Instruction stringlengths 45 106 | input_code stringlengths 1 13.7k | output_code stringlengths 1 13.7k |
|---|---|---|
Change the following Python code into C++ without altering its purpose. | import pyprimes
def primorial_prime(_pmax=500):
isprime = pyprimes.isprime
n, primo = 0, 1
for prime in pyprimes.nprimes(_pmax):
n, primo = n+1, primo * prime
if isprime(primo-1) or isprime(primo+1):
yield n
if __name__ == '__main__':
pyprimes.warn_probably = False
for i, n in zip(range(20), primorial_prime()):
print('Primorial prime %2i at primorial index: %3i' % (i+1, n))
| #include <cstdint>
#include <iostream>
#include <sstream>
#include <gmpxx.h>
typedef mpz_class integer;
bool is_probably_prime(const integer& n) {
return mpz_probab_prime_p(n.get_mpz_t(), 25) != 0;
}
bool is_prime(unsigned int n) {
if (n < 2)
return false;
if (n % 2 == 0)
return n == 2;
if (n % 3 == 0)
return n == 3;
for (unsigned int p = 5; p * p <= n; p += 4) {
if (n % p == 0)
return false;
p += 2;
if (n % p == 0)
return false;
}
return true;
}
int main() {
const unsigned int max = 20;
integer primorial = 1;
for (unsigned int p = 0, count = 0, index = 0; count < max; ++p) {
if (!is_prime(p))
continue;
primorial *= p;
++index;
if (is_probably_prime(primorial - 1) || is_probably_prime(primorial + 1)) {
if (count > 0)
std::cout << ' ';
std::cout << index;
++count;
}
}
std::cout << '\n';
return 0;
}
|
Convert the following code from Python to C++, ensuring the logic remains intact. | from collections import Counter
def basecount(dna):
return sorted(Counter(dna).items())
def seq_split(dna, n=50):
return [dna[i: i+n] for i in range(0, len(dna), n)]
def seq_pp(dna, n=50):
for i, part in enumerate(seq_split(dna, n)):
print(f"{i*n:>5}: {part}")
print("\n BASECOUNT:")
tot = 0
for base, count in basecount(dna):
print(f" {base:>3}: {count}")
tot += count
base, count = 'TOT', tot
print(f" {base:>3}= {count}")
if __name__ == '__main__':
print("SEQUENCE:")
sequence =
seq_pp(sequence)
| #include <map>
#include <string>
#include <iostream>
#include <iomanip>
const std::string DEFAULT_DNA = "CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATG"
"CTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTG"
"AGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGAT"
"GGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT"
"CGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGG"
"TCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA"
"TTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTAT"
"CGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTG"
"TCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGAC"
"GACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT";
class DnaBase {
public:
DnaBase(const std::string& dna = DEFAULT_DNA, int width = 50) : genome(dna), displayWidth(width) {
for (auto elm : dna) {
if (count.find(elm) == count.end())
count[elm] = 0;
++count[elm];
}
}
void viewGenome() {
std::cout << "Sequence:" << std::endl;
std::cout << std::endl;
int limit = genome.size() / displayWidth;
if (genome.size() % displayWidth != 0)
++limit;
for (int i = 0; i < limit; ++i) {
int beginPos = i * displayWidth;
std::cout << std::setw(4) << beginPos << " :" << std::setw(4) << genome.substr(beginPos, displayWidth) << std::endl;
}
std::cout << std::endl;
std::cout << "Base Count" << std::endl;
std::cout << "----------" << std::endl;
std::cout << std::endl;
int total = 0;
for (auto elm : count) {
std::cout << std::setw(4) << elm.first << " : " << elm.second << std::endl;
total += elm.second;
}
std::cout << std::endl;
std::cout << "Total: " << total << std::endl;
}
private:
std::string genome;
std::map<char, int> count;
int displayWidth;
};
int main(void) {
auto d = new DnaBase();
d->viewGenome();
delete d;
return 0;
}
|
Keep all operations the same but rewrite the snippet in C++. | from collections import Counter
def basecount(dna):
return sorted(Counter(dna).items())
def seq_split(dna, n=50):
return [dna[i: i+n] for i in range(0, len(dna), n)]
def seq_pp(dna, n=50):
for i, part in enumerate(seq_split(dna, n)):
print(f"{i*n:>5}: {part}")
print("\n BASECOUNT:")
tot = 0
for base, count in basecount(dna):
print(f" {base:>3}: {count}")
tot += count
base, count = 'TOT', tot
print(f" {base:>3}= {count}")
if __name__ == '__main__':
print("SEQUENCE:")
sequence =
seq_pp(sequence)
| #include <map>
#include <string>
#include <iostream>
#include <iomanip>
const std::string DEFAULT_DNA = "CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATG"
"CTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTG"
"AGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGAT"
"GGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT"
"CGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGG"
"TCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA"
"TTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTAT"
"CGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTG"
"TCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGAC"
"GACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT";
class DnaBase {
public:
DnaBase(const std::string& dna = DEFAULT_DNA, int width = 50) : genome(dna), displayWidth(width) {
for (auto elm : dna) {
if (count.find(elm) == count.end())
count[elm] = 0;
++count[elm];
}
}
void viewGenome() {
std::cout << "Sequence:" << std::endl;
std::cout << std::endl;
int limit = genome.size() / displayWidth;
if (genome.size() % displayWidth != 0)
++limit;
for (int i = 0; i < limit; ++i) {
int beginPos = i * displayWidth;
std::cout << std::setw(4) << beginPos << " :" << std::setw(4) << genome.substr(beginPos, displayWidth) << std::endl;
}
std::cout << std::endl;
std::cout << "Base Count" << std::endl;
std::cout << "----------" << std::endl;
std::cout << std::endl;
int total = 0;
for (auto elm : count) {
std::cout << std::setw(4) << elm.first << " : " << elm.second << std::endl;
total += elm.second;
}
std::cout << std::endl;
std::cout << "Total: " << total << std::endl;
}
private:
std::string genome;
std::map<char, int> count;
int displayWidth;
};
int main(void) {
auto d = new DnaBase();
d->viewGenome();
delete d;
return 0;
}
|
Port the provided Python code into C++ while preserving the original functionality. | import threading
import random
import time
class Philosopher(threading.Thread):
running = True
def __init__(self, xname, forkOnLeft, forkOnRight):
threading.Thread.__init__(self)
self.name = xname
self.forkOnLeft = forkOnLeft
self.forkOnRight = forkOnRight
def run(self):
while(self.running):
time.sleep( random.uniform(3,13))
print '%s is hungry.' % self.name
self.dine()
def dine(self):
fork1, fork2 = self.forkOnLeft, self.forkOnRight
while self.running:
fork1.acquire(True)
locked = fork2.acquire(False)
if locked: break
fork1.release()
print '%s swaps forks' % self.name
fork1, fork2 = fork2, fork1
else:
return
self.dining()
fork2.release()
fork1.release()
def dining(self):
print '%s starts eating '% self.name
time.sleep(random.uniform(1,10))
print '%s finishes eating and leaves to think.' % self.name
def DiningPhilosophers():
forks = [threading.Lock() for n in range(5)]
philosopherNames = ('Aristotle','Kant','Spinoza','Marx', 'Russel')
philosophers= [Philosopher(philosopherNames[i], forks[i%5], forks[(i+1)%5]) \
for i in range(5)]
random.seed(507129)
Philosopher.running = True
for p in philosophers: p.start()
time.sleep(100)
Philosopher.running = False
print ("Now we're finishing.")
DiningPhilosophers()
| #include <algorithm>
#include <array>
#include <chrono>
#include <iostream>
#include <mutex>
#include <random>
#include <string>
#include <string_view>
#include <thread>
const int timeScale = 42;
void Message(std::string_view message)
{
static std::mutex cout_mutex;
std::scoped_lock cout_lock(cout_mutex);
std::cout << message << std::endl;
}
struct Fork {
std::mutex mutex;
};
struct Dinner {
std::array<Fork, 5> forks;
~Dinner() { Message("Dinner is over"); }
};
class Philosopher
{
std::mt19937 rng{std::random_device {}()};
const std::string name;
Fork& left;
Fork& right;
std::thread worker;
void live();
void dine();
void ponder();
public:
Philosopher(std::string name_, Fork& l, Fork& r)
: name(std::move(name_)), left(l), right(r), worker(&Philosopher::live, this)
{}
~Philosopher()
{
worker.join();
Message(name + " went to sleep.");
}
};
void Philosopher::live()
{
for(;;)
{
{
std::scoped_lock dine_lock(left.mutex, right.mutex);
dine();
}
ponder();
}
}
void Philosopher::dine()
{
Message(name + " started eating.");
thread_local std::array<const char*, 3> foods {"chicken", "rice", "soda"};
thread_local std::array<const char*, 3> reactions {
"I like this %s!", "This %s is good.", "Mmm, %s..."
};
thread_local std::uniform_int_distribution<> dist(1, 6);
std::shuffle( foods.begin(), foods.end(), rng);
std::shuffle(reactions.begin(), reactions.end(), rng);
constexpr size_t buf_size = 64;
char buffer[buf_size];
for(int i = 0; i < 3; ++i) {
std::this_thread::sleep_for(std::chrono::milliseconds(dist(rng) * timeScale));
snprintf(buffer, buf_size, reactions[i], foods[i]);
Message(name + ": " + buffer);
}
std::this_thread::sleep_for(std::chrono::milliseconds(dist(rng)) * timeScale);
Message(name + " finished and left.");
}
void Philosopher::ponder()
{
static constexpr std::array<const char*, 5> topics {{
"politics", "art", "meaning of life", "source of morality", "how many straws makes a bale"
}};
thread_local std::uniform_int_distribution<> wait(1, 6);
thread_local std::uniform_int_distribution<> dist(0, topics.size() - 1);
while(dist(rng) > 0) {
std::this_thread::sleep_for(std::chrono::milliseconds(wait(rng) * 3 * timeScale));
Message(name + " is pondering about " + topics[dist(rng)] + ".");
}
std::this_thread::sleep_for(std::chrono::milliseconds(wait(rng) * 3 * timeScale));
Message(name + " is hungry again!");
}
int main()
{
Dinner dinner;
Message("Dinner started!");
std::array<Philosopher, 5> philosophers {{
{"Aristotle", dinner.forks[0], dinner.forks[1]},
{"Democritus", dinner.forks[1], dinner.forks[2]},
{"Plato", dinner.forks[2], dinner.forks[3]},
{"Pythagoras", dinner.forks[3], dinner.forks[4]},
{"Socrates", dinner.forks[4], dinner.forks[0]},
}};
Message("It is dark outside...");
}
|
Maintain the same structure and functionality when rewriting this code in C++. | fact = [1]
for n in range(1, 12):
fact.append(fact[n-1] * n)
for b in range(9, 12+1):
print(f"The factorions for base {b} are:")
for i in range(1, 1500000):
fact_sum = 0
j = i
while j > 0:
d = j % b
fact_sum += fact[d]
j = j//b
if fact_sum == i:
print(i, end=" ")
print("\n")
| #include <iostream>
class factorion_t {
public:
factorion_t() {
f[0] = 1u;
for (uint n = 1u; n < 12u; n++)
f[n] = f[n - 1] * n;
}
bool operator()(uint i, uint b) const {
uint sum = 0;
for (uint j = i; j > 0u; j /= b)
sum += f[j % b];
return sum == i;
}
private:
ulong f[12];
};
int main() {
factorion_t factorion;
for (uint b = 9u; b <= 12u; ++b) {
std::cout << "factorions for base " << b << ':';
for (uint i = 1u; i < 1500000u; ++i)
if (factorion(i, b))
std::cout << ' ' << i;
std::cout << std::endl;
}
return 0;
}
|
Preserve the algorithm and functionality while converting the code from Python to C++. | fact = [1]
for n in range(1, 12):
fact.append(fact[n-1] * n)
for b in range(9, 12+1):
print(f"The factorions for base {b} are:")
for i in range(1, 1500000):
fact_sum = 0
j = i
while j > 0:
d = j % b
fact_sum += fact[d]
j = j//b
if fact_sum == i:
print(i, end=" ")
print("\n")
| #include <iostream>
class factorion_t {
public:
factorion_t() {
f[0] = 1u;
for (uint n = 1u; n < 12u; n++)
f[n] = f[n - 1] * n;
}
bool operator()(uint i, uint b) const {
uint sum = 0;
for (uint j = i; j > 0u; j /= b)
sum += f[j % b];
return sum == i;
}
private:
ulong f[12];
};
int main() {
factorion_t factorion;
for (uint b = 9u; b <= 12u; ++b) {
std::cout << "factorions for base " << b << ':';
for (uint i = 1u; i < 1500000u; ++i)
if (factorion(i, b))
std::cout << ' ' << i;
std::cout << std::endl;
}
return 0;
}
|
Produce a language-to-language conversion: from Python to C++, same semantics. | import numpy as np
import scipy.optimize as opt
n0, K = 27, 7_800_000_000
def f(t, r):
return (n0 * np.exp(r * t)) / (( 1 + n0 * (np.exp(r * t) - 1) / K))
y = [
27, 27, 27, 44, 44, 59, 59, 59, 59, 59, 59, 59, 59, 60, 60,
61, 61, 66, 83, 219, 239, 392, 534, 631, 897, 1350, 2023,
2820, 4587, 6067, 7823, 9826, 11946, 14554, 17372, 20615,
24522, 28273, 31491, 34933, 37552, 40540, 43105, 45177,
60328, 64543, 67103, 69265, 71332, 73327, 75191, 75723,
76719, 77804, 78812, 79339, 80132, 80995, 82101, 83365,
85203, 87024, 89068, 90664, 93077, 95316, 98172, 102133,
105824, 109695, 114232, 118610, 125497, 133852, 143227,
151367, 167418, 180096, 194836, 213150, 242364, 271106,
305117, 338133, 377918, 416845, 468049, 527767, 591704,
656866, 715353, 777796, 851308, 928436, 1000249, 1082054,
1174652,
]
x = np.linspace(0.0, 96, 97)
r, cov = opt.curve_fit(f, x, y, [0.5])
print("The r for the world Covid-19 data is:", r,
", with covariance of", cov)
print("The calculated R0 is then", np.exp(12 * r))
| #include <cmath>
#include <functional>
#include <iostream>
constexpr double K = 7.8e9;
constexpr int n0 = 27;
constexpr double actual[] = {
27, 27, 27, 44, 44, 59, 59, 59, 59, 59, 59, 59, 59, 60, 60,
61, 61, 66, 83, 219, 239, 392, 534, 631, 897, 1350, 2023, 2820,
4587, 6067, 7823, 9826, 11946, 14554, 17372, 20615, 24522, 28273,
31491, 34933, 37552, 40540, 43105, 45177, 60328, 64543, 67103,
69265, 71332, 73327, 75191, 75723, 76719, 77804, 78812, 79339,
80132, 80995, 82101, 83365, 85203, 87024, 89068, 90664, 93077,
95316, 98172, 102133, 105824, 109695, 114232, 118610, 125497,
133852, 143227, 151367, 167418, 180096, 194836, 213150, 242364,
271106, 305117, 338133, 377918, 416845, 468049, 527767, 591704,
656866, 715353, 777796, 851308, 928436, 1000249, 1082054, 1174652
};
double f(double r) {
double sq = 0;
constexpr size_t len = std::size(actual);
for (size_t i = 0; i < len; ++i) {
double eri = std::exp(r * i);
double guess = (n0 * eri)/(1 + n0 * (eri - 1)/K);
double diff = guess - actual[i];
sq += diff * diff;
}
return sq;
}
double solve(std::function<double(double)> fn, double guess=0.5, double epsilon=0) {
for (double delta = guess ? guess : 1, f0 = fn(guess), factor = 2;
delta > epsilon && guess != guess - delta;
delta *= factor) {
double nf = fn(guess - delta);
if (nf < f0) {
f0 = nf;
guess -= delta;
} else {
nf = fn(guess + delta);
if (nf < f0) {
f0 = nf;
guess += delta;
} else
factor = 0.5;
}
}
return guess;
}
int main() {
double r = solve(f);
double R0 = std::exp(12 * r);
std::cout << "r = " << r << ", R0 = " << R0 << '\n';
return 0;
}
|
Can you help me rewrite this code in C++ instead of Python, keeping it the same logically? | def merge_list(a, b):
out = []
while len(a) and len(b):
if a[0] < b[0]:
out.append(a.pop(0))
else:
out.append(b.pop(0))
out += a
out += b
return out
def strand(a):
i, s = 0, [a.pop(0)]
while i < len(a):
if a[i] > s[-1]:
s.append(a.pop(i))
else:
i += 1
return s
def strand_sort(a):
out = strand(a)
while len(a):
out = merge_list(out, strand(a))
return out
print strand_sort([1, 6, 3, 2, 1, 7, 5, 3])
| #include <list>
template <typename T>
std::list<T> strandSort(std::list<T> lst) {
if (lst.size() <= 1)
return lst;
std::list<T> result;
std::list<T> sorted;
while (!lst.empty()) {
sorted.push_back(lst.front());
lst.pop_front();
for (typename std::list<T>::iterator it = lst.begin(); it != lst.end(); ) {
if (sorted.back() <= *it) {
sorted.push_back(*it);
it = lst.erase(it);
} else
it++;
}
result.merge(sorted);
}
return result;
}
|
Write the same algorithm in C++ as shown in this Python implementation. | def is_prime(n: int) -> bool:
if n <= 3:
return n > 1
if n % 2 == 0 or n % 3 == 0:
return False
i = 5
while i ** 2 <= n:
if n % i == 0 or n % (i + 2) == 0:
return False
i += 6
return True
def digit_sum(n: int) -> int:
sum = 0
while n > 0:
sum += n % 10
n //= 10
return sum
def main() -> None:
additive_primes = 0
for i in range(2, 500):
if is_prime(i) and is_prime(digit_sum(i)):
additive_primes += 1
print(i, end=" ")
print(f"\nFound {additive_primes} additive primes less than 500")
if __name__ == "__main__":
main()
| #include <iomanip>
#include <iostream>
bool is_prime(unsigned int n) {
if (n < 2)
return false;
if (n % 2 == 0)
return n == 2;
if (n % 3 == 0)
return n == 3;
for (unsigned int p = 5; p * p <= n; p += 4) {
if (n % p == 0)
return false;
p += 2;
if (n % p == 0)
return false;
}
return true;
}
unsigned int digit_sum(unsigned int n) {
unsigned int sum = 0;
for (; n > 0; n /= 10)
sum += n % 10;
return sum;
}
int main() {
const unsigned int limit = 500;
std::cout << "Additive primes less than " << limit << ":\n";
unsigned int count = 0;
for (unsigned int n = 1; n < limit; ++n) {
if (is_prime(digit_sum(n)) && is_prime(n)) {
std::cout << std::setw(3) << n;
if (++count % 10 == 0)
std::cout << '\n';
else
std::cout << ' ';
}
}
std::cout << '\n' << count << " additive primes found.\n";
}
|
Ensure the translated C++ code behaves exactly like the original Python snippet. | x = truevalue if condition else falsevalue
| class invertedAssign {
int data;
public:
invertedAssign(int data):data(data){}
int getData(){return data;}
void operator=(invertedAssign& other) const {
other.data = this->data;
}
};
#include <iostream>
int main(){
invertedAssign a = 0;
invertedAssign b = 42;
std::cout << a.getData() << ' ' << b.getData() << '\n';
b = a;
std::cout << a.getData() << ' ' << b.getData() << '\n';
}
|
Port the following code from Python to C++ with equivalent syntax and logic. | x = truevalue if condition else falsevalue
| class invertedAssign {
int data;
public:
invertedAssign(int data):data(data){}
int getData(){return data;}
void operator=(invertedAssign& other) const {
other.data = this->data;
}
};
#include <iostream>
int main(){
invertedAssign a = 0;
invertedAssign b = 42;
std::cout << a.getData() << ' ' << b.getData() << '\n';
b = a;
std::cout << a.getData() << ' ' << b.getData() << '\n';
}
|
Translate the given Python code snippet into C++ without altering its behavior. | from math import gcd
from functools import lru_cache
from itertools import islice, count
@lru_cache(maxsize=None)
def φ(n):
return sum(1 for k in range(1, n + 1) if gcd(n, k) == 1)
def perfect_totient():
for n0 in count(1):
parts, n = 0, n0
while n != 1:
n = φ(n)
parts += n
if parts == n0:
yield n0
if __name__ == '__main__':
print(list(islice(perfect_totient(), 20)))
| #include <cassert>
#include <iostream>
#include <vector>
class totient_calculator {
public:
explicit totient_calculator(int max) : totient_(max + 1) {
for (int i = 1; i <= max; ++i)
totient_[i] = i;
for (int i = 2; i <= max; ++i) {
if (totient_[i] < i)
continue;
for (int j = i; j <= max; j += i)
totient_[j] -= totient_[j] / i;
}
}
int totient(int n) const {
assert (n >= 1 && n < totient_.size());
return totient_[n];
}
bool is_prime(int n) const {
return totient(n) == n - 1;
}
private:
std::vector<int> totient_;
};
bool perfect_totient_number(const totient_calculator& tc, int n) {
int sum = 0;
for (int m = n; m > 1; ) {
int t = tc.totient(m);
sum += t;
m = t;
}
return sum == n;
}
int main() {
totient_calculator tc(10000);
int count = 0, n = 1;
std::cout << "First 20 perfect totient numbers:\n";
for (; count < 20; ++n) {
if (perfect_totient_number(tc, n)) {
if (count > 0)
std::cout << ' ';
++count;
std::cout << n;
}
}
std::cout << '\n';
return 0;
}
|
Write the same code in C++ as shown below in Python. | from math import gcd
from functools import lru_cache
from itertools import islice, count
@lru_cache(maxsize=None)
def φ(n):
return sum(1 for k in range(1, n + 1) if gcd(n, k) == 1)
def perfect_totient():
for n0 in count(1):
parts, n = 0, n0
while n != 1:
n = φ(n)
parts += n
if parts == n0:
yield n0
if __name__ == '__main__':
print(list(islice(perfect_totient(), 20)))
| #include <cassert>
#include <iostream>
#include <vector>
class totient_calculator {
public:
explicit totient_calculator(int max) : totient_(max + 1) {
for (int i = 1; i <= max; ++i)
totient_[i] = i;
for (int i = 2; i <= max; ++i) {
if (totient_[i] < i)
continue;
for (int j = i; j <= max; j += i)
totient_[j] -= totient_[j] / i;
}
}
int totient(int n) const {
assert (n >= 1 && n < totient_.size());
return totient_[n];
}
bool is_prime(int n) const {
return totient(n) == n - 1;
}
private:
std::vector<int> totient_;
};
bool perfect_totient_number(const totient_calculator& tc, int n) {
int sum = 0;
for (int m = n; m > 1; ) {
int t = tc.totient(m);
sum += t;
m = t;
}
return sum == n;
}
int main() {
totient_calculator tc(10000);
int count = 0, n = 1;
std::cout << "First 20 perfect totient numbers:\n";
for (; count < 20; ++n) {
if (perfect_totient_number(tc, n)) {
if (count > 0)
std::cout << ' ';
++count;
std::cout << n;
}
}
std::cout << '\n';
return 0;
}
|
Rewrite the snippet below in C++ so it works the same as the original Python code. | from math import gcd
from functools import lru_cache
from itertools import islice, count
@lru_cache(maxsize=None)
def φ(n):
return sum(1 for k in range(1, n + 1) if gcd(n, k) == 1)
def perfect_totient():
for n0 in count(1):
parts, n = 0, n0
while n != 1:
n = φ(n)
parts += n
if parts == n0:
yield n0
if __name__ == '__main__':
print(list(islice(perfect_totient(), 20)))
| #include <cassert>
#include <iostream>
#include <vector>
class totient_calculator {
public:
explicit totient_calculator(int max) : totient_(max + 1) {
for (int i = 1; i <= max; ++i)
totient_[i] = i;
for (int i = 2; i <= max; ++i) {
if (totient_[i] < i)
continue;
for (int j = i; j <= max; j += i)
totient_[j] -= totient_[j] / i;
}
}
int totient(int n) const {
assert (n >= 1 && n < totient_.size());
return totient_[n];
}
bool is_prime(int n) const {
return totient(n) == n - 1;
}
private:
std::vector<int> totient_;
};
bool perfect_totient_number(const totient_calculator& tc, int n) {
int sum = 0;
for (int m = n; m > 1; ) {
int t = tc.totient(m);
sum += t;
m = t;
}
return sum == n;
}
int main() {
totient_calculator tc(10000);
int count = 0, n = 1;
std::cout << "First 20 perfect totient numbers:\n";
for (; count < 20; ++n) {
if (perfect_totient_number(tc, n)) {
if (count > 0)
std::cout << ' ';
++count;
std::cout << n;
}
}
std::cout << '\n';
return 0;
}
|
Maintain the same structure and functionality when rewriting this code in C++. | class Delegator:
def __init__(self):
self.delegate = None
def operation(self):
if hasattr(self.delegate, 'thing') and callable(self.delegate.thing):
return self.delegate.thing()
return 'default implementation'
class Delegate:
def thing(self):
return 'delegate implementation'
if __name__ == '__main__':
a = Delegator()
assert a.operation() == 'default implementation'
a.delegate = 'A delegate may be any object'
assert a.operation() == 'default implementation'
a.delegate = Delegate()
assert a.operation() == 'delegate implementation'
| #include <tr1/memory>
#include <string>
#include <iostream>
#include <tr1/functional>
using namespace std;
using namespace std::tr1;
using std::tr1::function;
class IDelegate
{
public:
virtual ~IDelegate() {}
};
class IThing
{
public:
virtual ~IThing() {}
virtual std::string Thing() = 0;
};
class DelegateA : virtual public IDelegate
{
};
class DelegateB : public IThing, public IDelegate
{
std::string Thing()
{
return "delegate implementation";
}
};
class Delegator
{
public:
std::string Operation()
{
if(Delegate)
if (IThing * pThing = dynamic_cast<IThing*>(Delegate.get()))
return pThing->Thing();
return "default implementation";
}
shared_ptr<IDelegate> Delegate;
};
int main()
{
shared_ptr<DelegateA> delegateA(new DelegateA());
shared_ptr<DelegateB> delegateB(new DelegateB());
Delegator delegator;
std::cout << delegator.Operation() << std::endl;
delegator.Delegate = delegateA;
std::cout << delegator.Operation() << std::endl;
delegator.Delegate = delegateB;
std::cout << delegator.Operation() << std::endl;
}
|
Translate this program into C++ but keep the logic exactly as in Python. | def factorize(n):
assert(isinstance(n, int))
if n < 0:
n = -n
if n < 2:
return
k = 0
while 0 == n%2:
k += 1
n //= 2
if 0 < k:
yield (2,k)
p = 3
while p*p <= n:
k = 0
while 0 == n%p:
k += 1
n //= p
if 0 < k:
yield (p,k)
p += 2
if 1 < n:
yield (n,1)
def sum_of_divisors(n):
assert(n != 0)
ans = 1
for (p,k) in factorize(n):
ans *= (pow(p,k+1) - 1)//(p-1)
return ans
if __name__ == "__main__":
print([sum_of_divisors(n) for n in range(1,101)])
| #include <iomanip>
#include <iostream>
unsigned int divisor_sum(unsigned int n) {
unsigned int total = 1, power = 2;
for (; (n & 1) == 0; power <<= 1, n >>= 1)
total += power;
for (unsigned int p = 3; p * p <= n; p += 2) {
unsigned int sum = 1;
for (power = p; n % p == 0; power *= p, n /= p)
sum += power;
total *= sum;
}
if (n > 1)
total *= n + 1;
return total;
}
int main() {
const unsigned int limit = 100;
std::cout << "Sum of divisors for the first " << limit << " positive integers:\n";
for (unsigned int n = 1; n <= limit; ++n) {
