Instruction stringlengths 45 106 | input_code stringlengths 1 13.7k | output_code stringlengths 1 13.7k |
|---|---|---|
Produce a functionally identical C++ code for the snippet given in VB. | Sub magicsquare()
Const n = 9
Dim i As Integer, j As Integer, v As Integer
Debug.Print "The square order is: " & n
For i = 1 To n
For j = 1 To n
Cells(i, j) = ((i * 2 - j + n - 1) Mod n) * n + ((i * 2 + j - 2) Mod n) + 1
Next j
Next i
Debug.Print "The magic number of"; n; "x"; n; "square is:"; n * (n * n + 1) \ 2
End Sub
| #include <iostream>
#include <sstream>
#include <iomanip>
#include <cassert>
#include <vector>
using namespace std;
class MagicSquare
{
public:
MagicSquare(int d) : sqr(d*d,0), sz(d)
{
assert(d&1);
fillSqr();
}
void display()
{
cout << "Odd Magic Square: " << sz << " x " << sz << "\n";
cout << "It's Magic Sum is: " << magicNumber() << "\n\n";
ostringstream cvr;
cvr << sz * sz;
int l = cvr.str().size();
for( int y = 0; y < sz; y++ )
{
int yy = y * sz;
for( int x = 0; x < sz; x++ )
cout << setw( l + 2 ) << sqr[yy + x];
cout << "\n";
}
cout << "\n\n";
}
private:
void fillSqr()
{
int sx = sz / 2, sy = 0, c = 0;
while( c < sz * sz )
{
if( !sqr[sx + sy * sz] )
{
sqr[sx + sy * sz]= c + 1;
inc( sx ); dec( sy );
c++;
}
else
{
dec( sx ); inc( sy ); inc( sy );
}
}
}
int magicNumber()
{ return sz * ( ( sz * sz ) + 1 ) / 2; }
void inc( int& a )
{ if( ++a == sz ) a = 0; }
void dec( int& a )
{ if( --a < 0 ) a = sz - 1; }
bool checkPos( int x, int y )
{ return( isInside( x ) && isInside( y ) && !sqr[sz * y + x] ); }
bool isInside( int s )
{ return ( s < sz && s > -1 ); }
vector<int> sqr;
int sz;
};
int main()
{
MagicSquare s(7);
s.display();
return 0;
}
|
Write the same code in C++ as shown below in VB. | Sub BenfordLaw()
Dim BenResult(1 To 9) As Long
BENref = "30,1%|17,6%|12,5%|9,7%|7,9%|6,7%|5,8%|5,1%|4,6%"
For Each c In Selection.Cells
If InStr(1, "-0123456789", Left(c, 1)) > 0 Then
For i = 1 To 9
If CInt(Left(Abs(c), 1)) = i Then BenResult(i) = BenResult(i) + 1: Exit For
Next
End If
Next
Total= Application.Sum(BenResult)
biggest= Len(CStr(BenResult(1)))
txt = "# | Values | Real | Expected " & vbCrLf
For i = 1 To 9
If BenResult(i) > 0 Then
txt = txt & "#" & i & " | " & vbTab
txt = txt & String((biggest - Len(CStr(BenResult(i)))) * 2, " ") & Format(BenResult(i), "0") & " | " & vbTab
txt = txt & String((Len(CStr(Format(BenResult(1) / Total, "##0.0%"))) - Len(CStr(Format(BenResult(i) / Total, "##0.0%")))) * 2, " ") & Format(BenResult(i) / Total, "##0.0%") & " | " & vbTab
txt = txt & Format(Split(BENref, "|")(i - 1), " ##0.0%") & vbCrLf
End If
Next
MsgBox txt, vbOKOnly, "Finish"
End Sub
}
|
#include <cln/integer.h>
#include <cln/integer_io.h>
#include <iostream>
#include <algorithm>
#include <vector>
#include <iomanip>
#include <sstream>
#include <string>
#include <cstdlib>
#include <cmath>
#include <map>
using namespace cln ;
class NextNum {
public :
NextNum ( cl_I & a , cl_I & b ) : first( a ) , second ( b ) { }
cl_I operator( )( ) {
cl_I result = first + second ;
first = second ;
second = result ;
return result ;
}
private :
cl_I first ;
cl_I second ;
} ;
void findFrequencies( const std::vector<cl_I> & fibos , std::map<int , int> &numberfrequencies ) {
for ( cl_I bignumber : fibos ) {
std::ostringstream os ;
fprintdecimal ( os , bignumber ) ;
int firstdigit = std::atoi( os.str( ).substr( 0 , 1 ).c_str( )) ;
auto result = numberfrequencies.insert( std::make_pair( firstdigit , 1 ) ) ;
if ( ! result.second )
numberfrequencies[ firstdigit ]++ ;
}
}
int main( ) {
std::vector<cl_I> fibonaccis( 1000 ) ;
fibonaccis[ 0 ] = 0 ;
fibonaccis[ 1 ] = 1 ;
cl_I a = 0 ;
cl_I b = 1 ;
std::generate_n( fibonaccis.begin( ) + 2 , 998 , NextNum( a , b ) ) ;
std::cout << std::endl ;
std::map<int , int> frequencies ;
findFrequencies( fibonaccis , frequencies ) ;
std::cout << " found expected\n" ;
for ( int i = 1 ; i < 10 ; i++ ) {
double found = static_cast<double>( frequencies[ i ] ) / 1000 ;
double expected = std::log10( 1 + 1 / static_cast<double>( i )) ;
std::cout << i << " :" << std::setw( 16 ) << std::right << found * 100 << " %" ;
std::cout.precision( 3 ) ;
std::cout << std::setw( 26 ) << std::right << expected * 100 << " %\n" ;
}
return 0 ;
}
|
Port the provided VB code into C++ while preserving the original functionality. | Sub BenfordLaw()
Dim BenResult(1 To 9) As Long
BENref = "30,1%|17,6%|12,5%|9,7%|7,9%|6,7%|5,8%|5,1%|4,6%"
For Each c In Selection.Cells
If InStr(1, "-0123456789", Left(c, 1)) > 0 Then
For i = 1 To 9
If CInt(Left(Abs(c), 1)) = i Then BenResult(i) = BenResult(i) + 1: Exit For
Next
End If
Next
Total= Application.Sum(BenResult)
biggest= Len(CStr(BenResult(1)))
txt = "# | Values | Real | Expected " & vbCrLf
For i = 1 To 9
If BenResult(i) > 0 Then
txt = txt & "#" & i & " | " & vbTab
txt = txt & String((biggest - Len(CStr(BenResult(i)))) * 2, " ") & Format(BenResult(i), "0") & " | " & vbTab
txt = txt & String((Len(CStr(Format(BenResult(1) / Total, "##0.0%"))) - Len(CStr(Format(BenResult(i) / Total, "##0.0%")))) * 2, " ") & Format(BenResult(i) / Total, "##0.0%") & " | " & vbTab
txt = txt & Format(Split(BENref, "|")(i - 1), " ##0.0%") & vbCrLf
End If
Next
MsgBox txt, vbOKOnly, "Finish"
End Sub
}
|
#include <cln/integer.h>
#include <cln/integer_io.h>
#include <iostream>
#include <algorithm>
#include <vector>
#include <iomanip>
#include <sstream>
#include <string>
#include <cstdlib>
#include <cmath>
#include <map>
using namespace cln ;
class NextNum {
public :
NextNum ( cl_I & a , cl_I & b ) : first( a ) , second ( b ) { }
cl_I operator( )( ) {
cl_I result = first + second ;
first = second ;
second = result ;
return result ;
}
private :
cl_I first ;
cl_I second ;
} ;
void findFrequencies( const std::vector<cl_I> & fibos , std::map<int , int> &numberfrequencies ) {
for ( cl_I bignumber : fibos ) {
std::ostringstream os ;
fprintdecimal ( os , bignumber ) ;
int firstdigit = std::atoi( os.str( ).substr( 0 , 1 ).c_str( )) ;
auto result = numberfrequencies.insert( std::make_pair( firstdigit , 1 ) ) ;
if ( ! result.second )
numberfrequencies[ firstdigit ]++ ;
}
}
int main( ) {
std::vector<cl_I> fibonaccis( 1000 ) ;
fibonaccis[ 0 ] = 0 ;
fibonaccis[ 1 ] = 1 ;
cl_I a = 0 ;
cl_I b = 1 ;
std::generate_n( fibonaccis.begin( ) + 2 , 998 , NextNum( a , b ) ) ;
std::cout << std::endl ;
std::map<int , int> frequencies ;
findFrequencies( fibonaccis , frequencies ) ;
std::cout << " found expected\n" ;
for ( int i = 1 ; i < 10 ; i++ ) {
double found = static_cast<double>( frequencies[ i ] ) / 1000 ;
double expected = std::log10( 1 + 1 / static_cast<double>( i )) ;
std::cout << i << " :" << std::setw( 16 ) << std::right << found * 100 << " %" ;
std::cout.precision( 3 ) ;
std::cout << std::setw( 26 ) << std::right << expected * 100 << " %\n" ;
}
return 0 ;
}
|
Transform the following VB implementation into C++, maintaining the same output and logic. | Sub Main()
Debug.Print F(-10)
Debug.Print F(10)
End Sub
Private Function F(N As Long) As Variant
If N < 0 Then
F = "Error. Negative argument"
ElseIf N <= 1 Then
F = N
Else
F = F(N - 1) + F(N - 2)
End If
End Function
| double fib(double n)
{
if(n < 0)
{
throw "Invalid argument passed to fib";
}
else
{
struct actual_fib
{
static double calc(double n)
{
if(n < 2)
{
return n;
}
else
{
return calc(n-1) + calc(n-2);
}
}
};
return actual_fib::calc(n);
}
}
|
Convert the following code from VB to C++, ensuring the logic remains intact. | string = "Small Basic"
TextWindow.WriteLine(Text.GetSubTextToEnd(string, 2))
TextWindow.WriteLine(Text.GetSubText(string, 1, Text.GetLength(string) - 1))
TextWindow.WriteLine(Text.GetSubText(string, 2, Text.GetLength(string) - 2))
| #include <string>
#include <iostream>
int main( ) {
std::string word( "Premier League" ) ;
std::cout << "Without first letter: " << word.substr( 1 ) << " !\n" ;
std::cout << "Without last letter: " << word.substr( 0 , word.length( ) - 1 ) << " !\n" ;
std::cout << "Without first and last letter: " << word.substr( 1 , word.length( ) - 2 ) << " !\n" ;
return 0 ;
}
|
Convert the following code from VB to C++, ensuring the logic remains intact. | string = "Small Basic"
TextWindow.WriteLine(Text.GetSubTextToEnd(string, 2))
TextWindow.WriteLine(Text.GetSubText(string, 1, Text.GetLength(string) - 1))
TextWindow.WriteLine(Text.GetSubText(string, 2, Text.GetLength(string) - 2))
| #include <string>
#include <iostream>
int main( ) {
std::string word( "Premier League" ) ;
std::cout << "Without first letter: " << word.substr( 1 ) << " !\n" ;
std::cout << "Without last letter: " << word.substr( 0 , word.length( ) - 1 ) << " !\n" ;
std::cout << "Without first and last letter: " << word.substr( 1 , word.length( ) - 2 ) << " !\n" ;
return 0 ;
}
|
Write a version of this VB function in C++ with identical behavior. | string = "Small Basic"
TextWindow.WriteLine(Text.GetSubTextToEnd(string, 2))
TextWindow.WriteLine(Text.GetSubText(string, 1, Text.GetLength(string) - 1))
TextWindow.WriteLine(Text.GetSubText(string, 2, Text.GetLength(string) - 2))
| #include <string>
#include <iostream>
int main( ) {
std::string word( "Premier League" ) ;
std::cout << "Without first letter: " << word.substr( 1 ) << " !\n" ;
std::cout << "Without last letter: " << word.substr( 0 , word.length( ) - 1 ) << " !\n" ;
std::cout << "Without first and last letter: " << word.substr( 1 , word.length( ) - 2 ) << " !\n" ;
return 0 ;
}
|
Keep all operations the same but rewrite the snippet in C++. |
Set objfso = CreateObject("Scripting.FileSystemObject")
Set objfile = objfso.OpenTextFile(objfso.GetParentFolderName(WScript.ScriptFullName) &_
"\input.txt",1)
list = ""
previous_line = ""
l = Len(previous_line)
Do Until objfile.AtEndOfStream
current_line = objfile.ReadLine
If Mid(current_line,l+1,1) <> "" Then
list = current_line & vbCrLf
previous_line = current_line
l = Len(previous_line)
ElseIf Mid(current_line,l,1) <> "" And Mid(current_line,(l+1),1) = "" Then
list = list & current_line & vbCrLf
End If
Loop
WScript.Echo list
objfile.Close
Set objfso = Nothing
| #include <iostream>
#include <string.h>
int main()
{
std::string longLine, longestLines, newLine;
while (std::cin >> newLine)
{
auto isNewLineShorter = longLine.c_str();
auto isLongLineShorter = newLine.c_str();
while (*isNewLineShorter && *isLongLineShorter)
{
isNewLineShorter = &isNewLineShorter[1];
isLongLineShorter = &isLongLineShorter[1];
}
if(*isNewLineShorter) continue;
if(*isLongLineShorter)
{
longLine = newLine;
longestLines = newLine;
}
else
{
longestLines+=newLine;
}
longestLines+="\n";
}
std::cout << "\nLongest string:\n" << longestLines;
}
|
Write the same code in C++ as shown below in VB. | Option Base 1
Public Enum sett
name_ = 1
initState
endState
blank
rules
End Enum
Public incrementer As Variant, threeStateBB As Variant, fiveStateBB As Variant
Private Sub init()
incrementer = Array("Simple incrementer", _
"q0", _
"qf", _
"B", _
Array( _
Array("q0", "1", "1", "right", "q0"), _
Array("q0", "B", "1", "stay", "qf")))
threeStateBB = Array("Three-state busy beaver", _
"a", _
"halt", _
"0", _
Array( _
Array("a", "0", "1", "right", "b"), _
Array("a", "1", "1", "left", "c"), _
Array("b", "0", "1", "left", "a"), _
Array("b", "1", "1", "right", "b"), _
Array("c", "0", "1", "left", "b"), _
Array("c", "1", "1", "stay", "halt")))
fiveStateBB = Array("Five-state busy beaver", _
"A", _
"H", _
"0", _
Array( _
Array("A", "0", "1", "right", "B"), _
Array("A", "1", "1", "left", "C"), _
Array("B", "0", "1", "right", "C"), _
Array("B", "1", "1", "right", "B"), _
Array("C", "0", "1", "right", "D"), _
Array("C", "1", "0", "left", "E"), _
Array("D", "0", "1", "left", "A"), _
Array("D", "1", "1", "left", "D"), _
Array("E", "0", "1", "stay", "H"), _
Array("E", "1", "0", "left", "A")))
End Sub
Private Sub show(state As String, headpos As Long, tape As Collection)
Debug.Print " "; state; String$(7 - Len(state), " "); "| ";
For p = 1 To tape.Count
Debug.Print IIf(p = headpos, "[" & tape(p) & "]", " " & tape(p) & " ");
Next p
Debug.Print
End Sub
Private Sub UTM(machine As Variant, tape As Collection, Optional countOnly As Long = 0)
Dim state As String: state = machine(initState)
Dim headpos As Long: headpos = 1
Dim counter As Long, rule As Variant
Debug.Print machine(name_); vbCrLf; String$(Len(machine(name_)), "=")
If Not countOnly Then Debug.Print " State | Tape [head]" & vbCrLf & "---------------------"
Do While True
If headpos > tape.Count Then
tape.Add machine(blank)
Else
If headpos < 1 Then
tape.Add machine(blank), Before:=1
headpos = 1
End If
End If
If Not countOnly Then show state, headpos, tape
For i = LBound(machine(rules)) To UBound(machine(rules))
rule = machine(rules)(i)
If rule(1) = state And rule(2) = tape(headpos) Then
tape.Remove headpos
If headpos > tape.Count Then
tape.Add rule(3)
Else
tape.Add rule(3), Before:=headpos
End If
If rule(4) = "left" Then headpos = headpos - 1
If rule(4) = "right" Then headpos = headpos + 1
state = rule(5)
Exit For
End If
Next i
counter = counter + 1
If counter Mod 100000 = 0 Then
Debug.Print counter
DoEvents
DoEvents
End If
If state = machine(endState) Then Exit Do
Loop
DoEvents
If countOnly Then
Debug.Print "Steps taken: ", counter
Else
show state, headpos, tape
Debug.Print
End If
End Sub
Public Sub main()
init
Dim tap As New Collection
tap.Add "1": tap.Add "1": tap.Add "1"
UTM incrementer, tap
Set tap = New Collection
UTM threeStateBB, tap
Set tap = New Collection
UTM fiveStateBB, tap, countOnly:=-1
End Sub
| #include <vector>
#include <string>
#include <iostream>
#include <algorithm>
#include <fstream>
#include <iomanip>
typedef unsigned int uint;
using namespace std;
const uint TAPE_MAX_LEN = 49152;
struct action { char write, direction; };
class tape
{
public:
tape( uint startPos = TAPE_MAX_LEN >> 1 ) : MAX_LEN( TAPE_MAX_LEN ) { _sp = startPos; reset(); }
void reset() { clear( '0' ); headPos = _sp; }
char read(){ return _t[headPos]; }
void input( string a ){ if( a == "" ) return; for( uint s = 0; s < a.length(); s++ ) _t[headPos + s] = a[s]; }
void clear( char c ) { _t.clear(); blk = c; _t.resize( MAX_LEN, blk ); }
void action( const action* a ) { write( a->write ); move( a->direction ); }
void print( int c = 10 )
{
int ml = static_cast<int>( MAX_LEN ), st = static_cast<int>( headPos ) - c, ed = static_cast<int>( headPos ) + c + 1, tx;
for( int x = st; x < ed; x++ )
{ tx = x; if( tx < 0 ) tx += ml; if( tx >= ml ) tx -= ml; cout << _t[tx]; }
cout << endl << setw( c + 1 ) << "^" << endl;
}
private:
void move( char d ) { if( d == 'N' ) return; headPos += d == 'R' ? 1 : -1; if( headPos >= MAX_LEN ) headPos = d == 'R' ? 0 : MAX_LEN - 1; }
void write( char a ) { if( a != 'N' ) { if( a == 'B' ) _t[headPos] = blk; else _t[headPos] = a; } }
string _t; uint headPos, _sp; char blk; const uint MAX_LEN;
};
class state
{
public:
bool operator ==( const string o ) { return o == name; }
string name, next; char symbol, write, direction;
};
class actionTable
{
public:
bool loadTable( string file )
{
reset();
ifstream mf; mf.open( file.c_str() ); if( mf.is_open() )
{
string str; state stt;
while( mf.good() )
{
getline( mf, str ); if( str[0] == '\'' ) break;
parseState( str, stt ); states.push_back( stt );
}
while( mf.good() )
{
getline( mf, str ); if( str == "" ) continue;
if( str[0] == '!' ) blank = str.erase( 0, 1 )[0];
if( str[0] == '^' ) curState = str.erase( 0, 1 );
if( str[0] == '>' ) input = str.erase( 0, 1 );
}
mf.close(); return true;
}
cout << "Could not open " << file << endl; return false;
}
bool action( char symbol, action& a )
{
vector<state>::iterator f = states.begin();
while( true )
{
f = find( f, states.end(), curState );
if( f == states.end() ) return false;
if( ( *f ).symbol == '*' || ( *f ).symbol == symbol || ( ( *f ).symbol == 'B' && blank == symbol ) )
{ a.direction = ( *f ).direction; a.write = ( *f ).write; curState = ( *f ).next; break; }
f++;
}
return true;
}
void reset() { states.clear(); blank = '0'; curState = input = ""; }
string getInput() { return input; }
char getBlank() { return blank; }
private:
void parseState( string str, state& stt )
{
string a[5]; int idx = 0;
for( string::iterator si = str.begin(); si != str.end(); si++ )
{ if( ( *si ) == ';' ) idx++; else a[idx].append( &( *si ), 1 ); }
stt.name = a[0]; stt.symbol = a[1][0]; stt.write = a[2][0]; stt.direction = a[3][0]; stt.next = a[4];
}
vector<state> states; char blank; string curState, input;
};
class utm
{
public:
utm() { files[0] = "incrementer.utm"; files[1] = "busy_beaver.utm"; files[2] = "sort.utm"; }
void start()
{
while( true )
{
reset(); int t = showMenu(); if( t == 0 ) return;
if( !at.loadTable( files[t - 1] ) ) return; startMachine();
}
}
private:
void simulate()
{
char r; action a;
while( true ) { tp.print(); r = tp.read(); if( !( at.action( r, a ) ) ) break; tp.action( &a ); }
cout << endl << endl; system( "pause" );
}
int showMenu()
{
int t = -1;
while( t < 0 || t > 3 )
{
system( "cls" ); cout << "1. Incrementer\n2. Busy beaver\n3. Sort\n\n0. Quit";
cout << endl << endl << "Choose an action "; cin >> t;
}
return t;
}
void reset() { tp.reset(); at.reset(); }
void startMachine() { system( "cls" ); tp.clear( at.getBlank() ); tp.input( at.getInput() ); simulate(); }
tape tp; actionTable at; string files[7];
};
int main( int a, char* args[] ){ utm mm; mm.start(); return 0; }
|
Port the provided VB code into C++ while preserving the original functionality. | Option Base 1
Public Enum sett
name_ = 1
initState
endState
blank
rules
End Enum
Public incrementer As Variant, threeStateBB As Variant, fiveStateBB As Variant
Private Sub init()
incrementer = Array("Simple incrementer", _
"q0", _
"qf", _
"B", _
Array( _
Array("q0", "1", "1", "right", "q0"), _
Array("q0", "B", "1", "stay", "qf")))
threeStateBB = Array("Three-state busy beaver", _
"a", _
"halt", _
"0", _
Array( _
Array("a", "0", "1", "right", "b"), _
Array("a", "1", "1", "left", "c"), _
Array("b", "0", "1", "left", "a"), _
Array("b", "1", "1", "right", "b"), _
Array("c", "0", "1", "left", "b"), _
Array("c", "1", "1", "stay", "halt")))
fiveStateBB = Array("Five-state busy beaver", _
"A", _
"H", _
"0", _
Array( _
Array("A", "0", "1", "right", "B"), _
Array("A", "1", "1", "left", "C"), _
Array("B", "0", "1", "right", "C"), _
Array("B", "1", "1", "right", "B"), _
Array("C", "0", "1", "right", "D"), _
Array("C", "1", "0", "left", "E"), _
Array("D", "0", "1", "left", "A"), _
Array("D", "1", "1", "left", "D"), _
Array("E", "0", "1", "stay", "H"), _
Array("E", "1", "0", "left", "A")))
End Sub
Private Sub show(state As String, headpos As Long, tape As Collection)
Debug.Print " "; state; String$(7 - Len(state), " "); "| ";
For p = 1 To tape.Count
Debug.Print IIf(p = headpos, "[" & tape(p) & "]", " " & tape(p) & " ");
Next p
Debug.Print
End Sub
Private Sub UTM(machine As Variant, tape As Collection, Optional countOnly As Long = 0)
Dim state As String: state = machine(initState)
Dim headpos As Long: headpos = 1
Dim counter As Long, rule As Variant
Debug.Print machine(name_); vbCrLf; String$(Len(machine(name_)), "=")
If Not countOnly Then Debug.Print " State | Tape [head]" & vbCrLf & "---------------------"
Do While True
If headpos > tape.Count Then
tape.Add machine(blank)
Else
If headpos < 1 Then
tape.Add machine(blank), Before:=1
headpos = 1
End If
End If
If Not countOnly Then show state, headpos, tape
For i = LBound(machine(rules)) To UBound(machine(rules))
rule = machine(rules)(i)
If rule(1) = state And rule(2) = tape(headpos) Then
tape.Remove headpos
If headpos > tape.Count Then
tape.Add rule(3)
Else
tape.Add rule(3), Before:=headpos
End If
If rule(4) = "left" Then headpos = headpos - 1
If rule(4) = "right" Then headpos = headpos + 1
state = rule(5)
Exit For
End If
Next i
counter = counter + 1
If counter Mod 100000 = 0 Then
Debug.Print counter
DoEvents
DoEvents
End If
If state = machine(endState) Then Exit Do
Loop
DoEvents
If countOnly Then
Debug.Print "Steps taken: ", counter
Else
show state, headpos, tape
Debug.Print
End If
End Sub
Public Sub main()
init
Dim tap As New Collection
tap.Add "1": tap.Add "1": tap.Add "1"
UTM incrementer, tap
Set tap = New Collection
UTM threeStateBB, tap
Set tap = New Collection
UTM fiveStateBB, tap, countOnly:=-1
End Sub
| #include <vector>
#include <string>
#include <iostream>
#include <algorithm>
#include <fstream>
#include <iomanip>
typedef unsigned int uint;
using namespace std;
const uint TAPE_MAX_LEN = 49152;
struct action { char write, direction; };
class tape
{
public:
tape( uint startPos = TAPE_MAX_LEN >> 1 ) : MAX_LEN( TAPE_MAX_LEN ) { _sp = startPos; reset(); }
void reset() { clear( '0' ); headPos = _sp; }
char read(){ return _t[headPos]; }
void input( string a ){ if( a == "" ) return; for( uint s = 0; s < a.length(); s++ ) _t[headPos + s] = a[s]; }
void clear( char c ) { _t.clear(); blk = c; _t.resize( MAX_LEN, blk ); }
void action( const action* a ) { write( a->write ); move( a->direction ); }
void print( int c = 10 )
{
int ml = static_cast<int>( MAX_LEN ), st = static_cast<int>( headPos ) - c, ed = static_cast<int>( headPos ) + c + 1, tx;
for( int x = st; x < ed; x++ )
{ tx = x; if( tx < 0 ) tx += ml; if( tx >= ml ) tx -= ml; cout << _t[tx]; }
cout << endl << setw( c + 1 ) << "^" << endl;
}
private:
void move( char d ) { if( d == 'N' ) return; headPos += d == 'R' ? 1 : -1; if( headPos >= MAX_LEN ) headPos = d == 'R' ? 0 : MAX_LEN - 1; }
void write( char a ) { if( a != 'N' ) { if( a == 'B' ) _t[headPos] = blk; else _t[headPos] = a; } }
string _t; uint headPos, _sp; char blk; const uint MAX_LEN;
};
class state
{
public:
bool operator ==( const string o ) { return o == name; }
string name, next; char symbol, write, direction;
};
class actionTable
{
public:
bool loadTable( string file )
{
reset();
ifstream mf; mf.open( file.c_str() ); if( mf.is_open() )
{
string str; state stt;
while( mf.good() )
{
getline( mf, str ); if( str[0] == '\'' ) break;
parseState( str, stt ); states.push_back( stt );
}
while( mf.good() )
{
getline( mf, str ); if( str == "" ) continue;
if( str[0] == '!' ) blank = str.erase( 0, 1 )[0];
if( str[0] == '^' ) curState = str.erase( 0, 1 );
if( str[0] == '>' ) input = str.erase( 0, 1 );
}
mf.close(); return true;
}
cout << "Could not open " << file << endl; return false;
}
bool action( char symbol, action& a )
{
vector<state>::iterator f = states.begin();
while( true )
{
f = find( f, states.end(), curState );
if( f == states.end() ) return false;
if( ( *f ).symbol == '*' || ( *f ).symbol == symbol || ( ( *f ).symbol == 'B' && blank == symbol ) )
{ a.direction = ( *f ).direction; a.write = ( *f ).write; curState = ( *f ).next; break; }
f++;
}
return true;
}
void reset() { states.clear(); blank = '0'; curState = input = ""; }
string getInput() { return input; }
char getBlank() { return blank; }
private:
void parseState( string str, state& stt )
{
string a[5]; int idx = 0;
for( string::iterator si = str.begin(); si != str.end(); si++ )
{ if( ( *si ) == ';' ) idx++; else a[idx].append( &( *si ), 1 ); }
stt.name = a[0]; stt.symbol = a[1][0]; stt.write = a[2][0]; stt.direction = a[3][0]; stt.next = a[4];
}
vector<state> states; char blank; string curState, input;
};
class utm
{
public:
utm() { files[0] = "incrementer.utm"; files[1] = "busy_beaver.utm"; files[2] = "sort.utm"; }
void start()
{
while( true )
{
reset(); int t = showMenu(); if( t == 0 ) return;
if( !at.loadTable( files[t - 1] ) ) return; startMachine();
}
}
private:
void simulate()
{
char r; action a;
while( true ) { tp.print(); r = tp.read(); if( !( at.action( r, a ) ) ) break; tp.action( &a ); }
cout << endl << endl; system( "pause" );
}
int showMenu()
{
int t = -1;
while( t < 0 || t > 3 )
{
system( "cls" ); cout << "1. Incrementer\n2. Busy beaver\n3. Sort\n\n0. Quit";
cout << endl << endl << "Choose an action "; cin >> t;
}
return t;
}
void reset() { tp.reset(); at.reset(); }
void startMachine() { system( "cls" ); tp.clear( at.getBlank() ); tp.input( at.getInput() ); simulate(); }
tape tp; actionTable at; string files[7];
};
int main( int a, char* args[] ){ utm mm; mm.start(); return 0; }
|
Translate the given VB code snippet into C++ without altering its behavior. | Public Sub create_file()
Dim FileNumber As Integer
FileNumber = FreeFile
MkDir "docs"
Open "docs\output.txt" For Output As #FreeFile
Close #FreeFile
MkDir "C:\docs"
Open "C:\docs\output.txt" For Output As #FreeFile
Close #FreeFile
End Sub
| #include <direct.h>
#include <fstream>
int main() {
std::fstream f("output.txt", std::ios::out);
f.close();
f.open("/output.txt", std::ios::out);
f.close();
_mkdir("docs");
_mkdir("/docs");
return 0;
}
|
Keep all operations the same but rewrite the snippet in C++. | b=_
"CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATG" &_
"CTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTG" &_
"AGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGAT" &_
"GGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT" &_
"CGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGG" &_
"TCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA" &_
"TTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTAT" &_
"CGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTG" &_
"TCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGAC" &_
"GACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT"
s="SEQUENCE:"
acnt=0:ccnt=0:gcnt=0:tcnt=0
for i=0 to len(b)-1
if (i mod 30)=0 then s = s & vbcrlf & right(" "& i+1,3)&": "
if (i mod 5)=0 then s=s& " "
m=mid(b,i+1,1)
s=s & m
select case m
case "A":acnt=acnt+1
case "C":ccnt=ccnt+1
case "G":gcnt=gcnt+1
case "T":tcnt=tcnt+1
case else
wscript.echo "error at ",i+1, m
end select
next
wscript.echo s & vbcrlf
wscript.echo "Count: A="&acnt & " C=" & ccnt & " G=" & gcnt & " T=" & tcnt
| #include <map>
#include <string>
#include <iostream>
#include <iomanip>
const std::string DEFAULT_DNA = "CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATG"
"CTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTG"
"AGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGAT"
"GGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT"
"CGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGG"
"TCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA"
"TTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTAT"
"CGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTG"
"TCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGAC"
"GACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT";
class DnaBase {
public:
DnaBase(const std::string& dna = DEFAULT_DNA, int width = 50) : genome(dna), displayWidth(width) {
for (auto elm : dna) {
if (count.find(elm) == count.end())
count[elm] = 0;
++count[elm];
}
}
void viewGenome() {
std::cout << "Sequence:" << std::endl;
std::cout << std::endl;
int limit = genome.size() / displayWidth;
if (genome.size() % displayWidth != 0)
++limit;
for (int i = 0; i < limit; ++i) {
int beginPos = i * displayWidth;
std::cout << std::setw(4) << beginPos << " :" << std::setw(4) << genome.substr(beginPos, displayWidth) << std::endl;
}
std::cout << std::endl;
std::cout << "Base Count" << std::endl;
std::cout << "----------" << std::endl;
std::cout << std::endl;
int total = 0;
for (auto elm : count) {
std::cout << std::setw(4) << elm.first << " : " << elm.second << std::endl;
total += elm.second;
}
std::cout << std::endl;
std::cout << "Total: " << total << std::endl;
}
private:
std::string genome;
std::map<char, int> count;
int displayWidth;
};
int main(void) {
auto d = new DnaBase();
d->viewGenome();
delete d;
return 0;
}
|
Change the following VB code into C++ without altering its purpose. | b=_
"CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATG" &_
"CTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTG" &_
"AGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGAT" &_
"GGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT" &_
"CGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGG" &_
"TCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA" &_
"TTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTAT" &_
"CGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTG" &_
"TCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGAC" &_
"GACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT"
s="SEQUENCE:"
acnt=0:ccnt=0:gcnt=0:tcnt=0
for i=0 to len(b)-1
if (i mod 30)=0 then s = s & vbcrlf & right(" "& i+1,3)&": "
if (i mod 5)=0 then s=s& " "
m=mid(b,i+1,1)
s=s & m
select case m
case "A":acnt=acnt+1
case "C":ccnt=ccnt+1
case "G":gcnt=gcnt+1
case "T":tcnt=tcnt+1
case else
wscript.echo "error at ",i+1, m
end select
next
wscript.echo s & vbcrlf
wscript.echo "Count: A="&acnt & " C=" & ccnt & " G=" & gcnt & " T=" & tcnt
| #include <map>
#include <string>
#include <iostream>
#include <iomanip>
const std::string DEFAULT_DNA = "CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATG"
"CTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTG"
"AGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGAT"
"GGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT"
"CGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGG"
"TCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA"
"TTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTAT"
"CGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTG"
"TCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGAC"
"GACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT";
class DnaBase {
public:
DnaBase(const std::string& dna = DEFAULT_DNA, int width = 50) : genome(dna), displayWidth(width) {
for (auto elm : dna) {
if (count.find(elm) == count.end())
count[elm] = 0;
++count[elm];
}
}
void viewGenome() {
std::cout << "Sequence:" << std::endl;
std::cout << std::endl;
int limit = genome.size() / displayWidth;
if (genome.size() % displayWidth != 0)
++limit;
for (int i = 0; i < limit; ++i) {
int beginPos = i * displayWidth;
std::cout << std::setw(4) << beginPos << " :" << std::setw(4) << genome.substr(beginPos, displayWidth) << std::endl;
}
std::cout << std::endl;
std::cout << "Base Count" << std::endl;
std::cout << "----------" << std::endl;
std::cout << std::endl;
int total = 0;
for (auto elm : count) {
std::cout << std::setw(4) << elm.first << " : " << elm.second << std::endl;
total += elm.second;
}
std::cout << std::endl;
std::cout << "Total: " << total << std::endl;
}
private:
std::string genome;
std::map<char, int> count;
int displayWidth;
};
int main(void) {
auto d = new DnaBase();
d->viewGenome();
delete d;
return 0;
}
|
Produce a functionally identical C++ code for the snippet given in VB. |
Public Const HOLDON = False
Public Const DIJKSTRASOLUTION = True
Public Const X = 10
Public Const GETS = 0
Public Const PUTS = 1
Public Const EATS = 2
Public Const THKS = 5
Public Const FRSTFORK = 0
Public Const SCNDFORK = 1
Public Const SPAGHETI = 0
Public Const UNIVERSE = 1
Public Const MAXCOUNT = 100000
Public Const PHILOSOPHERS = 5
Public semaphore(PHILOSOPHERS - 1) As Integer
Public positi0n(1, PHILOSOPHERS - 1) As Integer
Public programcounter(PHILOSOPHERS - 1) As Long
Public statistics(PHILOSOPHERS - 1, 5, 1) As Long
Public names As Variant
Private Sub init()
names = [{"Aquinas","Babbage","Carroll","Derrida","Erasmus"}]
For j = 0 To PHILOSOPHERS - 2
positi0n(0, j) = j + 1
positi0n(1, j) = j
Next j
If DIJKSTRASOLUTION Then
positi0n(0, PHILOSOPHERS - 1) = j
positi0n(1, PHILOSOPHERS - 1) = 0
Else
positi0n(0, PHILOSOPHERS - 1) = 0
positi0n(1, PHILOSOPHERS - 1) = j
End If
End Sub
Private Sub philosopher(subject As Integer, verb As Integer, objekt As Integer)
statistics(subject, verb, objekt) = statistics(subject, verb, objekt) + 1
If verb < 2 Then
If semaphore(positi0n(objekt, subject)) <> verb Then
If Not HOLDON Then
semaphore(positi0n(FRSTFORK, subject)) = 1 - objekt
programcounter(subject) = 0
End If
Else
semaphore(positi0n(objekt, subject)) = 1 - verb
programcounter(subject) = (programcounter(subject) + 1) Mod 6
End If
Else
programcounter(subject) = IIf(X * Rnd > 1, verb, verb + 1) Mod 6
End If
End Sub
Private Sub dine()
Dim ph As Integer
Do While TC < MAXCOUNT
For ph = 0 To PHILOSOPHERS - 1
Select Case programcounter(ph)
Case 0: philosopher ph, GETS, FRSTFORK
Case 1: philosopher ph, GETS, SCNDFORK
Case 2: philosopher ph, EATS, SPAGHETI
Case 3: philosopher ph, PUTS, FRSTFORK
Case 4: philosopher ph, PUTS, SCNDFORK
Case 5: philosopher ph, THKS, UNIVERSE
End Select
TC = TC + 1
Next ph
Loop
End Sub
Private Sub show()
Debug.Print "Stats", "Gets", "Gets", "Eats", "Puts", "Puts", "Thinks"
Debug.Print "", "First", "Second", "Spag-", "First", "Second", "About"
Debug.Print "", "Fork", "Fork", "hetti", "Fork", "Fork", "Universe"
For subject = 0 To PHILOSOPHERS - 1
Debug.Print names(subject + 1),
For objekt = 0 To 1
Debug.Print statistics(subject, GETS, objekt),
Next objekt
Debug.Print statistics(subject, EATS, SPAGHETI),
For objekt = 0 To 1
Debug.Print statistics(subject, PUTS, objekt),
Next objekt
Debug.Print statistics(subject, THKS, UNIVERSE)
Next subject
End Sub
Public Sub main()
init
dine
show
End Sub
| #include <algorithm>
#include <array>
#include <chrono>
#include <iostream>
#include <mutex>
#include <random>
#include <string>
#include <string_view>
#include <thread>
const int timeScale = 42;
void Message(std::string_view message)
{
static std::mutex cout_mutex;
std::scoped_lock cout_lock(cout_mutex);
std::cout << message << std::endl;
}
struct Fork {
std::mutex mutex;
};
struct Dinner {
std::array<Fork, 5> forks;
~Dinner() { Message("Dinner is over"); }
};
class Philosopher
{
std::mt19937 rng{std::random_device {}()};
const std::string name;
Fork& left;
Fork& right;
std::thread worker;
void live();
void dine();
void ponder();
public:
Philosopher(std::string name_, Fork& l, Fork& r)
: name(std::move(name_)), left(l), right(r), worker(&Philosopher::live, this)
{}
~Philosopher()
{
worker.join();
Message(name + " went to sleep.");
}
};
void Philosopher::live()
{
for(;;)
{
{
std::scoped_lock dine_lock(left.mutex, right.mutex);
dine();
}
ponder();
}
}
void Philosopher::dine()
{
Message(name + " started eating.");
thread_local std::array<const char*, 3> foods {"chicken", "rice", "soda"};
thread_local std::array<const char*, 3> reactions {
"I like this %s!", "This %s is good.", "Mmm, %s..."
