Instruction
stringlengths
45
106
input_code
stringlengths
1
13.7k
output_code
stringlengths
1
13.7k
Maintain the same structure and functionality when rewriting this code in C.
package main import "fmt" type expr struct { x, y, z float64 c float64 } func addExpr(a, b expr) expr { return expr{a.x + b.x, a.y + b.y, a.z + b.z, a.c + b.c} } func subExpr(a, b expr) expr { return expr{a.x - b.x, a.y - b.y, a.z - b.z, a.c - b.c} } func mulExpr(a expr, c float64) expr { return expr{a.x * c, a.y * c, a.z * c, a.c * c} } func addRow(l []expr) []expr { if len(l) == 0 { panic("wrong") } r := make([]expr, len(l)-1) for i := range r { r[i] = addExpr(l[i], l[i+1]) } return r } func substX(a, b expr) expr { if b.x == 0 { panic("wrong") } return subExpr(a, mulExpr(b, a.x/b.x)) } func substY(a, b expr) expr { if b.y == 0 { panic("wrong") } return subExpr(a, mulExpr(b, a.y/b.y)) } func substZ(a, b expr) expr { if b.z == 0 { panic("wrong") } return subExpr(a, mulExpr(b, a.z/b.z)) } func solveX(a expr) float64 { if a.x == 0 || a.y != 0 || a.z != 0 { panic("wrong") } return -a.c / a.x } func solveY(a expr) float64 { if a.x != 0 || a.y == 0 || a.z != 0 { panic("wrong") } return -a.c / a.y } func solveZ(a expr) float64 { if a.x != 0 || a.y != 0 || a.z == 0 { panic("wrong") } return -a.c / a.z } func main() { r5 := []expr{{x: 1}, {c: 11}, {y: 1}, {c: 4}, {z: 1}} fmt.Println("bottom row:", r5) r4 := addRow(r5) fmt.Println("next row up:", r4) r3 := addRow(r4) fmt.Println("middle row:", r3) xyz := subExpr(expr{y: 1}, expr{x: 1, z: 1}) fmt.Println("xyz relation:", xyz) r3[2] = substZ(r3[2], xyz) fmt.Println("middle row after substituting for z:", r3) b := expr{c: 40} xy := subExpr(r3[0], b) fmt.Println("xy relation:", xy) r3[0] = b r3[2] = substX(r3[2], xy) fmt.Println("middle row after substituting for x:", r3) r2 := addRow(r3) fmt.Println("next row up:", r2) r1 := addRow(r2) fmt.Println("top row:", r1) y := subExpr(r1[0], expr{c: 151}) fmt.Println("y relation:", y) x := substY(xy, y) fmt.Println("x relation:", x) z := substX(substY(xyz, y), x) fmt.Println("z relation:", z) fmt.Println("x =", solveX(x)) fmt.Println("y =", solveY(y)) fmt.Println("z =", solveZ(z)) }
#include <stdio.h> #include <math.h> void pascal(int a, int b, int mid, int top, int* x, int* y, int* z) { double ytemp = (top - 4 * (a + b)) / 7.; if(fmod(ytemp, 1.) >= 0.0001) { x = 0; return; } *y = ytemp; *x = mid - 2 * a - *y; *z = *y - *x; } int main() { int a = 11, b = 4, mid = 40, top = 151; int x, y, z; pascal(a, b, mid, top, &x, &y, &z); if(x != 0) printf("x: %d, y: %d, z: %d\n", x, y, z); else printf("No solution\n"); return 0; }
Write the same algorithm in C as shown in this Go implementation.
package main import "fmt" type expr struct { x, y, z float64 c float64 } func addExpr(a, b expr) expr { return expr{a.x + b.x, a.y + b.y, a.z + b.z, a.c + b.c} } func subExpr(a, b expr) expr { return expr{a.x - b.x, a.y - b.y, a.z - b.z, a.c - b.c} } func mulExpr(a expr, c float64) expr { return expr{a.x * c, a.y * c, a.z * c, a.c * c} } func addRow(l []expr) []expr { if len(l) == 0 { panic("wrong") } r := make([]expr, len(l)-1) for i := range r { r[i] = addExpr(l[i], l[i+1]) } return r } func substX(a, b expr) expr { if b.x == 0 { panic("wrong") } return subExpr(a, mulExpr(b, a.x/b.x)) } func substY(a, b expr) expr { if b.y == 0 { panic("wrong") } return subExpr(a, mulExpr(b, a.y/b.y)) } func substZ(a, b expr) expr { if b.z == 0 { panic("wrong") } return subExpr(a, mulExpr(b, a.z/b.z)) } func solveX(a expr) float64 { if a.x == 0 || a.y != 0 || a.z != 0 { panic("wrong") } return -a.c / a.x } func solveY(a expr) float64 { if a.x != 0 || a.y == 0 || a.z != 0 { panic("wrong") } return -a.c / a.y } func solveZ(a expr) float64 { if a.x != 0 || a.y != 0 || a.z == 0 { panic("wrong") } return -a.c / a.z } func main() { r5 := []expr{{x: 1}, {c: 11}, {y: 1}, {c: 4}, {z: 1}} fmt.Println("bottom row:", r5) r4 := addRow(r5) fmt.Println("next row up:", r4) r3 := addRow(r4) fmt.Println("middle row:", r3) xyz := subExpr(expr{y: 1}, expr{x: 1, z: 1}) fmt.Println("xyz relation:", xyz) r3[2] = substZ(r3[2], xyz) fmt.Println("middle row after substituting for z:", r3) b := expr{c: 40} xy := subExpr(r3[0], b) fmt.Println("xy relation:", xy) r3[0] = b r3[2] = substX(r3[2], xy) fmt.Println("middle row after substituting for x:", r3) r2 := addRow(r3) fmt.Println("next row up:", r2) r1 := addRow(r2) fmt.Println("top row:", r1) y := subExpr(r1[0], expr{c: 151}) fmt.Println("y relation:", y) x := substY(xy, y) fmt.Println("x relation:", x) z := substX(substY(xyz, y), x) fmt.Println("z relation:", z) fmt.Println("x =", solveX(x)) fmt.Println("y =", solveY(y)) fmt.Println("z =", solveZ(z)) }
#include <stdio.h> #include <math.h> void pascal(int a, int b, int mid, int top, int* x, int* y, int* z) { double ytemp = (top - 4 * (a + b)) / 7.; if(fmod(ytemp, 1.) >= 0.0001) { x = 0; return; } *y = ytemp; *x = mid - 2 * a - *y; *z = *y - *x; } int main() { int a = 11, b = 4, mid = 40, top = 151; int x, y, z; pascal(a, b, mid, top, &x, &y, &z); if(x != 0) printf("x: %d, y: %d, z: %d\n", x, y, z); else printf("No solution\n"); return 0; }
Generate an equivalent C version of this Go code.
package main import ( "fmt" "math/big" ) var ( zero = new(big.Int) prod = new(big.Int) fact = new(big.Int) ) func ccFactors(n, m uint64) (*big.Int, bool) { prod.SetUint64(6*m + 1) if !prod.ProbablyPrime(0) { return zero, false } fact.SetUint64(12*m + 1) if !fact.ProbablyPrime(0) { return zero, false } prod.Mul(prod, fact) for i := uint64(1); i <= n-2; i++ { fact.SetUint64((1<<i)*9*m + 1) if !fact.ProbablyPrime(0) { return zero, false } prod.Mul(prod, fact) } return prod, true } func ccNumbers(start, end uint64) { for n := start; n <= end; n++ { m := uint64(1) if n > 4 { m = 1 << (n - 4) } for { num, ok := ccFactors(n, m) if ok { fmt.Printf("a(%d) = %d\n", n, num) break } if n <= 4 { m++ } else { m += 1 << (n - 4) } } } } func main() { ccNumbers(3, 9) }
#include <stdio.h> #include <stdlib.h> #include <gmp.h> typedef unsigned long long int u64; #define TRUE 1 #define FALSE 0 int primality_pretest(u64 k) { if (!(k % 3) || !(k % 5) || !(k % 7) || !(k % 11) || !(k % 13) || !(k % 17) || !(k % 19) || !(k % 23)) return (k <= 23); return TRUE; } int probprime(u64 k, mpz_t n) { mpz_set_ui(n, k); return mpz_probab_prime_p(n, 0); } int is_chernick(int n, u64 m, mpz_t z) { u64 t = 9 * m; if (primality_pretest(6 * m + 1) == FALSE) return FALSE; if (primality_pretest(12 * m + 1) == FALSE) return FALSE; for (int i = 1; i <= n - 2; i++) if (primality_pretest((t << i) + 1) == FALSE) return FALSE; if (probprime(6 * m + 1, z) == FALSE) return FALSE; if (probprime(12 * m + 1, z) == FALSE) return FALSE; for (int i = 1; i <= n - 2; i++) if (probprime((t << i) + 1, z) == FALSE) return FALSE; return TRUE; } int main(int argc, char const *argv[]) { mpz_t z; mpz_inits(z, NULL); for (int n = 3; n <= 10; n ++) { u64 multiplier = (n > 4) ? (1 << (n - 4)) : 1; if (n > 5) multiplier *= 5; for (u64 k = 1; ; k++) { u64 m = k * multiplier; if (is_chernick(n, m, z) == TRUE) { printf("a(%d) has m = %llu\n", n, m); break; } } } return 0; }
Convert this Go block to C, preserving its control flow and logic.
package main import ( "fmt" "math" ) const EPS = 0.001 const EPS_SQUARE = EPS * EPS func side(x1, y1, x2, y2, x, y float64) float64 { return (y2-y1)*(x-x1) + (-x2+x1)*(y-y1) } func naivePointInTriangle(x1, y1, x2, y2, x3, y3, x, y float64) bool { checkSide1 := side(x1, y1, x2, y2, x, y) >= 0 checkSide2 := side(x2, y2, x3, y3, x, y) >= 0 checkSide3 := side(x3, y3, x1, y1, x, y) >= 0 return checkSide1 && checkSide2 && checkSide3 } func pointInTriangleBoundingBox(x1, y1, x2, y2, x3, y3, x, y float64) bool { xMin := math.Min(x1, math.Min(x2, x3)) - EPS xMax := math.Max(x1, math.Max(x2, x3)) + EPS yMin := math.Min(y1, math.Min(y2, y3)) - EPS yMax := math.Max(y1, math.Max(y2, y3)) + EPS return !(x < xMin || xMax < x || y < yMin || yMax < y) } func distanceSquarePointToSegment(x1, y1, x2, y2, x, y float64) float64 { p1_p2_squareLength := (x2-x1)*(x2-x1) + (y2-y1)*(y2-y1) dotProduct := ((x-x1)*(x2-x1) + (y-y1)*(y2-y1)) / p1_p2_squareLength if dotProduct < 0 { return (x-x1)*(x-x1) + (y-y1)*(y-y1) } else if dotProduct <= 1 { p_p1_squareLength := (x1-x)*(x1-x) + (y1-y)*(y1-y) return p_p1_squareLength - dotProduct*dotProduct*p1_p2_squareLength } else { return (x-x2)*(x-x2) + (y-y2)*(y-y2) } } func accuratePointInTriangle(x1, y1, x2, y2, x3, y3, x, y float64) bool { if !pointInTriangleBoundingBox(x1, y1, x2, y2, x3, y3, x, y) { return false } if naivePointInTriangle(x1, y1, x2, y2, x3, y3, x, y) { return true } if distanceSquarePointToSegment(x1, y1, x2, y2, x, y) <= EPS_SQUARE { return true } if distanceSquarePointToSegment(x2, y2, x3, y3, x, y) <= EPS_SQUARE { return true } if distanceSquarePointToSegment(x3, y3, x1, y1, x, y) <= EPS_SQUARE { return true } return false } func main() { pts := [][2]float64{{0, 0}, {0, 1}, {3, 1}} tri := [][2]float64{{3.0 / 2, 12.0 / 5}, {51.0 / 10, -31.0 / 10}, {-19.0 / 5, 1.2}} fmt.Println("Triangle is", tri) x1, y1 := tri[0][0], tri[0][1] x2, y2 := tri[1][0], tri[1][1] x3, y3 := tri[2][0], tri[2][1] for _, pt := range pts { x, y := pt[0], pt[1] within := accuratePointInTriangle(x1, y1, x2, y2, x3, y3, x, y) fmt.Println("Point", pt, "is within triangle?", within) } fmt.Println() tri = [][2]float64{{1.0 / 10, 1.0 / 9}, {100.0 / 8, 100.0 / 3}, {100.0 / 4, 100.0 / 9}} fmt.Println("Triangle is", tri) x1, y1 = tri[0][0], tri[0][1] x2, y2 = tri[1][0], tri[1][1] x3, y3 = tri[2][0], tri[2][1] x := x1 + (3.0/7)*(x2-x1) y := y1 + (3.0/7)*(y2-y1) pt := [2]float64{x, y} within := accuratePointInTriangle(x1, y1, x2, y2, x3, y3, x, y) fmt.Println("Point", pt, "is within triangle ?", within) fmt.Println() tri = [][2]float64{{1.0 / 10, 1.0 / 9}, {100.0 / 8, 100.0 / 3}, {-100.0 / 8, 100.0 / 6}} fmt.Println("Triangle is", tri) x3 = tri[2][0] y3 = tri[2][1] within = accuratePointInTriangle(x1, y1, x2, y2, x3, y3, x, y) fmt.Println("Point", pt, "is within triangle ?", within) }
#include <stdbool.h> #include <stdio.h> #include <stdlib.h> const double EPS = 0.001; const double EPS_SQUARE = 0.000001; double side(double x1, double y1, double x2, double y2, double x, double y) { return (y2 - y1) * (x - x1) + (-x2 + x1) * (y - y1); } bool naivePointInTriangle(double x1, double y1, double x2, double y2, double x3, double y3, double x, double y) { double checkSide1 = side(x1, y1, x2, y2, x, y) >= 0; double checkSide2 = side(x2, y2, x3, y3, x, y) >= 0; double checkSide3 = side(x3, y3, x1, y1, x, y) >= 0; return checkSide1 && checkSide2 && checkSide3; } bool pointInTriangleBoundingBox(double x1, double y1, double x2, double y2, double x3, double y3, double x, double y) { double xMin = min(x1, min(x2, x3)) - EPS; double xMax = max(x1, max(x2, x3)) + EPS; double yMin = min(y1, min(y2, y3)) - EPS; double yMax = max(y1, max(y2, y3)) + EPS; return !(x < xMin || xMax < x || y < yMin || yMax < y); } double distanceSquarePointToSegment(double x1, double y1, double x2, double y2, double x, double y) { double p1_p2_squareLength = (x2 - x1) * (x2 - x1) + (y2 - y1) * (y2 - y1); double dotProduct = ((x - x1) * (x2 - x1) + (y - y1) * (y2 - y1)) / p1_p2_squareLength; if (dotProduct < 0) { return (x - x1) * (x - x1) + (y - y1) * (y - y1); } else if (dotProduct <= 1) { double p_p1_squareLength = (x1 - x) * (x1 - x) + (y1 - y) * (y1 - y); return p_p1_squareLength - dotProduct * dotProduct * p1_p2_squareLength; } else { return (x - x2) * (x - x2) + (y - y2) * (y - y2); } } bool accuratePointInTriangle(double x1, double y1, double x2, double y2, double x3, double y3, double x, double y) { if (!pointInTriangleBoundingBox(x1, y1, x2, y2, x3, y3, x, y)) { return false; } if (naivePointInTriangle(x1, y1, x2, y2, x3, y3, x, y)) { return true; } if (distanceSquarePointToSegment(x1, y1, x2, y2, x, y) <= EPS_SQUARE) { return true; } if (distanceSquarePointToSegment(x2, y2, x3, y3, x, y) <= EPS_SQUARE) { return true; } if (distanceSquarePointToSegment(x3, y3, x1, y1, x, y) <= EPS_SQUARE) { return true; } return false; } void printPoint(double x, double y) { printf("(%f, %f)", x, y); } void printTriangle(double x1, double y1, double x2, double y2, double x3, double y3) { printf("Triangle is ["); printPoint(x1, y1); printf(", "); printPoint(x2, y2); printf(", "); printPoint(x3, y3); printf("] \n"); } void test(double x1, double y1, double x2, double y2, double x3, double y3, double x, double y) { printTriangle(x1, y1, x2, y2, x3, y3); printf("Point "); printPoint(x, y); printf(" is within triangle? "); if (accuratePointInTriangle(x1, y1, x2, y2, x3, y3, x, y)) { printf("true\n"); } else { printf("false\n"); } } int main() { test(1.5, 2.4, 5.1, -3.1, -3.8, 1.2, 0, 0); test(1.5, 2.4, 5.1, -3.1, -3.8, 1.2, 0, 1); test(1.5, 2.4, 5.1, -3.1, -3.8, 1.2, 3, 1); printf("\n"); test(0.1, 0.1111111111111111, 12.5, 33.333333333333336, 25, 11.11111111111111, 5.414285714285714, 14.349206349206348); printf("\n"); test(0.1, 0.1111111111111111, 12.5, 33.333333333333336, -12.5, 16.666666666666668, 5.414285714285714, 14.349206349206348); printf("\n"); return 0; }
Change the following Go code into C without altering its purpose.
package main import ( "fmt" "math" ) const EPS = 0.001 const EPS_SQUARE = EPS * EPS func side(x1, y1, x2, y2, x, y float64) float64 { return (y2-y1)*(x-x1) + (-x2+x1)*(y-y1) } func naivePointInTriangle(x1, y1, x2, y2, x3, y3, x, y float64) bool { checkSide1 := side(x1, y1, x2, y2, x, y) >= 0 checkSide2 := side(x2, y2, x3, y3, x, y) >= 0 checkSide3 := side(x3, y3, x1, y1, x, y) >= 0 return checkSide1 && checkSide2 && checkSide3 } func pointInTriangleBoundingBox(x1, y1, x2, y2, x3, y3, x, y float64) bool { xMin := math.Min(x1, math.Min(x2, x3)) - EPS xMax := math.Max(x1, math.Max(x2, x3)) + EPS yMin := math.Min(y1, math.Min(y2, y3)) - EPS yMax := math.Max(y1, math.Max(y2, y3)) + EPS return !(x < xMin || xMax < x || y < yMin || yMax < y) } func distanceSquarePointToSegment(x1, y1, x2, y2, x, y float64) float64 { p1_p2_squareLength := (x2-x1)*(x2-x1) + (y2-y1)*(y2-y1) dotProduct := ((x-x1)*(x2-x1) + (y-y1)*(y2-y1)) / p1_p2_squareLength if dotProduct < 0 { return (x-x1)*(x-x1) + (y-y1)*(y-y1) } else if dotProduct <= 1 { p_p1_squareLength := (x1-x)*(x1-x) + (y1-y)*(y1-y) return p_p1_squareLength - dotProduct*dotProduct*p1_p2_squareLength } else { return (x-x2)*(x-x2) + (y-y2)*(y-y2) } } func accuratePointInTriangle(x1, y1, x2, y2, x3, y3, x, y float64) bool { if !pointInTriangleBoundingBox(x1, y1, x2, y2, x3, y3, x, y) { return false } if naivePointInTriangle(x1, y1, x2, y2, x3, y3, x, y) { return true } if distanceSquarePointToSegment(x1, y1, x2, y2, x, y) <= EPS_SQUARE { return true } if distanceSquarePointToSegment(x2, y2, x3, y3, x, y) <= EPS_SQUARE { return true } if distanceSquarePointToSegment(x3, y3, x1, y1, x, y) <= EPS_SQUARE { return true } return false } func main() { pts := [][2]float64{{0, 0}, {0, 1}, {3, 1}} tri := [][2]float64{{3.0 / 2, 12.0 / 5}, {51.0 / 10, -31.0 / 10}, {-19.0 / 5, 1.2}} fmt.Println("Triangle is", tri) x1, y1 := tri[0][0], tri[0][1] x2, y2 := tri[1][0], tri[1][1] x3, y3 := tri[2][0], tri[2][1] for _, pt := range pts { x, y := pt[0], pt[1] within := accuratePointInTriangle(x1, y1, x2, y2, x3, y3, x, y) fmt.Println("Point", pt, "is within triangle?", within) } fmt.Println() tri = [][2]float64{{1.0 / 10, 1.0 / 9}, {100.0 / 8, 100.0 / 3}, {100.0 / 4, 100.0 / 9}} fmt.Println("Triangle is", tri) x1, y1 = tri[0][0], tri[0][1] x2, y2 = tri[1][0], tri[1][1] x3, y3 = tri[2][0], tri[2][1] x := x1 + (3.0/7)*(x2-x1) y := y1 + (3.0/7)*(y2-y1) pt := [2]float64{x, y} within := accuratePointInTriangle(x1, y1, x2, y2, x3, y3, x, y) fmt.Println("Point", pt, "is within triangle ?", within) fmt.Println() tri = [][2]float64{{1.0 / 10, 1.0 / 9}, {100.0 / 8, 100.0 / 3}, {-100.0 / 8, 100.0 / 6}} fmt.Println("Triangle is", tri) x3 = tri[2][0] y3 = tri[2][1] within = accuratePointInTriangle(x1, y1, x2, y2, x3, y3, x, y) fmt.Println("Point", pt, "is within triangle ?", within) }
#include <stdbool.h> #include <stdio.h> #include <stdlib.h> const double EPS = 0.001; const double EPS_SQUARE = 0.000001; double side(double x1, double y1, double x2, double y2, double x, double y) { return (y2 - y1) * (x - x1) + (-x2 + x1) * (y - y1); } bool naivePointInTriangle(double x1, double y1, double x2, double y2, double x3, double y3, double x, double y) { double checkSide1 = side(x1, y1, x2, y2, x, y) >= 0; double checkSide2 = side(x2, y2, x3, y3, x, y) >= 0; double checkSide3 = side(x3, y3, x1, y1, x, y) >= 0; return checkSide1 && checkSide2 && checkSide3; } bool pointInTriangleBoundingBox(double x1, double y1, double x2, double y2, double x3, double y3, double x, double y) { double xMin = min(x1, min(x2, x3)) - EPS; double xMax = max(x1, max(x2, x3)) + EPS; double yMin = min(y1, min(y2, y3)) - EPS; double yMax = max(y1, max(y2, y3)) + EPS; return !(x < xMin || xMax < x || y < yMin || yMax < y); } double distanceSquarePointToSegment(double x1, double y1, double x2, double y2, double x, double y) { double p1_p2_squareLength = (x2 - x1) * (x2 - x1) + (y2 - y1) * (y2 - y1); double dotProduct = ((x - x1) * (x2 - x1) + (y - y1) * (y2 - y1)) / p1_p2_squareLength; if (dotProduct < 0) { return (x - x1) * (x - x1) + (y - y1) * (y - y1); } else if (dotProduct <= 1) { double p_p1_squareLength = (x1 - x) * (x1 - x) + (y1 - y) * (y1 - y); return p_p1_squareLength - dotProduct * dotProduct * p1_p2_squareLength; } else { return (x - x2) * (x - x2) + (y - y2) * (y - y2); } } bool accuratePointInTriangle(double x1, double y1, double x2, double y2, double x3, double y3, double x, double y) { if (!pointInTriangleBoundingBox(x1, y1, x2, y2, x3, y3, x, y)) { return false; } if (naivePointInTriangle(x1, y1, x2, y2, x3, y3, x, y)) { return true; } if (distanceSquarePointToSegment(x1, y1, x2, y2, x, y) <= EPS_SQUARE) { return true; } if (distanceSquarePointToSegment(x2, y2, x3, y3, x, y) <= EPS_SQUARE) { return true; } if (distanceSquarePointToSegment(x3, y3, x1, y1, x, y) <= EPS_SQUARE) { return true; } return false; } void printPoint(double x, double y) { printf("(%f, %f)", x, y); } void printTriangle(double x1, double y1, double x2, double y2, double x3, double y3) { printf("Triangle is ["); printPoint(x1, y1); printf(", "); printPoint(x2, y2); printf(", "); printPoint(x3, y3); printf("] \n"); } void test(double x1, double y1, double x2, double y2, double x3, double y3, double x, double y) { printTriangle(x1, y1, x2, y2, x3, y3); printf("Point "); printPoint(x, y); printf(" is within triangle? "); if (accuratePointInTriangle(x1, y1, x2, y2, x3, y3, x, y)) { printf("true\n"); } else { printf("false\n"); } } int main() { test(1.5, 2.4, 5.1, -3.1, -3.8, 1.2, 0, 0); test(1.5, 2.4, 5.1, -3.1, -3.8, 1.2, 0, 1); test(1.5, 2.4, 5.1, -3.1, -3.8, 1.2, 3, 1); printf("\n"); test(0.1, 0.1111111111111111, 12.5, 33.333333333333336, 25, 11.11111111111111, 5.414285714285714, 14.349206349206348); printf("\n"); test(0.1, 0.1111111111111111, 12.5, 33.333333333333336, -12.5, 16.666666666666668, 5.414285714285714, 14.349206349206348); printf("\n"); return 0; }
Port the provided Go code into C while preserving the original functionality.
package main import "fmt" func countDivisors(n int) int { count := 0 i := 1 k := 2 if n%2 == 0 { k = 1 } for i*i <= n { if n%i == 0 { count++ j := n / i if j != i { count++ } } i += k } return count } func main() { fmt.Println("The tau functions for the first 100 positive integers are:") for i := 1; i <= 100; i++ { fmt.Printf("%2d ", countDivisors(i)) if i%20 == 0 { fmt.Println() } } }
#include <stdio.h> unsigned int divisor_count(unsigned int n) { unsigned int total = 1; for (; (n & 1) == 0; n >>= 1) { ++total; } for (unsigned int p = 3; p * p <= n; p += 2) { unsigned int count = 1; for (; n % p == 0; n /= p) { ++count; } total *= count; } if (n > 1) { total *= 2; } return total; } int main() { const unsigned int limit = 100; unsigned int n; printf("Count of divisors for the first %d positive integers:\n", limit); for (n = 1; n <= limit; ++n) { printf("%3d", divisor_count(n)); if (n % 20 == 0) { printf("\n"); } } return 0; }
Convert the following code from Go to C, ensuring the logic remains intact.
package main import "fmt" func countDivisors(n int) int { count := 0 i := 1 k := 2 if n%2 == 0 { k = 1 } for i*i <= n { if n%i == 0 { count++ j := n / i if j != i { count++ } } i += k } return count } func main() { fmt.Println("The tau functions for the first 100 positive integers are:") for i := 1; i <= 100; i++ { fmt.Printf("%2d ", countDivisors(i)) if i%20 == 0 { fmt.Println() } } }
#include <stdio.h> unsigned int divisor_count(unsigned int n) { unsigned int total = 1; for (; (n & 1) == 0; n >>= 1) { ++total; } for (unsigned int p = 3; p * p <= n; p += 2) { unsigned int count = 1; for (; n % p == 0; n /= p) { ++count; } total *= count; } if (n > 1) { total *= 2; } return total; } int main() { const unsigned int limit = 100; unsigned int n; printf("Count of divisors for the first %d positive integers:\n", limit); for (n = 1; n <= limit; ++n) { printf("%3d", divisor_count(n)); if (n % 20 == 0) { printf("\n"); } } return 0; }
Port the following code from Go to C with equivalent syntax and logic.
package main import( "fmt" "unsafe" "reflect" ) func pointer() { fmt.Printf("Pointer:\n") var i int p := &i fmt.Printf("Before:\n\t%v: %v, %v\n", p, *p, i) *p = 3 fmt.Printf("After:\n\t%v: %v, %v\n", p, *p, i) } func slice() { fmt.Printf("Slice:\n") var a [10]byte var h reflect.SliceHeader h.Data = uintptr(unsafe.Pointer(&a)) h.Len = len(a) h.Cap = len(a) s := *(*[]byte)(unsafe.Pointer(&h)) fmt.Printf("Before:\n\ts: %v\n\ta: %v\n", s, a) copy(s, "A string.") fmt.Printf("After:\n\ts: %v\n\ta: %v\n", s, a) } func main() { pointer() fmt.Println() slice() }
#include <stdio.h> int main() { int intspace; int *address; address = &intspace; *address = 65535; printf("%p: %08x (=%08x)\n", address, *address, intspace); *((char*)address) = 0x00; *((char*)address+1) = 0x00; *((char*)address+2) = 0xff; *((char*)address+3) = 0xff; printf("%p: %08x (=%08x)\n", address, *address, intspace); return 0; }
Generate a C translation of this Go snippet without changing its computational steps.
package main import ( "fmt" "math/big" ) func main() { one := big.NewInt(1) pm := big.NewInt(1) var px, nx int var pb big.Int primes(4000, func(p int64) bool { pm.Mul(pm, pb.SetInt64(p)) px++ if pb.Add(pm, one).ProbablyPrime(0) || pb.Sub(pm, one).ProbablyPrime(0) { fmt.Print(px, " ") nx++ if nx == 20 { fmt.Println() return false } } return true }) } func primes(limit int, f func(int64) bool) { c := make([]bool, limit) c[0] = true c[1] = true lm := int64(limit) p := int64(2) for { f(p) p2 := p * p if p2 >= lm { break } for i := p2; i < lm; i += p { c[i] = true } for { p++ if !c[p] { break } } } for p++; p < lm; p++ { if !c[p] && !f(p) { break } } }
#include <gmp.h> int main(void) { mpz_t p, s; mpz_init_set_ui(p, 1); mpz_init_set_ui(s, 1); for (int n = 1, i = 0; i < 20; n++) { mpz_nextprime(s, s); mpz_mul(p, p, s); mpz_add_ui(p, p, 1); if (mpz_probab_prime_p(p, 25)) { mpz_sub_ui(p, p, 1); gmp_printf("%d\n", n); i++; continue; } mpz_sub_ui(p, p, 2); if (mpz_probab_prime_p(p, 25)) { mpz_add_ui(p, p, 1); gmp_printf("%d\n", n); i++; continue; } mpz_add_ui(p, p, 1); } mpz_clear(s); mpz_clear(p); }
Produce a language-to-language conversion: from Go to C, same semantics.
package main import ( "fmt" "sort" ) func main() { dna := "" + "CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATG" + "CTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTG" + "AGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGAT" + "GGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT" + "CGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGG" + "TCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA" + "TTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTAT" + "CGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTG" + "TCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGAC" + "GACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT" fmt.Println("SEQUENCE:") le := len(dna) for i := 0; i < le; i += 50 { k := i + 50 if k > le { k = le } fmt.Printf("%5d: %s\n", i, dna[i:k]) } baseMap := make(map[byte]int) for i := 0; i < le; i++ { baseMap[dna[i]]++ } var bases []byte for k := range baseMap { bases = append(bases, k) } sort.Slice(bases, func(i, j int) bool { return bases[i] < bases[j] }) fmt.Println("\nBASE COUNT:") for _, base := range bases { fmt.Printf(" %c: %3d\n", base, baseMap[base]) } fmt.Println(" ------") fmt.Println(" Σ:", le) fmt.Println(" ======") }
#include<string.h> #include<stdlib.h> #include<stdio.h> typedef struct genome{ char* strand; int length; struct genome* next; }genome; genome* genomeData; int totalLength = 0, Adenine = 0, Cytosine = 0, Guanine = 0, Thymine = 0; int numDigits(int num){ int len = 1; while(num>10){ num = num/10; len++; } return len; } void buildGenome(char str[100]){ int len = strlen(str),i; genome *genomeIterator, *newGenome; totalLength += len; for(i=0;i<len;i++){ switch(str[i]){ case 'A': Adenine++; break; case 'T': Thymine++; break; case 'C': Cytosine++; break; case 'G': Guanine++; break; }; } if(genomeData==NULL){ genomeData = (genome*)malloc(sizeof(genome)); genomeData->strand = (char*)malloc(len*sizeof(char)); strcpy(genomeData->strand,str); genomeData->length = len; genomeData->next = NULL; } else{ genomeIterator = genomeData; while(genomeIterator->next!=NULL) genomeIterator = genomeIterator->next; newGenome = (genome*)malloc(sizeof(genome)); newGenome->strand = (char*)malloc(len*sizeof(char)); strcpy(newGenome->strand,str); newGenome->length = len; newGenome->next = NULL; genomeIterator->next = newGenome; } } void printGenome(){ genome* genomeIterator = genomeData; int width = numDigits(totalLength), len = 0; printf("Sequence:\n"); while(genomeIterator!=NULL){ printf("\n%*d%3s%3s",width+1,len,":",genomeIterator->strand); len += genomeIterator->length; genomeIterator = genomeIterator->next; } printf("\n\nBase Count\n----------\n\n"); printf("%3c%3s%*d\n",'A',":",width+1,Adenine); printf("%3c%3s%*d\n",'T',":",width+1,Thymine); printf("%3c%3s%*d\n",'C',":",width+1,Cytosine); printf("%3c%3s%*d\n",'G',":",width+1,Guanine); printf("\n%3s%*d\n","Total:",width+1,Adenine + Thymine + Cytosine + Guanine); free(genomeData); } int main(int argc,char** argv) { char str[100]; int counter = 0, len; if(argc!=2){ printf("Usage : %s <Gene file name>\n",argv[0]); return 0; } FILE *fp = fopen(argv[1],"r"); while(fscanf(fp,"%s",str)!=EOF) buildGenome(str); fclose(fp); printGenome(); return 0; }
Convert the following code from Go to C, ensuring the logic remains intact.
