Instruction stringlengths 45 106 | input_code stringlengths 1 13.7k | output_code stringlengths 1 13.7k |
|---|---|---|
Translate the given VB code snippet into Python without altering its behavior. | Option Explicit
Const numchars=127
Function LZWCompress(si)
Dim oDict, intMaxCode, i,z,ii,ss,strCurrent,strNext,j
Set oDict = CreateObject("Scripting.Dictionary")
ReDim a(Len(si))
intMaxCode = numchars
For i = 0 To numchars
oDict.Add Chr(i), i
Next
strCurrent = Left(si,1)
j=0
For ii=2 To Len(si)
strNext = Mid(si,ii,1)
ss=strCurrent & strNext
If oDict.Exists(ss) Then
strCurrent = ss
Else
a(j)=oDict.Item(strCurrent) :j=j+1
intMaxCode = intMaxCode + 1
oDict.Add ss, intMaxCode
strCurrent = strNext
End If
Next
a(j)=oDict.Item(strCurrent)
ReDim preserve a(j)
LZWCompress=a
Set oDict = Nothing
End Function
Function lzwUncompress(sc)
Dim intNext, intCurrent, intMaxCode, i,ss,istr,s,j
s=""
reDim dict(1000)
intMaxCode = numchars
For i = 0 To numchars : dict(i)= Chr(i) : Next
intCurrent=sc(0)
For j=1 To UBound(sc)
ss=dict(intCurrent)
s= s & ss
intMaxCode = intMaxCode + 1
intnext=sc(j)
If intNext<intMaxCode Then
dict(intMaxCode)=ss & Left(dict(intNext), 1)
Else
dict(intMaxCode)=ss & Left(ss, 1)
End If
intCurrent = intNext
Next
s= s & dict(intCurrent)
lzwUncompress=s
End function
Sub printvec(a)
Dim s,i,x
s="("
For i=0 To UBound (a)
s=s & x & a(i)
x=", "
Next
WScript.echo s &")"
End sub
Dim a,b
b="TOBEORNOTTOBEORTOBEORNOT"
WScript.Echo b
a=LZWCompress (b)
printvec(a)
WScript.echo lzwUncompress (a )
wscript.quit 1
| def compress(uncompressed):
dict_size = 256
dictionary = dict((chr(i), i) for i in range(dict_size))
w = ""
result = []
for c in uncompressed:
wc = w + c
if wc in dictionary:
w = wc
else:
result.append(dictionary[w])
dictionary[wc] = dict_size
dict_size += 1
w = c
if w:
result.append(dictionary[w])
return result
def decompress(compressed):
from io import StringIO
dict_size = 256
dictionary = dict((i, chr(i)) for i in range(dict_size))
result = StringIO()
w = chr(compressed.pop(0))
result.write(w)
for k in compressed:
if k in dictionary:
entry = dictionary[k]
elif k == dict_size:
entry = w + w[0]
else:
raise ValueError('Bad compressed k: %s' % k)
result.write(entry)
dictionary[dict_size] = w + entry[0]
dict_size += 1
w = entry
return result.getvalue()
compressed = compress('TOBEORNOTTOBEORTOBEORNOT')
print (compressed)
decompressed = decompress(compressed)
print (decompressed)
|
Maintain the same structure and functionality when rewriting this code in Python. | Private Function ffr(n As Long) As Long
Dim R As New Collection
Dim S As New Collection
R.Add 1
S.Add 2
For i = 2 To n
R.Add R(i - 1) + S(i - 1)
For j = S(S.Count) + 1 To R(i) - 1
S.Add j
Next j
For j = R(i) + 1 To R(i) + S(i - 1)
S.Add j
Next j
Next i
ffr = R(n)
Set R = Nothing
Set S = Nothing
End Function
Private Function ffs(n As Long) As Long
Dim R As New Collection
Dim S As New Collection
R.Add 1
S.Add 2
For i = 2 To n
R.Add R(i - 1) + S(i - 1)
For j = S(S.Count) + 1 To R(i) - 1
S.Add j
Next j
For j = R(i) + 1 To R(i) + S(i - 1)
S.Add j
Next j
If S.Count >= n Then Exit For
Next i
ffs = S(n)
Set R = Nothing
Set S = Nothing
End Function
Public Sub main()
Dim i As Long
Debug.Print "The first ten values of R are:"
For i = 1 To 10
Debug.Print ffr(i);
Next i
Debug.Print
Dim x As New Collection
For i = 1 To 1000
x.Add i, CStr(i)
Next i
For i = 1 To 40
x.Remove CStr(ffr(i))
Next i
For i = 1 To 960
x.Remove CStr(ffs(i))
Next i
Debug.Print "The first 40 values of ffr plus the first 960 values of ffs "
Debug.Print "include all the integers from 1 to 1000 exactly once is "; Format(x.Count = 0)
End Sub
| def ffr(n):
if n < 1 or type(n) != int: raise ValueError("n must be an int >= 1")
try:
return ffr.r[n]
except IndexError:
r, s = ffr.r, ffs.s
ffr_n_1 = ffr(n-1)
lastr = r[-1]
s += list(range(s[-1] + 1, lastr))
if s[-1] < lastr: s += [lastr + 1]
len_s = len(s)
ffs_n_1 = s[n-1] if len_s > n else (n - len_s) + s[-1]
ans = ffr_n_1 + ffs_n_1
r.append(ans)
return ans
ffr.r = [None, 1]
def ffs(n):
if n < 1 or type(n) != int: raise ValueError("n must be an int >= 1")
try:
return ffs.s[n]
except IndexError:
r, s = ffr.r, ffs.s
for i in range(len(r), n+2):
ffr(i)
if len(s) > n:
return s[n]
raise Exception("Whoops!")
ffs.s = [None, 2]
if __name__ == '__main__':
first10 = [ffr(i) for i in range(1,11)]
assert first10 == [1, 3, 7, 12, 18, 26, 35, 45, 56, 69], "ffr() value error(s)"
print("ffr(n) for n = [1..10] is", first10)
bin = [None] + [0]*1000
for i in range(40, 0, -1):
bin[ffr(i)] += 1
for i in range(960, 0, -1):
bin[ffs(i)] += 1
if all(b == 1 for b in bin[1:1000]):
print("All Integers 1..1000 found OK")
else:
print("All Integers 1..1000 NOT found only once: ERROR")
|
Can you help me rewrite this code in Python instead of VB, keeping it the same logically? | Private Function ffr(n As Long) As Long
Dim R As New Collection
Dim S As New Collection
R.Add 1
S.Add 2
For i = 2 To n
R.Add R(i - 1) + S(i - 1)
For j = S(S.Count) + 1 To R(i) - 1
S.Add j
Next j
For j = R(i) + 1 To R(i) + S(i - 1)
S.Add j
Next j
Next i
ffr = R(n)
Set R = Nothing
Set S = Nothing
End Function
Private Function ffs(n As Long) As Long
Dim R As New Collection
Dim S As New Collection
R.Add 1
S.Add 2
For i = 2 To n
R.Add R(i - 1) + S(i - 1)
For j = S(S.Count) + 1 To R(i) - 1
S.Add j
Next j
For j = R(i) + 1 To R(i) + S(i - 1)
S.Add j
Next j
If S.Count >= n Then Exit For
Next i
ffs = S(n)
Set R = Nothing
Set S = Nothing
End Function
Public Sub main()
Dim i As Long
Debug.Print "The first ten values of R are:"
For i = 1 To 10
Debug.Print ffr(i);
Next i
Debug.Print
Dim x As New Collection
For i = 1 To 1000
x.Add i, CStr(i)
Next i
For i = 1 To 40
x.Remove CStr(ffr(i))
Next i
For i = 1 To 960
x.Remove CStr(ffs(i))
Next i
Debug.Print "The first 40 values of ffr plus the first 960 values of ffs "
Debug.Print "include all the integers from 1 to 1000 exactly once is "; Format(x.Count = 0)
End Sub
| def ffr(n):
if n < 1 or type(n) != int: raise ValueError("n must be an int >= 1")
try:
return ffr.r[n]
except IndexError:
r, s = ffr.r, ffs.s
ffr_n_1 = ffr(n-1)
lastr = r[-1]
s += list(range(s[-1] + 1, lastr))
if s[-1] < lastr: s += [lastr + 1]
len_s = len(s)
ffs_n_1 = s[n-1] if len_s > n else (n - len_s) + s[-1]
ans = ffr_n_1 + ffs_n_1
r.append(ans)
return ans
ffr.r = [None, 1]
def ffs(n):
if n < 1 or type(n) != int: raise ValueError("n must be an int >= 1")
try:
return ffs.s[n]
except IndexError:
r, s = ffr.r, ffs.s
for i in range(len(r), n+2):
ffr(i)
if len(s) > n:
return s[n]
raise Exception("Whoops!")
ffs.s = [None, 2]
if __name__ == '__main__':
first10 = [ffr(i) for i in range(1,11)]
assert first10 == [1, 3, 7, 12, 18, 26, 35, 45, 56, 69], "ffr() value error(s)"
print("ffr(n) for n = [1..10] is", first10)
bin = [None] + [0]*1000
for i in range(40, 0, -1):
bin[ffr(i)] += 1
for i in range(960, 0, -1):
bin[ffs(i)] += 1
if all(b == 1 for b in bin[1:1000]):
print("All Integers 1..1000 found OK")
else:
print("All Integers 1..1000 NOT found only once: ERROR")
|
Rewrite the snippet below in Python so it works the same as the original VB code. | Sub magicsquare()
Const n = 9
Dim i As Integer, j As Integer, v As Integer
Debug.Print "The square order is: " & n
For i = 1 To n
For j = 1 To n
Cells(i, j) = ((i * 2 - j + n - 1) Mod n) * n + ((i * 2 + j - 2) Mod n) + 1
Next j
Next i
Debug.Print "The magic number of"; n; "x"; n; "square is:"; n * (n * n + 1) \ 2
End Sub
| >>> def magic(n):
for row in range(1, n + 1):
print(' '.join('%*i' % (len(str(n**2)), cell) for cell in
(n * ((row + col - 1 + n // 2) % n) +
((row + 2 * col - 2) % n) + 1
for col in range(1, n + 1))))
print('\nAll sum to magic number %i' % ((n * n + 1) * n // 2))
>>> for n in (5, 3, 7):
print('\nOrder %i\n=======' % n)
magic(n)
Order 5
=======
17 24 1 8 15
23 5 7 14 16
4 6 13 20 22
10 12 19 21 3
11 18 25 2 9
All sum to magic number 65
Order 3
=======
8 1 6
3 5 7
4 9 2
All sum to magic number 15
Order 7
=======
30 39 48 1 10 19 28
38 47 7 9 18 27 29
46 6 8 17 26 35 37
5 14 16 25 34 36 45
13 15 24 33 42 44 4
21 23 32 41 43 3 12
22 31 40 49 2 11 20
All sum to magic number 175
>>>
|
Rewrite this program in Python while keeping its functionality equivalent to the VB version. | Sub magicsquare()
Const n = 9
Dim i As Integer, j As Integer, v As Integer
Debug.Print "The square order is: " & n
For i = 1 To n
For j = 1 To n
Cells(i, j) = ((i * 2 - j + n - 1) Mod n) * n + ((i * 2 + j - 2) Mod n) + 1
Next j
Next i
Debug.Print "The magic number of"; n; "x"; n; "square is:"; n * (n * n + 1) \ 2
End Sub
| >>> def magic(n):
for row in range(1, n + 1):
print(' '.join('%*i' % (len(str(n**2)), cell) for cell in
(n * ((row + col - 1 + n // 2) % n) +
((row + 2 * col - 2) % n) + 1
for col in range(1, n + 1))))
print('\nAll sum to magic number %i' % ((n * n + 1) * n // 2))
>>> for n in (5, 3, 7):
print('\nOrder %i\n=======' % n)
magic(n)
Order 5
=======
17 24 1 8 15
23 5 7 14 16
4 6 13 20 22
10 12 19 21 3
11 18 25 2 9
All sum to magic number 65
Order 3
=======
8 1 6
3 5 7
4 9 2
All sum to magic number 15
Order 7
=======
30 39 48 1 10 19 28
38 47 7 9 18 27 29
46 6 8 17 26 35 37
5 14 16 25 34 36 45
13 15 24 33 42 44 4
21 23 32 41 43 3 12
22 31 40 49 2 11 20
All sum to magic number 175
>>>
|
Please provide an equivalent version of this VB code in Python. | Sub BenfordLaw()
Dim BenResult(1 To 9) As Long
BENref = "30,1%|17,6%|12,5%|9,7%|7,9%|6,7%|5,8%|5,1%|4,6%"
For Each c In Selection.Cells
If InStr(1, "-0123456789", Left(c, 1)) > 0 Then
For i = 1 To 9
If CInt(Left(Abs(c), 1)) = i Then BenResult(i) = BenResult(i) + 1: Exit For
Next
End If
Next
Total= Application.Sum(BenResult)
biggest= Len(CStr(BenResult(1)))
txt = "# | Values | Real | Expected " & vbCrLf
For i = 1 To 9
If BenResult(i) > 0 Then
txt = txt & "#" & i & " | " & vbTab
txt = txt & String((biggest - Len(CStr(BenResult(i)))) * 2, " ") & Format(BenResult(i), "0") & " | " & vbTab
txt = txt & String((Len(CStr(Format(BenResult(1) / Total, "##0.0%"))) - Len(CStr(Format(BenResult(i) / Total, "##0.0%")))) * 2, " ") & Format(BenResult(i) / Total, "##0.0%") & " | " & vbTab
txt = txt & Format(Split(BENref, "|")(i - 1), " ##0.0%") & vbCrLf
End If
Next
MsgBox txt, vbOKOnly, "Finish"
End Sub
}
| from __future__ import division
from itertools import islice, count
from collections import Counter
from math import log10
from random import randint
expected = [log10(1+1/d) for d in range(1,10)]
def fib():
a,b = 1,1
while True:
yield a
a,b = b,a+b
def power_of_threes():
return (3**k for k in count(0))
def heads(s):
for a in s: yield int(str(a)[0])
def show_dist(title, s):
c = Counter(s)
size = sum(c.values())
res = [c[d]/size for d in range(1,10)]
print("\n%s Benfords deviation" % title)
for r, e in zip(res, expected):
print("%5.1f%% %5.1f%% %5.1f%%" % (r*100., e*100., abs(r - e)*100.))
def rand1000():
while True: yield randint(1,9999)
if __name__ == '__main__':
show_dist("fibbed", islice(heads(fib()), 1000))
show_dist("threes", islice(heads(power_of_threes()), 1000))
show_dist("random", islice(heads(rand1000()), 10000))
|
Convert the following code from VB to Python, ensuring the logic remains intact. | Sub BenfordLaw()
Dim BenResult(1 To 9) As Long
BENref = "30,1%|17,6%|12,5%|9,7%|7,9%|6,7%|5,8%|5,1%|4,6%"
For Each c In Selection.Cells
If InStr(1, "-0123456789", Left(c, 1)) > 0 Then
For i = 1 To 9
If CInt(Left(Abs(c), 1)) = i Then BenResult(i) = BenResult(i) + 1: Exit For
Next
End If
Next
Total= Application.Sum(BenResult)
biggest= Len(CStr(BenResult(1)))
txt = "# | Values | Real | Expected " & vbCrLf
For i = 1 To 9
If BenResult(i) > 0 Then
txt = txt & "#" & i & " | " & vbTab
txt = txt & String((biggest - Len(CStr(BenResult(i)))) * 2, " ") & Format(BenResult(i), "0") & " | " & vbTab
txt = txt & String((Len(CStr(Format(BenResult(1) / Total, "##0.0%"))) - Len(CStr(Format(BenResult(i) / Total, "##0.0%")))) * 2, " ") & Format(BenResult(i) / Total, "##0.0%") & " | " & vbTab
txt = txt & Format(Split(BENref, "|")(i - 1), " ##0.0%") & vbCrLf
End If
Next
MsgBox txt, vbOKOnly, "Finish"
End Sub
}
| from __future__ import division
from itertools import islice, count
from collections import Counter
from math import log10
from random import randint
expected = [log10(1+1/d) for d in range(1,10)]
def fib():
a,b = 1,1
while True:
yield a
a,b = b,a+b
def power_of_threes():
return (3**k for k in count(0))
def heads(s):
for a in s: yield int(str(a)[0])
def show_dist(title, s):
c = Counter(s)
size = sum(c.values())
res = [c[d]/size for d in range(1,10)]
print("\n%s Benfords deviation" % title)
for r, e in zip(res, expected):
print("%5.1f%% %5.1f%% %5.1f%%" % (r*100., e*100., abs(r - e)*100.))
def rand1000():
while True: yield randint(1,9999)
if __name__ == '__main__':
show_dist("fibbed", islice(heads(fib()), 1000))
show_dist("threes", islice(heads(power_of_threes()), 1000))
show_dist("random", islice(heads(rand1000()), 10000))
|
Ensure the translated Python code behaves exactly like the original VB snippet. | Sub Main()
Debug.Print F(-10)
Debug.Print F(10)
End Sub
Private Function F(N As Long) As Variant
If N < 0 Then
F = "Error. Negative argument"
ElseIf N <= 1 Then
F = N
Else
F = F(N - 1) + F(N - 2)
End If
End Function
| >>> Y = lambda f: (lambda x: x(x))(lambda y: f(lambda *args: y(y)(*args)))
>>> fib = lambda f: lambda n: None if n < 0 else (0 if n == 0 else (1 if n == 1 else f(n-1) + f(n-2)))
>>> [ Y(fib)(i) for i in range(-2, 10) ]
[None, None, 0, 1, 1, 2, 3, 5, 8, 13, 21, 34]
|
Port the following code from VB to Python with equivalent syntax and logic. | string = "Small Basic"
TextWindow.WriteLine(Text.GetSubTextToEnd(string, 2))
TextWindow.WriteLine(Text.GetSubText(string, 1, Text.GetLength(string) - 1))
TextWindow.WriteLine(Text.GetSubText(string, 2, Text.GetLength(string) - 2))
| print "knight"[1:]
print "socks"[:-1]
print "brooms"[1:-1]
|
Produce a language-to-language conversion: from VB to Python, same semantics. | string = "Small Basic"
TextWindow.WriteLine(Text.GetSubTextToEnd(string, 2))
TextWindow.WriteLine(Text.GetSubText(string, 1, Text.GetLength(string) - 1))
TextWindow.WriteLine(Text.GetSubText(string, 2, Text.GetLength(string) - 2))
| print "knight"[1:]
print "socks"[:-1]
print "brooms"[1:-1]
|
Can you help me rewrite this code in Python instead of VB, keeping it the same logically? |
Set objfso = CreateObject("Scripting.FileSystemObject")
Set objfile = objfso.OpenTextFile(objfso.GetParentFolderName(WScript.ScriptFullName) &_
"\input.txt",1)
list = ""
previous_line = ""
l = Len(previous_line)
Do Until objfile.AtEndOfStream
current_line = objfile.ReadLine
If Mid(current_line,l+1,1) <> "" Then
list = current_line & vbCrLf
previous_line = current_line
l = Len(previous_line)
ElseIf Mid(current_line,l,1) <> "" And Mid(current_line,(l+1),1) = "" Then
list = list & current_line & vbCrLf
End If
Loop
WScript.Echo list
objfile.Close
Set objfso = Nothing
| import fileinput
def longer(a, b):
try:
b[len(a)-1]
return False
except:
return True
longest, lines = '', ''
for x in fileinput.input():
if longer(x, longest):
lines, longest = x, x
elif not longer(longest, x):
lines += x
print(lines, end='')
|
Rewrite this program in Python while keeping its functionality equivalent to the VB version. |
Set objfso = CreateObject("Scripting.FileSystemObject")
Set objfile = objfso.OpenTextFile(objfso.GetParentFolderName(WScript.ScriptFullName) &_
"\input.txt",1)
list = ""
previous_line = ""
l = Len(previous_line)
Do Until objfile.AtEndOfStream
current_line = objfile.ReadLine
If Mid(current_line,l+1,1) <> "" Then
list = current_line & vbCrLf
previous_line = current_line
l = Len(previous_line)
ElseIf Mid(current_line,l,1) <> "" And Mid(current_line,(l+1),1) = "" Then
list = list & current_line & vbCrLf
End If
Loop
WScript.Echo list
objfile.Close
Set objfso = Nothing
| import fileinput
def longer(a, b):
try:
b[len(a)-1]
return False
except:
return True
longest, lines = '', ''
for x in fileinput.input():
if longer(x, longest):
lines, longest = x, x
elif not longer(longest, x):
lines += x
print(lines, end='')
|
Write the same code in Python as shown below in VB. | Option Base 1
Public Enum sett
name_ = 1
initState
endState
blank
rules
End Enum
Public incrementer As Variant, threeStateBB As Variant, fiveStateBB As Variant
Private Sub init()
incrementer = Array("Simple incrementer", _
"q0", _
"qf", _
"B", _
Array( _
Array("q0", "1", "1", "right", "q0"), _
Array("q0", "B", "1", "stay", "qf")))
threeStateBB = Array("Three-state busy beaver", _
"a", _
"halt", _
"0", _
Array( _
Array("a", "0", "1", "right", "b"), _
Array("a", "1", "1", "left", "c"), _
Array("b", "0", "1", "left", "a"), _
Array("b", "1", "1", "right", "b"), _
Array("c", "0", "1", "left", "b"), _
Array("c", "1", "1", "stay", "halt")))
fiveStateBB = Array("Five-state busy beaver", _
"A", _
"H", _
"0", _
Array( _
Array("A", "0", "1", "right", "B"), _
Array("A", "1", "1", "left", "C"), _
Array("B", "0", "1", "right", "C"), _
Array("B", "1", "1", "right", "B"), _
Array("C", "0", "1", "right", "D"), _
Array("C", "1", "0", "left", "E"), _
Array("D", "0", "1", "left", "A"), _
Array("D", "1", "1", "left", "D"), _
Array("E", "0", "1", "stay", "H"), _
Array("E", "1", "0", "left", "A")))
End Sub
Private Sub show(state As String, headpos As Long, tape As Collection)
Debug.Print " "; state; String$(7 - Len(state), " "); "| ";
For p = 1 To tape.Count
Debug.Print IIf(p = headpos, "[" & tape(p) & "]", " " & tape(p) & " ");
Next p
Debug.Print
End Sub
Private Sub UTM(machine As Variant, tape As Collection, Optional countOnly As Long = 0)
Dim state As String: state = machine(initState)
Dim headpos As Long: headpos = 1
Dim counter As Long, rule As Variant
Debug.Print machine(name_); vbCrLf; String$(Len(machine(name_)), "=")
If Not countOnly Then Debug.Print " State | Tape [head]" & vbCrLf & "---------------------"
Do While True
If headpos > tape.Count Then
tape.Add machine(blank)
Else
If headpos < 1 Then
tape.Add machine(blank), Before:=1
headpos = 1
End If
End If
If Not countOnly Then show state, headpos, tape
For i = LBound(machine(rules)) To UBound(machine(rules))
rule = machine(rules)(i)
If rule(1) = state And rule(2) = tape(headpos) Then
tape.Remove headpos
If headpos > tape.Count Then
tape.Add rule(3)
Else
tape.Add rule(3), Before:=headpos
End If
If rule(4) = "left" Then headpos = headpos - 1
If rule(4) = "right" Then headpos = headpos + 1
state = rule(5)
Exit For
End If
Next i
counter = counter + 1
If counter Mod 100000 = 0 Then
Debug.Print counter
DoEvents
DoEvents
End If
If state = machine(endState) Then Exit Do
Loop
DoEvents
If countOnly Then
Debug.Print "Steps taken: ", counter
Else
show state, headpos, tape
Debug.Print
End If
End Sub
Public Sub main()
init
Dim tap As New Collection
tap.Add "1": tap.Add "1": tap.Add "1"
UTM incrementer, tap
Set tap = New Collection
UTM threeStateBB, tap
Set tap = New Collection
UTM fiveStateBB, tap, countOnly:=-1
End Sub
| from __future__ import print_function
def run_utm(
state = None,
blank = None,
rules = [],
tape = [],
halt = None,
pos = 0):
st = state
if not tape: tape = [blank]
if pos < 0: pos += len(tape)
if pos >= len(tape) or pos < 0: raise Error( "bad init position")
rules = dict(((s0, v0), (v1, dr, s1)) for (s0, v0, v1, dr, s1) in rules)
while True:
print(st, '\t', end=" ")
for i, v in enumerate(tape):
if i == pos: print("[%s]" % (v,), end=" ")
else: print(v, end=" ")
print()
if st == halt: break
if (st, tape[pos]) not in rules: break
(v1, dr, s1) = rules[(st, tape[pos])]
tape[pos] = v1
if dr == 'left':
if pos > 0: pos -= 1
else: tape.insert(0, blank)
if dr == 'right':
pos += 1
if pos >= len(tape): tape.append(blank)
st = s1
print("incr machine\n")
run_utm(
halt = 'qf',
state = 'q0',
tape = list("111"),
blank = 'B',
rules = map(tuple,
["q0 1 1 right q0".split(),
"q0 B 1 stay qf".split()]
)
)
print("\nbusy beaver\n")
run_utm(
halt = 'halt',
state = 'a',
blank = '0',
rules = map(tuple,
["a 0 1 right b".split(),
"a 1 1 left c".split(),
"b 0 1 left a".split(),
"b 1 1 right b".split(),
"c 0 1 left b".split(),
"c 1 1 stay halt".split()]
)
)
print("\nsorting test\n")
run_utm(halt = 'STOP',
state = 'A',
blank = '0',
tape = "2 2 2 1 2 2 1 2 1 2 1 2 1 2".split(),
rules = map(tuple,
["A 1 1 right A".split(),
"A 2 3 right B".split(),
"A 0 0 left E".split(),
"B 1 1 right B".split(),
"B 2 2 right B".split(),
"B 0 0 left C".split(),
"C 1 2 left D".split(),
"C 2 2 left C".split(),
"C 3 2 left E".split(),
"D 1 1 left D".split(),
"D 2 2 left D".split(),
"D 3 1 right A".split(),
"E 1 1 left E".split(),
"E 0 0 right STOP".split()]
)
)
|
Maintain the same structure and functionality when rewriting this code in Python. | Option Base 1
Public Enum sett
name_ = 1
initState
endState
blank
rules
End Enum
Public incrementer As Variant, threeStateBB As Variant, fiveStateBB As Variant
Private Sub init()
incrementer = Array("Simple incrementer", _
"q0", _
"qf", _
"B", _
Array( _
Array("q0", "1", "1", "right", "q0"), _
Array("q0", "B", "1", "stay", "qf")))
threeStateBB = Array("Three-state busy beaver", _
"a", _
"halt", _
"0", _
Array( _
Array("a", "0", "1", "right", "b"), _
Array("a", "1", "1", "left", "c"), _
Array("b", "0", "1", "left", "a"), _
Array("b", "1", "1", "right", "b"), _
Array("c", "0", "1", "left", "b"), _
Array("c", "1", "1", "stay", "halt")))
fiveStateBB = Array("Five-state busy beaver", _
"A", _
"H", _
"0", _
Array( _
Array("A", "0", "1", "right", "B"), _
Array("A", "1", "1", "left", "C"), _
Array("B", "0", "1", "right", "C"), _
Array("B", "1", "1", "right", "B"), _
Array("C", "0", "1", "right", "D"), _
Array("C", "1", "0", "left", "E"), _
Array("D", "0", "1", "left", "A"), _
Array("D", "1", "1", "left", "D"), _
Array("E", "0", "1", "stay", "H"), _
Array("E", "1", "0", "left", "A")))
End Sub
