From item In sequence Select acc.Concat({item})) End Function Sub Main() Dim empty(-1) As Integer Dim list1 = {1, 2} Dim list2 = {3, 4} Dim list3 = {1776, 1789} Dim list4 = {7, 12} Dim list5 = {4, 14, 23} Dim list6 = {0, 1} Dim list7 = {1, 2, 3} Dim list8 = {30} Dim list9 = {500, 100} For Each sequnceList As Integer()() In { ({list1, list2}), ({list2, list1}), ({list1, empty}), ({empty, list1}), ({list3, list4, list5, list6}), ({list7, list8, list9}), ({list7, empty, list9}) } Dim cart = sequnceList.CartesianProduct().Select(Function(tuple) $"({String.Join(", ", tuple)})") Console.WriteLine($"{{{String.Join(", ", cart)}}}") Next End Sub End Module
Port the provided Java code into VB while preserving the original functionality.
import static java.util.Arrays.asList; import static java.util.Collections.emptyList; import static java.util.Optional.of; import static java.util.stream.Collectors.toList; import java.util.List; public class CartesianProduct { public List<?> product(List<?>... a) { if (a.length >= 2) { List<?> product = a[0]; for (int i = 1; i < a.length; i++) { product = product(product, a[i]); } return product; } return emptyList(); } private <A, B> List<?> product(List<A> a, List<B> b) { return of(a.stream() .map(e1 -> of(b.stream().map(e2 -> asList(e1, e2)).collect(toList())).orElse(emptyList())) .flatMap(List::stream) .collect(toList())).orElse(emptyList()); } }
Imports System.Runtime.CompilerServices Module Module1 <Extension()> Function CartesianProduct(Of T)(sequences As IEnumerable(Of IEnumerable(Of T))) As IEnumerable(Of IEnumerable(Of T)) Dim emptyProduct As IEnumerable(Of IEnumerable(Of T)) = {Enumerable.Empty(Of T)} Return sequences.Aggregate(emptyProduct, Function(accumulator, sequence) From acc In accumulator From item In sequence Select acc.Concat({item})) End Function Sub Main() Dim empty(-1) As Integer Dim list1 = {1, 2} Dim list2 = {3, 4} Dim list3 = {1776, 1789} Dim list4 = {7, 12} Dim list5 = {4, 14, 23} Dim list6 = {0, 1} Dim list7 = {1, 2, 3} Dim list8 = {30} Dim list9 = {500, 100} For Each sequnceList As Integer()() In { ({list1, list2}), ({list2, list1}), ({list1, empty}), ({empty, list1}), ({list3, list4, list5, list6}), ({list7, list8, list9}), ({list7, empty, list9}) } Dim cart = sequnceList.CartesianProduct().Select(Function(tuple) $"({String.Join(", ", tuple)})") Console.WriteLine($"{{{String.Join(", ", cart)}}}") Next End Sub End Module
Write the same code in VB as shown below in Java.
import java.util.Collections; import java.util.LinkedList; import java.util.List; public class Proper{ public static List<Integer> properDivs(int n){ List<Integer> divs = new LinkedList<Integer>(); if(n == 1) return divs; divs.add(1); for(int x = 2; x < n; x++){ if(n % x == 0) divs.add(x); } Collections.sort(divs); return divs; } public static void main(String[] args){ for(int x = 1; x <= 10; x++){ System.out.println(x + ": " + properDivs(x)); } int x = 0, count = 0; for(int n = 1; n <= 20000; n++){ if(properDivs(n).size() > count){ x = n; count = properDivs(n).size(); } } System.out.println(x + ": " + count); } }
dim _proper_divisors(100) sub proper_divisors(n) dim i dim _proper_divisors_count = 0 if n <> 1 then for i = 1 to (n \ 2) if n %% i = 0 then _proper_divisors_count = _proper_divisors_count + 1 _proper_divisors(_proper_divisors_count) = i end if next end if return _proper_divisors_count end sub sub show_proper_divisors(n, tabbed) dim cnt = proper_divisors(n) print str$(n) + ":"; tab(4);"(" + str$(cnt) + " items) "; dim j for j = 1 to cnt if tabbed then print str$(_proper_divisors(j)), else print str$(_proper_divisors(j)); end if if (j < cnt) then print ","; next print end sub dim i for i = 1 to 10 show_proper_divisors(i, false) next dim c dim maxindex = 0 dim maxlength = 0 for t = 1 to 20000 c = proper_divisors(t) if c > maxlength then maxindex = t maxlength = c end if next print "A maximum at "; show_proper_divisors(maxindex, false)
Keep all operations the same but rewrite the snippet in VB.
import java.io.StringWriter; import javax.xml.parsers.DocumentBuilderFactory; import javax.xml.transform.Result; import javax.xml.transform.Source; import javax.xml.transform.Transformer; import javax.xml.transform.TransformerFactory; import javax.xml.transform.dom.DOMSource; import javax.xml.transform.stream.StreamResult; import org.w3c.dom.Document; import org.w3c.dom.Element; public class XmlCreation { private static final String[] names = {"April", "Tam O'Shanter", "Emily"}; private static final String[] remarks = {"Bubbly: I'm > Tam and <= Emily", "Burns: \"When chapman billies leave the street ...\"", "Short & shrift"}; public static void main(String[] args) { try { final Document doc = DocumentBuilderFactory.newInstance().newDocumentBuilder().newDocument(); final Element root = doc.createElement("CharacterRemarks"); doc.appendChild(root); for(int i = 0; i < names.length; i++) { final Element character = doc.createElement("Character"); root.appendChild(character); character.setAttribute("name", names[i]); character.appendChild(doc.createTextNode(remarks[i])); } final Source source = new DOMSource(doc); final StringWriter buffer = new StringWriter(); final Result result = new StreamResult(buffer); final Transformer transformer = TransformerFactory.newInstance().newTransformer(); transformer.setOutputProperty("indent", "yes"); transformer.transform(source, result); System.out.println(buffer.toString()); } catch (Exception e) { e.printStackTrace(); } } }
Module XMLOutput Sub Main() Dim charRemarks As New Dictionary(Of String, String) charRemarks.Add("April", "Bubbly: I charRemarks.Add("Tam O charRemarks.Add("Emily", "Short & shrift") Dim xml = <CharacterRemarks> <%= From cr In charRemarks Select <Character name=<%= cr.Key %>><%= cr.Value %></Character> %> </CharacterRemarks> Console.WriteLine(xml) End Sub End Module
Keep all operations the same but rewrite the snippet in VB.
import java.awt.*; import java.awt.event.*; import java.awt.geom.*; import javax.swing.JApplet; import javax.swing.JFrame; public class Plot2d extends JApplet { double[] xi; double[] yi; public Plot2d(double[] x, double[] y) { this.xi = x; this.yi = y; } public static double max(double[] t) { double maximum = t[0]; for (int i = 1; i < t.length; i++) { if (t[i] > maximum) { maximum = t[i]; } } return maximum; } public static double min(double[] t) { double minimum = t[0]; for (int i = 1; i < t.length; i++) { if (t[i] < minimum) { minimum = t[i]; } } return minimum; } public void init() { setBackground(Color.white); setForeground(Color.white); } public void paint(Graphics g) { Graphics2D g2 = (Graphics2D) g; g2.setRenderingHint(RenderingHints.KEY_ANTIALIASING, RenderingHints.VALUE_ANTIALIAS_ON); g2.setPaint(Color.black); int x0 = 70; int y0 = 10; int xm = 670; int ym = 410; int xspan = xm - x0; int yspan = ym - y0; double xmax = max(xi); double xmin = min(xi); double ymax = max(yi); double ymin = min(yi); g2.draw(new Line2D.Double(x0, ym, xm, ym)); g2.draw(new Line2D.Double(x0, ym, x0, y0)); for (int j = 0; j < 5; j++) { int interv = 4; g2.drawString("" + (j * (xmax - xmin) / interv + xmin), j * xspan / interv + x0 - 10, ym + 20); g2.drawString("" + (j * (ymax - ymin) / interv + ymin), x0 - 20 - (int) (9 * Math.log10(ymax)), ym - j * yspan / interv + y0 - 5); g2.draw(new Line2D.Double(j * xspan / interv + x0, ym, j * xspan / interv + x0, ym + 5)); g2.draw(new Line2D.Double(x0 - 5, j * yspan / interv + y0, x0, j * yspan / interv + y0)); } for (int i = 0; i < xi.length; i++) { int f = (int) ((xi[i] - xmin) * xspan / (xmax - xmin)); int h = (int) (((ymax - ymin) - (yi[i] - ymin)) * yspan / (ymax - ymin)); g2.drawString("o", x0 + f - 3, h + 14); } for (int i = 0; i < xi.length - 1; i++) { int f = (int) ((xi[i] - xmin) * xspan / (xmax - xmin)); int f2 = (int) ((xi[i + 1] - xmin) * xspan / (xmax - xmin)); int h = (int) (((ymax - ymin) - (yi[i] - ymin)) * yspan / (ymax - ymin)); int h2 = (int) (((ymax - ymin) - (yi[i + 1] - ymin)) * yspan / (ymax - ymin)); g2.draw(new Line2D.Double(f + x0, h + y0, f2 + x0, h2 + y0)); } } public static void main(String args[]) { JFrame f = new JFrame("ShapesDemo2D"); f.addWindowListener(new WindowAdapter() { public void windowClosing(WindowEvent e) { System.exit(0); } }); double[] r = {0, 1, 2, 3, 4, 5, 6, 7, 8, 9}; double[] t = {2.7, 2.8, 31.4, 38.1, 58.0, 76.2, 100.5, 130.0, 149.3, 180.09}; JApplet applet = new Plot2d(r, t); f.getContentPane().add("Center", applet); applet.init(); f.pack(); f.setSize(new Dimension(720, 480)); f.show(); } }
Private Sub plot_coordinate_pairs(x As Variant, y As Variant) Dim chrt As Chart Set chrt = ActiveSheet.Shapes.AddChart.Chart With chrt .ChartType = xlLine .HasLegend = False .HasTitle = True .ChartTitle.Text = "Time" .SeriesCollection.NewSeries .SeriesCollection.Item(1).XValues = x .SeriesCollection.Item(1).Values = y .Axes(xlValue, xlPrimary).HasTitle = True .Axes(xlValue, xlPrimary).AxisTitle.Characters.Text = "microseconds" End With End Sub Public Sub main() x = [{0, 1, 2, 3, 4, 5, 6, 7, 8, 9}] y = [{2.7, 2.8, 31.4, 38.1, 58.0, 76.2, 100.5, 130.0, 149.3, 180.0}] plot_coordinate_pairs x, y End Sub
Can you help me rewrite this code in VB instead of Java, keeping it the same logically?