package main import ( "fmt" "sort" ) func main() { dna := "" + "CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATG" + "CTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTG" + "AGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGAT" + "GGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT" + "CGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGG" + "TCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA" + "TTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTAT" + "CGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTG" + "TCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGAC" + "GACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT" fmt.Println("SEQUENCE:") le := len(dna) for i := 0; i < le; i += 50 { k := i + 50 if k > le { k = le } fmt.Printf("%5d: %s\n", i, dna[i:k]) } baseMap := make(map[byte]int) for i := 0; i < le; i++ { baseMap[dna[i]]++ } var bases []byte for k := range baseMap { bases = append(bases, k) } sort.Slice(bases, func(i, j int) bool { return bases[i] < bases[j] }) fmt.Println("\nBASE COUNT:") for _, base := range bases { fmt.Printf(" %c: %3d\n", base, baseMap[base]) } fmt.Println(" ------") fmt.Println(" Σ:", le) fmt.Println(" ======") }
#include<string.h> #include<stdlib.h> #include<stdio.h> typedef struct genome{ char* strand; int length; struct genome* next; }genome; genome* genomeData; int totalLength = 0, Adenine = 0, Cytosine = 0, Guanine = 0, Thymine = 0; int numDigits(int num){ int len = 1; while(num>10){ num = num/10; len++; } return len; } void buildGenome(char str[100]){ int len = strlen(str),i; genome *genomeIterator, *newGenome; totalLength += len; for(i=0;i<len;i++){ switch(str[i]){ case 'A': Adenine++; break; case 'T': Thymine++; break; case 'C': Cytosine++; break; case 'G': Guanine++; break; }; } if(genomeData==NULL){ genomeData = (genome*)malloc(sizeof(genome)); genomeData->strand = (char*)malloc(len*sizeof(char)); strcpy(genomeData->strand,str); genomeData->length = len; genomeData->next = NULL; } else{ genomeIterator = genomeData; while(genomeIterator->next!=NULL) genomeIterator = genomeIterator->next; newGenome = (genome*)malloc(sizeof(genome)); newGenome->strand = (char*)malloc(len*sizeof(char)); strcpy(newGenome->strand,str); newGenome->length = len; newGenome->next = NULL; genomeIterator->next = newGenome; } } void printGenome(){ genome* genomeIterator = genomeData; int width = numDigits(totalLength), len = 0; printf("Sequence:\n"); while(genomeIterator!=NULL){ printf("\n%*d%3s%3s",width+1,len,":",genomeIterator->strand); len += genomeIterator->length; genomeIterator = genomeIterator->next; } printf("\n\nBase Count\n----------\n\n"); printf("%3c%3s%*d\n",'A',":",width+1,Adenine); printf("%3c%3s%*d\n",'T',":",width+1,Thymine); printf("%3c%3s%*d\n",'C',":",width+1,Cytosine); printf("%3c%3s%*d\n",'G',":",width+1,Guanine); printf("\n%3s%*d\n","Total:",width+1,Adenine + Thymine + Cytosine + Guanine); free(genomeData); } int main(int argc,char** argv) { char str[100]; int counter = 0, len; if(argc!=2){ printf("Usage : %s <Gene file name>\n",argv[0]); return 0; } FILE *fp = fopen(argv[1],"r"); while(fscanf(fp,"%s",str)!=EOF) buildGenome(str); fclose(fp); printGenome(); return 0; }
Change the following Go code into C without altering its purpose.
package main import ( "hash/fnv" "log" "math/rand" "os" "time" ) var ph = []string{"Aristotle", "Kant", "Spinoza", "Marx", "Russell"} const hunger = 3 const think = time.Second / 100 const eat = time.Second / 100 var fmt = log.New(os.Stdout, "", 0) var done = make(chan bool) type fork byte func philosopher(phName string, dominantHand, otherHand chan fork, done chan bool) { fmt.Println(phName, "seated") h := fnv.New64a() h.Write([]byte(phName)) rg := rand.New(rand.NewSource(int64(h.Sum64()))) rSleep := func(t time.Duration) { time.Sleep(t/2 + time.Duration(rg.Int63n(int64(t)))) } for h := hunger; h > 0; h-- { fmt.Println(phName, "hungry") <-dominantHand <-otherHand fmt.Println(phName, "eating") rSleep(eat) dominantHand <- 'f' otherHand <- 'f' fmt.Println(phName, "thinking") rSleep(think) } fmt.Println(phName, "satisfied") done <- true fmt.Println(phName, "left the table") } func main() { fmt.Println("table empty") place0 := make(chan fork, 1) place0 <- 'f' placeLeft := place0 for i := 1; i < len(ph); i++ { placeRight := make(chan fork, 1) placeRight <- 'f' go philosopher(ph[i], placeLeft, placeRight, done) placeLeft = placeRight } go philosopher(ph[0], place0, placeLeft, done) for range ph { <-done } fmt.Println("table empty") }
#include <pthread.h> #include <stdio.h> #include <stdlib.h> #include <unistd.h> #include <stdarg.h> #define N 5 const char *names[N] = { "Aristotle", "Kant", "Spinoza", "Marx", "Russell" }; pthread_mutex_t forks[N]; #define M 5 const char *topic[M] = { "Spaghetti!", "Life", "Universe", "Everything", "Bathroom" }; #define lock pthread_mutex_lock #define unlock pthread_mutex_unlock #define xy(x, y) printf("\033[%d;%dH", x, y) #define clear_eol(x) print(x, 12, "\033[K") void print(int y, int x, const char *fmt, ...) { static pthread_mutex_t screen = PTHREAD_MUTEX_INITIALIZER; va_list ap; va_start(ap, fmt); lock(&screen); xy(y + 1, x), vprintf(fmt, ap); xy(N + 1, 1), fflush(stdout); unlock(&screen); } void eat(int id) { int f[2], ration, i; f[0] = f[1] = id; f[id & 1] = (id + 1) % N; clear_eol(id); print(id, 12, "..oO (forks, need forks)"); for (i = 0; i < 2; i++) { lock(forks + f[i]); if (!i) clear_eol(id); print(id, 12 + (f[i] != id) * 6, "fork%d", f[i]); sleep(1); } for (i = 0, ration = 3 + rand() % 8; i < ration; i++) print(id, 24 + i * 4, "nom"), sleep(1); for (i = 0; i < 2; i++) unlock(forks + f[i]); } void think(int id) { int i, t; char buf[64] = {0}; do { clear_eol(id); sprintf(buf, "..oO (%s)", topic[t = rand() % M]); for (i = 0; buf[i]; i++) { print(id, i+12, "%c", buf[i]); if (i < 5) usleep(200000); } usleep(500000 + rand() % 1000000); } while (t); } void* philosophize(void *a) { int id = *(int*)a; print(id, 1, "%10s", names[id]); while(1) think(id), eat(id); } int main() { int i, id[N]; pthread_t tid[N]; for (i = 0; i < N; i++) pthread_mutex_init(forks + (id[i] = i), 0); for (i = 0; i < N; i++) pthread_create(tid + i, 0, philosophize, id + i); return pthread_join(tid[0], 0); }
Translate this program into C but keep the logic exactly as in Go.
package main import ( "fmt" "strconv" ) func main() { var fact [12]uint64 fact[0] = 1 for n := uint64(1); n < 12; n++ { fact[n] = fact[n-1] * n } for b := 9; b <= 12; b++ { fmt.Printf("The factorions for base %d are:\n", b) for i := uint64(1); i < 1500000; i++ { digits := strconv.FormatUint(i, b) sum := uint64(0) for _, digit := range digits { if digit < 'a' { sum += fact[digit-'0'] } else { sum += fact[digit+10-'a'] } } if sum == i { fmt.Printf("%d ", i) } } fmt.Println("\n") } }
#include <stdio.h> int main() { int n, b, d; unsigned long long i, j, sum, fact[12]; fact[0] = 1; for (n = 1; n < 12; ++n) { fact[n] = fact[n-1] * n; } for (b = 9; b <= 12; ++b) { printf("The factorions for base %d are:\n", b); for (i = 1; i < 1500000; ++i) { sum = 0; j = i; while (j > 0) { d = j % b; sum += fact[d]; j /= b; } if (sum == i) printf("%llu ", i); } printf("\n\n"); } return 0; }
Can you help me rewrite this code in C instead of Go, keeping it the same logically?
package main import ( "fmt" "strconv" ) func main() { var fact [12]uint64 fact[0] = 1 for n := uint64(1); n < 12; n++ { fact[n] = fact[n-1] * n } for b := 9; b <= 12; b++ { fmt.Printf("The factorions for base %d are:\n", b) for i := uint64(1); i < 1500000; i++ { digits := strconv.FormatUint(i, b) sum := uint64(0) for _, digit := range digits { if digit < 'a' { sum += fact[digit-'0'] } else { sum += fact[digit+10-'a'] } } if sum == i { fmt.Printf("%d ", i) } } fmt.Println("\n") } }
#include <stdio.h> int main() { int n, b, d; unsigned long long i, j, sum, fact[12]; fact[0] = 1; for (n = 1; n < 12; ++n) { fact[n] = fact[n-1] * n; } for (b = 9; b <= 12; ++b) { printf("The factorions for base %d are:\n", b); for (i = 1; i < 1500000; ++i) { sum = 0; j = i; while (j > 0) { d = j % b; sum += fact[d]; j /= b; } if (sum == i) printf("%llu ", i); } printf("\n\n"); } return 0; }
Convert the following code from Go to C, ensuring the logic remains intact.
package main import ( "fmt" "github.com/maorshutman/lm" "log" "math" ) const ( K = 7_800_000_000 n0 = 27 ) var y = []float64{ 27, 27, 27, 44, 44, 59, 59, 59, 59, 59, 59, 59, 59, 60, 60, 61, 61, 66, 83, 219, 239, 392, 534, 631, 897, 1350, 2023, 2820, 4587, 6067, 7823, 9826, 11946, 14554, 17372, 20615, 24522, 28273, 31491, 34933, 37552, 40540, 43105, 45177, 60328, 64543, 67103, 69265, 71332, 73327, 75191, 75723, 76719, 77804, 78812, 79339, 80132, 80995, 82101, 83365, 85203, 87024, 89068, 90664, 93077, 95316, 98172, 102133, 105824, 109695, 114232, 118610, 125497, 133852, 143227, 151367, 167418, 180096, 194836, 213150, 242364, 271106, 305117, 338133, 377918, 416845, 468049, 527767, 591704, 656866, 715353, 777796, 851308, 928436, 1000249, 1082054, 1174652, } func f(dst, p []float64) { for i := 0; i < len(y); i++ { t := float64(i) dst[i] = (n0*math.Exp(p[0]*t))/(1+n0*(math.Exp(p[0]*t)-1)/K) - y[i] } } func main() { j := lm.NumJac{Func: f} prob := lm.LMProblem{ Dim: 1, Size: len(y), Func: f, Jac: j.Jac, InitParams: []float64{0.5}, Tau: 1e-6, Eps1: 1e-8, Eps2: 1e-8, } res, err := lm.LM(prob, &lm.Settings{Iterations: 100, ObjectiveTol: 1e-16}) if err != nil { log.Fatal(err) } r := res.X[0] fmt.Printf("The logistic curve r for the world data is %.8f\n", r) fmt.Printf("R0 is then approximately equal to %.7f\n", math.Exp(12*r)) }
#include <math.h> #include <stdio.h> const double K = 7.8e9; const int n0 = 27; const double actual[] = { 27, 27, 27, 44, 44, 59, 59, 59, 59, 59, 59, 59, 59, 60, 60, 61, 61, 66, 83, 219, 239, 392, 534, 631, 897, 1350, 2023, 2820, 4587, 6067, 7823, 9826, 11946, 14554, 17372, 20615, 24522, 28273, 31491, 34933, 37552, 40540, 43105, 45177, 60328, 64543, 67103, 69265, 71332, 73327, 75191, 75723, 76719, 77804, 78812, 79339, 80132, 80995, 82101, 83365, 85203, 87024, 89068, 90664, 93077, 95316, 98172, 102133, 105824, 109695, 114232, 118610, 125497, 133852, 143227, 151367, 167418, 180096, 194836, 213150, 242364, 271106, 305117, 338133, 377918, 416845, 468049, 527767, 591704, 656866, 715353, 777796, 851308, 928436, 1000249, 1082054, 1174652 }; const size_t actual_size = sizeof(actual) / sizeof(double); double f(double r) { double sq = 0; size_t i; for (i = 0; i < actual_size; ++i) { double eri = exp(r * i); double guess = (n0 * eri) / (1 + n0 * (eri - 1) / K); double diff = guess - actual[i]; sq += diff * diff; } return sq; } double solve(double (*fn)(double), double guess, double epsilon) { double delta, f0, factor; for (delta = guess ? guess : 1, f0 = fn(guess), factor = 2; delta > epsilon && guess != guess - delta; delta *= factor) { double nf = (*fn)(guess - delta); if (nf < f0) { f0 = nf; guess -= delta; } else { nf = fn(guess + delta); if (nf < f0) { f0 = nf; guess += delta; } else { factor = 0.5; } } } return guess; } double solve_default(double (*fn)(double)) { return solve(fn, 0.5, 0); } int main() { double r = solve_default(f); double R0 = exp(12 * r); printf("r = %f, R0 = %f\n", r, R0); return 0; }
Convert this Go snippet to C and keep its semantics consistent.
package main import "fmt" type link struct { int next *link } func linkInts(s []int) *link { if len(s) == 0 { return nil } return &link{s[0], linkInts(s[1:])} } func (l *link) String() string { if l == nil { return "nil" } r := fmt.Sprintf("[%d", l.int) for l = l.next; l != nil; l = l.next { r = fmt.Sprintf("%s %d", r, l.int) } return r + "]" } func main() { a := linkInts([]int{170, 45, 75, -90, -802, 24, 2, 66}) fmt.Println("before:", a) b := strandSort(a) fmt.Println("after: ", b) } func strandSort(a *link) (result *link) { for a != nil { sublist := a a = a.next sTail := sublist for p, pPrev := a, a; p != nil; p = p.next { if p.int > sTail.int { sTail.next = p sTail = p if p == a { a = p.next } else { pPrev.next = p.next } } else { pPrev = p } } sTail.next = nil if result == nil { result = sublist continue } var m, rr *link if sublist.int < result.int { m = sublist sublist = m.next rr = result } else { m = result rr = m.next } result = m for { if sublist == nil { m.next = rr break } if rr == nil { m.next = sublist break } if sublist.int < rr.int { m.next = sublist m = sublist sublist = m.next } else { m.next = rr m = rr rr = m.next } } } return }
#include <stdio.h> typedef struct node_t *node, node_t; struct node_t { int v; node next; }; typedef struct { node head, tail; } slist; void push(slist *l, node e) { if (!l->head) l->head = e; if (l->tail) l->tail->next = e; l->tail = e; } node removehead(slist *l) { node e = l->head; if (e) { l->head = e->next; e->next = 0; } return e; } void join(slist *a, slist *b) { push(a, b->head); a->tail = b->tail; } void merge(slist *a, slist *b) { slist r = {0}; while (a->head && b->head) push(&r, removehead(a->head->v <= b->head->v ? a : b)); join(&r, a->head ? a : b); *a = r; b->head = b->tail = 0; } void sort(int *ar, int len) { node_t all[len]; for (int i = 0; i < len; i++) all[i].v = ar[i], all[i].next = i < len - 1 ? all + i + 1 : 0; slist list = {all, all + len - 1}, rem, strand = {0}, res = {0}; for (node e = 0; list.head; list = rem) { rem.head = rem.tail = 0; while ((e = removehead(&list))) push((!strand.head || e->v >= strand.tail->v) ? &strand : &rem, e); merge(&res, &strand); } for (int i = 0; res.head; i++, res.head = res.head->next) ar[i] = res.head->v; } void show(const char *title, int *x, int len) { printf("%s ", title); for (int i = 0; i < len; i++) printf("%3d ", x[i]); putchar('\n'); } int main(void) { int x[] = {-2,0,-2,5,5,3,-1,-3,5,5,0,2,-4,4,2}; # define SIZE sizeof(x)/sizeof(int) show("before sort:", x, SIZE); sort(x, sizeof(x)/sizeof(int)); show("after sort: ", x, SIZE); return 0; }
Translate this program into C but keep the logic exactly as in Go.
package main import "fmt" func isPrime(n int) bool { switch { case n < 2: return false case n%2 == 0: return n == 2 case n%3 == 0: return n == 3 default: d := 5 for d*d <= n { if n%d == 0 { return false } d += 2 if n%d == 0 { return false } d += 4 } return true } } func sumDigits(n int) int { sum := 0 for n > 0 { sum += n % 10 n /= 10 } return sum } func main() { fmt.Println("Additive primes less than 500:") i := 2 count := 0 for { if isPrime(i) && isPrime(sumDigits(i)) { count++ fmt.Printf("%3d ", i) if count%10 == 0 { fmt.Println() } } if i > 2 { i += 2 } else { i++ } if i > 499 { break } } fmt.Printf("\n\n%d additive primes found.\n", count) }
#include <stdbool.h> #include <stdio.h> #include <string.h> void memoizeIsPrime( bool * result, const int N ) { result[2] = true; result[3] = true; int prime[N]; prime[0] = 3; int end = 1; for (int n = 5; n < N; n += 2) { bool n_is_prime = true; for (int i = 0; i < end; ++i) { const int PRIME = prime[i]; if (n % PRIME == 0) { n_is_prime = false; break; } if (PRIME * PRIME > n) { break; } } if (n_is_prime) { prime[end++] = n; result[n] = true; } } } int sumOfDecimalDigits( int n ) { int sum = 0; while (n > 0) { sum += n % 10; n /= 10; } return sum; } int main( void ) { const int N = 500; printf( "Rosetta Code: additive primes less than %d:\n", N ); bool is_prime[N]; memset( is_prime, 0, sizeof(is_prime) ); memoizeIsPrime( is_prime, N ); printf( " 2" ); int count = 1; for (int i = 3; i < N; i += 2) { if (is_prime[i] && is_prime[sumOfDecimalDigits( i )]) { printf( "%4d", i ); ++count; if ((count % 10) == 0) { printf( "\n" ); } } } printf( "\nThose were %d additive primes.\n", count ); return 0; }
Rewrite the snippet below in C so it works the same as the original Go code.
package main import "fmt" type ibool bool const itrue ibool = true func (ib ibool) iif(cond bool) bool { if cond { return bool(ib) } return bool(!ib) } func main() { var needUmbrella bool raining := true if raining { needUmbrella = true } fmt.Printf("Is it raining? %t. Do I need an umbrella? %t\n", raining, needUmbrella) raining = false needUmbrella = itrue.iif(raining) fmt.Printf("Is it raining? %t. Do I need an umbrella? %t\n", raining, needUmbrella) }
#include <stdio.h> #include <stdlib.h> #define otherwise do { register int _o = 2; do { switch (_o) { case 1: #define given(Mc) ;case 0: break; case 2: _o = !!(Mc); continue; } break; } while (1); } while (0) int foo() { return 1; } main() { int a = 0; otherwise a = 4 given (foo()); printf("%d\n", a); exit(0); }
Write the same code in C as shown below in Go.
package main import "fmt" type ibool bool const itrue ibool = true func (ib ibool) iif(cond bool) bool { if cond { return bool(ib) } return bool(!ib) } func main() { var needUmbrella bool raining := true if raining { needUmbrella = true } fmt.Printf("Is it raining? %t. Do I need an umbrella? %t\n", raining, needUmbrella) raining = false needUmbrella = itrue.iif(raining) fmt.Printf("Is it raining? %t. Do I need an umbrella? %t\n", raining, needUmbrella) }
#include <stdio.h> #include <stdlib.h> #define otherwise do { register int _o = 2; do { switch (_o) { case 1: #define given(Mc) ;case 0: break; case 2: _o = !!(Mc); continue; } break; } while (1); } while (0) int foo() { return 1; } main() { int a = 0; otherwise a = 4 given (foo()); printf("%d\n", a); exit(0); }
Change the programming language of this snippet from Go to C without modifying what it does.
package main import "fmt" func gcd(n, k int) int { if n < k || k < 1 { panic("Need n >= k and k >= 1") } s := 1 for n&1 == 0 && k&1 == 0 { n >>= 1 k >>= 1 s <<= 1 } t := n if n&1 != 0 { t = -k } for t != 0 { for t&1 == 0 { t >>= 1 } if t > 0 { n = t } else { k = -t } t = n - k } return n * s } func totient(n int) int { tot := 0 for k := 1; k <= n; k++ { if gcd(n, k) == 1 { tot++ } } return tot } func main() { var perfect []int for n := 1; len(perfect) < 20; n += 2 { tot := n sum := 0 for tot != 1 { tot = totient(tot) sum += tot } if sum == n { perfect = append(perfect, n) } } fmt.Println("The first 20 perfect totient numbers are:") fmt.Println(perfect) }
#include<stdlib.h> #include<stdio.h> long totient(long n){ long tot = n,i; for(i=2;i*i<=n;i+=2){ if(n%i==0){ while(n%i==0) n/=i; tot-=tot/i; } if(i==2) i=1; } if(n>1) tot-=tot/n; return tot; } long* perfectTotients(long n){ long *ptList = (long*)malloc(n*sizeof(long)), m,count=0,sum,tot; for(m=1;count<n;m++){ tot = m; sum = 0; while(tot != 1){ tot = totient(tot); sum += tot; } if(sum == m) ptList[count++] = m; } return ptList; } long main(long argC, char* argV[]) { long *ptList,i,n; if(argC!=2) printf("Usage : %s <number of perfect Totient numbers required>",argV[0]); else{ n = atoi(argV[1]); ptList = perfectTotients(n); printf("The first %d perfect Totient numbers are : \n[",n); for(i=0;i<n;i++) printf(" %d,",ptList[i]); printf("\b]"); } return 0; }
Keep all operations the same but rewrite the snippet in C.
package main import "fmt" func gcd(n, k int) int { if n < k || k < 1 { panic("Need n >= k and k >= 1") } s := 1 for n&1 == 0 && k&1 == 0 { n >>= 1 k >>= 1 s <<= 1 } t := n if n&1 != 0 { t = -k } for t != 0 { for t&1 == 0 { t >>= 1 } if t > 0 { n = t } else { k = -t } t = n - k } return n * s } func totient(n int) int { tot := 0 for k := 1; k <= n; k++ { if gcd(n, k) == 1 { tot++ } } return tot } func main() { var perfect []int for n := 1; len(perfect) < 20; n += 2 { tot := n sum := 0 for tot != 1 { tot = totient(tot) sum += tot } if sum == n { perfect = append(perfect, n) } } fmt.Println("The first 20 perfect totient numbers are:") fmt.Println(perfect) }
#include<stdlib.h> #include<stdio.h> long totient(long n){ long tot = n,i; for(i=2;i*i<=n;i+=2){ if(n%i==0){ while(n%i==0) n/=i; tot-=tot/i; } if(i==2) i=1; } if(n>1) tot-=tot/n; return tot; } long* perfectTotients(long n){ long *ptList = (long*)malloc(n*sizeof(long)), m,count=0,sum,tot; for(m=1;count<n;m++){ tot = m; sum = 0; while(tot != 1){ tot = totient(tot); sum += tot; } if(sum == m) ptList[count++] = m; } return ptList; } long main(long argC, char* argV[]) { long *ptList,i,n; if(argC!=2) printf("Usage : %s <number of perfect Totient numbers required>",argV[0]); else{ n = atoi(argV[1]); ptList = perfectTotients(n); printf("The first %d perfect Totient numbers are : \n[",n); for(i=0;i<n;i++) printf(" %d,",ptList[i]); printf("\b]"); } return 0; }
Change the following Go code into C without altering its purpose.
package main import "fmt" type Delegator struct { delegate interface{} } type Thingable interface { thing() string } func (self Delegator) operation() string { if v, ok := self.delegate.(Thingable); ok { return v.thing() } return "default implementation" } type Delegate int func (Delegate) thing() string { return "delegate implementation" } func main() { a := Delegator{} fmt.Println(a.operation()) a.delegate = "A delegate may be any object" fmt.Println(a.operation()) var d Delegate a.delegate = d fmt.Println(a.operation()) }
#include <stdio.h> #include <stdlib.h> #include <string.h> typedef const char * (*Responder)( int p1); typedef struct sDelegate { Responder operation; } *Delegate; Delegate NewDelegate( Responder rspndr ) { Delegate dl = malloc(sizeof(struct sDelegate)); dl->operation = rspndr; return dl; } const char *DelegateThing(Delegate dl, int p1) { return (dl->operation)? (*dl->operation)(p1) : NULL; } typedef struct sDelegator { int param; char *phrase; Delegate delegate; } *Delegator; const char * defaultResponse( int p1) { return "default implementation"; } static struct sDelegate defaultDel = { &defaultResponse }; Delegator NewDelegator( int p, char *phrase) { Delegator d = malloc(sizeof(struct sDelegator)); d->param = p; d->phrase = phrase; d->delegate = &defaultDel; return d; } const char *Delegator_Operation( Delegator theDelegator, int p1, Delegate delroy) { const char *rtn; if (delroy) { rtn = DelegateThing(delroy, p1); if (!rtn) { rtn = DelegateThing(theDelegator->delegate, p1); } } else rtn = DelegateThing(theDelegator->delegate, p1); printf("%s\n", theDelegator->phrase ); return rtn; } const char *thing1( int p1) { printf("We're in thing1 with value %d\n" , p1); return "delegate implementation"; } int main() { Delegate del1 = NewDelegate(&thing1); Delegate del2 = NewDelegate(NULL); Delegator theDelegator = NewDelegator( 14, "A stellar vista, Baby."); printf("Delegator returns %s\n\n", Delegator_Operation( theDelegator, 3, NULL)); printf("Delegator returns %s\n\n", Delegator_Operation( theDelegator, 3, del1)); printf("Delegator returns %s\n\n", Delegator_Operation( theDelegator, 3, del2)); return 0; }
Keep all operations the same but rewrite the snippet in C.
package main import "fmt" func sumDivisors(n int) int { sum := 0 i := 1 k := 2 if n%2 == 0 { k = 1 } for i*i <= n { if n%i == 0 { sum += i j := n / i if j != i { sum += j } } i += k } return sum } func main() { fmt.Println("The sums of positive divisors for the first 100 positive integers are:") for i := 1; i <= 100; i++ { fmt.Printf("%3d ", sumDivisors(i)) if i%10 == 0 { fmt.Println() } } }
#include <stdio.h> unsigned int divisor_sum(unsigned int n) { unsigned int total = 1, power = 2; unsigned int p; for (; (n & 1) == 0; power <<= 1, n >>= 1) { total += power; } for (p = 3; p * p <= n; p += 2) { unsigned int sum = 1; for (power = p; n % p == 0; power *= p, n /= p) { sum += power; } total *= sum; } if (n > 1) { total *= n + 1; } return total; } int main() { const unsigned int limit = 100; unsigned int n; printf("Sum of divisors for the first %d positive integers:\n", limit); for (n = 1; n <= limit; ++n) { printf("%4d", divisor_sum(n)); if (n % 10 == 0) { printf("\n"); } } return 0; }
Preserve the algorithm and functionality while converting the code from Go to C.
package main import "fmt" func sumDivisors(n int) int { sum := 0 i := 1 k := 2 if n%2 == 0 { k = 1 } for i*i <= n { if n%i == 0 { sum += i j := n / i if j != i { sum += j } } i += k } return sum } func main() { fmt.Println("The sums of positive divisors for the first 100 positive integers are:") for i := 1; i <= 100; i++ { fmt.Printf("%3d ", sumDivisors(i)) if i%10 == 0 { fmt.Println() } } }
#include <stdio.h> unsigned int divisor_sum(unsigned int n) { unsigned int total = 1, power = 2; unsigned int p; for (; (n & 1) == 0; power <<= 1, n >>= 1) { total += power; } for (p = 3; p * p <= n; p += 2) { unsigned int sum = 1; for (power = p; n % p == 0; power *= p, n /= p) { sum += power; } total *= sum; } if (n > 1) { total *= n + 1; } return total; } int main() { const unsigned int limit = 100; unsigned int n; printf("Sum of divisors for the first %d positive integers:\n", limit); for (n = 1; n <= limit; ++n) { printf("%4d", divisor_sum(n)); if (n % 10 == 0) { printf("\n"); } } return 0; }
Transform the following Go implementation into C, maintaining the same output and logic.
package main import ( "fmt" "strings" ) var table = "Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy " + "COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find " + "NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput " + "Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO " + "MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT " + "READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT " + "RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up " func validate(commands, words []string, minLens []int) []string { results := make([]string, 0) if len(words) == 0 { return results } for _, word := range words { matchFound := false wlen := len(word) for i, command := range commands { if minLens[i] == 0 || wlen < minLens[i] || wlen > len(command) { continue } c := strings.ToUpper(command) w := strings.ToUpper(word) if strings.HasPrefix(c, w) { results = append(results, c) matchFound = true break } } if !matchFound { results = append(results, "*error*") } } return results } func main() { table = strings.TrimSpace(table) commands := strings.Fields(table) clen := len(commands) minLens := make([]int, clen) for i := 0; i < clen; i++ { count := 0 for _, c := range commands[i] { if c >= 'A' && c <= 'Z' { count++ } } minLens[i] = count } sentence := "riG rePEAT copies put mo rest types fup. 6 poweRin" words := strings.Fields(sentence) results := validate(commands, words, minLens) fmt.Print("user words: ") for j := 0; j < len(words); j++ { fmt.Printf("%-*s ", len(results[j]), words[j]) } fmt.Print("\nfull words: ") fmt.Println(strings.Join(results, " ")) }
#include <ctype.h> #include <stdbool.h> #include <stdio.h> #include <stdlib.h> #include <string.h> const char* command_table = "Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy " "COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find " "NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput " "Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO " "MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT " "READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT " "RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up"; typedef struct command_tag { char* cmd; size_t length; size_t min_len; struct command_tag* next; } command_t; bool command_match(const command_t* command, const char* str) { size_t olen = strlen(str); return olen >= command->min_len && olen <= command->length && strncmp(str, command->cmd, olen) == 0; } char* uppercase(char* str, size_t n) { for (size_t i = 0; i < n; ++i) str[i] = toupper((unsigned char)str[i]); return str; } size_t get_min_length(const char* str, size_t n) { size_t len = 0; while (len < n && isupper((unsigned char)str[len])) ++len; return len; } void fatal(const char* message) { fprintf(stderr, "%s\n", message); exit(1); } void* xmalloc(size_t n) { void* ptr = malloc(n); if (ptr == NULL) fatal("Out of memory"); return ptr; } void* xrealloc(void* p, size_t n) { void* ptr = realloc(p, n); if (ptr == NULL) fatal("Out of memory"); return ptr; } char** split_into_words(const char* str, size_t* count) { size_t size = 0; size_t capacity = 16; char** words = xmalloc(capacity * sizeof(char*)); size_t len = strlen(str); for (size_t begin = 0; begin < len; ) { size_t i = begin; for (; i < len && isspace((unsigned char)str[i]); ++i) {} begin = i; for (; i < len && !isspace((unsigned char)str[i]); ++i) {} size_t word_len = i - begin; if (word_len == 0) break; char* word = xmalloc(word_len + 1); memcpy(word, str + begin, word_len); word[word_len] = 0; begin += word_len; if (capacity == size) { capacity *= 2; words = xrealloc(words, capacity * sizeof(char*)); } words[size++] = word; } *count = size; return words; } command_t* make_command_list(const char* table) { command_t* cmd = NULL; size_t count = 0; char** words = split_into_words(table, &count); for (size_t i = 0; i < count; ++i) { char* word = words[i]; command_t* new_cmd = xmalloc(sizeof(command_t)); size_t word_len = strlen(word); new_cmd->length = word_len; new_cmd->min_len = get_min_length(word, word_len); new_cmd->cmd = uppercase(word, word_len); new_cmd->next = cmd; cmd = new_cmd; } free(words); return cmd; } void free_command_list(command_t* cmd) { while (cmd != NULL) { command_t* next = cmd->next; free(cmd->cmd); free(cmd); cmd = next; } } const command_t* find_command(const command_t* commands, const char* word) { for (const command_t* cmd = commands; cmd != NULL; cmd = cmd->next) { if (command_match(cmd, word)) return cmd; } return NULL; } void test(const command_t* commands, const char* input) { printf(" input: %s\n", input); printf("output:"); size_t count = 0; char** words = split_into_words(input, &count); for (size_t i = 0; i < count; ++i) { char* word = words[i]; uppercase(word, strlen(word)); const command_t* cmd_ptr = find_command(commands, word); printf(" %s", cmd_ptr ? cmd_ptr->cmd : "*error*"); free(word); } free(words); printf("\n"); } int main() { command_t* commands = make_command_list(command_table); const char* input = "riG rePEAT copies put mo rest types fup. 6 poweRin"; test(commands, input); free_command_list(commands); return 0; }
Translate this program into C but keep the logic exactly as in Go.