std::cout << std::setw(4) << divisor_sum(n);
if (n % 10 == 0)
std::cout << '\n';
}
}
|
Write the same code in C++ as shown below in Python. | def factorize(n):
assert(isinstance(n, int))
if n < 0:
n = -n
if n < 2:
return
k = 0
while 0 == n%2:
k += 1
n //= 2
if 0 < k:
yield (2,k)
p = 3
while p*p <= n:
k = 0
while 0 == n%p:
k += 1
n //= p
if 0 < k:
yield (p,k)
p += 2
if 1 < n:
yield (n,1)
def sum_of_divisors(n):
assert(n != 0)
ans = 1
for (p,k) in factorize(n):
ans *= (pow(p,k+1) - 1)//(p-1)
return ans
if __name__ == "__main__":
print([sum_of_divisors(n) for n in range(1,101)])
| #include <iomanip>
#include <iostream>
unsigned int divisor_sum(unsigned int n) {
unsigned int total = 1, power = 2;
for (; (n & 1) == 0; power <<= 1, n >>= 1)
total += power;
for (unsigned int p = 3; p * p <= n; p += 2) {
unsigned int sum = 1;
for (power = p; n % p == 0; power *= p, n /= p)
sum += power;
total *= sum;
}
if (n > 1)
total *= n + 1;
return total;
}
int main() {
const unsigned int limit = 100;
std::cout << "Sum of divisors for the first " << limit << " positive integers:\n";
for (unsigned int n = 1; n <= limit; ++n) {
std::cout << std::setw(4) << divisor_sum(n);
if (n % 10 == 0)
std::cout << '\n';
}
}
|
Generate a C++ translation of this Python snippet without changing its computational steps. | command_table_text = \
user_words = "riG rePEAT copies put mo rest types fup. 6 poweRin"
def find_abbreviations_length(command_table_text):
command_table = dict()
for word in command_table_text.split():
abbr_len = sum(1 for c in word if c.isupper())
if abbr_len == 0:
abbr_len = len(word)
command_table[word] = abbr_len
return command_table
def find_abbreviations(command_table):
abbreviations = dict()
for command, min_abbr_len in command_table.items():
for l in range(min_abbr_len, len(command)+1):
abbr = command[:l].lower()
abbreviations[abbr] = command.upper()
return abbreviations
def parse_user_string(user_string, abbreviations):
user_words = [word.lower() for word in user_string.split()]
commands = [abbreviations.get(user_word, "*error*") for user_word in user_words]
return " ".join(commands)
command_table = find_abbreviations_length(command_table_text)
abbreviations_table = find_abbreviations(command_table)
full_words = parse_user_string(user_words, abbreviations_table)
print("user words:", user_words)
print("full words:", full_words)
| #include <algorithm>
#include <cctype>
#include <iostream>
#include <sstream>
#include <string>
#include <vector>
const char* command_table =
"Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy "
"COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find "
"NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput "
"Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO "
"MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT "
"READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT "
"RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up";
class command {
public:
command(const std::string&, size_t);
const std::string& cmd() const { return cmd_; }
size_t min_length() const { return min_len_; }
bool match(const std::string&) const;
private:
std::string cmd_;
size_t min_len_;
};
command::command(const std::string& cmd, size_t min_len)
: cmd_(cmd), min_len_(min_len) {}
bool command::match(const std::string& str) const {
size_t olen = str.length();
return olen >= min_len_ && olen <= cmd_.length()
&& cmd_.compare(0, olen, str) == 0;
}
void uppercase(std::string& str) {
std::transform(str.begin(), str.end(), str.begin(),
[](unsigned char c) -> unsigned char { return std::toupper(c); });
}
size_t get_min_length(const std::string& str) {
size_t len = 0, n = str.length();
while (len < n && std::isupper(static_cast<unsigned char>(str[len])))
++len;
return len;
}
class command_list {
public:
explicit command_list(const char*);
const command* find_command(const std::string&) const;
private:
std::vector<command> commands_;
};
command_list::command_list(const char* table) {
std::vector<command> commands;
std::istringstream is(table);
std::string word;
while (is >> word) {
size_t len = get_min_length(word);
uppercase(word);
commands_.push_back(command(word, len));
}
}
const command* command_list::find_command(const std::string& word) const {
auto iter = std::find_if(commands_.begin(), commands_.end(),
[&word](const command& cmd) { return cmd.match(word); });
return (iter != commands_.end()) ? &*iter : nullptr;
}
std::string test(const command_list& commands, const std::string& input) {
std::string output;
std::istringstream is(input);
std::string word;
while (is >> word) {
if (!output.empty())
output += ' ';
uppercase(word);
const command* cmd_ptr = commands.find_command(word);
if (cmd_ptr)
output += cmd_ptr->cmd();
else
output += "*error*";
}
return output;
}
int main() {
command_list commands(command_table);
std::string input("riG rePEAT copies put mo rest types fup. 6 poweRin");
std::string output(test(commands, input));
std::cout << " input: " << input << '\n';
std::cout << "output: " << output << '\n';
return 0;
}
|
Translate the given Python code snippet into C++ without altering its behavior. | command_table_text = \
user_words = "riG rePEAT copies put mo rest types fup. 6 poweRin"
def find_abbreviations_length(command_table_text):
command_table = dict()
for word in command_table_text.split():
abbr_len = sum(1 for c in word if c.isupper())
if abbr_len == 0:
abbr_len = len(word)
command_table[word] = abbr_len
return command_table
def find_abbreviations(command_table):
abbreviations = dict()
for command, min_abbr_len in command_table.items():
for l in range(min_abbr_len, len(command)+1):
abbr = command[:l].lower()
abbreviations[abbr] = command.upper()
return abbreviations
def parse_user_string(user_string, abbreviations):
user_words = [word.lower() for word in user_string.split()]
commands = [abbreviations.get(user_word, "*error*") for user_word in user_words]
return " ".join(commands)
command_table = find_abbreviations_length(command_table_text)
abbreviations_table = find_abbreviations(command_table)
full_words = parse_user_string(user_words, abbreviations_table)
print("user words:", user_words)
print("full words:", full_words)
| #include <algorithm>
#include <cctype>
#include <iostream>
#include <sstream>
#include <string>
#include <vector>
const char* command_table =
"Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy "
"COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find "
"NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput "
"Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO "
"MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT "
"READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT "
"RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up";
class command {
public:
command(const std::string&, size_t);
const std::string& cmd() const { return cmd_; }
size_t min_length() const { return min_len_; }
bool match(const std::string&) const;
private:
std::string cmd_;
size_t min_len_;
};
command::command(const std::string& cmd, size_t min_len)
: cmd_(cmd), min_len_(min_len) {}
bool command::match(const std::string& str) const {
size_t olen = str.length();
return olen >= min_len_ && olen <= cmd_.length()
&& cmd_.compare(0, olen, str) == 0;
}
void uppercase(std::string& str) {
std::transform(str.begin(), str.end(), str.begin(),
[](unsigned char c) -> unsigned char { return std::toupper(c); });
}
size_t get_min_length(const std::string& str) {
size_t len = 0, n = str.length();
while (len < n && std::isupper(static_cast<unsigned char>(str[len])))
++len;
return len;
}
class command_list {
public:
explicit command_list(const char*);
const command* find_command(const std::string&) const;
private:
std::vector<command> commands_;
};
command_list::command_list(const char* table) {
std::vector<command> commands;
std::istringstream is(table);
std::string word;
while (is >> word) {
size_t len = get_min_length(word);
uppercase(word);
commands_.push_back(command(word, len));
}
}
const command* command_list::find_command(const std::string& word) const {
auto iter = std::find_if(commands_.begin(), commands_.end(),
[&word](const command& cmd) { return cmd.match(word); });
return (iter != commands_.end()) ? &*iter : nullptr;
}
std::string test(const command_list& commands, const std::string& input) {
std::string output;
std::istringstream is(input);
std::string word;
while (is >> word) {
if (!output.empty())
output += ' ';
uppercase(word);
const command* cmd_ptr = commands.find_command(word);
if (cmd_ptr)
output += cmd_ptr->cmd();
else
output += "*error*";
}
return output;
}
int main() {
command_list commands(command_table);
std::string input("riG rePEAT copies put mo rest types fup. 6 poweRin");
std::string output(test(commands, input));
std::cout << " input: " << input << '\n';
std::cout << "output: " << output << '\n';
return 0;
}
|
Translate this program into C++ but keep the logic exactly as in Python. | command_table_text = \
user_words = "riG rePEAT copies put mo rest types fup. 6 poweRin"
def find_abbreviations_length(command_table_text):
command_table = dict()
for word in command_table_text.split():
abbr_len = sum(1 for c in word if c.isupper())
if abbr_len == 0:
abbr_len = len(word)
command_table[word] = abbr_len
return command_table
def find_abbreviations(command_table):
abbreviations = dict()
for command, min_abbr_len in command_table.items():
for l in range(min_abbr_len, len(command)+1):
abbr = command[:l].lower()
abbreviations[abbr] = command.upper()
return abbreviations
def parse_user_string(user_string, abbreviations):
user_words = [word.lower() for word in user_string.split()]
commands = [abbreviations.get(user_word, "*error*") for user_word in user_words]
return " ".join(commands)
command_table = find_abbreviations_length(command_table_text)
abbreviations_table = find_abbreviations(command_table)
full_words = parse_user_string(user_words, abbreviations_table)
print("user words:", user_words)
print("full words:", full_words)
| #include <algorithm>
#include <cctype>
#include <iostream>
#include <sstream>
#include <string>
#include <vector>
const char* command_table =
"Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy "
"COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find "
"NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput "
"Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO "
"MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT "
"READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT "
"RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up";
class command {
public:
command(const std::string&, size_t);
const std::string& cmd() const { return cmd_; }
size_t min_length() const { return min_len_; }
bool match(const std::string&) const;
private:
std::string cmd_;
size_t min_len_;
};
command::command(const std::string& cmd, size_t min_len)
: cmd_(cmd), min_len_(min_len) {}
bool command::match(const std::string& str) const {
size_t olen = str.length();
return olen >= min_len_ && olen <= cmd_.length()
&& cmd_.compare(0, olen, str) == 0;
}
void uppercase(std::string& str) {
std::transform(str.begin(), str.end(), str.begin(),
[](unsigned char c) -> unsigned char { return std::toupper(c); });
}
size_t get_min_length(const std::string& str) {
size_t len = 0, n = str.length();
while (len < n && std::isupper(static_cast<unsigned char>(str[len])))
++len;
return len;
}
class command_list {
public:
explicit command_list(const char*);
const command* find_command(const std::string&) const;
private:
std::vector<command> commands_;
};
command_list::command_list(const char* table) {
std::vector<command> commands;
std::istringstream is(table);
std::string word;
while (is >> word) {
size_t len = get_min_length(word);
uppercase(word);
commands_.push_back(command(word, len));
}
}
const command* command_list::find_command(const std::string& word) const {
auto iter = std::find_if(commands_.begin(), commands_.end(),
[&word](const command& cmd) { return cmd.match(word); });
return (iter != commands_.end()) ? &*iter : nullptr;
}
std::string test(const command_list& commands, const std::string& input) {
std::string output;
std::istringstream is(input);
std::string word;
while (is >> word) {
if (!output.empty())
output += ' ';
uppercase(word);
const command* cmd_ptr = commands.find_command(word);
if (cmd_ptr)
output += cmd_ptr->cmd();
else
output += "*error*";
}
return output;
}
int main() {
command_list commands(command_table);
std::string input("riG rePEAT copies put mo rest types fup. 6 poweRin");
std::string output(test(commands, input));
std::cout << " input: " << input << '\n';
std::cout << "output: " << output << '\n';
return 0;
}
|
Translate the given Python code snippet into C++ without altering its behavior. | >>> s = "Hello"
>>> s[0] = "h"
Traceback (most recent call last):
File "<pyshell
s[0] = "h"
TypeError: 'str' object does not support item assignment
| #include <iostream>
class MyOtherClass
{
public:
const int m_x;
MyOtherClass(const int initX = 0) : m_x(initX) { }
};
int main()
{
MyOtherClass mocA, mocB(7);
std::cout << mocA.m_x << std::endl;
std::cout << mocB.m_x << std::endl;
return 0;
}
|
Write the same code in C++ as shown below in Python. | def clip(subjectPolygon, clipPolygon):
def inside(p):
return(cp2[0]-cp1[0])*(p[1]-cp1[1]) > (cp2[1]-cp1[1])*(p[0]-cp1[0])
def computeIntersection():
dc = [ cp1[0] - cp2[0], cp1[1] - cp2[1] ]
dp = [ s[0] - e[0], s[1] - e[1] ]
n1 = cp1[0] * cp2[1] - cp1[1] * cp2[0]
n2 = s[0] * e[1] - s[1] * e[0]
n3 = 1.0 / (dc[0] * dp[1] - dc[1] * dp[0])
return [(n1*dp[0] - n2*dc[0]) * n3, (n1*dp[1] - n2*dc[1]) * n3]
outputList = subjectPolygon
cp1 = clipPolygon[-1]
for clipVertex in clipPolygon:
cp2 = clipVertex
inputList = outputList
outputList = []
s = inputList[-1]
for subjectVertex in inputList:
e = subjectVertex
if inside(e):
if not inside(s):
outputList.append(computeIntersection())
outputList.append(e)
elif inside(s):
outputList.append(computeIntersection())
s = e
cp1 = cp2
return(outputList)
| #include <iostream>
#include <span>
#include <vector>
struct vec2 {
float x = 0.0f, y = 0.0f;
constexpr vec2 operator+(vec2 other) const {
return vec2{x + other.x, y + other.y};
}
constexpr vec2 operator-(vec2 other) const {
return vec2{x - other.x, y - other.y};
}
};
constexpr vec2 operator*(vec2 a, float b) { return vec2{a.x * b, a.y * b}; }
constexpr float dot(vec2 a, vec2 b) { return a.x * b.x + a.y * b.y; }
constexpr float cross(vec2 a, vec2 b) { return a.x * b.y - b.x * a.y; }
constexpr bool is_inside(vec2 point, vec2 a, vec2 b) {
return (cross(a - b, point) + cross(b, a)) < 0.0f;
}
constexpr vec2 intersection(vec2 a1, vec2 a2, vec2 b1, vec2 b2) {
return ((b1 - b2) * cross(a1, a2) - (a1 - a2) * cross(b1, b2)) *
(1.0f / cross(a1 - a2, b1 - b2));
}
std::vector<vec2> suther_land_hodgman(
std::span<vec2 const> subject_polygon, std::span<vec2 const> clip_polygon) {
if (clip_polygon.empty() || subject_polygon.empty()) {
return {};
}
std::vector<vec2> ring{subject_polygon.begin(), subject_polygon.end()};
vec2 p1 = clip_polygon[clip_polygon.size() - 1];
std::vector<vec2> input;
for (vec2 p2 : clip_polygon) {
input.clear();
input.insert(input.end(), ring.begin(), ring.end());
vec2 s = input[input.size() - 1];
ring.clear();
for (vec2 e : input) {
if (is_inside(e, p1, p2)) {
if (!is_inside(s, p1, p2)) {
ring.push_back(intersection(p1, p2, s, e));
}
ring.push_back(e);
} else if (is_inside(s, p1, p2)) {
ring.push_back(intersection(p1, p2, s, e));
}
s = e;
}
p1 = p2;
}
return ring;
}
int main(int argc, char **argv) {
vec2 subject_polygon[] = {{50, 150}, {200, 50}, {350, 150},
{350, 300}, {250, 300}, {200, 250},
{150, 350}, {100, 250}, {100, 200}};
vec2 clip_polygon[] = {{100, 100}, {300, 100}, {300, 300}, {100, 300}};
std::vector<vec2> clipped_polygon =
suther_land_hodgman(subject_polygon, clip_polygon);
std::cout << "Clipped polygon points:" << std::endl;
for (vec2 p : clipped_polygon) {
std::cout << "(" << p.x << ", " << p.y << ")" << std::endl;
}
return EXIT_SUCCESS;
}
|
Write a version of this Python function in C++ with identical behavior. | import string
sometext = .lower()
lc2bin = {ch: '{:05b}'.format(i)
for i, ch in enumerate(string.ascii_lowercase + ' .')}
bin2lc = {val: key for key, val in lc2bin.items()}
phrase = 'Rosetta code Bacon cipher example secret phrase to encode in the capitalisation of peter pan'.lower()
def to_5binary(msg):
return ( ch == '1' for ch in ''.join(lc2bin.get(ch, '') for ch in msg.lower()))
def encrypt(message, text):
bin5 = to_5binary(message)
textlist = list(text.lower())
out = []
for capitalise in bin5:
while textlist:
ch = textlist.pop(0)
if ch.isalpha():
if capitalise:
ch = ch.upper()
out.append(ch)
break
else:
out.append(ch)
else:
raise Exception('ERROR: Ran out of characters in sometext')
return ''.join(out) + '...'
def decrypt(bacontext):
binary = []
bin5 = []
out = []
for ch in bacontext:
if ch.isalpha():
binary.append('1' if ch.isupper() else '0')
if len(binary) == 5:
bin5 = ''.join(binary)
out.append(bin2lc[bin5])
binary = []
return ''.join(out)
print('PLAINTEXT = \n%s\n' % phrase)
encrypted = encrypt(phrase, sometext)
print('ENCRYPTED = \n%s\n' % encrypted)
decrypted = decrypt(encrypted)
print('DECRYPTED = \n%s\n' % decrypted)
assert phrase == decrypted, 'Round-tripping error'
| #include <iostream>
#include <algorithm>
#include <vector>
#include <bitset>
#include <string>
class bacon {
public:
bacon() {
int x = 0;
for( ; x < 9; x++ )
bAlphabet.push_back( std::bitset<5>( x ).to_string() );
bAlphabet.push_back( bAlphabet.back() );
for( ; x < 20; x++ )
bAlphabet.push_back( std::bitset<5>( x ).to_string() );
bAlphabet.push_back( bAlphabet.back() );
for( ; x < 24; x++ )
bAlphabet.push_back( std::bitset<5>( x ).to_string() );
}
std::string encode( std::string txt ) {
std::string r;
size_t z;
for( std::string::iterator i = txt.begin(); i != txt.end(); i++ ) {
z = toupper( *i );
if( z < 'A' || z > 'Z' ) continue;
r.append( bAlphabet.at( ( *i & 31 ) - 1 ) );
}
return r;
}
std::string decode( std::string txt ) {
size_t len = txt.length();
while( len % 5 != 0 ) len--;
if( len != txt.length() ) txt = txt.substr( 0, len );
std::string r;
for( size_t i = 0; i < len; i += 5 ) {
r.append( 1, 'A' + std::distance( bAlphabet.begin(), std::find( bAlphabet.begin(), bAlphabet.end(), txt.substr( i, 5 ) ) ) );
}
return r;
}
private:
std::vector<std::string> bAlphabet;
};
|
Transform the following Python implementation into C++, maintaining the same output and logic. | import string
sometext = .lower()
lc2bin = {ch: '{:05b}'.format(i)
for i, ch in enumerate(string.ascii_lowercase + ' .')}
bin2lc = {val: key for key, val in lc2bin.items()}
phrase = 'Rosetta code Bacon cipher example secret phrase to encode in the capitalisation of peter pan'.lower()
def to_5binary(msg):
return ( ch == '1' for ch in ''.join(lc2bin.get(ch, '') for ch in msg.lower()))
def encrypt(message, text):
bin5 = to_5binary(message)
textlist = list(text.lower())
out = []
for capitalise in bin5:
while textlist:
ch = textlist.pop(0)
if ch.isalpha():
if capitalise:
ch = ch.upper()
out.append(ch)
break
else:
out.append(ch)
else:
raise Exception('ERROR: Ran out of characters in sometext')
return ''.join(out) + '...'
def decrypt(bacontext):
binary = []
bin5 = []
out = []
for ch in bacontext:
if ch.isalpha():
binary.append('1' if ch.isupper() else '0')
if len(binary) == 5:
bin5 = ''.join(binary)
out.append(bin2lc[bin5])
binary = []
return ''.join(out)
print('PLAINTEXT = \n%s\n' % phrase)
encrypted = encrypt(phrase, sometext)
print('ENCRYPTED = \n%s\n' % encrypted)
decrypted = decrypt(encrypted)
print('DECRYPTED = \n%s\n' % decrypted)
assert phrase == decrypted, 'Round-tripping error'
| #include <iostream>
#include <algorithm>
#include <vector>
#include <bitset>
#include <string>
class bacon {
public:
bacon() {
int x = 0;
for( ; x < 9; x++ )
bAlphabet.push_back( std::bitset<5>( x ).to_string() );
bAlphabet.push_back( bAlphabet.back() );
for( ; x < 20; x++ )
bAlphabet.push_back( std::bitset<5>( x ).to_string() );
bAlphabet.push_back( bAlphabet.back() );
for( ; x < 24; x++ )
bAlphabet.push_back( std::bitset<5>( x ).to_string() );
}
std::string encode( std::string txt ) {
std::string r;
size_t z;
for( std::string::iterator i = txt.begin(); i != txt.end(); i++ ) {
z = toupper( *i );
if( z < 'A' || z > 'Z' ) continue;
r.append( bAlphabet.at( ( *i & 31 ) - 1 ) );
}
return r;
}
std::string decode( std::string txt ) {
size_t len = txt.length();
while( len % 5 != 0 ) len--;
if( len != txt.length() ) txt = txt.substr( 0, len );
std::string r;
for( size_t i = 0; i < len; i += 5 ) {
r.append( 1, 'A' + std::distance( bAlphabet.begin(), std::find( bAlphabet.begin(), bAlphabet.end(), txt.substr( i, 5 ) ) ) );
}
return r;
}
private:
std::vector<std::string> bAlphabet;
};
|
Generate an equivalent C++ version of this Python code. | def spiral(n):
dx,dy = 1,0
x,y = 0,0
myarray = [[None]* n for j in range(n)]
for i in xrange(n**2):
myarray[x][y] = i
nx,ny = x+dx, y+dy
if 0<=nx<n and 0<=ny<n and myarray[nx][ny] == None:
x,y = nx,ny
else:
dx,dy = -dy,dx
x,y = x+dx, y+dy
return myarray
def printspiral(myarray):
n = range(len(myarray))
for y in n:
for x in n:
print "%2i" % myarray[x][y],
print
printspiral(spiral(5))
| #include <vector>
#include <memory>
#include <cmath>
#include <iostream>
#include <iomanip>
using namespace std;
typedef vector< int > IntRow;
typedef vector< IntRow > IntTable;
auto_ptr< IntTable > getSpiralArray( int dimension )
{
auto_ptr< IntTable > spiralArrayPtr( new IntTable(
dimension, IntRow( dimension ) ) );
int numConcentricSquares = static_cast< int >( ceil(
static_cast< double >( dimension ) / 2.0 ) );
int j;
int sideLen = dimension;
int currNum = 0;
for ( int i = 0; i < numConcentricSquares; i++ )
{
for ( j = 0; j < sideLen; j++ )
( *spiralArrayPtr )[ i ][ i + j ] = currNum++;
for ( j = 1; j < sideLen; j++ )
( *spiralArrayPtr )[ i + j ][ dimension - 1 - i ] = currNum++;
for ( j = sideLen - 2; j > -1; j-- )
( *spiralArrayPtr )[ dimension - 1 - i ][ i + j ] = currNum++;
for ( j = sideLen - 2; j > 0; j-- )
( *spiralArrayPtr )[ i + j ][ i ] = currNum++;
sideLen -= 2;
}
return spiralArrayPtr;
}
void printSpiralArray( const auto_ptr< IntTable >& spiralArrayPtr )
{
size_t dimension = spiralArrayPtr->size();
int fieldWidth = static_cast< int >( floor( log10(
static_cast< double >( dimension * dimension - 1 ) ) ) ) + 2;
size_t col;
for ( size_t row = 0; row < dimension; row++ )
{
for ( col = 0; col < dimension; col++ )
cout << setw( fieldWidth ) << ( *spiralArrayPtr )[ row ][ col ];
cout << endl;
}
}
int main()
{
printSpiralArray( getSpiralArray( 5 ) );
}
|
Maintain the same structure and functionality when rewriting this code in C++. | >>> def printtable(data):
for row in data:
print ' '.join('%-5s' % ('"%s"' % cell) for cell in row)
>>> import operator
>>> def sorttable(table, ordering=None, column=0, reverse=False):
return sorted(table, cmp=ordering, key=operator.itemgetter(column), reverse=reverse)
>>> data = [["a", "b", "c"], ["", "q", "z"], ["zap", "zip", "Zot"]]
>>> printtable(data)
"a" "b" "c"
"" "q" "z"
"zap" "zip" "Zot"
>>> printtable( sorttable(data) )
"" "q" "z"
"a" "b" "c"
"zap" "zip" "Zot"
>>> printtable( sorttable(data, column=2) )
"zap" "zip" "Zot"
"a" "b" "c"
"" "q" "z"
>>> printtable( sorttable(data, column=1) )
"a" "b" "c"
"" "q" "z"
"zap" "zip" "Zot"
>>> printtable( sorttable(data, column=1, reverse=True) )
"zap" "zip" "Zot"
"" "q" "z"
"a" "b" "c"
>>> printtable( sorttable(data, ordering=lambda a,b: cmp(len(b),len(a))) )
"zap" "zip" "Zot"
"a" "b" "c"
"" "q" "z"
>>>
| #include <vector>
#include <algorithm>
#include <string>
template <class T>
struct sort_table_functor {
typedef bool (*CompFun)(const T &, const T &);
const CompFun ordering;
const int column;
const bool reverse;
sort_table_functor(CompFun o, int c, bool r) :
ordering(o), column(c), reverse(r) { }
bool operator()(const std::vector<T> &x, const std::vector<T> &y) const {
const T &a = x[column],
&b = y[column];
return reverse ? ordering(b, a)
: ordering(a, b);
}
};
template <class T>
bool myLess(const T &x, const T &y) { return x < y; }
template <class T>
void sort_table(std::vector<std::vector<T> > &table,
int column = 0, bool reverse = false,
bool (*ordering)(const T &, const T &) = myLess) {
std::sort(table.begin(), table.end(),
sort_table_functor<T>(ordering, column, reverse));
}
#include <iostream>
template <class T>
void print_matrix(std::vector<std::vector<T> > &data) {
for () {
for (int j = 0; j < 3; j++)
std::cout << data[i][j] << "\t";
std::cout << std::endl;
}
}
bool desc_len_comparator(const std::string &x, const std::string &y) {
return x.length() > y.length();
}
int main() {
std::string data_array[3][3] =
{
{"a", "b", "c"},
{"", "q", "z"},
{"zap", "zip", "Zot"}
};
std::vector<std::vector<std::string> > data_orig;
for (int i = 0; i < 3; i++) {
std::vector<std::string> row;
