text
stringlengths
8
5.77M
Tuesday, 26 November 2013 Everton v Liverpool preview I can’t wait for Everton v Liverpool. Even as an impartial spectator I absolutely love it. It’s my favourite fixture in the football calendar. The passion, intensity and entertainment that courses through it make it so special and unique. I do have the utter pleasure of holding a season ticket at Goodison Park and I look forward to going to the game all week, even when it’s not a biggie. Next week Everton play Stoke at home, hardly glamorous but I’ll be excited about it all week. That excitement and child on Christmas morning feeling is magnified and multiplied by 10 when Everton play Liverpool at home (especially when it’s on a Saturday). I still remember the FA Cup game in 2009 so fondly. It wasn’t actually the most entertaining of games in terms of goal scoring chances if memory serves me correctly, but it was such a great game in a different way. There was such tension, I think it was the most tense derby atmosphere I’ve ever witnessed (I am only 21) and both sets of fans were in great voice even before kick-off. When Steven Gerrard went off injured early on it was like Everton had scored, every Liverpool shot off target was greeted by a big relieved cheer of “waaaay”. It was dramatic, what with the late extra-time winning goal and the atmosphere- so keen even walking to the ground. It was a cold late January night and it just had a great feel to it. I was excited all day about it at school, jotting down my predicted line-ups in my Geography book, period 3. Then when I listened to the build-up on the radio on the way there and got to the ground there was such a sense of “this is no ordinary derby”. Not that derbies are ordinary by any means, but it was such a dramatic, atmospheric night and it was frankly one of my favourite ever games I’ve been to. Back to the present day this derby is, like last season’s at Goodison, set up very nicely. Liverpool are, you have to admit, looking improved this season and pose more threat than usual with Suarez AND Sturridge up front and Coutinho in and around there for company. But so are Everton, the blues have Romelu Lukaku up front who would give any defender a run for his money and has been in fantastic form for Everton overall so far. Everton also have the “like a new signing” talent of Ross Barkley who, again, can cause any defence problems and if he copes with the derby atmosphere and intensity, he will be a big threat on Saturday. Everton need to get back to scoring ways though, I wrote an article earlier in the week about how their wide players need to up their performances. Mirallas has been disappointing and Pienaar has looked rusty since returning from injury (an instant winner against Hull aside!). Baines and Coleman have stuttered a bit and I just think, especially in these big games, Everton thrive on their high intensity style of play and getting the ball out wide and crossing the ball a fair few times. That doesn’t mean “being ugly and long-ball”; it just means having a mixed style, which suits Everton. The game against Chelsea earlier in the season was a great example. Everton improved a lot in the second half when they went to a higher intensity style and drove at Chelsea more. That also gets the crowd going more and gets Everton’s tails up. So I think the wide players especially would thrive on this. It’ll be interesting as well to see how Everton deal with Suarez and Sturridge, I think Suarez is the biggest threat but Sturridge and Coutinho are big dangers too. But likewise, how will Liverpool deal with Lukaku, Barkley, Baines and co.? Everton and Liverpool both have more passing, intricate styles of play nowadays so it should be an interesting derby in terms of how the style of play pans out. Both sides are very close in terms of quality. Also, it has the added spice of Everton having finished above Liverpool for the last 2 seasons so there is a really intriguing battle for the title of kings of Merseyside ahead this season.
Q: Font Awesome Styling Q (Buttons In-Line) This is kind of a silly question since there is a simple answer, but I am trying to use font-awesome buttons in-line, as shown in this plunk. If I do this: <td class = "col-xs-1"> <span class="btn yellowFont fa fa-star" title = "Set this as the item's primary case." ng-if="!case.primaryCase"> </span> <span class="btn redFont fa fa-times" title = "Remove item from case." ng-if="!case.primaryCase"> </span> </td> the "btn" class pushes the second font-awesome icon to a new line. I can avoid this by removing the btn class, e.g. <span class="redFont fa fa-times"...> But this removes the default hover-over behavior, which I want to keep. Yet another solution is to have them in separate cells, but that makes the spacing between them far too wide (even 1/12 makes it too wide, and I don't know if I can further sub-divide table cells like I could with a normal grid, e.g. col-xs-1 for the cell and then col-xs-6 for each of the spans. In short, is there a way to have the font-awesome icons in line, next to the "Case Name" column, while keeping the default hover-over functionality (Yes, I do realize I can easily add a "on-mouseover" event, it's just dirty. A: You need to update the grid widths like shown below. In fact of the bootstrap grid should have 12 cols, take 3 and 9. <td class = "col-xs-3"> <span class="btn yellowFont fa fa-star" title = "Set this as the item's primary case." ng-if="!case.primaryCase"> </span> <span class="btn redFont fa fa-times" title = "Remove item from case." ng-if="!case.primaryCase"> </span> </td> <td class = "col-xs-9"> {{case.caseNumber}} </td>
Q: How can a custom ApplicationLoader start Dependency Injecting Actors and get tested? In "Dependency Injecting Actors" it's shown how to inject a parameter into the constructor of a child actor. The parent actor uses injectedChild to be allowed to pass to the child (at child creation time) only the non-injected parameter and then let Guice inject the rest. To do this, it extends InjectedActorSupport and gets the child's factory injected in the constructor: class MyParent @Inject() (childFactory: MyChild.Factory, @Assisted something: Something, @Assisted somethingElse: SomethingElse) extends Actor with InjectedActorSupport [..] val child: ActorRef = injectedChild(childFactory(something, somethingElse), childName) But what about the class that starts the parent and is not an actor but a custom ApplicationLoader? How can I start the parent actor from there? No mention of this is in the documentation. I tried doing the same for the loader as I did for parent: class MyLoader @Inject() (parentFactory: MyParent.Factory) extends ApplicationLoader with Actor with InjectedActorSupport { [..] val parent = injectedChild(parentFactory(something, somethingElse), parentName) would this be correct? How can I test it? class MyModule extends AbstractModule with AkkaGuiceSupport { def configure = { bindActor[MyParent](parentName) bindActor[MyLoader](loaderName) bindActorFactory[MyChild, MyChild.Factory] bindActorFactory[MyParent, MyParent.Factory] } } So: How do I start the parent from MyLoader while letting Guice dependency-inject what's required? How can I test MyLoader? This has been my test so far but now I need to pass the injected thingy to MyLoader and I don't know how (note the ***???**** in place of the argument which I do not know where to find): class MyLoaderSpec(_system: ActorSystem, implicit val ec: ExecutionContext) extends TestKit(_system) with WordSpecLike with BeforeAndAfterAll with Matchers { val loader = new SimstimLoader(???) override def beforeAll(): Unit = { loader.load(ApplicationLoader.createContext(new Environment(new File("."), ApplicationLoader.getClass.getClassLoader, Mode.Test))) } Thanks a million in advance! A: Here is how I solved this issue. --> How to start a parent actor who needs dependency-injection. First of all, manually starting such an actor is impossible if you, like me, need to dependency-inject an instance which you do not know how to pass and where from. The solution is to let Guice start the actor automagically. Here is how. First, create your binder module for Guice: class MyModule extends AbstractModule with AkkaGuiceSupport{ override def configure(): Unit = { bindActor[Root](Root.NAME) bind(classOf[StartupActors]).asEagerSingleton() } } Then, tell Play where your binder module is located by adding the following in your conf/application.conf: play.modules={ enabled += "my.path.to.MyModule" } The StartupActors is simply a class I use to log whenever the automagic start of dependency-injected actors actually takes place. I log the event so that I can be sure of when and whether it occurs: class StartupActors @Inject() (@Named(Root.NAME) root: ActorRef) { play.api.Logger.info(s"Initialised $root") } The Root actor in my case takes care of parsing a custom configuration. Since the resulting vars from the parsing is required by my parent actor and during the tests I need to mock such resulting vars, I delegate the parsing to an actor other than the parent actor, i.e., the Root actor: object Root { final val NAME = "THERoot" case class ParseConfiguration() } class Root @Inject()(configuration: Configuration, projectDAO: ProjectDAO) extends Actor { val resultingVar: Something = myConfigParsing() override def preStart(): Unit = { context.actorOf(Props(new MyParent(resultingVar: Something, somethingElse: SomethingElse, projectDAO: ProjectDAO))) } override def receive: Receive = { case ParseConfiguration => sender ! myConfigParsing() case _ => logger.error("Root actor received an unsupported message") } } The ParseConfiguration message is used uniquely for testing purposes. Normally the configuration parsing occurs instead because of the initialisation of the resultingVar attribute. This way, MyParent wont need to get anything injected. Only StartupActors and Root will get injected. MyParent will simply get projectDAO from Root and pass it on to all its children. class MyParent(something: Something, somethingElse: SomethingElse, projectDAO: ProjectDAO) extends Actor { ... } Finally, for completion, I'm reporting here how I wrote the tests since I had troubles finding enough information online around this as well. import akka.actor.{ActorRef, ActorSystem, Props} import akka.testkit.{TestKit, TestProbe} import com.typesafe.config.ConfigFactory import org.mockito.Mockito.mock import org.scalatest.{BeforeAndAfterAll, WordSpecLike} import org.specs2.matcher.MustMatchers import play.api.Configuration import scala.concurrent.ExecutionContext class RootSpec(_system: ActorSystem) extends TestKit(_system) with WordSpecLike with BeforeAndAfterAll with MustMatchers { implicit val ec: ExecutionContext = scala.concurrent.ExecutionContext.global val conf: com.typesafe.config.Config = ConfigFactory.load() val configuration: Configuration = Configuration(conf) val projectDAOMock: ProjectDAO = mock(classOf[ProjectDAO]) private var mainActor: ActorRef = _ private var something: Something = Something.empty def this() = this(ActorSystem("MySpec")) override def afterAll: Unit = { system.shutdown() } override def beforeAll(): Unit = { mainActor = system.actorOf(Props(new Root(configuration, projectDAOMock)), Root.NAME) } "RootSpec: Root Actor" should { val probe = TestProbe() "successfully parse the configuration file" in { probe.send(mainActor, ParseConfiguration) something = probe.expectMsgPF() { case msg => msg.asInstanceOf[Something] } } } } and then I test MyParent by conveniently providing mock objects in place of vars resulting from the configuration parsing: import akka.actor.{ActorRef, ActorSystem, Props} import akka.testkit.{TestKit, TestProbe} import org.mockito.Mockito import org.mockito.Mockito._ import org.scalatest.{BeforeAndAfterAll, WordSpecLike} import org.specs2.matcher.MustMatchers import scala.concurrent.ExecutionContext.Implicits.global import scala.concurrent.{ExecutionContext, Future} case class AnyProjectAPI(val projectAPI: ProjectAPI) extends AnyVal class MyParentSpec(_system: ActorSystem, implicit val ec: ExecutionContext) extends TestKit(_system) with WordSpecLike with BeforeAndAfterAll with MustMatchers { val something = mock(classOf[Something]) val somethingElse = mock(classOf[somethingElse]) val projectDAOMock: ProjectDAO = mock(classOf[ProjectDAO]) val projectTest: ProjectAPI = new ProjectAPI(allMyRandomConstructorArguments), val projectsList: List[ProjectAPI] = List(projectTest) val expectedCreationId = 1 private var parent: ActorRef = _ def this() = this(ActorSystem("MySpec"), scala.concurrent.ExecutionContext.global) override def afterAll: Unit = { system.shutdown() } override def beforeAll(): Unit = { parent = system.actorOf(Props(new MyParent(something, somethingElse, projectDAOMock)), MyParent.NAME) } "MyParentTesting: parent's pull request" should { when(myProjApi.getAllProjects).thenReturn(Future {projectsList}) val anyProject: AnyProjectAPI = AnyProjectAPI(org.mockito.Matchers.any[ProjectAPI]) Mockito.when(projectDAOMock.create(org.mockito.Matchers.any[ProjectAPI])) .thenReturn(Future {expectedCreationId}: Future[Int]) val probe = TestProbe() val probe1 = TestProbe() "be successfully satisfied by all children when multiple senders are waiting for an answer" in { probe.send(parent, UpdateProjects) probe1.send(parent, UpdateProjects) allChildren.foreach(child => probe.expectMsg(expectedCreationId)) allChildren.foreach(child => probe1.expectMsg(expectedCreationId)) } } }
The age group with by far the largest number of convictions for sex offenses are people between 14 and 20 years old. In 2002 I wrote this book Harmful to Minors and it argued that the things that we do in America to try to protect children from sex are way more harmful to them than sex itself—which is actually a great part of growing up—and that the things that we do such as criminalize kids sexuality, or put them into jail, or put them in psychological counseling, or giving them abstinence-only education—these things really have terribly grave consequences for kids. I wish I could say that that book made a difference in a positive direction but it didn't. Things have gotten way worse since 2002. Since that time almost every single state in the union has vigorously strengthened their sex crime statues. These laws are intended to protect children from sexual exploitation but they disproportionately affect teenagers. The age group with by far the largest number of convictions for sex offenses are people between 14 and 20 years old. These are, almost all of them, consensual acts of sex between kids with somebody who is about 2 or 3 years younger than them. There are 19,000 minors on sex offender registries nationally. 19,000! Some of these people are as young as 11 years old. In every state of the union if you have sex and you are a minor you are likely committing a felony. I will repeat this. If you are 16 in the state of Georgia and have sex with another 16 year old person you are committing a felonious act. You can be put in juvenile detention and after that you can be put into adult prison and after that you will be on a sex offender registry and once you're on a sex offender registry your life is effectively over. You can not get a job. You can not live in most places. You can not go into the military. You can not get into college. You can not get a loan for a college. You can live almost nowhere because there are these residency restrictions. You can't really have a relationship or have a family because you're not allowed to be near children, ever really, even your own children should you have them. These laws are very easy to get on the books. No amount of facts will stop them. Now these have been on the books for a long time, several decades, so there's a lot of evidence that shows they really don't protect anyone. The way sex panics work is that once you have more laws you have more enforcement. When you have more enforcement you have more arrests. What the laws do is they generally broaden the definition of a crime. For instance it used to be child pornography to take a picture of somebody who was under 12. They didn't really find enough child pornography and they had this big machine to go out and arrest people so then they made it 14 and then, still not quite enough, 16, and now 18. So you broaden the definition of the crime, you get more cops, you make more arrests, soon people are feeling like gosh there's a lot of crime. There's a perception of more crime and so they start to clamor for more laws and once they're on the books they're almost impossible to get off the books. Increasingly what the states are doing is not just punishing people, and especially minors, for sex—they're curing them! This conflation of punishment and cure also goes back a long time with overlapping religious and psychological cures. So you have this kind of slippage of different definitions of criminal, psychological and moral categories of sexual abuse, as they call it, and once you start to put these two things together there's a really twisted logic that's a tautology that kind of circles around and around on itself. So here's how it goes: According to sex abuse therapists, prosecutors, police and some journalists, even some parents, the behavior that kids are doing is wrong. It's wrong because it's illegal. Why is it illegal? Well it's illegal because it's wrong. But the really pernicious part of this is once you start to cure kids there's a whole industry of doing sex abuse therapy. The whole idea of offender treatment is already a conflation of these two agendas—the punishment agenda and the treatment agenda. These conflated terms are the lingua franca of the whole abuse industry. For instance there's a group called the National Adolescent Perpetrator Network which had a task force and they put out these standards of what they call sexual molestation. A criminologist named Frank Zimring did a really great book called An American Travesty and he takes all this stuff apart and he said, "According to this task force a majority of American men and boys have committed multiple acts of child molestation by the time they reach their 21st birthday. This aggregation of such behavior into one single category child molestation is an extraordinary abuse for an organization of therapists." What do they do with kids when they're in this therapy? The first axiom of it is that the therapist is not really there as a therapist on the side of the patient. The patient is actually seen as a kind of antagonist because he has broken the law, and the therapist's confederate is not the person in the room with them but the law, the prosecutor, so anything that the kid says to the therapist can and is used against him. Treatment involved putting a rubber-band appearing contraption hooked up through a computer around your penis and you sat in a dark room with your pants to your ankles and listened to various audio recordings What they do in these therapies is they make the kids rehearse over and over and confess the molestation that they've done, the fantasies that they have, the times they've masturbated, the times—should they be so lucky to actually have sex—the times they've had sex. They have to tell new people over and over, a new therapist, a new prosecutor, a new board of psychologists, and they're supposed to also reveal it to anyone that they might be thinking of having a relationship with, so that kind of cuts off the possibility of them kind of moving on out of this thing. What do they learn from it? As one kid who went through this said, "I learned that sex is bad." The assumptions of this system about sex and the protection of innocence and the dangerousness of sex offenders and about the appropriateness of state intervention in the sex lives of minors either through criminalization or through this pathologizing of teen sex, these assumptions are so widespread, so hegemonic, that even those people who critique the system use its own logic to do so. The argument against putting kids in jail and on sex offender registries is that it's unnecessary because treatment works, that's what they say, treatment works! Teens, it turns out, have the lowest recidivism rate of any class of sex offenders. Well it's obvious to me why they have a low recidivism rate. The reason is they get out of jail and they're no longer minors, so they are statutorily unable to commit the crime for which they were put in jail in the first place. The criminalization of teen sex is only the most extreme edge of a spectrum in the ways in which the state tries to protect kids by punishing them. The other things, you could say, really affect a lot more kids much more broadly and maybe even in a longer term way and one of these things is abstinence-only education which the federal government has spent 1.5 billion dollars on since 1982. That's when they passed what was called "the chastity law". It's the only money the federal government has ever in history put into sex education, and guess what, it didn't work either. Kids didn't stop having sex and in fact teen pregnancy is up in 26 states. Why are we so fucked up about sex? To tell you the truth I don't know because you go anywhere else in the world and people are really flabbergasted by us. I think the anarchist idea that the state needs to justify itself in order to perpetuate itself works really well when you're thinking about moral surveillance. You pass these laws, these bureaucracies get set up, and not just bureaucracies in the government but there are NGOs on the side and then there's professional organizations and there's therapists and all the rest and then there's the prison industrial complex—and then they need to have a reason to exist. So they have to do that both in their actions—they actually have to arrest a lot of people, and they also have to do it ideologically, discursively—that the culture needs to change for people to feel that this stuff really is wrong and it really is harmful. By this time it's really hard to find a parent who says, "Sure of course my kids are going to have sex and I want them to use birth control and don't want them to get any sexually transmitted diseases but this is wonderful I mean this is part of the great pleasure of being a kid and they'll stumble and they'll learn". It's really rare to find that. The ideological forces that try to repress sex are flexible. They're able to kind of change the target. In the 80s the big target of protection were women so there was a whole anti-porn movement at that moment. It didn't really take hold. People didn't sign on to it. There were two anti-porn ordinances that tried to pass in the Midwest in the 1980s but both of them were found to be unconstitutional. The advocates of censorship didn't just roll over and die. They changed their strategies and really started to hone in on kids—on protecting kids from sex. There was no adult left, no homosexual, adults were saying, "Look, it's consensual, leave me alone!" The advocates of censorship, I give a little catalog of how they change their names, because it's kind of interesting. How they went from protecting what they call "decency" to protecting children. So the Citizens For Decency Through Law became the Children's Legal Foundation and then that changed its name to the National Family Legal Foundation. The American Family Association was previously called the National Federation for Decency and then it got the word "family" in it. The National Coalition Against Pornography spun off into the National Law Center for Children and Families. The Justice Department's National Obscenity Enforcement Unit was rechristened the Child Exploitation and Obscenity Section. They set up this vast surveillance for child pornography. As I said before it was hard for them to find enough child pornography so they kept on widening the net. They brought in these vigilante groups like Perverted Justice. Do you remember? Some of you may have watched To Catch a Predator. Still couldn't get enough people so then they also started to say that a morphed image, a cartoon, an image in which there is no actual child being used to create pornography was also criminal. I just recently helped a couple in Kansas City who were arrested for child pornography. When their lawyer finally looked at the images they turned out to be pictures of naked Ken dolls. By this time their children had been taken out of their home and kept away from them for 4 months. Kids are being arrested for taking naked pictures of themselves —this is called sexting—and sending them on their cellphones to their friends. So the person can be a perpetrator and a victim of child pornography production at the same time! Then the friends who receive the images are now in possession. This happened in Greensburg Pennsylvania. Similar prosecutions have taken place in Alabama, Connecticut, Florida, New Jersey, New York, Michigan, Ohio, Texas and Utah, at last count. But there was a survey done of kids about their online behavior and 1 out of 5 kids said they had done sexting. So that's 20% of kids are doing some sort of a crime. Being caught for child pornography is no small thing. It is a federal crime and the penalties for it are four times higher, in general, than they are for murder. So if a kid gets prosecuted for one of these things they are in deep trouble and, as with all sex crimes, they will be on a sex offender registry afterwards. I think people in this room would probably agree that the state should stay out of consensual sex altogether for kids or adults. As for these crimes of passion I've been working on these issues for decades and really things have only gotten worse and I feel despairing about it. I don't know how it's going to change. I think the only way it's going to change is that it's going to get worse before it gets better. It turns out in Texas there's really a disproportionate amount of conviction, and this is true in California too, of Chicanos and Mexicans for having consensual relationships. Because it's pretty common, especially among working class and poor Mexicans, to have relationships in which the men are quite a bit older than the women. So it's really interesting, when you look at the names of people under surveillance in the state of California, there are a huge number of Hispanic names. These people get pulled into this thing and they're really astonished that the state could do this to their kids. It's completely heartbreaking. They've lost their children, they've lost their family, they've lost every penny they've got, their families are shamed in their neighborhoods, they have to move, and they get radicalized by it. The most radicalizing experience you can possibly have is to be on the other side of that gate. Once you are arrested you are no longer human. I think that in order for this kind of thing to change, you know, politics is not really rational—it's an emotional thing. Social movements are mobilized by feeling and once people start to have this tragic experience finally they may say, "ENOUGH!" I can tell you that we're probably getting to that point fast because I'll leave you with this statistic: At present 1 out of every 220 American men is under surveillance of the criminal justice system, in one way or another, for a sex offense. "The panic surrounding youthful sexuality can perhaps best be compared to the war on drugs: Both are based on ideology rather than science, and no amount of evidence can change the minds of true believers. Both mask underlying social agendas in which concern for children is used to control the behavior of adults. And both engender problems of credibility as young people reject exhortations to do as I say, not as I did."—What Judith Levine is Really Saying "What used to be called “playing doctor” for young children or thought of as normal sexual experimentation for older teens is now enough to get a kid arrested, taken away in handcuffs, put in juvenile jail, subjected to draconian psychological “treatment,” and put on a sex offender registry, often for the rest of his or her life! This is not just for aggressive or violent behavior, but for innocent, consensual play among giggling kids."—Criminalizing Child’s Play "Since the late 1900s, America has become an increasingly punitive society that sees fit to lock up its people—now almost one percent of us. Sex offenders are the latest category of villains for whom no sentence seems too harsh. The US federal sentencing guidelines make it official that photographing a 17-year-old boy with an erection earns a penalty about twice as severe as attempting to kill him—and about four times as severe as beating him up so badly that he accidentally dies."—Throwing Away the Key "America’s War on Sex is a comprehensive, well-coordinated attack on sexual education, entertainment, expression, health care by a large number of groups: local, state and federal government as well as morality groups, decency groups, right-wing media and right-wing think tanks."—Dr. Marty Klein
The Last Passover And The Institution Of The Lord's Supper -- Luke 22:1-38 “Now the feast of unleavened bread drew nigh, which is called the Passover. And the chief priests and scribes sought how they might kill Him; for they feared the people. Then entered Satan into Judas surnamed Iscariot, being of the number of the twelve. And he went his way, and communed with the chief priests and captains, how he might betray Him unto them. And they were glad, and covenanted to give him money. And he promised, and sought oportunity to betray Him unto them in the absence of the multitude. Then came the day of unleavened bread, when the passover must be killed. And He sent Peter and John, saying, Go and prepare us the passover, that we may eat. And they said unto Him, Where wilt Thou that we prepare? And He said unto them, Behold, when ye are entered into the city, there shall a man meet you, bearing a pitcher of water; follow him into the house where he entereth in. And ye shall say unto the goodman of the house, The Master saith unto thee, Where is the guestchamber, where I shall eat the passover with My disciples? And he shall show you a large upper room furnished: there make ready. And they went, and found as He had said unto them: and they made ready the passover. And when the hour was come, He sat down, and the twelve apostles with Him. And He said unto them, With desire I have desired to eat this passover with you before I suffer: for I say unto you, I will not any more eat thereof, until it be fulfilled in the kingdom of God. And He took the cup, and gave thanks, and said, Take this, and divide it among yourselves: for I say unto you, I will not drink of the fruit of the vine, until the kingdom of God shall come. And He took bread, and gave thanks, and brake it, and gave unto them, saying, This is My body which is given for you: this do in remembrance of Me. Likewise also the cup after supper, saying, This cup is the new testament in My blood, which is shed for you. But, behold, the hand of him that betrayeth Me is with Me on the table. And truly the Son of Man goeth, as it was determined: but woe unto that man by whom He is betrayed! And they began to enquire among themselves, which of them it was that should do this thing. And there was also a strife among them, which of them should be accounted the greatest. And He said unto them, The kings of the Gentiles exercise lordship over them: and they that exercise authority upon them are called benefactors. But ye shall not be so: but he that is greatest among you, let him be as the younger; and he that is chief, as he that doth serve. For whether is greater, he that sitteth at meat, or he that serveth? is not he that sitteth at meat? but I am among you as He that serveth. Ye are they which have continued with Me in My temptations. And I appoint unto you a kingdom, as My Father hath appointed unto Me; that ye may eat and drink at My table in My kingdom, and sit on thrones judging the twelve tribes of Israel. And the Lord said, Simon, Simon, behold, Satan hath desired to have you, that he may sift you as wheat: but I have prayed for thee, that thy faith fail not: and when thou art converted, strengthen thy brethren. And he said unto Him, Lord, I am ready to go with Thee, both into prison, and to death. And He said, I tell thee, Peter, the cock shall not crow this day, before that thou shalt thrice deny that thou knowest Me. And He said unto them, When I sent you without purse, and scrip, and shoes, lacked ye any thing? And they said, Nothing. Then said He unto them, But now, he that hath a purse, let him take it, and likewise his scrip: and he that hath no sword, let him sell his garment, and buy one. For I say unto you, that this that is written must yet be accomplished in Me, And He was reckoned among the transgressors: for the things concerning Me have an end. And they said, Lord, behold, here are two swords. And He said unto them, It is enough”-Luke 22:1-38. We now look at this lengthy section which deals with five distinct events: first, the treachery of Judas; second, the preparation and observance of the passover; third, the Lord’s Supper instituted; fourth, the place which His disciples will occupy in the future kingdom; and last, the Lord’s warning to Peter. The Passover Lamb was slain on the night the children of Israel were delivered out of Egypt. For the Jews the passover was a memorial of that event, but it was also a type of something that was yet to take place. The day had now come when this was about to be fulfilled. In 1 Corinthians 5:7-8 we read, “Purge out therefore the old leaven, that ye may be a new lump, as ye are unleavened. For even Christ our Passover is sacrificed for us. Therefore let us keep the feast, not with old leaven, neither with the leaven of malice and wickedness; but with the unleavened bread of sincerity and truth.” In the Bible leaven is always a symbol of evil, as we have seen. So we are called upon to put away from our lives everything unclean, everything contrary to the Spirit of Christ. For centuries Israel had kept this feast. Now the Lord Jesus Christ, the real Paschal Lamb, was in their midst and most of the people were utterly unaware of His presence. While He was preparing to keep the feast, the chief priests and scribes were conferring together how they might kill Him, little realizing that He was the antitypical Passover Lamb. “Then entered Satan into Judas surnamed Iscariot, being of the number of the twelve.” He was doing only what God had foreseen should be done. The perfidy ,of Judas was prophesied centuries before it became a reality. The leaders were plotting to kill Jesus, and Satan took possession of one of His disciples, who offered to betray Him for money. Think of Judas, companying with the Lord and the other disciples for three-and-one-half wonderful years, now communing with the chief priests and captains how he might deliver Him into their hands! There are many today who associate with Christians and take active part in religious services but have never known Christ themselves. Such was Judas. So when the time came Satan found in him a ready instrument to carry out his will. “And he went his way, and communed with the chief priests and captains, how he might betray Him unto them.” It would seem almost unbelievable were it not for the fact that the same kind of conduct has been repeated many times since. “And they were glad, and covenanted to give him money. And he promised, and sought opportunity to betray Him unto them in the absence of the multitude.” Judas imagined that no other eye saw nor ear heard as he plotted with the chief priests; but Jesus, God manifest in Him, knew all about the transaction, as He later revealed. Then the day came when the passover was to be killed. This involves a perplexing question for some people. We need to remember that the Jews’ day began at sunset, and it was after sunset on the fourteenth of Nisan that the Lord kept the pass-over with His disciples. Before the next sunset, that is, in the afternoon of the day following, our Lord Himself died on the cross. So He kept the Passover on the first evening of the appointed day, and He Himself suffered and died as the true Passover before the next evening. According to the Jews’ reckoning, therefore, both events took place on the one day. Jesus sent “Peter and John, saying, Go and prepare us the passover, that we may eat.” And they put the natural question to Him, “Where wilt Thou that we prepare?” He had no home in or about Jerusalem. But in those days it was customary for the Jews to have a special room set apart as a guestchamber where they might entertain travelers, especially at the passover time. Now Jesus knew of one in whose house He would be welcome, and where He could eat the passover with His disciples. So He said, “Behold, when ye are entered into the city, there shall a man meet you, bearing a pitcher of water; follow him into the house where he entereth in.” We might think these directions were rather indefinite. He did not tell them the man’s name nor anything else whereby to identify him; how were they to know when they met the right person? Well, you see it was a very unusual thing for a man to be found in the public streets bearing a pitcher of water. Ordinarily it was the women who went to the wells and carried the water, generally in earthen jars upon their heads. This is the common practice still in Oriental lands. So when Jesus said, “There shall a man meet you, bearing a pitcher of water,” He indicated something distinctive. The water-bearer may speak to us of those who with joy draw water from the wells of salvation. “And ye shall say unto the good-man of the house, The Master saith unto thee, Where is the guestchamber, where I shall eat the passover with My disciples?” That was all that was necessary. The owner of the house was evidently a believer in the Lord. “And he shall show you a large upper room furnished: there make ready.” It may be that this was the house in which John Mark lived, and that this large upper room was the same as that to which the disciples resorted after the resurrection of our Lord, and where the early Church held its first prayer-meetings. “And they went, and found as He had said unto them: and they made ready the passover.” They set the table with the roasted lamb, the unleavened bread, the bitter herbs, and the Passover wine. Then we read, “And when the hour was come, He sat down, and the twelve apostles with Him.” It was a blessed scene of fellowship, save for one jarring note-the presence of Judas the traitor. “And He said unto them, With desire I have desired to eat this passover with you before I suffer.” He had often participated in the pass-over feasts in the years that had gone. It was a picture of His own approaching death, and His love led Him to long to have His own with Him at the paschal table. He knew so well what was ahead of Him. He was the only One in Israel who knew that this passover prefigured His own death on Calvary and the salvation which He was to procure by the shedding of His precious blood. Now He had come to the last passover that God would ever recognize, the last passover of which He Himself would partake before fulfilling all He came to accomplish. He said, “I will not any more eat thereof, until it be fulfilled in the kingdom of God.” The type was passing away, the antitype was seen to take its place. “And He took the cup, and gave thanks.” This cup has nothing to do with the Lord’s Supper; it concluded the passover. He said, “Take this, and divide it among yourselves: for I say unto you, I will not drink of the fruit of the vine, until the kingdom of God shall come.” God had not commanded them to use the fruit of the vine in the passover, but this was a custom that had been practised for many centuries, and the Lord recognized this and accepted it. He Himself did not drink of it, for the fruit of the vine speaks of joy and gladness. He was going to death and sorrow: it was not His hour of gladness; He was to endure the cross before He entered into His joy. Following the passover He established the beautiful .ordinance which has been carried on by the Church of God for nineteen hundred years as a memorial of His death and suffering. “And He took bread, and gave thanks, and brake it, and gave unto them, saying, This is My body which is given for you: this do in remembrance of Me.” He took one of the passover loaves, the flat unleavened cakes, which He brake. Strange that anyone should have ever supposed that what He meant here was that the bread was changed into His own physical body. It was a symbolic act. The bread remained as it was after His thanksgiving, but it now had a special character as a picture of His body about to be given up to death. He said, “This is My body which is given for you: this do in remembrance of Me.” That is, do this from time to time to call Me to mind. “Likewise also the cup after supper, saying, This cup is the new testament in My blood, which is shed for you.” The word for “testament” and “covenant” is the same. I prefer the word “covenant” here. This is the cup of blessing (1 Corinthians 10:16) setting forth the new covenant in His blood about to be shed upon the cross for our redemption. As they drank of it they were expressing their fellowship as sinners redeemed to God by His blood. The day of the old covenant was passing away, and He was about to seal the new covenant by the shedding of His blood upon the cross. The Lord’s Supper (1 Corinthians 11:20) is a feast of remembrance, which is intended to carry our minds back to the death of our Saviour and also to cause us to look on to His coming again (1 Corinthians 11:26). It consisted, in the beginning, of a very simple meal, called the breaking of bread (Acts 2:46), and seems at first to have been observed daily or whenever a few Christians came together, possibly at the close of every ordinary meal. Later it appears to have been celebrated regularly on the first day of the week (Acts 20:7), though there is no hard-and-fast rule as to this. “As oft” as ye do this, seems to leave the question of time and frequency to the love and spiritual sensibilities of the disciples of Christ. In this service of remembrance the bread remains bread, and the fruit of the vine in the cup is unchanged in character, but the representative characters of both are insisted on. When Jesus said, “This is My body,” and, “This… is… My blood,” He sat in the midst of His followers, and His blood was still flowing in His veins and His body manifest among them. It was as if one held a photograph before a friend and said, “This is my mother.” No one would think that the piece of cardboard had been actually changed into the flesh and blood of a woman! But these memorials were designed to bring before us vividly the Person of our adorable Lord, enabling us to call Him to mind with more than ordinary clarity. Because of this, and of the expressed desire of Jesus Christ that we should thus remember Him, it has been the joy of christian hearts down through the centuries to come together around the table of the Lord to think of His sufferings, to meditate upon His love, and to enjoy communion with Him. In the celebration of the Lord’s Supper we are to be occupied with Christ Himself, with the memories of His love and grace, recalling His sorrows, sufferings, and death, and bearing in mind His promise to come again and receive us unto Himself. It is a mistake to think of this blessed ordinance as a means of grace, in the sense of having to do with the salvation of the soul. It is intended to deepen in the heart of those already saved, the realization of the preciousness of Christ. We come together to remember Him, and as He fills the vision of our souls we feast in spirit upon all that He is and all that He has done. Following this we have the treachery of Judas. “But, behold, the hand of him that betrayeth Me is with Me on the table.” We read, “After the sop Satan entered into him. Then said Jesus unto him, That thou doest, do quickly.” And he went immediately out and it was night-night not only outside but also in his own soul, never to be relieved by one ray of light. Jesus went on to say that the fact that the Son of Man had come into the world to die would not excuse those who deliberately sought to crucify Him. “And truly the Son of Man goeth, as it was determined: but woe unto that man by whom He is betrayed!” Actually, according to John 13:29-30, Judas left the room before the Lord’s Supper was instituted. In Luke 22:24 we read of a strife among” the disciples as to which of them should be the greatest. The Lord was about to die; He had just given them the communion, a picture of His death, and now these who really loved Him began to quarrel among themselves as to who would have the chief place in the coming kingdom. Pride is so hard to root out. There they were with the shadow of the cross falling over them, striving among themselves as to who should be greatest. He gently rebuked them by indicating that although this ambitious spirit is common among the nations and is to be expected among sinful men, it should not be found among His own. “But ye shall not be so: but he that is greatest among you, let him be as the younger; and he that is chief, as he that doth serve.” It was customary for worldly leaders to seek to hold their fellows in subjection, and those who did so were looked up to as benefactors if they seemed to govern righteously. But this lust for place and power is inconsistent for a disciple ,of Jesus. Greatness is shown by lowly service. The kingdom of God is the only kingdom ever known to man where the greatest are those who take the humblest place. “For whether is greater, he that sitteth at meat, or he that serveth? is not he that sitteth at meat? but I am among you as He that serveth.” In this attitude Jesus has set the example which all His followers should emulate. Then our Lord said, “Ye are they which have continued with Me in My temptations. And I appoint unto you a kingdom, as My Father hath appointed unto Me.” When He comes again to reign in glory, those who share His rejection now will participate with Him in His triumph (Revelation 3:21). He refers not to the present age but to that which succeeds this, when His kingdom will be established over all this earth; and in that day those who have been identified with Jesus, His own people, who owned Him when He was mocked and rejected, will have a wonderful place of recognition. The twelve will sit ,on thrones and judge the twelve tribes of Israel. “That ye may eat and drink at My table in My kingdom, and sit on thrones judging the twelve tribes of Israel.” The twelve (Matthias taking Judas’ place, Acts 1:26) are to have a special place in the administration of the coming kingdom in connection with restored Israel. While of the Church, they will rule with Christ over Israel on earth. The Lord says finally, “Simon, Simon, behold, Satan hath desired to have you, that he may sift you as wheat.” The word translated “desired” is really a stronger term than our English word; it is better rendered “demanded.” Just as Satan went before God and practically demanded to have the opportunity to test Job, accusing him before God, saying that Job loved God only for what God gave him, so Satan demanded to test Peter. But Jesus said, “I have prayed for thee, that thy faith fail not.” You know when we get into the devil’s sieve he can shake us up badly, but all that is left when he is through is chaff: the wheat falls through, and Satan has only the chaff. So do not be afraid of the devil’s sieve; God is able to sustain us. Remember that Jesus has said, “I have prayed for thee, that thy faith fail not!” Peter failed sadly. He denied his Lord three times, but his faith was preserved, and we find him turning back to Jesus and able to say, “Lord, Thou knowest all things, Thou knowest that I love Thee.” The Lord Jesus said, “And when thou art converted (when you are restored), strengthen thy brethren.” Sometimes the Lord has to allow some of His best servants to fail terribly in order to show them their weakness, and that they may be more tender and sympathetic toward others. Not realizing his own weakness Peter said, “Lord, I am ready to go with Thee, both into prison, and to death.” But the Lord said, “I tell thee, Peter, the cock shall not crow this day, before that thou shalt thrice deny that thou knowest Me.” The Lord knew Peter far better than he knew himself, and He knows you and me better than we know ourselves. Next our Lord warned His disciples of coming conflicts. He knew what would take place, and He said to them, “When I sent you without purse, and scrip, and shoes, lacked ye any thing?”-that is, when He sent them out into the cities of Galilee to give out the message of the gospel of the kingdom. “And they said, Nothing.” Everything had been provided. He said to them, “But now, he that hath a purse, let him take it, and likewise his script: and he that hath no sword, let him sell his garment, and buy one.” He did not mean literally that they should be armed with material swords; but we are taught elsewhere in Scripture that the Word of God is sharper than any two-edged sword (Hebrews 4:12). When they were ready to leave the upper room they said to Him, “Lord, behold, here are two swords. And He said unto them, It is enough”- that is, no more talk about that. He was not speaking about actual defense; He was not interested in weapons. He wanted them to go forth armed with the sword of the Spirit that they might meet the enemies of the truth as they went forth to proclaim the gospel. Verses 39-53 The Agony In Gethsemane -- Luke 22:39-53 “And He came out, and went, as He was wont, to the mount of Olives; and His disciples also followed Him. And when He was at the place, He said unto them, Pray that ye enter not into temptation. And He was withdrawn from them about a stone’s cast, and kneeled down, and prayed, saying, Father, if Thou be willing, remove this cup from Me: nevertheless not My will, but Thine, be done. And there appeared an angel unto Him from heaven, strengthening Him. And being in an agony He prayed more earnestly: and His sweat was as it were great drops of blood falling down to the ground. And when He rose up from prayer, and was come to His disciples, He found them sleeping for sorrow, and said unto them, Why sleep ye? rise and pray, lest ye enter into temptation. And while He yet spake, behold a multitude, and he that was called Judas, one of the twelve, went before them, and drew near unto Jesus to kiss Him. But Jesus said unto him, Judas, betrayest thou the Son of Man with a kiss? When they which were about Him saw what would follow, they said unto Him, Lord, shall we smite with the sword? And one of them smote the servant of the high priest, and cut off his right ear. And Jesus answered and said, Suffer ye thus far. And He touched his ear, and healed him. Then Jesus said unto the chief priests, and captains of the temple, and the elders, which were come to Him, Be ye come out, as against a thief, with swords and staves? When I was daily with you in the temple, ye stretched forth no hands against Me: but this is your hour, and the power of darkness”-Luke 22:39-53. Leaving the upper room the Lord went with His eleven disciples across the brook Kedron to the Mount of Olives. It had been His custom, when in Judaea, to retire from time to time to a garden on the slope of this mountain, called, as we are told elsewhere, Gethsemane. To this retreat He pursued His way. Luke does not mention the fact that He left eight of His followers at the entrance but took Peter, James, and John with Him as He passed into the garden. Coming to the place where He was wont to engage in prayer He bade them, “Pray that ye enter not into temptation. And He was withdrawn from them about a stone’s cast,” going deeper into the shades of the olive-yard, for such it was. There He fell on His knees and prayed. He was suffering intense perturbation of spirit. The very fact that He was the infinitely Holy One filled Him with deepest grief as He contemplated the full meaning of the cross. He could not have been who and what He was if He could contemplate with equanimity the awfulness of being made sin for a guilty world. His holy human nature shrank from this terrible ordeal. It was not death that He dreaded; but “with strong crying and tears” He prayed to “Him who was able to save Him out of death,” as Hebrews 5:7 should be translated. We are told there that He “was heard in that He feared,” or literally, He “was heard for His piety”; that is, His reverence for God His Father. In His soul’s distress, He prayed, saying, “Father, if Thou be willing, remove this cup from Me: nevertheless not My will, but Thine, be done.” What was the cup which He dreaded? I have heard many unworthy things said by those who have endeavored to explain this. Some have maintained that He was in such distress that He feared He might lose His reason and be unable to go on to the cross as a voluntary Substitute for sinners. But they who speak in this way lose sight of the fact that He was not only Man in all perfection, but also God with all power. Satan could do nothing against Him save by divine consent; and nowhere in Scripture is it intimated that the devil might be permitted such an advantage as this over the Christ of God. Others have taught that He feared the adversary would crush Him to death in the garden, and the plan of God be defeated which involved His hanging upon a tree. But this theory ignores His own declaration, “No man taketh it (His life) from Me, but I lay it down of Myself. I have power to lay it down, and I have power (authority) to take it again. This commandment have I received of My Father” (John 10:18). This absolutely contradicts any supposition as to Satan’s ability to destroy Him before His time. The cup He dreaded was not death as such. It was the cup of judgment which our sins had filled. In Psalms 75:8 we read, “In the hand of the Lord there is a cup, and the wine is red; it is full of mixture; and He poureth out of the same: but the dregs thereof, all the wicked of the earth shall wring them out, and drink them.” This cup of the wrath of God against sin was that from which the Holy Soul of our Saviour shrank. There in the garden He prayed that if there were any other way whereby the sin question might be settled, it should be manifested. There was no opposition to the will of the Father, no conflict of wills. It was rather full acquiescence with the will of God, even though He dreaded the drinking of that chalice of judgment. It was the perfection of His humanity that was manifested in that hour of His spirit’s agony. Luke alone of all the Evangelists tells us that, “There appeared an angel unto Him from heaven, strengthening Him.” How this emphasizes the reality of His Manhood! He, the Creator of angels, now as Man, derived strength from the ministry of one of these glorious beings. “Being in an agony He prayed more earnestly: and His sweat was as it were great drops of blood falling down to the ground.” There was great significance in this for Dr. Luke, to whom alone we are indebted for this information. It indicated the severity of the pressure under which our Lord was suffering. When the ordeal was over He arose in perfect calmness of spirit and came to His disciples, whom He found “sleeping for sorrow, and said unto them, Why sleep ye? rise and pray, lest ye enter into temptation.” For them the supreme test was about to take place, when He would be taken from them and they left bewildered and frightened. Even as He spoke lights were seen, and a mob of soldiers, priests, and civilians approached, led by Judas the traitor, who “drew near unto Jesus to kiss Him.” This was the prearranged signal which would indicate to the officers whom they were to arrest. “Jesus said unto him, Judas, betrayest thou the Son of Man with a kiss?” Apparently, the wretched traitor made no reply, and the soldiers proceeded to take Jesus into custody. The disciples were aroused by this act and exclaimed, “Lord, shall we smite with the sword?” One of them-Peter, as we know from other sources-began slashing about with his sword, and cut off the right ear of the servant of the high priest. But Jesus said, “Suffer ye thus far;” and He healed the wounded man. Someone has well remarked, “How busy we keep the Lord putting on ears that we in our mistaken zeal, cut off!” Addressing the chief priests and other officials, Jesus said, “Be ye come out, as against a thief, with swords and staves? When I was daily with you in the temple, ye stretched forth no hands against Me: but this is your hour, and the power of darkness.” It was a home-thrust. They had not dared attempt to arrest Him in the presence of the people, because many of them believed He was a Prophet even if they did not recognize in Him the promised Messiah. But in the dark these cowardly ecclesiastics and their henchmen laid hands on Him as He willingly surrendered Himself to them, and they led Him away for trial as a blasphemer and a sedition-ist. It was a sad manifestation of the incurable evil of the hearts of those outwardly pious priests and religious leaders. Verses 54-62 Peter's Failure And Repentance -- Luke 22:54-62 “Then took they Him, and led Him, and brought Him into the high priest’s house. And Peter followed afar off. And when they had kindled a fire in the midst of the hall, and were set down together, Peter sat down among them. But a certain maid beheld him as he sat by the fire, and earnestly looked upon him, and said, This man was also with Him. And he denied Him, saying, Woman, I know Him not. And after a little while another saw him, and said, Thou art also of them. And Peter said, Man, I am not. And about the space of one hour after another confidently affirmed, saying, Of a truth this fellow also was with Him: for he is a Galilean. And Peter said, Man, I know not what thou sayest. And immediately, while he yet spake, the cock crew. And the Lord turned, and looked upon Peter. And Peter remembered the word of the Lord, how He had said unto him, Before the cock crow, thou shalt deny Me thrice. And Peter went out, and wept bitterly”-Luke 22:54-62. In relating these life-stories it is characteristic of Holy Scripture to give us, not only the evidence of the love and devotion, but also something of the mistakes and sins of the friends of God in the Old Testament, and the disciples of our Lord Jesus Christ in the New. The reason is, I believe, that God would have us learn how to avoid their failures as well as to imitate their virtues, and follow them as they followed Christ. We might think that it would have been best to have told us only the good things and to have covered their blunders, but then we would be likely to come to the conclusion that these servants of God and our Lord Jesus Christ in past centuries were quite different from us; that they were men superior to us, and they did not fail as we do. So we get the whole story. Many souls have been warned and helped by the account of Peter’s failure and, thank God, his repentance. The whole life of Peter as we learn it from our Bible is most interesting and instructive: this sturdy fisherman who, from the time he first met the Lord Jesus, lost his heart to Him. His first meeting with Jesus was on that occasion when, as we read in John 1:41, his own brother, Andrew, sought him out and brought him to the Lord after Andrew and John, the author of the fourth Gospel, had spent the afternoon with the Saviour. From that time on Peter’s heart was won for Christ, but he did not immediately leave all for Him; he was not called to do so. Afterward the Lord was preaching on the shores of the Sea of Galilee, and the crowd thronged Him. Jesus looked about, and there was Peter’s fishing-boat near the shore; the Lord asked for permission to enter it, and Peter gladly received Him. Jesus told him to thrust out a little from the land; and using Peter’s boat as a pulpit He taught the people. This was easy to do. Anyone who has been there will recall how the land along the shore rises upward, forming an amphitheater. The throng could have stood or sat on the ground and looked at the Lord as He preached the Word. Possibly the message did not really reach the heart of this man Simon; but afterward when the crowd dispersed, Jesus turned to him and said, “Launch out into the deep, and let down your nets for a draught” (Luke 5:4). Peter was surprised at this, for the sun was shining; it was a most unlikely time for fishing, and he said, “Master, we have toiled all the night and have taken nothing.” Now the day was no time for fishing, but Peter said, “At Thy word I will let down the net;” and immediately they enclosed a great multitude of fish. You know the rest of the story. The interesting thing is this: when Peter saw the fish they had caught at that time of day he knew he was in the presence of the Creator ,of the fish, and he fell down at the feet of Jesus and said, “Depart from me; for I am a sinful man, O Lord.” And yet he took Him by the feet, as much as to say, “While I know I am not fit for Your company, Lord, You shall not get away from me if I can help it.” The Lord never turns away from a sinner’s confession. He spoke words of encouragement to Peter, assuring him of His confidence in him and saying, “Fear not; from henceforth thou shalt catch men” (Luke 5:10). Jesus called Peter into full-time association with Himself; so he left the fishing business to become a fisher of men. Later on Peter made his great confession of faith: “He asked His disciples, saying, Whom do men say that I the Son of Man am? And they said, Some say that Thou art John the Baptist: some, Elias; and others, Jeremias, or one of the prophets. He saith unto them, But whom say ye that I am?” Answering for all the disciples, Peter replied with holy enthusiasm, “Thou art the Christ, the Son of the living God. And Jesus answered and said unto him, Blessed art thou, Simon Bar-jona: for flesh and blood hath not revealed it unto thee, but My Father which is in heaven” (Matthew 16:13-17). It is always a divine revelation when one is brought to know the Lord Jesus Christ in the true mystery of His Person. Then the Lord said, “I say unto thee, That thou art Peter, and upon this rock (the rock of this confession) I will build My Church; and the gates of hell shall not prevail against it” (Matthew 16:18). I do not think Peter ever rose to a greater height in his experience while the Lord was with him on earth than at that time. But have you noticed that his backsliding began almost immediately afterward? We need to heed the important warning: “Let him that thinketh he stand-eth take heed lest he fall” (1 Corinthians 10:12). The Lord had just spoken of the wonderful revelation given to Peter and then went on to tell them of His approaching death on the cross, to be followed by His resurrection; and Peter, exalted undoubtedly by the abundance ,of the revelation, turned to the Lord and dared to say to Him, “Be it far from Thee, Lord: this shall not be unto Thee” (Matthew 16:22). He was correcting, or attempting to correct Jesus for saying He was to be delivered to the Gentiles and be crucified. Peter declared that nothing like that should take place. The Lord immediately turned to him and said, “Get thee behind Me, Satan: thou art an offence unto Me: for thou savorest not the things that be of God, but those that be of men” (Matthew 16:23). What a rebuke to be given to the prince of the apostles, and that so soon after he had made his great confession! Evidently he had become exalted by spiritual pride, and Satan led him to say that which, if acted upon, would mean that we would have been left without a Saviour and our sins unatoned for. It was only by going to the cross that the propitiation for sin could be made. We do not read much concerning the experiences of Peter after that, but we do know that he never reached such a high spiritual point again. On the Mount of Transfiguration, when Jesus was speaking with Moses and Elias of His decease which He would accomplish at Jerusalem, Peter felt he must say something-though he knew not what to say- and so he blurted out, “Lord, it is good for us to be here: if Thou wilt, let us make here three tabernacles; one for Thee, and one for Moses, and one for Elias. While he yet spake, behold, a bright cloud overshadowed them: and behold a voice out of the cloud, which said, This is My Beloved Son, in whom I am well pleased; hear ye Him” (Matthew 17:4-5). As much as to say, “Peter, do not put anybody on the level with My Son; He must have the pre-eminence in all things.” Scripture passes over the rest of Peter’s history until the night of our Lord’s betrayal. Then we see him with the rest of the disciples in the upper room. The Lord said, “All ye shall be offended because of Me this night: for it is written, I will smite the Shepherd, and the sheep of the flock shall be scattered abroad” (Matthew 26:31). Self-confident, yet loving the Lord and meaning every word, but failing to realize his own weakness, Peter said, “Although all shall be offended, yet will not I” (Mark 14:29). “I am ready to go with Thee, both into prison, and to death” (Luke 22:33). He was to go both to prison and to death in after years for Christ’s sake, but he was not ready at this time. The Lord said to him, “I tell thee, Peter, the cock shall not crow this day, before that thou shalt thrice deny that thou knowest Me.” And He who knew Peter so well, also said, “But I have prayed for thee, that thy faith fail not: and when thou art converted, strengthen thy brethren.” They went out to the garden of sorrow; and there Peter failed with the others: for the Lord took Peter, James, and John into the garden with Him. Ere He went a little farther to talk with His Father, He said to the three, “Watch and pray, that ye enter not into temptation: the spirit indeed is willing, but the flesh is weak” (Matthew 26:41). And He went away and prayed, saying, “O My Father, if it be possible, let this cup pass from Me: nevertheless not as I will, but as Thou wilt” (Matthew 26:39). And when He rose from His knees He found the three disciples sleeping for sorrow; it was the weakness of the flesh. Peter was asleep when he should have been alert, watching and praying. The Lord aroused them from their sleep and again bade them watch and pray; and He went away the second time, praying the same words, “Not My will, but Thine be done.” When He came the third time and found that Peter was still asleep, He said, “Sleep on now, and take your rest: behold, the hour is at hand, and the Son of Man is betrayed into the hands of sinners” (Matthew 26:45). Then came Judas and the rest, and Judas said, “Hail, Master; and kissed Him.” They came and took Jesus, and Peter became enraged. He was alert now, and he turned and drew his sword and cut off the ear of one of the servants of the high priest. The Lord said, “Put up thy sword,” and He healed the man. This was the energy of the flesh on Peter’s part. He, who before had been asleep when he should have been alert, was now roused up and active when he should have been passive and quiescent. They took Jesus away, and we are told that “Peter followed afar off.” This was a further evidence of his backslidden condition: instead of keeping close to Jesus and letting all see that he was identified with Him, he fell behind; his love would not let him leave entirely. Finally he reached the high priest’s house. There in the court a fire was burning, for it was a cold night; and Peter went in and sat with others around the fire. Again we see him drifting: in company with the ungodly while his Lord was on trial. “A certain maid beheld him as he sat by the fire, and earnestly looked upon him, and said, This man was also with him. And he denied Him, saying, Woman, I know Him not. And about the space of one hour after another confidently affirmed, saying, Of a truth this fellow also was with Him: for he is a Galilean. And Peter said, Man, I know not what thou sayest.” The more he opened his mouth the more he got into trouble. The Galileans had their own peculiar accent, so that the Judeans recognized Peter immediately as one from the northern province. His speech betrayed him. Evidently because he was overcome with fear, Peter began to curse and to swear, saying, “I know not the Man.” “And immediately the cock crew.” The Saviour’s words came back to Peter as Jesus looked upon him. Peter had gone down, down, down, until he had denied all knowledge of Christ. But now, oh, how he wept as Jesus gazed sadly and reproachfully upon him! That was the beginning of the work of restoration. Repentance had commenced. If we follow the record we find that the Lord had a private interview with Peter after the resurrection. We are told that the women who arrived at the tomb early on the resurrection morning were instructed to “Go your way, tell His disciples and Peter” (Mark 16:7). I am sure Peter must have been greatly distressed during those three days and nights; he felt that he had lost all contact with Jesus. But the risen Lord acknowledged him as a disciple still. When the two Emmaus disciples returned to the Eleven, they said, “The Lord is risen indeed, and hath appeared to Simon” (Luke 24:34). Undoubtedly Peter was fully restored at the time of the Lord’s private interview with him. His public restoration took place on the shores of Galilee shortly after, on that morning when the Saviour cooked Peter’s breakfast and served him and his fellow-disciples after they had toiled all night and again had caught nothing. Three times the Lord put the question to Peter: “Lovest thou Me?” Peter was grieved that Jesus asked him this question three times, but he had denied his Lord three times. Having restored him, the Lord said to Peter, “Feed My lambs… feed My sheep.” Oh, the infinite grace of our blessed Lord! We have failed Him, but He never has failed us. I can call upon all who believe and trust in Him to bear witness. God grant that as we face the difficulties of the coming days we will lean more completely upon Him; that we will faithfully acknowledge Christ, our blessed, risen Lord. Let us be careful not to trust in our own strength, but distrusting ourselves to rely wholly on Him, that we may ever be true to the trust committed to us! Verses 63-71 Jesus Before The Priests -- Luke 22:63-71 “And the men that held Jesus mocked Him, and smote Him. And when they had blindfolded Him, they struck Him on the face, and asked Him, saying, Prophesy, who is it that smote Thee? And many other things blasphemously spake they against Him. And as soon as it was day, the elders of the people and the chief priests and the scribes came together, and led Him into their council, saying, Art Thou the Christ? tell us. And He said unto them, If I tell you, ye will not believe: and if I also ask you, ye will not answer Me, nor let Me go. Hereafter shall the Son of Man sit on the right hand of the power of God. Then said they all, Art Thou then the Son of God? And He said unto them, Ye say that I am. And they said, What need we any further witness? for we ourselves have heard of His own mouth”-Luke 22:63-71. We have considered the agony in Gethsemane and the arrest of our blessed Lord when He was taken to the high priest’s house in the middle of the night. Then we noticed the failure, the denial of the apostle Peter; and as we looked a little farther on in the record we saw how graciously he was restored. Now we come back to the house of the high priest. It was directly contrary to Jewish law to conduct a trial in Jerusalem in the night-time, but all this was forgotten when the hatred of His enemies stirred their hearts to seek the condemnation and destruction of the Lord Jesus Christ. As we consider this portion we find several things emphasized. One is this: in order to be saved it is not enough that a person be religious. I suppose these priests were as religious as anyone in all Israel at this particular time. They were the religious leaders of the people; they believed firmly in the revelation that Jehovah had given of Himself as the one true and living God. Some have the idea that if one believes in one God nothing more is required; but we remember the apostle James (James 2:19) has said, “Thou believest that there is one God; thou doest well: the demons also believe, and shudder” (literal rendering). Demons recognize the truth of the unity of the Godhead, and they know that some day they are going to be called to judgment before Him; so they shudder at the very mention of His name. Mere faith, mere recognition rather, of the fact that there is one God does not save anyone. A man might turn from the worst kind of heathenism, fetishism, or any other form of paganism, and accept the idea that there is only one God and henceforth profess to serve Him, and yet not be saved at all. These priests believed in one God, but they were not saved. More than that, they believed in the inspiration of the Bible; they accepted the sacred writings as divinely given, and they believed in the prophetic character of those writings. They knew the Scriptures foretold the coming of the Messiah into the world. For centuries their forefathers had been studying the writings of the prophets; and they, themselves, had been looking forward to the coming of this Just One. Yet when the Lord Jesus Christ actually came in fulfilment of all that was written aforehand, they did not recognize Him. They refused to accept Him; they spurned Him, and turned Him over to Pilate that He might be crucified. There is something here that you and I may well take to heart. Many profess to accept the Bible as a revelation from heaven, at least to recognize the fact that God has spoken in it to mankind as in no other book. In that respect they are orthodox. But remember, one may believe all this and yet not know God’s salvation. It is not enough to know the Scriptures in order to be saved. Years ago when I first visited the Jerry McAuley Mission in New York, I sat through a very interesting service, and at the conclusion a man pointed to an old Scotsman over in one corner of the room, and he said to me, “That is Old Chapter-and-Verse.” I inquired what he meant by that. He replied, “Well, that is the name we have given him-Old Chapter-and-Verse. He is an alcohol addict; we never have known him to be sober. Yet every night he is at the meeting. He sleeps through most of it, but let anyone get up to give a testimony and misquote a scripture and Old Chapter-and-Verse wakes up at once. He has such a knowledge of the Bible from his Scotch bringing-up that it stirs him when he hears anyone misquote Scripture. The other night somebody got up and quoted that passage in Matthew 11:28 according to the old English prayer-book rendering, rather than from the Authorized Version: ‘Come unto Me, all ye that are weary.’ Old Chapter-and-Verse jumped up at once and said, ‘Haud on noo. Dinna ye be handlin’ the Word o’ God deceitfully. It does na’ say, ‘All ye that are weary,’ it says, ‘All ye that labor and are heavy laden;’ then he dropped back to go to sleep until somebody else misquoted another scripture.” Poor old man! He had a head full of Bible and a heart full ,of sin. The Bible says no drunkard shall inherit the kingdom of God. This man knew the Bible but not the Saviour of whom it speaks. These priests knew their Bibles, and yet they rejected the Christ of the Bible. They knew the Bible so well that some thirty years before, when Herod had heard of the birth of the King and inquired where Christ should be born, the scribes and chief priests turned at once to the prophecy, and answered, “In Bethlehem of Judaea: for thus it is written by the prophet. ‘And thou Bethlehem, in the land of Juda, art not the least among the princes of Juda: for out of thee shall come a Governor, that shall rule My people Israel’” (Matthew 2:6). They knew exactly where Messiah was to be born, and yet they did not receive Him for themselves. As He grew up to Manhood and went about ministering the Word among His own people, they actually fulfilled their own Scripture by condemning Him. So it is not enough to be acquainted with Scripture. One needs to open his heart to Christ and receive Him as his personal Saviour: for the Bible says, “There is none other name under heaven given among men, whereby we must be saved” (Acts 4:12). The men who took Jesus mocked Him and smote Him. I suppose these were the riff-raff, the reckless mob. They realized their religious leaders were against Christ, so they turned against Him too. “And when they had blindfolded Him, they struck Him on the face, and asked Him, saying, Prophesy, who is it that smote Thee?” Our blessed, adorable Lord, who was led as a lamb to the slaughter and as a sheep before the shearers was dumb, answered not a word. “And many other things blasphemously spake they against Him.” As the first light appeared upon the horizon, the leaders, chief priests, and scribes came together and led Him into their council. This was the supreme council in Israel which was made up of seventy of their most noted elders. They were there to judge the Lord Jesus Christ; and we are told in another Gospel that they brought a great many false witnesses to testify against Him-men who declared they had heard Him say certain things which they pieced together with other sayings which they tried to prove He had said, but which He never had said at all. In this way they endeavored to convict Him of blasphemy. They asked Him, “Art Thou the Christ?” The Lord Jesus answered, “If I tell you, ye will not believe: and if I also ask you, ye will not answer Me, nor let me go.” That is, if He were to assert Himself and say, “I am the Messiah,” giving Scripture to show how the Word of God had been fulfilled in Him, they would not believe. He knew their hearts were set upon rejecting Him. There was no evidence of repentance, and there was no sense of their need of a Saviour. That is why men and women are lost today: they reject Christ; they imagine they can get along without Him; they have no realization of the innate deceitfulness of their hearts. I have known many persons who objected to the truth of the gospel, claiming they could not believe it; until at last, broken down under the convicting power of the Holy Spirit of God, they realized their lost condition and the sinfulness of their lives, and found that only Jesus could meet their need. They had no difficulty trusting Him then; for they saw, as John Hambleton, the converted actor, used to put it, that “Jesus Exactly Suits Us Sinners.” The Lord Jesus Christ never attempted to answer these objectors, because He knew they had no desire to understand the truth. He said on one occasion, “If any man will do His will, he shall know of the doctrine, whether it be of God, or whether I speak of Myself” (John 7:17). But these people had no desire to make such a test; they were not ready to face things honestly in the presence of God. Jesus went on to make a marvelous declaration. He told them that though they spurned Him then, “Hereafter shall the Son of Man sit on the right hand of the power of God.” To them this was the very height of blasphemy; it amounted to nothing less than a claim to actual Deity. They continued the examination by inquiring-though not with any desire to know the truth-“Art Thou then the Son of God?” Doubtless they remembered what was written by Daniel the Prophet, of one like the Son of Man who came to the Ancient of Days to receive power, and glory, and a kingdom. Did Jesus mean that this prophecy referred to Himself? Was He the Son of the Highest? He answered, “Ye say that I am.” That is, they had spoken the truth in using that title when referring to Him. He was indeed the Son of God. They were full of indignation and cried, “What need we any further witness? for we ourselves have heard of His own mouth.” So they put Him down as guilty of blasphemy. And they were right if, as many claim today, He were only a man, even though the best and greatest of humankind; because for any mere man to claim what Jesus claimed for Himself would rightly prove Him to be either self-deceived or a blasphemer. But the Word reveals ,our blessed Lord to be God the Eternal Son who came down to this world, taking humanity into union with Deity, in order that He might go to the cross to give His life a ransom for sinful men.
