Instruction
stringlengths
45
106
input_code
stringlengths
1
13.7k
output_code
stringlengths
1
13.7k
Produce a language-to-language conversion: from Python to Go, same semantics.
import time, calendar, sched, winsound duration = 750 freq = 1280 bellchar = "\u2407" watches = 'Middle,Morning,Forenoon,Afternoon,First/Last dog,First'.split(',') def gap(n=1): time.sleep(n * duration / 1000) off = gap def on(n=1): winsound.Beep(freq, n * duration) def bong(): on(); off(0.5) def bongs(m): for i in range(m): print(bellchar, end=' ') bong() if i % 2: print(' ', end='') off(0.5) print('') scheds = sched.scheduler(time.time, time.sleep) def ships_bell(now=None): def adjust_to_half_hour(atime): atime[4] = (atime[4] // 30) * 30 atime[5] = 0 return atime debug = now is not None rightnow = time.gmtime() if not debug: now = adjust_to_half_hour( list(rightnow) ) then = now[::] then[4] += 30 hr, mn = now[3:5] watch, b = divmod(int(2 * hr + mn // 30 - 1), 8) b += 1 bells = '%i bell%s' % (b, 's' if b > 1 else ' ') if debug: print("%02i:%02i, %-20s %s" % (now[3], now[4], watches[watch] + ' watch', bells), end=' ') else: print("%02i:%02i, %-20s %s" % (rightnow[3], rightnow[4], watches[watch] + ' watch', bells), end=' ') bongs(b) if not debug: scheds.enterabs(calendar.timegm(then), 0, ships_bell) scheds.run() def dbg_tester(): for h in range(24): for m in (0, 30): if (h,m) == (24,30): break ships_bell( [2013, 3, 2, h, m, 15, 5, 61, 0] ) if __name__ == '__main__': ships_bell()
package main import ( "fmt" "strings" "time" ) func main() { watches := []string{ "First", "Middle", "Morning", "Forenoon", "Afternoon", "Dog", "First", } for { t := time.Now() h := t.Hour() m := t.Minute() s := t.Second() if (m == 0 || m == 30) && s == 0 { bell := 0 if m == 30 { bell = 1 } bells := (h*2 + bell) % 8 watch := h/4 + 1 if bells == 0 { bells = 8 watch-- } sound := strings.Repeat("\a", bells) pl := "s" if bells == 1 { pl = " " } w := watches[watch] + " watch" if watch == 5 { if bells < 5 { w = "First " + w } else { w = "Last " + w } } fmt.Printf("%s%02d:%02d = %d bell%s : %s\n", sound, h, m, bells, pl, w) } time.Sleep(1 * time.Second) } }
Port the following code from Python to Go with equivalent syntax and logic.
>>> Y = lambda f: (lambda x: x(x))(lambda y: f(lambda *args: y(y)(*args))) >>> fib = lambda f: lambda n: None if n < 0 else (0 if n == 0 else (1 if n == 1 else f(n-1) + f(n-2))) >>> [ Y(fib)(i) for i in range(-2, 10) ] [None, None, 0, 1, 1, 2, 3, 5, 8, 13, 21, 34]
package main import "fmt" func main() { for _, n := range []int{0, 1, 2, 3, 4, 5, 10, 40, -1} { f, ok := arFib(n) if ok { fmt.Printf("fib %d = %d\n", n, f) } else { fmt.Println("fib undefined for negative numbers") } } } func arFib(n int) (int, bool) { switch { case n < 0: return 0, false case n < 2: return n, true } return yc(func(recurse fn) fn { return func(left, term1, term2 int) int { if left == 0 { return term1+term2 } return recurse(left-1, term1+term2, term1) } })(n-2, 1, 0), true } type fn func(int, int, int) int type ff func(fn) fn type fx func(fx) fn func yc(f ff) fn { return func(x fx) fn { return x(x) }(func(x fx) fn { return f(func(a1, a2, a3 int) int { return x(x)(a1, a2, a3) }) }) }
Write a version of this Python function in Go with identical behavior.
print "knight"[1:] print "socks"[:-1] print "brooms"[1:-1]
package main import ( "fmt" "unicode/utf8" ) func main() { s := "ASCII" fmt.Println("String: ", s) fmt.Println("First byte removed: ", s[1:]) fmt.Println("Last byte removed: ", s[:len(s)-1]) fmt.Println("First and last removed:", s[1:len(s)-1]) u := "Δημοτική" fmt.Println("String: ", u) _, sizeFirst := utf8.DecodeRuneInString(u) fmt.Println("First rune removed: ", u[sizeFirst:]) _, sizeLast := utf8.DecodeLastRuneInString(u) fmt.Println("Last rune removed: ", u[:len(u)-sizeLast]) fmt.Println("First and last removed:", u[sizeFirst:len(u)-sizeLast]) }
Produce a language-to-language conversion: from Python to Go, same semantics.
print "knight"[1:] print "socks"[:-1] print "brooms"[1:-1]
package main import ( "fmt" "unicode/utf8" ) func main() { s := "ASCII" fmt.Println("String: ", s) fmt.Println("First byte removed: ", s[1:]) fmt.Println("Last byte removed: ", s[:len(s)-1]) fmt.Println("First and last removed:", s[1:len(s)-1]) u := "Δημοτική" fmt.Println("String: ", u) _, sizeFirst := utf8.DecodeRuneInString(u) fmt.Println("First rune removed: ", u[sizeFirst:]) _, sizeLast := utf8.DecodeLastRuneInString(u) fmt.Println("Last rune removed: ", u[:len(u)-sizeLast]) fmt.Println("First and last removed:", u[sizeFirst:len(u)-sizeLast]) }
Port the following code from Python to Go with equivalent syntax and logic.
print "knight"[1:] print "socks"[:-1] print "brooms"[1:-1]
package main import ( "fmt" "unicode/utf8" ) func main() { s := "ASCII" fmt.Println("String: ", s) fmt.Println("First byte removed: ", s[1:]) fmt.Println("Last byte removed: ", s[:len(s)-1]) fmt.Println("First and last removed:", s[1:len(s)-1]) u := "Δημοτική" fmt.Println("String: ", u) _, sizeFirst := utf8.DecodeRuneInString(u) fmt.Println("First rune removed: ", u[sizeFirst:]) _, sizeLast := utf8.DecodeLastRuneInString(u) fmt.Println("Last rune removed: ", u[:len(u)-sizeLast]) fmt.Println("First and last removed:", u[sizeFirst:len(u)-sizeLast]) }
Keep all operations the same but rewrite the snippet in Go.
from primesieve import primes from math import isqrt from functools import cache p = primes(isqrt(1_000_000_000)) @cache def phi(x, a): res = 0 while True: if not a or not x: return x + res a -= 1 res -= phi(x//p[a], a) def legpi(n): if n < 2: return 0 a = legpi(isqrt(n)) return phi(n, a) + a - 1 for e in range(10): print(f'10^{e}', legpi(10**e))
package main import ( "fmt" "log" "math" "rcu" ) func cantorPair(x, y int) int { if x < 0 || y < 0 { log.Fatal("Arguments must be non-negative integers.") } return (x*x + 3*x + 2*x*y + y + y*y) / 2 } func pi(n int) int { if n < 2 { return 0 } if n == 2 { return 1 } primes := rcu.Primes(int(math.Sqrt(float64(n)))) a := len(primes) memoPhi := make(map[int]int) var phi func(x, a int) int phi = func(x, a int) int { if a < 1 { return x } if a == 1 { return x - (x >> 1) } pa := primes[a-1] if x <= pa { return 1 } key := cantorPair(x, a) if v, ok := memoPhi[key]; ok { return v } memoPhi[key] = phi(x, a-1) - phi(x/pa, a-1) return memoPhi[key] } return phi(n, a) + a - 1 } func main() { for i, n := 0, 1; i <= 9; i, n = i+1, n*10 { fmt.Printf("10^%d %d\n", i, pi(n)) } }
Can you help me rewrite this code in Go instead of Python, keeping it the same logically?
def query(buffer_length): message = b'Here am I' L = len(message) return message[0:L*(L <= buffer_length)]
package main import "C" import "unsafe" func main() { C.Run() } const msg = "Here am I" func Query(cbuf *C.char, csiz *C.size_t) C.int { if int(*csiz) <= len(msg) { return 0 } pbuf := uintptr(unsafe.Pointer(cbuf)) for i := 0; i < len(msg); i++ { *((*byte)(unsafe.Pointer(pbuf))) = msg[i] pbuf++ } *((*byte)(unsafe.Pointer(pbuf))) = 0 *csiz = C.size_t(len(msg) + 1) return 1 }
Rewrite the snippet below in Go so it works the same as the original Python code.
import fileinput def longer(a, b): try: b[len(a)-1] return False except: return True longest, lines = '', '' for x in fileinput.input(): if longer(x, longest): lines, longest = x, x elif not longer(longest, x): lines += x print(lines, end='')
package main import ( "bufio" "os" ) func main() { in := bufio.NewReader(os.Stdin) var blankLine = "\n" var printLongest func(string) string printLongest = func(candidate string) (longest string) { longest = candidate s, err := in.ReadString('\n') defer func() { recover() defer func() { recover() }() _ = blankLine[0] func() { defer func() { recover() }() _ = s[len(longest)] longest = s }() longest = printLongest(longest) func() { defer func() { recover() os.Stdout.WriteString(s) }() _ = longest[len(s)] s = "" }() }() _ = err.(error) os.Stdout.WriteString(blankLine) blankLine = "" return } printLongest("") }
Port the provided Python code into Go while preserving the original functionality.
from __future__ import print_function def run_utm( state = None, blank = None, rules = [], tape = [], halt = None, pos = 0): st = state if not tape: tape = [blank] if pos < 0: pos += len(tape) if pos >= len(tape) or pos < 0: raise Error( "bad init position") rules = dict(((s0, v0), (v1, dr, s1)) for (s0, v0, v1, dr, s1) in rules) while True: print(st, '\t', end=" ") for i, v in enumerate(tape): if i == pos: print("[%s]" % (v,), end=" ") else: print(v, end=" ") print() if st == halt: break if (st, tape[pos]) not in rules: break (v1, dr, s1) = rules[(st, tape[pos])] tape[pos] = v1 if dr == 'left': if pos > 0: pos -= 1 else: tape.insert(0, blank) if dr == 'right': pos += 1 if pos >= len(tape): tape.append(blank) st = s1 print("incr machine\n") run_utm( halt = 'qf', state = 'q0', tape = list("111"), blank = 'B', rules = map(tuple, ["q0 1 1 right q0".split(), "q0 B 1 stay qf".split()] ) ) print("\nbusy beaver\n") run_utm( halt = 'halt', state = 'a', blank = '0', rules = map(tuple, ["a 0 1 right b".split(), "a 1 1 left c".split(), "b 0 1 left a".split(), "b 1 1 right b".split(), "c 0 1 left b".split(), "c 1 1 stay halt".split()] ) ) print("\nsorting test\n") run_utm(halt = 'STOP', state = 'A', blank = '0', tape = "2 2 2 1 2 2 1 2 1 2 1 2 1 2".split(), rules = map(tuple, ["A 1 1 right A".split(), "A 2 3 right B".split(), "A 0 0 left E".split(), "B 1 1 right B".split(), "B 2 2 right B".split(), "B 0 0 left C".split(), "C 1 2 left D".split(), "C 2 2 left C".split(), "C 3 2 left E".split(), "D 1 1 left D".split(), "D 2 2 left D".split(), "D 3 1 right A".split(), "E 1 1 left E".split(), "E 0 0 right STOP".split()] ) )
package turing type Symbol byte type Motion byte const ( Left Motion = 'L' Right Motion = 'R' Stay Motion = 'N' ) type Tape struct { data []Symbol pos, left int blank Symbol } func NewTape(blank Symbol, start int, data []Symbol) *Tape { t := &Tape{ data: data, blank: blank, } if start < 0 { t.Left(-start) } t.Right(start) return t } func (t *Tape) Stay() {} func (t *Tape) Data() []Symbol { return t.data[t.left:] } func (t *Tape) Read() Symbol { return t.data[t.pos] } func (t *Tape) Write(s Symbol) { t.data[t.pos] = s } func (t *Tape) Dup() *Tape { t2 := &Tape{ data: make([]Symbol, len(t.Data())), blank: t.blank, } copy(t2.data, t.Data()) t2.pos = t.pos - t.left return t2 } func (t *Tape) String() string { s := "" for i := t.left; i < len(t.data); i++ { b := t.data[i] if i == t.pos { s += "[" + string(b) + "]" } else { s += " " + string(b) + " " } } return s } func (t *Tape) Move(a Motion) { switch a { case Left: t.Left(1) case Right: t.Right(1) case Stay: t.Stay() } } const minSz = 16 func (t *Tape) Left(n int) { t.pos -= n if t.pos < 0 { var sz int for sz = minSz; cap(t.data[t.left:])-t.pos >= sz; sz <<= 1 { } newd := make([]Symbol, sz) newl := len(newd) - cap(t.data[t.left:]) n := copy(newd[newl:], t.data[t.left:]) t.data = newd[:newl+n] t.pos += newl - t.left t.left = newl } if t.pos < t.left { if t.blank != 0 { for i := t.pos; i < t.left; i++ { t.data[i] = t.blank } } t.left = t.pos } } func (t *Tape) Right(n int) { t.pos += n if t.pos >= cap(t.data) { var sz int for sz = minSz; t.pos >= sz; sz <<= 1 { } newd := make([]Symbol, sz) n := copy(newd[t.left:], t.data[t.left:]) t.data = newd[:t.left+n] } if i := len(t.data); t.pos >= i { t.data = t.data[:t.pos+1] if t.blank != 0 { for ; i < len(t.data); i++ { t.data[i] = t.blank } } } } type State string type Rule struct { State Symbol Write Symbol Motion Next State } func (i *Rule) key() key { return key{i.State, i.Symbol} } func (i *Rule) action() action { return action{i.Write, i.Motion, i.Next} } type key struct { State Symbol } type action struct { write Symbol Motion next State } type Machine struct { tape *Tape start, state State transition map[key]action l func(string, ...interface{}) } func NewMachine(rules []Rule) *Machine { m := &Machine{transition: make(map[key]action, len(rules))} if len(rules) > 0 { m.start = rules[0].State } for _, r := range rules { m.transition[r.key()] = r.action() } return m } func (m *Machine) Run(input *Tape) (int, *Tape) { m.tape = input.Dup() m.state = m.start for cnt := 0; ; cnt++ { if m.l != nil { m.l("%3d %4s: %v\n", cnt, m.state, m.tape) } sym := m.tape.Read() act, ok := m.transition[key{m.state, sym}] if !ok { return cnt, m.tape } m.tape.Write(act.write) m.tape.Move(act.Motion) m.state = act.next } }
Write a version of this Python function in Go with identical behavior.
from __future__ import print_function def run_utm( state = None, blank = None, rules = [], tape = [], halt = None, pos = 0): st = state if not tape: tape = [blank] if pos < 0: pos += len(tape) if pos >= len(tape) or pos < 0: raise Error( "bad init position") rules = dict(((s0, v0), (v1, dr, s1)) for (s0, v0, v1, dr, s1) in rules) while True: print(st, '\t', end=" ") for i, v in enumerate(tape): if i == pos: print("[%s]" % (v,), end=" ") else: print(v, end=" ") print() if st == halt: break if (st, tape[pos]) not in rules: break (v1, dr, s1) = rules[(st, tape[pos])] tape[pos] = v1 if dr == 'left': if pos > 0: pos -= 1 else: tape.insert(0, blank) if dr == 'right': pos += 1 if pos >= len(tape): tape.append(blank) st = s1 print("incr machine\n") run_utm( halt = 'qf', state = 'q0', tape = list("111"), blank = 'B', rules = map(tuple, ["q0 1 1 right q0".split(), "q0 B 1 stay qf".split()] ) ) print("\nbusy beaver\n") run_utm( halt = 'halt', state = 'a', blank = '0', rules = map(tuple, ["a 0 1 right b".split(), "a 1 1 left c".split(), "b 0 1 left a".split(), "b 1 1 right b".split(), "c 0 1 left b".split(), "c 1 1 stay halt".split()] ) ) print("\nsorting test\n") run_utm(halt = 'STOP', state = 'A', blank = '0', tape = "2 2 2 1 2 2 1 2 1 2 1 2 1 2".split(), rules = map(tuple, ["A 1 1 right A".split(), "A 2 3 right B".split(), "A 0 0 left E".split(), "B 1 1 right B".split(), "B 2 2 right B".split(), "B 0 0 left C".split(), "C 1 2 left D".split(), "C 2 2 left C".split(), "C 3 2 left E".split(), "D 1 1 left D".split(), "D 2 2 left D".split(), "D 3 1 right A".split(), "E 1 1 left E".split(), "E 0 0 right STOP".split()] ) )
package turing type Symbol byte type Motion byte const ( Left Motion = 'L' Right Motion = 'R' Stay Motion = 'N' ) type Tape struct { data []Symbol pos, left int blank Symbol } func NewTape(blank Symbol, start int, data []Symbol) *Tape { t := &Tape{ data: data, blank: blank, } if start < 0 { t.Left(-start) } t.Right(start) return t } func (t *Tape) Stay() {} func (t *Tape) Data() []Symbol { return t.data[t.left:] } func (t *Tape) Read() Symbol { return t.data[t.pos] } func (t *Tape) Write(s Symbol) { t.data[t.pos] = s } func (t *Tape) Dup() *Tape { t2 := &Tape{ data: make([]Symbol, len(t.Data())), blank: t.blank, } copy(t2.data, t.Data()) t2.pos = t.pos - t.left return t2 } func (t *Tape) String() string { s := "" for i := t.left; i < len(t.data); i++ { b := t.data[i] if i == t.pos { s += "[" + string(b) + "]" } else { s += " " + string(b) + " " } } return s } func (t *Tape) Move(a Motion) { switch a { case Left: t.Left(1) case Right: t.Right(1) case Stay: t.Stay() } } const minSz = 16 func (t *Tape) Left(n int) { t.pos -= n if t.pos < 0 { var sz int for sz = minSz; cap(t.data[t.left:])-t.pos >= sz; sz <<= 1 { } newd := make([]Symbol, sz) newl := len(newd) - cap(t.data[t.left:]) n := copy(newd[newl:], t.data[t.left:]) t.data = newd[:newl+n] t.pos += newl - t.left t.left = newl } if t.pos < t.left { if t.blank != 0 { for i := t.pos; i < t.left; i++ { t.data[i] = t.blank } } t.left = t.pos } } func (t *Tape) Right(n int) { t.pos += n if t.pos >= cap(t.data) { var sz int for sz = minSz; t.pos >= sz; sz <<= 1 { } newd := make([]Symbol, sz) n := copy(newd[t.left:], t.data[t.left:]) t.data = newd[:t.left+n] } if i := len(t.data); t.pos >= i { t.data = t.data[:t.pos+1] if t.blank != 0 { for ; i < len(t.data); i++ { t.data[i] = t.blank } } } } type State string type Rule struct { State Symbol Write Symbol Motion Next State } func (i *Rule) key() key { return key{i.State, i.Symbol} } func (i *Rule) action() action { return action{i.Write, i.Motion, i.Next} } type key struct { State Symbol } type action struct { write Symbol Motion next State } type Machine struct { tape *Tape start, state State transition map[key]action l func(string, ...interface{}) } func NewMachine(rules []Rule) *Machine { m := &Machine{transition: make(map[key]action, len(rules))} if len(rules) > 0 { m.start = rules[0].State } for _, r := range rules { m.transition[r.key()] = r.action() } return m } func (m *Machine) Run(input *Tape) (int, *Tape) { m.tape = input.Dup() m.state = m.start for cnt := 0; ; cnt++ { if m.l != nil { m.l("%3d %4s: %v\n", cnt, m.state, m.tape) } sym := m.tape.Read() act, ok := m.transition[key{m.state, sym}] if !ok { return cnt, m.tape } m.tape.Write(act.write) m.tape.Move(act.Motion) m.state = act.next } }
Can you help me rewrite this code in Go instead of Python, keeping it the same logically?
from __future__ import print_function def run_utm( state = None, blank = None, rules = [], tape = [], halt = None, pos = 0): st = state if not tape: tape = [blank] if pos < 0: pos += len(tape) if pos >= len(tape) or pos < 0: raise Error( "bad init position") rules = dict(((s0, v0), (v1, dr, s1)) for (s0, v0, v1, dr, s1) in rules) while True: print(st, '\t', end=" ") for i, v in enumerate(tape): if i == pos: print("[%s]" % (v,), end=" ") else: print(v, end=" ") print() if st == halt: break if (st, tape[pos]) not in rules: break (v1, dr, s1) = rules[(st, tape[pos])] tape[pos] = v1 if dr == 'left': if pos > 0: pos -= 1 else: tape.insert(0, blank) if dr == 'right': pos += 1 if pos >= len(tape): tape.append(blank) st = s1 print("incr machine\n") run_utm( halt = 'qf', state = 'q0', tape = list("111"), blank = 'B', rules = map(tuple, ["q0 1 1 right q0".split(), "q0 B 1 stay qf".split()] ) ) print("\nbusy beaver\n") run_utm( halt = 'halt', state = 'a', blank = '0', rules = map(tuple, ["a 0 1 right b".split(), "a 1 1 left c".split(), "b 0 1 left a".split(), "b 1 1 right b".split(), "c 0 1 left b".split(), "c 1 1 stay halt".split()] ) ) print("\nsorting test\n") run_utm(halt = 'STOP', state = 'A', blank = '0', tape = "2 2 2 1 2 2 1 2 1 2 1 2 1 2".split(), rules = map(tuple, ["A 1 1 right A".split(), "A 2 3 right B".split(), "A 0 0 left E".split(), "B 1 1 right B".split(), "B 2 2 right B".split(), "B 0 0 left C".split(), "C 1 2 left D".split(), "C 2 2 left C".split(), "C 3 2 left E".split(), "D 1 1 left D".split(), "D 2 2 left D".split(), "D 3 1 right A".split(), "E 1 1 left E".split(), "E 0 0 right STOP".split()] ) )
package turing type Symbol byte type Motion byte const ( Left Motion = 'L' Right Motion = 'R' Stay Motion = 'N' ) type Tape struct { data []Symbol pos, left int blank Symbol } func NewTape(blank Symbol, start int, data []Symbol) *Tape { t := &Tape{ data: data, blank: blank, } if start < 0 { t.Left(-start) } t.Right(start) return t } func (t *Tape) Stay() {} func (t *Tape) Data() []Symbol { return t.data[t.left:] } func (t *Tape) Read() Symbol { return t.data[t.pos] } func (t *Tape) Write(s Symbol) { t.data[t.pos] = s } func (t *Tape) Dup() *Tape { t2 := &Tape{ data: make([]Symbol, len(t.Data())), blank: t.blank, } copy(t2.data, t.Data()) t2.pos = t.pos - t.left return t2 } func (t *Tape) String() string { s := "" for i := t.left; i < len(t.data); i++ { b := t.data[i] if i == t.pos { s += "[" + string(b) + "]" } else { s += " " + string(b) + " " } } return s } func (t *Tape) Move(a Motion) { switch a { case Left: t.Left(1) case Right: t.Right(1) case Stay: t.Stay() } } const minSz = 16 func (t *Tape) Left(n int) { t.pos -= n if t.pos < 0 { var sz int for sz = minSz; cap(t.data[t.left:])-t.pos >= sz; sz <<= 1 { } newd := make([]Symbol, sz) newl := len(newd) - cap(t.data[t.left:]) n := copy(newd[newl:], t.data[t.left:]) t.data = newd[:newl+n] t.pos += newl - t.left t.left = newl } if t.pos < t.left { if t.blank != 0 { for i := t.pos; i < t.left; i++ { t.data[i] = t.blank } } t.left = t.pos } } func (t *Tape) Right(n int) { t.pos += n if t.pos >= cap(t.data) { var sz int for sz = minSz; t.pos >= sz; sz <<= 1 { } newd := make([]Symbol, sz) n := copy(newd[t.left:], t.data[t.left:]) t.data = newd[:t.left+n] } if i := len(t.data); t.pos >= i { t.data = t.data[:t.pos+1] if t.blank != 0 { for ; i < len(t.data); i++ { t.data[i] = t.blank } } } } type State string type Rule struct { State Symbol Write Symbol Motion Next State } func (i *Rule) key() key { return key{i.State, i.Symbol} } func (i *Rule) action() action { return action{i.Write, i.Motion, i.Next} } type key struct { State Symbol } type action struct { write Symbol Motion next State } type Machine struct { tape *Tape start, state State transition map[key]action l func(string, ...interface{}) } func NewMachine(rules []Rule) *Machine { m := &Machine{transition: make(map[key]action, len(rules))} if len(rules) > 0 { m.start = rules[0].State } for _, r := range rules { m.transition[r.key()] = r.action() } return m } func (m *Machine) Run(input *Tape) (int, *Tape) { m.tape = input.Dup() m.state = m.start for cnt := 0; ; cnt++ { if m.l != nil { m.l("%3d %4s: %v\n", cnt, m.state, m.tape) } sym := m.tape.Read() act, ok := m.transition[key{m.state, sym}] if !ok { return cnt, m.tape } m.tape.Write(act.write) m.tape.Move(act.Motion) m.state = act.next } }
Produce a language-to-language conversion: from Python to Go, same semantics.