Private Sub show(state As String, headpos As Long, tape As Collection)
Debug.Print " "; state; String$(7 - Len(state), " "); "| ";
For p = 1 To tape.Count
Debug.Print IIf(p = headpos, "[" & tape(p) & "]", " " & tape(p) & " ");
Next p
Debug.Print
End Sub
Private Sub UTM(machine As Variant, tape As Collection, Optional countOnly As Long = 0)
Dim state As String: state = machine(initState)
Dim headpos As Long: headpos = 1
Dim counter As Long, rule As Variant
Debug.Print machine(name_); vbCrLf; String$(Len(machine(name_)), "=")
If Not countOnly Then Debug.Print " State | Tape [head]" & vbCrLf & "---------------------"
Do While True
If headpos > tape.Count Then
tape.Add machine(blank)
Else
If headpos < 1 Then
tape.Add machine(blank), Before:=1
headpos = 1
End If
End If
If Not countOnly Then show state, headpos, tape
For i = LBound(machine(rules)) To UBound(machine(rules))
rule = machine(rules)(i)
If rule(1) = state And rule(2) = tape(headpos) Then
tape.Remove headpos
If headpos > tape.Count Then
tape.Add rule(3)
Else
tape.Add rule(3), Before:=headpos
End If
If rule(4) = "left" Then headpos = headpos - 1
If rule(4) = "right" Then headpos = headpos + 1
state = rule(5)
Exit For
End If
Next i
counter = counter + 1
If counter Mod 100000 = 0 Then
Debug.Print counter
DoEvents
DoEvents
End If
If state = machine(endState) Then Exit Do
Loop
DoEvents
If countOnly Then
Debug.Print "Steps taken: ", counter
Else
show state, headpos, tape
Debug.Print
End If
End Sub
Public Sub main()
init
Dim tap As New Collection
tap.Add "1": tap.Add "1": tap.Add "1"
UTM incrementer, tap
Set tap = New Collection
UTM threeStateBB, tap
Set tap = New Collection
UTM fiveStateBB, tap, countOnly:=-1
End Sub
| from __future__ import print_function
def run_utm(
state = None,
blank = None,
rules = [],
tape = [],
halt = None,
pos = 0):
st = state
if not tape: tape = [blank]
if pos < 0: pos += len(tape)
if pos >= len(tape) or pos < 0: raise Error( "bad init position")
rules = dict(((s0, v0), (v1, dr, s1)) for (s0, v0, v1, dr, s1) in rules)
while True:
print(st, '\t', end=" ")
for i, v in enumerate(tape):
if i == pos: print("[%s]" % (v,), end=" ")
else: print(v, end=" ")
print()
if st == halt: break
if (st, tape[pos]) not in rules: break
(v1, dr, s1) = rules[(st, tape[pos])]
tape[pos] = v1
if dr == 'left':
if pos > 0: pos -= 1
else: tape.insert(0, blank)
if dr == 'right':
pos += 1
if pos >= len(tape): tape.append(blank)
st = s1
print("incr machine\n")
run_utm(
halt = 'qf',
state = 'q0',
tape = list("111"),
blank = 'B',
rules = map(tuple,
["q0 1 1 right q0".split(),
"q0 B 1 stay qf".split()]
)
)
print("\nbusy beaver\n")
run_utm(
halt = 'halt',
state = 'a',
blank = '0',
rules = map(tuple,
["a 0 1 right b".split(),
"a 1 1 left c".split(),
"b 0 1 left a".split(),
"b 1 1 right b".split(),
"c 0 1 left b".split(),
"c 1 1 stay halt".split()]
)
)
print("\nsorting test\n")
run_utm(halt = 'STOP',
state = 'A',
blank = '0',
tape = "2 2 2 1 2 2 1 2 1 2 1 2 1 2".split(),
rules = map(tuple,
["A 1 1 right A".split(),
"A 2 3 right B".split(),
"A 0 0 left E".split(),
"B 1 1 right B".split(),
"B 2 2 right B".split(),
"B 0 0 left C".split(),
"C 1 2 left D".split(),
"C 2 2 left C".split(),
"C 3 2 left E".split(),
"D 1 1 left D".split(),
"D 2 2 left D".split(),
"D 3 1 right A".split(),
"E 1 1 left E".split(),
"E 0 0 right STOP".split()]
)
)
|
Rewrite the snippet below in Python so it works the same as the original VB code. | Public Sub create_file()
Dim FileNumber As Integer
FileNumber = FreeFile
MkDir "docs"
Open "docs\output.txt" For Output As #FreeFile
Close #FreeFile
MkDir "C:\docs"
Open "C:\docs\output.txt" For Output As #FreeFile
Close #FreeFile
End Sub
| import os
for directory in ['/', './']:
open(directory + 'output.txt', 'w').close()
os.mkdir(directory + 'docs')
|
Convert the following code from VB to Python, ensuring the logic remains intact. | b=_
"CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATG" &_
"CTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTG" &_
"AGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGAT" &_
"GGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT" &_
"CGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGG" &_
"TCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA" &_
"TTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTAT" &_
"CGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTG" &_
"TCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGAC" &_
"GACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT"
s="SEQUENCE:"
acnt=0:ccnt=0:gcnt=0:tcnt=0
for i=0 to len(b)-1
if (i mod 30)=0 then s = s & vbcrlf & right(" "& i+1,3)&": "
if (i mod 5)=0 then s=s& " "
m=mid(b,i+1,1)
s=s & m
select case m
case "A":acnt=acnt+1
case "C":ccnt=ccnt+1
case "G":gcnt=gcnt+1
case "T":tcnt=tcnt+1
case else
wscript.echo "error at ",i+1, m
end select
next
wscript.echo s & vbcrlf
wscript.echo "Count: A="&acnt & " C=" & ccnt & " G=" & gcnt & " T=" & tcnt
| from collections import Counter
def basecount(dna):
return sorted(Counter(dna).items())
def seq_split(dna, n=50):
return [dna[i: i+n] for i in range(0, len(dna), n)]
def seq_pp(dna, n=50):
for i, part in enumerate(seq_split(dna, n)):
print(f"{i*n:>5}: {part}")
print("\n BASECOUNT:")
tot = 0
for base, count in basecount(dna):
print(f" {base:>3}: {count}")
tot += count
base, count = 'TOT', tot
print(f" {base:>3}= {count}")
if __name__ == '__main__':
print("SEQUENCE:")
sequence =
seq_pp(sequence)
|
Please provide an equivalent version of this VB code in Python. | b=_
"CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATG" &_
"CTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTG" &_
"AGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGAT" &_
"GGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT" &_
"CGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGG" &_
"TCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA" &_
"TTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTAT" &_
"CGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTG" &_
"TCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGAC" &_
"GACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT"
s="SEQUENCE:"
acnt=0:ccnt=0:gcnt=0:tcnt=0
for i=0 to len(b)-1
if (i mod 30)=0 then s = s & vbcrlf & right(" "& i+1,3)&": "
if (i mod 5)=0 then s=s& " "
m=mid(b,i+1,1)
s=s & m
select case m
case "A":acnt=acnt+1
case "C":ccnt=ccnt+1
case "G":gcnt=gcnt+1
case "T":tcnt=tcnt+1
case else
wscript.echo "error at ",i+1, m
end select
next
wscript.echo s & vbcrlf
wscript.echo "Count: A="&acnt & " C=" & ccnt & " G=" & gcnt & " T=" & tcnt
| from collections import Counter
def basecount(dna):
return sorted(Counter(dna).items())
def seq_split(dna, n=50):
return [dna[i: i+n] for i in range(0, len(dna), n)]
def seq_pp(dna, n=50):
for i, part in enumerate(seq_split(dna, n)):
print(f"{i*n:>5}: {part}")
print("\n BASECOUNT:")
tot = 0
for base, count in basecount(dna):
print(f" {base:>3}: {count}")
tot += count
base, count = 'TOT', tot
print(f" {base:>3}= {count}")
if __name__ == '__main__':
print("SEQUENCE:")
sequence =
seq_pp(sequence)
|
Write a version of this VB function in Python with identical behavior. | b=_
"CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATG" &_
"CTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTG" &_
"AGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGAT" &_
"GGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT" &_
"CGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGG" &_
"TCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA" &_
"TTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTAT" &_
"CGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTG" &_
"TCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGAC" &_
"GACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT"
s="SEQUENCE:"
acnt=0:ccnt=0:gcnt=0:tcnt=0
for i=0 to len(b)-1
if (i mod 30)=0 then s = s & vbcrlf & right(" "& i+1,3)&": "
if (i mod 5)=0 then s=s& " "
m=mid(b,i+1,1)
s=s & m
select case m
case "A":acnt=acnt+1
case "C":ccnt=ccnt+1
case "G":gcnt=gcnt+1
case "T":tcnt=tcnt+1
case else
wscript.echo "error at ",i+1, m
end select
next
wscript.echo s & vbcrlf
wscript.echo "Count: A="&acnt & " C=" & ccnt & " G=" & gcnt & " T=" & tcnt
| from collections import Counter
def basecount(dna):
return sorted(Counter(dna).items())
def seq_split(dna, n=50):
return [dna[i: i+n] for i in range(0, len(dna), n)]
def seq_pp(dna, n=50):
for i, part in enumerate(seq_split(dna, n)):
print(f"{i*n:>5}: {part}")
print("\n BASECOUNT:")
tot = 0
for base, count in basecount(dna):
print(f" {base:>3}: {count}")
tot += count
base, count = 'TOT', tot
print(f" {base:>3}= {count}")
if __name__ == '__main__':
print("SEQUENCE:")
sequence =
seq_pp(sequence)
|
Keep all operations the same but rewrite the snippet in Python. |
Public Const HOLDON = False
Public Const DIJKSTRASOLUTION = True
Public Const X = 10
Public Const GETS = 0
Public Const PUTS = 1
Public Const EATS = 2
Public Const THKS = 5
Public Const FRSTFORK = 0
Public Const SCNDFORK = 1
Public Const SPAGHETI = 0
Public Const UNIVERSE = 1
Public Const MAXCOUNT = 100000
Public Const PHILOSOPHERS = 5
Public semaphore(PHILOSOPHERS - 1) As Integer
Public positi0n(1, PHILOSOPHERS - 1) As Integer
Public programcounter(PHILOSOPHERS - 1) As Long
Public statistics(PHILOSOPHERS - 1, 5, 1) As Long
Public names As Variant
Private Sub init()
names = [{"Aquinas","Babbage","Carroll","Derrida","Erasmus"}]
For j = 0 To PHILOSOPHERS - 2
positi0n(0, j) = j + 1
positi0n(1, j) = j
Next j
If DIJKSTRASOLUTION Then
positi0n(0, PHILOSOPHERS - 1) = j
positi0n(1, PHILOSOPHERS - 1) = 0
Else
positi0n(0, PHILOSOPHERS - 1) = 0
positi0n(1, PHILOSOPHERS - 1) = j
End If
End Sub
Private Sub philosopher(subject As Integer, verb As Integer, objekt As Integer)
statistics(subject, verb, objekt) = statistics(subject, verb, objekt) + 1
If verb < 2 Then
If semaphore(positi0n(objekt, subject)) <> verb Then
If Not HOLDON Then
semaphore(positi0n(FRSTFORK, subject)) = 1 - objekt
programcounter(subject) = 0
End If
Else
semaphore(positi0n(objekt, subject)) = 1 - verb
programcounter(subject) = (programcounter(subject) + 1) Mod 6
End If
Else
programcounter(subject) = IIf(X * Rnd > 1, verb, verb + 1) Mod 6
End If
End Sub
Private Sub dine()
Dim ph As Integer
Do While TC < MAXCOUNT
For ph = 0 To PHILOSOPHERS - 1
Select Case programcounter(ph)
Case 0: philosopher ph, GETS, FRSTFORK
Case 1: philosopher ph, GETS, SCNDFORK
Case 2: philosopher ph, EATS, SPAGHETI
Case 3: philosopher ph, PUTS, FRSTFORK
Case 4: philosopher ph, PUTS, SCNDFORK
Case 5: philosopher ph, THKS, UNIVERSE
End Select
TC = TC + 1
Next ph
Loop
End Sub
Private Sub show()
Debug.Print "Stats", "Gets", "Gets", "Eats", "Puts", "Puts", "Thinks"
Debug.Print "", "First", "Second", "Spag-", "First", "Second", "About"
Debug.Print "", "Fork", "Fork", "hetti", "Fork", "Fork", "Universe"
For subject = 0 To PHILOSOPHERS - 1
Debug.Print names(subject + 1),
For objekt = 0 To 1
Debug.Print statistics(subject, GETS, objekt),
Next objekt
Debug.Print statistics(subject, EATS, SPAGHETI),
For objekt = 0 To 1
Debug.Print statistics(subject, PUTS, objekt),
Next objekt
Debug.Print statistics(subject, THKS, UNIVERSE)
Next subject
End Sub
Public Sub main()
init
dine
show
End Sub
| import threading
import random
import time
class Philosopher(threading.Thread):
running = True
def __init__(self, xname, forkOnLeft, forkOnRight):
threading.Thread.__init__(self)
self.name = xname
self.forkOnLeft = forkOnLeft
self.forkOnRight = forkOnRight
def run(self):
while(self.running):
time.sleep( random.uniform(3,13))
print '%s is hungry.' % self.name
self.dine()
def dine(self):
fork1, fork2 = self.forkOnLeft, self.forkOnRight
while self.running:
fork1.acquire(True)
locked = fork2.acquire(False)
if locked: break
fork1.release()
print '%s swaps forks' % self.name
fork1, fork2 = fork2, fork1
else:
return
self.dining()
fork2.release()
fork1.release()
def dining(self):
print '%s starts eating '% self.name
time.sleep(random.uniform(1,10))
print '%s finishes eating and leaves to think.' % self.name
def DiningPhilosophers():
forks = [threading.Lock() for n in range(5)]
philosopherNames = ('Aristotle','Kant','Spinoza','Marx', 'Russel')
philosophers= [Philosopher(philosopherNames[i], forks[i%5], forks[(i+1)%5]) \
for i in range(5)]
random.seed(507129)
Philosopher.running = True
for p in philosophers: p.start()
time.sleep(100)
Philosopher.running = False
print ("Now we're finishing.")
DiningPhilosophers()
|
Please provide an equivalent version of this VB code in Python. |
Dim fact()
nn1=9 : nn2=12
lim=1499999
ReDim fact(nn2)
fact(0)=1
For i=1 To nn2
fact(i)=fact(i-1)*i
Next
For base=nn1 To nn2
list=""
For i=1 To lim
s=0
t=i
Do While t<>0
d=t Mod base
s=s+fact(d)
t=t\base
Loop
If s=i Then list=list &" "& i
Next
Wscript.Echo "the factorions for base "& right(" "& base,2) &" are: "& list
Next
| fact = [1]
for n in range(1, 12):
fact.append(fact[n-1] * n)
for b in range(9, 12+1):
print(f"The factorions for base {b} are:")
for i in range(1, 1500000):
fact_sum = 0
j = i
while j > 0:
d = j % b
fact_sum += fact[d]
j = j//b
if fact_sum == i:
print(i, end=" ")
print("\n")
|
Write the same code in Python as shown below in VB. |
Dim fact()
nn1=9 : nn2=12
lim=1499999
ReDim fact(nn2)
fact(0)=1
For i=1 To nn2
fact(i)=fact(i-1)*i
Next
For base=nn1 To nn2
list=""
For i=1 To lim
s=0
t=i
Do While t<>0
d=t Mod base
s=s+fact(d)
t=t\base
Loop
If s=i Then list=list &" "& i
Next
Wscript.Echo "the factorions for base "& right(" "& base,2) &" are: "& list
Next
| fact = [1]
for n in range(1, 12):
fact.append(fact[n-1] * n)
for b in range(9, 12+1):
print(f"The factorions for base {b} are:")
for i in range(1, 1500000):
fact_sum = 0
j = i
while j > 0:
d = j % b
fact_sum += fact[d]
j = j//b
if fact_sum == i:
print(i, end=" ")
print("\n")
|
Convert this VB snippet to Python and keep its semantics consistent. | Private Function ValidateUserWords(userstring As String) As String
Dim s As String
Dim user_words() As String
Dim command_table As Scripting.Dictionary
Set command_table = New Scripting.Dictionary
Dim abbreviations As Scripting.Dictionary
Set abbreviations = New Scripting.Dictionary
abbreviations.CompareMode = TextCompare
Dim commandtable() As String
Dim commands As String
s = s & "Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy "
s = s & "COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find "
s = s & "NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput "
s = s & "Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO "
s = s & "MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT "
s = s & "READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT "
s = s & "RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up "
commandtable = Split(s, " ")
Dim i As Integer
For Each word In commandtable
If Len(word) > 0 Then
i = 1
Do While Mid(word, i, 1) >= "A" And Mid(word, i, 1) <= "Z"
i = i + 1
Loop
command_table.Add Key:=word, Item:=i - 1
End If
Next word
For Each word In command_table
For i = command_table(word) To Len(word)
On Error Resume Next
abbreviations.Add Key:=Left(word, i), Item:=UCase(word)
Next i
Next word
user_words() = Split(userstring, " ")
For Each word In user_words
If Len(word) > 0 Then
If abbreviations.exists(word) Then
commands = commands & abbreviations(word) & " "
Else
commands = commands & "*error* "
End If
End If
Next word
ValidateUserWords = commands
End Function
Public Sub program()
Dim guserstring As String
guserstring = "riG rePEAT copies put mo rest types fup. 6 poweRin"
Debug.Print "user words:", guserstring
Debug.Print "full words:", ValidateUserWords(guserstring)
End Sub
| command_table_text = \
user_words = "riG rePEAT copies put mo rest types fup. 6 poweRin"
def find_abbreviations_length(command_table_text):
command_table = dict()
for word in command_table_text.split():
abbr_len = sum(1 for c in word if c.isupper())
if abbr_len == 0:
abbr_len = len(word)
command_table[word] = abbr_len
return command_table
def find_abbreviations(command_table):
abbreviations = dict()
for command, min_abbr_len in command_table.items():
for l in range(min_abbr_len, len(command)+1):
abbr = command[:l].lower()
abbreviations[abbr] = command.upper()
return abbreviations
def parse_user_string(user_string, abbreviations):
user_words = [word.lower() for word in user_string.split()]
commands = [abbreviations.get(user_word, "*error*") for user_word in user_words]
return " ".join(commands)
command_table = find_abbreviations_length(command_table_text)
abbreviations_table = find_abbreviations(command_table)
full_words = parse_user_string(user_words, abbreviations_table)
print("user words:", user_words)
print("full words:", full_words)
|
Generate a Python translation of this VB snippet without changing its computational steps. | Private Function ValidateUserWords(userstring As String) As String
Dim s As String
Dim user_words() As String
Dim command_table As Scripting.Dictionary
Set command_table = New Scripting.Dictionary
Dim abbreviations As Scripting.Dictionary
Set abbreviations = New Scripting.Dictionary
abbreviations.CompareMode = TextCompare
Dim commandtable() As String
Dim commands As String
s = s & "Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy "
s = s & "COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find "
s = s & "NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput "
s = s & "Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO "
s = s & "MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT "
s = s & "READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT "
s = s & "RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up "
commandtable = Split(s, " ")
Dim i As Integer
For Each word In commandtable
If Len(word) > 0 Then
i = 1
Do While Mid(word, i, 1) >= "A" And Mid(word, i, 1) <= "Z"
i = i + 1
Loop
command_table.Add Key:=word, Item:=i - 1
End If
Next word
For Each word In command_table
For i = command_table(word) To Len(word)
On Error Resume Next
abbreviations.Add Key:=Left(word, i), Item:=UCase(word)
Next i
Next word
user_words() = Split(userstring, " ")
For Each word In user_words
If Len(word) > 0 Then
If abbreviations.exists(word) Then
commands = commands & abbreviations(word) & " "
Else
commands = commands & "*error* "
End If
End If
Next word
ValidateUserWords = commands
End Function
Public Sub program()
Dim guserstring As String
guserstring = "riG rePEAT copies put mo rest types fup. 6 poweRin"
Debug.Print "user words:", guserstring
Debug.Print "full words:", ValidateUserWords(guserstring)
End Sub
| command_table_text = \
user_words = "riG rePEAT copies put mo rest types fup. 6 poweRin"
def find_abbreviations_length(command_table_text):
command_table = dict()
for word in command_table_text.split():
abbr_len = sum(1 for c in word if c.isupper())
if abbr_len == 0:
abbr_len = len(word)
command_table[word] = abbr_len
return command_table
def find_abbreviations(command_table):
abbreviations = dict()
for command, min_abbr_len in command_table.items():
for l in range(min_abbr_len, len(command)+1):
abbr = command[:l].lower()
abbreviations[abbr] = command.upper()
return abbreviations
def parse_user_string(user_string, abbreviations):
user_words = [word.lower() for word in user_string.split()]
commands = [abbreviations.get(user_word, "*error*") for user_word in user_words]
return " ".join(commands)
command_table = find_abbreviations_length(command_table_text)
abbreviations_table = find_abbreviations(command_table)
full_words = parse_user_string(user_words, abbreviations_table)
print("user words:", user_words)
print("full words:", full_words)
|
Can you help me rewrite this code in Python instead of VB, keeping it the same logically? | Imports System.Text
Module Module1
ReadOnly CODES As New Dictionary(Of Char, String) From {
{"a", "AAAAA"}, {"b", "AAAAB"}, {"c", "AAABA"}, {"d", "AAABB"}, {"e", "AABAA"},
{"f", "AABAB"}, {"g", "AABBA"}, {"h", "AABBB"}, {"i", "ABAAA"}, {"j", "ABAAB"},
{"k", "ABABA"}, {"l", "ABABB"}, {"m", "ABBAA"}, {"n", "ABBAB"}, {"o", "ABBBA"},
{"p", "ABBBB"}, {"q", "BAAAA"}, {"r", "BAAAB"}, {"s", "BAABA"}, {"t", "BAABB"},
{"u", "BABAA"}, {"v", "BABAB"}, {"w", "BABBA"}, {"x", "BABBB"}, {"y", "BBAAA"},
{"z", "BBAAB"}, {" ", "BBBAA"}
}
Function Encode(plainText As String, message As String) As String
Dim pt = plainText.ToLower()
Dim sb As New StringBuilder()
For Each c In pt
If "a" <= c AndAlso c <= "z" Then
sb.Append(CODES(c))
Else
sb.Append(CODES(" "))
End If
Next
Dim et = sb.ToString()
Dim mg = message.ToLower()
sb.Length = 0
Dim count = 0
For Each c In mg
If "a" <= c AndAlso c <= "z" Then
If et(count) = "A" Then
sb.Append(c)
Else
sb.Append(Chr(Asc(c) - 32))
End If
count += 1
If count = et.Length Then
Exit For
End If
Else
sb.Append(c)
End If
Next
Return sb.ToString()
End Function
Function Decode(message As String) As String
Dim sb As New StringBuilder
For Each c In message
If "a" <= c AndAlso c <= "z" Then
sb.Append("A")
ElseIf "A" <= c AndAlso c <= "Z" Then
sb.Append("B")
End If
Next
Dim et = sb.ToString()
sb.Length = 0
For index = 0 To et.Length - 1 Step 5
Dim quintet = et.Substring(index, 5)
Dim key = CODES.Where(Function(a) a.Value = quintet).First().Key
sb.Append(key)
Next
Return sb.ToString()
End Function
Sub Main()
Dim plainText = "the quick brown fox jumps over the lazy dog"
Dim message =
"bacon
"this task is to implement a program for encryption and decryption of " +
"plaintext using the simple alphabet of the baconian cipher or some " +
"other kind of representation of this alphabet (make anything signify anything). " +
"the baconian alphabet may optionally be extended to encode all lower " +
"case characters individually and/or adding a few punctuation characters " +
"such as the space."