Pathogenic mechanisms and current epidemiological status of HEV infection in asymptomatic blood donors and patients with chronic diseases. In recent years, the seroprevalence of anti-hepatitis E virus immunoglobulins (HEV) has increased in European countries with significant variability among the different geographical areas. HEV infection is spread in a wide range of animal species of which domestic pigs and wild boar represent the main reservoirs of genotype 3 and 4 (the genotypes present also in Europe). European citizens are incidental hosts, mainly infected by direct contact or consumption of foods derived from undercooked or insufficient hygiene handling infected pork products or wild boar meat. Epidemiologically, the HEV incidence is low in humans but serological data show a high proportion of subclinical infection caused by genotypes 3 or 4. In the general population, asymptomatic infection represents a high potential risk in particular subjects such as blood component recipients or occupationally exposed workers. This review offers a landscape of the current epidemiological status of HEV infection (genotypes 1, 2, 3, 4, 7) both in European asymptomatic subjects, patients with chronic diseases, and domestic pig impact on humans. We also underline advantages/disadvantages of high sensitivity and specificity tests using for detecting viral RNA or anti-HEV antibodies.
..............................................This Blog Named to LexisNexis' 2011 Top 50 List Tuesday, June 18, 2013 Secretary Moniz Testifies On DOE Science & Technology Priorities Jun 18: The House Science, Space and Technology Committee, Chaired by Representative Lamar Smith (R-TX) held a hearing to review the U.S. Department of Energy (DOE) Science & Technology Priorities. DOE Secretary Ernest Moniz was the only witness. In an opening statement, Rep. Smith said, "To many, the Department of Energy (DOE) is typically not regarded as a "science agency." But from its origins with the Manhattan Project to its current programs and mission, science has always served as DOE's foundation. Approximately $8.5 billion, or one-third of the Department's budget, is focused on civilian science and technology activities that fall under this Committee's jurisdiction. . . "Dr. Moniz's tenure begins at an extraordinary time in our nation's energy history. We are now just a few years into an energy revolution driven by hydraulic fracturing (fracking) that has enabled dramatic increases in oil and natural gas production. The notion of true American energy independence -- long dismissed as unrealistic -- is now attainable, perhaps even by the end of this decade. . . The shale boom has been accompanied by important energy policy debates. These include whether the Federal government should regulate fracking, whether the Keystone XL Pipeline should be built and how best to handle liquefied natural gas exports. . ." Ranking Member Eddie Bernice Johnson (D-TX) said, "I am pleased with the Department's budget request this year. If approved, the Office of Science, ARPA-E, the Office of Electricity, and the Office of Energy Efficiency and Renewable Energy would all receive a much-needed boost to advance the development of clean energy technologies that will be vital to our national security, our economy, and our environment in the decades to come. It is worth reminding my colleagues here today that we have seen how government research can pay off when it comes to energy development. DOE-supported research was key to the development of high-efficiency gas turbines for coal plants, nuclear reactors developed at federal labs, and the directional drilling and hydraulic fracturing practices that have led to the shale gas boom of today. But we should remember that those achievements required decades of federal investment, the overwhelming majority of which was focused on fossil and nuclear energy. I continue to support research to make today's technologies cleaner and more efficient, but I believe that it is time to level the playing field and introduce real competition to the markets. That is where the priorities set by this budget request come into play." Secretary Moniz said in part, "The mission of the Department of Energy could not be more urgent or important. From our efforts to find affordable and clean sources of energy, to ensuring the security of our nuclear stockpile, to cleaning up the legacy of the Cold War -- our work, which includes advancing the science that underpins these missions, is essential to our prosperity, environment, and security. Today, I will lay out my vision for how the Department can be best positioned to address these challenges. . . the President advocates an all-of-the-above energy strategy and I am very much in tune with this. . . "Since President Obama took office, the global energy landscape has undergone a profound change. In the United States, oil and gas production has increased each year, while oil imports have fallen to a 20 year low. At the same time, renewable electricity generation from wind, solar, and geothermal sources has doubled; and carbon emissions have fallen to the lowest level in the U.S. in nearly two decades. These changes have important implications for our economy, environment, and national security. Already we are seeing the effects of increased U.S. oil and natural gas production on global energy markets. . . "The President's Fiscal Year 2014 budget also requests continued support for the Advanced Research Projects Agency - Energy (ARPA-E), to support high-impact energy related research projects with the potential to transform the energy sector. ARPA-E has invested in roughly 285 high-risk, high-reward research projects that, if successful, could create the foundation for entirely new industries. Seventeen of these projects, which received an initial investment from ARPA-E of approximately $70 million in total, have attracted over $450 million in publicly-announced private sector follow-on funding. ARPA-E funded companies and research teams have produced a battery that doubled the energy density of any previous design, successfully engineered microbes that use carbon dioxide and hydrogen to make fuel for cars, and developed a one megawatt silicon carbide transistor the size of a fingernail. . . "The risks of global climate change threaten the health, security, and prosperity of future generations. DOE must continue to support a robust R&D portfolio of low-carbon options and key enablers: efficiency, renewables, nuclear, carbon capture and sequestration, energy storage, and smart and resilient grids. The President's FY 2014 Budget requests resources to invest in programs that support research, development, and deployment of the energy technologies of the future that will reduce greenhouse gas emissions and increase energy security. These investments will help us double American energy productivity by 2030, double renewable electricity generation again by 2020, cut net oil imports in half by the end of the decade, save consumers and businesses money by reducing energy use, and support groundbreaking research and innovation to safely and responsibly leverage every domestic source of energy. . ." In lengthy testimony he addressed various DOE mission areas including: Energy Technology and Policy; Science; Nuclear Security; Environmental Remediation; Management and Performance; and concluded that DOE, "has significant responsibilities that bear on America's economic, energy, environmental and nuclear security future. I have appreciated the opportunity to collaborate with members of this Committee and with other members of Congress both during my previous tenure at DOE and in the years since. I am committed to working with the Congress in a search for the solutions to the country's energy and nuclear security challenges. As President Obama has said, 'Today, no area holds more promise than our investments in American energy. After years of talking about it, we're finally poised to control our own energy future.' The investments included in the Administration's Energy Department budget request are vital to ensuring America's energy security and securing America's place as the world leader in the clean energy economy." Access the Republican website for the hearing with links to testimony and video (click here). Access the Democratic website for the hearing with links to testimony and video (click here). [#Energy]
Sign up to FREE email alerts from MyLondon - MyWestLondon News Subscribe Thank you for subscribing See our privacy notice Invalid Email The Metropolitan Police has published the latest crime statistics for July 2019 which show the levels of crime in all London boroughs. The data - which is available to freely view at met.police.uk - gives details of how many crimes are reported in each borough per 1,000 people. This allows for a level playing field when comparing boroughs with large populations such as Barnet (390,000 people) and low populated boroughs such as Kensington and Chelsea (156,000 people). In total across the whole of London there were 74,642 crimes in July which means there is roughly 8.29 crimes per 1,000 people. Theft is the highest reported crime with 20,089 instances recorded in July. You can find the most dangerous boroughs and least dangerous below: (Image: PA) 32) Richmond upon Thames - 4.99 crimes for every 1,000 people There were a total of 998 crimes in Richmond Upon Thames in July. Violence against a person was the highest reported crime with 273 reported cases. Theft was second with 278 reported crimes. In March 2019 Richmond South had the highest levels of crime overall in the borough. 31) Sutton - 5.21 crimes for every 1,000 people There were a total of 1,079 crimes in Sutton in July. Violence against a person was the highest reported crime with 350 acts recorded by police. Theft was again second with 222 reported crimes. In March 2019 Sutton Central and Town Centre had the highest levels of crime overall in the borough. 30) Bexley - 5.55 crimes for every 1,000 people In total the borough of Bexley saw 1,385 reported crimes with violence against a person being the highest (423). The second highest crime was vehicle offences with 246 and then theft at 255. In June 2019 the ward of Erith was considered the place you were most likely to be a victim of crime. (Image: @khoja) 29) Harrow - 5.62 crimes for every 1,000 people The total crime figure in Harrow was 1,431 in July. 415 cases of violence against a person and 300 incidents of theft. The third and fourth positions were taken by vehicle offences and burglary respectively. When looking at the year up to June 2018 to June 2019 the ward with the most crime was Greenhill. 28) Havering - 5.79 crimes for every 1,000 people There were 1,502 instances of crime in Havering in July which equates to 5.79 crimes per 1,000 people. Violence against a person (484) and theft (296) took the top two positions. 27) Merton - 5.86 crimes for every 1,000 people 1,234 crimes in Merton were reported to police in July 2019. Violence (364) and theft (272) were once again the highest recorded crimes. When looking at figures from police for the month of April 2019 Figge's Marsh would be the ward you were most likely to be a victim of crime. 26) Bromley - 5.91 crimes for every 1,000 people There were 1,975 crimes in the borough of Bromley in July. There were 599 reported cases of violence and 415 for theft. The next two highest were for burglary and vehicle offences. 25) Redbridge - 6.04 crimes for every 1,000 people In total there were 1,863 crimes in Redbridge for July. Violence against the person was the highest with 554 instances. Theft was second with 376 cases. 24) Kingston upon Thames - 6.09 crimes for every 1,000 people There were 1,001 crimes in Kingston Upon Thames which is one of London's least populated boroughs. Theft topped the list of the highest recorded crimes with 316 incidents. Grove is considered to be the most dangerous place in the borough according to figures from the police for May 2019. It is worth noting that this area is also the boroughs main shopping area. (Image: David Cook) 23) Barnet - 6.47 crimes for every 1,000 people There were a total of 2,566 crimes in Barnet in July. Violence against a person was the highest reported crime with 686 reported cases. Theft was second with 529 reported crimes. 22) Waltham Forest - 6.58 crimes for every 1,000 people There were 1,867 crimes in Waltham Forest in Jully. The highest was for violence at 488 and then theft at 377. Drug offences were fourth with 171 incidents. 21) Wandsworth - 6.59 crimes for every 1,000 people There were 2,125 incidents of crime in the Wandsworth during July 2019. Violence against a person (578) leads the crime rate figures as with most boroughs. However theft was only just behind with 515 incidents. According to figures released in May 2019 Northcote is the most dangerous borough. 20) Hillingdon - 6.83 crimes for every 1,000 people 2,124 crimes in Hillingdon were reported to police in July 2019. Violence (638) and theft (437) were once again the highest recorded crimes. According to statistics released for June 2019 Yiewsley was the most dangerous area in the borough . (Image: David Nathan) 19) Brent - 7.18 crimes for every 1,000 people The total crime figure in Brent for July was 2,416. 761 cases of violence and 408 of theft were the highest recorded. Drug offences (224) were the fourth highest after vehicle offences. In figures released for May 2019 Harlesden was the ward with the most crime Enfield - 7.30 crimes for every 1,000 people 18) Enfield - 7.30 crimes for every 1,000 people There were a total of 2,479 crimes in Enfield in July. Violence against a person was the highest reported crime with 766 acts recorded by police. Vehicle crime was the second highest with with 439 reported crimes, closely followed by theft with 420 instances. In June 2019 Upper Edmonton had the highest levels of crime overall in the borough. 17) Ealing - 7.33 crimes for every 1,000 people There were 2,570 crimes in Ealing for July Violence against a person topped the list of the highest recorded crimes with 735 incidents. East Acton is considered to be the most dangerous place in the borough according to figures from the police for April 2019. (Image: David Nathan) 16) Croydon -7.45 crimes for every 1,000 people There were a total of 2,909 crimes in Croydon in July. Fairfield is recorded as the most dangerous ward for July 2019. In terms of the type of crimes violence (975) tops the list and theft is second (273). 15) Lewisham - 7.57 crimes for every 1,000 people There were a total of 2,350 crimes in Lewisham in July. Violence against a person was the highest reported crime with 757 reported cases. Theft was second with 439 reported crimes. In July 2019 New Cross ward had the highest levels of crime overall in the borough. 14) Barking and Dagenham - 7.82 crimes for every 1,000 people Violence against a person (607) was the highest crime in Barking and Dagenham with theft second (296). Interestingly arson and criminal damage was the fourth highest crime with 123 reports. In June 2019 Abbey was confirmed as the ward which you would be most likely to be a victim of crime. (Image: Ged Cann) 13) Hounslow - 7.89 crimes for every 1,000 people A total of 2,195 crimes were reported in Hounslow during July. Public order offences was the fourth highest recorded crime with 183 reported crimes. There were 783 recorded instances of violence against a person. From June 2018 to June 2019 the ward of Syon saw the most crime in the borough. 12) Greenwich - 8.25 crimes for every 1,000 people There were 2,359 crimes recorded in Greenwich for July. The highest was violence against a person (731) followed by theft (464). The fourth highest was arson and criminal damage with 171 instances. 11) Newham - 8.55 crimes for every 1,000 people 3,102 crimes were recorded in Newham in July 2019. There were 344 reported instances of drug related crime. Violence (800) and theft (693) were again the highest in the borough. 10) Lambeth - 8.95 crimes for every 1,000 people A total of 2,989 crimes were recorded in July in Lambeth. Theft was the highest crime committed with 837 instances, then followed by violence against a person (791). Burglary was third with 291 crimes recorded. In May 2019 Bishop's ward was the most likely place to be a victim of crime. This area includes some of the most popular tourist attractions in London and the busiest station in the country, Waterloo. 9) Tower Hamlets - 8.97 crimes for every 1,000 people There were 2,837 crimes in July in Tower Hamlets. The top offence were violence against a person (779) and theft (700). Burglary was third and vehicle crime fourth. (Image: Isabel Infantes/PA Wire) 8) Haringey - 9.66 crimes for every 1,000 people There were 2,756 crimes recorded in Haringey for July. The fourth highest crime committed was robbery where the police recorded 257 crimes. Violence against a person was the highest crime with 682. 7) Southwark - 10.08 crimes for every 1,000 people The total number of crimes reported in Southwark were 3,240 for the month of July. With much of Southwark forming the central parts of London you would expect the levels of crime to be high. Theft was the highest with 994 reported crimes followed by violence at 793. In fourth place was drug offences with 253 instances. 6) Hackney - 10.94 crimes for every 1,000 people There were 3,073 crimes in Hackney in July. Theft is the number one crime with police recording 943 instances. Violence against the person is second with 714 instances. 5) Hammersmith and Fulham - 11.06 crimes for every 1,000 people 2,031 crimes were committed in July in Hammersmith and Fulham. Theft was the highest by a considerable margin with 658 reported cases. Violence against a person was second with 467. Public order offences were fourth with 148 instances. 4) Islington - 11.15 crimes for every 1,000 people 2,649 crimes were reported to the police in Islington during July. Theft is by a long way the highest reported crime with 941 instances. Violence against a person (575) is second but almost half the amount of crimes were recorded. In date arelease by the police for May 2019 Finsbury Park was the area within Islington with the most crime. 3) Camden - 12.42 crimes for every 1,000 people There were 3,137 crimes in Camden during July. 1,301 of the total figure were crimes of theft. The next highest is violence against a person with a much lower 610 reported crimes. In May 2019 police statistics reveal that Holborn and Covent Garden are the area that you will most likely be a victim of crime. 2) Kensington and Chelsea - 12.49 crimes for every 1,000 people Whilst Kensington and Chelsea has a higher crime rate per person than Camden the total amount of crimes is much lower standing at 1,982 for July. Theft again is extremely high (779) when compared against all other crimes in the borough. Violence against a person, which is second, only had 380 recorded instances of the crime. In May 2019 Brompton and Hans Town was the area where you are most likely to be a victim of crime. This area includes some of London's most famous attractions such as the Natural History Museum. Get MyLondon news with Alexa It's now easier than ever to get your London news - all you have to do is ask Alexa. You can get all the latest London headlines daily using the MyLondon flash briefing. And you don't even have to lift a finger. Just read this article to find out how to get it set up on your Amazon Echo or mobile device. 1) Westminster - 25.32 crimes for every 1,000 people - Most dangerous borough There were 6,389 crimes reported by police in July 2019 in Westminster. Theft is by far the most prevalent crime with 3,420 instances. Violence against a person is second on 931 instances. Westminster of course is the main tourist centre of London with millions visiting each year so perhaps the figures are not as surprising as at first glance.
Research on autism interventions helps parents make better choices (Medical Xpress)—More children than ever are being diagnosed with autism, which means more parents than ever face a dizzying array of often expensive treatment options. Giving parents and professionals authoritative information is the purpose of a new review spearheaded by the Frank Porter Graham Child Development Institute at the University of North Carolina at Chapel Hill. Without a thorough review of autism interventions, Allison Smith of Pawtucket, R.I., might never have asked to try video-modeling to help her twin sons, age 4, develop the key motor skill of blowing a feather, a steppingstone to speech. "Knowledge is power," said Smith, who found video-modeling on a list of proven interventions from the National Professional Development Center (NPDC) on Autism Spectrum Disorders, a multi-university center to promote the use of evidence-based practices. UNC is one of three NPDC operating sites. "Knowing what works has given us the upper hand in acquiring appropriate therapy and tools." Autism incurs an average lifetime price tag of $3.2 million per person, according to a 2007 research study in the Archives of Pediatric and Adolescent Medicine. But the Autism Society estimates that early diagnosis and effective interventions can reduce that lifetime cost by two-thirds. "Parents often pay for interventions that have no evidence behind them," said FPG director Samuel L. Odom, who co-headed the new review. "This report will allow them to make the best choices." In this five-year update for the NPDC, UNC scientists screened 29,000 articles about autism spectrum disorders to find the ones proven to work best. Compared to the 24 proven interventions in the 2008 report, the new report lists 27. Applying even more stringent criteria this time, the FPG team dropped "structured work systems" and added five practices: "exercise," "structured play groups," "scripting," "modeling" and "cognitive behavior intervention." After considering more studies, scientists also renamed and broadened one category, "technology-aided instruction." "Expanding the list offers more tools to educators and service providers. This improves outcomes for children with ASD," said Kristine Ganley, a training and technical assistance provider at George Mason University. NPDC's report on evidence-based practices provides important guidance for professionals and families. Before NPDC's list, parents and professionals often searched for practices online, with unreliable results. "Some interventions may seem cutting-edge, but we don't yet know if they have any drawbacks or trade-offs," said FPG investigator Connie Wong, the new report's lead author and co-head of the review of research. "Our report only includes what's tried and true." Related Stories Increased awareness of autism spectrum disorder (ASD) is placing huge demands on health care systems and health care professionals to help children and their families cope with the disorder. A comprehensive evidence-based ... (Medical Xpress)—Difficulty with social situations hinders the relationships, schoolwork, and mental health of teens with autism. Often these students struggle with complicated interactions in high school, but scientists ... As the number of children with autism increases nationwide, the need for effective and consistent clinical diagnosis is growing. A statewide committee recently published new guidelines designed to ensure health profession ... Researchers at the University of North Carolina at Chapel Hill have found that preschoolers with Autism Spectrum Disorder (ASD) who receive high-quality early intervention benefit developmentally regardless of the treatment ... Many children with intellectual disability or lower functioning autism spectrum disorders, particularly those in low and middle income countries, do not receive psychosocial treatment interventions for their condition. If ... Recommended for you The communication struggles of children with autism spectrum disorder can drive parents and educators to try anything to understand their thoughts, needs and wants. Unfortunately, specialists in psychology ... Technology is often maligned for having a negative influence on young people, particularly on their ability to develop healthy social relations and a sense of identity. But technology can also be a force for good. ... While aggression toward caregivers and peers is a challenge faced by many individuals and families dealing with autism, there has been much speculation in the media over the possibility of generally heightened aggression ... (Medical Xpress)—A pair of researchers with Emory University in Atlanta has published a Perspective piece in the journal Science, questioning whether oxytocin can help people with an autism spectrum disord ... A growth hormone can significantly improve the social impairment associated with autism spectrum disorder (ASD) in patients with a related genetic syndrome, according to a pilot study conducted at the Icahn ... User comments Please sign in to add a comment. Registration is free, and takes less than a minute. Read more Click here to reset your password. Sign in to get notified via email when new comments are made.
[Etiology, prophylaxis and treatment of extensive, multifocal cicatricial tracheal stenosis at the junction of sciences--surgery and anesthesia]. 759 patients with cucatritial stenosis of trachea were treated in the Russian Scientific Center of Surgery in the period from 1963 to 2009. Extensive or multifocal stenosis was diagnosed in 172 patients. 157 patients were previously operated in other hospitals. The lesion of larynx during admission was diagnosed in 122 cases. All patients were operated in compliance with the principle of alternation methods of anesthesia and respiratory support. As a result of consistent application of the landmark reconstructive-plastic operations and resection in combination with endoscopic surgery good results were achieved. Based on the data, treatment algorithm of extended and multifocal cicatricial stenosis of the trachea was developed.
Here are some incisive questions asked by a Twitter participant named Anne D on my idea that a better approach to health care reform might be to allow for large, competing, non-employer based competing self-funded ERISA Plans. The answers are what they are but these are particularly excellent questions and I thank Anne D for allowing me to share them. QUESTION: Isn't individual market essentially such that your "group" is the state you live in, minus people with employer insurance, thus, "Here are your plan options?" . At best. That is what is called "Community Rating." That is how rates in the Exchanges are set. The alternative is "Experience Rating," where the insured's rates are calculated based on claims data for similarly situated individuals. Generally, Community Rating benefits older or less health people and Experience Rating benefits younger or healthier individuals. Groups plans tend to be more balanced groups demographically and, in addition, they have group buying power. Additionally, inevitably, the younger healthier individuals grow older and less healthy and groups give you a way to account for that in a more obviously equitable way. (It is less the current, "I'm getting screwed on rates in ObamaCare!" and more "I know I will pay slightly more when I am young in order to pay slightly less when I am older.") QUESTION: Do we try to insure everyone first, or make sure everyone with insurance has optimal insurance first? ACA tries to do the first, but the individual. market is often unaffordable, while employer plans are often crud. But without the ACA, some people can't even get crud. Because of this, I'm not sure the health insurance market isn't optimally a group (rather than individual) market. Even in a Community Rated System, the individual has limited market power and that market power is atomized, even in the Exchanges under PPACA or under the Federal Employee Health Benefit Program ("FEHBP"). Modern Managed Care Insurance models are both an insurance model and a group discount model. "Discounted Fee for Service" means doctors and institutional providers provide Plans a volume discount. With commercial plans, participants and beneficiaries may see less of that savings than in what I am proposing, essentially not-for profit Plans bargaining with payers for actuarial services and administration and with doctors and institutional providers over fee schedules. Perhaps the first step is to modify the Employee Retirement Income Security Act ("ERISA") and its implementing regulations (which, despite the name, covers health plans as well) to make it easier to form non-employer-based groups. QUESTION: Some of the problem is states refusing Medicaid expansion, but even without that, how to insure people who aren't part of any organization? I'm not sure Medicaid is such a good program. The reimbursement rates are low and many doctors do not participate (the buzz word is "par'), pushing a lot of Medicaid patients into treatment at EDs, which tends to be both expensive and scatter-shot. I think "privatizing" Medicaid into these non-employer based Plans might be a useful approach. The Plans would be paid a Per Member/Per Month ("PM/PM") fee to provide care for a number of Medicaid patients assigned. The Plans would also have other participants and beneficiaries and could have some ability to incentivize more physicians to treat Medicaid patients and to incentivize Medicaid patients to be more compliant patients. This could put both more accountability and a human face on a system that is often abused by everyone. QUESTION: BUT WHAT IS THE VALUE OF DECIDING WHAT TESTS SHOULD BE COVERED? There are a couple of levels to this answer: clinical; economic and managerial. Further, the medical guidance as to what screening tests are required changes all the time. Recently, the guidance on mammograms changed considerably. Mandating these things as a matter of law, makes it far more difficult to stay current with the state of the art in medicine. Economically, the key to building groups that are economically sustainable is to have enough young healthy participants and beneficiaries. Making that group pay a higher fee to defray the costs of older people’s screening tests hardly seems an effective way to do so. Managerially, the better approach to this might be to not provide first dollar coverage of screening tests, but to reduce the premiums of those (generally older members) of these Plans who comply with the recommended schedules of screenings. QUESTION: COULD STATES BE A BASIS FOR SUCH PLANS? Attempts to do this have not been unknown. Several states, including the State of Hawaii, have tried to pass single payer laws since the 1970s. Vermont attempted to actually implement such a plan in 2011, abandoning the effort by 2014. As a first impression, it would appear that this might possibly work better with smaller states or larger cities, where you might get large (but wieldy) groups comprised of a balanced group by age and health status. It has not proven sustainable for small states to date and city-sponsored HMOs have tended to become not-for-profits. It also seems that running an ERISA Plan is a bit outside the “core business” of government. QUESTION: ISN”T THE WHOLE COUNTRY THE LARGEST POSSIBLE GROUP? WHY NOT BRITISH OR CANADIAN STYLE SINGLE PAYER? Again, providing (as with British National Health Service {“NHS”}) or financing healthcare (as with Canadian, Australian or New Zealand Medicare) is not really a core business of government. Beyond that, competition usually leads to lower prices and higher quality and fuels innovation. A good example would be the issues with cost and quality with the US Automobile industry prior to the rise of the German and Japanese auto industries that forced Detroit to lower prices and improve quality. Having large, well-designed, competing ERISA Plans seems to provide a fairly good way to increase quality and decrease costs. Company sponsored self-insured ERISA Plans (like those of Kroger’s and Whole Foods) are widely admired for their low costs and high quality. Guild (unions that consist of independent contractors) Plans, such as the Screen Actors’ Guild or Writers’ Guild of America, are likewise well regarded for their low costs and high quality. Making these proposed Plans non-employer-based also may make it possible to develop a workable “Bismarck System,” a system of government mandated, work-related, private insurance, used in places like France, the FRG and Japan. Despite the fact that a system of employer-provided private insurance became common in the US during and after WWII, it never became universal and now covers a declining plurality of Americans. Part of the reason for this is that self-employment and starting a small business is (and has been) common in the US. The “Gig Economy” has exacerbated these trends. Comments The issue is that Americans want high quality, ease of service health care for a bargain basement price. Countries that have health care provided to all its citizens have the usual long waits, rationalized care, reduced care, etc. But then they are not bitching about the $1K premium they pay each month. We as a country will need to determine what we want. If we want top notch get to spend quality time with the doc we are going to need to pay out our ass for coverage. Or we can go with a cheaper public option in which the doc skates between patients giving 2 minutes to each patient. And where only the worst cases get to spend a night in a hospital room. The interesting thing is that the system in France, the FRG and Japan is cheaper and generally of better or similar quality to what we have here. The problem is that many Americans are either self-employed or part of small businesses. A Bismarck System (as in France, the FRG and Japan) is usually built around pervasive employment by large companies or a pervasively unionized work force, neither of which exist here. The question becomes, how could you do it within our system and that answer appears to be expanding MEWAs under ERISA. John, Why do the private insurance companies continue to hold so much sway on government policy? I have been self employed since the early 80's and it is a huge disadvantage in obtaining affordable ,decent coverage. From being forced into the individual market to the tax disadvantages . Groups and large corporations have major advantages from treating insurance as a cost of doing business while the self employed are only entitled to much smaller deductions. What can be done to level the playing field? If Medicare administration cost's are only 1/3 of private insurer's why wouldn't this be a big driver in lowering cost's with medicare for those who choose it? How much more expensive would a medicare option be than the current ACA options. At 80/20 it probably would cover more than most current plans? I'm not sure Medicaid is such a good program. The reimbursement rates are low and many doctors do not participate (the buzz word is "par') That is why Medicaid is a good program. When people get something for free, as is the case with Medicaid, it shouldn’t be good. In a capitalist society the incentive to work should be such that you get better stuff than by not working. Or look at it this way, if Medicaid was really good insurance everyone would be looking to get it and it would bankrupt the country if they did so. As with any larger system there are many counter currents that make the problem complicated. As long as the insured never see the costs, at the time of purchase, it is likely that costs will spiral out of control, absent an overseer that arbitrarily controls costs, by reducing access or just setting limits on what the provider can charge. There are only two possible controls on the cost of something. 1) The purchaser sees the price tag, at the time of purchase, and then makes a decision about whether to buy it or not. 2) Some regulating authority controls the costs. The problem with health care is that we dont want to make cost analysis at the time we are sick, as we do when fixing our house or our car. We dont go out and get bids for fixing the problem, and then decide who to choose based on a trade off of quality vs price. This removes the normal price control from the system. We want to do anything the doctor suggests regardless of the cost, and regardless of relative effectiveness. We also dont want to pay very much for this privilege. Government, and employers have made this problem worse by limiting our choices on buying insurance. It is difficult to shop around for insurance, much less the health care itself. "Government, and employers have made this problem worse by limiting our choices on buying insurance. It is difficult to shop around for insurance, much less the health care itself." Which drives part of my idea. One nice thing about ERIDA Plans is that they have to publish a "Summary Plan Description," saying what they cover and how, If people could shop for various types of Plans, many I would guess, with HSAs for routine Primary Care kinds of things ("Rule out broken ankle" or "Rule out streph."); discounted fee-for service HMO relationships with a panel of docs and institutional providers for common serious things (cardiac issues and common cancers, for example); and high deductible insurance (at a group rate) for the "Black Swan" events, I think it would work better. (Which might also be a way to keep life-time limits from being an issue without PPACA's recourse to ipso dixit.) Additionally, neither government nor employers have "providing insurance" as a core business. Insurance companies do, but HMO products have moved it out of the pure insurance realm to a degree and I'm not sure they aren't out of their depth also. Medicaid shouldn't be free, it has to charge something, but it ought not be rolled back either. Insurance coverage should stay as is, the focus needs to be on reducing expenses, like import foreign prescription drugs; cap medical malpractice compensation; streamline insurance bureaucracy and paperwork; allow nurses, pharmacies and others to offer primary care; and enable insurers to compete nationally. Of course Medicaid has a positive effect on public health. Any money the government diverts towards healthcare will have a positive effect on public health. The problem is that we live in a world of limited financial resources. We simply can’t afford give too many people Medicaid or have it be really good healthcare insurance. As to what to do about someone with severe healthcare needs like TB, that guy should purchase healthcare insurance. To the extent he can’t afford it, he’s an obvious candidate for Medicaid quality insurance, which should only cover the necessities like contagious TB. The way out this mess is to implement tax deductible Health Savings Accounts and offer a large choice of insurers with plans that offer a wide range of coverage at competitive prices. When you're young, put more money into your Health Savings Account and just purchase true catastrophe insurance because the odds are in your favor when you're young. You do just the opposite when you get older, only now you have a lifetime of savings to pay for day to day health care costs. Get the government OUT of traditional health care and let people use the free market to purchase what they want at the price they're willing to pay. If you're a cheapskate and purchase lowball coverage, then don't bitch when you get seriously ill and they take your house away to pay your medical bills. Anything involving the government has the same chance as expecting the Tooth Fairy to pay for health care!!! Before anyone comes back with "what about the poor who can't afford health care?" - that is an entirely DIFFERENT PROBLEM and we shouldn't apply the solution for the poor to everyone. The simplest solution doesn't involve more Welfare State programs - it's a growing economy that makes the Welfare State all but obsolete! The few remaining poor can be handled by private charity. All that big, all-encompassing government programs accomplish is lower economic growth and thus increase unemployment and increase government dependency. Finally - if you bring your car to a mechanic after 5 years of never changing the oil, air filter, coolant, belts, etc. you can't expect him to just "fix it" for cheap. The same is true with your personal health - if you smoke, drink, do drugs, never exercise, overeat, make lousy nutrition choices, etc. - you can't show up to your doctor at age 65 and say "fix me". 75% of ALL MEDICAL EXPENSES are for the TREATMENT of PREVENTABLE diseases!!! Take reasonable care of yourself!!! "What difference does it make - get government out of ALL health care." To get maximum effect from group insurance, the government needs to change existing law. "[A]fter market" car parts are NOT produced by the original manufacturer." NOT after market PARTS, After-market Warranties, an insurance product. (Note: the link also references the rising cost of repairs, as did the link in the post you are responding to.) "The whole idea of insurance is to pool large numbers of people and spread the risk. Your statement is obvious." Not really, for two reasons: 1) prior to PPACA, many states had Experience Rated individual markets, where the "group" was similarly situated individuals. There are advantages in that for younger and healthier individuals as compared to community rated insurance (as set forth in the above-article). Group Plans have some of the advantages of both models; and 2) Groups also have buying power that individuals do not (as with USAA, which was set up to provide auto insurance for peripatetic Military and Naval personnel who were then deemed a poor insurance risk. There are multiple issues here, how to insure and provide for people, and how to keep costs down. If we cant keep costs down, it wont matter the scheme we use to provide insurance. In some way the patient has to have some incentive to know the costs of the services, and keep the costs reasonable. Otherwise, there is no incentive for the system to keep the costs down. It is not easy, since people wan the best care they can get, but we also need to put some market pressure on costs, which is impossible if we dont even know the costs. I guy private insurance, and the problem with the ACA, is that it mandated certain features be included in insurance, so my policy doubled in cost because of the mandated features. I could not keep the coverage I had before I had to get "better" coverage, even though I didnt want it. In the 1940s we got into a problem when companies started providing health insurance as a benefit. This took us down a path where the consumer was largely removed from the situation. The consumer didnt buy the insurance, and the consumer didnt know the cost of delivering the service. Any wonder the costs spiraled out of control ? Perhaps they don't sell them any more but I recall shipmates telling me they bought a contract for just those things the day they bought their new cars in DUHmerica. The name of the company that underwrote the service contract was the same as their insurance company.... Get the government OUT of traditional health care and let people use the free market to purchase what they want at the price they're willing to pay Get insurance companies profit motive out of it and save an immediate 40%. I didn't just pull that number out of my ass - in countries where there is no business between your health and your doctor the percentage of GDP spent on health care is 40% less. I guarantee you that if we removed the government protection from monopoly laws (e.g. can't buy health insurance across state lines) that insurance companies bribed our politicians to get, no insurer would see anywhere near a 40% margin. Getting the "profit motive" out of ANY industry is misguided and goes against human nature. NOBODY works for free or to break even - including yourself. When health care is "free" it will be worth it. As usual Haluska you're blinded by your Randian adoration. I clearly advocate for there to be no insurance companies you dolt. Get those greedy fuckers out of the equation and one gets an immediate 40% savings. As with the new proposed Financial Planning Fiduciary rules, there is a place for BOTH the profit motive and fiduciary relationships. PLANS should be in fiduciary relationships with participants and beneficiaries (and, likely not-for-profit) while insurance companies, working as administrators for Plans, should be profit oriented and arm's length, "I guarantee you that if we removed the government protection from monopoly laws (e.g. can't buy health insurance across state lines) that insurance companies bribed our politicians to get, no insurer would see anywhere near a 40% margin." I don't agree. It would probably drive small regional payers out of business and promote consolidation in an already consolidating business sector. You would get the benefits touted for this more effectively by shifting the norm in coverage to self-insured non-employer-based ERISA Plans that could pre-empt state insurance law. Yes, the pool is you do health insurance well. It doesn't work properly any other way. Insuring only yourself means every year you are more and more at risk for countless things happening (which means you are riskier which means you should naturally pay higher premiums according to how insurance works). If you have a pre-existing condition, forget about individual insurance. You should be paying over $5000 / month and high according to how "risky" you are. Employer (organized) group policies worked for a while. Now, they don't so much because many business don't want to do it anymore. They'd rather pay a $2000 / employee penalty than do it. And that leaves a lot of people uncovered. Let people group themselves into cooperatives to cover themselves as a group and you've solved this entire problem. This is basically illegal today. Rand Paul just had a very interesting discussion on cnn. He said he doesn't want an individual market. He thinks all of the 37 million individuals should be put in a group which would have tremendous leverage and force the insurers on bended knee to compete for the 37 million.Any thoughts on this? To other good points raised, you'll never get ahold of costs so long as Medicare exists in its current form. Seniors are the biggest users of healthcare. And the way Medicare works, seniors could care less about the cost of anything. Just keep them alive and healthy. You can go on about capitalism and sticking it to the poor and/or people with pre-existing conditions who don't work for big corporations to get ahold of costs. But the elephant in the room is Medicare (and this is arguably the reason FOR costs in the U.S. lifting off astronomically compared to other industrialized countries). 50 years of the biggest consumers of healthcare having every test, procedure, operation, drug, everything covered by the government. Another way to get a hold of costs is some sort of consortium of insurance companies and the government setting prices for what they'll cover, jointly. A lite version of price fixing. But people could pay out of pocket for 'better' procedures. But the basic, for the masses max payout is agreed among all the insurance providers and Medicare / Medicaid. "Let people group themselves into cooperatives to cover themselves as a group and you've solved this entire problem. This is basically illegal today." A bit more "expensive and risky" rather than per se illegal. Unless they fully self-insure MEWAs can't preempt state law and full-on MEWAs that could negotiate group rates with payers and create their own Plans, have very onerous record keeping requirements, exposure to huge fines if that is not done correctly and lots of professional expenses (lawyers and accountants) to do it right. A type of union, called a Guild, can represent independent contractors, but they are grandfathered due to anti-trust concerns. However, they do provide a model for how to do very broad groups. "He said he doesn't want an individual market. He thinks all of the 37 million individuals should be put in a group which would have tremendous leverage and force the insurers on bended knee to compete for the 37 million Any thoughts on this?" Because of the numbers involved, the varied epidemiological and social groups represented, I'd like to see a variety of competing plans representing 350 million people in the US. Optimal insurance is a failure from the start because it says "you must have this all inclusive coverage to be allowed to have coverage, cost is irrelevant because people adding more and more to the minimum plan don't care if you can afford it".
Britain’s Brexit Vote Spurs Wild Trading, Gambling A securities firm's electronic stock indicator reflects pedestrians passing by in Tokyo, June 20, 2016. Global markets jumped Monday as polls suggest British voters on Thursday will choose to remain in the European Union. Share Britain’s Brexit Vote Spurs Wild Trading, Gambling share LONDON — Currency traders are dubbing it the "remain bounce," buying Britain’s pound after torrid sales of sterling last week when markets feared the European Union’s most reluctant member would head for the exit door. As British voters prepare for Thursday’s Brexit referendum on whether to leave the 28-member union, European stock markets have been enjoying a parallel upswing. Trading volumes were up by 60 percent Monday, adding more than $68 billion to the value of Britain’s biggest companies and making up for the dramatic flight from British stocks last week. The frenetic activity was triggered by a series of weekend opinion polls suggesting the Remain in the EU camp may have snatched back the lead – if only by a percentage point or two – from Leave the EU campaigners. On Tuesday, Britain’s currency and stock traders paused, holding their positions as they tried to work out whether they had gone overboard Monday. Most Asian markets extended Monday’s global rally on easing Brexit concerns. In Japan, the benchmark Nikkei 225 closed 1.28 percent higher. "The markets have a myopic focus on one thing: the U.K. referendum vote," Chris Weston, an IG Markets strategist in Melbourne, wrote in an analysis Monday. Place your bets Gamblers have been getting in on the act, with feverish betting on Britons choosing to stay in the European Union. Odds on voting to remain have shortened. Bankers, currency traders, investors and gamblers have a lot riding on Brexit. Last week, Skybet was giving near even odds that Britain would leave, and 72 percent of betting was on a Brexit. Now most bookmakers are giving 3-to-1 odds against leaving. According to oddsmakers at the British betting company Ladbrokes PLC, the shift in direction has been significant, with 95 percent of Monday’s betting that the country would remain in the EU. Millions of pounds are riding on the result; bookmakers say the EU referendum is the biggest political money-spinner for them ever. Last year’s Scottish referendum previously was Britain’s biggest political betting event, “much to our surprise,” said Graham Sharpe, spokesman for another British bookmaking firm, William Hill. “I am optimistic that we have yet to see the best of the action with the EU referendum.” Britain’s bookmakers stand to lose big if the country votes to leave the EU. But their stakes are small compared with what’s happening in stock, future and currency markets. FILE - Investor George Soros warns that a British vote to leave the European Union would have grave financial consequences. Unbridled speculation The whole country’s economy is being bet on, according to investor and philanthropist George Soros, who broke the Bank of England in September 1992 by betting his hedge fund on a sterling devaluation. On Monday, Soros warned that a Brexit would "touch every household: the value of the pound would decline precipitously. It would also have an immediate and dramatic impact on financial markets, investment, prices and jobs," he wrote in Britain’s Guardian newspaper, warning of a "black Friday" for the UK. He predicted a pullout from the European Union would drive the pound down 25 to 30 percent below its pre-referendum trading range of $1.50 to $1.60. For many investors, Brexit buying and selling is motivated less by a wish to make a quick buck and more about not losing money and value. They are looking for safety, which a few weeks ago seemed to be in the dollar or gold. In holding their positions Tuesday, British stock traders possibly were heeding the advice of top market strategists. Mohamed El-Erian, chief economic adviser for German-based insurance and asset management firm Allianz, on late Monday cautioned that it might be better to be in cash during the financially turbulent environment than fully invested in stocks, bonds and other assets. El-Erian, in a roundtable briefing, said cash gives investors resilience and agility, allowing them to quickly react to new data and change course. A wag might argue that with some cash around, the average person might even like to make a wager, or, as the Brits would put it, "fancy a flutter" with bookmakers.
package com.codebear.keyboard.adapter; import android.content.Context; import android.view.LayoutInflater; import android.view.View; import android.view.ViewGroup; import android.widget.BaseAdapter; import android.widget.ImageView; import android.widget.LinearLayout; import android.widget.TextView; import com.bumptech.glide.Glide; import com.codebear.keyboard.R; import com.codebear.keyboard.data.AppFuncAdapterBean; import com.codebear.keyboard.data.AppFuncBean; /** * description: * <p> * Created by CodeBear on 2017/6/30. */ public class CBAppFuncAdapter extends BaseAdapter { public interface OnItemClickListener { void onItemClick(AppFuncBean data, int position, int page); } private Context mContext; private AppFuncAdapterBean mData; private double mItemHeightMaxRatio; private int mItemHeightMax; private int mItemHeightMin; private int mItemHeight; private OnItemClickListener itemClickListener; public void setItemClickListener(OnItemClickListener itemClickListener) { this.itemClickListener = itemClickListener; } public CBAppFuncAdapter(Context mContext, AppFuncAdapterBean mData) { this.mContext = mContext; this.mData = mData; this.mItemHeightMaxRatio = mData.getmItemHeightMaxRatio(); this.mItemHeight = (int) mContext.getResources().getDimension(mData.getmItemHeight()); } @Override public int getCount() { return mData.getmData().size(); } @Override public Object getItem(int i) { return mData.getmData().get(i); } @Override public long getItemId(int i) { return i; } @Override public View getView(final int i, View convertView, ViewGroup viewGroup) { ViewHolder viewHolder; if (convertView == null) { viewHolder = new ViewHolder(); convertView = LayoutInflater.from(mContext).inflate(R.layout.item_app_func, null); viewHolder.rootView = convertView; viewHolder.llRoot = (LinearLayout) convertView.findViewById(R.id.ll_root); viewHolder.ivIcon = (ImageView) convertView.findViewById(R.id.iv_icon); viewHolder.tvTitle = (TextView) convertView.findViewById(R.id.tv_title); convertView.setTag(viewHolder); } else { viewHolder = (ViewHolder) convertView.getTag(); } showData(viewHolder, i); updateUI(viewHolder, viewGroup); return convertView; } private void showData(final ViewHolder viewHolder, final int position) { if (mData.getmData().get(position).getIcon() != null) { Glide.with(mContext).asBitmap().load(mData.getmData().get(position).getIcon()).into(viewHolder.ivIcon); viewHolder.rootView.setOnClickListener(new View.OnClickListener() { @Override public void onClick(View view) { if (null != itemClickListener) { itemClickListener.onItemClick(mData.getmData().get(position), position, mData.getPage()); } } }); } viewHolder.tvTitle.setText(mData.getmData().get(position).getTitle()); } private void updateUI(ViewHolder viewHolder, ViewGroup parent) { mItemHeightMax = this.mItemHeightMax != 0 ? this.mItemHeightMax : (int) (mItemHeight * mItemHeightMaxRatio); mItemHeightMin = this.mItemHeightMin != 0 ? this.mItemHeightMin : mItemHeight; int realItemHeight = ((View) parent.getParent()).getMeasuredHeight() / mData.getRow(); realItemHeight = Math.min(realItemHeight, mItemHeightMax); realItemHeight = Math.max(realItemHeight, mItemHeightMin); viewHolder.ivIcon.setLayoutParams(new LinearLayout.LayoutParams(mItemHeight, mItemHeight)); viewHolder.llRoot.setLayoutParams(new LinearLayout.LayoutParams(LinearLayout.LayoutParams.MATCH_PARENT, realItemHeight)); } private class ViewHolder { View rootView; LinearLayout llRoot; ImageView ivIcon; TextView tvTitle; } }
/* * (C) 2003-2006 Gabest * (C) 2006-2014, 2016 see Authors.txt * * This file is part of MPC-HC. * * MPC-HC is free software; you can redistribute it and/or modify * it under the terms of the GNU General Public License as published by * the Free Software Foundation; either version 3 of the License, or * (at your option) any later version. * * MPC-HC is distributed in the hope that it will be useful, * but WITHOUT ANY WARRANTY; without even the implied warranty of * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the * GNU General Public License for more details. * * You should have received a copy of the GNU General Public License * along with this program. If not, see <http://www.gnu.org/licenses/>. * */ #pragma once #include "VolumeCtrl.h" #include <atlimage.h> class CMainFrame; class CPlayerToolBar : public CToolBar { DECLARE_DYNAMIC(CPlayerToolBar) private: CMainFrame* m_pMainFrame; bool IsMuted() const; void SetMute(bool fMute = true); int getHitButtonIdx(CPoint point); bool LoadExternalToolBar(CImage& image); void LoadToolbarImage(); int m_nButtonHeight; std::unique_ptr<CImageList> m_pButtonsImages; std::unique_ptr<CImageList> m_pDisabledButtonsImages; int m_volumeMinSizeInc; EventClient m_eventc; void EventCallback(MpcEvent ev); public: CPlayerToolBar(CMainFrame* pMainFrame); virtual ~CPlayerToolBar(); int GetVolume() const; int GetMinWidth() const; void SetVolume(int volume); __declspec(property(get = GetVolume, put = SetVolume)) int Volume; void ArrangeControls(); CVolumeCtrl m_volctrl; // Overrides // ClassWizard generated virtual function overrides //{{AFX_VIRTUAL(CPlayerToolBar) virtual BOOL Create(CWnd* pParentWnd); //}}AFX_VIRTUAL // Generated message map functions protected: //{{AFX_MSG(CPlayerToolBar) afx_msg void OnCustomDraw(NMHDR* pNMHDR, LRESULT* pResult); afx_msg void OnSize(UINT nType, int cx, int cy); afx_msg void OnInitialUpdate(); afx_msg BOOL OnVolumeMute(UINT nID); afx_msg void OnUpdateVolumeMute(CCmdUI* pCmdUI); afx_msg BOOL OnVolumeUp(UINT nID); afx_msg BOOL OnVolumeDown(UINT nID); afx_msg void OnNcPaint(); afx_msg void OnLButtonDown(UINT nFlags, CPoint point); afx_msg void OnMouseMove(UINT nFlags, CPoint point); afx_msg BOOL OnSetCursor(CWnd* pWnd, UINT nHitTest, UINT message); afx_msg BOOL OnToolTipNotify(UINT id, NMHDR* pNMHDR, LRESULT* pResult); //}}AFX_MSG DECLARE_MESSAGE_MAP() };
Creator of Doom and Chief Technology Officer at Oculus VR John Carmack didn't necessarily expect it to be Facebook, but said that Oculus had to partner with someone. Carmack commented on a post to Anamanaguchi member Peter Berkman’s blog, which criticized Facebook’s acquisition of Oculus VR. Berkman said he’s worried about Facebook collecting data, creating an “information monopoly,” and the notion that today “companies exist and operate only to be acquired.” In his response, Carmack said that there is a case for being an independent company like Valve and trying to build a new virtual reality ecosystem like Steam from the ground up. “This is probably what most of the passionate fans wanted to see,” he said. “The difference is that, for years, the industry thought Valve was nuts, and they had the field to themselves. Valve deserves all their success for having the vision and perseverance to see it through to the current state.” VR, Carmack argues, won’t be like that. “The experience is too obviously powerful, and it makes converts on contact,” he said. “The fairly rapid involvement of the Titans is inevitable, and the real questions were how deeply to partner, and with who.” He added that he didn’t expect it to be this soon, that he didn’t expect it to be Facebook, and that he could think of other, more obvious companies, but that he believes Facebook sees the “Big Picture.” “I wasn't personally involved in any of the negotiations,” he said. “I spent an afternoon talking technology with Mark Zuckerberg, and the next week I find out that he bought Oculus.” In 2000, Carmack founded Armadillo Aerospace, a space tourism startup. On Twitter, Carmack also said that the Facebook deal probably means he’ll give aerospace another shot, but not for several years. “I have divided my focus too much in the past,” he said. To catch up with the biggest news of the week, make sure you read everything you need to know about Facebook buying Oculus for $2 billion.
When he was running for mayor, Bill de Blasio said he wanted to decrease marijuana arrests. Numbers released by the Drug Policy Alliance, obtained from the New York State Division of Criminal Justice Services, show that marijuana arrests are not actually decreasing under the de Blasio administration, after having gone down during the last two years of the Bloomberg administration. In a previous piece, Capital looked at how it could be difficult to reconcile de Blasio's plan to decrease marijuana arrests with his plan to implement a version of Broken Windows policing, which in the 1990s relied on high numbers of marijuana possession arrests. MORE ON CAPITAL ADVERTISEMENT The report from the Drug Policy Alliance shows that at least in the first four months, marijuana arrests (all arrests where marijuana possession was the only or highest charge) are the same per month on average in January through April of this year as they were over the course of last year. The Drug Policy Alliance also pointed out that the marijuana possession arrest rates still significantly affect people of color—86 percent of arrests during the first four months of 2014 were of black and Latino individuals—the same as during the previous year under Bloomberg. Only 10 percent of the arrests were of white individuals. This is despite the fact that black and white people have similar marijuana usage patterns. Lastly, the data released by the Drug Policy Alliance shows the extent to which marijuana possession arrests decreased during the last two years of the Bloomberg administration. Much like stop-and-frisk numbers, marijuana arrests have decreased without the previous administration having changed its rhetoric or acknowledging a need for change. Based on the Drug Police Alliance numbers, marijuana possession arrests in 2013 were 27 percent less than 2012 and 43 percent less than they were in 2011. As you can see in the chart, this is still far more marijuana arrests than there were in 1980s and early 1990s. But if 2014 is the same as 2013, it still means 20,000 fewer arrests than the peak years of 2000, 2010 and 2011.
