Instruction
stringlengths
45
106
input_code
stringlengths
1
13.7k
output_code
stringlengths
1
13.7k
Translate the given Go code snippet into C++ without altering its behavior.
package main import( "fmt" "unsafe" "reflect" ) func pointer() { fmt.Printf("Pointer:\n") var i int p := &i fmt.Printf("Before:\n\t%v: %v, %v\n", p, *p, i) *p = 3 fmt.Printf("After:\n\t%v: %v, %v\n", p, *p, i) } func slice() { fmt.Printf("Slice:\n") var a [10]byte var h reflect.SliceHeader h.Data = uintptr(unsafe.Pointer(&a)) h.Len = len(a) h.Cap = len(a) s := *(*[]byte)(unsafe.Pointer(&h)) fmt.Printf("Before:\n\ts: %v\n\ta: %v\n", s, a) copy(s, "A string.") fmt.Printf("After:\n\ts: %v\n\ta: %v\n", s, a) } func main() { pointer() fmt.Println() slice() }
#include <string> #include <iostream> int main() { char* data = new char[sizeof(std::string)]; std::string* stringPtr = new (data) std::string("ABCD"); std::cout << *stringPtr << " 0x" << stringPtr << std::endl; stringPtr->~basic_string(); stringPtr = new (data) std::string("123456"); std::cout << *stringPtr << " 0x" << stringPtr << std::endl; stringPtr->~basic_string(); delete[] data; }
Translate the given Go code snippet into C++ without altering its behavior.
package main import ( "fmt" "math/big" ) func main() { one := big.NewInt(1) pm := big.NewInt(1) var px, nx int var pb big.Int primes(4000, func(p int64) bool { pm.Mul(pm, pb.SetInt64(p)) px++ if pb.Add(pm, one).ProbablyPrime(0) || pb.Sub(pm, one).ProbablyPrime(0) { fmt.Print(px, " ") nx++ if nx == 20 { fmt.Println() return false } } return true }) } func primes(limit int, f func(int64) bool) { c := make([]bool, limit) c[0] = true c[1] = true lm := int64(limit) p := int64(2) for { f(p) p2 := p * p if p2 >= lm { break } for i := p2; i < lm; i += p { c[i] = true } for { p++ if !c[p] { break } } } for p++; p < lm; p++ { if !c[p] && !f(p) { break } } }
#include <cstdint> #include <iostream> #include <sstream> #include <gmpxx.h> typedef mpz_class integer; bool is_probably_prime(const integer& n) { return mpz_probab_prime_p(n.get_mpz_t(), 25) != 0; } bool is_prime(unsigned int n) { if (n < 2) return false; if (n % 2 == 0) return n == 2; if (n % 3 == 0) return n == 3; for (unsigned int p = 5; p * p <= n; p += 4) { if (n % p == 0) return false; p += 2; if (n % p == 0) return false; } return true; } int main() { const unsigned int max = 20; integer primorial = 1; for (unsigned int p = 0, count = 0, index = 0; count < max; ++p) { if (!is_prime(p)) continue; primorial *= p; ++index; if (is_probably_prime(primorial - 1) || is_probably_prime(primorial + 1)) { if (count > 0) std::cout << ' '; std::cout << index; ++count; } } std::cout << '\n'; return 0; }
Write the same code in C++ as shown below in Go.
package main import ( "fmt" "sort" ) func main() { dna := "" + "CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATG" + "CTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTG" + "AGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGAT" + "GGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT" + "CGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGG" + "TCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA" + "TTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTAT" + "CGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTG" + "TCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGAC" + "GACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT" fmt.Println("SEQUENCE:") le := len(dna) for i := 0; i < le; i += 50 { k := i + 50 if k > le { k = le } fmt.Printf("%5d: %s\n", i, dna[i:k]) } baseMap := make(map[byte]int) for i := 0; i < le; i++ { baseMap[dna[i]]++ } var bases []byte for k := range baseMap { bases = append(bases, k) } sort.Slice(bases, func(i, j int) bool { return bases[i] < bases[j] }) fmt.Println("\nBASE COUNT:") for _, base := range bases { fmt.Printf(" %c: %3d\n", base, baseMap[base]) } fmt.Println(" ------") fmt.Println(" Σ:", le) fmt.Println(" ======") }
#include <map> #include <string> #include <iostream> #include <iomanip> const std::string DEFAULT_DNA = "CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATG" "CTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTG" "AGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGAT" "GGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT" "CGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGG" "TCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA" "TTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTAT" "CGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTG" "TCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGAC" "GACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT"; class DnaBase { public: DnaBase(const std::string& dna = DEFAULT_DNA, int width = 50) : genome(dna), displayWidth(width) { for (auto elm : dna) { if (count.find(elm) == count.end()) count[elm] = 0; ++count[elm]; } } void viewGenome() { std::cout << "Sequence:" << std::endl; std::cout << std::endl; int limit = genome.size() / displayWidth; if (genome.size() % displayWidth != 0) ++limit; for (int i = 0; i < limit; ++i) { int beginPos = i * displayWidth; std::cout << std::setw(4) << beginPos << "  :" << std::setw(4) << genome.substr(beginPos, displayWidth) << std::endl; } std::cout << std::endl; std::cout << "Base Count" << std::endl; std::cout << "----------" << std::endl; std::cout << std::endl; int total = 0; for (auto elm : count) { std::cout << std::setw(4) << elm.first << " : " << elm.second << std::endl; total += elm.second; } std::cout << std::endl; std::cout << "Total: " << total << std::endl; } private: std::string genome; std::map<char, int> count; int displayWidth; }; int main(void) { auto d = new DnaBase(); d->viewGenome(); delete d; return 0; }
Write a version of this Go function in C++ with identical behavior.
package main import ( "fmt" "sort" ) func main() { dna := "" + "CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATG" + "CTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTG" + "AGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGAT" + "GGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT" + "CGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGG" + "TCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA" + "TTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTAT" + "CGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTG" + "TCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGAC" + "GACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT" fmt.Println("SEQUENCE:") le := len(dna) for i := 0; i < le; i += 50 { k := i + 50 if k > le { k = le } fmt.Printf("%5d: %s\n", i, dna[i:k]) } baseMap := make(map[byte]int) for i := 0; i < le; i++ { baseMap[dna[i]]++ } var bases []byte for k := range baseMap { bases = append(bases, k) } sort.Slice(bases, func(i, j int) bool { return bases[i] < bases[j] }) fmt.Println("\nBASE COUNT:") for _, base := range bases { fmt.Printf(" %c: %3d\n", base, baseMap[base]) } fmt.Println(" ------") fmt.Println(" Σ:", le) fmt.Println(" ======") }
#include <map> #include <string> #include <iostream> #include <iomanip> const std::string DEFAULT_DNA = "CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATG" "CTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTG" "AGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGAT" "GGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT" "CGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGG" "TCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA" "TTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTAT" "CGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTG" "TCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGAC" "GACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT"; class DnaBase { public: DnaBase(const std::string& dna = DEFAULT_DNA, int width = 50) : genome(dna), displayWidth(width) { for (auto elm : dna) { if (count.find(elm) == count.end()) count[elm] = 0; ++count[elm]; } } void viewGenome() { std::cout << "Sequence:" << std::endl; std::cout << std::endl; int limit = genome.size() / displayWidth; if (genome.size() % displayWidth != 0) ++limit; for (int i = 0; i < limit; ++i) { int beginPos = i * displayWidth; std::cout << std::setw(4) << beginPos << "  :" << std::setw(4) << genome.substr(beginPos, displayWidth) << std::endl; } std::cout << std::endl; std::cout << "Base Count" << std::endl; std::cout << "----------" << std::endl; std::cout << std::endl; int total = 0; for (auto elm : count) { std::cout << std::setw(4) << elm.first << " : " << elm.second << std::endl; total += elm.second; } std::cout << std::endl; std::cout << "Total: " << total << std::endl; } private: std::string genome; std::map<char, int> count; int displayWidth; }; int main(void) { auto d = new DnaBase(); d->viewGenome(); delete d; return 0; }
Ensure the translated C++ code behaves exactly like the original Go snippet.
package main import ( "hash/fnv" "log" "math/rand" "os" "time" ) var ph = []string{"Aristotle", "Kant", "Spinoza", "Marx", "Russell"} const hunger = 3 const think = time.Second / 100 const eat = time.Second / 100 var fmt = log.New(os.Stdout, "", 0) var done = make(chan bool) type fork byte func philosopher(phName string, dominantHand, otherHand chan fork, done chan bool) { fmt.Println(phName, "seated") h := fnv.New64a() h.Write([]byte(phName)) rg := rand.New(rand.NewSource(int64(h.Sum64()))) rSleep := func(t time.Duration) { time.Sleep(t/2 + time.Duration(rg.Int63n(int64(t)))) } for h := hunger; h > 0; h-- { fmt.Println(phName, "hungry") <-dominantHand <-otherHand fmt.Println(phName, "eating") rSleep(eat) dominantHand <- 'f' otherHand <- 'f' fmt.Println(phName, "thinking") rSleep(think) } fmt.Println(phName, "satisfied") done <- true fmt.Println(phName, "left the table") } func main() { fmt.Println("table empty") place0 := make(chan fork, 1) place0 <- 'f' placeLeft := place0 for i := 1; i < len(ph); i++ { placeRight := make(chan fork, 1) placeRight <- 'f' go philosopher(ph[i], placeLeft, placeRight, done) placeLeft = placeRight } go philosopher(ph[0], place0, placeLeft, done) for range ph { <-done } fmt.Println("table empty") }
#include <algorithm> #include <array> #include <chrono> #include <iostream> #include <mutex> #include <random> #include <string> #include <string_view> #include <thread> const int timeScale = 42; void Message(std::string_view message) { static std::mutex cout_mutex; std::scoped_lock cout_lock(cout_mutex); std::cout << message << std::endl; } struct Fork { std::mutex mutex; }; struct Dinner { std::array<Fork, 5> forks; ~Dinner() { Message("Dinner is over"); } }; class Philosopher { std::mt19937 rng{std::random_device {}()}; const std::string name; Fork& left; Fork& right; std::thread worker; void live(); void dine(); void ponder(); public: Philosopher(std::string name_, Fork& l, Fork& r) : name(std::move(name_)), left(l), right(r), worker(&Philosopher::live, this) {} ~Philosopher() { worker.join(); Message(name + " went to sleep."); } }; void Philosopher::live() { for(;;) { { std::scoped_lock dine_lock(left.mutex, right.mutex); dine(); } ponder(); } } void Philosopher::dine() { Message(name + " started eating."); thread_local std::array<const char*, 3> foods {"chicken", "rice", "soda"}; thread_local std::array<const char*, 3> reactions { "I like this %s!", "This %s is good.", "Mmm, %s..." }; thread_local std::uniform_int_distribution<> dist(1, 6); std::shuffle( foods.begin(), foods.end(), rng); std::shuffle(reactions.begin(), reactions.end(), rng); constexpr size_t buf_size = 64; char buffer[buf_size]; for(int i = 0; i < 3; ++i) { std::this_thread::sleep_for(std::chrono::milliseconds(dist(rng) * timeScale)); snprintf(buffer, buf_size, reactions[i], foods[i]); Message(name + ": " + buffer); } std::this_thread::sleep_for(std::chrono::milliseconds(dist(rng)) * timeScale); Message(name + " finished and left."); } void Philosopher::ponder() { static constexpr std::array<const char*, 5> topics {{ "politics", "art", "meaning of life", "source of morality", "how many straws makes a bale" }}; thread_local std::uniform_int_distribution<> wait(1, 6); thread_local std::uniform_int_distribution<> dist(0, topics.size() - 1); while(dist(rng) > 0) { std::this_thread::sleep_for(std::chrono::milliseconds(wait(rng) * 3 * timeScale)); Message(name + " is pondering about " + topics[dist(rng)] + "."); } std::this_thread::sleep_for(std::chrono::milliseconds(wait(rng) * 3 * timeScale)); Message(name + " is hungry again!"); } int main() { Dinner dinner; Message("Dinner started!"); std::array<Philosopher, 5> philosophers {{ {"Aristotle", dinner.forks[0], dinner.forks[1]}, {"Democritus", dinner.forks[1], dinner.forks[2]}, {"Plato", dinner.forks[2], dinner.forks[3]}, {"Pythagoras", dinner.forks[3], dinner.forks[4]}, {"Socrates", dinner.forks[4], dinner.forks[0]}, }}; Message("It is dark outside..."); }
Generate a C++ translation of this Go snippet without changing its computational steps.
package main import ( "fmt" "strconv" ) func main() { var fact [12]uint64 fact[0] = 1 for n := uint64(1); n < 12; n++ { fact[n] = fact[n-1] * n } for b := 9; b <= 12; b++ { fmt.Printf("The factorions for base %d are:\n", b) for i := uint64(1); i < 1500000; i++ { digits := strconv.FormatUint(i, b) sum := uint64(0) for _, digit := range digits { if digit < 'a' { sum += fact[digit-'0'] } else { sum += fact[digit+10-'a'] } } if sum == i { fmt.Printf("%d ", i) } } fmt.Println("\n") } }
#include <iostream> class factorion_t { public: factorion_t() { f[0] = 1u; for (uint n = 1u; n < 12u; n++) f[n] = f[n - 1] * n; } bool operator()(uint i, uint b) const { uint sum = 0; for (uint j = i; j > 0u; j /= b) sum += f[j % b]; return sum == i; } private: ulong f[12]; }; int main() { factorion_t factorion; for (uint b = 9u; b <= 12u; ++b) { std::cout << "factorions for base " << b << ':'; for (uint i = 1u; i < 1500000u; ++i) if (factorion(i, b)) std::cout << ' ' << i; std::cout << std::endl; } return 0; }
Write the same algorithm in C++ as shown in this Go implementation.
package main import ( "fmt" "strconv" ) func main() { var fact [12]uint64 fact[0] = 1 for n := uint64(1); n < 12; n++ { fact[n] = fact[n-1] * n } for b := 9; b <= 12; b++ { fmt.Printf("The factorions for base %d are:\n", b) for i := uint64(1); i < 1500000; i++ { digits := strconv.FormatUint(i, b) sum := uint64(0) for _, digit := range digits { if digit < 'a' { sum += fact[digit-'0'] } else { sum += fact[digit+10-'a'] } } if sum == i { fmt.Printf("%d ", i) } } fmt.Println("\n") } }
#include <iostream> class factorion_t { public: factorion_t() { f[0] = 1u; for (uint n = 1u; n < 12u; n++) f[n] = f[n - 1] * n; } bool operator()(uint i, uint b) const { uint sum = 0; for (uint j = i; j > 0u; j /= b) sum += f[j % b]; return sum == i; } private: ulong f[12]; }; int main() { factorion_t factorion; for (uint b = 9u; b <= 12u; ++b) { std::cout << "factorions for base " << b << ':'; for (uint i = 1u; i < 1500000u; ++i) if (factorion(i, b)) std::cout << ' ' << i; std::cout << std::endl; } return 0; }
Convert the following code from Go to C++, ensuring the logic remains intact.
package main import ( "fmt" "github.com/maorshutman/lm" "log" "math" ) const ( K = 7_800_000_000 n0 = 27 ) var y = []float64{ 27, 27, 27, 44, 44, 59, 59, 59, 59, 59, 59, 59, 59, 60, 60, 61, 61, 66, 83, 219, 239, 392, 534, 631, 897, 1350, 2023, 2820, 4587, 6067, 7823, 9826, 11946, 14554, 17372, 20615, 24522, 28273, 31491, 34933, 37552, 40540, 43105, 45177, 60328, 64543, 67103, 69265, 71332, 73327, 75191, 75723, 76719, 77804, 78812, 79339, 80132, 80995, 82101, 83365, 85203, 87024, 89068, 90664, 93077, 95316, 98172, 102133, 105824, 109695, 114232, 118610, 125497, 133852, 143227, 151367, 167418, 180096, 194836, 213150, 242364, 271106, 305117, 338133, 377918, 416845, 468049, 527767, 591704, 656866, 715353, 777796, 851308, 928436, 1000249, 1082054, 1174652, } func f(dst, p []float64) { for i := 0; i < len(y); i++ { t := float64(i) dst[i] = (n0*math.Exp(p[0]*t))/(1+n0*(math.Exp(p[0]*t)-1)/K) - y[i] } } func main() { j := lm.NumJac{Func: f} prob := lm.LMProblem{ Dim: 1, Size: len(y), Func: f, Jac: j.Jac, InitParams: []float64{0.5}, Tau: 1e-6, Eps1: 1e-8, Eps2: 1e-8, } res, err := lm.LM(prob, &lm.Settings{Iterations: 100, ObjectiveTol: 1e-16}) if err != nil { log.Fatal(err) } r := res.X[0] fmt.Printf("The logistic curve r for the world data is %.8f\n", r) fmt.Printf("R0 is then approximately equal to %.7f\n", math.Exp(12*r)) }
#include <cmath> #include <functional> #include <iostream> constexpr double K = 7.8e9; constexpr int n0 = 27; constexpr double actual[] = { 27, 27, 27, 44, 44, 59, 59, 59, 59, 59, 59, 59, 59, 60, 60, 61, 61, 66, 83, 219, 239, 392, 534, 631, 897, 1350, 2023, 2820, 4587, 6067, 7823, 9826, 11946, 14554, 17372, 20615, 24522, 28273, 31491, 34933, 37552, 40540, 43105, 45177, 60328, 64543, 67103, 69265, 71332, 73327, 75191, 75723, 76719, 77804, 78812, 79339, 80132, 80995, 82101, 83365, 85203, 87024, 89068, 90664, 93077, 95316, 98172, 102133, 105824, 109695, 114232, 118610, 125497, 133852, 143227, 151367, 167418, 180096, 194836, 213150, 242364, 271106, 305117, 338133, 377918, 416845, 468049, 527767, 591704, 656866, 715353, 777796, 851308, 928436, 1000249, 1082054, 1174652 }; double f(double r) { double sq = 0; constexpr size_t len = std::size(actual); for (size_t i = 0; i < len; ++i) { double eri = std::exp(r * i); double guess = (n0 * eri)/(1 + n0 * (eri - 1)/K); double diff = guess - actual[i]; sq += diff * diff; } return sq; } double solve(std::function<double(double)> fn, double guess=0.5, double epsilon=0) { for (double delta = guess ? guess : 1, f0 = fn(guess), factor = 2; delta > epsilon && guess != guess - delta; delta *= factor) { double nf = fn(guess - delta); if (nf < f0) { f0 = nf; guess -= delta; } else { nf = fn(guess + delta); if (nf < f0) { f0 = nf; guess += delta; } else factor = 0.5; } } return guess; } int main() { double r = solve(f); double R0 = std::exp(12 * r); std::cout << "r = " << r << ", R0 = " << R0 << '\n'; return 0; }
Write the same algorithm in C++ as shown in this Go implementation.
package main import "fmt" type link struct { int next *link } func linkInts(s []int) *link { if len(s) == 0 { return nil } return &link{s[0], linkInts(s[1:])} } func (l *link) String() string { if l == nil { return "nil" } r := fmt.Sprintf("[%d", l.int) for l = l.next; l != nil; l = l.next { r = fmt.Sprintf("%s %d", r, l.int) } return r + "]" } func main() { a := linkInts([]int{170, 45, 75, -90, -802, 24, 2, 66}) fmt.Println("before:", a) b := strandSort(a) fmt.Println("after: ", b) } func strandSort(a *link) (result *link) { for a != nil { sublist := a a = a.next sTail := sublist for p, pPrev := a, a; p != nil; p = p.next { if p.int > sTail.int { sTail.next = p sTail = p if p == a { a = p.next } else { pPrev.next = p.next } } else { pPrev = p } } sTail.next = nil if result == nil { result = sublist continue } var m, rr *link if sublist.int < result.int { m = sublist sublist = m.next rr = result } else { m = result rr = m.next } result = m for { if sublist == nil { m.next = rr break } if rr == nil { m.next = sublist break } if sublist.int < rr.int { m.next = sublist m = sublist sublist = m.next } else { m.next = rr m = rr rr = m.next } } } return }
#include <list> template <typename T> std::list<T> strandSort(std::list<T> lst) { if (lst.size() <= 1) return lst; std::list<T> result; std::list<T> sorted; while (!lst.empty()) { sorted.push_back(lst.front()); lst.pop_front(); for (typename std::list<T>::iterator it = lst.begin(); it != lst.end(); ) { if (sorted.back() <= *it) { sorted.push_back(*it); it = lst.erase(it); } else it++; } result.merge(sorted); } return result; }
Change the programming language of this snippet from Go to C++ without modifying what it does.
package main import "fmt" func isPrime(n int) bool { switch { case n < 2: return false case n%2 == 0: return n == 2 case n%3 == 0: return n == 3 default: d := 5 for d*d <= n { if n%d == 0 { return false } d += 2 if n%d == 0 { return false } d += 4 } return true } } func sumDigits(n int) int { sum := 0 for n > 0 { sum += n % 10 n /= 10 } return sum } func main() { fmt.Println("Additive primes less than 500:") i := 2 count := 0 for { if isPrime(i) && isPrime(sumDigits(i)) { count++ fmt.Printf("%3d ", i) if count%10 == 0 { fmt.Println() } } if i > 2 { i += 2 } else { i++ } if i > 499 { break } } fmt.Printf("\n\n%d additive primes found.\n", count) }
#include <iomanip> #include <iostream> bool is_prime(unsigned int n) { if (n < 2) return false; if (n % 2 == 0) return n == 2; if (n % 3 == 0) return n == 3; for (unsigned int p = 5; p * p <= n; p += 4) { if (n % p == 0) return false; p += 2; if (n % p == 0) return false; } return true; } unsigned int digit_sum(unsigned int n) { unsigned int sum = 0; for (; n > 0; n /= 10) sum += n % 10; return sum; } int main() { const unsigned int limit = 500; std::cout << "Additive primes less than " << limit << ":\n"; unsigned int count = 0; for (unsigned int n = 1; n < limit; ++n) { if (is_prime(digit_sum(n)) && is_prime(n)) { std::cout << std::setw(3) << n; if (++count % 10 == 0) std::cout << '\n'; else std::cout << ' '; } } std::cout << '\n' << count << " additive primes found.\n"; }
Ensure the translated C++ code behaves exactly like the original Go snippet.
package main import "fmt" type ibool bool const itrue ibool = true func (ib ibool) iif(cond bool) bool { if cond { return bool(ib) } return bool(!ib) } func main() { var needUmbrella bool raining := true if raining { needUmbrella = true } fmt.Printf("Is it raining? %t. Do I need an umbrella? %t\n", raining, needUmbrella) raining = false needUmbrella = itrue.iif(raining) fmt.Printf("Is it raining? %t. Do I need an umbrella? %t\n", raining, needUmbrella) }
class invertedAssign { int data; public: invertedAssign(int data):data(data){} int getData(){return data;} void operator=(invertedAssign& other) const { other.data = this->data; } }; #include <iostream> int main(){ invertedAssign a = 0; invertedAssign b = 42; std::cout << a.getData() << ' ' << b.getData() << '\n'; b = a; std::cout << a.getData() << ' ' << b.getData() << '\n'; }
Preserve the algorithm and functionality while converting the code from Go to C++.
package main import "fmt" type ibool bool const itrue ibool = true func (ib ibool) iif(cond bool) bool { if cond { return bool(ib) } return bool(!ib) } func main() { var needUmbrella bool raining := true if raining { needUmbrella = true } fmt.Printf("Is it raining? %t. Do I need an umbrella? %t\n", raining, needUmbrella) raining = false needUmbrella = itrue.iif(raining) fmt.Printf("Is it raining? %t. Do I need an umbrella? %t\n", raining, needUmbrella) }
class invertedAssign { int data; public: invertedAssign(int data):data(data){} int getData(){return data;} void operator=(invertedAssign& other) const { other.data = this->data; } }; #include <iostream> int main(){ invertedAssign a = 0; invertedAssign b = 42; std::cout << a.getData() << ' ' << b.getData() << '\n'; b = a; std::cout << a.getData() << ' ' << b.getData() << '\n'; }
Preserve the algorithm and functionality while converting the code from Go to C++.
package main import "fmt" func gcd(n, k int) int { if n < k || k < 1 { panic("Need n >= k and k >= 1") } s := 1 for n&1 == 0 && k&1 == 0 { n >>= 1 k >>= 1 s <<= 1 } t := n if n&1 != 0 { t = -k } for t != 0 { for t&1 == 0 { t >>= 1 } if t > 0 { n = t } else { k = -t } t = n - k } return n * s } func totient(n int) int { tot := 0 for k := 1; k <= n; k++ { if gcd(n, k) == 1 { tot++ } } return tot } func main() { var perfect []int for n := 1; len(perfect) < 20; n += 2 { tot := n sum := 0 for tot != 1 { tot = totient(tot) sum += tot } if sum == n { perfect = append(perfect, n) } } fmt.Println("The first 20 perfect totient numbers are:") fmt.Println(perfect) }
#include <cassert> #include <iostream> #include <vector> class totient_calculator { public: explicit totient_calculator(int max) : totient_(max + 1) { for (int i = 1; i <= max; ++i) totient_[i] = i; for (int i = 2; i <= max; ++i) { if (totient_[i] < i) continue; for (int j = i; j <= max; j += i) totient_[j] -= totient_[j] / i; } } int totient(int n) const { assert (n >= 1 && n < totient_.size()); return totient_[n]; } bool is_prime(int n) const { return totient(n) == n - 1; } private: std::vector<int> totient_; }; bool perfect_totient_number(const totient_calculator& tc, int n) { int sum = 0; for (int m = n; m > 1; ) { int t = tc.totient(m); sum += t; m = t; } return sum == n; } int main() { totient_calculator tc(10000); int count = 0, n = 1; std::cout << "First 20 perfect totient numbers:\n"; for (; count < 20; ++n) { if (perfect_totient_number(tc, n)) { if (count > 0) std::cout << ' '; ++count; std::cout << n; } } std::cout << '\n'; return 0; }
Rewrite the snippet below in C++ so it works the same as the original Go code.
package main import "fmt" func gcd(n, k int) int { if n < k || k < 1 { panic("Need n >= k and k >= 1") } s := 1 for n&1 == 0 && k&1 == 0 { n >>= 1 k >>= 1 s <<= 1 } t := n if n&1 != 0 { t = -k } for t != 0 { for t&1 == 0 { t >>= 1 } if t > 0 { n = t } else { k = -t } t = n - k } return n * s } func totient(n int) int { tot := 0 for k := 1; k <= n; k++ { if gcd(n, k) == 1 { tot++ } } return tot } func main() { var perfect []int for n := 1; len(perfect) < 20; n += 2 { tot := n sum := 0 for tot != 1 { tot = totient(tot) sum += tot } if sum == n { perfect = append(perfect, n) } } fmt.Println("The first 20 perfect totient numbers are:") fmt.Println(perfect) }
#include <cassert> #include <iostream> #include <vector> class totient_calculator { public: explicit totient_calculator(int max) : totient_(max + 1) { for (int i = 1; i <= max; ++i) totient_[i] = i; for (int i = 2; i <= max; ++i) { if (totient_[i] < i) continue; for (int j = i; j <= max; j += i) totient_[j] -= totient_[j] / i; } } int totient(int n) const { assert (n >= 1 && n < totient_.size()); return totient_[n]; } bool is_prime(int n) const { return totient(n) == n - 1; } private: std::vector<int> totient_; }; bool perfect_totient_number(const totient_calculator& tc, int n) { int sum = 0; for (int m = n; m > 1; ) { int t = tc.totient(m); sum += t; m = t; } return sum == n; } int main() { totient_calculator tc(10000); int count = 0, n = 1; std::cout << "First 20 perfect totient numbers:\n"; for (; count < 20; ++n) { if (perfect_totient_number(tc, n)) { if (count > 0) std::cout << ' '; ++count; std::cout << n; } } std::cout << '\n'; return 0; }
Generate an equivalent C++ version of this Go code.
package main import "fmt" func gcd(n, k int) int { if n < k || k < 1 { panic("Need n >= k and k >= 1") } s := 1 for n&1 == 0 && k&1 == 0 { n >>= 1 k >>= 1 s <<= 1 } t := n if n&1 != 0 { t = -k } for t != 0 { for t&1 == 0 { t >>= 1 } if t > 0 { n = t } else { k = -t } t = n - k } return n * s } func totient(n int) int { tot := 0 for k := 1; k <= n; k++ { if gcd(n, k) == 1 { tot++ } } return tot } func main() { var perfect []int for n := 1; len(perfect) < 20; n += 2 { tot := n sum := 0 for tot != 1 { tot = totient(tot) sum += tot } if sum == n { perfect = append(perfect, n) } } fmt.Println("The first 20 perfect totient numbers are:") fmt.Println(perfect) }
#include <cassert> #include <iostream> #include <vector> class totient_calculator { public: explicit totient_calculator(int max) : totient_(max + 1) { for (int i = 1; i <= max; ++i) totient_[i] = i; for (int i = 2; i <= max; ++i) { if (totient_[i] < i) continue; for (int j = i; j <= max; j += i) totient_[j] -= totient_[j] / i; } } int totient(int n) const { assert (n >= 1 && n < totient_.size()); return totient_[n]; } bool is_prime(int n) const { return totient(n) == n - 1; } private: std::vector<int> totient_; }; bool perfect_totient_number(const totient_calculator& tc, int n) { int sum = 0; for (int m = n; m > 1; ) { int t = tc.totient(m); sum += t; m = t; } return sum == n; } int main() { totient_calculator tc(10000); int count = 0, n = 1; std::cout << "First 20 perfect totient numbers:\n"; for (; count < 20; ++n) { if (perfect_totient_number(tc, n)) { if (count > 0) std::cout << ' '; ++count; std::cout << n; } } std::cout << '\n'; return 0; }
Write the same algorithm in C++ as shown in this Go implementation.
package main import "fmt" type Delegator struct { delegate interface{} } type Thingable interface { thing() string } func (self Delegator) operation() string { if v, ok := self.delegate.(Thingable); ok { return v.thing() } return "default implementation" } type Delegate int func (Delegate) thing() string { return "delegate implementation" } func main() { a := Delegator{} fmt.Println(a.operation()) a.delegate = "A delegate may be any object" fmt.Println(a.operation()) var d Delegate a.delegate = d fmt.Println(a.operation()) }
#include <tr1/memory> #include <string> #include <iostream> #include <tr1/functional> using namespace std; using namespace std::tr1; using std::tr1::function; class IDelegate { public: virtual ~IDelegate() {} }; class IThing { public: virtual ~IThing() {} virtual std::string Thing() = 0; }; class DelegateA : virtual public IDelegate { }; class DelegateB : public IThing, public IDelegate { std::string Thing() { return "delegate implementation"; } }; class Delegator { public: std::string Operation() { if(Delegate) if (IThing * pThing = dynamic_cast<IThing*>(Delegate.get())) return pThing->Thing(); return "default implementation"; } shared_ptr<IDelegate> Delegate; }; int main() { shared_ptr<DelegateA> delegateA(new DelegateA()); shared_ptr<DelegateB> delegateB(new DelegateB()); Delegator delegator; std::cout << delegator.Operation() << std::endl; delegator.Delegate = delegateA; std::cout << delegator.Operation() << std::endl; delegator.Delegate = delegateB; std::cout << delegator.Operation() << std::endl; }
Port the following code from Go to C++ with equivalent syntax and logic.
package main import "fmt" func sumDivisors(n int) int { sum := 0 i := 1 k := 2 if n%2 == 0 { k = 1 } for i*i <= n { if n%i == 0 { sum += i j := n / i if j != i { sum += j } } i += k } return sum } func main() { fmt.Println("The sums of positive divisors for the first 100 positive integers are:") for i := 1; i <= 100; i++ { fmt.Printf("%3d ", sumDivisors(i)) if i%10 == 0 { fmt.Println() } } }
#include <iomanip> #include <iostream> unsigned int divisor_sum(unsigned int n) { unsigned int total = 1, power = 2; for (; (n & 1) == 0; power <<= 1, n >>= 1) total += power; for (unsigned int p = 3; p * p <= n; p += 2) { unsigned int sum = 1; for (power = p; n % p == 0; power *= p, n /= p) sum += power; total *= sum; } if (n > 1) total *= n + 1; return total; } int main() { const unsigned int limit = 100; std::cout << "Sum of divisors for the first " << limit << " positive integers:\n"; for (unsigned int n = 1; n <= limit; ++n) { std::cout << std::setw(4) << divisor_sum(n); if (n % 10 == 0) std::cout << '\n'; } }
Write the same code in C++ as shown below in Go.
