Instruction stringlengths 45 106 | input_code stringlengths 1 13.7k | output_code stringlengths 1 13.7k |
|---|---|---|
Keep all operations the same but rewrite the snippet in C. | using System;
using System.Collections.Generic;
using System.Globalization;
using System.Linq;
using System.Runtime.Serialization;
public static class MergeAndAggregateDatasets
{
public static void Main()
{
string patientsCsv = @"
PATIENT_ID,LASTNAME
1001,Hopper
4004,Wirth
3003,Kemeny
2002,Gosling
5005,Kurtz";
string visitsCsv = @"
PATIENT_ID,VISIT_DATE,SCORE
2002,2020-09-10,6.8
1001,2020-09-17,5.5
4004,2020-09-24,8.4
2002,2020-10-08,
1001,,6.6
3003,2020-11-12,
4004,2020-11-05,7.0
1001,2020-11-19,5.3";
string format = "yyyy-MM-dd";
var formatProvider = new DateTimeFormat(format).FormatProvider;
var patients = ParseCsv(
patientsCsv.Split(Environment.NewLine, StringSplitOptions.RemoveEmptyEntries),
line => (PatientId: int.Parse(line[0]), LastName: line[1]));
var visits = ParseCsv(
visitsCsv.Split(Environment.NewLine, StringSplitOptions.RemoveEmptyEntries),
line => (
PatientId: int.Parse(line[0]),
VisitDate: DateTime.TryParse(line[1], formatProvider, DateTimeStyles.None, out var date) ? date : default(DateTime?),
Score: double.TryParse(line[2], out double score) ? score : default(double?)
)
);
var results =
patients.GroupJoin(visits,
p => p.PatientId,
v => v.PatientId,
(p, vs) => (
p.PatientId,
p.LastName,
LastVisit: vs.Max(v => v.VisitDate),
ScoreSum: vs.Sum(v => v.Score),
ScoreAvg: vs.Average(v => v.Score)
)
).OrderBy(r => r.PatientId);
Console.WriteLine("| PATIENT_ID | LASTNAME | LAST_VISIT | SCORE_SUM | SCORE_AVG |");
foreach (var r in results) {
Console.WriteLine($"| {r.PatientId,-10} | {r.LastName,-8} | {r.LastVisit?.ToString(format) ?? "",-10} | {r.ScoreSum,9} | {r.ScoreAvg,9} |");
}
}
private static IEnumerable<T> ParseCsv<T>(string[] contents, Func<string[], T> constructor)
{
for (int i = 1; i < contents.Length; i++) {
var line = contents[i].Split(',');
yield return constructor(line);
}
}
}
|
#include <ctime>
#include <cstdint>
extern "C" {
int64_t from date(const char* string) {
struct tm tmInfo = {0};
strptime(string, "%Y-%m-%d", &tmInfo);
return mktime(&tmInfo);
}
}
|
Port the following code from C# to C with equivalent syntax and logic. | using System;
namespace prog
{
class MainClass
{
const float T0 = 100f;
const float TR = 20f;
const float k = 0.07f;
readonly static float[] delta_t = {2.0f,5.0f,10.0f};
const int n = 100;
public delegate float func(float t);
static float NewtonCooling(float t)
{
return -k * (t-TR);
}
public static void Main (string[] args)
{
func f = new func(NewtonCooling);
for(int i=0; i<delta_t.Length; i++)
{
Console.WriteLine("delta_t = " + delta_t[i]);
Euler(f,T0,n,delta_t[i]);
}
}
public static void Euler(func f, float y, int n, float h)
{
for(float x=0; x<=n; x+=h)
{
Console.WriteLine("\t" + x + "\t" + y);
y += h * f(y);
}
}
}
}
| #include <stdio.h>
#include <math.h>
typedef double (*deriv_f)(double, double);
#define FMT " %7.3f"
void ivp_euler(deriv_f f, double y, int step, int end_t)
{
int t = 0;
printf(" Step %2d: ", (int)step);
do {
if (t % 10 == 0) printf(FMT, y);
y += step * f(t, y);
} while ((t += step) <= end_t);
printf("\n");
}
void analytic()
{
double t;
printf(" Time: ");
for (t = 0; t <= 100; t += 10) printf(" %7g", t);
printf("\nAnalytic: ");
for (t = 0; t <= 100; t += 10)
printf(FMT, 20 + 80 * exp(-0.07 * t));
printf("\n");
}
double cooling(double t, double temp)
{
return -0.07 * (temp - 20);
}
int main()
{
analytic();
ivp_euler(cooling, 100, 2, 100);
ivp_euler(cooling, 100, 5, 100);
ivp_euler(cooling, 100, 10, 100);
return 0;
}
|
Convert the following code from C# to C, ensuring the logic remains intact. | using System;
using System.Diagnostics;
namespace sons
{
class Program
{
static void Main(string[] args)
{
for (int i = 1; i < 23; i++)
Console.WriteLine(nonsqr(i));
for (int i = 1; i < 1000000; i++)
{
double j = Math.Sqrt(nonsqr(i));
Debug.Assert(j != Math.Floor(j),"Square");
}
}
static int nonsqr(int i)
{
return (int)(i + Math.Floor(0.5 + Math.Sqrt(i)));
}
}
}
| #include <math.h>
#include <stdio.h>
#include <assert.h>
int nonsqr(int n) {
return n + (int)(0.5 + sqrt(n));
}
int main() {
int i;
for (i = 1; i < 23; i++)
printf("%d ", nonsqr(i));
printf("\n");
for (i = 1; i < 1000000; i++) {
double j = sqrt(nonsqr(i));
assert(j != floor(j));
}
return 0;
}
|
Produce a language-to-language conversion: from C# to C, same semantics. | using System;
using System.Diagnostics;
namespace sons
{
class Program
{
static void Main(string[] args)
{
for (int i = 1; i < 23; i++)
Console.WriteLine(nonsqr(i));
for (int i = 1; i < 1000000; i++)
{
double j = Math.Sqrt(nonsqr(i));
Debug.Assert(j != Math.Floor(j),"Square");
}
}
static int nonsqr(int i)
{
return (int)(i + Math.Floor(0.5 + Math.Sqrt(i)));
}
}
}
| #include <math.h>
#include <stdio.h>
#include <assert.h>
int nonsqr(int n) {
return n + (int)(0.5 + sqrt(n));
}
int main() {
int i;
for (i = 1; i < 23; i++)
printf("%d ", nonsqr(i));
printf("\n");
for (i = 1; i < 1000000; i++) {
double j = sqrt(nonsqr(i));
assert(j != floor(j));
}
return 0;
}
|
Maintain the same structure and functionality when rewriting this code in C. | using System;
namespace SubString
{
class Program
{
static void Main(string[] args)
{
string s = "0123456789";
const int n = 3;
const int m = 2;
const char c = '3';
const string z = "345";
Console.WriteLine(s.Substring(n, m));
Console.WriteLine(s.Substring(n, s.Length - n));
Console.WriteLine(s.Substring(0, s.Length - 1));
Console.WriteLine(s.Substring(s.IndexOf(c), m));
Console.WriteLine(s.Substring(s.IndexOf(z), m));
}
}
}
|
#define _CRT_SECURE_NO_WARNINGS
#include <stdio.h>
#include <stdlib.h>
#include <string.h>
void putm(char* string, size_t m)
{
while(*string && m--)
putchar(*string++);
}
int main(void)
{
char string[] =
"Programs for other encodings (such as 8-bit ASCII, or EUC-JP)."
int n = 3;
int m = 4;
char knownCharacter = '(';
char knownSubstring[] = "encodings";
putm(string+n-1, m ); putchar('\n');
puts(string+n+1); putchar('\n');
putm(string, strlen(string)-1); putchar('\n');
putm(strchr(string, knownCharacter), m ); putchar('\n');
putm(strstr(string, knownSubstring), m ); putchar('\n');
return EXIT_SUCCESS;
}
|
Translate this program into C but keep the logic exactly as in C#. | using System;
namespace SubString
{
class Program
{
static void Main(string[] args)
{
string s = "0123456789";
const int n = 3;
const int m = 2;
const char c = '3';
const string z = "345";
Console.WriteLine(s.Substring(n, m));
Console.WriteLine(s.Substring(n, s.Length - n));
Console.WriteLine(s.Substring(0, s.Length - 1));
Console.WriteLine(s.Substring(s.IndexOf(c), m));
Console.WriteLine(s.Substring(s.IndexOf(z), m));
}
}
}
|
#define _CRT_SECURE_NO_WARNINGS
#include <stdio.h>
#include <stdlib.h>
#include <string.h>
void putm(char* string, size_t m)
{
while(*string && m--)
putchar(*string++);
}
int main(void)
{
char string[] =
"Programs for other encodings (such as 8-bit ASCII, or EUC-JP)."
int n = 3;
int m = 4;
char knownCharacter = '(';
char knownSubstring[] = "encodings";
putm(string+n-1, m ); putchar('\n');
puts(string+n+1); putchar('\n');
putm(string, strlen(string)-1); putchar('\n');
putm(strchr(string, knownCharacter), m ); putchar('\n');
putm(strstr(string, knownSubstring), m ); putchar('\n');
return EXIT_SUCCESS;
}
|
Port the following code from C# to C with equivalent syntax and logic. | using System;
class Program
{
public static bool JortSort<T>(T[] array) where T : IComparable, IEquatable<T>
{
T[] originalArray = (T[]) array.Clone();
Array.Sort(array);
for (var i = 0; i < originalArray.Length; i++)
{
if (!Equals(originalArray[i], array[i]))
{
return false;
}
}
return true;
}
}
| #include <stdio.h>
#include <stdlib.h>
int number_of_digits(int x){
int NumberOfDigits;
for(NumberOfDigits=0;x!=0;NumberOfDigits++){
x=x/10;
}
return NumberOfDigits;
}
int* convert_array(char array[], int NumberOfElements)
{
int *convertedArray=malloc(NumberOfElements*sizeof(int));
int originalElement, convertedElement;
for(convertedElement=0, originalElement=0; convertedElement<NumberOfElements; convertedElement++)
{
convertedArray[convertedElement]=atoi(&array[originalElement]);
originalElement+=number_of_digits(convertedArray[convertedElement])+1;
}
return convertedArray;
}
int isSorted(int array[], int numberOfElements){
int sorted=1;
for(int counter=0;counter<numberOfElements;counter++){
if(counter!=0 && array[counter-1]>array[counter]) sorted--;
}
return sorted;
}
int main(int argc, char* argv[])
{
int* convertedArray;
convertedArray=convert_array(*(argv+1), argc-1);
if(isSorted(convertedArray, argc-1)==1) printf("Did you forgot to turn on your brain?! This array is already sorted!\n");
else if(argc-1<=10) printf("Am I really supposed to sort this? Sort it by yourself!\n");
else printf("Am I really supposed to sort this? Bhahahaha!\n");
free(convertedArray);
return 0;
}
|
Rewrite the snippet below in C so it works the same as the original C# code. | using System;
class Program
{
static void Main()
{
foreach (var year in new[] { 1900, 1994, 1996, DateTime.Now.Year })
{
Console.WriteLine("{0} is {1}a leap year.",
year,
DateTime.IsLeapYear(year) ? string.Empty : "not ");
}
}
}
| #include <stdio.h>
int is_leap_year(unsigned year)
{
return !(year & (year % 100 ? 3 : 15));
}
int main(void)
{
const unsigned test_case[] = {
1900, 1994, 1996, 1997, 2000, 2024, 2025, 2026, 2100
};
const unsigned n = sizeof test_case / sizeof test_case[0];
for (unsigned i = 0; i != n; ++i) {
unsigned year = test_case[i];
printf("%u is %sa leap year.\n", year, is_leap_year(year) ? "" : "not ");
}
return 0;
}
|
Translate the given C# code snippet into C without altering its behavior. | using static System.Console;
using static System.Linq.Enumerable;
public class Program
{
public static void Main() {
foreach (int n in new [] { 0, 5, 13, 21, -22 }) WriteLine($"{n}: {string.Join(", ", LexOrder(n))}");
}
public static IEnumerable<int> LexOrder(int n) => (n < 1 ? Range(n, 2 - n) : Range(1, n)).OrderBy(i => i.ToString());
}
| #include <math.h>
#include <stdio.h>
#include <stdlib.h>
#include <string.h>
int compareStrings(const void *a, const void *b) {
const char **aa = (const char **)a;
const char **bb = (const char **)b;
return strcmp(*aa, *bb);
}
void lexOrder(int n, int *ints) {
char **strs;
int i, first = 1, last = n, k = n, len;
if (n < 1) {
first = n; last = 1; k = 2 - n;
}
strs = malloc(k * sizeof(char *));
for (i = first; i <= last; ++i) {
if (i >= 1) len = (int)log10(i) + 2;
else if (i == 0) len = 2;
else len = (int)log10(-i) + 3;
strs[i-first] = malloc(len);
sprintf(strs[i-first], "%d", i);
}
qsort(strs, k, sizeof(char *), compareStrings);
for (i = 0; i < k; ++i) {
ints[i] = atoi(strs[i]);
free(strs[i]);
}
free(strs);
}
int main() {
int i, j, k, n, *ints;
int numbers[5] = {0, 5, 13, 21, -22};
printf("In lexicographical order:\n\n");
for (i = 0; i < 5; ++i) {
k = n = numbers[i];
if (k < 1) k = 2 - k;
ints = malloc(k * sizeof(int));
lexOrder(n, ints);
printf("%3d: [", n);
for (j = 0; j < k; ++j) {
printf("%d ", ints[j]);
}
printf("\b]\n");
free(ints);
}
return 0;
}
|
Transform the following C# implementation into C, maintaining the same output and logic. | using System;
class NumberNamer {
static readonly string[] incrementsOfOne =
{ "zero", "one", "two", "three", "four",
"five", "six", "seven", "eight", "nine",
"ten", "eleven", "twelve", "thirteen", "fourteen",
"fifteen", "sixteen", "seventeen", "eighteen", "nineteen" };
static readonly string[] incrementsOfTen =
{ "", "", "twenty", "thirty", "fourty",
"fifty", "sixty", "seventy", "eighty", "ninety" };
const string millionName = "million",
thousandName = "thousand",
hundredName = "hundred",
andName = "and";
public static string GetName( int i ) {
string output = "";
if( i >= 1000000 ) {
output += ParseTriplet( i / 1000000 ) + " " + millionName;
i %= 1000000;
if( i == 0 ) return output;
}
if( i >= 1000 ) {
if( output.Length > 0 ) {
output += ", ";
}
output += ParseTriplet( i / 1000 ) + " " + thousandName;
i %= 1000;
if( i == 0 ) return output;
}
if( output.Length > 0 ) {
output += ", ";
}
output += ParseTriplet( i );
return output;
}
static string ParseTriplet( int i ) {
string output = "";
if( i >= 100 ) {
output += incrementsOfOne[i / 100] + " " + hundredName;
i %= 100;
if( i == 0 ) return output;
}
if( output.Length > 0 ) {
output += " " + andName + " ";
}
if( i >= 20 ) {
output += incrementsOfTen[i / 10];
i %= 10;
if( i == 0 ) return output;
}
if( output.Length > 0 ) {
output += " ";
}
output += incrementsOfOne[i];
return output;
}
}
class Program {
static void Main( string[] args ) {
Console.WriteLine( NumberNamer.GetName( 1 ) );
Console.WriteLine( NumberNamer.GetName( 234 ) );
Console.WriteLine( NumberNamer.GetName( 31337 ) );
Console.WriteLine( NumberNamer.GetName( 987654321 ) );
}
}
| #include <stdio.h>
#include <string.h>
const char *ones[] = { 0, "one", "two", "three", "four",
"five", "six", "seven", "eight", "nine",
"ten", "eleven", "twelve", "thirteen", "fourteen",
"fifteen", "sixteen", "seventeen", "eighteen", "nineteen" };
const char *tens[] = { 0, "ten", "twenty", "thirty", "forty",
"fifty", "sixty", "seventy", "eighty", "ninety" };
const char *llions[] = { 0, "thousand", "million", "billion", "trillion",
};
const int maxillion = sizeof(llions) / sizeof(llions[0]) * 3 - 3;
int say_hundred(const char *s, int len, int depth, int has_lead)
{
int c[3], i;
for (i = -3; i < 0; i++) {
if (len + i >= 0) c[i + 3] = s[len + i] - '0';
else c[i + 3] = 0;
}
if (!(c[0] + c[1] + c[2])) return 0;
if (c[0]) {
printf("%s hundred", ones[c[0]]);
has_lead = 1;
}
if (has_lead && (c[1] || c[2]))
printf((!depth || c[0]) && (!c[0] || !c[1]) ? "and " :
c[0] ? " " : "");
if (c[1] < 2) {
if (c[1] || c[2]) printf("%s", ones[c[1] * 10 + c[2]]);
} else {
if (c[1]) {
printf("%s", tens[c[1]]);
if (c[2]) putchar('-');
}
if (c[2]) printf("%s", ones[c[2]]);
}
return 1;
}
int say_maxillion(const char *s, int len, int depth, int has_lead)
{
int n = len / 3, r = len % 3;
if (!r) {
n--;
r = 3;
}
const char *e = s + r;
do {
if (say_hundred(s, r, n, has_lead) && n) {
has_lead = 1;
printf(" %s", llions[n]);
if (!depth) printf(", ");
else printf(" ");
}
s = e; e += 3;
} while (r = 3, n--);
return 1;
}
void say_number(const char *s)
{
int len, i, got_sign = 0;
while (*s == ' ') s++;
if (*s < '0' || *s > '9') {
if (*s == '-') got_sign = -1;
else if (*s == '+') got_sign = 1;
else goto nan;
s++;
} else
got_sign = 1;
while (*s == '0') {
s++;
if (*s == '\0') {
printf("zero\n");
return;
}
}
len = strlen(s);
if (!len) goto nan;
for (i = 0; i < len; i++) {
if (s[i] < '0' || s[i] > '9') {
printf("(not a number)");
return;
}
}
if (got_sign == -1) printf("minus ");
int n = len / maxillion;
int r = len % maxillion;
if (!r) {
r = maxillion;
n--;
}
const char *end = s + len - n * maxillion;
int has_lead = 0;
do {
if ((has_lead = say_maxillion(s, r, n, has_lead))) {
for (i = 0; i < n; i++)
printf(" %s", llions[maxillion / 3]);
if (n) printf(", ");
}
n--;
r = maxillion;
s = end;
end += r;
} while (n >= 0);
printf("\n");
return;
nan: printf("not a number\n");
return;
}
int main()
{
say_number("-42");
say_number("1984");
say_number("10000");
say_number("1024");
say_number("1001001001001");
say_number("123456789012345678901234567890123456789012345678900000001");
return 0;
}
|
Ensure the translated C code behaves exactly like the original C# snippet. | using System;
using System.Collections.Generic;
namespace example
{
class Program
{
static void Main(string[] args)
{
var strings = new string[] { "abcd", "123456789", "abcdef", "1234567" };
compareAndReportStringsLength(strings);
}
private static void compareAndReportStringsLength(string[] strings)
{
if (strings.Length > 0)
{
char Q = '"';
string hasLength = " has length ";
string predicateMax = " and is the longest string";
string predicateMin = " and is the shortest string";
string predicateAve = " and is neither the longest nor the shortest string";
string predicate;
(int, int)[] li = new (int, int)[strings.Length];
for (int i = 0; i < strings.Length; i++)
li[i] = (strings[i].Length, i);
Array.Sort(li, ((int, int) a, (int, int) b) => b.Item1 - a.Item1);
int maxLength = li[0].Item1;
int minLength = li[strings.Length - 1].Item1;
for (int i = 0; i < strings.Length; i++)
{
int length = li[i].Item1;
string str = strings[li[i].Item2];
if (length == maxLength)
predicate = predicateMax;
else if (length == minLength)
predicate = predicateMin;
else
predicate = predicateAve;
Console.WriteLine(Q + str + Q + hasLength + length + predicate);
}
}
}
}
}
| #include <stdio.h>
#include <stdlib.h>
#include <string.h>
int cmp(const int* a, const int* b)
{
return *b - *a;
}
void compareAndReportStringsLength(const char* strings[], const int n)
{
if (n > 0)
{
char* has_length = "has length";
char* predicate_max = "and is the longest string";
char* predicate_min = "and is the shortest string";
char* predicate_ave = "and is neither the longest nor the shortest string";
int* si = malloc(2 * n * sizeof(int));
if (si != NULL)
{
for (int i = 0; i < n; i++)
{
si[2 * i] = strlen(strings[i]);
si[2 * i + 1] = i;
}
qsort(si, n, 2 * sizeof(int), cmp);
int max = si[0];
int min = si[2 * (n - 1)];
for (int i = 0; i < n; i++)
{
int length = si[2 * i];
char* string = strings[si[2 * i + 1]];
char* predicate;
if (length == max)
predicate = predicate_max;
else if (length == min)
predicate = predicate_min;
else
predicate = predicate_ave;
printf("\"%s\" %s %d %s\n",
string, has_length, length, predicate);
}
free(si);
}
else
{
fputs("unable allocate memory buffer", stderr);
}
}
}
int main(int argc, char* argv[])
{
char* list[] = { "abcd", "123456789", "abcdef", "1234567" };
compareAndReportStringsLength(list, 4);
return EXIT_SUCCESS;
}
|
Port the provided C# code into C while preserving the original functionality. | using System;
using System.Collections.Generic;
using System.IO;
using System.Linq;
class Program
{
static SortedDictionary<TItem, int> GetFrequencies<TItem>(IEnumerable<TItem> items)
{
var dictionary = new SortedDictionary<TItem, int>();
foreach (var item in items)
{
if (dictionary.ContainsKey(item))
{
dictionary[item]++;
}
else
{
dictionary[item] = 1;
}
}
return dictionary;
}
static void Main(string[] arguments)
{
var file = arguments.FirstOrDefault();
if (File.Exists(file))
{
var text = File.ReadAllText(file);
foreach (var entry in GetFrequencies(text))
{
Console.WriteLine("{0}: {1}", entry.Key, entry.Value);
}
}
}
}
|
int frequency[26];
int ch;
FILE* txt_file = fopen ("a_text_file.txt", "rt");
for (ch = 0; ch < 26; ch++)
frequency[ch] = 0;
while (1) {
ch = fgetc(txt_file);
if (ch == EOF) break;
if ('a' <= ch && ch <= 'z')
frequency[ch-'a']++;
else if ('A' <= ch && ch <= 'Z')
frequency[ch-'A']++;
}
|
Write the same code in C as shown below in C#. | using System;
using System.Collections.Generic;
using System.IO;
using System.Linq;
class Program
{
static SortedDictionary<TItem, int> GetFrequencies<TItem>(IEnumerable<TItem> items)
{
var dictionary = new SortedDictionary<TItem, int>();
foreach (var item in items)
{
if (dictionary.ContainsKey(item))
{
dictionary[item]++;
}
else
{
dictionary[item] = 1;
}
}
return dictionary;
}
static void Main(string[] arguments)
{
var file = arguments.FirstOrDefault();
if (File.Exists(file))
{
var text = File.ReadAllText(file);
foreach (var entry in GetFrequencies(text))
{
Console.WriteLine("{0}: {1}", entry.Key, entry.Value);
}
}
}
}
|
int frequency[26];
int ch;
FILE* txt_file = fopen ("a_text_file.txt", "rt");
for (ch = 0; ch < 26; ch++)
frequency[ch] = 0;
while (1) {
ch = fgetc(txt_file);
if (ch == EOF) break;
if ('a' <= ch && ch <= 'z')
frequency[ch-'a']++;
else if ('A' <= ch && ch <= 'Z')
frequency[ch-'A']++;
}
|
Rewrite this program in C while keeping its functionality equivalent to the C# version. | string s = "12345";
s = (int.Parse(s) + 1).ToString();
using System.Numerics;
string bis = "123456789012345678999999999";
bis = (BigInteger.Parse(bis) + 1).ToString();
| #include <stdio.h>
#include <string.h>
#include <stdlib.h>
char * incr(char *s)
{
int i, begin, tail, len;
int neg = (*s == '-');
char tgt = neg ? '0' : '9';
if (!strcmp(s, "-1")) {
s[0] = '0', s[1] = '\0';
return s;
}
len = strlen(s);
begin = (*s == '-' || *s == '+') ? 1 : 0;
for (tail = len - 1; tail >= begin && s[tail] == tgt; tail--);
if (tail < begin && !neg) {
if (!begin) s = realloc(s, len + 2);
s[0] = '1';
for (i = 1; i <= len - begin; i++) s[i] = '0';
s[len + 1] = '\0';
} else if (tail == begin && neg && s[1] == '1') {
for (i = 1; i < len - begin; i++) s[i] = '9';
s[len - 1] = '\0';
} else {
for (i = len - 1; i > tail; i--)
s[i] = neg ? '9' : '0';
s[tail] += neg ? -1 : 1;
}
return s;
}
void string_test(const char *s)
{
char *ret = malloc(strlen(s));
strcpy(ret, s);
printf("text: %s\n", ret);
printf(" ->: %s\n", ret = incr(ret));
free(ret);
}
int main()
{
string_test("+0");
string_test("-1");
string_test("-41");
string_test("+41");
string_test("999");
string_test("+999");
string_test("109999999999999999999999999999999999999999");
string_test("-100000000000000000000000000000000000000000000");
return 0;
}
|
Produce a functionally identical C code for the snippet given in C#. | using System;
public static string RemoveCharactersFromString(string testString, string removeChars)
{