package main import ( "fmt" "strings" ) var table = "Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy " + "COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find " + "NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput " + "Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO " + "MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT " + "READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT " + "RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up " func validate(commands, words []string, minLens []int) []string { results := make([]string, 0) if len(words) == 0 { return results } for _, word := range words { matchFound := false wlen := len(word) for i, command := range commands { if minLens[i] == 0 || wlen < minLens[i] || wlen > len(command) { continue } c := strings.ToUpper(command) w := strings.ToUpper(word) if strings.HasPrefix(c, w) { results = append(results, c) matchFound = true break } } if !matchFound { results = append(results, "*error*") } } return results } func main() { table = strings.TrimSpace(table) commands := strings.Fields(table) clen := len(commands) minLens := make([]int, clen) for i := 0; i < clen; i++ { count := 0 for _, c := range commands[i] { if c >= 'A' && c <= 'Z' { count++ } } minLens[i] = count } sentence := "riG rePEAT copies put mo rest types fup. 6 poweRin" words := strings.Fields(sentence) results := validate(commands, words, minLens) fmt.Print("user words: ") for j := 0; j < len(words); j++ { fmt.Printf("%-*s ", len(results[j]), words[j]) } fmt.Print("\nfull words: ") fmt.Println(strings.Join(results, " ")) }
#include <ctype.h> #include <stdbool.h> #include <stdio.h> #include <stdlib.h> #include <string.h> const char* command_table = "Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy " "COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find " "NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput " "Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO " "MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT " "READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT " "RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up"; typedef struct command_tag { char* cmd; size_t length; size_t min_len; struct command_tag* next; } command_t; bool command_match(const command_t* command, const char* str) { size_t olen = strlen(str); return olen >= command->min_len && olen <= command->length && strncmp(str, command->cmd, olen) == 0; } char* uppercase(char* str, size_t n) { for (size_t i = 0; i < n; ++i) str[i] = toupper((unsigned char)str[i]); return str; } size_t get_min_length(const char* str, size_t n) { size_t len = 0; while (len < n && isupper((unsigned char)str[len])) ++len; return len; } void fatal(const char* message) { fprintf(stderr, "%s\n", message); exit(1); } void* xmalloc(size_t n) { void* ptr = malloc(n); if (ptr == NULL) fatal("Out of memory"); return ptr; } void* xrealloc(void* p, size_t n) { void* ptr = realloc(p, n); if (ptr == NULL) fatal("Out of memory"); return ptr; } char** split_into_words(const char* str, size_t* count) { size_t size = 0; size_t capacity = 16; char** words = xmalloc(capacity * sizeof(char*)); size_t len = strlen(str); for (size_t begin = 0; begin < len; ) { size_t i = begin; for (; i < len && isspace((unsigned char)str[i]); ++i) {} begin = i; for (; i < len && !isspace((unsigned char)str[i]); ++i) {} size_t word_len = i - begin; if (word_len == 0) break; char* word = xmalloc(word_len + 1); memcpy(word, str + begin, word_len); word[word_len] = 0; begin += word_len; if (capacity == size) { capacity *= 2; words = xrealloc(words, capacity * sizeof(char*)); } words[size++] = word; } *count = size; return words; } command_t* make_command_list(const char* table) { command_t* cmd = NULL; size_t count = 0; char** words = split_into_words(table, &count); for (size_t i = 0; i < count; ++i) { char* word = words[i]; command_t* new_cmd = xmalloc(sizeof(command_t)); size_t word_len = strlen(word); new_cmd->length = word_len; new_cmd->min_len = get_min_length(word, word_len); new_cmd->cmd = uppercase(word, word_len); new_cmd->next = cmd; cmd = new_cmd; } free(words); return cmd; } void free_command_list(command_t* cmd) { while (cmd != NULL) { command_t* next = cmd->next; free(cmd->cmd); free(cmd); cmd = next; } } const command_t* find_command(const command_t* commands, const char* word) { for (const command_t* cmd = commands; cmd != NULL; cmd = cmd->next) { if (command_match(cmd, word)) return cmd; } return NULL; } void test(const command_t* commands, const char* input) { printf(" input: %s\n", input); printf("output:"); size_t count = 0; char** words = split_into_words(input, &count); for (size_t i = 0; i < count; ++i) { char* word = words[i]; uppercase(word, strlen(word)); const command_t* cmd_ptr = find_command(commands, word); printf(" %s", cmd_ptr ? cmd_ptr->cmd : "*error*"); free(word); } free(words); printf("\n"); } int main() { command_t* commands = make_command_list(command_table); const char* input = "riG rePEAT copies put mo rest types fup. 6 poweRin"; test(commands, input); free_command_list(commands); return 0; }
Write the same algorithm in C as shown in this Go implementation.
package main func main() { s := "immutable" s[0] = 'a' }
#define PI 3.14159265358979323 #define MINSIZE 10 #define MAXSIZE 100
Port the following code from Go to C with equivalent syntax and logic.
package main import "fmt" type point struct { x, y float32 } var subjectPolygon = []point{{50, 150}, {200, 50}, {350, 150}, {350, 300}, {250, 300}, {200, 250}, {150, 350}, {100, 250}, {100, 200}} var clipPolygon = []point{{100, 100}, {300, 100}, {300, 300}, {100, 300}} func main() { var cp1, cp2, s, e point inside := func(p point) bool { return (cp2.x-cp1.x)*(p.y-cp1.y) > (cp2.y-cp1.y)*(p.x-cp1.x) } intersection := func() (p point) { dcx, dcy := cp1.x-cp2.x, cp1.y-cp2.y dpx, dpy := s.x-e.x, s.y-e.y n1 := cp1.x*cp2.y - cp1.y*cp2.x n2 := s.x*e.y - s.y*e.x n3 := 1 / (dcx*dpy - dcy*dpx) p.x = (n1*dpx - n2*dcx) * n3 p.y = (n1*dpy - n2*dcy) * n3 return } outputList := subjectPolygon cp1 = clipPolygon[len(clipPolygon)-1] for _, cp2 = range clipPolygon { inputList := outputList outputList = nil s = inputList[len(inputList)-1] for _, e = range inputList { if inside(e) { if !inside(s) { outputList = append(outputList, intersection()) } outputList = append(outputList, e) } else if inside(s) { outputList = append(outputList, intersection()) } s = e } cp1 = cp2 } fmt.Println(outputList) }
#include <stdio.h> #include <stdlib.h> #include <math.h> typedef struct { double x, y; } vec_t, *vec; inline double dot(vec a, vec b) { return a->x * b->x + a->y * b->y; } inline double cross(vec a, vec b) { return a->x * b->y - a->y * b->x; } inline vec vsub(vec a, vec b, vec res) { res->x = a->x - b->x; res->y = a->y - b->y; return res; } int left_of(vec a, vec b, vec c) { vec_t tmp1, tmp2; double x; vsub(b, a, &tmp1); vsub(c, b, &tmp2); x = cross(&tmp1, &tmp2); return x < 0 ? -1 : x > 0; } int line_sect(vec x0, vec x1, vec y0, vec y1, vec res) { vec_t dx, dy, d; vsub(x1, x0, &dx); vsub(y1, y0, &dy); vsub(x0, y0, &d); double dyx = cross(&dy, &dx); if (!dyx) return 0; dyx = cross(&d, &dx) / dyx; if (dyx <= 0 || dyx >= 1) return 0; res->x = y0->x + dyx * dy.x; res->y = y0->y + dyx * dy.y; return 1; } typedef struct { int len, alloc; vec v; } poly_t, *poly; poly poly_new() { return (poly)calloc(1, sizeof(poly_t)); } void poly_free(poly p) { free(p->v); free(p); } void poly_append(poly p, vec v) { if (p->len >= p->alloc) { p->alloc *= 2; if (!p->alloc) p->alloc = 4; p->v = (vec)realloc(p->v, sizeof(vec_t) * p->alloc); } p->v[p->len++] = *v; } int poly_winding(poly p) { return left_of(p->v, p->v + 1, p->v + 2); } void poly_edge_clip(poly sub, vec x0, vec x1, int left, poly res) { int i, side0, side1; vec_t tmp; vec v0 = sub->v + sub->len - 1, v1; res->len = 0; side0 = left_of(x0, x1, v0); if (side0 != -left) poly_append(res, v0); for (i = 0; i < sub->len; i++) { v1 = sub->v + i; side1 = left_of(x0, x1, v1); if (side0 + side1 == 0 && side0) if (line_sect(x0, x1, v0, v1, &tmp)) poly_append(res, &tmp); if (i == sub->len - 1) break; if (side1 != -left) poly_append(res, v1); v0 = v1; side0 = side1; } } poly poly_clip(poly sub, poly clip) { int i; poly p1 = poly_new(), p2 = poly_new(), tmp; int dir = poly_winding(clip); poly_edge_clip(sub, clip->v + clip->len - 1, clip->v, dir, p2); for (i = 0; i < clip->len - 1; i++) { tmp = p2; p2 = p1; p1 = tmp; if(p1->len == 0) { p2->len = 0; break; } poly_edge_clip(p1, clip->v + i, clip->v + i + 1, dir, p2); } poly_free(p1); return p2; } int main() { int i; vec_t c[] = {{100,100}, {300,100}, {300,300}, {100,300}}; vec_t s[] = { {50,150}, {200,50}, {350,150}, {350,300},{250,300},{200,250}, {150,350},{100,250},{100,200}}; #define clen (sizeof(c)/sizeof(vec_t)) #define slen (sizeof(s)/sizeof(vec_t)) poly_t clipper = {clen, 0, c}; poly_t subject = {slen, 0, s}; poly res = poly_clip(&subject, &clipper); for (i = 0; i < res->len; i++) printf("%g %g\n", res->v[i].x, res->v[i].y); FILE * eps = fopen("test.eps", "w"); fprintf(eps, "%%!PS-Adobe-3.0\n%%%%BoundingBox: 40 40 360 360\n" "/l {lineto} def /m{moveto} def /s{setrgbcolor} def" "/c {closepath} def /gs {fill grestore stroke} def\n"); fprintf(eps, "0 setlinewidth %g %g m ", c[0].x, c[0].y); for (i = 1; i < clen; i++) fprintf(eps, "%g %g l ", c[i].x, c[i].y); fprintf(eps, "c .5 0 0 s gsave 1 .7 .7 s gs\n"); fprintf(eps, "%g %g m ", s[0].x, s[0].y); for (i = 1; i < slen; i++) fprintf(eps, "%g %g l ", s[i].x, s[i].y); fprintf(eps, "c 0 .2 .5 s gsave .4 .7 1 s gs\n"); fprintf(eps, "2 setlinewidth [10 8] 0 setdash %g %g m ", res->v[0].x, res->v[0].y); for (i = 1; i < res->len; i++) fprintf(eps, "%g %g l ", res->v[i].x, res->v[i].y); fprintf(eps, "c .5 0 .5 s gsave .7 .3 .8 s gs\n"); fprintf(eps, "%%%%EOF"); fclose(eps); printf("test.eps written\n"); return 0; }
Change the programming language of this snippet from Go to C without modifying what it does.
package main import( "fmt" "strings" ) var codes = map[rune]string { 'a' : "AAAAA", 'b' : "AAAAB", 'c' : "AAABA", 'd' : "AAABB", 'e' : "AABAA", 'f' : "AABAB", 'g' : "AABBA", 'h' : "AABBB", 'i' : "ABAAA", 'j' : "ABAAB", 'k' : "ABABA", 'l' : "ABABB", 'm' : "ABBAA", 'n' : "ABBAB", 'o' : "ABBBA", 'p' : "ABBBB", 'q' : "BAAAA", 'r' : "BAAAB", 's' : "BAABA", 't' : "BAABB", 'u' : "BABAA", 'v' : "BABAB", 'w' : "BABBA", 'x' : "BABBB", 'y' : "BBAAA", 'z' : "BBAAB", ' ' : "BBBAA", } func baconEncode(plainText string, message string) string { pt := strings.ToLower(plainText) var sb []byte for _, c := range pt { if c >= 'a' && c <= 'z' { sb = append(sb, codes[c]...) } else { sb = append(sb, codes[' ']...) } } et := string(sb) mg := strings.ToLower(message) sb = nil var count = 0 for _, c := range mg { if c >= 'a' && c <= 'z' { if et[count] == 'A' { sb = append(sb, byte(c)) } else { sb = append(sb, byte(c - 32)) } count++ if count == len(et) { break } } else { sb = append(sb, byte(c)) } } return string(sb) } func baconDecode(message string) string { var sb []byte for _, c := range message { if c >= 'a' && c <= 'z' { sb = append(sb, 'A') } else if c >= 'A' && c <= 'Z' { sb = append(sb, 'B') } } et := string(sb) sb = nil for i := 0; i < len(et); i += 5 { quintet := et[i : i + 5] for k, v := range codes { if v == quintet { sb = append(sb, byte(k)) break } } } return string(sb) } func main() { plainText := "the quick brown fox jumps over the lazy dog" message := "bacon's cipher is a method of steganography created by francis bacon." + "this task is to implement a program for encryption and decryption of " + "plaintext using the simple alphabet of the baconian cipher or some " + "other kind of representation of this alphabet (make anything signify anything). " + "the baconian alphabet may optionally be extended to encode all lower " + "case characters individually and/or adding a few punctuation characters " + "such as the space." cipherText := baconEncode(plainText, message) fmt.Printf("Cipher text ->\n\n%s\n", cipherText) decodedText := baconDecode(cipherText) fmt.Printf("\nHidden text ->\n\n%s\n", decodedText) }
#include <stdio.h> #include <string.h> #include <stdlib.h> char *codes[] = { "AAAAA", "AAAAB", "AAABA", "AAABB", "AABAA", "AABAB", "AABBA", "AABBB", "ABAAA", "ABAAB", "ABABA", "ABABB", "ABBAA", "ABBAB", "ABBBA", "ABBBB", "BAAAA", "BAAAB", "BAABA", "BAABB", "BABAA", "BABAB", "BABBA", "BABBB", "BBAAA", "BBAAB", "BBBAA" }; char *get_code(const char c) { if (c >= 97 && c <= 122) return codes[c - 97]; return codes[26]; } char get_char(const char *code) { int i; if (!strcmp(codes[26], code)) return ' '; for (i = 0; i < 26; ++i) { if (strcmp(codes[i], code) == 0) return 97 + i; } printf("\nCode \"%s\" is invalid\n", code); exit(1); } void str_tolower(char s[]) { int i; for (i = 0; i < strlen(s); ++i) s[i] = tolower(s[i]); } char *bacon_encode(char plain_text[], char message[]) { int i, count; int plen = strlen(plain_text), mlen = strlen(message); int elen = 5 * plen; char c; char *p, *et, *mt; et = malloc(elen + 1); str_tolower(plain_text); for (i = 0, p = et; i < plen; ++i, p += 5) { c = plain_text[i]; strncpy(p, get_code(c), 5); } *++p = '\0'; str_tolower(message); mt = calloc(mlen + 1, 1); for (i = 0, count = 0; i < mlen; ++i) { c = message[i]; if (c >= 'a' && c <= 'z') { if (et[count] == 'A') mt[i] = c; else mt[i] = c - 32; if (++count == elen) break; } else mt[i] = c; } free(et); return mt; } char *bacon_decode(char cipher_text[]) { int i, count, clen = strlen(cipher_text); int plen; char *p, *ct, *pt; char c, quintet[6]; ct = calloc(clen + 1, 1); for (i = 0, count = 0; i < clen; ++i) { c = cipher_text[i]; if (c >= 'a' && c <= 'z') ct[count++] = 'A'; else if (c >= 'A' && c <= 'Z') ct[count++] = 'B'; } plen = strlen(ct) / 5; pt = malloc(plen + 1); for (i = 0, p = ct; i < plen; ++i, p += 5) { strncpy(quintet, p, 5); quintet[5] = '\0'; pt[i] = get_char(quintet); } pt[plen] = '\0'; free(ct); return pt; } int main() { char plain_text[] = "the quick brown fox jumps over the lazy dog"; char message[] = "bacon's cipher is a method of steganography created by francis bacon." "this task is to implement a program for encryption and decryption of " "plaintext using the simple alphabet of the baconian cipher or some " "other kind of representation of this alphabet (make anything signify anything). " "the baconian alphabet may optionally be extended to encode all lower " "case characters individually and/or adding a few punctuation characters " "such as the space."; char *cipher_text, *hidden_text; cipher_text = bacon_encode(plain_text, message); printf("Cipher text ->\n\n%s\n", cipher_text); hidden_text = bacon_decode(cipher_text); printf("\nHidden text ->\n\n%s\n", hidden_text); free(cipher_text); free(hidden_text); return 0; }
Rewrite this program in C while keeping its functionality equivalent to the Go version.
package main import( "fmt" "strings" ) var codes = map[rune]string { 'a' : "AAAAA", 'b' : "AAAAB", 'c' : "AAABA", 'd' : "AAABB", 'e' : "AABAA", 'f' : "AABAB", 'g' : "AABBA", 'h' : "AABBB", 'i' : "ABAAA", 'j' : "ABAAB", 'k' : "ABABA", 'l' : "ABABB", 'm' : "ABBAA", 'n' : "ABBAB", 'o' : "ABBBA", 'p' : "ABBBB", 'q' : "BAAAA", 'r' : "BAAAB", 's' : "BAABA", 't' : "BAABB", 'u' : "BABAA", 'v' : "BABAB", 'w' : "BABBA", 'x' : "BABBB", 'y' : "BBAAA", 'z' : "BBAAB", ' ' : "BBBAA", } func baconEncode(plainText string, message string) string { pt := strings.ToLower(plainText) var sb []byte for _, c := range pt { if c >= 'a' && c <= 'z' { sb = append(sb, codes[c]...) } else { sb = append(sb, codes[' ']...) } } et := string(sb) mg := strings.ToLower(message) sb = nil var count = 0 for _, c := range mg { if c >= 'a' && c <= 'z' { if et[count] == 'A' { sb = append(sb, byte(c)) } else { sb = append(sb, byte(c - 32)) } count++ if count == len(et) { break } } else { sb = append(sb, byte(c)) } } return string(sb) } func baconDecode(message string) string { var sb []byte for _, c := range message { if c >= 'a' && c <= 'z' { sb = append(sb, 'A') } else if c >= 'A' && c <= 'Z' { sb = append(sb, 'B') } } et := string(sb) sb = nil for i := 0; i < len(et); i += 5 { quintet := et[i : i + 5] for k, v := range codes { if v == quintet { sb = append(sb, byte(k)) break } } } return string(sb) } func main() { plainText := "the quick brown fox jumps over the lazy dog" message := "bacon's cipher is a method of steganography created by francis bacon." + "this task is to implement a program for encryption and decryption of " + "plaintext using the simple alphabet of the baconian cipher or some " + "other kind of representation of this alphabet (make anything signify anything). " + "the baconian alphabet may optionally be extended to encode all lower " + "case characters individually and/or adding a few punctuation characters " + "such as the space." cipherText := baconEncode(plainText, message) fmt.Printf("Cipher text ->\n\n%s\n", cipherText) decodedText := baconDecode(cipherText) fmt.Printf("\nHidden text ->\n\n%s\n", decodedText) }
#include <stdio.h> #include <string.h> #include <stdlib.h> char *codes[] = { "AAAAA", "AAAAB", "AAABA", "AAABB", "AABAA", "AABAB", "AABBA", "AABBB", "ABAAA", "ABAAB", "ABABA", "ABABB", "ABBAA", "ABBAB", "ABBBA", "ABBBB", "BAAAA", "BAAAB", "BAABA", "BAABB", "BABAA", "BABAB", "BABBA", "BABBB", "BBAAA", "BBAAB", "BBBAA" }; char *get_code(const char c) { if (c >= 97 && c <= 122) return codes[c - 97]; return codes[26]; } char get_char(const char *code) { int i; if (!strcmp(codes[26], code)) return ' '; for (i = 0; i < 26; ++i) { if (strcmp(codes[i], code) == 0) return 97 + i; } printf("\nCode \"%s\" is invalid\n", code); exit(1); } void str_tolower(char s[]) { int i; for (i = 0; i < strlen(s); ++i) s[i] = tolower(s[i]); } char *bacon_encode(char plain_text[], char message[]) { int i, count; int plen = strlen(plain_text), mlen = strlen(message); int elen = 5 * plen; char c; char *p, *et, *mt; et = malloc(elen + 1); str_tolower(plain_text); for (i = 0, p = et; i < plen; ++i, p += 5) { c = plain_text[i]; strncpy(p, get_code(c), 5); } *++p = '\0'; str_tolower(message); mt = calloc(mlen + 1, 1); for (i = 0, count = 0; i < mlen; ++i) { c = message[i]; if (c >= 'a' && c <= 'z') { if (et[count] == 'A') mt[i] = c; else mt[i] = c - 32; if (++count == elen) break; } else mt[i] = c; } free(et); return mt; } char *bacon_decode(char cipher_text[]) { int i, count, clen = strlen(cipher_text); int plen; char *p, *ct, *pt; char c, quintet[6]; ct = calloc(clen + 1, 1); for (i = 0, count = 0; i < clen; ++i) { c = cipher_text[i]; if (c >= 'a' && c <= 'z') ct[count++] = 'A'; else if (c >= 'A' && c <= 'Z') ct[count++] = 'B'; } plen = strlen(ct) / 5; pt = malloc(plen + 1); for (i = 0, p = ct; i < plen; ++i, p += 5) { strncpy(quintet, p, 5); quintet[5] = '\0'; pt[i] = get_char(quintet); } pt[plen] = '\0'; free(ct); return pt; } int main() { char plain_text[] = "the quick brown fox jumps over the lazy dog"; char message[] = "bacon's cipher is a method of steganography created by francis bacon." "this task is to implement a program for encryption and decryption of " "plaintext using the simple alphabet of the baconian cipher or some " "other kind of representation of this alphabet (make anything signify anything). " "the baconian alphabet may optionally be extended to encode all lower " "case characters individually and/or adding a few punctuation characters " "such as the space."; char *cipher_text, *hidden_text; cipher_text = bacon_encode(plain_text, message); printf("Cipher text ->\n\n%s\n", cipher_text); hidden_text = bacon_decode(cipher_text); printf("\nHidden text ->\n\n%s\n", hidden_text); free(cipher_text); free(hidden_text); return 0; }
Write a version of this Go function in C with identical behavior.
package main import ( "fmt" "strconv" ) var n = 5 func main() { if n < 1 { return } top, left, bottom, right := 0, 0, n-1, n-1 sz := n * n a := make([]int, sz) i := 0 for left < right { for c := left; c <= right; c++ { a[top*n+c] = i i++ } top++ for r := top; r <= bottom; r++ { a[r*n+right] = i i++ } right-- if top == bottom { break } for c := right; c >= left; c-- { a[bottom*n+c] = i i++ } bottom-- for r := bottom; r >= top; r-- { a[r*n+left] = i i++ } left++ } a[top*n+left] = i w := len(strconv.Itoa(n*n - 1)) for i, e := range a { fmt.Printf("%*d ", w, e) if i%n == n-1 { fmt.Println("") } } }
#include <stdio.h> #include <stdlib.h> #define valid(i, j) 0 <= i && i < m && 0 <= j && j < n && !s[i][j] int main(int c, char **v) { int i, j, m = 0, n = 0; if (c >= 2) m = atoi(v[1]); if (c >= 3) n = atoi(v[2]); if (m <= 0) m = 5; if (n <= 0) n = m; int **s = calloc(1, sizeof(int *) * m + sizeof(int) * m * n); s[0] = (int*)(s + m); for (i = 1; i < m; i++) s[i] = s[i - 1] + n; int dx = 1, dy = 0, val = 0, t; for (i = j = 0; valid(i, j); i += dy, j += dx ) { for (; valid(i, j); j += dx, i += dy) s[i][j] = ++val; j -= dx; i -= dy; t = dy; dy = dx; dx = -t; } for (t = 2; val /= 10; t++); for(i = 0; i < m; i++) for(j = 0; j < n || !putchar('\n'); j++) printf("%*d", t, s[i][j]); return 0; }
Ensure the translated C code behaves exactly like the original Go snippet.
type cell string type spec struct { less func(cell, cell) bool column int reverse bool } func newSpec() (s spec) { return } t.sort(newSpec()) s := newSpec s.reverse = true t.sort(s)
#include <stdlib.h> #include <stdarg.h> #include <stdio.h> #include <ctype.h> #include <string.h> typedef const char * String; typedef struct sTable { String * *rows; int n_rows,n_cols; } *Table; typedef int (*CompareFctn)(String a, String b); struct { CompareFctn compare; int column; int reversed; } sortSpec; int CmprRows( const void *aa, const void *bb) { String *rA = *(String *const *)aa; String *rB = *(String *const *)bb; int sortCol = sortSpec.column; String left = sortSpec.reversed ? rB[sortCol] : rA[sortCol]; String right = sortSpec.reversed ? rA[sortCol] : rB[sortCol]; return sortSpec.compare( left, right ); } int sortTable(Table tbl, const char* argSpec,... ) { va_list vl; const char *p; int c; sortSpec.compare = &strcmp; sortSpec.column = 0; sortSpec.reversed = 0; va_start(vl, argSpec); if (argSpec) for (p=argSpec; *p; p++) { switch (*p) { case 'o': sortSpec.compare = va_arg(vl,CompareFctn); break; case 'c': c = va_arg(vl,int); if ( 0<=c && c<tbl->n_cols) sortSpec.column = c; break; case 'r': sortSpec.reversed = (0!=va_arg(vl,int)); break; } } va_end(vl); qsort( tbl->rows, tbl->n_rows, sizeof(String *), CmprRows); return 0; } void printTable( Table tbl, FILE *fout, const char *colFmts[]) { int row, col; for (row=0; row<tbl->n_rows; row++) { fprintf(fout, " "); for(col=0; col<tbl->n_cols; col++) { fprintf(fout, colFmts[col], tbl->rows[row][col]); } fprintf(fout, "\n"); } fprintf(fout, "\n"); } int ord(char v) { return v-'0'; } int cmprStrgs(String s1, String s2) { const char *p1 = s1; const char *p2 = s2; const char *mrk1, *mrk2; while ((tolower(*p1) == tolower(*p2)) && *p1) { p1++; p2++; } if (isdigit(*p1) && isdigit(*p2)) { long v1, v2; if ((*p1 == '0') ||(*p2 == '0')) { while (p1 > s1) { p1--; p2--; if (*p1 != '0') break; } if (!isdigit(*p1)) { p1++; p2++; } } mrk1 = p1; mrk2 = p2; v1 = 0; while(isdigit(*p1)) { v1 = 10*v1+ord(*p1); p1++; } v2 = 0; while(isdigit(*p2)) { v2 = 10*v2+ord(*p2); p2++; } if (v1 == v2) return(p2-mrk2)-(p1-mrk1); return v1 - v2; } if (tolower(*p1) != tolower(*p2)) return (tolower(*p1) - tolower(*p2)); for(p1=s1, p2=s2; (*p1 == *p2) && *p1; p1++, p2++); return (*p1 -*p2); } int main() { const char *colFmts[] = {" %-5.5s"," %-5.5s"," %-9.9s"}; String r1[] = { "a101", "red", "Java" }; String r2[] = { "ab40", "gren", "Smalltalk" }; String r3[] = { "ab9", "blue", "Fortran" }; String r4[] = { "ab09", "ylow", "Python" }; String r5[] = { "ab1a", "blak", "Factor" }; String r6[] = { "ab1b", "brwn", "C Sharp" }; String r7[] = { "Ab1b", "pink", "Ruby" }; String r8[] = { "ab1", "orng", "Scheme" }; String *rows[] = { r1, r2, r3, r4, r5, r6, r7, r8 }; struct sTable table; table.rows = rows; table.n_rows = 8; table.n_cols = 3; sortTable(&table, ""); printf("sort on col 0, ascending\n"); printTable(&table, stdout, colFmts); sortTable(&table, "ro", 1, &cmprStrgs); printf("sort on col 0, reverse.special\n"); printTable(&table, stdout, colFmts); sortTable(&table, "c", 1); printf("sort on col 1, ascending\n"); printTable(&table, stdout, colFmts); sortTable(&table, "cr", 2, 1); printf("sort on col 2, reverse\n"); printTable(&table, stdout, colFmts); return 0; }
Port the following code from Go to C with equivalent syntax and logic.
type cell string type spec struct { less func(cell, cell) bool column int reverse bool } func newSpec() (s spec) { return } t.sort(newSpec()) s := newSpec s.reverse = true t.sort(s)
#include <stdlib.h> #include <stdarg.h> #include <stdio.h> #include <ctype.h> #include <string.h> typedef const char * String; typedef struct sTable { String * *rows; int n_rows,n_cols; } *Table; typedef int (*CompareFctn)(String a, String b); struct { CompareFctn compare; int column; int reversed; } sortSpec; int CmprRows( const void *aa, const void *bb) { String *rA = *(String *const *)aa; String *rB = *(String *const *)bb; int sortCol = sortSpec.column; String left = sortSpec.reversed ? rB[sortCol] : rA[sortCol]; String right = sortSpec.reversed ? rA[sortCol] : rB[sortCol]; return sortSpec.compare( left, right ); } int sortTable(Table tbl, const char* argSpec,... ) { va_list vl; const char *p; int c; sortSpec.compare = &strcmp; sortSpec.column = 0; sortSpec.reversed = 0; va_start(vl, argSpec); if (argSpec) for (p=argSpec; *p; p++) { switch (*p) { case 'o': sortSpec.compare = va_arg(vl,CompareFctn); break; case 'c': c = va_arg(vl,int); if ( 0<=c && c<tbl->n_cols) sortSpec.column = c; break; case 'r': sortSpec.reversed = (0!=va_arg(vl,int)); break; } } va_end(vl); qsort( tbl->rows, tbl->n_rows, sizeof(String *), CmprRows); return 0; } void printTable( Table tbl, FILE *fout, const char *colFmts[]) { int row, col; for (row=0; row<tbl->n_rows; row++) { fprintf(fout, " "); for(col=0; col<tbl->n_cols; col++) { fprintf(fout, colFmts[col], tbl->rows[row][col]); } fprintf(fout, "\n"); } fprintf(fout, "\n"); } int ord(char v) { return v-'0'; } int cmprStrgs(String s1, String s2) { const char *p1 = s1; const char *p2 = s2; const char *mrk1, *mrk2; while ((tolower(*p1) == tolower(*p2)) && *p1) { p1++; p2++; } if (isdigit(*p1) && isdigit(*p2)) { long v1, v2; if ((*p1 == '0') ||(*p2 == '0')) { while (p1 > s1) { p1--; p2--; if (*p1 != '0') break; } if (!isdigit(*p1)) { p1++; p2++; } } mrk1 = p1; mrk2 = p2; v1 = 0; while(isdigit(*p1)) { v1 = 10*v1+ord(*p1); p1++; } v2 = 0; while(isdigit(*p2)) { v2 = 10*v2+ord(*p2); p2++; } if (v1 == v2) return(p2-mrk2)-(p1-mrk1); return v1 - v2; } if (tolower(*p1) != tolower(*p2)) return (tolower(*p1) - tolower(*p2)); for(p1=s1, p2=s2; (*p1 == *p2) && *p1; p1++, p2++); return (*p1 -*p2); } int main() { const char *colFmts[] = {" %-5.5s"," %-5.5s"," %-9.9s"}; String r1[] = { "a101", "red", "Java" }; String r2[] = { "ab40", "gren", "Smalltalk" }; String r3[] = { "ab9", "blue", "Fortran" }; String r4[] = { "ab09", "ylow", "Python" }; String r5[] = { "ab1a", "blak", "Factor" }; String r6[] = { "ab1b", "brwn", "C Sharp" }; String r7[] = { "Ab1b", "pink", "Ruby" }; String r8[] = { "ab1", "orng", "Scheme" }; String *rows[] = { r1, r2, r3, r4, r5, r6, r7, r8 }; struct sTable table; table.rows = rows; table.n_rows = 8; table.n_cols = 3; sortTable(&table, ""); printf("sort on col 0, ascending\n"); printTable(&table, stdout, colFmts); sortTable(&table, "ro", 1, &cmprStrgs); printf("sort on col 0, reverse.special\n"); printTable(&table, stdout, colFmts); sortTable(&table, "c", 1); printf("sort on col 1, ascending\n"); printTable(&table, stdout, colFmts); sortTable(&table, "cr", 2, 1); printf("sort on col 2, reverse\n"); printTable(&table, stdout, colFmts); return 0; }
Write the same algorithm in C as shown in this Go implementation.