#' Performs sample stratification based on signature contribution and enrichment analysis. #' #' @description Performs k-means clustering to assign signature to samples and performs enrichment analysis. #' #' @param maf an \code{\link{MAF}} object used for signature analysis. #' @param sig_res Signature results from \code{\link{extractSignatures}} #' @param minMut Consider only genes with minimum this number of samples mutated. Default 5. #' @param useCNV whether to include copy number events. Only applicable when MAF is read along with copy number data. Default TRUE if available. #' @param fn basename for output file. Default NULL. #' @return result list containing p-values #' @export #' @seealso \code{\link{plotEnrichmentResults}} signatureEnrichment = function(maf, sig_res, minMut = 5, useCNV = FALSE, fn = NULL){ contrib = sig_res$contributions contrib = t(contrib) set.seed(seed = 1024) message("Running k-means for signature assignment..") contrib.km = kmeans(x = contrib, centers = ncol(contrib)) cluster_df = as.data.frame(apply(contrib.km$centers, 2, function(x) which(x == max(x)))) colnames(cluster_df)[1] = 'Cluster' #cluster_df$Cluster = paste0("Cluster_", cluster_df$Cluster) data.table::setDT(x = cluster_df, keep.rownames = TRUE) colnames(cluster_df)[1] = 'Signature' xc = as.data.frame(contrib.km$cluster) colnames(xc)[1] = 'Cluster' data.table::setDT(xc, keep.rownames = TRUE) colnames(xc)[1] = 'Tumor_Sample_Barcode' xc = merge(xc, cluster_df, by = 'Cluster') xc[, Cluster := NULL] sig.mean.stat = lapply(unique(as.character(xc[,Signature])), function(x){ data.frame(sig_mean = apply(contrib[xc[Signature %in% x, Tumor_Sample_Barcode],, drop = FALSE], 2, mean) ) }) sig.sd.stat = lapply(unique(as.character(xc[,Signature])), function(x){ data.frame(sig_sd = apply(contrib[xc[Signature %in% x, Tumor_Sample_Barcode],, drop = FALSE], 2, sd)/sqrt(nrow(xc[Signature %in% x])) ) }) names(sig.mean.stat) = names(sig.sd.stat) = unique(as.character(xc[,Signature])) sig.mean.stat = as.data.frame(sig.mean.stat) colnames(sig.mean.stat) = unique(as.character(xc[,Signature])) sig.sd.stat = as.data.frame(sig.sd.stat) colnames(sig.sd.stat) = unique(as.character(xc[,Signature])) message("Performing pairwise and groupwise comparisions..") sig.enrich = clinicalEnrichment(maf = maf, clinicalFeature = "Signature", annotationDat = xc, minMut = minMut, useCNV = useCNV) sig.enrich$Signature_Assignment = xc cf.tbl = table(xc$Signature) message("Estimating mutation load and signature exposures..") mut.load = lapply(names(cf.tbl), function(x){ tsbs = xc[Signature %in% x][,Tumor_Sample_Barcode] subsetMaf(maf = maf, tsb = tsbs, fields = 'Hugo_Symbol', mafObj = FALSE)[,.N,Tumor_Sample_Barcode] }) names(mut.load) = names(cf.tbl) mut.load = data.table::rbindlist(mut.load, idcol = "Signature") mut.load[,Signature := gsub(pattern = 'Signature_', replacement = "", x = mut.load$Signature)] bsMax = max(unlist(lapply(split(mut.load, as.factor(mut.load$Signature)), function(x) max(boxplot.stats(x[,N])$stat)))) cols = RColorBrewer::brewer.pal(n = 9, name = "Pastel1")[1:ncol(sig.mean.stat)] names(cols) = rownames(sig.mean.stat) add_legend <- function(...) { opar <- par(fig=c(0, 1, 0, 1), oma=c(0, 0, 0, 0), mar=c(0, 0, 0, 0), new=TRUE) on.exit(par(opar)) plot(0, 0, type='n', bty='n', xaxt='n', yaxt='n') legend(...) } par(bty="n", mgp = c(0.5,0.5,0), las=1, tcl=-.25, font.main=4, xpd=TRUE, mar = c(3.4,2,2,4), mfrow = c(1, 2)) #layout(matrix(1:1, ncol=2, byrow = TRUE), heights=c(1,1,1,0.2)) title_size = 1 par(mar = c(3.5,2.5,2,2)) b = barplot(as.matrix(sig.mean.stat), ylim = c(0, 1 + max(sig.sd.stat, na.rm = TRUE)), col = cols, axes = FALSE, border = 0.1, xaxt = "n") for(i in 1:ncol(sig.sd.stat)){ segments(x0 = b[i], y0 = cumsum(sig.mean.stat[,i]) - sig.sd.stat[,i], x1 = b[i], y1 = cumsum(sig.mean.stat[,i]) + sig.sd.stat[,i], lwd = 1.5) } axis(side = 2, at = seq(0, 1, 0.25), labels = seq(0, 1, 0.25), lwd = 1.2, font.axis = 1, cex = 1.5, font = 1) mtext(text = gsub(pattern = "Signature_", replacement = "", x = colnames(sig.mean.stat)), side = 1, at = b, font = 1) mtext(text = "k-mean signature cluster", side = 1, line = 1.5, font = 1, cex = 0.9) title(main = 'Avg. signature exposure', cex.main = title_size, adj = 0) par(mar = c(3.4,2.5,2,2)) boxplot(at = 1:nrow(sig.mean.stat), N ~ Signature, data = mut.load, xaxt="n", col = cols, boxwex=0.6, outline = FALSE, lty=1, outwex=0, staplewex=0, axes = FALSE, ylim = c(0, bsMax), xlab = NA, ylab = NA) axis(side = 2, at = as.integer(seq(0, bsMax, length.out = 5)), lwd = 1, font = 1) mtext(text = c(gsub(pattern = "Signature_", replacement = "", x = names(cols))), side = 1, at = 1:nrow(sig.mean.stat), font = 1) mtext(text = c("N:", as.numeric(cf.tbl)), side = 1, line = 1.5, font = 1, at = 0:nrow(sig.mean.stat)) #mtext(text = "Signature", side = 1, line = 2, font = 2) title(main = 'Mutation load', cex.main = title_size, adj = 0) # add_legend("topright", pt.lwd = 2, # legend = names(cols), fill = cols, # bty = "n", cex = 1, border=NA, xpd = TRUE, text.font = 2) mut.load.summary = mut.load[,.(n_samples = .N, Median_mutations = median(N), Mean_mutations = mean(N)), Signature] sig.enrich$mutation_load = mut.load.summary if(!is.null(fn)){ write.table(x = sig.enrich$pairwise_comparision, file = paste0(fn, "_pairwise_comparision.tsv"), sep = "\t", quote = FALSE, row.names = FALSE) write.table(x = sig.enrich$groupwise_comparision, file = paste0(fn, "_groupwise_comparision.tsv"), sep = "\t", quote = FALSE, row.names = FALSE) write.table(x = sig.enrich$Signature_Assignment, file = paste0(fn, "_Signature_Assignment.tsv"), sep = "\t", quote = FALSE, row.names = FALSE) write.table(x = sig.enrich$mutation_load, file = paste0(fn, "_mutation_load.tsv"), sep = "\t", quote = FALSE, row.names = FALSE) } sig.enrich }
(-56914)/(-711425)). 50 Evaluate (1/2)/(((-189478)/(-12660))/(-449)). -15 Evaluate (2145/330)/(32318/(-44)). -1/113 125/((-65)/(-520)*-40) -25 What is (-4)/15*-3*10/(-24)? -1/3 What is (155/372)/(380/(-1216))? -4/3 (60/600*(-5)/2)/((-93)/33852) 91 Calculate ((192/(-728))/12)/(8060/2821). -1/130 Calculate (-18)/1365*(-2016)/(-2592). -2/195 What is the value of (415/(1472835/39884))/((-6)/(-63))? 118 Evaluate (-59)/(-177)*((-1)/(-10))/(44/(-1650))*-4. 5 What is the value of (-1*162/(-351))/(28/91)*(-8)/414? -2/69 Evaluate (-45)/(-1080)*504*1/(-120)*2. -7/20 What is ((-2548)/(-104))/(30/(-60))? -49 Calculate ((-3848)/351)/37*(-18)/(-408). -2/153 What is the value of 10*(-6)/(-72)*28050/187? 125 What is -1*2*(100/(-30))/(235/141)? 4 What is the value of (-1*(-4)/(-110))/((-833)/(-357)*(-36)/(-70))? -1/33 Calculate ((21/70)/((-22)/110))/(4/16*7). -6/7 What is ((-21)/30)/((-1451)/8706)? 21/5 Calculate (12834/(-2898))/((9/(-7))/3). 31/3 What is the value of ((-44)/(-11))/(((-25)/300)/((-6)/(96/(-14))))? -42 What is (95/((-674025)/172))/(2/24*(-592)/111)? 3/55 Evaluate ((-26)/((-1248)/72))/(112/(-42)). -9/16 Calculate (((-2)/5)/(87/174))/(-1*268/(-10)). -2/67 Evaluate (5*208*(-24)/3840)/((-1)/(-18)). -117 Evaluate (-10472)/272*7/(490/10). -11/2 (-1)/7*1*1760/((-20240)/(-92)) -8/7 Calculate (-70)/15*1*14*(-9)/(-112). -21/4 8/4*((-1)/5)/(1575/(-1125)) 2/7 What is ((-65)/(16120/558)*8/(-5))/(14/5)? 9/7 What is (-21)/7*(3243/(-92))/(54/24)? 47 What is (-22)/(-6)*(-109)/(15587/(-1443))? 37 ((38/(-1235)*13)/(168/160))/(12/(-14)) 4/9 Calculate (-848)/954*((-4)/(-14))/((-26)/117*6). 4/21 ((-351)/(-162))/(((99/6)/(-11))/9) -13 What is (-30)/((-2)/(-1))*(-24)/(-25)*(-137845)/55138? 36 What is 5/((10400/(-1216))/65)? -38 Evaluate (-5)/1*((-38)/684)/((-10)/9). -1/4 Calculate (117*22/(-231))/(((-945)/(-490))/9). -52 Calculate (-4)/(((-6)/20)/((-2592)/(-11880))). 32/11 What is the value of (((-450)/36)/((-180)/216))/(2/6)? 45 What is ((-184)/4830*70)/((((-1)/6)/(-1))/(-5))? 80 Calculate (27/(1701/144))/((221/13)/238). 32 Calculate (((-31)/155)/(36/(-1080)))/((-8)/2). -3/2 What is the value of (-9*14/(-63)*3/18)/((-2)/66)? -11 What is (-736)/(-1104)*3/(15/5)*(-87)/(-2)? 29 Evaluate (552/(-70)*(-520)/(-156))/(10/35). -92 What is (((-24764)/7216)/151)/(2/8*2)? -1/22 Evaluate (-60888)/472*(-6)/(-18). -43 Calculate (5/2)/(4025/(-53935))*2. -67 Calculate (91/(8918/196))/((-2)/27). -27 What is the value of (49/2646)/(125/(-12375))? -11/6 Evaluate 2/((-8)/(-14))*60600/6666*(-88)/(-490). 40/7 ((2/52)/(((-8405)/(-492))/(-41)))/(18/(-60)) 4/13 Calculate (-1)/(-4)*(-962)/(-1554)*21. 13/4 What is the value of -3*16/(-60)*(-643)/16718? -2/65 ((66/(-1683))/(42/(-238)))/(6/(-45)) -5/3 What is the value of -10*36/(-9)*(-21)/(-84)*1? 10 What is the value of 370*(-44)/330*3*6/(-72)*-3? -37 What is the value of 41/(37638/(-72))*(-1)/(-4)? -1/51 What is the value of (376/(-30))/((-9262)/1263*(-6)/33)? -47/5 Calculate 377200/12300*48/46. 32 Evaluate ((-860)/30)/(206/309). -43 What is the value of (4/(-2))/4*(-88)/55*(-51)/204? -1/5 ((-151)/((-41525)/165))/((-54)/40) -4/9 What is the value of (-130)/30*(-110)/130? 11/3 Evaluate (81/((-20250)/(-100)))/(318/(-15)). -1/53 Calculate ((-20388)/(-93445))/((-12)/(-22)). 2/5 (-18)/(-27)*-35*(-3)/42 5/3 What is the value of 1642/(-2463)*((-114)/(-5))/(10/50)? -76 What is 12/(-2490)*108315/(-5220)? 1/10 What is the value of (-1885)/116*56/14*7*(-4)/(-70)? -26 Calculate ((-5)/(-34))/(40/200*(-650)/312). -6/17 Evaluate (13/(403/(-372)))/(9/(-21)). 28 What is 4*((-6)/(-4))/((-11739)/1118)? -4/7 Calculate (83*(-38)/(-11039))/(2/12). 12/7 What is the value of (20/(-9240)*-6)/(16/112)? 1/11 ((-2)/(-21))/(60/(-1080)*-12)*-12 -12/7 What is the value of ((-554472)/(-476))/151*(-21)/(-2)? 81 What is the value of (4/(20/215))/((-705)/(-705))? 43 Calculate (-14325)/(-2865)*10/1. 50 Evaluate ((4/4)/(-9))/(((-2322)/(-43))/(-54)). 1/9 (-3760)/(-376)*(-78)/60 -13 ((-8)/(-216))/(8/(-96))*144/(-480) 2/15 What is the value of ((-20)/(-150)*-117)/(87/(-290))? 52 What is 10*73/((-7592)/364)? -35 Calculate 2/75*15/18*3348/6510. 2/175 (5*24*20/69600)/((-4)/(4/(-2))) 1/58 What is (-261)/4176*(7*1)/(98/14)? -1/16 What is the value of 2/(-4)*-4*8/48*513/19? 9 What is the value of 2327/(-62829)*(-567)/154? 3/22 16/(1332/2886*(-4)/12) -104 Calculate (-1038)/1903*2673/(-3240). 9/20 What is ((-2025)/7200)/(6/(-8))*-8? -3 Calculate (-2)/(-5)*(-1421)/882*45. -29 Calculate ((-13033)/(-729848))/((((-2)/(-4))/(-1))/1). -1/28 What is ((-48)/(-1064))/(252/(-441)*(-16)/(1408/33))? 4/19 What is ((-21252)/552)/(21/(-18))? 33 What is the value of (-20)/(-5)*((-31510)/460)/(6/3)? -137 What is the value of ((730/2628)/((-270)/(-6)))/((-1)/(-2))? 1/81 What is (552/299)/12*(-156)/(-276)? 2/23 1218/232*(-1264)/(-1185) 28/5 Evaluate 2/((12/27)/2)*9*30/(-13365). -2/11 Calculate 55/(-429)*18*8/(-600). 2/65 Evaluate ((-2)/2)/(3*(-3)/(-162)*(-6)/12). 36 Calculate -59*(-4510)/36285*2/(-33)*-3. 4/3 Evaluate (-18)/(-2)*3458/285*(-50)/70. -78 Evaluate -56*(-6)/(-63)*((-5)/8)/((-2)/12). -20 What is (-120)/(4860/81)*1/90*2? -2/45 Calculate (837/(-31))/((16/4)/4). -27 Evaluate (-2)/(38/(7068/31)). -12 (((-16)/25)/((-210)/(-1575)))/(4/((-160)/6)) 32 What is 274380/10760*(-4)/6? -17 Evaluate (19085/1439009)/(30/26). 1/87 (1557/(-21798))/((-8)/14) 1/8 -123*-6*(-29)/(-522) 41 Evaluate 30*(-54)/2025*-25. 20 Evaluate (-1)/27*9*((-2)/30)/((-1)/(-2)). 2/45 Calculate 1*-6*((-1)/(-4))/((5238/3312)/(-97)). 92 Evaluate (25*1575/16875)/(22/36). 42/11 Evaluate (819/(-78))/(287/(-984)). 36 What is the value of (((-21634)/1044)/373*78/(-2))/((-4)/6)? -13/4 Calculate ((-43392)/(-18))/(-113)*6/4. -32 What is the value of 1300/(-70)*980/280? -65 Evaluate (-320)/576*(9/84)/((-24)/(-32))*7. -5/9 Calculate (-27*(-700)/1350)/(8/2). 7/2 245/(-56)*60*(-14)/(-294) -25/2 What is the value of (-1*38/(-5))/((-2)/((-33)/(924/70)))? 19/2 Calculate (-44)/(-891)*(-16245)/(-1444). 5/9 What is the value of (16/516)/((-2034)/(-14577))? 2/9 Calculate 14*(-145)/(-9947)*(-56)/60. -4/21 Calculate (-26*36/(-6864))/((-130)/(-143)). 3/20 Calculate 903/(-86)*9/(-36)*8. 21 Calculate 792/22*3/36*(-153)/(-17). 27 What is (-32)/4*-59*(-2851)/11404? -118 What is the value of 339*(-17)/((-1887)/(-37))? -113 What is (-9504)/23760*4*7? -56/5 Evaluate (-19)/3*8/4*10110/6740. -19 -4*(-4)/(-480)*70*-15 35 ((-196452)/272)/321*(-52)/(-3) -39 Evaluate 2/((-91)/(-39858)*-12). -73 Calculate (171/(-38))/((2565/836)/45). -66 What is (-169351)/117243*-1*180/8? 65/2 (-3)/9*119/((-504322)/(-156)) -2/163 Calculate (-9*56/588)/((-14)/(-1617)). -99 What is the value of (-1045)/(-22)*912/(-2888)? -15 (6/(-35))/((154/(-55))/(-7))*(-2695)/55 21 What is the value of 6283*(-21)/(-25620)*20? 103 Evaluate (144/(-60))/(-3)*(-18)/8*(-760)/(-57). -24 What is the value of ((-5700)/(-9576))/((-25)/(-3))? 1/14 Evaluate (6/(-63)*2072/222)/(-11*30/(-495)). -4/3 Evaluate (-1*(36/(-12))/(-12))/(594/108). -1/22 Evaluate ((-3)/(-1))/(9/2)*-9*(-11092)/(-1416). -47 Evaluate ((-1134)/126)/(1026/2508). -22 (-59)/8260*10*-1 1/14 Calculate (-150)/300*(-24)/(-124)*1. -3/31 ((-35)/(-392))/(899/(-3596)) -5/14 What is ((-36)/(-1680))/(4452/(-1696))? -2/245 Evaluate (32310/(-8616))/(3/60). -75 Calculate (7/2)/((-500)/(-6500))*(-7)/((-245)/(-60)). -78 What is the value of (-52)/26*(((-6)/(-45))/2)/(142/(-213))? 1/5 ((7544/(-23))/82)/(8/(-34)) 17 What is the value of (-23632)/1055*(-5)/(-20)*-5? 28 Evaluate (-7037)/(-28148)*4*53. 53 What is (195/990)/((-2080)/160)? -1/66 What is (172347/(-15848))/((-3)/8)? 29 What is 10/(-14)*2429/(-22555)? 1/13 Calculate (((-46)/(-1127))/(-8*8/(-21056)))/(4/14). 47 What is the value of 15*984/(-1148)*28/(-5)? 72 What is the value of (4/(-4))/(((-36)/(-112))/((-33)/22))? 14/3 ((-27)/36)/((-216)/320)*-6*(-11)/(-770) -2/21 What is ((-20)/18)/(11228/555786)? -55 1580/1106*((30/40)/(6/16))/(-10) -2/7 Calculate (-44*51/136)/(((-5)/2)/5). 33 Evaluate ((-1424)/(-133144))/(4*5/340). 2/11 Evaluate 351*37/666*4. 78 234*(322/168)/23*(-3)/(15/(-10)) 39 Calculate ((-664)/(-83))/(352/(-16)). -4/11 Calculate (-20)/((-11)/((-297)/(-54))*(-6)/(-60)). 100 Evaluate -7*42/(-30)*(-74)/259*(-5)/2. 7 (-3)/261*(-36482)/1887 2/9 What is (2983/(-11932))/(15/(-8))? 2/15 Evaluate (11/((-352)
Taking an interviewer inside his helmet earlier this week, the senior Florida State defensive end described the machinations at play inside his mind whenever he looks up at Doak Campbell Stadium's scoreboard and sees a red "3" flashing in the box labeled "Down." "I have to get the sack," Carradine said, his voice quickening, his eyes growing even larger. "I have to get the sack." His excitement was so evident it looked as if he thought the person posing the question was a 160-pound quarterback ripe for a bone-crushing backfield hit. Racing around his right end position on one early second-quarter third down, Carradine brought to the ground one of three quarterbacks the Demon Deacons used during the Seminoles' 52-0 win. A quarter before, after a pre-snap mix-up between Carradine and fellow defensive end Bjoern Werner, Werner had one of his own. Their efforts, along with those of their defensive teammates, helped the Seminoles hold Wake Forest to a 1-for-16 third-down showing. So far this season, such third-down play has been replicated against other offenses that have faced the fourth-ranked Seminoles. When his team takes on No. 10 Clemson (3-0) this weekend, FSU coach Jimbo Fisher hopes to see a similar outcome. "I say this all the time: 'You can play a game well and play situations poorly and lose,'" Fisher said. "You can play average, play situations well and win the game. [Last week] we put a lot of focus on third downs, red zones, all those situations." Through three games, the Seminoles (3-0, 1-0 ACC) lead the nation in third-down defense. Opposing offenses have converted just 11.4 percent (5-of-44) of the third-down opportunities they have had against them this season. Fisher and his players contend the reason FSU's defense has been able to get off the field so quickly is because of the push of their defensive linemen. "We were able to get pressure to the quarterback, which makes the ball come out [quick]," Fisher said. "That rush makes a difference, now. When you control that line of scrimmage and make that ball come out, guys can't double-move you. They can't run all the way across the field. You're not covered as long. "We do a good job of mixing coverages, we contest and play good man [-to-man defense] and we were able to pressure the pocket and pressure the passer." FSU quarterback EJ Manuel, who faces the Seminoles' defensive line on a regular basis, said the difficulty in facing the group lies in its interior. Werner and Carradine are potential all-conference ends that teams are expecting to consistently rush off the edge. It is the defensive tackles who make the quarterback's throwing space shrink. "Those guys are collapsing the pocket each and every time," Manuel said. "As a quarterback, you're reading down the field. You don't necessarily look at the guys in front of you." Even mobile quarterbacks like Manuel and Clemson's Tajh Boyd have to go off feel and instinct in those situations. Sometimes, particularly during a pressure-filled third down, feel and instinct mean little. "You can't step up and sometimes you can't step into your throws," Manuel said. "That's where the interceptions and high balls come in."
Q: In QMessageBox, how do I add to the text copied by Ctrl-C? Using Qt, C++ on Windows, Ctrl-C copies a selection of text that includes the title, message, and so forth from a QMessageBox. I have added some additional fields and would like to add some custom text to the information copied from the standard QMessageBox from these fields. What do I override in QMessageBox to allow me to grab the text that is already being created and add my own text to it? A: You need to reimplement QMessageBox and all functions you want to use. Here is minimal example: custommessagebox.h #include <QMessageBox> #include <QShortcut> class CustomMessageBox : public QMessageBox { Q_OBJECT public: explicit CustomMessageBox(QWidget *parent = 0); CustomMessageBox(Icon icon, const QString &title, const QString &text, StandardButtons buttons = NoButton, QWidget *parent = Q_NULLPTR, Qt::WindowFlags flags = Qt::Dialog | Qt::MSWindowsFixedSizeDialogHint); static StandardButton information(QWidget *parent, const QString &title, const QString &text, StandardButtons buttons = Ok, StandardButton defaultButton = NoButton); protected: void keyPressEvent(QKeyEvent *e); }; custommessagebox.cpp #include "custommessagebox.h" #include <QClipboard> #include <QApplication> #include <QKeyEvent> #include <QDialogButtonBox> static QMessageBox::StandardButton showNewMessageBox(QWidget *parent, QMessageBox::Icon icon, const QString& title, const QString& text, QMessageBox::StandardButtons buttons, QMessageBox::StandardButton defaultButton) { CustomMessageBox msgBox(icon, title, text, QMessageBox::NoButton, parent); QDialogButtonBox *buttonBox = msgBox.findChild<QDialogButtonBox*>(); Q_ASSERT(buttonBox != 0); uint mask = QMessageBox::FirstButton; while (mask <= QMessageBox::LastButton) { uint sb = buttons & mask; mask <<= 1; if (!sb) continue; QPushButton *button = msgBox.addButton((QMessageBox::StandardButton)sb); // Choose the first accept role as the default if (msgBox.defaultButton()) continue; if ((defaultButton == QMessageBox::NoButton && buttonBox->buttonRole((QAbstractButton*)button) == QDialogButtonBox::AcceptRole) || (defaultButton != QMessageBox::NoButton && sb == uint(defaultButton))) msgBox.setDefaultButton(button); } if (msgBox.exec() == -1) return QMessageBox::Cancel; return msgBox.standardButton(msgBox.clickedButton()); } CustomMessageBox::CustomMessageBox(QWidget *parent) : QMessageBox(parent) { } CustomMessageBox::CustomMessageBox(QMessageBox::Icon icon, const QString &title, const QString &text, QMessageBox::StandardButtons buttons, QWidget *parent, Qt::WindowFlags flags) : QMessageBox(icon, title, text, buttons, parent, flags) { } void CustomMessageBox::keyPressEvent(QKeyEvent *e) { QMessageBox::keyPressEvent(e); if (e == QKeySequence::Copy) { QString separator = QString::fromLatin1("---------------------------\n"); QString tempText = QApplication::clipboard()->text(); tempText.append("Your custom text.\n" + separator); QApplication::clipboard()->setText(tempText); } } QMessageBox::StandardButton CustomMessageBox::information(QWidget *parent, const QString &title, const QString& text, StandardButtons buttons, StandardButton defaultButton) { return showNewMessageBox(parent, Information, title, text, buttons, defaultButton); } Usage: void MainWindow::showCustomMessage() { CustomMessageBox::information(this, "New message", "A lot of text", 0); } Also You might need to override question(), warning(), critical() and some other functions.
Two of Lee’s Summit’s new council members each accepted hundreds of dollars in campaign contributions from donors associated with RED Development, which is seeking subsidies for its Summit Place shopping center. At least one other council member is perturbed by the situation. District 1 Councilwoman Diane Forte and District 3 Councilwoman Diane Seif received contributions for the April 8 election from Jeff Haney, a vice president of RED Development and David Townsend, president of Townsend Capital. Those two companies are partnering to build a $72 million shopping center at 1301 Ward Road, east of the SummitWoods Crossing and Summit Fair centers, also RED Development projects. Those donations were noteworthy updates reported in 30-day after election reports filed this month by the candidates. The council on May 15 is to vote on amending a tax-increment financing plan, zoning and other decisions to allow the $78 million Summit Place to go forward. The council later will also have to approve a contract with other details of the TIF before the deal is final. Councilman Derek Holland, who is questioning the amount of subsidy RED, has not been shy about raising alarm over the project’s costs. He outlined his concerns in an editorial he penned for the Journal. Asked if the campaign contributions are a concern, he said: “It sure as hell is ... I don’t know if it is to anybody else in the city. I’m not suggesting it would buy anyone’s vote, I think it raises ethical questions.” Holland said the donations are too direct considering the timing coming soon after the election for a vote such an important and precedent-setting project. Holland said he hasn’t decided whether he’d ask for Seif or Forte to abstain from voting or make the issue part of the larger debate. Forte said she thought Holland is raising the issue about “funny money” as a side issue to win political support for his position. “The money I accepted was after I already said I was for the development,” Forte said. “I made that clear from the very beginning.” She accepted donations of $200 from Haney and $250 from Townsend. Steve Rich, director of project development for Townsend Capital in March also donated $250 to Forte. Forte said that she has been studying Summit Place issue closely. “I haven’t found anything to change my mind,” Forte said. Forte said that Holland and the previous council should have “had the guts” to go ahead and vote on the project earlier. “This is the first big vote of the council, and we’re going to play politics, that’s what it is, and I’m not going to play politics,” she said. She said she’ll vote for what she thinks is best for the city and isn’t going to “throw anyone under the bus” for the way they vote. Seif’s report said her campaign got $200 from Haney and $250 from Townsend on April 11. Seif had a large campaign chest of about $16,000, including several other developers, but their contributions were a small part of the overall donations from many individuals and businesses not in the development trade. She said she thought she was so successful raising money because of her long record of volunteerism and relationships she has developed in the community. “I don’t think there’s a problem whatsoever, as long as there’s been an ongoing relationship for many years,” Seif said. “People wanted to see me on the council ... they believe in my ethics and community involvement.” Seif said could see Holland’s position if the donations from Haney or Townsend had been a large amount of money, say $5,000 or $10,000. She said she considered the donations from Haney no different from those from other supporters who’d know her for years. She said she had worked with Haney’s father at Marion Labs year ago. Haney said he didn’t believe making the campaign contributions were unethical, noting his company has been a large supporter and investor in the community and he makes donations to good candidates when asked. “It’s America, we can back who we like,” Haney said. He said he hopes the council members consider the pluses and minuses of the project and see its benefits. He said RED Development has spent a lot of effort and money on the project so far and, “we hope this is a public-private partnership we can continue.” Rich could not be reached for comment. Craig Faith, an unsuccessful candidate in the District 2 race, also got donations from Townsend and Rich. District 2 Councilwoman Trish Carlyle, who won that race, didn’t report any donations that were from people associated with the Summit Place project. Join The Conversation Lee's Summit Journal is pleased to provide this opportunity to share information, experiences and observations about what's in the news. Some of the comments may be reprinted elsewhere in the site or in the newspaper. We encourage lively, open debate on the issues of the day, and ask that you refrain from profanity, hate speech, personal comments and remarks that are off point. Thank you for taking the time to offer your thoughts.
Immunizations. Vaccination is one of the most effective preventative health measures in modern times. It has positively affected the incidence and prevalence of a myriad of diseases, as well as improved both their morbidity and mortality. It is essential that health care providers understand the value of this intervention, promote comprehensive immunization coverage within their community, and recognize the underlying principles that guide decisions regarding vaccination. Factors important to consider before immunization administration include the type of vaccination, its recommended timing and intervals, and the presence of contraindications, precautions, or other special considerations.
#include "scripting/lua-bindings/auto/lua_cocos2dx_controller_auto.hpp" #if (CC_TARGET_PLATFORM == CC_PLATFORM_ANDROID || CC_TARGET_PLATFORM == CC_PLATFORM_IOS) #include "base/CCGameController.h" #include "scripting/lua-bindings/manual/tolua_fix.h" #include "scripting/lua-bindings/manual/LuaBasicConversions.h" int lua_cocos2dx_controller_Controller_receiveExternalKeyEvent(lua_State* tolua_S) { int argc = 0; cocos2d::Controller* cobj = nullptr; bool ok = true; #if COCOS2D_DEBUG >= 1 tolua_Error tolua_err; #endif #if COCOS2D_DEBUG >= 1 if (!tolua_isusertype(tolua_S,1,"cc.Controller",0,&tolua_err)) goto tolua_lerror; #endif cobj = (cocos2d::Controller*)tolua_tousertype(tolua_S,1,0); #if COCOS2D_DEBUG >= 1 if (!cobj) { tolua_error(tolua_S,"invalid 'cobj' in function 'lua_cocos2dx_controller_Controller_receiveExternalKeyEvent'", nullptr); return 0; } #endif argc = lua_gettop(tolua_S)-1; if (argc == 2) { int arg0; bool arg1; ok &= luaval_to_int32(tolua_S, 2,(int *)&arg0, "cc.Controller:receiveExternalKeyEvent"); ok &= luaval_to_boolean(tolua_S, 3,&arg1, "cc.Controller:receiveExternalKeyEvent"); if(!ok) { tolua_error(tolua_S,"invalid arguments in function 'lua_cocos2dx_controller_Controller_receiveExternalKeyEvent'", nullptr); return 0; } cobj->receiveExternalKeyEvent(arg0, arg1); lua_settop(tolua_S, 1); return 1; } luaL_error(tolua_S, "%s has wrong number of arguments: %d, was expecting %d \n", "cc.Controller:receiveExternalKeyEvent",argc, 2); return 0; #if COCOS2D_DEBUG >= 1 tolua_lerror: tolua_error(tolua_S,"#ferror in function 'lua_cocos2dx_controller_Controller_receiveExternalKeyEvent'.",&tolua_err); #endif return 0; } int lua_cocos2dx_controller_Controller_getDeviceName(lua_State* tolua_S) { int argc = 0; cocos2d::Controller* cobj = nullptr; bool ok = true; #if COCOS2D_DEBUG >= 1 tolua_Error tolua_err; #endif #if COCOS2D_DEBUG >= 1 if (!tolua_isusertype(tolua_S,1,"cc.Controller",0,&tolua_err)) goto tolua_lerror; #endif cobj = (cocos2d::Controller*)tolua_tousertype(tolua_S,1,0); #if COCOS2D_DEBUG >= 1 if (!cobj) { tolua_error(tolua_S,"invalid 'cobj' in function 'lua_cocos2dx_controller_Controller_getDeviceName'", nullptr); return 0; } #endif argc = lua_gettop(tolua_S)-1; if (argc == 0) { if(!ok) { tolua_error(tolua_S,"invalid arguments in function 'lua_cocos2dx_controller_Controller_getDeviceName'", nullptr); return 0; } const std::string& ret = cobj->getDeviceName(); lua_pushlstring(tolua_S,ret.c_str(),ret.length()); return 1; } luaL_error(tolua_S, "%s has wrong number of arguments: %d, was expecting %d \n", "cc.Controller:getDeviceName",argc, 0); return 0; #if COCOS2D_DEBUG >= 1 tolua_lerror: tolua_error(tolua_S,"#ferror in function 'lua_cocos2dx_controller_Controller_getDeviceName'.",&tolua_err); #endif return 0; } int lua_cocos2dx_controller_Controller_isConnected(lua_State* tolua_S) { int argc = 0; cocos2d::Controller* cobj = nullptr; bool ok = true; #if COCOS2D_DEBUG >= 1 tolua_Error tolua_err; #endif #if COCOS2D_DEBUG >= 1 if (!tolua_isusertype(tolua_S,1,"cc.Controller",0,&tolua_err)) goto tolua_lerror; #endif cobj = (cocos2d::Controller*)tolua_tousertype(tolua_S,1,0); #if COCOS2D_DEBUG >= 1 if (!cobj) { tolua_error(tolua_S,"invalid 'cobj' in function 'lua_cocos2dx_controller_Controller_isConnected'", nullptr); return 0; } #endif argc = lua_gettop(tolua_S)-1; if (argc == 0) { if(!ok) { tolua_error(tolua_S,"invalid arguments in function 'lua_cocos2dx_controller_Controller_isConnected'", nullptr); return 0; } bool ret = cobj->isConnected(); tolua_pushboolean(tolua_S,(bool)ret); return 1; } luaL_error(tolua_S, "%s has wrong number of arguments: %d, was expecting %d \n", "cc.Controller:isConnected",argc, 0); return 0; #if COCOS2D_DEBUG >= 1 tolua_lerror: tolua_error(tolua_S,"#ferror in function 'lua_cocos2dx_controller_Controller_isConnected'.",&tolua_err); #endif return 0; } int lua_cocos2dx_controller_Controller_getDeviceId(lua_State* tolua_S) { int argc = 0; cocos2d::Controller* cobj = nullptr; bool ok = true; #if COCOS2D_DEBUG >= 1 tolua_Error tolua_err; #endif #if COCOS2D_DEBUG >= 1 if (!tolua_isusertype(tolua_S,1,"cc.Controller",0,&tolua_err)) goto tolua_lerror; #endif cobj = (cocos2d::Controller*)tolua_tousertype(tolua_S,1,0); #if COCOS2D_DEBUG >= 1 if (!cobj) { tolua_error(tolua_S,"invalid 'cobj' in function 'lua_cocos2dx_controller_Controller_getDeviceId'", nullptr); return 0; } #endif argc = lua_gettop(tolua_S)-1; if (argc == 0) { if(!ok) { tolua_error(tolua_S,"invalid arguments in function 'lua_cocos2dx_controller_Controller_getDeviceId'", nullptr); return 0; } int ret = cobj->getDeviceId(); tolua_pushnumber(tolua_S,(lua_Number)ret); return 1; } luaL_error(tolua_S, "%s has wrong number of arguments: %d, was expecting %d \n", "cc.Controller:getDeviceId",argc, 0); return 0; #if COCOS2D_DEBUG >= 1 tolua_lerror: tolua_error(tolua_S,"#ferror in function 'lua_cocos2dx_controller_Controller_getDeviceId'.",&tolua_err); #endif return 0; } int lua_cocos2dx_controller_Controller_setTag(lua_State* tolua_S) { int argc = 0; cocos2d::Controller* cobj = nullptr; bool ok = true; #if COCOS2D_DEBUG >= 1 tolua_Error tolua_err; #endif #if COCOS2D_DEBUG >= 1 if (!tolua_isusertype(tolua_S,1,"cc.Controller",0,&tolua_err)) goto tolua_lerror; #endif cobj = (cocos2d::Controller*)tolua_tousertype(tolua_S,1,0); #if COCOS2D_DEBUG >= 1 if (!cobj) { tolua_error(tolua_S,"invalid 'cobj' in function 'lua_cocos2dx_controller_Controller_setTag'", nullptr); return 0; } #endif argc = lua_gettop(tolua_S)-1; if (argc == 1) { int arg0; ok &= luaval_to_int32(tolua_S, 2,(int *)&arg0, "cc.Controller:setTag"); if(!ok) { tolua_error(tolua_S,"invalid arguments in function 'lua_cocos2dx_controller_Controller_setTag'", nullptr); return 0; } cobj->setTag(arg0); lua_settop(tolua_S, 1); return 1; } luaL_error(tolua_S, "%s has wrong number of arguments: %d, was expecting %d \n", "cc.Controller:setTag",argc, 1); return 0; #if COCOS2D_DEBUG >= 1 tolua_lerror: tolua_error(tolua_S,"#ferror in function 'lua_cocos2dx_controller_Controller_setTag'.",&tolua_err); #endif return 0; } int lua_cocos2dx_controller_Controller_getTag(lua_State* tolua_S) { int argc = 0; cocos2d::Controller* cobj = nullptr; bool ok = true; #if COCOS2D_DEBUG >= 1 tolua_Error tolua_err; #endif #if COCOS2D_DEBUG >= 1 if (!tolua_isusertype(tolua_S,1,"cc.Controller",0,&tolua_err)) goto tolua_lerror; #endif cobj = (cocos2d::Controller*)tolua_tousertype(tolua_S,1,0); #if COCOS2D_DEBUG >= 1 if (!cobj) { tolua_error(tolua_S,"invalid 'cobj' in function 'lua_cocos2dx_controller_Controller_getTag'", nullptr); return 0; } #endif argc = lua_gettop(tolua_S)-1; if (argc == 0) { if(!ok) { tolua_error(tolua_S,"invalid arguments in function 'lua_cocos2dx_controller_Controller_getTag'", nullptr); return 0; } int ret = cobj->getTag(); tolua_pushnumber(tolua_S,(lua_Number)ret); return 1; } luaL_error(tolua_S, "%s has wrong number of arguments: %d, was expecting %d \n", "cc.Controller:getTag",argc, 0); return 0; #if COCOS2D_DEBUG >= 1 tolua_lerror: tolua_error(tolua_S,"#ferror in function 'lua_cocos2dx_controller_Controller_getTag'.",&tolua_err); #endif return 0; } int lua_cocos2dx_controller_Controller_startDiscoveryController(lua_State* tolua_S) { int argc = 0; bool ok = true; #if COCOS2D_DEBUG >= 1 tolua_Error tolua_err; #endif #if COCOS2D_DEBUG >= 1 if (!tolua_isusertable(tolua_S,1,"cc.Controller",0,&tolua_err)) goto tolua_lerror; #endif argc = lua_gettop(tolua_S) - 1; if (argc == 0) { if(!ok) { tolua_error(tolua_S,"invalid arguments in function 'lua_cocos2dx_controller_Controller_startDiscoveryController'", nullptr); return 0; } cocos2d::Controller::startDiscoveryController(); lua_settop(tolua_S, 1); return 1; } luaL_error(tolua_S, "%s has wrong number of arguments: %d, was expecting %d\n ", "cc.Controller:startDiscoveryController",argc, 0); return 0; #if COCOS2D_DEBUG >= 1 tolua_lerror: tolua_error(tolua_S,"#ferror in function 'lua_cocos2dx_controller_Controller_startDiscoveryController'.",&tolua_err); #endif return 0; } int lua_cocos2dx_controller_Controller_stopDiscoveryController(lua_State* tolua_S) { int argc = 0; bool ok = true; #if COCOS2D_DEBUG >= 1 tolua_Error tolua_err; #endif #if COCOS2D_DEBUG >= 1 if (!tolua_isusertable(tolua_S,1,"cc.Controller",0,&tolua_err)) goto tolua_lerror; #endif argc = lua_gettop(tolua_S) - 1; if (argc == 0) { if(!ok) { tolua_error(tolua_S,"invalid arguments in function 'lua_cocos2dx_controller_Controller_stopDiscoveryController'", nullptr); return 0; } cocos2d::Controller::stopDiscoveryController(); lua_settop(tolua_S, 1); return 1; } luaL_error(tolua_S, "%s has wrong number of arguments: %d, was expecting %d\n ", "cc.Controller:stopDiscoveryController",argc, 0); return 0; #if COCOS2D_DEBUG >= 1 tolua_lerror: tolua_error(tolua_S,"#ferror in function 'lua_cocos2dx_controller_Controller_stopDiscoveryController'.",&tolua_err); #endif return 0; } int lua_cocos2dx_controller_Controller_getControllerByDeviceId(lua_State* tolua_S) { int argc = 0; bool ok = true; #if COCOS2D_DEBUG >= 1 tolua_Error tolua_err; #endif #if COCOS2D_DEBUG >= 1 if (!tolua_isusertable(tolua_S,1,"cc.Controller",0,&tolua_err)) goto tolua_lerror; #endif argc = lua_gettop(tolua_S) - 1; if (argc == 1) { int arg0; ok &= luaval_to_int32(tolua_S, 2,(int *)&arg0, "cc.Controller:getControllerByDeviceId"); if(!ok) { tolua_error(tolua_S,"invalid arguments in function 'lua_cocos2dx_controller_Controller_getControllerByDeviceId'", nullptr); return 0; } cocos2d::Controller* ret = cocos2d::Controller::getControllerByDeviceId(arg0); object_to_luaval<cocos2d::Controller>(tolua_S, "cc.Controller",(cocos2d::Controller*)ret); return 1; } luaL_error(tolua_S, "%s has wrong number of arguments: %d, was expecting %d\n ", "cc.Controller:getControllerByDeviceId",argc, 1); return 0; #if COCOS2D_DEBUG >= 1 tolua_lerror: tolua_error(tolua_S,"#ferror in function 'lua_cocos2dx_controller_Controller_getControllerByDeviceId'.",&tolua_err); #endif return 0; } int lua_cocos2dx_controller_Controller_getControllerByTag(lua_State* tolua_S) { int argc = 0; bool ok = true; #if COCOS2D_DEBUG >= 1 tolua_Error tolua_err; #endif #if COCOS2D_DEBUG >= 1 if (!tolua_isusertable(tolua_S,1,"cc.Controller",0,&tolua_err)) goto tolua_lerror; #endif argc = lua_gettop(tolua_S) - 1; if (argc == 1) { int arg0; ok &= luaval_to_int32(tolua_S, 2,(int *)&arg0, "cc.Controller:getControllerByTag"); if(!ok) { tolua_error(tolua_S,"invalid arguments in function 'lua_cocos2dx_controller_Controller_getControllerByTag'", nullptr); return 0; } cocos2d::Controller* ret = cocos2d::Controller::getControllerByTag(arg0); object_to_luaval<cocos2d::Controller>(tolua_S, "cc.Controller",(cocos2d::Controller*)ret); return 1; } luaL_error(tolua_S, "%s has wrong number of arguments: %d, was expecting %d\n ", "cc.Controller:getControllerByTag",argc, 1); return 0; #if COCOS2D_DEBUG >= 1 tolua_lerror: tolua_error(tolua_S,"#ferror in function 'lua_cocos2dx_controller_Controller_getControllerByTag'.",&tolua_err); #endif return 0; } static int lua_cocos2dx_controller_Controller_finalize(lua_State* tolua_S) { printf("luabindings: finalizing LUA object (Controller)"); return 0; } int lua_register_cocos2dx_controller_Controller(lua_State* tolua_S) { tolua_usertype(tolua_S,"cc.Controller"); tolua_cclass(tolua_S,"Controller","cc.Controller","",nullptr); tolua_beginmodule(tolua_S,"Controller"); tolua_function(tolua_S,"receiveExternalKeyEvent",lua_cocos2dx_controller_Controller_receiveExternalKeyEvent); tolua_function(tolua_S,"getDeviceName",lua_cocos2dx_controller_Controller_getDeviceName); tolua_function(tolua_S,"isConnected",lua_cocos2dx_controller_Controller_isConnected); tolua_function(tolua_S,"getDeviceId",lua_cocos2dx_controller_Controller_getDeviceId); tolua_function(tolua_S,"setTag",lua_cocos2dx_controller_Controller_setTag); tolua_function(tolua_S,"getTag",lua_cocos2dx_controller_Controller_getTag); tolua_function(tolua_S,"startDiscoveryController", lua_cocos2dx_controller_Controller_startDiscoveryController); tolua_function(tolua_S,"stopDiscoveryController", lua_cocos2dx_controller_Controller_stopDiscoveryController); tolua_function(tolua_S,"getControllerByDeviceId", lua_cocos2dx_controller_Controller_getControllerByDeviceId); tolua_function(tolua_S,"getControllerByTag", lua_cocos2dx_controller_Controller_getControllerByTag); tolua_endmodule(tolua_S); std::string typeName = typeid(cocos2d::Controller).name(); g_luaType[typeName] = "cc.Controller"; g_typeCast["Controller"] = "cc.Controller"; return 1; } int lua_cocos2dx_controller_EventController_getControllerEventType(lua_State* tolua_S) { int argc = 0; cocos2d::EventController* cobj = nullptr; bool ok = true; #if COCOS2D_DEBUG >= 1 tolua_Error tolua_err; #endif #if COCOS2D_DEBUG >= 1 if (!tolua_isusertype(tolua_S,1,"cc.EventController",0,&tolua_err)) goto tolua_lerror; #endif cobj = (cocos2d::EventController*)tolua_tousertype(tolua_S,1,0); #if COCOS2D_DEBUG >= 1 if (!cobj) { tolua_error(tolua_S,"invalid 'cobj' in function 'lua_cocos2dx_controller_EventController_getControllerEventType'", nullptr); return 0; } #endif argc = lua_gettop(tolua_S)-1; if (argc == 0) { if(!ok) { tolua_error(tolua_S,"invalid arguments in function 'lua_cocos2dx_controller_EventController_getControllerEventType'", nullptr); return 0; } int ret = (int)cobj->getControllerEventType(); tolua_pushnumber(tolua_S,(lua_Number)ret); return 1; } luaL_error(tolua_S, "%s has wrong number of arguments: %d, was expecting %d \n", "cc.EventController:getControllerEventType",argc, 0); return 0; #if COCOS2D_DEBUG >= 1 tolua_lerror: tolua_error(tolua_S,"#ferror in function 'lua_cocos2dx_controller_EventController_getControllerEventType'.",&tolua_err); #endif return 0; } int lua_cocos2dx_controller_EventController_setConnectStatus(lua_State* tolua_S) { int argc = 0; cocos2d::EventController* cobj = nullptr; bool ok = true; #if COCOS2D_DEBUG >= 1 tolua_Error tolua_err; #endif #if COCOS2D_DEBUG >= 1 if (!tolua_isusertype(tolua_S,1,"cc.EventController",0,&tolua_err)) goto tolua_lerror; #endif cobj = (cocos2d::EventController*)tolua_tousertype(tolua_S,1,0); #if COCOS2D_DEBUG >= 1 if (!cobj) { tolua_error(tolua_S,"invalid 'cobj' in function 'lua_cocos2dx_controller_EventController_setConnectStatus'", nullptr); return 0; } #endif argc = lua_gettop(tolua_S)-1; if (argc == 1) { bool arg0; ok &= luaval_to_boolean(tolua_S, 2,&arg0, "cc.EventController:setConnectStatus"); if(!ok) { tolua_error(tolua_S,"invalid arguments in function 'lua_cocos2dx_controller_EventController_setConnectStatus'", nullptr); return 0; } cobj->setConnectStatus(arg0); lua_settop(tolua_S, 1); return 1; } luaL_error(tolua_S, "%s has wrong number of arguments: %d, was expecting %d \n", "cc.EventController:setConnectStatus",argc, 1); return 0; #if COCOS2D_DEBUG >= 1 tolua_lerror: tolua_error(tolua_S,"#ferror in function 'lua_cocos2dx_controller_EventController_setConnectStatus'.",&tolua_err); #endif return 0; } int lua_cocos2dx_controller_EventController_isConnected(lua_State* tolua_S) { int argc = 0; cocos2d::EventController* cobj = nullptr; bool ok = true; #if COCOS2D_DEBUG >= 1 tolua_Error tolua_err; #endif #if COCOS2D_DEBUG >= 1 if (!tolua_isusertype(tolua_S,1,"cc.EventController",0,&tolua_err)) goto tolua_lerror; #endif cobj = (cocos2d::EventController*)tolua_tousertype(tolua_S,1,0); #if COCOS2D_DEBUG >= 1 if (!cobj) { tolua_error(tolua_S,"invalid 'cobj' in function 'lua_cocos2dx_controller_EventController_isConnected'", nullptr); return 0; } #endif argc = lua_gettop(tolua_S)-1; if (argc == 0) { if(!ok) { tolua_error(tolua_S,"invalid arguments in function 'lua_cocos2dx_controller_EventController_isConnected'", nullptr); return 0; } bool ret = cobj->isConnected(); tolua_pushboolean(tolua_S,(bool)ret); return 1; } luaL_error(tolua_S, "%s has wrong number of arguments: %d, was expecting %d \n", "cc.EventController:isConnected",argc, 0); return 0; #if COCOS2D_DEBUG >= 1 tolua_lerror: tolua_error(tolua_S,"#ferror in function 'lua_cocos2dx_controller_EventController_isConnected'.",&tolua_err); #endif return 0; } int lua_cocos2dx_controller_EventController_setKeyCode(lua_State* tolua_S) { int argc = 0; cocos2d::EventController* cobj = nullptr; bool ok = true; #if COCOS2D_DEBUG >= 1 tolua_Error tolua_err; #endif #if COCOS2D_DEBUG >= 1 if (!tolua_isusertype(tolua_S,1,"cc.EventController",0,&tolua_err)) goto tolua_lerror; #endif cobj = (cocos2d::EventController*)tolua_tousertype(tolua_S,1,0); #if COCOS2D_DEBUG >= 1 if (!cobj) { tolua_error(tolua_S,"invalid 'cobj' in function 'lua_cocos2dx_controller_EventController_setKeyCode'", nullptr); return 0; } #endif argc = lua_gettop(tolua_S)-1; if (argc == 1) { int arg0; ok &= luaval_to_int32(tolua_S, 2,(int *)&arg0, "cc.EventController:setKeyCode"); if(!ok) { tolua_error(tolua_S,"invalid arguments in function 'lua_cocos2dx_controller_EventController_setKeyCode'", nullptr); return 0; } cobj->setKeyCode(arg0); lua_settop(tolua_S, 1); return 1; } luaL_error(tolua_S, "%s has wrong number of arguments: %d, was expecting %d \n", "cc.EventController:setKeyCode",argc, 1); return 0; #if COCOS2D_DEBUG >= 1 tolua_lerror: tolua_error(tolua_S,"#ferror in function 'lua_cocos2dx_controller_EventController_setKeyCode'.",&tolua_err); #endif return 0; } int lua_cocos2dx_controller_EventController_getController(lua_State* tolua_S) { int argc = 0; cocos2d::EventController* cobj = nullptr; bool ok = true; #if COCOS2D_DEBUG >= 1 tolua_Error tolua_err; #endif #if COCOS2D_DEBUG >= 1 if (!tolua_isusertype(tolua_S,1,"cc.EventController",0,&tolua_err)) goto tolua_lerror; #endif cobj = (cocos2d::EventController*)tolua_tousertype(tolua_S,1,0); #if COCOS2D_DEBUG >= 1 if (!cobj) { tolua_error(tolua_S,"invalid 'cobj' in function 'lua_cocos2dx_controller_EventController_getController'", nullptr); return 0; } #endif argc = lua_gettop(tolua_S)-1; if (argc == 0) { if(!ok) { tolua_error(tolua_S,"invalid arguments in function 'lua_cocos2dx_controller_EventController_getController'", nullptr); return 0; } cocos2d::Controller* ret = cobj->getController(); object_to_luaval<cocos2d::Controller>(tolua_S, "cc.Controller",(cocos2d::Controller*)ret); return 1; } luaL_error(tolua_S, "%s has wrong number of arguments: %d, was expecting %d \n", "cc.EventController:getController",argc, 0); return 0; #if COCOS2D_DEBUG >= 1 tolua_lerror: tolua_error(tolua_S,"#ferror in function 'lua_cocos2dx_controller_EventController_getController'.",&tolua_err); #endif return 0; } int lua_cocos2dx_controller_EventController_getKeyCode(lua_State* tolua_S) { int argc = 0; cocos2d::EventController* cobj = nullptr; bool ok = true; #if COCOS2D_DEBUG >= 1 tolua_Error tolua_err; #endif #if COCOS2D_DEBUG >= 1 if (!tolua_isusertype(tolua_S,1,"cc.EventController",0,&tolua_err)) goto tolua_lerror; #endif cobj = (cocos2d::EventController*)tolua_tousertype(tolua_S,1,0); #if COCOS2D_DEBUG >= 1 if (!cobj) { tolua_error(tolua_S,"invalid 'cobj' in function 'lua_cocos2dx_controller_EventController_getKeyCode'", nullptr); return 0; } #endif argc = lua_gettop(tolua_S)-1; if (argc == 0) { if(!ok) { tolua_error(tolua_S,"invalid arguments in function 'lua_cocos2dx_controller_EventController_getKeyCode'", nullptr); return 0; } int ret = cobj->getKeyCode(); tolua_pushnumber(tolua_S,(lua_Number)ret); return 1; } luaL_error(tolua_S, "%s has wrong number of arguments: %d, was expecting %d \n", "cc.EventController:getKeyCode",argc, 0); return 0; #if COCOS2D_DEBUG >= 1 tolua_lerror: tolua_error(tolua_S,"#ferror in function 'lua_cocos2dx_controller_EventController_getKeyCode'.",&tolua_err); #endif return 0; } int lua_cocos2dx_controller_EventController_constructor(lua_State* tolua_S) { int argc = 0; cocos2d::EventController* cobj = nullptr; bool ok = true; #if COCOS2D_DEBUG >= 1 tolua_Error tolua_err; #endif argc = lua_gettop(tolua_S)-1; do{ if (argc == 3) { cocos2d::EventController::ControllerEventType arg0; ok &= luaval_to_int32(tolua_S, 2,(int *)&arg0, "cc.EventController:EventController"); if (!ok) { break; } cocos2d::Controller* arg1; ok &= luaval_to_object<cocos2d::Controller>(tolua_S, 3, "cc.Controller",&arg1, "cc.EventController:EventController"); if (!ok) { break; } bool arg2; ok &= luaval_to_boolean(tolua_S, 4,&arg2, "cc.EventController:EventController"); if (!ok) { break; } cobj = new cocos2d::EventController(arg0, arg1, arg2); cobj->autorelease(); int ID = (int)cobj->_ID ; int* luaID = &cobj->_luaID ; toluafix_pushusertype_ccobject(tolua_S, ID, luaID, (void*)cobj,"cc.EventController"); return 1; } }while(0); ok = true; do{ if (argc == 3) { cocos2d::EventController::ControllerEventType arg0; ok &= luaval_to_int32(tolua_S, 2,(int *)&arg0, "cc.EventController:EventController"); if (!ok) { break; } cocos2d::Controller* arg1; ok &= luaval_to_object<cocos2d::Controller>(tolua_S, 3, "cc.Controller",&arg1, "cc.EventController:EventController"); if (!ok) { break; } int arg2; ok &= luaval_to_int32(tolua_S, 4,(int *)&arg2, "cc.EventController:EventController"); if (!ok) { break; } cobj = new cocos2d::EventController(arg0, arg1, arg2); cobj->autorelease(); int ID = (int)cobj->_ID ; int* luaID = &cobj->_luaID ; toluafix_pushusertype_ccobject(tolua_S, ID, luaID, (void*)cobj,"cc.EventController"); return 1; } }while(0); ok = true; luaL_error(tolua_S, "%s has wrong number of arguments: %d, was expecting %d \n", "cc.EventController:EventController",argc, 3); return 0; #if COCOS2D_DEBUG >= 1 tolua_error(tolua_S,"#ferror in function 'lua_cocos2dx_controller_EventController_constructor'.",&tolua_err); #endif return 0; } static int lua_cocos2dx_controller_EventController_finalize(lua_State* tolua_S) { printf("luabindings: finalizing LUA object (EventController)"); return 0; } int lua_register_cocos2dx_controller_EventController(lua_State* tolua_S) { tolua_usertype(tolua_S,"cc.EventController"); tolua_cclass(tolua_S,"EventController","cc.EventController","cc.Event",nullptr); tolua_beginmodule(tolua_S,"EventController"); tolua_function(tolua_S,"new",lua_cocos2dx_controller_EventController_constructor); tolua_function(tolua_S,"getControllerEventType",lua_cocos2dx_controller_EventController_getControllerEventType); tolua_function(tolua_S,"setConnectStatus",lua_cocos2dx_controller_EventController_setConnectStatus); tolua_function(tolua_S,"isConnected",lua_cocos2dx_controller_EventController_isConnected); tolua_function(tolua_S,"setKeyCode",lua_cocos2dx_controller_EventController_setKeyCode); tolua_function(tolua_S,"getController",lua_cocos2dx_controller_EventController_getController); tolua_function(tolua_S,"getKeyCode",lua_cocos2dx_controller_EventController_getKeyCode); tolua_endmodule(tolua_S); std::string typeName = typeid(cocos2d::EventController).name(); g_luaType[typeName] = "cc.EventController"; g_typeCast["EventController"] = "cc.EventController"; return 1; } int lua_cocos2dx_controller_EventListenerController_create(lua_State* tolua_S) { int argc = 0; bool ok = true; #if COCOS2D_DEBUG >= 1 tolua_Error tolua_err; #endif #if COCOS2D_DEBUG >= 1 if (!tolua_isusertable(tolua_S,1,"cc.EventListenerController",0,&tolua_err)) goto tolua_lerror; #endif argc = lua_gettop(tolua_S) - 1; if (argc == 0) { if(!ok) { tolua_error(tolua_S,"invalid arguments in function 'lua_cocos2dx_controller_EventListenerController_create'", nullptr); return 0; } cocos2d::EventListenerController* ret = cocos2d::EventListenerController::create(); object_to_luaval<cocos2d::EventListenerController>(tolua_S, "cc.EventListenerController",(cocos2d::EventListenerController*)ret); return 1; } luaL_error(tolua_S, "%s has wrong number of arguments: %d, was expecting %d\n ", "cc.EventListenerController:create",argc, 0); return 0; #if COCOS2D_DEBUG >= 1 tolua_lerror: tolua_error(tolua_S,"#ferror in function 'lua_cocos2dx_controller_EventListenerController_create'.",&tolua_err); #endif return 0; } static int lua_cocos2dx_controller_EventListenerController_finalize(lua_State* tolua_S) { printf("luabindings: finalizing LUA object (EventListenerController)"); return 0; } int lua_register_cocos2dx_controller_EventListenerController(lua_State* tolua_S) { tolua_usertype(tolua_S,"cc.EventListenerController"); tolua_cclass(tolua_S,"EventListenerController","cc.EventListenerController","cc.EventListener",nullptr); tolua_beginmodule(tolua_S,"EventListenerController"); tolua_function(tolua_S,"create", lua_cocos2dx_controller_EventListenerController_create); tolua_endmodule(tolua_S); std::string typeName = typeid(cocos2d::EventListenerController).name(); g_luaType[typeName] = "cc.EventListenerController"; g_typeCast["EventListenerController"] = "cc.EventListenerController"; return 1; } TOLUA_API int register_all_cocos2dx_controller(lua_State* tolua_S) { tolua_open(tolua_S); tolua_module(tolua_S,"cc",0); tolua_beginmodule(tolua_S,"cc"); lua_register_cocos2dx_controller_EventListenerController(tolua_S); lua_register_cocos2dx_controller_Controller(tolua_S); lua_register_cocos2dx_controller_EventController(tolua_S); tolua_endmodule(tolua_S); return 1; } #endif
Menu Nutra Natural Garcinia Cambogia Nutra Natural Garcinia is 100% additive free! You can now defeat your cravings and know you are doing it naturally! There are no side effects because there are no harmful stimulants. This incredible super enzyme is already known by scientists universally to be a vital compound in the metabolic process. The HCA (Hydoxycitric acid) in Nutra Natural Garcinia controls hunger desires to prevent overeating and help by block fat from being created before it can be stored on your thighs. Garcinia Cambogia also helps your body manage the stress hormones “cortisol,” which is the very the same hormone responsible for creating belly fat and causing all those restless nights and irritable mood swings. Why Should I Take Nutra Natural Garcinia? This incredible new formula has been produced by specialized experts to create highly effective nutritional weight loss safely. Emotional eating and nights of tossing and turning are over because this Garcinia extract increases serotonin levels in your body with the HCA (Hydroxycitric acid) HCA inhibits an all-natural enzyme known as Citrase Lyase. And this new more efficient enzyme now gives you one-thousand milligrams per serving. Additional Benefits Of Nutra Natural Garcinia Include: Burn Fat Safely Lose Weight Feel Great About Your Body Suppress Your Appetite Stop Emotional Eating Have Energy for Days When will Nutra Natural Garcinia Take Effect? Immediately! You’ll see the pounds slip away just as soon as you start this new miracle enzyme. You start seeing results as your body stops producing and storing fat, and starts burning it for fuel! This is the quick acting product you have been dreaming of.
/* * File: Random.cpp * Project: DUtils library * Author: Dorian Galvez-Lopez * Date: April 2010 * Description: manages pseudo-random numbers * * * This program is free software: you can redistribute it and/or modify * it under the terms of the GNU Lesser General Public License as published by * the Free Software Foundation, either version 3 of the License, or * any later version. * * This program is distributed in the hope that it will be useful, * but WITHOUT ANY WARRANTY; without even the implied warranty of * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the * GNU Lesser General Public License for more details. * * You should have received a copy of the GNU Lesser General Public License * along with this program. If not, see <http://www.gnu.org/licenses/>. * */ #include "Random.h" #include "Timestamp.h" #include <cstdlib> using namespace std; bool DUtils::Random::m_already_seeded = false; void DUtils::Random::SeedRand(){ Timestamp time; time.setToCurrentTime(); srand((unsigned)time.getFloatTime()); } void DUtils::Random::SeedRandOnce() { if(!m_already_seeded) { DUtils::Random::SeedRand(); m_already_seeded = true; } } void DUtils::Random::SeedRand(int seed) { srand(seed); } void DUtils::Random::SeedRandOnce(int seed) { if(!m_already_seeded) { DUtils::Random::SeedRand(seed); m_already_seeded = true; } } int DUtils::Random::RandomInt(int min, int max){ int d = max - min + 1; return int(((double)rand()/((double)RAND_MAX + 1.0)) * d) + min; } // --------------------------------------------------------------------------- // --------------------------------------------------------------------------- DUtils::Random::UnrepeatedRandomizer::UnrepeatedRandomizer(int min, int max) { if(min <= max) { m_min = min; m_max = max; } else { m_min = max; m_max = min; } createValues(); } // --------------------------------------------------------------------------- DUtils::Random::UnrepeatedRandomizer::UnrepeatedRandomizer (const DUtils::Random::UnrepeatedRandomizer& rnd) { *this = rnd; } // --------------------------------------------------------------------------- int DUtils::Random::UnrepeatedRandomizer::get() { if(empty()) createValues(); DUtils::Random::SeedRandOnce(); int k = DUtils::Random::RandomInt(0, m_values.size()-1); int ret = m_values[k]; m_values[k] = m_values.back(); m_values.pop_back(); return ret; } // --------------------------------------------------------------------------- void DUtils::Random::UnrepeatedRandomizer::createValues() { int n = m_max - m_min + 1; m_values.resize(n); for(int i = 0; i < n; ++i) m_values[i] = m_min + i; } // --------------------------------------------------------------------------- void DUtils::Random::UnrepeatedRandomizer::reset() { if((int)m_values.size() != m_max - m_min + 1) createValues(); } // --------------------------------------------------------------------------- DUtils::Random::UnrepeatedRandomizer& DUtils::Random::UnrepeatedRandomizer::operator= (const DUtils::Random::UnrepeatedRandomizer& rnd) { if(this != &rnd) { this->m_min = rnd.m_min; this->m_max = rnd.m_max; this->m_values = rnd.m_values; } return *this; } // ---------------------------------------------------------------------------
The poncho ain’t pretty You’re sitting ground level two rows from the front, on a cold Friday night at the MCG. The cold wind is blowing from the grey daunting skies and then it happens. It starts to rain. Rain is a beautiful thing especially when you are rugged up indoors wearing multiple layers and Ugg Boots watching the footy from the privacy of your bed. When you are at the footy however it becomes quite a dilemma. I like to take pride in my appearance, unless I just can’t be bothered and im staying at home, but yes otherwise I like to be ‘princess pretty’ even at the footy. I go through my normal makeup and hair ritual for the footy, mostly to disprove the whole ‘Collingwood ferals’ hypothesis. So when it rains the dilemma to face is obvious; to poncho or not to poncho?! Fashion-wise ponchos are a serious NO-NO! I mean, who looks good in a loose plastic bag?! It’s impossible to look attractive in a poncho. This leads me to my next point, sitting as close to the players as can be and wearing a poncho isn’t going to help the possible…no, highly unlikely elevation to WAG status. Sometimes players DO look into the crowd, they do! Especially after the game when they run down to give away mini footballs, and the poncho look, I doubt its going to be a turn on. “I first saw her at the footy in the crowd wearing a poncho.” Said NO FOOTY PLAYER EVER. Wear the poncho and suffer the consequences of poncho hair and looking like a potato sack or just a blob really. Guys aren’t as effected they can just rip off the sleeves of their ponchos and show off their guns… if it comes to that, but overall they do get away with it better. Most blokes seem to like the device; Collingwood’s very own Andrew Pickering says “ponchos are a great invention. I like the secretive feel of them.” That’s great Andrew but you don’t look like a blobby potato when you wear one. So I guess the only solution for footy fashionistas is to check the weather for rain and get some seats under the roof, oh and don’t forget a black and white umbrella for the walk to the carpark. Facebook and Twitter Want to know when new stories are posted? Enter your email address to subscribe and receive notifications of new posts by email. Note: this is not our eNewsletter sign up. Use the form on the other side to subscribe to our email eNewsletter as well!
