Instruction stringlengths 45 106 | input_code stringlengths 1 13.7k | output_code stringlengths 1 13.7k |
|---|---|---|
Transform the following Java implementation into VB, maintaining the same output and logic. | import java.io.File;
public class MainEntry {
public static void main(String[] args) {
walkin(new File("/home/user"));
}
public static void walkin(File dir) {
String pattern = ".mp3";
File listFile[] = dir.listFiles();
if (listFile != null) {
for (int i=0; i<listFile.length; i++) {
if (listFile[i].isDirectory()) {
walkin(listFile[i]);
} else {
if (listFile[i].getName().endsWith(pattern)) {
System.out.println(listFile[i].getPath());
}
}
}
}
}
}
| Sub printFiles(parentDir As FolderItem, pattern As String)
For i As Integer = 1 To parentDir.Count
If parentDir.Item(i).Directory Then
printFiles(parentDir.Item(i), pattern)
Else
Dim rg as New RegEx
Dim myMatch as RegExMatch
rg.SearchPattern = pattern
myMatch = rg.search(parentDir.Item(i).Name)
If myMatch <> Nil Then Print(parentDir.Item(i).AbsolutePath)
End If
Next
End Sub
|
Generate an equivalent VB version of this Java code. | import java.util.zip.* ;
public class CRCMaker {
public static void main( String[ ] args ) {
String toBeEncoded = new String( "The quick brown fox jumps over the lazy dog" ) ;
CRC32 myCRC = new CRC32( ) ;
myCRC.update( toBeEncoded.getBytes( ) ) ;
System.out.println( "The CRC-32 value is : " + Long.toHexString( myCRC.getValue( ) ) + " !" ) ;
}
}
| dim crctbl(255)
const crcc =&hEDB88320
sub gencrctable
for i= 0 to 255
k=i
for j=1 to 8
if k and 1 then
k=(k and &h7fffffff)\2 or (&h40000000 and ((k and &h80000000)<>0))
k=k xor crcc
else
k=(k and &h7fffffff)\2 or (&h40000000 and ((k and &h80000000)<>0))
end if
next
crctbl(i)=k
next
end sub
function crc32 (buf)
dim r,r1,i
r=&hffffffff
for i=1 to len(buf)
r1=(r and &h7fffffff)\&h100 or (&h800000 and (r and &h80000000)<>0)
r=r1 xor crctbl((asc(mid(buf,i,1))xor r) and 255)
next
crc32=r xor &hffffffff
end function
gencrctable
wscript.stdout.writeline hex(crc32("The quick brown fox jumps over the lazy dog"))
|
Translate the given Java code snippet into VB without altering its behavior. |
grammar csv2html;
dialog : {System.out.println("<HTML><Table>");}header body+{System.out.println("</Table></HTML>");} ;
header : {System.out.println("<THEAD align=\"center\"><TR bgcolor=\"blue\">");}row{System.out.println("</TR></THEAD");};
body : {System.out.println("<TBODY><TR>");}row{System.out.println("</TR></TBODY");};
row : field ',' field '\r'? '\n';
field : Field{System.out.println("<TD>" + $Field.text.replace("<","<").replace(">",">") + "</TD>");};
Field : ~[,\n\r]+;
| Public Sub CSV_TO_HTML()
input_ = "Character,Speech\n" & _
"The multitude,The messiah! Show us the messiah!\n" & _
"Brians mother,<angry>Now you listen here! He
"he
"The multitude,Who are you?\n" & _
"Brians mother,I
"The multitude,Behold his mother! Behold his mother!"
Debug.Print "<table>" & vbCrLf & "<tr><td>"
For i = 1 To Len(input_)
Select Case Mid(input_, i, 1)
Case "\"
If Mid(input_, i + 1, 1) = "n" Then
Debug.Print "</td></tr>" & vbCrLf & "<tr><td>";
i = i + 1
Else
Debug.Print Mid(input_, i, 1);
End If
Case ",": Debug.Print "</td><td>";
Case "<": Debug.Print "<";
Case ">": Debug.Print ">";
Case "&": Debug.Print "&";
Case Else: Debug.Print Mid(input_, i, 1);
End Select
Next i
Debug.Print "</td></tr>" & vbCrLf & "</table>"
End Sub
|
Rewrite this program in VB while keeping its functionality equivalent to the Java version. |
grammar csv2html;
dialog : {System.out.println("<HTML><Table>");}header body+{System.out.println("</Table></HTML>");} ;
header : {System.out.println("<THEAD align=\"center\"><TR bgcolor=\"blue\">");}row{System.out.println("</TR></THEAD");};
body : {System.out.println("<TBODY><TR>");}row{System.out.println("</TR></TBODY");};
row : field ',' field '\r'? '\n';
field : Field{System.out.println("<TD>" + $Field.text.replace("<","<").replace(">",">") + "</TD>");};
Field : ~[,\n\r]+;
| Public Sub CSV_TO_HTML()
input_ = "Character,Speech\n" & _
"The multitude,The messiah! Show us the messiah!\n" & _
"Brians mother,<angry>Now you listen here! He
"he
"The multitude,Who are you?\n" & _
"Brians mother,I
"The multitude,Behold his mother! Behold his mother!"
Debug.Print "<table>" & vbCrLf & "<tr><td>"
For i = 1 To Len(input_)
Select Case Mid(input_, i, 1)
Case "\"
If Mid(input_, i + 1, 1) = "n" Then
Debug.Print "</td></tr>" & vbCrLf & "<tr><td>";
i = i + 1
Else
Debug.Print Mid(input_, i, 1);
End If
Case ",": Debug.Print "</td><td>";
Case "<": Debug.Print "<";
Case ">": Debug.Print ">";
Case "&": Debug.Print "&";
Case Else: Debug.Print Mid(input_, i, 1);
End Select
Next i
Debug.Print "</td></tr>" & vbCrLf & "</table>"
End Sub
|
Translate the given Java code snippet into VB without altering its behavior. | public class MyClass{
private int variable;
public MyClass(){
}
public void someMethod(){
this.variable = 1;
}
}
| Class NumberContainer
Private TheNumber As Integer
Sub Constructor(InitialNumber As Integer)
TheNumber = InitialNumber
End Sub
Function Number() As Integer
Return TheNumber
End Function
Sub Number(Assigns NewNumber As Integer)
TheNumber = NewNumber
End Sub
End Class
|
Produce a language-to-language conversion: from Java to VB, same semantics. | public class Kaprekar {
private static String[] splitAt(String str, int idx){
String[] ans = new String[2];
ans[0] = str.substring(0, idx);
if(ans[0].equals("")) ans[0] = "0";
ans[1] = str.substring(idx);
return ans;
}
public static void main(String[] args){
int count = 0;
int base = (args.length > 0) ? Integer.parseInt(args[0]) : 10;
for(long i = 1; i <= 1000000; i++){
String sqrStr = Long.toString(i * i, base);
for(int j = 0; j < sqrStr.length() / 2 + 1; j++){
String[] parts = splitAt(sqrStr, j);
long firstNum = Long.parseLong(parts[0], base);
long secNum = Long.parseLong(parts[1], base);
if(secNum == 0) break;
if(firstNum + secNum == i){
System.out.println(i + "\t" + Long.toString(i, base) +
"\t" + sqrStr + "\t" + parts[0] + " + " + parts[1]);
count++;
break;
}
}
}
System.out.println(count + " Kaprekar numbers < 1000000 (base 10) in base "+base);
}
}
| Module Module1
ReadOnly max As ULong = 1000000
Function Kaprekar(n As ULong) As Boolean
If n = 1 Then Return True
Dim sq = n * n
Dim sq_str = Str(sq)
Dim l = Len(sq_str)
For x = l - 1 To 1 Step -1
If sq_str(x) = "0" Then
l = l - 1
Else
Exit For
End If
Next
For x = 1 To l - 1
Dim p2 = Val(Mid(sq_str, x + 1))
If p2 > n Then
Continue For
End If
Dim p1 = Val(Left(sq_str, x))
If p1 > n Then Return False
If (p1 + p2) = n Then Return True
Next
Return False
End Function
Sub Main()
Dim count = 0
Console.WriteLine("Kaprekar numbers below 10000")
For n = 1 To max - 1
If Kaprekar(n) Then
count = count + 1
If n < 10000 Then
Console.WriteLine("{0,2} {1,4}", count, n)
End If
End If
Next
Console.WriteLine()
Console.WriteLine("{0} numbers below {1} are kaprekar numbers", count, max)
End Sub
End Module
|
Change the programming language of this snippet from Java to VB without modifying what it does. | public class Kaprekar {
private static String[] splitAt(String str, int idx){
String[] ans = new String[2];
ans[0] = str.substring(0, idx);
if(ans[0].equals("")) ans[0] = "0";
ans[1] = str.substring(idx);
return ans;
}
public static void main(String[] args){
int count = 0;
int base = (args.length > 0) ? Integer.parseInt(args[0]) : 10;
for(long i = 1; i <= 1000000; i++){
String sqrStr = Long.toString(i * i, base);
for(int j = 0; j < sqrStr.length() / 2 + 1; j++){
String[] parts = splitAt(sqrStr, j);
long firstNum = Long.parseLong(parts[0], base);
long secNum = Long.parseLong(parts[1], base);
if(secNum == 0) break;
if(firstNum + secNum == i){
System.out.println(i + "\t" + Long.toString(i, base) +
"\t" + sqrStr + "\t" + parts[0] + " + " + parts[1]);
count++;
break;
}
}
}
System.out.println(count + " Kaprekar numbers < 1000000 (base 10) in base "+base);
}
}
| Module Module1
ReadOnly max As ULong = 1000000
Function Kaprekar(n As ULong) As Boolean
If n = 1 Then Return True
Dim sq = n * n
Dim sq_str = Str(sq)
Dim l = Len(sq_str)
For x = l - 1 To 1 Step -1
If sq_str(x) = "0" Then
l = l - 1
Else
Exit For
End If
Next
For x = 1 To l - 1
Dim p2 = Val(Mid(sq_str, x + 1))
If p2 > n Then
Continue For
End If
Dim p1 = Val(Left(sq_str, x))
If p1 > n Then Return False
If (p1 + p2) = n Then Return True
Next
Return False
End Function
Sub Main()
Dim count = 0
Console.WriteLine("Kaprekar numbers below 10000")
For n = 1 To max - 1
If Kaprekar(n) Then
count = count + 1
If n < 10000 Then
Console.WriteLine("{0,2} {1,4}", count, n)
End If
End If
Next
Console.WriteLine()
Console.WriteLine("{0} numbers below {1} are kaprekar numbers", count, max)
End Sub
End Module
|
Keep all operations the same but rewrite the snippet in VB. | public class Kaprekar {
private static String[] splitAt(String str, int idx){
String[] ans = new String[2];
ans[0] = str.substring(0, idx);
if(ans[0].equals("")) ans[0] = "0";
ans[1] = str.substring(idx);
return ans;
}
public static void main(String[] args){
int count = 0;
int base = (args.length > 0) ? Integer.parseInt(args[0]) : 10;
for(long i = 1; i <= 1000000; i++){
String sqrStr = Long.toString(i * i, base);
for(int j = 0; j < sqrStr.length() / 2 + 1; j++){
String[] parts = splitAt(sqrStr, j);
long firstNum = Long.parseLong(parts[0], base);
long secNum = Long.parseLong(parts[1], base);
if(secNum == 0) break;
if(firstNum + secNum == i){
System.out.println(i + "\t" + Long.toString(i, base) +
"\t" + sqrStr + "\t" + parts[0] + " + " + parts[1]);
count++;
break;
}
}
}
System.out.println(count + " Kaprekar numbers < 1000000 (base 10) in base "+base);
}
}
| Module Module1
ReadOnly max As ULong = 1000000
Function Kaprekar(n As ULong) As Boolean
If n = 1 Then Return True
Dim sq = n * n
Dim sq_str = Str(sq)
Dim l = Len(sq_str)
For x = l - 1 To 1 Step -1
If sq_str(x) = "0" Then
l = l - 1
Else
Exit For
End If
Next
For x = 1 To l - 1
Dim p2 = Val(Mid(sq_str, x + 1))
If p2 > n Then
Continue For
End If
Dim p1 = Val(Left(sq_str, x))
If p1 > n Then Return False
If (p1 + p2) = n Then Return True
Next
Return False
End Function
Sub Main()
Dim count = 0
Console.WriteLine("Kaprekar numbers below 10000")
For n = 1 To max - 1
If Kaprekar(n) Then
count = count + 1
If n < 10000 Then
Console.WriteLine("{0,2} {1,4}", count, n)
End If
End If
Next
Console.WriteLine()
Console.WriteLine("{0} numbers below {1} are kaprekar numbers", count, max)
End Sub
End Module
|
Translate the given Java code snippet into VB without altering its behavior. | import java.util.*;
public class LZW {
public static List<Integer> compress(String uncompressed) {
int dictSize = 256;
Map<String,Integer> dictionary = new HashMap<String,Integer>();
for (int i = 0; i < 256; i++)
dictionary.put("" + (char)i, i);
String w = "";
List<Integer> result = new ArrayList<Integer>();
for (char c : uncompressed.toCharArray()) {
String wc = w + c;
if (dictionary.containsKey(wc))
w = wc;
else {
result.add(dictionary.get(w));
dictionary.put(wc, dictSize++);
w = "" + c;
}
}
if (!w.equals(""))
result.add(dictionary.get(w));
return result;
}
public static String decompress(List<Integer> compressed) {
int dictSize = 256;
Map<Integer,String> dictionary = new HashMap<Integer,String>();
for (int i = 0; i < 256; i++)
dictionary.put(i, "" + (char)i);
String w = "" + (char)(int)compressed.remove(0);
StringBuffer result = new StringBuffer(w);
for (int k : compressed) {
String entry;
if (dictionary.containsKey(k))
entry = dictionary.get(k);
else if (k == dictSize)
entry = w + w.charAt(0);
else
throw new IllegalArgumentException("Bad compressed k: " + k);
result.append(entry);
dictionary.put(dictSize++, w + entry.charAt(0));
w = entry;
}
return result.toString();
}
public static void main(String[] args) {
List<Integer> compressed = compress("TOBEORNOTTOBEORTOBEORNOT");
System.out.println(compressed);
String decompressed = decompress(compressed);
System.out.println(decompressed);
}
}
| Option Explicit
Const numchars=127
Function LZWCompress(si)
Dim oDict, intMaxCode, i,z,ii,ss,strCurrent,strNext,j
Set oDict = CreateObject("Scripting.Dictionary")
ReDim a(Len(si))
intMaxCode = numchars
For i = 0 To numchars
oDict.Add Chr(i), i
Next
strCurrent = Left(si,1)
j=0
For ii=2 To Len(si)
strNext = Mid(si,ii,1)
ss=strCurrent & strNext
If oDict.Exists(ss) Then
strCurrent = ss
Else
a(j)=oDict.Item(strCurrent) :j=j+1
intMaxCode = intMaxCode + 1
oDict.Add ss, intMaxCode
strCurrent = strNext
End If
Next
a(j)=oDict.Item(strCurrent)
ReDim preserve a(j)
LZWCompress=a
Set oDict = Nothing
End Function
Function lzwUncompress(sc)
Dim intNext, intCurrent, intMaxCode, i,ss,istr,s,j
s=""
reDim dict(1000)
intMaxCode = numchars
For i = 0 To numchars : dict(i)= Chr(i) : Next
intCurrent=sc(0)
For j=1 To UBound(sc)
ss=dict(intCurrent)
s= s & ss
intMaxCode = intMaxCode + 1
intnext=sc(j)
If intNext<intMaxCode Then
dict(intMaxCode)=ss & Left(dict(intNext), 1)
Else
dict(intMaxCode)=ss & Left(ss, 1)
End If
intCurrent = intNext
Next
s= s & dict(intCurrent)
lzwUncompress=s
End function
Sub printvec(a)
Dim s,i,x
s="("
For i=0 To UBound (a)
s=s & x & a(i)
x=", "
Next
WScript.echo s &")"
End sub
Dim a,b
b="TOBEORNOTTOBEORTOBEORNOT"
WScript.Echo b
a=LZWCompress (b)
printvec(a)
WScript.echo lzwUncompress (a )
wscript.quit 1
|
Produce a language-to-language conversion: from Java to VB, same semantics. | import java.util.*;
class Hofstadter
{
private static List<Integer> getSequence(int rlistSize, int slistSize)
{
List<Integer> rlist = new ArrayList<Integer>();
List<Integer> slist = new ArrayList<Integer>();
Collections.addAll(rlist, 1, 3, 7);
Collections.addAll(slist, 2, 4, 5, 6);
List<Integer> list = (rlistSize > 0) ? rlist : slist;
int targetSize = (rlistSize > 0) ? rlistSize : slistSize;
while (list.size() > targetSize)
list.remove(list.size() - 1);
while (list.size() < targetSize)
{
int lastIndex = rlist.size() - 1;
int lastr = rlist.get(lastIndex).intValue();
int r = lastr + slist.get(lastIndex).intValue();
rlist.add(Integer.valueOf(r));
for (int s = lastr + 1; (s < r) && (list.size() < targetSize); s++)
slist.add(Integer.valueOf(s));
}
return list;
}
public static int ffr(int n)
{ return getSequence(n, 0).get(n - 1).intValue(); }
public static int ffs(int n)
{ return getSequence(0, n).get(n - 1).intValue(); }
public static void main(String[] args)
{
System.out.print("R():");
for (int n = 1; n <= 10; n++)
System.out.print(" " + ffr(n));
System.out.println();
Set<Integer> first40R = new HashSet<Integer>();
for (int n = 1; n <= 40; n++)
first40R.add(Integer.valueOf(ffr(n)));
Set<Integer> first960S = new HashSet<Integer>();
for (int n = 1; n <= 960; n++)
first960S.add(Integer.valueOf(ffs(n)));
for (int i = 1; i <= 1000; i++)
{
Integer n = Integer.valueOf(i);
if (first40R.contains(n) == first960S.contains(n))
System.out.println("Integer " + i + " either in both or neither set");
}
System.out.println("Done");
}
}
| Private Function ffr(n As Long) As Long
Dim R As New Collection
Dim S As New Collection
R.Add 1
S.Add 2
For i = 2 To n
R.Add R(i - 1) + S(i - 1)
For j = S(S.Count) + 1 To R(i) - 1
S.Add j
Next j
For j = R(i) + 1 To R(i) + S(i - 1)
S.Add j
Next j
Next i
ffr = R(n)
Set R = Nothing
Set S = Nothing
End Function
Private Function ffs(n As Long) As Long
Dim R As New Collection
Dim S As New Collection
R.Add 1
S.Add 2
For i = 2 To n
R.Add R(i - 1) + S(i - 1)
For j = S(S.Count) + 1 To R(i) - 1
S.Add j
Next j
For j = R(i) + 1 To R(i) + S(i - 1)
S.Add j
Next j
If S.Count >= n Then Exit For
Next i
ffs = S(n)
Set R = Nothing
Set S = Nothing
End Function
Public Sub main()
Dim i As Long
Debug.Print "The first ten values of R are:"
For i = 1 To 10
Debug.Print ffr(i);
Next i
Debug.Print
Dim x As New Collection
For i = 1 To 1000
x.Add i, CStr(i)
Next i
For i = 1 To 40
x.Remove CStr(ffr(i))
Next i
For i = 1 To 960
x.Remove CStr(ffs(i))
Next i
Debug.Print "The first 40 values of ffr plus the first 960 values of ffs "
Debug.Print "include all the integers from 1 to 1000 exactly once is "; Format(x.Count = 0)
End Sub
|
Port the following code from Java to VB with equivalent syntax and logic. | import java.util.*;
class Hofstadter
{
private static List<Integer> getSequence(int rlistSize, int slistSize)
{
List<Integer> rlist = new ArrayList<Integer>();
List<Integer> slist = new ArrayList<Integer>();
Collections.addAll(rlist, 1, 3, 7);
Collections.addAll(slist, 2, 4, 5, 6);
List<Integer> list = (rlistSize > 0) ? rlist : slist;
int targetSize = (rlistSize > 0) ? rlistSize : slistSize;
while (list.size() > targetSize)
list.remove(list.size() - 1);
while (list.size() < targetSize)
{
int lastIndex = rlist.size() - 1;
int lastr = rlist.get(lastIndex).intValue();
int r = lastr + slist.get(lastIndex).intValue();
rlist.add(Integer.valueOf(r));
for (int s = lastr + 1; (s < r) && (list.size() < targetSize); s++)
slist.add(Integer.valueOf(s));
}
return list;
}
public static int ffr(int n)
{ return getSequence(n, 0).get(n - 1).intValue(); }
public static int ffs(int n)
{ return getSequence(0, n).get(n - 1).intValue(); }
public static void main(String[] args)
{
System.out.print("R():");
for (int n = 1; n <= 10; n++)
System.out.print(" " + ffr(n));
System.out.println();
Set<Integer> first40R = new HashSet<Integer>();
for (int n = 1; n <= 40; n++)
first40R.add(Integer.valueOf(ffr(n)));
Set<Integer> first960S = new HashSet<Integer>();
for (int n = 1; n <= 960; n++)
first960S.add(Integer.valueOf(ffs(n)));
for (int i = 1; i <= 1000; i++)
{
Integer n = Integer.valueOf(i);
if (first40R.contains(n) == first960S.contains(n))
System.out.println("Integer " + i + " either in both or neither set");
}
System.out.println("Done");
}
}
| Private Function ffr(n As Long) As Long
Dim R As New Collection
Dim S As New Collection
R.Add 1
S.Add 2
For i = 2 To n
R.Add R(i - 1) + S(i - 1)
For j = S(S.Count) + 1 To R(i) - 1
S.Add j
Next j
For j = R(i) + 1 To R(i) + S(i - 1)
S.Add j
Next j
Next i
ffr = R(n)
Set R = Nothing
Set S = Nothing
End Function
Private Function ffs(n As Long) As Long
Dim R As New Collection
Dim S As New Collection
R.Add 1
S.Add 2
For i = 2 To n
R.Add R(i - 1) + S(i - 1)
For j = S(S.Count) + 1 To R(i) - 1
S.Add j
Next j
For j = R(i) + 1 To R(i) + S(i - 1)
S.Add j
Next j
If S.Count >= n Then Exit For
Next i
ffs = S(n)
Set R = Nothing
Set S = Nothing
End Function
Public Sub main()
Dim i As Long
Debug.Print "The first ten values of R are:"
For i = 1 To 10
Debug.Print ffr(i);
Next i
Debug.Print
Dim x As New Collection
For i = 1 To 1000
x.Add i, CStr(i)
Next i
For i = 1 To 40
x.Remove CStr(ffr(i))
Next i
For i = 1 To 960
x.Remove CStr(ffs(i))
Next i
Debug.Print "The first 40 values of ffr plus the first 960 values of ffs "
Debug.Print "include all the integers from 1 to 1000 exactly once is "; Format(x.Count = 0)
End Sub
|
Convert the following code from Java to VB, ensuring the logic remains intact. | public class MagicSquare {
public static void main(String[] args) {
int n = 5;
for (int[] row : magicSquareOdd(n)) {
for (int x : row)
System.out.format("%2s ", x);
System.out.println();
}
System.out.printf("\nMagic constant: %d ", (n * n + 1) * n / 2);
}
public static int[][] magicSquareOdd(final int base) {
if (base % 2 == 0 || base < 3)
throw new IllegalArgumentException("base must be odd and > 2");
int[][] grid = new int[base][base];
int r = 0, number = 0;
int size = base * base;
int c = base / 2;
while (number++ < size) {
grid[r][c] = number;
if (r == 0) {
if (c == base - 1) {
r++;
} else {
r = base - 1;
c++;
}
} else {
if (c == base - 1) {
r--;
c = 0;
} else {
if (grid[r - 1][c + 1] == 0) {
r--;
c++;
} else {
r++;
}
}
}
}
return grid;
}
}
| Sub magicsquare()
Const n = 9
Dim i As Integer, j As Integer, v As Integer
Debug.Print "The square order is: " & n
For i = 1 To n
For j = 1 To n
Cells(i, j) = ((i * 2 - j + n - 1) Mod n) * n + ((i * 2 + j - 2) Mod n) + 1
Next j
Next i
Debug.Print "The magic number of"; n; "x"; n; "square is:"; n * (n * n + 1) \ 2
End Sub
|
Preserve the algorithm and functionality while converting the code from Java to VB. | public class MagicSquare {
public static void main(String[] args) {
int n = 5;
for (int[] row : magicSquareOdd(n)) {
for (int x : row)
System.out.format("%2s ", x);
System.out.println();
}
System.out.printf("\nMagic constant: %d ", (n * n + 1) * n / 2);
}
public static int[][] magicSquareOdd(final int base) {
if (base % 2 == 0 || base < 3)
throw new IllegalArgumentException("base must be odd and > 2");
int[][] grid = new int[base][base];
int r = 0, number = 0;
int size = base * base;
int c = base / 2;
while (number++ < size) {
grid[r][c] = number;
if (r == 0) {
if (c == base - 1) {
r++;
} else {
r = base - 1;
c++;
}
} else {
if (c == base - 1) {
r--;
c = 0;
} else {
if (grid[r - 1][c + 1] == 0) {
r--;
c++;
} else {
r++;
}
}
}
}
return grid;
}
}
| Sub magicsquare()
Const n = 9
Dim i As Integer, j As Integer, v As Integer
Debug.Print "The square order is: " & n
For i = 1 To n
For j = 1 To n
Cells(i, j) = ((i * 2 - j + n - 1) Mod n) * n + ((i * 2 + j - 2) Mod n) + 1
Next j
Next i
Debug.Print "The magic number of"; n; "x"; n; "square is:"; n * (n * n + 1) \ 2
End Sub
|
Translate this program into VB but keep the logic exactly as in Java. | import java.math.BigInteger;
import java.util.Locale;
public class BenfordsLaw {
private static BigInteger[] generateFibonacci(int n) {
BigInteger[] fib = new BigInteger[n];
fib[0] = BigInteger.ONE;
fib[1] = BigInteger.ONE;
for (int i = 2; i < fib.length; i++) {
fib[i] = fib[i - 2].add(fib[i - 1]);
}
return fib;
}
public static void main(String[] args) {
BigInteger[] numbers = generateFibonacci(1000);
int[] firstDigits = new int[10];
for (BigInteger number : numbers) {
firstDigits[Integer.valueOf(number.toString().substring(0, 1))]++;
}
for (int i = 1; i < firstDigits.length; i++) {
System.out.printf(Locale.ROOT, "%d %10.6f %10.6f%n",
i, (double) firstDigits[i] / numbers.length, Math.log10(1.0 + 1.0 / i));
}
}
}
| Sub BenfordLaw()
Dim BenResult(1 To 9) As Long
BENref = "30,1%|17,6%|12,5%|9,7%|7,9%|6,7%|5,8%|5,1%|4,6%"
For Each c In Selection.Cells
If InStr(1, "-0123456789", Left(c, 1)) > 0 Then
For i = 1 To 9
If CInt(Left(Abs(c), 1)) = i Then BenResult(i) = BenResult(i) + 1: Exit For
Next
End If
Next
Total= Application.Sum(BenResult)
biggest= Len(CStr(BenResult(1)))
txt = "# | Values | Real | Expected " & vbCrLf
For i = 1 To 9
If BenResult(i) > 0 Then
txt = txt & "#" & i & " | " & vbTab
txt = txt & String((biggest - Len(CStr(BenResult(i)))) * 2, " ") & Format(BenResult(i), "0") & " | " & vbTab
txt = txt & String((Len(CStr(Format(BenResult(1) / Total, "##0.0%"))) - Len(CStr(Format(BenResult(i) / Total, "##0.0%")))) * 2, " ") & Format(BenResult(i) / Total, "##0.0%") & " | " & vbTab
txt = txt & Format(Split(BENref, "|")(i - 1), " ##0.0%") & vbCrLf
End If
Next
MsgBox txt, vbOKOnly, "Finish"
End Sub
}
|
Transform the following Java implementation into VB, maintaining the same output and logic. | import java.math.BigInteger;
import java.util.Locale;
public class BenfordsLaw {
private static BigInteger[] generateFibonacci(int n) {
BigInteger[] fib = new BigInteger[n];
fib[0] = BigInteger.ONE;
fib[1] = BigInteger.ONE;
for (int i = 2; i < fib.length; i++) {
fib[i] = fib[i - 2].add(fib[i - 1]);
}
return fib;
}
public static void main(String[] args) {
BigInteger[] numbers = generateFibonacci(1000);
int[] firstDigits = new int[10];
for (BigInteger number : numbers) {
firstDigits[Integer.valueOf(number.toString().substring(0, 1))]++;
}
for (int i = 1; i < firstDigits.length; i++) {
System.out.printf(Locale.ROOT, "%d %10.6f %10.6f%n",
i, (double) firstDigits[i] / numbers.length, Math.log10(1.0 + 1.0 / i));
}
}
}
| Sub BenfordLaw()
Dim BenResult(1 To 9) As Long
BENref = "30,1%|17,6%|12,5%|9,7%|7,9%|6,7%|5,8%|5,1%|4,6%"
For Each c In Selection.Cells
If InStr(1, "-0123456789", Left(c, 1)) > 0 Then
For i = 1 To 9
If CInt(Left(Abs(c), 1)) = i Then BenResult(i) = BenResult(i) + 1: Exit For
Next
End If
Next
Total= Application.Sum(BenResult)
biggest= Len(CStr(BenResult(1)))
txt = "# | Values | Real | Expected " & vbCrLf
For i = 1 To 9
If BenResult(i) > 0 Then
txt = txt & "#" & i & " | " & vbTab
txt = txt & String((biggest - Len(CStr(BenResult(i)))) * 2, " ") & Format(BenResult(i), "0") & " | " & vbTab
txt = txt & String((Len(CStr(Format(BenResult(1) / Total, "##0.0%"))) - Len(CStr(Format(BenResult(i) / Total, "##0.0%")))) * 2, " ") & Format(BenResult(i) / Total, "##0.0%") & " | " & vbTab
txt = txt & Format(Split(BENref, "|")(i - 1), " ##0.0%") & vbCrLf
End If
Next
MsgBox txt, vbOKOnly, "Finish"
End Sub
}
|
Produce a functionally identical VB code for the snippet given in Java. | public static long fib(int n) {
if (n < 0)
throw new IllegalArgumentException("n can not be a negative number");
return new Object() {
private long fibInner(int n) {
return (n < 2) ? n : (fibInner(n - 1) + fibInner(n - 2));
}
}.fibInner(n);
}
| Sub Main()
Debug.Print F(-10)
Debug.Print F(10)
End Sub
Private Function F(N As Long) As Variant
If N < 0 Then
F = "Error. Negative argument"
ElseIf N <= 1 Then
F = N
Else
F = F(N - 1) + F(N - 2)
End If
End Function
|
Rewrite the snippet below in VB so it works the same as the original Java code. | String strOrig = 'brooms';
String str1 = strOrig.substring(1, strOrig.length());
system.debug(str1);
String str2 = strOrig.substring(0, strOrig.length()-1);
system.debug(str2);
String str3 = strOrig.substring(1, strOrig.length()-1);
system.debug(str3);
String strOrig = 'brooms';
String str1 = strOrig.replaceAll( '^.', '' );
system.debug(str1);
String str2 = strOrig.replaceAll( '.$', '' ) ;
system.debug(str2);
String str3 = strOrig.replaceAll( '^.|.$', '' );
system.debug(str3);
| string = "Small Basic"
TextWindow.WriteLine(Text.GetSubTextToEnd(string, 2))
TextWindow.WriteLine(Text.GetSubText(string, 1, Text.GetLength(string) - 1))
TextWindow.WriteLine(Text.GetSubText(string, 2, Text.GetLength(string) - 2))
|
Maintain the same structure and functionality when rewriting this code in VB. | String strOrig = 'brooms';