package main import ( "fmt" "image" "image/color" "image/draw" "image/png" "math/rand" "os" "time" ) const ( imageWidth = 300 imageHeight = 200 nSites = 10 ) func main() { writePngFile(generateVoronoi(randomSites())) } func generateVoronoi(sx, sy []int) image.Image { sc := make([]color.NRGBA, nSites) for i := range sx { sc[i] = color.NRGBA{uint8(rand.Intn(256)), uint8(rand.Intn(256)), uint8(rand.Intn(256)), 255} } img := image.NewNRGBA(image.Rect(0, 0, imageWidth, imageHeight)) for x := 0; x < imageWidth; x++ { for y := 0; y < imageHeight; y++ { dMin := dot(imageWidth, imageHeight) var sMin int for s := 0; s < nSites; s++ { if d := dot(sx[s]-x, sy[s]-y); d < dMin { sMin = s dMin = d } } img.SetNRGBA(x, y, sc[sMin]) } } black := image.NewUniform(color.Black) for s := 0; s < nSites; s++ { draw.Draw(img, image.Rect(sx[s]-2, sy[s]-2, sx[s]+2, sy[s]+2), black, image.ZP, draw.Src) } return img } func dot(x, y int) int { return x*x + y*y } func randomSites() (sx, sy []int) { rand.Seed(time.Now().Unix()) sx = make([]int, nSites) sy = make([]int, nSites) for i := range sx { sx[i] = rand.Intn(imageWidth) sy[i] = rand.Intn(imageHeight) } return } func writePngFile(img image.Image) { f, err := os.Create("voronoi.png") if err != nil { fmt.Println(err) return } if err = png.Encode(f, img); err != nil { fmt.Println(err) } if err = f.Close(); err != nil { fmt.Println(err) } }
#include <stdio.h> #include <stdlib.h> #include <string.h> #define N_SITES 150 double site[N_SITES][2]; unsigned char rgb[N_SITES][3]; int size_x = 640, size_y = 480; inline double sq2(double x, double y) { return x * x + y * y; } #define for_k for (k = 0; k < N_SITES; k++) int nearest_site(double x, double y) { int k, ret = 0; double d, dist = 0; for_k { d = sq2(x - site[k][0], y - site[k][1]); if (!k || d < dist) { dist = d, ret = k; } } return ret; } int at_edge(int *color, int y, int x) { int i, j, c = color[y * size_x + x]; for (i = y - 1; i <= y + 1; i++) { if (i < 0 || i >= size_y) continue; for (j = x - 1; j <= x + 1; j++) { if (j < 0 || j >= size_x) continue; if (color[i * size_x + j] != c) return 1; } } return 0; } #define AA_RES 4 void aa_color(unsigned char *pix, int y, int x) { int i, j, n; double r = 0, g = 0, b = 0, xx, yy; for (i = 0; i < AA_RES; i++) { yy = y + 1. / AA_RES * i + .5; for (j = 0; j < AA_RES; j++) { xx = x + 1. / AA_RES * j + .5; n = nearest_site(xx, yy); r += rgb[n][0]; g += rgb[n][1]; b += rgb[n][2]; } } pix[0] = r / (AA_RES * AA_RES); pix[1] = g / (AA_RES * AA_RES); pix[2] = b / (AA_RES * AA_RES); } #define for_i for (i = 0; i < size_y; i++) #define for_j for (j = 0; j < size_x; j++) void gen_map() { int i, j, k; int *nearest = malloc(sizeof(int) * size_y * size_x); unsigned char *ptr, *buf, color; ptr = buf = malloc(3 * size_x * size_y); for_i for_j nearest[i * size_x + j] = nearest_site(j, i); for_i for_j { if (!at_edge(nearest, i, j)) memcpy(ptr, rgb[nearest[i * size_x + j]], 3); else aa_color(ptr, i, j); ptr += 3; } for (k = 0; k < N_SITES; k++) { color = (rgb[k][0]*.25 + rgb[k][1]*.6 + rgb[k][2]*.15 > 80) ? 0 : 255; for (i = site[k][1] - 1; i <= site[k][1] + 1; i++) { if (i < 0 || i >= size_y) continue; for (j = site[k][0] - 1; j <= site[k][0] + 1; j++) { if (j < 0 || j >= size_x) continue; ptr = buf + 3 * (i * size_x + j); ptr[0] = ptr[1] = ptr[2] = color; } } } printf("P6\n%d %d\n255\n", size_x, size_y); fflush(stdout); fwrite(buf, size_y * size_x * 3, 1, stdout); } #define frand(x) (rand() / (1. + RAND_MAX) * x) int main() { int k; for_k { site[k][0] = frand(size_x); site[k][1] = frand(size_y); rgb [k][0] = frand(256); rgb [k][1] = frand(256); rgb [k][2] = frand(256); } gen_map(); return 0; }
Preserve the algorithm and functionality while converting the code from Go to C.
package main import ( "fmt" "image" "image/color" "image/draw" "image/png" "math/rand" "os" "time" ) const ( imageWidth = 300 imageHeight = 200 nSites = 10 ) func main() { writePngFile(generateVoronoi(randomSites())) } func generateVoronoi(sx, sy []int) image.Image { sc := make([]color.NRGBA, nSites) for i := range sx { sc[i] = color.NRGBA{uint8(rand.Intn(256)), uint8(rand.Intn(256)), uint8(rand.Intn(256)), 255} } img := image.NewNRGBA(image.Rect(0, 0, imageWidth, imageHeight)) for x := 0; x < imageWidth; x++ { for y := 0; y < imageHeight; y++ { dMin := dot(imageWidth, imageHeight) var sMin int for s := 0; s < nSites; s++ { if d := dot(sx[s]-x, sy[s]-y); d < dMin { sMin = s dMin = d } } img.SetNRGBA(x, y, sc[sMin]) } } black := image.NewUniform(color.Black) for s := 0; s < nSites; s++ { draw.Draw(img, image.Rect(sx[s]-2, sy[s]-2, sx[s]+2, sy[s]+2), black, image.ZP, draw.Src) } return img } func dot(x, y int) int { return x*x + y*y } func randomSites() (sx, sy []int) { rand.Seed(time.Now().Unix()) sx = make([]int, nSites) sy = make([]int, nSites) for i := range sx { sx[i] = rand.Intn(imageWidth) sy[i] = rand.Intn(imageHeight) } return } func writePngFile(img image.Image) { f, err := os.Create("voronoi.png") if err != nil { fmt.Println(err) return } if err = png.Encode(f, img); err != nil { fmt.Println(err) } if err = f.Close(); err != nil { fmt.Println(err) } }
#include <stdio.h> #include <stdlib.h> #include <string.h> #define N_SITES 150 double site[N_SITES][2]; unsigned char rgb[N_SITES][3]; int size_x = 640, size_y = 480; inline double sq2(double x, double y) { return x * x + y * y; } #define for_k for (k = 0; k < N_SITES; k++) int nearest_site(double x, double y) { int k, ret = 0; double d, dist = 0; for_k { d = sq2(x - site[k][0], y - site[k][1]); if (!k || d < dist) { dist = d, ret = k; } } return ret; } int at_edge(int *color, int y, int x) { int i, j, c = color[y * size_x + x]; for (i = y - 1; i <= y + 1; i++) { if (i < 0 || i >= size_y) continue; for (j = x - 1; j <= x + 1; j++) { if (j < 0 || j >= size_x) continue; if (color[i * size_x + j] != c) return 1; } } return 0; } #define AA_RES 4 void aa_color(unsigned char *pix, int y, int x) { int i, j, n; double r = 0, g = 0, b = 0, xx, yy; for (i = 0; i < AA_RES; i++) { yy = y + 1. / AA_RES * i + .5; for (j = 0; j < AA_RES; j++) { xx = x + 1. / AA_RES * j + .5; n = nearest_site(xx, yy); r += rgb[n][0]; g += rgb[n][1]; b += rgb[n][2]; } } pix[0] = r / (AA_RES * AA_RES); pix[1] = g / (AA_RES * AA_RES); pix[2] = b / (AA_RES * AA_RES); } #define for_i for (i = 0; i < size_y; i++) #define for_j for (j = 0; j < size_x; j++) void gen_map() { int i, j, k; int *nearest = malloc(sizeof(int) * size_y * size_x); unsigned char *ptr, *buf, color; ptr = buf = malloc(3 * size_x * size_y); for_i for_j nearest[i * size_x + j] = nearest_site(j, i); for_i for_j { if (!at_edge(nearest, i, j)) memcpy(ptr, rgb[nearest[i * size_x + j]], 3); else aa_color(ptr, i, j); ptr += 3; } for (k = 0; k < N_SITES; k++) { color = (rgb[k][0]*.25 + rgb[k][1]*.6 + rgb[k][2]*.15 > 80) ? 0 : 255; for (i = site[k][1] - 1; i <= site[k][1] + 1; i++) { if (i < 0 || i >= size_y) continue; for (j = site[k][0] - 1; j <= site[k][0] + 1; j++) { if (j < 0 || j >= size_x) continue; ptr = buf + 3 * (i * size_x + j); ptr[0] = ptr[1] = ptr[2] = color; } } } printf("P6\n%d %d\n255\n", size_x, size_y); fflush(stdout); fwrite(buf, size_y * size_x * 3, 1, stdout); } #define frand(x) (rand() / (1. + RAND_MAX) * x) int main() { int k; for_k { site[k][0] = frand(size_x); site[k][1] = frand(size_y); rgb [k][0] = frand(256); rgb [k][1] = frand(256); rgb [k][2] = frand(256); } gen_map(); return 0; }
Translate this program into C but keep the logic exactly as in Go.
package main import "C" import ( "fmt" "unsafe" ) func main() { go1 := "hello C" c1 := C.CString(go1) go1 = "" c2 := C.strdup(c1) C.free(unsafe.Pointer(c1)) go2 := C.GoString(c2) C.free(unsafe.Pointer(c2)) fmt.Println(go2) }
#include <stdio.h> void sayHello(char* name){ printf("Hello %s!\n", name); } int doubleNum(int num){ return num * 2; }
Port the provided Go code into C while preserving the original functionality.
package main import "C" import ( "fmt" "unsafe" ) func main() { go1 := "hello C" c1 := C.CString(go1) go1 = "" c2 := C.strdup(c1) C.free(unsafe.Pointer(c1)) go2 := C.GoString(c2) C.free(unsafe.Pointer(c2)) fmt.Println(go2) }
#include <stdio.h> void sayHello(char* name){ printf("Hello %s!\n", name); } int doubleNum(int num){ return num * 2; }
Change the programming language of this snippet from Go to C without modifying what it does.
package main import ( "fmt" "math/rand" "time" ) func sOfNCreator(n int) func(byte) []byte { s := make([]byte, 0, n) m := n return func(item byte) []byte { if len(s) < n { s = append(s, item) } else { m++ if rand.Intn(m) < n { s[rand.Intn(n)] = item } } return s } } func main() { rand.Seed(time.Now().UnixNano()) var freq [10]int for r := 0; r < 1e5; r++ { sOfN := sOfNCreator(3) for d := byte('0'); d < '9'; d++ { sOfN(d) } for _, d := range sOfN('9') { freq[d-'0']++ } } fmt.Println(freq) }
#include <stdlib.h> #include <stdio.h> #include <string.h> #include <time.h> struct s_env { unsigned int n, i; size_t size; void *sample; }; void s_of_n_init(struct s_env *s_env, size_t size, unsigned int n) { s_env->i = 0; s_env->n = n; s_env->size = size; s_env->sample = malloc(n * size); } void sample_set_i(struct s_env *s_env, unsigned int i, void *item) { memcpy(s_env->sample + i * s_env->size, item, s_env->size); } void *s_of_n(struct s_env *s_env, void *item) { s_env->i++; if (s_env->i <= s_env->n) sample_set_i(s_env, s_env->i - 1, item); else if ((rand() % s_env->i) < s_env->n) sample_set_i(s_env, rand() % s_env->n, item); return s_env->sample; } int *test(unsigned int n, int *items_set, unsigned int num_items) { int i; struct s_env s_env; s_of_n_init(&s_env, sizeof(items_set[0]), n); for (i = 0; i < num_items; i++) { s_of_n(&s_env, (void *) &items_set[i]); } return (int *)s_env.sample; } int main() { unsigned int i, j; unsigned int n = 3; unsigned int num_items = 10; unsigned int *frequencies; int *items_set; srand(time(NULL)); items_set = malloc(num_items * sizeof(int)); frequencies = malloc(num_items * sizeof(int)); for (i = 0; i < num_items; i++) { items_set[i] = i; frequencies[i] = 0; } for (i = 0; i < 100000; i++) { int *res = test(n, items_set, num_items); for (j = 0; j < n; j++) { frequencies[res[j]]++; } free(res); } for (i = 0; i < num_items; i++) { printf(" %d", frequencies[i]); } puts(""); return 0; }
Please provide an equivalent version of this Go code in C.
package main import ( "fmt" "math/rand" "time" ) func sOfNCreator(n int) func(byte) []byte { s := make([]byte, 0, n) m := n return func(item byte) []byte { if len(s) < n { s = append(s, item) } else { m++ if rand.Intn(m) < n { s[rand.Intn(n)] = item } } return s } } func main() { rand.Seed(time.Now().UnixNano()) var freq [10]int for r := 0; r < 1e5; r++ { sOfN := sOfNCreator(3) for d := byte('0'); d < '9'; d++ { sOfN(d) } for _, d := range sOfN('9') { freq[d-'0']++ } } fmt.Println(freq) }
#include <stdlib.h> #include <stdio.h> #include <string.h> #include <time.h> struct s_env { unsigned int n, i; size_t size; void *sample; }; void s_of_n_init(struct s_env *s_env, size_t size, unsigned int n) { s_env->i = 0; s_env->n = n; s_env->size = size; s_env->sample = malloc(n * size); } void sample_set_i(struct s_env *s_env, unsigned int i, void *item) { memcpy(s_env->sample + i * s_env->size, item, s_env->size); } void *s_of_n(struct s_env *s_env, void *item) { s_env->i++; if (s_env->i <= s_env->n) sample_set_i(s_env, s_env->i - 1, item); else if ((rand() % s_env->i) < s_env->n) sample_set_i(s_env, rand() % s_env->n, item); return s_env->sample; } int *test(unsigned int n, int *items_set, unsigned int num_items) { int i; struct s_env s_env; s_of_n_init(&s_env, sizeof(items_set[0]), n); for (i = 0; i < num_items; i++) { s_of_n(&s_env, (void *) &items_set[i]); } return (int *)s_env.sample; } int main() { unsigned int i, j; unsigned int n = 3; unsigned int num_items = 10; unsigned int *frequencies; int *items_set; srand(time(NULL)); items_set = malloc(num_items * sizeof(int)); frequencies = malloc(num_items * sizeof(int)); for (i = 0; i < num_items; i++) { items_set[i] = i; frequencies[i] = 0; } for (i = 0; i < 100000; i++) { int *res = test(n, items_set, num_items); for (j = 0; j < n; j++) { frequencies[res[j]]++; } free(res); } for (i = 0; i < num_items; i++) { printf(" %d", frequencies[i]); } puts(""); return 0; }
Maintain the same structure and functionality when rewriting this code in C.
package main import ( "fmt" "math/rand" "time" ) func sOfNCreator(n int) func(byte) []byte { s := make([]byte, 0, n) m := n return func(item byte) []byte { if len(s) < n { s = append(s, item) } else { m++ if rand.Intn(m) < n { s[rand.Intn(n)] = item } } return s } } func main() { rand.Seed(time.Now().UnixNano()) var freq [10]int for r := 0; r < 1e5; r++ { sOfN := sOfNCreator(3) for d := byte('0'); d < '9'; d++ { sOfN(d) } for _, d := range sOfN('9') { freq[d-'0']++ } } fmt.Println(freq) }
#include <stdlib.h> #include <stdio.h> #include <string.h> #include <time.h> struct s_env { unsigned int n, i; size_t size; void *sample; }; void s_of_n_init(struct s_env *s_env, size_t size, unsigned int n) { s_env->i = 0; s_env->n = n; s_env->size = size; s_env->sample = malloc(n * size); } void sample_set_i(struct s_env *s_env, unsigned int i, void *item) { memcpy(s_env->sample + i * s_env->size, item, s_env->size); } void *s_of_n(struct s_env *s_env, void *item) { s_env->i++; if (s_env->i <= s_env->n) sample_set_i(s_env, s_env->i - 1, item); else if ((rand() % s_env->i) < s_env->n) sample_set_i(s_env, rand() % s_env->n, item); return s_env->sample; } int *test(unsigned int n, int *items_set, unsigned int num_items) { int i; struct s_env s_env; s_of_n_init(&s_env, sizeof(items_set[0]), n); for (i = 0; i < num_items; i++) { s_of_n(&s_env, (void *) &items_set[i]); } return (int *)s_env.sample; } int main() { unsigned int i, j; unsigned int n = 3; unsigned int num_items = 10; unsigned int *frequencies; int *items_set; srand(time(NULL)); items_set = malloc(num_items * sizeof(int)); frequencies = malloc(num_items * sizeof(int)); for (i = 0; i < num_items; i++) { items_set[i] = i; frequencies[i] = 0; } for (i = 0; i < 100000; i++) { int *res = test(n, items_set, num_items); for (j = 0; j < n; j++) { frequencies[res[j]]++; } free(res); } for (i = 0; i < num_items; i++) { printf(" %d", frequencies[i]); } puts(""); return 0; }
Convert this Go snippet to C and keep its semantics consistent.
package main import ( "fmt" "math/big" ) func bernoulli(n uint) *big.Rat { a := make([]big.Rat, n+1) z := new(big.Rat) for m := range a { a[m].SetFrac64(1, int64(m+1)) for j := m; j >= 1; j-- { d := &a[j-1] d.Mul(z.SetInt64(int64(j)), d.Sub(d, &a[j])) } } if n != 1 { return &a[0] } a[0].Neg(&a[0]) return &a[0] } func binomial(n, k int) int64 { if n <= 0 || k <= 0 || n < k { return 1 } var num, den int64 = 1, 1 for i := k + 1; i <= n; i++ { num *= int64(i) } for i := 2; i <= n-k; i++ { den *= int64(i) } return num / den } func faulhaberTriangle(p int) []big.Rat { coeffs := make([]big.Rat, p+1) q := big.NewRat(1, int64(p)+1) t := new(big.Rat) u := new(big.Rat) sign := -1 for j := range coeffs { sign *= -1 d := &coeffs[p-j] t.SetInt64(int64(sign)) u.SetInt64(binomial(p+1, j)) d.Mul(q, t) d.Mul(d, u) d.Mul(d, bernoulli(uint(j))) } return coeffs } func main() { for i := 0; i < 10; i++ { coeffs := faulhaberTriangle(i) for _, coeff := range coeffs { fmt.Printf("%5s ", coeff.RatString()) } fmt.Println() } fmt.Println() k := 17 cc := faulhaberTriangle(k) n := int64(1000) nn := big.NewRat(n, 1) np := big.NewRat(1, 1) sum := new(big.Rat) tmp := new(big.Rat) for _, c := range cc { np.Mul(np, nn) tmp.Set(np) tmp.Mul(tmp, &c) sum.Add(sum, tmp) } fmt.Println(sum.RatString()) }
#include <stdbool.h> #include <stdio.h> #include <stdlib.h> #include <string.h> int binomial(int n, int k) { int num, denom, i; if (n < 0 || k < 0 || n < k) return -1; if (n == 0 || k == 0) return 1; num = 1; for (i = k + 1; i <= n; ++i) { num = num * i; } denom = 1; for (i = 2; i <= n - k; ++i) { denom *= i; } return num / denom; } int gcd(int a, int b) { int temp; while (b != 0) { temp = a % b; a = b; b = temp; } return a; } typedef struct tFrac { int num, denom; } Frac; Frac makeFrac(int n, int d) { Frac result; int g; if (d == 0) { result.num = 0; result.denom = 0; return result; } if (n == 0) { d = 1; } else if (d < 0) { n = -n; d = -d; } g = abs(gcd(n, d)); if (g > 1) { n = n / g; d = d / g; } result.num = n; result.denom = d; return result; } Frac negateFrac(Frac f) { return makeFrac(-f.num, f.denom); } Frac subFrac(Frac lhs, Frac rhs) { return makeFrac(lhs.num * rhs.denom - lhs.denom * rhs.num, rhs.denom * lhs.denom); } Frac multFrac(Frac lhs, Frac rhs) { return makeFrac(lhs.num * rhs.num, lhs.denom * rhs.denom); } bool equalFrac(Frac lhs, Frac rhs) { return (lhs.num == rhs.num) && (lhs.denom == rhs.denom); } bool lessFrac(Frac lhs, Frac rhs) { return (lhs.num * rhs.denom) < (rhs.num * lhs.denom); } void printFrac(Frac f) { char buffer[7]; int len; if (f.denom != 1) { snprintf(buffer, 7, "%d/%d", f.num, f.denom); } else { snprintf(buffer, 7, "%d", f.num); } len = 7 - strlen(buffer); while (len-- > 0) { putc(' ', stdout); } printf(buffer); } Frac bernoulli(int n) { Frac a[16]; int j, m; if (n < 0) { a[0].num = 0; a[0].denom = 0; return a[0]; } for (m = 0; m <= n; ++m) { a[m] = makeFrac(1, m + 1); for (j = m; j >= 1; --j) { a[j - 1] = multFrac(subFrac(a[j - 1], a[j]), makeFrac(j, 1)); } } if (n != 1) { return a[0]; } return negateFrac(a[0]); } void faulhaber(int p) { Frac q, *coeffs; int j, sign; coeffs = malloc(sizeof(Frac)*(p + 1)); q = makeFrac(1, p + 1); sign = -1; for (j = 0; j <= p; ++j) { sign = -1 * sign; coeffs[p - j] = multFrac(multFrac(multFrac(q, makeFrac(sign, 1)), makeFrac(binomial(p + 1, j), 1)), bernoulli(j)); } for (j = 0; j <= p; ++j) { printFrac(coeffs[j]); } printf("\n"); free(coeffs); } int main() { int i; for (i = 0; i < 10; ++i) { faulhaber(i); } return 0; }
Convert the following code from Go to C, ensuring the logic remains intact.
package main import ( "fmt" "os" ) func main() { for i, x := range os.Args[1:] { fmt.Printf("the argument #%d is %s\n", i, x) } }
#include <stdlib.h> #include <stdio.h> int main(int argc, char* argv[]) { int i; (void) printf("This program is named %s.\n", argv[0]); for (i = 1; i < argc; ++i) (void) printf("the argument #%d is %s\n", i, argv[i]); return EXIT_SUCCESS; }
Translate this program into C but keep the logic exactly as in Go.
package main import ( "fmt" "os" ) func main() { for i, x := range os.Args[1:] { fmt.Printf("the argument #%d is %s\n", i, x) } }
#include <stdlib.h> #include <stdio.h> int main(int argc, char* argv[]) { int i; (void) printf("This program is named %s.\n", argv[0]); for (i = 1; i < argc; ++i) (void) printf("the argument #%d is %s\n", i, argv[i]); return EXIT_SUCCESS; }
Please provide an equivalent version of this Go code in C.
package main import ( "bytes" "fmt" "io/ioutil" "log" "sort" "strings" ) func main() { b, err := ioutil.ReadFile("unixdict.txt") if err != nil { log.Fatal("Error reading file") } letters := "deegklnow" wordsAll := bytes.Split(b, []byte{'\n'}) var words [][]byte for _, word := range wordsAll { word = bytes.TrimSpace(word) le := len(word) if le > 2 && le < 10 { words = append(words, word) } } var found []string for _, word := range words { le := len(word) if bytes.IndexByte(word, 'k') >= 0 { lets := letters ok := true for i := 0; i < le; i++ { c := word[i] ix := sort.Search(len(lets), func(i int) bool { return lets[i] >= c }) if ix < len(lets) && lets[ix] == c { lets = lets[0:ix] + lets[ix+1:] } else { ok = false break } } if ok { found = append(found, string(word)) } } } fmt.Println("The following", len(found), "words are the solutions to the puzzle:") fmt.Println(strings.Join(found, "\n")) mostFound := 0 var mostWords9 []string var mostLetters []byte var words9 [][]byte for _, word := range words { if len(word) == 9 { words9 = append(words9, word) } } for _, word9 := range words9 { letterBytes := make([]byte, len(word9)) copy(letterBytes, word9) sort.Slice(letterBytes, func(i, j int) bool { return letterBytes[i] < letterBytes[j] }) distinctBytes := []byte{letterBytes[0]} for _, b := range letterBytes[1:] { if b != distinctBytes[len(distinctBytes)-1] { distinctBytes = append(distinctBytes, b) } } distinctLetters := string(distinctBytes) for _, letter := range distinctLetters { found := 0 letterByte := byte(letter) for _, word := range words { le := len(word) if bytes.IndexByte(word, letterByte) >= 0 { lets := string(letterBytes) ok := true for i := 0; i < le; i++ { c := word[i] ix := sort.Search(len(lets), func(i int) bool { return lets[i] >= c }) if ix < len(lets) && lets[ix] == c { lets = lets[0:ix] + lets[ix+1:] } else { ok = false break } } if ok { found = found + 1 } } } if found > mostFound { mostFound = found mostWords9 = []string{string(word9)} mostLetters = []byte{letterByte} } else if found == mostFound { mostWords9 = append(mostWords9, string(word9)) mostLetters = append(mostLetters, letterByte) } } } fmt.Println("\nMost words found =", mostFound) fmt.Println("Nine letter words producing this total:") for i := 0; i < len(mostWords9); i++ { fmt.Println(mostWords9[i], "with central letter", string(mostLetters[i])) } }
#include <stdbool.h> #include <stdio.h> #define MAX_WORD 80 #define LETTERS 26 bool is_letter(char c) { return c >= 'a' && c <= 'z'; } int index(char c) { return c - 'a'; } void word_wheel(const char* letters, char central, int min_length, FILE* dict) { int max_count[LETTERS] = { 0 }; for (const char* p = letters; *p; ++p) { char c = *p; if (is_letter(c)) ++max_count[index(c)]; } char word[MAX_WORD + 1] = { 0 }; while (fgets(word, MAX_WORD, dict)) { int count[LETTERS] = { 0 }; for (const char* p = word; *p; ++p) { char c = *p; if (c == '\n') { if (p >= word + min_length && count[index(central)] > 0) printf("%s", word); } else if (is_letter(c)) { int i = index(c); if (++count[i] > max_count[i]) { break; } } else { break; } } } } int main(int argc, char** argv) { const char* dict = argc == 2 ? argv[1] : "unixdict.txt"; FILE* in = fopen(dict, "r"); if (in == NULL) { perror(dict); return 1; } word_wheel("ndeokgelw", 'k', 3, in); fclose(in); return 0; }
Change the programming language of this snippet from Go to C without modifying what it does.
package main import "fmt" func main() { a := []int{1, 2, 3} b := []int{7, 12, 60} c := append(a, b...) fmt.Println(c) i := []interface{}{1, 2, 3} j := []interface{}{"Crosby", "Stills", "Nash", "Young"} k := append(i, j...) fmt.Println(k) l := [...]int{1, 2, 3} m := [...]int{7, 12, 60} var n [len(l) + len(m)]int copy(n[:], l[:]) copy(n[len(l):], m[:]) fmt.Println(n) }
#include <stdlib.h> #include <stdio.h> #include <string.h> #define ARRAY_CONCAT(TYPE, A, An, B, Bn) \ (TYPE *)array_concat((const void *)(A), (An), (const void *)(B), (Bn), sizeof(TYPE)); void *array_concat(const void *a, size_t an, const void *b, size_t bn, size_t s) { char *p = malloc(s * (an + bn)); memcpy(p, a, an*s); memcpy(p + an*s, b, bn*s); return p; } const int a[] = { 1, 2, 3, 4, 5 }; const int b[] = { 6, 7, 8, 9, 0 }; int main(void) { unsigned int i; int *c = ARRAY_CONCAT(int, a, 5, b, 5); for(i = 0; i < 10; i++) printf("%d\n", c[i]); free(c); return EXIT_SUCCCESS; }
Transform the following Go implementation into C, maintaining the same output and logic.
package main import "fmt" func main() { var s string var i int if _, err := fmt.Scan(&s, &i); err == nil && i == 75000 { fmt.Println("good") } else { fmt.Println("wrong") } }
#include <stdio.h> #include <stdlib.h> int main(void) { char str[BUFSIZ]; puts("Enter a string: "); fgets(str, sizeof(str), stdin); long num; char buf[BUFSIZ]; do { puts("Enter 75000: "); fgets(buf, sizeof(buf), stdin); num = strtol(buf, NULL, 10); } while (num != 75000); return EXIT_SUCCESS; }
Can you help me rewrite this code in C instead of Go, keeping it the same logically?
package main import ( "encoding/binary" "log" "math" "os" "strings" ) func main() { const ( sampleRate = 44100 duration = 8 dataLength = sampleRate * duration hdrSize = 44 fileLen = dataLength + hdrSize - 8 ) buf1 := make([]byte, 1) buf2 := make([]byte, 2) buf4 := make([]byte, 4) var sb strings.Builder sb.WriteString("RIFF") binary.LittleEndian.PutUint32(buf4, fileLen) sb.Write(buf4) sb.WriteString("WAVE") sb.WriteString("fmt ") binary.LittleEndian.PutUint32(buf4, 16) sb.Write(buf4) binary.LittleEndian.PutUint16(buf2, 1) sb.Write(buf2) sb.Write(buf2) binary.LittleEndian.PutUint32(buf4, sampleRate) sb.Write(buf4) sb.Write(buf4) sb.Write(buf2) binary.LittleEndian.PutUint16(buf2, 8) sb.Write(buf2) sb.WriteString("data") binary.LittleEndian.PutUint32(buf4, dataLength) sb.Write(buf4) wavhdr := []byte(sb.String()) f, err := os.Create("notes.wav") if err != nil { log.Fatal(err) } defer f.Close() f.Write(wavhdr) freqs := [8]float64{261.6, 293.6, 329.6, 349.2, 392.0, 440.0, 493.9, 523.3} for j := 0; j < duration; j++ { freq := freqs[j] omega := 2 * math.Pi * freq for i := 0; i < dataLength/duration; i++ { y := 32 * math.Sin(omega*float64(i)/float64(sampleRate)) buf1[0] = byte(math.Round(y)) f.Write(buf1) } } }
#include<stdio.h> #include<conio.h> #include<math.h> #include<dos.h> typedef struct{ char str[3]; int key; }note; note sequence[] = {{"Do",0},{"Re",2},{"Mi",4},{"Fa",5},{"So",7},{"La",9},{"Ti",11},{"Do",12}}; int main(void) { int i=0; while(!kbhit()) { printf("\t%s",sequence[i].str); sound(261.63*pow(2,sequence[i].key/12.0)); delay(sequence[i].key%12==0?500:1000); i = (i+1)%8; i==0?printf("\n"):printf(""); } nosound(); return 0; }
Translate the given Go code snippet into C without altering its behavior.
package main import ( "encoding/binary" "log" "math" "os" "strings" ) func main() { const ( sampleRate = 44100 duration = 8 dataLength = sampleRate * duration hdrSize = 44 fileLen = dataLength + hdrSize - 8 ) buf1 := make([]byte, 1) buf2 := make([]byte, 2) buf4 := make([]byte, 4) var sb strings.Builder sb.WriteString("RIFF") binary.LittleEndian.PutUint32(buf4, fileLen) sb.Write(buf4) sb.WriteString("WAVE") sb.WriteString("fmt ") binary.LittleEndian.PutUint32(buf4, 16) sb.Write(buf4) binary.LittleEndian.PutUint16(buf2, 1) sb.Write(buf2) sb.Write(buf2) binary.LittleEndian.PutUint32(buf4, sampleRate) sb.Write(buf4) sb.Write(buf4) sb.Write(buf2) binary.LittleEndian.PutUint16(buf2, 8) sb.Write(buf2) sb.WriteString("data") binary.LittleEndian.PutUint32(buf4, dataLength) sb.Write(buf4) wavhdr := []byte(sb.String()) f, err := os.Create("notes.wav") if err != nil { log.Fatal(err) } defer f.Close() f.Write(wavhdr) freqs := [8]float64{261.6, 293.6, 329.6, 349.2, 392.0, 440.0, 493.9, 523.3} for j := 0; j < duration; j++ { freq := freqs[j] omega := 2 * math.Pi * freq for i := 0; i < dataLength/duration; i++ { y := 32 * math.Sin(omega*float64(i)/float64(sampleRate)) buf1[0] = byte(math.Round(y)) f.Write(buf1) } } }
#include<stdio.h> #include<conio.h> #include<math.h> #include<dos.h> typedef struct{ char str[3]; int key; }note; note sequence[] = {{"Do",0},{"Re",2},{"Mi",4},{"Fa",5},{"So",7},{"La",9},{"Ti",11},{"Do",12}}; int main(void) { int i=0; while(!kbhit()) { printf("\t%s",sequence[i].str); sound(261.63*pow(2,sequence[i].key/12.0)); delay(sequence[i].key%12==0?500:1000); i = (i+1)%8; i==0?printf("\n"):printf(""); } nosound(); return 0; }
Port the following code from Go to C with equivalent syntax and logic.