import java.awt.*; import java.awt.event.*; import java.awt.geom.*; import javax.swing.JApplet; import javax.swing.JFrame; public class Plot2d extends JApplet { double[] xi; double[] yi; public Plot2d(double[] x, double[] y) { this.xi = x; this.yi = y; } public static double max(double[] t) { double maximum = t[0]; for (int i = 1; i < t.length; i++) { if (t[i] > maximum) { maximum = t[i]; } } return maximum; } public static double min(double[] t) { double minimum = t[0]; for (int i = 1; i < t.length; i++) { if (t[i] < minimum) { minimum = t[i]; } } return minimum; } public void init() { setBackground(Color.white); setForeground(Color.white); } public void paint(Graphics g) { Graphics2D g2 = (Graphics2D) g; g2.setRenderingHint(RenderingHints.KEY_ANTIALIASING, RenderingHints.VALUE_ANTIALIAS_ON); g2.setPaint(Color.black); int x0 = 70; int y0 = 10; int xm = 670; int ym = 410; int xspan = xm - x0; int yspan = ym - y0; double xmax = max(xi); double xmin = min(xi); double ymax = max(yi); double ymin = min(yi); g2.draw(new Line2D.Double(x0, ym, xm, ym)); g2.draw(new Line2D.Double(x0, ym, x0, y0)); for (int j = 0; j < 5; j++) { int interv = 4; g2.drawString("" + (j * (xmax - xmin) / interv + xmin), j * xspan / interv + x0 - 10, ym + 20); g2.drawString("" + (j * (ymax - ymin) / interv + ymin), x0 - 20 - (int) (9 * Math.log10(ymax)), ym - j * yspan / interv + y0 - 5); g2.draw(new Line2D.Double(j * xspan / interv + x0, ym, j * xspan / interv + x0, ym + 5)); g2.draw(new Line2D.Double(x0 - 5, j * yspan / interv + y0, x0, j * yspan / interv + y0)); } for (int i = 0; i < xi.length; i++) { int f = (int) ((xi[i] - xmin) * xspan / (xmax - xmin)); int h = (int) (((ymax - ymin) - (yi[i] - ymin)) * yspan / (ymax - ymin)); g2.drawString("o", x0 + f - 3, h + 14); } for (int i = 0; i < xi.length - 1; i++) { int f = (int) ((xi[i] - xmin) * xspan / (xmax - xmin)); int f2 = (int) ((xi[i + 1] - xmin) * xspan / (xmax - xmin)); int h = (int) (((ymax - ymin) - (yi[i] - ymin)) * yspan / (ymax - ymin)); int h2 = (int) (((ymax - ymin) - (yi[i + 1] - ymin)) * yspan / (ymax - ymin)); g2.draw(new Line2D.Double(f + x0, h + y0, f2 + x0, h2 + y0)); } } public static void main(String args[]) { JFrame f = new JFrame("ShapesDemo2D"); f.addWindowListener(new WindowAdapter() { public void windowClosing(WindowEvent e) { System.exit(0); } }); double[] r = {0, 1, 2, 3, 4, 5, 6, 7, 8, 9}; double[] t = {2.7, 2.8, 31.4, 38.1, 58.0, 76.2, 100.5, 130.0, 149.3, 180.09}; JApplet applet = new Plot2d(r, t); f.getContentPane().add("Center", applet); applet.init(); f.pack(); f.setSize(new Dimension(720, 480)); f.show(); } }
Private Sub plot_coordinate_pairs(x As Variant, y As Variant) Dim chrt As Chart Set chrt = ActiveSheet.Shapes.AddChart.Chart With chrt .ChartType = xlLine .HasLegend = False .HasTitle = True .ChartTitle.Text = "Time" .SeriesCollection.NewSeries .SeriesCollection.Item(1).XValues = x .SeriesCollection.Item(1).Values = y .Axes(xlValue, xlPrimary).HasTitle = True .Axes(xlValue, xlPrimary).AxisTitle.Characters.Text = "microseconds" End With End Sub Public Sub main() x = [{0, 1, 2, 3, 4, 5, 6, 7, 8, 9}] y = [{2.7, 2.8, 31.4, 38.1, 58.0, 76.2, 100.5, 130.0, 149.3, 180.0}] plot_coordinate_pairs x, y End Sub
Port the provided Java code into VB while preserving the original functionality.
String str = "I am a string"; if (str.matches(".*string")) { System.out.println("ends with 'string'"); }
text = "I need more coffee!!!" Set regex = New RegExp regex.Global = True regex.Pattern = "\s" If regex.Test(text) Then WScript.StdOut.Write regex.Replace(text,vbCrLf) Else WScript.StdOut.Write "No matching pattern" End If
Rewrite this program in VB while keeping its functionality equivalent to the Java version.
import java.util.HashMap; public static void main(String[] args){ String[] keys= {"a", "b", "c"}; int[] vals= {1, 2, 3}; HashMap<String, Integer> hash= new HashMap<String, Integer>(); for(int i= 0; i < keys.length; i++){ hash.put(keys[i], vals[i]); } }
Set dict = CreateObject("Scripting.Dictionary") os = Array("Windows", "Linux", "MacOS") owner = Array("Microsoft", "Linus Torvalds", "Apple") For n = 0 To 2 dict.Add os(n), owner(n) Next MsgBox dict.Item("Linux") MsgBox dict.Item("MacOS") MsgBox dict.Item("Windows")
Convert the following code from Java to VB, ensuring the logic remains intact.
import java.awt.*; import static java.awt.Color.*; import javax.swing.*; public class ColourPinstripeDisplay extends JPanel { final static Color[] palette = {black, red, green, blue, magenta,cyan, yellow, white}; final int bands = 4; public ColourPinstripeDisplay() { setPreferredSize(new Dimension(900, 600)); } @Override public void paintComponent(Graphics g) { super.paintComponent(g); int h = getHeight(); for (int b = 1; b <= bands; b++) { for (int x = 0, colIndex = 0; x < getWidth(); x += b, colIndex++) { g.setColor(palette[colIndex % palette.length]); g.fillRect(x, (b - 1) * (h / bands), x + b, b * (h / bands)); } } } public static void main(String[] args) { SwingUtilities.invokeLater(() -> { JFrame f = new JFrame(); f.setDefaultCloseOperation(JFrame.EXIT_ON_CLOSE); f.setTitle("ColourPinstripeDisplay"); f.add(new ColourPinstripeDisplay(), BorderLayout.CENTER); f.pack(); f.setLocationRelativeTo(null); f.setVisible(true); }); } }
Public Class Main Inherits System.Windows.Forms.Form Public Sub New() Me.FormBorderStyle = FormBorderStyle.None Me.WindowState = FormWindowState.Maximized End Sub Private Sub Main_Load(sender As Object, e As EventArgs) Handles Me.Load Dim Index As Integer Dim Colors() As Color = {Color.Black, Color.Red, Color.Green, Color.Magenta, Color.Cyan, Color.Yellow, Color.White} Dim Height = (Me.ClientSize.Height / 4) + 1 For y = 1 To 4 Dim Top = Me.ClientSize.Height / 4 * (y - 1) For x = 0 To Me.ClientSize.Width Step y If Index = 6 Then Index = 0 Else Index += 1 Me.Controls.Add(New Panel With {.Top = Top, .Height = Height, .Left = x, .Width = y, .BackColor = Colors(Index)}) Next Next End Sub End Class
Keep all operations the same but rewrite the snippet in VB.
import java.util.*; public class CocktailSort { public static void main(String[] args) { Integer[] array = new Integer[]{ 5, 1, -6, 12, 3, 13, 2, 4, 0, 15 }; System.out.println("before: " + Arrays.toString(array)); cocktailSort(array); System.out.println("after: " + Arrays.toString(array)); } public static void cocktailSort(Object[] array) { int begin = 0; int end = array.length; if (end == 0) return; for (--end; begin < end; ) { int new_begin = end; int new_end = begin; for (int i = begin; i < end; ++i) { Comparable c1 = (Comparable)array[i]; Comparable c2 = (Comparable)array[i + 1]; if (c1.compareTo(c2) > 0) { swap(array, i, i + 1); new_end = i; } } end = new_end; for (int i = end; i > begin; --i) { Comparable c1 = (Comparable)array[i - 1]; Comparable c2 = (Comparable)array[i]; if (c1.compareTo(c2) > 0) { swap(array, i, i - 1); new_begin = i; } } begin = new_begin; } } private static void swap(Object[] array, int i, int j) { Object tmp = array[i]; array[i] = array[j]; array[j] = tmp; } }
Function cocktailShakerSort(ByVal A As Variant) As Variant beginIdx = LBound(A) endIdx = UBound(A) - 1 Do While beginIdx <= endIdx newBeginIdx = endIdx newEndIdx = beginIdx For ii = beginIdx To endIdx If A(ii) > A(ii + 1) Then tmp = A(ii): A(ii) = A(ii + 1): A(ii + 1) = tmp newEndIdx = ii End If Next ii endIdx = newEndIdx - 1 For ii = endIdx To beginIdx Step -1 If A(ii) > A(ii + 1) Then tmp = A(ii): A(ii) = A(ii + 1): A(ii + 1) = tmp newBeginIdx = ii End If Next ii beginIdx = newBeginIdx + 1 Loop cocktailShakerSort = A End Function Public Sub main() Dim B(20) As Variant For i = LBound(B) To UBound(B) B(i) = Int(Rnd() * 100) Next i Debug.Print Join(B, ", ") Debug.Print Join(cocktailShakerSort(B), ", ") End Sub
Generate a VB translation of this Java snippet without changing its computational steps.
import java.awt.*; import javax.swing.*; public class Pendulum extends JPanel implements Runnable { private double angle = Math.PI / 2; private int length; public Pendulum(int length) { this.length = length; setDoubleBuffered(true); } @Override public void paint(Graphics g) { g.setColor(Color.WHITE); g.fillRect(0, 0, getWidth(), getHeight()); g.setColor(Color.BLACK); int anchorX = getWidth() / 2, anchorY = getHeight() / 4; int ballX = anchorX + (int) (Math.sin(angle) * length); int ballY = anchorY + (int) (Math.cos(angle) * length); g.drawLine(anchorX, anchorY, ballX, ballY); g.fillOval(anchorX - 3, anchorY - 4, 7, 7); g.fillOval(ballX - 7, ballY - 7, 14, 14); } public void run() { double angleAccel, angleVelocity = 0, dt = 0.1; while (true) { angleAccel = -9.81 / length * Math.sin(angle); angleVelocity += angleAccel * dt; angle += angleVelocity * dt; repaint(); try { Thread.sleep(15); } catch (InterruptedException ex) {} } } @Override public Dimension getPreferredSize() { return new Dimension(2 * length + 50, length / 2 * 3); } public static void main(String[] args) { JFrame f = new JFrame("Pendulum"); Pendulum p = new Pendulum(200); f.add(p); f.setDefaultCloseOperation(JFrame.EXIT_ON_CLOSE); f.pack(); f.setVisible(true); new Thread(p).start(); } }
option explicit const dt = 0.15 const length=23 dim ans0:ans0=chr(27)&"[" dim Veloc,Accel,angle,olr,olc,r,c const r0=1 const c0=40 cls angle=0.7 while 1 wscript.sleep(50) Accel = -.9 * sin(Angle) Veloc = Veloc + Accel * dt Angle = Angle + Veloc * dt r = r0 + int(cos(Angle) * Length) c = c0+ int(2*sin(Angle) * Length) cls draw_line r,c,r0,c0 toxy r,c,"O" olr=r :olc=c wend sub cls() wscript.StdOut.Write ans0 &"2J"&ans0 &"?25l":end sub sub toxy(r,c,s) wscript.StdOut.Write ans0 & r & ";" & c & "f" & s :end sub Sub draw_line(r1,c1, r2,c2) Dim x,y,xf,yf,dx,dy,sx,sy,err,err2 x =r1 : y =c1 xf=r2 : yf=c2 dx=Abs(xf-x) : dy=Abs(yf-y) If x<xf Then sx=+1: Else sx=-1 If y<yf Then sy=+1: Else sy=-1 err=dx-dy Do toxy x,y,"." If x=xf And y=yf Then Exit Do err2=err+err If err2>-dy Then err=err-dy: x=x+sx If err2< dx Then err=err+dx: y=y+sy Loop End Sub
Convert the following code from Java to VB, ensuring the logic remains intact.
public class Gray { public static long grayEncode(long n){ return n ^ (n >>> 1); } public static long grayDecode(long n) { long p = n; while ((n >>>= 1) != 0) p ^= n; return p; } public static void main(String[] args){ System.out.println("i\tBinary\tGray\tDecoded"); for(int i = -1; i < 32;i++){ System.out.print(i +"\t"); System.out.print(Integer.toBinaryString(i) + "\t"); System.out.print(Long.toBinaryString(grayEncode(i))+ "\t"); System.out.println(grayDecode(grayEncode(i))); } } }
Function Encoder(ByVal n) Encoder = n Xor (n \ 2) End Function Function Decoder(ByVal n) Dim g : g = 0 Do While n > 0 g = g Xor n n = n \ 2 Loop Decoder = g End Function Function Dec2bin(ByVal n, ByVal length) Dim i, strbin : strbin = "" For i = 1 to 5 strbin = (n Mod 2) & strbin n = n \ 2 Next Dec2Bin = strbin End Function WScript.StdOut.WriteLine("Binary -> Gray Code -> Binary") For i = 0 to 31 encoded = Encoder(i) decoded = Decoder(encoded) WScript.StdOut.WriteLine(Dec2Bin(i, 5) & " -> " & Dec2Bin(encoded, 5) & " -> " & Dec2Bin(decoded, 5)) Next
Maintain the same structure and functionality when rewriting this code in VB.