for (int j = 0; j < 3; j++)
row.push_back(data_array[i][j]);
data_orig.push_back(row);
}
print_matrix(data_orig);
std::vector<std::vector<std::string> > data = data_orig;
sort_table(data);
print_matrix(data);
data = data_orig;
sort_table(data, 2);
print_matrix(data);
data = data_orig;
sort_table(data, 1);
print_matrix(data);
data = data_orig;
sort_table(data, 1, true);
print_matrix(data);
data = data_orig;
sort_table(data, 0, false, desc_len_comparator);
print_matrix(data);
return 0;
}
|
Produce a language-to-language conversion: from Python to C++, same semantics. | def setup():
size(500, 500)
generate_voronoi_diagram(width, height, 25)
saveFrame("VoronoiDiagram.png")
def generate_voronoi_diagram(w, h, num_cells):
nx, ny, nr, ng, nb = [], [], [], [], []
for i in range(num_cells):
nx.append(int(random(w)))
ny.append(int(random(h)))
nr.append(int(random(256)))
ng.append(int(random(256)))
nb.append(int(random(256)))
for y in range(h):
for x in range(w):
dmin = dist(0, 0, w - 1, h - 1)
j = -1
for i in range(num_cells):
d = dist(0, 0, nx[i] - x, ny[i] - y)
if d < dmin:
dmin = d
j = i
set(x, y, color(nr[j], ng[j], nb[j]))
| #include <windows.h>
#include <vector>
#include <string>
using namespace std;
struct Point {
int x, y;
};
class MyBitmap {
public:
MyBitmap() : pen_(nullptr) {}
~MyBitmap() {
DeleteObject(pen_);
DeleteDC(hdc_);
DeleteObject(bmp_);
}
bool Create(int w, int h) {
BITMAPINFO bi;
ZeroMemory(&bi, sizeof(bi));
bi.bmiHeader.biSize = sizeof(bi.bmiHeader);
bi.bmiHeader.biBitCount = sizeof(DWORD) * 8;
bi.bmiHeader.biCompression = BI_RGB;
bi.bmiHeader.biPlanes = 1;
bi.bmiHeader.biWidth = w;
bi.bmiHeader.biHeight = -h;
void *bits_ptr = nullptr;
HDC dc = GetDC(GetConsoleWindow());
bmp_ = CreateDIBSection(dc, &bi, DIB_RGB_COLORS, &bits_ptr, nullptr, 0);
if (!bmp_) return false;
hdc_ = CreateCompatibleDC(dc);
SelectObject(hdc_, bmp_);
ReleaseDC(GetConsoleWindow(), dc);
width_ = w;
height_ = h;
return true;
}
void SetPenColor(DWORD clr) {
if (pen_) DeleteObject(pen_);
pen_ = CreatePen(PS_SOLID, 1, clr);
SelectObject(hdc_, pen_);
}
bool SaveBitmap(const char* path) {
HANDLE file = CreateFile(path, GENERIC_WRITE, 0, nullptr, CREATE_ALWAYS, FILE_ATTRIBUTE_NORMAL, nullptr);
if (file == INVALID_HANDLE_VALUE) {
return false;
}
BITMAPFILEHEADER fileheader;
BITMAPINFO infoheader;
BITMAP bitmap;
GetObject(bmp_, sizeof(bitmap), &bitmap);
DWORD* dwp_bits = new DWORD[bitmap.bmWidth * bitmap.bmHeight];
ZeroMemory(dwp_bits, bitmap.bmWidth * bitmap.bmHeight * sizeof(DWORD));
ZeroMemory(&infoheader, sizeof(BITMAPINFO));
ZeroMemory(&fileheader, sizeof(BITMAPFILEHEADER));
infoheader.bmiHeader.biBitCount = sizeof(DWORD) * 8;
infoheader.bmiHeader.biCompression = BI_RGB;
infoheader.bmiHeader.biPlanes = 1;
infoheader.bmiHeader.biSize = sizeof(infoheader.bmiHeader);
infoheader.bmiHeader.biHeight = bitmap.bmHeight;
infoheader.bmiHeader.biWidth = bitmap.bmWidth;
infoheader.bmiHeader.biSizeImage = bitmap.bmWidth * bitmap.bmHeight * sizeof(DWORD);
fileheader.bfType = 0x4D42;
fileheader.bfOffBits = sizeof(infoheader.bmiHeader) + sizeof(BITMAPFILEHEADER);
fileheader.bfSize = fileheader.bfOffBits + infoheader.bmiHeader.biSizeImage;
GetDIBits(hdc_, bmp_, 0, height_, (LPVOID)dwp_bits, &infoheader, DIB_RGB_COLORS);
DWORD wb;
WriteFile(file, &fileheader, sizeof(BITMAPFILEHEADER), &wb, nullptr);
WriteFile(file, &infoheader.bmiHeader, sizeof(infoheader.bmiHeader), &wb, nullptr);
WriteFile(file, dwp_bits, bitmap.bmWidth * bitmap.bmHeight * 4, &wb, nullptr);
CloseHandle(file);
delete[] dwp_bits;
return true;
}
HDC hdc() { return hdc_; }
int width() { return width_; }
int height() { return height_; }
private:
HBITMAP bmp_;
HDC hdc_;
HPEN pen_;
int width_, height_;
};
static int DistanceSqrd(const Point& point, int x, int y) {
int xd = x - point.x;
int yd = y - point.y;
return (xd * xd) + (yd * yd);
}
class Voronoi {
public:
void Make(MyBitmap* bmp, int count) {
bmp_ = bmp;
CreatePoints(count);
CreateColors();
CreateSites();
SetSitesPoints();
}
private:
void CreateSites() {
int w = bmp_->width(), h = bmp_->height(), d;
for (int hh = 0; hh < h; hh++) {
for (int ww = 0; ww < w; ww++) {
int ind = -1, dist = INT_MAX;
for (size_t it = 0; it < points_.size(); it++) {
const Point& p = points_[it];
d = DistanceSqrd(p, ww, hh);
if (d < dist) {
dist = d;
ind = it;
}
}
if (ind > -1)
SetPixel(bmp_->hdc(), ww, hh, colors_[ind]);
else
__asm nop
}
}
}
void SetSitesPoints() {
for (const auto& point : points_) {
int x = point.x, y = point.y;
for (int i = -1; i < 2; i++)
for (int j = -1; j < 2; j++)
SetPixel(bmp_->hdc(), x + i, y + j, 0);
}
}
void CreatePoints(int count) {
const int w = bmp_->width() - 20, h = bmp_->height() - 20;
for (int i = 0; i < count; i++) {
points_.push_back({ rand() % w + 10, rand() % h + 10 });
}
}
void CreateColors() {
for (size_t i = 0; i < points_.size(); i++) {
DWORD c = RGB(rand() % 200 + 50, rand() % 200 + 55, rand() % 200 + 50);
colors_.push_back(c);
}
}
vector<Point> points_;
vector<DWORD> colors_;
MyBitmap* bmp_;
};
int main(int argc, char* argv[]) {
ShowWindow(GetConsoleWindow(), SW_MAXIMIZE);
srand(GetTickCount());
MyBitmap bmp;
bmp.Create(512, 512);
bmp.SetPenColor(0);
Voronoi v;
v.Make(&bmp, 50);
BitBlt(GetDC(GetConsoleWindow()), 20, 20, 512, 512, bmp.hdc(), 0, 0, SRCCOPY);
bmp.SaveBitmap("v.bmp");
system("pause");
return 0;
}
|
Transform the following Python implementation into C++, maintaining the same output and logic. | def setup():
size(500, 500)
generate_voronoi_diagram(width, height, 25)
saveFrame("VoronoiDiagram.png")
def generate_voronoi_diagram(w, h, num_cells):
nx, ny, nr, ng, nb = [], [], [], [], []
for i in range(num_cells):
nx.append(int(random(w)))
ny.append(int(random(h)))
nr.append(int(random(256)))
ng.append(int(random(256)))
nb.append(int(random(256)))
for y in range(h):
for x in range(w):
dmin = dist(0, 0, w - 1, h - 1)
j = -1
for i in range(num_cells):
d = dist(0, 0, nx[i] - x, ny[i] - y)
if d < dmin:
dmin = d
j = i
set(x, y, color(nr[j], ng[j], nb[j]))
| #include <windows.h>
#include <vector>
#include <string>
using namespace std;
struct Point {
int x, y;
};
class MyBitmap {
public:
MyBitmap() : pen_(nullptr) {}
~MyBitmap() {
DeleteObject(pen_);
DeleteDC(hdc_);
DeleteObject(bmp_);
}
bool Create(int w, int h) {
BITMAPINFO bi;
ZeroMemory(&bi, sizeof(bi));
bi.bmiHeader.biSize = sizeof(bi.bmiHeader);
bi.bmiHeader.biBitCount = sizeof(DWORD) * 8;
bi.bmiHeader.biCompression = BI_RGB;
bi.bmiHeader.biPlanes = 1;
bi.bmiHeader.biWidth = w;
bi.bmiHeader.biHeight = -h;
void *bits_ptr = nullptr;
HDC dc = GetDC(GetConsoleWindow());
bmp_ = CreateDIBSection(dc, &bi, DIB_RGB_COLORS, &bits_ptr, nullptr, 0);
if (!bmp_) return false;
hdc_ = CreateCompatibleDC(dc);
SelectObject(hdc_, bmp_);
ReleaseDC(GetConsoleWindow(), dc);
width_ = w;
height_ = h;
return true;
}
void SetPenColor(DWORD clr) {
if (pen_) DeleteObject(pen_);
pen_ = CreatePen(PS_SOLID, 1, clr);
SelectObject(hdc_, pen_);
}
bool SaveBitmap(const char* path) {
HANDLE file = CreateFile(path, GENERIC_WRITE, 0, nullptr, CREATE_ALWAYS, FILE_ATTRIBUTE_NORMAL, nullptr);
if (file == INVALID_HANDLE_VALUE) {
return false;
}
BITMAPFILEHEADER fileheader;
BITMAPINFO infoheader;
BITMAP bitmap;
GetObject(bmp_, sizeof(bitmap), &bitmap);
DWORD* dwp_bits = new DWORD[bitmap.bmWidth * bitmap.bmHeight];
ZeroMemory(dwp_bits, bitmap.bmWidth * bitmap.bmHeight * sizeof(DWORD));
ZeroMemory(&infoheader, sizeof(BITMAPINFO));
ZeroMemory(&fileheader, sizeof(BITMAPFILEHEADER));
infoheader.bmiHeader.biBitCount = sizeof(DWORD) * 8;
infoheader.bmiHeader.biCompression = BI_RGB;
infoheader.bmiHeader.biPlanes = 1;
infoheader.bmiHeader.biSize = sizeof(infoheader.bmiHeader);
infoheader.bmiHeader.biHeight = bitmap.bmHeight;
infoheader.bmiHeader.biWidth = bitmap.bmWidth;
infoheader.bmiHeader.biSizeImage = bitmap.bmWidth * bitmap.bmHeight * sizeof(DWORD);
fileheader.bfType = 0x4D42;
fileheader.bfOffBits = sizeof(infoheader.bmiHeader) + sizeof(BITMAPFILEHEADER);
fileheader.bfSize = fileheader.bfOffBits + infoheader.bmiHeader.biSizeImage;
GetDIBits(hdc_, bmp_, 0, height_, (LPVOID)dwp_bits, &infoheader, DIB_RGB_COLORS);
DWORD wb;
WriteFile(file, &fileheader, sizeof(BITMAPFILEHEADER), &wb, nullptr);
WriteFile(file, &infoheader.bmiHeader, sizeof(infoheader.bmiHeader), &wb, nullptr);
WriteFile(file, dwp_bits, bitmap.bmWidth * bitmap.bmHeight * 4, &wb, nullptr);
CloseHandle(file);
delete[] dwp_bits;
return true;
}
HDC hdc() { return hdc_; }
int width() { return width_; }
int height() { return height_; }
private:
HBITMAP bmp_;
HDC hdc_;
HPEN pen_;
int width_, height_;
};
static int DistanceSqrd(const Point& point, int x, int y) {
int xd = x - point.x;
int yd = y - point.y;
return (xd * xd) + (yd * yd);
}
class Voronoi {
public:
void Make(MyBitmap* bmp, int count) {
bmp_ = bmp;
CreatePoints(count);
CreateColors();
CreateSites();
SetSitesPoints();
}
private:
void CreateSites() {
int w = bmp_->width(), h = bmp_->height(), d;
for (int hh = 0; hh < h; hh++) {
for (int ww = 0; ww < w; ww++) {
int ind = -1, dist = INT_MAX;
for (size_t it = 0; it < points_.size(); it++) {
const Point& p = points_[it];
d = DistanceSqrd(p, ww, hh);
if (d < dist) {
dist = d;
ind = it;
}
}
if (ind > -1)
SetPixel(bmp_->hdc(), ww, hh, colors_[ind]);
else
__asm nop
}
}
}
void SetSitesPoints() {
for (const auto& point : points_) {
int x = point.x, y = point.y;
for (int i = -1; i < 2; i++)
for (int j = -1; j < 2; j++)
SetPixel(bmp_->hdc(), x + i, y + j, 0);
}
}
void CreatePoints(int count) {
const int w = bmp_->width() - 20, h = bmp_->height() - 20;
for (int i = 0; i < count; i++) {
points_.push_back({ rand() % w + 10, rand() % h + 10 });
}
}
void CreateColors() {
for (size_t i = 0; i < points_.size(); i++) {
DWORD c = RGB(rand() % 200 + 50, rand() % 200 + 55, rand() % 200 + 50);
colors_.push_back(c);
}
}
vector<Point> points_;
vector<DWORD> colors_;
MyBitmap* bmp_;
};
int main(int argc, char* argv[]) {
ShowWindow(GetConsoleWindow(), SW_MAXIMIZE);
srand(GetTickCount());
MyBitmap bmp;
bmp.Create(512, 512);
bmp.SetPenColor(0);
Voronoi v;
v.Make(&bmp, 50);
BitBlt(GetDC(GetConsoleWindow()), 20, 20, 512, 512, bmp.hdc(), 0, 0, SRCCOPY);
bmp.SaveBitmap("v.bmp");
system("pause");
return 0;
}
|
Produce a language-to-language conversion: from Python to C++, same semantics. | import ctypes
libc = ctypes.CDLL("/lib/libc.so.6")
libc.strcmp("abc", "def")
libc.strcmp("hello", "hello")
| FUNCTION MULTIPLY(X, Y)
DOUBLE PRECISION MULTIPLY, X, Y
|
Transform the following Python implementation into C++, maintaining the same output and logic. | from random import randrange
def s_of_n_creator(n):
sample, i = [], 0
def s_of_n(item):
nonlocal i
i += 1
if i <= n:
sample.append(item)
elif randrange(i) < n:
sample[randrange(n)] = item
return sample
return s_of_n
if __name__ == '__main__':
bin = [0]* 10
items = range(10)
print("Single run samples for n = 3:")
s_of_n = s_of_n_creator(3)
for item in items:
sample = s_of_n(item)
print(" Item: %i -> sample: %s" % (item, sample))
for trial in range(100000):
s_of_n = s_of_n_creator(3)
for item in items:
sample = s_of_n(item)
for s in sample:
bin[s] += 1
print("\nTest item frequencies for 100000 runs:\n ",
'\n '.join("%i:%i" % x for x in enumerate(bin)))
| #include <iostream>
#include <functional>
#include <vector>
#include <cstdlib>
#include <ctime>
template <typename T>
std::function<std::vector<T>(T)> s_of_n_creator(int n) {
std::vector<T> sample;
int i = 0;
return [=](T item) mutable {
i++;
if (i <= n) {
sample.push_back(item);
} else if (std::rand() % i < n) {
sample[std::rand() % n] = item;
}
return sample;
};
}
int main() {
std::srand(std::time(NULL));
int bin[10] = {0};
for (int trial = 0; trial < 100000; trial++) {
auto s_of_n = s_of_n_creator<int>(3);
std::vector<int> sample;
for (int i = 0; i < 10; i++)
sample = s_of_n(i);
for (int s : sample)
bin[s]++;
}
for (int x : bin)
std::cout << x << std::endl;
return 0;
}
|
Ensure the translated C++ code behaves exactly like the original Python snippet. | from random import randrange
def s_of_n_creator(n):
sample, i = [], 0
def s_of_n(item):
nonlocal i
i += 1
if i <= n:
sample.append(item)
elif randrange(i) < n:
sample[randrange(n)] = item
return sample
return s_of_n
if __name__ == '__main__':
bin = [0]* 10
items = range(10)
print("Single run samples for n = 3:")
s_of_n = s_of_n_creator(3)
for item in items:
sample = s_of_n(item)
print(" Item: %i -> sample: %s" % (item, sample))
for trial in range(100000):
s_of_n = s_of_n_creator(3)
for item in items:
sample = s_of_n(item)
for s in sample:
bin[s] += 1
print("\nTest item frequencies for 100000 runs:\n ",
'\n '.join("%i:%i" % x for x in enumerate(bin)))
| #include <iostream>
#include <functional>
#include <vector>
#include <cstdlib>
#include <ctime>
template <typename T>
std::function<std::vector<T>(T)> s_of_n_creator(int n) {
std::vector<T> sample;
int i = 0;
return [=](T item) mutable {
i++;
if (i <= n) {
sample.push_back(item);
} else if (std::rand() % i < n) {
sample[std::rand() % n] = item;
}
return sample;
};
}
int main() {
std::srand(std::time(NULL));
int bin[10] = {0};
for (int trial = 0; trial < 100000; trial++) {
auto s_of_n = s_of_n_creator<int>(3);
std::vector<int> sample;
for (int i = 0; i < 10; i++)
sample = s_of_n(i);
for (int s : sample)
bin[s]++;
}
for (int x : bin)
std::cout << x << std::endl;
return 0;
}
|
Translate this program into C++ but keep the logic exactly as in Python. |
from itertools import accumulate, chain, count, islice
from fractions import Fraction
def faulhaberTriangle(m):
def go(rs, n):
def f(x, y):
return Fraction(n, x) * y
xs = list(map(f, islice(count(2), m), rs))
return [Fraction(1 - sum(xs), 1)] + xs
return list(accumulate(
[[]] + list(islice(count(0), 1 + m)),
go
))[1:]
def faulhaberSum(p, n):
def go(x, y):
return y * (n ** x)
return sum(
map(go, count(1), faulhaberTriangle(p)[-1])
)
def main():
fs = faulhaberTriangle(9)
print(
fTable(__doc__ + ':\n')(str)(
compose(concat)(
fmap(showRatio(3)(3))
)
)(
index(fs)
)(range(0, len(fs)))
)
print('')
print(
faulhaberSum(17, 1000)
)
def fTable(s):
def gox(xShow):
def gofx(fxShow):
def gof(f):
def goxs(xs):
ys = [xShow(x) for x in xs]
w = max(map(len, ys))
def arrowed(x, y):
return y.rjust(w, ' ') + ' -> ' + (
fxShow(f(x))
)
return s + '\n' + '\n'.join(
map(arrowed, xs, ys)
)
return goxs
return gof
return gofx
return gox
def compose(g):
return lambda f: lambda x: g(f(x))
def concat(xs):
def f(ys):
zs = list(chain(*ys))
return ''.join(zs) if isinstance(ys[0], str) else zs
return (
f(xs) if isinstance(xs, list) else (
chain.from_iterable(xs)
)
) if xs else []
def fmap(f):
def go(xs):
return list(map(f, xs))
return go
def index(xs):
return lambda n: None if 0 > n else (
xs[n] if (
hasattr(xs, "__getitem__")
) else next(islice(xs, n, None))
)
def showRatio(m):
def go(n):
def f(r):
d = r.denominator
return str(r.numerator).rjust(m, ' ') + (
('/' + str(d).ljust(n, ' ')) if 1 != d else (
' ' * (1 + n)
)
)
return f
return go
if __name__ == '__main__':
main()
| #include <exception>
#include <iomanip>
#include <iostream>
#include <numeric>
#include <sstream>
#include <vector>
class Frac {
public:
Frac() : num(0), denom(1) {}
Frac(int n, int d) {
if (d == 0) {
throw std::runtime_error("d must not be zero");
}
int sign_of_d = d < 0 ? -1 : 1;
int g = std::gcd(n, d);
num = sign_of_d * n / g;
denom = sign_of_d * d / g;
}
Frac operator-() const {
return Frac(-num, denom);
}
Frac operator+(const Frac& rhs) const {
return Frac(num*rhs.denom + denom * rhs.num, rhs.denom*denom);
}
Frac operator-(const Frac& rhs) const {
return Frac(num*rhs.denom - denom * rhs.num, rhs.denom*denom);
}
Frac operator*(const Frac& rhs) const {
return Frac(num*rhs.num, denom*rhs.denom);
}
Frac operator*(int rhs) const {
return Frac(num * rhs, denom);
}
friend std::ostream& operator<<(std::ostream&, const Frac&);
private:
int num;
int denom;
};
std::ostream & operator<<(std::ostream & os, const Frac &f) {
if (f.num == 0 || f.denom == 1) {
return os << f.num;
}
std::stringstream ss;
ss << f.num << "/" << f.denom;
return os << ss.str();
}
Frac bernoulli(int n) {
if (n < 0) {
throw std::runtime_error("n may not be negative or zero");
}
std::vector<Frac> a;
for (int m = 0; m <= n; m++) {
a.push_back(Frac(1, m + 1));
for (int j = m; j >= 1; j--) {
a[j - 1] = (a[j - 1] - a[j]) * j;
}
}
if (n != 1) return a[0];
return -a[0];
}
int binomial(int n, int k) {
if (n < 0 || k < 0 || n < k) {
throw std::runtime_error("parameters are invalid");
}
if (n == 0 || k == 0) return 1;
int num = 1;
for (int i = k + 1; i <= n; i++) {
num *= i;
}
int denom = 1;
for (int i = 2; i <= n - k; i++) {
denom *= i;
}
return num / denom;
}
std::vector<Frac> faulhaberTraingle(int p) {
std::vector<Frac> coeffs(p + 1);
Frac q{ 1, p + 1 };
int sign = -1;
for (int j = 0; j <= p; j++) {
sign *= -1;
coeffs[p - j] = q * sign * binomial(p + 1, j) * bernoulli(j);
}
return coeffs;
}
int main() {
for (int i = 0; i < 10; i++) {
std::vector<Frac> coeffs = faulhaberTraingle(i);
for (auto frac : coeffs) {
std::cout << std::right << std::setw(5) << frac << " ";
}
std::cout << std::endl;
}
return 0;
}
|
Write a version of this Python function in C++ with identical behavior. | import sys
program_name = sys.argv[0]
arguments = sys.argv[1:]
count = len(arguments)
| #include <iostream>
int main(int argc, char* argv[])
{
std::cout << "This program is named " << argv[0] << std::endl;
std::cout << "There are " << argc-1 << " arguments given." << std::endl;
for (int i = 1; i < argc; ++i)
std::cout << "the argument #" << i << " is " << argv[i] << std::endl;
return 0;
}
|
Generate an equivalent C++ version of this Python code. | import sys
program_name = sys.argv[0]
arguments = sys.argv[1:]
count = len(arguments)
| #include <iostream>
int main(int argc, char* argv[])
{
std::cout << "This program is named " << argv[0] << std::endl;
std::cout << "There are " << argc-1 << " arguments given." << std::endl;
for (int i = 1; i < argc; ++i)
std::cout << "the argument #" << i << " is " << argv[i] << std::endl;
return 0;
}
|
Maintain the same structure and functionality when rewriting this code in C++. | import urllib.request
from collections import Counter
GRID =
def getwords(url='http://wiki.puzzlers.org/pub/wordlists/unixdict.txt'):
"Return lowercased words of 3 to 9 characters"
words = urllib.request.urlopen(url).read().decode().strip().lower().split()
return (w for w in words if 2 < len(w) < 10)
def solve(grid, dictionary):
gridcount = Counter(grid)
mid = grid[4]
return [word for word in dictionary
if mid in word and not (Counter(word) - gridcount)]
if __name__ == '__main__':
chars = ''.join(GRID.strip().lower().split())
found = solve(chars, dictionary=getwords())
print('\n'.join(found))
| #include <array>
#include <iostream>
#include <fstream>
#include <map>
#include <string>
#include <vector>
#include <boost/program_options.hpp>
class letterset {
public:
letterset() {
count_.fill(0);
}
explicit letterset(const std::string& str) {
count_.fill(0);
for (char c : str)
add(c);
}
bool contains(const letterset& set) const {
for (size_t i = 0; i < count_.size(); ++i) {
if (set.count_[i] > count_[i])
return false;
}
return true;
}
unsigned int count(char c) const {
return count_[index(c)];
}
bool is_valid() const {
return count_[0] == 0;
}
void add(char c) {
++count_[index(c)];
}
private:
static bool is_letter(char c) { return c >= 'a' && c <= 'z'; }
static int index(char c) { return is_letter(c) ? c - 'a' + 1 : 0; }
std::array<unsigned int, 27> count_;
};
template <typename iterator, typename separator>
std::string join(iterator begin, iterator end, separator sep) {
std::string result;
if (begin != end) {
result += *begin++;
for (; begin != end; ++begin) {
result += sep;
result += *begin;
}
}
return result;
}
using dictionary = std::vector<std::pair<std::string, letterset>>;
dictionary load_dictionary(const std::string& filename, int min_length,
int max_length) {
std::ifstream in(filename);
if (!in)
throw std::runtime_error("Cannot open file " + filename);
std::string word;
dictionary result;
while (getline(in, word)) {
if (word.size() < min_length)
continue;
if (word.size() > max_length)
continue;
letterset set(word);
if (set.is_valid())
result.emplace_back(word, set);
}
return result;
}
void word_wheel(const dictionary& dict, const std::string& letters,
char central_letter) {
letterset set(letters);
if (central_letter == 0 && !letters.empty())
central_letter = letters.at(letters.size()/2);
std::map<size_t, std::vector<std::string>> words;
for (const auto& pair : dict) {
const auto& word = pair.first;
const auto& subset = pair.second;
if (subset.count(central_letter) > 0 && set.contains(subset))
words[word.size()].push_back(word);
}
size_t total = 0;
for (const auto& p : words) {
const auto& v = p.second;
auto n = v.size();
total += n;
std::cout << "Found " << n << " " << (n == 1 ? "word" : "words")
<< " of length " << p.first << ": "
<< join(v.begin(), v.end(), ", ") << '\n';
}
std::cout << "Number of words found: " << total << '\n';
}
void find_max_word_count(const dictionary& dict, int word_length) {
size_t max_count = 0;
std::vector<std::pair<std::string, char>> max_words;
for (const auto& pair : dict) {
const auto& word = pair.first;
if (word.size() != word_length)
continue;
const auto& set = pair.second;
dictionary subsets;
for (const auto& p : dict) {
if (set.contains(p.second))
subsets.push_back(p);
}
letterset done;
for (size_t index = 0; index < word_length; ++index) {
char central_letter = word[index];
if (done.count(central_letter) > 0)
continue;
done.add(central_letter);
size_t count = 0;
for (const auto& p : subsets) {
const auto& subset = p.second;
if (subset.count(central_letter) > 0)
++count;
}
if (count > max_count) {
max_words.clear();
max_count = count;
}
if (count == max_count)
max_words.emplace_back(word, central_letter);
}
}
std::cout << "Maximum word count: " << max_count << '\n';
std::cout << "Words of " << word_length << " letters producing this count:\n";
for (const auto& pair : max_words)
std::cout << pair.first << " with central letter " << pair.second << '\n';
}
constexpr const char* option_filename = "filename";
constexpr const char* option_wheel = "wheel";
constexpr const char* option_central = "central";
constexpr const char* option_min_length = "min-length";
constexpr const char* option_part2 = "part2";
int main(int argc, char** argv) {
const int word_length = 9;
int min_length = 3;
std::string letters = "ndeokgelw";
std::string filename = "unixdict.txt";
char central_letter = 0;
bool do_part2 = false;
namespace po = boost::program_options;
po::options_description desc("Allowed options");
desc.add_options()
(option_filename, po::value<std::string>(), "name of dictionary file")
(option_wheel, po::value<std::string>(), "word wheel letters")
(option_central, po::value<char>(), "central letter (defaults to middle letter of word)")
(option_min_length, po::value<int>(), "minimum word length")
(option_part2, "include part 2");
try {
po::variables_map vm;
po::store(po::parse_command_line(argc, argv, desc), vm);
po::notify(vm);
if (vm.count(option_filename))
filename = vm[option_filename].as<std::string>();
if (vm.count(option_wheel))
letters = vm[option_wheel].as<std::string>();
if (vm.count(option_central))
central_letter = vm[option_central].as<char>();
if (vm.count(option_min_length))
min_length = vm[option_min_length].as<int>();
if (vm.count(option_part2))
do_part2 = true;
auto dict = load_dictionary(filename, min_length, word_length);
word_wheel(dict, letters, central_letter);
if (do_part2) {
std::cout << '\n';
find_max_word_count(dict, word_length);
}
} catch (const std::exception& ex) {
std::cerr << ex.what() << '\n';
return EXIT_FAILURE;
}
return EXIT_SUCCESS;
}
|
Write the same algorithm in C++ as shown in this Python implementation. | arr1 = [1, 2, 3]
arr2 = [4, 5, 6]
arr3 = [7, 8, 9]
arr4 = arr1 + arr2
assert arr4 == [1, 2, 3, 4, 5, 6]
arr4.extend(arr3)
assert arr4 == [1, 2, 3, 4, 5, 6, 7, 8, 9]
| #include <vector>
#include <iostream>
int main()
{
std::vector<int> a(3), b(4);
a[0] = 11; a[1] = 12; a[2] = 13;
b[0] = 21; b[1] = 22; b[2] = 23; b[3] = 24;
a.insert(a.end(), b.begin(), b.end());
for (int i = 0; i < a.size(); ++i)
std::cout << "a[" << i << "] = " << a[i] << "\n";
}
|
Maintain the same structure and functionality when rewriting this code in C++. | string = raw_input("Input a string: ")
| #include <iostream>
#include <string>
using namespace std;
int main()
{
long int integer_input;
string string_input;
cout << "Enter an integer: ";
cin >> integer_input;
cout << "Enter a string: ";
cin >> string_input;
return 0;
}
|
Port the provided Python code into C++ while preserving the original functionality. | >>> import winsound
>>> for note in [261.63, 293.66, 329.63, 349.23, 392.00, 440.00, 493.88, 523.25]:
winsound.Beep(int(note+.5), 500)
>>>
| #include <iostream>
#include <windows.h>
#include <mmsystem.h>