char[] charAry = removeChars.ToCharArray();
string returnString = testString;
foreach (char c in charAry)
{
while (returnString.IndexOf(c) > -1)
{
returnString = returnString.Remove(returnString.IndexOf(c), 1);
}
}
return returnString;
}
| #include <string.h>
#include <stdio.h>
#include <stdlib.h>
char *strip_chars(const char *string, const char *chars)
{
char * newstr = malloc(strlen(string) + 1);
int counter = 0;
for ( ; *string; string++) {
if (!strchr(chars, *string)) {
newstr[ counter ] = *string;
++ counter;
}
}
newstr[counter] = 0;
return newstr;
}
int main(void)
{
char *new = strip_chars("She was a soul stripper. She took my heart!", "aei");
printf("%s\n", new);
free(new);
return 0;
}
|
Ensure the translated C code behaves exactly like the original C# snippet. | using System;
using System.Linq;
class Program
{
static void Main()
{
Console.WriteLine(new[] { 1, 2, 3 }.Average());
}
}
| #include <stdio.h>
double mean(double *v, int len)
{
double sum = 0;
int i;
for (i = 0; i < len; i++)
sum += v[i];
return sum / len;
}
int main(void)
{
double v[] = {1, 2, 2.718, 3, 3.142};
int i, len;
for (len = 5; len >= 0; len--) {
printf("mean[");
for (i = 0; i < len; i++)
printf(i ? ", %g" : "%g", v[i]);
printf("] = %g\n", mean(v, len));
}
return 0;
}
|
Please provide an equivalent version of this C# code in C. | using System;
using System.Collections.Generic;
namespace Entropy
{
class Program
{
public static double logtwo(double num)
{
return Math.Log(num)/Math.Log(2);
}
public static void Main(string[] args)
{
label1:
string input = Console.ReadLine();
double infoC=0;
Dictionary<char,double> table = new Dictionary<char, double>();
foreach (char c in input)
{
if (table.ContainsKey(c))
table[c]++;
else
table.Add(c,1);
}
double freq;
foreach (KeyValuePair<char,double> letter in table)
{
freq=letter.Value/input.Length;
infoC+=freq*logtwo(freq);
}
infoC*=-1;
Console.WriteLine("The Entropy of {0} is {1}",input,infoC);
goto label1;
}
}
}
| #include <stdio.h>
#include <stdlib.h>
#include <stdbool.h>
#include <string.h>
#include <math.h>
#define MAXLEN 100
int makehist(unsigned char *S,int *hist,int len){
int wherechar[256];
int i,histlen;
histlen=0;
for(i=0;i<256;i++)wherechar[i]=-1;
for(i=0;i<len;i++){
if(wherechar[(int)S[i]]==-1){
wherechar[(int)S[i]]=histlen;
histlen++;
}
hist[wherechar[(int)S[i]]]++;
}
return histlen;
}
double entropy(int *hist,int histlen,int len){
int i;
double H;
H=0;
for(i=0;i<histlen;i++){
H-=(double)hist[i]/len*log2((double)hist[i]/len);
}
return H;
}
int main(void){
unsigned char S[MAXLEN];
int len,*hist,histlen;
double H;
scanf("%[^\n]",S);
len=strlen(S);
hist=(int*)calloc(len,sizeof(int));
histlen=makehist(S,hist,len);
H=entropy(hist,histlen,len);
printf("%lf\n",H);
return 0;
}
|
Generate an equivalent C version of this C# code. | using System;
using System.Text;
using System.Collections.Generic;
public class TokenizeAStringWithEscaping
{
public static void Main() {
string testcase = "one^|uno||three^^^^|four^^^|^cuatro|";
foreach (var token in testcase.Tokenize(separator: '|', escape: '^')) {
Console.WriteLine(": " + token);
}
}
}
public static class Extensions
{
public static IEnumerable<string> Tokenize(this string input, char separator, char escape) {
if (input == null) yield break;
var buffer = new StringBuilder();
bool escaping = false;
foreach (char c in input) {
if (escaping) {
buffer.Append(c);
escaping = false;
} else if (c == escape) {
escaping = true;
} else if (c == separator) {
yield return buffer.Flush();
} else {
buffer.Append(c);
}
}
if (buffer.Length > 0 || input[input.Length-1] == separator) yield return buffer.Flush();
}
public static string Flush(this StringBuilder stringBuilder) {
string result = stringBuilder.ToString();
stringBuilder.Clear();
return result;
}
}
| #include <stdlib.h>
#include <stdio.h>
#define STR_DEMO "one^|uno||three^^^^|four^^^|^cuatro|"
#define SEP '|'
#define ESC '^'
typedef char* Str;
unsigned int ElQ( const char *s, char sep, char esc );
Str *Tokenize( char *s, char sep, char esc, unsigned int *q );
int main() {
char s[] = STR_DEMO;
unsigned int i, q;
Str *list = Tokenize( s, SEP, ESC, &q );
if( list != NULL ) {
printf( "\n Original string: %s\n\n", STR_DEMO );
printf( " %d tokens:\n\n", q );
for( i=0; i<q; ++i )
printf( " %4d. %s\n", i+1, list[i] );
free( list );
}
return 0;
}
unsigned int ElQ( const char *s, char sep, char esc ) {
unsigned int q, e;
const char *p;
for( e=0, q=1, p=s; *p; ++p ) {
if( *p == esc )
e = !e;
else if( *p == sep )
q += !e;
else e = 0;
}
return q;
}
Str *Tokenize( char *s, char sep, char esc, unsigned int *q ) {
Str *list = NULL;
*q = ElQ( s, sep, esc );
list = malloc( *q * sizeof(Str) );
if( list != NULL ) {
unsigned int e, i;
char *p;
i = 0;
list[i++] = s;
for( e=0, p=s; *p; ++p ) {
if( *p == esc ) {
e = !e;
}
else if( *p == sep && !e ) {
list[i++] = p+1;
*p = '\0';
}
else {
e = 0;
}
}
}
return list;
}
|
Can you help me rewrite this code in C instead of C#, keeping it the same logically? | Using System;
namespace HelloWorld {
class Program
{
static void Main()
{
Console.Writeln("Hello World!");
}
}
}
| const hello = "Hello world!\n"
print(hello)
|
Can you help me rewrite this code in C instead of C#, keeping it the same logically? | using System;
using System.Collections.Generic;
using System.Linq;
class Program
{
static IEnumerable<int> ForwardDifference(IEnumerable<int> sequence, uint order = 1u)
{
switch (order)
{
case 0u:
return sequence;
case 1u:
return sequence.Skip(1).Zip(sequence, (next, current) => next - current);
default:
return ForwardDifference(ForwardDifference(sequence), order - 1u);
}
}
static void Main()
{
IEnumerable<int> sequence = new[] { 90, 47, 58, 29, 22, 32, 55, 5, 55, 73 };
do
{
Console.WriteLine(string.Join(", ", sequence));
} while ((sequence = ForwardDifference(sequence)).Any());
}
}
| #include <stdlib.h>
#include <string.h>
#include <stdio.h>
double* fwd_diff(double* x, unsigned int len, unsigned int order)
{
unsigned int i, j;
double* y;
if (order >= len) return 0;
y = malloc(sizeof(double) * len);
if (!order) {
memcpy(y, x, sizeof(double) * len);
return y;
}
for (j = 0; j < order; j++, x = y)
for (i = 0, len--; i < len; i++)
y[i] = x[i + 1] - x[i];
y = realloc(y, sizeof(double) * len);
return y;
}
int main(void)
{
double *y, x[] = {90, 47, 58, 29, 22, 32, 55, 5, 55, 73};
int i, len = sizeof(x) / sizeof(x[0]);
y = fwd_diff(x, len, 1);
for (i = 0; i < len - 1; i++)
printf("%g ", y[i]);
putchar('\n');
return 0;
}
|
Generate a C translation of this C# snippet without changing its computational steps. | static bool isPrime(int n)
{
if (n <= 1) return false;
for (int i = 2; i * i <= n; i++)
if (n % i == 0) return false;
return true;
}
| int is_prime(unsigned int n)
{
unsigned int p;
if (!(n & 1) || n < 2 ) return n == 2;
for (p = 3; p <= n/p; p += 2)
if (!(n % p)) return 0;
return 1;
}
|
Preserve the algorithm and functionality while converting the code from C# to C. | static bool isPrime(int n)
{
if (n <= 1) return false;
for (int i = 2; i * i <= n; i++)
if (n % i == 0) return false;
return true;
}
| int is_prime(unsigned int n)
{
unsigned int p;
if (!(n & 1) || n < 2 ) return n == 2;
for (p = 3; p <= n/p; p += 2)
if (!(n % p)) return 0;
return 1;
}
|
Please provide an equivalent version of this C# code in C. | using System;
namespace BinomialCoefficients
{
class Program
{
static void Main(string[] args)
{
ulong n = 1000000, k = 3;
ulong result = biCoefficient(n, k);
Console.WriteLine("The Binomial Coefficient of {0}, and {1}, is equal to: {2}", n, k, result);
Console.ReadLine();
}
static int fact(int n)
{
if (n == 0) return 1;
else return n * fact(n - 1);
}
static ulong biCoefficient(ulong n, ulong k)
{
if (k > n - k)
{
k = n - k;
}
ulong c = 1;
for (uint i = 0; i < k; i++)
{
c = c * (n - i);
c = c / (i + 1);
}
return c;
}
}
}
| #include <stdio.h>
#include <limits.h>
static unsigned long gcd_ui(unsigned long x, unsigned long y) {
unsigned long t;
if (y < x) { t = x; x = y; y = t; }
while (y > 0) {
t = y; y = x % y; x = t;
}
return x;
}
unsigned long binomial(unsigned long n, unsigned long k) {
unsigned long d, g, r = 1;
if (k == 0) return 1;
if (k == 1) return n;
if (k >= n) return (k == n);
if (k > n/2) k = n-k;
for (d = 1; d <= k; d++) {
if (r >= ULONG_MAX/n) {
unsigned long nr, dr;
g = gcd_ui(n, d); nr = n/g; dr = d/g;
g = gcd_ui(r, dr); r = r/g; dr = dr/g;
if (r >= ULONG_MAX/nr) return 0;
r *= nr;
r /= dr;
n--;
} else {
r *= n--;
r /= d;
}
}
return r;
}
int main() {
printf("%lu\n", binomial(5, 3));
printf("%lu\n", binomial(40, 19));
printf("%lu\n", binomial(67, 31));
return 0;
}
|
Produce a language-to-language conversion: from C# to C, same semantics. |
int[] intArray = new int[5] { 1, 2, 3, 4, 5 };
int[] intArray = new int[]{ 1, 2, 3, 4, 5 };
int[] intArray = { 1, 2, 3, 4, 5 };
string[] stringArr = new string[5];
stringArr[0] = "string";
| #define cSize( a ) ( sizeof(a)/sizeof(a[0]) )
int ar[10];
ar[0] = 1;
ar[1] = 2;
int* p;
for (p=ar;
p<(ar+cSize(ar));
p++) {
printf("%d\n",*p);
}
|
Generate an equivalent C version of this C# code. |
int[] intArray = new int[5] { 1, 2, 3, 4, 5 };
int[] intArray = new int[]{ 1, 2, 3, 4, 5 };
int[] intArray = { 1, 2, 3, 4, 5 };
string[] stringArr = new string[5];
stringArr[0] = "string";
| #define cSize( a ) ( sizeof(a)/sizeof(a[0]) )
int ar[10];
ar[0] = 1;
ar[1] = 2;
int* p;
for (p=ar;
p<(ar+cSize(ar));
p++) {
printf("%d\n",*p);
}
|
Generate a C translation of this C# snippet without changing its computational steps. | var current = [head of list to traverse]
while(current != null)
{
current = current.Next;
}
| struct link *first;
struct link *iter;
for(iter = first; iter != NULL; iter = iter->next) {
}
|
Convert this C# block to C, preserving its control flow and logic. | using System;
using System.IO;
class PPMWriter
{
public static void WriteBitmapToPPM(string file, Bitmap bitmap)
{
var writer = new StreamWriter(file);
writer.WriteLine("P6");
writer.WriteLine($"{bitmap.Width} {bitmap.Height}");
writer.WriteLine("255");
writer.Close();
var writerB = new BinaryWriter(new FileStream(file, FileMode.Append));
for (int x = 0; x < bitmap.Height; x++)
for (int y = 0; y < bitmap.Width; y++)
{
Color color = bitmap.GetPixel(y, x);
writerB.Write(color.R);
writerB.Write(color.G);
writerB.Write(color.B);
}
writerB.Close();
}
}
| #include <stdlib.h>
#include <stdio.h>
int main(void)
{
const int dimx = 800, dimy = 800;
int i, j;
FILE *fp = fopen("first.ppm", "wb");
(void) fprintf(fp, "P6\n%d %d\n255\n", dimx, dimy);
for (j = 0; j < dimy; ++j)
{
for (i = 0; i < dimx; ++i)
{
static unsigned char color[3];
color[0] = i % 256;
color[1] = j % 256;
color[2] = (i * j) % 256;
(void) fwrite(color, 1, 3, fp);
}
}
(void) fclose(fp);
return EXIT_SUCCESS;
}
|
Write the same algorithm in C as shown in this C# implementation. | using System;
using System.IO;
class PPMWriter
{
public static void WriteBitmapToPPM(string file, Bitmap bitmap)
{
var writer = new StreamWriter(file);
writer.WriteLine("P6");
writer.WriteLine($"{bitmap.Width} {bitmap.Height}");
writer.WriteLine("255");
writer.Close();
var writerB = new BinaryWriter(new FileStream(file, FileMode.Append));
for (int x = 0; x < bitmap.Height; x++)
for (int y = 0; y < bitmap.Width; y++)
{
Color color = bitmap.GetPixel(y, x);
writerB.Write(color.R);
writerB.Write(color.G);
writerB.Write(color.B);
}
writerB.Close();
}
}
| #include <stdlib.h>
#include <stdio.h>
int main(void)
{
const int dimx = 800, dimy = 800;
int i, j;
FILE *fp = fopen("first.ppm", "wb");
(void) fprintf(fp, "P6\n%d %d\n255\n", dimx, dimy);
for (j = 0; j < dimy; ++j)
{
for (i = 0; i < dimx; ++i)
{
static unsigned char color[3];
color[0] = i % 256;
color[1] = j % 256;
color[2] = (i * j) % 256;
(void) fwrite(color, 1, 3, fp);
}
}
(void) fclose(fp);
return EXIT_SUCCESS;
}
|
Change the following C# code into C without altering its purpose. | using System;
using System.IO;
namespace DeleteFile {
class Program {
static void Main() {
File.Delete("input.txt");
Directory.Delete("docs");
File.Delete("/input.txt");
Directory.Delete("/docs");
}
}
}
| #include <stdio.h>
int main() {
remove("input.txt");
remove("/input.txt");
remove("docs");
remove("/docs");
return 0;
}
|
Convert the following code from C# to C, ensuring the logic remains intact. | using System;
public static class DiscordianDate
{
static readonly string[] seasons = { "Chaos", "Discord", "Confusion", "Bureaucracy", "The Aftermath" };
static readonly string[] weekdays = { "Sweetmorn", "Boomtime", "Pungenday", "Prickle-Prickle", "Setting Orange" };
static readonly string[] apostles = { "Mungday", "Mojoday", "Syaday", "Zaraday", "Maladay" };
static readonly string[] holidays = { "Chaoflux", "Discoflux", "Confuflux", "Bureflux", "Afflux" };
public static string Discordian(this DateTime date) {
string yold = $" in the YOLD {date.Year + 1166}.";
int dayOfYear = date.DayOfYear;
if (DateTime.IsLeapYear(date.Year)) {
if (dayOfYear == 60) return "St. Tib's day" + yold;
else if (dayOfYear > 60) dayOfYear--;
}
dayOfYear--;
int seasonDay = dayOfYear % 73 + 1;
int seasonNr = dayOfYear / 73;
int weekdayNr = dayOfYear % 5;
string holyday = "";
if (seasonDay == 5) holyday = $" Celebrate {apostles[seasonNr]}!";
else if (seasonDay == 50) holyday = $" Celebrate {holidays[seasonNr]}!";
return $"{weekdays[weekdayNr]}, day {seasonDay} of {seasons[seasonNr]}{yold}{holyday}";
}
public static void Main() {
foreach (var (day, month, year) in new [] {
(1, 1, 2010),
(5, 1, 2010),
(19, 2, 2011),
(28, 2, 2012),
(29, 2, 2012),
(1, 3, 2012),
(19, 3, 2013),
(3, 5, 2014),
(31, 5, 2015),
(22, 6, 2016),
(15, 7, 2016),
(12, 8, 2017),
(19, 9, 2018),
(26, 9, 2018),
(24, 10, 2019),
(8, 12, 2020),
(31, 12, 2020)
})
{
Console.WriteLine($"{day:00}-{month:00}-{year:00} = {new DateTime(year, month, day).Discordian()}");
}
}
}
| #include <stdlib.h>
#include <stdio.h>
#include <time.h>
#define day_of_week( x ) ((x) == 1 ? "Sweetmorn" :\
(x) == 2 ? "Boomtime" :\
(x) == 3 ? "Pungenday" :\
(x) == 4 ? "Prickle-Prickle" :\
"Setting Orange")
#define season( x ) ((x) == 0 ? "Chaos" :\
(x) == 1 ? "Discord" :\
(x) == 2 ? "Confusion" :\
(x) == 3 ? "Bureaucracy" :\
"The Aftermath")
#define date( x ) ((x)%73 == 0 ? 73 : (x)%73)
#define leap_year( x ) ((x) % 400 == 0 || (((x) % 4) == 0 && (x) % 100))
char * ddate( int y, int d ){
int dyear = 1166 + y;
char * result = malloc( 100 * sizeof( char ) );
if( leap_year( y ) ){
if( d == 60 ){
sprintf( result, "St. Tib's Day, YOLD %d", dyear );
return result;
} else if( d >= 60 ){
-- d;
}
}
sprintf( result, "%s, %s %d, YOLD %d",
day_of_week(d%5), season(((d%73)==0?d-1:d)/73 ), date( d ), dyear );
return result;
}
int day_of_year( int y, int m, int d ){
int month_lengths[ 12 ] = { 31, 28, 31, 30, 31, 30, 31, 31, 30, 31, 30, 31 };
for( ; m > 1; m -- ){
d += month_lengths[ m - 2 ];
if( m == 3 && leap_year( y ) ){
++ d;
}
}
return d;
}
int main( int argc, char * argv[] ){
time_t now;
struct tm * now_time;
int year, doy;
if( argc == 1 ){
now = time( NULL );
now_time = localtime( &now );
year = now_time->tm_year + 1900; doy = now_time->tm_yday + 1;
} else if( argc == 4 ){
year = atoi( argv[ 1 ] ); doy = day_of_year( atoi( argv[ 1 ] ), atoi( argv[ 2 ] ), atoi( argv[ 3 ] ) );
}
char * result = ddate( year, doy );
puts( result );
free( result );
return 0;
}
|
Change the programming language of this snippet from C# to C without modifying what it does. | using System;
public static class DiscordianDate
{
static readonly string[] seasons = { "Chaos", "Discord", "Confusion", "Bureaucracy", "The Aftermath" };
static readonly string[] weekdays = { "Sweetmorn", "Boomtime", "Pungenday", "Prickle-Prickle", "Setting Orange" };
static readonly string[] apostles = { "Mungday", "Mojoday", "Syaday", "Zaraday", "Maladay" };
static readonly string[] holidays = { "Chaoflux", "Discoflux", "Confuflux", "Bureflux", "Afflux" };
public static string Discordian(this DateTime date) {
string yold = $" in the YOLD {date.Year + 1166}.";
int dayOfYear = date.DayOfYear;
if (DateTime.IsLeapYear(date.Year)) {
if (dayOfYear == 60) return "St. Tib's day" + yold;
else if (dayOfYear > 60) dayOfYear--;
}
dayOfYear--;
int seasonDay = dayOfYear % 73 + 1;
int seasonNr = dayOfYear / 73;
int weekdayNr = dayOfYear % 5;
string holyday = "";
if (seasonDay == 5) holyday = $" Celebrate {apostles[seasonNr]}!";
else if (seasonDay == 50) holyday = $" Celebrate {holidays[seasonNr]}!";
return $"{weekdays[weekdayNr]}, day {seasonDay} of {seasons[seasonNr]}{yold}{holyday}";
}
public static void Main() {
foreach (var (day, month, year) in new [] {
(1, 1, 2010),
(5, 1, 2010),
(19, 2, 2011),
(28, 2, 2012),
(29, 2, 2012),
(1, 3, 2012),
(19, 3, 2013),
(3, 5, 2014),
(31, 5, 2015),
(22, 6, 2016),
(15, 7, 2016),
(12, 8, 2017),
(19, 9, 2018),
(26, 9, 2018),
(24, 10, 2019),
(8, 12, 2020),
(31, 12, 2020)
})
{
Console.WriteLine($"{day:00}-{month:00}-{year:00} = {new DateTime(year, month, day).Discordian()}");
}
}
}
| #include <stdlib.h>
#include <stdio.h>
#include <time.h>
#define day_of_week( x ) ((x) == 1 ? "Sweetmorn" :\
(x) == 2 ? "Boomtime" :\
(x) == 3 ? "Pungenday" :\
(x) == 4 ? "Prickle-Prickle" :\
"Setting Orange")
#define season( x ) ((x) == 0 ? "Chaos" :\
(x) == 1 ? "Discord" :\
(x) == 2 ? "Confusion" :\
(x) == 3 ? "Bureaucracy" :\
"The Aftermath")
#define date( x ) ((x)%73 == 0 ? 73 : (x)%73)
#define leap_year( x ) ((x) % 400 == 0 || (((x) % 4) == 0 && (x) % 100))
char * ddate( int y, int d ){
int dyear = 1166 + y;
char * result = malloc( 100 * sizeof( char ) );
if( leap_year( y ) ){
if( d == 60 ){
sprintf( result, "St. Tib's Day, YOLD %d", dyear );
return result;
} else if( d >= 60 ){
-- d;
}
}
sprintf( result, "%s, %s %d, YOLD %d",
day_of_week(d%5), season(((d%73)==0?d-1:d)/73 ), date( d ), dyear );
return result;
}
int day_of_year( int y, int m, int d ){
int month_lengths[ 12 ] = { 31, 28, 31, 30, 31, 30, 31, 31, 30, 31, 30, 31 };
for( ; m > 1; m -- ){
d += month_lengths[ m - 2 ];
if( m == 3 && leap_year( y ) ){
++ d;
}
}
return d;
}
int main( int argc, char * argv[] ){
time_t now;
struct tm * now_time;
int year, doy;
if( argc == 1 ){
now = time( NULL );
now_time = localtime( &now );
year = now_time->tm_year + 1900; doy = now_time->tm_yday + 1;
} else if( argc == 4 ){
year = atoi( argv[ 1 ] ); doy = day_of_year( atoi( argv[ 1 ] ), atoi( argv[ 2 ] ), atoi( argv[ 3 ] ) );
}
char * result = ddate( year, doy );
puts( result );
free( result );
return 0;
}
|
Convert this C# snippet to C and keep its semantics consistent. | public class AverageLoopLength {
private static int N = 100000;
private static double analytical(int n) {
double[] factorial = new double[n + 1];
double[] powers = new double[n + 1];
powers[0] = 1.0;
factorial[0] = 1.0;
for (int i = 1; i <= n; i++) {
factorial[i] = factorial[i - 1] * i;
powers[i] = powers[i - 1] * n;
}
double sum = 0;
for (int i = 1; i <= n; i++) {
sum += factorial[n] / factorial[n - i] / powers[i];
}
return sum;
}
private static double average(int n) {
Random rnd = new Random();
double sum = 0.0;
for (int a = 0; a < N; a++) {
int[] random = new int[n];
for (int i = 0; i < n; i++) {
random[i] = rnd.Next(n);
}
var seen = new HashSet<double>(n);
int current = 0;
int length = 0;
while (seen.Add(current)) {
length++;
current = random[current];
}
sum += length;
}
return sum / N;
}
public static void Main(string[] args) {
Console.WriteLine(" N average analytical (error)");
Console.WriteLine("=== ========= ============ =========");
for (int i = 1; i <= 20; i++) {
var average = AverageLoopLength.average(i);
var analytical = AverageLoopLength.analytical(i);
Console.WriteLine("{0,3} {1,10:N4} {2,13:N4} {3,8:N2}%", i, average, analytical, (analytical - average) / analytical * 100);
}
}
}
| #include <stdio.h>
#include <stdlib.h>
#include <math.h>
#include <time.h>
#define MAX_N 20
#define TIMES 1000000
double factorial(int n) {
double f = 1;
int i;
for (i = 1; i <= n; i++) f *= i;
return f;
}
double expected(int n) {
double sum = 0;
int i;
for (i = 1; i <= n; i++)
sum += factorial(n) / pow(n, i) / factorial(n - i);
return sum;
}
int randint(int n) {
int r, rmax = RAND_MAX / n * n;
while ((r = rand()) >= rmax);
return r / (RAND_MAX / n);
}
int test(int n, int times) {
int i, count = 0;
for (i = 0; i < times; i++) {
int x = 1, bits = 0;
while (!(bits & x)) {
count++;
bits |= x;
x = 1 << randint(n);
}
}
return count;
}
int main(void) {
srand(time(0));
puts(" n\tavg\texp.\tdiff\n-------------------------------");
int n;
for (n = 1; n <= MAX_N; n++) {
int cnt = test(n, TIMES);
double avg = (double)cnt / TIMES;
double theory = expected(n);
double diff = (avg / theory - 1) * 100;
printf("%2d %8.4f %8.4f %6.3f%%\n", n, avg, theory, diff);
}
return 0;
}
|
Write a version of this VB function in Go with identical behavior. | Debug.Print Hex(&HF0F0 And &HFF00)
Debug.Print Hex(&HF0F0 Or &HFF00)
Debug.Print Hex(&HF0F0 Xor &HFF00)
Debug.Print Hex(Not &HF0F0)
Debug.Print Hex(&HF0F0 Eqv &HFF00)
Debug.Print Hex(&HF0F0 Imp &HFF00)
| package main
import "fmt"
func bitwise(a, b int16) {
fmt.Printf("a: %016b\n", uint16(a))
fmt.Printf("b: %016b\n", uint16(b))
fmt.Printf("and: %016b\n", uint16(a&b))
fmt.Printf("or: %016b\n", uint16(a|b))
fmt.Printf("xor: %016b\n", uint16(a^b))
fmt.Printf("not: %016b\n", uint16(^a))
if b < 0 {
fmt.Println("Right operand is negative, but all shifts require an unsigned right operand (shift distance).")