public class Gray { public static long grayEncode(long n){ return n ^ (n >>> 1); } public static long grayDecode(long n) { long p = n; while ((n >>>= 1) != 0) p ^= n; return p; } public static void main(String[] args){ System.out.println("i\tBinary\tGray\tDecoded"); for(int i = -1; i < 32;i++){ System.out.print(i +"\t"); System.out.print(Integer.toBinaryString(i) + "\t"); System.out.print(Long.toBinaryString(grayEncode(i))+ "\t"); System.out.println(grayDecode(grayEncode(i))); } } }
Function Encoder(ByVal n) Encoder = n Xor (n \ 2) End Function Function Decoder(ByVal n) Dim g : g = 0 Do While n > 0 g = g Xor n n = n \ 2 Loop Decoder = g End Function Function Dec2bin(ByVal n, ByVal length) Dim i, strbin : strbin = "" For i = 1 to 5 strbin = (n Mod 2) & strbin n = n \ 2 Next Dec2Bin = strbin End Function WScript.StdOut.WriteLine("Binary -> Gray Code -> Binary") For i = 0 to 31 encoded = Encoder(i) decoded = Decoder(encoded) WScript.StdOut.WriteLine(Dec2Bin(i, 5) & " -> " & Dec2Bin(encoded, 5) & " -> " & Dec2Bin(decoded, 5)) Next
Write a version of this Java function in VB with identical behavior.
public enum Pip { Two, Three, Four, Five, Six, Seven, Eight, Nine, Ten, Jack, Queen, King, Ace }
class playingcard dim suit dim pips end class class carddeck private suitnames private pipnames private cardno private deck(52) private nTop sub class_initialize dim suit dim pips suitnames = split("H,D,C,S",",") pipnames = split("A,2,3,4,5,6,7,8,9,10,J,Q,K",",") cardno = 0 for suit = 1 to 4 for pips = 1 to 13 set deck(cardno) = new playingcard deck(cardno).suit = suitnames(suit-1) deck(cardno).pips = pipnames(pips-1) cardno = cardno + 1 next next nTop = 0 end sub public sub showdeck dim a redim a(51-nTop) for i = nTop to 51 a(i) = deck(i).pips & deck(i).suit next wscript.echo join( a, ", ") end sub public sub shuffle dim r randomize timer for i = nTop to 51 r = int( rnd * ( 52 - nTop ) ) if r <> i then objswap deck(i),deck(r) end if next end sub public function deal() set deal = deck( nTop ) nTop = nTop + 1 end function public property get cardsRemaining cardsRemaining = 52 - nTop end property private sub objswap( a, b ) dim tmp set tmp = a set a = b set b = tmp end sub end class
Port the following code from Java to VB with equivalent syntax and logic.
Int[] literalArray = [1,2,3]; Int[] fixedLengthArray = new Int[10]; Int[] variableArray = new Int[]; assert literalArray.size == 3; Int n = literalArray[2]; fixedLengthArray[4] = 12345; fixedLengthArray += 6789; variableArray += 6789;
Option Base {0|1}
Write the same algorithm in VB as shown in this Java implementation.
public static boolean inCarpet(long x, long y) { while (x!=0 && y!=0) { if (x % 3 == 1 && y % 3 == 1) return false; x /= 3; y /= 3; } return true; } public static void carpet(final int n) { final double power = Math.pow(3,n); for(long i = 0; i < power; i++) { for(long j = 0; j < power; j++) { System.out.print(inCarpet(i, j) ? "*" : " "); } System.out.println(); } }
Const Order = 4 Function InCarpet(ByVal x As Integer, ByVal y As Integer) Do While x <> 0 And y <> 0 If x Mod 3 = 1 And y Mod 3 = 1 Then InCarpet = " " Exit Function End If x = x \ 3 y = y \ 3 Loop InCarpet = "#" End Function Public Sub sierpinski_carpet() Dim i As Integer, j As Integer For i = 0 To 3 ^ Order - 1 For j = 0 To 3 ^ Order - 1 Debug.Print InCarpet(i, j); Next j Debug.Print Next i End Sub
Rewrite this program in VB while keeping its functionality equivalent to the Java version.
public class BogoSort { public static void main(String[] args) { int[] arr={4,5,6,0,7,8,9,1,2,3}; BogoSort now=new BogoSort(); System.out.print("Unsorted: "); now.display1D(arr); now.bogo(arr); System.out.print("Sorted: "); now.display1D(arr); } void bogo(int[] arr) { int shuffle=1; for(;!isSorted(arr);shuffle++) shuffle(arr); System.out.println("This took "+shuffle+" shuffles."); } void shuffle(int[] arr) { int i=arr.length-1; while(i>0) swap(arr,i--,(int)(Math.random()*i)); } void swap(int[] arr,int i,int j) { int temp=arr[i]; arr[i]=arr[j]; arr[j]=temp; } boolean isSorted(int[] arr) { for(int i=1;i<arr.length;i++) if(arr[i]<arr[i-1]) return false; return true; } void display1D(int[] arr) { for(int i=0;i<arr.length;i++) System.out.print(arr[i]+" "); System.out.println(); } }
Private Function Knuth(a As Variant) As Variant Dim t As Variant, i As Integer If Not IsMissing(a) Then For i = UBound(a) To LBound(a) + 1 Step -1 j = Int((UBound(a) - LBound(a) + 1) * Rnd + LBound(a)) t = a(i) a(i) = a(j) a(j) = t Next i End If Knuth = a End Function Private Function inOrder(s As Variant) i = 2 Do While i <= UBound(s) If s(i) < s(i - 1) Then inOrder = False Exit Function End If i = i + 1 Loop inOrder = True End Function Private Function bogosort(ByVal s As Variant) As Variant Do While Not inOrder(s) Debug.Print Join(s, ", ") s = Knuth(s) Loop bogosort = s End Function Public Sub main() Debug.Print Join(bogosort(Knuth([{1,2,3,4,5,6}])), ", ") End Sub
Write a version of this Java function in VB with identical behavior.
public class Euler { private static void euler (Callable f, double y0, int a, int b, int h) { int t = a; double y = y0; while (t < b) { System.out.println ("" + t + " " + y); t += h; y += h * f.compute (t, y); } System.out.println ("DONE"); } public static void main (String[] args) { Callable cooling = new Cooling (); int[] steps = {2, 5, 10}; for (int stepSize : steps) { System.out.println ("Step size: " + stepSize); euler (cooling, 100.0, 0, 100, stepSize); } } } interface Callable { public double compute (int time, double t); } class Cooling implements Callable { public double compute (int time, double t) { return -0.07 * (t - 20); } }
Private Sub ivp_euler(f As String, y As Double, step As Integer, end_t As Integer) Dim t As Integer Debug.Print " Step "; step; ": ", Do While t <= end_t If t Mod 10 = 0 Then Debug.Print Format(y, "0.000"), y = y + step * Application.Run(f, y) t = t + step Loop Debug.Print End Sub Sub analytic() Debug.Print " Time: ", For t = 0 To 100 Step 10 Debug.Print " "; t, Next t Debug.Print Debug.Print "Analytic: ", For t = 0 To 100 Step 10 Debug.Print Format(20 + 80 * Exp(-0.07 * t), "0.000"), Next t Debug.Print End Sub Private Function cooling(temp As Double) As Double cooling = -0.07 * (temp - 20) End Function Public Sub euler_method() Dim r_cooling As String r_cooling = "cooling" analytic ivp_euler r_cooling, 100, 2, 100 ivp_euler r_cooling, 100, 5, 100 ivp_euler r_cooling, 100, 10, 100 End Sub
Generate an equivalent VB version of this Java code.
public class SeqNonSquares { public static int nonsqr(int n) { return n + (int)Math.round(Math.sqrt(n)); } public static void main(String[] args) { for (int i = 1; i < 23; i++) System.out.print(nonsqr(i) + " "); System.out.println(); for (int i = 1; i < 1000000; i++) { double j = Math.sqrt(nonsqr(i)); assert j != Math.floor(j); } } }
Sub Main() Dim i&, c&, j#, s$ Const N& = 1000000 s = "values for n in the range 1 to 22 : " For i = 1 To 22 s = s & ns(i) & ", " Next For i = 1 To N j = Sqr(ns(i)) If j = CInt(j) Then c = c + 1 Next Debug.Print s Debug.Print c & " squares less than " & N End Sub Private Function ns(l As Long) As Long ns = l + Int(1 / 2 + Sqr(l)) End Function
Write the same code in VB as shown below in Java.
public static String Substring(String str, int n, int m){ return str.substring(n, n+m); } public static String Substring(String str, int n){ return str.substring(n); } public static String Substring(String str){ return str.substring(0, str.length()-1); } public static String Substring(String str, char c, int m){ return str.substring(str.indexOf(c), str.indexOf(c)+m+1); } public static String Substring(String str, String sub, int m){ return str.substring(str.indexOf(sub), str.indexOf(sub)+m+1); }
Public Sub substring() sentence = "the last thing the man said was the" n = 10: m = 5 Debug.Print Mid(sentence, n, 5) Debug.Print Right(sentence, Len(sentence) - n + 1) Debug.Print Left(sentence, Len(sentence) - 1) k = InStr(1, sentence, "m") Debug.Print Mid(sentence, k, 5) k = InStr(1, sentence, "aid") Debug.Print Mid(sentence, k, 5) End Sub
Transform the following Java implementation into VB, maintaining the same output and logic.
public static String Substring(String str, int n, int m){ return str.substring(n, n+m); } public static String Substring(String str, int n){ return str.substring(n); } public static String Substring(String str){ return str.substring(0, str.length()-1); } public static String Substring(String str, char c, int m){ return str.substring(str.indexOf(c), str.indexOf(c)+m+1); } public static String Substring(String str, String sub, int m){ return str.substring(str.indexOf(sub), str.indexOf(sub)+m+1); }
Public Sub substring() sentence = "the last thing the man said was the" n = 10: m = 5 Debug.Print Mid(sentence, n, 5) Debug.Print Right(sentence, Len(sentence) - n + 1) Debug.Print Left(sentence, Len(sentence) - 1) k = InStr(1, sentence, "m") Debug.Print Mid(sentence, k, 5) k = InStr(1, sentence, "aid") Debug.Print Mid(sentence, k, 5) End Sub
Generate a VB translation of this Java snippet without changing its computational steps.
public class JortSort { public static void main(String[] args) { System.out.println(jortSort(new int[]{1, 2, 3})); } static boolean jortSort(int[] arr) { return true; } }
Function JortSort(s) JortSort = True arrPreSort = Split(s,",") Set arrSorted = CreateObject("System.Collections.ArrayList") For i = 0 To UBound(arrPreSort) arrSorted.Add(arrPreSort(i)) Next arrSorted.Sort() For j = 0 To UBound(arrPreSort) If arrPreSort(j) <> arrSorted(j) Then JortSort = False Exit For End If Next End Function WScript.StdOut.Write JortSort("1,2,3,4,5") WScript.StdOut.WriteLine WScript.StdOut.Write JortSort("1,2,3,5,4") WScript.StdOut.WriteLine WScript.StdOut.Write JortSort("a,b,c") WScript.StdOut.WriteLine WScript.StdOut.Write JortSort("a,c,b")
Rewrite the snippet below in VB so it works the same as the original Java code.
import java.util.GregorianCalendar; import java.text.MessageFormat; public class Leapyear{ public static void main(String[] argv){ int[] yrs = {1800,1900,1994,1998,1999,2000,2001,2004,2100}; GregorianCalendar cal = new GregorianCalendar(); for(int year : yrs){ System.err.println(MessageFormat.format("The year {0,number,#} is leaper: {1} / {2}.", year, cal.isLeapYear(year), isLeapYear(year))); } } public static boolean isLeapYear(int year){ return (year % 100 == 0) ? (year % 400 == 0) : (year % 4 == 0); } }
Public Function Leap_year(year As Integer) As Boolean Leap_year = (Month(DateSerial(year, 2, 29)) = 2) End Function
Rewrite the snippet below in VB so it works the same as the original Java code.