#pragma comment ( lib, "winmm.lib" )
typedef unsigned char byte;
typedef union
{
unsigned long word;
unsigned char data[4];
}
midi_msg;
class midi
{
public:
midi()
{
if( midiOutOpen( &device, 0, 0, 0, CALLBACK_NULL) != MMSYSERR_NOERROR )
{
std::cout << "Error opening MIDI Output..." << std::endl;
device = 0;
}
}
~midi()
{
midiOutReset( device );
midiOutClose( device );
}
bool isOpen() { return device != 0; }
void setInstrument( byte i )
{
message.data[0] = 0xc0; message.data[1] = i;
message.data[2] = 0; message.data[3] = 0;
midiOutShortMsg( device, message.word );
}
void playNote( byte n, unsigned i )
{
playNote( n ); Sleep( i ); stopNote( n );
}
private:
void playNote( byte n )
{
message.data[0] = 0x90; message.data[1] = n;
message.data[2] = 127; message.data[3] = 0;
midiOutShortMsg( device, message.word );
}
void stopNote( byte n )
{
message.data[0] = 0x90; message.data[1] = n;
message.data[2] = 0; message.data[3] = 0;
midiOutShortMsg( device, message.word );
}
HMIDIOUT device;
midi_msg message;
};
int main( int argc, char* argv[] )
{
midi m;
if( m.isOpen() )
{
byte notes[] = { 60, 62, 64, 65, 67, 69, 71, 72 };
m.setInstrument( 42 );
for( int x = 0; x < 8; x++ )
m.playNote( notes[x], rand() % 100 + 158 );
Sleep( 1000 );
}
return 0;
}
|
Rewrite this program in C++ while keeping its functionality equivalent to the Python version. | >>> import winsound
>>> for note in [261.63, 293.66, 329.63, 349.23, 392.00, 440.00, 493.88, 523.25]:
winsound.Beep(int(note+.5), 500)
>>>
| #include <iostream>
#include <windows.h>
#include <mmsystem.h>
#pragma comment ( lib, "winmm.lib" )
typedef unsigned char byte;
typedef union
{
unsigned long word;
unsigned char data[4];
}
midi_msg;
class midi
{
public:
midi()
{
if( midiOutOpen( &device, 0, 0, 0, CALLBACK_NULL) != MMSYSERR_NOERROR )
{
std::cout << "Error opening MIDI Output..." << std::endl;
device = 0;
}
}
~midi()
{
midiOutReset( device );
midiOutClose( device );
}
bool isOpen() { return device != 0; }
void setInstrument( byte i )
{
message.data[0] = 0xc0; message.data[1] = i;
message.data[2] = 0; message.data[3] = 0;
midiOutShortMsg( device, message.word );
}
void playNote( byte n, unsigned i )
{
playNote( n ); Sleep( i ); stopNote( n );
}
private:
void playNote( byte n )
{
message.data[0] = 0x90; message.data[1] = n;
message.data[2] = 127; message.data[3] = 0;
midiOutShortMsg( device, message.word );
}
void stopNote( byte n )
{
message.data[0] = 0x90; message.data[1] = n;
message.data[2] = 0; message.data[3] = 0;
midiOutShortMsg( device, message.word );
}
HMIDIOUT device;
midi_msg message;
};
int main( int argc, char* argv[] )
{
midi m;
if( m.isOpen() )
{
byte notes[] = { 60, 62, 64, 65, 67, 69, 71, 72 };
m.setInstrument( 42 );
for( int x = 0; x < 8; x++ )
m.playNote( notes[x], rand() % 100 + 158 );
Sleep( 1000 );
}
return 0;
}
|
Convert this Python snippet to C++ and keep its semantics consistent. | >>> import winsound
>>> for note in [261.63, 293.66, 329.63, 349.23, 392.00, 440.00, 493.88, 523.25]:
winsound.Beep(int(note+.5), 500)
>>>
| #include <iostream>
#include <windows.h>
#include <mmsystem.h>
#pragma comment ( lib, "winmm.lib" )
typedef unsigned char byte;
typedef union
{
unsigned long word;
unsigned char data[4];
}
midi_msg;
class midi
{
public:
midi()
{
if( midiOutOpen( &device, 0, 0, 0, CALLBACK_NULL) != MMSYSERR_NOERROR )
{
std::cout << "Error opening MIDI Output..." << std::endl;
device = 0;
}
}
~midi()
{
midiOutReset( device );
midiOutClose( device );
}
bool isOpen() { return device != 0; }
void setInstrument( byte i )
{
message.data[0] = 0xc0; message.data[1] = i;
message.data[2] = 0; message.data[3] = 0;
midiOutShortMsg( device, message.word );
}
void playNote( byte n, unsigned i )
{
playNote( n ); Sleep( i ); stopNote( n );
}
private:
void playNote( byte n )
{
message.data[0] = 0x90; message.data[1] = n;
message.data[2] = 127; message.data[3] = 0;
midiOutShortMsg( device, message.word );
}
void stopNote( byte n )
{
message.data[0] = 0x90; message.data[1] = n;
message.data[2] = 0; message.data[3] = 0;
midiOutShortMsg( device, message.word );
}
HMIDIOUT device;
midi_msg message;
};
int main( int argc, char* argv[] )
{
midi m;
if( m.isOpen() )
{
byte notes[] = { 60, 62, 64, 65, 67, 69, 71, 72 };
m.setInstrument( 42 );
for( int x = 0; x < 8; x++ )
m.playNote( notes[x], rand() % 100 + 158 );
Sleep( 1000 );
}
return 0;
}
|
Transform the following Python implementation into C++, maintaining the same output and logic. | from itertools import combinations
def anycomb(items):
' return combinations of any length from the items '
return ( comb
for r in range(1, len(items)+1)
for comb in combinations(items, r)
)
def totalvalue(comb):
' Totalise a particular combination of items'
totwt = totval = 0
for item, wt, val in comb:
totwt += wt
totval += val
return (totval, -totwt) if totwt <= 400 else (0, 0)
items = (
("map", 9, 150), ("compass", 13, 35), ("water", 153, 200), ("sandwich", 50, 160),
("glucose", 15, 60), ("tin", 68, 45), ("banana", 27, 60), ("apple", 39, 40),
("cheese", 23, 30), ("beer", 52, 10), ("suntan cream", 11, 70), ("camera", 32, 30),
("t-shirt", 24, 15), ("trousers", 48, 10), ("umbrella", 73, 40),
("waterproof trousers", 42, 70), ("waterproof overclothes", 43, 75),
("note-case", 22, 80), ("sunglasses", 7, 20), ("towel", 18, 12),
("socks", 4, 50), ("book", 30, 10),
)
bagged = max( anycomb(items), key=totalvalue)
print("Bagged the following items\n " +
'\n '.join(sorted(item for item,_,_ in bagged)))
val, wt = totalvalue(bagged)
print("for a total value of %i and a total weight of %i" % (val, -wt))
| #include <vector>
#include <string>
#include <iostream>
#include <boost/tuple/tuple.hpp>
#include <set>
int findBestPack( const std::vector<boost::tuple<std::string , int , int> > & ,
std::set<int> & , const int ) ;
int main( ) {
std::vector<boost::tuple<std::string , int , int> > items ;
items.push_back( boost::make_tuple( "" , 0 , 0 ) ) ;
items.push_back( boost::make_tuple( "map" , 9 , 150 ) ) ;
items.push_back( boost::make_tuple( "compass" , 13 , 35 ) ) ;
items.push_back( boost::make_tuple( "water" , 153 , 200 ) ) ;
items.push_back( boost::make_tuple( "sandwich", 50 , 160 ) ) ;
items.push_back( boost::make_tuple( "glucose" , 15 , 60 ) ) ;
items.push_back( boost::make_tuple( "tin", 68 , 45 ) ) ;
items.push_back( boost::make_tuple( "banana", 27 , 60 ) ) ;
items.push_back( boost::make_tuple( "apple" , 39 , 40 ) ) ;
items.push_back( boost::make_tuple( "cheese" , 23 , 30 ) ) ;
items.push_back( boost::make_tuple( "beer" , 52 , 10 ) ) ;
items.push_back( boost::make_tuple( "suntan creme" , 11 , 70 ) ) ;
items.push_back( boost::make_tuple( "camera" , 32 , 30 ) ) ;
items.push_back( boost::make_tuple( "T-shirt" , 24 , 15 ) ) ;
items.push_back( boost::make_tuple( "trousers" , 48 , 10 ) ) ;
items.push_back( boost::make_tuple( "umbrella" , 73 , 40 ) ) ;
items.push_back( boost::make_tuple( "waterproof trousers" , 42 , 70 ) ) ;
items.push_back( boost::make_tuple( "waterproof overclothes" , 43 , 75 ) ) ;
items.push_back( boost::make_tuple( "note-case" , 22 , 80 ) ) ;
items.push_back( boost::make_tuple( "sunglasses" , 7 , 20 ) ) ;
items.push_back( boost::make_tuple( "towel" , 18 , 12 ) ) ;
items.push_back( boost::make_tuple( "socks" , 4 , 50 ) ) ;
items.push_back( boost::make_tuple( "book" , 30 , 10 ) ) ;
const int maximumWeight = 400 ;
std::set<int> bestItems ;
int bestValue = findBestPack( items , bestItems , maximumWeight ) ;
std::cout << "The best value that can be packed in the given knapsack is " <<
bestValue << " !\n" ;
int totalweight = 0 ;
std::cout << "The following items should be packed in the knapsack:\n" ;
for ( std::set<int>::const_iterator si = bestItems.begin( ) ;
si != bestItems.end( ) ; si++ ) {
std::cout << (items.begin( ) + *si)->get<0>( ) << "\n" ;
totalweight += (items.begin( ) + *si)->get<1>( ) ;
}
std::cout << "The total weight of all items is " << totalweight << " !\n" ;
return 0 ;
}
int findBestPack( const std::vector<boost::tuple<std::string , int , int> > & items ,std::set<int> & bestItems , const int weightlimit ) {
const int n = items.size( ) ;
int bestValues [ n ][ weightlimit ] ;
std::set<int> solutionSets[ n ][ weightlimit ] ;
std::set<int> emptyset ;
for ( int i = 0 ; i < n ; i++ ) {
for ( int j = 0 ; j < weightlimit ; j++ ) {
bestValues[ i ][ j ] = 0 ;
solutionSets[ i ][ j ] = emptyset ;
}
}
for ( int i = 0 ; i < n ; i++ ) {
for ( int weight = 0 ; weight < weightlimit ; weight++ ) {
if ( i == 0 )
bestValues[ i ][ weight ] = 0 ;
else {
int itemweight = (items.begin( ) + i)->get<1>( ) ;
if ( weight < itemweight ) {
bestValues[ i ][ weight ] = bestValues[ i - 1 ][ weight ] ;
solutionSets[ i ][ weight ] = solutionSets[ i - 1 ][ weight ] ;
} else {
if ( bestValues[ i - 1 ][ weight - itemweight ] +
(items.begin( ) + i)->get<2>( ) >
bestValues[ i - 1 ][ weight ] ) {
bestValues[ i ][ weight ] =
bestValues[ i - 1 ][ weight - itemweight ] +
(items.begin( ) + i)->get<2>( ) ;
solutionSets[ i ][ weight ] =
solutionSets[ i - 1 ][ weight - itemweight ] ;
solutionSets[ i ][ weight ].insert( i ) ;
}
else {
bestValues[ i ][ weight ] = bestValues[ i - 1 ][ weight ] ;
solutionSets[ i ][ weight ] = solutionSets[ i - 1 ][ weight ] ;
}
}
}
}
}
bestItems.swap( solutionSets[ n - 1][ weightlimit - 1 ] ) ;
return bestValues[ n - 1 ][ weightlimit - 1 ] ;
}
|
Rewrite this program in C++ while keeping its functionality equivalent to the Python version. | from __future__ import print_function
from itertools import takewhile
maxsum = 99
def get_primes(max):
if max < 2:
return []
lprimes = [2]
for x in range(3, max + 1, 2):
for p in lprimes:
if x % p == 0:
break
else:
lprimes.append(x)
return lprimes
descendants = [[] for _ in range(maxsum + 1)]
ancestors = [[] for _ in range(maxsum + 1)]
primes = get_primes(maxsum)
for p in primes:
descendants[p].append(p)
for s in range(1, len(descendants) - p):
descendants[s + p] += [p * pr for pr in descendants[s]]
for p in primes + [4]:
descendants[p].pop()
total = 0
for s in range(1, maxsum + 1):
descendants[s].sort()
for d in takewhile(lambda x: x <= maxsum, descendants[s]):
ancestors[d] = ancestors[s] + [s]
print([s], "Level:", len(ancestors[s]))
print("Ancestors:", ancestors[s] if len(ancestors[s]) else "None")
print("Descendants:", len(descendants[s]) if len(descendants[s]) else "None")
if len(descendants[s]):
print(descendants[s])
print()
total += len(descendants[s])
print("Total descendants", total)
| #include <algorithm>
#include <iostream>
#include <vector>
typedef unsigned long long integer;
std::vector<integer> get_ancestors(const std::vector<integer>& ancestor, integer n) {
std::vector<integer> result;
for (integer a = ancestor[n]; a != 0 && a != n; ) {
n = a;
a = ancestor[n];
result.push_back(n);
}
return result;
}
void print_vector(const std::vector<integer>& vec) {
if (vec.empty()) {
std::cout << "none\n";
return;
}
auto i = vec.begin();
std::cout << *i++;
for (; i != vec.end(); ++i)
std::cout << ", " << *i;
std::cout << '\n';
}
bool is_prime(integer n) {
if (n < 2)
return false;
if (n % 2 == 0)
return n == 2;
for (integer p = 3; p * p <= n; p += 2) {
if (n % p == 0)
return false;
}
return true;
}
int main(int argc, char** argv) {
const size_t limit = 100;
std::vector<integer> ancestor(limit, 0);
std::vector<std::vector<integer>> descendants(limit);
for (size_t prime = 0; prime < limit; ++prime) {
if (!is_prime(prime))
continue;
descendants[prime].push_back(prime);
for (size_t i = 0; i + prime < limit; ++i) {
integer s = i + prime;
for (integer n : descendants[i]) {
integer prod = n * prime;
descendants[s].push_back(prod);
if (prod < limit)
ancestor[prod] = s;
}
}
}
size_t total_descendants = 0;
for (integer i = 1; i < limit; ++i) {
std::vector<integer> ancestors(get_ancestors(ancestor, i));
std::cout << "[" << i << "] Level: " << ancestors.size() << '\n';
std::cout << "Ancestors: ";
std::sort(ancestors.begin(), ancestors.end());
print_vector(ancestors);
std::cout << "Descendants: ";
std::vector<integer>& desc = descendants[i];
if (!desc.empty()) {
std::sort(desc.begin(), desc.end());
if (desc[0] == i)
desc.erase(desc.begin());
}
std::cout << desc.size() << '\n';
total_descendants += desc.size();
if (!desc.empty())
print_vector(desc);
std::cout << '\n';
}
std::cout << "Total descendants: " << total_descendants << '\n';
return 0;
}
|
Port the provided Python code into C++ while preserving the original functionality. | from __future__ import print_function
from itertools import takewhile
maxsum = 99
def get_primes(max):
if max < 2:
return []
lprimes = [2]
for x in range(3, max + 1, 2):
for p in lprimes:
if x % p == 0:
break
else:
lprimes.append(x)
return lprimes
descendants = [[] for _ in range(maxsum + 1)]
ancestors = [[] for _ in range(maxsum + 1)]
primes = get_primes(maxsum)
for p in primes:
descendants[p].append(p)
for s in range(1, len(descendants) - p):
descendants[s + p] += [p * pr for pr in descendants[s]]
for p in primes + [4]:
descendants[p].pop()
total = 0
for s in range(1, maxsum + 1):
descendants[s].sort()
for d in takewhile(lambda x: x <= maxsum, descendants[s]):
ancestors[d] = ancestors[s] + [s]
print([s], "Level:", len(ancestors[s]))
print("Ancestors:", ancestors[s] if len(ancestors[s]) else "None")
print("Descendants:", len(descendants[s]) if len(descendants[s]) else "None")
if len(descendants[s]):
print(descendants[s])
print()
total += len(descendants[s])
print("Total descendants", total)
| #include <algorithm>
#include <iostream>
#include <vector>
typedef unsigned long long integer;
std::vector<integer> get_ancestors(const std::vector<integer>& ancestor, integer n) {
std::vector<integer> result;
for (integer a = ancestor[n]; a != 0 && a != n; ) {
n = a;
a = ancestor[n];
result.push_back(n);
}
return result;
}
void print_vector(const std::vector<integer>& vec) {
if (vec.empty()) {
std::cout << "none\n";
return;
}
auto i = vec.begin();
std::cout << *i++;
for (; i != vec.end(); ++i)
std::cout << ", " << *i;
std::cout << '\n';
}
bool is_prime(integer n) {
if (n < 2)
return false;
if (n % 2 == 0)
return n == 2;
for (integer p = 3; p * p <= n; p += 2) {
if (n % p == 0)
return false;
}
return true;
}
int main(int argc, char** argv) {
const size_t limit = 100;
std::vector<integer> ancestor(limit, 0);
std::vector<std::vector<integer>> descendants(limit);
for (size_t prime = 0; prime < limit; ++prime) {
if (!is_prime(prime))
continue;
descendants[prime].push_back(prime);
for (size_t i = 0; i + prime < limit; ++i) {
integer s = i + prime;
for (integer n : descendants[i]) {
integer prod = n * prime;
descendants[s].push_back(prod);
if (prod < limit)
ancestor[prod] = s;
}
}
}
size_t total_descendants = 0;
for (integer i = 1; i < limit; ++i) {
std::vector<integer> ancestors(get_ancestors(ancestor, i));
std::cout << "[" << i << "] Level: " << ancestors.size() << '\n';
std::cout << "Ancestors: ";
std::sort(ancestors.begin(), ancestors.end());
print_vector(ancestors);
std::cout << "Descendants: ";
std::vector<integer>& desc = descendants[i];
if (!desc.empty()) {
std::sort(desc.begin(), desc.end());
if (desc[0] == i)
desc.erase(desc.begin());
}
std::cout << desc.size() << '\n';
total_descendants += desc.size();
if (!desc.empty())
print_vector(desc);
std::cout << '\n';
}
std::cout << "Total descendants: " << total_descendants << '\n';
return 0;
}
|
Please provide an equivalent version of this Python code in C++. | import itertools
def cp(lsts):
return list(itertools.product(*lsts))
if __name__ == '__main__':
from pprint import pprint as pp
for lists in [[[1,2],[3,4]], [[3,4],[1,2]], [[], [1, 2]], [[1, 2], []],
((1776, 1789), (7, 12), (4, 14, 23), (0, 1)),
((1, 2, 3), (30,), (500, 100)),
((1, 2, 3), (), (500, 100))]:
print(lists, '=>')
pp(cp(lists), indent=2)
| #include <iostream>
#include <vector>
#include <algorithm>
void print(const std::vector<std::vector<int>>& v) {
std::cout << "{ ";
for (const auto& p : v) {
std::cout << "(";
for (const auto& e : p) {
std::cout << e << " ";
}
std::cout << ") ";
}
std::cout << "}" << std::endl;
}
auto product(const std::vector<std::vector<int>>& lists) {
std::vector<std::vector<int>> result;
if (std::find_if(std::begin(lists), std::end(lists),
[](auto e) -> bool { return e.size() == 0; }) != std::end(lists)) {
return result;
}
for (auto& e : lists[0]) {
result.push_back({ e });
}
for (size_t i = 1; i < lists.size(); ++i) {
std::vector<std::vector<int>> temp;
for (auto& e : result) {
for (auto f : lists[i]) {
auto e_tmp = e;
e_tmp.push_back(f);
temp.push_back(e_tmp);
}
}
result = temp;
}
return result;
}
int main() {
std::vector<std::vector<int>> prods[] = {
{ { 1, 2 }, { 3, 4 } },
{ { 3, 4 }, { 1, 2} },
{ { 1, 2 }, { } },
{ { }, { 1, 2 } },
{ { 1776, 1789 }, { 7, 12 }, { 4, 14, 23 }, { 0, 1 } },
{ { 1, 2, 3 }, { 30 }, { 500, 100 } },
{ { 1, 2, 3 }, { }, { 500, 100 } }
};
for (const auto& p : prods) {
print(product(p));
}
std::cin.ignore();
std::cin.get();
return 0;
}
|
Preserve the algorithm and functionality while converting the code from Python to C++. | import itertools
def cp(lsts):
return list(itertools.product(*lsts))
if __name__ == '__main__':
from pprint import pprint as pp
for lists in [[[1,2],[3,4]], [[3,4],[1,2]], [[], [1, 2]], [[1, 2], []],
((1776, 1789), (7, 12), (4, 14, 23), (0, 1)),
((1, 2, 3), (30,), (500, 100)),
((1, 2, 3), (), (500, 100))]:
print(lists, '=>')
pp(cp(lists), indent=2)
| #include <iostream>
#include <vector>
#include <algorithm>
void print(const std::vector<std::vector<int>>& v) {
std::cout << "{ ";
for (const auto& p : v) {
std::cout << "(";
for (const auto& e : p) {
std::cout << e << " ";
}
std::cout << ") ";
}
std::cout << "}" << std::endl;
}
auto product(const std::vector<std::vector<int>>& lists) {
std::vector<std::vector<int>> result;
if (std::find_if(std::begin(lists), std::end(lists),
[](auto e) -> bool { return e.size() == 0; }) != std::end(lists)) {
return result;
}
for (auto& e : lists[0]) {
result.push_back({ e });
}
for (size_t i = 1; i < lists.size(); ++i) {
std::vector<std::vector<int>> temp;
for (auto& e : result) {
for (auto f : lists[i]) {
auto e_tmp = e;
e_tmp.push_back(f);
temp.push_back(e_tmp);
}
}
result = temp;
}
return result;
}
int main() {
std::vector<std::vector<int>> prods[] = {
{ { 1, 2 }, { 3, 4 } },
{ { 3, 4 }, { 1, 2} },
{ { 1, 2 }, { } },
{ { }, { 1, 2 } },
{ { 1776, 1789 }, { 7, 12 }, { 4, 14, 23 }, { 0, 1 } },
{ { 1, 2, 3 }, { 30 }, { 500, 100 } },
{ { 1, 2, 3 }, { }, { 500, 100 } }
};
for (const auto& p : prods) {
print(product(p));
}
std::cin.ignore();
std::cin.get();
return 0;
}
|
Convert the following code from Python to C++, ensuring the logic remains intact. | >>>
>>> from math import sin, cos, acos, asin
>>>
>>> cube = lambda x: x * x * x
>>> croot = lambda x: x ** (1/3.0)
>>>
>>>
>>> compose = lambda f1, f2: ( lambda x: f1(f2(x)) )
>>>
>>> funclist = [sin, cos, cube]
>>> funclisti = [asin, acos, croot]
>>>
>>> [compose(inversef, f)(.5) for f, inversef in zip(funclist, funclisti)]
[0.5, 0.4999999999999999, 0.5]
>>>
| #include <functional>
#include <algorithm>
#include <iostream>
#include <vector>
#include <cmath>
using std::cout;
using std::endl;
using std::vector;
using std::function;
using std::transform;
using std::back_inserter;
typedef function<double(double)> FunType;
vector<FunType> A = {sin, cos, tan, [](double x) { return x*x*x; } };
vector<FunType> B = {asin, acos, atan, [](double x) { return exp(log(x)/3); } };
template <typename A, typename B, typename C>
function<C(A)> compose(function<C(B)> f, function<B(A)> g) {
return [f,g](A x) { return f(g(x)); };
}
int main() {
vector<FunType> composedFuns;
auto exNums = {0.0, 0.2, 0.4, 0.6, 0.8, 1.0};
transform(B.begin(), B.end(),
A.begin(),
back_inserter(composedFuns),
compose<double, double, double>);
for (auto num: exNums)
for (auto fun: composedFuns)
cout << u8"f\u207B\u00B9.f(" << num << ") = " << fun(num) << endl;
return 0;
}
|
Port the following code from Python to C++ with equivalent syntax and logic. | >>> def proper_divs2(n):
... return {x for x in range(1, (n + 1) // 2 + 1) if n % x == 0 and n != x}
...
>>> [proper_divs2(n) for n in range(1, 11)]
[set(), {1}, {1}, {1, 2}, {1}, {1, 2, 3}, {1}, {1, 2, 4}, {1, 3}, {1, 2, 5}]
>>>
>>> n, length = max(((n, len(proper_divs2(n))) for n in range(1, 20001)), key=lambda pd: pd[1])
>>> n
15120
>>> length
79
>>>
| #include <vector>
#include <iostream>
#include <algorithm>
std::vector<int> properDivisors ( int number ) {
std::vector<int> divisors ;
for ( int i = 1 ; i < number / 2 + 1 ; i++ )
if ( number % i == 0 )
divisors.push_back( i ) ;
return divisors ;
}
int main( ) {
std::vector<int> divisors ;
unsigned int maxdivisors = 0 ;
int corresponding_number = 0 ;
for ( int i = 1 ; i < 11 ; i++ ) {
divisors = properDivisors ( i ) ;
std::cout << "Proper divisors of " << i << ":\n" ;
for ( int number : divisors ) {
std::cout << number << " " ;
}
std::cout << std::endl ;
divisors.clear( ) ;
}
for ( int i = 11 ; i < 20001 ; i++ ) {
divisors = properDivisors ( i ) ;
if ( divisors.size( ) > maxdivisors ) {
maxdivisors = divisors.size( ) ;
corresponding_number = i ;
}
divisors.clear( ) ;
}
std::cout << "Most divisors has " << corresponding_number <<
" , it has " << maxdivisors << " divisors!\n" ;
return 0 ;
}
|
Please provide an equivalent version of this Python code in C++. | >>> from xml.etree import ElementTree as ET
>>> from itertools import izip
>>> def characterstoxml(names, remarks):
root = ET.Element("CharacterRemarks")
for name, remark in izip(names, remarks):
c = ET.SubElement(root, "Character", {'name': name})
c.text = remark
return ET.tostring(root)
>>> print characterstoxml(
names = ["April", "Tam O'Shanter", "Emily"],
remarks = [ "Bubbly: I'm > Tam and <= Emily",
'Burns: "When chapman billies leave the street ..."',
'Short & shrift' ] ).replace('><','>\n<')
| #include <vector>
#include <utility>
#include <iostream>
#include <boost/algorithm/string.hpp>
std::string create_xml( std::vector<std::string> & ,std::vector<std::string> & ) ;
int main( ) {
std::vector<std::string> names , remarks ;
names.push_back( "April" ) ;
names.push_back( "Tam O'Shantor" ) ;
names.push_back ( "Emily" ) ;
remarks.push_back( "Bubbly, I'm > Tam and <= Emily" ) ;
remarks.push_back( "Burns: \"When chapman billies leave the street ...\"" ) ;
remarks.push_back( "Short & shrift" ) ;
std::cout << "This is in XML:\n" ;
std::cout << create_xml( names , remarks ) << std::endl ;
return 0 ;
}
std::string create_xml( std::vector<std::string> & names ,
std::vector<std::string> & remarks ) {
std::vector<std::pair<std::string , std::string> > entities ;
entities.push_back( std::make_pair( "&" , "&" ) ) ;
entities.push_back( std::make_pair( "<" , "<" ) ) ;
entities.push_back( std::make_pair( ">" , ">" ) ) ;
std::string xmlstring ( "<CharacterRemarks>\n" ) ;
std::vector<std::string>::iterator vsi = names.begin( ) ;
typedef std::vector<std::pair<std::string , std::string> >::iterator Vpss ;
for ( ; vsi != names.end( ) ; vsi++ ) {
for ( Vpss vs = entities.begin( ) ; vs != entities.end( ) ; vs++ ) {
boost::replace_all ( *vsi , vs->first , vs->second ) ;
}
}
for ( vsi = remarks.begin( ) ; vsi != remarks.end( ) ; vsi++ ) {
for ( Vpss vs = entities.begin( ) ; vs != entities.end( ) ; vs++ ) {
boost::replace_all ( *vsi , vs->first , vs->second ) ;
}
}
for ( int i = 0 ; i < names.size( ) ; i++ ) {
xmlstring.append( "\t<Character name=\"").append( names[ i ] ).append( "\">")
.append( remarks[ i ] ).append( "</Character>\n" ) ;
}
xmlstring.append( "</CharacterRemarks>" ) ;
return xmlstring ;
}
|
Maintain the same structure and functionality when rewriting this code in C++. | >>> x = [0, 1, 2, 3, 4, 5, 6, 7, 8, 9]
>>> y = [2.7, 2.8, 31.4, 38.1, 58.0, 76.2, 100.5, 130.0, 149.3, 180.0]
>>> import pylab
>>> pylab.plot(x, y, 'bo')
>>> pylab.savefig('qsort-range-10-9.png')
| #include <windows.h>
#include <string>
#include <vector>
using namespace std;
const int HSTEP = 46, MWID = 40, MHEI = 471;
const float VSTEP = 2.3f;
class vector2
{
public:
vector2() { x = y = 0; }
vector2( float a, float b ) { x = a; y = b; }
void set( float a, float b ) { x = a; y = b; }
float x, y;
};
class myBitmap
{
public:
myBitmap() : pen( NULL ), brush( NULL ), clr( 0 ), wid( 1 ) {}
~myBitmap()
{
DeleteObject( pen );
DeleteObject( brush );
DeleteDC( hdc );
DeleteObject( bmp );
}
bool create( int w, int h )
{
BITMAPINFO bi;
ZeroMemory( &bi, sizeof( bi ) );
bi.bmiHeader.biSize = sizeof( bi.bmiHeader );
bi.bmiHeader.biBitCount = sizeof( DWORD ) * 8;
bi.bmiHeader.biCompression = BI_RGB;
bi.bmiHeader.biPlanes = 1;
bi.bmiHeader.biWidth = w;
bi.bmiHeader.biHeight = -h;
HDC dc = GetDC( GetConsoleWindow() );
bmp = CreateDIBSection( dc, &bi, DIB_RGB_COLORS, &pBits, NULL, 0 );
if( !bmp ) return false;
hdc = CreateCompatibleDC( dc );
SelectObject( hdc, bmp );
ReleaseDC( GetConsoleWindow(), dc );
width = w; height = h;
return true;
}
void clear( BYTE clr = 0 )
{
memset( pBits, clr, width * height * sizeof( DWORD ) );