Dim cipherText = Encode(plainText, message)
Console.WriteLine("Cipher text ->" & Environment.NewLine & "{0}", cipherText)
Dim decodedText = Decode(cipherText)
Console.WriteLine(Environment.NewLine & "Hidden text ->" & Environment.NewLine & "{0}", decodedText)
End Sub
End Module
| import string
sometext = .lower()
lc2bin = {ch: '{:05b}'.format(i)
for i, ch in enumerate(string.ascii_lowercase + ' .')}
bin2lc = {val: key for key, val in lc2bin.items()}
phrase = 'Rosetta code Bacon cipher example secret phrase to encode in the capitalisation of peter pan'.lower()
def to_5binary(msg):
return ( ch == '1' for ch in ''.join(lc2bin.get(ch, '') for ch in msg.lower()))
def encrypt(message, text):
bin5 = to_5binary(message)
textlist = list(text.lower())
out = []
for capitalise in bin5:
while textlist:
ch = textlist.pop(0)
if ch.isalpha():
if capitalise:
ch = ch.upper()
out.append(ch)
break
else:
out.append(ch)
else:
raise Exception('ERROR: Ran out of characters in sometext')
return ''.join(out) + '...'
def decrypt(bacontext):
binary = []
bin5 = []
out = []
for ch in bacontext:
if ch.isalpha():
binary.append('1' if ch.isupper() else '0')
if len(binary) == 5:
bin5 = ''.join(binary)
out.append(bin2lc[bin5])
binary = []
return ''.join(out)
print('PLAINTEXT = \n%s\n' % phrase)
encrypted = encrypt(phrase, sometext)
print('ENCRYPTED = \n%s\n' % encrypted)
decrypted = decrypt(encrypted)
print('DECRYPTED = \n%s\n' % decrypted)
assert phrase == decrypted, 'Round-tripping error'
|
Ensure the translated Python code behaves exactly like the original VB snippet. | Imports System.Text
Module Module1
ReadOnly CODES As New Dictionary(Of Char, String) From {
{"a", "AAAAA"}, {"b", "AAAAB"}, {"c", "AAABA"}, {"d", "AAABB"}, {"e", "AABAA"},
{"f", "AABAB"}, {"g", "AABBA"}, {"h", "AABBB"}, {"i", "ABAAA"}, {"j", "ABAAB"},
{"k", "ABABA"}, {"l", "ABABB"}, {"m", "ABBAA"}, {"n", "ABBAB"}, {"o", "ABBBA"},
{"p", "ABBBB"}, {"q", "BAAAA"}, {"r", "BAAAB"}, {"s", "BAABA"}, {"t", "BAABB"},
{"u", "BABAA"}, {"v", "BABAB"}, {"w", "BABBA"}, {"x", "BABBB"}, {"y", "BBAAA"},
{"z", "BBAAB"}, {" ", "BBBAA"}
}
Function Encode(plainText As String, message As String) As String
Dim pt = plainText.ToLower()
Dim sb As New StringBuilder()
For Each c In pt
If "a" <= c AndAlso c <= "z" Then
sb.Append(CODES(c))
Else
sb.Append(CODES(" "))
End If
Next
Dim et = sb.ToString()
Dim mg = message.ToLower()
sb.Length = 0
Dim count = 0
For Each c In mg
If "a" <= c AndAlso c <= "z" Then
If et(count) = "A" Then
sb.Append(c)
Else
sb.Append(Chr(Asc(c) - 32))
End If
count += 1
If count = et.Length Then
Exit For
End If
Else
sb.Append(c)
End If
Next
Return sb.ToString()
End Function
Function Decode(message As String) As String
Dim sb As New StringBuilder
For Each c In message
If "a" <= c AndAlso c <= "z" Then
sb.Append("A")
ElseIf "A" <= c AndAlso c <= "Z" Then
sb.Append("B")
End If
Next
Dim et = sb.ToString()
sb.Length = 0
For index = 0 To et.Length - 1 Step 5
Dim quintet = et.Substring(index, 5)
Dim key = CODES.Where(Function(a) a.Value = quintet).First().Key
sb.Append(key)
Next
Return sb.ToString()
End Function
Sub Main()
Dim plainText = "the quick brown fox jumps over the lazy dog"
Dim message =
"bacon
"this task is to implement a program for encryption and decryption of " +
"plaintext using the simple alphabet of the baconian cipher or some " +
"other kind of representation of this alphabet (make anything signify anything). " +
"the baconian alphabet may optionally be extended to encode all lower " +
"case characters individually and/or adding a few punctuation characters " +
"such as the space."
Dim cipherText = Encode(plainText, message)
Console.WriteLine("Cipher text ->" & Environment.NewLine & "{0}", cipherText)
Dim decodedText = Decode(cipherText)
Console.WriteLine(Environment.NewLine & "Hidden text ->" & Environment.NewLine & "{0}", decodedText)
End Sub
End Module
| import string
sometext = .lower()
lc2bin = {ch: '{:05b}'.format(i)
for i, ch in enumerate(string.ascii_lowercase + ' .')}
bin2lc = {val: key for key, val in lc2bin.items()}
phrase = 'Rosetta code Bacon cipher example secret phrase to encode in the capitalisation of peter pan'.lower()
def to_5binary(msg):
return ( ch == '1' for ch in ''.join(lc2bin.get(ch, '') for ch in msg.lower()))
def encrypt(message, text):
bin5 = to_5binary(message)
textlist = list(text.lower())
out = []
for capitalise in bin5:
while textlist:
ch = textlist.pop(0)
if ch.isalpha():
if capitalise:
ch = ch.upper()
out.append(ch)
break
else:
out.append(ch)
else:
raise Exception('ERROR: Ran out of characters in sometext')
return ''.join(out) + '...'
def decrypt(bacontext):
binary = []
bin5 = []
out = []
for ch in bacontext:
if ch.isalpha():
binary.append('1' if ch.isupper() else '0')
if len(binary) == 5:
bin5 = ''.join(binary)
out.append(bin2lc[bin5])
binary = []
return ''.join(out)
print('PLAINTEXT = \n%s\n' % phrase)
encrypted = encrypt(phrase, sometext)
print('ENCRYPTED = \n%s\n' % encrypted)
decrypted = decrypt(encrypted)
print('DECRYPTED = \n%s\n' % decrypted)
assert phrase == decrypted, 'Round-tripping error'
|
Write a version of this VB function in Python with identical behavior. | Imports System.Text
Module Module1
ReadOnly CODES As New Dictionary(Of Char, String) From {
{"a", "AAAAA"}, {"b", "AAAAB"}, {"c", "AAABA"}, {"d", "AAABB"}, {"e", "AABAA"},
{"f", "AABAB"}, {"g", "AABBA"}, {"h", "AABBB"}, {"i", "ABAAA"}, {"j", "ABAAB"},
{"k", "ABABA"}, {"l", "ABABB"}, {"m", "ABBAA"}, {"n", "ABBAB"}, {"o", "ABBBA"},
{"p", "ABBBB"}, {"q", "BAAAA"}, {"r", "BAAAB"}, {"s", "BAABA"}, {"t", "BAABB"},
{"u", "BABAA"}, {"v", "BABAB"}, {"w", "BABBA"}, {"x", "BABBB"}, {"y", "BBAAA"},
{"z", "BBAAB"}, {" ", "BBBAA"}
}
Function Encode(plainText As String, message As String) As String
Dim pt = plainText.ToLower()
Dim sb As New StringBuilder()
For Each c In pt
If "a" <= c AndAlso c <= "z" Then
sb.Append(CODES(c))
Else
sb.Append(CODES(" "))
End If
Next
Dim et = sb.ToString()
Dim mg = message.ToLower()
sb.Length = 0
Dim count = 0
For Each c In mg
If "a" <= c AndAlso c <= "z" Then
If et(count) = "A" Then
sb.Append(c)
Else
sb.Append(Chr(Asc(c) - 32))
End If
count += 1
If count = et.Length Then
Exit For
End If
Else
sb.Append(c)
End If
Next
Return sb.ToString()
End Function
Function Decode(message As String) As String
Dim sb As New StringBuilder
For Each c In message
If "a" <= c AndAlso c <= "z" Then
sb.Append("A")
ElseIf "A" <= c AndAlso c <= "Z" Then
sb.Append("B")
End If
Next
Dim et = sb.ToString()
sb.Length = 0
For index = 0 To et.Length - 1 Step 5
Dim quintet = et.Substring(index, 5)
Dim key = CODES.Where(Function(a) a.Value = quintet).First().Key
sb.Append(key)
Next
Return sb.ToString()
End Function
Sub Main()
Dim plainText = "the quick brown fox jumps over the lazy dog"
Dim message =
"bacon
"this task is to implement a program for encryption and decryption of " +
"plaintext using the simple alphabet of the baconian cipher or some " +
"other kind of representation of this alphabet (make anything signify anything). " +
"the baconian alphabet may optionally be extended to encode all lower " +
"case characters individually and/or adding a few punctuation characters " +
"such as the space."
Dim cipherText = Encode(plainText, message)
Console.WriteLine("Cipher text ->" & Environment.NewLine & "{0}", cipherText)
Dim decodedText = Decode(cipherText)
Console.WriteLine(Environment.NewLine & "Hidden text ->" & Environment.NewLine & "{0}", decodedText)
End Sub
End Module
| import string
sometext = .lower()
lc2bin = {ch: '{:05b}'.format(i)
for i, ch in enumerate(string.ascii_lowercase + ' .')}
bin2lc = {val: key for key, val in lc2bin.items()}
phrase = 'Rosetta code Bacon cipher example secret phrase to encode in the capitalisation of peter pan'.lower()
def to_5binary(msg):
return ( ch == '1' for ch in ''.join(lc2bin.get(ch, '') for ch in msg.lower()))
def encrypt(message, text):
bin5 = to_5binary(message)
textlist = list(text.lower())
out = []
for capitalise in bin5:
while textlist:
ch = textlist.pop(0)
if ch.isalpha():
if capitalise:
ch = ch.upper()
out.append(ch)
break
else:
out.append(ch)
else:
raise Exception('ERROR: Ran out of characters in sometext')
return ''.join(out) + '...'
def decrypt(bacontext):
binary = []
bin5 = []
out = []
for ch in bacontext:
if ch.isalpha():
binary.append('1' if ch.isupper() else '0')
if len(binary) == 5:
bin5 = ''.join(binary)
out.append(bin2lc[bin5])
binary = []
return ''.join(out)
print('PLAINTEXT = \n%s\n' % phrase)
encrypted = encrypt(phrase, sometext)
print('ENCRYPTED = \n%s\n' % encrypted)
decrypted = decrypt(encrypted)
print('DECRYPTED = \n%s\n' % decrypted)
assert phrase == decrypted, 'Round-tripping error'
|
Write the same algorithm in Python as shown in this VB implementation. | Function build_spiral(n)
botcol = 0 : topcol = n - 1
botrow = 0 : toprow = n - 1
Dim matrix()
ReDim matrix(topcol,toprow)
dir = 0 : col = 0 : row = 0
For i = 0 To n*n-1
matrix(col,row) = i
Select Case dir
Case 0
If col < topcol Then
col = col + 1
Else
dir = 1 : row = row + 1 : botrow = botrow + 1
End If
Case 1
If row < toprow Then
row = row + 1
Else
dir = 2 : col = col - 1 : topcol = topcol - 1
End If
Case 2
If col > botcol Then
col = col - 1
Else
dir = 3 : row = row - 1 : toprow = toprow - 1
End If
Case 3
If row > botrow Then
row = row - 1
Else
dir = 0 : col = col + 1 : botcol = botcol + 1
End If
End Select
Next
For y = 0 To n-1
For x = 0 To n-1
WScript.StdOut.Write matrix(x,y) & vbTab
Next
WScript.StdOut.WriteLine
Next
End Function
build_spiral(CInt(WScript.Arguments(0)))
| def spiral(n):
dx,dy = 1,0
x,y = 0,0
myarray = [[None]* n for j in range(n)]
for i in xrange(n**2):
myarray[x][y] = i
nx,ny = x+dx, y+dy
if 0<=nx<n and 0<=ny<n and myarray[nx][ny] == None:
x,y = nx,ny
else:
dx,dy = -dy,dx
x,y = x+dx, y+dy
return myarray
def printspiral(myarray):
n = range(len(myarray))
for y in n:
for x in n:
print "%2i" % myarray[x][y],
print
printspiral(spiral(5))
|
Produce a functionally identical Python code for the snippet given in VB. | Private Sub optional_parameters(theRange As String, _
Optional ordering As Integer = 0, _
Optional column As Integer = 1, _
Optional reverse As Integer = 1)
ActiveSheet.Sort.SortFields.Clear
ActiveSheet.Sort.SortFields.Add _
Key:=Range(theRange).Columns(column), _
SortOn:=SortOnValues, _
Order:=reverse, _
DataOption:=ordering
With ActiveSheet.Sort
.SetRange Range(theRange)
.Header = xlGuess
.MatchCase = False
.Orientation = xlTopToBottom
.SortMethod = xlPinYin
.Apply
End With
End Sub
Public Sub main()
optional_parameters theRange:="A1:C4", ordering:=1, column:=2, reverse:=1
End Sub
| >>> def printtable(data):
for row in data:
print ' '.join('%-5s' % ('"%s"' % cell) for cell in row)
>>> import operator
>>> def sorttable(table, ordering=None, column=0, reverse=False):
return sorted(table, cmp=ordering, key=operator.itemgetter(column), reverse=reverse)
>>> data = [["a", "b", "c"], ["", "q", "z"], ["zap", "zip", "Zot"]]
>>> printtable(data)
"a" "b" "c"
"" "q" "z"
"zap" "zip" "Zot"
>>> printtable( sorttable(data) )
"" "q" "z"
"a" "b" "c"
"zap" "zip" "Zot"
>>> printtable( sorttable(data, column=2) )
"zap" "zip" "Zot"
"a" "b" "c"
"" "q" "z"
>>> printtable( sorttable(data, column=1) )
"a" "b" "c"
"" "q" "z"
"zap" "zip" "Zot"
>>> printtable( sorttable(data, column=1, reverse=True) )
"zap" "zip" "Zot"
"" "q" "z"
"a" "b" "c"
>>> printtable( sorttable(data, ordering=lambda a,b: cmp(len(b),len(a))) )
"zap" "zip" "Zot"
"a" "b" "c"
"" "q" "z"
>>>
|
Convert the following code from VB to Python, ensuring the logic remains intact. | Declare Function CreateFileW Lib "Kernel32" (FileName As WString, DesiredAccess As Integer, ShareMode As Integer, SecurityAttributes As Integer, _
CreateDisposition As Integer, Flags As Integer, Template As Integer) As Integer
Declare Function WriteFile Lib "Kernel32" (fHandle As Integer, writeData As Ptr, numOfBytes As Integer, ByRef numOfBytesWritten As Integer, _
overlapped As Ptr) As Boolean
Declare Function GetLastError Lib "Kernel32" () As Integer
Declare Function CloseHandle Lib "kernel32" (hObject As Integer) As Boolean
Const FILE_SHARE_READ = &h00000001
Const FILE_SHARE_WRITE = &h00000002
Const OPEN_EXISTING = 3
Dim fHandle As Integer = CreateFileW("C:\foo.txt", 0, FILE_SHARE_READ Or FILE_SHARE_WRITE, 0, OPEN_EXISTING, 0, 0)
If fHandle > 0 Then
Dim mb As MemoryBlock = "Hello, World!"