};
thread_local std::uniform_int_distribution<> dist(1, 6);
std::shuffle( foods.begin(), foods.end(), rng);
std::shuffle(reactions.begin(), reactions.end(), rng);
constexpr size_t buf_size = 64;
char buffer[buf_size];
for(int i = 0; i < 3; ++i) {
std::this_thread::sleep_for(std::chrono::milliseconds(dist(rng) * timeScale));
snprintf(buffer, buf_size, reactions[i], foods[i]);
Message(name + ": " + buffer);
}
std::this_thread::sleep_for(std::chrono::milliseconds(dist(rng)) * timeScale);
Message(name + " finished and left.");
}
void Philosopher::ponder()
{
static constexpr std::array<const char*, 5> topics {{
"politics", "art", "meaning of life", "source of morality", "how many straws makes a bale"
}};
thread_local std::uniform_int_distribution<> wait(1, 6);
thread_local std::uniform_int_distribution<> dist(0, topics.size() - 1);
while(dist(rng) > 0) {
std::this_thread::sleep_for(std::chrono::milliseconds(wait(rng) * 3 * timeScale));
Message(name + " is pondering about " + topics[dist(rng)] + ".");
}
std::this_thread::sleep_for(std::chrono::milliseconds(wait(rng) * 3 * timeScale));
Message(name + " is hungry again!");
}
int main()
{
Dinner dinner;
Message("Dinner started!");
std::array<Philosopher, 5> philosophers {{
{"Aristotle", dinner.forks[0], dinner.forks[1]},
{"Democritus", dinner.forks[1], dinner.forks[2]},
{"Plato", dinner.forks[2], dinner.forks[3]},
{"Pythagoras", dinner.forks[3], dinner.forks[4]},
{"Socrates", dinner.forks[4], dinner.forks[0]},
}};
Message("It is dark outside...");
}
|
Port the provided VB code into C++ while preserving the original functionality. |
Dim fact()
nn1=9 : nn2=12
lim=1499999
ReDim fact(nn2)
fact(0)=1
For i=1 To nn2
fact(i)=fact(i-1)*i
Next
For base=nn1 To nn2
list=""
For i=1 To lim
s=0
t=i
Do While t<>0
d=t Mod base
s=s+fact(d)
t=t\base
Loop
If s=i Then list=list &" "& i
Next
Wscript.Echo "the factorions for base "& right(" "& base,2) &" are: "& list
Next
| #include <iostream>
class factorion_t {
public:
factorion_t() {
f[0] = 1u;
for (uint n = 1u; n < 12u; n++)
f[n] = f[n - 1] * n;
}
bool operator()(uint i, uint b) const {
uint sum = 0;
for (uint j = i; j > 0u; j /= b)
sum += f[j % b];
return sum == i;
}
private:
ulong f[12];
};
int main() {
factorion_t factorion;
for (uint b = 9u; b <= 12u; ++b) {
std::cout << "factorions for base " << b << ':';
for (uint i = 1u; i < 1500000u; ++i)
if (factorion(i, b))
std::cout << ' ' << i;
std::cout << std::endl;
}
return 0;
}
|
Produce a language-to-language conversion: from VB to C++, same semantics. |
Dim fact()
nn1=9 : nn2=12
lim=1499999
ReDim fact(nn2)
fact(0)=1
For i=1 To nn2
fact(i)=fact(i-1)*i
Next
For base=nn1 To nn2
list=""
For i=1 To lim
s=0
t=i
Do While t<>0
d=t Mod base
s=s+fact(d)
t=t\base
Loop
If s=i Then list=list &" "& i
Next
Wscript.Echo "the factorions for base "& right(" "& base,2) &" are: "& list
Next
| #include <iostream>
class factorion_t {
public:
factorion_t() {
f[0] = 1u;
for (uint n = 1u; n < 12u; n++)
f[n] = f[n - 1] * n;
}
bool operator()(uint i, uint b) const {
uint sum = 0;
for (uint j = i; j > 0u; j /= b)
sum += f[j % b];
return sum == i;
}
private:
ulong f[12];
};
int main() {
factorion_t factorion;
for (uint b = 9u; b <= 12u; ++b) {
std::cout << "factorions for base " << b << ':';
for (uint i = 1u; i < 1500000u; ++i)
if (factorion(i, b))
std::cout << ' ' << i;
std::cout << std::endl;
}
return 0;
}
|
Preserve the algorithm and functionality while converting the code from VB to C++. | Private Function ValidateUserWords(userstring As String) As String
Dim s As String
Dim user_words() As String
Dim command_table As Scripting.Dictionary
Set command_table = New Scripting.Dictionary
Dim abbreviations As Scripting.Dictionary
Set abbreviations = New Scripting.Dictionary
abbreviations.CompareMode = TextCompare
Dim commandtable() As String
Dim commands As String
s = s & "Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy "
s = s & "COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find "
s = s & "NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput "
s = s & "Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO "
s = s & "MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT "
s = s & "READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT "
s = s & "RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up "
commandtable = Split(s, " ")
Dim i As Integer
For Each word In commandtable
If Len(word) > 0 Then
i = 1
Do While Mid(word, i, 1) >= "A" And Mid(word, i, 1) <= "Z"
i = i + 1
Loop
command_table.Add Key:=word, Item:=i - 1
End If
Next word
For Each word In command_table
For i = command_table(word) To Len(word)
On Error Resume Next
abbreviations.Add Key:=Left(word, i), Item:=UCase(word)
Next i
Next word
user_words() = Split(userstring, " ")
For Each word In user_words
If Len(word) > 0 Then
If abbreviations.exists(word) Then
commands = commands & abbreviations(word) & " "
Else
commands = commands & "*error* "
End If
End If
Next word
ValidateUserWords = commands
End Function
Public Sub program()
Dim guserstring As String
guserstring = "riG rePEAT copies put mo rest types fup. 6 poweRin"
Debug.Print "user words:", guserstring
Debug.Print "full words:", ValidateUserWords(guserstring)
End Sub
| #include <algorithm>
#include <cctype>
#include <iostream>
#include <sstream>
#include <string>
#include <vector>
const char* command_table =
"Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy "
"COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find "
"NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput "
"Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO "
"MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT "
"READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT "
"RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up";
class command {
public:
command(const std::string&, size_t);
const std::string& cmd() const { return cmd_; }
size_t min_length() const { return min_len_; }
bool match(const std::string&) const;
private:
std::string cmd_;
size_t min_len_;
};
command::command(const std::string& cmd, size_t min_len)
: cmd_(cmd), min_len_(min_len) {}
bool command::match(const std::string& str) const {
size_t olen = str.length();
return olen >= min_len_ && olen <= cmd_.length()
&& cmd_.compare(0, olen, str) == 0;
}
void uppercase(std::string& str) {
std::transform(str.begin(), str.end(), str.begin(),
[](unsigned char c) -> unsigned char { return std::toupper(c); });
}
size_t get_min_length(const std::string& str) {
size_t len = 0, n = str.length();
while (len < n && std::isupper(static_cast<unsigned char>(str[len])))
++len;
return len;
}
class command_list {
public:
explicit command_list(const char*);
const command* find_command(const std::string&) const;
private:
std::vector<command> commands_;
};
command_list::command_list(const char* table) {
std::vector<command> commands;
std::istringstream is(table);
std::string word;
while (is >> word) {
size_t len = get_min_length(word);
uppercase(word);
commands_.push_back(command(word, len));
}
}
const command* command_list::find_command(const std::string& word) const {
auto iter = std::find_if(commands_.begin(), commands_.end(),
[&word](const command& cmd) { return cmd.match(word); });
return (iter != commands_.end()) ? &*iter : nullptr;
}
std::string test(const command_list& commands, const std::string& input) {
std::string output;
std::istringstream is(input);
std::string word;
while (is >> word) {
if (!output.empty())
output += ' ';
uppercase(word);
const command* cmd_ptr = commands.find_command(word);
if (cmd_ptr)
output += cmd_ptr->cmd();
else
output += "*error*";
}
return output;
}
int main() {
command_list commands(command_table);
std::string input("riG rePEAT copies put mo rest types fup. 6 poweRin");
std::string output(test(commands, input));
std::cout << " input: " << input << '\n';
std::cout << "output: " << output << '\n';
return 0;
}
|
Generate an equivalent C++ version of this VB code. | Private Function ValidateUserWords(userstring As String) As String
Dim s As String
Dim user_words() As String
Dim command_table As Scripting.Dictionary
Set command_table = New Scripting.Dictionary
Dim abbreviations As Scripting.Dictionary
Set abbreviations = New Scripting.Dictionary
abbreviations.CompareMode = TextCompare
Dim commandtable() As String
Dim commands As String
s = s & "Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy "
s = s & "COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find "
s = s & "NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput "
s = s & "Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO "
s = s & "MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT "
s = s & "READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT "
s = s & "RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up "
commandtable = Split(s, " ")
Dim i As Integer
For Each word In commandtable
If Len(word) > 0 Then
i = 1
Do While Mid(word, i, 1) >= "A" And Mid(word, i, 1) <= "Z"
i = i + 1
Loop
command_table.Add Key:=word, Item:=i - 1
End If
Next word
For Each word In command_table
For i = command_table(word) To Len(word)
On Error Resume Next
abbreviations.Add Key:=Left(word, i), Item:=UCase(word)
Next i
Next word
user_words() = Split(userstring, " ")
For Each word In user_words
If Len(word) > 0 Then
If abbreviations.exists(word) Then
commands = commands & abbreviations(word) & " "
Else
commands = commands & "*error* "
End If
End If
Next word
ValidateUserWords = commands
End Function
Public Sub program()
Dim guserstring As String
guserstring = "riG rePEAT copies put mo rest types fup. 6 poweRin"
Debug.Print "user words:", guserstring
Debug.Print "full words:", ValidateUserWords(guserstring)
End Sub
| #include <algorithm>
#include <cctype>
#include <iostream>
#include <sstream>
#include <string>
#include <vector>
const char* command_table =
"Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy "
"COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find "
"NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput "
"Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO "
"MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT "
"READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT "
"RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up";
class command {
public:
command(const std::string&, size_t);
const std::string& cmd() const { return cmd_; }
size_t min_length() const { return min_len_; }
bool match(const std::string&) const;
private:
std::string cmd_;
size_t min_len_;
};
command::command(const std::string& cmd, size_t min_len)
: cmd_(cmd), min_len_(min_len) {}
bool command::match(const std::string& str) const {
size_t olen = str.length();
return olen >= min_len_ && olen <= cmd_.length()
&& cmd_.compare(0, olen, str) == 0;
}
void uppercase(std::string& str) {
std::transform(str.begin(), str.end(), str.begin(),
[](unsigned char c) -> unsigned char { return std::toupper(c); });
}
size_t get_min_length(const std::string& str) {
size_t len = 0, n = str.length();
while (len < n && std::isupper(static_cast<unsigned char>(str[len])))
++len;
return len;
}
class command_list {
public:
explicit command_list(const char*);
const command* find_command(const std::string&) const;
private:
std::vector<command> commands_;
};
command_list::command_list(const char* table) {
std::vector<command> commands;
std::istringstream is(table);
std::string word;
while (is >> word) {
size_t len = get_min_length(word);
uppercase(word);
commands_.push_back(command(word, len));
}
}
const command* command_list::find_command(const std::string& word) const {
auto iter = std::find_if(commands_.begin(), commands_.end(),
[&word](const command& cmd) { return cmd.match(word); });
return (iter != commands_.end()) ? &*iter : nullptr;
}
std::string test(const command_list& commands, const std::string& input) {
std::string output;
std::istringstream is(input);
std::string word;
while (is >> word) {
if (!output.empty())
output += ' ';
uppercase(word);
const command* cmd_ptr = commands.find_command(word);
if (cmd_ptr)
output += cmd_ptr->cmd();
else
output += "*error*";
}
return output;
}
int main() {
command_list commands(command_table);
std::string input("riG rePEAT copies put mo rest types fup. 6 poweRin");
std::string output(test(commands, input));
std::cout << " input: " << input << '\n';
std::cout << "output: " << output << '\n';
return 0;
}
|
Rewrite the snippet below in C++ so it works the same as the original VB code. | Imports System.Text
Module Module1
ReadOnly CODES As New Dictionary(Of Char, String) From {
{"a", "AAAAA"}, {"b", "AAAAB"}, {"c", "AAABA"}, {"d", "AAABB"}, {"e", "AABAA"},
{"f", "AABAB"}, {"g", "AABBA"}, {"h", "AABBB"}, {"i", "ABAAA"}, {"j", "ABAAB"},
{"k", "ABABA"}, {"l", "ABABB"}, {"m", "ABBAA"}, {"n", "ABBAB"}, {"o", "ABBBA"},
{"p", "ABBBB"}, {"q", "BAAAA"}, {"r", "BAAAB"}, {"s", "BAABA"}, {"t", "BAABB"},
{"u", "BABAA"}, {"v", "BABAB"}, {"w", "BABBA"}, {"x", "BABBB"}, {"y", "BBAAA"},
{"z", "BBAAB"}, {" ", "BBBAA"}
}
Function Encode(plainText As String, message As String) As String
Dim pt = plainText.ToLower()
Dim sb As New StringBuilder()
For Each c In pt
If "a" <= c AndAlso c <= "z" Then
sb.Append(CODES(c))
Else
sb.Append(CODES(" "))
End If
Next
Dim et = sb.ToString()
Dim mg = message.ToLower()
sb.Length = 0
Dim count = 0
For Each c In mg
If "a" <= c AndAlso c <= "z" Then
If et(count) = "A" Then
sb.Append(c)
Else
sb.Append(Chr(Asc(c) - 32))
End If
count += 1
If count = et.Length Then
Exit For
End If
Else
sb.Append(c)
End If
Next
Return sb.ToString()
End Function
Function Decode(message As String) As String
Dim sb As New StringBuilder
For Each c In message
If "a" <= c AndAlso c <= "z" Then
sb.Append("A")
ElseIf "A" <= c AndAlso c <= "Z" Then
sb.Append("B")
End If
Next
Dim et = sb.ToString()
sb.Length = 0
For index = 0 To et.Length - 1 Step 5
Dim quintet = et.Substring(index, 5)
Dim key = CODES.Where(Function(a) a.Value = quintet).First().Key
sb.Append(key)
Next
Return sb.ToString()
End Function
Sub Main()
Dim plainText = "the quick brown fox jumps over the lazy dog"
Dim message =
"bacon
"this task is to implement a program for encryption and decryption of " +
"plaintext using the simple alphabet of the baconian cipher or some " +
"other kind of representation of this alphabet (make anything signify anything). " +
"the baconian alphabet may optionally be extended to encode all lower " +
"case characters individually and/or adding a few punctuation characters " +
"such as the space."
Dim cipherText = Encode(plainText, message)
Console.WriteLine("Cipher text ->" & Environment.NewLine & "{0}", cipherText)
Dim decodedText = Decode(cipherText)
Console.WriteLine(Environment.NewLine & "Hidden text ->" & Environment.NewLine & "{0}", decodedText)
End Sub
End Module
| #include <iostream>
#include <algorithm>
#include <vector>
#include <bitset>
#include <string>
class bacon {
public:
bacon() {
int x = 0;
for( ; x < 9; x++ )
bAlphabet.push_back( std::bitset<5>( x ).to_string() );
bAlphabet.push_back( bAlphabet.back() );
for( ; x < 20; x++ )
bAlphabet.push_back( std::bitset<5>( x ).to_string() );
bAlphabet.push_back( bAlphabet.back() );
for( ; x < 24; x++ )
bAlphabet.push_back( std::bitset<5>( x ).to_string() );
}
std::string encode( std::string txt ) {
std::string r;
size_t z;
for( std::string::iterator i = txt.begin(); i != txt.end(); i++ ) {
z = toupper( *i );
if( z < 'A' || z > 'Z' ) continue;
r.append( bAlphabet.at( ( *i & 31 ) - 1 ) );
}
return r;
}
std::string decode( std::string txt ) {
size_t len = txt.length();
while( len % 5 != 0 ) len--;
if( len != txt.length() ) txt = txt.substr( 0, len );
std::string r;
for( size_t i = 0; i < len; i += 5 ) {
r.append( 1, 'A' + std::distance( bAlphabet.begin(), std::find( bAlphabet.begin(), bAlphabet.end(), txt.substr( i, 5 ) ) ) );
}
return r;
}
private:
std::vector<std::string> bAlphabet;
};
|
Translate this program into C++ but keep the logic exactly as in VB. | Imports System.Text
Module Module1
ReadOnly CODES As New Dictionary(Of Char, String) From {
{"a", "AAAAA"}, {"b", "AAAAB"}, {"c", "AAABA"}, {"d", "AAABB"}, {"e", "AABAA"},
{"f", "AABAB"}, {"g", "AABBA"}, {"h", "AABBB"}, {"i", "ABAAA"}, {"j", "ABAAB"},
{"k", "ABABA"}, {"l", "ABABB"}, {"m", "ABBAA"}, {"n", "ABBAB"}, {"o", "ABBBA"},
{"p", "ABBBB"}, {"q", "BAAAA"}, {"r", "BAAAB"}, {"s", "BAABA"}, {"t", "BAABB"},
{"u", "BABAA"}, {"v", "BABAB"}, {"w", "BABBA"}, {"x", "BABBB"}, {"y", "BBAAA"},
{"z", "BBAAB"}, {" ", "BBBAA"}
}
Function Encode(plainText As String, message As String) As String
Dim pt = plainText.ToLower()
Dim sb As New StringBuilder()
For Each c In pt
If "a" <= c AndAlso c <= "z" Then
sb.Append(CODES(c))
Else
sb.Append(CODES(" "))
End If
Next
Dim et = sb.ToString()
Dim mg = message.ToLower()
sb.Length = 0
Dim count = 0
For Each c In mg
If "a" <= c AndAlso c <= "z" Then
If et(count) = "A" Then
sb.Append(c)
Else
sb.Append(Chr(Asc(c) - 32))
End If
count += 1
If count = et.Length Then
Exit For
End If
Else
sb.Append(c)
End If
Next
Return sb.ToString()
End Function
Function Decode(message As String) As String
Dim sb As New StringBuilder
For Each c In message
If "a" <= c AndAlso c <= "z" Then
sb.Append("A")
ElseIf "A" <= c AndAlso c <= "Z" Then
sb.Append("B")
End If
Next
Dim et = sb.ToString()
sb.Length = 0
For index = 0 To et.Length - 1 Step 5
Dim quintet = et.Substring(index, 5)
Dim key = CODES.Where(Function(a) a.Value = quintet).First().Key
sb.Append(key)
Next
Return sb.ToString()
End Function
Sub Main()
Dim plainText = "the quick brown fox jumps over the lazy dog"
Dim message =
"bacon
"this task is to implement a program for encryption and decryption of " +
"plaintext using the simple alphabet of the baconian cipher or some " +
"other kind of representation of this alphabet (make anything signify anything). " +
"the baconian alphabet may optionally be extended to encode all lower " +
"case characters individually and/or adding a few punctuation characters " +
"such as the space."
Dim cipherText = Encode(plainText, message)
Console.WriteLine("Cipher text ->" & Environment.NewLine & "{0}", cipherText)
Dim decodedText = Decode(cipherText)
Console.WriteLine(Environment.NewLine & "Hidden text ->" & Environment.NewLine & "{0}", decodedText)
End Sub
End Module
| #include <iostream>
#include <algorithm>
#include <vector>
#include <bitset>
#include <string>
class bacon {
public:
bacon() {
int x = 0;
for( ; x < 9; x++ )
bAlphabet.push_back( std::bitset<5>( x ).to_string() );
bAlphabet.push_back( bAlphabet.back() );
for( ; x < 20; x++ )
bAlphabet.push_back( std::bitset<5>( x ).to_string() );
bAlphabet.push_back( bAlphabet.back() );
for( ; x < 24; x++ )
bAlphabet.push_back( std::bitset<5>( x ).to_string() );
}
std::string encode( std::string txt ) {
std::string r;
size_t z;
for( std::string::iterator i = txt.begin(); i != txt.end(); i++ ) {
z = toupper( *i );
if( z < 'A' || z > 'Z' ) continue;
r.append( bAlphabet.at( ( *i & 31 ) - 1 ) );
}
return r;
}
std::string decode( std::string txt ) {
size_t len = txt.length();
while( len % 5 != 0 ) len--;
if( len != txt.length() ) txt = txt.substr( 0, len );
std::string r;
for( size_t i = 0; i < len; i += 5 ) {
r.append( 1, 'A' + std::distance( bAlphabet.begin(), std::find( bAlphabet.begin(), bAlphabet.end(), txt.substr( i, 5 ) ) ) );
}
return r;
}
private:
std::vector<std::string> bAlphabet;
};
|
Write the same algorithm in C++ as shown in this VB implementation. | Function build_spiral(n)
botcol = 0 : topcol = n - 1
botrow = 0 : toprow = n - 1
Dim matrix()
ReDim matrix(topcol,toprow)
dir = 0 : col = 0 : row = 0
For i = 0 To n*n-1
matrix(col,row) = i
Select Case dir
Case 0
If col < topcol Then
col = col + 1
Else
dir = 1 : row = row + 1 : botrow = botrow + 1
End If
Case 1
If row < toprow Then
row = row + 1
Else
dir = 2 : col = col - 1 : topcol = topcol - 1
End If
Case 2
If col > botcol Then
col = col - 1
Else
dir = 3 : row = row - 1 : toprow = toprow - 1
End If
Case 3
If row > botrow Then
row = row - 1
Else
dir = 0 : col = col + 1 : botcol = botcol + 1
End If
End Select
Next
For y = 0 To n-1
For x = 0 To n-1
WScript.StdOut.Write matrix(x,y) & vbTab
Next
WScript.StdOut.WriteLine
Next
End Function
build_spiral(CInt(WScript.Arguments(0)))
| #include <vector>
#include <memory>
#include <cmath>
#include <iostream>
#include <iomanip>
using namespace std;
typedef vector< int > IntRow;
typedef vector< IntRow > IntTable;
auto_ptr< IntTable > getSpiralArray( int dimension )
{
auto_ptr< IntTable > spiralArrayPtr( new IntTable(
dimension, IntRow( dimension ) ) );
int numConcentricSquares = static_cast< int >( ceil(
static_cast< double >( dimension ) / 2.0 ) );
int j;
int sideLen = dimension;
int currNum = 0;
for ( int i = 0; i < numConcentricSquares; i++ )
{
for ( j = 0; j < sideLen; j++ )
( *spiralArrayPtr )[ i ][ i + j ] = currNum++;
for ( j = 1; j < sideLen; j++ )
( *spiralArrayPtr )[ i + j ][ dimension - 1 - i ] = currNum++;
for ( j = sideLen - 2; j > -1; j-- )
( *spiralArrayPtr )[ dimension - 1 - i ][ i + j ] = currNum++;
for ( j = sideLen - 2; j > 0; j-- )
( *spiralArrayPtr )[ i + j ][ i ] = currNum++;
sideLen -= 2;
}
return spiralArrayPtr;
}
void printSpiralArray( const auto_ptr< IntTable >& spiralArrayPtr )
{
size_t dimension = spiralArrayPtr->size();
int fieldWidth = static_cast< int >( floor( log10(
static_cast< double >( dimension * dimension - 1 ) ) ) ) + 2;
size_t col;
for ( size_t row = 0; row < dimension; row++ )
{
for ( col = 0; col < dimension; col++ )
cout << setw( fieldWidth ) << ( *spiralArrayPtr )[ row ][ col ];
cout << endl;
}
}
int main()
{
printSpiralArray( getSpiralArray( 5 ) );
}
|
Write a version of this VB function in C++ with identical behavior. | Private Sub optional_parameters(theRange As String, _
Optional ordering As Integer = 0, _
Optional column As Integer = 1, _
Optional reverse As Integer = 1)
ActiveSheet.Sort.SortFields.Clear
ActiveSheet.Sort.SortFields.Add _
Key:=Range(theRange).Columns(column), _
SortOn:=SortOnValues, _
Order:=reverse, _
DataOption:=ordering
With ActiveSheet.Sort
.SetRange Range(theRange)
.Header = xlGuess
.MatchCase = False
.Orientation = xlTopToBottom
.SortMethod = xlPinYin
.Apply
End With
End Sub
Public Sub main()
optional_parameters theRange:="A1:C4", ordering:=1, column:=2, reverse:=1
End Sub
| #include <vector>
#include <algorithm>
#include <string>
template <class T>
struct sort_table_functor {
typedef bool (*CompFun)(const T &, const T &);
const CompFun ordering;
const int column;
const bool reverse;
sort_table_functor(CompFun o, int c, bool r) :
ordering(o), column(c), reverse(r) { }
bool operator()(const std::vector<T> &x, const std::vector<T> &y) const {
const T &a = x[column],
&b = y[column];
return reverse ? ordering(b, a)
: ordering(a, b);
}
};
template <class T>
bool myLess(const T &x, const T &y) { return x < y; }
template <class T>
void sort_table(std::vector<std::vector<T> > &table,
int column = 0, bool reverse = false,
bool (*ordering)(const T &, const T &) = myLess) {
std::sort(table.begin(), table.end(),
sort_table_functor<T>(ordering, column, reverse));
}
#include <iostream>
template <class T>
void print_matrix(std::vector<std::vector<T> > &data) {
for () {
for (int j = 0; j < 3; j++)
std::cout << data[i][j] << "\t";
std::cout << std::endl;
}
}
bool desc_len_comparator(const std::string &x, const std::string &y) {
return x.length() > y.length();
}
int main() {
std::string data_array[3][3] =
{
{"a", "b", "c"},
{"", "q", "z"},
{"zap", "zip", "Zot"}
};
std::vector<std::vector<std::string> > data_orig;
for (int i = 0; i < 3; i++) {
std::vector<std::string> row;
for (int j = 0; j < 3; j++)
row.push_back(data_array[i][j]);
data_orig.push_back(row);
}
print_matrix(data_orig);
std::vector<std::vector<std::string> > data = data_orig;
sort_table(data);
print_matrix(data);
data = data_orig;
sort_table(data, 2);
print_matrix(data);
data = data_orig;
sort_table(data, 1);
print_matrix(data);
data = data_orig;
sort_table(data, 1, true);
print_matrix(data);
data = data_orig;
sort_table(data, 0, false, desc_len_comparator);
print_matrix(data);
return 0;
}
|
Convert this VB block to C++, preserving its control flow and logic. | Declare Function CreateFileW Lib "Kernel32" (FileName As WString, DesiredAccess As Integer, ShareMode As Integer, SecurityAttributes As Integer, _
CreateDisposition As Integer, Flags As Integer, Template As Integer) As Integer
Declare Function WriteFile Lib "Kernel32" (fHandle As Integer, writeData As Ptr, numOfBytes As Integer, ByRef numOfBytesWritten As Integer, _
overlapped As Ptr) As Boolean
Declare Function GetLastError Lib "Kernel32" () As Integer
Declare Function CloseHandle Lib "kernel32" (hObject As Integer) As Boolean
Const FILE_SHARE_READ = &h00000001
Const FILE_SHARE_WRITE = &h00000002
Const OPEN_EXISTING = 3
Dim fHandle As Integer = CreateFileW("C:\foo.txt", 0, FILE_SHARE_READ Or FILE_SHARE_WRITE, 0, OPEN_EXISTING, 0, 0)
If fHandle > 0 Then
Dim mb As MemoryBlock = "Hello, World!"
