Instruction
stringlengths
45
106
input_code
stringlengths
1
13.7k
output_code
stringlengths
1
13.7k
Write the same algorithm in C# as shown in this Python implementation.
import random class Card(object): suits = ("Clubs","Hearts","Spades","Diamonds") pips = ("2","3","4","5","6","7","8","9","10","Jack","Queen","King","Ace") def __init__(self, pip,suit): self.pip=pip self.suit=suit def __str__(self): return "%s %s"%(self.pip,self.suit) class Deck(object): def __init__(self): self.deck = [Card(pip,suit) for suit in Card.suits for pip in Card.pips] def __str__(self): return "[%s]"%", ".join( (str(card) for card in self.deck)) def shuffle(self): random.shuffle(self.deck) def deal(self): self.shuffle() return self.deck.pop(0)
using System; using System.Linq; using System.Collections.Generic; public struct Card { public Card(string rank, string suit) : this() { Rank = rank; Suit = suit; } public string Rank { get; } public string Suit { get; } public override string ToString() => $"{Rank} of {Suit}"; } public class Deck : IEnumerable<Card> { static readonly string[] ranks = { "Two", "Three", "Four", "Five", "Six", "Seven", "Eight", "Nine", "Ten", "Jack", "Queen", "King", "Ace" }; static readonly string[] suits = { "Clubs", "Diamonds", "Hearts", "Spades" }; readonly List<Card> cards; public Deck() { cards = (from suit in suits from rank in ranks select new Card(rank, suit)).ToList(); } public int Count => cards.Count; public void Shuffle() { var random = new Random(); for (int i = 0; i < cards.Count; i++) { int r = random.Next(i, cards.Count); var temp = cards[i]; cards[i] = cards[r]; cards[r] = temp; } } public Card Deal() { int last = cards.Count - 1; Card card = cards[last]; cards.RemoveAt(last); return card; } public IEnumerator<Card> GetEnumerator() { for (int i = cards.Count - 1; i >= 0; i--) yield return cards[i]; } System.Collections.IEnumerator System.Collections.IEnumerable.GetEnumerator() => GetEnumerator(); }
Port the provided Python code into C# while preserving the original functionality.
array = [] array.append(1) array.append(3) array[0] = 2 print array[0]
int[] numbers = new int[10];
Ensure the translated C# code behaves exactly like the original Python snippet.
array = [] array.append(1) array.append(3) array[0] = 2 print array[0]
int[] numbers = new int[10];
Translate this program into C# but keep the logic exactly as in Python.
def setup(): size(729, 729) fill(0) background(255) noStroke() rect(width / 3, height / 3, width / 3, width / 3) rectangles(width / 3, height / 3, width / 3) def rectangles(x, y, s): if s < 1: return xc, yc = x - s, y - s for row in range(3): for col in range(3): if not (row == 1 and col == 1): xx, yy = xc + row * s, yc + col * s delta = s / 3 rect(xx + delta, yy + delta, delta, delta) rectangles(xx + s / 3, yy + s / 3, s / 3)
using System; using System.Collections.Generic; using System.Linq; class Program { static List<string> NextCarpet(List<string> carpet) { return carpet.Select(x => x + x + x) .Concat(carpet.Select(x => x + x.Replace('#', ' ') + x)) .Concat(carpet.Select(x => x + x + x)).ToList(); } static List<string> SierpinskiCarpet(int n) { return Enumerable.Range(1, n).Aggregate(new List<string> { "#" }, (carpet, _) => NextCarpet(carpet)); } static void Main(string[] args) { foreach (string s in SierpinskiCarpet(3)) Console.WriteLine(s); } }
Translate the given Python code snippet into C# without altering its behavior.
import random def bogosort(l): while not in_order(l): random.shuffle(l) return l def in_order(l): if not l: return True last = l[0] for x in l[1:]: if x < last: return False last = x return True
using System; using System.Collections.Generic; namespace RosettaCode.BogoSort { public static class BogoSorter { public static void Sort<T>(List<T> list) where T:IComparable { while (!list.isSorted()) { list.Shuffle(); } } private static bool isSorted<T>(this IList<T> list) where T:IComparable { if(list.Count<=1) return true; for (int i = 1 ; i < list.Count; i++) if(list[i].CompareTo(list[i-1])<0) return false; return true; } private static void Shuffle<T>(this IList<T> list) { Random rand = new Random(); for (int i = 0; i < list.Count; i++) { int swapIndex = rand.Next(list.Count); T temp = list[swapIndex]; list[swapIndex] = list[i]; list[i] = temp; } } } class TestProgram { static void Main() { List<int> testList = new List<int> { 3, 4, 1, 8, 7, 4, -2 }; BogoSorter.Sort(testList); foreach (int i in testList) Console.Write(i + " "); } } }
Change the following Python code into C# without altering its purpose.
import pandas as pd df_patients = pd.read_csv (r'patients.csv', sep = ",", decimal=".") df_visits = pd.read_csv (r'visits.csv', sep = ",", decimal=".") df_visits['VISIT_DATE'] = pd.to_datetime(df_visits['VISIT_DATE']) df_merge = df_patients.merge(df_visits, on='PATIENT_ID', how='left') df_group = df_merge.groupby(['PATIENT_ID','LASTNAME'], as_index=False) df_result = df_group.agg({'VISIT_DATE': 'max', 'SCORE': [lambda x: x.sum(min_count=1),'mean']}) print(df_result)
using System; using System.Collections.Generic; using System.Globalization; using System.Linq; using System.Runtime.Serialization; public static class MergeAndAggregateDatasets { public static void Main() { string patientsCsv = @" PATIENT_ID,LASTNAME 1001,Hopper 4004,Wirth 3003,Kemeny 2002,Gosling 5005,Kurtz"; string visitsCsv = @" PATIENT_ID,VISIT_DATE,SCORE 2002,2020-09-10,6.8 1001,2020-09-17,5.5 4004,2020-09-24,8.4 2002,2020-10-08, 1001,,6.6 3003,2020-11-12, 4004,2020-11-05,7.0 1001,2020-11-19,5.3"; string format = "yyyy-MM-dd"; var formatProvider = new DateTimeFormat(format).FormatProvider; var patients = ParseCsv( patientsCsv.Split(Environment.NewLine, StringSplitOptions.RemoveEmptyEntries), line => (PatientId: int.Parse(line[0]), LastName: line[1])); var visits = ParseCsv( visitsCsv.Split(Environment.NewLine, StringSplitOptions.RemoveEmptyEntries), line => ( PatientId: int.Parse(line[0]), VisitDate: DateTime.TryParse(line[1], formatProvider, DateTimeStyles.None, out var date) ? date : default(DateTime?), Score: double.TryParse(line[2], out double score) ? score : default(double?) ) ); var results = patients.GroupJoin(visits, p => p.PatientId, v => v.PatientId, (p, vs) => ( p.PatientId, p.LastName, LastVisit: vs.Max(v => v.VisitDate), ScoreSum: vs.Sum(v => v.Score), ScoreAvg: vs.Average(v => v.Score) ) ).OrderBy(r => r.PatientId); Console.WriteLine("| PATIENT_ID | LASTNAME | LAST_VISIT | SCORE_SUM | SCORE_AVG |"); foreach (var r in results) { Console.WriteLine($"| {r.PatientId,-10} | {r.LastName,-8} | {r.LastVisit?.ToString(format) ?? "",-10} | {r.ScoreSum,9} | {r.ScoreAvg,9} |"); } } private static IEnumerable<T> ParseCsv<T>(string[] contents, Func<string[], T> constructor) { for (int i = 1; i < contents.Length; i++) { var line = contents[i].Split(','); yield return constructor(line); } } }
Preserve the algorithm and functionality while converting the code from Python to C#.
import pandas as pd df_patients = pd.read_csv (r'patients.csv', sep = ",", decimal=".") df_visits = pd.read_csv (r'visits.csv', sep = ",", decimal=".") df_visits['VISIT_DATE'] = pd.to_datetime(df_visits['VISIT_DATE']) df_merge = df_patients.merge(df_visits, on='PATIENT_ID', how='left') df_group = df_merge.groupby(['PATIENT_ID','LASTNAME'], as_index=False) df_result = df_group.agg({'VISIT_DATE': 'max', 'SCORE': [lambda x: x.sum(min_count=1),'mean']}) print(df_result)
using System; using System.Collections.Generic; using System.Globalization; using System.Linq; using System.Runtime.Serialization; public static class MergeAndAggregateDatasets { public static void Main() { string patientsCsv = @" PATIENT_ID,LASTNAME 1001,Hopper 4004,Wirth 3003,Kemeny 2002,Gosling 5005,Kurtz"; string visitsCsv = @" PATIENT_ID,VISIT_DATE,SCORE 2002,2020-09-10,6.8 1001,2020-09-17,5.5 4004,2020-09-24,8.4 2002,2020-10-08, 1001,,6.6 3003,2020-11-12, 4004,2020-11-05,7.0 1001,2020-11-19,5.3"; string format = "yyyy-MM-dd"; var formatProvider = new DateTimeFormat(format).FormatProvider; var patients = ParseCsv( patientsCsv.Split(Environment.NewLine, StringSplitOptions.RemoveEmptyEntries), line => (PatientId: int.Parse(line[0]), LastName: line[1])); var visits = ParseCsv( visitsCsv.Split(Environment.NewLine, StringSplitOptions.RemoveEmptyEntries), line => ( PatientId: int.Parse(line[0]), VisitDate: DateTime.TryParse(line[1], formatProvider, DateTimeStyles.None, out var date) ? date : default(DateTime?), Score: double.TryParse(line[2], out double score) ? score : default(double?) ) ); var results = patients.GroupJoin(visits, p => p.PatientId, v => v.PatientId, (p, vs) => ( p.PatientId, p.LastName, LastVisit: vs.Max(v => v.VisitDate), ScoreSum: vs.Sum(v => v.Score), ScoreAvg: vs.Average(v => v.Score) ) ).OrderBy(r => r.PatientId); Console.WriteLine("| PATIENT_ID | LASTNAME | LAST_VISIT | SCORE_SUM | SCORE_AVG |"); foreach (var r in results) { Console.WriteLine($"| {r.PatientId,-10} | {r.LastName,-8} | {r.LastVisit?.ToString(format) ?? "",-10} | {r.ScoreSum,9} | {r.ScoreAvg,9} |"); } } private static IEnumerable<T> ParseCsv<T>(string[] contents, Func<string[], T> constructor) { for (int i = 1; i < contents.Length; i++) { var line = contents[i].Split(','); yield return constructor(line); } } }
Port the provided Python code into C# while preserving the original functionality.
def euler(f,y0,a,b,h): t,y = a,y0 while t <= b: print "%6.3f %6.3f" % (t,y) t += h y += h * f(t,y) def newtoncooling(time, temp): return -0.07 * (temp - 20) euler(newtoncooling,100,0,100,10)
using System; namespace prog { class MainClass { const float T0 = 100f; const float TR = 20f; const float k = 0.07f; readonly static float[] delta_t = {2.0f,5.0f,10.0f}; const int n = 100; public delegate float func(float t); static float NewtonCooling(float t) { return -k * (t-TR); } public static void Main (string[] args) { func f = new func(NewtonCooling); for(int i=0; i<delta_t.Length; i++) { Console.WriteLine("delta_t = " + delta_t[i]); Euler(f,T0,n,delta_t[i]); } } public static void Euler(func f, float y, int n, float h) { for(float x=0; x<=n; x+=h) { Console.WriteLine("\t" + x + "\t" + y); y += h * f(y); } } } }
Port the provided Python code into C# while preserving the original functionality.
>>> from math import floor, sqrt >>> def non_square(n): return n + floor(1/2 + sqrt(n)) >>> >>> print(*map(non_square, range(1, 23))) 2 3 5 6 7 8 10 11 12 13 14 15 17 18 19 20 21 22 23 24 26 27 >>> >>> def is_square(n): return sqrt(n).is_integer() >>> non_squares = map(non_square, range(1, 10 ** 6)) >>> next(filter(is_square, non_squares)) StopIteration Traceback (most recent call last) <ipython-input-45-f32645fc1c0a> in <module>() 1 non_squares = map(non_square, range(1, 10 ** 6)) ----> 2 next(filter(is_square, non_squares)) StopIteration:
using System; using System.Diagnostics; namespace sons { class Program { static void Main(string[] args) { for (int i = 1; i < 23; i++) Console.WriteLine(nonsqr(i)); for (int i = 1; i < 1000000; i++) { double j = Math.Sqrt(nonsqr(i)); Debug.Assert(j != Math.Floor(j),"Square"); } } static int nonsqr(int i) { return (int)(i + Math.Floor(0.5 + Math.Sqrt(i))); } } }
Translate the given Python code snippet into C# without altering its behavior.
>>> s = 'abcdefgh' >>> n, m, char, chars = 2, 3, 'd', 'cd' >>> >>> s[n-1:n+m-1] 'bcd' >>> >>> s[n-1:] 'bcdefgh' >>> >>> s[:-1] 'abcdefg' >>> >>> indx = s.index(char) >>> s[indx:indx+m] 'def' >>> >>> indx = s.index(chars) >>> s[indx:indx+m] 'cde' >>>
using System; namespace SubString { class Program { static void Main(string[] args) { string s = "0123456789"; const int n = 3; const int m = 2; const char c = '3'; const string z = "345"; Console.WriteLine(s.Substring(n, m)); Console.WriteLine(s.Substring(n, s.Length - n)); Console.WriteLine(s.Substring(0, s.Length - 1)); Console.WriteLine(s.Substring(s.IndexOf(c), m)); Console.WriteLine(s.Substring(s.IndexOf(z), m)); } } }
Maintain the same structure and functionality when rewriting this code in C#.
>>> def jortsort(sequence): return list(sequence) == sorted(sequence) >>> for data in [(1,2,4,3), (14,6,8), ['a', 'c'], ['s', 'u', 'x'], 'CVGH', 'PQRST']: print(f'jortsort({repr(data)}) is {jortsort(data)}') jortsort((1, 2, 4, 3)) is False jortsort((14, 6, 8)) is False jortsort(['a', 'c']) is True jortsort(['s', 'u', 'x']) is True jortsort('CVGH') is False jortsort('PQRST') is True >>>
using System; class Program { public static bool JortSort<T>(T[] array) where T : IComparable, IEquatable<T> { T[] originalArray = (T[]) array.Clone(); Array.Sort(array); for (var i = 0; i < originalArray.Length; i++) { if (!Equals(originalArray[i], array[i])) { return false; } } return true; } }
Translate this program into C# but keep the logic exactly as in Python.
import calendar calendar.isleap(year)
using System; class Program { static void Main() { foreach (var year in new[] { 1900, 1994, 1996, DateTime.Now.Year }) { Console.WriteLine("{0} is {1}a leap year.", year, DateTime.IsLeapYear(year) ? string.Empty : "not "); } } }
Produce a language-to-language conversion: from Python to C#, same semantics.
n=13 print(sorted(range(1,n+1), key=str))
using static System.Console; using static System.Linq.Enumerable; public class Program { public static void Main() { foreach (int n in new [] { 0, 5, 13, 21, -22 }) WriteLine($"{n}: {string.Join(", ", LexOrder(n))}"); } public static IEnumerable<int> LexOrder(int n) => (n < 1 ? Range(n, 2 - n) : Range(1, n)).OrderBy(i => i.ToString()); }
Translate the given Python code snippet into C# without altering its behavior.
TENS = [None, None, "twenty", "thirty", "forty", "fifty", "sixty", "seventy", "eighty", "ninety"] SMALL = ["zero", "one", "two", "three", "four", "five", "six", "seven", "eight", "nine", "ten", "eleven", "twelve", "thirteen", "fourteen", "fifteen", "sixteen", "seventeen", "eighteen", "nineteen"] HUGE = [None, None] + [h + "illion" for h in ("m", "b", "tr", "quadr", "quint", "sext", "sept", "oct", "non", "dec")] def nonzero(c, n, connect=''): return "" if n == 0 else connect + c + spell_integer(n) def last_and(num): if ',' in num: pre, last = num.rsplit(',', 1) if ' and ' not in last: last = ' and' + last num = ''.join([pre, ',', last]) return num def big(e, n): if e == 0: return spell_integer(n) elif e == 1: return spell_integer(n) + " thousand" else: return spell_integer(n) + " " + HUGE[e] def base1000_rev(n): while n != 0: n, r = divmod(n, 1000) yield r def spell_integer(n): if n < 0: return "minus " + spell_integer(-n) elif n < 20: return SMALL[n] elif n < 100: a, b = divmod(n, 10) return TENS[a] + nonzero("-", b) elif n < 1000: a, b = divmod(n, 100) return SMALL[a] + " hundred" + nonzero(" ", b, ' and') else: num = ", ".join([big(e, x) for e, x in enumerate(base1000_rev(n)) if x][::-1]) return last_and(num) if __name__ == '__main__': for n in (0, -3, 5, -7, 11, -13, 17, -19, 23, -29): print('%+4i -> %s' % (n, spell_integer(n))) print('') n = 201021002001 while n: print('%-12i -> %s' % (n, spell_integer(n))) n //= -10 print('%-12i -> %s' % (n, spell_integer(n))) print('')
using System; class NumberNamer { static readonly string[] incrementsOfOne = { "zero", "one", "two", "three", "four", "five", "six", "seven", "eight", "nine", "ten", "eleven", "twelve", "thirteen", "fourteen", "fifteen", "sixteen", "seventeen", "eighteen", "nineteen" }; static readonly string[] incrementsOfTen = { "", "", "twenty", "thirty", "fourty", "fifty", "sixty", "seventy", "eighty", "ninety" }; const string millionName = "million", thousandName = "thousand", hundredName = "hundred", andName = "and"; public static string GetName( int i ) { string output = ""; if( i >= 1000000 ) { output += ParseTriplet( i / 1000000 ) + " " + millionName; i %= 1000000; if( i == 0 ) return output; } if( i >= 1000 ) { if( output.Length > 0 ) { output += ", "; } output += ParseTriplet( i / 1000 ) + " " + thousandName; i %= 1000; if( i == 0 ) return output; } if( output.Length > 0 ) { output += ", "; } output += ParseTriplet( i ); return output; } static string ParseTriplet( int i ) { string output = ""; if( i >= 100 ) { output += incrementsOfOne[i / 100] + " " + hundredName; i %= 100; if( i == 0 ) return output; } if( output.Length > 0 ) { output += " " + andName + " "; } if( i >= 20 ) { output += incrementsOfTen[i / 10]; i %= 10; if( i == 0 ) return output; } if( output.Length > 0 ) { output += " "; } output += incrementsOfOne[i]; return output; } } class Program { static void Main( string[] args ) { Console.WriteLine( NumberNamer.GetName( 1 ) ); Console.WriteLine( NumberNamer.GetName( 234 ) ); Console.WriteLine( NumberNamer.GetName( 31337 ) ); Console.WriteLine( NumberNamer.GetName( 987654321 ) ); } }
Preserve the algorithm and functionality while converting the code from Python to C#.
A = 'I am string' B = 'I am string too' if len(A) > len(B): print('"' + A + '"', 'has length', len(A), 'and is the longest of the two strings') print('"' + B + '"', 'has length', len(B), 'and is the shortest of the two strings') elif len(A) < len(B): print('"' + B + '"', 'has length', len(B), 'and is the longest of the two strings') print('"' + A + '"', 'has length', len(A), 'and is the shortest of the two strings') else: print('"' + A + '"', 'has length', len(A), 'and it is as long as the second string') print('"' + B + '"', 'has length', len(B), 'and it is as long as the second string')
using System; using System.Collections.Generic; namespace example { class Program { static void Main(string[] args) { var strings = new string[] { "abcd", "123456789", "abcdef", "1234567" }; compareAndReportStringsLength(strings); } private static void compareAndReportStringsLength(string[] strings) { if (strings.Length > 0) { char Q = '"'; string hasLength = " has length "; string predicateMax = " and is the longest string"; string predicateMin = " and is the shortest string"; string predicateAve = " and is neither the longest nor the shortest string"; string predicate; (int, int)[] li = new (int, int)[strings.Length]; for (int i = 0; i < strings.Length; i++) li[i] = (strings[i].Length, i); Array.Sort(li, ((int, int) a, (int, int) b) => b.Item1 - a.Item1); int maxLength = li[0].Item1; int minLength = li[strings.Length - 1].Item1; for (int i = 0; i < strings.Length; i++) { int length = li[i].Item1; string str = strings[li[i].Item2]; if (length == maxLength) predicate = predicateMax; else if (length == minLength) predicate = predicateMin; else predicate = predicateAve; Console.WriteLine(Q + str + Q + hasLength + length + predicate); } } } } }
Preserve the algorithm and functionality while converting the code from Python to C#.
import collections, sys def filecharcount(openfile): return sorted(collections.Counter(c for l in openfile for c in l).items()) f = open(sys.argv[1]) print(filecharcount(f))
using System; using System.Collections.Generic; using System.IO; using System.Linq; class Program { static SortedDictionary<TItem, int> GetFrequencies<TItem>(IEnumerable<TItem> items) { var dictionary = new SortedDictionary<TItem, int>(); foreach (var item in items) { if (dictionary.ContainsKey(item)) { dictionary[item]++; } else { dictionary[item] = 1; } } return dictionary; } static void Main(string[] arguments) { var file = arguments.FirstOrDefault(); if (File.Exists(file)) { var text = File.ReadAllText(file); foreach (var entry in GetFrequencies(text)) { Console.WriteLine("{0}: {1}", entry.Key, entry.Value); } } } }
Please provide an equivalent version of this Python code in C#.
next = str(int('123') + 1)
string s = "12345"; s = (int.Parse(s) + 1).ToString(); using System.Numerics; string bis = "123456789012345678999999999"; bis = (BigInteger.Parse(bis) + 1).ToString();
Change the programming language of this snippet from Python to C# without modifying what it does.