}
void setBrushColor( DWORD bClr )
{
if( brush ) DeleteObject( brush );
brush = CreateSolidBrush( bClr );
SelectObject( hdc, brush );
}
void setPenColor( DWORD c ) { clr = c; createPen(); }
void setPenWidth( int w ) { wid = w; createPen(); }
void saveBitmap( string path )
{
BITMAPFILEHEADER fileheader;
BITMAPINFO infoheader;
BITMAP bitmap;
DWORD wb;
GetObject( bmp, sizeof( bitmap ), &bitmap );
DWORD* dwpBits = new DWORD[bitmap.bmWidth * bitmap.bmHeight];
ZeroMemory( dwpBits, bitmap.bmWidth * bitmap.bmHeight * sizeof( DWORD ) );
ZeroMemory( &infoheader, sizeof( BITMAPINFO ) );
ZeroMemory( &fileheader, sizeof( BITMAPFILEHEADER ) );
infoheader.bmiHeader.biBitCount = sizeof( DWORD ) * 8;
infoheader.bmiHeader.biCompression = BI_RGB;
infoheader.bmiHeader.biPlanes = 1;
infoheader.bmiHeader.biSize = sizeof( infoheader.bmiHeader );
infoheader.bmiHeader.biHeight = bitmap.bmHeight;
infoheader.bmiHeader.biWidth = bitmap.bmWidth;
infoheader.bmiHeader.biSizeImage = bitmap.bmWidth * bitmap.bmHeight * sizeof( DWORD );
fileheader.bfType = 0x4D42;
fileheader.bfOffBits = sizeof( infoheader.bmiHeader ) + sizeof( BITMAPFILEHEADER );
fileheader.bfSize = fileheader.bfOffBits + infoheader.bmiHeader.biSizeImage;
GetDIBits( hdc, bmp, 0, height, ( LPVOID )dwpBits, &infoheader, DIB_RGB_COLORS );
HANDLE file = CreateFile( path.c_str(), GENERIC_WRITE, 0, NULL, CREATE_ALWAYS, FILE_ATTRIBUTE_NORMAL, NULL );
WriteFile( file, &fileheader, sizeof( BITMAPFILEHEADER ), &wb, NULL );
WriteFile( file, &infoheader.bmiHeader, sizeof( infoheader.bmiHeader ), &wb, NULL );
WriteFile( file, dwpBits, bitmap.bmWidth * bitmap.bmHeight * 4, &wb, NULL );
CloseHandle( file );
delete [] dwpBits;
}
HDC getDC() const { return hdc; }
int getWidth() const { return width; }
int getHeight() const { return height; }
private:
void createPen()
{
if( pen ) DeleteObject( pen );
pen = CreatePen( PS_SOLID, wid, clr );
SelectObject( hdc, pen );
}
HBITMAP bmp;
HDC hdc;
HPEN pen;
HBRUSH brush;
void *pBits;
int width, height, wid;
DWORD clr;
};
class plot
{
public:
plot() { bmp.create( 512, 512 ); }
void draw( vector<vector2>* pairs )
{
bmp.clear( 0xff );
drawGraph( pairs );
plotIt( pairs );
HDC dc = GetDC( GetConsoleWindow() );
BitBlt( dc, 0, 30, 512, 512, bmp.getDC(), 0, 0, SRCCOPY );
ReleaseDC( GetConsoleWindow(), dc );
}
private:
void drawGraph( vector<vector2>* pairs )
{
HDC dc = bmp.getDC();
bmp.setPenColor( RGB( 240, 240, 240 ) );
DWORD b = 11, c = 40, x;
RECT rc; char txt[8];
for( x = 0; x < pairs->size(); x++ )
{
MoveToEx( dc, 40, b, NULL ); LineTo( dc, 500, b );
MoveToEx( dc, c, 11, NULL ); LineTo( dc, c, 471 );
wsprintf( txt, "%d", ( pairs->size() - x ) * 20 );
SetRect( &rc, 0, b - 9, 36, b + 11 );
DrawText( dc, txt, lstrlen( txt ), &rc, DT_RIGHT | DT_VCENTER | DT_SINGLELINE );
wsprintf( txt, "%d", x );
SetRect( &rc, c - 8, 472, c + 8, 492 );
DrawText( dc, txt, lstrlen( txt ), &rc, DT_CENTER | DT_VCENTER | DT_SINGLELINE );
c += 46; b += 46;
}
SetRect( &rc, 0, b - 9, 36, b + 11 );
DrawText( dc, "0", 1, &rc, DT_RIGHT | DT_VCENTER | DT_SINGLELINE );
bmp.setPenColor( 0 ); bmp.setPenWidth( 3 );
MoveToEx( dc, 40, 11, NULL ); LineTo( dc, 40, 471 );
MoveToEx( dc, 40, 471, NULL ); LineTo( dc, 500, 471 );
}
void plotIt( vector<vector2>* pairs )
{
HDC dc = bmp.getDC();
HBRUSH br = CreateSolidBrush( 255 );
RECT rc;
bmp.setPenColor( 255 ); bmp.setPenWidth( 2 );
vector<vector2>::iterator it = pairs->begin();
int a = MWID + HSTEP * static_cast<int>( ( *it ).x ), b = MHEI - static_cast<int>( VSTEP * ( *it ).y );
MoveToEx( dc, a, b, NULL );
SetRect( &rc, a - 3, b - 3, a + 3, b + 3 ); FillRect( dc, &rc, br );
it++;
for( ; it < pairs->end(); it++ )
{
a = MWID + HSTEP * static_cast<int>( ( *it ).x );
b = MHEI - static_cast<int>( VSTEP * ( *it ).y );
SetRect( &rc, a - 3, b - 3, a + 3, b + 3 );
FillRect( dc, &rc, br ); LineTo( dc, a, b );
}
DeleteObject( br );
}
myBitmap bmp;
};
int main( int argc, char* argv[] )
{
ShowWindow( GetConsoleWindow(), SW_MAXIMIZE );
plot pt;
vector<vector2> pairs;
pairs.push_back( vector2( 0, 2.7f ) ); pairs.push_back( vector2( 1, 2.8f ) );
pairs.push_back( vector2( 2.0f, 31.4f ) ); pairs.push_back( vector2( 3.0f, 38.1f ) );
pairs.push_back( vector2( 4.0f, 58.0f ) ); pairs.push_back( vector2( 5.0f, 76.2f ) );
pairs.push_back( vector2( 6.0f, 100.5f ) ); pairs.push_back( vector2( 7.0f, 130.0f ) );
pairs.push_back( vector2( 8.0f, 149.3f ) ); pairs.push_back( vector2( 9.0f, 180.0f ) );
pt.draw( &pairs );
system( "pause" );
return 0;
}
|
Maintain the same structure and functionality when rewriting this code in C++. | >>> x = [0, 1, 2, 3, 4, 5, 6, 7, 8, 9]
>>> y = [2.7, 2.8, 31.4, 38.1, 58.0, 76.2, 100.5, 130.0, 149.3, 180.0]
>>> import pylab
>>> pylab.plot(x, y, 'bo')
>>> pylab.savefig('qsort-range-10-9.png')
| #include <windows.h>
#include <string>
#include <vector>
using namespace std;
const int HSTEP = 46, MWID = 40, MHEI = 471;
const float VSTEP = 2.3f;
class vector2
{
public:
vector2() { x = y = 0; }
vector2( float a, float b ) { x = a; y = b; }
void set( float a, float b ) { x = a; y = b; }
float x, y;
};
class myBitmap
{
public:
myBitmap() : pen( NULL ), brush( NULL ), clr( 0 ), wid( 1 ) {}
~myBitmap()
{
DeleteObject( pen );
DeleteObject( brush );
DeleteDC( hdc );
DeleteObject( bmp );
}
bool create( int w, int h )
{
BITMAPINFO bi;
ZeroMemory( &bi, sizeof( bi ) );
bi.bmiHeader.biSize = sizeof( bi.bmiHeader );
bi.bmiHeader.biBitCount = sizeof( DWORD ) * 8;
bi.bmiHeader.biCompression = BI_RGB;
bi.bmiHeader.biPlanes = 1;
bi.bmiHeader.biWidth = w;
bi.bmiHeader.biHeight = -h;
HDC dc = GetDC( GetConsoleWindow() );
bmp = CreateDIBSection( dc, &bi, DIB_RGB_COLORS, &pBits, NULL, 0 );
if( !bmp ) return false;
hdc = CreateCompatibleDC( dc );
SelectObject( hdc, bmp );
ReleaseDC( GetConsoleWindow(), dc );
width = w; height = h;
return true;
}
void clear( BYTE clr = 0 )
{
memset( pBits, clr, width * height * sizeof( DWORD ) );
}
void setBrushColor( DWORD bClr )
{
if( brush ) DeleteObject( brush );
brush = CreateSolidBrush( bClr );
SelectObject( hdc, brush );
}
void setPenColor( DWORD c ) { clr = c; createPen(); }
void setPenWidth( int w ) { wid = w; createPen(); }
void saveBitmap( string path )
{
BITMAPFILEHEADER fileheader;
BITMAPINFO infoheader;
BITMAP bitmap;
DWORD wb;
GetObject( bmp, sizeof( bitmap ), &bitmap );
DWORD* dwpBits = new DWORD[bitmap.bmWidth * bitmap.bmHeight];
ZeroMemory( dwpBits, bitmap.bmWidth * bitmap.bmHeight * sizeof( DWORD ) );
ZeroMemory( &infoheader, sizeof( BITMAPINFO ) );
ZeroMemory( &fileheader, sizeof( BITMAPFILEHEADER ) );
infoheader.bmiHeader.biBitCount = sizeof( DWORD ) * 8;
infoheader.bmiHeader.biCompression = BI_RGB;
infoheader.bmiHeader.biPlanes = 1;
infoheader.bmiHeader.biSize = sizeof( infoheader.bmiHeader );
infoheader.bmiHeader.biHeight = bitmap.bmHeight;
infoheader.bmiHeader.biWidth = bitmap.bmWidth;
infoheader.bmiHeader.biSizeImage = bitmap.bmWidth * bitmap.bmHeight * sizeof( DWORD );
fileheader.bfType = 0x4D42;
fileheader.bfOffBits = sizeof( infoheader.bmiHeader ) + sizeof( BITMAPFILEHEADER );
fileheader.bfSize = fileheader.bfOffBits + infoheader.bmiHeader.biSizeImage;
GetDIBits( hdc, bmp, 0, height, ( LPVOID )dwpBits, &infoheader, DIB_RGB_COLORS );
HANDLE file = CreateFile( path.c_str(), GENERIC_WRITE, 0, NULL, CREATE_ALWAYS, FILE_ATTRIBUTE_NORMAL, NULL );
WriteFile( file, &fileheader, sizeof( BITMAPFILEHEADER ), &wb, NULL );
WriteFile( file, &infoheader.bmiHeader, sizeof( infoheader.bmiHeader ), &wb, NULL );
WriteFile( file, dwpBits, bitmap.bmWidth * bitmap.bmHeight * 4, &wb, NULL );
CloseHandle( file );
delete [] dwpBits;
}
HDC getDC() const { return hdc; }
int getWidth() const { return width; }
int getHeight() const { return height; }
private:
void createPen()
{
if( pen ) DeleteObject( pen );
pen = CreatePen( PS_SOLID, wid, clr );
SelectObject( hdc, pen );
}
HBITMAP bmp;
HDC hdc;
HPEN pen;
HBRUSH brush;
void *pBits;
int width, height, wid;
DWORD clr;
};
class plot
{
public:
plot() { bmp.create( 512, 512 ); }
void draw( vector<vector2>* pairs )
{
bmp.clear( 0xff );
drawGraph( pairs );
plotIt( pairs );
HDC dc = GetDC( GetConsoleWindow() );
BitBlt( dc, 0, 30, 512, 512, bmp.getDC(), 0, 0, SRCCOPY );
ReleaseDC( GetConsoleWindow(), dc );
}
private:
void drawGraph( vector<vector2>* pairs )
{
HDC dc = bmp.getDC();
bmp.setPenColor( RGB( 240, 240, 240 ) );
DWORD b = 11, c = 40, x;
RECT rc; char txt[8];
for( x = 0; x < pairs->size(); x++ )
{
MoveToEx( dc, 40, b, NULL ); LineTo( dc, 500, b );
MoveToEx( dc, c, 11, NULL ); LineTo( dc, c, 471 );
wsprintf( txt, "%d", ( pairs->size() - x ) * 20 );
SetRect( &rc, 0, b - 9, 36, b + 11 );
DrawText( dc, txt, lstrlen( txt ), &rc, DT_RIGHT | DT_VCENTER | DT_SINGLELINE );
wsprintf( txt, "%d", x );
SetRect( &rc, c - 8, 472, c + 8, 492 );
DrawText( dc, txt, lstrlen( txt ), &rc, DT_CENTER | DT_VCENTER | DT_SINGLELINE );
c += 46; b += 46;
}
SetRect( &rc, 0, b - 9, 36, b + 11 );
DrawText( dc, "0", 1, &rc, DT_RIGHT | DT_VCENTER | DT_SINGLELINE );
bmp.setPenColor( 0 ); bmp.setPenWidth( 3 );
MoveToEx( dc, 40, 11, NULL ); LineTo( dc, 40, 471 );
MoveToEx( dc, 40, 471, NULL ); LineTo( dc, 500, 471 );
}
void plotIt( vector<vector2>* pairs )
{
HDC dc = bmp.getDC();
HBRUSH br = CreateSolidBrush( 255 );
RECT rc;
bmp.setPenColor( 255 ); bmp.setPenWidth( 2 );
vector<vector2>::iterator it = pairs->begin();
int a = MWID + HSTEP * static_cast<int>( ( *it ).x ), b = MHEI - static_cast<int>( VSTEP * ( *it ).y );
MoveToEx( dc, a, b, NULL );
SetRect( &rc, a - 3, b - 3, a + 3, b + 3 ); FillRect( dc, &rc, br );
it++;
for( ; it < pairs->end(); it++ )
{
a = MWID + HSTEP * static_cast<int>( ( *it ).x );
b = MHEI - static_cast<int>( VSTEP * ( *it ).y );
SetRect( &rc, a - 3, b - 3, a + 3, b + 3 );
FillRect( dc, &rc, br ); LineTo( dc, a, b );
}
DeleteObject( br );
}
myBitmap bmp;
};
int main( int argc, char* argv[] )
{
ShowWindow( GetConsoleWindow(), SW_MAXIMIZE );
plot pt;
vector<vector2> pairs;
pairs.push_back( vector2( 0, 2.7f ) ); pairs.push_back( vector2( 1, 2.8f ) );
pairs.push_back( vector2( 2.0f, 31.4f ) ); pairs.push_back( vector2( 3.0f, 38.1f ) );
pairs.push_back( vector2( 4.0f, 58.0f ) ); pairs.push_back( vector2( 5.0f, 76.2f ) );
pairs.push_back( vector2( 6.0f, 100.5f ) ); pairs.push_back( vector2( 7.0f, 130.0f ) );
pairs.push_back( vector2( 8.0f, 149.3f ) ); pairs.push_back( vector2( 9.0f, 180.0f ) );
pt.draw( &pairs );
system( "pause" );
return 0;
}
|
Ensure the translated C++ code behaves exactly like the original Python snippet. | >>> x = [0, 1, 2, 3, 4, 5, 6, 7, 8, 9]
>>> y = [2.7, 2.8, 31.4, 38.1, 58.0, 76.2, 100.5, 130.0, 149.3, 180.0]
>>> import pylab
>>> pylab.plot(x, y, 'bo')
>>> pylab.savefig('qsort-range-10-9.png')
| #include <windows.h>
#include <string>
#include <vector>
using namespace std;
const int HSTEP = 46, MWID = 40, MHEI = 471;
const float VSTEP = 2.3f;
class vector2
{
public:
vector2() { x = y = 0; }
vector2( float a, float b ) { x = a; y = b; }
void set( float a, float b ) { x = a; y = b; }
float x, y;
};
class myBitmap
{
public:
myBitmap() : pen( NULL ), brush( NULL ), clr( 0 ), wid( 1 ) {}
~myBitmap()
{
DeleteObject( pen );
DeleteObject( brush );
DeleteDC( hdc );
DeleteObject( bmp );
}
bool create( int w, int h )
{
BITMAPINFO bi;
ZeroMemory( &bi, sizeof( bi ) );
bi.bmiHeader.biSize = sizeof( bi.bmiHeader );
bi.bmiHeader.biBitCount = sizeof( DWORD ) * 8;
bi.bmiHeader.biCompression = BI_RGB;
bi.bmiHeader.biPlanes = 1;
bi.bmiHeader.biWidth = w;
bi.bmiHeader.biHeight = -h;
HDC dc = GetDC( GetConsoleWindow() );
bmp = CreateDIBSection( dc, &bi, DIB_RGB_COLORS, &pBits, NULL, 0 );
if( !bmp ) return false;
hdc = CreateCompatibleDC( dc );
SelectObject( hdc, bmp );
ReleaseDC( GetConsoleWindow(), dc );
width = w; height = h;
return true;
}
void clear( BYTE clr = 0 )
{
memset( pBits, clr, width * height * sizeof( DWORD ) );
}
void setBrushColor( DWORD bClr )
{
if( brush ) DeleteObject( brush );
brush = CreateSolidBrush( bClr );
SelectObject( hdc, brush );
}
void setPenColor( DWORD c ) { clr = c; createPen(); }
void setPenWidth( int w ) { wid = w; createPen(); }
void saveBitmap( string path )
{
BITMAPFILEHEADER fileheader;
BITMAPINFO infoheader;
BITMAP bitmap;
DWORD wb;
GetObject( bmp, sizeof( bitmap ), &bitmap );
DWORD* dwpBits = new DWORD[bitmap.bmWidth * bitmap.bmHeight];
ZeroMemory( dwpBits, bitmap.bmWidth * bitmap.bmHeight * sizeof( DWORD ) );
ZeroMemory( &infoheader, sizeof( BITMAPINFO ) );
ZeroMemory( &fileheader, sizeof( BITMAPFILEHEADER ) );
infoheader.bmiHeader.biBitCount = sizeof( DWORD ) * 8;
infoheader.bmiHeader.biCompression = BI_RGB;
infoheader.bmiHeader.biPlanes = 1;
infoheader.bmiHeader.biSize = sizeof( infoheader.bmiHeader );
infoheader.bmiHeader.biHeight = bitmap.bmHeight;
infoheader.bmiHeader.biWidth = bitmap.bmWidth;
infoheader.bmiHeader.biSizeImage = bitmap.bmWidth * bitmap.bmHeight * sizeof( DWORD );
fileheader.bfType = 0x4D42;
fileheader.bfOffBits = sizeof( infoheader.bmiHeader ) + sizeof( BITMAPFILEHEADER );
fileheader.bfSize = fileheader.bfOffBits + infoheader.bmiHeader.biSizeImage;
GetDIBits( hdc, bmp, 0, height, ( LPVOID )dwpBits, &infoheader, DIB_RGB_COLORS );
HANDLE file = CreateFile( path.c_str(), GENERIC_WRITE, 0, NULL, CREATE_ALWAYS, FILE_ATTRIBUTE_NORMAL, NULL );
WriteFile( file, &fileheader, sizeof( BITMAPFILEHEADER ), &wb, NULL );
WriteFile( file, &infoheader.bmiHeader, sizeof( infoheader.bmiHeader ), &wb, NULL );
WriteFile( file, dwpBits, bitmap.bmWidth * bitmap.bmHeight * 4, &wb, NULL );
CloseHandle( file );
delete [] dwpBits;
}
HDC getDC() const { return hdc; }
int getWidth() const { return width; }
int getHeight() const { return height; }
private:
void createPen()
{
if( pen ) DeleteObject( pen );
pen = CreatePen( PS_SOLID, wid, clr );
SelectObject( hdc, pen );
}
HBITMAP bmp;
HDC hdc;
HPEN pen;
HBRUSH brush;
void *pBits;
int width, height, wid;
DWORD clr;
};
class plot
{
public:
plot() { bmp.create( 512, 512 ); }
void draw( vector<vector2>* pairs )
{
bmp.clear( 0xff );
drawGraph( pairs );
plotIt( pairs );
HDC dc = GetDC( GetConsoleWindow() );
BitBlt( dc, 0, 30, 512, 512, bmp.getDC(), 0, 0, SRCCOPY );
ReleaseDC( GetConsoleWindow(), dc );
}
private:
void drawGraph( vector<vector2>* pairs )
{
HDC dc = bmp.getDC();
bmp.setPenColor( RGB( 240, 240, 240 ) );
DWORD b = 11, c = 40, x;
RECT rc; char txt[8];
for( x = 0; x < pairs->size(); x++ )
{
MoveToEx( dc, 40, b, NULL ); LineTo( dc, 500, b );
MoveToEx( dc, c, 11, NULL ); LineTo( dc, c, 471 );
wsprintf( txt, "%d", ( pairs->size() - x ) * 20 );
SetRect( &rc, 0, b - 9, 36, b + 11 );
DrawText( dc, txt, lstrlen( txt ), &rc, DT_RIGHT | DT_VCENTER | DT_SINGLELINE );
wsprintf( txt, "%d", x );
SetRect( &rc, c - 8, 472, c + 8, 492 );
DrawText( dc, txt, lstrlen( txt ), &rc, DT_CENTER | DT_VCENTER | DT_SINGLELINE );
c += 46; b += 46;
}
SetRect( &rc, 0, b - 9, 36, b + 11 );
DrawText( dc, "0", 1, &rc, DT_RIGHT | DT_VCENTER | DT_SINGLELINE );
bmp.setPenColor( 0 ); bmp.setPenWidth( 3 );
MoveToEx( dc, 40, 11, NULL ); LineTo( dc, 40, 471 );
MoveToEx( dc, 40, 471, NULL ); LineTo( dc, 500, 471 );
}
void plotIt( vector<vector2>* pairs )
{
HDC dc = bmp.getDC();
HBRUSH br = CreateSolidBrush( 255 );
RECT rc;
bmp.setPenColor( 255 ); bmp.setPenWidth( 2 );
vector<vector2>::iterator it = pairs->begin();
int a = MWID + HSTEP * static_cast<int>( ( *it ).x ), b = MHEI - static_cast<int>( VSTEP * ( *it ).y );
MoveToEx( dc, a, b, NULL );
SetRect( &rc, a - 3, b - 3, a + 3, b + 3 ); FillRect( dc, &rc, br );
it++;
for( ; it < pairs->end(); it++ )
{
a = MWID + HSTEP * static_cast<int>( ( *it ).x );
b = MHEI - static_cast<int>( VSTEP * ( *it ).y );
SetRect( &rc, a - 3, b - 3, a + 3, b + 3 );
FillRect( dc, &rc, br ); LineTo( dc, a, b );
}
DeleteObject( br );
}
myBitmap bmp;
};
int main( int argc, char* argv[] )
{
ShowWindow( GetConsoleWindow(), SW_MAXIMIZE );
plot pt;
vector<vector2> pairs;
pairs.push_back( vector2( 0, 2.7f ) ); pairs.push_back( vector2( 1, 2.8f ) );
pairs.push_back( vector2( 2.0f, 31.4f ) ); pairs.push_back( vector2( 3.0f, 38.1f ) );
pairs.push_back( vector2( 4.0f, 58.0f ) ); pairs.push_back( vector2( 5.0f, 76.2f ) );
pairs.push_back( vector2( 6.0f, 100.5f ) ); pairs.push_back( vector2( 7.0f, 130.0f ) );
pairs.push_back( vector2( 8.0f, 149.3f ) ); pairs.push_back( vector2( 9.0f, 180.0f ) );
pt.draw( &pairs );
system( "pause" );
return 0;
}
|
Generate a C++ translation of this Python snippet without changing its computational steps. | import re
string = "This is a string"
if re.search('string$', string):
print("Ends with string.")
string = re.sub(" a ", " another ", string)
print(string)
| #include <iostream>
#include <string>
#include <iterator>
#include <regex>
int main()
{
std::regex re(".* string$");
std::string s = "Hi, I am a string";
if (std::regex_match(s, re))
std::cout << "The string matches.\n";
else
std::cout << "Oops - not found?\n";
std::regex re2(" a.*a");
std::smatch match;
if (std::regex_search(s, match, re2))
{
std::cout << "Matched " << match.length()
<< " characters starting at " << match.position() << ".\n";
std::cout << "Matched character sequence: \""
<< match.str() << "\"\n";
}
else
{
std::cout << "Oops - not found?\n";
}
std::string dest_string;
std::regex_replace(std::back_inserter(dest_string),
s.begin(), s.end(),
re2,
"'m now a changed");
std::cout << dest_string << std::endl;
}
|
Can you help me rewrite this code in C++ instead of Python, keeping it the same logically? | inclusive_range = mn, mx = (1, 10)
print( % inclusive_range)
i = 0
while True:
i += 1
guess = (mn+mx)//2
txt = input("Guess %2i is: %2i. The score for which is (h,l,=): "
% (i, guess)).strip().lower()[0]
if txt not in 'hl=':
print(" I don't understand your input of '%s' ?" % txt)
continue
if txt == 'h':
mx = guess-1
if txt == 'l':
mn = guess+1
if txt == '=':
print(" Ye-Haw!!")
break
if (mn > mx) or (mn < inclusive_range[0]) or (mx > inclusive_range[1]):
print("Please check your scoring as I cannot find the value")
break
print("\nThanks for keeping score.")
| #include <iostream>
#include <algorithm>
#include <string>
#include <iterator>
struct GuessNumberIterator : std::iterator<std::random_access_iterator_tag, int> {
int i;
GuessNumberIterator() { }
GuessNumberIterator(int _i) : i(_i) { }
GuessNumberIterator& operator++() { ++i; return *this; }
GuessNumberIterator operator++(int) {
GuessNumberIterator tmp = *this; ++(*this); return tmp; }
bool operator==(const GuessNumberIterator& y) { return i == y.i; }
bool operator!=(const GuessNumberIterator& y) { return i != y.i; }
int operator*() {
std::cout << "Is your number less than or equal to " << i << "? ";
std::string s;
std::cin >> s;
return (s != "" && (s[0] == 'y' || s[0] == 'Y')) ? 0 : -1;
}
GuessNumberIterator& operator--() { --i; return *this; }
GuessNumberIterator operator--(int) {
GuessNumberIterator tmp = *this; --(*this); return tmp; }
GuessNumberIterator& operator+=(int n) { i += n; return *this; }
GuessNumberIterator& operator-=(int n) { i -= n; return *this; }
GuessNumberIterator operator+(int n) {
GuessNumberIterator tmp = *this; return tmp += n; }
GuessNumberIterator operator-(int n) {
GuessNumberIterator tmp = *this; return tmp -= n; }
int operator-(const GuessNumberIterator &y) { return i - y.i; }
int operator[](int n) { return *(*this + n); }
bool operator<(const GuessNumberIterator &y) { return i < y.i; }
bool operator>(const GuessNumberIterator &y) { return i > y.i; }
bool operator<=(const GuessNumberIterator &y) { return i <= y.i; }
bool operator>=(const GuessNumberIterator &y) { return i >= y.i; }
};
inline GuessNumberIterator operator+(int n, GuessNumberIterator &i) { return i + n; }
const int lower = 0;
const int upper = 100;
int main() {
std::cout << "Instructions:\n"
<< "Think of integer number from " << lower << " (inclusive) to "
<< upper << " (exclusive) and\n"
<< "I will guess it. After each guess, I will ask you if it is less than\n"
<< "or equal to some number, and you will respond with \"yes\" or \"no\".\n";
int answer = std::lower_bound(GuessNumberIterator(lower), GuessNumberIterator(upper), 0).i;
std::cout << "Your number is " << answer << ".\n";
return 0;
}
|
Port the following code from Python to C++ with equivalent syntax and logic. | keys = ['a', 'b', 'c']
values = [1, 2, 3]
hash = {key: value for key, value in zip(keys, values)}
| #include <unordered_map>
#include <string>
int main()
{
std::string keys[] = { "1", "2", "3" };
std::string vals[] = { "a", "b", "c" };
std::unordered_map<std::string, std::string> hash;
for( int i = 0 ; i < 3 ; i++ )
hash[ keys[i] ] = vals[i] ;
}
|
Write the same code in C++ as shown below in Python. | from bisect import bisect_right
def bin_it(limits: list, data: list) -> list:
"Bin data according to (ascending) limits."
bins = [0] * (len(limits) + 1)
for d in data:
bins[bisect_right(limits, d)] += 1
return bins
def bin_print(limits: list, bins: list) -> list:
print(f" < {limits[0]:3} := {bins[0]:3}")
for lo, hi, count in zip(limits, limits[1:], bins[1:]):
print(f">= {lo:3} .. < {hi:3} := {count:3}")
print(f">= {limits[-1]:3} := {bins[-1]:3}")
if __name__ == "__main__":
print("RC FIRST EXAMPLE\n")
limits = [23, 37, 43, 53, 67, 83]
data = [95,21,94,12,99,4,70,75,83,93,52,80,57,5,53,86,65,17,92,83,71,61,54,58,47,
16, 8, 9,32,84,7,87,46,19,30,37,96,6,98,40,79,97,45,64,60,29,49,36,43,55]
bins = bin_it(limits, data)
bin_print(limits, bins)
print("\nRC SECOND EXAMPLE\n")
limits = [14, 18, 249, 312, 389, 392, 513, 591, 634, 720]
data = [445,814,519,697,700,130,255,889,481,122,932, 77,323,525,570,219,367,523,442,933,
416,589,930,373,202,253,775, 47,731,685,293,126,133,450,545,100,741,583,763,306,
655,267,248,477,549,238, 62,678, 98,534,622,907,406,714,184,391,913, 42,560,247,
346,860, 56,138,546, 38,985,948, 58,213,799,319,390,634,458,945,733,507,916,123,
345,110,720,917,313,845,426, 9,457,628,410,723,354,895,881,953,677,137,397, 97,
854,740, 83,216,421, 94,517,479,292,963,376,981,480, 39,257,272,157, 5,316,395,
787,942,456,242,759,898,576, 67,298,425,894,435,831,241,989,614,987,770,384,692,
698,765,331,487,251,600,879,342,982,527,736,795,585, 40, 54,901,408,359,577,237,
605,847,353,968,832,205,838,427,876,959,686,646,835,127,621,892,443,198,988,791,
466, 23,707,467, 33,670,921,180,991,396,160,436,717,918, 8,374,101,684,727,749]
bins = bin_it(limits, data)
bin_print(limits, bins)
| #include <algorithm>
#include <cassert>
#include <iomanip>
#include <iostream>
#include <vector>
std::vector<int> bins(const std::vector<int>& limits,
const std::vector<int>& data) {
std::vector<int> result(limits.size() + 1, 0);
for (int n : data) {
auto i = std::upper_bound(limits.begin(), limits.end(), n);
++result[i - limits.begin()];
}
return result;
}
void print_bins(const std::vector<int>& limits, const std::vector<int>& bins) {
size_t n = limits.size();
if (n == 0)
return;
assert(n + 1 == bins.size());
std::cout << " < " << std::setw(3) << limits[0] << ": "
<< std::setw(2) << bins[0] << '\n';
for (size_t i = 1; i < n; ++i)
std::cout << ">= " << std::setw(3) << limits[i - 1] << " and < "
<< std::setw(3) << limits[i] << ": " << std::setw(2)
<< bins[i] << '\n';
std::cout << ">= " << std::setw(3) << limits[n - 1] << " : "
<< std::setw(2) << bins[n] << '\n';
}
int main() {
const std::vector<int> limits1{23, 37, 43, 53, 67, 83};
const std::vector<int> data1{
95, 21, 94, 12, 99, 4, 70, 75, 83, 93, 52, 80, 57, 5, 53, 86, 65,
17, 92, 83, 71, 61, 54, 58, 47, 16, 8, 9, 32, 84, 7, 87, 46, 19,
30, 37, 96, 6, 98, 40, 79, 97, 45, 64, 60, 29, 49, 36, 43, 55};
std::cout << "Example 1:\n";
print_bins(limits1, bins(limits1, data1));
const std::vector<int> limits2{14, 18, 249, 312, 389,
392, 513, 591, 634, 720};
const std::vector<int> data2{
445, 814, 519, 697, 700, 130, 255, 889, 481, 122, 932, 77, 323, 525,
570, 219, 367, 523, 442, 933, 416, 589, 930, 373, 202, 253, 775, 47,
731, 685, 293, 126, 133, 450, 545, 100, 741, 583, 763, 306, 655, 267,
248, 477, 549, 238, 62, 678, 98, 534, 622, 907, 406, 714, 184, 391,
913, 42, 560, 247, 346, 860, 56, 138, 546, 38, 985, 948, 58, 213,
799, 319, 390, 634, 458, 945, 733, 507, 916, 123, 345, 110, 720, 917,
313, 845, 426, 9, 457, 628, 410, 723, 354, 895, 881, 953, 677, 137,
397, 97, 854, 740, 83, 216, 421, 94, 517, 479, 292, 963, 376, 981,
480, 39, 257, 272, 157, 5, 316, 395, 787, 942, 456, 242, 759, 898,
576, 67, 298, 425, 894, 435, 831, 241, 989, 614, 987, 770, 384, 692,
698, 765, 331, 487, 251, 600, 879, 342, 982, 527, 736, 795, 585, 40,
54, 901, 408, 359, 577, 237, 605, 847, 353, 968, 832, 205, 838, 427,
876, 959, 686, 646, 835, 127, 621, 892, 443, 198, 988, 791, 466, 23,
707, 467, 33, 670, 921, 180, 991, 396, 160, 436, 717, 918, 8, 374,
101, 684, 727, 749};
std::cout << "\nExample 2:\n";
print_bins(limits2, bins(limits2, data2));
}
|
Port the following code from Python to C++ with equivalent syntax and logic. | from bisect import bisect_right
def bin_it(limits: list, data: list) -> list:
"Bin data according to (ascending) limits."