Dim bytesWritten As Integer
If Not WriteFile(fHandle, mb, mb.Size, bytesWritten, Nil) Then
MsgBox("Error Number: " + Str(GetLastError))
End If
Call CloseHandle(fHandle)
Else
MsgBox("Error Number: " + Str(GetLastError))
End If
| FUNCTION MULTIPLY(X, Y)
DOUBLE PRECISION MULTIPLY, X, Y
|
Port the following code from VB to C++ with equivalent syntax and logic. | Declare Function CreateFileW Lib "Kernel32" (FileName As WString, DesiredAccess As Integer, ShareMode As Integer, SecurityAttributes As Integer, _
CreateDisposition As Integer, Flags As Integer, Template As Integer) As Integer
Declare Function WriteFile Lib "Kernel32" (fHandle As Integer, writeData As Ptr, numOfBytes As Integer, ByRef numOfBytesWritten As Integer, _
overlapped As Ptr) As Boolean
Declare Function GetLastError Lib "Kernel32" () As Integer
Declare Function CloseHandle Lib "kernel32" (hObject As Integer) As Boolean
Const FILE_SHARE_READ = &h00000001
Const FILE_SHARE_WRITE = &h00000002
Const OPEN_EXISTING = 3
Dim fHandle As Integer = CreateFileW("C:\foo.txt", 0, FILE_SHARE_READ Or FILE_SHARE_WRITE, 0, OPEN_EXISTING, 0, 0)
If fHandle > 0 Then
Dim mb As MemoryBlock = "Hello, World!"
Dim bytesWritten As Integer
If Not WriteFile(fHandle, mb, mb.Size, bytesWritten, Nil) Then
MsgBox("Error Number: " + Str(GetLastError))
End If
Call CloseHandle(fHandle)
Else
MsgBox("Error Number: " + Str(GetLastError))
End If
| FUNCTION MULTIPLY(X, Y)
DOUBLE PRECISION MULTIPLY, X, Y
|
Produce a functionally identical C++ code for the snippet given in VB. | Module Module1
Class Frac
Private ReadOnly num As Long
Private ReadOnly denom As Long
Public Shared ReadOnly ZERO = New Frac(0, 1)
Public Shared ReadOnly ONE = New Frac(1, 1)
Public Sub New(n As Long, d As Long)
If d = 0 Then
Throw New ArgumentException("d must not be zero")
End If
Dim nn = n
Dim dd = d
If nn = 0 Then
dd = 1
ElseIf dd < 0 Then
nn = -nn
dd = -dd
End If
Dim g = Math.Abs(Gcd(nn, dd))
If g > 1 Then
nn /= g
dd /= g
End If
num = nn
denom = dd
End Sub
Private Shared Function Gcd(a As Long, b As Long) As Long
If b = 0 Then
Return a
Else
Return Gcd(b, a Mod b)
End If
End Function
Public Shared Operator -(self As Frac) As Frac
Return New Frac(-self.num, self.denom)
End Operator
Public Shared Operator +(lhs As Frac, rhs As Frac) As Frac
Return New Frac(lhs.num * rhs.denom + lhs.denom * rhs.num, rhs.denom * lhs.denom)
End Operator
Public Shared Operator -(lhs As Frac, rhs As Frac) As Frac
Return lhs + -rhs
End Operator
Public Shared Operator *(lhs As Frac, rhs As Frac) As Frac
Return New Frac(lhs.num * rhs.num, lhs.denom * rhs.denom)
End Operator
Public Shared Operator <(lhs As Frac, rhs As Frac) As Boolean
Dim x = lhs.num / lhs.denom
Dim y = rhs.num / rhs.denom
Return x < y
End Operator
Public Shared Operator >(lhs As Frac, rhs As Frac) As Boolean
Dim x = lhs.num / lhs.denom
Dim y = rhs.num / rhs.denom
Return x > y
End Operator
Public Shared Operator =(lhs As Frac, rhs As Frac) As Boolean
Return lhs.num = rhs.num AndAlso lhs.denom = rhs.denom
End Operator
Public Shared Operator <>(lhs As Frac, rhs As Frac) As Boolean
Return lhs.num <> rhs.num OrElse lhs.denom <> rhs.denom
End Operator
Public Overrides Function ToString() As String
If denom = 1 Then
Return num.ToString
Else
Return String.Format("{0}/{1}", num, denom)
End If
End Function
Public Overrides Function Equals(obj As Object) As Boolean
Dim frac = CType(obj, Frac)
Return Not IsNothing(frac) AndAlso num = frac.num AndAlso denom = frac.denom
End Function
End Class
Function Bernoulli(n As Integer) As Frac
If n < 0 Then
Throw New ArgumentException("n may not be negative or zero")
End If
Dim a(n + 1) As Frac
For m = 0 To n
a(m) = New Frac(1, m + 1)
For j = m To 1 Step -1
a(j - 1) = (a(j - 1) - a(j)) * New Frac(j, 1)
Next
Next
If n <> 1 Then
Return a(0)
Else
Return -a(0)
End If
End Function
Function Binomial(n As Integer, k As Integer) As Integer
If n < 0 OrElse k < 0 OrElse n < k Then
Throw New ArgumentException()
End If
If n = 0 OrElse k = 0 Then
Return 1
End If
Dim num = 1
For i = k + 1 To n
num *= i
Next
Dim denom = 1
For i = 2 To n - k
denom *= i
Next
Return num \ denom
End Function
Function FaulhaberTriangle(p As Integer) As Frac()
Dim coeffs(p + 1) As Frac
For i = 1 To p + 1
coeffs(i - 1) = Frac.ZERO
Next
Dim q As New Frac(1, p + 1)
Dim sign = -1
For j = 0 To p
sign *= -1
coeffs(p - j) = q * New Frac(sign, 1) * New Frac(Binomial(p + 1, j), 1) * Bernoulli(j)
Next
Return coeffs
End Function
Sub Main()
For i = 1 To 10
Dim coeffs = FaulhaberTriangle(i - 1)
For Each coeff In coeffs
Console.Write("{0,5} ", coeff)
Next
Console.WriteLine()
Next
End Sub
End Module
| #include <exception>
#include <iomanip>
#include <iostream>
#include <numeric>
#include <sstream>
#include <vector>
class Frac {
public:
Frac() : num(0), denom(1) {}
Frac(int n, int d) {
if (d == 0) {
throw std::runtime_error("d must not be zero");
}
int sign_of_d = d < 0 ? -1 : 1;
int g = std::gcd(n, d);
num = sign_of_d * n / g;
denom = sign_of_d * d / g;
}
Frac operator-() const {
return Frac(-num, denom);
}
Frac operator+(const Frac& rhs) const {
return Frac(num*rhs.denom + denom * rhs.num, rhs.denom*denom);
}
Frac operator-(const Frac& rhs) const {
return Frac(num*rhs.denom - denom * rhs.num, rhs.denom*denom);
}
Frac operator*(const Frac& rhs) const {
return Frac(num*rhs.num, denom*rhs.denom);
}
Frac operator*(int rhs) const {
return Frac(num * rhs, denom);
}
friend std::ostream& operator<<(std::ostream&, const Frac&);
private:
int num;
int denom;
};
std::ostream & operator<<(std::ostream & os, const Frac &f) {
if (f.num == 0 || f.denom == 1) {
return os << f.num;
}
std::stringstream ss;
ss << f.num << "/" << f.denom;
return os << ss.str();
}
Frac bernoulli(int n) {
if (n < 0) {
throw std::runtime_error("n may not be negative or zero");
}
std::vector<Frac> a;
for (int m = 0; m <= n; m++) {
a.push_back(Frac(1, m + 1));
for (int j = m; j >= 1; j--) {
a[j - 1] = (a[j - 1] - a[j]) * j;
}
}
if (n != 1) return a[0];
return -a[0];
}
int binomial(int n, int k) {
if (n < 0 || k < 0 || n < k) {
throw std::runtime_error("parameters are invalid");
}
if (n == 0 || k == 0) return 1;
int num = 1;
for (int i = k + 1; i <= n; i++) {
num *= i;
}
int denom = 1;
for (int i = 2; i <= n - k; i++) {
denom *= i;
}
return num / denom;
}
std::vector<Frac> faulhaberTraingle(int p) {
std::vector<Frac> coeffs(p + 1);
Frac q{ 1, p + 1 };
int sign = -1;
for (int j = 0; j <= p; j++) {
sign *= -1;
coeffs[p - j] = q * sign * binomial(p + 1, j) * bernoulli(j);
}
return coeffs;
}
int main() {
for (int i = 0; i < 10; i++) {
std::vector<Frac> coeffs = faulhaberTraingle(i);
for (auto frac : coeffs) {
std::cout << std::right << std::setw(5) << frac << " ";
}
std::cout << std::endl;
}
return 0;
}
|
Rewrite the snippet below in C++ so it works the same as the original VB code. | Function Run(args() as String) As Integer
For each arg As String In args
Stdout.WriteLine(arg)
Next
End Function
| #include <iostream>
int main(int argc, char* argv[])
{
std::cout << "This program is named " << argv[0] << std::endl;
std::cout << "There are " << argc-1 << " arguments given." << std::endl;
for (int i = 1; i < argc; ++i)
std::cout << "the argument #" << i << " is " << argv[i] << std::endl;
return 0;
}
|
Can you help me rewrite this code in C++ instead of VB, keeping it the same logically? | Function Run(args() as String) As Integer
For each arg As String In args
Stdout.WriteLine(arg)
Next
End Function
| #include <iostream>
int main(int argc, char* argv[])
{
std::cout << "This program is named " << argv[0] << std::endl;
std::cout << "There are " << argc-1 << " arguments given." << std::endl;
for (int i = 1; i < argc; ++i)
std::cout << "the argument #" << i << " is " << argv[i] << std::endl;
return 0;
}
|
Produce a functionally identical C++ code for the snippet given in VB. | Const wheel="ndeokgelw"
Sub print(s):
On Error Resume Next
WScript.stdout.WriteLine (s)
If err= &h80070006& Then WScript.Echo " Please run this script with CScript": WScript.quit
End Sub
Dim oDic
Set oDic = WScript.CreateObject("scripting.dictionary")
Dim cnt(127)
Dim fso
Set fso = WScript.CreateObject("Scripting.Filesystemobject")
Set ff=fso.OpenTextFile("unixdict.txt")
i=0
print "reading words of 3 or more letters"
While Not ff.AtEndOfStream
x=LCase(ff.ReadLine)
If Len(x)>=3 Then
If Not odic.exists(x) Then oDic.Add x,0
End If
Wend
print "remaining words: "& oDic.Count & vbcrlf
ff.Close
Set ff=Nothing
Set fso=Nothing
Set re=New RegExp
print "removing words with chars not in the wheel"
re.pattern="[^"& wheel &"]"
For Each w In oDic.Keys
If re.test(w) Then oDic.remove(w)
Next
print "remaining words: "& oDic.Count & vbcrlf
print "ensuring the mandatory letter "& Mid(wheel,5,1) & " is present"
re.Pattern=Mid(wheel,5,1)
For Each w In oDic.Keys
If Not re.test(w) Then oDic.remove(w)
Next
print "remaining words: "& oDic.Count & vbcrlf
print "checking number of chars"
Dim nDic
Set nDic = WScript.CreateObject("scripting.dictionary")
For i=1 To Len(wheel)
x=Mid(wheel,i,1)
If nDic.Exists(x) Then
a=nDic(x)
nDic(x)=Array(a(0)+1,0)
Else
nDic.add x,Array(1,0)
End If
Next
For Each w In oDic.Keys
For Each c In nDic.Keys
ndic(c)=Array(nDic(c)(0),0)
Next
For ii = 1 To len(w)
c=Mid(w,ii,1)
a=nDic(c)
If (a(0)=a(1)) Then
oDic.Remove(w):Exit For
End If
nDic(c)=Array(a(0),a(1)+1)
Next
Next
print "Remaining words "& oDic.count
For Each w In oDic.Keys
print w
Next
| #include <array>
#include <iostream>
#include <fstream>
#include <map>
#include <string>
#include <vector>
#include <boost/program_options.hpp>
class letterset {
public:
letterset() {
count_.fill(0);
}
explicit letterset(const std::string& str) {
count_.fill(0);
for (char c : str)
add(c);
}
bool contains(const letterset& set) const {
for (size_t i = 0; i < count_.size(); ++i) {
if (set.count_[i] > count_[i])
return false;
}
return true;
}
unsigned int count(char c) const {
return count_[index(c)];
}
bool is_valid() const {
return count_[0] == 0;
}
void add(char c) {
++count_[index(c)];
}
private:
static bool is_letter(char c) { return c >= 'a' && c <= 'z'; }
static int index(char c) { return is_letter(c) ? c - 'a' + 1 : 0; }
std::array<unsigned int, 27> count_;
};
template <typename iterator, typename separator>
std::string join(iterator begin, iterator end, separator sep) {
std::string result;
if (begin != end) {
result += *begin++;
for (; begin != end; ++begin) {
result += sep;
result += *begin;
}
}
return result;
}
using dictionary = std::vector<std::pair<std::string, letterset>>;
dictionary load_dictionary(const std::string& filename, int min_length,
int max_length) {
std::ifstream in(filename);
if (!in)
throw std::runtime_error("Cannot open file " + filename);
std::string word;
dictionary result;
while (getline(in, word)) {
if (word.size() < min_length)
continue;
if (word.size() > max_length)
continue;
letterset set(word);
if (set.is_valid())
result.emplace_back(word, set);
}
return result;
}
void word_wheel(const dictionary& dict, const std::string& letters,
char central_letter) {
letterset set(letters);
if (central_letter == 0 && !letters.empty())
central_letter = letters.at(letters.size()/2);
std::map<size_t, std::vector<std::string>> words;
for (const auto& pair : dict) {
const auto& word = pair.first;
const auto& subset = pair.second;
if (subset.count(central_letter) > 0 && set.contains(subset))
words[word.size()].push_back(word);
}
size_t total = 0;
for (const auto& p : words) {
const auto& v = p.second;
auto n = v.size();
total += n;
std::cout << "Found " << n << " " << (n == 1 ? "word" : "words")
<< " of length " << p.first << ": "
<< join(v.begin(), v.end(), ", ") << '\n';
}
std::cout << "Number of words found: " << total << '\n';
}
void find_max_word_count(const dictionary& dict, int word_length) {
size_t max_count = 0;
std::vector<std::pair<std::string, char>> max_words;
for (const auto& pair : dict) {
const auto& word = pair.first;
if (word.size() != word_length)
continue;
const auto& set = pair.second;
dictionary subsets;
for (const auto& p : dict) {
if (set.contains(p.second))
subsets.push_back(p);
}
letterset done;
for (size_t index = 0; index < word_length; ++index) {
char central_letter = word[index];
if (done.count(central_letter) > 0)
continue;
done.add(central_letter);
size_t count = 0;
for (const auto& p : subsets) {
const auto& subset = p.second;
if (subset.count(central_letter) > 0)
++count;
}
if (count > max_count) {
max_words.clear();
max_count = count;
}
if (count == max_count)
max_words.emplace_back(word, central_letter);
}
}
std::cout << "Maximum word count: " << max_count << '\n';
std::cout << "Words of " << word_length << " letters producing this count:\n";
for (const auto& pair : max_words)
std::cout << pair.first << " with central letter " << pair.second << '\n';
}
constexpr const char* option_filename = "filename";
constexpr const char* option_wheel = "wheel";
constexpr const char* option_central = "central";
constexpr const char* option_min_length = "min-length";
constexpr const char* option_part2 = "part2";
int main(int argc, char** argv) {
const int word_length = 9;
int min_length = 3;
std::string letters = "ndeokgelw";
std::string filename = "unixdict.txt";
char central_letter = 0;
bool do_part2 = false;
namespace po = boost::program_options;
po::options_description desc("Allowed options");
desc.add_options()
(option_filename, po::value<std::string>(), "name of dictionary file")
(option_wheel, po::value<std::string>(), "word wheel letters")
(option_central, po::value<char>(), "central letter (defaults to middle letter of word)")
(option_min_length, po::value<int>(), "minimum word length")
(option_part2, "include part 2");
try {
po::variables_map vm;
po::store(po::parse_command_line(argc, argv, desc), vm);
po::notify(vm);
if (vm.count(option_filename))
filename = vm[option_filename].as<std::string>();
if (vm.count(option_wheel))
letters = vm[option_wheel].as<std::string>();
if (vm.count(option_central))
central_letter = vm[option_central].as<char>();
if (vm.count(option_min_length))
min_length = vm[option_min_length].as<int>();
if (vm.count(option_part2))
do_part2 = true;
auto dict = load_dictionary(filename, min_length, word_length);
word_wheel(dict, letters, central_letter);
if (do_part2) {
std::cout << '\n';
find_max_word_count(dict, word_length);
}
} catch (const std::exception& ex) {
std::cerr << ex.what() << '\n';
return EXIT_FAILURE;
}
return EXIT_SUCCESS;
}
|
Port the provided VB code into C++ while preserving the original functionality. | DEFINT A(1 to 4) = {1, 2, 3, 4}
DEFINT B(1 to 4) = {10, 20, 30, 40}
Redim A(1 to 8) as integer
MEMCPY(varptr(A(5)), varptr(B(1)), Sizeof(integer)*4)
| #include <vector>
#include <iostream>
int main()
{
std::vector<int> a(3), b(4);
a[0] = 11; a[1] = 12; a[2] = 13;
b[0] = 21; b[1] = 22; b[2] = 23; b[3] = 24;
a.insert(a.end(), b.begin(), b.end());
for (int i = 0; i < a.size(); ++i)
std::cout << "a[" << i << "] = " << a[i] << "\n";
}
|
Maintain the same structure and functionality when rewriting this code in C++. | Public Sub text()
Debug.Print InputBox("Input a string")
Debug.Print InputBox("Input the integer 75000", "Input an integer", 75000, Context = "Long")
End Sub
| #include <iostream>
#include <string>
using namespace std;
int main()
{
long int integer_input;
string string_input;
cout << "Enter an integer: ";
cin >> integer_input;
cout << "Enter a string: ";
cin >> string_input;
return 0;
}
|
Generate an equivalent C++ version of this VB code. | Public Sub text()
Debug.Print InputBox("Input a string")
Debug.Print InputBox("Input the integer 75000", "Input an integer", 75000, Context = "Long")
End Sub
| #include <iostream>
#include <string>
using namespace std;
int main()
{
long int integer_input;
string string_input;
cout << "Enter an integer: ";
cin >> integer_input;
cout << "Enter a string: ";
cin >> string_input;
return 0;
}
|
Convert the following code from VB to C++, ensuring the logic remains intact. | Option Explicit
Declare Function Beep Lib "kernel32" (ByVal Freq As Long, ByVal Dur As Long) As Long
Sub Musical_Scale()
Dim Fqs, i As Integer
Fqs = Array(264, 297, 330, 352, 396, 440, 495, 528)
For i = LBound(Fqs) To UBound(Fqs)
Beep Fqs(i), 500
Next
End Sub
| #include <iostream>
#include <windows.h>
#include <mmsystem.h>
#pragma comment ( lib, "winmm.lib" )
typedef unsigned char byte;
typedef union
{
unsigned long word;
unsigned char data[4];
}
midi_msg;
class midi
{
public:
midi()
{
if( midiOutOpen( &device, 0, 0, 0, CALLBACK_NULL) != MMSYSERR_NOERROR )
{
std::cout << "Error opening MIDI Output..." << std::endl;
device = 0;
}
}
~midi()
{
midiOutReset( device );
midiOutClose( device );
}
bool isOpen() { return device != 0; }
void setInstrument( byte i )
{
message.data[0] = 0xc0; message.data[1] = i;
message.data[2] = 0; message.data[3] = 0;
midiOutShortMsg( device, message.word );
}
void playNote( byte n, unsigned i )
{
playNote( n ); Sleep( i ); stopNote( n );
}
private:
void playNote( byte n )
{
message.data[0] = 0x90; message.data[1] = n;
message.data[2] = 127; message.data[3] = 0;
midiOutShortMsg( device, message.word );
}
void stopNote( byte n )
{
message.data[0] = 0x90; message.data[1] = n;
message.data[2] = 0; message.data[3] = 0;
midiOutShortMsg( device, message.word );
}
HMIDIOUT device;
midi_msg message;
};
int main( int argc, char* argv[] )
{
midi m;
if( m.isOpen() )
{
byte notes[] = { 60, 62, 64, 65, 67, 69, 71, 72 };
m.setInstrument( 42 );
for( int x = 0; x < 8; x++ )
m.playNote( notes[x], rand() % 100 + 158 );
Sleep( 1000 );
}
return 0;
}
|
Translate this program into C++ but keep the logic exactly as in VB. | Option Explicit
Declare Function Beep Lib "kernel32" (ByVal Freq As Long, ByVal Dur As Long) As Long
Sub Musical_Scale()
Dim Fqs, i As Integer
Fqs = Array(264, 297, 330, 352, 396, 440, 495, 528)
For i = LBound(Fqs) To UBound(Fqs)
Beep Fqs(i), 500
Next
End Sub
| #include <iostream>
#include <windows.h>
#include <mmsystem.h>
#pragma comment ( lib, "winmm.lib" )
typedef unsigned char byte;
typedef union
{
unsigned long word;
unsigned char data[4];
}
midi_msg;
class midi
{
public:
midi()
{
if( midiOutOpen( &device, 0, 0, 0, CALLBACK_NULL) != MMSYSERR_NOERROR )
{
std::cout << "Error opening MIDI Output..." << std::endl;
device = 0;
}
}
~midi()
{
midiOutReset( device );
midiOutClose( device );
}
bool isOpen() { return device != 0; }
void setInstrument( byte i )
{
message.data[0] = 0xc0; message.data[1] = i;
message.data[2] = 0; message.data[3] = 0;
midiOutShortMsg( device, message.word );
}
void playNote( byte n, unsigned i )
{
playNote( n ); Sleep( i ); stopNote( n );
}
private:
void playNote( byte n )
{
message.data[0] = 0x90; message.data[1] = n;
message.data[2] = 127; message.data[3] = 0;
midiOutShortMsg( device, message.word );
}
void stopNote( byte n )
{
message.data[0] = 0x90; message.data[1] = n;
message.data[2] = 0; message.data[3] = 0;
midiOutShortMsg( device, message.word );
}
HMIDIOUT device;
midi_msg message;
};
int main( int argc, char* argv[] )
{
midi m;
if( m.isOpen() )
{
byte notes[] = { 60, 62, 64, 65, 67, 69, 71, 72 };
m.setInstrument( 42 );
for( int x = 0; x < 8; x++ )
m.playNote( notes[x], rand() % 100 + 158 );
Sleep( 1000 );
}
return 0;
}
|
Preserve the algorithm and functionality while converting the code from VB to C++. |
Option Explicit
Const maxWeight = 400
Dim DataList As Variant
Dim xList(64, 3) As Variant
Dim nItems As Integer
Dim s As String, xss As String
Dim xwei As Integer, xval As Integer, nn As Integer
Sub Main()
Dim i As Integer, j As Integer
DataList = Array("map", 9, 150, "compass", 13, 35, "water", 153, 200, "sandwich", 50, 160, _
"glucose", 15, 60, "tin", 68, 45, "banana", 27, 60, "apple", 39, 40, _
"cheese", 23, 30, "beer", 52, 10, "suntan cream", 11, 70, "camera", 32, 30, _
"T-shirt", 24, 15, "trousers", 48, 10, "umbrella", 73, 40, "book", 30, 10, _
"waterproof trousers", 42, 70, "waterproof overclothes", 43, 75, _
"note-case", 22, 80, "sunglasses", 7, 20, "towel", 18, 12, "socks", 4, 50)
nItems = (UBound(DataList) + 1) / 3
j = 0
For i = 1 To nItems
xList(i, 1) = DataList(j)
xList(i, 2) = DataList(j + 1)
xList(i, 3) = DataList(j + 2)
j = j + 3
Next i
s = ""
For i = 1 To nItems
s = s & Chr(i)
Next
nn = 0
Call ChoiceBin(1, "")
For i = 1 To Len(xss)
j = Asc(Mid(xss, i, 1))
Debug.Print xList(j, 1)
Next i
Debug.Print "count=" & Len(xss), "weight=" & xwei, "value=" & xval
End Sub
Private Sub ChoiceBin(n As String, ss As String)
Dim r As String
Dim i As Integer, j As Integer, iwei As Integer, ival As Integer
Dim ipct As Integer
If n = Len(s) + 1 Then
iwei = 0: ival = 0
For i = 1 To Len(ss)
j = Asc(Mid(ss, i, 1))
iwei = iwei + xList(j, 2)
ival = ival + xList(j, 3)
Next
If iwei <= maxWeight And ival > xval Then
xss = ss: xwei = iwei: xval = ival
End If
Else
r = Mid(s, n, 1)
Call ChoiceBin(n + 1, ss & r)
Call ChoiceBin(n + 1, ss)
End If
End Sub
| #include <vector>
#include <string>
#include <iostream>
#include <boost/tuple/tuple.hpp>
#include <set>
int findBestPack( const std::vector<boost::tuple<std::string , int , int> > & ,
std::set<int> & , const int ) ;
int main( ) {
std::vector<boost::tuple<std::string , int , int> > items ;
items.push_back( boost::make_tuple( "" , 0 , 0 ) ) ;
items.push_back( boost::make_tuple( "map" , 9 , 150 ) ) ;
items.push_back( boost::make_tuple( "compass" , 13 , 35 ) ) ;
items.push_back( boost::make_tuple( "water" , 153 , 200 ) ) ;
items.push_back( boost::make_tuple( "sandwich", 50 , 160 ) ) ;
items.push_back( boost::make_tuple( "glucose" , 15 , 60 ) ) ;
items.push_back( boost::make_tuple( "tin", 68 , 45 ) ) ;
items.push_back( boost::make_tuple( "banana", 27 , 60 ) ) ;
items.push_back( boost::make_tuple( "apple" , 39 , 40 ) ) ;
items.push_back( boost::make_tuple( "cheese" , 23 , 30 ) ) ;
items.push_back( boost::make_tuple( "beer" , 52 , 10 ) ) ;
items.push_back( boost::make_tuple( "suntan creme" , 11 , 70 ) ) ;
items.push_back( boost::make_tuple( "camera" , 32 , 30 ) ) ;
items.push_back( boost::make_tuple( "T-shirt" , 24 , 15 ) ) ;
items.push_back( boost::make_tuple( "trousers" , 48 , 10 ) ) ;
items.push_back( boost::make_tuple( "umbrella" , 73 , 40 ) ) ;
items.push_back( boost::make_tuple( "waterproof trousers" , 42 , 70 ) ) ;
items.push_back( boost::make_tuple( "waterproof overclothes" , 43 , 75 ) ) ;
items.push_back( boost::make_tuple( "note-case" , 22 , 80 ) ) ;
items.push_back( boost::make_tuple( "sunglasses" , 7 , 20 ) ) ;
items.push_back( boost::make_tuple( "towel" , 18 , 12 ) ) ;
items.push_back( boost::make_tuple( "socks" , 4 , 50 ) ) ;
items.push_back( boost::make_tuple( "book" , 30 , 10 ) ) ;
const int maximumWeight = 400 ;
std::set<int> bestItems ;
int bestValue = findBestPack( items , bestItems , maximumWeight ) ;
std::cout << "The best value that can be packed in the given knapsack is " <<
bestValue << " !\n" ;
int totalweight = 0 ;