# Copyright 2015 The TensorFlow Authors. All Rights Reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. # ============================================================================== """Evaluation for CIFAR-10. Accuracy: cifar10_train.py achieves 83.0% accuracy after 100K steps (256 epochs of data) as judged by cifar10_eval.py. Speed: On a single Tesla K40, cifar10_train.py processes a single batch of 128 images in 0.25-0.35 sec (i.e. 350 - 600 images /sec). The model reaches ~86% accuracy after 100K steps in 8 hours of training time. Usage: Please see the tutorial and website for how to download the CIFAR-10 data set, compile the program and train the model. http://tensorflow.org/tutorials/deep_cnn/ """ from __future__ import absolute_import from __future__ import division from __future__ import print_function from datetime import datetime import math import time import numpy as np import tensorflow as tf import cifar10 parser = cifar10.parser parser.add_argument('--eval_dir', type=str, default='/tmp/cifar10_eval', help='Directory where to write event logs.') parser.add_argument('--eval_data', type=str, default='test', help='Either `test` or `train_eval`.') parser.add_argument('--checkpoint_dir', type=str, default='/tmp/cifar10_train', help='Directory where to read model checkpoints.') parser.add_argument('--eval_interval_secs', type=int, default=60*5, help='How often to run the eval.') parser.add_argument('--num_examples', type=int, default=10000, help='Number of examples to run.') parser.add_argument('--run_once', type=bool, default=False, help='Whether to run eval only once.') def eval_once(saver, summary_writer, top_k_op, summary_op): """Run Eval once. Args: saver: Saver. summary_writer: Summary writer. top_k_op: Top K op. summary_op: Summary op. """ with tf.Session() as sess: ckpt = tf.train.get_checkpoint_state(FLAGS.checkpoint_dir) if ckpt and ckpt.model_checkpoint_path: # Restores from checkpoint saver.restore(sess, ckpt.model_checkpoint_path) # Assuming model_checkpoint_path looks something like: # /my-favorite-path/cifar10_train/model.ckpt-0, # extract global_step from it. global_step = ckpt.model_checkpoint_path.split('/')[-1].split('-')[-1] else: print('No checkpoint file found') return # Start the queue runners. coord = tf.train.Coordinator() try: threads = [] for qr in tf.get_collection(tf.GraphKeys.QUEUE_RUNNERS): threads.extend(qr.create_threads(sess, coord=coord, daemon=True, start=True)) num_iter = int(math.ceil(FLAGS.num_examples / FLAGS.batch_size)) true_count = 0 # Counts the number of correct predictions. total_sample_count = num_iter * FLAGS.batch_size step = 0 while step < num_iter and not coord.should_stop(): predictions = sess.run([top_k_op]) true_count += np.sum(predictions) step += 1 # Compute precision @ 1. precision = true_count / total_sample_count print('%s: precision @ 1 = %.3f' % (datetime.now(), precision)) summary = tf.Summary() summary.ParseFromString(sess.run(summary_op)) summary.value.add(tag='Precision @ 1', simple_value=precision) summary_writer.add_summary(summary, global_step) except Exception as e: # pylint: disable=broad-except coord.request_stop(e) coord.request_stop() coord.join(threads, stop_grace_period_secs=10) def evaluate(): """Eval CIFAR-10 for a number of steps.""" with tf.Graph().as_default() as g: # Get images and labels for CIFAR-10. eval_data = FLAGS.eval_data == 'test' images, labels = cifar10.inputs(eval_data=eval_data) # Build a Graph that computes the logits predictions from the # inference model. logits = cifar10.inference(images) # Calculate predictions. top_k_op = tf.nn.in_top_k(logits, labels, 1) # Restore the moving average version of the learned variables for eval. variable_averages = tf.train.ExponentialMovingAverage( cifar10.MOVING_AVERAGE_DECAY) variables_to_restore = variable_averages.variables_to_restore() saver = tf.train.Saver(variables_to_restore) # Build the summary operation based on the TF collection of Summaries. summary_op = tf.summary.merge_all() summary_writer = tf.summary.FileWriter(FLAGS.eval_dir, g) while True: eval_once(saver, summary_writer, top_k_op, summary_op) if FLAGS.run_once: break time.sleep(FLAGS.eval_interval_secs) def main(argv=None): # pylint: disable=unused-argument cifar10.maybe_download_and_extract() if tf.gfile.Exists(FLAGS.eval_dir): tf.gfile.DeleteRecursively(FLAGS.eval_dir) tf.gfile.MakeDirs(FLAGS.eval_dir) evaluate() if __name__ == '__main__': FLAGS = parser.parse_args() tf.app.run()
C I sell a line of plastics FC And I travel on the road FEm And I have a case of samples FG Which believe me is a load C Every night a strange cafe FC A strange hotel and then FEm Early in the morning FGC I am on the road again Dm When the season's over Em And my lonesome journey ends DmEm That's the only time I see DmG My family and my friends C I drive up Ocean Parkway FC And before I stop the car FEm My ma leans out the window FGC And she hollers, "Here we are!" C Shake hands with your Uncle Max, mein boy FC And here is your sister Shirl FEm And here is your cousin Isabel DmG That's Irving's oldest girl C And do you remember the Tishman twins FC Gerald and Jerome FC We all came out to greet you FGC And to wish you welcome home Meet... F Merowitz, Berowitz, Handelman, Schandelman BbC Sperber and Gerber and Steiner and Stone F Boskowitz, Lubowitz, Aaronson, Baronson, BbF Kleinman and Feinman and Friedman and Cohn Gb Smallowitz, Wallowitz, Teitelbaum, Mandelbaum BDb Levin, Levinsky, Levine and Levi Gb Brumburger, Schlumburger, Minkus and Pinkus BGb And Stein with an "e-i" and Styne with a "y" AbDb Shake hands with your Uncle Sol mein boy GbDb And here is your brother Sid GbFm And here is your cousin Yetta EbmAb Who expects another kid Db Whenever you're on the road mein boy GbDb Wherever you may roam GbFm We'll all be here when you come back GbAbDb To wish you welcome home Note: personally, I prefer to go up a full step, not a half step, at the "Smallowitz" key change; it makes it easier to play. For that version, the chords for the final three stanzas are: G / C / D / G / C / GA / D / G / D / G / Gbm / Em / AD / G / D / G / Gbm / G / A / D
I Wish To Be An Asteroid, Burning To Nothing ☦A story about our Cosmonaut.☦ I am a second, human-shaped moon circling around my home. That lie comforts me when I am at my loneliest. I am a forgotten, lost human, whose efforts will be remembered by no one. That truth reminds me when I am at my most lucid. Lucidity doesn't come often. It's easier to try and sleep the years off of me. Sometimes, when my dreams are generous, I can be nestled in these comforts for a small eternity. But I always wake up to the silence in my suit, in my helm. I used to hate it some time ago, but all the hatred has bled out of me like all my tears. My visor is covered with dust that cannot be wiped off. I have tried everything to remove it, including my spit. It's just another mystery that is my existence, now. I used to dwell on myself a long time ago. Panic struck me often in those times, where I'd fear I was no longer human, no longer alive nor dead. At one point I was afraid that I had somehow ascended the paradigm of life and death, and so was beyond even the grim reaper's kiss. Now that all my fears have been confirmed, I am no longer afraid. I am no longer sad or angry. One can call it acceptance, but I don't think I can accept what I don't understand. I am a vertigo state, not quite falling and not quite rising. My thoughts, too, are not solid around any concept to explain what I am now. I have let go even of the solidity of my name, as there was no point of having a name when no one is there to call you by it. It is easier this way, to think fluid as my body is. My home is bright as a New Year's ornament, reminding me that even if I am not down there to continue it, the world continues itself. When I am at my loneliest, the web of lights over the earth keep me company in a way that the far away glow of the stars cannot. I look forward to the night, when the web glows brightest. Sometimes I imagine that the web lifts off of the world to swaddle me in a net of warmth, gently pulling me down and returning me back home. But then I wake up from my dreams and find myself here again, cold and alone. The lights probably began to dim a while ago, but I only notice it now on this night when I am lonely and empty and looking to my web of light to guide me into comfort. Some of the strings are thin, worn, or cut. A small black out, perhaps. Still, it slides worry into my flesh and that worry proceeds to infest my intestines with doubt. The itching sensation of concern flashes hot on my skin like oil from a pan. Desperate to run from my emotions, I shut my gaze to sleep. When I am again awake, I remain trapped in my anxiety and find the lights have not been this dim in a long time. I would give everything to be on the ground again, if only to be able to ask what is happening to cause things to go dark. It is easy to delude onesself that this is just some new technology that moves cities underground; any kind of excuse or explanation would do. But I know it is not that simple. My years shackled to my fate teaches me to assume my deepest anxiety is the truth. I stay awake for as long as I can. My stomach tells me to be nauseous but there is nothing to vomit except the fear lodged in my intestines. I try to network my brain to the webbing of the lights, perhaps in a desperate attempt to be with my kind before they slip away and leave me behind. "I'm still here! I'm still here! Don't leave, I'm still here!" None of my shouting does anything. The lights cannot hear me. No one can hear me. I am being pulled across an expanse of ocean and ice. I am an aurora borealis across the dark sky with no one to witness my flight. The lights grow ever dimmer. I can help. I am an intelligent man who knows all of the latest technologies. I have even watched the technology evolve. Please net me down. Scoop me from the sky like a fish from the ocean. I can rebuild; we can rebuild. I resist the forces that pull me, screaming insanity into the far-away earth. The world is callous in its rejection. Once, I awaken to find the world darker than I have ever seen it. I learn what it means to be sad again. I re-learn how to mourn. It is so much more painful to become reacquainted with this kind of sorrow now that I have nothing at all to comfort me. The stars reject me as callously as the earth and I am alone with my thoughts, reliving anew the grief that is being conscious in this cold state. In a dream, it is many years into the future. The sun expands, consuming half the solar system. It swallows my tiny body whole, gulping me into its searing heat. I am burned away to nothing. I imagine it is the embrace of my family and friends as they welcome me home.
Q: PHP - "Sal's mall is $emo" vs "Sal's mall is ".$emo - string with quotes concatenation efficiency In PHP, which is a better way to concatenate strings (with a single-quote) in terms of resources? "Sal's mall is $emo." Or: "Sal's mall is ".$emo.'.' Or: 'Sal\'s mall is '.$emo.'.' A: Never mind micro-optimization. Choose what makes your code more readable. A: 'Sal\'s mall is '.$emo.'.' The third way is more efficient (slightly). You can test it by yourself doing a loop: for ($i = 0; $i < 100000; $i++) { // enter code here }
When pundits and rival politicians call Ron Paul an “isolationist,” they mislead the American people -- and they know it. They know it? How could they not: Ron Paul is for unilateral, unconditional free trade. He believes any American should be perfectly free to buy from or sell to any person in the world. In that sense -- the laissez-faire sense -- he favors globalization, which, applied consistently, would require a worldwide free market. He’s such a strong advocate of free trade that he objects to the world’s governments, led by the U.S. government, setting up international bureaucracies, such as the World Trade Organization, to manage trade. He thinks trade should be a totally private matter. That’s a solid classical-liberal, or libertarian, position. So why is Paul repeatedly called an isolationist? Apparently in today’s political world, being an isolationist means opposing the U.S. government’s policing the rest of the world through invasion, occupation, and war -- that is, militarism. The word “isolationist” has always suggested a fear of foreigners, and no doubt those who apply the word to Paul want to cash in on that sense. So we are left with the daffy conclusion that Ron Paul is a xenophobic, head-in-the-sand isolationist precisely because he prefers peaceful trade with foreigners rather than invasion, occupation, and demolition of their countries. If that’s what it means to be an isolationist, count me as one too. It’s easy to understand why this inappropriate label is stuck on Paul. Establishment conservatives and progressives are terrified by him and desperately want him to go away. They’re terrified because he has done the worst thing imaginable: he has held up a mirror and reminded them of what they are. He has shown establishment conservatives and even so-called Republican moderates (such as Mitt Romney and Jon Huntsman) that they are, and long have been, apologists for empire and therefore betrayers of the republican (small-r) ideals they say they embrace. When Paul condemns past, present, and future aggressive wars (such as the one being planned for Iran); when he calls for closing America’s 900 military installations in over 40 countries and removing America's troops from 130 countries; when he advocates an end to all economic and military aid to foreign governments (including Israel’s); and when he opposes wholesale violation of the Bill of Rights (see the PATRIOT Act and the National Defense Authorization Act), he is saying to his Republican rivals, You have helped destroy individual liberty by shamefully supporting the U.S. global empire, which brutalizes foreign populations, fosters an exploitative military-industrial complex, violates civil liberties, and burdens the American people with obscene debt, taxation, and Federal Reserve monetary manipulation. That charge must be hard to take from a fellow Republican. So his rivals strike back in the way they know best: they smear Paul. The thought of a staunch antiwar, pro-Bill of Rights candidate running against Barack Obama scares the daylights out of them, because they know only one way to run against a Democrat: accuse him of being an appeaser and a socialist. This is absurd, however, because Obama is neither. He has steadfastly carried on the empire’s program of global militarism and corporatism. If you doubt it, look at his foreign-policy record and the long list of Wall Street people who advise him and give him money. Which brings us to the progressives. If you think establishment conservatives are scared of Ron Paul, imagine how Obama and his supporters must feel. Can you imagine their having to run against a consistent antiwar, pro-Bill of Rights opponent? This is the same Obama who has maintained Guantanamo, launched more deadly drone attacks than George W. Bush, signed into law the authority to detain individuals indefinitely without charge or trial, claimed he may kill even American citizens without due process, cracked down harshly on whistle-blowers, protected torturers from legal consequences, invoked state secrets to quash lawsuits by torture victims, and on and on. Most progressives live in a fantasy world where they are champions of peace, tolerance, and the rule of law, when in fact they support -- and refuse to criticize -- a man who has mimicked George W. Bush in virtually every way. How can they tolerate a man -- Ron Paul -- who reminds them of that? Sheldon Richman is senior fellow at The Future of Freedom Foundation (www.fff.org) and editor of The Freeman magazine.
807 P.2d 734 (1991) 111 N.M. 550 Don E. HERMAN, Surviving Spouse of Patricia D. Herman, Deceased, Petitioner, v. MINERS' HOSPITAL, Respondent. No. 19488. Supreme Court of New Mexico. February 28, 1991. *735 Kastler and Kamm, Terrence R. Kamm, Raton, for petitioner. Montgomery & Andrews, P.A., Katherine W. Hall, Santa Fe, for respondent. OPINION BACA, Justice. This appeal is before us on writ of certiorari to the court of appeals. Petitioner Don Herman seeks to appeal the judgment of the court of appeals, which reversed an award of death benefits made by a hearing examiner of the Workers' Compensation Division. We have granted the petition, and we reverse the judgment of the court of appeals, reinstating the award of benefits. Respondent Miners' Hospital (Hospital) employed Herman's spouse, the decedent, as a nurse. On July 21, 1986, decedent died as a result of a heart attack suffered at work. She had been treated at the Hospital for the heart attack immediately prior to her death, and she died at the Hospital. Decedent's heart attack occurred during a period when she suffered from substantial stress related to her employment. Following her death, the Hospital, as employer, did not file a first report of accident, and petitioner filed a claim for death benefits on July 20, 1988, almost two years after the death. The Workers' Compensation hearing examiner determined that decedent died in an accident arising out of and in the course of her employment and that her death was causally connected to employment-related stress. The examiner also concluded that the Hospital had actual notice of the accident and that the Hospital's failure to file a first report of accident tolled the statute of limitations. See NMSA 1978, §§ 52-1-58 & -59. Accordingly, Herman was awarded benefits as surviving spouse. The court of appeals reversed in a memorandum opinion, holding that the claim was barred by the notice requirements of the Workers' Compensation Act, NMSA 1978, Section 52-1-29, and that the claim was *736 barred by the statute of limitations contained in Section 52-1-31(B). We consider those two issues: whether the claim was barred by the notice requirements, and whether it was barred by the statute of limitations, as well as a third issue raised before the court of appeals but not discussed: whether the finding of causation was supported by substantial evidence.[1] I. IS THE HEARING EXAMINER'S FINDING THAT DECEDENT'S HEART ATTACK WAS CAUSALLY RELATED TO ON-THE-JOB STRESS SUPPORTED BY SUBSTANTIAL EVIDENCE? The essence of the Hospital's claim is that Herman failed to carry his burden to show that the heart attack resulted from decedent's employment, and thus there was not substantial evidence supporting the hearing examiner's finding of causation. It argues that under whole record review the finding must be reversed because the totality of the evidence indicates that the finding was not reasonable. On appeal, to determine whether a challenged finding is supported by substantial evidence, we have always given deference to the fact finder, even when we apply, as here, whole record review. See Duke City Lumber Co. v. New Mexico Envtl. Improvement Bd., 101 N.M. 291, 681 P.2d 717 (1984); Tallman v. ABF (Arkansas Best Freight), 108 N.M. 124, 767 P.2d 363 (Ct.App.), cert. denied, 109 N.M. 33, 781 P.2d 305 (1988). When applying whole record review, the reviewing court "views the evidence in the light most favorable to the agency decision, but may not view favorable evidence with total disregard to contravening evidence." National Council on Compensation Ins. v. New Mexico State Corp. Comm'n, 107 N.M. 278, 282, 756 P.2d 558, 562 (1988) (citations omitted). Substantial evidence on the whole record is such evidence that demonstrates the reasonableness of the administrative decision. Id. To determine whether a finding of fact is amply supported by the whole record, we do not rely solely on one part of the evidence if to do so would be unreasonable. We must find "evidence that is credible in light of the whole record and that is sufficient for a reasonable mind to accept as adequate to support the conclusion reached by the agency." Id. We will not, however, substitute our judgment for that of the agency; although the evidence may support inconsistent findings, we will not disturb the agency's finding if supported by substantial evidence on the record as a whole. Tallman, 108 N.M. at 129, 767 P.2d at 368. As long as substantial evidence supports the findings of the hearing officer, an appellate court will not disturb those findings on appeal. Yates v. Matthews, 71 N.M. 451, 379 P.2d 441 (1963). Section 52-1-28(B) requires that where an employer denies a disability is a result of an accident, the claimant "must establish that causal connection as a probability by expert testimony of a health care provider." In other words, Herman had to show by medical evidence that decedent's death and heart attack was a medically probable result of the work-related stress. See Anderson v. Mackey, 93 N.M. 40, 42, 596 P.2d 253, 255 (1979). The Hospital asserts that a possible cause only becomes a probable cause "`when in the absence of other reasonable causal explanations it becomes more likely than not that the injury was a result of its action.'" Bufalino v. Safeway Stores, Inc., 98 N.M. 560, 565, 650 P.2d 844, 849 (Ct.App.1982) (quoting Parker v. Employers Mut. Liab. Ins. Co., 440 S.W.2d 43, 47 (Tex.1969)). Bufalino determined that speculation — which "arises when the probabilities of an event happened in one or two *737 ways and there is not evidence as to which way it did happen" — is improper as a basis for determining causation. Id. The Hospital, however, does not reflect on Bufalin o's determination that the fact finder is given deference when faced with conflicting medical testimony regarding causation and medical probability. See id.; see also Yates, 71 N.M. at 453-54, 379 P.2d at 442-43 (trier of fact must resolve disagreement and determine true facts). As we will show, our review of the evidence indicates this latter proposition is dispositive.[2] Three medical experts presented evidence, two on behalf of Herman and one for the Hospital. All testified that several factors could cause a heart attack and that several of the factors were present in decedent. Stress was identified as a minor risk factor. All of the experts agreed that smoking, high cholesterol, high blood pressure, diabetes, and a family history of heart disease were major factors. The Hospital's expert indicated that job-related stress was one of many minor factors, while Herman's experts testified it was one of four minor factors. The Hospital's expert testified that as the number of risk factors present in a patient increased, the risk of heart attack multiplied. One of Herman's experts testified that stress appeared to have exacerbated decedent's high blood pressure, which caused heart damage. This evidence was contradicted by other testimony. We conclude that, even under whole record review, the testimony supports the hearing examiner's findings. Whole record review is not an excuse for an appellate court to reweigh the evidence and replace the fact finder's conclusions with its own. It allows the reviewing court greater latitude to determine whether a finding of fact was reasonable based on the evidence, and we hold that, in this case, even though the examiner was faced with conflicting evidence, its finding was reasonable. In Oliver v. City of Albuquerque, 106 N.M. 350, 352, 742 P.2d 1055, 1057 (1987), we noted that when a pre-existing condition is aggravated by employment-related stress, the requirement of a job-related injury is met. Thus, Herman only had to show to a medical probability that the stress aggravated what may have been a pre-existing condition. In the present case, the Hospital's expert stated there was no causal connection, and one of claimant's experts is contended to have been discredited. However, claimant's other expert, a cardiologist, presented evidence to the effect that stress, although a minor risk factor when compared to several major risks that afflicted decedent, is a factor causing heart attacks. Evidence also was presented that the more factors present in a patient, the greater the likelihood of heart disease. Thus, the evidence is sufficient for us to sustain the fact finder under the Oliver standard and applying whole record review. Herman was not required to prove that stress was the only factor causing the fatal heart attack; he needed to show that the heart attack more likely than not was the result of stress. Bufalino, 98 N.M. at 565, 650 P.2d at 849. We find the evidence presented here susceptible to a conclusion similar to that articulated in Oliver. To conclude otherwise, under these facts, would sanction a rationale that a finder of fact could never reach a determination of "medical probability" when opposing parties presented experts with diametrically opposed opinions. Conflicting evidence does not, by itself, demand a conclusion that only a "medical possibility" has been shown. The evidence presented here, simply stated, is that stress is a factor, albeit minor, in causing heart disease; the risk of heart disease multiplies *738 with each additional risk; decedent was under employment-related stress both from an incident the day of her attack and from daily stress, and she had a heart attack. Moreover, there was contested evidence that, as evidenced by the autopsy, stress exacerbated decedent's hypertension and that absent the stress, decedent would have lived another five to ten years. There was sufficient medical testimony presented to support the hearing examiner's decision. II. DID THE HOSPITAL HAVE ACTUAL NOTICE? Section 52-1-29(B) excuses the written notice requirements of subsection (A), and states: No written notice is required to be given where the employer or any superintendent or foreman or other agent in charge of the work in connection with which the accident occurred had actual knowledge of its occurrence. The Hospital argues that we are presented with a narrow legal issue: whether knowledge of an on-the-job heart attack constitutes actual knowledge of an accident sufficient to satisfy Section 52-1-29(B). This appears to be the position of the court of appeals, which, despite the hearing examiner's finding of actual notice based on the Hospital employees' knowledge of the time, place, and circumstances of the accidental death, determined that "there is no evidence in the record that [the Hospital] knew that the heart attack was caused by the decedent's employment." In a workers' compensation case where a dependent seeks benefits based on the worker's death by heart attack, the death is analyzed as the disability, the heart attack as the injury, and the employment-related stress as the accident. Oliver, 106 N.M. at 351, 742 P.2d at 1056 (analyzing whether a fire fighter who died as a result of a heart attack was entitled to benefits pursuant to Section 52-1-28). In the instant case, the hearing examiner made a finding that the Hospital had actual notice based on the circumstances. Those circumstances incontrovertibly included knowledge of the heart attack (the injury) and the death (disability). The remaining questions of fact were whether the Hospital had knowledge of the job-related stress (the accident) and causation between the accident and the injury, and the examiner found that it did. We conclude that ample evidence supports the finding of knowledge under the unique facts and setting of this case. The Hospital knew of the decedent's heart attack — not only did she suffer the heart attack at work, but she was treated and died there. The Hospital also knew of her stressful schedule. Decedent worked a forty-hour week; she was on call an additional eighty hours a week, she attended school, and she was involved in merger plans, all with the Hospital's knowledge. Moreover, testimony indicated that decedent had an argument with one of the hospital's surgeons on the day of her death.[3] The court of appeals rejected petitioner's argument that Section 52-1-29(B) was satisfied because the Hospital's *739 knowledge of decedent's death by heart attack at work constituted knowledge of the accident. We agree with that court to the extent that it opined that the employer must have knowledge of the accident, not merely the injury, see Herndon v. Albuquerque Public Schools, 92 N.M. 635, 593 P.2d 470 (Ct.App.1978),' and that, although a heart attack can be compensable under New Mexico law, see Oliver, 106 N.M. at 352, 742 P.2d at 1057; Sanchez v. Board of County Comm'rs, 63 N.M. 85, 313 P.2d 1055 (1957), not every heart attack is compensable — it must relate to the employment. See Wilson v. Navajo Freight Lines, Inc., 73 N.M. 470, 473, 389 P.2d 594, 596 (1964). An element of causation must be present, and the employer must have knowledge that a work-related accident caused the injury for the actual notice requirement to be met. See Herndon, 92 N.M. at 642, 593 P.2d at 477; 2B A. Larson, The Law of Workmen's Compensation § 78.31(a)(2). The employer has actual notice of a job-related accident as required by the statute when he has knowledge of the injury and "some knowledge of accompanying facts connecting the injury or illness with the employment, and indicating to a reasonably conscientious manager that the case might involve a potential compensation claim." 2B A. Larson, supra, § 78.31(a)(2) at 15-133 to -136 (footnotes omitted); see Collins v. Big Four Paving, Inc., 77 N.M. 380, 383, 423 P.2d 418, 420 (1967) (actual knowledge "does not mean first-hand knowledge, but only `knowledge' as the word is used in common parlance * * *. `[A]ctual knowledge' is knowledge sufficient to impress a reasonable man, i.e., knowledge obtained in the daily affairs of life, but not absolute certainty.") (citations omitted). The finding that the Hospital had actual knowledge of the circumstances of decedent's accidental death, which we have found supported by the evidence, constitutes a finding of causation. Such a conclusion need not rest on the admittedly flimsy logic that knowledge of the stress, heart attack, and death necessarily leads to the conclusion that an employer knew of causation. The hearing examiner was entitled to draw inferences from the facts presented. See Powers v. Riccobene Masonry Constr., Inc., 97 N.M. 20, 636 P.2d 291 (Ct.App.1980). The totality of the facts and circumstances determine whether an employer has actual knowledge of a compensable injury. Rohrer v. Eidal Int'l, 79 N.M. 711, 713, 449 P.2d 81, 83 (Ct.App. 1968). The examiner could reasonably infer from the evidence presented that the Hospital through its employees knew that the work-related stress induced the heart attack and gave rise to a potential claim. Moreover, the reasons and policies underlying the notice requirement support our conclusion. The requirement is designed to protect the employer, allowing it to investigate the facts and circumstances surrounding an injury while the facts are accessible. It allows the employer to act to prevent the filing of fictitious claims and to make sure an injured employee receives proper medical attention. See Herndon, 92 N.M. at 641, 593 P.2d at 476 (citing Ogletree v. Jones, 44 N.M. 567, 106 P.2d 302 (1940)); Beckwith v. Cactus Drilling Corp., 84 N.M. 565, 568, 505 P.2d 1241, 1244 (Ct.App.), cert. denied, 84 N.M. 560, 505 P.2d 1236 (1973). Under the circumstances of the instant case, it is apparent that the reasons behind the notice requirement cannot be further served. The Hospital was in as good a position (if not better) as decedent or Herman to investigate the situation and provide prompt medical assistance. See Collins, 77 N.M. at 383, 423 P.2d at 420 (although bodies not yet discovered, employer and insurer had benefit of all known facts within a few days of decedents' disappearance in plane wreck, and under the circumstances further investigation would serve no purpose). The court of appeals apparently felt compelled to reverse the hearing examiner by our opinion in Wilson v. Navajo Freight Lines, Inc., 73 N.M. 470, 389 P.2d 594 (1964). In Wilson, the fact finder had denied the employee-claimant benefits. The employee had been a truck driver who, while driving through Missouri for the defendant-employer, suffered a heart attack. The employer was not given written notice, *740 and we refused to hold that, as a matter of law, the employer's notice of a heart attack that occurred on the job constituted knowledge of the accident. Id. at 473, 389 P.2d at 596. Wilson is readily distinguished from the case at bar. The hearing examiner found actual notice based on the unique circumstances and setting of this case, and on review we find substantial support for that finding.[4] III. WAS THE STATUTE OF LIMITATIONS TOLLED? NMSA 1978, Section 52-1-58 requires an employer to file a written report of a compensable accidental injury suffered by an employee with the labor commissioner within ten days of the injury. Section 52-1-59 provides that the effect of a failure to file is that no claim for compensation is barred prior to the filing of the appropriate report. Section 52-1-31(B) contains the otherwise applicable statute of limitations and the procedure for filing a claim upon the death of a worker for which compensation may be received. Eligible dependents are entitled to recover benefits, although no claim can be filed unless notice has been given as required by Section 52-1-29 and a claim is filed within a year of the worker's death. In the present case, the claim was filed almost two years after decedent's demise. The hearing examiner, however, found the statute of limitations was tolled and the claim was not barred because of the Hospital's failure to file a first report of accident as required by Section 52-1-58. The court of appeals held otherwise, determining that, because it reversed the examiner's finding of actual notice, Wilson required the conclusion that the statute of limitations was not tolled. See 73 N.M. at 474, 389 P.2d at 596. Although the court of appeals properly construed Wilson, it applied an erroneous factual predicate. Our conclusion that the Hospital did have notice mandates the application of Section 52-1-59 to toll the time limitation. The Hospital had actual notice of the compensable injury, yet failed to file a written report as required. Thus, we hold that the claim is not time barred. See Wilson, 73 N.M. at 474, 389 P.2d at 596; Sanchez v. Bernalillo County, 57 N.M. 217, 257 P.2d 909 (1953); Cisneros v. Molycorp, Inc., 107 N.M. 788, 765 P.2d 761 (Ct.App.), cert. denied, 107 N.M. 785, 765 P.2d 758 (1988). Accordingly, we reverse the decision of the court of appeals and reinstate the judgment of the workers' compensation hearing officer. IT IS SO ORDERED. SOSA, CI, and FRANCHINI, J., concur. NOTES [1] The relevant statute, and that considered by the hearing examiner and the court of appeals, is the one in effect at the time the cause of action accrued, i.e. when the employee knew or should have known of the existence of a compensable injury. Noffsker v. Barnett & Sons, 72 N.M. 471, 384 P.2d 1022 (1963); Strickland v. Coca-Cola Bottling Co., 107 N.M. 500, 760 P.2d 793 (Ct.App.), cert. denied, 107 N.M. 413, 759 P.2d 200 (1988). Accordingly, we apply the statutory provisions in effect on July 1, 1986, and statutory references are to provisions contained in the original 1978 compilation. [2] The Hospital also refers us to Renfro v. San Juan Hospital, Inc., 75 N.M. 235, 403 P.2d 681 (1965). In that case, however, the medical evidence could at best indicate that the work-related accident was one possible cause of plaintiff's injuries, whereas in this case, although certain medical evidence indicated that the immediate cause of the heart attack was stress, other evidence was to the effect that stress was not the cause. In other words, the instant case presents us, as it did the hearing examiner, with conflicting evidence that required the finder of fact to determine facts based on its evaluation of credibility, demeanor, and other relevant factors, not evidence that required the fact finder to speculate as to causation. [3] The Hospital argues that the purported knowledge of the testifying physician (who apparently was an independent physician at the Hospital and was not on the staff) regarding job-related stress does not establish the Hospital's knowledge of the accident. In this regard the Hospital misapprehends the role of an appellate court in reviewing the evidence and the function of circumstantial evidence in establishing facts, including actual knowledge. See Professional Insurors, Inc. v. Buck Scott & Son Motor Co., 110 N.M. 299, 795 P.2d 991 (1990). We extend every reasonable inference to the finder of fact to determine whether a finding is supported. In this case, in the context of the hospital setting, we find the hearing officer's inferences from the testimony of the physician (even assuming arguendo that his knowledge does not constitute knowledge of the Hospital) that a staff physician, who induces stress by dressing down an employee, has knowledge of a stressful environment and therefore knowledge of the accident. We reject the Hospital's argument that only the knowledge of decedent's immediate supervisor or the knowledge of the personnel director are relevant. In a hospital setting, the knowledge of a staff surgeon may suffice to meet the requirements of Section 52-1-29(B). Moreover, we find the examiner's finding of actual knowledge of the accident a reasonable inference from the Hospital's knowledge of decedent's schedule in the context of the hospital setting. [4] Moreover, a common-sense consideration of this problem demonstrates the logic of our conclusion and the reasonableness of the hearing examiner's inferences. Whereas a trucking company may not be in a position to know reasonably that a heart attack suffered by a driver somewhere in Missouri is related causally to the employment and, therefore, the result of a work-related accident, a hospital could know reasonably that a heart attack suffered by a nurse while under stress both from an incident that same day and from the daily demands of her occupation is connected causally to her employment, at least to the extent that it has notice of a potential claim.
Q: Is there something more standard for handling "this" without making "that" reference to "this" I have some code here: App.prototype.binds = function(){ var that = this; $('.postlist li').live('click', function(){ that.selectPost(this);} ); } App.prototype.selectPost = function(){ this.function(); } I am creating a reference of "this" as "that" in my binds function so in my selectPost(), I can use "this" to reference the App object instead of the list item. Is there a more graceful/standard solution to this instead of using "that"? With the Answer, my code becomes: App.prototype.binds = function(){ $('.postlist li').live('click', $.proxy(this.selectPost, this) ); } App.prototype.selectPost = function(e){ this.function(); // function in App var itemClicked = e.currentTarget; //or var $itemClicked = $(e.currentTarget); } A: You can bind the functions in constructor or just in time: In constructor function App() { this.selectPost = this.selectPost.bind( this ); //$.proxy( this.selectPost, this ) in jQuery } App.prototype.binds = function(){ $('.postlist li').live('click', this.selectPost ); //Already bound in constructor } Just in time: App.prototype.binds = function(){ $('.postlist li').live('click', this.selectPost.bind( this )); //$.proxy( this.selectPost, this ) in jQuery } Note that .bind is only supported in newer browsers, jQuery has $.proxy that should be preferred. I have opened a feature request in jQuery that has been accepted http://bugs.jquery.com/ticket/12031. It will make this easier when using jQuery events. Note that there is a common misunderstanding that the e.target will be same as normal this in a jQuery event handler. It is actually e.currentTarget. So now that this refers to the instance and not the element, you can get the elemet through e.currentTarget.
Just a couple of months ago, rumors indicated Spotify was negotiating to acquire fellow music streamer SoundCloud. Now, TechCrunch reports hearing from a source that those talks have ended and Spotify is walking away. According to the Financial Times, Spotify has considered this deal twice before and ended negotiations because it couldn't agree on a price.
Q: Tesseract OCR won't recognize division symbol "÷" I am using Tesseract in iOS 8 for an OCR based app but it incorrectly converts the division "÷" symbol in the image to a plus "+" sign. For example, this image always converts to the text string "8+4+4". It should be "8+4÷4". I've tried using different trained data language files "eng+equ", "ita", adding "÷" to the whitelist, setting the ocr_engine variable to cube, converting image to grayscale or black & white, upsizing the image by 2 and 4 times. Everything I've tried always returns a plus "+" sign instead of a division "÷" symbol. I tried using only the "equ" trained data file and that DOES return the division symbol correctly - but all other characters are then garbage. I've been looking into this (Google, Stackoverflow) for several days and cannot figure it out. How do I get Tesseract to include and recognize the division "÷" symbol? UPDATE: The best I have been able to do is to set the AVCaptureSession preset to high AVCaptureSession *session = [[AVCaptureSession alloc] init]; session.sessionPreset = AVCaptureSessionPresetHigh; The captured image above dimensions are then 676 × 405 pixels. Using Tesseract OCR UIImage category (image is named 'source') to binarize the image: // Binarize the source image to improve contrast (using the UIImage category provided by TesseractOCR) UIImage *blackAndWhiteImage = [source blackAndWhite]; [self.tesseract setImage:blackAndWhiteImage]; This will usually convert the division symbol to the text "-1-", but I've seen "-:-" and other numbers and uppercase characters between the minus signs. I can check for that in the returned text. But then it is impossible to know whether to treat the returned text "8-1-2" as a true subtraction or 'maybe' division. A: Train the or engine wit different fonts. Here is the tool for training the engine. Have a look on this also Or you can use JTessBoxEditor
Systolic functional response of normal older and younger adult left ventricles to beta-blockade during exercise. There is controversy over the effects of beta-blockade on the left ventricular systolic response of the heart of the elderly to stress. In this study we compared the effects of acute beta-blockade in normal older and younger adult left ventricles during exercise. The study population consisted of 17 healthy elderly people, 67 +/- 3 years old, while 18 young normal subjects, 31 +/- 4 years old, served as controls. A symptom-limited exercise treadmill test was performed before and 15 minutes after intravenous administration of 0.12 mg propranolol/kg. M-mode echocardiographic studies were performed before and immediately after each test. Intravenous propranolol at rest decreased heart rate by 14 +/- 7 beats/min in the elderly and by 7.5 +/- 8 beats/min in the young (p = 0.02), decreased the double product by 2500 +/- 1200 mmHg/min and 1830 +/- 970 mmHg/min (p = 0.05), respectively; changed the left ventricular end-systolic dimension by +0.21 +/- 0.36 cm and +0.03 +/- 0.24 cm (p = 0.09), respectively; and changed the end-diastolic dimension by +0.22 +/- 0.46 cm in the elderly and by -0.02 +/- 0.32 cm in the young (p = 0.08). The change in fractional shortening was -1.22 +/- 4.17% in the elderly and -0.78 +/- 4.05% in the young (p > 0.05), and the decrease in the systolic blood pressure/end-systolic dimension ratio was 5.9 +/- 7 mmHg/cm and 4.3 +/- 3.8 mmHg/cm, respectively (p > 0.05).(ABSTRACT TRUNCATED AT 250 WORDS)
Add new comment Just wanted to present some examples of where we as the Bank actively engaged in learning from other experts in the Crisis Community. In the case of Haiti, we engaged, we learned, and we move more quickly than before (http://blogs.worldbank.org/dmblog/how-civic-hacking-answered-haiti-disaster) This is certainly not the rule but something to feel hopeful about. Many more examples upcoming. Stay tuned.
The U.S. announcement of drawdown of its forces in Iraq has grabbed great importance on the Iraqi political stage as the country has declared cleansing its territories from ISIS and ending the terrorist group’s self-proclaimed caliphate, eliminating the pretext under which the US-led coalition sent forces to Iraq. However, the current conditions Iraq is living bear a lot of challenges to Baghdad amid Washington’s insistence to keep its military forces in the country as long as possible. This intent has been exposed by the recent comments made by the American officials who talked about the need for their military to stay long-term in Iraq. Kata’ib Hezbollah, another anti-ISIS force in Iraq, also came clean on the US stay. Its spokesman stated that the American presence in Iraq is “occupation.” He added that there is no time to debate what the presence of the American military in Iraq should be labeled. He further argued that the US-led alliance was made without Iraq’s will and that Americans entered Iraq uninvited. After announcing the Pentagon’s stance on the continuation of the US military presence in Iraq, Iraqi Kata’ib Hezbollah warned Americans about a military confrontation that could take place at any moment. Jafar al-Husseini, the spokesman of Iraqi Kata’ib Hezbollah during a speech, stated that “a military confrontation with United States may take place at any moment”… … … Terrorist Gangs Using Western Made Guided Missiles in Syria by Frontinfo Media: Be advised, VIDEO CONTAINS GRAPHIC IMAGES, not recommended for children under age of 18 ~ Mature viewers only ~ This is a war documentary ~ For documentary and educational purposes only ~ Video overing wars posted not to offend, shock or encourage violence but for news / historical and educational purposes ~ Real events – as it is – often videotaped by the people who lived thru it ~ It is raw footage, therefore : Use your own discretion ~ If it’s not something you were expecting to watch, please watch something else ~ Again : This is a war documentary, VIDEO CONTAINS GRAPHIC IMAGES ~ IF IT’S NOT SOMETHING YOU WERE LOOKING FOR STOP, DO NOT WATCH! The U.S. is relocating Daesh (ISIS, ISIL, IS) mercenary-terrorists from Syria and Iraq to Afghanistan after the terrorist group has lost its strongholds in the west Asian Arab states, Iran’s top military commander said on Tuesday. Chief of Staff of the Iranian Armed Forces Major General Mohammad Baqeri told Tasnim news agency on Tuesday that continued tensions in Southwest Asia would provide Americans with the much-desired pretext to prolong their military presence there. “This is a serious case. The ISIS members have come to Afghanistan not for Jihad against the US and other foreign troops, they have come to set up a foothold for their further expansion to the north, to Central Asia,” he said, noting that most IS group’s fighters in Afghanistan come from Central Asia or Russia… … … Syrian army has intercepted missiles Israeli regime’s fighter jets fired towards a military position near the capital, Damascus. In a statement carried by state media on Wednesday, the army said the Israeli aircraft used Lebanese airspace for the missile strikes. Loud blasts were heard in Damascus at around 3:30 a.m. local time. “Our air defense systems blocked them and destroyed most of them,” said the statement. The latest attack on Syria came shortly after Israeli Prime Minister Benjamin Netanyahu paid a rare visit to the occupied part of Syria’s Golan Heights and peered across the border. In a letter sent to the UN Secretary General and Security Council President, the Ministry said that on 3:42 am on Wednesday in 7/2/2018, the Israeli occupation attacked once again the territory of the Syrian Arab Republic, as Israeli aircrafts fired missiles from the Lebanese airspace on an area in Damascus Countryside province. The Ministry went on to say that the attack coincided with the attacks of armed terrorist organizations and the launching of more than 1,000 rockets and mortar rounds during the past few days on neighborhoods, suburbs, diplomatic missions, service facilities, and churches in Damascus and other cities, where dozens of civilians were killed and hundreds others were wounded, most of them women and children… … … … … … … … … The competent authorities on Friday seized new amounts of weapons, various ammunition, toxic materials and Israeli-made mines left by Daesh (ISIS) terrorist organization in the eastern countryside of Deir Ezzor. The authorities discovered Israeli-made mines, poisonous materials and weapons from the remnants of Daesh during the sweeping operations of the villages of al-Sayyal, Hassrat and the town of al-Jalaa in the eastern countryside of the province, according to SANA’s reporter. The competent authorities continue their work in combing the villages and towns of the eastern countryside of Deir Ezzor and cleansing the area of the remnants of Daesh in preparation for the return of the families to their homes… … … … … …Dissident-affiliated websites reported on Tuesday that Israeli military is planning to cross into Syria amid intensified tensions between Daesh (ISIS, ISIL) and other rival terrorist groups in the Southern part of the country… … … … … …The Zionist entity intention is to transform most of Israel’s neighboring Arab states into warring tribes and ethnicities so they would no longer be a threat to the colonial entity. Tel Aviv leaders have stated openly that they would prefer continued chaos in Syria… … … Over 1,000 localities, 78 oil and gas fields and two deposits of phosphate ores have been liberated in Syria over the past 227 days, commander of Russia’s military group in Syria Colonel-General Sergey Surovikin has told Russian President Vladimir Putin during this visit to the Khmeimim airbase on December 12. In total, the area of 67,000 square kilometers has been liberated. Col. Gen. Surovikin added that Russian warplanes have flown 6,956 sorties and helicopters have conducted more than 7,000 sorties killing over 32,000 militants and destroying 394 battle tanks and 12,000 pieces of other equipment. The general revealed that Russia is set to withdraw 23 warplanes of different types and 2 Ka-52 attack helicopters, the military police force, the commando unit, the field hospital and the mine-clearing center. The remaining forces will continue conducting tasks in the country. Thus, some number of attack helicopters and warplanes will remain in the country. The Khmeimim airbase and the Tartus naval facility will remain operational. Moscow will also continue providing supplies to the Syrian Arab Army (SAA). The Russian General Staff has declared the liberation of Syria from Islamic State (IS, formerly ISIS), stating that all territories previously under terrorist control were liberated in the final push by the Syrian Army. “All terrorist units of ISIS on Syrian soil have been destroyed, and the territory is liberated,” Armed Forces Chief of Staff General Valery Gerasimov said. “Therefore, as of today, there’s no territory controlled by ISIS in Syria,” he added. Gerasimov made the announcement during an annual briefing for foreign military attachés. “Naturally, there might be some spots of resistance, but the military work has been largely completed in the area and at the time. Completed with a full victory, I repeat, with a victory and defeat of the terrorists,” Russian leader said… … … FOREWORD: The U.S. Department of Defense’s Special Operations Command [SOCOM] has since 2015 commissioned three cargo ships to transport 4,700 tons of arms and ammunition including ATGMs. These loads of weapons and ammunition result from the satellites being shipped to Turkish coasts to tbe spread in the Middle East from the ports of Constanta in Romania and Burgas in Bulgaria, with the likely intended final destination of these arms being the various factions of mercenary-terrorists, the so called “Syrian Opposition”…… … … On November 29 (2017), members of Daesh (so called ISIS, ISIL, IS) destroyed three bulldozers of the Syrian Arab Army (SAA) with anti-tank guided missiles (ATGMs) north of the T-2 station, near the Syrian-Iraq border… … … This intense usage of ATGMs by Daesh against the SAA shows that Daesh is now relaying on rapid hit and run attacks as its main tactic to stop the government advance… … … Once the SAA secures the western bank, ISIS will be trapped in the empty Homs desert… … … Assad, Putin meeting could mean end of Syrian war is close [interview with anti-war activist, Brian Becker] Syrian President Bashar Assad met with Russian President Vladimir Putin in the resort city of Sochi, Russia on Monday. The two leaders spent three hours discussing military operations in Syria and the fight against terrorism in the Middle East. Brian Becker of the anti-war ANSWER Coalition, tells RT America’s Anya Parampil that the meeting could signify that the six-year Syrian War is coming to a close. President Bashar al-Assad, during a work visit he paid to Russia on Tuesday, held a summit meeting with Russian President Vladimir Putin in Sochi City in presence of senior Russian political and military officials. President Putin congratulated President al-Assad on the successes achieved by Syria in the framework of combating terrorism, and on approaching victory over terrorism by the Syrian people. President al-Assad indicated that the victories achieved against terrorism led to the return of security to many areas and subsequently, citizens returned to them and the wheel of normal life began to move again, in addition to pushing the political track forwards to find solution to the crisis in Syria. President al-Assad conveyed thanks by the Syrian people to President Putin and the friendly and loyal Russian people for what Russia has done to protect the Syrians in face of terrorism, and to protect the unity of the Syrian territories, in addition to what the Russian institutions have done to support the Syrian people in all domains, particularly the military institution which has made a lot of sacrifices to protect the sovereignty and independence of Syria and its territorial integrity. President Putin expressed Russia’s high appreciation for the readiness expressed by the Syrian Government and its openness on whoever wants peace and for the support provided by President al-Assad to Astana process in which the participants succeeded in establishing de-escalation zones and starting dialogue with all the Syrian parties… … … Russia affirmed that the terrorists’ provocations and the shelling of the Russian chancery in Damascus will not affect Russia’s resolve to continue cooperation with partners to eliminate terror hubs in Syria, to contribute to restoration of peace and security in the country, strengthening of its sovereignty, unity and territorial integrity. “A shell fired by terrorist groups hit the outer fence of dwelling compound at the Russian embassy, causing damage to the building’s wall, electricity lines and the water supplies system,” said the Russian Foreign Ministry, adding that no one was hurt. The ministry strongly condemned the recent terrorist attack, adding that Moscow has repeatedly drawn attention of the international community to continuing shelling of the Syrian capital at the hands of terrorist groups which oppose the restoration of peace to the Syrian territory… … … (Baku) ~ Russian Foreign Minister, Sergey Lavrov, affirmed on Monday that the OPCW-UN Joint Investigative Mechanism on Syria “has worked in a shameful way” depending in its conclusions on data proposed by nongovernmental institutions, some of which linked to terrorists. In a speech on Monday before Azerbaijan Diplomatic Academy, Lavrov said that Mechanism acted in a shameful way, and instead of sending its experts to the sites of the chemical incidents, it only depended on video recordings handed over to it by nongovernmental organizations working on the ground, which have been involved with extremists and even with terrorists. He added that the U.S. and Britain are trying to impose their decisions on extending the JIM mandate in unethical ways, wondering how senior diplomats use such immoral methods. Lavrov reiterated that Moscow called for preventing the use of terrorists to achieve short-term goals, saying that fighting terrorism entails exerting joint international efforts, and that Russia and Azerbaijan are willing to make the task of combating terrorism very far from the double standards… … … The usual suspects have been put under house arrest. These criminals include Prince Al-Waleed bin Talaal, one of the richest men in the world and the most visible of all the ersatz “nobles” of Arabia along with a gaggle of other princes and entrepreneurs, not to mention a son of a former king. But, get this, the Saudis also have arrested the Prime Minister of Lebanon, Saad Al-Hareeri. But, get this and remember this: Both Ahmad Jarbaa and Riyaadh Hijaab are also in the old slammer. The last two are “leaders” of the gentrified opposition to Dr. Assad’s presidency in Syria. Hmmmmm. What could be going on here? Benny Mileikowski (a/k/a Netanyahu) has serious troubles in the brothel which is the Zionist Apartheid State. He is facing 4 separate investigations into his malfeasance as PM. As the article below correctly points out, he is in need of a diversion. With public trust eroding and accusations of betrayal appearing more frequently, he must pull something out of his yarmulka to reunite his disgruntled constituency. He needs a new war. King Muhammad bin Salmaan, unlovingly referred to as MBS, has similar problems. While not being accused of corruption himself for the simple reason that he’s the king’s son, he has accused others of the same thing… … … The Russian state-run media has accused the United States of evacuating ISIS commanders from the city of Mayadin before it was liberated by the Syrian Army in October. According to RIA Novosti (a Russian version of Sputnik), US helicopters have evacuated ISIS commanders from the citiy before the launch of the Syrian army’s operation. The outlet cited an alleged eyewitness to confirm this statement: “American military aviation first made a maneuver in the area […] near a Mayadin farm. Then [ the aviation] launched an airstrike, we tried to hide and saw several US helicopters. There were foreign Daesh [ISIS] commanders on the ground, who were waiting for them next to their headquarters… The helicopters took them outside of Mayadin.” “US aviation… first a sound from it, then a massive strike that was followed by the US helicopters’ flight and transportation of Daesh leaders after which the airstrikes ceased,” the outlet quoted the 79-year-old eyewitness. The manhad reportedly served in the Syrian Army and can distinguish US aircraft. The outlet also cited other locals that allegedly seen how cars transported two foreign ISIS commanders with their families from Mayadin to the local headquarters. Then helicopters reportedly arrived and took them in an unknown direction… … … Russian Defense Ministry said that the Russian forces on Saturday directed several strikes on the sites of Daesh (ISIS, ISIL, IS) mercenary-terrorist organization in the city of al-Bukamal in the southeastern countryside of Deir Ezzor city. Command centers and weapon depots were among the targets hit by the bombers which flew over Iran and Iraq, according to the statement. On Friday, long-range bombers Tupolev-22 and the submarine The Kolpino have dealt a massive missile and air strike against ISIS terrorists and infrastructure near al-Bukamal. THIS IS HOW THE SYRIAN ARMY FREES AREAS FROM TERRORISTS AND RETURNS THEM TO THE LOCAL POPULATION. A unit of the Syrian Arab Army freed 19 civilians who had been abducted by ISIS (ISIL, Daesh, IS) mercenary-terrorists in the eastern countryside of Hama. A Syrian Arab Army unit, in cooperation with popular defense groups, managed to free 19 civilians, including 5 children and 8 women, from ISIS (ISIL, Daesh, IS) mercenary-terrorists on the outskirts of al-Sa’an town in Hama countryside. Syrian Army units also secured the return of 26 kidnapped persons to al-Qaryatain city, who had been abducted by ISIS terrorists and used as human shields when the remnants of terrorists were fleeing from the city before the army regained control over it on October 21st. A field commander said that the army secured the safety of the citizens and provided them with food and water. The commander added that the kidnapped persons talked about the crimes committed by ISIS against anyone who opposed them in al-Qaryatain under the pretext of apostasy from the Islamic religion, and they forced the abductees to transfer bodies to the orchards surrounding the city… … … More death and destruction in Syria, as the U.S.-led coalition carries out yet another airstrike in the city of Dayr al-Zawr. According to Syrian media, the strike which happened in the government-held district of Qusur left at least 14 civilians dead and dozens more injured. The U.S.-led coalition carries out regular air raids in Syria under the pretext of targeting Daesh terrorists. However, there are many reports of large civilian casualties on the ground. The strikes lack authorization from both the Syrian government and the United Nations. What the US-led coalition did to Syria’s Raqqa is comparable to the infamous Allied bombing of Dresden in 1945, the Russian Defense Ministry Spokesman Gen. Igor Konashenkov said, adding that the allies may be rushing to pour money into Raqqa to cover up the aftermath. Raqqa, which has served as the Syrian stronghold of the terrorist group Islamic State (IS, formerly ISIS/ISIL) since January 2014, was seized by the US-backed group Syrian Democratic Forces earlier this week. Some 80 percent of residential buildings in the city are estimated to have been rendered uninhabitable during the fighting, which involved massive bombardment by the US-led coalition’s airstrikes and artillery shelling. “Raqqa’s fate calls to mind that of Dresden in 1945, leveled by the US-British bombings,” Konashenkov added, referring to the controversial campaign reaching a peak in February 1945, during which American and British bombers dropped over 3,900 tons of bombs on the Nazi-controlled German city, killing some 25,000 civilians and destroying much of its center… … … The Russian Defense Ministry “has questions” about the sudden move of the anti-Daesh coalition to help civilians in Raqqa. “[The only explanation of this] is an aspiration to quickly cover up the tracks of the barbaric bombings of the United States and the coalition’s aircraft that have buried thousands of civilians liberated from the Islamic State [Daesh] under the ruins of Raqqa,” Russian Defense Ministry spokesman said. Russian Defense Ministry spokesman Maj. Gen. Igor Konashenkov called the urgent intention of the US-led coalition members to allocate financial aid to the Syrian Raqqa suspicious amid repeated refusals to deliver humanitarian aid to the Syrians affected by the civil war. “Raqqa has not managed to cool down after bombings of the international coalition and the high-ranking officials from Washington, Paris and Berlin have started making statements about the urgent allocation of tens of millions dollars and euros to Raqqa. These millions should allegedly help to restore peaceful life in the city. We welcome such generosity, but we have questions,” Konashenkov said Sunday. According to the official, over the past two years, Russia has repeatedly asked the United States and European nations to send humanitarian aid to the Syrians affected by war, and has also prepared a list of settlements, where this assistance is needed most of all, without dividing Syrians into “bad” and “good” ones. However, the response was always negative, Konashenkov added. “[The only explanation of this] is an aspiration to quickly cover up the tracks of the barbaric bombings by the United States and the coalition’s aircraft that have buried thousands of civilians liberated from the Islamic State [Daesh] terrorist group under the ruins of Raqqa,” Konashenkov added. There is dangerous news evolving from Raqqa, Syria. While ISIS is largely defeated seeds get sown for its reappearance. The Kurdish forces under the label SDF and led by U.S. special forces have defeated ISIS in Raqqa. Cleanup operations continue. The victory came only after the the U.S. and its proxies agreed to give free passage to the last few hundreds of foreign and Syrian ISIS fighters and their families. Since these boarded buses and were moved out of Raqqa on Saturday night nothing has been heard of them. On Monday the U.S. coordinator for the fight against ISIS, Brett McGurk, brought an unwelcome visitor to Syria. The United States is losing ground, both in Syria and Iraq, and it wants to hold on to whatever it can in order to enter into negotiations later on, Jamal Wakeem, international relations professor, Lebanese University, told RT. Syrian troops on Saturday liberated the city of Al-Mayadeen in Deir ez-Zor province from ISIS, according to the Russian defense ministry. The tactic used by the US forces – whether in Syria or in Iraq – is to cause as much damage as possible to make the cities that get liberated from ISIS hard to rebuild and to reconstruct. At the same time, they want to turn the issue of the civilians and their needs as a mean to obstruct further advances of the Syrian army – especially that the US is losing ground, both in Syria and Iraq, and it wants to hold on to whatever it could in order to enter into negotiations later on… … … Evidence continues to emerge that the US military forces in Syria and Iraq are cooperating with the Daesh terrorist group According to Iranian, Syrian and Russian military officials, the US support to terrorists undermine the efforts to end the war in Syria and Iraq. Former diplomat and political analyst: “There is a high probability that the US military forces are cooperating with Daesh (ISIS/ISIL) on the ground in Syria and Iraq”. “The documents and videos available on the Internet, as well as the actions of American helicopters aimed at evacuating injured [terrorists] and the relocation of Daesh commanders, prove [this collaboration]. The US has even gone further and instructs other countries how to act in order not to harm Daesh: Otherwise, they themselves may become the target of American aircraft”… … … A commander of Iran’s Islamic Revolution Guards Corps (IRGC) says the United States has airdropped weapons and food supplies to Daesh in Iraq and Syria as the Takfiri terrorist group was facing defeat. The second-in-command of the IRGC’s Ground Force, Brigadier General Abdullah Araqi, said on Wednesday that the US had provided logistic support to Daesh in the Syrian province of Dayr al-Zawr and the Iraqi provinces of Diyala, Nineveh and Salahuddin. The secretary general of the Lebanese Hezbollah says the United States does not want Daesh Takfiri group to be destroyed and is providing Takfiri terrorists with assistance through its bases in Syria. “It is only the United States, which does not let Daesh be totally annihilated,” Nasrallah said in his speech. “US Air Force does not allow the Syrian army and resistance groups to advance toward positions occupied by Daesh,” he added… … … Kiev’s Regime Support Terrorists on Behalf of Washington: Another Brick in the Wall of the USA’s War Crimes and Its Support for the Global Terror Project… … … The Organized Crime and Corruption Reporting Project (OCCRP) together with the Balkan Investigative Reporting Network revealed a scheme of weapons supply to the terrorists of Daesh (ISIS) and al-Nusra. There is no secret that the U.S. provides the so-called moderate opposition and Kurdish militia in Syria with arms and ammunition most of which are the weapons remained after the Soviet-led Warsaw Pact disbanded. The U.S. DOD, through U.S. SOCOM, MacDill Air Force Base, Florida, as well as Picatinny Arsenal, American military research, and manufacturing facility located in Dover, New Jersey, acquired arms in some Eastern European countries including Ukraine for their further sending to Syria. The procurement volume has already exceeded $700 billion. Kiev used the logistical scheme elaborated by Washington to export arms and weapons from the Ukrainian armed forces weapons depots. The deal is estimated at $110 billion. Only between June 5 and September 15, the United States sent 1,421 trucks loaded with weaponry to the “moderate” opposition, including 596 trucks (more than 40 %) from Ukraine. Most of them ended up in ISIS’ hands… … … (South Front Maps) ~ The Syrian Arab Army (SAA) Tiger Forces have liberated the city of al-Mayadin from Daesh (ISIS, ISIL, IS) mercenary-terrorists in the province of Deir Ezzor. The liberation of al-Mayadin is a devastating blow to the Daesh defense in the Euphrates Valley. Now, the SAA has an opportunity to advance on the Omar oil fields from al-Mayadin. The Russian Defense Ministry has raised the issue of some 300 Daesh terrorists on pickup trucks infiltrating a US-controlled zone in Syria’s al-Tanf region. The Russian Defense Ministry has urged “the US side to explain its selective blindness regarding militants” operating near US forces in Syria. The ministry’s spokesman said the 300 Daesh militants had tried to block a strategically important road linking Damascus and Deir ez-Zor, which is used for delivering humanitarian aid to civilians and supplies for the Syrian Army. Aid for Militants: U.S. to Be Responsible for Sabotage of Peace Process in Syria Maj. Gen. Igor Konashenkov said that the truce in the southern de-escalation zone in Syria could be undermined after the relocation of 600 militants and two convoys with medical aid into the area. “Considering such significant reinforcements in terms of manpower, medicine and food, with tacit US approval, one does not have to be an expert to forecast an attempt to derail the truce in the southern de-escalation zone,” he said. The U.S.-led coalition against the internationally condemned terrorist group Daesh is acting in Syria like it is trying to destroy the country and prolong the armed conflict there. Thousands of Syrian women and children have been killed by coalition airstrikes in the provinces of Raqqa and Deir ez-Zor. The U.S.-coalition has so far confirmed that 735 civilians have been killed by “unintentional” airstrikes in Syria and Iraq, adding that 350 more reports of civilian casualties are currently under review. On Monday, the Syrian Defense Ministry released footage of the arms confiscated from different terrorist organizations, including Daesh (ISIS) and rebranded al-Nusra Front, along with the report, where it said that most of the weapons had been manufactured in the U.S. or by its allies. After the liberation of east Aleppo and areas in the provinces of Homs, Hama, Aleppo, and Deir ez-Zzor, the terrorists of these two organizations also left behind weapons made in Bulgaria and Eastern European countries, apparently bought and delivered by the U.S.. The Ministry pointed out that the discovery suggests that the US has been applying the very same pattern it used in Afghanistan in the 1980s, when the U.S. and Saudi Arabia sent weapons to Pakistani intelligence, which ended up with al-Qaeda and the Taliban. Among the confiscated weapons were Soviet-made guns which were likely exported to the states of the Warsaw Pact in the past and were later purchased from these states. The munitions are the transported by both sea and air from Europe to Turkey, Jordan and Kuwait. They are then distributed to U.S. allies in northern and southern Syria by planes and trucks… … … The Russian Defense Ministry has accused the US-led international coalition of “simulating” the fight against ISIS in Iraq. The coalition conducted fewer airstrikes in Iraq in September while well-armed terrorists crossed into Syria, Moscow added. For the past week, the focus of the Russian-led air campaign in Syria has been to annihilate terrorists in the city of Al-Mayadeen, one of the terrorists’ last strongholds southeast of the city of Deir ez-Zor. Despite being almost encircled by the Syrian Arab Army (SAA) in Al-Mayadeen, Islamic State (IS, formerly ISIS/ISIL) terrorists continue to replenish their ranks and supplies in the Euphrates Valley, where the US-led Syrian Democratic Forces (SDF) are conducting their own operation against terrorists in the resource-rich region of Syria, the Russian Defense Ministry said. According to last week’s estimates the Syrian military, with Russian air support, had liberated over 90 percent of Syria from IS forces. Stressing that no one really doubts the inevitable defeat of IS terrorism in Deir ez-Zor, the Defense Ministry on Tuesday has questioned the US-led coalition’s anti-terrorist effort in Iraq. “The ongoing fueling of terrorists from Iraq raises serious questions about the real objectives of anti-terrorist operations conducted in the region by the US and the so-called ‘international coalition’ jets,” the ministry’s spokesman, Major General Igor Konashenkov, noted in Tuesday’s statement… … … Gen. Ali Al Ali, chief of the main operational directorate of the Syrian Arab Army, accused the U.S. of supplying weapons to terrorists bought under the Pentagon’s program of assistance to ‘U.S. allies’. The United States is supplying weapons to terrorists in Syria, not the opposition, Gen. Ali Al Ali, chief of the main operational directorate of the Syrian army, told reporters during a demonstration of weapons seized from militants. “We know that the United States delivered 1,421 trucks with military equipment and weapons between June 5 and September 15 this year to terrorists in Syria. The weapons were allegedly intended to fight terrorists, but eventually they fell into the hands of militants of the Islamic State [Daesh] and Jabhat al-Nusra [terrorist groups banned in Russia],” Ali said. He said Syrian radicals were getting weapons bought under the Pentagon’s program of assistance to US allies. Another Syrian army serviceman Walid Khali told reporters during a demonstration of weapons seized from terrorists that militants of the Jabhat al-Nusra terrorist group, who attacked the observation post of the Russian military police in Syria on September 18, carried over 100 items of small arms and hand-held grenade launchers made in the United States, Belgium and France. Hezbollah chief says U.S. is helping Daesh [VIDEO] Sayyed Hassan Nasrallah, said U.S. jets support the terrorists by preventing resistance forces from advancing on Daesh hideouts in Syria… … … The Damascus university medical doctor heading Medical Forensics department Dr. Hussein Nofal estimates that at least 18,000 Syrians have had organs removed during the war thus far. Since the outbreak of war in 2012, 6.5 million people have been displaced within Syria and another 4.8 million have become refugees forced to flee to neighboring countries like Turkey and Lebanon or 10% have migrated to Europe. With another 386,000 estimated dead, that’s 11.7 million humans in Syria who have violently lost their lives or homes – stunningly over half the total prewar population of 22 million Syrians. All this tragic human horror only occurs because of an overly aggressive, imperialistic US-Israeli foreign policy creating a path of chaos and destruction across the Middle East and North Africa secretly supporting Islamic terrorists to fight US-Israeli proxy wars to illegally overthrow sovereign national governments like Assad’s. The ruling elite behind the Greater Israel Project deploys US Empire to manufacture unlawful wars and the subsequent largest migration crisis since WWII to willfully and methodically destabilize the world generating such dire human living conditions that expedite formation of a one world government. Ironically but also by criminal design, the two closest neighboring countries most powerful in the region that are most directly responsible for the Islamic terrorists and the MENA wars – Israel and Saudi Arabia – refuse to even take in a single refugee from the very same wars they both create and promote. Note that Israel, Saudi Arabia along with third wheel Turkey as part of the US Empire-led axis-of-evil, longtime regional ally and fellow NATO member Turkey received a $6.6 billion bribe from the bankrupted EU to “manage and control” the migration crisis, only to then turn around and unleash yet more waves of refugees pouring into Europe to this day. And it’s Turkey and Israel that both also play the most prominent role in the soaring organ trafficking epidemic as well. A 2001 BBC report disclosed that Israel per capita stands as the world’s largest recipient nation for organ transplants yet is the country with the fewest organ donors…. … … In a brand new edition of ISIS (Daesh, ISIL, IS) so-called ‘Inside the Khalifah’ series, a huge anti-aircraft gun is put on display for the camera. The video, filmed at an undisclosed yet visibly bombed out location, shows an English-speaking fighter from Singapore encouraging Islamic State supporters around the world while another militant loads huge caliber bullets onto a large truck… … … The Russian Ministry of Defence published aerial photos made during a period from September 8 to 12, which confirms the interaction of the US with ISIS terrorists. In the north of the Deir ez-Zor province, the US special forces ensure unobstructed passage of the SDF detachments under their control through ISIS units. The move is along the eastern bank of the Euphrates towards Deir ez-Zor. Just in the areas controlled by ISIS terrorists, we see many Hummer armored cars of US special forces. And it is interesting that all this is inside the strongholds of ISIS terrorists, and around there are no signs of an assault, no craters bombs, no damaged equipment. Moreover, Americans feel themselves so calm and safe there that they did not even put up any sort of military protection around them. In the meantime, the so-called Syrian Democratic Forces controlled by the US, hinder the movement of government troops along the Euphrates’ eastern bank to the Iraq border. They simply shoot at the Syrian army, using mortars and rocket launchers. The photographs that the Russian Defense Ministry published on Sunday on its Facebook page provide compelling evidence that the Syrian Democratic Forces (SDF) and the US troops that support them are present in Syria’s areas held by the violent extremist group Daesh, the ministry said Monday. Russian Defense Ministry’s spokesman Mj. Gen. Igor Konashenkov said Monday that Moscow received no response from the United States or the SDF on the issue of the photographs’ revelation by Russia. “No explanations or refutations on the issue from the representatives of the SDF or the US Armed Forces followed,” he stressed. The photos in question show US Hummer armored vehicles that are used by the US Army’s special forces in the Deir ez-Zor area. The Defense Ministry said the footage clearly showed that the units of US Army’s special forces were deployed in the footholds previously set up by Daesh militants. Speaking on Monday, Konashenkov stressed that the pictures indicated that Daesh terrorists didn’t fight against US personnel in the area, citing the absence of shell craters and the signs of airstrikes in the area… … … At 10:11 a.m. the Black Fleet submarine Veliky Novgorod operating in the Mediterranean waters fired the Kalibr cruise missiles from submerged position at the terrorists’ objects in Syria. The missiles targeted recently detected defensive posts, concentration of personnel and hardware as well as ammunition depots of Jabhat_al_Nusra in Idlib province. The firing range was about 300 kilometers. This surprise missile attack in the province of Idlib eliminated critical control points, training bases and armored vehicles that had been involved in attempt to seize 29 Russian Military Police servicemen in the north of Hama province. Libyan authorities arrested a leader and mosque preacher of the ISIS terrorist group who later confessed to be a Mossad officer. According to the Libyan authorities, preacher Abu Hafs’ real name is Benjamin Efraim, an Israeli national operating in one of Mossad’s special units which conduct espionage operations in Arab and Islamic countries. The Libyan authorities said the Mossad spy has started his career in Libya by leading a 200-member ISIS-affiliated group and moved to Benghazi in disguise as a preacher. According to them, Abu Hafs had attempted to infiltrate Egypt, adding that the group, under his command, is among the most barbaric terrorist groups which had threatened to export war to Egypt. The report came in the backdrop of a number of reports that said ISIS Leader Abu Bakr al-Baghdadi was also a Mossad agent although no credible evidence has yet been presented to substantiate the claim. When the terror outfit attacked Iraq and conquered Mosul some three years ago, numerous reports have surfaced the media disclosing that tens of Mossad agents are leading ISIS fighters… … … The Syrian army troops are preparing for a new phase of military operations against the terrorists in Deir Ezzur after breaking the siege of the city and its military airport as well as withdrawal of ISIL (Daesh, ISIS, IS) from several strategic areas. In Raqqa region the US-led coalition fighter jets bombed the city, killing and wounding several more civilians. The US-led coalition warplanes hit hard al-Badu region in Raqqa city on Wednesday, killing at least 11 civilians. The Syrian army drove ISIL out of 90sq/km of lands in the Central parts of the country after regaining control over 20 villages and hills. The Syrian army continued operations to establish security in areas near Deir Ezzur airbase and Battalion 137 base, and intensified the war on ISIL in Southeastern Deir Ezzur. The army soldiers conducted clean-up operations in areas near Deir Ezzur airbase on Thursday and established security at the military airport’s runways to get ready for anti-terrorism missions after removing the siege on Deir Ezzur city and regaining control of al-Tharda Mountains and the airbase in the last week. The Syrian army also continued its military operations against the ISIL terrorist group in a besieged region in the Central province of Homs, regaining control of five more towns after heavy clashes with the terrorists… … … NOTICE TO READERS These infos are not intended to be shocking or to glorify violence in any way. These articles/images/videos are for educational purposes only, for documenting and try to explain the backdrop of a historical ruthless and bloody war, whose characteristics and details are routinely distorted and smothered by the dominant media.