bins = [0] * (len(limits) + 1)
for d in data:
bins[bisect_right(limits, d)] += 1
return bins
def bin_print(limits: list, bins: list) -> list:
print(f" < {limits[0]:3} := {bins[0]:3}")
for lo, hi, count in zip(limits, limits[1:], bins[1:]):
print(f">= {lo:3} .. < {hi:3} := {count:3}")
print(f">= {limits[-1]:3} := {bins[-1]:3}")
if __name__ == "__main__":
print("RC FIRST EXAMPLE\n")
limits = [23, 37, 43, 53, 67, 83]
data = [95,21,94,12,99,4,70,75,83,93,52,80,57,5,53,86,65,17,92,83,71,61,54,58,47,
16, 8, 9,32,84,7,87,46,19,30,37,96,6,98,40,79,97,45,64,60,29,49,36,43,55]
bins = bin_it(limits, data)
bin_print(limits, bins)
print("\nRC SECOND EXAMPLE\n")
limits = [14, 18, 249, 312, 389, 392, 513, 591, 634, 720]
data = [445,814,519,697,700,130,255,889,481,122,932, 77,323,525,570,219,367,523,442,933,
416,589,930,373,202,253,775, 47,731,685,293,126,133,450,545,100,741,583,763,306,
655,267,248,477,549,238, 62,678, 98,534,622,907,406,714,184,391,913, 42,560,247,
346,860, 56,138,546, 38,985,948, 58,213,799,319,390,634,458,945,733,507,916,123,
345,110,720,917,313,845,426, 9,457,628,410,723,354,895,881,953,677,137,397, 97,
854,740, 83,216,421, 94,517,479,292,963,376,981,480, 39,257,272,157, 5,316,395,
787,942,456,242,759,898,576, 67,298,425,894,435,831,241,989,614,987,770,384,692,
698,765,331,487,251,600,879,342,982,527,736,795,585, 40, 54,901,408,359,577,237,
605,847,353,968,832,205,838,427,876,959,686,646,835,127,621,892,443,198,988,791,
466, 23,707,467, 33,670,921,180,991,396,160,436,717,918, 8,374,101,684,727,749]
bins = bin_it(limits, data)
bin_print(limits, bins)
| #include <algorithm>
#include <cassert>
#include <iomanip>
#include <iostream>
#include <vector>
std::vector<int> bins(const std::vector<int>& limits,
const std::vector<int>& data) {
std::vector<int> result(limits.size() + 1, 0);
for (int n : data) {
auto i = std::upper_bound(limits.begin(), limits.end(), n);
++result[i - limits.begin()];
}
return result;
}
void print_bins(const std::vector<int>& limits, const std::vector<int>& bins) {
size_t n = limits.size();
if (n == 0)
return;
assert(n + 1 == bins.size());
std::cout << " < " << std::setw(3) << limits[0] << ": "
<< std::setw(2) << bins[0] << '\n';
for (size_t i = 1; i < n; ++i)
std::cout << ">= " << std::setw(3) << limits[i - 1] << " and < "
<< std::setw(3) << limits[i] << ": " << std::setw(2)
<< bins[i] << '\n';
std::cout << ">= " << std::setw(3) << limits[n - 1] << " : "
<< std::setw(2) << bins[n] << '\n';
}
int main() {
const std::vector<int> limits1{23, 37, 43, 53, 67, 83};
const std::vector<int> data1{
95, 21, 94, 12, 99, 4, 70, 75, 83, 93, 52, 80, 57, 5, 53, 86, 65,
17, 92, 83, 71, 61, 54, 58, 47, 16, 8, 9, 32, 84, 7, 87, 46, 19,
30, 37, 96, 6, 98, 40, 79, 97, 45, 64, 60, 29, 49, 36, 43, 55};
std::cout << "Example 1:\n";
print_bins(limits1, bins(limits1, data1));
const std::vector<int> limits2{14, 18, 249, 312, 389,
392, 513, 591, 634, 720};
const std::vector<int> data2{
445, 814, 519, 697, 700, 130, 255, 889, 481, 122, 932, 77, 323, 525,
570, 219, 367, 523, 442, 933, 416, 589, 930, 373, 202, 253, 775, 47,
731, 685, 293, 126, 133, 450, 545, 100, 741, 583, 763, 306, 655, 267,
248, 477, 549, 238, 62, 678, 98, 534, 622, 907, 406, 714, 184, 391,
913, 42, 560, 247, 346, 860, 56, 138, 546, 38, 985, 948, 58, 213,
799, 319, 390, 634, 458, 945, 733, 507, 916, 123, 345, 110, 720, 917,
313, 845, 426, 9, 457, 628, 410, 723, 354, 895, 881, 953, 677, 137,
397, 97, 854, 740, 83, 216, 421, 94, 517, 479, 292, 963, 376, 981,
480, 39, 257, 272, 157, 5, 316, 395, 787, 942, 456, 242, 759, 898,
576, 67, 298, 425, 894, 435, 831, 241, 989, 614, 987, 770, 384, 692,
698, 765, 331, 487, 251, 600, 879, 342, 982, 527, 736, 795, 585, 40,
54, 901, 408, 359, 577, 237, 605, 847, 353, 968, 832, 205, 838, 427,
876, 959, 686, 646, 835, 127, 621, 892, 443, 198, 988, 791, 466, 23,
707, 467, 33, 670, 921, 180, 991, 396, 160, 436, 717, 918, 8, 374,
101, 684, 727, 749};
std::cout << "\nExample 2:\n";
print_bins(limits2, bins(limits2, data2));
}
|
Can you help me rewrite this code in C++ instead of Python, keeping it the same logically? | def setup():
size(600, 600)
background(0)
stroke(255)
drawTree(300, 550, 9)
def drawTree(x, y, depth):
fork_ang = radians(20)
base_len = 10
if depth > 0:
pushMatrix()
translate(x, y - baseLen * depth)
line(0, baseLen * depth, 0, 0)
rotate(fork_ang)
drawTree(0, 0, depth - 1)
rotate(2 * -fork_ang)
drawTree(0, 0, depth - 1)
popMatrix()
| #include <windows.h>
#include <string>
#include <math.h>
using namespace std;
const float PI = 3.1415926536f;
class myBitmap
{
public:
myBitmap() : pen( NULL ) {}
~myBitmap()
{
DeleteObject( pen );
DeleteDC( hdc );
DeleteObject( bmp );
}
bool create( int w, int h )
{
BITMAPINFO bi;
void *pBits;
ZeroMemory( &bi, sizeof( bi ) );
bi.bmiHeader.biSize = sizeof( bi.bmiHeader );
bi.bmiHeader.biBitCount = sizeof( DWORD ) * 8;
bi.bmiHeader.biCompression = BI_RGB;
bi.bmiHeader.biPlanes = 1;
bi.bmiHeader.biWidth = w;
bi.bmiHeader.biHeight = -h;
HDC dc = GetDC( GetConsoleWindow() );
bmp = CreateDIBSection( dc, &bi, DIB_RGB_COLORS, &pBits, NULL, 0 );
if( !bmp ) return false;
hdc = CreateCompatibleDC( dc );
SelectObject( hdc, bmp );
ReleaseDC( GetConsoleWindow(), dc );
width = w; height = h;
return true;
}
void setPenColor( DWORD clr )
{
if( pen ) DeleteObject( pen );
pen = CreatePen( PS_SOLID, 1, clr );
SelectObject( hdc, pen );
}
void saveBitmap( string path )
{
BITMAPFILEHEADER fileheader;
BITMAPINFO infoheader;
BITMAP bitmap;
DWORD* dwpBits;
DWORD wb;
HANDLE file;
GetObject( bmp, sizeof( bitmap ), &bitmap );
dwpBits = new DWORD[bitmap.bmWidth * bitmap.bmHeight];
ZeroMemory( dwpBits, bitmap.bmWidth * bitmap.bmHeight * sizeof( DWORD ) );
ZeroMemory( &infoheader, sizeof( BITMAPINFO ) );
ZeroMemory( &fileheader, sizeof( BITMAPFILEHEADER ) );
infoheader.bmiHeader.biBitCount = sizeof( DWORD ) * 8;
infoheader.bmiHeader.biCompression = BI_RGB;
infoheader.bmiHeader.biPlanes = 1;
infoheader.bmiHeader.biSize = sizeof( infoheader.bmiHeader );
infoheader.bmiHeader.biHeight = bitmap.bmHeight;
infoheader.bmiHeader.biWidth = bitmap.bmWidth;
infoheader.bmiHeader.biSizeImage = bitmap.bmWidth * bitmap.bmHeight * sizeof( DWORD );
fileheader.bfType = 0x4D42;
fileheader.bfOffBits = sizeof( infoheader.bmiHeader ) + sizeof( BITMAPFILEHEADER );
fileheader.bfSize = fileheader.bfOffBits + infoheader.bmiHeader.biSizeImage;
GetDIBits( hdc, bmp, 0, height, ( LPVOID )dwpBits, &infoheader, DIB_RGB_COLORS );
file = CreateFile( path.c_str(), GENERIC_WRITE, 0, NULL, CREATE_ALWAYS, FILE_ATTRIBUTE_NORMAL, NULL );
WriteFile( file, &fileheader, sizeof( BITMAPFILEHEADER ), &wb, NULL );
WriteFile( file, &infoheader.bmiHeader, sizeof( infoheader.bmiHeader ), &wb, NULL );
WriteFile( file, dwpBits, bitmap.bmWidth * bitmap.bmHeight * 4, &wb, NULL );
CloseHandle( file );
delete [] dwpBits;
}
HDC getDC() { return hdc; }
int getWidth() { return width; }
int getHeight() { return height; }
private:
HBITMAP bmp;
HDC hdc;
HPEN pen;
int width, height;
};
class vector2
{
public:
vector2() { x = y = 0; }
vector2( int a, int b ) { x = a; y = b; }
void set( int a, int b ) { x = a; y = b; }
void rotate( float angle_r )
{
float _x = static_cast<float>( x ),
_y = static_cast<float>( y ),
s = sinf( angle_r ),
c = cosf( angle_r ),
a = _x * c - _y * s,
b = _x * s + _y * c;
x = static_cast<int>( a );
y = static_cast<int>( b );
}
int x, y;
};
class fractalTree
{
public:
fractalTree() { _ang = DegToRadian( 24.0f ); }
float DegToRadian( float degree ) { return degree * ( PI / 180.0f ); }
void create( myBitmap* bmp )
{
_bmp = bmp;
float line_len = 130.0f;
vector2 sp( _bmp->getWidth() / 2, _bmp->getHeight() - 1 );
MoveToEx( _bmp->getDC(), sp.x, sp.y, NULL );
sp.y -= static_cast<int>( line_len );
LineTo( _bmp->getDC(), sp.x, sp.y);
drawRL( &sp, line_len, 0, true );
drawRL( &sp, line_len, 0, false );
}
private:
void drawRL( vector2* sp, float line_len, float a, bool rg )
{
line_len *= .75f;
if( line_len < 2.0f ) return;
MoveToEx( _bmp->getDC(), sp->x, sp->y, NULL );
vector2 r( 0, static_cast<int>( line_len ) );
if( rg ) a -= _ang;
else a += _ang;
r.rotate( a );
r.x += sp->x; r.y = sp->y - r.y;
LineTo( _bmp->getDC(), r.x, r.y );
drawRL( &r, line_len, a, true );
drawRL( &r, line_len, a, false );
}
myBitmap* _bmp;
float _ang;
};
int main( int argc, char* argv[] )
{
ShowWindow( GetConsoleWindow(), SW_MAXIMIZE );
myBitmap bmp;
bmp.create( 640, 512 );
bmp.setPenColor( RGB( 255, 255, 0 ) );
fractalTree tree;
tree.create( &bmp );
BitBlt( GetDC( GetConsoleWindow() ), 0, 20, 648, 512, bmp.getDC(), 0, 0, SRCCOPY );
bmp.saveBitmap( "f:
system( "pause" );
return 0;
}
|
Keep all operations the same but rewrite the snippet in C++. | from turtle import *
colors = ["black", "red", "green", "blue", "magenta", "cyan", "yellow", "white"]
screen = getscreen()
left_edge = -screen.window_width()//2
right_edge = screen.window_width()//2
quarter_height = screen.window_height()//4
half_height = quarter_height * 2
speed("fastest")
for quarter in range(4):
pensize(quarter+1)
colornum = 0
min_y = half_height - ((quarter + 1) * quarter_height)
max_y = half_height - ((quarter) * quarter_height)
for x in range(left_edge,right_edge,quarter+1):
penup()
pencolor(colors[colornum])
colornum = (colornum + 1) % len(colors)
setposition(x,min_y)
pendown()
setposition(x,max_y)
notused = input("Hit enter to continue: ")
| #include <windows.h>
class pinstripe
{
public:
pinstripe() { createColors(); }
void setDimensions( int x, int y ) { _mw = x; _mh = y; }
void createColors()
{
colors[0] = 0; colors[1] = 255; colors[2] = RGB( 0, 255, 0 );
colors[3] = RGB( 0, 0, 255 ); colors[4] = RGB( 255, 0, 255 );
colors[5] = RGB( 0, 255, 255 ); colors[6] = RGB( 255, 255, 0 );
colors[7] = RGB( 255, 255, 255 );
}
void draw( HDC dc )
{
HPEN pen;
int lh = _mh / 4, row, cp;
for( int lw = 1; lw < 5; lw++ )
{
cp = 0;
row = ( lw - 1 ) * lh;
for( int x = 0 + lw > 1 ? lw > 3 ? 2 : 1 : 0; x < _mw; x += lw )
{
pen = CreatePen( PS_SOLID, lw, colors[cp] );
++cp %= 8;
SelectObject( dc, pen );
MoveToEx( dc, x, row, NULL );
LineTo( dc, x, row + lh );
DeleteObject( pen );
}
}
}
private:
int _mw, _mh;
DWORD colors[8];
};
pinstripe pin;
void PaintWnd( HWND hWnd )
{
PAINTSTRUCT ps;
HDC hdc = BeginPaint( hWnd, &ps );
pin.draw( hdc );
EndPaint( hWnd, &ps );
}
LRESULT CALLBACK WndProc( HWND hWnd, UINT msg, WPARAM wParam, LPARAM lParam )
{
switch( msg )
{
case WM_DESTROY: PostQuitMessage( 0 ); break;
case WM_PAINT: PaintWnd( hWnd ); break;
default:
return DefWindowProc( hWnd, msg, wParam, lParam );
}
return 0;
}
HWND InitAll( HINSTANCE hInstance )
{
WNDCLASSEX wcex;
ZeroMemory( &wcex, sizeof( wcex ) );
wcex.cbSize = sizeof( WNDCLASSEX );
wcex.style = CS_HREDRAW | CS_VREDRAW;
wcex.lpfnWndProc = WndProc;
wcex.hInstance = hInstance;
wcex.hCursor = LoadCursor( NULL, IDC_ARROW );
wcex.hbrBackground = ( HBRUSH )( COLOR_WINDOW + 1 );
wcex.lpszClassName = "_CLR_PS_";
RegisterClassEx( &wcex );
return CreateWindow( "_CLR_PS_", ".: Clr Pinstripe -- PJorente :.", WS_POPUP, CW_USEDEFAULT, 0, 200, 200, NULL, NULL, hInstance, NULL );
}
int APIENTRY _tWinMain( HINSTANCE hInstance, HINSTANCE hPrevInstance, LPTSTR lpCmdLine, int nCmdShow )
{
srand( GetTickCount() );
HWND hwnd = InitAll( hInstance );
if( !hwnd ) return -1;
int mw = GetSystemMetrics( SM_CXSCREEN ),
mh = GetSystemMetrics( SM_CYSCREEN );
pin.setDimensions( mw, mh );
RECT rc = { 0, 0, mw, mh };
AdjustWindowRectEx( &rc, WS_POPUP, FALSE, 0 );
int w = rc.right - rc.left,
h = rc.bottom - rc.top;
int posX = ( GetSystemMetrics( SM_CXSCREEN ) >> 1 ) - ( w >> 1 ),
posY = ( GetSystemMetrics( SM_CYSCREEN ) >> 1 ) - ( h >> 1 );
SetWindowPos( hwnd, HWND_TOP, posX, posY, w, h, SWP_NOZORDER );
ShowWindow( hwnd, nCmdShow );
UpdateWindow( hwnd );
MSG msg;
ZeroMemory( &msg, sizeof( msg ) );
while( msg.message != WM_QUIT )
{
if( PeekMessage( &msg, NULL, 0, 0, PM_REMOVE ) != 0 )
{
TranslateMessage( &msg );
DispatchMessage( &msg );
}
}
return UnregisterClass( "_CLR_PS_", hInstance );
}
|
Preserve the algorithm and functionality while converting the code from Python to C++. | from datetime import date
from calendar import isleap
def weekday(d):
days = ["Sunday", "Monday", "Tuesday", "Wednesday", "Thursday",
"Friday", "Saturday"]
dooms = [
[3, 7, 7, 4, 2, 6, 4, 1, 5, 3, 7, 5],
[4, 1, 7, 4, 2, 6, 4, 1, 5, 3, 7, 5]
]
c = d.year // 100
r = d.year % 100
s = r // 12
t = r % 12
c_anchor = (5 * (c % 4) + 2) % 7
doomsday = (s + t + (t // 4) + c_anchor) % 7
anchorday = dooms[isleap(d.year)][d.month - 1]
weekday = (doomsday + d.day - anchorday + 7) % 7
return days[weekday]
dates = [date(*x) for x in
[(1800, 1, 6), (1875, 3, 29), (1915, 12, 7), (1970, 12, 23),
(2043, 5, 14), (2077, 2, 12), (2101, 4, 2)]
]
for d in dates:
tense = "was" if d < date.today() else "is" if d == date.today() else "will be"
print("{} {} a {}".format(d.strftime("%B %d, %Y"), tense, weekday(d)))
| #include <iostream>
#include <cstdint>
struct Date {
std::uint16_t year;
std::uint8_t month;
std::uint8_t day;
};
constexpr bool leap(int year) {
return year%4==0 && (year%100!=0 || year%400==0);
}
const std::string& weekday(const Date& date) {
static const std::uint8_t leapdoom[] = {4,1,7,2,4,6,4,1,5,3,7,5};
static const std::uint8_t normdoom[] = {3,7,7,4,2,6,4,1,5,3,7,5};
static const std::string days[] = {
"Sunday", "Monday", "Tuesday", "Wednesday", "Thursday",
"Friday", "Saturday"
};
unsigned const c = date.year/100, r = date.year%100;
unsigned const s = r/12, t = r%12;
unsigned const c_anchor = (5 * (c%4) + 2) % 7;
unsigned const doom = (s + t + t/4 + c_anchor) % 7;
unsigned const anchor = (leap(date.year) ? leapdoom : normdoom)[date.month-1];
return days[(doom+date.day-anchor+7)%7];
}
int main(void) {
const std::string months[] = {"",
"January", "February", "March", "April", "May", "June",
"July", "August", "September", "October", "November", "December"
};
const Date dates[] = {
{1800,1,6}, {1875,3,29}, {1915,12,7}, {1970,12,23}, {2043,5,14},
{2077,2,12}, {2101,4,2}
};
for (const Date& d : dates) {
std::cout << months[d.month] << " " << (int)d.day << ", " << d.year;
std::cout << (d.year > 2021 ? " will be " : " was ");
std::cout << "on a " << weekday(d) << std::endl;
}
return 0;
}
|
Write a version of this Python function in C++ with identical behavior. | from datetime import date
from calendar import isleap
def weekday(d):
days = ["Sunday", "Monday", "Tuesday", "Wednesday", "Thursday",
"Friday", "Saturday"]
dooms = [
[3, 7, 7, 4, 2, 6, 4, 1, 5, 3, 7, 5],
[4, 1, 7, 4, 2, 6, 4, 1, 5, 3, 7, 5]
]
c = d.year // 100
r = d.year % 100
s = r // 12
t = r % 12
c_anchor = (5 * (c % 4) + 2) % 7
doomsday = (s + t + (t // 4) + c_anchor) % 7
anchorday = dooms[isleap(d.year)][d.month - 1]
weekday = (doomsday + d.day - anchorday + 7) % 7
return days[weekday]
dates = [date(*x) for x in
[(1800, 1, 6), (1875, 3, 29), (1915, 12, 7), (1970, 12, 23),
(2043, 5, 14), (2077, 2, 12), (2101, 4, 2)]
]
for d in dates:
tense = "was" if d < date.today() else "is" if d == date.today() else "will be"
print("{} {} a {}".format(d.strftime("%B %d, %Y"), tense, weekday(d)))
| #include <iostream>
#include <cstdint>
struct Date {
std::uint16_t year;
std::uint8_t month;
std::uint8_t day;
};
constexpr bool leap(int year) {
return year%4==0 && (year%100!=0 || year%400==0);
}
const std::string& weekday(const Date& date) {
static const std::uint8_t leapdoom[] = {4,1,7,2,4,6,4,1,5,3,7,5};
static const std::uint8_t normdoom[] = {3,7,7,4,2,6,4,1,5,3,7,5};
static const std::string days[] = {
"Sunday", "Monday", "Tuesday", "Wednesday", "Thursday",
"Friday", "Saturday"
};
unsigned const c = date.year/100, r = date.year%100;
unsigned const s = r/12, t = r%12;
unsigned const c_anchor = (5 * (c%4) + 2) % 7;
unsigned const doom = (s + t + t/4 + c_anchor) % 7;
unsigned const anchor = (leap(date.year) ? leapdoom : normdoom)[date.month-1];
return days[(doom+date.day-anchor+7)%7];
}
int main(void) {
const std::string months[] = {"",
"January", "February", "March", "April", "May", "June",
"July", "August", "September", "October", "November", "December"
};
const Date dates[] = {
{1800,1,6}, {1875,3,29}, {1915,12,7}, {1970,12,23}, {2043,5,14},
{2077,2,12}, {2101,4,2}
};
for (const Date& d : dates) {
std::cout << months[d.month] << " " << (int)d.day << ", " << d.year;
std::cout << (d.year > 2021 ? " will be " : " was ");
std::cout << "on a " << weekday(d) << std::endl;
}
return 0;
}
|
Generate an equivalent C++ version of this Python code. |
def cocktailshiftingbounds(A):
beginIdx = 0
endIdx = len(A) - 1
while beginIdx <= endIdx:
newBeginIdx = endIdx
newEndIdx = beginIdx
for ii in range(beginIdx,endIdx):
if A[ii] > A[ii + 1]:
A[ii+1], A[ii] = A[ii], A[ii+1]
newEndIdx = ii
endIdx = newEndIdx
for ii in range(endIdx,beginIdx-1,-1):
if A[ii] > A[ii + 1]:
A[ii+1], A[ii] = A[ii], A[ii+1]
newBeginIdx = ii
beginIdx = newBeginIdx + 1
test1 = [7, 6, 5, 9, 8, 4, 3, 1, 2, 0]
cocktailshiftingbounds(test1)
print(test1)
test2=list('big fjords vex quick waltz nymph')
cocktailshiftingbounds(test2)
print(''.join(test2))
| #include <algorithm>
#include <cassert>
#include <iostream>
#include <iterator>
#include <vector>
template <typename iterator>
void cocktail_shaker_sort(iterator begin, iterator end) {
if (begin == end)
return;
for (--end; begin < end; ) {
iterator new_begin = end;
iterator new_end = begin;
for (iterator i = begin; i < end; ++i) {
iterator j = i + 1;
if (*j < *i) {
std::iter_swap(i, j);
new_end = i;
}
}
end = new_end;
for (iterator i = end; i > begin; --i) {
iterator j = i - 1;
if (*i < *j) {
std::iter_swap(i, j);
new_begin = i;
}
}
begin = new_begin;
}
}
template <typename iterator>
void print(iterator begin, iterator end) {
if (begin == end)
return;
std::cout << *begin++;
while (begin != end)
std::cout << ' ' << *begin++;
std::cout << '\n';
}
int main() {
std::vector<int> v{5, 1, -6, 12, 3, 13, 2, 4, 0, 15};
std::cout << "before: ";
print(v.begin(), v.end());
cocktail_shaker_sort(v.begin(), v.end());
assert(std::is_sorted(v.begin(), v.end()));
std::cout << "after: ";
print(v.begin(), v.end());
return 0;
}
|
Write the same algorithm in C++ as shown in this Python implementation. | import pygame, sys
from pygame.locals import *
from math import sin, cos, radians
pygame.init()
WINDOWSIZE = 250
TIMETICK = 100
BOBSIZE = 15
window = pygame.display.set_mode((WINDOWSIZE, WINDOWSIZE))
pygame.display.set_caption("Pendulum")
screen = pygame.display.get_surface()
screen.fill((255,255,255))
PIVOT = (WINDOWSIZE/2, WINDOWSIZE/10)
SWINGLENGTH = PIVOT[1]*4
class BobMass(pygame.sprite.Sprite):
def __init__(self):
pygame.sprite.Sprite.__init__(self)
self.theta = 45
self.dtheta = 0
self.rect = pygame.Rect(PIVOT[0]-SWINGLENGTH*cos(radians(self.theta)),
PIVOT[1]+SWINGLENGTH*sin(radians(self.theta)),
1,1)
self.draw()
def recomputeAngle(self):
scaling = 3000.0/(SWINGLENGTH**2)
firstDDtheta = -sin(radians(self.theta))*scaling
midDtheta = self.dtheta + firstDDtheta
midtheta = self.theta + (self.dtheta + midDtheta)/2.0
midDDtheta = -sin(radians(midtheta))*scaling
midDtheta = self.dtheta + (firstDDtheta + midDDtheta)/2
midtheta = self.theta + (self.dtheta + midDtheta)/2
midDDtheta = -sin(radians(midtheta)) * scaling
lastDtheta = midDtheta + midDDtheta
lasttheta = midtheta + (midDtheta + lastDtheta)/2.0
lastDDtheta = -sin(radians(lasttheta)) * scaling
lastDtheta = midDtheta + (midDDtheta + lastDDtheta)/2.0
lasttheta = midtheta + (midDtheta + lastDtheta)/2.0
self.dtheta = lastDtheta
self.theta = lasttheta
self.rect = pygame.Rect(PIVOT[0]-
SWINGLENGTH*sin(radians(self.theta)),
PIVOT[1]+
SWINGLENGTH*cos(radians(self.theta)),1,1)
def draw(self):
pygame.draw.circle(screen, (0,0,0), PIVOT, 5, 0)
pygame.draw.circle(screen, (0,0,0), self.rect.center, BOBSIZE, 0)
pygame.draw.aaline(screen, (0,0,0), PIVOT, self.rect.center)
pygame.draw.line(screen, (0,0,0), (0, PIVOT[1]), (WINDOWSIZE, PIVOT[1]))
def update(self):
self.recomputeAngle()
screen.fill((255,255,255))
self.draw()
bob = BobMass()
TICK = USEREVENT + 2
pygame.time.set_timer(TICK, TIMETICK)
def input(events):
for event in events:
if event.type == QUIT:
sys.exit(0)
elif event.type == TICK:
bob.update()
while True:
input(pygame.event.get())
pygame.display.flip()
| #ifndef __wxPendulumDlg_h__
#define __wxPendulumDlg_h__
#ifdef __BORLANDC__
#pragma hdrstop
#endif
#ifndef WX_PRECOMP
#include <wx/wx.h>
#include <wx/dialog.h>
#else
#include <wx/wxprec.h>
#endif
#include <wx/timer.h>
#include <wx/dcbuffer.h>
#include <cmath>
class wxPendulumDlgApp : public wxApp
{
public:
bool OnInit();
int OnExit();
};
class wxPendulumDlg : public wxDialog
{
public:
wxPendulumDlg(wxWindow *parent, wxWindowID id = 1, const wxString &title = wxT("wxPendulum"),
const wxPoint& pos = wxDefaultPosition, const wxSize& size = wxDefaultSize,
long style = wxSUNKEN_BORDER | wxCAPTION | wxRESIZE_BORDER | wxSYSTEM_MENU | wxDIALOG_NO_PARENT | wxMINIMIZE_BOX | wxMAXIMIZE_BOX | wxCLOSE_BOX);
virtual ~wxPendulumDlg();
void wxPendulumDlgPaint(wxPaintEvent& event);
void wxPendulumDlgSize(wxSizeEvent& event);
void OnTimer(wxTimerEvent& event);
private:
wxTimer *m_timer;
unsigned int m_uiLength;
double m_Angle;
double m_AngleVelocity;
enum wxIDs
{
ID_WXTIMER1 = 1001,
ID_DUMMY_VALUE_
};
void OnClose(wxCloseEvent& event);
void CreateGUIControls();
DECLARE_EVENT_TABLE()
};
#endif
|
Rewrite the snippet below in C++ so it works the same as the original Python code. | >>> def int2bin(n):
'From positive integer to list of binary bits, msb at index 0'
if n:
bits = []
while n:
n,remainder = divmod(n, 2)
bits.insert(0, remainder)
return bits
else: return [0]
>>> def bin2int(bits):
'From binary bits, msb at index 0 to integer'
i = 0
for bit in bits:
i = i * 2 + bit
return i
| #include <bitset>
#include <iostream>
#include <string>
#include <assert.h>
uint32_t gray_encode(uint32_t b)
{
return b ^ (b >> 1);
}
uint32_t gray_decode(uint32_t g)
{
for (uint32_t bit = 1U << 31; bit > 1; bit >>= 1)
{
if (g & bit) g ^= bit >> 1;
}
return g;
}
std::string to_binary(int value)
{
const std::bitset<32> bs(value);
const std::string str(bs.to_string());
const size_t pos(str.find('1'));
return pos == std::string::npos ? "0" : str.substr(pos);
}
int main()
{
std::cout << "Number\tBinary\tGray\tDecoded\n";
for (uint32_t n = 0; n < 32; ++n)
{
uint32_t g = gray_encode(n);
assert(gray_decode(g) == n);
std::cout << n << "\t" << to_binary(n) << "\t" << to_binary(g) << "\t" << g << "\n";
}
}
|
Translate this program into C++ but keep the logic exactly as in Python. | >>> def int2bin(n):
'From positive integer to list of binary bits, msb at index 0'
if n:
bits = []
while n:
n,remainder = divmod(n, 2)
bits.insert(0, remainder)
return bits
else: return [0]
>>> def bin2int(bits):
'From binary bits, msb at index 0 to integer'
i = 0
for bit in bits:
i = i * 2 + bit
return i
| #include <bitset>
#include <iostream>
#include <string>
#include <assert.h>
uint32_t gray_encode(uint32_t b)
{
return b ^ (b >> 1);
}
uint32_t gray_decode(uint32_t g)
{
for (uint32_t bit = 1U << 31; bit > 1; bit >>= 1)
{
if (g & bit) g ^= bit >> 1;
}
return g;
}
std::string to_binary(int value)
{
const std::bitset<32> bs(value);
const std::string str(bs.to_string());
const size_t pos(str.find('1'));
return pos == std::string::npos ? "0" : str.substr(pos);
}
int main()
{
std::cout << "Number\tBinary\tGray\tDecoded\n";
for (uint32_t n = 0; n < 32; ++n)
{
uint32_t g = gray_encode(n);
assert(gray_decode(g) == n);
std::cout << n << "\t" << to_binary(n) << "\t" << to_binary(g) << "\t" << g << "\n";
}
}
|
Rewrite this program in C++ while keeping its functionality equivalent to the Python version. | >>> def int2bin(n):
'From positive integer to list of binary bits, msb at index 0'
if n:
bits = []
while n:
n,remainder = divmod(n, 2)
bits.insert(0, remainder)
return bits
else: return [0]
>>> def bin2int(bits):
'From binary bits, msb at index 0 to integer'
i = 0
for bit in bits:
i = i * 2 + bit
return i
| #include <bitset>
#include <iostream>
#include <string>
#include <assert.h>
uint32_t gray_encode(uint32_t b)
{
return b ^ (b >> 1);
}
uint32_t gray_decode(uint32_t g)
{
for (uint32_t bit = 1U << 31; bit > 1; bit >>= 1)
{
if (g & bit) g ^= bit >> 1;
}
return g;
}
std::string to_binary(int value)
{
const std::bitset<32> bs(value);
const std::string str(bs.to_string());
const size_t pos(str.find('1'));
return pos == std::string::npos ? "0" : str.substr(pos);
}
int main()
{
std::cout << "Number\tBinary\tGray\tDecoded\n";
for (uint32_t n = 0; n < 32; ++n)
{
uint32_t g = gray_encode(n);
assert(gray_decode(g) == n);
std::cout << n << "\t" << to_binary(n) << "\t" << to_binary(g) << "\t" << g << "\n";
}
}
|
Rewrite the snippet below in C++ so it works the same as the original Python code. | >>> with open('/dev/tape', 'w') as t: t.write('Hi Tape!\n')
...