return
}
ua := uint16(a)
ub := uint32(b)
fmt.Printf("shl: %016b\n", uint16(ua<<ub))
fmt.Printf("shr: %016b\n", uint16(ua>>ub))
fmt.Printf("las: %016b\n", uint16(a<<ub))
fmt.Printf("ras: %016b\n", uint16(a>>ub))
fmt.Printf("rol: %016b\n", uint16(a<<ub|int16(uint16(a)>>(16-ub))))
fmt.Printf("ror: %016b\n", uint16(int16(uint16(a)>>ub)|a<<(16-ub)))
}
func main() {
var a, b int16 = -460, 6
bitwise(a, b)
}
|
Convert this VB block to Go, preserving its control flow and logic. | option explicit
const pi180= 0.01745329251994329576923690768489
const pi=3.1415926535897932384626433832795
class turtle
dim fso
dim fn
dim svg
dim iang
dim ori
dim incr
dim pdown
dim clr
dim x
dim y
public property let orient(n):ori = n*pi180 :end property
public property let iangle(n):iang= n*pi180 :end property
public sub pd() : pdown=true: end sub
public sub pu() :pdown=FALSE :end sub
public sub rt(i)
ori=ori - i*iang:
end sub
public sub lt(i):
ori=(ori + i*iang)
end sub
public sub bw(l)
x= x+ cos(ori+pi)*l*incr
y= y+ sin(ori+pi)*l*incr
end sub
public sub fw(l)
dim x1,y1
x1=x + cos(ori)*l*incr
y1=y + sin(ori)*l*incr
if pdown then line x,y,x1,y1
x=x1:y=y1
end sub
Private Sub Class_Initialize()
setlocale "us"
initsvg
x=400:y=400:incr=100
ori=90*pi180
iang=90*pi180
clr=0
pdown=true
end sub
Private Sub Class_Terminate()
disply
end sub
private sub line (x,y,x1,y1)
svg.WriteLine "<line x1=""" & x & """ y1= """& y & """ x2=""" & x1& """ y2=""" & y1 & """/>"
end sub
private sub disply()
dim shell
svg.WriteLine "</svg></body></html>"
svg.close
Set shell = CreateObject("Shell.Application")
shell.ShellExecute fn,1,False
end sub
private sub initsvg()
dim scriptpath
Set fso = CreateObject ("Scripting.Filesystemobject")
ScriptPath= Left(WScript.ScriptFullName, InStrRev(WScript.ScriptFullName, "\"))
fn=Scriptpath & "SIERP.HTML"
Set svg = fso.CreateTextFile(fn,True)
if SVG IS nothing then wscript.echo "Can
svg.WriteLine "<!DOCTYPE html>" &vbcrlf & "<html>" &vbcrlf & "<head>"
svg.writeline "<style>" & vbcrlf & "line {stroke:rgb(255,0,0);stroke-width:.5}" &vbcrlf &"</style>"
svg.writeline "</head>"&vbcrlf & "<body>"
svg.WriteLine "<svg xmlns=""http://www.w3.org/2000/svg"" width=""800"" height=""800"" viewBox=""0 0 800 800"">"
end sub
end class
sub dragon(st,le,dir)
if st=0 then x.fw le: exit sub
x.rt dir
dragon st-1, le/1.41421 ,1
x.rt dir*2
dragon st-1, le/1.41421 ,-1
x.rt dir
end sub
dim x
set x=new turtle
x.iangle=45
x.orient=45
x.incr=1
x.x=200:x.y=200
dragon 12,300,1
set x=nothing
| package main
import (
"fmt"
"image"
"image/color"
"image/draw"
"image/png"
"math"
"os"
)
const sep = 512
const depth = 14
var s = math.Sqrt2 / 2
var sin = []float64{0, s, 1, s, 0, -s, -1, -s}
var cos = []float64{1, s, 0, -s, -1, -s, 0, s}
var p = color.NRGBA{64, 192, 96, 255}
var b *image.NRGBA
func main() {
width := sep * 11 / 6
height := sep * 4 / 3
bounds := image.Rect(0, 0, width, height)
b = image.NewNRGBA(bounds)
draw.Draw(b, bounds, image.NewUniform(color.White), image.ZP, draw.Src)
dragon(14, 0, 1, sep, sep/2, sep*5/6)
f, err := os.Create("dragon.png")
if err != nil {
fmt.Println(err)
return
}
if err = png.Encode(f, b); err != nil {
fmt.Println(err)
}
if err = f.Close(); err != nil {
fmt.Println(err)
}
}
func dragon(n, a, t int, d, x, y float64) {
if n <= 1 {
x1 := int(x + .5)
y1 := int(y + .5)
x2 := int(x + d*cos[a] + .5)
y2 := int(y + d*sin[a] + .5)
xInc := 1
if x1 > x2 {
xInc = -1
}
yInc := 1
if y1 > y2 {
yInc = -1
}
for x, y := x1, y1; ; x, y = x+xInc, y+yInc {
b.Set(x, y, p)
if x == x2 {
break
}
}
return
}
d *= s
a1 := (a - t) & 7
a2 := (a + t) & 7
dragon(n-1, a1, 1, d, x, y)
dragon(n-1, a2, -1, d, x+d*cos[a1], y+d*sin[a1])
}
|
Translate the given VB code snippet into Go without altering its behavior. | $Include "Rapidq.inc"
dim file as qfilestream
if file.open("c:\A Test.txt", fmOpenRead) then
while not File.eof
print File.readline
wend
else
print "Cannot read file"
end if
input "Press enter to exit: ";a$
| package main
import (
"bufio"
"fmt"
"log"
"os"
)
func init() {
log.SetFlags(log.Lshortfile)
}
func main() {
inputFile, err := os.Open("byline.go")
if err != nil {
log.Fatal("Error opening input file:", err)
}
defer inputFile.Close()
scanner := bufio.NewScanner(inputFile)
for scanner.Scan() {
fmt.Println(scanner.Text())
}
if err := scanner.Err(); err != nil {
log.Fatal(scanner.Err())
}
}
|
Port the provided VB code into Go while preserving the original functionality. | Public Sub Insert(ByVal a As Node(Of T), ByVal b As Node(Of T), ByVal c As T)
Dim node As New Node(Of T)(value)
a.Next = node
node.Previous = a
b.Previous = node
node.Next = b
End Sub
| package main
import "fmt"
type dlNode struct {
string
next, prev *dlNode
}
type dlList struct {
head, tail *dlNode
}
func (list *dlList) String() string {
if list.head == nil {
return fmt.Sprint(list.head)
}
r := "[" + list.head.string
for p := list.head.next; p != nil; p = p.next {
r += " " + p.string
}
return r + "]"
}
func (list *dlList) insertTail(node *dlNode) {
if list.tail == nil {
list.head = node
} else {
list.tail.next = node
}
node.next = nil
node.prev = list.tail
list.tail = node
}
func (list *dlList) insertAfter(existing, insert *dlNode) {
insert.prev = existing
insert.next = existing.next
existing.next.prev = insert
existing.next = insert
if existing == list.tail {
list.tail = insert
}
}
func main() {
dll := &dlList{}
fmt.Println(dll)
a := &dlNode{string: "A"}
dll.insertTail(a)
dll.insertTail(&dlNode{string: "B"})
fmt.Println(dll)
dll.insertAfter(a, &dlNode{string: "C"})
fmt.Println(dll)
}
|
Produce a language-to-language conversion: from VB to Go, same semantics. | Dim s As Variant
Private Function quick_select(ByRef s As Variant, k As Integer) As Integer
Dim left As Integer, right As Integer, pos As Integer
Dim pivotValue As Integer, tmp As Integer
left = 1: right = UBound(s)
Do While left < right
pivotValue = s(k)
tmp = s(k)
s(k) = s(right)
s(right) = tmp
pos = left
For i = left To right
If s(i) < pivotValue Then
tmp = s(i)
s(i) = s(pos)
s(pos) = tmp
pos = pos + 1
End If
Next i
tmp = s(right)
s(right) = s(pos)
s(pos) = tmp
If pos = k Then
Exit Do
End If
If pos < k Then
left = pos + 1
Else
right = pos - 1
End If
Loop
quick_select = s(k)
End Function
Public Sub main()
Dim r As Integer, i As Integer
s = [{9, 8, 7, 6, 5, 0, 1, 2, 3, 4}]
For i = 1 To 10
r = quick_select(s, i)
Debug.Print IIf(i < 10, r & ", ", "" & r);
Next i
End Sub
| package main
import "fmt"
func quickselect(list []int, k int) int {
for {
px := len(list) / 2
pv := list[px]
last := len(list) - 1
list[px], list[last] = list[last], list[px]
i := 0
for j := 0; j < last; j++ {
if list[j] < pv {
list[i], list[j] = list[j], list[i]
i++
}
}
if i == k {
return pv
}
if k < i {
list = list[:i]
} else {
list[i], list[last] = list[last], list[i]
list = list[i+1:]
k -= i + 1
}
}
}
func main() {
for i := 0; ; i++ {
v := []int{9, 8, 7, 6, 5, 0, 1, 2, 3, 4}
if i == len(v) {
return
}
fmt.Println(quickselect(v, i))
}
}
|
Convert this VB block to Go, preserving its control flow and logic. | Private Function to_base(ByVal number As Long, base As Integer) As String
Dim digits As String, result As String
Dim i As Integer, digit As Integer
digits = "0123456789abcdefghijklmnopqrstuvwxyz"
Do While number > 0
digit = number Mod base
result = Mid(digits, digit + 1, 1) & result
number = number \ base
Loop
to_base = result
End Function
Private Function from_base(number As String, base As Integer) As Long
Dim digits As String, result As Long
Dim i As Integer
digits = "0123456789abcdefghijklmnopqrstuvwxyz"
result = Val(InStr(1, digits, Mid(number, 1, 1), vbTextCompare) - 1)
For i = 2 To Len(number)
result = result * base + Val(InStr(1, digits, Mid(number, i, 1), vbTextCompare) - 1)
Next i
from_base = result
End Function
Public Sub Non_decimal_radices_Convert()
Debug.Print "26 decimal in base 16 is: "; to_base(26, 16); ". Conversely, hexadecimal 1a in decimal is: "; from_base("1a", 16)
End Sub
| package main
import (
"fmt"
"math/big"
"strconv"
)
func main () {
s := strconv.FormatInt(26, 16)
fmt.Println(s)
i, err := strconv.ParseInt("1a", 16, 64)
if err == nil {
fmt.Println(i)
}
b, ok := new(big.Int).SetString("1a", 16)
if ok {
fmt.Println(b)
}
}
|
Preserve the algorithm and functionality while converting the code from VB to Go. | Sub printFiles(parentDir As FolderItem, pattern As String)
For i As Integer = 1 To parentDir.Count
If parentDir.Item(i).Directory Then
printFiles(parentDir.Item(i), pattern)
Else
Dim rg as New RegEx
Dim myMatch as RegExMatch
rg.SearchPattern = pattern
myMatch = rg.search(parentDir.Item(i).Name)
If myMatch <> Nil Then Print(parentDir.Item(i).AbsolutePath)
End If
Next
End Sub
| package main
import (
"fmt"
"os"
"path/filepath"
)
func VisitFile(fp string, fi os.FileInfo, err error) error {
if err != nil {
fmt.Println(err)
return nil
}
if fi.IsDir() {
return nil
}
matched, err := filepath.Match("*.mp3", fi.Name())
if err != nil {
fmt.Println(err)
return err
}
if matched {
fmt.Println(fp)
}
return nil
}
func main() {
filepath.Walk("/", VisitFile)
}
|
Rewrite the snippet below in Go so it works the same as the original VB code. | dim crctbl(255)
const crcc =&hEDB88320
sub gencrctable
for i= 0 to 255
k=i
for j=1 to 8
if k and 1 then
k=(k and &h7fffffff)\2 or (&h40000000 and ((k and &h80000000)<>0))
k=k xor crcc
else
k=(k and &h7fffffff)\2 or (&h40000000 and ((k and &h80000000)<>0))
end if
next
crctbl(i)=k
next
end sub
function crc32 (buf)
dim r,r1,i
r=&hffffffff
for i=1 to len(buf)
r1=(r and &h7fffffff)\&h100 or (&h800000 and (r and &h80000000)<>0)
r=r1 xor crctbl((asc(mid(buf,i,1))xor r) and 255)
next
crc32=r xor &hffffffff
end function
gencrctable
wscript.stdout.writeline hex(crc32("The quick brown fox jumps over the lazy dog"))
| package main
import (
"fmt"
"hash/crc32"
)
func main() {
s := []byte("The quick brown fox jumps over the lazy dog")
result := crc32.ChecksumIEEE(s)
fmt.Printf("%X\n", result)
}
|
Write the same algorithm in Go as shown in this VB implementation. | Public Sub CSV_TO_HTML()
input_ = "Character,Speech\n" & _
"The multitude,The messiah! Show us the messiah!\n" & _
"Brians mother,<angry>Now you listen here! He
"he
"The multitude,Who are you?\n" & _
"Brians mother,I
"The multitude,Behold his mother! Behold his mother!"
Debug.Print "<table>" & vbCrLf & "<tr><td>"
For i = 1 To Len(input_)
Select Case Mid(input_, i, 1)
Case "\"
If Mid(input_, i + 1, 1) = "n" Then
Debug.Print "</td></tr>" & vbCrLf & "<tr><td>";
i = i + 1
Else
Debug.Print Mid(input_, i, 1);
End If
Case ",": Debug.Print "</td><td>";
Case "<": Debug.Print "<";
Case ">": Debug.Print ">";
Case "&": Debug.Print "&";
Case Else: Debug.Print Mid(input_, i, 1);
End Select
Next i
Debug.Print "</td></tr>" & vbCrLf & "</table>"
End Sub
| package main
import (
"bytes"
"encoding/csv"
"fmt"
"html/template"
"strings"
)
var c = `Character,Speech
The multitude,The messiah! Show us the messiah!
Brians mother,<angry>Now you listen here! He's not the messiah; he's a very naughty boy! Now go away!</angry>
The multitude,Who are you?
Brians mother,I'm his mother; that's who!
The multitude,Behold his mother! Behold his mother!`
func main() {
if h, err := csvToHtml(c); err != nil {
fmt.Println(err)
} else {
fmt.Print(h)
}
}
func csvToHtml(c string) (string, error) {
data, err := csv.NewReader(bytes.NewBufferString(c)).ReadAll()
if err != nil {
return "", err
}
var b strings.Builder
err = template.Must(template.New("").Parse(`<table>
{{range .}} <tr>{{range .}}<td>{{.}}</td>{{end}}</tr>
{{end}}</table>
`)).Execute(&b, data)
return b.String(), err
}
|
Change the following VB code into Go without altering its purpose. | Public Sub CSV_TO_HTML()
input_ = "Character,Speech\n" & _
"The multitude,The messiah! Show us the messiah!\n" & _
"Brians mother,<angry>Now you listen here! He
"he
"The multitude,Who are you?\n" & _
"Brians mother,I
"The multitude,Behold his mother! Behold his mother!"
Debug.Print "<table>" & vbCrLf & "<tr><td>"
For i = 1 To Len(input_)
Select Case Mid(input_, i, 1)
Case "\"
If Mid(input_, i + 1, 1) = "n" Then
Debug.Print "</td></tr>" & vbCrLf & "<tr><td>";
i = i + 1
Else
Debug.Print Mid(input_, i, 1);
End If
Case ",": Debug.Print "</td><td>";
Case "<": Debug.Print "<";
Case ">": Debug.Print ">";
Case "&": Debug.Print "&";
Case Else: Debug.Print Mid(input_, i, 1);
End Select
Next i
Debug.Print "</td></tr>" & vbCrLf & "</table>"
End Sub
| package main
import (
"bytes"
"encoding/csv"
"fmt"
"html/template"
"strings"
)
var c = `Character,Speech
The multitude,The messiah! Show us the messiah!
Brians mother,<angry>Now you listen here! He's not the messiah; he's a very naughty boy! Now go away!</angry>
The multitude,Who are you?
Brians mother,I'm his mother; that's who!
The multitude,Behold his mother! Behold his mother!`
func main() {
if h, err := csvToHtml(c); err != nil {
fmt.Println(err)
} else {
fmt.Print(h)
}
}
func csvToHtml(c string) (string, error) {
data, err := csv.NewReader(bytes.NewBufferString(c)).ReadAll()
if err != nil {
return "", err
}
var b strings.Builder
err = template.Must(template.New("").Parse(`<table>
{{range .}} <tr>{{range .}}<td>{{.}}</td>{{end}}</tr>
{{end}}</table>
`)).Execute(&b, data)
return b.String(), err
}
|
Keep all operations the same but rewrite the snippet in Go. | Class NumberContainer
Private TheNumber As Integer
Sub Constructor(InitialNumber As Integer)
TheNumber = InitialNumber
End Sub
Function Number() As Integer
Return TheNumber
End Function
Sub Number(Assigns NewNumber As Integer)
TheNumber = NewNumber
End Sub
End Class
| package main
import "fmt"
type picnicBasket struct {
nServings int
corkscrew bool
}
func (b *picnicBasket) happy() bool {
return b.nServings > 1 && b.corkscrew
}
func newPicnicBasket(nPeople int) *picnicBasket {
return &picnicBasket{nPeople, nPeople > 0}
}
func main() {
var pb picnicBasket
pbl := picnicBasket{}
pbp := &picnicBasket{}
pbn := new(picnicBasket)
forTwo := newPicnicBasket(2)
forToo := &picnicBasket{nServings: 2, corkscrew: true}
fmt.Println(pb.nServings, pb.corkscrew)
fmt.Println(pbl.nServings, pbl.corkscrew)
fmt.Println(pbp)
fmt.Println(pbn)
fmt.Println(forTwo)
fmt.Println(forToo)
}
|
Transform the following VB implementation into Go, maintaining the same output and logic. | Module Module1
ReadOnly max As ULong = 1000000
Function Kaprekar(n As ULong) As Boolean
If n = 1 Then Return True
Dim sq = n * n
Dim sq_str = Str(sq)
Dim l = Len(sq_str)
For x = l - 1 To 1 Step -1
If sq_str(x) = "0" Then
l = l - 1
Else
Exit For
End If
Next
For x = 1 To l - 1
Dim p2 = Val(Mid(sq_str, x + 1))
If p2 > n Then
Continue For
End If
Dim p1 = Val(Left(sq_str, x))
If p1 > n Then Return False
If (p1 + p2) = n Then Return True
Next
Return False
End Function
Sub Main()
Dim count = 0
Console.WriteLine("Kaprekar numbers below 10000")
For n = 1 To max - 1
If Kaprekar(n) Then
count = count + 1
If n < 10000 Then
Console.WriteLine("{0,2} {1,4}", count, n)
End If
End If
Next
Console.WriteLine()
Console.WriteLine("{0} numbers below {1} are kaprekar numbers", count, max)
End Sub
End Module
| package main
import (
"fmt"
"strconv"
)
func kaprekar(n uint64, base uint64) (bool, int) {
order := 0
if n == 1 {
return true, -1
}
nn, power := n*n, uint64(1)
for power <= nn {
power *= base
order++
}
power /= base
order--
for ; power > 1; power /= base {
q, r := nn/power, nn%power
if q >= n {
return false, -1
}
if q+r == n {
return true, order
}
order--
}
return false, -1
}
func main() {
max := uint64(10000)
fmt.Printf("Kaprekar numbers < %d:\n", max)
for m := uint64(0); m < max; m++ {
if is, _ := kaprekar(m, 10); is {
fmt.Println(" ", m)
}
}
max = 1e6
var count int
for m := uint64(0); m < max; m++ {
if is, _ := kaprekar(m, 10); is {
count++
}
}
fmt.Printf("\nThere are %d Kaprekar numbers < %d.\n", count, max)
const base = 17
maxB := "1000000"
fmt.Printf("\nKaprekar numbers between 1 and %s(base %d):\n", maxB, base)
max, _ = strconv.ParseUint(maxB, base, 64)
fmt.Printf("\n Base 10 Base %d Square Split\n", base)
for m := uint64(2); m < max; m++ {
is, pos := kaprekar(m, base)
if !is {
continue
}
sq := strconv.FormatUint(m*m, base)
str := strconv.FormatUint(m, base)
split := len(sq)-pos
fmt.Printf("%8d %7s %12s %6s + %s\n", m,
str, sq, sq[:split], sq[split:])
}
}
|
Produce a language-to-language conversion: from VB to Go, same semantics. | Module Module1
ReadOnly max As ULong = 1000000
Function Kaprekar(n As ULong) As Boolean
If n = 1 Then Return True
Dim sq = n * n
Dim sq_str = Str(sq)
Dim l = Len(sq_str)
For x = l - 1 To 1 Step -1
If sq_str(x) = "0" Then
l = l - 1
Else
Exit For
End If
Next
For x = 1 To l - 1
Dim p2 = Val(Mid(sq_str, x + 1))
If p2 > n Then
Continue For
End If
Dim p1 = Val(Left(sq_str, x))
If p1 > n Then Return False
If (p1 + p2) = n Then Return True
Next
Return False
End Function
Sub Main()
Dim count = 0
Console.WriteLine("Kaprekar numbers below 10000")
For n = 1 To max - 1
If Kaprekar(n) Then
count = count + 1
If n < 10000 Then
Console.WriteLine("{0,2} {1,4}", count, n)
End If
End If
Next
Console.WriteLine()
Console.WriteLine("{0} numbers below {1} are kaprekar numbers", count, max)
End Sub
End Module
| package main
import (
"fmt"
"strconv"
)
func kaprekar(n uint64, base uint64) (bool, int) {
order := 0
if n == 1 {
return true, -1
}
nn, power := n*n, uint64(1)
for power <= nn {
power *= base
order++
}
power /= base
order--
for ; power > 1; power /= base {
q, r := nn/power, nn%power
if q >= n {
return false, -1
}
if q+r == n {
return true, order
}
order--
}
return false, -1
}
func main() {
max := uint64(10000)
fmt.Printf("Kaprekar numbers < %d:\n", max)
for m := uint64(0); m < max; m++ {
if is, _ := kaprekar(m, 10); is {
fmt.Println(" ", m)
}
}
max = 1e6
var count int
for m := uint64(0); m < max; m++ {
if is, _ := kaprekar(m, 10); is {
count++
}
}
fmt.Printf("\nThere are %d Kaprekar numbers < %d.\n", count, max)
const base = 17
maxB := "1000000"
fmt.Printf("\nKaprekar numbers between 1 and %s(base %d):\n", maxB, base)
max, _ = strconv.ParseUint(maxB, base, 64)
fmt.Printf("\n Base 10 Base %d Square Split\n", base)
for m := uint64(2); m < max; m++ {
is, pos := kaprekar(m, base)
if !is {
continue
}
sq := strconv.FormatUint(m*m, base)
str := strconv.FormatUint(m, base)
split := len(sq)-pos
fmt.Printf("%8d %7s %12s %6s + %s\n", m,
str, sq, sq[:split], sq[split:])
}
}
|
Keep all operations the same but rewrite the snippet in Go. | Option Explicit
Const numchars=127
Function LZWCompress(si)
Dim oDict, intMaxCode, i,z,ii,ss,strCurrent,strNext,j
Set oDict = CreateObject("Scripting.Dictionary")
ReDim a(Len(si))
intMaxCode = numchars
For i = 0 To numchars
oDict.Add Chr(i), i
Next
strCurrent = Left(si,1)
j=0
For ii=2 To Len(si)
strNext = Mid(si,ii,1)
ss=strCurrent & strNext
If oDict.Exists(ss) Then
strCurrent = ss
Else
a(j)=oDict.Item(strCurrent) :j=j+1
intMaxCode = intMaxCode + 1
oDict.Add ss, intMaxCode
strCurrent = strNext
End If
Next
a(j)=oDict.Item(strCurrent)
ReDim preserve a(j)
LZWCompress=a
Set oDict = Nothing
End Function
Function lzwUncompress(sc)
Dim intNext, intCurrent, intMaxCode, i,ss,istr,s,j
s=""
reDim dict(1000)
intMaxCode = numchars
For i = 0 To numchars : dict(i)= Chr(i) : Next
intCurrent=sc(0)
For j=1 To UBound(sc)
ss=dict(intCurrent)
s= s & ss
intMaxCode = intMaxCode + 1
intnext=sc(j)
If intNext<intMaxCode Then
dict(intMaxCode)=ss & Left(dict(intNext), 1)
Else
dict(intMaxCode)=ss & Left(ss, 1)
End If
intCurrent = intNext
Next
s= s & dict(intCurrent)
lzwUncompress=s
End function
Sub printvec(a)
Dim s,i,x
s="("
For i=0 To UBound (a)
s=s & x & a(i)
x=", "
Next
WScript.echo s &")"
End sub
Dim a,b
b="TOBEORNOTTOBEORTOBEORNOT"
WScript.Echo b
a=LZWCompress (b)
printvec(a)
WScript.echo lzwUncompress (a )
wscript.quit 1
| package main
import (
"fmt"
"log"
"strings"
)
func compress(uncompressed string) []int {
dictSize := 256
dictionary := make(map[string]int, dictSize)
for i := 0; i < dictSize; i++ {
dictionary[string([]byte{byte(i)})] = i
}
var result []int
var w []byte
for i := 0; i < len(uncompressed); i++ {
c := uncompressed[i]
wc := append(w, c)
if _, ok := dictionary[string(wc)]; ok {
w = wc
} else {
result = append(result, dictionary[string(w)])
dictionary[string(wc)] = dictSize
dictSize++
wc[0] = c
w = wc[:1]
}
}
if len(w) > 0 {
result = append(result, dictionary[string(w)])
}
return result
}
type BadSymbolError int
func (e BadSymbolError) Error() string {
return fmt.Sprint("Bad compressed symbol ", int(e))
}
func decompress(compressed []int) (string, error) {
dictSize := 256
dictionary := make(map[int][]byte, dictSize)
for i := 0; i < dictSize; i++ {
dictionary[i] = []byte{byte(i)}
}
var result strings.Builder
var w []byte
for _, k := range compressed {
var entry []byte
if x, ok := dictionary[k]; ok {
entry = x[:len(x):len(x)]
} else if k == dictSize && len(w) > 0 {
entry = append(w, w[0])
} else {
return result.String(), BadSymbolError(k)
}
result.Write(entry)
if len(w) > 0 {
w = append(w, entry[0])
dictionary[dictSize] = w
dictSize++
}
w = entry
}
return result.String(), nil
}
func main() {
compressed := compress("TOBEORNOTTOBEORTOBEORNOT")
fmt.Println(compressed)
decompressed, err := decompress(compressed)
if err != nil {
log.Fatal(err)
}
fmt.Println(decompressed)
}
|
Please provide an equivalent version of this VB code in Go. | Private Function ffr(n As Long) As Long
Dim R As New Collection
Dim S As New Collection
R.Add 1
S.Add 2
For i = 2 To n
R.Add R(i - 1) + S(i - 1)
For j = S(S.Count) + 1 To R(i) - 1
S.Add j
Next j
For j = R(i) + 1 To R(i) + S(i - 1)
S.Add j
Next j
Next i
ffr = R(n)
Set R = Nothing
Set S = Nothing
End Function
Private Function ffs(n As Long) As Long
Dim R As New Collection
Dim S As New Collection
R.Add 1
S.Add 2
For i = 2 To n
R.Add R(i - 1) + S(i - 1)
For j = S(S.Count) + 1 To R(i) - 1
S.Add j
Next j
For j = R(i) + 1 To R(i) + S(i - 1)
S.Add j
Next j
If S.Count >= n Then Exit For
Next i
ffs = S(n)
Set R = Nothing
Set S = Nothing
End Function
Public Sub main()
Dim i As Long
Debug.Print "The first ten values of R are:"
For i = 1 To 10
Debug.Print ffr(i);
Next i
Debug.Print
Dim x As New Collection
For i = 1 To 1000
x.Add i, CStr(i)
Next i
For i = 1 To 40
x.Remove CStr(ffr(i))
Next i
For i = 1 To 960
x.Remove CStr(ffs(i))
Next i
Debug.Print "The first 40 values of ffr plus the first 960 values of ffs "
Debug.Print "include all the integers from 1 to 1000 exactly once is "; Format(x.Count = 0)
End Sub
| package main
import "fmt"
var ffr, ffs func(int) int
func init() {
r := []int{0, 1}
s := []int{0, 2}
ffr = func(n int) int {
for len(r) <= n {
nrk := len(r) - 1
rNxt := r[nrk] + s[nrk]