package main import "fmt" func sumDivisors(n int) int { sum := 0 i := 1 k := 2 if n%2 == 0 { k = 1 } for i*i <= n { if n%i == 0 { sum += i j := n / i if j != i { sum += j } } i += k } return sum } func main() { fmt.Println("The sums of positive divisors for the first 100 positive integers are:") for i := 1; i <= 100; i++ { fmt.Printf("%3d ", sumDivisors(i)) if i%10 == 0 { fmt.Println() } } }
#include <iomanip> #include <iostream> unsigned int divisor_sum(unsigned int n) { unsigned int total = 1, power = 2; for (; (n & 1) == 0; power <<= 1, n >>= 1) total += power; for (unsigned int p = 3; p * p <= n; p += 2) { unsigned int sum = 1; for (power = p; n % p == 0; power *= p, n /= p) sum += power; total *= sum; } if (n > 1) total *= n + 1; return total; } int main() { const unsigned int limit = 100; std::cout << "Sum of divisors for the first " << limit << " positive integers:\n"; for (unsigned int n = 1; n <= limit; ++n) { std::cout << std::setw(4) << divisor_sum(n); if (n % 10 == 0) std::cout << '\n'; } }
Keep all operations the same but rewrite the snippet in C++.
package main import "fmt" func sumDivisors(n int) int { sum := 0 i := 1 k := 2 if n%2 == 0 { k = 1 } for i*i <= n { if n%i == 0 { sum += i j := n / i if j != i { sum += j } } i += k } return sum } func main() { fmt.Println("The sums of positive divisors for the first 100 positive integers are:") for i := 1; i <= 100; i++ { fmt.Printf("%3d ", sumDivisors(i)) if i%10 == 0 { fmt.Println() } } }
#include <iomanip> #include <iostream> unsigned int divisor_sum(unsigned int n) { unsigned int total = 1, power = 2; for (; (n & 1) == 0; power <<= 1, n >>= 1) total += power; for (unsigned int p = 3; p * p <= n; p += 2) { unsigned int sum = 1; for (power = p; n % p == 0; power *= p, n /= p) sum += power; total *= sum; } if (n > 1) total *= n + 1; return total; } int main() { const unsigned int limit = 100; std::cout << "Sum of divisors for the first " << limit << " positive integers:\n"; for (unsigned int n = 1; n <= limit; ++n) { std::cout << std::setw(4) << divisor_sum(n); if (n % 10 == 0) std::cout << '\n'; } }
Port the provided Go code into C++ while preserving the original functionality.
package main import ( "fmt" "strings" ) var table = "Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy " + "COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find " + "NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput " + "Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO " + "MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT " + "READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT " + "RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up " func validate(commands, words []string, minLens []int) []string { results := make([]string, 0) if len(words) == 0 { return results } for _, word := range words { matchFound := false wlen := len(word) for i, command := range commands { if minLens[i] == 0 || wlen < minLens[i] || wlen > len(command) { continue } c := strings.ToUpper(command) w := strings.ToUpper(word) if strings.HasPrefix(c, w) { results = append(results, c) matchFound = true break } } if !matchFound { results = append(results, "*error*") } } return results } func main() { table = strings.TrimSpace(table) commands := strings.Fields(table) clen := len(commands) minLens := make([]int, clen) for i := 0; i < clen; i++ { count := 0 for _, c := range commands[i] { if c >= 'A' && c <= 'Z' { count++ } } minLens[i] = count } sentence := "riG rePEAT copies put mo rest types fup. 6 poweRin" words := strings.Fields(sentence) results := validate(commands, words, minLens) fmt.Print("user words: ") for j := 0; j < len(words); j++ { fmt.Printf("%-*s ", len(results[j]), words[j]) } fmt.Print("\nfull words: ") fmt.Println(strings.Join(results, " ")) }
#include <algorithm> #include <cctype> #include <iostream> #include <sstream> #include <string> #include <vector> const char* command_table = "Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy " "COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find " "NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput " "Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO " "MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT " "READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT " "RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up"; class command { public: command(const std::string&, size_t); const std::string& cmd() const { return cmd_; } size_t min_length() const { return min_len_; } bool match(const std::string&) const; private: std::string cmd_; size_t min_len_; }; command::command(const std::string& cmd, size_t min_len) : cmd_(cmd), min_len_(min_len) {} bool command::match(const std::string& str) const { size_t olen = str.length(); return olen >= min_len_ && olen <= cmd_.length() && cmd_.compare(0, olen, str) == 0; } void uppercase(std::string& str) { std::transform(str.begin(), str.end(), str.begin(), [](unsigned char c) -> unsigned char { return std::toupper(c); }); } size_t get_min_length(const std::string& str) { size_t len = 0, n = str.length(); while (len < n && std::isupper(static_cast<unsigned char>(str[len]))) ++len; return len; } class command_list { public: explicit command_list(const char*); const command* find_command(const std::string&) const; private: std::vector<command> commands_; }; command_list::command_list(const char* table) { std::vector<command> commands; std::istringstream is(table); std::string word; while (is >> word) { size_t len = get_min_length(word); uppercase(word); commands_.push_back(command(word, len)); } } const command* command_list::find_command(const std::string& word) const { auto iter = std::find_if(commands_.begin(), commands_.end(), [&word](const command& cmd) { return cmd.match(word); }); return (iter != commands_.end()) ? &*iter : nullptr; } std::string test(const command_list& commands, const std::string& input) { std::string output; std::istringstream is(input); std::string word; while (is >> word) { if (!output.empty()) output += ' '; uppercase(word); const command* cmd_ptr = commands.find_command(word); if (cmd_ptr) output += cmd_ptr->cmd(); else output += "*error*"; } return output; } int main() { command_list commands(command_table); std::string input("riG rePEAT copies put mo rest types fup. 6 poweRin"); std::string output(test(commands, input)); std::cout << " input: " << input << '\n'; std::cout << "output: " << output << '\n'; return 0; }
Write the same code in C++ as shown below in Go.
package main import ( "fmt" "strings" ) var table = "Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy " + "COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find " + "NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput " + "Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO " + "MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT " + "READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT " + "RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up " func validate(commands, words []string, minLens []int) []string { results := make([]string, 0) if len(words) == 0 { return results } for _, word := range words { matchFound := false wlen := len(word) for i, command := range commands { if minLens[i] == 0 || wlen < minLens[i] || wlen > len(command) { continue } c := strings.ToUpper(command) w := strings.ToUpper(word) if strings.HasPrefix(c, w) { results = append(results, c) matchFound = true break } } if !matchFound { results = append(results, "*error*") } } return results } func main() { table = strings.TrimSpace(table) commands := strings.Fields(table) clen := len(commands) minLens := make([]int, clen) for i := 0; i < clen; i++ { count := 0 for _, c := range commands[i] { if c >= 'A' && c <= 'Z' { count++ } } minLens[i] = count } sentence := "riG rePEAT copies put mo rest types fup. 6 poweRin" words := strings.Fields(sentence) results := validate(commands, words, minLens) fmt.Print("user words: ") for j := 0; j < len(words); j++ { fmt.Printf("%-*s ", len(results[j]), words[j]) } fmt.Print("\nfull words: ") fmt.Println(strings.Join(results, " ")) }
#include <algorithm> #include <cctype> #include <iostream> #include <sstream> #include <string> #include <vector> const char* command_table = "Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy " "COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find " "NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput " "Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO " "MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT " "READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT " "RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up"; class command { public: command(const std::string&, size_t); const std::string& cmd() const { return cmd_; } size_t min_length() const { return min_len_; } bool match(const std::string&) const; private: std::string cmd_; size_t min_len_; }; command::command(const std::string& cmd, size_t min_len) : cmd_(cmd), min_len_(min_len) {} bool command::match(const std::string& str) const { size_t olen = str.length(); return olen >= min_len_ && olen <= cmd_.length() && cmd_.compare(0, olen, str) == 0; } void uppercase(std::string& str) { std::transform(str.begin(), str.end(), str.begin(), [](unsigned char c) -> unsigned char { return std::toupper(c); }); } size_t get_min_length(const std::string& str) { size_t len = 0, n = str.length(); while (len < n && std::isupper(static_cast<unsigned char>(str[len]))) ++len; return len; } class command_list { public: explicit command_list(const char*); const command* find_command(const std::string&) const; private: std::vector<command> commands_; }; command_list::command_list(const char* table) { std::vector<command> commands; std::istringstream is(table); std::string word; while (is >> word) { size_t len = get_min_length(word); uppercase(word); commands_.push_back(command(word, len)); } } const command* command_list::find_command(const std::string& word) const { auto iter = std::find_if(commands_.begin(), commands_.end(), [&word](const command& cmd) { return cmd.match(word); }); return (iter != commands_.end()) ? &*iter : nullptr; } std::string test(const command_list& commands, const std::string& input) { std::string output; std::istringstream is(input); std::string word; while (is >> word) { if (!output.empty()) output += ' '; uppercase(word); const command* cmd_ptr = commands.find_command(word); if (cmd_ptr) output += cmd_ptr->cmd(); else output += "*error*"; } return output; } int main() { command_list commands(command_table); std::string input("riG rePEAT copies put mo rest types fup. 6 poweRin"); std::string output(test(commands, input)); std::cout << " input: " << input << '\n'; std::cout << "output: " << output << '\n'; return 0; }
Keep all operations the same but rewrite the snippet in C++.
package main func main() { s := "immutable" s[0] = 'a' }
#include <iostream> class MyOtherClass { public: const int m_x; MyOtherClass(const int initX = 0) : m_x(initX) { } }; int main() { MyOtherClass mocA, mocB(7); std::cout << mocA.m_x << std::endl; std::cout << mocB.m_x << std::endl; return 0; }
Generate a C++ translation of this Go snippet without changing its computational steps.
package main import "fmt" type point struct { x, y float32 } var subjectPolygon = []point{{50, 150}, {200, 50}, {350, 150}, {350, 300}, {250, 300}, {200, 250}, {150, 350}, {100, 250}, {100, 200}} var clipPolygon = []point{{100, 100}, {300, 100}, {300, 300}, {100, 300}} func main() { var cp1, cp2, s, e point inside := func(p point) bool { return (cp2.x-cp1.x)*(p.y-cp1.y) > (cp2.y-cp1.y)*(p.x-cp1.x) } intersection := func() (p point) { dcx, dcy := cp1.x-cp2.x, cp1.y-cp2.y dpx, dpy := s.x-e.x, s.y-e.y n1 := cp1.x*cp2.y - cp1.y*cp2.x n2 := s.x*e.y - s.y*e.x n3 := 1 / (dcx*dpy - dcy*dpx) p.x = (n1*dpx - n2*dcx) * n3 p.y = (n1*dpy - n2*dcy) * n3 return } outputList := subjectPolygon cp1 = clipPolygon[len(clipPolygon)-1] for _, cp2 = range clipPolygon { inputList := outputList outputList = nil s = inputList[len(inputList)-1] for _, e = range inputList { if inside(e) { if !inside(s) { outputList = append(outputList, intersection()) } outputList = append(outputList, e) } else if inside(s) { outputList = append(outputList, intersection()) } s = e } cp1 = cp2 } fmt.Println(outputList) }
#include <iostream> #include <span> #include <vector> struct vec2 { float x = 0.0f, y = 0.0f; constexpr vec2 operator+(vec2 other) const { return vec2{x + other.x, y + other.y}; } constexpr vec2 operator-(vec2 other) const { return vec2{x - other.x, y - other.y}; } }; constexpr vec2 operator*(vec2 a, float b) { return vec2{a.x * b, a.y * b}; } constexpr float dot(vec2 a, vec2 b) { return a.x * b.x + a.y * b.y; } constexpr float cross(vec2 a, vec2 b) { return a.x * b.y - b.x * a.y; } constexpr bool is_inside(vec2 point, vec2 a, vec2 b) { return (cross(a - b, point) + cross(b, a)) < 0.0f; } constexpr vec2 intersection(vec2 a1, vec2 a2, vec2 b1, vec2 b2) { return ((b1 - b2) * cross(a1, a2) - (a1 - a2) * cross(b1, b2)) * (1.0f / cross(a1 - a2, b1 - b2)); } std::vector<vec2> suther_land_hodgman( std::span<vec2 const> subject_polygon, std::span<vec2 const> clip_polygon) { if (clip_polygon.empty() || subject_polygon.empty()) { return {}; } std::vector<vec2> ring{subject_polygon.begin(), subject_polygon.end()}; vec2 p1 = clip_polygon[clip_polygon.size() - 1]; std::vector<vec2> input; for (vec2 p2 : clip_polygon) { input.clear(); input.insert(input.end(), ring.begin(), ring.end()); vec2 s = input[input.size() - 1]; ring.clear(); for (vec2 e : input) { if (is_inside(e, p1, p2)) { if (!is_inside(s, p1, p2)) { ring.push_back(intersection(p1, p2, s, e)); } ring.push_back(e); } else if (is_inside(s, p1, p2)) { ring.push_back(intersection(p1, p2, s, e)); } s = e; } p1 = p2; } return ring; } int main(int argc, char **argv) { vec2 subject_polygon[] = {{50, 150}, {200, 50}, {350, 150}, {350, 300}, {250, 300}, {200, 250}, {150, 350}, {100, 250}, {100, 200}}; vec2 clip_polygon[] = {{100, 100}, {300, 100}, {300, 300}, {100, 300}}; std::vector<vec2> clipped_polygon = suther_land_hodgman(subject_polygon, clip_polygon); std::cout << "Clipped polygon points:" << std::endl; for (vec2 p : clipped_polygon) { std::cout << "(" << p.x << ", " << p.y << ")" << std::endl; } return EXIT_SUCCESS; }
Port the provided Go code into C++ while preserving the original functionality.
package main import( "fmt" "strings" ) var codes = map[rune]string { 'a' : "AAAAA", 'b' : "AAAAB", 'c' : "AAABA", 'd' : "AAABB", 'e' : "AABAA", 'f' : "AABAB", 'g' : "AABBA", 'h' : "AABBB", 'i' : "ABAAA", 'j' : "ABAAB", 'k' : "ABABA", 'l' : "ABABB", 'm' : "ABBAA", 'n' : "ABBAB", 'o' : "ABBBA", 'p' : "ABBBB", 'q' : "BAAAA", 'r' : "BAAAB", 's' : "BAABA", 't' : "BAABB", 'u' : "BABAA", 'v' : "BABAB", 'w' : "BABBA", 'x' : "BABBB", 'y' : "BBAAA", 'z' : "BBAAB", ' ' : "BBBAA", } func baconEncode(plainText string, message string) string { pt := strings.ToLower(plainText) var sb []byte for _, c := range pt { if c >= 'a' && c <= 'z' { sb = append(sb, codes[c]...) } else { sb = append(sb, codes[' ']...) } } et := string(sb) mg := strings.ToLower(message) sb = nil var count = 0 for _, c := range mg { if c >= 'a' && c <= 'z' { if et[count] == 'A' { sb = append(sb, byte(c)) } else { sb = append(sb, byte(c - 32)) } count++ if count == len(et) { break } } else { sb = append(sb, byte(c)) } } return string(sb) } func baconDecode(message string) string { var sb []byte for _, c := range message { if c >= 'a' && c <= 'z' { sb = append(sb, 'A') } else if c >= 'A' && c <= 'Z' { sb = append(sb, 'B') } } et := string(sb) sb = nil for i := 0; i < len(et); i += 5 { quintet := et[i : i + 5] for k, v := range codes { if v == quintet { sb = append(sb, byte(k)) break } } } return string(sb) } func main() { plainText := "the quick brown fox jumps over the lazy dog" message := "bacon's cipher is a method of steganography created by francis bacon." + "this task is to implement a program for encryption and decryption of " + "plaintext using the simple alphabet of the baconian cipher or some " + "other kind of representation of this alphabet (make anything signify anything). " + "the baconian alphabet may optionally be extended to encode all lower " + "case characters individually and/or adding a few punctuation characters " + "such as the space." cipherText := baconEncode(plainText, message) fmt.Printf("Cipher text ->\n\n%s\n", cipherText) decodedText := baconDecode(cipherText) fmt.Printf("\nHidden text ->\n\n%s\n", decodedText) }
#include <iostream> #include <algorithm> #include <vector> #include <bitset> #include <string> class bacon { public: bacon() { int x = 0; for( ; x < 9; x++ ) bAlphabet.push_back( std::bitset<5>( x ).to_string() ); bAlphabet.push_back( bAlphabet.back() ); for( ; x < 20; x++ ) bAlphabet.push_back( std::bitset<5>( x ).to_string() ); bAlphabet.push_back( bAlphabet.back() ); for( ; x < 24; x++ ) bAlphabet.push_back( std::bitset<5>( x ).to_string() ); } std::string encode( std::string txt ) { std::string r; size_t z; for( std::string::iterator i = txt.begin(); i != txt.end(); i++ ) { z = toupper( *i ); if( z < 'A' || z > 'Z' ) continue; r.append( bAlphabet.at( ( *i & 31 ) - 1 ) ); } return r; } std::string decode( std::string txt ) { size_t len = txt.length(); while( len % 5 != 0 ) len--; if( len != txt.length() ) txt = txt.substr( 0, len ); std::string r; for( size_t i = 0; i < len; i += 5 ) { r.append( 1, 'A' + std::distance( bAlphabet.begin(), std::find( bAlphabet.begin(), bAlphabet.end(), txt.substr( i, 5 ) ) ) ); } return r; } private: std::vector<std::string> bAlphabet; };
Port the following code from Go to C++ with equivalent syntax and logic.
package main import( "fmt" "strings" ) var codes = map[rune]string { 'a' : "AAAAA", 'b' : "AAAAB", 'c' : "AAABA", 'd' : "AAABB", 'e' : "AABAA", 'f' : "AABAB", 'g' : "AABBA", 'h' : "AABBB", 'i' : "ABAAA", 'j' : "ABAAB", 'k' : "ABABA", 'l' : "ABABB", 'm' : "ABBAA", 'n' : "ABBAB", 'o' : "ABBBA", 'p' : "ABBBB", 'q' : "BAAAA", 'r' : "BAAAB", 's' : "BAABA", 't' : "BAABB", 'u' : "BABAA", 'v' : "BABAB", 'w' : "BABBA", 'x' : "BABBB", 'y' : "BBAAA", 'z' : "BBAAB", ' ' : "BBBAA", } func baconEncode(plainText string, message string) string { pt := strings.ToLower(plainText) var sb []byte for _, c := range pt { if c >= 'a' && c <= 'z' { sb = append(sb, codes[c]...) } else { sb = append(sb, codes[' ']...) } } et := string(sb) mg := strings.ToLower(message) sb = nil var count = 0 for _, c := range mg { if c >= 'a' && c <= 'z' { if et[count] == 'A' { sb = append(sb, byte(c)) } else { sb = append(sb, byte(c - 32)) } count++ if count == len(et) { break } } else { sb = append(sb, byte(c)) } } return string(sb) } func baconDecode(message string) string { var sb []byte for _, c := range message { if c >= 'a' && c <= 'z' { sb = append(sb, 'A') } else if c >= 'A' && c <= 'Z' { sb = append(sb, 'B') } } et := string(sb) sb = nil for i := 0; i < len(et); i += 5 { quintet := et[i : i + 5] for k, v := range codes { if v == quintet { sb = append(sb, byte(k)) break } } } return string(sb) } func main() { plainText := "the quick brown fox jumps over the lazy dog" message := "bacon's cipher is a method of steganography created by francis bacon." + "this task is to implement a program for encryption and decryption of " + "plaintext using the simple alphabet of the baconian cipher or some " + "other kind of representation of this alphabet (make anything signify anything). " + "the baconian alphabet may optionally be extended to encode all lower " + "case characters individually and/or adding a few punctuation characters " + "such as the space." cipherText := baconEncode(plainText, message) fmt.Printf("Cipher text ->\n\n%s\n", cipherText) decodedText := baconDecode(cipherText) fmt.Printf("\nHidden text ->\n\n%s\n", decodedText) }
#include <iostream> #include <algorithm> #include <vector> #include <bitset> #include <string> class bacon { public: bacon() { int x = 0; for( ; x < 9; x++ ) bAlphabet.push_back( std::bitset<5>( x ).to_string() ); bAlphabet.push_back( bAlphabet.back() ); for( ; x < 20; x++ ) bAlphabet.push_back( std::bitset<5>( x ).to_string() ); bAlphabet.push_back( bAlphabet.back() ); for( ; x < 24; x++ ) bAlphabet.push_back( std::bitset<5>( x ).to_string() ); } std::string encode( std::string txt ) { std::string r; size_t z; for( std::string::iterator i = txt.begin(); i != txt.end(); i++ ) { z = toupper( *i ); if( z < 'A' || z > 'Z' ) continue; r.append( bAlphabet.at( ( *i & 31 ) - 1 ) ); } return r; } std::string decode( std::string txt ) { size_t len = txt.length(); while( len % 5 != 0 ) len--; if( len != txt.length() ) txt = txt.substr( 0, len ); std::string r; for( size_t i = 0; i < len; i += 5 ) { r.append( 1, 'A' + std::distance( bAlphabet.begin(), std::find( bAlphabet.begin(), bAlphabet.end(), txt.substr( i, 5 ) ) ) ); } return r; } private: std::vector<std::string> bAlphabet; };
Change the following Go code into C++ without altering its purpose.
package main import( "fmt" "strings" ) var codes = map[rune]string { 'a' : "AAAAA", 'b' : "AAAAB", 'c' : "AAABA", 'd' : "AAABB", 'e' : "AABAA", 'f' : "AABAB", 'g' : "AABBA", 'h' : "AABBB", 'i' : "ABAAA", 'j' : "ABAAB", 'k' : "ABABA", 'l' : "ABABB", 'm' : "ABBAA", 'n' : "ABBAB", 'o' : "ABBBA", 'p' : "ABBBB", 'q' : "BAAAA", 'r' : "BAAAB", 's' : "BAABA", 't' : "BAABB", 'u' : "BABAA", 'v' : "BABAB", 'w' : "BABBA", 'x' : "BABBB", 'y' : "BBAAA", 'z' : "BBAAB", ' ' : "BBBAA", } func baconEncode(plainText string, message string) string { pt := strings.ToLower(plainText) var sb []byte for _, c := range pt { if c >= 'a' && c <= 'z' { sb = append(sb, codes[c]...) } else { sb = append(sb, codes[' ']...) } } et := string(sb) mg := strings.ToLower(message) sb = nil var count = 0 for _, c := range mg { if c >= 'a' && c <= 'z' { if et[count] == 'A' { sb = append(sb, byte(c)) } else { sb = append(sb, byte(c - 32)) } count++ if count == len(et) { break } } else { sb = append(sb, byte(c)) } } return string(sb) } func baconDecode(message string) string { var sb []byte for _, c := range message { if c >= 'a' && c <= 'z' { sb = append(sb, 'A') } else if c >= 'A' && c <= 'Z' { sb = append(sb, 'B') } } et := string(sb) sb = nil for i := 0; i < len(et); i += 5 { quintet := et[i : i + 5] for k, v := range codes { if v == quintet { sb = append(sb, byte(k)) break } } } return string(sb) } func main() { plainText := "the quick brown fox jumps over the lazy dog" message := "bacon's cipher is a method of steganography created by francis bacon." + "this task is to implement a program for encryption and decryption of " + "plaintext using the simple alphabet of the baconian cipher or some " + "other kind of representation of this alphabet (make anything signify anything). " + "the baconian alphabet may optionally be extended to encode all lower " + "case characters individually and/or adding a few punctuation characters " + "such as the space." cipherText := baconEncode(plainText, message) fmt.Printf("Cipher text ->\n\n%s\n", cipherText) decodedText := baconDecode(cipherText) fmt.Printf("\nHidden text ->\n\n%s\n", decodedText) }
#include <iostream> #include <algorithm> #include <vector> #include <bitset> #include <string> class bacon { public: bacon() { int x = 0; for( ; x < 9; x++ ) bAlphabet.push_back( std::bitset<5>( x ).to_string() ); bAlphabet.push_back( bAlphabet.back() ); for( ; x < 20; x++ ) bAlphabet.push_back( std::bitset<5>( x ).to_string() ); bAlphabet.push_back( bAlphabet.back() ); for( ; x < 24; x++ ) bAlphabet.push_back( std::bitset<5>( x ).to_string() ); } std::string encode( std::string txt ) { std::string r; size_t z; for( std::string::iterator i = txt.begin(); i != txt.end(); i++ ) { z = toupper( *i ); if( z < 'A' || z > 'Z' ) continue; r.append( bAlphabet.at( ( *i & 31 ) - 1 ) ); } return r; } std::string decode( std::string txt ) { size_t len = txt.length(); while( len % 5 != 0 ) len--; if( len != txt.length() ) txt = txt.substr( 0, len ); std::string r; for( size_t i = 0; i < len; i += 5 ) { r.append( 1, 'A' + std::distance( bAlphabet.begin(), std::find( bAlphabet.begin(), bAlphabet.end(), txt.substr( i, 5 ) ) ) ); } return r; } private: std::vector<std::string> bAlphabet; };
Transform the following Go implementation into C++, maintaining the same output and logic.
package main import ( "fmt" "strconv" ) var n = 5 func main() { if n < 1 { return } top, left, bottom, right := 0, 0, n-1, n-1 sz := n * n a := make([]int, sz) i := 0 for left < right { for c := left; c <= right; c++ { a[top*n+c] = i i++ } top++ for r := top; r <= bottom; r++ { a[r*n+right] = i i++ } right-- if top == bottom { break } for c := right; c >= left; c-- { a[bottom*n+c] = i i++ } bottom-- for r := bottom; r >= top; r-- { a[r*n+left] = i i++ } left++ } a[top*n+left] = i w := len(strconv.Itoa(n*n - 1)) for i, e := range a { fmt.Printf("%*d ", w, e) if i%n == n-1 { fmt.Println("") } } }
#include <vector> #include <memory> #include <cmath> #include <iostream> #include <iomanip> using namespace std; typedef vector< int > IntRow; typedef vector< IntRow > IntTable; auto_ptr< IntTable > getSpiralArray( int dimension ) { auto_ptr< IntTable > spiralArrayPtr( new IntTable( dimension, IntRow( dimension ) ) ); int numConcentricSquares = static_cast< int >( ceil( static_cast< double >( dimension ) / 2.0 ) ); int j; int sideLen = dimension; int currNum = 0; for ( int i = 0; i < numConcentricSquares; i++ ) { for ( j = 0; j < sideLen; j++ ) ( *spiralArrayPtr )[ i ][ i + j ] = currNum++; for ( j = 1; j < sideLen; j++ ) ( *spiralArrayPtr )[ i + j ][ dimension - 1 - i ] = currNum++; for ( j = sideLen - 2; j > -1; j-- ) ( *spiralArrayPtr )[ dimension - 1 - i ][ i + j ] = currNum++; for ( j = sideLen - 2; j > 0; j-- ) ( *spiralArrayPtr )[ i + j ][ i ] = currNum++; sideLen -= 2; } return spiralArrayPtr; } void printSpiralArray( const auto_ptr< IntTable >& spiralArrayPtr ) { size_t dimension = spiralArrayPtr->size(); int fieldWidth = static_cast< int >( floor( log10( static_cast< double >( dimension * dimension - 1 ) ) ) ) + 2; size_t col; for ( size_t row = 0; row < dimension; row++ ) { for ( col = 0; col < dimension; col++ ) cout << setw( fieldWidth ) << ( *spiralArrayPtr )[ row ][ col ]; cout << endl; } } int main() { printSpiralArray( getSpiralArray( 5 ) ); }
Transform the following Go implementation into C++, maintaining the same output and logic.
package main import ( "fmt" "strconv" ) var n = 5 func main() { if n < 1 { return } top, left, bottom, right := 0, 0, n-1, n-1 sz := n * n a := make([]int, sz) i := 0 for left < right { for c := left; c <= right; c++ { a[top*n+c] = i i++ } top++ for r := top; r <= bottom; r++ { a[r*n+right] = i i++ } right-- if top == bottom { break } for c := right; c >= left; c-- { a[bottom*n+c] = i i++ } bottom-- for r := bottom; r >= top; r-- { a[r*n+left] = i i++ } left++ } a[top*n+left] = i w := len(strconv.Itoa(n*n - 1)) for i, e := range a { fmt.Printf("%*d ", w, e) if i%n == n-1 { fmt.Println("") } } }
#include <vector> #include <memory> #include <cmath> #include <iostream> #include <iomanip> using namespace std; typedef vector< int > IntRow; typedef vector< IntRow > IntTable; auto_ptr< IntTable > getSpiralArray( int dimension ) { auto_ptr< IntTable > spiralArrayPtr( new IntTable( dimension, IntRow( dimension ) ) ); int numConcentricSquares = static_cast< int >( ceil( static_cast< double >( dimension ) / 2.0 ) ); int j; int sideLen = dimension; int currNum = 0; for ( int i = 0; i < numConcentricSquares; i++ ) { for ( j = 0; j < sideLen; j++ ) ( *spiralArrayPtr )[ i ][ i + j ] = currNum++; for ( j = 1; j < sideLen; j++ ) ( *spiralArrayPtr )[ i + j ][ dimension - 1 - i ] = currNum++; for ( j = sideLen - 2; j > -1; j-- ) ( *spiralArrayPtr )[ dimension - 1 - i ][ i + j ] = currNum++; for ( j = sideLen - 2; j > 0; j-- ) ( *spiralArrayPtr )[ i + j ][ i ] = currNum++; sideLen -= 2; } return spiralArrayPtr; } void printSpiralArray( const auto_ptr< IntTable >& spiralArrayPtr ) { size_t dimension = spiralArrayPtr->size(); int fieldWidth = static_cast< int >( floor( log10( static_cast< double >( dimension * dimension - 1 ) ) ) ) + 2; size_t col; for ( size_t row = 0; row < dimension; row++ ) { for ( col = 0; col < dimension; col++ ) cout << setw( fieldWidth ) << ( *spiralArrayPtr )[ row ][ col ]; cout << endl; } } int main() { printSpiralArray( getSpiralArray( 5 ) ); }
Transform the following Go implementation into C++, maintaining the same output and logic.
type cell string type spec struct { less func(cell, cell) bool column int reverse bool } func newSpec() (s spec) { return } t.sort(newSpec()) s := newSpec s.reverse = true t.sort(s)
#include <vector> #include <algorithm> #include <string> template <class T> struct sort_table_functor { typedef bool (*CompFun)(const T &, const T &); const CompFun ordering; const int column; const bool reverse; sort_table_functor(CompFun o, int c, bool r) : ordering(o), column(c), reverse(r) { } bool operator()(const std::vector<T> &x, const std::vector<T> &y) const { const T &a = x[column], &b = y[column]; return reverse ? ordering(b, a) : ordering(a, b); } }; template <class T> bool myLess(const T &x, const T &y) { return x < y; } template <class T> void sort_table(std::vector<std::vector<T> > &table, int column = 0, bool reverse = false, bool (*ordering)(const T &, const T &) = myLess) { std::sort(table.begin(), table.end(), sort_table_functor<T>(ordering, column, reverse)); } #include <iostream> template <class T> void print_matrix(std::vector<std::vector<T> > &data) { for () { for (int j = 0; j < 3; j++) std::cout << data[i][j] << "\t"; std::cout << std::endl; } } bool desc_len_comparator(const std::string &x, const std::string &y) { return x.length() > y.length(); } int main() { std::string data_array[3][3] = { {"a", "b", "c"}, {"", "q", "z"}, {"zap", "zip", "Zot"} }; std::vector<std::vector<std::string> > data_orig; for (int i = 0; i < 3; i++) { std::vector<std::string> row; for (int j = 0; j < 3; j++) row.push_back(data_array[i][j]); data_orig.push_back(row); } print_matrix(data_orig); std::vector<std::vector<std::string> > data = data_orig; sort_table(data); print_matrix(data); data = data_orig; sort_table(data, 2); print_matrix(data); data = data_orig; sort_table(data, 1); print_matrix(data); data = data_orig; sort_table(data, 1, true); print_matrix(data); data = data_orig; sort_table(data, 0, false, desc_len_comparator); print_matrix(data); return 0; }
Translate this program into C++ but keep the logic exactly as in Go.