String str1 = strOrig.substring(1, strOrig.length());
system.debug(str1);
String str2 = strOrig.substring(0, strOrig.length()-1);
system.debug(str2);
String str3 = strOrig.substring(1, strOrig.length()-1);
system.debug(str3);
String strOrig = 'brooms';
String str1 = strOrig.replaceAll( '^.', '' );
system.debug(str1);
String str2 = strOrig.replaceAll( '.$', '' ) ;
system.debug(str2);
String str3 = strOrig.replaceAll( '^.|.$', '' );
system.debug(str3);
| string = "Small Basic"
TextWindow.WriteLine(Text.GetSubTextToEnd(string, 2))
TextWindow.WriteLine(Text.GetSubText(string, 1, Text.GetLength(string) - 1))
TextWindow.WriteLine(Text.GetSubText(string, 2, Text.GetLength(string) - 2))
|
Produce a language-to-language conversion: from Java to VB, same semantics. | String strOrig = 'brooms';
String str1 = strOrig.substring(1, strOrig.length());
system.debug(str1);
String str2 = strOrig.substring(0, strOrig.length()-1);
system.debug(str2);
String str3 = strOrig.substring(1, strOrig.length()-1);
system.debug(str3);
String strOrig = 'brooms';
String str1 = strOrig.replaceAll( '^.', '' );
system.debug(str1);
String str2 = strOrig.replaceAll( '.$', '' ) ;
system.debug(str2);
String str3 = strOrig.replaceAll( '^.|.$', '' );
system.debug(str3);
| string = "Small Basic"
TextWindow.WriteLine(Text.GetSubTextToEnd(string, 2))
TextWindow.WriteLine(Text.GetSubText(string, 1, Text.GetLength(string) - 1))
TextWindow.WriteLine(Text.GetSubText(string, 2, Text.GetLength(string) - 2))
|
Write the same algorithm in VB as shown in this Java implementation. | import java.io.File;
import java.util.Scanner;
public class LongestStringChallenge {
public static void main(String[] args) throws Exception {
String lines = "", longest = "";
try (Scanner sc = new Scanner(new File("lines.txt"))) {
while(sc.hasNext()) {
String line = sc.nextLine();
if (longer(longest, line))
lines = longest = line;
else if (!longer(line, longest))
lines = lines.concat("\n").concat(line);
}
}
System.out.println(lines);
}
static boolean longer(String a, String b) {
try {
String dummy = a.substring(b.length());
} catch (StringIndexOutOfBoundsException e) {
return true;
}
return false;
}
}
|
Set objfso = CreateObject("Scripting.FileSystemObject")
Set objfile = objfso.OpenTextFile(objfso.GetParentFolderName(WScript.ScriptFullName) &_
"\input.txt",1)
list = ""
previous_line = ""
l = Len(previous_line)
Do Until objfile.AtEndOfStream
current_line = objfile.ReadLine
If Mid(current_line,l+1,1) <> "" Then
list = current_line & vbCrLf
previous_line = current_line
l = Len(previous_line)
ElseIf Mid(current_line,l,1) <> "" And Mid(current_line,(l+1),1) = "" Then
list = list & current_line & vbCrLf
End If
Loop
WScript.Echo list
objfile.Close
Set objfso = Nothing
|
Please provide an equivalent version of this Java code in VB. | import java.util.HashMap;
import java.util.HashSet;
import java.util.LinkedList;
import java.util.ListIterator;
import java.util.List;
import java.util.Set;
import java.util.Map;
public class UTM {
private List<String> tape;
private String blankSymbol;
private ListIterator<String> head;
private Map<StateTapeSymbolPair, Transition> transitions = new HashMap<StateTapeSymbolPair, Transition>();
private Set<String> terminalStates;
private String initialState;
public UTM(Set<Transition> transitions, Set<String> terminalStates, String initialState, String blankSymbol) {
this.blankSymbol = blankSymbol;
for (Transition t : transitions) {
this.transitions.put(t.from, t);
}
this.terminalStates = terminalStates;
this.initialState = initialState;
}
public static class StateTapeSymbolPair {
private String state;
private String tapeSymbol;
public StateTapeSymbolPair(String state, String tapeSymbol) {
this.state = state;
this.tapeSymbol = tapeSymbol;
}
@Override
public int hashCode() {
final int prime = 31;
int result = 1;
result = prime * result
+ ((state == null) ? 0 : state.hashCode());
result = prime
* result
+ ((tapeSymbol == null) ? 0 : tapeSymbol
.hashCode());
return result;
}
@Override
public boolean equals(Object obj) {
if (this == obj)
return true;
if (obj == null)
return false;
if (getClass() != obj.getClass())
return false;
StateTapeSymbolPair other = (StateTapeSymbolPair) obj;
if (state == null) {
if (other.state != null)
return false;
} else if (!state.equals(other.state))
return false;
if (tapeSymbol == null) {
if (other.tapeSymbol != null)
return false;
} else if (!tapeSymbol.equals(other.tapeSymbol))
return false;
return true;
}
@Override
public String toString() {
return "(" + state + "," + tapeSymbol + ")";
}
}
public static class Transition {
private StateTapeSymbolPair from;
private StateTapeSymbolPair to;
private int direction;
public Transition(StateTapeSymbolPair from, StateTapeSymbolPair to, int direction) {
this.from = from;
this.to = to;
this.direction = direction;
}
@Override
public String toString() {
return from + "=>" + to + "/" + direction;
}
}
public void initializeTape(List<String> input) {
tape = input;
}
public void initializeTape(String input) {
tape = new LinkedList<String>();
for (int i = 0; i < input.length(); i++) {
tape.add(input.charAt(i) + "");
}
}
public List<String> runTM() {
if (tape.size() == 0) {
tape.add(blankSymbol);
}
head = tape.listIterator();
head.next();
head.previous();
StateTapeSymbolPair tsp = new StateTapeSymbolPair(initialState, tape.get(0));
while (transitions.containsKey(tsp)) {
System.out.println(this + " --- " + transitions.get(tsp));
Transition trans = transitions.get(tsp);
head.set(trans.to.tapeSymbol);
tsp.state = trans.to.state;
if (trans.direction == -1) {
if (!head.hasPrevious()) {
head.add(blankSymbol);
}
tsp.tapeSymbol = head.previous();
} else if (trans.direction == 1) {
head.next();
if (!head.hasNext()) {
head.add(blankSymbol);
head.previous();
}
tsp.tapeSymbol = head.next();
head.previous();
} else {
tsp.tapeSymbol = trans.to.tapeSymbol;
}
}
System.out.println(this + " --- " + tsp);
if (terminalStates.contains(tsp.state)) {
return tape;
} else {
return null;
}
}
@Override
public String toString() {
try {
int headPos = head.previousIndex();
String s = "[ ";
for (int i = 0; i <= headPos; i++) {
s += tape.get(i) + " ";
}
s += "[H] ";
for (int i = headPos + 1; i < tape.size(); i++) {
s += tape.get(i) + " ";
}
return s + "]";
} catch (Exception e) {
return "";
}
}
public static void main(String[] args) {
String init = "q0";
String blank = "b";
Set<String> term = new HashSet<String>();
term.add("qf");
Set<Transition> trans = new HashSet<Transition>();
trans.add(new Transition(new StateTapeSymbolPair("q0", "1"), new StateTapeSymbolPair("q0", "1"), 1));
trans.add(new Transition(new StateTapeSymbolPair("q0", "b"), new StateTapeSymbolPair("qf", "1"), 0));
UTM machine = new UTM(trans, term, init, blank);
machine.initializeTape("111");
System.out.println("Output (si): " + machine.runTM() + "\n");
init = "a";
term.clear();
term.add("halt");
blank = "0";
trans.clear();
trans.add(new Transition(new StateTapeSymbolPair("a", "0"), new StateTapeSymbolPair("b", "1"), 1));
trans.add(new Transition(new StateTapeSymbolPair("a", "1"), new StateTapeSymbolPair("c", "1"), -1));
trans.add(new Transition(new StateTapeSymbolPair("b", "0"), new StateTapeSymbolPair("a", "1"), -1));
trans.add(new Transition(new StateTapeSymbolPair("b", "1"), new StateTapeSymbolPair("b", "1"), 1));
trans.add(new Transition(new StateTapeSymbolPair("c", "0"), new StateTapeSymbolPair("b", "1"), -1));
trans.add(new Transition(new StateTapeSymbolPair("c", "1"), new StateTapeSymbolPair("halt", "1"), 0));
machine = new UTM(trans, term, init, blank);
machine.initializeTape("");
System.out.println("Output (bb): " + machine.runTM());
init = "s0";
blank = "*";
term = new HashSet<String>();
term.add("see");
trans = new HashSet<Transition>();
trans.add(new Transition(new StateTapeSymbolPair("s0", "a"), new StateTapeSymbolPair("s0", "a"), 1));
trans.add(new Transition(new StateTapeSymbolPair("s0", "b"), new StateTapeSymbolPair("s1", "B"), 1));
trans.add(new Transition(new StateTapeSymbolPair("s0", "*"), new StateTapeSymbolPair("se", "*"), -1));
trans.add(new Transition(new StateTapeSymbolPair("s1", "a"), new StateTapeSymbolPair("s1", "a"), 1));
trans.add(new Transition(new StateTapeSymbolPair("s1", "b"), new StateTapeSymbolPair("s1", "b"), 1));
trans.add(new Transition(new StateTapeSymbolPair("s1", "*"), new StateTapeSymbolPair("s2", "*"), -1));
trans.add(new Transition(new StateTapeSymbolPair("s2", "a"), new StateTapeSymbolPair("s3", "b"), -1));
trans.add(new Transition(new StateTapeSymbolPair("s2", "b"), new StateTapeSymbolPair("s2", "b"), -1));
trans.add(new Transition(new StateTapeSymbolPair("s2", "B"), new StateTapeSymbolPair("se", "b"), -1));
trans.add(new Transition(new StateTapeSymbolPair("s3", "a"), new StateTapeSymbolPair("s3", "a"), -1));
trans.add(new Transition(new StateTapeSymbolPair("s3", "b"), new StateTapeSymbolPair("s3", "b"), -1));
trans.add(new Transition(new StateTapeSymbolPair("s3", "B"), new StateTapeSymbolPair("s0", "a"), 1));
trans.add(new Transition(new StateTapeSymbolPair("se", "a"), new StateTapeSymbolPair("se", "a"), -1));
trans.add(new Transition(new StateTapeSymbolPair("se", "*"), new StateTapeSymbolPair("see", "*"), 1));
machine = new UTM(trans, term, init, blank);
machine.initializeTape("babbababaa");
System.out.println("Output (sort): " + machine.runTM() + "\n");
}
}
| Option Base 1
Public Enum sett
name_ = 1
initState
endState
blank
rules
End Enum
Public incrementer As Variant, threeStateBB As Variant, fiveStateBB As Variant
Private Sub init()
incrementer = Array("Simple incrementer", _
"q0", _
"qf", _
"B", _
Array( _
Array("q0", "1", "1", "right", "q0"), _
Array("q0", "B", "1", "stay", "qf")))
threeStateBB = Array("Three-state busy beaver", _
"a", _
"halt", _
"0", _
Array( _
Array("a", "0", "1", "right", "b"), _
Array("a", "1", "1", "left", "c"), _
Array("b", "0", "1", "left", "a"), _
Array("b", "1", "1", "right", "b"), _
Array("c", "0", "1", "left", "b"), _
Array("c", "1", "1", "stay", "halt")))
fiveStateBB = Array("Five-state busy beaver", _
"A", _
"H", _
"0", _
Array( _
Array("A", "0", "1", "right", "B"), _
Array("A", "1", "1", "left", "C"), _
Array("B", "0", "1", "right", "C"), _
Array("B", "1", "1", "right", "B"), _
Array("C", "0", "1", "right", "D"), _
Array("C", "1", "0", "left", "E"), _
Array("D", "0", "1", "left", "A"), _
Array("D", "1", "1", "left", "D"), _
Array("E", "0", "1", "stay", "H"), _
Array("E", "1", "0", "left", "A")))
End Sub
Private Sub show(state As String, headpos As Long, tape As Collection)
Debug.Print " "; state; String$(7 - Len(state), " "); "| ";
For p = 1 To tape.Count
Debug.Print IIf(p = headpos, "[" & tape(p) & "]", " " & tape(p) & " ");
Next p
Debug.Print
End Sub
Private Sub UTM(machine As Variant, tape As Collection, Optional countOnly As Long = 0)
Dim state As String: state = machine(initState)
Dim headpos As Long: headpos = 1
Dim counter As Long, rule As Variant
Debug.Print machine(name_); vbCrLf; String$(Len(machine(name_)), "=")
If Not countOnly Then Debug.Print " State | Tape [head]" & vbCrLf & "---------------------"
Do While True
If headpos > tape.Count Then
tape.Add machine(blank)
Else
If headpos < 1 Then
tape.Add machine(blank), Before:=1
headpos = 1
End If
End If
If Not countOnly Then show state, headpos, tape
For i = LBound(machine(rules)) To UBound(machine(rules))
rule = machine(rules)(i)
If rule(1) = state And rule(2) = tape(headpos) Then
tape.Remove headpos
If headpos > tape.Count Then
tape.Add rule(3)
Else
tape.Add rule(3), Before:=headpos
End If
If rule(4) = "left" Then headpos = headpos - 1
If rule(4) = "right" Then headpos = headpos + 1
state = rule(5)
Exit For
End If
Next i
counter = counter + 1
If counter Mod 100000 = 0 Then
Debug.Print counter
DoEvents
DoEvents
End If
If state = machine(endState) Then Exit Do
Loop
DoEvents
If countOnly Then
Debug.Print "Steps taken: ", counter
Else
show state, headpos, tape
Debug.Print
End If
End Sub
Public Sub main()
init
Dim tap As New Collection
tap.Add "1": tap.Add "1": tap.Add "1"
UTM incrementer, tap
Set tap = New Collection
UTM threeStateBB, tap
Set tap = New Collection
UTM fiveStateBB, tap, countOnly:=-1
End Sub
|
Port the provided Java code into VB while preserving the original functionality. | import java.util.HashMap;
import java.util.HashSet;
import java.util.LinkedList;
import java.util.ListIterator;
import java.util.List;
import java.util.Set;
import java.util.Map;
public class UTM {
private List<String> tape;
private String blankSymbol;
private ListIterator<String> head;
private Map<StateTapeSymbolPair, Transition> transitions = new HashMap<StateTapeSymbolPair, Transition>();
private Set<String> terminalStates;
private String initialState;
public UTM(Set<Transition> transitions, Set<String> terminalStates, String initialState, String blankSymbol) {
this.blankSymbol = blankSymbol;
for (Transition t : transitions) {
this.transitions.put(t.from, t);
}
this.terminalStates = terminalStates;
this.initialState = initialState;
}
public static class StateTapeSymbolPair {
private String state;
private String tapeSymbol;
public StateTapeSymbolPair(String state, String tapeSymbol) {
this.state = state;
this.tapeSymbol = tapeSymbol;
}
@Override
public int hashCode() {
final int prime = 31;
int result = 1;
result = prime * result
+ ((state == null) ? 0 : state.hashCode());
result = prime
* result
+ ((tapeSymbol == null) ? 0 : tapeSymbol
.hashCode());
return result;
}
@Override
public boolean equals(Object obj) {
if (this == obj)
return true;
if (obj == null)
return false;
if (getClass() != obj.getClass())
return false;
StateTapeSymbolPair other = (StateTapeSymbolPair) obj;
if (state == null) {
if (other.state != null)
return false;
} else if (!state.equals(other.state))
return false;
if (tapeSymbol == null) {
if (other.tapeSymbol != null)
return false;
} else if (!tapeSymbol.equals(other.tapeSymbol))
return false;
return true;
}
@Override
public String toString() {
return "(" + state + "," + tapeSymbol + ")";
}
}
public static class Transition {
private StateTapeSymbolPair from;
private StateTapeSymbolPair to;
private int direction;
public Transition(StateTapeSymbolPair from, StateTapeSymbolPair to, int direction) {
this.from = from;
this.to = to;
this.direction = direction;
}
@Override
public String toString() {
return from + "=>" + to + "/" + direction;
}
}
public void initializeTape(List<String> input) {
tape = input;
}
public void initializeTape(String input) {
tape = new LinkedList<String>();
for (int i = 0; i < input.length(); i++) {
tape.add(input.charAt(i) + "");
}
}
public List<String> runTM() {
if (tape.size() == 0) {
tape.add(blankSymbol);
}
head = tape.listIterator();
head.next();
head.previous();
StateTapeSymbolPair tsp = new StateTapeSymbolPair(initialState, tape.get(0));
while (transitions.containsKey(tsp)) {
System.out.println(this + " --- " + transitions.get(tsp));
Transition trans = transitions.get(tsp);
head.set(trans.to.tapeSymbol);
tsp.state = trans.to.state;
if (trans.direction == -1) {
if (!head.hasPrevious()) {
head.add(blankSymbol);
}
tsp.tapeSymbol = head.previous();
} else if (trans.direction == 1) {
head.next();
if (!head.hasNext()) {
head.add(blankSymbol);
head.previous();
}
tsp.tapeSymbol = head.next();
head.previous();
} else {
tsp.tapeSymbol = trans.to.tapeSymbol;
}
}
System.out.println(this + " --- " + tsp);
if (terminalStates.contains(tsp.state)) {
return tape;
} else {
return null;
}
}
@Override
public String toString() {
try {
int headPos = head.previousIndex();
String s = "[ ";
for (int i = 0; i <= headPos; i++) {
s += tape.get(i) + " ";
}
s += "[H] ";
for (int i = headPos + 1; i < tape.size(); i++) {
s += tape.get(i) + " ";
}
return s + "]";
} catch (Exception e) {
return "";
}
}
public static void main(String[] args) {
String init = "q0";
String blank = "b";
Set<String> term = new HashSet<String>();
term.add("qf");
Set<Transition> trans = new HashSet<Transition>();
trans.add(new Transition(new StateTapeSymbolPair("q0", "1"), new StateTapeSymbolPair("q0", "1"), 1));
trans.add(new Transition(new StateTapeSymbolPair("q0", "b"), new StateTapeSymbolPair("qf", "1"), 0));
UTM machine = new UTM(trans, term, init, blank);
machine.initializeTape("111");
System.out.println("Output (si): " + machine.runTM() + "\n");
init = "a";
term.clear();
term.add("halt");
blank = "0";
trans.clear();
trans.add(new Transition(new StateTapeSymbolPair("a", "0"), new StateTapeSymbolPair("b", "1"), 1));
trans.add(new Transition(new StateTapeSymbolPair("a", "1"), new StateTapeSymbolPair("c", "1"), -1));
trans.add(new Transition(new StateTapeSymbolPair("b", "0"), new StateTapeSymbolPair("a", "1"), -1));
trans.add(new Transition(new StateTapeSymbolPair("b", "1"), new StateTapeSymbolPair("b", "1"), 1));
trans.add(new Transition(new StateTapeSymbolPair("c", "0"), new StateTapeSymbolPair("b", "1"), -1));
trans.add(new Transition(new StateTapeSymbolPair("c", "1"), new StateTapeSymbolPair("halt", "1"), 0));
machine = new UTM(trans, term, init, blank);
machine.initializeTape("");
System.out.println("Output (bb): " + machine.runTM());
init = "s0";
blank = "*";
term = new HashSet<String>();
term.add("see");
trans = new HashSet<Transition>();
trans.add(new Transition(new StateTapeSymbolPair("s0", "a"), new StateTapeSymbolPair("s0", "a"), 1));
trans.add(new Transition(new StateTapeSymbolPair("s0", "b"), new StateTapeSymbolPair("s1", "B"), 1));
trans.add(new Transition(new StateTapeSymbolPair("s0", "*"), new StateTapeSymbolPair("se", "*"), -1));
trans.add(new Transition(new StateTapeSymbolPair("s1", "a"), new StateTapeSymbolPair("s1", "a"), 1));
trans.add(new Transition(new StateTapeSymbolPair("s1", "b"), new StateTapeSymbolPair("s1", "b"), 1));
trans.add(new Transition(new StateTapeSymbolPair("s1", "*"), new StateTapeSymbolPair("s2", "*"), -1));
trans.add(new Transition(new StateTapeSymbolPair("s2", "a"), new StateTapeSymbolPair("s3", "b"), -1));
trans.add(new Transition(new StateTapeSymbolPair("s2", "b"), new StateTapeSymbolPair("s2", "b"), -1));
trans.add(new Transition(new StateTapeSymbolPair("s2", "B"), new StateTapeSymbolPair("se", "b"), -1));
trans.add(new Transition(new StateTapeSymbolPair("s3", "a"), new StateTapeSymbolPair("s3", "a"), -1));
trans.add(new Transition(new StateTapeSymbolPair("s3", "b"), new StateTapeSymbolPair("s3", "b"), -1));
trans.add(new Transition(new StateTapeSymbolPair("s3", "B"), new StateTapeSymbolPair("s0", "a"), 1));
trans.add(new Transition(new StateTapeSymbolPair("se", "a"), new StateTapeSymbolPair("se", "a"), -1));
trans.add(new Transition(new StateTapeSymbolPair("se", "*"), new StateTapeSymbolPair("see", "*"), 1));
machine = new UTM(trans, term, init, blank);
machine.initializeTape("babbababaa");
System.out.println("Output (sort): " + machine.runTM() + "\n");
}
}
| Option Base 1
Public Enum sett
name_ = 1
initState
endState
blank
rules
End Enum
Public incrementer As Variant, threeStateBB As Variant, fiveStateBB As Variant
Private Sub init()
incrementer = Array("Simple incrementer", _
"q0", _
"qf", _
"B", _
Array( _
Array("q0", "1", "1", "right", "q0"), _
Array("q0", "B", "1", "stay", "qf")))
threeStateBB = Array("Three-state busy beaver", _
"a", _
"halt", _
"0", _
Array( _
Array("a", "0", "1", "right", "b"), _
Array("a", "1", "1", "left", "c"), _
Array("b", "0", "1", "left", "a"), _
Array("b", "1", "1", "right", "b"), _
Array("c", "0", "1", "left", "b"), _
Array("c", "1", "1", "stay", "halt")))
fiveStateBB = Array("Five-state busy beaver", _
"A", _
"H", _
"0", _
Array( _
Array("A", "0", "1", "right", "B"), _
Array("A", "1", "1", "left", "C"), _
Array("B", "0", "1", "right", "C"), _
Array("B", "1", "1", "right", "B"), _
Array("C", "0", "1", "right", "D"), _
Array("C", "1", "0", "left", "E"), _
Array("D", "0", "1", "left", "A"), _
Array("D", "1", "1", "left", "D"), _
Array("E", "0", "1", "stay", "H"), _
Array("E", "1", "0", "left", "A")))
End Sub
Private Sub show(state As String, headpos As Long, tape As Collection)
Debug.Print " "; state; String$(7 - Len(state), " "); "| ";
For p = 1 To tape.Count
Debug.Print IIf(p = headpos, "[" & tape(p) & "]", " " & tape(p) & " ");
Next p
Debug.Print
End Sub
Private Sub UTM(machine As Variant, tape As Collection, Optional countOnly As Long = 0)
Dim state As String: state = machine(initState)
Dim headpos As Long: headpos = 1
Dim counter As Long, rule As Variant
Debug.Print machine(name_); vbCrLf; String$(Len(machine(name_)), "=")
If Not countOnly Then Debug.Print " State | Tape [head]" & vbCrLf & "---------------------"
Do While True
If headpos > tape.Count Then
tape.Add machine(blank)
Else
If headpos < 1 Then
tape.Add machine(blank), Before:=1
headpos = 1
End If
End If
If Not countOnly Then show state, headpos, tape
For i = LBound(machine(rules)) To UBound(machine(rules))
rule = machine(rules)(i)
If rule(1) = state And rule(2) = tape(headpos) Then
tape.Remove headpos
If headpos > tape.Count Then
tape.Add rule(3)
Else
tape.Add rule(3), Before:=headpos
End If
If rule(4) = "left" Then headpos = headpos - 1
If rule(4) = "right" Then headpos = headpos + 1
state = rule(5)
Exit For
End If
Next i
counter = counter + 1
If counter Mod 100000 = 0 Then
Debug.Print counter
DoEvents
DoEvents
End If
If state = machine(endState) Then Exit Do
Loop
DoEvents
If countOnly Then
Debug.Print "Steps taken: ", counter
Else
show state, headpos, tape
Debug.Print
End If
End Sub
Public Sub main()
init
Dim tap As New Collection
tap.Add "1": tap.Add "1": tap.Add "1"
UTM incrementer, tap
Set tap = New Collection
UTM threeStateBB, tap
Set tap = New Collection
UTM fiveStateBB, tap, countOnly:=-1
End Sub
|
Convert the following code from Java to VB, ensuring the logic remains intact. | import java.io.*;
public class CreateFileTest {
public static void main(String args[]) {
try {
new File("output.txt").createNewFile();
new File(File.separator + "output.txt").createNewFile();
new File("docs").mkdir();
new File(File.separator + "docs").mkdir();
} catch (IOException e) {
System.err.println(e.getMessage());
}
}
}
| Public Sub create_file()
Dim FileNumber As Integer
FileNumber = FreeFile
MkDir "docs"
Open "docs\output.txt" For Output As #FreeFile
Close #FreeFile
MkDir "C:\docs"
Open "C:\docs\output.txt" For Output As #FreeFile
Close #FreeFile
End Sub
|
Transform the following Java implementation into VB, maintaining the same output and logic. | import java.util.HashMap;
import java.util.Map;
public class orderedSequence {
public static void main(String[] args) {
Sequence gene = new Sequence("CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATGCTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTGAGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGATGGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTTCGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGGTCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATATTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTATCGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTGTCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGACGACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT");
gene.runSequence();
}
}
public class Sequence {
private final String seq;
public Sequence(String sq) {
this.seq = sq;
}
public void prettyPrint() {
System.out.println("Sequence:");
int i = 0;
for ( ; i < seq.length() - 50 ; i += 50) {
System.out.printf("%5s : %s\n", i + 50, seq.substring(i, i + 50));
}
System.out.printf("%5s : %s\n", seq.length(), seq.substring(i));
}
public void displayCount() {
Map<Character, Integer> counter = new HashMap<>();
for (int i = 0 ; i < seq.length() ; ++i) {
counter.merge(seq.charAt(i), 1, Integer::sum);
}
System.out.println("Base vs. Count:");
counter.forEach(
key, value -> System.out.printf("%5s : %s\n", key, value));
System.out.printf("%5s: %s\n", "SUM", seq.length());
}
public void runSequence() {
this.prettyPrint();
this.displayCount();
}
}
| b=_
"CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATG" &_
"CTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTG" &_
"AGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGAT" &_
"GGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT" &_
"CGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGG" &_
"TCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA" &_
"TTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTAT" &_
"CGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTG" &_
"TCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGAC" &_
"GACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT"
s="SEQUENCE:"
acnt=0:ccnt=0:gcnt=0:tcnt=0
for i=0 to len(b)-1
if (i mod 30)=0 then s = s & vbcrlf & right(" "& i+1,3)&": "
if (i mod 5)=0 then s=s& " "
m=mid(b,i+1,1)
s=s & m
select case m
case "A":acnt=acnt+1
case "C":ccnt=ccnt+1
case "G":gcnt=gcnt+1
case "T":tcnt=tcnt+1
case else
wscript.echo "error at ",i+1, m
end select
next
wscript.echo s & vbcrlf
wscript.echo "Count: A="&acnt & " C=" & ccnt & " G=" & gcnt & " T=" & tcnt
|
Write a version of this Java function in VB with identical behavior. | import java.util.HashMap;
import java.util.Map;
public class orderedSequence {
public static void main(String[] args) {
Sequence gene = new Sequence("CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATGCTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTGAGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGATGGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTTCGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGGTCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATATTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTATCGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTGTCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGACGACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT");
gene.runSequence();
}
}
public class Sequence {
private final String seq;
public Sequence(String sq) {
this.seq = sq;
}
public void prettyPrint() {
System.out.println("Sequence:");