import os for directory in ['/', './']: open(directory + 'output.txt', 'w').close() os.mkdir(directory + 'docs')
package main import ( "fmt" "os" ) func createFile(fn string) { f, err := os.Create(fn) if err != nil { fmt.Println(err) return } fmt.Println("file", fn, "created!") f.Close() } func createDir(dn string) { err := os.Mkdir(dn, 0666) if err != nil { fmt.Println(err) return } fmt.Println("directory", dn, "created!") } func main() { createFile("input.txt") createFile("/input.txt") createDir("docs") createDir("/docs") }
Please provide an equivalent version of this Python code in Go.
from itertools import count, islice def primes(_cache=[2, 3]): yield from _cache for n in count(_cache[-1]+2, 2): if isprime(n): _cache.append(n) yield n def isprime(n, _seen={0: False, 1: False}): def _isprime(n): for p in primes(): if p*p > n: return True if n%p == 0: return False if n not in _seen: _seen[n] = _isprime(n) return _seen[n] def unprime(): for a in count(1): d = 1 while d <= a: base = (a//(d*10))*(d*10) + (a%d) if any(isprime(y) for y in range(base, base + d*10, d)): break d *= 10 else: yield a print('First 35:') print(' '.join(str(i) for i in islice(unprime(), 35))) print('\nThe 600-th:') print(list(islice(unprime(), 599, 600))[0]) print() first, need = [False]*10, 10 for p in unprime(): i = p%10 if first[i]: continue first[i] = p need -= 1 if not need: break for i,v in enumerate(first): print(f'{i} ending: {v}')
package main import ( "fmt" "strconv" ) func isPrime(n int) bool { switch { case n < 2: return false case n%2 == 0: return n == 2 case n%3 == 0: return n == 3 default: d := 5 for d*d <= n { if n%d == 0 { return false } d += 2 if n%d == 0 { return false } d += 4 } return true } } func commatize(n int) string { s := fmt.Sprintf("%d", n) le := len(s) for i := le - 3; i >= 1; i -= 3 { s = s[0:i] + "," + s[i:] } return s } func main() { fmt.Println("The first 35 unprimeable numbers are:") count := 0 var firstNum [10]int outer: for i, countFirst := 100, 0; countFirst < 10; i++ { if isPrime(i) { continue } s := strconv.Itoa(i) le := len(s) b := []byte(s) for j := 0; j < le; j++ { for k := byte('0'); k <= '9'; k++ { if s[j] == k { continue } b[j] = k n, _ := strconv.Atoi(string(b)) if isPrime(n) { continue outer } } b[j] = s[j] } lastDigit := s[le-1] - '0' if firstNum[lastDigit] == 0 { firstNum[lastDigit] = i countFirst++ } count++ if count <= 35 { fmt.Printf("%d ", i) } if count == 35 { fmt.Print("\n\nThe 600th unprimeable number is: ") } if count == 600 { fmt.Printf("%s\n\n", commatize(i)) } } fmt.Println("The first unprimeable number that ends in:") for i := 0; i < 10; i++ { fmt.Printf(" %d is: %9s\n", i, commatize(firstNum[i])) } }
Rewrite the snippet below in Go so it works the same as the original Python code.
def combine( snl, snr ): cl = {} if isinstance(snl, int): cl['1'] = snl elif isinstance(snl, string): cl[snl] = 1 else: cl.update( snl) if isinstance(snr, int): n = cl.get('1', 0) cl['1'] = n + snr elif isinstance(snr, string): n = cl.get(snr, 0) cl[snr] = n + 1 else: for k,v in snr.items(): n = cl.get(k, 0) cl[k] = n+v return cl def constrain(nsum, vn ): nn = {} nn.update(vn) n = nn.get('1', 0) nn['1'] = n - nsum return nn def makeMatrix( constraints ): vmap = set() for c in constraints: vmap.update( c.keys()) vmap.remove('1') nvars = len(vmap) vmap = sorted(vmap) mtx = [] for c in constraints: row = [] for vv in vmap: row.append(float(c.get(vv, 0))) row.append(-float(c.get('1',0))) mtx.append(row) if len(constraints) == nvars: print 'System appears solvable' elif len(constraints) < nvars: print 'System is not solvable - needs more constraints.' return mtx, vmap def SolvePyramid( vl, cnstr ): vl.reverse() constraints = [cnstr] lvls = len(vl) for lvln in range(1,lvls): lvd = vl[lvln] for k in range(lvls - lvln): sn = lvd[k] ll = vl[lvln-1] vn = combine(ll[k], ll[k+1]) if sn is None: lvd[k] = vn else: constraints.append(constrain( sn, vn )) print 'Constraint Equations:' for cstr in constraints: fset = ('%d*%s'%(v,k) for k,v in cstr.items() ) print ' + '.join(fset), ' = 0' mtx,vmap = makeMatrix(constraints) MtxSolve(mtx) d = len(vmap) for j in range(d): print vmap[j],'=', mtx[j][d] def MtxSolve(mtx): mDim = len(mtx) for j in range(mDim): rw0= mtx[j] f = 1.0/rw0[j] for k in range(j, mDim+1): rw0[k] *= f for l in range(1+j,mDim): rwl = mtx[l] f = -rwl[j] for k in range(j, mDim+1): rwl[k] += f * rw0[k] for j1 in range(1,mDim): j = mDim - j1 rw0= mtx[j] for l in range(0, j): rwl = mtx[l] f = -rwl[j] rwl[j] += f * rw0[j] rwl[mDim] += f * rw0[mDim] return mtx p = [ [151], [None,None], [40,None,None], [None,None,None,None], ['X', 11, 'Y', 4, 'Z'] ] addlConstraint = { 'X':1, 'Y':-1, 'Z':1, '1':0 } SolvePyramid( p, addlConstraint)
package main import "fmt" type expr struct { x, y, z float64 c float64 } func addExpr(a, b expr) expr { return expr{a.x + b.x, a.y + b.y, a.z + b.z, a.c + b.c} } func subExpr(a, b expr) expr { return expr{a.x - b.x, a.y - b.y, a.z - b.z, a.c - b.c} } func mulExpr(a expr, c float64) expr { return expr{a.x * c, a.y * c, a.z * c, a.c * c} } func addRow(l []expr) []expr { if len(l) == 0 { panic("wrong") } r := make([]expr, len(l)-1) for i := range r { r[i] = addExpr(l[i], l[i+1]) } return r } func substX(a, b expr) expr { if b.x == 0 { panic("wrong") } return subExpr(a, mulExpr(b, a.x/b.x)) } func substY(a, b expr) expr { if b.y == 0 { panic("wrong") } return subExpr(a, mulExpr(b, a.y/b.y)) } func substZ(a, b expr) expr { if b.z == 0 { panic("wrong") } return subExpr(a, mulExpr(b, a.z/b.z)) } func solveX(a expr) float64 { if a.x == 0 || a.y != 0 || a.z != 0 { panic("wrong") } return -a.c / a.x } func solveY(a expr) float64 { if a.x != 0 || a.y == 0 || a.z != 0 { panic("wrong") } return -a.c / a.y } func solveZ(a expr) float64 { if a.x != 0 || a.y != 0 || a.z == 0 { panic("wrong") } return -a.c / a.z } func main() { r5 := []expr{{x: 1}, {c: 11}, {y: 1}, {c: 4}, {z: 1}} fmt.Println("bottom row:", r5) r4 := addRow(r5) fmt.Println("next row up:", r4) r3 := addRow(r4) fmt.Println("middle row:", r3) xyz := subExpr(expr{y: 1}, expr{x: 1, z: 1}) fmt.Println("xyz relation:", xyz) r3[2] = substZ(r3[2], xyz) fmt.Println("middle row after substituting for z:", r3) b := expr{c: 40} xy := subExpr(r3[0], b) fmt.Println("xy relation:", xy) r3[0] = b r3[2] = substX(r3[2], xy) fmt.Println("middle row after substituting for x:", r3) r2 := addRow(r3) fmt.Println("next row up:", r2) r1 := addRow(r2) fmt.Println("top row:", r1) y := subExpr(r1[0], expr{c: 151}) fmt.Println("y relation:", y) x := substY(xy, y) fmt.Println("x relation:", x) z := substX(substY(xyz, y), x) fmt.Println("z relation:", z) fmt.Println("x =", solveX(x)) fmt.Println("y =", solveY(y)) fmt.Println("z =", solveZ(z)) }
Can you help me rewrite this code in Go instead of Python, keeping it the same logically?
def combine( snl, snr ): cl = {} if isinstance(snl, int): cl['1'] = snl elif isinstance(snl, string): cl[snl] = 1 else: cl.update( snl) if isinstance(snr, int): n = cl.get('1', 0) cl['1'] = n + snr elif isinstance(snr, string): n = cl.get(snr, 0) cl[snr] = n + 1 else: for k,v in snr.items(): n = cl.get(k, 0) cl[k] = n+v return cl def constrain(nsum, vn ): nn = {} nn.update(vn) n = nn.get('1', 0) nn['1'] = n - nsum return nn def makeMatrix( constraints ): vmap = set() for c in constraints: vmap.update( c.keys()) vmap.remove('1') nvars = len(vmap) vmap = sorted(vmap) mtx = [] for c in constraints: row = [] for vv in vmap: row.append(float(c.get(vv, 0))) row.append(-float(c.get('1',0))) mtx.append(row) if len(constraints) == nvars: print 'System appears solvable' elif len(constraints) < nvars: print 'System is not solvable - needs more constraints.' return mtx, vmap def SolvePyramid( vl, cnstr ): vl.reverse() constraints = [cnstr] lvls = len(vl) for lvln in range(1,lvls): lvd = vl[lvln] for k in range(lvls - lvln): sn = lvd[k] ll = vl[lvln-1] vn = combine(ll[k], ll[k+1]) if sn is None: lvd[k] = vn else: constraints.append(constrain( sn, vn )) print 'Constraint Equations:' for cstr in constraints: fset = ('%d*%s'%(v,k) for k,v in cstr.items() ) print ' + '.join(fset), ' = 0' mtx,vmap = makeMatrix(constraints) MtxSolve(mtx) d = len(vmap) for j in range(d): print vmap[j],'=', mtx[j][d] def MtxSolve(mtx): mDim = len(mtx) for j in range(mDim): rw0= mtx[j] f = 1.0/rw0[j] for k in range(j, mDim+1): rw0[k] *= f for l in range(1+j,mDim): rwl = mtx[l] f = -rwl[j] for k in range(j, mDim+1): rwl[k] += f * rw0[k] for j1 in range(1,mDim): j = mDim - j1 rw0= mtx[j] for l in range(0, j): rwl = mtx[l] f = -rwl[j] rwl[j] += f * rw0[j] rwl[mDim] += f * rw0[mDim] return mtx p = [ [151], [None,None], [40,None,None], [None,None,None,None], ['X', 11, 'Y', 4, 'Z'] ] addlConstraint = { 'X':1, 'Y':-1, 'Z':1, '1':0 } SolvePyramid( p, addlConstraint)
package main import "fmt" type expr struct { x, y, z float64 c float64 } func addExpr(a, b expr) expr { return expr{a.x + b.x, a.y + b.y, a.z + b.z, a.c + b.c} } func subExpr(a, b expr) expr { return expr{a.x - b.x, a.y - b.y, a.z - b.z, a.c - b.c} } func mulExpr(a expr, c float64) expr { return expr{a.x * c, a.y * c, a.z * c, a.c * c} } func addRow(l []expr) []expr { if len(l) == 0 { panic("wrong") } r := make([]expr, len(l)-1) for i := range r { r[i] = addExpr(l[i], l[i+1]) } return r } func substX(a, b expr) expr { if b.x == 0 { panic("wrong") } return subExpr(a, mulExpr(b, a.x/b.x)) } func substY(a, b expr) expr { if b.y == 0 { panic("wrong") } return subExpr(a, mulExpr(b, a.y/b.y)) } func substZ(a, b expr) expr { if b.z == 0 { panic("wrong") } return subExpr(a, mulExpr(b, a.z/b.z)) } func solveX(a expr) float64 { if a.x == 0 || a.y != 0 || a.z != 0 { panic("wrong") } return -a.c / a.x } func solveY(a expr) float64 { if a.x != 0 || a.y == 0 || a.z != 0 { panic("wrong") } return -a.c / a.y } func solveZ(a expr) float64 { if a.x != 0 || a.y != 0 || a.z == 0 { panic("wrong") } return -a.c / a.z } func main() { r5 := []expr{{x: 1}, {c: 11}, {y: 1}, {c: 4}, {z: 1}} fmt.Println("bottom row:", r5) r4 := addRow(r5) fmt.Println("next row up:", r4) r3 := addRow(r4) fmt.Println("middle row:", r3) xyz := subExpr(expr{y: 1}, expr{x: 1, z: 1}) fmt.Println("xyz relation:", xyz) r3[2] = substZ(r3[2], xyz) fmt.Println("middle row after substituting for z:", r3) b := expr{c: 40} xy := subExpr(r3[0], b) fmt.Println("xy relation:", xy) r3[0] = b r3[2] = substX(r3[2], xy) fmt.Println("middle row after substituting for x:", r3) r2 := addRow(r3) fmt.Println("next row up:", r2) r1 := addRow(r2) fmt.Println("top row:", r1) y := subExpr(r1[0], expr{c: 151}) fmt.Println("y relation:", y) x := substY(xy, y) fmt.Println("x relation:", x) z := substX(substY(xyz, y), x) fmt.Println("z relation:", z) fmt.Println("x =", solveX(x)) fmt.Println("y =", solveY(y)) fmt.Println("z =", solveZ(z)) }
Preserve the algorithm and functionality while converting the code from Python to Go.
from sympy import isprime def primality_pretest(k): if not (k % 3) or not (k % 5) or not (k % 7) or not (k % 11) or not(k % 13) or not (k % 17) or not (k % 19) or not (k % 23): return (k <= 23) return True def is_chernick(n, m): t = 9 * m if not primality_pretest(6 * m + 1): return False if not primality_pretest(12 * m + 1): return False for i in range(1,n-1): if not primality_pretest((t << i) + 1): return False if not isprime(6 * m + 1): return False if not isprime(12 * m + 1): return False for i in range(1,n - 1): if not isprime((t << i) + 1): return False return True for n in range(3,10): if n > 4: multiplier = 1 << (n - 4) else: multiplier = 1 if n > 5: multiplier *= 5 k = 1 while True: m = k * multiplier if is_chernick(n, m): print("a("+str(n)+") has m = "+str(m)) break k += 1
package main import ( "fmt" "math/big" ) var ( zero = new(big.Int) prod = new(big.Int) fact = new(big.Int) ) func ccFactors(n, m uint64) (*big.Int, bool) { prod.SetUint64(6*m + 1) if !prod.ProbablyPrime(0) { return zero, false } fact.SetUint64(12*m + 1) if !fact.ProbablyPrime(0) { return zero, false } prod.Mul(prod, fact) for i := uint64(1); i <= n-2; i++ { fact.SetUint64((1<<i)*9*m + 1) if !fact.ProbablyPrime(0) { return zero, false } prod.Mul(prod, fact) } return prod, true } func ccNumbers(start, end uint64) { for n := start; n <= end; n++ { m := uint64(1) if n > 4 { m = 1 << (n - 4) } for { num, ok := ccFactors(n, m) if ok { fmt.Printf("a(%d) = %d\n", n, num) break } if n <= 4 { m++ } else { m += 1 << (n - 4) } } } } func main() { ccNumbers(3, 9) }
Write the same algorithm in Go as shown in this Python implementation.
from sympy import isprime def primality_pretest(k): if not (k % 3) or not (k % 5) or not (k % 7) or not (k % 11) or not(k % 13) or not (k % 17) or not (k % 19) or not (k % 23): return (k <= 23) return True def is_chernick(n, m): t = 9 * m if not primality_pretest(6 * m + 1): return False if not primality_pretest(12 * m + 1): return False for i in range(1,n-1): if not primality_pretest((t << i) + 1): return False if not isprime(6 * m + 1): return False if not isprime(12 * m + 1): return False for i in range(1,n - 1): if not isprime((t << i) + 1): return False return True for n in range(3,10): if n > 4: multiplier = 1 << (n - 4) else: multiplier = 1 if n > 5: multiplier *= 5 k = 1 while True: m = k * multiplier if is_chernick(n, m): print("a("+str(n)+") has m = "+str(m)) break k += 1
package main import ( "fmt" "math/big" ) var ( zero = new(big.Int) prod = new(big.Int) fact = new(big.Int) ) func ccFactors(n, m uint64) (*big.Int, bool) { prod.SetUint64(6*m + 1) if !prod.ProbablyPrime(0) { return zero, false } fact.SetUint64(12*m + 1) if !fact.ProbablyPrime(0) { return zero, false } prod.Mul(prod, fact) for i := uint64(1); i <= n-2; i++ { fact.SetUint64((1<<i)*9*m + 1) if !fact.ProbablyPrime(0) { return zero, false } prod.Mul(prod, fact) } return prod, true } func ccNumbers(start, end uint64) { for n := start; n <= end; n++ { m := uint64(1) if n > 4 { m = 1 << (n - 4) } for { num, ok := ccFactors(n, m) if ok { fmt.Printf("a(%d) = %d\n", n, num) break } if n <= 4 { m++ } else { m += 1 << (n - 4) } } } } func main() { ccNumbers(3, 9) }
Ensure the translated Go code behaves exactly like the original Python snippet.
from sympy.geometry import Point, Triangle def sign(pt1, pt2, pt3): return (pt1.x - pt3.x) * (pt2.y - pt3.y) - (pt2.x - pt3.x) * (pt1.y - pt3.y) def iswithin(point, pt1, pt2, pt3): zval1 = sign(point, pt1, pt2) zval2 = sign(point, pt2, pt3) zval3 = sign(point, pt3, pt1) notanyneg = zval1 >= 0 and zval2 >= 0 and zval3 >= 0 notanypos = zval1 <= 0 and zval2 <= 0 and zval3 <= 0 return notanyneg or notanypos if __name__ == "__main__": POINTS = [Point(0, 0)] TRI = Triangle(Point(1.5, 2.4), Point(5.1, -3.1), Point(-3.8, 0.5)) for pnt in POINTS: a, b, c = TRI.vertices isornot = "is" if iswithin(pnt, a, b, c) else "is not" print("Point", pnt, isornot, "within the triangle", TRI)
package main import ( "fmt" "math" ) const EPS = 0.001 const EPS_SQUARE = EPS * EPS func side(x1, y1, x2, y2, x, y float64) float64 { return (y2-y1)*(x-x1) + (-x2+x1)*(y-y1) } func naivePointInTriangle(x1, y1, x2, y2, x3, y3, x, y float64) bool { checkSide1 := side(x1, y1, x2, y2, x, y) >= 0 checkSide2 := side(x2, y2, x3, y3, x, y) >= 0 checkSide3 := side(x3, y3, x1, y1, x, y) >= 0 return checkSide1 && checkSide2 && checkSide3 } func pointInTriangleBoundingBox(x1, y1, x2, y2, x3, y3, x, y float64) bool { xMin := math.Min(x1, math.Min(x2, x3)) - EPS xMax := math.Max(x1, math.Max(x2, x3)) + EPS yMin := math.Min(y1, math.Min(y2, y3)) - EPS yMax := math.Max(y1, math.Max(y2, y3)) + EPS return !(x < xMin || xMax < x || y < yMin || yMax < y) } func distanceSquarePointToSegment(x1, y1, x2, y2, x, y float64) float64 { p1_p2_squareLength := (x2-x1)*(x2-x1) + (y2-y1)*(y2-y1) dotProduct := ((x-x1)*(x2-x1) + (y-y1)*(y2-y1)) / p1_p2_squareLength if dotProduct < 0 { return (x-x1)*(x-x1) + (y-y1)*(y-y1) } else if dotProduct <= 1 { p_p1_squareLength := (x1-x)*(x1-x) + (y1-y)*(y1-y) return p_p1_squareLength - dotProduct*dotProduct*p1_p2_squareLength } else { return (x-x2)*(x-x2) + (y-y2)*(y-y2) } } func accuratePointInTriangle(x1, y1, x2, y2, x3, y3, x, y float64) bool { if !pointInTriangleBoundingBox(x1, y1, x2, y2, x3, y3, x, y) { return false } if naivePointInTriangle(x1, y1, x2, y2, x3, y3, x, y) { return true } if distanceSquarePointToSegment(x1, y1, x2, y2, x, y) <= EPS_SQUARE { return true } if distanceSquarePointToSegment(x2, y2, x3, y3, x, y) <= EPS_SQUARE { return true } if distanceSquarePointToSegment(x3, y3, x1, y1, x, y) <= EPS_SQUARE { return true } return false } func main() { pts := [][2]float64{{0, 0}, {0, 1}, {3, 1}} tri := [][2]float64{{3.0 / 2, 12.0 / 5}, {51.0 / 10, -31.0 / 10}, {-19.0 / 5, 1.2}} fmt.Println("Triangle is", tri) x1, y1 := tri[0][0], tri[0][1] x2, y2 := tri[1][0], tri[1][1] x3, y3 := tri[2][0], tri[2][1] for _, pt := range pts { x, y := pt[0], pt[1] within := accuratePointInTriangle(x1, y1, x2, y2, x3, y3, x, y) fmt.Println("Point", pt, "is within triangle?", within) } fmt.Println() tri = [][2]float64{{1.0 / 10, 1.0 / 9}, {100.0 / 8, 100.0 / 3}, {100.0 / 4, 100.0 / 9}} fmt.Println("Triangle is", tri) x1, y1 = tri[0][0], tri[0][1] x2, y2 = tri[1][0], tri[1][1] x3, y3 = tri[2][0], tri[2][1] x := x1 + (3.0/7)*(x2-x1) y := y1 + (3.0/7)*(y2-y1) pt := [2]float64{x, y} within := accuratePointInTriangle(x1, y1, x2, y2, x3, y3, x, y) fmt.Println("Point", pt, "is within triangle ?", within) fmt.Println() tri = [][2]float64{{1.0 / 10, 1.0 / 9}, {100.0 / 8, 100.0 / 3}, {-100.0 / 8, 100.0 / 6}} fmt.Println("Triangle is", tri) x3 = tri[2][0] y3 = tri[2][1] within = accuratePointInTriangle(x1, y1, x2, y2, x3, y3, x, y) fmt.Println("Point", pt, "is within triangle ?", within) }
Translate the given Python code snippet into Go without altering its behavior.