>>> def stripchars(s, chars): ... return s.translate(None, chars) ... >>> stripchars("She was a soul stripper. She took my heart!", "aei") 'Sh ws soul strppr. Sh took my hrt!'
using System; public static string RemoveCharactersFromString(string testString, string removeChars) { char[] charAry = removeChars.ToCharArray(); string returnString = testString; foreach (char c in charAry) { while (returnString.IndexOf(c) > -1) { returnString = returnString.Remove(returnString.IndexOf(c), 1); } } return returnString; }
Produce a functionally identical C# code for the snippet given in Python.
from math import fsum def average(x): return fsum(x)/float(len(x)) if x else 0 print (average([0,0,3,1,4,1,5,9,0,0])) print (average([1e20,-1e-20,3,1,4,1,5,9,-1e20,1e-20]))
using System; using System.Linq; class Program { static void Main() { Console.WriteLine(new[] { 1, 2, 3 }.Average()); } }
Can you help me rewrite this code in C# instead of Python, keeping it the same logically?
from __future__ import division import math def hist(source): hist = {}; l = 0; for e in source: l += 1 if e not in hist: hist[e] = 0 hist[e] += 1 return (l,hist) def entropy(hist,l): elist = [] for v in hist.values(): c = v / l elist.append(-c * math.log(c ,2)) return sum(elist) def printHist(h): flip = lambda (k,v) : (v,k) h = sorted(h.iteritems(), key = flip) print 'Sym\thi\tfi\tInf' for (k,v) in h: print '%s\t%f\t%f\t%f'%(k,v,v/l,-math.log(v/l, 2)) source = "1223334444" (l,h) = hist(source); print '.[Results].' print 'Length',l print 'Entropy:', entropy(h, l) printHist(h)
using System; using System.Collections.Generic; namespace Entropy { class Program { public static double logtwo(double num) { return Math.Log(num)/Math.Log(2); } public static void Main(string[] args) { label1: string input = Console.ReadLine(); double infoC=0; Dictionary<char,double> table = new Dictionary<char, double>(); foreach (char c in input) { if (table.ContainsKey(c)) table[c]++; else table.Add(c,1); } double freq; foreach (KeyValuePair<char,double> letter in table) { freq=letter.Value/input.Length; infoC+=freq*logtwo(freq); } infoC*=-1; Console.WriteLine("The Entropy of {0} is {1}",input,infoC); goto label1; } } }
Convert the following code from Python to C#, ensuring the logic remains intact.
def token_with_escape(a, escape = '^', separator = '|'): result = [] token = '' state = 0 for c in a: if state == 0: if c == escape: state = 1 elif c == separator: result.append(token) token = '' else: token += c elif state == 1: token += c state = 0 result.append(token) return result
using System; using System.Text; using System.Collections.Generic; public class TokenizeAStringWithEscaping { public static void Main() { string testcase = "one^|uno||three^^^^|four^^^|^cuatro|"; foreach (var token in testcase.Tokenize(separator: '|', escape: '^')) { Console.WriteLine(": " + token); } } } public static class Extensions { public static IEnumerable<string> Tokenize(this string input, char separator, char escape) { if (input == null) yield break; var buffer = new StringBuilder(); bool escaping = false; foreach (char c in input) { if (escaping) { buffer.Append(c); escaping = false; } else if (c == escape) { escaping = true; } else if (c == separator) { yield return buffer.Flush(); } else { buffer.Append(c); } } if (buffer.Length > 0 || input[input.Length-1] == separator) yield return buffer.Flush(); } public static string Flush(this StringBuilder stringBuilder) { string result = stringBuilder.ToString(); stringBuilder.Clear(); return result; } }
Preserve the algorithm and functionality while converting the code from Python to C#.
print "Hello world!"
Using System; namespace HelloWorld { class Program { static void Main() { Console.Writeln("Hello World!"); } } }
Rewrite this program in C# while keeping its functionality equivalent to the Python version.
print "Hello world!"
Using System; namespace HelloWorld { class Program { static void Main() { Console.Writeln("Hello World!"); } } }
Produce a functionally identical C# code for the snippet given in Python.
>>> dif = lambda s: [x-s[i] for i,x in enumerate(s[1:])] >>> >>> difn = lambda s, n: difn(dif(s), n-1) if n else s >>> s = [90, 47, 58, 29, 22, 32, 55, 5, 55, 73] >>> difn(s, 0) [90, 47, 58, 29, 22, 32, 55, 5, 55, 73] >>> difn(s, 1) [-43, 11, -29, -7, 10, 23, -50, 50, 18] >>> difn(s, 2) [54, -40, 22, 17, 13, -73, 100, -32] >>> from pprint import pprint >>> pprint( [difn(s, i) for i in xrange(10)] ) [[90, 47, 58, 29, 22, 32, 55, 5, 55, 73], [-43, 11, -29, -7, 10, 23, -50, 50, 18], [54, -40, 22, 17, 13, -73, 100, -32], [-94, 62, -5, -4, -86, 173, -132], [156, -67, 1, -82, 259, -305], [-223, 68, -83, 341, -564], [291, -151, 424, -905], [-442, 575, -1329], [1017, -1904], [-2921]]
using System; using System.Collections.Generic; using System.Linq; class Program { static IEnumerable<int> ForwardDifference(IEnumerable<int> sequence, uint order = 1u) { switch (order) { case 0u: return sequence; case 1u: return sequence.Skip(1).Zip(sequence, (next, current) => next - current); default: return ForwardDifference(ForwardDifference(sequence), order - 1u); } } static void Main() { IEnumerable<int> sequence = new[] { 90, 47, 58, 29, 22, 32, 55, 5, 55, 73 }; do { Console.WriteLine(string.Join(", ", sequence)); } while ((sequence = ForwardDifference(sequence)).Any()); } }
Convert this Python block to C#, preserving its control flow and logic.
def prime(a): return not (a < 2 or any(a % x == 0 for x in xrange(2, int(a**0.5) + 1)))
static bool isPrime(int n) { if (n <= 1) return false; for (int i = 2; i * i <= n; i++) if (n % i == 0) return false; return true; }
Convert the following code from Python to C#, ensuring the logic remains intact.
def prime(a): return not (a < 2 or any(a % x == 0 for x in xrange(2, int(a**0.5) + 1)))
static bool isPrime(int n) { if (n <= 1) return false; for (int i = 2; i * i <= n; i++) if (n % i == 0) return false; return true; }
Port the following code from Python to C# with equivalent syntax and logic.
def binomialCoeff(n, k): result = 1 for i in range(1, k+1): result = result * (n-i+1) / i return result if __name__ == "__main__": print(binomialCoeff(5, 3))
using System; namespace BinomialCoefficients { class Program { static void Main(string[] args) { ulong n = 1000000, k = 3; ulong result = biCoefficient(n, k); Console.WriteLine("The Binomial Coefficient of {0}, and {1}, is equal to: {2}", n, k, result); Console.ReadLine(); } static int fact(int n) { if (n == 0) return 1; else return n * fact(n - 1); } static ulong biCoefficient(ulong n, ulong k) { if (k > n - k) { k = n - k; } ulong c = 1; for (uint i = 0; i < k; i++) { c = c * (n - i); c = c / (i + 1); } return c; } } }
Generate an equivalent C# version of this Python code.
collection = [0, '1'] x = collection[0] collection.append(2) collection.insert(0, '-1') y = collection[0] collection.extend([2,'3']) collection += [2,'3'] collection[2:6] len(collection) collection = (0, 1) collection[:] collection[-4:-1] collection[::2] collection="some string" x = collection[::-1] collection[::2] == "some string"[::2] collection.__getitem__(slice(0,len(collection),2)) collection = {0: "zero", 1: "one"} collection['zero'] = 2 collection = set([0, '1'])
int[] intArray = new int[5] { 1, 2, 3, 4, 5 }; int[] intArray = new int[]{ 1, 2, 3, 4, 5 }; int[] intArray = { 1, 2, 3, 4, 5 }; string[] stringArr = new string[5]; stringArr[0] = "string";
Port the provided Python code into C# while preserving the original functionality.
for node in lst: print node.value
var current = [head of list to traverse] while(current != null) { current = current.Next; }
Convert this Python snippet to C# and keep its semantics consistent.
import io ppmfileout = io.StringIO('') def writeppmp3(self, f): self.writeppm(f, ppmformat='P3') def writeppm(self, f, ppmformat='P6'): assert ppmformat in ['P3', 'P6'], 'Format wrong' magic = ppmformat + '\n' comment = ' maxval = max(max(max(bit) for bit in row) for row in self.map) assert ppmformat == 'P3' or 0 <= maxval < 256, 'R,G,B must fit in a byte' if ppmformat == 'P6': fwrite = lambda s: f.write(bytes(s, 'UTF-8')) maxval = 255 else: fwrite = f.write numsize=len(str(maxval)) fwrite(magic) fwrite(comment) fwrite('%i %i\n%i\n' % (self.width, self.height, maxval)) for h in range(self.height-1, -1, -1): for w in range(self.width): r, g, b = self.get(w, h) if ppmformat == 'P3': fwrite(' %*i %*i %*i' % (numsize, r, numsize, g, numsize, b)) else: fwrite('%c%c%c' % (r, g, b)) if ppmformat == 'P3': fwrite('\n') Bitmap.writeppmp3 = writeppmp3 Bitmap.writeppm = writeppm bitmap = Bitmap(4, 4, black) bitmap.fillrect(1, 0, 1, 2, white) bitmap.set(3, 3, Colour(127, 0, 63)) bitmap.writeppmp3(ppmfileout) print(ppmfileout.getvalue()) ppmfileout = open('tmp.ppm', 'wb') bitmap.writeppm(ppmfileout) ppmfileout.close()
using System; using System.IO; class PPMWriter { public static void WriteBitmapToPPM(string file, Bitmap bitmap) { var writer = new StreamWriter(file); writer.WriteLine("P6"); writer.WriteLine($"{bitmap.Width} {bitmap.Height}"); writer.WriteLine("255"); writer.Close(); var writerB = new BinaryWriter(new FileStream(file, FileMode.Append)); for (int x = 0; x < bitmap.Height; x++) for (int y = 0; y < bitmap.Width; y++) { Color color = bitmap.GetPixel(y, x); writerB.Write(color.R); writerB.Write(color.G); writerB.Write(color.B); } writerB.Close(); } }
Convert this Python snippet to C# and keep its semantics consistent.
import os os.remove("output.txt") os.rmdir("docs") os.remove("/output.txt") os.rmdir("/docs")
using System; using System.IO; namespace DeleteFile { class Program { static void Main() { File.Delete("input.txt"); Directory.Delete("docs"); File.Delete("/input.txt"); Directory.Delete("/docs"); } } }
Rewrite this program in C# while keeping its functionality equivalent to the Python version.
import datetime, calendar DISCORDIAN_SEASONS = ["Chaos", "Discord", "Confusion", "Bureaucracy", "The Aftermath"] def ddate(year, month, day): today = datetime.date(year, month, day) is_leap_year = calendar.isleap(year) if is_leap_year and month == 2 and day == 29: return "St. Tib's Day, YOLD " + (year + 1166) day_of_year = today.timetuple().tm_yday - 1 if is_leap_year and day_of_year >= 60: day_of_year -= 1 season, dday = divmod(day_of_year, 73) return "%s %d, YOLD %d" % (DISCORDIAN_SEASONS[season], dday + 1, year + 1166)
using System; public static class DiscordianDate { static readonly string[] seasons = { "Chaos", "Discord", "Confusion", "Bureaucracy", "The Aftermath" }; static readonly string[] weekdays = { "Sweetmorn", "Boomtime", "Pungenday", "Prickle-Prickle", "Setting Orange" }; static readonly string[] apostles = { "Mungday", "Mojoday", "Syaday", "Zaraday", "Maladay" }; static readonly string[] holidays = { "Chaoflux", "Discoflux", "Confuflux", "Bureflux", "Afflux" }; public static string Discordian(this DateTime date) { string yold = $" in the YOLD {date.Year + 1166}."; int dayOfYear = date.DayOfYear; if (DateTime.IsLeapYear(date.Year)) { if (dayOfYear == 60) return "St. Tib's day" + yold; else if (dayOfYear > 60) dayOfYear--; } dayOfYear--; int seasonDay = dayOfYear % 73 + 1; int seasonNr = dayOfYear / 73; int weekdayNr = dayOfYear % 5; string holyday = ""; if (seasonDay == 5) holyday = $" Celebrate {apostles[seasonNr]}!"; else if (seasonDay == 50) holyday = $" Celebrate {holidays[seasonNr]}!"; return $"{weekdays[weekdayNr]}, day {seasonDay} of {seasons[seasonNr]}{yold}{holyday}"; } public static void Main() { foreach (var (day, month, year) in new [] { (1, 1, 2010), (5, 1, 2010), (19, 2, 2011), (28, 2, 2012), (29, 2, 2012), (1, 3, 2012), (19, 3, 2013), (3, 5, 2014), (31, 5, 2015), (22, 6, 2016), (15, 7, 2016), (12, 8, 2017), (19, 9, 2018), (26, 9, 2018), (24, 10, 2019), (8, 12, 2020), (31, 12, 2020) }) { Console.WriteLine($"{day:00}-{month:00}-{year:00} = {new DateTime(year, month, day).Discordian()}"); } } }
Convert this Python snippet to C# and keep its semantics consistent.
from __future__ import division from math import factorial from random import randrange MAX_N = 20 TIMES = 1000000 def analytical(n): return sum(factorial(n) / pow(n, i) / factorial(n -i) for i in range(1, n+1)) def test(n, times): count = 0 for i in range(times): x, bits = 1, 0 while not (bits & x): count += 1 bits |= x x = 1 << randrange(n) return count / times if __name__ == '__main__': print(" n\tavg\texp.\tdiff\n-------------------------------") for n in range(1, MAX_N+1): avg = test(n, TIMES) theory = analytical(n) diff = (avg / theory - 1) * 100 print("%2d %8.4f %8.4f %6.3f%%" % (n, avg, theory, diff))
public class AverageLoopLength { private static int N = 100000; private static double analytical(int n) { double[] factorial = new double[n + 1]; double[] powers = new double[n + 1]; powers[0] = 1.0; factorial[0] = 1.0; for (int i = 1; i <= n; i++) { factorial[i] = factorial[i - 1] * i; powers[i] = powers[i - 1] * n; } double sum = 0; for (int i = 1; i <= n; i++) { sum += factorial[n] / factorial[n - i] / powers[i]; } return sum; } private static double average(int n) { Random rnd = new Random(); double sum = 0.0; for (int a = 0; a < N; a++) { int[] random = new int[n]; for (int i = 0; i < n; i++) { random[i] = rnd.Next(n); } var seen = new HashSet<double>(n); int current = 0; int length = 0; while (seen.Add(current)) { length++; current = random[current]; } sum += length; } return sum / N; } public static void Main(string[] args) { Console.WriteLine(" N average analytical (error)"); Console.WriteLine("=== ========= ============ ========="); for (int i = 1; i <= 20; i++) { var average = AverageLoopLength.average(i); var analytical = AverageLoopLength.analytical(i); Console.WriteLine("{0,3} {1,10:N4} {2,13:N4} {3,8:N2}%", i, average, analytical, (analytical - average) / analytical * 100); } } }
Keep all operations the same but rewrite the snippet in C#.
from __future__ import division from math import factorial from random import randrange MAX_N = 20 TIMES = 1000000 def analytical(n): return sum(factorial(n) / pow(n, i) / factorial(n -i) for i in range(1, n+1)) def test(n, times): count = 0 for i in range(times): x, bits = 1, 0 while not (bits & x): count += 1 bits |= x x = 1 << randrange(n) return count / times if __name__ == '__main__': print(" n\tavg\texp.\tdiff\n-------------------------------") for n in range(1, MAX_N+1): avg = test(n, TIMES) theory = analytical(n) diff = (avg / theory - 1) * 100 print("%2d %8.4f %8.4f %6.3f%%" % (n, avg, theory, diff))
public class AverageLoopLength { private static int N = 100000; private static double analytical(int n) { double[] factorial = new double[n + 1]; double[] powers = new double[n + 1]; powers[0] = 1.0; factorial[0] = 1.0; for (int i = 1; i <= n; i++) { factorial[i] = factorial[i - 1] * i; powers[i] = powers[i - 1] * n; } double sum = 0; for (int i = 1; i <= n; i++) { sum += factorial[n] / factorial[n - i] / powers[i]; } return sum; } private static double average(int n) { Random rnd = new Random(); double sum = 0.0; for (int a = 0; a < N; a++) { int[] random = new int[n]; for (int i = 0; i < n; i++) { random[i] = rnd.Next(n); } var seen = new HashSet<double>(n); int current = 0; int length = 0; while (seen.Add(current)) { length++; current = random[current]; } sum += length; } return sum / N; } public static void Main(string[] args) { Console.WriteLine(" N average analytical (error)"); Console.WriteLine("=== ========= ============ ========="); for (int i = 1; i <= 20; i++) { var average = AverageLoopLength.average(i); var analytical = AverageLoopLength.analytical(i); Console.WriteLine("{0,3} {1,10:N4} {2,13:N4} {3,8:N2}%", i, average, analytical, (analytical - average) / analytical * 100); } } }
Preserve the algorithm and functionality while converting the code from Python to C#.
>>> original = 'Mary had a %s lamb.' >>> extra = 'little' >>> original % extra 'Mary had a little lamb.'
class Program { static void Main() { string extra = "little"; string formatted = $"Mary had a {extra} lamb."; System.Console.WriteLine(formatted); } }
Generate a C# translation of this Python snippet without changing its computational steps.
from itertools import islice def posd(): "diff between position numbers. 1, 2, 3... interleaved with 3, 5, 7..." count, odd = 1, 3 while True: yield count yield odd count, odd = count + 1, odd + 2 def pos_gen(): "position numbers. 1 3 2 5 7 4 9 ..." val = 1 diff = posd() while True: yield val val += next(diff) def plus_minus(): "yield (list_offset, sign) or zero for Partition calc" n, sign = 0, [1, 1] p_gen = pos_gen() out_on = next(p_gen) while True: n += 1 if n == out_on: next_sign = sign.pop(0) if not sign: sign = [-next_sign] * 2 yield -n, next_sign out_on = next(p_gen) else: yield 0 def part(n): "Partition numbers" p = [1] p_m = plus_minus() mods = [] for _ in range(n): next_plus_minus = next(p_m) if next_plus_minus: mods.append(next_plus_minus) p.append(sum(p[offset] * sign for offset, sign in mods)) return p[-1] print("(Intermediaries):") print(" posd:", list(islice(posd(), 10))) print(" pos_gen:", list(islice(pos_gen(), 10))) print(" plus_minus:", list(islice(plus_minus(), 15))) print("\nPartitions:", [part(x) for x in range(15)])
using System; class Program { const long Lm = (long)1e18; const string Fm = "D18"; struct LI { public long lo, ml, mh, hi, tp; } static void inc(ref LI d, LI s) { if ((d.lo += s.lo) >= Lm) { d.ml++; d.lo -= Lm; } if ((d.ml += s.ml) >= Lm) { d.mh++; d.ml -= Lm; } if ((d.mh += s.mh) >= Lm) { d.hi++; d.mh -= Lm; } if ((d.hi += s.hi) >= Lm) { d.tp++; d.hi -= Lm; } d.tp += s.tp; } static void dec(ref LI d, LI s) { if ((d.lo -= s.lo) < 0) { d.ml--; d.lo += Lm; } if ((d.ml -= s.ml) < 0) { d.mh--; d.ml += Lm; } if ((d.mh -= s.mh) < 0) { d.hi--; d.mh += Lm; } if ((d.hi -= s.hi) < 0) { d.tp--; d.hi += Lm; } d.tp -= s.tp; } static LI set(long s) { LI d; d.lo = s; d.ml = d.mh = d.hi = d.tp = 0; return d; } static string fmt(LI x) { if (x.tp > 0) return x.tp.ToString() + x.hi.ToString(Fm) + x.mh.ToString(Fm) + x.ml.ToString(Fm) + x.lo.ToString(Fm); if (x.hi > 0) return x.hi.ToString() + x.mh.ToString(Fm) + x.ml.ToString(Fm) + x.lo.ToString(Fm); if (x.mh > 0) return x.mh.ToString() + x.ml.ToString(Fm) + x.lo.ToString(Fm); if (x.ml > 0) return x.ml.ToString() + x.lo.ToString(Fm); return x.lo.ToString(); } static LI partcount(int n) { var P = new LI[n + 1]; P[0] = set(1); for (int i = 1; i <= n; i++) { int k = 0, d = -2, j = i; LI x = set(0); while (true) { if ((j -= (d += 3) -k) >= 0) inc(ref x, P[j]); else break; if ((j -= ++k) >= 0) inc(ref x, P[j]); else break; if ((j -= (d += 3) -k) >= 0) dec(ref x, P[j]); else break; if ((j -= ++k) >= 0) dec(ref x, P[j]); else break; } P[i] = x; } return P[n]; } static void Main(string[] args) { var sw = System.Diagnostics.Stopwatch.StartNew (); var res = partcount(6666); sw.Stop(); Console.Write("{0} {1} ms", fmt(res), sw.Elapsed.TotalMilliseconds); } }
Translate this program into C# but keep the logic exactly as in Python.
from collections import deque def prime_digits_sum(r): q = deque([(r, 0)]) while q: r, n = q.popleft() for d in 2, 3, 5, 7: if d >= r: if d == r: yield n + d break q.append((r - d, (n + d) * 10)) print(*prime_digits_sum(13))
using System; using static System.Console; using LI = System.Collections.Generic.SortedSet<int>; class Program { static LI unl(LI res, LI set, int lft, int mul = 1, int vlu = 0) { if (lft == 0) res.Add(vlu); else if (lft > 0) foreach (int itm in set) res = unl(res, set, lft - itm, mul * 10, vlu + itm * mul); return res; } static void Main(string[] args) { WriteLine(string.Join(" ", unl(new LI {}, new LI { 2, 3, 5, 7 }, 13))); } }
Write a version of this Python function in C# with identical behavior.
from collections import deque def prime_digits_sum(r): q = deque([(r, 0)]) while q: r, n = q.popleft() for d in 2, 3, 5, 7: if d >= r: if d == r: yield n + d break q.append((r - d, (n + d) * 10)) print(*prime_digits_sum(13))
using System; using static System.Console; using LI = System.Collections.Generic.SortedSet<int>; class Program { static LI unl(LI res, LI set, int lft, int mul = 1, int vlu = 0) { if (lft == 0) res.Add(vlu); else if (lft > 0) foreach (int itm in set) res = unl(res, set, lft - itm, mul * 10, vlu + itm * mul); return res; } static void Main(string[] args) { WriteLine(string.Join(" ", unl(new LI {}, new LI { 2, 3, 5, 7 }, 13))); } }
Convert the following code from Python to C#, ensuring the logic remains intact.
from collections import deque def prime_digits_sum(r): q = deque([(r, 0)]) while q: r, n = q.popleft() for d in 2, 3, 5, 7: if d >= r: if d == r: yield n + d break q.append((r - d, (n + d) * 10)) print(*prime_digits_sum(13))
using System; using static System.Console; using LI = System.Collections.Generic.SortedSet<int>; class Program { static LI unl(LI res, LI set, int lft, int mul = 1, int vlu = 0) { if (lft == 0) res.Add(vlu); else if (lft > 0) foreach (int itm in set) res = unl(res, set, lft - itm, mul * 10, vlu + itm * mul); return res; } static void Main(string[] args) { WriteLine(string.Join(" ", unl(new LI {}, new LI { 2, 3, 5, 7 }, 13))); } }
Transform the following Python implementation into C#, maintaining the same output and logic.
import sys, datetime, shutil if len(sys.argv) == 1: try: with open('notes.txt', 'r') as f: shutil.copyfileobj(f, sys.stdout) except IOError: pass else: with open('notes.txt', 'a') as f: f.write(datetime.datetime.now().isoformat() + '\n') f.write("\t%s\n" % ' '.join(sys.argv[1:]))
using System; using System.IO; using System.Text; namespace RosettaCode { internal class Program { private const string FileName = "NOTES.TXT"; private static void Main(string[] args) { if (args.Length==0) { string txt = File.ReadAllText(FileName); Console.WriteLine(txt); } else { var sb = new StringBuilder(); sb.Append(DateTime.Now).Append("\n\t"); foreach (string s in args) sb.Append(s).Append(" "); sb.Append("\n"); if (File.Exists(FileName)) File.AppendAllText(FileName, sb.ToString()); else File.WriteAllText(FileName, sb.ToString()); } } } }
Produce a language-to-language conversion: from Python to C#, same semantics.