import java.math.BigInteger; public class CombinationsAndPermutations { public static void main(String[] args) { System.out.println(Double.MAX_VALUE); System.out.println("A sample of permutations from 1 to 12 with exact Integer arithmetic:"); for ( int n = 1 ; n <= 12 ; n++ ) { int k = n / 2; System.out.printf("%d P %d = %s%n", n, k, permutation(n, k)); } System.out.println(); System.out.println("A sample of combinations from 10 to 60 with exact Integer arithmetic:"); for ( int n = 10 ; n <= 60 ; n += 5 ) { int k = n / 2; System.out.printf("%d C %d = %s%n", n, k, combination(n, k)); } System.out.println(); System.out.println("A sample of permutations from 5 to 15000 displayed in floating point arithmetic:"); System.out.printf("%d P %d = %s%n", 5, 2, display(permutation(5, 2), 50)); for ( int n = 1000 ; n <= 15000 ; n += 1000 ) { int k = n / 2; System.out.printf("%d P %d = %s%n", n, k, display(permutation(n, k), 50)); } System.out.println(); System.out.println("A sample of combinations from 100 to 1000 displayed in floating point arithmetic:"); for ( int n = 100 ; n <= 1000 ; n += 100 ) { int k = n / 2; System.out.printf("%d C %d = %s%n", n, k, display(combination(n, k), 50)); } } private static String display(BigInteger val, int precision) { String s = val.toString(); precision = Math.min(precision, s.length()); StringBuilder sb = new StringBuilder(); sb.append(s.substring(0, 1)); sb.append("."); sb.append(s.substring(1, precision)); sb.append(" * 10^"); sb.append(s.length()-1); return sb.toString(); } public static BigInteger combination(int n, int k) { if ( n-k < k ) { k = n-k; } BigInteger result = permutation(n, k); while ( k > 0 ) { result = result.divide(BigInteger.valueOf(k)); k--; } return result; } public static BigInteger permutation(int n, int k) { BigInteger result = BigInteger.ONE; for ( int i = n ; i >= n-k+1 ; i-- ) { result = result.multiply(BigInteger.valueOf(i)); } return result; } }
dim i,j Wscript.StdOut.WriteLine "-- Long Integer - Permutations - from 1 to 12" for i=1 to 12 for j=1 to i Wscript.StdOut.Write "P(" & i & "," & j & ")=" & perm(i,j) & " " next Wscript.StdOut.WriteLine "" next Wscript.StdOut.WriteLine "-- Float integer - Combinations from 10 to 60" for i=10 to 60 step 10 for j=1 to i step i\5 Wscript.StdOut.Write "C(" & i & "," & j & ")=" & comb(i,j) & " " next Wscript.StdOut.WriteLine "" next Wscript.StdOut.WriteLine "-- Float integer - Permutations from 5000 to 15000" for i=5000 to 15000 step 5000 for j=10 to 70 step 20 Wscript.StdOut.Write "C(" & i & "," & j & ")=" & perm(i,j) & " " next Wscript.StdOut.WriteLine "" next Wscript.StdOut.WriteLine "-- Float integer - Combinations from 200 to 1000" for i=200 to 1000 step 200 for j=20 to 100 step 20 Wscript.StdOut.Write "P(" & i & "," & j & ")=" & comb(i,j) & " " next Wscript.StdOut.WriteLine "" next function perm(x,y) dim i,z z=1 for i=x-y+1 to x z=z*i next perm=z end function function fact(x) dim i,z z=1 for i=2 to x z=z*i next fact=z end function function comb(byval x,byval y) if y>x then comb=0 elseif x=y then comb=1 else if x-y<y then y=x-y comb=perm(x,y)/fact(y) end if end function
Generate an equivalent VB version of this Java code.
import java.util.List; import java.util.stream.*; public class LexicographicalNumbers { static List<Integer> lexOrder(int n) { int first = 1, last = n; if (n < 1) { first = n; last = 1; } return IntStream.rangeClosed(first, last) .mapToObj(Integer::toString) .sorted() .map(Integer::valueOf) .collect(Collectors.toList()); } public static void main(String[] args) { System.out.println("In lexicographical order:\n"); int[] ints = {0, 5, 13, 21, -22}; for (int n : ints) { System.out.printf("%3d: %s\n", n, lexOrder(n)); } } }
Public Function sortlexicographically(N As Integer) Dim arrList As Object Set arrList = CreateObject("System.Collections.ArrayList") For i = 1 To N arrList.Add CStr(i) Next i arrList.Sort Dim item As Variant For Each item In arrList Debug.Print item & ", "; Next End Function Public Sub main() Call sortlexicographically(13) End Sub
Keep all operations the same but rewrite the snippet in VB.
module NumberNames { void run() { @Inject Console console; Int[] tests = [0, 1, -1, 11, -17, 42, 99, 100, 101, -111, 1000, 1234, 10000, 100000, 123456789000, 0x123456789ABCDEF]; for (Int test : tests) { console.print($"{test} = {toEnglish(test)}"); } } static String[] digits = ["zero", "one", "two", "three", "four", "five", "six", "seven", "eight", "nine"]; static String[] teens = ["ten", "eleven", "twelve", "thirteen", "fourteen", "fifteen", "sixteen", "seventeen", "eighteen", "nineteen"]; static String[] tens = ["zero", "ten", "twenty", "thirty", "forty", "fifty", "sixty", "seventy", "eighty", "ninety"]; static String[] ten3rd = ["?", "thousand", "million", "billion", "trillion", "quadrillion", "quintillion"]; static String toEnglish(Int n) { StringBuffer buf = new StringBuffer(); if (n < 0) { "negative ".appendTo(buf); n = -n; } format3digits(n, buf); return buf.toString(); } static void format3digits(Int n, StringBuffer buf, Int nested=0) { (Int left, Int right) = n /% 1000; if (left != 0) { format3digits(left, buf, nested+1); } if (right != 0 || (left == 0 && nested==0)) { if (right >= 100) { (left, right) = (right /% 100); digits[left].appendTo(buf); " hundred ".appendTo(buf); if (right != 0) { format2digits(right, buf); } } else { format2digits(right, buf); } if (nested > 0) { ten3rd[nested].appendTo(buf).add(' '); } } } static void format2digits(Int n, StringBuffer buf) { switch (n) { case 0..9: digits[n].appendTo(buf).add(' '); break; case 10..19: teens[n-10].appendTo(buf).add(' '); break; default: (Int left, Int right) = n /% 10; tens[left].appendTo(buf); if (right == 0) { buf.add(' '); } else { buf.add('-'); digits[right].appendTo(buf).add(' '); } break; } } }
Public twenties As Variant Public decades As Variant Public orders As Variant Private Sub init() twenties = [{"zero","one","two","three","four","five","six","seven","eight","nine","ten", "eleven","twelve","thirteen","fourteen","fifteen","sixteen","seventeen","eighteen","nineteen"}] decades = [{"twenty","thirty","forty","fifty","sixty","seventy","eighty","ninety"}] orders = [{1E15,"quadrillion"; 1E12,"trillion"; 1E9,"billion"; 1E6,"million"; 1E3,"thousand"}] End Sub Private Function Twenty(N As Variant) Twenty = twenties(N Mod 20 + 1) End Function Private Function Decade(N As Variant) Decade = decades(N Mod 10 - 1) End Function Private Function Hundred(N As Variant) If N < 20 Then Hundred = Twenty(N) Exit Function Else If N Mod 10 = 0 Then Hundred = Decade((N \ 10) Mod 10) Exit Function End If End If Hundred = Decade(N \ 10) & "-" & Twenty(N Mod 10) End Function Private Function Thousand(N As Variant, withand As String) If N < 100 Then Thousand = withand & Hundred(N) Exit Function Else If N Mod 100 = 0 Then Thousand = withand & Twenty(WorksheetFunction.Floor_Precise(N / 100)) & " hundred" Exit Function End If End If Thousand = Twenty(N \ 100) & " hundred and " & Hundred(N Mod 100) End Function Private Function Triplet(N As Variant) Dim Order, High As Variant, Low As Variant Dim Name As String, res As String For i = 1 To UBound(orders) Order = orders(i, 1) Name = orders(i, 2) High = WorksheetFunction.Floor_Precise(N / Order) Low = N - High * Order If High <> 0 Then res = res & Thousand(High, "") & " " & Name End If N = Low If Low = 0 Then Exit For If Len(res) And High <> 0 Then res = res & ", " End If Next i If N <> 0 Or res = "" Then res = res & Thousand(WorksheetFunction.Floor_Precise(N), IIf(res = "", "", "and ")) N = N - Int(N) If N > 0.000001 Then res = res & " point" For i = 1 To 10 n_ = WorksheetFunction.Floor_Precise(N * 10.0000001) res = res & " " & twenties(n_ + 1) N = N * 10 - n_ If Abs(N) < 0.000001 Then Exit For Next i End If End If Triplet = res End Function Private Function spell(N As Variant) Dim res As String If N < 0 Then res = "minus " N = -N End If res = res & Triplet(N) spell = res End Function Private Function smartp(N As Variant) Dim res As String If N = WorksheetFunction.Floor_Precise(N) Then smartp = CStr(N) Exit Function End If res = CStr(N) If InStr(1, res, ".") Then res = Left(res, InStr(1, res, ".")) End If smartp = res End Function Sub Main() Dim si As Variant init Samples1 = [{99, 300, 310, 417, 1501, 12609, 200000000000100, 999999999999999, -123456787654321,102003000400005,1020030004,102003,102,1,0,-1,-99, -1501,1234,12.34}] Samples2 = [{10000001.2,1E-3,-2.7182818, 201021002001,-20102100200,2010210020,-201021002,20102100,-2010210, 201021,-20102,2010,-201,20,-2}] For i = 1 To UBound(Samples1) si = Samples1(i) Debug.Print Format(smartp(si), "@@@@@@@@@@@@@@@@"); " "; spell(si) Next i For i = 1 To UBound(Samples2) si = Samples2(i) Debug.Print Format(smartp(si), "@@@@@@@@@@@@@@@@"); " "; spell(si) Next i End Sub
Write the same algorithm in VB as shown in this Java implementation.
public static void shell(int[] a) { int increment = a.length / 2; while (increment > 0) { for (int i = increment; i < a.length; i++) { int j = i; int temp = a[i]; while (j >= increment && a[j - increment] > temp) { a[j] = a[j - increment]; j = j - increment; } a[j] = temp; } if (increment == 2) { increment = 1; } else { increment *= (5.0 / 11); } } }
Sub arrShellSort(ByVal arrData As Variant) Dim lngHold, lngGap As Long Dim lngCount, lngMin, lngMax As Long Dim varItem As Variant lngMin = LBound(arrData) lngMax = UBound(arrData) lngGap = lngMin Do While (lngGap < lngMax) lngGap = 3 * lngGap + 1 Loop Do While (lngGap > 1) lngGap = lngGap \ 3 For lngCount = lngGap + lngMin To lngMax varItem = arrData(lngCount) lngHold = lngCount Do While ((arrData(lngHold - lngGap) > varItem)) arrData(lngHold) = arrData(lngHold - lngGap) lngHold = lngHold - lngGap If (lngHold < lngMin + lngGap) Then Exit Do Loop arrData(lngHold) = varItem Next Loop arrShellSort = arrData End Sub
Can you help me rewrite this code in VB instead of Java, keeping it the same logically?
import java.util.LinkedList; public class DoublyLinkedList { public static void main(String[] args) { LinkedList<String> list = new LinkedList<String>(); list.addFirst("Add First"); list.addLast("Add Last 1"); list.addLast("Add Last 2"); list.addLast("Add Last 1"); traverseList(list); list.removeFirstOccurrence("Add Last 1"); traverseList(list); } private static void traverseList(LinkedList<String> list) { System.out.println("Traverse List:"); for ( int i = 0 ; i < list.size() ; i++ ) { System.out.printf("Element number %d - Element value = '%s'%n", i, list.get(i)); } System.out.println(); } }
Public Class DoubleLinkList(Of T) Private m_Head As Node(Of T) Private m_Tail As Node(Of T) Public Sub AddHead(ByVal value As T) Dim node As New Node(Of T)(Me, value) If m_Head Is Nothing Then m_Head = Node m_Tail = m_Head Else node.Next = m_Head m_Head = node End If End Sub Public Sub AddTail(ByVal value As T) Dim node As New Node(Of T)(Me, value) If m_Tail Is Nothing Then m_Head = node m_Tail = m_Head Else node.Previous = m_Tail m_Tail = node End If End Sub Public ReadOnly Property Head() As Node(Of T) Get Return m_Head End Get End Property Public ReadOnly Property Tail() As Node(Of T) Get Return m_Tail End Get End Property Public Sub RemoveTail() If m_Tail Is Nothing Then Return If m_Tail.Previous Is Nothing Then m_Head = Nothing m_Tail = Nothing Else m_Tail = m_Tail.Previous m_Tail.Next = Nothing End If End Sub Public Sub RemoveHead() If m_Head Is Nothing Then Return If m_Head.Next Is Nothing Then m_Head = Nothing m_Tail = Nothing Else m_Head = m_Head.Next m_Head.Previous = Nothing End If End Sub End Class Public Class Node(Of T) Private ReadOnly m_Value As T Private m_Next As Node(Of T) Private m_Previous As Node(Of T) Private ReadOnly m_Parent As DoubleLinkList(Of T) Public Sub New(ByVal parent As DoubleLinkList(Of T), ByVal value As T) m_Parent = parent m_Value = value End Sub Public Property [Next]() As Node(Of T) Get Return m_Next End Get Friend Set(ByVal value As Node(Of T)) m_Next = value End Set End Property Public Property Previous() As Node(Of T) Get Return m_Previous End Get Friend Set(ByVal value As Node(Of T)) m_Previous = value End Set End Property Public ReadOnly Property Value() As T Get Return m_Value End Get End Property Public Sub InsertAfter(ByVal value As T) If m_Next Is Nothing Then m_Parent.AddTail(value) ElseIf m_Previous Is Nothing Then m_Parent.AddHead(value) Else Dim node As New Node(Of T)(m_Parent, value) node.Previous = Me node.Next = Me.Next Me.Next.Previous = node Me.Next = node End If End Sub Public Sub Remove() If m_Next Is Nothing Then m_Parent.RemoveTail() ElseIf m_Previous Is Nothing Then m_Parent.RemoveHead() Else m_Previous.Next = Me.Next m_Next.Previous = Me.Previous End If End Sub End Class
Write the same code in VB as shown below in Java.