Dim bytesWritten As Integer
If Not WriteFile(fHandle, mb, mb.Size, bytesWritten, Nil) Then
MsgBox("Error Number: " + Str(GetLastError))
End If
Call CloseHandle(fHandle)
Else
MsgBox("Error Number: " + Str(GetLastError))
End If
| import ctypes
libc = ctypes.CDLL("/lib/libc.so.6")
libc.strcmp("abc", "def")
libc.strcmp("hello", "hello")
|
Please provide an equivalent version of this VB code in Python. | Module Module1
Class Frac
Private ReadOnly num As Long
Private ReadOnly denom As Long
Public Shared ReadOnly ZERO = New Frac(0, 1)
Public Shared ReadOnly ONE = New Frac(1, 1)
Public Sub New(n As Long, d As Long)
If d = 0 Then
Throw New ArgumentException("d must not be zero")
End If
Dim nn = n
Dim dd = d
If nn = 0 Then
dd = 1
ElseIf dd < 0 Then
nn = -nn
dd = -dd
End If
Dim g = Math.Abs(Gcd(nn, dd))
If g > 1 Then
nn /= g
dd /= g
End If
num = nn
denom = dd
End Sub
Private Shared Function Gcd(a As Long, b As Long) As Long
If b = 0 Then
Return a
Else
Return Gcd(b, a Mod b)
End If
End Function
Public Shared Operator -(self As Frac) As Frac
Return New Frac(-self.num, self.denom)
End Operator
Public Shared Operator +(lhs As Frac, rhs As Frac) As Frac
Return New Frac(lhs.num * rhs.denom + lhs.denom * rhs.num, rhs.denom * lhs.denom)
End Operator
Public Shared Operator -(lhs As Frac, rhs As Frac) As Frac
Return lhs + -rhs
End Operator
Public Shared Operator *(lhs As Frac, rhs As Frac) As Frac
Return New Frac(lhs.num * rhs.num, lhs.denom * rhs.denom)
End Operator
Public Shared Operator <(lhs As Frac, rhs As Frac) As Boolean
Dim x = lhs.num / lhs.denom
Dim y = rhs.num / rhs.denom
Return x < y
End Operator
Public Shared Operator >(lhs As Frac, rhs As Frac) As Boolean
Dim x = lhs.num / lhs.denom
Dim y = rhs.num / rhs.denom
Return x > y
End Operator
Public Shared Operator =(lhs As Frac, rhs As Frac) As Boolean
Return lhs.num = rhs.num AndAlso lhs.denom = rhs.denom
End Operator
Public Shared Operator <>(lhs As Frac, rhs As Frac) As Boolean
Return lhs.num <> rhs.num OrElse lhs.denom <> rhs.denom
End Operator
Public Overrides Function ToString() As String
If denom = 1 Then
Return num.ToString
Else
Return String.Format("{0}/{1}", num, denom)
End If
End Function
Public Overrides Function Equals(obj As Object) As Boolean
Dim frac = CType(obj, Frac)
Return Not IsNothing(frac) AndAlso num = frac.num AndAlso denom = frac.denom
End Function
End Class
Function Bernoulli(n As Integer) As Frac
If n < 0 Then
Throw New ArgumentException("n may not be negative or zero")
End If
Dim a(n + 1) As Frac
For m = 0 To n
a(m) = New Frac(1, m + 1)
For j = m To 1 Step -1
a(j - 1) = (a(j - 1) - a(j)) * New Frac(j, 1)
Next
Next
If n <> 1 Then
Return a(0)
Else
Return -a(0)
End If
End Function
Function Binomial(n As Integer, k As Integer) As Integer
If n < 0 OrElse k < 0 OrElse n < k Then
Throw New ArgumentException()
End If
If n = 0 OrElse k = 0 Then
Return 1
End If
Dim num = 1
For i = k + 1 To n
num *= i
Next
Dim denom = 1
For i = 2 To n - k
denom *= i
Next
Return num \ denom
End Function
Function FaulhaberTriangle(p As Integer) As Frac()
Dim coeffs(p + 1) As Frac
For i = 1 To p + 1
coeffs(i - 1) = Frac.ZERO
Next
Dim q As New Frac(1, p + 1)
Dim sign = -1
For j = 0 To p
sign *= -1
coeffs(p - j) = q * New Frac(sign, 1) * New Frac(Binomial(p + 1, j), 1) * Bernoulli(j)
Next
Return coeffs
End Function
Sub Main()
For i = 1 To 10
Dim coeffs = FaulhaberTriangle(i - 1)
For Each coeff In coeffs
Console.Write("{0,5} ", coeff)
Next
Console.WriteLine()
Next
End Sub
End Module
|
from itertools import accumulate, chain, count, islice
from fractions import Fraction
def faulhaberTriangle(m):
def go(rs, n):
def f(x, y):
return Fraction(n, x) * y
xs = list(map(f, islice(count(2), m), rs))
return [Fraction(1 - sum(xs), 1)] + xs
return list(accumulate(
[[]] + list(islice(count(0), 1 + m)),
go
))[1:]
def faulhaberSum(p, n):
def go(x, y):
return y * (n ** x)
return sum(
map(go, count(1), faulhaberTriangle(p)[-1])
)
def main():
fs = faulhaberTriangle(9)
print(
fTable(__doc__ + ':\n')(str)(
compose(concat)(
fmap(showRatio(3)(3))
)
)(
index(fs)
)(range(0, len(fs)))
)
print('')
print(
faulhaberSum(17, 1000)
)
def fTable(s):
def gox(xShow):
def gofx(fxShow):
def gof(f):
def goxs(xs):
ys = [xShow(x) for x in xs]
w = max(map(len, ys))
def arrowed(x, y):
return y.rjust(w, ' ') + ' -> ' + (
fxShow(f(x))
)
return s + '\n' + '\n'.join(
map(arrowed, xs, ys)
)
return goxs
return gof
return gofx
return gox
def compose(g):
return lambda f: lambda x: g(f(x))
def concat(xs):
def f(ys):
zs = list(chain(*ys))
return ''.join(zs) if isinstance(ys[0], str) else zs
return (
f(xs) if isinstance(xs, list) else (
chain.from_iterable(xs)
)
) if xs else []
def fmap(f):
def go(xs):
return list(map(f, xs))
return go
def index(xs):
return lambda n: None if 0 > n else (
xs[n] if (
hasattr(xs, "__getitem__")
) else next(islice(xs, n, None))
)
def showRatio(m):
def go(n):
def f(r):
d = r.denominator
return str(r.numerator).rjust(m, ' ') + (
('/' + str(d).ljust(n, ' ')) if 1 != d else (
' ' * (1 + n)
)
)
return f
return go
if __name__ == '__main__':
main()
|
Maintain the same structure and functionality when rewriting this code in Python. | Function Run(args() as String) As Integer
For each arg As String In args
Stdout.WriteLine(arg)
Next
End Function
| import sys
program_name = sys.argv[0]
arguments = sys.argv[1:]
count = len(arguments)
|
Convert this VB snippet to Python and keep its semantics consistent. | Function Run(args() as String) As Integer
For each arg As String In args
Stdout.WriteLine(arg)
Next
End Function
| import sys
program_name = sys.argv[0]
arguments = sys.argv[1:]
count = len(arguments)
|
Rewrite this program in Python while keeping its functionality equivalent to the VB version. | Const wheel="ndeokgelw"
Sub print(s):
On Error Resume Next
WScript.stdout.WriteLine (s)
If err= &h80070006& Then WScript.Echo " Please run this script with CScript": WScript.quit
End Sub
Dim oDic
Set oDic = WScript.CreateObject("scripting.dictionary")
Dim cnt(127)
Dim fso
Set fso = WScript.CreateObject("Scripting.Filesystemobject")
Set ff=fso.OpenTextFile("unixdict.txt")
i=0
print "reading words of 3 or more letters"
While Not ff.AtEndOfStream
x=LCase(ff.ReadLine)
If Len(x)>=3 Then
If Not odic.exists(x) Then oDic.Add x,0
End If
Wend
print "remaining words: "& oDic.Count & vbcrlf
ff.Close
Set ff=Nothing
Set fso=Nothing
Set re=New RegExp
print "removing words with chars not in the wheel"
re.pattern="[^"& wheel &"]"
For Each w In oDic.Keys
If re.test(w) Then oDic.remove(w)
Next
print "remaining words: "& oDic.Count & vbcrlf
print "ensuring the mandatory letter "& Mid(wheel,5,1) & " is present"
re.Pattern=Mid(wheel,5,1)
For Each w In oDic.Keys
If Not re.test(w) Then oDic.remove(w)
Next
print "remaining words: "& oDic.Count & vbcrlf
print "checking number of chars"
Dim nDic
Set nDic = WScript.CreateObject("scripting.dictionary")
For i=1 To Len(wheel)
x=Mid(wheel,i,1)
If nDic.Exists(x) Then
a=nDic(x)
nDic(x)=Array(a(0)+1,0)
Else
nDic.add x,Array(1,0)
End If
Next
For Each w In oDic.Keys
For Each c In nDic.Keys
ndic(c)=Array(nDic(c)(0),0)
Next
For ii = 1 To len(w)
c=Mid(w,ii,1)
a=nDic(c)
If (a(0)=a(1)) Then
oDic.Remove(w):Exit For
End If
nDic(c)=Array(a(0),a(1)+1)
Next
Next
print "Remaining words "& oDic.count
For Each w In oDic.Keys
print w
Next
| import urllib.request
from collections import Counter
GRID =
def getwords(url='http://wiki.puzzlers.org/pub/wordlists/unixdict.txt'):
"Return lowercased words of 3 to 9 characters"
words = urllib.request.urlopen(url).read().decode().strip().lower().split()
return (w for w in words if 2 < len(w) < 10)
def solve(grid, dictionary):
gridcount = Counter(grid)
mid = grid[4]
return [word for word in dictionary
if mid in word and not (Counter(word) - gridcount)]
if __name__ == '__main__':
chars = ''.join(GRID.strip().lower().split())
found = solve(chars, dictionary=getwords())
print('\n'.join(found))
|
Ensure the translated Python code behaves exactly like the original VB snippet. | DEFINT A(1 to 4) = {1, 2, 3, 4}
DEFINT B(1 to 4) = {10, 20, 30, 40}
Redim A(1 to 8) as integer
MEMCPY(varptr(A(5)), varptr(B(1)), Sizeof(integer)*4)
| arr1 = [1, 2, 3]
arr2 = [4, 5, 6]
arr3 = [7, 8, 9]
arr4 = arr1 + arr2
assert arr4 == [1, 2, 3, 4, 5, 6]
arr4.extend(arr3)
assert arr4 == [1, 2, 3, 4, 5, 6, 7, 8, 9]
|
Generate an equivalent Python version of this VB code. | Public Sub text()
Debug.Print InputBox("Input a string")
Debug.Print InputBox("Input the integer 75000", "Input an integer", 75000, Context = "Long")
End Sub
| string = raw_input("Input a string: ")
|
Keep all operations the same but rewrite the snippet in Python. | Public Sub text()
Debug.Print InputBox("Input a string")
Debug.Print InputBox("Input the integer 75000", "Input an integer", 75000, Context = "Long")
End Sub
| string = raw_input("Input a string: ")
|
Produce a language-to-language conversion: from VB to Python, same semantics. | Option Explicit
Declare Function Beep Lib "kernel32" (ByVal Freq As Long, ByVal Dur As Long) As Long
Sub Musical_Scale()
Dim Fqs, i As Integer
Fqs = Array(264, 297, 330, 352, 396, 440, 495, 528)
For i = LBound(Fqs) To UBound(Fqs)
Beep Fqs(i), 500
Next
End Sub
| >>> import winsound
>>> for note in [261.63, 293.66, 329.63, 349.23, 392.00, 440.00, 493.88, 523.25]:
winsound.Beep(int(note+.5), 500)
>>>
|
Translate this program into Python but keep the logic exactly as in VB. | Option Explicit
Declare Function Beep Lib "kernel32" (ByVal Freq As Long, ByVal Dur As Long) As Long
Sub Musical_Scale()
Dim Fqs, i As Integer
Fqs = Array(264, 297, 330, 352, 396, 440, 495, 528)
For i = LBound(Fqs) To UBound(Fqs)
Beep Fqs(i), 500
Next
End Sub
| >>> import winsound
>>> for note in [261.63, 293.66, 329.63, 349.23, 392.00, 440.00, 493.88, 523.25]:
winsound.Beep(int(note+.5), 500)
>>>
|
Rewrite this program in Python while keeping its functionality equivalent to the VB version. |
Option Explicit
Const maxWeight = 400
Dim DataList As Variant
Dim xList(64, 3) As Variant
Dim nItems As Integer
Dim s As String, xss As String
Dim xwei As Integer, xval As Integer, nn As Integer
Sub Main()
Dim i As Integer, j As Integer
DataList = Array("map", 9, 150, "compass", 13, 35, "water", 153, 200, "sandwich", 50, 160, _
"glucose", 15, 60, "tin", 68, 45, "banana", 27, 60, "apple", 39, 40, _
"cheese", 23, 30, "beer", 52, 10, "suntan cream", 11, 70, "camera", 32, 30, _
"T-shirt", 24, 15, "trousers", 48, 10, "umbrella", 73, 40, "book", 30, 10, _
"waterproof trousers", 42, 70, "waterproof overclothes", 43, 75, _
"note-case", 22, 80, "sunglasses", 7, 20, "towel", 18, 12, "socks", 4, 50)
nItems = (UBound(DataList) + 1) / 3
j = 0
For i = 1 To nItems
xList(i, 1) = DataList(j)
xList(i, 2) = DataList(j + 1)
xList(i, 3) = DataList(j + 2)
j = j + 3
Next i
s = ""
For i = 1 To nItems
s = s & Chr(i)
Next
nn = 0
Call ChoiceBin(1, "")
For i = 1 To Len(xss)
j = Asc(Mid(xss, i, 1))
Debug.Print xList(j, 1)
Next i
Debug.Print "count=" & Len(xss), "weight=" & xwei, "value=" & xval
End Sub
Private Sub ChoiceBin(n As String, ss As String)
Dim r As String
Dim i As Integer, j As Integer, iwei As Integer, ival As Integer
Dim ipct As Integer
If n = Len(s) + 1 Then
iwei = 0: ival = 0
For i = 1 To Len(ss)
j = Asc(Mid(ss, i, 1))
iwei = iwei + xList(j, 2)
ival = ival + xList(j, 3)
Next
If iwei <= maxWeight And ival > xval Then
xss = ss: xwei = iwei: xval = ival
End If
Else
r = Mid(s, n, 1)
Call ChoiceBin(n + 1, ss & r)
Call ChoiceBin(n + 1, ss)
End If
End Sub
| from itertools import combinations
def anycomb(items):
' return combinations of any length from the items '
return ( comb
for r in range(1, len(items)+1)
for comb in combinations(items, r)
)
def totalvalue(comb):
' Totalise a particular combination of items'
totwt = totval = 0
for item, wt, val in comb:
totwt += wt
totval += val
return (totval, -totwt) if totwt <= 400 else (0, 0)
items = (
("map", 9, 150), ("compass", 13, 35), ("water", 153, 200), ("sandwich", 50, 160),
("glucose", 15, 60), ("tin", 68, 45), ("banana", 27, 60), ("apple", 39, 40),
("cheese", 23, 30), ("beer", 52, 10), ("suntan cream", 11, 70), ("camera", 32, 30),
("t-shirt", 24, 15), ("trousers", 48, 10), ("umbrella", 73, 40),
("waterproof trousers", 42, 70), ("waterproof overclothes", 43, 75),
("note-case", 22, 80), ("sunglasses", 7, 20), ("towel", 18, 12),
("socks", 4, 50), ("book", 30, 10),
)
bagged = max( anycomb(items), key=totalvalue)
print("Bagged the following items\n " +
'\n '.join(sorted(item for item,_,_ in bagged)))
val, wt = totalvalue(bagged)
print("for a total value of %i and a total weight of %i" % (val, -wt))
|
Ensure the translated Python code behaves exactly like the original VB snippet. | Imports System.Math
Module Module1
Const MAXPRIME = 99
Const MAXPARENT = 99
Const NBRCHILDREN = 547100
Public Primes As New Collection()
Public PrimesR As New Collection()
Public Ancestors As New Collection()
Public Parents(MAXPARENT + 1) As Integer
Public CptDescendants(MAXPARENT + 1) As Integer
Public Children(NBRCHILDREN) As ChildStruct
Public iChildren As Integer
Public Delimiter As String = ", "
Public Structure ChildStruct
Public Child As Long
Public pLower As Integer
Public pHigher As Integer
End Structure
Sub Main()
Dim Parent As Short
Dim Sum As Short
Dim i As Short
Dim TotDesc As Integer = 0
Dim MidPrime As Integer
If GetPrimes(Primes, MAXPRIME) = vbFalse Then
Return
End If
For i = Primes.Count To 1 Step -1
PrimesR.Add(Primes.Item(i))
Next
MidPrime = PrimesR.Item(1) / 2
For Each Prime In PrimesR
Parents(Prime) = InsertChild(Parents(Prime), Prime)
CptDescendants(Prime) += 1
If Prime > MidPrime Then
Continue For
End If
For Parent = 1 To MAXPARENT
Sum = Parent + Prime
If Sum > MAXPARENT Then
Exit For
End If
If Parents(Parent) Then
InsertPreorder(Parents(Parent), Sum, Prime)
CptDescendants(Sum) += CptDescendants(Parent)
End If
Next
Next
RemoveFalseChildren()
If MAXPARENT > MAXPRIME Then
If GetPrimes(Primes, MAXPARENT) = vbFalse Then
Return
End If
End If
FileOpen(1, "Ancestors.txt", OpenMode.Output)
For Parent = 1 To MAXPARENT
GetAncestors(Parent)
PrintLine(1, "[" & Parent.ToString & "] Level: " & Ancestors.Count.ToString)
If Ancestors.Count Then
Print(1, "Ancestors: " & Ancestors.Item(1).ToString)
For i = 2 To Ancestors.Count
Print(1, ", " & Ancestors.Item(i).ToString)
Next
PrintLine(1)
Ancestors.Clear()
Else
PrintLine(1, "Ancestors: None")
End If
If CptDescendants(Parent) Then
PrintLine(1, "Descendants: " & CptDescendants(Parent).ToString)
Delimiter = ""
PrintDescendants(Parents(Parent))
PrintLine(1)
TotDesc += CptDescendants(Parent)
Else
PrintLine(1, "Descendants: None")
End If
PrintLine(1)
Next
Primes.Clear()
PrimesR.Clear()
PrintLine(1, "Total descendants " & TotDesc.ToString)
PrintLine(1)
FileClose(1)
End Sub
Function InsertPreorder(_index As Integer, _sum As Short, _prime As Short)
Parents(_sum) = InsertChild(Parents(_sum), Children(_index).Child * _prime)
If Children(_index).pLower Then
InsertPreorder(Children(_index).pLower, _sum, _prime)
End If
If Children(_index).pHigher Then
InsertPreorder(Children(_index).pHigher, _sum, _prime)
End If
Return Nothing
End Function
Function InsertChild(_index As Integer, _child As Long) As Integer
If _index Then
If _child <= Children(_index).Child Then
Children(_index).pLower = InsertChild(Children(_index).pLower, _child)
Else
Children(_index).pHigher = InsertChild(Children(_index).pHigher, _child)
End If
Else
iChildren += 1
_index = iChildren
Children(_index).Child = _child
Children(_index).pLower = 0
Children(_index).pHigher = 0
End If
Return _index
End Function
Function RemoveFalseChildren()
Dim Exclusions As New Collection
Exclusions.Add(4)
For Each Prime In Primes
Exclusions.Add(Prime)
Next
For Each ex In Exclusions
Parents(ex) = Children(Parents(ex)).pHigher
CptDescendants(ex) -= 1
Next
Exclusions.Clear()
Return Nothing
End Function
Function GetAncestors(_child As Short)
Dim Child As Short = _child
Dim Parent As Short = 0
For Each Prime In Primes
If Child = 1 Then
Exit For
End If
While Child Mod Prime = 0
Child /= Prime
Parent += Prime
End While
Next
If Parent = _child Or _child = 1 Then
Return Nothing
End If
GetAncestors(Parent)
Ancestors.Add(Parent)
Return Nothing
End Function
Function PrintDescendants(_index As Integer)
If Children(_index).pLower Then
PrintDescendants(Children(_index).pLower)
End If
Print(1, Delimiter.ToString & Children(_index).Child.ToString)
Delimiter = ", "
If Children(_index).pHigher Then
PrintDescendants(Children(_index).pHigher)
End If
Return Nothing
End Function
Function GetPrimes(ByRef _primes As Object, Optional _maxPrime As Integer = 2) As Boolean
Dim Value As Integer = 3
Dim Max As Integer
Dim Prime As Integer
If _maxPrime < 2 Then
Return vbFalse
End If
_primes.Add(2)
While Value <= _maxPrime
Max = Floor(Sqrt(Value))
For Each Prime In _primes
If Prime > Max Then
_primes.Add(Value)
Exit For
End If
If Value Mod Prime = 0 Then
Exit For
End If
Next
Value += 2
End While
Return vbTrue
End Function
End Module
| from __future__ import print_function
from itertools import takewhile
maxsum = 99
def get_primes(max):
if max < 2:
return []
lprimes = [2]
for x in range(3, max + 1, 2):
for p in lprimes:
if x % p == 0:
break
else:
lprimes.append(x)
return lprimes
descendants = [[] for _ in range(maxsum + 1)]
ancestors = [[] for _ in range(maxsum + 1)]
primes = get_primes(maxsum)
for p in primes:
descendants[p].append(p)
for s in range(1, len(descendants) - p):
descendants[s + p] += [p * pr for pr in descendants[s]]
for p in primes + [4]:
descendants[p].pop()
total = 0
for s in range(1, maxsum + 1):
descendants[s].sort()
for d in takewhile(lambda x: x <= maxsum, descendants[s]):
ancestors[d] = ancestors[s] + [s]
print([s], "Level:", len(ancestors[s]))
print("Ancestors:", ancestors[s] if len(ancestors[s]) else "None")
print("Descendants:", len(descendants[s]) if len(descendants[s]) else "None")
if len(descendants[s]):
print(descendants[s])
print()
total += len(descendants[s])
print("Total descendants", total)
|
Transform the following VB implementation into Python, maintaining the same output and logic. | Imports System.Runtime.CompilerServices
Module Module1
<Extension()>
Function CartesianProduct(Of T)(sequences As IEnumerable(Of IEnumerable(Of T))) As IEnumerable(Of IEnumerable(Of T))
Dim emptyProduct As IEnumerable(Of IEnumerable(Of T)) = {Enumerable.Empty(Of T)}
Return sequences.Aggregate(emptyProduct, Function(accumulator, sequence) From acc In accumulator From item In sequence Select acc.Concat({item}))
End Function
Sub Main()
Dim empty(-1) As Integer
Dim list1 = {1, 2}
Dim list2 = {3, 4}
Dim list3 = {1776, 1789}
Dim list4 = {7, 12}
Dim list5 = {4, 14, 23}
Dim list6 = {0, 1}
Dim list7 = {1, 2, 3}
Dim list8 = {30}
Dim list9 = {500, 100}
For Each sequnceList As Integer()() In {
({list1, list2}),
({list2, list1}),
({list1, empty}),
({empty, list1}),
({list3, list4, list5, list6}),
({list7, list8, list9}),
({list7, empty, list9})
}
Dim cart = sequnceList.CartesianProduct().Select(Function(tuple) $"({String.Join(", ", tuple)})")
Console.WriteLine($"{{{String.Join(", ", cart)}}}")
Next
End Sub
End Module
| import itertools
def cp(lsts):
return list(itertools.product(*lsts))
if __name__ == '__main__':
from pprint import pprint as pp
for lists in [[[1,2],[3,4]], [[3,4],[1,2]], [[], [1, 2]], [[1, 2], []],
((1776, 1789), (7, 12), (4, 14, 23), (0, 1)),
((1, 2, 3), (30,), (500, 100)),
((1, 2, 3), (), (500, 100))]:
print(lists, '=>')
pp(cp(lists), indent=2)
|
Generate an equivalent Python version of this VB code. | Imports System.Runtime.CompilerServices
Module Module1
<Extension()>
Function CartesianProduct(Of T)(sequences As IEnumerable(Of IEnumerable(Of T))) As IEnumerable(Of IEnumerable(Of T))
Dim emptyProduct As IEnumerable(Of IEnumerable(Of T)) = {Enumerable.Empty(Of T)}
Return sequences.Aggregate(emptyProduct, Function(accumulator, sequence) From acc In accumulator From item In sequence Select acc.Concat({item}))
End Function
Sub Main()
Dim empty(-1) As Integer
Dim list1 = {1, 2}
Dim list2 = {3, 4}
Dim list3 = {1776, 1789}
Dim list4 = {7, 12}
Dim list5 = {4, 14, 23}
Dim list6 = {0, 1}
Dim list7 = {1, 2, 3}
Dim list8 = {30}
Dim list9 = {500, 100}
For Each sequnceList As Integer()() In {
({list1, list2}),
({list2, list1}),
({list1, empty}),
({empty, list1}),
({list3, list4, list5, list6}),
({list7, list8, list9}),
({list7, empty, list9})
}
Dim cart = sequnceList.CartesianProduct().Select(Function(tuple) $"({String.Join(", ", tuple)})")
Console.WriteLine($"{{{String.Join(", ", cart)}}}")
Next
End Sub
End Module
| import itertools
def cp(lsts):
return list(itertools.product(*lsts))
if __name__ == '__main__':
from pprint import pprint as pp
for lists in [[[1,2],[3,4]], [[3,4],[1,2]], [[], [1, 2]], [[1, 2], []],
((1776, 1789), (7, 12), (4, 14, 23), (0, 1)),
((1, 2, 3), (30,), (500, 100)),
((1, 2, 3), (), (500, 100))]:
print(lists, '=>')
pp(cp(lists), indent=2)
|
Produce a language-to-language conversion: from VB to Python, same semantics. | dim _proper_divisors(100)
sub proper_divisors(n)
dim i
dim _proper_divisors_count = 0
if n <> 1 then
for i = 1 to (n \ 2)
if n %% i = 0 then
_proper_divisors_count = _proper_divisors_count + 1
_proper_divisors(_proper_divisors_count) = i
end if
next
end if
return _proper_divisors_count
end sub
sub show_proper_divisors(n, tabbed)
dim cnt = proper_divisors(n)
print str$(n) + ":"; tab(4);"(" + str$(cnt) + " items) ";
dim j
for j = 1 to cnt
if tabbed then
print str$(_proper_divisors(j)),
else
print str$(_proper_divisors(j));
end if
if (j < cnt) then print ",";
next
print
end sub
dim i
for i = 1 to 10
show_proper_divisors(i, false)
next
dim c
dim maxindex = 0
dim maxlength = 0
for t = 1 to 20000
c = proper_divisors(t)
if c > maxlength then
maxindex = t
maxlength = c
end if
next
print "A maximum at ";
show_proper_divisors(maxindex, false)
| >>> def proper_divs2(n):
... return {x for x in range(1, (n + 1) // 2 + 1) if n % x == 0 and n != x}
...