--- # # Copyright (c) 2020 NetEase Inc. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. # - name: get config dir shell: dirname {{ conf_path }} register: dirname_res - name: create config dir vars: dir_name: "{{ dirname_res.stdout }}" include_tasks: common_tasks/create_dir.yml - name: generate configuration file directly ignore_errors: true template: src={{ template_name }}.j2 dest={{ conf_path }} mode=0644 register: template_res - name: generate configuration file with sudo block: - name: generate configuration file at /tmp template: src={{ template_name }}.j2 dest=/tmp/{{ template_name }} mode=0644 - name: mv config file shell: sudo mv /tmp/{{ template_name }} {{ conf_path }} when: template_res.failed
Odin Odin (オーディン Ōdin) is a recurring summon in the series. He has appeared in every Final Fantasy game from Final Fantasy III through to Final Fantasy IX, as well as Final Fantasy Tactics. Most commonly, Odin will appear and slice though enemies with his sword, cleaving them in two and inflicting Instant Death. Other games give Odin the ability to damage enemies normally as well. His basic physical characteristics are that of a demonic-looking knight with horns, a long, curved scimitar as his weapon, and a cape. This progressed to also include a lance-type weapon called Gungnir. He always is seen on his horse, who takes on demonic-type attributes as well, such as red eyes and body armor. Sleipnir, Odin's steed in Norse mythology, has eight legs; in some games in the series, Odin's steed has six legs. In Final Fantasy III, Sleipnir can be encountered as a six-legged enemy, while Odin's steed is a normal horse.
package com.dotcms.graphql; import static com.dotcms.content.elasticsearch.constants.ESMappingConstants.BASE_TYPE; import static com.dotcms.content.elasticsearch.constants.ESMappingConstants.CONTENT_TYPE; import static com.dotcms.content.elasticsearch.constants.ESMappingConstants.IDENTIFIER; import static com.dotcms.content.elasticsearch.constants.ESMappingConstants.INODE; import static com.dotcms.content.elasticsearch.constants.ESMappingConstants.LIVE; import static com.dotcms.content.elasticsearch.constants.ESMappingConstants.MOD_DATE; import static com.dotcms.content.elasticsearch.constants.ESMappingConstants.TITLE; import static com.dotcms.content.elasticsearch.constants.ESMappingConstants.URL_MAP; import static com.dotcms.content.elasticsearch.constants.ESMappingConstants.WORKING; import static com.dotmarketing.portlets.contentlet.model.Contentlet.ARCHIVED_KEY; import static com.dotmarketing.portlets.contentlet.model.Contentlet.FOLDER_KEY; import static com.dotmarketing.portlets.contentlet.model.Contentlet.HOST_KEY; import static com.dotmarketing.portlets.contentlet.model.Contentlet.LOCKED_KEY; import static com.dotmarketing.portlets.contentlet.model.Contentlet.MOD_USER_KEY; import static com.dotmarketing.portlets.contentlet.model.Contentlet.OWNER_KEY; import static com.dotmarketing.portlets.contentlet.model.Contentlet.TITLE_IMAGE_KEY; import static graphql.Scalars.GraphQLBoolean; import static graphql.Scalars.GraphQLID; import static graphql.Scalars.GraphQLString; import com.dotcms.graphql.datafetcher.ContentMapDataFetcher; import com.dotcms.graphql.datafetcher.FolderFieldDataFetcher; import com.dotcms.graphql.datafetcher.LanguageDataFetcher; import com.dotcms.graphql.datafetcher.SiteFieldDataFetcher; import com.dotcms.graphql.datafetcher.TitleImageFieldDataFetcher; import com.dotcms.graphql.datafetcher.UserDataFetcher; import com.dotcms.graphql.util.TypeUtil.TypeFetcher; import com.dotmarketing.portlets.contentlet.model.Contentlet; import com.dotmarketing.util.UtilMethods; import graphql.schema.GraphQLArgument; import graphql.schema.GraphQLTypeReference; import graphql.schema.PropertyDataFetcher; import java.util.HashMap; import java.util.Map; import java.util.function.Function; /** * Utility class that defines and returns the available fields for the {@link InterfaceType#CONTENTLET} */ public final class ContentFields { private ContentFields() {} public static Map<String, TypeFetcher> getContentFields() { final Map<String, TypeFetcher> contentFields = new HashMap<>(); contentFields.put(MOD_DATE, new TypeFetcher(GraphQLString)); contentFields.put(TITLE, new TypeFetcher(GraphQLString)); contentFields.put(TITLE_IMAGE_KEY, new TypeFetcher(GraphQLTypeReference.typeRef("Binary"), new TitleImageFieldDataFetcher())); contentFields.put(CONTENT_TYPE, new TypeFetcher(GraphQLString)); contentFields.put(BASE_TYPE, new TypeFetcher(GraphQLString)); contentFields.put(LIVE, new TypeFetcher(GraphQLBoolean)); contentFields.put(WORKING, new TypeFetcher(GraphQLBoolean)); contentFields.put(ARCHIVED_KEY, new TypeFetcher(GraphQLBoolean)); contentFields.put(LOCKED_KEY, new TypeFetcher(GraphQLBoolean)); contentFields.put("conLanguage", new TypeFetcher(GraphQLTypeReference.typeRef("Language"), new LanguageDataFetcher())); contentFields.put(IDENTIFIER, new TypeFetcher(GraphQLID)); contentFields.put(INODE, new TypeFetcher(GraphQLID)); contentFields.put(HOST_KEY, new TypeFetcher(GraphQLTypeReference.typeRef("Site"), new SiteFieldDataFetcher())); contentFields.put(FOLDER_KEY, new TypeFetcher(GraphQLTypeReference.typeRef("Folder"), new FolderFieldDataFetcher())); contentFields.put(URL_MAP, new TypeFetcher(GraphQLString, PropertyDataFetcher .fetching((Function<Contentlet, String>) (contentlet) -> UtilMethods.isSet(contentlet.getStringProperty("urlMap")) ? contentlet.getStringProperty("urlMap") : contentlet.getStringProperty("URL_MAP_FOR_CONTENT")))); contentFields.put(OWNER_KEY, new TypeFetcher(GraphQLTypeReference.typeRef("User"), new UserDataFetcher())); contentFields.put(MOD_USER_KEY, new TypeFetcher(GraphQLTypeReference.typeRef("User"), new UserDataFetcher())); contentFields.put("map", new TypeFetcher(GraphQLString, new ContentMapDataFetcher(), GraphQLArgument.newArgument().name("key").type(GraphQLString).build())); return contentFields; } }
Archive for February, 2016 Huge swaths of the country have had rapid social change imposed on them because of the EU. Their response is logical The EU referendum is announced, and less than a year after its humiliation at the last general election, the dismal science of opinion polling is back. A YouGov survey in Wednesday’s Times, for instance, led off with news that, once the all-important don’t-knows had been excluded, 51% of its respondents wanted out, while 49% favoured staying in. Some 26% said David Cameron had got Britain “a good deal”, but 35% thought the opposite. Supermarket chain to allow collection points back into its UK supermarkets after backlash The supermarket chain Asda has announced a policy U-turn that will see the return of permanent collection points for food banks and other charities in all its UK stores. The move comes after the Guardian broke the news that the collection points were being removed across Britain. Some food banks said the move would threaten 25% of their supplies, while the Trussell Trust food bank network warned of losses of food of up to a third. Supermarket chain ceases scheme, which allowed customers to donate food bought in store or brought from home, without announcing to media Asda has removed permanent collection points for food banks from stores across the UK, in a move that has caused alarm among charities and the supermarket chain’s customers. Following reports on social media that collection trolleys and boxes had disappeared from stores across Scotland, as well as in Hampshire, Lancashire, Norwich and Newcastle, the Guardian has established that Asda, which is owned by the US retail giant Walmart, has removed donation points from all of its UK stores. Long maligned as eyesores and an offence to human values, modernist architecture is enjoying a passionate upsurge in interest. John Harris visits Manchester and Sheffield to talk to the enthusiasts campaigning for these urban landmarks On a bitingly cold Thursday morning, Jack Hale and I are standing next to a stretch of the Sheffield inner ring road, and staring, awestruck, at an electricity substation. On the face of it, those last two words might suggest some anonymous brick box. But the Moore Street substation is nothing like that. Completed in 1968 and granted Grade II-listed status in 2013, it suggests a futuristic version of a castle, complete with ramparts, and its overall dimensions are stunning. “It’s the same feeling some people get from mountains or waterfalls,” Hale says. “This is man-made, but it’s powerful. It seems … what’s the word?” His legacy is clear to see: no room for creativity and critical thinking, plenty for exams and rote learning The other week, my six-year-old daughter had one of her school friends over for tea, and the two of them decided to have a read of Julia Donaldson’s The Snail and the Whale. For anyone who doesn’t know, it’s the story of a worldwide voyage jointly undertaken by the titular animals, with lovely subtexts about friendship and co-operation, and some brilliantly executed dramatic tension. At our local state primary school, my daughter’s class do brilliant work inspired by it – building a huge humpback whale out of household rubbish, learning about the same creature’s migration paths, and so on. But that afternoon, such things receded into the distance, as my daughter’s friend looked intently at the text, tuned out of the actual story, and began to pick out the word types: “Noun … verb … noun … verb.” I was taught three to a desk, but the teaching had no end of things going for it
WASHINGTON — The Federal Reserve gave its strongest signal yet that it would undertake a new effort this fall to strengthen the hobbling economic recovery. Unless the economy improved significantly, “many members” of the Fed’s policymaking committee felt that additional stimulus would be needed “fairly soon,” according to an account of the group’s last meeting, which ended Aug. 1. Policymakers didn’t specify which actions might be taken. But the meeting minutes, which were released Wednesday after the usual three-week lag, suggested that their preferred option was large-scale bond purchases known in Fed-talk as QE3, short for a third round of quantitative easing. Some analysts said the new program, aimed at getting more dollars flowing into the economy, was likely to be announced at the conclusion of the Fed’s next two-day meeting, starting Sept. 12. “Fed minutes suggest QE3 is a done deal,” said Paul Ashworth, an economist at Capital Economics, in the title of his research note. Other economists didn’t go quite so far but agreed that the odds of further Fed action in the fall were now higher. Since the Fed’s last meeting, the economy has shown somewhat stronger data, including a pickup in job growth and retail sales. Some said that could dissuade the Fed from pursuing more easing policies right away. But the minutes revealed that it would take “substantial and sustainable strengthening in the pace of the economic recovery” for policymakers to hold off on new stimulus — and very few experts are predicting such improvement any time soon. Martin Schwerdtfeger, senior economist at TD Bank, saw another reason for the Fed to act in September rather than later: “The Fed might want to have more information before acting, which would augur for QE3 in October,” Schwerdtfeger wrote in a note to clients. “However, the proximity of the November presidential elections reduces the likelihood of such an outcome. Therefore, QE3 could come in September.” The U.S. central bank previously launched two rounds of bond buying to drive down long-term interest rates and spur investment and lending, but some Fed officials and analysts have questioned whether a third effort would be beneficial, given that rates already are at very low levels. Analysts such as Ashworth doubt that QE3 would have a meaningful and lasting economic effect. And Wall Street showed little enthusiasm Wednesday after the release of the minutes, with mixed results in the major indexes. The Dow Jones industrial average lost nearly 31 points, while the Nasdaq composite index and the Standard & Poor’s 500 index posted small gains. The Fed minutes showed that policymakers also support another, more modest tool to bolster economic growth. Many would keep its benchmark short-term interest rate near zero beyond the end of 2014, its current qualified commitment. don.lee@latimes.com
package dev.huhao.samples.ddd.blogservice.domain.concepts; public interface ValueObject { }
// Copyright (c) Microsoft. All Rights Reserved. Licensed under the Apache License, Version 2.0. See License.txt in the project root for license information. using System; using System.Collections.Generic; using System.ComponentModel.Composition; using System.Diagnostics; using System.Linq; using System.Text; using System.Threading.Tasks; using Microsoft.CodeAnalysis.Compilers; using Microsoft.CodeAnalysis.Services.CSharp.Formatting; using Microsoft.CodeAnalysis.Services.Formatting; using Microsoft.CodeAnalysis.Services.OptionService; using Microsoft.CodeAnalysis.Text; using Microsoft.CodeAnalysis.VisualStudio.Services; using Microsoft.CodeAnalysis.VisualStudio.Services.Implementation.Options; using Microsoft.VisualStudio.Shell; namespace Microsoft.CodeAnalysis.VisualStudio.CSharp.Options { [ExportOptionSerializer(AllLanguageOptionReferences.TabFeatureName)] internal sealed class CSharpSettingsSerializer : AbstractLanguageSettingsSerializer { [ImportingConstructor] public CSharpSettingsSerializer(SVsServiceProvider serviceProvider) : base(Guids.CSharpLanguageServiceId, serviceProvider) { } public override bool TryFetch(OptionInfo option, string language, out object value) { if (language != LanguageNames.CSharp) { value = null; return false; } if (option.Key.Equals(AllLanguageOptionReferences.UseTab)) { value = languageSetting.fInsertTabs != 0; return true; } if (option.Key == AllLanguageOptionReferences.TabSize) { value = (int)languageSetting.uTabSize; return true; } if (option.Key == AllLanguageOptionReferences.IndentationSize) { value = (int)languageSetting.uIndentSize; return true; } if (option.Key == AllLanguageOptionReferences.DebugMode) { value = option.DefaultValue; return true; } value = null; return false; } public override bool TryPersist(OptionInfo option, string language, object value) { if (language != LanguageNames.CSharp) { value = null; return false; } if (option.Key == AllLanguageOptionReferences.UseTab) { languageSetting.fInsertTabs = (uint)((bool)value ? 1 : 0); SetUserPreferences(); return true; } if (option.Key == AllLanguageOptionReferences.TabSize) { languageSetting.uTabSize = (uint)value; SetUserPreferences(); return true; } if (option.Key == AllLanguageOptionReferences.IndentationSize) { languageSetting.uIndentSize = (uint)value; SetUserPreferences(); return true; } if (option.Key == AllLanguageOptionReferences.DebugMode) { // Currently we don't store it. return true; } return false; } } }
Third District Court of Appeal State of Florida Opinion filed August 13, 2014. Not final until disposition of timely filed motion for rehearing. ________________ No. 3D13-716 Lower Tribunal No. 12-49371 ________________ Allscripts Healthcare Solutions, Inc., Appellant, vs. Pain Clinic of Northwest Florida, Inc., et al., Appellees. An Appeal of a non-final order from the Circuit Court for Miami-Dade County, John W. Thornton, Judge. Greenberg Traurig, P.A., and Hilarie Bass, Elliot H. Scherker, Mark A. Salky, Brigid F. Cech Samole, Timothy A. Kolaya, and Jay A. Yagoda, for appellant. Kozyak, Tropin & Throckmorton, P.A., and Adam M. Moskowitz and Thomas A. Tucker Ronzetti; Fuerst, Ittleman, David & Joseph, PL, and Allan A. Joseph, Christopher M. David and Mitchell M. Fuerst; Kula & Samson, LLP, and Elliot B. Kula, Daniel M. Samson, and W. Aaron Daniel; Arthur J. England, Jr., P.A., and Arthur J. England, Jr., for appellees. Before ROTHENBERG, LOGUE, and SCALES, JJ. LOGUE, J. Allscripts Healthcare Solutions, Inc. (“Allscripts”) appeals an order denying its motion to compel arbitration. We affirm. Allscripts marketed software to certain doctors and healthcare providers. The plaintiffs in the case below, and the appellees here, are doctors and providers who purchased licenses for the software (“the Doctors”). The purchases occurred pursuant to master agreements between the Doctors and a subsidiary of Allscripts (“the Subsidiary”). The master agreements governing the purchase of these licenses contained an arbitration provision, as follows: Any dispute or claim arising out of, or in connection with, this Agreement shall be finally settled by binding arbitration . . . . Except for [the Doctors] and [the Subsidiary], no other party may sue or be sued under this agreement. Allscripts was not a party to the master agreements. As alleged in the Complaint, when the software failed to sufficiently support the Doctors’ compliance with the requirements of certain federal regulations, Allscripts removed the software from the market and ceased technical and other support for the software. Allscripts then directly contacted the Doctors to offer a free upgrade of the software. The upgrade, however, consisted of completely different software that was less effective than the prior software and required substantial and expensive costs to retrain employees and transfer records. The Doctors filed a class action lawsuit directly against Allscripts. Allscripts moved to 2 compel arbitration, based on the arbitration provision in the master agreements. The trial court denied the motion. This appeal followed. The rub in this case is that Allscripts is not a signatory to the arbitration provisions at issue. Florida courts have long held that “no party may be forced to submit a dispute to arbitration that the party did not intend and agree to arbitrate.” Seifert v. U.S. Home Corp., 750 So. 2d 633, 636 (Fla. 1999). “Generally, therefore, a non-signatory to a contract containing an arbitration agreement cannot compel a signatory to submit to arbitration.” Rolls-Royce PLC v. Royal Caribbean Cruises LTD., 960 So. 2d 768, 770 (Fla. 3d DCA 2007). Florida courts, however, have recognized certain exceptions to this rule. Under the doctrine of equitable estoppel, for example, Florida courts have permitted a non-signatory defendant to enforce an arbitration clause against a signatory plaintiff either: (1) “when the signatory to a written agreement containing an arbitration clause must rely on the terms of the written agreement in asserting its claims against the nonsignatory,” Koechli v. BIP Int’l, Inc., 870 So. 2d 940, 944 (Fla. 1st DCA 2004) (citation omitted); or (2) when “there are allegations of concerted action by both a nonsignatory and one or more of the signatories to the contract.” Roman v. Atl. Coast Constr. & Dev., Inc., 44 So. 3d 222, 224 (Fla. 4th DCA 2010) (citation omitted). Allscripts asserts that arbitration should be compelled under the first exception. 3 The idea behind the first exception is that a signatory plaintiff should not be allowed to sue to essentially enforce its rights under a contract and, at the same time, evade an arbitration agreement in the contract, simply by naming as defendants parties who were not signatories to the contract. As one court explained: The purpose of the doctrine is to prevent a plaintiff from, in effect, trying to have his cake and eat it too; that is, from relying on the contract when it works to his advantage by establishing the claim, and repudiating it when it works to his disadvantage. . . . The plaintiff’s actual depend[e]nce on the underlying contract in making out the claim against the nonsignatory defendant is therefore always the sine qua non of an appropriate situation for applying equitable estoppel. Bailey v. ERG Enterprises, LP, 705 F.3d 1311, 1320 (11th Cir. 2013) (citation omitted); see also Giller v. Cafeteria of S. Beach Ltd., LLP, 967 So. 2d 240, 242 (Fla. 3d DCA 2007) (“One cannot both take advantage of contract provisions to seek to impose liability on an individual professional and at the same time avoid another contract term or provision for which it has no use.”); Morales v. Perez, 952 So. 2d 605, 610 n.2 (Fla. 3d DCA 2007) (noting that “Dr. Perez is attempting to avoid the arbitration provision [of the contract] while simultaneously seeking to enforce certain provisions purportedly in his favor”); BDO Seidman, LLP v. Bee, 970 So. 2d 869, 875 (Fla. 4th DCA 2007) (“A party may not rely on a contract to establish his claims while avoiding his obligation under the contract to arbitrate such claims.”). 4 A plaintiff’s dependence on the contract in this sense means more than that plaintiff would not own the product except for the contract: “A simple but-for relationship does not constitute the actual dependence on the underlying contract that equitable estoppel requires.” Bailey, 705 F.3d at 1321-22. Instead, reliance on the contract in this context requires that “a party must actually depend on the underlying contract to assert its claims.” Id. at 1321. Thus, for this exception to apply, “the claim . . . must, at a minimum, raise some issue the resolution of which requires reference to or construction of some portion of the contract itself.” Rolls- Royce, 960 So. 2d at 771. This last point depends upon a factually-intense review of the claim. Some of the distinctions made by the courts in this regard are quite fine. Compare Giller, 967 So. 2d at 242 (compelling arbitration because “indisputable nexus” existed between the plaintiff’s claims of architectural malpractice and the contract under which the defendant architect was hired to work on the project), with Rolls-Royce, 960 So. 2d at 770 (declining to compel arbitration because a cruise line company’s claim that a subcontractor’s negligent design, manufacture, and repair of propulsion pod was independent of the cruise line’s contract with a general contractor to build the cruise ship). We conclude this case is more similar to Rolls-Royce than Geller. While it is certainly true that this lawsuit would not exist but for the fact that the Doctors 5 purchased the software licenses from the Subsidiary, the causes of action in the Complaint are not attempts to enforce contractual rights under the master agreements. Instead, the allegations in the Complaint reach beyond the master agreements to encompass actions that Allscripts took outside the scope of the agreements: allegedly marketing the defective software, ceasing support of the software, and attempting to force the Doctors to accept an alternative product which was, again allegedly, less effective and more expensive to use. These are not actions that the Subsidiary participated in or controlled. They are actions by Allscripts and therefore outside the contract between the Doctors and the Subsidiary. Thus, for the arbitration agreements here to be triggered, the Doctors’ claims “must, at a minimum, raise some issue the resolution of which requires reference to or construction of some portion of the contract itself.” Rolls-Royce, 960 So. 2d at 771. Based on the class complaint as framed, we agree with the Doctors that the class claims do not require reference to or construction of the master agreements. Allscripts argues the Doctors should be compelled to arbitrate because Allscripts could only be liable here as an alter ego of the Subsidiary. To the extent that Allscripts relies on precedent that permits a party to pierce its own corporate veil to allow that party the benefit of an arbitration clause between its subsidiary and a signatory-plaintiff, those cases rely on the same equitable estoppel theories 6 discussed above. See E.I. DuPont de Nemours & Co. v. Rhone Poulenc Fiber & Resin Intermediates, S.A.S., 269 F.3d 187, 201 (3d Cir. 2001) (referencing cases in which, based on an equitable estoppel theory, “a non-signatory voluntarily pierces its own veil to arbitrate claims against a signatory that are derivative of its corporate-subsidiary’s claims against the same signatory”). Because the Doctors’ claims do not arise out of the master agreement, those cases are inapposite. We do not, however, reach the issue of the viability of any cause of action brought by the Doctors against Allscripts with respect to their alleged injuries stemming from the purchase of the software licenses, outside of their rights under the master agreements with the Subsidiary. We note only that the Doctors cannot rely on any rights under the master agreements in establishing any claims against Allscripts without invoking the arbitration provisions. Affirmed. 7
Charlie Stubbs (Coronation Street) Charlie Stubbs is a fictional character from the British ITV soap opera, Coronation Street, played by Bill Ward. He made his first appearance during the episode broadcast on 10 November 2003 and last appearance on 15 January 2007. During his time on the programme, Charlie gradually became the show's third antagonist after being transpired to have a narcissistic, manipulative and despicable streak. This became evident during most of the character's story arc, which saw Charlie spark a relationship local landlady Shelley Unwin (Sally Lindsay) - whom he ends up mistreating, up to the point where he clashes with her interfering mother Bev (Susie Blake), before she eventually jilts him at their wedding. He then went on to proceed in forming a close friendship with his colleague Jason Grimshaw (Ryan Thomas); instigate a feud with Shelly's ex-husband Peter Barlow (Chris Gascoyne) after assaulting him; embark on an affair with Jason's girlfriend Maria Sutherland (Samia Smith); attempt to drown local teenager David Platt (Jack P. Shepherd) in retribution for the latter trying to blackmail him; and repeatedly clashes with Maria's best-friend Claire Peacock (Julia Haworth) over his antagonistic nature. In his exit storyline, Charlie recoups his once-broken romance with Peter's stepsister Tracy Barlow (Kate Ford) - who, unbeknownst to him, is plotting to exact revenge on the character after discovering the extent of his affairs and deceit. This ultimately results in Tracy attacking Charlie with an ornament, which consequently results in Charlie being hospitalized and later dying of his injuries. Storylines Charlie Stubbs first arrived in Weatherfield along with one of his fellow builders. Upon arrival, they become outraged when local factory owner Mike Baldwin (Johnny Briggs) refuses to move his car so they could park their vehicle. In retaliation, they used a bulldozer to move Mike’s car and it was narrowly saved from being smashed up. Charlie later began dating Shelley Unwin (Sally Lindsay), which further escalated into a relationship. However, Charlie was unfaithful. When arsonist Maya Sharma (Sasha Behar) set fire to the Corner Shop on Coronation Street, Charlie and Ciaran McCarthy (Keith Duffy) broke in and rescued Dev (Jimmi Harkishin) and Sunita Alahan (Shobna Gulati). Charlie eventually began harassing Shelley at every opportunity. At one point, he tried to make her choose between him and her mother, Bev (Susie Blake). On one occasion he ripped out Shelley’s earrings in a fit of rage. When he asked his colleague Jason Grimshaw (Ryan Thomas) for a sealent gun, Betty Williams (Betty Driver) overheard their conversation on the phone and thought Charlie wanted a genuine firearm. She phoned the police and he was arrested. When he was released, however, he became less violent. He accidentally opened a door which hit Shelley in the face. This caused him to lock her in her bedroom to stop people seeing her face as he knew people would think he was abusing her. Charlie later began to abuse Shelley mentally rather than physically, which caused her to develop agoraphobia. However, she received treatment and Charlie proposed to her, but she jilted him on their wedding day. Despite begging for forgiveness, Shelley refused reconciliation. In 2005, Charlie began a relationship with Tracy Barlow (Kate Ford). He convinced her to move in with him and later in February 2006, manipulated her into having her daughter Amy (Amber Chadwick) move in with her parents. In turn, Tracy began to manipulate Charlie. She pretended to be pregnant and used the money he gave her for an abortion to buy expensive shoes and used her "grief" to have him allow Amy to move back in. When Shelley visited before her mother’s marriage to Fred Elliott (John Savident), she and Charlie had a one-night stand. She told Tracy about their night of passion, who accused her of lying. Shelley later revealed that she was pregnant with Charlie’s baby but didn’t allow Charlie to have anything to do with the baby, and left. He and Tracy briefly split but reconciled. Charlie later began an affair with Maria Sutherland (Samia Smith), who was renting his flat. When David Platt (Jack P. Shepherd) discovered the affair he tried to blackmail Charlie, threatening to reveal the affair to Tracy. Charlie retaliated by trying to drown David in the bath. When Tracy eventually found out about the affair, they split once more. Tracy began to plot revenge against Charlie and pretended to make amends with Charlie. She pretended he was abusing her to the point of burning herself with an iron to make it look like Charlie was responsible for her injuries. Charlie eventually realized his partner was seeking revenge and when he was about to tell her their relationship was over, she insisted on performing a lap dance for him. She hit him round the head with a heavy ornament, and he later died in hospital. She claimed she’d killed him in self-defence but the court found her guilty and she was given a life sentence. In December 2010, Tracy returned to the cobbles after being released on legal technicalities. Creation and development Actor Bill Ward was cast in the role of Charlie. Bill Ward signed a new contract with the British soap opera in early 2005 because the producers planned "to build Charlie's narcissistic and sadistic behavior towards Shelley (Sally Lindsay)" throughout the year. Upon the announcement that the character would begin a romance with Tracy Barlow (Kate Ford), a Coronation Street insider revealed that it was "a piece of genius by the writers pairing the show's biggest bitch with the vilest villain", and that "the antics they will get up to will obviously cause misery and heartache for many people." It was also revealed that "it was decided that the two characters of Charlie and Tracy were very much part of the programmes long-term future", and that it "therefore made sense to cement them together as a couple and to give them storylines guaranteed to make them two of Weatherfield's 'most hated'." Charlie’s character was expected to become "the most hated man on telly" when it was announced that he would embark on an affair and manipulate Maria Sutherland (Samia Smith). Bill Ward "shocked" Coronation Street producers by deciding to leave the serial a few months into his then-current contract, since they had "expected him to stay on after giving him another top storyline". The producers claimed that Bill was "an asset to the show", and that they "would have been developing further storylines for the character." Reception In 2005, actor Bill Ward claimed that people approached him regarding the abuse his character gave to Shelley Unwin (Sally Lindsay). He said that "every now and then, after a couple of beers, somebody will come up and say 'She deserves it, doesn't she?'", and that "they think Charlie is a hero and that it's all legitimate and acceptable behavior, which it isn't." He also revealed that he "had to be more wary" about where he went since his character started his "reign of terror", and that he’d had notes left on his car, which he found "worrying and unnerving". Despite claiming some people condoned his behavior, he also said that some people told him to "be nicer to that Shelley". Bill thought that his character was "a shocking man who behaves abysmally", but that as an actor he had to "justify everything he does". Grace Dent, an editor of The Guardian, described the character of Charlie as "a brilliant soap baddie", as a "philanderer and a mysoginist [sic]", and a "violent bully and a relentless liar." She opined that Charlie "ended almost every scene with a solitary moment spent smirking to himself about his latest huge fib", and that "by the time Charlie died, he was having so many smirks behind so many backs he spent many scenes pulling a face like he had a raspberry pip stuck in his dentures." Charlie has also been described as "a bona fide Coronation Street villain" and as "Greater Manchester's very own JR Ewing". The character has been opined to be "arguably the most graphic soap death". The episode which featured the character's murder was listed as the second-most watched for any programme on TV in 2007, having been watched by 13.1 million viewers. Bill Ward received the "Best Exit" award in British Soap Awards 2007 for his role in the character of Charlie. The same year, the storyline which saw Charlie murdered by Tracy Barlow received the "Best Storyline" award. He was also nominated for the Inside Soap "Best Bad Boy" award. See also List of Coronation Street characters (2003) List of soap opera villains References External links Charlie Stubbs at corrie.net Category:Coronation Street characters Category:Fictional construction workers Category:Television characters introduced in 2003 Category:Male characters in television Category:Fictional murdered people in soap operas
The opportunity to see him up close, in a non-confrontational arena, seemed like the perfect opportunity to form my own opinion about Corbyn, away from the din of public opprobrium. I desperately wanted to find a man whose presence and words would shatter the parody of him that emerges through the media filter. But I did not. Varoufakis’ questioning was as gentle as it is possible to be, the precise opposite of a Humphrys grilling, but it felt like watching a loving father toss balls very gently to a toddler who drops every one. Whatever the topic, Corbyn’s needle fell into the same groove about inequality. When he was asked how he was bearing up under the stress of his job, he talked about inequality. When asked why his party wasn’t ahead in the polls, he talked about inequality.
Background {#Sec1} ========== The continuous worldwide increase in obesity is a serious health problem \[[@CR1]\]. One promising approach to tackling the obesity problem is to understand the control mechanisms of adipocytes. Adipose tissue comprises white adipocyte tissue (WAT) and brown adipocyte tissue (BAT), both of which are related to energy homeostasis. When excessive energy is ingested, WAT stores energy in the form of triglycerides in unilocular white adipocytes, and it secretes many adipokines such as tumor necrosis factor-α (TNF-α), interleukin-6 (IL-6), and plasminogen activator inhibitor-1 (PAI-1), which induce insulin resistance \[[@CR1], [@CR2]\]. In contrast, multiple local BAT dissipates excess energy through thermogenesis, based on its high mitochondrial content and the expression of uncoupling protein 1 (UCP1) \[[@CR3], [@CR4]\]. Induction of thermogenesis in BAT is a promising method for the treatment of obesity \[[@CR5], [@CR6]\]. However, the amount of BAT in adults is quite small \[[@CR3], [@CR7]\]. Recently, brown-like adipocytes called beige adipocytes were found in WAT, and they expressed UCP1 to dissipate energy, similar to brown adipocytes \[[@CR8]--[@CR10]\]. The inducing phenomenon of beige adipocytes in WAT is called "browning". Induction of the browning increases energy consumption and could help to improve metabolic disorders \[[@CR5], [@CR6], [@CR9]\]. Trehalose, a non-reducing disaccharide consisting of two D-glucose residues, has been associated with various biological effects, such as inhibition of bone resorption \[[@CR11]\], suppression of inflammatory responses \[[@CR12], [@CR13]\], alleviation of Huntington's disease \[[@CR14]\], and inhibition of atherosclerotic plaque formation \[[@CR15]\]. Recently, we demonstrated that trehalose has anti-metabolic abilities such as lowering insulin secretion \[[@CR16], [@CR17]\]. When obese mice were fed a high fat diet (HFD) and administered drinking water containing 0.3% (W/V) trehalose from 8 to 15 weeks, adipocyte hypertrophy was suppressed, insulin resistance was alleviated, glucose tolerance was improved \[[@CR18], [@CR19]\], and hypertrophy of the Langerhans islands was prevented \[[@CR20]\]. Since glucose, maltose, high-fructose corn syrup, and fructose did not have such effects \[[@CR18], [@CR20]\], these effects were thought to be specific for trehalose. Based on the results of an oral glucose tolerance test administered to mice fed a HFD and given drinking water containing trehalose for a long period, we demonstrated that one of the mechanisms of adipocyte hypertrophy inhibition is lowered insulin secretion, because insulin increases the accumulation of fat \[[@CR18], [@CR19], [@CR21]\]. However, the other mechanisms by which trehalose inhibits adipocyte hypertrophy are not yet known. On the other hand, in human studies, subjects who ingested 10 g/day of trehalose for 12 weeks showed improvement in glucose tolerance under normal dietary conditions \[[@CR22]\]. Although this has not been evaluated yet, trehalose is considered to be able to suppress adipocytes even under normal conditions. For anti-obesity, it is necessary to suppress the transition from healthy to obesity as well as to improve from the obese state. Therefore, regulation of adipocytes in normal conditions, especially the increase of beige adipocytes, is important for anti-obesity. However, the effect of trehalose in normal state on adipocytes has not been clarified yet. Therefore, the purpose of this study is to examine the effects of trehalose on beige and brown adipocytes under the normal feeding conditions. Besides the measurement of adipocyte size in both mesenteric and inguinal adipose tissues, we examine the rates of UCP1 positive cells to analyze the induction of beige adipocytes. Materials and methods {#Sec2} ===================== Animals {#Sec3} ------- Ten-week-old female C57BL/6 J mice were obtained from CLEA Japan, Inc. (Tokyo, Japan) and fed a standard diet (CE-2; CLEA Japan, Inc.) and water *ad libitum*for a week. The mice were kept in a temperature-controlled room with a 12-h light cycle. This study was approved by the Laboratory Animal Care Committee of the Hayashibara Co., Ltd. (Okayama, Japan), and all animal experiments were conducted in accordance with the Guidelines for Care and Use of Laboratory Animals of the Hayashibara Co., Ltd. Test substances {#Sec4} --------------- TREHA™ (Hayashibara Co. Ltd.) was used as the source of trehalose. It contains more than 98.0% trehalose dihydrate. SUNMALT™-S (Hayashibara Co. Ltd.) was used as the source of maltose, containing at least 92% maltose monohydrate. Study design {#Sec5} ------------ The experimental protocol is shown in Fig. [1](#Fig1){ref-type="fig"}. A total of 48 mice were used in this study. After a week of acclimatization, the 11-week-old mice were randomly divided into 3 groups, which were matched for body weight. Detailed grouping is shown in Fig. [1](#Fig1){ref-type="fig"}. Two groups of mice were fed a commercial normal diet (CE-2) and then administered either 0.3% (W/V) trehalose or 0.3% (W/V) maltose in drinking water *ad libitum*, respectively (*n* = 16, for each group). As the experimental control, another group of mice received a normal diet and water alone (n = 16). Four mice were grouped per cage; each cage had to contain animals of a single group. Intake of food and water, which were replaced every other day, was monitored, and body weights were recorded weekly throughout the experiment. The skin temperature of the interscapular region was measured by an emission thermometer (\#53006, Yokogawa Test & Measurement Corporation, Tokyo, Japan) every 3 weeks, the rectal temperature was measured using a rectal thermometer (KN-91-AD1687-M, Natsume Seisakusho Co., Ltd., Tokyo, Japan), and non-fasting blood glucose levels were measured with a simple blood glucose meter (Accu-Chek® Aviva Nano meter, Roche Diabetes Care Inc., Indianapolis, IN). After 16 weeks of treatment, the mice were euthanized under pentobarbital anesthesia. Adipose tissue was weighed, and blood samples were collected from the abdominal vena cava to measure fibroblast growth factor-21 (FGF-21). The FGF-21 was measured using an enzyme-linked immunosorbent assay kit (Mouse/Rat FGF-21 Immunoassay, R&D Systems Inc., Minneapolis, MN).Fig. 1Experimental protocol. After a week of acclimation, all mice were divided into 3 groups matched by body weight and then administered 0.3% (W/V) trehalose or 0.3% (W/V) maltose in drinking water, or water alone. Interscapular and rectal temperature and non-fasting blood glucose were measured every 3 weeks (*n* = 16, group A + group B). The mice were euthanized at 16 weeks. Histological examination and analysis of adipose tissues and measurement of serum FGF-21 protein were performed using samples from 8 mice (group A). Analysis of gene expression in adipose tissues were performed another 8 mice (group B). FGF-21: fibroblast growth factor-21 Calculation of energy intake {#Sec6} ---------------------------- The energy densities of the normal diet and of the drinking water containing 0.3% (W/V) trehalose or 0.3% (W/V) maltose were 14.2 kJ, 0.05 kJ, and 0.05 kJ per gram, respectively. Based on these data, the mean energy intake per mouse in each group was calculated using the following formulas: Energy intake (kJ/mouse/day) Mice consuming a normal diet and 0.3 % (W/V) trehalose or 0.3 % (W/V) maltose Food intake (g) × 14.2 (kJ) + water intake (g) × 0.05 (kJ) Mice consuming a normal diet and water Food intake (g) × 14.2 (kJ) + water intake (g) × 0 (kJ) Histological analysis of adipocyte size {#Sec7} --------------------------------------- Mesenteric adipose tissue samples and inguinal adipose tissue samples were fixed with 10% (V/V) buffered formalin and embedded in paraffin. Sections were deparaffinized in xylene, stained with hematoxylin and eosin, and then examined using light microscopy. Photographs of the respective adipose tissue sections were taken of 5 random areas per section at 400 × magnification. More than 200 adipocyte sizes were measured by image analysis software (cellSens, Olympus Corporation, Tokyo, Japan). Rates of UCP1 positive cells in white adipose tissues {#Sec8} ----------------------------------------------------- Sections of mesenteric adipose tissue and inguinal adipose tissue were stained with anti-UCP1 antibody (diluted at 1:200, ab23841, Abcam, Cambridge, UK) and then stained with secondary antibody (anti-rabbit diluted 1:2, Dako EnVision® + system-HRP labelled polymer; Agilent Technologies, Santa Clara, CA). Photographs were taken of 5 random areas of each adipose tissue sample at 400 × magnification. The number of UCP1 positive cells among the total adipocytes (500--800 cells) was measured by cellSens, and the rates of UCP1 positive cells were calculated. RNA extraction and quantitative real-time polymerase chain reaction (PCR) {#Sec9} ------------------------------------------------------------------------- Each mesenteric and inguinal adipose tissue was homogenized in the presence of QIAzol Lysis Reagent (Qiagen, Hilden, Germany) using a TissueRuptor® (Qiagen). The respective homogenates were separated into aqueous and organic phases by the addition of chloroform. According to the respective user manuals, total RNAs from the aqueous phase were isolated using an RNeasy Mini Kit (Qiagen) and DNase (Qiagen). Subsequently, first-strand cDNA was synthesized using SuperScript™ VILO™ Master mix (ThermoFisher Scientific, Waltham, MA). Specific primers for PCR analysis were designed using Primer 3 software (<http://primer3.sourceforge.net/>) (Table [1](#Tab1){ref-type="table"}). The synthesized cDNA was mixed with SYBR™ Green Master Mix (ThermoFisher Scientific) and different sets of gene-specific primers. Real-time PCR was performed using a LightCycler® 480 system (Roche Diagnostic K.K., Tokyo, Japan). For quantitative purposes, the expression levels of the respective target genes were normalized to the housekeeping gene 18S rRNA.Table 1Summary of the sequences of gene-specific real-time PCR primersTargetGenBank accession No.Forward (5′ → 3′)Reverse (5′ → 3′)18S rRNAACTCAACACGGGAAACCTCACCCCAGACAAATCGCTCCACCAACCideaNM_007702ACAGAAATGGACACCGGGTATCCTTAACACGGCCTTGAAUcp1NM_009463GGGCCCTTGTAAACAACAAAGAAGCCACAAACCCTTTGAAPrdm16NM_027504CCAGATGTCAGCCATAGAAACCTCTTGCCACAGTACCTGCACPgc1αNM_008904ATGTGTCGCCTTCTTGCTCTAGGGAGAATTGCGGTGTGT Statistics {#Sec10} ---------- The data is expressed as means ± standard deviations. A power analysis (G\*Power 3.1.9.4, <http://www.gpower.hhu.de/>) showed that the sample size of 8 mice in each group was suitable for detecting a difference between the 3 experimental groups (1-β = 0.80, effect size = 0.7, α = 0.05). In addition, the calculated *p* values are described. Statistically significant effects of trehalose were examined using Tukey-Kramer (JMP 9.0: SAS, Cary, NC, USA) in the case of dispersion uniformity and normality. Non-parametric data were analyzed by the Steel-Dwass or Steel test or Wilcoxon test (JMP 9.0: SAS). A *p*-value less than 0.05 was considered significant. Results {#Sec11} ======= Continuous ingestion of trehalose showed no effect on energy intake, body weight, and tissue weight {#Sec12} --------------------------------------------------------------------------------------------------- The energy intakes during the experiment were 48.1 ± 1.8, 47.2 ± 1.8, and 47.7 ± 1.6 kJ per mouse per day in the water, trehalose, and maltose groups, respectively. There was no significant difference in the energy intake between the trehalose and the maltose groups. Among the three groups, there were no significant differences in food and water consumption, and the weights of whole body and each organ (*p* \< 0.05) are shown in Figs. [2](#Fig2){ref-type="fig"}a to c and Table [2](#Tab2){ref-type="table"}.Fig. 2The effect of drinking water containing trehalose on body weight, food intake, and water consumption. The body weight (**a**), food intake (**b**) and water consumption (**c**) per mouse were measured every week during the experiment. Values were shown as means ± standard deviations (*n* = 16). Statistical analysis was performed using non-parametric Steel-Dwass. There was no significant difference among the three groups in the respective parameters (*p* \< 0.05)Table 2Body, adipose tissue and organ weights in mice after 16 weeks of trehalose intakeWaterTrehaloseMaltoseBody weight (g)24.6 ± 1.1124.4 ± 1.2024.3 ± 1.22Adipose weight (g)Mesenteric adipose0.23 ± 0.050.23 ± 0.040.21 ± 0.05Perirenal adipose0.15 ± 0.060.15 ± 0.050.14 ± 0.04Retroperitoneal adipose0.34 ± 0.110.35 ± 0.120.31 ± 0.10Liver (g)1.28 ± 0.091.27 ± 0.151.24 ± 0.07Values are means ± standard deviation of 8 mice per group. There are no significant differences between the 3 groups (*p* \< 0.05). Statistical analysis was performed by non-parametric Steel-Dwass Trehalose exhibited thermogenic ability at core body sites {#Sec13} ---------------------------------------------------------- We first examined the thermogenic ability of trehalose by measuring body temperature in the scapular and the rectal regions. The surface temperature of the interscapular region showed no significant difference between the trehalose and the other two groups. The only observable difference was that the maltose group showed slightly lower temperatures at several points, as shown in Fig. [3](#Fig3){ref-type="fig"}a. When we measured the rectal temperature, trehalose appeared to exhibit thermogenic abilities, which were detected as a significantly higher temperature (*p* \< 0.05) from 12 to 15 weeks in comparison with those of the maltose and the water groups, respectively. In addition, a tendency towards higher temperature (but not significant) was also observed in the trehalose group from 6 to 9 weeks (Fig. [3](#Fig3){ref-type="fig"}b).Fig. 3The effect of drinking water containing trehalose on body temperature. Every 3 weeks, interscapular (**a**) and rectal temperature (**b**) were measured. Values were shown as means ± standard deviations (n = 16). Statistical analysis was performed using Tukey-Kramer and Steel-Dwass. Interscapular temperature (**a**): Values show statistical significance at 6 weeks of the experiment (Water vs Maltose; *p* \< 0.05). Rectal temperature (**b**): values show statistical significance at 12 weeks (Trehalose vs Maltose; *p* \< 0.05) and at 15 weeks of the experiments (Trehalose vs Water; *p* \< 0.05) Blood glucose {#Sec14} ------------- When non-fasting blood glucose was measured after a light phase of 2 to 3.5 h at 15 weeks of the experiment, the blood glucose level of the trehalose group tended to be lower than that of the water group (*p* = 0.09), as shown in Fig. [4](#Fig4){ref-type="fig"}.Fig. 4The effect of drinking water containing trehalose on blood glucose levels. Non-fasting blood glucose was measured after a light phase of 2 to 3.5 h at 15 weeks of the experiment. Values are shown as means ± standard deviations (n = 16). Statistical analysis was performed using Tukey-Kramer Trehalose suppressed adipocyte hypertrophy in mesenteric and inguinal adipose tissues {#Sec15} ------------------------------------------------------------------------------------- We examined the histology of the WAT in the mesenteric and the inguinal adipose tissues and measured the adipocyte sizes from both WAT using the image software cellSens. Histologically, the WAT in both the water and the maltose groups consisted of many large uniocular white adipocytes, whereas the WAT in the trehalose group consisted of many multilocular adipocytes with small lipid droplets (Fig. [5](#Fig5){ref-type="fig"}a). Surprisingly, even under the normal dietary conditions, the size of the mesenteric adipocytes in the trehalose group (732 ± 70 μm^2^) was significantly smaller than those of the water (1094 ± 212 μm^2^) and the maltose groups (1138 ± 218 μm^2^) (*p* \< 0.01) (Fig. [5](#Fig5){ref-type="fig"}b). Moreover, the size of the subcutaneous inguinal adipocytes was also smaller in the trehalose (738 ± 184 μm^2^) group than in the water (1412 ± 244 μm^2^) and the maltose groups (1155 ± 136 μm^2^) (*p* \< 0.01), as well as in the case of the mesenteric adipocytes (Fig. [5](#Fig5){ref-type="fig"}c). In both the mesenteric and inguinal adipose tissues, the peak of the frequencies of adipocyte size in the trehalose group was less than 400 μm^2^, whereas those of the water and maltose groups were from 1500 to 2000 μm^2^ (Fig. [5](#Fig5){ref-type="fig"}d and e).Fig. 5The effect of drinking water containing trehalose on adipocyte size in mesenteric and inguinal adipose tissue. The histology of WAT in the mesenteric and the inguinal adipose tissues and also the adipocyte size of both WATs were measured using the image software cellSens. Representative images of hematoxylin-eosin staining in sections of inguinal adipose tissue (× 400) are shown to assess histologically (**a**) and determine the size of mesenteric adipocytes (**b**) and inguinal adipocytes (**c**). In addition, cell size profiling in mesenteric adipose tissue (**d**) and inguinal adipose tissue (**e**) is summarized. Values are shown as means ± standard deviations (*n* = 8). Statistical analysis was performed with Tukey-Kramer. Values show statistical significance (5b and 5c; *p* \< 0.01, 5c; *p* \< 0.05). WAT: white adipose tissue Trehalose increased the proportion of UCP1 positive cells in mesenteric and inguinal adipose tissues {#Sec16} ---------------------------------------------------------------------------------------------------- Next, we examined the numbers of beige cells contained in these adipose tissues. UCP1 staining was used to identify the beige cells in mesenteric and inguinal adipose tissues (Fig. [6](#Fig6){ref-type="fig"}a). As shown in Fig. [6](#Fig6){ref-type="fig"}a, UCP1 positive cells were stained blue in their cytoplasm. In the trehalose group, WAT was interspersed with a large number of multilocular cells, but those cells were scarce in WAT from the water and the maltose groups. The numbers of UCP1 positive cells were counted. The rates of the UCP1 positive cells in the total adipocytes are shown in Fig. [6](#Fig6){ref-type="fig"}b and c. In the mesenteric adipose tissue, a significantly higher rate of UCP1 positive cells was found in the trehalose group (32.6 ± 4.2%) than in the water (23.0 ± 3.4%) (*p* \< 0.01) and the maltose groups (27.1 ± 3.9%) (*p* \< 0.05) (Fig. [6](#Fig6){ref-type="fig"}b). Similarly, in the inguinal adipose tissue, the rate of UCP1 positive cells was significantly higher in the trehalose group (31.8 ± 4.6%) than in the water group (25.1 ± 4.5%) (*p* \< 0.05), but that of the maltose group was not statistically different (Fig. [6](#Fig6){ref-type="fig"}c).Fig. 6The effect of drinking water containing trehalose on browning in mesenteric and inguinal adipose tissue. UCP1 positive cells were stained blue with anti-UCP1 antibody (× 400) in the respective pictures (**a**). Arrows (→) indicate UCP1 positive cells. The inset is a magnified image of UCP1 positive cells (× 1000). The proportion of UCP1 positive cells in mesenteric adipose tissue (**b**). The proportion of UCP1 positive cells in inguinal adipose tissue (**c**). Values are shown as means ± standard deviations (n = 8). Statistical analysis was performed using Tukey-Kramer. Values show statistical significance (6b; *p* \< 0.01, 6b and 6c; *p* \< 0.05). UCP1: uncoupling protein 1 Increased rates of UCP1 positive cells correlated with decreased adipocyte size {#Sec17} ------------------------------------------------------------------------------- These results suggest that trehalose induced UCP1 positive beige cells in relation to the suppression of adipocyte hypertrophy. To confirm the relationship, therefore, we examined the correlation between adipocyte size and UCP1 positive ratio (*n* = 8, each group). In both the mesenteric and the inguinal adipose tissues, there was a negative correlation between the adipocyte size and the rates of UCP1 positive cells, and their correlation coefficients were r = − 0.55 (*p* \< 0.01) and r = − 0.60 (*p* \< 0.01), respectively (Fig. [7](#Fig7){ref-type="fig"}a and b). When more UCP1 positive cells were induced in the adipose tissues, it was found that the white adipocytes became smaller in size.Fig. 7Correlation between UCP1 positive cell ratio (%) and white adipocyte size. The correlation between adipocyte size and UCP1 positive ratio (n = 8, each group) was determined in mesenteric (**a**) and inguinal (**b**) adipose tissue, respectively. Negative correlations were found between the adipocyte size and the proportion of UCP1 positive cells in both mesenteric and inguinal adipose tissue (Pearson correlation coefficients r = − 0.55, r = − 0.60, respectively). Values show statistical significance (7a and 7b; *p* \< 0.01) (n = 8). UCP1: uncoupling protein 1 Trehalose induced expression of beige adipocyte-related genes {#Sec18} ------------------------------------------------------------- Furthermore, we measured the expression of genes associated with beige adipocytes. According to the previous paper \[[@CR6], [@CR23], [@CR24]\], the four genes *Cidea* (cell death-inducing DNA fragmentation factor-α-like effector A)*, Ucp1, Prdm16* (PR domain containing 16)*,* and *Pgc1α* (PPARγ coactivator 1α) were selected as markers for beige adipocytes. *Cidea* is a gene that encodes a lipid droplet protein to regulate triglyceride deposition in adipocytes. *Prdm16* encodes a zinc finger protein and functions as a transcriptional coregulator to control the development of brown adipocytes. *Pgc1α* is a gene encoding a transcriptional coactivator and is defined as a master regulator of mitochondrial biogenesis. In the mesenteric adipose tissue, mRNA expression levels of *Cidea, Prdm16,* and *Pgc1α* in the trehalose group showed a tendency to be higher than those in the water and the maltose groups, although there were no significant differences (Fig. [8](#Fig8){ref-type="fig"}a). In the inguinal adipose tissue, the *cidea* expression level in the trehalose group was significantly higher compared to those of the water and the maltose groups (*p* \< 0.05). Among the other genes, the *Ucp1* expression level in the trehalose group was significantly higher than that in the maltose group (*p* \< 0.05), but not in the water group (Fig. [8](#Fig8){ref-type="fig"}b).Fig. 8The effect of drinking water containing trehalose on beige-adipocyte-related gene expression. Total RNAs were extracted from mesenteric adipose tissues and inguinal adipose tissues, and the respective cDNAs were prepared as described in the manual. Subsequently, real-time PCR was performed using a LightCycler®480 system. For quantitative purposes, expression levels of the respective target genes were normalized to the housekeeping gene 18S rRNA. Mesenteric adipose tissues (**a**) and inguinal adipose tissues (**b**) are shown. Values are shown as means ± standard deviations (n = 8). *Cidea* expression was significantly higher in the trehalose group compared with both the water and the maltose groups (8b; *p* \< 0.05, Steel). *Ucp1* expression was significantly higher in the trehalose group compared with the maltose group (8b; *p* \< 0.05, Tukey-Kramer). *Cidea*: cell death-inducing DNA fragmentation factor-α-like effector A; UCP1: uncoupling protein 1 Trehalose did not induce more severe fatty degeneration than maltose {#Sec19} -------------------------------------------------------------------- We examined whether trehalose administration affected BAT, a representative heat-producing tissue. Since fatty degeneration of BAT was observed in the saccharide (trehalose or maltose)-administered groups, as shown in Fig. [9](#Fig9){ref-type="fig"}a, we compared the severity among the three groups by the histopathological method of fatty degeneration scores. In the water group, the BAT of all mice showed a normal structure and their fatty degeneration scores were zero. In contrast, both the trehalose and the maltose groups exhibited higher and varying degrees of fatty degeneration scores compared with those of the water group. However, the fatty degeneration score of the trehalose group was significantly lower than that of the maltose group (*p* \< 0.05) (Fig. [9](#Fig9){ref-type="fig"}b).Fig. 9Effect of drinking water containing trehalose on BAT. Histological analysis of BAT (**a**) hematoxylin-eosin staining, × 400). Arrows (→) indicate vacuolation of BAT cells by fat deposition. Fatty degeneration scores (**b**) were graded as negative: 0, slightly: 1, mildly: 2, and severe: 3. Subsequently, the personal score was plotted (n = 8). Statistical analysis was performed using the nonparametric Wilcoxon test. Values show statistical significance (9b; *p* \< 0.01 and *p* \< 0.05). BAT: brown adipose tissue Trehalose had no effect on serum levels of FGF-21 {#Sec20} ------------------------------------------------- FGF-21 is a circulating hepatokine that is a potential drug to regulate extrahepatic energy homeostasis and induce BAT activation or WAT browning. Therefore, serum FGF-21 levels were measured to investigate the possible involvement of FGF-21 in trehalose-induced browning. As shown in Fig. [10](#Fig10){ref-type="fig"}, the serum levels of FGF-21 were not different among the three groups.Fig. 10Effect of drinking water containing trehalose on FGF-21 protein levels in serum. Serum FGF-21 protein was measured at the end of the experiment. Values were shown as means ± standard deviations (n = 8). Statistical analysis was performed using non-parametric Steel-Dwass. FGF-21: fibroblast growth factor-21 Discussion {#Sec21} ========== In the present study, we demonstrated that drinking water containing trehalose with a normal diet significantly induced WAT browning in inguinal and mesenteric adipose tissues, with significant upregulation of the beige adipocyte-related genes *Cidea* and *Ucp1*. To our knowledge, this is the first report to evaluate the in vivo effects of disaccharide on WAT browning by immunohistochemical methods. We deduced that these effects resulted in elevated body temperature in the rectal region. Moreover, we found a strong correlation between the increase in the rate of UCP1 positive cells and the decrease in adipocyte hypertrophy, indicating that WAT browning is involved in the mechanism for the regulation of adipocyte size. Regarding the UCP1 expression, there was a discrepancy between the gene and the protein expression levels in the mesenteric tissue, but this contradiction was not observed in the inguinal adipose tissue. The reasons are as follows: 1) samples from the mesenteric preparation may contain more non-adipose tissue than those from the inguinal preparation and 2) *Ucp1* gene expression is more inducible in the inguinal adipose tissue than in the mesenteric adipose tissue \[[@CR25], [@CR26]\]. It is well known that there are three possible ways to induce thermogenesis: 1) increase of BAT activity in existing classical brown adipocytes, 2) induction of formation of new adipocytes from adipogenic progenitor cells, and 3) switching of existing white adipocytes to beige adipocytes in subcutaneous fat (WAT browning). We provided evidence that trehalose exerts thermogenic activity through the WAT browning mechanism. It is unlikely that trehalose promoted BAT activity, as the histological analysis of BAT did not show such evidence in our experiments. Although the second possibility of progenitor cell differentiation is quite interesting, further investigation is required to verify the possibility. In general, thermogenic stimulation such as cold exposure exerts its effects by stimulating the sympathetic nervous system (SNS) to release norepinephrine and then increasing the thermogenesis of BAT through β3-adrenergic receptor (adrb3) activation. Several dietary components have been described as thermogenic molecules exhibiting browning ability, including capsaicin, resveratrol, curcumin, green tea, berberine, and fish oil \[[@CR27], [@CR28]\]. Capsaicin and fish oil exert thermogenic effects by indirect activation of the adrb3, which is first induced by their binding to transient receptor potential vanilloid 1 and is followed by stimulation of SNS and release of norepinephrine. Curcumin and green tea have been shown to be effective in inducing WAT browning and thermogenesis through the mechanism of mitochondrial biogenesis and adrb3 activation. Since trehalose could directly induce browning in adipocytes in cell culture (data not shown), we deduced that the action of trehalose was not mediated by the SNS. It has also been suggested that resveratrol increases thermogenesis by stimulating mitochondrial biogenesis and increasing beige adipocytes. The underlying mechanism is thought to involve the activation of AMP-activated protein kinase (AMPK) and its downstream pathway to nicotinamide adenine dinucleotide (NAD)-sirtuin1-PCG1α \[[@CR23], [@CR29]\]. Furthermore, berberine, an alkaloid compound found in various herbs, has been shown to regulate adaptive thermogenesis, and that mechanism may involve AMPK and *Pgc1*α activation. Since we have previously demonstrated that trehalose increases serum high molecular weight adiponectin and mitigates insulin resistance in HFD-fed mice \[[@CR19]\], on the other hand, the possibility to activate AMPK-*Pgc1α* downstream of adiponectin was also considered. As another mechanism, berberine has been reported to decrease inflammatory markers such as TNF-α and IL-6, and those anti-inflammatory effects are presumed to enhance WAT browning by M2 macrophage polarization \[[@CR30]\]. Since trehalose could also exert anti-inflammatory effects, we predicted these effects in WAT browning. However, histological observations in our studies did not show significant infiltration of eosinophils and M2 macrophages in WAT. Recently, Zang et al. \[[@CR31]\] demonstrated that trehalose induces thermogenesis in a hepatocyte transcription factor EB (TFEB)-dependent manner, with a concomitant upregulation of *Ucp1* expression in hepatic and white adipose tissue. They proposed a mechanism in which trehalose first induces the hepatic fasting response by inhibiting the glucose transporter hepatocyte solute carrier 2A (SLC2A), and subsequently triggers AMPK-*Pgc1*α-TFEB-FGF-21 signaling. In this mechanism, hepatocytes are an important part of the action of trehalose, and systemic thermogenesis is supposed to be partially induced by the hepatocyte-centered fasting-like response. Therefore, we measured FGF-21 protein, which plays a central role in systemic thermogenesis. However, the serum FGF-21 protein was not elevated by trehalose administration in comparison to the water or the maltose groups. We do not know the exact reason for this discrepancy with the results of Zang et al. \[[@CR31]\], but we assume that differences in the experimental conditions caused the inconsistency. In their experiments, 3% (W/V) trehalose was administered with drinking water for 5 days, while we administered 0.3% (W/V) trehalose for 16 weeks. That is, their administration was conducted with higher concentrations and for shorter periods of time compared with ours. Another possibility has been proposed by Fisher et al. \[[@CR32]\]. They demonstrated that cold exposure induces browning in WAT without increasing the circulating FGF-21 levels, suggesting that upregulation of FGF-21 gene expression itself in WAT can operate thermogenesis signaling. However, it has not yet been possible to prove the involvement of FGF-21 in the mechanism of WAT browning by trehalose administration. Otherwise, our results may suggest the presence of distinct signal pathways. On the other hand, Chevalier et al. \[[@CR33]\] demonstrated that cold exposure leads to marked changes in the gut microbiota, and this "cold microbiota" phenomenon increases WAT browning. Therefore, we think that changes in the microbiota may be one of the browning mechanisms of trehalose. We are now planning some experiments to test our hypothesis. Conclusions {#Sec22} =========== We have demonstrated that drinking water containing trehalose induced WAT browning accompanied with suppression of white adipocyte hypertrophy, elevation of body temperature and mitigation of blood glucose levels, even under normal diet conditions and at a lower concentration compared with previous studies. Therefore, we propose trehalose as a new type of thermogenic dietary component for improving human health by preventing obesity and promoting WAT browning. adrb3 : beta-3 adrenergic receptor AMPK : AMP-activated protein kinase BAT : Brown adipose tissue *Cidea* : Cell death-inducing DNA fragmentation factor-α-like effector A FGF-21 : Fibroblast growth factor-21 HFD : High fat diet IL-6 : Interleukin-6 NAD : Nicotinamide adenine dinucleotide PAI-1 : Plasminogen activator inhibitor-1 PCR : Polymerase chain reaction *Pgc1α* : PPARγ coactivator 1α *Prdm16* : PR domain containing 16 SLC2A : Solute carrier 2A SNS : Sympathetic nervous system TFEB : Transcription factor EB TNF-α : Tumor necrosis factor-α UCP1 : Uncoupling protein 1 V/V : Volume/volume W/V : Weight/volume WAT : White adipose tissue **Publisher's Note** Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. We thank Dr. Shuji Nakamura in our company for reviewing the manuscript. Design of the study was done by CA, NA, SA, CY, SE and HM. Experiments were performed by CA, NA, SA, CY, SM, AM and AS. Analysis and data mining were performed by CA, NA and SA. Technical assistance was performed by SA, CY, SM, AM and AS. Interpretation of the information obtained was done by NA, SE, TA, HM and CA. The manuscript was written by CA, NA and approved by HM, TA and US. All authors have read and approved the final manuscript. Not applicable. Not applicable. All experimental procedures were conducted in accordance with the Guidelines for Care and Use of Laboratory Animals of the Hayashibara Co., Ltd. All authors support the submission to this journal. All authors are employees of Hayashibara Co. Ltd., and all funds for the study were sponsored. The authors declare that they have no other conflicts of interest.