int i = 0;
for ( ; i < seq.length() - 50 ; i += 50) {
System.out.printf("%5s : %s\n", i + 50, seq.substring(i, i + 50));
}
System.out.printf("%5s : %s\n", seq.length(), seq.substring(i));
}
public void displayCount() {
Map<Character, Integer> counter = new HashMap<>();
for (int i = 0 ; i < seq.length() ; ++i) {
counter.merge(seq.charAt(i), 1, Integer::sum);
}
System.out.println("Base vs. Count:");
counter.forEach(
key, value -> System.out.printf("%5s : %s\n", key, value));
System.out.printf("%5s: %s\n", "SUM", seq.length());
}
public void runSequence() {
this.prettyPrint();
this.displayCount();
}
}
| b=_
"CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATG" &_
"CTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTG" &_
"AGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGAT" &_
"GGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT" &_
"CGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGG" &_
"TCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA" &_
"TTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTAT" &_
"CGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTG" &_
"TCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGAC" &_
"GACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT"
s="SEQUENCE:"
acnt=0:ccnt=0:gcnt=0:tcnt=0
for i=0 to len(b)-1
if (i mod 30)=0 then s = s & vbcrlf & right(" "& i+1,3)&": "
if (i mod 5)=0 then s=s& " "
m=mid(b,i+1,1)
s=s & m
select case m
case "A":acnt=acnt+1
case "C":ccnt=ccnt+1
case "G":gcnt=gcnt+1
case "T":tcnt=tcnt+1
case else
wscript.echo "error at ",i+1, m
end select
next
wscript.echo s & vbcrlf
wscript.echo "Count: A="&acnt & " C=" & ccnt & " G=" & gcnt & " T=" & tcnt
|
Convert the following code from Java to VB, ensuring the logic remains intact. | package diningphilosophers;
import java.util.ArrayList;
import java.util.Random;
import java.util.concurrent.atomic.AtomicBoolean;
import java.util.concurrent.atomic.AtomicInteger;
enum PhilosopherState { Get, Eat, Pon }
class Fork {
public static final int ON_TABLE = -1;
static int instances = 0;
public int id;
public AtomicInteger holder = new AtomicInteger(ON_TABLE);
Fork() { id = instances++; }
}
class Philosopher implements Runnable {
static final int maxWaitMs = 100;
static AtomicInteger token = new AtomicInteger(0);
static int instances = 0;
static Random rand = new Random();
AtomicBoolean end = new AtomicBoolean(false);
int id;
PhilosopherState state = PhilosopherState.Get;
Fork left;
Fork right;
int timesEaten = 0;
Philosopher() {
id = instances++;
left = Main.forks.get(id);
right = Main.forks.get((id+1)%Main.philosopherCount);
}
void sleep() { try { Thread.sleep(rand.nextInt(maxWaitMs)); }
catch (InterruptedException ex) {} }
void waitForFork(Fork fork) {
do {
if (fork.holder.get() == Fork.ON_TABLE) {
fork.holder.set(id);
return;
} else {
sleep();
}
} while (true);
}
public void run() {
do {
if (state == PhilosopherState.Pon) {
state = PhilosopherState.Get;
} else {
if (token.get() == id) {
waitForFork(left);
waitForFork(right);
token.set((id+2)% Main.philosopherCount);
state = PhilosopherState.Eat;
timesEaten++;
sleep();
left.holder.set(Fork.ON_TABLE);
right.holder.set(Fork.ON_TABLE);
state = PhilosopherState.Pon;
sleep();
} else {
sleep();
}
}
} while (!end.get());
}
}
public class Main {
static final int philosopherCount = 5;
static final int runSeconds = 15;
static ArrayList<Fork> forks = new ArrayList<Fork>();
static ArrayList<Philosopher> philosophers = new ArrayList<Philosopher>();
public static void main(String[] args) {
for (int i = 0 ; i < philosopherCount ; i++) forks.add(new Fork());
for (int i = 0 ; i < philosopherCount ; i++)
philosophers.add(new Philosopher());
for (Philosopher p : philosophers) new Thread(p).start();
long endTime = System.currentTimeMillis() + (runSeconds * 1000);
do {
StringBuilder sb = new StringBuilder("|");
for (Philosopher p : philosophers) {
sb.append(p.state.toString());
sb.append("|");
}
sb.append(" |");
for (Fork f : forks) {
int holder = f.holder.get();
sb.append(holder==-1?" ":String.format("P%02d",holder));
sb.append("|");
}
System.out.println(sb.toString());
try {Thread.sleep(1000);} catch (Exception ex) {}
} while (System.currentTimeMillis() < endTime);
for (Philosopher p : philosophers) p.end.set(true);
for (Philosopher p : philosophers)
System.out.printf("P%02d: ate %,d times, %,d/sec\n",
p.id, p.timesEaten, p.timesEaten/runSeconds);
}
}
|
Public Const HOLDON = False
Public Const DIJKSTRASOLUTION = True
Public Const X = 10
Public Const GETS = 0
Public Const PUTS = 1
Public Const EATS = 2
Public Const THKS = 5
Public Const FRSTFORK = 0
Public Const SCNDFORK = 1
Public Const SPAGHETI = 0
Public Const UNIVERSE = 1
Public Const MAXCOUNT = 100000
Public Const PHILOSOPHERS = 5
Public semaphore(PHILOSOPHERS - 1) As Integer
Public positi0n(1, PHILOSOPHERS - 1) As Integer
Public programcounter(PHILOSOPHERS - 1) As Long
Public statistics(PHILOSOPHERS - 1, 5, 1) As Long
Public names As Variant
Private Sub init()
names = [{"Aquinas","Babbage","Carroll","Derrida","Erasmus"}]
For j = 0 To PHILOSOPHERS - 2
positi0n(0, j) = j + 1
positi0n(1, j) = j
Next j
If DIJKSTRASOLUTION Then
positi0n(0, PHILOSOPHERS - 1) = j
positi0n(1, PHILOSOPHERS - 1) = 0
Else
positi0n(0, PHILOSOPHERS - 1) = 0
positi0n(1, PHILOSOPHERS - 1) = j
End If
End Sub
Private Sub philosopher(subject As Integer, verb As Integer, objekt As Integer)
statistics(subject, verb, objekt) = statistics(subject, verb, objekt) + 1
If verb < 2 Then
If semaphore(positi0n(objekt, subject)) <> verb Then
If Not HOLDON Then
semaphore(positi0n(FRSTFORK, subject)) = 1 - objekt
programcounter(subject) = 0
End If
Else
semaphore(positi0n(objekt, subject)) = 1 - verb
programcounter(subject) = (programcounter(subject) + 1) Mod 6
End If
Else
programcounter(subject) = IIf(X * Rnd > 1, verb, verb + 1) Mod 6
End If
End Sub
Private Sub dine()
Dim ph As Integer
Do While TC < MAXCOUNT
For ph = 0 To PHILOSOPHERS - 1
Select Case programcounter(ph)
Case 0: philosopher ph, GETS, FRSTFORK
Case 1: philosopher ph, GETS, SCNDFORK
Case 2: philosopher ph, EATS, SPAGHETI
Case 3: philosopher ph, PUTS, FRSTFORK
Case 4: philosopher ph, PUTS, SCNDFORK
Case 5: philosopher ph, THKS, UNIVERSE
End Select
TC = TC + 1
Next ph
Loop
End Sub
Private Sub show()
Debug.Print "Stats", "Gets", "Gets", "Eats", "Puts", "Puts", "Thinks"
Debug.Print "", "First", "Second", "Spag-", "First", "Second", "About"
Debug.Print "", "Fork", "Fork", "hetti", "Fork", "Fork", "Universe"
For subject = 0 To PHILOSOPHERS - 1
Debug.Print names(subject + 1),
For objekt = 0 To 1
Debug.Print statistics(subject, GETS, objekt),
Next objekt
Debug.Print statistics(subject, EATS, SPAGHETI),
For objekt = 0 To 1
Debug.Print statistics(subject, PUTS, objekt),
Next objekt
Debug.Print statistics(subject, THKS, UNIVERSE)
Next subject
End Sub
Public Sub main()
init
dine
show
End Sub
|
Convert this Java snippet to VB and keep its semantics consistent. | public class Factorion {
public static void main(String [] args){
System.out.println("Base 9:");
for(int i = 1; i <= 1499999; i++){
String iStri = String.valueOf(i);
int multiplied = operate(iStri,9);
if(multiplied == i){
System.out.print(i + "\t");
}
}
System.out.println("\nBase 10:");
for(int i = 1; i <= 1499999; i++){
String iStri = String.valueOf(i);
int multiplied = operate(iStri,10);
if(multiplied == i){
System.out.print(i + "\t");
}
}
System.out.println("\nBase 11:");
for(int i = 1; i <= 1499999; i++){
String iStri = String.valueOf(i);
int multiplied = operate(iStri,11);
if(multiplied == i){
System.out.print(i + "\t");
}
}
System.out.println("\nBase 12:");
for(int i = 1; i <= 1499999; i++){
String iStri = String.valueOf(i);
int multiplied = operate(iStri,12);
if(multiplied == i){
System.out.print(i + "\t");
}
}
}
public static int factorialRec(int n){
int result = 1;
return n == 0 ? result : result * n * factorialRec(n-1);
}
public static int operate(String s, int base){
int sum = 0;
String strx = fromDeci(base, Integer.parseInt(s));
for(int i = 0; i < strx.length(); i++){
if(strx.charAt(i) == 'A'){
sum += factorialRec(10);
}else if(strx.charAt(i) == 'B') {
sum += factorialRec(11);
}else if(strx.charAt(i) == 'C') {
sum += factorialRec(12);
}else {
sum += factorialRec(Integer.parseInt(String.valueOf(strx.charAt(i)), base));
}
}
return sum;
}
static char reVal(int num) {
if (num >= 0 && num <= 9)
return (char)(num + 48);
else
return (char)(num - 10 + 65);
}
static String fromDeci(int base, int num){
StringBuilder s = new StringBuilder();
while (num > 0) {
s.append(reVal(num % base));
num /= base;
}
return new String(new StringBuilder(s).reverse());
}
}
|
Dim fact()
nn1=9 : nn2=12
lim=1499999
ReDim fact(nn2)
fact(0)=1
For i=1 To nn2
fact(i)=fact(i-1)*i
Next
For base=nn1 To nn2
list=""
For i=1 To lim
s=0
t=i
Do While t<>0
d=t Mod base
s=s+fact(d)
t=t\base
Loop
If s=i Then list=list &" "& i
Next
Wscript.Echo "the factorions for base "& right(" "& base,2) &" are: "& list
Next
|
Write a version of this Java function in VB with identical behavior. | public class Factorion {
public static void main(String [] args){
System.out.println("Base 9:");
for(int i = 1; i <= 1499999; i++){
String iStri = String.valueOf(i);
int multiplied = operate(iStri,9);
if(multiplied == i){
System.out.print(i + "\t");
}
}
System.out.println("\nBase 10:");
for(int i = 1; i <= 1499999; i++){
String iStri = String.valueOf(i);
int multiplied = operate(iStri,10);
if(multiplied == i){
System.out.print(i + "\t");
}
}
System.out.println("\nBase 11:");
for(int i = 1; i <= 1499999; i++){
String iStri = String.valueOf(i);
int multiplied = operate(iStri,11);
if(multiplied == i){
System.out.print(i + "\t");
}
}
System.out.println("\nBase 12:");
for(int i = 1; i <= 1499999; i++){
String iStri = String.valueOf(i);
int multiplied = operate(iStri,12);
if(multiplied == i){
System.out.print(i + "\t");
}
}
}
public static int factorialRec(int n){
int result = 1;
return n == 0 ? result : result * n * factorialRec(n-1);
}
public static int operate(String s, int base){
int sum = 0;
String strx = fromDeci(base, Integer.parseInt(s));
for(int i = 0; i < strx.length(); i++){
if(strx.charAt(i) == 'A'){
sum += factorialRec(10);
}else if(strx.charAt(i) == 'B') {
sum += factorialRec(11);
}else if(strx.charAt(i) == 'C') {
sum += factorialRec(12);
}else {
sum += factorialRec(Integer.parseInt(String.valueOf(strx.charAt(i)), base));
}
}
return sum;
}
static char reVal(int num) {
if (num >= 0 && num <= 9)
return (char)(num + 48);
else
return (char)(num - 10 + 65);
}
static String fromDeci(int base, int num){
StringBuilder s = new StringBuilder();
while (num > 0) {
s.append(reVal(num % base));
num /= base;
}
return new String(new StringBuilder(s).reverse());
}
}
|
Dim fact()
nn1=9 : nn2=12
lim=1499999
ReDim fact(nn2)
fact(0)=1
For i=1 To nn2
fact(i)=fact(i-1)*i
Next
For base=nn1 To nn2
list=""
For i=1 To lim
s=0
t=i
Do While t<>0
d=t Mod base
s=s+fact(d)
t=t\base
Loop
If s=i Then list=list &" "& i
Next
Wscript.Echo "the factorions for base "& right(" "& base,2) &" are: "& list
Next
|
Change the programming language of this snippet from Java to VB without modifying what it does. | import java.util.HashMap;
import java.util.Map;
import java.util.Scanner;
public class AbbreviationsEasy {
private static final Scanner input = new Scanner(System.in);
private static final String COMMAND_TABLE
= " Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy\n" +
" COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find\n" +
" NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput\n" +
" Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO\n" +
" MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT\n" +
" READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT\n" +
" RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up";
public static void main(String[] args) {
String[] cmdTableArr = COMMAND_TABLE.split("\\s+");
Map<String, Integer> cmd_table = new HashMap<String, Integer>();
for (String word : cmdTableArr) {
cmd_table.put(word, countCaps(word));
}
System.out.print("Please enter your command to verify: ");
String userInput = input.nextLine();
String[] user_input = userInput.split("\\s+");
for (String s : user_input) {
boolean match = false;
for (String cmd : cmd_table.keySet()) {
if (s.length() >= cmd_table.get(cmd) && s.length() <= cmd.length()) {
String temp = cmd.toUpperCase();
if (temp.startsWith(s.toUpperCase())) {
System.out.print(temp + " ");
match = true;
}
}
}
if (!match) {
System.out.print("*error* ");
}
}
}
private static int countCaps(String word) {
int numCaps = 0;
for (int i = 0; i < word.length(); i++) {
if (Character.isUpperCase(word.charAt(i))) {
numCaps++;
}
}
return numCaps;
}
}
| Private Function ValidateUserWords(userstring As String) As String
Dim s As String
Dim user_words() As String
Dim command_table As Scripting.Dictionary
Set command_table = New Scripting.Dictionary
Dim abbreviations As Scripting.Dictionary
Set abbreviations = New Scripting.Dictionary
abbreviations.CompareMode = TextCompare
Dim commandtable() As String
Dim commands As String
s = s & "Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy "
s = s & "COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find "
s = s & "NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput "
s = s & "Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO "
s = s & "MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT "
s = s & "READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT "
s = s & "RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up "
commandtable = Split(s, " ")
Dim i As Integer
For Each word In commandtable
If Len(word) > 0 Then
i = 1
Do While Mid(word, i, 1) >= "A" And Mid(word, i, 1) <= "Z"
i = i + 1
Loop
command_table.Add Key:=word, Item:=i - 1
End If
Next word
For Each word In command_table
For i = command_table(word) To Len(word)
On Error Resume Next
abbreviations.Add Key:=Left(word, i), Item:=UCase(word)
Next i
Next word
user_words() = Split(userstring, " ")
For Each word In user_words
If Len(word) > 0 Then
If abbreviations.exists(word) Then
commands = commands & abbreviations(word) & " "
Else
commands = commands & "*error* "
End If
End If
Next word
ValidateUserWords = commands
End Function
Public Sub program()
Dim guserstring As String
guserstring = "riG rePEAT copies put mo rest types fup. 6 poweRin"
Debug.Print "user words:", guserstring
Debug.Print "full words:", ValidateUserWords(guserstring)
End Sub
|
Convert this Java snippet to VB and keep its semantics consistent. | import java.util.HashMap;
import java.util.Map;
import java.util.Scanner;
public class AbbreviationsEasy {
private static final Scanner input = new Scanner(System.in);
private static final String COMMAND_TABLE
= " Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy\n" +
" COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find\n" +
" NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput\n" +
" Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO\n" +
" MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT\n" +
" READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT\n" +
" RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up";
public static void main(String[] args) {
String[] cmdTableArr = COMMAND_TABLE.split("\\s+");
Map<String, Integer> cmd_table = new HashMap<String, Integer>();
for (String word : cmdTableArr) {
cmd_table.put(word, countCaps(word));
}
System.out.print("Please enter your command to verify: ");
String userInput = input.nextLine();
String[] user_input = userInput.split("\\s+");
for (String s : user_input) {
boolean match = false;
for (String cmd : cmd_table.keySet()) {
if (s.length() >= cmd_table.get(cmd) && s.length() <= cmd.length()) {
String temp = cmd.toUpperCase();
if (temp.startsWith(s.toUpperCase())) {
System.out.print(temp + " ");
match = true;
}
}
}
if (!match) {
System.out.print("*error* ");
}
}
}
private static int countCaps(String word) {
int numCaps = 0;
for (int i = 0; i < word.length(); i++) {
if (Character.isUpperCase(word.charAt(i))) {
numCaps++;
}
}
return numCaps;
}
}
| Private Function ValidateUserWords(userstring As String) As String
Dim s As String
Dim user_words() As String
Dim command_table As Scripting.Dictionary
Set command_table = New Scripting.Dictionary
Dim abbreviations As Scripting.Dictionary
Set abbreviations = New Scripting.Dictionary
abbreviations.CompareMode = TextCompare
Dim commandtable() As String
Dim commands As String
s = s & "Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy "
s = s & "COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find "
s = s & "NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput "
s = s & "Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO "
s = s & "MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT "
s = s & "READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT "
s = s & "RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up "
commandtable = Split(s, " ")
Dim i As Integer
For Each word In commandtable
If Len(word) > 0 Then
i = 1
Do While Mid(word, i, 1) >= "A" And Mid(word, i, 1) <= "Z"
i = i + 1
Loop
command_table.Add Key:=word, Item:=i - 1
End If
Next word
For Each word In command_table
For i = command_table(word) To Len(word)
On Error Resume Next
abbreviations.Add Key:=Left(word, i), Item:=UCase(word)
Next i
Next word
user_words() = Split(userstring, " ")
For Each word In user_words
If Len(word) > 0 Then
If abbreviations.exists(word) Then
commands = commands & abbreviations(word) & " "
Else
commands = commands & "*error* "
End If
End If
Next word
ValidateUserWords = commands
End Function
Public Sub program()
Dim guserstring As String
guserstring = "riG rePEAT copies put mo rest types fup. 6 poweRin"
Debug.Print "user words:", guserstring
Debug.Print "full words:", ValidateUserWords(guserstring)
End Sub
|
Write a version of this Java function in VB with identical behavior. | import java.util.HashMap;
import java.util.Map;
import java.util.Scanner;
public class AbbreviationsEasy {
private static final Scanner input = new Scanner(System.in);
private static final String COMMAND_TABLE
= " Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy\n" +
" COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find\n" +
" NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput\n" +
" Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO\n" +
" MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT\n" +
" READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT\n" +
" RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up";
public static void main(String[] args) {
String[] cmdTableArr = COMMAND_TABLE.split("\\s+");
Map<String, Integer> cmd_table = new HashMap<String, Integer>();
for (String word : cmdTableArr) {
cmd_table.put(word, countCaps(word));
}
System.out.print("Please enter your command to verify: ");
String userInput = input.nextLine();
String[] user_input = userInput.split("\\s+");
for (String s : user_input) {
boolean match = false;
for (String cmd : cmd_table.keySet()) {
if (s.length() >= cmd_table.get(cmd) && s.length() <= cmd.length()) {
String temp = cmd.toUpperCase();
if (temp.startsWith(s.toUpperCase())) {
System.out.print(temp + " ");
match = true;
}
}
}
if (!match) {
System.out.print("*error* ");
}
}
}
private static int countCaps(String word) {
int numCaps = 0;
for (int i = 0; i < word.length(); i++) {
if (Character.isUpperCase(word.charAt(i))) {
numCaps++;
}
}
return numCaps;
}
}
| Private Function ValidateUserWords(userstring As String) As String
Dim s As String
Dim user_words() As String
Dim command_table As Scripting.Dictionary
Set command_table = New Scripting.Dictionary
Dim abbreviations As Scripting.Dictionary
Set abbreviations = New Scripting.Dictionary
abbreviations.CompareMode = TextCompare
Dim commandtable() As String
Dim commands As String
s = s & "Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy "
s = s & "COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find "
s = s & "NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput "
s = s & "Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO "
s = s & "MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT "
s = s & "READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT "
s = s & "RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up "
commandtable = Split(s, " ")
Dim i As Integer
For Each word In commandtable
If Len(word) > 0 Then
i = 1
Do While Mid(word, i, 1) >= "A" And Mid(word, i, 1) <= "Z"
i = i + 1
Loop
command_table.Add Key:=word, Item:=i - 1
End If
Next word
For Each word In command_table
For i = command_table(word) To Len(word)
On Error Resume Next
abbreviations.Add Key:=Left(word, i), Item:=UCase(word)
Next i
Next word
user_words() = Split(userstring, " ")
For Each word In user_words
If Len(word) > 0 Then
If abbreviations.exists(word) Then
commands = commands & abbreviations(word) & " "
Else
commands = commands & "*error* "
End If
End If
Next word
ValidateUserWords = commands
End Function
Public Sub program()
Dim guserstring As String
guserstring = "riG rePEAT copies put mo rest types fup. 6 poweRin"
Debug.Print "user words:", guserstring
Debug.Print "full words:", ValidateUserWords(guserstring)
End Sub
|
Rewrite this program in VB while keeping its functionality equivalent to the Java version. | import java.util.HashMap;
import java.util.Map;
import java.util.Objects;
public class BaconCipher {
private static final Map<Character, String> codes;
static {
codes = new HashMap<>();
codes.putAll(Map.of(
'a', "AAAAA", 'b', "AAAAB", 'c', "AAABA", 'd', "AAABB", 'e', "AABAA",
'f', "AABAB", 'g', "AABBA", 'h', "AABBB", 'i', "ABAAA", 'j', "ABAAB"
));
codes.putAll(Map.of(
'k', "ABABA", 'l', "ABABB", 'm', "ABBAA", 'n', "ABBAB", 'o', "ABBBA",
'p', "ABBBB", 'q', "BAAAA", 'r', "BAAAB", 's', "BAABA", 't', "BAABB"
));
codes.putAll(Map.of(
'u', "BABAA", 'v', "BABAB", 'w', "BABBA", 'x', "BABBB", 'y', "BBAAA",
'z', "BBAAB", ' ', "BBBAA"
));
}
private static String encode(String plainText, String message) {
String pt = plainText.toLowerCase();
StringBuilder sb = new StringBuilder();
for (char c : pt.toCharArray()) {
if ('a' <= c && c <= 'z') sb.append(codes.get(c));
else sb.append(codes.get(' '));
}
String et = sb.toString();
String mg = message.toLowerCase();
sb.setLength(0);
int count = 0;
for (char c : mg.toCharArray()) {
if ('a' <= c && c <= 'z') {
if (et.charAt(count) == 'A') sb.append(c);
else sb.append(((char) (c - 32)));
count++;
if (count == et.length()) break;
} else sb.append(c);
}
return sb.toString();
}
private static String decode(String message) {
StringBuilder sb = new StringBuilder();
for (char c : message.toCharArray()) {
if ('a' <= c && c <= 'z') sb.append('A');
if ('A' <= c && c <= 'Z') sb.append('B');
}
String et = sb.toString();
sb.setLength(0);
for (int i = 0; i < et.length(); i += 5) {
String quintet = et.substring(i, i + 5);
Character key = codes.entrySet().stream().filter(a -> Objects.equals(a.getValue(), quintet)).findFirst().map(Map.Entry::getKey).orElse(null);
sb.append(key);
}
return sb.toString();
}
public static void main(String[] args) {
String plainText = "the quick brown fox jumps over the lazy dog";
String message = "bacon's cipher is a method of steganography created by francis bacon. " +
"this task is to implement a program for encryption and decryption of " +
"plaintext using the simple alphabet of the baconian cipher or some " +
"other kind of representation of this alphabet (make anything signify anything). " +
"the baconian alphabet may optionally be extended to encode all lower " +
"case characters individually and/or adding a few punctuation characters " +
"such as the space.";
String cipherText = encode(plainText, message);
System.out.printf("Cipher text ->\n\n%s\n", cipherText);
String decodedText = decode(cipherText);
System.out.printf("\nHidden text ->\n\n%s\n", decodedText);
}
}
| Imports System.Text
Module Module1
ReadOnly CODES As New Dictionary(Of Char, String) From {
{"a", "AAAAA"}, {"b", "AAAAB"}, {"c", "AAABA"}, {"d", "AAABB"}, {"e", "AABAA"},
{"f", "AABAB"}, {"g", "AABBA"}, {"h", "AABBB"}, {"i", "ABAAA"}, {"j", "ABAAB"},
{"k", "ABABA"}, {"l", "ABABB"}, {"m", "ABBAA"}, {"n", "ABBAB"}, {"o", "ABBBA"},
{"p", "ABBBB"}, {"q", "BAAAA"}, {"r", "BAAAB"}, {"s", "BAABA"}, {"t", "BAABB"},
{"u", "BABAA"}, {"v", "BABAB"}, {"w", "BABBA"}, {"x", "BABBB"}, {"y", "BBAAA"},
{"z", "BBAAB"}, {" ", "BBBAA"}
}
Function Encode(plainText As String, message As String) As String
Dim pt = plainText.ToLower()
Dim sb As New StringBuilder()
For Each c In pt
If "a" <= c AndAlso c <= "z" Then
sb.Append(CODES(c))
Else
sb.Append(CODES(" "))
End If
Next
Dim et = sb.ToString()
Dim mg = message.ToLower()
sb.Length = 0
Dim count = 0
For Each c In mg
If "a" <= c AndAlso c <= "z" Then
If et(count) = "A" Then
sb.Append(c)
Else
sb.Append(Chr(Asc(c) - 32))
End If
count += 1
If count = et.Length Then
Exit For
End If
Else
sb.Append(c)
End If
Next
Return sb.ToString()
End Function
Function Decode(message As String) As String
Dim sb As New StringBuilder
For Each c In message
If "a" <= c AndAlso c <= "z" Then
sb.Append("A")
ElseIf "A" <= c AndAlso c <= "Z" Then
sb.Append("B")
End If
Next
Dim et = sb.ToString()
sb.Length = 0
For index = 0 To et.Length - 1 Step 5
Dim quintet = et.Substring(index, 5)
Dim key = CODES.Where(Function(a) a.Value = quintet).First().Key
sb.Append(key)
Next
Return sb.ToString()
End Function
Sub Main()
Dim plainText = "the quick brown fox jumps over the lazy dog"
Dim message =
"bacon
"this task is to implement a program for encryption and decryption of " +
"plaintext using the simple alphabet of the baconian cipher or some " +
"other kind of representation of this alphabet (make anything signify anything). " +
"the baconian alphabet may optionally be extended to encode all lower " +
"case characters individually and/or adding a few punctuation characters " +
"such as the space."