r = append(r, rNxt)
for sn := r[nrk] + 2; sn < rNxt; sn++ {
s = append(s, sn)
}
s = append(s, rNxt+1)
}
return r[n]
}
ffs = func(n int) int {
for len(s) <= n {
ffr(len(r))
}
return s[n]
}
}
func main() {
for n := 1; n <= 10; n++ {
fmt.Printf("r(%d): %d\n", n, ffr(n))
}
var found [1001]int
for n := 1; n <= 40; n++ {
found[ffr(n)]++
}
for n := 1; n <= 960; n++ {
found[ffs(n)]++
}
for i := 1; i <= 1000; i++ {
if found[i] != 1 {
fmt.Println("task 4: FAIL")
return
}
}
fmt.Println("task 4: PASS")
}
|
Change the programming language of this snippet from VB to Go without modifying what it does. | Private Function ffr(n As Long) As Long
Dim R As New Collection
Dim S As New Collection
R.Add 1
S.Add 2
For i = 2 To n
R.Add R(i - 1) + S(i - 1)
For j = S(S.Count) + 1 To R(i) - 1
S.Add j
Next j
For j = R(i) + 1 To R(i) + S(i - 1)
S.Add j
Next j
Next i
ffr = R(n)
Set R = Nothing
Set S = Nothing
End Function
Private Function ffs(n As Long) As Long
Dim R As New Collection
Dim S As New Collection
R.Add 1
S.Add 2
For i = 2 To n
R.Add R(i - 1) + S(i - 1)
For j = S(S.Count) + 1 To R(i) - 1
S.Add j
Next j
For j = R(i) + 1 To R(i) + S(i - 1)
S.Add j
Next j
If S.Count >= n Then Exit For
Next i
ffs = S(n)
Set R = Nothing
Set S = Nothing
End Function
Public Sub main()
Dim i As Long
Debug.Print "The first ten values of R are:"
For i = 1 To 10
Debug.Print ffr(i);
Next i
Debug.Print
Dim x As New Collection
For i = 1 To 1000
x.Add i, CStr(i)
Next i
For i = 1 To 40
x.Remove CStr(ffr(i))
Next i
For i = 1 To 960
x.Remove CStr(ffs(i))
Next i
Debug.Print "The first 40 values of ffr plus the first 960 values of ffs "
Debug.Print "include all the integers from 1 to 1000 exactly once is "; Format(x.Count = 0)
End Sub
| package main
import "fmt"
var ffr, ffs func(int) int
func init() {
r := []int{0, 1}
s := []int{0, 2}
ffr = func(n int) int {
for len(r) <= n {
nrk := len(r) - 1
rNxt := r[nrk] + s[nrk]
r = append(r, rNxt)
for sn := r[nrk] + 2; sn < rNxt; sn++ {
s = append(s, sn)
}
s = append(s, rNxt+1)
}
return r[n]
}
ffs = func(n int) int {
for len(s) <= n {
ffr(len(r))
}
return s[n]
}
}
func main() {
for n := 1; n <= 10; n++ {
fmt.Printf("r(%d): %d\n", n, ffr(n))
}
var found [1001]int
for n := 1; n <= 40; n++ {
found[ffr(n)]++
}
for n := 1; n <= 960; n++ {
found[ffs(n)]++
}
for i := 1; i <= 1000; i++ {
if found[i] != 1 {
fmt.Println("task 4: FAIL")
return
}
}
fmt.Println("task 4: PASS")
}
|
Convert this VB block to Go, preserving its control flow and logic. | Sub magicsquare()
Const n = 9
Dim i As Integer, j As Integer, v As Integer
Debug.Print "The square order is: " & n
For i = 1 To n
For j = 1 To n
Cells(i, j) = ((i * 2 - j + n - 1) Mod n) * n + ((i * 2 + j - 2) Mod n) + 1
Next j
Next i
Debug.Print "The magic number of"; n; "x"; n; "square is:"; n * (n * n + 1) \ 2
End Sub
| package main
import (
"fmt"
"log"
)
func ms(n int) (int, []int) {
M := func(x int) int { return (x + n - 1) % n }
if n <= 0 || n&1 == 0 {
n = 5
log.Println("forcing size", n)
}
m := make([]int, n*n)
i, j := 0, n/2
for k := 1; k <= n*n; k++ {
m[i*n+j] = k
if m[M(i)*n+M(j)] != 0 {
i = (i + 1) % n
} else {
i, j = M(i), M(j)
}
}
return n, m
}
func main() {
n, m := ms(5)
i := 2
for j := 1; j <= n*n; j *= 10 {
i++
}
f := fmt.Sprintf("%%%dd", i)
for i := 0; i < n; i++ {
for j := 0; j < n; j++ {
fmt.Printf(f, m[i*n+j])
}
fmt.Println()
}
}
|
Change the following VB code into Go without altering its purpose. | Sub magicsquare()
Const n = 9
Dim i As Integer, j As Integer, v As Integer
Debug.Print "The square order is: " & n
For i = 1 To n
For j = 1 To n
Cells(i, j) = ((i * 2 - j + n - 1) Mod n) * n + ((i * 2 + j - 2) Mod n) + 1
Next j
Next i
Debug.Print "The magic number of"; n; "x"; n; "square is:"; n * (n * n + 1) \ 2
End Sub
| package main
import (
"fmt"
"log"
)
func ms(n int) (int, []int) {
M := func(x int) int { return (x + n - 1) % n }
if n <= 0 || n&1 == 0 {
n = 5
log.Println("forcing size", n)
}
m := make([]int, n*n)
i, j := 0, n/2
for k := 1; k <= n*n; k++ {
m[i*n+j] = k
if m[M(i)*n+M(j)] != 0 {
i = (i + 1) % n
} else {
i, j = M(i), M(j)
}
}
return n, m
}
func main() {
n, m := ms(5)
i := 2
for j := 1; j <= n*n; j *= 10 {
i++
}
f := fmt.Sprintf("%%%dd", i)
for i := 0; i < n; i++ {
for j := 0; j < n; j++ {
fmt.Printf(f, m[i*n+j])
}
fmt.Println()
}
}
|
Ensure the translated Go code behaves exactly like the original VB snippet. | Sub BenfordLaw()
Dim BenResult(1 To 9) As Long
BENref = "30,1%|17,6%|12,5%|9,7%|7,9%|6,7%|5,8%|5,1%|4,6%"
For Each c In Selection.Cells
If InStr(1, "-0123456789", Left(c, 1)) > 0 Then
For i = 1 To 9
If CInt(Left(Abs(c), 1)) = i Then BenResult(i) = BenResult(i) + 1: Exit For
Next
End If
Next
Total= Application.Sum(BenResult)
biggest= Len(CStr(BenResult(1)))
txt = "# | Values | Real | Expected " & vbCrLf
For i = 1 To 9
If BenResult(i) > 0 Then
txt = txt & "#" & i & " | " & vbTab
txt = txt & String((biggest - Len(CStr(BenResult(i)))) * 2, " ") & Format(BenResult(i), "0") & " | " & vbTab
txt = txt & String((Len(CStr(Format(BenResult(1) / Total, "##0.0%"))) - Len(CStr(Format(BenResult(i) / Total, "##0.0%")))) * 2, " ") & Format(BenResult(i) / Total, "##0.0%") & " | " & vbTab
txt = txt & Format(Split(BENref, "|")(i - 1), " ##0.0%") & vbCrLf
End If
Next
MsgBox txt, vbOKOnly, "Finish"
End Sub
}
| package main
import (
"fmt"
"math"
)
func Fib1000() []float64 {
a, b, r := 0., 1., [1000]float64{}
for i := range r {
r[i], a, b = b, b, b+a
}
return r[:]
}
func main() {
show(Fib1000(), "First 1000 Fibonacci numbers")
}
func show(c []float64, title string) {
var f [9]int
for _, v := range c {
f[fmt.Sprintf("%g", v)[0]-'1']++
}
fmt.Println(title)
fmt.Println("Digit Observed Predicted")
for i, n := range f {
fmt.Printf(" %d %9.3f %8.3f\n", i+1, float64(n)/float64(len(c)),
math.Log10(1+1/float64(i+1)))
}
}
|
Translate the given VB code snippet into Go without altering its behavior. | Sub BenfordLaw()
Dim BenResult(1 To 9) As Long
BENref = "30,1%|17,6%|12,5%|9,7%|7,9%|6,7%|5,8%|5,1%|4,6%"
For Each c In Selection.Cells
If InStr(1, "-0123456789", Left(c, 1)) > 0 Then
For i = 1 To 9
If CInt(Left(Abs(c), 1)) = i Then BenResult(i) = BenResult(i) + 1: Exit For
Next
End If
Next
Total= Application.Sum(BenResult)
biggest= Len(CStr(BenResult(1)))
txt = "# | Values | Real | Expected " & vbCrLf
For i = 1 To 9
If BenResult(i) > 0 Then
txt = txt & "#" & i & " | " & vbTab
txt = txt & String((biggest - Len(CStr(BenResult(i)))) * 2, " ") & Format(BenResult(i), "0") & " | " & vbTab
txt = txt & String((Len(CStr(Format(BenResult(1) / Total, "##0.0%"))) - Len(CStr(Format(BenResult(i) / Total, "##0.0%")))) * 2, " ") & Format(BenResult(i) / Total, "##0.0%") & " | " & vbTab
txt = txt & Format(Split(BENref, "|")(i - 1), " ##0.0%") & vbCrLf
End If
Next
MsgBox txt, vbOKOnly, "Finish"
End Sub
}
| package main
import (
"fmt"
"math"
)
func Fib1000() []float64 {
a, b, r := 0., 1., [1000]float64{}
for i := range r {
r[i], a, b = b, b, b+a
}
return r[:]
}
func main() {
show(Fib1000(), "First 1000 Fibonacci numbers")
}
func show(c []float64, title string) {
var f [9]int
for _, v := range c {
f[fmt.Sprintf("%g", v)[0]-'1']++
}
fmt.Println(title)
fmt.Println("Digit Observed Predicted")
for i, n := range f {
fmt.Printf(" %d %9.3f %8.3f\n", i+1, float64(n)/float64(len(c)),
math.Log10(1+1/float64(i+1)))
}
}
|
Rewrite the snippet below in Go so it works the same as the original VB code. | Sub Main()
Debug.Print F(-10)
Debug.Print F(10)
End Sub
Private Function F(N As Long) As Variant
If N < 0 Then
F = "Error. Negative argument"
ElseIf N <= 1 Then
F = N
Else
F = F(N - 1) + F(N - 2)
End If
End Function
| package main
import "fmt"
func main() {
for _, n := range []int{0, 1, 2, 3, 4, 5, 10, 40, -1} {
f, ok := arFib(n)
if ok {
fmt.Printf("fib %d = %d\n", n, f)
} else {
fmt.Println("fib undefined for negative numbers")
}
}
}
func arFib(n int) (int, bool) {
switch {
case n < 0:
return 0, false
case n < 2:
return n, true
}
return yc(func(recurse fn) fn {
return func(left, term1, term2 int) int {
if left == 0 {
return term1+term2
}
return recurse(left-1, term1+term2, term1)
}
})(n-2, 1, 0), true
}
type fn func(int, int, int) int
type ff func(fn) fn
type fx func(fx) fn
func yc(f ff) fn {
return func(x fx) fn {
return x(x)
}(func(x fx) fn {
return f(func(a1, a2, a3 int) int {
return x(x)(a1, a2, a3)
})
})
}
|
Write the same code in Go as shown below in VB. | string = "Small Basic"
TextWindow.WriteLine(Text.GetSubTextToEnd(string, 2))
TextWindow.WriteLine(Text.GetSubText(string, 1, Text.GetLength(string) - 1))
TextWindow.WriteLine(Text.GetSubText(string, 2, Text.GetLength(string) - 2))
| package main
import (
"fmt"
"unicode/utf8"
)
func main() {
s := "ASCII"
fmt.Println("String: ", s)
fmt.Println("First byte removed: ", s[1:])
fmt.Println("Last byte removed: ", s[:len(s)-1])
fmt.Println("First and last removed:", s[1:len(s)-1])
u := "Δημοτική"
fmt.Println("String: ", u)
_, sizeFirst := utf8.DecodeRuneInString(u)
fmt.Println("First rune removed: ", u[sizeFirst:])
_, sizeLast := utf8.DecodeLastRuneInString(u)
fmt.Println("Last rune removed: ", u[:len(u)-sizeLast])
fmt.Println("First and last removed:", u[sizeFirst:len(u)-sizeLast])
}
|
Write the same code in Go as shown below in VB. | string = "Small Basic"
TextWindow.WriteLine(Text.GetSubTextToEnd(string, 2))
TextWindow.WriteLine(Text.GetSubText(string, 1, Text.GetLength(string) - 1))
TextWindow.WriteLine(Text.GetSubText(string, 2, Text.GetLength(string) - 2))
| package main
import (
"fmt"
"unicode/utf8"
)
func main() {
s := "ASCII"
fmt.Println("String: ", s)
fmt.Println("First byte removed: ", s[1:])
fmt.Println("Last byte removed: ", s[:len(s)-1])
fmt.Println("First and last removed:", s[1:len(s)-1])
u := "Δημοτική"
fmt.Println("String: ", u)
_, sizeFirst := utf8.DecodeRuneInString(u)
fmt.Println("First rune removed: ", u[sizeFirst:])
_, sizeLast := utf8.DecodeLastRuneInString(u)
fmt.Println("Last rune removed: ", u[:len(u)-sizeLast])
fmt.Println("First and last removed:", u[sizeFirst:len(u)-sizeLast])
}
|
Change the programming language of this snippet from VB to Go without modifying what it does. | string = "Small Basic"
TextWindow.WriteLine(Text.GetSubTextToEnd(string, 2))
TextWindow.WriteLine(Text.GetSubText(string, 1, Text.GetLength(string) - 1))
TextWindow.WriteLine(Text.GetSubText(string, 2, Text.GetLength(string) - 2))
| package main
import (
"fmt"
"unicode/utf8"
)
func main() {
s := "ASCII"
fmt.Println("String: ", s)
fmt.Println("First byte removed: ", s[1:])
fmt.Println("Last byte removed: ", s[:len(s)-1])
fmt.Println("First and last removed:", s[1:len(s)-1])
u := "Δημοτική"
fmt.Println("String: ", u)
_, sizeFirst := utf8.DecodeRuneInString(u)
fmt.Println("First rune removed: ", u[sizeFirst:])
_, sizeLast := utf8.DecodeLastRuneInString(u)
fmt.Println("Last rune removed: ", u[:len(u)-sizeLast])
fmt.Println("First and last removed:", u[sizeFirst:len(u)-sizeLast])
}
|
Convert this VB block to Go, preserving its control flow and logic. | string = "Small Basic"
TextWindow.WriteLine(Text.GetSubTextToEnd(string, 2))
TextWindow.WriteLine(Text.GetSubText(string, 1, Text.GetLength(string) - 1))
TextWindow.WriteLine(Text.GetSubText(string, 2, Text.GetLength(string) - 2))
| package main
import (
"fmt"
"unicode/utf8"
)
func main() {
s := "ASCII"
fmt.Println("String: ", s)
fmt.Println("First byte removed: ", s[1:])
fmt.Println("Last byte removed: ", s[:len(s)-1])
fmt.Println("First and last removed:", s[1:len(s)-1])
u := "Δημοτική"
fmt.Println("String: ", u)
_, sizeFirst := utf8.DecodeRuneInString(u)
fmt.Println("First rune removed: ", u[sizeFirst:])
_, sizeLast := utf8.DecodeLastRuneInString(u)
fmt.Println("Last rune removed: ", u[:len(u)-sizeLast])
fmt.Println("First and last removed:", u[sizeFirst:len(u)-sizeLast])
}
|
Translate this program into Go but keep the logic exactly as in VB. |
Set objfso = CreateObject("Scripting.FileSystemObject")
Set objfile = objfso.OpenTextFile(objfso.GetParentFolderName(WScript.ScriptFullName) &_
"\input.txt",1)
list = ""
previous_line = ""
l = Len(previous_line)
Do Until objfile.AtEndOfStream
current_line = objfile.ReadLine
If Mid(current_line,l+1,1) <> "" Then
list = current_line & vbCrLf
previous_line = current_line
l = Len(previous_line)
ElseIf Mid(current_line,l,1) <> "" And Mid(current_line,(l+1),1) = "" Then
list = list & current_line & vbCrLf
End If
Loop
WScript.Echo list
objfile.Close
Set objfso = Nothing
| package main
import (
"bufio"
"os"
)
func main() {
in := bufio.NewReader(os.Stdin)
var blankLine = "\n"
var printLongest func(string) string
printLongest = func(candidate string) (longest string) {
longest = candidate
s, err := in.ReadString('\n')
defer func() {
recover()
defer func() {
recover()
}()
_ = blankLine[0]
func() {
defer func() {
recover()
}()
_ = s[len(longest)]
longest = s
}()
longest = printLongest(longest)
func() {
defer func() {
recover()
os.Stdout.WriteString(s)
}()
_ = longest[len(s)]
s = ""
}()
}()
_ = err.(error)
os.Stdout.WriteString(blankLine)
blankLine = ""
return
}
printLongest("")
}
|
Rewrite the snippet below in Go so it works the same as the original VB code. | Option Base 1
Public Enum sett
name_ = 1
initState
endState
blank
rules
End Enum
Public incrementer As Variant, threeStateBB As Variant, fiveStateBB As Variant
Private Sub init()
incrementer = Array("Simple incrementer", _
"q0", _
"qf", _
"B", _
Array( _
Array("q0", "1", "1", "right", "q0"), _
Array("q0", "B", "1", "stay", "qf")))
threeStateBB = Array("Three-state busy beaver", _
"a", _
"halt", _
"0", _
Array( _
Array("a", "0", "1", "right", "b"), _
Array("a", "1", "1", "left", "c"), _
Array("b", "0", "1", "left", "a"), _
Array("b", "1", "1", "right", "b"), _
Array("c", "0", "1", "left", "b"), _
Array("c", "1", "1", "stay", "halt")))
fiveStateBB = Array("Five-state busy beaver", _
"A", _
"H", _
"0", _
Array( _
Array("A", "0", "1", "right", "B"), _
Array("A", "1", "1", "left", "C"), _
Array("B", "0", "1", "right", "C"), _
Array("B", "1", "1", "right", "B"), _
Array("C", "0", "1", "right", "D"), _
Array("C", "1", "0", "left", "E"), _
Array("D", "0", "1", "left", "A"), _
Array("D", "1", "1", "left", "D"), _
Array("E", "0", "1", "stay", "H"), _
Array("E", "1", "0", "left", "A")))
End Sub
Private Sub show(state As String, headpos As Long, tape As Collection)
Debug.Print " "; state; String$(7 - Len(state), " "); "| ";
For p = 1 To tape.Count
Debug.Print IIf(p = headpos, "[" & tape(p) & "]", " " & tape(p) & " ");
Next p
Debug.Print
End Sub
Private Sub UTM(machine As Variant, tape As Collection, Optional countOnly As Long = 0)
Dim state As String: state = machine(initState)
Dim headpos As Long: headpos = 1
Dim counter As Long, rule As Variant
Debug.Print machine(name_); vbCrLf; String$(Len(machine(name_)), "=")
If Not countOnly Then Debug.Print " State | Tape [head]" & vbCrLf & "---------------------"
Do While True
If headpos > tape.Count Then
tape.Add machine(blank)
Else
If headpos < 1 Then
tape.Add machine(blank), Before:=1
headpos = 1
End If
End If
If Not countOnly Then show state, headpos, tape
For i = LBound(machine(rules)) To UBound(machine(rules))
rule = machine(rules)(i)
If rule(1) = state And rule(2) = tape(headpos) Then
tape.Remove headpos
If headpos > tape.Count Then
tape.Add rule(3)
Else
tape.Add rule(3), Before:=headpos
End If
If rule(4) = "left" Then headpos = headpos - 1
If rule(4) = "right" Then headpos = headpos + 1
state = rule(5)
Exit For
End If
Next i
counter = counter + 1
If counter Mod 100000 = 0 Then
Debug.Print counter
DoEvents
DoEvents
End If
If state = machine(endState) Then Exit Do
Loop
DoEvents
If countOnly Then
Debug.Print "Steps taken: ", counter
Else
show state, headpos, tape
Debug.Print
End If
End Sub
Public Sub main()
init
Dim tap As New Collection
tap.Add "1": tap.Add "1": tap.Add "1"
UTM incrementer, tap
Set tap = New Collection
UTM threeStateBB, tap
Set tap = New Collection
UTM fiveStateBB, tap, countOnly:=-1
End Sub
| package turing
type Symbol byte
type Motion byte
const (
Left Motion = 'L'
Right Motion = 'R'
Stay Motion = 'N'
)
type Tape struct {
data []Symbol
pos, left int
blank Symbol
}
func NewTape(blank Symbol, start int, data []Symbol) *Tape {
t := &Tape{
data: data,
blank: blank,
}
if start < 0 {
t.Left(-start)
}
t.Right(start)
return t
}
func (t *Tape) Stay() {}
func (t *Tape) Data() []Symbol { return t.data[t.left:] }
func (t *Tape) Read() Symbol { return t.data[t.pos] }
func (t *Tape) Write(s Symbol) { t.data[t.pos] = s }
func (t *Tape) Dup() *Tape {
t2 := &Tape{
data: make([]Symbol, len(t.Data())),
blank: t.blank,
}
copy(t2.data, t.Data())
t2.pos = t.pos - t.left
return t2
}
func (t *Tape) String() string {
s := ""
for i := t.left; i < len(t.data); i++ {
b := t.data[i]
if i == t.pos {
s += "[" + string(b) + "]"
} else {
s += " " + string(b) + " "
}
}
return s
}
func (t *Tape) Move(a Motion) {
switch a {
case Left:
t.Left(1)
case Right:
t.Right(1)
case Stay:
t.Stay()
}
}
const minSz = 16
func (t *Tape) Left(n int) {
t.pos -= n
if t.pos < 0 {
var sz int
for sz = minSz; cap(t.data[t.left:])-t.pos >= sz; sz <<= 1 {
}
newd := make([]Symbol, sz)
newl := len(newd) - cap(t.data[t.left:])
n := copy(newd[newl:], t.data[t.left:])
t.data = newd[:newl+n]
t.pos += newl - t.left
t.left = newl
}
if t.pos < t.left {
if t.blank != 0 {
for i := t.pos; i < t.left; i++ {
t.data[i] = t.blank
}
}
t.left = t.pos
}
}
func (t *Tape) Right(n int) {
t.pos += n
if t.pos >= cap(t.data) {
var sz int
for sz = minSz; t.pos >= sz; sz <<= 1 {
}
newd := make([]Symbol, sz)
n := copy(newd[t.left:], t.data[t.left:])
t.data = newd[:t.left+n]
}
if i := len(t.data); t.pos >= i {
t.data = t.data[:t.pos+1]
if t.blank != 0 {
for ; i < len(t.data); i++ {
t.data[i] = t.blank
}
}
}
}
type State string
type Rule struct {
State
Symbol
Write Symbol
Motion
Next State
}
func (i *Rule) key() key { return key{i.State, i.Symbol} }
func (i *Rule) action() action { return action{i.Write, i.Motion, i.Next} }
type key struct {
State
Symbol
}
type action struct {
write Symbol
Motion
next State
}
type Machine struct {
tape *Tape
start, state State
transition map[key]action
l func(string, ...interface{})
}
func NewMachine(rules []Rule) *Machine {
m := &Machine{transition: make(map[key]action, len(rules))}
if len(rules) > 0 {
m.start = rules[0].State
}
for _, r := range rules {
m.transition[r.key()] = r.action()
}
return m
}
func (m *Machine) Run(input *Tape) (int, *Tape) {
m.tape = input.Dup()
m.state = m.start
for cnt := 0; ; cnt++ {
if m.l != nil {
m.l("%3d %4s: %v\n", cnt, m.state, m.tape)
}
sym := m.tape.Read()
act, ok := m.transition[key{m.state, sym}]
if !ok {
return cnt, m.tape
}
m.tape.Write(act.write)
m.tape.Move(act.Motion)
m.state = act.next
}
}
|
Generate a Go translation of this VB snippet without changing its computational steps. | Option Base 1
Public Enum sett
name_ = 1
initState
endState
blank
rules
End Enum
Public incrementer As Variant, threeStateBB As Variant, fiveStateBB As Variant
Private Sub init()
incrementer = Array("Simple incrementer", _
"q0", _
"qf", _
"B", _
Array( _
Array("q0", "1", "1", "right", "q0"), _
Array("q0", "B", "1", "stay", "qf")))
threeStateBB = Array("Three-state busy beaver", _
"a", _
"halt", _
"0", _
Array( _
Array("a", "0", "1", "right", "b"), _
Array("a", "1", "1", "left", "c"), _
Array("b", "0", "1", "left", "a"), _
Array("b", "1", "1", "right", "b"), _
Array("c", "0", "1", "left", "b"), _
Array("c", "1", "1", "stay", "halt")))
fiveStateBB = Array("Five-state busy beaver", _
"A", _
"H", _
"0", _
Array( _
Array("A", "0", "1", "right", "B"), _
Array("A", "1", "1", "left", "C"), _
Array("B", "0", "1", "right", "C"), _
Array("B", "1", "1", "right", "B"), _
Array("C", "0", "1", "right", "D"), _
Array("C", "1", "0", "left", "E"), _
Array("D", "0", "1", "left", "A"), _
Array("D", "1", "1", "left", "D"), _
Array("E", "0", "1", "stay", "H"), _
Array("E", "1", "0", "left", "A")))
End Sub
Private Sub show(state As String, headpos As Long, tape As Collection)
Debug.Print " "; state; String$(7 - Len(state), " "); "| ";
For p = 1 To tape.Count
Debug.Print IIf(p = headpos, "[" & tape(p) & "]", " " & tape(p) & " ");
Next p
Debug.Print
End Sub
Private Sub UTM(machine As Variant, tape As Collection, Optional countOnly As Long = 0)
Dim state As String: state = machine(initState)
Dim headpos As Long: headpos = 1
Dim counter As Long, rule As Variant
Debug.Print machine(name_); vbCrLf; String$(Len(machine(name_)), "=")
If Not countOnly Then Debug.Print " State | Tape [head]" & vbCrLf & "---------------------"
Do While True
If headpos > tape.Count Then
tape.Add machine(blank)
Else
If headpos < 1 Then
tape.Add machine(blank), Before:=1
headpos = 1
End If
End If
If Not countOnly Then show state, headpos, tape
For i = LBound(machine(rules)) To UBound(machine(rules))
rule = machine(rules)(i)
If rule(1) = state And rule(2) = tape(headpos) Then
tape.Remove headpos
If headpos > tape.Count Then
tape.Add rule(3)
Else
tape.Add rule(3), Before:=headpos
End If
If rule(4) = "left" Then headpos = headpos - 1
If rule(4) = "right" Then headpos = headpos + 1
state = rule(5)
Exit For
End If
Next i
counter = counter + 1
If counter Mod 100000 = 0 Then
Debug.Print counter
DoEvents
DoEvents
End If
If state = machine(endState) Then Exit Do
Loop
DoEvents
If countOnly Then
Debug.Print "Steps taken: ", counter
Else
show state, headpos, tape
Debug.Print
End If
End Sub
Public Sub main()
init
Dim tap As New Collection
tap.Add "1": tap.Add "1": tap.Add "1"
UTM incrementer, tap
Set tap = New Collection
UTM threeStateBB, tap
Set tap = New Collection
UTM fiveStateBB, tap, countOnly:=-1
End Sub
| package turing
type Symbol byte
type Motion byte
const (
Left Motion = 'L'
Right Motion = 'R'
Stay Motion = 'N'
)
type Tape struct {
data []Symbol
pos, left int
blank Symbol
}
func NewTape(blank Symbol, start int, data []Symbol) *Tape {
t := &Tape{
data: data,
blank: blank,
}
if start < 0 {
t.Left(-start)
}
t.Right(start)
return t
}
func (t *Tape) Stay() {}
func (t *Tape) Data() []Symbol { return t.data[t.left:] }
func (t *Tape) Read() Symbol { return t.data[t.pos] }
func (t *Tape) Write(s Symbol) { t.data[t.pos] = s }
func (t *Tape) Dup() *Tape {
t2 := &Tape{
data: make([]Symbol, len(t.Data())),
blank: t.blank,
}
copy(t2.data, t.Data())
t2.pos = t.pos - t.left
return t2
}
func (t *Tape) String() string {
s := ""
for i := t.left; i < len(t.data); i++ {
b := t.data[i]
if i == t.pos {
s += "[" + string(b) + "]"
} else {
s += " " + string(b) + " "
}
}
return s
}
func (t *Tape) Move(a Motion) {
switch a {
case Left:
t.Left(1)
case Right:
t.Right(1)
case Stay:
t.Stay()
}
}