std::cout << "The following items should be packed in the knapsack:\n" ;
for ( std::set<int>::const_iterator si = bestItems.begin( ) ;
si != bestItems.end( ) ; si++ ) {
std::cout << (items.begin( ) + *si)->get<0>( ) << "\n" ;
totalweight += (items.begin( ) + *si)->get<1>( ) ;
}
std::cout << "The total weight of all items is " << totalweight << " !\n" ;
return 0 ;
}
int findBestPack( const std::vector<boost::tuple<std::string , int , int> > & items ,std::set<int> & bestItems , const int weightlimit ) {
const int n = items.size( ) ;
int bestValues [ n ][ weightlimit ] ;
std::set<int> solutionSets[ n ][ weightlimit ] ;
std::set<int> emptyset ;
for ( int i = 0 ; i < n ; i++ ) {
for ( int j = 0 ; j < weightlimit ; j++ ) {
bestValues[ i ][ j ] = 0 ;
solutionSets[ i ][ j ] = emptyset ;
}
}
for ( int i = 0 ; i < n ; i++ ) {
for ( int weight = 0 ; weight < weightlimit ; weight++ ) {
if ( i == 0 )
bestValues[ i ][ weight ] = 0 ;
else {
int itemweight = (items.begin( ) + i)->get<1>( ) ;
if ( weight < itemweight ) {
bestValues[ i ][ weight ] = bestValues[ i - 1 ][ weight ] ;
solutionSets[ i ][ weight ] = solutionSets[ i - 1 ][ weight ] ;
} else {
if ( bestValues[ i - 1 ][ weight - itemweight ] +
(items.begin( ) + i)->get<2>( ) >
bestValues[ i - 1 ][ weight ] ) {
bestValues[ i ][ weight ] =
bestValues[ i - 1 ][ weight - itemweight ] +
(items.begin( ) + i)->get<2>( ) ;
solutionSets[ i ][ weight ] =
solutionSets[ i - 1 ][ weight - itemweight ] ;
solutionSets[ i ][ weight ].insert( i ) ;
}
else {
bestValues[ i ][ weight ] = bestValues[ i - 1 ][ weight ] ;
solutionSets[ i ][ weight ] = solutionSets[ i - 1 ][ weight ] ;
}
}
}
}
}
bestItems.swap( solutionSets[ n - 1][ weightlimit - 1 ] ) ;
return bestValues[ n - 1 ][ weightlimit - 1 ] ;
}
|
Generate a C++ translation of this VB snippet without changing its computational steps. |
Option Explicit
Const maxWeight = 400
Dim DataList As Variant
Dim xList(64, 3) As Variant
Dim nItems As Integer
Dim s As String, xss As String
Dim xwei As Integer, xval As Integer, nn As Integer
Sub Main()
Dim i As Integer, j As Integer
DataList = Array("map", 9, 150, "compass", 13, 35, "water", 153, 200, "sandwich", 50, 160, _
"glucose", 15, 60, "tin", 68, 45, "banana", 27, 60, "apple", 39, 40, _
"cheese", 23, 30, "beer", 52, 10, "suntan cream", 11, 70, "camera", 32, 30, _
"T-shirt", 24, 15, "trousers", 48, 10, "umbrella", 73, 40, "book", 30, 10, _
"waterproof trousers", 42, 70, "waterproof overclothes", 43, 75, _
"note-case", 22, 80, "sunglasses", 7, 20, "towel", 18, 12, "socks", 4, 50)
nItems = (UBound(DataList) + 1) / 3
j = 0
For i = 1 To nItems
xList(i, 1) = DataList(j)
xList(i, 2) = DataList(j + 1)
xList(i, 3) = DataList(j + 2)
j = j + 3
Next i
s = ""
For i = 1 To nItems
s = s & Chr(i)
Next
nn = 0
Call ChoiceBin(1, "")
For i = 1 To Len(xss)
j = Asc(Mid(xss, i, 1))
Debug.Print xList(j, 1)
Next i
Debug.Print "count=" & Len(xss), "weight=" & xwei, "value=" & xval
End Sub
Private Sub ChoiceBin(n As String, ss As String)
Dim r As String
Dim i As Integer, j As Integer, iwei As Integer, ival As Integer
Dim ipct As Integer
If n = Len(s) + 1 Then
iwei = 0: ival = 0
For i = 1 To Len(ss)
j = Asc(Mid(ss, i, 1))
iwei = iwei + xList(j, 2)
ival = ival + xList(j, 3)
Next
If iwei <= maxWeight And ival > xval Then
xss = ss: xwei = iwei: xval = ival
End If
Else
r = Mid(s, n, 1)
Call ChoiceBin(n + 1, ss & r)
Call ChoiceBin(n + 1, ss)
End If
End Sub
| #include <vector>
#include <string>
#include <iostream>
#include <boost/tuple/tuple.hpp>
#include <set>
int findBestPack( const std::vector<boost::tuple<std::string , int , int> > & ,
std::set<int> & , const int ) ;
int main( ) {
std::vector<boost::tuple<std::string , int , int> > items ;
items.push_back( boost::make_tuple( "" , 0 , 0 ) ) ;
items.push_back( boost::make_tuple( "map" , 9 , 150 ) ) ;
items.push_back( boost::make_tuple( "compass" , 13 , 35 ) ) ;
items.push_back( boost::make_tuple( "water" , 153 , 200 ) ) ;
items.push_back( boost::make_tuple( "sandwich", 50 , 160 ) ) ;
items.push_back( boost::make_tuple( "glucose" , 15 , 60 ) ) ;
items.push_back( boost::make_tuple( "tin", 68 , 45 ) ) ;
items.push_back( boost::make_tuple( "banana", 27 , 60 ) ) ;
items.push_back( boost::make_tuple( "apple" , 39 , 40 ) ) ;
items.push_back( boost::make_tuple( "cheese" , 23 , 30 ) ) ;
items.push_back( boost::make_tuple( "beer" , 52 , 10 ) ) ;
items.push_back( boost::make_tuple( "suntan creme" , 11 , 70 ) ) ;
items.push_back( boost::make_tuple( "camera" , 32 , 30 ) ) ;
items.push_back( boost::make_tuple( "T-shirt" , 24 , 15 ) ) ;
items.push_back( boost::make_tuple( "trousers" , 48 , 10 ) ) ;
items.push_back( boost::make_tuple( "umbrella" , 73 , 40 ) ) ;
items.push_back( boost::make_tuple( "waterproof trousers" , 42 , 70 ) ) ;
items.push_back( boost::make_tuple( "waterproof overclothes" , 43 , 75 ) ) ;
items.push_back( boost::make_tuple( "note-case" , 22 , 80 ) ) ;
items.push_back( boost::make_tuple( "sunglasses" , 7 , 20 ) ) ;
items.push_back( boost::make_tuple( "towel" , 18 , 12 ) ) ;
items.push_back( boost::make_tuple( "socks" , 4 , 50 ) ) ;
items.push_back( boost::make_tuple( "book" , 30 , 10 ) ) ;
const int maximumWeight = 400 ;
std::set<int> bestItems ;
int bestValue = findBestPack( items , bestItems , maximumWeight ) ;
std::cout << "The best value that can be packed in the given knapsack is " <<
bestValue << " !\n" ;
int totalweight = 0 ;
std::cout << "The following items should be packed in the knapsack:\n" ;
for ( std::set<int>::const_iterator si = bestItems.begin( ) ;
si != bestItems.end( ) ; si++ ) {
std::cout << (items.begin( ) + *si)->get<0>( ) << "\n" ;
totalweight += (items.begin( ) + *si)->get<1>( ) ;
}
std::cout << "The total weight of all items is " << totalweight << " !\n" ;
return 0 ;
}
int findBestPack( const std::vector<boost::tuple<std::string , int , int> > & items ,std::set<int> & bestItems , const int weightlimit ) {
const int n = items.size( ) ;
int bestValues [ n ][ weightlimit ] ;
std::set<int> solutionSets[ n ][ weightlimit ] ;
std::set<int> emptyset ;
for ( int i = 0 ; i < n ; i++ ) {
for ( int j = 0 ; j < weightlimit ; j++ ) {
bestValues[ i ][ j ] = 0 ;
solutionSets[ i ][ j ] = emptyset ;
}
}
for ( int i = 0 ; i < n ; i++ ) {
for ( int weight = 0 ; weight < weightlimit ; weight++ ) {
if ( i == 0 )
bestValues[ i ][ weight ] = 0 ;
else {
int itemweight = (items.begin( ) + i)->get<1>( ) ;
if ( weight < itemweight ) {
bestValues[ i ][ weight ] = bestValues[ i - 1 ][ weight ] ;
solutionSets[ i ][ weight ] = solutionSets[ i - 1 ][ weight ] ;
} else {
if ( bestValues[ i - 1 ][ weight - itemweight ] +
(items.begin( ) + i)->get<2>( ) >
bestValues[ i - 1 ][ weight ] ) {
bestValues[ i ][ weight ] =
bestValues[ i - 1 ][ weight - itemweight ] +
(items.begin( ) + i)->get<2>( ) ;
solutionSets[ i ][ weight ] =
solutionSets[ i - 1 ][ weight - itemweight ] ;
solutionSets[ i ][ weight ].insert( i ) ;
}
else {
bestValues[ i ][ weight ] = bestValues[ i - 1 ][ weight ] ;
solutionSets[ i ][ weight ] = solutionSets[ i - 1 ][ weight ] ;
}
}
}
}
}
bestItems.swap( solutionSets[ n - 1][ weightlimit - 1 ] ) ;
return bestValues[ n - 1 ][ weightlimit - 1 ] ;
}
|
Ensure the translated C++ code behaves exactly like the original VB snippet. | Imports System.Math
Module Module1
Const MAXPRIME = 99
Const MAXPARENT = 99
Const NBRCHILDREN = 547100
Public Primes As New Collection()
Public PrimesR As New Collection()
Public Ancestors As New Collection()
Public Parents(MAXPARENT + 1) As Integer
Public CptDescendants(MAXPARENT + 1) As Integer
Public Children(NBRCHILDREN) As ChildStruct
Public iChildren As Integer
Public Delimiter As String = ", "
Public Structure ChildStruct
Public Child As Long
Public pLower As Integer
Public pHigher As Integer
End Structure
Sub Main()
Dim Parent As Short
Dim Sum As Short
Dim i As Short
Dim TotDesc As Integer = 0
Dim MidPrime As Integer
If GetPrimes(Primes, MAXPRIME) = vbFalse Then
Return
End If
For i = Primes.Count To 1 Step -1
PrimesR.Add(Primes.Item(i))
Next
MidPrime = PrimesR.Item(1) / 2
For Each Prime In PrimesR
Parents(Prime) = InsertChild(Parents(Prime), Prime)
CptDescendants(Prime) += 1
If Prime > MidPrime Then
Continue For
End If
For Parent = 1 To MAXPARENT
Sum = Parent + Prime
If Sum > MAXPARENT Then
Exit For
End If
If Parents(Parent) Then
InsertPreorder(Parents(Parent), Sum, Prime)
CptDescendants(Sum) += CptDescendants(Parent)
End If
Next
Next
RemoveFalseChildren()
If MAXPARENT > MAXPRIME Then
If GetPrimes(Primes, MAXPARENT) = vbFalse Then
Return
End If
End If
FileOpen(1, "Ancestors.txt", OpenMode.Output)
For Parent = 1 To MAXPARENT
GetAncestors(Parent)
PrintLine(1, "[" & Parent.ToString & "] Level: " & Ancestors.Count.ToString)
If Ancestors.Count Then
Print(1, "Ancestors: " & Ancestors.Item(1).ToString)
For i = 2 To Ancestors.Count
Print(1, ", " & Ancestors.Item(i).ToString)
Next
PrintLine(1)
Ancestors.Clear()
Else
PrintLine(1, "Ancestors: None")
End If
If CptDescendants(Parent) Then
PrintLine(1, "Descendants: " & CptDescendants(Parent).ToString)
Delimiter = ""
PrintDescendants(Parents(Parent))
PrintLine(1)
TotDesc += CptDescendants(Parent)
Else
PrintLine(1, "Descendants: None")
End If
PrintLine(1)
Next
Primes.Clear()
PrimesR.Clear()
PrintLine(1, "Total descendants " & TotDesc.ToString)
PrintLine(1)
FileClose(1)
End Sub
Function InsertPreorder(_index As Integer, _sum As Short, _prime As Short)
Parents(_sum) = InsertChild(Parents(_sum), Children(_index).Child * _prime)
If Children(_index).pLower Then
InsertPreorder(Children(_index).pLower, _sum, _prime)
End If
If Children(_index).pHigher Then
InsertPreorder(Children(_index).pHigher, _sum, _prime)
End If
Return Nothing
End Function
Function InsertChild(_index As Integer, _child As Long) As Integer
If _index Then
If _child <= Children(_index).Child Then
Children(_index).pLower = InsertChild(Children(_index).pLower, _child)
Else
Children(_index).pHigher = InsertChild(Children(_index).pHigher, _child)
End If
Else
iChildren += 1
_index = iChildren
Children(_index).Child = _child
Children(_index).pLower = 0
Children(_index).pHigher = 0
End If
Return _index
End Function
Function RemoveFalseChildren()
Dim Exclusions As New Collection
Exclusions.Add(4)
For Each Prime In Primes
Exclusions.Add(Prime)
Next
For Each ex In Exclusions
Parents(ex) = Children(Parents(ex)).pHigher
CptDescendants(ex) -= 1
Next
Exclusions.Clear()
Return Nothing
End Function
Function GetAncestors(_child As Short)
Dim Child As Short = _child
Dim Parent As Short = 0
For Each Prime In Primes
If Child = 1 Then
Exit For
End If
While Child Mod Prime = 0
Child /= Prime
Parent += Prime
End While
Next
If Parent = _child Or _child = 1 Then
Return Nothing
End If
GetAncestors(Parent)
Ancestors.Add(Parent)
Return Nothing
End Function
Function PrintDescendants(_index As Integer)
If Children(_index).pLower Then
PrintDescendants(Children(_index).pLower)
End If
Print(1, Delimiter.ToString & Children(_index).Child.ToString)
Delimiter = ", "
If Children(_index).pHigher Then
PrintDescendants(Children(_index).pHigher)
End If
Return Nothing
End Function
Function GetPrimes(ByRef _primes As Object, Optional _maxPrime As Integer = 2) As Boolean
Dim Value As Integer = 3
Dim Max As Integer
Dim Prime As Integer
If _maxPrime < 2 Then
Return vbFalse
End If
_primes.Add(2)
While Value <= _maxPrime
Max = Floor(Sqrt(Value))
For Each Prime In _primes
If Prime > Max Then
_primes.Add(Value)
Exit For
End If
If Value Mod Prime = 0 Then
Exit For
End If
Next
Value += 2
End While
Return vbTrue
End Function
End Module
| #include <algorithm>
#include <iostream>
#include <vector>
typedef unsigned long long integer;
std::vector<integer> get_ancestors(const std::vector<integer>& ancestor, integer n) {
std::vector<integer> result;
for (integer a = ancestor[n]; a != 0 && a != n; ) {
n = a;
a = ancestor[n];
result.push_back(n);
}
return result;
}
void print_vector(const std::vector<integer>& vec) {
if (vec.empty()) {
std::cout << "none\n";
return;
}
auto i = vec.begin();
std::cout << *i++;
for (; i != vec.end(); ++i)
std::cout << ", " << *i;
std::cout << '\n';
}
bool is_prime(integer n) {
if (n < 2)
return false;
if (n % 2 == 0)
return n == 2;
for (integer p = 3; p * p <= n; p += 2) {
if (n % p == 0)
return false;
}
return true;
}
int main(int argc, char** argv) {
const size_t limit = 100;
std::vector<integer> ancestor(limit, 0);
std::vector<std::vector<integer>> descendants(limit);
for (size_t prime = 0; prime < limit; ++prime) {
if (!is_prime(prime))
continue;
descendants[prime].push_back(prime);
for (size_t i = 0; i + prime < limit; ++i) {
integer s = i + prime;
for (integer n : descendants[i]) {
integer prod = n * prime;
descendants[s].push_back(prod);
if (prod < limit)
ancestor[prod] = s;
}
}
}
size_t total_descendants = 0;
for (integer i = 1; i < limit; ++i) {
std::vector<integer> ancestors(get_ancestors(ancestor, i));
std::cout << "[" << i << "] Level: " << ancestors.size() << '\n';
std::cout << "Ancestors: ";
std::sort(ancestors.begin(), ancestors.end());
print_vector(ancestors);
std::cout << "Descendants: ";
std::vector<integer>& desc = descendants[i];
if (!desc.empty()) {
std::sort(desc.begin(), desc.end());
if (desc[0] == i)
desc.erase(desc.begin());
}
std::cout << desc.size() << '\n';
total_descendants += desc.size();
if (!desc.empty())
print_vector(desc);
std::cout << '\n';
}
std::cout << "Total descendants: " << total_descendants << '\n';
return 0;
}
|
Ensure the translated C++ code behaves exactly like the original VB snippet. | Imports System.Runtime.CompilerServices
Module Module1
<Extension()>
Function CartesianProduct(Of T)(sequences As IEnumerable(Of IEnumerable(Of T))) As IEnumerable(Of IEnumerable(Of T))
Dim emptyProduct As IEnumerable(Of IEnumerable(Of T)) = {Enumerable.Empty(Of T)}
Return sequences.Aggregate(emptyProduct, Function(accumulator, sequence) From acc In accumulator From item In sequence Select acc.Concat({item}))
End Function
Sub Main()
Dim empty(-1) As Integer
Dim list1 = {1, 2}
Dim list2 = {3, 4}
Dim list3 = {1776, 1789}
Dim list4 = {7, 12}
Dim list5 = {4, 14, 23}
Dim list6 = {0, 1}
Dim list7 = {1, 2, 3}
Dim list8 = {30}
Dim list9 = {500, 100}
For Each sequnceList As Integer()() In {
({list1, list2}),
({list2, list1}),
({list1, empty}),
({empty, list1}),
({list3, list4, list5, list6}),
({list7, list8, list9}),
({list7, empty, list9})
}
Dim cart = sequnceList.CartesianProduct().Select(Function(tuple) $"({String.Join(", ", tuple)})")
Console.WriteLine($"{{{String.Join(", ", cart)}}}")
Next
End Sub
End Module
| #include <iostream>
#include <vector>
#include <algorithm>
void print(const std::vector<std::vector<int>>& v) {
std::cout << "{ ";
for (const auto& p : v) {
std::cout << "(";
for (const auto& e : p) {
std::cout << e << " ";
}
std::cout << ") ";
}
std::cout << "}" << std::endl;
}
auto product(const std::vector<std::vector<int>>& lists) {
std::vector<std::vector<int>> result;
if (std::find_if(std::begin(lists), std::end(lists),
[](auto e) -> bool { return e.size() == 0; }) != std::end(lists)) {
return result;
}
for (auto& e : lists[0]) {
result.push_back({ e });
}
for (size_t i = 1; i < lists.size(); ++i) {
std::vector<std::vector<int>> temp;
for (auto& e : result) {
for (auto f : lists[i]) {
auto e_tmp = e;
e_tmp.push_back(f);
temp.push_back(e_tmp);
}
}
result = temp;
}
return result;
}
int main() {
std::vector<std::vector<int>> prods[] = {
{ { 1, 2 }, { 3, 4 } },
{ { 3, 4 }, { 1, 2} },
{ { 1, 2 }, { } },
{ { }, { 1, 2 } },
{ { 1776, 1789 }, { 7, 12 }, { 4, 14, 23 }, { 0, 1 } },
{ { 1, 2, 3 }, { 30 }, { 500, 100 } },
{ { 1, 2, 3 }, { }, { 500, 100 } }
};
for (const auto& p : prods) {
print(product(p));
}
std::cin.ignore();
std::cin.get();
return 0;
}
|
Change the programming language of this snippet from VB to C++ without modifying what it does. | Imports System.Runtime.CompilerServices
Module Module1
<Extension()>
Function CartesianProduct(Of T)(sequences As IEnumerable(Of IEnumerable(Of T))) As IEnumerable(Of IEnumerable(Of T))
Dim emptyProduct As IEnumerable(Of IEnumerable(Of T)) = {Enumerable.Empty(Of T)}
Return sequences.Aggregate(emptyProduct, Function(accumulator, sequence) From acc In accumulator From item In sequence Select acc.Concat({item}))
End Function
Sub Main()
Dim empty(-1) As Integer
Dim list1 = {1, 2}
Dim list2 = {3, 4}
Dim list3 = {1776, 1789}
Dim list4 = {7, 12}
Dim list5 = {4, 14, 23}
Dim list6 = {0, 1}
Dim list7 = {1, 2, 3}
Dim list8 = {30}
Dim list9 = {500, 100}
For Each sequnceList As Integer()() In {
({list1, list2}),
({list2, list1}),
({list1, empty}),
({empty, list1}),
({list3, list4, list5, list6}),
({list7, list8, list9}),
({list7, empty, list9})
}
Dim cart = sequnceList.CartesianProduct().Select(Function(tuple) $"({String.Join(", ", tuple)})")
Console.WriteLine($"{{{String.Join(", ", cart)}}}")
Next
End Sub
End Module
| #include <iostream>
#include <vector>
#include <algorithm>
void print(const std::vector<std::vector<int>>& v) {
std::cout << "{ ";
for (const auto& p : v) {
std::cout << "(";
for (const auto& e : p) {
std::cout << e << " ";
}
std::cout << ") ";
}
std::cout << "}" << std::endl;
}
auto product(const std::vector<std::vector<int>>& lists) {
std::vector<std::vector<int>> result;
if (std::find_if(std::begin(lists), std::end(lists),
[](auto e) -> bool { return e.size() == 0; }) != std::end(lists)) {
return result;
}
for (auto& e : lists[0]) {
result.push_back({ e });
}
for (size_t i = 1; i < lists.size(); ++i) {
std::vector<std::vector<int>> temp;
for (auto& e : result) {
for (auto f : lists[i]) {
auto e_tmp = e;
e_tmp.push_back(f);
temp.push_back(e_tmp);
}
}
result = temp;
}
return result;
}
int main() {
std::vector<std::vector<int>> prods[] = {
{ { 1, 2 }, { 3, 4 } },
{ { 3, 4 }, { 1, 2} },
{ { 1, 2 }, { } },
{ { }, { 1, 2 } },
{ { 1776, 1789 }, { 7, 12 }, { 4, 14, 23 }, { 0, 1 } },
{ { 1, 2, 3 }, { 30 }, { 500, 100 } },
{ { 1, 2, 3 }, { }, { 500, 100 } }
};
for (const auto& p : prods) {
print(product(p));
}
std::cin.ignore();
std::cin.get();
return 0;
}
|
Convert this VB snippet to C++ and keep its semantics consistent. | dim _proper_divisors(100)
sub proper_divisors(n)
dim i
dim _proper_divisors_count = 0
if n <> 1 then
for i = 1 to (n \ 2)
if n %% i = 0 then
_proper_divisors_count = _proper_divisors_count + 1
_proper_divisors(_proper_divisors_count) = i
end if
next
end if
return _proper_divisors_count
end sub
sub show_proper_divisors(n, tabbed)
dim cnt = proper_divisors(n)
print str$(n) + ":"; tab(4);"(" + str$(cnt) + " items) ";
dim j
for j = 1 to cnt
if tabbed then
print str$(_proper_divisors(j)),
else
print str$(_proper_divisors(j));
end if
if (j < cnt) then print ",";
next
print
end sub
dim i
for i = 1 to 10
show_proper_divisors(i, false)
next
dim c
dim maxindex = 0
dim maxlength = 0
for t = 1 to 20000
c = proper_divisors(t)
if c > maxlength then
maxindex = t
maxlength = c
end if
next
print "A maximum at ";
show_proper_divisors(maxindex, false)
| #include <vector>
#include <iostream>
#include <algorithm>
std::vector<int> properDivisors ( int number ) {
std::vector<int> divisors ;
for ( int i = 1 ; i < number / 2 + 1 ; i++ )
if ( number % i == 0 )
divisors.push_back( i ) ;
return divisors ;
}
int main( ) {
std::vector<int> divisors ;
unsigned int maxdivisors = 0 ;
int corresponding_number = 0 ;
for ( int i = 1 ; i < 11 ; i++ ) {
divisors = properDivisors ( i ) ;
std::cout << "Proper divisors of " << i << ":\n" ;
for ( int number : divisors ) {
std::cout << number << " " ;
}
std::cout << std::endl ;
divisors.clear( ) ;
}
for ( int i = 11 ; i < 20001 ; i++ ) {
divisors = properDivisors ( i ) ;
if ( divisors.size( ) > maxdivisors ) {
maxdivisors = divisors.size( ) ;
corresponding_number = i ;
}
divisors.clear( ) ;
}
std::cout << "Most divisors has " << corresponding_number <<
" , it has " << maxdivisors << " divisors!\n" ;
return 0 ;
}
|
Maintain the same structure and functionality when rewriting this code in C++. | Module XMLOutput
Sub Main()
Dim charRemarks As New Dictionary(Of String, String)
charRemarks.Add("April", "Bubbly: I
charRemarks.Add("Tam O
charRemarks.Add("Emily", "Short & shrift")
Dim xml = <CharacterRemarks>
<%= From cr In charRemarks Select <Character name=<%= cr.Key %>><%= cr.Value %></Character> %>
</CharacterRemarks>
Console.WriteLine(xml)
End Sub
End Module
| #include <vector>
#include <utility>
#include <iostream>
#include <boost/algorithm/string.hpp>
std::string create_xml( std::vector<std::string> & ,std::vector<std::string> & ) ;
int main( ) {
std::vector<std::string> names , remarks ;
names.push_back( "April" ) ;
names.push_back( "Tam O'Shantor" ) ;
names.push_back ( "Emily" ) ;
remarks.push_back( "Bubbly, I'm > Tam and <= Emily" ) ;
remarks.push_back( "Burns: \"When chapman billies leave the street ...\"" ) ;
remarks.push_back( "Short & shrift" ) ;
std::cout << "This is in XML:\n" ;
std::cout << create_xml( names , remarks ) << std::endl ;
return 0 ;
}
std::string create_xml( std::vector<std::string> & names ,
std::vector<std::string> & remarks ) {
std::vector<std::pair<std::string , std::string> > entities ;
entities.push_back( std::make_pair( "&" , "&" ) ) ;
entities.push_back( std::make_pair( "<" , "<" ) ) ;
entities.push_back( std::make_pair( ">" , ">" ) ) ;
std::string xmlstring ( "<CharacterRemarks>\n" ) ;
std::vector<std::string>::iterator vsi = names.begin( ) ;
typedef std::vector<std::pair<std::string , std::string> >::iterator Vpss ;
for ( ; vsi != names.end( ) ; vsi++ ) {
for ( Vpss vs = entities.begin( ) ; vs != entities.end( ) ; vs++ ) {
boost::replace_all ( *vsi , vs->first , vs->second ) ;
}
}
for ( vsi = remarks.begin( ) ; vsi != remarks.end( ) ; vsi++ ) {
for ( Vpss vs = entities.begin( ) ; vs != entities.end( ) ; vs++ ) {
boost::replace_all ( *vsi , vs->first , vs->second ) ;
}
}
for ( int i = 0 ; i < names.size( ) ; i++ ) {
xmlstring.append( "\t<Character name=\"").append( names[ i ] ).append( "\">")
.append( remarks[ i ] ).append( "</Character>\n" ) ;
}
xmlstring.append( "</CharacterRemarks>" ) ;
return xmlstring ;
}
|
Maintain the same structure and functionality when rewriting this code in C++. | Private Sub plot_coordinate_pairs(x As Variant, y As Variant)
Dim chrt As Chart
Set chrt = ActiveSheet.Shapes.AddChart.Chart
With chrt
.ChartType = xlLine
.HasLegend = False
.HasTitle = True
.ChartTitle.Text = "Time"
.SeriesCollection.NewSeries
.SeriesCollection.Item(1).XValues = x
.SeriesCollection.Item(1).Values = y
.Axes(xlValue, xlPrimary).HasTitle = True
.Axes(xlValue, xlPrimary).AxisTitle.Characters.Text = "microseconds"
End With
End Sub
Public Sub main()
x = [{0, 1, 2, 3, 4, 5, 6, 7, 8, 9}]
y = [{2.7, 2.8, 31.4, 38.1, 58.0, 76.2, 100.5, 130.0, 149.3, 180.0}]
plot_coordinate_pairs x, y
End Sub
| #include <windows.h>
#include <string>
#include <vector>
using namespace std;
const int HSTEP = 46, MWID = 40, MHEI = 471;
const float VSTEP = 2.3f;