Dim cipherText = Encode(plainText, message)
Console.WriteLine("Cipher text ->" & Environment.NewLine & "{0}", cipherText)
Dim decodedText = Decode(cipherText)
Console.WriteLine(Environment.NewLine & "Hidden text ->" & Environment.NewLine & "{0}", decodedText)
End Sub
End Module
|
Please provide an equivalent version of this Java code in VB. | import java.util.HashMap;
import java.util.Map;
import java.util.Objects;
public class BaconCipher {
private static final Map<Character, String> codes;
static {
codes = new HashMap<>();
codes.putAll(Map.of(
'a', "AAAAA", 'b', "AAAAB", 'c', "AAABA", 'd', "AAABB", 'e', "AABAA",
'f', "AABAB", 'g', "AABBA", 'h', "AABBB", 'i', "ABAAA", 'j', "ABAAB"
));
codes.putAll(Map.of(
'k', "ABABA", 'l', "ABABB", 'm', "ABBAA", 'n', "ABBAB", 'o', "ABBBA",
'p', "ABBBB", 'q', "BAAAA", 'r', "BAAAB", 's', "BAABA", 't', "BAABB"
));
codes.putAll(Map.of(
'u', "BABAA", 'v', "BABAB", 'w', "BABBA", 'x', "BABBB", 'y', "BBAAA",
'z', "BBAAB", ' ', "BBBAA"
));
}
private static String encode(String plainText, String message) {
String pt = plainText.toLowerCase();
StringBuilder sb = new StringBuilder();
for (char c : pt.toCharArray()) {
if ('a' <= c && c <= 'z') sb.append(codes.get(c));
else sb.append(codes.get(' '));
}
String et = sb.toString();
String mg = message.toLowerCase();
sb.setLength(0);
int count = 0;
for (char c : mg.toCharArray()) {
if ('a' <= c && c <= 'z') {
if (et.charAt(count) == 'A') sb.append(c);
else sb.append(((char) (c - 32)));
count++;
if (count == et.length()) break;
} else sb.append(c);
}
return sb.toString();
}
private static String decode(String message) {
StringBuilder sb = new StringBuilder();
for (char c : message.toCharArray()) {
if ('a' <= c && c <= 'z') sb.append('A');
if ('A' <= c && c <= 'Z') sb.append('B');
}
String et = sb.toString();
sb.setLength(0);
for (int i = 0; i < et.length(); i += 5) {
String quintet = et.substring(i, i + 5);
Character key = codes.entrySet().stream().filter(a -> Objects.equals(a.getValue(), quintet)).findFirst().map(Map.Entry::getKey).orElse(null);
sb.append(key);
}
return sb.toString();
}
public static void main(String[] args) {
String plainText = "the quick brown fox jumps over the lazy dog";
String message = "bacon's cipher is a method of steganography created by francis bacon. " +
"this task is to implement a program for encryption and decryption of " +
"plaintext using the simple alphabet of the baconian cipher or some " +
"other kind of representation of this alphabet (make anything signify anything). " +
"the baconian alphabet may optionally be extended to encode all lower " +
"case characters individually and/or adding a few punctuation characters " +
"such as the space.";
String cipherText = encode(plainText, message);
System.out.printf("Cipher text ->\n\n%s\n", cipherText);
String decodedText = decode(cipherText);
System.out.printf("\nHidden text ->\n\n%s\n", decodedText);
}
}
| Imports System.Text
Module Module1
ReadOnly CODES As New Dictionary(Of Char, String) From {
{"a", "AAAAA"}, {"b", "AAAAB"}, {"c", "AAABA"}, {"d", "AAABB"}, {"e", "AABAA"},
{"f", "AABAB"}, {"g", "AABBA"}, {"h", "AABBB"}, {"i", "ABAAA"}, {"j", "ABAAB"},
{"k", "ABABA"}, {"l", "ABABB"}, {"m", "ABBAA"}, {"n", "ABBAB"}, {"o", "ABBBA"},
{"p", "ABBBB"}, {"q", "BAAAA"}, {"r", "BAAAB"}, {"s", "BAABA"}, {"t", "BAABB"},
{"u", "BABAA"}, {"v", "BABAB"}, {"w", "BABBA"}, {"x", "BABBB"}, {"y", "BBAAA"},
{"z", "BBAAB"}, {" ", "BBBAA"}
}
Function Encode(plainText As String, message As String) As String
Dim pt = plainText.ToLower()
Dim sb As New StringBuilder()
For Each c In pt
If "a" <= c AndAlso c <= "z" Then
sb.Append(CODES(c))
Else
sb.Append(CODES(" "))
End If
Next
Dim et = sb.ToString()
Dim mg = message.ToLower()
sb.Length = 0
Dim count = 0
For Each c In mg
If "a" <= c AndAlso c <= "z" Then
If et(count) = "A" Then
sb.Append(c)
Else
sb.Append(Chr(Asc(c) - 32))
End If
count += 1
If count = et.Length Then
Exit For
End If
Else
sb.Append(c)
End If
Next
Return sb.ToString()
End Function
Function Decode(message As String) As String
Dim sb As New StringBuilder
For Each c In message
If "a" <= c AndAlso c <= "z" Then
sb.Append("A")
ElseIf "A" <= c AndAlso c <= "Z" Then
sb.Append("B")
End If
Next
Dim et = sb.ToString()
sb.Length = 0
For index = 0 To et.Length - 1 Step 5
Dim quintet = et.Substring(index, 5)
Dim key = CODES.Where(Function(a) a.Value = quintet).First().Key
sb.Append(key)
Next
Return sb.ToString()
End Function
Sub Main()
Dim plainText = "the quick brown fox jumps over the lazy dog"
Dim message =
"bacon
"this task is to implement a program for encryption and decryption of " +
"plaintext using the simple alphabet of the baconian cipher or some " +
"other kind of representation of this alphabet (make anything signify anything). " +
"the baconian alphabet may optionally be extended to encode all lower " +
"case characters individually and/or adding a few punctuation characters " +
"such as the space."
Dim cipherText = Encode(plainText, message)
Console.WriteLine("Cipher text ->" & Environment.NewLine & "{0}", cipherText)
Dim decodedText = Decode(cipherText)
Console.WriteLine(Environment.NewLine & "Hidden text ->" & Environment.NewLine & "{0}", decodedText)
End Sub
End Module
|
Transform the following Java implementation into VB, maintaining the same output and logic. | public class Blah {
public static void main(String[] args) {
print2dArray(getSpiralArray(5));
}
public static int[][] getSpiralArray(int dimension) {
int[][] spiralArray = new int[dimension][dimension];
int numConcentricSquares = (int) Math.ceil((dimension) / 2.0);
int j;
int sideLen = dimension;
int currNum = 0;
for (int i = 0; i < numConcentricSquares; i++) {
for (j = 0; j < sideLen; j++) {
spiralArray[i][i + j] = currNum++;
}
for (j = 1; j < sideLen; j++) {
spiralArray[i + j][dimension - 1 - i] = currNum++;
}
for (j = sideLen - 2; j > -1; j--) {
spiralArray[dimension - 1 - i][i + j] = currNum++;
}
for (j = sideLen - 2; j > 0; j--) {
spiralArray[i + j][i] = currNum++;
}
sideLen -= 2;
}
return spiralArray;
}
public static void print2dArray(int[][] array) {
for (int[] row : array) {
for (int elem : row) {
System.out.printf("%3d", elem);
}
System.out.println();
}
}
}
| Function build_spiral(n)
botcol = 0 : topcol = n - 1
botrow = 0 : toprow = n - 1
Dim matrix()
ReDim matrix(topcol,toprow)
dir = 0 : col = 0 : row = 0
For i = 0 To n*n-1
matrix(col,row) = i
Select Case dir
Case 0
If col < topcol Then
col = col + 1
Else
dir = 1 : row = row + 1 : botrow = botrow + 1
End If
Case 1
If row < toprow Then
row = row + 1
Else
dir = 2 : col = col - 1 : topcol = topcol - 1
End If
Case 2
If col > botcol Then
col = col - 1
Else
dir = 3 : row = row - 1 : toprow = toprow - 1
End If
Case 3
If row > botrow Then
row = row - 1
Else
dir = 0 : col = col + 1 : botcol = botcol + 1
End If
End Select
Next
For y = 0 To n-1
For x = 0 To n-1
WScript.StdOut.Write matrix(x,y) & vbTab
Next
WScript.StdOut.WriteLine
Next
End Function
build_spiral(CInt(WScript.Arguments(0)))
|
Keep all operations the same but rewrite the snippet in VB. | module OptionalParameters
{
typedef Type<String >.Orderer as ColumnOrderer;
typedef Type<String[]>.Orderer as RowOrderer;
static String[][] sort(String[][] table,
ColumnOrderer? orderer = Null,
Int column = 0,
Boolean reverse = False,
)
{
orderer ?:= (s1, s2) -> s1 <=> s2;
ColumnOrderer byString = reverse
? ((s1, s2) -> orderer(s1, s2).reversed)
: orderer;
RowOrderer byColumn = (row1, row2) -> byString(row1[column], row2[column]);
return table.sorted(byColumn);
}
void run()
{
String[][] table =
[
["c", "x", "i"],
["a", "y", "p"],
["b", "z", "a"],
];
show("original input", table);
show("by default sort on column 0", sort(table));
show("by column 2", sort(table, column=2));
show("by column 2 reversed", sort(table, column=2, reverse=True));
}
void show(String title, String[][] table)
{
@Inject Console console;
console.print($"{title}:");
for (val row : table)
{
console.print($" {row}");
}
console.print();
}
}
| Private Sub optional_parameters(theRange As String, _
Optional ordering As Integer = 0, _
Optional column As Integer = 1, _
Optional reverse As Integer = 1)
ActiveSheet.Sort.SortFields.Clear
ActiveSheet.Sort.SortFields.Add _
Key:=Range(theRange).Columns(column), _
SortOn:=SortOnValues, _
Order:=reverse, _
DataOption:=ordering
With ActiveSheet.Sort
.SetRange Range(theRange)
.Header = xlGuess
.MatchCase = False
.Orientation = xlTopToBottom
.SortMethod = xlPinYin
.Apply
End With
End Sub
Public Sub main()
optional_parameters theRange:="A1:C4", ordering:=1, column:=2, reverse:=1
End Sub
|
Change the following Java code into VB without altering its purpose. | public class JNIDemo
{
static
{ System.loadLibrary("JNIDemo"); }
public static void main(String[] args)
{
System.out.println(callStrdup("Hello World!"));
}
private static native String callStrdup(String s);
}
| Declare Function CreateFileW Lib "Kernel32" (FileName As WString, DesiredAccess As Integer, ShareMode As Integer, SecurityAttributes As Integer, _
CreateDisposition As Integer, Flags As Integer, Template As Integer) As Integer
Declare Function WriteFile Lib "Kernel32" (fHandle As Integer, writeData As Ptr, numOfBytes As Integer, ByRef numOfBytesWritten As Integer, _
overlapped As Ptr) As Boolean
Declare Function GetLastError Lib "Kernel32" () As Integer
Declare Function CloseHandle Lib "kernel32" (hObject As Integer) As Boolean
Const FILE_SHARE_READ = &h00000001
Const FILE_SHARE_WRITE = &h00000002
Const OPEN_EXISTING = 3
Dim fHandle As Integer = CreateFileW("C:\foo.txt", 0, FILE_SHARE_READ Or FILE_SHARE_WRITE, 0, OPEN_EXISTING, 0, 0)
If fHandle > 0 Then
Dim mb As MemoryBlock = "Hello, World!"
Dim bytesWritten As Integer
If Not WriteFile(fHandle, mb, mb.Size, bytesWritten, Nil) Then
MsgBox("Error Number: " + Str(GetLastError))
End If
Call CloseHandle(fHandle)
Else
MsgBox("Error Number: " + Str(GetLastError))
End If
|
Translate the given Java code snippet into VB without altering its behavior. | import java.math.BigDecimal;
import java.math.MathContext;
import java.util.Arrays;
import java.util.stream.LongStream;
public class FaulhabersTriangle {
private static final MathContext MC = new MathContext(256);
private static long gcd(long a, long b) {
if (b == 0) {
return a;
}
return gcd(b, a % b);
}
private static class Frac implements Comparable<Frac> {
private long num;
private long denom;
public static final Frac ZERO = new Frac(0, 1);
public Frac(long n, long d) {
if (d == 0) throw new IllegalArgumentException("d must not be zero");
long nn = n;
long dd = d;
if (nn == 0) {
dd = 1;
} else if (dd < 0) {
nn = -nn;
dd = -dd;
}
long g = Math.abs(gcd(nn, dd));
if (g > 1) {
nn /= g;
dd /= g;
}
num = nn;
denom = dd;
}
public Frac plus(Frac rhs) {
return new Frac(num * rhs.denom + denom * rhs.num, rhs.denom * denom);
}
public Frac unaryMinus() {
return new Frac(-num, denom);
}
public Frac minus(Frac rhs) {
return this.plus(rhs.unaryMinus());
}
public Frac times(Frac rhs) {
return new Frac(this.num * rhs.num, this.denom * rhs.denom);
}
@Override
public int compareTo(Frac o) {
double diff = toDouble() - o.toDouble();
return Double.compare(diff, 0.0);
}
@Override
public boolean equals(Object obj) {
return null != obj && obj instanceof Frac && this.compareTo((Frac) obj) == 0;
}
@Override
public String toString() {
if (denom == 1) {
return Long.toString(num);
}
return String.format("%d/%d", num, denom);
}
public double toDouble() {
return (double) num / denom;
}
public BigDecimal toBigDecimal() {
return BigDecimal.valueOf(num).divide(BigDecimal.valueOf(denom), MC);
}
}
private static Frac bernoulli(int n) {
if (n < 0) throw new IllegalArgumentException("n may not be negative or zero");
Frac[] a = new Frac[n + 1];
Arrays.fill(a, Frac.ZERO);
for (int m = 0; m <= n; ++m) {
a[m] = new Frac(1, m + 1);
for (int j = m; j >= 1; --j) {
a[j - 1] = a[j - 1].minus(a[j]).times(new Frac(j, 1));
}
}
if (n != 1) return a[0];
return a[0].unaryMinus();
}
private static long binomial(int n, int k) {
if (n < 0 || k < 0 || n < k) throw new IllegalArgumentException();
if (n == 0 || k == 0) return 1;
long num = LongStream.rangeClosed(k + 1, n).reduce(1, (a, b) -> a * b);
long den = LongStream.rangeClosed(2, n - k).reduce(1, (acc, i) -> acc * i);
return num / den;
}
private static Frac[] faulhaberTriangle(int p) {
Frac[] coeffs = new Frac[p + 1];
Arrays.fill(coeffs, Frac.ZERO);
Frac q = new Frac(1, p + 1);
int sign = -1;
for (int j = 0; j <= p; ++j) {
sign *= -1;
coeffs[p - j] = q.times(new Frac(sign, 1)).times(new Frac(binomial(p + 1, j), 1)).times(bernoulli(j));
}
return coeffs;
}
public static void main(String[] args) {
for (int i = 0; i <= 9; ++i) {
Frac[] coeffs = faulhaberTriangle(i);
for (Frac coeff : coeffs) {
System.out.printf("%5s ", coeff);
}
System.out.println();
}
System.out.println();
int k = 17;
Frac[] cc = faulhaberTriangle(k);
int n = 1000;
BigDecimal nn = BigDecimal.valueOf(n);
BigDecimal np = BigDecimal.ONE;
BigDecimal sum = BigDecimal.ZERO;
for (Frac c : cc) {
np = np.multiply(nn);
sum = sum.add(np.multiply(c.toBigDecimal()));
}
System.out.println(sum.toBigInteger());
}
}
| Module Module1
Class Frac
Private ReadOnly num As Long
Private ReadOnly denom As Long
Public Shared ReadOnly ZERO = New Frac(0, 1)
Public Shared ReadOnly ONE = New Frac(1, 1)
Public Sub New(n As Long, d As Long)
If d = 0 Then
Throw New ArgumentException("d must not be zero")
End If
Dim nn = n
Dim dd = d
If nn = 0 Then
dd = 1
ElseIf dd < 0 Then
nn = -nn
dd = -dd
End If
Dim g = Math.Abs(Gcd(nn, dd))
If g > 1 Then
nn /= g
dd /= g
End If
num = nn
denom = dd
End Sub
Private Shared Function Gcd(a As Long, b As Long) As Long
If b = 0 Then
Return a
Else
Return Gcd(b, a Mod b)
End If
End Function
Public Shared Operator -(self As Frac) As Frac
Return New Frac(-self.num, self.denom)
End Operator
Public Shared Operator +(lhs As Frac, rhs As Frac) As Frac
Return New Frac(lhs.num * rhs.denom + lhs.denom * rhs.num, rhs.denom * lhs.denom)
End Operator
Public Shared Operator -(lhs As Frac, rhs As Frac) As Frac
Return lhs + -rhs
End Operator
Public Shared Operator *(lhs As Frac, rhs As Frac) As Frac
Return New Frac(lhs.num * rhs.num, lhs.denom * rhs.denom)
End Operator
Public Shared Operator <(lhs As Frac, rhs As Frac) As Boolean
Dim x = lhs.num / lhs.denom
Dim y = rhs.num / rhs.denom
Return x < y
End Operator
Public Shared Operator >(lhs As Frac, rhs As Frac) As Boolean
Dim x = lhs.num / lhs.denom
Dim y = rhs.num / rhs.denom
Return x > y
End Operator
Public Shared Operator =(lhs As Frac, rhs As Frac) As Boolean
Return lhs.num = rhs.num AndAlso lhs.denom = rhs.denom
End Operator
Public Shared Operator <>(lhs As Frac, rhs As Frac) As Boolean
Return lhs.num <> rhs.num OrElse lhs.denom <> rhs.denom
End Operator
Public Overrides Function ToString() As String
If denom = 1 Then
Return num.ToString
Else
Return String.Format("{0}/{1}", num, denom)
End If
End Function
Public Overrides Function Equals(obj As Object) As Boolean
Dim frac = CType(obj, Frac)
Return Not IsNothing(frac) AndAlso num = frac.num AndAlso denom = frac.denom
End Function
End Class
Function Bernoulli(n As Integer) As Frac
If n < 0 Then
Throw New ArgumentException("n may not be negative or zero")
End If
Dim a(n + 1) As Frac
For m = 0 To n
a(m) = New Frac(1, m + 1)
For j = m To 1 Step -1
a(j - 1) = (a(j - 1) - a(j)) * New Frac(j, 1)
Next
Next
If n <> 1 Then
Return a(0)
Else
Return -a(0)
End If
End Function
Function Binomial(n As Integer, k As Integer) As Integer
If n < 0 OrElse k < 0 OrElse n < k Then
Throw New ArgumentException()
End If
If n = 0 OrElse k = 0 Then
Return 1
End If
Dim num = 1
For i = k + 1 To n
num *= i
Next
Dim denom = 1
For i = 2 To n - k
denom *= i
Next
Return num \ denom
End Function
Function FaulhaberTriangle(p As Integer) As Frac()
Dim coeffs(p + 1) As Frac
For i = 1 To p + 1
coeffs(i - 1) = Frac.ZERO
Next
Dim q As New Frac(1, p + 1)
Dim sign = -1
For j = 0 To p
sign *= -1
coeffs(p - j) = q * New Frac(sign, 1) * New Frac(Binomial(p + 1, j), 1) * Bernoulli(j)
Next
Return coeffs
End Function
Sub Main()
For i = 1 To 10
Dim coeffs = FaulhaberTriangle(i - 1)
For Each coeff In coeffs
Console.Write("{0,5} ", coeff)
Next
Console.WriteLine()
Next
End Sub
End Module
|
Write the same code in VB as shown below in Java. | public class Arguments {
public static void main(String[] args) {
System.out.println("There are " + args.length + " arguments given.");
for(int i = 0; i < args.length; i++)
System.out.println("The argument #" + (i+1) + " is " + args[i] + " and is at index " + i);
}
}
| Function Run(args() as String) As Integer
For each arg As String In args
Stdout.WriteLine(arg)
Next
End Function
|
Write the same algorithm in VB as shown in this Java implementation. | public class Arguments {
public static void main(String[] args) {
System.out.println("There are " + args.length + " arguments given.");
for(int i = 0; i < args.length; i++)
System.out.println("The argument #" + (i+1) + " is " + args[i] + " and is at index " + i);
}
}
| Function Run(args() as String) As Integer
For each arg As String In args
Stdout.WriteLine(arg)
Next
End Function
|
Translate the given Java code snippet into VB without altering its behavior. | public class Arguments {
public static void main(String[] args) {
System.out.println("There are " + args.length + " arguments given.");
for(int i = 0; i < args.length; i++)
System.out.println("The argument #" + (i+1) + " is " + args[i] + " and is at index " + i);
}
}
| Function Run(args() as String) As Integer
For each arg As String In args
Stdout.WriteLine(arg)
Next
End Function
|
Translate this program into VB but keep the logic exactly as in Java. | String[] fruits = ["apples", "oranges"];
String[] grains = ["wheat", "corn"];
String[] all = fruits + grains;
| DEFINT A(1 to 4) = {1, 2, 3, 4}
DEFINT B(1 to 4) = {10, 20, 30, 40}
Redim A(1 to 8) as integer
MEMCPY(varptr(A(5)), varptr(B(1)), Sizeof(integer)*4)
|
Convert the following code from Java to VB, ensuring the logic remains intact. | String[] fruits = ["apples", "oranges"];
String[] grains = ["wheat", "corn"];
String[] all = fruits + grains;
| DEFINT A(1 to 4) = {1, 2, 3, 4}
DEFINT B(1 to 4) = {10, 20, 30, 40}
Redim A(1 to 8) as integer
MEMCPY(varptr(A(5)), varptr(B(1)), Sizeof(integer)*4)
|
Produce a functionally identical VB code for the snippet given in Java. | import java.util.Scanner;
public class GetInput {
public static void main(String[] args) throws Exception {
Scanner s = new Scanner(System.in);
System.out.print("Enter a string: ");
String str = s.nextLine();
System.out.print("Enter an integer: ");
int i = Integer.parseInt(s.next());
}
}
| Public Sub text()
Debug.Print InputBox("Input a string")
Debug.Print InputBox("Input the integer 75000", "Input an integer", 75000, Context = "Long")
End Sub
|
Convert this Java block to VB, preserving its control flow and logic. |
import processing.sound.*;
float[] frequencies = {261.63, 293.66, 329.63, 349.23, 392.00, 440.00, 493.88, 523.25};
SinOsc sine;
size(500,500);
sine = new SinOsc(this);
for(int i=0;i<frequencies.length;i++){
sine.freq(frequencies[i]);
sine.play();
delay(500);
}
| Option Explicit
Declare Function Beep Lib "kernel32" (ByVal Freq As Long, ByVal Dur As Long) As Long
Sub Musical_Scale()
Dim Fqs, i As Integer
Fqs = Array(264, 297, 330, 352, 396, 440, 495, 528)
For i = LBound(Fqs) To UBound(Fqs)
Beep Fqs(i), 500
Next
End Sub
|
Preserve the algorithm and functionality while converting the code from Java to VB. |
import processing.sound.*;
float[] frequencies = {261.63, 293.66, 329.63, 349.23, 392.00, 440.00, 493.88, 523.25};
SinOsc sine;
size(500,500);
sine = new SinOsc(this);
for(int i=0;i<frequencies.length;i++){
sine.freq(frequencies[i]);
sine.play();
delay(500);
}
| Option Explicit
Declare Function Beep Lib "kernel32" (ByVal Freq As Long, ByVal Dur As Long) As Long
Sub Musical_Scale()
Dim Fqs, i As Integer
Fqs = Array(264, 297, 330, 352, 396, 440, 495, 528)
For i = LBound(Fqs) To UBound(Fqs)
Beep Fqs(i), 500
Next
End Sub
|
Port the provided Java code into VB while preserving the original functionality. | package hu.pj.alg.test;
import hu.pj.alg.ZeroOneKnapsack;
import hu.pj.obj.Item;
import java.util.*;
import java.text.*;
public class ZeroOneKnapsackForTourists {
public ZeroOneKnapsackForTourists() {
ZeroOneKnapsack zok = new ZeroOneKnapsack(400);
zok.add("map", 9, 150);
zok.add("compass", 13, 35);
zok.add("water", 153, 200);
zok.add("sandwich", 50, 160);
zok.add("glucose", 15, 60);
zok.add("tin", 68, 45);
zok.add("banana", 27, 60);
zok.add("apple", 39, 40);
zok.add("cheese", 23, 30);
zok.add("beer", 52, 10);
zok.add("suntan cream", 11, 70);
zok.add("camera", 32, 30);
zok.add("t-shirt", 24, 15);
zok.add("trousers", 48, 10);
zok.add("umbrella", 73, 40);
zok.add("waterproof trousers", 42, 70);
zok.add("waterproof overclothes", 43, 75);
zok.add("note-case", 22, 80);
zok.add("sunglasses", 7, 20);
zok.add("towel", 18, 12);
zok.add("socks", 4, 50);
zok.add("book", 30, 10);
List<Item> itemList = zok.calcSolution();
if (zok.isCalculated()) {
NumberFormat nf = NumberFormat.getInstance();
System.out.println(
"Maximal weight = " +
nf.format(zok.getMaxWeight() / 100.0) + " kg"
);
System.out.println(
"Total weight of solution = " +
nf.format(zok.getSolutionWeight() / 100.0) + " kg"
);
System.out.println(
"Total value = " +
zok.getProfit()
);
System.out.println();
System.out.println(
"You can carry the following materials " +
"in the knapsack:"
);
for (Item item : itemList) {
if (item.getInKnapsack() == 1) {
System.out.format(
"%1$-23s %2$-3s %3$-5s %4$-15s \n",
item.getName(),
item.getWeight(), "dag ",
"(value = " + item.getValue() + ")"
);
}
}
} else {
System.out.println(
"The problem is not solved. " +
"Maybe you gave wrong data."
);
}
}
public static void main(String[] args) {
new ZeroOneKnapsackForTourists();
}
}
|
Option Explicit
Const maxWeight = 400
Dim DataList As Variant
Dim xList(64, 3) As Variant
Dim nItems As Integer
Dim s As String, xss As String
Dim xwei As Integer, xval As Integer, nn As Integer
Sub Main()
Dim i As Integer, j As Integer
DataList = Array("map", 9, 150, "compass", 13, 35, "water", 153, 200, "sandwich", 50, 160, _
"glucose", 15, 60, "tin", 68, 45, "banana", 27, 60, "apple", 39, 40, _
"cheese", 23, 30, "beer", 52, 10, "suntan cream", 11, 70, "camera", 32, 30, _
"T-shirt", 24, 15, "trousers", 48, 10, "umbrella", 73, 40, "book", 30, 10, _
"waterproof trousers", 42, 70, "waterproof overclothes", 43, 75, _
"note-case", 22, 80, "sunglasses", 7, 20, "towel", 18, 12, "socks", 4, 50)
nItems = (UBound(DataList) + 1) / 3
j = 0
For i = 1 To nItems
xList(i, 1) = DataList(j)
xList(i, 2) = DataList(j + 1)
xList(i, 3) = DataList(j + 2)
j = j + 3
Next i
s = ""
For i = 1 To nItems
s = s & Chr(i)
Next
nn = 0
Call ChoiceBin(1, "")
For i = 1 To Len(xss)
j = Asc(Mid(xss, i, 1))
Debug.Print xList(j, 1)
Next i
Debug.Print "count=" & Len(xss), "weight=" & xwei, "value=" & xval
End Sub
Private Sub ChoiceBin(n As String, ss As String)
Dim r As String
Dim i As Integer, j As Integer, iwei As Integer, ival As Integer
Dim ipct As Integer
If n = Len(s) + 1 Then
iwei = 0: ival = 0
For i = 1 To Len(ss)
j = Asc(Mid(ss, i, 1))
iwei = iwei + xList(j, 2)
ival = ival + xList(j, 3)
Next
If iwei <= maxWeight And ival > xval Then
xss = ss: xwei = iwei: xval = ival
End If
Else
r = Mid(s, n, 1)
Call ChoiceBin(n + 1, ss & r)
Call ChoiceBin(n + 1, ss)
End If
End Sub
|
Port the provided Java code into VB while preserving the original functionality. | package hu.pj.alg.test;
import hu.pj.alg.ZeroOneKnapsack;
import hu.pj.obj.Item;
import java.util.*;
import java.text.*;
public class ZeroOneKnapsackForTourists {
public ZeroOneKnapsackForTourists() {
ZeroOneKnapsack zok = new ZeroOneKnapsack(400);
zok.add("map", 9, 150);
zok.add("compass", 13, 35);
zok.add("water", 153, 200);
zok.add("sandwich", 50, 160);
zok.add("glucose", 15, 60);
zok.add("tin", 68, 45);
zok.add("banana", 27, 60);
zok.add("apple", 39, 40);
zok.add("cheese", 23, 30);
zok.add("beer", 52, 10);
zok.add("suntan cream", 11, 70);
zok.add("camera", 32, 30);
zok.add("t-shirt", 24, 15);
zok.add("trousers", 48, 10);
zok.add("umbrella", 73, 40);
zok.add("waterproof trousers", 42, 70);
zok.add("waterproof overclothes", 43, 75);
zok.add("note-case", 22, 80);
zok.add("sunglasses", 7, 20);
zok.add("towel", 18, 12);
zok.add("socks", 4, 50);
zok.add("book", 30, 10);
List<Item> itemList = zok.calcSolution();
if (zok.isCalculated()) {
NumberFormat nf = NumberFormat.getInstance();
System.out.println(
"Maximal weight = " +
nf.format(zok.getMaxWeight() / 100.0) + " kg"
);
System.out.println(
"Total weight of solution = " +
nf.format(zok.getSolutionWeight() / 100.0) + " kg"
);
System.out.println(
"Total value = " +
zok.getProfit()
);
System.out.println();
System.out.println(
"You can carry the following materials " +
"in the knapsack:"
);
for (Item item : itemList) {
if (item.getInKnapsack() == 1) {
System.out.format(
"%1$-23s %2$-3s %3$-5s %4$-15s \n",
item.getName(),
item.getWeight(), "dag ",
"(value = " + item.getValue() + ")"
);
}
}
} else {
System.out.println(
"The problem is not solved. " +
"Maybe you gave wrong data."