from sympy.geometry import Point, Triangle def sign(pt1, pt2, pt3): return (pt1.x - pt3.x) * (pt2.y - pt3.y) - (pt2.x - pt3.x) * (pt1.y - pt3.y) def iswithin(point, pt1, pt2, pt3): zval1 = sign(point, pt1, pt2) zval2 = sign(point, pt2, pt3) zval3 = sign(point, pt3, pt1) notanyneg = zval1 >= 0 and zval2 >= 0 and zval3 >= 0 notanypos = zval1 <= 0 and zval2 <= 0 and zval3 <= 0 return notanyneg or notanypos if __name__ == "__main__": POINTS = [Point(0, 0)] TRI = Triangle(Point(1.5, 2.4), Point(5.1, -3.1), Point(-3.8, 0.5)) for pnt in POINTS: a, b, c = TRI.vertices isornot = "is" if iswithin(pnt, a, b, c) else "is not" print("Point", pnt, isornot, "within the triangle", TRI)
package main import ( "fmt" "math" ) const EPS = 0.001 const EPS_SQUARE = EPS * EPS func side(x1, y1, x2, y2, x, y float64) float64 { return (y2-y1)*(x-x1) + (-x2+x1)*(y-y1) } func naivePointInTriangle(x1, y1, x2, y2, x3, y3, x, y float64) bool { checkSide1 := side(x1, y1, x2, y2, x, y) >= 0 checkSide2 := side(x2, y2, x3, y3, x, y) >= 0 checkSide3 := side(x3, y3, x1, y1, x, y) >= 0 return checkSide1 && checkSide2 && checkSide3 } func pointInTriangleBoundingBox(x1, y1, x2, y2, x3, y3, x, y float64) bool { xMin := math.Min(x1, math.Min(x2, x3)) - EPS xMax := math.Max(x1, math.Max(x2, x3)) + EPS yMin := math.Min(y1, math.Min(y2, y3)) - EPS yMax := math.Max(y1, math.Max(y2, y3)) + EPS return !(x < xMin || xMax < x || y < yMin || yMax < y) } func distanceSquarePointToSegment(x1, y1, x2, y2, x, y float64) float64 { p1_p2_squareLength := (x2-x1)*(x2-x1) + (y2-y1)*(y2-y1) dotProduct := ((x-x1)*(x2-x1) + (y-y1)*(y2-y1)) / p1_p2_squareLength if dotProduct < 0 { return (x-x1)*(x-x1) + (y-y1)*(y-y1) } else if dotProduct <= 1 { p_p1_squareLength := (x1-x)*(x1-x) + (y1-y)*(y1-y) return p_p1_squareLength - dotProduct*dotProduct*p1_p2_squareLength } else { return (x-x2)*(x-x2) + (y-y2)*(y-y2) } } func accuratePointInTriangle(x1, y1, x2, y2, x3, y3, x, y float64) bool { if !pointInTriangleBoundingBox(x1, y1, x2, y2, x3, y3, x, y) { return false } if naivePointInTriangle(x1, y1, x2, y2, x3, y3, x, y) { return true } if distanceSquarePointToSegment(x1, y1, x2, y2, x, y) <= EPS_SQUARE { return true } if distanceSquarePointToSegment(x2, y2, x3, y3, x, y) <= EPS_SQUARE { return true } if distanceSquarePointToSegment(x3, y3, x1, y1, x, y) <= EPS_SQUARE { return true } return false } func main() { pts := [][2]float64{{0, 0}, {0, 1}, {3, 1}} tri := [][2]float64{{3.0 / 2, 12.0 / 5}, {51.0 / 10, -31.0 / 10}, {-19.0 / 5, 1.2}} fmt.Println("Triangle is", tri) x1, y1 := tri[0][0], tri[0][1] x2, y2 := tri[1][0], tri[1][1] x3, y3 := tri[2][0], tri[2][1] for _, pt := range pts { x, y := pt[0], pt[1] within := accuratePointInTriangle(x1, y1, x2, y2, x3, y3, x, y) fmt.Println("Point", pt, "is within triangle?", within) } fmt.Println() tri = [][2]float64{{1.0 / 10, 1.0 / 9}, {100.0 / 8, 100.0 / 3}, {100.0 / 4, 100.0 / 9}} fmt.Println("Triangle is", tri) x1, y1 = tri[0][0], tri[0][1] x2, y2 = tri[1][0], tri[1][1] x3, y3 = tri[2][0], tri[2][1] x := x1 + (3.0/7)*(x2-x1) y := y1 + (3.0/7)*(y2-y1) pt := [2]float64{x, y} within := accuratePointInTriangle(x1, y1, x2, y2, x3, y3, x, y) fmt.Println("Point", pt, "is within triangle ?", within) fmt.Println() tri = [][2]float64{{1.0 / 10, 1.0 / 9}, {100.0 / 8, 100.0 / 3}, {-100.0 / 8, 100.0 / 6}} fmt.Println("Triangle is", tri) x3 = tri[2][0] y3 = tri[2][1] within = accuratePointInTriangle(x1, y1, x2, y2, x3, y3, x, y) fmt.Println("Point", pt, "is within triangle ?", within) }
Convert this Python block to Go, preserving its control flow and logic.
def factorize(n): assert(isinstance(n, int)) if n < 0: n = -n if n < 2: return k = 0 while 0 == n%2: k += 1 n //= 2 if 0 < k: yield (2,k) p = 3 while p*p <= n: k = 0 while 0 == n%p: k += 1 n //= p if 0 < k: yield (p,k) p += 2 if 1 < n: yield (n,1) def tau(n): assert(n != 0) ans = 1 for (p,k) in factorize(n): ans *= 1 + k return ans if __name__ == "__main__": print(*map(tau, range(1, 101)))
package main import "fmt" func countDivisors(n int) int { count := 0 i := 1 k := 2 if n%2 == 0 { k = 1 } for i*i <= n { if n%i == 0 { count++ j := n / i if j != i { count++ } } i += k } return count } func main() { fmt.Println("The tau functions for the first 100 positive integers are:") for i := 1; i <= 100; i++ { fmt.Printf("%2d ", countDivisors(i)) if i%20 == 0 { fmt.Println() } } }
Generate a Go translation of this Python snippet without changing its computational steps.
def factorize(n): assert(isinstance(n, int)) if n < 0: n = -n if n < 2: return k = 0 while 0 == n%2: k += 1 n //= 2 if 0 < k: yield (2,k) p = 3 while p*p <= n: k = 0 while 0 == n%p: k += 1 n //= p if 0 < k: yield (p,k) p += 2 if 1 < n: yield (n,1) def tau(n): assert(n != 0) ans = 1 for (p,k) in factorize(n): ans *= 1 + k return ans if __name__ == "__main__": print(*map(tau, range(1, 101)))
package main import "fmt" func countDivisors(n int) int { count := 0 i := 1 k := 2 if n%2 == 0 { k = 1 } for i*i <= n { if n%i == 0 { count++ j := n / i if j != i { count++ } } i += k } return count } func main() { fmt.Println("The tau functions for the first 100 positive integers are:") for i := 1; i <= 100; i++ { fmt.Printf("%2d ", countDivisors(i)) if i%20 == 0 { fmt.Println() } } }
Convert the following code from Python to Go, ensuring the logic remains intact.
import pyprimes def primorial_prime(_pmax=500): isprime = pyprimes.isprime n, primo = 0, 1 for prime in pyprimes.nprimes(_pmax): n, primo = n+1, primo * prime if isprime(primo-1) or isprime(primo+1): yield n if __name__ == '__main__': pyprimes.warn_probably = False for i, n in zip(range(20), primorial_prime()): print('Primorial prime %2i at primorial index: %3i' % (i+1, n))
package main import ( "fmt" "math/big" ) func main() { one := big.NewInt(1) pm := big.NewInt(1) var px, nx int var pb big.Int primes(4000, func(p int64) bool { pm.Mul(pm, pb.SetInt64(p)) px++ if pb.Add(pm, one).ProbablyPrime(0) || pb.Sub(pm, one).ProbablyPrime(0) { fmt.Print(px, " ") nx++ if nx == 20 { fmt.Println() return false } } return true }) } func primes(limit int, f func(int64) bool) { c := make([]bool, limit) c[0] = true c[1] = true lm := int64(limit) p := int64(2) for { f(p) p2 := p * p if p2 >= lm { break } for i := p2; i < lm; i += p { c[i] = true } for { p++ if !c[p] { break } } } for p++; p < lm; p++ { if !c[p] && !f(p) { break } } }
Produce a language-to-language conversion: from Python to Go, same semantics.
from collections import Counter def basecount(dna): return sorted(Counter(dna).items()) def seq_split(dna, n=50): return [dna[i: i+n] for i in range(0, len(dna), n)] def seq_pp(dna, n=50): for i, part in enumerate(seq_split(dna, n)): print(f"{i*n:>5}: {part}") print("\n BASECOUNT:") tot = 0 for base, count in basecount(dna): print(f" {base:>3}: {count}") tot += count base, count = 'TOT', tot print(f" {base:>3}= {count}") if __name__ == '__main__': print("SEQUENCE:") sequence = seq_pp(sequence)
package main import ( "fmt" "sort" ) func main() { dna := "" + "CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATG" + "CTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTG" + "AGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGAT" + "GGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT" + "CGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGG" + "TCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA" + "TTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTAT" + "CGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTG" + "TCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGAC" + "GACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT" fmt.Println("SEQUENCE:") le := len(dna) for i := 0; i < le; i += 50 { k := i + 50 if k > le { k = le } fmt.Printf("%5d: %s\n", i, dna[i:k]) } baseMap := make(map[byte]int) for i := 0; i < le; i++ { baseMap[dna[i]]++ } var bases []byte for k := range baseMap { bases = append(bases, k) } sort.Slice(bases, func(i, j int) bool { return bases[i] < bases[j] }) fmt.Println("\nBASE COUNT:") for _, base := range bases { fmt.Printf(" %c: %3d\n", base, baseMap[base]) } fmt.Println(" ------") fmt.Println(" Σ:", le) fmt.Println(" ======") }
Maintain the same structure and functionality when rewriting this code in Go.
from collections import Counter def basecount(dna): return sorted(Counter(dna).items()) def seq_split(dna, n=50): return [dna[i: i+n] for i in range(0, len(dna), n)] def seq_pp(dna, n=50): for i, part in enumerate(seq_split(dna, n)): print(f"{i*n:>5}: {part}") print("\n BASECOUNT:") tot = 0 for base, count in basecount(dna): print(f" {base:>3}: {count}") tot += count base, count = 'TOT', tot print(f" {base:>3}= {count}") if __name__ == '__main__': print("SEQUENCE:") sequence = seq_pp(sequence)
package main import ( "fmt" "sort" ) func main() { dna := "" + "CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATG" + "CTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTG" + "AGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGAT" + "GGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT" + "CGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGG" + "TCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA" + "TTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTAT" + "CGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTG" + "TCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGAC" + "GACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT" fmt.Println("SEQUENCE:") le := len(dna) for i := 0; i < le; i += 50 { k := i + 50 if k > le { k = le } fmt.Printf("%5d: %s\n", i, dna[i:k]) } baseMap := make(map[byte]int) for i := 0; i < le; i++ { baseMap[dna[i]]++ } var bases []byte for k := range baseMap { bases = append(bases, k) } sort.Slice(bases, func(i, j int) bool { return bases[i] < bases[j] }) fmt.Println("\nBASE COUNT:") for _, base := range bases { fmt.Printf(" %c: %3d\n", base, baseMap[base]) } fmt.Println(" ------") fmt.Println(" Σ:", le) fmt.Println(" ======") }
Transform the following Python implementation into Go, maintaining the same output and logic.
from collections import Counter def basecount(dna): return sorted(Counter(dna).items()) def seq_split(dna, n=50): return [dna[i: i+n] for i in range(0, len(dna), n)] def seq_pp(dna, n=50): for i, part in enumerate(seq_split(dna, n)): print(f"{i*n:>5}: {part}") print("\n BASECOUNT:") tot = 0 for base, count in basecount(dna): print(f" {base:>3}: {count}") tot += count base, count = 'TOT', tot print(f" {base:>3}= {count}") if __name__ == '__main__': print("SEQUENCE:") sequence = seq_pp(sequence)
package main import ( "fmt" "sort" ) func main() { dna := "" + "CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATG" + "CTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTG" + "AGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGAT" + "GGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT" + "CGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGG" + "TCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA" + "TTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTAT" + "CGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTG" + "TCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGAC" + "GACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT" fmt.Println("SEQUENCE:") le := len(dna) for i := 0; i < le; i += 50 { k := i + 50 if k > le { k = le } fmt.Printf("%5d: %s\n", i, dna[i:k]) } baseMap := make(map[byte]int) for i := 0; i < le; i++ { baseMap[dna[i]]++ } var bases []byte for k := range baseMap { bases = append(bases, k) } sort.Slice(bases, func(i, j int) bool { return bases[i] < bases[j] }) fmt.Println("\nBASE COUNT:") for _, base := range bases { fmt.Printf(" %c: %3d\n", base, baseMap[base]) } fmt.Println(" ------") fmt.Println(" Σ:", le) fmt.Println(" ======") }
Write the same algorithm in Go as shown in this Python implementation.
import threading import random import time class Philosopher(threading.Thread): running = True def __init__(self, xname, forkOnLeft, forkOnRight): threading.Thread.__init__(self) self.name = xname self.forkOnLeft = forkOnLeft self.forkOnRight = forkOnRight def run(self): while(self.running): time.sleep( random.uniform(3,13)) print '%s is hungry.' % self.name self.dine() def dine(self): fork1, fork2 = self.forkOnLeft, self.forkOnRight while self.running: fork1.acquire(True) locked = fork2.acquire(False) if locked: break fork1.release() print '%s swaps forks' % self.name fork1, fork2 = fork2, fork1 else: return self.dining() fork2.release() fork1.release() def dining(self): print '%s starts eating '% self.name time.sleep(random.uniform(1,10)) print '%s finishes eating and leaves to think.' % self.name def DiningPhilosophers(): forks = [threading.Lock() for n in range(5)] philosopherNames = ('Aristotle','Kant','Spinoza','Marx', 'Russel') philosophers= [Philosopher(philosopherNames[i], forks[i%5], forks[(i+1)%5]) \ for i in range(5)] random.seed(507129) Philosopher.running = True for p in philosophers: p.start() time.sleep(100) Philosopher.running = False print ("Now we're finishing.") DiningPhilosophers()
package main import ( "hash/fnv" "log" "math/rand" "os" "time" ) var ph = []string{"Aristotle", "Kant", "Spinoza", "Marx", "Russell"} const hunger = 3 const think = time.Second / 100 const eat = time.Second / 100 var fmt = log.New(os.Stdout, "", 0) var done = make(chan bool) type fork byte func philosopher(phName string, dominantHand, otherHand chan fork, done chan bool) { fmt.Println(phName, "seated") h := fnv.New64a() h.Write([]byte(phName)) rg := rand.New(rand.NewSource(int64(h.Sum64()))) rSleep := func(t time.Duration) { time.Sleep(t/2 + time.Duration(rg.Int63n(int64(t)))) } for h := hunger; h > 0; h-- { fmt.Println(phName, "hungry") <-dominantHand <-otherHand fmt.Println(phName, "eating") rSleep(eat) dominantHand <- 'f' otherHand <- 'f' fmt.Println(phName, "thinking") rSleep(think) } fmt.Println(phName, "satisfied") done <- true fmt.Println(phName, "left the table") } func main() { fmt.Println("table empty") place0 := make(chan fork, 1) place0 <- 'f' placeLeft := place0 for i := 1; i < len(ph); i++ { placeRight := make(chan fork, 1) placeRight <- 'f' go philosopher(ph[i], placeLeft, placeRight, done) placeLeft = placeRight } go philosopher(ph[0], place0, placeLeft, done) for range ph { <-done } fmt.Println("table empty") }
Translate the given Python code snippet into Go without altering its behavior.
fact = [1] for n in range(1, 12): fact.append(fact[n-1] * n) for b in range(9, 12+1): print(f"The factorions for base {b} are:") for i in range(1, 1500000): fact_sum = 0 j = i while j > 0: d = j % b fact_sum += fact[d] j = j//b if fact_sum == i: print(i, end=" ") print("\n")
package main import ( "fmt" "strconv" ) func main() { var fact [12]uint64 fact[0] = 1 for n := uint64(1); n < 12; n++ { fact[n] = fact[n-1] * n } for b := 9; b <= 12; b++ { fmt.Printf("The factorions for base %d are:\n", b) for i := uint64(1); i < 1500000; i++ { digits := strconv.FormatUint(i, b) sum := uint64(0) for _, digit := range digits { if digit < 'a' { sum += fact[digit-'0'] } else { sum += fact[digit+10-'a'] } } if sum == i { fmt.Printf("%d ", i) } } fmt.Println("\n") } }
Keep all operations the same but rewrite the snippet in Go.
fact = [1] for n in range(1, 12): fact.append(fact[n-1] * n) for b in range(9, 12+1): print(f"The factorions for base {b} are:") for i in range(1, 1500000): fact_sum = 0 j = i while j > 0: d = j % b fact_sum += fact[d] j = j//b if fact_sum == i: print(i, end=" ") print("\n")
package main import ( "fmt" "strconv" ) func main() { var fact [12]uint64 fact[0] = 1 for n := uint64(1); n < 12; n++ { fact[n] = fact[n-1] * n } for b := 9; b <= 12; b++ { fmt.Printf("The factorions for base %d are:\n", b) for i := uint64(1); i < 1500000; i++ { digits := strconv.FormatUint(i, b) sum := uint64(0) for _, digit := range digits { if digit < 'a' { sum += fact[digit-'0'] } else { sum += fact[digit+10-'a'] } } if sum == i { fmt.Printf("%d ", i) } } fmt.Println("\n") } }
Please provide an equivalent version of this Python code in Go.
fact = [1] for n in range(1, 12): fact.append(fact[n-1] * n) for b in range(9, 12+1): print(f"The factorions for base {b} are:") for i in range(1, 1500000): fact_sum = 0 j = i while j > 0: d = j % b fact_sum += fact[d] j = j//b if fact_sum == i: print(i, end=" ") print("\n")
package main import ( "fmt" "strconv" ) func main() { var fact [12]uint64 fact[0] = 1 for n := uint64(1); n < 12; n++ { fact[n] = fact[n-1] * n } for b := 9; b <= 12; b++ { fmt.Printf("The factorions for base %d are:\n", b) for i := uint64(1); i < 1500000; i++ { digits := strconv.FormatUint(i, b) sum := uint64(0) for _, digit := range digits { if digit < 'a' { sum += fact[digit-'0'] } else { sum += fact[digit+10-'a'] } } if sum == i { fmt.Printf("%d ", i) } } fmt.Println("\n") } }
Rewrite the snippet below in Go so it works the same as the original Python code.
import numpy as np import scipy.optimize as opt n0, K = 27, 7_800_000_000 def f(t, r): return (n0 * np.exp(r * t)) / (( 1 + n0 * (np.exp(r * t) - 1) / K)) y = [ 27, 27, 27, 44, 44, 59, 59, 59, 59, 59, 59, 59, 59, 60, 60, 61, 61, 66, 83, 219, 239, 392, 534, 631, 897, 1350, 2023, 2820, 4587, 6067, 7823, 9826, 11946, 14554, 17372, 20615, 24522, 28273, 31491, 34933, 37552, 40540, 43105, 45177, 60328, 64543, 67103, 69265, 71332, 73327, 75191, 75723, 76719, 77804, 78812, 79339, 80132, 80995, 82101, 83365, 85203, 87024, 89068, 90664, 93077, 95316, 98172, 102133, 105824, 109695, 114232, 118610, 125497, 133852, 143227, 151367, 167418, 180096, 194836, 213150, 242364, 271106, 305117, 338133, 377918, 416845, 468049, 527767, 591704, 656866, 715353, 777796, 851308, 928436, 1000249, 1082054, 1174652, ] x = np.linspace(0.0, 96, 97) r, cov = opt.curve_fit(f, x, y, [0.5]) print("The r for the world Covid-19 data is:", r, ", with covariance of", cov) print("The calculated R0 is then", np.exp(12 * r))
package main import ( "fmt" "github.com/maorshutman/lm" "log" "math" ) const ( K = 7_800_000_000 n0 = 27 ) var y = []float64{ 27, 27, 27, 44, 44, 59, 59, 59, 59, 59, 59, 59, 59, 60, 60, 61, 61, 66, 83, 219, 239, 392, 534, 631, 897, 1350, 2023, 2820, 4587, 6067, 7823, 9826, 11946, 14554, 17372, 20615, 24522, 28273, 31491, 34933, 37552, 40540, 43105, 45177, 60328, 64543, 67103, 69265, 71332, 73327, 75191, 75723, 76719, 77804, 78812, 79339, 80132, 80995, 82101, 83365, 85203, 87024, 89068, 90664, 93077, 95316, 98172, 102133, 105824, 109695, 114232, 118610, 125497, 133852, 143227, 151367, 167418, 180096, 194836, 213150, 242364, 271106, 305117, 338133, 377918, 416845, 468049, 527767, 591704, 656866, 715353, 777796, 851308, 928436, 1000249, 1082054, 1174652, } func f(dst, p []float64) { for i := 0; i < len(y); i++ { t := float64(i) dst[i] = (n0*math.Exp(p[0]*t))/(1+n0*(math.Exp(p[0]*t)-1)/K) - y[i] } } func main() { j := lm.NumJac{Func: f} prob := lm.LMProblem{ Dim: 1, Size: len(y), Func: f, Jac: j.Jac, InitParams: []float64{0.5}, Tau: 1e-6, Eps1: 1e-8, Eps2: 1e-8, } res, err := lm.LM(prob, &lm.Settings{Iterations: 100, ObjectiveTol: 1e-16}) if err != nil { log.Fatal(err) } r := res.X[0] fmt.Printf("The logistic curve r for the world data is %.8f\n", r) fmt.Printf("R0 is then approximately equal to %.7f\n", math.Exp(12*r)) }
Rewrite this program in Go while keeping its functionality equivalent to the Python version.
def merge_list(a, b): out = [] while len(a) and len(b): if a[0] < b[0]: out.append(a.pop(0)) else: out.append(b.pop(0)) out += a out += b return out def strand(a): i, s = 0, [a.pop(0)] while i < len(a): if a[i] > s[-1]: s.append(a.pop(i)) else: i += 1 return s def strand_sort(a): out = strand(a) while len(a): out = merge_list(out, strand(a)) return out print strand_sort([1, 6, 3, 2, 1, 7, 5, 3])
package main import "fmt" type link struct { int next *link } func linkInts(s []int) *link { if len(s) == 0 { return nil } return &link{s[0], linkInts(s[1:])} } func (l *link) String() string { if l == nil { return "nil" } r := fmt.Sprintf("[%d", l.int) for l = l.next; l != nil; l = l.next { r = fmt.Sprintf("%s %d", r, l.int) } return r + "]" } func main() { a := linkInts([]int{170, 45, 75, -90, -802, 24, 2, 66}) fmt.Println("before:", a) b := strandSort(a) fmt.Println("after: ", b) } func strandSort(a *link) (result *link) { for a != nil { sublist := a a = a.next sTail := sublist for p, pPrev := a, a; p != nil; p = p.next { if p.int > sTail.int { sTail.next = p sTail = p if p == a { a = p.next } else { pPrev.next = p.next } } else { pPrev = p } } sTail.next = nil if result == nil { result = sublist continue } var m, rr *link if sublist.int < result.int { m = sublist sublist = m.next rr = result } else { m = result rr = m.next } result = m for { if sublist == nil { m.next = rr break } if rr == nil { m.next = sublist break } if sublist.int < rr.int { m.next = sublist m = sublist sublist = m.next } else { m.next = rr m = rr rr = m.next } } } return }
Produce a functionally identical Go code for the snippet given in Python.