package main import ( "fmt" "image" "image/color" "image/draw" "image/png" "math/rand" "os" "time" ) const ( imageWidth = 300 imageHeight = 200 nSites = 10 ) func main() { writePngFile(generateVoronoi(randomSites())) } func generateVoronoi(sx, sy []int) image.Image { sc := make([]color.NRGBA, nSites) for i := range sx { sc[i] = color.NRGBA{uint8(rand.Intn(256)), uint8(rand.Intn(256)), uint8(rand.Intn(256)), 255} } img := image.NewNRGBA(image.Rect(0, 0, imageWidth, imageHeight)) for x := 0; x < imageWidth; x++ { for y := 0; y < imageHeight; y++ { dMin := dot(imageWidth, imageHeight) var sMin int for s := 0; s < nSites; s++ { if d := dot(sx[s]-x, sy[s]-y); d < dMin { sMin = s dMin = d } } img.SetNRGBA(x, y, sc[sMin]) } } black := image.NewUniform(color.Black) for s := 0; s < nSites; s++ { draw.Draw(img, image.Rect(sx[s]-2, sy[s]-2, sx[s]+2, sy[s]+2), black, image.ZP, draw.Src) } return img } func dot(x, y int) int { return x*x + y*y } func randomSites() (sx, sy []int) { rand.Seed(time.Now().Unix()) sx = make([]int, nSites) sy = make([]int, nSites) for i := range sx { sx[i] = rand.Intn(imageWidth) sy[i] = rand.Intn(imageHeight) } return } func writePngFile(img image.Image) { f, err := os.Create("voronoi.png") if err != nil { fmt.Println(err) return } if err = png.Encode(f, img); err != nil { fmt.Println(err) } if err = f.Close(); err != nil { fmt.Println(err) } }
#include <windows.h> #include <vector> #include <string> using namespace std; struct Point { int x, y; }; class MyBitmap { public: MyBitmap() : pen_(nullptr) {} ~MyBitmap() { DeleteObject(pen_); DeleteDC(hdc_); DeleteObject(bmp_); } bool Create(int w, int h) { BITMAPINFO bi; ZeroMemory(&bi, sizeof(bi)); bi.bmiHeader.biSize = sizeof(bi.bmiHeader); bi.bmiHeader.biBitCount = sizeof(DWORD) * 8; bi.bmiHeader.biCompression = BI_RGB; bi.bmiHeader.biPlanes = 1; bi.bmiHeader.biWidth = w; bi.bmiHeader.biHeight = -h; void *bits_ptr = nullptr; HDC dc = GetDC(GetConsoleWindow()); bmp_ = CreateDIBSection(dc, &bi, DIB_RGB_COLORS, &bits_ptr, nullptr, 0); if (!bmp_) return false; hdc_ = CreateCompatibleDC(dc); SelectObject(hdc_, bmp_); ReleaseDC(GetConsoleWindow(), dc); width_ = w; height_ = h; return true; } void SetPenColor(DWORD clr) { if (pen_) DeleteObject(pen_); pen_ = CreatePen(PS_SOLID, 1, clr); SelectObject(hdc_, pen_); } bool SaveBitmap(const char* path) { HANDLE file = CreateFile(path, GENERIC_WRITE, 0, nullptr, CREATE_ALWAYS, FILE_ATTRIBUTE_NORMAL, nullptr); if (file == INVALID_HANDLE_VALUE) { return false; } BITMAPFILEHEADER fileheader; BITMAPINFO infoheader; BITMAP bitmap; GetObject(bmp_, sizeof(bitmap), &bitmap); DWORD* dwp_bits = new DWORD[bitmap.bmWidth * bitmap.bmHeight]; ZeroMemory(dwp_bits, bitmap.bmWidth * bitmap.bmHeight * sizeof(DWORD)); ZeroMemory(&infoheader, sizeof(BITMAPINFO)); ZeroMemory(&fileheader, sizeof(BITMAPFILEHEADER)); infoheader.bmiHeader.biBitCount = sizeof(DWORD) * 8; infoheader.bmiHeader.biCompression = BI_RGB; infoheader.bmiHeader.biPlanes = 1; infoheader.bmiHeader.biSize = sizeof(infoheader.bmiHeader); infoheader.bmiHeader.biHeight = bitmap.bmHeight; infoheader.bmiHeader.biWidth = bitmap.bmWidth; infoheader.bmiHeader.biSizeImage = bitmap.bmWidth * bitmap.bmHeight * sizeof(DWORD); fileheader.bfType = 0x4D42; fileheader.bfOffBits = sizeof(infoheader.bmiHeader) + sizeof(BITMAPFILEHEADER); fileheader.bfSize = fileheader.bfOffBits + infoheader.bmiHeader.biSizeImage; GetDIBits(hdc_, bmp_, 0, height_, (LPVOID)dwp_bits, &infoheader, DIB_RGB_COLORS); DWORD wb; WriteFile(file, &fileheader, sizeof(BITMAPFILEHEADER), &wb, nullptr); WriteFile(file, &infoheader.bmiHeader, sizeof(infoheader.bmiHeader), &wb, nullptr); WriteFile(file, dwp_bits, bitmap.bmWidth * bitmap.bmHeight * 4, &wb, nullptr); CloseHandle(file); delete[] dwp_bits; return true; } HDC hdc() { return hdc_; } int width() { return width_; } int height() { return height_; } private: HBITMAP bmp_; HDC hdc_; HPEN pen_; int width_, height_; }; static int DistanceSqrd(const Point& point, int x, int y) { int xd = x - point.x; int yd = y - point.y; return (xd * xd) + (yd * yd); } class Voronoi { public: void Make(MyBitmap* bmp, int count) { bmp_ = bmp; CreatePoints(count); CreateColors(); CreateSites(); SetSitesPoints(); } private: void CreateSites() { int w = bmp_->width(), h = bmp_->height(), d; for (int hh = 0; hh < h; hh++) { for (int ww = 0; ww < w; ww++) { int ind = -1, dist = INT_MAX; for (size_t it = 0; it < points_.size(); it++) { const Point& p = points_[it]; d = DistanceSqrd(p, ww, hh); if (d < dist) { dist = d; ind = it; } } if (ind > -1) SetPixel(bmp_->hdc(), ww, hh, colors_[ind]); else __asm nop } } } void SetSitesPoints() { for (const auto& point : points_) { int x = point.x, y = point.y; for (int i = -1; i < 2; i++) for (int j = -1; j < 2; j++) SetPixel(bmp_->hdc(), x + i, y + j, 0); } } void CreatePoints(int count) { const int w = bmp_->width() - 20, h = bmp_->height() - 20; for (int i = 0; i < count; i++) { points_.push_back({ rand() % w + 10, rand() % h + 10 }); } } void CreateColors() { for (size_t i = 0; i < points_.size(); i++) { DWORD c = RGB(rand() % 200 + 50, rand() % 200 + 55, rand() % 200 + 50); colors_.push_back(c); } } vector<Point> points_; vector<DWORD> colors_; MyBitmap* bmp_; }; int main(int argc, char* argv[]) { ShowWindow(GetConsoleWindow(), SW_MAXIMIZE); srand(GetTickCount()); MyBitmap bmp; bmp.Create(512, 512); bmp.SetPenColor(0); Voronoi v; v.Make(&bmp, 50); BitBlt(GetDC(GetConsoleWindow()), 20, 20, 512, 512, bmp.hdc(), 0, 0, SRCCOPY); bmp.SaveBitmap("v.bmp"); system("pause"); return 0; }
Transform the following Go implementation into C++, maintaining the same output and logic.
package main import ( "fmt" "image" "image/color" "image/draw" "image/png" "math/rand" "os" "time" ) const ( imageWidth = 300 imageHeight = 200 nSites = 10 ) func main() { writePngFile(generateVoronoi(randomSites())) } func generateVoronoi(sx, sy []int) image.Image { sc := make([]color.NRGBA, nSites) for i := range sx { sc[i] = color.NRGBA{uint8(rand.Intn(256)), uint8(rand.Intn(256)), uint8(rand.Intn(256)), 255} } img := image.NewNRGBA(image.Rect(0, 0, imageWidth, imageHeight)) for x := 0; x < imageWidth; x++ { for y := 0; y < imageHeight; y++ { dMin := dot(imageWidth, imageHeight) var sMin int for s := 0; s < nSites; s++ { if d := dot(sx[s]-x, sy[s]-y); d < dMin { sMin = s dMin = d } } img.SetNRGBA(x, y, sc[sMin]) } } black := image.NewUniform(color.Black) for s := 0; s < nSites; s++ { draw.Draw(img, image.Rect(sx[s]-2, sy[s]-2, sx[s]+2, sy[s]+2), black, image.ZP, draw.Src) } return img } func dot(x, y int) int { return x*x + y*y } func randomSites() (sx, sy []int) { rand.Seed(time.Now().Unix()) sx = make([]int, nSites) sy = make([]int, nSites) for i := range sx { sx[i] = rand.Intn(imageWidth) sy[i] = rand.Intn(imageHeight) } return } func writePngFile(img image.Image) { f, err := os.Create("voronoi.png") if err != nil { fmt.Println(err) return } if err = png.Encode(f, img); err != nil { fmt.Println(err) } if err = f.Close(); err != nil { fmt.Println(err) } }
#include <windows.h> #include <vector> #include <string> using namespace std; struct Point { int x, y; }; class MyBitmap { public: MyBitmap() : pen_(nullptr) {} ~MyBitmap() { DeleteObject(pen_); DeleteDC(hdc_); DeleteObject(bmp_); } bool Create(int w, int h) { BITMAPINFO bi; ZeroMemory(&bi, sizeof(bi)); bi.bmiHeader.biSize = sizeof(bi.bmiHeader); bi.bmiHeader.biBitCount = sizeof(DWORD) * 8; bi.bmiHeader.biCompression = BI_RGB; bi.bmiHeader.biPlanes = 1; bi.bmiHeader.biWidth = w; bi.bmiHeader.biHeight = -h; void *bits_ptr = nullptr; HDC dc = GetDC(GetConsoleWindow()); bmp_ = CreateDIBSection(dc, &bi, DIB_RGB_COLORS, &bits_ptr, nullptr, 0); if (!bmp_) return false; hdc_ = CreateCompatibleDC(dc); SelectObject(hdc_, bmp_); ReleaseDC(GetConsoleWindow(), dc); width_ = w; height_ = h; return true; } void SetPenColor(DWORD clr) { if (pen_) DeleteObject(pen_); pen_ = CreatePen(PS_SOLID, 1, clr); SelectObject(hdc_, pen_); } bool SaveBitmap(const char* path) { HANDLE file = CreateFile(path, GENERIC_WRITE, 0, nullptr, CREATE_ALWAYS, FILE_ATTRIBUTE_NORMAL, nullptr); if (file == INVALID_HANDLE_VALUE) { return false; } BITMAPFILEHEADER fileheader; BITMAPINFO infoheader; BITMAP bitmap; GetObject(bmp_, sizeof(bitmap), &bitmap); DWORD* dwp_bits = new DWORD[bitmap.bmWidth * bitmap.bmHeight]; ZeroMemory(dwp_bits, bitmap.bmWidth * bitmap.bmHeight * sizeof(DWORD)); ZeroMemory(&infoheader, sizeof(BITMAPINFO)); ZeroMemory(&fileheader, sizeof(BITMAPFILEHEADER)); infoheader.bmiHeader.biBitCount = sizeof(DWORD) * 8; infoheader.bmiHeader.biCompression = BI_RGB; infoheader.bmiHeader.biPlanes = 1; infoheader.bmiHeader.biSize = sizeof(infoheader.bmiHeader); infoheader.bmiHeader.biHeight = bitmap.bmHeight; infoheader.bmiHeader.biWidth = bitmap.bmWidth; infoheader.bmiHeader.biSizeImage = bitmap.bmWidth * bitmap.bmHeight * sizeof(DWORD); fileheader.bfType = 0x4D42; fileheader.bfOffBits = sizeof(infoheader.bmiHeader) + sizeof(BITMAPFILEHEADER); fileheader.bfSize = fileheader.bfOffBits + infoheader.bmiHeader.biSizeImage; GetDIBits(hdc_, bmp_, 0, height_, (LPVOID)dwp_bits, &infoheader, DIB_RGB_COLORS); DWORD wb; WriteFile(file, &fileheader, sizeof(BITMAPFILEHEADER), &wb, nullptr); WriteFile(file, &infoheader.bmiHeader, sizeof(infoheader.bmiHeader), &wb, nullptr); WriteFile(file, dwp_bits, bitmap.bmWidth * bitmap.bmHeight * 4, &wb, nullptr); CloseHandle(file); delete[] dwp_bits; return true; } HDC hdc() { return hdc_; } int width() { return width_; } int height() { return height_; } private: HBITMAP bmp_; HDC hdc_; HPEN pen_; int width_, height_; }; static int DistanceSqrd(const Point& point, int x, int y) { int xd = x - point.x; int yd = y - point.y; return (xd * xd) + (yd * yd); } class Voronoi { public: void Make(MyBitmap* bmp, int count) { bmp_ = bmp; CreatePoints(count); CreateColors(); CreateSites(); SetSitesPoints(); } private: void CreateSites() { int w = bmp_->width(), h = bmp_->height(), d; for (int hh = 0; hh < h; hh++) { for (int ww = 0; ww < w; ww++) { int ind = -1, dist = INT_MAX; for (size_t it = 0; it < points_.size(); it++) { const Point& p = points_[it]; d = DistanceSqrd(p, ww, hh); if (d < dist) { dist = d; ind = it; } } if (ind > -1) SetPixel(bmp_->hdc(), ww, hh, colors_[ind]); else __asm nop } } } void SetSitesPoints() { for (const auto& point : points_) { int x = point.x, y = point.y; for (int i = -1; i < 2; i++) for (int j = -1; j < 2; j++) SetPixel(bmp_->hdc(), x + i, y + j, 0); } } void CreatePoints(int count) { const int w = bmp_->width() - 20, h = bmp_->height() - 20; for (int i = 0; i < count; i++) { points_.push_back({ rand() % w + 10, rand() % h + 10 }); } } void CreateColors() { for (size_t i = 0; i < points_.size(); i++) { DWORD c = RGB(rand() % 200 + 50, rand() % 200 + 55, rand() % 200 + 50); colors_.push_back(c); } } vector<Point> points_; vector<DWORD> colors_; MyBitmap* bmp_; }; int main(int argc, char* argv[]) { ShowWindow(GetConsoleWindow(), SW_MAXIMIZE); srand(GetTickCount()); MyBitmap bmp; bmp.Create(512, 512); bmp.SetPenColor(0); Voronoi v; v.Make(&bmp, 50); BitBlt(GetDC(GetConsoleWindow()), 20, 20, 512, 512, bmp.hdc(), 0, 0, SRCCOPY); bmp.SaveBitmap("v.bmp"); system("pause"); return 0; }
Produce a language-to-language conversion: from Go to C++, same semantics.
package main import "C" import ( "fmt" "unsafe" ) func main() { go1 := "hello C" c1 := C.CString(go1) go1 = "" c2 := C.strdup(c1) C.free(unsafe.Pointer(c1)) go2 := C.GoString(c2) C.free(unsafe.Pointer(c2)) fmt.Println(go2) }
FUNCTION MULTIPLY(X, Y) DOUBLE PRECISION MULTIPLY, X, Y
Maintain the same structure and functionality when rewriting this code in C++.
package main import ( "fmt" "math/rand" "time" ) func sOfNCreator(n int) func(byte) []byte { s := make([]byte, 0, n) m := n return func(item byte) []byte { if len(s) < n { s = append(s, item) } else { m++ if rand.Intn(m) < n { s[rand.Intn(n)] = item } } return s } } func main() { rand.Seed(time.Now().UnixNano()) var freq [10]int for r := 0; r < 1e5; r++ { sOfN := sOfNCreator(3) for d := byte('0'); d < '9'; d++ { sOfN(d) } for _, d := range sOfN('9') { freq[d-'0']++ } } fmt.Println(freq) }
#include <iostream> #include <functional> #include <vector> #include <cstdlib> #include <ctime> template <typename T> std::function<std::vector<T>(T)> s_of_n_creator(int n) { std::vector<T> sample; int i = 0; return [=](T item) mutable { i++; if (i <= n) { sample.push_back(item); } else if (std::rand() % i < n) { sample[std::rand() % n] = item; } return sample; }; } int main() { std::srand(std::time(NULL)); int bin[10] = {0}; for (int trial = 0; trial < 100000; trial++) { auto s_of_n = s_of_n_creator<int>(3); std::vector<int> sample; for (int i = 0; i < 10; i++) sample = s_of_n(i); for (int s : sample) bin[s]++; } for (int x : bin) std::cout << x << std::endl; return 0; }
Can you help me rewrite this code in C++ instead of Go, keeping it the same logically?
package main import ( "fmt" "math/rand" "time" ) func sOfNCreator(n int) func(byte) []byte { s := make([]byte, 0, n) m := n return func(item byte) []byte { if len(s) < n { s = append(s, item) } else { m++ if rand.Intn(m) < n { s[rand.Intn(n)] = item } } return s } } func main() { rand.Seed(time.Now().UnixNano()) var freq [10]int for r := 0; r < 1e5; r++ { sOfN := sOfNCreator(3) for d := byte('0'); d < '9'; d++ { sOfN(d) } for _, d := range sOfN('9') { freq[d-'0']++ } } fmt.Println(freq) }
#include <iostream> #include <functional> #include <vector> #include <cstdlib> #include <ctime> template <typename T> std::function<std::vector<T>(T)> s_of_n_creator(int n) { std::vector<T> sample; int i = 0; return [=](T item) mutable { i++; if (i <= n) { sample.push_back(item); } else if (std::rand() % i < n) { sample[std::rand() % n] = item; } return sample; }; } int main() { std::srand(std::time(NULL)); int bin[10] = {0}; for (int trial = 0; trial < 100000; trial++) { auto s_of_n = s_of_n_creator<int>(3); std::vector<int> sample; for (int i = 0; i < 10; i++) sample = s_of_n(i); for (int s : sample) bin[s]++; } for (int x : bin) std::cout << x << std::endl; return 0; }
Produce a language-to-language conversion: from Go to C++, same semantics.
package main import ( "fmt" "math/big" ) func bernoulli(n uint) *big.Rat { a := make([]big.Rat, n+1) z := new(big.Rat) for m := range a { a[m].SetFrac64(1, int64(m+1)) for j := m; j >= 1; j-- { d := &a[j-1] d.Mul(z.SetInt64(int64(j)), d.Sub(d, &a[j])) } } if n != 1 { return &a[0] } a[0].Neg(&a[0]) return &a[0] } func binomial(n, k int) int64 { if n <= 0 || k <= 0 || n < k { return 1 } var num, den int64 = 1, 1 for i := k + 1; i <= n; i++ { num *= int64(i) } for i := 2; i <= n-k; i++ { den *= int64(i) } return num / den } func faulhaberTriangle(p int) []big.Rat { coeffs := make([]big.Rat, p+1) q := big.NewRat(1, int64(p)+1) t := new(big.Rat) u := new(big.Rat) sign := -1 for j := range coeffs { sign *= -1 d := &coeffs[p-j] t.SetInt64(int64(sign)) u.SetInt64(binomial(p+1, j)) d.Mul(q, t) d.Mul(d, u) d.Mul(d, bernoulli(uint(j))) } return coeffs } func main() { for i := 0; i < 10; i++ { coeffs := faulhaberTriangle(i) for _, coeff := range coeffs { fmt.Printf("%5s ", coeff.RatString()) } fmt.Println() } fmt.Println() k := 17 cc := faulhaberTriangle(k) n := int64(1000) nn := big.NewRat(n, 1) np := big.NewRat(1, 1) sum := new(big.Rat) tmp := new(big.Rat) for _, c := range cc { np.Mul(np, nn) tmp.Set(np) tmp.Mul(tmp, &c) sum.Add(sum, tmp) } fmt.Println(sum.RatString()) }
#include <exception> #include <iomanip> #include <iostream> #include <numeric> #include <sstream> #include <vector> class Frac { public: Frac() : num(0), denom(1) {} Frac(int n, int d) { if (d == 0) { throw std::runtime_error("d must not be zero"); } int sign_of_d = d < 0 ? -1 : 1; int g = std::gcd(n, d); num = sign_of_d * n / g; denom = sign_of_d * d / g; } Frac operator-() const { return Frac(-num, denom); } Frac operator+(const Frac& rhs) const { return Frac(num*rhs.denom + denom * rhs.num, rhs.denom*denom); } Frac operator-(const Frac& rhs) const { return Frac(num*rhs.denom - denom * rhs.num, rhs.denom*denom); } Frac operator*(const Frac& rhs) const { return Frac(num*rhs.num, denom*rhs.denom); } Frac operator*(int rhs) const { return Frac(num * rhs, denom); } friend std::ostream& operator<<(std::ostream&, const Frac&); private: int num; int denom; }; std::ostream & operator<<(std::ostream & os, const Frac &f) { if (f.num == 0 || f.denom == 1) { return os << f.num; } std::stringstream ss; ss << f.num << "/" << f.denom; return os << ss.str(); } Frac bernoulli(int n) { if (n < 0) { throw std::runtime_error("n may not be negative or zero"); } std::vector<Frac> a; for (int m = 0; m <= n; m++) { a.push_back(Frac(1, m + 1)); for (int j = m; j >= 1; j--) { a[j - 1] = (a[j - 1] - a[j]) * j; } } if (n != 1) return a[0]; return -a[0]; } int binomial(int n, int k) { if (n < 0 || k < 0 || n < k) { throw std::runtime_error("parameters are invalid"); } if (n == 0 || k == 0) return 1; int num = 1; for (int i = k + 1; i <= n; i++) { num *= i; } int denom = 1; for (int i = 2; i <= n - k; i++) { denom *= i; } return num / denom; } std::vector<Frac> faulhaberTraingle(int p) { std::vector<Frac> coeffs(p + 1); Frac q{ 1, p + 1 }; int sign = -1; for (int j = 0; j <= p; j++) { sign *= -1; coeffs[p - j] = q * sign * binomial(p + 1, j) * bernoulli(j); } return coeffs; } int main() { for (int i = 0; i < 10; i++) { std::vector<Frac> coeffs = faulhaberTraingle(i); for (auto frac : coeffs) { std::cout << std::right << std::setw(5) << frac << " "; } std::cout << std::endl; } return 0; }
Convert this Go snippet to C++ and keep its semantics consistent.
package main import ( "fmt" "os" ) func main() { for i, x := range os.Args[1:] { fmt.Printf("the argument #%d is %s\n", i, x) } }
#include <iostream> int main(int argc, char* argv[]) { std::cout << "This program is named " << argv[0] << std::endl; std::cout << "There are " << argc-1 << " arguments given." << std::endl; for (int i = 1; i < argc; ++i) std::cout << "the argument #" << i << " is " << argv[i] << std::endl; return 0; }
Rewrite the snippet below in C++ so it works the same as the original Go code.
package main import ( "fmt" "os" ) func main() { for i, x := range os.Args[1:] { fmt.Printf("the argument #%d is %s\n", i, x) } }
#include <iostream> int main(int argc, char* argv[]) { std::cout << "This program is named " << argv[0] << std::endl; std::cout << "There are " << argc-1 << " arguments given." << std::endl; for (int i = 1; i < argc; ++i) std::cout << "the argument #" << i << " is " << argv[i] << std::endl; return 0; }
Transform the following Go implementation into C++, maintaining the same output and logic.
package main import ( "bytes" "fmt" "io/ioutil" "log" "sort" "strings" ) func main() { b, err := ioutil.ReadFile("unixdict.txt") if err != nil { log.Fatal("Error reading file") } letters := "deegklnow" wordsAll := bytes.Split(b, []byte{'\n'}) var words [][]byte for _, word := range wordsAll { word = bytes.TrimSpace(word) le := len(word) if le > 2 && le < 10 { words = append(words, word) } } var found []string for _, word := range words { le := len(word) if bytes.IndexByte(word, 'k') >= 0 { lets := letters ok := true for i := 0; i < le; i++ { c := word[i] ix := sort.Search(len(lets), func(i int) bool { return lets[i] >= c }) if ix < len(lets) && lets[ix] == c { lets = lets[0:ix] + lets[ix+1:] } else { ok = false break } } if ok { found = append(found, string(word)) } } } fmt.Println("The following", len(found), "words are the solutions to the puzzle:") fmt.Println(strings.Join(found, "\n")) mostFound := 0 var mostWords9 []string var mostLetters []byte var words9 [][]byte for _, word := range words { if len(word) == 9 { words9 = append(words9, word) } } for _, word9 := range words9 { letterBytes := make([]byte, len(word9)) copy(letterBytes, word9) sort.Slice(letterBytes, func(i, j int) bool { return letterBytes[i] < letterBytes[j] }) distinctBytes := []byte{letterBytes[0]} for _, b := range letterBytes[1:] { if b != distinctBytes[len(distinctBytes)-1] { distinctBytes = append(distinctBytes, b) } } distinctLetters := string(distinctBytes) for _, letter := range distinctLetters { found := 0 letterByte := byte(letter) for _, word := range words { le := len(word) if bytes.IndexByte(word, letterByte) >= 0 { lets := string(letterBytes) ok := true for i := 0; i < le; i++ { c := word[i] ix := sort.Search(len(lets), func(i int) bool { return lets[i] >= c }) if ix < len(lets) && lets[ix] == c { lets = lets[0:ix] + lets[ix+1:] } else { ok = false break } } if ok { found = found + 1 } } } if found > mostFound { mostFound = found mostWords9 = []string{string(word9)} mostLetters = []byte{letterByte} } else if found == mostFound { mostWords9 = append(mostWords9, string(word9)) mostLetters = append(mostLetters, letterByte) } } } fmt.Println("\nMost words found =", mostFound) fmt.Println("Nine letter words producing this total:") for i := 0; i < len(mostWords9); i++ { fmt.Println(mostWords9[i], "with central letter", string(mostLetters[i])) } }
#include <array> #include <iostream> #include <fstream> #include <map> #include <string> #include <vector> #include <boost/program_options.hpp> class letterset { public: letterset() { count_.fill(0); } explicit letterset(const std::string& str) { count_.fill(0); for (char c : str) add(c); } bool contains(const letterset& set) const { for (size_t i = 0; i < count_.size(); ++i) { if (set.count_[i] > count_[i]) return false; } return true; } unsigned int count(char c) const { return count_[index(c)]; } bool is_valid() const { return count_[0] == 0; } void add(char c) { ++count_[index(c)]; } private: static bool is_letter(char c) { return c >= 'a' && c <= 'z'; } static int index(char c) { return is_letter(c) ? c - 'a' + 1 : 0; } std::array<unsigned int, 27> count_; }; template <typename iterator, typename separator> std::string join(iterator begin, iterator end, separator sep) { std::string result; if (begin != end) { result += *begin++; for (; begin != end; ++begin) { result += sep; result += *begin; } } return result; } using dictionary = std::vector<std::pair<std::string, letterset>>; dictionary load_dictionary(const std::string& filename, int min_length, int max_length) { std::ifstream in(filename); if (!in) throw std::runtime_error("Cannot open file " + filename); std::string word; dictionary result; while (getline(in, word)) { if (word.size() < min_length) continue; if (word.size() > max_length) continue; letterset set(word); if (set.is_valid()) result.emplace_back(word, set); } return result; } void word_wheel(const dictionary& dict, const std::string& letters, char central_letter) { letterset set(letters); if (central_letter == 0 && !letters.empty()) central_letter = letters.at(letters.size()/2); std::map<size_t, std::vector<std::string>> words; for (const auto& pair : dict) { const auto& word = pair.first; const auto& subset = pair.second; if (subset.count(central_letter) > 0 && set.contains(subset)) words[word.size()].push_back(word); } size_t total = 0; for (const auto& p : words) { const auto& v = p.second; auto n = v.size(); total += n; std::cout << "Found " << n << " " << (n == 1 ? "word" : "words") << " of length " << p.first << ": " << join(v.begin(), v.end(), ", ") << '\n'; } std::cout << "Number of words found: " << total << '\n'; } void find_max_word_count(const dictionary& dict, int word_length) { size_t max_count = 0; std::vector<std::pair<std::string, char>> max_words; for (const auto& pair : dict) { const auto& word = pair.first; if (word.size() != word_length) continue; const auto& set = pair.second; dictionary subsets; for (const auto& p : dict) { if (set.contains(p.second)) subsets.push_back(p); } letterset done; for (size_t index = 0; index < word_length; ++index) { char central_letter = word[index]; if (done.count(central_letter) > 0) continue; done.add(central_letter); size_t count = 0; for (const auto& p : subsets) { const auto& subset = p.second; if (subset.count(central_letter) > 0) ++count; } if (count > max_count) { max_words.clear(); max_count = count; } if (count == max_count) max_words.emplace_back(word, central_letter); } } std::cout << "Maximum word count: " << max_count << '\n'; std::cout << "Words of " << word_length << " letters producing this count:\n"; for (const auto& pair : max_words) std::cout << pair.first << " with central letter " << pair.second << '\n'; } constexpr const char* option_filename = "filename"; constexpr const char* option_wheel = "wheel"; constexpr const char* option_central = "central"; constexpr const char* option_min_length = "min-length"; constexpr const char* option_part2 = "part2"; int main(int argc, char** argv) { const int word_length = 9; int min_length = 3; std::string letters = "ndeokgelw"; std::string filename = "unixdict.txt"; char central_letter = 0; bool do_part2 = false; namespace po = boost::program_options; po::options_description desc("Allowed options"); desc.add_options() (option_filename, po::value<std::string>(), "name of dictionary file") (option_wheel, po::value<std::string>(), "word wheel letters") (option_central, po::value<char>(), "central letter (defaults to middle letter of word)") (option_min_length, po::value<int>(), "minimum word length") (option_part2, "include part 2"); try { po::variables_map vm; po::store(po::parse_command_line(argc, argv, desc), vm); po::notify(vm); if (vm.count(option_filename)) filename = vm[option_filename].as<std::string>(); if (vm.count(option_wheel)) letters = vm[option_wheel].as<std::string>(); if (vm.count(option_central)) central_letter = vm[option_central].as<char>(); if (vm.count(option_min_length)) min_length = vm[option_min_length].as<int>(); if (vm.count(option_part2)) do_part2 = true; auto dict = load_dictionary(filename, min_length, word_length); word_wheel(dict, letters, central_letter); if (do_part2) { std::cout << '\n'; find_max_word_count(dict, word_length); } } catch (const std::exception& ex) { std::cerr << ex.what() << '\n'; return EXIT_FAILURE; } return EXIT_SUCCESS; }
Convert this Go block to C++, preserving its control flow and logic.
package main import "fmt" func main() { a := []int{1, 2, 3} b := []int{7, 12, 60} c := append(a, b...) fmt.Println(c) i := []interface{}{1, 2, 3} j := []interface{}{"Crosby", "Stills", "Nash", "Young"} k := append(i, j...) fmt.Println(k) l := [...]int{1, 2, 3} m := [...]int{7, 12, 60} var n [len(l) + len(m)]int copy(n[:], l[:]) copy(n[len(l):], m[:]) fmt.Println(n) }
#include <vector> #include <iostream> int main() { std::vector<int> a(3), b(4); a[0] = 11; a[1] = 12; a[2] = 13; b[0] = 21; b[1] = 22; b[2] = 23; b[3] = 24; a.insert(a.end(), b.begin(), b.end()); for (int i = 0; i < a.size(); ++i) std::cout << "a[" << i << "] = " << a[i] << "\n"; }
Port the provided Go code into C++ while preserving the original functionality.
package main import "fmt" func main() { var s string var i int if _, err := fmt.Scan(&s, &i); err == nil && i == 75000 { fmt.Println("good") } else { fmt.Println("wrong") } }
#include <iostream> #include <string> using namespace std; int main() { long int integer_input; string string_input; cout << "Enter an integer: "; cin >> integer_input; cout << "Enter a string: "; cin >> string_input; return 0; }
Change the following Go code into C++ without altering its purpose.