const minSz = 16
func (t *Tape) Left(n int) {
t.pos -= n
if t.pos < 0 {
var sz int
for sz = minSz; cap(t.data[t.left:])-t.pos >= sz; sz <<= 1 {
}
newd := make([]Symbol, sz)
newl := len(newd) - cap(t.data[t.left:])
n := copy(newd[newl:], t.data[t.left:])
t.data = newd[:newl+n]
t.pos += newl - t.left
t.left = newl
}
if t.pos < t.left {
if t.blank != 0 {
for i := t.pos; i < t.left; i++ {
t.data[i] = t.blank
}
}
t.left = t.pos
}
}
func (t *Tape) Right(n int) {
t.pos += n
if t.pos >= cap(t.data) {
var sz int
for sz = minSz; t.pos >= sz; sz <<= 1 {
}
newd := make([]Symbol, sz)
n := copy(newd[t.left:], t.data[t.left:])
t.data = newd[:t.left+n]
}
if i := len(t.data); t.pos >= i {
t.data = t.data[:t.pos+1]
if t.blank != 0 {
for ; i < len(t.data); i++ {
t.data[i] = t.blank
}
}
}
}
type State string
type Rule struct {
State
Symbol
Write Symbol
Motion
Next State
}
func (i *Rule) key() key { return key{i.State, i.Symbol} }
func (i *Rule) action() action { return action{i.Write, i.Motion, i.Next} }
type key struct {
State
Symbol
}
type action struct {
write Symbol
Motion
next State
}
type Machine struct {
tape *Tape
start, state State
transition map[key]action
l func(string, ...interface{})
}
func NewMachine(rules []Rule) *Machine {
m := &Machine{transition: make(map[key]action, len(rules))}
if len(rules) > 0 {
m.start = rules[0].State
}
for _, r := range rules {
m.transition[r.key()] = r.action()
}
return m
}
func (m *Machine) Run(input *Tape) (int, *Tape) {
m.tape = input.Dup()
m.state = m.start
for cnt := 0; ; cnt++ {
if m.l != nil {
m.l("%3d %4s: %v\n", cnt, m.state, m.tape)
}
sym := m.tape.Read()
act, ok := m.transition[key{m.state, sym}]
if !ok {
return cnt, m.tape
}
m.tape.Write(act.write)
m.tape.Move(act.Motion)
m.state = act.next
}
}
|
Maintain the same structure and functionality when rewriting this code in Go. | Public Sub create_file()
Dim FileNumber As Integer
FileNumber = FreeFile
MkDir "docs"
Open "docs\output.txt" For Output As #FreeFile
Close #FreeFile
MkDir "C:\docs"
Open "C:\docs\output.txt" For Output As #FreeFile
Close #FreeFile
End Sub
| package main
import (
"fmt"
"os"
)
func createFile(fn string) {
f, err := os.Create(fn)
if err != nil {
fmt.Println(err)
return
}
fmt.Println("file", fn, "created!")
f.Close()
}
func createDir(dn string) {
err := os.Mkdir(dn, 0666)
if err != nil {
fmt.Println(err)
return
}
fmt.Println("directory", dn, "created!")
}
func main() {
createFile("input.txt")
createFile("/input.txt")
createDir("docs")
createDir("/docs")
}
|
Write the same algorithm in Go as shown in this VB implementation. | Public Sub create_file()
Dim FileNumber As Integer
FileNumber = FreeFile
MkDir "docs"
Open "docs\output.txt" For Output As #FreeFile
Close #FreeFile
MkDir "C:\docs"
Open "C:\docs\output.txt" For Output As #FreeFile
Close #FreeFile
End Sub
| package main
import (
"fmt"
"os"
)
func createFile(fn string) {
f, err := os.Create(fn)
if err != nil {
fmt.Println(err)
return
}
fmt.Println("file", fn, "created!")
f.Close()
}
func createDir(dn string) {
err := os.Mkdir(dn, 0666)
if err != nil {
fmt.Println(err)
return
}
fmt.Println("directory", dn, "created!")
}
func main() {
createFile("input.txt")
createFile("/input.txt")
createDir("docs")
createDir("/docs")
}
|
Preserve the algorithm and functionality while converting the code from VB to Go. | b=_
"CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATG" &_
"CTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTG" &_
"AGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGAT" &_
"GGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT" &_
"CGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGG" &_
"TCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA" &_
"TTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTAT" &_
"CGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTG" &_
"TCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGAC" &_
"GACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT"
s="SEQUENCE:"
acnt=0:ccnt=0:gcnt=0:tcnt=0
for i=0 to len(b)-1
if (i mod 30)=0 then s = s & vbcrlf & right(" "& i+1,3)&": "
if (i mod 5)=0 then s=s& " "
m=mid(b,i+1,1)
s=s & m
select case m
case "A":acnt=acnt+1
case "C":ccnt=ccnt+1
case "G":gcnt=gcnt+1
case "T":tcnt=tcnt+1
case else
wscript.echo "error at ",i+1, m
end select
next
wscript.echo s & vbcrlf
wscript.echo "Count: A="&acnt & " C=" & ccnt & " G=" & gcnt & " T=" & tcnt
| package main
import (
"fmt"
"sort"
)
func main() {
dna := "" +
"CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATG" +
"CTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTG" +
"AGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGAT" +
"GGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT" +
"CGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGG" +
"TCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA" +
"TTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTAT" +
"CGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTG" +
"TCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGAC" +
"GACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT"
fmt.Println("SEQUENCE:")
le := len(dna)
for i := 0; i < le; i += 50 {
k := i + 50
if k > le {
k = le
}
fmt.Printf("%5d: %s\n", i, dna[i:k])
}
baseMap := make(map[byte]int)
for i := 0; i < le; i++ {
baseMap[dna[i]]++
}
var bases []byte
for k := range baseMap {
bases = append(bases, k)
}
sort.Slice(bases, func(i, j int) bool {
return bases[i] < bases[j]
})
fmt.Println("\nBASE COUNT:")
for _, base := range bases {
fmt.Printf(" %c: %3d\n", base, baseMap[base])
}
fmt.Println(" ------")
fmt.Println(" Σ:", le)
fmt.Println(" ======")
}
|
Can you help me rewrite this code in Go instead of VB, keeping it the same logically? | b=_
"CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATG" &_
"CTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTG" &_
"AGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGAT" &_
"GGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT" &_
"CGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGG" &_
"TCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA" &_
"TTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTAT" &_
"CGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTG" &_
"TCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGAC" &_
"GACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT"
s="SEQUENCE:"
acnt=0:ccnt=0:gcnt=0:tcnt=0
for i=0 to len(b)-1
if (i mod 30)=0 then s = s & vbcrlf & right(" "& i+1,3)&": "
if (i mod 5)=0 then s=s& " "
m=mid(b,i+1,1)
s=s & m
select case m
case "A":acnt=acnt+1
case "C":ccnt=ccnt+1
case "G":gcnt=gcnt+1
case "T":tcnt=tcnt+1
case else
wscript.echo "error at ",i+1, m
end select
next
wscript.echo s & vbcrlf
wscript.echo "Count: A="&acnt & " C=" & ccnt & " G=" & gcnt & " T=" & tcnt
| package main
import (
"fmt"
"sort"
)
func main() {
dna := "" +
"CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATG" +
"CTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTG" +
"AGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGAT" +
"GGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT" +
"CGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGG" +
"TCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA" +
"TTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTAT" +
"CGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTG" +
"TCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGAC" +
"GACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT"
fmt.Println("SEQUENCE:")
le := len(dna)
for i := 0; i < le; i += 50 {
k := i + 50
if k > le {
k = le
}
fmt.Printf("%5d: %s\n", i, dna[i:k])
}
baseMap := make(map[byte]int)
for i := 0; i < le; i++ {
baseMap[dna[i]]++
}
var bases []byte
for k := range baseMap {
bases = append(bases, k)
}
sort.Slice(bases, func(i, j int) bool {
return bases[i] < bases[j]
})
fmt.Println("\nBASE COUNT:")
for _, base := range bases {
fmt.Printf(" %c: %3d\n", base, baseMap[base])
}
fmt.Println(" ------")
fmt.Println(" Σ:", le)
fmt.Println(" ======")
}
|
Keep all operations the same but rewrite the snippet in Go. |
Public Const HOLDON = False
Public Const DIJKSTRASOLUTION = True
Public Const X = 10
Public Const GETS = 0
Public Const PUTS = 1
Public Const EATS = 2
Public Const THKS = 5
Public Const FRSTFORK = 0
Public Const SCNDFORK = 1
Public Const SPAGHETI = 0
Public Const UNIVERSE = 1
Public Const MAXCOUNT = 100000
Public Const PHILOSOPHERS = 5
Public semaphore(PHILOSOPHERS - 1) As Integer
Public positi0n(1, PHILOSOPHERS - 1) As Integer
Public programcounter(PHILOSOPHERS - 1) As Long
Public statistics(PHILOSOPHERS - 1, 5, 1) As Long
Public names As Variant
Private Sub init()
names = [{"Aquinas","Babbage","Carroll","Derrida","Erasmus"}]
For j = 0 To PHILOSOPHERS - 2
positi0n(0, j) = j + 1
positi0n(1, j) = j
Next j
If DIJKSTRASOLUTION Then
positi0n(0, PHILOSOPHERS - 1) = j
positi0n(1, PHILOSOPHERS - 1) = 0
Else
positi0n(0, PHILOSOPHERS - 1) = 0
positi0n(1, PHILOSOPHERS - 1) = j
End If
End Sub
Private Sub philosopher(subject As Integer, verb As Integer, objekt As Integer)
statistics(subject, verb, objekt) = statistics(subject, verb, objekt) + 1
If verb < 2 Then
If semaphore(positi0n(objekt, subject)) <> verb Then
If Not HOLDON Then
semaphore(positi0n(FRSTFORK, subject)) = 1 - objekt
programcounter(subject) = 0
End If
Else
semaphore(positi0n(objekt, subject)) = 1 - verb
programcounter(subject) = (programcounter(subject) + 1) Mod 6
End If
Else
programcounter(subject) = IIf(X * Rnd > 1, verb, verb + 1) Mod 6
End If
End Sub
Private Sub dine()
Dim ph As Integer
Do While TC < MAXCOUNT
For ph = 0 To PHILOSOPHERS - 1
Select Case programcounter(ph)
Case 0: philosopher ph, GETS, FRSTFORK
Case 1: philosopher ph, GETS, SCNDFORK
Case 2: philosopher ph, EATS, SPAGHETI
Case 3: philosopher ph, PUTS, FRSTFORK
Case 4: philosopher ph, PUTS, SCNDFORK
Case 5: philosopher ph, THKS, UNIVERSE
End Select
TC = TC + 1
Next ph
Loop
End Sub
Private Sub show()
Debug.Print "Stats", "Gets", "Gets", "Eats", "Puts", "Puts", "Thinks"
Debug.Print "", "First", "Second", "Spag-", "First", "Second", "About"
Debug.Print "", "Fork", "Fork", "hetti", "Fork", "Fork", "Universe"
For subject = 0 To PHILOSOPHERS - 1
Debug.Print names(subject + 1),
For objekt = 0 To 1
Debug.Print statistics(subject, GETS, objekt),
Next objekt
Debug.Print statistics(subject, EATS, SPAGHETI),
For objekt = 0 To 1
Debug.Print statistics(subject, PUTS, objekt),
Next objekt
Debug.Print statistics(subject, THKS, UNIVERSE)
Next subject
End Sub
Public Sub main()
init
dine
show
End Sub
| package main
import (
"hash/fnv"
"log"
"math/rand"
"os"
"time"
)
var ph = []string{"Aristotle", "Kant", "Spinoza", "Marx", "Russell"}
const hunger = 3
const think = time.Second / 100
const eat = time.Second / 100
var fmt = log.New(os.Stdout, "", 0)
var done = make(chan bool)
type fork byte
func philosopher(phName string,
dominantHand, otherHand chan fork, done chan bool) {
fmt.Println(phName, "seated")
h := fnv.New64a()
h.Write([]byte(phName))
rg := rand.New(rand.NewSource(int64(h.Sum64())))
rSleep := func(t time.Duration) {
time.Sleep(t/2 + time.Duration(rg.Int63n(int64(t))))
}
for h := hunger; h > 0; h-- {
fmt.Println(phName, "hungry")
<-dominantHand
<-otherHand
fmt.Println(phName, "eating")
rSleep(eat)
dominantHand <- 'f'
otherHand <- 'f'
fmt.Println(phName, "thinking")
rSleep(think)
}
fmt.Println(phName, "satisfied")
done <- true
fmt.Println(phName, "left the table")
}
func main() {
fmt.Println("table empty")
place0 := make(chan fork, 1)
place0 <- 'f'
placeLeft := place0
for i := 1; i < len(ph); i++ {
placeRight := make(chan fork, 1)
placeRight <- 'f'
go philosopher(ph[i], placeLeft, placeRight, done)
placeLeft = placeRight
}
go philosopher(ph[0], place0, placeLeft, done)
for range ph {
<-done
}
fmt.Println("table empty")
}
|
Translate this program into Go but keep the logic exactly as in VB. |
Dim fact()
nn1=9 : nn2=12
lim=1499999
ReDim fact(nn2)
fact(0)=1
For i=1 To nn2
fact(i)=fact(i-1)*i
Next
For base=nn1 To nn2
list=""
For i=1 To lim
s=0
t=i
Do While t<>0
d=t Mod base
s=s+fact(d)
t=t\base
Loop
If s=i Then list=list &" "& i
Next
Wscript.Echo "the factorions for base "& right(" "& base,2) &" are: "& list
Next
| package main
import (
"fmt"
"strconv"
)
func main() {
var fact [12]uint64
fact[0] = 1
for n := uint64(1); n < 12; n++ {
fact[n] = fact[n-1] * n
}
for b := 9; b <= 12; b++ {
fmt.Printf("The factorions for base %d are:\n", b)
for i := uint64(1); i < 1500000; i++ {
digits := strconv.FormatUint(i, b)
sum := uint64(0)
for _, digit := range digits {
if digit < 'a' {
sum += fact[digit-'0']
} else {
sum += fact[digit+10-'a']
}
}
if sum == i {
fmt.Printf("%d ", i)
}
}
fmt.Println("\n")
}
}
|
Translate this program into Go but keep the logic exactly as in VB. |
Dim fact()
nn1=9 : nn2=12
lim=1499999
ReDim fact(nn2)
fact(0)=1
For i=1 To nn2
fact(i)=fact(i-1)*i
Next
For base=nn1 To nn2
list=""
For i=1 To lim
s=0
t=i
Do While t<>0
d=t Mod base
s=s+fact(d)
t=t\base
Loop
If s=i Then list=list &" "& i
Next
Wscript.Echo "the factorions for base "& right(" "& base,2) &" are: "& list
Next
| package main
import (
"fmt"
"strconv"
)
func main() {
var fact [12]uint64
fact[0] = 1
for n := uint64(1); n < 12; n++ {
fact[n] = fact[n-1] * n
}
for b := 9; b <= 12; b++ {
fmt.Printf("The factorions for base %d are:\n", b)
for i := uint64(1); i < 1500000; i++ {
digits := strconv.FormatUint(i, b)
sum := uint64(0)
for _, digit := range digits {
if digit < 'a' {
sum += fact[digit-'0']
} else {
sum += fact[digit+10-'a']
}
}
if sum == i {
fmt.Printf("%d ", i)
}
}
fmt.Println("\n")
}
}
|
Keep all operations the same but rewrite the snippet in Go. | Private Function ValidateUserWords(userstring As String) As String
Dim s As String
Dim user_words() As String
Dim command_table As Scripting.Dictionary
Set command_table = New Scripting.Dictionary
Dim abbreviations As Scripting.Dictionary
Set abbreviations = New Scripting.Dictionary
abbreviations.CompareMode = TextCompare
Dim commandtable() As String
Dim commands As String
s = s & "Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy "
s = s & "COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find "
s = s & "NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput "
s = s & "Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO "
s = s & "MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT "
s = s & "READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT "
s = s & "RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up "
commandtable = Split(s, " ")
Dim i As Integer
For Each word In commandtable
If Len(word) > 0 Then
i = 1
Do While Mid(word, i, 1) >= "A" And Mid(word, i, 1) <= "Z"
i = i + 1
Loop
command_table.Add Key:=word, Item:=i - 1
End If
Next word
For Each word In command_table
For i = command_table(word) To Len(word)
On Error Resume Next
abbreviations.Add Key:=Left(word, i), Item:=UCase(word)
Next i
Next word
user_words() = Split(userstring, " ")
For Each word In user_words
If Len(word) > 0 Then
If abbreviations.exists(word) Then
commands = commands & abbreviations(word) & " "
Else
commands = commands & "*error* "
End If
End If
Next word
ValidateUserWords = commands
End Function
Public Sub program()
Dim guserstring As String
guserstring = "riG rePEAT copies put mo rest types fup. 6 poweRin"
Debug.Print "user words:", guserstring
Debug.Print "full words:", ValidateUserWords(guserstring)
End Sub
| package main
import (
"fmt"
"strings"
)
var table =
"Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy " +
"COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find " +
"NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput " +
"Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO " +
"MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT " +
"READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT " +
"RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up "
func validate(commands, words []string, minLens []int) []string {
results := make([]string, 0)
if len(words) == 0 {
return results
}
for _, word := range words {
matchFound := false
wlen := len(word)
for i, command := range commands {
if minLens[i] == 0 || wlen < minLens[i] || wlen > len(command) {
continue
}
c := strings.ToUpper(command)
w := strings.ToUpper(word)
if strings.HasPrefix(c, w) {
results = append(results, c)
matchFound = true
break
}
}
if !matchFound {
results = append(results, "*error*")
}
}
return results
}
func main() {
table = strings.TrimSpace(table)
commands := strings.Fields(table)
clen := len(commands)
minLens := make([]int, clen)
for i := 0; i < clen; i++ {
count := 0
for _, c := range commands[i] {
if c >= 'A' && c <= 'Z' {
count++
}
}
minLens[i] = count
}
sentence := "riG rePEAT copies put mo rest types fup. 6 poweRin"
words := strings.Fields(sentence)
results := validate(commands, words, minLens)
fmt.Print("user words: ")
for j := 0; j < len(words); j++ {
fmt.Printf("%-*s ", len(results[j]), words[j])
}
fmt.Print("\nfull words: ")
fmt.Println(strings.Join(results, " "))
}
|
Ensure the translated Go code behaves exactly like the original VB snippet. | Private Function ValidateUserWords(userstring As String) As String
Dim s As String
Dim user_words() As String
Dim command_table As Scripting.Dictionary
Set command_table = New Scripting.Dictionary
Dim abbreviations As Scripting.Dictionary
Set abbreviations = New Scripting.Dictionary
abbreviations.CompareMode = TextCompare
Dim commandtable() As String
Dim commands As String
s = s & "Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy "
s = s & "COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find "
s = s & "NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput "
s = s & "Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO "
s = s & "MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT "
s = s & "READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT "
s = s & "RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up "
commandtable = Split(s, " ")
Dim i As Integer
For Each word In commandtable
If Len(word) > 0 Then
i = 1
Do While Mid(word, i, 1) >= "A" And Mid(word, i, 1) <= "Z"
i = i + 1
Loop
command_table.Add Key:=word, Item:=i - 1
End If
Next word
For Each word In command_table
For i = command_table(word) To Len(word)
On Error Resume Next
abbreviations.Add Key:=Left(word, i), Item:=UCase(word)
Next i
Next word
user_words() = Split(userstring, " ")
For Each word In user_words
If Len(word) > 0 Then
If abbreviations.exists(word) Then
commands = commands & abbreviations(word) & " "
Else
commands = commands & "*error* "
End If
End If
Next word
ValidateUserWords = commands
End Function
Public Sub program()
Dim guserstring As String
guserstring = "riG rePEAT copies put mo rest types fup. 6 poweRin"
Debug.Print "user words:", guserstring
Debug.Print "full words:", ValidateUserWords(guserstring)
End Sub
| package main
import (
"fmt"
"strings"
)
var table =
"Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy " +
"COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find " +
"NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput " +
"Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO " +
"MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT " +
"READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT " +
"RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up "
func validate(commands, words []string, minLens []int) []string {
results := make([]string, 0)
if len(words) == 0 {
return results
}
for _, word := range words {
matchFound := false
wlen := len(word)
for i, command := range commands {
if minLens[i] == 0 || wlen < minLens[i] || wlen > len(command) {
continue
}
c := strings.ToUpper(command)
w := strings.ToUpper(word)
if strings.HasPrefix(c, w) {
results = append(results, c)
matchFound = true
break
}
}
if !matchFound {
results = append(results, "*error*")
}
}
return results
}
func main() {
table = strings.TrimSpace(table)
commands := strings.Fields(table)
clen := len(commands)
minLens := make([]int, clen)
for i := 0; i < clen; i++ {
count := 0
for _, c := range commands[i] {
if c >= 'A' && c <= 'Z' {
count++
}
}
minLens[i] = count
}
sentence := "riG rePEAT copies put mo rest types fup. 6 poweRin"
words := strings.Fields(sentence)
results := validate(commands, words, minLens)
fmt.Print("user words: ")
for j := 0; j < len(words); j++ {
fmt.Printf("%-*s ", len(results[j]), words[j])
}
fmt.Print("\nfull words: ")
fmt.Println(strings.Join(results, " "))
}
|
Port the following code from VB to Go with equivalent syntax and logic. | Imports System.Text
Module Module1
ReadOnly CODES As New Dictionary(Of Char, String) From {
{"a", "AAAAA"}, {"b", "AAAAB"}, {"c", "AAABA"}, {"d", "AAABB"}, {"e", "AABAA"},
{"f", "AABAB"}, {"g", "AABBA"}, {"h", "AABBB"}, {"i", "ABAAA"}, {"j", "ABAAB"},
{"k", "ABABA"}, {"l", "ABABB"}, {"m", "ABBAA"}, {"n", "ABBAB"}, {"o", "ABBBA"},
{"p", "ABBBB"}, {"q", "BAAAA"}, {"r", "BAAAB"}, {"s", "BAABA"}, {"t", "BAABB"},
{"u", "BABAA"}, {"v", "BABAB"}, {"w", "BABBA"}, {"x", "BABBB"}, {"y", "BBAAA"},
{"z", "BBAAB"}, {" ", "BBBAA"}
}
Function Encode(plainText As String, message As String) As String
Dim pt = plainText.ToLower()
Dim sb As New StringBuilder()
For Each c In pt
If "a" <= c AndAlso c <= "z" Then
sb.Append(CODES(c))
Else
sb.Append(CODES(" "))
End If
Next
Dim et = sb.ToString()
Dim mg = message.ToLower()
sb.Length = 0
Dim count = 0
For Each c In mg
If "a" <= c AndAlso c <= "z" Then
If et(count) = "A" Then
sb.Append(c)
Else
sb.Append(Chr(Asc(c) - 32))
End If
count += 1
If count = et.Length Then
Exit For
End If
Else
sb.Append(c)
End If
Next
Return sb.ToString()
End Function
Function Decode(message As String) As String
Dim sb As New StringBuilder
For Each c In message
If "a" <= c AndAlso c <= "z" Then
sb.Append("A")
ElseIf "A" <= c AndAlso c <= "Z" Then
sb.Append("B")
End If
Next
Dim et = sb.ToString()
sb.Length = 0
For index = 0 To et.Length - 1 Step 5
Dim quintet = et.Substring(index, 5)
Dim key = CODES.Where(Function(a) a.Value = quintet).First().Key
sb.Append(key)
Next
Return sb.ToString()
End Function
Sub Main()
Dim plainText = "the quick brown fox jumps over the lazy dog"
Dim message =
"bacon
"this task is to implement a program for encryption and decryption of " +
"plaintext using the simple alphabet of the baconian cipher or some " +
"other kind of representation of this alphabet (make anything signify anything). " +
"the baconian alphabet may optionally be extended to encode all lower " +
"case characters individually and/or adding a few punctuation characters " +
"such as the space."