>>> [proper_divs2(n) for n in range(1, 11)]
[set(), {1}, {1}, {1, 2}, {1}, {1, 2, 3}, {1}, {1, 2, 4}, {1, 3}, {1, 2, 5}]
>>>
>>> n, length = max(((n, len(proper_divs2(n))) for n in range(1, 20001)), key=lambda pd: pd[1])
>>> n
15120
>>> length
79
>>>
|
Write a version of this VB function in Python with identical behavior. | Module XMLOutput
Sub Main()
Dim charRemarks As New Dictionary(Of String, String)
charRemarks.Add("April", "Bubbly: I
charRemarks.Add("Tam O
charRemarks.Add("Emily", "Short & shrift")
Dim xml = <CharacterRemarks>
<%= From cr In charRemarks Select <Character name=<%= cr.Key %>><%= cr.Value %></Character> %>
</CharacterRemarks>
Console.WriteLine(xml)
End Sub
End Module
| >>> from xml.etree import ElementTree as ET
>>> from itertools import izip
>>> def characterstoxml(names, remarks):
root = ET.Element("CharacterRemarks")
for name, remark in izip(names, remarks):
c = ET.SubElement(root, "Character", {'name': name})
c.text = remark
return ET.tostring(root)
>>> print characterstoxml(
names = ["April", "Tam O'Shanter", "Emily"],
remarks = [ "Bubbly: I'm > Tam and <= Emily",
'Burns: "When chapman billies leave the street ..."',
'Short & shrift' ] ).replace('><','>\n<')
|
Write a version of this VB function in Python with identical behavior. | Private Sub plot_coordinate_pairs(x As Variant, y As Variant)
Dim chrt As Chart
Set chrt = ActiveSheet.Shapes.AddChart.Chart
With chrt
.ChartType = xlLine
.HasLegend = False
.HasTitle = True
.ChartTitle.Text = "Time"
.SeriesCollection.NewSeries
.SeriesCollection.Item(1).XValues = x
.SeriesCollection.Item(1).Values = y
.Axes(xlValue, xlPrimary).HasTitle = True
.Axes(xlValue, xlPrimary).AxisTitle.Characters.Text = "microseconds"
End With
End Sub
Public Sub main()
x = [{0, 1, 2, 3, 4, 5, 6, 7, 8, 9}]
y = [{2.7, 2.8, 31.4, 38.1, 58.0, 76.2, 100.5, 130.0, 149.3, 180.0}]
plot_coordinate_pairs x, y
End Sub
| >>> x = [0, 1, 2, 3, 4, 5, 6, 7, 8, 9]
>>> y = [2.7, 2.8, 31.4, 38.1, 58.0, 76.2, 100.5, 130.0, 149.3, 180.0]
>>> import pylab
>>> pylab.plot(x, y, 'bo')
>>> pylab.savefig('qsort-range-10-9.png')
|
Rewrite this program in Python while keeping its functionality equivalent to the VB version. | Private Sub plot_coordinate_pairs(x As Variant, y As Variant)
Dim chrt As Chart
Set chrt = ActiveSheet.Shapes.AddChart.Chart
With chrt
.ChartType = xlLine
.HasLegend = False
.HasTitle = True
.ChartTitle.Text = "Time"
.SeriesCollection.NewSeries
.SeriesCollection.Item(1).XValues = x
.SeriesCollection.Item(1).Values = y
.Axes(xlValue, xlPrimary).HasTitle = True
.Axes(xlValue, xlPrimary).AxisTitle.Characters.Text = "microseconds"
End With
End Sub
Public Sub main()
x = [{0, 1, 2, 3, 4, 5, 6, 7, 8, 9}]
y = [{2.7, 2.8, 31.4, 38.1, 58.0, 76.2, 100.5, 130.0, 149.3, 180.0}]
plot_coordinate_pairs x, y
End Sub
| >>> x = [0, 1, 2, 3, 4, 5, 6, 7, 8, 9]
>>> y = [2.7, 2.8, 31.4, 38.1, 58.0, 76.2, 100.5, 130.0, 149.3, 180.0]
>>> import pylab
>>> pylab.plot(x, y, 'bo')
>>> pylab.savefig('qsort-range-10-9.png')
|
Transform the following VB implementation into Python, maintaining the same output and logic. | text = "I need more coffee!!!"
Set regex = New RegExp
regex.Global = True
regex.Pattern = "\s"
If regex.Test(text) Then
WScript.StdOut.Write regex.Replace(text,vbCrLf)
Else
WScript.StdOut.Write "No matching pattern"
End If
| import re
string = "This is a string"
if re.search('string$', string):
print("Ends with string.")
string = re.sub(" a ", " another ", string)
print(string)
|
Please provide an equivalent version of this VB code in Python. | Set dict = CreateObject("Scripting.Dictionary")
os = Array("Windows", "Linux", "MacOS")
owner = Array("Microsoft", "Linus Torvalds", "Apple")
For n = 0 To 2
dict.Add os(n), owner(n)
Next
MsgBox dict.Item("Linux")
MsgBox dict.Item("MacOS")
MsgBox dict.Item("Windows")
| keys = ['a', 'b', 'c']
values = [1, 2, 3]
hash = {key: value for key, value in zip(keys, values)}
|
Change the programming language of this snippet from VB to Python without modifying what it does. | Public Class Main
Inherits System.Windows.Forms.Form
Public Sub New()
Me.FormBorderStyle = FormBorderStyle.None
Me.WindowState = FormWindowState.Maximized
End Sub
Private Sub Main_Load(sender As Object, e As EventArgs) Handles Me.Load
Dim Index As Integer
Dim Colors() As Color = {Color.Black, Color.Red, Color.Green, Color.Magenta, Color.Cyan, Color.Yellow, Color.White}
Dim Height = (Me.ClientSize.Height / 4) + 1
For y = 1 To 4
Dim Top = Me.ClientSize.Height / 4 * (y - 1)
For x = 0 To Me.ClientSize.Width Step y
If Index = 6 Then Index = 0 Else Index += 1
Me.Controls.Add(New Panel With {.Top = Top, .Height = Height, .Left = x, .Width = y, .BackColor = Colors(Index)})
Next
Next
End Sub
End Class
| from turtle import *
colors = ["black", "red", "green", "blue", "magenta", "cyan", "yellow", "white"]
screen = getscreen()
left_edge = -screen.window_width()//2
right_edge = screen.window_width()//2
quarter_height = screen.window_height()//4
half_height = quarter_height * 2
speed("fastest")
for quarter in range(4):
pensize(quarter+1)
colornum = 0
min_y = half_height - ((quarter + 1) * quarter_height)
max_y = half_height - ((quarter) * quarter_height)
for x in range(left_edge,right_edge,quarter+1):
penup()
pencolor(colors[colornum])
colornum = (colornum + 1) % len(colors)
setposition(x,min_y)
pendown()
setposition(x,max_y)
notused = input("Hit enter to continue: ")
|
Can you help me rewrite this code in Python instead of VB, keeping it the same logically? |
Function cocktailShakerSort(ByVal A As Variant) As Variant
beginIdx = LBound(A)
endIdx = UBound(A) - 1
Do While beginIdx <= endIdx
newBeginIdx = endIdx
newEndIdx = beginIdx
For ii = beginIdx To endIdx
If A(ii) > A(ii + 1) Then
tmp = A(ii): A(ii) = A(ii + 1): A(ii + 1) = tmp
newEndIdx = ii
End If
Next ii
endIdx = newEndIdx - 1
For ii = endIdx To beginIdx Step -1
If A(ii) > A(ii + 1) Then
tmp = A(ii): A(ii) = A(ii + 1): A(ii + 1) = tmp
newBeginIdx = ii
End If
Next ii
beginIdx = newBeginIdx + 1
Loop
cocktailShakerSort = A
End Function
Public Sub main()
Dim B(20) As Variant
For i = LBound(B) To UBound(B)
B(i) = Int(Rnd() * 100)
Next i
Debug.Print Join(B, ", ")
Debug.Print Join(cocktailShakerSort(B), ", ")
End Sub
|
def cocktailshiftingbounds(A):
beginIdx = 0
endIdx = len(A) - 1
while beginIdx <= endIdx:
newBeginIdx = endIdx
newEndIdx = beginIdx
for ii in range(beginIdx,endIdx):
if A[ii] > A[ii + 1]:
A[ii+1], A[ii] = A[ii], A[ii+1]
newEndIdx = ii
endIdx = newEndIdx
for ii in range(endIdx,beginIdx-1,-1):
if A[ii] > A[ii + 1]:
A[ii+1], A[ii] = A[ii], A[ii+1]
newBeginIdx = ii
beginIdx = newBeginIdx + 1
test1 = [7, 6, 5, 9, 8, 4, 3, 1, 2, 0]
cocktailshiftingbounds(test1)
print(test1)
test2=list('big fjords vex quick waltz nymph')
cocktailshiftingbounds(test2)
print(''.join(test2))
|
Maintain the same structure and functionality when rewriting this code in Python. | option explicit
const dt = 0.15
const length=23
dim ans0:ans0=chr(27)&"["
dim Veloc,Accel,angle,olr,olc,r,c
const r0=1
const c0=40
cls
angle=0.7
while 1
wscript.sleep(50)
Accel = -.9 * sin(Angle)
Veloc = Veloc + Accel * dt
Angle = Angle + Veloc * dt
r = r0 + int(cos(Angle) * Length)
c = c0+ int(2*sin(Angle) * Length)
cls
draw_line r,c,r0,c0
toxy r,c,"O"
olr=r :olc=c
wend
sub cls() wscript.StdOut.Write ans0 &"2J"&ans0 &"?25l":end sub
sub toxy(r,c,s) wscript.StdOut.Write ans0 & r & ";" & c & "f" & s :end sub
Sub draw_line(r1,c1, r2,c2)
Dim x,y,xf,yf,dx,dy,sx,sy,err,err2
x =r1 : y =c1
xf=r2 : yf=c2
dx=Abs(xf-x) : dy=Abs(yf-y)
If x<xf Then sx=+1: Else sx=-1
If y<yf Then sy=+1: Else sy=-1
err=dx-dy
Do
toxy x,y,"."
If x=xf And y=yf Then Exit Do
err2=err+err
If err2>-dy Then err=err-dy: x=x+sx
If err2< dx Then err=err+dx: y=y+sy
Loop
End Sub
| import pygame, sys
from pygame.locals import *
from math import sin, cos, radians
pygame.init()
WINDOWSIZE = 250
TIMETICK = 100
BOBSIZE = 15
window = pygame.display.set_mode((WINDOWSIZE, WINDOWSIZE))
pygame.display.set_caption("Pendulum")
screen = pygame.display.get_surface()
screen.fill((255,255,255))
PIVOT = (WINDOWSIZE/2, WINDOWSIZE/10)
SWINGLENGTH = PIVOT[1]*4
class BobMass(pygame.sprite.Sprite):
def __init__(self):
pygame.sprite.Sprite.__init__(self)
self.theta = 45
self.dtheta = 0
self.rect = pygame.Rect(PIVOT[0]-SWINGLENGTH*cos(radians(self.theta)),
PIVOT[1]+SWINGLENGTH*sin(radians(self.theta)),
1,1)
self.draw()
def recomputeAngle(self):
scaling = 3000.0/(SWINGLENGTH**2)
firstDDtheta = -sin(radians(self.theta))*scaling
midDtheta = self.dtheta + firstDDtheta
midtheta = self.theta + (self.dtheta + midDtheta)/2.0
midDDtheta = -sin(radians(midtheta))*scaling
midDtheta = self.dtheta + (firstDDtheta + midDDtheta)/2
midtheta = self.theta + (self.dtheta + midDtheta)/2
midDDtheta = -sin(radians(midtheta)) * scaling
lastDtheta = midDtheta + midDDtheta
lasttheta = midtheta + (midDtheta + lastDtheta)/2.0
lastDDtheta = -sin(radians(lasttheta)) * scaling
lastDtheta = midDtheta + (midDDtheta + lastDDtheta)/2.0
lasttheta = midtheta + (midDtheta + lastDtheta)/2.0
self.dtheta = lastDtheta
self.theta = lasttheta
self.rect = pygame.Rect(PIVOT[0]-
SWINGLENGTH*sin(radians(self.theta)),
PIVOT[1]+
SWINGLENGTH*cos(radians(self.theta)),1,1)
def draw(self):
pygame.draw.circle(screen, (0,0,0), PIVOT, 5, 0)
pygame.draw.circle(screen, (0,0,0), self.rect.center, BOBSIZE, 0)
pygame.draw.aaline(screen, (0,0,0), PIVOT, self.rect.center)
pygame.draw.line(screen, (0,0,0), (0, PIVOT[1]), (WINDOWSIZE, PIVOT[1]))
def update(self):
self.recomputeAngle()
screen.fill((255,255,255))
self.draw()
bob = BobMass()
TICK = USEREVENT + 2
pygame.time.set_timer(TICK, TIMETICK)
def input(events):
for event in events:
if event.type == QUIT:
sys.exit(0)
elif event.type == TICK:
bob.update()
while True:
input(pygame.event.get())
pygame.display.flip()
|
Convert this VB snippet to Python and keep its semantics consistent. | Function Encoder(ByVal n)
Encoder = n Xor (n \ 2)
End Function
Function Decoder(ByVal n)
Dim g : g = 0
Do While n > 0
g = g Xor n
n = n \ 2
Loop
Decoder = g
End Function
Function Dec2bin(ByVal n, ByVal length)
Dim i, strbin : strbin = ""
For i = 1 to 5
strbin = (n Mod 2) & strbin
n = n \ 2
Next
Dec2Bin = strbin
End Function
WScript.StdOut.WriteLine("Binary -> Gray Code -> Binary")
For i = 0 to 31
encoded = Encoder(i)
decoded = Decoder(encoded)
WScript.StdOut.WriteLine(Dec2Bin(i, 5) & " -> " & Dec2Bin(encoded, 5) & " -> " & Dec2Bin(decoded, 5))
Next
| >>> def int2bin(n):
'From positive integer to list of binary bits, msb at index 0'
if n:
bits = []
while n:
n,remainder = divmod(n, 2)
bits.insert(0, remainder)
return bits
else: return [0]
>>> def bin2int(bits):
'From binary bits, msb at index 0 to integer'
i = 0
for bit in bits:
i = i * 2 + bit
return i
|
Write the same code in Python as shown below in VB. | Function Encoder(ByVal n)
Encoder = n Xor (n \ 2)
End Function
Function Decoder(ByVal n)
Dim g : g = 0
Do While n > 0
g = g Xor n
n = n \ 2
Loop
Decoder = g
End Function
Function Dec2bin(ByVal n, ByVal length)
Dim i, strbin : strbin = ""
For i = 1 to 5
strbin = (n Mod 2) & strbin
n = n \ 2
Next
Dec2Bin = strbin
End Function
WScript.StdOut.WriteLine("Binary -> Gray Code -> Binary")
For i = 0 to 31
encoded = Encoder(i)
decoded = Decoder(encoded)
WScript.StdOut.WriteLine(Dec2Bin(i, 5) & " -> " & Dec2Bin(encoded, 5) & " -> " & Dec2Bin(decoded, 5))
Next
| >>> def int2bin(n):
'From positive integer to list of binary bits, msb at index 0'
if n:
bits = []
while n:
n,remainder = divmod(n, 2)
bits.insert(0, remainder)
return bits
else: return [0]
>>> def bin2int(bits):
'From binary bits, msb at index 0 to integer'
i = 0
for bit in bits:
i = i * 2 + bit
return i
|
Rewrite the snippet below in Python so it works the same as the original VB code. | Function Encoder(ByVal n)
Encoder = n Xor (n \ 2)
End Function
Function Decoder(ByVal n)
Dim g : g = 0
Do While n > 0
g = g Xor n
n = n \ 2
Loop
Decoder = g
End Function
Function Dec2bin(ByVal n, ByVal length)
Dim i, strbin : strbin = ""
For i = 1 to 5
strbin = (n Mod 2) & strbin
n = n \ 2
Next
Dec2Bin = strbin
End Function
WScript.StdOut.WriteLine("Binary -> Gray Code -> Binary")
For i = 0 to 31
encoded = Encoder(i)
decoded = Decoder(encoded)
WScript.StdOut.WriteLine(Dec2Bin(i, 5) & " -> " & Dec2Bin(encoded, 5) & " -> " & Dec2Bin(decoded, 5))
Next
| >>> def int2bin(n):
'From positive integer to list of binary bits, msb at index 0'
if n:
bits = []
while n:
n,remainder = divmod(n, 2)
bits.insert(0, remainder)
return bits
else: return [0]
>>> def bin2int(bits):
'From binary bits, msb at index 0 to integer'
i = 0
for bit in bits:
i = i * 2 + bit
return i
|
Rewrite the snippet below in Python so it works the same as the original VB code. | class playingcard
dim suit
dim pips
end class
class carddeck
private suitnames
private pipnames
private cardno
private deck(52)
private nTop
sub class_initialize
dim suit
dim pips
suitnames = split("H,D,C,S",",")
pipnames = split("A,2,3,4,5,6,7,8,9,10,J,Q,K",",")
cardno = 0
for suit = 1 to 4
for pips = 1 to 13
set deck(cardno) = new playingcard
deck(cardno).suit = suitnames(suit-1)
deck(cardno).pips = pipnames(pips-1)
cardno = cardno + 1
next
next
nTop = 0
end sub
public sub showdeck
dim a
redim a(51-nTop)
for i = nTop to 51
a(i) = deck(i).pips & deck(i).suit
next
wscript.echo join( a, ", ")
end sub
public sub shuffle
dim r
randomize timer
for i = nTop to 51
r = int( rnd * ( 52 - nTop ) )
if r <> i then
objswap deck(i),deck(r)
end if
next
end sub
public function deal()
set deal = deck( nTop )
nTop = nTop + 1
end function
public property get cardsRemaining
cardsRemaining = 52 - nTop
end property
private sub objswap( a, b )
dim tmp
set tmp = a
set a = b
set b = tmp
end sub
end class
| import random
class Card(object):
suits = ("Clubs","Hearts","Spades","Diamonds")
pips = ("2","3","4","5","6","7","8","9","10","Jack","Queen","King","Ace")
def __init__(self, pip,suit):
self.pip=pip
self.suit=suit
def __str__(self):
return "%s %s"%(self.pip,self.suit)
class Deck(object):
def __init__(self):
self.deck = [Card(pip,suit) for suit in Card.suits for pip in Card.pips]
def __str__(self):
return "[%s]"%", ".join( (str(card) for card in self.deck))
def shuffle(self):
random.shuffle(self.deck)
def deal(self):
self.shuffle()
return self.deck.pop(0)
|
Generate a Python translation of this VB snippet without changing its computational steps. | Option Base {0|1}
| array = []
array.append(1)
array.append(3)
array[0] = 2
print array[0]
|
Convert this VB block to Python, preserving its control flow and logic. | Option Base {0|1}
| array = []
array.append(1)
array.append(3)
array[0] = 2
print array[0]
|
Write the same code in Python as shown below in VB. | Const Order = 4
Function InCarpet(ByVal x As Integer, ByVal y As Integer)
Do While x <> 0 And y <> 0
If x Mod 3 = 1 And y Mod 3 = 1 Then
InCarpet = " "
Exit Function
End If
x = x \ 3
y = y \ 3
Loop
InCarpet = "#"
End Function
Public Sub sierpinski_carpet()
Dim i As Integer, j As Integer
For i = 0 To 3 ^ Order - 1
For j = 0 To 3 ^ Order - 1
Debug.Print InCarpet(i, j);
Next j
Debug.Print
Next i
End Sub
| def setup():
size(729, 729)
fill(0)
background(255)
noStroke()
rect(width / 3, height / 3, width / 3, width / 3)
rectangles(width / 3, height / 3, width / 3)
def rectangles(x, y, s):
if s < 1: return
xc, yc = x - s, y - s
for row in range(3):
for col in range(3):
if not (row == 1 and col == 1):
xx, yy = xc + row * s, yc + col * s
delta = s / 3
rect(xx + delta, yy + delta, delta, delta)
rectangles(xx + s / 3, yy + s / 3, s / 3)
|
Can you help me rewrite this code in Python instead of VB, keeping it the same logically? | Private Function Knuth(a As Variant) As Variant
Dim t As Variant, i As Integer
If Not IsMissing(a) Then
For i = UBound(a) To LBound(a) + 1 Step -1
j = Int((UBound(a) - LBound(a) + 1) * Rnd + LBound(a))
t = a(i)
a(i) = a(j)
a(j) = t
Next i
End If
Knuth = a
End Function
Private Function inOrder(s As Variant)
i = 2
Do While i <= UBound(s)
If s(i) < s(i - 1) Then
inOrder = False
Exit Function
End If
i = i + 1
Loop
inOrder = True
End Function
Private Function bogosort(ByVal s As Variant) As Variant
Do While Not inOrder(s)
Debug.Print Join(s, ", ")
s = Knuth(s)
Loop
bogosort = s
End Function
Public Sub main()
Debug.Print Join(bogosort(Knuth([{1,2,3,4,5,6}])), ", ")
End Sub
| import random
def bogosort(l):
while not in_order(l):
random.shuffle(l)
return l
def in_order(l):
if not l:
return True
last = l[0]
for x in l[1:]:
if x < last:
return False
last = x
return True
|
Port the following code from VB to Python with equivalent syntax and logic. | Private Sub ivp_euler(f As String, y As Double, step As Integer, end_t As Integer)
Dim t As Integer
Debug.Print " Step "; step; ": ",
Do While t <= end_t
If t Mod 10 = 0 Then Debug.Print Format(y, "0.000"),
y = y + step * Application.Run(f, y)
t = t + step
Loop
Debug.Print
End Sub
Sub analytic()
Debug.Print " Time: ",
For t = 0 To 100 Step 10
Debug.Print " "; t,
Next t
Debug.Print
Debug.Print "Analytic: ",
For t = 0 To 100 Step 10
Debug.Print Format(20 + 80 * Exp(-0.07 * t), "0.000"),
Next t
Debug.Print
End Sub
Private Function cooling(temp As Double) As Double
cooling = -0.07 * (temp - 20)
End Function
Public Sub euler_method()
Dim r_cooling As String
r_cooling = "cooling"
analytic
ivp_euler r_cooling, 100, 2, 100
ivp_euler r_cooling, 100, 5, 100
ivp_euler r_cooling, 100, 10, 100
End Sub
| def euler(f,y0,a,b,h):
t,y = a,y0
while t <= b:
print "%6.3f %6.3f" % (t,y)
t += h
y += h * f(t,y)
def newtoncooling(time, temp):
return -0.07 * (temp - 20)
euler(newtoncooling,100,0,100,10)
|
Produce a language-to-language conversion: from VB to Python, same semantics. | Sub Main()
Dim i&, c&, j#, s$
Const N& = 1000000
s = "values for n in the range 1 to 22 : "
For i = 1 To 22
s = s & ns(i) & ", "
Next
For i = 1 To N
j = Sqr(ns(i))
If j = CInt(j) Then c = c + 1
Next
Debug.Print s
Debug.Print c & " squares less than " & N
End Sub
Private Function ns(l As Long) As Long
ns = l + Int(1 / 2 + Sqr(l))
End Function
| >>> from math import floor, sqrt
>>> def non_square(n):
return n + floor(1/2 + sqrt(n))
>>>
>>> print(*map(non_square, range(1, 23)))
2 3 5 6 7 8 10 11 12 13 14 15 17 18 19 20 21 22 23 24 26 27
>>>
>>> def is_square(n):
return sqrt(n).is_integer()
>>> non_squares = map(non_square, range(1, 10 ** 6))
>>> next(filter(is_square, non_squares))
StopIteration Traceback (most recent call last)
<ipython-input-45-f32645fc1c0a> in <module>()
1 non_squares = map(non_square, range(1, 10 ** 6))
----> 2 next(filter(is_square, non_squares))
StopIteration:
|
Write a version of this VB function in Python with identical behavior. | Sub Main()
Dim i&, c&, j#, s$
Const N& = 1000000
s = "values for n in the range 1 to 22 : "
For i = 1 To 22
s = s & ns(i) & ", "
Next
For i = 1 To N
j = Sqr(ns(i))
If j = CInt(j) Then c = c + 1
Next
Debug.Print s
Debug.Print c & " squares less than " & N
End Sub
Private Function ns(l As Long) As Long
ns = l + Int(1 / 2 + Sqr(l))
End Function