package main import "fmt" func main() { var s string var i int if _, err := fmt.Scan(&s, &i); err == nil && i == 75000 { fmt.Println("good") } else { fmt.Println("wrong") } }
#include <iostream> #include <string> using namespace std; int main() { long int integer_input; string string_input; cout << "Enter an integer: "; cin >> integer_input; cout << "Enter a string: "; cin >> string_input; return 0; }
Maintain the same structure and functionality when rewriting this code in C++.
package main import ( "encoding/binary" "log" "math" "os" "strings" ) func main() { const ( sampleRate = 44100 duration = 8 dataLength = sampleRate * duration hdrSize = 44 fileLen = dataLength + hdrSize - 8 ) buf1 := make([]byte, 1) buf2 := make([]byte, 2) buf4 := make([]byte, 4) var sb strings.Builder sb.WriteString("RIFF") binary.LittleEndian.PutUint32(buf4, fileLen) sb.Write(buf4) sb.WriteString("WAVE") sb.WriteString("fmt ") binary.LittleEndian.PutUint32(buf4, 16) sb.Write(buf4) binary.LittleEndian.PutUint16(buf2, 1) sb.Write(buf2) sb.Write(buf2) binary.LittleEndian.PutUint32(buf4, sampleRate) sb.Write(buf4) sb.Write(buf4) sb.Write(buf2) binary.LittleEndian.PutUint16(buf2, 8) sb.Write(buf2) sb.WriteString("data") binary.LittleEndian.PutUint32(buf4, dataLength) sb.Write(buf4) wavhdr := []byte(sb.String()) f, err := os.Create("notes.wav") if err != nil { log.Fatal(err) } defer f.Close() f.Write(wavhdr) freqs := [8]float64{261.6, 293.6, 329.6, 349.2, 392.0, 440.0, 493.9, 523.3} for j := 0; j < duration; j++ { freq := freqs[j] omega := 2 * math.Pi * freq for i := 0; i < dataLength/duration; i++ { y := 32 * math.Sin(omega*float64(i)/float64(sampleRate)) buf1[0] = byte(math.Round(y)) f.Write(buf1) } } }
#include <iostream> #include <windows.h> #include <mmsystem.h> #pragma comment ( lib, "winmm.lib" ) typedef unsigned char byte; typedef union { unsigned long word; unsigned char data[4]; } midi_msg; class midi { public: midi() { if( midiOutOpen( &device, 0, 0, 0, CALLBACK_NULL) != MMSYSERR_NOERROR ) { std::cout << "Error opening MIDI Output..." << std::endl; device = 0; } } ~midi() { midiOutReset( device ); midiOutClose( device ); } bool isOpen() { return device != 0; } void setInstrument( byte i ) { message.data[0] = 0xc0; message.data[1] = i; message.data[2] = 0; message.data[3] = 0; midiOutShortMsg( device, message.word ); } void playNote( byte n, unsigned i ) { playNote( n ); Sleep( i ); stopNote( n ); } private: void playNote( byte n ) { message.data[0] = 0x90; message.data[1] = n; message.data[2] = 127; message.data[3] = 0; midiOutShortMsg( device, message.word ); } void stopNote( byte n ) { message.data[0] = 0x90; message.data[1] = n; message.data[2] = 0; message.data[3] = 0; midiOutShortMsg( device, message.word ); } HMIDIOUT device; midi_msg message; }; int main( int argc, char* argv[] ) { midi m; if( m.isOpen() ) { byte notes[] = { 60, 62, 64, 65, 67, 69, 71, 72 }; m.setInstrument( 42 ); for( int x = 0; x < 8; x++ ) m.playNote( notes[x], rand() % 100 + 158 ); Sleep( 1000 ); } return 0; }
Transform the following Go implementation into C++, maintaining the same output and logic.
package main import ( "encoding/binary" "log" "math" "os" "strings" ) func main() { const ( sampleRate = 44100 duration = 8 dataLength = sampleRate * duration hdrSize = 44 fileLen = dataLength + hdrSize - 8 ) buf1 := make([]byte, 1) buf2 := make([]byte, 2) buf4 := make([]byte, 4) var sb strings.Builder sb.WriteString("RIFF") binary.LittleEndian.PutUint32(buf4, fileLen) sb.Write(buf4) sb.WriteString("WAVE") sb.WriteString("fmt ") binary.LittleEndian.PutUint32(buf4, 16) sb.Write(buf4) binary.LittleEndian.PutUint16(buf2, 1) sb.Write(buf2) sb.Write(buf2) binary.LittleEndian.PutUint32(buf4, sampleRate) sb.Write(buf4) sb.Write(buf4) sb.Write(buf2) binary.LittleEndian.PutUint16(buf2, 8) sb.Write(buf2) sb.WriteString("data") binary.LittleEndian.PutUint32(buf4, dataLength) sb.Write(buf4) wavhdr := []byte(sb.String()) f, err := os.Create("notes.wav") if err != nil { log.Fatal(err) } defer f.Close() f.Write(wavhdr) freqs := [8]float64{261.6, 293.6, 329.6, 349.2, 392.0, 440.0, 493.9, 523.3} for j := 0; j < duration; j++ { freq := freqs[j] omega := 2 * math.Pi * freq for i := 0; i < dataLength/duration; i++ { y := 32 * math.Sin(omega*float64(i)/float64(sampleRate)) buf1[0] = byte(math.Round(y)) f.Write(buf1) } } }
#include <iostream> #include <windows.h> #include <mmsystem.h> #pragma comment ( lib, "winmm.lib" ) typedef unsigned char byte; typedef union { unsigned long word; unsigned char data[4]; } midi_msg; class midi { public: midi() { if( midiOutOpen( &device, 0, 0, 0, CALLBACK_NULL) != MMSYSERR_NOERROR ) { std::cout << "Error opening MIDI Output..." << std::endl; device = 0; } } ~midi() { midiOutReset( device ); midiOutClose( device ); } bool isOpen() { return device != 0; } void setInstrument( byte i ) { message.data[0] = 0xc0; message.data[1] = i; message.data[2] = 0; message.data[3] = 0; midiOutShortMsg( device, message.word ); } void playNote( byte n, unsigned i ) { playNote( n ); Sleep( i ); stopNote( n ); } private: void playNote( byte n ) { message.data[0] = 0x90; message.data[1] = n; message.data[2] = 127; message.data[3] = 0; midiOutShortMsg( device, message.word ); } void stopNote( byte n ) { message.data[0] = 0x90; message.data[1] = n; message.data[2] = 0; message.data[3] = 0; midiOutShortMsg( device, message.word ); } HMIDIOUT device; midi_msg message; }; int main( int argc, char* argv[] ) { midi m; if( m.isOpen() ) { byte notes[] = { 60, 62, 64, 65, 67, 69, 71, 72 }; m.setInstrument( 42 ); for( int x = 0; x < 8; x++ ) m.playNote( notes[x], rand() % 100 + 158 ); Sleep( 1000 ); } return 0; }
Transform the following Go implementation into C++, maintaining the same output and logic.
package main import "fmt" type item struct { string w, v int } var wants = []item{ {"map", 9, 150}, {"compass", 13, 35}, {"water", 153, 200}, {"sandwich", 50, 160}, {"glucose", 15, 60}, {"tin", 68, 45}, {"banana", 27, 60}, {"apple", 39, 40}, {"cheese", 23, 30}, {"beer", 52, 10}, {"suntan cream", 11, 70}, {"camera", 32, 30}, {"T-shirt", 24, 15}, {"trousers", 48, 10}, {"umbrella", 73, 40}, {"waterproof trousers", 42, 70}, {"waterproof overclothes", 43, 75}, {"note-case", 22, 80}, {"sunglasses", 7, 20}, {"towel", 18, 12}, {"socks", 4, 50}, {"book", 30, 10}, } const maxWt = 400 func main() { items, w, v := m(len(wants)-1, maxWt) fmt.Println(items) fmt.Println("weight:", w) fmt.Println("value:", v) } func m(i, w int) ([]string, int, int) { if i < 0 || w == 0 { return nil, 0, 0 } else if wants[i].w > w { return m(i-1, w) } i0, w0, v0 := m(i-1, w) i1, w1, v1 := m(i-1, w-wants[i].w) v1 += wants[i].v if v1 > v0 { return append(i1, wants[i].string), w1 + wants[i].w, v1 } return i0, w0, v0 }
#include <vector> #include <string> #include <iostream> #include <boost/tuple/tuple.hpp> #include <set> int findBestPack( const std::vector<boost::tuple<std::string , int , int> > & , std::set<int> & , const int ) ; int main( ) { std::vector<boost::tuple<std::string , int , int> > items ; items.push_back( boost::make_tuple( "" , 0 , 0 ) ) ; items.push_back( boost::make_tuple( "map" , 9 , 150 ) ) ; items.push_back( boost::make_tuple( "compass" , 13 , 35 ) ) ; items.push_back( boost::make_tuple( "water" , 153 , 200 ) ) ; items.push_back( boost::make_tuple( "sandwich", 50 , 160 ) ) ; items.push_back( boost::make_tuple( "glucose" , 15 , 60 ) ) ; items.push_back( boost::make_tuple( "tin", 68 , 45 ) ) ; items.push_back( boost::make_tuple( "banana", 27 , 60 ) ) ; items.push_back( boost::make_tuple( "apple" , 39 , 40 ) ) ; items.push_back( boost::make_tuple( "cheese" , 23 , 30 ) ) ; items.push_back( boost::make_tuple( "beer" , 52 , 10 ) ) ; items.push_back( boost::make_tuple( "suntan creme" , 11 , 70 ) ) ; items.push_back( boost::make_tuple( "camera" , 32 , 30 ) ) ; items.push_back( boost::make_tuple( "T-shirt" , 24 , 15 ) ) ; items.push_back( boost::make_tuple( "trousers" , 48 , 10 ) ) ; items.push_back( boost::make_tuple( "umbrella" , 73 , 40 ) ) ; items.push_back( boost::make_tuple( "waterproof trousers" , 42 , 70 ) ) ; items.push_back( boost::make_tuple( "waterproof overclothes" , 43 , 75 ) ) ; items.push_back( boost::make_tuple( "note-case" , 22 , 80 ) ) ; items.push_back( boost::make_tuple( "sunglasses" , 7 , 20 ) ) ; items.push_back( boost::make_tuple( "towel" , 18 , 12 ) ) ; items.push_back( boost::make_tuple( "socks" , 4 , 50 ) ) ; items.push_back( boost::make_tuple( "book" , 30 , 10 ) ) ; const int maximumWeight = 400 ; std::set<int> bestItems ; int bestValue = findBestPack( items , bestItems , maximumWeight ) ; std::cout << "The best value that can be packed in the given knapsack is " << bestValue << " !\n" ; int totalweight = 0 ; std::cout << "The following items should be packed in the knapsack:\n" ; for ( std::set<int>::const_iterator si = bestItems.begin( ) ; si != bestItems.end( ) ; si++ ) { std::cout << (items.begin( ) + *si)->get<0>( ) << "\n" ; totalweight += (items.begin( ) + *si)->get<1>( ) ; } std::cout << "The total weight of all items is " << totalweight << " !\n" ; return 0 ; } int findBestPack( const std::vector<boost::tuple<std::string , int , int> > & items ,std::set<int> & bestItems , const int weightlimit ) { const int n = items.size( ) ; int bestValues [ n ][ weightlimit ] ; std::set<int> solutionSets[ n ][ weightlimit ] ; std::set<int> emptyset ; for ( int i = 0 ; i < n ; i++ ) { for ( int j = 0 ; j < weightlimit ; j++ ) { bestValues[ i ][ j ] = 0 ; solutionSets[ i ][ j ] = emptyset ; } } for ( int i = 0 ; i < n ; i++ ) { for ( int weight = 0 ; weight < weightlimit ; weight++ ) { if ( i == 0 ) bestValues[ i ][ weight ] = 0 ; else { int itemweight = (items.begin( ) + i)->get<1>( ) ; if ( weight < itemweight ) { bestValues[ i ][ weight ] = bestValues[ i - 1 ][ weight ] ; solutionSets[ i ][ weight ] = solutionSets[ i - 1 ][ weight ] ; } else { if ( bestValues[ i - 1 ][ weight - itemweight ] + (items.begin( ) + i)->get<2>( ) > bestValues[ i - 1 ][ weight ] ) { bestValues[ i ][ weight ] = bestValues[ i - 1 ][ weight - itemweight ] + (items.begin( ) + i)->get<2>( ) ; solutionSets[ i ][ weight ] = solutionSets[ i - 1 ][ weight - itemweight ] ; solutionSets[ i ][ weight ].insert( i ) ; } else { bestValues[ i ][ weight ] = bestValues[ i - 1 ][ weight ] ; solutionSets[ i ][ weight ] = solutionSets[ i - 1 ][ weight ] ; } } } } } bestItems.swap( solutionSets[ n - 1][ weightlimit - 1 ] ) ; return bestValues[ n - 1 ][ weightlimit - 1 ] ; }
Port the following code from Go to C++ with equivalent syntax and logic.
package main import ( "fmt" "sort" ) func getPrimes(max int) []int { if max < 2 { return []int{} } lprimes := []int{2} outer: for x := 3; x <= max; x += 2 { for _, p := range lprimes { if x%p == 0 { continue outer } } lprimes = append(lprimes, x) } return lprimes } func main() { const maxSum = 99 descendants := make([][]int64, maxSum+1) ancestors := make([][]int, maxSum+1) for i := 0; i <= maxSum; i++ { descendants[i] = []int64{} ancestors[i] = []int{} } primes := getPrimes(maxSum) for _, p := range primes { descendants[p] = append(descendants[p], int64(p)) for s := 1; s < len(descendants)-p; s++ { temp := make([]int64, len(descendants[s])) for i := 0; i < len(descendants[s]); i++ { temp[i] = int64(p) * descendants[s][i] } descendants[s+p] = append(descendants[s+p], temp...) } } for _, p := range append(primes, 4) { le := len(descendants[p]) if le == 0 { continue } descendants[p][le-1] = 0 descendants[p] = descendants[p][:le-1] } total := 0 for s := 1; s <= maxSum; s++ { x := descendants[s] sort.Slice(x, func(i, j int) bool { return x[i] < x[j] }) total += len(descendants[s]) index := 0 for ; index < len(descendants[s]); index++ { if descendants[s][index] > int64(maxSum) { break } } for _, d := range descendants[s][:index] { ancestors[d] = append(ancestors[s], s) } if (s >= 21 && s <= 45) || (s >= 47 && s <= 73) || (s >= 75 && s < maxSum) { continue } temp := fmt.Sprintf("%v", ancestors[s]) fmt.Printf("%2d: %d Ancestor(s): %-14s", s, len(ancestors[s]), temp) le := len(descendants[s]) if le <= 10 { fmt.Printf("%5d Descendant(s): %v\n", le, descendants[s]) } else { fmt.Printf("%5d Descendant(s): %v\b ...]\n", le, descendants[s][:10]) } } fmt.Println("\nTotal descendants", total) }
#include <algorithm> #include <iostream> #include <vector> typedef unsigned long long integer; std::vector<integer> get_ancestors(const std::vector<integer>& ancestor, integer n) { std::vector<integer> result; for (integer a = ancestor[n]; a != 0 && a != n; ) { n = a; a = ancestor[n]; result.push_back(n); } return result; } void print_vector(const std::vector<integer>& vec) { if (vec.empty()) { std::cout << "none\n"; return; } auto i = vec.begin(); std::cout << *i++; for (; i != vec.end(); ++i) std::cout << ", " << *i; std::cout << '\n'; } bool is_prime(integer n) { if (n < 2) return false; if (n % 2 == 0) return n == 2; for (integer p = 3; p * p <= n; p += 2) { if (n % p == 0) return false; } return true; } int main(int argc, char** argv) { const size_t limit = 100; std::vector<integer> ancestor(limit, 0); std::vector<std::vector<integer>> descendants(limit); for (size_t prime = 0; prime < limit; ++prime) { if (!is_prime(prime)) continue; descendants[prime].push_back(prime); for (size_t i = 0; i + prime < limit; ++i) { integer s = i + prime; for (integer n : descendants[i]) { integer prod = n * prime; descendants[s].push_back(prod); if (prod < limit) ancestor[prod] = s; } } } size_t total_descendants = 0; for (integer i = 1; i < limit; ++i) { std::vector<integer> ancestors(get_ancestors(ancestor, i)); std::cout << "[" << i << "] Level: " << ancestors.size() << '\n'; std::cout << "Ancestors: "; std::sort(ancestors.begin(), ancestors.end()); print_vector(ancestors); std::cout << "Descendants: "; std::vector<integer>& desc = descendants[i]; if (!desc.empty()) { std::sort(desc.begin(), desc.end()); if (desc[0] == i) desc.erase(desc.begin()); } std::cout << desc.size() << '\n'; total_descendants += desc.size(); if (!desc.empty()) print_vector(desc); std::cout << '\n'; } std::cout << "Total descendants: " << total_descendants << '\n'; return 0; }
Produce a language-to-language conversion: from Go to C++, same semantics.
package main import "fmt" type pair [2]int func cart2(a, b []int) []pair { p := make([]pair, len(a)*len(b)) i := 0 for _, a := range a { for _, b := range b { p[i] = pair{a, b} i++ } } return p } func main() { fmt.Println(cart2([]int{1, 2}, []int{3, 4})) fmt.Println(cart2([]int{3, 4}, []int{1, 2})) fmt.Println(cart2([]int{1, 2}, nil)) fmt.Println(cart2(nil, []int{1, 2})) }
#include <iostream> #include <vector> #include <algorithm> void print(const std::vector<std::vector<int>>& v) { std::cout << "{ "; for (const auto& p : v) { std::cout << "("; for (const auto& e : p) { std::cout << e << " "; } std::cout << ") "; } std::cout << "}" << std::endl; } auto product(const std::vector<std::vector<int>>& lists) { std::vector<std::vector<int>> result; if (std::find_if(std::begin(lists), std::end(lists), [](auto e) -> bool { return e.size() == 0; }) != std::end(lists)) { return result; } for (auto& e : lists[0]) { result.push_back({ e }); } for (size_t i = 1; i < lists.size(); ++i) { std::vector<std::vector<int>> temp; for (auto& e : result) { for (auto f : lists[i]) { auto e_tmp = e; e_tmp.push_back(f); temp.push_back(e_tmp); } } result = temp; } return result; } int main() { std::vector<std::vector<int>> prods[] = { { { 1, 2 }, { 3, 4 } }, { { 3, 4 }, { 1, 2} }, { { 1, 2 }, { } }, { { }, { 1, 2 } }, { { 1776, 1789 }, { 7, 12 }, { 4, 14, 23 }, { 0, 1 } }, { { 1, 2, 3 }, { 30 }, { 500, 100 } }, { { 1, 2, 3 }, { }, { 500, 100 } } }; for (const auto& p : prods) { print(product(p)); } std::cin.ignore(); std::cin.get(); return 0; }
Please provide an equivalent version of this Go code in C++.
package main import "fmt" type pair [2]int func cart2(a, b []int) []pair { p := make([]pair, len(a)*len(b)) i := 0 for _, a := range a { for _, b := range b { p[i] = pair{a, b} i++ } } return p } func main() { fmt.Println(cart2([]int{1, 2}, []int{3, 4})) fmt.Println(cart2([]int{3, 4}, []int{1, 2})) fmt.Println(cart2([]int{1, 2}, nil)) fmt.Println(cart2(nil, []int{1, 2})) }
#include <iostream> #include <vector> #include <algorithm> void print(const std::vector<std::vector<int>>& v) { std::cout << "{ "; for (const auto& p : v) { std::cout << "("; for (const auto& e : p) { std::cout << e << " "; } std::cout << ") "; } std::cout << "}" << std::endl; } auto product(const std::vector<std::vector<int>>& lists) { std::vector<std::vector<int>> result; if (std::find_if(std::begin(lists), std::end(lists), [](auto e) -> bool { return e.size() == 0; }) != std::end(lists)) { return result; } for (auto& e : lists[0]) { result.push_back({ e }); } for (size_t i = 1; i < lists.size(); ++i) { std::vector<std::vector<int>> temp; for (auto& e : result) { for (auto f : lists[i]) { auto e_tmp = e; e_tmp.push_back(f); temp.push_back(e_tmp); } } result = temp; } return result; } int main() { std::vector<std::vector<int>> prods[] = { { { 1, 2 }, { 3, 4 } }, { { 3, 4 }, { 1, 2} }, { { 1, 2 }, { } }, { { }, { 1, 2 } }, { { 1776, 1789 }, { 7, 12 }, { 4, 14, 23 }, { 0, 1 } }, { { 1, 2, 3 }, { 30 }, { 500, 100 } }, { { 1, 2, 3 }, { }, { 500, 100 } } }; for (const auto& p : prods) { print(product(p)); } std::cin.ignore(); std::cin.get(); return 0; }
Generate a C++ translation of this Go snippet without changing its computational steps.
package main import "math" import "fmt" func cube(x float64) float64 { return math.Pow(x, 3) } type ffType func(float64) float64 func compose(f, g ffType) ffType { return func(x float64) float64 { return f(g(x)) } } func main() { funclist := []ffType{math.Sin, math.Cos, cube} funclisti := []ffType{math.Asin, math.Acos, math.Cbrt} for i := 0; i < 3; i++ { fmt.Println(compose(funclisti[i], funclist[i])(.5)) } }
#include <functional> #include <algorithm> #include <iostream> #include <vector> #include <cmath> using std::cout; using std::endl; using std::vector; using std::function; using std::transform; using std::back_inserter; typedef function<double(double)> FunType; vector<FunType> A = {sin, cos, tan, [](double x) { return x*x*x; } }; vector<FunType> B = {asin, acos, atan, [](double x) { return exp(log(x)/3); } }; template <typename A, typename B, typename C> function<C(A)> compose(function<C(B)> f, function<B(A)> g) { return [f,g](A x) { return f(g(x)); }; } int main() { vector<FunType> composedFuns; auto exNums = {0.0, 0.2, 0.4, 0.6, 0.8, 1.0}; transform(B.begin(), B.end(), A.begin(), back_inserter(composedFuns), compose<double, double, double>); for (auto num: exNums) for (auto fun: composedFuns) cout << u8"f\u207B\u00B9.f(" << num << ") = " << fun(num) << endl; return 0; }
Translate the given Go code snippet into C++ without altering its behavior.
package main import "math" import "fmt" func cube(x float64) float64 { return math.Pow(x, 3) } type ffType func(float64) float64 func compose(f, g ffType) ffType { return func(x float64) float64 { return f(g(x)) } } func main() { funclist := []ffType{math.Sin, math.Cos, cube} funclisti := []ffType{math.Asin, math.Acos, math.Cbrt} for i := 0; i < 3; i++ { fmt.Println(compose(funclisti[i], funclist[i])(.5)) } }
#include <functional> #include <algorithm> #include <iostream> #include <vector> #include <cmath> using std::cout; using std::endl; using std::vector; using std::function; using std::transform; using std::back_inserter; typedef function<double(double)> FunType; vector<FunType> A = {sin, cos, tan, [](double x) { return x*x*x; } }; vector<FunType> B = {asin, acos, atan, [](double x) { return exp(log(x)/3); } }; template <typename A, typename B, typename C> function<C(A)> compose(function<C(B)> f, function<B(A)> g) { return [f,g](A x) { return f(g(x)); }; } int main() { vector<FunType> composedFuns; auto exNums = {0.0, 0.2, 0.4, 0.6, 0.8, 1.0}; transform(B.begin(), B.end(), A.begin(), back_inserter(composedFuns), compose<double, double, double>); for (auto num: exNums) for (auto fun: composedFuns) cout << u8"f\u207B\u00B9.f(" << num << ") = " << fun(num) << endl; return 0; }
Write the same code in C++ as shown below in Go.
package main import ( "fmt" "strconv" ) func listProperDivisors(limit int) { if limit < 1 { return } width := len(strconv.Itoa(limit)) for i := 1; i <= limit; i++ { fmt.Printf("%*d -> ", width, i) if i == 1 { fmt.Println("(None)") continue } for j := 1; j <= i/2; j++ { if i%j == 0 { fmt.Printf(" %d", j) } } fmt.Println() } } func countProperDivisors(n int) int { if n < 2 { return 0 } count := 0 for i := 1; i <= n/2; i++ { if n%i == 0 { count++ } } return count } func main() { fmt.Println("The proper divisors of the following numbers are :\n") listProperDivisors(10) fmt.Println() maxCount := 0 most := []int{1} for n := 2; n <= 20000; n++ { count := countProperDivisors(n) if count == maxCount { most = append(most, n) } else if count > maxCount { maxCount = count most = most[0:1] most[0] = n } } fmt.Print("The following number(s) <= 20000 have the most proper divisors, ") fmt.Println("namely", maxCount, "\b\n") for _, n := range most { fmt.Println(n) } }
#include <vector> #include <iostream> #include <algorithm> std::vector<int> properDivisors ( int number ) { std::vector<int> divisors ; for ( int i = 1 ; i < number / 2 + 1 ; i++ ) if ( number % i == 0 ) divisors.push_back( i ) ; return divisors ; } int main( ) { std::vector<int> divisors ; unsigned int maxdivisors = 0 ; int corresponding_number = 0 ; for ( int i = 1 ; i < 11 ; i++ ) { divisors = properDivisors ( i ) ; std::cout << "Proper divisors of " << i << ":\n" ; for ( int number : divisors ) { std::cout << number << " " ; } std::cout << std::endl ; divisors.clear( ) ; } for ( int i = 11 ; i < 20001 ; i++ ) { divisors = properDivisors ( i ) ; if ( divisors.size( ) > maxdivisors ) { maxdivisors = divisors.size( ) ; corresponding_number = i ; } divisors.clear( ) ; } std::cout << "Most divisors has " << corresponding_number << " , it has " << maxdivisors << " divisors!\n" ; return 0 ; }
Port the provided Go code into C++ while preserving the original functionality.
package main import ( "encoding/xml" "fmt" ) func xRemarks(r CharacterRemarks) (string, error) { b, err := xml.MarshalIndent(r, "", " ") return string(b), err } type CharacterRemarks struct { Character []crm } type crm struct { Name string `xml:"name,attr"` Remark string `xml:",chardata"` } func main() { x, err := xRemarks(CharacterRemarks{[]crm{ {`April`, `Bubbly: I'm > Tam and <= Emily`}, {`Tam O'Shanter`, `Burns: "When chapman billies leave the street ..."`}, {`Emily`, `Short & shrift`}, }}) if err != nil { x = err.Error() } fmt.Println(x) }
#include <vector> #include <utility> #include <iostream> #include <boost/algorithm/string.hpp> std::string create_xml( std::vector<std::string> & ,std::vector<std::string> & ) ; int main( ) { std::vector<std::string> names , remarks ; names.push_back( "April" ) ; names.push_back( "Tam O'Shantor" ) ; names.push_back ( "Emily" ) ; remarks.push_back( "Bubbly, I'm > Tam and <= Emily" ) ; remarks.push_back( "Burns: \"When chapman billies leave the street ...\"" ) ; remarks.push_back( "Short & shrift" ) ; std::cout << "This is in XML:\n" ; std::cout << create_xml( names , remarks ) << std::endl ; return 0 ; } std::string create_xml( std::vector<std::string> & names , std::vector<std::string> & remarks ) { std::vector<std::pair<std::string , std::string> > entities ; entities.push_back( std::make_pair( "&" , "&amp;" ) ) ; entities.push_back( std::make_pair( "<" , "&lt;" ) ) ; entities.push_back( std::make_pair( ">" , "&gt;" ) ) ; std::string xmlstring ( "<CharacterRemarks>\n" ) ; std::vector<std::string>::iterator vsi = names.begin( ) ; typedef std::vector<std::pair<std::string , std::string> >::iterator Vpss ; for ( ; vsi != names.end( ) ; vsi++ ) { for ( Vpss vs = entities.begin( ) ; vs != entities.end( ) ; vs++ ) { boost::replace_all ( *vsi , vs->first , vs->second ) ; } } for ( vsi = remarks.begin( ) ; vsi != remarks.end( ) ; vsi++ ) { for ( Vpss vs = entities.begin( ) ; vs != entities.end( ) ; vs++ ) { boost::replace_all ( *vsi , vs->first , vs->second ) ; } } for ( int i = 0 ; i < names.size( ) ; i++ ) { xmlstring.append( "\t<Character name=\"").append( names[ i ] ).append( "\">") .append( remarks[ i ] ).append( "</Character>\n" ) ; } xmlstring.append( "</CharacterRemarks>" ) ; return xmlstring ; }
Ensure the translated C++ code behaves exactly like the original Go snippet.
package main import ( "encoding/xml" "fmt" ) func xRemarks(r CharacterRemarks) (string, error) { b, err := xml.MarshalIndent(r, "", " ") return string(b), err } type CharacterRemarks struct { Character []crm } type crm struct { Name string `xml:"name,attr"` Remark string `xml:",chardata"` } func main() { x, err := xRemarks(CharacterRemarks{[]crm{ {`April`, `Bubbly: I'm > Tam and <= Emily`}, {`Tam O'Shanter`, `Burns: "When chapman billies leave the street ..."`}, {`Emily`, `Short & shrift`}, }}) if err != nil { x = err.Error() } fmt.Println(x) }
#include <vector> #include <utility> #include <iostream> #include <boost/algorithm/string.hpp> std::string create_xml( std::vector<std::string> & ,std::vector<std::string> & ) ; int main( ) { std::vector<std::string> names , remarks ; names.push_back( "April" ) ; names.push_back( "Tam O'Shantor" ) ; names.push_back ( "Emily" ) ; remarks.push_back( "Bubbly, I'm > Tam and <= Emily" ) ; remarks.push_back( "Burns: \"When chapman billies leave the street ...\"" ) ; remarks.push_back( "Short & shrift" ) ; std::cout << "This is in XML:\n" ; std::cout << create_xml( names , remarks ) << std::endl ; return 0 ; } std::string create_xml( std::vector<std::string> & names , std::vector<std::string> & remarks ) { std::vector<std::pair<std::string , std::string> > entities ; entities.push_back( std::make_pair( "&" , "&amp;" ) ) ; entities.push_back( std::make_pair( "<" , "&lt;" ) ) ; entities.push_back( std::make_pair( ">" , "&gt;" ) ) ; std::string xmlstring ( "<CharacterRemarks>\n" ) ; std::vector<std::string>::iterator vsi = names.begin( ) ; typedef std::vector<std::pair<std::string , std::string> >::iterator Vpss ; for ( ; vsi != names.end( ) ; vsi++ ) { for ( Vpss vs = entities.begin( ) ; vs != entities.end( ) ; vs++ ) { boost::replace_all ( *vsi , vs->first , vs->second ) ; } } for ( vsi = remarks.begin( ) ; vsi != remarks.end( ) ; vsi++ ) { for ( Vpss vs = entities.begin( ) ; vs != entities.end( ) ; vs++ ) { boost::replace_all ( *vsi , vs->first , vs->second ) ; } } for ( int i = 0 ; i < names.size( ) ; i++ ) { xmlstring.append( "\t<Character name=\"").append( names[ i ] ).append( "\">") .append( remarks[ i ] ).append( "</Character>\n" ) ; } xmlstring.append( "</CharacterRemarks>" ) ; return xmlstring ; }
Produce a functionally identical C++ code for the snippet given in Go.