class vector2
{
public:
vector2() { x = y = 0; }
vector2( float a, float b ) { x = a; y = b; }
void set( float a, float b ) { x = a; y = b; }
float x, y;
};
class myBitmap
{
public:
myBitmap() : pen( NULL ), brush( NULL ), clr( 0 ), wid( 1 ) {}
~myBitmap()
{
DeleteObject( pen );
DeleteObject( brush );
DeleteDC( hdc );
DeleteObject( bmp );
}
bool create( int w, int h )
{
BITMAPINFO bi;
ZeroMemory( &bi, sizeof( bi ) );
bi.bmiHeader.biSize = sizeof( bi.bmiHeader );
bi.bmiHeader.biBitCount = sizeof( DWORD ) * 8;
bi.bmiHeader.biCompression = BI_RGB;
bi.bmiHeader.biPlanes = 1;
bi.bmiHeader.biWidth = w;
bi.bmiHeader.biHeight = -h;
HDC dc = GetDC( GetConsoleWindow() );
bmp = CreateDIBSection( dc, &bi, DIB_RGB_COLORS, &pBits, NULL, 0 );
if( !bmp ) return false;
hdc = CreateCompatibleDC( dc );
SelectObject( hdc, bmp );
ReleaseDC( GetConsoleWindow(), dc );
width = w; height = h;
return true;
}
void clear( BYTE clr = 0 )
{
memset( pBits, clr, width * height * sizeof( DWORD ) );
}
void setBrushColor( DWORD bClr )
{
if( brush ) DeleteObject( brush );
brush = CreateSolidBrush( bClr );
SelectObject( hdc, brush );
}
void setPenColor( DWORD c ) { clr = c; createPen(); }
void setPenWidth( int w ) { wid = w; createPen(); }
void saveBitmap( string path )
{
BITMAPFILEHEADER fileheader;
BITMAPINFO infoheader;
BITMAP bitmap;
DWORD wb;
GetObject( bmp, sizeof( bitmap ), &bitmap );
DWORD* dwpBits = new DWORD[bitmap.bmWidth * bitmap.bmHeight];
ZeroMemory( dwpBits, bitmap.bmWidth * bitmap.bmHeight * sizeof( DWORD ) );
ZeroMemory( &infoheader, sizeof( BITMAPINFO ) );
ZeroMemory( &fileheader, sizeof( BITMAPFILEHEADER ) );
infoheader.bmiHeader.biBitCount = sizeof( DWORD ) * 8;
infoheader.bmiHeader.biCompression = BI_RGB;
infoheader.bmiHeader.biPlanes = 1;
infoheader.bmiHeader.biSize = sizeof( infoheader.bmiHeader );
infoheader.bmiHeader.biHeight = bitmap.bmHeight;
infoheader.bmiHeader.biWidth = bitmap.bmWidth;
infoheader.bmiHeader.biSizeImage = bitmap.bmWidth * bitmap.bmHeight * sizeof( DWORD );
fileheader.bfType = 0x4D42;
fileheader.bfOffBits = sizeof( infoheader.bmiHeader ) + sizeof( BITMAPFILEHEADER );
fileheader.bfSize = fileheader.bfOffBits + infoheader.bmiHeader.biSizeImage;
GetDIBits( hdc, bmp, 0, height, ( LPVOID )dwpBits, &infoheader, DIB_RGB_COLORS );
HANDLE file = CreateFile( path.c_str(), GENERIC_WRITE, 0, NULL, CREATE_ALWAYS, FILE_ATTRIBUTE_NORMAL, NULL );
WriteFile( file, &fileheader, sizeof( BITMAPFILEHEADER ), &wb, NULL );
WriteFile( file, &infoheader.bmiHeader, sizeof( infoheader.bmiHeader ), &wb, NULL );
WriteFile( file, dwpBits, bitmap.bmWidth * bitmap.bmHeight * 4, &wb, NULL );
CloseHandle( file );
delete [] dwpBits;
}
HDC getDC() const { return hdc; }
int getWidth() const { return width; }
int getHeight() const { return height; }
private:
void createPen()
{
if( pen ) DeleteObject( pen );
pen = CreatePen( PS_SOLID, wid, clr );
SelectObject( hdc, pen );
}
HBITMAP bmp;
HDC hdc;
HPEN pen;
HBRUSH brush;
void *pBits;
int width, height, wid;
DWORD clr;
};
class plot
{
public:
plot() { bmp.create( 512, 512 ); }
void draw( vector<vector2>* pairs )
{
bmp.clear( 0xff );
drawGraph( pairs );
plotIt( pairs );
HDC dc = GetDC( GetConsoleWindow() );
BitBlt( dc, 0, 30, 512, 512, bmp.getDC(), 0, 0, SRCCOPY );
ReleaseDC( GetConsoleWindow(), dc );
}
private:
void drawGraph( vector<vector2>* pairs )
{
HDC dc = bmp.getDC();
bmp.setPenColor( RGB( 240, 240, 240 ) );
DWORD b = 11, c = 40, x;
RECT rc; char txt[8];
for( x = 0; x < pairs->size(); x++ )
{
MoveToEx( dc, 40, b, NULL ); LineTo( dc, 500, b );
MoveToEx( dc, c, 11, NULL ); LineTo( dc, c, 471 );
wsprintf( txt, "%d", ( pairs->size() - x ) * 20 );
SetRect( &rc, 0, b - 9, 36, b + 11 );
DrawText( dc, txt, lstrlen( txt ), &rc, DT_RIGHT | DT_VCENTER | DT_SINGLELINE );
wsprintf( txt, "%d", x );
SetRect( &rc, c - 8, 472, c + 8, 492 );
DrawText( dc, txt, lstrlen( txt ), &rc, DT_CENTER | DT_VCENTER | DT_SINGLELINE );
c += 46; b += 46;
}
SetRect( &rc, 0, b - 9, 36, b + 11 );
DrawText( dc, "0", 1, &rc, DT_RIGHT | DT_VCENTER | DT_SINGLELINE );
bmp.setPenColor( 0 ); bmp.setPenWidth( 3 );
MoveToEx( dc, 40, 11, NULL ); LineTo( dc, 40, 471 );
MoveToEx( dc, 40, 471, NULL ); LineTo( dc, 500, 471 );
}
void plotIt( vector<vector2>* pairs )
{
HDC dc = bmp.getDC();
HBRUSH br = CreateSolidBrush( 255 );
RECT rc;
bmp.setPenColor( 255 ); bmp.setPenWidth( 2 );
vector<vector2>::iterator it = pairs->begin();
int a = MWID + HSTEP * static_cast<int>( ( *it ).x ), b = MHEI - static_cast<int>( VSTEP * ( *it ).y );
MoveToEx( dc, a, b, NULL );
SetRect( &rc, a - 3, b - 3, a + 3, b + 3 ); FillRect( dc, &rc, br );
it++;
for( ; it < pairs->end(); it++ )
{
a = MWID + HSTEP * static_cast<int>( ( *it ).x );
b = MHEI - static_cast<int>( VSTEP * ( *it ).y );
SetRect( &rc, a - 3, b - 3, a + 3, b + 3 );
FillRect( dc, &rc, br ); LineTo( dc, a, b );
}
DeleteObject( br );
}
myBitmap bmp;
};
int main( int argc, char* argv[] )
{
ShowWindow( GetConsoleWindow(), SW_MAXIMIZE );
plot pt;
vector<vector2> pairs;
pairs.push_back( vector2( 0, 2.7f ) ); pairs.push_back( vector2( 1, 2.8f ) );
pairs.push_back( vector2( 2.0f, 31.4f ) ); pairs.push_back( vector2( 3.0f, 38.1f ) );
pairs.push_back( vector2( 4.0f, 58.0f ) ); pairs.push_back( vector2( 5.0f, 76.2f ) );
pairs.push_back( vector2( 6.0f, 100.5f ) ); pairs.push_back( vector2( 7.0f, 130.0f ) );
pairs.push_back( vector2( 8.0f, 149.3f ) ); pairs.push_back( vector2( 9.0f, 180.0f ) );
pt.draw( &pairs );
system( "pause" );
return 0;
}
|
Port the provided VB code into C++ while preserving the original functionality. | Private Sub plot_coordinate_pairs(x As Variant, y As Variant)
Dim chrt As Chart
Set chrt = ActiveSheet.Shapes.AddChart.Chart
With chrt
.ChartType = xlLine
.HasLegend = False
.HasTitle = True
.ChartTitle.Text = "Time"
.SeriesCollection.NewSeries
.SeriesCollection.Item(1).XValues = x
.SeriesCollection.Item(1).Values = y
.Axes(xlValue, xlPrimary).HasTitle = True
.Axes(xlValue, xlPrimary).AxisTitle.Characters.Text = "microseconds"
End With
End Sub
Public Sub main()
x = [{0, 1, 2, 3, 4, 5, 6, 7, 8, 9}]
y = [{2.7, 2.8, 31.4, 38.1, 58.0, 76.2, 100.5, 130.0, 149.3, 180.0}]
plot_coordinate_pairs x, y
End Sub
| #include <windows.h>
#include <string>
#include <vector>
using namespace std;
const int HSTEP = 46, MWID = 40, MHEI = 471;
const float VSTEP = 2.3f;
class vector2
{
public:
vector2() { x = y = 0; }
vector2( float a, float b ) { x = a; y = b; }
void set( float a, float b ) { x = a; y = b; }
float x, y;
};
class myBitmap
{
public:
myBitmap() : pen( NULL ), brush( NULL ), clr( 0 ), wid( 1 ) {}
~myBitmap()
{
DeleteObject( pen );
DeleteObject( brush );
DeleteDC( hdc );
DeleteObject( bmp );
}
bool create( int w, int h )
{
BITMAPINFO bi;
ZeroMemory( &bi, sizeof( bi ) );
bi.bmiHeader.biSize = sizeof( bi.bmiHeader );
bi.bmiHeader.biBitCount = sizeof( DWORD ) * 8;
bi.bmiHeader.biCompression = BI_RGB;
bi.bmiHeader.biPlanes = 1;
bi.bmiHeader.biWidth = w;
bi.bmiHeader.biHeight = -h;
HDC dc = GetDC( GetConsoleWindow() );
bmp = CreateDIBSection( dc, &bi, DIB_RGB_COLORS, &pBits, NULL, 0 );
if( !bmp ) return false;
hdc = CreateCompatibleDC( dc );
SelectObject( hdc, bmp );
ReleaseDC( GetConsoleWindow(), dc );
width = w; height = h;
return true;
}
void clear( BYTE clr = 0 )
{
memset( pBits, clr, width * height * sizeof( DWORD ) );
}
void setBrushColor( DWORD bClr )
{
if( brush ) DeleteObject( brush );
brush = CreateSolidBrush( bClr );
SelectObject( hdc, brush );
}
void setPenColor( DWORD c ) { clr = c; createPen(); }
void setPenWidth( int w ) { wid = w; createPen(); }
void saveBitmap( string path )
{
BITMAPFILEHEADER fileheader;
BITMAPINFO infoheader;
BITMAP bitmap;
DWORD wb;
GetObject( bmp, sizeof( bitmap ), &bitmap );
DWORD* dwpBits = new DWORD[bitmap.bmWidth * bitmap.bmHeight];
ZeroMemory( dwpBits, bitmap.bmWidth * bitmap.bmHeight * sizeof( DWORD ) );
ZeroMemory( &infoheader, sizeof( BITMAPINFO ) );
ZeroMemory( &fileheader, sizeof( BITMAPFILEHEADER ) );
infoheader.bmiHeader.biBitCount = sizeof( DWORD ) * 8;
infoheader.bmiHeader.biCompression = BI_RGB;
infoheader.bmiHeader.biPlanes = 1;
infoheader.bmiHeader.biSize = sizeof( infoheader.bmiHeader );
infoheader.bmiHeader.biHeight = bitmap.bmHeight;
infoheader.bmiHeader.biWidth = bitmap.bmWidth;
infoheader.bmiHeader.biSizeImage = bitmap.bmWidth * bitmap.bmHeight * sizeof( DWORD );
fileheader.bfType = 0x4D42;
fileheader.bfOffBits = sizeof( infoheader.bmiHeader ) + sizeof( BITMAPFILEHEADER );
fileheader.bfSize = fileheader.bfOffBits + infoheader.bmiHeader.biSizeImage;
GetDIBits( hdc, bmp, 0, height, ( LPVOID )dwpBits, &infoheader, DIB_RGB_COLORS );
HANDLE file = CreateFile( path.c_str(), GENERIC_WRITE, 0, NULL, CREATE_ALWAYS, FILE_ATTRIBUTE_NORMAL, NULL );
WriteFile( file, &fileheader, sizeof( BITMAPFILEHEADER ), &wb, NULL );
WriteFile( file, &infoheader.bmiHeader, sizeof( infoheader.bmiHeader ), &wb, NULL );
WriteFile( file, dwpBits, bitmap.bmWidth * bitmap.bmHeight * 4, &wb, NULL );
CloseHandle( file );
delete [] dwpBits;
}
HDC getDC() const { return hdc; }
int getWidth() const { return width; }
int getHeight() const { return height; }
private:
void createPen()
{
if( pen ) DeleteObject( pen );
pen = CreatePen( PS_SOLID, wid, clr );
SelectObject( hdc, pen );
}
HBITMAP bmp;
HDC hdc;
HPEN pen;
HBRUSH brush;
void *pBits;
int width, height, wid;
DWORD clr;
};
class plot
{
public:
plot() { bmp.create( 512, 512 ); }
void draw( vector<vector2>* pairs )
{
bmp.clear( 0xff );
drawGraph( pairs );
plotIt( pairs );
HDC dc = GetDC( GetConsoleWindow() );
BitBlt( dc, 0, 30, 512, 512, bmp.getDC(), 0, 0, SRCCOPY );
ReleaseDC( GetConsoleWindow(), dc );
}
private:
void drawGraph( vector<vector2>* pairs )
{
HDC dc = bmp.getDC();
bmp.setPenColor( RGB( 240, 240, 240 ) );
DWORD b = 11, c = 40, x;
RECT rc; char txt[8];
for( x = 0; x < pairs->size(); x++ )
{
MoveToEx( dc, 40, b, NULL ); LineTo( dc, 500, b );
MoveToEx( dc, c, 11, NULL ); LineTo( dc, c, 471 );
wsprintf( txt, "%d", ( pairs->size() - x ) * 20 );
SetRect( &rc, 0, b - 9, 36, b + 11 );
DrawText( dc, txt, lstrlen( txt ), &rc, DT_RIGHT | DT_VCENTER | DT_SINGLELINE );
wsprintf( txt, "%d", x );
SetRect( &rc, c - 8, 472, c + 8, 492 );
DrawText( dc, txt, lstrlen( txt ), &rc, DT_CENTER | DT_VCENTER | DT_SINGLELINE );
c += 46; b += 46;
}
SetRect( &rc, 0, b - 9, 36, b + 11 );
DrawText( dc, "0", 1, &rc, DT_RIGHT | DT_VCENTER | DT_SINGLELINE );
bmp.setPenColor( 0 ); bmp.setPenWidth( 3 );
MoveToEx( dc, 40, 11, NULL ); LineTo( dc, 40, 471 );
MoveToEx( dc, 40, 471, NULL ); LineTo( dc, 500, 471 );
}
void plotIt( vector<vector2>* pairs )
{
HDC dc = bmp.getDC();
HBRUSH br = CreateSolidBrush( 255 );
RECT rc;
bmp.setPenColor( 255 ); bmp.setPenWidth( 2 );
vector<vector2>::iterator it = pairs->begin();
int a = MWID + HSTEP * static_cast<int>( ( *it ).x ), b = MHEI - static_cast<int>( VSTEP * ( *it ).y );
MoveToEx( dc, a, b, NULL );
SetRect( &rc, a - 3, b - 3, a + 3, b + 3 ); FillRect( dc, &rc, br );
it++;
for( ; it < pairs->end(); it++ )
{
a = MWID + HSTEP * static_cast<int>( ( *it ).x );
b = MHEI - static_cast<int>( VSTEP * ( *it ).y );
SetRect( &rc, a - 3, b - 3, a + 3, b + 3 );
FillRect( dc, &rc, br ); LineTo( dc, a, b );
}
DeleteObject( br );
}
myBitmap bmp;
};
int main( int argc, char* argv[] )
{
ShowWindow( GetConsoleWindow(), SW_MAXIMIZE );
plot pt;
vector<vector2> pairs;
pairs.push_back( vector2( 0, 2.7f ) ); pairs.push_back( vector2( 1, 2.8f ) );
pairs.push_back( vector2( 2.0f, 31.4f ) ); pairs.push_back( vector2( 3.0f, 38.1f ) );
pairs.push_back( vector2( 4.0f, 58.0f ) ); pairs.push_back( vector2( 5.0f, 76.2f ) );
pairs.push_back( vector2( 6.0f, 100.5f ) ); pairs.push_back( vector2( 7.0f, 130.0f ) );
pairs.push_back( vector2( 8.0f, 149.3f ) ); pairs.push_back( vector2( 9.0f, 180.0f ) );
pt.draw( &pairs );
system( "pause" );
return 0;
}
|
Generate an equivalent C++ version of this VB code. | text = "I need more coffee!!!"
Set regex = New RegExp
regex.Global = True
regex.Pattern = "\s"
If regex.Test(text) Then
WScript.StdOut.Write regex.Replace(text,vbCrLf)
Else
WScript.StdOut.Write "No matching pattern"
End If
| #include <iostream>
#include <string>
#include <iterator>
#include <regex>
int main()
{
std::regex re(".* string$");
std::string s = "Hi, I am a string";
if (std::regex_match(s, re))
std::cout << "The string matches.\n";
else
std::cout << "Oops - not found?\n";
std::regex re2(" a.*a");
std::smatch match;
if (std::regex_search(s, match, re2))
{
std::cout << "Matched " << match.length()
<< " characters starting at " << match.position() << ".\n";
std::cout << "Matched character sequence: \""
<< match.str() << "\"\n";
}
else
{
std::cout << "Oops - not found?\n";
}
std::string dest_string;
std::regex_replace(std::back_inserter(dest_string),
s.begin(), s.end(),
re2,
"'m now a changed");
std::cout << dest_string << std::endl;
}
|
Ensure the translated C++ code behaves exactly like the original VB snippet. | Set dict = CreateObject("Scripting.Dictionary")
os = Array("Windows", "Linux", "MacOS")
owner = Array("Microsoft", "Linus Torvalds", "Apple")
For n = 0 To 2
dict.Add os(n), owner(n)
Next
MsgBox dict.Item("Linux")
MsgBox dict.Item("MacOS")
MsgBox dict.Item("Windows")
| #include <unordered_map>
#include <string>
int main()
{
std::string keys[] = { "1", "2", "3" };
std::string vals[] = { "a", "b", "c" };
std::unordered_map<std::string, std::string> hash;
for( int i = 0 ; i < 3 ; i++ )
hash[ keys[i] ] = vals[i] ;
}
|
Preserve the algorithm and functionality while converting the code from VB to C++. | Public Class Main
Inherits System.Windows.Forms.Form
Public Sub New()
Me.FormBorderStyle = FormBorderStyle.None
Me.WindowState = FormWindowState.Maximized
End Sub
Private Sub Main_Load(sender As Object, e As EventArgs) Handles Me.Load
Dim Index As Integer
Dim Colors() As Color = {Color.Black, Color.Red, Color.Green, Color.Magenta, Color.Cyan, Color.Yellow, Color.White}
Dim Height = (Me.ClientSize.Height / 4) + 1
For y = 1 To 4
Dim Top = Me.ClientSize.Height / 4 * (y - 1)
For x = 0 To Me.ClientSize.Width Step y
If Index = 6 Then Index = 0 Else Index += 1
Me.Controls.Add(New Panel With {.Top = Top, .Height = Height, .Left = x, .Width = y, .BackColor = Colors(Index)})
Next
Next
End Sub
End Class
| #include <windows.h>
class pinstripe
{
public:
pinstripe() { createColors(); }
void setDimensions( int x, int y ) { _mw = x; _mh = y; }
void createColors()
{
colors[0] = 0; colors[1] = 255; colors[2] = RGB( 0, 255, 0 );
colors[3] = RGB( 0, 0, 255 ); colors[4] = RGB( 255, 0, 255 );
colors[5] = RGB( 0, 255, 255 ); colors[6] = RGB( 255, 255, 0 );
colors[7] = RGB( 255, 255, 255 );
}
void draw( HDC dc )
{
HPEN pen;
int lh = _mh / 4, row, cp;
for( int lw = 1; lw < 5; lw++ )
{
cp = 0;
row = ( lw - 1 ) * lh;
for( int x = 0 + lw > 1 ? lw > 3 ? 2 : 1 : 0; x < _mw; x += lw )
{
pen = CreatePen( PS_SOLID, lw, colors[cp] );
++cp %= 8;
SelectObject( dc, pen );
MoveToEx( dc, x, row, NULL );
LineTo( dc, x, row + lh );
DeleteObject( pen );
}
}
}
private:
int _mw, _mh;
DWORD colors[8];
};
pinstripe pin;
void PaintWnd( HWND hWnd )
{
PAINTSTRUCT ps;
HDC hdc = BeginPaint( hWnd, &ps );
pin.draw( hdc );
EndPaint( hWnd, &ps );
}
LRESULT CALLBACK WndProc( HWND hWnd, UINT msg, WPARAM wParam, LPARAM lParam )
{
switch( msg )
{
case WM_DESTROY: PostQuitMessage( 0 ); break;
case WM_PAINT: PaintWnd( hWnd ); break;
default:
return DefWindowProc( hWnd, msg, wParam, lParam );
}
return 0;
}
HWND InitAll( HINSTANCE hInstance )
{
WNDCLASSEX wcex;
ZeroMemory( &wcex, sizeof( wcex ) );
wcex.cbSize = sizeof( WNDCLASSEX );
wcex.style = CS_HREDRAW | CS_VREDRAW;
wcex.lpfnWndProc = WndProc;
wcex.hInstance = hInstance;
wcex.hCursor = LoadCursor( NULL, IDC_ARROW );
wcex.hbrBackground = ( HBRUSH )( COLOR_WINDOW + 1 );
wcex.lpszClassName = "_CLR_PS_";
RegisterClassEx( &wcex );
return CreateWindow( "_CLR_PS_", ".: Clr Pinstripe -- PJorente :.", WS_POPUP, CW_USEDEFAULT, 0, 200, 200, NULL, NULL, hInstance, NULL );
}
int APIENTRY _tWinMain( HINSTANCE hInstance, HINSTANCE hPrevInstance, LPTSTR lpCmdLine, int nCmdShow )
{
srand( GetTickCount() );
HWND hwnd = InitAll( hInstance );
if( !hwnd ) return -1;
int mw = GetSystemMetrics( SM_CXSCREEN ),
mh = GetSystemMetrics( SM_CYSCREEN );
pin.setDimensions( mw, mh );
RECT rc = { 0, 0, mw, mh };
AdjustWindowRectEx( &rc, WS_POPUP, FALSE, 0 );
int w = rc.right - rc.left,
h = rc.bottom - rc.top;
int posX = ( GetSystemMetrics( SM_CXSCREEN ) >> 1 ) - ( w >> 1 ),
posY = ( GetSystemMetrics( SM_CYSCREEN ) >> 1 ) - ( h >> 1 );
SetWindowPos( hwnd, HWND_TOP, posX, posY, w, h, SWP_NOZORDER );
ShowWindow( hwnd, nCmdShow );
UpdateWindow( hwnd );
MSG msg;
ZeroMemory( &msg, sizeof( msg ) );
while( msg.message != WM_QUIT )
{
if( PeekMessage( &msg, NULL, 0, 0, PM_REMOVE ) != 0 )
{
TranslateMessage( &msg );
DispatchMessage( &msg );
}
}
return UnregisterClass( "_CLR_PS_", hInstance );
}
|
Write a version of this VB function in C++ with identical behavior. | Public Class Main
Inherits System.Windows.Forms.Form
Public Sub New()
Me.FormBorderStyle = FormBorderStyle.None
Me.WindowState = FormWindowState.Maximized
End Sub
Private Sub Main_Load(sender As Object, e As EventArgs) Handles Me.Load
Dim Index As Integer
Dim Colors() As Color = {Color.Black, Color.Red, Color.Green, Color.Magenta, Color.Cyan, Color.Yellow, Color.White}
Dim Height = (Me.ClientSize.Height / 4) + 1
For y = 1 To 4
Dim Top = Me.ClientSize.Height / 4 * (y - 1)
For x = 0 To Me.ClientSize.Width Step y
If Index = 6 Then Index = 0 Else Index += 1
Me.Controls.Add(New Panel With {.Top = Top, .Height = Height, .Left = x, .Width = y, .BackColor = Colors(Index)})
Next
Next
End Sub
End Class
| #include <windows.h>
class pinstripe
{
public:
pinstripe() { createColors(); }
void setDimensions( int x, int y ) { _mw = x; _mh = y; }
void createColors()
{
colors[0] = 0; colors[1] = 255; colors[2] = RGB( 0, 255, 0 );
colors[3] = RGB( 0, 0, 255 ); colors[4] = RGB( 255, 0, 255 );
colors[5] = RGB( 0, 255, 255 ); colors[6] = RGB( 255, 255, 0 );
colors[7] = RGB( 255, 255, 255 );
}
void draw( HDC dc )
{
HPEN pen;
int lh = _mh / 4, row, cp;
for( int lw = 1; lw < 5; lw++ )
{
cp = 0;
row = ( lw - 1 ) * lh;
for( int x = 0 + lw > 1 ? lw > 3 ? 2 : 1 : 0; x < _mw; x += lw )
{
pen = CreatePen( PS_SOLID, lw, colors[cp] );
++cp %= 8;
SelectObject( dc, pen );
MoveToEx( dc, x, row, NULL );
LineTo( dc, x, row + lh );
DeleteObject( pen );
}
}
}
private:
int _mw, _mh;
DWORD colors[8];
};
pinstripe pin;
void PaintWnd( HWND hWnd )
{
PAINTSTRUCT ps;
HDC hdc = BeginPaint( hWnd, &ps );
pin.draw( hdc );
EndPaint( hWnd, &ps );
}
LRESULT CALLBACK WndProc( HWND hWnd, UINT msg, WPARAM wParam, LPARAM lParam )
{
switch( msg )
{
case WM_DESTROY: PostQuitMessage( 0 ); break;
case WM_PAINT: PaintWnd( hWnd ); break;
default:
return DefWindowProc( hWnd, msg, wParam, lParam );
}
return 0;
}
HWND InitAll( HINSTANCE hInstance )
{
WNDCLASSEX wcex;
ZeroMemory( &wcex, sizeof( wcex ) );
wcex.cbSize = sizeof( WNDCLASSEX );
wcex.style = CS_HREDRAW | CS_VREDRAW;
wcex.lpfnWndProc = WndProc;
wcex.hInstance = hInstance;
wcex.hCursor = LoadCursor( NULL, IDC_ARROW );
wcex.hbrBackground = ( HBRUSH )( COLOR_WINDOW + 1 );
wcex.lpszClassName = "_CLR_PS_";
RegisterClassEx( &wcex );
return CreateWindow( "_CLR_PS_", ".: Clr Pinstripe -- PJorente :.", WS_POPUP, CW_USEDEFAULT, 0, 200, 200, NULL, NULL, hInstance, NULL );
}
int APIENTRY _tWinMain( HINSTANCE hInstance, HINSTANCE hPrevInstance, LPTSTR lpCmdLine, int nCmdShow )
{
srand( GetTickCount() );
HWND hwnd = InitAll( hInstance );
if( !hwnd ) return -1;
int mw = GetSystemMetrics( SM_CXSCREEN ),
mh = GetSystemMetrics( SM_CYSCREEN );
pin.setDimensions( mw, mh );
RECT rc = { 0, 0, mw, mh };
AdjustWindowRectEx( &rc, WS_POPUP, FALSE, 0 );
int w = rc.right - rc.left,
h = rc.bottom - rc.top;
int posX = ( GetSystemMetrics( SM_CXSCREEN ) >> 1 ) - ( w >> 1 ),
posY = ( GetSystemMetrics( SM_CYSCREEN ) >> 1 ) - ( h >> 1 );
SetWindowPos( hwnd, HWND_TOP, posX, posY, w, h, SWP_NOZORDER );
ShowWindow( hwnd, nCmdShow );
UpdateWindow( hwnd );
MSG msg;
ZeroMemory( &msg, sizeof( msg ) );
while( msg.message != WM_QUIT )
{
if( PeekMessage( &msg, NULL, 0, 0, PM_REMOVE ) != 0 )
{
TranslateMessage( &msg );
DispatchMessage( &msg );
}
}
return UnregisterClass( "_CLR_PS_", hInstance );
}
|
Produce a language-to-language conversion: from VB to C++, same semantics. |
Function cocktailShakerSort(ByVal A As Variant) As Variant
beginIdx = LBound(A)
endIdx = UBound(A) - 1
Do While beginIdx <= endIdx
newBeginIdx = endIdx
newEndIdx = beginIdx
For ii = beginIdx To endIdx
If A(ii) > A(ii + 1) Then
tmp = A(ii): A(ii) = A(ii + 1): A(ii + 1) = tmp
newEndIdx = ii
End If
Next ii
endIdx = newEndIdx - 1
For ii = endIdx To beginIdx Step -1
If A(ii) > A(ii + 1) Then
tmp = A(ii): A(ii) = A(ii + 1): A(ii + 1) = tmp
newBeginIdx = ii
End If
Next ii
beginIdx = newBeginIdx + 1
Loop
cocktailShakerSort = A
End Function
Public Sub main()
Dim B(20) As Variant
For i = LBound(B) To UBound(B)
B(i) = Int(Rnd() * 100)
Next i
Debug.Print Join(B, ", ")
Debug.Print Join(cocktailShakerSort(B), ", ")
End Sub
| #include <algorithm>
#include <cassert>
#include <iostream>
#include <iterator>
#include <vector>
template <typename iterator>
void cocktail_shaker_sort(iterator begin, iterator end) {
if (begin == end)
return;
for (--end; begin < end; ) {
iterator new_begin = end;
iterator new_end = begin;
for (iterator i = begin; i < end; ++i) {
iterator j = i + 1;
if (*j < *i) {
std::iter_swap(i, j);
new_end = i;
}
}
end = new_end;
for (iterator i = end; i > begin; --i) {
iterator j = i - 1;
if (*i < *j) {
std::iter_swap(i, j);
new_begin = i;
}
}
begin = new_begin;
}
}
template <typename iterator>
void print(iterator begin, iterator end) {
if (begin == end)
return;
std::cout << *begin++;
while (begin != end)
std::cout << ' ' << *begin++;
std::cout << '\n';
}
int main() {
std::vector<int> v{5, 1, -6, 12, 3, 13, 2, 4, 0, 15};
std::cout << "before: ";
print(v.begin(), v.end());
cocktail_shaker_sort(v.begin(), v.end());
assert(std::is_sorted(v.begin(), v.end()));
std::cout << "after: ";
print(v.begin(), v.end());
return 0;
}
|
Maintain the same structure and functionality when rewriting this code in C++. | option explicit
const dt = 0.15
const length=23
dim ans0:ans0=chr(27)&"["
dim Veloc,Accel,angle,olr,olc,r,c
const r0=1
const c0=40
cls
angle=0.7
while 1
wscript.sleep(50)
Accel = -.9 * sin(Angle)
Veloc = Veloc + Accel * dt
Angle = Angle + Veloc * dt
r = r0 + int(cos(Angle) * Length)
c = c0+ int(2*sin(Angle) * Length)
cls
draw_line r,c,r0,c0
toxy r,c,"O"
olr=r :olc=c
wend
sub cls() wscript.StdOut.Write ans0 &"2J"&ans0 &"?25l":end sub
sub toxy(r,c,s) wscript.StdOut.Write ans0 & r & ";" & c & "f" & s :end sub
Sub draw_line(r1,c1, r2,c2)
Dim x,y,xf,yf,dx,dy,sx,sy,err,err2
x =r1 : y =c1
xf=r2 : yf=c2
dx=Abs(xf-x) : dy=Abs(yf-y)
If x<xf Then sx=+1: Else sx=-1
If y<yf Then sy=+1: Else sy=-1
err=dx-dy
Do
toxy x,y,"."