PI = 3.141592653589793 TWO_PI = 6.283185307179586 def normalize2deg(a): while a < 0: a += 360 while a >= 360: a -= 360 return a def normalize2grad(a): while a < 0: a += 400 while a >= 400: a -= 400 return a def normalize2mil(a): while a < 0: a += 6400 while a >= 6400: a -= 6400 return a def normalize2rad(a): while a < 0: a += TWO_PI while a >= TWO_PI: a -= TWO_PI return a def deg2grad(a): return a * 10.0 / 9.0 def deg2mil(a): return a * 160.0 / 9.0 def deg2rad(a): return a * PI / 180.0 def grad2deg(a): return a * 9.0 / 10.0 def grad2mil(a): return a * 16.0 def grad2rad(a): return a * PI / 200.0 def mil2deg(a): return a * 9.0 / 160.0 def mil2grad(a): return a / 16.0 def mil2rad(a): return a * PI / 3200.0 def rad2deg(a): return a * 180.0 / PI def rad2grad(a): return a * 200.0 / PI def rad2mil(a): return a * 3200.0 / PI
using System; public static class Angles { public static void Main() => Print(-2, -1, 0, 1, 2, 6.2831853, 16, 57.2957795, 359, 6399, 1_000_000); public static void Print(params double[] angles) { string[] names = { "Degrees", "Gradians", "Mils", "Radians" }; Func<double, double> rnd = a => Math.Round(a, 4); Func<double, double>[] normal = { NormalizeDeg, NormalizeGrad, NormalizeMil, NormalizeRad }; Func<double, double>[,] convert = { { a => a, DegToGrad, DegToMil, DegToRad }, { GradToDeg, a => a, GradToMil, GradToRad }, { MilToDeg, MilToGrad, a => a, MilToRad }, { RadToDeg, RadToGrad, RadToMil, a => a } }; Console.WriteLine($@"{"Angle",-12}{"Normalized",-12}{"Unit",-12}{ "Degrees",-12}{"Gradians",-12}{"Mils",-12}{"Radians",-12}"); foreach (double angle in angles) { for (int i = 0; i < 4; i++) { double nAngle = normal[i](angle); Console.WriteLine($@"{ rnd(angle),-12}{ rnd(nAngle),-12}{ names[i],-12}{ rnd(convert[i, 0](nAngle)),-12}{ rnd(convert[i, 1](nAngle)),-12}{ rnd(convert[i, 2](nAngle)),-12}{ rnd(convert[i, 3](nAngle)),-12}"); } } } public static double NormalizeDeg(double angle) => Normalize(angle, 360); public static double NormalizeGrad(double angle) => Normalize(angle, 400); public static double NormalizeMil(double angle) => Normalize(angle, 6400); public static double NormalizeRad(double angle) => Normalize(angle, 2 * Math.PI); private static double Normalize(double angle, double N) { while (angle <= -N) angle += N; while (angle >= N) angle -= N; return angle; } public static double DegToGrad(double angle) => angle * 10 / 9; public static double DegToMil(double angle) => angle * 160 / 9; public static double DegToRad(double angle) => angle * Math.PI / 180; public static double GradToDeg(double angle) => angle * 9 / 10; public static double GradToMil(double angle) => angle * 16; public static double GradToRad(double angle) => angle * Math.PI / 200; public static double MilToDeg(double angle) => angle * 9 / 160; public static double MilToGrad(double angle) => angle / 16; public static double MilToRad(double angle) => angle * Math.PI / 3200; public static double RadToDeg(double angle) => angle * 180 / Math.PI; public static double RadToGrad(double angle) => angle * 200 / Math.PI; public static double RadToMil(double angle) => angle * 3200 / Math.PI; }
Translate this program into C# but keep the logic exactly as in Python.
>>> import os >>> os.path.commonpath(['/home/user1/tmp/coverage/test', '/home/user1/tmp/covert/operator', '/home/user1/tmp/coven/members']) '/home/user1/tmp'
using System; using System.Collections.Generic; using System.Linq; using System.Text; namespace RosettaCodeTasks { class Program { static void Main ( string[ ] args ) { FindCommonDirectoryPath.Test ( ); } } class FindCommonDirectoryPath { public static void Test ( ) { Console.WriteLine ( "Find Common Directory Path" ); Console.WriteLine ( ); List<string> PathSet1 = new List<string> ( ); PathSet1.Add ( "/home/user1/tmp/coverage/test" ); PathSet1.Add ( "/home/user1/tmp/covert/operator" ); PathSet1.Add ( "/home/user1/tmp/coven/members" ); Console.WriteLine("Path Set 1 (All Absolute Paths):"); foreach ( string path in PathSet1 ) { Console.WriteLine ( path ); } Console.WriteLine ( "Path Set 1 Common Path: {0}", FindCommonPath ( "/", PathSet1 ) ); } public static string FindCommonPath ( string Separator, List<string> Paths ) { string CommonPath = String.Empty; List<string> SeparatedPath = Paths .First ( str => str.Length == Paths.Max ( st2 => st2.Length ) ) .Split ( new string[ ] { Separator }, StringSplitOptions.RemoveEmptyEntries ) .ToList ( ); foreach ( string PathSegment in SeparatedPath.AsEnumerable ( ) ) { if ( CommonPath.Length == 0 && Paths.All ( str => str.StartsWith ( PathSegment ) ) ) { CommonPath = PathSegment; } else if ( Paths.All ( str => str.StartsWith ( CommonPath + Separator + PathSegment ) ) ) { CommonPath += Separator + PathSegment; } else { break; } } return CommonPath; } } }
Write the same algorithm in C# as shown in this Python implementation.
from itertools import islice class Recamans(): "Recamán's sequence generator callable class" def __init__(self): self.a = None self.n = None def __call__(self): "Recamán's sequence generator" nxt = 0 a, n = {nxt}, 0 self.a = a self.n = n yield nxt while True: an1, n = nxt, n + 1 nxt = an1 - n if nxt < 0 or nxt in a: nxt = an1 + n a.add(nxt) self.n = n yield nxt if __name__ == '__main__': recamans = Recamans() print("First fifteen members of Recamans sequence:", list(islice(recamans(), 15))) so_far = set() for term in recamans(): if term in so_far: print(f"First duplicate number in series is: a({recamans.n}) = {term}") break so_far.add(term) n = 1_000 setn = set(range(n + 1)) for _ in recamans(): if setn.issubset(recamans.a): print(f"Range 0 ..{n} is covered by terms up to a({recamans.n})") break
using System; using System.Collections.Generic; namespace RecamanSequence { class Program { static void Main(string[] args) { List<int> a = new List<int>() { 0 }; HashSet<int> used = new HashSet<int>() { 0 }; HashSet<int> used1000 = new HashSet<int>() { 0 }; bool foundDup = false; int n = 1; while (n <= 15 || !foundDup || used1000.Count < 1001) { int next = a[n - 1] - n; if (next < 1 || used.Contains(next)) { next += 2 * n; } bool alreadyUsed = used.Contains(next); a.Add(next); if (!alreadyUsed) { used.Add(next); if (0 <= next && next <= 1000) { used1000.Add(next); } } if (n == 14) { Console.WriteLine("The first 15 terms of the Recaman sequence are: [{0}]", string.Join(", ", a)); } if (!foundDup && alreadyUsed) { Console.WriteLine("The first duplicated term is a[{0}] = {1}", n, next); foundDup = true; } if (used1000.Count == 1001) { Console.WriteLine("Terms up to a[{0}] are needed to generate 0 to 1000", n); } n++; } } } }
Write the same algorithm in C# as shown in this Python implementation.
from itertools import islice class Recamans(): "Recamán's sequence generator callable class" def __init__(self): self.a = None self.n = None def __call__(self): "Recamán's sequence generator" nxt = 0 a, n = {nxt}, 0 self.a = a self.n = n yield nxt while True: an1, n = nxt, n + 1 nxt = an1 - n if nxt < 0 or nxt in a: nxt = an1 + n a.add(nxt) self.n = n yield nxt if __name__ == '__main__': recamans = Recamans() print("First fifteen members of Recamans sequence:", list(islice(recamans(), 15))) so_far = set() for term in recamans(): if term in so_far: print(f"First duplicate number in series is: a({recamans.n}) = {term}") break so_far.add(term) n = 1_000 setn = set(range(n + 1)) for _ in recamans(): if setn.issubset(recamans.a): print(f"Range 0 ..{n} is covered by terms up to a({recamans.n})") break
using System; using System.Collections.Generic; namespace RecamanSequence { class Program { static void Main(string[] args) { List<int> a = new List<int>() { 0 }; HashSet<int> used = new HashSet<int>() { 0 }; HashSet<int> used1000 = new HashSet<int>() { 0 }; bool foundDup = false; int n = 1; while (n <= 15 || !foundDup || used1000.Count < 1001) { int next = a[n - 1] - n; if (next < 1 || used.Contains(next)) { next += 2 * n; } bool alreadyUsed = used.Contains(next); a.Add(next); if (!alreadyUsed) { used.Add(next); if (0 <= next && next <= 1000) { used1000.Add(next); } } if (n == 14) { Console.WriteLine("The first 15 terms of the Recaman sequence are: [{0}]", string.Join(", ", a)); } if (!foundDup && alreadyUsed) { Console.WriteLine("The first duplicated term is a[{0}] = {1}", n, next); foundDup = true; } if (used1000.Count == 1001) { Console.WriteLine("Terms up to a[{0}] are needed to generate 0 to 1000", n); } n++; } } } }
Keep all operations the same but rewrite the snippet in C#.
>>> from array import array >>> argslist = [('l', []), ('c', 'hello world'), ('u', u'hello \u2641'), ('l', [1, 2, 3, 4, 5]), ('d', [1.0, 2.0, 3.14])] >>> for typecode, initializer in argslist: a = array(typecode, initializer) print a del a array('l') array('c', 'hello world') array('u', u'hello \u2641') array('l', [1, 2, 3, 4, 5]) array('d', [1.0, 2.0, 3.1400000000000001]) >>>
using System; using System.Runtime.InteropServices; public unsafe class Program { public static unsafe void HeapMemory() { const int HEAP_ZERO_MEMORY = 0x00000008; const int size = 1000; int ph = GetProcessHeap(); void* pointer = HeapAlloc(ph, HEAP_ZERO_MEMORY, size); if (pointer == null) throw new OutOfMemoryException(); Console.WriteLine(HeapSize(ph, 0, pointer)); HeapFree(ph, 0, pointer); } public static unsafe void StackMemory() { byte* buffer = stackalloc byte[1000]; } public static void Main(string[] args) { HeapMemory(); StackMemory(); } [DllImport("kernel32")] static extern void* HeapAlloc(int hHeap, int flags, int size); [DllImport("kernel32")] static extern bool HeapFree(int hHeap, int flags, void* block); [DllImport("kernel32")] static extern int GetProcessHeap(); [DllImport("kernel32")] static extern int HeapSize(int hHeap, int flags, void* block); }
Port the following code from Python to C# with equivalent syntax and logic.
import random board = list('123456789') wins = ((0,1,2), (3,4,5), (6,7,8), (0,3,6), (1,4,7), (2,5,8), (0,4,8), (2,4,6)) def printboard(): print('\n'.join(' '.join(board[x:x+3]) for x in(0,3,6))) def score(): for w in wins: b = board[w[0]] if b in 'XO' and all (board[i] == b for i in w): return b, [i+1 for i in w] return None, None def finished(): return all (b in 'XO' for b in board) def space(): return [ b for b in board if b not in 'XO'] def my_turn(xo): options = space() choice = random.choice(options) board[int(choice)-1] = xo return choice def your_turn(xo): options = space() while True: choice = input(" Put your %s in any of these positions: %s " % (xo, ''.join(options))).strip() if choice in options: break print( "Whoops I don't understand the input" ) board[int(choice)-1] = xo return choice def me(xo='X'): printboard() print('I go at', my_turn(xo)) return score() assert not s[0], "\n%s wins across %s" % s def you(xo='O'): printboard() print('You went at', your_turn(xo)) return score() assert not s[0], "\n%s wins across %s" % s print(__doc__) while not finished(): s = me('X') if s[0]: printboard() print("\n%s wins across %s" % s) break if not finished(): s = you('O') if s[0]: printboard() print("\n%s wins across %s" % s) break else: print('\nA draw')
using System; using System.Collections.Generic; using System.Linq; using System.Text; namespace RosettaTicTacToe { class Program { static string[][] Players = new string[][] { new string[] { "COMPUTER", "X" }, new string[] { "HUMAN", "O" } }; const int Unplayed = -1; const int Computer = 0; const int Human = 1; static int[] GameBoard = new int[9]; static int[] corners = new int[] { 0, 2, 6, 8 }; static int[][] wins = new int[][] { new int[] { 0, 1, 2 }, new int[] { 3, 4, 5 }, new int[] { 6, 7, 8 }, new int[] { 0, 3, 6 }, new int[] { 1, 4, 7 }, new int[] { 2, 5, 8 }, new int[] { 0, 4, 8 }, new int[] { 2, 4, 6 } }; static void Main(string[] args) { while (true) { Console.Clear(); Console.WriteLine("Welcome to Rosetta Code Tic-Tac-Toe for C#."); initializeGameBoard(); displayGameBoard(); int currentPlayer = rnd.Next(0, 2); Console.WriteLine("The first move goes to {0} who is playing {1}s.\n", playerName(currentPlayer), playerToken(currentPlayer)); while (true) { int thisMove = getMoveFor(currentPlayer); if (thisMove == Unplayed) { Console.WriteLine("{0}, you've quit the game ... am I that good?", playerName(currentPlayer)); break; } playMove(thisMove, currentPlayer); displayGameBoard(); if (isGameWon()) { Console.WriteLine("{0} has won the game!", playerName(currentPlayer)); break; } else if (isGameTied()) { Console.WriteLine("Cat game ... we have a tie."); break; } currentPlayer = getNextPlayer(currentPlayer); } if (!playAgain()) return; } } static int getMoveFor(int player) { if (player == Human) return getManualMove(player); else { int selectedMove = getSemiRandomMove(player); Console.WriteLine("{0} selects position {1}.", playerName(player), selectedMove + 1); return selectedMove; } } static int getManualMove(int player) { while (true) { Console.Write("{0}, enter you move (number): ", playerName(player)); ConsoleKeyInfo keyInfo = Console.ReadKey(); Console.WriteLine(); if (keyInfo.Key == ConsoleKey.Escape) return Unplayed; if (keyInfo.Key >= ConsoleKey.D1 && keyInfo.Key <= ConsoleKey.D9) { int move = keyInfo.KeyChar - '1'; if (GameBoard[move] == Unplayed) return move; else Console.WriteLine("Spot {0} is already taken, please select again.", move + 1); } else Console.WriteLine("Illegal move, please select again.\n"); } } static int getRandomMove(int player) { int movesLeft = GameBoard.Count(position => position == Unplayed); int x = rnd.Next(0, movesLeft); for (int i = 0; i < GameBoard.Length; i++) { if (GameBoard[i] == Unplayed && x < 0) return i; x--; } return Unplayed; } static int getSemiRandomMove(int player) { int posToPlay; if (checkForWinningMove(player, out posToPlay)) return posToPlay; if (checkForBlockingMove(player, out posToPlay)) return posToPlay; return getRandomMove(player); } static int getBestMove(int player) { return -1; } static bool checkForWinningMove(int player, out int posToPlay) { posToPlay = Unplayed; foreach (var line in wins) if (twoOfThreeMatchPlayer(player, line, out posToPlay)) return true; return false; } static bool checkForBlockingMove(int player, out int posToPlay) { posToPlay = Unplayed; foreach (var line in wins) if (twoOfThreeMatchPlayer(getNextPlayer(player), line, out posToPlay)) return true; return false; } static bool twoOfThreeMatchPlayer(int player, int[] line, out int posToPlay) { int cnt = 0; posToPlay = int.MinValue; foreach (int pos in line) { if (GameBoard[pos] == player) cnt++; else if (GameBoard[pos] == Unplayed) posToPlay = pos; } return cnt == 2 && posToPlay >= 0; } static void playMove(int boardPosition, int player) { GameBoard[boardPosition] = player; } static bool isGameWon() { return wins.Any(line => takenBySamePlayer(line[0], line[1], line[2])); } static bool takenBySamePlayer(int a, int b, int c) { return GameBoard[a] != Unplayed && GameBoard[a] == GameBoard[b] && GameBoard[a] == GameBoard[c]; } static bool isGameTied() { return !GameBoard.Any(spot => spot == Unplayed); } static Random rnd = new Random(); static void initializeGameBoard() { for (int i = 0; i < GameBoard.Length; i++) GameBoard[i] = Unplayed; } static string playerName(int player) { return Players[player][0]; } static string playerToken(int player) { return Players[player][1]; } static int getNextPlayer(int player) { return (player + 1) % 2; } static void displayGameBoard() { Console.WriteLine(" {0} | {1} | {2}", pieceAt(0), pieceAt(1), pieceAt(2)); Console.WriteLine("---|---|---"); Console.WriteLine(" {0} | {1} | {2}", pieceAt(3), pieceAt(4), pieceAt(5)); Console.WriteLine("---|---|---"); Console.WriteLine(" {0} | {1} | {2}", pieceAt(6), pieceAt(7), pieceAt(8)); Console.WriteLine(); } static string pieceAt(int boardPosition) { if (GameBoard[boardPosition] == Unplayed) return (boardPosition + 1).ToString(); return playerToken(GameBoard[boardPosition]); } private static bool playAgain() { Console.WriteLine("\nDo you want to play again?"); return Console.ReadKey(false).Key == ConsoleKey.Y; } } }
Generate an equivalent C# version of this Python code.
i=1 while i: print(i) i += 1
using System; using System.Numerics; class Program { static void Main() { BigInteger i = 1; while (true) { Console.WriteLine(i++); } } }
Preserve the algorithm and functionality while converting the code from Python to C#.
i=1 while i: print(i) i += 1
using System; using System.Numerics; class Program { static void Main() { BigInteger i = 1; while (true) { Console.WriteLine(i++); } } }
Translate the given Python code snippet into C# without altering its behavior.
>>> import socket >>> ips = set(i[4][0] for i in socket.getaddrinfo('www.kame.net', 80)) >>> for ip in ips: print ip ... 2001:200:dff:fff1:216:3eff:feb1:44d7 203.178.141.194
private string LookupDns(string s) { try { System.Net.IPHostEntry ip = System.Net.Dns.GetHostEntry(s); string result = ip.AddressList[0].ToString(); for (int i = 1; i < ip.AddressList.Length; ++i) result += ", " + ip.AddressList[i].ToString(); return result; } catch (System.Net.Sockets.SocketException se) { return se.Message; } }
Maintain the same structure and functionality when rewriting this code in C#.
>>> import socket >>> ips = set(i[4][0] for i in socket.getaddrinfo('www.kame.net', 80)) >>> for ip in ips: print ip ... 2001:200:dff:fff1:216:3eff:feb1:44d7 203.178.141.194
private string LookupDns(string s) { try { System.Net.IPHostEntry ip = System.Net.Dns.GetHostEntry(s); string result = ip.AddressList[0].ToString(); for (int i = 1; i < ip.AddressList.Length; ++i) result += ", " + ip.AddressList[i].ToString(); return result; } catch (System.Net.Sockets.SocketException se) { return se.Message; } }
Change the programming language of this snippet from Python to C# without modifying what it does.
from random import randint def dice5(): return randint(1, 5) def dice7(): r = dice5() + dice5() * 5 - 6 return (r % 7) + 1 if r < 21 else dice7()
using System; public class SevenSidedDice { Random random = new Random(); static void Main(string[] args) { SevenSidedDice sevenDice = new SevenSidedDice(); Console.WriteLine("Random number from 1 to 7: "+ sevenDice.seven()); Console.Read(); } int seven() { int v=21; while(v>20) v=five()+five()*5-6; return 1+v%7; } int five() { return 1 + random.Next(5); } }
Preserve the algorithm and functionality while converting the code from Python to C#.
width = int(raw_input("Width of myarray: ")) height = int(raw_input("Height of Array: ")) myarray = [[0] * width for i in range(height)] myarray[0][0] = 3.5 print (myarray[0][0])
class Program { static void Main(string[] args) { Console.WriteLine("Enter two integers. Space delimited please: "); string s = Console.ReadLine(); int[,] myArray=new int[(int)s[0],(int)s[2]]; myArray[0, 0] = 2; Console.WriteLine(myArray[0, 0]); Console.ReadLine(); } }
Translate this program into C# but keep the logic exactly as in Python.
def chinese_remainder(n, a): sum = 0 prod = reduce(lambda a, b: a*b, n) for n_i, a_i in zip(n, a): p = prod / n_i sum += a_i * mul_inv(p, n_i) * p return sum % prod def mul_inv(a, b): b0 = b x0, x1 = 0, 1 if b == 1: return 1 while a > 1: q = a / b a, b = b, a%b x0, x1 = x1 - q * x0, x0 if x1 < 0: x1 += b0 return x1 if __name__ == '__main__': n = [3, 5, 7] a = [2, 3, 2] print chinese_remainder(n, a)
using System; using System.Linq; namespace ChineseRemainderTheorem { class Program { static void Main(string[] args) { int[] n = { 3, 5, 7 }; int[] a = { 2, 3, 2 }; int result = ChineseRemainderTheorem.Solve(n, a); int counter = 0; int maxCount = n.Length - 1; while (counter <= maxCount) { Console.WriteLine($"{result} ≡ {a[counter]} (mod {n[counter]})"); counter++; } } } public static class ChineseRemainderTheorem { public static int Solve(int[] n, int[] a) { int prod = n.Aggregate(1, (i, j) => i * j); int p; int sm = 0; for (int i = 0; i < n.Length; i++) { p = prod / n[i]; sm += a[i] * ModularMultiplicativeInverse(p, n[i]) * p; } return sm % prod; } private static int ModularMultiplicativeInverse(int a, int mod) { int b = a % mod; for (int x = 1; x < mod; x++) { if ((b * x) % mod == 1) { return x; } } return 1; } } }
Port the following code from VB to Java with equivalent syntax and logic.