import java.io.BufferedReader; import java.io.FileReader; import java.io.IOException; import java.util.Arrays; public class LetterFreq { public static int[] countLetters(String filename) throws IOException{ int[] freqs = new int[26]; BufferedReader in = new BufferedReader(new FileReader(filename)); String line; while((line = in.readLine()) != null){ line = line.toUpperCase(); for(char ch:line.toCharArray()){ if(Character.isLetter(ch)){ freqs[ch - 'A']++; } } } in.close(); return freqs; } public static void main(String[] args) throws IOException{ System.out.println(Arrays.toString(countLetters("filename.txt"))); } }
TYPE regChar Character AS STRING * 3 Count AS LONG END TYPE DIM iChar AS INTEGER DIM iCL AS INTEGER DIM iCountChars AS INTEGER DIM iFile AS INTEGER DIM i AS INTEGER DIM lMUC AS LONG DIM iMUI AS INTEGER DIM lLUC AS LONG DIM iLUI AS INTEGER DIM iMaxIdx AS INTEGER DIM iP AS INTEGER DIM iPause AS INTEGER DIM iPMI AS INTEGER DIM iPrint AS INTEGER DIM lHowMany AS LONG DIM lTotChars AS LONG DIM sTime AS SINGLE DIM strFile AS STRING DIM strTxt AS STRING DIM strDate AS STRING DIM strTime AS STRING DIM strKey AS STRING CONST LngReg = 256 CONST Letters = 1 CONST FALSE = 0 CONST TRUE = NOT FALSE strDate = DATE$ strTime = TIME$ iFile = FREEFILE DO CLS PRINT "This program counts letters or characters in a text file." PRINT INPUT "File to open: ", strFile OPEN strFile FOR BINARY AS #iFile IF LOF(iFile) > 0 THEN PRINT "Count: 1) Letters 2) Characters (1 or 2)"; DO strKey = INKEY$ LOOP UNTIL strKey = "1" OR strKey = "2" PRINT ". Option selected: "; strKey iCL = VAL(strKey) sTime = TIMER iP = POS(0) lHowMany = LOF(iFile) strTxt = SPACE$(LngReg) IF iCL = Letters THEN iMaxIdx = 26 ELSE iMaxIdx = 255 END IF IF iMaxIdx <> iPMI THEN iPMI = iMaxIdx REDIM rChar(0 TO iMaxIdx) AS regChar FOR i = 0 TO iMaxIdx IF iCL = Letters THEN strTxt = CHR$(i + 65) IF i = 26 THEN strTxt = CHR$(165) ELSE SELECT CASE i CASE 0: strTxt = "nul" CASE 7: strTxt = "bel" CASE 9: strTxt = "tab" CASE 10: strTxt = "lf" CASE 11: strTxt = "vt" CASE 12: strTxt = "ff" CASE 13: strTxt = "cr" CASE 28: strTxt = "fs" CASE 29: strTxt = "gs" CASE 30: strTxt = "rs" CASE 31: strTxt = "us" CASE 32: strTxt = "sp" CASE ELSE: strTxt = CHR$(i) END SELECT END IF rChar(i).Character = strTxt NEXT i ELSE FOR i = 0 TO iMaxIdx rChar(i).Count = 0 NEXT i END IF PRINT "Looking for "; IF iCL = Letters THEN PRINT "letters."; ELSE PRINT "characters."; PRINT " File is"; STR$(lHowMany); " in size. Working"; : COLOR 23: PRINT "..."; : COLOR (7) DO WHILE LOC(iFile) < LOF(iFile) IF LOC(iFile) + LngReg > LOF(iFile) THEN strTxt = SPACE$(LOF(iFile) - LOC(iFile)) END IF GET #iFile, , strTxt FOR i = 1 TO LEN(strTxt) IF iCL = Letters THEN iChar = ASC(UCASE$(MID$(strTxt, i, 1))) SELECT CASE iChar CASE 164: iChar = 165 CASE 160: iChar = 65 CASE 130, 144: iChar = 69 CASE 161: iChar = 73 CASE 162: iChar = 79 CASE 163, 129: iChar = 85 END SELECT iChar = iChar - 65 IF iChar >= 0 AND iChar <= 25 THEN rChar(iChar).Count = rChar(iChar).Count + 1 ELSEIF iChar = 100 THEN rChar(iMaxIdx).Count = rChar(iMaxIdx).Count + 1 END IF ELSE iChar = ASC(MID$(strTxt, i, 1)) rChar(iChar).Count = rChar(iChar).Count + 1 END IF NEXT i LOOP CLOSE #iFile lMUC = 0 iMUI = 0 lLUC = 2147483647 iLUI = 0 iPrint = FALSE lTotChars = 0 iCountChars = 0 iPause = FALSE CLS IF iCL = Letters THEN PRINT "Letters found: "; ELSE PRINT "Characters found: "; FOR i = 0 TO iMaxIdx IF lMUC < rChar(i).Count THEN lMUC = rChar(i).Count iMUI = i END IF IF rChar(i).Count > 0 THEN strTxt = "" IF iPrint THEN strTxt = ", " ELSE iPrint = TRUE strTxt = strTxt + LTRIM$(RTRIM$(rChar(i).Character)) strTxt = strTxt + "=" + LTRIM$(STR$(rChar(i).Count)) iP = POS(0) IF iP + LEN(strTxt) + 1 >= 80 AND iPrint THEN PRINT "," IF CSRLIN >= 23 AND NOT iPause THEN iPause = TRUE PRINT "Press a key to continue..." DO strKey = INKEY$ LOOP UNTIL strKey <> "" END IF strTxt = MID$(strTxt, 3) END IF PRINT strTxt; lTotChars = lTotChars + rChar(i).Count iCountChars = iCountChars + 1 IF lLUC > rChar(i).Count THEN lLUC = rChar(i).Count iLUI = i END IF END IF NEXT i PRINT "." PRINT PRINT "File analyzed....................: "; strFile PRINT "Looked for.......................: "; : IF iCL = Letters THEN PRINT "Letters" ELSE PRINT "Characters" PRINT "Total characters in file.........:"; lHowMany PRINT "Total characters counted.........:"; lTotChars IF iCL = Letters THEN PRINT "Characters discarded on count....:"; lHowMany - lTotChars PRINT "Distinct characters found in file:"; iCountChars; "of"; iMaxIdx + 1 PRINT "Most used character was..........: "; iPrint = FALSE FOR i = 0 TO iMaxIdx IF rChar(i).Count = lMUC THEN IF iPrint THEN PRINT ", "; ELSE iPrint = TRUE PRINT RTRIM$(LTRIM$(rChar(i).Character)); END IF NEXT i PRINT " ("; LTRIM$(STR$(rChar(iMUI).Count)); " times)" PRINT "Least used character was.........: "; iPrint = FALSE FOR i = 0 TO iMaxIdx IF rChar(i).Count = lLUC THEN IF iPrint THEN PRINT ", "; ELSE iPrint = TRUE PRINT RTRIM$(LTRIM$(rChar(i).Character)); END IF NEXT i PRINT " ("; LTRIM$(STR$(rChar(iLUI).Count)); " times)" PRINT "Time spent in the process........:"; TIMER - sTime; "seconds" ELSE CLOSE #iFile KILL strFile PRINT PRINT "File does not exist." END IF PRINT PRINT "Again? (Y/n)" DO strTxt = UCASE$(INKEY$) LOOP UNTIL strTxt = "N" OR strTxt = "Y" OR strTxt = CHR$(13) OR strTxt = CHR$(27) LOOP UNTIL strTxt = "N" OR strTxt = CHR$(27) CLS PRINT "End of execution." PRINT "Start time: "; strDate; " "; strTime; ", end time: "; DATE$; " "; TIME$; "." END
Port the following code from Java to VB with equivalent syntax and logic.
String s = "12345"; IntLiteral lit1 = new IntLiteral(s); IntLiteral lit2 = 6789; ++lit1; ++lit2;
Dim s As String = "123" s = CStr(CInt("123") + 1) s = (CInt("123") + 1).ToString
Transform the following Java implementation into VB, maintaining the same output and logic.
class StripChars { public static String stripChars(String inString, String toStrip) { return inString.replaceAll("[" + toStrip + "]", ""); } public static void main(String[] args) { String sentence = "She was a soul stripper. She took my heart!"; String chars = "aei"; System.out.println("sentence: " + sentence); System.out.println("to strip: " + chars); System.out.println("stripped: " + stripChars(sentence, chars)); } }
Function StripChars(stString As String, stStripChars As String, Optional bSpace As Boolean) Dim i As Integer, stReplace As String If bSpace = True Then stReplace = " " Else stReplace = "" End If For i = 1 To Len(stStripChars) stString = Replace(stString, Mid(stStripChars, i, 1), stReplace) Next i StripChars = stString End Function
Write a version of this Java function in VB with identical behavior.
public static double avg(double... arr) { double sum = 0.0; for (double x : arr) { sum += x; } return sum / arr.length; }
Private Function mean(v() As Double, ByVal leng As Integer) As Variant Dim sum As Double, i As Integer sum = 0: i = 0 For i = 0 To leng - 1 sum = sum + vv Next i If leng = 0 Then mean = CVErr(xlErrDiv0) Else mean = sum / leng End If End Function Public Sub main() Dim v(4) As Double Dim i As Integer, leng As Integer v(0) = 1# v(1) = 2# v(2) = 2.178 v(3) = 3# v(4) = 3.142 For leng = 5 To 0 Step -1 Debug.Print "mean["; For i = 0 To leng - 1 Debug.Print IIf(i, "; " & v(i), "" & v(i)); Next i Debug.Print "] = "; mean(v, leng) Next leng End Sub
Please provide an equivalent version of this Java code in VB.