If x=xf And y=yf Then Exit Do
err2=err+err
If err2>-dy Then err=err-dy: x=x+sx
If err2< dx Then err=err+dx: y=y+sy
Loop
End Sub
| #ifndef __wxPendulumDlg_h__
#define __wxPendulumDlg_h__
#ifdef __BORLANDC__
#pragma hdrstop
#endif
#ifndef WX_PRECOMP
#include <wx/wx.h>
#include <wx/dialog.h>
#else
#include <wx/wxprec.h>
#endif
#include <wx/timer.h>
#include <wx/dcbuffer.h>
#include <cmath>
class wxPendulumDlgApp : public wxApp
{
public:
bool OnInit();
int OnExit();
};
class wxPendulumDlg : public wxDialog
{
public:
wxPendulumDlg(wxWindow *parent, wxWindowID id = 1, const wxString &title = wxT("wxPendulum"),
const wxPoint& pos = wxDefaultPosition, const wxSize& size = wxDefaultSize,
long style = wxSUNKEN_BORDER | wxCAPTION | wxRESIZE_BORDER | wxSYSTEM_MENU | wxDIALOG_NO_PARENT | wxMINIMIZE_BOX | wxMAXIMIZE_BOX | wxCLOSE_BOX);
virtual ~wxPendulumDlg();
void wxPendulumDlgPaint(wxPaintEvent& event);
void wxPendulumDlgSize(wxSizeEvent& event);
void OnTimer(wxTimerEvent& event);
private:
wxTimer *m_timer;
unsigned int m_uiLength;
double m_Angle;
double m_AngleVelocity;
enum wxIDs
{
ID_WXTIMER1 = 1001,
ID_DUMMY_VALUE_
};
void OnClose(wxCloseEvent& event);
void CreateGUIControls();
DECLARE_EVENT_TABLE()
};
#endif
|
Write the same algorithm in C++ as shown in this VB implementation. | Function Encoder(ByVal n)
Encoder = n Xor (n \ 2)
End Function
Function Decoder(ByVal n)
Dim g : g = 0
Do While n > 0
g = g Xor n
n = n \ 2
Loop
Decoder = g
End Function
Function Dec2bin(ByVal n, ByVal length)
Dim i, strbin : strbin = ""
For i = 1 to 5
strbin = (n Mod 2) & strbin
n = n \ 2
Next
Dec2Bin = strbin
End Function
WScript.StdOut.WriteLine("Binary -> Gray Code -> Binary")
For i = 0 to 31
encoded = Encoder(i)
decoded = Decoder(encoded)
WScript.StdOut.WriteLine(Dec2Bin(i, 5) & " -> " & Dec2Bin(encoded, 5) & " -> " & Dec2Bin(decoded, 5))
Next
| #include <bitset>
#include <iostream>
#include <string>
#include <assert.h>
uint32_t gray_encode(uint32_t b)
{
return b ^ (b >> 1);
}
uint32_t gray_decode(uint32_t g)
{
for (uint32_t bit = 1U << 31; bit > 1; bit >>= 1)
{
if (g & bit) g ^= bit >> 1;
}
return g;
}
std::string to_binary(int value)
{
const std::bitset<32> bs(value);
const std::string str(bs.to_string());
const size_t pos(str.find('1'));
return pos == std::string::npos ? "0" : str.substr(pos);
}
int main()
{
std::cout << "Number\tBinary\tGray\tDecoded\n";
for (uint32_t n = 0; n < 32; ++n)
{
uint32_t g = gray_encode(n);
assert(gray_decode(g) == n);
std::cout << n << "\t" << to_binary(n) << "\t" << to_binary(g) << "\t" << g << "\n";
}
}
|
Ensure the translated C++ code behaves exactly like the original VB snippet. | Function Encoder(ByVal n)
Encoder = n Xor (n \ 2)
End Function
Function Decoder(ByVal n)
Dim g : g = 0
Do While n > 0
g = g Xor n
n = n \ 2
Loop
Decoder = g
End Function
Function Dec2bin(ByVal n, ByVal length)
Dim i, strbin : strbin = ""
For i = 1 to 5
strbin = (n Mod 2) & strbin
n = n \ 2
Next
Dec2Bin = strbin
End Function
WScript.StdOut.WriteLine("Binary -> Gray Code -> Binary")
For i = 0 to 31
encoded = Encoder(i)
decoded = Decoder(encoded)
WScript.StdOut.WriteLine(Dec2Bin(i, 5) & " -> " & Dec2Bin(encoded, 5) & " -> " & Dec2Bin(decoded, 5))
Next
| #include <bitset>
#include <iostream>
#include <string>
#include <assert.h>
uint32_t gray_encode(uint32_t b)
{
return b ^ (b >> 1);
}
uint32_t gray_decode(uint32_t g)
{
for (uint32_t bit = 1U << 31; bit > 1; bit >>= 1)
{
if (g & bit) g ^= bit >> 1;
}
return g;
}
std::string to_binary(int value)
{
const std::bitset<32> bs(value);
const std::string str(bs.to_string());
const size_t pos(str.find('1'));
return pos == std::string::npos ? "0" : str.substr(pos);
}
int main()
{
std::cout << "Number\tBinary\tGray\tDecoded\n";
for (uint32_t n = 0; n < 32; ++n)
{
uint32_t g = gray_encode(n);
assert(gray_decode(g) == n);
std::cout << n << "\t" << to_binary(n) << "\t" << to_binary(g) << "\t" << g << "\n";
}
}
|
Can you help me rewrite this code in C++ instead of VB, keeping it the same logically? | class playingcard
dim suit
dim pips
end class
class carddeck
private suitnames
private pipnames
private cardno
private deck(52)
private nTop
sub class_initialize
dim suit
dim pips
suitnames = split("H,D,C,S",",")
pipnames = split("A,2,3,4,5,6,7,8,9,10,J,Q,K",",")
cardno = 0
for suit = 1 to 4
for pips = 1 to 13
set deck(cardno) = new playingcard
deck(cardno).suit = suitnames(suit-1)
deck(cardno).pips = pipnames(pips-1)
cardno = cardno + 1
next
next
nTop = 0
end sub
public sub showdeck
dim a
redim a(51-nTop)
for i = nTop to 51
a(i) = deck(i).pips & deck(i).suit
next
wscript.echo join( a, ", ")
end sub
public sub shuffle
dim r
randomize timer
for i = nTop to 51
r = int( rnd * ( 52 - nTop ) )
if r <> i then
objswap deck(i),deck(r)
end if
next
end sub
public function deal()
set deal = deck( nTop )
nTop = nTop + 1
end function
public property get cardsRemaining
cardsRemaining = 52 - nTop
end property
private sub objswap( a, b )
dim tmp
set tmp = a
set a = b
set b = tmp
end sub
end class
| #include <deque>
#include <algorithm>
#include <ostream>
#include <iterator>
namespace cards
{
class card
{
public:
enum pip_type { two, three, four, five, six, seven, eight, nine, ten,
jack, queen, king, ace, pip_count };
enum suite_type { hearts, spades, diamonds, clubs, suite_count };
enum { unique_count = pip_count * suite_count };
card(suite_type s, pip_type p): value(s + suite_count * p) {}
explicit card(unsigned char v = 0): value(v) {}
pip_type pip() { return pip_type(value / suite_count); }
suite_type suite() { return suite_type(value % suite_count); }
private:
unsigned char value;
};
const char* const pip_names[] =
{ "two", "three", "four", "five", "six", "seven", "eight", "nine", "ten",
"jack", "queen", "king", "ace" };
std::ostream& operator<<(std::ostream& os, card::pip_type pip)
{
return os << pip_names[pip];
}
const char* const suite_names[] =
{ "hearts", "spades", "diamonds", "clubs" };
std::ostream& operator<<(std::ostream& os, card::suite_type suite)
{
return os << suite_names[suite];
}
std::ostream& operator<<(std::ostream& os, card c)
{
return os << c.pip() << " of " << c.suite();
}
class deck
{
public:
deck()
{
for (int i = 0; i < card::unique_count; ++i) {
cards.push_back(card(i));
}
}
void shuffle() { std::random_shuffle(cards.begin(), cards.end()); }
card deal() { card c = cards.front(); cards.pop_front(); return c; }
typedef std::deque<card>::const_iterator const_iterator;
const_iterator begin() const { return cards.cbegin(); }
const_iterator end() const { return cards.cend(); }
private:
std::deque<card> cards;
};
inline std::ostream& operator<<(std::ostream& os, const deck& d)
{
std::copy(d.begin(), d.end(), std::ostream_iterator<card>(os, "\n"));
return os;
}
}
|
Write the same code in C++ as shown below in VB. | class playingcard
dim suit
dim pips
end class
class carddeck
private suitnames
private pipnames
private cardno
private deck(52)
private nTop
sub class_initialize
dim suit
dim pips
suitnames = split("H,D,C,S",",")
pipnames = split("A,2,3,4,5,6,7,8,9,10,J,Q,K",",")
cardno = 0
for suit = 1 to 4
for pips = 1 to 13
set deck(cardno) = new playingcard
deck(cardno).suit = suitnames(suit-1)
deck(cardno).pips = pipnames(pips-1)
cardno = cardno + 1
next
next
nTop = 0
end sub
public sub showdeck
dim a
redim a(51-nTop)
for i = nTop to 51
a(i) = deck(i).pips & deck(i).suit
next
wscript.echo join( a, ", ")
end sub
public sub shuffle
dim r
randomize timer
for i = nTop to 51
r = int( rnd * ( 52 - nTop ) )
if r <> i then
objswap deck(i),deck(r)
end if
next
end sub
public function deal()
set deal = deck( nTop )
nTop = nTop + 1
end function
public property get cardsRemaining
cardsRemaining = 52 - nTop
end property
private sub objswap( a, b )
dim tmp
set tmp = a
set a = b
set b = tmp
end sub
end class
| #include <deque>
#include <algorithm>
#include <ostream>
#include <iterator>
namespace cards
{
class card
{
public:
enum pip_type { two, three, four, five, six, seven, eight, nine, ten,
jack, queen, king, ace, pip_count };
enum suite_type { hearts, spades, diamonds, clubs, suite_count };
enum { unique_count = pip_count * suite_count };
card(suite_type s, pip_type p): value(s + suite_count * p) {}
explicit card(unsigned char v = 0): value(v) {}
pip_type pip() { return pip_type(value / suite_count); }
suite_type suite() { return suite_type(value % suite_count); }
private:
unsigned char value;
};
const char* const pip_names[] =
{ "two", "three", "four", "five", "six", "seven", "eight", "nine", "ten",
"jack", "queen", "king", "ace" };
std::ostream& operator<<(std::ostream& os, card::pip_type pip)
{
return os << pip_names[pip];
}
const char* const suite_names[] =
{ "hearts", "spades", "diamonds", "clubs" };
std::ostream& operator<<(std::ostream& os, card::suite_type suite)
{
return os << suite_names[suite];
}
std::ostream& operator<<(std::ostream& os, card c)
{
return os << c.pip() << " of " << c.suite();
}
class deck
{
public:
deck()
{
for (int i = 0; i < card::unique_count; ++i) {
cards.push_back(card(i));
}
}
void shuffle() { std::random_shuffle(cards.begin(), cards.end()); }
card deal() { card c = cards.front(); cards.pop_front(); return c; }
typedef std::deque<card>::const_iterator const_iterator;
const_iterator begin() const { return cards.cbegin(); }
const_iterator end() const { return cards.cend(); }
private:
std::deque<card> cards;
};
inline std::ostream& operator<<(std::ostream& os, const deck& d)
{
std::copy(d.begin(), d.end(), std::ostream_iterator<card>(os, "\n"));
return os;
}
}
|
Translate this program into C++ but keep the logic exactly as in VB. | Option Base {0|1}
| #include <array>
#include <vector>
#include <algorithm>
#include <iostream>
#include <iterator>
#include <string>
template <typename Array>
void demonstrate(Array& array)
{
array[2] = "Three";
array.at(1) = "Two";
std::reverse(begin(array), end(array));
std::for_each(begin(array), end(array),
[](typename Array::value_type const& element)
{
std::cout << element << ' ';
});
std::cout << '\n';
}
int main()
{
auto fixed_size_array = std::array<std::string, 3>{ "One", "Four", "Eight" };
auto dynamic_array = std::vector<std::string>{ "One", "Four" };
dynamic_array.push_back("Eight");
demonstrate(fixed_size_array);
demonstrate(dynamic_array);
}
|
Convert the following code from VB to C++, ensuring the logic remains intact. | Const Order = 4
Function InCarpet(ByVal x As Integer, ByVal y As Integer)
Do While x <> 0 And y <> 0
If x Mod 3 = 1 And y Mod 3 = 1 Then
InCarpet = " "
Exit Function
End If
x = x \ 3
y = y \ 3
Loop
InCarpet = "#"
End Function
Public Sub sierpinski_carpet()
Dim i As Integer, j As Integer
For i = 0 To 3 ^ Order - 1
For j = 0 To 3 ^ Order - 1
Debug.Print InCarpet(i, j);
Next j
Debug.Print
Next i
End Sub
|
#include <cstdint>
#include <cstdlib>
#include <cstdio>
static constexpr int32_t bct_low_bits = 0x55555555;
static int32_t bct_decrement(int32_t v) {
--v;
return v ^ (v & (v>>1) & bct_low_bits);
}
int main (int argc, char *argv[])
{
const int32_t n = (1 < argc) ? std::atoi(argv[1]) : 3;
if (n < 0 || 9 < n) {
std::printf("N out of range (use 0..9): %ld\n", long(n));
return 1;
}
const int32_t size_bct = 1<<(n*2);
int32_t y = size_bct;
do {
y = bct_decrement(y);
int32_t x = size_bct;
do {
x = bct_decrement(x);
std::putchar((x & y & bct_low_bits) ? ' ' : '#');
} while (0 < x);
std::putchar('\n');
} while (0 < y);
return 0;
}
|
Port the provided VB code into C++ while preserving the original functionality. | Private Function Knuth(a As Variant) As Variant
Dim t As Variant, i As Integer
If Not IsMissing(a) Then
For i = UBound(a) To LBound(a) + 1 Step -1
j = Int((UBound(a) - LBound(a) + 1) * Rnd + LBound(a))
t = a(i)
a(i) = a(j)
a(j) = t
Next i
End If
Knuth = a
End Function
Private Function inOrder(s As Variant)
i = 2
Do While i <= UBound(s)
If s(i) < s(i - 1) Then
inOrder = False
Exit Function
End If
i = i + 1
Loop
inOrder = True
End Function
Private Function bogosort(ByVal s As Variant) As Variant
Do While Not inOrder(s)
Debug.Print Join(s, ", ")
s = Knuth(s)
Loop
bogosort = s
End Function
Public Sub main()
Debug.Print Join(bogosort(Knuth([{1,2,3,4,5,6}])), ", ")
End Sub
| #include <algorithm>
#include <iostream>
#include <iterator>
#include <random>
template <typename RandomAccessIterator, typename Predicate>
void bogo_sort(RandomAccessIterator begin, RandomAccessIterator end,
Predicate p) {
std::random_device rd;
std::mt19937 generator(rd());
while (!std::is_sorted(begin, end, p)) {
std::shuffle(begin, end, generator);
}
}
template <typename RandomAccessIterator>
void bogo_sort(RandomAccessIterator begin, RandomAccessIterator end) {
bogo_sort(
begin, end,
std::less<
typename std::iterator_traits<RandomAccessIterator>::value_type>());
}
int main() {
int a[] = {100, 2, 56, 200, -52, 3, 99, 33, 177, -199};
bogo_sort(std::begin(a), std::end(a));
copy(std::begin(a), std::end(a), std::ostream_iterator<int>(std::cout, " "));
std::cout << "\n";
}
|
Convert the following code from VB to C++, ensuring the logic remains intact. | Private Sub ivp_euler(f As String, y As Double, step As Integer, end_t As Integer)
Dim t As Integer
Debug.Print " Step "; step; ": ",
Do While t <= end_t
If t Mod 10 = 0 Then Debug.Print Format(y, "0.000"),
y = y + step * Application.Run(f, y)
t = t + step
Loop
Debug.Print
End Sub
Sub analytic()
Debug.Print " Time: ",
For t = 0 To 100 Step 10
Debug.Print " "; t,
Next t
Debug.Print
Debug.Print "Analytic: ",
For t = 0 To 100 Step 10
Debug.Print Format(20 + 80 * Exp(-0.07 * t), "0.000"),
Next t
Debug.Print
End Sub
Private Function cooling(temp As Double) As Double
cooling = -0.07 * (temp - 20)
End Function
Public Sub euler_method()
Dim r_cooling As String
r_cooling = "cooling"
analytic
ivp_euler r_cooling, 100, 2, 100
ivp_euler r_cooling, 100, 5, 100
ivp_euler r_cooling, 100, 10, 100
End Sub
| #include <iomanip>
#include <iostream>
typedef double F(double,double);
void euler(F f, double y0, double a, double b, double h)
{
double y = y0;
for (double t = a; t < b; t += h)
{
std::cout << std::fixed << std::setprecision(3) << t << " " << y << "\n";
y += h * f(t, y);
}
std::cout << "done\n";
}
double newtonCoolingLaw(double, double t)
{
return -0.07 * (t - 20);
}
int main()
{
euler(newtonCoolingLaw, 100, 0, 100, 2);
euler(newtonCoolingLaw, 100, 0, 100, 5);
euler(newtonCoolingLaw, 100, 0, 100, 10);
}
|
Write the same code in C++ as shown below in VB. | Sub Main()
Dim i&, c&, j#, s$
Const N& = 1000000
s = "values for n in the range 1 to 22 : "
For i = 1 To 22
s = s & ns(i) & ", "
Next
For i = 1 To N
j = Sqr(ns(i))
If j = CInt(j) Then c = c + 1
Next
Debug.Print s
Debug.Print c & " squares less than " & N
End Sub
Private Function ns(l As Long) As Long
ns = l + Int(1 / 2 + Sqr(l))
End Function
| #include <iostream>
#include <algorithm>
#include <vector>
#include <cmath>
#include <boost/bind.hpp>
#include <iterator>
double nextNumber( double number ) {
return number + floor( 0.5 + sqrt( number ) ) ;
}
int main( ) {
std::vector<double> non_squares ;
typedef std::vector<double>::iterator SVI ;
non_squares.reserve( 1000000 ) ;
for ( double i = 1.0 ; i < 100001.0 ; i += 1 )
non_squares.push_back( nextNumber( i ) ) ;
std::copy( non_squares.begin( ) , non_squares.begin( ) + 22 ,
std::ostream_iterator<double>(std::cout, " " ) ) ;
std::cout << '\n' ;
SVI found = std::find_if ( non_squares.begin( ) , non_squares.end( ) ,
boost::bind( &floor, boost::bind( &sqrt, _1 ) ) == boost::bind( &sqrt, _1 ) ) ;
if ( found != non_squares.end( ) ) {
std::cout << "Found a square number in the sequence!\n" ;
std::cout << "It is " << *found << " !\n" ;
}
else {
std::cout << "Up to 1000000, found no square number in the sequence!\n" ;
}
return 0 ;
}
|
Write the same algorithm in C++ as shown in this VB implementation. | Public Sub substring()
sentence = "the last thing the man said was the"
n = 10: m = 5
Debug.Print Mid(sentence, n, 5)
Debug.Print Right(sentence, Len(sentence) - n + 1)
Debug.Print Left(sentence, Len(sentence) - 1)
k = InStr(1, sentence, "m")
Debug.Print Mid(sentence, k, 5)
k = InStr(1, sentence, "aid")
Debug.Print Mid(sentence, k, 5)
End Sub
| #include <iostream>
#include <string>
int main()
{
std::string s = "0123456789";
int const n = 3;
int const m = 4;
char const c = '2';
std::string const sub = "456";
std::cout << s.substr(n, m)<< "\n";
std::cout << s.substr(n) << "\n";
std::cout << s.substr(0, s.size()-1) << "\n";
std::cout << s.substr(s.find(c), m) << "\n";
std::cout << s.substr(s.find(sub), m) << "\n";
}
|
Rewrite this program in C++ while keeping its functionality equivalent to the VB version. | Function JortSort(s)
JortSort = True
arrPreSort = Split(s,",")
Set arrSorted = CreateObject("System.Collections.ArrayList")
For i = 0 To UBound(arrPreSort)
arrSorted.Add(arrPreSort(i))
Next
arrSorted.Sort()
For j = 0 To UBound(arrPreSort)
If arrPreSort(j) <> arrSorted(j) Then
JortSort = False
Exit For
End If
Next
End Function
WScript.StdOut.Write JortSort("1,2,3,4,5")
WScript.StdOut.WriteLine
WScript.StdOut.Write JortSort("1,2,3,5,4")
WScript.StdOut.WriteLine
WScript.StdOut.Write JortSort("a,b,c")
WScript.StdOut.WriteLine
WScript.StdOut.Write JortSort("a,c,b")
| #include <algorithm>
#include <string>
#include <iostream>
#include <iterator>
class jortSort {
public:
template<class T>
bool jort_sort( T* o, size_t s ) {
T* n = copy_array( o, s );
sort_array( n, s );
bool r = false;
if( n ) {
r = check( o, n, s );
delete [] n;
}
return r;
}
private:
template<class T>
T* copy_array( T* o, size_t s ) {
T* z = new T[s];
memcpy( z, o, s * sizeof( T ) );
return z;
}
template<class T>
void sort_array( T* n, size_t s ) {
std::sort( n, n + s );
}
template<class T>
bool check( T* n, T* o, size_t s ) {
for( size_t x = 0; x < s; x++ )
if( n[x] != o[x] ) return false;
return true;
}
};
jortSort js;
template<class T>
void displayTest( T* o, size_t s ) {
std::copy( o, o + s, std::ostream_iterator<T>( std::cout, " " ) );
std::cout << ": -> The array is " << ( js.jort_sort( o, s ) ? "sorted!" : "not sorted!" ) << "\n\n";
}
int main( int argc, char* argv[] ) {
const size_t s = 5;
std::string oStr[] = { "5", "A", "D", "R", "S" };
displayTest( oStr, s );
std::swap( oStr[0], oStr[1] );
displayTest( oStr, s );
int oInt[] = { 1, 2, 3, 4, 5 };
displayTest( oInt, s );
std::swap( oInt[0], oInt[1] );
displayTest( oInt, s );
return 0;
}
|
Ensure the translated C++ code behaves exactly like the original VB snippet. | Public Function Leap_year(year As Integer) As Boolean
Leap_year = (Month(DateSerial(year, 2, 29)) = 2)
End Function
| #include <iostream>
bool is_leap_year(int year) {
return year % 4 == 0 && (year % 100 != 0 || year % 400 == 0);
}
int main() {
for (auto year : {1900, 1994, 1996, 1997, 2000}) {
std::cout << year << (is_leap_year(year) ? " is" : " is not") << " a leap year.\n";
}
}
|
Ensure the translated C++ code behaves exactly like the original VB snippet. |
dim i,j
Wscript.StdOut.WriteLine "-- Long Integer - Permutations - from 1 to 12"
for i=1 to 12
for j=1 to i
Wscript.StdOut.Write "P(" & i & "," & j & ")=" & perm(i,j) & " "
next
Wscript.StdOut.WriteLine ""
next
Wscript.StdOut.WriteLine "-- Float integer - Combinations from 10 to 60"
for i=10 to 60 step 10
for j=1 to i step i\5
Wscript.StdOut.Write "C(" & i & "," & j & ")=" & comb(i,j) & " "
next
Wscript.StdOut.WriteLine ""
next
Wscript.StdOut.WriteLine "-- Float integer - Permutations from 5000 to 15000"
for i=5000 to 15000 step 5000
for j=10 to 70 step 20
Wscript.StdOut.Write "C(" & i & "," & j & ")=" & perm(i,j) & " "
next
Wscript.StdOut.WriteLine ""
next
Wscript.StdOut.WriteLine "-- Float integer - Combinations from 200 to 1000"
for i=200 to 1000 step 200
for j=20 to 100 step 20
Wscript.StdOut.Write "P(" & i & "," & j & ")=" & comb(i,j) & " "
next
Wscript.StdOut.WriteLine ""
next
function perm(x,y)
dim i,z
z=1
for i=x-y+1 to x
z=z*i
next
perm=z
end function
function fact(x)
dim i,z
z=1
for i=2 to x
z=z*i
next
fact=z
end function
function comb(byval x,byval y)
if y>x then
comb=0
elseif x=y then
comb=1
else
if x-y<y then y=x-y
comb=perm(x,y)/fact(y)
end if
end function
| #include <boost/multiprecision/gmp.hpp>
#include <iostream>
using namespace boost::multiprecision;
mpz_int p(uint n, uint p) {
mpz_int r = 1;
mpz_int k = n - p;
while (n > k)
r *= n--;
return r;
}
mpz_int c(uint n, uint k) {
mpz_int r = p(n, k);
while (k)
r /= k--;
return r;
}
int main() {
for (uint i = 1u; i < 12u; i++)
std::cout << "P(12," << i << ") = " << p(12u, i) << std::endl;
for (uint i = 10u; i < 60u; i += 10u)
std::cout << "C(60," << i << ") = " << c(60u, i) << std::endl;
return 0;
}
|
Change the programming language of this snippet from VB to C++ without modifying what it does. | Public Function sortlexicographically(N As Integer)
Dim arrList As Object
Set arrList = CreateObject("System.Collections.ArrayList")
For i = 1 To N
arrList.Add CStr(i)
Next i
arrList.Sort
Dim item As Variant
For Each item In arrList
Debug.Print item & ", ";
Next
End Function
Public Sub main()
Call sortlexicographically(13)
End Sub
| #include <algorithm>
#include <iostream>
#include <numeric>
#include <string>
#include <vector>
void lexicographical_sort(std::vector<int>& numbers) {
std::vector<std::string> strings(numbers.size());
std::transform(numbers.begin(), numbers.end(), strings.begin(),
[](int i) { return std::to_string(i); });
std::sort(strings.begin(), strings.end());
std::transform(strings.begin(), strings.end(), numbers.begin(),
[](const std::string& s) { return std::stoi(s); });
}
std::vector<int> lexicographically_sorted_vector(int n) {
std::vector<int> numbers(n >= 1 ? n : 2 - n);
std::iota(numbers.begin(), numbers.end(), std::min(1, n));
lexicographical_sort(numbers);
return numbers;
}
template <typename T>
void print_vector(std::ostream& out, const std::vector<T>& v) {
out << '[';
if (!v.empty()) {
auto i = v.begin();
out << *i++;
for (; i != v.end(); ++i)
out << ',' << *i;
}
out << "]\n";
}
int main(int argc, char** argv) {
for (int i : { 0, 5, 13, 21, -22 }) {
std::cout << i << ": ";
print_vector(std::cout, lexicographically_sorted_vector(i));
}
return 0;
}
|
Change the following VB code into C++ without altering its purpose. | Public twenties As Variant
Public decades As Variant
Public orders As Variant
Private Sub init()
twenties = [{"zero","one","two","three","four","five","six","seven","eight","nine","ten", "eleven","twelve","thirteen","fourteen","fifteen","sixteen","seventeen","eighteen","nineteen"}]
decades = [{"twenty","thirty","forty","fifty","sixty","seventy","eighty","ninety"}]
orders = [{1E15,"quadrillion"; 1E12,"trillion"; 1E9,"billion"; 1E6,"million"; 1E3,"thousand"}]
End Sub
Private Function Twenty(N As Variant)
Twenty = twenties(N Mod 20 + 1)
End Function
Private Function Decade(N As Variant)
Decade = decades(N Mod 10 - 1)
End Function
Private Function Hundred(N As Variant)
If N < 20 Then
Hundred = Twenty(N)
Exit Function
Else
If N Mod 10 = 0 Then
Hundred = Decade((N \ 10) Mod 10)
Exit Function
End If
End If
Hundred = Decade(N \ 10) & "-" & Twenty(N Mod 10)
End Function
Private Function Thousand(N As Variant, withand As String)
If N < 100 Then
Thousand = withand & Hundred(N)
Exit Function
Else
If N Mod 100 = 0 Then
Thousand = withand & Twenty(WorksheetFunction.Floor_Precise(N / 100)) & " hundred"
Exit Function
End If
End If
Thousand = Twenty(N \ 100) & " hundred and " & Hundred(N Mod 100)
End Function
Private Function Triplet(N As Variant)
Dim Order, High As Variant, Low As Variant
Dim Name As String, res As String
For i = 1 To UBound(orders)
Order = orders(i, 1)
Name = orders(i, 2)
High = WorksheetFunction.Floor_Precise(N / Order)
Low = N - High * Order
If High <> 0 Then
res = res & Thousand(High, "") & " " & Name
End If
N = Low
If Low = 0 Then Exit For
If Len(res) And High <> 0 Then
res = res & ", "
End If
Next i
If N <> 0 Or res = "" Then
res = res & Thousand(WorksheetFunction.Floor_Precise(N), IIf(res = "", "", "and "))
N = N - Int(N)
If N > 0.000001 Then
res = res & " point"
For i = 1 To 10
n_ = WorksheetFunction.Floor_Precise(N * 10.0000001)
res = res & " " & twenties(n_ + 1)
N = N * 10 - n_
If Abs(N) < 0.000001 Then Exit For
Next i
End If
End If
Triplet = res
End Function
Private Function spell(N As Variant)
Dim res As String
If N < 0 Then
res = "minus "
N = -N
End If
res = res & Triplet(N)
spell = res
End Function
Private Function smartp(N As Variant)
Dim res As String
If N = WorksheetFunction.Floor_Precise(N) Then
smartp = CStr(N)
Exit Function
End If
res = CStr(N)
If InStr(1, res, ".") Then
res = Left(res, InStr(1, res, "."))
End If
smartp = res
End Function
Sub Main()
Dim si As Variant
init
Samples1 = [{99, 300, 310, 417, 1501, 12609, 200000000000100, 999999999999999, -123456787654321,102003000400005,1020030004,102003,102,1,0,-1,-99, -1501,1234,12.34}]
Samples2 = [{10000001.2,1E-3,-2.7182818, 201021002001,-20102100200,2010210020,-201021002,20102100,-2010210, 201021,-20102,2010,-201,20,-2}]
For i = 1 To UBound(Samples1)
si = Samples1(i)
Debug.Print Format(smartp(si), "@@@@@@@@@@@@@@@@"); " "; spell(si)
Next i
For i = 1 To UBound(Samples2)
si = Samples2(i)
Debug.Print Format(smartp(si), "@@@@@@@@@@@@@@@@"); " "; spell(si)
Next i
End Sub
| #include <string>
#include <iostream>
using std::string;
const char* smallNumbers[] = {
"zero", "one", "two", "three", "four", "five",
"six", "seven", "eight", "nine", "ten",
"eleven", "twelve", "thirteen", "fourteen", "fifteen",
"sixteen", "seventeen", "eighteen", "nineteen"
};
string spellHundreds(unsigned n) {
string res;
if (n > 99) {
res = smallNumbers[n/100];
res += " hundred";
n %= 100;
if (n) res += " and ";
}
if (n >= 20) {
static const char* Decades[] = {
"", "", "twenty", "thirty", "forty",
"fifty", "sixty", "seventy", "eighty", "ninety"
};
res += Decades[n/10];
n %= 10;
if (n) res += "-";
}
if (n < 20 && n > 0)
res += smallNumbers[n];
return res;
}
const char* thousandPowers[] = {
" billion", " million", " thousand", "" };
typedef unsigned long Spellable;
string spell(Spellable n) {
if (n < 20) return smallNumbers[n];
string res;
const char** pScaleName = thousandPowers;
Spellable scaleFactor = 1000000000;
while (scaleFactor > 0) {
if (n >= scaleFactor) {
Spellable h = n / scaleFactor;
res += spellHundreds(h) + *pScaleName;
n %= scaleFactor;
if (n) res += ", ";
}
scaleFactor /= 1000;
++pScaleName;
}
return res;
}
int main() {
#define SPELL_IT(x) std::cout << #x " " << spell(x) << std::endl;
SPELL_IT( 99);
SPELL_IT( 300);
SPELL_IT( 310);
SPELL_IT( 1501);
SPELL_IT( 12609);
SPELL_IT( 512609);
SPELL_IT(43112609);
SPELL_IT(1234567890);
return 0;
}
|
Produce a functionally identical C++ code for the snippet given in VB. | Sub arrShellSort(ByVal arrData As Variant)
Dim lngHold, lngGap As Long
Dim lngCount, lngMin, lngMax As Long
Dim varItem As Variant
lngMin = LBound(arrData)
lngMax = UBound(arrData)
lngGap = lngMin
Do While (lngGap < lngMax)
lngGap = 3 * lngGap + 1
Loop
Do While (lngGap > 1)
lngGap = lngGap \ 3
For lngCount = lngGap + lngMin To lngMax
varItem = arrData(lngCount)
lngHold = lngCount
Do While ((arrData(lngHold - lngGap) > varItem))
arrData(lngHold) = arrData(lngHold - lngGap)
lngHold = lngHold - lngGap
If (lngHold < lngMin + lngGap) Then Exit Do
Loop
arrData(lngHold) = varItem
Next
Loop
arrShellSort = arrData
End Sub
| #include <time.h>
#include <iostream>
using namespace std;
const int MAX = 126;
class shell
{
public:
shell()
{ _gap[0] = 1750; _gap[1] = 701; _gap[2] = 301; _gap[3] = 132; _gap[4] = 57; _gap[5] = 23; _gap[6] = 10; _gap[7] = 4; _gap[8] = 1; }
void sort( int* a, int count )
{
_cnt = count;
for( int x = 0; x < 9; x++ )
if( count > _gap[x] )
{ _idx = x; break; }
sortIt( a );
}
private:
void sortIt( int* arr )
{
bool sorted = false;
while( true )
{
sorted = true;
int st = 0;
for( int x = _gap[_idx]; x < _cnt; x += _gap[_idx] )
{
if( arr[st] > arr[x] )
{ swap( arr[st], arr[x] ); sorted = false; }
st = x;
}
if( ++_idx >= 8 ) _idx = 8;
if( sorted && _idx == 8 ) break;
}
}
void swap( int& a, int& b ) { int t = a; a = b; b = t; }
int _gap[9], _idx, _cnt;
};
int main( int argc, char* argv[] )
{
srand( static_cast<unsigned int>( time( NULL ) ) ); int arr[MAX];
for( int x = 0; x < MAX; x++ )
arr[x] = rand() % MAX - rand() % MAX;
cout << " Before: \n=========\n";
for( int x = 0; x < 7; x++ )
{
for( int a = 0; a < 18; a++ )
{ cout << arr[x * 18 + a] << " "; }
cout << endl;
}
cout << endl; shell s; s.sort( arr, MAX );
cout << " After: \n========\n";
for( int x = 0; x < 7; x++ )
{
for( int a = 0; a < 18; a++ )
{ cout << arr[x * 18 + a] << " "; }
cout << endl;
}
cout << endl << endl; return system( "pause" );
}
|
Write the same algorithm in C++ as shown in this VB implementation. | Public Class DoubleLinkList(Of T)
Private m_Head As Node(Of T)
Private m_Tail As Node(Of T)
Public Sub AddHead(ByVal value As T)
Dim node As New Node(Of T)(Me, value)
If m_Head Is Nothing Then
m_Head = Node
m_Tail = m_Head
Else
node.Next = m_Head
m_Head = node
End If
End Sub
Public Sub AddTail(ByVal value As T)
Dim node As New Node(Of T)(Me, value)
If m_Tail Is Nothing Then
m_Head = node
m_Tail = m_Head
Else
node.Previous = m_Tail
m_Tail = node
End If
End Sub
Public ReadOnly Property Head() As Node(Of T)
Get
Return m_Head
End Get
End Property
Public ReadOnly Property Tail() As Node(Of T)
Get
Return m_Tail
End Get
End Property
Public Sub RemoveTail()
If m_Tail Is Nothing Then Return
If m_Tail.Previous Is Nothing Then
m_Head = Nothing
m_Tail = Nothing
Else
m_Tail = m_Tail.Previous
m_Tail.Next = Nothing
End If
End Sub
Public Sub RemoveHead()
If m_Head Is Nothing Then Return
If m_Head.Next Is Nothing Then
m_Head = Nothing
m_Tail = Nothing
Else
m_Head = m_Head.Next
m_Head.Previous = Nothing
End If
End Sub
End Class
Public Class Node(Of T)
Private ReadOnly m_Value As T
Private m_Next As Node(Of T)
Private m_Previous As Node(Of T)
Private ReadOnly m_Parent As DoubleLinkList(Of T)
Public Sub New(ByVal parent As DoubleLinkList(Of T), ByVal value As T)
m_Parent = parent
m_Value = value
End Sub
Public Property [Next]() As Node(Of T)
Get
Return m_Next
End Get
Friend Set(ByVal value As Node(Of T))
m_Next = value
End Set
End Property
Public Property Previous() As Node(Of T)
Get
Return m_Previous
End Get
Friend Set(ByVal value As Node(Of T))
m_Previous = value
End Set
End Property
Public ReadOnly Property Value() As T
Get
Return m_Value
End Get
End Property
Public Sub InsertAfter(ByVal value As T)
If m_Next Is Nothing Then
m_Parent.AddTail(value)
ElseIf m_Previous Is Nothing Then
m_Parent.AddHead(value)
Else
Dim node As New Node(Of T)(m_Parent, value)
node.Previous = Me
node.Next = Me.Next
Me.Next.Previous = node
Me.Next = node
End If
End Sub
Public Sub Remove()
If m_Next Is Nothing Then
m_Parent.RemoveTail()
ElseIf m_Previous Is Nothing Then
m_Parent.RemoveHead()
Else
m_Previous.Next = Me.Next
m_Next.Previous = Me.Previous
End If
End Sub
End Class
| #include <iostream>
#include <list>
int main ()
{
std::list<int> numbers {1, 5, 7, 0, 3, 2};
numbers.insert(numbers.begin(), 9);
numbers.insert(numbers.end(), 4);
auto it = std::next(numbers.begin(), numbers.size() / 2);
numbers.insert(it, 6);
for(const auto& i: numbers)
std::cout << i << ' ';
std::cout << '\n';
}
|
Write a version of this VB function in C++ with identical behavior. |
TYPE regChar
Character AS STRING * 3
Count AS LONG
END TYPE
DIM iChar AS INTEGER
DIM iCL AS INTEGER
DIM iCountChars AS INTEGER
DIM iFile AS INTEGER
DIM i AS INTEGER
DIM lMUC AS LONG
DIM iMUI AS INTEGER
DIM lLUC AS LONG
DIM iLUI AS INTEGER
DIM iMaxIdx AS INTEGER
DIM iP AS INTEGER
DIM iPause AS INTEGER
DIM iPMI AS INTEGER
DIM iPrint AS INTEGER
DIM lHowMany AS LONG
DIM lTotChars AS LONG
DIM sTime AS SINGLE
DIM strFile AS STRING
DIM strTxt AS STRING
DIM strDate AS STRING
DIM strTime AS STRING
DIM strKey AS STRING
CONST LngReg = 256
CONST Letters = 1
CONST FALSE = 0
CONST TRUE = NOT FALSE
strDate = DATE$
strTime = TIME$
iFile = FREEFILE
DO
CLS
PRINT "This program counts letters or characters in a text file."