>>>
| #include <iostream>
#include <fstream>
#if defined(_WIN32) || defined(WIN32)
constexpr auto FILENAME = "tape.file";
#else
constexpr auto FILENAME = "/dev/tape";
#endif
int main() {
std::filebuf fb;
fb.open(FILENAME,std::ios::out);
std::ostream os(&fb);
os << "Hello World\n";
fb.close();
return 0;
}
|
Write a version of this Python function in C++ with identical behavior. | def heapsort(lst):
for start in range((len(lst)-2)/2, -1, -1):
siftdown(lst, start, len(lst)-1)
for end in range(len(lst)-1, 0, -1):
lst[end], lst[0] = lst[0], lst[end]
siftdown(lst, 0, end - 1)
return lst
def siftdown(lst, start, end):
root = start
while True:
child = root * 2 + 1
if child > end: break
if child + 1 <= end and lst[child] < lst[child + 1]:
child += 1
if lst[root] < lst[child]:
lst[root], lst[child] = lst[child], lst[root]
root = child
else:
break
| #include <algorithm>
#include <iterator>
#include <iostream>
template<typename RandomAccessIterator>
void heap_sort(RandomAccessIterator begin, RandomAccessIterator end) {
std::make_heap(begin, end);
std::sort_heap(begin, end);
}
int main() {
int a[] = {100, 2, 56, 200, -52, 3, 99, 33, 177, -199};
heap_sort(std::begin(a), std::end(a));
copy(std::begin(a), std::end(a), std::ostream_iterator<int>(std::cout, " "));
std::cout << "\n";
}
|
Convert this Python block to C++, preserving its control flow and logic. | import random
class Card(object):
suits = ("Clubs","Hearts","Spades","Diamonds")
pips = ("2","3","4","5","6","7","8","9","10","Jack","Queen","King","Ace")
def __init__(self, pip,suit):
self.pip=pip
self.suit=suit
def __str__(self):
return "%s %s"%(self.pip,self.suit)
class Deck(object):
def __init__(self):
self.deck = [Card(pip,suit) for suit in Card.suits for pip in Card.pips]
def __str__(self):
return "[%s]"%", ".join( (str(card) for card in self.deck))
def shuffle(self):
random.shuffle(self.deck)
def deal(self):
self.shuffle()
return self.deck.pop(0)
| #include <deque>
#include <algorithm>
#include <ostream>
#include <iterator>
namespace cards
{
class card
{
public:
enum pip_type { two, three, four, five, six, seven, eight, nine, ten,
jack, queen, king, ace, pip_count };
enum suite_type { hearts, spades, diamonds, clubs, suite_count };
enum { unique_count = pip_count * suite_count };
card(suite_type s, pip_type p): value(s + suite_count * p) {}
explicit card(unsigned char v = 0): value(v) {}
pip_type pip() { return pip_type(value / suite_count); }
suite_type suite() { return suite_type(value % suite_count); }
private:
unsigned char value;
};
const char* const pip_names[] =
{ "two", "three", "four", "five", "six", "seven", "eight", "nine", "ten",
"jack", "queen", "king", "ace" };
std::ostream& operator<<(std::ostream& os, card::pip_type pip)
{
return os << pip_names[pip];
}
const char* const suite_names[] =
{ "hearts", "spades", "diamonds", "clubs" };
std::ostream& operator<<(std::ostream& os, card::suite_type suite)
{
return os << suite_names[suite];
}
std::ostream& operator<<(std::ostream& os, card c)
{
return os << c.pip() << " of " << c.suite();
}
class deck
{
public:
deck()
{
for (int i = 0; i < card::unique_count; ++i) {
cards.push_back(card(i));
}
}
void shuffle() { std::random_shuffle(cards.begin(), cards.end()); }
card deal() { card c = cards.front(); cards.pop_front(); return c; }
typedef std::deque<card>::const_iterator const_iterator;
const_iterator begin() const { return cards.cbegin(); }
const_iterator end() const { return cards.cend(); }
private:
std::deque<card> cards;
};
inline std::ostream& operator<<(std::ostream& os, const deck& d)
{
std::copy(d.begin(), d.end(), std::ostream_iterator<card>(os, "\n"));
return os;
}
}
|
Produce a language-to-language conversion: from Python to C++, same semantics. | import random
class Card(object):
suits = ("Clubs","Hearts","Spades","Diamonds")
pips = ("2","3","4","5","6","7","8","9","10","Jack","Queen","King","Ace")
def __init__(self, pip,suit):
self.pip=pip
self.suit=suit
def __str__(self):
return "%s %s"%(self.pip,self.suit)
class Deck(object):
def __init__(self):
self.deck = [Card(pip,suit) for suit in Card.suits for pip in Card.pips]
def __str__(self):
return "[%s]"%", ".join( (str(card) for card in self.deck))
def shuffle(self):
random.shuffle(self.deck)
def deal(self):
self.shuffle()
return self.deck.pop(0)
| #include <deque>
#include <algorithm>
#include <ostream>
#include <iterator>
namespace cards
{
class card
{
public:
enum pip_type { two, three, four, five, six, seven, eight, nine, ten,
jack, queen, king, ace, pip_count };
enum suite_type { hearts, spades, diamonds, clubs, suite_count };
enum { unique_count = pip_count * suite_count };
card(suite_type s, pip_type p): value(s + suite_count * p) {}
explicit card(unsigned char v = 0): value(v) {}
pip_type pip() { return pip_type(value / suite_count); }
suite_type suite() { return suite_type(value % suite_count); }
private:
unsigned char value;
};
const char* const pip_names[] =
{ "two", "three", "four", "five", "six", "seven", "eight", "nine", "ten",
"jack", "queen", "king", "ace" };
std::ostream& operator<<(std::ostream& os, card::pip_type pip)
{
return os << pip_names[pip];
}
const char* const suite_names[] =
{ "hearts", "spades", "diamonds", "clubs" };
std::ostream& operator<<(std::ostream& os, card::suite_type suite)
{
return os << suite_names[suite];
}
std::ostream& operator<<(std::ostream& os, card c)
{
return os << c.pip() << " of " << c.suite();
}
class deck
{
public:
deck()
{
for (int i = 0; i < card::unique_count; ++i) {
cards.push_back(card(i));
}
}
void shuffle() { std::random_shuffle(cards.begin(), cards.end()); }
card deal() { card c = cards.front(); cards.pop_front(); return c; }
typedef std::deque<card>::const_iterator const_iterator;
const_iterator begin() const { return cards.cbegin(); }
const_iterator end() const { return cards.cend(); }
private:
std::deque<card> cards;
};
inline std::ostream& operator<<(std::ostream& os, const deck& d)
{
std::copy(d.begin(), d.end(), std::ostream_iterator<card>(os, "\n"));
return os;
}
}
|
Can you help me rewrite this code in C++ instead of Python, keeping it the same logically? | array = []
array.append(1)
array.append(3)
array[0] = 2
print array[0]
| #include <array>
#include <vector>
#include <algorithm>
#include <iostream>
#include <iterator>
#include <string>
template <typename Array>
void demonstrate(Array& array)
{
array[2] = "Three";
array.at(1) = "Two";
std::reverse(begin(array), end(array));
std::for_each(begin(array), end(array),
[](typename Array::value_type const& element)
{
std::cout << element << ' ';
});
std::cout << '\n';
}
int main()
{
auto fixed_size_array = std::array<std::string, 3>{ "One", "Four", "Eight" };
auto dynamic_array = std::vector<std::string>{ "One", "Four" };
dynamic_array.push_back("Eight");
demonstrate(fixed_size_array);
demonstrate(dynamic_array);
}
|
Produce a language-to-language conversion: from Python to C++, same semantics. | def setup():
size(729, 729)
fill(0)
background(255)
noStroke()
rect(width / 3, height / 3, width / 3, width / 3)
rectangles(width / 3, height / 3, width / 3)
def rectangles(x, y, s):
if s < 1: return
xc, yc = x - s, y - s
for row in range(3):
for col in range(3):
if not (row == 1 and col == 1):
xx, yy = xc + row * s, yc + col * s
delta = s / 3
rect(xx + delta, yy + delta, delta, delta)
rectangles(xx + s / 3, yy + s / 3, s / 3)
|
#include <cstdint>
#include <cstdlib>
#include <cstdio>
static constexpr int32_t bct_low_bits = 0x55555555;
static int32_t bct_decrement(int32_t v) {
--v;
return v ^ (v & (v>>1) & bct_low_bits);
}
int main (int argc, char *argv[])
{
const int32_t n = (1 < argc) ? std::atoi(argv[1]) : 3;
if (n < 0 || 9 < n) {
std::printf("N out of range (use 0..9): %ld\n", long(n));
return 1;
}
const int32_t size_bct = 1<<(n*2);
int32_t y = size_bct;
do {
y = bct_decrement(y);
int32_t x = size_bct;
do {
x = bct_decrement(x);
std::putchar((x & y & bct_low_bits) ? ' ' : '#');
} while (0 < x);
std::putchar('\n');
} while (0 < y);
return 0;
}
|
Change the programming language of this snippet from Python to C++ without modifying what it does. | import random
def bogosort(l):
while not in_order(l):
random.shuffle(l)
return l
def in_order(l):
if not l:
return True
last = l[0]
for x in l[1:]:
if x < last:
return False
last = x
return True
| #include <algorithm>
#include <iostream>
#include <iterator>
#include <random>
template <typename RandomAccessIterator, typename Predicate>
void bogo_sort(RandomAccessIterator begin, RandomAccessIterator end,
Predicate p) {
std::random_device rd;
std::mt19937 generator(rd());
while (!std::is_sorted(begin, end, p)) {
std::shuffle(begin, end, generator);
}
}
template <typename RandomAccessIterator>
void bogo_sort(RandomAccessIterator begin, RandomAccessIterator end) {
bogo_sort(
begin, end,
std::less<
typename std::iterator_traits<RandomAccessIterator>::value_type>());
}
int main() {
int a[] = {100, 2, 56, 200, -52, 3, 99, 33, 177, -199};
bogo_sort(std::begin(a), std::end(a));
copy(std::begin(a), std::end(a), std::ostream_iterator<int>(std::cout, " "));
std::cout << "\n";
}
|
Generate an equivalent C++ version of this Python code. |
import pandas as pd
df_patients = pd.read_csv (r'patients.csv', sep = ",", decimal=".")
df_visits = pd.read_csv (r'visits.csv', sep = ",", decimal=".")
df_visits['VISIT_DATE'] = pd.to_datetime(df_visits['VISIT_DATE'])
df_merge = df_patients.merge(df_visits, on='PATIENT_ID', how='left')
df_group = df_merge.groupby(['PATIENT_ID','LASTNAME'], as_index=False)
df_result = df_group.agg({'VISIT_DATE': 'max', 'SCORE': [lambda x: x.sum(min_count=1),'mean']})
print(df_result)
| #include <iostream>
#include <optional>
#include <ranges>
#include <string>
#include <vector>
using namespace std;
struct Patient
{
string ID;
string LastName;
};
struct Visit
{
string PatientID;
string Date;
optional<float> Score;
};
int main(void)
{
auto patients = vector<Patient> {
{"1001", "Hopper"},
{"4004", "Wirth"},
{"3003", "Kemeny"},
{"2002", "Gosling"},
{"5005", "Kurtz"}};
auto visits = vector<Visit> {
{"2002", "2020-09-10", 6.8},
{"1001", "2020-09-17", 5.5},
{"4004", "2020-09-24", 8.4},
{"2002", "2020-10-08", },
{"1001", "" , 6.6},
{"3003", "2020-11-12", },
{"4004", "2020-11-05", 7.0},
{"1001", "2020-11-19", 5.3}};
sort(patients.begin(), patients.end(),
[](const auto& a, const auto&b){ return a.ID < b.ID;});
cout << "| PATIENT_ID | LASTNAME | LAST_VISIT | SCORE_SUM | SCORE_AVG |\n";
for(const auto& patient : patients)
{
string lastVisit;
float sum = 0;
int numScores = 0;
auto patientFilter = [&patient](const Visit &v){return v.PatientID == patient.ID;};
for(const auto& visit : visits | views::filter( patientFilter ))
{
if(visit.Score)
{
sum += *visit.Score;
numScores++;
}
lastVisit = max(lastVisit, visit.Date);
}
cout << "| " << patient.ID << " | ";
cout.width(8); cout << patient.LastName << " | ";
cout.width(10); cout << lastVisit << " | ";
if(numScores > 0)
{
cout.width(9); cout << sum << " | ";
cout.width(9); cout << (sum / float(numScores));
}
else cout << " | ";
cout << " |\n";
}
}
|
Convert this Python block to C++, preserving its control flow and logic. | def euler(f,y0,a,b,h):
t,y = a,y0
while t <= b:
print "%6.3f %6.3f" % (t,y)
t += h
y += h * f(t,y)
def newtoncooling(time, temp):
return -0.07 * (temp - 20)
euler(newtoncooling,100,0,100,10)
| #include <iomanip>
#include <iostream>
typedef double F(double,double);
void euler(F f, double y0, double a, double b, double h)
{
double y = y0;
for (double t = a; t < b; t += h)
{
std::cout << std::fixed << std::setprecision(3) << t << " " << y << "\n";
y += h * f(t, y);
}
std::cout << "done\n";
}
double newtonCoolingLaw(double, double t)
{
return -0.07 * (t - 20);
}
int main()
{
euler(newtonCoolingLaw, 100, 0, 100, 2);
euler(newtonCoolingLaw, 100, 0, 100, 5);
euler(newtonCoolingLaw, 100, 0, 100, 10);
}
|
Rewrite this program in C++ while keeping its functionality equivalent to the Python version. | >>> from math import floor, sqrt
>>> def non_square(n):
return n + floor(1/2 + sqrt(n))
>>>
>>> print(*map(non_square, range(1, 23)))
2 3 5 6 7 8 10 11 12 13 14 15 17 18 19 20 21 22 23 24 26 27
>>>
>>> def is_square(n):
return sqrt(n).is_integer()
>>> non_squares = map(non_square, range(1, 10 ** 6))
>>> next(filter(is_square, non_squares))
StopIteration Traceback (most recent call last)
<ipython-input-45-f32645fc1c0a> in <module>()
1 non_squares = map(non_square, range(1, 10 ** 6))
----> 2 next(filter(is_square, non_squares))
StopIteration:
| #include <iostream>
#include <algorithm>
#include <vector>
#include <cmath>
#include <boost/bind.hpp>
#include <iterator>
double nextNumber( double number ) {
return number + floor( 0.5 + sqrt( number ) ) ;
}
int main( ) {
std::vector<double> non_squares ;
typedef std::vector<double>::iterator SVI ;
non_squares.reserve( 1000000 ) ;
for ( double i = 1.0 ; i < 100001.0 ; i += 1 )
non_squares.push_back( nextNumber( i ) ) ;
std::copy( non_squares.begin( ) , non_squares.begin( ) + 22 ,
std::ostream_iterator<double>(std::cout, " " ) ) ;
std::cout << '\n' ;
SVI found = std::find_if ( non_squares.begin( ) , non_squares.end( ) ,
boost::bind( &floor, boost::bind( &sqrt, _1 ) ) == boost::bind( &sqrt, _1 ) ) ;
if ( found != non_squares.end( ) ) {
std::cout << "Found a square number in the sequence!\n" ;
std::cout << "It is " << *found << " !\n" ;
}
else {
std::cout << "Up to 1000000, found no square number in the sequence!\n" ;
}
return 0 ;
}
|
Produce a language-to-language conversion: from Python to C++, same semantics. | >>> s = 'abcdefgh'
>>> n, m, char, chars = 2, 3, 'd', 'cd'
>>>
>>> s[n-1:n+m-1]
'bcd'
>>>
>>> s[n-1:]
'bcdefgh'
>>>
>>> s[:-1]
'abcdefg'
>>>
>>> indx = s.index(char)
>>> s[indx:indx+m]
'def'
>>>
>>> indx = s.index(chars)
>>> s[indx:indx+m]
'cde'
>>>
| #include <iostream>
#include <string>
int main()
{
std::string s = "0123456789";
int const n = 3;
int const m = 4;
char const c = '2';
std::string const sub = "456";
std::cout << s.substr(n, m)<< "\n";
std::cout << s.substr(n) << "\n";
std::cout << s.substr(0, s.size()-1) << "\n";
std::cout << s.substr(s.find(c), m) << "\n";
std::cout << s.substr(s.find(sub), m) << "\n";
}
|
Port the provided Python code into C++ while preserving the original functionality. | >>> def jortsort(sequence):
return list(sequence) == sorted(sequence)
>>> for data in [(1,2,4,3), (14,6,8), ['a', 'c'], ['s', 'u', 'x'], 'CVGH', 'PQRST']:
print(f'jortsort({repr(data)}) is {jortsort(data)}')
jortsort((1, 2, 4, 3)) is False
jortsort((14, 6, 8)) is False
jortsort(['a', 'c']) is True
jortsort(['s', 'u', 'x']) is True
jortsort('CVGH') is False
jortsort('PQRST') is True
>>>
| #include <algorithm>
#include <string>
#include <iostream>
#include <iterator>
class jortSort {
public:
template<class T>
bool jort_sort( T* o, size_t s ) {
T* n = copy_array( o, s );
sort_array( n, s );
bool r = false;
if( n ) {
r = check( o, n, s );
delete [] n;
}
return r;
}
private:
template<class T>
T* copy_array( T* o, size_t s ) {
T* z = new T[s];
memcpy( z, o, s * sizeof( T ) );
return z;
}
template<class T>
void sort_array( T* n, size_t s ) {
std::sort( n, n + s );
}
template<class T>
bool check( T* n, T* o, size_t s ) {
for( size_t x = 0; x < s; x++ )
if( n[x] != o[x] ) return false;
return true;
}
};
jortSort js;
template<class T>
void displayTest( T* o, size_t s ) {
std::copy( o, o + s, std::ostream_iterator<T>( std::cout, " " ) );
std::cout << ": -> The array is " << ( js.jort_sort( o, s ) ? "sorted!" : "not sorted!" ) << "\n\n";
}
int main( int argc, char* argv[] ) {
const size_t s = 5;
std::string oStr[] = { "5", "A", "D", "R", "S" };
displayTest( oStr, s );
std::swap( oStr[0], oStr[1] );
displayTest( oStr, s );
int oInt[] = { 1, 2, 3, 4, 5 };
displayTest( oInt, s );
std::swap( oInt[0], oInt[1] );
displayTest( oInt, s );
return 0;
}
|
Convert this Python snippet to C++ and keep its semantics consistent. | import calendar
calendar.isleap(year)
| #include <iostream>
bool is_leap_year(int year) {
return year % 4 == 0 && (year % 100 != 0 || year % 400 == 0);
}
int main() {
for (auto year : {1900, 1994, 1996, 1997, 2000}) {
std::cout << year << (is_leap_year(year) ? " is" : " is not") << " a leap year.\n";
}
}
|
Keep all operations the same but rewrite the snippet in C++. | from __future__ import print_function
from scipy.misc import factorial as fact
from scipy.misc import comb
def perm(N, k, exact=0):
return comb(N, k, exact) * fact(k, exact)
exact=True
print('Sample Perms 1..12')
for N in range(1, 13):
k = max(N-2, 1)
print('%iP%i =' % (N, k), perm(N, k, exact), end=', ' if N % 5 else '\n')
print('\n\nSample Combs 10..60')
for N in range(10, 61, 10):
k = N-2
print('%iC%i =' % (N, k), comb(N, k, exact), end=', ' if N % 50 else '\n')
exact=False
print('\n\nSample Perms 5..1500 Using FP approximations')
for N in [5, 15, 150, 1500, 15000]:
k = N-2
print('%iP%i =' % (N, k), perm(N, k, exact))
print('\nSample Combs 100..1000 Using FP approximations')
for N in range(100, 1001, 100):
k = N-2
print('%iC%i =' % (N, k), comb(N, k, exact))
| #include <boost/multiprecision/gmp.hpp>
#include <iostream>
using namespace boost::multiprecision;
mpz_int p(uint n, uint p) {
mpz_int r = 1;
mpz_int k = n - p;
while (n > k)
r *= n--;
return r;
}
mpz_int c(uint n, uint k) {
mpz_int r = p(n, k);
while (k)
r /= k--;
return r;
}
int main() {
for (uint i = 1u; i < 12u; i++)
std::cout << "P(12," << i << ") = " << p(12u, i) << std::endl;
for (uint i = 10u; i < 60u; i += 10u)
std::cout << "C(60," << i << ") = " << c(60u, i) << std::endl;
return 0;
}
|
Port the provided Python code into C++ while preserving the original functionality. | n=13
print(sorted(range(1,n+1), key=str))
| #include <algorithm>
#include <iostream>
#include <numeric>
#include <string>
#include <vector>
void lexicographical_sort(std::vector<int>& numbers) {
std::vector<std::string> strings(numbers.size());
std::transform(numbers.begin(), numbers.end(), strings.begin(),
[](int i) { return std::to_string(i); });
std::sort(strings.begin(), strings.end());
std::transform(strings.begin(), strings.end(), numbers.begin(),
[](const std::string& s) { return std::stoi(s); });
}
std::vector<int> lexicographically_sorted_vector(int n) {
std::vector<int> numbers(n >= 1 ? n : 2 - n);
std::iota(numbers.begin(), numbers.end(), std::min(1, n));
lexicographical_sort(numbers);
return numbers;
}
template <typename T>
void print_vector(std::ostream& out, const std::vector<T>& v) {
out << '[';
if (!v.empty()) {
auto i = v.begin();
out << *i++;
for (; i != v.end(); ++i)
out << ',' << *i;
}
out << "]\n";
}
int main(int argc, char** argv) {
for (int i : { 0, 5, 13, 21, -22 }) {
std::cout << i << ": ";
print_vector(std::cout, lexicographically_sorted_vector(i));
}
return 0;
}
|
Please provide an equivalent version of this Python code in C++. | TENS = [None, None, "twenty", "thirty", "forty",
"fifty", "sixty", "seventy", "eighty", "ninety"]
SMALL = ["zero", "one", "two", "three", "four", "five",
"six", "seven", "eight", "nine", "ten", "eleven",
"twelve", "thirteen", "fourteen", "fifteen",
"sixteen", "seventeen", "eighteen", "nineteen"]
HUGE = [None, None] + [h + "illion"
for h in ("m", "b", "tr", "quadr", "quint", "sext",
"sept", "oct", "non", "dec")]
def nonzero(c, n, connect=''):
return "" if n == 0 else connect + c + spell_integer(n)
def last_and(num):
if ',' in num:
pre, last = num.rsplit(',', 1)
if ' and ' not in last:
last = ' and' + last
num = ''.join([pre, ',', last])
return num
def big(e, n):
if e == 0:
return spell_integer(n)
elif e == 1:
return spell_integer(n) + " thousand"
else:
return spell_integer(n) + " " + HUGE[e]
def base1000_rev(n):
while n != 0:
n, r = divmod(n, 1000)
yield r
def spell_integer(n):
if n < 0:
return "minus " + spell_integer(-n)
elif n < 20:
return SMALL[n]
elif n < 100:
a, b = divmod(n, 10)
return TENS[a] + nonzero("-", b)
elif n < 1000:
a, b = divmod(n, 100)
return SMALL[a] + " hundred" + nonzero(" ", b, ' and')
else:
num = ", ".join([big(e, x) for e, x in
enumerate(base1000_rev(n)) if x][::-1])
return last_and(num)
if __name__ == '__main__':
for n in (0, -3, 5, -7, 11, -13, 17, -19, 23, -29):
print('%+4i -> %s' % (n, spell_integer(n)))
print('')
n = 201021002001
while n:
print('%-12i -> %s' % (n, spell_integer(n)))
n //= -10
print('%-12i -> %s' % (n, spell_integer(n)))
print('')
| #include <string>
#include <iostream>
using std::string;
const char* smallNumbers[] = {
"zero", "one", "two", "three", "four", "five",
"six", "seven", "eight", "nine", "ten",
"eleven", "twelve", "thirteen", "fourteen", "fifteen",
"sixteen", "seventeen", "eighteen", "nineteen"
};
string spellHundreds(unsigned n) {
string res;
if (n > 99) {
res = smallNumbers[n/100];
res += " hundred";
n %= 100;
if (n) res += " and ";
}
if (n >= 20) {
static const char* Decades[] = {
"", "", "twenty", "thirty", "forty",
"fifty", "sixty", "seventy", "eighty", "ninety"
};
res += Decades[n/10];
n %= 10;
if (n) res += "-";
}
if (n < 20 && n > 0)
res += smallNumbers[n];
return res;
}
const char* thousandPowers[] = {
" billion", " million", " thousand", "" };
typedef unsigned long Spellable;
string spell(Spellable n) {
if (n < 20) return smallNumbers[n];
string res;
const char** pScaleName = thousandPowers;
Spellable scaleFactor = 1000000000;
while (scaleFactor > 0) {
if (n >= scaleFactor) {
Spellable h = n / scaleFactor;
res += spellHundreds(h) + *pScaleName;
n %= scaleFactor;
if (n) res += ", ";
}
scaleFactor /= 1000;
++pScaleName;
}
return res;
}
int main() {
#define SPELL_IT(x) std::cout << #x " " << spell(x) << std::endl;
SPELL_IT( 99);
SPELL_IT( 300);
SPELL_IT( 310);
SPELL_IT( 1501);
SPELL_IT( 12609);
SPELL_IT( 512609);
SPELL_IT(43112609);
SPELL_IT(1234567890);
return 0;
}
|
Convert this Python snippet to C++ and keep its semantics consistent. | A = 'I am string'
B = 'I am string too'
if len(A) > len(B):
print('"' + A + '"', 'has length', len(A), 'and is the longest of the two strings')
print('"' + B + '"', 'has length', len(B), 'and is the shortest of the two strings')
elif len(A) < len(B):
print('"' + B + '"', 'has length', len(B), 'and is the longest of the two strings')
print('"' + A + '"', 'has length', len(A), 'and is the shortest of the two strings')
else:
print('"' + A + '"', 'has length', len(A), 'and it is as long as the second string')
print('"' + B + '"', 'has length', len(B), 'and it is as long as the second string')
| #include <iostream>
#include <algorithm>
#include <string>
#include <list>
using namespace std;
bool cmp(const string& a, const string& b)
{
return b.length() < a.length();
}
void compareAndReportStringsLength(list<string> listOfStrings)
{
if (!listOfStrings.empty())
{
char Q = '"';
string has_length(" has length ");
string predicate_max(" and is the longest string");
string predicate_min(" and is the shortest string");
string predicate_ave(" and is neither the longest nor the shortest string");
list<string> ls(listOfStrings);
ls.sort(cmp);
int max = ls.front().length();
int min = ls.back().length();
for (list<string>::iterator s = ls.begin(); s != ls.end(); s++)
{
int length = s->length();
string* predicate;
if (length == max)
predicate = &predicate_max;
else if (length == min)
predicate = &predicate_min;
else
predicate = &predicate_ave;
cout << Q << *s << Q << has_length << length << *predicate << endl;
}
}
}
int main(int argc, char* argv[])
{
list<string> listOfStrings{ "abcd", "123456789", "abcdef", "1234567" };
compareAndReportStringsLength(listOfStrings);
return EXIT_SUCCESS;
}
|
Rewrite the snippet below in C++ so it works the same as the original Python code. | def shell(seq):
inc = len(seq) // 2
while inc:
for i, el in enumerate(seq[inc:], inc):
while i >= inc and seq[i - inc] > el:
seq[i] = seq[i - inc]
i -= inc
seq[i] = el
inc = 1 if inc == 2 else inc * 5 // 11
| #include <time.h>
#include <iostream>
using namespace std;
const int MAX = 126;
class shell
{
public:
shell()
{ _gap[0] = 1750; _gap[1] = 701; _gap[2] = 301; _gap[3] = 132; _gap[4] = 57; _gap[5] = 23; _gap[6] = 10; _gap[7] = 4; _gap[8] = 1; }
void sort( int* a, int count )
{
_cnt = count;
for( int x = 0; x < 9; x++ )
if( count > _gap[x] )
{ _idx = x; break; }
sortIt( a );
}
private:
void sortIt( int* arr )
{
bool sorted = false;
while( true )
{
sorted = true;
int st = 0;
for( int x = _gap[_idx]; x < _cnt; x += _gap[_idx] )
{
if( arr[st] > arr[x] )
{ swap( arr[st], arr[x] ); sorted = false; }
st = x;
}
if( ++_idx >= 8 ) _idx = 8;
if( sorted && _idx == 8 ) break;
}
}
void swap( int& a, int& b ) { int t = a; a = b; b = t; }
int _gap[9], _idx, _cnt;
};
int main( int argc, char* argv[] )
{
srand( static_cast<unsigned int>( time( NULL ) ) ); int arr[MAX];
for( int x = 0; x < MAX; x++ )
arr[x] = rand() % MAX - rand() % MAX;
cout << " Before: \n=========\n";
for( int x = 0; x < 7; x++ )
{
for( int a = 0; a < 18; a++ )
{ cout << arr[x * 18 + a] << " "; }
cout << endl;
}
cout << endl; shell s; s.sort( arr, MAX );
cout << " After: \n========\n";
for( int x = 0; x < 7; x++ )
{
for( int a = 0; a < 18; a++ )
{ cout << arr[x * 18 + a] << " "; }
cout << endl;
}
cout << endl << endl; return system( "pause" );
}
|
Preserve the algorithm and functionality while converting the code from Python to C++. | from collections import deque
some_list = deque(["a", "b", "c"])
print(some_list)
some_list.appendleft("Z")
print(some_list)
for value in reversed(some_list):
print(value)
| #include <iostream>
#include <list>
int main ()
{
std::list<int> numbers {1, 5, 7, 0, 3, 2};
numbers.insert(numbers.begin(), 9);
numbers.insert(numbers.end(), 4);
auto it = std::next(numbers.begin(), numbers.size() / 2);
numbers.insert(it, 6);
for(const auto& i: numbers)
std::cout << i << ' ';
std::cout << '\n';
}
|
Convert this Python snippet to C++ and keep its semantics consistent. | import collections, sys
def filecharcount(openfile):
return sorted(collections.Counter(c for l in openfile for c in l).items())
f = open(sys.argv[1])
print(filecharcount(f))
| #include <fstream>
#include <iostream>
int main()
{
std::ifstream input("filename.txt", std::ios_base::binary);
if (!input)
{
std::cerr << "error: can't open file\n";
return -1;
}
size_t count[256];
std::fill_n(count, 256, 0);
for (char c; input.get(c); ++count[uint8_t(c)])
;
for (size_t i = 0; i < 256; ++i)
{
if (count[i] && isgraph(i))
{
std::cout << char(i) << " = " << count[i] << '\n';
}
}
}
|
Ensure the translated C++ code behaves exactly like the original Python snippet. | from itertools import combinations as comb
def statistic(ab, a):
sumab, suma = sum(ab), sum(a)
return ( suma / len(a) -
(sumab -suma) / (len(ab) - len(a)) )
def permutationTest(a, b):
ab = a + b
Tobs = statistic(ab, a)
under = 0
for count, perm in enumerate(comb(ab, len(a)), 1):
if statistic(ab, perm) <= Tobs:
under += 1
return under * 100. / count
treatmentGroup = [85, 88, 75, 66, 25, 29, 83, 39, 97]
controlGroup = [68, 41, 10, 49, 16, 65, 32, 92, 28, 98]
under = permutationTest(treatmentGroup, controlGroup)
print("under=%.2f%%, over=%.2f%%" % (under, 100. - under))
| #include<iostream>
#include<vector>
#include<numeric>
#include<functional>
class
{
public:
int64_t operator()(int n, int k){ return partial_factorial(n, k) / factorial(n - k);}
private:
int64_t partial_factorial(int from, int to) { return from == to ? 1 : from * partial_factorial(from - 1, to); }
int64_t factorial(int n) { return n == 0 ? 1 : n * factorial(n - 1);}
}combinations;
int main()
{
static constexpr int treatment = 9;
const std::vector<int> data{ 85, 88, 75, 66, 25, 29, 83, 39, 97,
68, 41, 10, 49, 16, 65, 32, 92, 28, 98 };
int treated = std::accumulate(data.begin(), data.begin() + treatment, 0);
std::function<int (int, int, int)> pick;
pick = [&](int n, int from, int accumulated)
{
if(n == 0)
return accumulated > treated ? 1 : 0;
else
return pick(n - 1, from - 1, accumulated + data[from - 1]) +
(from > n ? pick(n, from - 1, accumulated) : 0);
};
int total = combinations(data.size(), treatment);
int greater = pick(treatment, data.size(), 0);
int lesser = total - greater;
std::cout << "<= : " << 100.0 * lesser / total << "% " << lesser << std::endl
<< " > : " << 100.0 * greater / total << "% " << greater << std::endl;
}
|
Change the programming language of this snippet from Python to C++ without modifying what it does. |
def isPrime(n) :
if (n < 2) :
return False
for i in range(2, n + 1) :
if (i * i <= n and n % i == 0) :
return False
return True
def mobius(N) :
if (N == 1) :
return 1
p = 0
for i in range(1, N + 1) :
if (N % i == 0 and
isPrime(i)) :
if (N % (i * i) == 0) :
return 0
else :
p = p + 1
if(p % 2 != 0) :
return -1
else :
return 1
print("Mobius numbers from 1..99:")
for i in range(1, 100):
print(f"{mobius(i):>4}", end = '')
if i % 20 == 0: print()
| #include <iomanip>
#include <iostream>
#include <vector>
constexpr int MU_MAX = 1'000'000;
std::vector<int> MU;
int mobiusFunction(int n) {
if (!MU.empty()) {
return MU[n];
}
MU.resize(MU_MAX + 1, 1);
int root = sqrt(MU_MAX);
for (int i = 2; i <= root; i++) {
if (MU[i] == 1) {
for (int j = i; j <= MU_MAX; j += i) {
MU[j] *= -i;
}
for (int j = i * i; j <= MU_MAX; j += i * i) {
MU[j] = 0;
}
}
}
for (int i = 2; i <= MU_MAX; i++) {
if (MU[i] == i) {
MU[i] = 1;
} else if (MU[i] == -i) {
MU[i] = -1;
} else if (MU[i] < 0) {
MU[i] = 1;
} else if (MU[i] > 0) {
MU[i] = -1;
}
}
return MU[n];
}
int main() {
std::cout << "First 199 terms of the möbius function are as follows:\n ";
for (int n = 1; n < 200; n++) {
std::cout << std::setw(2) << mobiusFunction(n) << " ";
if ((n + 1) % 20 == 0) {
std::cout << '\n';
}
}
return 0;
}
|
Port the following code from Python to C++ with equivalent syntax and logic. | next = str(int('123') + 1)
|
#include <cstdlib>
#include <string>
#include <sstream>
std::string s = "12345";
int i;
std::istringstream(s) >> i;
i++;
std::ostringstream oss;
if (oss << i) s = oss.str();
|
Translate this program into C++ but keep the logic exactly as in Python. | >>> def stripchars(s, chars):
... return s.translate(None, chars)
...