package main import ( "fmt" "log" "os/exec" ) var ( x = []int{0, 1, 2, 3, 4, 5, 6, 7, 8, 9} y = []float64{2.7, 2.8, 31.4, 38.1, 58.0, 76.2, 100.5, 130.0, 149.3, 180.0} ) func main() { g := exec.Command("gnuplot", "-persist") w, err := g.StdinPipe() if err != nil { log.Fatal(err) } if err = g.Start(); err != nil { log.Fatal(err) } fmt.Fprintln(w, "unset key; plot '-'") for i, xi := range x { fmt.Fprintf(w, "%d %f\n", xi, y[i]) } fmt.Fprintln(w, "e") w.Close() g.Wait() }
#include <windows.h> #include <string> #include <vector> using namespace std; const int HSTEP = 46, MWID = 40, MHEI = 471; const float VSTEP = 2.3f; class vector2 { public: vector2() { x = y = 0; } vector2( float a, float b ) { x = a; y = b; } void set( float a, float b ) { x = a; y = b; } float x, y; }; class myBitmap { public: myBitmap() : pen( NULL ), brush( NULL ), clr( 0 ), wid( 1 ) {} ~myBitmap() { DeleteObject( pen ); DeleteObject( brush ); DeleteDC( hdc ); DeleteObject( bmp ); } bool create( int w, int h ) { BITMAPINFO bi; ZeroMemory( &bi, sizeof( bi ) ); bi.bmiHeader.biSize = sizeof( bi.bmiHeader ); bi.bmiHeader.biBitCount = sizeof( DWORD ) * 8; bi.bmiHeader.biCompression = BI_RGB; bi.bmiHeader.biPlanes = 1; bi.bmiHeader.biWidth = w; bi.bmiHeader.biHeight = -h; HDC dc = GetDC( GetConsoleWindow() ); bmp = CreateDIBSection( dc, &bi, DIB_RGB_COLORS, &pBits, NULL, 0 ); if( !bmp ) return false; hdc = CreateCompatibleDC( dc ); SelectObject( hdc, bmp ); ReleaseDC( GetConsoleWindow(), dc ); width = w; height = h; return true; } void clear( BYTE clr = 0 ) { memset( pBits, clr, width * height * sizeof( DWORD ) ); } void setBrushColor( DWORD bClr ) { if( brush ) DeleteObject( brush ); brush = CreateSolidBrush( bClr ); SelectObject( hdc, brush ); } void setPenColor( DWORD c ) { clr = c; createPen(); } void setPenWidth( int w ) { wid = w; createPen(); } void saveBitmap( string path ) { BITMAPFILEHEADER fileheader; BITMAPINFO infoheader; BITMAP bitmap; DWORD wb; GetObject( bmp, sizeof( bitmap ), &bitmap ); DWORD* dwpBits = new DWORD[bitmap.bmWidth * bitmap.bmHeight]; ZeroMemory( dwpBits, bitmap.bmWidth * bitmap.bmHeight * sizeof( DWORD ) ); ZeroMemory( &infoheader, sizeof( BITMAPINFO ) ); ZeroMemory( &fileheader, sizeof( BITMAPFILEHEADER ) ); infoheader.bmiHeader.biBitCount = sizeof( DWORD ) * 8; infoheader.bmiHeader.biCompression = BI_RGB; infoheader.bmiHeader.biPlanes = 1; infoheader.bmiHeader.biSize = sizeof( infoheader.bmiHeader ); infoheader.bmiHeader.biHeight = bitmap.bmHeight; infoheader.bmiHeader.biWidth = bitmap.bmWidth; infoheader.bmiHeader.biSizeImage = bitmap.bmWidth * bitmap.bmHeight * sizeof( DWORD ); fileheader.bfType = 0x4D42; fileheader.bfOffBits = sizeof( infoheader.bmiHeader ) + sizeof( BITMAPFILEHEADER ); fileheader.bfSize = fileheader.bfOffBits + infoheader.bmiHeader.biSizeImage; GetDIBits( hdc, bmp, 0, height, ( LPVOID )dwpBits, &infoheader, DIB_RGB_COLORS ); HANDLE file = CreateFile( path.c_str(), GENERIC_WRITE, 0, NULL, CREATE_ALWAYS, FILE_ATTRIBUTE_NORMAL, NULL ); WriteFile( file, &fileheader, sizeof( BITMAPFILEHEADER ), &wb, NULL ); WriteFile( file, &infoheader.bmiHeader, sizeof( infoheader.bmiHeader ), &wb, NULL ); WriteFile( file, dwpBits, bitmap.bmWidth * bitmap.bmHeight * 4, &wb, NULL ); CloseHandle( file ); delete [] dwpBits; } HDC getDC() const { return hdc; } int getWidth() const { return width; } int getHeight() const { return height; } private: void createPen() { if( pen ) DeleteObject( pen ); pen = CreatePen( PS_SOLID, wid, clr ); SelectObject( hdc, pen ); } HBITMAP bmp; HDC hdc; HPEN pen; HBRUSH brush; void *pBits; int width, height, wid; DWORD clr; }; class plot { public: plot() { bmp.create( 512, 512 ); } void draw( vector<vector2>* pairs ) { bmp.clear( 0xff ); drawGraph( pairs ); plotIt( pairs ); HDC dc = GetDC( GetConsoleWindow() ); BitBlt( dc, 0, 30, 512, 512, bmp.getDC(), 0, 0, SRCCOPY ); ReleaseDC( GetConsoleWindow(), dc ); } private: void drawGraph( vector<vector2>* pairs ) { HDC dc = bmp.getDC(); bmp.setPenColor( RGB( 240, 240, 240 ) ); DWORD b = 11, c = 40, x; RECT rc; char txt[8]; for( x = 0; x < pairs->size(); x++ ) { MoveToEx( dc, 40, b, NULL ); LineTo( dc, 500, b ); MoveToEx( dc, c, 11, NULL ); LineTo( dc, c, 471 ); wsprintf( txt, "%d", ( pairs->size() - x ) * 20 ); SetRect( &rc, 0, b - 9, 36, b + 11 ); DrawText( dc, txt, lstrlen( txt ), &rc, DT_RIGHT | DT_VCENTER | DT_SINGLELINE ); wsprintf( txt, "%d", x ); SetRect( &rc, c - 8, 472, c + 8, 492 ); DrawText( dc, txt, lstrlen( txt ), &rc, DT_CENTER | DT_VCENTER | DT_SINGLELINE ); c += 46; b += 46; } SetRect( &rc, 0, b - 9, 36, b + 11 ); DrawText( dc, "0", 1, &rc, DT_RIGHT | DT_VCENTER | DT_SINGLELINE ); bmp.setPenColor( 0 ); bmp.setPenWidth( 3 ); MoveToEx( dc, 40, 11, NULL ); LineTo( dc, 40, 471 ); MoveToEx( dc, 40, 471, NULL ); LineTo( dc, 500, 471 ); } void plotIt( vector<vector2>* pairs ) { HDC dc = bmp.getDC(); HBRUSH br = CreateSolidBrush( 255 ); RECT rc; bmp.setPenColor( 255 ); bmp.setPenWidth( 2 ); vector<vector2>::iterator it = pairs->begin(); int a = MWID + HSTEP * static_cast<int>( ( *it ).x ), b = MHEI - static_cast<int>( VSTEP * ( *it ).y ); MoveToEx( dc, a, b, NULL ); SetRect( &rc, a - 3, b - 3, a + 3, b + 3 ); FillRect( dc, &rc, br ); it++; for( ; it < pairs->end(); it++ ) { a = MWID + HSTEP * static_cast<int>( ( *it ).x ); b = MHEI - static_cast<int>( VSTEP * ( *it ).y ); SetRect( &rc, a - 3, b - 3, a + 3, b + 3 ); FillRect( dc, &rc, br ); LineTo( dc, a, b ); } DeleteObject( br ); } myBitmap bmp; }; int main( int argc, char* argv[] ) { ShowWindow( GetConsoleWindow(), SW_MAXIMIZE ); plot pt; vector<vector2> pairs; pairs.push_back( vector2( 0, 2.7f ) ); pairs.push_back( vector2( 1, 2.8f ) ); pairs.push_back( vector2( 2.0f, 31.4f ) ); pairs.push_back( vector2( 3.0f, 38.1f ) ); pairs.push_back( vector2( 4.0f, 58.0f ) ); pairs.push_back( vector2( 5.0f, 76.2f ) ); pairs.push_back( vector2( 6.0f, 100.5f ) ); pairs.push_back( vector2( 7.0f, 130.0f ) ); pairs.push_back( vector2( 8.0f, 149.3f ) ); pairs.push_back( vector2( 9.0f, 180.0f ) ); pt.draw( &pairs ); system( "pause" ); return 0; }
Translate this program into C++ but keep the logic exactly as in Go.
package main import ( "fmt" "log" "os/exec" ) var ( x = []int{0, 1, 2, 3, 4, 5, 6, 7, 8, 9} y = []float64{2.7, 2.8, 31.4, 38.1, 58.0, 76.2, 100.5, 130.0, 149.3, 180.0} ) func main() { g := exec.Command("gnuplot", "-persist") w, err := g.StdinPipe() if err != nil { log.Fatal(err) } if err = g.Start(); err != nil { log.Fatal(err) } fmt.Fprintln(w, "unset key; plot '-'") for i, xi := range x { fmt.Fprintf(w, "%d %f\n", xi, y[i]) } fmt.Fprintln(w, "e") w.Close() g.Wait() }
#include <windows.h> #include <string> #include <vector> using namespace std; const int HSTEP = 46, MWID = 40, MHEI = 471; const float VSTEP = 2.3f; class vector2 { public: vector2() { x = y = 0; } vector2( float a, float b ) { x = a; y = b; } void set( float a, float b ) { x = a; y = b; } float x, y; }; class myBitmap { public: myBitmap() : pen( NULL ), brush( NULL ), clr( 0 ), wid( 1 ) {} ~myBitmap() { DeleteObject( pen ); DeleteObject( brush ); DeleteDC( hdc ); DeleteObject( bmp ); } bool create( int w, int h ) { BITMAPINFO bi; ZeroMemory( &bi, sizeof( bi ) ); bi.bmiHeader.biSize = sizeof( bi.bmiHeader ); bi.bmiHeader.biBitCount = sizeof( DWORD ) * 8; bi.bmiHeader.biCompression = BI_RGB; bi.bmiHeader.biPlanes = 1; bi.bmiHeader.biWidth = w; bi.bmiHeader.biHeight = -h; HDC dc = GetDC( GetConsoleWindow() ); bmp = CreateDIBSection( dc, &bi, DIB_RGB_COLORS, &pBits, NULL, 0 ); if( !bmp ) return false; hdc = CreateCompatibleDC( dc ); SelectObject( hdc, bmp ); ReleaseDC( GetConsoleWindow(), dc ); width = w; height = h; return true; } void clear( BYTE clr = 0 ) { memset( pBits, clr, width * height * sizeof( DWORD ) ); } void setBrushColor( DWORD bClr ) { if( brush ) DeleteObject( brush ); brush = CreateSolidBrush( bClr ); SelectObject( hdc, brush ); } void setPenColor( DWORD c ) { clr = c; createPen(); } void setPenWidth( int w ) { wid = w; createPen(); } void saveBitmap( string path ) { BITMAPFILEHEADER fileheader; BITMAPINFO infoheader; BITMAP bitmap; DWORD wb; GetObject( bmp, sizeof( bitmap ), &bitmap ); DWORD* dwpBits = new DWORD[bitmap.bmWidth * bitmap.bmHeight]; ZeroMemory( dwpBits, bitmap.bmWidth * bitmap.bmHeight * sizeof( DWORD ) ); ZeroMemory( &infoheader, sizeof( BITMAPINFO ) ); ZeroMemory( &fileheader, sizeof( BITMAPFILEHEADER ) ); infoheader.bmiHeader.biBitCount = sizeof( DWORD ) * 8; infoheader.bmiHeader.biCompression = BI_RGB; infoheader.bmiHeader.biPlanes = 1; infoheader.bmiHeader.biSize = sizeof( infoheader.bmiHeader ); infoheader.bmiHeader.biHeight = bitmap.bmHeight; infoheader.bmiHeader.biWidth = bitmap.bmWidth; infoheader.bmiHeader.biSizeImage = bitmap.bmWidth * bitmap.bmHeight * sizeof( DWORD ); fileheader.bfType = 0x4D42; fileheader.bfOffBits = sizeof( infoheader.bmiHeader ) + sizeof( BITMAPFILEHEADER ); fileheader.bfSize = fileheader.bfOffBits + infoheader.bmiHeader.biSizeImage; GetDIBits( hdc, bmp, 0, height, ( LPVOID )dwpBits, &infoheader, DIB_RGB_COLORS ); HANDLE file = CreateFile( path.c_str(), GENERIC_WRITE, 0, NULL, CREATE_ALWAYS, FILE_ATTRIBUTE_NORMAL, NULL ); WriteFile( file, &fileheader, sizeof( BITMAPFILEHEADER ), &wb, NULL ); WriteFile( file, &infoheader.bmiHeader, sizeof( infoheader.bmiHeader ), &wb, NULL ); WriteFile( file, dwpBits, bitmap.bmWidth * bitmap.bmHeight * 4, &wb, NULL ); CloseHandle( file ); delete [] dwpBits; } HDC getDC() const { return hdc; } int getWidth() const { return width; } int getHeight() const { return height; } private: void createPen() { if( pen ) DeleteObject( pen ); pen = CreatePen( PS_SOLID, wid, clr ); SelectObject( hdc, pen ); } HBITMAP bmp; HDC hdc; HPEN pen; HBRUSH brush; void *pBits; int width, height, wid; DWORD clr; }; class plot { public: plot() { bmp.create( 512, 512 ); } void draw( vector<vector2>* pairs ) { bmp.clear( 0xff ); drawGraph( pairs ); plotIt( pairs ); HDC dc = GetDC( GetConsoleWindow() ); BitBlt( dc, 0, 30, 512, 512, bmp.getDC(), 0, 0, SRCCOPY ); ReleaseDC( GetConsoleWindow(), dc ); } private: void drawGraph( vector<vector2>* pairs ) { HDC dc = bmp.getDC(); bmp.setPenColor( RGB( 240, 240, 240 ) ); DWORD b = 11, c = 40, x; RECT rc; char txt[8]; for( x = 0; x < pairs->size(); x++ ) { MoveToEx( dc, 40, b, NULL ); LineTo( dc, 500, b ); MoveToEx( dc, c, 11, NULL ); LineTo( dc, c, 471 ); wsprintf( txt, "%d", ( pairs->size() - x ) * 20 ); SetRect( &rc, 0, b - 9, 36, b + 11 ); DrawText( dc, txt, lstrlen( txt ), &rc, DT_RIGHT | DT_VCENTER | DT_SINGLELINE ); wsprintf( txt, "%d", x ); SetRect( &rc, c - 8, 472, c + 8, 492 ); DrawText( dc, txt, lstrlen( txt ), &rc, DT_CENTER | DT_VCENTER | DT_SINGLELINE ); c += 46; b += 46; } SetRect( &rc, 0, b - 9, 36, b + 11 ); DrawText( dc, "0", 1, &rc, DT_RIGHT | DT_VCENTER | DT_SINGLELINE ); bmp.setPenColor( 0 ); bmp.setPenWidth( 3 ); MoveToEx( dc, 40, 11, NULL ); LineTo( dc, 40, 471 ); MoveToEx( dc, 40, 471, NULL ); LineTo( dc, 500, 471 ); } void plotIt( vector<vector2>* pairs ) { HDC dc = bmp.getDC(); HBRUSH br = CreateSolidBrush( 255 ); RECT rc; bmp.setPenColor( 255 ); bmp.setPenWidth( 2 ); vector<vector2>::iterator it = pairs->begin(); int a = MWID + HSTEP * static_cast<int>( ( *it ).x ), b = MHEI - static_cast<int>( VSTEP * ( *it ).y ); MoveToEx( dc, a, b, NULL ); SetRect( &rc, a - 3, b - 3, a + 3, b + 3 ); FillRect( dc, &rc, br ); it++; for( ; it < pairs->end(); it++ ) { a = MWID + HSTEP * static_cast<int>( ( *it ).x ); b = MHEI - static_cast<int>( VSTEP * ( *it ).y ); SetRect( &rc, a - 3, b - 3, a + 3, b + 3 ); FillRect( dc, &rc, br ); LineTo( dc, a, b ); } DeleteObject( br ); } myBitmap bmp; }; int main( int argc, char* argv[] ) { ShowWindow( GetConsoleWindow(), SW_MAXIMIZE ); plot pt; vector<vector2> pairs; pairs.push_back( vector2( 0, 2.7f ) ); pairs.push_back( vector2( 1, 2.8f ) ); pairs.push_back( vector2( 2.0f, 31.4f ) ); pairs.push_back( vector2( 3.0f, 38.1f ) ); pairs.push_back( vector2( 4.0f, 58.0f ) ); pairs.push_back( vector2( 5.0f, 76.2f ) ); pairs.push_back( vector2( 6.0f, 100.5f ) ); pairs.push_back( vector2( 7.0f, 130.0f ) ); pairs.push_back( vector2( 8.0f, 149.3f ) ); pairs.push_back( vector2( 9.0f, 180.0f ) ); pt.draw( &pairs ); system( "pause" ); return 0; }
Generate a C++ translation of this Go snippet without changing its computational steps.
package main import "fmt" import "regexp" func main() { str := "I am the original string" matched, _ := regexp.MatchString(".*string$", str) if matched { fmt.Println("ends with 'string'") } pattern := regexp.MustCompile("original") result := pattern.ReplaceAllString(str, "modified") fmt.Println(result) }
#include <iostream> #include <string> #include <iterator> #include <regex> int main() { std::regex re(".* string$"); std::string s = "Hi, I am a string"; if (std::regex_match(s, re)) std::cout << "The string matches.\n"; else std::cout << "Oops - not found?\n"; std::regex re2(" a.*a"); std::smatch match; if (std::regex_search(s, match, re2)) { std::cout << "Matched " << match.length() << " characters starting at " << match.position() << ".\n"; std::cout << "Matched character sequence: \"" << match.str() << "\"\n"; } else { std::cout << "Oops - not found?\n"; } std::string dest_string; std::regex_replace(std::back_inserter(dest_string), s.begin(), s.end(), re2, "'m now a changed"); std::cout << dest_string << std::endl; }
Rewrite the snippet below in C++ so it works the same as the original Go code.
package main import ( "fmt" "sort" ) func main() { lower, upper := 0, 100 fmt.Printf(`Instructions: Think of integer number from %d (inclusive) to %d (exclusive) and I will guess it. After each guess, I will ask you if it is less than or equal to some number, and you will respond with "yes" or "no". `, lower, upper) answer := sort.Search(upper-lower, func (i int) bool { fmt.Printf("Is your number less than or equal to %d? ", lower+i) s := "" fmt.Scanf("%s", &s) return s != "" && s[0] == 'y' }) fmt.Printf("Your number is %d.\n", lower+answer) }
#include <iostream> #include <algorithm> #include <string> #include <iterator> struct GuessNumberIterator : std::iterator<std::random_access_iterator_tag, int> { int i; GuessNumberIterator() { } GuessNumberIterator(int _i) : i(_i) { } GuessNumberIterator& operator++() { ++i; return *this; } GuessNumberIterator operator++(int) { GuessNumberIterator tmp = *this; ++(*this); return tmp; } bool operator==(const GuessNumberIterator& y) { return i == y.i; } bool operator!=(const GuessNumberIterator& y) { return i != y.i; } int operator*() { std::cout << "Is your number less than or equal to " << i << "? "; std::string s; std::cin >> s; return (s != "" && (s[0] == 'y' || s[0] == 'Y')) ? 0 : -1; } GuessNumberIterator& operator--() { --i; return *this; } GuessNumberIterator operator--(int) { GuessNumberIterator tmp = *this; --(*this); return tmp; } GuessNumberIterator& operator+=(int n) { i += n; return *this; } GuessNumberIterator& operator-=(int n) { i -= n; return *this; } GuessNumberIterator operator+(int n) { GuessNumberIterator tmp = *this; return tmp += n; } GuessNumberIterator operator-(int n) { GuessNumberIterator tmp = *this; return tmp -= n; } int operator-(const GuessNumberIterator &y) { return i - y.i; } int operator[](int n) { return *(*this + n); } bool operator<(const GuessNumberIterator &y) { return i < y.i; } bool operator>(const GuessNumberIterator &y) { return i > y.i; } bool operator<=(const GuessNumberIterator &y) { return i <= y.i; } bool operator>=(const GuessNumberIterator &y) { return i >= y.i; } }; inline GuessNumberIterator operator+(int n, GuessNumberIterator &i) { return i + n; } const int lower = 0; const int upper = 100; int main() { std::cout << "Instructions:\n" << "Think of integer number from " << lower << " (inclusive) to " << upper << " (exclusive) and\n" << "I will guess it. After each guess, I will ask you if it is less than\n" << "or equal to some number, and you will respond with \"yes\" or \"no\".\n"; int answer = std::lower_bound(GuessNumberIterator(lower), GuessNumberIterator(upper), 0).i; std::cout << "Your number is " << answer << ".\n"; return 0; }
Write the same algorithm in C++ as shown in this Go implementation.
package main import "fmt" func main() { keys := []string{"a", "b", "c"} vals := []int{1, 2, 3} hash := map[string]int{} for i, key := range keys { hash[key] = vals[i] } fmt.Println(hash) }
#include <unordered_map> #include <string> int main() { std::string keys[] = { "1", "2", "3" }; std::string vals[] = { "a", "b", "c" }; std::unordered_map<std::string, std::string> hash; for( int i = 0 ; i < 3 ; i++ ) hash[ keys[i] ] = vals[i] ; }
Convert this Go snippet to C++ and keep its semantics consistent.
package main import ( "fmt" "sort" ) func getBins(limits, data []int) []int { n := len(limits) bins := make([]int, n+1) for _, d := range data { index := sort.SearchInts(limits, d) if index < len(limits) && d == limits[index] { index++ } bins[index]++ } return bins } func printBins(limits, bins []int) { n := len(limits) fmt.Printf(" < %3d = %2d\n", limits[0], bins[0]) for i := 1; i < n; i++ { fmt.Printf(">= %3d and < %3d = %2d\n", limits[i-1], limits[i], bins[i]) } fmt.Printf(">= %3d = %2d\n", limits[n-1], bins[n]) fmt.Println() } func main() { limitsList := [][]int{ {23, 37, 43, 53, 67, 83}, {14, 18, 249, 312, 389, 392, 513, 591, 634, 720}, } dataList := [][]int{ { 95, 21, 94, 12, 99, 4, 70, 75, 83, 93, 52, 80, 57, 5, 53, 86, 65, 17, 92, 83, 71, 61, 54, 58, 47, 16, 8, 9, 32, 84, 7, 87, 46, 19, 30, 37, 96, 6, 98, 40, 79, 97, 45, 64, 60, 29, 49, 36, 43, 55, }, { 445, 814, 519, 697, 700, 130, 255, 889, 481, 122, 932, 77, 323, 525, 570, 219, 367, 523, 442, 933, 416, 589, 930, 373, 202, 253, 775, 47, 731, 685, 293, 126, 133, 450, 545, 100, 741, 583, 763, 306, 655, 267, 248, 477, 549, 238, 62, 678, 98, 534, 622, 907, 406, 714, 184, 391, 913, 42, 560, 247, 346, 860, 56, 138, 546, 38, 985, 948, 58, 213, 799, 319, 390, 634, 458, 945, 733, 507, 916, 123, 345, 110, 720, 917, 313, 845, 426, 9, 457, 628, 410, 723, 354, 895, 881, 953, 677, 137, 397, 97, 854, 740, 83, 216, 421, 94, 517, 479, 292, 963, 376, 981, 480, 39, 257, 272, 157, 5, 316, 395, 787, 942, 456, 242, 759, 898, 576, 67, 298, 425, 894, 435, 831, 241, 989, 614, 987, 770, 384, 692, 698, 765, 331, 487, 251, 600, 879, 342, 982, 527, 736, 795, 585, 40, 54, 901, 408, 359, 577, 237, 605, 847, 353, 968, 832, 205, 838, 427, 876, 959, 686, 646, 835, 127, 621, 892, 443, 198, 988, 791, 466, 23, 707, 467, 33, 670, 921, 180, 991, 396, 160, 436, 717, 918, 8, 374, 101, 684, 727, 749, }, } for i := 0; i < len(limitsList); i++ { fmt.Println("Example", i+1, "\b\n") bins := getBins(limitsList[i], dataList[i]) printBins(limitsList[i], bins) } }
#include <algorithm> #include <cassert> #include <iomanip> #include <iostream> #include <vector> std::vector<int> bins(const std::vector<int>& limits, const std::vector<int>& data) { std::vector<int> result(limits.size() + 1, 0); for (int n : data) { auto i = std::upper_bound(limits.begin(), limits.end(), n); ++result[i - limits.begin()]; } return result; } void print_bins(const std::vector<int>& limits, const std::vector<int>& bins) { size_t n = limits.size(); if (n == 0) return; assert(n + 1 == bins.size()); std::cout << " < " << std::setw(3) << limits[0] << ": " << std::setw(2) << bins[0] << '\n'; for (size_t i = 1; i < n; ++i) std::cout << ">= " << std::setw(3) << limits[i - 1] << " and < " << std::setw(3) << limits[i] << ": " << std::setw(2) << bins[i] << '\n'; std::cout << ">= " << std::setw(3) << limits[n - 1] << "  : " << std::setw(2) << bins[n] << '\n'; } int main() { const std::vector<int> limits1{23, 37, 43, 53, 67, 83}; const std::vector<int> data1{ 95, 21, 94, 12, 99, 4, 70, 75, 83, 93, 52, 80, 57, 5, 53, 86, 65, 17, 92, 83, 71, 61, 54, 58, 47, 16, 8, 9, 32, 84, 7, 87, 46, 19, 30, 37, 96, 6, 98, 40, 79, 97, 45, 64, 60, 29, 49, 36, 43, 55}; std::cout << "Example 1:\n"; print_bins(limits1, bins(limits1, data1)); const std::vector<int> limits2{14, 18, 249, 312, 389, 392, 513, 591, 634, 720}; const std::vector<int> data2{ 445, 814, 519, 697, 700, 130, 255, 889, 481, 122, 932, 77, 323, 525, 570, 219, 367, 523, 442, 933, 416, 589, 930, 373, 202, 253, 775, 47, 731, 685, 293, 126, 133, 450, 545, 100, 741, 583, 763, 306, 655, 267, 248, 477, 549, 238, 62, 678, 98, 534, 622, 907, 406, 714, 184, 391, 913, 42, 560, 247, 346, 860, 56, 138, 546, 38, 985, 948, 58, 213, 799, 319, 390, 634, 458, 945, 733, 507, 916, 123, 345, 110, 720, 917, 313, 845, 426, 9, 457, 628, 410, 723, 354, 895, 881, 953, 677, 137, 397, 97, 854, 740, 83, 216, 421, 94, 517, 479, 292, 963, 376, 981, 480, 39, 257, 272, 157, 5, 316, 395, 787, 942, 456, 242, 759, 898, 576, 67, 298, 425, 894, 435, 831, 241, 989, 614, 987, 770, 384, 692, 698, 765, 331, 487, 251, 600, 879, 342, 982, 527, 736, 795, 585, 40, 54, 901, 408, 359, 577, 237, 605, 847, 353, 968, 832, 205, 838, 427, 876, 959, 686, 646, 835, 127, 621, 892, 443, 198, 988, 791, 466, 23, 707, 467, 33, 670, 921, 180, 991, 396, 160, 436, 717, 918, 8, 374, 101, 684, 727, 749}; std::cout << "\nExample 2:\n"; print_bins(limits2, bins(limits2, data2)); }
Can you help me rewrite this code in C++ instead of Go, keeping it the same logically?
package main import ( "fmt" "sort" ) func getBins(limits, data []int) []int { n := len(limits) bins := make([]int, n+1) for _, d := range data { index := sort.SearchInts(limits, d) if index < len(limits) && d == limits[index] { index++ } bins[index]++ } return bins } func printBins(limits, bins []int) { n := len(limits) fmt.Printf(" < %3d = %2d\n", limits[0], bins[0]) for i := 1; i < n; i++ { fmt.Printf(">= %3d and < %3d = %2d\n", limits[i-1], limits[i], bins[i]) } fmt.Printf(">= %3d = %2d\n", limits[n-1], bins[n]) fmt.Println() } func main() { limitsList := [][]int{ {23, 37, 43, 53, 67, 83}, {14, 18, 249, 312, 389, 392, 513, 591, 634, 720}, } dataList := [][]int{ { 95, 21, 94, 12, 99, 4, 70, 75, 83, 93, 52, 80, 57, 5, 53, 86, 65, 17, 92, 83, 71, 61, 54, 58, 47, 16, 8, 9, 32, 84, 7, 87, 46, 19, 30, 37, 96, 6, 98, 40, 79, 97, 45, 64, 60, 29, 49, 36, 43, 55, }, { 445, 814, 519, 697, 700, 130, 255, 889, 481, 122, 932, 77, 323, 525, 570, 219, 367, 523, 442, 933, 416, 589, 930, 373, 202, 253, 775, 47, 731, 685, 293, 126, 133, 450, 545, 100, 741, 583, 763, 306, 655, 267, 248, 477, 549, 238, 62, 678, 98, 534, 622, 907, 406, 714, 184, 391, 913, 42, 560, 247, 346, 860, 56, 138, 546, 38, 985, 948, 58, 213, 799, 319, 390, 634, 458, 945, 733, 507, 916, 123, 345, 110, 720, 917, 313, 845, 426, 9, 457, 628, 410, 723, 354, 895, 881, 953, 677, 137, 397, 97, 854, 740, 83, 216, 421, 94, 517, 479, 292, 963, 376, 981, 480, 39, 257, 272, 157, 5, 316, 395, 787, 942, 456, 242, 759, 898, 576, 67, 298, 425, 894, 435, 831, 241, 989, 614, 987, 770, 384, 692, 698, 765, 331, 487, 251, 600, 879, 342, 982, 527, 736, 795, 585, 40, 54, 901, 408, 359, 577, 237, 605, 847, 353, 968, 832, 205, 838, 427, 876, 959, 686, 646, 835, 127, 621, 892, 443, 198, 988, 791, 466, 23, 707, 467, 33, 670, 921, 180, 991, 396, 160, 436, 717, 918, 8, 374, 101, 684, 727, 749, }, } for i := 0; i < len(limitsList); i++ { fmt.Println("Example", i+1, "\b\n") bins := getBins(limitsList[i], dataList[i]) printBins(limitsList[i], bins) } }
#include <algorithm> #include <cassert> #include <iomanip> #include <iostream> #include <vector> std::vector<int> bins(const std::vector<int>& limits, const std::vector<int>& data) { std::vector<int> result(limits.size() + 1, 0); for (int n : data) { auto i = std::upper_bound(limits.begin(), limits.end(), n); ++result[i - limits.begin()]; } return result; } void print_bins(const std::vector<int>& limits, const std::vector<int>& bins) { size_t n = limits.size(); if (n == 0) return; assert(n + 1 == bins.size()); std::cout << " < " << std::setw(3) << limits[0] << ": " << std::setw(2) << bins[0] << '\n'; for (size_t i = 1; i < n; ++i) std::cout << ">= " << std::setw(3) << limits[i - 1] << " and < " << std::setw(3) << limits[i] << ": " << std::setw(2) << bins[i] << '\n'; std::cout << ">= " << std::setw(3) << limits[n - 1] << "  : " << std::setw(2) << bins[n] << '\n'; } int main() { const std::vector<int> limits1{23, 37, 43, 53, 67, 83}; const std::vector<int> data1{ 95, 21, 94, 12, 99, 4, 70, 75, 83, 93, 52, 80, 57, 5, 53, 86, 65, 17, 92, 83, 71, 61, 54, 58, 47, 16, 8, 9, 32, 84, 7, 87, 46, 19, 30, 37, 96, 6, 98, 40, 79, 97, 45, 64, 60, 29, 49, 36, 43, 55}; std::cout << "Example 1:\n"; print_bins(limits1, bins(limits1, data1)); const std::vector<int> limits2{14, 18, 249, 312, 389, 392, 513, 591, 634, 720}; const std::vector<int> data2{ 445, 814, 519, 697, 700, 130, 255, 889, 481, 122, 932, 77, 323, 525, 570, 219, 367, 523, 442, 933, 416, 589, 930, 373, 202, 253, 775, 47, 731, 685, 293, 126, 133, 450, 545, 100, 741, 583, 763, 306, 655, 267, 248, 477, 549, 238, 62, 678, 98, 534, 622, 907, 406, 714, 184, 391, 913, 42, 560, 247, 346, 860, 56, 138, 546, 38, 985, 948, 58, 213, 799, 319, 390, 634, 458, 945, 733, 507, 916, 123, 345, 110, 720, 917, 313, 845, 426, 9, 457, 628, 410, 723, 354, 895, 881, 953, 677, 137, 397, 97, 854, 740, 83, 216, 421, 94, 517, 479, 292, 963, 376, 981, 480, 39, 257, 272, 157, 5, 316, 395, 787, 942, 456, 242, 759, 898, 576, 67, 298, 425, 894, 435, 831, 241, 989, 614, 987, 770, 384, 692, 698, 765, 331, 487, 251, 600, 879, 342, 982, 527, 736, 795, 585, 40, 54, 901, 408, 359, 577, 237, 605, 847, 353, 968, 832, 205, 838, 427, 876, 959, 686, 646, 835, 127, 621, 892, 443, 198, 988, 791, 466, 23, 707, 467, 33, 670, 921, 180, 991, 396, 160, 436, 717, 918, 8, 374, 101, 684, 727, 749}; std::cout << "\nExample 2:\n"; print_bins(limits2, bins(limits2, data2)); }
Translate this program into C++ but keep the logic exactly as in Go.