def is_prime(n: int) -> bool: if n <= 3: return n > 1 if n % 2 == 0 or n % 3 == 0: return False i = 5 while i ** 2 <= n: if n % i == 0 or n % (i + 2) == 0: return False i += 6 return True def digit_sum(n: int) -> int: sum = 0 while n > 0: sum += n % 10 n //= 10 return sum def main() -> None: additive_primes = 0 for i in range(2, 500): if is_prime(i) and is_prime(digit_sum(i)): additive_primes += 1 print(i, end=" ") print(f"\nFound {additive_primes} additive primes less than 500") if __name__ == "__main__": main()
package main import "fmt" func isPrime(n int) bool { switch { case n < 2: return false case n%2 == 0: return n == 2 case n%3 == 0: return n == 3 default: d := 5 for d*d <= n { if n%d == 0 { return false } d += 2 if n%d == 0 { return false } d += 4 } return true } } func sumDigits(n int) int { sum := 0 for n > 0 { sum += n % 10 n /= 10 } return sum } func main() { fmt.Println("Additive primes less than 500:") i := 2 count := 0 for { if isPrime(i) && isPrime(sumDigits(i)) { count++ fmt.Printf("%3d ", i) if count%10 == 0 { fmt.Println() } } if i > 2 { i += 2 } else { i++ } if i > 499 { break } } fmt.Printf("\n\n%d additive primes found.\n", count) }
Port the provided Python code into Go while preserving the original functionality.
x = truevalue if condition else falsevalue
package main import "fmt" type ibool bool const itrue ibool = true func (ib ibool) iif(cond bool) bool { if cond { return bool(ib) } return bool(!ib) } func main() { var needUmbrella bool raining := true if raining { needUmbrella = true } fmt.Printf("Is it raining? %t. Do I need an umbrella? %t\n", raining, needUmbrella) raining = false needUmbrella = itrue.iif(raining) fmt.Printf("Is it raining? %t. Do I need an umbrella? %t\n", raining, needUmbrella) }
Write the same code in Go as shown below in Python.
x = truevalue if condition else falsevalue
package main import "fmt" type ibool bool const itrue ibool = true func (ib ibool) iif(cond bool) bool { if cond { return bool(ib) } return bool(!ib) } func main() { var needUmbrella bool raining := true if raining { needUmbrella = true } fmt.Printf("Is it raining? %t. Do I need an umbrella? %t\n", raining, needUmbrella) raining = false needUmbrella = itrue.iif(raining) fmt.Printf("Is it raining? %t. Do I need an umbrella? %t\n", raining, needUmbrella) }
Please provide an equivalent version of this Python code in Go.
from math import gcd from functools import lru_cache from itertools import islice, count @lru_cache(maxsize=None) def φ(n): return sum(1 for k in range(1, n + 1) if gcd(n, k) == 1) def perfect_totient(): for n0 in count(1): parts, n = 0, n0 while n != 1: n = φ(n) parts += n if parts == n0: yield n0 if __name__ == '__main__': print(list(islice(perfect_totient(), 20)))
package main import "fmt" func gcd(n, k int) int { if n < k || k < 1 { panic("Need n >= k and k >= 1") } s := 1 for n&1 == 0 && k&1 == 0 { n >>= 1 k >>= 1 s <<= 1 } t := n if n&1 != 0 { t = -k } for t != 0 { for t&1 == 0 { t >>= 1 } if t > 0 { n = t } else { k = -t } t = n - k } return n * s } func totient(n int) int { tot := 0 for k := 1; k <= n; k++ { if gcd(n, k) == 1 { tot++ } } return tot } func main() { var perfect []int for n := 1; len(perfect) < 20; n += 2 { tot := n sum := 0 for tot != 1 { tot = totient(tot) sum += tot } if sum == n { perfect = append(perfect, n) } } fmt.Println("The first 20 perfect totient numbers are:") fmt.Println(perfect) }
Convert the following code from Python to Go, ensuring the logic remains intact.
from math import gcd from functools import lru_cache from itertools import islice, count @lru_cache(maxsize=None) def φ(n): return sum(1 for k in range(1, n + 1) if gcd(n, k) == 1) def perfect_totient(): for n0 in count(1): parts, n = 0, n0 while n != 1: n = φ(n) parts += n if parts == n0: yield n0 if __name__ == '__main__': print(list(islice(perfect_totient(), 20)))
package main import "fmt" func gcd(n, k int) int { if n < k || k < 1 { panic("Need n >= k and k >= 1") } s := 1 for n&1 == 0 && k&1 == 0 { n >>= 1 k >>= 1 s <<= 1 } t := n if n&1 != 0 { t = -k } for t != 0 { for t&1 == 0 { t >>= 1 } if t > 0 { n = t } else { k = -t } t = n - k } return n * s } func totient(n int) int { tot := 0 for k := 1; k <= n; k++ { if gcd(n, k) == 1 { tot++ } } return tot } func main() { var perfect []int for n := 1; len(perfect) < 20; n += 2 { tot := n sum := 0 for tot != 1 { tot = totient(tot) sum += tot } if sum == n { perfect = append(perfect, n) } } fmt.Println("The first 20 perfect totient numbers are:") fmt.Println(perfect) }
Rewrite the snippet below in Go so it works the same as the original Python code.
class Delegator: def __init__(self): self.delegate = None def operation(self): if hasattr(self.delegate, 'thing') and callable(self.delegate.thing): return self.delegate.thing() return 'default implementation' class Delegate: def thing(self): return 'delegate implementation' if __name__ == '__main__': a = Delegator() assert a.operation() == 'default implementation' a.delegate = 'A delegate may be any object' assert a.operation() == 'default implementation' a.delegate = Delegate() assert a.operation() == 'delegate implementation'
package main import "fmt" type Delegator struct { delegate interface{} } type Thingable interface { thing() string } func (self Delegator) operation() string { if v, ok := self.delegate.(Thingable); ok { return v.thing() } return "default implementation" } type Delegate int func (Delegate) thing() string { return "delegate implementation" } func main() { a := Delegator{} fmt.Println(a.operation()) a.delegate = "A delegate may be any object" fmt.Println(a.operation()) var d Delegate a.delegate = d fmt.Println(a.operation()) }
Change the following Python code into Go without altering its purpose.
def factorize(n): assert(isinstance(n, int)) if n < 0: n = -n if n < 2: return k = 0 while 0 == n%2: k += 1 n //= 2 if 0 < k: yield (2,k) p = 3 while p*p <= n: k = 0 while 0 == n%p: k += 1 n //= p if 0 < k: yield (p,k) p += 2 if 1 < n: yield (n,1) def sum_of_divisors(n): assert(n != 0) ans = 1 for (p,k) in factorize(n): ans *= (pow(p,k+1) - 1)//(p-1) return ans if __name__ == "__main__": print([sum_of_divisors(n) for n in range(1,101)])
package main import "fmt" func sumDivisors(n int) int { sum := 0 i := 1 k := 2 if n%2 == 0 { k = 1 } for i*i <= n { if n%i == 0 { sum += i j := n / i if j != i { sum += j } } i += k } return sum } func main() { fmt.Println("The sums of positive divisors for the first 100 positive integers are:") for i := 1; i <= 100; i++ { fmt.Printf("%3d ", sumDivisors(i)) if i%10 == 0 { fmt.Println() } } }
Change the following Python code into Go without altering its purpose.
def factorize(n): assert(isinstance(n, int)) if n < 0: n = -n if n < 2: return k = 0 while 0 == n%2: k += 1 n //= 2 if 0 < k: yield (2,k) p = 3 while p*p <= n: k = 0 while 0 == n%p: k += 1 n //= p if 0 < k: yield (p,k) p += 2 if 1 < n: yield (n,1) def sum_of_divisors(n): assert(n != 0) ans = 1 for (p,k) in factorize(n): ans *= (pow(p,k+1) - 1)//(p-1) return ans if __name__ == "__main__": print([sum_of_divisors(n) for n in range(1,101)])
package main import "fmt" func sumDivisors(n int) int { sum := 0 i := 1 k := 2 if n%2 == 0 { k = 1 } for i*i <= n { if n%i == 0 { sum += i j := n / i if j != i { sum += j } } i += k } return sum } func main() { fmt.Println("The sums of positive divisors for the first 100 positive integers are:") for i := 1; i <= 100; i++ { fmt.Printf("%3d ", sumDivisors(i)) if i%10 == 0 { fmt.Println() } } }
Produce a functionally identical Go code for the snippet given in Python.
command_table_text = \ user_words = "riG rePEAT copies put mo rest types fup. 6 poweRin" def find_abbreviations_length(command_table_text): command_table = dict() for word in command_table_text.split(): abbr_len = sum(1 for c in word if c.isupper()) if abbr_len == 0: abbr_len = len(word) command_table[word] = abbr_len return command_table def find_abbreviations(command_table): abbreviations = dict() for command, min_abbr_len in command_table.items(): for l in range(min_abbr_len, len(command)+1): abbr = command[:l].lower() abbreviations[abbr] = command.upper() return abbreviations def parse_user_string(user_string, abbreviations): user_words = [word.lower() for word in user_string.split()] commands = [abbreviations.get(user_word, "*error*") for user_word in user_words] return " ".join(commands) command_table = find_abbreviations_length(command_table_text) abbreviations_table = find_abbreviations(command_table) full_words = parse_user_string(user_words, abbreviations_table) print("user words:", user_words) print("full words:", full_words)
package main import ( "fmt" "strings" ) var table = "Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy " + "COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find " + "NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput " + "Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO " + "MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT " + "READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT " + "RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up " func validate(commands, words []string, minLens []int) []string { results := make([]string, 0) if len(words) == 0 { return results } for _, word := range words { matchFound := false wlen := len(word) for i, command := range commands { if minLens[i] == 0 || wlen < minLens[i] || wlen > len(command) { continue } c := strings.ToUpper(command) w := strings.ToUpper(word) if strings.HasPrefix(c, w) { results = append(results, c) matchFound = true break } } if !matchFound { results = append(results, "*error*") } } return results } func main() { table = strings.TrimSpace(table) commands := strings.Fields(table) clen := len(commands) minLens := make([]int, clen) for i := 0; i < clen; i++ { count := 0 for _, c := range commands[i] { if c >= 'A' && c <= 'Z' { count++ } } minLens[i] = count } sentence := "riG rePEAT copies put mo rest types fup. 6 poweRin" words := strings.Fields(sentence) results := validate(commands, words, minLens) fmt.Print("user words: ") for j := 0; j < len(words); j++ { fmt.Printf("%-*s ", len(results[j]), words[j]) } fmt.Print("\nfull words: ") fmt.Println(strings.Join(results, " ")) }
Change the programming language of this snippet from Python to Go without modifying what it does.
command_table_text = \ user_words = "riG rePEAT copies put mo rest types fup. 6 poweRin" def find_abbreviations_length(command_table_text): command_table = dict() for word in command_table_text.split(): abbr_len = sum(1 for c in word if c.isupper()) if abbr_len == 0: abbr_len = len(word) command_table[word] = abbr_len return command_table def find_abbreviations(command_table): abbreviations = dict() for command, min_abbr_len in command_table.items(): for l in range(min_abbr_len, len(command)+1): abbr = command[:l].lower() abbreviations[abbr] = command.upper() return abbreviations def parse_user_string(user_string, abbreviations): user_words = [word.lower() for word in user_string.split()] commands = [abbreviations.get(user_word, "*error*") for user_word in user_words] return " ".join(commands) command_table = find_abbreviations_length(command_table_text) abbreviations_table = find_abbreviations(command_table) full_words = parse_user_string(user_words, abbreviations_table) print("user words:", user_words) print("full words:", full_words)
package main import ( "fmt" "strings" ) var table = "Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy " + "COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find " + "NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput " + "Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO " + "MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT " + "READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT " + "RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up " func validate(commands, words []string, minLens []int) []string { results := make([]string, 0) if len(words) == 0 { return results } for _, word := range words { matchFound := false wlen := len(word) for i, command := range commands { if minLens[i] == 0 || wlen < minLens[i] || wlen > len(command) { continue } c := strings.ToUpper(command) w := strings.ToUpper(word) if strings.HasPrefix(c, w) { results = append(results, c) matchFound = true break } } if !matchFound { results = append(results, "*error*") } } return results } func main() { table = strings.TrimSpace(table) commands := strings.Fields(table) clen := len(commands) minLens := make([]int, clen) for i := 0; i < clen; i++ { count := 0 for _, c := range commands[i] { if c >= 'A' && c <= 'Z' { count++ } } minLens[i] = count } sentence := "riG rePEAT copies put mo rest types fup. 6 poweRin" words := strings.Fields(sentence) results := validate(commands, words, minLens) fmt.Print("user words: ") for j := 0; j < len(words); j++ { fmt.Printf("%-*s ", len(results[j]), words[j]) } fmt.Print("\nfull words: ") fmt.Println(strings.Join(results, " ")) }
Convert this Python snippet to Go and keep its semantics consistent.
>>> s = "Hello" >>> s[0] = "h" Traceback (most recent call last): File "<pyshell s[0] = "h" TypeError: 'str' object does not support item assignment
package main func main() { s := "immutable" s[0] = 'a' }
Rewrite this program in Go while keeping its functionality equivalent to the Python version.
def clip(subjectPolygon, clipPolygon): def inside(p): return(cp2[0]-cp1[0])*(p[1]-cp1[1]) > (cp2[1]-cp1[1])*(p[0]-cp1[0]) def computeIntersection(): dc = [ cp1[0] - cp2[0], cp1[1] - cp2[1] ] dp = [ s[0] - e[0], s[1] - e[1] ] n1 = cp1[0] * cp2[1] - cp1[1] * cp2[0] n2 = s[0] * e[1] - s[1] * e[0] n3 = 1.0 / (dc[0] * dp[1] - dc[1] * dp[0]) return [(n1*dp[0] - n2*dc[0]) * n3, (n1*dp[1] - n2*dc[1]) * n3] outputList = subjectPolygon cp1 = clipPolygon[-1] for clipVertex in clipPolygon: cp2 = clipVertex inputList = outputList outputList = [] s = inputList[-1] for subjectVertex in inputList: e = subjectVertex if inside(e): if not inside(s): outputList.append(computeIntersection()) outputList.append(e) elif inside(s): outputList.append(computeIntersection()) s = e cp1 = cp2 return(outputList)
package main import "fmt" type point struct { x, y float32 } var subjectPolygon = []point{{50, 150}, {200, 50}, {350, 150}, {350, 300}, {250, 300}, {200, 250}, {150, 350}, {100, 250}, {100, 200}} var clipPolygon = []point{{100, 100}, {300, 100}, {300, 300}, {100, 300}} func main() { var cp1, cp2, s, e point inside := func(p point) bool { return (cp2.x-cp1.x)*(p.y-cp1.y) > (cp2.y-cp1.y)*(p.x-cp1.x) } intersection := func() (p point) { dcx, dcy := cp1.x-cp2.x, cp1.y-cp2.y dpx, dpy := s.x-e.x, s.y-e.y n1 := cp1.x*cp2.y - cp1.y*cp2.x n2 := s.x*e.y - s.y*e.x n3 := 1 / (dcx*dpy - dcy*dpx) p.x = (n1*dpx - n2*dcx) * n3 p.y = (n1*dpy - n2*dcy) * n3 return } outputList := subjectPolygon cp1 = clipPolygon[len(clipPolygon)-1] for _, cp2 = range clipPolygon { inputList := outputList outputList = nil s = inputList[len(inputList)-1] for _, e = range inputList { if inside(e) { if !inside(s) { outputList = append(outputList, intersection()) } outputList = append(outputList, e) } else if inside(s) { outputList = append(outputList, intersection()) } s = e } cp1 = cp2 } fmt.Println(outputList) }
Translate this program into Go but keep the logic exactly as in Python.
import string sometext = .lower() lc2bin = {ch: '{:05b}'.format(i) for i, ch in enumerate(string.ascii_lowercase + ' .')} bin2lc = {val: key for key, val in lc2bin.items()} phrase = 'Rosetta code Bacon cipher example secret phrase to encode in the capitalisation of peter pan'.lower() def to_5binary(msg): return ( ch == '1' for ch in ''.join(lc2bin.get(ch, '') for ch in msg.lower())) def encrypt(message, text): bin5 = to_5binary(message) textlist = list(text.lower()) out = [] for capitalise in bin5: while textlist: ch = textlist.pop(0) if ch.isalpha(): if capitalise: ch = ch.upper() out.append(ch) break else: out.append(ch) else: raise Exception('ERROR: Ran out of characters in sometext') return ''.join(out) + '...' def decrypt(bacontext): binary = [] bin5 = [] out = [] for ch in bacontext: if ch.isalpha(): binary.append('1' if ch.isupper() else '0') if len(binary) == 5: bin5 = ''.join(binary) out.append(bin2lc[bin5]) binary = [] return ''.join(out) print('PLAINTEXT = \n%s\n' % phrase) encrypted = encrypt(phrase, sometext) print('ENCRYPTED = \n%s\n' % encrypted) decrypted = decrypt(encrypted) print('DECRYPTED = \n%s\n' % decrypted) assert phrase == decrypted, 'Round-tripping error'
package main import( "fmt" "strings" ) var codes = map[rune]string { 'a' : "AAAAA", 'b' : "AAAAB", 'c' : "AAABA", 'd' : "AAABB", 'e' : "AABAA", 'f' : "AABAB", 'g' : "AABBA", 'h' : "AABBB", 'i' : "ABAAA", 'j' : "ABAAB", 'k' : "ABABA", 'l' : "ABABB", 'm' : "ABBAA", 'n' : "ABBAB", 'o' : "ABBBA", 'p' : "ABBBB", 'q' : "BAAAA", 'r' : "BAAAB", 's' : "BAABA", 't' : "BAABB", 'u' : "BABAA", 'v' : "BABAB", 'w' : "BABBA", 'x' : "BABBB", 'y' : "BBAAA", 'z' : "BBAAB", ' ' : "BBBAA", } func baconEncode(plainText string, message string) string { pt := strings.ToLower(plainText) var sb []byte for _, c := range pt { if c >= 'a' && c <= 'z' { sb = append(sb, codes[c]...) } else { sb = append(sb, codes[' ']...) } } et := string(sb) mg := strings.ToLower(message) sb = nil var count = 0 for _, c := range mg { if c >= 'a' && c <= 'z' { if et[count] == 'A' { sb = append(sb, byte(c)) } else { sb = append(sb, byte(c - 32)) } count++ if count == len(et) { break } } else { sb = append(sb, byte(c)) } } return string(sb) } func baconDecode(message string) string { var sb []byte for _, c := range message { if c >= 'a' && c <= 'z' { sb = append(sb, 'A') } else if c >= 'A' && c <= 'Z' { sb = append(sb, 'B') } } et := string(sb) sb = nil for i := 0; i < len(et); i += 5 { quintet := et[i : i + 5] for k, v := range codes { if v == quintet { sb = append(sb, byte(k)) break } } } return string(sb) } func main() { plainText := "the quick brown fox jumps over the lazy dog" message := "bacon's cipher is a method of steganography created by francis bacon." + "this task is to implement a program for encryption and decryption of " + "plaintext using the simple alphabet of the baconian cipher or some " + "other kind of representation of this alphabet (make anything signify anything). " + "the baconian alphabet may optionally be extended to encode all lower " + "case characters individually and/or adding a few punctuation characters " + "such as the space." cipherText := baconEncode(plainText, message) fmt.Printf("Cipher text ->\n\n%s\n", cipherText) decodedText := baconDecode(cipherText) fmt.Printf("\nHidden text ->\n\n%s\n", decodedText) }
Port the following code from Python to Go with equivalent syntax and logic.
import string sometext = .lower() lc2bin = {ch: '{:05b}'.format(i) for i, ch in enumerate(string.ascii_lowercase + ' .')} bin2lc = {val: key for key, val in lc2bin.items()} phrase = 'Rosetta code Bacon cipher example secret phrase to encode in the capitalisation of peter pan'.lower() def to_5binary(msg): return ( ch == '1' for ch in ''.join(lc2bin.get(ch, '') for ch in msg.lower())) def encrypt(message, text): bin5 = to_5binary(message) textlist = list(text.lower()) out = [] for capitalise in bin5: while textlist: ch = textlist.pop(0) if ch.isalpha(): if capitalise: ch = ch.upper() out.append(ch) break else: out.append(ch) else: raise Exception('ERROR: Ran out of characters in sometext') return ''.join(out) + '...' def decrypt(bacontext): binary = [] bin5 = [] out = [] for ch in bacontext: if ch.isalpha(): binary.append('1' if ch.isupper() else '0') if len(binary) == 5: bin5 = ''.join(binary) out.append(bin2lc[bin5]) binary = [] return ''.join(out) print('PLAINTEXT = \n%s\n' % phrase) encrypted = encrypt(phrase, sometext) print('ENCRYPTED = \n%s\n' % encrypted) decrypted = decrypt(encrypted) print('DECRYPTED = \n%s\n' % decrypted) assert phrase == decrypted, 'Round-tripping error'
package main import( "fmt" "strings" ) var codes = map[rune]string { 'a' : "AAAAA", 'b' : "AAAAB", 'c' : "AAABA", 'd' : "AAABB", 'e' : "AABAA", 'f' : "AABAB", 'g' : "AABBA", 'h' : "AABBB", 'i' : "ABAAA", 'j' : "ABAAB", 'k' : "ABABA", 'l' : "ABABB", 'm' : "ABBAA", 'n' : "ABBAB", 'o' : "ABBBA", 'p' : "ABBBB", 'q' : "BAAAA", 'r' : "BAAAB", 's' : "BAABA", 't' : "BAABB", 'u' : "BABAA", 'v' : "BABAB", 'w' : "BABBA", 'x' : "BABBB", 'y' : "BBAAA", 'z' : "BBAAB", ' ' : "BBBAA", } func baconEncode(plainText string, message string) string { pt := strings.ToLower(plainText) var sb []byte for _, c := range pt { if c >= 'a' && c <= 'z' { sb = append(sb, codes[c]...) } else { sb = append(sb, codes[' ']...) } } et := string(sb) mg := strings.ToLower(message) sb = nil var count = 0 for _, c := range mg { if c >= 'a' && c <= 'z' { if et[count] == 'A' { sb = append(sb, byte(c)) } else { sb = append(sb, byte(c - 32)) } count++ if count == len(et) { break } } else { sb = append(sb, byte(c)) } } return string(sb) } func baconDecode(message string) string { var sb []byte for _, c := range message { if c >= 'a' && c <= 'z' { sb = append(sb, 'A') } else if c >= 'A' && c <= 'Z' { sb = append(sb, 'B') } } et := string(sb) sb = nil for i := 0; i < len(et); i += 5 { quintet := et[i : i + 5] for k, v := range codes { if v == quintet { sb = append(sb, byte(k)) break } } } return string(sb) } func main() { plainText := "the quick brown fox jumps over the lazy dog" message := "bacon's cipher is a method of steganography created by francis bacon." + "this task is to implement a program for encryption and decryption of " + "plaintext using the simple alphabet of the baconian cipher or some " + "other kind of representation of this alphabet (make anything signify anything). " + "the baconian alphabet may optionally be extended to encode all lower " + "case characters individually and/or adding a few punctuation characters " + "such as the space." cipherText := baconEncode(plainText, message) fmt.Printf("Cipher text ->\n\n%s\n", cipherText) decodedText := baconDecode(cipherText) fmt.Printf("\nHidden text ->\n\n%s\n", decodedText) }
Write the same code in Go as shown below in Python.
def spiral(n): dx,dy = 1,0 x,y = 0,0 myarray = [[None]* n for j in range(n)] for i in xrange(n**2): myarray[x][y] = i nx,ny = x+dx, y+dy if 0<=nx<n and 0<=ny<n and myarray[nx][ny] == None: x,y = nx,ny else: dx,dy = -dy,dx x,y = x+dx, y+dy return myarray def printspiral(myarray): n = range(len(myarray)) for y in n: for x in n: print "%2i" % myarray[x][y], print printspiral(spiral(5))
package main import ( "fmt" "strconv" ) var n = 5 func main() { if n < 1 { return } top, left, bottom, right := 0, 0, n-1, n-1 sz := n * n a := make([]int, sz) i := 0 for left < right { for c := left; c <= right; c++ { a[top*n+c] = i i++ } top++ for r := top; r <= bottom; r++ { a[r*n+right] = i i++ } right-- if top == bottom { break } for c := right; c >= left; c-- { a[bottom*n+c] = i i++ } bottom-- for r := bottom; r >= top; r-- { a[r*n+left] = i i++ } left++ } a[top*n+left] = i w := len(strconv.Itoa(n*n - 1)) for i, e := range a { fmt.Printf("%*d ", w, e) if i%n == n-1 { fmt.Println("") } } }
Write a version of this Python function in Go with identical behavior.