| >>> from math import floor, sqrt
>>> def non_square(n):
return n + floor(1/2 + sqrt(n))
>>>
>>> print(*map(non_square, range(1, 23)))
2 3 5 6 7 8 10 11 12 13 14 15 17 18 19 20 21 22 23 24 26 27
>>>
>>> def is_square(n):
return sqrt(n).is_integer()
>>> non_squares = map(non_square, range(1, 10 ** 6))
>>> next(filter(is_square, non_squares))
StopIteration Traceback (most recent call last)
<ipython-input-45-f32645fc1c0a> in <module>()
1 non_squares = map(non_square, range(1, 10 ** 6))
----> 2 next(filter(is_square, non_squares))
StopIteration:
|
Write a version of this VB function in Python with identical behavior. | Public Sub substring()
sentence = "the last thing the man said was the"
n = 10: m = 5
Debug.Print Mid(sentence, n, 5)
Debug.Print Right(sentence, Len(sentence) - n + 1)
Debug.Print Left(sentence, Len(sentence) - 1)
k = InStr(1, sentence, "m")
Debug.Print Mid(sentence, k, 5)
k = InStr(1, sentence, "aid")
Debug.Print Mid(sentence, k, 5)
End Sub
| >>> s = 'abcdefgh'
>>> n, m, char, chars = 2, 3, 'd', 'cd'
>>>
>>> s[n-1:n+m-1]
'bcd'
>>>
>>> s[n-1:]
'bcdefgh'
>>>
>>> s[:-1]
'abcdefg'
>>>
>>> indx = s.index(char)
>>> s[indx:indx+m]
'def'
>>>
>>> indx = s.index(chars)
>>> s[indx:indx+m]
'cde'
>>>
|
Transform the following VB implementation into Python, maintaining the same output and logic. | Function JortSort(s)
JortSort = True
arrPreSort = Split(s,",")
Set arrSorted = CreateObject("System.Collections.ArrayList")
For i = 0 To UBound(arrPreSort)
arrSorted.Add(arrPreSort(i))
Next
arrSorted.Sort()
For j = 0 To UBound(arrPreSort)
If arrPreSort(j) <> arrSorted(j) Then
JortSort = False
Exit For
End If
Next
End Function
WScript.StdOut.Write JortSort("1,2,3,4,5")
WScript.StdOut.WriteLine
WScript.StdOut.Write JortSort("1,2,3,5,4")
WScript.StdOut.WriteLine
WScript.StdOut.Write JortSort("a,b,c")
WScript.StdOut.WriteLine
WScript.StdOut.Write JortSort("a,c,b")
| >>> def jortsort(sequence):
return list(sequence) == sorted(sequence)
>>> for data in [(1,2,4,3), (14,6,8), ['a', 'c'], ['s', 'u', 'x'], 'CVGH', 'PQRST']:
print(f'jortsort({repr(data)}) is {jortsort(data)}')
jortsort((1, 2, 4, 3)) is False
jortsort((14, 6, 8)) is False
jortsort(['a', 'c']) is True
jortsort(['s', 'u', 'x']) is True
jortsort('CVGH') is False
jortsort('PQRST') is True
>>>
|
Generate an equivalent Python version of this VB code. | Public Function Leap_year(year As Integer) As Boolean
Leap_year = (Month(DateSerial(year, 2, 29)) = 2)
End Function
| import calendar
calendar.isleap(year)
|
Preserve the algorithm and functionality while converting the code from VB to Python. |
dim i,j
Wscript.StdOut.WriteLine "-- Long Integer - Permutations - from 1 to 12"
for i=1 to 12
for j=1 to i
Wscript.StdOut.Write "P(" & i & "," & j & ")=" & perm(i,j) & " "
next
Wscript.StdOut.WriteLine ""
next
Wscript.StdOut.WriteLine "-- Float integer - Combinations from 10 to 60"
for i=10 to 60 step 10
for j=1 to i step i\5
Wscript.StdOut.Write "C(" & i & "," & j & ")=" & comb(i,j) & " "
next
Wscript.StdOut.WriteLine ""
next
Wscript.StdOut.WriteLine "-- Float integer - Permutations from 5000 to 15000"
for i=5000 to 15000 step 5000
for j=10 to 70 step 20
Wscript.StdOut.Write "C(" & i & "," & j & ")=" & perm(i,j) & " "
next
Wscript.StdOut.WriteLine ""
next
Wscript.StdOut.WriteLine "-- Float integer - Combinations from 200 to 1000"
for i=200 to 1000 step 200
for j=20 to 100 step 20
Wscript.StdOut.Write "P(" & i & "," & j & ")=" & comb(i,j) & " "
next
Wscript.StdOut.WriteLine ""
next
function perm(x,y)
dim i,z
z=1
for i=x-y+1 to x
z=z*i
next
perm=z
end function
function fact(x)
dim i,z
z=1
for i=2 to x
z=z*i
next
fact=z
end function
function comb(byval x,byval y)
if y>x then
comb=0
elseif x=y then
comb=1
else
if x-y<y then y=x-y
comb=perm(x,y)/fact(y)
end if
end function
| from __future__ import print_function
from scipy.misc import factorial as fact
from scipy.misc import comb
def perm(N, k, exact=0):
return comb(N, k, exact) * fact(k, exact)
exact=True
print('Sample Perms 1..12')
for N in range(1, 13):
k = max(N-2, 1)
print('%iP%i =' % (N, k), perm(N, k, exact), end=', ' if N % 5 else '\n')
print('\n\nSample Combs 10..60')
for N in range(10, 61, 10):
k = N-2
print('%iC%i =' % (N, k), comb(N, k, exact), end=', ' if N % 50 else '\n')
exact=False
print('\n\nSample Perms 5..1500 Using FP approximations')
for N in [5, 15, 150, 1500, 15000]:
k = N-2
print('%iP%i =' % (N, k), perm(N, k, exact))
print('\nSample Combs 100..1000 Using FP approximations')
for N in range(100, 1001, 100):
k = N-2
print('%iC%i =' % (N, k), comb(N, k, exact))
|
Translate this program into Python but keep the logic exactly as in VB. | Public Function sortlexicographically(N As Integer)
Dim arrList As Object
Set arrList = CreateObject("System.Collections.ArrayList")
For i = 1 To N
arrList.Add CStr(i)
Next i
arrList.Sort
Dim item As Variant
For Each item In arrList
Debug.Print item & ", ";
Next
End Function
Public Sub main()
Call sortlexicographically(13)
End Sub
| n=13
print(sorted(range(1,n+1), key=str))
|
Translate the given VB code snippet into Python without altering its behavior. | Public twenties As Variant
Public decades As Variant
Public orders As Variant
Private Sub init()
twenties = [{"zero","one","two","three","four","five","six","seven","eight","nine","ten", "eleven","twelve","thirteen","fourteen","fifteen","sixteen","seventeen","eighteen","nineteen"}]
decades = [{"twenty","thirty","forty","fifty","sixty","seventy","eighty","ninety"}]
orders = [{1E15,"quadrillion"; 1E12,"trillion"; 1E9,"billion"; 1E6,"million"; 1E3,"thousand"}]
End Sub
Private Function Twenty(N As Variant)
Twenty = twenties(N Mod 20 + 1)
End Function
Private Function Decade(N As Variant)
Decade = decades(N Mod 10 - 1)
End Function
Private Function Hundred(N As Variant)
If N < 20 Then
Hundred = Twenty(N)
Exit Function
Else
If N Mod 10 = 0 Then
Hundred = Decade((N \ 10) Mod 10)
Exit Function
End If
End If
Hundred = Decade(N \ 10) & "-" & Twenty(N Mod 10)
End Function
Private Function Thousand(N As Variant, withand As String)
If N < 100 Then
Thousand = withand & Hundred(N)
Exit Function
Else
If N Mod 100 = 0 Then
Thousand = withand & Twenty(WorksheetFunction.Floor_Precise(N / 100)) & " hundred"
Exit Function
End If
End If
Thousand = Twenty(N \ 100) & " hundred and " & Hundred(N Mod 100)
End Function
Private Function Triplet(N As Variant)
Dim Order, High As Variant, Low As Variant
Dim Name As String, res As String
For i = 1 To UBound(orders)
Order = orders(i, 1)
Name = orders(i, 2)
High = WorksheetFunction.Floor_Precise(N / Order)
Low = N - High * Order
If High <> 0 Then
res = res & Thousand(High, "") & " " & Name
End If
N = Low
If Low = 0 Then Exit For
If Len(res) And High <> 0 Then
res = res & ", "
End If
Next i
If N <> 0 Or res = "" Then
res = res & Thousand(WorksheetFunction.Floor_Precise(N), IIf(res = "", "", "and "))
N = N - Int(N)
If N > 0.000001 Then
res = res & " point"
For i = 1 To 10
n_ = WorksheetFunction.Floor_Precise(N * 10.0000001)
res = res & " " & twenties(n_ + 1)
N = N * 10 - n_
If Abs(N) < 0.000001 Then Exit For
Next i
End If
End If
Triplet = res
End Function
Private Function spell(N As Variant)
Dim res As String
If N < 0 Then
res = "minus "
N = -N
End If
res = res & Triplet(N)
spell = res
End Function
Private Function smartp(N As Variant)
Dim res As String
If N = WorksheetFunction.Floor_Precise(N) Then
smartp = CStr(N)
Exit Function
End If
res = CStr(N)
If InStr(1, res, ".") Then
res = Left(res, InStr(1, res, "."))
End If
smartp = res
End Function
Sub Main()
Dim si As Variant
init
Samples1 = [{99, 300, 310, 417, 1501, 12609, 200000000000100, 999999999999999, -123456787654321,102003000400005,1020030004,102003,102,1,0,-1,-99, -1501,1234,12.34}]
Samples2 = [{10000001.2,1E-3,-2.7182818, 201021002001,-20102100200,2010210020,-201021002,20102100,-2010210, 201021,-20102,2010,-201,20,-2}]
For i = 1 To UBound(Samples1)
si = Samples1(i)
Debug.Print Format(smartp(si), "@@@@@@@@@@@@@@@@"); " "; spell(si)
Next i
For i = 1 To UBound(Samples2)
si = Samples2(i)
Debug.Print Format(smartp(si), "@@@@@@@@@@@@@@@@"); " "; spell(si)
Next i
End Sub
| TENS = [None, None, "twenty", "thirty", "forty",
"fifty", "sixty", "seventy", "eighty", "ninety"]
SMALL = ["zero", "one", "two", "three", "four", "five",
"six", "seven", "eight", "nine", "ten", "eleven",
"twelve", "thirteen", "fourteen", "fifteen",
"sixteen", "seventeen", "eighteen", "nineteen"]
HUGE = [None, None] + [h + "illion"
for h in ("m", "b", "tr", "quadr", "quint", "sext",
"sept", "oct", "non", "dec")]
def nonzero(c, n, connect=''):
return "" if n == 0 else connect + c + spell_integer(n)
def last_and(num):
if ',' in num:
pre, last = num.rsplit(',', 1)
if ' and ' not in last:
last = ' and' + last
num = ''.join([pre, ',', last])
return num
def big(e, n):
if e == 0:
return spell_integer(n)
elif e == 1:
return spell_integer(n) + " thousand"
else:
return spell_integer(n) + " " + HUGE[e]
def base1000_rev(n):
while n != 0:
n, r = divmod(n, 1000)
yield r
def spell_integer(n):
if n < 0:
return "minus " + spell_integer(-n)
elif n < 20:
return SMALL[n]
elif n < 100:
a, b = divmod(n, 10)
return TENS[a] + nonzero("-", b)
elif n < 1000:
a, b = divmod(n, 100)
return SMALL[a] + " hundred" + nonzero(" ", b, ' and')
else:
num = ", ".join([big(e, x) for e, x in
enumerate(base1000_rev(n)) if x][::-1])
return last_and(num)
if __name__ == '__main__':
for n in (0, -3, 5, -7, 11, -13, 17, -19, 23, -29):
print('%+4i -> %s' % (n, spell_integer(n)))
print('')
n = 201021002001
while n:
print('%-12i -> %s' % (n, spell_integer(n)))
n //= -10
print('%-12i -> %s' % (n, spell_integer(n)))
print('')
|
Produce a language-to-language conversion: from VB to Python, same semantics. | Sub arrShellSort(ByVal arrData As Variant)
Dim lngHold, lngGap As Long
Dim lngCount, lngMin, lngMax As Long
Dim varItem As Variant
lngMin = LBound(arrData)
lngMax = UBound(arrData)
lngGap = lngMin
Do While (lngGap < lngMax)
lngGap = 3 * lngGap + 1
Loop
Do While (lngGap > 1)
lngGap = lngGap \ 3
For lngCount = lngGap + lngMin To lngMax
varItem = arrData(lngCount)
lngHold = lngCount
Do While ((arrData(lngHold - lngGap) > varItem))
arrData(lngHold) = arrData(lngHold - lngGap)
lngHold = lngHold - lngGap
If (lngHold < lngMin + lngGap) Then Exit Do
Loop
arrData(lngHold) = varItem
Next
Loop
arrShellSort = arrData
End Sub
| def shell(seq):
inc = len(seq) // 2
while inc:
for i, el in enumerate(seq[inc:], inc):
while i >= inc and seq[i - inc] > el:
seq[i] = seq[i - inc]
i -= inc
seq[i] = el
inc = 1 if inc == 2 else inc * 5 // 11
|
Write a version of this VB function in Python with identical behavior. | Public Class DoubleLinkList(Of T)
Private m_Head As Node(Of T)
Private m_Tail As Node(Of T)
Public Sub AddHead(ByVal value As T)
Dim node As New Node(Of T)(Me, value)
If m_Head Is Nothing Then
m_Head = Node
m_Tail = m_Head
Else
node.Next = m_Head
m_Head = node
End If
End Sub
Public Sub AddTail(ByVal value As T)
Dim node As New Node(Of T)(Me, value)
If m_Tail Is Nothing Then
m_Head = node
m_Tail = m_Head
Else
node.Previous = m_Tail
m_Tail = node
End If
End Sub
Public ReadOnly Property Head() As Node(Of T)
Get
Return m_Head
End Get
End Property
Public ReadOnly Property Tail() As Node(Of T)
Get
Return m_Tail
End Get
End Property
Public Sub RemoveTail()
If m_Tail Is Nothing Then Return
If m_Tail.Previous Is Nothing Then
m_Head = Nothing
m_Tail = Nothing
Else
m_Tail = m_Tail.Previous
m_Tail.Next = Nothing
End If
End Sub
Public Sub RemoveHead()
If m_Head Is Nothing Then Return
If m_Head.Next Is Nothing Then
m_Head = Nothing
m_Tail = Nothing
Else
m_Head = m_Head.Next
m_Head.Previous = Nothing
End If
End Sub
End Class
Public Class Node(Of T)
Private ReadOnly m_Value As T
Private m_Next As Node(Of T)
Private m_Previous As Node(Of T)
Private ReadOnly m_Parent As DoubleLinkList(Of T)
Public Sub New(ByVal parent As DoubleLinkList(Of T), ByVal value As T)
m_Parent = parent
m_Value = value
End Sub
Public Property [Next]() As Node(Of T)
Get
Return m_Next
End Get
Friend Set(ByVal value As Node(Of T))
m_Next = value
End Set
End Property
Public Property Previous() As Node(Of T)
Get
Return m_Previous
End Get
Friend Set(ByVal value As Node(Of T))
m_Previous = value
End Set
End Property
Public ReadOnly Property Value() As T
Get
Return m_Value
End Get
End Property
Public Sub InsertAfter(ByVal value As T)
If m_Next Is Nothing Then
m_Parent.AddTail(value)
ElseIf m_Previous Is Nothing Then
m_Parent.AddHead(value)
Else
Dim node As New Node(Of T)(m_Parent, value)
node.Previous = Me
node.Next = Me.Next
Me.Next.Previous = node
Me.Next = node
End If
End Sub
Public Sub Remove()
If m_Next Is Nothing Then
m_Parent.RemoveTail()
ElseIf m_Previous Is Nothing Then
m_Parent.RemoveHead()
Else
m_Previous.Next = Me.Next
m_Next.Previous = Me.Previous
End If
End Sub
End Class
| from collections import deque
some_list = deque(["a", "b", "c"])
print(some_list)
some_list.appendleft("Z")
print(some_list)
for value in reversed(some_list):
print(value)
|
Produce a functionally identical Python code for the snippet given in VB. |
TYPE regChar
Character AS STRING * 3
Count AS LONG
END TYPE
DIM iChar AS INTEGER
DIM iCL AS INTEGER
DIM iCountChars AS INTEGER
DIM iFile AS INTEGER
DIM i AS INTEGER
DIM lMUC AS LONG
DIM iMUI AS INTEGER
DIM lLUC AS LONG
DIM iLUI AS INTEGER
DIM iMaxIdx AS INTEGER
DIM iP AS INTEGER
DIM iPause AS INTEGER
DIM iPMI AS INTEGER
DIM iPrint AS INTEGER
DIM lHowMany AS LONG
DIM lTotChars AS LONG
DIM sTime AS SINGLE
DIM strFile AS STRING
DIM strTxt AS STRING
DIM strDate AS STRING
DIM strTime AS STRING
DIM strKey AS STRING
CONST LngReg = 256
CONST Letters = 1
CONST FALSE = 0
CONST TRUE = NOT FALSE
strDate = DATE$
strTime = TIME$
iFile = FREEFILE
DO
CLS
PRINT "This program counts letters or characters in a text file."
PRINT
INPUT "File to open: ", strFile
OPEN strFile FOR BINARY AS #iFile
IF LOF(iFile) > 0 THEN
PRINT "Count: 1) Letters 2) Characters (1 or 2)";
DO
strKey = INKEY$
LOOP UNTIL strKey = "1" OR strKey = "2"
PRINT ". Option selected: "; strKey
iCL = VAL(strKey)
sTime = TIMER
iP = POS(0)
lHowMany = LOF(iFile)
strTxt = SPACE$(LngReg)
IF iCL = Letters THEN
iMaxIdx = 26
ELSE
iMaxIdx = 255
END IF
IF iMaxIdx <> iPMI THEN
iPMI = iMaxIdx
REDIM rChar(0 TO iMaxIdx) AS regChar
FOR i = 0 TO iMaxIdx
IF iCL = Letters THEN
strTxt = CHR$(i + 65)
IF i = 26 THEN strTxt = CHR$(165)
ELSE
SELECT CASE i
CASE 0: strTxt = "nul"
CASE 7: strTxt = "bel"
CASE 9: strTxt = "tab"
CASE 10: strTxt = "lf"
CASE 11: strTxt = "vt"
CASE 12: strTxt = "ff"
CASE 13: strTxt = "cr"
CASE 28: strTxt = "fs"
CASE 29: strTxt = "gs"
CASE 30: strTxt = "rs"
CASE 31: strTxt = "us"
CASE 32: strTxt = "sp"
CASE ELSE: strTxt = CHR$(i)
END SELECT
END IF
rChar(i).Character = strTxt
NEXT i
ELSE
FOR i = 0 TO iMaxIdx
rChar(i).Count = 0
NEXT i
END IF
PRINT "Looking for ";
IF iCL = Letters THEN PRINT "letters."; ELSE PRINT "characters.";
PRINT " File is"; STR$(lHowMany); " in size. Working"; : COLOR 23: PRINT "..."; : COLOR (7)
DO WHILE LOC(iFile) < LOF(iFile)
IF LOC(iFile) + LngReg > LOF(iFile) THEN
strTxt = SPACE$(LOF(iFile) - LOC(iFile))
END IF
GET #iFile, , strTxt
FOR i = 1 TO LEN(strTxt)
IF iCL = Letters THEN
iChar = ASC(UCASE$(MID$(strTxt, i, 1)))
SELECT CASE iChar
CASE 164: iChar = 165
CASE 160: iChar = 65
CASE 130, 144: iChar = 69
CASE 161: iChar = 73
CASE 162: iChar = 79
CASE 163, 129: iChar = 85
END SELECT
iChar = iChar - 65
IF iChar >= 0 AND iChar <= 25 THEN
rChar(iChar).Count = rChar(iChar).Count + 1
ELSEIF iChar = 100 THEN
rChar(iMaxIdx).Count = rChar(iMaxIdx).Count + 1
END IF
ELSE
iChar = ASC(MID$(strTxt, i, 1))
rChar(iChar).Count = rChar(iChar).Count + 1
END IF
NEXT i
LOOP
CLOSE #iFile
lMUC = 0
iMUI = 0
lLUC = 2147483647
iLUI = 0
iPrint = FALSE
lTotChars = 0
iCountChars = 0
iPause = FALSE
CLS
IF iCL = Letters THEN PRINT "Letters found: "; ELSE PRINT "Characters found: ";
FOR i = 0 TO iMaxIdx
IF lMUC < rChar(i).Count THEN
lMUC = rChar(i).Count
iMUI = i
END IF
IF rChar(i).Count > 0 THEN
strTxt = ""
IF iPrint THEN strTxt = ", " ELSE iPrint = TRUE
strTxt = strTxt + LTRIM$(RTRIM$(rChar(i).Character))
strTxt = strTxt + "=" + LTRIM$(STR$(rChar(i).Count))
iP = POS(0)
IF iP + LEN(strTxt) + 1 >= 80 AND iPrint THEN
PRINT ","
IF CSRLIN >= 23 AND NOT iPause THEN
iPause = TRUE
PRINT "Press a key to continue..."
DO
strKey = INKEY$
LOOP UNTIL strKey <> ""
END IF
strTxt = MID$(strTxt, 3)
END IF
PRINT strTxt;
lTotChars = lTotChars + rChar(i).Count
iCountChars = iCountChars + 1
IF lLUC > rChar(i).Count THEN
lLUC = rChar(i).Count
iLUI = i
END IF
END IF
NEXT i
PRINT "."
PRINT
PRINT "File analyzed....................: "; strFile
PRINT "Looked for.......................: "; : IF iCL = Letters THEN PRINT "Letters" ELSE PRINT "Characters"
PRINT "Total characters in file.........:"; lHowMany
PRINT "Total characters counted.........:"; lTotChars
IF iCL = Letters THEN PRINT "Characters discarded on count....:"; lHowMany - lTotChars
PRINT "Distinct characters found in file:"; iCountChars; "of"; iMaxIdx + 1
PRINT "Most used character was..........: ";
iPrint = FALSE
FOR i = 0 TO iMaxIdx
IF rChar(i).Count = lMUC THEN
IF iPrint THEN PRINT ", "; ELSE iPrint = TRUE
PRINT RTRIM$(LTRIM$(rChar(i).Character));
END IF
NEXT i
PRINT " ("; LTRIM$(STR$(rChar(iMUI).Count)); " times)"
PRINT "Least used character was.........: ";
iPrint = FALSE
FOR i = 0 TO iMaxIdx
IF rChar(i).Count = lLUC THEN
IF iPrint THEN PRINT ", "; ELSE iPrint = TRUE
PRINT RTRIM$(LTRIM$(rChar(i).Character));
END IF
NEXT i
PRINT " ("; LTRIM$(STR$(rChar(iLUI).Count)); " times)"
PRINT "Time spent in the process........:"; TIMER - sTime; "seconds"
ELSE
CLOSE #iFile
KILL strFile
PRINT
PRINT "File does not exist."
END IF
PRINT
PRINT "Again? (Y/n)"
DO
strTxt = UCASE$(INKEY$)
LOOP UNTIL strTxt = "N" OR strTxt = "Y" OR strTxt = CHR$(13) OR strTxt = CHR$(27)
LOOP UNTIL strTxt = "N" OR strTxt = CHR$(27)
CLS
PRINT "End of execution."
PRINT "Start time: "; strDate; " "; strTime; ", end time: "; DATE$; " "; TIME$; "."
END
| import collections, sys
def filecharcount(openfile):
return sorted(collections.Counter(c for l in openfile for c in l).items())
f = open(sys.argv[1])
print(filecharcount(f))
|
Generate an equivalent Python version of this VB code. | Dim s As String = "123"
s = CStr(CInt("123") + 1)
s = (CInt("123") + 1).ToString
| next = str(int('123') + 1)
|
Port the provided VB code into Python while preserving the original functionality. | Dim s As String = "123"
s = CStr(CInt("123") + 1)
s = (CInt("123") + 1).ToString
| next = str(int('123') + 1)
|
Change the following VB code into Python without altering its purpose. | Function StripChars(stString As String, stStripChars As String, Optional bSpace As Boolean)
Dim i As Integer, stReplace As String
If bSpace = True Then
stReplace = " "
Else
stReplace = ""
End If
For i = 1 To Len(stStripChars)
stString = Replace(stString, Mid(stStripChars, i, 1), stReplace)
Next i
StripChars = stString
End Function
| >>> def stripchars(s, chars):
... return s.translate(None, chars)
...