Debug.Print Hex(&HF0F0 And &HFF00) Debug.Print Hex(&HF0F0 Or &HFF00) Debug.Print Hex(&HF0F0 Xor &HFF00) Debug.Print Hex(Not &HF0F0) Debug.Print Hex(&HF0F0 Eqv &HFF00) Debug.Print Hex(&HF0F0 Imp &HFF00)
module BitwiseOps { @Inject Console console; void run() { for ((Int64 n1, Int64 n2) : [0=7, 1=5, 42=2, 0x123456789ABCDEF=0xFF]) { static String hex(Int64 n) { return n.toByteArray() [(n.leadingZeroCount / 8).minOf(7) ..< 8].toString(); } console.print($|For values {n1} ({hex(n1)}) and {n2} ({hex(n2)}): | {hex(n1)} AND {hex(n2)} = {hex(n1 & n2)} | {hex(n1)} OR {hex(n2)} = {hex(n1 | n2)} | {hex(n1)} XOR {hex(n2)} = {hex(n1 ^ n2)} | NOT {hex(n1)} = {hex(~n1)} | left shift {hex(n1)} by {n2} = {hex(n1 << n2)} | right shift {hex(n1)} by {n2} = {hex(n1 >> n2)} | right arithmetic shift {hex(n1)} by {n2} = {hex(n1 >>> n2)} | left rotate {hex(n1)} by {n2} = {hex(n1.rotateLeft(n2))} | right rotate {hex(n1)} by {n2} = {hex(n1.rotateRight(n2))} | leftmost bit of {hex(n1)} = {hex(n1.leftmostBit)} | rightmost bit of {hex(n1)} = {hex(n1.rightmostBit)} | leading zero count of {hex(n1)} = {n1.leadingZeroCount} | trailing zero count of {hex(n1)} = {n1.trailingZeroCount} | bit count (aka "population") of {hex(n1)} = {n1.bitCount} | reversed bits of {hex(n1)} = {hex(n1.reverseBits())} | reverse bytes of {hex(n1)} = {hex(n1.reverseBytes())} | ); } } }
Rewrite the snippet below in Java so it works the same as the original VB code.
option explicit const pi180= 0.01745329251994329576923690768489 const pi=3.1415926535897932384626433832795 class turtle dim fso dim fn dim svg dim iang dim ori dim incr dim pdown dim clr dim x dim y public property let orient(n):ori = n*pi180 :end property public property let iangle(n):iang= n*pi180 :end property public sub pd() : pdown=true: end sub public sub pu() :pdown=FALSE :end sub public sub rt(i) ori=ori - i*iang: end sub public sub lt(i): ori=(ori + i*iang) end sub public sub bw(l) x= x+ cos(ori+pi)*l*incr y= y+ sin(ori+pi)*l*incr end sub public sub fw(l) dim x1,y1 x1=x + cos(ori)*l*incr y1=y + sin(ori)*l*incr if pdown then line x,y,x1,y1 x=x1:y=y1 end sub Private Sub Class_Initialize() setlocale "us" initsvg x=400:y=400:incr=100 ori=90*pi180 iang=90*pi180 clr=0 pdown=true end sub Private Sub Class_Terminate() disply end sub private sub line (x,y,x1,y1) svg.WriteLine "<line x1=""" & x & """ y1= """& y & """ x2=""" & x1& """ y2=""" & y1 & """/>" end sub private sub disply() dim shell svg.WriteLine "</svg></body></html>" svg.close Set shell = CreateObject("Shell.Application") shell.ShellExecute fn,1,False end sub private sub initsvg() dim scriptpath Set fso = CreateObject ("Scripting.Filesystemobject") ScriptPath= Left(WScript.ScriptFullName, InStrRev(WScript.ScriptFullName, "\")) fn=Scriptpath & "SIERP.HTML" Set svg = fso.CreateTextFile(fn,True) if SVG IS nothing then wscript.echo "Can svg.WriteLine "<!DOCTYPE html>" &vbcrlf & "<html>" &vbcrlf & "<head>" svg.writeline "<style>" & vbcrlf & "line {stroke:rgb(255,0,0);stroke-width:.5}" &vbcrlf &"</style>" svg.writeline "</head>"&vbcrlf & "<body>" svg.WriteLine "<svg xmlns=""http://www.w3.org/2000/svg"" width=""800"" height=""800"" viewBox=""0 0 800 800"">" end sub end class sub dragon(st,le,dir) if st=0 then x.fw le: exit sub x.rt dir dragon st-1, le/1.41421 ,1 x.rt dir*2 dragon st-1, le/1.41421 ,-1 x.rt dir end sub dim x set x=new turtle x.iangle=45 x.orient=45 x.incr=1 x.x=200:x.y=200 dragon 12,300,1 set x=nothing
import java.awt.Color; import java.awt.Graphics; import java.util.*; import javax.swing.JFrame; public class DragonCurve extends JFrame { private List<Integer> turns; private double startingAngle, side; public DragonCurve(int iter) { super("Dragon Curve"); setBounds(100, 100, 800, 600); setDefaultCloseOperation(EXIT_ON_CLOSE); turns = getSequence(iter); startingAngle = -iter * (Math.PI / 4); side = 400 / Math.pow(2, iter / 2.); } public List<Integer> getSequence(int iterations) { List<Integer> turnSequence = new ArrayList<Integer>(); for (int i = 0; i < iterations; i++) { List<Integer> copy = new ArrayList<Integer>(turnSequence); Collections.reverse(copy); turnSequence.add(1); for (Integer turn : copy) { turnSequence.add(-turn); } } return turnSequence; } @Override public void paint(Graphics g) { g.setColor(Color.BLACK); double angle = startingAngle; int x1 = 230, y1 = 350; int x2 = x1 + (int) (Math.cos(angle) * side); int y2 = y1 + (int) (Math.sin(angle) * side); g.drawLine(x1, y1, x2, y2); x1 = x2; y1 = y2; for (Integer turn : turns) { angle += turn * (Math.PI / 2); x2 = x1 + (int) (Math.cos(angle) * side); y2 = y1 + (int) (Math.sin(angle) * side); g.drawLine(x1, y1, x2, y2); x1 = x2; y1 = y2; } } public static void main(String[] args) { new DragonCurve(14).setVisible(true); } }
Generate a Java translation of this VB snippet without changing its computational steps.
$Include "Rapidq.inc" dim file as qfilestream if file.open("c:\A Test.txt", fmOpenRead) then while not File.eof print File.readline wend else print "Cannot read file" end if input "Press enter to exit: ";a$
import java.io.BufferedReader; import java.io.FileReader; public class ReadFileByLines { private static void processLine(int lineNo, String line) { } public static void main(String[] args) { for (String filename : args) { BufferedReader br = null; FileReader fr = null; try { fr = new FileReader(filename); br = new BufferedReader(fr); String line; int lineNo = 0; while ((line = br.readLine()) != null) { processLine(++lineNo, line); } } catch (Exception x) { x.printStackTrace(); } finally { if (fr != null) { try {br.close();} catch (Exception ignoreMe) {} try {fr.close();} catch (Exception ignoreMe) {} } } } } }
Write the same code in Java as shown below in VB.
Public Sub Insert(ByVal a As Node(Of T), ByVal b As Node(Of T), ByVal c As T) Dim node As New Node(Of T)(value) a.Next = node node.Previous = a b.Previous = node node.Next = b End Sub
import java.util.LinkedList; @SuppressWarnings("serial") public class DoublyLinkedListInsertion<T> extends LinkedList<T> { public static void main(String[] args) { DoublyLinkedListInsertion<String> list = new DoublyLinkedListInsertion<String>(); list.addFirst("Add First 1"); list.addFirst("Add First 2"); list.addFirst("Add First 3"); list.addFirst("Add First 4"); list.addFirst("Add First 5"); traverseList(list); list.addAfter("Add First 3", "Add New"); traverseList(list); } public void addAfter(T after, T element) { int index = indexOf(after); if ( index >= 0 ) { add(index + 1, element); } else { addLast(element); } } private static void traverseList(LinkedList<String> list) { System.out.println("Traverse List:"); for ( int i = 0 ; i < list.size() ; i++ ) { System.out.printf("Element number %d - Element value = '%s'%n", i, list.get(i)); } System.out.println(); } }
Maintain the same structure and functionality when rewriting this code in Java.
Dim s As Variant Private Function quick_select(ByRef s As Variant, k As Integer) As Integer Dim left As Integer, right As Integer, pos As Integer Dim pivotValue As Integer, tmp As Integer left = 1: right = UBound(s) Do While left < right pivotValue = s(k) tmp = s(k) s(k) = s(right) s(right) = tmp pos = left For i = left To right If s(i) < pivotValue Then tmp = s(i) s(i) = s(pos) s(pos) = tmp pos = pos + 1 End If Next i tmp = s(right) s(right) = s(pos) s(pos) = tmp If pos = k Then Exit Do End If If pos < k Then left = pos + 1 Else right = pos - 1 End If Loop quick_select = s(k) End Function Public Sub main() Dim r As Integer, i As Integer s = [{9, 8, 7, 6, 5, 0, 1, 2, 3, 4}] For i = 1 To 10 r = quick_select(s, i) Debug.Print IIf(i < 10, r & ", ", "" & r); Next i End Sub
import java.util.Random; public class QuickSelect { private static <E extends Comparable<? super E>> int partition(E[] arr, int left, int right, int pivot) { E pivotVal = arr[pivot]; swap(arr, pivot, right); int storeIndex = left; for (int i = left; i < right; i++) { if (arr[i].compareTo(pivotVal) < 0) { swap(arr, i, storeIndex); storeIndex++; } } swap(arr, right, storeIndex); return storeIndex; } private static <E extends Comparable<? super E>> E select(E[] arr, int n) { int left = 0; int right = arr.length - 1; Random rand = new Random(); while (right >= left) { int pivotIndex = partition(arr, left, right, rand.nextInt(right - left + 1) + left); if (pivotIndex == n) { return arr[pivotIndex]; } else if (pivotIndex < n) { left = pivotIndex + 1; } else { right = pivotIndex - 1; } } return null; } private static void swap(Object[] arr, int i1, int i2) { if (i1 != i2) { Object temp = arr[i1]; arr[i1] = arr[i2]; arr[i2] = temp; } } public static void main(String[] args) { for (int i = 0; i < 10; i++) { Integer[] input = {9, 8, 7, 6, 5, 0, 1, 2, 3, 4}; System.out.print(select(input, i)); if (i < 9) System.out.print(", "); } System.out.println(); } }
Write a version of this VB function in Java with identical behavior.
Private Function to_base(ByVal number As Long, base As Integer) As String Dim digits As String, result As String Dim i As Integer, digit As Integer digits = "0123456789abcdefghijklmnopqrstuvwxyz" Do While number > 0 digit = number Mod base result = Mid(digits, digit + 1, 1) & result number = number \ base Loop to_base = result End Function Private Function from_base(number As String, base As Integer) As Long Dim digits As String, result As Long Dim i As Integer digits = "0123456789abcdefghijklmnopqrstuvwxyz" result = Val(InStr(1, digits, Mid(number, 1, 1), vbTextCompare) - 1) For i = 2 To Len(number) result = result * base + Val(InStr(1, digits, Mid(number, i, 1), vbTextCompare) - 1) Next i from_base = result End Function Public Sub Non_decimal_radices_Convert() Debug.Print "26 decimal in base 16 is: "; to_base(26, 16); ". Conversely, hexadecimal 1a in decimal is: "; from_base("1a", 16) End Sub
public static long backToTen(String num, int oldBase){ return Long.parseLong(num, oldBase); } public static String tenToBase(long num, int newBase){ return Long.toString(num, newBase); }
Write the same algorithm in Java as shown in this VB implementation.
Sub printFiles(parentDir As FolderItem, pattern As String) For i As Integer = 1 To parentDir.Count If parentDir.Item(i).Directory Then printFiles(parentDir.Item(i), pattern) Else Dim rg as New RegEx Dim myMatch as RegExMatch rg.SearchPattern = pattern myMatch = rg.search(parentDir.Item(i).Name) If myMatch <> Nil Then Print(parentDir.Item(i).AbsolutePath) End If Next End Sub
import java.io.File; public class MainEntry { public static void main(String[] args) { walkin(new File("/home/user")); } public static void walkin(File dir) { String pattern = ".mp3"; File listFile[] = dir.listFiles(); if (listFile != null) { for (int i=0; i<listFile.length; i++) { if (listFile[i].isDirectory()) { walkin(listFile[i]); } else { if (listFile[i].getName().endsWith(pattern)) { System.out.println(listFile[i].getPath()); } } } } } }
Maintain the same structure and functionality when rewriting this code in Java.
dim crctbl(255) const crcc =&hEDB88320 sub gencrctable for i= 0 to 255 k=i for j=1 to 8 if k and 1 then k=(k and &h7fffffff)\2 or (&h40000000 and ((k and &h80000000)<>0)) k=k xor crcc else k=(k and &h7fffffff)\2 or (&h40000000 and ((k and &h80000000)<>0)) end if next crctbl(i)=k next end sub function crc32 (buf) dim r,r1,i r=&hffffffff for i=1 to len(buf) r1=(r and &h7fffffff)\&h100 or (&h800000 and (r and &h80000000)<>0) r=r1 xor crctbl((asc(mid(buf,i,1))xor r) and 255) next crc32=r xor &hffffffff end function gencrctable wscript.stdout.writeline hex(crc32("The quick brown fox jumps over the lazy dog"))
import java.util.zip.* ; public class CRCMaker { public static void main( String[ ] args ) { String toBeEncoded = new String( "The quick brown fox jumps over the lazy dog" ) ; CRC32 myCRC = new CRC32( ) ; myCRC.update( toBeEncoded.getBytes( ) ) ; System.out.println( "The CRC-32 value is : " + Long.toHexString( myCRC.getValue( ) ) + " !" ) ; } }
Convert this VB snippet to Java and keep its semantics consistent.
Public Sub CSV_TO_HTML() input_ = "Character,Speech\n" & _ "The multitude,The messiah! Show us the messiah!\n" & _ "Brians mother,<angry>Now you listen here! He "he "The multitude,Who are you?\n" & _ "Brians mother,I "The multitude,Behold his mother! Behold his mother!" Debug.Print "<table>" & vbCrLf & "<tr><td>" For i = 1 To Len(input_) Select Case Mid(input_, i, 1) Case "\" If Mid(input_, i + 1, 1) = "n" Then Debug.Print "</td></tr>" & vbCrLf & "<tr><td>"; i = i + 1 Else Debug.Print Mid(input_, i, 1); End If Case ",": Debug.Print "</td><td>"; Case "<": Debug.Print "&lt;"; Case ">": Debug.Print "&gt;"; Case "&": Debug.Print "&amp;"; Case Else: Debug.Print Mid(input_, i, 1); End Select Next i Debug.Print "</td></tr>" & vbCrLf & "</table>" End Sub
grammar csv2html; dialog : {System.out.println("<HTML><Table>");}header body+{System.out.println("</Table></HTML>");} ; header : {System.out.println("<THEAD align=\"center\"><TR bgcolor=\"blue\">");}row{System.out.println("</TR></THEAD");}; body : {System.out.println("<TBODY><TR>");}row{System.out.println("</TR></TBODY");}; row : field ',' field '\r'? '\n'; field : Field{System.out.println("<TD>" + $Field.text.replace("<","&lt;").replace(">","&gt;") + "</TD>");}; Field : ~[,\n\r]+;
Rewrite the snippet below in Java so it works the same as the original VB code.
Public Sub CSV_TO_HTML() input_ = "Character,Speech\n" & _ "The multitude,The messiah! Show us the messiah!\n" & _ "Brians mother,<angry>Now you listen here! He "he "The multitude,Who are you?\n" & _ "Brians mother,I "The multitude,Behold his mother! Behold his mother!" Debug.Print "<table>" & vbCrLf & "<tr><td>" For i = 1 To Len(input_) Select Case Mid(input_, i, 1) Case "\" If Mid(input_, i + 1, 1) = "n" Then Debug.Print "</td></tr>" & vbCrLf & "<tr><td>"; i = i + 1 Else Debug.Print Mid(input_, i, 1); End If Case ",": Debug.Print "</td><td>"; Case "<": Debug.Print "&lt;"; Case ">": Debug.Print "&gt;"; Case "&": Debug.Print "&amp;"; Case Else: Debug.Print Mid(input_, i, 1); End Select Next i Debug.Print "</td></tr>" & vbCrLf & "</table>" End Sub
grammar csv2html; dialog : {System.out.println("<HTML><Table>");}header body+{System.out.println("</Table></HTML>");} ; header : {System.out.println("<THEAD align=\"center\"><TR bgcolor=\"blue\">");}row{System.out.println("</TR></THEAD");}; body : {System.out.println("<TBODY><TR>");}row{System.out.println("</TR></TBODY");}; row : field ',' field '\r'? '\n'; field : Field{System.out.println("<TD>" + $Field.text.replace("<","&lt;").replace(">","&gt;") + "</TD>");}; Field : ~[,\n\r]+;
Generate an equivalent Java version of this VB code.
Class NumberContainer Private TheNumber As Integer Sub Constructor(InitialNumber As Integer) TheNumber = InitialNumber End Sub Function Number() As Integer Return TheNumber End Function Sub Number(Assigns NewNumber As Integer) TheNumber = NewNumber End Sub End Class
public class MyClass{ private int variable; public MyClass(){ } public void someMethod(){ this.variable = 1; } }
Change the following VB code into Java without altering its purpose.
Module Module1 ReadOnly max As ULong = 1000000 Function Kaprekar(n As ULong) As Boolean If n = 1 Then Return True Dim sq = n * n Dim sq_str = Str(sq) Dim l = Len(sq_str) For x = l - 1 To 1 Step -1 If sq_str(x) = "0" Then l = l - 1 Else Exit For End If Next For x = 1 To l - 1 Dim p2 = Val(Mid(sq_str, x + 1)) If p2 > n Then Continue For End If Dim p1 = Val(Left(sq_str, x)) If p1 > n Then Return False If (p1 + p2) = n Then Return True Next Return False End Function Sub Main() Dim count = 0 Console.WriteLine("Kaprekar numbers below 10000") For n = 1 To max - 1 If Kaprekar(n) Then count = count + 1 If n < 10000 Then Console.WriteLine("{0,2} {1,4}", count, n) End If End If Next Console.WriteLine() Console.WriteLine("{0} numbers below {1} are kaprekar numbers", count, max) End Sub End Module
public class Kaprekar { private static String[] splitAt(String str, int idx){ String[] ans = new String[2]; ans[0] = str.substring(0, idx); if(ans[0].equals("")) ans[0] = "0"; ans[1] = str.substring(idx); return ans; } public static void main(String[] args){ int count = 0; int base = (args.length > 0) ? Integer.parseInt(args[0]) : 10; for(long i = 1; i <= 1000000; i++){ String sqrStr = Long.toString(i * i, base); for(int j = 0; j < sqrStr.length() / 2 + 1; j++){ String[] parts = splitAt(sqrStr, j); long firstNum = Long.parseLong(parts[0], base); long secNum = Long.parseLong(parts[1], base); if(secNum == 0) break; if(firstNum + secNum == i){ System.out.println(i + "\t" + Long.toString(i, base) + "\t" + sqrStr + "\t" + parts[0] + " + " + parts[1]); count++; break; } } } System.out.println(count + " Kaprekar numbers < 1000000 (base 10) in base "+base); } }
Ensure the translated Java code behaves exactly like the original VB snippet.
Module Module1 ReadOnly max As ULong = 1000000 Function Kaprekar(n As ULong) As Boolean If n = 1 Then Return True Dim sq = n * n Dim sq_str = Str(sq) Dim l = Len(sq_str) For x = l - 1 To 1 Step -1 If sq_str(x) = "0" Then l = l - 1 Else Exit For End If Next For x = 1 To l - 1 Dim p2 = Val(Mid(sq_str, x + 1)) If p2 > n Then Continue For End If Dim p1 = Val(Left(sq_str, x)) If p1 > n Then Return False If (p1 + p2) = n Then Return True Next Return False End Function Sub Main() Dim count = 0 Console.WriteLine("Kaprekar numbers below 10000") For n = 1 To max - 1 If Kaprekar(n) Then count = count + 1 If n < 10000 Then Console.WriteLine("{0,2} {1,4}", count, n) End If End If Next Console.WriteLine() Console.WriteLine("{0} numbers below {1} are kaprekar numbers", count, max) End Sub End Module
public class Kaprekar { private static String[] splitAt(String str, int idx){ String[] ans = new String[2]; ans[0] = str.substring(0, idx); if(ans[0].equals("")) ans[0] = "0"; ans[1] = str.substring(idx); return ans; } public static void main(String[] args){ int count = 0; int base = (args.length > 0) ? Integer.parseInt(args[0]) : 10; for(long i = 1; i <= 1000000; i++){ String sqrStr = Long.toString(i * i, base); for(int j = 0; j < sqrStr.length() / 2 + 1; j++){ String[] parts = splitAt(sqrStr, j); long firstNum = Long.parseLong(parts[0], base); long secNum = Long.parseLong(parts[1], base); if(secNum == 0) break; if(firstNum + secNum == i){ System.out.println(i + "\t" + Long.toString(i, base) + "\t" + sqrStr + "\t" + parts[0] + " + " + parts[1]); count++; break; } } } System.out.println(count + " Kaprekar numbers < 1000000 (base 10) in base "+base); } }
Generate a Java translation of this VB snippet without changing its computational steps.
Module Module1 ReadOnly max As ULong = 1000000 Function Kaprekar(n As ULong) As Boolean If n = 1 Then Return True Dim sq = n * n Dim sq_str = Str(sq) Dim l = Len(sq_str) For x = l - 1 To 1 Step -1 If sq_str(x) = "0" Then l = l - 1 Else Exit For End If Next For x = 1 To l - 1 Dim p2 = Val(Mid(sq_str, x + 1)) If p2 > n Then Continue For End If Dim p1 = Val(Left(sq_str, x)) If p1 > n Then Return False If (p1 + p2) = n Then Return True Next Return False End Function Sub Main() Dim count = 0 Console.WriteLine("Kaprekar numbers below 10000") For n = 1 To max - 1 If Kaprekar(n) Then count = count + 1 If n < 10000 Then Console.WriteLine("{0,2} {1,4}", count, n) End If End If Next Console.WriteLine() Console.WriteLine("{0} numbers below {1} are kaprekar numbers", count, max) End Sub End Module
public class Kaprekar { private static String[] splitAt(String str, int idx){ String[] ans = new String[2]; ans[0] = str.substring(0, idx); if(ans[0].equals("")) ans[0] = "0"; ans[1] = str.substring(idx); return ans; } public static void main(String[] args){ int count = 0; int base = (args.length > 0) ? Integer.parseInt(args[0]) : 10; for(long i = 1; i <= 1000000; i++){ String sqrStr = Long.toString(i * i, base); for(int j = 0; j < sqrStr.length() / 2 + 1; j++){ String[] parts = splitAt(sqrStr, j); long firstNum = Long.parseLong(parts[0], base); long secNum = Long.parseLong(parts[1], base); if(secNum == 0) break; if(firstNum + secNum == i){ System.out.println(i + "\t" + Long.toString(i, base) + "\t" + sqrStr + "\t" + parts[0] + " + " + parts[1]); count++; break; } } } System.out.println(count + " Kaprekar numbers < 1000000 (base 10) in base "+base); } }
Can you help me rewrite this code in Java instead of VB, keeping it the same logically?