In order to broaden our understanding of the many different types of drug users, we are collecting and analyzing data on all identified drug users in Dade County, which are identified from Dade County Jail, 30 treatment programs of the Comprehensive Drug Program, Jackson Memorial Hospital Emergency Room, Tri-Ethnic School populations, and Tri-Ethnic communities of high drug use where our ethnographers are using field techniques to identify drug use. From this total population of drug users, analytical comparisons will be made among the Tri-Ethnic groupings, predictive profiles constructed, ecological distributions delineated, and follow-up studies will be based on the intial year's base-line data. A random sample of high drug use areas and low drug use areas will provide comparative data between drug users and non-users.
Tbx6 induces cardiomyocyte proliferation in postnatal and adult mouse hearts. Cardiovascular disease is a leading cause of death worldwide. Mammalian cardiomyocytes (CMs) proliferate during embryonic development, whereas they largely lose their regenerative capacity after birth. Defined factors expressed in cardiac progenitors or embryonic CMs may activate the cell cycle and induce CM proliferation in postnatal and adult hearts. Here, we report that the overexpression of Tbx6, enriched in the cardiac mesoderm (progenitor cells), induces CM proliferation in postnatal and adult mouse hearts. By screening 24 factors enriched in cardiac progenitors or embryonic CMs, we found that only Tbx6 could induce CM proliferation in primary cultured postnatal rat CMs. Intriguingly, it did not induce the proliferation of cardiac fibroblasts. We next generated a recombinant adeno-associated virus serotype 9 vector encoding Tbx6 (AAV9-Tbx6) for transduction into mouse CMs in vivo. The subcutaneous injection of AAV9-Tbx6 into neonatal mice induced CM proliferation in postnatal and adult mouse hearts. Mechanistically, Tbx6 overexpression upregulated multiple cell cycle activators including Aurkb, Mki67, Ccna1, and Ccnb2 and suppressed the tumor suppressor Rb1. Thus, Tbx6 promotes CM proliferation in postnatal and adult mouse hearts by modifying the expression of cell cycle regulators.
Set in 1977 in a provincial French town, "Potiche" is a free adaptation of the 1970s eponymous hit comic play. Suzanne Pujol is a submissive, housebound 'trophy housewife' who steps in to manage the umbrella factory run by her wealthy and tyrannical husband after the workers go on strike and take him hostage. To everyone's surprise, Suzanne proves herself a competent and assertive woman of action. But, when her husband returns from a restful cruise in top form, things get complicated. Rated R for some sexuality.
[Clinical application of spirapril in patients with arterial hypertension combined with chronic obstructive pulmonary disease]. In this study quadropril (Spirapril, Pliva) was given for 2 months to patients with arterial hypertension combined with chronic obstructive pulmonary disease. The results show that quadropril (6 mg/day) is highly effective as monotherapy in patients with mild and moderate hypertensive disease. Its effects appear as significant lowering of mean 24 hour systolic and diastolic blood pressure (BP), lowering of diurnal and nocturnal BP. Therapy with quadropril for 8 weeks did not impair parameters of external respiration, produced no negative action on lipid and carbohydrate metabolism, was well tolerated, and caused no considerable side effects.
Story highlights Police say a 'highly explosive mix' of substances was in the apartment The suspect being sought is identified as Syrian man Jaber Albakr (CNN) Police in Germany are hunting a 22-year-old Syrian man in connection with a suspected planned bomb attack, Saxony Police told CNN on Saturday. He was named by police as Jaber Albakr. He was born Jan. 10, 1994 and is from the Damascus countryside, police said. The details emerged during a large-scale police operation in the city of Chemnitz. Two people were arrested at the city's train station, police said, and their luggage was being searched. The station was temporarily cordoned off, police said. Another person was arrested in the city center. Police said they believe the person was in contact with the suspect. Currently running a large-scale operation in #Chemnitz because of the suspicion of a planned bomb attack. — Polizei Sachsen (@PolizeiSachsen) October 8, 2016 Officers found traces of explosives in their search of an apartment in the city's Fritz-Heckert district, Saxony Police spokesman Tom Bernhardt told CNN. Read More
Q: CHDK: Timelapse/intervalometer with gradually adjusting exposure or overexposure detection I'm trying to tweak a CHDK script for my Canon PowerShot G12 to take pictures at a regular interval. The goal is to make smooth time lapse videos. I've previously burned the sensor of a G11 because of an unexpected lighting change, and would like to prevent this from happening again. So now I'm looking for a way to either: Adjust the exposure slowly over the span of several pictures, or Detect a certain level of overexposure and abort the script Here is what I have so far: @title Timelapse photo fixed @param m Interval (min) @default m 0 @param s Interval (sec) @default s 5 @param h Number of takes (x100) @default h 10 @param x Initial delay (sec) @default x 10 set_raw 0 t=100*h if t<100 then t=100 i=60000*m+1000*s if i<100 then i=100 if x<5 then x=5 sleep 1000*x-2000 print "Pressing shutter halfway..." press "shoot_half" sleep 2000 for j=1 to t cls print "Taking photo",j,"of",t click "shoot_full" press "shoot_half" print " Waiting",m;":";s,"..." print " " sleep i next j release "shoot_half" end (The shoot_half bits are there to prevent the exposure/focus from changing during a shoot; if there is a better way to do that I'd also love to about it.) Where should I go from here? A: These problems were encountered when trying to compensate from the bright sunlight to the dark of night for sunset and sunrise events. There've been a couple of "sunset" scripts created long ago to circumvent these problems, as well as trying to adjust for exposures when the light levels are far too low and the camera's own exposure meter can no longer function. Done by polling the data directly from the RAW sensor data when needed. Look into these scripts on these two links: http://chdk.setepontos.com/index.php?topic=2156.0 http://chdk.setepontos.com/index.php?topic=3079.0
Arriving at the EU summit this week, Theresa May had that purposeful air of a school superintendent walking up the drive to the Addams family mansion, determined that Wednesday and Pugsley should be enrolled in a conventional educational establishment without delay. Some long hours later, May staggered back down the drive much as that school superintendent might, short of having no shoes and an actual bat in her electrocuted hair. And so to the latest scenes in the Brexit farce. The formula for successful farce-writing, as laid down in the 19th century, is to get your character up a tree in the first act, throw stones at them in the second, then get them down in the third. As far as Brexit goes, the UK went up the tree voluntarily, and has now been throwing human waste at itself for two and a half years. Does anyone want to come and get us down? Sorry, it’s quite … disgusting up here now. We have been given a fortnight’s grace to get our shit together – which was almost the formal wording on the communique My sole point of light this week was being told that David Cameron had finished his memoir – and that the publishers want him to cut 100,000 words from it. No idea what that takes this coolly anticipated opus down to, but given that Geri Halliwell had published two autobiographies by the age of 30, something more truncated would feel commensurate with the former prime minister’s contribution. Back to Brussels, though, and a reminder that one of the remarkable things about the UK’s take on these negotiations has been the oft-stated belief that the EU will save us at the 11th hour. That’s never quite how the likes of weekend warrior David Davis used to put it, naturally – but we were forever being told that Brussels would cave, that we just needed to hold our nerve, that this is how they work. Two quick points on that: 1. Why have so many Brexiteers been the sort of crap movie villains who boast about their secret plan out loud, in full, in advance of actually executing it? 2. Well done, you congenitally incompetent, dick-waving amateurs. It’s impossible to read about looming bog-roll shortages and not think, “Wow. We really do hold all the cards.” Seven days from Britain crashing out without a deal, the EU used the summit to take back control. We have been given a fortnight’s extra grace to get our shit together – which was almost the formal wording on the communique. The anonymous briefing from the EU side was marginally less forgiving than napalm warfare. “It was 90 minutes of nothing,” one EU source said of May’s performance. “She didn’t even give clarity if she was organising a vote. Asked three times what she would do if she lost the vote, she couldn’t say. It was fucking awful. Dreadful. Evasive even by her standards.” But enough of the more positive comments. The negative ones are summarised by the briefing’s observation on May: “Instead of three days until 29 March to deal with her resignation, we have 15 days to prepare.” Oof. This is the equivalent of lying on your deathbed and hearing your relatives discuss how many finger sandwiches are honestly going to be needed for the wake. Let’s not over-cater, you know? Play Video 1:24 Comic relief: three times actual laughs were had at Brexit summit – video Sequels-wise, we’re in uncharted territory as far as Meaningful Vote 3 goes. Even the Weekend at Bernie’s franchise didn’t exhume the corpse for a third time. The soon to be outgoing prime minister has belatedly realised that she needs the MPs she insulted on Wednesday, and consequently acknowledged on Thursday that “MPs are frustrated too”. One of those moments where “I’m a strategically defunct tin-eared lunatic” seems to be the hardest word. The withdrawal agreement’s first hurdle is that Speaker John Bercow has said it can’t be brought before the house in its previous form. “You respect the referee and abide by his decisions,” judged Brexit secretary Stephen Barclay, with all the moral heft John Terry might bring to such a statement. Inevitably, then, MPs will find some sort of procedural way to do it, probably paving the way for the deal to die horribly again, before proceeding to indicative votes for various options. There are no good options, but some are rather less catastrophic than others. According to Tory MP Nick Boles, who’s pushing one or other of said options: “I guess we will discover next week whether the Conservative party still wants to be the party of business.” Incredible use of “still”, there. I don’t want to be a bitch, but I feel like the Conservative party probably lost that Kitemark in the week no-deal planners were forced to reopen an effing nuclear bunker under the Ministry of Defence. Thanks for your pitch, Tories – but for that reason, the Dragons are out. Also, you might want to press pause on those “natural party of government” mouse mats you had ordered for sale at party conference. I think the printers will be OK with it – they’re subletting the warehouse space to stockpile insulin and stuff. Brexit: DUP accuses May of being 'far too willing to capitulate' to EU – live news Read more According to ERG vice-chair Steve Baker, meanwhile, “The wrong Conservatives have the levers of power.” The wrong Conservatives … mmmmm. Go on, Steve. “National humiliation is imminent through these ‘indicative votes’.” Imminent?! Never mind Boles’s “still” – take a look at Steve Baker’s “imminent”. Have you ever seen anything as preposterously, forlornly belated as that “imminent”? I’m afraid it would understate matters to compare this to Rose shivering on the door at the end of Titanic, and observing mildly that an iceberg might be “imminent”. No, on balance, this makes Steve the most disastrous baker since the one who set fire to London in 1666, who I suppose we now have to picture wandering through the smouldering remains of the capital and judging that the time to switch his oven off is “imminent”. Whichever way it pans out, next week’s political weather forecast promises some sort of conflagration. Do, please, adjust your “national humiliation” preparations accordingly. • Marina Hyde is a Guardian columnist
1. Field of the Invention The present invention relates to a short force arm deflection device, and in particular to a deflection device that is mountable to a section of center post of an umbrella between a top cap and a runner to provide a short force arm that allows deflection and canopy opening operated in an effortless manner and belongs to a technical field of improved deflection device of umbrella. 2. The Related Arts For commonly used large-sized umbrellas, such as beach parasols, garden parasols, and advertisement umbrella, to make opening the umbrellas easy, a winding device that is mounted to an umbrella center post is employed, in which the winding device comprises a crank arm, which when rotated, drives a pull cord concealed in the interior of the center post to pull a runner to move along the center post. The umbrella is opened when the runner is moved upward and the umbrella is closed when the runner moves downward. Some umbrellas are provided with a deflection device, whereby if the pull cord is controlled to continuously pull the runner to move upward after the umbrella has been completely opened, the deflection device that is mounted to the center post is actuated to incline the umbrella by an angle. The conventional deflection device, once mounted to an umbrella, exhibits such a significant feature that when the runner is pulled upward to open the umbrella, the deflection device is located on the center post at a position below the runner. If the runner is further pulled to move upward, the deflection device will incline the umbrella canopy by an angle, where the deflection device that is located below the runner get further from the runner. Heretofore, the deflection device is mounted to an umbrella center post at a position below the runner and consequently, for the center post, a long force arm is formed above a deflection portion of the deflection device for supporting the total weight of the whole umbrella top, including a top cap, ribs, stretchers, and the runner. The deflection device will bear a greater gravitational force when the deflection device makes a deflection angle that is larger and thus the inclination of the umbrella canopy is greater. Such a great force is only supported by a pivot pin of the deflection device and this may easily cause damage to the components thereof. Malfunctioning of the deflection device makes the operation of smooth umbrella opening and deflection impossible. The long force arm makes opening umbrella laborious. However, make the deflection device of a material of good strength may, sometimes, causes an excessively increased expenditure. All these problems are commonly seen in the umbrellas to which the conventional deflection devices are mounted.
Q: Reconstructing a 2D shape from its projection in 1D I have a convex closed shape in 2 D space (on the x-y plane). I do not know what it looks like. I rotate this shape about approximately the center of its bounding box 64 times by 5.625 degrees (360/64). For each rotation I have the x-coordinates of the extreme points of the shape. In other words I know the left and right x extents of the shape for each rotation (assuming an orthographic projection). How do I obtain 64 points on the shape that do not contradict the x projections. Note that the 2D shape is rotating, but the coordinate axes are not rotating along with it. So if your object is a line, the x projection of each end if plotted will essentially be a sin/cos wave depending on its original orientation. The higher the number of rotations, if I have the solution - the closer I will get to my actual shape. In reality I do not know the exact point I am rotating the shape about, however any solution assuming I do know will still be helpful, as I don't mind the reconstruction being imperfect. A: We used the straight-forward method to reconstruct. Projection is a shade of the object. You start with a bounding 2D box. For each projection you cut away from the 2D shape left and right parts that fall outside of the projection. So, the main function calculates intersection of two convex 2D shapes. You calculate these intersections for each projection. We have several purple projections P1, P2, P3, P4 of the original green object: Knowing position of a purple projection build two red rays coming from the end points of a projection and intersect them with the reconstructed object: The red object was reconstructed using 4 projections. When compared to original green you can see that they are not the same. The more projections you have the less error you'll get in the final result.
Disorder in Milk Proteins: α-Lactalbumin. Part C. Peculiarities of Metal Binding. This is a concluding part of the three-part article from a series of reviews on the abundance and roles of intrinsic disorder in milk proteins. In this paper, we describe the peculiarities of metal binding to a multifunctional milk protein, α-lactalbumin, which has two domains, a large α-helical domain and a small β-sheet domain connected by a calcium binding loop. It is known that in addition to four disulfide bonds, the native fold of this protein is stabilized by binding of a calcium ion. In fact, although in various mammals, α-lactalbumins are rather poorly conserved possessing the overall sequence identity of ~16%, the positions of all eight cysteines and a calcium binding site (residues DKFLDDDITDDI in human protein) are strongly conserved. Curiously, this conserved calcium binding loop is located within a region with increased structural flexibility. Besides canonical calcium binding, α-lactalbumin is known to interact with other metals, such as zinc (for which it has a specific binding site), and, in its apo-form, it can bind other divalent and monovalent cations. The binding of Mg2+, Na+, and K+ to the Ca2+ site increases α-lactalbumin stability against action of heat and various denaturing agents, with the higher stabilization effects being imposed by the stronger bound metal ions.
The human 26 S and 20 S proteasomes generate overlapping but different sets of peptide fragments from a model protein substrate. Intracellular protein degradation is a major source of short antigenic peptides that can be presented on the cell surface in the context of major histocompatibility class I molecules for recognition by cytotoxic T lymphocytes. The capacity of the most important cytosolic protease, the 20 S proteasome, to generate peptide fragments with an average length of 7-8 amino acid residues has been thoroughly investigated. It has been shown that the cleavage products are not randomly generated, but originate from the commitment of the catalytically active subunits to complex recognition motifs in the primary amino acid sequence. The role of the even larger 26 S proteasome is less well defined, however. It has been demonstrated that the 26 S proteasome can bind and degrade ubiquitin-tagged proteins and minigene translation products in vivo and in vitro, but the nature of the degradation products remains elusive. In this study, we present the first analysis of cleavage products from in vitro digestion of the unmodified model substrate beta-casein with both the 26 S and 20 S proteasome. The data we obtained show that 26 S and 20 S proteasomes generate overlapping, but at the same time substantially different, sets of fragments by following very similar instructions.
<project xmlns="http://maven.apache.org/POM/4.0.0" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xsi:schemaLocation="http://maven.apache.org/POM/4.0.0 http://maven.apache.org/xsd/maven-4.0.0.xsd"> <modelVersion>4.0.0</modelVersion> <parent> <groupId>com.freedomotic</groupId> <artifactId>freedomotic-plugins</artifactId> <version>5.6-SNAPSHOT</version> <relativePath>../../</relativePath> </parent> <artifactId>marytts</artifactId> <packaging>jar</packaging> <name>marytts</name> <version>3.0</version> <developers> <developer> <id>mauro</id> <name>Mauro</name> <email>mauro@www.freedomotic-iot.com</email> <organization>Freedomotic</organization> <organizationUrl>http://www.www.freedomotic-iot.com</organizationUrl> <properties> <nation>it</nation> </properties> <timezone>-1</timezone> </developer> </developers> <properties> <project.build.sourceEncoding>UTF-8</project.build.sourceEncoding> <freedomotic.basedir>${project.parent.basedir}</freedomotic.basedir> <freedomotic.package.type>device</freedomotic.package.type> <freedomotic.nodeid>36485</freedomotic.nodeid> <freedomotic.package.license>GNU GPL2</freedomotic.package.license> <freedomotic.package.vendor.name>Mauro</freedomotic.package.vendor.name> <freedomotic.package.vendor.surname>Cicolella</freedomotic.package.vendor.surname> <freedomotic.package.vendor.contact>Cicolella</freedomotic.package.vendor.contact> <freedomotic.package.vendor.company>Freedomotic</freedomotic.package.vendor.company> <freedomotic.package.vendor.nation>it</freedomotic.package.vendor.nation> <freedomotic.framework.required.major>5</freedomotic.framework.required.major> <freedomotic.framework.required.minor>6</freedomotic.framework.required.minor> <freedomotic.framework.required.build>x</freedomotic.framework.required.build> <!--don't like this but works for the moment --> <freedomotic.synch.dist.path>../../../framework/freedomotic-core/plugins/</freedomotic.synch.dist.path> <freedomotic.marketplace.file>${project.artifactId}-${freedomotic.framework.required.major}.${freedomotic.framework.required.minor}.${freedomotic.framework.required.build}-${project.version}.${freedomotic.package.type}</freedomotic.marketplace.file> <freedomotic.marketplace.username></freedomotic.marketplace.username> <freedomotic.marketplace.password></freedomotic.marketplace.password> </properties> <dependencies> <dependency> <groupId>junit</groupId> <artifactId>junit</artifactId> <scope>test</scope> </dependency> <dependency> <groupId>${project.groupId}</groupId> <artifactId>freedomotic-core</artifactId> <version>${project.parent.version}</version> <scope>provided</scope> </dependency> <dependency> <groupId>de.dfki.mary</groupId> <artifactId>marytts-runtime</artifactId> <version>5.1.1</version> </dependency> <dependency> <groupId>de.dfki.mary</groupId> <artifactId>marytts-lang-de</artifactId> <version>5.1.1</version> </dependency> <dependency> <groupId>de.dfki.mary</groupId> <artifactId>marytts-lang-en</artifactId> <version>5.1.1</version> </dependency> <dependency> <groupId>de.dfki.mary</groupId> <artifactId>marytts-lang-fr</artifactId> <version>5.1.1</version> </dependency> <dependency> <groupId>de.dfki.mary</groupId> <artifactId>marytts-lang-it</artifactId> <version>5.1.1</version> </dependency> <dependency> <groupId>de.dfki.mary</groupId> <artifactId>marytts-lang-ru</artifactId> <version>5.1.1</version> </dependency> <dependency> <groupId>de.dfki.mary</groupId> <artifactId>marytts-lang-sv</artifactId> <version>5.1.1</version> </dependency> <dependency> <groupId>de.dfki.mary</groupId> <artifactId>marytts-lang-te</artifactId> <version>5.1.1</version> </dependency> <dependency> <groupId>de.dfki.mary</groupId> <artifactId>marytts-lang-tr</artifactId> <version>5.1.1</version> </dependency> <dependency> <groupId>de.dfki.mary</groupId> <artifactId>voice-cmu-slt-hsmm</artifactId> <version>5.1.1</version> </dependency> <dependency> <groupId>de.dfki.lt.jtok</groupId> <artifactId>jtok-core</artifactId> <version>1.9.1</version> </dependency> </dependencies> <repositories> <repository> <id>bintray</id> <url>http://dl.bintray.com/marytts/marytts</url> </repository> <repository> <id>spring-milestones</id> <url>http://repo.springsource.org/libs-milestone/</url> </repository> </repositories> <build> <plugins> <plugin> <artifactId>maven-resources-plugin</artifactId> </plugin> <plugin> <groupId>org.apache.maven.plugins</groupId> <artifactId>maven-dependency-plugin</artifactId> </plugin> <plugin> <groupId>com.mycila.maven-license-plugin</groupId> <artifactId>maven-license-plugin</artifactId> </plugin> <plugin> <artifactId>maven-antrun-plugin</artifactId> </plugin> </plugins> </build> </project>
Sure, you’re trapped in your house, but there’s an entire galaxy of cool stuff right over your head in the night sky. Space is infinitely expanding (and contracting, but we’ll focus on the expanding), which might relieve the claustrophobia and boredom that come along with quarantine. Here are eight pictures showing the mystery and wonder of the universe. Star Cluster Just how it sounds, a star cluster is a bound group of stars. Young clusters contain fewer stars with more distance between them. As a cluster gets older, the stars move closer together, united by gravity. You can see some star clusters in the night sky with the naked eye. One is the constellation Seven Sisters, another’s inside the constellation Cancer. The closest star cluster, Hyades, is just 153 light-years from earth and you can see it inside the constellation Taurus. Nebula The word nebula is Latin for cloud, which is also a perfect description. Images of nebulae from space are beautiful and other-wordly. They occur when dust, hydrogen, or ionized gases come together to form a cloud in space. There’s one visible to the naked-eye, the Orion Nebula. It’s positioned inside the Orion constellation, just below the belt of three stars. Mars Doesn’t this look like it could be a picture of deserts on Earth? This one is from the Mars Reconnaissance Orbiter, taken back in 2015. It shows the dunes in a desert on the surface of the planet. (x) Andromeda Galaxy Our nearest neighboring galaxy, just 2.5 million light years away. Early astronomers first observed it in the 10th century, calling it a nebulous smear. Continued study through the centuries led to the first observation of a supernova in the 19th century. Not until 1925 was it identified as a separate galaxy by Edwin Hubbard, using his Hooker telescope. Aurora Borealis When solar wind hits the upper atmosphere of earth, it changes the paths of particles, creating beautiful light shows visible both from the surface of the planet and outer space. Sirenum Fossae, Mars There are several long troughs on the surface of Mars, called fossae. Gullies appear throughout the Sirenum Fossae, formed by frozen carbon dioxide running like water down the faces of dunes and craters. Total Solar Eclipse In 2017, the northern hemisphere of Earth observed a total solar eclipse, which happens when the orbit of the moon brings the Earth into perfect alignment with the Sun and Moon. There’s between 2 and 5 eclipses every year, with an average of 240 per century. The next time there will be 5 eclipses in a single year will be in 2206. Triangulum Galaxy The most distant permanent celestial body that’s visible to the naked eye, it’s smaller than both the Milky Way and Andromeda. It’s moving toward the Andromeda galaxy, leading astronomers to believe it’s a satellite of the larger galaxy.
Q: What's wrong with this TestMethod? So I want to learn a little bit of TDD and wanted to see if I could test an Index action which should simply return a View. The test doesn't pass and the error is Test method Summumnet.Tests.Controllers.PhysicalTestsControllerTest.IndexShouldReturnView threw exception: System.ArgumentException: Expression is not a property access: c => c.FindById(1) Here's my controller action code: [Authorize] [AllowedToEditEHR] public class PhysicalTestsController : Controller { private IUnitOfWork unitOfWork; private IRepository<EHR> ehrRepository; private const int PAGESIZE = 5; public PhysicalTestsController(IUnitOfWork unit) { unitOfWork = unit; ehrRepository = unitOfWork.EHRs; } public ActionResult Index(int ehrId, int? page) { EHR ehr = ehrRepository.FindById(ehrId); var physicaltests = ehr.PhysicalTests.Where(test => !test.IsDeleted).OrderByDescending(test => test.CreationDate); List<PhysicalTestListItem> physicalTestsVM = new List<PhysicalTestListItem>(); Mapper.Map(physicaltests, physicalTestsVM); var paginatedTests = physicalTestsVM.ToPagedList(page ?? 0, PAGESIZE); return View(paginatedTests); } and here's the test [TestClass] public class PhysicalTestsControllerTest { [TestMethod] public void IndexShouldReturnView() { // Arrange var mock = new Mock<ControllerContext>(); mock.SetupGet(p => p.HttpContext.User.Identity.Name).Returns("nacho"); mock.SetupGet(p => p.HttpContext.Request.IsAuthenticated).Returns(true); var mockUnitofWork = new Mock<IUnitOfWork>(); var mockEhrRepository = new Mock<IRepository<EHR>>(); mockEhrRepository.SetupGet(c => c.FindById(1)).Returns(new EHR { PhysicalTests = new List<PhysicalTest>()}); mockUnitofWork.SetupGet(p=>p.EHRs).Returns(mockEhrRepository.Object); PhysicalTestsController controller = new PhysicalTestsController(mockUnitofWork.Object); controller.ControllerContext = mock.Object; // Act ViewResult result = controller.Index(1, 0) as ViewResult; // Assert Assert.IsNotNull(result); } A: A few pointers: You don't need to mock HttpContext for this test. Sure, you have an Authorize attribute on your controller, but action filters aren't run when you're unit testing your controllers. So you can just assume that the user will be authenticated and authorized. SetupGet is, I believe, pretty obsolete. You should consider using Setup instead: mockUnitofWork.Setup(p => p.EHRs).Returns(mockEhrRepository.Object); THis is in fact what is causing your error, since SetupGet can only be used on properties, while Setup can be used on more or less anything. Since FindById isn't a property (it's a method), you get that error. When setting up a function call, you usually get better results if you don't give exact input arguments, but rather specify conditions that the input arguments must satisfy. This avoids unexpected and often hard-to-track testing bugs when you pass in two identical - but separate - instances of a class, and expect them to be the same. In Moq, you can use the static methods on It to do this. If you want to allow for any int, just say It.IsAny<int>() in place of the integer argument. If you want to be specific, you can use a lambda expression to declare when the behavior should apply, using It.Is<int>(i => someCondition(i)). So instead of .Setup(c => c.FindById(1)) you say mockEhrRepository.Setup(r => r.FindById(It.Is<int>(i => i == 1)).Returns(...) For value types this doesn't make any difference, but I think it's a good habit. I usually choose to not care which integer is given, which simplifies the setup expression a little: mockEhrRepository.Setup(r => r.FindById(It.IsAny<int>()).Returns(...) But to be clear: The only thing in this post you need to do to get rid of your error, is to change SetupGet to Setup.
Quadrilateral ABCD has coordinates A( 3, -5) B (5, -2) C (10, -4) , D (8, -7) Quadrilateral ABCD is a rectangle, because opposite sides are congruent and adjacent sides are perpendicular Square, because all four sides are congruent and adjacent sides are perpendicular parallelogram, because opposite sides are congruent and adjacent sides are not perpendicular rhombus, because all four sides are congruent and adjacent sides are not perpendicular OpenStudy is now Brainly! Quadrilateral ABCD has coordinates A( 3, -5) B (5, -2) C (10, -4) , D (8, -7) Quadrilateral ABCD is a rectangle, because opposite sides are congruent and adjacent sides are perpendicular Square, because all four sides are congruent and adjacent sides are perpendicular parallelogram, because opposite sides are congruent and adjacent sides are not perpendicular rhombus, because all four sides are congruent and adjacent sides are not perpendicular Mathematics Stacey Warren - Expert brainly.com Hey! We 've verified this expert answer for you, click below to unlock the details :)
1. Introduction {#sec1} =============== The myelodysplastic syndromes (MDS) compose a heterogeneous group of clonal stem cell disorders, characterized by ineffective hematopoiesis in one or more cell lineages, and a propensity to progress to acute myeloid leukemia (AML). The risk of transformation to leukemia is determined in part by the degree of morphologic atypia, blast percentage in the bone marrow, and cytogenetics of the MDS clone \[[@B1], [@B2]\]. MDS patients are often asymptomatic, and the diagnosis is made at the time of routine laboratory screening tests that reveal cytopenias in one or more lines or dysplasia on the blood smear. Typical disease manifestations include fatigue and weakness from anemia, infections from neutropenia, or bleeding due to thrombocytopenia or platelet dysfunction. Autoimmunity in association with MDS is well described. Specifically, vasculitides, arthritis, connective tissue diseases, pulmonary infiltrates, polymyalgia rheumatica, and ulcerative colitis have preceded or accompanied the diagnosis of MDS in several case reports and series \[[@B3]--[@B6]\]. However, there are no cases, to our knowledge, of MDS presenting as acute fibrinous and organizing pneumonia (AFOP) and lacrimal gland pseudotumor. Here, we present a case of MDS manifesting as AFOP, lacrimal gland pseudotumor, polyarthritis, and fever of unknown origin. 2. Case Report {#sec2} ============== A 53-year-old postmenopausal woman, with a history of hypertension and fibromyalgia, presented with 1 month of intermittent chest pain, mild nonproductive cough, dyspnea on exertion, and a 22 lb weight loss over 4 months. Complete blood count revealed a macrocytic anemia with a mean corpuscular volume (MCV) as high as 108, with normal cobalamin and red blood cell folate. Coombs testing was negative, and her levels of lactate dehydrogenase (LDH), haptoglobin, and unconjugated bilirubin were normal. The peripheral blood smear showed dysplastic changes in all hematopoietic lineages including hypogranulation and hypersegmentation of the neutrophils and rare teardrop-shaped red cells, prompting a bone marrow evaluation. Bone marrow aspirate yielded a diagnosis of MDS, refractory anemia with excess blasts (RAEB-1; 8% blasts) with karyotype 46,XX,+1,der(1;7)(q10;p10)\[20\], resulting in the loss of 7q in 20/20 cells on examination of 20 metaphases. She required transfusion support for symptomatic anemia and became red blood cell transfusion dependent over the next several months. As she presented with shortness of breath and pleuritic chest pain, a computed tomography (CT) scan of the chest was performed at initial presentation which revealed multiple, calcified, slightly enlarged mediastinal, and hilar lymph nodes as well as scattered ground-glass linear and nodular opacities. Bronchoalveolar lavage was suggestive, but not diagnostic, of alveolar proteinosis. Transbronchial biopsy and wedge resection by video-assisted thoracic surgery (VATS) procedure were also nondiagnostic. Two months later the patient presented with severe bilateral eye pain, marked eyelid swelling, high fever, and a blanching rash on the upper and lower extremities. Lacrimal gland biopsy showed prominent acute and chronic inflammatory infiltration with focal abscess formation, few macrophages, and perivascular inflammatory cuffing, diagnostic of lacrimal gland pseudotumor. Gram stain, acid-fast bacilli (AFB) stain, and fungal stains were negative. Skin biopsy revealed panicular hemorrhage without signs of panniculitis or vasculitis. Repeat chest CT showed increase in size and number of pulmonary nodules. Repeat VATS procedure with wedge resection of the lung now revealed a diagnosis of acute fibrinous and organizing pneumonia (AFOP) which is a rare form of acute lung injury distinct from both diffuse alveolar damage (DAD) and organizing pneumonia. Initiation of intravenous Solumedrol 100 mg daily led to improved orbital and respiratory symptoms within 6 weeks. A repeat chest CT scan showed almost complete resolution of pulmonary nodules. Her transfusion requirements also declined while on high dose steroids. She was eventually placed on Prednisone 80 mg daily, which was decreased by 10 mg per week to a maintenance dose of 20 mg. Subsequently, treatment with Decitabine 20 mg/m^2^ (a hypomethylating agent) was initiated for her MDS. Four months later, while on Prednisone 20 mg daily and after completing her third cycle of Decitabine 20 mg/m^2^, she presented with high fevers, severe bitemporal headaches, and exertional dyspnea. Erythrocyte sedimentation rate (ESR) and C-reactive protein (CRP) were elevated to 140 mm/hr and 54.83 mg/L, respectively. A left temporal artery biopsy performed to assess for giant cell arteritis (GCA) was nondiagnostic. However, magnetic resonance imaging (MRI) of the head showed thickening of the temporal arteries. Blood and urine cultures were sterile. Antinuclear antibody (ANA), cytoplasmic antineutrophil cytoplasmic antibody (c-ANCA), and perinuclear cytoplasmic antibodies (p-ANCA) tests were negative. Chest CT scan performed due to increasing dyspnea showed recurrent pulmonary nodules. Intravenous Solumedrol 100 mg was resumed as there remained clinical concern for GCA. She experienced a brisk improvement in her symptoms, and her ESR decreased. She was discharged on Prednisone 100 mg with plan to taper the dose by 10 mg every 2 weeks. Over the next few months, and as Prednisone was decreased to 40 mg daily, the patient presented with recurrent high fevers, flares of bilateral temporal headaches, and exquisite tenderness over the temporal regions. She also complained of blurred vision and jaw claudication during her second admission. Right temporal artery biopsy was again nondiagnostic for vasculitis. Extensive workup for infection, including CT scans, transesophageal echocardiogram, and tagged white blood cell scan were unrevealing. Repeat bone marrow aspirate and biopsy showed persistent MDS with the emergence of a new clone that expressed the trisomy 8 marker. Fluorescent in situ hybridization (FISH) detected nuc ish(D7S486x1)\[151/200\]/(D8Z2x3)\[131/200\]. There was doubling of the original abnormal clone in approximately 94 chromosomes. Aneuploidy of chromosomes 7q, 8, and 20q but not 5q was identified. Her symptoms again improved on high dose steroids. The patient was therefore started on oral methotrexate (MTx) 15 mg weekly, as she continued to manifest a dominant autoimmune phenotype. She defervesced after two doses, but MTx was promptly discontinued due to myelosuppression. In the next few months, she was repeatedly admitted to the hospital with fevers, pancytopenia, fatigue, severe myalgias, and arthralgias. A repeat bone marrow biopsy during her final hospitalization revealed markedly hypocellular bone marrow (\<5%) without increase in white cell blasts. There was overall clinical deterioration due to bone marrow failure, progressive dyspnea and hypoxemia with progressive lung infiltrates, and intractable, generalized bone pain. The decision was made to institute comfort care measures, and the patient succumbed to her illness several days later. Postmortem exam was not allowed by the family. 3. Discussion {#sec3} ============= MDS is a common hematologic disorder that typically presents with one or more cytopenias. Autoimmunity is noted in up to 30% of patients in some series with autoimmune hemolytic anemia and immune thrombocytopenia seen most commonly \[[@B7]\]. Enright et al. studied 221 patients with MDS, of whom 30 (7.4%) had autoimmune organ disease \[[@B4]\]. In 7 cases, autoimmunity was diagnosed concurrently with MDS; 16 cases emerged along the MDS course, and 7 cases preceded the diagnosis. Autoimmune phenomena included cutaneous vasculitis, polyarthritis, myositis, polyneuropathy, glomerulonephritis, ulcerative colitis, pulmonary infiltrates, and pleural effusions \[[@B4]\]. Giannouli et al. also reported on 70 patients with MDS, of whom 12 (18.5%) developed rheumatologic syndromes including interstitial pulmonary infiltrates, polymyalgia rheumatica, and temporal arteritis \[[@B3]\]. A causal relationship is yet to be established between MDS and autoimmunity, but studies on the immunopathology and predictive biomarkers in MDS are ongoing. A number of immunoregulatory abnormalities have been described. Studies have shown that patients with MDS have reduced numbers of helper T cells \[[@B8]\], abnormal monocyte-derived dendritic cells \[[@B9]\], dysfunctional T regulatory cells \[[@B10]\], increased interferon regulatory factor-1 (IRF-1), m-RNA expression \[[@B11]\], decreased natural killer (NK) cell activity, and abnormalities of antibody-dependent cell killing \[[@B12]\]. Our patient presented with symptomatic anemia characteristic of MDS. The MDS clone was characterized by the 46,XX,+1,der(1;7)(q10;p10)\[20\] cytogenetic aberration that is reported in 1--3% MDS patients. By FISH, a trisomy 8 clone later emerged in a majority of 200 cells. Over the course of a few months, she developed histologically proven acute fibrinous and organizing pneumonia (AFOP), lacrimal gland pseudotumor and a rheumatologic syndrome of noninfectious fevers, polyarthritis, myositis, and presumed temporal arteritis. AFOP is a rare and relatively new histopathologic entity that is associated with clinical evidence of acute lung injury. The precise etiology is unknown but an association with collagen vascular diseases and malignancies has been reported \[[@B13]\]. A recent case report by Vasu et al. described a case of AFOP associated with Decitabine, which our patient also received for her MDS \[[@B14]\]. However, she was diagnosed with AFOP prior to receiving her first dose of Decitabine therapy. As far as we are aware, there are no reports of an association between MDS and AFOP, though there are case reports of pulmonary autoimmunity in patients with MDS. In the case series by both Giannouli et al. and Enright et al., noninfectious pulmonary infiltrates were reported as a manifestation of MDS \[[@B3], [@B4]\]. Additionally, Shimanuki et al. reported on a case report of organizing pneumonia in a patient with MDS \[[@B15]\]. Weng et al. also reported cryptogenic organizing pneumonia (COP) in a patient with MDS \[[@B16]\]. Response to steroids in all of these cases including our patient supports an immune pathogenesis. Interestingly, the der 1q; 7p chromosomal abnormality was previously described in 3 patients with MDS and disease-associated pulmonary syndromes \[[@B17]\]. Bilateral lacrimal gland pseudotumor is also rare in adults and is often recurrent and refractory to treatment. The etiology of orbital pseudotumor is unknown, but the proposed mechanisms include autoimmunity, infection, and abnormal wound healing \[[@B18], [@B19]\]. While there are no reports of MDS associated with lacrimal gland pseudotumor, there is a case report of MDS presenting with orbital inflammation. Rouhiainen described a patient who presented with chemosis, redness, and swelling of the eyelids that preceded an MDS diagnosis \[[@B20]\]. The orbital inflammation recurred twice over a 9-month period until finally controlled on a daily dose of maintenance prednisone. In summary, we report a case of MDS presenting with a novel spectrum of autoimmune diseases including AFOP and orbital pseudotumor. We speculate that these clinicopathologic entities extend the spectrum of autoimmune phenomenon seen in MDS and may be associated with an overall poorer prognosis. The authors would like to thank Dr. Joseph Rencic and Dr. Kenneth Miller of Tufts Medical Center for their help in editing the paper. [^1]: Academic Editors: E. Arellano-Rodrigo, C. M. Morris, and A. Ohsaka
Perpetrator of crimes against humanity, ethnic cleansing and cultural genocide. Documented serial violator of international law and the most fundamental human rights. Complicit in territorial aggression. All these accusations, and countless more like them, have recently been made by mainstream commentators, respected academics and official international figures. Of whom do they speak? Australia, of course. But does such insistent, brutal critique create a misleading picture of actual moral performance? Relentless, powerful criticism Most readers will be familiar with these accusations. Australia’s treatment of asylum seekers attracts well-publicised accusations of crimes against humanity and prompts serial reports of its serious breaches of human rights. Australia has recently been accused of racist and discriminatory acts of cultural genocide, ethnic cleansing and “acts of war” for proposals to remove basic services to its remote indigenous communities. Australia’s (lack of) action on climate change allegedly amounts to crimes against humanity and its involvement in Middle East conflicts is tantamount to the crime of aggression. Meanwhile, major human rights reports highlight a “grim outlook” for Australia. It is little wonder that respected international figures should thus mention Australia in the same breath as brutal regimes like Islamic State (IS), Syria and North Korea. Actual moral performance With all this in mind, you might be surprised where Australia sits in global human rights rankings. Australia consistently places in the very top echelon of such rankings, as seen here, here and here. Equally, it is a strong performer on governance values, democracy indexes and combined measures of happiness. There is a reason desperate refugees flood to Australia, rather than flee from it. What explains this gap? Of course, one can be comparatively a top performer and still be plagued with serious problems. But instead of using language appropriate to talking about serious problems, commentators routinely invoke notions of horrifying criminality. Through talk of genocide and atrocity, commentators often fail to distinguish between, on the one hand, savage slaughter and full-throttle repression and, on the other, rash, botched, insensitive, unilateral, ham-fisted or politicised responses to genuinely tough ethical questions. Equally, the debate can be skewed towards criticism. Political discourse, media and activism are all prone to invoking crisis, sensation and scandal. Even academia is not immune. Social “critique” rightly bears a special place in academic life, but can direct attention towards what is going wrong, rather than what is going right. Some of these practices – for example, politicians’ confected outrage – are lamentable. Other practices, such as academics and independent bodies speaking truth to power, are vital. Nevertheless, these many different phenomena combine to paint a misleadingly depressing picture of the country’s moral landscape. But aren’t there benefits? Even if the picture is skewed towards critique, real benefits arise. A negative slant can head off the natural tendency towards venerating one’s own community. Such a tendency can tempt us towards ugly nationalism or delusions about inherent cultural superiority. Having high local expectations can also help secure important reforms and prevent complacency. For example, by congratulating ourselves on our high global rankings, Australians might spurn the call for new human rights legislation — even though this might be a powerful method for responding to the serious problems we do face. But at what cost? Hyperbole can undercut support for important causes when objective, balanced argument would work better. Rather than changing their behaviour, people might switch off from critique. They might see the United Nations and human rights itself as nothing but unrelenting sources of shame and rebuke. So, too, can other countries easily brush aside Australia’s entreaties to respect rights and international law. Who are we to preach to others — like Russia or Indonesia — if our own brand is irreparably tainted (as Iran recently queried)? But perhaps the most serious ramifications of this cultural phenomenon lie in the potentially corrosive effect on ordinary people’s moral character. Like every society, Australia needs to encourage reasonable allegiance and commitment to its social and political processes. We are all shocked when young people choose to betray Australia’s values by joining a genocidal regime like IS. Yet our own “public relations” efforts showcase our flaws, not our successes. If people give up on the society around them, then they can tend to excuse their own moral failings and self-righteously disconnect from political life. Why play fair if the system is corrupt? Finally, while it can feel good to scold wrongdoers, encouragement sometimes works better for achieving results. In the current environment, Australians would struggle to feel any kind of “cultural ownership” of human rights. This is a real shame. From the most inauspicious beginnings, Australians have built their country into an extraordinary human rights success story. They should be inspired to go on living up to that status.
The Cleveland Browns are giving Kareem Hunt another chance in the NFL. The team announced Monday it had signed the former Kansas City Chiefs running back, who was waived in late November after a video emerged depicting him shoving and kicking a woman last February in an incident at a Cleveland hotel. Hunt was not arrested and no charges were made, but the Chiefs parted with him after the team said he "was not truthful" in discussions with management. “First off, I would like to once again apologize for my actions last year," Hunt said in a statement through the team. "What I did was wrong and inexcusable. That is not the man I was raised to be, and I’ve learned a great deal from that experience and certainly should have been more truthful about it after the fact. "I’m extremely grateful that John Dorsey, Dee and Jimmy Haslam and the Cleveland Browns organization are granting me the opportunity to earn their trust and represent their organization in the best way possible on and off the field. I am committed to following the necessary steps to learn and to be a better and healthier person from this situation. I also understand the expectations that the Browns have clearly laid out and that I have to earn my way back to the NFL. I’m a work in progress as a person, but I’m committed to taking advantage of the support systems that I have in place to become the best and healthier version of myself.” Hunt remains ineligible to play or practice while he is on the commissioner's exempt list. NFL Commissioner Roger Goodell said before the Super Bowl the league was still investigating three separate off-field incidents involving Hunt, who could be subject to a suspension as part of the league's conduct policy. Browns general manager John Dorsey drafted Hunt in the third round out of Toledo in 2017 when he served in the same role for the Chiefs. Dorsey said in a news conference later on Monday that the team he had not reached out to the woman that Hunt had shoved and kicked, but the team would have a zero-tolerance policy for him on further incidents. “My relationship and interaction with Kareem since 2016 in college was an important part of this decision making process but we then did extensive due diligence with many individuals, including clinical professionals, to have a better understanding of the person he is today and whether it was prudent to sign him," Dorsey said in a statement. "There were two important factors: one is that Kareem took full responsibility for his egregious actions and showed true remorse and secondly, just as importantly, he is undergoing and is committed to necessary professional treatment and a plan that has been clearly laid out. “We fully understand and respect the complexity of questions and issues in signing a player with Kareem’s history and do not condone his actions. Given what we know about Kareem through our extensive research, we believe he deserves a second chance but certainly with the understanding that he has to go through critical and essential steps to become a performing member of this organization, aside from what the NFL determines from their ongoing investigation. We fully understand that Kareem is subject to discipline by the NFL. Here at the Browns, there is a detailed plan with expectations laid out that he understands and must follow, because any similar incident will not be tolerated. We will support Kareem through this process and utilize our resources, however permitted, to help him become successful on and off the field as long as he continues to show the commitment necessary to represent this organization.”