);
}
}
public static void main(String[] args) {
new ZeroOneKnapsackForTourists();
}
}
|
Option Explicit
Const maxWeight = 400
Dim DataList As Variant
Dim xList(64, 3) As Variant
Dim nItems As Integer
Dim s As String, xss As String
Dim xwei As Integer, xval As Integer, nn As Integer
Sub Main()
Dim i As Integer, j As Integer
DataList = Array("map", 9, 150, "compass", 13, 35, "water", 153, 200, "sandwich", 50, 160, _
"glucose", 15, 60, "tin", 68, 45, "banana", 27, 60, "apple", 39, 40, _
"cheese", 23, 30, "beer", 52, 10, "suntan cream", 11, 70, "camera", 32, 30, _
"T-shirt", 24, 15, "trousers", 48, 10, "umbrella", 73, 40, "book", 30, 10, _
"waterproof trousers", 42, 70, "waterproof overclothes", 43, 75, _
"note-case", 22, 80, "sunglasses", 7, 20, "towel", 18, 12, "socks", 4, 50)
nItems = (UBound(DataList) + 1) / 3
j = 0
For i = 1 To nItems
xList(i, 1) = DataList(j)
xList(i, 2) = DataList(j + 1)
xList(i, 3) = DataList(j + 2)
j = j + 3
Next i
s = ""
For i = 1 To nItems
s = s & Chr(i)
Next
nn = 0
Call ChoiceBin(1, "")
For i = 1 To Len(xss)
j = Asc(Mid(xss, i, 1))
Debug.Print xList(j, 1)
Next i
Debug.Print "count=" & Len(xss), "weight=" & xwei, "value=" & xval
End Sub
Private Sub ChoiceBin(n As String, ss As String)
Dim r As String
Dim i As Integer, j As Integer, iwei As Integer, ival As Integer
Dim ipct As Integer
If n = Len(s) + 1 Then
iwei = 0: ival = 0
For i = 1 To Len(ss)
j = Asc(Mid(ss, i, 1))
iwei = iwei + xList(j, 2)
ival = ival + xList(j, 3)
Next
If iwei <= maxWeight And ival > xval Then
xss = ss: xwei = iwei: xval = ival
End If
Else
r = Mid(s, n, 1)
Call ChoiceBin(n + 1, ss & r)
Call ChoiceBin(n + 1, ss)
End If
End Sub
|
Write the same algorithm in VB as shown in this Java implementation. | import java.io.*;
import java.util.*;
public class PrimeDescendants {
public static void main(String[] args) {
try (Writer writer = new BufferedWriter(new OutputStreamWriter(System.out))) {
printPrimeDesc(writer, 100);
} catch (IOException ex) {
ex.printStackTrace();
}
}
private static void printPrimeDesc(Writer writer, int limit) throws IOException {
List<Long> primes = findPrimes(limit);
List<Long> ancestor = new ArrayList<>(limit);
List<List<Long>> descendants = new ArrayList<>(limit);
for (int i = 0; i < limit; ++i) {
ancestor.add(Long.valueOf(0));
descendants.add(new ArrayList<Long>());
}
for (Long prime : primes) {
int p = prime.intValue();
descendants.get(p).add(prime);
for (int i = 0; i + p < limit; ++i) {
int s = i + p;
for (Long n : descendants.get(i)) {
Long prod = n * p;
descendants.get(s).add(prod);
if (prod < limit)
ancestor.set(prod.intValue(), Long.valueOf(s));
}
}
}
int totalDescendants = 0;
for (int i = 1; i < limit; ++i) {
List<Long> ancestors = getAncestors(ancestor, i);
writer.write("[" + i + "] Level: " + ancestors.size() + "\n");
writer.write("Ancestors: ");
Collections.sort(ancestors);
print(writer, ancestors);
writer.write("Descendants: ");
List<Long> desc = descendants.get(i);
if (!desc.isEmpty()) {
Collections.sort(desc);
if (desc.get(0) == i)
desc.remove(0);
}
writer.write(desc.size() + "\n");
totalDescendants += desc.size();
if (!desc.isEmpty())
print(writer, desc);
writer.write("\n");
}
writer.write("Total descendants: " + totalDescendants + "\n");
}
private static List<Long> findPrimes(int limit) {
boolean[] isprime = new boolean[limit];
Arrays.fill(isprime, true);
isprime[0] = isprime[1] = false;
for (int p = 2; p * p < limit; ++p) {
if (isprime[p]) {
for (int i = p * p; i < limit; i += p)
isprime[i] = false;
}
}
List<Long> primes = new ArrayList<>();
for (int p = 2; p < limit; ++p) {
if (isprime[p])
primes.add(Long.valueOf(p));
}
return primes;
}
private static List<Long> getAncestors(List<Long> ancestor, int n) {
List<Long> result = new ArrayList<>();
for (Long a = ancestor.get(n); a != 0 && a != n; ) {
n = a.intValue();
a = ancestor.get(n);
result.add(Long.valueOf(n));
}
return result;
}
private static void print(Writer writer, List<Long> list) throws IOException {
if (list.isEmpty()) {
writer.write("none\n");
return;
}
int i = 0;
writer.write(String.valueOf(list.get(i++)));
for (; i != list.size(); ++i)
writer.write(", " + list.get(i));
writer.write("\n");
}
}
| Imports System.Math
Module Module1
Const MAXPRIME = 99
Const MAXPARENT = 99
Const NBRCHILDREN = 547100
Public Primes As New Collection()
Public PrimesR As New Collection()
Public Ancestors As New Collection()
Public Parents(MAXPARENT + 1) As Integer
Public CptDescendants(MAXPARENT + 1) As Integer
Public Children(NBRCHILDREN) As ChildStruct
Public iChildren As Integer
Public Delimiter As String = ", "
Public Structure ChildStruct
Public Child As Long
Public pLower As Integer
Public pHigher As Integer
End Structure
Sub Main()
Dim Parent As Short
Dim Sum As Short
Dim i As Short
Dim TotDesc As Integer = 0
Dim MidPrime As Integer
If GetPrimes(Primes, MAXPRIME) = vbFalse Then
Return
End If
For i = Primes.Count To 1 Step -1
PrimesR.Add(Primes.Item(i))
Next
MidPrime = PrimesR.Item(1) / 2
For Each Prime In PrimesR
Parents(Prime) = InsertChild(Parents(Prime), Prime)
CptDescendants(Prime) += 1
If Prime > MidPrime Then
Continue For
End If
For Parent = 1 To MAXPARENT
Sum = Parent + Prime
If Sum > MAXPARENT Then
Exit For
End If
If Parents(Parent) Then
InsertPreorder(Parents(Parent), Sum, Prime)
CptDescendants(Sum) += CptDescendants(Parent)
End If
Next
Next
RemoveFalseChildren()
If MAXPARENT > MAXPRIME Then
If GetPrimes(Primes, MAXPARENT) = vbFalse Then
Return
End If
End If
FileOpen(1, "Ancestors.txt", OpenMode.Output)
For Parent = 1 To MAXPARENT
GetAncestors(Parent)
PrintLine(1, "[" & Parent.ToString & "] Level: " & Ancestors.Count.ToString)
If Ancestors.Count Then
Print(1, "Ancestors: " & Ancestors.Item(1).ToString)
For i = 2 To Ancestors.Count
Print(1, ", " & Ancestors.Item(i).ToString)
Next
PrintLine(1)
Ancestors.Clear()
Else
PrintLine(1, "Ancestors: None")
End If
If CptDescendants(Parent) Then
PrintLine(1, "Descendants: " & CptDescendants(Parent).ToString)
Delimiter = ""
PrintDescendants(Parents(Parent))
PrintLine(1)
TotDesc += CptDescendants(Parent)
Else
PrintLine(1, "Descendants: None")
End If
PrintLine(1)
Next
Primes.Clear()
PrimesR.Clear()
PrintLine(1, "Total descendants " & TotDesc.ToString)
PrintLine(1)
FileClose(1)
End Sub
Function InsertPreorder(_index As Integer, _sum As Short, _prime As Short)
Parents(_sum) = InsertChild(Parents(_sum), Children(_index).Child * _prime)
If Children(_index).pLower Then
InsertPreorder(Children(_index).pLower, _sum, _prime)
End If
If Children(_index).pHigher Then
InsertPreorder(Children(_index).pHigher, _sum, _prime)
End If
Return Nothing
End Function
Function InsertChild(_index As Integer, _child As Long) As Integer
If _index Then
If _child <= Children(_index).Child Then
Children(_index).pLower = InsertChild(Children(_index).pLower, _child)
Else
Children(_index).pHigher = InsertChild(Children(_index).pHigher, _child)
End If
Else
iChildren += 1
_index = iChildren
Children(_index).Child = _child
Children(_index).pLower = 0
Children(_index).pHigher = 0
End If
Return _index
End Function
Function RemoveFalseChildren()
Dim Exclusions As New Collection
Exclusions.Add(4)
For Each Prime In Primes
Exclusions.Add(Prime)
Next
For Each ex In Exclusions
Parents(ex) = Children(Parents(ex)).pHigher
CptDescendants(ex) -= 1
Next
Exclusions.Clear()
Return Nothing
End Function
Function GetAncestors(_child As Short)
Dim Child As Short = _child
Dim Parent As Short = 0
For Each Prime In Primes
If Child = 1 Then
Exit For
End If
While Child Mod Prime = 0
Child /= Prime
Parent += Prime
End While
Next
If Parent = _child Or _child = 1 Then
Return Nothing
End If
GetAncestors(Parent)
Ancestors.Add(Parent)
Return Nothing
End Function
Function PrintDescendants(_index As Integer)
If Children(_index).pLower Then
PrintDescendants(Children(_index).pLower)
End If
Print(1, Delimiter.ToString & Children(_index).Child.ToString)
Delimiter = ", "
If Children(_index).pHigher Then
PrintDescendants(Children(_index).pHigher)
End If
Return Nothing
End Function
Function GetPrimes(ByRef _primes As Object, Optional _maxPrime As Integer = 2) As Boolean
Dim Value As Integer = 3
Dim Max As Integer
Dim Prime As Integer
If _maxPrime < 2 Then
Return vbFalse
End If
_primes.Add(2)
While Value <= _maxPrime
Max = Floor(Sqrt(Value))
For Each Prime In _primes
If Prime > Max Then
_primes.Add(Value)
Exit For
End If
If Value Mod Prime = 0 Then
Exit For
End If
Next
Value += 2
End While
Return vbTrue
End Function
End Module
|
Write a version of this Java function in VB with identical behavior. | import static java.util.Arrays.asList;
import static java.util.Collections.emptyList;
import static java.util.Optional.of;
import static java.util.stream.Collectors.toList;
import java.util.List;
public class CartesianProduct {
public List<?> product(List<?>... a) {
if (a.length >= 2) {
List<?> product = a[0];
for (int i = 1; i < a.length; i++) {
product = product(product, a[i]);
}
return product;
}
return emptyList();
}
private <A, B> List<?> product(List<A> a, List<B> b) {
return of(a.stream()
.map(e1 -> of(b.stream().map(e2 -> asList(e1, e2)).collect(toList())).orElse(emptyList()))
.flatMap(List::stream)
.collect(toList())).orElse(emptyList());
}
}
| Imports System.Runtime.CompilerServices
Module Module1
<Extension()>
Function CartesianProduct(Of T)(sequences As IEnumerable(Of IEnumerable(Of T))) As IEnumerable(Of IEnumerable(Of T))
Dim emptyProduct As IEnumerable(Of IEnumerable(Of T)) = {Enumerable.Empty(Of T)}
Return sequences.Aggregate(emptyProduct, Function(accumulator, sequence) From acc In accumulator From item In sequence Select acc.Concat({item}))
End Function
Sub Main()
Dim empty(-1) As Integer
Dim list1 = {1, 2}
Dim list2 = {3, 4}
Dim list3 = {1776, 1789}
Dim list4 = {7, 12}
Dim list5 = {4, 14, 23}
Dim list6 = {0, 1}
Dim list7 = {1, 2, 3}
Dim list8 = {30}
Dim list9 = {500, 100}
For Each sequnceList As Integer()() In {
({list1, list2}),
({list2, list1}),
({list1, empty}),
({empty, list1}),
({list3, list4, list5, list6}),
({list7, list8, list9}),
({list7, empty, list9})
}
Dim cart = sequnceList.CartesianProduct().Select(Function(tuple) $"({String.Join(", ", tuple)})")
Console.WriteLine($"{{{String.Join(", ", cart)}}}")
Next
End Sub
End Module
|
Convert this Java block to VB, preserving its control flow and logic. | import static java.util.Arrays.asList;
import static java.util.Collections.emptyList;
import static java.util.Optional.of;
import static java.util.stream.Collectors.toList;
import java.util.List;
public class CartesianProduct {
public List<?> product(List<?>... a) {
if (a.length >= 2) {
List<?> product = a[0];
for (int i = 1; i < a.length; i++) {
product = product(product, a[i]);
}
return product;
}
return emptyList();
}
private <A, B> List<?> product(List<A> a, List<B> b) {
return of(a.stream()
.map(e1 -> of(b.stream().map(e2 -> asList(e1, e2)).collect(toList())).orElse(emptyList()))
.flatMap(List::stream)
.collect(toList())).orElse(emptyList());
}
}
| Imports System.Runtime.CompilerServices
Module Module1
<Extension()>
Function CartesianProduct(Of T)(sequences As IEnumerable(Of IEnumerable(Of T))) As IEnumerable(Of IEnumerable(Of T))
Dim emptyProduct As IEnumerable(Of IEnumerable(Of T)) = {Enumerable.Empty(Of T)}
Return sequences.Aggregate(emptyProduct, Function(accumulator, sequence) From acc In accumulator From item In sequence Select acc.Concat({item}))
End Function
Sub Main()
Dim empty(-1) As Integer
Dim list1 = {1, 2}
Dim list2 = {3, 4}
Dim list3 = {1776, 1789}
Dim list4 = {7, 12}
Dim list5 = {4, 14, 23}
Dim list6 = {0, 1}
Dim list7 = {1, 2, 3}
Dim list8 = {30}
Dim list9 = {500, 100}
For Each sequnceList As Integer()() In {
({list1, list2}),
({list2, list1}),
({list1, empty}),
({empty, list1}),
({list3, list4, list5, list6}),
({list7, list8, list9}),
({list7, empty, list9})
}
Dim cart = sequnceList.CartesianProduct().Select(Function(tuple) $"({String.Join(", ", tuple)})")
Console.WriteLine($"{{{String.Join(", ", cart)}}}")
Next
End Sub
End Module
|
Port the provided Java code into VB while preserving the original functionality. | import static java.util.Arrays.asList;
import static java.util.Collections.emptyList;
import static java.util.Optional.of;
import static java.util.stream.Collectors.toList;
import java.util.List;
public class CartesianProduct {
public List<?> product(List<?>... a) {
if (a.length >= 2) {
List<?> product = a[0];
for (int i = 1; i < a.length; i++) {
product = product(product, a[i]);
}
return product;
}
return emptyList();
}
private <A, B> List<?> product(List<A> a, List<B> b) {
return of(a.stream()
.map(e1 -> of(b.stream().map(e2 -> asList(e1, e2)).collect(toList())).orElse(emptyList()))
.flatMap(List::stream)
.collect(toList())).orElse(emptyList());
}
}
| Imports System.Runtime.CompilerServices
Module Module1
<Extension()>
Function CartesianProduct(Of T)(sequences As IEnumerable(Of IEnumerable(Of T))) As IEnumerable(Of IEnumerable(Of T))
Dim emptyProduct As IEnumerable(Of IEnumerable(Of T)) = {Enumerable.Empty(Of T)}
Return sequences.Aggregate(emptyProduct, Function(accumulator, sequence) From acc In accumulator From item In sequence Select acc.Concat({item}))
End Function
Sub Main()
Dim empty(-1) As Integer
Dim list1 = {1, 2}
Dim list2 = {3, 4}
Dim list3 = {1776, 1789}
Dim list4 = {7, 12}
Dim list5 = {4, 14, 23}
Dim list6 = {0, 1}
Dim list7 = {1, 2, 3}
Dim list8 = {30}
Dim list9 = {500, 100}
For Each sequnceList As Integer()() In {
({list1, list2}),
({list2, list1}),
({list1, empty}),
({empty, list1}),
({list3, list4, list5, list6}),
({list7, list8, list9}),
({list7, empty, list9})
}
Dim cart = sequnceList.CartesianProduct().Select(Function(tuple) $"({String.Join(", ", tuple)})")
Console.WriteLine($"{{{String.Join(", ", cart)}}}")
Next
End Sub
End Module
|
Write the same code in VB as shown below in Java. | import java.util.Collections;
import java.util.LinkedList;
import java.util.List;
public class Proper{
public static List<Integer> properDivs(int n){
List<Integer> divs = new LinkedList<Integer>();
if(n == 1) return divs;
divs.add(1);
for(int x = 2; x < n; x++){
if(n % x == 0) divs.add(x);
}
Collections.sort(divs);
return divs;
}
public static void main(String[] args){
for(int x = 1; x <= 10; x++){
System.out.println(x + ": " + properDivs(x));
}
int x = 0, count = 0;
for(int n = 1; n <= 20000; n++){
if(properDivs(n).size() > count){
x = n;
count = properDivs(n).size();
}
}
System.out.println(x + ": " + count);
}
}
| dim _proper_divisors(100)
sub proper_divisors(n)
dim i
dim _proper_divisors_count = 0
if n <> 1 then
for i = 1 to (n \ 2)
if n %% i = 0 then
_proper_divisors_count = _proper_divisors_count + 1
_proper_divisors(_proper_divisors_count) = i
end if
next
end if
return _proper_divisors_count
end sub
sub show_proper_divisors(n, tabbed)
dim cnt = proper_divisors(n)
print str$(n) + ":"; tab(4);"(" + str$(cnt) + " items) ";
dim j
for j = 1 to cnt
if tabbed then
print str$(_proper_divisors(j)),
else
print str$(_proper_divisors(j));
end if
if (j < cnt) then print ",";
next
print
end sub
dim i
for i = 1 to 10
show_proper_divisors(i, false)
next
dim c
dim maxindex = 0
dim maxlength = 0
for t = 1 to 20000
c = proper_divisors(t)
if c > maxlength then
maxindex = t
maxlength = c
end if
next
print "A maximum at ";
show_proper_divisors(maxindex, false)
|
Keep all operations the same but rewrite the snippet in VB. | import java.io.StringWriter;
import javax.xml.parsers.DocumentBuilderFactory;
import javax.xml.transform.Result;
import javax.xml.transform.Source;
import javax.xml.transform.Transformer;
import javax.xml.transform.TransformerFactory;
import javax.xml.transform.dom.DOMSource;
import javax.xml.transform.stream.StreamResult;
import org.w3c.dom.Document;
import org.w3c.dom.Element;
public class XmlCreation {
private static final String[] names = {"April", "Tam O'Shanter", "Emily"};
private static final String[] remarks = {"Bubbly: I'm > Tam and <= Emily",
"Burns: \"When chapman billies leave the street ...\"",
"Short & shrift"};
public static void main(String[] args) {
try {
final Document doc = DocumentBuilderFactory.newInstance().newDocumentBuilder().newDocument();
final Element root = doc.createElement("CharacterRemarks");
doc.appendChild(root);
for(int i = 0; i < names.length; i++) {
final Element character = doc.createElement("Character");
root.appendChild(character);
character.setAttribute("name", names[i]);
character.appendChild(doc.createTextNode(remarks[i]));
}
final Source source = new DOMSource(doc);
final StringWriter buffer = new StringWriter();
final Result result = new StreamResult(buffer);
final Transformer transformer = TransformerFactory.newInstance().newTransformer();
transformer.setOutputProperty("indent", "yes");
transformer.transform(source, result);
System.out.println(buffer.toString());
} catch (Exception e) {
e.printStackTrace();
}
}
}
| Module XMLOutput
Sub Main()
Dim charRemarks As New Dictionary(Of String, String)
charRemarks.Add("April", "Bubbly: I
charRemarks.Add("Tam O
charRemarks.Add("Emily", "Short & shrift")
Dim xml = <CharacterRemarks>
<%= From cr In charRemarks Select <Character name=<%= cr.Key %>><%= cr.Value %></Character> %>
</CharacterRemarks>
Console.WriteLine(xml)
End Sub
End Module
|
Keep all operations the same but rewrite the snippet in VB. | import java.awt.*;
import java.awt.event.*;
import java.awt.geom.*;
import javax.swing.JApplet;
import javax.swing.JFrame;
public class Plot2d extends JApplet {
double[] xi;
double[] yi;
public Plot2d(double[] x, double[] y) {
this.xi = x;
this.yi = y;
}
public static double max(double[] t) {
double maximum = t[0];
for (int i = 1; i < t.length; i++) {
if (t[i] > maximum) {
maximum = t[i];
}
}
return maximum;
}
public static double min(double[] t) {
double minimum = t[0];
for (int i = 1; i < t.length; i++) {
if (t[i] < minimum) {
minimum = t[i];
}
}
return minimum;
}
public void init() {
setBackground(Color.white);
setForeground(Color.white);
}
public void paint(Graphics g) {
Graphics2D g2 = (Graphics2D) g;
g2.setRenderingHint(RenderingHints.KEY_ANTIALIASING,
RenderingHints.VALUE_ANTIALIAS_ON);
g2.setPaint(Color.black);
int x0 = 70;
int y0 = 10;
int xm = 670;
int ym = 410;
int xspan = xm - x0;
int yspan = ym - y0;
double xmax = max(xi);
double xmin = min(xi);
double ymax = max(yi);
double ymin = min(yi);
g2.draw(new Line2D.Double(x0, ym, xm, ym));
g2.draw(new Line2D.Double(x0, ym, x0, y0));
for (int j = 0; j < 5; j++) {
int interv = 4;
g2.drawString("" + (j * (xmax - xmin) / interv + xmin), j * xspan / interv + x0 - 10, ym + 20);
g2.drawString("" + (j * (ymax - ymin) / interv + ymin), x0 - 20 - (int) (9 * Math.log10(ymax)),
ym - j * yspan / interv + y0 - 5);
g2.draw(new Line2D.Double(j * xspan / interv + x0, ym, j * xspan / interv + x0, ym + 5));
g2.draw(new Line2D.Double(x0 - 5, j * yspan / interv + y0, x0, j * yspan / interv + y0));
}
for (int i = 0; i < xi.length; i++) {
int f = (int) ((xi[i] - xmin) * xspan / (xmax - xmin));
int h = (int) (((ymax - ymin) - (yi[i] - ymin)) * yspan / (ymax - ymin));
g2.drawString("o", x0 + f - 3, h + 14);
}
for (int i = 0; i < xi.length - 1; i++) {
int f = (int) ((xi[i] - xmin) * xspan / (xmax - xmin));
int f2 = (int) ((xi[i + 1] - xmin) * xspan / (xmax - xmin));
int h = (int) (((ymax - ymin) - (yi[i] - ymin)) * yspan / (ymax - ymin));
int h2 = (int) (((ymax - ymin) - (yi[i + 1] - ymin)) * yspan / (ymax - ymin));
g2.draw(new Line2D.Double(f + x0, h + y0, f2 + x0, h2 + y0));
}
}
public static void main(String args[]) {
JFrame f = new JFrame("ShapesDemo2D");
f.addWindowListener(new WindowAdapter() {
public void windowClosing(WindowEvent e) {
System.exit(0);
}
});
double[] r = {0, 1, 2, 3, 4, 5, 6, 7, 8, 9};
double[] t = {2.7, 2.8, 31.4, 38.1, 58.0, 76.2, 100.5, 130.0, 149.3, 180.09};
JApplet applet = new Plot2d(r, t);
f.getContentPane().add("Center", applet);
applet.init();
f.pack();
f.setSize(new Dimension(720, 480));
f.show();
}
}
| Private Sub plot_coordinate_pairs(x As Variant, y As Variant)
Dim chrt As Chart
Set chrt = ActiveSheet.Shapes.AddChart.Chart
With chrt
.ChartType = xlLine
.HasLegend = False
.HasTitle = True
.ChartTitle.Text = "Time"
.SeriesCollection.NewSeries
.SeriesCollection.Item(1).XValues = x
.SeriesCollection.Item(1).Values = y
.Axes(xlValue, xlPrimary).HasTitle = True
.Axes(xlValue, xlPrimary).AxisTitle.Characters.Text = "microseconds"
End With
End Sub
Public Sub main()
x = [{0, 1, 2, 3, 4, 5, 6, 7, 8, 9}]
y = [{2.7, 2.8, 31.4, 38.1, 58.0, 76.2, 100.5, 130.0, 149.3, 180.0}]
plot_coordinate_pairs x, y
End Sub
|
Can you help me rewrite this code in VB instead of Java, keeping it the same logically? | import java.awt.*;
import java.awt.event.*;
import java.awt.geom.*;
import javax.swing.JApplet;
import javax.swing.JFrame;
public class Plot2d extends JApplet {
double[] xi;
double[] yi;
public Plot2d(double[] x, double[] y) {
this.xi = x;
this.yi = y;
}
public static double max(double[] t) {
double maximum = t[0];
for (int i = 1; i < t.length; i++) {
if (t[i] > maximum) {
maximum = t[i];
}
}
return maximum;
}
public static double min(double[] t) {
double minimum = t[0];
for (int i = 1; i < t.length; i++) {
if (t[i] < minimum) {
minimum = t[i];
}
}
return minimum;
}
public void init() {
setBackground(Color.white);
setForeground(Color.white);
}
public void paint(Graphics g) {
Graphics2D g2 = (Graphics2D) g;
g2.setRenderingHint(RenderingHints.KEY_ANTIALIASING,
RenderingHints.VALUE_ANTIALIAS_ON);
g2.setPaint(Color.black);
int x0 = 70;
int y0 = 10;
int xm = 670;
int ym = 410;
int xspan = xm - x0;
int yspan = ym - y0;
double xmax = max(xi);
double xmin = min(xi);
double ymax = max(yi);
double ymin = min(yi);
g2.draw(new Line2D.Double(x0, ym, xm, ym));
g2.draw(new Line2D.Double(x0, ym, x0, y0));
for (int j = 0; j < 5; j++) {
int interv = 4;
g2.drawString("" + (j * (xmax - xmin) / interv + xmin), j * xspan / interv + x0 - 10, ym + 20);
g2.drawString("" + (j * (ymax - ymin) / interv + ymin), x0 - 20 - (int) (9 * Math.log10(ymax)),
ym - j * yspan / interv + y0 - 5);
g2.draw(new Line2D.Double(j * xspan / interv + x0, ym, j * xspan / interv + x0, ym + 5));
g2.draw(new Line2D.Double(x0 - 5, j * yspan / interv + y0, x0, j * yspan / interv + y0));
}
for (int i = 0; i < xi.length; i++) {
int f = (int) ((xi[i] - xmin) * xspan / (xmax - xmin));
int h = (int) (((ymax - ymin) - (yi[i] - ymin)) * yspan / (ymax - ymin));
g2.drawString("o", x0 + f - 3, h + 14);
}
for (int i = 0; i < xi.length - 1; i++) {
int f = (int) ((xi[i] - xmin) * xspan / (xmax - xmin));
int f2 = (int) ((xi[i + 1] - xmin) * xspan / (xmax - xmin));
int h = (int) (((ymax - ymin) - (yi[i] - ymin)) * yspan / (ymax - ymin));
int h2 = (int) (((ymax - ymin) - (yi[i + 1] - ymin)) * yspan / (ymax - ymin));
g2.draw(new Line2D.Double(f + x0, h + y0, f2 + x0, h2 + y0));
}
}
public static void main(String args[]) {
JFrame f = new JFrame("ShapesDemo2D");
f.addWindowListener(new WindowAdapter() {
public void windowClosing(WindowEvent e) {
System.exit(0);
}
});
double[] r = {0, 1, 2, 3, 4, 5, 6, 7, 8, 9};
double[] t = {2.7, 2.8, 31.4, 38.1, 58.0, 76.2, 100.5, 130.0, 149.3, 180.09};
JApplet applet = new Plot2d(r, t);
f.getContentPane().add("Center", applet);
applet.init();
f.pack();
f.setSize(new Dimension(720, 480));
f.show();
}
}
| Private Sub plot_coordinate_pairs(x As Variant, y As Variant)
Dim chrt As Chart
Set chrt = ActiveSheet.Shapes.AddChart.Chart
With chrt
.ChartType = xlLine
.HasLegend = False
.HasTitle = True
.ChartTitle.Text = "Time"
.SeriesCollection.NewSeries
.SeriesCollection.Item(1).XValues = x
.SeriesCollection.Item(1).Values = y
.Axes(xlValue, xlPrimary).HasTitle = True
.Axes(xlValue, xlPrimary).AxisTitle.Characters.Text = "microseconds"
End With
End Sub
Public Sub main()
x = [{0, 1, 2, 3, 4, 5, 6, 7, 8, 9}]
y = [{2.7, 2.8, 31.4, 38.1, 58.0, 76.2, 100.5, 130.0, 149.3, 180.0}]
plot_coordinate_pairs x, y
End Sub
|
Port the provided Java code into VB while preserving the original functionality. | String str = "I am a string";
if (str.matches(".*string")) {
System.out.println("ends with 'string'");
}
| text = "I need more coffee!!!"