>>> def printtable(data): for row in data: print ' '.join('%-5s' % ('"%s"' % cell) for cell in row) >>> import operator >>> def sorttable(table, ordering=None, column=0, reverse=False): return sorted(table, cmp=ordering, key=operator.itemgetter(column), reverse=reverse) >>> data = [["a", "b", "c"], ["", "q", "z"], ["zap", "zip", "Zot"]] >>> printtable(data) "a" "b" "c" "" "q" "z" "zap" "zip" "Zot" >>> printtable( sorttable(data) ) "" "q" "z" "a" "b" "c" "zap" "zip" "Zot" >>> printtable( sorttable(data, column=2) ) "zap" "zip" "Zot" "a" "b" "c" "" "q" "z" >>> printtable( sorttable(data, column=1) ) "a" "b" "c" "" "q" "z" "zap" "zip" "Zot" >>> printtable( sorttable(data, column=1, reverse=True) ) "zap" "zip" "Zot" "" "q" "z" "a" "b" "c" >>> printtable( sorttable(data, ordering=lambda a,b: cmp(len(b),len(a))) ) "zap" "zip" "Zot" "a" "b" "c" "" "q" "z" >>>
type cell string type spec struct { less func(cell, cell) bool column int reverse bool } func newSpec() (s spec) { return } t.sort(newSpec()) s := newSpec s.reverse = true t.sort(s)
Preserve the algorithm and functionality while converting the code from Python to Go.
def setup(): size(500, 500) generate_voronoi_diagram(width, height, 25) saveFrame("VoronoiDiagram.png") def generate_voronoi_diagram(w, h, num_cells): nx, ny, nr, ng, nb = [], [], [], [], [] for i in range(num_cells): nx.append(int(random(w))) ny.append(int(random(h))) nr.append(int(random(256))) ng.append(int(random(256))) nb.append(int(random(256))) for y in range(h): for x in range(w): dmin = dist(0, 0, w - 1, h - 1) j = -1 for i in range(num_cells): d = dist(0, 0, nx[i] - x, ny[i] - y) if d < dmin: dmin = d j = i set(x, y, color(nr[j], ng[j], nb[j]))
package main import ( "fmt" "image" "image/color" "image/draw" "image/png" "math/rand" "os" "time" ) const ( imageWidth = 300 imageHeight = 200 nSites = 10 ) func main() { writePngFile(generateVoronoi(randomSites())) } func generateVoronoi(sx, sy []int) image.Image { sc := make([]color.NRGBA, nSites) for i := range sx { sc[i] = color.NRGBA{uint8(rand.Intn(256)), uint8(rand.Intn(256)), uint8(rand.Intn(256)), 255} } img := image.NewNRGBA(image.Rect(0, 0, imageWidth, imageHeight)) for x := 0; x < imageWidth; x++ { for y := 0; y < imageHeight; y++ { dMin := dot(imageWidth, imageHeight) var sMin int for s := 0; s < nSites; s++ { if d := dot(sx[s]-x, sy[s]-y); d < dMin { sMin = s dMin = d } } img.SetNRGBA(x, y, sc[sMin]) } } black := image.NewUniform(color.Black) for s := 0; s < nSites; s++ { draw.Draw(img, image.Rect(sx[s]-2, sy[s]-2, sx[s]+2, sy[s]+2), black, image.ZP, draw.Src) } return img } func dot(x, y int) int { return x*x + y*y } func randomSites() (sx, sy []int) { rand.Seed(time.Now().Unix()) sx = make([]int, nSites) sy = make([]int, nSites) for i := range sx { sx[i] = rand.Intn(imageWidth) sy[i] = rand.Intn(imageHeight) } return } func writePngFile(img image.Image) { f, err := os.Create("voronoi.png") if err != nil { fmt.Println(err) return } if err = png.Encode(f, img); err != nil { fmt.Println(err) } if err = f.Close(); err != nil { fmt.Println(err) } }
Produce a language-to-language conversion: from Python to Go, same semantics.
def setup(): size(500, 500) generate_voronoi_diagram(width, height, 25) saveFrame("VoronoiDiagram.png") def generate_voronoi_diagram(w, h, num_cells): nx, ny, nr, ng, nb = [], [], [], [], [] for i in range(num_cells): nx.append(int(random(w))) ny.append(int(random(h))) nr.append(int(random(256))) ng.append(int(random(256))) nb.append(int(random(256))) for y in range(h): for x in range(w): dmin = dist(0, 0, w - 1, h - 1) j = -1 for i in range(num_cells): d = dist(0, 0, nx[i] - x, ny[i] - y) if d < dmin: dmin = d j = i set(x, y, color(nr[j], ng[j], nb[j]))
package main import ( "fmt" "image" "image/color" "image/draw" "image/png" "math/rand" "os" "time" ) const ( imageWidth = 300 imageHeight = 200 nSites = 10 ) func main() { writePngFile(generateVoronoi(randomSites())) } func generateVoronoi(sx, sy []int) image.Image { sc := make([]color.NRGBA, nSites) for i := range sx { sc[i] = color.NRGBA{uint8(rand.Intn(256)), uint8(rand.Intn(256)), uint8(rand.Intn(256)), 255} } img := image.NewNRGBA(image.Rect(0, 0, imageWidth, imageHeight)) for x := 0; x < imageWidth; x++ { for y := 0; y < imageHeight; y++ { dMin := dot(imageWidth, imageHeight) var sMin int for s := 0; s < nSites; s++ { if d := dot(sx[s]-x, sy[s]-y); d < dMin { sMin = s dMin = d } } img.SetNRGBA(x, y, sc[sMin]) } } black := image.NewUniform(color.Black) for s := 0; s < nSites; s++ { draw.Draw(img, image.Rect(sx[s]-2, sy[s]-2, sx[s]+2, sy[s]+2), black, image.ZP, draw.Src) } return img } func dot(x, y int) int { return x*x + y*y } func randomSites() (sx, sy []int) { rand.Seed(time.Now().Unix()) sx = make([]int, nSites) sy = make([]int, nSites) for i := range sx { sx[i] = rand.Intn(imageWidth) sy[i] = rand.Intn(imageHeight) } return } func writePngFile(img image.Image) { f, err := os.Create("voronoi.png") if err != nil { fmt.Println(err) return } if err = png.Encode(f, img); err != nil { fmt.Println(err) } if err = f.Close(); err != nil { fmt.Println(err) } }
Transform the following Python implementation into Go, maintaining the same output and logic.
import ctypes libc = ctypes.CDLL("/lib/libc.so.6") libc.strcmp("abc", "def") libc.strcmp("hello", "hello")
package main import "C" import ( "fmt" "unsafe" ) func main() { go1 := "hello C" c1 := C.CString(go1) go1 = "" c2 := C.strdup(c1) C.free(unsafe.Pointer(c1)) go2 := C.GoString(c2) C.free(unsafe.Pointer(c2)) fmt.Println(go2) }
Generate an equivalent Go version of this Python code.
from random import randrange def s_of_n_creator(n): sample, i = [], 0 def s_of_n(item): nonlocal i i += 1 if i <= n: sample.append(item) elif randrange(i) < n: sample[randrange(n)] = item return sample return s_of_n if __name__ == '__main__': bin = [0]* 10 items = range(10) print("Single run samples for n = 3:") s_of_n = s_of_n_creator(3) for item in items: sample = s_of_n(item) print(" Item: %i -> sample: %s" % (item, sample)) for trial in range(100000): s_of_n = s_of_n_creator(3) for item in items: sample = s_of_n(item) for s in sample: bin[s] += 1 print("\nTest item frequencies for 100000 runs:\n ", '\n '.join("%i:%i" % x for x in enumerate(bin)))
package main import ( "fmt" "math/rand" "time" ) func sOfNCreator(n int) func(byte) []byte { s := make([]byte, 0, n) m := n return func(item byte) []byte { if len(s) < n { s = append(s, item) } else { m++ if rand.Intn(m) < n { s[rand.Intn(n)] = item } } return s } } func main() { rand.Seed(time.Now().UnixNano()) var freq [10]int for r := 0; r < 1e5; r++ { sOfN := sOfNCreator(3) for d := byte('0'); d < '9'; d++ { sOfN(d) } for _, d := range sOfN('9') { freq[d-'0']++ } } fmt.Println(freq) }
Port the following code from Python to Go with equivalent syntax and logic.
from random import randrange def s_of_n_creator(n): sample, i = [], 0 def s_of_n(item): nonlocal i i += 1 if i <= n: sample.append(item) elif randrange(i) < n: sample[randrange(n)] = item return sample return s_of_n if __name__ == '__main__': bin = [0]* 10 items = range(10) print("Single run samples for n = 3:") s_of_n = s_of_n_creator(3) for item in items: sample = s_of_n(item) print(" Item: %i -> sample: %s" % (item, sample)) for trial in range(100000): s_of_n = s_of_n_creator(3) for item in items: sample = s_of_n(item) for s in sample: bin[s] += 1 print("\nTest item frequencies for 100000 runs:\n ", '\n '.join("%i:%i" % x for x in enumerate(bin)))
package main import ( "fmt" "math/rand" "time" ) func sOfNCreator(n int) func(byte) []byte { s := make([]byte, 0, n) m := n return func(item byte) []byte { if len(s) < n { s = append(s, item) } else { m++ if rand.Intn(m) < n { s[rand.Intn(n)] = item } } return s } } func main() { rand.Seed(time.Now().UnixNano()) var freq [10]int for r := 0; r < 1e5; r++ { sOfN := sOfNCreator(3) for d := byte('0'); d < '9'; d++ { sOfN(d) } for _, d := range sOfN('9') { freq[d-'0']++ } } fmt.Println(freq) }
Change the programming language of this snippet from Python to Go without modifying what it does.
from itertools import accumulate, chain, count, islice from fractions import Fraction def faulhaberTriangle(m): def go(rs, n): def f(x, y): return Fraction(n, x) * y xs = list(map(f, islice(count(2), m), rs)) return [Fraction(1 - sum(xs), 1)] + xs return list(accumulate( [[]] + list(islice(count(0), 1 + m)), go ))[1:] def faulhaberSum(p, n): def go(x, y): return y * (n ** x) return sum( map(go, count(1), faulhaberTriangle(p)[-1]) ) def main(): fs = faulhaberTriangle(9) print( fTable(__doc__ + ':\n')(str)( compose(concat)( fmap(showRatio(3)(3)) ) )( index(fs) )(range(0, len(fs))) ) print('') print( faulhaberSum(17, 1000) ) def fTable(s): def gox(xShow): def gofx(fxShow): def gof(f): def goxs(xs): ys = [xShow(x) for x in xs] w = max(map(len, ys)) def arrowed(x, y): return y.rjust(w, ' ') + ' -> ' + ( fxShow(f(x)) ) return s + '\n' + '\n'.join( map(arrowed, xs, ys) ) return goxs return gof return gofx return gox def compose(g): return lambda f: lambda x: g(f(x)) def concat(xs): def f(ys): zs = list(chain(*ys)) return ''.join(zs) if isinstance(ys[0], str) else zs return ( f(xs) if isinstance(xs, list) else ( chain.from_iterable(xs) ) ) if xs else [] def fmap(f): def go(xs): return list(map(f, xs)) return go def index(xs): return lambda n: None if 0 > n else ( xs[n] if ( hasattr(xs, "__getitem__") ) else next(islice(xs, n, None)) ) def showRatio(m): def go(n): def f(r): d = r.denominator return str(r.numerator).rjust(m, ' ') + ( ('/' + str(d).ljust(n, ' ')) if 1 != d else ( ' ' * (1 + n) ) ) return f return go if __name__ == '__main__': main()
package main import ( "fmt" "math/big" ) func bernoulli(n uint) *big.Rat { a := make([]big.Rat, n+1) z := new(big.Rat) for m := range a { a[m].SetFrac64(1, int64(m+1)) for j := m; j >= 1; j-- { d := &a[j-1] d.Mul(z.SetInt64(int64(j)), d.Sub(d, &a[j])) } } if n != 1 { return &a[0] } a[0].Neg(&a[0]) return &a[0] } func binomial(n, k int) int64 { if n <= 0 || k <= 0 || n < k { return 1 } var num, den int64 = 1, 1 for i := k + 1; i <= n; i++ { num *= int64(i) } for i := 2; i <= n-k; i++ { den *= int64(i) } return num / den } func faulhaberTriangle(p int) []big.Rat { coeffs := make([]big.Rat, p+1) q := big.NewRat(1, int64(p)+1) t := new(big.Rat) u := new(big.Rat) sign := -1 for j := range coeffs { sign *= -1 d := &coeffs[p-j] t.SetInt64(int64(sign)) u.SetInt64(binomial(p+1, j)) d.Mul(q, t) d.Mul(d, u) d.Mul(d, bernoulli(uint(j))) } return coeffs } func main() { for i := 0; i < 10; i++ { coeffs := faulhaberTriangle(i) for _, coeff := range coeffs { fmt.Printf("%5s ", coeff.RatString()) } fmt.Println() } fmt.Println() k := 17 cc := faulhaberTriangle(k) n := int64(1000) nn := big.NewRat(n, 1) np := big.NewRat(1, 1) sum := new(big.Rat) tmp := new(big.Rat) for _, c := range cc { np.Mul(np, nn) tmp.Set(np) tmp.Mul(tmp, &c) sum.Add(sum, tmp) } fmt.Println(sum.RatString()) }
Produce a language-to-language conversion: from Python to Go, same semantics.
import sys program_name = sys.argv[0] arguments = sys.argv[1:] count = len(arguments)
package main import ( "fmt" "os" ) func main() { for i, x := range os.Args[1:] { fmt.Printf("the argument #%d is %s\n", i, x) } }
Convert this Python block to Go, preserving its control flow and logic.
import sys program_name = sys.argv[0] arguments = sys.argv[1:] count = len(arguments)
package main import ( "fmt" "os" ) func main() { for i, x := range os.Args[1:] { fmt.Printf("the argument #%d is %s\n", i, x) } }
Please provide an equivalent version of this Python code in Go.
import urllib.request from collections import Counter GRID = def getwords(url='http://wiki.puzzlers.org/pub/wordlists/unixdict.txt'): "Return lowercased words of 3 to 9 characters" words = urllib.request.urlopen(url).read().decode().strip().lower().split() return (w for w in words if 2 < len(w) < 10) def solve(grid, dictionary): gridcount = Counter(grid) mid = grid[4] return [word for word in dictionary if mid in word and not (Counter(word) - gridcount)] if __name__ == '__main__': chars = ''.join(GRID.strip().lower().split()) found = solve(chars, dictionary=getwords()) print('\n'.join(found))
package main import ( "bytes" "fmt" "io/ioutil" "log" "sort" "strings" ) func main() { b, err := ioutil.ReadFile("unixdict.txt") if err != nil { log.Fatal("Error reading file") } letters := "deegklnow" wordsAll := bytes.Split(b, []byte{'\n'}) var words [][]byte for _, word := range wordsAll { word = bytes.TrimSpace(word) le := len(word) if le > 2 && le < 10 { words = append(words, word) } } var found []string for _, word := range words { le := len(word) if bytes.IndexByte(word, 'k') >= 0 { lets := letters ok := true for i := 0; i < le; i++ { c := word[i] ix := sort.Search(len(lets), func(i int) bool { return lets[i] >= c }) if ix < len(lets) && lets[ix] == c { lets = lets[0:ix] + lets[ix+1:] } else { ok = false break } } if ok { found = append(found, string(word)) } } } fmt.Println("The following", len(found), "words are the solutions to the puzzle:") fmt.Println(strings.Join(found, "\n")) mostFound := 0 var mostWords9 []string var mostLetters []byte var words9 [][]byte for _, word := range words { if len(word) == 9 { words9 = append(words9, word) } } for _, word9 := range words9 { letterBytes := make([]byte, len(word9)) copy(letterBytes, word9) sort.Slice(letterBytes, func(i, j int) bool { return letterBytes[i] < letterBytes[j] }) distinctBytes := []byte{letterBytes[0]} for _, b := range letterBytes[1:] { if b != distinctBytes[len(distinctBytes)-1] { distinctBytes = append(distinctBytes, b) } } distinctLetters := string(distinctBytes) for _, letter := range distinctLetters { found := 0 letterByte := byte(letter) for _, word := range words { le := len(word) if bytes.IndexByte(word, letterByte) >= 0 { lets := string(letterBytes) ok := true for i := 0; i < le; i++ { c := word[i] ix := sort.Search(len(lets), func(i int) bool { return lets[i] >= c }) if ix < len(lets) && lets[ix] == c { lets = lets[0:ix] + lets[ix+1:] } else { ok = false break } } if ok { found = found + 1 } } } if found > mostFound { mostFound = found mostWords9 = []string{string(word9)} mostLetters = []byte{letterByte} } else if found == mostFound { mostWords9 = append(mostWords9, string(word9)) mostLetters = append(mostLetters, letterByte) } } } fmt.Println("\nMost words found =", mostFound) fmt.Println("Nine letter words producing this total:") for i := 0; i < len(mostWords9); i++ { fmt.Println(mostWords9[i], "with central letter", string(mostLetters[i])) } }
Produce a functionally identical Go code for the snippet given in Python.
arr1 = [1, 2, 3] arr2 = [4, 5, 6] arr3 = [7, 8, 9] arr4 = arr1 + arr2 assert arr4 == [1, 2, 3, 4, 5, 6] arr4.extend(arr3) assert arr4 == [1, 2, 3, 4, 5, 6, 7, 8, 9]
package main import "fmt" func main() { a := []int{1, 2, 3} b := []int{7, 12, 60} c := append(a, b...) fmt.Println(c) i := []interface{}{1, 2, 3} j := []interface{}{"Crosby", "Stills", "Nash", "Young"} k := append(i, j...) fmt.Println(k) l := [...]int{1, 2, 3} m := [...]int{7, 12, 60} var n [len(l) + len(m)]int copy(n[:], l[:]) copy(n[len(l):], m[:]) fmt.Println(n) }
Generate a Go translation of this Python snippet without changing its computational steps.
string = raw_input("Input a string: ")
package main import "fmt" func main() { var s string var i int if _, err := fmt.Scan(&s, &i); err == nil && i == 75000 { fmt.Println("good") } else { fmt.Println("wrong") } }
Write the same algorithm in Go as shown in this Python implementation.
>>> import winsound >>> for note in [261.63, 293.66, 329.63, 349.23, 392.00, 440.00, 493.88, 523.25]: winsound.Beep(int(note+.5), 500) >>>
package main import ( "encoding/binary" "log" "math" "os" "strings" ) func main() { const ( sampleRate = 44100 duration = 8 dataLength = sampleRate * duration hdrSize = 44 fileLen = dataLength + hdrSize - 8 ) buf1 := make([]byte, 1) buf2 := make([]byte, 2) buf4 := make([]byte, 4) var sb strings.Builder sb.WriteString("RIFF") binary.LittleEndian.PutUint32(buf4, fileLen) sb.Write(buf4) sb.WriteString("WAVE") sb.WriteString("fmt ") binary.LittleEndian.PutUint32(buf4, 16) sb.Write(buf4) binary.LittleEndian.PutUint16(buf2, 1) sb.Write(buf2) sb.Write(buf2) binary.LittleEndian.PutUint32(buf4, sampleRate) sb.Write(buf4) sb.Write(buf4) sb.Write(buf2) binary.LittleEndian.PutUint16(buf2, 8) sb.Write(buf2) sb.WriteString("data") binary.LittleEndian.PutUint32(buf4, dataLength) sb.Write(buf4) wavhdr := []byte(sb.String()) f, err := os.Create("notes.wav") if err != nil { log.Fatal(err) } defer f.Close() f.Write(wavhdr) freqs := [8]float64{261.6, 293.6, 329.6, 349.2, 392.0, 440.0, 493.9, 523.3} for j := 0; j < duration; j++ { freq := freqs[j] omega := 2 * math.Pi * freq for i := 0; i < dataLength/duration; i++ { y := 32 * math.Sin(omega*float64(i)/float64(sampleRate)) buf1[0] = byte(math.Round(y)) f.Write(buf1) } } }
Write a version of this Python function in Go with identical behavior.