Option Explicit Const numchars=127 Function LZWCompress(si) Dim oDict, intMaxCode, i,z,ii,ss,strCurrent,strNext,j Set oDict = CreateObject("Scripting.Dictionary") ReDim a(Len(si)) intMaxCode = numchars For i = 0 To numchars oDict.Add Chr(i), i Next strCurrent = Left(si,1) j=0 For ii=2 To Len(si) strNext = Mid(si,ii,1) ss=strCurrent & strNext If oDict.Exists(ss) Then strCurrent = ss Else a(j)=oDict.Item(strCurrent) :j=j+1 intMaxCode = intMaxCode + 1 oDict.Add ss, intMaxCode strCurrent = strNext End If Next a(j)=oDict.Item(strCurrent) ReDim preserve a(j) LZWCompress=a Set oDict = Nothing End Function Function lzwUncompress(sc) Dim intNext, intCurrent, intMaxCode, i,ss,istr,s,j s="" reDim dict(1000) intMaxCode = numchars For i = 0 To numchars : dict(i)= Chr(i) : Next intCurrent=sc(0) For j=1 To UBound(sc) ss=dict(intCurrent) s= s & ss intMaxCode = intMaxCode + 1 intnext=sc(j) If intNext<intMaxCode Then dict(intMaxCode)=ss & Left(dict(intNext), 1) Else dict(intMaxCode)=ss & Left(ss, 1) End If intCurrent = intNext Next s= s & dict(intCurrent) lzwUncompress=s End function Sub printvec(a) Dim s,i,x s="(" For i=0 To UBound (a) s=s & x & a(i) x=", " Next WScript.echo s &")" End sub Dim a,b b="TOBEORNOTTOBEORTOBEORNOT" WScript.Echo b a=LZWCompress (b) printvec(a) WScript.echo lzwUncompress (a ) wscript.quit 1
import java.util.*; public class LZW { public static List<Integer> compress(String uncompressed) { int dictSize = 256; Map<String,Integer> dictionary = new HashMap<String,Integer>(); for (int i = 0; i < 256; i++) dictionary.put("" + (char)i, i); String w = ""; List<Integer> result = new ArrayList<Integer>(); for (char c : uncompressed.toCharArray()) { String wc = w + c; if (dictionary.containsKey(wc)) w = wc; else { result.add(dictionary.get(w)); dictionary.put(wc, dictSize++); w = "" + c; } } if (!w.equals("")) result.add(dictionary.get(w)); return result; } public static String decompress(List<Integer> compressed) { int dictSize = 256; Map<Integer,String> dictionary = new HashMap<Integer,String>(); for (int i = 0; i < 256; i++) dictionary.put(i, "" + (char)i); String w = "" + (char)(int)compressed.remove(0); StringBuffer result = new StringBuffer(w); for (int k : compressed) { String entry; if (dictionary.containsKey(k)) entry = dictionary.get(k); else if (k == dictSize) entry = w + w.charAt(0); else throw new IllegalArgumentException("Bad compressed k: " + k); result.append(entry); dictionary.put(dictSize++, w + entry.charAt(0)); w = entry; } return result.toString(); } public static void main(String[] args) { List<Integer> compressed = compress("TOBEORNOTTOBEORTOBEORNOT"); System.out.println(compressed); String decompressed = decompress(compressed); System.out.println(decompressed); } }
Generate an equivalent Java version of this VB code.
Private Function ffr(n As Long) As Long Dim R As New Collection Dim S As New Collection R.Add 1 S.Add 2 For i = 2 To n R.Add R(i - 1) + S(i - 1) For j = S(S.Count) + 1 To R(i) - 1 S.Add j Next j For j = R(i) + 1 To R(i) + S(i - 1) S.Add j Next j Next i ffr = R(n) Set R = Nothing Set S = Nothing End Function Private Function ffs(n As Long) As Long Dim R As New Collection Dim S As New Collection R.Add 1 S.Add 2 For i = 2 To n R.Add R(i - 1) + S(i - 1) For j = S(S.Count) + 1 To R(i) - 1 S.Add j Next j For j = R(i) + 1 To R(i) + S(i - 1) S.Add j Next j If S.Count >= n Then Exit For Next i ffs = S(n) Set R = Nothing Set S = Nothing End Function Public Sub main() Dim i As Long Debug.Print "The first ten values of R are:" For i = 1 To 10 Debug.Print ffr(i); Next i Debug.Print Dim x As New Collection For i = 1 To 1000 x.Add i, CStr(i) Next i For i = 1 To 40 x.Remove CStr(ffr(i)) Next i For i = 1 To 960 x.Remove CStr(ffs(i)) Next i Debug.Print "The first 40 values of ffr plus the first 960 values of ffs " Debug.Print "include all the integers from 1 to 1000 exactly once is "; Format(x.Count = 0) End Sub
import java.util.*; class Hofstadter { private static List<Integer> getSequence(int rlistSize, int slistSize) { List<Integer> rlist = new ArrayList<Integer>(); List<Integer> slist = new ArrayList<Integer>(); Collections.addAll(rlist, 1, 3, 7); Collections.addAll(slist, 2, 4, 5, 6); List<Integer> list = (rlistSize > 0) ? rlist : slist; int targetSize = (rlistSize > 0) ? rlistSize : slistSize; while (list.size() > targetSize) list.remove(list.size() - 1); while (list.size() < targetSize) { int lastIndex = rlist.size() - 1; int lastr = rlist.get(lastIndex).intValue(); int r = lastr + slist.get(lastIndex).intValue(); rlist.add(Integer.valueOf(r)); for (int s = lastr + 1; (s < r) && (list.size() < targetSize); s++) slist.add(Integer.valueOf(s)); } return list; } public static int ffr(int n) { return getSequence(n, 0).get(n - 1).intValue(); } public static int ffs(int n) { return getSequence(0, n).get(n - 1).intValue(); } public static void main(String[] args) { System.out.print("R():"); for (int n = 1; n <= 10; n++) System.out.print(" " + ffr(n)); System.out.println(); Set<Integer> first40R = new HashSet<Integer>(); for (int n = 1; n <= 40; n++) first40R.add(Integer.valueOf(ffr(n))); Set<Integer> first960S = new HashSet<Integer>(); for (int n = 1; n <= 960; n++) first960S.add(Integer.valueOf(ffs(n))); for (int i = 1; i <= 1000; i++) { Integer n = Integer.valueOf(i); if (first40R.contains(n) == first960S.contains(n)) System.out.println("Integer " + i + " either in both or neither set"); } System.out.println("Done"); } }
Can you help me rewrite this code in Java instead of VB, keeping it the same logically?
Private Function ffr(n As Long) As Long Dim R As New Collection Dim S As New Collection R.Add 1 S.Add 2 For i = 2 To n R.Add R(i - 1) + S(i - 1) For j = S(S.Count) + 1 To R(i) - 1 S.Add j Next j For j = R(i) + 1 To R(i) + S(i - 1) S.Add j Next j Next i ffr = R(n) Set R = Nothing Set S = Nothing End Function Private Function ffs(n As Long) As Long Dim R As New Collection Dim S As New Collection R.Add 1 S.Add 2 For i = 2 To n R.Add R(i - 1) + S(i - 1) For j = S(S.Count) + 1 To R(i) - 1 S.Add j Next j For j = R(i) + 1 To R(i) + S(i - 1) S.Add j Next j If S.Count >= n Then Exit For Next i ffs = S(n) Set R = Nothing Set S = Nothing End Function Public Sub main() Dim i As Long Debug.Print "The first ten values of R are:" For i = 1 To 10 Debug.Print ffr(i); Next i Debug.Print Dim x As New Collection For i = 1 To 1000 x.Add i, CStr(i) Next i For i = 1 To 40 x.Remove CStr(ffr(i)) Next i For i = 1 To 960 x.Remove CStr(ffs(i)) Next i Debug.Print "The first 40 values of ffr plus the first 960 values of ffs " Debug.Print "include all the integers from 1 to 1000 exactly once is "; Format(x.Count = 0) End Sub
import java.util.*; class Hofstadter { private static List<Integer> getSequence(int rlistSize, int slistSize) { List<Integer> rlist = new ArrayList<Integer>(); List<Integer> slist = new ArrayList<Integer>(); Collections.addAll(rlist, 1, 3, 7); Collections.addAll(slist, 2, 4, 5, 6); List<Integer> list = (rlistSize > 0) ? rlist : slist; int targetSize = (rlistSize > 0) ? rlistSize : slistSize; while (list.size() > targetSize) list.remove(list.size() - 1); while (list.size() < targetSize) { int lastIndex = rlist.size() - 1; int lastr = rlist.get(lastIndex).intValue(); int r = lastr + slist.get(lastIndex).intValue(); rlist.add(Integer.valueOf(r)); for (int s = lastr + 1; (s < r) && (list.size() < targetSize); s++) slist.add(Integer.valueOf(s)); } return list; } public static int ffr(int n) { return getSequence(n, 0).get(n - 1).intValue(); } public static int ffs(int n) { return getSequence(0, n).get(n - 1).intValue(); } public static void main(String[] args) { System.out.print("R():"); for (int n = 1; n <= 10; n++) System.out.print(" " + ffr(n)); System.out.println(); Set<Integer> first40R = new HashSet<Integer>(); for (int n = 1; n <= 40; n++) first40R.add(Integer.valueOf(ffr(n))); Set<Integer> first960S = new HashSet<Integer>(); for (int n = 1; n <= 960; n++) first960S.add(Integer.valueOf(ffs(n))); for (int i = 1; i <= 1000; i++) { Integer n = Integer.valueOf(i); if (first40R.contains(n) == first960S.contains(n)) System.out.println("Integer " + i + " either in both or neither set"); } System.out.println("Done"); } }
Produce a functionally identical Java code for the snippet given in VB.
Sub magicsquare() Const n = 9 Dim i As Integer, j As Integer, v As Integer Debug.Print "The square order is: " & n For i = 1 To n For j = 1 To n Cells(i, j) = ((i * 2 - j + n - 1) Mod n) * n + ((i * 2 + j - 2) Mod n) + 1 Next j Next i Debug.Print "The magic number of"; n; "x"; n; "square is:"; n * (n * n + 1) \ 2 End Sub
public class MagicSquare { public static void main(String[] args) { int n = 5; for (int[] row : magicSquareOdd(n)) { for (int x : row) System.out.format("%2s ", x); System.out.println(); } System.out.printf("\nMagic constant: %d ", (n * n + 1) * n / 2); } public static int[][] magicSquareOdd(final int base) { if (base % 2 == 0 || base < 3) throw new IllegalArgumentException("base must be odd and > 2"); int[][] grid = new int[base][base]; int r = 0, number = 0; int size = base * base; int c = base / 2; while (number++ < size) { grid[r][c] = number; if (r == 0) { if (c == base - 1) { r++; } else { r = base - 1; c++; } } else { if (c == base - 1) { r--; c = 0; } else { if (grid[r - 1][c + 1] == 0) { r--; c++; } else { r++; } } } } return grid; } }
Convert the following code from VB to Java, ensuring the logic remains intact.
Sub magicsquare() Const n = 9 Dim i As Integer, j As Integer, v As Integer Debug.Print "The square order is: " & n For i = 1 To n For j = 1 To n Cells(i, j) = ((i * 2 - j + n - 1) Mod n) * n + ((i * 2 + j - 2) Mod n) + 1 Next j Next i Debug.Print "The magic number of"; n; "x"; n; "square is:"; n * (n * n + 1) \ 2 End Sub
public class MagicSquare { public static void main(String[] args) { int n = 5; for (int[] row : magicSquareOdd(n)) { for (int x : row) System.out.format("%2s ", x); System.out.println(); } System.out.printf("\nMagic constant: %d ", (n * n + 1) * n / 2); } public static int[][] magicSquareOdd(final int base) { if (base % 2 == 0 || base < 3) throw new IllegalArgumentException("base must be odd and > 2"); int[][] grid = new int[base][base]; int r = 0, number = 0; int size = base * base; int c = base / 2; while (number++ < size) { grid[r][c] = number; if (r == 0) { if (c == base - 1) { r++; } else { r = base - 1; c++; } } else { if (c == base - 1) { r--; c = 0; } else { if (grid[r - 1][c + 1] == 0) { r--; c++; } else { r++; } } } } return grid; } }
Port the provided VB code into Java while preserving the original functionality.
Sub BenfordLaw() Dim BenResult(1 To 9) As Long BENref = "30,1%|17,6%|12,5%|9,7%|7,9%|6,7%|5,8%|5,1%|4,6%" For Each c In Selection.Cells If InStr(1, "-0123456789", Left(c, 1)) > 0 Then For i = 1 To 9 If CInt(Left(Abs(c), 1)) = i Then BenResult(i) = BenResult(i) + 1: Exit For Next End If Next Total= Application.Sum(BenResult) biggest= Len(CStr(BenResult(1))) txt = "# | Values | Real | Expected " & vbCrLf For i = 1 To 9 If BenResult(i) > 0 Then txt = txt & "#" & i & " | " & vbTab txt = txt & String((biggest - Len(CStr(BenResult(i)))) * 2, " ") & Format(BenResult(i), "0") & " | " & vbTab txt = txt & String((Len(CStr(Format(BenResult(1) / Total, "##0.0%"))) - Len(CStr(Format(BenResult(i) / Total, "##0.0%")))) * 2, " ") & Format(BenResult(i) / Total, "##0.0%") & " | " & vbTab txt = txt & Format(Split(BENref, "|")(i - 1), " ##0.0%") & vbCrLf End If Next MsgBox txt, vbOKOnly, "Finish" End Sub }
import java.math.BigInteger; import java.util.Locale; public class BenfordsLaw { private static BigInteger[] generateFibonacci(int n) { BigInteger[] fib = new BigInteger[n]; fib[0] = BigInteger.ONE; fib[1] = BigInteger.ONE; for (int i = 2; i < fib.length; i++) { fib[i] = fib[i - 2].add(fib[i - 1]); } return fib; } public static void main(String[] args) { BigInteger[] numbers = generateFibonacci(1000); int[] firstDigits = new int[10]; for (BigInteger number : numbers) { firstDigits[Integer.valueOf(number.toString().substring(0, 1))]++; } for (int i = 1; i < firstDigits.length; i++) { System.out.printf(Locale.ROOT, "%d %10.6f %10.6f%n", i, (double) firstDigits[i] / numbers.length, Math.log10(1.0 + 1.0 / i)); } } }
Generate an equivalent Java version of this VB code.
Sub BenfordLaw() Dim BenResult(1 To 9) As Long BENref = "30,1%|17,6%|12,5%|9,7%|7,9%|6,7%|5,8%|5,1%|4,6%" For Each c In Selection.Cells If InStr(1, "-0123456789", Left(c, 1)) > 0 Then For i = 1 To 9 If CInt(Left(Abs(c), 1)) = i Then BenResult(i) = BenResult(i) + 1: Exit For Next End If Next Total= Application.Sum(BenResult) biggest= Len(CStr(BenResult(1))) txt = "# | Values | Real | Expected " & vbCrLf For i = 1 To 9 If BenResult(i) > 0 Then txt = txt & "#" & i & " | " & vbTab txt = txt & String((biggest - Len(CStr(BenResult(i)))) * 2, " ") & Format(BenResult(i), "0") & " | " & vbTab txt = txt & String((Len(CStr(Format(BenResult(1) / Total, "##0.0%"))) - Len(CStr(Format(BenResult(i) / Total, "##0.0%")))) * 2, " ") & Format(BenResult(i) / Total, "##0.0%") & " | " & vbTab txt = txt & Format(Split(BENref, "|")(i - 1), " ##0.0%") & vbCrLf End If Next MsgBox txt, vbOKOnly, "Finish" End Sub }
import java.math.BigInteger; import java.util.Locale; public class BenfordsLaw { private static BigInteger[] generateFibonacci(int n) { BigInteger[] fib = new BigInteger[n]; fib[0] = BigInteger.ONE; fib[1] = BigInteger.ONE; for (int i = 2; i < fib.length; i++) { fib[i] = fib[i - 2].add(fib[i - 1]); } return fib; } public static void main(String[] args) { BigInteger[] numbers = generateFibonacci(1000); int[] firstDigits = new int[10]; for (BigInteger number : numbers) { firstDigits[Integer.valueOf(number.toString().substring(0, 1))]++; } for (int i = 1; i < firstDigits.length; i++) { System.out.printf(Locale.ROOT, "%d %10.6f %10.6f%n", i, (double) firstDigits[i] / numbers.length, Math.log10(1.0 + 1.0 / i)); } } }
Change the following VB code into Java without altering its purpose.
Sub Main() Debug.Print F(-10) Debug.Print F(10) End Sub Private Function F(N As Long) As Variant If N < 0 Then F = "Error. Negative argument" ElseIf N <= 1 Then F = N Else F = F(N - 1) + F(N - 2) End If End Function
public static long fib(int n) { if (n < 0) throw new IllegalArgumentException("n can not be a negative number"); return new Object() { private long fibInner(int n) { return (n < 2) ? n : (fibInner(n - 1) + fibInner(n - 2)); } }.fibInner(n); }
Change the following VB code into Java without altering its purpose.
string = "Small Basic" TextWindow.WriteLine(Text.GetSubTextToEnd(string, 2)) TextWindow.WriteLine(Text.GetSubText(string, 1, Text.GetLength(string) - 1)) TextWindow.WriteLine(Text.GetSubText(string, 2, Text.GetLength(string) - 2))
String strOrig = 'brooms'; String str1 = strOrig.substring(1, strOrig.length()); system.debug(str1); String str2 = strOrig.substring(0, strOrig.length()-1); system.debug(str2); String str3 = strOrig.substring(1, strOrig.length()-1); system.debug(str3); String strOrig = 'brooms'; String str1 = strOrig.replaceAll( '^.', '' ); system.debug(str1); String str2 = strOrig.replaceAll( '.$', '' ) ; system.debug(str2); String str3 = strOrig.replaceAll( '^.|.$', '' ); system.debug(str3);
Preserve the algorithm and functionality while converting the code from VB to Java.
string = "Small Basic" TextWindow.WriteLine(Text.GetSubTextToEnd(string, 2)) TextWindow.WriteLine(Text.GetSubText(string, 1, Text.GetLength(string) - 1)) TextWindow.WriteLine(Text.GetSubText(string, 2, Text.GetLength(string) - 2))
String strOrig = 'brooms'; String str1 = strOrig.substring(1, strOrig.length()); system.debug(str1); String str2 = strOrig.substring(0, strOrig.length()-1); system.debug(str2); String str3 = strOrig.substring(1, strOrig.length()-1); system.debug(str3); String strOrig = 'brooms'; String str1 = strOrig.replaceAll( '^.', '' ); system.debug(str1); String str2 = strOrig.replaceAll( '.$', '' ) ; system.debug(str2); String str3 = strOrig.replaceAll( '^.|.$', '' ); system.debug(str3);
Ensure the translated Java code behaves exactly like the original VB snippet.
string = "Small Basic" TextWindow.WriteLine(Text.GetSubTextToEnd(string, 2)) TextWindow.WriteLine(Text.GetSubText(string, 1, Text.GetLength(string) - 1)) TextWindow.WriteLine(Text.GetSubText(string, 2, Text.GetLength(string) - 2))
String strOrig = 'brooms'; String str1 = strOrig.substring(1, strOrig.length()); system.debug(str1); String str2 = strOrig.substring(0, strOrig.length()-1); system.debug(str2); String str3 = strOrig.substring(1, strOrig.length()-1); system.debug(str3); String strOrig = 'brooms'; String str1 = strOrig.replaceAll( '^.', '' ); system.debug(str1); String str2 = strOrig.replaceAll( '.$', '' ) ; system.debug(str2); String str3 = strOrig.replaceAll( '^.|.$', '' ); system.debug(str3);
Translate this program into Java but keep the logic exactly as in VB.
Set objfso = CreateObject("Scripting.FileSystemObject") Set objfile = objfso.OpenTextFile(objfso.GetParentFolderName(WScript.ScriptFullName) &_ "\input.txt",1) list = "" previous_line = "" l = Len(previous_line) Do Until objfile.AtEndOfStream current_line = objfile.ReadLine If Mid(current_line,l+1,1) <> "" Then list = current_line & vbCrLf previous_line = current_line l = Len(previous_line) ElseIf Mid(current_line,l,1) <> "" And Mid(current_line,(l+1),1) = "" Then list = list & current_line & vbCrLf End If Loop WScript.Echo list objfile.Close Set objfso = Nothing
import java.io.File; import java.util.Scanner; public class LongestStringChallenge { public static void main(String[] args) throws Exception { String lines = "", longest = ""; try (Scanner sc = new Scanner(new File("lines.txt"))) { while(sc.hasNext()) { String line = sc.nextLine(); if (longer(longest, line)) lines = longest = line; else if (!longer(line, longest)) lines = lines.concat("\n").concat(line); } } System.out.println(lines); } static boolean longer(String a, String b) { try { String dummy = a.substring(b.length()); } catch (StringIndexOutOfBoundsException e) { return true; } return false; } }
Generate a Java translation of this VB snippet without changing its computational steps.