>>> stripchars("She was a soul stripper. She took my heart!", "aei")
'Sh ws soul strppr. Sh took my hrt!'
| #include <algorithm>
#include <iostream>
#include <string>
std::string stripchars(std::string str, const std::string &chars)
{
str.erase(
std::remove_if(str.begin(), str.end(), [&](char c){
return chars.find(c) != std::string::npos;
}),
str.end()
);
return str;
}
int main()
{
std::cout << stripchars("She was a soul stripper. She took my heart!", "aei") << '\n';
return 0;
}
|
Produce a functionally identical C++ code for the snippet given in Python. | from itertools import permutations
in_order = lambda s: all(x <= s[i+1] for i,x in enumerate(s[:-1]))
perm_sort = lambda s: (p for p in permutations(s) if in_order(p)).next()
| #include <algorithm>
template<typename ForwardIterator>
void permutation_sort(ForwardIterator begin, ForwardIterator end)
{
while (std::next_permutation(begin, end))
{
}
}
|
Translate this program into C++ but keep the logic exactly as in Python. | from math import fsum
def average(x):
return fsum(x)/float(len(x)) if x else 0
print (average([0,0,3,1,4,1,5,9,0,0]))
print (average([1e20,-1e-20,3,1,4,1,5,9,-1e20,1e-20]))
| #include <vector>
double mean(const std::vector<double>& numbers)
{
if (numbers.size() == 0)
return 0;
double sum = 0;
for (std::vector<double>::iterator i = numbers.begin(); i != numbers.end(); i++)
sum += *i;
return sum / numbers.size();
}
|
Translate the given Python code snippet into C++ without altering its behavior. | command_table_text =
user_words = "riG rePEAT copies put mo rest types fup. 6 poweRin"
def find_abbreviations_length(command_table_text):
command_table = dict()
input_iter = iter(command_table_text.split())
word = None
try:
while True:
if word is None:
word = next(input_iter)
abbr_len = next(input_iter, len(word))
try:
command_table[word] = int(abbr_len)
word = None
except ValueError:
command_table[word] = len(word)
word = abbr_len
except StopIteration:
pass
return command_table
def find_abbreviations(command_table):
abbreviations = dict()
for command, min_abbr_len in command_table.items():
for l in range(min_abbr_len, len(command)+1):
abbr = command[:l].lower()
abbreviations[abbr] = command.upper()
return abbreviations
def parse_user_string(user_string, abbreviations):
user_words = [word.lower() for word in user_string.split()]
commands = [abbreviations.get(user_word, "*error*") for user_word in user_words]
return " ".join(commands)
command_table = find_abbreviations_length(command_table_text)
abbreviations_table = find_abbreviations(command_table)
full_words = parse_user_string(user_words, abbreviations_table)
print("user words:", user_words)
print("full words:", full_words)
| #include <algorithm>
#include <cctype>
#include <iostream>
#include <sstream>
#include <string>
#include <vector>
const char* command_table =
"add 1 alter 3 backup 2 bottom 1 Cappend 2 change 1 Schange Cinsert 2 Clast 3 "
"compress 4 copy 2 count 3 Coverlay 3 cursor 3 delete 3 Cdelete 2 down 1 duplicate "
"3 xEdit 1 expand 3 extract 3 find 1 Nfind 2 Nfindup 6 NfUP 3 Cfind 2 findUP 3 fUP 2 "
"forward 2 get help 1 hexType 4 input 1 powerInput 3 join 1 split 2 spltJOIN load "
"locate 1 Clocate 2 lowerCase 3 upperCase 3 Lprefix 2 macro merge 2 modify 3 move 2 "
"msg next 1 overlay 1 parse preserve 4 purge 3 put putD query 1 quit read recover 3 "
"refresh renum 3 repeat 3 replace 1 Creplace 2 reset 3 restore 4 rgtLEFT right 2 left "
"2 save set shift 2 si sort sos stack 3 status 4 top transfer 3 type 1 up 1";
class command {
public:
command(const std::string&, size_t);
const std::string& cmd() const { return cmd_; }
size_t min_length() const { return min_len_; }
bool match(const std::string&) const;
private:
std::string cmd_;
size_t min_len_;
};
command::command(const std::string& cmd, size_t min_len)
: cmd_(cmd), min_len_(min_len) {}
bool command::match(const std::string& str) const {
size_t olen = str.length();
return olen >= min_len_ && olen <= cmd_.length()
&& cmd_.compare(0, olen, str) == 0;
}
bool parse_integer(const std::string& word, int& value) {
try {
size_t pos;
int i = std::stoi(word, &pos, 10);
if (pos < word.length())
return false;
value = i;
return true;
} catch (const std::exception& ex) {
return false;
}
}
void uppercase(std::string& str) {
std::transform(str.begin(), str.end(), str.begin(),
[](unsigned char c) -> unsigned char { return std::toupper(c); });
}
class command_list {
public:
explicit command_list(const char*);
const command* find_command(const std::string&) const;
private:
std::vector<command> commands_;
};
command_list::command_list(const char* table) {
std::istringstream is(table);
std::string word;
std::vector<std::string> words;
while (is >> word) {
uppercase(word);
words.push_back(word);
}
for (size_t i = 0, n = words.size(); i < n; ++i) {
word = words[i];
int len = word.length();
if (i + 1 < n && parse_integer(words[i + 1], len))
++i;
commands_.push_back(command(word, len));
}
}
const command* command_list::find_command(const std::string& word) const {
auto iter = std::find_if(commands_.begin(), commands_.end(),
[&word](const command& cmd) { return cmd.match(word); });
return (iter != commands_.end()) ? &*iter : nullptr;
}
std::string test(const command_list& commands, const std::string& input) {
std::string output;
std::istringstream is(input);
std::string word;
while (is >> word) {
if (!output.empty())
output += ' ';
uppercase(word);
const command* cmd_ptr = commands.find_command(word);
if (cmd_ptr)
output += cmd_ptr->cmd();
else
output += "*error*";
}
return output;
}
int main() {
command_list commands(command_table);
std::string input("riG rePEAT copies put mo rest types fup. 6 poweRin");
std::string output(test(commands, input));
std::cout << " input: " << input << '\n';
std::cout << "output: " << output << '\n';
return 0;
}
|
Produce a functionally identical C++ code for the snippet given in Python. | command_table_text =
user_words = "riG rePEAT copies put mo rest types fup. 6 poweRin"
def find_abbreviations_length(command_table_text):
command_table = dict()
input_iter = iter(command_table_text.split())
word = None
try:
while True:
if word is None:
word = next(input_iter)
abbr_len = next(input_iter, len(word))
try:
command_table[word] = int(abbr_len)
word = None
except ValueError:
command_table[word] = len(word)
word = abbr_len
except StopIteration:
pass
return command_table
def find_abbreviations(command_table):
abbreviations = dict()
for command, min_abbr_len in command_table.items():
for l in range(min_abbr_len, len(command)+1):
abbr = command[:l].lower()
abbreviations[abbr] = command.upper()
return abbreviations
def parse_user_string(user_string, abbreviations):
user_words = [word.lower() for word in user_string.split()]
commands = [abbreviations.get(user_word, "*error*") for user_word in user_words]
return " ".join(commands)
command_table = find_abbreviations_length(command_table_text)
abbreviations_table = find_abbreviations(command_table)
full_words = parse_user_string(user_words, abbreviations_table)
print("user words:", user_words)
print("full words:", full_words)
| #include <algorithm>
#include <cctype>
#include <iostream>
#include <sstream>
#include <string>
#include <vector>
const char* command_table =
"add 1 alter 3 backup 2 bottom 1 Cappend 2 change 1 Schange Cinsert 2 Clast 3 "
"compress 4 copy 2 count 3 Coverlay 3 cursor 3 delete 3 Cdelete 2 down 1 duplicate "
"3 xEdit 1 expand 3 extract 3 find 1 Nfind 2 Nfindup 6 NfUP 3 Cfind 2 findUP 3 fUP 2 "
"forward 2 get help 1 hexType 4 input 1 powerInput 3 join 1 split 2 spltJOIN load "
"locate 1 Clocate 2 lowerCase 3 upperCase 3 Lprefix 2 macro merge 2 modify 3 move 2 "
"msg next 1 overlay 1 parse preserve 4 purge 3 put putD query 1 quit read recover 3 "
"refresh renum 3 repeat 3 replace 1 Creplace 2 reset 3 restore 4 rgtLEFT right 2 left "
"2 save set shift 2 si sort sos stack 3 status 4 top transfer 3 type 1 up 1";
class command {
public:
command(const std::string&, size_t);
const std::string& cmd() const { return cmd_; }
size_t min_length() const { return min_len_; }
bool match(const std::string&) const;
private:
std::string cmd_;
size_t min_len_;
};
command::command(const std::string& cmd, size_t min_len)
: cmd_(cmd), min_len_(min_len) {}
bool command::match(const std::string& str) const {
size_t olen = str.length();
return olen >= min_len_ && olen <= cmd_.length()
&& cmd_.compare(0, olen, str) == 0;
}
bool parse_integer(const std::string& word, int& value) {
try {
size_t pos;
int i = std::stoi(word, &pos, 10);
if (pos < word.length())
return false;
value = i;
return true;
} catch (const std::exception& ex) {
return false;
}
}
void uppercase(std::string& str) {
std::transform(str.begin(), str.end(), str.begin(),
[](unsigned char c) -> unsigned char { return std::toupper(c); });
}
class command_list {
public:
explicit command_list(const char*);
const command* find_command(const std::string&) const;
private:
std::vector<command> commands_;
};
command_list::command_list(const char* table) {
std::istringstream is(table);
std::string word;
std::vector<std::string> words;
while (is >> word) {
uppercase(word);
words.push_back(word);
}
for (size_t i = 0, n = words.size(); i < n; ++i) {
word = words[i];
int len = word.length();
if (i + 1 < n && parse_integer(words[i + 1], len))
++i;
commands_.push_back(command(word, len));
}
}
const command* command_list::find_command(const std::string& word) const {
auto iter = std::find_if(commands_.begin(), commands_.end(),
[&word](const command& cmd) { return cmd.match(word); });
return (iter != commands_.end()) ? &*iter : nullptr;
}
std::string test(const command_list& commands, const std::string& input) {
std::string output;
std::istringstream is(input);
std::string word;
while (is >> word) {
if (!output.empty())
output += ' ';
uppercase(word);
const command* cmd_ptr = commands.find_command(word);
if (cmd_ptr)
output += cmd_ptr->cmd();
else
output += "*error*";
}
return output;
}
int main() {
command_list commands(command_table);
std::string input("riG rePEAT copies put mo rest types fup. 6 poweRin");
std::string output(test(commands, input));
std::cout << " input: " << input << '\n';
std::cout << "output: " << output << '\n';
return 0;
}
|
Write the same code in C++ as shown below in Python. | from __future__ import division
import math
def hist(source):
hist = {}; l = 0;
for e in source:
l += 1
if e not in hist:
hist[e] = 0
hist[e] += 1
return (l,hist)
def entropy(hist,l):
elist = []
for v in hist.values():
c = v / l
elist.append(-c * math.log(c ,2))
return sum(elist)
def printHist(h):
flip = lambda (k,v) : (v,k)
h = sorted(h.iteritems(), key = flip)
print 'Sym\thi\tfi\tInf'
for (k,v) in h:
print '%s\t%f\t%f\t%f'%(k,v,v/l,-math.log(v/l, 2))
source = "1223334444"
(l,h) = hist(source);
print '.[Results].'
print 'Length',l
print 'Entropy:', entropy(h, l)
printHist(h)
| #include <string>
#include <map>
#include <iostream>
#include <algorithm>
#include <cmath>
double log2( double number ) {
return log( number ) / log( 2 ) ;
}
int main( int argc , char *argv[ ] ) {
std::string teststring( argv[ 1 ] ) ;
std::map<char , int> frequencies ;
for ( char c : teststring )
frequencies[ c ] ++ ;
int numlen = teststring.length( ) ;
double infocontent = 0 ;
for ( std::pair<char , int> p : frequencies ) {
double freq = static_cast<double>( p.second ) / numlen ;
infocontent -= freq * log2( freq ) ;
}
std::cout << "The information content of " << teststring
<< " is " << infocontent << std::endl ;
return 0 ;
}
|
Maintain the same structure and functionality when rewriting this code in C++. | def token_with_escape(a, escape = '^', separator = '|'):
result = []
token = ''
state = 0
for c in a:
if state == 0:
if c == escape:
state = 1
elif c == separator:
result.append(token)
token = ''
else:
token += c
elif state == 1:
token += c
state = 0
result.append(token)
return result
| #include <iostream>
#include <stdexcept>
#include <string>
#include <vector>
using namespace std;
vector<string> tokenize(const string& input, char seperator, char escape) {
vector<string> output;
string token;
bool inEsc = false;
for (char ch : input) {
if (inEsc) {
inEsc = false;
} else if (ch == escape) {
inEsc = true;
continue;
} else if (ch == seperator) {
output.push_back(token);
token = "";
continue;
}
token += ch;
}
if (inEsc)
throw new invalid_argument("Invalid terminal escape");
output.push_back(token);
return output;
}
int main() {
string sample = "one^|uno||three^^^^|four^^^|^cuatro|";
cout << sample << endl;
cout << '[';
for (auto t : tokenize(sample, '|', '^')) {
cout << '"' << t << "\", ";
}
cout << ']' << endl;
return 0;
}
|
Convert the following code from Python to C++, ensuring the logic remains intact. | print "Hello world!"
| #include <iostream>
int main () {
std::cout << "Hello world!" << std::endl;
}
|
Convert this Python block to C++, preserving its control flow and logic. | LIMIT = 1_000_035
def primes2(limit=LIMIT):
if limit < 2: return []
if limit < 3: return [2]
lmtbf = (limit - 3) // 2
buf = [True] * (lmtbf + 1)
for i in range((int(limit ** 0.5) - 3) // 2 + 1):
if buf[i]:
p = i + i + 3
s = p * (i + 1) + i
buf[s::p] = [False] * ((lmtbf - s) // p + 1)
return [2] + [i + i + 3 for i, v in enumerate(buf) if v]
primes = primes2(LIMIT +6)
primeset = set(primes)
primearray = [n in primeset for n in range(LIMIT)]
s = [[] for x in range(4)]
unsexy = []
for p in primes:
if p > LIMIT:
break
if p + 6 in primeset and p + 6 < LIMIT:
s[0].append((p, p+6))
elif p + 6 in primeset:
break
else:
if p - 6 not in primeset:
unsexy.append(p)
continue
if p + 12 in primeset and p + 12 < LIMIT:
s[1].append((p, p+6, p+12))
else:
continue
if p + 18 in primeset and p + 18 < LIMIT:
s[2].append((p, p+6, p+12, p+18))
else:
continue
if p + 24 in primeset and p + 24 < LIMIT:
s[3].append((p, p+6, p+12, p+18, p+24))
print('"SEXY" PRIME GROUPINGS:')
for sexy, name in zip(s, 'pairs triplets quadruplets quintuplets'.split()):
print(f' {len(sexy)} {na (not isPrime(n-6))))) |> Array.ofSeq
printfn "There are %d unsexy primes less than 1,000,035. The last 10 are:" n.Length
Array.skip (n.Length-10) n |> Array.iter(fun n->printf "%d " n); printfn ""
let ni=pCache |> Seq.takeWhile(fun n->nme} ending with ...')
for sx in sexy[-5:]:
print(' ',sx)
print(f'\nThere are {len(unsexy)} unsexy primes ending with ...')
for usx in unsexy[-10:]:
print(' ',usx)
| #include <array>
#include <iostream>
#include <vector>
#include <boost/circular_buffer.hpp>
#include "prime_sieve.hpp"
int main() {
using std::cout;
using std::vector;
using boost::circular_buffer;
using group_buffer = circular_buffer<vector<int>>;
const int max = 1000035;
const int max_group_size = 5;
const int diff = 6;
const int array_size = max + diff;
const int max_groups = 5;
const int max_unsexy = 10;
prime_sieve sieve(array_size);
std::array<int, max_group_size> group_count{0};
vector<group_buffer> groups(max_group_size, group_buffer(max_groups));
int unsexy_count = 0;
circular_buffer<int> unsexy_primes(max_unsexy);
vector<int> group;
for (int p = 2; p < max; ++p) {
if (!sieve.is_prime(p))
continue;
if (!sieve.is_prime(p + diff) && (p - diff < 2 || !sieve.is_prime(p - diff))) {
++unsexy_count;
unsexy_primes.push_back(p);
} else {
group.clear();
group.push_back(p);
for (int group_size = 1; group_size < max_group_size; group_size++) {
int next_p = p + group_size * diff;
if (next_p >= max || !sieve.is_prime(next_p))
break;
group.push_back(next_p);
++group_count[group_size];
groups[group_size].push_back(group);
}
}
}
for (int size = 1; size < max_group_size; ++size) {
cout << "number of groups of size " << size + 1 << " is " << group_count[size] << '\n';
cout << "last " << groups[size].size() << " groups of size " << size + 1 << ":";
for (const vector<int>& group : groups[size]) {
cout << " (";
for (size_t i = 0; i < group.size(); ++i) {
if (i > 0)
cout << ' ';
cout << group[i];
}
cout << ")";
}
cout << "\n\n";
}
cout << "number of unsexy primes is " << unsexy_count << '\n';
cout << "last " << unsexy_primes.size() << " unsexy primes:";
for (int prime : unsexy_primes)
cout << ' ' << prime;
cout << '\n';
return 0;
}
|
Write the same algorithm in C++ as shown in this Python implementation. | >>> dif = lambda s: [x-s[i] for i,x in enumerate(s[1:])]
>>>
>>> difn = lambda s, n: difn(dif(s), n-1) if n else s
>>> s = [90, 47, 58, 29, 22, 32, 55, 5, 55, 73]
>>> difn(s, 0)
[90, 47, 58, 29, 22, 32, 55, 5, 55, 73]
>>> difn(s, 1)
[-43, 11, -29, -7, 10, 23, -50, 50, 18]
>>> difn(s, 2)
[54, -40, 22, 17, 13, -73, 100, -32]
>>> from pprint import pprint
>>> pprint( [difn(s, i) for i in xrange(10)] )
[[90, 47, 58, 29, 22, 32, 55, 5, 55, 73],
[-43, 11, -29, -7, 10, 23, -50, 50, 18],
[54, -40, 22, 17, 13, -73, 100, -32],
[-94, 62, -5, -4, -86, 173, -132],
[156, -67, 1, -82, 259, -305],
[-223, 68, -83, 341, -564],
[291, -151, 424, -905],
[-442, 575, -1329],
[1017, -1904],
[-2921]]
| #include <vector>
#include <iterator>
#include <algorithm>
template<typename InputIterator, typename OutputIterator>
OutputIterator forward_difference(InputIterator first, InputIterator last,
OutputIterator dest)
{
if (first == last)
return dest;
typedef typename std::iterator_traits<InputIterator>::value_type value_type;
value_type temp = *first++;
while (first != last)
{
value_type temp2 = *first++;
*dest++ = temp2 - temp;
temp = temp2;
}
return dest;
}
template<typename InputIterator, typename OutputIterator>
OutputIterator nth_forward_difference(int order,
InputIterator first, InputIterator last,
OutputIterator dest)
{
if (order == 0)
return std::copy(first, last, dest);
if (order == 1)
return forward_difference(first, last, dest);
typedef typename std::iterator_traits<InputIterator>::value_type value_type;
std::vector<value_type> temp_storage;
forward_difference(first, last, std::back_inserter(temp_storage));
typename std::vector<value_type>::iterator begin = temp_storage.begin(),
end = temp_storage.end();
for (int i = 1; i < order-1; ++i)
end = forward_difference(begin, end, begin);
return forward_difference(begin, end, dest);
}
#include <iostream>
int main()
{
double array[10] = { 90.0, 47.0, 58.0, 29.0, 22.0, 32.0, 55.0, 5.0, 55.0, 73.0 };
std::vector<double> dest;
nth_forward_difference(1, array, array+10, std::back_inserter(dest));
std::copy(dest.begin(), dest.end(), std::ostream_iterator<double>(std::cout, " "));
std::cout << std::endl;
nth_forward_difference(2, array, array+10, std::ostream_iterator<double>(std::cout, " "));
std::cout << std::endl;
nth_forward_difference(9, array, array+10, std::ostream_iterator<double>(std::cout, " "));
std::cout << std::endl;
nth_forward_difference(10, array, array+10, std::ostream_iterator<double>(std::cout, " "));
std::cout << std::endl;
nth_forward_difference(0, array, array+10, std::ostream_iterator<double>(std::cout, " "));
std::cout << std::endl;
double* end = nth_forward_difference(3, array, array+10, array);
for (double* p = array; p < end; ++p)
std::cout << *p << " ";
std::cout << std::endl;
return 0;
}
|
Rewrite this program in C++ while keeping its functionality equivalent to the Python version. | def prime(a):
return not (a < 2 or any(a % x == 0 for x in xrange(2, int(a**0.5) + 1)))
| #include <cmath>
bool is_prime(unsigned int n)
{
if (n <= 1)
return false;
if (n == 2)
return true;
for (unsigned int i = 2; i <= sqrt(n); ++i)
if (n % i == 0)
return false;
return true;
}
|
Translate the given Python code snippet into C++ without altering its behavior. | def binomialCoeff(n, k):
result = 1
for i in range(1, k+1):
result = result * (n-i+1) / i
return result
if __name__ == "__main__":
print(binomialCoeff(5, 3))
| double Factorial(double nValue)
{
double result = nValue;
double result_next;
double pc = nValue;
do
{
result_next = result*(pc-1);
result = result_next;
pc--;
}while(pc>2);
nValue = result;
return nValue;
}
double binomialCoefficient(double n, double k)
{
if (abs(n - k) < 1e-7 || k < 1e-7) return 1.0;
if( abs(k-1.0) < 1e-7 || abs(k - (n-1)) < 1e-7)return n;
return Factorial(n) /(Factorial(k)*Factorial((n - k)));
}
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.