Dim cipherText = Encode(plainText, message)
Console.WriteLine("Cipher text ->" & Environment.NewLine & "{0}", cipherText)
Dim decodedText = Decode(cipherText)
Console.WriteLine(Environment.NewLine & "Hidden text ->" & Environment.NewLine & "{0}", decodedText)
End Sub
End Module
| package main
import(
"fmt"
"strings"
)
var codes = map[rune]string {
'a' : "AAAAA", 'b' : "AAAAB", 'c' : "AAABA", 'd' : "AAABB", 'e' : "AABAA",
'f' : "AABAB", 'g' : "AABBA", 'h' : "AABBB", 'i' : "ABAAA", 'j' : "ABAAB",
'k' : "ABABA", 'l' : "ABABB", 'm' : "ABBAA", 'n' : "ABBAB", 'o' : "ABBBA",
'p' : "ABBBB", 'q' : "BAAAA", 'r' : "BAAAB", 's' : "BAABA", 't' : "BAABB",
'u' : "BABAA", 'v' : "BABAB", 'w' : "BABBA", 'x' : "BABBB", 'y' : "BBAAA",
'z' : "BBAAB", ' ' : "BBBAA",
}
func baconEncode(plainText string, message string) string {
pt := strings.ToLower(plainText)
var sb []byte
for _, c := range pt {
if c >= 'a' && c <= 'z' {
sb = append(sb, codes[c]...)
} else {
sb = append(sb, codes[' ']...)
}
}
et := string(sb)
mg := strings.ToLower(message)
sb = nil
var count = 0
for _, c := range mg {
if c >= 'a' && c <= 'z' {
if et[count] == 'A' {
sb = append(sb, byte(c))
} else {
sb = append(sb, byte(c - 32))
}
count++
if count == len(et) { break }
} else {
sb = append(sb, byte(c))
}
}
return string(sb)
}
func baconDecode(message string) string {
var sb []byte
for _, c := range message {
if c >= 'a' && c <= 'z' {
sb = append(sb, 'A')
} else if c >= 'A' && c <= 'Z' {
sb = append(sb, 'B')
}
}
et := string(sb)
sb = nil
for i := 0; i < len(et); i += 5 {
quintet := et[i : i + 5]
for k, v := range codes {
if v == quintet {
sb = append(sb, byte(k))
break
}
}
}
return string(sb)
}
func main() {
plainText := "the quick brown fox jumps over the lazy dog"
message := "bacon's cipher is a method of steganography created by francis bacon." +
"this task is to implement a program for encryption and decryption of " +
"plaintext using the simple alphabet of the baconian cipher or some " +
"other kind of representation of this alphabet (make anything signify anything). " +
"the baconian alphabet may optionally be extended to encode all lower " +
"case characters individually and/or adding a few punctuation characters " +
"such as the space."
cipherText := baconEncode(plainText, message)
fmt.Printf("Cipher text ->\n\n%s\n", cipherText)
decodedText := baconDecode(cipherText)
fmt.Printf("\nHidden text ->\n\n%s\n", decodedText)
}
|
Preserve the algorithm and functionality while converting the code from VB to Go. | Imports System.Text
Module Module1
ReadOnly CODES As New Dictionary(Of Char, String) From {
{"a", "AAAAA"}, {"b", "AAAAB"}, {"c", "AAABA"}, {"d", "AAABB"}, {"e", "AABAA"},
{"f", "AABAB"}, {"g", "AABBA"}, {"h", "AABBB"}, {"i", "ABAAA"}, {"j", "ABAAB"},
{"k", "ABABA"}, {"l", "ABABB"}, {"m", "ABBAA"}, {"n", "ABBAB"}, {"o", "ABBBA"},
{"p", "ABBBB"}, {"q", "BAAAA"}, {"r", "BAAAB"}, {"s", "BAABA"}, {"t", "BAABB"},
{"u", "BABAA"}, {"v", "BABAB"}, {"w", "BABBA"}, {"x", "BABBB"}, {"y", "BBAAA"},
{"z", "BBAAB"}, {" ", "BBBAA"}
}
Function Encode(plainText As String, message As String) As String
Dim pt = plainText.ToLower()
Dim sb As New StringBuilder()
For Each c In pt
If "a" <= c AndAlso c <= "z" Then
sb.Append(CODES(c))
Else
sb.Append(CODES(" "))
End If
Next
Dim et = sb.ToString()
Dim mg = message.ToLower()
sb.Length = 0
Dim count = 0
For Each c In mg
If "a" <= c AndAlso c <= "z" Then
If et(count) = "A" Then
sb.Append(c)
Else
sb.Append(Chr(Asc(c) - 32))
End If
count += 1
If count = et.Length Then
Exit For
End If
Else
sb.Append(c)
End If
Next
Return sb.ToString()
End Function
Function Decode(message As String) As String
Dim sb As New StringBuilder
For Each c In message
If "a" <= c AndAlso c <= "z" Then
sb.Append("A")
ElseIf "A" <= c AndAlso c <= "Z" Then
sb.Append("B")
End If
Next
Dim et = sb.ToString()
sb.Length = 0
For index = 0 To et.Length - 1 Step 5
Dim quintet = et.Substring(index, 5)
Dim key = CODES.Where(Function(a) a.Value = quintet).First().Key
sb.Append(key)
Next
Return sb.ToString()
End Function
Sub Main()
Dim plainText = "the quick brown fox jumps over the lazy dog"
Dim message =
"bacon
"this task is to implement a program for encryption and decryption of " +
"plaintext using the simple alphabet of the baconian cipher or some " +
"other kind of representation of this alphabet (make anything signify anything). " +
"the baconian alphabet may optionally be extended to encode all lower " +
"case characters individually and/or adding a few punctuation characters " +
"such as the space."
Dim cipherText = Encode(plainText, message)
Console.WriteLine("Cipher text ->" & Environment.NewLine & "{0}", cipherText)
Dim decodedText = Decode(cipherText)
Console.WriteLine(Environment.NewLine & "Hidden text ->" & Environment.NewLine & "{0}", decodedText)
End Sub
End Module
| package main
import(
"fmt"
"strings"
)
var codes = map[rune]string {
'a' : "AAAAA", 'b' : "AAAAB", 'c' : "AAABA", 'd' : "AAABB", 'e' : "AABAA",
'f' : "AABAB", 'g' : "AABBA", 'h' : "AABBB", 'i' : "ABAAA", 'j' : "ABAAB",
'k' : "ABABA", 'l' : "ABABB", 'm' : "ABBAA", 'n' : "ABBAB", 'o' : "ABBBA",
'p' : "ABBBB", 'q' : "BAAAA", 'r' : "BAAAB", 's' : "BAABA", 't' : "BAABB",
'u' : "BABAA", 'v' : "BABAB", 'w' : "BABBA", 'x' : "BABBB", 'y' : "BBAAA",
'z' : "BBAAB", ' ' : "BBBAA",
}
func baconEncode(plainText string, message string) string {
pt := strings.ToLower(plainText)
var sb []byte
for _, c := range pt {
if c >= 'a' && c <= 'z' {
sb = append(sb, codes[c]...)
} else {
sb = append(sb, codes[' ']...)
}
}
et := string(sb)
mg := strings.ToLower(message)
sb = nil
var count = 0
for _, c := range mg {
if c >= 'a' && c <= 'z' {
if et[count] == 'A' {
sb = append(sb, byte(c))
} else {
sb = append(sb, byte(c - 32))
}
count++
if count == len(et) { break }
} else {
sb = append(sb, byte(c))
}
}
return string(sb)
}
func baconDecode(message string) string {
var sb []byte
for _, c := range message {
if c >= 'a' && c <= 'z' {
sb = append(sb, 'A')
} else if c >= 'A' && c <= 'Z' {
sb = append(sb, 'B')
}
}
et := string(sb)
sb = nil
for i := 0; i < len(et); i += 5 {
quintet := et[i : i + 5]
for k, v := range codes {
if v == quintet {
sb = append(sb, byte(k))
break
}
}
}
return string(sb)
}
func main() {
plainText := "the quick brown fox jumps over the lazy dog"
message := "bacon's cipher is a method of steganography created by francis bacon." +
"this task is to implement a program for encryption and decryption of " +
"plaintext using the simple alphabet of the baconian cipher or some " +
"other kind of representation of this alphabet (make anything signify anything). " +
"the baconian alphabet may optionally be extended to encode all lower " +
"case characters individually and/or adding a few punctuation characters " +
"such as the space."
cipherText := baconEncode(plainText, message)
fmt.Printf("Cipher text ->\n\n%s\n", cipherText)
decodedText := baconDecode(cipherText)
fmt.Printf("\nHidden text ->\n\n%s\n", decodedText)
}
|
Convert this VB block to Go, preserving its control flow and logic. | Function build_spiral(n)
botcol = 0 : topcol = n - 1
botrow = 0 : toprow = n - 1
Dim matrix()
ReDim matrix(topcol,toprow)
dir = 0 : col = 0 : row = 0
For i = 0 To n*n-1
matrix(col,row) = i
Select Case dir
Case 0
If col < topcol Then
col = col + 1
Else
dir = 1 : row = row + 1 : botrow = botrow + 1
End If
Case 1
If row < toprow Then
row = row + 1
Else
dir = 2 : col = col - 1 : topcol = topcol - 1
End If
Case 2
If col > botcol Then
col = col - 1
Else
dir = 3 : row = row - 1 : toprow = toprow - 1
End If
Case 3
If row > botrow Then
row = row - 1
Else
dir = 0 : col = col + 1 : botcol = botcol + 1
End If
End Select
Next
For y = 0 To n-1
For x = 0 To n-1
WScript.StdOut.Write matrix(x,y) & vbTab
Next
WScript.StdOut.WriteLine
Next
End Function
build_spiral(CInt(WScript.Arguments(0)))
| package main
import (
"fmt"
"strconv"
)
var n = 5
func main() {
if n < 1 {
return
}
top, left, bottom, right := 0, 0, n-1, n-1
sz := n * n
a := make([]int, sz)
i := 0
for left < right {
for c := left; c <= right; c++ {
a[top*n+c] = i
i++
}
top++
for r := top; r <= bottom; r++ {
a[r*n+right] = i
i++
}
right--
if top == bottom {
break
}
for c := right; c >= left; c-- {
a[bottom*n+c] = i
i++
}
bottom--
for r := bottom; r >= top; r-- {
a[r*n+left] = i
i++
}
left++
}
a[top*n+left] = i
w := len(strconv.Itoa(n*n - 1))
for i, e := range a {
fmt.Printf("%*d ", w, e)
if i%n == n-1 {
fmt.Println("")
}
}
}
|
Generate an equivalent Go version of this VB code. | Private Sub optional_parameters(theRange As String, _
Optional ordering As Integer = 0, _
Optional column As Integer = 1, _
Optional reverse As Integer = 1)
ActiveSheet.Sort.SortFields.Clear
ActiveSheet.Sort.SortFields.Add _
Key:=Range(theRange).Columns(column), _
SortOn:=SortOnValues, _
Order:=reverse, _
DataOption:=ordering
With ActiveSheet.Sort
.SetRange Range(theRange)
.Header = xlGuess
.MatchCase = False
.Orientation = xlTopToBottom
.SortMethod = xlPinYin
.Apply
End With
End Sub
Public Sub main()
optional_parameters theRange:="A1:C4", ordering:=1, column:=2, reverse:=1
End Sub
| type cell string
type spec struct {
less func(cell, cell) bool
column int
reverse bool
}
func newSpec() (s spec) {
return
}
t.sort(newSpec())
s := newSpec
s.reverse = true
t.sort(s)
|
Write a version of this VB function in Go with identical behavior. | Declare Function CreateFileW Lib "Kernel32" (FileName As WString, DesiredAccess As Integer, ShareMode As Integer, SecurityAttributes As Integer, _
CreateDisposition As Integer, Flags As Integer, Template As Integer) As Integer
Declare Function WriteFile Lib "Kernel32" (fHandle As Integer, writeData As Ptr, numOfBytes As Integer, ByRef numOfBytesWritten As Integer, _
overlapped As Ptr) As Boolean
Declare Function GetLastError Lib "Kernel32" () As Integer
Declare Function CloseHandle Lib "kernel32" (hObject As Integer) As Boolean
Const FILE_SHARE_READ = &h00000001
Const FILE_SHARE_WRITE = &h00000002
Const OPEN_EXISTING = 3
Dim fHandle As Integer = CreateFileW("C:\foo.txt", 0, FILE_SHARE_READ Or FILE_SHARE_WRITE, 0, OPEN_EXISTING, 0, 0)
If fHandle > 0 Then
Dim mb As MemoryBlock = "Hello, World!"
Dim bytesWritten As Integer
If Not WriteFile(fHandle, mb, mb.Size, bytesWritten, Nil) Then
MsgBox("Error Number: " + Str(GetLastError))
End If
Call CloseHandle(fHandle)
Else
MsgBox("Error Number: " + Str(GetLastError))
End If
| package main
import "C"
import (
"fmt"
"unsafe"
)
func main() {
go1 := "hello C"
c1 := C.CString(go1)
go1 = ""
c2 := C.strdup(c1)
C.free(unsafe.Pointer(c1))
go2 := C.GoString(c2)
C.free(unsafe.Pointer(c2))
fmt.Println(go2)
}
|
Change the programming language of this snippet from VB to Go without modifying what it does. | Module Module1
Class Frac
Private ReadOnly num As Long
Private ReadOnly denom As Long
Public Shared ReadOnly ZERO = New Frac(0, 1)
Public Shared ReadOnly ONE = New Frac(1, 1)
Public Sub New(n As Long, d As Long)
If d = 0 Then
Throw New ArgumentException("d must not be zero")
End If
Dim nn = n
Dim dd = d
If nn = 0 Then
dd = 1
ElseIf dd < 0 Then
nn = -nn
dd = -dd
End If
Dim g = Math.Abs(Gcd(nn, dd))
If g > 1 Then
nn /= g
dd /= g
End If
num = nn
denom = dd
End Sub
Private Shared Function Gcd(a As Long, b As Long) As Long
If b = 0 Then
Return a
Else
Return Gcd(b, a Mod b)
End If
End Function
Public Shared Operator -(self As Frac) As Frac
Return New Frac(-self.num, self.denom)
End Operator
Public Shared Operator +(lhs As Frac, rhs As Frac) As Frac
Return New Frac(lhs.num * rhs.denom + lhs.denom * rhs.num, rhs.denom * lhs.denom)
End Operator
Public Shared Operator -(lhs As Frac, rhs As Frac) As Frac
Return lhs + -rhs
End Operator
Public Shared Operator *(lhs As Frac, rhs As Frac) As Frac
Return New Frac(lhs.num * rhs.num, lhs.denom * rhs.denom)
End Operator
Public Shared Operator <(lhs As Frac, rhs As Frac) As Boolean
Dim x = lhs.num / lhs.denom
Dim y = rhs.num / rhs.denom
Return x < y
End Operator
Public Shared Operator >(lhs As Frac, rhs As Frac) As Boolean
Dim x = lhs.num / lhs.denom
Dim y = rhs.num / rhs.denom
Return x > y
End Operator
Public Shared Operator =(lhs As Frac, rhs As Frac) As Boolean
Return lhs.num = rhs.num AndAlso lhs.denom = rhs.denom
End Operator
Public Shared Operator <>(lhs As Frac, rhs As Frac) As Boolean
Return lhs.num <> rhs.num OrElse lhs.denom <> rhs.denom
End Operator
Public Overrides Function ToString() As String
If denom = 1 Then
Return num.ToString
Else
Return String.Format("{0}/{1}", num, denom)
End If
End Function
Public Overrides Function Equals(obj As Object) As Boolean
Dim frac = CType(obj, Frac)
Return Not IsNothing(frac) AndAlso num = frac.num AndAlso denom = frac.denom
End Function
End Class
Function Bernoulli(n As Integer) As Frac
If n < 0 Then
Throw New ArgumentException("n may not be negative or zero")
End If
Dim a(n + 1) As Frac
For m = 0 To n
a(m) = New Frac(1, m + 1)
For j = m To 1 Step -1
a(j - 1) = (a(j - 1) - a(j)) * New Frac(j, 1)
Next
Next
If n <> 1 Then
Return a(0)
Else
Return -a(0)
End If
End Function
Function Binomial(n As Integer, k As Integer) As Integer
If n < 0 OrElse k < 0 OrElse n < k Then
Throw New ArgumentException()
End If
If n = 0 OrElse k = 0 Then
Return 1
End If
Dim num = 1
For i = k + 1 To n
num *= i
Next
Dim denom = 1
For i = 2 To n - k
denom *= i
Next
Return num \ denom
End Function
Function FaulhaberTriangle(p As Integer) As Frac()
Dim coeffs(p + 1) As Frac
For i = 1 To p + 1
coeffs(i - 1) = Frac.ZERO
Next
Dim q As New Frac(1, p + 1)
Dim sign = -1
For j = 0 To p
sign *= -1
coeffs(p - j) = q * New Frac(sign, 1) * New Frac(Binomial(p + 1, j), 1) * Bernoulli(j)
Next
Return coeffs
End Function
Sub Main()
For i = 1 To 10
Dim coeffs = FaulhaberTriangle(i - 1)
For Each coeff In coeffs
Console.Write("{0,5} ", coeff)
Next
Console.WriteLine()
Next
End Sub
End Module
| package main
import (
"fmt"
"math/big"
)
func bernoulli(n uint) *big.Rat {
a := make([]big.Rat, n+1)
z := new(big.Rat)
for m := range a {
a[m].SetFrac64(1, int64(m+1))
for j := m; j >= 1; j-- {
d := &a[j-1]
d.Mul(z.SetInt64(int64(j)), d.Sub(d, &a[j]))
}
}
if n != 1 {
return &a[0]
}
a[0].Neg(&a[0])
return &a[0]
}
func binomial(n, k int) int64 {
if n <= 0 || k <= 0 || n < k {
return 1
}
var num, den int64 = 1, 1
for i := k + 1; i <= n; i++ {
num *= int64(i)
}
for i := 2; i <= n-k; i++ {
den *= int64(i)
}
return num / den
}
func faulhaberTriangle(p int) []big.Rat {
coeffs := make([]big.Rat, p+1)
q := big.NewRat(1, int64(p)+1)
t := new(big.Rat)
u := new(big.Rat)
sign := -1
for j := range coeffs {
sign *= -1
d := &coeffs[p-j]
t.SetInt64(int64(sign))
u.SetInt64(binomial(p+1, j))
d.Mul(q, t)
d.Mul(d, u)
d.Mul(d, bernoulli(uint(j)))
}
return coeffs
}
func main() {
for i := 0; i < 10; i++ {
coeffs := faulhaberTriangle(i)
for _, coeff := range coeffs {
fmt.Printf("%5s ", coeff.RatString())
}
fmt.Println()
}
fmt.Println()
k := 17
cc := faulhaberTriangle(k)
n := int64(1000)
nn := big.NewRat(n, 1)
np := big.NewRat(1, 1)
sum := new(big.Rat)
tmp := new(big.Rat)
for _, c := range cc {
np.Mul(np, nn)
tmp.Set(np)
tmp.Mul(tmp, &c)
sum.Add(sum, tmp)
}
fmt.Println(sum.RatString())
}
|
Maintain the same structure and functionality when rewriting this code in Go. | Function Run(args() as String) As Integer
For each arg As String In args
Stdout.WriteLine(arg)
Next
End Function
| package main
import (
"fmt"
"os"
)
func main() {
for i, x := range os.Args[1:] {
fmt.Printf("the argument #%d is %s\n", i, x)
}
}
|
Translate this program into Go but keep the logic exactly as in VB. | Function Run(args() as String) As Integer
For each arg As String In args
Stdout.WriteLine(arg)
Next
End Function
| package main
import (
"fmt"
"os"
)
func main() {
for i, x := range os.Args[1:] {
fmt.Printf("the argument #%d is %s\n", i, x)
}
}
|
Preserve the algorithm and functionality while converting the code from VB to Go. | Const wheel="ndeokgelw"
Sub print(s):
On Error Resume Next
WScript.stdout.WriteLine (s)
If err= &h80070006& Then WScript.Echo " Please run this script with CScript": WScript.quit
End Sub
Dim oDic
Set oDic = WScript.CreateObject("scripting.dictionary")
Dim cnt(127)
Dim fso
Set fso = WScript.CreateObject("Scripting.Filesystemobject")
Set ff=fso.OpenTextFile("unixdict.txt")
i=0
print "reading words of 3 or more letters"
While Not ff.AtEndOfStream
x=LCase(ff.ReadLine)
If Len(x)>=3 Then
If Not odic.exists(x) Then oDic.Add x,0
End If
Wend
print "remaining words: "& oDic.Count & vbcrlf
ff.Close
Set ff=Nothing
Set fso=Nothing
Set re=New RegExp
print "removing words with chars not in the wheel"
re.pattern="[^"& wheel &"]"
For Each w In oDic.Keys
If re.test(w) Then oDic.remove(w)
Next
print "remaining words: "& oDic.Count & vbcrlf
print "ensuring the mandatory letter "& Mid(wheel,5,1) & " is present"
re.Pattern=Mid(wheel,5,1)
For Each w In oDic.Keys
If Not re.test(w) Then oDic.remove(w)
Next
print "remaining words: "& oDic.Count & vbcrlf
print "checking number of chars"
Dim nDic
Set nDic = WScript.CreateObject("scripting.dictionary")
For i=1 To Len(wheel)
x=Mid(wheel,i,1)
If nDic.Exists(x) Then
a=nDic(x)
nDic(x)=Array(a(0)+1,0)
Else
nDic.add x,Array(1,0)
End If
Next
For Each w In oDic.Keys
For Each c In nDic.Keys
ndic(c)=Array(nDic(c)(0),0)
Next
For ii = 1 To len(w)
c=Mid(w,ii,1)
a=nDic(c)
If (a(0)=a(1)) Then
oDic.Remove(w):Exit For
End If
nDic(c)=Array(a(0),a(1)+1)
Next
Next
print "Remaining words "& oDic.count
For Each w In oDic.Keys
print w
Next
| package main
import (
"bytes"
"fmt"
"io/ioutil"
"log"
"sort"
"strings"
)
func main() {
b, err := ioutil.ReadFile("unixdict.txt")
if err != nil {
log.Fatal("Error reading file")
}
letters := "deegklnow"
wordsAll := bytes.Split(b, []byte{'\n'})
var words [][]byte
for _, word := range wordsAll {
word = bytes.TrimSpace(word)
le := len(word)
if le > 2 && le < 10 {
words = append(words, word)
}
}
var found []string
for _, word := range words {
le := len(word)
if bytes.IndexByte(word, 'k') >= 0 {
lets := letters
ok := true
for i := 0; i < le; i++ {
c := word[i]
ix := sort.Search(len(lets), func(i int) bool { return lets[i] >= c })
if ix < len(lets) && lets[ix] == c {
lets = lets[0:ix] + lets[ix+1:]
} else {
ok = false
break
}
}
if ok {
found = append(found, string(word))
}
}
}
fmt.Println("The following", len(found), "words are the solutions to the puzzle:")
fmt.Println(strings.Join(found, "\n"))
mostFound := 0
var mostWords9 []string
var mostLetters []byte
var words9 [][]byte
for _, word := range words {
if len(word) == 9 {
words9 = append(words9, word)
}
}
for _, word9 := range words9 {
letterBytes := make([]byte, len(word9))
copy(letterBytes, word9)
sort.Slice(letterBytes, func(i, j int) bool { return letterBytes[i] < letterBytes[j] })
distinctBytes := []byte{letterBytes[0]}
for _, b := range letterBytes[1:] {
if b != distinctBytes[len(distinctBytes)-1] {
distinctBytes = append(distinctBytes, b)
}
}
distinctLetters := string(distinctBytes)
for _, letter := range distinctLetters {
found := 0
letterByte := byte(letter)
for _, word := range words {
le := len(word)
if bytes.IndexByte(word, letterByte) >= 0 {
lets := string(letterBytes)
ok := true
for i := 0; i < le; i++ {
c := word[i]
ix := sort.Search(len(lets), func(i int) bool { return lets[i] >= c })
if ix < len(lets) && lets[ix] == c {
lets = lets[0:ix] + lets[ix+1:]
} else {
ok = false
break
}
}
if ok {
found = found + 1
}
}
}
if found > mostFound {
mostFound = found
mostWords9 = []string{string(word9)}
mostLetters = []byte{letterByte}
} else if found == mostFound {
mostWords9 = append(mostWords9, string(word9))
mostLetters = append(mostLetters, letterByte)
}
}
}
fmt.Println("\nMost words found =", mostFound)
fmt.Println("Nine letter words producing this total:")
for i := 0; i < len(mostWords9); i++ {
fmt.Println(mostWords9[i], "with central letter", string(mostLetters[i]))
}
}
|
Change the following VB code into Go without altering its purpose. | DEFINT A(1 to 4) = {1, 2, 3, 4}
DEFINT B(1 to 4) = {10, 20, 30, 40}
Redim A(1 to 8) as integer
MEMCPY(varptr(A(5)), varptr(B(1)), Sizeof(integer)*4)
| package main
import "fmt"
func main() {
a := []int{1, 2, 3}
b := []int{7, 12, 60}
c := append(a, b...)