PRINT
INPUT "File to open: ", strFile
OPEN strFile FOR BINARY AS #iFile
IF LOF(iFile) > 0 THEN
PRINT "Count: 1) Letters 2) Characters (1 or 2)";
DO
strKey = INKEY$
LOOP UNTIL strKey = "1" OR strKey = "2"
PRINT ". Option selected: "; strKey
iCL = VAL(strKey)
sTime = TIMER
iP = POS(0)
lHowMany = LOF(iFile)
strTxt = SPACE$(LngReg)
IF iCL = Letters THEN
iMaxIdx = 26
ELSE
iMaxIdx = 255
END IF
IF iMaxIdx <> iPMI THEN
iPMI = iMaxIdx
REDIM rChar(0 TO iMaxIdx) AS regChar
FOR i = 0 TO iMaxIdx
IF iCL = Letters THEN
strTxt = CHR$(i + 65)
IF i = 26 THEN strTxt = CHR$(165)
ELSE
SELECT CASE i
CASE 0: strTxt = "nul"
CASE 7: strTxt = "bel"
CASE 9: strTxt = "tab"
CASE 10: strTxt = "lf"
CASE 11: strTxt = "vt"
CASE 12: strTxt = "ff"
CASE 13: strTxt = "cr"
CASE 28: strTxt = "fs"
CASE 29: strTxt = "gs"
CASE 30: strTxt = "rs"
CASE 31: strTxt = "us"
CASE 32: strTxt = "sp"
CASE ELSE: strTxt = CHR$(i)
END SELECT
END IF
rChar(i).Character = strTxt
NEXT i
ELSE
FOR i = 0 TO iMaxIdx
rChar(i).Count = 0
NEXT i
END IF
PRINT "Looking for ";
IF iCL = Letters THEN PRINT "letters."; ELSE PRINT "characters.";
PRINT " File is"; STR$(lHowMany); " in size. Working"; : COLOR 23: PRINT "..."; : COLOR (7)
DO WHILE LOC(iFile) < LOF(iFile)
IF LOC(iFile) + LngReg > LOF(iFile) THEN
strTxt = SPACE$(LOF(iFile) - LOC(iFile))
END IF
GET #iFile, , strTxt
FOR i = 1 TO LEN(strTxt)
IF iCL = Letters THEN
iChar = ASC(UCASE$(MID$(strTxt, i, 1)))
SELECT CASE iChar
CASE 164: iChar = 165
CASE 160: iChar = 65
CASE 130, 144: iChar = 69
CASE 161: iChar = 73
CASE 162: iChar = 79
CASE 163, 129: iChar = 85
END SELECT
iChar = iChar - 65
IF iChar >= 0 AND iChar <= 25 THEN
rChar(iChar).Count = rChar(iChar).Count + 1
ELSEIF iChar = 100 THEN
rChar(iMaxIdx).Count = rChar(iMaxIdx).Count + 1
END IF
ELSE
iChar = ASC(MID$(strTxt, i, 1))
rChar(iChar).Count = rChar(iChar).Count + 1
END IF
NEXT i
LOOP
CLOSE #iFile
lMUC = 0
iMUI = 0
lLUC = 2147483647
iLUI = 0
iPrint = FALSE
lTotChars = 0
iCountChars = 0
iPause = FALSE
CLS
IF iCL = Letters THEN PRINT "Letters found: "; ELSE PRINT "Characters found: ";
FOR i = 0 TO iMaxIdx
IF lMUC < rChar(i).Count THEN
lMUC = rChar(i).Count
iMUI = i
END IF
IF rChar(i).Count > 0 THEN
strTxt = ""
IF iPrint THEN strTxt = ", " ELSE iPrint = TRUE
strTxt = strTxt + LTRIM$(RTRIM$(rChar(i).Character))
strTxt = strTxt + "=" + LTRIM$(STR$(rChar(i).Count))
iP = POS(0)
IF iP + LEN(strTxt) + 1 >= 80 AND iPrint THEN
PRINT ","
IF CSRLIN >= 23 AND NOT iPause THEN
iPause = TRUE
PRINT "Press a key to continue..."
DO
strKey = INKEY$
LOOP UNTIL strKey <> ""
END IF
strTxt = MID$(strTxt, 3)
END IF
PRINT strTxt;
lTotChars = lTotChars + rChar(i).Count
iCountChars = iCountChars + 1
IF lLUC > rChar(i).Count THEN
lLUC = rChar(i).Count
iLUI = i
END IF
END IF
NEXT i
PRINT "."
PRINT
PRINT "File analyzed....................: "; strFile
PRINT "Looked for.......................: "; : IF iCL = Letters THEN PRINT "Letters" ELSE PRINT "Characters"
PRINT "Total characters in file.........:"; lHowMany
PRINT "Total characters counted.........:"; lTotChars
IF iCL = Letters THEN PRINT "Characters discarded on count....:"; lHowMany - lTotChars
PRINT "Distinct characters found in file:"; iCountChars; "of"; iMaxIdx + 1
PRINT "Most used character was..........: ";
iPrint = FALSE
FOR i = 0 TO iMaxIdx
IF rChar(i).Count = lMUC THEN
IF iPrint THEN PRINT ", "; ELSE iPrint = TRUE
PRINT RTRIM$(LTRIM$(rChar(i).Character));
END IF
NEXT i
PRINT " ("; LTRIM$(STR$(rChar(iMUI).Count)); " times)"
PRINT "Least used character was.........: ";
iPrint = FALSE
FOR i = 0 TO iMaxIdx
IF rChar(i).Count = lLUC THEN
IF iPrint THEN PRINT ", "; ELSE iPrint = TRUE
PRINT RTRIM$(LTRIM$(rChar(i).Character));
END IF
NEXT i
PRINT " ("; LTRIM$(STR$(rChar(iLUI).Count)); " times)"
PRINT "Time spent in the process........:"; TIMER - sTime; "seconds"
ELSE
CLOSE #iFile
KILL strFile
PRINT
PRINT "File does not exist."
END IF
PRINT
PRINT "Again? (Y/n)"
DO
strTxt = UCASE$(INKEY$)
LOOP UNTIL strTxt = "N" OR strTxt = "Y" OR strTxt = CHR$(13) OR strTxt = CHR$(27)
LOOP UNTIL strTxt = "N" OR strTxt = CHR$(27)
CLS
PRINT "End of execution."
PRINT "Start time: "; strDate; " "; strTime; ", end time: "; DATE$; " "; TIME$; "."
END
| #include <fstream>
#include <iostream>
int main()
{
std::ifstream input("filename.txt", std::ios_base::binary);
if (!input)
{
std::cerr << "error: can't open file\n";
return -1;
}
size_t count[256];
std::fill_n(count, 256, 0);
for (char c; input.get(c); ++count[uint8_t(c)])
;
for (size_t i = 0; i < 256; ++i)
{
if (count[i] && isgraph(i))
{
std::cout << char(i) << " = " << count[i] << '\n';
}
}
}
|
Generate a C++ translation of this VB snippet without changing its computational steps. | Dim s As String = "123"
s = CStr(CInt("123") + 1)
s = (CInt("123") + 1).ToString
|
#include <cstdlib>
#include <string>
#include <sstream>
std::string s = "12345";
int i;
std::istringstream(s) >> i;
i++;
std::ostringstream oss;
if (oss << i) s = oss.str();
|
Produce a language-to-language conversion: from VB to C++, same semantics. | Function StripChars(stString As String, stStripChars As String, Optional bSpace As Boolean)
Dim i As Integer, stReplace As String
If bSpace = True Then
stReplace = " "
Else
stReplace = ""
End If
For i = 1 To Len(stStripChars)
stString = Replace(stString, Mid(stStripChars, i, 1), stReplace)
Next i
StripChars = stString
End Function
| #include <algorithm>
#include <iostream>
#include <string>
std::string stripchars(std::string str, const std::string &chars)
{
str.erase(
std::remove_if(str.begin(), str.end(), [&](char c){
return chars.find(c) != std::string::npos;
}),
str.end()
);
return str;
}
int main()
{
std::cout << stripchars("She was a soul stripper. She took my heart!", "aei") << '\n';
return 0;
}
|
Convert this VB block to C++, preserving its control flow and logic. | Function StripChars(stString As String, stStripChars As String, Optional bSpace As Boolean)
Dim i As Integer, stReplace As String
If bSpace = True Then
stReplace = " "
Else
stReplace = ""
End If
For i = 1 To Len(stStripChars)
stString = Replace(stString, Mid(stStripChars, i, 1), stReplace)
Next i
StripChars = stString
End Function
| #include <algorithm>
#include <iostream>
#include <string>
std::string stripchars(std::string str, const std::string &chars)
{
str.erase(
std::remove_if(str.begin(), str.end(), [&](char c){
return chars.find(c) != std::string::npos;
}),
str.end()
);
return str;
}
int main()
{
std::cout << stripchars("She was a soul stripper. She took my heart!", "aei") << '\n';
return 0;
}
|
Port the following code from VB to C++ with equivalent syntax and logic. | Private Function mean(v() As Double, ByVal leng As Integer) As Variant
Dim sum As Double, i As Integer
sum = 0: i = 0
For i = 0 To leng - 1
sum = sum + vv
Next i
If leng = 0 Then
mean = CVErr(xlErrDiv0)
Else
mean = sum / leng
End If
End Function
Public Sub main()
Dim v(4) As Double
Dim i As Integer, leng As Integer
v(0) = 1#
v(1) = 2#
v(2) = 2.178
v(3) = 3#
v(4) = 3.142
For leng = 5 To 0 Step -1
Debug.Print "mean[";
For i = 0 To leng - 1
Debug.Print IIf(i, "; " & v(i), "" & v(i));
Next i
Debug.Print "] = "; mean(v, leng)
Next leng
End Sub
| #include <vector>
double mean(const std::vector<double>& numbers)
{
if (numbers.size() == 0)
return 0;
double sum = 0;
for (std::vector<double>::iterator i = numbers.begin(); i != numbers.end(); i++)
sum += *i;
return sum / numbers.size();
}
|
Write the same algorithm in C++ as shown in this VB implementation. | Private Function ValidateUserWords(userstring As String) As String
Dim s As String
Dim user_words() As String
Dim command_table As Scripting.Dictionary
Set command_table = New Scripting.Dictionary
Dim abbreviations As Scripting.Dictionary
Set abbreviations = New Scripting.Dictionary
abbreviations.CompareMode = TextCompare
Dim commandtable() As String
Dim commands As String
s = s & "add 1 alter 3 backup 2 bottom 1 Cappend 2 change 1 Schange Cinsert 2 Clast 3 "
s = s & "compress 4 copy 2 count 3 Coverlay 3 cursor 3 delete 3 Cdelete 2 down 1 duplicate "
s = s & "3 xEdit 1 expand 3 extract 3 find 1 Nfind 2 Nfindup 6 NfUP 3 Cfind 2 findUP 3 fUP 2 "
s = s & "forward 2 get help 1 hexType 4 input 1 powerInput 3 join 1 split 2 spltJOIN load "
s = s & "locate 1 Clocate 2 lowerCase 3 upperCase 3 Lprefix 2 macro merge 2 modify 3 move 2 "
s = s & "msg next 1 overlay 1 parse preserve 4 purge 3 put putD query 1 quit read recover 3 "
s = s & "refresh renum 3 repeat 3 replace 1 Creplace 2 reset 3 restore 4 rgtLEFT right 2 left "
s = s & "2 save set shift 2 si sort sos stack 3 status 4 top transfer 3 type 1 up 1 "
commandtable = Split(s, " ")
Dim i As Integer, word As Variant, number As Integer
For i = LBound(commandtable) To UBound(commandtable)
word = commandtable(i)
If Len(word) > 0 Then
i = i + 1
Do While Len(commandtable(i)) = 0: i = i + 1: Loop
number = Val(commandtable(i))
If number > 0 Then
command_table.Add Key:=word, Item:=number
Else
command_table.Add Key:=word, Item:=Len(word)
i = i - 1
End If
End If
Next i
For Each word In command_table
For i = command_table(word) To Len(word)
On Error Resume Next
abbreviations.Add Key:=Left(word, i), Item:=UCase(word)
Next i
Next word
user_words() = Split(userstring, " ")
For Each word In user_words
If Len(word) > 0 Then
If abbreviations.exists(word) Then
commands = commands & abbreviations(word) & " "
Else
commands = commands & "*error* "
End If
End If
Next word
ValidateUserWords = commands
End Function
Public Sub program()
Dim guserstring As String
guserstring = "riG rePEAT copies put mo rest types fup. 6 poweRin"
Debug.Print "user words:", guserstring
Debug.Print "full words:", ValidateUserWords(guserstring)
End Sub
| #include <algorithm>
#include <cctype>
#include <iostream>
#include <sstream>
#include <string>
#include <vector>
const char* command_table =
"add 1 alter 3 backup 2 bottom 1 Cappend 2 change 1 Schange Cinsert 2 Clast 3 "
"compress 4 copy 2 count 3 Coverlay 3 cursor 3 delete 3 Cdelete 2 down 1 duplicate "
"3 xEdit 1 expand 3 extract 3 find 1 Nfind 2 Nfindup 6 NfUP 3 Cfind 2 findUP 3 fUP 2 "
"forward 2 get help 1 hexType 4 input 1 powerInput 3 join 1 split 2 spltJOIN load "
"locate 1 Clocate 2 lowerCase 3 upperCase 3 Lprefix 2 macro merge 2 modify 3 move 2 "
"msg next 1 overlay 1 parse preserve 4 purge 3 put putD query 1 quit read recover 3 "
"refresh renum 3 repeat 3 replace 1 Creplace 2 reset 3 restore 4 rgtLEFT right 2 left "
"2 save set shift 2 si sort sos stack 3 status 4 top transfer 3 type 1 up 1";
class command {
public:
command(const std::string&, size_t);
const std::string& cmd() const { return cmd_; }
size_t min_length() const { return min_len_; }
bool match(const std::string&) const;
private:
std::string cmd_;
size_t min_len_;
};
command::command(const std::string& cmd, size_t min_len)
: cmd_(cmd), min_len_(min_len) {}
bool command::match(const std::string& str) const {
size_t olen = str.length();
return olen >= min_len_ && olen <= cmd_.length()
&& cmd_.compare(0, olen, str) == 0;
}
bool parse_integer(const std::string& word, int& value) {
try {
size_t pos;
int i = std::stoi(word, &pos, 10);
if (pos < word.length())
return false;
value = i;
return true;
} catch (const std::exception& ex) {
return false;
}
}
void uppercase(std::string& str) {
std::transform(str.begin(), str.end(), str.begin(),
[](unsigned char c) -> unsigned char { return std::toupper(c); });
}
class command_list {
public:
explicit command_list(const char*);
const command* find_command(const std::string&) const;
private:
std::vector<command> commands_;
};
command_list::command_list(const char* table) {
std::istringstream is(table);
std::string word;
std::vector<std::string> words;
while (is >> word) {
uppercase(word);
words.push_back(word);
}
for (size_t i = 0, n = words.size(); i < n; ++i) {
word = words[i];
int len = word.length();
if (i + 1 < n && parse_integer(words[i + 1], len))
++i;
commands_.push_back(command(word, len));
}
}
const command* command_list::find_command(const std::string& word) const {
auto iter = std::find_if(commands_.begin(), commands_.end(),
[&word](const command& cmd) { return cmd.match(word); });
return (iter != commands_.end()) ? &*iter : nullptr;
}
std::string test(const command_list& commands, const std::string& input) {
std::string output;
std::istringstream is(input);
std::string word;
while (is >> word) {
if (!output.empty())
output += ' ';
uppercase(word);
const command* cmd_ptr = commands.find_command(word);
if (cmd_ptr)
output += cmd_ptr->cmd();
else
output += "*error*";
}
return output;
}
int main() {
command_list commands(command_table);
std::string input("riG rePEAT copies put mo rest types fup. 6 poweRin");
std::string output(test(commands, input));
std::cout << " input: " << input << '\n';
std::cout << "output: " << output << '\n';
return 0;
}
|
Preserve the algorithm and functionality while converting the code from VB to C++. | Private Function ValidateUserWords(userstring As String) As String
Dim s As String
Dim user_words() As String
Dim command_table As Scripting.Dictionary
Set command_table = New Scripting.Dictionary
Dim abbreviations As Scripting.Dictionary
Set abbreviations = New Scripting.Dictionary
abbreviations.CompareMode = TextCompare
Dim commandtable() As String
Dim commands As String
s = s & "add 1 alter 3 backup 2 bottom 1 Cappend 2 change 1 Schange Cinsert 2 Clast 3 "
s = s & "compress 4 copy 2 count 3 Coverlay 3 cursor 3 delete 3 Cdelete 2 down 1 duplicate "
s = s & "3 xEdit 1 expand 3 extract 3 find 1 Nfind 2 Nfindup 6 NfUP 3 Cfind 2 findUP 3 fUP 2 "
s = s & "forward 2 get help 1 hexType 4 input 1 powerInput 3 join 1 split 2 spltJOIN load "
s = s & "locate 1 Clocate 2 lowerCase 3 upperCase 3 Lprefix 2 macro merge 2 modify 3 move 2 "
s = s & "msg next 1 overlay 1 parse preserve 4 purge 3 put putD query 1 quit read recover 3 "
s = s & "refresh renum 3 repeat 3 replace 1 Creplace 2 reset 3 restore 4 rgtLEFT right 2 left "
s = s & "2 save set shift 2 si sort sos stack 3 status 4 top transfer 3 type 1 up 1 "
commandtable = Split(s, " ")
Dim i As Integer, word As Variant, number As Integer
For i = LBound(commandtable) To UBound(commandtable)
word = commandtable(i)
If Len(word) > 0 Then
i = i + 1
Do While Len(commandtable(i)) = 0: i = i + 1: Loop
number = Val(commandtable(i))
If number > 0 Then
command_table.Add Key:=word, Item:=number
Else
command_table.Add Key:=word, Item:=Len(word)
i = i - 1
End If
End If
Next i
For Each word In command_table
For i = command_table(word) To Len(word)
On Error Resume Next
abbreviations.Add Key:=Left(word, i), Item:=UCase(word)
Next i
Next word
user_words() = Split(userstring, " ")
For Each word In user_words
If Len(word) > 0 Then
If abbreviations.exists(word) Then
commands = commands & abbreviations(word) & " "
Else
commands = commands & "*error* "
End If
End If
Next word
ValidateUserWords = commands
End Function
Public Sub program()
Dim guserstring As String
guserstring = "riG rePEAT copies put mo rest types fup. 6 poweRin"
Debug.Print "user words:", guserstring
Debug.Print "full words:", ValidateUserWords(guserstring)
End Sub
| #include <algorithm>
#include <cctype>
#include <iostream>
#include <sstream>
#include <string>
#include <vector>
const char* command_table =
"add 1 alter 3 backup 2 bottom 1 Cappend 2 change 1 Schange Cinsert 2 Clast 3 "
"compress 4 copy 2 count 3 Coverlay 3 cursor 3 delete 3 Cdelete 2 down 1 duplicate "
"3 xEdit 1 expand 3 extract 3 find 1 Nfind 2 Nfindup 6 NfUP 3 Cfind 2 findUP 3 fUP 2 "
"forward 2 get help 1 hexType 4 input 1 powerInput 3 join 1 split 2 spltJOIN load "
"locate 1 Clocate 2 lowerCase 3 upperCase 3 Lprefix 2 macro merge 2 modify 3 move 2 "
"msg next 1 overlay 1 parse preserve 4 purge 3 put putD query 1 quit read recover 3 "
"refresh renum 3 repeat 3 replace 1 Creplace 2 reset 3 restore 4 rgtLEFT right 2 left "
"2 save set shift 2 si sort sos stack 3 status 4 top transfer 3 type 1 up 1";
class command {
public:
command(const std::string&, size_t);
const std::string& cmd() const { return cmd_; }
size_t min_length() const { return min_len_; }
bool match(const std::string&) const;
private:
std::string cmd_;
size_t min_len_;
};
command::command(const std::string& cmd, size_t min_len)
: cmd_(cmd), min_len_(min_len) {}
bool command::match(const std::string& str) const {
size_t olen = str.length();
return olen >= min_len_ && olen <= cmd_.length()
&& cmd_.compare(0, olen, str) == 0;
}
bool parse_integer(const std::string& word, int& value) {
try {
size_t pos;
int i = std::stoi(word, &pos, 10);
if (pos < word.length())
return false;
value = i;
return true;
} catch (const std::exception& ex) {
return false;
}
}
void uppercase(std::string& str) {
std::transform(str.begin(), str.end(), str.begin(),
[](unsigned char c) -> unsigned char { return std::toupper(c); });
}
class command_list {
public:
explicit command_list(const char*);
const command* find_command(const std::string&) const;
private:
std::vector<command> commands_;
};
command_list::command_list(const char* table) {
std::istringstream is(table);
std::string word;
std::vector<std::string> words;
while (is >> word) {
uppercase(word);
words.push_back(word);
}
for (size_t i = 0, n = words.size(); i < n; ++i) {
word = words[i];
int len = word.length();
if (i + 1 < n && parse_integer(words[i + 1], len))
++i;
commands_.push_back(command(word, len));
}
}
const command* command_list::find_command(const std::string& word) const {
auto iter = std::find_if(commands_.begin(), commands_.end(),
[&word](const command& cmd) { return cmd.match(word); });
return (iter != commands_.end()) ? &*iter : nullptr;
}
std::string test(const command_list& commands, const std::string& input) {
std::string output;
std::istringstream is(input);
std::string word;
while (is >> word) {
if (!output.empty())
output += ' ';
uppercase(word);
const command* cmd_ptr = commands.find_command(word);
if (cmd_ptr)
output += cmd_ptr->cmd();
else
output += "*error*";
}
return output;
}
int main() {
command_list commands(command_table);
std::string input("riG rePEAT copies put mo rest types fup. 6 poweRin");
std::string output(test(commands, input));
std::cout << " input: " << input << '\n';
std::cout << "output: " << output << '\n';
return 0;
}
|
Change the programming language of this snippet from VB to C++ without modifying what it does. | Private Function tokenize(s As String, sep As String, esc As String) As Collection
Dim ret As New Collection
Dim this As String
Dim skip As Boolean
If Len(s) <> 0 Then
For i = 1 To Len(s)
si = Mid(s, i, 1)
If skip Then
this = this & si
skip = False
Else
If si = esc Then
skip = True
Else
If si = sep Then
ret.Add this
this = ""
Else
this = this & si
End If
End If
End If
Next i
ret.Add this
End If
Set tokenize = ret
End Function
Public Sub main()
Dim out As Collection
Set out = tokenize("one^|uno||three^^^^|four^^^|^cuatro|", "|", "^")
Dim outstring() As String
ReDim outstring(out.Count - 1)
For i = 0 To out.Count - 1
outstring(i) = out(i + 1)
Next i
Debug.Print Join(outstring, ", ")
End Sub
| #include <iostream>
#include <stdexcept>
#include <string>
#include <vector>
using namespace std;
vector<string> tokenize(const string& input, char seperator, char escape) {
vector<string> output;
string token;
bool inEsc = false;
for (char ch : input) {
if (inEsc) {
inEsc = false;
} else if (ch == escape) {
inEsc = true;
continue;
} else if (ch == seperator) {
output.push_back(token);
token = "";
continue;
}
token += ch;
}
if (inEsc)
throw new invalid_argument("Invalid terminal escape");
output.push_back(token);
return output;
}
int main() {
string sample = "one^|uno||three^^^^|four^^^|^cuatro|";
cout << sample << endl;
cout << '[';
for (auto t : tokenize(sample, '|', '^')) {
cout << '"' << t << "\", ";
}
cout << ']' << endl;
return 0;
}
|
Change the programming language of this snippet from VB to C++ without modifying what it does. | Public Sub hello_world_text
Debug.Print "Hello World!"