package main import ( "math" "raster" ) const ( width = 400 height = 300 depth = 8 angle = 12 length = 50 frac = .8 ) func main() { g := raster.NewGrmap(width, height) ftree(g, width/2, height*9/10, length, 0, depth) g.Bitmap().WritePpmFile("ftree.ppm") } func ftree(g *raster.Grmap, x, y, distance, direction float64, depth int) { x2 := x + distance*math.Sin(direction*math.Pi/180) y2 := y - distance*math.Cos(direction*math.Pi/180) g.AaLine(x, y, x2, y2) if depth > 0 { ftree(g, x2, y2, distance*frac, direction-angle, depth-1) ftree(g, x2, y2, distance*frac, direction+angle, depth-1) } }
#include <windows.h> #include <string> #include <math.h> using namespace std; const float PI = 3.1415926536f; class myBitmap { public: myBitmap() : pen( NULL ) {} ~myBitmap() { DeleteObject( pen ); DeleteDC( hdc ); DeleteObject( bmp ); } bool create( int w, int h ) { BITMAPINFO bi; void *pBits; ZeroMemory( &bi, sizeof( bi ) ); bi.bmiHeader.biSize = sizeof( bi.bmiHeader ); bi.bmiHeader.biBitCount = sizeof( DWORD ) * 8; bi.bmiHeader.biCompression = BI_RGB; bi.bmiHeader.biPlanes = 1; bi.bmiHeader.biWidth = w; bi.bmiHeader.biHeight = -h; HDC dc = GetDC( GetConsoleWindow() ); bmp = CreateDIBSection( dc, &bi, DIB_RGB_COLORS, &pBits, NULL, 0 ); if( !bmp ) return false; hdc = CreateCompatibleDC( dc ); SelectObject( hdc, bmp ); ReleaseDC( GetConsoleWindow(), dc ); width = w; height = h; return true; } void setPenColor( DWORD clr ) { if( pen ) DeleteObject( pen ); pen = CreatePen( PS_SOLID, 1, clr ); SelectObject( hdc, pen ); } void saveBitmap( string path ) { BITMAPFILEHEADER fileheader; BITMAPINFO infoheader; BITMAP bitmap; DWORD* dwpBits; DWORD wb; HANDLE file; GetObject( bmp, sizeof( bitmap ), &bitmap ); dwpBits = new DWORD[bitmap.bmWidth * bitmap.bmHeight]; ZeroMemory( dwpBits, bitmap.bmWidth * bitmap.bmHeight * sizeof( DWORD ) ); ZeroMemory( &infoheader, sizeof( BITMAPINFO ) ); ZeroMemory( &fileheader, sizeof( BITMAPFILEHEADER ) ); infoheader.bmiHeader.biBitCount = sizeof( DWORD ) * 8; infoheader.bmiHeader.biCompression = BI_RGB; infoheader.bmiHeader.biPlanes = 1; infoheader.bmiHeader.biSize = sizeof( infoheader.bmiHeader ); infoheader.bmiHeader.biHeight = bitmap.bmHeight; infoheader.bmiHeader.biWidth = bitmap.bmWidth; infoheader.bmiHeader.biSizeImage = bitmap.bmWidth * bitmap.bmHeight * sizeof( DWORD ); fileheader.bfType = 0x4D42; fileheader.bfOffBits = sizeof( infoheader.bmiHeader ) + sizeof( BITMAPFILEHEADER ); fileheader.bfSize = fileheader.bfOffBits + infoheader.bmiHeader.biSizeImage; GetDIBits( hdc, bmp, 0, height, ( LPVOID )dwpBits, &infoheader, DIB_RGB_COLORS ); file = CreateFile( path.c_str(), GENERIC_WRITE, 0, NULL, CREATE_ALWAYS, FILE_ATTRIBUTE_NORMAL, NULL ); WriteFile( file, &fileheader, sizeof( BITMAPFILEHEADER ), &wb, NULL ); WriteFile( file, &infoheader.bmiHeader, sizeof( infoheader.bmiHeader ), &wb, NULL ); WriteFile( file, dwpBits, bitmap.bmWidth * bitmap.bmHeight * 4, &wb, NULL ); CloseHandle( file ); delete [] dwpBits; } HDC getDC() { return hdc; } int getWidth() { return width; } int getHeight() { return height; } private: HBITMAP bmp; HDC hdc; HPEN pen; int width, height; }; class vector2 { public: vector2() { x = y = 0; } vector2( int a, int b ) { x = a; y = b; } void set( int a, int b ) { x = a; y = b; } void rotate( float angle_r ) { float _x = static_cast<float>( x ), _y = static_cast<float>( y ), s = sinf( angle_r ), c = cosf( angle_r ), a = _x * c - _y * s, b = _x * s + _y * c; x = static_cast<int>( a ); y = static_cast<int>( b ); } int x, y; }; class fractalTree { public: fractalTree() { _ang = DegToRadian( 24.0f ); } float DegToRadian( float degree ) { return degree * ( PI / 180.0f ); } void create( myBitmap* bmp ) { _bmp = bmp; float line_len = 130.0f; vector2 sp( _bmp->getWidth() / 2, _bmp->getHeight() - 1 ); MoveToEx( _bmp->getDC(), sp.x, sp.y, NULL ); sp.y -= static_cast<int>( line_len ); LineTo( _bmp->getDC(), sp.x, sp.y); drawRL( &sp, line_len, 0, true ); drawRL( &sp, line_len, 0, false ); } private: void drawRL( vector2* sp, float line_len, float a, bool rg ) { line_len *= .75f; if( line_len < 2.0f ) return; MoveToEx( _bmp->getDC(), sp->x, sp->y, NULL ); vector2 r( 0, static_cast<int>( line_len ) ); if( rg ) a -= _ang; else a += _ang; r.rotate( a ); r.x += sp->x; r.y = sp->y - r.y; LineTo( _bmp->getDC(), r.x, r.y ); drawRL( &r, line_len, a, true ); drawRL( &r, line_len, a, false ); } myBitmap* _bmp; float _ang; }; int main( int argc, char* argv[] ) { ShowWindow( GetConsoleWindow(), SW_MAXIMIZE ); myBitmap bmp; bmp.create( 640, 512 ); bmp.setPenColor( RGB( 255, 255, 0 ) ); fractalTree tree; tree.create( &bmp ); BitBlt( GetDC( GetConsoleWindow() ), 0, 20, 648, 512, bmp.getDC(), 0, 0, SRCCOPY ); bmp.saveBitmap( "f: system( "pause" ); return 0; }
Translate this program into C++ but keep the logic exactly as in Go.
package main import "github.com/fogleman/gg" var palette = [8]string{ "000000", "FF0000", "00FF00", "0000FF", "FF00FF", "00FFFF", "FFFF00", "FFFFFF", } func pinstripe(dc *gg.Context) { w := dc.Width() h := dc.Height() / 4 for b := 1; b <= 4; b++ { for x, ci := 0, 0; x < w; x, ci = x+b, ci+1 { dc.SetHexColor(palette[ci%8]) y := h * (b - 1) dc.DrawRectangle(float64(x), float64(y), float64(b), float64(h)) dc.Fill() } } } func main() { dc := gg.NewContext(900, 600) pinstripe(dc) dc.SavePNG("color_pinstripe.png") }
#include <windows.h> class pinstripe { public: pinstripe() { createColors(); } void setDimensions( int x, int y ) { _mw = x; _mh = y; } void createColors() { colors[0] = 0; colors[1] = 255; colors[2] = RGB( 0, 255, 0 ); colors[3] = RGB( 0, 0, 255 ); colors[4] = RGB( 255, 0, 255 ); colors[5] = RGB( 0, 255, 255 ); colors[6] = RGB( 255, 255, 0 ); colors[7] = RGB( 255, 255, 255 ); } void draw( HDC dc ) { HPEN pen; int lh = _mh / 4, row, cp; for( int lw = 1; lw < 5; lw++ ) { cp = 0; row = ( lw - 1 ) * lh; for( int x = 0 + lw > 1 ? lw > 3 ? 2 : 1 : 0; x < _mw; x += lw ) { pen = CreatePen( PS_SOLID, lw, colors[cp] ); ++cp %= 8; SelectObject( dc, pen ); MoveToEx( dc, x, row, NULL ); LineTo( dc, x, row + lh ); DeleteObject( pen ); } } } private: int _mw, _mh; DWORD colors[8]; }; pinstripe pin; void PaintWnd( HWND hWnd ) { PAINTSTRUCT ps; HDC hdc = BeginPaint( hWnd, &ps ); pin.draw( hdc ); EndPaint( hWnd, &ps ); } LRESULT CALLBACK WndProc( HWND hWnd, UINT msg, WPARAM wParam, LPARAM lParam ) { switch( msg ) { case WM_DESTROY: PostQuitMessage( 0 ); break; case WM_PAINT: PaintWnd( hWnd ); break; default: return DefWindowProc( hWnd, msg, wParam, lParam ); } return 0; } HWND InitAll( HINSTANCE hInstance ) { WNDCLASSEX wcex; ZeroMemory( &wcex, sizeof( wcex ) ); wcex.cbSize = sizeof( WNDCLASSEX ); wcex.style = CS_HREDRAW | CS_VREDRAW; wcex.lpfnWndProc = WndProc; wcex.hInstance = hInstance; wcex.hCursor = LoadCursor( NULL, IDC_ARROW ); wcex.hbrBackground = ( HBRUSH )( COLOR_WINDOW + 1 ); wcex.lpszClassName = "_CLR_PS_"; RegisterClassEx( &wcex ); return CreateWindow( "_CLR_PS_", ".: Clr Pinstripe -- PJorente :.", WS_POPUP, CW_USEDEFAULT, 0, 200, 200, NULL, NULL, hInstance, NULL ); } int APIENTRY _tWinMain( HINSTANCE hInstance, HINSTANCE hPrevInstance, LPTSTR lpCmdLine, int nCmdShow ) { srand( GetTickCount() ); HWND hwnd = InitAll( hInstance ); if( !hwnd ) return -1; int mw = GetSystemMetrics( SM_CXSCREEN ), mh = GetSystemMetrics( SM_CYSCREEN ); pin.setDimensions( mw, mh ); RECT rc = { 0, 0, mw, mh }; AdjustWindowRectEx( &rc, WS_POPUP, FALSE, 0 ); int w = rc.right - rc.left, h = rc.bottom - rc.top; int posX = ( GetSystemMetrics( SM_CXSCREEN ) >> 1 ) - ( w >> 1 ), posY = ( GetSystemMetrics( SM_CYSCREEN ) >> 1 ) - ( h >> 1 ); SetWindowPos( hwnd, HWND_TOP, posX, posY, w, h, SWP_NOZORDER ); ShowWindow( hwnd, nCmdShow ); UpdateWindow( hwnd ); MSG msg; ZeroMemory( &msg, sizeof( msg ) ); while( msg.message != WM_QUIT ) { if( PeekMessage( &msg, NULL, 0, 0, PM_REMOVE ) != 0 ) { TranslateMessage( &msg ); DispatchMessage( &msg ); } } return UnregisterClass( "_CLR_PS_", hInstance ); }
Can you help me rewrite this code in C++ instead of Go, keeping it the same logically?
package main import ( "fmt" "strconv" ) var days = []string{"Sunday", "Monday", "Tuesday", "Wednesday", "Thursday", "Friday", "Saturday"} func anchorDay(y int) int { return (2 + 5*(y%4) + 4*(y%100) + 6*(y%400)) % 7 } func isLeapYear(y int) bool { return y%4 == 0 && (y%100 != 0 || y%400 == 0) } var firstDaysCommon = []int{3, 7, 7, 4, 2, 6, 4, 1, 5, 3, 7, 5} var firstDaysLeap = []int{4, 1, 7, 4, 2, 6, 4, 1, 5, 3, 7, 5} func main() { dates := []string{ "1800-01-06", "1875-03-29", "1915-12-07", "1970-12-23", "2043-05-14", "2077-02-12", "2101-04-02", } fmt.Println("Days of week given by Doomsday rule:") for _, date := range dates { y, _ := strconv.Atoi(date[0:4]) m, _ := strconv.Atoi(date[5:7]) m-- d, _ := strconv.Atoi(date[8:10]) a := anchorDay(y) f := firstDaysCommon[m] if isLeapYear(y) { f = firstDaysLeap[m] } w := d - f if w < 0 { w = 7 + w } dow := (a + w) % 7 fmt.Printf("%s -> %s\n", date, days[dow]) } }
#include <iostream> #include <cstdint> struct Date { std::uint16_t year; std::uint8_t month; std::uint8_t day; }; constexpr bool leap(int year) { return year%4==0 && (year%100!=0 || year%400==0); } const std::string& weekday(const Date& date) { static const std::uint8_t leapdoom[] = {4,1,7,2,4,6,4,1,5,3,7,5}; static const std::uint8_t normdoom[] = {3,7,7,4,2,6,4,1,5,3,7,5}; static const std::string days[] = { "Sunday", "Monday", "Tuesday", "Wednesday", "Thursday", "Friday", "Saturday" }; unsigned const c = date.year/100, r = date.year%100; unsigned const s = r/12, t = r%12; unsigned const c_anchor = (5 * (c%4) + 2) % 7; unsigned const doom = (s + t + t/4 + c_anchor) % 7; unsigned const anchor = (leap(date.year) ? leapdoom : normdoom)[date.month-1]; return days[(doom+date.day-anchor+7)%7]; } int main(void) { const std::string months[] = {"", "January", "February", "March", "April", "May", "June", "July", "August", "September", "October", "November", "December" }; const Date dates[] = { {1800,1,6}, {1875,3,29}, {1915,12,7}, {1970,12,23}, {2043,5,14}, {2077,2,12}, {2101,4,2} }; for (const Date& d : dates) { std::cout << months[d.month] << " " << (int)d.day << ", " << d.year; std::cout << (d.year > 2021 ? " will be " : " was "); std::cout << "on a " << weekday(d) << std::endl; } return 0; }
Write a version of this Go function in C++ with identical behavior.
package main import ( "fmt" "strconv" ) var days = []string{"Sunday", "Monday", "Tuesday", "Wednesday", "Thursday", "Friday", "Saturday"} func anchorDay(y int) int { return (2 + 5*(y%4) + 4*(y%100) + 6*(y%400)) % 7 } func isLeapYear(y int) bool { return y%4 == 0 && (y%100 != 0 || y%400 == 0) } var firstDaysCommon = []int{3, 7, 7, 4, 2, 6, 4, 1, 5, 3, 7, 5} var firstDaysLeap = []int{4, 1, 7, 4, 2, 6, 4, 1, 5, 3, 7, 5} func main() { dates := []string{ "1800-01-06", "1875-03-29", "1915-12-07", "1970-12-23", "2043-05-14", "2077-02-12", "2101-04-02", } fmt.Println("Days of week given by Doomsday rule:") for _, date := range dates { y, _ := strconv.Atoi(date[0:4]) m, _ := strconv.Atoi(date[5:7]) m-- d, _ := strconv.Atoi(date[8:10]) a := anchorDay(y) f := firstDaysCommon[m] if isLeapYear(y) { f = firstDaysLeap[m] } w := d - f if w < 0 { w = 7 + w } dow := (a + w) % 7 fmt.Printf("%s -> %s\n", date, days[dow]) } }
#include <iostream> #include <cstdint> struct Date { std::uint16_t year; std::uint8_t month; std::uint8_t day; }; constexpr bool leap(int year) { return year%4==0 && (year%100!=0 || year%400==0); } const std::string& weekday(const Date& date) { static const std::uint8_t leapdoom[] = {4,1,7,2,4,6,4,1,5,3,7,5}; static const std::uint8_t normdoom[] = {3,7,7,4,2,6,4,1,5,3,7,5}; static const std::string days[] = { "Sunday", "Monday", "Tuesday", "Wednesday", "Thursday", "Friday", "Saturday" }; unsigned const c = date.year/100, r = date.year%100; unsigned const s = r/12, t = r%12; unsigned const c_anchor = (5 * (c%4) + 2) % 7; unsigned const doom = (s + t + t/4 + c_anchor) % 7; unsigned const anchor = (leap(date.year) ? leapdoom : normdoom)[date.month-1]; return days[(doom+date.day-anchor+7)%7]; } int main(void) { const std::string months[] = {"", "January", "February", "March", "April", "May", "June", "July", "August", "September", "October", "November", "December" }; const Date dates[] = { {1800,1,6}, {1875,3,29}, {1915,12,7}, {1970,12,23}, {2043,5,14}, {2077,2,12}, {2101,4,2} }; for (const Date& d : dates) { std::cout << months[d.month] << " " << (int)d.day << ", " << d.year; std::cout << (d.year > 2021 ? " will be " : " was "); std::cout << "on a " << weekday(d) << std::endl; } return 0; }
Keep all operations the same but rewrite the snippet in C++.
package main import ( "fmt" "math/rand" "time" ) func cocktailShakerSort(a []int) { var begin = 0 var end = len(a) - 2 for begin <= end { newBegin := end newEnd := begin for i := begin; i <= end; i++ { if a[i] > a[i+1] { a[i+1], a[i] = a[i], a[i+1] newEnd = i } } end = newEnd - 1 for i := end; i >= begin; i-- { if a[i] > a[i+1] { a[i+1], a[i] = a[i], a[i+1] newBegin = i } } begin = newBegin + 1 } } func cocktailSort(a []int) { last := len(a) - 1 for { swapped := false for i := 0; i < last; i++ { if a[i] > a[i+1] { a[i], a[i+1] = a[i+1], a[i] swapped = true } } if !swapped { return } swapped = false for i := last - 1; i >= 0; i-- { if a[i] > a[i+1] { a[i], a[i+1] = a[i+1], a[i] swapped = true } } if !swapped { return } } } func main() { a := []int{21, 4, -9, 62, -7, 107, -62, 4, 0, -170} fmt.Println("Original array:", a) b := make([]int, len(a)) copy(b, a) cocktailSort(a) fmt.Println("Cocktail sort :", a) cocktailShakerSort(b) fmt.Println("C/Shaker sort :", b) rand.Seed(time.Now().UnixNano()) fmt.Println("\nRelative speed of the two sorts") fmt.Println(" N x faster (CSS v CS)") fmt.Println("----- -------------------") const runs = 10 for _, n := range []int{1000, 2000, 4000, 8000, 10000, 20000} { sum := 0.0 for i := 1; i <= runs; i++ { nums := make([]int, n) for i := 0; i < n; i++ { rn := rand.Intn(100000) if i%2 == 1 { rn = -rn } nums[i] = rn } nums2 := make([]int, n) copy(nums2, nums) start := time.Now() cocktailSort(nums) elapsed := time.Since(start) start2 := time.Now() cocktailShakerSort(nums2) elapsed2 := time.Since(start2) sum += float64(elapsed) / float64(elapsed2) } fmt.Printf(" %2dk %0.3f\n", n/1000, sum/runs) } }
#include <algorithm> #include <cassert> #include <iostream> #include <iterator> #include <vector> template <typename iterator> void cocktail_shaker_sort(iterator begin, iterator end) { if (begin == end) return; for (--end; begin < end; ) { iterator new_begin = end; iterator new_end = begin; for (iterator i = begin; i < end; ++i) { iterator j = i + 1; if (*j < *i) { std::iter_swap(i, j); new_end = i; } } end = new_end; for (iterator i = end; i > begin; --i) { iterator j = i - 1; if (*i < *j) { std::iter_swap(i, j); new_begin = i; } } begin = new_begin; } } template <typename iterator> void print(iterator begin, iterator end) { if (begin == end) return; std::cout << *begin++; while (begin != end) std::cout << ' ' << *begin++; std::cout << '\n'; } int main() { std::vector<int> v{5, 1, -6, 12, 3, 13, 2, 4, 0, 15}; std::cout << "before: "; print(v.begin(), v.end()); cocktail_shaker_sort(v.begin(), v.end()); assert(std::is_sorted(v.begin(), v.end())); std::cout << "after: "; print(v.begin(), v.end()); return 0; }
Translate this program into C++ but keep the logic exactly as in Go.
package main import ( "github.com/google/gxui" "github.com/google/gxui/drivers/gl" "github.com/google/gxui/math" "github.com/google/gxui/themes/dark" omath "math" "time" ) const ( ANIMATION_WIDTH int = 480 ANIMATION_HEIGHT int = 320 BALL_RADIUS float32 = 25.0 METER_PER_PIXEL float64 = 1.0 / 20.0 PHI_ZERO float64 = omath.Pi * 0.5 ) var ( l float64 = float64(ANIMATION_HEIGHT) * 0.5 freq float64 = omath.Sqrt(9.81 / (l * METER_PER_PIXEL)) ) type Pendulum interface { GetPhi() float64 } type mathematicalPendulum struct { start time.Time } func (p *mathematicalPendulum) GetPhi() float64 { if (p.start == time.Time{}) { p.start = time.Now() } t := float64(time.Since(p.start).Nanoseconds()) / omath.Pow10(9) return PHI_ZERO * omath.Cos(t*freq) } type numericalPendulum struct { currentPhi float64 angAcc float64 angVel float64 lastTime time.Time } func (p *numericalPendulum) GetPhi() float64 { dt := 0.0 if (p.lastTime != time.Time{}) { dt = float64(time.Since(p.lastTime).Nanoseconds()) / omath.Pow10(9) } p.lastTime = time.Now() p.angAcc = -9.81 / (float64(l) * METER_PER_PIXEL) * omath.Sin(p.currentPhi) p.angVel += p.angAcc * dt p.currentPhi += p.angVel * dt return p.currentPhi } func draw(p Pendulum, canvas gxui.Canvas, x, y int) { attachment := math.Point{X: ANIMATION_WIDTH/2 + x, Y: y} phi := p.GetPhi() ball := math.Point{X: x + ANIMATION_WIDTH/2 + math.Round(float32(l*omath.Sin(phi))), Y: y + math.Round(float32(l*omath.Cos(phi)))} line := gxui.Polygon{gxui.PolygonVertex{attachment, 0}, gxui.PolygonVertex{ball, 0}} canvas.DrawLines(line, gxui.DefaultPen) m := math.Point{int(BALL_RADIUS), int(BALL_RADIUS)} rect := math.Rect{ball.Sub(m), ball.Add(m)} canvas.DrawRoundedRect(rect, BALL_RADIUS, BALL_RADIUS, BALL_RADIUS, BALL_RADIUS, gxui.TransparentPen, gxui.CreateBrush(gxui.Yellow)) } func appMain(driver gxui.Driver) { theme := dark.CreateTheme(driver) window := theme.CreateWindow(ANIMATION_WIDTH, 2*ANIMATION_HEIGHT, "Pendulum") window.SetBackgroundBrush(gxui.CreateBrush(gxui.Gray50)) image := theme.CreateImage() ticker := time.NewTicker(time.Millisecond * 15) pendulum := &mathematicalPendulum{} pendulum2 := &numericalPendulum{PHI_ZERO, 0.0, 0.0, time.Time{}} go func() { for _ = range ticker.C { canvas := driver.CreateCanvas(math.Size{ANIMATION_WIDTH, 2 * ANIMATION_HEIGHT}) canvas.Clear(gxui.White) draw(pendulum, canvas, 0, 0) draw(pendulum2, canvas, 0, ANIMATION_HEIGHT) canvas.Complete() driver.Call(func() { image.SetCanvas(canvas) }) } }() window.AddChild(image) window.OnClose(ticker.Stop) window.OnClose(driver.Terminate) } func main() { gl.StartDriver(appMain) }
#ifndef __wxPendulumDlg_h__ #define __wxPendulumDlg_h__ #ifdef __BORLANDC__ #pragma hdrstop #endif #ifndef WX_PRECOMP #include <wx/wx.h> #include <wx/dialog.h> #else #include <wx/wxprec.h> #endif #include <wx/timer.h> #include <wx/dcbuffer.h> #include <cmath> class wxPendulumDlgApp : public wxApp { public: bool OnInit(); int OnExit(); }; class wxPendulumDlg : public wxDialog { public: wxPendulumDlg(wxWindow *parent, wxWindowID id = 1, const wxString &title = wxT("wxPendulum"), const wxPoint& pos = wxDefaultPosition, const wxSize& size = wxDefaultSize, long style = wxSUNKEN_BORDER | wxCAPTION | wxRESIZE_BORDER | wxSYSTEM_MENU | wxDIALOG_NO_PARENT | wxMINIMIZE_BOX | wxMAXIMIZE_BOX | wxCLOSE_BOX); virtual ~wxPendulumDlg(); void wxPendulumDlgPaint(wxPaintEvent& event); void wxPendulumDlgSize(wxSizeEvent& event); void OnTimer(wxTimerEvent& event); private: wxTimer *m_timer; unsigned int m_uiLength; double m_Angle; double m_AngleVelocity; enum wxIDs { ID_WXTIMER1 = 1001, ID_DUMMY_VALUE_ }; void OnClose(wxCloseEvent& event); void CreateGUIControls(); DECLARE_EVENT_TABLE() }; #endif
Transform the following Go implementation into C++, maintaining the same output and logic.
package main import "fmt" func enc(b int) int { return b ^ b>>1 } func dec(g int) (b int) { for ; g != 0; g >>= 1 { b ^= g } return } func main() { fmt.Println("decimal binary gray decoded") for b := 0; b < 32; b++ { g := enc(b) d := dec(g) fmt.Printf(" %2d %05b %05b %05b %2d\n", b, b, g, d, d) } }
#include <bitset> #include <iostream> #include <string> #include <assert.h> uint32_t gray_encode(uint32_t b) { return b ^ (b >> 1); } uint32_t gray_decode(uint32_t g) { for (uint32_t bit = 1U << 31; bit > 1; bit >>= 1) { if (g & bit) g ^= bit >> 1; } return g; } std::string to_binary(int value) { const std::bitset<32> bs(value); const std::string str(bs.to_string()); const size_t pos(str.find('1')); return pos == std::string::npos ? "0" : str.substr(pos); } int main() { std::cout << "Number\tBinary\tGray\tDecoded\n"; for (uint32_t n = 0; n < 32; ++n) { uint32_t g = gray_encode(n); assert(gray_decode(g) == n); std::cout << n << "\t" << to_binary(n) << "\t" << to_binary(g) << "\t" << g << "\n"; } }
Convert this Go block to C++, preserving its control flow and logic.
package main import "fmt" func enc(b int) int { return b ^ b>>1 } func dec(g int) (b int) { for ; g != 0; g >>= 1 { b ^= g } return } func main() { fmt.Println("decimal binary gray decoded") for b := 0; b < 32; b++ { g := enc(b) d := dec(g) fmt.Printf(" %2d %05b %05b %05b %2d\n", b, b, g, d, d) } }
#include <bitset> #include <iostream> #include <string> #include <assert.h> uint32_t gray_encode(uint32_t b) { return b ^ (b >> 1); } uint32_t gray_decode(uint32_t g) { for (uint32_t bit = 1U << 31; bit > 1; bit >>= 1) { if (g & bit) g ^= bit >> 1; } return g; } std::string to_binary(int value) { const std::bitset<32> bs(value); const std::string str(bs.to_string()); const size_t pos(str.find('1')); return pos == std::string::npos ? "0" : str.substr(pos); } int main() { std::cout << "Number\tBinary\tGray\tDecoded\n"; for (uint32_t n = 0; n < 32; ++n) { uint32_t g = gray_encode(n); assert(gray_decode(g) == n); std::cout << n << "\t" << to_binary(n) << "\t" << to_binary(g) << "\t" << g << "\n"; } }
Rewrite this program in C++ while keeping its functionality equivalent to the Go version.
package main import ( "archive/tar" "compress/gzip" "flag" "io" "log" "os" "time" ) func main() { filename := flag.String("file", "TAPE.FILE", "filename within TAR") data := flag.String("data", "", "data for file") outfile := flag.String("out", "", "output file or device (e.g. /dev/tape)") gzipFlag := flag.Bool("gzip", false, "use gzip compression") flag.Parse() var w io.Writer = os.Stdout if *outfile != "" { f, err := os.Create(*outfile) if err != nil { log.Fatalf("opening/creating %q: %v", *outfile, err) } defer f.Close() w = f } if *gzipFlag { zw := gzip.NewWriter(w) defer zw.Close() w = zw } tw := tar.NewWriter(w) defer tw.Close() w = tw tw.WriteHeader(&tar.Header{ Name: *filename, Mode: 0660, Size: int64(len(*data)), ModTime: time.Now(), Typeflag: tar.TypeReg, Uname: "guest", Gname: "guest", }) _, err := w.Write([]byte(*data)) if err != nil { log.Fatal("writing data:", err) } }
#include <iostream> #include <fstream> #if defined(_WIN32) || defined(WIN32) constexpr auto FILENAME = "tape.file"; #else constexpr auto FILENAME = "/dev/tape"; #endif int main() { std::filebuf fb; fb.open(FILENAME,std::ios::out); std::ostream os(&fb); os << "Hello World\n"; fb.close(); return 0; }
Generate an equivalent C++ version of this Go code.
package main import ( "archive/tar" "compress/gzip" "flag" "io" "log" "os" "time" ) func main() { filename := flag.String("file", "TAPE.FILE", "filename within TAR") data := flag.String("data", "", "data for file") outfile := flag.String("out", "", "output file or device (e.g. /dev/tape)") gzipFlag := flag.Bool("gzip", false, "use gzip compression") flag.Parse() var w io.Writer = os.Stdout if *outfile != "" { f, err := os.Create(*outfile) if err != nil { log.Fatalf("opening/creating %q: %v", *outfile, err) } defer f.Close() w = f } if *gzipFlag { zw := gzip.NewWriter(w) defer zw.Close() w = zw } tw := tar.NewWriter(w) defer tw.Close() w = tw tw.WriteHeader(&tar.Header{ Name: *filename, Mode: 0660, Size: int64(len(*data)), ModTime: time.Now(), Typeflag: tar.TypeReg, Uname: "guest", Gname: "guest", }) _, err := w.Write([]byte(*data)) if err != nil { log.Fatal("writing data:", err) } }
#include <iostream> #include <fstream> #if defined(_WIN32) || defined(WIN32) constexpr auto FILENAME = "tape.file"; #else constexpr auto FILENAME = "/dev/tape"; #endif int main() { std::filebuf fb; fb.open(FILENAME,std::ios::out); std::ostream os(&fb); os << "Hello World\n"; fb.close(); return 0; }
Generate a C++ translation of this Go snippet without changing its computational steps.
package main import ( "sort" "container/heap" "fmt" ) type HeapHelper struct { container sort.Interface length int } func (self HeapHelper) Len() int { return self.length } func (self HeapHelper) Less(i, j int) bool { return self.container.Less(j, i) } func (self HeapHelper) Swap(i, j int) { self.container.Swap(i, j) } func (self *HeapHelper) Push(x interface{}) { panic("impossible") } func (self *HeapHelper) Pop() interface{} { self.length-- return nil } func heapSort(a sort.Interface) { helper := HeapHelper{ a, a.Len() } heap.Init(&helper) for helper.length > 0 { heap.Pop(&helper) } } func main() { a := []int{170, 45, 75, -90, -802, 24, 2, 66} fmt.Println("before:", a) heapSort(sort.IntSlice(a)) fmt.Println("after: ", a) }
#include <algorithm> #include <iterator> #include <iostream> template<typename RandomAccessIterator> void heap_sort(RandomAccessIterator begin, RandomAccessIterator end) { std::make_heap(begin, end); std::sort_heap(begin, end); } int main() { int a[] = {100, 2, 56, 200, -52, 3, 99, 33, 177, -199}; heap_sort(std::begin(a), std::end(a)); copy(std::begin(a), std::end(a), std::ostream_iterator<int>(std::cout, " ")); std::cout << "\n"; }
Convert this Go snippet to C++ and keep its semantics consistent.