Set regex = New RegExp
regex.Global = True
regex.Pattern = "\s"
If regex.Test(text) Then
WScript.StdOut.Write regex.Replace(text,vbCrLf)
Else
WScript.StdOut.Write "No matching pattern"
End If
|
Rewrite this program in VB while keeping its functionality equivalent to the Java version. | import java.util.HashMap;
public static void main(String[] args){
String[] keys= {"a", "b", "c"};
int[] vals= {1, 2, 3};
HashMap<String, Integer> hash= new HashMap<String, Integer>();
for(int i= 0; i < keys.length; i++){
hash.put(keys[i], vals[i]);
}
}
| Set dict = CreateObject("Scripting.Dictionary")
os = Array("Windows", "Linux", "MacOS")
owner = Array("Microsoft", "Linus Torvalds", "Apple")
For n = 0 To 2
dict.Add os(n), owner(n)
Next
MsgBox dict.Item("Linux")
MsgBox dict.Item("MacOS")
MsgBox dict.Item("Windows")
|
Convert the following code from Java to VB, ensuring the logic remains intact. | import java.awt.*;
import static java.awt.Color.*;
import javax.swing.*;
public class ColourPinstripeDisplay extends JPanel {
final static Color[] palette = {black, red, green, blue, magenta,cyan,
yellow, white};
final int bands = 4;
public ColourPinstripeDisplay() {
setPreferredSize(new Dimension(900, 600));
}
@Override
public void paintComponent(Graphics g) {
super.paintComponent(g);
int h = getHeight();
for (int b = 1; b <= bands; b++) {
for (int x = 0, colIndex = 0; x < getWidth(); x += b, colIndex++) {
g.setColor(palette[colIndex % palette.length]);
g.fillRect(x, (b - 1) * (h / bands), x + b, b * (h / bands));
}
}
}
public static void main(String[] args) {
SwingUtilities.invokeLater(() -> {
JFrame f = new JFrame();
f.setDefaultCloseOperation(JFrame.EXIT_ON_CLOSE);
f.setTitle("ColourPinstripeDisplay");
f.add(new ColourPinstripeDisplay(), BorderLayout.CENTER);
f.pack();
f.setLocationRelativeTo(null);
f.setVisible(true);
});
}
}
| Public Class Main
Inherits System.Windows.Forms.Form
Public Sub New()
Me.FormBorderStyle = FormBorderStyle.None
Me.WindowState = FormWindowState.Maximized
End Sub
Private Sub Main_Load(sender As Object, e As EventArgs) Handles Me.Load
Dim Index As Integer
Dim Colors() As Color = {Color.Black, Color.Red, Color.Green, Color.Magenta, Color.Cyan, Color.Yellow, Color.White}
Dim Height = (Me.ClientSize.Height / 4) + 1
For y = 1 To 4
Dim Top = Me.ClientSize.Height / 4 * (y - 1)
For x = 0 To Me.ClientSize.Width Step y
If Index = 6 Then Index = 0 Else Index += 1
Me.Controls.Add(New Panel With {.Top = Top, .Height = Height, .Left = x, .Width = y, .BackColor = Colors(Index)})
Next
Next
End Sub
End Class
|
Keep all operations the same but rewrite the snippet in VB. | import java.util.*;
public class CocktailSort {
public static void main(String[] args) {
Integer[] array = new Integer[]{ 5, 1, -6, 12, 3, 13, 2, 4, 0, 15 };
System.out.println("before: " + Arrays.toString(array));
cocktailSort(array);
System.out.println("after: " + Arrays.toString(array));
}
public static void cocktailSort(Object[] array) {
int begin = 0;
int end = array.length;
if (end == 0)
return;
for (--end; begin < end; ) {
int new_begin = end;
int new_end = begin;
for (int i = begin; i < end; ++i) {
Comparable c1 = (Comparable)array[i];
Comparable c2 = (Comparable)array[i + 1];
if (c1.compareTo(c2) > 0) {
swap(array, i, i + 1);
new_end = i;
}
}
end = new_end;
for (int i = end; i > begin; --i) {
Comparable c1 = (Comparable)array[i - 1];
Comparable c2 = (Comparable)array[i];
if (c1.compareTo(c2) > 0) {
swap(array, i, i - 1);
new_begin = i;
}
}
begin = new_begin;
}
}
private static void swap(Object[] array, int i, int j) {
Object tmp = array[i];
array[i] = array[j];
array[j] = tmp;
}
}
|
Function cocktailShakerSort(ByVal A As Variant) As Variant
beginIdx = LBound(A)
endIdx = UBound(A) - 1
Do While beginIdx <= endIdx
newBeginIdx = endIdx
newEndIdx = beginIdx
For ii = beginIdx To endIdx
If A(ii) > A(ii + 1) Then
tmp = A(ii): A(ii) = A(ii + 1): A(ii + 1) = tmp
newEndIdx = ii
End If
Next ii
endIdx = newEndIdx - 1
For ii = endIdx To beginIdx Step -1
If A(ii) > A(ii + 1) Then
tmp = A(ii): A(ii) = A(ii + 1): A(ii + 1) = tmp
newBeginIdx = ii
End If
Next ii
beginIdx = newBeginIdx + 1
Loop
cocktailShakerSort = A
End Function
Public Sub main()
Dim B(20) As Variant
For i = LBound(B) To UBound(B)
B(i) = Int(Rnd() * 100)
Next i
Debug.Print Join(B, ", ")
Debug.Print Join(cocktailShakerSort(B), ", ")
End Sub
|
Generate a VB translation of this Java snippet without changing its computational steps. | import java.awt.*;
import javax.swing.*;
public class Pendulum extends JPanel implements Runnable {
private double angle = Math.PI / 2;
private int length;
public Pendulum(int length) {
this.length = length;
setDoubleBuffered(true);
}
@Override
public void paint(Graphics g) {
g.setColor(Color.WHITE);
g.fillRect(0, 0, getWidth(), getHeight());
g.setColor(Color.BLACK);
int anchorX = getWidth() / 2, anchorY = getHeight() / 4;
int ballX = anchorX + (int) (Math.sin(angle) * length);
int ballY = anchorY + (int) (Math.cos(angle) * length);
g.drawLine(anchorX, anchorY, ballX, ballY);
g.fillOval(anchorX - 3, anchorY - 4, 7, 7);
g.fillOval(ballX - 7, ballY - 7, 14, 14);
}
public void run() {
double angleAccel, angleVelocity = 0, dt = 0.1;
while (true) {
angleAccel = -9.81 / length * Math.sin(angle);
angleVelocity += angleAccel * dt;
angle += angleVelocity * dt;
repaint();
try { Thread.sleep(15); } catch (InterruptedException ex) {}
}
}
@Override
public Dimension getPreferredSize() {
return new Dimension(2 * length + 50, length / 2 * 3);
}
public static void main(String[] args) {
JFrame f = new JFrame("Pendulum");
Pendulum p = new Pendulum(200);
f.add(p);
f.setDefaultCloseOperation(JFrame.EXIT_ON_CLOSE);
f.pack();
f.setVisible(true);
new Thread(p).start();
}
}
| option explicit
const dt = 0.15
const length=23
dim ans0:ans0=chr(27)&"["
dim Veloc,Accel,angle,olr,olc,r,c
const r0=1
const c0=40
cls
angle=0.7
while 1
wscript.sleep(50)
Accel = -.9 * sin(Angle)
Veloc = Veloc + Accel * dt
Angle = Angle + Veloc * dt
r = r0 + int(cos(Angle) * Length)
c = c0+ int(2*sin(Angle) * Length)
cls
draw_line r,c,r0,c0
toxy r,c,"O"
olr=r :olc=c
wend
sub cls() wscript.StdOut.Write ans0 &"2J"&ans0 &"?25l":end sub
sub toxy(r,c,s) wscript.StdOut.Write ans0 & r & ";" & c & "f" & s :end sub
Sub draw_line(r1,c1, r2,c2)
Dim x,y,xf,yf,dx,dy,sx,sy,err,err2
x =r1 : y =c1
xf=r2 : yf=c2
dx=Abs(xf-x) : dy=Abs(yf-y)
If x<xf Then sx=+1: Else sx=-1
If y<yf Then sy=+1: Else sy=-1
err=dx-dy
Do
toxy x,y,"."
If x=xf And y=yf Then Exit Do
err2=err+err
If err2>-dy Then err=err-dy: x=x+sx
If err2< dx Then err=err+dx: y=y+sy
Loop
End Sub
|
Convert the following code from Java to VB, ensuring the logic remains intact. | public class Gray {
public static long grayEncode(long n){
return n ^ (n >>> 1);
}
public static long grayDecode(long n) {
long p = n;
while ((n >>>= 1) != 0)
p ^= n;
return p;
}
public static void main(String[] args){
System.out.println("i\tBinary\tGray\tDecoded");
for(int i = -1; i < 32;i++){
System.out.print(i +"\t");
System.out.print(Integer.toBinaryString(i) + "\t");
System.out.print(Long.toBinaryString(grayEncode(i))+ "\t");
System.out.println(grayDecode(grayEncode(i)));
}
}
}
| Function Encoder(ByVal n)
Encoder = n Xor (n \ 2)
End Function
Function Decoder(ByVal n)
Dim g : g = 0
Do While n > 0
g = g Xor n
n = n \ 2
Loop
Decoder = g
End Function
Function Dec2bin(ByVal n, ByVal length)
Dim i, strbin : strbin = ""
For i = 1 to 5
strbin = (n Mod 2) & strbin
n = n \ 2
Next
Dec2Bin = strbin
End Function
WScript.StdOut.WriteLine("Binary -> Gray Code -> Binary")
For i = 0 to 31
encoded = Encoder(i)
decoded = Decoder(encoded)
WScript.StdOut.WriteLine(Dec2Bin(i, 5) & " -> " & Dec2Bin(encoded, 5) & " -> " & Dec2Bin(decoded, 5))
Next
|
Maintain the same structure and functionality when rewriting this code in VB. | public class Gray {
public static long grayEncode(long n){
return n ^ (n >>> 1);
}
public static long grayDecode(long n) {
long p = n;
while ((n >>>= 1) != 0)
p ^= n;
return p;
}
public static void main(String[] args){
System.out.println("i\tBinary\tGray\tDecoded");
for(int i = -1; i < 32;i++){
System.out.print(i +"\t");
System.out.print(Integer.toBinaryString(i) + "\t");
System.out.print(Long.toBinaryString(grayEncode(i))+ "\t");
System.out.println(grayDecode(grayEncode(i)));
}
}
}
| Function Encoder(ByVal n)
Encoder = n Xor (n \ 2)
End Function
Function Decoder(ByVal n)
Dim g : g = 0
Do While n > 0
g = g Xor n
n = n \ 2
Loop
Decoder = g
End Function
Function Dec2bin(ByVal n, ByVal length)
Dim i, strbin : strbin = ""
For i = 1 to 5
strbin = (n Mod 2) & strbin
n = n \ 2
Next
Dec2Bin = strbin
End Function
WScript.StdOut.WriteLine("Binary -> Gray Code -> Binary")
For i = 0 to 31
encoded = Encoder(i)
decoded = Decoder(encoded)
WScript.StdOut.WriteLine(Dec2Bin(i, 5) & " -> " & Dec2Bin(encoded, 5) & " -> " & Dec2Bin(decoded, 5))
Next
|
Write a version of this Java function in VB with identical behavior. | public enum Pip { Two, Three, Four, Five, Six, Seven,
Eight, Nine, Ten, Jack, Queen, King, Ace }
| class playingcard
dim suit
dim pips
end class
class carddeck
private suitnames
private pipnames
private cardno
private deck(52)
private nTop
sub class_initialize
dim suit
dim pips
suitnames = split("H,D,C,S",",")
pipnames = split("A,2,3,4,5,6,7,8,9,10,J,Q,K",",")
cardno = 0
for suit = 1 to 4
for pips = 1 to 13
set deck(cardno) = new playingcard
deck(cardno).suit = suitnames(suit-1)
deck(cardno).pips = pipnames(pips-1)
cardno = cardno + 1
next
next
nTop = 0
end sub
public sub showdeck
dim a
redim a(51-nTop)
for i = nTop to 51
a(i) = deck(i).pips & deck(i).suit
next
wscript.echo join( a, ", ")
end sub
public sub shuffle
dim r
randomize timer
for i = nTop to 51
r = int( rnd * ( 52 - nTop ) )
if r <> i then
objswap deck(i),deck(r)
end if
next
end sub
public function deal()
set deal = deck( nTop )
nTop = nTop + 1
end function
public property get cardsRemaining
cardsRemaining = 52 - nTop
end property
private sub objswap( a, b )
dim tmp
set tmp = a
set a = b
set b = tmp
end sub
end class
|
Port the following code from Java to VB with equivalent syntax and logic. | Int[] literalArray = [1,2,3];
Int[] fixedLengthArray = new Int[10];
Int[] variableArray = new Int[];
assert literalArray.size == 3;
Int n = literalArray[2];
fixedLengthArray[4] = 12345;
fixedLengthArray += 6789;
variableArray += 6789;
| Option Base {0|1}
|
Write the same algorithm in VB as shown in this Java implementation. | public static boolean inCarpet(long x, long y) {
while (x!=0 && y!=0) {
if (x % 3 == 1 && y % 3 == 1)
return false;
x /= 3;
y /= 3;
}
return true;
}
public static void carpet(final int n) {
final double power = Math.pow(3,n);
for(long i = 0; i < power; i++) {
for(long j = 0; j < power; j++) {
System.out.print(inCarpet(i, j) ? "*" : " ");
}
System.out.println();
}
}
| Const Order = 4
Function InCarpet(ByVal x As Integer, ByVal y As Integer)
Do While x <> 0 And y <> 0
If x Mod 3 = 1 And y Mod 3 = 1 Then
InCarpet = " "
Exit Function
End If
x = x \ 3
y = y \ 3
Loop
InCarpet = "#"
End Function
Public Sub sierpinski_carpet()
Dim i As Integer, j As Integer
For i = 0 To 3 ^ Order - 1
For j = 0 To 3 ^ Order - 1
Debug.Print InCarpet(i, j);
Next j
Debug.Print
Next i
End Sub
|
Rewrite this program in VB while keeping its functionality equivalent to the Java version. | public class BogoSort
{
public static void main(String[] args)
{
int[] arr={4,5,6,0,7,8,9,1,2,3};
BogoSort now=new BogoSort();
System.out.print("Unsorted: ");
now.display1D(arr);
now.bogo(arr);
System.out.print("Sorted: ");
now.display1D(arr);
}
void bogo(int[] arr)
{
int shuffle=1;
for(;!isSorted(arr);shuffle++)
shuffle(arr);
System.out.println("This took "+shuffle+" shuffles.");
}
void shuffle(int[] arr)
{
int i=arr.length-1;
while(i>0)
swap(arr,i--,(int)(Math.random()*i));
}
void swap(int[] arr,int i,int j)
{
int temp=arr[i];
arr[i]=arr[j];
arr[j]=temp;
}
boolean isSorted(int[] arr)
{
for(int i=1;i<arr.length;i++)
if(arr[i]<arr[i-1])
return false;
return true;
}
void display1D(int[] arr)
{
for(int i=0;i<arr.length;i++)
System.out.print(arr[i]+" ");
System.out.println();
}
}
| Private Function Knuth(a As Variant) As Variant
Dim t As Variant, i As Integer
If Not IsMissing(a) Then
For i = UBound(a) To LBound(a) + 1 Step -1
j = Int((UBound(a) - LBound(a) + 1) * Rnd + LBound(a))
t = a(i)
a(i) = a(j)
a(j) = t
Next i
End If
Knuth = a
End Function
Private Function inOrder(s As Variant)
i = 2
Do While i <= UBound(s)
If s(i) < s(i - 1) Then
inOrder = False
Exit Function
End If
i = i + 1
Loop
inOrder = True
End Function
Private Function bogosort(ByVal s As Variant) As Variant
Do While Not inOrder(s)
Debug.Print Join(s, ", ")
s = Knuth(s)
Loop
bogosort = s
End Function
Public Sub main()
Debug.Print Join(bogosort(Knuth([{1,2,3,4,5,6}])), ", ")
End Sub
|
Write a version of this Java function in VB with identical behavior. | public class Euler {
private static void euler (Callable f, double y0, int a, int b, int h) {
int t = a;
double y = y0;
while (t < b) {
System.out.println ("" + t + " " + y);
t += h;
y += h * f.compute (t, y);
}
System.out.println ("DONE");
}
public static void main (String[] args) {
Callable cooling = new Cooling ();
int[] steps = {2, 5, 10};
for (int stepSize : steps) {
System.out.println ("Step size: " + stepSize);
euler (cooling, 100.0, 0, 100, stepSize);
}
}
}
interface Callable {
public double compute (int time, double t);
}
class Cooling implements Callable {
public double compute (int time, double t) {
return -0.07 * (t - 20);
}
}
| Private Sub ivp_euler(f As String, y As Double, step As Integer, end_t As Integer)
Dim t As Integer
Debug.Print " Step "; step; ": ",
Do While t <= end_t
If t Mod 10 = 0 Then Debug.Print Format(y, "0.000"),
y = y + step * Application.Run(f, y)
t = t + step
Loop
Debug.Print
End Sub
Sub analytic()
Debug.Print " Time: ",
For t = 0 To 100 Step 10
Debug.Print " "; t,
Next t
Debug.Print
Debug.Print "Analytic: ",
For t = 0 To 100 Step 10
Debug.Print Format(20 + 80 * Exp(-0.07 * t), "0.000"),
Next t
Debug.Print
End Sub
Private Function cooling(temp As Double) As Double
cooling = -0.07 * (temp - 20)
End Function
Public Sub euler_method()
Dim r_cooling As String
r_cooling = "cooling"
analytic
ivp_euler r_cooling, 100, 2, 100
ivp_euler r_cooling, 100, 5, 100
ivp_euler r_cooling, 100, 10, 100
End Sub
|
Generate an equivalent VB version of this Java code. | public class SeqNonSquares {
public static int nonsqr(int n) {
return n + (int)Math.round(Math.sqrt(n));
}
public static void main(String[] args) {
for (int i = 1; i < 23; i++)
System.out.print(nonsqr(i) + " ");
System.out.println();
for (int i = 1; i < 1000000; i++) {
double j = Math.sqrt(nonsqr(i));
assert j != Math.floor(j);
}
}
}
| Sub Main()
Dim i&, c&, j#, s$
Const N& = 1000000
s = "values for n in the range 1 to 22 : "
For i = 1 To 22
s = s & ns(i) & ", "
Next
For i = 1 To N
j = Sqr(ns(i))
If j = CInt(j) Then c = c + 1
Next
Debug.Print s
Debug.Print c & " squares less than " & N
End Sub
Private Function ns(l As Long) As Long
ns = l + Int(1 / 2 + Sqr(l))
End Function
|
Write the same code in VB as shown below in Java. | public static String Substring(String str, int n, int m){
return str.substring(n, n+m);
}
public static String Substring(String str, int n){
return str.substring(n);
}
public static String Substring(String str){
return str.substring(0, str.length()-1);
}
public static String Substring(String str, char c, int m){
return str.substring(str.indexOf(c), str.indexOf(c)+m+1);
}
public static String Substring(String str, String sub, int m){
return str.substring(str.indexOf(sub), str.indexOf(sub)+m+1);
}
| Public Sub substring()
sentence = "the last thing the man said was the"
n = 10: m = 5
Debug.Print Mid(sentence, n, 5)
Debug.Print Right(sentence, Len(sentence) - n + 1)
Debug.Print Left(sentence, Len(sentence) - 1)
k = InStr(1, sentence, "m")
Debug.Print Mid(sentence, k, 5)
k = InStr(1, sentence, "aid")
Debug.Print Mid(sentence, k, 5)
End Sub
|
Transform the following Java implementation into VB, maintaining the same output and logic. | public static String Substring(String str, int n, int m){
return str.substring(n, n+m);
}
public static String Substring(String str, int n){
return str.substring(n);
}
public static String Substring(String str){
return str.substring(0, str.length()-1);
}
public static String Substring(String str, char c, int m){
return str.substring(str.indexOf(c), str.indexOf(c)+m+1);
}
public static String Substring(String str, String sub, int m){
return str.substring(str.indexOf(sub), str.indexOf(sub)+m+1);
}
| Public Sub substring()
sentence = "the last thing the man said was the"
n = 10: m = 5
Debug.Print Mid(sentence, n, 5)
Debug.Print Right(sentence, Len(sentence) - n + 1)
Debug.Print Left(sentence, Len(sentence) - 1)
k = InStr(1, sentence, "m")
Debug.Print Mid(sentence, k, 5)
k = InStr(1, sentence, "aid")
Debug.Print Mid(sentence, k, 5)
End Sub
|
Generate a VB translation of this Java snippet without changing its computational steps. | public class JortSort {
public static void main(String[] args) {
System.out.println(jortSort(new int[]{1, 2, 3}));
}
static boolean jortSort(int[] arr) {
return true;
}
}
| Function JortSort(s)
JortSort = True
arrPreSort = Split(s,",")
Set arrSorted = CreateObject("System.Collections.ArrayList")
For i = 0 To UBound(arrPreSort)
arrSorted.Add(arrPreSort(i))
Next
arrSorted.Sort()
For j = 0 To UBound(arrPreSort)
If arrPreSort(j) <> arrSorted(j) Then
JortSort = False
Exit For
End If
Next
End Function
WScript.StdOut.Write JortSort("1,2,3,4,5")
WScript.StdOut.WriteLine
WScript.StdOut.Write JortSort("1,2,3,5,4")
WScript.StdOut.WriteLine
WScript.StdOut.Write JortSort("a,b,c")
WScript.StdOut.WriteLine
WScript.StdOut.Write JortSort("a,c,b")
|
Rewrite the snippet below in VB so it works the same as the original Java code. | import java.util.GregorianCalendar;
import java.text.MessageFormat;
public class Leapyear{
public static void main(String[] argv){
int[] yrs = {1800,1900,1994,1998,1999,2000,2001,2004,2100};
GregorianCalendar cal = new GregorianCalendar();
for(int year : yrs){
System.err.println(MessageFormat.format("The year {0,number,#} is leaper: {1} / {2}.",
year, cal.isLeapYear(year), isLeapYear(year)));
}
}
public static boolean isLeapYear(int year){
return (year % 100 == 0) ? (year % 400 == 0) : (year % 4 == 0);
}
}
| Public Function Leap_year(year As Integer) As Boolean
Leap_year = (Month(DateSerial(year, 2, 29)) = 2)
End Function
|
Rewrite the snippet below in VB so it works the same as the original Java code. | import java.math.BigInteger;
public class CombinationsAndPermutations {
public static void main(String[] args) {
System.out.println(Double.MAX_VALUE);
System.out.println("A sample of permutations from 1 to 12 with exact Integer arithmetic:");
for ( int n = 1 ; n <= 12 ; n++ ) {
int k = n / 2;
System.out.printf("%d P %d = %s%n", n, k, permutation(n, k));
}
System.out.println();
System.out.println("A sample of combinations from 10 to 60 with exact Integer arithmetic:");
for ( int n = 10 ; n <= 60 ; n += 5 ) {
int k = n / 2;
System.out.printf("%d C %d = %s%n", n, k, combination(n, k));
}
System.out.println();
System.out.println("A sample of permutations from 5 to 15000 displayed in floating point arithmetic:");
System.out.printf("%d P %d = %s%n", 5, 2, display(permutation(5, 2), 50));
for ( int n = 1000 ; n <= 15000 ; n += 1000 ) {
int k = n / 2;
System.out.printf("%d P %d = %s%n", n, k, display(permutation(n, k), 50));
}
System.out.println();
System.out.println("A sample of combinations from 100 to 1000 displayed in floating point arithmetic:");
for ( int n = 100 ; n <= 1000 ; n += 100 ) {
int k = n / 2;
System.out.printf("%d C %d = %s%n", n, k, display(combination(n, k), 50));
}
}
private static String display(BigInteger val, int precision) {
String s = val.toString();
precision = Math.min(precision, s.length());
StringBuilder sb = new StringBuilder();
sb.append(s.substring(0, 1));
sb.append(".");
sb.append(s.substring(1, precision));
sb.append(" * 10^");
sb.append(s.length()-1);
return sb.toString();
}
public static BigInteger combination(int n, int k) {
if ( n-k < k ) {
k = n-k;
}
BigInteger result = permutation(n, k);
while ( k > 0 ) {
result = result.divide(BigInteger.valueOf(k));
k--;
}
return result;
}
public static BigInteger permutation(int n, int k) {
BigInteger result = BigInteger.ONE;
for ( int i = n ; i >= n-k+1 ; i-- ) {
result = result.multiply(BigInteger.valueOf(i));
}
return result;
}
}
|
dim i,j
Wscript.StdOut.WriteLine "-- Long Integer - Permutations - from 1 to 12"
for i=1 to 12
for j=1 to i
Wscript.StdOut.Write "P(" & i & "," & j & ")=" & perm(i,j) & " "
next
Wscript.StdOut.WriteLine ""
next
Wscript.StdOut.WriteLine "-- Float integer - Combinations from 10 to 60"
for i=10 to 60 step 10
for j=1 to i step i\5
Wscript.StdOut.Write "C(" & i & "," & j & ")=" & comb(i,j) & " "
next
Wscript.StdOut.WriteLine ""
next
Wscript.StdOut.WriteLine "-- Float integer - Permutations from 5000 to 15000"
for i=5000 to 15000 step 5000
for j=10 to 70 step 20
Wscript.StdOut.Write "C(" & i & "," & j & ")=" & perm(i,j) & " "
next
Wscript.StdOut.WriteLine ""
next
Wscript.StdOut.WriteLine "-- Float integer - Combinations from 200 to 1000"
for i=200 to 1000 step 200
for j=20 to 100 step 20
Wscript.StdOut.Write "P(" & i & "," & j & ")=" & comb(i,j) & " "
next
Wscript.StdOut.WriteLine ""
next
function perm(x,y)
dim i,z
z=1
for i=x-y+1 to x
z=z*i
next
perm=z
end function
function fact(x)
dim i,z
z=1
for i=2 to x
z=z*i
next
fact=z
end function
function comb(byval x,byval y)
if y>x then
comb=0
elseif x=y then
comb=1
else
if x-y<y then y=x-y
comb=perm(x,y)/fact(y)
end if
end function
|
Generate an equivalent VB version of this Java code. | import java.util.List;
import java.util.stream.*;
public class LexicographicalNumbers {
static List<Integer> lexOrder(int n) {
int first = 1, last = n;
if (n < 1) {
first = n;
last = 1;
}
return IntStream.rangeClosed(first, last)
.mapToObj(Integer::toString)
.sorted()
.map(Integer::valueOf)
.collect(Collectors.toList());
}
public static void main(String[] args) {
System.out.println("In lexicographical order:\n");
int[] ints = {0, 5, 13, 21, -22};
for (int n : ints) {
System.out.printf("%3d: %s\n", n, lexOrder(n));
}
}
}
| Public Function sortlexicographically(N As Integer)
Dim arrList As Object
Set arrList = CreateObject("System.Collections.ArrayList")
For i = 1 To N
arrList.Add CStr(i)
Next i
arrList.Sort
Dim item As Variant
For Each item In arrList
Debug.Print item & ", ";
Next
End Function
Public Sub main()
Call sortlexicographically(13)
End Sub
|
Keep all operations the same but rewrite the snippet in VB. | module NumberNames
{
void run()
{
@Inject Console console;
Int[] tests = [0, 1, -1, 11, -17, 42, 99, 100, 101, -111, 1000, 1234, 10000, 100000,
123456789000, 0x123456789ABCDEF];
for (Int test : tests)
{
console.print($"{test} = {toEnglish(test)}");
}
}
static String[] digits = ["zero", "one", "two", "three", "four",
"five", "six", "seven", "eight", "nine"];
static String[] teens = ["ten", "eleven", "twelve", "thirteen", "fourteen",
"fifteen", "sixteen", "seventeen", "eighteen", "nineteen"];
static String[] tens = ["zero", "ten", "twenty", "thirty", "forty",
"fifty", "sixty", "seventy", "eighty", "ninety"];
static String[] ten3rd = ["?", "thousand", "million", "billion", "trillion",
"quadrillion", "quintillion"];
static String toEnglish(Int n)
{
StringBuffer buf = new StringBuffer();
if (n < 0)
{
"negative ".appendTo(buf);
n = -n;
}
format3digits(n, buf);
return buf.toString();
}
static void format3digits(Int n, StringBuffer buf, Int nested=0)
{
(Int left, Int right) = n /% 1000;
if (left != 0)
{
format3digits(left, buf, nested+1);
}
if (right != 0 || (left == 0 && nested==0))
{
if (right >= 100)
{
(left, right) = (right /% 100);
digits[left].appendTo(buf);
" hundred ".appendTo(buf);
if (right != 0)
{
format2digits(right, buf);
}
}
else
{
format2digits(right, buf);
}
if (nested > 0)
{
ten3rd[nested].appendTo(buf).add(' ');
}
}
}
static void format2digits(Int n, StringBuffer buf)
{
switch (n)
{
case 0..9:
digits[n].appendTo(buf).add(' ');
break;
case 10..19:
teens[n-10].appendTo(buf).add(' ');
break;
default:
(Int left, Int right) = n /% 10;
tens[left].appendTo(buf);
if (right == 0)
{
buf.add(' ');
}
else
{
buf.add('-');
digits[right].appendTo(buf).add(' ');
}
break;
}
}
}
| Public twenties As Variant
Public decades As Variant
Public orders As Variant
Private Sub init()
twenties = [{"zero","one","two","three","four","five","six","seven","eight","nine","ten", "eleven","twelve","thirteen","fourteen","fifteen","sixteen","seventeen","eighteen","nineteen"}]
decades = [{"twenty","thirty","forty","fifty","sixty","seventy","eighty","ninety"}]
orders = [{1E15,"quadrillion"; 1E12,"trillion"; 1E9,"billion"; 1E6,"million"; 1E3,"thousand"}]
End Sub
Private Function Twenty(N As Variant)
Twenty = twenties(N Mod 20 + 1)
End Function
Private Function Decade(N As Variant)
Decade = decades(N Mod 10 - 1)
End Function
Private Function Hundred(N As Variant)
If N < 20 Then
Hundred = Twenty(N)
Exit Function
Else
If N Mod 10 = 0 Then
Hundred = Decade((N \ 10) Mod 10)
Exit Function
End If
End If
Hundred = Decade(N \ 10) & "-" & Twenty(N Mod 10)
End Function
Private Function Thousand(N As Variant, withand As String)
If N < 100 Then
Thousand = withand & Hundred(N)
Exit Function
Else
If N Mod 100 = 0 Then
Thousand = withand & Twenty(WorksheetFunction.Floor_Precise(N / 100)) & " hundred"
Exit Function
End If
End If
Thousand = Twenty(N \ 100) & " hundred and " & Hundred(N Mod 100)
End Function
Private Function Triplet(N As Variant)
Dim Order, High As Variant, Low As Variant
Dim Name As String, res As String
For i = 1 To UBound(orders)
Order = orders(i, 1)
Name = orders(i, 2)
High = WorksheetFunction.Floor_Precise(N / Order)
Low = N - High * Order
If High <> 0 Then
res = res & Thousand(High, "") & " " & Name
End If
N = Low
If Low = 0 Then Exit For
If Len(res) And High <> 0 Then
res = res & ", "
End If
Next i
If N <> 0 Or res = "" Then
res = res & Thousand(WorksheetFunction.Floor_Precise(N), IIf(res = "", "", "and "))
N = N - Int(N)
If N > 0.000001 Then
res = res & " point"
For i = 1 To 10
n_ = WorksheetFunction.Floor_Precise(N * 10.0000001)
res = res & " " & twenties(n_ + 1)
N = N * 10 - n_
If Abs(N) < 0.000001 Then Exit For
Next i
End If
End If
Triplet = res
End Function
Private Function spell(N As Variant)
Dim res As String
If N < 0 Then
res = "minus "
N = -N
End If
res = res & Triplet(N)
spell = res
End Function
Private Function smartp(N As Variant)
Dim res As String
If N = WorksheetFunction.Floor_Precise(N) Then
smartp = CStr(N)
Exit Function
End If
res = CStr(N)
If InStr(1, res, ".") Then
res = Left(res, InStr(1, res, "."))