import java.util.*; public class Abbreviations { public static void main(String[] args) { CommandList commands = new CommandList(commandTable); String input = "riG rePEAT copies put mo rest types fup. 6 poweRin"; System.out.println(" input: " + input); System.out.println("output: " + test(commands, input)); } private static String test(CommandList commands, String input) { StringBuilder output = new StringBuilder(); Scanner scanner = new Scanner(input); while (scanner.hasNext()) { String word = scanner.next(); if (output.length() > 0) output.append(' '); Command cmd = commands.findCommand(word); if (cmd != null) output.append(cmd.cmd); else output.append("*error*"); } return output.toString(); } private static String commandTable = "add 1 alter 3 backup 2 bottom 1 Cappend 2 change 1 Schange Cinsert 2 Clast 3 " + "compress 4 copy 2 count 3 Coverlay 3 cursor 3 delete 3 Cdelete 2 down 1 duplicate " + "3 xEdit 1 expand 3 extract 3 find 1 Nfind 2 Nfindup 6 NfUP 3 Cfind 2 findUP 3 fUP 2 " + "forward 2 get help 1 hexType 4 input 1 powerInput 3 join 1 split 2 spltJOIN load " + "locate 1 Clocate 2 lowerCase 3 upperCase 3 Lprefix 2 macro merge 2 modify 3 move 2 " + "msg next 1 overlay 1 parse preserve 4 purge 3 put putD query 1 quit read recover 3 " + "refresh renum 3 repeat 3 replace 1 Creplace 2 reset 3 restore 4 rgtLEFT right 2 left " + "2 save set shift 2 si sort sos stack 3 status 4 top transfer 3 type 1 up 1"; private static class Command { private Command(String cmd, int minLength) { this.cmd = cmd; this.minLength = minLength; } private boolean match(String str) { int olen = str.length(); return olen >= minLength && olen <= cmd.length() && cmd.regionMatches(true, 0, str, 0, olen); } private String cmd; private int minLength; } private static Integer parseInteger(String word) { try { return Integer.valueOf(word); } catch (NumberFormatException ex) { return null; } } private static class CommandList { private CommandList(String table) { Scanner scanner = new Scanner(table); List<String> words = new ArrayList<>(); while (scanner.hasNext()) { String word = scanner.next(); words.add(word.toUpperCase()); } for (int i = 0, n = words.size(); i < n; ++i) { String word = words.get(i); int len = word.length(); if (i + 1 < n) { Integer number = parseInteger(words.get(i + 1)); if (number != null) { len = number.intValue(); ++i; } } commands.add(new Command(word, len)); } } private Command findCommand(String word) { for (Command command : commands) { if (command.match(word)) return command; } return null; } private List<Command> commands = new ArrayList<>(); } }
Private Function ValidateUserWords(userstring As String) As String Dim s As String Dim user_words() As String Dim command_table As Scripting.Dictionary Set command_table = New Scripting.Dictionary Dim abbreviations As Scripting.Dictionary Set abbreviations = New Scripting.Dictionary abbreviations.CompareMode = TextCompare Dim commandtable() As String Dim commands As String s = s & "add 1 alter 3 backup 2 bottom 1 Cappend 2 change 1 Schange Cinsert 2 Clast 3 " s = s & "compress 4 copy 2 count 3 Coverlay 3 cursor 3 delete 3 Cdelete 2 down 1 duplicate " s = s & "3 xEdit 1 expand 3 extract 3 find 1 Nfind 2 Nfindup 6 NfUP 3 Cfind 2 findUP 3 fUP 2 " s = s & "forward 2 get help 1 hexType 4 input 1 powerInput 3 join 1 split 2 spltJOIN load " s = s & "locate 1 Clocate 2 lowerCase 3 upperCase 3 Lprefix 2 macro merge 2 modify 3 move 2 " s = s & "msg next 1 overlay 1 parse preserve 4 purge 3 put putD query 1 quit read recover 3 " s = s & "refresh renum 3 repeat 3 replace 1 Creplace 2 reset 3 restore 4 rgtLEFT right 2 left " s = s & "2 save set shift 2 si sort sos stack 3 status 4 top transfer 3 type 1 up 1 " commandtable = Split(s, " ") Dim i As Integer, word As Variant, number As Integer For i = LBound(commandtable) To UBound(commandtable) word = commandtable(i) If Len(word) > 0 Then i = i + 1 Do While Len(commandtable(i)) = 0: i = i + 1: Loop number = Val(commandtable(i)) If number > 0 Then command_table.Add Key:=word, Item:=number Else command_table.Add Key:=word, Item:=Len(word) i = i - 1 End If End If Next i For Each word In command_table For i = command_table(word) To Len(word) On Error Resume Next abbreviations.Add Key:=Left(word, i), Item:=UCase(word) Next i Next word user_words() = Split(userstring, " ") For Each word In user_words If Len(word) > 0 Then If abbreviations.exists(word) Then commands = commands & abbreviations(word) & " " Else commands = commands & "*error* " End If End If Next word ValidateUserWords = commands End Function Public Sub program() Dim guserstring As String guserstring = "riG rePEAT copies put mo rest types fup. 6 poweRin" Debug.Print "user words:", guserstring Debug.Print "full words:", ValidateUserWords(guserstring) End Sub
Produce a language-to-language conversion: from Java to VB, same semantics.
import java.util.*; public class Abbreviations { public static void main(String[] args) { CommandList commands = new CommandList(commandTable); String input = "riG rePEAT copies put mo rest types fup. 6 poweRin"; System.out.println(" input: " + input); System.out.println("output: " + test(commands, input)); } private static String test(CommandList commands, String input) { StringBuilder output = new StringBuilder(); Scanner scanner = new Scanner(input); while (scanner.hasNext()) { String word = scanner.next(); if (output.length() > 0) output.append(' '); Command cmd = commands.findCommand(word); if (cmd != null) output.append(cmd.cmd); else output.append("*error*"); } return output.toString(); } private static String commandTable = "add 1 alter 3 backup 2 bottom 1 Cappend 2 change 1 Schange Cinsert 2 Clast 3 " + "compress 4 copy 2 count 3 Coverlay 3 cursor 3 delete 3 Cdelete 2 down 1 duplicate " + "3 xEdit 1 expand 3 extract 3 find 1 Nfind 2 Nfindup 6 NfUP 3 Cfind 2 findUP 3 fUP 2 " + "forward 2 get help 1 hexType 4 input 1 powerInput 3 join 1 split 2 spltJOIN load " + "locate 1 Clocate 2 lowerCase 3 upperCase 3 Lprefix 2 macro merge 2 modify 3 move 2 " + "msg next 1 overlay 1 parse preserve 4 purge 3 put putD query 1 quit read recover 3 " + "refresh renum 3 repeat 3 replace 1 Creplace 2 reset 3 restore 4 rgtLEFT right 2 left " + "2 save set shift 2 si sort sos stack 3 status 4 top transfer 3 type 1 up 1"; private static class Command { private Command(String cmd, int minLength) { this.cmd = cmd; this.minLength = minLength; } private boolean match(String str) { int olen = str.length(); return olen >= minLength && olen <= cmd.length() && cmd.regionMatches(true, 0, str, 0, olen); } private String cmd; private int minLength; } private static Integer parseInteger(String word) { try { return Integer.valueOf(word); } catch (NumberFormatException ex) { return null; } } private static class CommandList { private CommandList(String table) { Scanner scanner = new Scanner(table); List<String> words = new ArrayList<>(); while (scanner.hasNext()) { String word = scanner.next(); words.add(word.toUpperCase()); } for (int i = 0, n = words.size(); i < n; ++i) { String word = words.get(i); int len = word.length(); if (i + 1 < n) { Integer number = parseInteger(words.get(i + 1)); if (number != null) { len = number.intValue(); ++i; } } commands.add(new Command(word, len)); } } private Command findCommand(String word) { for (Command command : commands) { if (command.match(word)) return command; } return null; } private List<Command> commands = new ArrayList<>(); } }
Private Function ValidateUserWords(userstring As String) As String Dim s As String Dim user_words() As String Dim command_table As Scripting.Dictionary Set command_table = New Scripting.Dictionary Dim abbreviations As Scripting.Dictionary Set abbreviations = New Scripting.Dictionary abbreviations.CompareMode = TextCompare Dim commandtable() As String Dim commands As String s = s & "add 1 alter 3 backup 2 bottom 1 Cappend 2 change 1 Schange Cinsert 2 Clast 3 " s = s & "compress 4 copy 2 count 3 Coverlay 3 cursor 3 delete 3 Cdelete 2 down 1 duplicate " s = s & "3 xEdit 1 expand 3 extract 3 find 1 Nfind 2 Nfindup 6 NfUP 3 Cfind 2 findUP 3 fUP 2 " s = s & "forward 2 get help 1 hexType 4 input 1 powerInput 3 join 1 split 2 spltJOIN load " s = s & "locate 1 Clocate 2 lowerCase 3 upperCase 3 Lprefix 2 macro merge 2 modify 3 move 2 " s = s & "msg next 1 overlay 1 parse preserve 4 purge 3 put putD query 1 quit read recover 3 " s = s & "refresh renum 3 repeat 3 replace 1 Creplace 2 reset 3 restore 4 rgtLEFT right 2 left " s = s & "2 save set shift 2 si sort sos stack 3 status 4 top transfer 3 type 1 up 1 " commandtable = Split(s, " ") Dim i As Integer, word As Variant, number As Integer For i = LBound(commandtable) To UBound(commandtable) word = commandtable(i) If Len(word) > 0 Then i = i + 1 Do While Len(commandtable(i)) = 0: i = i + 1: Loop number = Val(commandtable(i)) If number > 0 Then command_table.Add Key:=word, Item:=number Else command_table.Add Key:=word, Item:=Len(word) i = i - 1 End If End If Next i For Each word In command_table For i = command_table(word) To Len(word) On Error Resume Next abbreviations.Add Key:=Left(word, i), Item:=UCase(word) Next i Next word user_words() = Split(userstring, " ") For Each word In user_words If Len(word) > 0 Then If abbreviations.exists(word) Then commands = commands & abbreviations(word) & " " Else commands = commands & "*error* " End If End If Next word ValidateUserWords = commands End Function Public Sub program() Dim guserstring As String guserstring = "riG rePEAT copies put mo rest types fup. 6 poweRin" Debug.Print "user words:", guserstring Debug.Print "full words:", ValidateUserWords(guserstring) End Sub
Ensure the translated VB code behaves exactly like the original Java snippet.
import java.util.*; public class TokenizeStringWithEscaping { public static void main(String[] args) { String sample = "one^|uno||three^^^^|four^^^|^cuatro|"; char separator = '|'; char escape = '^'; System.out.println(sample); try { System.out.println(tokenizeString(sample, separator, escape)); } catch (Exception e) { System.out.println(e); } } public static List<String> tokenizeString(String s, char sep, char escape) throws Exception { List<String> tokens = new ArrayList<>(); StringBuilder sb = new StringBuilder(); boolean inEscape = false; for (char c : s.toCharArray()) { if (inEscape) { inEscape = false; } else if (c == escape) { inEscape = true; continue; } else if (c == sep) { tokens.add(sb.toString()); sb.setLength(0); continue; } sb.append(c); } if (inEscape) throw new Exception("Invalid terminal escape"); tokens.add(sb.toString()); return tokens; } }
Private Function tokenize(s As String, sep As String, esc As String) As Collection Dim ret As New Collection Dim this As String Dim skip As Boolean If Len(s) <> 0 Then For i = 1 To Len(s) si = Mid(s, i, 1) If skip Then this = this & si skip = False Else If si = esc Then skip = True Else If si = sep Then ret.Add this this = "" Else this = this & si End If End If End If Next i ret.Add this End If Set tokenize = ret End Function Public Sub main() Dim out As Collection Set out = tokenize("one^|uno||three^^^^|four^^^|^cuatro|", "|", "^") Dim outstring() As String ReDim outstring(out.Count - 1) For i = 0 To out.Count - 1 outstring(i) = out(i + 1) Next i Debug.Print Join(outstring, ", ") End Sub
Keep all operations the same but rewrite the snippet in VB.
module HelloWorld { void run() { @Inject Console console; console.print("Hello World!"); } }
Public Sub hello_world_text Debug.Print "Hello World!" End Sub
Keep all operations the same but rewrite the snippet in VB.
module HelloWorld { void run() { @Inject Console console; console.print("Hello World!"); } }
Public Sub hello_world_text Debug.Print "Hello World!" End Sub
Maintain the same structure and functionality when rewriting this code in VB.
import java.util.Arrays; public class FD { public static void main(String args[]) { double[] a = {90, 47, 58, 29, 22, 32, 55, 5, 55, 73}; System.out.println(Arrays.toString(dif(a, 1))); System.out.println(Arrays.toString(dif(a, 2))); System.out.println(Arrays.toString(dif(a, 9))); System.out.println(Arrays.toString(dif(a, 10))); System.out.println(Arrays.toString(dif(a, 11))); System.out.println(Arrays.toString(dif(a, -1))); System.out.println(Arrays.toString(dif(a, 0))); } public static double[] dif(double[] a, int n) { if (n < 0) return null; for (int i = 0; i < n && a.length > 0; i++) { double[] b = new double[a.length - 1]; for (int j = 0; j < b.length; j++){ b[j] = a[j+1] - a[j]; } a = b; } return a; } }
Module ForwardDifference Sub Main() Dim lNum As New List(Of Integer)(New Integer() {90, 47, 58, 29, 22, 32, 55, 5, 55, 73}) For i As UInteger = 0 To 9 Console.WriteLine(String.Join(" ", (From n In Difference(i, lNum) Select String.Format("{0,5}", n)).ToArray())) Next Console.ReadKey() End Sub Private Function Difference(ByVal Level As UInteger, ByVal Numbers As List(Of Integer)) As List(Of Integer) If Level >= Numbers.Count Then Throw New ArgumentOutOfRangeException("Level", "Level must be less than number of items in Numbers") For i As Integer = 1 To Level Numbers = (From n In Enumerable.Range(0, Numbers.Count - 1) _ Select Numbers(n + 1) - Numbers(n)).ToList() Next Return Numbers End Function End Module
Generate an equivalent VB version of this Java code.