>>> stripchars("She was a soul stripper. She took my heart!", "aei")
'Sh ws soul strppr. Sh took my hrt!'
|
Change the following VB code into Python without altering its purpose. | Private Function mean(v() As Double, ByVal leng As Integer) As Variant
Dim sum As Double, i As Integer
sum = 0: i = 0
For i = 0 To leng - 1
sum = sum + vv
Next i
If leng = 0 Then
mean = CVErr(xlErrDiv0)
Else
mean = sum / leng
End If
End Function
Public Sub main()
Dim v(4) As Double
Dim i As Integer, leng As Integer
v(0) = 1#
v(1) = 2#
v(2) = 2.178
v(3) = 3#
v(4) = 3.142
For leng = 5 To 0 Step -1
Debug.Print "mean[";
For i = 0 To leng - 1
Debug.Print IIf(i, "; " & v(i), "" & v(i));
Next i
Debug.Print "] = "; mean(v, leng)
Next leng
End Sub
| from math import fsum
def average(x):
return fsum(x)/float(len(x)) if x else 0
print (average([0,0,3,1,4,1,5,9,0,0]))
print (average([1e20,-1e-20,3,1,4,1,5,9,-1e20,1e-20]))
|
Change the programming language of this snippet from VB to Python without modifying what it does. | Private Function ValidateUserWords(userstring As String) As String
Dim s As String
Dim user_words() As String
Dim command_table As Scripting.Dictionary
Set command_table = New Scripting.Dictionary
Dim abbreviations As Scripting.Dictionary
Set abbreviations = New Scripting.Dictionary
abbreviations.CompareMode = TextCompare
Dim commandtable() As String
Dim commands As String
s = s & "add 1 alter 3 backup 2 bottom 1 Cappend 2 change 1 Schange Cinsert 2 Clast 3 "
s = s & "compress 4 copy 2 count 3 Coverlay 3 cursor 3 delete 3 Cdelete 2 down 1 duplicate "
s = s & "3 xEdit 1 expand 3 extract 3 find 1 Nfind 2 Nfindup 6 NfUP 3 Cfind 2 findUP 3 fUP 2 "
s = s & "forward 2 get help 1 hexType 4 input 1 powerInput 3 join 1 split 2 spltJOIN load "
s = s & "locate 1 Clocate 2 lowerCase 3 upperCase 3 Lprefix 2 macro merge 2 modify 3 move 2 "
s = s & "msg next 1 overlay 1 parse preserve 4 purge 3 put putD query 1 quit read recover 3 "
s = s & "refresh renum 3 repeat 3 replace 1 Creplace 2 reset 3 restore 4 rgtLEFT right 2 left "
s = s & "2 save set shift 2 si sort sos stack 3 status 4 top transfer 3 type 1 up 1 "
commandtable = Split(s, " ")
Dim i As Integer, word As Variant, number As Integer
For i = LBound(commandtable) To UBound(commandtable)
word = commandtable(i)
If Len(word) > 0 Then
i = i + 1
Do While Len(commandtable(i)) = 0: i = i + 1: Loop
number = Val(commandtable(i))
If number > 0 Then
command_table.Add Key:=word, Item:=number
Else
command_table.Add Key:=word, Item:=Len(word)
i = i - 1
End If
End If
Next i
For Each word In command_table
For i = command_table(word) To Len(word)
On Error Resume Next
abbreviations.Add Key:=Left(word, i), Item:=UCase(word)
Next i
Next word
user_words() = Split(userstring, " ")
For Each word In user_words
If Len(word) > 0 Then
If abbreviations.exists(word) Then
commands = commands & abbreviations(word) & " "
Else
commands = commands & "*error* "
End If
End If
Next word
ValidateUserWords = commands
End Function
Public Sub program()
Dim guserstring As String
guserstring = "riG rePEAT copies put mo rest types fup. 6 poweRin"
Debug.Print "user words:", guserstring
Debug.Print "full words:", ValidateUserWords(guserstring)
End Sub
| command_table_text =
user_words = "riG rePEAT copies put mo rest types fup. 6 poweRin"
def find_abbreviations_length(command_table_text):
command_table = dict()
input_iter = iter(command_table_text.split())
word = None
try:
while True:
if word is None:
word = next(input_iter)
abbr_len = next(input_iter, len(word))
try:
command_table[word] = int(abbr_len)
word = None
except ValueError:
command_table[word] = len(word)
word = abbr_len
except StopIteration:
pass
return command_table
def find_abbreviations(command_table):
abbreviations = dict()
for command, min_abbr_len in command_table.items():
for l in range(min_abbr_len, len(command)+1):
abbr = command[:l].lower()
abbreviations[abbr] = command.upper()
return abbreviations
def parse_user_string(user_string, abbreviations):
user_words = [word.lower() for word in user_string.split()]
commands = [abbreviations.get(user_word, "*error*") for user_word in user_words]
return " ".join(commands)
command_table = find_abbreviations_length(command_table_text)
abbreviations_table = find_abbreviations(command_table)
full_words = parse_user_string(user_words, abbreviations_table)
print("user words:", user_words)
print("full words:", full_words)
|
Translate this program into Python but keep the logic exactly as in VB. | Private Function ValidateUserWords(userstring As String) As String
Dim s As String
Dim user_words() As String
Dim command_table As Scripting.Dictionary
Set command_table = New Scripting.Dictionary
Dim abbreviations As Scripting.Dictionary
Set abbreviations = New Scripting.Dictionary
abbreviations.CompareMode = TextCompare
Dim commandtable() As String
Dim commands As String
s = s & "add 1 alter 3 backup 2 bottom 1 Cappend 2 change 1 Schange Cinsert 2 Clast 3 "
s = s & "compress 4 copy 2 count 3 Coverlay 3 cursor 3 delete 3 Cdelete 2 down 1 duplicate "
s = s & "3 xEdit 1 expand 3 extract 3 find 1 Nfind 2 Nfindup 6 NfUP 3 Cfind 2 findUP 3 fUP 2 "
s = s & "forward 2 get help 1 hexType 4 input 1 powerInput 3 join 1 split 2 spltJOIN load "
s = s & "locate 1 Clocate 2 lowerCase 3 upperCase 3 Lprefix 2 macro merge 2 modify 3 move 2 "
s = s & "msg next 1 overlay 1 parse preserve 4 purge 3 put putD query 1 quit read recover 3 "
s = s & "refresh renum 3 repeat 3 replace 1 Creplace 2 reset 3 restore 4 rgtLEFT right 2 left "
s = s & "2 save set shift 2 si sort sos stack 3 status 4 top transfer 3 type 1 up 1 "
commandtable = Split(s, " ")
Dim i As Integer, word As Variant, number As Integer
For i = LBound(commandtable) To UBound(commandtable)
word = commandtable(i)
If Len(word) > 0 Then
i = i + 1
Do While Len(commandtable(i)) = 0: i = i + 1: Loop
number = Val(commandtable(i))
If number > 0 Then
command_table.Add Key:=word, Item:=number
Else
command_table.Add Key:=word, Item:=Len(word)
i = i - 1
End If
End If
Next i
For Each word In command_table
For i = command_table(word) To Len(word)
On Error Resume Next
abbreviations.Add Key:=Left(word, i), Item:=UCase(word)
Next i
Next word
user_words() = Split(userstring, " ")
For Each word In user_words
If Len(word) > 0 Then
If abbreviations.exists(word) Then
commands = commands & abbreviations(word) & " "
Else
commands = commands & "*error* "
End If
End If
Next word
ValidateUserWords = commands
End Function
Public Sub program()
Dim guserstring As String
guserstring = "riG rePEAT copies put mo rest types fup. 6 poweRin"
Debug.Print "user words:", guserstring
Debug.Print "full words:", ValidateUserWords(guserstring)
End Sub
| command_table_text =
user_words = "riG rePEAT copies put mo rest types fup. 6 poweRin"
def find_abbreviations_length(command_table_text):
command_table = dict()
input_iter = iter(command_table_text.split())
word = None
try:
while True:
if word is None:
word = next(input_iter)
abbr_len = next(input_iter, len(word))
try:
command_table[word] = int(abbr_len)
word = None
except ValueError:
command_table[word] = len(word)
word = abbr_len
except StopIteration:
pass
return command_table
def find_abbreviations(command_table):
abbreviations = dict()
for command, min_abbr_len in command_table.items():
for l in range(min_abbr_len, len(command)+1):
abbr = command[:l].lower()
abbreviations[abbr] = command.upper()
return abbreviations
def parse_user_string(user_string, abbreviations):
user_words = [word.lower() for word in user_string.split()]
commands = [abbreviations.get(user_word, "*error*") for user_word in user_words]
return " ".join(commands)
command_table = find_abbreviations_length(command_table_text)
abbreviations_table = find_abbreviations(command_table)
full_words = parse_user_string(user_words, abbreviations_table)
print("user words:", user_words)
print("full words:", full_words)
|
Produce a functionally identical Python code for the snippet given in VB. | Private Function tokenize(s As String, sep As String, esc As String) As Collection
Dim ret As New Collection
Dim this As String
Dim skip As Boolean
If Len(s) <> 0 Then
For i = 1 To Len(s)
si = Mid(s, i, 1)
If skip Then
this = this & si
skip = False
Else
If si = esc Then
skip = True
Else
If si = sep Then
ret.Add this
this = ""
Else
this = this & si
End If
End If
End If
Next i
ret.Add this
End If
Set tokenize = ret
End Function
Public Sub main()
Dim out As Collection
Set out = tokenize("one^|uno||three^^^^|four^^^|^cuatro|", "|", "^")
Dim outstring() As String
ReDim outstring(out.Count - 1)
For i = 0 To out.Count - 1
outstring(i) = out(i + 1)
Next i
Debug.Print Join(outstring, ", ")
End Sub
| def token_with_escape(a, escape = '^', separator = '|'):
result = []
token = ''
state = 0
for c in a:
if state == 0:
if c == escape:
state = 1
elif c == separator:
result.append(token)
token = ''
else:
token += c
elif state == 1:
token += c
state = 0
result.append(token)
return result
|
Port the following code from VB to Python with equivalent syntax and logic. | Module ForwardDifference
Sub Main()
Dim lNum As New List(Of Integer)(New Integer() {90, 47, 58, 29, 22, 32, 55, 5, 55, 73})
For i As UInteger = 0 To 9
Console.WriteLine(String.Join(" ", (From n In Difference(i, lNum) Select String.Format("{0,5}", n)).ToArray()))
Next
Console.ReadKey()
End Sub
Private Function Difference(ByVal Level As UInteger, ByVal Numbers As List(Of Integer)) As List(Of Integer)
If Level >= Numbers.Count Then Throw New ArgumentOutOfRangeException("Level", "Level must be less than number of items in Numbers")
For i As Integer = 1 To Level
Numbers = (From n In Enumerable.Range(0, Numbers.Count - 1) _
Select Numbers(n + 1) - Numbers(n)).ToList()
Next
Return Numbers
End Function
End Module
| >>> dif = lambda s: [x-s[i] for i,x in enumerate(s[1:])]
>>>
>>> difn = lambda s, n: difn(dif(s), n-1) if n else s
>>> s = [90, 47, 58, 29, 22, 32, 55, 5, 55, 73]
>>> difn(s, 0)
[90, 47, 58, 29, 22, 32, 55, 5, 55, 73]
>>> difn(s, 1)
[-43, 11, -29, -7, 10, 23, -50, 50, 18]
>>> difn(s, 2)
[54, -40, 22, 17, 13, -73, 100, -32]
>>> from pprint import pprint
>>> pprint( [difn(s, i) for i in xrange(10)] )
[[90, 47, 58, 29, 22, 32, 55, 5, 55, 73],
[-43, 11, -29, -7, 10, 23, -50, 50, 18],
[54, -40, 22, 17, 13, -73, 100, -32],
[-94, 62, -5, -4, -86, 173, -132],
[156, -67, 1, -82, 259, -305],
[-223, 68, -83, 341, -564],
[291, -151, 424, -905],
[-442, 575, -1329],
[1017, -1904],
[-2921]]
|
Keep all operations the same but rewrite the snippet in Python. | Option Explicit
Sub FirstTwentyPrimes()
Dim count As Integer, i As Long, t(19) As String
Do
i = i + 1
If IsPrime(i) Then
t(count) = i
count = count + 1
End If
Loop While count <= UBound(t)
Debug.Print Join(t, ", ")
End Sub
Function IsPrime(Nb As Long) As Boolean
If Nb = 2 Then
IsPrime = True
ElseIf Nb < 2 Or Nb Mod 2 = 0 Then
Exit Function
Else
Dim i As Long
For i = 3 To Sqr(Nb) Step 2
If Nb Mod i = 0 Then Exit Function
Next
IsPrime = True
End If
End Function
| def prime(a):
return not (a < 2 or any(a % x == 0 for x in xrange(2, int(a**0.5) + 1)))
|
Please provide an equivalent version of this VB code in Python. | Function binomial(n,k)
binomial = factorial(n)/(factorial(n-k)*factorial(k))
End Function
Function factorial(n)
If n = 0 Then
factorial = 1
Else
For i = n To 1 Step -1
If i = n Then
factorial = n
Else
factorial = factorial * i
End If
Next
End If
End Function
WScript.StdOut.Write "the binomial coefficient of 5 and 3 = " & binomial(5,3)
WScript.StdOut.WriteLine
| def binomialCoeff(n, k):
result = 1
for i in range(1, k+1):
result = result * (n-i+1) / i
return result
if __name__ == "__main__":
print(binomialCoeff(5, 3))
|
Please provide an equivalent version of this VB code in Python. | Dim coll As New Collection
coll.Add "apple"
coll.Add "banana"
| collection = [0, '1']
x = collection[0]
collection.append(2)
collection.insert(0, '-1')
y = collection[0]
collection.extend([2,'3'])
collection += [2,'3']
collection[2:6]
len(collection)
collection = (0, 1)
collection[:]
collection[-4:-1]
collection[::2]
collection="some string"
x = collection[::-1]
collection[::2] == "some string"[::2]
collection.__getitem__(slice(0,len(collection),2))
collection = {0: "zero", 1: "one"}
collection['zero'] = 2
collection = set([0, '1'])
|
Rewrite the snippet below in Python so it works the same as the original VB code. | Dim coll As New Collection
coll.Add "apple"
coll.Add "banana"
| collection = [0, '1']
x = collection[0]
collection.append(2)
collection.insert(0, '-1')
y = collection[0]
collection.extend([2,'3'])
collection += [2,'3']
collection[2:6]
len(collection)
collection = (0, 1)
collection[:]
collection[-4:-1]
collection[::2]
collection="some string"
x = collection[::-1]
collection[::2] == "some string"[::2]
collection.__getitem__(slice(0,len(collection),2))
collection = {0: "zero", 1: "one"}
collection['zero'] = 2
collection = set([0, '1'])
|
Can you help me rewrite this code in Python instead of VB, keeping it the same logically? | Private Sub Iterate(ByVal list As LinkedList(Of Integer))
Dim node = list.First
Do Until node Is Nothing
node = node.Next
Loop
End Sub
| for node in lst:
print node.value
|
Translate the given VB code snippet into Python without altering its behavior. | Public Shared Sub SaveRasterBitmapToPpmFile(ByVal rasterBitmap As RasterBitmap, ByVal filepath As String)
Dim header As String = String.Format("P6{0}{1}{2}{3}{0}255{0}", vbLf, rasterBitmap.Width, " "c, rasterBitmap.Height)
Dim bufferSize As Integer = header.Length + (rasterBitmap.Width * rasterBitmap.Height * 3)
Dim bytes(bufferSize - 1) As Byte
Buffer.BlockCopy(Encoding.ASCII.GetBytes(header.ToString), 0, bytes, 0, header.Length)
Dim index As Integer = header.Length
For y As Integer = 0 To rasterBitmap.Height - 1
For x As Integer = 0 To rasterBitmap.Width - 1
Dim color As Rgb = rasterBitmap.GetPixel(x, y)
bytes(index) = color.R
bytes(index + 1) = color.G
bytes(index + 2) = color.B
index += 3
Next
Next
My.Computer.FileSystem.WriteAllBytes(filepath, bytes, False)
End Sub
|
import io
ppmfileout = io.StringIO('')
def writeppmp3(self, f):
self.writeppm(f, ppmformat='P3')
def writeppm(self, f, ppmformat='P6'):
assert ppmformat in ['P3', 'P6'], 'Format wrong'
magic = ppmformat + '\n'
comment = '
maxval = max(max(max(bit) for bit in row) for row in self.map)
assert ppmformat == 'P3' or 0 <= maxval < 256, 'R,G,B must fit in a byte'
if ppmformat == 'P6':
fwrite = lambda s: f.write(bytes(s, 'UTF-8'))
maxval = 255
else:
fwrite = f.write
numsize=len(str(maxval))
fwrite(magic)
fwrite(comment)
fwrite('%i %i\n%i\n' % (self.width, self.height, maxval))
for h in range(self.height-1, -1, -1):
for w in range(self.width):
r, g, b = self.get(w, h)
if ppmformat == 'P3':
fwrite(' %*i %*i %*i' % (numsize, r, numsize, g, numsize, b))
else:
fwrite('%c%c%c' % (r, g, b))
if ppmformat == 'P3':
fwrite('\n')
Bitmap.writeppmp3 = writeppmp3
Bitmap.writeppm = writeppm
bitmap = Bitmap(4, 4, black)
bitmap.fillrect(1, 0, 1, 2, white)
bitmap.set(3, 3, Colour(127, 0, 63))
bitmap.writeppmp3(ppmfileout)
print(ppmfileout.getvalue())
ppmfileout = open('tmp.ppm', 'wb')
bitmap.writeppm(ppmfileout)
ppmfileout.close()
|
Convert this VB block to Python, preserving its control flow and logic. | Option Explicit
Sub DeleteFileOrDirectory()
Dim myPath As String
myPath = "C:\Users\surname.name\Desktop\Docs"
Kill myPath & "\input.txt"
RmDir myPath
End Sub
| import os
os.remove("output.txt")
os.rmdir("docs")
os.remove("/output.txt")
os.rmdir("/docs")
|
Rewrite the snippet below in Python so it works the same as the original VB code. | Const MAX = 20
Const ITER = 1000000
Function expected(n As Long) As Double
Dim sum As Double
For i = 1 To n
sum = sum + WorksheetFunction.Fact(n) / n ^ i / WorksheetFunction.Fact(n - i)
Next i
expected = sum
End Function
Function test(n As Long) As Double
Dim count As Long
Dim x As Long, bits As Long
For i = 1 To ITER
x = 1
bits = 0
Do While Not bits And x
count = count + 1
bits = bits Or x
x = 2 ^ (Int(n * Rnd()))
Loop
Next i
test = count / ITER
End Function
Public Sub main()
Dim n As Long
Debug.Print " n avg. exp. (error%)"
Debug.Print "== ====== ====== ========"
For n = 1 To MAX
av = test(n)
ex = expected(n)
Debug.Print Format(n, "@@"); " "; Format(av, "0.0000"); " ";
Debug.Print Format(ex, "0.0000"); " ("; Format(Abs(1 - av / ex), "0.000%"); ")"
Next n
End Sub
| from __future__ import division
from math import factorial
from random import randrange
MAX_N = 20
TIMES = 1000000
def analytical(n):
return sum(factorial(n) / pow(n, i) / factorial(n -i) for i in range(1, n+1))
def test(n, times):
count = 0
for i in range(times):
x, bits = 1, 0
while not (bits & x):
count += 1
bits |= x
x = 1 << randrange(n)
return count / times
if __name__ == '__main__':
print(" n\tavg\texp.\tdiff\n-------------------------------")
for n in range(1, MAX_N+1):
avg = test(n, TIMES)
theory = analytical(n)
diff = (avg / theory - 1) * 100
print("%2d %8.4f %8.4f %6.3f%%" % (n, avg, theory, diff))
|
Write the same code in Python as shown below in VB. | Const MAX = 20
Const ITER = 1000000
Function expected(n As Long) As Double
Dim sum As Double
For i = 1 To n
sum = sum + WorksheetFunction.Fact(n) / n ^ i / WorksheetFunction.Fact(n - i)
Next i
expected = sum
End Function
Function test(n As Long) As Double
Dim count As Long
Dim x As Long, bits As Long
For i = 1 To ITER
x = 1
bits = 0
Do While Not bits And x
count = count + 1
bits = bits Or x
x = 2 ^ (Int(n * Rnd()))
Loop
Next i
test = count / ITER
End Function
Public Sub main()
Dim n As Long
Debug.Print " n avg. exp. (error%)"
Debug.Print "== ====== ====== ========"
For n = 1 To MAX
av = test(n)
ex = expected(n)
Debug.Print Format(n, "@@"); " "; Format(av, "0.0000"); " ";
Debug.Print Format(ex, "0.0000"); " ("; Format(Abs(1 - av / ex), "0.000%"); ")"
Next n
End Sub
| from __future__ import division
from math import factorial
from random import randrange
MAX_N = 20
TIMES = 1000000
def analytical(n):
return sum(factorial(n) / pow(n, i) / factorial(n -i) for i in range(1, n+1))
def test(n, times):
count = 0
for i in range(times):
x, bits = 1, 0
while not (bits & x):
count += 1
bits |= x
x = 1 << randrange(n)
return count / times
if __name__ == '__main__':
print(" n\tavg\texp.\tdiff\n-------------------------------")
for n in range(1, MAX_N+1):
avg = test(n, TIMES)
theory = analytical(n)
diff = (avg / theory - 1) * 100
print("%2d %8.4f %8.4f %6.3f%%" % (n, avg, theory, diff))
|
Port the provided VB code into Python while preserving the original functionality. | Dim name as String = "J. Doe"
Dim balance as Double = 123.45
Dim prompt as String = String.Format("Hello {0}, your balance is {1}.", name, balance)
Console.WriteLine(prompt)
| >>> original = 'Mary had a %s lamb.'