package main import "fmt" type item struct { string w, v int } var wants = []item{ {"map", 9, 150}, {"compass", 13, 35}, {"water", 153, 200}, {"sandwich", 50, 160}, {"glucose", 15, 60}, {"tin", 68, 45}, {"banana", 27, 60}, {"apple", 39, 40}, {"cheese", 23, 30}, {"beer", 52, 10}, {"suntan cream", 11, 70}, {"camera", 32, 30}, {"T-shirt", 24, 15}, {"trousers", 48, 10}, {"umbrella", 73, 40}, {"waterproof trousers", 42, 70}, {"waterproof overclothes", 43, 75}, {"note-case", 22, 80}, {"sunglasses", 7, 20}, {"towel", 18, 12}, {"socks", 4, 50}, {"book", 30, 10}, } const maxWt = 400 func main() { items, w, v := m(len(wants)-1, maxWt) fmt.Println(items) fmt.Println("weight:", w) fmt.Println("value:", v) } func m(i, w int) ([]string, int, int) { if i < 0 || w == 0 { return nil, 0, 0 } else if wants[i].w > w { return m(i-1, w) } i0, w0, v0 := m(i-1, w) i1, w1, v1 := m(i-1, w-wants[i].w) v1 += wants[i].v if v1 > v0 { return append(i1, wants[i].string), w1 + wants[i].w, v1 } return i0, w0, v0 }
#include <stdio.h> #include <stdlib.h> typedef struct { char *name; int weight; int value; } item_t; item_t items[] = { {"map", 9, 150}, {"compass", 13, 35}, {"water", 153, 200}, {"sandwich", 50, 160}, {"glucose", 15, 60}, {"tin", 68, 45}, {"banana", 27, 60}, {"apple", 39, 40}, {"cheese", 23, 30}, {"beer", 52, 10}, {"suntan cream", 11, 70}, {"camera", 32, 30}, {"T-shirt", 24, 15}, {"trousers", 48, 10}, {"umbrella", 73, 40}, {"waterproof trousers", 42, 70}, {"waterproof overclothes", 43, 75}, {"note-case", 22, 80}, {"sunglasses", 7, 20}, {"towel", 18, 12}, {"socks", 4, 50}, {"book", 30, 10}, }; int *knapsack (item_t *items, int n, int w) { int i, j, a, b, *mm, **m, *s; mm = calloc((n + 1) * (w + 1), sizeof (int)); m = malloc((n + 1) * sizeof (int *)); m[0] = mm; for (i = 1; i <= n; i++) { m[i] = &mm[i * (w + 1)]; for (j = 0; j <= w; j++) { if (items[i - 1].weight > j) { m[i][j] = m[i - 1][j]; } else { a = m[i - 1][j]; b = m[i - 1][j - items[i - 1].weight] + items[i - 1].value; m[i][j] = a > b ? a : b; } } } s = calloc(n, sizeof (int)); for (i = n, j = w; i > 0; i--) { if (m[i][j] > m[i - 1][j]) { s[i - 1] = 1; j -= items[i - 1].weight; } } free(mm); free(m); return s; } int main () { int i, n, tw = 0, tv = 0, *s; n = sizeof (items) / sizeof (item_t); s = knapsack(items, n, 400); for (i = 0; i < n; i++) { if (s[i]) { printf("%-22s %5d %5d\n", items[i].name, items[i].weight, items[i].value); tw += items[i].weight; tv += items[i].value; } } printf("%-22s %5d %5d\n", "totals:", tw, tv); return 0; }
Can you help me rewrite this code in C instead of Go, keeping it the same logically?
package main import ( "fmt" "sort" ) func getPrimes(max int) []int { if max < 2 { return []int{} } lprimes := []int{2} outer: for x := 3; x <= max; x += 2 { for _, p := range lprimes { if x%p == 0 { continue outer } } lprimes = append(lprimes, x) } return lprimes } func main() { const maxSum = 99 descendants := make([][]int64, maxSum+1) ancestors := make([][]int, maxSum+1) for i := 0; i <= maxSum; i++ { descendants[i] = []int64{} ancestors[i] = []int{} } primes := getPrimes(maxSum) for _, p := range primes { descendants[p] = append(descendants[p], int64(p)) for s := 1; s < len(descendants)-p; s++ { temp := make([]int64, len(descendants[s])) for i := 0; i < len(descendants[s]); i++ { temp[i] = int64(p) * descendants[s][i] } descendants[s+p] = append(descendants[s+p], temp...) } } for _, p := range append(primes, 4) { le := len(descendants[p]) if le == 0 { continue } descendants[p][le-1] = 0 descendants[p] = descendants[p][:le-1] } total := 0 for s := 1; s <= maxSum; s++ { x := descendants[s] sort.Slice(x, func(i, j int) bool { return x[i] < x[j] }) total += len(descendants[s]) index := 0 for ; index < len(descendants[s]); index++ { if descendants[s][index] > int64(maxSum) { break } } for _, d := range descendants[s][:index] { ancestors[d] = append(ancestors[s], s) } if (s >= 21 && s <= 45) || (s >= 47 && s <= 73) || (s >= 75 && s < maxSum) { continue } temp := fmt.Sprintf("%v", ancestors[s]) fmt.Printf("%2d: %d Ancestor(s): %-14s", s, len(ancestors[s]), temp) le := len(descendants[s]) if le <= 10 { fmt.Printf("%5d Descendant(s): %v\n", le, descendants[s]) } else { fmt.Printf("%5d Descendant(s): %v\b ...]\n", le, descendants[s][:10]) } } fmt.Println("\nTotal descendants", total) }
#include <math.h> #include <stdio.h> #include <stdlib.h> #include <string.h> #define MAXPRIME 99 #define MAXPARENT 99 #define NBRPRIMES 30 #define NBRANCESTORS 10 FILE *FileOut; char format[] = ", %lld"; int Primes[NBRPRIMES]; int iPrimes; short Ancestors[NBRANCESTORS]; struct Children { long long Child; struct Children *pNext; }; struct Children *Parents[MAXPARENT+1][2]; int CptDescendants[MAXPARENT+1]; long long MaxDescendant = (long long) pow(3.0, 33.0); short GetParent(long long child); struct Children *AppendChild(struct Children *node, long long child); short GetAncestors(short child); void PrintDescendants(struct Children *node); int GetPrimes(int primes[], int maxPrime); int main() { long long Child; short i, Parent, Level; int TotDesc = 0; if ((iPrimes = GetPrimes(Primes, MAXPRIME)) < 0) return 1; for (Child = 1; Child <= MaxDescendant; Child++) { if (Parent = GetParent(Child)) { Parents[Parent][1] = AppendChild(Parents[Parent][1], Child); if (Parents[Parent][0] == NULL) Parents[Parent][0] = Parents[Parent][1]; CptDescendants[Parent]++; } } if (MAXPARENT > MAXPRIME) if (GetPrimes(Primes, MAXPARENT) < 0) return 1; if (fopen_s(&FileOut, "Ancestors.txt", "w")) return 1; for (Parent = 1; Parent <= MAXPARENT; Parent++) { Level = GetAncestors(Parent); fprintf(FileOut, "[%d] Level: %d\n", Parent, Level); if (Level) { fprintf(FileOut, "Ancestors: %d", Ancestors[0]); for (i = 1; i < Level; i++) fprintf(FileOut, ", %d", Ancestors[i]); } else fprintf(FileOut, "Ancestors: None"); if (CptDescendants[Parent]) { fprintf(FileOut, "\nDescendants: %d\n", CptDescendants[Parent]); strcpy_s(format, "%lld"); PrintDescendants(Parents[Parent][0]); fprintf(FileOut, "\n"); } else fprintf(FileOut, "\nDescendants: None\n"); fprintf(FileOut, "\n"); TotDesc += CptDescendants[Parent]; } fprintf(FileOut, "Total descendants %d\n\n", TotDesc); if (fclose(FileOut)) return 1; return 0; } short GetParent(long long child) { long long Child = child; short Parent = 0; short Index = 0; while (Child > 1 && Parent <= MAXPARENT) { if (Index > iPrimes) return 0; while (Child % Primes[Index] == 0) { Child /= Primes[Index]; Parent += Primes[Index]; } Index++; } if (Parent == child || Parent > MAXPARENT || child == 1) return 0; return Parent; } struct Children *AppendChild(struct Children *node, long long child) { static struct Children *NodeNew; if (NodeNew = (struct Children *) malloc(sizeof(struct Children))) { NodeNew->Child = child; NodeNew->pNext = NULL; if (node != NULL) node->pNext = NodeNew; } return NodeNew; } short GetAncestors(short child) { short Child = child; short Parent = 0; short Index = 0; while (Child > 1) { while (Child % Primes[Index] == 0) { Child /= Primes[Index]; Parent += Primes[Index]; } Index++; } if (Parent == child || child == 1) return 0; Index = GetAncestors(Parent); Ancestors[Index] = Parent; return ++Index; } void PrintDescendants(struct Children *node) { static struct Children *NodeCurr; static struct Children *NodePrev; NodeCurr = node; NodePrev = NULL; while (NodeCurr) { fprintf(FileOut, format, NodeCurr->Child); strcpy_s(format, ", %lld"); NodePrev = NodeCurr; NodeCurr = NodeCurr->pNext; free(NodePrev); } return; } int GetPrimes(int primes[], int maxPrime) { if (maxPrime < 2) return -1; int Index = 0, Value = 1; int Max, i; primes[0] = 2; while ((Value += 2) <= maxPrime) { Max = (int) floor(sqrt((double) Value)); for (i = 0; i <= Index; i++) { if (primes[i] > Max) { if (++Index >= NBRPRIMES) return -1; primes[Index] = Value; break; } if (Value % primes[i] == 0) break; } } return Index; }
Port the following code from Go to C with equivalent syntax and logic.
package main import "fmt" type pair [2]int func cart2(a, b []int) []pair { p := make([]pair, len(a)*len(b)) i := 0 for _, a := range a { for _, b := range b { p[i] = pair{a, b} i++ } } return p } func main() { fmt.Println(cart2([]int{1, 2}, []int{3, 4})) fmt.Println(cart2([]int{3, 4}, []int{1, 2})) fmt.Println(cart2([]int{1, 2}, nil)) fmt.Println(cart2(nil, []int{1, 2})) }
#include<string.h> #include<stdlib.h> #include<stdio.h> void cartesianProduct(int** sets, int* setLengths, int* currentSet, int numSets, int times){ int i,j; if(times==numSets){ printf("("); for(i=0;i<times;i++){ printf("%d,",currentSet[i]); } printf("\b),"); } else{ for(j=0;j<setLengths[times];j++){ currentSet[times] = sets[times][j]; cartesianProduct(sets,setLengths,currentSet,numSets,times+1); } } } void printSets(int** sets, int* setLengths, int numSets){ int i,j; printf("\nNumber of sets : %d",numSets); for(i=0;i<numSets+1;i++){ printf("\nSet %d : ",i+1); for(j=0;j<setLengths[i];j++){ printf(" %d ",sets[i][j]); } } } void processInputString(char* str){ int **sets, *currentSet, *setLengths, setLength, numSets = 0, i,j,k,l,start,counter=0; char *token,*holder,*holderToken; for(i=0;str[i]!=00;i++) if(str[i]=='x') numSets++; if(numSets==0){ printf("\n%s",str); return; } currentSet = (int*)calloc(sizeof(int),numSets + 1); setLengths = (int*)calloc(sizeof(int),numSets + 1); sets = (int**)malloc((numSets + 1)*sizeof(int*)); token = strtok(str,"x"); while(token!=NULL){ holder = (char*)malloc(strlen(token)*sizeof(char)); j = 0; for(i=0;token[i]!=00;i++){ if(token[i]>='0' && token[i]<='9') holder[j++] = token[i]; else if(token[i]==',') holder[j++] = ' '; } holder[j] = 00; setLength = 0; for(i=0;holder[i]!=00;i++) if(holder[i]==' ') setLength++; if(setLength==0 && strlen(holder)==0){ printf("\n{}"); return; } setLengths[counter] = setLength+1; sets[counter] = (int*)malloc((1+setLength)*sizeof(int)); k = 0; start = 0; for(l=0;holder[l]!=00;l++){ if(holder[l+1]==' '||holder[l+1]==00){ holderToken = (char*)malloc((l+1-start)*sizeof(char)); strncpy(holderToken,holder + start,l+1-start); sets[counter][k++] = atoi(holderToken); start = l+2; } } counter++; token = strtok(NULL,"x"); } printf("\n{"); cartesianProduct(sets,setLengths,currentSet,numSets + 1,0); printf("\b}"); } int main(int argC,char* argV[]) { if(argC!=2) printf("Usage : %s <Set product expression enclosed in double quotes>",argV[0]); else processInputString(argV[1]); return 0; }
Transform the following Go implementation into C, maintaining the same output and logic.
package main import "fmt" type pair [2]int func cart2(a, b []int) []pair { p := make([]pair, len(a)*len(b)) i := 0 for _, a := range a { for _, b := range b { p[i] = pair{a, b} i++ } } return p } func main() { fmt.Println(cart2([]int{1, 2}, []int{3, 4})) fmt.Println(cart2([]int{3, 4}, []int{1, 2})) fmt.Println(cart2([]int{1, 2}, nil)) fmt.Println(cart2(nil, []int{1, 2})) }
#include<string.h> #include<stdlib.h> #include<stdio.h> void cartesianProduct(int** sets, int* setLengths, int* currentSet, int numSets, int times){ int i,j; if(times==numSets){ printf("("); for(i=0;i<times;i++){ printf("%d,",currentSet[i]); } printf("\b),"); } else{ for(j=0;j<setLengths[times];j++){ currentSet[times] = sets[times][j]; cartesianProduct(sets,setLengths,currentSet,numSets,times+1); } } } void printSets(int** sets, int* setLengths, int numSets){ int i,j; printf("\nNumber of sets : %d",numSets); for(i=0;i<numSets+1;i++){ printf("\nSet %d : ",i+1); for(j=0;j<setLengths[i];j++){ printf(" %d ",sets[i][j]); } } } void processInputString(char* str){ int **sets, *currentSet, *setLengths, setLength, numSets = 0, i,j,k,l,start,counter=0; char *token,*holder,*holderToken; for(i=0;str[i]!=00;i++) if(str[i]=='x') numSets++; if(numSets==0){ printf("\n%s",str); return; } currentSet = (int*)calloc(sizeof(int),numSets + 1); setLengths = (int*)calloc(sizeof(int),numSets + 1); sets = (int**)malloc((numSets + 1)*sizeof(int*)); token = strtok(str,"x"); while(token!=NULL){ holder = (char*)malloc(strlen(token)*sizeof(char)); j = 0; for(i=0;token[i]!=00;i++){ if(token[i]>='0' && token[i]<='9') holder[j++] = token[i]; else if(token[i]==',') holder[j++] = ' '; } holder[j] = 00; setLength = 0; for(i=0;holder[i]!=00;i++) if(holder[i]==' ') setLength++; if(setLength==0 && strlen(holder)==0){ printf("\n{}"); return; } setLengths[counter] = setLength+1; sets[counter] = (int*)malloc((1+setLength)*sizeof(int)); k = 0; start = 0; for(l=0;holder[l]!=00;l++){ if(holder[l+1]==' '||holder[l+1]==00){ holderToken = (char*)malloc((l+1-start)*sizeof(char)); strncpy(holderToken,holder + start,l+1-start); sets[counter][k++] = atoi(holderToken); start = l+2; } } counter++; token = strtok(NULL,"x"); } printf("\n{"); cartesianProduct(sets,setLengths,currentSet,numSets + 1,0); printf("\b}"); } int main(int argC,char* argV[]) { if(argC!=2) printf("Usage : %s <Set product expression enclosed in double quotes>",argV[0]); else processInputString(argV[1]); return 0; }
Ensure the translated C code behaves exactly like the original Go snippet.
package main import "math" import "fmt" func cube(x float64) float64 { return math.Pow(x, 3) } type ffType func(float64) float64 func compose(f, g ffType) ffType { return func(x float64) float64 { return f(g(x)) } } func main() { funclist := []ffType{math.Sin, math.Cos, cube} funclisti := []ffType{math.Asin, math.Acos, math.Cbrt} for i := 0; i < 3; i++ { fmt.Println(compose(funclisti[i], funclist[i])(.5)) } }
#include <stdlib.h> #include <stdio.h> #include <math.h> typedef double (*Class2Func)(double); double functionA( double v) { return v*v*v; } double functionB(double v) { return exp(log(v)/3); } double Function1( Class2Func f2, double val ) { return f2(val); } Class2Func WhichFunc( int idx) { return (idx < 4) ? &functionA : &functionB; } Class2Func funcListA[] = {&functionA, &sin, &cos, &tan }; Class2Func funcListB[] = {&functionB, &asin, &acos, &atan }; double InvokeComposed( Class2Func f1, Class2Func f2, double val ) { return f1(f2(val)); } typedef struct sComposition { Class2Func f1; Class2Func f2; } *Composition; Composition Compose( Class2Func f1, Class2Func f2) { Composition comp = malloc(sizeof(struct sComposition)); comp->f1 = f1; comp->f2 = f2; return comp; } double CallComposed( Composition comp, double val ) { return comp->f1( comp->f2(val) ); } int main(int argc, char *argv[]) { int ix; Composition c; printf("Function1(functionA, 3.0) = %f\n", Function1(WhichFunc(0), 3.0)); for (ix=0; ix<4; ix++) { c = Compose(funcListA[ix], funcListB[ix]); printf("Compostion %d(0.9) = %f\n", ix, CallComposed(c, 0.9)); } return 0; }
Write a version of this Go function in C with identical behavior.
package main import ( "fmt" "strconv" ) func listProperDivisors(limit int) { if limit < 1 { return } width := len(strconv.Itoa(limit)) for i := 1; i <= limit; i++ { fmt.Printf("%*d -> ", width, i) if i == 1 { fmt.Println("(None)") continue } for j := 1; j <= i/2; j++ { if i%j == 0 { fmt.Printf(" %d", j) } } fmt.Println() } } func countProperDivisors(n int) int { if n < 2 { return 0 } count := 0 for i := 1; i <= n/2; i++ { if n%i == 0 { count++ } } return count } func main() { fmt.Println("The proper divisors of the following numbers are :\n") listProperDivisors(10) fmt.Println() maxCount := 0 most := []int{1} for n := 2; n <= 20000; n++ { count := countProperDivisors(n) if count == maxCount { most = append(most, n) } else if count > maxCount { maxCount = count most = most[0:1] most[0] = n } } fmt.Print("The following number(s) <= 20000 have the most proper divisors, ") fmt.Println("namely", maxCount, "\b\n") for _, n := range most { fmt.Println(n) } }
#include <stdio.h> #include <stdbool.h> int proper_divisors(const int n, bool print_flag) { int count = 0; for (int i = 1; i < n; ++i) { if (n % i == 0) { count++; if (print_flag) printf("%d ", i); } } if (print_flag) printf("\n"); return count; } int main(void) { for (int i = 1; i <= 10; ++i) { printf("%d: ", i); proper_divisors(i, true); } int max = 0; int max_i = 1; for (int i = 1; i <= 20000; ++i) { int v = proper_divisors(i, false); if (v >= max) { max = v; max_i = i; } } printf("%d with %d divisors\n", max_i, max); return 0; }
Rewrite this program in C while keeping its functionality equivalent to the Go version.
package main import ( "encoding/xml" "fmt" ) func xRemarks(r CharacterRemarks) (string, error) { b, err := xml.MarshalIndent(r, "", " ") return string(b), err } type CharacterRemarks struct { Character []crm } type crm struct { Name string `xml:"name,attr"` Remark string `xml:",chardata"` } func main() { x, err := xRemarks(CharacterRemarks{[]crm{ {`April`, `Bubbly: I'm > Tam and <= Emily`}, {`Tam O'Shanter`, `Burns: "When chapman billies leave the street ..."`}, {`Emily`, `Short & shrift`}, }}) if err != nil { x = err.Error() } fmt.Println(x) }
#include <stdio.h> #include <stdlib.h> #include <string.h> #include <libxml/parser.h> #include <libxml/tree.h> const char *names[] = { "April", "Tam O'Shanter", "Emily", NULL }; const char *remarks[] = { "Bubbly: I'm > Tam and <= Emily", "Burns: \"When chapman billies leave the street ...\"", "Short & shrift", NULL }; int main() { xmlDoc *doc = NULL; xmlNode *root = NULL, *node; const char **next; int a; doc = xmlNewDoc("1.0"); root = xmlNewNode(NULL, "CharacterRemarks"); xmlDocSetRootElement(doc, root); for(next = names, a = 0; *next != NULL; next++, a++) { node = xmlNewNode(NULL, "Character"); (void)xmlNewProp(node, "name", *next); xmlAddChild(node, xmlNewText(remarks[a])); xmlAddChild(root, node); } xmlElemDump(stdout, doc, root); xmlFreeDoc(doc); xmlCleanupParser(); return EXIT_SUCCESS; }
Please provide an equivalent version of this Go code in C.
package main import ( "fmt" "log" "os/exec" ) var ( x = []int{0, 1, 2, 3, 4, 5, 6, 7, 8, 9} y = []float64{2.7, 2.8, 31.4, 38.1, 58.0, 76.2, 100.5, 130.0, 149.3, 180.0} ) func main() { g := exec.Command("gnuplot", "-persist") w, err := g.StdinPipe() if err != nil { log.Fatal(err) } if err = g.Start(); err != nil { log.Fatal(err) } fmt.Fprintln(w, "unset key; plot '-'") for i, xi := range x { fmt.Fprintf(w, "%d %f\n", xi, y[i]) } fmt.Fprintln(w, "e") w.Close() g.Wait() }
#include <stdio.h> #include <stdlib.h> #include <math.h> #include <plot.h> #define NP 10 double x[NP] = {0, 1, 2, 3, 4, 5, 6, 7, 8, 9}; double y[NP] = {2.7, 2.8, 31.4, 38.1, 58.0, 76.2, 100.5, 130.0, 149.3, 180.0}; void minmax(double *x, double *y, double *minx, double *maxx, double *miny, double *maxy, int n) { int i; *minx = *maxx = x[0]; *miny = *maxy = y[0]; for(i=1; i < n; i++) { if ( x[i] < *minx ) *minx = x[i]; if ( x[i] > *maxx ) *maxx = x[i]; if ( y[i] < *miny ) *miny = y[i]; if ( y[i] > *maxy ) *maxy = y[i]; } } #define YLAB_HEIGHT_F 0.1 #define XLAB_WIDTH_F 0.2 #define XDIV (NP*1.0) #define YDIV (NP*1.0) #define EXTRA_W 0.01 #define EXTRA_H 0.01 #define DOTSCALE (1.0/150.0) #define MAXLABLEN 32 #define PUSHSCALE(X,Y) pl_fscale((X),(Y)) #define POPSCALE(X,Y) pl_fscale(1.0/(X), 1.0/(Y)) #define FMOVESCALE(X,Y) pl_fmove((X)/sx, (Y)/sy) int main() { int plotter, i; double minx, miny, maxx, maxy; double lx, ly; double xticstep, yticstep, nx, ny; double sx, sy; char labs[MAXLABLEN+1]; plotter = pl_newpl("png", NULL, stdout, NULL); if ( plotter < 0 ) exit(1); pl_selectpl(plotter); if ( pl_openpl() < 0 ) exit(1); minmax(x, y, &minx, &maxx, &miny, &maxy, NP); lx = maxx - minx; ly = maxy - miny; pl_fspace(floor(minx) - XLAB_WIDTH_F * lx, floor(miny) - YLAB_HEIGHT_F * ly, ceil(maxx) + EXTRA_W * lx, ceil(maxy) + EXTRA_H * ly); xticstep = (ceil(maxx) - floor(minx)) / XDIV; yticstep = (ceil(maxy) - floor(miny)) / YDIV; pl_flinewidth(0.25); if ( lx < ly ) { sx = lx/ly; sy = 1.0; } else { sx = 1.0; sy = ly/lx; } pl_erase(); pl_fbox(floor(minx), floor(miny), ceil(maxx), ceil(maxy)); pl_fontname("HersheySerif"); for(ny=floor(miny); ny < ceil(maxy); ny += yticstep) { pl_fline(floor(minx), ny, ceil(maxx), ny); snprintf(labs, MAXLABLEN, "%6.2lf", ny); FMOVESCALE(floor(minx) - XLAB_WIDTH_F * lx, ny); PUSHSCALE(sx,sy); pl_label(labs); POPSCALE(sx,sy); } for(nx=floor(minx); nx < ceil(maxx); nx += xticstep) { pl_fline(nx, floor(miny), nx, ceil(maxy)); snprintf(labs, MAXLABLEN, "%6.2lf", nx); FMOVESCALE(nx, floor(miny)); PUSHSCALE(sx,sy); pl_ftextangle(-90); pl_alabel('l', 'b', labs); POPSCALE(sx,sy); } pl_fillcolorname("red"); pl_filltype(1); for(i=0; i < NP; i++) { pl_fbox(x[i] - lx * DOTSCALE, y[i] - ly * DOTSCALE, x[i] + lx * DOTSCALE, y[i] + ly * DOTSCALE); } pl_flushpl(); pl_closepl(); }
Rewrite the snippet below in C so it works the same as the original Go code.
package main import ( "fmt" "log" "os/exec" ) var ( x = []int{0, 1, 2, 3, 4, 5, 6, 7, 8, 9} y = []float64{2.7, 2.8, 31.4, 38.1, 58.0, 76.2, 100.5, 130.0, 149.3, 180.0} ) func main() { g := exec.Command("gnuplot", "-persist") w, err := g.StdinPipe() if err != nil { log.Fatal(err) } if err = g.Start(); err != nil { log.Fatal(err) } fmt.Fprintln(w, "unset key; plot '-'") for i, xi := range x { fmt.Fprintf(w, "%d %f\n", xi, y[i]) } fmt.Fprintln(w, "e") w.Close() g.Wait() }
#include <stdio.h> #include <stdlib.h> #include <math.h> #include <plot.h> #define NP 10 double x[NP] = {0, 1, 2, 3, 4, 5, 6, 7, 8, 9}; double y[NP] = {2.7, 2.8, 31.4, 38.1, 58.0, 76.2, 100.5, 130.0, 149.3, 180.0}; void minmax(double *x, double *y, double *minx, double *maxx, double *miny, double *maxy, int n) { int i; *minx = *maxx = x[0]; *miny = *maxy = y[0]; for(i=1; i < n; i++) { if ( x[i] < *minx ) *minx = x[i]; if ( x[i] > *maxx ) *maxx = x[i]; if ( y[i] < *miny ) *miny = y[i]; if ( y[i] > *maxy ) *maxy = y[i]; } } #define YLAB_HEIGHT_F 0.1 #define XLAB_WIDTH_F 0.2 #define XDIV (NP*1.0) #define YDIV (NP*1.0) #define EXTRA_W 0.01 #define EXTRA_H 0.01 #define DOTSCALE (1.0/150.0) #define MAXLABLEN 32 #define PUSHSCALE(X,Y) pl_fscale((X),(Y)) #define POPSCALE(X,Y) pl_fscale(1.0/(X), 1.0/(Y)) #define FMOVESCALE(X,Y) pl_fmove((X)/sx, (Y)/sy) int main() { int plotter, i; double minx, miny, maxx, maxy; double lx, ly; double xticstep, yticstep, nx, ny; double sx, sy; char labs[MAXLABLEN+1]; plotter = pl_newpl("png", NULL, stdout, NULL); if ( plotter < 0 ) exit(1); pl_selectpl(plotter); if ( pl_openpl() < 0 ) exit(1); minmax(x, y, &minx, &maxx, &miny, &maxy, NP); lx = maxx - minx; ly = maxy - miny; pl_fspace(floor(minx) - XLAB_WIDTH_F * lx, floor(miny) - YLAB_HEIGHT_F * ly, ceil(maxx) + EXTRA_W * lx, ceil(maxy) + EXTRA_H * ly); xticstep = (ceil(maxx) - floor(minx)) / XDIV; yticstep = (ceil(maxy) - floor(miny)) / YDIV; pl_flinewidth(0.25); if ( lx < ly ) { sx = lx/ly; sy = 1.0; } else { sx = 1.0; sy = ly/lx; } pl_erase(); pl_fbox(floor(minx), floor(miny), ceil(maxx), ceil(maxy)); pl_fontname("HersheySerif"); for(ny=floor(miny); ny < ceil(maxy); ny += yticstep) { pl_fline(floor(minx), ny, ceil(maxx), ny); snprintf(labs, MAXLABLEN, "%6.2lf", ny); FMOVESCALE(floor(minx) - XLAB_WIDTH_F * lx, ny); PUSHSCALE(sx,sy); pl_label(labs); POPSCALE(sx,sy); } for(nx=floor(minx); nx < ceil(maxx); nx += xticstep) { pl_fline(nx, floor(miny), nx, ceil(maxy)); snprintf(labs, MAXLABLEN, "%6.2lf", nx); FMOVESCALE(nx, floor(miny)); PUSHSCALE(sx,sy); pl_ftextangle(-90); pl_alabel('l', 'b', labs); POPSCALE(sx,sy); } pl_fillcolorname("red"); pl_filltype(1); for(i=0; i < NP; i++) { pl_fbox(x[i] - lx * DOTSCALE, y[i] - ly * DOTSCALE, x[i] + lx * DOTSCALE, y[i] + ly * DOTSCALE); } pl_flushpl(); pl_closepl(); }
Transform the following Go implementation into C, maintaining the same output and logic.
package main import "fmt" import "regexp" func main() { str := "I am the original string" matched, _ := regexp.MatchString(".*string$", str) if matched { fmt.Println("ends with 'string'") } pattern := regexp.MustCompile("original") result := pattern.ReplaceAllString(str, "modified") fmt.Println(result) }
#include <stdio.h> #include <stdlib.h> #include <sys/types.h> #include <regex.h> #include <string.h> int main() { regex_t preg; regmatch_t substmatch[1]; const char *tp = "string$"; const char *t1 = "this is a matching string"; const char *t2 = "this is not a matching string!"; const char *ss = "istyfied"; regcomp(&preg, "string$", REG_EXTENDED); printf("'%s' %smatched with '%s'\n", t1, (regexec(&preg, t1, 0, NULL, 0)==0) ? "" : "did not ", tp); printf("'%s' %smatched with '%s'\n", t2, (regexec(&preg, t2, 0, NULL, 0)==0) ? "" : "did not ", tp); regfree(&preg); regcomp(&preg, "a[a-z]+", REG_EXTENDED); if ( regexec(&preg, t1, 1, substmatch, 0) == 0 ) { char *ns = malloc(substmatch[0].rm_so + 1 + strlen(ss) + (strlen(t1) - substmatch[0].rm_eo) + 2); memcpy(ns, t1, substmatch[0].rm_so+1); memcpy(&ns[substmatch[0].rm_so], ss, strlen(ss)); memcpy(&ns[substmatch[0].rm_so+strlen(ss)], &t1[substmatch[0].rm_eo], strlen(&t1[substmatch[0].rm_eo])); ns[ substmatch[0].rm_so + strlen(ss) + strlen(&t1[substmatch[0].rm_eo]) ] = 0; printf("mod string: '%s'\n", ns); free(ns); } else { printf("the string '%s' is the same: no matching!\n", t1); } regfree(&preg); return 0; }
Translate the given Go code snippet into C without altering its behavior.
package main import ( "fmt" "sort" ) func main() { lower, upper := 0, 100 fmt.Printf(`Instructions: Think of integer number from %d (inclusive) to %d (exclusive) and I will guess it. After each guess, I will ask you if it is less than or equal to some number, and you will respond with "yes" or "no". `, lower, upper) answer := sort.Search(upper-lower, func (i int) bool { fmt.Printf("Is your number less than or equal to %d? ", lower+i) s := "" fmt.Scanf("%s", &s) return s != "" && s[0] == 'y' }) fmt.Printf("Your number is %d.\n", lower+answer) }
#include <stdio.h> int main(){ int bounds[ 2 ] = {1, 100}; char input[ 2 ] = " "; int choice = (bounds[ 0 ] + bounds[ 1 ]) / 2; printf( "Choose a number between %d and %d.\n", bounds[ 0 ], bounds[ 1 ] ); do{ switch( input[ 0 ] ){ case 'H': bounds[ 1 ] = choice; break; case 'L': bounds[ 0 ] = choice; break; case 'Y': printf( "\nAwwwright\n" ); return 0; } choice = (bounds[ 0 ] + bounds[ 1 ]) / 2; printf( "Is the number %d? (Y/H/L) ", choice ); }while( scanf( "%1s", input ) == 1 ); return 0; }
Preserve the algorithm and functionality while converting the code from Go to C.