Option Base 1 Public Enum sett name_ = 1 initState endState blank rules End Enum Public incrementer As Variant, threeStateBB As Variant, fiveStateBB As Variant Private Sub init() incrementer = Array("Simple incrementer", _ "q0", _ "qf", _ "B", _ Array( _ Array("q0", "1", "1", "right", "q0"), _ Array("q0", "B", "1", "stay", "qf"))) threeStateBB = Array("Three-state busy beaver", _ "a", _ "halt", _ "0", _ Array( _ Array("a", "0", "1", "right", "b"), _ Array("a", "1", "1", "left", "c"), _ Array("b", "0", "1", "left", "a"), _ Array("b", "1", "1", "right", "b"), _ Array("c", "0", "1", "left", "b"), _ Array("c", "1", "1", "stay", "halt"))) fiveStateBB = Array("Five-state busy beaver", _ "A", _ "H", _ "0", _ Array( _ Array("A", "0", "1", "right", "B"), _ Array("A", "1", "1", "left", "C"), _ Array("B", "0", "1", "right", "C"), _ Array("B", "1", "1", "right", "B"), _ Array("C", "0", "1", "right", "D"), _ Array("C", "1", "0", "left", "E"), _ Array("D", "0", "1", "left", "A"), _ Array("D", "1", "1", "left", "D"), _ Array("E", "0", "1", "stay", "H"), _ Array("E", "1", "0", "left", "A"))) End Sub Private Sub show(state As String, headpos As Long, tape As Collection) Debug.Print " "; state; String$(7 - Len(state), " "); "| "; For p = 1 To tape.Count Debug.Print IIf(p = headpos, "[" & tape(p) & "]", " " & tape(p) & " "); Next p Debug.Print End Sub Private Sub UTM(machine As Variant, tape As Collection, Optional countOnly As Long = 0) Dim state As String: state = machine(initState) Dim headpos As Long: headpos = 1 Dim counter As Long, rule As Variant Debug.Print machine(name_); vbCrLf; String$(Len(machine(name_)), "=") If Not countOnly Then Debug.Print " State | Tape [head]" & vbCrLf & "---------------------" Do While True If headpos > tape.Count Then tape.Add machine(blank) Else If headpos < 1 Then tape.Add machine(blank), Before:=1 headpos = 1 End If End If If Not countOnly Then show state, headpos, tape For i = LBound(machine(rules)) To UBound(machine(rules)) rule = machine(rules)(i) If rule(1) = state And rule(2) = tape(headpos) Then tape.Remove headpos If headpos > tape.Count Then tape.Add rule(3) Else tape.Add rule(3), Before:=headpos End If If rule(4) = "left" Then headpos = headpos - 1 If rule(4) = "right" Then headpos = headpos + 1 state = rule(5) Exit For End If Next i counter = counter + 1 If counter Mod 100000 = 0 Then Debug.Print counter DoEvents DoEvents End If If state = machine(endState) Then Exit Do Loop DoEvents If countOnly Then Debug.Print "Steps taken: ", counter Else show state, headpos, tape Debug.Print End If End Sub Public Sub main() init Dim tap As New Collection tap.Add "1": tap.Add "1": tap.Add "1" UTM incrementer, tap Set tap = New Collection UTM threeStateBB, tap Set tap = New Collection UTM fiveStateBB, tap, countOnly:=-1 End Sub
import java.util.HashMap; import java.util.HashSet; import java.util.LinkedList; import java.util.ListIterator; import java.util.List; import java.util.Set; import java.util.Map; public class UTM { private List<String> tape; private String blankSymbol; private ListIterator<String> head; private Map<StateTapeSymbolPair, Transition> transitions = new HashMap<StateTapeSymbolPair, Transition>(); private Set<String> terminalStates; private String initialState; public UTM(Set<Transition> transitions, Set<String> terminalStates, String initialState, String blankSymbol) { this.blankSymbol = blankSymbol; for (Transition t : transitions) { this.transitions.put(t.from, t); } this.terminalStates = terminalStates; this.initialState = initialState; } public static class StateTapeSymbolPair { private String state; private String tapeSymbol; public StateTapeSymbolPair(String state, String tapeSymbol) { this.state = state; this.tapeSymbol = tapeSymbol; } @Override public int hashCode() { final int prime = 31; int result = 1; result = prime * result + ((state == null) ? 0 : state.hashCode()); result = prime * result + ((tapeSymbol == null) ? 0 : tapeSymbol .hashCode()); return result; } @Override public boolean equals(Object obj) { if (this == obj) return true; if (obj == null) return false; if (getClass() != obj.getClass()) return false; StateTapeSymbolPair other = (StateTapeSymbolPair) obj; if (state == null) { if (other.state != null) return false; } else if (!state.equals(other.state)) return false; if (tapeSymbol == null) { if (other.tapeSymbol != null) return false; } else if (!tapeSymbol.equals(other.tapeSymbol)) return false; return true; } @Override public String toString() { return "(" + state + "," + tapeSymbol + ")"; } } public static class Transition { private StateTapeSymbolPair from; private StateTapeSymbolPair to; private int direction; public Transition(StateTapeSymbolPair from, StateTapeSymbolPair to, int direction) { this.from = from; this.to = to; this.direction = direction; } @Override public String toString() { return from + "=>" + to + "/" + direction; } } public void initializeTape(List<String> input) { tape = input; } public void initializeTape(String input) { tape = new LinkedList<String>(); for (int i = 0; i < input.length(); i++) { tape.add(input.charAt(i) + ""); } } public List<String> runTM() { if (tape.size() == 0) { tape.add(blankSymbol); } head = tape.listIterator(); head.next(); head.previous(); StateTapeSymbolPair tsp = new StateTapeSymbolPair(initialState, tape.get(0)); while (transitions.containsKey(tsp)) { System.out.println(this + " --- " + transitions.get(tsp)); Transition trans = transitions.get(tsp); head.set(trans.to.tapeSymbol); tsp.state = trans.to.state; if (trans.direction == -1) { if (!head.hasPrevious()) { head.add(blankSymbol); } tsp.tapeSymbol = head.previous(); } else if (trans.direction == 1) { head.next(); if (!head.hasNext()) { head.add(blankSymbol); head.previous(); } tsp.tapeSymbol = head.next(); head.previous(); } else { tsp.tapeSymbol = trans.to.tapeSymbol; } } System.out.println(this + " --- " + tsp); if (terminalStates.contains(tsp.state)) { return tape; } else { return null; } } @Override public String toString() { try { int headPos = head.previousIndex(); String s = "[ "; for (int i = 0; i <= headPos; i++) { s += tape.get(i) + " "; } s += "[H] "; for (int i = headPos + 1; i < tape.size(); i++) { s += tape.get(i) + " "; } return s + "]"; } catch (Exception e) { return ""; } } public static void main(String[] args) { String init = "q0"; String blank = "b"; Set<String> term = new HashSet<String>(); term.add("qf"); Set<Transition> trans = new HashSet<Transition>(); trans.add(new Transition(new StateTapeSymbolPair("q0", "1"), new StateTapeSymbolPair("q0", "1"), 1)); trans.add(new Transition(new StateTapeSymbolPair("q0", "b"), new StateTapeSymbolPair("qf", "1"), 0)); UTM machine = new UTM(trans, term, init, blank); machine.initializeTape("111"); System.out.println("Output (si): " + machine.runTM() + "\n"); init = "a"; term.clear(); term.add("halt"); blank = "0"; trans.clear(); trans.add(new Transition(new StateTapeSymbolPair("a", "0"), new StateTapeSymbolPair("b", "1"), 1)); trans.add(new Transition(new StateTapeSymbolPair("a", "1"), new StateTapeSymbolPair("c", "1"), -1)); trans.add(new Transition(new StateTapeSymbolPair("b", "0"), new StateTapeSymbolPair("a", "1"), -1)); trans.add(new Transition(new StateTapeSymbolPair("b", "1"), new StateTapeSymbolPair("b", "1"), 1)); trans.add(new Transition(new StateTapeSymbolPair("c", "0"), new StateTapeSymbolPair("b", "1"), -1)); trans.add(new Transition(new StateTapeSymbolPair("c", "1"), new StateTapeSymbolPair("halt", "1"), 0)); machine = new UTM(trans, term, init, blank); machine.initializeTape(""); System.out.println("Output (bb): " + machine.runTM()); init = "s0"; blank = "*"; term = new HashSet<String>(); term.add("see"); trans = new HashSet<Transition>(); trans.add(new Transition(new StateTapeSymbolPair("s0", "a"), new StateTapeSymbolPair("s0", "a"), 1)); trans.add(new Transition(new StateTapeSymbolPair("s0", "b"), new StateTapeSymbolPair("s1", "B"), 1)); trans.add(new Transition(new StateTapeSymbolPair("s0", "*"), new StateTapeSymbolPair("se", "*"), -1)); trans.add(new Transition(new StateTapeSymbolPair("s1", "a"), new StateTapeSymbolPair("s1", "a"), 1)); trans.add(new Transition(new StateTapeSymbolPair("s1", "b"), new StateTapeSymbolPair("s1", "b"), 1)); trans.add(new Transition(new StateTapeSymbolPair("s1", "*"), new StateTapeSymbolPair("s2", "*"), -1)); trans.add(new Transition(new StateTapeSymbolPair("s2", "a"), new StateTapeSymbolPair("s3", "b"), -1)); trans.add(new Transition(new StateTapeSymbolPair("s2", "b"), new StateTapeSymbolPair("s2", "b"), -1)); trans.add(new Transition(new StateTapeSymbolPair("s2", "B"), new StateTapeSymbolPair("se", "b"), -1)); trans.add(new Transition(new StateTapeSymbolPair("s3", "a"), new StateTapeSymbolPair("s3", "a"), -1)); trans.add(new Transition(new StateTapeSymbolPair("s3", "b"), new StateTapeSymbolPair("s3", "b"), -1)); trans.add(new Transition(new StateTapeSymbolPair("s3", "B"), new StateTapeSymbolPair("s0", "a"), 1)); trans.add(new Transition(new StateTapeSymbolPair("se", "a"), new StateTapeSymbolPair("se", "a"), -1)); trans.add(new Transition(new StateTapeSymbolPair("se", "*"), new StateTapeSymbolPair("see", "*"), 1)); machine = new UTM(trans, term, init, blank); machine.initializeTape("babbababaa"); System.out.println("Output (sort): " + machine.runTM() + "\n"); } }
Port the provided VB code into Java while preserving the original functionality.
Option Base 1 Public Enum sett name_ = 1 initState endState blank rules End Enum Public incrementer As Variant, threeStateBB As Variant, fiveStateBB As Variant Private Sub init() incrementer = Array("Simple incrementer", _ "q0", _ "qf", _ "B", _ Array( _ Array("q0", "1", "1", "right", "q0"), _ Array("q0", "B", "1", "stay", "qf"))) threeStateBB = Array("Three-state busy beaver", _ "a", _ "halt", _ "0", _ Array( _ Array("a", "0", "1", "right", "b"), _ Array("a", "1", "1", "left", "c"), _ Array("b", "0", "1", "left", "a"), _ Array("b", "1", "1", "right", "b"), _ Array("c", "0", "1", "left", "b"), _ Array("c", "1", "1", "stay", "halt"))) fiveStateBB = Array("Five-state busy beaver", _ "A", _ "H", _ "0", _ Array( _ Array("A", "0", "1", "right", "B"), _ Array("A", "1", "1", "left", "C"), _ Array("B", "0", "1", "right", "C"), _ Array("B", "1", "1", "right", "B"), _ Array("C", "0", "1", "right", "D"), _ Array("C", "1", "0", "left", "E"), _ Array("D", "0", "1", "left", "A"), _ Array("D", "1", "1", "left", "D"), _ Array("E", "0", "1", "stay", "H"), _ Array("E", "1", "0", "left", "A"))) End Sub Private Sub show(state As String, headpos As Long, tape As Collection) Debug.Print " "; state; String$(7 - Len(state), " "); "| "; For p = 1 To tape.Count Debug.Print IIf(p = headpos, "[" & tape(p) & "]", " " & tape(p) & " "); Next p Debug.Print End Sub Private Sub UTM(machine As Variant, tape As Collection, Optional countOnly As Long = 0) Dim state As String: state = machine(initState) Dim headpos As Long: headpos = 1 Dim counter As Long, rule As Variant Debug.Print machine(name_); vbCrLf; String$(Len(machine(name_)), "=") If Not countOnly Then Debug.Print " State | Tape [head]" & vbCrLf & "---------------------" Do While True If headpos > tape.Count Then tape.Add machine(blank) Else If headpos < 1 Then tape.Add machine(blank), Before:=1 headpos = 1 End If End If If Not countOnly Then show state, headpos, tape For i = LBound(machine(rules)) To UBound(machine(rules)) rule = machine(rules)(i) If rule(1) = state And rule(2) = tape(headpos) Then tape.Remove headpos If headpos > tape.Count Then tape.Add rule(3) Else tape.Add rule(3), Before:=headpos End If If rule(4) = "left" Then headpos = headpos - 1 If rule(4) = "right" Then headpos = headpos + 1 state = rule(5) Exit For End If Next i counter = counter + 1 If counter Mod 100000 = 0 Then Debug.Print counter DoEvents DoEvents End If If state = machine(endState) Then Exit Do Loop DoEvents If countOnly Then Debug.Print "Steps taken: ", counter Else show state, headpos, tape Debug.Print End If End Sub Public Sub main() init Dim tap As New Collection tap.Add "1": tap.Add "1": tap.Add "1" UTM incrementer, tap Set tap = New Collection UTM threeStateBB, tap Set tap = New Collection UTM fiveStateBB, tap, countOnly:=-1 End Sub
import java.util.HashMap; import java.util.HashSet; import java.util.LinkedList; import java.util.ListIterator; import java.util.List; import java.util.Set; import java.util.Map; public class UTM { private List<String> tape; private String blankSymbol; private ListIterator<String> head; private Map<StateTapeSymbolPair, Transition> transitions = new HashMap<StateTapeSymbolPair, Transition>(); private Set<String> terminalStates; private String initialState; public UTM(Set<Transition> transitions, Set<String> terminalStates, String initialState, String blankSymbol) { this.blankSymbol = blankSymbol; for (Transition t : transitions) { this.transitions.put(t.from, t); } this.terminalStates = terminalStates; this.initialState = initialState; } public static class StateTapeSymbolPair { private String state; private String tapeSymbol; public StateTapeSymbolPair(String state, String tapeSymbol) { this.state = state; this.tapeSymbol = tapeSymbol; } @Override public int hashCode() { final int prime = 31; int result = 1; result = prime * result + ((state == null) ? 0 : state.hashCode()); result = prime * result + ((tapeSymbol == null) ? 0 : tapeSymbol .hashCode()); return result; } @Override public boolean equals(Object obj) { if (this == obj) return true; if (obj == null) return false; if (getClass() != obj.getClass()) return false; StateTapeSymbolPair other = (StateTapeSymbolPair) obj; if (state == null) { if (other.state != null) return false; } else if (!state.equals(other.state)) return false; if (tapeSymbol == null) { if (other.tapeSymbol != null) return false; } else if (!tapeSymbol.equals(other.tapeSymbol)) return false; return true; } @Override public String toString() { return "(" + state + "," + tapeSymbol + ")"; } } public static class Transition { private StateTapeSymbolPair from; private StateTapeSymbolPair to; private int direction; public Transition(StateTapeSymbolPair from, StateTapeSymbolPair to, int direction) { this.from = from; this.to = to; this.direction = direction; } @Override public String toString() { return from + "=>" + to + "/" + direction; } } public void initializeTape(List<String> input) { tape = input; } public void initializeTape(String input) { tape = new LinkedList<String>(); for (int i = 0; i < input.length(); i++) { tape.add(input.charAt(i) + ""); } } public List<String> runTM() { if (tape.size() == 0) { tape.add(blankSymbol); } head = tape.listIterator(); head.next(); head.previous(); StateTapeSymbolPair tsp = new StateTapeSymbolPair(initialState, tape.get(0)); while (transitions.containsKey(tsp)) { System.out.println(this + " --- " + transitions.get(tsp)); Transition trans = transitions.get(tsp); head.set(trans.to.tapeSymbol); tsp.state = trans.to.state; if (trans.direction == -1) { if (!head.hasPrevious()) { head.add(blankSymbol); } tsp.tapeSymbol = head.previous(); } else if (trans.direction == 1) { head.next(); if (!head.hasNext()) { head.add(blankSymbol); head.previous(); } tsp.tapeSymbol = head.next(); head.previous(); } else { tsp.tapeSymbol = trans.to.tapeSymbol; } } System.out.println(this + " --- " + tsp); if (terminalStates.contains(tsp.state)) { return tape; } else { return null; } } @Override public String toString() { try { int headPos = head.previousIndex(); String s = "[ "; for (int i = 0; i <= headPos; i++) { s += tape.get(i) + " "; } s += "[H] "; for (int i = headPos + 1; i < tape.size(); i++) { s += tape.get(i) + " "; } return s + "]"; } catch (Exception e) { return ""; } } public static void main(String[] args) { String init = "q0"; String blank = "b"; Set<String> term = new HashSet<String>(); term.add("qf"); Set<Transition> trans = new HashSet<Transition>(); trans.add(new Transition(new StateTapeSymbolPair("q0", "1"), new StateTapeSymbolPair("q0", "1"), 1)); trans.add(new Transition(new StateTapeSymbolPair("q0", "b"), new StateTapeSymbolPair("qf", "1"), 0)); UTM machine = new UTM(trans, term, init, blank); machine.initializeTape("111"); System.out.println("Output (si): " + machine.runTM() + "\n"); init = "a"; term.clear(); term.add("halt"); blank = "0"; trans.clear(); trans.add(new Transition(new StateTapeSymbolPair("a", "0"), new StateTapeSymbolPair("b", "1"), 1)); trans.add(new Transition(new StateTapeSymbolPair("a", "1"), new StateTapeSymbolPair("c", "1"), -1)); trans.add(new Transition(new StateTapeSymbolPair("b", "0"), new StateTapeSymbolPair("a", "1"), -1)); trans.add(new Transition(new StateTapeSymbolPair("b", "1"), new StateTapeSymbolPair("b", "1"), 1)); trans.add(new Transition(new StateTapeSymbolPair("c", "0"), new StateTapeSymbolPair("b", "1"), -1)); trans.add(new Transition(new StateTapeSymbolPair("c", "1"), new StateTapeSymbolPair("halt", "1"), 0)); machine = new UTM(trans, term, init, blank); machine.initializeTape(""); System.out.println("Output (bb): " + machine.runTM()); init = "s0"; blank = "*"; term = new HashSet<String>(); term.add("see"); trans = new HashSet<Transition>(); trans.add(new Transition(new StateTapeSymbolPair("s0", "a"), new StateTapeSymbolPair("s0", "a"), 1)); trans.add(new Transition(new StateTapeSymbolPair("s0", "b"), new StateTapeSymbolPair("s1", "B"), 1)); trans.add(new Transition(new StateTapeSymbolPair("s0", "*"), new StateTapeSymbolPair("se", "*"), -1)); trans.add(new Transition(new StateTapeSymbolPair("s1", "a"), new StateTapeSymbolPair("s1", "a"), 1)); trans.add(new Transition(new StateTapeSymbolPair("s1", "b"), new StateTapeSymbolPair("s1", "b"), 1)); trans.add(new Transition(new StateTapeSymbolPair("s1", "*"), new StateTapeSymbolPair("s2", "*"), -1)); trans.add(new Transition(new StateTapeSymbolPair("s2", "a"), new StateTapeSymbolPair("s3", "b"), -1)); trans.add(new Transition(new StateTapeSymbolPair("s2", "b"), new StateTapeSymbolPair("s2", "b"), -1)); trans.add(new Transition(new StateTapeSymbolPair("s2", "B"), new StateTapeSymbolPair("se", "b"), -1)); trans.add(new Transition(new StateTapeSymbolPair("s3", "a"), new StateTapeSymbolPair("s3", "a"), -1)); trans.add(new Transition(new StateTapeSymbolPair("s3", "b"), new StateTapeSymbolPair("s3", "b"), -1)); trans.add(new Transition(new StateTapeSymbolPair("s3", "B"), new StateTapeSymbolPair("s0", "a"), 1)); trans.add(new Transition(new StateTapeSymbolPair("se", "a"), new StateTapeSymbolPair("se", "a"), -1)); trans.add(new Transition(new StateTapeSymbolPair("se", "*"), new StateTapeSymbolPair("see", "*"), 1)); machine = new UTM(trans, term, init, blank); machine.initializeTape("babbababaa"); System.out.println("Output (sort): " + machine.runTM() + "\n"); } }
Produce a functionally identical Java code for the snippet given in VB.
Public Sub create_file() Dim FileNumber As Integer FileNumber = FreeFile MkDir "docs" Open "docs\output.txt" For Output As #FreeFile Close #FreeFile MkDir "C:\docs" Open "C:\docs\output.txt" For Output As #FreeFile Close #FreeFile End Sub
import java.io.*; public class CreateFileTest { public static void main(String args[]) { try { new File("output.txt").createNewFile(); new File(File.separator + "output.txt").createNewFile(); new File("docs").mkdir(); new File(File.separator + "docs").mkdir(); } catch (IOException e) { System.err.println(e.getMessage()); } } }
Convert the following code from VB to Java, ensuring the logic remains intact.
b=_ "CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATG" &_ "CTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTG" &_ "AGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGAT" &_ "GGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT" &_ "CGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGG" &_ "TCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA" &_ "TTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTAT" &_ "CGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTG" &_ "TCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGAC" &_ "GACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT" s="SEQUENCE:" acnt=0:ccnt=0:gcnt=0:tcnt=0 for i=0 to len(b)-1 if (i mod 30)=0 then s = s & vbcrlf & right(" "& i+1,3)&": " if (i mod 5)=0 then s=s& " " m=mid(b,i+1,1) s=s & m select case m case "A":acnt=acnt+1 case "C":ccnt=ccnt+1 case "G":gcnt=gcnt+1 case "T":tcnt=tcnt+1 case else wscript.echo "error at ",i+1, m end select next wscript.echo s & vbcrlf wscript.echo "Count: A="&acnt & " C=" & ccnt & " G=" & gcnt & " T=" & tcnt
import java.util.HashMap; import java.util.Map; public class orderedSequence { public static void main(String[] args) { Sequence gene = new Sequence("CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATGCTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTGAGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGATGGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTTCGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGGTCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATATTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTATCGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTGTCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGACGACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT"); gene.runSequence(); } } public class Sequence { private final String seq; public Sequence(String sq) { this.seq = sq; } public void prettyPrint() { System.out.println("Sequence:"); int i = 0; for ( ; i < seq.length() - 50 ; i += 50) { System.out.printf("%5s : %s\n", i + 50, seq.substring(i, i + 50)); } System.out.printf("%5s : %s\n", seq.length(), seq.substring(i)); } public void displayCount() { Map<Character, Integer> counter = new HashMap<>(); for (int i = 0 ; i < seq.length() ; ++i) { counter.merge(seq.charAt(i), 1, Integer::sum); } System.out.println("Base vs. Count:"); counter.forEach( key, value -> System.out.printf("%5s : %s\n", key, value)); System.out.printf("%5s: %s\n", "SUM", seq.length()); } public void runSequence() { this.prettyPrint(); this.displayCount(); } }
Translate the given VB code snippet into Java without altering its behavior.
b=_ "CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATG" &_ "CTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTG" &_ "AGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGAT" &_ "GGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT" &_ "CGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGG" &_ "TCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA" &_ "TTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTAT" &_ "CGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTG" &_ "TCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGAC" &_ "GACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT" s="SEQUENCE:" acnt=0:ccnt=0:gcnt=0:tcnt=0 for i=0 to len(b)-1 if (i mod 30)=0 then s = s & vbcrlf & right(" "& i+1,3)&": " if (i mod 5)=0 then s=s& " " m=mid(b,i+1,1) s=s & m select case m case "A":acnt=acnt+1 case "C":ccnt=ccnt+1 case "G":gcnt=gcnt+1 case "T":tcnt=tcnt+1 case else wscript.echo "error at ",i+1, m end select next wscript.echo s & vbcrlf wscript.echo "Count: A="&acnt & " C=" & ccnt & " G=" & gcnt & " T=" & tcnt
import java.util.HashMap; import java.util.Map; public class orderedSequence { public static void main(String[] args) { Sequence gene = new Sequence("CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATGCTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTGAGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGATGGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTTCGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGGTCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATATTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTATCGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTGTCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGACGACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT"); gene.runSequence(); } } public class Sequence { private final String seq; public Sequence(String sq) { this.seq = sq; } public void prettyPrint() { System.out.println("Sequence:"); int i = 0; for ( ; i < seq.length() - 50 ; i += 50) { System.out.printf("%5s : %s\n", i + 50, seq.substring(i, i + 50)); } System.out.printf("%5s : %s\n", seq.length(), seq.substring(i)); } public void displayCount() { Map<Character, Integer> counter = new HashMap<>(); for (int i = 0 ; i < seq.length() ; ++i) { counter.merge(seq.charAt(i), 1, Integer::sum); } System.out.println("Base vs. Count:"); counter.forEach( key, value -> System.out.printf("%5s : %s\n", key, value)); System.out.printf("%5s: %s\n", "SUM", seq.length()); } public void runSequence() { this.prettyPrint(); this.displayCount(); } }
Write the same code in Java as shown below in VB.