>>> import winsound >>> for note in [261.63, 293.66, 329.63, 349.23, 392.00, 440.00, 493.88, 523.25]: winsound.Beep(int(note+.5), 500) >>>
package main import ( "encoding/binary" "log" "math" "os" "strings" ) func main() { const ( sampleRate = 44100 duration = 8 dataLength = sampleRate * duration hdrSize = 44 fileLen = dataLength + hdrSize - 8 ) buf1 := make([]byte, 1) buf2 := make([]byte, 2) buf4 := make([]byte, 4) var sb strings.Builder sb.WriteString("RIFF") binary.LittleEndian.PutUint32(buf4, fileLen) sb.Write(buf4) sb.WriteString("WAVE") sb.WriteString("fmt ") binary.LittleEndian.PutUint32(buf4, 16) sb.Write(buf4) binary.LittleEndian.PutUint16(buf2, 1) sb.Write(buf2) sb.Write(buf2) binary.LittleEndian.PutUint32(buf4, sampleRate) sb.Write(buf4) sb.Write(buf4) sb.Write(buf2) binary.LittleEndian.PutUint16(buf2, 8) sb.Write(buf2) sb.WriteString("data") binary.LittleEndian.PutUint32(buf4, dataLength) sb.Write(buf4) wavhdr := []byte(sb.String()) f, err := os.Create("notes.wav") if err != nil { log.Fatal(err) } defer f.Close() f.Write(wavhdr) freqs := [8]float64{261.6, 293.6, 329.6, 349.2, 392.0, 440.0, 493.9, 523.3} for j := 0; j < duration; j++ { freq := freqs[j] omega := 2 * math.Pi * freq for i := 0; i < dataLength/duration; i++ { y := 32 * math.Sin(omega*float64(i)/float64(sampleRate)) buf1[0] = byte(math.Round(y)) f.Write(buf1) } } }
Produce a language-to-language conversion: from Python to Go, same semantics.
from itertools import combinations def anycomb(items): ' return combinations of any length from the items ' return ( comb for r in range(1, len(items)+1) for comb in combinations(items, r) ) def totalvalue(comb): ' Totalise a particular combination of items' totwt = totval = 0 for item, wt, val in comb: totwt += wt totval += val return (totval, -totwt) if totwt <= 400 else (0, 0) items = ( ("map", 9, 150), ("compass", 13, 35), ("water", 153, 200), ("sandwich", 50, 160), ("glucose", 15, 60), ("tin", 68, 45), ("banana", 27, 60), ("apple", 39, 40), ("cheese", 23, 30), ("beer", 52, 10), ("suntan cream", 11, 70), ("camera", 32, 30), ("t-shirt", 24, 15), ("trousers", 48, 10), ("umbrella", 73, 40), ("waterproof trousers", 42, 70), ("waterproof overclothes", 43, 75), ("note-case", 22, 80), ("sunglasses", 7, 20), ("towel", 18, 12), ("socks", 4, 50), ("book", 30, 10), ) bagged = max( anycomb(items), key=totalvalue) print("Bagged the following items\n " + '\n '.join(sorted(item for item,_,_ in bagged))) val, wt = totalvalue(bagged) print("for a total value of %i and a total weight of %i" % (val, -wt))
package main import "fmt" type item struct { string w, v int } var wants = []item{ {"map", 9, 150}, {"compass", 13, 35}, {"water", 153, 200}, {"sandwich", 50, 160}, {"glucose", 15, 60}, {"tin", 68, 45}, {"banana", 27, 60}, {"apple", 39, 40}, {"cheese", 23, 30}, {"beer", 52, 10}, {"suntan cream", 11, 70}, {"camera", 32, 30}, {"T-shirt", 24, 15}, {"trousers", 48, 10}, {"umbrella", 73, 40}, {"waterproof trousers", 42, 70}, {"waterproof overclothes", 43, 75}, {"note-case", 22, 80}, {"sunglasses", 7, 20}, {"towel", 18, 12}, {"socks", 4, 50}, {"book", 30, 10}, } const maxWt = 400 func main() { items, w, v := m(len(wants)-1, maxWt) fmt.Println(items) fmt.Println("weight:", w) fmt.Println("value:", v) } func m(i, w int) ([]string, int, int) { if i < 0 || w == 0 { return nil, 0, 0 } else if wants[i].w > w { return m(i-1, w) } i0, w0, v0 := m(i-1, w) i1, w1, v1 := m(i-1, w-wants[i].w) v1 += wants[i].v if v1 > v0 { return append(i1, wants[i].string), w1 + wants[i].w, v1 } return i0, w0, v0 }
Rewrite this program in Go while keeping its functionality equivalent to the Python version.
from __future__ import print_function from itertools import takewhile maxsum = 99 def get_primes(max): if max < 2: return [] lprimes = [2] for x in range(3, max + 1, 2): for p in lprimes: if x % p == 0: break else: lprimes.append(x) return lprimes descendants = [[] for _ in range(maxsum + 1)] ancestors = [[] for _ in range(maxsum + 1)] primes = get_primes(maxsum) for p in primes: descendants[p].append(p) for s in range(1, len(descendants) - p): descendants[s + p] += [p * pr for pr in descendants[s]] for p in primes + [4]: descendants[p].pop() total = 0 for s in range(1, maxsum + 1): descendants[s].sort() for d in takewhile(lambda x: x <= maxsum, descendants[s]): ancestors[d] = ancestors[s] + [s] print([s], "Level:", len(ancestors[s])) print("Ancestors:", ancestors[s] if len(ancestors[s]) else "None") print("Descendants:", len(descendants[s]) if len(descendants[s]) else "None") if len(descendants[s]): print(descendants[s]) print() total += len(descendants[s]) print("Total descendants", total)
package main import ( "fmt" "sort" ) func getPrimes(max int) []int { if max < 2 { return []int{} } lprimes := []int{2} outer: for x := 3; x <= max; x += 2 { for _, p := range lprimes { if x%p == 0 { continue outer } } lprimes = append(lprimes, x) } return lprimes } func main() { const maxSum = 99 descendants := make([][]int64, maxSum+1) ancestors := make([][]int, maxSum+1) for i := 0; i <= maxSum; i++ { descendants[i] = []int64{} ancestors[i] = []int{} } primes := getPrimes(maxSum) for _, p := range primes { descendants[p] = append(descendants[p], int64(p)) for s := 1; s < len(descendants)-p; s++ { temp := make([]int64, len(descendants[s])) for i := 0; i < len(descendants[s]); i++ { temp[i] = int64(p) * descendants[s][i] } descendants[s+p] = append(descendants[s+p], temp...) } } for _, p := range append(primes, 4) { le := len(descendants[p]) if le == 0 { continue } descendants[p][le-1] = 0 descendants[p] = descendants[p][:le-1] } total := 0 for s := 1; s <= maxSum; s++ { x := descendants[s] sort.Slice(x, func(i, j int) bool { return x[i] < x[j] }) total += len(descendants[s]) index := 0 for ; index < len(descendants[s]); index++ { if descendants[s][index] > int64(maxSum) { break } } for _, d := range descendants[s][:index] { ancestors[d] = append(ancestors[s], s) } if (s >= 21 && s <= 45) || (s >= 47 && s <= 73) || (s >= 75 && s < maxSum) { continue } temp := fmt.Sprintf("%v", ancestors[s]) fmt.Printf("%2d: %d Ancestor(s): %-14s", s, len(ancestors[s]), temp) le := len(descendants[s]) if le <= 10 { fmt.Printf("%5d Descendant(s): %v\n", le, descendants[s]) } else { fmt.Printf("%5d Descendant(s): %v\b ...]\n", le, descendants[s][:10]) } } fmt.Println("\nTotal descendants", total) }
Write a version of this Python function in Go with identical behavior.
import itertools def cp(lsts): return list(itertools.product(*lsts)) if __name__ == '__main__': from pprint import pprint as pp for lists in [[[1,2],[3,4]], [[3,4],[1,2]], [[], [1, 2]], [[1, 2], []], ((1776, 1789), (7, 12), (4, 14, 23), (0, 1)), ((1, 2, 3), (30,), (500, 100)), ((1, 2, 3), (), (500, 100))]: print(lists, '=>') pp(cp(lists), indent=2)
package main import "fmt" type pair [2]int func cart2(a, b []int) []pair { p := make([]pair, len(a)*len(b)) i := 0 for _, a := range a { for _, b := range b { p[i] = pair{a, b} i++ } } return p } func main() { fmt.Println(cart2([]int{1, 2}, []int{3, 4})) fmt.Println(cart2([]int{3, 4}, []int{1, 2})) fmt.Println(cart2([]int{1, 2}, nil)) fmt.Println(cart2(nil, []int{1, 2})) }
Port the provided Python code into Go while preserving the original functionality.
import itertools def cp(lsts): return list(itertools.product(*lsts)) if __name__ == '__main__': from pprint import pprint as pp for lists in [[[1,2],[3,4]], [[3,4],[1,2]], [[], [1, 2]], [[1, 2], []], ((1776, 1789), (7, 12), (4, 14, 23), (0, 1)), ((1, 2, 3), (30,), (500, 100)), ((1, 2, 3), (), (500, 100))]: print(lists, '=>') pp(cp(lists), indent=2)
package main import "fmt" type pair [2]int func cart2(a, b []int) []pair { p := make([]pair, len(a)*len(b)) i := 0 for _, a := range a { for _, b := range b { p[i] = pair{a, b} i++ } } return p } func main() { fmt.Println(cart2([]int{1, 2}, []int{3, 4})) fmt.Println(cart2([]int{3, 4}, []int{1, 2})) fmt.Println(cart2([]int{1, 2}, nil)) fmt.Println(cart2(nil, []int{1, 2})) }
Translate this program into Go but keep the logic exactly as in Python.
import itertools def cp(lsts): return list(itertools.product(*lsts)) if __name__ == '__main__': from pprint import pprint as pp for lists in [[[1,2],[3,4]], [[3,4],[1,2]], [[], [1, 2]], [[1, 2], []], ((1776, 1789), (7, 12), (4, 14, 23), (0, 1)), ((1, 2, 3), (30,), (500, 100)), ((1, 2, 3), (), (500, 100))]: print(lists, '=>') pp(cp(lists), indent=2)
package main import "fmt" type pair [2]int func cart2(a, b []int) []pair { p := make([]pair, len(a)*len(b)) i := 0 for _, a := range a { for _, b := range b { p[i] = pair{a, b} i++ } } return p } func main() { fmt.Println(cart2([]int{1, 2}, []int{3, 4})) fmt.Println(cart2([]int{3, 4}, []int{1, 2})) fmt.Println(cart2([]int{1, 2}, nil)) fmt.Println(cart2(nil, []int{1, 2})) }
Write the same code in Go as shown below in Python.
>>> >>> from math import sin, cos, acos, asin >>> >>> cube = lambda x: x * x * x >>> croot = lambda x: x ** (1/3.0) >>> >>> >>> compose = lambda f1, f2: ( lambda x: f1(f2(x)) ) >>> >>> funclist = [sin, cos, cube] >>> funclisti = [asin, acos, croot] >>> >>> [compose(inversef, f)(.5) for f, inversef in zip(funclist, funclisti)] [0.5, 0.4999999999999999, 0.5] >>>
package main import "math" import "fmt" func cube(x float64) float64 { return math.Pow(x, 3) } type ffType func(float64) float64 func compose(f, g ffType) ffType { return func(x float64) float64 { return f(g(x)) } } func main() { funclist := []ffType{math.Sin, math.Cos, cube} funclisti := []ffType{math.Asin, math.Acos, math.Cbrt} for i := 0; i < 3; i++ { fmt.Println(compose(funclisti[i], funclist[i])(.5)) } }
Generate a Go translation of this Python snippet without changing its computational steps.
>>> def proper_divs2(n): ... return {x for x in range(1, (n + 1) // 2 + 1) if n % x == 0 and n != x} ... >>> [proper_divs2(n) for n in range(1, 11)] [set(), {1}, {1}, {1, 2}, {1}, {1, 2, 3}, {1}, {1, 2, 4}, {1, 3}, {1, 2, 5}] >>> >>> n, length = max(((n, len(proper_divs2(n))) for n in range(1, 20001)), key=lambda pd: pd[1]) >>> n 15120 >>> length 79 >>>
package main import ( "fmt" "strconv" ) func listProperDivisors(limit int) { if limit < 1 { return } width := len(strconv.Itoa(limit)) for i := 1; i <= limit; i++ { fmt.Printf("%*d -> ", width, i) if i == 1 { fmt.Println("(None)") continue } for j := 1; j <= i/2; j++ { if i%j == 0 { fmt.Printf(" %d", j) } } fmt.Println() } } func countProperDivisors(n int) int { if n < 2 { return 0 } count := 0 for i := 1; i <= n/2; i++ { if n%i == 0 { count++ } } return count } func main() { fmt.Println("The proper divisors of the following numbers are :\n") listProperDivisors(10) fmt.Println() maxCount := 0 most := []int{1} for n := 2; n <= 20000; n++ { count := countProperDivisors(n) if count == maxCount { most = append(most, n) } else if count > maxCount { maxCount = count most = most[0:1] most[0] = n } } fmt.Print("The following number(s) <= 20000 have the most proper divisors, ") fmt.Println("namely", maxCount, "\b\n") for _, n := range most { fmt.Println(n) } }
Translate this program into Go but keep the logic exactly as in Python.
>>> from xml.etree import ElementTree as ET >>> from itertools import izip >>> def characterstoxml(names, remarks): root = ET.Element("CharacterRemarks") for name, remark in izip(names, remarks): c = ET.SubElement(root, "Character", {'name': name}) c.text = remark return ET.tostring(root) >>> print characterstoxml( names = ["April", "Tam O'Shanter", "Emily"], remarks = [ "Bubbly: I'm > Tam and <= Emily", 'Burns: "When chapman billies leave the street ..."', 'Short & shrift' ] ).replace('><','>\n<')
package main import ( "encoding/xml" "fmt" ) func xRemarks(r CharacterRemarks) (string, error) { b, err := xml.MarshalIndent(r, "", " ") return string(b), err } type CharacterRemarks struct { Character []crm } type crm struct { Name string `xml:"name,attr"` Remark string `xml:",chardata"` } func main() { x, err := xRemarks(CharacterRemarks{[]crm{ {`April`, `Bubbly: I'm > Tam and <= Emily`}, {`Tam O'Shanter`, `Burns: "When chapman billies leave the street ..."`}, {`Emily`, `Short & shrift`}, }}) if err != nil { x = err.Error() } fmt.Println(x) }
Translate this program into Go but keep the logic exactly as in Python.
>>> x = [0, 1, 2, 3, 4, 5, 6, 7, 8, 9] >>> y = [2.7, 2.8, 31.4, 38.1, 58.0, 76.2, 100.5, 130.0, 149.3, 180.0] >>> import pylab >>> pylab.plot(x, y, 'bo') >>> pylab.savefig('qsort-range-10-9.png')
package main import ( "fmt" "log" "os/exec" ) var ( x = []int{0, 1, 2, 3, 4, 5, 6, 7, 8, 9} y = []float64{2.7, 2.8, 31.4, 38.1, 58.0, 76.2, 100.5, 130.0, 149.3, 180.0} ) func main() { g := exec.Command("gnuplot", "-persist") w, err := g.StdinPipe() if err != nil { log.Fatal(err) } if err = g.Start(); err != nil { log.Fatal(err) } fmt.Fprintln(w, "unset key; plot '-'") for i, xi := range x { fmt.Fprintf(w, "%d %f\n", xi, y[i]) } fmt.Fprintln(w, "e") w.Close() g.Wait() }
Port the provided Python code into Go while preserving the original functionality.
>>> x = [0, 1, 2, 3, 4, 5, 6, 7, 8, 9] >>> y = [2.7, 2.8, 31.4, 38.1, 58.0, 76.2, 100.5, 130.0, 149.3, 180.0] >>> import pylab >>> pylab.plot(x, y, 'bo') >>> pylab.savefig('qsort-range-10-9.png')
package main import ( "fmt" "log" "os/exec" ) var ( x = []int{0, 1, 2, 3, 4, 5, 6, 7, 8, 9} y = []float64{2.7, 2.8, 31.4, 38.1, 58.0, 76.2, 100.5, 130.0, 149.3, 180.0} ) func main() { g := exec.Command("gnuplot", "-persist") w, err := g.StdinPipe() if err != nil { log.Fatal(err) } if err = g.Start(); err != nil { log.Fatal(err) } fmt.Fprintln(w, "unset key; plot '-'") for i, xi := range x { fmt.Fprintf(w, "%d %f\n", xi, y[i]) } fmt.Fprintln(w, "e") w.Close() g.Wait() }
Transform the following Python implementation into Go, maintaining the same output and logic.
import re string = "This is a string" if re.search('string$', string): print("Ends with string.") string = re.sub(" a ", " another ", string) print(string)
package main import "fmt" import "regexp" func main() { str := "I am the original string" matched, _ := regexp.MatchString(".*string$", str) if matched { fmt.Println("ends with 'string'") } pattern := regexp.MustCompile("original") result := pattern.ReplaceAllString(str, "modified") fmt.Println(result) }
Please provide an equivalent version of this Python code in Go.
inclusive_range = mn, mx = (1, 10) print( % inclusive_range) i = 0 while True: i += 1 guess = (mn+mx)//2 txt = input("Guess %2i is: %2i. The score for which is (h,l,=): " % (i, guess)).strip().lower()[0] if txt not in 'hl=': print(" I don't understand your input of '%s' ?" % txt) continue if txt == 'h': mx = guess-1 if txt == 'l': mn = guess+1 if txt == '=': print(" Ye-Haw!!") break if (mn > mx) or (mn < inclusive_range[0]) or (mx > inclusive_range[1]): print("Please check your scoring as I cannot find the value") break print("\nThanks for keeping score.")
package main import ( "fmt" "sort" ) func main() { lower, upper := 0, 100 fmt.Printf(`Instructions: Think of integer number from %d (inclusive) to %d (exclusive) and I will guess it. After each guess, I will ask you if it is less than or equal to some number, and you will respond with "yes" or "no". `, lower, upper) answer := sort.Search(upper-lower, func (i int) bool { fmt.Printf("Is your number less than or equal to %d? ", lower+i) s := "" fmt.Scanf("%s", &s) return s != "" && s[0] == 'y' }) fmt.Printf("Your number is %d.\n", lower+answer) }
Change the programming language of this snippet from Python to Go without modifying what it does.
keys = ['a', 'b', 'c'] values = [1, 2, 3] hash = {key: value for key, value in zip(keys, values)}
package main import "fmt" func main() { keys := []string{"a", "b", "c"} vals := []int{1, 2, 3} hash := map[string]int{} for i, key := range keys { hash[key] = vals[i] } fmt.Println(hash) }
Port the following code from Python to Go with equivalent syntax and logic.
from bisect import bisect_right def bin_it(limits: list, data: list) -> list: "Bin data according to (ascending) limits." bins = [0] * (len(limits) + 1) for d in data: bins[bisect_right(limits, d)] += 1 return bins def bin_print(limits: list, bins: list) -> list: print(f" < {limits[0]:3} := {bins[0]:3}") for lo, hi, count in zip(limits, limits[1:], bins[1:]): print(f">= {lo:3} .. < {hi:3} := {count:3}") print(f">= {limits[-1]:3}  := {bins[-1]:3}") if __name__ == "__main__": print("RC FIRST EXAMPLE\n") limits = [23, 37, 43, 53, 67, 83] data = [95,21,94,12,99,4,70,75,83,93,52,80,57,5,53,86,65,17,92,83,71,61,54,58,47, 16, 8, 9,32,84,7,87,46,19,30,37,96,6,98,40,79,97,45,64,60,29,49,36,43,55] bins = bin_it(limits, data) bin_print(limits, bins) print("\nRC SECOND EXAMPLE\n") limits = [14, 18, 249, 312, 389, 392, 513, 591, 634, 720] data = [445,814,519,697,700,130,255,889,481,122,932, 77,323,525,570,219,367,523,442,933, 416,589,930,373,202,253,775, 47,731,685,293,126,133,450,545,100,741,583,763,306, 655,267,248,477,549,238, 62,678, 98,534,622,907,406,714,184,391,913, 42,560,247, 346,860, 56,138,546, 38,985,948, 58,213,799,319,390,634,458,945,733,507,916,123, 345,110,720,917,313,845,426, 9,457,628,410,723,354,895,881,953,677,137,397, 97, 854,740, 83,216,421, 94,517,479,292,963,376,981,480, 39,257,272,157, 5,316,395, 787,942,456,242,759,898,576, 67,298,425,894,435,831,241,989,614,987,770,384,692, 698,765,331,487,251,600,879,342,982,527,736,795,585, 40, 54,901,408,359,577,237, 605,847,353,968,832,205,838,427,876,959,686,646,835,127,621,892,443,198,988,791, 466, 23,707,467, 33,670,921,180,991,396,160,436,717,918, 8,374,101,684,727,749] bins = bin_it(limits, data) bin_print(limits, bins)
package main import ( "fmt" "sort" ) func getBins(limits, data []int) []int { n := len(limits) bins := make([]int, n+1) for _, d := range data { index := sort.SearchInts(limits, d) if index < len(limits) && d == limits[index] { index++ } bins[index]++ } return bins } func printBins(limits, bins []int) { n := len(limits) fmt.Printf(" < %3d = %2d\n", limits[0], bins[0]) for i := 1; i < n; i++ { fmt.Printf(">= %3d and < %3d = %2d\n", limits[i-1], limits[i], bins[i]) } fmt.Printf(">= %3d = %2d\n", limits[n-1], bins[n]) fmt.Println() } func main() { limitsList := [][]int{ {23, 37, 43, 53, 67, 83}, {14, 18, 249, 312, 389, 392, 513, 591, 634, 720}, } dataList := [][]int{ { 95, 21, 94, 12, 99, 4, 70, 75, 83, 93, 52, 80, 57, 5, 53, 86, 65, 17, 92, 83, 71, 61, 54, 58, 47, 16, 8, 9, 32, 84, 7, 87, 46, 19, 30, 37, 96, 6, 98, 40, 79, 97, 45, 64, 60, 29, 49, 36, 43, 55, }, { 445, 814, 519, 697, 700, 130, 255, 889, 481, 122, 932, 77, 323, 525, 570, 219, 367, 523, 442, 933, 416, 589, 930, 373, 202, 253, 775, 47, 731, 685, 293, 126, 133, 450, 545, 100, 741, 583, 763, 306, 655, 267, 248, 477, 549, 238, 62, 678, 98, 534, 622, 907, 406, 714, 184, 391, 913, 42, 560, 247, 346, 860, 56, 138, 546, 38, 985, 948, 58, 213, 799, 319, 390, 634, 458, 945, 733, 507, 916, 123, 345, 110, 720, 917, 313, 845, 426, 9, 457, 628, 410, 723, 354, 895, 881, 953, 677, 137, 397, 97, 854, 740, 83, 216, 421, 94, 517, 479, 292, 963, 376, 981, 480, 39, 257, 272, 157, 5, 316, 395, 787, 942, 456, 242, 759, 898, 576, 67, 298, 425, 894, 435, 831, 241, 989, 614, 987, 770, 384, 692, 698, 765, 331, 487, 251, 600, 879, 342, 982, 527, 736, 795, 585, 40, 54, 901, 408, 359, 577, 237, 605, 847, 353, 968, 832, 205, 838, 427, 876, 959, 686, 646, 835, 127, 621, 892, 443, 198, 988, 791, 466, 23, 707, 467, 33, 670, 921, 180, 991, 396, 160, 436, 717, 918, 8, 374, 101, 684, 727, 749, }, } for i := 0; i < len(limitsList); i++ { fmt.Println("Example", i+1, "\b\n") bins := getBins(limitsList[i], dataList[i]) printBins(limitsList[i], bins) } }
Write the same code in Go as shown below in Python.