fmt.Println(c)
i := []interface{}{1, 2, 3}
j := []interface{}{"Crosby", "Stills", "Nash", "Young"}
k := append(i, j...)
fmt.Println(k)
l := [...]int{1, 2, 3}
m := [...]int{7, 12, 60}
var n [len(l) + len(m)]int
copy(n[:], l[:])
copy(n[len(l):], m[:])
fmt.Println(n)
}
|
Preserve the algorithm and functionality while converting the code from VB to Go. | Public Sub text()
Debug.Print InputBox("Input a string")
Debug.Print InputBox("Input the integer 75000", "Input an integer", 75000, Context = "Long")
End Sub
| package main
import "fmt"
func main() {
var s string
var i int
if _, err := fmt.Scan(&s, &i); err == nil && i == 75000 {
fmt.Println("good")
} else {
fmt.Println("wrong")
}
}
|
Convert the following code from VB to Go, ensuring the logic remains intact. | Option Explicit
Declare Function Beep Lib "kernel32" (ByVal Freq As Long, ByVal Dur As Long) As Long
Sub Musical_Scale()
Dim Fqs, i As Integer
Fqs = Array(264, 297, 330, 352, 396, 440, 495, 528)
For i = LBound(Fqs) To UBound(Fqs)
Beep Fqs(i), 500
Next
End Sub
| package main
import (
"encoding/binary"
"log"
"math"
"os"
"strings"
)
func main() {
const (
sampleRate = 44100
duration = 8
dataLength = sampleRate * duration
hdrSize = 44
fileLen = dataLength + hdrSize - 8
)
buf1 := make([]byte, 1)
buf2 := make([]byte, 2)
buf4 := make([]byte, 4)
var sb strings.Builder
sb.WriteString("RIFF")
binary.LittleEndian.PutUint32(buf4, fileLen)
sb.Write(buf4)
sb.WriteString("WAVE")
sb.WriteString("fmt ")
binary.LittleEndian.PutUint32(buf4, 16)
sb.Write(buf4)
binary.LittleEndian.PutUint16(buf2, 1)
sb.Write(buf2)
sb.Write(buf2)
binary.LittleEndian.PutUint32(buf4, sampleRate)
sb.Write(buf4)
sb.Write(buf4)
sb.Write(buf2)
binary.LittleEndian.PutUint16(buf2, 8)
sb.Write(buf2)
sb.WriteString("data")
binary.LittleEndian.PutUint32(buf4, dataLength)
sb.Write(buf4)
wavhdr := []byte(sb.String())
f, err := os.Create("notes.wav")
if err != nil {
log.Fatal(err)
}
defer f.Close()
f.Write(wavhdr)
freqs := [8]float64{261.6, 293.6, 329.6, 349.2, 392.0, 440.0, 493.9, 523.3}
for j := 0; j < duration; j++ {
freq := freqs[j]
omega := 2 * math.Pi * freq
for i := 0; i < dataLength/duration; i++ {
y := 32 * math.Sin(omega*float64(i)/float64(sampleRate))
buf1[0] = byte(math.Round(y))
f.Write(buf1)
}
}
}
|
Translate the given VB code snippet into Go without altering its behavior. | Option Explicit
Declare Function Beep Lib "kernel32" (ByVal Freq As Long, ByVal Dur As Long) As Long
Sub Musical_Scale()
Dim Fqs, i As Integer
Fqs = Array(264, 297, 330, 352, 396, 440, 495, 528)
For i = LBound(Fqs) To UBound(Fqs)
Beep Fqs(i), 500
Next
End Sub
| package main
import (
"encoding/binary"
"log"
"math"
"os"
"strings"
)
func main() {
const (
sampleRate = 44100
duration = 8
dataLength = sampleRate * duration
hdrSize = 44
fileLen = dataLength + hdrSize - 8
)
buf1 := make([]byte, 1)
buf2 := make([]byte, 2)
buf4 := make([]byte, 4)
var sb strings.Builder
sb.WriteString("RIFF")
binary.LittleEndian.PutUint32(buf4, fileLen)
sb.Write(buf4)
sb.WriteString("WAVE")
sb.WriteString("fmt ")
binary.LittleEndian.PutUint32(buf4, 16)
sb.Write(buf4)
binary.LittleEndian.PutUint16(buf2, 1)
sb.Write(buf2)
sb.Write(buf2)
binary.LittleEndian.PutUint32(buf4, sampleRate)
sb.Write(buf4)
sb.Write(buf4)
sb.Write(buf2)
binary.LittleEndian.PutUint16(buf2, 8)
sb.Write(buf2)
sb.WriteString("data")
binary.LittleEndian.PutUint32(buf4, dataLength)
sb.Write(buf4)
wavhdr := []byte(sb.String())
f, err := os.Create("notes.wav")
if err != nil {
log.Fatal(err)
}
defer f.Close()
f.Write(wavhdr)
freqs := [8]float64{261.6, 293.6, 329.6, 349.2, 392.0, 440.0, 493.9, 523.3}
for j := 0; j < duration; j++ {
freq := freqs[j]
omega := 2 * math.Pi * freq
for i := 0; i < dataLength/duration; i++ {
y := 32 * math.Sin(omega*float64(i)/float64(sampleRate))
buf1[0] = byte(math.Round(y))
f.Write(buf1)
}
}
}
|
Transform the following VB implementation into Go, maintaining the same output and logic. |
Option Explicit
Const maxWeight = 400
Dim DataList As Variant
Dim xList(64, 3) As Variant
Dim nItems As Integer
Dim s As String, xss As String
Dim xwei As Integer, xval As Integer, nn As Integer
Sub Main()
Dim i As Integer, j As Integer
DataList = Array("map", 9, 150, "compass", 13, 35, "water", 153, 200, "sandwich", 50, 160, _
"glucose", 15, 60, "tin", 68, 45, "banana", 27, 60, "apple", 39, 40, _
"cheese", 23, 30, "beer", 52, 10, "suntan cream", 11, 70, "camera", 32, 30, _
"T-shirt", 24, 15, "trousers", 48, 10, "umbrella", 73, 40, "book", 30, 10, _
"waterproof trousers", 42, 70, "waterproof overclothes", 43, 75, _
"note-case", 22, 80, "sunglasses", 7, 20, "towel", 18, 12, "socks", 4, 50)
nItems = (UBound(DataList) + 1) / 3
j = 0
For i = 1 To nItems
xList(i, 1) = DataList(j)
xList(i, 2) = DataList(j + 1)
xList(i, 3) = DataList(j + 2)
j = j + 3
Next i
s = ""
For i = 1 To nItems
s = s & Chr(i)
Next
nn = 0
Call ChoiceBin(1, "")
For i = 1 To Len(xss)
j = Asc(Mid(xss, i, 1))
Debug.Print xList(j, 1)
Next i
Debug.Print "count=" & Len(xss), "weight=" & xwei, "value=" & xval
End Sub
Private Sub ChoiceBin(n As String, ss As String)
Dim r As String
Dim i As Integer, j As Integer, iwei As Integer, ival As Integer
Dim ipct As Integer
If n = Len(s) + 1 Then
iwei = 0: ival = 0
For i = 1 To Len(ss)
j = Asc(Mid(ss, i, 1))
iwei = iwei + xList(j, 2)
ival = ival + xList(j, 3)
Next
If iwei <= maxWeight And ival > xval Then
xss = ss: xwei = iwei: xval = ival
End If
Else
r = Mid(s, n, 1)
Call ChoiceBin(n + 1, ss & r)
Call ChoiceBin(n + 1, ss)
End If
End Sub
| package main
import "fmt"
type item struct {
string
w, v int
}
var wants = []item{
{"map", 9, 150},
{"compass", 13, 35},
{"water", 153, 200},
{"sandwich", 50, 160},
{"glucose", 15, 60},
{"tin", 68, 45},
{"banana", 27, 60},
{"apple", 39, 40},
{"cheese", 23, 30},
{"beer", 52, 10},
{"suntan cream", 11, 70},
{"camera", 32, 30},
{"T-shirt", 24, 15},
{"trousers", 48, 10},
{"umbrella", 73, 40},
{"waterproof trousers", 42, 70},
{"waterproof overclothes", 43, 75},
{"note-case", 22, 80},
{"sunglasses", 7, 20},
{"towel", 18, 12},
{"socks", 4, 50},
{"book", 30, 10},
}
const maxWt = 400
func main() {
items, w, v := m(len(wants)-1, maxWt)
fmt.Println(items)
fmt.Println("weight:", w)
fmt.Println("value:", v)
}
func m(i, w int) ([]string, int, int) {
if i < 0 || w == 0 {
return nil, 0, 0
} else if wants[i].w > w {
return m(i-1, w)
}
i0, w0, v0 := m(i-1, w)
i1, w1, v1 := m(i-1, w-wants[i].w)
v1 += wants[i].v
if v1 > v0 {
return append(i1, wants[i].string), w1 + wants[i].w, v1
}
return i0, w0, v0
}
|
Translate the given VB code snippet into Go without altering its behavior. | Imports System.Math
Module Module1
Const MAXPRIME = 99
Const MAXPARENT = 99
Const NBRCHILDREN = 547100
Public Primes As New Collection()
Public PrimesR As New Collection()
Public Ancestors As New Collection()
Public Parents(MAXPARENT + 1) As Integer
Public CptDescendants(MAXPARENT + 1) As Integer
Public Children(NBRCHILDREN) As ChildStruct
Public iChildren As Integer
Public Delimiter As String = ", "
Public Structure ChildStruct
Public Child As Long
Public pLower As Integer
Public pHigher As Integer
End Structure
Sub Main()
Dim Parent As Short
Dim Sum As Short
Dim i As Short
Dim TotDesc As Integer = 0
Dim MidPrime As Integer
If GetPrimes(Primes, MAXPRIME) = vbFalse Then
Return
End If
For i = Primes.Count To 1 Step -1
PrimesR.Add(Primes.Item(i))
Next
MidPrime = PrimesR.Item(1) / 2
For Each Prime In PrimesR
Parents(Prime) = InsertChild(Parents(Prime), Prime)
CptDescendants(Prime) += 1
If Prime > MidPrime Then
Continue For
End If
For Parent = 1 To MAXPARENT
Sum = Parent + Prime
If Sum > MAXPARENT Then
Exit For
End If
If Parents(Parent) Then
InsertPreorder(Parents(Parent), Sum, Prime)
CptDescendants(Sum) += CptDescendants(Parent)
End If
Next
Next
RemoveFalseChildren()
If MAXPARENT > MAXPRIME Then
If GetPrimes(Primes, MAXPARENT) = vbFalse Then
Return
End If
End If
FileOpen(1, "Ancestors.txt", OpenMode.Output)
For Parent = 1 To MAXPARENT
GetAncestors(Parent)
PrintLine(1, "[" & Parent.ToString & "] Level: " & Ancestors.Count.ToString)
If Ancestors.Count Then
Print(1, "Ancestors: " & Ancestors.Item(1).ToString)
For i = 2 To Ancestors.Count
Print(1, ", " & Ancestors.Item(i).ToString)
Next
PrintLine(1)
Ancestors.Clear()
Else
PrintLine(1, "Ancestors: None")
End If
If CptDescendants(Parent) Then
PrintLine(1, "Descendants: " & CptDescendants(Parent).ToString)
Delimiter = ""
PrintDescendants(Parents(Parent))
PrintLine(1)
TotDesc += CptDescendants(Parent)
Else
PrintLine(1, "Descendants: None")
End If
PrintLine(1)
Next
Primes.Clear()
PrimesR.Clear()
PrintLine(1, "Total descendants " & TotDesc.ToString)
PrintLine(1)
FileClose(1)
End Sub
Function InsertPreorder(_index As Integer, _sum As Short, _prime As Short)
Parents(_sum) = InsertChild(Parents(_sum), Children(_index).Child * _prime)
If Children(_index).pLower Then
InsertPreorder(Children(_index).pLower, _sum, _prime)
End If
If Children(_index).pHigher Then
InsertPreorder(Children(_index).pHigher, _sum, _prime)
End If
Return Nothing
End Function
Function InsertChild(_index As Integer, _child As Long) As Integer
If _index Then
If _child <= Children(_index).Child Then
Children(_index).pLower = InsertChild(Children(_index).pLower, _child)
Else
Children(_index).pHigher = InsertChild(Children(_index).pHigher, _child)
End If
Else
iChildren += 1
_index = iChildren
Children(_index).Child = _child
Children(_index).pLower = 0
Children(_index).pHigher = 0
End If
Return _index
End Function
Function RemoveFalseChildren()
Dim Exclusions As New Collection
Exclusions.Add(4)
For Each Prime In Primes
Exclusions.Add(Prime)
Next
For Each ex In Exclusions
Parents(ex) = Children(Parents(ex)).pHigher
CptDescendants(ex) -= 1
Next
Exclusions.Clear()
Return Nothing
End Function
Function GetAncestors(_child As Short)
Dim Child As Short = _child
Dim Parent As Short = 0
For Each Prime In Primes
If Child = 1 Then
Exit For
End If
While Child Mod Prime = 0
Child /= Prime
Parent += Prime
End While
Next
If Parent = _child Or _child = 1 Then
Return Nothing
End If
GetAncestors(Parent)
Ancestors.Add(Parent)
Return Nothing
End Function
Function PrintDescendants(_index As Integer)
If Children(_index).pLower Then
PrintDescendants(Children(_index).pLower)
End If
Print(1, Delimiter.ToString & Children(_index).Child.ToString)
Delimiter = ", "
If Children(_index).pHigher Then
PrintDescendants(Children(_index).pHigher)
End If
Return Nothing
End Function
Function GetPrimes(ByRef _primes As Object, Optional _maxPrime As Integer = 2) As Boolean
Dim Value As Integer = 3
Dim Max As Integer
Dim Prime As Integer
If _maxPrime < 2 Then
Return vbFalse
End If
_primes.Add(2)
While Value <= _maxPrime
Max = Floor(Sqrt(Value))
For Each Prime In _primes
If Prime > Max Then
_primes.Add(Value)
Exit For
End If
If Value Mod Prime = 0 Then
Exit For
End If
Next
Value += 2
End While
Return vbTrue
End Function
End Module
| package main
import (
"fmt"
"sort"
)
func getPrimes(max int) []int {
if max < 2 {
return []int{}
}
lprimes := []int{2}
outer:
for x := 3; x <= max; x += 2 {
for _, p := range lprimes {
if x%p == 0 {
continue outer
}
}
lprimes = append(lprimes, x)
}
return lprimes
}
func main() {
const maxSum = 99
descendants := make([][]int64, maxSum+1)
ancestors := make([][]int, maxSum+1)
for i := 0; i <= maxSum; i++ {
descendants[i] = []int64{}
ancestors[i] = []int{}
}
primes := getPrimes(maxSum)
for _, p := range primes {
descendants[p] = append(descendants[p], int64(p))
for s := 1; s < len(descendants)-p; s++ {
temp := make([]int64, len(descendants[s]))
for i := 0; i < len(descendants[s]); i++ {
temp[i] = int64(p) * descendants[s][i]
}
descendants[s+p] = append(descendants[s+p], temp...)
}
}
for _, p := range append(primes, 4) {
le := len(descendants[p])
if le == 0 {
continue
}
descendants[p][le-1] = 0
descendants[p] = descendants[p][:le-1]
}
total := 0
for s := 1; s <= maxSum; s++ {
x := descendants[s]
sort.Slice(x, func(i, j int) bool {
return x[i] < x[j]
})
total += len(descendants[s])
index := 0
for ; index < len(descendants[s]); index++ {
if descendants[s][index] > int64(maxSum) {
break
}
}
for _, d := range descendants[s][:index] {
ancestors[d] = append(ancestors[s], s)
}
if (s >= 21 && s <= 45) || (s >= 47 && s <= 73) || (s >= 75 && s < maxSum) {
continue
}
temp := fmt.Sprintf("%v", ancestors[s])
fmt.Printf("%2d: %d Ancestor(s): %-14s", s, len(ancestors[s]), temp)
le := len(descendants[s])
if le <= 10 {
fmt.Printf("%5d Descendant(s): %v\n", le, descendants[s])
} else {
fmt.Printf("%5d Descendant(s): %v\b ...]\n", le, descendants[s][:10])
}
}
fmt.Println("\nTotal descendants", total)
}
|
Generate an equivalent Go version of this VB code. | Imports System.Runtime.CompilerServices
Module Module1
<Extension()>
Function CartesianProduct(Of T)(sequences As IEnumerable(Of IEnumerable(Of T))) As IEnumerable(Of IEnumerable(Of T))
Dim emptyProduct As IEnumerable(Of IEnumerable(Of T)) = {Enumerable.Empty(Of T)}
Return sequences.Aggregate(emptyProduct, Function(accumulator, sequence) From acc In accumulator From item In sequence Select acc.Concat({item}))
End Function
Sub Main()
Dim empty(-1) As Integer
Dim list1 = {1, 2}
Dim list2 = {3, 4}
Dim list3 = {1776, 1789}
Dim list4 = {7, 12}
Dim list5 = {4, 14, 23}
Dim list6 = {0, 1}
Dim list7 = {1, 2, 3}
Dim list8 = {30}
Dim list9 = {500, 100}
For Each sequnceList As Integer()() In {
({list1, list2}),
({list2, list1}),
({list1, empty}),
({empty, list1}),
({list3, list4, list5, list6}),
({list7, list8, list9}),
({list7, empty, list9})
}
Dim cart = sequnceList.CartesianProduct().Select(Function(tuple) $"({String.Join(", ", tuple)})")
Console.WriteLine($"{{{String.Join(", ", cart)}}}")
Next
End Sub
End Module
| package main
import "fmt"
type pair [2]int
func cart2(a, b []int) []pair {
p := make([]pair, len(a)*len(b))
i := 0
for _, a := range a {
for _, b := range b {
p[i] = pair{a, b}
i++
}
}
return p
}
func main() {
fmt.Println(cart2([]int{1, 2}, []int{3, 4}))
fmt.Println(cart2([]int{3, 4}, []int{1, 2}))
fmt.Println(cart2([]int{1, 2}, nil))
fmt.Println(cart2(nil, []int{1, 2}))
}
|
Generate a Go translation of this VB snippet without changing its computational steps. | Imports System.Runtime.CompilerServices
Module Module1
<Extension()>
Function CartesianProduct(Of T)(sequences As IEnumerable(Of IEnumerable(Of T))) As IEnumerable(Of IEnumerable(Of T))
Dim emptyProduct As IEnumerable(Of IEnumerable(Of T)) = {Enumerable.Empty(Of T)}
Return sequences.Aggregate(emptyProduct, Function(accumulator, sequence) From acc In accumulator From item In sequence Select acc.Concat({item}))
End Function
Sub Main()
Dim empty(-1) As Integer
Dim list1 = {1, 2}
Dim list2 = {3, 4}
Dim list3 = {1776, 1789}
Dim list4 = {7, 12}
Dim list5 = {4, 14, 23}
Dim list6 = {0, 1}
Dim list7 = {1, 2, 3}
Dim list8 = {30}
Dim list9 = {500, 100}
For Each sequnceList As Integer()() In {
({list1, list2}),
({list2, list1}),
({list1, empty}),
({empty, list1}),
({list3, list4, list5, list6}),
({list7, list8, list9}),
({list7, empty, list9})
}
Dim cart = sequnceList.CartesianProduct().Select(Function(tuple) $"({String.Join(", ", tuple)})")
Console.WriteLine($"{{{String.Join(", ", cart)}}}")
Next
End Sub
End Module
| package main
import "fmt"
type pair [2]int
func cart2(a, b []int) []pair {
p := make([]pair, len(a)*len(b))
i := 0
for _, a := range a {
for _, b := range b {
p[i] = pair{a, b}
i++
}
}
return p
}
func main() {
fmt.Println(cart2([]int{1, 2}, []int{3, 4}))
fmt.Println(cart2([]int{3, 4}, []int{1, 2}))
fmt.Println(cart2([]int{1, 2}, nil))
fmt.Println(cart2(nil, []int{1, 2}))
}
|
Keep all operations the same but rewrite the snippet in Go. | dim _proper_divisors(100)
sub proper_divisors(n)
dim i
dim _proper_divisors_count = 0
if n <> 1 then
for i = 1 to (n \ 2)
if n %% i = 0 then
_proper_divisors_count = _proper_divisors_count + 1
_proper_divisors(_proper_divisors_count) = i
end if
next
end if
return _proper_divisors_count
end sub
sub show_proper_divisors(n, tabbed)
dim cnt = proper_divisors(n)
print str$(n) + ":"; tab(4);"(" + str$(cnt) + " items) ";
dim j
for j = 1 to cnt
if tabbed then
print str$(_proper_divisors(j)),
else
print str$(_proper_divisors(j));
end if
if (j < cnt) then print ",";
next
print
end sub
dim i
for i = 1 to 10
show_proper_divisors(i, false)
next
dim c
dim maxindex = 0
dim maxlength = 0
for t = 1 to 20000
c = proper_divisors(t)
if c > maxlength then
maxindex = t
maxlength = c
end if
next
print "A maximum at ";
show_proper_divisors(maxindex, false)
| package main
import (
"fmt"
"strconv"
)
func listProperDivisors(limit int) {
if limit < 1 {
return
}
width := len(strconv.Itoa(limit))
for i := 1; i <= limit; i++ {
fmt.Printf("%*d -> ", width, i)
if i == 1 {
fmt.Println("(None)")
continue
}
for j := 1; j <= i/2; j++ {
if i%j == 0 {
fmt.Printf(" %d", j)
}
}
fmt.Println()
}
}
func countProperDivisors(n int) int {
if n < 2 {
return 0
}
count := 0
for i := 1; i <= n/2; i++ {
if n%i == 0 {
count++
}
}
return count
}
func main() {
fmt.Println("The proper divisors of the following numbers are :\n")
listProperDivisors(10)
fmt.Println()
maxCount := 0
most := []int{1}
for n := 2; n <= 20000; n++ {
count := countProperDivisors(n)
if count == maxCount {
most = append(most, n)
} else if count > maxCount {
maxCount = count
most = most[0:1]
most[0] = n
}
}
fmt.Print("The following number(s) <= 20000 have the most proper divisors, ")
fmt.Println("namely", maxCount, "\b\n")
for _, n := range most {
fmt.Println(n)
}
}
|
Change the following VB code into Go without altering its purpose. | Module XMLOutput
Sub Main()
Dim charRemarks As New Dictionary(Of String, String)
charRemarks.Add("April", "Bubbly: I
charRemarks.Add("Tam O
charRemarks.Add("Emily", "Short & shrift")
Dim xml = <CharacterRemarks>
<%= From cr In charRemarks Select <Character name=<%= cr.Key %>><%= cr.Value %></Character> %>
</CharacterRemarks>
Console.WriteLine(xml)
End Sub
End Module
| package main
import (
"encoding/xml"
"fmt"
)
func xRemarks(r CharacterRemarks) (string, error) {
b, err := xml.MarshalIndent(r, "", " ")
return string(b), err
}
type CharacterRemarks struct {
Character []crm
}
type crm struct {
Name string `xml:"name,attr"`
Remark string `xml:",chardata"`
}
func main() {
x, err := xRemarks(CharacterRemarks{[]crm{
{`April`, `Bubbly: I'm > Tam and <= Emily`},
{`Tam O'Shanter`, `Burns: "When chapman billies leave the street ..."`},
{`Emily`, `Short & shrift`},
}})
if err != nil {
x = err.Error()
}
fmt.Println(x)
}
|
Change the programming language of this snippet from VB to Go without modifying what it does. | Private Sub plot_coordinate_pairs(x As Variant, y As Variant)
Dim chrt As Chart
Set chrt = ActiveSheet.Shapes.AddChart.Chart
With chrt
.ChartType = xlLine
.HasLegend = False
.HasTitle = True
.ChartTitle.Text = "Time"
.SeriesCollection.NewSeries
.SeriesCollection.Item(1).XValues = x
.SeriesCollection.Item(1).Values = y
.Axes(xlValue, xlPrimary).HasTitle = True
.Axes(xlValue, xlPrimary).AxisTitle.Characters.Text = "microseconds"
End With
End Sub
Public Sub main()
x = [{0, 1, 2, 3, 4, 5, 6, 7, 8, 9}]
y = [{2.7, 2.8, 31.4, 38.1, 58.0, 76.2, 100.5, 130.0, 149.3, 180.0}]
plot_coordinate_pairs x, y
End Sub
| package main
import (
"fmt"
"log"
"os/exec"
)
var (
x = []int{0, 1, 2, 3, 4, 5, 6, 7, 8, 9}
y = []float64{2.7, 2.8, 31.4, 38.1, 58.0, 76.2, 100.5, 130.0, 149.3, 180.0}
)
func main() {
g := exec.Command("gnuplot", "-persist")
w, err := g.StdinPipe()
if err != nil {
log.Fatal(err)
}
if err = g.Start(); err != nil {
log.Fatal(err)
}
fmt.Fprintln(w, "unset key; plot '-'")
for i, xi := range x {
fmt.Fprintf(w, "%d %f\n", xi, y[i])
}
fmt.Fprintln(w, "e")
w.Close()
g.Wait()
}
|
Produce a functionally identical Go code for the snippet given in VB. | Private Sub plot_coordinate_pairs(x As Variant, y As Variant)
Dim chrt As Chart
Set chrt = ActiveSheet.Shapes.AddChart.Chart
With chrt
.ChartType = xlLine
.HasLegend = False
.HasTitle = True
.ChartTitle.Text = "Time"
.SeriesCollection.NewSeries
.SeriesCollection.Item(1).XValues = x
.SeriesCollection.Item(1).Values = y
.Axes(xlValue, xlPrimary).HasTitle = True
.Axes(xlValue, xlPrimary).AxisTitle.Characters.Text = "microseconds"
End With
End Sub
Public Sub main()
x = [{0, 1, 2, 3, 4, 5, 6, 7, 8, 9}]
y = [{2.7, 2.8, 31.4, 38.1, 58.0, 76.2, 100.5, 130.0, 149.3, 180.0}]
plot_coordinate_pairs x, y
End Sub
| package main
import (
"fmt"
"log"
"os/exec"
)
var (
x = []int{0, 1, 2, 3, 4, 5, 6, 7, 8, 9}
y = []float64{2.7, 2.8, 31.4, 38.1, 58.0, 76.2, 100.5, 130.0, 149.3, 180.0}
)
func main() {
g := exec.Command("gnuplot", "-persist")
w, err := g.StdinPipe()
if err != nil {
log.Fatal(err)
}
if err = g.Start(); err != nil {
log.Fatal(err)
}
fmt.Fprintln(w, "unset key; plot '-'")
for i, xi := range x {
fmt.Fprintf(w, "%d %f\n", xi, y[i])
}
fmt.Fprintln(w, "e")
w.Close()
g.Wait()
}
|
Produce a language-to-language conversion: from VB to Go, same semantics. | text = "I need more coffee!!!"