public static boolean prime(long a){ if(a == 2){ return true; }else if(a <= 1 || a % 2 == 0){ return false; } long max = (long)Math.sqrt(a); for(long n= 3; n <= max; n+= 2){ if(a % n == 0){ return false; } } return true; }
Option Explicit Sub FirstTwentyPrimes() Dim count As Integer, i As Long, t(19) As String Do i = i + 1 If IsPrime(i) Then t(count) = i count = count + 1 End If Loop While count <= UBound(t) Debug.Print Join(t, ", ") End Sub Function IsPrime(Nb As Long) As Boolean If Nb = 2 Then IsPrime = True ElseIf Nb < 2 Or Nb Mod 2 = 0 Then Exit Function Else Dim i As Long For i = 3 To Sqr(Nb) Step 2 If Nb Mod i = 0 Then Exit Function Next IsPrime = True End If End Function
Write the same algorithm in VB as shown in this Java implementation.
public class Binomial { private static long binomialInt(int n, int k) { if (k > n - k) k = n - k; long binom = 1; for (int i = 1; i <= k; i++) binom = binom * (n + 1 - i) / i; return binom; } private static Object binomialIntReliable(int n, int k) { if (k > n - k) k = n - k; long binom = 1; for (int i = 1; i <= k; i++) { try { binom = Math.multiplyExact(binom, n + 1 - i) / i; } catch (ArithmeticException e) { return "overflow"; } } return binom; } private static double binomialFloat(int n, int k) { if (k > n - k) k = n - k; double binom = 1.0; for (int i = 1; i <= k; i++) binom = binom * (n + 1 - i) / i; return binom; } private static BigInteger binomialBigInt(int n, int k) { if (k > n - k) k = n - k; BigInteger binom = BigInteger.ONE; for (int i = 1; i <= k; i++) { binom = binom.multiply(BigInteger.valueOf(n + 1 - i)); binom = binom.divide(BigInteger.valueOf(i)); } return binom; } private static void demo(int n, int k) { List<Object> data = Arrays.asList( n, k, binomialInt(n, k), binomialIntReliable(n, k), binomialFloat(n, k), binomialBigInt(n, k)); System.out.println(data.stream().map(Object::toString).collect(Collectors.joining("\t"))); } public static void main(String[] args) { demo(5, 3); demo(1000, 300); } }
Function binomial(n,k) binomial = factorial(n)/(factorial(n-k)*factorial(k)) End Function Function factorial(n) If n = 0 Then factorial = 1 Else For i = n To 1 Step -1 If i = n Then factorial = n Else factorial = factorial * i End If Next End If End Function WScript.StdOut.Write "the binomial coefficient of 5 and 3 = " & binomial(5,3) WScript.StdOut.WriteLine
Change the following Java code into VB without altering its purpose.
List arrayList = new ArrayList(); arrayList.add(new Integer(0)); arrayList.add(0); List<Integer> myarrlist = new ArrayList<Integer>(); int sum; for(int i = 0; i < 10; i++) { myarrlist.add(i); }
Dim coll As New Collection coll.Add "apple" coll.Add "banana"
Convert the following code from Java to VB, ensuring the logic remains intact.
LinkedList<Type> list = new LinkedList<Type>(); for(Type i: list){ System.out.println(i); }
Private Sub Iterate(ByVal list As LinkedList(Of Integer)) Dim node = list.First Do Until node Is Nothing node = node.Next Loop End Sub
Change the following Java code into VB without altering its purpose.
import java.io.BufferedOutputStream; import java.io.File; import java.io.FileOutputStream; import java.io.IOException; import java.nio.charset.StandardCharsets; public class PPMWriter { public void bitmapToPPM(File file, BasicBitmapStorage bitmap) throws IOException { file.delete(); try (var os = new FileOutputStream(file, true); var bw = new BufferedOutputStream(os)) { var header = String.format("P6\n%d %d\n255\n", bitmap.getWidth(), bitmap.getHeight()); bw.write(header.getBytes(StandardCharsets.US_ASCII)); for (var y = 0; y < bitmap.getHeight(); y++) { for (var x = 0; x < bitmap.getWidth(); x++) { var pixel = bitmap.getPixel(x, y); bw.write(pixel.getRed()); bw.write(pixel.getGreen()); bw.write(pixel.getBlue()); } } } } }
Public Shared Sub SaveRasterBitmapToPpmFile(ByVal rasterBitmap As RasterBitmap, ByVal filepath As String) Dim header As String = String.Format("P6{0}{1}{2}{3}{0}255{0}", vbLf, rasterBitmap.Width, " "c, rasterBitmap.Height) Dim bufferSize As Integer = header.Length + (rasterBitmap.Width * rasterBitmap.Height * 3) Dim bytes(bufferSize - 1) As Byte Buffer.BlockCopy(Encoding.ASCII.GetBytes(header.ToString), 0, bytes, 0, header.Length) Dim index As Integer = header.Length For y As Integer = 0 To rasterBitmap.Height - 1 For x As Integer = 0 To rasterBitmap.Width - 1 Dim color As Rgb = rasterBitmap.GetPixel(x, y) bytes(index) = color.R bytes(index + 1) = color.G bytes(index + 2) = color.B index += 3 Next Next My.Computer.FileSystem.WriteAllBytes(filepath, bytes, False) End Sub
Write the same algorithm in VB as shown in this Java implementation.
import java.io.File; public class FileDeleteTest { public static boolean deleteFile(String filename) { boolean exists = new File(filename).delete(); return exists; } public static void test(String type, String filename) { System.out.println("The following " + type + " called " + filename + (deleteFile(filename) ? " was deleted." : " could not be deleted.") ); } public static void main(String args[]) { test("file", "input.txt"); test("file", File.seperator + "input.txt"); test("directory", "docs"); test("directory", File.seperator + "docs" + File.seperator); } }
Option Explicit Sub DeleteFileOrDirectory() Dim myPath As String myPath = "C:\Users\surname.name\Desktop\Docs" Kill myPath & "\input.txt" RmDir myPath End Sub
Convert the following code from Java to VB, ensuring the logic remains intact.
import java.util.HashSet; import java.util.Random; import java.util.Set; public class AverageLoopLength { private static final int N = 100000; private static double analytical(int n) { double[] factorial = new double[n + 1]; double[] powers = new double[n + 1]; powers[0] = 1.0; factorial[0] = 1.0; for (int i = 1; i <= n; i++) { factorial[i] = factorial[i - 1] * i; powers[i] = powers[i - 1] * n; } double sum = 0; for (int i = 1; i <= n; i++) { sum += factorial[n] / factorial[n - i] / powers[i]; } return sum; } private static double average(int n) { Random rnd = new Random(); double sum = 0.0; for (int a = 0; a < N; a++) { int[] random = new int[n]; for (int i = 0; i < n; i++) { random[i] = rnd.nextInt(n); } Set<Integer> seen = new HashSet<>(n); int current = 0; int length = 0; while (seen.add(current)) { length++; current = random[current]; } sum += length; } return sum / N; } public static void main(String[] args) { System.out.println(" N average analytical (error)"); System.out.println("=== ========= ============ ========="); for (int i = 1; i <= 20; i++) { double avg = average(i); double ana = analytical(i); System.out.println(String.format("%3d %9.4f %12.4f (%6.2f%%)", i, avg, ana, ((ana - avg) / ana * 100))); } } }
Const MAX = 20 Const ITER = 1000000 Function expected(n As Long) As Double Dim sum As Double For i = 1 To n sum = sum + WorksheetFunction.Fact(n) / n ^ i / WorksheetFunction.Fact(n - i) Next i expected = sum End Function Function test(n As Long) As Double Dim count As Long Dim x As Long, bits As Long For i = 1 To ITER x = 1 bits = 0 Do While Not bits And x count = count + 1 bits = bits Or x x = 2 ^ (Int(n * Rnd())) Loop Next i test = count / ITER End Function Public Sub main() Dim n As Long Debug.Print " n avg. exp. (error%)" Debug.Print "== ====== ====== ========" For n = 1 To MAX av = test(n) ex = expected(n) Debug.Print Format(n, "@@"); " "; Format(av, "0.0000"); " "; Debug.Print Format(ex, "0.0000"); " ("; Format(Abs(1 - av / ex), "0.000%"); ")" Next n End Sub
Transform the following Java implementation into VB, maintaining the same output and logic.
import java.util.HashSet; import java.util.Random; import java.util.Set; public class AverageLoopLength { private static final int N = 100000; private static double analytical(int n) { double[] factorial = new double[n + 1]; double[] powers = new double[n + 1]; powers[0] = 1.0; factorial[0] = 1.0; for (int i = 1; i <= n; i++) { factorial[i] = factorial[i - 1] * i; powers[i] = powers[i - 1] * n; } double sum = 0; for (int i = 1; i <= n; i++) { sum += factorial[n] / factorial[n - i] / powers[i]; } return sum; } private static double average(int n) { Random rnd = new Random(); double sum = 0.0; for (int a = 0; a < N; a++) { int[] random = new int[n]; for (int i = 0; i < n; i++) { random[i] = rnd.nextInt(n); } Set<Integer> seen = new HashSet<>(n); int current = 0; int length = 0; while (seen.add(current)) { length++; current = random[current]; } sum += length; } return sum / N; } public static void main(String[] args) { System.out.println(" N average analytical (error)"); System.out.println("=== ========= ============ ========="); for (int i = 1; i <= 20; i++) { double avg = average(i); double ana = analytical(i); System.out.println(String.format("%3d %9.4f %12.4f (%6.2f%%)", i, avg, ana, ((ana - avg) / ana * 100))); } } }
Const MAX = 20 Const ITER = 1000000 Function expected(n As Long) As Double Dim sum As Double For i = 1 To n sum = sum + WorksheetFunction.Fact(n) / n ^ i / WorksheetFunction.Fact(n - i) Next i expected = sum End Function Function test(n As Long) As Double Dim count As Long Dim x As Long, bits As Long For i = 1 To ITER x = 1 bits = 0 Do While Not bits And x count = count + 1 bits = bits Or x x = 2 ^ (Int(n * Rnd())) Loop Next i test = count / ITER End Function Public Sub main() Dim n As Long Debug.Print " n avg. exp. (error%)" Debug.Print "== ====== ====== ========" For n = 1 To MAX av = test(n) ex = expected(n) Debug.Print Format(n, "@@"); " "; Format(av, "0.0000"); " "; Debug.Print Format(ex, "0.0000"); " ("; Format(Abs(1 - av / ex), "0.000%"); ")" Next n End Sub
Generate a VB translation of this Java snippet without changing its computational steps.