from bisect import bisect_right def bin_it(limits: list, data: list) -> list: "Bin data according to (ascending) limits." bins = [0] * (len(limits) + 1) for d in data: bins[bisect_right(limits, d)] += 1 return bins def bin_print(limits: list, bins: list) -> list: print(f" < {limits[0]:3} := {bins[0]:3}") for lo, hi, count in zip(limits, limits[1:], bins[1:]): print(f">= {lo:3} .. < {hi:3} := {count:3}") print(f">= {limits[-1]:3}  := {bins[-1]:3}") if __name__ == "__main__": print("RC FIRST EXAMPLE\n") limits = [23, 37, 43, 53, 67, 83] data = [95,21,94,12,99,4,70,75,83,93,52,80,57,5,53,86,65,17,92,83,71,61,54,58,47, 16, 8, 9,32,84,7,87,46,19,30,37,96,6,98,40,79,97,45,64,60,29,49,36,43,55] bins = bin_it(limits, data) bin_print(limits, bins) print("\nRC SECOND EXAMPLE\n") limits = [14, 18, 249, 312, 389, 392, 513, 591, 634, 720] data = [445,814,519,697,700,130,255,889,481,122,932, 77,323,525,570,219,367,523,442,933, 416,589,930,373,202,253,775, 47,731,685,293,126,133,450,545,100,741,583,763,306, 655,267,248,477,549,238, 62,678, 98,534,622,907,406,714,184,391,913, 42,560,247, 346,860, 56,138,546, 38,985,948, 58,213,799,319,390,634,458,945,733,507,916,123, 345,110,720,917,313,845,426, 9,457,628,410,723,354,895,881,953,677,137,397, 97, 854,740, 83,216,421, 94,517,479,292,963,376,981,480, 39,257,272,157, 5,316,395, 787,942,456,242,759,898,576, 67,298,425,894,435,831,241,989,614,987,770,384,692, 698,765,331,487,251,600,879,342,982,527,736,795,585, 40, 54,901,408,359,577,237, 605,847,353,968,832,205,838,427,876,959,686,646,835,127,621,892,443,198,988,791, 466, 23,707,467, 33,670,921,180,991,396,160,436,717,918, 8,374,101,684,727,749] bins = bin_it(limits, data) bin_print(limits, bins)
package main import ( "fmt" "sort" ) func getBins(limits, data []int) []int { n := len(limits) bins := make([]int, n+1) for _, d := range data { index := sort.SearchInts(limits, d) if index < len(limits) && d == limits[index] { index++ } bins[index]++ } return bins } func printBins(limits, bins []int) { n := len(limits) fmt.Printf(" < %3d = %2d\n", limits[0], bins[0]) for i := 1; i < n; i++ { fmt.Printf(">= %3d and < %3d = %2d\n", limits[i-1], limits[i], bins[i]) } fmt.Printf(">= %3d = %2d\n", limits[n-1], bins[n]) fmt.Println() } func main() { limitsList := [][]int{ {23, 37, 43, 53, 67, 83}, {14, 18, 249, 312, 389, 392, 513, 591, 634, 720}, } dataList := [][]int{ { 95, 21, 94, 12, 99, 4, 70, 75, 83, 93, 52, 80, 57, 5, 53, 86, 65, 17, 92, 83, 71, 61, 54, 58, 47, 16, 8, 9, 32, 84, 7, 87, 46, 19, 30, 37, 96, 6, 98, 40, 79, 97, 45, 64, 60, 29, 49, 36, 43, 55, }, { 445, 814, 519, 697, 700, 130, 255, 889, 481, 122, 932, 77, 323, 525, 570, 219, 367, 523, 442, 933, 416, 589, 930, 373, 202, 253, 775, 47, 731, 685, 293, 126, 133, 450, 545, 100, 741, 583, 763, 306, 655, 267, 248, 477, 549, 238, 62, 678, 98, 534, 622, 907, 406, 714, 184, 391, 913, 42, 560, 247, 346, 860, 56, 138, 546, 38, 985, 948, 58, 213, 799, 319, 390, 634, 458, 945, 733, 507, 916, 123, 345, 110, 720, 917, 313, 845, 426, 9, 457, 628, 410, 723, 354, 895, 881, 953, 677, 137, 397, 97, 854, 740, 83, 216, 421, 94, 517, 479, 292, 963, 376, 981, 480, 39, 257, 272, 157, 5, 316, 395, 787, 942, 456, 242, 759, 898, 576, 67, 298, 425, 894, 435, 831, 241, 989, 614, 987, 770, 384, 692, 698, 765, 331, 487, 251, 600, 879, 342, 982, 527, 736, 795, 585, 40, 54, 901, 408, 359, 577, 237, 605, 847, 353, 968, 832, 205, 838, 427, 876, 959, 686, 646, 835, 127, 621, 892, 443, 198, 988, 791, 466, 23, 707, 467, 33, 670, 921, 180, 991, 396, 160, 436, 717, 918, 8, 374, 101, 684, 727, 749, }, } for i := 0; i < len(limitsList); i++ { fmt.Println("Example", i+1, "\b\n") bins := getBins(limitsList[i], dataList[i]) printBins(limitsList[i], bins) } }
Generate an equivalent Go version of this Python code.
def setup(): size(600, 600) background(0) stroke(255) drawTree(300, 550, 9) def drawTree(x, y, depth): fork_ang = radians(20) base_len = 10 if depth > 0: pushMatrix() translate(x, y - baseLen * depth) line(0, baseLen * depth, 0, 0) rotate(fork_ang) drawTree(0, 0, depth - 1) rotate(2 * -fork_ang) drawTree(0, 0, depth - 1) popMatrix()
package main import ( "math" "raster" ) const ( width = 400 height = 300 depth = 8 angle = 12 length = 50 frac = .8 ) func main() { g := raster.NewGrmap(width, height) ftree(g, width/2, height*9/10, length, 0, depth) g.Bitmap().WritePpmFile("ftree.ppm") } func ftree(g *raster.Grmap, x, y, distance, direction float64, depth int) { x2 := x + distance*math.Sin(direction*math.Pi/180) y2 := y - distance*math.Cos(direction*math.Pi/180) g.AaLine(x, y, x2, y2) if depth > 0 { ftree(g, x2, y2, distance*frac, direction-angle, depth-1) ftree(g, x2, y2, distance*frac, direction+angle, depth-1) } }
Produce a language-to-language conversion: from Python to Go, same semantics.
from turtle import * colors = ["black", "red", "green", "blue", "magenta", "cyan", "yellow", "white"] screen = getscreen() left_edge = -screen.window_width()//2 right_edge = screen.window_width()//2 quarter_height = screen.window_height()//4 half_height = quarter_height * 2 speed("fastest") for quarter in range(4): pensize(quarter+1) colornum = 0 min_y = half_height - ((quarter + 1) * quarter_height) max_y = half_height - ((quarter) * quarter_height) for x in range(left_edge,right_edge,quarter+1): penup() pencolor(colors[colornum]) colornum = (colornum + 1) % len(colors) setposition(x,min_y) pendown() setposition(x,max_y) notused = input("Hit enter to continue: ")
package main import "github.com/fogleman/gg" var palette = [8]string{ "000000", "FF0000", "00FF00", "0000FF", "FF00FF", "00FFFF", "FFFF00", "FFFFFF", } func pinstripe(dc *gg.Context) { w := dc.Width() h := dc.Height() / 4 for b := 1; b <= 4; b++ { for x, ci := 0, 0; x < w; x, ci = x+b, ci+1 { dc.SetHexColor(palette[ci%8]) y := h * (b - 1) dc.DrawRectangle(float64(x), float64(y), float64(b), float64(h)) dc.Fill() } } } func main() { dc := gg.NewContext(900, 600) pinstripe(dc) dc.SavePNG("color_pinstripe.png") }
Change the programming language of this snippet from Python to Go without modifying what it does.
from datetime import date from calendar import isleap def weekday(d): days = ["Sunday", "Monday", "Tuesday", "Wednesday", "Thursday", "Friday", "Saturday"] dooms = [ [3, 7, 7, 4, 2, 6, 4, 1, 5, 3, 7, 5], [4, 1, 7, 4, 2, 6, 4, 1, 5, 3, 7, 5] ] c = d.year // 100 r = d.year % 100 s = r // 12 t = r % 12 c_anchor = (5 * (c % 4) + 2) % 7 doomsday = (s + t + (t // 4) + c_anchor) % 7 anchorday = dooms[isleap(d.year)][d.month - 1] weekday = (doomsday + d.day - anchorday + 7) % 7 return days[weekday] dates = [date(*x) for x in [(1800, 1, 6), (1875, 3, 29), (1915, 12, 7), (1970, 12, 23), (2043, 5, 14), (2077, 2, 12), (2101, 4, 2)] ] for d in dates: tense = "was" if d < date.today() else "is" if d == date.today() else "will be" print("{} {} a {}".format(d.strftime("%B %d, %Y"), tense, weekday(d)))
package main import ( "fmt" "strconv" ) var days = []string{"Sunday", "Monday", "Tuesday", "Wednesday", "Thursday", "Friday", "Saturday"} func anchorDay(y int) int { return (2 + 5*(y%4) + 4*(y%100) + 6*(y%400)) % 7 } func isLeapYear(y int) bool { return y%4 == 0 && (y%100 != 0 || y%400 == 0) } var firstDaysCommon = []int{3, 7, 7, 4, 2, 6, 4, 1, 5, 3, 7, 5} var firstDaysLeap = []int{4, 1, 7, 4, 2, 6, 4, 1, 5, 3, 7, 5} func main() { dates := []string{ "1800-01-06", "1875-03-29", "1915-12-07", "1970-12-23", "2043-05-14", "2077-02-12", "2101-04-02", } fmt.Println("Days of week given by Doomsday rule:") for _, date := range dates { y, _ := strconv.Atoi(date[0:4]) m, _ := strconv.Atoi(date[5:7]) m-- d, _ := strconv.Atoi(date[8:10]) a := anchorDay(y) f := firstDaysCommon[m] if isLeapYear(y) { f = firstDaysLeap[m] } w := d - f if w < 0 { w = 7 + w } dow := (a + w) % 7 fmt.Printf("%s -> %s\n", date, days[dow]) } }
Produce a language-to-language conversion: from Python to Go, same semantics.
from datetime import date from calendar import isleap def weekday(d): days = ["Sunday", "Monday", "Tuesday", "Wednesday", "Thursday", "Friday", "Saturday"] dooms = [ [3, 7, 7, 4, 2, 6, 4, 1, 5, 3, 7, 5], [4, 1, 7, 4, 2, 6, 4, 1, 5, 3, 7, 5] ] c = d.year // 100 r = d.year % 100 s = r // 12 t = r % 12 c_anchor = (5 * (c % 4) + 2) % 7 doomsday = (s + t + (t // 4) + c_anchor) % 7 anchorday = dooms[isleap(d.year)][d.month - 1] weekday = (doomsday + d.day - anchorday + 7) % 7 return days[weekday] dates = [date(*x) for x in [(1800, 1, 6), (1875, 3, 29), (1915, 12, 7), (1970, 12, 23), (2043, 5, 14), (2077, 2, 12), (2101, 4, 2)] ] for d in dates: tense = "was" if d < date.today() else "is" if d == date.today() else "will be" print("{} {} a {}".format(d.strftime("%B %d, %Y"), tense, weekday(d)))
package main import ( "fmt" "strconv" ) var days = []string{"Sunday", "Monday", "Tuesday", "Wednesday", "Thursday", "Friday", "Saturday"} func anchorDay(y int) int { return (2 + 5*(y%4) + 4*(y%100) + 6*(y%400)) % 7 } func isLeapYear(y int) bool { return y%4 == 0 && (y%100 != 0 || y%400 == 0) } var firstDaysCommon = []int{3, 7, 7, 4, 2, 6, 4, 1, 5, 3, 7, 5} var firstDaysLeap = []int{4, 1, 7, 4, 2, 6, 4, 1, 5, 3, 7, 5} func main() { dates := []string{ "1800-01-06", "1875-03-29", "1915-12-07", "1970-12-23", "2043-05-14", "2077-02-12", "2101-04-02", } fmt.Println("Days of week given by Doomsday rule:") for _, date := range dates { y, _ := strconv.Atoi(date[0:4]) m, _ := strconv.Atoi(date[5:7]) m-- d, _ := strconv.Atoi(date[8:10]) a := anchorDay(y) f := firstDaysCommon[m] if isLeapYear(y) { f = firstDaysLeap[m] } w := d - f if w < 0 { w = 7 + w } dow := (a + w) % 7 fmt.Printf("%s -> %s\n", date, days[dow]) } }
Transform the following Python implementation into Go, maintaining the same output and logic.
def cocktailshiftingbounds(A): beginIdx = 0 endIdx = len(A) - 1 while beginIdx <= endIdx: newBeginIdx = endIdx newEndIdx = beginIdx for ii in range(beginIdx,endIdx): if A[ii] > A[ii + 1]: A[ii+1], A[ii] = A[ii], A[ii+1] newEndIdx = ii endIdx = newEndIdx for ii in range(endIdx,beginIdx-1,-1): if A[ii] > A[ii + 1]: A[ii+1], A[ii] = A[ii], A[ii+1] newBeginIdx = ii beginIdx = newBeginIdx + 1 test1 = [7, 6, 5, 9, 8, 4, 3, 1, 2, 0] cocktailshiftingbounds(test1) print(test1) test2=list('big fjords vex quick waltz nymph') cocktailshiftingbounds(test2) print(''.join(test2))
package main import ( "fmt" "math/rand" "time" ) func cocktailShakerSort(a []int) { var begin = 0 var end = len(a) - 2 for begin <= end { newBegin := end newEnd := begin for i := begin; i <= end; i++ { if a[i] > a[i+1] { a[i+1], a[i] = a[i], a[i+1] newEnd = i } } end = newEnd - 1 for i := end; i >= begin; i-- { if a[i] > a[i+1] { a[i+1], a[i] = a[i], a[i+1] newBegin = i } } begin = newBegin + 1 } } func cocktailSort(a []int) { last := len(a) - 1 for { swapped := false for i := 0; i < last; i++ { if a[i] > a[i+1] { a[i], a[i+1] = a[i+1], a[i] swapped = true } } if !swapped { return } swapped = false for i := last - 1; i >= 0; i-- { if a[i] > a[i+1] { a[i], a[i+1] = a[i+1], a[i] swapped = true } } if !swapped { return } } } func main() { a := []int{21, 4, -9, 62, -7, 107, -62, 4, 0, -170} fmt.Println("Original array:", a) b := make([]int, len(a)) copy(b, a) cocktailSort(a) fmt.Println("Cocktail sort :", a) cocktailShakerSort(b) fmt.Println("C/Shaker sort :", b) rand.Seed(time.Now().UnixNano()) fmt.Println("\nRelative speed of the two sorts") fmt.Println(" N x faster (CSS v CS)") fmt.Println("----- -------------------") const runs = 10 for _, n := range []int{1000, 2000, 4000, 8000, 10000, 20000} { sum := 0.0 for i := 1; i <= runs; i++ { nums := make([]int, n) for i := 0; i < n; i++ { rn := rand.Intn(100000) if i%2 == 1 { rn = -rn } nums[i] = rn } nums2 := make([]int, n) copy(nums2, nums) start := time.Now() cocktailSort(nums) elapsed := time.Since(start) start2 := time.Now() cocktailShakerSort(nums2) elapsed2 := time.Since(start2) sum += float64(elapsed) / float64(elapsed2) } fmt.Printf(" %2dk %0.3f\n", n/1000, sum/runs) } }
Produce a functionally identical Go code for the snippet given in Python.
import pygame, sys from pygame.locals import * from math import sin, cos, radians pygame.init() WINDOWSIZE = 250 TIMETICK = 100 BOBSIZE = 15 window = pygame.display.set_mode((WINDOWSIZE, WINDOWSIZE)) pygame.display.set_caption("Pendulum") screen = pygame.display.get_surface() screen.fill((255,255,255)) PIVOT = (WINDOWSIZE/2, WINDOWSIZE/10) SWINGLENGTH = PIVOT[1]*4 class BobMass(pygame.sprite.Sprite): def __init__(self): pygame.sprite.Sprite.__init__(self) self.theta = 45 self.dtheta = 0 self.rect = pygame.Rect(PIVOT[0]-SWINGLENGTH*cos(radians(self.theta)), PIVOT[1]+SWINGLENGTH*sin(radians(self.theta)), 1,1) self.draw() def recomputeAngle(self): scaling = 3000.0/(SWINGLENGTH**2) firstDDtheta = -sin(radians(self.theta))*scaling midDtheta = self.dtheta + firstDDtheta midtheta = self.theta + (self.dtheta + midDtheta)/2.0 midDDtheta = -sin(radians(midtheta))*scaling midDtheta = self.dtheta + (firstDDtheta + midDDtheta)/2 midtheta = self.theta + (self.dtheta + midDtheta)/2 midDDtheta = -sin(radians(midtheta)) * scaling lastDtheta = midDtheta + midDDtheta lasttheta = midtheta + (midDtheta + lastDtheta)/2.0 lastDDtheta = -sin(radians(lasttheta)) * scaling lastDtheta = midDtheta + (midDDtheta + lastDDtheta)/2.0 lasttheta = midtheta + (midDtheta + lastDtheta)/2.0 self.dtheta = lastDtheta self.theta = lasttheta self.rect = pygame.Rect(PIVOT[0]- SWINGLENGTH*sin(radians(self.theta)), PIVOT[1]+ SWINGLENGTH*cos(radians(self.theta)),1,1) def draw(self): pygame.draw.circle(screen, (0,0,0), PIVOT, 5, 0) pygame.draw.circle(screen, (0,0,0), self.rect.center, BOBSIZE, 0) pygame.draw.aaline(screen, (0,0,0), PIVOT, self.rect.center) pygame.draw.line(screen, (0,0,0), (0, PIVOT[1]), (WINDOWSIZE, PIVOT[1])) def update(self): self.recomputeAngle() screen.fill((255,255,255)) self.draw() bob = BobMass() TICK = USEREVENT + 2 pygame.time.set_timer(TICK, TIMETICK) def input(events): for event in events: if event.type == QUIT: sys.exit(0) elif event.type == TICK: bob.update() while True: input(pygame.event.get()) pygame.display.flip()
package main import ( "github.com/google/gxui" "github.com/google/gxui/drivers/gl" "github.com/google/gxui/math" "github.com/google/gxui/themes/dark" omath "math" "time" ) const ( ANIMATION_WIDTH int = 480 ANIMATION_HEIGHT int = 320 BALL_RADIUS float32 = 25.0 METER_PER_PIXEL float64 = 1.0 / 20.0 PHI_ZERO float64 = omath.Pi * 0.5 ) var ( l float64 = float64(ANIMATION_HEIGHT) * 0.5 freq float64 = omath.Sqrt(9.81 / (l * METER_PER_PIXEL)) ) type Pendulum interface { GetPhi() float64 } type mathematicalPendulum struct { start time.Time } func (p *mathematicalPendulum) GetPhi() float64 { if (p.start == time.Time{}) { p.start = time.Now() } t := float64(time.Since(p.start).Nanoseconds()) / omath.Pow10(9) return PHI_ZERO * omath.Cos(t*freq) } type numericalPendulum struct { currentPhi float64 angAcc float64 angVel float64 lastTime time.Time } func (p *numericalPendulum) GetPhi() float64 { dt := 0.0 if (p.lastTime != time.Time{}) { dt = float64(time.Since(p.lastTime).Nanoseconds()) / omath.Pow10(9) } p.lastTime = time.Now() p.angAcc = -9.81 / (float64(l) * METER_PER_PIXEL) * omath.Sin(p.currentPhi) p.angVel += p.angAcc * dt p.currentPhi += p.angVel * dt return p.currentPhi } func draw(p Pendulum, canvas gxui.Canvas, x, y int) { attachment := math.Point{X: ANIMATION_WIDTH/2 + x, Y: y} phi := p.GetPhi() ball := math.Point{X: x + ANIMATION_WIDTH/2 + math.Round(float32(l*omath.Sin(phi))), Y: y + math.Round(float32(l*omath.Cos(phi)))} line := gxui.Polygon{gxui.PolygonVertex{attachment, 0}, gxui.PolygonVertex{ball, 0}} canvas.DrawLines(line, gxui.DefaultPen) m := math.Point{int(BALL_RADIUS), int(BALL_RADIUS)} rect := math.Rect{ball.Sub(m), ball.Add(m)} canvas.DrawRoundedRect(rect, BALL_RADIUS, BALL_RADIUS, BALL_RADIUS, BALL_RADIUS, gxui.TransparentPen, gxui.CreateBrush(gxui.Yellow)) } func appMain(driver gxui.Driver) { theme := dark.CreateTheme(driver) window := theme.CreateWindow(ANIMATION_WIDTH, 2*ANIMATION_HEIGHT, "Pendulum") window.SetBackgroundBrush(gxui.CreateBrush(gxui.Gray50)) image := theme.CreateImage() ticker := time.NewTicker(time.Millisecond * 15) pendulum := &mathematicalPendulum{} pendulum2 := &numericalPendulum{PHI_ZERO, 0.0, 0.0, time.Time{}} go func() { for _ = range ticker.C { canvas := driver.CreateCanvas(math.Size{ANIMATION_WIDTH, 2 * ANIMATION_HEIGHT}) canvas.Clear(gxui.White) draw(pendulum, canvas, 0, 0) draw(pendulum2, canvas, 0, ANIMATION_HEIGHT) canvas.Complete() driver.Call(func() { image.SetCanvas(canvas) }) } }() window.AddChild(image) window.OnClose(ticker.Stop) window.OnClose(driver.Terminate) } func main() { gl.StartDriver(appMain) }
Please provide an equivalent version of this Python code in Go.
>>> def int2bin(n): 'From positive integer to list of binary bits, msb at index 0' if n: bits = [] while n: n,remainder = divmod(n, 2) bits.insert(0, remainder) return bits else: return [0] >>> def bin2int(bits): 'From binary bits, msb at index 0 to integer' i = 0 for bit in bits: i = i * 2 + bit return i
package main import "fmt" func enc(b int) int { return b ^ b>>1 } func dec(g int) (b int) { for ; g != 0; g >>= 1 { b ^= g } return } func main() { fmt.Println("decimal binary gray decoded") for b := 0; b < 32; b++ { g := enc(b) d := dec(g) fmt.Printf(" %2d %05b %05b %05b %2d\n", b, b, g, d, d) } }
Change the following Python code into Go without altering its purpose.
>>> def int2bin(n): 'From positive integer to list of binary bits, msb at index 0' if n: bits = [] while n: n,remainder = divmod(n, 2) bits.insert(0, remainder) return bits else: return [0] >>> def bin2int(bits): 'From binary bits, msb at index 0 to integer' i = 0 for bit in bits: i = i * 2 + bit return i
package main import "fmt" func enc(b int) int { return b ^ b>>1 } func dec(g int) (b int) { for ; g != 0; g >>= 1 { b ^= g } return } func main() { fmt.Println("decimal binary gray decoded") for b := 0; b < 32; b++ { g := enc(b) d := dec(g) fmt.Printf(" %2d %05b %05b %05b %2d\n", b, b, g, d, d) } }
Convert the following code from Python to Go, ensuring the logic remains intact.
>>> def int2bin(n): 'From positive integer to list of binary bits, msb at index 0' if n: bits = [] while n: n,remainder = divmod(n, 2) bits.insert(0, remainder) return bits else: return [0] >>> def bin2int(bits): 'From binary bits, msb at index 0 to integer' i = 0 for bit in bits: i = i * 2 + bit return i
package main import "fmt" func enc(b int) int { return b ^ b>>1 } func dec(g int) (b int) { for ; g != 0; g >>= 1 { b ^= g } return } func main() { fmt.Println("decimal binary gray decoded") for b := 0; b < 32; b++ { g := enc(b) d := dec(g) fmt.Printf(" %2d %05b %05b %05b %2d\n", b, b, g, d, d) } }
Write the same algorithm in Go as shown in this Python implementation.
>>> with open('/dev/tape', 'w') as t: t.write('Hi Tape!\n') ... >>>
package main import ( "archive/tar" "compress/gzip" "flag" "io" "log" "os" "time" ) func main() { filename := flag.String("file", "TAPE.FILE", "filename within TAR") data := flag.String("data", "", "data for file") outfile := flag.String("out", "", "output file or device (e.g. /dev/tape)") gzipFlag := flag.Bool("gzip", false, "use gzip compression") flag.Parse() var w io.Writer = os.Stdout if *outfile != "" { f, err := os.Create(*outfile) if err != nil { log.Fatalf("opening/creating %q: %v", *outfile, err) } defer f.Close() w = f } if *gzipFlag { zw := gzip.NewWriter(w) defer zw.Close() w = zw } tw := tar.NewWriter(w) defer tw.Close() w = tw tw.WriteHeader(&tar.Header{ Name: *filename, Mode: 0660, Size: int64(len(*data)), ModTime: time.Now(), Typeflag: tar.TypeReg, Uname: "guest", Gname: "guest", }) _, err := w.Write([]byte(*data)) if err != nil { log.Fatal("writing data:", err) } }
Convert this Python snippet to Go and keep its semantics consistent.