Set regex = New RegExp
regex.Global = True
regex.Pattern = "\s"
If regex.Test(text) Then
WScript.StdOut.Write regex.Replace(text,vbCrLf)
Else
WScript.StdOut.Write "No matching pattern"
End If
| package main
import "fmt"
import "regexp"
func main() {
str := "I am the original string"
matched, _ := regexp.MatchString(".*string$", str)
if matched { fmt.Println("ends with 'string'") }
pattern := regexp.MustCompile("original")
result := pattern.ReplaceAllString(str, "modified")
fmt.Println(result)
}
|
Can you help me rewrite this code in Go instead of VB, keeping it the same logically? | text = "I need more coffee!!!"
Set regex = New RegExp
regex.Global = True
regex.Pattern = "\s"
If regex.Test(text) Then
WScript.StdOut.Write regex.Replace(text,vbCrLf)
Else
WScript.StdOut.Write "No matching pattern"
End If
| package main
import "fmt"
import "regexp"
func main() {
str := "I am the original string"
matched, _ := regexp.MatchString(".*string$", str)
if matched { fmt.Println("ends with 'string'") }
pattern := regexp.MustCompile("original")
result := pattern.ReplaceAllString(str, "modified")
fmt.Println(result)
}
|
Rewrite this program in Go while keeping its functionality equivalent to the VB version. | Set dict = CreateObject("Scripting.Dictionary")
os = Array("Windows", "Linux", "MacOS")
owner = Array("Microsoft", "Linus Torvalds", "Apple")
For n = 0 To 2
dict.Add os(n), owner(n)
Next
MsgBox dict.Item("Linux")
MsgBox dict.Item("MacOS")
MsgBox dict.Item("Windows")
| package main
import "fmt"
func main() {
keys := []string{"a", "b", "c"}
vals := []int{1, 2, 3}
hash := map[string]int{}
for i, key := range keys {
hash[key] = vals[i]
}
fmt.Println(hash)
}
|
Port the following code from VB to Go with equivalent syntax and logic. | Public Class Main
Inherits System.Windows.Forms.Form
Public Sub New()
Me.FormBorderStyle = FormBorderStyle.None
Me.WindowState = FormWindowState.Maximized
End Sub
Private Sub Main_Load(sender As Object, e As EventArgs) Handles Me.Load
Dim Index As Integer
Dim Colors() As Color = {Color.Black, Color.Red, Color.Green, Color.Magenta, Color.Cyan, Color.Yellow, Color.White}
Dim Height = (Me.ClientSize.Height / 4) + 1
For y = 1 To 4
Dim Top = Me.ClientSize.Height / 4 * (y - 1)
For x = 0 To Me.ClientSize.Width Step y
If Index = 6 Then Index = 0 Else Index += 1
Me.Controls.Add(New Panel With {.Top = Top, .Height = Height, .Left = x, .Width = y, .BackColor = Colors(Index)})
Next
Next
End Sub
End Class
| package main
import "github.com/fogleman/gg"
var palette = [8]string{
"000000",
"FF0000",
"00FF00",
"0000FF",
"FF00FF",
"00FFFF",
"FFFF00",
"FFFFFF",
}
func pinstripe(dc *gg.Context) {
w := dc.Width()
h := dc.Height() / 4
for b := 1; b <= 4; b++ {
for x, ci := 0, 0; x < w; x, ci = x+b, ci+1 {
dc.SetHexColor(palette[ci%8])
y := h * (b - 1)
dc.DrawRectangle(float64(x), float64(y), float64(b), float64(h))
dc.Fill()
}
}
}
func main() {
dc := gg.NewContext(900, 600)
pinstripe(dc)
dc.SavePNG("color_pinstripe.png")
}
|
Produce a language-to-language conversion: from VB to Go, same semantics. |
Function cocktailShakerSort(ByVal A As Variant) As Variant
beginIdx = LBound(A)
endIdx = UBound(A) - 1
Do While beginIdx <= endIdx
newBeginIdx = endIdx
newEndIdx = beginIdx
For ii = beginIdx To endIdx
If A(ii) > A(ii + 1) Then
tmp = A(ii): A(ii) = A(ii + 1): A(ii + 1) = tmp
newEndIdx = ii
End If
Next ii
endIdx = newEndIdx - 1
For ii = endIdx To beginIdx Step -1
If A(ii) > A(ii + 1) Then
tmp = A(ii): A(ii) = A(ii + 1): A(ii + 1) = tmp
newBeginIdx = ii
End If
Next ii
beginIdx = newBeginIdx + 1
Loop
cocktailShakerSort = A
End Function
Public Sub main()
Dim B(20) As Variant
For i = LBound(B) To UBound(B)
B(i) = Int(Rnd() * 100)
Next i
Debug.Print Join(B, ", ")
Debug.Print Join(cocktailShakerSort(B), ", ")
End Sub
| package main
import (
"fmt"
"math/rand"
"time"
)
func cocktailShakerSort(a []int) {
var begin = 0
var end = len(a) - 2
for begin <= end {
newBegin := end
newEnd := begin
for i := begin; i <= end; i++ {
if a[i] > a[i+1] {
a[i+1], a[i] = a[i], a[i+1]
newEnd = i
}
}
end = newEnd - 1
for i := end; i >= begin; i-- {
if a[i] > a[i+1] {
a[i+1], a[i] = a[i], a[i+1]
newBegin = i
}
}
begin = newBegin + 1
}
}
func cocktailSort(a []int) {
last := len(a) - 1
for {
swapped := false
for i := 0; i < last; i++ {
if a[i] > a[i+1] {
a[i], a[i+1] = a[i+1], a[i]
swapped = true
}
}
if !swapped {
return
}
swapped = false
for i := last - 1; i >= 0; i-- {
if a[i] > a[i+1] {
a[i], a[i+1] = a[i+1], a[i]
swapped = true
}
}
if !swapped {
return
}
}
}
func main() {
a := []int{21, 4, -9, 62, -7, 107, -62, 4, 0, -170}
fmt.Println("Original array:", a)
b := make([]int, len(a))
copy(b, a)
cocktailSort(a)
fmt.Println("Cocktail sort :", a)
cocktailShakerSort(b)
fmt.Println("C/Shaker sort :", b)
rand.Seed(time.Now().UnixNano())
fmt.Println("\nRelative speed of the two sorts")
fmt.Println(" N x faster (CSS v CS)")
fmt.Println("----- -------------------")
const runs = 10
for _, n := range []int{1000, 2000, 4000, 8000, 10000, 20000} {
sum := 0.0
for i := 1; i <= runs; i++ {
nums := make([]int, n)
for i := 0; i < n; i++ {
rn := rand.Intn(100000)
if i%2 == 1 {
rn = -rn
}
nums[i] = rn
}
nums2 := make([]int, n)
copy(nums2, nums)
start := time.Now()
cocktailSort(nums)
elapsed := time.Since(start)
start2 := time.Now()
cocktailShakerSort(nums2)
elapsed2 := time.Since(start2)
sum += float64(elapsed) / float64(elapsed2)
}
fmt.Printf(" %2dk %0.3f\n", n/1000, sum/runs)
}
}
|
Please provide an equivalent version of this VB code in Go. |
Function cocktailShakerSort(ByVal A As Variant) As Variant
beginIdx = LBound(A)
endIdx = UBound(A) - 1
Do While beginIdx <= endIdx
newBeginIdx = endIdx
newEndIdx = beginIdx
For ii = beginIdx To endIdx
If A(ii) > A(ii + 1) Then
tmp = A(ii): A(ii) = A(ii + 1): A(ii + 1) = tmp
newEndIdx = ii
End If
Next ii
endIdx = newEndIdx - 1
For ii = endIdx To beginIdx Step -1
If A(ii) > A(ii + 1) Then
tmp = A(ii): A(ii) = A(ii + 1): A(ii + 1) = tmp
newBeginIdx = ii
End If
Next ii
beginIdx = newBeginIdx + 1
Loop
cocktailShakerSort = A
End Function
Public Sub main()
Dim B(20) As Variant
For i = LBound(B) To UBound(B)
B(i) = Int(Rnd() * 100)
Next i
Debug.Print Join(B, ", ")
Debug.Print Join(cocktailShakerSort(B), ", ")
End Sub
| package main
import (
"fmt"
"math/rand"
"time"
)
func cocktailShakerSort(a []int) {
var begin = 0
var end = len(a) - 2
for begin <= end {
newBegin := end
newEnd := begin
for i := begin; i <= end; i++ {
if a[i] > a[i+1] {
a[i+1], a[i] = a[i], a[i+1]
newEnd = i
}
}
end = newEnd - 1
for i := end; i >= begin; i-- {
if a[i] > a[i+1] {
a[i+1], a[i] = a[i], a[i+1]
newBegin = i
}
}
begin = newBegin + 1
}
}
func cocktailSort(a []int) {
last := len(a) - 1
for {
swapped := false
for i := 0; i < last; i++ {
if a[i] > a[i+1] {
a[i], a[i+1] = a[i+1], a[i]
swapped = true
}
}
if !swapped {
return
}
swapped = false
for i := last - 1; i >= 0; i-- {
if a[i] > a[i+1] {
a[i], a[i+1] = a[i+1], a[i]
swapped = true
}
}
if !swapped {
return
}
}
}
func main() {
a := []int{21, 4, -9, 62, -7, 107, -62, 4, 0, -170}
fmt.Println("Original array:", a)
b := make([]int, len(a))
copy(b, a)
cocktailSort(a)
fmt.Println("Cocktail sort :", a)
cocktailShakerSort(b)
fmt.Println("C/Shaker sort :", b)
rand.Seed(time.Now().UnixNano())
fmt.Println("\nRelative speed of the two sorts")
fmt.Println(" N x faster (CSS v CS)")
fmt.Println("----- -------------------")
const runs = 10
for _, n := range []int{1000, 2000, 4000, 8000, 10000, 20000} {
sum := 0.0
for i := 1; i <= runs; i++ {
nums := make([]int, n)
for i := 0; i < n; i++ {
rn := rand.Intn(100000)
if i%2 == 1 {
rn = -rn
}
nums[i] = rn
}
nums2 := make([]int, n)
copy(nums2, nums)
start := time.Now()
cocktailSort(nums)
elapsed := time.Since(start)
start2 := time.Now()
cocktailShakerSort(nums2)
elapsed2 := time.Since(start2)
sum += float64(elapsed) / float64(elapsed2)
}
fmt.Printf(" %2dk %0.3f\n", n/1000, sum/runs)
}
}
|
Preserve the algorithm and functionality while converting the code from VB to Go. | option explicit
const dt = 0.15
const length=23
dim ans0:ans0=chr(27)&"["
dim Veloc,Accel,angle,olr,olc,r,c
const r0=1
const c0=40
cls
angle=0.7
while 1
wscript.sleep(50)
Accel = -.9 * sin(Angle)
Veloc = Veloc + Accel * dt
Angle = Angle + Veloc * dt
r = r0 + int(cos(Angle) * Length)
c = c0+ int(2*sin(Angle) * Length)
cls
draw_line r,c,r0,c0
toxy r,c,"O"
olr=r :olc=c
wend
sub cls() wscript.StdOut.Write ans0 &"2J"&ans0 &"?25l":end sub
sub toxy(r,c,s) wscript.StdOut.Write ans0 & r & ";" & c & "f" & s :end sub
Sub draw_line(r1,c1, r2,c2)
Dim x,y,xf,yf,dx,dy,sx,sy,err,err2
x =r1 : y =c1
xf=r2 : yf=c2
dx=Abs(xf-x) : dy=Abs(yf-y)
If x<xf Then sx=+1: Else sx=-1
If y<yf Then sy=+1: Else sy=-1
err=dx-dy
Do
toxy x,y,"."
If x=xf And y=yf Then Exit Do
err2=err+err
If err2>-dy Then err=err-dy: x=x+sx
If err2< dx Then err=err+dx: y=y+sy
Loop
End Sub
| package main
import (
"github.com/google/gxui"
"github.com/google/gxui/drivers/gl"
"github.com/google/gxui/math"
"github.com/google/gxui/themes/dark"
omath "math"
"time"
)
const (
ANIMATION_WIDTH int = 480
ANIMATION_HEIGHT int = 320
BALL_RADIUS float32 = 25.0
METER_PER_PIXEL float64 = 1.0 / 20.0
PHI_ZERO float64 = omath.Pi * 0.5
)
var (
l float64 = float64(ANIMATION_HEIGHT) * 0.5
freq float64 = omath.Sqrt(9.81 / (l * METER_PER_PIXEL))
)
type Pendulum interface {
GetPhi() float64
}
type mathematicalPendulum struct {
start time.Time
}
func (p *mathematicalPendulum) GetPhi() float64 {
if (p.start == time.Time{}) {
p.start = time.Now()
}
t := float64(time.Since(p.start).Nanoseconds()) / omath.Pow10(9)
return PHI_ZERO * omath.Cos(t*freq)
}
type numericalPendulum struct {
currentPhi float64
angAcc float64
angVel float64
lastTime time.Time
}
func (p *numericalPendulum) GetPhi() float64 {
dt := 0.0
if (p.lastTime != time.Time{}) {
dt = float64(time.Since(p.lastTime).Nanoseconds()) / omath.Pow10(9)
}
p.lastTime = time.Now()
p.angAcc = -9.81 / (float64(l) * METER_PER_PIXEL) * omath.Sin(p.currentPhi)
p.angVel += p.angAcc * dt
p.currentPhi += p.angVel * dt
return p.currentPhi
}
func draw(p Pendulum, canvas gxui.Canvas, x, y int) {
attachment := math.Point{X: ANIMATION_WIDTH/2 + x, Y: y}
phi := p.GetPhi()
ball := math.Point{X: x + ANIMATION_WIDTH/2 + math.Round(float32(l*omath.Sin(phi))), Y: y + math.Round(float32(l*omath.Cos(phi)))}
line := gxui.Polygon{gxui.PolygonVertex{attachment, 0}, gxui.PolygonVertex{ball, 0}}
canvas.DrawLines(line, gxui.DefaultPen)
m := math.Point{int(BALL_RADIUS), int(BALL_RADIUS)}
rect := math.Rect{ball.Sub(m), ball.Add(m)}
canvas.DrawRoundedRect(rect, BALL_RADIUS, BALL_RADIUS, BALL_RADIUS, BALL_RADIUS, gxui.TransparentPen, gxui.CreateBrush(gxui.Yellow))
}
func appMain(driver gxui.Driver) {
theme := dark.CreateTheme(driver)
window := theme.CreateWindow(ANIMATION_WIDTH, 2*ANIMATION_HEIGHT, "Pendulum")
window.SetBackgroundBrush(gxui.CreateBrush(gxui.Gray50))
image := theme.CreateImage()
ticker := time.NewTicker(time.Millisecond * 15)
pendulum := &mathematicalPendulum{}
pendulum2 := &numericalPendulum{PHI_ZERO, 0.0, 0.0, time.Time{}}
go func() {
for _ = range ticker.C {
canvas := driver.CreateCanvas(math.Size{ANIMATION_WIDTH, 2 * ANIMATION_HEIGHT})
canvas.Clear(gxui.White)
draw(pendulum, canvas, 0, 0)
draw(pendulum2, canvas, 0, ANIMATION_HEIGHT)
canvas.Complete()
driver.Call(func() {
image.SetCanvas(canvas)
})
}
}()
window.AddChild(image)
window.OnClose(ticker.Stop)
window.OnClose(driver.Terminate)
}
func main() {
gl.StartDriver(appMain)
}
|
Produce a functionally identical Go code for the snippet given in VB. | Function Encoder(ByVal n)
Encoder = n Xor (n \ 2)
End Function
Function Decoder(ByVal n)
Dim g : g = 0
Do While n > 0
g = g Xor n
n = n \ 2
Loop
Decoder = g
End Function
Function Dec2bin(ByVal n, ByVal length)
Dim i, strbin : strbin = ""
For i = 1 to 5
strbin = (n Mod 2) & strbin
n = n \ 2
Next
Dec2Bin = strbin
End Function
WScript.StdOut.WriteLine("Binary -> Gray Code -> Binary")
For i = 0 to 31
encoded = Encoder(i)
decoded = Decoder(encoded)
WScript.StdOut.WriteLine(Dec2Bin(i, 5) & " -> " & Dec2Bin(encoded, 5) & " -> " & Dec2Bin(decoded, 5))
Next
| package main
import "fmt"
func enc(b int) int {
return b ^ b>>1
}
func dec(g int) (b int) {
for ; g != 0; g >>= 1 {
b ^= g
}
return
}
func main() {
fmt.Println("decimal binary gray decoded")
for b := 0; b < 32; b++ {
g := enc(b)
d := dec(g)
fmt.Printf(" %2d %05b %05b %05b %2d\n", b, b, g, d, d)
}
}
|
Maintain the same structure and functionality when rewriting this code in Go. | Function Encoder(ByVal n)
Encoder = n Xor (n \ 2)
End Function
Function Decoder(ByVal n)
Dim g : g = 0
Do While n > 0
g = g Xor n
n = n \ 2
Loop
Decoder = g
End Function
Function Dec2bin(ByVal n, ByVal length)
Dim i, strbin : strbin = ""
For i = 1 to 5
strbin = (n Mod 2) & strbin
n = n \ 2
Next
Dec2Bin = strbin
End Function
WScript.StdOut.WriteLine("Binary -> Gray Code -> Binary")
For i = 0 to 31
encoded = Encoder(i)
decoded = Decoder(encoded)
WScript.StdOut.WriteLine(Dec2Bin(i, 5) & " -> " & Dec2Bin(encoded, 5) & " -> " & Dec2Bin(decoded, 5))
Next
| package main
import "fmt"
func enc(b int) int {
return b ^ b>>1
}
func dec(g int) (b int) {
for ; g != 0; g >>= 1 {
b ^= g
}
return
}
func main() {
fmt.Println("decimal binary gray decoded")
for b := 0; b < 32; b++ {
g := enc(b)
d := dec(g)
fmt.Printf(" %2d %05b %05b %05b %2d\n", b, b, g, d, d)
}
}
|
Ensure the translated Go code behaves exactly like the original VB snippet. | class playingcard
dim suit
dim pips
end class
class carddeck
private suitnames
private pipnames
private cardno
private deck(52)
private nTop
sub class_initialize
dim suit
dim pips
suitnames = split("H,D,C,S",",")
pipnames = split("A,2,3,4,5,6,7,8,9,10,J,Q,K",",")
cardno = 0
for suit = 1 to 4
for pips = 1 to 13
set deck(cardno) = new playingcard
deck(cardno).suit = suitnames(suit-1)
deck(cardno).pips = pipnames(pips-1)
cardno = cardno + 1
next
next
nTop = 0
end sub
public sub showdeck
dim a
redim a(51-nTop)
for i = nTop to 51
a(i) = deck(i).pips & deck(i).suit
next
wscript.echo join( a, ", ")
end sub
public sub shuffle
dim r
randomize timer
for i = nTop to 51
r = int( rnd * ( 52 - nTop ) )
if r <> i then
objswap deck(i),deck(r)
end if
next
end sub
public function deal()
set deal = deck( nTop )
nTop = nTop + 1
end function
public property get cardsRemaining
cardsRemaining = 52 - nTop
end property
private sub objswap( a, b )
dim tmp
set tmp = a
set a = b
set b = tmp
end sub
end class
| package cards
import (
"math/rand"
)
type Suit uint8
const (
Spade Suit = 3
Heart Suit = 2
Diamond Suit = 1
Club Suit = 0
)
func (s Suit) String() string {
const suites = "CDHS"
return suites[s : s+1]
}
type Rank uint8
const (
Ace Rank = 1
Two Rank = 2
Three Rank = 3
Four Rank = 4
Five Rank = 5
Six Rank = 6
Seven Rank = 7
Eight Rank = 8
Nine Rank = 9
Ten Rank = 10
Jack Rank = 11
Queen Rank = 12
King Rank = 13
)
func (r Rank) String() string {
const ranks = "A23456789TJQK"
return ranks[r-1 : r]
}
type Card uint8
func NewCard(r Rank, s Suit) Card {
return Card(13*uint8(s) + uint8(r-1))
}
func (c Card) RankSuit() (Rank, Suit) {
return Rank(c%13 + 1), Suit(c / 13)
}
func (c Card) Rank() Rank {
return Rank(c%13 + 1)
}
func (c Card) Suit() Suit {
return Suit(c / 13)
}
func (c Card) String() string {
return c.Rank().String() + c.Suit().String()
}
type Deck []Card
func NewDeck() Deck {
d := make(Deck, 52)
for i := range d {
d[i] = Card(i)
}
return d
}
func (d Deck) String() string {
s := ""
for i, c := range d {
switch {
case i == 0:
case i%13 == 0:
s += "\n"
default:
s += " "
}
s += c.String()
}
return s
}
func (d Deck) Shuffle() {
for i := range d {
j := rand.Intn(i + 1)
d[i], d[j] = d[j], d[i]
}
}
func (d Deck) Contains(tc Card) bool {
for _, c := range d {
if c == tc {
return true
}
}
return false
}
func (d *Deck) AddDeck(decks ...Deck) {
for _, o := range decks {
*d = append(*d, o...)
}
}
func (d *Deck) AddCard(c Card) {
*d = append(*d, c)
}
func (d *Deck) Draw(n int) Deck {
old := *d
*d = old[n:]
return old[:n:n]
}
func (d *Deck) DrawCard() (Card, bool) {
if len(*d) == 0 {
return 0, false
}
old := *d
*d = old[1:]
return old[0], true
}
func (d *Deck) Deal(cards int, hands ...Deck) ([]Deck, bool) {
for i := 0; i < cards; i++ {
for j := range hands {
if len(*d) == 0 {
return hands, false
}
hands[j] = append(hands[j], (*d)[0])
*d = (*d)[1:]
}
}
return hands, true
}
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.