Membrane type-1 matrix metalloproteinase (MT1-MMP) exhibits an important intracellular cleavage function and causes chromosome instability. Elevated expression of membrane type-1 matrix metalloproteinase (MT1-MMP) is closely associated with malignancies. There is a consensus among scientists that cell surface-associated MT1-MMP is a key player in pericellular proteolytic events. Now we have identified an intracellular, hitherto unknown, function of MT1-MMP. We demonstrated that MT1-MMP is trafficked along the tubulin cytoskeleton. A fraction of cellular MT1-MMP accumulates in the centrosomal compartment. MT1-MMP targets an integral centrosomal protein, pericentrin. Pericentrin is known to be essential to the normal functioning of centrosomes and to mitotic spindle formation. Expression of MT1-MMP stimulates mitotic spindle aberrations and aneuploidy in non-malignant cells. Volumes of data indicate that chromosome instability is an early event of carcinogenesis. In agreement, the presence of MT1-MMP activity correlates with degraded pericentrin in tumor biopsies, whereas normal tissues exhibit intact pericentrin. We believe that our data show a novel proteolytic pathway to chromatin instability and elucidate the close association of MT1-MMP with malignant transformation.
In a recent review, VanRullen ([@B8]) concludes that electrophysiological data should not be filtered at all when one is interested in the temporal dynamics or onset latencies of the electrophysiological responses. This conclusion was based on the observation that response onset latency was "smeared out in time for several tens or even hundreds of milliseconds" (p. 6) in a simulated dataset. It is correct that any band limitation in the frequency domain necessarily affects the signal in the time domain resulting in reduced precision and artifacts (cf. e.g., Luck, [@B5]). Nevertheless, here, we will discuss that the problem is overestimated by about an order of magnitude by the assumptions and analysis parameters used in VanRullen\'s simulated dataset and advertise the cautious usage of carefully designed filters to be able to also detect small signals. Filter Selection ================ The filter selected in VanRullen\'s simulation was a bad choice as it results in artifacts not related to filtering *per se*. The FIR filter generated by EEGLAB (Delorme et al., [@B1]) with default settings exhibits excessive filter ringing (cf., Figure [A1](#FA1){ref-type="fig"} in Appendix), and excessive pass-band ripple including non-unity gain at DC (the step response never returns to one). These artifacts are due to a known misconception in FIR filter design in EEGLAB[^1^](#fn1){ref-type="fn"}. The artifacts are further amplified by filtering twice, forward and backward, to achieve zero-phase. With more appropriate filters the underestimation of signal onset latency due to the smoothing effect of low-pass filtering could be narrowed down to about 4--12 ms in the simulated dataset (see Figure [1](#F1){ref-type="fig"} and Appendix for a simulation), that is, about an order of magnitude smaller than assumed. ![**Impact of filter type and signal-to-noise ratio (SNR) on the time course of the averaged signal and the detected signal onset latency in the simulated dataset (sampling frequency 500 Hz; step signal; signal onset 150--180 ms) as defined by VanRullen ([@B8])**. The simulated dataset was filtered with the EEGLAB firls based filter, a windowed sinc FIR filter (Widmann, [@B9]), a discrete Gaussian kernel filter (Lindeberg, [@B4]), and a minimum-phase converted version of the Gaussian filter (causal; see Figure [A1](#FA1){ref-type="fig"} in Appendix for a detailed description of the filters). Single trial signal-to-noise ratio was reduced in 20 dB-steps from +26 dB (original dataset; left column) to −14 dB (right column). The Gaussian filtered single trials (second row) and the averaged trials (third row) are displayed. Signal onset latency was measured by a running one-sided t-test (bottom row; gray bars) and jack-knifing with a relative 20%-criterion (black lines; Kiesel et al., [@B3]).](fpsyg-03-00233-g001){#F1} Signal-to Noise Ratio ===================== The signal-to-noise ratio chosen by VanRullen for the simulated dataset is implausibly high (+26 dB at single trial level, +43 dB averaged) as signal-to-noise ratios smaller than one are common in real electrophysiological data. This assumption biases the conclusion on the detectability of the signal without filtering and overestimates the impact of filter ringing artifacts. At more realistic signal-to-noise ratios no significant impact of the filter artifacts is observed (but only effects of transient smoothing by low-pass filtering; see Figure [1](#F1){ref-type="fig"} and Appendix). The precision that can be achieved in the measurement of the response onset latency is limited by signal-to-noise ratio. Thus, the trade-off between filter effects versus the signal-to-noise ratio gain by filtering must be considered. Filter Effects vs. Filter Artifacts =================================== We also recommend to distinguish between filter effects, that is, the obligatory effects any filter with equivalent properties -- cutoff frequency, roll-off, ripple, and attenuation -- would have on the data (e.g., smoothing of transients as demonstrated by the filter\'s step response), and filter artifacts, that is, effects which can be minimized by selection of filter type and parameters (e.g., ringing). Causal Filtering ================ In a commentary on VanRullen, Rousselet ([@B7]) suggested to use "causal" filtering to solve the problem of signal onset latency underestimation due to smoothing. This is a valid recommendation, which has already been given (e.g., Luck, [@B5]). However, it should have been made explicit that the suggested type of "causal" filtering comes at the cost of a distortion of phase information also with FIR filters (cf., Figure [A1](#FA1){ref-type="fig"} in Appendix). The causality in filtering is not directly related to the symmetry of filter coefficients as implied in Figure 1 in Rousselet\'s ([@B7]) comment. That is, the FIR filter labeled "non-causal" can also be applied in a causal way by not compensating the filter\'s delay (by not filtering the signal backward and not "left-shifting" the signal by the group delay). In order to reduce this filter delay in causal filtering, asymmetric "causal" FIR filters, more often referred to as minimum-phase filters, can be used. However, as FIR filter coefficients necessarily must be symmetric (or antisymmetric) for the filter to have linear-phase characteristic (Rabiner and Gold, [@B6]; Ifeachor and Jervis, [@B2]), this reduction of filter delay comes at the cost of a non-linear phase response and the introduction of a systematic delay in the signal (which can not easily be compensated due to non-linear phase). The recommendation for minimum-phase causal FIR filtering, thus, should be strictly limited to the detection of onset latencies and applications where causality is required for theoretical considerations. In its application it should be considered that the systematic delay and the non-linear phase response could also affect response onset information. In the first paragraph of the appendix Rousselet ([@B7]) suggests that the causal filtered signal could be left-shifted by the group delay to achieve zero-phase. We do not agree with this recommendation: First, this would re-introduce non-causality. Second, this statement is wrong as only linear-phase (anti-/symmetric FIR) filters can be made zero-phase by left-shifting the signal. Conclusion ========== In the analysis of electrophysiological data signal-to-noise ratio has to be improved by all adequate means. Priority should be given to the collection of higher numbers of trials and reduction of noise in data recording. However, in most situations filtering will nevertheless be necessary to appropriately analyze electrophysiological data. In these situations it is essential to know and understand the effects of filtering on the data and cautiously adjust filter settings (cutoff frequencies, roll-off, attenuation, and ripple) to the signal of interest and the particular application, e.g., by evaluating the effects of different filters on the data. Especially the high-pass filtering of slow ERP components or blinks, as commonly observed in the literature, might seriously affect ERP time course and amplitudes (see, Luck, [@B5], for a detailed discussion). Furthermore, we recommend not using default filter settings, in particular when using EEGLAB, but rather to manually and carefully select filter type and parameters to minimize filter artifacts. Filtering can result in considerable distortions of the time course (and amplitude) of a signal as demonstrated by VanRullen ([@B8]). Thus, filtering should not be used lightly. However, if effects of filtering are cautiously considered and filter artifacts are minimized, a valid interpretation of the temporal dynamics of filtered electrophysiological data is possible and signals missed otherwise can be detected with filtering. We are grateful to Burkhard Maess for the extensive discussion and helpful comments and to Nicole Wetzel for her helpful comments on the manuscript. The research was supported by a grant from the German Research Foundation (DFG; a Reinhart-Koselleck grant awarded to Erich Schröger). ^1^The EEGLAB "Basic FIR filter" function is based on the firls (least square fitting of FIR coefficients) MATLAB function (in the current version 11.0.2.1b as of writing this commentary). Filter length is defined independently of transition-band width. This can result in various adverse effects from sub-optimal stop-band attenuation, over filter artifacts, to leakage in the transition-band (the infamous "band-pass filter bug"). The problem is increased by the property of the firls function that transition-bands are defined as "do not care" regions. In a warning message it is announced in the current EEGLAB version that firls based filters are no longer recommended and fir1 should be used instead and will be the default setting in a future version. In its current implementation this change will not solve the problem as filter length and transition-band width are still defined independently. The filter actually generated by the fir1 function will deviate from the requested and reported transition-band width. Filter selection ---------------- We re-analyzed the simulated dataset as defined by VanRullen by means of a 49 point Hamming windowed sinc FIR filter (same length as the "default" EEGLAB generated filter; Widmann, [@B9]), and a discrete Gaussian kernel filter (σ = 6.18 ms; see Figure [A1](#FA1){ref-type="fig"} for impulse, step, magnitude, and phase responses). The signal onset latency was underestimated by about 4 (windowed sinc) to 12 ms (discrete Gaussian) relative to unfiltered data compared to 42 ms when applying the EEGLAB firls default filter by one-sided *t*-tests (see Figure 1, bottom row; with non-simulated data more appropriate methods as, e.g., cluster-based non-parametric analysis, Maris and Oostenveld, [@B10], could have been employed). No signal onset latency underestimation was observed using a jack-knifing technique with a relative 20%-criterion (Kiesel et al., [@B3]). Significant ringing artifacts could still be observed with the windowed sinc filter, in particular undershoot before signal onset (see Figure 1, left column, third row). Additionally, we re-analyzed the dataset by means of a causal filtering with a minimum-phase converted discrete Gaussian kernel filter as suggested by Rousselet ([@B7]). The signal onset latency was overestimated by 4 ms due to the systematic delay introduced by causal filtering (16 ms as estimated by jack-knifing). However, the morphology of the signal was considerably affected by the non-linear phase response of the filter. ![**Prototypical low-pass linear-phase filters' impulse, step, magnitude, and phase responses (top row; sampling frequency = 500 Hz, cutoff frequency 30 Hz)**. The EEGLAB "Basic FIR filter" (red, 49 points, default settings, EEGLAB v11.0.2.1b; Delorme et al., [@B1]) exhibiting excessive ringing artifacts ("ripples" in the time domain observed if filtering a non-oscillating input, e.g., a step signal, yields an oscillating output) is shown in comparison to a windowed sinc (green, 49 points, firfilt EEGLAB plugin; Widmann, [@B9]) and a discrete Gaussian kernel filter (σ = 6.18 ms, based on a modified Bessel function; Lindeberg, [@B4]). The minimum-phase converted version of the discrete Gaussian kernel filter (bottom row; "causal" filter converted by means of Hilbert transform) shows a considerably non-linear phase response but does not show a response before signal onset.](fpsyg-03-00233-a001){#FA1} Signal-to-noise ratio --------------------- In two additional analyses we reduced single trial signal-to-noise ratio in the simulated dataset in steps of −20 dB to +6 dB and −14 dB by reducing the signal amplitude from 1 to 0.1 and 0.01, respectively (Figure 1, columns two and three). At +6 dB signal-to-noise ratio the differences in onset latency underestimation between the linear-phase filters were significantly reduced (non-unity DC gain is still noticeable with the EEGLAB firls filter). No significant ringing artifacts were observed with the windowed sinc FIR filters. Importantly, at −14 dB single trial signal-to-noise ratio the signal could no longer be reliably detected without filtering and thus no signal onset latency could be determined. With non-causal and causal filtering the signal was detectable and the onset latency was overestimated by 4--6 and 18 ms, respectively (0 and 14 ms as estimated by jack-knifing). −14 dB single trial signal-to-noise ratio would be considered a good value in many electrophysiological measurements as, e.g., in electroencephalography (EEG). Averaging the 50 trials improved signal-to-noise ratio by +17 dB. Filtering further improved signal-to-noise ratio by about +12 dB allowing the reliable detection of the signal. We would like to note that ringing artifacts must be considered in relation to noise level. In non-simulated electrophysiological data ringing artifacts are not expected to have a major impact due to the high noise level on the one hand and the absence of ultra-sharp transients on the other hand. Recommendations for selection of filter type and parameters ----------------------------------------------------------- Unfortunately there cannot be given a ubiquitously valid recommendation for the selection of optimal filter settings, type, and parameters. They have to be individually adjusted to each application. Infinite impulse response (IIR) filters are often considered as computationally more efficient compared to FIR filters as they are shorter. However, it should be considered, that the signal has to be filtered twice -- forward and backward -- to achieve zero-phase (possibly introducing artifacts with DC offsets at signal boundaries and squaring the frequency response); a larger number of computations is necessary with IIR filters due to recursive operation (relative to the IIR filter\'s shorter length); numerical errors can be accumulated due to the infinitive impulse response; and they are more difficult to control and can be unstable. For FIR filters, only symmetric linear-phase filters should be considered for most applications in electrophysiology as they can be easily made zero-phase by left-shifting the signal by the filters group delay. There are various methods to design FIR filters, e.g., the Remez-exchange (equiripple) algorithm, preferable for arbitrary frequency responses not very common in the analysis of electrophysiological data (McClellan et al., [@B11]). The authors have good experiences with windowed sinc FIR filters, also commonly referred to as "ideal" filters due to the rectangular shape of the sinc function in the frequency domain. Implementations for the analysis of electrophysiological data can be found, e.g., in EEProbe software package (ANT, Enschede, The Netherlands) and the open-source firfilt EEGLAB plugin (Widmann, [@B9]). For a widely accessible introduction to windowed sinc FIR filter design see, e.g., Smith ([@B12]). Windowed sinc FIR filter\'s stop-band attenuation (and pass-band ripple) can be precisely controlled by selection of window type; the filters' transition-band width is a function of filter order/length (and window type), thus, filter length can be estimated (as with Remez-exchange FIR filters) or computed (with Kaiser windows), and high-pass filters can be easily optimized for excellent DC attenuation. If filter ringing is assumed to have an impact on a particular application, non-oscillating FIR filters, as, e.g., Gaussian kernel FIR filters, should be considered. As rule of thumb, stop-band attenuation should be selected only as high as necessary, wider transition-bands (slow roll-off) should be preferred over narrower ones where possible. Cutoff frequencies and transition-bands should be separated from the signal of interest in the frequency domain to minimize distortion of the signal by filter artifacts and undesired filter effects. The filter should be as short as possible in order to minimize temporal smearing. Low-pass filters can sometimes be omitted in favor of later analysis steps introducing additional filtering as, e.g., computing time window mean values (representing low-pass filters as well). Balancing transition-band width and cutoff frequency is a particular challenge for high-pass filter design as the transition-band is limited by DC on the one hand but cutoff frequency should be low in order not to distort slow components on the other hand. Extreme cutoff frequencies \<0.1 Hz as found sometimes in the literature should be avoided as filters usually become very long. [^1]: Edited by: Guillaume A. Rousselet, University of Glasgow, UK [^2]: Reviewed by: Rufin VanRullen, Centre de Recherche Cerveau et Cognition, France; Lucas C. Parra, City College of New York, USA [^3]: This article was submitted to Frontiers in Perception Science, a specialty of Frontiers in Psychology.
Q: call a method Asynchronously from another method I have a collect_data method which is called from another method create. I want to call this collect_data method asynchronously as the user need not wait for response from function create. def create(obj): "do something in database" "return ID for newly created data in DB" collect_data(obj, newly_created_id) return newly_created_id def collect_data(obj, newly_created_id): "collect data from other methods." "Put the data in MQ." So, i want to run this collect_data asynchronously so that user need not wait for the newly_created_id until the data is put in ActiveMQ. I tried multiprocessing, something like below. import multiprocessing as mp def create(obj): pool = mp.Pool() "do something in database" "return ID for newly created data in DB" pool.apply_async(collect_data, args=(obj, newly_created_id)) return newly_created_id But this does not seem to run asynchronously. To test I inserted a sleep for 2 mins in collect_data. Function create did not return the newly_created_id immediately. Can someone please help. A: from multiprocessing import Pool import time import random class DATA: def __init__(self, obj, new_id): self.obj = obj self.new_id = new_id def collect_id(data): print 'collecting data for obj {0} with id {1}'.format(data.obj, data.new_id) def create(obj): pool = Pool() # "do something in database" # "return ID for newly created data in DB" newly_created_id = int(random.random()*10) data = DATA(obj, newly_created_id) r = pool.map_async(collect_id, [data]) return newly_created_id new_id = create({'some':'object'}) print "new id: {0}".format(new_id) You will see it outputs the ID before it outputs that it's collecting the data, showing its happening async in the background
10p tax help too slow - Darling Chancellor Alistair Darling has admitted to MPs that ministers should have moved "faster" to compensate those who lost out over the 10p tax rate. And he said he wanted to do more to help the million people not compensated by his £2.7bn emergency package in May. He said compensatory measures for the over-65s and many parents were brought in when the tax rate was scrapped. But he said: "Should we have gone faster and further? Yes we should, which led to my announcement in May." Mr Darling was answering questions from MPs on the Treasury Select Committee, which is holding an inquiry into the effects of the 10p tax band being axed. Fiscal rules Before he announced concessions in May, it was estimated that 5.3m low-paid people would have been left worse off by the change - which threatened to provoke a backbench rebellion by Labour MPs. He told MPs he did not accept he had put the government's own fiscal rules, which require public sector borrowing to be held below 40% of national income, at risk by his concessions. It was necessary to announce it as quickly as possible - we should have done something faster and we should have done more Alistair Darling He said it would have been wrong to take the money out of the economy, by tax increases elsewhere, at a time the economy was slowing. In May, just weeks after the Budget and following a rebellion by Labour MPs, he announced a £2.7bn package effectively giving an extra £120 this year to all basic rate tax payers. Conservative MP Philip Dunne quoted an interview Mr Darling did shortly after becoming chancellor, in which he said that any tax changes should be "made at the proper time, in the context of the Budget, or the pre-Budget report". Failed in job? Mr Dunne asked if Mr Darling felt he had failed in the job. The chancellor: "I think in relation to the announcement made in May, I'm not aware that there are many people who are seriously suggesting we should not have said anything until November. "It was necessary to announce it as quickly as possible - we should have done something faster and we should have done more and I think, having recognised that, it would have been completely wrong to have delayed making any announcement until the autumn." "I have said on many occasions that I'm sorry this situation arose in the first place and it has been sorted out." 'More to help' Asked if a full analysis had been done of the effects of the change when it was being planned, he said "the distributional effects of any changes are looked at" and it had been recognised some people would lose out. Some changes had been made to help those aged over 65 and families with children but added: "If you are asking should we have gone faster and further, yes we should have." He said about four million people left worse off by the abolition of the lowest tax rate had been compensated, but admitted a further one million were still worse off. "There are people we still want to do more to help and we will do that in the context of the Pre-Budget Report," he said. But he refused to outline exactly what he was intending to do once this year's tax concessions expired but said he was committed to helping those on low incomes. Conservative MP Michael Fallon said, as it was estimated that four million people hit by the 10p tax band abolition had been helped - along with a further 13 million families, if the higher personal tax allowance was not continued it was inevitable that 13m people would be worse off next year. Mr Darling urged him to wait to see what measures he put forward in the pre-Budget report. The decision to abolish the 10p tax rate, made by Gordon Brown in his last Budget as chancellor, came into force in April this year - alongside a reduction in the basic rate of tax from 22% to 20%. The Treasury committee is conducting a brief inquiry into the abolition of the 10p tax rate and compensatory measures that is expected to report within weeks. This page is best viewed in an up-to-date web browser with style sheets (CSS) enabled. While you will be able to view the content of this page in your current browser, you will not be able to get the full visual experience. Please consider upgrading your browser software or enabling style sheets (CSS) if you are able to do so.
OpenGrok 0.11.1 OpenGrok is a fast and usable source code search and cross reference engine. It helps you search, cross-reference, and navigate your source tree. It can understand various program file formats and version control histories like Mercurial, Bazaar, Git, ClearCase, Perforce, SCCS, RCS, CVS, or Subversion. In other words, it lets you grok (profoundly understand) the source. Changes: A problem with the ignore list not skipping many files was fixed. Caching was added to the Web app. There were various cleanups and script improvements. README files are now shown again if the indexer is out of sync. When upgrading, there is no need to reindex from scratch
The surgical management of bilharzial strictures of the ureter. Twenty-one ureteric strictures due to bilharzia have been treated surgically in 13 patients. Two required nephrectomy; 19 had direct ureteric reimplantation into the dome of the bladder after excision of the strictured segment of ureter. A simple technique of reimplantation into the dome of the bladder is described and early results have justified its further use.
Splitting the Foundation from the core devs, and kickstarting funding for other teams to work on Aragon In the tech world, startups usually capitalize by amassing Intellectual Property, data, and governance. They attempt to centralize all this to their own benefit. Most crypto projects that are pursuing decentralization can't be categorized as startups. Crypto projects usually capitalize by creating a network/protocol/DApp that has a token which should become more valuable as the utility of its network/protocol/DApp grows. Let's see how this differs from a startup: Intellectual Property Proprietary solutions require a lot more trust as the end-user has no way of knowing what's included in the code. Therefore proprietary solutions are not viable in the crypto world. Being open source is a must for crypto projects. This eliminates the competitive edge that having IP gives to a startup. Data Blockchains are transparent by nature. With the software being open source for anyone to dissect, the trust can be mutually established between developers and users. And by utilizing a blockchain, the user owns the datathat gets generated in the process. This makes it impossible for a decentralized platform to retain your data and build a walled garden around it. Governance As crypto networks are open for anyone to use, it only makes sense for them to be governed by their users. This way they won't suffer from having a single centralized party, like a startup, that could arbitrarily take advantage of the user base. With a token model, you can create incentives for those governing the project to create mutual value. A defensible token model was well-argued by Luke in his recent Thoughts On Governance and Network Effects post. In the post he explores the reason as to why the key difference is not whether the product is a protocol or an application, but whether the network effect driven by tokenization is defensible or not. Does it makes sense for development teams to be centralized? Knowing all of the above, we can see a huge difference in how startups and crypto projects need to be run. Startups Startups own and control the development resources they have and need for their products to exist. The core developers are employed by the startup. It wouldn't make much sense for a community participant to work on the startup's product if the IP, data and governance are all centralized. The contributor wouldn't see much return in exchange for their efforts. Crypto projects In a crypto project, these lines blur. You can be the consumer of the product. You can be producing content or code for the project. You can participate in maintaining the project. You can be part of governing the development of the project, and so on. There are plenty of ways a community member can benefit in this communal kind of project: You can fork the software, enhance it and adapt it to your needs. This adds value to both yourself and the larger community You can do the above and be directly rewarded by the network for your contribution You can exercise governance power over the network, making it stronger by favoring Voice instead of Exit and making decisions that benefit the project and your stake in it Incentives can be set in a way that a crypto network resembles a living organism that employs humans to achieve its goals. And it evolves and adapts to better define those goals, and the road to achieving them by using governance. If this living organism survives only as a result of a centralized team developing it, what if that team disappears for whatever reason? That would be a significant drawback for the project, even if the code is open source and the governance decentralized. That's why we will start to decentralize the development of Aragon during 2018. Splitting the Aragon Foundation and the Core Developer Company Funds were raised in the token sale in order to best serve the interests of the Aragon project. For the project to be as resilient as possible, the development of the project should not be controlled by a single central entity. It should be in the hands of the community and multiple different development teams. Right now the team developing Aragon is directly employed by the Aragon Foundation, which is an unfair advantage over other teams that have interest in contributing to the project. If you go to the About page at the Aragon website, you'll see the faces of all our core team members. We have a very strict hiring process, so not a lot of people end up being in that page. However, there will be other community members that do deserve to be showcased on the project's website. To encourage other teams to work on Aragon, we will be splitting off the Foundation to form a company of core developers. Everyone currently employed by the Foundation will become employees of a new company funded by the Foundation. That way, we level the playing field for other teams to join the core development of the project. We have always upheld the notion that Aragon will be Community Governed. We plan to maintain the Foundation, and reduce its authority as the governance of the project is fully transferred to the ANT holders, along with a significant portion of the funds from the token sale. The full transition will happen gradually over time as we make sure the platform and network are working securely and as intended. This split is an early step in that journey. Funding other teams to work on Aragon With Aragon Nest we are already supporting projects that are not necessarily sustainable by themselves yet, but are crucial to the Aragon and Ethereum ecosystems. In the coming months, we will expand the scope of Nest to start funding alternative teams that have a desire to work on the Aragon Core client, aragonOS and on Aragon Apps. In the medium term, as a part of the Aragon Network, we will begin experimenting with sustainable methods of funding contributions to the project. Okay, but how will this impact the development of Aragon? Right now, practically speaking, it won't. We will keep working on Aragon just as we have been consistently doing since November 2016. In the medium term, it will hopefully produce a wave of new contributors and teams working on some of the core Aragon infrastructure, accelerating the development of the project. In the long term, it will make Aragon's development efforts decentralized. Which will increase the probability of the project to survive whatever threats it might face in the future. This is a firm commitment. We will be transparent about this and keep the community updated as we always do. I personally had the immense privilege to have been able to work on Aragon and see it grow from the first day on. I cannot wait to see other teams working on Aragon with the same level of passion and care that we do. To Aragon's future 🥂
Injuries are considered an inevitable by-product of participation in elite sport (Hurley et al., [@B14]), and over the past 30 years, psychologists have proposed a number of models to explain athletes\' psychological reactions to their injuries. These models have included the grief model (Kübler-Ross, [@B19]; Rotella, [@B27]) and the cognitive appraisal models (Brewer, [@B4]; Wiese-Bjornstal et al., [@B32]). When examining the value of these models, researchers have identified a number of factors mediating athletes\' responses to their injuries. Factors such as social support (Clement and Shannon, [@B6]) and perceived consequences of injuries for the athletes (Hurley et al., [@B14]) have been popular lines of investigation. A less popular avenue of research has been the impact of tournament-ending injuries on the mental states of remaining squad members called upon to perform without their injured colleagues. Given the lack of research in this area, it could be fruitful to discuss the potential impact of player attrition rates on their teams\' mental states, and subsequent performances, using the Rugby World Cup 2015 (RWC 2015) as a case study. This case study is considered appropriate because many countries suffered serious injuries to some of their best players just before, or during, this RWC (Lewis, [@B21]). For example, the Irish team lost one of its most experienced players, Paul O\'Connell, due to injury early in the tournament, as did South Africa, who was forced to play without captain, Jean De Villiers, from game three of the tournament. Similarly, the New Zealand "All Blacks" lost their experienced player, Tony Woodcock, due to injury before their quarter final match. Despite the loss of Woodcock, the New Zealand team was successful in defending its RWC title from 2011. Indeed in 2011, New Zealand played without four of its out-half players. Is it possible the New Zealand team did something different, compared to the other nations, to prepare successfully for both the RWC 2011 and 2015 tournaments? This paper will explore possible reasons why some of the other nations failed to perform to their potential at the RWC 2015. This paper is organized as follows: First, the mental challenges team players may have faced following the loss of influential players through injury will be discussed. The potential for emotional contagion to have permeated throughout such teams, and its possible impact on those teams\' subsequent performances will dominate this discussion (Moll et al., [@B23]). Second, some possible areas for future research will be suggested, focusing on the role support staff (including coaches, medical staff, and sport psychologists) working with such teams might play in helping their teams to thrive in such circumstances in the future. Possible mental challenges for team players at the RWC 2015, following the loss of influential team members through injury {#s1} ========================================================================================================================== As mentioned earlier, many teams competing at RWC 2015 suffered the loss of influential players due to injury during the warm-up, pool, and knock-out stages of the tournament (Lewis, [@B21]). In rugby union, which is a collision sport, the potential for injury is high when compared to non-contact sports (Almedia et al., [@B1]). Tournament-ending injuries to such elite team players have the potential to cause disturbances not only in the injured players\' emotional and behavioral states, but also in the remaining team members\' mental states and on-pitch performances. Seeing a teammate suffer a tournament-ending injury could result in other team members experiencing an increased fear of injury themselves, and decreased levels of confidence in the team\'s overall ability to continue to perform at a high level in the competition. Indeed, the Head Coach of South Africa, Heyneke Meyers, commented that De Villiers was the "glue" of the South African team and that his influence would be missed (The Guardian, [@B30]). It is interesting then that empirical research measuring the impact of such player losses has not been the focus of researchers\' attention to date, despite common sense dictating that such losses could contribute to changes in teams\' collective thought processes at competitions such as the RWC (Cary, [@B5]). For example, doubts surrounding the ability of another player to successfully perform in the role of an injured colleague within a team could have occurred at the RWC 2015. This potential for negative social contagion to develop within teams who suffer high numbers of player losses due to injury is worthy of attention. Social contagion refers to the spread of mood states, attitudes or behaviors from an initial person, called "the initiator," to another person, called "the recipient," without the recipient being necessarily aware of this effect of the initiator (Levy and Nail, [@B20], p. 266). In general, studies of social contagion have focused on two main areas (i) emotional contagion---the spread of mood states throughout a population, and (ii) behavioral contagion---the spread of behaviors throughout a population. Some empirical studies of social contagion have been conducted in real-world, high-performance settings. For example, Wagstaff and Weston ([@B31]) examined the impact of social contagion on teams making expeditions to the Antarctica. Interestingly, some of the negative contagion-performance effects reported by Wagstaff and Weston ([@B31]) have also been reported in environments where direct contact between individuals has not taken place, such as through social media outlets (i.e., Facebook; see Kramer et al., [@B18]). These findings highlight that contagion effects in performance settings should not be underestimated. Emotional contagion implies that emotions expressed by one individual in a group or team, may spread to other members of that collective group. Some factors thought to be important in determining the rate and extent of emotional contagion, according to Bartel and Saavedra ([@B2]), include: (i) the degree of membership stability within the group, i.e., the turnover rate of members within the group, and the number of years members are part of that group (Squire, [@B29]), (ii) the task interdependence within the group, i.e., how much group members rely on one another to complete their tasks effectively (Georgopoulos, [@B10]), and (iii) the social interdependence within the group, i.e., the impact of other group members\' actions on other individuals\' abilities to accomplish their goals \[such impacts may be positive (cooperative) or negative (competitive); Johnson and Johnson, [@B16]\]. Some coaches and support staff of RWC 2015 teams would, perhaps, have benefited from having a greater understanding of the impact of such factors on their teams\' performances. Often, during the RWC 2015, spectators, commentators, and coaches discussed the potential impact of injuries on teams\' performances (Hewett, [@B11]; The Guardian, [@B30]). On occasion, they questioned the ability of substitute players to effectively replace their injured teammates (Cary, [@B5]). The lack of research on the potential impact of team members\' reduced confidence in a replacement player\'s ability exposes an area for investigation. Perhaps participants in such studies may be viewed as reluctant to voice their real concerns about fellow team members being capable of replacing their unavailable injured colleagues. This view may account for researchers avoiding this specific avenue of investigation. The good news is that while individuals may be affected negatively by those around them, they may also be affected in a positive way (Fransen et al., [@B8]). This point prompts the question of what can be done to enable team members maintain high levels of confidence in their own, and other teammates\', ability to perform successfully in their roles, when placed in high pressure situations such as those presented at the RWC 2015 (something the New Zealand team appear to have successfully achieved, as is evident from their recent successes in the tournament). The specific role support staff may play in helping teams, including replacement players, to thrive in high pressure competitions, such as the RWC {#s2} ================================================================================================================================================== Team coaches, medical personnel, and sport psychologists may play an important role in helping team members to remain confident and thrive in situations where the loss of an influential player occurs, such as at the RWC. Rather than seeing the situation as a threat to success, players could be encouraged to see the situation as an accepted and positive challenge they are capable of overcoming (Hodge and Smith, [@B12]). One suggestion for support staff could be to spend more time, in advance of such tournaments, creating a team ethos centered on equality among all players and support staff. A number of recent studies have been devoted to the "teamwork" dimension of team cohesion (McEwan and Beauchamp, [@B22]; also see Moran, [@B24], for a review of this topic). Perhaps, placing a greater emphasis on "team spirit" and player acceptance is warranted now in team environments, in order to positively impact on the character and attitudes of team members. This appears to be something the New Zealand players have been successful in achieving in recent years, based on their results at the RWC 2011 and 2015. Coaches and support staff who actively promote and encourage an investment in personal relationships among all members of their team environment are more likely to develop a greater team awareness of the importance of interpersonal dynamics. Such an approach to team management could increase the sense of equality and acceptance within the team (Garn, [@B9]). It may also help to create an attitude of personal responsibility for performances and a greater acceptance of individual leadership duties by all players within a team (Kerr, [@B17]; Smith, [@B28]). One novel way to enhance players\' coping skills in times of unrest and stress due to player injury losses might involve the use of virtual reality technology, such as the Oculus Rift (Oculus, [@B25]). Virtual match-day scenarios could be designed to simulate match-day events, where key players are made "unavailable due to injury," and other players are required to "replace" them. Programs could be designed to prepare all available players, including replacement players, for the demands and atmosphere of such match-day possibilities. Players could be taught to engage in relaxation and concentration strategies (i.e., self-talk management, appropriate goal setting, breathing exercises, and progressive muscular relaxation techniques; Cotterill, [@B7]) while watching such match-day simulations, in order to train them to remain calm, focused, and positive in their mind-set when called upon to perform at important tournaments. These match simulations could be used by all players well in advance of important tournaments to help them mentally prepare for these possible real-life events (Pramuk, [@B26]). Researchers could also empirically investigate if such virtual preparation compared to, or along with, for example, mental imagery rehearsal of such scenarios, could establish greater player confidence and acceptance for all players\' contributions within a squad of players. Similar virtual reality simulations have been used successfully with stroke patients (Hurley, [@B13]) and to prepare injured players for a return to play (Independent Pictures, [@B15]). Therefore, the use of such technology would not be unfamiliar to many elite players. Final thoughts {#s3} ============== It is possible teams who, by their own standards, did not produce peak performances at the RWC 2015 suffered the negative effects of emotional, and behavioral, contagion due to player injuries. As discussed above, these outcomes may have occurred as a result of decreased levels of confidence in replacement team members\' potential performances, although such assertions are in need of more support via empirical investigations. How such situations may be prevented from hampering teams\' performances in future competitions should also be the focus of empirical research by psychologists working with these teams. Such research might help to provide a greater understanding of the unexpected decreases in some teams\' performances at the RWC 2015 (Boss and Kleinert, [@B3]). Perhaps engaging in mental skills training using a virtual reality environment could inoculate players against the negative emotional and performance effects of social contagion. One should also consider that tournaments such as the RWC occur in 4-year cycles, therefore for such an intervention to be effective, the club environments of players should also incorporate a similar approach to players\' preparations. Author contributions {#s4} ==================== The author confirms being the sole contributor of this work and approved it for publication. Conflict of interest statement ------------------------------ The author declares that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. The author would like to thank Professor Aidan Moran (UCD) for his valuable suggestions in the final stages of the initial editing process for this opinion piece. [^1]: Edited by: Tadhg Eoghan MacIntyre, University of Limerick, Ireland [^2]: Reviewed by: Mary Margaret Meade, Ulster University, UK; Caren Diehl, National Sports Institute of Malaysia, Malaysia; Cian Aherne, Health Service Executive, Ireland [^3]: This article was submitted to Movement Science and Sport Psychology, a section of the journal Frontiers in Psychology
Q: instanceof operator in java with interfaces Can anyone explain the following behavior in Java using instanceof operator . Runnable r = new Thread(); eventhough the type of variable r is Runnable and the instanceof comparison is done on classes that do not reside in the same class hierarchy System.out.println(r instanceof String); // This line does not compile System.out.println(r instanceof Vector); // This line compiles System.out.println(r instanceof FileNotFoundException); // This line compiles A: String class is final -- that means it can't be subclassed. Moreover, it doesn't implement Runnable. All of this is known at compile time; hence, compilation error.
New maternity unit for yorkshire. A major £1 million maternity unit opened its doors to mothers to be in the Yorkshire area recently.
Hir — Bart DeLorenzo directs this darkly funny, shockingly absurd and endlessly surprising vision of a world in transition by MacArthur genius Taylor Mac. Somewhere in the suburbs, Isaac has returned from Afghanistan with a dishonorable discharge, only to discover a household in revolt. The insurgent: his mom. Liberated from an oppressive marriage to Isaac’s father by his debilitating stroke, and with Max, Isaac's newly out transgender sibling, as her ally, Paige is on a crusade to dismantle the patriarchy. “Top Ten Best Theater of 2015… Perhaps no play this year inspired a greater sense of awe than Taylor Mac’s audacious dive into the dysfunctional-family playpen of American theater.” — The New York Times
INDUSTRY COMPANY Pennsylvania Bars Harrisburg Bankruptcy The financially strapped city of Harrisburg, Pennsylvania, will have to wait until at least November 30 before it can file for bankruptcy — that’s the decision from the state legislature and Governor Tom Corbett. The financially strapped city of Harrisburg, Pennsylvania, will have to wait until at least November 30 before it can file for bankruptcy — that’s the decision from the state legislature and Governor Tom Corbett, according to Stateline.org. Harrisburg is currently under receivership from the state and faces more than $300 million in debt largely as a result of a ruinous trash incinerator project. Some city officials want to deal with the problem by declaring bankruptcy. The 2012-13 state budget signed by Corbett on Saturday makes that impossible for at least the next five months. The delay was an idea spawned by the legislature, but Corbett did not disagree with it, says Kelly Roberts, a spokesperson for the governor. The ban was met with frustration from the city council and the state-appointed receiver, retired Air Force General William Lynch. "Lynch has said he wants the bankruptcy option,” said city councilman Brad Koplinski in an interview with Reuters. “Why would Governor Corbett send his general into combat to negotiate with our city's creditors without the heaviest artillery? We are trading in our tanks for pea shooters and our nuclear missiles for slingshots." Adding to the frustration over the delay, the receivership itself is still under fire from a faction of angry city officials. Five city council members, Controller Dan Miller and Treasurer John Campbell filed a lawsuit in federal court last week challenging the state takeover and seeking to stop the work of the receiver. They argue that because the legislature handed the power to choose and appoint the receiver to Governor Corbett, the move is a violation of due process. In the nation as a whole, 262 municipalities have filed for bankruptcy since 1980.
Bioinspired design We envisioned a personal thermal management technology, which would leverage the static infrared-reflecting configuration of the space blanket and draw inspiration from the dynamic color-changing mechanisms intrinsic to squid skin (Fig. 1e). We thus designed a composite material comprised of (1) a soft and stretchable infrared-transparent polymer matrix and (2) an overlaid array of infrared-reflecting metal domains stably anchored within the matrix via columnar nanostructures (Fig. 1e, inset and Fig. 1f, left). In our design, the polymer matrix emulates the chromatophore-containing transparent dermal layer of squid, while the metal domains emulate the embedded chromatophore organs themselves. Prior to any mechanical actuation, the nanostructure-anchored, infrared-reflecting metal domains are densely packed and completely cover the underlying matrix (Fig. 1f, left), in similar fashion to how expanded plate-like chromatophores are overlapped in squid skin (Fig. 1d, left). The composite material thus reflects nearly all incident infrared radiation (Fig. 1f, left), in analogy to the arrays of overlapped chromatophores reflecting visible light of specific wavelengths (Fig. 1d, left). However, upon mechanical actuation, the anchored metal domains become spread apart and uncover portions of the stretched underlying polymer matrix (Fig. 1f, right), in similar fashion to how contracted point-like chromatophores are separated in squid skin (Fig. 1d, right). The composite material thus transmits a significant fraction of the incident infrared radiation (Fig. 1f, right), in analogy to arrays of contracted chromatophores transmitting relatively more visible light (Fig. 1d, right). In essence, mechanical actuation (stretching) reversibly changes the surface microstructure of our composite material and thus dynamically alters its ability to transmit and reflect infrared radiation (e.g., heat). The general design simultaneously encompasses the desirable technical advantages of the space blanket (i.e., straightforward low-cost manufacturability and outstanding energy efficiency) and the unique natural characteristics of squid skin (i.e., a favorable form factor and on-demand controllability). Composite fabrication We began our experiments by fabricating the desired thermoregulatory composite material according to the scheme in Fig. 2a. Here, we prepared samples with areas of >~160 cm2 by using common laboratory techniques and methods that would ultimately allow for larger-area manufacturing on an industrial scale. In brief, we electron-beam evaporated an infrared-reflecting, nanostructured copper film onto a support substrate via a two-step oblique angle deposition process (Fig. 2a, left)33, obtaining arrayed tilted nanoscale columns that emerged from an underlying continuous metal (copper) coating, as confirmed by top–down scanning electron microscopy (SEM) (Fig. 2b and Supplementary Fig. 1). Next, we spincast an infrared-transparent styrene–ethylene–butylene–styrene (SEBS) copolymer34,35 directly onto the nanostructured metal layer (Fig. 2a, middle), stably anchoring the copper columns within this elastomer, as confirmed by cross-sectional SEM (Fig. 2c and Supplementary Fig. 1). Subsequently, we heat-treated and delaminated the resulting composite from the support substrate to obtain a free-standing material (Fig. 2a, right), which featured a fractured, multi-domain copper coating on one side, as confirmed by top–down SEM (Fig. 2d). Overall, the described robust, high-yield procedure furnished a uniform and relatively large-area composite analogous to the one envisioned in Fig. 1e, f. Fig. 2 Preparation of the thermoregulatory composite material. a Schematic of the general fabrication procedure for the composite material. The steps consist of the electron-beam deposition of a nanostructured copper film onto a support substrate (left), the spincasting of a styrene–ethylene–butylene–styrene block copolymer directly onto this film (middle), and the delamination of the resulting composite from the substrate (right). b Digital camera image of a substrate-bound nanostructured copper film (top). The scale bar is 2 cm. A representative top–down scanning electron microscopy (SEM) image demonstrates that the film consists of arrayed tilted nanoscale columns that emerge from an underlying continuous copper coating (inset). The scale bar is 200 nm. c Digital camera image of a substrate-bound composite material (top). The scale bar is 2 cm. A representative cross-sectional SEM image demonstrates that the tilted copper nanostructures are anchored within the polymer (inset). The scale bar is 500 nm. d Digital camera image of a free-standing composite material in a tape-based holder (top). The scale bar is 2 cm. A representative top–down SEM image demonstrates that the overlaid copper coating is fractured and consists of multiple abutting domains (inset). The scale bar is 20 μm Full size image Infrared and mechanical characterization We initially characterized our composites’ mechanical properties via tensile testing, while also evaluating their surface microstructure at different applied strains. For our composites, the engineering stress vs. engineering strain curves revealed that they behaved like soft and stretchable elastomers, with an average elastic modulus of ~2 MPa and an elongation at break of ~700% (Supplementary Fig. 2). In their relaxed state, the composites were visibly opaque and highly reflective, as indicated by digital camera imaging, and their surfaces consisted of a dense arrangement of abutting, irregularly shaped metal domains, which completely covered the underlying polymer matrix, as confirmed by SEM and energy dispersive spectroscopy (EDS) (Fig. 3a, left and Fig. 3b). However, under a strain of 30%, the composites became partially transparent and less reflective, as indicated by digital camera imaging, and their surfaces consisted of a sparser arrangement of metal domains that were proximal to but not directly contacting one another, revealing some of the underlying strained polymer matrix, as confirmed by SEM and EDS (Fig. 3a, middle and Fig. 3c). Under a larger strain of 50%, the composites further increased their visual transparency and appeared even less reflective, as indicated by digital camera imaging, and their surfaces consisted of an arrangement of metal domains that were spread farther apart from each other, uncovering even more of the underlying strained polymer matrix, as confirmed by SEM and EDS (Fig. 3a, right and Fig. 3d). Importantly, the composites could be loaded/unloaded in <1 s, featured fully reversible changes in both their visible appearance and surface microstructure, and readily withstood repeated mechanical cycling. Interestingly, the composites demonstrated properties similar to those reported for various squid skin components, including elastic moduli (~0.5–3 MPa for the chromatophore-containing dermal layer)25, response times (<1 s for chromatophore organs)26, and capacities for extreme elongation (>14-fold diameter expansion for chromatophore pigment cells)27. Therefore, the composites exhibit several advantageous characteristics that are desired for thermal switching applications, including a rapid response time, a soft and stretchable form factor, and a straightforward actuation mechanism (Supplementary Table 2). Fig. 3 Mechanical actuation of changes in surface microstructure and infrared properties for the composite material. a Schematic of the mechanical actuation of the composite with strains of 0% (left), 30% (middle), and 50% (right). The surface microstructure and the reflection and transmission of infrared radiation change as a function of the applied strain. b Digital camera image of a composite under a strain of 0% above an anteater cartoon (top). The scale bar is 1 cm. A top–down scanning electron microscopy (SEM) image and copper elemental map, where the metal is colored green, for the surface of a representative composite material under a strain of 0% (inset). The scale bars are 100 μm. c Digital camera image of a composite under a strain of 30% above an anteater cartoon (top). The scale bar is 1 cm. A top–down SEM image and copper elemental map, where the metal is colored green, for the surface of a representative composite material under a strain of 30% (inset). The scale bars are 100 μm. d Digital camera image of a composite under a strain of 50% above an anteater cartoon (top). The scale bar is 1 cm. A top–down SEM image and copper elemental map, where the metal is colored green, for the surface of a representative composite material under a strain of 50% (inset). The scale bars are 100 μm. e The total infrared reflectance spectra for a representative composite material under strains of 0% (black trace), 30% (red trace), and 50% (blue trace). The reflectance observed at 0% strain is recovered even after successive actuation with higher strains (pink dotted trace). f The total infrared transmittance spectra for a representative composite material under strains of 0% (black trace), 30% (red trace), and 50% (blue trace). The transmittance observed at 0% strain is recovered even after successive actuation with higher strains (pink dotted trace). g Plot of the decrease in the average total reflectance for representative composites as a function of the applied strain. All error bars represent the standard deviation. h Plot of the increase in the average total transmittance for representative composites as a function of the applied strain. All error bars represent the standard deviation Full size image We next showed that the composites’ infrared reflectance and transmittance could be dynamically modulated on demand by an applied mechanical stimulus (a uniaxial strain). In its relaxed state, a representative composite featured a high average total reflectance of ~100% (Fig. 3e) and a low average total transmittance of ~1%, as well as no apparent signals associated with specific functional groups (Fig. 3f), due to complete coverage of the infrared-transparent polymer matrix by the infrared-reflecting copper coating (Fig. 3b). However, under a strain of 30%, the representative composite featured a reduced average total reflectance of ~77% (Fig. 3e) and an increased average total transmittance of ~16%, as well as signals corresponding to the chemical functionalities of SEBS (e.g., –C=C–, –CH 2 –, and =C–H) (Fig. 3f), confirming that the underlying polymer matrix was partially uncovered (Fig. 3c)36,37. Under an increased strain of 50%, the representative composite featured an even smaller average total reflectance of ~67% (Fig. 3e) and an even larger average total transmittance of ~25%, as well as increased intensities for the SEBS-associated spectroscopic signals (Fig. 3f), due to additional exposure of the underlying polymer matrix (Fig. 3d). In general, the composites’ reflectance and transmittance both demonstrated a non-linear dependence on the strain, with the reflectance decreasing by ~25 ± 1%, ~35 ± 1%, and ~47 ± 2% at strains of 30%, 50%, and 100%, respectively (Fig. 3g), and the transmittance increasing by ~15 ± 1%, ~24 ± 2%, and ~39 ± 3% at strains of 30%, 50%, and 100%, respectively (Fig. 3h) (all relative to the initial unstretched state). Notably, the composites displayed fully reversible changes in their infrared reflectance and transmittance (Fig. 3e, f) and also exhibited excellent stability, with no degradation in their functionality after >~103 actuation cycles (Supplementary Fig. 3). Moreover, based on their transmittance at strains of 0% and 100%, our mechanically actuated materials possess maximum transmittance on/off ratios of >~25, which exceed the best values reported for radiative thermal switches (Supplementary Table 2). Thus, the composites showcase several additional characteristics desired for thermal switching applications, including reversibility, stability, and high on/off ratios (Supplementary Table 2). Thermal modeling and evaluation Having confirmed our composites’ tunable infrared properties, we evaluated their promise for adaptive thermal management within the context of a wearable configuration. To this end, we leveraged our spectroscopic measurements and computationally modeled heat transfer between human skin, the composite material, and the surrounding environment in various states of actuation (for comparison, we performed analogous experiments and calculations for several common types of cloth) (Fig. 4a, Supplementary Note 1, Supplementary Fig. 4, and Supplementary Table 3)38,39. We also determined the environmental setpoint temperatures, i.e., ones at which the body’s skin temperature and outgoing heat flux remain constant, that would ensure individuals maintained their thermal comfort while wearing the unstrained and strained composites (or types of cloth). In their relaxed state, the composites featured a setpoint temperature of ~14.5 °C, which was similar to the value of ~14.3 °C found for the space blanket (Fig. 4b). However, under a moderate strain of 30%, the composites featured a setpoint temperature of ~19.2 °C, which was similar to the value of ~18.9 °C found for a Columbia Omniheat fleece lining (Fig. 4b). In addition, under an increased strain of 50%, the composites featured a setpoint temperature of ~20.9 °C, which was similar to the value of ~20.5 °C found for wool (Fig. 4b). Moreover, under an even greater strain of 100%, the composites featured a setpoint temperature of ~22.7 °C, which was similar to the value of ~22.8 °C found for cotton (Fig. 4b). Taken together, our infrared spectroscopy experiments and subsequent calculations confirmed that the composites could be rapidly actuated with strain to maintain a wearer’s thermal comfort across an environmental setpoint temperature window of ~8.2 °C, which is among the largest dynamic ranges reported for any comparable passive material (Fig. 4b). In essence, the composites possess unprecedented switching capabilities, wherein their infrared reflectance and transmittance can be modulated in real time to emulate various types of cloth (note that common fabrics would typically exhibit small and/or irreversible changes in their infrared properties upon the application of strain). Assuming broad implementation in advanced garments that are widely deployed and adopted, our composites’ significant dynamic temperature setpoint window of >8 °C could enable an estimated reduction in building energy consumption of >30%9,40,41. Fig. 4 Mechanical control over the setpoint temperature and thermoregulatory properties for the composite material. a Schematic of the heat flux from human skin, through the composite material, and to a variable-temperature environment without (left) and with (right) mechanical actuation. The heat flux from the skin to the surroundings increases in order to maintain the skin temperature at a constant value upon going from a cooler (left) to a warmer (right) environment. b Plot of the environmental setpoint temperatures at which an individual would remain comfortable, i.e., maintain a constant skin temperature and unchanged outgoing heat flux, while wearing either various common types of cloth (black diamonds) or the composite material at different applied strains (blue and red triangles). The calculated setpoint temperature associated with the composite can be dynamically adjusted via mechanical actuation, and the composites’ accessible setpoint temperature range is indicated by the area shaded in red and blue. c Schematic of the heat flux from a sweating-guarded hot plate, through a composite, and to a controlled environment without (left) and with (right) mechanical actuation. d Plot of the steady-state heat flux from the hot plate as a function of time for a representative composite material under strains of 0% (black dots), 30% (red dots), and 50% (blue dots) Full size image We next proceeded to validate our composites’ ability to adaptively manage heat transfer from a surface that emulated the thermal behavior of human skin. To this end, we mounted the composites in a custom-designed holder that allowed for the application of strain on a sweating guarded hot plate and then tested their thermoregulatory functionality under controlled conditions without and with mechanical actuation (Fig. 4c and Supplementary Fig. 5). In its relaxed state, a representative composite maintained the steady state heat flux from the hot plate at an average value of ~248 W m−2 (Fig. 4d). Under a moderate strain of 30%, the same composite maintained the steady state heat flux from the hot plate at a higher average value of ~291 W m−2 (Fig. 4d). Under a further increased strain of 50%, the composite maintained the steady state heat flux from the hot plate at an even higher average value of ~307 W m−2 (Fig. 4d). In general, the heat flux could be stably, reliably, and repeatedly modulated by average values of ~36 ± 8 and ~51 ± 8 W m−2 upon actuation with applied strains of 30% and 50%, respectively (with a maximum change of ~59 W m−2). Excitingly, based on these measurements, the composites can manage up to one quarter of the metabolic heat generation from the human body, which is expected to be ~70 W m−2 for a sedentary individual (and potentially much higher depending on the type of activity)38,42. In addition, the composites need an estimated input of only ~3 W m−2 for one mechanical switching event (at moderate strain) and do not continuously consume power, making their energy requirements substantially lower than all known active thermal management platforms (Supplementary Note 2 and Supplementary Table 1). Consequently, the composites demonstrate the key advantages of both passive and active systems by exhibiting excellent energy efficiency while simultaneously allowing for real-time user control. Human subject testing Last, we assessed the composites’ ability to function as the dynamic switchable components in wearable systems and, more specifically, to locally manage the temperature of the human body. For this purpose, we fabricated custom-designed composite-based sleeves, which allowed for mechanical actuation of the joined composites via a straightforward fastener assembly (for comparative purposes, we prepared analogous space blanket-based sleeves) (Fig. 5a and Supplementary Fig. 6). Subsequently, we outfitted a human subject with these sleeves and then recorded the outgoing heat flux and apparent change in temperature for both the sleeve-covered and bare forearms of the wearer, while actuating the composites with different strains (note that the forearms served as internal standards that facilitate comparisons across all measurements) (Fig. 5b–f and Supplementary Fig. 7). In initial benchmark experiments, a static space blanket-based sleeve trapped (primarily reflected back) the heat emitted by the covered forearm (Fig. 5b) and thus raised its temperature by ~1.0 ± 0.1 °C more than the bare forearm of the same person (Fig. 5g and Supplementary Fig. 7). Similarly, without applied strain, the composite-based sleeve trapped the heat emitted by the covered forearm (Fig. 5c) and raised its temperature by ~0.9 ± 0.1 °C more than the same person’s bare forearm (Fig. 5g and Supplementary Fig. 7), much like the space blanket. However, for an applied strain of 30%, the composite-based sleeve trapped only some of the heat emitted by the covered forearm (Fig. 5e) and raised its temperature by only ~0.3 ± 0.1 °C more than the same person’s bare forearm (Fig. 5g and Supplementary Fig. 7), which constituted a >2-fold reduction in the temperature change measured for the space blanket. Furthermore, for an applied strain of 50%, the composite-based sleeve trapped substantially less of the heat emitted from the covered forearm (Fig. 5f) and raised its temperature by only ~0.1 ± 0.1 °C more than the same person’s bare forearm (Fig. 5g and Supplementary Fig. 7), which represented a ~10-fold reduction in the temperature change measured for the space blanket. Overall, the measurements demonstrated that the composite-based sleeves could be adjusted to manage the heat flux from the wearer to the surrounding environment in real time (Fig. 5b–f and Supplementary Movie 1) and to modulate the wearer’s local changes in body temperature by nearly an order of magnitude with excellent control (Fig. 5g). Importantly, the maximum measured temperature changes were ~2–5-fold greater than the reported temperature perception thresholds for a variety of human subjects, allowing users of the composite-based sleeves to readily perceive the thermal effect of the different actuation states43. In principle, the performance of the sleeves and comfort of the wearer could be improved further through the use of composites from comparable infrared-transparent polymer matrices with enhanced breathabilities. Overall, these exciting preliminary findings lay the groundwork for the development of sophisticated composite material-based garments, which can be site-specifically actuated via more advanced strategies and thus allow for regulation of the local thermal environment across a wearer’s entire body.
Q: What are the sources for the textual variants of Romans 8:1? I know variants exist which exclude, "who walk not according to the he flesh, but according to the spirit". I understand the TR includes those words, but I am also aware of newly discovered witnesses which predate witnesses like Codex Sianiticus and Vaticanus, which do actually agree with MT. Mark 9:29 as an example is supported in P45, which is nearly a century older than the previously mentioned Codex. I haven't been able to find a treatise on Romans 8:1 though. A: A good internet source for quick summaries of the textual situation is the NET bible which here reads: The earliest and best witnesses of the Alexandrian and Western texts, as well as a few others (א* B D* F G 6 1506 1739 1881 pc co), have no additional words for v. 1. Later scribes (A D1 Ψ 81 365 629 pc vg) added the words μὴ κατὰ σάρκα περιπατοῦσιν (mh kata sarka peripatousin, “who do not walk according to the flesh”), while even later ones (א2 D2 33vid Ï) added ἀλλὰ κατὰ πνεῦμα (alla kata pneuma, “but [who do walk] according to the Spirit”). Both the external evidence and the internal evidence are compelling for the shortest reading. The scribes were evidently motivated to add such qualifications (interpolated from v. 4) to insulate Paul’s gospel from charges that it was characterized too much by grace. The KJV follows the longest reading found in Ï. You can find similar details here as well. א* means the original text of Sinaiticus (while 2א indicates that a corrector later changed the text of Sanaiticus) and B means the original text of Vaticanus. Any prior text would be a papyrus and so would be indicated by a lower-case p with a subscript indicating which papyrus. So if you look at Romans 5:17 you can see what p46 reads. For Romans 8:1 there's no reading given for p46. In fact, as the wikipedia page for p46 indicates, that manuscript is missing Rom 6:14–8:15. In fact none of the early papyri contain this passage (you can verify that here, but also if any of them did have this passage they would be listed at the NET bible and at the list of textual variants). Sinaiticus and Vaticanus are the earliest sources with this verse.
Q: Powershell Active Directory DisplayName I have a powershell script that builds active directory users based on CSV file. It has the attributes defined like this: -GivenName $_.FirstName ` -Surname $_.LastName ` -SamAccountName $_.UserName ` I want to add the DisplayName attribute to combine $.FirstName and $.LastName with a space in the between. I tried: -DisplayName $_.FirstName + " " + $_.LastName ` But the above doesn't work, it gives an error. Can anyone kindly suggest how I can define the DisplayName attribute with the firstname and lastname from the CSV data? Thanks A: When PowerShell looks at arguments passed to a command, each individual token is interpreted as a separate input argument. Wrap the string concatenation in a sub-expression ($()) to pass it as a single string: Set-ADUser ... -DisplayName $($_.FirstName + " " + $_.LastName) or use an expandable string: Set-ADUser ... -DisplayName "$($_.FirstName) $($_.LastName)" As Lee_Dailey notes, you might want to use a technique called "splatting" to organize your parameter arguments instead of splitting them over multiple lines: Import-Csv users.csv |ForEach-Object { $parameterArgs = @{ Name = $_.Name SamAccountName = $_.UserName GivenName = $_.FirstName Surname = $_.LastName DisplayName = $_.FirstName,$_.LastName -join ' ' } # pass our parameter arguments by "@splatting" New-ADUser @parameterArgs }
1. Field of the Invention The present invention relates to an information processing apparatus and method, information processing system, and recording medium, and particularly relates to an information processing apparatus and method, information processing system, and recording medium wherein a controlled apparatus connected to a network transmits control screen data of itself to a controlling apparatus for display thereupon, and the contents of operation executed by the user making reference to the display screen of the controlling apparatus are notified to the controlled apparatus by the controlling apparatus, thereby allowing other apparatuses to be controlled without issuing control commands. 2. Description of the Related Art Home network systems such as the IEEE1394 serial bus can be used to connect multiple information processing apparatuses (e.g., DTV (Digital Television), DVHS (Digital Video Home System), IRD (Integrated Receiver Decoder), etc.) and carry out playing and recording of video and audio information, or to transmit and receive information between information processing apparatuses to carry out editing processing such as dubbing. Conventionally, control of the controlled information processing apparatus is carried out by the controlling information processing apparatus issuing AV/C (Audio Video/Control) commands to the controlled information processing apparatus. However, in the event that the controlling apparatus needs to transmit control commands to a controlled apparatus in order to control processing executed by another apparatus on a network with multiple information processing apparatuses connected, and in the event that multiple controlled apparatuses exist, the controlling apparatus has had to record all control commands for controlling each controlled apparatus.