package main import "fmt" func main() { keys := []string{"a", "b", "c"} vals := []int{1, 2, 3} hash := map[string]int{} for i, key := range keys { hash[key] = vals[i] } fmt.Println(hash) }
#include <stdio.h> #include <stdlib.h> #include <string.h> #define KeyType const char * #define ValType int #define HASH_SIZE 4096 unsigned strhashkey( const char * key, int max) { unsigned h=0; unsigned hl, hr; while(*key) { h += *key; hl= 0x5C5 ^ (h&0xfff00000 )>>18; hr =(h&0x000fffff ); h = hl ^ hr ^ *key++; } return h % max; } typedef struct sHme { KeyType key; ValType value; struct sHme *link; } *MapEntry; typedef struct he { MapEntry first, last; } HashElement; HashElement hash[HASH_SIZE]; typedef void (*KeyCopyF)(KeyType *kdest, KeyType ksrc); typedef void (*ValCopyF)(ValType *vdest, ValType vsrc); typedef unsigned (*KeyHashF)( KeyType key, int upperBound ); typedef int (*KeyCmprF)(KeyType key1, KeyType key2); void HashAddH( KeyType key, ValType value, KeyCopyF copyKey, ValCopyF copyVal, KeyHashF hashKey, KeyCmprF keySame ) { unsigned hix = (*hashKey)(key, HASH_SIZE); MapEntry m_ent; for (m_ent= hash[hix].first; m_ent && !(*keySame)(m_ent->key,key); m_ent=m_ent->link); if (m_ent) { (*copyVal)(&m_ent->value, value); } else { MapEntry last; MapEntry hme = malloc(sizeof(struct sHme)); (*copyKey)(&hme->key, key); (*copyVal)(&hme->value, value); hme->link = NULL; last = hash[hix].last; if (last) { last->link = hme; } else hash[hix].first = hme; hash[hix].last = hme; } } int HashGetH(ValType *val, KeyType key, KeyHashF hashKey, KeyCmprF keySame ) { unsigned hix = (*hashKey)(key, HASH_SIZE); MapEntry m_ent; for (m_ent= hash[hix].first; m_ent && !(*keySame)(m_ent->key,key); m_ent=m_ent->link); if (m_ent) { *val = m_ent->value; } return (m_ent != NULL); } void copyStr(const char**dest, const char *src) { *dest = strdup(src); } void copyInt( int *dest, int src) { *dest = src; } int strCompare( const char *key1, const char *key2) { return strcmp(key1, key2) == 0; } void HashAdd( KeyType key, ValType value ) { HashAddH( key, value, &copyStr, &copyInt, &strhashkey, &strCompare); } int HashGet(ValType *val, KeyType key) { return HashGetH( val, key, &strhashkey, &strCompare); } int main() { static const char * keyList[] = {"red","orange","yellow","green", "blue", "violet" }; static int valuList[] = {1,43,640, 747, 42, 42}; int ix; for (ix=0; ix<6; ix++) { HashAdd(keyList[ix], valuList[ix]); } return 0; }
Port the provided Go code into C while preserving the original functionality.
package main import ( "fmt" "sort" ) func getBins(limits, data []int) []int { n := len(limits) bins := make([]int, n+1) for _, d := range data { index := sort.SearchInts(limits, d) if index < len(limits) && d == limits[index] { index++ } bins[index]++ } return bins } func printBins(limits, bins []int) { n := len(limits) fmt.Printf(" < %3d = %2d\n", limits[0], bins[0]) for i := 1; i < n; i++ { fmt.Printf(">= %3d and < %3d = %2d\n", limits[i-1], limits[i], bins[i]) } fmt.Printf(">= %3d = %2d\n", limits[n-1], bins[n]) fmt.Println() } func main() { limitsList := [][]int{ {23, 37, 43, 53, 67, 83}, {14, 18, 249, 312, 389, 392, 513, 591, 634, 720}, } dataList := [][]int{ { 95, 21, 94, 12, 99, 4, 70, 75, 83, 93, 52, 80, 57, 5, 53, 86, 65, 17, 92, 83, 71, 61, 54, 58, 47, 16, 8, 9, 32, 84, 7, 87, 46, 19, 30, 37, 96, 6, 98, 40, 79, 97, 45, 64, 60, 29, 49, 36, 43, 55, }, { 445, 814, 519, 697, 700, 130, 255, 889, 481, 122, 932, 77, 323, 525, 570, 219, 367, 523, 442, 933, 416, 589, 930, 373, 202, 253, 775, 47, 731, 685, 293, 126, 133, 450, 545, 100, 741, 583, 763, 306, 655, 267, 248, 477, 549, 238, 62, 678, 98, 534, 622, 907, 406, 714, 184, 391, 913, 42, 560, 247, 346, 860, 56, 138, 546, 38, 985, 948, 58, 213, 799, 319, 390, 634, 458, 945, 733, 507, 916, 123, 345, 110, 720, 917, 313, 845, 426, 9, 457, 628, 410, 723, 354, 895, 881, 953, 677, 137, 397, 97, 854, 740, 83, 216, 421, 94, 517, 479, 292, 963, 376, 981, 480, 39, 257, 272, 157, 5, 316, 395, 787, 942, 456, 242, 759, 898, 576, 67, 298, 425, 894, 435, 831, 241, 989, 614, 987, 770, 384, 692, 698, 765, 331, 487, 251, 600, 879, 342, 982, 527, 736, 795, 585, 40, 54, 901, 408, 359, 577, 237, 605, 847, 353, 968, 832, 205, 838, 427, 876, 959, 686, 646, 835, 127, 621, 892, 443, 198, 988, 791, 466, 23, 707, 467, 33, 670, 921, 180, 991, 396, 160, 436, 717, 918, 8, 374, 101, 684, 727, 749, }, } for i := 0; i < len(limitsList); i++ { fmt.Println("Example", i+1, "\b\n") bins := getBins(limitsList[i], dataList[i]) printBins(limitsList[i], bins) } }
#include <stdio.h> #include <stdlib.h> size_t upper_bound(const int* array, size_t n, int value) { size_t start = 0; while (n > 0) { size_t step = n / 2; size_t index = start + step; if (value >= array[index]) { start = index + 1; n -= step + 1; } else { n = step; } } return start; } int* bins(const int* limits, size_t nlimits, const int* data, size_t ndata) { int* result = calloc(nlimits + 1, sizeof(int)); if (result == NULL) return NULL; for (size_t i = 0; i < ndata; ++i) ++result[upper_bound(limits, nlimits, data[i])]; return result; } void print_bins(const int* limits, size_t n, const int* bins) { if (n == 0) return; printf(" < %3d: %2d\n", limits[0], bins[0]); for (size_t i = 1; i < n; ++i) printf(">= %3d and < %3d: %2d\n", limits[i - 1], limits[i], bins[i]); printf(">= %3d  : %2d\n", limits[n - 1], bins[n]); } int main() { const int limits1[] = {23, 37, 43, 53, 67, 83}; const int data1[] = {95, 21, 94, 12, 99, 4, 70, 75, 83, 93, 52, 80, 57, 5, 53, 86, 65, 17, 92, 83, 71, 61, 54, 58, 47, 16, 8, 9, 32, 84, 7, 87, 46, 19, 30, 37, 96, 6, 98, 40, 79, 97, 45, 64, 60, 29, 49, 36, 43, 55}; printf("Example 1:\n"); size_t n = sizeof(limits1) / sizeof(int); int* b = bins(limits1, n, data1, sizeof(data1) / sizeof(int)); if (b == NULL) { fprintf(stderr, "Out of memory\n"); return EXIT_FAILURE; } print_bins(limits1, n, b); free(b); const int limits2[] = {14, 18, 249, 312, 389, 392, 513, 591, 634, 720}; const int data2[] = { 445, 814, 519, 697, 700, 130, 255, 889, 481, 122, 932, 77, 323, 525, 570, 219, 367, 523, 442, 933, 416, 589, 930, 373, 202, 253, 775, 47, 731, 685, 293, 126, 133, 450, 545, 100, 741, 583, 763, 306, 655, 267, 248, 477, 549, 238, 62, 678, 98, 534, 622, 907, 406, 714, 184, 391, 913, 42, 560, 247, 346, 860, 56, 138, 546, 38, 985, 948, 58, 213, 799, 319, 390, 634, 458, 945, 733, 507, 916, 123, 345, 110, 720, 917, 313, 845, 426, 9, 457, 628, 410, 723, 354, 895, 881, 953, 677, 137, 397, 97, 854, 740, 83, 216, 421, 94, 517, 479, 292, 963, 376, 981, 480, 39, 257, 272, 157, 5, 316, 395, 787, 942, 456, 242, 759, 898, 576, 67, 298, 425, 894, 435, 831, 241, 989, 614, 987, 770, 384, 692, 698, 765, 331, 487, 251, 600, 879, 342, 982, 527, 736, 795, 585, 40, 54, 901, 408, 359, 577, 237, 605, 847, 353, 968, 832, 205, 838, 427, 876, 959, 686, 646, 835, 127, 621, 892, 443, 198, 988, 791, 466, 23, 707, 467, 33, 670, 921, 180, 991, 396, 160, 436, 717, 918, 8, 374, 101, 684, 727, 749}; printf("\nExample 2:\n"); n = sizeof(limits2) / sizeof(int); b = bins(limits2, n, data2, sizeof(data2) / sizeof(int)); if (b == NULL) { fprintf(stderr, "Out of memory\n"); return EXIT_FAILURE; } print_bins(limits2, n, b); free(b); return EXIT_SUCCESS; }
Produce a language-to-language conversion: from Go to C, same semantics.
package main import ( "fmt" "sort" ) func getBins(limits, data []int) []int { n := len(limits) bins := make([]int, n+1) for _, d := range data { index := sort.SearchInts(limits, d) if index < len(limits) && d == limits[index] { index++ } bins[index]++ } return bins } func printBins(limits, bins []int) { n := len(limits) fmt.Printf(" < %3d = %2d\n", limits[0], bins[0]) for i := 1; i < n; i++ { fmt.Printf(">= %3d and < %3d = %2d\n", limits[i-1], limits[i], bins[i]) } fmt.Printf(">= %3d = %2d\n", limits[n-1], bins[n]) fmt.Println() } func main() { limitsList := [][]int{ {23, 37, 43, 53, 67, 83}, {14, 18, 249, 312, 389, 392, 513, 591, 634, 720}, } dataList := [][]int{ { 95, 21, 94, 12, 99, 4, 70, 75, 83, 93, 52, 80, 57, 5, 53, 86, 65, 17, 92, 83, 71, 61, 54, 58, 47, 16, 8, 9, 32, 84, 7, 87, 46, 19, 30, 37, 96, 6, 98, 40, 79, 97, 45, 64, 60, 29, 49, 36, 43, 55, }, { 445, 814, 519, 697, 700, 130, 255, 889, 481, 122, 932, 77, 323, 525, 570, 219, 367, 523, 442, 933, 416, 589, 930, 373, 202, 253, 775, 47, 731, 685, 293, 126, 133, 450, 545, 100, 741, 583, 763, 306, 655, 267, 248, 477, 549, 238, 62, 678, 98, 534, 622, 907, 406, 714, 184, 391, 913, 42, 560, 247, 346, 860, 56, 138, 546, 38, 985, 948, 58, 213, 799, 319, 390, 634, 458, 945, 733, 507, 916, 123, 345, 110, 720, 917, 313, 845, 426, 9, 457, 628, 410, 723, 354, 895, 881, 953, 677, 137, 397, 97, 854, 740, 83, 216, 421, 94, 517, 479, 292, 963, 376, 981, 480, 39, 257, 272, 157, 5, 316, 395, 787, 942, 456, 242, 759, 898, 576, 67, 298, 425, 894, 435, 831, 241, 989, 614, 987, 770, 384, 692, 698, 765, 331, 487, 251, 600, 879, 342, 982, 527, 736, 795, 585, 40, 54, 901, 408, 359, 577, 237, 605, 847, 353, 968, 832, 205, 838, 427, 876, 959, 686, 646, 835, 127, 621, 892, 443, 198, 988, 791, 466, 23, 707, 467, 33, 670, 921, 180, 991, 396, 160, 436, 717, 918, 8, 374, 101, 684, 727, 749, }, } for i := 0; i < len(limitsList); i++ { fmt.Println("Example", i+1, "\b\n") bins := getBins(limitsList[i], dataList[i]) printBins(limitsList[i], bins) } }
#include <stdio.h> #include <stdlib.h> size_t upper_bound(const int* array, size_t n, int value) { size_t start = 0; while (n > 0) { size_t step = n / 2; size_t index = start + step; if (value >= array[index]) { start = index + 1; n -= step + 1; } else { n = step; } } return start; } int* bins(const int* limits, size_t nlimits, const int* data, size_t ndata) { int* result = calloc(nlimits + 1, sizeof(int)); if (result == NULL) return NULL; for (size_t i = 0; i < ndata; ++i) ++result[upper_bound(limits, nlimits, data[i])]; return result; } void print_bins(const int* limits, size_t n, const int* bins) { if (n == 0) return; printf(" < %3d: %2d\n", limits[0], bins[0]); for (size_t i = 1; i < n; ++i) printf(">= %3d and < %3d: %2d\n", limits[i - 1], limits[i], bins[i]); printf(">= %3d  : %2d\n", limits[n - 1], bins[n]); } int main() { const int limits1[] = {23, 37, 43, 53, 67, 83}; const int data1[] = {95, 21, 94, 12, 99, 4, 70, 75, 83, 93, 52, 80, 57, 5, 53, 86, 65, 17, 92, 83, 71, 61, 54, 58, 47, 16, 8, 9, 32, 84, 7, 87, 46, 19, 30, 37, 96, 6, 98, 40, 79, 97, 45, 64, 60, 29, 49, 36, 43, 55}; printf("Example 1:\n"); size_t n = sizeof(limits1) / sizeof(int); int* b = bins(limits1, n, data1, sizeof(data1) / sizeof(int)); if (b == NULL) { fprintf(stderr, "Out of memory\n"); return EXIT_FAILURE; } print_bins(limits1, n, b); free(b); const int limits2[] = {14, 18, 249, 312, 389, 392, 513, 591, 634, 720}; const int data2[] = { 445, 814, 519, 697, 700, 130, 255, 889, 481, 122, 932, 77, 323, 525, 570, 219, 367, 523, 442, 933, 416, 589, 930, 373, 202, 253, 775, 47, 731, 685, 293, 126, 133, 450, 545, 100, 741, 583, 763, 306, 655, 267, 248, 477, 549, 238, 62, 678, 98, 534, 622, 907, 406, 714, 184, 391, 913, 42, 560, 247, 346, 860, 56, 138, 546, 38, 985, 948, 58, 213, 799, 319, 390, 634, 458, 945, 733, 507, 916, 123, 345, 110, 720, 917, 313, 845, 426, 9, 457, 628, 410, 723, 354, 895, 881, 953, 677, 137, 397, 97, 854, 740, 83, 216, 421, 94, 517, 479, 292, 963, 376, 981, 480, 39, 257, 272, 157, 5, 316, 395, 787, 942, 456, 242, 759, 898, 576, 67, 298, 425, 894, 435, 831, 241, 989, 614, 987, 770, 384, 692, 698, 765, 331, 487, 251, 600, 879, 342, 982, 527, 736, 795, 585, 40, 54, 901, 408, 359, 577, 237, 605, 847, 353, 968, 832, 205, 838, 427, 876, 959, 686, 646, 835, 127, 621, 892, 443, 198, 988, 791, 466, 23, 707, 467, 33, 670, 921, 180, 991, 396, 160, 436, 717, 918, 8, 374, 101, 684, 727, 749}; printf("\nExample 2:\n"); n = sizeof(limits2) / sizeof(int); b = bins(limits2, n, data2, sizeof(data2) / sizeof(int)); if (b == NULL) { fprintf(stderr, "Out of memory\n"); return EXIT_FAILURE; } print_bins(limits2, n, b); free(b); return EXIT_SUCCESS; }
Preserve the algorithm and functionality while converting the code from Go to C.
package main import ( "math" "raster" ) const ( width = 400 height = 300 depth = 8 angle = 12 length = 50 frac = .8 ) func main() { g := raster.NewGrmap(width, height) ftree(g, width/2, height*9/10, length, 0, depth) g.Bitmap().WritePpmFile("ftree.ppm") } func ftree(g *raster.Grmap, x, y, distance, direction float64, depth int) { x2 := x + distance*math.Sin(direction*math.Pi/180) y2 := y - distance*math.Cos(direction*math.Pi/180) g.AaLine(x, y, x2, y2) if depth > 0 { ftree(g, x2, y2, distance*frac, direction-angle, depth-1) ftree(g, x2, y2, distance*frac, direction+angle, depth-1) } }
#include <SDL/SDL.h> #ifdef WITH_CAIRO #include <cairo.h> #else #include <SDL/sge.h> #endif #include <cairo.h> #include <stdlib.h> #include <time.h> #include <math.h> #ifdef WITH_CAIRO #define PI 3.1415926535 #endif #define SIZE 800 #define SCALE 5 #define BRANCHES 14 #define ROTATION_SCALE 0.75 #define INITIAL_LENGTH 50 double rand_fl(){ return (double)rand() / (double)RAND_MAX; } void draw_tree(SDL_Surface * surface, double offsetx, double offsety, double directionx, double directiony, double size, double rotation, int depth) { #ifdef WITH_CAIRO cairo_surface_t *surf = cairo_image_surface_create_for_data( surface->pixels, CAIRO_FORMAT_RGB24, surface->w, surface->h, surface->pitch ); cairo_t *ct = cairo_create(surf); cairo_set_line_width(ct, 1); cairo_set_source_rgba(ct, 0,0,0,1); cairo_move_to(ct, (int)offsetx, (int)offsety); cairo_line_to(ct, (int)(offsetx + directionx * size), (int)(offsety + directiony * size)); cairo_stroke(ct); #else sge_AALine(surface, (int)offsetx, (int)offsety, (int)(offsetx + directionx * size), (int)(offsety + directiony * size), SDL_MapRGB(surface->format, 0, 0, 0)); #endif if (depth > 0){ draw_tree(surface, offsetx + directionx * size, offsety + directiony * size, directionx * cos(rotation) + directiony * sin(rotation), directionx * -sin(rotation) + directiony * cos(rotation), size * rand_fl() / SCALE + size * (SCALE - 1) / SCALE, rotation * ROTATION_SCALE, depth - 1); draw_tree(surface, offsetx + directionx * size, offsety + directiony * size, directionx * cos(-rotation) + directiony * sin(-rotation), directionx * -sin(-rotation) + directiony * cos(-rotation), size * rand_fl() / SCALE + size * (SCALE - 1) / SCALE, rotation * ROTATION_SCALE, depth - 1); } } void render(SDL_Surface * surface){ SDL_FillRect(surface, NULL, SDL_MapRGB(surface->format, 255, 255, 255)); draw_tree(surface, surface->w / 2.0, surface->h - 10.0, 0.0, -1.0, INITIAL_LENGTH, PI / 8, BRANCHES); SDL_UpdateRect(surface, 0, 0, 0, 0); } int main(){ SDL_Surface * screen; SDL_Event evt; SDL_Init(SDL_INIT_VIDEO); srand((unsigned)time(NULL)); screen = SDL_SetVideoMode(SIZE, SIZE, 32, SDL_HWSURFACE); render(screen); while(1){ if (SDL_PollEvent(&evt)){ if(evt.type == SDL_QUIT) break; } SDL_Delay(1); } SDL_Quit(); return 0; }
Preserve the algorithm and functionality while converting the code from Go to C.
package main import "github.com/fogleman/gg" var palette = [8]string{ "000000", "FF0000", "00FF00", "0000FF", "FF00FF", "00FFFF", "FFFF00", "FFFFFF", } func pinstripe(dc *gg.Context) { w := dc.Width() h := dc.Height() / 4 for b := 1; b <= 4; b++ { for x, ci := 0, 0; x < w; x, ci = x+b, ci+1 { dc.SetHexColor(palette[ci%8]) y := h * (b - 1) dc.DrawRectangle(float64(x), float64(y), float64(b), float64(h)) dc.Fill() } } } func main() { dc := gg.NewContext(900, 600) pinstripe(dc) dc.SavePNG("color_pinstripe.png") }
#include<graphics.h> #include<conio.h> #define sections 4 int main() { int d=DETECT,m,maxX,maxY,x,y,colour=0,increment=1; initgraph(&d,&m,"c:/turboc3/bgi"); maxX = getmaxx(); maxY = getmaxy(); for(y=0;y<maxY;y+=maxY/sections) { for(x=0;x<maxX;x+=increment) { setfillstyle(SOLID_FILL,(colour++)%16); bar(x,y,x+increment,y+maxY/sections); } increment++; colour = 0; } getch(); closegraph(); return 0; }
Can you help me rewrite this code in C instead of Go, keeping it the same logically?
package main import ( "fmt" "strconv" ) var days = []string{"Sunday", "Monday", "Tuesday", "Wednesday", "Thursday", "Friday", "Saturday"} func anchorDay(y int) int { return (2 + 5*(y%4) + 4*(y%100) + 6*(y%400)) % 7 } func isLeapYear(y int) bool { return y%4 == 0 && (y%100 != 0 || y%400 == 0) } var firstDaysCommon = []int{3, 7, 7, 4, 2, 6, 4, 1, 5, 3, 7, 5} var firstDaysLeap = []int{4, 1, 7, 4, 2, 6, 4, 1, 5, 3, 7, 5} func main() { dates := []string{ "1800-01-06", "1875-03-29", "1915-12-07", "1970-12-23", "2043-05-14", "2077-02-12", "2101-04-02", } fmt.Println("Days of week given by Doomsday rule:") for _, date := range dates { y, _ := strconv.Atoi(date[0:4]) m, _ := strconv.Atoi(date[5:7]) m-- d, _ := strconv.Atoi(date[8:10]) a := anchorDay(y) f := firstDaysCommon[m] if isLeapYear(y) { f = firstDaysLeap[m] } w := d - f if w < 0 { w = 7 + w } dow := (a + w) % 7 fmt.Printf("%s -> %s\n", date, days[dow]) } }
#include <stdio.h> #include <stdint.h> #include <stdbool.h> typedef struct { uint16_t year; uint8_t month; uint8_t day; } Date; bool leap(uint16_t year) { return year%4==0 && (year%100!=0 || year%400==0); } const char *weekday(Date date) { static const uint8_t leapdoom[] = {4,1,7,2,4,6,4,1,5,3,7,5}; static const uint8_t normdoom[] = {3,7,7,4,2,6,4,1,5,3,7,5}; static const char *days[] = { "Sunday", "Monday", "Tuesday", "Wednesday", "Thursday", "Friday", "Saturday" }; unsigned c = date.year/100, r = date.year%100; unsigned s = r/12, t = r%12; unsigned c_anchor = (5 * (c%4) + 2) % 7; unsigned doom = (s + t + (t/4) + c_anchor) % 7; unsigned anchor = (leap(date.year) ? leapdoom : normdoom)[date.month-1]; return days[(doom+date.day-anchor+7)%7]; } int main(void) { const char *past = "was", *future = "will be"; const char *months[] = { "", "January", "February", "March", "April", "May", "June", "July", "August", "September", "October", "November", "December" }; const Date dates[] = { {1800,1,6}, {1875,3,29}, {1915,12,7}, {1970,12,23}, {2043,5,14}, {2077,2,12}, {2101,4,2} }; int i; for (i=0; i < sizeof(dates)/sizeof(Date); i++) { printf("%s %d, %d %s on a %s.\n", months[dates[i].month], dates[i].day, dates[i].year, dates[i].year > 2021 ? future : past, weekday(dates[i])); } return 0; }
Write the same code in C as shown below in Go.
package main import ( "fmt" "strconv" ) var days = []string{"Sunday", "Monday", "Tuesday", "Wednesday", "Thursday", "Friday", "Saturday"} func anchorDay(y int) int { return (2 + 5*(y%4) + 4*(y%100) + 6*(y%400)) % 7 } func isLeapYear(y int) bool { return y%4 == 0 && (y%100 != 0 || y%400 == 0) } var firstDaysCommon = []int{3, 7, 7, 4, 2, 6, 4, 1, 5, 3, 7, 5} var firstDaysLeap = []int{4, 1, 7, 4, 2, 6, 4, 1, 5, 3, 7, 5} func main() { dates := []string{ "1800-01-06", "1875-03-29", "1915-12-07", "1970-12-23", "2043-05-14", "2077-02-12", "2101-04-02", } fmt.Println("Days of week given by Doomsday rule:") for _, date := range dates { y, _ := strconv.Atoi(date[0:4]) m, _ := strconv.Atoi(date[5:7]) m-- d, _ := strconv.Atoi(date[8:10]) a := anchorDay(y) f := firstDaysCommon[m] if isLeapYear(y) { f = firstDaysLeap[m] } w := d - f if w < 0 { w = 7 + w } dow := (a + w) % 7 fmt.Printf("%s -> %s\n", date, days[dow]) } }
#include <stdio.h> #include <stdint.h> #include <stdbool.h> typedef struct { uint16_t year; uint8_t month; uint8_t day; } Date; bool leap(uint16_t year) { return year%4==0 && (year%100!=0 || year%400==0); } const char *weekday(Date date) { static const uint8_t leapdoom[] = {4,1,7,2,4,6,4,1,5,3,7,5}; static const uint8_t normdoom[] = {3,7,7,4,2,6,4,1,5,3,7,5}; static const char *days[] = { "Sunday", "Monday", "Tuesday", "Wednesday", "Thursday", "Friday", "Saturday" }; unsigned c = date.year/100, r = date.year%100; unsigned s = r/12, t = r%12; unsigned c_anchor = (5 * (c%4) + 2) % 7; unsigned doom = (s + t + (t/4) + c_anchor) % 7; unsigned anchor = (leap(date.year) ? leapdoom : normdoom)[date.month-1]; return days[(doom+date.day-anchor+7)%7]; } int main(void) { const char *past = "was", *future = "will be"; const char *months[] = { "", "January", "February", "March", "April", "May", "June", "July", "August", "September", "October", "November", "December" }; const Date dates[] = { {1800,1,6}, {1875,3,29}, {1915,12,7}, {1970,12,23}, {2043,5,14}, {2077,2,12}, {2101,4,2} }; int i; for (i=0; i < sizeof(dates)/sizeof(Date); i++) { printf("%s %d, %d %s on a %s.\n", months[dates[i].month], dates[i].day, dates[i].year, dates[i].year > 2021 ? future : past, weekday(dates[i])); } return 0; }
Generate an equivalent C version of this Go code.
package main import ( "fmt" "math/rand" "time" ) func cocktailShakerSort(a []int) { var begin = 0 var end = len(a) - 2 for begin <= end { newBegin := end newEnd := begin for i := begin; i <= end; i++ { if a[i] > a[i+1] { a[i+1], a[i] = a[i], a[i+1] newEnd = i } } end = newEnd - 1 for i := end; i >= begin; i-- { if a[i] > a[i+1] { a[i+1], a[i] = a[i], a[i+1] newBegin = i } } begin = newBegin + 1 } } func cocktailSort(a []int) { last := len(a) - 1 for { swapped := false for i := 0; i < last; i++ { if a[i] > a[i+1] { a[i], a[i+1] = a[i+1], a[i] swapped = true } } if !swapped { return } swapped = false for i := last - 1; i >= 0; i-- { if a[i] > a[i+1] { a[i], a[i+1] = a[i+1], a[i] swapped = true } } if !swapped { return } } } func main() { a := []int{21, 4, -9, 62, -7, 107, -62, 4, 0, -170} fmt.Println("Original array:", a) b := make([]int, len(a)) copy(b, a) cocktailSort(a) fmt.Println("Cocktail sort :", a) cocktailShakerSort(b) fmt.Println("C/Shaker sort :", b) rand.Seed(time.Now().UnixNano()) fmt.Println("\nRelative speed of the two sorts") fmt.Println(" N x faster (CSS v CS)") fmt.Println("----- -------------------") const runs = 10 for _, n := range []int{1000, 2000, 4000, 8000, 10000, 20000} { sum := 0.0 for i := 1; i <= runs; i++ { nums := make([]int, n) for i := 0; i < n; i++ { rn := rand.Intn(100000) if i%2 == 1 { rn = -rn } nums[i] = rn } nums2 := make([]int, n) copy(nums2, nums) start := time.Now() cocktailSort(nums) elapsed := time.Since(start) start2 := time.Now() cocktailShakerSort(nums2) elapsed2 := time.Since(start2) sum += float64(elapsed) / float64(elapsed2) } fmt.Printf(" %2dk %0.3f\n", n/1000, sum/runs) } }
#include <stdio.h> #include <string.h> void swap(char* p1, char* p2, size_t size) { for (; size-- > 0; ++p1, ++p2) { char tmp = *p1; *p1 = *p2; *p2 = tmp; } } void cocktail_shaker_sort(void* base, size_t count, size_t size, int (*cmp)(const void*, const void*)) { char* begin = base; char* end = base + size * count; if (end == begin) return; for (end -= size; begin < end; ) { char* new_begin = end; char* new_end = begin; for (char* p = begin; p < end; p += size) { char* q = p + size; if (cmp(p, q) > 0) { swap(p, q, size); new_end = p; } } end = new_end; for (char* p = end; p > begin; p -= size) { char* q = p - size; if (cmp(q, p) > 0) { swap(p, q, size); new_begin = p; } } begin = new_begin; } } int string_compare(const void* p1, const void* p2) { const char* const* s1 = p1; const char* const* s2 = p2; return strcmp(*s1, *s2); } void print(const char** a, size_t len) { for (size_t i = 0; i < len; ++i) printf("%s ", a[i]); printf("\n"); } int main() { const char* a[] = { "one", "two", "three", "four", "five", "six", "seven", "eight" }; const size_t len = sizeof(a)/sizeof(a[0]); printf("before: "); print(a, len); cocktail_shaker_sort(a, len, sizeof(char*), string_compare); printf("after: "); print(a, len); return 0; }
Generate a C translation of this Go snippet without changing its computational steps.
package main import ( "github.com/google/gxui" "github.com/google/gxui/drivers/gl" "github.com/google/gxui/math" "github.com/google/gxui/themes/dark" omath "math" "time" ) const ( ANIMATION_WIDTH int = 480 ANIMATION_HEIGHT int = 320 BALL_RADIUS float32 = 25.0 METER_PER_PIXEL float64 = 1.0 / 20.0 PHI_ZERO float64 = omath.Pi * 0.5 ) var ( l float64 = float64(ANIMATION_HEIGHT) * 0.5 freq float64 = omath.Sqrt(9.81 / (l * METER_PER_PIXEL)) ) type Pendulum interface { GetPhi() float64 } type mathematicalPendulum struct { start time.Time } func (p *mathematicalPendulum) GetPhi() float64 { if (p.start == time.Time{}) { p.start = time.Now() } t := float64(time.Since(p.start).Nanoseconds()) / omath.Pow10(9) return PHI_ZERO * omath.Cos(t*freq) } type numericalPendulum struct { currentPhi float64 angAcc float64 angVel float64 lastTime time.Time } func (p *numericalPendulum) GetPhi() float64 { dt := 0.0 if (p.lastTime != time.Time{}) { dt = float64(time.Since(p.lastTime).Nanoseconds()) / omath.Pow10(9) } p.lastTime = time.Now() p.angAcc = -9.81 / (float64(l) * METER_PER_PIXEL) * omath.Sin(p.currentPhi) p.angVel += p.angAcc * dt p.currentPhi += p.angVel * dt return p.currentPhi } func draw(p Pendulum, canvas gxui.Canvas, x, y int) { attachment := math.Point{X: ANIMATION_WIDTH/2 + x, Y: y} phi := p.GetPhi() ball := math.Point{X: x + ANIMATION_WIDTH/2 + math.Round(float32(l*omath.Sin(phi))), Y: y + math.Round(float32(l*omath.Cos(phi)))} line := gxui.Polygon{gxui.PolygonVertex{attachment, 0}, gxui.PolygonVertex{ball, 0}} canvas.DrawLines(line, gxui.DefaultPen) m := math.Point{int(BALL_RADIUS), int(BALL_RADIUS)} rect := math.Rect{ball.Sub(m), ball.Add(m)} canvas.DrawRoundedRect(rect, BALL_RADIUS, BALL_RADIUS, BALL_RADIUS, BALL_RADIUS, gxui.TransparentPen, gxui.CreateBrush(gxui.Yellow)) } func appMain(driver gxui.Driver) { theme := dark.CreateTheme(driver) window := theme.CreateWindow(ANIMATION_WIDTH, 2*ANIMATION_HEIGHT, "Pendulum") window.SetBackgroundBrush(gxui.CreateBrush(gxui.Gray50)) image := theme.CreateImage() ticker := time.NewTicker(time.Millisecond * 15) pendulum := &mathematicalPendulum{} pendulum2 := &numericalPendulum{PHI_ZERO, 0.0, 0.0, time.Time{}} go func() { for _ = range ticker.C { canvas := driver.CreateCanvas(math.Size{ANIMATION_WIDTH, 2 * ANIMATION_HEIGHT}) canvas.Clear(gxui.White) draw(pendulum, canvas, 0, 0) draw(pendulum2, canvas, 0, ANIMATION_HEIGHT) canvas.Complete() driver.Call(func() { image.SetCanvas(canvas) }) } }() window.AddChild(image) window.OnClose(ticker.Stop) window.OnClose(driver.Terminate) } func main() { gl.StartDriver(appMain) }
#include <stdlib.h> #include <math.h> #include <GL/glut.h> #include <GL/gl.h> #include <sys/time.h> #define length 5 #define g 9.8 double alpha, accl, omega = 0, E; struct timeval tv; double elappsed() { struct timeval now; gettimeofday(&now, 0); int ret = (now.tv_sec - tv.tv_sec) * 1000000 + now.tv_usec - tv.tv_usec; tv = now; return ret / 1.e6; } void resize(int w, int h) { glViewport(0, 0, w, h); glMatrixMode(GL_PROJECTION); glLoadIdentity(); glMatrixMode(GL_MODELVIEW); glLoadIdentity(); glOrtho(0, w, h, 0, -1, 1); } void render() { double x = 320 + 300 * sin(alpha), y = 300 * cos(alpha); resize(640, 320); glClear(GL_COLOR_BUFFER_BIT); glBegin(GL_LINES); glVertex2d(320, 0); glVertex2d(x, y); glEnd(); glFlush(); double us = elappsed(); alpha += (omega + us * accl / 2) * us; omega += accl * us; if (length * g * (1 - cos(alpha)) >= E) { alpha = (alpha < 0 ? -1 : 1) * acos(1 - E / length / g); omega = 0; } accl = -g / length * sin(alpha); } void init_gfx(int *c, char **v) { glutInit(c, v); glutInitDisplayMode(GLUT_RGB); glutInitWindowSize(640, 320); glutIdleFunc(render); glutCreateWindow("Pendulum"); } int main(int c, char **v) { alpha = 4 * atan2(1, 1) / 2.1; E = length * g * (1 - cos(alpha)); accl = -g / length * sin(alpha); omega = 0; gettimeofday(&tv, 0); init_gfx(&c, v); glutMainLoop(); return 0; }
Please provide an equivalent version of this Go code in C.