package cards import ( "math/rand" ) type Suit uint8 const ( Spade Suit = 3 Heart Suit = 2 Diamond Suit = 1 Club Suit = 0 ) func (s Suit) String() string { const suites = "CDHS" return suites[s : s+1] } type Rank uint8 const ( Ace Rank = 1 Two Rank = 2 Three Rank = 3 Four Rank = 4 Five Rank = 5 Six Rank = 6 Seven Rank = 7 Eight Rank = 8 Nine Rank = 9 Ten Rank = 10 Jack Rank = 11 Queen Rank = 12 King Rank = 13 ) func (r Rank) String() string { const ranks = "A23456789TJQK" return ranks[r-1 : r] } type Card uint8 func NewCard(r Rank, s Suit) Card { return Card(13*uint8(s) + uint8(r-1)) } func (c Card) RankSuit() (Rank, Suit) { return Rank(c%13 + 1), Suit(c / 13) } func (c Card) Rank() Rank { return Rank(c%13 + 1) } func (c Card) Suit() Suit { return Suit(c / 13) } func (c Card) String() string { return c.Rank().String() + c.Suit().String() } type Deck []Card func NewDeck() Deck { d := make(Deck, 52) for i := range d { d[i] = Card(i) } return d } func (d Deck) String() string { s := "" for i, c := range d { switch { case i == 0: case i%13 == 0: s += "\n" default: s += " " } s += c.String() } return s } func (d Deck) Shuffle() { for i := range d { j := rand.Intn(i + 1) d[i], d[j] = d[j], d[i] } } func (d Deck) Contains(tc Card) bool { for _, c := range d { if c == tc { return true } } return false } func (d *Deck) AddDeck(decks ...Deck) { for _, o := range decks { *d = append(*d, o...) } } func (d *Deck) AddCard(c Card) { *d = append(*d, c) } func (d *Deck) Draw(n int) Deck { old := *d *d = old[n:] return old[:n:n] } func (d *Deck) DrawCard() (Card, bool) { if len(*d) == 0 { return 0, false } old := *d *d = old[1:] return old[0], true } func (d *Deck) Deal(cards int, hands ...Deck) ([]Deck, bool) { for i := 0; i < cards; i++ { for j := range hands { if len(*d) == 0 { return hands, false } hands[j] = append(hands[j], (*d)[0]) *d = (*d)[1:] } } return hands, true }
#include <deque> #include <algorithm> #include <ostream> #include <iterator> namespace cards { class card { public: enum pip_type { two, three, four, five, six, seven, eight, nine, ten, jack, queen, king, ace, pip_count }; enum suite_type { hearts, spades, diamonds, clubs, suite_count }; enum { unique_count = pip_count * suite_count }; card(suite_type s, pip_type p): value(s + suite_count * p) {} explicit card(unsigned char v = 0): value(v) {} pip_type pip() { return pip_type(value / suite_count); } suite_type suite() { return suite_type(value % suite_count); } private: unsigned char value; }; const char* const pip_names[] = { "two", "three", "four", "five", "six", "seven", "eight", "nine", "ten", "jack", "queen", "king", "ace" }; std::ostream& operator<<(std::ostream& os, card::pip_type pip) { return os << pip_names[pip]; } const char* const suite_names[] = { "hearts", "spades", "diamonds", "clubs" }; std::ostream& operator<<(std::ostream& os, card::suite_type suite) { return os << suite_names[suite]; } std::ostream& operator<<(std::ostream& os, card c) { return os << c.pip() << " of " << c.suite(); } class deck { public: deck() { for (int i = 0; i < card::unique_count; ++i) { cards.push_back(card(i)); } } void shuffle() { std::random_shuffle(cards.begin(), cards.end()); } card deal() { card c = cards.front(); cards.pop_front(); return c; } typedef std::deque<card>::const_iterator const_iterator; const_iterator begin() const { return cards.cbegin(); } const_iterator end() const { return cards.cend(); } private: std::deque<card> cards; }; inline std::ostream& operator<<(std::ostream& os, const deck& d) { std::copy(d.begin(), d.end(), std::ostream_iterator<card>(os, "\n")); return os; } }
Port the following code from Go to C++ with equivalent syntax and logic.
package main import ( "fmt" ) func main() { var a [5]int fmt.Println("len(a) =", len(a)) fmt.Println("a =", a) a[0] = 3 fmt.Println("a =", a) fmt.Println("a[0] =", a[0]) s := a[:4] fmt.Println("s =", s) fmt.Println("len(s) =", len(s), " cap(s) =", cap(s)) s = s[:5] fmt.Println("s =", s) a[0] = 22 fmt.Println("a =", a) fmt.Println("s =", s) s = append(s, 4, 5, 6) fmt.Println("s =", s) fmt.Println("len(s) =", len(s), " cap(s) =", cap(s)) a[4] = -1 fmt.Println("a =", a) fmt.Println("s =", s) s = make([]int, 8) fmt.Println("s =", s) fmt.Println("len(s) =", len(s), " cap(s) =", cap(s)) }
#include <array> #include <vector> #include <algorithm> #include <iostream> #include <iterator> #include <string> template <typename Array> void demonstrate(Array& array) { array[2] = "Three"; array.at(1) = "Two"; std::reverse(begin(array), end(array)); std::for_each(begin(array), end(array), [](typename Array::value_type const& element) { std::cout << element << ' '; }); std::cout << '\n'; } int main() { auto fixed_size_array = std::array<std::string, 3>{ "One", "Four", "Eight" }; auto dynamic_array = std::vector<std::string>{ "One", "Four" }; dynamic_array.push_back("Eight"); demonstrate(fixed_size_array); demonstrate(dynamic_array); }
Preserve the algorithm and functionality while converting the code from Go to C++.
package main import ( "fmt" "strings" "unicode/utf8" ) var order = 3 var grain = "#" func main() { carpet := []string{grain} for ; order > 0; order-- { hole := strings.Repeat(" ", utf8.RuneCountInString(carpet[0])) middle := make([]string, len(carpet)) for i, s := range carpet { middle[i] = s + hole + s carpet[i] = strings.Repeat(s, 3) } carpet = append(append(carpet, middle...), carpet...) } for _, r := range carpet { fmt.Println(r) } }
#include <cstdint> #include <cstdlib> #include <cstdio> static constexpr int32_t bct_low_bits = 0x55555555; static int32_t bct_decrement(int32_t v) { --v; return v ^ (v & (v>>1) & bct_low_bits); } int main (int argc, char *argv[]) { const int32_t n = (1 < argc) ? std::atoi(argv[1]) : 3; if (n < 0 || 9 < n) { std::printf("N out of range (use 0..9): %ld\n", long(n)); return 1; } const int32_t size_bct = 1<<(n*2); int32_t y = size_bct; do { y = bct_decrement(y); int32_t x = size_bct; do { x = bct_decrement(x); std::putchar((x & y & bct_low_bits) ? ' ' : '#'); } while (0 < x); std::putchar('\n'); } while (0 < y); return 0; }
Change the programming language of this snippet from Go to C++ without modifying what it does.
package main import ( "fmt" "math/rand" "sort" "time" ) func main() { list := []int{31, 41, 59, 26, 53, 58, 97, 93, 23, 84} rand.Seed(time.Now().UnixNano()) fmt.Println("unsorted:", list) temp := make([]int, len(list)) copy(temp, list) for !sort.IntsAreSorted(temp) { for i, v := range rand.Perm(len(list)) { temp[i] = list[v] } } fmt.Println("sorted! ", temp) }
#include <algorithm> #include <iostream> #include <iterator> #include <random> template <typename RandomAccessIterator, typename Predicate> void bogo_sort(RandomAccessIterator begin, RandomAccessIterator end, Predicate p) { std::random_device rd; std::mt19937 generator(rd()); while (!std::is_sorted(begin, end, p)) { std::shuffle(begin, end, generator); } } template <typename RandomAccessIterator> void bogo_sort(RandomAccessIterator begin, RandomAccessIterator end) { bogo_sort( begin, end, std::less< typename std::iterator_traits<RandomAccessIterator>::value_type>()); } int main() { int a[] = {100, 2, 56, 200, -52, 3, 99, 33, 177, -199}; bogo_sort(std::begin(a), std::end(a)); copy(std::begin(a), std::end(a), std::ostream_iterator<int>(std::cout, " ")); std::cout << "\n"; }
Write a version of this Go function in C++ with identical behavior.
package main import ( "fmt" "math" "sort" ) type Patient struct { id int lastName string } var patientDir = make(map[int]string) var patientIds []int func patientNew(id int, lastName string) Patient { patientDir[id] = lastName patientIds = append(patientIds, id) sort.Ints(patientIds) return Patient{id, lastName} } type DS struct { dates []string scores []float64 } type Visit struct { id int date string score float64 } var visitDir = make(map[int]DS) func visitNew(id int, date string, score float64) Visit { if date == "" { date = "0000-00-00" } v, ok := visitDir[id] if ok { v.dates = append(v.dates, date) v.scores = append(v.scores, score) visitDir[id] = DS{v.dates, v.scores} } else { visitDir[id] = DS{[]string{date}, []float64{score}} } return Visit{id, date, score} } type Merge struct{ id int } func (m Merge) lastName() string { return patientDir[m.id] } func (m Merge) dates() []string { return visitDir[m.id].dates } func (m Merge) scores() []float64 { return visitDir[m.id].scores } func (m Merge) lastVisit() string { dates := m.dates() dates2 := make([]string, len(dates)) copy(dates2, dates) sort.Strings(dates2) return dates2[len(dates2)-1] } func (m Merge) scoreSum() float64 { sum := 0.0 for _, score := range m.scores() { if score != -1 { sum += score } } return sum } func (m Merge) scoreAvg() float64 { count := 0 for _, score := range m.scores() { if score != -1 { count++ } } return m.scoreSum() / float64(count) } func mergePrint(merges []Merge) { fmt.Println("| PATIENT_ID | LASTNAME | LAST_VISIT | SCORE_SUM | SCORE_AVG |") f := "| %d | %-7s | %s | %4s | %4s |\n" for _, m := range merges { _, ok := visitDir[m.id] if ok { lv := m.lastVisit() if lv == "0000-00-00" { lv = " " } scoreSum := m.scoreSum() ss := fmt.Sprintf("%4.1f", scoreSum) if scoreSum == 0 { ss = " " } scoreAvg := m.scoreAvg() sa := " " if !math.IsNaN(scoreAvg) { sa = fmt.Sprintf("%4.2f", scoreAvg) } fmt.Printf(f, m.id, m.lastName(), lv, ss, sa) } else { fmt.Printf(f, m.id, m.lastName(), " ", " ", " ") } } } func main() { patientNew(1001, "Hopper") patientNew(4004, "Wirth") patientNew(3003, "Kemeny") patientNew(2002, "Gosling") patientNew(5005, "Kurtz") visitNew(2002, "2020-09-10", 6.8) visitNew(1001, "2020-09-17", 5.5) visitNew(4004, "2020-09-24", 8.4) visitNew(2002, "2020-10-08", -1) visitNew(1001, "", 6.6) visitNew(3003, "2020-11-12", -1) visitNew(4004, "2020-11-05", 7.0) visitNew(1001, "2020-11-19", 5.3) merges := make([]Merge, len(patientIds)) for i, id := range patientIds { merges[i] = Merge{id} } mergePrint(merges) }
#include <iostream> #include <optional> #include <ranges> #include <string> #include <vector> using namespace std; struct Patient { string ID; string LastName; }; struct Visit { string PatientID; string Date; optional<float> Score; }; int main(void) { auto patients = vector<Patient> { {"1001", "Hopper"}, {"4004", "Wirth"}, {"3003", "Kemeny"}, {"2002", "Gosling"}, {"5005", "Kurtz"}}; auto visits = vector<Visit> { {"2002", "2020-09-10", 6.8}, {"1001", "2020-09-17", 5.5}, {"4004", "2020-09-24", 8.4}, {"2002", "2020-10-08", }, {"1001", "" , 6.6}, {"3003", "2020-11-12", }, {"4004", "2020-11-05", 7.0}, {"1001", "2020-11-19", 5.3}}; sort(patients.begin(), patients.end(), [](const auto& a, const auto&b){ return a.ID < b.ID;}); cout << "| PATIENT_ID | LASTNAME | LAST_VISIT | SCORE_SUM | SCORE_AVG |\n"; for(const auto& patient : patients) { string lastVisit; float sum = 0; int numScores = 0; auto patientFilter = [&patient](const Visit &v){return v.PatientID == patient.ID;}; for(const auto& visit : visits | views::filter( patientFilter )) { if(visit.Score) { sum += *visit.Score; numScores++; } lastVisit = max(lastVisit, visit.Date); } cout << "| " << patient.ID << " | "; cout.width(8); cout << patient.LastName << " | "; cout.width(10); cout << lastVisit << " | "; if(numScores > 0) { cout.width(9); cout << sum << " | "; cout.width(9); cout << (sum / float(numScores)); } else cout << " | "; cout << " |\n"; } }
Produce a functionally identical C++ code for the snippet given in Go.
package main import ( "fmt" "math" ) type fdy func(float64, float64) float64 func eulerStep(f fdy, x, y, h float64) float64 { return y + h*f(x, y) } func newCoolingRate(k float64) func(float64) float64 { return func(deltaTemp float64) float64 { return -k * deltaTemp } } func newTempFunc(k, ambientTemp, initialTemp float64) func(float64) float64 { return func(time float64) float64 { return ambientTemp + (initialTemp-ambientTemp)*math.Exp(-k*time) } } func newCoolingRateDy(k, ambientTemp float64) fdy { crf := newCoolingRate(k) return func(_, objectTemp float64) float64 { return crf(objectTemp - ambientTemp) } } func main() { k := .07 tempRoom := 20. tempObject := 100. fcr := newCoolingRateDy(k, tempRoom) analytic := newTempFunc(k, tempRoom, tempObject) for _, deltaTime := range []float64{2, 5, 10} { fmt.Printf("Step size = %.1f\n", deltaTime) fmt.Println(" Time Euler's Analytic") temp := tempObject for time := 0.; time <= 100; time += deltaTime { fmt.Printf("%5.1f %7.3f %7.3f\n", time, temp, analytic(time)) temp = eulerStep(fcr, time, temp, deltaTime) } fmt.Println() } }
#include <iomanip> #include <iostream> typedef double F(double,double); void euler(F f, double y0, double a, double b, double h) { double y = y0; for (double t = a; t < b; t += h) { std::cout << std::fixed << std::setprecision(3) << t << " " << y << "\n"; y += h * f(t, y); } std::cout << "done\n"; } double newtonCoolingLaw(double, double t) { return -0.07 * (t - 20); } int main() { euler(newtonCoolingLaw, 100, 0, 100, 2); euler(newtonCoolingLaw, 100, 0, 100, 5); euler(newtonCoolingLaw, 100, 0, 100, 10); }
Translate the given Go code snippet into C++ without altering its behavior.
package main import ( "fmt" "math" ) func remarkable(n int) int { return n + int(.5+math.Sqrt(float64(n))) } func main() { fmt.Println(" n r(n)") fmt.Println("--- ---") for n := 1; n <= 22; n++ { fmt.Printf("%3d %3d\n", n, remarkable(n)) } const limit = 1e6 fmt.Println("\nChecking for squares for n <", limit) next := 2 nextSq := 4 for n := 1; n < limit; n++ { r := remarkable(n) switch { case r == nextSq: panic(n) case r > nextSq: fmt.Println(nextSq, "didn't occur") next++ nextSq = next * next } } fmt.Println("No squares occur for n <", limit) }
#include <iostream> #include <algorithm> #include <vector> #include <cmath> #include <boost/bind.hpp> #include <iterator> double nextNumber( double number ) { return number + floor( 0.5 + sqrt( number ) ) ; } int main( ) { std::vector<double> non_squares ; typedef std::vector<double>::iterator SVI ; non_squares.reserve( 1000000 ) ; for ( double i = 1.0 ; i < 100001.0 ; i += 1 ) non_squares.push_back( nextNumber( i ) ) ; std::copy( non_squares.begin( ) , non_squares.begin( ) + 22 , std::ostream_iterator<double>(std::cout, " " ) ) ; std::cout << '\n' ; SVI found = std::find_if ( non_squares.begin( ) , non_squares.end( ) , boost::bind( &floor, boost::bind( &sqrt, _1 ) ) == boost::bind( &sqrt, _1 ) ) ; if ( found != non_squares.end( ) ) { std::cout << "Found a square number in the sequence!\n" ; std::cout << "It is " << *found << " !\n" ; } else { std::cout << "Up to 1000000, found no square number in the sequence!\n" ; } return 0 ; }
Translate the given Go code snippet into C++ without altering its behavior.
package main import ( "fmt" "strings" ) func main() { s := "ABCDEFGH" n, m := 2, 3 fmt.Println("Index: ", "01234567") fmt.Println("String:", s) fmt.Printf("Start %d, length %d: %s\n", n, m, s[n : n+m]) fmt.Printf("Start %d, to end: %s\n", n, s[n:]) fmt.Printf("All but last: %s\n", s[:len(s)-1]) dx := strings.IndexByte(s, 'D') fmt.Printf("Start 'D', length %d: %s\n", m, s[dx : dx+m]) sx := strings.Index(s, "DE") fmt.Printf(`Start "DE", length %d: %s`+"\n", m, s[sx : sx+m]) }
#include <iostream> #include <string> int main() { std::string s = "0123456789"; int const n = 3; int const m = 4; char const c = '2'; std::string const sub = "456"; std::cout << s.substr(n, m)<< "\n"; std::cout << s.substr(n) << "\n"; std::cout << s.substr(0, s.size()-1) << "\n"; std::cout << s.substr(s.find(c), m) << "\n"; std::cout << s.substr(s.find(sub), m) << "\n"; }
Rewrite the snippet below in C++ so it works the same as the original Go code.
package main import ( "fmt" "strings" ) func main() { s := "ABCDEFGH" n, m := 2, 3 fmt.Println("Index: ", "01234567") fmt.Println("String:", s) fmt.Printf("Start %d, length %d: %s\n", n, m, s[n : n+m]) fmt.Printf("Start %d, to end: %s\n", n, s[n:]) fmt.Printf("All but last: %s\n", s[:len(s)-1]) dx := strings.IndexByte(s, 'D') fmt.Printf("Start 'D', length %d: %s\n", m, s[dx : dx+m]) sx := strings.Index(s, "DE") fmt.Printf(`Start "DE", length %d: %s`+"\n", m, s[sx : sx+m]) }
#include <iostream> #include <string> int main() { std::string s = "0123456789"; int const n = 3; int const m = 4; char const c = '2'; std::string const sub = "456"; std::cout << s.substr(n, m)<< "\n"; std::cout << s.substr(n) << "\n"; std::cout << s.substr(0, s.size()-1) << "\n"; std::cout << s.substr(s.find(c), m) << "\n"; std::cout << s.substr(s.find(sub), m) << "\n"; }
Produce a functionally identical C++ code for the snippet given in Go.
package main import ( "log" "sort" ) func main() { log.Println(jortSort([]int{1, 2, 1, 11, 213, 2, 4})) log.Println(jortSort([]int{0, 1, 0, 0, 0, 0})) log.Println(jortSort([]int{1, 2, 4, 11, 22, 22})) log.Println(jortSort([]int{0, 0, 0, 1, 2, 2})) } func jortSort(a []int) bool { c := make([]int, len(a)) copy(c, a) sort.Ints(a) for k, v := range c { if v == a[k] { continue } else { return false } } return true }
#include <algorithm> #include <string> #include <iostream> #include <iterator> class jortSort { public: template<class T> bool jort_sort( T* o, size_t s ) { T* n = copy_array( o, s ); sort_array( n, s ); bool r = false; if( n ) { r = check( o, n, s ); delete [] n; } return r; } private: template<class T> T* copy_array( T* o, size_t s ) { T* z = new T[s]; memcpy( z, o, s * sizeof( T ) ); return z; } template<class T> void sort_array( T* n, size_t s ) { std::sort( n, n + s ); } template<class T> bool check( T* n, T* o, size_t s ) { for( size_t x = 0; x < s; x++ ) if( n[x] != o[x] ) return false; return true; } }; jortSort js; template<class T> void displayTest( T* o, size_t s ) { std::copy( o, o + s, std::ostream_iterator<T>( std::cout, " " ) ); std::cout << ": -> The array is " << ( js.jort_sort( o, s ) ? "sorted!" : "not sorted!" ) << "\n\n"; } int main( int argc, char* argv[] ) { const size_t s = 5; std::string oStr[] = { "5", "A", "D", "R", "S" }; displayTest( oStr, s ); std::swap( oStr[0], oStr[1] ); displayTest( oStr, s ); int oInt[] = { 1, 2, 3, 4, 5 }; displayTest( oInt, s ); std::swap( oInt[0], oInt[1] ); displayTest( oInt, s ); return 0; }
Translate this program into C++ but keep the logic exactly as in Go.
func isLeap(year int) bool { return year%400 == 0 || year%4 == 0 && year%100 != 0 }
#include <iostream> bool is_leap_year(int year) { return year % 4 == 0 && (year % 100 != 0 || year % 400 == 0); } int main() { for (auto year : {1900, 1994, 1996, 1997, 2000}) { std::cout << year << (is_leap_year(year) ? " is" : " is not") << " a leap year.\n"; } }
Preserve the algorithm and functionality while converting the code from Go to C++.
package main import ( "fmt" "math/big" ) func main() { var n, p int64 fmt.Printf("A sample of permutations from 1 to 12:\n") for n = 1; n < 13; n++ { p = n / 3 fmt.Printf("P(%d,%d) = %d\n", n, p, perm(big.NewInt(n), big.NewInt(p))) } fmt.Printf("\nA sample of combinations from 10 to 60:\n") for n = 10; n < 61; n += 10 { p = n / 3 fmt.Printf("C(%d,%d) = %d\n", n, p, comb(big.NewInt(n), big.NewInt(p))) } fmt.Printf("\nA sample of permutations from 5 to 15000:\n") nArr := [...]int64{5, 50, 500, 1000, 5000, 15000} for _, n = range nArr { p = n / 3 fmt.Printf("P(%d,%d) = %d\n", n, p, perm(big.NewInt(n), big.NewInt(p))) } fmt.Printf("\nA sample of combinations from 100 to 1000:\n") for n = 100; n < 1001; n += 100 { p = n / 3 fmt.Printf("C(%d,%d) = %d\n", n, p, comb(big.NewInt(n), big.NewInt(p))) } } func fact(n *big.Int) *big.Int { if n.Sign() < 1 { return big.NewInt(0) } r := big.NewInt(1) i := big.NewInt(2) for i.Cmp(n) < 1 { r.Mul(r, i) i.Add(i, big.NewInt(1)) } return r } func perm(n, k *big.Int) *big.Int { r := fact(n) r.Div(r, fact(n.Sub(n, k))) return r } func comb(n, r *big.Int) *big.Int { if r.Cmp(n) == 1 { return big.NewInt(0) } if r.Cmp(n) == 0 { return big.NewInt(1) } c := fact(n) den := fact(n.Sub(n, r)) den.Mul(den, fact(r)) c.Div(c, den) return c }
#include <boost/multiprecision/gmp.hpp> #include <iostream> using namespace boost::multiprecision; mpz_int p(uint n, uint p) { mpz_int r = 1; mpz_int k = n - p; while (n > k) r *= n--; return r; } mpz_int c(uint n, uint k) { mpz_int r = p(n, k); while (k) r /= k--; return r; } int main() { for (uint i = 1u; i < 12u; i++) std::cout << "P(12," << i << ") = " << p(12u, i) << std::endl; for (uint i = 10u; i < 60u; i += 10u) std::cout << "C(60," << i << ") = " << c(60u, i) << std::endl; return 0; }
Generate a C++ translation of this Go snippet without changing its computational steps.
package main import ( "fmt" "math/big" ) func main() { var n, p int64 fmt.Printf("A sample of permutations from 1 to 12:\n") for n = 1; n < 13; n++ { p = n / 3 fmt.Printf("P(%d,%d) = %d\n", n, p, perm(big.NewInt(n), big.NewInt(p))) } fmt.Printf("\nA sample of combinations from 10 to 60:\n") for n = 10; n < 61; n += 10 { p = n / 3 fmt.Printf("C(%d,%d) = %d\n", n, p, comb(big.NewInt(n), big.NewInt(p))) } fmt.Printf("\nA sample of permutations from 5 to 15000:\n") nArr := [...]int64{5, 50, 500, 1000, 5000, 15000} for _, n = range nArr { p = n / 3 fmt.Printf("P(%d,%d) = %d\n", n, p, perm(big.NewInt(n), big.NewInt(p))) } fmt.Printf("\nA sample of combinations from 100 to 1000:\n") for n = 100; n < 1001; n += 100 { p = n / 3 fmt.Printf("C(%d,%d) = %d\n", n, p, comb(big.NewInt(n), big.NewInt(p))) } } func fact(n *big.Int) *big.Int { if n.Sign() < 1 { return big.NewInt(0) } r := big.NewInt(1) i := big.NewInt(2) for i.Cmp(n) < 1 { r.Mul(r, i) i.Add(i, big.NewInt(1)) } return r } func perm(n, k *big.Int) *big.Int { r := fact(n) r.Div(r, fact(n.Sub(n, k))) return r } func comb(n, r *big.Int) *big.Int { if r.Cmp(n) == 1 { return big.NewInt(0) } if r.Cmp(n) == 0 { return big.NewInt(1) } c := fact(n) den := fact(n.Sub(n, r)) den.Mul(den, fact(r)) c.Div(c, den) return c }
#include <boost/multiprecision/gmp.hpp> #include <iostream> using namespace boost::multiprecision; mpz_int p(uint n, uint p) { mpz_int r = 1; mpz_int k = n - p; while (n > k) r *= n--; return r; } mpz_int c(uint n, uint k) { mpz_int r = p(n, k); while (k) r /= k--; return r; } int main() { for (uint i = 1u; i < 12u; i++) std::cout << "P(12," << i << ") = " << p(12u, i) << std::endl; for (uint i = 10u; i < 60u; i += 10u) std::cout << "C(60," << i << ") = " << c(60u, i) << std::endl; return 0; }
Convert this Go block to C++, preserving its control flow and logic.
package main import ( "fmt" "sort" "strconv" ) func lexOrder(n int) []int { first, last, k := 1, n, n if n < 1 { first, last, k = n, 1, 2-n } strs := make([]string, k) for i := first; i <= last; i++ { strs[i-first] = strconv.Itoa(i) } sort.Strings(strs) ints := make([]int, k) for i := 0; i < k; i++ { ints[i], _ = strconv.Atoi(strs[i]) } return ints } func main() { fmt.Println("In lexicographical order:\n") for _, n := range []int{0, 5, 13, 21, -22} { fmt.Printf("%3d: %v\n", n, lexOrder(n)) } }
#include <algorithm> #include <iostream> #include <numeric> #include <string> #include <vector> void lexicographical_sort(std::vector<int>& numbers) { std::vector<std::string> strings(numbers.size()); std::transform(numbers.begin(), numbers.end(), strings.begin(), [](int i) { return std::to_string(i); }); std::sort(strings.begin(), strings.end()); std::transform(strings.begin(), strings.end(), numbers.begin(), [](const std::string& s) { return std::stoi(s); }); } std::vector<int> lexicographically_sorted_vector(int n) { std::vector<int> numbers(n >= 1 ? n : 2 - n); std::iota(numbers.begin(), numbers.end(), std::min(1, n)); lexicographical_sort(numbers); return numbers; } template <typename T> void print_vector(std::ostream& out, const std::vector<T>& v) { out << '['; if (!v.empty()) { auto i = v.begin(); out << *i++; for (; i != v.end(); ++i) out << ',' << *i; } out << "]\n"; } int main(int argc, char** argv) { for (int i : { 0, 5, 13, 21, -22 }) { std::cout << i << ": "; print_vector(std::cout, lexicographically_sorted_vector(i)); } return 0; }
Translate this program into C++ but keep the logic exactly as in Go.
package main import "fmt" func main() { for _, n := range []int64{12, 1048576, 9e18, -2, 0} { fmt.Println(say(n)) } } var small = [...]string{"zero", "one", "two", "three", "four", "five", "six", "seven", "eight", "nine", "ten", "eleven", "twelve", "thirteen", "fourteen", "fifteen", "sixteen", "seventeen", "eighteen", "nineteen"} var tens = [...]string{"", "", "twenty", "thirty", "forty", "fifty", "sixty", "seventy", "eighty", "ninety"} var illions = [...]string{"", " thousand", " million", " billion", " trillion", " quadrillion", " quintillion"} func say(n int64) string { var t string if n < 0 { t = "negative " n = -n } switch { case n < 20: t += small[n] case n < 100: t += tens[n/10] s := n % 10 if s > 0 { t += "-" + small[s] } case n < 1000: t += small[n/100] + " hundred" s := n % 100 if s > 0 { t += " " + say(s) } default: sx := "" for i := 0; n > 0; i++ { p := n % 1000 n /= 1000 if p > 0 { ix := say(p) + illions[i] if sx != "" { ix += " " + sx } sx = ix } } t += sx } return t }
#include <string> #include <iostream> using std::string; const char* smallNumbers[] = { "zero", "one", "two", "three", "four", "five", "six", "seven", "eight", "nine", "ten", "eleven", "twelve", "thirteen", "fourteen", "fifteen", "sixteen", "seventeen", "eighteen", "nineteen" }; string spellHundreds(unsigned n) { string res; if (n > 99) { res = smallNumbers[n/100]; res += " hundred"; n %= 100; if (n) res += " and "; } if (n >= 20) { static const char* Decades[] = { "", "", "twenty", "thirty", "forty", "fifty", "sixty", "seventy", "eighty", "ninety" }; res += Decades[n/10]; n %= 10; if (n) res += "-"; } if (n < 20 && n > 0) res += smallNumbers[n]; return res; } const char* thousandPowers[] = { " billion", " million", " thousand", "" }; typedef unsigned long Spellable; string spell(Spellable n) { if (n < 20) return smallNumbers[n]; string res; const char** pScaleName = thousandPowers; Spellable scaleFactor = 1000000000; while (scaleFactor > 0) { if (n >= scaleFactor) { Spellable h = n / scaleFactor; res += spellHundreds(h) + *pScaleName; n %= scaleFactor; if (n) res += ", "; } scaleFactor /= 1000; ++pScaleName; } return res; } int main() { #define SPELL_IT(x) std::cout << #x " " << spell(x) << std::endl; SPELL_IT( 99); SPELL_IT( 300); SPELL_IT( 310); SPELL_IT( 1501); SPELL_IT( 12609); SPELL_IT( 512609); SPELL_IT(43112609); SPELL_IT(1234567890); return 0; }
Translate this program into C++ but keep the logic exactly as in Go.
package main import ( "fmt" "os" "sort" ) func main() { if len(os.Args) == 1 { compareStrings("abcd", "123456789", "abcdef", "1234567") } else { strings := os.Args[1:] compareStrings(strings...) } } func compareStrings(strings ...string) { sort.SliceStable(strings, func(i, j int) bool { return len(strings[i]) > len(strings[j]) }) for _, s := range strings { fmt.Printf("%d: %s\n", len(s), s) } }
#include <iostream> #include <algorithm> #include <string> #include <list> using namespace std; bool cmp(const string& a, const string& b) { return b.length() < a.length(); } void compareAndReportStringsLength(list<string> listOfStrings) { if (!listOfStrings.empty()) { char Q = '"'; string has_length(" has length "); string predicate_max(" and is the longest string"); string predicate_min(" and is the shortest string"); string predicate_ave(" and is neither the longest nor the shortest string"); list<string> ls(listOfStrings); ls.sort(cmp); int max = ls.front().length(); int min = ls.back().length(); for (list<string>::iterator s = ls.begin(); s != ls.end(); s++) { int length = s->length(); string* predicate; if (length == max) predicate = &predicate_max; else if (length == min) predicate = &predicate_min; else predicate = &predicate_ave; cout << Q << *s << Q << has_length << length << *predicate << endl; } } } int main(int argc, char* argv[]) { list<string> listOfStrings{ "abcd", "123456789", "abcdef", "1234567" }; compareAndReportStringsLength(listOfStrings); return EXIT_SUCCESS; }
Ensure the translated C++ code behaves exactly like the original Go snippet.