End If
smartp = res
End Function
Sub Main()
Dim si As Variant
init
Samples1 = [{99, 300, 310, 417, 1501, 12609, 200000000000100, 999999999999999, -123456787654321,102003000400005,1020030004,102003,102,1,0,-1,-99, -1501,1234,12.34}]
Samples2 = [{10000001.2,1E-3,-2.7182818, 201021002001,-20102100200,2010210020,-201021002,20102100,-2010210, 201021,-20102,2010,-201,20,-2}]
For i = 1 To UBound(Samples1)
si = Samples1(i)
Debug.Print Format(smartp(si), "@@@@@@@@@@@@@@@@"); " "; spell(si)
Next i
For i = 1 To UBound(Samples2)
si = Samples2(i)
Debug.Print Format(smartp(si), "@@@@@@@@@@@@@@@@"); " "; spell(si)
Next i
End Sub
|
Write the same algorithm in VB as shown in this Java implementation. | public static void shell(int[] a) {
int increment = a.length / 2;
while (increment > 0) {
for (int i = increment; i < a.length; i++) {
int j = i;
int temp = a[i];
while (j >= increment && a[j - increment] > temp) {
a[j] = a[j - increment];
j = j - increment;
}
a[j] = temp;
}
if (increment == 2) {
increment = 1;
} else {
increment *= (5.0 / 11);
}
}
}
| Sub arrShellSort(ByVal arrData As Variant)
Dim lngHold, lngGap As Long
Dim lngCount, lngMin, lngMax As Long
Dim varItem As Variant
lngMin = LBound(arrData)
lngMax = UBound(arrData)
lngGap = lngMin
Do While (lngGap < lngMax)
lngGap = 3 * lngGap + 1
Loop
Do While (lngGap > 1)
lngGap = lngGap \ 3
For lngCount = lngGap + lngMin To lngMax
varItem = arrData(lngCount)
lngHold = lngCount
Do While ((arrData(lngHold - lngGap) > varItem))
arrData(lngHold) = arrData(lngHold - lngGap)
lngHold = lngHold - lngGap
If (lngHold < lngMin + lngGap) Then Exit Do
Loop
arrData(lngHold) = varItem
Next
Loop
arrShellSort = arrData
End Sub
|
Can you help me rewrite this code in VB instead of Java, keeping it the same logically? | import java.util.LinkedList;
public class DoublyLinkedList {
public static void main(String[] args) {
LinkedList<String> list = new LinkedList<String>();
list.addFirst("Add First");
list.addLast("Add Last 1");
list.addLast("Add Last 2");
list.addLast("Add Last 1");
traverseList(list);
list.removeFirstOccurrence("Add Last 1");
traverseList(list);
}
private static void traverseList(LinkedList<String> list) {
System.out.println("Traverse List:");
for ( int i = 0 ; i < list.size() ; i++ ) {
System.out.printf("Element number %d - Element value = '%s'%n", i, list.get(i));
}
System.out.println();
}
}
| Public Class DoubleLinkList(Of T)
Private m_Head As Node(Of T)
Private m_Tail As Node(Of T)
Public Sub AddHead(ByVal value As T)
Dim node As New Node(Of T)(Me, value)
If m_Head Is Nothing Then
m_Head = Node
m_Tail = m_Head
Else
node.Next = m_Head
m_Head = node
End If
End Sub
Public Sub AddTail(ByVal value As T)
Dim node As New Node(Of T)(Me, value)
If m_Tail Is Nothing Then
m_Head = node
m_Tail = m_Head
Else
node.Previous = m_Tail
m_Tail = node
End If
End Sub
Public ReadOnly Property Head() As Node(Of T)
Get
Return m_Head
End Get
End Property
Public ReadOnly Property Tail() As Node(Of T)
Get
Return m_Tail
End Get
End Property
Public Sub RemoveTail()
If m_Tail Is Nothing Then Return
If m_Tail.Previous Is Nothing Then
m_Head = Nothing
m_Tail = Nothing
Else
m_Tail = m_Tail.Previous
m_Tail.Next = Nothing
End If
End Sub
Public Sub RemoveHead()
If m_Head Is Nothing Then Return
If m_Head.Next Is Nothing Then
m_Head = Nothing
m_Tail = Nothing
Else
m_Head = m_Head.Next
m_Head.Previous = Nothing
End If
End Sub
End Class
Public Class Node(Of T)
Private ReadOnly m_Value As T
Private m_Next As Node(Of T)
Private m_Previous As Node(Of T)
Private ReadOnly m_Parent As DoubleLinkList(Of T)
Public Sub New(ByVal parent As DoubleLinkList(Of T), ByVal value As T)
m_Parent = parent
m_Value = value
End Sub
Public Property [Next]() As Node(Of T)
Get
Return m_Next
End Get
Friend Set(ByVal value As Node(Of T))
m_Next = value
End Set
End Property
Public Property Previous() As Node(Of T)
Get
Return m_Previous
End Get
Friend Set(ByVal value As Node(Of T))
m_Previous = value
End Set
End Property
Public ReadOnly Property Value() As T
Get
Return m_Value
End Get
End Property
Public Sub InsertAfter(ByVal value As T)
If m_Next Is Nothing Then
m_Parent.AddTail(value)
ElseIf m_Previous Is Nothing Then
m_Parent.AddHead(value)
Else
Dim node As New Node(Of T)(m_Parent, value)
node.Previous = Me
node.Next = Me.Next
Me.Next.Previous = node
Me.Next = node
End If
End Sub
Public Sub Remove()
If m_Next Is Nothing Then
m_Parent.RemoveTail()
ElseIf m_Previous Is Nothing Then
m_Parent.RemoveHead()
Else
m_Previous.Next = Me.Next
m_Next.Previous = Me.Previous
End If
End Sub
End Class
|
Write the same code in VB as shown below in Java. | import java.io.BufferedReader;
import java.io.FileReader;
import java.io.IOException;
import java.util.Arrays;
public class LetterFreq {
public static int[] countLetters(String filename) throws IOException{
int[] freqs = new int[26];
BufferedReader in = new BufferedReader(new FileReader(filename));
String line;
while((line = in.readLine()) != null){
line = line.toUpperCase();
for(char ch:line.toCharArray()){
if(Character.isLetter(ch)){
freqs[ch - 'A']++;
}
}
}
in.close();
return freqs;
}
public static void main(String[] args) throws IOException{
System.out.println(Arrays.toString(countLetters("filename.txt")));
}
}
|
TYPE regChar
Character AS STRING * 3
Count AS LONG
END TYPE
DIM iChar AS INTEGER
DIM iCL AS INTEGER
DIM iCountChars AS INTEGER
DIM iFile AS INTEGER
DIM i AS INTEGER
DIM lMUC AS LONG
DIM iMUI AS INTEGER
DIM lLUC AS LONG
DIM iLUI AS INTEGER
DIM iMaxIdx AS INTEGER
DIM iP AS INTEGER
DIM iPause AS INTEGER
DIM iPMI AS INTEGER
DIM iPrint AS INTEGER
DIM lHowMany AS LONG
DIM lTotChars AS LONG
DIM sTime AS SINGLE
DIM strFile AS STRING
DIM strTxt AS STRING
DIM strDate AS STRING
DIM strTime AS STRING
DIM strKey AS STRING
CONST LngReg = 256
CONST Letters = 1
CONST FALSE = 0
CONST TRUE = NOT FALSE
strDate = DATE$
strTime = TIME$
iFile = FREEFILE
DO
CLS
PRINT "This program counts letters or characters in a text file."
PRINT
INPUT "File to open: ", strFile
OPEN strFile FOR BINARY AS #iFile
IF LOF(iFile) > 0 THEN
PRINT "Count: 1) Letters 2) Characters (1 or 2)";
DO
strKey = INKEY$
LOOP UNTIL strKey = "1" OR strKey = "2"
PRINT ". Option selected: "; strKey
iCL = VAL(strKey)
sTime = TIMER
iP = POS(0)
lHowMany = LOF(iFile)
strTxt = SPACE$(LngReg)
IF iCL = Letters THEN
iMaxIdx = 26
ELSE
iMaxIdx = 255
END IF
IF iMaxIdx <> iPMI THEN
iPMI = iMaxIdx
REDIM rChar(0 TO iMaxIdx) AS regChar
FOR i = 0 TO iMaxIdx
IF iCL = Letters THEN
strTxt = CHR$(i + 65)
IF i = 26 THEN strTxt = CHR$(165)
ELSE
SELECT CASE i
CASE 0: strTxt = "nul"
CASE 7: strTxt = "bel"
CASE 9: strTxt = "tab"
CASE 10: strTxt = "lf"
CASE 11: strTxt = "vt"
CASE 12: strTxt = "ff"
CASE 13: strTxt = "cr"
CASE 28: strTxt = "fs"
CASE 29: strTxt = "gs"
CASE 30: strTxt = "rs"
CASE 31: strTxt = "us"
CASE 32: strTxt = "sp"
CASE ELSE: strTxt = CHR$(i)
END SELECT
END IF
rChar(i).Character = strTxt
NEXT i
ELSE
FOR i = 0 TO iMaxIdx
rChar(i).Count = 0
NEXT i
END IF
PRINT "Looking for ";
IF iCL = Letters THEN PRINT "letters."; ELSE PRINT "characters.";
PRINT " File is"; STR$(lHowMany); " in size. Working"; : COLOR 23: PRINT "..."; : COLOR (7)
DO WHILE LOC(iFile) < LOF(iFile)
IF LOC(iFile) + LngReg > LOF(iFile) THEN
strTxt = SPACE$(LOF(iFile) - LOC(iFile))
END IF
GET #iFile, , strTxt
FOR i = 1 TO LEN(strTxt)
IF iCL = Letters THEN
iChar = ASC(UCASE$(MID$(strTxt, i, 1)))
SELECT CASE iChar
CASE 164: iChar = 165
CASE 160: iChar = 65
CASE 130, 144: iChar = 69
CASE 161: iChar = 73
CASE 162: iChar = 79
CASE 163, 129: iChar = 85
END SELECT
iChar = iChar - 65
IF iChar >= 0 AND iChar <= 25 THEN
rChar(iChar).Count = rChar(iChar).Count + 1
ELSEIF iChar = 100 THEN
rChar(iMaxIdx).Count = rChar(iMaxIdx).Count + 1
END IF
ELSE
iChar = ASC(MID$(strTxt, i, 1))
rChar(iChar).Count = rChar(iChar).Count + 1
END IF
NEXT i
LOOP
CLOSE #iFile
lMUC = 0
iMUI = 0
lLUC = 2147483647
iLUI = 0
iPrint = FALSE
lTotChars = 0
iCountChars = 0
iPause = FALSE
CLS
IF iCL = Letters THEN PRINT "Letters found: "; ELSE PRINT "Characters found: ";
FOR i = 0 TO iMaxIdx
IF lMUC < rChar(i).Count THEN
lMUC = rChar(i).Count
iMUI = i
END IF
IF rChar(i).Count > 0 THEN
strTxt = ""
IF iPrint THEN strTxt = ", " ELSE iPrint = TRUE
strTxt = strTxt + LTRIM$(RTRIM$(rChar(i).Character))
strTxt = strTxt + "=" + LTRIM$(STR$(rChar(i).Count))
iP = POS(0)
IF iP + LEN(strTxt) + 1 >= 80 AND iPrint THEN
PRINT ","
IF CSRLIN >= 23 AND NOT iPause THEN
iPause = TRUE
PRINT "Press a key to continue..."
DO
strKey = INKEY$
LOOP UNTIL strKey <> ""
END IF
strTxt = MID$(strTxt, 3)
END IF
PRINT strTxt;
lTotChars = lTotChars + rChar(i).Count
iCountChars = iCountChars + 1
IF lLUC > rChar(i).Count THEN
lLUC = rChar(i).Count
iLUI = i
END IF
END IF
NEXT i
PRINT "."
PRINT
PRINT "File analyzed....................: "; strFile
PRINT "Looked for.......................: "; : IF iCL = Letters THEN PRINT "Letters" ELSE PRINT "Characters"
PRINT "Total characters in file.........:"; lHowMany
PRINT "Total characters counted.........:"; lTotChars
IF iCL = Letters THEN PRINT "Characters discarded on count....:"; lHowMany - lTotChars
PRINT "Distinct characters found in file:"; iCountChars; "of"; iMaxIdx + 1
PRINT "Most used character was..........: ";
iPrint = FALSE
FOR i = 0 TO iMaxIdx
IF rChar(i).Count = lMUC THEN
IF iPrint THEN PRINT ", "; ELSE iPrint = TRUE
PRINT RTRIM$(LTRIM$(rChar(i).Character));
END IF
NEXT i
PRINT " ("; LTRIM$(STR$(rChar(iMUI).Count)); " times)"
PRINT "Least used character was.........: ";
iPrint = FALSE
FOR i = 0 TO iMaxIdx
IF rChar(i).Count = lLUC THEN
IF iPrint THEN PRINT ", "; ELSE iPrint = TRUE
PRINT RTRIM$(LTRIM$(rChar(i).Character));
END IF
NEXT i
PRINT " ("; LTRIM$(STR$(rChar(iLUI).Count)); " times)"
PRINT "Time spent in the process........:"; TIMER - sTime; "seconds"
ELSE
CLOSE #iFile
KILL strFile
PRINT
PRINT "File does not exist."
END IF
PRINT
PRINT "Again? (Y/n)"
DO
strTxt = UCASE$(INKEY$)
LOOP UNTIL strTxt = "N" OR strTxt = "Y" OR strTxt = CHR$(13) OR strTxt = CHR$(27)
LOOP UNTIL strTxt = "N" OR strTxt = CHR$(27)
CLS
PRINT "End of execution."
PRINT "Start time: "; strDate; " "; strTime; ", end time: "; DATE$; " "; TIME$; "."
END
|
Port the following code from Java to VB with equivalent syntax and logic. | String s = "12345";
IntLiteral lit1 = new IntLiteral(s);
IntLiteral lit2 = 6789;
++lit1;
++lit2;
| Dim s As String = "123"
s = CStr(CInt("123") + 1)
s = (CInt("123") + 1).ToString
|
Transform the following Java implementation into VB, maintaining the same output and logic. | class StripChars {
public static String stripChars(String inString, String toStrip) {
return inString.replaceAll("[" + toStrip + "]", "");
}
public static void main(String[] args) {
String sentence = "She was a soul stripper. She took my heart!";
String chars = "aei";
System.out.println("sentence: " + sentence);
System.out.println("to strip: " + chars);
System.out.println("stripped: " + stripChars(sentence, chars));
}
}
| Function StripChars(stString As String, stStripChars As String, Optional bSpace As Boolean)
Dim i As Integer, stReplace As String
If bSpace = True Then
stReplace = " "
Else
stReplace = ""
End If
For i = 1 To Len(stStripChars)
stString = Replace(stString, Mid(stStripChars, i, 1), stReplace)
Next i
StripChars = stString
End Function
|
Write a version of this Java function in VB with identical behavior. | public static double avg(double... arr) {
double sum = 0.0;
for (double x : arr) {
sum += x;
}
return sum / arr.length;
}
| Private Function mean(v() As Double, ByVal leng As Integer) As Variant
Dim sum As Double, i As Integer
sum = 0: i = 0
For i = 0 To leng - 1
sum = sum + vv
Next i
If leng = 0 Then
mean = CVErr(xlErrDiv0)
Else
mean = sum / leng
End If
End Function
Public Sub main()
Dim v(4) As Double
Dim i As Integer, leng As Integer
v(0) = 1#
v(1) = 2#
v(2) = 2.178
v(3) = 3#
v(4) = 3.142
For leng = 5 To 0 Step -1
Debug.Print "mean[";
For i = 0 To leng - 1
Debug.Print IIf(i, "; " & v(i), "" & v(i));
Next i
Debug.Print "] = "; mean(v, leng)
Next leng
End Sub
|
Please provide an equivalent version of this Java code in VB. | import java.util.*;
public class Abbreviations {
public static void main(String[] args) {
CommandList commands = new CommandList(commandTable);
String input = "riG rePEAT copies put mo rest types fup. 6 poweRin";
System.out.println(" input: " + input);
System.out.println("output: " + test(commands, input));
}
private static String test(CommandList commands, String input) {
StringBuilder output = new StringBuilder();
Scanner scanner = new Scanner(input);
while (scanner.hasNext()) {
String word = scanner.next();
if (output.length() > 0)
output.append(' ');
Command cmd = commands.findCommand(word);
if (cmd != null)
output.append(cmd.cmd);
else
output.append("*error*");
}
return output.toString();
}
private static String commandTable =
"add 1 alter 3 backup 2 bottom 1 Cappend 2 change 1 Schange Cinsert 2 Clast 3 " +
"compress 4 copy 2 count 3 Coverlay 3 cursor 3 delete 3 Cdelete 2 down 1 duplicate " +
"3 xEdit 1 expand 3 extract 3 find 1 Nfind 2 Nfindup 6 NfUP 3 Cfind 2 findUP 3 fUP 2 " +
"forward 2 get help 1 hexType 4 input 1 powerInput 3 join 1 split 2 spltJOIN load " +
"locate 1 Clocate 2 lowerCase 3 upperCase 3 Lprefix 2 macro merge 2 modify 3 move 2 " +
"msg next 1 overlay 1 parse preserve 4 purge 3 put putD query 1 quit read recover 3 " +
"refresh renum 3 repeat 3 replace 1 Creplace 2 reset 3 restore 4 rgtLEFT right 2 left " +
"2 save set shift 2 si sort sos stack 3 status 4 top transfer 3 type 1 up 1";
private static class Command {
private Command(String cmd, int minLength) {
this.cmd = cmd;
this.minLength = minLength;
}
private boolean match(String str) {
int olen = str.length();
return olen >= minLength && olen <= cmd.length()
&& cmd.regionMatches(true, 0, str, 0, olen);
}
private String cmd;
private int minLength;
}
private static Integer parseInteger(String word) {
try {
return Integer.valueOf(word);
} catch (NumberFormatException ex) {
return null;
}
}
private static class CommandList {
private CommandList(String table) {
Scanner scanner = new Scanner(table);
List<String> words = new ArrayList<>();
while (scanner.hasNext()) {
String word = scanner.next();
words.add(word.toUpperCase());
}
for (int i = 0, n = words.size(); i < n; ++i) {
String word = words.get(i);
int len = word.length();
if (i + 1 < n) {
Integer number = parseInteger(words.get(i + 1));
if (number != null) {
len = number.intValue();
++i;
}
}
commands.add(new Command(word, len));
}
}
private Command findCommand(String word) {
for (Command command : commands) {
if (command.match(word))
return command;
}
return null;
}
private List<Command> commands = new ArrayList<>();
}
}
| Private Function ValidateUserWords(userstring As String) As String
Dim s As String
Dim user_words() As String
Dim command_table As Scripting.Dictionary
Set command_table = New Scripting.Dictionary
Dim abbreviations As Scripting.Dictionary
Set abbreviations = New Scripting.Dictionary
abbreviations.CompareMode = TextCompare
Dim commandtable() As String
Dim commands As String
s = s & "add 1 alter 3 backup 2 bottom 1 Cappend 2 change 1 Schange Cinsert 2 Clast 3 "
s = s & "compress 4 copy 2 count 3 Coverlay 3 cursor 3 delete 3 Cdelete 2 down 1 duplicate "
s = s & "3 xEdit 1 expand 3 extract 3 find 1 Nfind 2 Nfindup 6 NfUP 3 Cfind 2 findUP 3 fUP 2 "
s = s & "forward 2 get help 1 hexType 4 input 1 powerInput 3 join 1 split 2 spltJOIN load "
s = s & "locate 1 Clocate 2 lowerCase 3 upperCase 3 Lprefix 2 macro merge 2 modify 3 move 2 "
s = s & "msg next 1 overlay 1 parse preserve 4 purge 3 put putD query 1 quit read recover 3 "
s = s & "refresh renum 3 repeat 3 replace 1 Creplace 2 reset 3 restore 4 rgtLEFT right 2 left "
s = s & "2 save set shift 2 si sort sos stack 3 status 4 top transfer 3 type 1 up 1 "
commandtable = Split(s, " ")
Dim i As Integer, word As Variant, number As Integer
For i = LBound(commandtable) To UBound(commandtable)
word = commandtable(i)
If Len(word) > 0 Then
i = i + 1
Do While Len(commandtable(i)) = 0: i = i + 1: Loop
number = Val(commandtable(i))
If number > 0 Then
command_table.Add Key:=word, Item:=number
Else
command_table.Add Key:=word, Item:=Len(word)
i = i - 1
End If
End If
Next i
For Each word In command_table
For i = command_table(word) To Len(word)
On Error Resume Next
abbreviations.Add Key:=Left(word, i), Item:=UCase(word)
Next i
Next word
user_words() = Split(userstring, " ")
For Each word In user_words
If Len(word) > 0 Then
If abbreviations.exists(word) Then
commands = commands & abbreviations(word) & " "
Else
commands = commands & "*error* "
End If
End If
Next word
ValidateUserWords = commands
End Function
Public Sub program()
Dim guserstring As String
guserstring = "riG rePEAT copies put mo rest types fup. 6 poweRin"
Debug.Print "user words:", guserstring
Debug.Print "full words:", ValidateUserWords(guserstring)
End Sub
|
Produce a language-to-language conversion: from Java to VB, same semantics. | import java.util.*;
public class Abbreviations {
public static void main(String[] args) {
CommandList commands = new CommandList(commandTable);
String input = "riG rePEAT copies put mo rest types fup. 6 poweRin";
System.out.println(" input: " + input);
System.out.println("output: " + test(commands, input));
}
private static String test(CommandList commands, String input) {
StringBuilder output = new StringBuilder();
Scanner scanner = new Scanner(input);
while (scanner.hasNext()) {
String word = scanner.next();
if (output.length() > 0)
output.append(' ');
Command cmd = commands.findCommand(word);
if (cmd != null)
output.append(cmd.cmd);
else
output.append("*error*");
}
return output.toString();
}
private static String commandTable =
"add 1 alter 3 backup 2 bottom 1 Cappend 2 change 1 Schange Cinsert 2 Clast 3 " +
"compress 4 copy 2 count 3 Coverlay 3 cursor 3 delete 3 Cdelete 2 down 1 duplicate " +
"3 xEdit 1 expand 3 extract 3 find 1 Nfind 2 Nfindup 6 NfUP 3 Cfind 2 findUP 3 fUP 2 " +
"forward 2 get help 1 hexType 4 input 1 powerInput 3 join 1 split 2 spltJOIN load " +
"locate 1 Clocate 2 lowerCase 3 upperCase 3 Lprefix 2 macro merge 2 modify 3 move 2 " +
"msg next 1 overlay 1 parse preserve 4 purge 3 put putD query 1 quit read recover 3 " +
"refresh renum 3 repeat 3 replace 1 Creplace 2 reset 3 restore 4 rgtLEFT right 2 left " +
"2 save set shift 2 si sort sos stack 3 status 4 top transfer 3 type 1 up 1";
private static class Command {
private Command(String cmd, int minLength) {
this.cmd = cmd;
this.minLength = minLength;
}
private boolean match(String str) {
int olen = str.length();
return olen >= minLength && olen <= cmd.length()
&& cmd.regionMatches(true, 0, str, 0, olen);
}
private String cmd;
private int minLength;
}
private static Integer parseInteger(String word) {
try {
return Integer.valueOf(word);
} catch (NumberFormatException ex) {
return null;
}
}
private static class CommandList {
private CommandList(String table) {
Scanner scanner = new Scanner(table);
List<String> words = new ArrayList<>();
while (scanner.hasNext()) {
String word = scanner.next();
words.add(word.toUpperCase());
}
for (int i = 0, n = words.size(); i < n; ++i) {
String word = words.get(i);
int len = word.length();
if (i + 1 < n) {
Integer number = parseInteger(words.get(i + 1));
if (number != null) {
len = number.intValue();
++i;
}
}
commands.add(new Command(word, len));
}
}
private Command findCommand(String word) {
for (Command command : commands) {
if (command.match(word))
return command;
}
return null;
}
private List<Command> commands = new ArrayList<>();
}
}
| Private Function ValidateUserWords(userstring As String) As String
Dim s As String
Dim user_words() As String
Dim command_table As Scripting.Dictionary
Set command_table = New Scripting.Dictionary
Dim abbreviations As Scripting.Dictionary
Set abbreviations = New Scripting.Dictionary
abbreviations.CompareMode = TextCompare
Dim commandtable() As String
Dim commands As String
s = s & "add 1 alter 3 backup 2 bottom 1 Cappend 2 change 1 Schange Cinsert 2 Clast 3 "
s = s & "compress 4 copy 2 count 3 Coverlay 3 cursor 3 delete 3 Cdelete 2 down 1 duplicate "
s = s & "3 xEdit 1 expand 3 extract 3 find 1 Nfind 2 Nfindup 6 NfUP 3 Cfind 2 findUP 3 fUP 2 "
s = s & "forward 2 get help 1 hexType 4 input 1 powerInput 3 join 1 split 2 spltJOIN load "
s = s & "locate 1 Clocate 2 lowerCase 3 upperCase 3 Lprefix 2 macro merge 2 modify 3 move 2 "
s = s & "msg next 1 overlay 1 parse preserve 4 purge 3 put putD query 1 quit read recover 3 "
s = s & "refresh renum 3 repeat 3 replace 1 Creplace 2 reset 3 restore 4 rgtLEFT right 2 left "
s = s & "2 save set shift 2 si sort sos stack 3 status 4 top transfer 3 type 1 up 1 "
commandtable = Split(s, " ")
Dim i As Integer, word As Variant, number As Integer
For i = LBound(commandtable) To UBound(commandtable)
word = commandtable(i)
If Len(word) > 0 Then
i = i + 1
Do While Len(commandtable(i)) = 0: i = i + 1: Loop
number = Val(commandtable(i))
If number > 0 Then
command_table.Add Key:=word, Item:=number
Else
command_table.Add Key:=word, Item:=Len(word)
i = i - 1
End If
End If
Next i
For Each word In command_table
For i = command_table(word) To Len(word)
On Error Resume Next
abbreviations.Add Key:=Left(word, i), Item:=UCase(word)
Next i
Next word
user_words() = Split(userstring, " ")
For Each word In user_words
If Len(word) > 0 Then
If abbreviations.exists(word) Then
commands = commands & abbreviations(word) & " "
Else
commands = commands & "*error* "
End If
End If
Next word
ValidateUserWords = commands
End Function
Public Sub program()
Dim guserstring As String
guserstring = "riG rePEAT copies put mo rest types fup. 6 poweRin"
Debug.Print "user words:", guserstring
Debug.Print "full words:", ValidateUserWords(guserstring)
End Sub
|
Ensure the translated VB code behaves exactly like the original Java snippet. | import java.util.*;
public class TokenizeStringWithEscaping {
public static void main(String[] args) {
String sample = "one^|uno||three^^^^|four^^^|^cuatro|";
char separator = '|';
char escape = '^';
System.out.println(sample);
try {
System.out.println(tokenizeString(sample, separator, escape));
} catch (Exception e) {
System.out.println(e);
}
}
public static List<String> tokenizeString(String s, char sep, char escape)
throws Exception {
List<String> tokens = new ArrayList<>();
StringBuilder sb = new StringBuilder();
boolean inEscape = false;
for (char c : s.toCharArray()) {
if (inEscape) {
inEscape = false;
} else if (c == escape) {
inEscape = true;
continue;
} else if (c == sep) {
tokens.add(sb.toString());
sb.setLength(0);
continue;
}
sb.append(c);
}
if (inEscape)
throw new Exception("Invalid terminal escape");
tokens.add(sb.toString());
return tokens;
}
}
| Private Function tokenize(s As String, sep As String, esc As String) As Collection
Dim ret As New Collection
Dim this As String
Dim skip As Boolean
If Len(s) <> 0 Then
For i = 1 To Len(s)
si = Mid(s, i, 1)
If skip Then
this = this & si
skip = False
Else
If si = esc Then
skip = True
Else
If si = sep Then
ret.Add this
this = ""
Else
this = this & si
End If
End If
End If
Next i
ret.Add this
End If
Set tokenize = ret
End Function
Public Sub main()
Dim out As Collection
Set out = tokenize("one^|uno||three^^^^|four^^^|^cuatro|", "|", "^")
Dim outstring() As String
ReDim outstring(out.Count - 1)
For i = 0 To out.Count - 1
outstring(i) = out(i + 1)
Next i
Debug.Print Join(outstring, ", ")
End Sub
|
Keep all operations the same but rewrite the snippet in VB. | module HelloWorld
{
void run()
{
@Inject Console console;
console.print("Hello World!");
}
}
| Public Sub hello_world_text
Debug.Print "Hello World!"