Public Const HOLDON = False Public Const DIJKSTRASOLUTION = True Public Const X = 10 Public Const GETS = 0 Public Const PUTS = 1 Public Const EATS = 2 Public Const THKS = 5 Public Const FRSTFORK = 0 Public Const SCNDFORK = 1 Public Const SPAGHETI = 0 Public Const UNIVERSE = 1 Public Const MAXCOUNT = 100000 Public Const PHILOSOPHERS = 5 Public semaphore(PHILOSOPHERS - 1) As Integer Public positi0n(1, PHILOSOPHERS - 1) As Integer Public programcounter(PHILOSOPHERS - 1) As Long Public statistics(PHILOSOPHERS - 1, 5, 1) As Long Public names As Variant Private Sub init() names = [{"Aquinas","Babbage","Carroll","Derrida","Erasmus"}] For j = 0 To PHILOSOPHERS - 2 positi0n(0, j) = j + 1 positi0n(1, j) = j Next j If DIJKSTRASOLUTION Then positi0n(0, PHILOSOPHERS - 1) = j positi0n(1, PHILOSOPHERS - 1) = 0 Else positi0n(0, PHILOSOPHERS - 1) = 0 positi0n(1, PHILOSOPHERS - 1) = j End If End Sub Private Sub philosopher(subject As Integer, verb As Integer, objekt As Integer) statistics(subject, verb, objekt) = statistics(subject, verb, objekt) + 1 If verb < 2 Then If semaphore(positi0n(objekt, subject)) <> verb Then If Not HOLDON Then semaphore(positi0n(FRSTFORK, subject)) = 1 - objekt programcounter(subject) = 0 End If Else semaphore(positi0n(objekt, subject)) = 1 - verb programcounter(subject) = (programcounter(subject) + 1) Mod 6 End If Else programcounter(subject) = IIf(X * Rnd > 1, verb, verb + 1) Mod 6 End If End Sub Private Sub dine() Dim ph As Integer Do While TC < MAXCOUNT For ph = 0 To PHILOSOPHERS - 1 Select Case programcounter(ph) Case 0: philosopher ph, GETS, FRSTFORK Case 1: philosopher ph, GETS, SCNDFORK Case 2: philosopher ph, EATS, SPAGHETI Case 3: philosopher ph, PUTS, FRSTFORK Case 4: philosopher ph, PUTS, SCNDFORK Case 5: philosopher ph, THKS, UNIVERSE End Select TC = TC + 1 Next ph Loop End Sub Private Sub show() Debug.Print "Stats", "Gets", "Gets", "Eats", "Puts", "Puts", "Thinks" Debug.Print "", "First", "Second", "Spag-", "First", "Second", "About" Debug.Print "", "Fork", "Fork", "hetti", "Fork", "Fork", "Universe" For subject = 0 To PHILOSOPHERS - 1 Debug.Print names(subject + 1), For objekt = 0 To 1 Debug.Print statistics(subject, GETS, objekt), Next objekt Debug.Print statistics(subject, EATS, SPAGHETI), For objekt = 0 To 1 Debug.Print statistics(subject, PUTS, objekt), Next objekt Debug.Print statistics(subject, THKS, UNIVERSE) Next subject End Sub Public Sub main() init dine show End Sub
package diningphilosophers; import java.util.ArrayList; import java.util.Random; import java.util.concurrent.atomic.AtomicBoolean; import java.util.concurrent.atomic.AtomicInteger; enum PhilosopherState { Get, Eat, Pon } class Fork { public static final int ON_TABLE = -1; static int instances = 0; public int id; public AtomicInteger holder = new AtomicInteger(ON_TABLE); Fork() { id = instances++; } } class Philosopher implements Runnable { static final int maxWaitMs = 100; static AtomicInteger token = new AtomicInteger(0); static int instances = 0; static Random rand = new Random(); AtomicBoolean end = new AtomicBoolean(false); int id; PhilosopherState state = PhilosopherState.Get; Fork left; Fork right; int timesEaten = 0; Philosopher() { id = instances++; left = Main.forks.get(id); right = Main.forks.get((id+1)%Main.philosopherCount); } void sleep() { try { Thread.sleep(rand.nextInt(maxWaitMs)); } catch (InterruptedException ex) {} } void waitForFork(Fork fork) { do { if (fork.holder.get() == Fork.ON_TABLE) { fork.holder.set(id); return; } else { sleep(); } } while (true); } public void run() { do { if (state == PhilosopherState.Pon) { state = PhilosopherState.Get; } else { if (token.get() == id) { waitForFork(left); waitForFork(right); token.set((id+2)% Main.philosopherCount); state = PhilosopherState.Eat; timesEaten++; sleep(); left.holder.set(Fork.ON_TABLE); right.holder.set(Fork.ON_TABLE); state = PhilosopherState.Pon; sleep(); } else { sleep(); } } } while (!end.get()); } } public class Main { static final int philosopherCount = 5; static final int runSeconds = 15; static ArrayList<Fork> forks = new ArrayList<Fork>(); static ArrayList<Philosopher> philosophers = new ArrayList<Philosopher>(); public static void main(String[] args) { for (int i = 0 ; i < philosopherCount ; i++) forks.add(new Fork()); for (int i = 0 ; i < philosopherCount ; i++) philosophers.add(new Philosopher()); for (Philosopher p : philosophers) new Thread(p).start(); long endTime = System.currentTimeMillis() + (runSeconds * 1000); do { StringBuilder sb = new StringBuilder("|"); for (Philosopher p : philosophers) { sb.append(p.state.toString()); sb.append("|"); } sb.append(" |"); for (Fork f : forks) { int holder = f.holder.get(); sb.append(holder==-1?" ":String.format("P%02d",holder)); sb.append("|"); } System.out.println(sb.toString()); try {Thread.sleep(1000);} catch (Exception ex) {} } while (System.currentTimeMillis() < endTime); for (Philosopher p : philosophers) p.end.set(true); for (Philosopher p : philosophers) System.out.printf("P%02d: ate %,d times, %,d/sec\n", p.id, p.timesEaten, p.timesEaten/runSeconds); } }
Port the provided VB code into Java while preserving the original functionality.
Dim fact() nn1=9 : nn2=12 lim=1499999 ReDim fact(nn2) fact(0)=1 For i=1 To nn2 fact(i)=fact(i-1)*i Next For base=nn1 To nn2 list="" For i=1 To lim s=0 t=i Do While t<>0 d=t Mod base s=s+fact(d) t=t\base Loop If s=i Then list=list &" "& i Next Wscript.Echo "the factorions for base "& right(" "& base,2) &" are: "& list Next
public class Factorion { public static void main(String [] args){ System.out.println("Base 9:"); for(int i = 1; i <= 1499999; i++){ String iStri = String.valueOf(i); int multiplied = operate(iStri,9); if(multiplied == i){ System.out.print(i + "\t"); } } System.out.println("\nBase 10:"); for(int i = 1; i <= 1499999; i++){ String iStri = String.valueOf(i); int multiplied = operate(iStri,10); if(multiplied == i){ System.out.print(i + "\t"); } } System.out.println("\nBase 11:"); for(int i = 1; i <= 1499999; i++){ String iStri = String.valueOf(i); int multiplied = operate(iStri,11); if(multiplied == i){ System.out.print(i + "\t"); } } System.out.println("\nBase 12:"); for(int i = 1; i <= 1499999; i++){ String iStri = String.valueOf(i); int multiplied = operate(iStri,12); if(multiplied == i){ System.out.print(i + "\t"); } } } public static int factorialRec(int n){ int result = 1; return n == 0 ? result : result * n * factorialRec(n-1); } public static int operate(String s, int base){ int sum = 0; String strx = fromDeci(base, Integer.parseInt(s)); for(int i = 0; i < strx.length(); i++){ if(strx.charAt(i) == 'A'){ sum += factorialRec(10); }else if(strx.charAt(i) == 'B') { sum += factorialRec(11); }else if(strx.charAt(i) == 'C') { sum += factorialRec(12); }else { sum += factorialRec(Integer.parseInt(String.valueOf(strx.charAt(i)), base)); } } return sum; } static char reVal(int num) { if (num >= 0 && num <= 9) return (char)(num + 48); else return (char)(num - 10 + 65); } static String fromDeci(int base, int num){ StringBuilder s = new StringBuilder(); while (num > 0) { s.append(reVal(num % base)); num /= base; } return new String(new StringBuilder(s).reverse()); } }
Write the same algorithm in Java as shown in this VB implementation.
Dim fact() nn1=9 : nn2=12 lim=1499999 ReDim fact(nn2) fact(0)=1 For i=1 To nn2 fact(i)=fact(i-1)*i Next For base=nn1 To nn2 list="" For i=1 To lim s=0 t=i Do While t<>0 d=t Mod base s=s+fact(d) t=t\base Loop If s=i Then list=list &" "& i Next Wscript.Echo "the factorions for base "& right(" "& base,2) &" are: "& list Next
public class Factorion { public static void main(String [] args){ System.out.println("Base 9:"); for(int i = 1; i <= 1499999; i++){ String iStri = String.valueOf(i); int multiplied = operate(iStri,9); if(multiplied == i){ System.out.print(i + "\t"); } } System.out.println("\nBase 10:"); for(int i = 1; i <= 1499999; i++){ String iStri = String.valueOf(i); int multiplied = operate(iStri,10); if(multiplied == i){ System.out.print(i + "\t"); } } System.out.println("\nBase 11:"); for(int i = 1; i <= 1499999; i++){ String iStri = String.valueOf(i); int multiplied = operate(iStri,11); if(multiplied == i){ System.out.print(i + "\t"); } } System.out.println("\nBase 12:"); for(int i = 1; i <= 1499999; i++){ String iStri = String.valueOf(i); int multiplied = operate(iStri,12); if(multiplied == i){ System.out.print(i + "\t"); } } } public static int factorialRec(int n){ int result = 1; return n == 0 ? result : result * n * factorialRec(n-1); } public static int operate(String s, int base){ int sum = 0; String strx = fromDeci(base, Integer.parseInt(s)); for(int i = 0; i < strx.length(); i++){ if(strx.charAt(i) == 'A'){ sum += factorialRec(10); }else if(strx.charAt(i) == 'B') { sum += factorialRec(11); }else if(strx.charAt(i) == 'C') { sum += factorialRec(12); }else { sum += factorialRec(Integer.parseInt(String.valueOf(strx.charAt(i)), base)); } } return sum; } static char reVal(int num) { if (num >= 0 && num <= 9) return (char)(num + 48); else return (char)(num - 10 + 65); } static String fromDeci(int base, int num){ StringBuilder s = new StringBuilder(); while (num > 0) { s.append(reVal(num % base)); num /= base; } return new String(new StringBuilder(s).reverse()); } }
Convert this VB block to Java, preserving its control flow and logic.
Private Function ValidateUserWords(userstring As String) As String Dim s As String Dim user_words() As String Dim command_table As Scripting.Dictionary Set command_table = New Scripting.Dictionary Dim abbreviations As Scripting.Dictionary Set abbreviations = New Scripting.Dictionary abbreviations.CompareMode = TextCompare Dim commandtable() As String Dim commands As String s = s & "Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy " s = s & "COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find " s = s & "NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput " s = s & "Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO " s = s & "MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT " s = s & "READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT " s = s & "RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up " commandtable = Split(s, " ") Dim i As Integer For Each word In commandtable If Len(word) > 0 Then i = 1 Do While Mid(word, i, 1) >= "A" And Mid(word, i, 1) <= "Z" i = i + 1 Loop command_table.Add Key:=word, Item:=i - 1 End If Next word For Each word In command_table For i = command_table(word) To Len(word) On Error Resume Next abbreviations.Add Key:=Left(word, i), Item:=UCase(word) Next i Next word user_words() = Split(userstring, " ") For Each word In user_words If Len(word) > 0 Then If abbreviations.exists(word) Then commands = commands & abbreviations(word) & " " Else commands = commands & "*error* " End If End If Next word ValidateUserWords = commands End Function Public Sub program() Dim guserstring As String guserstring = "riG rePEAT copies put mo rest types fup. 6 poweRin" Debug.Print "user words:", guserstring Debug.Print "full words:", ValidateUserWords(guserstring) End Sub
import java.util.HashMap; import java.util.Map; import java.util.Scanner; public class AbbreviationsEasy { private static final Scanner input = new Scanner(System.in); private static final String COMMAND_TABLE = " Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy\n" + " COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find\n" + " NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput\n" + " Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO\n" + " MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT\n" + " READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT\n" + " RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up"; public static void main(String[] args) { String[] cmdTableArr = COMMAND_TABLE.split("\\s+"); Map<String, Integer> cmd_table = new HashMap<String, Integer>(); for (String word : cmdTableArr) { cmd_table.put(word, countCaps(word)); } System.out.print("Please enter your command to verify: "); String userInput = input.nextLine(); String[] user_input = userInput.split("\\s+"); for (String s : user_input) { boolean match = false; for (String cmd : cmd_table.keySet()) { if (s.length() >= cmd_table.get(cmd) && s.length() <= cmd.length()) { String temp = cmd.toUpperCase(); if (temp.startsWith(s.toUpperCase())) { System.out.print(temp + " "); match = true; } } } if (!match) { System.out.print("*error* "); } } } private static int countCaps(String word) { int numCaps = 0; for (int i = 0; i < word.length(); i++) { if (Character.isUpperCase(word.charAt(i))) { numCaps++; } } return numCaps; } }
Change the following VB code into Java without altering its purpose.
Private Function ValidateUserWords(userstring As String) As String Dim s As String Dim user_words() As String Dim command_table As Scripting.Dictionary Set command_table = New Scripting.Dictionary Dim abbreviations As Scripting.Dictionary Set abbreviations = New Scripting.Dictionary abbreviations.CompareMode = TextCompare Dim commandtable() As String Dim commands As String s = s & "Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy " s = s & "COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find " s = s & "NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput " s = s & "Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO " s = s & "MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT " s = s & "READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT " s = s & "RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up " commandtable = Split(s, " ") Dim i As Integer For Each word In commandtable If Len(word) > 0 Then i = 1 Do While Mid(word, i, 1) >= "A" And Mid(word, i, 1) <= "Z" i = i + 1 Loop command_table.Add Key:=word, Item:=i - 1 End If Next word For Each word In command_table For i = command_table(word) To Len(word) On Error Resume Next abbreviations.Add Key:=Left(word, i), Item:=UCase(word) Next i Next word user_words() = Split(userstring, " ") For Each word In user_words If Len(word) > 0 Then If abbreviations.exists(word) Then commands = commands & abbreviations(word) & " " Else commands = commands & "*error* " End If End If Next word ValidateUserWords = commands End Function Public Sub program() Dim guserstring As String guserstring = "riG rePEAT copies put mo rest types fup. 6 poweRin" Debug.Print "user words:", guserstring Debug.Print "full words:", ValidateUserWords(guserstring) End Sub
import java.util.HashMap; import java.util.Map; import java.util.Scanner; public class AbbreviationsEasy { private static final Scanner input = new Scanner(System.in); private static final String COMMAND_TABLE = " Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy\n" + " COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find\n" + " NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput\n" + " Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO\n" + " MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT\n" + " READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT\n" + " RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up"; public static void main(String[] args) { String[] cmdTableArr = COMMAND_TABLE.split("\\s+"); Map<String, Integer> cmd_table = new HashMap<String, Integer>(); for (String word : cmdTableArr) { cmd_table.put(word, countCaps(word)); } System.out.print("Please enter your command to verify: "); String userInput = input.nextLine(); String[] user_input = userInput.split("\\s+"); for (String s : user_input) { boolean match = false; for (String cmd : cmd_table.keySet()) { if (s.length() >= cmd_table.get(cmd) && s.length() <= cmd.length()) { String temp = cmd.toUpperCase(); if (temp.startsWith(s.toUpperCase())) { System.out.print(temp + " "); match = true; } } } if (!match) { System.out.print("*error* "); } } } private static int countCaps(String word) { int numCaps = 0; for (int i = 0; i < word.length(); i++) { if (Character.isUpperCase(word.charAt(i))) { numCaps++; } } return numCaps; } }
Change the following VB code into Java without altering its purpose.
Private Function ValidateUserWords(userstring As String) As String Dim s As String Dim user_words() As String Dim command_table As Scripting.Dictionary Set command_table = New Scripting.Dictionary Dim abbreviations As Scripting.Dictionary Set abbreviations = New Scripting.Dictionary abbreviations.CompareMode = TextCompare Dim commandtable() As String Dim commands As String s = s & "Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy " s = s & "COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find " s = s & "NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput " s = s & "Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO " s = s & "MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT " s = s & "READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT " s = s & "RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up " commandtable = Split(s, " ") Dim i As Integer For Each word In commandtable If Len(word) > 0 Then i = 1 Do While Mid(word, i, 1) >= "A" And Mid(word, i, 1) <= "Z" i = i + 1 Loop command_table.Add Key:=word, Item:=i - 1 End If Next word For Each word In command_table For i = command_table(word) To Len(word) On Error Resume Next abbreviations.Add Key:=Left(word, i), Item:=UCase(word) Next i Next word user_words() = Split(userstring, " ") For Each word In user_words If Len(word) > 0 Then If abbreviations.exists(word) Then commands = commands & abbreviations(word) & " " Else commands = commands & "*error* " End If End If Next word ValidateUserWords = commands End Function Public Sub program() Dim guserstring As String guserstring = "riG rePEAT copies put mo rest types fup. 6 poweRin" Debug.Print "user words:", guserstring Debug.Print "full words:", ValidateUserWords(guserstring) End Sub
import java.util.HashMap; import java.util.Map; import java.util.Scanner; public class AbbreviationsEasy { private static final Scanner input = new Scanner(System.in); private static final String COMMAND_TABLE = " Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy\n" + " COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find\n" + " NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput\n" + " Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO\n" + " MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT\n" + " READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT\n" + " RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up"; public static void main(String[] args) { String[] cmdTableArr = COMMAND_TABLE.split("\\s+"); Map<String, Integer> cmd_table = new HashMap<String, Integer>(); for (String word : cmdTableArr) { cmd_table.put(word, countCaps(word)); } System.out.print("Please enter your command to verify: "); String userInput = input.nextLine(); String[] user_input = userInput.split("\\s+"); for (String s : user_input) { boolean match = false; for (String cmd : cmd_table.keySet()) { if (s.length() >= cmd_table.get(cmd) && s.length() <= cmd.length()) { String temp = cmd.toUpperCase(); if (temp.startsWith(s.toUpperCase())) { System.out.print(temp + " "); match = true; } } } if (!match) { System.out.print("*error* "); } } } private static int countCaps(String word) { int numCaps = 0; for (int i = 0; i < word.length(); i++) { if (Character.isUpperCase(word.charAt(i))) { numCaps++; } } return numCaps; } }
Port the provided VB code into Java while preserving the original functionality.