End Sub
| #include <iostream>
int main () {
std::cout << "Hello world!" << std::endl;
}
|
Write the same algorithm in C++ as shown in this VB implementation. | Module ForwardDifference
Sub Main()
Dim lNum As New List(Of Integer)(New Integer() {90, 47, 58, 29, 22, 32, 55, 5, 55, 73})
For i As UInteger = 0 To 9
Console.WriteLine(String.Join(" ", (From n In Difference(i, lNum) Select String.Format("{0,5}", n)).ToArray()))
Next
Console.ReadKey()
End Sub
Private Function Difference(ByVal Level As UInteger, ByVal Numbers As List(Of Integer)) As List(Of Integer)
If Level >= Numbers.Count Then Throw New ArgumentOutOfRangeException("Level", "Level must be less than number of items in Numbers")
For i As Integer = 1 To Level
Numbers = (From n In Enumerable.Range(0, Numbers.Count - 1) _
Select Numbers(n + 1) - Numbers(n)).ToList()
Next
Return Numbers
End Function
End Module
| #include <vector>
#include <iterator>
#include <algorithm>
template<typename InputIterator, typename OutputIterator>
OutputIterator forward_difference(InputIterator first, InputIterator last,
OutputIterator dest)
{
if (first == last)
return dest;
typedef typename std::iterator_traits<InputIterator>::value_type value_type;
value_type temp = *first++;
while (first != last)
{
value_type temp2 = *first++;
*dest++ = temp2 - temp;
temp = temp2;
}
return dest;
}
template<typename InputIterator, typename OutputIterator>
OutputIterator nth_forward_difference(int order,
InputIterator first, InputIterator last,
OutputIterator dest)
{
if (order == 0)
return std::copy(first, last, dest);
if (order == 1)
return forward_difference(first, last, dest);
typedef typename std::iterator_traits<InputIterator>::value_type value_type;
std::vector<value_type> temp_storage;
forward_difference(first, last, std::back_inserter(temp_storage));
typename std::vector<value_type>::iterator begin = temp_storage.begin(),
end = temp_storage.end();
for (int i = 1; i < order-1; ++i)
end = forward_difference(begin, end, begin);
return forward_difference(begin, end, dest);
}
#include <iostream>
int main()
{
double array[10] = { 90.0, 47.0, 58.0, 29.0, 22.0, 32.0, 55.0, 5.0, 55.0, 73.0 };
std::vector<double> dest;
nth_forward_difference(1, array, array+10, std::back_inserter(dest));
std::copy(dest.begin(), dest.end(), std::ostream_iterator<double>(std::cout, " "));
std::cout << std::endl;
nth_forward_difference(2, array, array+10, std::ostream_iterator<double>(std::cout, " "));
std::cout << std::endl;
nth_forward_difference(9, array, array+10, std::ostream_iterator<double>(std::cout, " "));
std::cout << std::endl;
nth_forward_difference(10, array, array+10, std::ostream_iterator<double>(std::cout, " "));
std::cout << std::endl;
nth_forward_difference(0, array, array+10, std::ostream_iterator<double>(std::cout, " "));
std::cout << std::endl;
double* end = nth_forward_difference(3, array, array+10, array);
for (double* p = array; p < end; ++p)
std::cout << *p << " ";
std::cout << std::endl;
return 0;
}
|
Write the same algorithm in C++ as shown in this VB implementation. | Option Explicit
Sub FirstTwentyPrimes()
Dim count As Integer, i As Long, t(19) As String
Do
i = i + 1
If IsPrime(i) Then
t(count) = i
count = count + 1
End If
Loop While count <= UBound(t)
Debug.Print Join(t, ", ")
End Sub
Function IsPrime(Nb As Long) As Boolean
If Nb = 2 Then
IsPrime = True
ElseIf Nb < 2 Or Nb Mod 2 = 0 Then
Exit Function
Else
Dim i As Long
For i = 3 To Sqr(Nb) Step 2
If Nb Mod i = 0 Then Exit Function
Next
IsPrime = True
End If
End Function
| #include <cmath>
bool is_prime(unsigned int n)
{
if (n <= 1)
return false;
if (n == 2)
return true;
for (unsigned int i = 2; i <= sqrt(n); ++i)
if (n % i == 0)
return false;
return true;
}
|
Keep all operations the same but rewrite the snippet in C++. | Function binomial(n,k)
binomial = factorial(n)/(factorial(n-k)*factorial(k))
End Function
Function factorial(n)
If n = 0 Then
factorial = 1
Else
For i = n To 1 Step -1
If i = n Then
factorial = n
Else
factorial = factorial * i
End If
Next
End If
End Function
WScript.StdOut.Write "the binomial coefficient of 5 and 3 = " & binomial(5,3)
WScript.StdOut.WriteLine
| double Factorial(double nValue)
{
double result = nValue;
double result_next;
double pc = nValue;
do
{
result_next = result*(pc-1);
result = result_next;
pc--;
}while(pc>2);
nValue = result;
return nValue;
}
double binomialCoefficient(double n, double k)
{
if (abs(n - k) < 1e-7 || k < 1e-7) return 1.0;
if( abs(k-1.0) < 1e-7 || abs(k - (n-1)) < 1e-7)return n;
return Factorial(n) /(Factorial(k)*Factorial((n - k)));
}
|
Produce a functionally identical C++ code for the snippet given in VB. | Dim coll As New Collection
coll.Add "apple"
coll.Add "banana"
| int a[5];
a[0] = 1;
int primes[10] = { 2, 3, 5, 7, 11, 13, 17, 19, 23, 29 };
#include <string>
std::string strings[4];
|
Generate an equivalent PHP version of this C# code. | static void bitwise(int a, int b)
{
Console.WriteLine("a and b is {0}", a & b);
Console.WriteLine("a or b is {0}", a | b);
Console.WriteLine("a xor b is {0}", a ^ b);
Console.WriteLine("not a is {0}", ~a);
Console.WriteLine("a lshift b is {0}", a << b);
Console.WriteLine("a arshift b is {0}", a >> b);
uint c = (uint)a;
Console.WriteLine("c rshift b is {0}", c >> b);
}
| function bitwise($a, $b)
{
function zerofill($a,$b) {
if($a>=0) return $a>>$b;
if($b==0) return (($a>>1)&0x7fffffff)*2+(($a>>$b)&1); // this line shifts a 0 into the sign bit for compatibility, replace with "if($b==0) return $a;" if you need $b=0 to mean that nothing happens
return ((~$a)>>$b)^(0x7fffffff>>($b-1));
echo '$a AND $b: ' . $a & $b . '\n';
echo '$a OR $b: ' . $a | $b . '\n';
echo '$a XOR $b: ' . $a ^ $b . '\n';
echo 'NOT $a: ' . ~$a . '\n';
echo '$a << $b: ' . $a << $b . '\n'; // left shift
echo '$a >> $b: ' . $a >> $b . '\n'; // arithmetic right shift
echo 'zerofill($a, $b): ' . zerofill($a, $b) . '\n'; // logical right shift
}
|
Port the provided C# code into PHP while preserving the original functionality. | foreach (string readLine in File.ReadLines("FileName"))
DoSomething(readLine);
| <?php
$file = fopen(__FILE__, 'r'); // read current file
while ($line = fgets($file)) {
$line = rtrim($line); // removes linebreaks and spaces at end
echo strrev($line) . "\n"; // reverse line and upload it
}
|
Change the programming language of this snippet from C# to PHP without modifying what it does. | public static class BaseConverter {
public static long stringToLong(string s, int b) {
if ( b < 2 || b > 36 )
throw new ArgumentException("Base must be between 2 and 36", "b");
checked {
int slen = s.Length;
long result = 0;
bool isNegative = false;
for ( int i = 0; i < slen; i++ ) {
char c = s[i];
int num;
if ( c == '-' ) {
if ( i != 0 )
throw new ArgumentException("A negative sign is allowed only as the first character of the string.", "s");
isNegative = true;
continue;
}
if ( c > 0x2F && c < 0x3A )
num = c - 0x30;
else if ( c > 0x40 && c < 0x5B )
num = c - 0x37;
else if ( c > 0x60 && c < 0x7B )
num = c - 0x57;
else
throw new ArgumentException("The string contains an invalid character '" + c + "'", "s");
if ( num >= b )
throw new ArgumentException("The string contains a character '" + c + "' which is not allowed in base " + b, "s");
result *= b;
result += num;
}
if ( isNegative )
result = -result;
return result;
}
}
public static string longToString(long n, int b) {
if ( b < 2 || b > 36 )
throw new ArgumentException("Base must be between 2 and 36", "b");
if ( b == 10 )
return n.ToString();
checked {
long longBase = b;
StringBuilder sb = new StringBuilder();
if ( n < 0 ) {
n = -n;
sb.Append('-');
}
long div = 1;
while ( n / div >= b )
div *= b;
while ( true ) {
byte digit = (byte) (n / div);
if ( digit < 10 )
sb.Append((char) (digit + 0x30));
else
sb.Append((char) (digit + 0x57));
if ( div == 1 )
break;
n %= div;
div /= b;
}
return sb.ToString();
}
}
}
| base_convert("26", 10, 16); // returns "1a"
|
Generate an equivalent PHP version of this C# code. | using System;
using System.Collections.Generic;
using System.IO;
using System.Linq;
namespace RosettaRecursiveDirectory
{
class Program
{
static IEnumerable<FileInfo> TraverseDirectory(string rootPath, Func<FileInfo, bool> Pattern)
{
var directoryStack = new Stack<DirectoryInfo>();
directoryStack.Push(new DirectoryInfo(rootPath));
while (directoryStack.Count > 0)
{
var dir = directoryStack.Pop();
try
{
foreach (var i in dir.GetDirectories())
directoryStack.Push(i);
}
catch (UnauthorizedAccessException) {
continue;
}
foreach (var f in dir.GetFiles().Where(Pattern))
yield return f;
}
}
static void Main(string[] args)
{
foreach (var file in TraverseDirectory(@"C:\Windows", f => f.Extension == ".wmv"))
Console.WriteLine(file.FullName);
Console.WriteLine("Done.");
}
}
}
| function findFiles($dir = '.', $pattern = '/./'){
$prefix = $dir . '/';
$dir = dir($dir);
while (false !== ($file = $dir->read())){
if ($file === '.' || $file === '..') continue;
$file = $prefix . $file;
if (is_dir($file)) findFiles($file, $pattern);
if (preg_match($pattern, $file)){
echo $file . "\n";
}
}
}
findFiles('./foo', '/\.bar$/');
|
Rewrite the snippet below in PHP so it works the same as the original C# code. |
public class Crc32
{
#region Constants
private const UInt32 s_generator = 0xEDB88320;
#endregion
#region Constructors
public Crc32()
{
m_checksumTable = Enumerable.Range(0, 256).Select(i =>
{
var tableEntry = (uint)i;
for (var j = 0; j < 8; ++j)
{
tableEntry = ((tableEntry & 1) != 0)
? (s_generator ^ (tableEntry >> 1))
: (tableEntry >> 1);
}
return tableEntry;
}).ToArray();
}
#endregion
#region Methods
public UInt32 Get<T>(IEnumerable<T> byteStream)
{
try
{
return ~byteStream.Aggregate(0xFFFFFFFF, (checksumRegister, currentByte) =>
(m_checksumTable[(checksumRegister & 0xFF) ^ Convert.ToByte(currentByte)] ^ (checksumRegister >> 8)));
}
catch (FormatException e)
{
throw new CrcException("Could not read the stream out as bytes.", e);
}
catch (InvalidCastException e)
{
throw new CrcException("Could not read the stream out as bytes.", e);
}
catch (OverflowException e)
{
throw new CrcException("Could not read the stream out as bytes.", e);
}
}
#endregion
#region Fields
private readonly UInt32[] m_checksumTable;
#endregion
}
| printf("%x\n", crc32("The quick brown fox jumps over the lazy dog"));
|
Change the following C# code into PHP without altering its purpose. | public class MyClass
{
public MyClass()
{
}
public void SomeMethod()
{
}
private int _variable;
public int Variable
{
get { return _variable; }
set { _variable = value; }
}
public static void Main()
{
MyClass instance = new MyClass();
instance.SomeMethod();
instance.Variable = 99;
System.Console.WriteLine( "Variable=" + instance.Variable.ToString() );
}
}
| class MyClass {
public static $classVar;
public $instanceVar; // can also initialize it here
function __construct() {
$this->instanceVar = 0;
}
function someMethod() {
$this->instanceVar = 1;
self::$classVar = 3;
}
}
$myObj = new MyClass();
|
Change the programming language of this snippet from C# to PHP without modifying what it does. | using System;
using System.Collections.Generic;
public class KaprekarNumbers {
public static void Main() {
int count = 0;
foreach ( ulong i in _kaprekarGenerator(999999) ) {
Console.WriteLine(i);
count++;
}
Console.WriteLine("There are {0} Kaprekar numbers less than 1000000.", count);
}
private static IEnumerable<ulong> _kaprekarGenerator(ulong max) {
ulong next = 1;
yield return next;
for ( next = 2; next <= max; next++ ) {
ulong square = next * next;
for ( ulong check = 10; check <= 10000000000000000000; check *= 10 ) {
if ( square <= check )
break;
ulong r = square % check;
ulong q = (square - r) / check;
if ( r != 0 && q + r == next ) {
yield return next;
break;
}
}
}
}
}
| set_time_limit(300);
print_r(array_filter(range(1, 10000), 'isKaprekar'));
echo count(array_filter(range(1, 1000000), 'isKaprekar'));
function isKaprekar($n) {
$a = $n * $n;
$b = bcmod("$a", "10");
for ($d = 1, $t = 0; $a > 0; $d *= 10) {
$b += $t * $d;
if ($b > $n) break;
$a = floor($a / 10);
if ($b && $a + $b == $n)
return true;
$t = bcmod("$a", "10");
}
return false;
}
|
Convert this C# snippet to PHP and keep its semantics consistent. | using System;
using System.Collections.Generic;
public class KaprekarNumbers {
public static void Main() {
int count = 0;
foreach ( ulong i in _kaprekarGenerator(999999) ) {
Console.WriteLine(i);
count++;
}
Console.WriteLine("There are {0} Kaprekar numbers less than 1000000.", count);
}
private static IEnumerable<ulong> _kaprekarGenerator(ulong max) {
ulong next = 1;
yield return next;
for ( next = 2; next <= max; next++ ) {
ulong square = next * next;
for ( ulong check = 10; check <= 10000000000000000000; check *= 10 ) {
if ( square <= check )
break;
ulong r = square % check;
ulong q = (square - r) / check;
if ( r != 0 && q + r == next ) {
yield return next;
break;
}
}
}
}
}
| set_time_limit(300);
print_r(array_filter(range(1, 10000), 'isKaprekar'));
echo count(array_filter(range(1, 1000000), 'isKaprekar'));
function isKaprekar($n) {
$a = $n * $n;
$b = bcmod("$a", "10");
for ($d = 1, $t = 0; $a > 0; $d *= 10) {
$b += $t * $d;
if ($b > $n) break;
$a = floor($a / 10);
if ($b && $a + $b == $n)
return true;
$t = bcmod("$a", "10");
}
return false;
}
|
Rewrite this program in PHP while keeping its functionality equivalent to the C# version. | static int Fib(int n)
{
if (n < 0) throw new ArgumentException("Must be non negativ", "n");
Func<int, int> fib = null;
fib = p => p > 1 ? fib(p - 2) + fib(p - 1) : p;
return fib(n);
}
| <?php
function fib($n) {
if ($n < 0)
throw new Exception('Negative numbers not allowed');
$f = function($n) { // This function must be called using call_user_func() only
if ($n < 2)
return 1;
else {
$g = debug_backtrace()[1]['args'][0];
return call_user_func($g, $n-1) + call_user_func($g, $n-2);
}
};
return call_user_func($f, $n);
}
echo fib(8), "\n";
?>
|
Transform the following C# implementation into PHP, maintaining the same output and logic. | using System;
using System.IO;
class Program {
static void Main(string[] args) {
File.Create("output.txt");
File.Create(@"\output.txt");
Directory.CreateDirectory("docs");
Directory.CreateDirectory(@"\docs");
}
}
| <?php
touch('output.txt');
mkdir('docs');
touch('/output.txt');
mkdir('/docs');
?>
|
Write the same code in PHP as shown below in C#. | using System;
interface IOperable
{
string Operate();
}
class Inoperable
{
}
class Operable : IOperable
{
public string Operate()
{
return "Delegate implementation.";
}
}
class Delegator : IOperable
{
object Delegate;
public string Operate()
{
var operable = Delegate as IOperable;
return operable != null ? operable.Operate() : "Default implementation.";
}
static void Main()
{
var delegator = new Delegator();
foreach (var @delegate in new object[] { null, new Inoperable(), new Operable() })
{
delegator.Delegate = @delegate;
Console.WriteLine(delegator.Operate());
}
}
}
| class Delegator {
function __construct() {
$this->delegate = NULL ;
}
function operation() {
if(method_exists($this->delegate, "thing"))
return $this->delegate->thing() ;
return 'default implementation' ;
}
}
class Delegate {
function thing() {
return 'Delegate Implementation' ;
}
}
$a = new Delegator() ;
print "{$a->operation()}\n" ;
$a->delegate = 'A delegate may be any object' ;
print "{$a->operation()}\n" ;
$a->delegate = new Delegate() ;
print "{$a->operation()}\n" ;
|
Keep all operations the same but rewrite the snippet in PHP. | using System;
namespace RosettaCode {
class Program {
static void Main(string[] args) {
for (int i = 0; i < args.Length; i++)
Console.WriteLine(String.Format("Argument {0} is '{1}'", i, args[i]));
}
}
}
| <?php
$program_name = $argv[0];
$second_arg = $argv[2];
$all_args_without_program_name = array_shift($argv);
|
Port the following code from C# to PHP with equivalent syntax and logic. | using System;
namespace RosettaCode {
class Program {
static void Main(string[] args) {
for (int i = 0; i < args.Length; i++)
Console.WriteLine(String.Format("Argument {0} is '{1}'", i, args[i]));
}
}
}
| <?php
$program_name = $argv[0];
$second_arg = $argv[2];
$all_args_without_program_name = array_shift($argv);
|
Change the programming language of this snippet from C# to PHP without modifying what it does. | using System;
namespace RosettaCode
{
class Program
{
static void Main(string[] args)
{
int[] a = { 1, 2, 3 };
int[] b = { 4, 5, 6 };
int[] c = new int[a.Length + b.Length];
a.CopyTo(c, 0);
b.CopyTo(c, a.Length);
foreach(int n in c)
{
Console.WriteLine(n.ToString());
}
}
}
}
| $arr1 = array(1, 2, 3);
$arr2 = array(4, 5, 6);
$arr3 = array_merge($arr1, $arr2);
|
Transform the following C# implementation into PHP, maintaining the same output and logic. | using System;
namespace C_Sharp_Console {
class example {
static void Main() {
string word;
int num;
Console.Write("Enter an integer: ");
num = Console.Read();
Console.Write("Enter a String: ");
word = Console.ReadLine();
}
}
}
| #!/usr/bin/php
<?php
$string = fgets(STDIN);
$integer = (int) fgets(STDIN);
|
Convert this C# block to PHP, preserving its control flow and logic. | using System;
using System.Collections.Generic;
namespace Tests_With_Framework_4
{
class Bag : IEnumerable<Bag.Item>
{
List<Item> items;
const int MaxWeightAllowed = 400;
public Bag()
{
items = new List<Item>();
}
void AddItem(Item i)
{
if ((TotalWeight + i.Weight) <= MaxWeightAllowed)
items.Add(i);
}
public void Calculate(List<Item> items)
{
foreach (Item i in Sorte(items))
{
AddItem(i);
}
}
List<Item> Sorte(List<Item> inputItems)
{
List<Item> choosenItems = new List<Item>();
for (int i = 0; i < inputItems.Count; i++)
{
int j = -1;
if (i == 0)
{
choosenItems.Add(inputItems[i]);
}
if (i > 0)
{
if (!RecursiveF(inputItems, choosenItems, i, choosenItems.Count - 1, false, ref j))
{
choosenItems.Add(inputItems[i]);
}
}
}
return choosenItems;
}
bool RecursiveF(List<Item> knapsackItems, List<Item> choosenItems, int i, int lastBound, bool dec, ref int indxToAdd)
{
if (!(lastBound < 0))
{
if ( knapsackItems[i].ResultWV < choosenItems[lastBound].ResultWV )
{
indxToAdd = lastBound;
}
return RecursiveF(knapsackItems, choosenItems, i, lastBound - 1, true, ref indxToAdd);
}
if (indxToAdd > -1)
{
choosenItems.Insert(indxToAdd, knapsackItems[i]);
return true;
}
return false;
}
#region IEnumerable<Item> Members
IEnumerator<Item> IEnumerable<Item>.GetEnumerator()
{
foreach (Item i in items)
yield return i;
}
#endregion
#region IEnumerable Members
System.Collections.IEnumerator System.Collections.IEnumerable.GetEnumerator()
{
return items.GetEnumerator();
}
#endregion
public int TotalWeight
{
get
{
var sum = 0;
foreach (Item i in this)
{
sum += i.Weight;
}
return sum;
}
}
public class Item
{
public string Name { get; set; } public int Weight { get; set; } public int Value { get; set; } public int ResultWV { get { return Weight-Value; } }
public override string ToString()
{
return "Name : " + Name + " Wieght : " + Weight + " Value : " + Value + " ResultWV : " + ResultWV;
}
}
}
class Program
{
static void Main(string[] args)
{List<Bag.Item> knapsackItems = new List<Bag.Item>();
knapsackItems.Add(new Bag.Item() { Name = "Map", Weight = 9, Value = 150 });
knapsackItems.Add(new Bag.Item() { Name = "Water", Weight = 153, Value = 200 });
knapsackItems.Add(new Bag.Item() { Name = "Compass", Weight = 13, Value = 35 });
knapsackItems.Add(new Bag.Item() { Name = "Sandwitch", Weight = 50, Value = 160 });
knapsackItems.Add(new Bag.Item() { Name = "Glucose", Weight = 15, Value = 60 });
knapsackItems.Add(new Bag.Item() { Name = "Tin", Weight = 68, Value = 45 });
knapsackItems.Add(new Bag.Item() { Name = "Banana", Weight = 27, Value = 60 });
knapsackItems.Add(new Bag.Item() { Name = "Apple", Weight = 39, Value = 40 });
knapsackItems.Add(new Bag.Item() { Name = "Cheese", Weight = 23, Value = 30 });
knapsackItems.Add(new Bag.Item() { Name = "Beer", Weight = 52, Value = 10 });
knapsackItems.Add(new Bag.Item() { Name = "Suntan Cream", Weight = 11, Value = 70 });
knapsackItems.Add(new Bag.Item() { Name = "Camera", Weight = 32, Value = 30 });
knapsackItems.Add(new Bag.Item() { Name = "T-shirt", Weight = 24, Value = 15 });
knapsackItems.Add(new Bag.Item() { Name = "Trousers", Weight = 48, Value = 10 });
knapsackItems.Add(new Bag.Item() { Name = "Umbrella", Weight = 73, Value = 40 });
knapsackItems.Add(new Bag.Item() { Name = "WaterProof Trousers", Weight = 42, Value = 70 });
knapsackItems.Add(new Bag.Item() { Name = "Note-Case", Weight = 22, Value = 80 });
knapsackItems.Add(new Bag.Item() { Name = "Sunglasses", Weight = 7, Value = 20 });
knapsackItems.Add(new Bag.Item() { Name = "Towel", Weight = 18, Value = 12 });
knapsackItems.Add(new Bag.Item() { Name = "Socks", Weight = 4, Value = 50 });
knapsackItems.Add(new Bag.Item() { Name = "Book", Weight = 30, Value = 10 });
knapsackItems.Add(new Bag.Item() { Name = "waterproof overclothes ", Weight = 43, Value = 75 });
Bag b = new Bag();
b.Calculate(knapsackItems);
b.All(x => { Console.WriteLine(x); return true; });
Console.WriteLine(b.Sum(x => x.Weight));
Console.ReadKey();
}
}
}
| #########################################################
# 0-1 Knapsack Problem Solve with memoization optimize and index returns
# $w = weight of item
# $v = value of item
# $i = index
# $aW = Available Weight
# $m = Memo items array
# PHP Translation from Python, Memoization,
# and index return functionality added by Brian Berneker
#
#########################################################
function knapSolveFast2($w, $v, $i, $aW, &$m) {
global $numcalls;
$numcalls ++;
if (isset($m[$i][$aW])) {
return array( $m[$i][$aW], $m['picked'][$i][$aW] );
} else {
if ($i == 0) {
if ($w[$i] <= $aW) { // Will this item fit?
$m[$i][$aW] = $v[$i]; // Memo this item
$m['picked'][$i][$aW] = array($i); // and the picked item
return array($v[$i],array($i)); // Return the value of this item and add it to the picked list
} else {
$m[$i][$aW] = 0; // Memo zero
$m['picked'][$i][$aW] = array(); // and a blank array entry...
return array(0,array()); // Return nothing
}
}
list ($without_i, $without_PI) = knapSolveFast2($w, $v, $i-1, $aW, $m);
if ($w[$i] > $aW) { // Does it return too many?
$m[$i][$aW] = $without_i; // Memo without including this one
$m['picked'][$i][$aW] = $without_PI; // and a blank array entry...
return array($without_i, $without_PI); // and return it
} else {
list ($with_i,$with_PI) = knapSolveFast2($w, $v, ($i-1), ($aW - $w[$i]), $m);
$with_i += $v[$i]; // ..and add the value of this one..
if ($with_i > $without_i) {
$res = $with_i;
$picked = $with_PI;
array_push($picked,$i);
} else {
$res = $without_i;
$picked = $without_PI;
}
$m[$i][$aW] = $res; // Store it in the memo
$m['picked'][$i][$aW] = $picked; // and store the picked item
return array ($res,$picked); // and then return it
}
}
}
$items4 = array("map","compass","water","sandwich","glucose","tin","banana","apple","cheese","beer","suntan cream","camera","t-shirt","trousers","umbrella","waterproof trousers","waterproof overclothes","note-case","sunglasses","towel","socks","book");
$w4 = array(9,13,153,50,15,68,27,39,23,52,11,32,24,48,73,42,43,22,7,18,4,30);
$v4 = array(150,35,200,160,60,45,60,40,30,10,70,30,15,10,40,70,75,80,20,12,50,10);
## Initialize
$numcalls = 0; $m = array(); $pickedItems = array();
## Solve
list ($m4,$pickedItems) = knapSolveFast2($w4, $v4, sizeof($v4) -1, 400, $m);
# Display Result
echo "<b>Items:</b><br>".join(", ",$items4)."<br>";
echo "<b>Max Value Found:</b><br>$m4 (in $numcalls calls)<br>";
echo "<b>Array Indices:</b><br>".join(",",$pickedItems)."<br>";
echo "<b>Chosen Items:</b><br>";
echo "<table border cellspacing=0>";
echo "<tr><td>Item</td><td>Value</td><td>Weight</td></tr>";
$totalVal = $totalWt = 0;
foreach($pickedItems as $key) {
$totalVal += $v4[$key];
$totalWt += $w4[$key];
echo "<tr><td>".$items4[$key]."</td><td>".$v4[$key]."</td><td>".$w4[$key]."</td></tr>";
}
echo "<tr><td align=right><b>Totals</b></td><td>$totalVal</td><td>$totalWt</td></tr>";
echo "</table><hr>";
|
Please provide an equivalent version of this C# code in PHP. | using System;
class Program
{
static void Main(string[] args)
{
var cube = new Func<double, double>(x => Math.Pow(x, 3.0));
var croot = new Func<double, double>(x => Math.Pow(x, 1 / 3.0));
var functionTuples = new[]
{
(forward: Math.Sin, backward: Math.Asin),
(forward: Math.Cos, backward: Math.Acos),
(forward: cube, backward: croot)
};
foreach (var ft in functionTuples)
{
Console.WriteLine(ft.backward(ft.forward(0.5)));
}
}
}
| $compose = function ($f, $g) {
return function ($x) use ($f, $g) {
return $f($g($x));
};
};
$fn = array('sin', 'cos', function ($x) { return pow($x, 3); });
$inv = array('asin', 'acos', function ($x) { return pow($x, 1/3); });
for ($i = 0; $i < 3; $i++) {
$f = $compose($inv[$i], $fn[$i]);
echo $f(0.5), PHP_EOL;
}
|
Port the following code from C# to PHP with equivalent syntax and logic. | namespace RosettaCode.ProperDivisors
{
using System;
using System.Collections.Generic;
using System.Linq;
internal static class Program
{
private static IEnumerable<int> ProperDivisors(int number)
{
return
Enumerable.Range(1, number / 2)
.Where(divisor => number % divisor == 0);
}
private static void Main()
{
foreach (var number in Enumerable.Range(1, 10))
{
Console.WriteLine("{0}: {{{1}}}", number,
string.Join(", ", ProperDivisors(number)));
}
var record = Enumerable.Range(1, 20000).Select(number => new
{
Number = number,
Count = ProperDivisors(number).Count()
}).OrderByDescending(currentRecord => currentRecord.Count).First();
Console.WriteLine("{0}: {1}", record.Number, record.Count);
}
}
}
| <?php
function ProperDivisors($n) {
yield 1;
$large_divisors = [];
for ($i = 2; $i <= sqrt($n); $i++) {
if ($n % $i == 0) {
yield $i;
if ($i*$i != $n) {
$large_divisors[] = $n / $i;
}
}
}
foreach (array_reverse($large_divisors) as $i) {
yield $i;
}
}
assert([1, 2, 4, 5, 10, 20, 25, 50] ==
iterator_to_array(ProperDivisors(100)));
foreach (range(1, 10) as $n) {
echo "$n =>";
foreach (ProperDivisors($n) as $divisor) {
echo " $divisor";
}
echo "\n";
}
$divisorsCount = [];
for ($i = 1; $i < 20000; $i++) {
$divisorsCount[sizeof(iterator_to_array(ProperDivisors($i)))][] = $i;
}
ksort($divisorsCount);
echo "Numbers with most divisors: ", implode(", ", end($divisorsCount)), ".\n";
echo "They have ", key($divisorsCount), " divisors.\n";
|
Translate this program into PHP but keep the logic exactly as in C#. | using System;
using System.Text.RegularExpressions;
class Program {
static void Main(string[] args) {
string str = "I am a string";
if (new Regex("string$").IsMatch(str)) {
Console.WriteLine("Ends with string.");
}
str = new Regex(" a ").Replace(str, " another ");
Console.WriteLine(str);
}
}
| $string = 'I am a string';
# Test
if (preg_match('/string$/', $string))
{
echo "Ends with 'string'\n";
}
# Replace
$string = preg_replace('/\ba\b/', 'another', $string);
echo "Found 'a' and replace it with 'another', resulting in this string: $string\n";
|
Translate this program into PHP but keep the logic exactly as in C#. | static class Program
{
static void Main()
{
System.Collections.Hashtable h = new System.Collections.Hashtable();
string[] keys = { "foo", "bar", "val" };
string[] values = { "little", "miss", "muffet" };
System.Diagnostics.Trace.Assert(keys.Length == values.Length, "Arrays are not same length.");
for (int i = 0; i < keys.Length; i++)
{
h.Add(keys[i], values[i]);
}
}
}
| $keys = array('a', 'b', 'c');
$values = array(1, 2, 3);
$hash = array_combine($keys, $values);
|
Rewrite the snippet below in PHP so it works the same as the original C# code. | using System;
using System.Linq;
using System.Collections.Generic;
public struct Card
{
public Card(string rank, string suit) : this()
{
Rank = rank;
Suit = suit;
}
public string Rank { get; }
public string Suit { get; }
public override string ToString() => $"{Rank} of {Suit}";
}
public class Deck : IEnumerable<Card>
{
static readonly string[] ranks = { "Two", "Three", "Four", "Five", "Six",
"Seven", "Eight", "Nine", "Ten", "Jack", "Queen", "King", "Ace" };
static readonly string[] suits = { "Clubs", "Diamonds", "Hearts", "Spades" };
readonly List<Card> cards;
public Deck() {
cards = (from suit in suits
from rank in ranks
select new Card(rank, suit)).ToList();
}
public int Count => cards.Count;
public void Shuffle() {
var random = new Random();
for (int i = 0; i < cards.Count; i++) {
int r = random.Next(i, cards.Count);
var temp = cards[i];
cards[i] = cards[r];
cards[r] = temp;
}
}
public Card Deal() {
int last = cards.Count - 1;
Card card = cards[last];
cards.RemoveAt(last);
return card;
}
public IEnumerator<Card> GetEnumerator() {
for (int i = cards.Count - 1; i >= 0; i--)
yield return cards[i];
}
System.Collections.IEnumerator System.Collections.IEnumerable.GetEnumerator() => GetEnumerator();
}
| class Card
{
protected static $suits = array( '♠', '♥', '♦', '♣' );
protected static $pips = array( '2', '3', '4', '5', '6', '7', '8', '9', 'T', 'J', 'Q', 'K', 'A' );
protected $suit;
protected $suitOrder;
protected $pip;
protected $pipOrder;
protected $order;
public function __construct( $suit, $pip )
{
if( !in_array( $suit, self::$suits ) )
{
throw new InvalidArgumentException( 'Invalid suit' );
}
if( !in_array( $pip, self::$pips ) )
{
throw new InvalidArgumentException( 'Invalid pip' );
}
$this->suit = $suit;
$this->pip = $pip;
}
public function getSuit()
{
return $this->suit;
}
public function getPip()
{
return $this->pip;
}
public function getSuitOrder()
{
if( !isset( $this->suitOrder ) )
{
$this->suitOrder = array_search( $this->suit, self::$suits );
}
return $this->suitOrder;
}
public function getPipOrder()
{
if( !isset( $this->pipOrder ) )
{
$this->pipOrder = array_search( $this->pip, self::$pips );
}
return $this->pipOrder;
}
public function getOrder()
{
if( !isset( $this->order ) )
{
$suitOrder = $this->getSuitOrder();
$pipOrder = $this->getPipOrder();
$this->order = $pipOrder * count( self::$suits ) + $suitOrder;
}
return $this->order;
}
public function compareSuit( Card $other )
{
return $this->getSuitOrder() - $other->getSuitOrder();
}
public function comparePip( Card $other )
{
return $this->getPipOrder() - $other->getPipOrder();
}
public function compare( Card $other )
{
return $this->getOrder() - $other->getOrder();
}
public function __toString()
{
return $this->suit . $this->pip;
}
public static function getSuits()
{
return self::$suits;
}
public static function getPips()
{
return self::$pips;
}
}
class CardCollection
implements Countable, Iterator
{
protected $cards = array();
protected function __construct( array $cards = array() )
{
foreach( $cards as $card )
{
$this->addCard( $card );
}
}
public function count()
{
return count( $this->cards );
}
public function key()
{
return key( $this->cards );
}
public function valid()
{
return null !== $this->key();
}
public function next()
{
next( $this->cards );
}
public function current()
{
return current( $this->cards );
}
public function rewind()
{
reset( $this->cards );
}
public function sort( $comparer = null )
{
$comparer = $comparer ?: function( $a, $b ) {
return $a->compare( $b );
};
if( !is_callable( $comparer ) )
{
throw new InvalidArgumentException( 'Invalid comparer; comparer should be callable' );
}
usort( $this->cards, $comparer );
return $this;
}
public function toString()
{
return implode( ' ', $this->cards );
}
public function __toString()
{
return $this->toString();
}
protected function addCard( Card $card )
{
if( in_array( $card, $this->cards ) )
{
throw new DomainException( 'Card is already present in this collection' );
}
$this->cards[] = $card;
}
}
class Deck
extends CardCollection
{
public function __construct( $shuffled = false )
{
foreach( Card::getSuits() as $suit )
{
foreach( Card::getPips() as $pip )
{
$this->addCard( new Card( $suit, $pip ) );
}
}
if( $shuffled )
{
$this->shuffle();
}
}
public function deal( $amount = 1, CardCollection $cardCollection = null )
{
if( !is_int( $amount ) || $amount < 1 )
{
throw new InvalidArgumentException( 'Invalid amount; amount should be an integer, larger than 0' );
}
if( $amount > count( $this->cards ) )
{
throw new RangeException( 'Invalid amount; requested amount is larger than the amount of available cards' );
}
$cards = array_splice( $this->cards, 0, $amount );
$cardCollection = $cardCollection ?: new CardCollection;
foreach( $cards as $card )
{
$cardCollection->addCard( $card );
}
return $cardCollection;
}
public function shuffle()
{
shuffle( $this->cards );
}
}
class Hand
extends CardCollection
{
public function __construct() {}
public function play( $position )
{
if( !isset( $this->cards[ $position ] ) )
{
throw new OutOfBoundsException( 'Invalid position; position is not present in this hand' );
}
$result = array_splice( $this->cards, $position, 1 );
return $result[ 0 ];
}
}
|
Translate the given C# code snippet into PHP without altering its behavior. | int[] numbers = new int[10];
| $NumberArray = array(0, 1, 2, 3, 4, 5, 6);
$LetterArray = array("a", "b", "c", "d", "e", "f");
$simpleForm = ['apple', 'orange'];
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.