Extended high frequency audiometry in pre-school children. Since adequate and reliable earphones are now available and standards have been established, clinical audiometry can be performed at extended high frequencies (EHFs). In the present study, 47 preschool children (aged 4-7 years) were examined with EHFs (8-16 kHz) using the new Sennheiser HDA 200 earphone. The hearing thresholds correspond to those of other studies; the median thresholds and range increase with increasing frequency. The medians and quartiles were: 10 kHz: 25 (5-35) dB(SPL), 11.2 kHz: 35 (20-40) dB(SPL), 14 kHz 40 (30-50) dB(SPL) and 16 kHz: 50 (40-60) dB(SPL). The hearing thresholds could be more reliably determined in the older children (> 5 years) and were 5 dB better than in the younger ones (< 5 years). Thresholds in the 10-12.5 kHz range correspond to those of adults but are more sensitive by 5-12 dB in the 14-16 kHz range.
/* * Copyright (C) 2011 The Android Open Source Project * * Licensed under the Apache License, Version 2.0 (the "License"); * you may not use this file except in compliance with the License. * You may obtain a copy of the License at * * http://www.apache.org/licenses/LICENSE-2.0 * * Unless required by applicable law or agreed to in writing, software * distributed under the License is distributed on an "AS IS" BASIS, * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. * See the License for the specific language governing permissions and * limitations under the License. */ package com.android.perftest; import android.os.Environment; import android.content.res.Resources; import android.graphics.Bitmap; import android.graphics.BitmapFactory; import android.renderscript.*; import android.renderscript.Element.DataKind; import android.renderscript.Element.DataType; import android.renderscript.Allocation.MipmapControl; import android.renderscript.Program.TextureType; import android.renderscript.RenderScript.RSMessageHandler; import android.renderscript.Mesh.Primitive; import android.renderscript.Matrix4f; import android.renderscript.ProgramVertexFixedFunction; import android.util.Log; public class MeshTest implements RsBenchBaseTest{ private static final String TAG = "MeshTest"; private RenderScriptGL mRS; private Resources mRes; int mBenchmarkDimX; int mBenchmarkDimY; private Mesh m10by10Mesh; private Mesh m100by100Mesh; private Mesh mWbyHMesh; private ScriptC_mesh_test mGeoScript; private final BitmapFactory.Options mOptionsARGB = new BitmapFactory.Options(); ScriptField_TestScripts_s.Item[] mTests; private final String[] mNames = { "Full screen mesh 10 by 10", "Full screen mesh 100 by 100", "Full screen mesh W / 4 by H / 4" }; public MeshTest() { mBenchmarkDimX = 1280; mBenchmarkDimY = 720; } void addTest(int index, int meshNum) { mTests[index] = new ScriptField_TestScripts_s.Item(); mTests[index].testScript = mGeoScript; mTests[index].testName = Allocation.createFromString(mRS, mNames[index], Allocation.USAGE_SCRIPT); mTests[index].debugName = RsBenchRS.createZeroTerminatedAlloc(mRS, mNames[index], Allocation.USAGE_SCRIPT); ScriptField_MeshTestData_s.Item dataItem = new ScriptField_MeshTestData_s.Item(); dataItem.meshNum = meshNum; ScriptField_MeshTestData_s testData = new ScriptField_MeshTestData_s(mRS, 1); testData.set(dataItem, 0, true); mTests[index].testData = testData.getAllocation(); } public boolean init(RenderScriptGL rs, Resources res) { mRS = rs; mRes = res; initGeoScript(); mTests = new ScriptField_TestScripts_s.Item[mNames.length]; int index = 0; addTest(index++, 0 /*meshNum*/); addTest(index++, 1 /*meshNum*/); addTest(index++, 2 /*meshNum*/); return true; } public ScriptField_TestScripts_s.Item[] getTests() { return mTests; } public String[] getTestNames() { return mNames; } private Mesh getMbyNMesh(float width, float height, int wResolution, int hResolution) { Mesh.TriangleMeshBuilder tmb = new Mesh.TriangleMeshBuilder(mRS, 2, Mesh.TriangleMeshBuilder.TEXTURE_0); for (int y = 0; y <= hResolution; y++) { final float normalizedY = (float)y / hResolution; final float yOffset = (normalizedY - 0.5f) * height; for (int x = 0; x <= wResolution; x++) { float normalizedX = (float)x / wResolution; float xOffset = (normalizedX - 0.5f) * width; tmb.setTexture((float)x % 2, (float)y % 2); tmb.addVertex(xOffset, yOffset); } } for (int y = 0; y < hResolution; y++) { final int curY = y * (wResolution + 1); final int belowY = (y + 1) * (wResolution + 1); for (int x = 0; x < wResolution; x++) { int curV = curY + x; int belowV = belowY + x; tmb.addTriangle(curV, belowV, curV + 1); tmb.addTriangle(belowV, belowV + 1, curV + 1); } } return tmb.create(true); } private Allocation loadTextureRGB(int id) { return Allocation.createFromBitmapResource(mRS, mRes, id, Allocation.MipmapControl.MIPMAP_ON_SYNC_TO_TEXTURE, Allocation.USAGE_GRAPHICS_TEXTURE); } void initGeoScript() { mGeoScript = new ScriptC_mesh_test(mRS, mRes, R.raw.mesh_test); ProgramVertexFixedFunction.Builder pvb = new ProgramVertexFixedFunction.Builder(mRS); ProgramVertexFixedFunction progVertex = pvb.create(); ProgramVertexFixedFunction.Constants PVA = new ProgramVertexFixedFunction.Constants(mRS); ((ProgramVertexFixedFunction)progVertex).bindConstants(PVA); Matrix4f proj = new Matrix4f(); proj.loadOrthoWindow(mBenchmarkDimX, mBenchmarkDimY); PVA.setProjection(proj); mGeoScript.set_gProgVertex(progVertex); ProgramFragmentFixedFunction.Builder texBuilder = new ProgramFragmentFixedFunction.Builder(mRS); texBuilder.setTexture(ProgramFragmentFixedFunction.Builder.EnvMode.REPLACE, ProgramFragmentFixedFunction.Builder.Format.RGBA, 0); mGeoScript.set_gProgFragmentTexture(texBuilder.create()); mGeoScript.set_gProgStoreBlendNone(ProgramStore.BLEND_NONE_DEPTH_NONE(mRS)); mGeoScript.set_gLinearClamp(Sampler.CLAMP_LINEAR(mRS)); mGeoScript.set_gTexOpaque(loadTextureRGB(R.drawable.data)); m10by10Mesh = getMbyNMesh(mBenchmarkDimX, mBenchmarkDimY, 10, 10); m100by100Mesh = getMbyNMesh(mBenchmarkDimX, mBenchmarkDimY, 100, 100); mWbyHMesh= getMbyNMesh(mBenchmarkDimX, mBenchmarkDimY, mBenchmarkDimX/4, mBenchmarkDimY/4); mGeoScript.set_g10by10Mesh(m10by10Mesh); mGeoScript.set_g100by100Mesh(m100by100Mesh); mGeoScript.set_gWbyHMesh(mWbyHMesh); } }
Media playback is unsupported on your device Media caption David Cameron: ''I don't support decriminalisation'' The idea of a royal commission to consider decriminalising illegal drugs - as suggested by a group of MPs - has been ruled out by the prime minister. In response to the report by the home affairs select committee, David Cameron said the current policy was working in Britain. The committee highlighted Portugal's approach, where people found with drugs are not always prosecuted. It also asked ministers to monitor cannabis legalisation elsewhere. "Drugs use is coming down, the emphasis on treatment is absolutely right, and we need to continue with that to make sure we can really make a difference, " Mr Cameron said. "Also, we need to do more to keep drugs out of our prisons. "These are the government's priorities and I think we should continue with that rather than have some very, very long-term royal commission." A royal commission is a public inquiry created by the head of state into a defined subject and overseen by a commissioner who has quasi-judicial powers. Legal highs Official figures show that drug use in England and Wales is at its lowest rate under current measurements since 1996. Media playback is unsupported on your device Media caption Ex-addict, Paul Spittlehouse: "I wasn't affected by the threat of conviction" However, there is concern over the growth and prevalence of "legal highs", some of which are banned, amid a recorded rise in deaths linked to their use. The committee stops short of supporting a relaxation of legal sanctions for drug use, as suggested by experts at the UK Drug Policy Commission in October, but it does call on ministers to look in detail at the idea. The Dissuasion Commission: Portugal's answer In Portugal, resources are focused on drug treatment rather than law enforcement. Users of small amounts of drugs don't face a criminal penalty if they attend a "Dissuasion Commission". It establishes whether the user is addicted or just a casual user. The commission stops criminal proceedings if a problem user agrees to treatment - but it will also impose penalties on a user if he or she goes back to drugs. These include bans on certain types of work and restrictions on the user's movements and whom they can meet. Fines tend to be reserved for casual drug users because Portuguese experts say it is counter-productive to fine addicts. If the individual sticks with the programme and emerges clean, he or she has no criminal record. Mark Easton: How Portugal treats drug addicts In its wide-ranging report, the cross-party home affairs committee said MPs had visited Portugal as part of attempts to understand different systems of decriminalisation which were being used around the world to manage the harm of drugs, rather than just hand out penalties for their use. Portugal has not legalised drugs but it has a system of not imposing criminal penalties on drug users who enter into special programmes designed to end their habits. "We were impressed by what we saw of the Portuguese depenalised system," said the MPs. "It had clearly reduced public concern about drug use in that country and was supported by all political parties and the police. "The current political debate in Portugal is about how treatment is funded... not about depenalisation itself. "Although it is not certain that the Portuguese experience could be replicated in the UK, given societal differences, we believe this is a model that merits significantly closer consideration." The committee urged ministers to monitor the effect of plans for cannabis legalisation in the US states of Colorado and Washington and in Uruguay, The MPs said that, although drug use was falling, the impact of their use still cost billions and there were questions over whether the international strategy was working. They said the time was right for a "fundamental review of all UK drugs policy in the international context" and recommended a royal commission be set up with an end-date of 2015. The Home Office disagreed that a Royal Commission was the correct course of action, saying: "Our current laws draw on the best available evidence and as such we have no intention of downgrading or declassifying cannabis." However, the Home Office minister Jeremy Browne, a Liberal Democrat, said the government was "open to new ways of thinking". He told BBC Radio 4's Today programme: "We are open-minded, we think it's a decent, thoughtful, balanced report. We will consider it carefully."
[Obesity prevention in preschool and schoolchildren attending public schools from a district of Santiago, Chile: pilot project 2006]. Childhood obesity in Chile has been recognized as a public health problem. In 2006, we developed a school-based obesity prevention pilot project to intervene during 5 months preschool and schoolchildren from 1st to 4th grades attending 7 public schools located in a district of Santiago, Chile of medium-low and low SES. The objective of this project was to evaluate the feasibility of implementing a longer intervention giving recommendations to the educational authorities to better implement it. We trained teachers to apply educational activities ( in nutrition and physical activity) for the children in the 7 schools, but additionally in 4 of these schools, teachers of those grades participated in a Counselling program on healthy lifestyle applied individually, anthropometric evaluation and blood tests. The initiatives were evaluated on a sample of 522 schoolchildren (nutritional status and physical fitness), 38 teachers with Counselling (BMI, waist circumference or WC, blood sugar, HDL, triglycerides, cholesterol) and 19 teachers with no counselling (BMI and WC). Additionally, we evaluated the quality of PE classes. The results on the children show a trend on only the younger ones to decrease the % obesity, improving significantly their physical fitness. In teachers with counselling, a trend toward decreasing BMI and WC was observed, while biochemical parameters remained unchanged. We showed that it is feasible to implement a longer intervention recommending improving the quality of PE classes and allowing more time to train teachers and for individual counselling.
– Coffee in take-away cups is perfectly acceptable in the autumn and I plan on taking full advantage. You will regularly spot me at Karsmakers and Natural Café over on Avenue Louise. Might even splurge for a fancy one over at Café de la Presse. – The kittens get cuddly in the autumn. Looking forward to some quality couch time curled up with the cats. – Colder weather means I can indulge in massive bowls of chili. {Hello, my name is Jessica and I am a chili addict.} – Mini-breaks. Rumor has it D is planning a secret weekend trip somewhere later this month… heh heh. I love them. – It is a good month to explore “new things”. The September rush is out of the way. We’re all still busy, but after getting over the laziness of summer, we’re ready to juggle again. Some recent new finds: – Music: last night, at the suggestion of {newly minted Brussels-concert guru} Tatiana, we went to see Walk the Moon and Fun play at Ancienne Belgique {or, the “AB” for locals}. Such a packed and enthusiastic show!! Check these two bands out if you do not know them already. Brussels is apparently already crazy about them. – TV shows: An adorable friend recently introduced me to Rookie Blue. Heading for their fourth season, the DVD cover stated it is “like Grey’s Anatomy, but with guns”. Very accurate description – full of silly Canadian policy drama, with a good soundtrack. – Movies: we must get through November to see the new Bond movie. But in the meantime, I’m looking forward to seeing The Words. Bradley Cooper, Jeremy Irons, Dennis Quaid, Olivia Wilde and Zoë Saldana? Great cast. Archives Official stuff Unless otherwise stated, all content and images on this blog are mine. If you want to use or reproduce quotes and pictures from this blog, please be kind and cite the source with a link back here. All views posted here are my personal opinions and do not represent the views of my employer or its clients. Advertisements 3 comments Tatiana said: October 1, 201210:26 am Thanks for the shout out – although guru may be a bit strong, lol – although that show was awesome! And let me know what you think of The Casual Vacancy – I’ve seen mixed reviews so i’d be interested in your take on it!
Enhanced radiosensitization and chemosensitization in NF-kappaB-suppressed human oral cancer cells via the inhibition of gamma-irradiation- and 5-FU-induced production of IL-6 and IL-8. We examined the mechanisms underlying the enhancement of radiosensitivity and chemosensitivity to gamma-irradiation (IR) and 5-Fluorouracil (5-FU) in human oral carcinoma cells (B88) in which NF-kappaB activity was constitutively suppressed. Three super-repressor form of IkappaBalpha cDNA-transfected cell (B88mI) clones and 1 empty vector-transfected cell clone (B88neo) have been established. We found that the tumor-forming ability in nude mice of B88mI clones was significantly lower than that of B88 or B88neo. This suppressed ability in tumorigenicity was attributed to the down-regulation of the expression of interleukin (IL)-1alpha, IL-6, IL-8, vascular endothelial growth factor (VEGF) and matrix metalloproteinase (MMP)-9 in B88mI cell clones as compared to that in B88 or B88neo. IR and 5-FU induced a much greater degree of apoptosis, as evidenced by flow cytometry analysis and annexin V staining, in B88mI cell clones than in B88 or B88neo. When tumor-bearing nude mice were treated with IR or 5-FU, the suppression of tumor growth was significantly augmented in B88mI cell clones as compared to that in B88 or B88neo. ELISA analysis indicated that although a remarkable increase in production of IL-6 and IL-8 was observed in B88 and B88neo after in vitro exposure to IR or treatment with 5-FU, radiotherapy and chemotherapy-induced production of these cytokines was significantly suppressed in B88mI cell clones. These findings suggest that production of angiogenic factors and growth factors in response to radiotherapy and chemotherapy is a principal mechanism of inducible radioresistance and chemoresistance in human oral cancers, and establish the inhibition of NF-kappaB as a rational approach to improve conventional radiotherapy and chemotherapy outcomes.
47 freelancers are bidding on average $32/hour for this job Ok can we discuss more on freelancer inbox to get detail understanding about project ? i am having some technical question on this so let me know when you get time to discuss on this and clear the doubts. I have More Hello dear How are you? I am good at React js/Redux, webpack. typescript, nosql and nodejs as well I am familiar with front end development I will delivery great result in your proposed time Best regards Dear Client! I've just read your job description carefully. I am very interested in this job because I am suitable to this job. I’m full stack developer. I have enough experience for web development using ReacMore Hello, my name is Daniel, nice to meet you. I am an experienced web designer & developer and I`m really interested in your project. Quality and speed are my leading stars and I am one message away from being at your seMore Hello, I am a full stacking developer, I have worked many Application and live on application store, we will discuss about project feature and I will give you the best work of mine in estimate time duration.I'm veryMore Hello, sir I am React.js developer. I have a detail look to your project, I have a great skill in design and React.js. I'm sure I can complete your project. My price and period is negotiable. We can discuss the dMore Hello, I am an individual developer, i have 7+ years of experience in REACT, please send me a message so we can discuss more in detail. I am a skilled and experienced Developer having 7+ years of experience in ROMore Hi there, Yes, I have experience in Front End React.js and I am an individual developer and ready to work on your project with honesty and sincerity. I would be obliged if you arrange a quick meeting with me in tMore Hi, I am very interested in your project because react.js, React Native, Redux and Angular are my favorite skills. I am ready to start working now but please if possible share with me exact and complete requirementMore Hi, I have gone through your requirement and have exact match with the Skills you are looking for current project. I am also Willing to long term relationship..For full time as well as part time. I am ready to More Dear Employer I am very interested in your project As you can see in my portfolio, I am ReactJS expert I am also excellent at MEAN/MERN stack and several Javascript frameworks such as JQuery. If you want to work wiMore Dear Client, You landed on the right profile We are Synapse and we deal with the website and mobile development, As per my understanding you want a professional frontend developer and we are glad to inform you thatMore Hi , It’s great to meet you. we will make the ERC20,ERC721 and ETH based Token in one day. ping me up so that we can discuss it more. We develop: cutting-edge software for Blockchain, ERC721, ERC20 Token DeveMore Greetings!! We serve 600+ happy clients in different disciplines of business!! We at KrishaWeb are most preferred agency for our client due to 100% recommendation and “5 STAR” rating from our clients which we achMore Hello Sir/Mam, Hope you are doing well. I have read your project requirement and understood that you are looking React.js Expert developer. I am pleased to infrom you that i am fullstake developer and i have mMore
STAR Wars fans will be out in force today for the biggest day on their calendar — May the Fourth. Across the world, fans of the series will dust off their Stormtrooper armour and plait their hair in cinnamon bun ringlets to pay homage to one of the most popular film franchises in history. Since its inception “May the Fourth” has grown in leaps and bounds, to the point that it’s no longer out of the ordinary to see a Stormtropper, Darth Vader and a pint sized Chewbacca quench their thirst at a Melbourne juice bar. media_camera The Herald Sun is the best way to keep up with the news in any galaxy no matter how far, far away. Picture: Jake Nowakowski Last year, the seventh instalment in the series, The Force Awakens, was released and topped box offices worldwide. READ MORE: WEIRD HOLIDAYS AROUND THE WORLD What will the future hold for the series? We don’t know. But we do know that Siths and Jedis will put their differences aside to control the galaxy today. And if May the Fourth isn’t enough for you, know that Thursday May 5 is known as “Revenge of the Fifth.” media_camera Does the 86 tram stop at Tatooine? Picture: Jake Nowakowski media_camera It’s no Millennium Falcon but it beats walking. Picture: Jake Nowakowski media_camera Stormtrooper stands guard while Darth Vader and Chewbacca pose to commemorate “May the Fourth.” media_camera A Stormtrooper’s “dark side” was always likely to attract police attention. Picture: Jake Nowakowski
The New York Times editorial page, November 12, called on President Trump to “Please Read The Constitution.” Interestingly, the Times, in an editorial it published November 20, 2014 apparently chose to misread the Constitution, urging President Obama to act on immigration without regard for the Constitution, noting that President Obama plans to act “under executive authority” and make “major changes to immigration policy, including shielding several million unauthorized immigrants from deportation…because he has given up waiting for Congress to act.” The editorial did not cite the provision in the Constitution authorizing presidential action when Congress does not act. There is no such provision, of course.
This isn’t new for Canon, as various other regions around the globe offer flat rate repairs on products such as PowerShot. However, this is the first time we’ve heard of flat rate repairs for EOS M products and hopefully this comes to other areas of the planet in the coming months. From Canon Japan (Google Translated): From September 20, 2017 (Wednesday), we will introduce a uniform repair fee for some products of single lens reflex camera, mirrorless camera and interchangeable lens. The uniform repair fee includes technical fees for repair and parts costs (excluding expendables and accessories) necessary for repairing the defective part, and repair is carried out at a fixed fee provided for each model regardless of the content of the failure I will. That's a really weird coincidence seeing that I JUST picked up my repaired EOS M3 yesterday from Canon Repair Center in Osaka, Japan. The repair bill was for 15,746 JPY (roughly $145 USD), so it's a little disconcerting that the flat price is nearly a $100 USD more than that. I dont like flat rate repair prices. It just means that every freakin little repair issue costs a bundle. I bet, Canon makes way more money out of this scheme than out of reasonable repair prices depending on type/amount of damage. I dont like flat rate repair prices. It just means that every freakin little repair issue costs a bundle. I bet, Canon makes way more money out of this scheme than out of reasonable repair prices depending on type/amount of damage. I agree. Maybe this isn't a big deal to most, but it's a real turn off for me towards Canon. $230 for even the smallest of out of warranty repairs for a camera that costs $500 or $600 is ludicrous in my opinion. Granted, the vast majority of my Canon cameras and gear have given me no problems and needed no repairs in the years I've been using them. But having to ante up $150 this week for what was most likely faulty glue and a loose ribbon on a poorly designed tilt screen mechanism doesn't inspire me with confidence. Whereas recently I had been considering investing in a third FF DSLR to go with my 5D4 and replace my aging (but still kicking) 5D2, and upgrading to the M5 from my M3, now for the first time ever, I'm considering looking at some other company that doesn't withhold modern features, charge a premium, and then charge another premium when you need a repair. I never worried about repairs with my Canon gear before. But learning there were others that experienced the exact same issue I had with the M3 and the fact that it happened after only 2 years of use (compared to the at least 5 years I've used any of my other bodies without problems) robs me in a lot of confidence in Canon's current QA. And interestingly enough, that flat-rate price tier, from what I can tell, doesn't mention regular EF or L lenses at all. I have to imagine this is some greedy new strategy concocted to get people to just buy a new camera instead of going through the prohibitively expensive hassle of repairing it.
HLFD ^;'.L4"„AP^£ALS D!V • •-• i w , , 20!3f1ARI8 AN 9= 13 IN THE COURT OF APPEALS FOR THE STATE OF WASHINGTON STATE OF WASHINGTON, No. 66005-5-1 Respondent, DIVISION ONE v. RUSSELL EARL LOVEN, UNPUBLISHED OPINION Appellant. FILED: March 18. 2013 Spearman, A.C.J. — Russell Loven was convicted of several counts of rape of a child, one count of child molestation, one count of sexual exploitation of a minor, and one count of possessing depictions of minors engaged in sexually explicit conduct. On appeal, he claims the trial court erred in (1) denying his for-cause challenges to two potential jurors; (2) denying his request for a multiple-acts unanimity instruction for the depictions count; and (3) considering his prior convictions for rape of a child as predicate offenses during sentencing. Concluding that the first two issues are controlled by case law adverse to Loven's position and that his prior convictions are not constitutionally invalid on their face, we affirm. FACTS Loven lived in two different apartments owned by Chris Nyhus from 2004 until October 2008. Loven worked as a handyman for Nyhus in exchange for rent. Nyhus's stepson, R.B., met Loven in 2004, when R.B. was 10 years old. Loven engaged in No. 66005-5-1/2 sexual acts with R.B. starting from when the latter was 10years old until he was 14.1 Loven told his roommate, Christina Evans, that his relationship with R.B. "was just touching and oral, nothing else." Verbatim Report of Proceeding (VRP) at 901, 931. Loven told Evans he did not think the relationship was wrong because he considered it to be consensual. Over the course of four years, Loven took photographs and videos of R.B., posting some of these images on the internet. When R.B. was 14 years old, he introduced Loven to his 15-year-old friend C.J. Loven gave R.B. and C.J. marijuana and alcohol. On one occasion when R.B. and C.J. were at Loven's apartment, Loven told C.J. that R.B. and Loven were going into the bedroom to have oral sex. Loven touched C.J.'s penis with his hand on several occasions and asked C.J. repeatedly to allow Loven to perform fellatio on him. C.J. refused at first but eventually agreed. Loven had an extensive collection of child pornography, including images of children between the approximate ages of 4 to 14 engaging in sexual acts with adults and other children. Loven told Evans that he kept some of these materials in one of his cars because he did not want to get caught with them inside the apartment. In October 2008, Evans' friend Julie Leach called the police and took Evans to speak to Detective Keith Savas about Loven. Savas interviewed Loven on October 24, 2008. During this interview, Loven denied having sexual contact with R.B. but admitted to possessing child pornography. The State charged Loven with one count of rape of a child in the first degree (victim R.B.), one count of rape ofa child in the second degree (R.B.), two counts of During this four-year period, Loven was between 39 and 43 years old. No. 66005-5-1/3 rape of a child in the third degree (R.B. and C.J.), one count of child molestation in the third degree (C.J.), one count of sexual exploitation of a minor (R.B.), and one count of possessing depictions of minors engaged in sexually explicit conduct. A jury trial on these charges took place in January 2010. Before trial, prospective jurors answered the following questions: 13. Are you able to sit on a jury in a case involving an accusation of sexual misconduct by an adult male against two male children? 14. Are you able to sit on a jury in a case involving an accusation of rape of a child? 15. Are you able to sit on a jurywhere you would view graphic images of children engaged in sexual conduct? Clerk's Papers (CP) at 285, 297. Jurors 25 and 47 answered each of these questions "no." jd. During voir dire, these jurors elaborated on the difficulties they would have in sitting on the case.2 Loven challenged jurors 25 and 47 for cause. The court denied the challenges. The defense later used two peremptory challenges to excuse jurors 25 and 47 and ultimately used all six allotted peremptory challenges. 2Juror 25 stated that she would tend to believe a child witness and the child's allegations of sexual abuse. She expressed uncertainty when the court asked her whether she could "listen to evidence regarding this topic and assess witnesses' credibility and be a fair and unbiased juror." Defense counsel brought up hercomments thatshe would startfrom the position thata child's allegations of sexual abuse were true unless she were shown evidence to the contrary and asked, "Sort ofin this kind ofcase guilty until proven innocent, right?." She responded, "Yeah." When the court attempted to clarify her position, she said she would probably lean toward believing the child but "would find outwhat's true" and "wouldn't just assume it's right." She responded "yes" when the court asked if she could presume the defendant innocent until proven guilty and hold the Stateto its burden of proof. VRP at 559-68. Juror 47 revealed that her husband had taken photographs of their 13- and 14-year-old daughter "as she went into adolescence, and he insists that it was art, but Ithought it was very inappropriate[.]" VRP at 388, 392. She believed she could not sit on a case involving similar accusations because it would bring up feelings thatshe had at that earlier time. She also said she believed children most often tell the truth. When the court asked whether she could be a fair and impartial juror, she answered, "I probably could." VRP at 389. The court again asked, "Do you think you can be a fair and impartial juror for both the defense and the State given what's happened? Can you setaside what happened with your daughter and only listen to the evidence in this case?" Juror 47 said, "I believe I can." VRP at 389. No. 66005-5-1/4 At trial, the State presented testimony from R.B. and C.J., who testified that Loven had oral sex with them during the charging periods. Police witnesses testified that Loven possessed over 4,000 still images and 40 videos of children. Savas testified these consisted of, "[ajmong other things, numerous, thousands of images of children engaged in sex acts with other children, children engaged in sex acts with adults, photographs that depict naked, partially clothed, or fully clothed children in sexually suggestive poses we call child erotica." VRP at 1408. The State admitted 26 CDs and DVDs containing images and videos. The images and videos that were admitted and shown to the jury included images and videos of R.B., including depictions of him performing fellatio on Loven; a video of a 5- or 6-year-old girl having anal sex with an adult male; and a photograph depicting young boys with erect penises. Loven asked the trial court to instruct the jury that it must be unanimous as to which act supported a guilty verdict on each of the seven counts. Regarding the depictions count, Loven argued that because the evidence for the depictions count and the exploitation count was being presented to the jury in the same trial, the jury could convict him of both counts based on the same image. He expressed concerns that this might violate double jeopardy. The State opposed such an instruction for the depictions count, asserting there was only one "unit of prosecution" which could be based on "one photo, maybe 5,000 photos." VRP at 1493. The court denied a unanimity instruction for the depictions count.3 In closing argument, the prosecutor did not elect an image to support the depictions count, making a general reference to 1The court approved a unanimity instruction for the six other counts. No. 66005-5-1/5 the thousands of images and videos found in Loven's possession and then discussing the photographs of R.B. and the video of the 5- or 6-year-old child. The jury convicted Loven as charged. At sentencing, the trial court found that Loven had previously been convicted of two counts of rape of a child in the first degree and imposed the mandatory sentence of life in prison without the possibility of parole.4 Loven appeals, assigning error to (1) the denial of his for-cause challenges to jurors 25 and 47, (2) the denial of his request for a multiple-acts unanimity instruction, and (3) the consideration of his previous convictions for rape of a child as predicate offenses at sentencing. DISCUSSION For-Cause Challenge to Jurors The denial of a challenge for cause is reviewed for abuse of discretion. State v. Gonzales, 111 Wn. App. 276, 278, 45 P.3d 205 (2002). A defendant has the right to an impartial jury under both the state and federal constitutions. State v. Roberts, 142 Wn.2d 471, 517, 14 P.3d 717 (2000). A prospective juror should be removed for cause when the juror's views or opinions would "'prevent or substantially impair the performance of his duties as a juror in accordance with his instructions and his oath.'" State v. Hughes. 106 Wn.2d 176, 181, 721 P.2d 902 (1986) (quoting Wainwright v. Witt, 469 U.S. 412, 424, 105 S. Ct. 844, 83 L. Ed. 2d 841 (1985)). This "actual bias" is defined by statute as "the existence ofa state of mind on the part ofthe juror in reference to the action, or to either party, which satisfies the court that the challenged 4The State alleged Loven had previously been convicted of rape ofa child in the first degree. Asecond conviction for rape ofa child in the first or second degree thus resulted in a sentence oflife without parole. RCW 9.94A.030(37)(b); RCW 9.94A.507. No. 66005-5-1/6 person cannot try the issue impartially and without prejudice to the substantial rights of the party challenging!.]" RCW 4.44.170(2). This case is controlled bv State v. Fire. 145 Wn.2d 152, 34 P.3d 1218 (2001). Fire was charged with child molestation. Id. at 154. He brought a for-cause challenge against a juror who expressed that he might have difficulty putting aside his strong feelings about the type of accusation against the defendant in determining guilt or innocence. JU at 155-56. After the trial court denied the for-cause challenge, Fire used a peremptory challenge to excuse the juror and subsequently used all of his peremptory challenges. Id, at 156. There was no evidence that a biased juror sat on the jury, and Fire was convicted as charged. Id, at 156, 159. On appeal, this court held that the juror had demonstrated actual bias and should have been excluded by the trial court. State v. Fire, 100 Wn. App. 722, 729- 30, 998 P.2d 362 (2000). We reversed Fire's convictions, noting that under State v. Parnell. 77 Wn.2d 503, 463 P.2d 134 (1969), a trial court's erroneous denial of a for- cause challenge requires reversal regardless ofwhether the juror was ultimately removed by a peremptory challenge. Fire, 100 Wn. App. at 727 (citing Parnell. 77 Wn.2d at 508). The Washington Supreme Court granted review and reversed this court. Abrogating Parnell in relevant part, the court held there was no basis for reversal of the conviction under those circumstances: We find that even if that juror should have been dismissed for cause, Fire exercised one of his peremptory challenges to remove the juror, and there is no showing that a biased juror, against whom the peremptory challenge might have been used, sat on his panel. Following the reasoning in United States v. Martinez-Salazar. 528 U.S. 304, 307, 315-16, 120 S.Ct. 774, 145 LEd.2d 792 (2000) and No. 66005-5-1/7 State v. Roberts. 142 Wn.2d 471, 517-18, 14 P.3d 713 (2000), we conclude that Fire did not lose a peremptory challenge, but exercised it. Therefore, he has not demonstrated prejudice and has not been deprived of any constitutional right. Without having to decide whether the juror should have been removed for cause, we reverse the Court of Appeals and remand for actions consistent with this opinion.151 Fire. 145 Wn.2d at 154. Fire is directly on point. As in Fire, even if juror 25 or juror 47 should have been dismissed for cause, Loven has not alleged that a biased juror sat on the panel and has not demonstrated prejudice.6 Loven contends Fire was wrongly decided and argues we should follow pre-Fire cases, including Parnell.7 But Parnell was abrogated by Fire, and this court may not overlook binding precedent of the Washington Supreme Court. State v. Hunlev. 161 Wn. App. 919, 932, 253 P.3d 448 (2011), affd, 175 Wn.2d 901, 287 P.3d 584 (2012). 5The cited portion of Fire is from the lead opinion, which was signed by four justices and concluded that Washington case law had tacitly abandoned Parnell's rule that the erroneous deprivation ofa peremptory challenge in itself required reversal. Fire, 145 Wn.2d at 159-63. Justice Alexander, concurring in the result, expressed the view that the Parnell rule had not yet been abandoned butthat itshould be in light of Martinez-Salazar. Fire. 145 Wn.2d at 165-68 (Alexander, C.J., concurring). Thus, a majority ofthe court agreed thatwithout a showing of prejudice, the mere use ofa peremptory challenge to cure an erroneously denied for-cause challenge did not violate the defendant's right to an impartial jury. 6Also as in Fjre, we do not reach the issue ofwhether the jurors should have been removed for cause. 7 He also cites McMahon v. Carlisle-Pennell Lumber Co.. 135 Wash. 27, 30, 236 P. 797 (1925); State v. Stentz. 30 Wash. 134, 70 P. 241 (1902), abrogated by Fire, 145 Wn.2d at 163; State v Lattin 19 Wash. 57, 60-61, 52 P. 314 (1898); State v. Moody. 18 Wash. 165, 170-72, 51 P. 356 (1897); State v. Rutten. 13 Wash. 203, 43 P. 30 (1895); State v. Wilcox. 11 Wash. 215, 223, 39 P. 368 (1895); State v. Murphy. 9 Wash. 204, 37 P. 420 (1894); and State v. Stackhouse. 90 Wn. App. 344, 351-52, 957 P.2d 218 (1998). No. 66005-5-1/8 Loven also argues Fjre should be overruled on state constitutional grounds, providing briefing ofthe Gunwall8 factors and contending article I, section 21 and article I, section 22 of the Washington Constitution provide greater protection of "the right to an impartial jury as protected by our state right to appeal" than does the Sixth Amendment. Specifically, he cites the right to an impartial jury under article I, section 22; the right to appeal under article I, section 22; and the inviolate right to trial by jury under article I, section 21.9 He appears to argue that these provisions create a hybrid independent right that was violated in his case. But Loven cites no authority in support of this argument. Moreover, it is evident that Loven was tried by a jury in this case and he is before us now on appeal of the jury's verdicts. Thus, we conclude that neither article I, section 21 nor the right to appeal under article I, section 22 was violated in this case. Turning to Loven's claim that the "impartial jury" guarantee under article I, section 22 provides greater protection than the Sixth Amendment in this case, we reject this claim because a majority of the Washington Supreme Court has concluded 8State v. Gunwall, 106 Wn.2d 54, 720 P.2d 808 (1986) sets forth six nonexclusive factors to guide Washington courts in determining whether a state constitutional provision affords greater rights than its federal counterpart: (1) the textual language of the state constitution; (2) significant differences in the texts of the parallel provisions of the federal and state constitutions; (3) state constitutional and common law history; (4) preexisting state law; (5) differences in structure between the federal and state constitutions; and (6) matters of particular state interest or local concern. Jd. at 61-62. 9Wash. Const., art. I, § 21 states: The right of trial by jury shall remain inviolate, but the legislature may provide for a jury of any number less than twelve in courts not of record, and for a verdict by nine or more jurors in civil cases in any court of record, and for waiving of the jury in civil cases where the consent of the parties interested is given thereto. Wash. Const, art. I, § 22 provides, in relevant part: In criminal prosecutions the accused shall have the right... to have a speedy public trial by an impartial jury of the county in which the offense is charged to have been committed and the right to appeal in all cases .... 8 No. 66005-5-1/9 that the Parnell rule (i.e., that a defendant is presumed to be prejudiced when he is compelled to exhaust his peremptory challenges to remove a juror who should have been removed for cause) is not a constitutional rule. While the lead opinion expressed the view that the rule in Parnell. Rutten. and Stentz was based on constitutional rather than common law grounds, Justice Alexander opined that the Parnell rule was not constitutionally based but rather based on the broader purpose of peremptory challenges, to allow a party to exclude a potential juror for which no reason need be given. Fire, 145 Wn.2d at 164-65 (plurality); 168 (Alexander, J., concurring). Justice Sanders, in a dissenting opinion joined by three other justices, concluded, "The basis for the rule that a defendant is presumed to be prejudiced when he is compelled to exhaust his peremptory challenges to remove a juror who should have been removed for cause is found in neither the state nor the federal constitution. Rather it is firmly ensconced in Washington common law." Id at 177 (Sanders, J., dissenting). Thus, the rule in Parnell has been interpreted by a majority of our supreme court as not rooted in our state constitution, and Gunwall is therefore of no assistance. Jury Unanimity A defendant has a right to a unanimous jury verdict under the Sixth Amendment to the United States Constitution and article I, section 22 of the Washington Constitution. State v. Kitchen, 110 Wn.2d 403, 409, 756 P.2d 105 (1988). To protect this right in cases where the evidence indicates that more than one distinct criminal act has been committed but the defendant is charged with only one count of criminal conduct, either (1) the State may elect the act upon which itwill rely No. 66005-5-1/10 for conviction or (2) jurors must be instructed that they must agree that the same underlying criminal act has been proved beyond a reasonable doubt. State v. Petrich. 101 Wn.2d 566, 572, 683 P.2d 173 (1984). Loven claims the trial court erred in denying a Petrich instruction for the count of possessing depictions of minors engaged in sexually explicit conduct. He first contends as a general matter that possession can occur at different times and places, and can be constructive, actual, or unwitting. He asserts that, in his case, rational jurors could have found that he did not possess all of the images (believing the defense's suggestion at trial that Leach planted some of the images or gave them to police under the pretense that they were Loven's). But he does not specify how the numerous photographs, digital images, and videos found in his case broke down into multiple distinct acts. His argument simply rests on the notion that each image presented to the jury was a separate act and that the jury was required to agree as to the image upon which its conviction was based. We rejected this notion in State v. Furseth. 156 Wn. App. 516, 233 P.3d 902, rev, denied. 170 Wn.2d 1007 (2010). There, Furseth was charged with one count of possessing depictions of minors engaged in sexually explicit conduct. ]d at 518. At trial, multiple images found stored on his computer were introduced into evidence, some depicting apparently prepubescent children engaged in sexual intercourse and others depicting young men and boys in various stages of undress. ]d at 519. The jury convicted him as charged. ]d On appeal, Furseth argued his conviction was invalid because the jury was not instructed it had to unanimously agree as to which image out of several constituted child pornography found in his possession, and the 10 No. 66005-5-1/11 State did not elect a particular image. ]d We rejected this argument based on State v. Sutherbv. 165 Wn.2d 870, 204 P.3d 916 (2009), where the court held that regardless of the number of images involved or the number of minors depicted, possession of multiple images of child pornography constitutes a single "unit of prosecution."10 Furseth. 156Wn. App. at 520-21 (citing Sutherbv. 165Wn.2d at 882). We held in Furseth that "because the State could not have charged Furseth with multiple, separate counts of possession of child pornography, evidence that he possessed multiple images does not constitute evidence of multiple criminal acts," and therefore a unanimity instruction was not required.11 Furseth. 156 Wn. App. at 522. Loven argues that Furseth was wrongly decided, citing State v. Adel. 136 Wn.2d 629, 965 P.2d 1072 (1998), and State v. King. 75 Wn. App. 899, 878 P.2d 466 (1994). Furseth is not inconsistent with these cases. In Adel. the defendant was convicted of two counts of misdemeanor marijuana possession for possessing marijuana simultaneously in two different locations, in his car and in his store. Adel. 136 Wn.2d at 631. The issue was whether Adel's possession of marijuana in two 10 The legislature subsequently amended the statute defining possession ofdepictions of minors engaged in sexually explicit conduct by dividing it into two degrees based on the content ofthe material involved. Laws of 2010, ch. 227 § 6. The unitof prosecution for the first-degree offense is now "each depiction or image" possessed by a defendant. RCW 9.68A.070(1)(c). The unit ofprosecution for the second-degree offense is"each incident ofpossession ofone or more depictions or images." RCW 9.68A.070(2)(c). These amendments occurred after the events in Loven's case. 11 We do not read Furseth as holding, as a matterof law, that an allegation of possessing child pornography can never involve multiple acts. We noted in Furseth that "[w]e do not address situations in which spatial or temporal differences might give rise to allegations ofmultiple acts ofpossession." Furseth, 156 Wn. App. at 522 n.5. Loven's argument that possession can occur at different times and places and can be actual orconstructive could relate to the "spatial orand temporal differences" issue we mentioned in Furseth. But he does not explain how spatial or temporal issues created distinct multiple acts of possession in his case. 11 No. 66005-5-1/12 places constituted one criminal act (or "unit of prosecution"), in which case his two convictions violated double jeopardy. Jd. at 632. The court stated: The proper question for this case is what act or course of conduct has the Legislature defined as the punishable act for simple possession of a controlled substance? When the Legislature defines the scope of a criminal act (the unit of prosecution), double jeopardy protects a defendant from being convicted twice under the same statute for committing just one unit of the crime. ]d at 634. The court concluded that the pertinent statute failed to indicate whether the Legislature intended to punish a person multiple times for possession based on drugs being kept in multiple places. Under the rule of lenity, therefore, Adel could be found guilty on only one count of possession where all of the drugs were within his domain and control at the same time. ]d at 635-36. Adel holds that the unit of prosecution analysis defines the criminal act thatforms the basis for a conviction for a given crime and is consistent with Sutherbv. upon which ourdecision in Furseth was based. Next, King is distinguishable from this case and Furseth. King was convicted of one count of cocaine possession based on evidence that he possessed cocaine (1) in a car in which he was a passenger (constructive possession) and (2) in a fanny pack he was wearing (actual possession). King, 75 Wn. App. at 901. King claimed the cocaine in the fanny pack was planted by the police and that the cocaine in the car belonged to the driver. Id at 901-04. At trial, the court initially offered to submit a written unanimity instruction, but denied King's subsequent requestfor a unanimity instruction after the prosecutor agreed to make an election as to the specific instance of possession. The prosecutor did not make an election, however, and the trial court did not give a unanimity instruction. Id. at 903. 12 No. 66005-5-1/13 King claimed on appeal that the trial court erred in failing to provide a Petrich instruction because the State agreed to elect but failed to do so. Id at 900. The State argued on appeal that King's conviction was based on a continuing course of conduct, and thus, no unanimity instruction was required. ]d at 902-03. This court agreed with King: If the State claims it will elect one out of multiple incidents to rely on for conviction it may not later equivocate. In such a case, the trial court must remedy the State's error by issuing a unanimity instruction. Here, as a result of the State's comment and the court's inaction, we cannot say that the jury acted with unanimity as to one act of possession. ]d at 903. Here, unlike in King, the State never agreed to elect. Furthermore, King allegedly possessed cocaine in two different ways (constructive versus actual) and presented different defenses as to each, |d at 903-04. These facts distinguish King from Furseth. As noted, in this case Loven never explained how the many images in his case broke down into separate multiple acts. In fact, defense counsel conceded in closing argument that Loven was guilty of possessing depictions of children engaged in sexually explicit conduct, and asserted no defenses that distinguished between any purportedly separate acts of possession as in King.12 Predicate Conviction In a statement of additional grounds, Loven claims his two 1994 convictions for rape of a child in the first degree, which were used as predicate offenses for a sentence of life under RCW 9.94A.507, were invalid and suffer from constitutional 12 Defense counsel argued that Leach gave police some images that did not belong to Loven, but this was presented to discredit Leach's testimony as it might relate to the counts Loven argued he did not commit. 13 No. 66005-5-1/14 defects. Primarily he contends his counsel misadvised him as to his eligibility for a Special Sex Offender Sentencing Alternative and provided ineffective assistance, rendering his plea to those offenses facially invalid, involuntary, and unconstitutional. A prior conviction that has "previously determined to have been unconstitutionally obtained or which is constitutionally invalid on its face may not be considered" in a sentencing proceeding. State v. Ammons. 105 Wn.2d 175, 187-88, 713 P.2d 719 (1986). "Constitutionally invalid on its face means a conviction which without further elaboration evidences infirmities of a constitutional magnitude." ]d at 188. The Ammons court explained that "[t]o require the state to prove the constitutional validity of prior convictions before they could be used would turn the sentencing proceeding into an appellate review of all prior convictions." Id Here, Loven's 1994 convictions have not previously been determined to have been unconstitutionally obtained. And, as the trial court found, the judgment and sentence appears valid on its face. 8/27/10 RP 6. His conviction does not, without further elaboration, show infirmities of a constitutional magnitude. Loven does not point specifically to anything in the document to show its facial invalidity, and the defects he alleges cannot be determined from the judgment and sentence. His recourse, if any, is to challenge the constitutionality of his guilty pleas collaterally in a personal restraint petition under RAP 16.3. State v. Lewis. 141 Wn. App. 367, 397 n.21, 166 P.3d 786 (2007). 14 No.. 66005-5-i/15 Affirmed. ^unv\i^J\\^\, WE CONCUR: ctw —* Z \%
Upregulation of microRNA-143-3p induces apoptosis and suppresses proliferation, invasion, and migration of papillary thyroid carcinoma cells by targeting MSI2. As a tumor-associated biological molecule, microRNA-143-3p (miR-143-3p) is implicated in the progression of papillary thyroid carcinoma (PTC). We conducted this study to elucidate the effects of miR-143-3p mediated by Musashi RNA binding protein 2 (MSI2) on the biological activities of PTC cells. The K1 cells with the lowest miR-143-3p expression were selected for the experiments. The targeting relationship between miR-143-3p and MSI2 was verified. The biological functions of miR-143-3p and MSI2 with respect to K1 cell proliferation, cycle distribution, apoptosis, invasion, migration, and tumorigenesis were studied using gain- and loss-of-function assays both in vitro and in vivo. MSI2 was verified to be a target gene of miR-143-3p. Cells treated with upregulation of miR-143-3p or silencing of MSI2 exhibited significantly decreased the expression of Bcl-2, PCNA, MCM2, Ki67, MSI2, MMP-2, and MMP-9. This was accompanied by inhibited cell proliferation, cell invasion, and migration, as well as a significant increase in Bax expression, cell cycle arrest, and cell apoptosis. More importantly, the tumor inhibitory effects of upregulated miR-143-3p were also confirmed in the tumor xenografts in nude mice. Our results indicate that upregulation of miR-143-3p suppresses the progression of PTC by impeding cell growth, invasion, and migration via downregulation of MSI2, highlighting the potential of miR-143-3p as a target for future PTC treatment.
Star Wars Lightsaber Candelstick (video) We love anything to do with Star Wars here at Geeky Gadgets, and the latest Star Wars themed gadget would be ideal if you want to treat your other half to a romantic meal, as long as they are a Star Wars fan, the Star Wars Lightsaber Candlestick. This fun geeky candlestick has been modeled after Darth Vader’s Lightsaber and it is made from cast zinc alloy and has been chrome plated, and it should be available just before Christmas. Maybe you could get a couple and use them to decorate the Christmas table, it will retail for $39.99 when it goes on sale in December from Think Geek.
DDoS Attacks Will Now Be ‘Something You Only Read About in the History Books’ - jgrahamc https://motherboard.vice.com/en_us/article/59dd5q/cloudflare-ceo-ddos-attacks-will-now-be-something-you-only-read-about-in-the-history-books ====== thinkMOAR 'Reading about something in history books' implies it doesn't happen or occur anymore. ~~~ kentonv I think that was the point, yes. (Though it is admittedly hyperbolic.)
5 stars to Precision! We live in Broomfield and Tom was our technician. We received next-day service on a Saturday, which was particularly impressive since our need was not an emergency. Tom called to let us know exactly when he would arrive, was prompt, and resolved our issues readily. Tom's knowledge and expertise with garage doors, openers, keypads was excellent. We recommend Precision wholeheartedly. If the batteries are alive and well, but you still can't open the door, your remote may have gotten out of electronic sync with your main opener. In that case, reprogramming your remote may be in order. How to reprogram varies slightly with each model. Check with your manufacturer to get specific instructions on how to do this with your remote. Their website will often be able to provide this information for you. When it comes to installing garage doors and openers, The Home Depot has an unbeatable team of professionals dedicated to making sure your garage door project runs smoothly from start to finish. Your new garage door can be customized with a variety of features like unique color choices, window styles and hardware upgrades. We also offer options for your garage door opener including Smartphone control, Wi-Fi, battery back-up. The Home Depot installs garage doors and garage door openers with extended warranties that go beyond industry standards. Contact us today for a free in-home consultation. Absolute Overhead Door recently launched a blog that can be found here so that readers would be able to see the benefits of a garage and what they should do in the event their newly driving teenage drove into the garage door. The blog offers many tips for “fix at home” solutions as well as giving examples of situations when calling us for a service call is the best decision. In our blog, we give professional and honest recommendations for the most reader and budget friendly options for families looking for advice that doesnt cost a fortune and an obligation to purchase a new garage door from a salesman afterwards! Check it out! We hope you enjoy it. With hundreds of moving parts that are all required to work together, it's no surprise that garage doors may need occasional repair and maintenance. Garage door repair services are also required in emergency situations, like when the garage door won't operate and the car is trapped inside or you've accidentally backed into the door when it was closed. Whether it's a specific repair of your garage door opener, a broken spring that needs to be replaced, or a bent or rusted track, The Home Depot's local, licensed service providers can get the job done quickly and efficiently. Finally, we also carry any and every residential garage door product that you need to have a state-of-the-art, secure and safe garage door. We are proud certified dealers of Clopay doors, the most durable and versatile doors on the market. With over fifty years of garage door manufacturing experience, you can trust Clopay quality, just as you can trust our team to install these highest-quality doors. For garage doors with windows, try to match the glass style of your house windows to provide a more consistent look. It’s also recommended that you install insulated windows if your garage is heated or air conditioned. If you opt for an uninsulated garage door, make sure it’s made of thick steel – specifically 24-gauge. Thicker steel will help prevent dents. When you're done watching this video you'll know how to determine whether the company you hired to replace your garage door spring installed the right size spring on your door. You'll also learn the consequences to your garage door opener if the wrong size spring is used. If you are having a problem with your garage door spring, the 2:30 minutes you spend watching this video is time will spent. While you can certainly redo any security features on your garage door, it is often wise to replace the entire door if in fact that is the way a burglar gained access to your house. A new security code may seem like enough, but you don’t know how the thief figured out the old code in the first place. If the motor was disengaged, the issue might be a design flaw in the door itself. The best way to ensure that the thief doesn’t return or another thief doesn’t take advantage of the same unknown security weakness is to install a new door. Again, doing so with give you access to the kinds of robust security features that are being installed and implemented in the newest garage doors on the market. If the batteries are alive and well, but you still can't open the door, your remote may have gotten out of electronic sync with your main opener. In that case, reprogramming your remote may be in order. How to reprogram varies slightly with each model. Check with your manufacturer to get specific instructions on how to do this with your remote. Their website will often be able to provide this information for you. The technician, Robert Helton, was very pleasant, helpful, and professional. He repaired the garage door opener expeditiously and explained why it hadn't worked properly. He also checked the chain mechanism and the door itself and showed me how to manually work the door should I need to do that in the future. I was very pleased with this repair work. Widths - in addition to doors coming in a range of styles, they can be found as double-width and single-width styles. There are some serious considerations when opting for one over the other. For example, if a homeowner decides to use a single door that covers the entire opening of a two-car garage they will have to make serious structural modifications to the entry way; Regardless of the material, you will likely need to perform some regular maintenance tasks. A garage door professional can examine common problem areas to ensure all are working as they should. Additionally, it is necessary to examine the integrity of the door itself, since your garage can be especially vulnerable to security issues if your door is not structurally sound. Garage Door Repair Aurora CO As a first time homeowner, Home advisors is an invaluable tool! There is a steep learning curve that comes with buying a house!!!! Being able to have access to unbiased information is great! It really helps to have a basic idea of what costs are, and all the different things that go into each project. who knew that there was so much to consider when looking to replace garage doors!!!! Step 5: Check for loose hardware, and tighten as needed. On swing-up doors, check the plates where the spring is mounted to be sure the screws are tight, and tighten any loose screws. On roll-up doors, check the hinges that hold the sections of the door together; tighten any loose screws, and replace any damaged hinges. Sagging at one side of the door can often be corrected by servicing the hinges. If a screw hole is enlarged, replace the screw with a longer one of the same diameter, and use a hollow fiber plug, dipped in carpenters' glue, with the new screw. If the wood is cracked at a hinge, remove the hinge and fill the cracks and the screw holes with wood filler. Let the filler dry and then replace the hinge. If possible, move the hinge onto solid wood. It is precisely on those coldest days of the year when you most need and appreciate the convenience of opening and closing your garage door quickly. Sadly, that's exactly the kind of day when moisture and cold can conspire to make this difficult. Garage doors can and do freeze to the garage floor. Sometimes it is just a minor icy connection between the two that can be broken when you hit the opener button. If the door refuses to budge on the first attempt, though, resist the urge to keep banging on the automatic opener button. This is likely to cause a more serious problem with the garage door opener—including, but not limited to, stripped gears, broken springs, and a burned-out motor on the opener. Garage doors are the largest moving object inside your home. If you have a problematic garage door, it compromises the safety of your family and home. Overhead Door Company of Santa Fe™ is a professional company you can count on. We provide you with quality service at a reasonable price. We offer FREE estimates on replacement garage doors and are spring replacement specialists. 24 hours a day 7 days a week we are your number one garage door repair service. Containment cables. When old extension springs break, the springs and cables become heavy whips that damage cars and even injure people. To solve the whipping problem, manufacturers now offer containment cables that run through the center of side-mounted extension springs. If you have extension springs and don’t plan to replace your door, make sure the springs have these containment cables, or have a professional install them. Most families use their garage doors every day, and when something goes wrong, they simply can’t afford to wait on slow, unresponsive technicians. That’s why Aladdin Garage Doors offers unbeatably fast and professional garage door repair services. In fact, as long as you call us by 2 PM, we’ll make your residential garage door service call the very same day—or the service call is free! As we’ve mentioned before, springs are installed within your garage lift mechanism in order to help lift the door. Because doors are so heavy, the lift motor would undergo far more significant wear and tear if it had to lift the full weight of the door every time you opened it. Furthermore, in order to ensure that you can open your door even if you lose power in your home, springs allow you to lift the door by hand when the motor is disengaged. As we’ve mentioned before, springs are installed within your garage lift mechanism in order to help lift the door. Because doors are so heavy, the lift motor would undergo far more significant wear and tear if it had to lift the full weight of the door every time you opened it. Furthermore, in order to ensure that you can open your door even if you lose power in your home, springs allow you to lift the door by hand when the motor is disengaged. To install a single new garage door it should cost between $500 and $800. They demonstrate that the average homeowner can usually tackle such a project in a nine hour time span and a professional will be able to complete it in roughly five hours. Should it be a DIY project? Not really, most housing experts point out that it is a two-person job, requires advanced carpentry skills, and even knowledge of household electronic systems. Whether you’re looking for garage door opener maintenance, garage door opener repair, or a brand new garage door opener, Sears Home Services can help. We’re your best, most-trusted option for fast, quick, and easy local service, repair, and maintenance of your automatic garage door opener. Whether your garage door won’t open or close, your garage door opener chain is broken, your automatic garage door opener won’t work after a power outage, your garage door won’t work when it’s cold, or your automatic garage door opener won’t stop running, we’ll connect you to the best local automatic garage door opener repair service technicians in the business. Technicians that are highly trained, licensed, vetted, nearby, and guaranteed to help fix all of your garage door opener needs. We have thousands of local technicians that are always “near me,” that can help you no matter what your appliance emergency. Though you can do some maintenance to your garage doors on your own, it may be a good idea to schedule routine inspections with a professional. A typical service call will include a manual inspection of the door and opener. Then adjustments can be made including spring tension, chain/belt tension, limits and force adjustments and door lubrication. Fees for this service vary from place to place, but garage door repairs typically cost between $147 and $340. Wood - Wood garage doors are sturdy and quite beautiful. However, if you live in a humid climate, your doors will be prone to rotting and splitting. If your wood is painted, you must also factor in the costs of painting as part of your regular maintenance routine. The cost of repairing the wood varies depending on the type. However, average cost to repair a wood panel is $190 to $215. My one mild complaint is the seemingly excessive safety measures taken when you close the door. The alarm is, well, alarming. And the flashing lights tend to frighten people who aren't expecting them. I've seen Craftsman smart garages that just close like normal. I'd really prefer to not have a small light show announcing my door is closing every time. Absolute Overhead Door recently launched a blog that can be found here so that readers would be able to see the benefits of a garage and what they should do in the event their newly driving teenage drove into the garage door. The blog offers many tips for “fix at home” solutions as well as giving examples of situations when calling us for a service call is the best decision. In our blog, we give professional and honest recommendations for the most reader and budget friendly options for families looking for advice that doesnt cost a fortune and an obligation to purchase a new garage door from a salesman afterwards! Check it out! We hope you enjoy it. Most families use their garage doors every day, and when something goes wrong, they simply can’t afford to wait on slow, unresponsive technicians. That’s why Aladdin Garage Doors offers unbeatably fast and professional garage door repair services. In fact, as long as you call us by 2 PM, we’ll make your residential garage door service call the very same day—or the service call is free! When the lay-person typically sees a circuit board, they immediately seize up and think that's it's too advanced for them to fix. In reality, replacing circuit boards for the Chamberlain Liftmaster, Sears, and Craftsman garage door openers is relatively easy with proper instruction. This video will walk you through the process of replacing the circuit board on a Chamberlain Liftmaster, Sears, and Craftsman garage door opener. Garage Door wont open Aurora Colorado 80016
You are watching Kimi ga Aruji de Shitsuji ga Ore de Episode 9 in High Quality English subbed. Kimi ga Aruji de Shitsuji ga Ore de Episode 9 is from Kimi ga Aruji de Shitsuji ga Ore de anime series. If you enjoyed Kimi ga Aruji de Shitsuji ga Ore de Episode 9 please share it with others! Please note that this Episode is hosted on a third-party video sharing website, and it is not affiliated with Chia-Anime.
[Scintigraphic findings in amoebic abscess of the liver (author's transl)]. The accuracy, size, localization and course of liver scans of solitary or multiple amoebic liver abscesses was evaluated in 52 patients. The scintigraphic data were correlated with the clinical symptoms. In 47 of the 52 patients it was possible to demonstrate the liver abscess on the scintigram; the right lobe of the liver was involved more frequently than would have been expected simply on the basis of its volume. In most of the patients investigated the abscesses were solitary and in only 28% was it posssible to recognise two or three abscesses occurring simultaneously. Follow-up examinations showed rapid diminution in the size of the abscess furing medical treatment but complete return to normal during the first six months occurred in only 17% of cases. The results are discussed.