String original = "Mary had a X lamb"; String little = "little"; String replaced = original.replace("X", little); System.out.println(replaced); System.out.printf("Mary had a %s lamb.", little); String formatted = String.format("Mary had a %s lamb.", little); System.out.println(formatted);
Dim name as String = "J. Doe" Dim balance as Double = 123.45 Dim prompt as String = String.Format("Hello {0}, your balance is {1}.", name, balance) Console.WriteLine(prompt)
Write a version of this Java function in VB with identical behavior.
import java.util.Scanner; public class MatrixArithmetic { public static double[][] minor(double[][] a, int x, int y){ int length = a.length-1; double[][] result = new double[length][length]; for(int i=0;i<length;i++) for(int j=0;j<length;j++){ if(i<x && j<y){ result[i][j] = a[i][j]; }else if(i>=x && j<y){ result[i][j] = a[i+1][j]; }else if(i<x && j>=y){ result[i][j] = a[i][j+1]; }else{ result[i][j] = a[i+1][j+1]; } } return result; } public static double det(double[][] a){ if(a.length == 1){ return a[0][0]; }else{ int sign = 1; double sum = 0; for(int i=0;i<a.length;i++){ sum += sign * a[0][i] * det(minor(a,0,i)); sign *= -1; } return sum; } } public static double perm(double[][] a){ if(a.length == 1){ return a[0][0]; }else{ double sum = 0; for(int i=0;i<a.length;i++){ sum += a[0][i] * perm(minor(a,0,i)); } return sum; } } public static void main(String args[]){ Scanner sc = new Scanner(System.in); int size = sc.nextInt(); double[][] a = new double[size][size]; for(int i=0;i<size;i++) for(int j=0;j<size;j++){ a[i][j] = sc.nextDouble(); } sc.close(); System.out.println("Determinant: "+det(a)); System.out.println("Permanent: "+perm(a)); } }
Module Module1 Function Minor(a As Double(,), x As Integer, y As Integer) As Double(,) Dim length = a.GetLength(0) - 1 Dim result(length - 1, length - 1) As Double For i = 1 To length For j = 1 To length If i < x AndAlso j < y Then result(i - 1, j - 1) = a(i - 1, j - 1) ElseIf i >= x AndAlso j < y Then result(i - 1, j - 1) = a(i, j - 1) ElseIf i < x AndAlso j >= y Then result(i - 1, j - 1) = a(i - 1, j) Else result(i - 1, j - 1) = a(i, j) End If Next Next Return result End Function Function Det(a As Double(,)) As Double If a.GetLength(0) = 1 Then Return a(0, 0) Else Dim sign = 1 Dim sum = 0.0 For i = 1 To a.GetLength(0) sum += sign * a(0, i - 1) * Det(Minor(a, 0, i)) sign *= -1 Next Return sum End If End Function Function Perm(a As Double(,)) As Double If a.GetLength(0) = 1 Then Return a(0, 0) Else Dim sum = 0.0 For i = 1 To a.GetLength(0) sum += a(0, i - 1) * Perm(Minor(a, 0, i)) Next Return sum End If End Function Sub WriteLine(a As Double(,)) For i = 1 To a.GetLength(0) Console.Write("[") For j = 1 To a.GetLength(1) If j > 1 Then Console.Write(", ") End If Console.Write(a(i - 1, j - 1)) Next Console.WriteLine("]") Next End Sub Sub Test(a As Double(,)) If a.GetLength(0) <> a.GetLength(1) Then Throw New ArgumentException("The dimensions must be equal") End If WriteLine(a) Console.WriteLine("Permanant  : {0}", Perm(a)) Console.WriteLine("Determinant: {0}", Det(a)) Console.WriteLine() End Sub Sub Main() Test({{1, 2}, {3, 4}}) Test({{1, 2, 3, 4}, {4, 5, 6, 7}, {7, 8, 9, 10}, {10, 11, 12, 13}}) Test({{0, 1, 2, 3, 4}, {5, 6, 7, 8, 9}, {10, 11, 12, 13, 14}, {15, 16, 17, 18, 19}, {20, 21, 22, 23, 24}}) End Sub End Module
Rewrite the snippet below in VB so it works the same as the original Java code.
import java.util.Scanner; public class MatrixArithmetic { public static double[][] minor(double[][] a, int x, int y){ int length = a.length-1; double[][] result = new double[length][length]; for(int i=0;i<length;i++) for(int j=0;j<length;j++){ if(i<x && j<y){ result[i][j] = a[i][j]; }else if(i>=x && j<y){ result[i][j] = a[i+1][j]; }else if(i<x && j>=y){ result[i][j] = a[i][j+1]; }else{ result[i][j] = a[i+1][j+1]; } } return result; } public static double det(double[][] a){ if(a.length == 1){ return a[0][0]; }else{ int sign = 1; double sum = 0; for(int i=0;i<a.length;i++){ sum += sign * a[0][i] * det(minor(a,0,i)); sign *= -1; } return sum; } } public static double perm(double[][] a){ if(a.length == 1){ return a[0][0]; }else{ double sum = 0; for(int i=0;i<a.length;i++){ sum += a[0][i] * perm(minor(a,0,i)); } return sum; } } public static void main(String args[]){ Scanner sc = new Scanner(System.in); int size = sc.nextInt(); double[][] a = new double[size][size]; for(int i=0;i<size;i++) for(int j=0;j<size;j++){ a[i][j] = sc.nextDouble(); } sc.close(); System.out.println("Determinant: "+det(a)); System.out.println("Permanent: "+perm(a)); } }
Module Module1 Function Minor(a As Double(,), x As Integer, y As Integer) As Double(,) Dim length = a.GetLength(0) - 1 Dim result(length - 1, length - 1) As Double For i = 1 To length For j = 1 To length If i < x AndAlso j < y Then result(i - 1, j - 1) = a(i - 1, j - 1) ElseIf i >= x AndAlso j < y Then result(i - 1, j - 1) = a(i, j - 1) ElseIf i < x AndAlso j >= y Then result(i - 1, j - 1) = a(i - 1, j) Else result(i - 1, j - 1) = a(i, j) End If Next Next Return result End Function Function Det(a As Double(,)) As Double If a.GetLength(0) = 1 Then Return a(0, 0) Else Dim sign = 1 Dim sum = 0.0 For i = 1 To a.GetLength(0) sum += sign * a(0, i - 1) * Det(Minor(a, 0, i)) sign *= -1 Next Return sum End If End Function Function Perm(a As Double(,)) As Double If a.GetLength(0) = 1 Then Return a(0, 0) Else Dim sum = 0.0 For i = 1 To a.GetLength(0) sum += a(0, i - 1) * Perm(Minor(a, 0, i)) Next Return sum End If End Function Sub WriteLine(a As Double(,)) For i = 1 To a.GetLength(0) Console.Write("[") For j = 1 To a.GetLength(1) If j > 1 Then Console.Write(", ") End If Console.Write(a(i - 1, j - 1)) Next Console.WriteLine("]") Next End Sub Sub Test(a As Double(,)) If a.GetLength(0) <> a.GetLength(1) Then Throw New ArgumentException("The dimensions must be equal") End If WriteLine(a) Console.WriteLine("Permanant  : {0}", Perm(a)) Console.WriteLine("Determinant: {0}", Det(a)) Console.WriteLine() End Sub Sub Main() Test({{1, 2}, {3, 4}}) Test({{1, 2, 3, 4}, {4, 5, 6, 7}, {7, 8, 9, 10}, {10, 11, 12, 13}}) Test({{0, 1, 2, 3, 4}, {5, 6, 7, 8, 9}, {10, 11, 12, 13, 14}, {15, 16, 17, 18, 19}, {20, 21, 22, 23, 24}}) End Sub End Module
Maintain the same structure and functionality when rewriting this code in Go.
void bitwise(int a, int b) { printf("a and b: %d\n", a & b); printf("a or b: %d\n", a | b); printf("a xor b: %d\n", a ^ b); printf("not a: %d\n", ~a); printf("a << n: %d\n", a << b); printf("a >> n: %d\n", a >> b); unsigned int c = a; printf("c >> b: %d\n", c >> b); return 0; }
package main import "fmt" func bitwise(a, b int16) { fmt.Printf("a: %016b\n", uint16(a)) fmt.Printf("b: %016b\n", uint16(b)) fmt.Printf("and: %016b\n", uint16(a&b)) fmt.Printf("or: %016b\n", uint16(a|b)) fmt.Printf("xor: %016b\n", uint16(a^b)) fmt.Printf("not: %016b\n", uint16(^a)) if b < 0 { fmt.Println("Right operand is negative, but all shifts require an unsigned right operand (shift distance).") return } ua := uint16(a) ub := uint32(b) fmt.Printf("shl: %016b\n", uint16(ua<<ub)) fmt.Printf("shr: %016b\n", uint16(ua>>ub)) fmt.Printf("las: %016b\n", uint16(a<<ub)) fmt.Printf("ras: %016b\n", uint16(a>>ub)) fmt.Printf("rol: %016b\n", uint16(a<<ub|int16(uint16(a)>>(16-ub)))) fmt.Printf("ror: %016b\n", uint16(int16(uint16(a)>>ub)|a<<(16-ub))) } func main() { var a, b int16 = -460, 6 bitwise(a, b) }
Convert this C snippet to Go and keep its semantics consistent.
#include <stdio.h> #include <stdlib.h> #include <string.h> #include <math.h> long long x, y, dx, dy, scale, clen; typedef struct { double r, g, b; } rgb; rgb ** pix; void sc_up() { long long tmp = dx - dy; dy = dx + dy; dx = tmp; scale *= 2; x *= 2; y *= 2; } void h_rgb(long long x, long long y) { rgb *p = &pix[y][x]; # define SAT 1 double h = 6.0 * clen / scale; double VAL = 1 - (cos(3.141592653579 * 64 * clen / scale) - 1) / 4; double c = SAT * VAL; double X = c * (1 - fabs(fmod(h, 2) - 1)); switch((int)h) { case 0: p->r += c; p->g += X; return; case 1: p->r += X; p->g += c; return; case 2: p->g += c; p->b += X; return; case 3: p->g += X; p->b += c; return; case 4: p->r += X; p->b += c; return; default: p->r += c; p->b += X; } } void iter_string(const char * str, int d) { long tmp; # define LEFT tmp = -dy; dy = dx; dx = tmp # define RIGHT tmp = dy; dy = -dx; dx = tmp while (*str != '\0') { switch(*(str++)) { case 'X': if (d) iter_string("X+YF+", d - 1); continue; case 'Y': if (d) iter_string("-FX-Y", d - 1); continue; case '+': RIGHT; continue; case '-': LEFT; continue; case 'F': clen ++; h_rgb(x/scale, y/scale); x += dx; y += dy; continue; } } } void dragon(long leng, int depth) { long i, d = leng / 3 + 1; long h = leng + 3, w = leng + d * 3 / 2 + 2; rgb *buf = malloc(sizeof(rgb) * w * h); pix = malloc(sizeof(rgb *) * h); for (i = 0; i < h; i++) pix[i] = buf + w * i; memset(buf, 0, sizeof(rgb) * w * h); x = y = d; dx = leng; dy = 0; scale = 1; clen = 0; for (i = 0; i < depth; i++) sc_up(); iter_string("FX", depth); unsigned char *fpix = malloc(w * h * 3); double maxv = 0, *dbuf = (double*)buf; for (i = 3 * w * h - 1; i >= 0; i--) if (dbuf[i] > maxv) maxv = dbuf[i]; for (i = 3 * h * w - 1; i >= 0; i--) fpix[i] = 255 * dbuf[i] / maxv; printf("P6\n%ld %ld\n255\n", w, h); fflush(stdout); fwrite(fpix, h * w * 3, 1, stdout); } int main(int c, char ** v) { int size, depth; depth = (c > 1) ? atoi(v[1]) : 10; size = 1 << depth; fprintf(stderr, "size: %d depth: %d\n", size, depth); dragon(size, depth * 2); return 0; }
package main import ( "fmt" "image" "image/color" "image/draw" "image/png" "math" "os" ) const sep = 512 const depth = 14 var s = math.Sqrt2 / 2 var sin = []float64{0, s, 1, s, 0, -s, -1, -s} var cos = []float64{1, s, 0, -s, -1, -s, 0, s} var p = color.NRGBA{64, 192, 96, 255} var b *image.NRGBA func main() { width := sep * 11 / 6 height := sep * 4 / 3 bounds := image.Rect(0, 0, width, height) b = image.NewNRGBA(bounds) draw.Draw(b, bounds, image.NewUniform(color.White), image.ZP, draw.Src) dragon(14, 0, 1, sep, sep/2, sep*5/6) f, err := os.Create("dragon.png") if err != nil { fmt.Println(err) return } if err = png.Encode(f, b); err != nil { fmt.Println(err) } if err = f.Close(); err != nil { fmt.Println(err) } } func dragon(n, a, t int, d, x, y float64) { if n <= 1 { x1 := int(x + .5) y1 := int(y + .5) x2 := int(x + d*cos[a] + .5) y2 := int(y + d*sin[a] + .5) xInc := 1 if x1 > x2 { xInc = -1 } yInc := 1 if y1 > y2 { yInc = -1 } for x, y := x1, y1; ; x, y = x+xInc, y+yInc { b.Set(x, y, p) if x == x2 { break } } return } d *= s a1 := (a - t) & 7 a2 := (a + t) & 7 dragon(n-1, a1, 1, d, x, y) dragon(n-1, a2, -1, d, x+d*cos[a1], y+d*sin[a1]) }