package main import "fmt" func enc(b int) int { return b ^ b>>1 } func dec(g int) (b int) { for ; g != 0; g >>= 1 { b ^= g } return } func main() { fmt.Println("decimal binary gray decoded") for b := 0; b < 32; b++ { g := enc(b) d := dec(g) fmt.Printf(" %2d %05b %05b %05b %2d\n", b, b, g, d, d) } }
int gray_encode(int n) { return n ^ (n >> 1); } int gray_decode(int n) { int p = n; while (n >>= 1) p ^= n; return p; }
Change the programming language of this snippet from Go to C without modifying what it does.
package main import "fmt" func enc(b int) int { return b ^ b>>1 } func dec(g int) (b int) { for ; g != 0; g >>= 1 { b ^= g } return } func main() { fmt.Println("decimal binary gray decoded") for b := 0; b < 32; b++ { g := enc(b) d := dec(g) fmt.Printf(" %2d %05b %05b %05b %2d\n", b, b, g, d, d) } }
int gray_encode(int n) { return n ^ (n >> 1); } int gray_decode(int n) { int p = n; while (n >>= 1) p ^= n; return p; }
Convert the following code from Go to C, ensuring the logic remains intact.
package main import ( "archive/tar" "compress/gzip" "flag" "io" "log" "os" "time" ) func main() { filename := flag.String("file", "TAPE.FILE", "filename within TAR") data := flag.String("data", "", "data for file") outfile := flag.String("out", "", "output file or device (e.g. /dev/tape)") gzipFlag := flag.Bool("gzip", false, "use gzip compression") flag.Parse() var w io.Writer = os.Stdout if *outfile != "" { f, err := os.Create(*outfile) if err != nil { log.Fatalf("opening/creating %q: %v", *outfile, err) } defer f.Close() w = f } if *gzipFlag { zw := gzip.NewWriter(w) defer zw.Close() w = zw } tw := tar.NewWriter(w) defer tw.Close() w = tw tw.WriteHeader(&tar.Header{ Name: *filename, Mode: 0660, Size: int64(len(*data)), ModTime: time.Now(), Typeflag: tar.TypeReg, Uname: "guest", Gname: "guest", }) _, err := w.Write([]byte(*data)) if err != nil { log.Fatal("writing data:", err) } }
#include<stdio.h> int main() { FILE* fp = fopen("TAPE.FILE","w"); fprintf(fp,"This code should be able to write a file to magnetic tape.\n"); fprintf(fp,"The Wikipedia page on Magnetic tape data storage shows that magnetic tapes are still in use.\n"); fprintf(fp,"In fact, the latest format, at the time of writing this code is TS1155 released in 2017.\n"); fprintf(fp,"And since C is already 44, maybe 45, years old in 2017, I am sure someone somewhere did use a C compiler on magnetic tapes.\n"); fprintf(fp,"If you happen to have one, please try to compile and execute me on that system.\n"); fprintf(fp,"My creator tested me on an i5 machine with SSD and RAM that couldn't have even been dreamt of by Denis Ritchie.\n"); fprintf(fp,"Who knows ? Maybe he did foresee today, after all he created something which is still young after 44-45 years and counting...\n"); fprintf(fp,"EOF"); fclose(fp); return 0; }
Change the following Go code into C without altering its purpose.
package main import ( "sort" "container/heap" "fmt" ) type HeapHelper struct { container sort.Interface length int } func (self HeapHelper) Len() int { return self.length } func (self HeapHelper) Less(i, j int) bool { return self.container.Less(j, i) } func (self HeapHelper) Swap(i, j int) { self.container.Swap(i, j) } func (self *HeapHelper) Push(x interface{}) { panic("impossible") } func (self *HeapHelper) Pop() interface{} { self.length-- return nil } func heapSort(a sort.Interface) { helper := HeapHelper{ a, a.Len() } heap.Init(&helper) for helper.length > 0 { heap.Pop(&helper) } } func main() { a := []int{170, 45, 75, -90, -802, 24, 2, 66} fmt.Println("before:", a) heapSort(sort.IntSlice(a)) fmt.Println("after: ", a) }
#include <stdio.h> int max (int *a, int n, int i, int j, int k) { int m = i; if (j < n && a[j] > a[m]) { m = j; } if (k < n && a[k] > a[m]) { m = k; } return m; } void downheap (int *a, int n, int i) { while (1) { int j = max(a, n, i, 2 * i + 1, 2 * i + 2); if (j == i) { break; } int t = a[i]; a[i] = a[j]; a[j] = t; i = j; } } void heapsort (int *a, int n) { int i; for (i = (n - 2) / 2; i >= 0; i--) { downheap(a, n, i); } for (i = 0; i < n; i++) { int t = a[n - i - 1]; a[n - i - 1] = a[0]; a[0] = t; downheap(a, n - i - 1, 0); } } int main () { int a[] = {4, 65, 2, -31, 0, 99, 2, 83, 782, 1}; int n = sizeof a / sizeof a[0]; int i; for (i = 0; i < n; i++) printf("%d%s", a[i], i == n - 1 ? "\n" : " "); heapsort(a, n); for (i = 0; i < n; i++) printf("%d%s", a[i], i == n - 1 ? "\n" : " "); return 0; }
Produce a language-to-language conversion: from Go to C, same semantics.
package cards import ( "math/rand" ) type Suit uint8 const ( Spade Suit = 3 Heart Suit = 2 Diamond Suit = 1 Club Suit = 0 ) func (s Suit) String() string { const suites = "CDHS" return suites[s : s+1] } type Rank uint8 const ( Ace Rank = 1 Two Rank = 2 Three Rank = 3 Four Rank = 4 Five Rank = 5 Six Rank = 6 Seven Rank = 7 Eight Rank = 8 Nine Rank = 9 Ten Rank = 10 Jack Rank = 11 Queen Rank = 12 King Rank = 13 ) func (r Rank) String() string { const ranks = "A23456789TJQK" return ranks[r-1 : r] } type Card uint8 func NewCard(r Rank, s Suit) Card { return Card(13*uint8(s) + uint8(r-1)) } func (c Card) RankSuit() (Rank, Suit) { return Rank(c%13 + 1), Suit(c / 13) } func (c Card) Rank() Rank { return Rank(c%13 + 1) } func (c Card) Suit() Suit { return Suit(c / 13) } func (c Card) String() string { return c.Rank().String() + c.Suit().String() } type Deck []Card func NewDeck() Deck { d := make(Deck, 52) for i := range d { d[i] = Card(i) } return d } func (d Deck) String() string { s := "" for i, c := range d { switch { case i == 0: case i%13 == 0: s += "\n" default: s += " " } s += c.String() } return s } func (d Deck) Shuffle() { for i := range d { j := rand.Intn(i + 1) d[i], d[j] = d[j], d[i] } } func (d Deck) Contains(tc Card) bool { for _, c := range d { if c == tc { return true } } return false } func (d *Deck) AddDeck(decks ...Deck) { for _, o := range decks { *d = append(*d, o...) } } func (d *Deck) AddCard(c Card) { *d = append(*d, c) } func (d *Deck) Draw(n int) Deck { old := *d *d = old[n:] return old[:n:n] } func (d *Deck) DrawCard() (Card, bool) { if len(*d) == 0 { return 0, false } old := *d *d = old[1:] return old[0], true } func (d *Deck) Deal(cards int, hands ...Deck) ([]Deck, bool) { for i := 0; i < cards; i++ { for j := range hands { if len(*d) == 0 { return hands, false } hands[j] = append(hands[j], (*d)[0]) *d = (*d)[1:] } } return hands, true }
#include <stdio.h> #include <stdlib.h> #include <locale.h> int locale_ok = 0; wchar_t s_suits[] = L"♠♥♦♣"; const char *s_suits_ascii[] = { "S", "H", "D", "C" }; const char *s_nums[] = { "WHAT", "A", "2", "3", "4", "5", "6", "7", "8", "9", "10", "J", "Q", "K", "OVERFLOW" }; typedef struct { int suit, number, _s; } card_t, *card; typedef struct { int n; card_t cards[52]; } deck_t, *deck; void show_card(card c) { if (locale_ok) printf(" %lc%s", s_suits[c->suit], s_nums[c->number]); else printf(" %s%s", s_suits_ascii[c->suit], s_nums[c->number]); } deck new_deck() { int i, j, k; deck d = malloc(sizeof(deck_t)); d->n = 52; for (i = k = 0; i < 4; i++) for (j = 1; j <= 13; j++, k++) { d->cards[k].suit = i; d->cards[k].number = j; } return d; } void show_deck(deck d) { int i; printf("%d cards:", d->n); for (i = 0; i < d->n; i++) show_card(d->cards + i); printf("\n"); } int cmp_card(const void *a, const void *b) { int x = ((card)a)->_s, y = ((card)b)->_s; return x < y ? -1 : x > y; } card deal_card(deck d) { if (!d->n) return 0; return d->cards + --d->n; } void shuffle_deck(deck d) { int i; for (i = 0; i < d->n; i++) d->cards[i]._s = rand(); qsort(d->cards, d->n, sizeof(card_t), cmp_card); } int main() { int i, j; deck d = new_deck(); locale_ok = (0 != setlocale(LC_CTYPE, "")); printf("New deck, "); show_deck(d); printf("\nShuffle and deal to three players:\n"); shuffle_deck(d); for (i = 0; i < 3; i++) { for (j = 0; j < 5; j++) show_card(deal_card(d)); printf("\n"); } printf("Left in deck "); show_deck(d); return 0; }
Change the following Go code into C without altering its purpose.
package main import ( "fmt" ) func main() { var a [5]int fmt.Println("len(a) =", len(a)) fmt.Println("a =", a) a[0] = 3 fmt.Println("a =", a) fmt.Println("a[0] =", a[0]) s := a[:4] fmt.Println("s =", s) fmt.Println("len(s) =", len(s), " cap(s) =", cap(s)) s = s[:5] fmt.Println("s =", s) a[0] = 22 fmt.Println("a =", a) fmt.Println("s =", s) s = append(s, 4, 5, 6) fmt.Println("s =", s) fmt.Println("len(s) =", len(s), " cap(s) =", cap(s)) a[4] = -1 fmt.Println("a =", a) fmt.Println("s =", s) s = make([]int, 8) fmt.Println("s =", s) fmt.Println("len(s) =", len(s), " cap(s) =", cap(s)) }
char foo() { char array[5] = {3,6,9,12,15}; return array[2]; }
Produce a functionally identical C code for the snippet given in Go.
package main import ( "fmt" "strings" "unicode/utf8" ) var order = 3 var grain = "#" func main() { carpet := []string{grain} for ; order > 0; order-- { hole := strings.Repeat(" ", utf8.RuneCountInString(carpet[0])) middle := make([]string, len(carpet)) for i, s := range carpet { middle[i] = s + hole + s carpet[i] = strings.Repeat(s, 3) } carpet = append(append(carpet, middle...), carpet...) } for _, r := range carpet { fmt.Println(r) } }
#include <stdio.h> int main() { int i, j, dim, d; int depth = 3; for (i = 0, dim = 1; i < depth; i++, dim *= 3); for (i = 0; i < dim; i++) { for (j = 0; j < dim; j++) { for (d = dim / 3; d; d /= 3) if ((i % (d * 3)) / d == 1 && (j % (d * 3)) / d == 1) break; printf(d ? " " : "##"); } printf("\n"); } return 0; }
Port the following code from Go to C with equivalent syntax and logic.
package main import ( "fmt" "math/rand" "sort" "time" ) func main() { list := []int{31, 41, 59, 26, 53, 58, 97, 93, 23, 84} rand.Seed(time.Now().UnixNano()) fmt.Println("unsorted:", list) temp := make([]int, len(list)) copy(temp, list) for !sort.IntsAreSorted(temp) { for i, v := range rand.Perm(len(list)) { temp[i] = list[v] } } fmt.Println("sorted! ", temp) }
#include <stdio.h> #include <stdlib.h> #include <stdbool.h> bool is_sorted(int *a, int n) { while ( --n >= 1 ) { if ( a[n] < a[n-1] ) return false; } return true; } void shuffle(int *a, int n) { int i, t, r; for(i=0; i < n; i++) { t = a[i]; r = rand() % n; a[i] = a[r]; a[r] = t; } } void bogosort(int *a, int n) { while ( !is_sorted(a, n) ) shuffle(a, n); } int main() { int numbers[] = { 1, 10, 9, 7, 3, 0 }; int i; bogosort(numbers, 6); for (i=0; i < 6; i++) printf("%d ", numbers[i]); printf("\n"); }
Can you help me rewrite this code in C instead of Go, keeping it the same logically?
package main import ( "fmt" "math" "sort" ) type Patient struct { id int lastName string } var patientDir = make(map[int]string) var patientIds []int func patientNew(id int, lastName string) Patient { patientDir[id] = lastName patientIds = append(patientIds, id) sort.Ints(patientIds) return Patient{id, lastName} } type DS struct { dates []string scores []float64 } type Visit struct { id int date string score float64 } var visitDir = make(map[int]DS) func visitNew(id int, date string, score float64) Visit { if date == "" { date = "0000-00-00" } v, ok := visitDir[id] if ok { v.dates = append(v.dates, date) v.scores = append(v.scores, score) visitDir[id] = DS{v.dates, v.scores} } else { visitDir[id] = DS{[]string{date}, []float64{score}} } return Visit{id, date, score} } type Merge struct{ id int } func (m Merge) lastName() string { return patientDir[m.id] } func (m Merge) dates() []string { return visitDir[m.id].dates } func (m Merge) scores() []float64 { return visitDir[m.id].scores } func (m Merge) lastVisit() string { dates := m.dates() dates2 := make([]string, len(dates)) copy(dates2, dates) sort.Strings(dates2) return dates2[len(dates2)-1] } func (m Merge) scoreSum() float64 { sum := 0.0 for _, score := range m.scores() { if score != -1 { sum += score } } return sum } func (m Merge) scoreAvg() float64 { count := 0 for _, score := range m.scores() { if score != -1 { count++ } } return m.scoreSum() / float64(count) } func mergePrint(merges []Merge) { fmt.Println("| PATIENT_ID | LASTNAME | LAST_VISIT | SCORE_SUM | SCORE_AVG |") f := "| %d | %-7s | %s | %4s | %4s |\n" for _, m := range merges { _, ok := visitDir[m.id] if ok { lv := m.lastVisit() if lv == "0000-00-00" { lv = " " } scoreSum := m.scoreSum() ss := fmt.Sprintf("%4.1f", scoreSum) if scoreSum == 0 { ss = " " } scoreAvg := m.scoreAvg() sa := " " if !math.IsNaN(scoreAvg) { sa = fmt.Sprintf("%4.2f", scoreAvg) } fmt.Printf(f, m.id, m.lastName(), lv, ss, sa) } else { fmt.Printf(f, m.id, m.lastName(), " ", " ", " ") } } } func main() { patientNew(1001, "Hopper") patientNew(4004, "Wirth") patientNew(3003, "Kemeny") patientNew(2002, "Gosling") patientNew(5005, "Kurtz") visitNew(2002, "2020-09-10", 6.8) visitNew(1001, "2020-09-17", 5.5) visitNew(4004, "2020-09-24", 8.4) visitNew(2002, "2020-10-08", -1) visitNew(1001, "", 6.6) visitNew(3003, "2020-11-12", -1) visitNew(4004, "2020-11-05", 7.0) visitNew(1001, "2020-11-19", 5.3) merges := make([]Merge, len(patientIds)) for i, id := range patientIds { merges[i] = Merge{id} } mergePrint(merges) }
#include <ctime> #include <cstdint> extern "C" { int64_t from date(const char* string) { struct tm tmInfo = {0}; strptime(string, "%Y-%m-%d", &tmInfo); return mktime(&tmInfo); } }
Convert this Go snippet to C and keep its semantics consistent.
package main import ( "fmt" "math" ) type fdy func(float64, float64) float64 func eulerStep(f fdy, x, y, h float64) float64 { return y + h*f(x, y) } func newCoolingRate(k float64) func(float64) float64 { return func(deltaTemp float64) float64 { return -k * deltaTemp } } func newTempFunc(k, ambientTemp, initialTemp float64) func(float64) float64 { return func(time float64) float64 { return ambientTemp + (initialTemp-ambientTemp)*math.Exp(-k*time) } } func newCoolingRateDy(k, ambientTemp float64) fdy { crf := newCoolingRate(k) return func(_, objectTemp float64) float64 { return crf(objectTemp - ambientTemp) } } func main() { k := .07 tempRoom := 20. tempObject := 100. fcr := newCoolingRateDy(k, tempRoom) analytic := newTempFunc(k, tempRoom, tempObject) for _, deltaTime := range []float64{2, 5, 10} { fmt.Printf("Step size = %.1f\n", deltaTime) fmt.Println(" Time Euler's Analytic") temp := tempObject for time := 0.; time <= 100; time += deltaTime { fmt.Printf("%5.1f %7.3f %7.3f\n", time, temp, analytic(time)) temp = eulerStep(fcr, time, temp, deltaTime) } fmt.Println() } }
#include <stdio.h> #include <math.h> typedef double (*deriv_f)(double, double); #define FMT " %7.3f" void ivp_euler(deriv_f f, double y, int step, int end_t) { int t = 0; printf(" Step %2d: ", (int)step); do { if (t % 10 == 0) printf(FMT, y); y += step * f(t, y); } while ((t += step) <= end_t); printf("\n"); } void analytic() { double t; printf(" Time: "); for (t = 0; t <= 100; t += 10) printf(" %7g", t); printf("\nAnalytic: "); for (t = 0; t <= 100; t += 10) printf(FMT, 20 + 80 * exp(-0.07 * t)); printf("\n"); } double cooling(double t, double temp) { return -0.07 * (temp - 20); } int main() { analytic(); ivp_euler(cooling, 100, 2, 100); ivp_euler(cooling, 100, 5, 100); ivp_euler(cooling, 100, 10, 100); return 0; }
Translate this program into C but keep the logic exactly as in Go.
package main import ( "fmt" "math" ) func remarkable(n int) int { return n + int(.5+math.Sqrt(float64(n))) } func main() { fmt.Println(" n r(n)") fmt.Println("--- ---") for n := 1; n <= 22; n++ { fmt.Printf("%3d %3d\n", n, remarkable(n)) } const limit = 1e6 fmt.Println("\nChecking for squares for n <", limit) next := 2 nextSq := 4 for n := 1; n < limit; n++ { r := remarkable(n) switch { case r == nextSq: panic(n) case r > nextSq: fmt.Println(nextSq, "didn't occur") next++ nextSq = next * next } } fmt.Println("No squares occur for n <", limit) }
#include <math.h> #include <stdio.h> #include <assert.h> int nonsqr(int n) { return n + (int)(0.5 + sqrt(n)); } int main() { int i; for (i = 1; i < 23; i++) printf("%d ", nonsqr(i)); printf("\n"); for (i = 1; i < 1000000; i++) { double j = sqrt(nonsqr(i)); assert(j != floor(j)); } return 0; }
Translate the given Go code snippet into C without altering its behavior.
package main import ( "fmt" "math" ) func remarkable(n int) int { return n + int(.5+math.Sqrt(float64(n))) } func main() { fmt.Println(" n r(n)") fmt.Println("--- ---") for n := 1; n <= 22; n++ { fmt.Printf("%3d %3d\n", n, remarkable(n)) } const limit = 1e6 fmt.Println("\nChecking for squares for n <", limit) next := 2 nextSq := 4 for n := 1; n < limit; n++ { r := remarkable(n) switch { case r == nextSq: panic(n) case r > nextSq: fmt.Println(nextSq, "didn't occur") next++ nextSq = next * next } } fmt.Println("No squares occur for n <", limit) }
#include <math.h> #include <stdio.h> #include <assert.h> int nonsqr(int n) { return n + (int)(0.5 + sqrt(n)); } int main() { int i; for (i = 1; i < 23; i++) printf("%d ", nonsqr(i)); printf("\n"); for (i = 1; i < 1000000; i++) { double j = sqrt(nonsqr(i)); assert(j != floor(j)); } return 0; }
Please provide an equivalent version of this Go code in C.
package main import ( "fmt" "strings" ) func main() { s := "ABCDEFGH" n, m := 2, 3 fmt.Println("Index: ", "01234567") fmt.Println("String:", s) fmt.Printf("Start %d, length %d: %s\n", n, m, s[n : n+m]) fmt.Printf("Start %d, to end: %s\n", n, s[n:]) fmt.Printf("All but last: %s\n", s[:len(s)-1]) dx := strings.IndexByte(s, 'D') fmt.Printf("Start 'D', length %d: %s\n", m, s[dx : dx+m]) sx := strings.Index(s, "DE") fmt.Printf(`Start "DE", length %d: %s`+"\n", m, s[sx : sx+m]) }
#define _CRT_SECURE_NO_WARNINGS #include <stdio.h> #include <stdlib.h> #include <string.h> void putm(char* string, size_t m) { while(*string && m--) putchar(*string++); } int main(void) { char string[] = "Programs for other encodings (such as 8-bit ASCII, or EUC-JP)." int n = 3; int m = 4; char knownCharacter = '('; char knownSubstring[] = "encodings"; putm(string+n-1, m ); putchar('\n'); puts(string+n+1); putchar('\n'); putm(string, strlen(string)-1); putchar('\n'); putm(strchr(string, knownCharacter), m ); putchar('\n'); putm(strstr(string, knownSubstring), m ); putchar('\n'); return EXIT_SUCCESS; }
Please provide an equivalent version of this Go code in C.
package main import ( "log" "sort" ) func main() { log.Println(jortSort([]int{1, 2, 1, 11, 213, 2, 4})) log.Println(jortSort([]int{0, 1, 0, 0, 0, 0})) log.Println(jortSort([]int{1, 2, 4, 11, 22, 22})) log.Println(jortSort([]int{0, 0, 0, 1, 2, 2})) } func jortSort(a []int) bool { c := make([]int, len(a)) copy(c, a) sort.Ints(a) for k, v := range c { if v == a[k] { continue } else { return false } } return true }
#include <stdio.h> #include <stdlib.h> int number_of_digits(int x){ int NumberOfDigits; for(NumberOfDigits=0;x!=0;NumberOfDigits++){ x=x/10; } return NumberOfDigits; } int* convert_array(char array[], int NumberOfElements) { int *convertedArray=malloc(NumberOfElements*sizeof(int)); int originalElement, convertedElement; for(convertedElement=0, originalElement=0; convertedElement<NumberOfElements; convertedElement++) { convertedArray[convertedElement]=atoi(&array[originalElement]); originalElement+=number_of_digits(convertedArray[convertedElement])+1; } return convertedArray; } int isSorted(int array[], int numberOfElements){ int sorted=1; for(int counter=0;counter<numberOfElements;counter++){ if(counter!=0 && array[counter-1]>array[counter]) sorted--; } return sorted; } int main(int argc, char* argv[]) { int* convertedArray; convertedArray=convert_array(*(argv+1), argc-1); if(isSorted(convertedArray, argc-1)==1) printf("Did you forgot to turn on your brain?! This array is already sorted!\n"); else if(argc-1<=10) printf("Am I really supposed to sort this? Sort it by yourself!\n"); else printf("Am I really supposed to sort this? Bhahahaha!\n"); free(convertedArray); return 0; }
Can you help me rewrite this code in C instead of Go, keeping it the same logically?
func isLeap(year int) bool { return year%400 == 0 || year%4 == 0 && year%100 != 0 }
#include <stdio.h> int is_leap_year(unsigned year) { return !(year & (year % 100 ? 3 : 15)); } int main(void) { const unsigned test_case[] = { 1900, 1994, 1996, 1997, 2000, 2024, 2025, 2026, 2100 }; const unsigned n = sizeof test_case / sizeof test_case[0]; for (unsigned i = 0; i != n; ++i) { unsigned year = test_case[i]; printf("%u is %sa leap year.\n", year, is_leap_year(year) ? "" : "not "); } return 0; }
Write a version of this Go function in C with identical behavior.
package main import ( "fmt" "math/big" ) func main() { var n, p int64 fmt.Printf("A sample of permutations from 1 to 12:\n") for n = 1; n < 13; n++ { p = n / 3 fmt.Printf("P(%d,%d) = %d\n", n, p, perm(big.NewInt(n), big.NewInt(p))) } fmt.Printf("\nA sample of combinations from 10 to 60:\n") for n = 10; n < 61; n += 10 { p = n / 3 fmt.Printf("C(%d,%d) = %d\n", n, p, comb(big.NewInt(n), big.NewInt(p))) } fmt.Printf("\nA sample of permutations from 5 to 15000:\n") nArr := [...]int64{5, 50, 500, 1000, 5000, 15000} for _, n = range nArr { p = n / 3 fmt.Printf("P(%d,%d) = %d\n", n, p, perm(big.NewInt(n), big.NewInt(p))) } fmt.Printf("\nA sample of combinations from 100 to 1000:\n") for n = 100; n < 1001; n += 100 { p = n / 3 fmt.Printf("C(%d,%d) = %d\n", n, p, comb(big.NewInt(n), big.NewInt(p))) } } func fact(n *big.Int) *big.Int { if n.Sign() < 1 { return big.NewInt(0) } r := big.NewInt(1) i := big.NewInt(2) for i.Cmp(n) < 1 { r.Mul(r, i) i.Add(i, big.NewInt(1)) } return r } func perm(n, k *big.Int) *big.Int { r := fact(n) r.Div(r, fact(n.Sub(n, k))) return r } func comb(n, r *big.Int) *big.Int { if r.Cmp(n) == 1 { return big.NewInt(0) } if r.Cmp(n) == 0 { return big.NewInt(1) } c := fact(n) den := fact(n.Sub(n, r)) den.Mul(den, fact(r)) c.Div(c, den) return c }
#include <gmp.h> void perm(mpz_t out, int n, int k) { mpz_set_ui(out, 1); k = n - k; while (n > k) mpz_mul_ui(out, out, n--); } void comb(mpz_t out, int n, int k) { perm(out, n, k); while (k) mpz_divexact_ui(out, out, k--); } int main(void) { mpz_t x; mpz_init(x); perm(x, 1000, 969); gmp_printf("P(1000,969) = %Zd\n", x); comb(x, 1000, 969); gmp_printf("C(1000,969) = %Zd\n", x); return 0; }
Can you help me rewrite this code in C instead of Go, keeping it the same logically?
package main import ( "fmt" "sort" "strconv" ) func lexOrder(n int) []int { first, last, k := 1, n, n if n < 1 { first, last, k = n, 1, 2-n } strs := make([]string, k) for i := first; i <= last; i++ { strs[i-first] = strconv.Itoa(i) } sort.Strings(strs) ints := make([]int, k) for i := 0; i < k; i++ { ints[i], _ = strconv.Atoi(strs[i]) } return ints } func main() { fmt.Println("In lexicographical order:\n") for _, n := range []int{0, 5, 13, 21, -22} { fmt.Printf("%3d: %v\n", n, lexOrder(n)) } }
#include <math.h> #include <stdio.h> #include <stdlib.h> #include <string.h> int compareStrings(const void *a, const void *b) { const char **aa = (const char **)a; const char **bb = (const char **)b; return strcmp(*aa, *bb); } void lexOrder(int n, int *ints) { char **strs; int i, first = 1, last = n, k = n, len; if (n < 1) { first = n; last = 1; k = 2 - n; } strs = malloc(k * sizeof(char *)); for (i = first; i <= last; ++i) { if (i >= 1) len = (int)log10(i) + 2; else if (i == 0) len = 2; else len = (int)log10(-i) + 3; strs[i-first] = malloc(len); sprintf(strs[i-first], "%d", i); } qsort(strs, k, sizeof(char *), compareStrings); for (i = 0; i < k; ++i) { ints[i] = atoi(strs[i]); free(strs[i]); } free(strs); } int main() { int i, j, k, n, *ints; int numbers[5] = {0, 5, 13, 21, -22}; printf("In lexicographical order:\n\n"); for (i = 0; i < 5; ++i) { k = n = numbers[i]; if (k < 1) k = 2 - k; ints = malloc(k * sizeof(int)); lexOrder(n, ints); printf("%3d: [", n); for (j = 0; j < k; ++j) { printf("%d ", ints[j]); } printf("\b]\n"); free(ints); } return 0; }
Port the following code from Go to C with equivalent syntax and logic.
package main import "fmt" func main() { for _, n := range []int64{12, 1048576, 9e18, -2, 0} { fmt.Println(say(n)) } } var small = [...]string{"zero", "one", "two", "three", "four", "five", "six", "seven", "eight", "nine", "ten", "eleven", "twelve", "thirteen", "fourteen", "fifteen", "sixteen", "seventeen", "eighteen", "nineteen"} var tens = [...]string{"", "", "twenty", "thirty", "forty", "fifty", "sixty", "seventy", "eighty", "ninety"} var illions = [...]string{"", " thousand", " million", " billion", " trillion", " quadrillion", " quintillion"} func say(n int64) string { var t string if n < 0 { t = "negative " n = -n } switch { case n < 20: t += small[n] case n < 100: t += tens[n/10] s := n % 10 if s > 0 { t += "-" + small[s] } case n < 1000: t += small[n/100] + " hundred" s := n % 100 if s > 0 { t += " " + say(s) } default: sx := "" for i := 0; n > 0; i++ { p := n % 1000 n /= 1000 if p > 0 { ix := say(p) + illions[i] if sx != "" { ix += " " + sx } sx = ix } } t += sx } return t }
#include <stdio.h> #include <string.h> const char *ones[] = { 0, "one", "two", "three", "four", "five", "six", "seven", "eight", "nine", "ten", "eleven", "twelve", "thirteen", "fourteen", "fifteen", "sixteen", "seventeen", "eighteen", "nineteen" }; const char *tens[] = { 0, "ten", "twenty", "thirty", "forty", "fifty", "sixty", "seventy", "eighty", "ninety" }; const char *llions[] = { 0, "thousand", "million", "billion", "trillion", }; const int maxillion = sizeof(llions) / sizeof(llions[0]) * 3 - 3; int say_hundred(const char *s, int len, int depth, int has_lead) { int c[3], i; for (i = -3; i < 0; i++) { if (len + i >= 0) c[i + 3] = s[len + i] - '0'; else c[i + 3] = 0; } if (!(c[0] + c[1] + c[2])) return 0; if (c[0]) { printf("%s hundred", ones[c[0]]); has_lead = 1; } if (has_lead && (c[1] || c[2])) printf((!depth || c[0]) && (!c[0] || !c[1]) ? "and " : c[0] ? " " : ""); if (c[1] < 2) { if (c[1] || c[2]) printf("%s", ones[c[1] * 10 + c[2]]); } else { if (c[1]) { printf("%s", tens[c[1]]); if (c[2]) putchar('-'); } if (c[2]) printf("%s", ones[c[2]]); } return 1; } int say_maxillion(const char *s, int len, int depth, int has_lead) { int n = len / 3, r = len % 3; if (!r) { n--; r = 3; } const char *e = s + r; do { if (say_hundred(s, r, n, has_lead) && n) { has_lead = 1; printf(" %s", llions[n]); if (!depth) printf(", "); else printf(" "); } s = e; e += 3; } while (r = 3, n--); return 1; } void say_number(const char *s) { int len, i, got_sign = 0; while (*s == ' ') s++; if (*s < '0' || *s > '9') { if (*s == '-') got_sign = -1; else if (*s == '+') got_sign = 1; else goto nan; s++; } else got_sign = 1; while (*s == '0') { s++; if (*s == '\0') { printf("zero\n"); return; } } len = strlen(s); if (!len) goto nan; for (i = 0; i < len; i++) { if (s[i] < '0' || s[i] > '9') { printf("(not a number)"); return; } } if (got_sign == -1) printf("minus "); int n = len / maxillion; int r = len % maxillion; if (!r) { r = maxillion; n--; } const char *end = s + len - n * maxillion; int has_lead = 0; do { if ((has_lead = say_maxillion(s, r, n, has_lead))) { for (i = 0; i < n; i++) printf(" %s", llions[maxillion / 3]); if (n) printf(", "); } n--; r = maxillion; s = end; end += r; } while (n >= 0); printf("\n"); return; nan: printf("not a number\n"); return; } int main() { say_number("-42"); say_number("1984"); say_number("10000"); say_number("1024"); say_number("1001001001001"); say_number("123456789012345678901234567890123456789012345678900000001"); return 0; }
Produce a language-to-language conversion: from Go to C, same semantics.