End Sub
|
Keep all operations the same but rewrite the snippet in VB. | module HelloWorld
{
void run()
{
@Inject Console console;
console.print("Hello World!");
}
}
| Public Sub hello_world_text
Debug.Print "Hello World!"
End Sub
|
Maintain the same structure and functionality when rewriting this code in VB. | import java.util.Arrays;
public class FD {
public static void main(String args[]) {
double[] a = {90, 47, 58, 29, 22, 32, 55, 5, 55, 73};
System.out.println(Arrays.toString(dif(a, 1)));
System.out.println(Arrays.toString(dif(a, 2)));
System.out.println(Arrays.toString(dif(a, 9)));
System.out.println(Arrays.toString(dif(a, 10)));
System.out.println(Arrays.toString(dif(a, 11)));
System.out.println(Arrays.toString(dif(a, -1)));
System.out.println(Arrays.toString(dif(a, 0)));
}
public static double[] dif(double[] a, int n) {
if (n < 0)
return null;
for (int i = 0; i < n && a.length > 0; i++) {
double[] b = new double[a.length - 1];
for (int j = 0; j < b.length; j++){
b[j] = a[j+1] - a[j];
}
a = b;
}
return a;
}
}
| Module ForwardDifference
Sub Main()
Dim lNum As New List(Of Integer)(New Integer() {90, 47, 58, 29, 22, 32, 55, 5, 55, 73})
For i As UInteger = 0 To 9
Console.WriteLine(String.Join(" ", (From n In Difference(i, lNum) Select String.Format("{0,5}", n)).ToArray()))
Next
Console.ReadKey()
End Sub
Private Function Difference(ByVal Level As UInteger, ByVal Numbers As List(Of Integer)) As List(Of Integer)
If Level >= Numbers.Count Then Throw New ArgumentOutOfRangeException("Level", "Level must be less than number of items in Numbers")
For i As Integer = 1 To Level
Numbers = (From n In Enumerable.Range(0, Numbers.Count - 1) _
Select Numbers(n + 1) - Numbers(n)).ToList()
Next
Return Numbers
End Function
End Module
|
Generate an equivalent VB version of this Java code. | public static boolean prime(long a){
if(a == 2){
return true;
}else if(a <= 1 || a % 2 == 0){
return false;
}
long max = (long)Math.sqrt(a);
for(long n= 3; n <= max; n+= 2){
if(a % n == 0){ return false; }
}
return true;
}
| Option Explicit
Sub FirstTwentyPrimes()
Dim count As Integer, i As Long, t(19) As String
Do
i = i + 1
If IsPrime(i) Then
t(count) = i
count = count + 1
End If
Loop While count <= UBound(t)
Debug.Print Join(t, ", ")
End Sub
Function IsPrime(Nb As Long) As Boolean
If Nb = 2 Then
IsPrime = True
ElseIf Nb < 2 Or Nb Mod 2 = 0 Then
Exit Function
Else
Dim i As Long
For i = 3 To Sqr(Nb) Step 2
If Nb Mod i = 0 Then Exit Function
Next
IsPrime = True
End If
End Function
|
Write the same algorithm in VB as shown in this Java implementation. | public class Binomial {
private static long binomialInt(int n, int k) {
if (k > n - k)
k = n - k;
long binom = 1;
for (int i = 1; i <= k; i++)
binom = binom * (n + 1 - i) / i;
return binom;
}
private static Object binomialIntReliable(int n, int k) {
if (k > n - k)
k = n - k;
long binom = 1;
for (int i = 1; i <= k; i++) {
try {
binom = Math.multiplyExact(binom, n + 1 - i) / i;
} catch (ArithmeticException e) {
return "overflow";
}
}
return binom;
}
private static double binomialFloat(int n, int k) {
if (k > n - k)
k = n - k;
double binom = 1.0;
for (int i = 1; i <= k; i++)
binom = binom * (n + 1 - i) / i;
return binom;
}
private static BigInteger binomialBigInt(int n, int k) {
if (k > n - k)
k = n - k;
BigInteger binom = BigInteger.ONE;
for (int i = 1; i <= k; i++) {
binom = binom.multiply(BigInteger.valueOf(n + 1 - i));
binom = binom.divide(BigInteger.valueOf(i));
}
return binom;
}
private static void demo(int n, int k) {
List<Object> data = Arrays.asList(
n,
k,
binomialInt(n, k),
binomialIntReliable(n, k),
binomialFloat(n, k),
binomialBigInt(n, k));
System.out.println(data.stream().map(Object::toString).collect(Collectors.joining("\t")));
}
public static void main(String[] args) {
demo(5, 3);
demo(1000, 300);
}
}
| Function binomial(n,k)
binomial = factorial(n)/(factorial(n-k)*factorial(k))
End Function
Function factorial(n)
If n = 0 Then
factorial = 1
Else
For i = n To 1 Step -1
If i = n Then
factorial = n
Else
factorial = factorial * i
End If
Next
End If
End Function
WScript.StdOut.Write "the binomial coefficient of 5 and 3 = " & binomial(5,3)
WScript.StdOut.WriteLine
|
Change the following Java code into VB without altering its purpose. | List arrayList = new ArrayList();
arrayList.add(new Integer(0));
arrayList.add(0);
List<Integer> myarrlist = new ArrayList<Integer>();
int sum;
for(int i = 0; i < 10; i++) {
myarrlist.add(i);
}
| Dim coll As New Collection
coll.Add "apple"
coll.Add "banana"
|
Convert the following code from Java to VB, ensuring the logic remains intact. | LinkedList<Type> list = new LinkedList<Type>();
for(Type i: list){
System.out.println(i);
}
| Private Sub Iterate(ByVal list As LinkedList(Of Integer))
Dim node = list.First
Do Until node Is Nothing
node = node.Next
Loop
End Sub
|
Change the following Java code into VB without altering its purpose. | import java.io.BufferedOutputStream;
import java.io.File;
import java.io.FileOutputStream;
import java.io.IOException;
import java.nio.charset.StandardCharsets;
public class PPMWriter {
public void bitmapToPPM(File file, BasicBitmapStorage bitmap) throws IOException {
file.delete();
try (var os = new FileOutputStream(file, true);
var bw = new BufferedOutputStream(os)) {
var header = String.format("P6\n%d %d\n255\n",
bitmap.getWidth(), bitmap.getHeight());
bw.write(header.getBytes(StandardCharsets.US_ASCII));
for (var y = 0; y < bitmap.getHeight(); y++) {
for (var x = 0; x < bitmap.getWidth(); x++) {
var pixel = bitmap.getPixel(x, y);
bw.write(pixel.getRed());
bw.write(pixel.getGreen());
bw.write(pixel.getBlue());
}
}
}
}
}
| Public Shared Sub SaveRasterBitmapToPpmFile(ByVal rasterBitmap As RasterBitmap, ByVal filepath As String)
Dim header As String = String.Format("P6{0}{1}{2}{3}{0}255{0}", vbLf, rasterBitmap.Width, " "c, rasterBitmap.Height)
Dim bufferSize As Integer = header.Length + (rasterBitmap.Width * rasterBitmap.Height * 3)
Dim bytes(bufferSize - 1) As Byte
Buffer.BlockCopy(Encoding.ASCII.GetBytes(header.ToString), 0, bytes, 0, header.Length)
Dim index As Integer = header.Length
For y As Integer = 0 To rasterBitmap.Height - 1
For x As Integer = 0 To rasterBitmap.Width - 1
Dim color As Rgb = rasterBitmap.GetPixel(x, y)
bytes(index) = color.R
bytes(index + 1) = color.G
bytes(index + 2) = color.B
index += 3
Next
Next
My.Computer.FileSystem.WriteAllBytes(filepath, bytes, False)
End Sub
|
Write the same algorithm in VB as shown in this Java implementation. | import java.io.File;
public class FileDeleteTest {
public static boolean deleteFile(String filename) {
boolean exists = new File(filename).delete();
return exists;
}
public static void test(String type, String filename) {
System.out.println("The following " + type + " called " + filename +
(deleteFile(filename) ? " was deleted." : " could not be deleted.")
);
}
public static void main(String args[]) {
test("file", "input.txt");
test("file", File.seperator + "input.txt");
test("directory", "docs");
test("directory", File.seperator + "docs" + File.seperator);
}
}
| Option Explicit
Sub DeleteFileOrDirectory()
Dim myPath As String
myPath = "C:\Users\surname.name\Desktop\Docs"
Kill myPath & "\input.txt"
RmDir myPath
End Sub
|
Convert the following code from Java to VB, ensuring the logic remains intact. | import java.util.HashSet;
import java.util.Random;
import java.util.Set;
public class AverageLoopLength {
private static final int N = 100000;
private static double analytical(int n) {
double[] factorial = new double[n + 1];
double[] powers = new double[n + 1];
powers[0] = 1.0;
factorial[0] = 1.0;
for (int i = 1; i <= n; i++) {
factorial[i] = factorial[i - 1] * i;
powers[i] = powers[i - 1] * n;
}
double sum = 0;
for (int i = 1; i <= n; i++) {
sum += factorial[n] / factorial[n - i] / powers[i];
}
return sum;
}
private static double average(int n) {
Random rnd = new Random();
double sum = 0.0;
for (int a = 0; a < N; a++) {
int[] random = new int[n];
for (int i = 0; i < n; i++) {
random[i] = rnd.nextInt(n);
}
Set<Integer> seen = new HashSet<>(n);
int current = 0;
int length = 0;
while (seen.add(current)) {
length++;
current = random[current];
}
sum += length;
}
return sum / N;
}
public static void main(String[] args) {
System.out.println(" N average analytical (error)");
System.out.println("=== ========= ============ =========");
for (int i = 1; i <= 20; i++) {
double avg = average(i);
double ana = analytical(i);
System.out.println(String.format("%3d %9.4f %12.4f (%6.2f%%)", i, avg, ana, ((ana - avg) / ana * 100)));
}
}
}
| Const MAX = 20
Const ITER = 1000000
Function expected(n As Long) As Double
Dim sum As Double
For i = 1 To n
sum = sum + WorksheetFunction.Fact(n) / n ^ i / WorksheetFunction.Fact(n - i)
Next i
expected = sum
End Function
Function test(n As Long) As Double
Dim count As Long
Dim x As Long, bits As Long
For i = 1 To ITER
x = 1
bits = 0
Do While Not bits And x
count = count + 1
bits = bits Or x
x = 2 ^ (Int(n * Rnd()))
Loop
Next i
test = count / ITER
End Function
Public Sub main()
Dim n As Long
Debug.Print " n avg. exp. (error%)"
Debug.Print "== ====== ====== ========"
For n = 1 To MAX
av = test(n)
ex = expected(n)
Debug.Print Format(n, "@@"); " "; Format(av, "0.0000"); " ";
Debug.Print Format(ex, "0.0000"); " ("; Format(Abs(1 - av / ex), "0.000%"); ")"
Next n
End Sub
|
Transform the following Java implementation into VB, maintaining the same output and logic. | import java.util.HashSet;
import java.util.Random;
import java.util.Set;
public class AverageLoopLength {
private static final int N = 100000;
private static double analytical(int n) {
double[] factorial = new double[n + 1];
double[] powers = new double[n + 1];
powers[0] = 1.0;
factorial[0] = 1.0;
for (int i = 1; i <= n; i++) {
factorial[i] = factorial[i - 1] * i;
powers[i] = powers[i - 1] * n;
}
double sum = 0;
for (int i = 1; i <= n; i++) {
sum += factorial[n] / factorial[n - i] / powers[i];
}
return sum;
}
private static double average(int n) {
Random rnd = new Random();
double sum = 0.0;
for (int a = 0; a < N; a++) {
int[] random = new int[n];
for (int i = 0; i < n; i++) {
random[i] = rnd.nextInt(n);
}
Set<Integer> seen = new HashSet<>(n);
int current = 0;
int length = 0;
while (seen.add(current)) {
length++;
current = random[current];
}
sum += length;
}
return sum / N;
}
public static void main(String[] args) {
System.out.println(" N average analytical (error)");
System.out.println("=== ========= ============ =========");
for (int i = 1; i <= 20; i++) {
double avg = average(i);
double ana = analytical(i);
System.out.println(String.format("%3d %9.4f %12.4f (%6.2f%%)", i, avg, ana, ((ana - avg) / ana * 100)));
}
}
}
| Const MAX = 20
Const ITER = 1000000
Function expected(n As Long) As Double
Dim sum As Double
For i = 1 To n
sum = sum + WorksheetFunction.Fact(n) / n ^ i / WorksheetFunction.Fact(n - i)
Next i
expected = sum
End Function
Function test(n As Long) As Double
Dim count As Long
Dim x As Long, bits As Long
For i = 1 To ITER
x = 1
bits = 0
Do While Not bits And x
count = count + 1
bits = bits Or x
x = 2 ^ (Int(n * Rnd()))
Loop
Next i
test = count / ITER
End Function
Public Sub main()
Dim n As Long
Debug.Print " n avg. exp. (error%)"
Debug.Print "== ====== ====== ========"
For n = 1 To MAX
av = test(n)
ex = expected(n)
Debug.Print Format(n, "@@"); " "; Format(av, "0.0000"); " ";
Debug.Print Format(ex, "0.0000"); " ("; Format(Abs(1 - av / ex), "0.000%"); ")"
Next n
End Sub
|
Generate a VB translation of this Java snippet without changing its computational steps. | String original = "Mary had a X lamb";
String little = "little";
String replaced = original.replace("X", little);
System.out.println(replaced);
System.out.printf("Mary had a %s lamb.", little);
String formatted = String.format("Mary had a %s lamb.", little);
System.out.println(formatted);
| Dim name as String = "J. Doe"
Dim balance as Double = 123.45
Dim prompt as String = String.Format("Hello {0}, your balance is {1}.", name, balance)
Console.WriteLine(prompt)
|
Write a version of this Java function in VB with identical behavior. | import java.util.Scanner;
public class MatrixArithmetic {
public static double[][] minor(double[][] a, int x, int y){
int length = a.length-1;
double[][] result = new double[length][length];
for(int i=0;i<length;i++) for(int j=0;j<length;j++){
if(i<x && j<y){
result[i][j] = a[i][j];
}else if(i>=x && j<y){
result[i][j] = a[i+1][j];
}else if(i<x && j>=y){
result[i][j] = a[i][j+1];
}else{
result[i][j] = a[i+1][j+1];
}
}
return result;
}
public static double det(double[][] a){
if(a.length == 1){
return a[0][0];
}else{
int sign = 1;
double sum = 0;
for(int i=0;i<a.length;i++){
sum += sign * a[0][i] * det(minor(a,0,i));
sign *= -1;
}
return sum;
}
}
public static double perm(double[][] a){
if(a.length == 1){
return a[0][0];
}else{
double sum = 0;
for(int i=0;i<a.length;i++){
sum += a[0][i] * perm(minor(a,0,i));
}
return sum;
}
}
public static void main(String args[]){
Scanner sc = new Scanner(System.in);
int size = sc.nextInt();
double[][] a = new double[size][size];
for(int i=0;i<size;i++) for(int j=0;j<size;j++){
a[i][j] = sc.nextDouble();
}
sc.close();
System.out.println("Determinant: "+det(a));
System.out.println("Permanent: "+perm(a));
}
}
| Module Module1
Function Minor(a As Double(,), x As Integer, y As Integer) As Double(,)
Dim length = a.GetLength(0) - 1
Dim result(length - 1, length - 1) As Double
For i = 1 To length
For j = 1 To length
If i < x AndAlso j < y Then
result(i - 1, j - 1) = a(i - 1, j - 1)
ElseIf i >= x AndAlso j < y Then
result(i - 1, j - 1) = a(i, j - 1)
ElseIf i < x AndAlso j >= y Then
result(i - 1, j - 1) = a(i - 1, j)
Else
result(i - 1, j - 1) = a(i, j)
End If
Next
Next
Return result
End Function
Function Det(a As Double(,)) As Double
If a.GetLength(0) = 1 Then
Return a(0, 0)
Else
Dim sign = 1
Dim sum = 0.0
For i = 1 To a.GetLength(0)
sum += sign * a(0, i - 1) * Det(Minor(a, 0, i))
sign *= -1
Next
Return sum
End If
End Function
Function Perm(a As Double(,)) As Double
If a.GetLength(0) = 1 Then
Return a(0, 0)
Else
Dim sum = 0.0
For i = 1 To a.GetLength(0)
sum += a(0, i - 1) * Perm(Minor(a, 0, i))
Next
Return sum
End If
End Function
Sub WriteLine(a As Double(,))
For i = 1 To a.GetLength(0)
Console.Write("[")
For j = 1 To a.GetLength(1)
If j > 1 Then
Console.Write(", ")
End If
Console.Write(a(i - 1, j - 1))
Next
Console.WriteLine("]")
Next
End Sub
Sub Test(a As Double(,))
If a.GetLength(0) <> a.GetLength(1) Then
Throw New ArgumentException("The dimensions must be equal")
End If
WriteLine(a)
Console.WriteLine("Permanant : {0}", Perm(a))
Console.WriteLine("Determinant: {0}", Det(a))
Console.WriteLine()
End Sub
Sub Main()
Test({{1, 2}, {3, 4}})
Test({{1, 2, 3, 4}, {4, 5, 6, 7}, {7, 8, 9, 10}, {10, 11, 12, 13}})
Test({{0, 1, 2, 3, 4}, {5, 6, 7, 8, 9}, {10, 11, 12, 13, 14}, {15, 16, 17, 18, 19}, {20, 21, 22, 23, 24}})
End Sub
End Module
|
Rewrite the snippet below in VB so it works the same as the original Java code. | import java.util.Scanner;
public class MatrixArithmetic {
public static double[][] minor(double[][] a, int x, int y){
int length = a.length-1;
double[][] result = new double[length][length];
for(int i=0;i<length;i++) for(int j=0;j<length;j++){
if(i<x && j<y){
result[i][j] = a[i][j];
}else if(i>=x && j<y){
result[i][j] = a[i+1][j];
}else if(i<x && j>=y){
result[i][j] = a[i][j+1];
}else{
result[i][j] = a[i+1][j+1];
}
}
return result;
}
public static double det(double[][] a){
if(a.length == 1){
return a[0][0];
}else{
int sign = 1;
double sum = 0;
for(int i=0;i<a.length;i++){
sum += sign * a[0][i] * det(minor(a,0,i));
sign *= -1;
}
return sum;
}
}
public static double perm(double[][] a){
if(a.length == 1){
return a[0][0];
}else{
double sum = 0;
for(int i=0;i<a.length;i++){
sum += a[0][i] * perm(minor(a,0,i));
}
return sum;
}
}
public static void main(String args[]){
Scanner sc = new Scanner(System.in);
int size = sc.nextInt();
double[][] a = new double[size][size];
for(int i=0;i<size;i++) for(int j=0;j<size;j++){
a[i][j] = sc.nextDouble();
}
sc.close();
System.out.println("Determinant: "+det(a));
System.out.println("Permanent: "+perm(a));
}
}
| Module Module1
Function Minor(a As Double(,), x As Integer, y As Integer) As Double(,)
Dim length = a.GetLength(0) - 1
Dim result(length - 1, length - 1) As Double
For i = 1 To length
For j = 1 To length
If i < x AndAlso j < y Then
result(i - 1, j - 1) = a(i - 1, j - 1)
ElseIf i >= x AndAlso j < y Then
result(i - 1, j - 1) = a(i, j - 1)
ElseIf i < x AndAlso j >= y Then
result(i - 1, j - 1) = a(i - 1, j)
Else
result(i - 1, j - 1) = a(i, j)
End If
Next
Next
Return result
End Function
Function Det(a As Double(,)) As Double
If a.GetLength(0) = 1 Then
Return a(0, 0)
Else
Dim sign = 1
Dim sum = 0.0
For i = 1 To a.GetLength(0)
sum += sign * a(0, i - 1) * Det(Minor(a, 0, i))
sign *= -1
Next
Return sum
End If
End Function
Function Perm(a As Double(,)) As Double
If a.GetLength(0) = 1 Then
Return a(0, 0)
Else
Dim sum = 0.0
For i = 1 To a.GetLength(0)
sum += a(0, i - 1) * Perm(Minor(a, 0, i))
Next
Return sum
End If
End Function
Sub WriteLine(a As Double(,))
For i = 1 To a.GetLength(0)
Console.Write("[")
For j = 1 To a.GetLength(1)
If j > 1 Then
Console.Write(", ")
End If
Console.Write(a(i - 1, j - 1))
Next
Console.WriteLine("]")
Next
End Sub
Sub Test(a As Double(,))
If a.GetLength(0) <> a.GetLength(1) Then
Throw New ArgumentException("The dimensions must be equal")
End If
WriteLine(a)
Console.WriteLine("Permanant : {0}", Perm(a))
Console.WriteLine("Determinant: {0}", Det(a))
Console.WriteLine()
End Sub
Sub Main()
Test({{1, 2}, {3, 4}})
Test({{1, 2, 3, 4}, {4, 5, 6, 7}, {7, 8, 9, 10}, {10, 11, 12, 13}})
Test({{0, 1, 2, 3, 4}, {5, 6, 7, 8, 9}, {10, 11, 12, 13, 14}, {15, 16, 17, 18, 19}, {20, 21, 22, 23, 24}})
End Sub
End Module
|
Maintain the same structure and functionality when rewriting this code in Go. | void bitwise(int a, int b)
{
printf("a and b: %d\n", a & b);
printf("a or b: %d\n", a | b);
printf("a xor b: %d\n", a ^ b);
printf("not a: %d\n", ~a);
printf("a << n: %d\n", a << b);
printf("a >> n: %d\n", a >> b);
unsigned int c = a;
printf("c >> b: %d\n", c >> b);
return 0;
}
| package main
import "fmt"
func bitwise(a, b int16) {
fmt.Printf("a: %016b\n", uint16(a))
fmt.Printf("b: %016b\n", uint16(b))
fmt.Printf("and: %016b\n", uint16(a&b))
fmt.Printf("or: %016b\n", uint16(a|b))
fmt.Printf("xor: %016b\n", uint16(a^b))
fmt.Printf("not: %016b\n", uint16(^a))
if b < 0 {
fmt.Println("Right operand is negative, but all shifts require an unsigned right operand (shift distance).")
return
}
ua := uint16(a)
ub := uint32(b)
fmt.Printf("shl: %016b\n", uint16(ua<<ub))
fmt.Printf("shr: %016b\n", uint16(ua>>ub))
fmt.Printf("las: %016b\n", uint16(a<<ub))
fmt.Printf("ras: %016b\n", uint16(a>>ub))
fmt.Printf("rol: %016b\n", uint16(a<<ub|int16(uint16(a)>>(16-ub))))
fmt.Printf("ror: %016b\n", uint16(int16(uint16(a)>>ub)|a<<(16-ub)))
}
func main() {
var a, b int16 = -460, 6
bitwise(a, b)
}
|
Convert this C snippet to Go and keep its semantics consistent. | #include <stdio.h>
#include <stdlib.h>
#include <string.h>
#include <math.h>
long long x, y, dx, dy, scale, clen;
typedef struct { double r, g, b; } rgb;
rgb ** pix;
void sc_up()
{
long long tmp = dx - dy; dy = dx + dy; dx = tmp;
scale *= 2; x *= 2; y *= 2;
}
void h_rgb(long long x, long long y)
{
rgb *p = &pix[y][x];
# define SAT 1
double h = 6.0 * clen / scale;
double VAL = 1 - (cos(3.141592653579 * 64 * clen / scale) - 1) / 4;
double c = SAT * VAL;
double X = c * (1 - fabs(fmod(h, 2) - 1));
switch((int)h) {
case 0: p->r += c; p->g += X; return;
case 1: p->r += X; p->g += c; return;
case 2: p->g += c; p->b += X; return;
case 3: p->g += X; p->b += c; return;
case 4: p->r += X; p->b += c; return;
default:
p->r += c; p->b += X;
}
}
void iter_string(const char * str, int d)
{
long tmp;
# define LEFT tmp = -dy; dy = dx; dx = tmp
# define RIGHT tmp = dy; dy = -dx; dx = tmp
while (*str != '\0') {
switch(*(str++)) {
case 'X': if (d) iter_string("X+YF+", d - 1); continue;
case 'Y': if (d) iter_string("-FX-Y", d - 1); continue;
case '+': RIGHT; continue;
case '-': LEFT; continue;
case 'F':
clen ++;
h_rgb(x/scale, y/scale);
x += dx; y += dy;
continue;
}
}
}
void dragon(long leng, int depth)
{
long i, d = leng / 3 + 1;
long h = leng + 3, w = leng + d * 3 / 2 + 2;
rgb *buf = malloc(sizeof(rgb) * w * h);
pix = malloc(sizeof(rgb *) * h);
for (i = 0; i < h; i++)
pix[i] = buf + w * i;
memset(buf, 0, sizeof(rgb) * w * h);
x = y = d; dx = leng; dy = 0; scale = 1; clen = 0;
for (i = 0; i < depth; i++) sc_up();
iter_string("FX", depth);
unsigned char *fpix = malloc(w * h * 3);
double maxv = 0, *dbuf = (double*)buf;
for (i = 3 * w * h - 1; i >= 0; i--)
if (dbuf[i] > maxv) maxv = dbuf[i];
for (i = 3 * h * w - 1; i >= 0; i--)
fpix[i] = 255 * dbuf[i] / maxv;
printf("P6\n%ld %ld\n255\n", w, h);
fflush(stdout);
fwrite(fpix, h * w * 3, 1, stdout);
}
int main(int c, char ** v)
{
int size, depth;
depth = (c > 1) ? atoi(v[1]) : 10;
size = 1 << depth;
fprintf(stderr, "size: %d depth: %d\n", size, depth);
dragon(size, depth * 2);
return 0;
}
| package main
import (
"fmt"
"image"
"image/color"
"image/draw"
"image/png"
"math"
"os"
)
const sep = 512
const depth = 14
var s = math.Sqrt2 / 2
var sin = []float64{0, s, 1, s, 0, -s, -1, -s}
var cos = []float64{1, s, 0, -s, -1, -s, 0, s}
var p = color.NRGBA{64, 192, 96, 255}
var b *image.NRGBA
func main() {
width := sep * 11 / 6
height := sep * 4 / 3
bounds := image.Rect(0, 0, width, height)
b = image.NewNRGBA(bounds)
draw.Draw(b, bounds, image.NewUniform(color.White), image.ZP, draw.Src)
dragon(14, 0, 1, sep, sep/2, sep*5/6)
f, err := os.Create("dragon.png")
if err != nil {
fmt.Println(err)
return
}
if err = png.Encode(f, b); err != nil {
fmt.Println(err)
}
if err = f.Close(); err != nil {
fmt.Println(err)
}
}
func dragon(n, a, t int, d, x, y float64) {
if n <= 1 {
x1 := int(x + .5)
y1 := int(y + .5)
x2 := int(x + d*cos[a] + .5)
y2 := int(y + d*sin[a] + .5)
xInc := 1
if x1 > x2 {
xInc = -1
}
yInc := 1
if y1 > y2 {
yInc = -1
}
for x, y := x1, y1; ; x, y = x+xInc, y+yInc {
b.Set(x, y, p)
if x == x2 {
break
}
}
return
}
d *= s
a1 := (a - t) & 7
a2 := (a + t) & 7
dragon(n-1, a1, 1, d, x, y)
dragon(n-1, a2, -1, d, x+d*cos[a1], y+d*sin[a1])
}
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.