>>> with open('/dev/tape', 'w') as t: t.write('Hi Tape!\n') ... >>>
package main import ( "archive/tar" "compress/gzip" "flag" "io" "log" "os" "time" ) func main() { filename := flag.String("file", "TAPE.FILE", "filename within TAR") data := flag.String("data", "", "data for file") outfile := flag.String("out", "", "output file or device (e.g. /dev/tape)") gzipFlag := flag.Bool("gzip", false, "use gzip compression") flag.Parse() var w io.Writer = os.Stdout if *outfile != "" { f, err := os.Create(*outfile) if err != nil { log.Fatalf("opening/creating %q: %v", *outfile, err) } defer f.Close() w = f } if *gzipFlag { zw := gzip.NewWriter(w) defer zw.Close() w = zw } tw := tar.NewWriter(w) defer tw.Close() w = tw tw.WriteHeader(&tar.Header{ Name: *filename, Mode: 0660, Size: int64(len(*data)), ModTime: time.Now(), Typeflag: tar.TypeReg, Uname: "guest", Gname: "guest", }) _, err := w.Write([]byte(*data)) if err != nil { log.Fatal("writing data:", err) } }
Translate this program into Go but keep the logic exactly as in Python.
def heapsort(lst): for start in range((len(lst)-2)/2, -1, -1): siftdown(lst, start, len(lst)-1) for end in range(len(lst)-1, 0, -1): lst[end], lst[0] = lst[0], lst[end] siftdown(lst, 0, end - 1) return lst def siftdown(lst, start, end): root = start while True: child = root * 2 + 1 if child > end: break if child + 1 <= end and lst[child] < lst[child + 1]: child += 1 if lst[root] < lst[child]: lst[root], lst[child] = lst[child], lst[root] root = child else: break
package main import ( "sort" "container/heap" "fmt" ) type HeapHelper struct { container sort.Interface length int } func (self HeapHelper) Len() int { return self.length } func (self HeapHelper) Less(i, j int) bool { return self.container.Less(j, i) } func (self HeapHelper) Swap(i, j int) { self.container.Swap(i, j) } func (self *HeapHelper) Push(x interface{}) { panic("impossible") } func (self *HeapHelper) Pop() interface{} { self.length-- return nil } func heapSort(a sort.Interface) { helper := HeapHelper{ a, a.Len() } heap.Init(&helper) for helper.length > 0 { heap.Pop(&helper) } } func main() { a := []int{170, 45, 75, -90, -802, 24, 2, 66} fmt.Println("before:", a) heapSort(sort.IntSlice(a)) fmt.Println("after: ", a) }
Convert this Python snippet to Go and keep its semantics consistent.
import random class Card(object): suits = ("Clubs","Hearts","Spades","Diamonds") pips = ("2","3","4","5","6","7","8","9","10","Jack","Queen","King","Ace") def __init__(self, pip,suit): self.pip=pip self.suit=suit def __str__(self): return "%s %s"%(self.pip,self.suit) class Deck(object): def __init__(self): self.deck = [Card(pip,suit) for suit in Card.suits for pip in Card.pips] def __str__(self): return "[%s]"%", ".join( (str(card) for card in self.deck)) def shuffle(self): random.shuffle(self.deck) def deal(self): self.shuffle() return self.deck.pop(0)
package cards import ( "math/rand" ) type Suit uint8 const ( Spade Suit = 3 Heart Suit = 2 Diamond Suit = 1 Club Suit = 0 ) func (s Suit) String() string { const suites = "CDHS" return suites[s : s+1] } type Rank uint8 const ( Ace Rank = 1 Two Rank = 2 Three Rank = 3 Four Rank = 4 Five Rank = 5 Six Rank = 6 Seven Rank = 7 Eight Rank = 8 Nine Rank = 9 Ten Rank = 10 Jack Rank = 11 Queen Rank = 12 King Rank = 13 ) func (r Rank) String() string { const ranks = "A23456789TJQK" return ranks[r-1 : r] } type Card uint8 func NewCard(r Rank, s Suit) Card { return Card(13*uint8(s) + uint8(r-1)) } func (c Card) RankSuit() (Rank, Suit) { return Rank(c%13 + 1), Suit(c / 13) } func (c Card) Rank() Rank { return Rank(c%13 + 1) } func (c Card) Suit() Suit { return Suit(c / 13) } func (c Card) String() string { return c.Rank().String() + c.Suit().String() } type Deck []Card func NewDeck() Deck { d := make(Deck, 52) for i := range d { d[i] = Card(i) } return d } func (d Deck) String() string { s := "" for i, c := range d { switch { case i == 0: case i%13 == 0: s += "\n" default: s += " " } s += c.String() } return s } func (d Deck) Shuffle() { for i := range d { j := rand.Intn(i + 1) d[i], d[j] = d[j], d[i] } } func (d Deck) Contains(tc Card) bool { for _, c := range d { if c == tc { return true } } return false } func (d *Deck) AddDeck(decks ...Deck) { for _, o := range decks { *d = append(*d, o...) } } func (d *Deck) AddCard(c Card) { *d = append(*d, c) } func (d *Deck) Draw(n int) Deck { old := *d *d = old[n:] return old[:n:n] } func (d *Deck) DrawCard() (Card, bool) { if len(*d) == 0 { return 0, false } old := *d *d = old[1:] return old[0], true } func (d *Deck) Deal(cards int, hands ...Deck) ([]Deck, bool) { for i := 0; i < cards; i++ { for j := range hands { if len(*d) == 0 { return hands, false } hands[j] = append(hands[j], (*d)[0]) *d = (*d)[1:] } } return hands, true }
Write the same code in Go as shown below in Python.
array = [] array.append(1) array.append(3) array[0] = 2 print array[0]
package main import ( "fmt" ) func main() { var a [5]int fmt.Println("len(a) =", len(a)) fmt.Println("a =", a) a[0] = 3 fmt.Println("a =", a) fmt.Println("a[0] =", a[0]) s := a[:4] fmt.Println("s =", s) fmt.Println("len(s) =", len(s), " cap(s) =", cap(s)) s = s[:5] fmt.Println("s =", s) a[0] = 22 fmt.Println("a =", a) fmt.Println("s =", s) s = append(s, 4, 5, 6) fmt.Println("s =", s) fmt.Println("len(s) =", len(s), " cap(s) =", cap(s)) a[4] = -1 fmt.Println("a =", a) fmt.Println("s =", s) s = make([]int, 8) fmt.Println("s =", s) fmt.Println("len(s) =", len(s), " cap(s) =", cap(s)) }
Rewrite the snippet below in Go so it works the same as the original Python code.
def setup(): size(729, 729) fill(0) background(255) noStroke() rect(width / 3, height / 3, width / 3, width / 3) rectangles(width / 3, height / 3, width / 3) def rectangles(x, y, s): if s < 1: return xc, yc = x - s, y - s for row in range(3): for col in range(3): if not (row == 1 and col == 1): xx, yy = xc + row * s, yc + col * s delta = s / 3 rect(xx + delta, yy + delta, delta, delta) rectangles(xx + s / 3, yy + s / 3, s / 3)
package main import ( "fmt" "strings" "unicode/utf8" ) var order = 3 var grain = "#" func main() { carpet := []string{grain} for ; order > 0; order-- { hole := strings.Repeat(" ", utf8.RuneCountInString(carpet[0])) middle := make([]string, len(carpet)) for i, s := range carpet { middle[i] = s + hole + s carpet[i] = strings.Repeat(s, 3) } carpet = append(append(carpet, middle...), carpet...) } for _, r := range carpet { fmt.Println(r) } }
Port the provided Python code into Go while preserving the original functionality.
import random def bogosort(l): while not in_order(l): random.shuffle(l) return l def in_order(l): if not l: return True last = l[0] for x in l[1:]: if x < last: return False last = x return True
package main import ( "fmt" "math/rand" "sort" "time" ) func main() { list := []int{31, 41, 59, 26, 53, 58, 97, 93, 23, 84} rand.Seed(time.Now().UnixNano()) fmt.Println("unsorted:", list) temp := make([]int, len(list)) copy(temp, list) for !sort.IntsAreSorted(temp) { for i, v := range rand.Perm(len(list)) { temp[i] = list[v] } } fmt.Println("sorted! ", temp) }
Keep all operations the same but rewrite the snippet in Go.
import pandas as pd df_patients = pd.read_csv (r'patients.csv', sep = ",", decimal=".") df_visits = pd.read_csv (r'visits.csv', sep = ",", decimal=".") df_visits['VISIT_DATE'] = pd.to_datetime(df_visits['VISIT_DATE']) df_merge = df_patients.merge(df_visits, on='PATIENT_ID', how='left') df_group = df_merge.groupby(['PATIENT_ID','LASTNAME'], as_index=False) df_result = df_group.agg({'VISIT_DATE': 'max', 'SCORE': [lambda x: x.sum(min_count=1),'mean']}) print(df_result)
package main import ( "fmt" "math" "sort" ) type Patient struct { id int lastName string } var patientDir = make(map[int]string) var patientIds []int func patientNew(id int, lastName string) Patient { patientDir[id] = lastName patientIds = append(patientIds, id) sort.Ints(patientIds) return Patient{id, lastName} } type DS struct { dates []string scores []float64 } type Visit struct { id int date string score float64 } var visitDir = make(map[int]DS) func visitNew(id int, date string, score float64) Visit { if date == "" { date = "0000-00-00" } v, ok := visitDir[id] if ok { v.dates = append(v.dates, date) v.scores = append(v.scores, score) visitDir[id] = DS{v.dates, v.scores} } else { visitDir[id] = DS{[]string{date}, []float64{score}} } return Visit{id, date, score} } type Merge struct{ id int } func (m Merge) lastName() string { return patientDir[m.id] } func (m Merge) dates() []string { return visitDir[m.id].dates } func (m Merge) scores() []float64 { return visitDir[m.id].scores } func (m Merge) lastVisit() string { dates := m.dates() dates2 := make([]string, len(dates)) copy(dates2, dates) sort.Strings(dates2) return dates2[len(dates2)-1] } func (m Merge) scoreSum() float64 { sum := 0.0 for _, score := range m.scores() { if score != -1 { sum += score } } return sum } func (m Merge) scoreAvg() float64 { count := 0 for _, score := range m.scores() { if score != -1 { count++ } } return m.scoreSum() / float64(count) } func mergePrint(merges []Merge) { fmt.Println("| PATIENT_ID | LASTNAME | LAST_VISIT | SCORE_SUM | SCORE_AVG |") f := "| %d | %-7s | %s | %4s | %4s |\n" for _, m := range merges { _, ok := visitDir[m.id] if ok { lv := m.lastVisit() if lv == "0000-00-00" { lv = " " } scoreSum := m.scoreSum() ss := fmt.Sprintf("%4.1f", scoreSum) if scoreSum == 0 { ss = " " } scoreAvg := m.scoreAvg() sa := " " if !math.IsNaN(scoreAvg) { sa = fmt.Sprintf("%4.2f", scoreAvg) } fmt.Printf(f, m.id, m.lastName(), lv, ss, sa) } else { fmt.Printf(f, m.id, m.lastName(), " ", " ", " ") } } } func main() { patientNew(1001, "Hopper") patientNew(4004, "Wirth") patientNew(3003, "Kemeny") patientNew(2002, "Gosling") patientNew(5005, "Kurtz") visitNew(2002, "2020-09-10", 6.8) visitNew(1001, "2020-09-17", 5.5) visitNew(4004, "2020-09-24", 8.4) visitNew(2002, "2020-10-08", -1) visitNew(1001, "", 6.6) visitNew(3003, "2020-11-12", -1) visitNew(4004, "2020-11-05", 7.0) visitNew(1001, "2020-11-19", 5.3) merges := make([]Merge, len(patientIds)) for i, id := range patientIds { merges[i] = Merge{id} } mergePrint(merges) }
Convert the following code from Python to Go, ensuring the logic remains intact.
def euler(f,y0,a,b,h): t,y = a,y0 while t <= b: print "%6.3f %6.3f" % (t,y) t += h y += h * f(t,y) def newtoncooling(time, temp): return -0.07 * (temp - 20) euler(newtoncooling,100,0,100,10)
package main import ( "fmt" "math" ) type fdy func(float64, float64) float64 func eulerStep(f fdy, x, y, h float64) float64 { return y + h*f(x, y) } func newCoolingRate(k float64) func(float64) float64 { return func(deltaTemp float64) float64 { return -k * deltaTemp } } func newTempFunc(k, ambientTemp, initialTemp float64) func(float64) float64 { return func(time float64) float64 { return ambientTemp + (initialTemp-ambientTemp)*math.Exp(-k*time) } } func newCoolingRateDy(k, ambientTemp float64) fdy { crf := newCoolingRate(k) return func(_, objectTemp float64) float64 { return crf(objectTemp - ambientTemp) } } func main() { k := .07 tempRoom := 20. tempObject := 100. fcr := newCoolingRateDy(k, tempRoom) analytic := newTempFunc(k, tempRoom, tempObject) for _, deltaTime := range []float64{2, 5, 10} { fmt.Printf("Step size = %.1f\n", deltaTime) fmt.Println(" Time Euler's Analytic") temp := tempObject for time := 0.; time <= 100; time += deltaTime { fmt.Printf("%5.1f %7.3f %7.3f\n", time, temp, analytic(time)) temp = eulerStep(fcr, time, temp, deltaTime) } fmt.Println() } }
Generate a Go translation of this Python snippet without changing its computational steps.
>>> from math import floor, sqrt >>> def non_square(n): return n + floor(1/2 + sqrt(n)) >>> >>> print(*map(non_square, range(1, 23))) 2 3 5 6 7 8 10 11 12 13 14 15 17 18 19 20 21 22 23 24 26 27 >>> >>> def is_square(n): return sqrt(n).is_integer() >>> non_squares = map(non_square, range(1, 10 ** 6)) >>> next(filter(is_square, non_squares)) StopIteration Traceback (most recent call last) <ipython-input-45-f32645fc1c0a> in <module>() 1 non_squares = map(non_square, range(1, 10 ** 6)) ----> 2 next(filter(is_square, non_squares)) StopIteration:
package main import ( "fmt" "math" ) func remarkable(n int) int { return n + int(.5+math.Sqrt(float64(n))) } func main() { fmt.Println(" n r(n)") fmt.Println("--- ---") for n := 1; n <= 22; n++ { fmt.Printf("%3d %3d\n", n, remarkable(n)) } const limit = 1e6 fmt.Println("\nChecking for squares for n <", limit) next := 2 nextSq := 4 for n := 1; n < limit; n++ { r := remarkable(n) switch { case r == nextSq: panic(n) case r > nextSq: fmt.Println(nextSq, "didn't occur") next++ nextSq = next * next } } fmt.Println("No squares occur for n <", limit) }
Convert this Python snippet to Go and keep its semantics consistent.
>>> s = 'abcdefgh' >>> n, m, char, chars = 2, 3, 'd', 'cd' >>> >>> s[n-1:n+m-1] 'bcd' >>> >>> s[n-1:] 'bcdefgh' >>> >>> s[:-1] 'abcdefg' >>> >>> indx = s.index(char) >>> s[indx:indx+m] 'def' >>> >>> indx = s.index(chars) >>> s[indx:indx+m] 'cde' >>>
package main import ( "fmt" "strings" ) func main() { s := "ABCDEFGH" n, m := 2, 3 fmt.Println("Index: ", "01234567") fmt.Println("String:", s) fmt.Printf("Start %d, length %d: %s\n", n, m, s[n : n+m]) fmt.Printf("Start %d, to end: %s\n", n, s[n:]) fmt.Printf("All but last: %s\n", s[:len(s)-1]) dx := strings.IndexByte(s, 'D') fmt.Printf("Start 'D', length %d: %s\n", m, s[dx : dx+m]) sx := strings.Index(s, "DE") fmt.Printf(`Start "DE", length %d: %s`+"\n", m, s[sx : sx+m]) }
Keep all operations the same but rewrite the snippet in Go.
>>> def jortsort(sequence): return list(sequence) == sorted(sequence) >>> for data in [(1,2,4,3), (14,6,8), ['a', 'c'], ['s', 'u', 'x'], 'CVGH', 'PQRST']: print(f'jortsort({repr(data)}) is {jortsort(data)}') jortsort((1, 2, 4, 3)) is False jortsort((14, 6, 8)) is False jortsort(['a', 'c']) is True jortsort(['s', 'u', 'x']) is True jortsort('CVGH') is False jortsort('PQRST') is True >>>
package main import ( "log" "sort" ) func main() { log.Println(jortSort([]int{1, 2, 1, 11, 213, 2, 4})) log.Println(jortSort([]int{0, 1, 0, 0, 0, 0})) log.Println(jortSort([]int{1, 2, 4, 11, 22, 22})) log.Println(jortSort([]int{0, 0, 0, 1, 2, 2})) } func jortSort(a []int) bool { c := make([]int, len(a)) copy(c, a) sort.Ints(a) for k, v := range c { if v == a[k] { continue } else { return false } } return true }
Change the following Python code into Go without altering its purpose.
import calendar calendar.isleap(year)
func isLeap(year int) bool { return year%400 == 0 || year%4 == 0 && year%100 != 0 }
Ensure the translated Go code behaves exactly like the original Python snippet.
from __future__ import print_function from scipy.misc import factorial as fact from scipy.misc import comb def perm(N, k, exact=0): return comb(N, k, exact) * fact(k, exact) exact=True print('Sample Perms 1..12') for N in range(1, 13): k = max(N-2, 1) print('%iP%i =' % (N, k), perm(N, k, exact), end=', ' if N % 5 else '\n') print('\n\nSample Combs 10..60') for N in range(10, 61, 10): k = N-2 print('%iC%i =' % (N, k), comb(N, k, exact), end=', ' if N % 50 else '\n') exact=False print('\n\nSample Perms 5..1500 Using FP approximations') for N in [5, 15, 150, 1500, 15000]: k = N-2 print('%iP%i =' % (N, k), perm(N, k, exact)) print('\nSample Combs 100..1000 Using FP approximations') for N in range(100, 1001, 100): k = N-2 print('%iC%i =' % (N, k), comb(N, k, exact))
package main import ( "fmt" "math/big" ) func main() { var n, p int64 fmt.Printf("A sample of permutations from 1 to 12:\n") for n = 1; n < 13; n++ { p = n / 3 fmt.Printf("P(%d,%d) = %d\n", n, p, perm(big.NewInt(n), big.NewInt(p))) } fmt.Printf("\nA sample of combinations from 10 to 60:\n") for n = 10; n < 61; n += 10 { p = n / 3 fmt.Printf("C(%d,%d) = %d\n", n, p, comb(big.NewInt(n), big.NewInt(p))) } fmt.Printf("\nA sample of permutations from 5 to 15000:\n") nArr := [...]int64{5, 50, 500, 1000, 5000, 15000} for _, n = range nArr { p = n / 3 fmt.Printf("P(%d,%d) = %d\n", n, p, perm(big.NewInt(n), big.NewInt(p))) } fmt.Printf("\nA sample of combinations from 100 to 1000:\n") for n = 100; n < 1001; n += 100 { p = n / 3 fmt.Printf("C(%d,%d) = %d\n", n, p, comb(big.NewInt(n), big.NewInt(p))) } } func fact(n *big.Int) *big.Int { if n.Sign() < 1 { return big.NewInt(0) } r := big.NewInt(1) i := big.NewInt(2) for i.Cmp(n) < 1 { r.Mul(r, i) i.Add(i, big.NewInt(1)) } return r } func perm(n, k *big.Int) *big.Int { r := fact(n) r.Div(r, fact(n.Sub(n, k))) return r } func comb(n, r *big.Int) *big.Int { if r.Cmp(n) == 1 { return big.NewInt(0) } if r.Cmp(n) == 0 { return big.NewInt(1) } c := fact(n) den := fact(n.Sub(n, r)) den.Mul(den, fact(r)) c.Div(c, den) return c }
Generate an equivalent Go version of this Python code.
n=13 print(sorted(range(1,n+1), key=str))
package main import ( "fmt" "sort" "strconv" ) func lexOrder(n int) []int { first, last, k := 1, n, n if n < 1 { first, last, k = n, 1, 2-n } strs := make([]string, k) for i := first; i <= last; i++ { strs[i-first] = strconv.Itoa(i) } sort.Strings(strs) ints := make([]int, k) for i := 0; i < k; i++ { ints[i], _ = strconv.Atoi(strs[i]) } return ints } func main() { fmt.Println("In lexicographical order:\n") for _, n := range []int{0, 5, 13, 21, -22} { fmt.Printf("%3d: %v\n", n, lexOrder(n)) } }
Produce a language-to-language conversion: from Python to Go, same semantics.
TENS = [None, None, "twenty", "thirty", "forty", "fifty", "sixty", "seventy", "eighty", "ninety"] SMALL = ["zero", "one", "two", "three", "four", "five", "six", "seven", "eight", "nine", "ten", "eleven", "twelve", "thirteen", "fourteen", "fifteen", "sixteen", "seventeen", "eighteen", "nineteen"] HUGE = [None, None] + [h + "illion" for h in ("m", "b", "tr", "quadr", "quint", "sext", "sept", "oct", "non", "dec")] def nonzero(c, n, connect=''): return "" if n == 0 else connect + c + spell_integer(n) def last_and(num): if ',' in num: pre, last = num.rsplit(',', 1) if ' and ' not in last: last = ' and' + last num = ''.join([pre, ',', last]) return num def big(e, n): if e == 0: return spell_integer(n) elif e == 1: return spell_integer(n) + " thousand" else: return spell_integer(n) + " " + HUGE[e] def base1000_rev(n): while n != 0: n, r = divmod(n, 1000) yield r def spell_integer(n): if n < 0: return "minus " + spell_integer(-n) elif n < 20: return SMALL[n] elif n < 100: a, b = divmod(n, 10) return TENS[a] + nonzero("-", b) elif n < 1000: a, b = divmod(n, 100) return SMALL[a] + " hundred" + nonzero(" ", b, ' and') else: num = ", ".join([big(e, x) for e, x in enumerate(base1000_rev(n)) if x][::-1]) return last_and(num) if __name__ == '__main__': for n in (0, -3, 5, -7, 11, -13, 17, -19, 23, -29): print('%+4i -> %s' % (n, spell_integer(n))) print('') n = 201021002001 while n: print('%-12i -> %s' % (n, spell_integer(n))) n //= -10 print('%-12i -> %s' % (n, spell_integer(n))) print('')
package main import "fmt" func main() { for _, n := range []int64{12, 1048576, 9e18, -2, 0} { fmt.Println(say(n)) } } var small = [...]string{"zero", "one", "two", "three", "four", "five", "six", "seven", "eight", "nine", "ten", "eleven", "twelve", "thirteen", "fourteen", "fifteen", "sixteen", "seventeen", "eighteen", "nineteen"} var tens = [...]string{"", "", "twenty", "thirty", "forty", "fifty", "sixty", "seventy", "eighty", "ninety"} var illions = [...]string{"", " thousand", " million", " billion", " trillion", " quadrillion", " quintillion"} func say(n int64) string { var t string if n < 0 { t = "negative " n = -n } switch { case n < 20: t += small[n] case n < 100: t += tens[n/10] s := n % 10 if s > 0 { t += "-" + small[s] } case n < 1000: t += small[n/100] + " hundred" s := n % 100 if s > 0 { t += " " + say(s) } default: sx := "" for i := 0; n > 0; i++ { p := n % 1000 n /= 1000 if p > 0 { ix := say(p) + illions[i] if sx != "" { ix += " " + sx } sx = ix } } t += sx } return t }