package main import ( "fmt" "os" "sort" ) func main() { if len(os.Args) == 1 { compareStrings("abcd", "123456789", "abcdef", "1234567") } else { strings := os.Args[1:] compareStrings(strings...) } } func compareStrings(strings ...string) { sort.SliceStable(strings, func(i, j int) bool { return len(strings[i]) > len(strings[j]) }) for _, s := range strings { fmt.Printf("%d: %s\n", len(s), s) } }
#include <stdio.h> #include <stdlib.h> #include <string.h> int cmp(const int* a, const int* b) { return *b - *a; } void compareAndReportStringsLength(const char* strings[], const int n) { if (n > 0) { char* has_length = "has length"; char* predicate_max = "and is the longest string"; char* predicate_min = "and is the shortest string"; char* predicate_ave = "and is neither the longest nor the shortest string"; int* si = malloc(2 * n * sizeof(int)); if (si != NULL) { for (int i = 0; i < n; i++) { si[2 * i] = strlen(strings[i]); si[2 * i + 1] = i; } qsort(si, n, 2 * sizeof(int), cmp); int max = si[0]; int min = si[2 * (n - 1)]; for (int i = 0; i < n; i++) { int length = si[2 * i]; char* string = strings[si[2 * i + 1]]; char* predicate; if (length == max) predicate = predicate_max; else if (length == min) predicate = predicate_min; else predicate = predicate_ave; printf("\"%s\" %s %d %s\n", string, has_length, length, predicate); } free(si); } else { fputs("unable allocate memory buffer", stderr); } } } int main(int argc, char* argv[]) { char* list[] = { "abcd", "123456789", "abcdef", "1234567" }; compareAndReportStringsLength(list, 4); return EXIT_SUCCESS; }
Maintain the same structure and functionality when rewriting this code in C.
package main import "fmt" var a = []int{170, 45, 75, -90, -802, 24, 2, 66} func main() { fmt.Println("before:", a) for inc := len(a) / 2; inc > 0; inc = (inc + 1) * 5 / 11 { for i := inc; i < len(a); i++ { j, temp := i, a[i] for ; j >= inc && a[j-inc] > temp; j -= inc { a[j] = a[j-inc] } a[j] = temp } } fmt.Println("after: ", a) }
#include <stdio.h> void shell_sort (int *a, int n) { int h, i, j, t; for (h = n; h /= 2;) { for (i = h; i < n; i++) { t = a[i]; for (j = i; j >= h && t < a[j - h]; j -= h) { a[j] = a[j - h]; } a[j] = t; } } } int main (int ac, char **av) { int a[] = {4, 65, 2, -31, 0, 99, 2, 83, 782, 1}; int n = sizeof a / sizeof a[0]; int i; for (i = 0; i < n; i++) printf("%d%s", a[i], i == n - 1 ? "\n" : " "); shell_sort(a, n); for (i = 0; i < n; i++) printf("%d%s", a[i], i == n - 1 ? "\n" : " "); return 0; }
Keep all operations the same but rewrite the snippet in C.
type dlNode struct { int next, prev *dlNode } type dlList struct { members map[*dlNode]int head, tail **dlNode }
#include <stdio.h> #include <stdlib.h> struct List { struct MNode *head; struct MNode *tail; struct MNode *tail_pred; }; struct MNode { struct MNode *succ; struct MNode *pred; }; typedef struct MNode *NODE; typedef struct List *LIST; LIST newList(void); int isEmpty(LIST); NODE getTail(LIST); NODE getHead(LIST); NODE addTail(LIST, NODE); NODE addHead(LIST, NODE); NODE remHead(LIST); NODE remTail(LIST); NODE insertAfter(LIST, NODE, NODE); NODE removeNode(LIST, NODE); LIST newList(void) { LIST tl = malloc(sizeof(struct List)); if ( tl != NULL ) { tl->tail_pred = (NODE)&tl->head; tl->tail = NULL; tl->head = (NODE)&tl->tail; return tl; } return NULL; } int isEmpty(LIST l) { return (l->head->succ == 0); } NODE getHead(LIST l) { return l->head; } NODE getTail(LIST l) { return l->tail_pred; } NODE addTail(LIST l, NODE n) { n->succ = (NODE)&l->tail; n->pred = l->tail_pred; l->tail_pred->succ = n; l->tail_pred = n; return n; } NODE addHead(LIST l, NODE n) { n->succ = l->head; n->pred = (NODE)&l->head; l->head->pred = n; l->head = n; return n; } NODE remHead(LIST l) { NODE h; h = l->head; l->head = l->head->succ; l->head->pred = (NODE)&l->head; return h; } NODE remTail(LIST l) { NODE t; t = l->tail_pred; l->tail_pred = l->tail_pred->pred; l->tail_pred->succ = (NODE)&l->tail; return t; } NODE insertAfter(LIST l, NODE r, NODE n) { n->pred = r; n->succ = r->succ; n->succ->pred = n; r->succ = n; return n; } NODE removeNode(LIST l, NODE n) { n->pred->succ = n->succ; n->succ->pred = n->pred; return n; }
Translate the given Go code snippet into C without altering its behavior.
package main import ( "fmt" "io/ioutil" "sort" "unicode" ) const file = "unixdict.txt" func main() { bs, err := ioutil.ReadFile(file) if err != nil { fmt.Println(err) return } m := make(map[rune]int) for _, r := range string(bs) { m[r]++ } lfs := make(lfList, 0, len(m)) for l, f := range m { lfs = append(lfs, &letterFreq{l, f}) } sort.Sort(lfs) fmt.Println("file:", file) fmt.Println("letter frequency") for _, lf := range lfs { if unicode.IsGraphic(lf.rune) { fmt.Printf(" %c %7d\n", lf.rune, lf.freq) } else { fmt.Printf("%U %7d\n", lf.rune, lf.freq) } } } type letterFreq struct { rune freq int } type lfList []*letterFreq func (lfs lfList) Len() int { return len(lfs) } func (lfs lfList) Less(i, j int) bool { switch fd := lfs[i].freq - lfs[j].freq; { case fd < 0: return false case fd > 0: return true } return lfs[i].rune < lfs[j].rune } func (lfs lfList) Swap(i, j int) { lfs[i], lfs[j] = lfs[j], lfs[i] }
int frequency[26]; int ch; FILE* txt_file = fopen ("a_text_file.txt", "rt"); for (ch = 0; ch < 26; ch++) frequency[ch] = 0; while (1) { ch = fgetc(txt_file); if (ch == EOF) break; if ('a' <= ch && ch <= 'z') frequency[ch-'a']++; else if ('A' <= ch && ch <= 'Z') frequency[ch-'A']++; }
Maintain the same structure and functionality when rewriting this code in C.
package main import "fmt" var tr = []int{85, 88, 75, 66, 25, 29, 83, 39, 97} var ct = []int{68, 41, 10, 49, 16, 65, 32, 92, 28, 98} func main() { all := make([]int, len(tr)+len(ct)) copy(all, tr) copy(all[len(tr):], ct) var sumAll int for _, r := range all { sumAll += r } sd := func(trc []int) int { var sumTr int for _, x := range trc { sumTr += all[x] } return sumTr*len(ct) - (sumAll-sumTr)*len(tr) } a := make([]int, len(tr)) for i, _ := range a { a[i] = i } sdObs := sd(a) var nLe, nGt int comb(len(all), len(tr), func(c []int) { if sd(c) > sdObs { nGt++ } else { nLe++ } }) pc := 100 / float64(nLe+nGt) fmt.Printf("differences <= observed: %f%%\n", float64(nLe)*pc) fmt.Printf("differences > observed: %f%%\n", float64(nGt)*pc) } func comb(n, m int, emit func([]int)) { s := make([]int, m) last := m - 1 var rc func(int, int) rc = func(i, next int) { for j := next; j < n; j++ { s[i] = j if i == last { emit(s) } else { rc(i+1, j+1) } } return } rc(0, 0) }
#include <stdio.h> int data[] = { 85, 88, 75, 66, 25, 29, 83, 39, 97, 68, 41, 10, 49, 16, 65, 32, 92, 28, 98 }; int pick(int at, int remain, int accu, int treat) { if (!remain) return (accu > treat) ? 1 : 0; return pick(at - 1, remain - 1, accu + data[at - 1], treat) + ( at > remain ? pick(at - 1, remain, accu, treat) : 0 ); } int main() { int treat = 0, i; int le, gt; double total = 1; for (i = 0; i < 9; i++) treat += data[i]; for (i = 19; i > 10; i--) total *= i; for (i = 9; i > 0; i--) total /= i; gt = pick(19, 9, 0, treat); le = total - gt; printf("<= : %f%% %d\n > : %f%% %d\n", 100 * le / total, le, 100 * gt / total, gt); return 0; }
Port the provided Go code into C while preserving the original functionality.
package main import "fmt" func möbius(to int) []int { if to < 1 { to = 1 } mobs := make([]int, to+1) primes := []int{2} for i := 1; i <= to; i++ { j := i cp := 0 spf := false for _, p := range primes { if p > j { break } if j%p == 0 { j /= p cp++ } if j%p == 0 { spf = true break } } if cp == 0 && i > 2 { cp = 1 primes = append(primes, i) } if !spf { if cp%2 == 0 { mobs[i] = 1 } else { mobs[i] = -1 } } } return mobs } func main() { mobs := möbius(199) fmt.Println("Möbius sequence - First 199 terms:") for i := 0; i < 200; i++ { if i == 0 { fmt.Print(" ") continue } if i%20 == 0 { fmt.Println() } fmt.Printf("  % d", mobs[i]) } }
#include <math.h> #include <stdio.h> #include <stdlib.h> #include <string.h> int main() { const int MU_MAX = 1000000; int i, j; int *mu; int sqroot; sqroot = (int)sqrt(MU_MAX); mu = malloc((MU_MAX + 1) * sizeof(int)); for (i = 0; i < MU_MAX;i++) { mu[i] = 1; } for (i = 2; i <= sqroot; i++) { if (mu[i] == 1) { for (j = i; j <= MU_MAX; j += i) { mu[j] *= -i; } for (j = i * i; j <= MU_MAX; j += i * i) { mu[j] = 0; } } } for (i = 2; i <= MU_MAX; i++) { if (mu[i] == i) { mu[i] = 1; } else if (mu[i] == -i) { mu[i] = -1; } else if (mu[i] < 0) { mu[i] = 1; } else if (mu[i] > 0) { mu[i] = -1; } } printf("First 199 terms of the möbius function are as follows:\n "); for (i = 1; i < 200; i++) { printf("%2d ", mu[i]); if ((i + 1) % 20 == 0) { printf("\n"); } } free(mu); return 0; }
Can you help me rewrite this code in C instead of Go, keeping it the same logically?
package main import "fmt" import "strconv" func main() { i, _ := strconv.Atoi("1234") fmt.Println(strconv.Itoa(i + 1)) }
#include <stdio.h> #include <string.h> #include <stdlib.h> char * incr(char *s) { int i, begin, tail, len; int neg = (*s == '-'); char tgt = neg ? '0' : '9'; if (!strcmp(s, "-1")) { s[0] = '0', s[1] = '\0'; return s; } len = strlen(s); begin = (*s == '-' || *s == '+') ? 1 : 0; for (tail = len - 1; tail >= begin && s[tail] == tgt; tail--); if (tail < begin && !neg) { if (!begin) s = realloc(s, len + 2); s[0] = '1'; for (i = 1; i <= len - begin; i++) s[i] = '0'; s[len + 1] = '\0'; } else if (tail == begin && neg && s[1] == '1') { for (i = 1; i < len - begin; i++) s[i] = '9'; s[len - 1] = '\0'; } else { for (i = len - 1; i > tail; i--) s[i] = neg ? '9' : '0'; s[tail] += neg ? -1 : 1; } return s; } void string_test(const char *s) { char *ret = malloc(strlen(s)); strcpy(ret, s); printf("text: %s\n", ret); printf(" ->: %s\n", ret = incr(ret)); free(ret); } int main() { string_test("+0"); string_test("-1"); string_test("-41"); string_test("+41"); string_test("999"); string_test("+999"); string_test("109999999999999999999999999999999999999999"); string_test("-100000000000000000000000000000000000000000000"); return 0; }
Write a version of this Go function in C with identical behavior.
package main import ( "fmt" "strings" ) func stripchars(str, chr string) string { return strings.Map(func(r rune) rune { if strings.IndexRune(chr, r) < 0 { return r } return -1 }, str) } func main() { fmt.Println(stripchars("She was a soul stripper. She took my heart!", "aei")) }
#include <string.h> #include <stdio.h> #include <stdlib.h> char *strip_chars(const char *string, const char *chars) { char * newstr = malloc(strlen(string) + 1); int counter = 0; for ( ; *string; string++) { if (!strchr(chars, *string)) { newstr[ counter ] = *string; ++ counter; } } newstr[counter] = 0; return newstr; } int main(void) { char *new = strip_chars("She was a soul stripper. She took my heart!", "aei"); printf("%s\n", new); free(new); return 0; }
Change the following Go code into C without altering its purpose.
package main import "fmt" var a = []int{170, 45, 75, -90, -802, 24, 2, 66} func main() { fmt.Println("before:", a) if len(a) > 1 && !recurse(len(a) - 1) { panic("sorted permutation not found!") } fmt.Println("after: ", a) } func recurse(last int) bool { if last <= 0 { for i := len(a) - 1; a[i] >= a[i-1]; i-- { if i == 1 { return true } } return false } for i := 0; i <= last; i++ { a[i], a[last] = a[last], a[i] if recurse(last - 1) { return true } a[i], a[last] = a[last], a[i] } return false }
#include <stdio.h> #include <stdlib.h> #include <string.h> typedef int(*cmp_func)(const void*, const void*); void perm_sort(void *a, int n, size_t msize, cmp_func _cmp) { char *p, *q, *tmp = malloc(msize); # define A(i) ((char *)a + msize * (i)) # define swap(a, b) {\ memcpy(tmp, a, msize);\ memcpy(a, b, msize);\ memcpy(b, tmp, msize); } while (1) { for (p = A(n - 1); (void*)p > a; p = q) if (_cmp(q = p - msize, p) > 0) break; if ((void*)p <= a) break; for (p = A(n - 1); p > q; p-= msize) if (_cmp(q, p) > 0) break; swap(p, q); for (q += msize, p = A(n - 1); q < p; q += msize, p -= msize) swap(p, q); } free(tmp); } int scmp(const void *a, const void *b) { return strcmp(*(const char *const *)a, *(const char *const *)b); } int main() { int i; const char *strs[] = { "spqr", "abc", "giant squid", "stuff", "def" }; perm_sort(strs, 5, sizeof(*strs), scmp); for (i = 0; i < 5; i++) printf("%s\n", strs[i]); return 0; }
Write the same algorithm in C as shown in this Go implementation.
package main import ( "fmt" "math" ) func mean(v []float64) (m float64, ok bool) { if len(v) == 0 { return } var parts []float64 for _, x := range v { var i int for _, p := range parts { sum := p + x var err float64 switch ax, ap := math.Abs(x), math.Abs(p); { case ax < ap: err = x - (sum - p) case ap < ax: err = p - (sum - x) } if err != 0 { parts[i] = err i++ } x = sum } parts = append(parts[:i], x) } var sum float64 for _, x := range parts { sum += x } return sum / float64(len(v)), true } func main() { for _, v := range [][]float64{ []float64{}, []float64{math.Inf(1), math.Inf(1)}, []float64{math.Inf(1), math.Inf(-1)}, []float64{3, 1, 4, 1, 5, 9}, []float64{1e20, 3, 1, 4, 1, 5, 9, -1e20}, []float64{10, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 0, 0, 0, .11}, []float64{10, 20, 30, 40, 50, -100, 4.7, -11e2}, } { fmt.Println("Vector:", v) if m, ok := mean(v); ok { fmt.Printf("Mean of %d numbers is %g\n\n", len(v), m) } else { fmt.Println("Mean undefined\n") } } }
#include <stdio.h> double mean(double *v, int len) { double sum = 0; int i; for (i = 0; i < len; i++) sum += v[i]; return sum / len; } int main(void) { double v[] = {1, 2, 2.718, 3, 3.142}; int i, len; for (len = 5; len >= 0; len--) { printf("mean["); for (i = 0; i < len; i++) printf(i ? ", %g" : "%g", v[i]); printf("] = %g\n", mean(v, len)); } return 0; }
Ensure the translated C code behaves exactly like the original Go snippet.
package main import ( "io" "os" "strconv" "strings" "text/tabwriter" ) func readTable(table string) ([]string, []int) { fields := strings.Fields(table) var commands []string var minLens []int for i, max := 0, len(fields); i < max; { cmd := fields[i] cmdLen := len(cmd) i++ if i < max { num, err := strconv.Atoi(fields[i]) if err == nil && 1 <= num && num < cmdLen { cmdLen = num i++ } } commands = append(commands, cmd) minLens = append(minLens, cmdLen) } return commands, minLens } func validateCommands(commands []string, minLens []int, words []string) []string { var results []string for _, word := range words { matchFound := false wlen := len(word) for i, command := range commands { if minLens[i] == 0 || wlen < minLens[i] || wlen > len(command) { continue } c := strings.ToUpper(command) w := strings.ToUpper(word) if strings.HasPrefix(c, w) { results = append(results, c) matchFound = true break } } if !matchFound { results = append(results, "*error*") } } return results } func printResults(words []string, results []string) { wr := tabwriter.NewWriter(os.Stdout, 0, 1, 1, ' ', 0) io.WriteString(wr, "user words:") for _, word := range words { io.WriteString(wr, "\t"+word) } io.WriteString(wr, "\n") io.WriteString(wr, "full words:\t"+strings.Join(results, "\t")+"\n") wr.Flush() } func main() { const table = "" + "add 1 alter 3 backup 2 bottom 1 Cappend 2 change 1 Schange Cinsert 2 Clast 3 " + "compress 4 copy 2 count 3 Coverlay 3 cursor 3 delete 3 Cdelete 2 down 1 duplicate " + "3 xEdit 1 expand 3 extract 3 find 1 Nfind 2 Nfindup 6 NfUP 3 Cfind 2 findUP 3 fUP 2 " + "forward 2 get help 1 hexType 4 input 1 powerInput 3 join 1 split 2 spltJOIN load " + "locate 1 Clocate 2 lowerCase 3 upperCase 3 Lprefix 2 macro merge 2 modify 3 move 2 " + "msg next 1 overlay 1 parse preserve 4 purge 3 put putD query 1 quit read recover 3 " + "refresh renum 3 repeat 3 replace 1 Creplace 2 reset 3 restore 4 rgtLEFT right 2 left " + "2 save set shift 2 si sort sos stack 3 status 4 top transfer 3 type 1 up 1 " const sentence = "riG rePEAT copies put mo rest types fup. 6 poweRin" commands, minLens := readTable(table) words := strings.Fields(sentence) results := validateCommands(commands, minLens, words) printResults(words, results) }
#include <ctype.h> #include <stdbool.h> #include <stdio.h> #include <stdlib.h> #include <string.h> const char* command_table = "add 1 alter 3 backup 2 bottom 1 Cappend 2 change 1 Schange Cinsert 2 Clast 3 " "compress 4 copy 2 count 3 Coverlay 3 cursor 3 delete 3 Cdelete 2 down 1 duplicate " "3 xEdit 1 expand 3 extract 3 find 1 Nfind 2 Nfindup 6 NfUP 3 Cfind 2 findUP 3 fUP 2 " "forward 2 get help 1 hexType 4 input 1 powerInput 3 join 1 split 2 spltJOIN load " "locate 1 Clocate 2 lowerCase 3 upperCase 3 Lprefix 2 macro merge 2 modify 3 move 2 " "msg next 1 overlay 1 parse preserve 4 purge 3 put putD query 1 quit read recover 3 " "refresh renum 3 repeat 3 replace 1 Creplace 2 reset 3 restore 4 rgtLEFT right 2 left " "2 save set shift 2 si sort sos stack 3 status 4 top transfer 3 type 1 up 1"; typedef struct command_tag { char* cmd; size_t length; size_t min_len; struct command_tag* next; } command_t; bool command_match(const command_t* command, const char* str) { size_t olen = strlen(str); return olen >= command->min_len && olen <= command->length && strncmp(str, command->cmd, olen) == 0; } char* uppercase(char* str, size_t n) { for (size_t i = 0; i < n; ++i) str[i] = toupper((unsigned char)str[i]); return str; } void fatal(const char* message) { fprintf(stderr, "%s\n", message); exit(1); } void* xmalloc(size_t n) { void* ptr = malloc(n); if (ptr == NULL) fatal("Out of memory"); return ptr; } void* xrealloc(void* p, size_t n) { void* ptr = realloc(p, n); if (ptr == NULL) fatal("Out of memory"); return ptr; } char** split_into_words(const char* str, size_t* count) { size_t size = 0; size_t capacity = 16; char** words = xmalloc(capacity * sizeof(char*)); size_t len = strlen(str); for (size_t begin = 0; begin < len; ) { size_t i = begin; for (; i < len && isspace((unsigned char)str[i]); ++i) {} begin = i; for (; i < len && !isspace((unsigned char)str[i]); ++i) {} size_t word_len = i - begin; if (word_len == 0) break; char* word = xmalloc(word_len + 1); memcpy(word, str + begin, word_len); word[word_len] = 0; begin += word_len; if (capacity == size) { capacity *= 2; words = xrealloc(words, capacity * sizeof(char*)); } words[size++] = word; } *count = size; return words; } command_t* make_command_list(const char* table) { command_t* cmd = NULL; size_t count = 0; char** words = split_into_words(table, &count); for (size_t i = 0; i < count; ++i) { char* word = words[i]; command_t* new_cmd = xmalloc(sizeof(command_t)); size_t word_len = strlen(word); new_cmd->length = word_len; new_cmd->min_len = word_len; new_cmd->cmd = uppercase(word, word_len); if (i + 1 < count) { char* eptr = 0; unsigned long min_len = strtoul(words[i + 1], &eptr, 10); if (min_len > 0 && *eptr == 0) { free(words[i + 1]); new_cmd->min_len = min_len; ++i; } } new_cmd->next = cmd; cmd = new_cmd; } free(words); return cmd; } void free_command_list(command_t* cmd) { while (cmd != NULL) { command_t* next = cmd->next; free(cmd->cmd); free(cmd); cmd = next; } } const command_t* find_command(const command_t* commands, const char* word) { for (const command_t* cmd = commands; cmd != NULL; cmd = cmd->next) { if (command_match(cmd, word)) return cmd; } return NULL; } void test(const command_t* commands, const char* input) { printf(" input: %s\n", input); printf("output:"); size_t count = 0; char** words = split_into_words(input, &count); for (size_t i = 0; i < count; ++i) { char* word = words[i]; uppercase(word, strlen(word)); const command_t* cmd_ptr = find_command(commands, word); printf(" %s", cmd_ptr ? cmd_ptr->cmd : "*error*"); free(word); } free(words); printf("\n"); } int main() { command_t* commands = make_command_list(command_table); const char* input = "riG rePEAT copies put mo rest types fup. 6 poweRin"; test(commands, input); free_command_list(commands); return 0; }
Translate this program into C but keep the logic exactly as in Go.
package main import ( "io" "os" "strconv" "strings" "text/tabwriter" ) func readTable(table string) ([]string, []int) { fields := strings.Fields(table) var commands []string var minLens []int for i, max := 0, len(fields); i < max; { cmd := fields[i] cmdLen := len(cmd) i++ if i < max { num, err := strconv.Atoi(fields[i]) if err == nil && 1 <= num && num < cmdLen { cmdLen = num i++ } } commands = append(commands, cmd) minLens = append(minLens, cmdLen) } return commands, minLens } func validateCommands(commands []string, minLens []int, words []string) []string { var results []string for _, word := range words { matchFound := false wlen := len(word) for i, command := range commands { if minLens[i] == 0 || wlen < minLens[i] || wlen > len(command) { continue } c := strings.ToUpper(command) w := strings.ToUpper(word) if strings.HasPrefix(c, w) { results = append(results, c) matchFound = true break } } if !matchFound { results = append(results, "*error*") } } return results } func printResults(words []string, results []string) { wr := tabwriter.NewWriter(os.Stdout, 0, 1, 1, ' ', 0) io.WriteString(wr, "user words:") for _, word := range words { io.WriteString(wr, "\t"+word) } io.WriteString(wr, "\n") io.WriteString(wr, "full words:\t"+strings.Join(results, "\t")+"\n") wr.Flush() } func main() { const table = "" + "add 1 alter 3 backup 2 bottom 1 Cappend 2 change 1 Schange Cinsert 2 Clast 3 " + "compress 4 copy 2 count 3 Coverlay 3 cursor 3 delete 3 Cdelete 2 down 1 duplicate " + "3 xEdit 1 expand 3 extract 3 find 1 Nfind 2 Nfindup 6 NfUP 3 Cfind 2 findUP 3 fUP 2 " + "forward 2 get help 1 hexType 4 input 1 powerInput 3 join 1 split 2 spltJOIN load " + "locate 1 Clocate 2 lowerCase 3 upperCase 3 Lprefix 2 macro merge 2 modify 3 move 2 " + "msg next 1 overlay 1 parse preserve 4 purge 3 put putD query 1 quit read recover 3 " + "refresh renum 3 repeat 3 replace 1 Creplace 2 reset 3 restore 4 rgtLEFT right 2 left " + "2 save set shift 2 si sort sos stack 3 status 4 top transfer 3 type 1 up 1 " const sentence = "riG rePEAT copies put mo rest types fup. 6 poweRin" commands, minLens := readTable(table) words := strings.Fields(sentence) results := validateCommands(commands, minLens, words) printResults(words, results) }
#include <ctype.h> #include <stdbool.h> #include <stdio.h> #include <stdlib.h> #include <string.h> const char* command_table = "add 1 alter 3 backup 2 bottom 1 Cappend 2 change 1 Schange Cinsert 2 Clast 3 " "compress 4 copy 2 count 3 Coverlay 3 cursor 3 delete 3 Cdelete 2 down 1 duplicate " "3 xEdit 1 expand 3 extract 3 find 1 Nfind 2 Nfindup 6 NfUP 3 Cfind 2 findUP 3 fUP 2 " "forward 2 get help 1 hexType 4 input 1 powerInput 3 join 1 split 2 spltJOIN load " "locate 1 Clocate 2 lowerCase 3 upperCase 3 Lprefix 2 macro merge 2 modify 3 move 2 " "msg next 1 overlay 1 parse preserve 4 purge 3 put putD query 1 quit read recover 3 " "refresh renum 3 repeat 3 replace 1 Creplace 2 reset 3 restore 4 rgtLEFT right 2 left " "2 save set shift 2 si sort sos stack 3 status 4 top transfer 3 type 1 up 1"; typedef struct command_tag { char* cmd; size_t length; size_t min_len; struct command_tag* next; } command_t; bool command_match(const command_t* command, const char* str) { size_t olen = strlen(str); return olen >= command->min_len && olen <= command->length && strncmp(str, command->cmd, olen) == 0; } char* uppercase(char* str, size_t n) { for (size_t i = 0; i < n; ++i) str[i] = toupper((unsigned char)str[i]); return str; } void fatal(const char* message) { fprintf(stderr, "%s\n", message); exit(1); } void* xmalloc(size_t n) { void* ptr = malloc(n); if (ptr == NULL) fatal("Out of memory"); return ptr; } void* xrealloc(void* p, size_t n) { void* ptr = realloc(p, n); if (ptr == NULL) fatal("Out of memory"); return ptr; } char** split_into_words(const char* str, size_t* count) { size_t size = 0; size_t capacity = 16; char** words = xmalloc(capacity * sizeof(char*)); size_t len = strlen(str); for (size_t begin = 0; begin < len; ) { size_t i = begin; for (; i < len && isspace((unsigned char)str[i]); ++i) {} begin = i; for (; i < len && !isspace((unsigned char)str[i]); ++i) {} size_t word_len = i - begin; if (word_len == 0) break; char* word = xmalloc(word_len + 1); memcpy(word, str + begin, word_len); word[word_len] = 0; begin += word_len; if (capacity == size) { capacity *= 2; words = xrealloc(words, capacity * sizeof(char*)); } words[size++] = word; } *count = size; return words; } command_t* make_command_list(const char* table) { command_t* cmd = NULL; size_t count = 0; char** words = split_into_words(table, &count); for (size_t i = 0; i < count; ++i) { char* word = words[i]; command_t* new_cmd = xmalloc(sizeof(command_t)); size_t word_len = strlen(word); new_cmd->length = word_len; new_cmd->min_len = word_len; new_cmd->cmd = uppercase(word, word_len); if (i + 1 < count) { char* eptr = 0; unsigned long min_len = strtoul(words[i + 1], &eptr, 10); if (min_len > 0 && *eptr == 0) { free(words[i + 1]); new_cmd->min_len = min_len; ++i; } } new_cmd->next = cmd; cmd = new_cmd; } free(words); return cmd; } void free_command_list(command_t* cmd) { while (cmd != NULL) { command_t* next = cmd->next; free(cmd->cmd); free(cmd); cmd = next; } } const command_t* find_command(const command_t* commands, const char* word) { for (const command_t* cmd = commands; cmd != NULL; cmd = cmd->next) { if (command_match(cmd, word)) return cmd; } return NULL; } void test(const command_t* commands, const char* input) { printf(" input: %s\n", input); printf("output:"); size_t count = 0; char** words = split_into_words(input, &count); for (size_t i = 0; i < count; ++i) { char* word = words[i]; uppercase(word, strlen(word)); const command_t* cmd_ptr = find_command(commands, word); printf(" %s", cmd_ptr ? cmd_ptr->cmd : "*error*"); free(word); } free(words); printf("\n"); } int main() { command_t* commands = make_command_list(command_table); const char* input = "riG rePEAT copies put mo rest types fup. 6 poweRin"; test(commands, input); free_command_list(commands); return 0; }
Produce a functionally identical C code for the snippet given in Go.
package main import ( "fmt" "math" "strings" ) func main(){ fmt.Println(H("1223334444")) } func H(data string) (entropy float64) { if data == "" { return 0 } for i := 0; i < 256; i++ { px := float64(strings.Count(data, string(byte(i)))) / float64(len(data)) if px > 0 { entropy += -px * math.Log2(px) } } return entropy }
#include <stdio.h> #include <stdlib.h> #include <stdbool.h> #include <string.h> #include <math.h> #define MAXLEN 100 int makehist(unsigned char *S,int *hist,int len){ int wherechar[256]; int i,histlen; histlen=0; for(i=0;i<256;i++)wherechar[i]=-1; for(i=0;i<len;i++){ if(wherechar[(int)S[i]]==-1){ wherechar[(int)S[i]]=histlen; histlen++; } hist[wherechar[(int)S[i]]]++; } return histlen; } double entropy(int *hist,int histlen,int len){ int i; double H; H=0; for(i=0;i<histlen;i++){ H-=(double)hist[i]/len*log2((double)hist[i]/len); } return H; } int main(void){ unsigned char S[MAXLEN]; int len,*hist,histlen; double H; scanf("%[^\n]",S); len=strlen(S); hist=(int*)calloc(len,sizeof(int)); histlen=makehist(S,hist,len); H=entropy(hist,histlen,len); printf("%lf\n",H); return 0; }
Port the following code from Go to C with equivalent syntax and logic.
package main import ( "errors" "fmt" ) func TokenizeString(s string, sep, escape rune) (tokens []string, err error) { var runes []rune inEscape := false for _, r := range s { switch { case inEscape: inEscape = false fallthrough default: runes = append(runes, r) case r == escape: inEscape = true case r == sep: tokens = append(tokens, string(runes)) runes = runes[:0] } } tokens = append(tokens, string(runes)) if inEscape { err = errors.New("invalid terminal escape") } return tokens, err } func main() { const sample = "one^|uno||three^^^^|four^^^|^cuatro|" const separator = '|' const escape = '^' fmt.Printf("Input: %q\n", sample) tokens, err := TokenizeString(sample, separator, escape) if err != nil { fmt.Println("error:", err) } else { fmt.Printf("Tokens: %q\n", tokens) } }
#include <stdlib.h> #include <stdio.h> #define STR_DEMO "one^|uno||three^^^^|four^^^|^cuatro|" #define SEP '|' #define ESC '^' typedef char* Str; unsigned int ElQ( const char *s, char sep, char esc ); Str *Tokenize( char *s, char sep, char esc, unsigned int *q ); int main() { char s[] = STR_DEMO; unsigned int i, q; Str *list = Tokenize( s, SEP, ESC, &q ); if( list != NULL ) { printf( "\n Original string: %s\n\n", STR_DEMO ); printf( " %d tokens:\n\n", q ); for( i=0; i<q; ++i ) printf( " %4d. %s\n", i+1, list[i] ); free( list ); } return 0; } unsigned int ElQ( const char *s, char sep, char esc ) { unsigned int q, e; const char *p; for( e=0, q=1, p=s; *p; ++p ) { if( *p == esc ) e = !e; else if( *p == sep ) q += !e; else e = 0; } return q; } Str *Tokenize( char *s, char sep, char esc, unsigned int *q ) { Str *list = NULL; *q = ElQ( s, sep, esc ); list = malloc( *q * sizeof(Str) ); if( list != NULL ) { unsigned int e, i; char *p; i = 0; list[i++] = s; for( e=0, p=s; *p; ++p ) { if( *p == esc ) { e = !e; } else if( *p == sep && !e ) { list[i++] = p+1; *p = '\0'; } else { e = 0; } } } return list; }