package main import "fmt" var a = []int{170, 45, 75, -90, -802, 24, 2, 66} func main() { fmt.Println("before:", a) for inc := len(a) / 2; inc > 0; inc = (inc + 1) * 5 / 11 { for i := inc; i < len(a); i++ { j, temp := i, a[i] for ; j >= inc && a[j-inc] > temp; j -= inc { a[j] = a[j-inc] } a[j] = temp } } fmt.Println("after: ", a) }
#include <time.h> #include <iostream> using namespace std; const int MAX = 126; class shell { public: shell() { _gap[0] = 1750; _gap[1] = 701; _gap[2] = 301; _gap[3] = 132; _gap[4] = 57; _gap[5] = 23; _gap[6] = 10; _gap[7] = 4; _gap[8] = 1; } void sort( int* a, int count ) { _cnt = count; for( int x = 0; x < 9; x++ ) if( count > _gap[x] ) { _idx = x; break; } sortIt( a ); } private: void sortIt( int* arr ) { bool sorted = false; while( true ) { sorted = true; int st = 0; for( int x = _gap[_idx]; x < _cnt; x += _gap[_idx] ) { if( arr[st] > arr[x] ) { swap( arr[st], arr[x] ); sorted = false; } st = x; } if( ++_idx >= 8 ) _idx = 8; if( sorted && _idx == 8 ) break; } } void swap( int& a, int& b ) { int t = a; a = b; b = t; } int _gap[9], _idx, _cnt; }; int main( int argc, char* argv[] ) { srand( static_cast<unsigned int>( time( NULL ) ) ); int arr[MAX]; for( int x = 0; x < MAX; x++ ) arr[x] = rand() % MAX - rand() % MAX; cout << " Before: \n=========\n"; for( int x = 0; x < 7; x++ ) { for( int a = 0; a < 18; a++ ) { cout << arr[x * 18 + a] << " "; } cout << endl; } cout << endl; shell s; s.sort( arr, MAX ); cout << " After: \n========\n"; for( int x = 0; x < 7; x++ ) { for( int a = 0; a < 18; a++ ) { cout << arr[x * 18 + a] << " "; } cout << endl; } cout << endl << endl; return system( "pause" ); }
Write a version of this Go function in C++ with identical behavior.
type dlNode struct { int next, prev *dlNode } type dlList struct { members map[*dlNode]int head, tail **dlNode }
#include <iostream> #include <list> int main () { std::list<int> numbers {1, 5, 7, 0, 3, 2}; numbers.insert(numbers.begin(), 9); numbers.insert(numbers.end(), 4); auto it = std::next(numbers.begin(), numbers.size() / 2); numbers.insert(it, 6); for(const auto& i: numbers) std::cout << i << ' '; std::cout << '\n'; }
Can you help me rewrite this code in C++ instead of Go, keeping it the same logically?
package main import ( "fmt" "io/ioutil" "sort" "unicode" ) const file = "unixdict.txt" func main() { bs, err := ioutil.ReadFile(file) if err != nil { fmt.Println(err) return } m := make(map[rune]int) for _, r := range string(bs) { m[r]++ } lfs := make(lfList, 0, len(m)) for l, f := range m { lfs = append(lfs, &letterFreq{l, f}) } sort.Sort(lfs) fmt.Println("file:", file) fmt.Println("letter frequency") for _, lf := range lfs { if unicode.IsGraphic(lf.rune) { fmt.Printf(" %c %7d\n", lf.rune, lf.freq) } else { fmt.Printf("%U %7d\n", lf.rune, lf.freq) } } } type letterFreq struct { rune freq int } type lfList []*letterFreq func (lfs lfList) Len() int { return len(lfs) } func (lfs lfList) Less(i, j int) bool { switch fd := lfs[i].freq - lfs[j].freq; { case fd < 0: return false case fd > 0: return true } return lfs[i].rune < lfs[j].rune } func (lfs lfList) Swap(i, j int) { lfs[i], lfs[j] = lfs[j], lfs[i] }
#include <fstream> #include <iostream> int main() { std::ifstream input("filename.txt", std::ios_base::binary); if (!input) { std::cerr << "error: can't open file\n"; return -1; } size_t count[256]; std::fill_n(count, 256, 0); for (char c; input.get(c); ++count[uint8_t(c)]) ; for (size_t i = 0; i < 256; ++i) { if (count[i] && isgraph(i)) { std::cout << char(i) << " = " << count[i] << '\n'; } } }
Translate the given Go code snippet into C++ without altering its behavior.
package main import "fmt" var tr = []int{85, 88, 75, 66, 25, 29, 83, 39, 97} var ct = []int{68, 41, 10, 49, 16, 65, 32, 92, 28, 98} func main() { all := make([]int, len(tr)+len(ct)) copy(all, tr) copy(all[len(tr):], ct) var sumAll int for _, r := range all { sumAll += r } sd := func(trc []int) int { var sumTr int for _, x := range trc { sumTr += all[x] } return sumTr*len(ct) - (sumAll-sumTr)*len(tr) } a := make([]int, len(tr)) for i, _ := range a { a[i] = i } sdObs := sd(a) var nLe, nGt int comb(len(all), len(tr), func(c []int) { if sd(c) > sdObs { nGt++ } else { nLe++ } }) pc := 100 / float64(nLe+nGt) fmt.Printf("differences <= observed: %f%%\n", float64(nLe)*pc) fmt.Printf("differences > observed: %f%%\n", float64(nGt)*pc) } func comb(n, m int, emit func([]int)) { s := make([]int, m) last := m - 1 var rc func(int, int) rc = func(i, next int) { for j := next; j < n; j++ { s[i] = j if i == last { emit(s) } else { rc(i+1, j+1) } } return } rc(0, 0) }
#include<iostream> #include<vector> #include<numeric> #include<functional> class { public: int64_t operator()(int n, int k){ return partial_factorial(n, k) / factorial(n - k);} private: int64_t partial_factorial(int from, int to) { return from == to ? 1 : from * partial_factorial(from - 1, to); } int64_t factorial(int n) { return n == 0 ? 1 : n * factorial(n - 1);} }combinations; int main() { static constexpr int treatment = 9; const std::vector<int> data{ 85, 88, 75, 66, 25, 29, 83, 39, 97, 68, 41, 10, 49, 16, 65, 32, 92, 28, 98 }; int treated = std::accumulate(data.begin(), data.begin() + treatment, 0); std::function<int (int, int, int)> pick; pick = [&](int n, int from, int accumulated) { if(n == 0) return accumulated > treated ? 1 : 0; else return pick(n - 1, from - 1, accumulated + data[from - 1]) + (from > n ? pick(n, from - 1, accumulated) : 0); }; int total = combinations(data.size(), treatment); int greater = pick(treatment, data.size(), 0); int lesser = total - greater; std::cout << "<= : " << 100.0 * lesser / total << "% " << lesser << std::endl << " > : " << 100.0 * greater / total << "% " << greater << std::endl; }
Maintain the same structure and functionality when rewriting this code in C++.
package main import "fmt" func möbius(to int) []int { if to < 1 { to = 1 } mobs := make([]int, to+1) primes := []int{2} for i := 1; i <= to; i++ { j := i cp := 0 spf := false for _, p := range primes { if p > j { break } if j%p == 0 { j /= p cp++ } if j%p == 0 { spf = true break } } if cp == 0 && i > 2 { cp = 1 primes = append(primes, i) } if !spf { if cp%2 == 0 { mobs[i] = 1 } else { mobs[i] = -1 } } } return mobs } func main() { mobs := möbius(199) fmt.Println("Möbius sequence - First 199 terms:") for i := 0; i < 200; i++ { if i == 0 { fmt.Print(" ") continue } if i%20 == 0 { fmt.Println() } fmt.Printf("  % d", mobs[i]) } }
#include <iomanip> #include <iostream> #include <vector> constexpr int MU_MAX = 1'000'000; std::vector<int> MU; int mobiusFunction(int n) { if (!MU.empty()) { return MU[n]; } MU.resize(MU_MAX + 1, 1); int root = sqrt(MU_MAX); for (int i = 2; i <= root; i++) { if (MU[i] == 1) { for (int j = i; j <= MU_MAX; j += i) { MU[j] *= -i; } for (int j = i * i; j <= MU_MAX; j += i * i) { MU[j] = 0; } } } for (int i = 2; i <= MU_MAX; i++) { if (MU[i] == i) { MU[i] = 1; } else if (MU[i] == -i) { MU[i] = -1; } else if (MU[i] < 0) { MU[i] = 1; } else if (MU[i] > 0) { MU[i] = -1; } } return MU[n]; } int main() { std::cout << "First 199 terms of the möbius function are as follows:\n "; for (int n = 1; n < 200; n++) { std::cout << std::setw(2) << mobiusFunction(n) << " "; if ((n + 1) % 20 == 0) { std::cout << '\n'; } } return 0; }
Transform the following Go implementation into C++, maintaining the same output and logic.
package main import "fmt" import "strconv" func main() { i, _ := strconv.Atoi("1234") fmt.Println(strconv.Itoa(i + 1)) }
#include <cstdlib> #include <string> #include <sstream> std::string s = "12345"; int i; std::istringstream(s) >> i; i++; std::ostringstream oss; if (oss << i) s = oss.str();
Preserve the algorithm and functionality while converting the code from Go to C++.
package main import ( "fmt" "strings" ) func stripchars(str, chr string) string { return strings.Map(func(r rune) rune { if strings.IndexRune(chr, r) < 0 { return r } return -1 }, str) } func main() { fmt.Println(stripchars("She was a soul stripper. She took my heart!", "aei")) }
#include <algorithm> #include <iostream> #include <string> std::string stripchars(std::string str, const std::string &chars) { str.erase( std::remove_if(str.begin(), str.end(), [&](char c){ return chars.find(c) != std::string::npos; }), str.end() ); return str; } int main() { std::cout << stripchars("She was a soul stripper. She took my heart!", "aei") << '\n'; return 0; }
Keep all operations the same but rewrite the snippet in C++.
package main import "fmt" var a = []int{170, 45, 75, -90, -802, 24, 2, 66} func main() { fmt.Println("before:", a) if len(a) > 1 && !recurse(len(a) - 1) { panic("sorted permutation not found!") } fmt.Println("after: ", a) } func recurse(last int) bool { if last <= 0 { for i := len(a) - 1; a[i] >= a[i-1]; i-- { if i == 1 { return true } } return false } for i := 0; i <= last; i++ { a[i], a[last] = a[last], a[i] if recurse(last - 1) { return true } a[i], a[last] = a[last], a[i] } return false }
#include <algorithm> template<typename ForwardIterator> void permutation_sort(ForwardIterator begin, ForwardIterator end) { while (std::next_permutation(begin, end)) { } }
Please provide an equivalent version of this Go code in C++.
package main import ( "fmt" "math" ) func mean(v []float64) (m float64, ok bool) { if len(v) == 0 { return } var parts []float64 for _, x := range v { var i int for _, p := range parts { sum := p + x var err float64 switch ax, ap := math.Abs(x), math.Abs(p); { case ax < ap: err = x - (sum - p) case ap < ax: err = p - (sum - x) } if err != 0 { parts[i] = err i++ } x = sum } parts = append(parts[:i], x) } var sum float64 for _, x := range parts { sum += x } return sum / float64(len(v)), true } func main() { for _, v := range [][]float64{ []float64{}, []float64{math.Inf(1), math.Inf(1)}, []float64{math.Inf(1), math.Inf(-1)}, []float64{3, 1, 4, 1, 5, 9}, []float64{1e20, 3, 1, 4, 1, 5, 9, -1e20}, []float64{10, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 0, 0, 0, .11}, []float64{10, 20, 30, 40, 50, -100, 4.7, -11e2}, } { fmt.Println("Vector:", v) if m, ok := mean(v); ok { fmt.Printf("Mean of %d numbers is %g\n\n", len(v), m) } else { fmt.Println("Mean undefined\n") } } }
#include <vector> double mean(const std::vector<double>& numbers) { if (numbers.size() == 0) return 0; double sum = 0; for (std::vector<double>::iterator i = numbers.begin(); i != numbers.end(); i++) sum += *i; return sum / numbers.size(); }
Convert the following code from Go to C++, ensuring the logic remains intact.
package main import ( "io" "os" "strconv" "strings" "text/tabwriter" ) func readTable(table string) ([]string, []int) { fields := strings.Fields(table) var commands []string var minLens []int for i, max := 0, len(fields); i < max; { cmd := fields[i] cmdLen := len(cmd) i++ if i < max { num, err := strconv.Atoi(fields[i]) if err == nil && 1 <= num && num < cmdLen { cmdLen = num i++ } } commands = append(commands, cmd) minLens = append(minLens, cmdLen) } return commands, minLens } func validateCommands(commands []string, minLens []int, words []string) []string { var results []string for _, word := range words { matchFound := false wlen := len(word) for i, command := range commands { if minLens[i] == 0 || wlen < minLens[i] || wlen > len(command) { continue } c := strings.ToUpper(command) w := strings.ToUpper(word) if strings.HasPrefix(c, w) { results = append(results, c) matchFound = true break } } if !matchFound { results = append(results, "*error*") } } return results } func printResults(words []string, results []string) { wr := tabwriter.NewWriter(os.Stdout, 0, 1, 1, ' ', 0) io.WriteString(wr, "user words:") for _, word := range words { io.WriteString(wr, "\t"+word) } io.WriteString(wr, "\n") io.WriteString(wr, "full words:\t"+strings.Join(results, "\t")+"\n") wr.Flush() } func main() { const table = "" + "add 1 alter 3 backup 2 bottom 1 Cappend 2 change 1 Schange Cinsert 2 Clast 3 " + "compress 4 copy 2 count 3 Coverlay 3 cursor 3 delete 3 Cdelete 2 down 1 duplicate " + "3 xEdit 1 expand 3 extract 3 find 1 Nfind 2 Nfindup 6 NfUP 3 Cfind 2 findUP 3 fUP 2 " + "forward 2 get help 1 hexType 4 input 1 powerInput 3 join 1 split 2 spltJOIN load " + "locate 1 Clocate 2 lowerCase 3 upperCase 3 Lprefix 2 macro merge 2 modify 3 move 2 " + "msg next 1 overlay 1 parse preserve 4 purge 3 put putD query 1 quit read recover 3 " + "refresh renum 3 repeat 3 replace 1 Creplace 2 reset 3 restore 4 rgtLEFT right 2 left " + "2 save set shift 2 si sort sos stack 3 status 4 top transfer 3 type 1 up 1 " const sentence = "riG rePEAT copies put mo rest types fup. 6 poweRin" commands, minLens := readTable(table) words := strings.Fields(sentence) results := validateCommands(commands, minLens, words) printResults(words, results) }
#include <algorithm> #include <cctype> #include <iostream> #include <sstream> #include <string> #include <vector> const char* command_table = "add 1 alter 3 backup 2 bottom 1 Cappend 2 change 1 Schange Cinsert 2 Clast 3 " "compress 4 copy 2 count 3 Coverlay 3 cursor 3 delete 3 Cdelete 2 down 1 duplicate " "3 xEdit 1 expand 3 extract 3 find 1 Nfind 2 Nfindup 6 NfUP 3 Cfind 2 findUP 3 fUP 2 " "forward 2 get help 1 hexType 4 input 1 powerInput 3 join 1 split 2 spltJOIN load " "locate 1 Clocate 2 lowerCase 3 upperCase 3 Lprefix 2 macro merge 2 modify 3 move 2 " "msg next 1 overlay 1 parse preserve 4 purge 3 put putD query 1 quit read recover 3 " "refresh renum 3 repeat 3 replace 1 Creplace 2 reset 3 restore 4 rgtLEFT right 2 left " "2 save set shift 2 si sort sos stack 3 status 4 top transfer 3 type 1 up 1"; class command { public: command(const std::string&, size_t); const std::string& cmd() const { return cmd_; } size_t min_length() const { return min_len_; } bool match(const std::string&) const; private: std::string cmd_; size_t min_len_; }; command::command(const std::string& cmd, size_t min_len) : cmd_(cmd), min_len_(min_len) {} bool command::match(const std::string& str) const { size_t olen = str.length(); return olen >= min_len_ && olen <= cmd_.length() && cmd_.compare(0, olen, str) == 0; } bool parse_integer(const std::string& word, int& value) { try { size_t pos; int i = std::stoi(word, &pos, 10); if (pos < word.length()) return false; value = i; return true; } catch (const std::exception& ex) { return false; } } void uppercase(std::string& str) { std::transform(str.begin(), str.end(), str.begin(), [](unsigned char c) -> unsigned char { return std::toupper(c); }); } class command_list { public: explicit command_list(const char*); const command* find_command(const std::string&) const; private: std::vector<command> commands_; }; command_list::command_list(const char* table) { std::istringstream is(table); std::string word; std::vector<std::string> words; while (is >> word) { uppercase(word); words.push_back(word); } for (size_t i = 0, n = words.size(); i < n; ++i) { word = words[i]; int len = word.length(); if (i + 1 < n && parse_integer(words[i + 1], len)) ++i; commands_.push_back(command(word, len)); } } const command* command_list::find_command(const std::string& word) const { auto iter = std::find_if(commands_.begin(), commands_.end(), [&word](const command& cmd) { return cmd.match(word); }); return (iter != commands_.end()) ? &*iter : nullptr; } std::string test(const command_list& commands, const std::string& input) { std::string output; std::istringstream is(input); std::string word; while (is >> word) { if (!output.empty()) output += ' '; uppercase(word); const command* cmd_ptr = commands.find_command(word); if (cmd_ptr) output += cmd_ptr->cmd(); else output += "*error*"; } return output; } int main() { command_list commands(command_table); std::string input("riG rePEAT copies put mo rest types fup. 6 poweRin"); std::string output(test(commands, input)); std::cout << " input: " << input << '\n'; std::cout << "output: " << output << '\n'; return 0; }
Please provide an equivalent version of this Go code in C++.
package main import ( "io" "os" "strconv" "strings" "text/tabwriter" ) func readTable(table string) ([]string, []int) { fields := strings.Fields(table) var commands []string var minLens []int for i, max := 0, len(fields); i < max; { cmd := fields[i] cmdLen := len(cmd) i++ if i < max { num, err := strconv.Atoi(fields[i]) if err == nil && 1 <= num && num < cmdLen { cmdLen = num i++ } } commands = append(commands, cmd) minLens = append(minLens, cmdLen) } return commands, minLens } func validateCommands(commands []string, minLens []int, words []string) []string { var results []string for _, word := range words { matchFound := false wlen := len(word) for i, command := range commands { if minLens[i] == 0 || wlen < minLens[i] || wlen > len(command) { continue } c := strings.ToUpper(command) w := strings.ToUpper(word) if strings.HasPrefix(c, w) { results = append(results, c) matchFound = true break } } if !matchFound { results = append(results, "*error*") } } return results } func printResults(words []string, results []string) { wr := tabwriter.NewWriter(os.Stdout, 0, 1, 1, ' ', 0) io.WriteString(wr, "user words:") for _, word := range words { io.WriteString(wr, "\t"+word) } io.WriteString(wr, "\n") io.WriteString(wr, "full words:\t"+strings.Join(results, "\t")+"\n") wr.Flush() } func main() { const table = "" + "add 1 alter 3 backup 2 bottom 1 Cappend 2 change 1 Schange Cinsert 2 Clast 3 " + "compress 4 copy 2 count 3 Coverlay 3 cursor 3 delete 3 Cdelete 2 down 1 duplicate " + "3 xEdit 1 expand 3 extract 3 find 1 Nfind 2 Nfindup 6 NfUP 3 Cfind 2 findUP 3 fUP 2 " + "forward 2 get help 1 hexType 4 input 1 powerInput 3 join 1 split 2 spltJOIN load " + "locate 1 Clocate 2 lowerCase 3 upperCase 3 Lprefix 2 macro merge 2 modify 3 move 2 " + "msg next 1 overlay 1 parse preserve 4 purge 3 put putD query 1 quit read recover 3 " + "refresh renum 3 repeat 3 replace 1 Creplace 2 reset 3 restore 4 rgtLEFT right 2 left " + "2 save set shift 2 si sort sos stack 3 status 4 top transfer 3 type 1 up 1 " const sentence = "riG rePEAT copies put mo rest types fup. 6 poweRin" commands, minLens := readTable(table) words := strings.Fields(sentence) results := validateCommands(commands, minLens, words) printResults(words, results) }
#include <algorithm> #include <cctype> #include <iostream> #include <sstream> #include <string> #include <vector> const char* command_table = "add 1 alter 3 backup 2 bottom 1 Cappend 2 change 1 Schange Cinsert 2 Clast 3 " "compress 4 copy 2 count 3 Coverlay 3 cursor 3 delete 3 Cdelete 2 down 1 duplicate " "3 xEdit 1 expand 3 extract 3 find 1 Nfind 2 Nfindup 6 NfUP 3 Cfind 2 findUP 3 fUP 2 " "forward 2 get help 1 hexType 4 input 1 powerInput 3 join 1 split 2 spltJOIN load " "locate 1 Clocate 2 lowerCase 3 upperCase 3 Lprefix 2 macro merge 2 modify 3 move 2 " "msg next 1 overlay 1 parse preserve 4 purge 3 put putD query 1 quit read recover 3 " "refresh renum 3 repeat 3 replace 1 Creplace 2 reset 3 restore 4 rgtLEFT right 2 left " "2 save set shift 2 si sort sos stack 3 status 4 top transfer 3 type 1 up 1"; class command { public: command(const std::string&, size_t); const std::string& cmd() const { return cmd_; } size_t min_length() const { return min_len_; } bool match(const std::string&) const; private: std::string cmd_; size_t min_len_; }; command::command(const std::string& cmd, size_t min_len) : cmd_(cmd), min_len_(min_len) {} bool command::match(const std::string& str) const { size_t olen = str.length(); return olen >= min_len_ && olen <= cmd_.length() && cmd_.compare(0, olen, str) == 0; } bool parse_integer(const std::string& word, int& value) { try { size_t pos; int i = std::stoi(word, &pos, 10); if (pos < word.length()) return false; value = i; return true; } catch (const std::exception& ex) { return false; } } void uppercase(std::string& str) { std::transform(str.begin(), str.end(), str.begin(), [](unsigned char c) -> unsigned char { return std::toupper(c); }); } class command_list { public: explicit command_list(const char*); const command* find_command(const std::string&) const; private: std::vector<command> commands_; }; command_list::command_list(const char* table) { std::istringstream is(table); std::string word; std::vector<std::string> words; while (is >> word) { uppercase(word); words.push_back(word); } for (size_t i = 0, n = words.size(); i < n; ++i) { word = words[i]; int len = word.length(); if (i + 1 < n && parse_integer(words[i + 1], len)) ++i; commands_.push_back(command(word, len)); } } const command* command_list::find_command(const std::string& word) const { auto iter = std::find_if(commands_.begin(), commands_.end(), [&word](const command& cmd) { return cmd.match(word); }); return (iter != commands_.end()) ? &*iter : nullptr; } std::string test(const command_list& commands, const std::string& input) { std::string output; std::istringstream is(input); std::string word; while (is >> word) { if (!output.empty()) output += ' '; uppercase(word); const command* cmd_ptr = commands.find_command(word); if (cmd_ptr) output += cmd_ptr->cmd(); else output += "*error*"; } return output; } int main() { command_list commands(command_table); std::string input("riG rePEAT copies put mo rest types fup. 6 poweRin"); std::string output(test(commands, input)); std::cout << " input: " << input << '\n'; std::cout << "output: " << output << '\n'; return 0; }
Generate a C++ translation of this Go snippet without changing its computational steps.
package main import ( "io" "os" "strconv" "strings" "text/tabwriter" ) func readTable(table string) ([]string, []int) { fields := strings.Fields(table) var commands []string var minLens []int for i, max := 0, len(fields); i < max; { cmd := fields[i] cmdLen := len(cmd) i++ if i < max { num, err := strconv.Atoi(fields[i]) if err == nil && 1 <= num && num < cmdLen { cmdLen = num i++ } } commands = append(commands, cmd) minLens = append(minLens, cmdLen) } return commands, minLens } func validateCommands(commands []string, minLens []int, words []string) []string { var results []string for _, word := range words { matchFound := false wlen := len(word) for i, command := range commands { if minLens[i] == 0 || wlen < minLens[i] || wlen > len(command) { continue } c := strings.ToUpper(command) w := strings.ToUpper(word) if strings.HasPrefix(c, w) { results = append(results, c) matchFound = true break } } if !matchFound { results = append(results, "*error*") } } return results } func printResults(words []string, results []string) { wr := tabwriter.NewWriter(os.Stdout, 0, 1, 1, ' ', 0) io.WriteString(wr, "user words:") for _, word := range words { io.WriteString(wr, "\t"+word) } io.WriteString(wr, "\n") io.WriteString(wr, "full words:\t"+strings.Join(results, "\t")+"\n") wr.Flush() } func main() { const table = "" + "add 1 alter 3 backup 2 bottom 1 Cappend 2 change 1 Schange Cinsert 2 Clast 3 " + "compress 4 copy 2 count 3 Coverlay 3 cursor 3 delete 3 Cdelete 2 down 1 duplicate " + "3 xEdit 1 expand 3 extract 3 find 1 Nfind 2 Nfindup 6 NfUP 3 Cfind 2 findUP 3 fUP 2 " + "forward 2 get help 1 hexType 4 input 1 powerInput 3 join 1 split 2 spltJOIN load " + "locate 1 Clocate 2 lowerCase 3 upperCase 3 Lprefix 2 macro merge 2 modify 3 move 2 " + "msg next 1 overlay 1 parse preserve 4 purge 3 put putD query 1 quit read recover 3 " + "refresh renum 3 repeat 3 replace 1 Creplace 2 reset 3 restore 4 rgtLEFT right 2 left " + "2 save set shift 2 si sort sos stack 3 status 4 top transfer 3 type 1 up 1 " const sentence = "riG rePEAT copies put mo rest types fup. 6 poweRin" commands, minLens := readTable(table) words := strings.Fields(sentence) results := validateCommands(commands, minLens, words) printResults(words, results) }
#include <algorithm> #include <cctype> #include <iostream> #include <sstream> #include <string> #include <vector> const char* command_table = "add 1 alter 3 backup 2 bottom 1 Cappend 2 change 1 Schange Cinsert 2 Clast 3 " "compress 4 copy 2 count 3 Coverlay 3 cursor 3 delete 3 Cdelete 2 down 1 duplicate " "3 xEdit 1 expand 3 extract 3 find 1 Nfind 2 Nfindup 6 NfUP 3 Cfind 2 findUP 3 fUP 2 " "forward 2 get help 1 hexType 4 input 1 powerInput 3 join 1 split 2 spltJOIN load " "locate 1 Clocate 2 lowerCase 3 upperCase 3 Lprefix 2 macro merge 2 modify 3 move 2 " "msg next 1 overlay 1 parse preserve 4 purge 3 put putD query 1 quit read recover 3 " "refresh renum 3 repeat 3 replace 1 Creplace 2 reset 3 restore 4 rgtLEFT right 2 left " "2 save set shift 2 si sort sos stack 3 status 4 top transfer 3 type 1 up 1"; class command { public: command(const std::string&, size_t); const std::string& cmd() const { return cmd_; } size_t min_length() const { return min_len_; } bool match(const std::string&) const; private: std::string cmd_; size_t min_len_; }; command::command(const std::string& cmd, size_t min_len) : cmd_(cmd), min_len_(min_len) {} bool command::match(const std::string& str) const { size_t olen = str.length(); return olen >= min_len_ && olen <= cmd_.length() && cmd_.compare(0, olen, str) == 0; } bool parse_integer(const std::string& word, int& value) { try { size_t pos; int i = std::stoi(word, &pos, 10); if (pos < word.length()) return false; value = i; return true; } catch (const std::exception& ex) { return false; } } void uppercase(std::string& str) { std::transform(str.begin(), str.end(), str.begin(), [](unsigned char c) -> unsigned char { return std::toupper(c); }); } class command_list { public: explicit command_list(const char*); const command* find_command(const std::string&) const; private: std::vector<command> commands_; }; command_list::command_list(const char* table) { std::istringstream is(table); std::string word; std::vector<std::string> words; while (is >> word) { uppercase(word); words.push_back(word); } for (size_t i = 0, n = words.size(); i < n; ++i) { word = words[i]; int len = word.length(); if (i + 1 < n && parse_integer(words[i + 1], len)) ++i; commands_.push_back(command(word, len)); } } const command* command_list::find_command(const std::string& word) const { auto iter = std::find_if(commands_.begin(), commands_.end(), [&word](const command& cmd) { return cmd.match(word); }); return (iter != commands_.end()) ? &*iter : nullptr; } std::string test(const command_list& commands, const std::string& input) { std::string output; std::istringstream is(input); std::string word; while (is >> word) { if (!output.empty()) output += ' '; uppercase(word); const command* cmd_ptr = commands.find_command(word); if (cmd_ptr) output += cmd_ptr->cmd(); else output += "*error*"; } return output; } int main() { command_list commands(command_table); std::string input("riG rePEAT copies put mo rest types fup. 6 poweRin"); std::string output(test(commands, input)); std::cout << " input: " << input << '\n'; std::cout << "output: " << output << '\n'; return 0; }
Can you help me rewrite this code in C++ instead of Go, keeping it the same logically?
package main import ( "fmt" "math" "strings" ) func main(){ fmt.Println(H("1223334444")) } func H(data string) (entropy float64) { if data == "" { return 0 } for i := 0; i < 256; i++ { px := float64(strings.Count(data, string(byte(i)))) / float64(len(data)) if px > 0 { entropy += -px * math.Log2(px) } } return entropy }
#include <string> #include <map> #include <iostream> #include <algorithm> #include <cmath> double log2( double number ) { return log( number ) / log( 2 ) ; } int main( int argc , char *argv[ ] ) { std::string teststring( argv[ 1 ] ) ; std::map<char , int> frequencies ; for ( char c : teststring ) frequencies[ c ] ++ ; int numlen = teststring.length( ) ; double infocontent = 0 ; for ( std::pair<char , int> p : frequencies ) { double freq = static_cast<double>( p.second ) / numlen ; infocontent -= freq * log2( freq ) ; } std::cout << "The information content of " << teststring << " is " << infocontent << std::endl ; return 0 ; }
Convert the following code from Go to C++, ensuring the logic remains intact.
package main import ( "errors" "fmt" ) func TokenizeString(s string, sep, escape rune) (tokens []string, err error) { var runes []rune inEscape := false for _, r := range s { switch { case inEscape: inEscape = false fallthrough default: runes = append(runes, r) case r == escape: inEscape = true case r == sep: tokens = append(tokens, string(runes)) runes = runes[:0] } } tokens = append(tokens, string(runes)) if inEscape { err = errors.New("invalid terminal escape") } return tokens, err } func main() { const sample = "one^|uno||three^^^^|four^^^|^cuatro|" const separator = '|' const escape = '^' fmt.Printf("Input: %q\n", sample) tokens, err := TokenizeString(sample, separator, escape) if err != nil { fmt.Println("error:", err) } else { fmt.Printf("Tokens: %q\n", tokens) } }
#include <iostream> #include <stdexcept> #include <string> #include <vector> using namespace std; vector<string> tokenize(const string& input, char seperator, char escape) { vector<string> output; string token; bool inEsc = false; for (char ch : input) { if (inEsc) { inEsc = false; } else if (ch == escape) { inEsc = true; continue; } else if (ch == seperator) { output.push_back(token); token = ""; continue; } token += ch; } if (inEsc) throw new invalid_argument("Invalid terminal escape"); output.push_back(token); return output; } int main() { string sample = "one^|uno||three^^^^|four^^^|^cuatro|"; cout << sample << endl; cout << '['; for (auto t : tokenize(sample, '|', '^')) { cout << '"' << t << "\", "; } cout << ']' << endl; return 0; }