Imports System.Text Module Module1 ReadOnly CODES As New Dictionary(Of Char, String) From { {"a", "AAAAA"}, {"b", "AAAAB"}, {"c", "AAABA"}, {"d", "AAABB"}, {"e", "AABAA"}, {"f", "AABAB"}, {"g", "AABBA"}, {"h", "AABBB"}, {"i", "ABAAA"}, {"j", "ABAAB"}, {"k", "ABABA"}, {"l", "ABABB"}, {"m", "ABBAA"}, {"n", "ABBAB"}, {"o", "ABBBA"}, {"p", "ABBBB"}, {"q", "BAAAA"}, {"r", "BAAAB"}, {"s", "BAABA"}, {"t", "BAABB"}, {"u", "BABAA"}, {"v", "BABAB"}, {"w", "BABBA"}, {"x", "BABBB"}, {"y", "BBAAA"}, {"z", "BBAAB"}, {" ", "BBBAA"} } Function Encode(plainText As String, message As String) As String Dim pt = plainText.ToLower() Dim sb As New StringBuilder() For Each c In pt If "a" <= c AndAlso c <= "z" Then sb.Append(CODES(c)) Else sb.Append(CODES(" ")) End If Next Dim et = sb.ToString() Dim mg = message.ToLower() sb.Length = 0 Dim count = 0 For Each c In mg If "a" <= c AndAlso c <= "z" Then If et(count) = "A" Then sb.Append(c) Else sb.Append(Chr(Asc(c) - 32)) End If count += 1 If count = et.Length Then Exit For End If Else sb.Append(c) End If Next Return sb.ToString() End Function Function Decode(message As String) As String Dim sb As New StringBuilder For Each c In message If "a" <= c AndAlso c <= "z" Then sb.Append("A") ElseIf "A" <= c AndAlso c <= "Z" Then sb.Append("B") End If Next Dim et = sb.ToString() sb.Length = 0 For index = 0 To et.Length - 1 Step 5 Dim quintet = et.Substring(index, 5) Dim key = CODES.Where(Function(a) a.Value = quintet).First().Key sb.Append(key) Next Return sb.ToString() End Function Sub Main() Dim plainText = "the quick brown fox jumps over the lazy dog" Dim message = "bacon "this task is to implement a program for encryption and decryption of " + "plaintext using the simple alphabet of the baconian cipher or some " + "other kind of representation of this alphabet (make anything signify anything). " + "the baconian alphabet may optionally be extended to encode all lower " + "case characters individually and/or adding a few punctuation characters " + "such as the space." Dim cipherText = Encode(plainText, message) Console.WriteLine("Cipher text ->" & Environment.NewLine & "{0}", cipherText) Dim decodedText = Decode(cipherText) Console.WriteLine(Environment.NewLine & "Hidden text ->" & Environment.NewLine & "{0}", decodedText) End Sub End Module
import java.util.HashMap; import java.util.Map; import java.util.Objects; public class BaconCipher { private static final Map<Character, String> codes; static { codes = new HashMap<>(); codes.putAll(Map.of( 'a', "AAAAA", 'b', "AAAAB", 'c', "AAABA", 'd', "AAABB", 'e', "AABAA", 'f', "AABAB", 'g', "AABBA", 'h', "AABBB", 'i', "ABAAA", 'j', "ABAAB" )); codes.putAll(Map.of( 'k', "ABABA", 'l', "ABABB", 'm', "ABBAA", 'n', "ABBAB", 'o', "ABBBA", 'p', "ABBBB", 'q', "BAAAA", 'r', "BAAAB", 's', "BAABA", 't', "BAABB" )); codes.putAll(Map.of( 'u', "BABAA", 'v', "BABAB", 'w', "BABBA", 'x', "BABBB", 'y', "BBAAA", 'z', "BBAAB", ' ', "BBBAA" )); } private static String encode(String plainText, String message) { String pt = plainText.toLowerCase(); StringBuilder sb = new StringBuilder(); for (char c : pt.toCharArray()) { if ('a' <= c && c <= 'z') sb.append(codes.get(c)); else sb.append(codes.get(' ')); } String et = sb.toString(); String mg = message.toLowerCase(); sb.setLength(0); int count = 0; for (char c : mg.toCharArray()) { if ('a' <= c && c <= 'z') { if (et.charAt(count) == 'A') sb.append(c); else sb.append(((char) (c - 32))); count++; if (count == et.length()) break; } else sb.append(c); } return sb.toString(); } private static String decode(String message) { StringBuilder sb = new StringBuilder(); for (char c : message.toCharArray()) { if ('a' <= c && c <= 'z') sb.append('A'); if ('A' <= c && c <= 'Z') sb.append('B'); } String et = sb.toString(); sb.setLength(0); for (int i = 0; i < et.length(); i += 5) { String quintet = et.substring(i, i + 5); Character key = codes.entrySet().stream().filter(a -> Objects.equals(a.getValue(), quintet)).findFirst().map(Map.Entry::getKey).orElse(null); sb.append(key); } return sb.toString(); } public static void main(String[] args) { String plainText = "the quick brown fox jumps over the lazy dog"; String message = "bacon's cipher is a method of steganography created by francis bacon. " + "this task is to implement a program for encryption and decryption of " + "plaintext using the simple alphabet of the baconian cipher or some " + "other kind of representation of this alphabet (make anything signify anything). " + "the baconian alphabet may optionally be extended to encode all lower " + "case characters individually and/or adding a few punctuation characters " + "such as the space."; String cipherText = encode(plainText, message); System.out.printf("Cipher text ->\n\n%s\n", cipherText); String decodedText = decode(cipherText); System.out.printf("\nHidden text ->\n\n%s\n", decodedText); } }
Convert this VB block to Java, preserving its control flow and logic.
Imports System.Text Module Module1 ReadOnly CODES As New Dictionary(Of Char, String) From { {"a", "AAAAA"}, {"b", "AAAAB"}, {"c", "AAABA"}, {"d", "AAABB"}, {"e", "AABAA"}, {"f", "AABAB"}, {"g", "AABBA"}, {"h", "AABBB"}, {"i", "ABAAA"}, {"j", "ABAAB"}, {"k", "ABABA"}, {"l", "ABABB"}, {"m", "ABBAA"}, {"n", "ABBAB"}, {"o", "ABBBA"}, {"p", "ABBBB"}, {"q", "BAAAA"}, {"r", "BAAAB"}, {"s", "BAABA"}, {"t", "BAABB"}, {"u", "BABAA"}, {"v", "BABAB"}, {"w", "BABBA"}, {"x", "BABBB"}, {"y", "BBAAA"}, {"z", "BBAAB"}, {" ", "BBBAA"} } Function Encode(plainText As String, message As String) As String Dim pt = plainText.ToLower() Dim sb As New StringBuilder() For Each c In pt If "a" <= c AndAlso c <= "z" Then sb.Append(CODES(c)) Else sb.Append(CODES(" ")) End If Next Dim et = sb.ToString() Dim mg = message.ToLower() sb.Length = 0 Dim count = 0 For Each c In mg If "a" <= c AndAlso c <= "z" Then If et(count) = "A" Then sb.Append(c) Else sb.Append(Chr(Asc(c) - 32)) End If count += 1 If count = et.Length Then Exit For End If Else sb.Append(c) End If Next Return sb.ToString() End Function Function Decode(message As String) As String Dim sb As New StringBuilder For Each c In message If "a" <= c AndAlso c <= "z" Then sb.Append("A") ElseIf "A" <= c AndAlso c <= "Z" Then sb.Append("B") End If Next Dim et = sb.ToString() sb.Length = 0 For index = 0 To et.Length - 1 Step 5 Dim quintet = et.Substring(index, 5) Dim key = CODES.Where(Function(a) a.Value = quintet).First().Key sb.Append(key) Next Return sb.ToString() End Function Sub Main() Dim plainText = "the quick brown fox jumps over the lazy dog" Dim message = "bacon "this task is to implement a program for encryption and decryption of " + "plaintext using the simple alphabet of the baconian cipher or some " + "other kind of representation of this alphabet (make anything signify anything). " + "the baconian alphabet may optionally be extended to encode all lower " + "case characters individually and/or adding a few punctuation characters " + "such as the space." Dim cipherText = Encode(plainText, message) Console.WriteLine("Cipher text ->" & Environment.NewLine & "{0}", cipherText) Dim decodedText = Decode(cipherText) Console.WriteLine(Environment.NewLine & "Hidden text ->" & Environment.NewLine & "{0}", decodedText) End Sub End Module
import java.util.HashMap; import java.util.Map; import java.util.Objects; public class BaconCipher { private static final Map<Character, String> codes; static { codes = new HashMap<>(); codes.putAll(Map.of( 'a', "AAAAA", 'b', "AAAAB", 'c', "AAABA", 'd', "AAABB", 'e', "AABAA", 'f', "AABAB", 'g', "AABBA", 'h', "AABBB", 'i', "ABAAA", 'j', "ABAAB" )); codes.putAll(Map.of( 'k', "ABABA", 'l', "ABABB", 'm', "ABBAA", 'n', "ABBAB", 'o', "ABBBA", 'p', "ABBBB", 'q', "BAAAA", 'r', "BAAAB", 's', "BAABA", 't', "BAABB" )); codes.putAll(Map.of( 'u', "BABAA", 'v', "BABAB", 'w', "BABBA", 'x', "BABBB", 'y', "BBAAA", 'z', "BBAAB", ' ', "BBBAA" )); } private static String encode(String plainText, String message) { String pt = plainText.toLowerCase(); StringBuilder sb = new StringBuilder(); for (char c : pt.toCharArray()) { if ('a' <= c && c <= 'z') sb.append(codes.get(c)); else sb.append(codes.get(' ')); } String et = sb.toString(); String mg = message.toLowerCase(); sb.setLength(0); int count = 0; for (char c : mg.toCharArray()) { if ('a' <= c && c <= 'z') { if (et.charAt(count) == 'A') sb.append(c); else sb.append(((char) (c - 32))); count++; if (count == et.length()) break; } else sb.append(c); } return sb.toString(); } private static String decode(String message) { StringBuilder sb = new StringBuilder(); for (char c : message.toCharArray()) { if ('a' <= c && c <= 'z') sb.append('A'); if ('A' <= c && c <= 'Z') sb.append('B'); } String et = sb.toString(); sb.setLength(0); for (int i = 0; i < et.length(); i += 5) { String quintet = et.substring(i, i + 5); Character key = codes.entrySet().stream().filter(a -> Objects.equals(a.getValue(), quintet)).findFirst().map(Map.Entry::getKey).orElse(null); sb.append(key); } return sb.toString(); } public static void main(String[] args) { String plainText = "the quick brown fox jumps over the lazy dog"; String message = "bacon's cipher is a method of steganography created by francis bacon. " + "this task is to implement a program for encryption and decryption of " + "plaintext using the simple alphabet of the baconian cipher or some " + "other kind of representation of this alphabet (make anything signify anything). " + "the baconian alphabet may optionally be extended to encode all lower " + "case characters individually and/or adding a few punctuation characters " + "such as the space."; String cipherText = encode(plainText, message); System.out.printf("Cipher text ->\n\n%s\n", cipherText); String decodedText = decode(cipherText); System.out.printf("\nHidden text ->\n\n%s\n", decodedText); } }
Please provide an equivalent version of this VB code in Java.
Function build_spiral(n) botcol = 0 : topcol = n - 1 botrow = 0 : toprow = n - 1 Dim matrix() ReDim matrix(topcol,toprow) dir = 0 : col = 0 : row = 0 For i = 0 To n*n-1 matrix(col,row) = i Select Case dir Case 0 If col < topcol Then col = col + 1 Else dir = 1 : row = row + 1 : botrow = botrow + 1 End If Case 1 If row < toprow Then row = row + 1 Else dir = 2 : col = col - 1 : topcol = topcol - 1 End If Case 2 If col > botcol Then col = col - 1 Else dir = 3 : row = row - 1 : toprow = toprow - 1 End If Case 3 If row > botrow Then row = row - 1 Else dir = 0 : col = col + 1 : botcol = botcol + 1 End If End Select Next For y = 0 To n-1 For x = 0 To n-1 WScript.StdOut.Write matrix(x,y) & vbTab Next WScript.StdOut.WriteLine Next End Function build_spiral(CInt(WScript.Arguments(0)))
public class Blah { public static void main(String[] args) { print2dArray(getSpiralArray(5)); } public static int[][] getSpiralArray(int dimension) { int[][] spiralArray = new int[dimension][dimension]; int numConcentricSquares = (int) Math.ceil((dimension) / 2.0); int j; int sideLen = dimension; int currNum = 0; for (int i = 0; i < numConcentricSquares; i++) { for (j = 0; j < sideLen; j++) { spiralArray[i][i + j] = currNum++; } for (j = 1; j < sideLen; j++) { spiralArray[i + j][dimension - 1 - i] = currNum++; } for (j = sideLen - 2; j > -1; j--) { spiralArray[dimension - 1 - i][i + j] = currNum++; } for (j = sideLen - 2; j > 0; j--) { spiralArray[i + j][i] = currNum++; } sideLen -= 2; } return spiralArray; } public static void print2dArray(int[][] array) { for (int[] row : array) { for (int elem : row) { System.out.printf("%3d", elem); } System.out.println(); } } }
Generate an equivalent Java version of this VB code.
Private Sub optional_parameters(theRange As String, _ Optional ordering As Integer = 0, _ Optional column As Integer = 1, _ Optional reverse As Integer = 1) ActiveSheet.Sort.SortFields.Clear ActiveSheet.Sort.SortFields.Add _ Key:=Range(theRange).Columns(column), _ SortOn:=SortOnValues, _ Order:=reverse, _ DataOption:=ordering With ActiveSheet.Sort .SetRange Range(theRange) .Header = xlGuess .MatchCase = False .Orientation = xlTopToBottom .SortMethod = xlPinYin .Apply End With End Sub Public Sub main() optional_parameters theRange:="A1:C4", ordering:=1, column:=2, reverse:=1 End Sub
module OptionalParameters { typedef Type<String >.Orderer as ColumnOrderer; typedef Type<String[]>.Orderer as RowOrderer; static String[][] sort(String[][] table, ColumnOrderer? orderer = Null, Int column = 0, Boolean reverse = False, ) { orderer ?:= (s1, s2) -> s1 <=> s2; ColumnOrderer byString = reverse ? ((s1, s2) -> orderer(s1, s2).reversed) : orderer; RowOrderer byColumn = (row1, row2) -> byString(row1[column], row2[column]); return table.sorted(byColumn); } void run() { String[][] table = [ ["c", "x", "i"], ["a", "y", "p"], ["b", "z", "a"], ]; show("original input", table); show("by default sort on column 0", sort(table)); show("by column 2", sort(table, column=2)); show("by column 2 reversed", sort(table, column=2, reverse=True)); } void show(String title, String[][] table) { @Inject Console console; console.print($"{title}:"); for (val row : table) { console.print($" {row}"); } console.print(); } }
Convert this VB block to Java, preserving its control flow and logic.
Declare Function CreateFileW Lib "Kernel32" (FileName As WString, DesiredAccess As Integer, ShareMode As Integer, SecurityAttributes As Integer, _ CreateDisposition As Integer, Flags As Integer, Template As Integer) As Integer Declare Function WriteFile Lib "Kernel32" (fHandle As Integer, writeData As Ptr, numOfBytes As Integer, ByRef numOfBytesWritten As Integer, _ overlapped As Ptr) As Boolean Declare Function GetLastError Lib "Kernel32" () As Integer Declare Function CloseHandle Lib "kernel32" (hObject As Integer) As Boolean Const FILE_SHARE_READ = &h00000001 Const FILE_SHARE_WRITE = &h00000002 Const OPEN_EXISTING = 3 Dim fHandle As Integer = CreateFileW("C:\foo.txt", 0, FILE_SHARE_READ Or FILE_SHARE_WRITE, 0, OPEN_EXISTING, 0, 0) If fHandle > 0 Then Dim mb As MemoryBlock = "Hello, World!" Dim bytesWritten As Integer If Not WriteFile(fHandle, mb, mb.Size, bytesWritten, Nil) Then MsgBox("Error Number: " + Str(GetLastError)) End If Call CloseHandle(fHandle) Else MsgBox("Error Number: " + Str(GetLastError)) End If
public class JNIDemo { static { System.loadLibrary("JNIDemo"); } public static void main(String[] args) { System.out.println(callStrdup("Hello World!")); } private static native String callStrdup(String s); }
Translate the given VB code snippet into Java without altering its behavior.
Module Module1 Class Frac Private ReadOnly num As Long Private ReadOnly denom As Long Public Shared ReadOnly ZERO = New Frac(0, 1) Public Shared ReadOnly ONE = New Frac(1, 1) Public Sub New(n As Long, d As Long) If d = 0 Then Throw New ArgumentException("d must not be zero") End If Dim nn = n Dim dd = d If nn = 0 Then dd = 1 ElseIf dd < 0 Then nn = -nn dd = -dd End If Dim g = Math.Abs(Gcd(nn, dd)) If g > 1 Then nn /= g dd /= g End If num = nn denom = dd End Sub Private Shared Function Gcd(a As Long, b As Long) As Long If b = 0 Then Return a Else Return Gcd(b, a Mod b) End If End Function Public Shared Operator -(self As Frac) As Frac Return New Frac(-self.num, self.denom) End Operator Public Shared Operator +(lhs As Frac, rhs As Frac) As Frac Return New Frac(lhs.num * rhs.denom + lhs.denom * rhs.num, rhs.denom * lhs.denom) End Operator Public Shared Operator -(lhs As Frac, rhs As Frac) As Frac Return lhs + -rhs End Operator Public Shared Operator *(lhs As Frac, rhs As Frac) As Frac Return New Frac(lhs.num * rhs.num, lhs.denom * rhs.denom) End Operator Public Shared Operator <(lhs As Frac, rhs As Frac) As Boolean Dim x = lhs.num / lhs.denom Dim y = rhs.num / rhs.denom Return x < y End Operator Public Shared Operator >(lhs As Frac, rhs As Frac) As Boolean Dim x = lhs.num / lhs.denom Dim y = rhs.num / rhs.denom Return x > y End Operator Public Shared Operator =(lhs As Frac, rhs As Frac) As Boolean Return lhs.num = rhs.num AndAlso lhs.denom = rhs.denom End Operator Public Shared Operator <>(lhs As Frac, rhs As Frac) As Boolean Return lhs.num <> rhs.num OrElse lhs.denom <> rhs.denom End Operator Public Overrides Function ToString() As String If denom = 1 Then Return num.ToString Else Return String.Format("{0}/{1}", num, denom) End If End Function Public Overrides Function Equals(obj As Object) As Boolean Dim frac = CType(obj, Frac) Return Not IsNothing(frac) AndAlso num = frac.num AndAlso denom = frac.denom End Function End Class Function Bernoulli(n As Integer) As Frac If n < 0 Then Throw New ArgumentException("n may not be negative or zero") End If Dim a(n + 1) As Frac For m = 0 To n a(m) = New Frac(1, m + 1) For j = m To 1 Step -1 a(j - 1) = (a(j - 1) - a(j)) * New Frac(j, 1) Next Next If n <> 1 Then Return a(0) Else Return -a(0) End If End Function Function Binomial(n As Integer, k As Integer) As Integer If n < 0 OrElse k < 0 OrElse n < k Then Throw New ArgumentException() End If If n = 0 OrElse k = 0 Then Return 1 End If Dim num = 1 For i = k + 1 To n num *= i Next Dim denom = 1 For i = 2 To n - k denom *= i Next Return num \ denom End Function Function FaulhaberTriangle(p As Integer) As Frac() Dim coeffs(p + 1) As Frac For i = 1 To p + 1 coeffs(i - 1) = Frac.ZERO Next Dim q As New Frac(1, p + 1) Dim sign = -1 For j = 0 To p sign *= -1 coeffs(p - j) = q * New Frac(sign, 1) * New Frac(Binomial(p + 1, j), 1) * Bernoulli(j) Next Return coeffs End Function Sub Main() For i = 1 To 10 Dim coeffs = FaulhaberTriangle(i - 1) For Each coeff In coeffs Console.Write("{0,5} ", coeff) Next Console.WriteLine() Next End Sub End Module
import java.math.BigDecimal; import java.math.MathContext; import java.util.Arrays; import java.util.stream.LongStream; public class FaulhabersTriangle { private static final MathContext MC = new MathContext(256); private static long gcd(long a, long b) { if (b == 0) { return a; } return gcd(b, a % b); } private static class Frac implements Comparable<Frac> { private long num; private long denom; public static final Frac ZERO = new Frac(0, 1); public Frac(long n, long d) { if (d == 0) throw new IllegalArgumentException("d must not be zero"); long nn = n; long dd = d; if (nn == 0) { dd = 1; } else if (dd < 0) { nn = -nn; dd = -dd; } long g = Math.abs(gcd(nn, dd)); if (g > 1) { nn /= g; dd /= g; } num = nn; denom = dd; } public Frac plus(Frac rhs) { return new Frac(num * rhs.denom + denom * rhs.num, rhs.denom * denom); } public Frac unaryMinus() { return new Frac(-num, denom); } public Frac minus(Frac rhs) { return this.plus(rhs.unaryMinus()); } public Frac times(Frac rhs) { return new Frac(this.num * rhs.num, this.denom * rhs.denom); } @Override public int compareTo(Frac o) { double diff = toDouble() - o.toDouble(); return Double.compare(diff, 0.0); } @Override public boolean equals(Object obj) { return null != obj && obj instanceof Frac && this.compareTo((Frac) obj) == 0; } @Override public String toString() { if (denom == 1) { return Long.toString(num); } return String.format("%d/%d", num, denom); } public double toDouble() { return (double) num / denom; } public BigDecimal toBigDecimal() { return BigDecimal.valueOf(num).divide(BigDecimal.valueOf(denom), MC); } } private static Frac bernoulli(int n) { if (n < 0) throw new IllegalArgumentException("n may not be negative or zero"); Frac[] a = new Frac[n + 1]; Arrays.fill(a, Frac.ZERO); for (int m = 0; m <= n; ++m) { a[m] = new Frac(1, m + 1); for (int j = m; j >= 1; --j) { a[j - 1] = a[j - 1].minus(a[j]).times(new Frac(j, 1)); } } if (n != 1) return a[0]; return a[0].unaryMinus(); } private static long binomial(int n, int k) { if (n < 0 || k < 0 || n < k) throw new IllegalArgumentException(); if (n == 0 || k == 0) return 1; long num = LongStream.rangeClosed(k + 1, n).reduce(1, (a, b) -> a * b); long den = LongStream.rangeClosed(2, n - k).reduce(1, (acc, i) -> acc * i); return num / den; } private static Frac[] faulhaberTriangle(int p) { Frac[] coeffs = new Frac[p + 1]; Arrays.fill(coeffs, Frac.ZERO); Frac q = new Frac(1, p + 1); int sign = -1; for (int j = 0; j <= p; ++j) { sign *= -1; coeffs[p - j] = q.times(new Frac(sign, 1)).times(new Frac(binomial(p + 1, j), 1)).times(bernoulli(j)); } return coeffs; } public static void main(String[] args) { for (int i = 0; i <= 9; ++i) { Frac[] coeffs = faulhaberTriangle(i); for (Frac coeff : coeffs) { System.out.printf("%5s ", coeff); } System.out.println(); } System.out.println(); int k = 17; Frac[] cc = faulhaberTriangle(k); int n = 1000; BigDecimal nn = BigDecimal.valueOf(n); BigDecimal np = BigDecimal.ONE; BigDecimal sum = BigDecimal.ZERO; for (Frac c : cc) { np = np.multiply(nn); sum = sum.add(np.multiply(c.toBigDecimal())); } System.out.println(sum.toBigInteger()); } }
Preserve the algorithm and functionality while converting the code from VB to Java.
Function Run(args() as String) As Integer For each arg As String In args Stdout.WriteLine(arg) Next End Function
public class Arguments { public static void main(String[] args) { System.out.println("There are " + args.length + " arguments given."); for(int i = 0; i < args.length; i++) System.out.println("The argument #" + (i+1) + " is " + args[i] + " and is at index " + i); } }
Change the programming language of this snippet from VB to Java without modifying what it does.
Function Run(args() as String) As Integer For each arg As String In args Stdout.WriteLine(arg) Next End Function
public class Arguments { public static void main(String[] args) { System.out.println("There are " + args.length + " arguments given."); for(int i = 0; i < args.length; i++) System.out.println("The argument #" + (i+1) + " is " + args[i] + " and is at index " + i); } }
Convert the following code from VB to Java, ensuring the logic remains intact.
Function Run(args() as String) As Integer For each arg As String In args Stdout.WriteLine(arg) Next End Function
public class Arguments { public static void main(String[] args) { System.out.println("There are " + args.length + " arguments given."); for(int i = 0; i < args.length; i++) System.out.println("The argument #" + (i+1) + " is " + args[i] + " and is at index " + i); } }
Preserve the algorithm and functionality while converting the code from VB to Java.
DEFINT A(1 to 4) = {1, 2, 3, 4} DEFINT B(1 to 4) = {10, 20, 30, 40} Redim A(1 to 8) as integer MEMCPY(varptr(A(5)), varptr(B(1)), Sizeof(integer)*4)
String[] fruits = ["apples", "oranges"]; String[] grains = ["wheat", "corn"]; String[] all = fruits + grains;