>>> extra = 'little'
>>> original % extra
'Mary had a little lamb.'
|
Rewrite the snippet below in Python so it works the same as the original VB code. | Module Module1
Function Minor(a As Double(,), x As Integer, y As Integer) As Double(,)
Dim length = a.GetLength(0) - 1
Dim result(length - 1, length - 1) As Double
For i = 1 To length
For j = 1 To length
If i < x AndAlso j < y Then
result(i - 1, j - 1) = a(i - 1, j - 1)
ElseIf i >= x AndAlso j < y Then
result(i - 1, j - 1) = a(i, j - 1)
ElseIf i < x AndAlso j >= y Then
result(i - 1, j - 1) = a(i - 1, j)
Else
result(i - 1, j - 1) = a(i, j)
End If
Next
Next
Return result
End Function
Function Det(a As Double(,)) As Double
If a.GetLength(0) = 1 Then
Return a(0, 0)
Else
Dim sign = 1
Dim sum = 0.0
For i = 1 To a.GetLength(0)
sum += sign * a(0, i - 1) * Det(Minor(a, 0, i))
sign *= -1
Next
Return sum
End If
End Function
Function Perm(a As Double(,)) As Double
If a.GetLength(0) = 1 Then
Return a(0, 0)
Else
Dim sum = 0.0
For i = 1 To a.GetLength(0)
sum += a(0, i - 1) * Perm(Minor(a, 0, i))
Next
Return sum
End If
End Function
Sub WriteLine(a As Double(,))
For i = 1 To a.GetLength(0)
Console.Write("[")
For j = 1 To a.GetLength(1)
If j > 1 Then
Console.Write(", ")
End If
Console.Write(a(i - 1, j - 1))
Next
Console.WriteLine("]")
Next
End Sub
Sub Test(a As Double(,))
If a.GetLength(0) <> a.GetLength(1) Then
Throw New ArgumentException("The dimensions must be equal")
End If
WriteLine(a)
Console.WriteLine("Permanant : {0}", Perm(a))
Console.WriteLine("Determinant: {0}", Det(a))
Console.WriteLine()
End Sub
Sub Main()
Test({{1, 2}, {3, 4}})
Test({{1, 2, 3, 4}, {4, 5, 6, 7}, {7, 8, 9, 10}, {10, 11, 12, 13}})
Test({{0, 1, 2, 3, 4}, {5, 6, 7, 8, 9}, {10, 11, 12, 13, 14}, {15, 16, 17, 18, 19}, {20, 21, 22, 23, 24}})
End Sub
End Module
| from itertools import permutations
from operator import mul
from math import fsum
from spermutations import spermutations
def prod(lst):
return reduce(mul, lst, 1)
def perm(a):
n = len(a)
r = range(n)
s = permutations(r)
return fsum(prod(a[i][sigma[i]] for i in r) for sigma in s)
def det(a):
n = len(a)
r = range(n)
s = spermutations(n)
return fsum(sign * prod(a[i][sigma[i]] for i in r)
for sigma, sign in s)
if __name__ == '__main__':
from pprint import pprint as pp
for a in (
[
[1, 2],
[3, 4]],
[
[1, 2, 3, 4],
[4, 5, 6, 7],
[7, 8, 9, 10],
[10, 11, 12, 13]],
[
[ 0, 1, 2, 3, 4],
[ 5, 6, 7, 8, 9],
[10, 11, 12, 13, 14],
[15, 16, 17, 18, 19],
[20, 21, 22, 23, 24]],
):
print('')
pp(a)
print('Perm: %s Det: %s' % (perm(a), det(a)))
|
Translate the given VB code snippet into Python without altering its behavior. | Module Module1
Function Minor(a As Double(,), x As Integer, y As Integer) As Double(,)
Dim length = a.GetLength(0) - 1
Dim result(length - 1, length - 1) As Double
For i = 1 To length
For j = 1 To length
If i < x AndAlso j < y Then
result(i - 1, j - 1) = a(i - 1, j - 1)
ElseIf i >= x AndAlso j < y Then
result(i - 1, j - 1) = a(i, j - 1)
ElseIf i < x AndAlso j >= y Then
result(i - 1, j - 1) = a(i - 1, j)
Else
result(i - 1, j - 1) = a(i, j)
End If
Next
Next
Return result
End Function
Function Det(a As Double(,)) As Double
If a.GetLength(0) = 1 Then
Return a(0, 0)
Else
Dim sign = 1
Dim sum = 0.0
For i = 1 To a.GetLength(0)
sum += sign * a(0, i - 1) * Det(Minor(a, 0, i))
sign *= -1
Next
Return sum
End If
End Function
Function Perm(a As Double(,)) As Double
If a.GetLength(0) = 1 Then
Return a(0, 0)
Else
Dim sum = 0.0
For i = 1 To a.GetLength(0)
sum += a(0, i - 1) * Perm(Minor(a, 0, i))
Next
Return sum
End If
End Function
Sub WriteLine(a As Double(,))
For i = 1 To a.GetLength(0)
Console.Write("[")
For j = 1 To a.GetLength(1)
If j > 1 Then
Console.Write(", ")
End If
Console.Write(a(i - 1, j - 1))
Next
Console.WriteLine("]")
Next
End Sub
Sub Test(a As Double(,))
If a.GetLength(0) <> a.GetLength(1) Then
Throw New ArgumentException("The dimensions must be equal")
End If
WriteLine(a)
Console.WriteLine("Permanant : {0}", Perm(a))
Console.WriteLine("Determinant: {0}", Det(a))
Console.WriteLine()
End Sub
Sub Main()
Test({{1, 2}, {3, 4}})
Test({{1, 2, 3, 4}, {4, 5, 6, 7}, {7, 8, 9, 10}, {10, 11, 12, 13}})
Test({{0, 1, 2, 3, 4}, {5, 6, 7, 8, 9}, {10, 11, 12, 13, 14}, {15, 16, 17, 18, 19}, {20, 21, 22, 23, 24}})
End Sub
End Module
| from itertools import permutations
from operator import mul
from math import fsum
from spermutations import spermutations
def prod(lst):
return reduce(mul, lst, 1)
def perm(a):
n = len(a)
r = range(n)
s = permutations(r)
return fsum(prod(a[i][sigma[i]] for i in r) for sigma in s)
def det(a):
n = len(a)
r = range(n)
s = spermutations(n)
return fsum(sign * prod(a[i][sigma[i]] for i in r)
for sigma, sign in s)
if __name__ == '__main__':
from pprint import pprint as pp
for a in (
[
[1, 2],
[3, 4]],
[
[1, 2, 3, 4],
[4, 5, 6, 7],
[7, 8, 9, 10],
[10, 11, 12, 13]],
[
[ 0, 1, 2, 3, 4],
[ 5, 6, 7, 8, 9],
[10, 11, 12, 13, 14],
[15, 16, 17, 18, 19],
[20, 21, 22, 23, 24]],
):
print('')
pp(a)
print('Perm: %s Det: %s' % (perm(a), det(a)))
|
Rewrite this program in Python while keeping its functionality equivalent to the VB version. | Imports System.Math
Module RayCasting
Private square As Integer()() = {New Integer() {0, 0}, New Integer() {20, 0}, New Integer() {20, 20}, New Integer() {0, 20}}
Private squareHole As Integer()() = {New Integer() {0, 0}, New Integer() {20, 0}, New Integer() {20, 20}, New Integer() {0, 20}, New Integer() {5, 5}, New Integer() {15, 5}, New Integer() {15, 15}, New Integer() {5, 15}}
Private strange As Integer()() = {New Integer() {0, 0}, New Integer() {5, 5}, New Integer() {0, 20}, New Integer() {5, 15}, New Integer() {15, 15}, New Integer() {20, 20}, New Integer() {20, 0}}
Private hexagon As Integer()() = {New Integer() {6, 0}, New Integer() {14, 0}, New Integer() {20, 10}, New Integer() {14, 20}, New Integer() {6, 20}, New Integer() {0, 10}}
Private shapes As Integer()()() = {square, squareHole, strange, hexagon}
Public Sub Main()
Dim testPoints As Double()() = {New Double() {10, 10}, New Double() {10, 16}, New Double() {-20, 10}, New Double() {0, 10}, New Double() {20, 10}, New Double() {16, 10}, New Double() {20, 20}}
For Each shape As Integer()() In shapes
For Each point As Double() In testPoints
Console.Write(String.Format("{0} ", Contains(shape, point).ToString.PadLeft(7)))
Next
Console.WriteLine()
Next
End Sub
Private Function Contains(shape As Integer()(), point As Double()) As Boolean
Dim inside As Boolean = False
Dim length As Integer = shape.Length
For i As Integer = 0 To length - 1
If Intersects(shape(i), shape((i + 1) Mod length), point) Then
inside = Not inside
End If
Next
Return inside
End Function
Private Function Intersects(a As Integer(), b As Integer(), p As Double()) As Boolean
If a(1) > b(1) Then Return Intersects(b, a, p)
If p(1) = a(1) Or p(1) = b(1) Then p(1) += 0.0001
If p(1) > b(1) Or p(1) < a(1) Or p(0) >= Max(a(0), b(0)) Then Return False
If p(0) < Min(a(0), b(0)) Then Return True
Dim red As Double = (p(1) - a(1)) / (p(0) - a(0))
Dim blue As Double = (b(1) - a(1)) / (b(0) - a(0))
Return red >= blue
End Function
End Module
| from collections import namedtuple
from pprint import pprint as pp
import sys
Pt = namedtuple('Pt', 'x, y')
Edge = namedtuple('Edge', 'a, b')
Poly = namedtuple('Poly', 'name, edges')
_eps = 0.00001
_huge = sys.float_info.max
_tiny = sys.float_info.min
def rayintersectseg(p, edge):
a,b = edge
if a.y > b.y:
a,b = b,a
if p.y == a.y or p.y == b.y:
p = Pt(p.x, p.y + _eps)
intersect = False
if (p.y > b.y or p.y < a.y) or (
p.x > max(a.x, b.x)):
return False
if p.x < min(a.x, b.x):
intersect = True
else:
if abs(a.x - b.x) > _tiny:
m_red = (b.y - a.y) / float(b.x - a.x)
else:
m_red = _huge
if abs(a.x - p.x) > _tiny:
m_blue = (p.y - a.y) / float(p.x - a.x)
else:
m_blue = _huge
intersect = m_blue >= m_red
return intersect
def _odd(x): return x%2 == 1
def ispointinside(p, poly):
ln = len(poly)
return _odd(sum(rayintersectseg(p, edge)
for edge in poly.edges ))
def polypp(poly):
print ("\n Polygon(name='%s', edges=(" % poly.name)
print (' ', ',\n '.join(str(e) for e in poly.edges) + '\n ))')
if __name__ == '__main__':
polys = [
Poly(name='square', edges=(
Edge(a=Pt(x=0, y=0), b=Pt(x=10, y=0)),
Edge(a=Pt(x=10, y=0), b=Pt(x=10, y=10)),
Edge(a=Pt(x=10, y=10), b=Pt(x=0, y=10)),
Edge(a=Pt(x=0, y=10), b=Pt(x=0, y=0))
)),
Poly(name='square_hole', edges=(
Edge(a=Pt(x=0, y=0), b=Pt(x=10, y=0)),
Edge(a=Pt(x=10, y=0), b=Pt(x=10, y=10)),
Edge(a=Pt(x=10, y=10), b=Pt(x=0, y=10)),
Edge(a=Pt(x=0, y=10), b=Pt(x=0, y=0)),
Edge(a=Pt(x=2.5, y=2.5), b=Pt(x=7.5, y=2.5)),
Edge(a=Pt(x=7.5, y=2.5), b=Pt(x=7.5, y=7.5)),
Edge(a=Pt(x=7.5, y=7.5), b=Pt(x=2.5, y=7.5)),
Edge(a=Pt(x=2.5, y=7.5), b=Pt(x=2.5, y=2.5))
)),
Poly(name='strange', edges=(
Edge(a=Pt(x=0, y=0), b=Pt(x=2.5, y=2.5)),
Edge(a=Pt(x=2.5, y=2.5), b=Pt(x=0, y=10)),
Edge(a=Pt(x=0, y=10), b=Pt(x=2.5, y=7.5)),
Edge(a=Pt(x=2.5, y=7.5), b=Pt(x=7.5, y=7.5)),
Edge(a=Pt(x=7.5, y=7.5), b=Pt(x=10, y=10)),
Edge(a=Pt(x=10, y=10), b=Pt(x=10, y=0)),
Edge(a=Pt(x=10, y=0), b=Pt(x=2.5, y=2.5))
)),
Poly(name='exagon', edges=(
Edge(a=Pt(x=3, y=0), b=Pt(x=7, y=0)),
Edge(a=Pt(x=7, y=0), b=Pt(x=10, y=5)),
Edge(a=Pt(x=10, y=5), b=Pt(x=7, y=10)),
Edge(a=Pt(x=7, y=10), b=Pt(x=3, y=10)),
Edge(a=Pt(x=3, y=10), b=Pt(x=0, y=5)),
Edge(a=Pt(x=0, y=5), b=Pt(x=3, y=0))
)),
]
testpoints = (Pt(x=5, y=5), Pt(x=5, y=8),
Pt(x=-10, y=5), Pt(x=0, y=5),
Pt(x=10, y=5), Pt(x=8, y=5),
Pt(x=10, y=10))
print ("\n TESTING WHETHER POINTS ARE WITHIN POLYGONS")
for poly in polys:
polypp(poly)
print (' ', '\t'.join("%s: %s" % (p, ispointinside(p, poly))
for p in testpoints[:3]))
print (' ', '\t'.join("%s: %s" % (p, ispointinside(p, poly))
for p in testpoints[3:6]))
print (' ', '\t'.join("%s: %s" % (p, ispointinside(p, poly))
for p in testpoints[6:]))
|
Convert the following code from VB to Python, ensuring the logic remains intact. | Function CountSubstring(str,substr)
CountSubstring = 0
For i = 1 To Len(str)
If Len(str) >= Len(substr) Then
If InStr(i,str,substr) Then
CountSubstring = CountSubstring + 1
i = InStr(i,str,substr) + Len(substr) - 1
End If
Else
Exit For
End If
Next
End Function
WScript.StdOut.Write CountSubstring("the three truths","th") & vbCrLf
WScript.StdOut.Write CountSubstring("ababababab","abab") & vbCrLf
| >>> "the three truths".count("th")
3
>>> "ababababab".count("abab")
2
|
Write a version of this VB function in Python with identical behavior. | Imports System
Imports System.Console
Imports LI = System.Collections.Generic.SortedSet(Of Integer)
Module Module1
Function unl(ByVal res As LI, ByVal lst As LI, ByVal lft As Integer, ByVal Optional mul As Integer = 1, ByVal Optional vlu As Integer = 0) As LI
If lft = 0 Then
res.Add(vlu)
ElseIf lft > 0 Then
For Each itm As Integer In lst
res = unl(res, lst, lft - itm, mul * 10, vlu + itm * mul)
Next
End If
Return res
End Function
Sub Main(ByVal args As String())
WriteLine(string.Join(" ",
unl(new LI From {}, new LI From { 2, 3, 5, 7 }, 13)))
End Sub
End Module
| from collections import deque
def prime_digits_sum(r):
q = deque([(r, 0)])
while q:
r, n = q.popleft()
for d in 2, 3, 5, 7:
if d >= r:
if d == r: yield n + d
break
q.append((r - d, (n + d) * 10))
print(*prime_digits_sum(13))
|
Translate the given VB code snippet into Python without altering its behavior. | Imports System
Imports System.Console
Imports LI = System.Collections.Generic.SortedSet(Of Integer)
Module Module1
Function unl(ByVal res As LI, ByVal lst As LI, ByVal lft As Integer, ByVal Optional mul As Integer = 1, ByVal Optional vlu As Integer = 0) As LI
If lft = 0 Then
res.Add(vlu)
ElseIf lft > 0 Then
For Each itm As Integer In lst
res = unl(res, lst, lft - itm, mul * 10, vlu + itm * mul)
Next
End If
Return res
End Function
Sub Main(ByVal args As String())
WriteLine(string.Join(" ",
unl(new LI From {}, new LI From { 2, 3, 5, 7 }, 13)))
End Sub
End Module
| from collections import deque
def prime_digits_sum(r):
q = deque([(r, 0)])
while q:
r, n = q.popleft()
for d in 2, 3, 5, 7:
if d >= r:
if d == r: yield n + d
break
q.append((r - d, (n + d) * 10))
print(*prime_digits_sum(13))
|
Change the programming language of this snippet from VB to Python without modifying what it does. | Imports System
Imports System.Console
Imports LI = System.Collections.Generic.SortedSet(Of Integer)
Module Module1
Function unl(ByVal res As LI, ByVal lst As LI, ByVal lft As Integer, ByVal Optional mul As Integer = 1, ByVal Optional vlu As Integer = 0) As LI
If lft = 0 Then
res.Add(vlu)
ElseIf lft > 0 Then
For Each itm As Integer In lst
res = unl(res, lst, lft - itm, mul * 10, vlu + itm * mul)
Next
End If
Return res
End Function
Sub Main(ByVal args As String())
WriteLine(string.Join(" ",
unl(new LI From {}, new LI From { 2, 3, 5, 7 }, 13)))
End Sub
End Module
| from collections import deque
def prime_digits_sum(r):
q = deque([(r, 0)])
while q:
r, n = q.popleft()
for d in 2, 3, 5, 7:
if d >= r:
if d == r: yield n + d
break
q.append((r - d, (n + d) * 10))
print(*prime_digits_sum(13))
|
Convert this VB block to Python, preserving its control flow and logic. | Imports System.IO
Module Notes
Function Main(ByVal cmdArgs() As String) As Integer
Try
If cmdArgs.Length = 0 Then
Using sr As New StreamReader("NOTES.TXT")
Console.WriteLine(sr.ReadToEnd)
End Using
Else
Using sw As New StreamWriter("NOTES.TXT", True)
sw.WriteLine(Date.Now.ToString())
sw.WriteLine("{0}{1}", ControlChars.Tab, String.Join(" ", cmdArgs))
End Using
End If
Catch
End Try
End Function
End Module
| import sys, datetime, shutil
if len(sys.argv) == 1:
try:
with open('notes.txt', 'r') as f:
shutil.copyfileobj(f, sys.stdout)
except IOError:
pass
else:
with open('notes.txt', 'a') as f:
f.write(datetime.datetime.now().isoformat() + '\n')
f.write("\t%s\n" % ' '.join(sys.argv[1:]))
|
Port the following code from VB to Python with equivalent syntax and logic. | Public Function CommonDirectoryPath(ParamArray Paths()) As String
Dim v As Variant
Dim Path() As String, s As String
Dim i As Long, j As Long, k As Long
Const PATH_SEPARATOR As String = "/"
For Each v In Paths
ReDim Preserve Path(0 To i)
Path(i) = v
i = i + 1
Next v
k = 1
Do
For i = 0 To UBound(Path)
If i Then
If InStr(k, Path(i), PATH_SEPARATOR) <> j Then
Exit Do
ElseIf Left$(Path(i), j) <> Left$(Path(0), j) Then
Exit Do
End If
Else
j = InStr(k, Path(i), PATH_SEPARATOR)
If j = 0 Then
Exit Do
End If
End If
Next i
s = Left$(Path(0), j + CLng(k <> 1))
k = j + 1
Loop
CommonDirectoryPath = s
End Function
Sub Main()
Debug.Assert CommonDirectoryPath( _
"/home/user1/tmp/coverage/test", _
"/home/user1/tmp/covert/operator", _
"/home/user1/tmp/coven/members") = _
"/home/user1/tmp"
Debug.Assert CommonDirectoryPath( _
"/home/user1/tmp/coverage/test", _
"/home/user1/tmp/covert/operator", _
"/home/user1/tmp/coven/members", _
"/home/user1/abc/coven/members") = _
"/home/user1"
Debug.Assert CommonDirectoryPath( _
"/home/user1/tmp/coverage/test", _
"/hope/user1/tmp/covert/operator", _
"/home/user1/tmp/coven/members") = _
"/"
End Sub
| >>> import os
>>> os.path.commonpath(['/home/user1/tmp/coverage/test',
'/home/user1/tmp/covert/operator', '/home/user1/tmp/coven/members'])
'/home/user1/tmp'
|
Generate an equivalent C# version of this VB code. | Debug.Print Hex(&HF0F0 And &HFF00)
Debug.Print Hex(&HF0F0 Or &HFF00)
Debug.Print Hex(&HF0F0 Xor &HFF00)
Debug.Print Hex(Not &HF0F0)
Debug.Print Hex(&HF0F0 Eqv &HFF00)
Debug.Print Hex(&HF0F0 Imp &HFF00)
| static void bitwise(int a, int b)
{
Console.WriteLine("a and b is {0}", a & b);
Console.WriteLine("a or b is {0}", a | b);
Console.WriteLine("a xor b is {0}", a ^ b);
Console.WriteLine("not a is {0}", ~a);
Console.WriteLine("a lshift b is {0}", a << b);
Console.WriteLine("a arshift b is {0}", a >> b);
uint c = (uint)a;
Console.WriteLine("c rshift b is {0}", c >> b);
}
|
Port the provided VB code into C# while preserving the original functionality. | option explicit
const pi180= 0.01745329251994329576923690768489
const pi=3.1415926535897932384626433832795
class turtle
dim fso
dim fn
dim svg
dim iang
dim ori
dim incr
dim pdown
dim clr
dim x
dim y
public property let orient(n):ori = n*pi180 :end property
public property let iangle(n):iang= n*pi180 :end property
public sub pd() : pdown=true: end sub
public sub pu() :pdown=FALSE :end sub
public sub rt(i)
ori=ori - i*iang:
end sub
public sub lt(i):
ori=(ori + i*iang)
end sub
public sub bw(l)
x= x+ cos(ori+pi)*l*incr
y= y+ sin(ori+pi)*l*incr
end sub
public sub fw(l)
dim x1,y1
x1=x + cos(ori)*l*incr
y1=y + sin(ori)*l*incr
if pdown then line x,y,x1,y1
x=x1:y=y1
end sub
Private Sub Class_Initialize()
setlocale "us"
initsvg
x=400:y=400:incr=100
ori=90*pi180
iang=90*pi180
clr=0
pdown=true
end sub
Private Sub Class_Terminate()
disply
end sub
private sub line (x,y,x1,y1)
svg.WriteLine "<line x1=""" & x & """ y1= """& y & """ x2=""" & x1& """ y2=""" & y1 & """/>"
end sub
private sub disply()
dim shell
svg.WriteLine "</svg></body></html>"
svg.close
Set shell = CreateObject("Shell.Application")
shell.ShellExecute fn,1,False
end sub
private sub initsvg()
dim scriptpath
Set fso = CreateObject ("Scripting.Filesystemobject")
ScriptPath= Left(WScript.ScriptFullName, InStrRev(WScript.ScriptFullName, "\"))
fn=Scriptpath & "SIERP.HTML"
Set svg = fso.CreateTextFile(fn,True)
if SVG IS nothing then wscript.echo "Can
svg.WriteLine "<!DOCTYPE html>" &vbcrlf & "<html>" &vbcrlf & "<head>"
svg.writeline "<style>" & vbcrlf & "line {stroke:rgb(255,0,0);stroke-width:.5}" &vbcrlf &"</style>"
svg.writeline "</head>"&vbcrlf & "<body>"
svg.WriteLine "<svg xmlns=""http://www.w3.org/2000/svg"" width=""800"" height=""800"" viewBox=""0 0 800 800"">"
end sub
end class
sub dragon(st,le,dir)
if st=0 then x.fw le: exit sub
x.rt dir
dragon st-1, le/1.41421 ,1
x.rt dir*2
dragon st-1, le/1.41421 ,-1
x.rt dir
end sub
dim x
set x=new turtle
x.iangle=45
x.orient=45
x.incr=1
x.x=200:x.y=200
dragon 12,300,1
set x=nothing
| using System;
using System.Collections.Generic;
using System.Drawing;
using System.Drawing.Drawing2D;
using System.Windows.Forms;
public class DragonCurve : Form
{
private List<int> turns;
private double startingAngle, side;
public DragonCurve(int iter)
{
Size = new Size(800, 600);
StartPosition = FormStartPosition.CenterScreen;
DoubleBuffered = true;
BackColor = Color.White;
startingAngle = -iter * (Math.PI / 4);
side = 400 / Math.Pow(2, iter / 2.0);
turns = getSequence(iter);
}
private List<int> getSequence(int iter)
{
var turnSequence = new List<int>();
for (int i = 0; i < iter; i++)
{
var copy = new List<int>(turnSequence);
copy.Reverse();
turnSequence.Add(1);
foreach (int turn in copy)
{
turnSequence.Add(-turn);
}
}
return turnSequence;
}
protected override void OnPaint(PaintEventArgs e)
{
base.OnPaint(e);
e.Graphics.SmoothingMode = SmoothingMode.AntiAlias;
double angle = startingAngle;
int x1 = 230, y1 = 350;
int x2 = x1 + (int)(Math.Cos(angle) * side);
int y2 = y1 + (int)(Math.Sin(angle) * side);
e.Graphics.DrawLine(Pens.Black, x1, y1, x2, y2);
x1 = x2;
y1 = y2;
foreach (int turn in turns)
{
angle += turn * (Math.PI / 2);
x2 = x1 + (int)(Math.Cos(angle) * side);
y2 = y1 + (int)(Math.Sin(angle) * side);
e.Graphics.DrawLine(Pens.Black, x1, y1, x2, y2);
x1 = x2;
y1 = y2;
}
}
[STAThread]
static void Main()
{
Application.Run(new DragonCurve(14));
}
}
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.